id	sid	tid	token	lemma	pos
finefocus-4313	1	1	98	98	NUM
finefocus-4313	1	2	|	|	ADV
finefocus-4313	1	3	fine	fine	ADJ
finefocus-4313	1	4	focus	focus	NOUN
finefocus-4313	1	5	preliminary	preliminary	ADJ
finefocus-4313	1	6	studies	study	NOUN
finefocus-4313	1	7	on	on	ADP
finefocus-4313	1	8	a	a	DET
finefocus-4313	1	9	novel	novel	ADJ
finefocus-4313	1	10	antimicrobial	antimicrobial	ADJ
finefocus-4313	1	11	compound	compound	NOUN
finefocus-4313	1	12	producing	produce	VERB
finefocus-4313	1	13	bacterium	bacterium	NOUN
finefocus-4313	1	14	discovered	discover	VERB
finefocus-4313	1	15	in	in	ADP
finefocus-4313	1	16	the	the	DET
finefocus-4313	1	17	rio	rio	NOUN
finefocus-4313	1	18	grande	grande	PROPN
finefocus-4313	1	19	valley	valley	PROPN
finefocus-4313	1	20	of	of	ADP
finefocus-4313	1	21	texas	texas	PROPN
finefocus-4313	1	22	julissa	julissa	PROPN
finefocus-4313	1	23	hernandez	hernandez	PROPN
finefocus-4313	1	24	(	(	PUNCT
finefocus-4313	1	25	juliehdz_3601@tamu.edu	juliehdz_3601@tamu.edu	PROPN
finefocus-4313	1	26	)	)	PUNCT
finefocus-4313	1	27	anieto	anieto	NOUN
finefocus-4313	1	28	ugochukwu	ugochukwu	NOUN
finefocus-4313	1	29	(	(	PUNCT
finefocus-4313	1	30	uanieto@tamu.edu	uanieto@tamu.edu	PROPN
finefocus-4313	1	31	)	)	PUNCT
finefocus-4313	1	32	texas	texas	PROPN
finefocus-4313	1	33	a&m	a&m	PROPN
finefocus-4313	1	34	university	university	PROPN
finefocus-4313	1	35	higher	high	ADJ
finefocus-4313	1	36	education	education	NOUN
finefocus-4313	1	37	center	center	NOUN
finefocus-4313	1	38	in	in	ADP
finefocus-4313	1	39	mcallen	mcallen	PROPN
finefocus-4313	1	40	(	(	PUNCT
finefocus-4313	1	41	hecm	hecm	PROPN
finefocus-4313	1	42	)	)	PUNCT
finefocus-4313	1	43	vol	vol	NOUN
finefocus-4313	1	44	9	9	NUM
finefocus-4313	1	45	|	|	ADV
finefocus-4313	1	46	99	99	NUM
finefocus-4313	2	1	abstract	abstract	ADV
finefocus-4313	2	2	we	we	PRON
finefocus-4313	2	3	analyzed	analyze	VERB
finefocus-4313	2	4	different	different	ADJ
finefocus-4313	2	5	soil	soil	NOUN
finefocus-4313	2	6	samples	sample	NOUN
finefocus-4313	2	7	collected	collect	VERB
finefocus-4313	2	8	across	across	ADP
finefocus-4313	2	9	the	the	DET
finefocus-4313	2	10	rio	rio	NOUN
finefocus-4313	2	11	grande	grande	PROPN
finefocus-4313	2	12	valley	valley	PROPN
finefocus-4313	2	13	(	(	PUNCT
finefocus-4313	2	14	rgv	rgv	PROPN
finefocus-4313	2	15	)	)	PUNCT
finefocus-4313	2	16	of	of	ADP
finefocus-4313	2	17	texas	texas	PROPN
finefocus-4313	2	18	for	for	ADP
finefocus-4313	2	19	bacteria	bacteria	NOUN
finefocus-4313	2	20	capable	capable	ADJ
finefocus-4313	2	21	of	of	ADP
finefocus-4313	2	22	producing	produce	VERB
finefocus-4313	2	23	antimicrobial	antimicrobial	ADJ
finefocus-4313	2	24	compounds	compound	NOUN
finefocus-4313	2	25	.	.	PUNCT
finefocus-4313	3	1	of	of	ADP
finefocus-4313	3	2	the	the	DET
finefocus-4313	3	3	more	more	ADJ
finefocus-4313	3	4	than	than	ADP
finefocus-4313	3	5	500	500	NUM
finefocus-4313	3	6	bacterial	bacterial	ADJ
finefocus-4313	3	7	colonies	colony	NOUN
finefocus-4313	3	8	tested	test	VERB
finefocus-4313	3	9	,	,	PUNCT
finefocus-4313	3	10	less	less	ADJ
finefocus-4313	3	11	than	than	ADP
finefocus-4313	3	12	1	1	NUM
finefocus-4313	3	13	percent	percent	NOUN
finefocus-4313	3	14	gave	give	VERB
finefocus-4313	3	15	any	any	DET
finefocus-4313	3	16	indication	indication	NOUN
finefocus-4313	3	17	of	of	ADP
finefocus-4313	3	18	the	the	DET
finefocus-4313	3	19	likelihood	likelihood	NOUN
finefocus-4313	3	20	of	of	ADP
finefocus-4313	3	21	producing	produce	VERB
finefocus-4313	3	22	antimicrobial	antimicrobial	ADJ
finefocus-4313	3	23	compounds	compound	NOUN
finefocus-4313	3	24	asdetermined	asdetermine	VERB
finefocus-4313	3	25	by	by	ADP
finefocus-4313	3	26	the	the	DET
finefocus-4313	3	27	diameter	diameter	NOUN
finefocus-4313	3	28	of	of	ADP
finefocus-4313	3	29	the	the	DET
finefocus-4313	3	30	observed	observe	VERB
finefocus-4313	3	31	zones	zone	NOUN
finefocus-4313	3	32	of	of	ADP
finefocus-4313	3	33	inhibition	inhibition	NOUN
finefocus-4313	3	34	created	create	VERB
finefocus-4313	3	35	when	when	SCONJ
finefocus-4313	3	36	tested	test	VERB
finefocus-4313	3	37	on	on	ADP
finefocus-4313	3	38	the	the	DET
finefocus-4313	3	39	cultures	culture	NOUN
finefocus-4313	3	40	of	of	ADP
finefocus-4313	3	41	safe	safe	ADJ
finefocus-4313	3	42	eskape	eskape	NOUN
finefocus-4313	3	43	relatives	relative	NOUN
finefocus-4313	3	44	.	.	PUNCT
finefocus-4313	4	1	one	one	NUM
finefocus-4313	4	2	of	of	ADP
finefocus-4313	4	3	the	the	DET
finefocus-4313	4	4	soil	soil	NOUN
finefocus-4313	4	5	isolates	isolate	NOUN
finefocus-4313	4	6	of	of	ADP
finefocus-4313	4	7	interest	interest	NOUN
finefocus-4313	4	8	was	be	AUX
finefocus-4313	4	9	further	far	ADV
finefocus-4313	4	10	studied	study	VERB
finefocus-4313	4	11	with	with	ADP
finefocus-4313	4	12	the	the	DET
finefocus-4313	4	13	16s	16s	PROPN
finefocus-4313	4	14	rrna	rrna	PROPN
finefocus-4313	4	15	gene	gene	NOUN
finefocus-4313	4	16	sequenced	sequence	VERB
finefocus-4313	4	17	and	and	CCONJ
finefocus-4313	4	18	analyzed	analyze	VERB
finefocus-4313	4	19	,	,	PUNCT
finefocus-4313	4	20	and	and	CCONJ
finefocus-4313	4	21	its	its	PRON
finefocus-4313	4	22	antimicrobial	antimicrobial	ADJ
finefocus-4313	4	23	compound	compound	NOUN
finefocus-4313	4	24	was	be	AUX
finefocus-4313	4	25	also	also	ADV
finefocus-4313	4	26	extracted	extract	VERB
finefocus-4313	4	27	using	use	VERB
finefocus-4313	4	28	the	the	DET
finefocus-4313	4	29	ethyl	ethyl	PROPN
finefocus-4313	4	30	acetate	acetate	NOUN
finefocus-4313	4	31	and	and	CCONJ
finefocus-4313	4	32	methanol	methanol	NOUN
finefocus-4313	4	33	extraction	extraction	NOUN
finefocus-4313	4	34	method	method	NOUN
finefocus-4313	4	35	.	.	PUNCT
finefocus-4313	5	1	the	the	DET
finefocus-4313	5	2	results	result	NOUN
finefocus-4313	5	3	obtained	obtain	VERB
finefocus-4313	5	4	suggest	suggest	VERB
finefocus-4313	5	5	that	that	SCONJ
finefocus-4313	5	6	the	the	DET
finefocus-4313	5	7	identified	identify	VERB
finefocus-4313	5	8	bacterium	bacterium	NOUN
finefocus-4313	5	9	could	could	AUX
finefocus-4313	5	10	be	be	AUX
finefocus-4313	5	11	a	a	DET
finefocus-4313	5	12	novel	novel	ADJ
finefocus-4313	5	13	specie	specie	NOUN
finefocus-4313	5	14	or	or	CCONJ
finefocus-4313	5	15	at	at	ADP
finefocus-4313	5	16	least	least	ADJ
finefocus-4313	5	17	a	a	DET
finefocus-4313	5	18	sub	sub	NOUN
finefocus-4313	5	19	-	-	NOUN
finefocus-4313	5	20	specie	specie	NOUN
finefocus-4313	5	21	of	of	ADP
finefocus-4313	5	22	the	the	DET
finefocus-4313	5	23	genus	genus	NOUN
finefocus-4313	5	24	pseudomonas	pseudomona	NOUN
finefocus-4313	5	25	and	and	CCONJ
finefocus-4313	5	26	the	the	DET
finefocus-4313	5	27	novel	novel	ADJ
finefocus-4313	5	28	antimicrobial	antimicrobial	ADJ
finefocus-4313	5	29	compound	compound	NOUN
finefocus-4313	5	30	discovered	discover	VERB
finefocus-4313	5	31	possibly	possibly	ADV
finefocus-4313	5	32	broad	broad	ADJ
finefocus-4313	5	33	spectrum	spectrum	NOUN
finefocus-4313	5	34	in	in	ADP
finefocus-4313	5	35	nature	nature	NOUN
finefocus-4313	5	36	considering	consider	VERB
finefocus-4313	5	37	that	that	SCONJ
finefocus-4313	5	38	it	it	PRON
finefocus-4313	5	39	is	be	AUX
finefocus-4313	5	40	active	active	ADJ
finefocus-4313	5	41	against	against	ADP
finefocus-4313	5	42	gram	gram	NOUN
finefocus-4313	5	43	-	-	PUNCT
finefocus-4313	5	44	positive	positive	ADJ
finefocus-4313	5	45	and	and	CCONJ
finefocus-4313	5	46	gram	gram	NOUN
finefocus-4313	5	47	-	-	PUNCT
finefocus-4313	5	48	negative	negative	ADJ
finefocus-4313	5	49	bacteria	bacteria	NOUN
finefocus-4313	5	50	,	,	PUNCT
finefocus-4313	5	51	especially	especially	ADV
finefocus-4313	5	52	staphylococcus	staphylococcus	NOUN
finefocus-4313	5	53	epidermidis	epidermidi	NOUN
finefocus-4313	5	54	,	,	PUNCT
finefocus-4313	5	55	the	the	DET
finefocus-4313	5	56	safe	safe	ADJ
finefocus-4313	5	57	relative	relative	NOUN
finefocus-4313	5	58	of	of	ADP
finefocus-4313	5	59	staphylococcus	staphylococcus	NOUN
finefocus-4313	5	60	aureus	aureus	NOUN
finefocus-4313	5	61	.	.	PUNCT
finefocus-4313	6	1	furthermore	furthermore	ADV
finefocus-4313	6	2	,	,	PUNCT
finefocus-4313	6	3	positive	positive	ADJ
finefocus-4313	6	4	inhibitory	inhibitory	ADJ
finefocus-4313	6	5	results	result	NOUN
finefocus-4313	6	6	were	be	AUX
finefocus-4313	6	7	obtained	obtain	VERB
finefocus-4313	6	8	when	when	SCONJ
finefocus-4313	6	9	the	the	DET
finefocus-4313	6	10	antimicrobial	antimicrobial	ADJ
finefocus-4313	6	11	compound	compound	NOUN
finefocus-4313	6	12	was	be	AUX
finefocus-4313	6	13	tested	test	VERB
finefocus-4313	6	14	on	on	ADP
finefocus-4313	6	15	bacillus	bacillus	NOUN
finefocus-4313	6	16	subtilis	subtili	NOUN
finefocus-4313	6	17	,	,	PUNCT
finefocus-4313	6	18	klebsiella	klebsiella	NOUN
finefocus-4313	6	19	pneumoniae	pneumoniae	PROPN
finefocus-4313	6	20	,	,	PUNCT
finefocus-4313	6	21	pseudomonas	pseudomonas	PROPN
finefocus-4313	6	22	putida	putida	PROPN
finefocus-4313	6	23	,	,	PUNCT
finefocus-4313	6	24	enterococcus	enterococcus	NOUN
finefocus-4313	6	25	raffinosus	raffinosus	NOUN
finefocus-4313	6	26	,	,	PUNCT
finefocus-4313	6	27	erwinia	erwinia	NOUN
finefocus-4313	6	28	caratovora	caratovora	NOUN
finefocus-4313	6	29	,	,	PUNCT
finefocus-4313	6	30	enterobacter	enterobacter	NOUN
finefocus-4313	6	31	aerogenes	aerogene	NOUN
finefocus-4313	6	32	and	and	CCONJ
finefocus-4313	6	33	an	an	DET
finefocus-4313	6	34	unknown	unknown	ADJ
finefocus-4313	6	35	bacterium	bacterium	NOUN
finefocus-4313	6	36	from	from	ADP
finefocus-4313	6	37	an	an	DET
finefocus-4313	6	38	environmental	environmental	ADJ
finefocus-4313	6	39	sample	sample	NOUN
finefocus-4313	6	40	etc	etc	X
finefocus-4313	6	41	.	.	PUNCT
finefocus-4313	7	1	the	the	DET
finefocus-4313	7	2	newly	newly	ADV
finefocus-4313	7	3	discovered	discover	VERB
finefocus-4313	7	4	antimicrobial	antimicrobial	ADJ
finefocus-4313	7	5	compound	compound	NOUN
finefocus-4313	7	6	has	have	AUX
finefocus-4313	7	7	been	be	AUX
finefocus-4313	7	8	named	name	VERB
finefocus-4313	7	9	“	"	PUNCT
finefocus-4313	7	10	anietocin	anietocin	NOUN
finefocus-4313	7	11	”	"	PUNCT
finefocus-4313	7	12	and	and	CCONJ
finefocus-4313	7	13	will	will	AUX
finefocus-4313	7	14	be	be	AUX
finefocus-4313	7	15	the	the	DET
finefocus-4313	7	16	subject	subject	NOUN
finefocus-4313	7	17	of	of	ADP
finefocus-4313	7	18	extensive	extensive	ADJ
finefocus-4313	7	19	studies	study	NOUN
finefocus-4313	7	20	in	in	ADP
finefocus-4313	7	21	the	the	DET
finefocus-4313	7	22	coming	come	VERB
finefocus-4313	7	23	research	research	NOUN
finefocus-4313	7	24	efforts	effort	NOUN
finefocus-4313	7	25	.	.	PUNCT
finefocus-4313	8	1	introduction	introduction	NOUN
finefocus-4313	8	2	the	the	DET
finefocus-4313	8	3	emergence	emergence	NOUN
finefocus-4313	8	4	of	of	ADP
finefocus-4313	8	5	antimicrobial	antimicrobial	ADJ
finefocus-4313	8	6	resistance	resistance	NOUN
finefocus-4313	8	7	in	in	ADP
finefocus-4313	8	8	pathogenic	pathogenic	ADJ
finefocus-4313	8	9	bacteria	bacteria	NOUN
finefocus-4313	8	10	has	have	AUX
finefocus-4313	8	11	turned	turn	VERB
finefocus-4313	8	12	into	into	ADP
finefocus-4313	8	13	a	a	DET
finefocus-4313	8	14	global	global	ADJ
finefocus-4313	8	15	phenomenon	phenomenon	NOUN
finefocus-4313	8	16	with	with	ADP
finefocus-4313	8	17	the	the	DET
finefocus-4313	8	18	tremendous	tremendous	ADJ
finefocus-4313	8	19	potential	potential	NOUN
finefocus-4313	8	20	of	of	ADP
finefocus-4313	8	21	being	be	AUX
finefocus-4313	8	22	the	the	DET
finefocus-4313	8	23	leading	lead	VERB
finefocus-4313	8	24	cause	cause	NOUN
finefocus-4313	8	25	of	of	ADP
finefocus-4313	8	26	death	death	NOUN
finefocus-4313	8	27	if	if	SCONJ
finefocus-4313	8	28	left	leave	VERB
finefocus-4313	8	29	unchallenged	unchallenged	ADJ
finefocus-4313	8	30	(	(	PUNCT
finefocus-4313	8	31	aslam	aslam	PROPN
finefocus-4313	8	32	et	et	PROPN
finefocus-4313	8	33	al	al	PROPN
finefocus-4313	8	34	.	.	PROPN
finefocus-4313	8	35	,	,	PUNCT
finefocus-4313	8	36	2018	2018	NUM
finefocus-4313	8	37	)	)	PUNCT
finefocus-4313	8	38	.	.	PUNCT
finefocus-4313	9	1	for	for	ADP
finefocus-4313	9	2	this	this	DET
finefocus-4313	9	3	reason	reason	NOUN
finefocus-4313	9	4	,	,	PUNCT
finefocus-4313	9	5	many	many	ADJ
finefocus-4313	9	6	researchers	researcher	NOUN
finefocus-4313	9	7	across	across	ADP
finefocus-4313	9	8	the	the	DET
finefocus-4313	9	9	globe	globe	NOUN
finefocus-4313	9	10	have	have	AUX
finefocus-4313	9	11	actively	actively	ADV
finefocus-4313	9	12	worked	work	VERB
finefocus-4313	9	13	and	and	CCONJ
finefocus-4313	9	14	are	be	AUX
finefocus-4313	9	15	currently	currently	ADV
finefocus-4313	9	16	engaged	engage	VERB
finefocus-4313	9	17	in	in	ADP
finefocus-4313	9	18	finding	find	VERB
finefocus-4313	9	19	solutions	solution	NOUN
finefocus-4313	9	20	to	to	ADP
finefocus-4313	9	21	this	this	DET
finefocus-4313	9	22	problem	problem	NOUN
finefocus-4313	9	23	.	.	PUNCT
finefocus-4313	10	1	a	a	DET
finefocus-4313	10	2	number	number	NOUN
finefocus-4313	10	3	of	of	ADP
finefocus-4313	10	4	scientific	scientific	ADJ
finefocus-4313	10	5	articles	article	NOUN
finefocus-4313	10	6	have	have	AUX
finefocus-4313	10	7	been	be	AUX
finefocus-4313	10	8	published	publish	VERB
finefocus-4313	10	9	,	,	PUNCT
finefocus-4313	10	10	showcasing	showcase	VERB
finefocus-4313	10	11	novel	novel	ADJ
finefocus-4313	10	12	discoveries	discovery	NOUN
finefocus-4313	10	13	including	include	VERB
finefocus-4313	10	14	one	one	NUM
finefocus-4313	10	15	by	by	ADP
finefocus-4313	10	16	darabpour	darabpour	PROPN
finefocus-4313	10	17	et	et	PROPN
finefocus-4313	10	18	al	al	PROPN
finefocus-4313	10	19	.	.	PUNCT
finefocus-4313	11	1	(	(	PUNCT
finefocus-4313	11	2	2012)where	2012)where	NUM
finefocus-4313	11	3	they	they	PRON
finefocus-4313	11	4	described	describe	VERB
finefocus-4313	11	5	an	an	DET
finefocus-4313	11	6	antibiotic	antibiotic	ADJ
finefocus-4313	11	7	producing	produce	VERB
finefocus-4313	11	8	pseudoalteromonas	pseudoalteromona	NOUN
finefocus-4313	11	9	piscicida	piscicida	NOUN
finefocus-4313	11	10	that	that	PRON
finefocus-4313	11	11	was	be	AUX
finefocus-4313	11	12	effective	effective	ADJ
finefocus-4313	11	13	against	against	ADP
finefocus-4313	11	14	most	most	ADJ
finefocus-4313	11	15	gram	gram	NOUN
finefocus-4313	11	16	-	-	PUNCT
finefocus-4313	11	17	positive	positive	ADJ
finefocus-4313	11	18	bacteria	bacteria	NOUN
finefocus-4313	11	19	.	.	PUNCT
finefocus-4313	12	1	similarly	similarly	ADV
finefocus-4313	12	2	,	,	PUNCT
finefocus-4313	12	3	pishchany	pishchany	NOUN
finefocus-4313	12	4	et	et	PROPN
finefocus-4313	12	5	al	al	PROPN
finefocus-4313	12	6	.	.	PROPN
finefocus-4313	13	1	(	(	PUNCT
finefocus-4313	13	2	2018	2018	NUM
finefocus-4313	13	3	)	)	PUNCT
finefocus-4313	13	4	described	describe	VERB
finefocus-4313	13	5	the	the	DET
finefocus-4313	13	6	successes	success	NOUN
finefocus-4313	13	7	of	of	ADP
finefocus-4313	13	8	the	the	DET
finefocus-4313	13	9	novel	novel	ADJ
finefocus-4313	13	10	antibiotic	antibiotic	ADJ
finefocus-4313	13	11	amycomicin	amycomicin	NOUN
finefocus-4313	13	12	on	on	ADP
finefocus-4313	13	13	different	different	ADJ
finefocus-4313	13	14	bacteria	bacteria	NOUN
finefocus-4313	13	15	including	include	VERB
finefocus-4313	13	16	staphylococcus	staphylococcus	NOUN
finefocus-4313	13	17	aureus	aureus	NOUN
finefocus-4313	13	18	.	.	PUNCT
finefocus-4313	14	1	many	many	ADJ
finefocus-4313	14	2	of	of	ADP
finefocus-4313	14	3	the	the	DET
finefocus-4313	14	4	discoveries	discovery	NOUN
finefocus-4313	14	5	have	have	AUX
finefocus-4313	14	6	made	make	VERB
finefocus-4313	14	7	it	it	PRON
finefocus-4313	14	8	to	to	ADP
finefocus-4313	14	9	patents	patent	NOUN
finefocus-4313	14	10	as	as	ADP
finefocus-4313	14	11	novel	novel	ADJ
finefocus-4313	14	12	antibiotics	antibiotic	NOUN
finefocus-4313	14	13	as	as	SCONJ
finefocus-4313	14	14	described	describe	VERB
finefocus-4313	14	15	by	by	ADP
finefocus-4313	14	16	koulenti	koulenti	PROPN
finefocus-4313	14	17	et	et	PROPN
finefocus-4313	14	18	al	al	PROPN
finefocus-4313	14	19	.	.	PROPN
finefocus-4313	15	1	(	(	PUNCT
finefocus-4313	15	2	2019	2019	NUM
finefocus-4313	15	3	)	)	PUNCT
finefocus-4313	15	4	.	.	PUNCT
finefocus-4313	16	1	such	such	ADJ
finefocus-4313	16	2	novel	novel	ADJ
finefocus-4313	16	3	antibiotics	antibiotic	NOUN
finefocus-4313	16	4	that	that	PRON
finefocus-4313	16	5	were	be	AUX
finefocus-4313	16	6	described	describe	VERB
finefocus-4313	16	7	as	as	ADP
finefocus-4313	16	8	efficient	efficient	ADJ
finefocus-4313	16	9	against	against	ADP
finefocus-4313	16	10	multidrug	multidrug	NOUN
finefocus-4313	16	11	-	-	PUNCT
finefocus-4313	16	12	resistant	resistant	ADJ
finefocus-4313	16	13	gram	gram	NOUN
finefocus-4313	16	14	-	-	PUNCT
finefocus-4313	16	15	positive	positive	ADJ
finefocus-4313	16	16	bacteria	bacteria	NOUN
finefocus-4313	16	17	include	include	VERB
finefocus-4313	16	18	ceftobiprole	ceftobiprole	PROPN
finefocus-4313	16	19	,	,	PUNCT
finefocus-4313	16	20	ceftaroline	ceftaroline	NOUN
finefocus-4313	16	21	,	,	PUNCT
finefocus-4313	16	22	telavancin	telavancin	PROPN
finefocus-4313	16	23	,	,	PUNCT
finefocus-4313	16	24	oritavancin	oritavancin	PROPN
finefocus-4313	16	25	,	,	PUNCT
finefocus-4313	16	26	dalbavancin	dalbavancin	PROPN
finefocus-4313	16	27	etc	etc	X
finefocus-4313	16	28	.	.	X
finefocus-4313	17	1	in	in	ADP
finefocus-4313	17	2	addition	addition	NOUN
finefocus-4313	17	3	to	to	ADP
finefocus-4313	17	4	antimicrobial	antimicrobial	ADJ
finefocus-4313	17	5	compounds	compound	NOUN
finefocus-4313	17	6	derived	derive	VERB
finefocus-4313	17	7	from	from	ADP
finefocus-4313	17	8	bacteria	bacteria	NOUN
finefocus-4313	17	9	,	,	PUNCT
finefocus-4313	17	10	a	a	DET
finefocus-4313	17	11	few	few	ADJ
finefocus-4313	17	12	studies	study	NOUN
finefocus-4313	17	13	have	have	AUX
finefocus-4313	17	14	reported	report	VERB
finefocus-4313	17	15	the	the	DET
finefocus-4313	17	16	use	use	NOUN
finefocus-4313	17	17	of	of	ADP
finefocus-4313	17	18	other	other	ADJ
finefocus-4313	17	19	chemical	chemical	NOUN
finefocus-4313	17	20	compounds	compound	NOUN
finefocus-4313	17	21	in	in	ADP
finefocus-4313	17	22	our	our	PRON
finefocus-4313	17	23	fight	fight	NOUN
finefocus-4313	17	24	against	against	ADP
finefocus-4313	17	25	multi	multi	ADJ
finefocus-4313	17	26	-	-	ADJ
finefocus-4313	17	27	drug	drug	ADJ
finefocus-4313	17	28	resistant	resistant	ADJ
finefocus-4313	17	29	bacteria	bacteria	NOUN
finefocus-4313	17	30	,	,	PUNCT
finefocus-4313	17	31	notably	notably	ADV
finefocus-4313	17	32	behroozian	behroozian	PROPN
finefocus-4313	17	33	et	et	PROPN
finefocus-4313	17	34	al	al	PROPN
finefocus-4313	17	35	.	.	PUNCT
finefocus-4313	18	1	(	(	PUNCT
finefocus-4313	18	2	2016	2016	NUM
finefocus-4313	18	3	)	)	PUNCT
finefocus-4313	18	4	reported	report	VERB
finefocus-4313	18	5	the	the	DET
finefocus-4313	18	6	successful	successful	ADJ
finefocus-4313	18	7	use	use	NOUN
finefocus-4313	18	8	of	of	ADP
finefocus-4313	18	9	kisameet	kisameet	NOUN
finefocus-4313	18	10	clay	clay	NOUN
finefocus-4313	18	11	on	on	ADP
finefocus-4313	18	12	eskape	eskape	NOUN
finefocus-4313	18	13	pathogens	pathogen	NOUN
finefocus-4313	18	14	.	.	PUNCT
finefocus-4313	19	1	similarly	similarly	ADV
finefocus-4313	19	2	,	,	PUNCT
finefocus-4313	19	3	hijazi	hijazi	PROPN
finefocus-4313	19	4	et	et	PROPN
finefocus-4313	19	5	al	al	PROPN
finefocus-4313	19	6	.	.	PROPN
finefocus-4313	20	1	(	(	PUNCT
finefocus-4313	20	2	2018	2018	NUM
finefocus-4313	20	3	)	)	PUNCT
finefocus-4313	20	4	described	describe	VERB
finefocus-4313	20	5	the	the	DET
finefocus-4313	20	6	antimicrobial	antimicrobial	ADJ
finefocus-4313	20	7	property	property	NOUN
finefocus-4313	20	8	of	of	ADP
finefocus-4313	20	9	gallium	gallium	NOUN
finefocus-4313	20	10	compounds	compound	VERB
finefocus-4313	20	11	on	on	ADP
finefocus-4313	20	12	eskape	eskape	NOUN
finefocus-4313	20	13	pathogens	pathogen	NOUN
finefocus-4313	20	14	.	.	PUNCT
finefocus-4313	21	1	perhaps	perhaps	ADV
finefocus-4313	21	2	to	to	PART
finefocus-4313	21	3	be	be	AUX
finefocus-4313	21	4	considered	consider	VERB
finefocus-4313	21	5	an	an	DET
finefocus-4313	21	6	outlier	outlier	NOUN
finefocus-4313	21	7	to	to	ADP
finefocus-4313	21	8	recent	recent	ADJ
finefocus-4313	21	9	endeavors	endeavor	NOUN
finefocus-4313	21	10	with	with	ADP
finefocus-4313	21	11	novel	novel	ADJ
finefocus-4313	21	12	antimicrobial	antimicrobial	ADJ
finefocus-4313	21	13	compounds	compound	NOUN
finefocus-4313	21	14	,	,	PUNCT
finefocus-4313	21	15	is	be	AUX
finefocus-4313	21	16	the	the	DET
finefocus-4313	21	17	article	article	NOUN
finefocus-4313	21	18	by	by	ADP
finefocus-4313	21	19	nakonieczna	nakonieczna	PROPN
finefocus-4313	21	20	et	et	PROPN
finefocus-4313	21	21	al.(2019	al.(2019	PROPN
finefocus-4313	21	22	)	)	PUNCT
finefocus-4313	21	23	describing	describe	VERB
finefocus-4313	21	24	the	the	DET
finefocus-4313	21	25	latest	late	ADJ
finefocus-4313	21	26	photoinactivation	photoinactivation	NOUN
