id	sid	tid	token	lemma	pos
finefocus-531	1	1	19applied	19applied	NUM
finefocus-531	1	2	&	&	CCONJ
finefocus-531	1	3	environmental	environmental	ADJ
finefocus-531	1	4	microbiology	microbiology	NOUN
finefocus-531	1	5	•	•	NOUN
finefocus-531	1	6	characterization	characterization	NOUN
finefocus-531	1	7	of	of	ADP
finefocus-531	1	8	a	a	DET
finefocus-531	1	9	1,2	1,2	NUM
finefocus-531	1	10	-	-	PUNCT
finefocus-531	1	11	propanediol	propanediol	NOUN
finefocus-531	1	12	producing	produce	VERB
finefocus-531	1	13	escherichia	escherichia	NOUN
finefocus-531	1	14	strain	strain	NOUN
finefocus-531	1	15	isolated	isolate	VERB
finefocus-531	1	16	from	from	ADP
finefocus-531	1	17	a	a	DET
finefocus-531	1	18	geothermally	geothermally	ADV
finefocus-531	1	19	heated	heated	ADJ
finefocus-531	1	20	intertidal	intertidal	ADJ
finefocus-531	1	21	pool	pool	NOUN
finefocus-531	1	22	in	in	ADP
finefocus-531	1	23	northern	northern	ADJ
finefocus-531	1	24	iceland	iceland	PROPN
finefocus-531	1	25	birta	birta	PROPN
finefocus-531	1	26	líf	líf	PROPN
finefocus-531	1	27	fjölnisdóttir1	fjölnisdóttir1	NOUN
finefocus-531	1	28	*	*	NOUN
finefocus-531	1	29	,	,	PUNCT
finefocus-531	1	30	pálína	pálína	ADJ
finefocus-531	1	31	haraldsdóttir1	haraldsdóttir1	NOUN
finefocus-531	1	32	,	,	PUNCT
finefocus-531	1	33	eva	eva	PROPN
finefocus-531	1	34	maría	maría	PROPN
finefocus-531	1	35	ingvadóttir1	ingvadóttir1	PROPN
finefocus-531	1	36	,	,	PUNCT
finefocus-531	1	37	sean	sean	PROPN
finefocus-531	1	38	m.	m.	PROPN
finefocus-531	1	39	scully1,2	scully1,2	PROPN
finefocus-531	1	40	,	,	PUNCT
finefocus-531	1	41	and	and	CCONJ
finefocus-531	1	42	jóhann	jóhann	ADJ
finefocus-531	1	43	örlygsson1	örlygsson1	NOUN
finefocus-531	1	44	1university	1university	NUM
finefocus-531	1	45	of	of	ADP
finefocus-531	1	46	akureyri	akureyri	NOUN
finefocus-531	1	47	,	,	PUNCT
finefocus-531	1	48	faculty	faculty	NOUN
finefocus-531	1	49	of	of	ADP
finefocus-531	1	50	natural	natural	ADJ
finefocus-531	1	51	resource	resource	NOUN
finefocus-531	1	52	sciences	science	NOUN
finefocus-531	1	53	,	,	PUNCT
finefocus-531	1	54	borgir	borgir	PROPN
finefocus-531	1	55	,	,	PUNCT
finefocus-531	1	56	nordurslod	nordurslod	NOUN
finefocus-531	1	57	2	2	NUM
finefocus-531	1	58	,	,	PUNCT
finefocus-531	1	59	600	600	NUM
finefocus-531	1	60	akureyri	akureyri	NOUN
finefocus-531	1	61	,	,	PUNCT
finefocus-531	1	62	iceland	iceland	PROPN
finefocus-531	1	63	2university	2university	PROPN
finefocus-531	1	64	of	of	ADP
finefocus-531	1	65	iceland	iceland	PROPN
finefocus-531	1	66	,	,	PUNCT
finefocus-531	1	67	sæmundargötu	sæmundargötu	PROPN
finefocus-531	1	68	2	2	NUM
finefocus-531	1	69	,	,	PUNCT
finefocus-531	1	70	101	101	NUM
finefocus-531	1	71	reykjavík	reykjavík	NOUN