finefocus-4313	21	27	method	method	NOUN
finefocus-4313	21	28	used	use	VERB
finefocus-4313	21	29	on	on	ADP
finefocus-4313	21	30	eskape	eskape	NOUN
finefocus-4313	21	31	pathogens	pathogen	NOUN
finefocus-4313	21	32	.	.	PUNCT
finefocus-4313	22	1	100	100	NUM
finefocus-4313	22	2	|	|	CCONJ
finefocus-4313	22	3	fine	fine	ADJ
finefocus-4313	22	4	focus	focus	NOUN
finefocus-4313	22	5	members	member	NOUN
finefocus-4313	22	6	of	of	ADP
finefocus-4313	22	7	the	the	DET
finefocus-4313	22	8	eskape	eskape	NOUN
finefocus-4313	22	9	pathogens	pathogen	NOUN
finefocus-4313	22	10	include	include	VERB
finefocus-4313	22	11	enterococcus	enterococcus	NOUN
finefocus-4313	22	12	faecium	faecium	NOUN
finefocus-4313	22	13	,	,	PUNCT
finefocus-4313	22	14	staphylococcus	staphylococcus	NOUN
finefocus-4313	22	15	aureus	aureus	NOUN
finefocus-4313	22	16	,	,	PUNCT
finefocus-4313	22	17	klebsiella	klebsiella	PROPN
finefocus-4313	22	18	pneumoniae	pneumoniae	NOUN
finefocus-4313	22	19	,	,	PUNCT
finefocus-4313	22	20	acinetobacter	acinetobacter	ADV
finefocus-4313	22	21	baumannii	baumannii	PROPN
finefocus-4313	22	22	,	,	PUNCT
finefocus-4313	22	23	pseudomonas	pseudomona	NOUN
finefocus-4313	22	24	aeruginosa	aeruginosa	NOUN
finefocus-4313	22	25	and	and	CCONJ
finefocus-4313	22	26	enterobacter	enterobacter	NOUN
finefocus-4313	22	27	spp	spp	NOUN
finefocus-4313	22	28	.	.	PUNCT
finefocus-4313	23	1	(	(	PUNCT
finefocus-4313	23	2	mulani	mulani	PROPN
finefocus-4313	23	3	,	,	PUNCT
finefocus-4313	23	4	et	et	PROPN
finefocus-4313	23	5	al	al	PROPN
finefocus-4313	23	6	.	.	PROPN
finefocus-4313	23	7	,	,	PUNCT
finefocus-4313	23	8	2019	2019	NUM
finefocus-4313	23	9	)	)	PUNCT
finefocus-4313	23	10	.	.	PUNCT
finefocus-4313	24	1	these	these	DET
finefocus-4313	24	2	bacteria	bacteria	NOUN
finefocus-4313	24	3	are	be	AUX
finefocus-4313	24	4	resistant	resistant	ADJ
finefocus-4313	24	5	to	to	ADP
finefocus-4313	24	6	multiple	multiple	ADJ
finefocus-4313	24	7	drugs	drug	NOUN
finefocus-4313	24	8	and	and	CCONJ
finefocus-4313	24	9	are	be	AUX
finefocus-4313	24	10	known	know	VERB
finefocus-4313	24	11	to	to	PART
finefocus-4313	24	12	be	be	AUX
finefocus-4313	24	13	virulent	virulent	ADJ
finefocus-4313	24	14	(	(	PUNCT
finefocus-4313	24	15	mulaniet	mulaniet	PROPN
finefocus-4313	24	16	al	al	PROPN
finefocus-4313	24	17	.	.	PROPN
finefocus-4313	24	18	,	,	PUNCT
finefocus-4313	24	19	2019	2019	NUM
finefocus-4313	24	20	)	)	PUNCT
finefocus-4313	24	21	.	.	PUNCT
finefocus-4313	25	1	the	the	DET
finefocus-4313	25	2	mechanisms	mechanism	NOUN
finefocus-4313	25	3	employed	employ	VERB
finefocus-4313	25	4	by	by	ADP
finefocus-4313	25	5	these	these	DET
finefocus-4313	25	6	eskape	eskape	NOUN
finefocus-4313	25	7	pathogens	pathogen	NOUN
finefocus-4313	25	8	to	to	PART
finefocus-4313	25	9	evade	evade	VERB
finefocus-4313	25	10	antibiotics	antibiotic	NOUN
finefocus-4313	25	11	include	include	VERB
finefocus-4313	25	12	the	the	DET
finefocus-4313	25	13	alteration	alteration	NOUN
finefocus-4313	25	14	of	of	ADP
finefocus-4313	25	15	the	the	DET
finefocus-4313	25	16	compounds	compound	NOUN
finefocus-4313	25	17	,	,	PUNCT
finefocus-4313	25	18	modification	modification	NOUN
finefocus-4313	25	19	of	of	ADP
finefocus-4313	25	20	the	the	DET
finefocus-4313	25	21	binding	bind	VERB
finefocus-4313	25	22	sites	site	NOUN
finefocus-4313	25	23	of	of	ADP
finefocus-4313	25	24	drugs	drug	NOUN
finefocus-4313	25	25	,	,	PUNCT
finefocus-4313	25	26	intracellular	intracellular	ADJ
finefocus-4313	25	27	decrease	decrease	NOUN
finefocus-4313	25	28	in	in	ADP
finefocus-4313	25	29	the	the	DET
finefocus-4313	25	30	accumulation	accumulation	NOUN
finefocus-4313	25	31	of	of	ADP
finefocus-4313	25	32	the	the	DET
finefocus-4313	25	33	drug	drug	NOUN
finefocus-4313	25	34	,	,	PUNCT
finefocus-4313	25	35	loss	loss	NOUN
finefocus-4313	25	36	of	of	ADP
finefocus-4313	25	37	porin	porin	NOUN
finefocus-4313	25	38	,	,	PUNCT
finefocus-4313	25	39	the	the	DET
finefocus-4313	25	40	use	use	NOUN
finefocus-4313	25	41	of	of	ADP
finefocus-4313	25	42	efflux	efflux	NOUN
finefocus-4313	25	43	pumps	pump	NOUN
finefocus-4313	25	44	etc	etc	X
finefocus-4313	25	45	.	.	X
finefocus-4313	26	1	(	(	PUNCT
finefocus-4313	26	2	santajit	santajit	PROPN
finefocus-4313	26	3	and	and	CCONJ
finefocus-4313	26	4	indrawattana	indrawattana	PROPN
finefocus-4313	26	5	,	,	PUNCT
finefocus-4313	26	6	2016	2016	NUM
finefocus-4313	26	7	)	)	PUNCT
finefocus-4313	26	8	.	.	PUNCT
finefocus-4313	27	1	these	these	DET
finefocus-4313	27	2	mechanisms	mechanism	NOUN
finefocus-4313	27	3	do	do	AUX
finefocus-4313	27	4	not	not	PART
finefocus-4313	27	5	deviate	deviate	VERB
finefocus-4313	27	6	at	at	ADV
finefocus-4313	27	7	all	all	ADV
finefocus-4313	27	8	from	from	ADP
finefocus-4313	27	9	previously	previously	ADV
finefocus-4313	27	10	established	establish	VERB
finefocus-4313	27	11	mechanisms	mechanism	NOUN
finefocus-4313	27	12	of	of	ADP
finefocus-4313	27	13	evasion	evasion	NOUN
finefocus-4313	27	14	by	by	ADP
finefocus-4313	27	15	all	all	DET
finefocus-4313	27	16	bacteria	bacteria	NOUN
finefocus-4313	27	17	that	that	PRON
finefocus-4313	27	18	are	be	AUX
finefocus-4313	27	19	sensitive	sensitive	ADJ
finefocus-4313	27	20	to	to	ADP
finefocus-4313	27	21	antibiotics	antibiotic	NOUN
finefocus-4313	27	22	.	.	PUNCT
finefocus-4313	28	1	in	in	ADP
finefocus-4313	28	2	our	our	PRON
finefocus-4313	28	3	efforts	effort	NOUN
finefocus-4313	28	4	to	to	PART
finefocus-4313	28	5	contribute	contribute	VERB
finefocus-4313	28	6	to	to	ADP
finefocus-4313	28	7	slowing	slow	VERB
finefocus-4313	28	8	down	down	ADP
finefocus-4313	28	9	the	the	DET
finefocus-4313	28	10	depletion	depletion	NOUN
finefocus-4313	28	11	of	of	ADP
finefocus-4313	28	12	our	our	PRON
finefocus-4313	28	13	potent	potent	ADJ
finefocus-4313	28	14	antibiotics	antibiotic	NOUN
finefocus-4313	28	15	and	and	CCONJ
finefocus-4313	28	16	the	the	DET
finefocus-4313	28	17	emergence	emergence	NOUN
finefocus-4313	28	18	of	of	ADP
finefocus-4313	28	19	superbugs	superbug	NOUN
finefocus-4313	28	20	,	,	PUNCT
finefocus-4313	28	21	we	we	PRON
finefocus-4313	28	22	discovered	discover	VERB
finefocus-4313	28	23	a	a	DET
finefocus-4313	28	24	highly	highly	ADV
finefocus-4313	28	25	effective	effective	ADJ
finefocus-4313	28	26	antimicrobial	antimicrobial	ADJ
finefocus-4313	28	27	compound	compound	NOUN
finefocus-4313	28	28	which	which	PRON
finefocus-4313	28	29	has	have	AUX
finefocus-4313	28	30	been	be	AUX
finefocus-4313	28	31	named	name	VERB
finefocus-4313	28	32	“	"	PUNCT
finefocus-4313	28	33	anietocin	anietocin	NOUN
finefocus-4313	28	34	”	"	PUNCT
finefocus-4313	28	35	and	and	CCONJ
finefocus-4313	28	36	is	be	AUX
finefocus-4313	28	37	produced	produce	VERB
finefocus-4313	28	38	by	by	ADP
finefocus-4313	28	39	a	a	DET
finefocus-4313	28	40	possibly	possibly	ADV
finefocus-4313	28	41	novel	novel	ADJ
finefocus-4313	28	42	specie	specie	NOUN
finefocus-4313	28	43	or	or	CCONJ
finefocus-4313	28	44	at	at	ADP
finefocus-4313	28	45	least	least	ADJ
finefocus-4313	28	46	a	a	DET
finefocus-4313	28	47	sub	sub	NOUN
finefocus-4313	28	48	-	-	NOUN
finefocus-4313	28	49	specie	specie	NOUN
finefocus-4313	28	50	of	of	ADP
finefocus-4313	28	51	the	the	DET
finefocus-4313	28	52	genus	genus	NOUN
finefocus-4313	28	53	pseudomonas	pseudomona	NOUN
finefocus-4313	28	54	based	base	VERB
finefocus-4313	28	55	on	on	ADP
finefocus-4313	28	56	its	its	PRON
finefocus-4313	28	57	determined	determined	ADJ
finefocus-4313	28	58	16s	16s	PROPN
finefocus-4313	28	59	rrna	rrna	PROPN
finefocus-4313	28	60	gene	gene	NOUN
finefocus-4313	28	61	sequence	sequence	NOUN
finefocus-4313	28	62	data	datum	NOUN
finefocus-4313	28	63	.	.	PUNCT
finefocus-4313	29	1	this	this	DET
finefocus-4313	29	2	novel	novel	NOUN
finefocus-4313	29	3	pseudomonas	pseudomona	VERB
finefocus-4313	29	4	spp	spp	NOUN
finefocus-4313	29	5	.	.	PUNCT
finefocus-4313	29	6	grows	grow	VERB
finefocus-4313	29	7	profusely	profusely	ADV
finefocus-4313	29	8	in	in	ADP
finefocus-4313	29	9	liquid	liquid	NOUN
finefocus-4313	29	10	and	and	CCONJ
finefocus-4313	29	11	on	on	ADP
finefocus-4313	29	12	solid	solid	ADJ
finefocus-4313	29	13	tryptic	tryptic	ADJ
finefocus-4313	29	14	soy	soy	NOUN
finefocus-4313	29	15	media	medium	NOUN
finefocus-4313	29	16	and	and	CCONJ
finefocus-4313	29	17	creates	create	VERB
finefocus-4313	29	18	a	a	DET
finefocus-4313	29	19	significant	significant	ADJ
finefocus-4313	29	20	zone	zone	NOUN
finefocus-4313	29	21	of	of	ADP
finefocus-4313	29	22	inhibition	inhibition	NOUN
finefocus-4313	29	23	when	when	SCONJ
finefocus-4313	29	24	tested	test	VERB
finefocus-4313	29	25	on	on	ADP
finefocus-4313	29	26	different	different	ADJ
finefocus-4313	29	27	bacteria	bacteria	NOUN
finefocus-4313	29	28	including	include	VERB
finefocus-4313	29	29	a	a	DET
finefocus-4313	29	30	member	member	NOUN
finefocus-4313	29	31	of	of	ADP
finefocus-4313	29	32	the	the	DET
finefocus-4313	29	33	eskape	eskape	NOUN
finefocus-4313	29	34	pathogens	pathogen	NOUN
finefocus-4313	29	35	and	and	CCONJ
finefocus-4313	29	36	safe	safe	ADJ
finefocus-4313	29	37	eskape	eskape	NOUN
finefocus-4313	29	38	relatives	relative	NOUN
finefocus-4313	29	39	.	.	PUNCT
finefocus-4313	30	1	there	there	PRON
finefocus-4313	30	2	are	be	VERB
finefocus-4313	30	3	quite	quite	DET
finefocus-4313	30	4	a	a	DET
finefocus-4313	30	5	number	number	NOUN
finefocus-4313	30	6	of	of	ADP
finefocus-4313	30	7	reported	report	VERB
finefocus-4313	30	8	studies	study	NOUN
finefocus-4313	30	9	where	where	SCONJ
finefocus-4313	30	10	pseudomonas	pseudomona	NOUN
finefocus-4313	30	11	spp	spp	NOUN
finefocus-4313	30	12	.	.	PUNCT
finefocus-4313	31	1	have	have	AUX
finefocus-4313	31	2	been	be	AUX
finefocus-4313	31	3	researched	research	VERB
finefocus-4313	31	4	for	for	ADP
finefocus-4313	31	5	the	the	DET
finefocus-4313	31	6	possibility	possibility	NOUN
finefocus-4313	31	7	of	of	ADP
finefocus-4313	31	8	producing	produce	VERB
finefocus-4313	31	9	antimicrobial	antimicrobial	ADJ
finefocus-4313	31	10	compounds	compound	NOUN
finefocus-4313	31	11	.	.	PUNCT
finefocus-4313	32	1	for	for	ADP
finefocus-4313	32	2	example	example	NOUN
finefocus-4313	32	3	raaijmakers	raaijmaker	NOUN
finefocus-4313	32	4	et	et	PROPN
finefocus-4313	32	5	al	al	PROPN
finefocus-4313	32	6	.	.	PROPN
finefocus-4313	33	1	(	(	PUNCT
finefocus-4313	33	2	1997	1997	NUM
finefocus-4313	33	3	)	)	PUNCT
finefocus-4313	33	4	described	describe	VERB
finefocus-4313	33	5	the	the	DET
finefocus-4313	33	6	production	production	NOUN
finefocus-4313	33	7	of	of	ADP
finefocus-4313	33	8	phanazine-1	phanazine-1	NOUN
finefocus-4313	33	9	-	-	ADJ
finefocus-4313	33	10	carboxylic	carboxylic	ADJ
finefocus-4313	33	11	acid	acid	NOUN
finefocus-4313	33	12	(	(	PUNCT
finefocus-4313	33	13	pca	pca	PROPN
finefocus-4313	33	14	)	)	PUNCT
finefocus-4313	33	15	and	and	CCONJ
finefocus-4313	33	16	2,4	2,4	NUM
finefocus-4313	33	17	-	-	PUNCT
finefocus-4313	33	18	diacetlyphloroglucinol	diacetlyphloroglucinol	NOUN
finefocus-4313	33	19	(	(	PUNCT
finefocus-4313	33	20	phl	phl	NOUN
finefocus-4313	33	21	)	)	PUNCT
finefocus-4313	33	22	as	as	SCONJ
finefocus-4313	33	23	it	it	PRON
finefocus-4313	33	24	concerns	concern	VERB
finefocus-4313	33	25	the	the	DET
finefocus-4313	33	26	diseases	disease	NOUN
finefocus-4313	33	27	of	of	ADP
finefocus-4313	33	28	wheat	wheat	NOUN
finefocus-4313	33	29	while	while	SCONJ
finefocus-4313	33	30	darabpour	darabpour	PROPN
finefocus-4313	33	31	et	et	PROPN
finefocus-4313	33	32	al	al	PROPN
finefocus-4313	33	33	.	.	PROPN
finefocus-4313	34	1	(	(	PUNCT
finefocus-4313	34	2	2010	2010	NUM
finefocus-4313	34	3	)	)	PUNCT
finefocus-4313	34	4	described	describe	VERB
finefocus-4313	34	5	a	a	DET
finefocus-4313	34	6	p.	p.	NOUN
finefocus-4313	34	7	aeruginosa	aeruginosa	PROPN
finefocus-4313	34	8	strain	strain	PROPN
finefocus-4313	34	9	pg-01	pg-01	ADV
finefocus-4313	34	10	isolated	isolate	VERB
finefocus-4313	34	11	from	from	ADP
finefocus-4313	34	12	the	the	DET
finefocus-4313	34	13	persian	persian	PROPN
finefocus-4313	34	14	gulf	gulf	PROPN
finefocus-4313	34	15	.	.	PUNCT
finefocus-4313	35	1	the	the	DET
finefocus-4313	35	2	maximum	maximum	PROPN
finefocus-4313	35	3	zone	zone	NOUN
finefocus-4313	35	4	of	of	ADP
finefocus-4313	35	5	inhibition	inhibition	NOUN
finefocus-4313	35	6	observed	observe	VERB
finefocus-4313	35	7	was	be	AUX
finefocus-4313	35	8	33	33	NUM
finefocus-4313	35	9	mm	mm	NOUN
finefocus-4313	35	10	in	in	ADP
finefocus-4313	35	11	a	a	DET
finefocus-4313	35	12	culture	culture	NOUN
finefocus-4313	35	13	of	of	ADP
finefocus-4313	35	14	methicillin	methicillin	NOUN
finefocus-4313	35	15	-	-	PUNCT
finefocus-4313	35	16	resistant	resistant	ADJ
finefocus-4313	35	17	staphylococcus	staphylococcus	NOUN
finefocus-4313	35	18	aureus	aureus	NOUN
finefocus-4313	35	19	(	(	PUNCT
finefocus-4313	35	20	mrsa	mrsa	NOUN
finefocus-4313	35	21	)	)	PUNCT
finefocus-4313	35	22	.	.	PUNCT
finefocus-4313	36	1	the	the	DET
finefocus-4313	36	2	possible	possible	ADJ
finefocus-4313	36	3	pseudomonas	pseudomona	NOUN
finefocus-4313	36	4	spp	spp	NOUN
finefocus-4313	36	5	.	.	PUNCT
finefocus-4313	36	6	responsible	responsible	ADJ
finefocus-4313	36	7	for	for	ADP
finefocus-4313	36	8	producing	produce	VERB
finefocus-4313	36	9	“	"	PUNCT
finefocus-4313	36	10	anietocin	anietocin	NOUN
finefocus-4313	36	11	”	"	PUNCT
finefocus-4313	36	12	was	be	AUX
finefocus-4313	36	13	isolated	isolate	VERB
finefocus-4313	36	14	from	from	ADP
finefocus-4313	36	15	a	a	DET
finefocus-4313	36	16	soil	soil	NOUN
finefocus-4313	36	17	sample	sample	NOUN
finefocus-4313	36	18	,	,	PUNCT
finefocus-4313	36	19	and	and	CCONJ
finefocus-4313	36	20	we	we	PRON
finefocus-4313	36	21	hereby	hereby	ADV
finefocus-4313	36	22	present	present	VERB
finefocus-4313	36	23	the	the	DET
finefocus-4313	36	24	preliminary	preliminary	ADJ
finefocus-4313	36	25	results	result	NOUN
finefocus-4313	36	26	obtained	obtain	VERB
finefocus-4313	36	27	with	with	ADP
finefocus-4313	36	28	the	the	DET
finefocus-4313	36	29	raw	raw	ADJ
finefocus-4313	36	30	extracts	extract	NOUN
finefocus-4313	36	31	of	of	ADP
finefocus-4313	36	32	this	this	DET
finefocus-4313	36	33	novel	novel	ADJ
finefocus-4313	36	34	antimicrobial	antimicrobial	ADJ
finefocus-4313	36	35	compound	compound	NOUN
finefocus-4313	36	36	on	on	ADP
finefocus-4313	36	37	safe	safe	ADJ
finefocus-4313	36	38	eskape	eskape	NOUN
finefocus-4313	36	39	relatives	relative	NOUN
finefocus-4313	36	40	and	and	CCONJ
finefocus-4313	36	41	klebsiella	klebsiella	NOUN
finefocus-4313	36	42	pneumoniae	pneumoniae	NOUN
finefocus-4313	36	43	.	.	PUNCT
finefocus-4313	37	1	materials	material	NOUN
finefocus-4313	37	2	and	and	CCONJ
finefocus-4313	37	3	methods	method	NOUN
finefocus-4313	37	4	unless	unless	SCONJ
finefocus-4313	37	5	otherwise	otherwise	ADV
finefocus-4313	37	6	stated	state	VERB
finefocus-4313	37	7	,	,	PUNCT
finefocus-4313	37	8	all	all	DET
finefocus-4313	37	9	methods	method	NOUN
finefocus-4313	37	10	used	use	VERB
finefocus-4313	37	11	were	be	AUX
finefocus-4313	37	12	adapted	adapt	VERB
finefocus-4313	37	13	with	with	ADP
finefocus-4313	37	14	minor	minor	ADJ
finefocus-4313	37	15	modifications	modification	NOUN
finefocus-4313	37	16	from	from	ADP
finefocus-4313	37	17	the	the	DET
finefocus-4313	37	18	small	small	ADJ
finefocus-4313	37	19	world	world	PROPN
finefocus-4313	37	20	initiative	initiative	NOUN
finefocus-4313	37	21	research	research	PROPN
finefocus-4313	37	22	protocols	protocol	NOUN
finefocus-4313	37	23	(	(	PUNCT
finefocus-4313	37	24	4th	4th	ADJ
finefocus-4313	37	25	edition	edition	NOUN
finefocus-4313	37	26	)	)	PUNCT
finefocus-4313	37	27	by	by	ADP
finefocus-4313	37	28	broderick	broderick	PROPN
finefocus-4313	37	29	and	and	CCONJ
finefocus-4313	37	30	kurt	kurt	PROPN
finefocus-4313	37	31	(	(	PUNCT
finefocus-4313	37	32	2016	2016	NUM
finefocus-4313	37	33	)	)	PUNCT
finefocus-4313	37	34	soil	soil	NOUN
finefocus-4313	37	35	sample	sample	NOUN
finefocus-4313	37	36	soil	soil	NOUN
finefocus-4313	37	37	samples	sample	NOUN
finefocus-4313	37	38	were	be	AUX
finefocus-4313	37	39	collected	collect	VERB
finefocus-4313	37	40	in	in	ADP
finefocus-4313	37	41	resealable	resealable	ADJ
finefocus-4313	37	42	bags	bag	NOUN
finefocus-4313	37	43	from	from	ADP
finefocus-4313	37	44	different	different	ADJ
finefocus-4313	37	45	locations	location	NOUN
finefocus-4313	37	46	across	across	ADP
finefocus-4313	37	47	the	the	DET
finefocus-4313	37	48	rio	rio	NOUN
finefocus-4313	37	49	grande	grande	PROPN
finefocus-4313	37	50	valley	valley	PROPN
finefocus-4313	37	51	of	of	ADP
finefocus-4313	37	52	texas	texas	PROPN
finefocus-4313	37	53	with	with	ADP
finefocus-4313	37	54	particular	particular	ADJ
finefocus-4313	37	55	focus	focus	NOUN
finefocus-4313	37	56	in	in	ADP
finefocus-4313	37	57	hidalgo	hidalgo	PROPN
finefocus-4313	37	58	county	county	PROPN
finefocus-4313	37	59	.	.	PUNCT
finefocus-4313	38	1	the	the	DET
finefocus-4313	38	2	target	target	NOUN
finefocus-4313	38	3	soil	soil	NOUN
finefocus-4313	38	4	samples	sample	NOUN
finefocus-4313	38	5	were	be	AUX
finefocus-4313	38	6	from	from	ADP
finefocus-4313	38	7	the	the	DET
finefocus-4313	38	8	topsoil	topsoil	NOUN
finefocus-4313	38	9	where	where	SCONJ
finefocus-4313	38	10	organic	organic	ADJ
finefocus-4313	38	11	matter	matter	NOUN
finefocus-4313	38	12	is	be	AUX
finefocus-4313	38	13	the	the	DET
finefocus-4313	38	14	most	most	ADV
finefocus-4313	38	15	abundant	abundant	ADJ
finefocus-4313	38	16	.	.	PUNCT
finefocus-4313	39	1	a	a	DET
finefocus-4313	39	2	soil	soil	NOUN
finefocus-4313	39	3	sample	sample	NOUN
finefocus-4313	39	4	data	datum	NOUN
finefocus-4313	39	5	collection	collection	NOUN
finefocus-4313	39	6	sheet	sheet	NOUN
finefocus-4313	39	7	as	as	SCONJ
finefocus-4313	39	8	designed	design	VERB
finefocus-4313	39	9	by	by	ADP
finefocus-4313	39	10	the	the	DET
finefocus-4313	39	11	small	small	ADJ
finefocus-4313	39	12	world	world	NOUN
finefocus-4313	39	13	initiative	initiative	NOUN
finefocus-4313	39	14	(	(	PUNCT
finefocus-4313	39	15	http://	http://	PROPN
finefocus-4313	39	16	www.smallworldinitiative.org/	www.smallworldinitiative.org/	X
finefocus-4313	39	17	)	)	PUNCT
finefocus-4313	39	18	was	be	AUX
finefocus-4313	39	19	used	use	VERB
finefocus-4313	39	20	to	to	PART
finefocus-4313	39	21	document	document	VERB
finefocus-4313	39	22	the	the	DET
finefocus-4313	39	23	characteristics	characteristic	NOUN
finefocus-4313	39	24	of	of	ADP
finefocus-4313	39	25	the	the	DET
finefocus-4313	39	26	collected	collect	VERB
finefocus-4313	39	27	sample	sample	NOUN
finefocus-4313	39	28	which	which	PRON
finefocus-4313	39	29	included	include	VERB
finefocus-4313	39	30	the	the	DET
finefocus-4313	39	31	general	general	ADJ
finefocus-4313	39	32	location	location	NOUN
finefocus-4313	39	33	,	,	PUNCT
finefocus-4313	39	34	gps	gps	PROPN
finefocus-4313	39	35	coordinates	coordinate	NOUN
finefocus-4313	39	36	,	,	PUNCT
finefocus-4313	39	37	dates	date	NOUN
finefocus-4313	39	38	and	and	CCONJ
finefocus-4313	39	39	times	time	NOUN
finefocus-4313	39	40	collected	collect	VERB
finefocus-4313	39	41	,	,	PUNCT
finefocus-4313	39	42	sample	sample	NOUN
finefocus-4313	39	43	site	site	NOUN
finefocus-4313	39	44	descriptors	descriptor	NOUN
finefocus-4313	39	45	,	,	PUNCT
finefocus-4313	39	46	air	air	NOUN
finefocus-4313	39	47	temperature	temperature	NOUN
finefocus-4313	39	48	in	in	ADP
finefocus-4313	39	49	celsius	celsius	NOUN
finefocus-4313	39	50	,	,	PUNCT
finefocus-4313	39	51	humidity	humidity	NOUN
finefocus-4313	39	52	,	,	PUNCT
finefocus-4313	39	53	depth	depth	NOUN
finefocus-4313	39	54	,	,	PUNCT
finefocus-4313	39	55	type	type	NOUN
finefocus-4313	39	56	of	of	ADP
finefocus-4313	39	57	soil	soil	NOUN
finefocus-4313	39	58	,	,	PUNCT
finefocus-4313	39	59	soil	soil	NOUN
finefocus-4313	39	60	temperature	temperature	NOUN
finefocus-4313	39	61	,	,	PUNCT
finefocus-4313	39	62	ph	ph	NOUN
finefocus-4313	39	63	of	of	ADP
finefocus-4313	39	64	soil	soil	NOUN
finefocus-4313	39	65	,	,	PUNCT
finefocus-4313	39	66	soil	soil	NOUN
finefocus-4313	39	67	water	water	NOUN
finefocus-4313	39	68	vol	vol	NOUN
finefocus-4313	39	69	9	9	NUM
finefocus-4313	39	70	|	|	ADV
finefocus-4313	39	71	101	101	NUM
finefocus-4313	39	72	content	content	NOUN
finefocus-4313	39	73	etc	etc	X
finefocus-4313	39	74	.	.	X
finefocus-4313	40	1	soil	soil	NOUN
finefocus-4313	40	2	samples	sample	NOUN
finefocus-4313	40	3	were	be	AUX
finefocus-4313	40	4	kept	keep	VERB
finefocus-4313	40	5	at	at	ADP
finefocus-4313	40	6	room	room	NOUN
finefocus-4313	40	7	temperature	temperature	NOUN
finefocus-4313	40	8	and	and	CCONJ
finefocus-4313	40	9	processed	process	VERB
finefocus-4313	40	10	within	within	ADP
finefocus-4313	40	11	72	72	NUM
finefocus-4313	40	12	hours	hour	NOUN
finefocus-4313	40	13	of	of	ADP
finefocus-4313	40	14	collection	collection	NOUN
finefocus-4313	40	15	.	.	PUNCT
finefocus-4313	41	1	broth	broth	ADJ
finefocus-4313	41	2	culture	culture	NOUN
finefocus-4313	41	3	preparation	preparation	NOUN
finefocus-4313	41	4	0.1	0.1	NUM
finefocus-4313	41	5	g	g	NOUN
finefocus-4313	41	6	of	of	ADP
finefocus-4313	41	7	each	each	DET
finefocus-4313	41	8	collected	collect	VERB
finefocus-4313	41	9	soil	soil	NOUN
finefocus-4313	41	10	sample	sample	NOUN
finefocus-4313	41	11	was	be	AUX
finefocus-4313	41	12	aseptically	aseptically	ADV
finefocus-4313	41	13	added	add	VERB
finefocus-4313	41	14	to	to	ADP
finefocus-4313	41	15	10	10	NUM
finefocus-4313	41	16	ml	ml	NOUN
finefocus-4313	41	17	of	of	ADP
finefocus-4313	41	18	sterilized	sterilize	VERB
finefocus-4313	41	19	tryptic	tryptic	ADJ
finefocus-4313	41	20	soy	soy	NOUN
finefocus-4313	41	21	broth	broth	NOUN
finefocus-4313	41	22	(	(	PUNCT
finefocus-4313	41	23	tsb	tsb	PROPN
finefocus-4313	41	24	,	,	PUNCT
finefocus-4313	41	25	bd	bd	PROPN
finefocus-4313	41	26	bdl	bdl	PROPN
finefocus-4313	41	27	,	,	PUNCT
finefocus-4313	41	28	9046995	9046995	NUM
finefocus-4313	41	29	,	,	PUNCT
finefocus-4313	41	30	sparks	spark	VERB
finefocus-4313	41	31	md	md	PROPN
finefocus-4313	41	32	)	)	PUNCT
finefocus-4313	41	33	.	.	PUNCT
finefocus-4313	42	1	this	this	PRON
finefocus-4313	42	2	was	be	AUX
finefocus-4313	42	3	thoroughly	thoroughly	ADV
finefocus-4313	42	4	mixed	mixed	ADJ
finefocus-4313	42	5	using	use	VERB
finefocus-4313	42	6	a	a	DET
finefocus-4313	42	7	bench	bench	NOUN
finefocus-4313	42	8	top	top	ADJ
finefocus-4313	42	9	vortex	vortex	NOUN
finefocus-4313	42	10	machine	machine	NOUN
finefocus-4313	42	11	,	,	PUNCT
finefocus-4313	42	12	and	and	CCONJ
finefocus-4313	42	13	thereafter	thereafter	ADV
finefocus-4313	42	14	0.1	0.1	NUM
finefocus-4313	42	15	ml	ml	NOUN
finefocus-4313	42	16	of	of	ADP
finefocus-4313	42	17	this	this	DET
finefocus-4313	42	18	mix	mix	NOUN
finefocus-4313	42	19	was	be	AUX
finefocus-4313	42	20	used	use	VERB
finefocus-4313	42	21	to	to	PART
finefocus-4313	42	22	inoculate	inoculate	VERB
finefocus-4313	42	23	another	another	DET
finefocus-4313	42	24	9.9	9.9	NUM
finefocus-4313	42	25	ml	ml	NOUN
finefocus-4313	42	26	of	of	ADP
finefocus-4313	42	27	tsb	tsb	NOUN
finefocus-4313	42	28	to	to	PART
finefocus-4313	42	29	bring	bring	VERB
finefocus-4313	42	30	the	the	DET
finefocus-4313	42	31	final	final	ADJ
finefocus-4313	42	32	dilution	dilution	NOUN
finefocus-4313	42	33	to	to	ADP
finefocus-4313	42	34	10	10	NUM
finefocus-4313	42	35	̄3	̄3	NOUN
finefocus-4313	42	36	.	.	PUNCT
finefocus-4313	43	1	the	the	DET
finefocus-4313	43	2	broth	broth	ADJ
finefocus-4313	43	3	cultures	culture	NOUN
finefocus-4313	43	4	were	be	AUX
finefocus-4313	43	5	incubated	incubate	VERB
finefocus-4313	43	6	at	at	ADP
finefocus-4313	43	7	37	37	NUM
finefocus-4313	43	8	°	°	ADP
finefocus-4313	43	9	c	c	NOUN
finefocus-4313	43	10	between	between	ADP
finefocus-4313	43	11	18	18	NUM
finefocus-4313	43	12	-	-	SYM
finefocus-4313	43	13	24	24	NUM
finefocus-4313	43	14	hours	hour	NOUN
finefocus-4313	43	15	.	.	PUNCT
finefocus-4313	44	1	solid	solid	ADJ
finefocus-4313	44	2	media	medium	NOUN
finefocus-4313	44	3	plating	plating	NOUN
finefocus-4313	44	4	10	10	NUM
finefocus-4313	44	5	μl	μl	ADP
finefocus-4313	44	6	of	of	ADP
finefocus-4313	44	7	the	the	DET
finefocus-4313	44	8	10	10	NUM
finefocus-4313	44	9	̄3	̄3	PRON
finefocus-4313	44	10	dilution	dilution	NOUN
finefocus-4313	44	11	was	be	AUX
finefocus-4313	44	12	taken	take	VERB
finefocus-4313	44	13	and	and	CCONJ
finefocus-4313	44	14	diluted	dilute	VERB
finefocus-4313	44	15	in	in	ADP
finefocus-4313	44	16	90	90	NUM
finefocus-4313	44	17	μl	μl	ADP
finefocus-4313	44	18	of	of	ADP
finefocus-4313	44	19	freshly	freshly	ADV
finefocus-4313	44	20	prepared	prepare	VERB
finefocus-4313	44	21	tsb	tsb	ADJ
finefocus-4313	44	22	broth	broth	NOUN
finefocus-4313	44	23	and	and	CCONJ
finefocus-4313	44	24	a	a	DET
finefocus-4313	44	25	final	final	ADJ
finefocus-4313	44	26	100	100	NUM
finefocus-4313	44	27	μl	μl	ADP
finefocus-4313	44	28	of	of	ADP
finefocus-4313	44	29	this	this	DET
finefocus-4313	44	30	dilution	dilution	NOUN
finefocus-4313	44	31	was	be	AUX
finefocus-4313	44	32	taken	take	VERB
finefocus-4313	44	33	and	and	CCONJ
finefocus-4313	44	34	then	then	ADV
finefocus-4313	44	35	spread	spread	VERB
finefocus-4313	44	36	plated	plate	VERB
finefocus-4313	44	37	on	on	ADP
finefocus-4313	44	38	tryptic	tryptic	ADJ
finefocus-4313	44	39	soy	soy	NOUN
finefocus-4313	44	40	agar	agar	NOUN
finefocus-4313	44	41	plates	plate	NOUN
finefocus-4313	44	42	(	(	PUNCT
finefocus-4313	44	43	tsa	tsa	PROPN
finefocus-4313	44	44	,	,	PUNCT
finefocus-4313	44	45	becton	becton	PROPN
finefocus-4313	44	46	dickinson	dickinson	PROPN
finefocus-4313	44	47	bdl	bdl	PROPN
finefocus-4313	44	48	,	,	PUNCT
finefocus-4313	44	49	8346803	8346803	NUM
finefocus-4313	44	50	,	,	PUNCT
finefocus-4313	44	51	spars	spar	VERB
finefocus-4313	44	52	md	md	NOUN
finefocus-4313	44	53	)	)	PUNCT
finefocus-4313	44	54	prepared	prepare	VERB
finefocus-4313	44	55	with	with	ADP
finefocus-4313	44	56	25	25	NUM
finefocus-4313	44	57	μg	μg	NOUN
finefocus-4313	44	58	/	/	SYM
finefocus-4313	44	59	ml	ml	NOUN
finefocus-4313	44	60	of	of	ADP
finefocus-4313	44	61	95	95	NUM
finefocus-4313	44	62	%	%	NOUN
finefocus-4313	44	63	cycloheximide	cycloheximide	NOUN
finefocus-4313	44	64	(	(	PUNCT
finefocus-4313	44	65	acros	acros	PROPN
finefocus-4313	44	66	organics	organic	NOUN
finefocus-4313	44	67	,	,	PUNCT
finefocus-4313	44	68	a0411477	a0411477	PROPN
finefocus-4313	44	69	,	,	PUNCT
finefocus-4313	44	70	china	china	PROPN
finefocus-4313	44	71	)	)	PUNCT
finefocus-4313	44	72	to	to	PART
finefocus-4313	44	73	prevent	prevent	VERB
finefocus-4313	44	74	fungal	fungal	ADJ
finefocus-4313	44	75	growth	growth	NOUN
finefocus-4313	44	76	.	.	PUNCT
finefocus-4313	45	1	the	the	DET
finefocus-4313	45	2	plates	plate	NOUN
finefocus-4313	45	3	were	be	AUX
finefocus-4313	45	4	incubated	incubate	VERB
finefocus-4313	45	5	at	at	ADP
finefocus-4313	45	6	37	37	NUM
finefocus-4313	45	7	°	°	NOUN
finefocus-4313	45	8	c	c	NOUN
finefocus-4313	45	9	for	for	ADP
finefocus-4313	45	10	24	24	NUM
finefocus-4313	45	11	-	-	SYM
finefocus-4313	45	12	48	48	NUM
finefocus-4313	45	13	hours	hour	NOUN
finefocus-4313	45	14	.	.	PUNCT
finefocus-4313	46	1	colony	colony	NOUN
finefocus-4313	46	2	selection	selection	NOUN
finefocus-4313	46	3	after	after	ADP
finefocus-4313	46	4	24	24	NUM
finefocus-4313	46	5	-	-	SYM
finefocus-4313	46	6	48	48	NUM
finefocus-4313	46	7	hours	hour	NOUN
finefocus-4313	46	8	,	,	PUNCT
finefocus-4313	46	9	the	the	DET
finefocus-4313	46	10	incubated	incubate	VERB
finefocus-4313	46	11	plates	plate	NOUN
finefocus-4313	46	12	were	be	AUX
finefocus-4313	46	13	observed	observe	VERB
finefocus-4313	46	14	for	for	ADP
finefocus-4313	46	15	the	the	DET
finefocus-4313	46	16	formation	formation	NOUN
finefocus-4313	46	17	of	of	ADP
finefocus-4313	46	18	bacterial	bacterial	ADJ
finefocus-4313	46	19	colonies	colony	NOUN
finefocus-4313	46	20	,	,	PUNCT
finefocus-4313	46	21	with	with	ADP
finefocus-4313	46	22	particular	particular	ADJ
finefocus-4313	46	23	attention	attention	NOUN
finefocus-4313	46	24	paid	pay	VERB
finefocus-4313	46	25	to	to	ADP
finefocus-4313	46	26	single	single	ADJ
finefocus-4313	46	27	colonies	colony	NOUN
finefocus-4313	46	28	with	with	ADP
finefocus-4313	46	29	unique	unique	ADJ
finefocus-4313	46	30	characteristics	characteristic	NOUN
finefocus-4313	46	31	such	such	ADJ
finefocus-4313	46	32	as	as	ADP
finefocus-4313	46	33	size	size	NOUN
finefocus-4313	46	34	,	,	PUNCT
finefocus-4313	46	35	color	color	NOUN
finefocus-4313	46	36	,	,	PUNCT
finefocus-4313	46	37	smooth	smooth	ADJ
finefocus-4313	46	38	antimicrobial	antimicrobial	ADJ
finefocus-4313	46	39	compounds	compound	NOUN
finefocus-4313	46	40	production	production	NOUN
finefocus-4313	46	41	test	test	NOUN
finefocus-4313	46	42	the	the	DET
finefocus-4313	46	43	isolated	isolated	ADJ
finefocus-4313	46	44	pure	pure	ADJ
finefocus-4313	46	45	colonies	colony	NOUN
finefocus-4313	46	46	were	be	AUX
finefocus-4313	46	47	collectively	collectively	ADV
finefocus-4313	46	48	spotted	spot	VERB
finefocus-4313	46	49	grid	grid	NOUN
finefocus-4313	46	50	style	style	NOUN
finefocus-4313	46	51	using	use	VERB
finefocus-4313	46	52	sterile	sterile	ADJ
finefocus-4313	46	53	toothpicks	toothpick	NOUN
finefocus-4313	46	54	on	on	ADP
finefocus-4313	46	55	prepared	prepared	ADJ
finefocus-4313	46	56	tsa	tsa	NOUN
finefocus-4313	46	57	plates	plate	NOUN
finefocus-4313	46	58	of	of	ADP
finefocus-4313	46	59	cultures	culture	NOUN
finefocus-4313	46	60	of	of	ADP
finefocus-4313	46	61	safe	safe	ADJ
finefocus-4313	46	62	eskape	eskape	NOUN
finefocus-4313	46	63	relatives	relative	NOUN
finefocus-4313	46	64	and	and	CCONJ
finefocus-4313	46	65	k.	k.	NOUN
finefocus-4313	46	66	pneumoniae	pneumoniae	PROPN
finefocus-4313	46	67	.	.	PUNCT
finefocus-4313	47	1	the	the	DET
finefocus-4313	47	2	plates	plate	NOUN
finefocus-4313	47	3	previously	previously	ADV
finefocus-4313	47	4	described	describe	VERB
finefocus-4313	47	5	were	be	AUX
finefocus-4313	47	6	prepared	prepare	VERB
finefocus-4313	47	7	using	use	VERB
finefocus-4313	47	8	freezer	freezer	NOUN
finefocus-4313	47	9	stocks	stock	NOUN
finefocus-4313	47	10	of	of	ADP
finefocus-4313	47	11	eskape	eskape	NOUN
finefocus-4313	47	12	relatives	relative	NOUN
finefocus-4313	47	13	and	and	CCONJ
finefocus-4313	47	14	k.	k.	NOUN
finefocus-4313	47	15	pneumoniae	pneumoniae	PROPN
finefocus-4313	47	16	,	,	PUNCT
finefocus-4313	47	17	where	where	SCONJ
finefocus-4313	47	18	single	single	ADJ
finefocus-4313	47	19	colonies	colony	NOUN
finefocus-4313	47	20	were	be	AUX
finefocus-4313	47	21	re	re	VERB
finefocus-4313	47	22	-	-	VERB
finefocus-4313	47	23	inoculated	inoculate	VERB
finefocus-4313	47	24	into	into	ADP
finefocus-4313	47	25	fresh	fresh	ADJ
finefocus-4313	47	26	broths	broth	NOUN
finefocus-4313	47	27	before	before	ADP
finefocus-4313	47	28	being	be	AUX
finefocus-4313	47	29	transferred	transfer	VERB
finefocus-4313	47	30	onto	onto	ADP
finefocus-4313	47	31	tsa	tsa	NOUN
finefocus-4313	47	32	plates	plate	NOUN
finefocus-4313	47	33	using	use	VERB
finefocus-4313	47	34	the	the	DET
finefocus-4313	47	35	spread	spread	ADJ
finefocus-4313	47	36	plating	plating	NOUN
finefocus-4313	47	37	techniques	technique	NOUN
finefocus-4313	47	38	.	.	PUNCT
finefocus-4313	48	1	these	these	DET
finefocus-4313	48	2	plates	plate	NOUN
finefocus-4313	48	3	were	be	AUX
finefocus-4313	48	4	spotted	spot	VERB
finefocus-4313	48	5	with	with	ADP
finefocus-4313	48	6	the	the	DET
finefocus-4313	48	7	suspected	suspect	VERB
finefocus-4313	48	8	antimicrobial	antimicrobial	ADJ
finefocus-4313	48	9	compounds	compound	NOUN
finefocus-4313	48	10	producing	produce	VERB
finefocus-4313	48	11	soil	soil	NOUN
finefocus-4313	48	12	isolates	isolate	NOUN
finefocus-4313	48	13	and	and	CCONJ
finefocus-4313	48	14	incubated	incubate	VERB
finefocus-4313	48	15	at	at	ADP
finefocus-4313	48	16	37	37	NUM
finefocus-4313	48	17	°	°	ADP
finefocus-4313	48	18	c	c	NOUN
finefocus-4313	48	19	for	for	ADP
finefocus-4313	48	20	24	24	NUM
finefocus-4313	48	21	-	-	SYM
finefocus-4313	48	22	48	48	NUM
finefocus-4313	48	23	hours	hour	NOUN
finefocus-4313	48	24	thereafter	thereafter	ADV
finefocus-4313	48	25	they	they	PRON
finefocus-4313	48	26	were	be	AUX
finefocus-4313	48	27	removed	remove	VERB
finefocus-4313	48	28	and	and	CCONJ
finefocus-4313	48	29	observed	observe	VERB
finefocus-4313	48	30	for	for	ADP
finefocus-4313	48	31	any	any	DET
finefocus-4313	48	32	noticeable	noticeable	ADJ
finefocus-4313	48	33	zones	zone	NOUN
finefocus-4313	48	34	of	of	ADP
finefocus-4313	48	35	inhibitions	inhibition	NOUN
finefocus-4313	48	36	.	.	PUNCT
finefocus-4313	49	1	antimicrobial	antimicrobial	ADJ
finefocus-4313	49	2	compound	compound	NOUN
finefocus-4313	49	3	screening	screen	VERB
finefocus-4313	49	4	the	the	DET
finefocus-4313	49	5	isolated	isolate	VERB
finefocus-4313	49	6	colonies	colony	NOUN
finefocus-4313	49	7	that	that	PRON
finefocus-4313	49	8	showed	show	VERB
finefocus-4313	49	9	noticeable	noticeable	ADJ
finefocus-4313	49	10	zones	zone	NOUN
finefocus-4313	49	11	of	of	ADP
finefocus-4313	49	12	inhibition	inhibition	NOUN
finefocus-4313	49	13	in	in	ADP
finefocus-4313	49	14	the	the	DET
finefocus-4313	49	15	antimicrobial	antimicrobial	ADJ
finefocus-4313	49	16	compounds	compound	NOUN
finefocus-4313	49	17	production	production	NOUN
finefocus-4313	49	18	tests	test	NOUN
finefocus-4313	49	19	previously	previously	ADV
finefocus-4313	49	20	described	describe	VERB
finefocus-4313	49	21	were	be	AUX
finefocus-4313	49	22	individually	individually	ADV
finefocus-4313	49	23	spotted	spot	VERB
finefocus-4313	49	24	on	on	ADP
finefocus-4313	49	25	prepared	prepared	ADJ
finefocus-4313	49	26	plates	plate	NOUN
finefocus-4313	49	27	of	of	ADP
finefocus-4313	49	28	cultures	culture	NOUN
finefocus-4313	49	29	of	of	ADP
finefocus-4313	49	30	safe	safe	ADJ
finefocus-4313	49	31	eskape	eskape	NOUN
finefocus-4313	49	32	relatives	relative	NOUN
finefocus-4313	49	33	and	and	CCONJ
finefocus-4313	49	34	k.	k.	NOUN
finefocus-4313	49	35	pneumoniae	pneumoniae	NOUN
finefocus-4313	49	36	and	and	CCONJ
finefocus-4313	49	37	incubated	incubate	VERB
finefocus-4313	49	38	as	as	SCONJ
finefocus-4313	49	39	previously	previously	ADV
finefocus-4313	49	40	described	describe	VERB
finefocus-4313	49	41	.	.	PUNCT
finefocus-4313	50	1	the	the	DET
finefocus-4313	50	2	plates	plate	NOUN
finefocus-4313	50	3	were	be	AUX
finefocus-4313	50	4	once	once	ADV
finefocus-4313	50	5	again	again	ADV
finefocus-4313	50	6	screened	screen	VERB
finefocus-4313	50	7	for	for	ADP
finefocus-4313	50	8	evidence	evidence	NOUN
finefocus-4313	50	9	of	of	ADP
finefocus-4313	50	10	antimicrobial	antimicrobial	ADJ
finefocus-4313	50	11	activity	activity	NOUN
finefocus-4313	50	12	by	by	ADP
finefocus-4313	50	13	looking	look	VERB
finefocus-4313	50	14	for	for	ADP
finefocus-4313	50	15	evidence	evidence	NOUN
finefocus-4313	50	16	of	of	ADP
finefocus-4313	50	17	“	"	PUNCT
finefocus-4313	50	18	zones	zone	NOUN
finefocus-4313	50	19	of	of	ADP
finefocus-4313	50	20	inhibition	inhibition	NOUN
finefocus-4313	50	21	”	"	PUNCT
finefocus-4313	50	22	–	–	PUNCT
finefocus-4313	50	23	a	a	DET
finefocus-4313	50	24	clearing	clearing	NOUN
finefocus-4313	50	25	on	on	ADP
finefocus-4313	50	26	the	the	DET
finefocus-4313	50	27	bacterial	bacterial	ADJ
finefocus-4313	50	28	lawn	lawn	NOUN
finefocus-4313	50	29	where	where	SCONJ
finefocus-4313	50	30	the	the	DET
finefocus-4313	50	31	isolates	isolate	NOUN
finefocus-4313	50	32	were	be	AUX
finefocus-4313	50	33	spotted	spot	VERB
finefocus-4313	50	34	using	use	VERB
finefocus-4313	50	35	sterile	sterile	ADJ
finefocus-4313	50	36	toothpicks	toothpick	NOUN
finefocus-4313	50	37	.	.	PUNCT
finefocus-4313	51	1	this	this	DET
finefocus-4313	51	2	procedure	procedure	NOUN
finefocus-4313	51	3	is	be	AUX
finefocus-4313	51	4	a	a	DET
finefocus-4313	51	5	confirmation	confirmation	NOUN
finefocus-4313	51	6	of	of	ADP
finefocus-4313	51	7	what	what	PRON
finefocus-4313	51	8	was	be	AUX
finefocus-4313	51	9	done	do	VERB
finefocus-4313	51	10	prior	prior	ADV
finefocus-4313	51	11	in	in	ADP
finefocus-4313	51	12	f.	f.	PROPN
finefocus-4313	51	13	dna	dna	PROPN
finefocus-4313	51	14	extraction	extraction	PROPN
finefocus-4313	51	15	,	,	PUNCT
finefocus-4313	51	16	amplification	amplification	NOUN
finefocus-4313	51	17	,	,	PUNCT
finefocus-4313	51	18	gel	gel	NOUN
finefocus-4313	51	19	electrophoresis	electrophoresis	NOUN
finefocus-4313	51	20	and	and	CCONJ
finefocus-4313	51	21	sequencing	sequence	VERB
finefocus-4313	51	22	the	the	DET
finefocus-4313	51	23	isolate	isolate	NOUN
finefocus-4313	51	24	of	of	ADP
finefocus-4313	51	25	interest	interest	NOUN
finefocus-4313	51	26	that	that	PRON
finefocus-4313	51	27	demonstrated	demonstrate	VERB
finefocus-4313	51	28	zones	zone	NOUN
finefocus-4313	51	29	of	of	ADP
finefocus-4313	51	30	inhibition	inhibition	NOUN
finefocus-4313	51	31	against	against	ADP
finefocus-4313	51	32	any	any	PRON
finefocus-4313	51	33	of	of	ADP
finefocus-4313	51	34	the	the	DET
finefocus-4313	51	35	safe	safe	ADJ
finefocus-4313	51	36	eskape	eskape	NOUN
finefocus-4313	51	37	relatives	relative	NOUN
finefocus-4313	51	38	and	and	CCONJ
finefocus-4313	51	39	other	other	ADJ
finefocus-4313	51	40	tested	test	VERB
finefocus-4313	51	41	bacteria	bacteria	NOUN
finefocus-4313	51	42	had	have	AUX
finefocus-4313	51	43	its	its	PRON
finefocus-4313	51	44	dna	dna	NOUN
finefocus-4313	51	45	extracted	extract	VERB
finefocus-4313	51	46	using	use	VERB
finefocus-4313	51	47	102	102	NUM
finefocus-4313	51	48	|	|	ADV
finefocus-4313	51	49	fine	fine	ADJ
finefocus-4313	51	50	focus	focus	NOUN
finefocus-4313	51	51	the	the	DET
finefocus-4313	51	52	zymo	zymo	NOUN
finefocus-4313	51	53	quick	quick	ADJ
finefocus-4313	51	54	-	-	PUNCT
finefocus-4313	51	55	dna	dna	NOUN
finefocus-4313	51	56	miniprep	miniprep	NOUN
finefocus-4313	51	57	plus	plus	CCONJ
finefocus-4313	51	58	kit	kit	NOUN
finefocus-4313	51	59	protocols	protocol	NOUN
finefocus-4313	51	60	(	(	PUNCT
finefocus-4313	51	61	zymoresearch	zymoresearch	PROPN
finefocus-4313	51	62	,	,	PUNCT
finefocus-4313	51	63	207601	207601	NUM
finefocus-4313	51	64	,	,	PUNCT
finefocus-4313	51	65	usa	usa	PROPN
finefocus-4313	51	66	)	)	PUNCT
finefocus-4313	51	67	.	.	PUNCT
finefocus-4313	52	1	these	these	DET
finefocus-4313	52	2	isolates	isolate	NOUN
finefocus-4313	52	3	were	be	AUX
finefocus-4313	52	4	grown	grow	VERB
finefocus-4313	52	5	in	in	ADP
finefocus-4313	52	6	tsb	tsb	ADJ
finefocus-4313	52	7	broth	broth	NOUN
finefocus-4313	52	8	overnight	overnight	ADV
finefocus-4313	52	9	at	at	ADP
finefocus-4313	52	10	37	37	NUM
finefocus-4313	52	11	°	°	NOUN
finefocus-4313	52	12	c	c	NOUN
finefocus-4313	52	13	before	before	ADP
finefocus-4313	52	14	the	the	DET
finefocus-4313	52	15	dna	dna	PROPN
finefocus-4313	52	16	isolation	isolation	NOUN
finefocus-4313	52	17	.	.	PUNCT
finefocus-4313	53	1	the	the	DET
finefocus-4313	53	2	gene	gene	NOUN
finefocus-4313	53	3	sequence	sequence	NOUN
finefocus-4313	53	4	of	of	ADP
finefocus-4313	53	5	the	the	DET
finefocus-4313	53	6	16s	16s	PROPN
finefocus-4313	53	7	rrna	rrna	PROPN
finefocus-4313	53	8	were	be	AUX
finefocus-4313	53	9	amplified	amplify	VERB
finefocus-4313	53	10	using	use	VERB
finefocus-4313	53	11	16s	16	NOUN
finefocus-4313	53	12	rrna	rrna	VERB
finefocus-4313	53	13	forward	forward	ADV
finefocus-4313	53	14	(	(	PUNCT
finefocus-4313	53	15	agagtttgatcctggctcag	agagtttgatcctggctcag	NUM
finefocus-4313	53	16	)	)	PUNCT
finefocus-4313	53	17	and	and	CCONJ
finefocus-4313	53	18	16s	16	NOUN
finefocus-4313	53	19	rrna	rrna	PROPN
finefocus-4313	53	20	reverse	reverse	NOUN
finefocus-4313	53	21	(	(	PUNCT
finefocus-4313	53	22	acggctaccttgttacgactt	acggctaccttgttacgactt	ADJ
finefocus-4313	53	23	)	)	PUNCT
finefocus-4313	53	24	sequences	sequence	NOUN
finefocus-4313	53	25	primers	primer	NOUN
finefocus-4313	53	26	(	(	PUNCT
finefocus-4313	53	27	integrated	integrate	VERB
finefocus-4313	53	28	dna	dna	PROPN
finefocus-4313	53	29	technologies	technology	NOUN
finefocus-4313	53	30	,	,	PUNCT
finefocus-4313	53	31	inc	inc	PROPN
finefocus-4313	53	32	.	.	PROPN
finefocus-4313	53	33	)	)	PUNCT
finefocus-4313	54	1	and	and	CCONJ
finefocus-4313	54	2	thereafter	thereafter	ADV
finefocus-4313	54	3	,	,	PUNCT
finefocus-4313	54	4	gel	gel	NOUN
finefocus-4313	54	5	electrophoresis	electrophoresis	NOUN
finefocus-4313	54	6	was	be	AUX
finefocus-4313	54	7	performed	perform	VERB
finefocus-4313	54	8	to	to	PART
finefocus-4313	54	9	confirm	confirm	VERB
finefocus-4313	54	10	the	the	DET
finefocus-4313	54	11	right	right	ADJ
finefocus-4313	54	12	size	size	NOUN
finefocus-4313	54	13	sequence	sequence	NOUN
finefocus-4313	54	14	at	at	ADP
finefocus-4313	54	15	approximately	approximately	ADV
finefocus-4313	54	16	1500	1500	NUM
finefocus-4313	54	17	base	base	NOUN
finefocus-4313	54	18	pairs	pair	NOUN
finefocus-4313	54	19	.	.	PUNCT
finefocus-4313	55	1	the	the	DET
finefocus-4313	55	2	amplified	amplify	VERB
finefocus-4313	55	3	gene	gene	NOUN
finefocus-4313	55	4	sequence	sequence	NOUN
finefocus-4313	55	5	was	be	AUX
finefocus-4313	55	6	cleaned	clean	VERB
finefocus-4313	55	7	up	up	ADP
finefocus-4313	55	8	using	use	VERB
finefocus-4313	55	9	the	the	DET
finefocus-4313	55	10	monarch	monarch	NOUN
finefocus-4313	55	11	pcr	pcr	PROPN
finefocus-4313	55	12	&	&	CCONJ
finefocus-4313	55	13	dna	dna	PROPN
finefocus-4313	55	14	cleanup	cleanup	NOUN
finefocus-4313	55	15	kit	kit	NOUN
finefocus-4313	55	16	(	(	PUNCT
finefocus-4313	55	17	new	new	PROPN
finefocus-4313	55	18	england	england	PROPN
finefocus-4313	55	19	biolabs	biolabs	PROPN
finefocus-4313	55	20	)	)	PUNCT
finefocus-4313	55	21	and	and	CCONJ
finefocus-4313	55	22	sequenced	sequence	VERB
finefocus-4313	55	23	for	for	ADP
finefocus-4313	55	24	identification	identification	NOUN