finefocus-531	1	72	,	,	PUNCT
finefocus-531	1	73	iceland	iceland	PROPN
finefocus-531	1	74	manuscript	manuscript	NOUN
finefocus-531	1	75	received	receive	VERB
finefocus-531	1	76	11	11	NUM
finefocus-531	1	77	august	august	PROPN
finefocus-531	1	78	2016	2016	NUM
finefocus-531	1	79	;	;	PUNCT
finefocus-531	1	80	accepted	accept	VERB
finefocus-531	1	81	29	29	NUM
finefocus-531	1	82	july	july	PROPN
finefocus-531	1	83	2017	2017	NUM
finefocus-531	1	84	copyright	copyright	NOUN
finefocus-531	1	85	2018	2018	NUM
finefocus-531	1	86	,	,	PUNCT
finefocus-531	1	87	fine	fine	ADJ
finefocus-531	1	88	focus	focus	NOUN
finefocus-531	1	89	.	.	PUNCT
finefocus-531	2	1	all	all	DET
finefocus-531	2	2	rights	right	NOUN
finefocus-531	2	3	reserved	reserve	VERB
finefocus-531	2	4	.	.	PUNCT
finefocus-531	3	1	20	20	NUM
finefocus-531	3	2	•	•	NUM
finefocus-531	3	3	fine	fine	ADJ
finefocus-531	3	4	focus	focus	NOUN
finefocus-531	3	5	,	,	PUNCT
finefocus-531	3	6	vol	vol	NOUN
finefocus-531	3	7	.	.	PUNCT
finefocus-531	3	8	4(1	4(1	NOUN
finefocus-531	3	9	)	)	PUNCT
finefocus-531	4	1	the	the	DET
finefocus-531	4	2	ability	ability	NOUN
finefocus-531	4	3	of	of	ADP
finefocus-531	4	4	a	a	DET
finefocus-531	4	5	mesophilic	mesophilic	ADJ
finefocus-531	4	6	isolate	isolate	NOUN
finefocus-531	4	7	,	,	PUNCT
finefocus-531	4	8	strain	strain	NOUN
finefocus-531	4	9	cc5c	cc5c	PROPN
finefocus-531	4	10	,	,	PUNCT
finefocus-531	4	11	isolated	isolate	VERB
finefocus-531	4	12	from	from	ADP
finefocus-531	4	13	a	a	DET
finefocus-531	4	14	temperate	temperate	ADJ
finefocus-531	4	15	geothermally	geothermally	ADV
finefocus-531	4	16	-	-	PUNCT
finefocus-531	4	17	heated	heat	VERB
finefocus-531	4	18	intertidal	intertidal	ADJ
finefocus-531	4	19	pool	pool	NOUN
finefocus-531	4	20	in	in	ADP
finefocus-531	4	21	northern	northern	ADJ
finefocus-531	4	22	iceland	iceland	PROPN
finefocus-531	4	23	is	be	AUX
finefocus-531	4	24	described	describe	VERB
finefocus-531	4	25	herein	herein	NOUN
finefocus-531	4	26	.	.	PUNCT
finefocus-531	5	1	strain	strain	PROPN
finefocus-531	5	2	cc5c	cc5c	NUM
finefocus-531	5	3	belongs	belong	VERB
finefocus-531	5	4	to	to	ADP
finefocus-531	5	5	the	the	DET
finefocus-531	5	6	family	family	NOUN
finefocus-531	5	7	enterobacteriaceae	enterobacteriaceae	NOUN
finefocus-531	5	8	with	with	ADP
finefocus-531	5	9	greater	great	ADJ
finefocus-531	5	10	than	than	ADP
finefocus-531	5	11	99.1	99.1	NUM
finefocus-531	5	12	%	%	NOUN
finefocus-531	5	13	similarity	similarity	NOUN
finefocus-531	5	14	to	to	PART
finefocus-531	5	15	escherichia	escherichia	VERB
finefocus-531	5	16	marmotae	marmotae	NOUN
finefocus-531	5	17	and	and	CCONJ
finefocus-531	5	18	shigella	shigella	PROPN
finefocus-531	5	19	dysenteriae	dysenteriae	NOUN