finefocus-4313	55	25	by	by	ADP
finefocus-4313	55	26	eurofins	eurofin	NOUN
finefocus-4313	55	27	genomics	genomic	NOUN
finefocus-4313	55	28	.	.	PUNCT
finefocus-4313	56	1	organic	organic	ADJ
finefocus-4313	56	2	extraction	extraction	NOUN
finefocus-4313	56	3	the	the	DET
finefocus-4313	56	4	antimicrobial	antimicrobial	ADJ
finefocus-4313	56	5	producing	produce	VERB
finefocus-4313	56	6	isolate	isolate	NOUN
finefocus-4313	56	7	of	of	ADP
finefocus-4313	56	8	interest	interest	NOUN
finefocus-4313	56	9	was	be	AUX
finefocus-4313	56	10	grown	grow	VERB
finefocus-4313	56	11	on	on	ADP
finefocus-4313	56	12	solid	solid	ADJ
finefocus-4313	56	13	media	medium	NOUN
finefocus-4313	56	14	and	and	CCONJ
finefocus-4313	56	15	was	be	AUX
finefocus-4313	56	16	subjected	subject	VERB
finefocus-4313	56	17	to	to	ADP
finefocus-4313	56	18	organic	organic	ADJ
finefocus-4313	56	19	extraction	extraction	NOUN
finefocus-4313	56	20	as	as	SCONJ
finefocus-4313	56	21	described	describe	VERB
finefocus-4313	56	22	in	in	ADP
finefocus-4313	56	23	the	the	DET
finefocus-4313	56	24	small	small	ADJ
finefocus-4313	56	25	world	world	PROPN
finefocus-4313	56	26	initiative	initiative	NOUN
finefocus-4313	56	27	research	research	PROPN
finefocus-4313	56	28	protocols	protocol	NOUN
finefocus-4313	56	29	(	(	PUNCT
finefocus-4313	56	30	4th	4th	ADJ
finefocus-4313	56	31	edition	edition	NOUN
finefocus-4313	56	32	)	)	PUNCT
finefocus-4313	56	33	by	by	ADP
finefocus-4313	56	34	broderick	broderick	PROPN
finefocus-4313	56	35	and	and	CCONJ
finefocus-4313	56	36	kurt	kurt	PROPN
finefocus-4313	56	37	(	(	PUNCT
finefocus-4313	56	38	2016	2016	NUM
finefocus-4313	56	39	)	)	PUNCT
finefocus-4313	56	40	.	.	PUNCT
finefocus-4313	57	1	a	a	DET
finefocus-4313	57	2	spatula	spatula	NOUN
finefocus-4313	57	3	was	be	AUX
finefocus-4313	57	4	used	use	VERB
finefocus-4313	57	5	to	to	PART
finefocus-4313	57	6	cut	cut	VERB
finefocus-4313	57	7	2	2	NUM
finefocus-4313	57	8	-	-	SYM
finefocus-4313	57	9	3	3	NUM
finefocus-4313	57	10	small	small	ADJ
finefocus-4313	57	11	pieces	piece	NOUN
finefocus-4313	57	12	of	of	ADP
finefocus-4313	57	13	agar	agar	NOUN
finefocus-4313	57	14	(	(	PUNCT
finefocus-4313	57	15	1	1	NUM
finefocus-4313	57	16	inch	inch	NOUN
finefocus-4313	57	17	square	square	NOUN
finefocus-4313	57	18	)	)	PUNCT
finefocus-4313	57	19	containing	contain	VERB
finefocus-4313	57	20	the	the	DET
finefocus-4313	57	21	antimicrobial	antimicrobial	ADJ
finefocus-4313	57	22	producing	produce	VERB
finefocus-4313	57	23	culture	culture	NOUN
finefocus-4313	57	24	isolate	isolate	NOUN
finefocus-4313	57	25	,	,	PUNCT
finefocus-4313	57	26	which	which	PRON
finefocus-4313	57	27	was	be	AUX
finefocus-4313	57	28	then	then	ADV
finefocus-4313	57	29	transferred	transfer	VERB
finefocus-4313	57	30	into	into	ADP
finefocus-4313	57	31	100	100	NUM
finefocus-4313	57	32	ml	ml	NOUN
finefocus-4313	57	33	glass	glass	NOUN
finefocus-4313	57	34	bottle	bottle	NOUN
finefocus-4313	57	35	and	and	CCONJ
finefocus-4313	57	36	placed	place	VERB
finefocus-4313	57	37	in	in	ADP
finefocus-4313	57	38	-20	-20	NUM
finefocus-4313	57	39	°	°	PROPN
finefocus-4313	57	40	c	c	NOUN
finefocus-4313	57	41	freezer	freezer	NOUN
finefocus-4313	57	42	overnight	overnight	ADV
finefocus-4313	57	43	,	,	PUNCT
finefocus-4313	57	44	this	this	DET
finefocus-4313	57	45	procedure	procedure	NOUN
finefocus-4313	57	46	was	be	AUX
finefocus-4313	57	47	replicated	replicate	VERB
finefocus-4313	57	48	multiple	multiple	ADJ
finefocus-4313	57	49	times	time	NOUN
finefocus-4313	57	50	to	to	PART
finefocus-4313	57	51	increase	increase	VERB
finefocus-4313	57	52	the	the	DET
finefocus-4313	57	53	quantity	quantity	NOUN
finefocus-4313	57	54	of	of	ADP
finefocus-4313	57	55	extract	extract	NOUN
finefocus-4313	57	56	obtained.thereafter	obtained.thereafter	ADV
finefocus-4313	57	57	,	,	PUNCT
finefocus-4313	57	58	15	15	NUM
finefocus-4313	57	59	ml	ml	NOUN
finefocus-4313	57	60	of	of	ADP
finefocus-4313	57	61	99	99	NUM
finefocus-4313	57	62	%	%	NOUN
finefocus-4313	57	63	ethyl	ethyl	PROPN
finefocus-4313	57	64	acetate	acetate	NOUN
finefocus-4313	57	65	(	(	PUNCT
finefocus-4313	57	66	flint	flint	NOUN
finefocus-4313	57	67	scientific	scientific	ADJ
finefocus-4313	57	68	,	,	PUNCT
finefocus-4313	57	69	273018	273018	NUM
finefocus-4313	57	70	,	,	PUNCT
finefocus-4313	57	71	batavia	batavia	PROPN
finefocus-4313	57	72	,	,	PUNCT
finefocus-4313	57	73	il	il	PROPN
finefocus-4313	57	74	)	)	PUNCT
finefocus-4313	57	75	and	and	CCONJ
finefocus-4313	57	76	10	10	NUM
finefocus-4313	57	77	ml	ml	NOUN
finefocus-4313	57	78	of	of	ADP
finefocus-4313	57	79	deionized	deionize	VERB
finefocus-4313	57	80	water	water	NOUN
finefocus-4313	57	81	were	be	AUX
finefocus-4313	57	82	added	add	VERB
finefocus-4313	57	83	to	to	ADP
finefocus-4313	57	84	each	each	DET
finefocus-4313	57	85	bottle	bottle	NOUN
finefocus-4313	57	86	and	and	CCONJ
finefocus-4313	57	87	shaken	shake	VERB
finefocus-4313	57	88	vigorously	vigorously	ADV
finefocus-4313	57	89	at	at	ADP
finefocus-4313	57	90	room	room	NOUN
finefocus-4313	57	91	temperature	temperature	NOUN
finefocus-4313	57	92	for	for	ADP
finefocus-4313	57	93	20	20	NUM
finefocus-4313	57	94	30	30	NUM
finefocus-4313	57	95	minutes	minute	NOUN
finefocus-4313	57	96	.	.	PUNCT
finefocus-4313	58	1	a	a	DET
finefocus-4313	58	2	pipette	pipette	NOUN
finefocus-4313	58	3	was	be	AUX
finefocus-4313	58	4	then	then	ADV
finefocus-4313	58	5	used	use	VERB
finefocus-4313	58	6	to	to	PART
finefocus-4313	58	7	transfer	transfer	VERB
finefocus-4313	58	8	the	the	DET
finefocus-4313	58	9	entire	entire	ADJ
finefocus-4313	58	10	liquid	liquid	ADJ
finefocus-4313	58	11	contents	content	NOUN
finefocus-4313	58	12	of	of	ADP
finefocus-4313	58	13	the	the	DET
finefocus-4313	58	14	bottles	bottle	NOUN
finefocus-4313	58	15	to	to	ADP
finefocus-4313	58	16	new	new	ADJ
finefocus-4313	58	17	bottles	bottle	NOUN
finefocus-4313	58	18	,	,	PUNCT
finefocus-4313	58	19	avoiding	avoid	VERB
finefocus-4313	58	20	the	the	DET
finefocus-4313	58	21	agar	agar	NOUN
finefocus-4313	58	22	debris	debris	NOUN
finefocus-4313	58	23	and	and	CCONJ
finefocus-4313	58	24	allowed	allow	VERB
finefocus-4313	58	25	to	to	PART
finefocus-4313	58	26	sit	sit	VERB
finefocus-4313	58	27	for	for	ADP
finefocus-4313	58	28	as	as	ADV
finefocus-4313	58	29	long	long	ADV
finefocus-4313	58	30	as	as	SCONJ
finefocus-4313	58	31	needed	need	VERB
finefocus-4313	58	32	for	for	SCONJ
finefocus-4313	58	33	the	the	DET
finefocus-4313	58	34	two	two	NUM
finefocus-4313	58	35	phases	phase	NOUN
finefocus-4313	58	36	to	to	PART
finefocus-4313	58	37	separate	separate	VERB
finefocus-4313	58	38	.	.	PUNCT
finefocus-4313	59	1	the	the	DET
finefocus-4313	59	2	separated	separate	VERB
finefocus-4313	59	3	ethyl	ethyl	PROPN
finefocus-4313	59	4	acetate	acetate	NOUN
finefocus-4313	59	5	layer	layer	NOUN
finefocus-4313	59	6	(	(	PUNCT
finefocus-4313	59	7	top	top	ADJ
finefocus-4313	59	8	portion	portion	NOUN
finefocus-4313	59	9	)	)	PUNCT
finefocus-4313	59	10	up	up	ADP
finefocus-4313	59	11	to	to	PART
finefocus-4313	59	12	10	10	NUM
finefocus-4313	59	13	ml	ml	NOUN
finefocus-4313	59	14	,	,	PUNCT
finefocus-4313	59	15	was	be	AUX
finefocus-4313	59	16	then	then	ADV
finefocus-4313	59	17	transferred	transfer	VERB
finefocus-4313	59	18	to	to	ADP
finefocus-4313	59	19	new	new	ADJ
finefocus-4313	59	20	bottles	bottle	NOUN
finefocus-4313	59	21	and	and	CCONJ
finefocus-4313	59	22	placed	place	VERB
finefocus-4313	59	23	without	without	ADP
finefocus-4313	59	24	caps	cap	NOUN
finefocus-4313	59	25	inside	inside	ADP
finefocus-4313	59	26	the	the	DET
finefocus-4313	59	27	fume	fume	NOUN
finefocus-4313	59	28	hood	hood	NOUN
finefocus-4313	59	29	until	until	SCONJ
finefocus-4313	59	30	all	all	DET
finefocus-4313	59	31	ethyl	ethyl	PROPN
finefocus-4313	59	32	acetate	acetate	PROPN
finefocus-4313	59	33	had	have	AUX
finefocus-4313	59	34	evaporated	evaporate	VERB
finefocus-4313	59	35	(	(	PUNCT
finefocus-4313	59	36	usually	usually	ADV
finefocus-4313	59	37	between	between	ADP
finefocus-4313	59	38	96	96	NUM
finefocus-4313	59	39	-	-	SYM
finefocus-4313	59	40	120	120	NUM
finefocus-4313	59	41	hours	hour	NOUN
finefocus-4313	59	42	)	)	PUNCT
finefocus-4313	59	43	.	.	PUNCT
finefocus-4313	60	1	after	after	SCONJ
finefocus-4313	60	2	the	the	DET
finefocus-4313	60	3	entire	entire	ADJ
finefocus-4313	60	4	ethyl	ethyl	PROPN
finefocus-4313	60	5	acetate	acetate	NOUN
finefocus-4313	60	6	had	have	AUX
finefocus-4313	60	7	evaporated	evaporate	VERB
finefocus-4313	60	8	,	,	PUNCT
finefocus-4313	60	9	leaving	leave	VERB
finefocus-4313	60	10	behind	behind	ADP
finefocus-4313	60	11	a	a	DET
finefocus-4313	60	12	white	white	ADJ
finefocus-4313	60	13	residue	residue	NOUN
finefocus-4313	60	14	hereby	hereby	ADV
finefocus-4313	60	15	referred	refer	VERB
finefocus-4313	60	16	to	to	ADP
finefocus-4313	60	17	as	as	ADP
finefocus-4313	60	18	the	the	DET
finefocus-4313	60	19	“	"	PUNCT
finefocus-4313	60	20	the	the	DET
finefocus-4313	60	21	crude	crude	ADJ
finefocus-4313	60	22	extract	extract	NOUN
finefocus-4313	60	23	”	"	PUNCT
finefocus-4313	60	24	,	,	PUNCT
finefocus-4313	60	25	the	the	DET
finefocus-4313	60	26	white	white	ADJ
finefocus-4313	60	27	residue	residue	NOUN
finefocus-4313	60	28	was	be	AUX
finefocus-4313	60	29	dissolved	dissolve	VERB
finefocus-4313	60	30	by	by	ADP
finefocus-4313	60	31	the	the	DET
finefocus-4313	60	32	addition	addition	NOUN
finefocus-4313	60	33	of	of	ADP
finefocus-4313	60	34	80	80	NUM
finefocus-4313	60	35	μl	μl	ADP
finefocus-4313	60	36	of	of	ADP
finefocus-4313	60	37	methanol	methanol	NOUN
finefocus-4313	60	38	(	(	PUNCT
finefocus-4313	60	39	vwr	vwr	PROPN
finefocus-4313	60	40	,	,	PUNCT
finefocus-4313	60	41	0000200921	0000200921	NUM
finefocus-4313	60	42	,	,	PUNCT
finefocus-4313	60	43	mississauga	mississauga	PROPN
finefocus-4313	60	44	on	on	ADP
finefocus-4313	60	45	)	)	PUNCT
finefocus-4313	60	46	in	in	ADP
finefocus-4313	60	47	each	each	DET
finefocus-4313	60	48	bottle	bottle	NOUN
finefocus-4313	60	49	and	and	CCONJ
finefocus-4313	60	50	the	the	DET
finefocus-4313	60	51	solution	solution	NOUN
finefocus-4313	60	52	kept	keep	VERB
finefocus-4313	60	53	at	at	ADP
finefocus-4313	60	54	4	4	NUM
finefocus-4313	60	55	°	°	ADP
finefocus-4313	60	56	c	c	NOUN
finefocus-4313	60	57	for	for	ADP
finefocus-4313	60	58	further	further	ADJ
finefocus-4313	60	59	use	use	NOUN
finefocus-4313	60	60	,	,	PUNCT
finefocus-4313	60	61	usually	usually	ADV
finefocus-4313	60	62	between	between	ADP
finefocus-4313	60	63	12	12	NUM
finefocus-4313	60	64	-	-	SYM
finefocus-4313	60	65	24	24	NUM
finefocus-4313	60	66	hours	hour	NOUN
finefocus-4313	60	67	after	after	ADP
finefocus-4313	60	68	extraction	extraction	NOUN
finefocus-4313	60	69	.	.	PUNCT
finefocus-4313	61	1	screening	screen	VERB
finefocus-4313	61	2	for	for	ADP
finefocus-4313	61	3	antimicrobial	antimicrobial	ADJ
finefocus-4313	61	4	activity	activity	NOUN
finefocus-4313	61	5	the	the	DET
finefocus-4313	61	6	solution	solution	NOUN
finefocus-4313	61	7	obtained	obtain	VERB
finefocus-4313	61	8	from	from	ADP
finefocus-4313	61	9	the	the	DET
finefocus-4313	61	10	organic	organic	ADJ
finefocus-4313	61	11	extraction	extraction	NOUN
finefocus-4313	61	12	(	(	PUNCT
finefocus-4313	61	13	white	white	ADJ
finefocus-4313	61	14	residues	residue	NOUN
finefocus-4313	61	15	dissolved	dissolve	VERB
finefocus-4313	61	16	in	in	ADP
finefocus-4313	61	17	the	the	DET
finefocus-4313	61	18	methanol	methanol	NOUN
finefocus-4313	61	19	)	)	PUNCT
finefocus-4313	61	20	was	be	AUX
finefocus-4313	61	21	tested	test	VERB
finefocus-4313	61	22	on	on	ADP
finefocus-4313	61	23	prepared	prepared	ADJ
finefocus-4313	61	24	plates	plate	NOUN
finefocus-4313	61	25	of	of	ADP
finefocus-4313	61	26	safe	safe	ADJ
finefocus-4313	61	27	eskape	eskape	NOUN
finefocus-4313	61	28	relatives	relative	NOUN
finefocus-4313	61	29	and	and	CCONJ
finefocus-4313	61	30	other	other	ADJ
finefocus-4313	61	31	bacteria	bacteria	NOUN
finefocus-4313	61	32	.	.	PUNCT
finefocus-4313	62	1	30	30	NUM
finefocus-4313	62	2	μl	μl	ADP
finefocus-4313	62	3	each	each	PRON
finefocus-4313	62	4	of	of	ADP
finefocus-4313	62	5	the	the	DET
finefocus-4313	62	6	solution	solution	NOUN
finefocus-4313	62	7	(	(	PUNCT
finefocus-4313	62	8	crude	crude	ADJ
finefocus-4313	62	9	extract	extract	NOUN
finefocus-4313	62	10	dissolved	dissolve	VERB
finefocus-4313	62	11	in	in	ADP
finefocus-4313	62	12	methanol	methanol	NOUN
finefocus-4313	62	13	)	)	PUNCT
finefocus-4313	62	14	was	be	AUX
finefocus-4313	62	15	dropped	drop	VERB
finefocus-4313	62	16	on	on	ADP
finefocus-4313	62	17	the	the	DET
finefocus-4313	62	18	plates	plate	NOUN
finefocus-4313	62	19	containing	contain	VERB
finefocus-4313	62	20	the	the	DET
finefocus-4313	62	21	prepared	prepare	VERB
finefocus-4313	62	22	plates	plate	NOUN
finefocus-4313	62	23	,	,	PUNCT
finefocus-4313	62	24	another	another	DET
finefocus-4313	62	25	30	30	NUM
finefocus-4313	62	26	μl	μl	NOUN
finefocus-4313	62	27	of	of	ADP
finefocus-4313	62	28	methanol	methanol	NOUN
finefocus-4313	62	29	dropped	drop	VERB
finefocus-4313	62	30	on	on	ADP
finefocus-4313	62	31	a	a	DET
finefocus-4313	62	32	different	different	ADJ
finefocus-4313	62	33	part	part	NOUN
finefocus-4313	62	34	of	of	ADP
finefocus-4313	62	35	the	the	DET
finefocus-4313	62	36	plate	plate	NOUN
finefocus-4313	62	37	as	as	ADP
finefocus-4313	62	38	negative	negative	ADJ
finefocus-4313	62	39	control	control	NOUN
finefocus-4313	62	40	and	and	CCONJ
finefocus-4313	62	41	in	in	ADP
finefocus-4313	62	42	some	some	DET
finefocus-4313	62	43	cases	case	NOUN
finefocus-4313	62	44	different	different	ADJ
finefocus-4313	62	45	antibiotics	antibiotic	NOUN
finefocus-4313	62	46	disks	disk	NOUN
finefocus-4313	62	47	(	(	PUNCT
finefocus-4313	62	48	bd	bd	PROPN
finefocus-4313	62	49	bbltm	bbltm	PROPN
finefocus-4313	62	50	,	,	PUNCT
finefocus-4313	62	51	sparks	spark	VERB
finefocus-4313	62	52	md	md	PROPN
finefocus-4313	62	53	)	)	PUNCT
finefocus-4313	62	54	were	be	AUX
finefocus-4313	62	55	tested	test	VERB
finefocus-4313	62	56	against	against	ADP
finefocus-4313	62	57	the	the	DET
finefocus-4313	62	58	solution	solution	NOUN
finefocus-4313	62	59	for	for	ADP
finefocus-4313	62	60	comparison	comparison	NOUN
finefocus-4313	62	61	.	.	PUNCT
finefocus-4313	63	1	the	the	DET
finefocus-4313	63	2	plates	plate	NOUN
finefocus-4313	63	3	were	be	AUX
finefocus-4313	63	4	incubated	incubate	VERB
finefocus-4313	63	5	at	at	ADP
finefocus-4313	63	6	37	37	NUM
finefocus-4313	63	7	°	°	NOUN
finefocus-4313	63	8	c	c	NOUN
finefocus-4313	63	9	for	for	ADP
finefocus-4313	63	10	24	24	NUM
finefocus-4313	63	11	-	-	SYM
finefocus-4313	63	12	48	48	NUM
finefocus-4313	63	13	hours	hour	NOUN
finefocus-4313	63	14	.	.	PUNCT
finefocus-4313	64	1	the	the	DET
finefocus-4313	64	2	zones	zone	NOUN
finefocus-4313	64	3	of	of	ADP
finefocus-4313	64	4	inhibition	inhibition	NOUN
finefocus-4313	64	5	produced	produce	VERB
finefocus-4313	64	6	by	by	ADP
finefocus-4313	64	7	the	the	DET
finefocus-4313	64	8	antimicrobial	antimicrobial	ADJ
finefocus-4313	64	9	compound	compound	NOUN
finefocus-4313	64	10	were	be	AUX
finefocus-4313	64	11	measured	measure	VERB
finefocus-4313	64	12	and	and	CCONJ
finefocus-4313	64	13	compared	compare	VERB
finefocus-4313	64	14	to	to	ADP
finefocus-4313	64	15	zones	zone	NOUN
finefocus-4313	64	16	of	of	ADP
finefocus-4313	64	17	inhibition	inhibition	NOUN
finefocus-4313	64	18	produced	produce	VERB
finefocus-4313	64	19	by	by	ADP
finefocus-4313	64	20	the	the	DET
finefocus-4313	64	21	antibiotic	antibiotic	ADJ
finefocus-4313	64	22	disks	disk	NOUN
finefocus-4313	64	23	.	.	PUNCT
finefocus-4313	65	1	these	these	DET
finefocus-4313	65	2	steps	step	NOUN
finefocus-4313	65	3	were	be	AUX
finefocus-4313	65	4	replicated	replicate	VERB
finefocus-4313	65	5	several	several	ADJ
finefocus-4313	65	6	times	time	NOUN
finefocus-4313	65	7	and	and	CCONJ
finefocus-4313	65	8	confirmed	confirm	VERB
finefocus-4313	65	9	reproducible	reproducible	ADJ
finefocus-4313	65	10	.	.	PUNCT
finefocus-4313	66	1	vol	vol	NOUN
finefocus-4313	66	2	9	9	NUM
finefocus-4313	66	3	|	|	CCONJ
finefocus-4313	66	4	103	103	NUM
finefocus-4313	66	5	infra	infra	NOUN
finefocus-4313	66	6	-	-	PUNCT
finefocus-4313	66	7	red	red	ADJ
finefocus-4313	66	8	spectroscopy	spectroscopy	VERB
finefocus-4313	66	9	the	the	DET
finefocus-4313	66	10	antimicrobial	antimicrobial	ADJ
finefocus-4313	66	11	compound	compound	NOUN
finefocus-4313	66	12	solution	solution	NOUN
finefocus-4313	66	13	was	be	AUX
finefocus-4313	66	14	tested	test	VERB
finefocus-4313	66	15	to	to	PART
finefocus-4313	66	16	determine	determine	VERB
finefocus-4313	66	17	the	the	DET
finefocus-4313	66	18	functional	functional	ADJ
finefocus-4313	66	19	groups	group	NOUN
finefocus-4313	66	20	in	in	ADP
finefocus-4313	66	21	the	the	DET
finefocus-4313	66	22	mixture	mixture	NOUN
finefocus-4313	66	23	using	use	VERB
finefocus-4313	66	24	the	the	DET
finefocus-4313	66	25	fourier	fourier	NOUN
finefocus-4313	66	26	transform	transform	NOUN
finefocus-4313	66	27	infrared	infrared	ADJ
finefocus-4313	66	28	spectrophotometer	spectrophotometer	NOUN
finefocus-4313	66	29	(	(	PUNCT
finefocus-4313	66	30	shimadzu	shimadzu	PROPN
finefocus-4313	66	31	)	)	PUNCT
finefocus-4313	66	32	.	.	PUNCT
finefocus-4313	67	1	resolution	resolution	NOUN
finefocus-4313	67	2	was	be	AUX
finefocus-4313	67	3	set	set	VERB
finefocus-4313	67	4	at	at	ADP
finefocus-4313	67	5	4	4	NUM
finefocus-4313	67	6	cm-1	cm-1	NOUN
finefocus-4313	67	7	and	and	CCONJ
finefocus-4313	67	8	the	the	DET
finefocus-4313	67	9	happgenzel	happgenzel	ADJ
finefocus-4313	67	10	apodization	apodization	NOUN
finefocus-4313	67	11	was	be	AUX
finefocus-4313	67	12	utilized	utilize	VERB
finefocus-4313	67	13	for	for	ADP
finefocus-4313	67	14	a	a	DET
finefocus-4313	67	15	total	total	NOUN
finefocus-4313	67	16	of	of	ADP
finefocus-4313	67	17	4	4	NUM
finefocus-4313	67	18	scans	scan	NOUN
finefocus-4313	67	19	.	.	PUNCT
finefocus-4313	68	1	results	result	NOUN
finefocus-4313	68	2	more	more	ADJ
finefocus-4313	68	3	than	than	ADP
finefocus-4313	68	4	100	100	NUM
finefocus-4313	68	5	unknown	unknown	ADJ
finefocus-4313	68	6	soil	soil	NOUN
finefocus-4313	68	7	bacteria	bacteria	NOUN
finefocus-4313	68	8	isolates	isolate	NOUN
finefocus-4313	68	9	were	be	AUX
finefocus-4313	68	10	tested	test	VERB
finefocus-4313	68	11	on	on	ADP
finefocus-4313	68	12	eskape	eskape	NOUN
finefocus-4313	68	13	relatives	relative	NOUN
finefocus-4313	68	14	for	for	ADP
finefocus-4313	68	15	the	the	DET
finefocus-4313	68	16	ability	ability	NOUN
finefocus-4313	68	17	to	to	PART
finefocus-4313	68	18	produce	produce	VERB
finefocus-4313	68	19	antimicrobial	antimicrobial	ADJ
finefocus-4313	68	20	compounds	compound	NOUN
finefocus-4313	68	21	.	.	PUNCT
finefocus-4313	69	1	among	among	ADP
finefocus-4313	69	2	them	they	PRON
finefocus-4313	69	3	was	be	AUX
finefocus-4313	69	4	an	an	DET
finefocus-4313	69	5	isolate	isolate	NOUN
finefocus-4313	69	6	with	with	ADP
finefocus-4313	69	7	a	a	DET
finefocus-4313	69	8	yellow	yellow	ADJ
finefocus-4313	69	9	appearance	appearance	NOUN
finefocus-4313	69	10	that	that	PRON
finefocus-4313	69	11	created	create	VERB
finefocus-4313	69	12	a	a	DET
finefocus-4313	69	13	clear	clear	ADJ
finefocus-4313	69	14	zone	zone	NOUN
finefocus-4313	69	15	of	of	ADP
finefocus-4313	69	16	inhibition	inhibition	NOUN
finefocus-4313	69	17	when	when	SCONJ
finefocus-4313	69	18	tested	test	VERB
finefocus-4313	69	19	on	on	ADP
finefocus-4313	69	20	b.	b.	PROPN
finefocus-4313	69	21	subtilis	subtilis	PROPN
finefocus-4313	69	22	and	and	CCONJ
finefocus-4313	69	23	s.	s.	PROPN
finefocus-4313	69	24	epidermidis	epidermidis	PROPN
finefocus-4313	69	25	and	and	CCONJ
finefocus-4313	69	26	subsequent	subsequent	ADJ
finefocus-4313	69	27	testing	testing	NOUN
finefocus-4313	69	28	of	of	ADP
finefocus-4313	69	29	the	the	DET
finefocus-4313	69	30	isolate	isolate	NOUN
finefocus-4313	69	31	of	of	ADP
finefocus-4313	69	32	interest	interest	NOUN
finefocus-4313	69	33	on	on	ADP
finefocus-4313	69	34	k.	k.	PROPN
finefocus-4313	69	35	pneumoniae	pneumoniae	PROPN
finefocus-4313	69	36	,	,	PUNCT
finefocus-4313	69	37	e.	e.	PROPN
finefocus-4313	69	38	raffinosus	raffinosus	PROPN
finefocus-4313	69	39	and	and	CCONJ
finefocus-4313	69	40	others	other	NOUN
finefocus-4313	69	41	(	(	PUNCT
finefocus-4313	69	42	not	not	PART
finefocus-4313	69	43	shown	show	VERB
finefocus-4313	69	44	)	)	PUNCT
finefocus-4313	69	45	in	in	ADP
finefocus-4313	69	46	figure	figure	NOUN
finefocus-4313	69	47	1	1	NUM
finefocus-4313	69	48	produced	produce	VERB
finefocus-4313	69	49	zones	zone	NOUN
finefocus-4313	69	50	of	of	ADP
finefocus-4313	69	51	inhibition	inhibition	NOUN
finefocus-4313	69	52	of	of	ADP
finefocus-4313	69	53	varying	vary	VERB
finefocus-4313	69	54	diameters	diameter	NOUN
finefocus-4313	69	55	.	.	PUNCT
finefocus-4313	70	1	the	the	DET
finefocus-4313	70	2	culture	culture	NOUN
finefocus-4313	70	3	of	of	ADP
finefocus-4313	70	4	the	the	DET
finefocus-4313	70	5	suspected	suspect	VERB
finefocus-4313	70	6	novel	novel	ADJ
finefocus-4313	70	7	species	specie	NOUN
finefocus-4313	70	8	or	or	CCONJ
finefocus-4313	70	9	at	at	ADP
finefocus-4313	70	10	least	least	ADJ
finefocus-4313	70	11	a	a	DET
finefocus-4313	70	12	sub	sub	NOUN
finefocus-4313	70	13	-	-	ADJ
finefocus-4313	70	14	specie	specie	NOUN
finefocus-4313	70	15	of	of	ADP
finefocus-4313	70	16	pseudomonas	pseudomona	NOUN
finefocus-4313	70	17	was	be	AUX
finefocus-4313	70	18	assumed	assume	VERB
finefocus-4313	70	19	to	to	PART
finefocus-4313	70	20	be	be	AUX
finefocus-4313	70	21	producing	produce	VERB
finefocus-4313	70	22	an	an	DET
finefocus-4313	70	23	antimicrobial	antimicrobial	ADJ
finefocus-4313	70	24	compound	compound	NOUN
finefocus-4313	70	25	when	when	SCONJ
finefocus-4313	70	26	spot	spot	NOUN
finefocus-4313	70	27	tested	test	VERB
finefocus-4313	70	28	on	on	ADP
finefocus-4313	70	29	the	the	DET
finefocus-4313	70	30	7	7	NUM
finefocus-4313	70	31	listed	list	VERB
finefocus-4313	70	32	bacteria	bacteria	NOUN
finefocus-4313	70	33	in	in	ADP
finefocus-4313	70	34	table	table	NOUN
finefocus-4313	70	35	1	1	NUM
finefocus-4313	70	36	.	.	PUNCT
finefocus-4313	71	1	this	this	DET
finefocus-4313	71	2	spot	spot	NOUN
finefocus-4313	71	3	testing	testing	NOUN
finefocus-4313	71	4	was	be	AUX
finefocus-4313	71	5	replicated	replicate	VERB
finefocus-4313	71	6	multiple	multiple	ADJ
finefocus-4313	71	7	times	time	NOUN
finefocus-4313	71	8	and	and	CCONJ
finefocus-4313	71	9	the	the	DET
finefocus-4313	71	10	ability	ability	NOUN
finefocus-4313	71	11	of	of	ADP
finefocus-4313	71	12	the	the	DET
finefocus-4313	71	13	bacterium	bacterium	NOUN
finefocus-4313	71	14	to	to	PART
finefocus-4313	71	15	produce	produce	VERB
finefocus-4313	71	16	clear	clear	ADJ
finefocus-4313	71	17	zones	zone	NOUN
finefocus-4313	71	18	of	of	ADP
finefocus-4313	71	19	inhibition	inhibition	NOUN
finefocus-4313	71	20	when	when	SCONJ
finefocus-4313	71	21	spotted	spot	VERB
finefocus-4313	71	22	confirmed	confirm	VERB
finefocus-4313	71	23	its	its	PRON
finefocus-4313	71	24	antimicrobial	antimicrobial	ADJ
finefocus-4313	71	25	producing	produce	VERB
finefocus-4313	71	26	ability	ability	NOUN
finefocus-4313	71	27	.	.	PUNCT
finefocus-4313	72	1	it	it	PRON
finefocus-4313	72	2	was	be	AUX
finefocus-4313	72	3	noted	note	VERB
finefocus-4313	72	4	that	that	SCONJ
finefocus-4313	72	5	some	some	DET
finefocus-4313	72	6	inconsistencies	inconsistency	NOUN
finefocus-4313	72	7	were	be	AUX
finefocus-4313	72	8	observed	observe	VERB
finefocus-4313	72	9	when	when	SCONJ
finefocus-4313	72	10	the	the	DET
finefocus-4313	72	11	antimicrobial	antimicrobial	ADJ
finefocus-4313	72	12	compound	compound	NOUN
finefocus-4313	72	13	producing	produce	VERB
finefocus-4313	72	14	bacterium	bacterium	NOUN
finefocus-4313	72	15	was	be	AUX
finefocus-4313	72	16	tested	test	VERB
finefocus-4313	72	17	on	on	ADP
finefocus-4313	72	18	cultures	culture	NOUN
finefocus-4313	72	19	of	of	ADP
finefocus-4313	72	20	e.	e.	PROPN
finefocus-4313	72	21	coli	coli	PROPN
finefocus-4313	72	22	,	,	PUNCT
finefocus-4313	72	23	as	as	SCONJ
finefocus-4313	72	24	some	some	PRON
finefocus-4313	72	25	of	of	ADP
finefocus-4313	72	26	the	the	DET
finefocus-4313	72	27	results	result	NOUN
finefocus-4313	72	28	were	be	AUX
finefocus-4313	72	29	initially	initially	ADV
finefocus-4313	72	30	positive	positive	ADJ
finefocus-4313	72	31	but	but	CCONJ
finefocus-4313	72	32	came	come	VERB
finefocus-4313	72	33	back	back	ADV
finefocus-4313	72	34	negative	negative	ADJ
finefocus-4313	72	35	on	on	ADP
finefocus-4313	72	36	subsequent	subsequent	ADJ
finefocus-4313	72	37	spot	spot	NOUN
finefocus-4313	72	38	testing	testing	NOUN
finefocus-4313	72	39	.	.	PUNCT
finefocus-4313	73	1	cultures	culture	NOUN
finefocus-4313	73	2	of	of	ADP
finefocus-4313	73	3	e.	e.	PROPN
finefocus-4313	73	4	coli	coli	PROPN
finefocus-4313	73	5	sustained	sustain	VERB
finefocus-4313	73	6	these	these	DET
finefocus-4313	73	7	variations	variation	NOUN
finefocus-4313	73	8	and	and	CCONJ
finefocus-4313	73	9	so	so	ADV
finefocus-4313	73	10	were	be	AUX
finefocus-4313	73	11	declared	declare	VERB
finefocus-4313	73	12	nonsensitive	nonsensitive	ADJ
finefocus-4313	73	13	to	to	ADP
finefocus-4313	73	14	the	the	DET
finefocus-4313	73	15	antimicrobial	antimicrobial	ADJ
finefocus-4313	73	16	compound	compound	NOUN
finefocus-4313	73	17	produced	produce	VERB
finefocus-4313	73	18	by	by	ADP
finefocus-4313	73	19	the	the	DET
finefocus-4313	73	20	unknown	unknown	ADJ
finefocus-4313	73	21	bacterium	bacterium	NOUN
finefocus-4313	73	22	.	.	PUNCT
finefocus-4313	74	1	table	table	NOUN
finefocus-4313	74	2	1	1	NUM
finefocus-4313	74	3	shows	show	VERB
finefocus-4313	74	4	the	the	DET
finefocus-4313	74	5	results	result	NOUN
finefocus-4313	74	6	obtained	obtain	VERB
finefocus-4313	74	7	when	when	SCONJ
finefocus-4313	74	8	testing	test	VERB
finefocus-4313	74	9	with	with	ADP
finefocus-4313	74	10	the	the	DET
finefocus-4313	74	11	unknown	unknown	ADJ
finefocus-4313	74	12	compound	compound	NOUN
finefocus-4313	74	13	on	on	ADP
finefocus-4313	74	14	safe	safe	ADJ
finefocus-4313	74	15	eskape	eskape	NOUN
finefocus-4313	74	16	relatives	relative	NOUN
finefocus-4313	74	17	and	and	CCONJ
finefocus-4313	74	18	k.	k.	NOUN
finefocus-4313	74	19	pneumoniae	pneumoniae	PROPN
finefocus-4313	74	20	.	.	PUNCT
finefocus-4313	75	1	b.	b.	PROPN
finefocus-4313	75	2	subtilis	subtilis	PROPN
finefocus-4313	75	3	and	and	CCONJ
finefocus-4313	75	4	s.	s.	PROPN
finefocus-4313	75	5	epidermidis	epidermidis	PROPN
finefocus-4313	75	6	showed	show	VERB
finefocus-4313	75	7	higher	high	ADJ
finefocus-4313	75	8	levels	level	NOUN
finefocus-4313	75	9	of	of	ADP
finefocus-4313	75	10	sensitivity	sensitivity	NOUN
finefocus-4313	75	11	to	to	ADP
finefocus-4313	75	12	the	the	DET
finefocus-4313	75	13	unknown	unknown	ADJ
finefocus-4313	75	14	bacterium	bacterium	NOUN
finefocus-4313	75	15	,	,	PUNCT
finefocus-4313	75	16	suggesting	suggest	VERB
finefocus-4313	75	17	that	that	SCONJ
finefocus-4313	75	18	perhaps	perhaps	ADV
finefocus-4313	75	19	the	the	DET
finefocus-4313	75	20	antimicrobial	antimicrobial	ADJ
finefocus-4313	75	21	compound	compound	NOUN
finefocus-4313	75	22	produced	produce	VERB
finefocus-4313	75	23	could	could	AUX
finefocus-4313	75	24	have	have	VERB
finefocus-4313	75	25	more	more	ADJ
finefocus-4313	75	26	effect	effect	NOUN
finefocus-4313	75	27	on	on	ADP
finefocus-4313	75	28	gram	gram	NOUN
finefocus-4313	75	29	-	-	PUNCT
finefocus-4313	75	30	positives	positive	NOUN
finefocus-4313	75	31	species	specie	NOUN
finefocus-4313	75	32	especially	especially	ADV
finefocus-4313	75	33	the	the	DET
finefocus-4313	75	34	non	non	ADJ
finefocus-4313	75	35	-	-	ADJ
finefocus-4313	75	36	sporeforming	sporeforming	ADJ
finefocus-4313	75	37	s.	s.	PROPN
finefocus-4313	75	38	epidermidis	epidermidi	NOUN
finefocus-4313	75	39	.	.	PUNCT
finefocus-4313	76	1	the	the	DET
finefocus-4313	76	2	rest	rest	NOUN
finefocus-4313	76	3	of	of	ADP
finefocus-4313	76	4	the	the	DET
finefocus-4313	76	5	test	test	NOUN
finefocus-4313	76	6	cultures	culture	NOUN
finefocus-4313	76	7	showed	show	VERB
finefocus-4313	76	8	varying	vary	VERB
finefocus-4313	76	9	degrees	degree	NOUN
finefocus-4313	76	10	of	of	ADP
finefocus-4313	76	11	sensitivity	sensitivity	NOUN
finefocus-4313	76	12	over	over	ADP
finefocus-4313	76	13	many	many	ADJ
finefocus-4313	76	14	replicates	replicate	NOUN
finefocus-4313	76	15	,	,	PUNCT
finefocus-4313	76	16	with	with	ADP
finefocus-4313	76	17	e.	e.	PROPN
finefocus-4313	76	18	coli	coli	PROPN
finefocus-4313	76	19	,	,	PUNCT
finefocus-4313	76	20	appearing	appear	VERB
finefocus-4313	76	21	to	to	PART
finefocus-4313	76	22	be	be	AUX
finefocus-4313	76	23	the	the	DET
finefocus-4313	76	24	least	least	ADJ
finefocus-4313	76	25	sensitive	sensitive	ADJ
finefocus-4313	76	26	.	.	PUNCT
finefocus-4313	77	1	the	the	DET
finefocus-4313	77	2	unknown	unknown	ADJ
finefocus-4313	77	3	bacterium	bacterium	NOUN
finefocus-4313	77	4	was	be	AUX
finefocus-4313	77	5	used	use	VERB
finefocus-4313	77	6	after	after	ADP
finefocus-4313	77	7	incubation	incubation	NOUN
finefocus-4313	77	8	for	for	ADP
finefocus-4313	77	9	18	18	NUM
finefocus-4313	77	10	–	–	SYM
finefocus-4313	77	11	24	24	NUM
finefocus-4313	77	12	hours	hour	NOUN
finefocus-4313	77	13	for	for	ADP
finefocus-4313	77	14	best	good	ADJ
finefocus-4313	77	15	results	result	NOUN
finefocus-4313	77	16	.	.	PUNCT
finefocus-4313	78	1	older	old	ADJ
finefocus-4313	78	2	cultures	culture	NOUN
finefocus-4313	78	3	of	of	ADP
finefocus-4313	78	4	this	this	DET
finefocus-4313	78	5	unknown	unknown	ADJ
finefocus-4313	78	6	bacterium	bacterium	NOUN
finefocus-4313	78	7	showed	show	VERB
finefocus-4313	78	8	less	less	ADJ
finefocus-4313	78	9	ability	ability	NOUN
finefocus-4313	78	10	to	to	PART
finefocus-4313	78	11	inhibit	inhibit	VERB
finefocus-4313	78	12	the	the	DET
finefocus-4313	78	13	growth	growth	NOUN
finefocus-4313	78	14	of	of	ADP
finefocus-4313	78	15	the	the	DET
finefocus-4313	78	16	test	test	NOUN
finefocus-4313	78	17	cultures	culture	NOUN
finefocus-4313	78	18	.	.	PUNCT
finefocus-4313	79	1	104	104	NUM
finefocus-4313	79	2	|	|	ADV
finefocus-4313	79	3	fine	fine	ADJ
finefocus-4313	79	4	focus	focus	NOUN
finefocus-4313	79	5	fig	fig	NOUN
finefocus-4313	79	6	1	1	NUM
finefocus-4313	79	7	:	:	PUNCT
finefocus-4313	79	8	left	leave	VERB
finefocus-4313	79	9	to	to	ADP
finefocus-4313	79	10	right	right	NOUN
finefocus-4313	79	11	.	.	PUNCT
finefocus-4313	80	1	the	the	DET
finefocus-4313	80	2	unknown	unknown	ADJ
finefocus-4313	80	3	bacterium	bacterium	NOUN
finefocus-4313	80	4	(	(	PUNCT
finefocus-4313	80	5	pointed	point	VERB
finefocus-4313	80	6	)	)	PUNCT
finefocus-4313	80	7	on	on	ADP
finefocus-4313	80	8	a	a	DET
finefocus-4313	80	9	culture	culture	NOUN
finefocus-4313	80	10	of	of	ADP
finefocus-4313	80	11	b.	b.	PROPN
finefocus-4313	80	12	subtilis	subtilis	PROPN
finefocus-4313	80	13	,	,	PUNCT
finefocus-4313	80	14	the	the	DET
finefocus-4313	80	15	zone	zone	NOUN
finefocus-4313	80	16	of	of	ADP
finefocus-4313	80	17	inhibition	inhibition	NOUN
finefocus-4313	80	18	can	can	AUX
finefocus-4313	80	19	be	be	AUX
finefocus-4313	80	20	clearly	clearly	ADV
finefocus-4313	80	21	seen	see	VERB
finefocus-4313	80	22	on	on	ADP
finefocus-4313	80	23	the	the	DET
finefocus-4313	80	24	plates	plate	NOUN
finefocus-4313	80	25	.	.	PUNCT
finefocus-4313	81	1	table	table	NOUN
finefocus-4313	81	2	1	1	NUM
finefocus-4313	81	3	:	:	PUNCT
finefocus-4313	81	4	tester	tester	ADJ
finefocus-4313	81	5	bacteria	bacteria	NOUN
finefocus-4313	81	6	are	be	AUX
finefocus-4313	81	7	used	use	VERB
finefocus-4313	81	8	to	to	PART
finefocus-4313	81	9	verify	verify	VERB
finefocus-4313	81	10	the	the	DET
finefocus-4313	81	11	antimicrobial	antimicrobial	ADJ
finefocus-4313	81	12	compound	compound	NOUN
finefocus-4313	81	13	produced	produce	VERB
finefocus-4313	81	14	by	by	ADP
finefocus-4313	81	15	the	the	DET
finefocus-4313	81	16	unknown	unknown	ADJ
finefocus-4313	81	17	bacterium	bacterium	NOUN
finefocus-4313	81	18	.	.	PUNCT
finefocus-4313	82	1	=	=	PUNCT
finefocus-4313	83	1	no	no	DET
finefocus-4313	83	2	zone	zone	NOUN
finefocus-4313	83	3	of	of	ADP
finefocus-4313	83	4	inhibition	inhibition	NOUN
finefocus-4313	83	5	observed	observe	VERB
finefocus-4313	83	6	,	,	PUNCT
finefocus-4313	83	7	+	+	CCONJ
finefocus-4313	83	8	=	=	SYM
finefocus-4313	83	9	zone	zone	NOUN
finefocus-4313	83	10	of	of	ADP
finefocus-4313	83	11	inhibition	inhibition	NOUN
finefocus-4313	83	12	observed	observe	VERB
finefocus-4313	83	13	,	,	PUNCT
finefocus-4313	83	14	+	+	PROPN
finefocus-4313	83	15	+	+	CCONJ
finefocus-4313	83	16	=	=	VERB
finefocus-4313	83	17	large	large	ADJ
finefocus-4313	83	18	zone	zone	NOUN
finefocus-4313	83	19	of	of	ADP
finefocus-4313	83	20	inhibition	inhibition	NOUN
finefocus-4313	83	21	observed	observe	VERB
finefocus-4313	83	22	tester	tester	NOUN
finefocus-4313	83	23	bacterium	bacterium	NOUN
finefocus-4313	83	24	result	result	NOUN
finefocus-4313	83	25	1	1	NUM
finefocus-4313	83	26	.	.	PUNCT
finefocus-4313	83	27	enterococcus	enterococcus	NOUN
finefocus-4313	83	28	raffinosus	raffinosus	NOUN
finefocus-4313	83	29	+	+	CCONJ
finefocus-4313	83	30	2	2	X
finefocus-4313	83	31	.	.	NOUN
finefocus-4313	83	32	escherichia	escherichia	NOUN
finefocus-4313	83	33	coli	coli	NOUN
finefocus-4313	83	34	3	3	NUM
finefocus-4313	83	35	.	.	PUNCT
finefocus-4313	83	36	erwinia	erwinia	NOUN
finefocus-4313	83	37	caratovora	caratovora	NOUN
finefocus-4313	83	38	+	+	CCONJ
finefocus-4313	83	39	4	4	X
finefocus-4313	83	40	.	.	X
finefocus-4313	83	41	pseudomonas	pseudomona	NOUN
finefocus-4313	83	42	putida	putida	VERB
finefocus-4313	83	43	+	+	CCONJ
finefocus-4313	83	44	5	5	X
finefocus-4313	83	45	.	.	PUNCT
finefocus-4313	83	46	staphylococcus	staphylococcus	NOUN
finefocus-4313	83	47	epidermidis	epidermidi	NOUN
finefocus-4313	83	48	+	+	PROPN
finefocus-4313	83	49	+	+	PROPN
finefocus-4313	83	50	6	6	NUM
finefocus-4313	83	51	.	.	X
finefocus-4313	84	1	enterobacter	enterobacter	NOUN
finefocus-4313	84	2	aerogenes	aerogene	NOUN
finefocus-4313	84	3	+	+	CCONJ
finefocus-4313	84	4	7	7	X
finefocus-4313	84	5	.	.	PUNCT
finefocus-4313	84	6	bacillus	bacillus	NOUN
finefocus-4313	84	7	subtilis	subtili	NOUN
finefocus-4313	85	1	+	+	PROPN
finefocus-4313	85	2	+	+	NUM
finefocus-4313	85	3	vol	vol	NOUN
finefocus-4313	85	4	9	9	NUM
finefocus-4313	85	5	|	|	ADV
finefocus-4313	85	6	105	105	NUM
finefocus-4313	85	7	the	the	DET
finefocus-4313	85	8	raw	raw	ADJ
finefocus-4313	85	9	extract	extract	NOUN
finefocus-4313	85	10	from	from	ADP
finefocus-4313	85	11	the	the	DET
finefocus-4313	85	12	antimicrobial	antimicrobial	ADJ
finefocus-4313	85	13	compound	compound	NOUN
finefocus-4313	85	14	producing	produce	VERB
finefocus-4313	85	15	bacterium	bacterium	NOUN
finefocus-4313	85	16	was	be	AUX
finefocus-4313	85	17	obtained	obtain	VERB
finefocus-4313	85	18	as	as	SCONJ
finefocus-4313	85	19	described	describe	VERB
finefocus-4313	85	20	in	in	ADP
finefocus-4313	85	21	the	the	DET
finefocus-4313	85	22	materials	material	NOUN
finefocus-4313	85	23	and	and	CCONJ
finefocus-4313	85	24	methods	method	NOUN
finefocus-4313	85	25	section	section	NOUN
finefocus-4313	85	26	and	and	CCONJ
finefocus-4313	85	27	was	be	AUX
finefocus-4313	85	28	used	use	VERB
finefocus-4313	85	29	on	on	ADP
finefocus-4313	85	30	the	the	DET
finefocus-4313	85	31	test	test	NOUN
finefocus-4313	85	32	cultures	culture	NOUN
finefocus-4313	85	33	to	to	PART
finefocus-4313	85	34	confirm	confirm	VERB
finefocus-4313	85	35	potency	potency	NOUN
finefocus-4313	85	36	.	.	PUNCT
finefocus-4313	86	1	the	the	DET
finefocus-4313	86	2	results	result	NOUN
finefocus-4313	86	3	obtained	obtain	VERB
finefocus-4313	86	4	showed	show	VERB
finefocus-4313	86	5	consistency	consistency	NOUN
finefocus-4313	86	6	as	as	SCONJ
finefocus-4313	86	7	earlier	early	ADV
finefocus-4313	86	8	observed	observe	VERB
finefocus-4313	86	9	when	when	SCONJ
finefocus-4313	86	10	the	the	DET
finefocus-4313	86	11	antimicrobial	antimicrobial	ADJ
finefocus-4313	86	12	compound	compound	NOUN
finefocus-4313	86	13	was	be	AUX
finefocus-4313	86	14	directly	directly	ADV
finefocus-4313	86	15	used	use	VERB
finefocus-4313	86	16	on	on	ADP
finefocus-4313	86	17	the	the	DET
finefocus-4313	86	18	test	test	NOUN
finefocus-4313	86	19	cultures	culture	NOUN
finefocus-4313	86	20	.	.	PUNCT
finefocus-4313	87	1	s.	s.	PROPN
finefocus-4313	87	2	epidermidis	epidermidis	PROPN
finefocus-4313	87	3	showed	show	VERB
finefocus-4313	87	4	the	the	DET
finefocus-4313	87	5	highest	high	ADJ
finefocus-4313	87	6	level	level	NOUN
finefocus-4313	87	7	of	of	ADP
finefocus-4313	87	8	sensitivity	sensitivity	NOUN
finefocus-4313	87	9	as	as	SCONJ
finefocus-4313	87	10	can	can	AUX
finefocus-4313	87	11	be	be	AUX
finefocus-4313	87	12	observed	observe	VERB
finefocus-4313	87	13	from	from	ADP
finefocus-4313	87	14	the	the	DET
finefocus-4313	87	15	zone	zone	NOUN
finefocus-4313	87	16	of	of	ADP
finefocus-4313	87	17	inhibition	inhibition	NOUN
finefocus-4313	87	18	obtained	obtain	VERB
finefocus-4313	87	19	.	.	PUNCT
finefocus-4313	88	1	e.	e.	PROPN
finefocus-4313	88	2	coli	coli	PROPN
finefocus-4313	88	3	though	though	ADV
finefocus-4313	88	4	,	,	PUNCT
finefocus-4313	88	5	originally	originally	ADV
finefocus-4313	88	6	declared	declare	VERB
finefocus-4313	88	7	non	non	ADJ
finefocus-4313	88	8	-	-	ADJ
finefocus-4313	88	9	sensitive	sensitive	ADJ
finefocus-4313	88	10	,	,	PUNCT
finefocus-4313	88	11	appeared	appear	VERB
finefocus-4313	88	12	this	this	DET
finefocus-4313	88	13	time	time	NOUN
finefocus-4313	88	14	to	to	PART
finefocus-4313	88	15	show	show	VERB
finefocus-4313	88	16	a	a	DET
finefocus-4313	88	17	slight	slight	ADJ
finefocus-4313	88	18	degree	degree	NOUN
finefocus-4313	88	19	of	of	ADP
finefocus-4313	88	20	sensitivity	sensitivity	NOUN
finefocus-4313	88	21	,	,	PUNCT
finefocus-4313	88	22	suggesting	suggest	VERB
finefocus-4313	88	23	that	that	SCONJ
finefocus-4313	88	24	perhaps	perhaps	ADV
finefocus-4313	88	25	much	much	ADJ
finefocus-4313	88	26	is	be	AUX
finefocus-4313	88	27	left	leave	VERB
finefocus-4313	88	28	for	for	SCONJ
finefocus-4313	88	29	us	we	PRON
finefocus-4313	88	30	to	to	PART
finefocus-4313	88	31	understand	understand	VERB
finefocus-4313	88	32	on	on	ADP
finefocus-4313	88	33	the	the	DET
finefocus-4313	88	34	culturing	culture	VERB
finefocus-4313	88	35	conditions	condition	NOUN
finefocus-4313	88	36	of	of	ADP
finefocus-4313	88	37	this	this	DET
finefocus-4313	88	38	unknown	unknown	ADJ
finefocus-4313	88	39	bacterium	bacterium	NOUN
finefocus-4313	88	40	to	to	PART
finefocus-4313	88	41	produce	produce	VERB
finefocus-4313	88	42	the	the	DET
finefocus-4313	88	43	maximum	maximum	ADJ
finefocus-4313	88	44	and/or	and/or	CCONJ
finefocus-4313	88	45	most	most	ADV
finefocus-4313	88	46	potent	potent	ADJ
finefocus-4313	88	47	form	form	NOUN
finefocus-4313	88	48	of	of	ADP
finefocus-4313	88	49	the	the	DET
finefocus-4313	88	50	antimicrobial	antimicrobial	ADJ
finefocus-4313	88	51	compound	compound	NOUN
finefocus-4313	88	52	.	.	PUNCT
finefocus-4313	89	1	for	for	ADP
finefocus-4313	89	2	this	this	DET
finefocus-4313	89	3	testing	testing	NOUN
finefocus-4313	89	4	phase	phase	NOUN
finefocus-4313	89	5	,	,	PUNCT
finefocus-4313	89	6	a	a	DET
finefocus-4313	89	7	bacterium	bacterium	NOUN
finefocus-4313	89	8	obtained	obtain	VERB
finefocus-4313	89	9	from	from	ADP
finefocus-4313	89	10	an	an	DET
finefocus-4313	89	11	environmental	environmental	ADJ
finefocus-4313	89	12	sample	sample	NOUN
finefocus-4313	89	13	was	be	AUX
finefocus-4313	89	14	added	add	VERB
finefocus-4313	89	15	to	to	ADP
finefocus-4313	89	16	the	the	DET
finefocus-4313	89	17	line	line	NOUN
finefocus-4313	89	18	-	-	PUNCT
finefocus-4313	89	19	up	up	NOUN
finefocus-4313	89	20	of	of	ADP
finefocus-4313	89	21	test	test	NOUN
finefocus-4313	89	22	cultures	culture	NOUN
finefocus-4313	89	23	and	and	CCONJ
finefocus-4313	89	24	was	be	AUX
finefocus-4313	89	25	sensitive	sensitive	ADJ
finefocus-4313	89	26	to	to	ADP
finefocus-4313	89	27	the	the	DET
finefocus-4313	89	28	crude	crude	ADJ
finefocus-4313	89	29	extract	extract	NOUN
finefocus-4313	89	30	of	of	ADP
finefocus-4313	89	31	the	the	DET
finefocus-4313	89	32	antimicrobial	antimicrobial	ADJ
finefocus-4313	89	33	compound	compound	NOUN
finefocus-4313	89	34	being	be	AUX
finefocus-4313	89	35	tested	test	VERB
finefocus-4313	89	36	.	.	PUNCT
finefocus-4313	90	1	106	106	NUM
finefocus-4313	91	1	|	|	ADV
finefocus-4313	91	2	fine	fine	ADJ
finefocus-4313	91	3	focus	focus	NOUN
finefocus-4313	91	4	fig	fig	NOUN
finefocus-4313	91	5	2	2	NUM
finefocus-4313	91	6	:	:	PUNCT
finefocus-4313	91	7	top	top	NOUN
finefocus-4313	91	8	to	to	ADP
finefocus-4313	91	9	bottom	bottom	NOUN
finefocus-4313	91	10	.	.	PUNCT
finefocus-4313	92	1	the	the	DET
finefocus-4313	92	2	antimicrobial	antimicrobial	ADJ
finefocus-4313	92	3	compound	compound	NOUN
finefocus-4313	92	4	zones	zone	NOUN
finefocus-4313	92	5	of	of	ADP
finefocus-4313	92	6	inhibition	inhibition	NOUN
finefocus-4313	92	7	(	(	PUNCT
finefocus-4313	92	8	pointed	point	VERB
finefocus-4313	92	9	)	)	PUNCT
finefocus-4313	92	10	on	on	ADP
finefocus-4313	92	11	a	a	DET
finefocus-4313	92	12	culture	culture	NOUN
finefocus-4313	92	13	of	of	ADP
finefocus-4313	92	14	s.	s.	PROPN
finefocus-4313	92	15	epidermidis	epidermidis	PROPN
finefocus-4313	92	16	,	,	PUNCT
finefocus-4313	92	17	and	and	CCONJ
finefocus-4313	92	18	an	an	DET
finefocus-4313	92	19	unknown	unknown	ADJ
finefocus-4313	92	20	environmental	environmental	ADJ
finefocus-4313	92	21	sample	sample	NOUN
finefocus-4313	92	22	extract	extract	NOUN
finefocus-4313	92	23	bacterium	bacterium	NOUN
finefocus-4313	92	24	,	,	PUNCT
finefocus-4313	92	25	methanol	methanol	NOUN
finefocus-4313	92	26	was	be	AUX
finefocus-4313	92	27	used	use	VERB
finefocus-4313	92	28	as	as	ADP
finefocus-4313	92	29	the	the	DET
finefocus-4313	92	30	negative	negative	ADJ
finefocus-4313	92	31	control	control	NOUN
finefocus-4313	92	32	and	and	CCONJ
finefocus-4313	92	33	represents	represent	VERB
finefocus-4313	92	34	the	the	DET
finefocus-4313	92	35	alphabet	alphabet	NOUN
finefocus-4313	92	36	“	"	PUNCT
finefocus-4313	92	37	b	b	PROPN
finefocus-4313	92	38	”	"	PUNCT
finefocus-4313	92	39	and	and	CCONJ
finefocus-4313	92	40	written	write	VERB
finefocus-4313	92	41	as	as	ADP
finefocus-4313	92	42	methanol	methanol	NOUN
finefocus-4313	92	43	in	in	ADP
finefocus-4313	92	44	some	some	PRON
finefocus-4313	92	45	of	of	ADP
finefocus-4313	92	46	the	the	DET
finefocus-4313	92	47	plates	plate	NOUN
finefocus-4313	92	48	.	.	PUNCT
finefocus-4313	93	1	vol	vol	NOUN
finefocus-4313	93	2	9	9	NUM
finefocus-4313	93	3	|	|	ADV
finefocus-4313	93	4	107	107	NUM
finefocus-4313	93	5	and	and	CCONJ
finefocus-4313	93	6	none	none	NOUN
finefocus-4313	93	7	of	of	ADP
finefocus-4313	93	8	the	the	DET
finefocus-4313	93	9	commercially	commercially	ADV
finefocus-4313	93	10	available	available	ADJ
finefocus-4313	93	11	antibiotic	antibiotic	ADJ
finefocus-4313	93	12	discs	disc	NOUN
finefocus-4313	93	13	has	have	AUX
finefocus-4313	93	14	produced	produce	VERB
finefocus-4313	93	15	this	this	DET
finefocus-4313	93	16	result	result	NOUN
finefocus-4313	93	17	on	on	ADP
finefocus-4313	93	18	any	any	DET
finefocus-4313	93	19	bacterium	bacterium	NOUN
finefocus-4313	93	20	.	.	PUNCT
finefocus-4313	94	1	this	this	PRON
finefocus-4313	94	2	suggests	suggest	VERB
finefocus-4313	94	3	a	a	DET
finefocus-4313	94	4	unique	unique	ADJ
finefocus-4313	94	5	killing	killing	NOUN
finefocus-4313	94	6	efficiency	efficiency	NOUN
finefocus-4313	94	7	that	that	PRON
finefocus-4313	94	8	may	may	AUX
finefocus-4313	94	9	become	become	VERB
finefocus-4313	94	10	the	the	DET
finefocus-4313	94	11	new	new	ADJ
finefocus-4313	94	12	and	and	CCONJ
finefocus-4313	94	13	effective	effective	ADJ
finefocus-4313	94	14	antibiotic	antibiotic	NOUN
finefocus-4313	94	15	against	against	ADP
finefocus-4313	94	16	resistant	resistant	ADJ
finefocus-4313	94	17	pathogens	pathogen	NOUN
finefocus-4313	94	18	.	.	PUNCT
finefocus-4313	95	1	to	to	PART
finefocus-4313	95	2	determine	determine	VERB
finefocus-4313	95	3	this	this	DET
finefocus-4313	95	4	unknown	unknown	ADJ
finefocus-4313	95	5	antimicrobial	antimicrobial	ADJ
finefocus-4313	95	6	compound	compound	NOUN
finefocus-4313	95	7	’s	’s	PART
finefocus-4313	95	8	effectiveness	effectiveness	NOUN
finefocus-4313	95	9	when	when	SCONJ
finefocus-4313	95	10	compared	compare	VERB
finefocus-4313	95	11	with	with	ADP
finefocus-4313	95	12	known	known	ADJ
finefocus-4313	95	13	antibiotics	antibiotic	NOUN
finefocus-4313	95	14	,	,	PUNCT
finefocus-4313	95	15	we	we	PRON
finefocus-4313	95	16	set	set	VERB
finefocus-4313	95	17	up	up	ADP
finefocus-4313	95	18	an	an	DET
finefocus-4313	95	19	experiment	experiment	NOUN
finefocus-4313	95	20	with	with	ADP
finefocus-4313	95	21	s.	s.	PROPN
finefocus-4313	95	22	epidermidis	epidermidis	PROPN
finefocus-4313	95	23	and	and	CCONJ
finefocus-4313	95	24	k.	k.	NOUN
finefocus-4313	95	25	pneumoniae	pneumoniae	NOUN
finefocus-4313	95	26	,	,	PUNCT
finefocus-4313	95	27	representing	represent	VERB
finefocus-4313	95	28	gram	gram	NOUN
finefocus-4313	95	29	-	-	PUNCT
finefocus-4313	95	30	positive	positive	ADJ
finefocus-4313	95	31	and	and	CCONJ
finefocus-4313	95	32	gram	gram	NOUN
finefocus-4313	95	33	-	-	PUNCT
finefocus-4313	95	34	negative	negative	ADJ
finefocus-4313	95	35	bacteria	bacteria	NOUN
finefocus-4313	95	36	respectively	respectively	ADV
finefocus-4313	95	37	.	.	PUNCT
finefocus-4313	96	1	for	for	ADP
finefocus-4313	96	2	s.	s.	PROPN
finefocus-4313	96	3	epidermidis	epidermidis	PROPN
finefocus-4313	96	4	,	,	PUNCT
finefocus-4313	96	5	penicillin	penicillin	NOUN
finefocus-4313	96	6	10	10	NUM
finefocus-4313	96	7	iu	iu	ADP
finefocus-4313	96	8	(	(	PUNCT
finefocus-4313	96	9	bd	bd	PROPN
finefocus-4313	96	10	,	,	PUNCT
finefocus-4313	96	11	bdl	bdl	PROPN
finefocus-4313	96	12	9154628	9154628	NUM
finefocus-4313	96	13	,	,	PUNCT
finefocus-4313	96	14	sparks	spark	VERB
finefocus-4313	96	15	md	md	PROPN
finefocus-4313	96	16	)	)	PUNCT
finefocus-4313	96	17	was	be	AUX
finefocus-4313	96	18	used	use	VERB
finefocus-4313	96	19	to	to	PART
finefocus-4313	96	20	compare	compare	VERB
finefocus-4313	96	21	to	to	ADP
finefocus-4313	96	22	the	the	DET
finefocus-4313	96	23	unknown	unknown	ADJ
finefocus-4313	96	24	antimicrobial	antimicrobial	ADJ
finefocus-4313	96	25	compound	compound	NOUN
finefocus-4313	96	26	while	while	SCONJ
finefocus-4313	96	27	1.25	1.25	NUM
finefocus-4313	96	28	μg	μg	NOUN
finefocus-4313	96	29	trimethoprim/	trimethoprim/	NUM
finefocus-4313	96	30	sulfamethoxazole	sulfamethoxazole	NOUN
finefocus-4313	96	31	(	(	PUNCT
finefocus-4313	96	32	sxt	sxt	PROPN
finefocus-4313	96	33	,	,	PUNCT
finefocus-4313	96	34	bd	bd	PROPN
finefocus-4313	96	35	bdl	bdl	PROPN
finefocus-4313	96	36	,	,	PUNCT
finefocus-4313	96	37	9078838	9078838	NUM
finefocus-4313	96	38	,	,	PUNCT
finefocus-4313	96	39	sparks	spark	VERB
finefocus-4313	96	40	md	md	PROPN
finefocus-4313	96	41	)	)	PUNCT
finefocus-4313	96	42	was	be	AUX
finefocus-4313	96	43	used	use	VERB
finefocus-4313	96	44	for	for	ADP
finefocus-4313	96	45	the	the	DET
finefocus-4313	96	46	same	same	ADJ
finefocus-4313	96	47	comparison	comparison	NOUN
finefocus-4313	96	48	on	on	ADP
finefocus-4313	96	49	k.	k.	PROPN
finefocus-4313	96	50	pneumoniae	pneumoniae	PROPN
finefocus-4313	96	51	.	.	PUNCT
finefocus-4313	97	1	the	the	DET
finefocus-4313	97	2	choice	choice	NOUN
finefocus-4313	97	3	for	for	ADP
finefocus-4313	97	4	these	these	DET
finefocus-4313	97	5	two	two	NUM
finefocus-4313	97	6	well	well	ADV
finefocus-4313	97	7	-	-	PUNCT
finefocus-4313	97	8	established	establish	VERB
finefocus-4313	97	9	antibiotics	antibiotic	NOUN
finefocus-4313	97	10	is	be	AUX
finefocus-4313	97	11	hinged	hinge	VERB
finefocus-4313	97	12	on	on	ADP
finefocus-4313	97	13	their	their	PRON
finefocus-4313	97	14	known	know	VERB
finefocus-4313	97	15	efficacy	efficacy	NOUN
finefocus-4313	97	16	when	when	SCONJ
finefocus-4313	97	17	used	use	VERB
finefocus-4313	97	18	on	on	ADP
finefocus-4313	97	19	the	the	DET
finefocus-4313	97	20	aforementioned	aforementioned	ADJ
finefocus-4313	97	21	bacteria	bacteria	NOUN
finefocus-4313	97	22	.	.	PUNCT
finefocus-4313	98	1	for	for	ADP
finefocus-4313	98	2	example	example	NOUN
finefocus-4313	98	3	,	,	PUNCT
finefocus-4313	98	4	some	some	DET
finefocus-4313	98	5	strains	strain	NOUN
finefocus-4313	98	6	of	of	ADP
finefocus-4313	98	7	k.	k.	NOUN
finefocus-4313	98	8	pneumoniae	pneumoniae	ADJ
finefocus-4313	98	9	strains	strain	NOUN
finefocus-4313	98	10	are	be	AUX
finefocus-4313	98	11	susceptible	susceptible	ADJ
finefocus-4313	98	12	to	to	ADP
finefocus-4313	98	13	sxt	sxt	PROPN
finefocus-4313	98	14	as	as	SCONJ
finefocus-4313	98	15	reported	report	VERB
finefocus-4313	98	16	by	by	ADP
finefocus-4313	98	17	ballén	ballén	NOUN
finefocus-4313	98	18	et	et	PROPN
finefocus-4313	98	19	al	al	PROPN
finefocus-4313	98	20	.	.	PROPN
finefocus-4313	99	1	(	(	PUNCT
finefocus-4313	99	2	2021	2021	NUM
finefocus-4313	99	3	)	)	PUNCT
finefocus-4313	99	4	.	.	PUNCT
finefocus-4313	100	1	similarly	similarly	ADV
finefocus-4313	100	2	,	,	PUNCT
finefocus-4313	100	3	it	it	PRON
finefocus-4313	100	4	is	be	AUX
finefocus-4313	100	5	common	common	ADJ
finefocus-4313	100	6	knowledge	knowledge	NOUN
finefocus-4313	100	7	that	that	SCONJ
finefocus-4313	100	8	penicillin	penicillin	NOUN
finefocus-4313	100	9	is	be	AUX
finefocus-4313	100	10	the	the	DET
finefocus-4313	100	11	oldest	old	ADJ
finefocus-4313	100	12	commercially	commercially	ADV
finefocus-4313	100	13	viable	viable	ADJ
finefocus-4313	100	14	antibiotic	antibiotic	NOUN
finefocus-4313	100	15	in	in	ADP
finefocus-4313	100	16	modern	modern	ADJ
finefocus-4313	100	17	medicine	medicine	NOUN
finefocus-4313	100	18	.	.	PUNCT
finefocus-4313	101	1	its	its	PRON
finefocus-4313	101	2	mode	mode	NOUN
finefocus-4313	101	3	of	of	ADP
finefocus-4313	101	4	action	action	NOUN
finefocus-4313	101	5	being	be	AUX
finefocus-4313	101	6	to	to	PART
finefocus-4313	101	7	interfere	interfere	VERB
finefocus-4313	101	8	with	with	ADP
finefocus-4313	101	9	the	the	DET
finefocus-4313	101	10	synthesis	synthesis	NOUN
finefocus-4313	101	11	of	of	ADP
finefocus-4313	101	12	the	the	DET
finefocus-4313	101	13	bacterial	bacterial	ADJ
finefocus-4313	101	14	cell	cell	NOUN
finefocus-4313	101	15	walls	wall	NOUN
finefocus-4313	101	16	as	as	SCONJ
finefocus-4313	101	17	described	describe	VERB
finefocus-4313	101	18	by	by	ADP
finefocus-4313	101	19	soares	soare	NOUN
finefocus-4313	101	20	et	et	PROPN
finefocus-4313	101	21	al	al	PROPN
finefocus-4313	101	22	.	.	PROPN
finefocus-4313	101	23	(	(	PUNCT
finefocus-4313	101	24	2012	2012	NUM
finefocus-4313	101	25	)	)	PUNCT
finefocus-4313	101	26	.	.	PUNCT
finefocus-4313	102	1	this	this	DET
finefocus-4313	102	2	novel	novel	ADJ
finefocus-4313	102	3	antimicrobial	antimicrobial	ADJ
finefocus-4313	102	4	compound	compound	NOUN
finefocus-4313	102	5	appeared	appear	VERB
finefocus-4313	102	6	more	more	ADV
finefocus-4313	102	7	potent	potent	ADJ
finefocus-4313	102	8	than	than	ADP
finefocus-4313	102	9	penicillin	penicillin	NOUN
finefocus-4313	102	10	(	(	PUNCT
finefocus-4313	102	11	10	10	NUM
finefocus-4313	102	12	iu	iu	NOUN
finefocus-4313	102	13	)	)	PUNCT
finefocus-4313	102	14	on	on	ADP
finefocus-4313	102	15	s.	s.	PROPN
finefocus-4313	102	16	epidermidis	epidermidis	PROPN
finefocus-4313	102	17	and	and	CCONJ
finefocus-4313	102	18	sxt	sxt	PROPN
finefocus-4313	102	19	(	(	PUNCT
finefocus-4313	102	20	1.25	1.25	NUM
finefocus-4313	102	21	μg	μg	NOUN
finefocus-4313	102	22	)	)	PUNCT
finefocus-4313	102	23	on	on	ADP
finefocus-4313	102	24	k.	k.	PROPN
finefocus-4313	102	25	pneumoniae	pneumoniae	PROPN
finefocus-4313	102	26	when	when	SCONJ
finefocus-4313	102	27	measured	measure	VERB
finefocus-4313	102	28	by	by	ADP
finefocus-4313	102	29	the	the	DET
finefocus-4313	102	30	observable	observable	ADJ
finefocus-4313	102	31	zones	zone	NOUN
finefocus-4313	102	32	of	of	ADP
finefocus-4313	102	33	inhibition	inhibition	NOUN
finefocus-4313	102	34	produced	produce	VERB
finefocus-4313	102	35	as	as	SCONJ
finefocus-4313	102	36	can	can	AUX
finefocus-4313	102	37	be	be	AUX
finefocus-4313	102	38	seen	see	VERB
finefocus-4313	102	39	in	in	ADP
finefocus-4313	102	40	figure	figure	NOUN
finefocus-4313	102	41	3	3	NUM
finefocus-4313	102	42	below	below	ADV
finefocus-4313	102	43	and	and	CCONJ
finefocus-4313	102	44	this	this	DET
finefocus-4313	102	45	experiment	experiment	NOUN
finefocus-4313	102	46	was	be	AUX
finefocus-4313	102	47	replicated	replicate	VERB
finefocus-4313	102	48	many	many	ADJ
finefocus-4313	102	49	times	time	NOUN
finefocus-4313	102	50	with	with	ADP
finefocus-4313	102	51	the	the	DET
finefocus-4313	102	52	same	same	ADJ
finefocus-4313	102	53	outcomes	outcome	NOUN
finefocus-4313	102	54	.	.	PUNCT
finefocus-4313	103	1	going	go	VERB
finefocus-4313	103	2	by	by	ADP
finefocus-4313	103	3	the	the	DET
finefocus-4313	103	4	bd	bd	PROPN
finefocus-4313	103	5	bbltm	bbltm	PROPN
finefocus-4313	103	6	antimicrobial	antimicrobial	ADJ
finefocus-4313	103	7	susceptibility	susceptibility	NOUN
finefocus-4313	103	8	tables	table	NOUN
finefocus-4313	103	9	,	,	PUNCT
finefocus-4313	103	10	penicillin	penicillin	NOUN
finefocus-4313	103	11	(	(	PUNCT
finefocus-4313	103	12	10	10	NUM
finefocus-4313	103	13	iu	iu	NOUN
finefocus-4313	103	14	)	)	PUNCT
finefocus-4313	103	15	with	with	ADP
finefocus-4313	103	16	values	value	NOUN
finefocus-4313	103	17	greater	great	ADJ
finefocus-4313	103	18	than	than	ADP
finefocus-4313	103	19	29	29	NUM
finefocus-4313	103	20	mm	mm	NOUN
finefocus-4313	103	21	in	in	ADP
finefocus-4313	103	22	diameter	diameter	NOUN
finefocus-4313	103	23	on	on	ADP
finefocus-4313	103	24	staphylococcus	staphylococcus	NOUN
finefocus-4313	103	25	species	specie	NOUN
finefocus-4313	103	26	is	be	AUX
finefocus-4313	103	27	the	the	DET
finefocus-4313	103	28	top	top	ADJ
finefocus-4313	103	29	range	range	NOUN
finefocus-4313	103	30	effectiveness	effectiveness	NOUN
finefocus-4313	103	31	but	but	CCONJ
finefocus-4313	103	32	,	,	PUNCT
finefocus-4313	103	33	we	we	PRON
finefocus-4313	103	34	achieved	achieve	VERB
finefocus-4313	103	35	a	a	DET
finefocus-4313	103	36	little	little	ADJ
finefocus-4313	103	37	more	more	ADJ
finefocus-4313	103	38	than	than	ADP
finefocus-4313	103	39	500	500	NUM
finefocus-4313	103	40	mm	mm	NOUN
finefocus-4313	103	41	in	in	ADP
finefocus-4313	103	42	diameter	diameter	NOUN
finefocus-4313	103	43	of	of	ADP
finefocus-4313	103	44	zone	zone	NOUN
finefocus-4313	103	45	of	of	ADP
finefocus-4313	103	46	inhibition	inhibition	NOUN
finefocus-4313	103	47	using	use	VERB
finefocus-4313	103	48	the	the	DET
finefocus-4313	103	49	novel	novel	ADJ
finefocus-4313	103	50	antimicrobial	antimicrobial	ADJ
finefocus-4313	103	51	compound	compound	NOUN
finefocus-4313	103	52	.	.	PUNCT
finefocus-4313	104	1	as	as	ADV
finefocus-4313	104	2	far	far	ADV
finefocus-4313	104	3	as	as	SCONJ
finefocus-4313	104	4	we	we	PRON
finefocus-4313	104	5	know	know	VERB
finefocus-4313	104	6	,	,	PUNCT
finefocus-4313	104	7	no	no	DET
finefocus-4313	104	8	research	research	NOUN
finefocus-4313	104	9	article	article	NOUN
finefocus-4313	104	10	has	have	AUX
finefocus-4313	104	11	ever	ever	ADV
finefocus-4313	104	12	reported	report	VERB
finefocus-4313	104	13	this	this	DET
finefocus-4313	104	14	extremely	extremely	ADV
finefocus-4313	104	15	large	large	ADJ
finefocus-4313	104	16	number	number	NOUN
finefocus-4313	104	17	with	with	ADP
finefocus-4313	104	18	either	either	CCONJ
finefocus-4313	104	19	crude	crude	ADJ
finefocus-4313	104	20	or	or	CCONJ
finefocus-4313	104	21	refined	refined	ADJ
finefocus-4313	104	22	extract	extract	NOUN
finefocus-4313	104	23	108	108	NUM
finefocus-4313	104	24	|	|	ADV
finefocus-4313	104	25	fine	fine	ADJ
finefocus-4313	104	26	focus	focus	NOUN
finefocus-4313	104	27	fig	fig	NOUN
finefocus-4313	104	28	3	3	NUM
finefocus-4313	104	29	:	:	PUNCT
finefocus-4313	104	30	top	top	NOUN
finefocus-4313	104	31	to	to	ADP
finefocus-4313	104	32	bottom	bottom	NOUN
finefocus-4313	104	33	.	.	PUNCT
finefocus-4313	105	1	the	the	DET
finefocus-4313	105	2	unknown	unknown	ADJ
finefocus-4313	105	3	antimicrobial	antimicrobial	ADJ
finefocus-4313	105	4	compound	compound	NOUN
finefocus-4313	105	5	(	(	PUNCT
finefocus-4313	105	6	red	red	ADJ
finefocus-4313	105	7	arrow	arrow	NOUN
finefocus-4313	105	8	)	)	PUNCT
finefocus-4313	105	9	on	on	ADP
finefocus-4313	105	10	s.	s.	PROPN
finefocus-4313	105	11	epidermidis	epidermidis	PROPN
finefocus-4313	105	12	and	and	CCONJ
finefocus-4313	105	13	k.	k.	NOUN
finefocus-4313	105	14	pneumoniae	pneumoniae	PROPN
finefocus-4313	105	15	.	.	PUNCT
finefocus-4313	106	1	p-10	p-10	PUNCT
finefocus-4313	106	2	and	and	CCONJ
finefocus-4313	106	3	sxt	sxt	PROPN
finefocus-4313	106	4	are	be	AUX
finefocus-4313	106	5	arrowed	arrowe	VERB
finefocus-4313	106	6	in	in	ADP
finefocus-4313	106	7	blue	blue	ADJ
finefocus-4313	106	8	.	.	PUNCT
finefocus-4313	107	1	the	the	DET
finefocus-4313	107	2	zone	zone	NOUN
finefocus-4313	107	3	of	of	ADP
finefocus-4313	107	4	inhibition	inhibition	NOUN
finefocus-4313	107	5	produced	produce	VERB
finefocus-4313	107	6	by	by	ADP
finefocus-4313	107	7	the	the	DET
finefocus-4313	107	8	unknown	unknown	ADJ
finefocus-4313	107	9	antimicrobial	antimicrobial	ADJ
finefocus-4313	107	10	compound	compound	NOUN
finefocus-4313	107	11	on	on	ADP
finefocus-4313	107	12	s.	s.	PROPN
finefocus-4313	107	13	epidermidis	epidermidis	PROPN
finefocus-4313	107	14	was	be	AUX
finefocus-4313	107	15	slightly	slightly	ADV
finefocus-4313	107	16	above	above	ADP
finefocus-4313	107	17	500	500	NUM
finefocus-4313	107	18	mm	mm	NOUN
finefocus-4313	107	19	in	in	ADP
finefocus-4313	107	20	diameter	diameter	NOUN
finefocus-4313	107	21	.	.	PUNCT
finefocus-4313	108	1	vol	vol	NOUN
finefocus-4313	108	2	9	9	NUM
finefocus-4313	108	3	|	|	ADV
finefocus-4313	108	4	109	109	NUM
finefocus-4313	108	5	cm-1	cm-1	NOUN
finefocus-4313	108	6	.	.	PUNCT
finefocus-4313	109	1	a	a	DET
finefocus-4313	109	2	very	very	ADV
finefocus-4313	109	3	sharp	sharp	ADJ
finefocus-4313	109	4	peak	peak	NOUN
finefocus-4313	109	5	at	at	ADP
finefocus-4313	109	6	approximately	approximately	ADV
finefocus-4313	109	7	900	900	NUM
finefocus-4313	109	8	cm-1	cm-1	NOUN
finefocus-4313	109	9	suggests	suggest	VERB
finefocus-4313	109	10	the	the	DET
finefocus-4313	109	11	presence	presence	NOUN
finefocus-4313	109	12	of	of	ADP
finefocus-4313	109	13	a	a	DET
finefocus-4313	109	14	dior	dior	ADJ
finefocus-4313	109	15	trisubstituted	trisubstitute	VERB
finefocus-4313	109	16	alkane	alkane	NOUN
finefocus-4313	109	17	group	group	NOUN
finefocus-4313	109	18	.	.	PUNCT
finefocus-4313	110	1	discussion	discussion	NOUN
finefocus-4313	110	2	not	not	PART
finefocus-4313	110	3	much	much	ADV
finefocus-4313	110	4	is	be	AUX
finefocus-4313	110	5	known	know	VERB
finefocus-4313	110	6	about	about	ADP
finefocus-4313	110	7	this	this	DET
finefocus-4313	110	8	likely	likely	ADJ
finefocus-4313	110	9	pseudomonas	pseudomona	NOUN
finefocus-4313	110	10	sp	sp	NOUN
finefocus-4313	110	11	.	.	PUNCT
finefocus-4313	111	1	that	that	PRON
finefocus-4313	111	2	produces	produce	VERB
finefocus-4313	111	3	the	the	DET
finefocus-4313	111	4	novel	novel	ADJ
finefocus-4313	111	5	antimicrobial	antimicrobial	ADJ
finefocus-4313	111	6	compound	compound	NOUN
finefocus-4313	111	7	anietocin	anietocin	NOUN
finefocus-4313	111	8	but	but	CCONJ
finefocus-4313	111	9	the	the	DET
finefocus-4313	111	10	outcomes	outcome	NOUN
finefocus-4313	111	11	of	of	ADP
finefocus-4313	111	12	the	the	DET
finefocus-4313	111	13	spot	spot	NOUN
finefocus-4313	111	14	testing	testing	NOUN
finefocus-4313	111	15	experiment	experiment	NOUN
finefocus-4313	111	16	across	across	ADP
finefocus-4313	111	17	a	a	DET
finefocus-4313	111	18	battery	battery	NOUN
finefocus-4313	111	19	of	of	ADP
finefocus-4313	111	20	safe	safe	ADJ
finefocus-4313	111	21	eskape	eskape	NOUN
finefocus-4313	111	22	relatives	relative	NOUN
finefocus-4313	111	23	and	and	CCONJ
finefocus-4313	111	24	including	include	VERB
finefocus-4313	111	25	an	an	DET
finefocus-4313	111	26	eskape	eskape	NOUN
finefocus-4313	111	27	pathogen	pathogen	NOUN
finefocus-4313	111	28	itself	itself	PRON
finefocus-4313	111	29	suggest	suggest	VERB
finefocus-4313	111	30	that	that	SCONJ
finefocus-4313	111	31	it	it	PRON
finefocus-4313	111	32	could	could	AUX
finefocus-4313	111	33	well	well	ADV
finefocus-4313	111	34	become	become	VERB
finefocus-4313	111	35	an	an	DET
finefocus-4313	111	36	effective	effective	ADJ
finefocus-4313	111	37	antimicrobial	antimicrobial	ADJ
finefocus-4313	111	38	compound	compound	NOUN
finefocus-4313	111	39	.	.	PUNCT
finefocus-4313	112	1	a	a	DET
finefocus-4313	112	2	much	much	ADV
finefocus-4313	112	3	better	well	ADJ
finefocus-4313	112	4	outcome	outcome	NOUN
finefocus-4313	112	5	is	be	AUX
finefocus-4313	112	6	seen	see	VERB
finefocus-4313	112	7	when	when	SCONJ
finefocus-4313	112	8	tested	test	VERB
finefocus-4313	112	9	on	on	ADP
finefocus-4313	112	10	grampositives	grampositive	NOUN
finefocus-4313	112	11	than	than	ADP
finefocus-4313	112	12	on	on	ADP
finefocus-4313	112	13	gram	gram	NOUN
finefocus-4313	112	14	-	-	PUNCT
finefocus-4313	112	15	negatives	negative	NOUN
finefocus-4313	112	16	,	,	PUNCT
finefocus-4313	112	17	with	with	ADP
finefocus-4313	112	18	s.	s.	PROPN
finefocus-4313	112	19	epidermidis	epidermidis	PROPN
finefocus-4313	112	20	showing	show	VERB
finefocus-4313	112	21	an	an	DET
finefocus-4313	112	22	outstanding	outstanding	ADJ
finefocus-4313	112	23	level	level	NOUN
finefocus-4313	112	24	of	of	ADP
finefocus-4313	112	25	sensitivity	sensitivity	NOUN
finefocus-4313	112	26	when	when	SCONJ
finefocus-4313	112	27	exposed	expose	VERB
finefocus-4313	112	28	to	to	ADP
finefocus-4313	112	29	anietocin	anietocin	PROPN
finefocus-4313	112	30	.	.	PUNCT
finefocus-4313	113	1	as	as	SCONJ
finefocus-4313	113	2	s.	s.	PROPN
finefocus-4313	113	3	epidermidis	epidermidis	PROPN
finefocus-4313	113	4	is	be	AUX
finefocus-4313	113	5	the	the	DET
finefocus-4313	113	6	safe	safe	ADJ
finefocus-4313	113	7	version	version	NOUN
finefocus-4313	113	8	of	of	ADP
finefocus-4313	113	9	the	the	DET
finefocus-4313	113	10	eskape	eskape	NOUN
finefocus-4313	113	11	pathogen	pathogen	NOUN
finefocus-4313	113	12	s.	s.	PROPN
finefocus-4313	113	13	aureus	aureus	PROPN
finefocus-4313	113	14	,	,	PUNCT
finefocus-4313	113	15	we	we	PRON
finefocus-4313	113	16	are	be	AUX
finefocus-4313	113	17	hopeful	hopeful	ADJ
finefocus-4313	113	18	that	that	SCONJ
finefocus-4313	113	19	this	this	DET
finefocus-4313	113	20	positive	positive	ADJ
finefocus-4313	113	21	result	result	NOUN
finefocus-4313	113	22	will	will	AUX
finefocus-4313	113	23	be	be	AUX
finefocus-4313	113	24	replicated	replicate	VERB
finefocus-4313	113	25	when	when	SCONJ
finefocus-4313	113	26	tried	try	VERB
finefocus-4313	113	27	on	on	ADP
finefocus-4313	113	28	it	it	PRON
finefocus-4313	113	29	.	.	PUNCT
finefocus-4313	114	1	the	the	DET
finefocus-4313	114	2	preliminary	preliminary	ADJ
finefocus-4313	114	3	results	result	NOUN
finefocus-4313	114	4	obtained	obtain	VERB
finefocus-4313	114	5	show	show	VERB
finefocus-4313	114	6	the	the	DET
finefocus-4313	114	7	superiority	superiority	NOUN
finefocus-4313	114	8	of	of	ADP
finefocus-4313	114	9	anietocin	anietocin	NOUN
finefocus-4313	114	10	on	on	ADP
finefocus-4313	114	11	s.	s.	PROPN
finefocus-4313	114	12	epidermidis	epidermidis	PROPN
finefocus-4313	114	13	by	by	ADP
finefocus-4313	114	14	the	the	DET
finefocus-4313	114	15	observed	observe	VERB
finefocus-4313	114	16	and	and	CCONJ
finefocus-4313	114	17	measured	measured	ADJ
finefocus-4313	114	18	zones	zone	NOUN
finefocus-4313	114	19	of	of	ADP
finefocus-4313	114	20	inhibition	inhibition	NOUN
finefocus-4313	114	21	using	use	VERB
finefocus-4313	114	22	only	only	ADV
finefocus-4313	114	23	the	the	DET
finefocus-4313	114	24	crude	crude	ADJ
finefocus-4313	114	25	extract	extract	NOUN
finefocus-4313	114	26	when	when	SCONJ
finefocus-4313	114	27	compared	compare	VERB
finefocus-4313	114	28	to	to	ADP
finefocus-4313	114	29	10u	10u	NOUN
finefocus-4313	114	30	penicillin	penicillin	PROPN
finefocus-4313	114	31	.	.	PUNCT
finefocus-4313	115	1	we	we	PRON
finefocus-4313	115	2	hypothesize	hypothesize	VERB
finefocus-4313	115	3	that	that	SCONJ
finefocus-4313	115	4	a	a	DET
finefocus-4313	115	5	cleaned	clean	VERB
finefocus-4313	115	6	up	up	ADP
finefocus-4313	115	7	and	and	CCONJ
finefocus-4313	115	8	pure	pure	ADJ
finefocus-4313	115	9	anietocin	anietocin	NOUN
finefocus-4313	115	10	compound	compound	NOUN
finefocus-4313	115	11	will	will	AUX
finefocus-4313	115	12	effectively	effectively	ADV
finefocus-4313	115	13	confirm	confirm	VERB
finefocus-4313	115	14	this	this	DET
finefocus-4313	115	15	superiority	superiority	NOUN
finefocus-4313	115	16	by	by	ADP
finefocus-4313	115	17	giving	give	VERB
finefocus-4313	115	18	much	much	ADV
finefocus-4313	115	19	wider	wide	ADJ
finefocus-4313	115	20	zones	zone	NOUN
finefocus-4313	115	21	of	of	ADP
finefocus-4313	115	22	inhibition	inhibition	NOUN
finefocus-4313	115	23	with	with	ADP
finefocus-4313	115	24	lower	low	ADJ
finefocus-4313	115	25	minimal	minimal	ADJ
finefocus-4313	115	26	inhibitory	inhibitory	ADJ
finefocus-4313	115	27	concentration	concentration	NOUN
finefocus-4313	115	28	(	(	PUNCT
finefocus-4313	115	29	mic	mic	ADJ
finefocus-4313	115	30	)	)	PUNCT
finefocus-4313	115	31	values	value	NOUN
finefocus-4313	115	32	.	.	PUNCT
finefocus-4313	116	1	our	our	PRON
finefocus-4313	116	2	next	next	ADJ
finefocus-4313	116	3	focus	focus	NOUN
finefocus-4313	116	4	is	be	AUX
finefocus-4313	116	5	to	to	PART
finefocus-4313	116	6	purify	purify	VERB
finefocus-4313	116	7	the	the	DET
finefocus-4313	116	8	anietocin	anietocin	NOUN
finefocus-4313	116	9	antimicrobial	antimicrobial	ADJ
finefocus-4313	116	10	compound	compound	NOUN
finefocus-4313	116	11	,	,	PUNCT
finefocus-4313	116	12	determine	determine	VERB
finefocus-4313	116	13	its	its	PRON
finefocus-4313	116	14	chemical	chemical	NOUN
finefocus-4313	116	15	structure	structure	NOUN
finefocus-4313	116	16	,	,	PUNCT
finefocus-4313	116	17	minimal	minimal	ADJ
finefocus-4313	116	18	inhibitory	inhibitory	ADJ
finefocus-4313	116	19	concentration	concentration	NOUN
finefocus-4313	116	20	based	base	VERB
finefocus-4313	116	21	on	on	ADP
finefocus-4313	116	22	the	the	DET
finefocus-4313	116	23	european	european	PROPN
finefocus-4313	116	24	committee	committee	PROPN
finefocus-4313	116	25	on	on	ADP
finefocus-4313	116	26	antimicrobial	antimicrobial	ADJ
finefocus-4313	116	27	susceptibility	susceptibility	NOUN
finefocus-4313	116	28	testing	testing	NOUN
finefocus-4313	116	29	(	(	PUNCT
finefocus-4313	116	30	eucast	eucast	NOUN
finefocus-4313	116	31	)	)	PUNCT
finefocus-4313	116	32	guidelines	guideline	NOUN
finefocus-4313	116	33	,	,	PUNCT
finefocus-4313	116	34	the	the	DET
finefocus-4313	116	35	full	full	ADJ
finefocus-4313	116	36	genome	genome	NOUN
finefocus-4313	116	37	analyses	analysis	NOUN
finefocus-4313	116	38	of	of	ADP
finefocus-4313	116	39	the	the	DET
finefocus-4313	116	40	suspected	suspect	VERB
finefocus-4313	116	41	pseudomonas	pseudomona	NOUN
finefocus-4313	116	42	spp	spp	NOUN
finefocus-4313	116	43	.	.	PUNCT
finefocus-4313	117	1	and	and	CCONJ
finefocus-4313	117	2	other	other	ADJ
finefocus-4313	117	3	studies	study	NOUN
finefocus-4313	117	4	that	that	PRON
finefocus-4313	117	5	will	will	AUX
finefocus-4313	117	6	assist	assist	VERB
finefocus-4313	117	7	in	in	ADP
finefocus-4313	117	8	moving	move	VERB
finefocus-4313	117	9	it	it	PRON
finefocus-4313	117	10	from	from	ADP
finefocus-4313	117	11	laboratory	laboratory	NOUN
finefocus-4313	117	12	to	to	ADP
finefocus-4313	117	13	the	the	DET
finefocus-4313	117	14	pharmacy	pharmacy	NOUN
finefocus-4313	117	15	.	.	PUNCT
finefocus-4313	118	1	the	the	DET
finefocus-4313	118	2	result	result	NOUN
finefocus-4313	118	3	of	of	ADP
finefocus-4313	118	4	16s	16	NOUN
finefocus-4313	118	5	rrna	rrna	PROPN
finefocus-4313	118	6	genes	gene	NOUN
finefocus-4313	118	7	sequencing	sequence	VERB
finefocus-4313	118	8	analysis	analysis	NOUN
finefocus-4313	118	9	(	(	PUNCT
finefocus-4313	118	10	genbank	genbank	NOUN
finefocus-4313	118	11	accession	accession	NOUN
finefocus-4313	118	12	number	number	NOUN
finefocus-4313	118	13	on964909	on964909	NOUN
finefocus-4313	118	14	,	,	PUNCT
finefocus-4313	118	15	seqidanieto	seqidanieto	NOUN
finefocus-4313	118	16	)	)	PUNCT
finefocus-4313	118	17	,	,	PUNCT
finefocus-4313	118	18	suggests	suggest	VERB
finefocus-4313	118	19	the	the	DET
finefocus-4313	118	20	likelihood	likelihood	NOUN
finefocus-4313	118	21	of	of	ADP
finefocus-4313	118	22	a	a	DET
finefocus-4313	118	23	relationship	relationship	NOUN
finefocus-4313	118	24	with	with	ADP
finefocus-4313	118	25	the	the	DET
finefocus-4313	118	26	genus	genus	PROPN
finefocus-4313	118	27	pseudomonas	pseudomona	NOUN
finefocus-4313	118	28	,	,	PUNCT
finefocus-4313	118	29	azotobacter	azotobacter	NOUN
finefocus-4313	118	30	,	,	PUNCT
finefocus-4313	118	31	halopseudomonas	halopseudomona	NOUN
finefocus-4313	118	32	,	,	PUNCT
finefocus-4313	118	33	atopomonas	atopomona	NOUN
finefocus-4313	118	34	,	,	PUNCT
finefocus-4313	118	35	and	and	CCONJ
finefocus-4313	118	36	azorhizophilus	azorhizophilus	ADJ
finefocus-4313	118	37	.	.	PUNCT
finefocus-4313	119	1	the	the	DET
finefocus-4313	119	2	closest	close	ADJ
finefocus-4313	119	3	matches	match	NOUN
finefocus-4313	119	4	with	with	ADP
finefocus-4313	119	5	a	a	DET
finefocus-4313	119	6	max	max	NOUN
finefocus-4313	119	7	score	score	NOUN
finefocus-4313	119	8	and	and	CCONJ
finefocus-4313	119	9	total	total	ADJ
finefocus-4313	119	10	score	score	NOUN
finefocus-4313	119	11	of	of	ADP
finefocus-4313	119	12	723	723	NUM
finefocus-4313	119	13	and	and	CCONJ
finefocus-4313	119	14	86	86	NUM
finefocus-4313	119	15	%	%	NOUN
finefocus-4313	119	16	percent	percent	NOUN
finefocus-4313	119	17	identities	identity	NOUN
finefocus-4313	119	18	suggest	suggest	VERB
finefocus-4313	119	19	a	a	DET
finefocus-4313	119	20	possible	possible	ADJ
finefocus-4313	119	21	closer	close	ADJ
finefocus-4313	119	22	relationship	relationship	NOUN
finefocus-4313	119	23	with	with	ADP
finefocus-4313	119	24	p.	p.	NOUN
finefocus-4313	119	25	aeruginosa	aeruginosa	PROPN
finefocus-4313	119	26	strains	strain	VERB
finefocus-4313	119	27	ddm	ddm	PROPN
finefocus-4313	119	28	50071	50071	NUM
finefocus-4313	119	29	,	,	PUNCT
finefocus-4313	119	30	nbrc	nbrc	NOUN
finefocus-4313	119	31	12689	12689	NUM
finefocus-4313	119	32	and	and	CCONJ
finefocus-4313	119	33	atcc	atcc	ADJ
finefocus-4313	119	34	10145	10145	NUM
finefocus-4313	119	35	(	(	PUNCT
finefocus-4313	119	36	genbank	genbank	NOUN
finefocus-4313	119	37	accession	accession	NOUN
finefocus-4313	119	38	numbers	number	NOUN
finefocus-4313	119	39	nr_117678.1	nr_117678.1	ADV
finefocus-4313	119	40	,	,	PUNCT
finefocus-4313	119	41	nr_113599.1	nr_113599.1	PROPN
finefocus-4313	119	42	and	and	CCONJ
finefocus-4313	119	43	nr_114471.1	nr_114471.1	NOUN
finefocus-4313	119	44	respectively	respectively	ADV
finefocus-4313	119	45	)	)	PUNCT
finefocus-4313	119	46	.	.	PUNCT
finefocus-4313	120	1	considering	consider	VERB
finefocus-4313	120	2	the	the	DET
finefocus-4313	120	3	unique	unique	ADJ
finefocus-4313	120	4	nature	nature	NOUN
finefocus-4313	120	5	of	of	ADP
finefocus-4313	120	6	this	this	DET
finefocus-4313	120	7	isolate	isolate	NOUN
finefocus-4313	120	8	by	by	ADP
finefocus-4313	120	9	its	its	PRON
finefocus-4313	120	10	ability	ability	NOUN
finefocus-4313	120	11	to	to	PART
finefocus-4313	120	12	produce	produce	VERB
finefocus-4313	120	13	an	an	DET
finefocus-4313	120	14	antimicrobial	antimicrobial	ADJ
finefocus-4313	120	15	compound	compound	NOUN
finefocus-4313	120	16	,	,	PUNCT
finefocus-4313	120	17	previously	previously	ADV
finefocus-4313	120	18	undescribed	undescribe	VERB
finefocus-4313	120	19	as	as	ADV
finefocus-4313	120	20	far	far	ADV
finefocus-4313	120	21	as	as	SCONJ
finefocus-4313	120	22	we	we	PRON
finefocus-4313	120	23	are	be	AUX
finefocus-4313	120	24	aware	aware	ADJ
finefocus-4313	120	25	,	,	PUNCT
finefocus-4313	120	26	we	we	PRON
finefocus-4313	120	27	hypothesize	hypothesize	VERB
finefocus-4313	120	28	that	that	SCONJ
finefocus-4313	120	29	this	this	PRON
finefocus-4313	120	30	suggested	suggest	VERB
finefocus-4313	120	31	pseudomonas	pseudomona	NOUN
finefocus-4313	120	32	spp	spp	NOUN
finefocus-4313	120	33	.	.	PUNCT
finefocus-4313	120	34	is	be	AUX
finefocus-4313	120	35	likely	likely	ADJ
finefocus-4313	120	36	a	a	DET
finefocus-4313	120	37	new	new	ADJ
finefocus-4313	120	38	addition	addition	NOUN
finefocus-4313	120	39	to	to	ADP
finefocus-4313	120	40	the	the	DET
finefocus-4313	120	41	genus	genus	NOUN
finefocus-4313	120	42	or	or	CCONJ
finefocus-4313	120	43	a	a	DET
finefocus-4313	120	44	sub	sub	NOUN
finefocus-4313	120	45	-	-	NOUN
finefocus-4313	120	46	specie	specie	NOUN
finefocus-4313	120	47	at	at	ADP
finefocus-4313	120	48	the	the	DET
finefocus-4313	120	49	minimum	minimum	NOUN
finefocus-4313	120	50	.	.	PUNCT
finefocus-4313	121	1	its	its	PRON
finefocus-4313	121	2	antimicrobial	antimicrobial	ADJ
finefocus-4313	121	3	compound	compound	NOUN
finefocus-4313	121	4	is	be	AUX
finefocus-4313	121	5	equally	equally	ADV
finefocus-4313	121	6	novel	novel	ADJ
finefocus-4313	121	7	based	base	VERB
finefocus-4313	121	8	on	on	ADP
finefocus-4313	121	9	the	the	DET
finefocus-4313	121	10	observed	observe	VERB
finefocus-4313	121	11	preliminary	preliminary	ADJ
finefocus-4313	121	12	results	result	NOUN
finefocus-4313	121	13	and	and	CCONJ
finefocus-4313	121	14	therefore	therefore	ADV
finefocus-4313	121	15	referred	refer	VERB
finefocus-4313	121	16	to	to	ADP
finefocus-4313	121	17	as	as	ADP
finefocus-4313	121	18	“	"	PUNCT
finefocus-4313	121	19	anietocin	anietocin	NOUN
finefocus-4313	121	20	”	"	PUNCT
finefocus-4313	121	21	for	for	ADP
finefocus-4313	121	22	the	the	DET
finefocus-4313	121	23	purposes	purpose	NOUN
finefocus-4313	121	24	of	of	ADP
finefocus-4313	121	25	proper	proper	ADJ
finefocus-4313	121	26	identification	identification	NOUN
finefocus-4313	121	27	.	.	PUNCT
finefocus-4313	122	1	the	the	DET
finefocus-4313	122	2	results	result	NOUN
finefocus-4313	122	3	of	of	ADP
finefocus-4313	122	4	the	the	DET
finefocus-4313	122	5	infra	infra	NOUN
finefocus-4313	122	6	-	-	PUNCT
finefocus-4313	122	7	red	red	ADJ
finefocus-4313	122	8	spectroscopy	spectroscopy	NOUN
finefocus-4313	122	9	analyses	analysis	NOUN
finefocus-4313	122	10	,	,	PUNCT
finefocus-4313	122	11	suggest	suggest	VERB
finefocus-4313	122	12	the	the	DET
finefocus-4313	122	13	possible	possible	ADJ
finefocus-4313	122	14	presence	presence	NOUN
finefocus-4313	122	15	of	of	ADP
finefocus-4313	122	16	alkenes	alkene	NOUN
finefocus-4313	122	17	(=	(=	NOUN
finefocus-4313	123	1	c	c	X
finefocus-4313	123	2	-	-	PUNCT
finefocus-4313	123	3	h	h	NOUN
finefocus-4313	123	4	)	)	PUNCT
finefocus-4313	123	5	and	and	CCONJ
finefocus-4313	123	6	alkanes	alkane	NOUN
finefocus-4313	123	7	(	(	PUNCT
finefocus-4313	123	8	c	c	NOUN
finefocus-4313	123	9	-	-	PUNCT
finefocus-4313	123	10	h	h	NOUN
finefocus-4313	123	11	)	)	PUNCT
finefocus-4313	123	12	functional	functional	ADJ
finefocus-4313	123	13	groups	group	NOUN
finefocus-4313	123	14	with	with	ADP
finefocus-4313	123	15	peaks	peak	NOUN
finefocus-4313	123	16	seen	see	VERB
finefocus-4313	123	17	at	at	ADP
finefocus-4313	123	18	3100	3100	NUM
finefocus-4313	123	19	-	-	SYM
finefocus-4313	123	20	2900	2900	NUM
finefocus-4313	123	21	cm-1	cm-1	NOUN
finefocus-4313	123	22	regions	region	NOUN
finefocus-4313	123	23	;	;	PUNCT
finefocus-4313	123	24	however	however	ADV
finefocus-4313	123	25	,	,	PUNCT
finefocus-4313	123	26	this	this	PRON
finefocus-4313	123	27	can	can	AUX
finefocus-4313	123	28	be	be	AUX
finefocus-4313	123	29	regarded	regard	VERB
finefocus-4313	123	30	as	as	ADP
finefocus-4313	123	31	inconclusive	inconclusive	ADJ
finefocus-4313	123	32	because	because	SCONJ
finefocus-4313	123	33	the	the	DET
finefocus-4313	123	34	peaks	peak	NOUN
finefocus-4313	123	35	appear	appear	VERB
finefocus-4313	123	36	weak	weak	ADJ
finefocus-4313	123	37	which	which	PRON
finefocus-4313	123	38	does	do	AUX
finefocus-4313	123	39	not	not	PART
finefocus-4313	123	40	correlate	correlate	VERB
finefocus-4313	123	41	with	with	ADP
finefocus-4313	123	42	the	the	DET
finefocus-4313	123	43	description	description	NOUN
finefocus-4313	123	44	of	of	ADP
finefocus-4313	123	45	known	know	VERB
finefocus-4313	123	46	peaks	peak	NOUN
finefocus-4313	123	47	at	at	ADP
finefocus-4313	123	48	the	the	DET
finefocus-4313	123	49	same	same	ADJ
finefocus-4313	123	50	region	region	NOUN
finefocus-4313	123	51	.	.	PUNCT
finefocus-4313	124	1	this	this	DET
finefocus-4313	124	2	weak	weak	ADJ
finefocus-4313	124	3	appearance	appearance	NOUN
finefocus-4313	124	4	could	could	AUX
finefocus-4313	124	5	be	be	AUX
finefocus-4313	124	6	a	a	DET
finefocus-4313	124	7	function	function	NOUN
finefocus-4313	124	8	of	of	ADP
finefocus-4313	124	9	the	the	DET
finefocus-4313	124	10	crude	crude	ADJ
finefocus-4313	124	11	nature	nature	NOUN
finefocus-4313	124	12	of	of	ADP
finefocus-4313	124	13	the	the	DET
finefocus-4313	124	14	extract	extract	NOUN
finefocus-4313	124	15	,	,	PUNCT
finefocus-4313	124	16	with	with	ADP
finefocus-4313	124	17	numerous	numerous	ADJ
finefocus-4313	124	18	artifacts	artifact	NOUN
finefocus-4313	124	19	interfering	interfere	VERB
finefocus-4313	124	20	with	with	ADP
finefocus-4313	124	21	the	the	DET
finefocus-4313	124	22	analyses	analysis	NOUN
finefocus-4313	124	23	.	.	PUNCT
finefocus-4313	125	1	a	a	DET
finefocus-4313	125	2	critical	critical	ADJ
finefocus-4313	125	3	look	look	NOUN
finefocus-4313	125	4	at	at	ADP
finefocus-4313	125	5	the	the	DET
finefocus-4313	125	6	fingerprint	fingerprint	NOUN
finefocus-4313	125	7	region	region	NOUN
finefocus-4313	125	8	of	of	ADP
finefocus-4313	125	9	the	the	DET
finefocus-4313	125	10	infra	infra	NOUN
finefocus-4313	125	11	-	-	PUNCT
finefocus-4313	125	12	red	red	ADJ
finefocus-4313	125	13	spectroscopy	spectroscopy	NOUN
finefocus-4313	125	14	analyses	analysis	NOUN
finefocus-4313	125	15	suggests	suggest	VERB
finefocus-4313	125	16	the	the	DET
finefocus-4313	125	17	likelihood	likelihood	NOUN
finefocus-4313	125	18	of	of	ADP
finefocus-4313	125	19	the	the	DET
finefocus-4313	125	20	presence	presence	NOUN
finefocus-4313	125	21	of	of	ADP
finefocus-4313	125	22	methyl	methyl	NOUN
finefocus-4313	125	23	or	or	CCONJ
finefocus-4313	125	24	methylene	methylene	NOUN
finefocus-4313	125	25	groups	group	NOUN
finefocus-4313	125	26	(	(	PUNCT
finefocus-4313	125	27	c	c	X
finefocus-4313	125	28	-	-	PUNCT
finefocus-4313	125	29	h	h	NOUN
finefocus-4313	125	30	bending	bending	NOUN
finefocus-4313	125	31	)	)	PUNCT
finefocus-4313	125	32	with	with	ADP
finefocus-4313	125	33	medium	medium	ADJ
finefocus-4313	125	34	sized	sized	ADJ
finefocus-4313	125	35	peaks	peak	NOUN
finefocus-4313	125	36	at	at	ADP
finefocus-4313	125	37	around	around	ADP
finefocus-4313	125	38	1500	1500	NUM
finefocus-4313	125	39	-	-	SYM
finefocus-4313	125	40	1450	1450	NUM
finefocus-4313	125	41	110	110	NUM
finefocus-4313	125	42	|	|	ADV
finefocus-4313	125	43	fine	fine	ADJ
finefocus-4313	125	44	focus	focus	NOUN
finefocus-4313	125	45	references	reference	NOUN
finefocus-4313	125	46	1	1	NUM
finefocus-4313	125	47	.	.	X
finefocus-4313	125	48	aslam	aslam	PROPN
finefocus-4313	125	49	,	,	PUNCT
finefocus-4313	125	50	b.	b.	PROPN
finefocus-4313	125	51	,	,	PUNCT
finefocus-4313	125	52	wang	wang	PROPN
finefocus-4313	125	53	,	,	PUNCT
finefocus-4313	125	54	w.	w.	PROPN
finefocus-4313	125	55	,	,	PUNCT
finefocus-4313	125	56	arshad	arshad	PROPN
finefocus-4313	125	57	,	,	PUNCT
finefocus-4313	125	58	m.	m.	NOUN
finefocus-4313	125	59	i.	i.	PROPN
finefocus-4313	125	60	,	,	PUNCT
finefocus-4313	125	61	khurshid	khurshid	PROPN
finefocus-4313	125	62	,	,	PUNCT
finefocus-4313	125	63	m.	m.	NOUN
finefocus-4313	125	64	,	,	PUNCT
finefocus-4313	125	65	muzammil	muzammil	PROPN
finefocus-4313	125	66	,	,	PUNCT
finefocus-4313	125	67	s.	s.	PROPN
finefocus-4313	125	68	,	,	PUNCT
finefocus-4313	125	69	rasool	rasool	PROPN
finefocus-4313	125	70	,	,	PUNCT
finefocus-4313	125	71	m.	m.	PROPN
finefocus-4313	125	72	h.	h.	PROPN
finefocus-4313	125	73	,	,	PUNCT
finefocus-4313	125	74	nisar	nisar	PROPN
finefocus-4313	125	75	,	,	PUNCT
finefocus-4313	125	76	m.	m.	NOUN
finefocus-4313	125	77	a.	a.	PROPN
finefocus-4313	125	78	,	,	PUNCT
finefocus-4313	125	79	alvi	alvi	PROPN
finefocus-4313	125	80	,	,	PUNCT
finefocus-4313	125	81	r.	r.	PROPN
finefocus-4313	125	82	f.	f.	PROPN
finefocus-4313	125	83	,	,	PUNCT
finefocus-4313	125	84	aslam	aslam	PROPN
finefocus-4313	125	85	,	,	PUNCT
finefocus-4313	125	86	m.	m.	NOUN
finefocus-4313	125	87	a.	a.	PROPN
finefocus-4313	125	88	,	,	PUNCT
finefocus-4313	125	89	qamar	qamar	PROPN
finefocus-4313	125	90	,	,	PUNCT
finefocus-4313	125	91	m.	m.	NOUN
finefocus-4313	125	92	u.	u.	PROPN
finefocus-4313	125	93	,	,	PUNCT
finefocus-4313	125	94	salamat	salamat	PROPN
finefocus-4313	125	95	,	,	PUNCT
finefocus-4313	125	96	m.	m.	PROPN
finefocus-4313	125	97	k.	k.	PROPN
finefocus-4313	125	98	f.	f.	PROPN
finefocus-4313	125	99	&	&	CCONJ
finefocus-4313	125	100	baloch	baloch	PROPN
finefocus-4313	125	101	,	,	PUNCT
finefocus-4313	125	102	z.	z.	PROPN
finefocus-4313	125	103	2018	2018	NUM
finefocus-4313	125	104	.	.	PUNCT
finefocus-4313	126	1	antibiotic	antibiotic	ADJ
finefocus-4313	126	2	resistance	resistance	NOUN
finefocus-4313	126	3	:	:	PUNCT
finefocus-4313	126	4	a	a	DET
finefocus-4313	126	5	rundown	rundown	NOUN
finefocus-4313	126	6	of	of	ADP
finefocus-4313	126	7	a	a	DET
finefocus-4313	126	8	global	global	ADJ
finefocus-4313	126	9	crisis	crisis	NOUN
finefocus-4313	126	10	.	.	PUNCT
finefocus-4313	127	1	infect	infect	VERB
finefocus-4313	127	2	drug	drug	NOUN
finefocus-4313	127	3	resist	resist	NOUN
finefocus-4313	127	4	,	,	PUNCT
finefocus-4313	127	5	11	11	NUM
finefocus-4313	127	6	,	,	PUNCT
finefocus-4313	127	7	1645	1645	NUM
finefocus-4313	127	8	-	-	SYM
finefocus-4313	127	9	1658	1658	NUM
finefocus-4313	127	10	.	.	PUNCT
finefocus-4313	128	1	2	2	X
finefocus-4313	128	2	.	.	X
finefocus-4313	128	3	ballén	ballén	NOUN
finefocus-4313	128	4	,	,	PUNCT
finefocus-4313	128	5	v.	v.	ADV
finefocus-4313	128	6	,	,	PUNCT
finefocus-4313	128	7	gabasa	gabasa	PROPN
finefocus-4313	128	8	,	,	PUNCT
finefocus-4313	128	9	y.	y.	PROPN
finefocus-4313	128	10	,	,	PUNCT
finefocus-4313	128	11	ratia	ratia	PROPN
finefocus-4313	128	12	,	,	PUNCT
finefocus-4313	128	13	c.	c.	PROPN
finefocus-4313	128	14	,	,	PUNCT
finefocus-4313	128	15	ortega	ortega	PROPN
finefocus-4313	128	16	,	,	PUNCT
finefocus-4313	128	17	r.	r.	PROPN
finefocus-4313	128	18	,	,	PUNCT
finefocus-4313	128	19	tejero	tejero	NOUN
finefocus-4313	128	20	,	,	PUNCT
finefocus-4313	128	21	m.	m.	NOUN
finefocus-4313	128	22	&	&	CCONJ
finefocus-4313	128	23	soto	soto	PROPN
finefocus-4313	128	24	,	,	PUNCT
finefocus-4313	128	25	s.	s.	PROPN
finefocus-4313	128	26	2021	2021	NUM
finefocus-4313	128	27	.	.	PUNCT
finefocus-4313	129	1	antibiotic	antibiotic	ADJ
finefocus-4313	129	2	resistance	resistance	NOUN
finefocus-4313	129	3	and	and	CCONJ
finefocus-4313	129	4	virulence	virulence	NOUN
finefocus-4313	129	5	profiles	profile	NOUN
finefocus-4313	129	6	of	of	ADP
finefocus-4313	129	7	klebsiella	klebsiella	NOUN
finefocus-4313	129	8	pneumoniae	pneumoniae	ADJ
finefocus-4313	129	9	strains	strain	NOUN
finefocus-4313	129	10	isolated	isolate	VERB
finefocus-4313	129	11	from	from	ADP
finefocus-4313	129	12	different	different	ADJ
finefocus-4313	129	13	clinical	clinical	ADJ
finefocus-4313	129	14	sources	source	NOUN
finefocus-4313	129	15	.	.	PUNCT
finefocus-4313	130	1	frontiers	frontier	NOUN
finefocus-4313	130	2	in	in	ADP
finefocus-4313	130	3	cellular	cellular	ADJ
finefocus-4313	130	4	and	and	CCONJ
finefocus-4313	130	5	infection	infection	NOUN
finefocus-4313	130	6	microbiology	microbiology	NOUN
finefocus-4313	130	7	,	,	PUNCT
finefocus-4313	130	8	11	11	NUM
finefocus-4313	130	9	.	.	NOUN
finefocus-4313	130	10	3	3	X
finefocus-4313	130	11	.	.	X
finefocus-4313	131	1	behroozian	behroozian	PROPN
finefocus-4313	131	2	,	,	PUNCT
finefocus-4313	131	3	s.	s.	PROPN
finefocus-4313	131	4	,	,	PUNCT
finefocus-4313	131	5	svensson	svensson	PROPN
finefocus-4313	131	6	,	,	PUNCT
finefocus-4313	131	7	s.	s.	PROPN
finefocus-4313	131	8	l.	l.	PROPN
finefocus-4313	131	9	&	&	CCONJ
finefocus-4313	131	10	davies	davies	PROPN
finefocus-4313	131	11	,	,	PUNCT
finefocus-4313	131	12	j.	j.	PROPN
finefocus-4313	131	13	2016	2016	NUM
finefocus-4313	131	14	.	.	PUNCT
finefocus-4313	132	1	kisameet	kisameet	NOUN
finefocus-4313	132	2	clay	clay	NOUN
finefocus-4313	132	3	exhibits	exhibit	VERB
finefocus-4313	132	4	potent	potent	ADJ
finefocus-4313	132	5	antibacterial	antibacterial	ADJ
finefocus-4313	132	6	activity	activity	NOUN
finefocus-4313	132	7	against	against	ADP
finefocus-4313	132	8	the	the	DET
finefocus-4313	132	9	eskape	eskape	NOUN
finefocus-4313	132	10	pathogens	pathogen	NOUN
finefocus-4313	132	11	.	.	PUNCT
finefocus-4313	133	1	mbio	mbio	PROPN
finefocus-4313	133	2	,	,	PUNCT
finefocus-4313	133	3	7	7	NUM
finefocus-4313	133	4	,	,	PUNCT
finefocus-4313	133	5	e01842	e01842	VERB
finefocus-4313	133	6	-	-	PUNCT
finefocus-4313	133	7	15	15	NUM
finefocus-4313	133	8	.	.	NOUN
finefocus-4313	134	1	4	4	NUM
finefocus-4313	134	2	.	.	X
finefocus-4313	134	3	darabpour	darabpour	PROPN
finefocus-4313	134	4	,	,	PUNCT
finefocus-4313	134	5	e.	e.	PROPN
finefocus-4313	134	6	,	,	PUNCT
finefocus-4313	134	7	ardakani	ardakani	PROPN
finefocus-4313	134	8	,	,	PUNCT
finefocus-4313	134	9	m.	m.	PROPN
finefocus-4313	134	10	r.	r.	PROPN
finefocus-4313	134	11	,	,	PUNCT
finefocus-4313	134	12	motamedi	motamedi	PROPN
finefocus-4313	134	13	,	,	PUNCT
finefocus-4313	134	14	h.	h.	PROPN
finefocus-4313	134	15	,	,	PUNCT
finefocus-4313	134	16	ghezelbash	ghezelbash	NOUN
finefocus-4313	134	17	,	,	PUNCT
finefocus-4313	134	18	g.	g.	PROPN
finefocus-4313	134	19	&	&	CCONJ
finefocus-4313	134	20	ronagh	ronagh	PROPN
finefocus-4313	134	21	,	,	PUNCT
finefocus-4313	134	22	m.	m.	NOUN
finefocus-4313	134	23	t.	t.	PROPN
finefocus-4313	134	24	2010	2010	NUM
finefocus-4313	134	25	.	.	PUNCT
finefocus-4313	135	1	isolation	isolation	NOUN
finefocus-4313	135	2	of	of	ADP
finefocus-4313	135	3	an	an	DET
finefocus-4313	135	4	antibiotic	antibiotic	ADJ
finefocus-4313	135	5	producer	producer	NOUN
finefocus-4313	135	6	pseudomonas	pseudomona	NOUN
finefocus-4313	135	7	sp	sp	NOUN
finefocus-4313	135	8	from	from	ADP
finefocus-4313	135	9	the	the	DET
finefocus-4313	135	10	persian	persian	PROPN
finefocus-4313	135	11	gulf	gulf	PROPN
finefocus-4313	135	12	.	.	PUNCT
finefocus-4313	136	1	asian	asian	PROPN
finefocus-4313	136	2	pacific	pacific	PROPN
finefocus-4313	136	3	journal	journal	PROPN
finefocus-4313	136	4	of	of	ADP
finefocus-4313	136	5	tropical	tropical	ADJ
finefocus-4313	136	6	medicine	medicine	NOUN
finefocus-4313	136	7	,	,	PUNCT
finefocus-4313	136	8	3	3	NUM
finefocus-4313	136	9	,	,	PUNCT
finefocus-4313	136	10	318	318	NUM
finefocus-4313	136	11	-	-	SYM
finefocus-4313	136	12	318	318	NUM
finefocus-4313	136	13	.	.	PUNCT
finefocus-4313	137	1	5	5	NUM
finefocus-4313	137	2	.	.	X
finefocus-4313	137	3	darabpour	darabpour	PROPN
finefocus-4313	137	4	,	,	PUNCT
finefocus-4313	137	5	e.	e.	PROPN
finefocus-4313	137	6	,	,	PUNCT
finefocus-4313	137	7	roayaei	roayaei	PROPN
finefocus-4313	137	8	ardakani	ardakani	PROPN
finefocus-4313	137	9	,	,	PUNCT
finefocus-4313	137	10	m.	m.	NOUN
finefocus-4313	137	11	,	,	PUNCT
finefocus-4313	137	12	motamedi	motamedi	PROPN
finefocus-4313	137	13	,	,	PUNCT
finefocus-4313	137	14	h.	h.	PROPN
finefocus-4313	137	15	&	&	CCONJ
finefocus-4313	137	16	taghi	taghi	PROPN
finefocus-4313	137	17	ronagh	ronagh	PROPN
finefocus-4313	137	18	,	,	PUNCT
finefocus-4313	137	19	m.	m.	NOUN
finefocus-4313	137	20	2012	2012	NUM
finefocus-4313	137	21	.	.	PUNCT
finefocus-4313	138	1	isolation	isolation	NOUN
finefocus-4313	138	2	of	of	ADP
finefocus-4313	138	3	a	a	DET
finefocus-4313	138	4	potent	potent	ADJ
finefocus-4313	138	5	antibiotic	antibiotic	ADJ
finefocus-4313	138	6	producer	producer	NOUN
finefocus-4313	138	7	bacterium	bacterium	NOUN
finefocus-4313	138	8	,	,	PUNCT
finefocus-4313	138	9	especially	especially	ADV
finefocus-4313	138	10	against	against	ADP
finefocus-4313	138	11	mrsa	mrsa	NOUN
finefocus-4313	138	12	,	,	PUNCT
finefocus-4313	138	13	from	from	ADP
finefocus-4313	138	14	northern	northern	ADJ
finefocus-4313	138	15	region	region	NOUN
finefocus-4313	138	16	of	of	ADP
finefocus-4313	138	17	the	the	DET
finefocus-4313	138	18	persian	persian	PROPN
finefocus-4313	138	19	gulf	gulf	PROPN
finefocus-4313	138	20	.	.	PUNCT
finefocus-4313	139	1	bosn	bosn	PROPN
finefocus-4313	139	2	j	j	PROPN
finefocus-4313	139	3	basic	basic	ADJ
finefocus-4313	139	4	med	med	PROPN
finefocus-4313	139	5	sci	sci	PROPN
finefocus-4313	139	6	,	,	PUNCT
finefocus-4313	139	7	12	12	NUM
finefocus-4313	139	8	,	,	PUNCT
finefocus-4313	139	9	108	108	NUM
finefocus-4313	139	10	-	-	SYM
finefocus-4313	139	11	21	21	NUM
finefocus-4313	139	12	.	.	PUNCT
finefocus-4313	140	1	6	6	NUM
finefocus-4313	140	2	.	.	X
finefocus-4313	140	3	hijazi	hijazi	PROPN
finefocus-4313	140	4	,	,	PUNCT
finefocus-4313	140	5	s.	s.	PROPN
finefocus-4313	140	6	,	,	PUNCT
finefocus-4313	140	7	visaggio	visaggio	PROPN
finefocus-4313	140	8	,	,	PUNCT
finefocus-4313	140	9	d.	d.	PROPN
finefocus-4313	140	10	,	,	PUNCT
finefocus-4313	140	11	pirolo	pirolo	PROPN
finefocus-4313	140	12	,	,	PUNCT
finefocus-4313	140	13	m.	m.	NOUN
finefocus-4313	140	14	,	,	PUNCT
finefocus-4313	140	15	frangipani	frangipani	PROPN
finefocus-4313	140	16	,	,	PUNCT
finefocus-4313	140	17	e.	e.	PROPN
finefocus-4313	140	18	,	,	PUNCT
finefocus-4313	140	19	bernstein	bernstein	PROPN
finefocus-4313	140	20	,	,	PUNCT
finefocus-4313	140	21	l.	l.	PROPN
finefocus-4313	140	22	&	&	CCONJ
finefocus-4313	140	23	visca	visca	PROPN
finefocus-4313	140	24	,	,	PUNCT
finefocus-4313	140	25	p.	p.	NOUN
finefocus-4313	140	26	2018	2018	NUM
finefocus-4313	140	27	.	.	PUNCT
finefocus-4313	141	1	antimicrobial	antimicrobial	ADJ
finefocus-4313	141	2	activity	activity	NOUN
finefocus-4313	141	3	of	of	ADP
finefocus-4313	141	4	gallium	gallium	NOUN
finefocus-4313	141	5	compounds	compound	VERB
finefocus-4313	141	6	on	on	ADP
finefocus-4313	141	7	eskape	eskape	NOUN
finefocus-4313	141	8	pathogens	pathogen	NOUN
finefocus-4313	141	9	.	.	PUNCT
finefocus-4313	142	1	front	front	ADJ
finefocus-4313	142	2	cell	cell	NOUN
finefocus-4313	142	3	infect	infect	VERB
finefocus-4313	142	4	microbiol	microbiol	NOUN
finefocus-4313	142	5	,	,	PUNCT
finefocus-4313	142	6	8	8	NUM
finefocus-4313	142	7	,	,	PUNCT
finefocus-4313	142	8	316	316	NUM
finefocus-4313	142	9	.	.	NOUN
finefocus-4313	142	10	7	7	NUM
finefocus-4313	142	11	.	.	X
finefocus-4313	143	1	koulenti	koulenti	PROPN
finefocus-4313	143	2	,	,	PUNCT
finefocus-4313	143	3	d.	d.	PROPN
finefocus-4313	143	4	,	,	PUNCT
finefocus-4313	143	5	xu	xu	PROPN
finefocus-4313	143	6	,	,	PUNCT
finefocus-4313	143	7	e.	e.	PROPN
finefocus-4313	143	8	,	,	PUNCT
finefocus-4313	143	9	mok	mok	PROPN
finefocus-4313	143	10	,	,	PUNCT
finefocus-4313	143	11	i.	i.	PROPN
finefocus-4313	143	12	y.	y.	PROPN
finefocus-4313	143	13	s.	s.	PROPN
finefocus-4313	143	14	,	,	PUNCT
finefocus-4313	143	15	song	song	NOUN
finefocus-4313	143	16	,	,	PUNCT
finefocus-4313	143	17	a.	a.	NOUN
finefocus-4313	143	18	,	,	PUNCT
finefocus-4313	143	19	karageorgopoulos	karageorgopoulo	NOUN
finefocus-4313	143	20	,	,	PUNCT
finefocus-4313	143	21	d.	d.	PROPN
finefocus-4313	143	22	e.	e.	PROPN
finefocus-4313	143	23	,	,	PUNCT
finefocus-4313	143	24	armaganidis	armaganidis	PROPN
finefocus-4313	143	25	,	,	PUNCT
finefocus-4313	143	26	a.	a.	NOUN
finefocus-4313	143	27	,	,	PUNCT
finefocus-4313	143	28	lipman	lipman	PROPN
finefocus-4313	143	29	,	,	PUNCT
finefocus-4313	143	30	j.	j.	PROPN
finefocus-4313	143	31	&	&	CCONJ
finefocus-4313	143	32	tsiodras	tsiodras	PROPN
finefocus-4313	143	33	,	,	PUNCT
finefocus-4313	143	34	s.	s.	PROPN
finefocus-4313	143	35	2019	2019	NUM
finefocus-4313	143	36	.	.	PUNCT
finefocus-4313	144	1	novel	novel	ADJ
finefocus-4313	144	2	antibiotics	antibiotic	NOUN
finefocus-4313	144	3	for	for	ADP
finefocus-4313	144	4	multidrug	multidrug	NOUN
finefocus-4313	144	5	-	-	PUNCT
finefocus-4313	144	6	resistant	resistant	ADJ
finefocus-4313	144	7	gram	gram	NOUN
finefocus-4313	144	8	-	-	PUNCT
finefocus-4313	144	9	positive	positive	ADJ
finefocus-4313	144	10	microorganisms	microorganism	NOUN
finefocus-4313	144	11	.	.	PUNCT
finefocus-4313	145	1	microorganisms	microorganism	NOUN
finefocus-4313	145	2	,	,	PUNCT
finefocus-4313	145	3	7	7	NUM
finefocus-4313	145	4	.	.	NOUN
finefocus-4313	145	5	8	8	NUM
finefocus-4313	145	6	.	.	X
finefocus-4313	146	1	mulani	mulani	ADJ
finefocus-4313	146	2	,	,	PUNCT
finefocus-4313	146	3	m.	m.	NOUN
finefocus-4313	146	4	s.	s.	PROPN
finefocus-4313	146	5	,	,	PUNCT
finefocus-4313	146	6	kamble	kamble	PROPN
finefocus-4313	146	7	,	,	PUNCT
finefocus-4313	146	8	e.	e.	PROPN
finefocus-4313	146	9	e.	e.	PROPN
finefocus-4313	146	10	,	,	PUNCT
finefocus-4313	146	11	kumkar	kumkar	PROPN
finefocus-4313	146	12	,	,	PUNCT
finefocus-4313	146	13	s.	s.	PROPN
finefocus-4313	146	14	n.	n.	PROPN
finefocus-4313	146	15	,	,	PUNCT
finefocus-4313	146	16	tawre	tawre	PROPN
finefocus-4313	146	17	,	,	PUNCT
finefocus-4313	146	18	m.	m.	PROPN
finefocus-4313	146	19	s.	s.	PROPN
finefocus-4313	146	20	&	&	CCONJ
finefocus-4313	146	21	pardesi	pardesi	PROPN
finefocus-4313	146	22	,	,	PUNCT
finefocus-4313	147	1	k.	k.	PROPN
finefocus-4313	147	2	r.	r.	PROPN
finefocus-4313	147	3	2019	2019	NUM
finefocus-4313	147	4	.	.	PUNCT
finefocus-4313	148	1	emerging	emerge	VERB
finefocus-4313	148	2	strategies	strategy	NOUN
finefocus-4313	148	3	to	to	PART
finefocus-4313	148	4	combat	combat	VERB
finefocus-4313	148	5	eskape	eskape	NOUN
finefocus-4313	148	6	pathogens	pathogen	NOUN
finefocus-4313	148	7	in	in	ADP
finefocus-4313	148	8	the	the	DET
finefocus-4313	148	9	era	era	NOUN
finefocus-4313	148	10	of	of	ADP
finefocus-4313	148	11	antimicrobial	antimicrobial	ADJ
finefocus-4313	148	12	resistance	resistance	NOUN
finefocus-4313	148	13	:	:	PUNCT
finefocus-4313	148	14	a	a	DET
finefocus-4313	148	15	review	review	NOUN
finefocus-4313	148	16	.	.	PUNCT
finefocus-4313	149	1	front	front	PROPN
finefocus-4313	149	2	microbiol	microbiol	PROPN
finefocus-4313	149	3	,	,	PUNCT
finefocus-4313	149	4	10	10	NUM
finefocus-4313	149	5	,	,	PUNCT
finefocus-4313	149	6	539	539	NUM
finefocus-4313	149	7	.	.	NOUN
finefocus-4313	150	1	9	9	X
finefocus-4313	150	2	.	.	X
finefocus-4313	150	3	nakonieczna	nakonieczna	PROPN
finefocus-4313	150	4	,	,	PUNCT
finefocus-4313	150	5	j.	j.	PROPN
finefocus-4313	150	6	,	,	PUNCT
finefocus-4313	150	7	wozniak	wozniak	PROPN
finefocus-4313	150	8	,	,	PUNCT
finefocus-4313	150	9	a.	a.	PROPN
finefocus-4313	150	10	,	,	PUNCT
finefocus-4313	150	11	pieranski	pieranski	ADJ
finefocus-4313	150	12	,	,	PUNCT
finefocus-4313	150	13	m.	m.	NOUN
finefocus-4313	150	14	,	,	PUNCT
finefocus-4313	150	15	rapacka	rapacka	NOUN
finefocus-4313	150	16	-	-	PUNCT
finefocus-4313	150	17	zdonczyk	zdonczyk	PROPN
finefocus-4313	150	18	,	,	PUNCT
finefocus-4313	150	19	a.	a.	NOUN
finefocus-4313	150	20	,	,	PUNCT
finefocus-4313	150	21	ogonowska	ogonowska	NOUN
finefocus-4313	150	22	,	,	PUNCT
finefocus-4313	150	23	p.	p.	NOUN
finefocus-4313	150	24	&	&	CCONJ
finefocus-4313	150	25	grinholc	grinholc	PROPN
finefocus-4313	150	26	,	,	PUNCT
finefocus-4313	150	27	m.	m.	NOUN
finefocus-4313	150	28	2019	2019	NUM
finefocus-4313	150	29	.	.	PUNCT
finefocus-4313	151	1	photoinactivation	photoinactivation	NOUN
finefocus-4313	151	2	of	of	ADP
finefocus-4313	151	3	eskape	eskape	NOUN
finefocus-4313	151	4	pathogens	pathogen	NOUN
finefocus-4313	151	5	:	:	PUNCT
finefocus-4313	151	6	overview	overview	NOUN
finefocus-4313	151	7	of	of	ADP
finefocus-4313	151	8	novel	novel	ADJ
finefocus-4313	151	9	therapeutic	therapeutic	ADJ
finefocus-4313	151	10	strategy	strategy	NOUN
finefocus-4313	151	11	.	.	PUNCT
finefocus-4313	152	1	future	future	ADJ
finefocus-4313	152	2	med	med	ADJ
finefocus-4313	152	3	chem	chem	NOUN
finefocus-4313	152	4	,	,	PUNCT
finefocus-4313	152	5	11	11	NUM
finefocus-4313	152	6	,	,	PUNCT
finefocus-4313	152	7	443	443	NUM
finefocus-4313	152	8	-	-	SYM
finefocus-4313	152	9	461	461	NUM
finefocus-4313	152	10	.	.	PUNCT
finefocus-4313	153	1	vol	vol	NOUN
finefocus-4313	153	2	9	9	NUM
finefocus-4313	153	3	|	|	CCONJ
finefocus-4313	153	4	111	111	NUM
finefocus-4313	153	5	10	10	NUM
finefocus-4313	153	6	.	.	PUNCT
finefocus-4313	154	1	pishchany	pishchany	PROPN
finefocus-4313	154	2	,	,	PUNCT
finefocus-4313	154	3	g.	g.	PROPN
finefocus-4313	154	4	,	,	PUNCT
finefocus-4313	154	5	mevers	mever	NOUN
finefocus-4313	154	6	,	,	PUNCT
finefocus-4313	154	7	e.	e.	PROPN
finefocus-4313	154	8	,	,	PUNCT
finefocus-4313	154	9	ndousse	ndousse	NOUN
finefocus-4313	154	10	-	-	PUNCT
finefocus-4313	154	11	fetter	fetter	NOUN
finefocus-4313	154	12	,	,	PUNCT
finefocus-4313	154	13	s.	s.	PROPN
finefocus-4313	154	14	,	,	PUNCT
finefocus-4313	154	15	horvath	horvath	PROPN
finefocus-4313	154	16	,	,	PUNCT
finefocus-4313	154	17	d.	d.	PROPN
finefocus-4313	154	18	j.	j.	PROPN
finefocus-4313	154	19	,	,	PUNCT
finefocus-4313	154	20	jr	jr	PROPN
finefocus-4313	154	21	.	.	PROPN
finefocus-4313	154	22	,	,	PUNCT
finefocus-4313	154	23	paludo	paludo	NOUN
finefocus-4313	154	24	,	,	PUNCT
finefocus-4313	154	25	c.	c.	PROPN
finefocus-4313	154	26	r.	r.	PROPN
finefocus-4313	154	27	,	,	PUNCT
finefocus-4313	154	28	silva	silva	NOUN
finefocus-4313	154	29	-	-	PUNCT
finefocus-4313	154	30	junior	junior	NOUN
finefocus-4313	154	31	,	,	PUNCT
finefocus-4313	154	32	e.	e.	PROPN
finefocus-4313	154	33	a.	a.	PROPN
finefocus-4313	154	34	,	,	PUNCT
finefocus-4313	154	35	koren	koren	PROPN
finefocus-4313	154	36	,	,	PUNCT
finefocus-4313	154	37	s.	s.	PROPN
finefocus-4313	154	38	,	,	PUNCT
finefocus-4313	154	39	skaar	skaar	NOUN
finefocus-4313	154	40	,	,	PUNCT
finefocus-4313	154	41	e.	e.	PROPN
finefocus-4313	154	42	p.	p.	PROPN
finefocus-4313	154	43	,	,	PUNCT
finefocus-4313	154	44	clardy	clardy	PROPN
finefocus-4313	154	45	,	,	PUNCT
finefocus-4313	154	46	j.	j.	PROPN
finefocus-4313	154	47	&	&	CCONJ
finefocus-4313	154	48	kolter	kolter	PROPN
finefocus-4313	154	49	,	,	PUNCT
finefocus-4313	154	50	r.	r.	PROPN
finefocus-4313	154	51	2018	2018	NUM
finefocus-4313	154	52	.	.	PUNCT
finefocus-4313	155	1	amycomicin	amycomicin	PROPN
finefocus-4313	155	2	is	be	AUX
finefocus-4313	155	3	a	a	DET
finefocus-4313	155	4	potent	potent	ADJ
finefocus-4313	155	5	and	and	CCONJ
finefocus-4313	155	6	specific	specific	ADJ
finefocus-4313	155	7	antibiotic	antibiotic	NOUN
finefocus-4313	155	8	discovered	discover	VERB
finefocus-4313	155	9	with	with	ADP
finefocus-4313	155	10	a	a	DET
finefocus-4313	155	11	targeted	target	VERB
finefocus-4313	155	12	interaction	interaction	NOUN
finefocus-4313	155	13	screen	screen	NOUN
finefocus-4313	155	14	.	.	PUNCT
finefocus-4313	156	1	proc	proc	PROPN
finefocus-4313	156	2	natl	natl	PROPN
finefocus-4313	156	3	acad	acad	PROPN
finefocus-4313	156	4	sci	sci	PROPN
finefocus-4313	156	5	u	u	PROPN
finefocus-4313	156	6	s	s	PROPN
finefocus-4313	156	7	a	a	PRON
finefocus-4313	156	8	,	,	PUNCT
finefocus-4313	156	9	115	115	NUM
finefocus-4313	156	10	,	,	PUNCT
finefocus-4313	156	11	10124	10124	NUM
finefocus-4313	156	12	-	-	SYM
finefocus-4313	156	13	10129	10129	NUM
finefocus-4313	156	14	.	.	PUNCT
finefocus-4313	157	1	11	11	NUM
finefocus-4313	157	2	.	.	PUNCT
finefocus-4313	157	3	raaijmakers	raaijmaker	NOUN
finefocus-4313	157	4	,	,	PUNCT
finefocus-4313	157	5	j.	j.	PROPN
finefocus-4313	157	6	m.	m.	PROPN
finefocus-4313	157	7	,	,	PUNCT
finefocus-4313	157	8	weller	weller	PROPN
finefocus-4313	157	9	,	,	PUNCT
finefocus-4313	157	10	d.	d.	PROPN
finefocus-4313	157	11	m.	m.	PROPN
finefocus-4313	157	12	&	&	CCONJ
finefocus-4313	157	13	thomashow	thomashow	PROPN
finefocus-4313	157	14	,	,	PUNCT
finefocus-4313	157	15	l.	l.	PROPN
finefocus-4313	157	16	s.	s.	PROPN
finefocus-4313	157	17	1997	1997	NUM
finefocus-4313	157	18	.	.	PUNCT
finefocus-4313	158	1	frequency	frequency	NOUN
finefocus-4313	158	2	of	of	ADP
finefocus-4313	158	3	antibiotic	antibiotic	NOUN
finefocus-4313	158	4	-	-	PUNCT
finefocus-4313	158	5	producing	produce	VERB
finefocus-4313	158	6	pseudomonas	pseudomona	NOUN
finefocus-4313	158	7	spp	spp	NOUN
finefocus-4313	158	8	.	.	PUNCT
finefocus-4313	159	1	in	in	ADP
finefocus-4313	159	2	natural	natural	ADJ
finefocus-4313	159	3	environments	environment	NOUN
finefocus-4313	159	4	.	.	PUNCT
finefocus-4313	160	1	appl	appl	PROPN
finefocus-4313	160	2	environ	environ	X
finefocus-4313	160	3	microbiol	microbiol	PROPN
finefocus-4313	160	4	,	,	PUNCT
finefocus-4313	160	5	63	63	NUM
finefocus-4313	160	6	,	,	PUNCT
finefocus-4313	160	7	881	881	NUM
finefocus-4313	160	8	-	-	SYM
finefocus-4313	160	9	7	7	NUM
finefocus-4313	160	10	.	.	NOUN
finefocus-4313	160	11	12	12	NUM
finefocus-4313	160	12	.	.	PUNCT
finefocus-4313	161	1	santajit	santajit	PROPN
finefocus-4313	161	2	,	,	PUNCT
finefocus-4313	161	3	s.	s.	PROPN
finefocus-4313	161	4	&	&	CCONJ
finefocus-4313	161	5	indrawattana	indrawattana	PROPN
finefocus-4313	161	6	,	,	PUNCT
finefocus-4313	161	7	n.	n.	PROPN
finefocus-4313	161	8	2016	2016	NUM
finefocus-4313	161	9	.	.	PUNCT
finefocus-4313	162	1	mechanisms	mechanism	NOUN
finefocus-4313	162	2	of	of	ADP
finefocus-4313	162	3	antimicrobial	antimicrobial	ADJ
finefocus-4313	162	4	resistance	resistance	NOUN
finefocus-4313	162	5	in	in	ADP
finefocus-4313	162	6	eskape	eskape	NOUN
finefocus-4313	162	7	pathogens	pathogen	NOUN
finefocus-4313	162	8	.	.	PUNCT
finefocus-4313	162	9	biomed	biome	VERB
finefocus-4313	162	10	res	re	NOUN
finefocus-4313	162	11	int	int	NOUN
finefocus-4313	162	12	,	,	PUNCT
finefocus-4313	162	13	2016	2016	NUM
finefocus-4313	162	14	,	,	PUNCT
finefocus-4313	162	15	2475067	2475067	NUM
finefocus-4313	162	16	.	.	PUNCT
finefocus-4313	163	1	13	13	NUM
finefocus-4313	163	2	.	.	PUNCT
finefocus-4313	163	3	soares	soares	PROPN
finefocus-4313	163	4	,	,	PUNCT
finefocus-4313	163	5	g.	g.	PROPN
finefocus-4313	163	6	m.	m.	PROPN
finefocus-4313	163	7	,	,	PUNCT
finefocus-4313	163	8	figueiredo	figueiredo	PROPN
finefocus-4313	163	9	lc	lc	PROPN
finefocus-4313	163	10	fau	fau	PROPN
finefocus-4313	163	11	faveri	faveri	PROPN
finefocus-4313	163	12	,	,	PUNCT
finefocus-4313	163	13	m.	m.	NOUN
finefocus-4313	163	14	,	,	PUNCT
finefocus-4313	163	15	faveri	faveri	PROPN
finefocus-4313	163	16	m	m	PROPN
finefocus-4313	163	17	fau	fau	PROPN
finefocus-4313	163	18	cortelli	cortelli	PROPN
finefocus-4313	163	19	,	,	PUNCT
finefocus-4313	163	20	s.	s.	PROPN
finefocus-4313	163	21	c.	c.	PROPN
finefocus-4313	163	22	,	,	PUNCT
finefocus-4313	163	23	cortelli	cortelli	PROPN
finefocus-4313	163	24	sc	sc	PROPN
finefocus-4313	163	25	fau	fau	PROPN
finefocus-4313	163	26	duarte	duarte	PROPN
finefocus-4313	163	27	,	,	PUNCT
finefocus-4313	163	28	p.	p.	PROPN
finefocus-4313	163	29	m.	m.	NOUN
finefocus-4313	163	30	,	,	PUNCT
finefocus-4313	163	31	duarte	duarte	PROPN
finefocus-4313	163	32	pm	pm	PROPN
finefocus-4313	163	33	fau	fau	PROPN
finefocus-4313	163	34	feres	fere	NOUN
finefocus-4313	163	35	,	,	PUNCT
finefocus-4313	163	36	m.	m.	NOUN
finefocus-4313	163	37	&	&	CCONJ
finefocus-4313	163	38	feres	fere	NOUN
finefocus-4313	163	39	,	,	PUNCT
finefocus-4313	163	40	m.	m.	NOUN
finefocus-4313	163	41	mechanisms	mechanism	NOUN
finefocus-4313	163	42	of	of	ADP
finefocus-4313	163	43	action	action	NOUN
finefocus-4313	163	44	of	of	ADP
finefocus-4313	163	45	systemic	systemic	ADJ
finefocus-4313	163	46	antibiotics	antibiotic	NOUN
finefocus-4313	163	47	used	use	VERB
finefocus-4313	163	48	in	in	ADP
finefocus-4313	163	49	periodontal	periodontal	ADJ
finefocus-4313	163	50	treatment	treatment	NOUN
finefocus-4313	163	51	and	and	CCONJ
finefocus-4313	163	52	mechanisms	mechanism	NOUN
finefocus-4313	163	53	of	of	ADP
finefocus-4313	163	54	bacterial	bacterial	ADJ
finefocus-4313	163	55	resistance	resistance	NOUN
finefocus-4313	163	56	to	to	ADP
finefocus-4313	163	57	these	these	DET
finefocus-4313	163	58	drugs	drug	NOUN