finefocus-531	5	20	based	base	VERB
finefocus-531	5	21	upon	upon	SCONJ
finefocus-531	5	22	16s	16s	PROPN
finefocus-531	5	23	rrna	rrna	PROPN
finefocus-531	5	24	gene	gene	NOUN
finefocus-531	5	25	analysis	analysis	NOUN
finefocus-531	5	26	.	.	PUNCT
finefocus-531	6	1	strain	strain	PROPN
finefocus-531	6	2	cc5c	cc5c	PROPN
finefocus-531	6	3	is	be	AUX
finefocus-531	6	4	a	a	DET
finefocus-531	6	5	facultative	facultative	ADJ
finefocus-531	6	6	anaerobe	anaerobe	NOUN
finefocus-531	6	7	exhibiting	exhibit	VERB
finefocus-531	6	8	growth	growth	NOUN
finefocus-531	6	9	between	between	ADP
finefocus-531	6	10	5	5	NUM
finefocus-531	6	11	and	and	CCONJ
finefocus-531	6	12	50	50	NUM
finefocus-531	6	13	°	°	NOUN
finefocus-531	6	14	c	c	NOUN
finefocus-531	6	15	with	with	ADP
finefocus-531	6	16	an	an	DET
finefocus-531	6	17	optimal	optimal	ADJ
finefocus-531	6	18	growth	growth	NOUN
finefocus-531	6	19	at	at	ADP
finefocus-531	6	20	40	40	NUM
finefocus-531	6	21	°	°	NOUN
finefocus-531	6	22	c	c	NOUN
finefocus-531	6	23	,	,	PUNCT
finefocus-531	6	24	initial	initial	ADJ
finefocus-531	6	25	ph	ph	ADJ
finefocus-531	6	26	values	value	NOUN
finefocus-531	6	27	between	between	ADP
finefocus-531	6	28	4.0	4.0	NUM
finefocus-531	6	29	and	and	CCONJ
finefocus-531	6	30	9.0	9.0	NUM
finefocus-531	6	31	with	with	ADP
finefocus-531	6	32	an	an	DET
finefocus-531	6	33	optimum	optimum	NOUN
finefocus-531	6	34	at	at	ADP
finefocus-531	6	35	ph	ph	PROPN
finefocus-531	6	36	7.5	7.5	NUM
finefocus-531	6	37	.	.	PUNCT
finefocus-531	7	1	strain	strain	PROPN
finefocus-531	7	2	cc5c	cc5c	PROPN
finefocus-531	7	3	,	,	PUNCT
finefocus-531	7	4	unlike	unlike	ADP
finefocus-531	7	5	its	its	PRON
finefocus-531	7	6	nearest	near	ADJ
finefocus-531	7	7	phylogenetic	phylogenetic	ADJ
finefocus-531	7	8	neighbors	neighbor	NOUN
finefocus-531	7	9	,	,	PUNCT
finefocus-531	7	10	degrades	degrade	VERB
finefocus-531	7	11	starch	starch	NOUN
finefocus-531	7	12	,	,	PUNCT
finefocus-531	7	13	dulcitol	dulcitol	NOUN
finefocus-531	7	14	,	,	PUNCT
finefocus-531	7	15	and	and	CCONJ
finefocus-531	7	16	sucrose	sucrose	VERB
finefocus-531	7	17	as	as	ADV
finefocus-531	7	18	well	well	ADV
finefocus-531	7	19	as	as	ADP
finefocus-531	7	20	potentially	potentially	ADV
finefocus-531	7	21	cellobiose	cellobiose	VERB
finefocus-531	7	22	which	which	PRON
finefocus-531	7	23	are	be	AUX
finefocus-531	7	24	uncommon	uncommon	ADJ
finefocus-531	7	25	features	feature	NOUN
finefocus-531	7	26	among	among	ADP
finefocus-531	7	27	these	these	DET
finefocus-531	7	28	genera	genera	NOUN
finefocus-531	7	29	.	.	PUNCT
finefocus-531	8	1	under	under	ADP
finefocus-531	8	2	aerobic	aerobic	ADJ
finefocus-531	8	3	conditions	condition	NOUN
finefocus-531	8	4	the	the	DET
finefocus-531	8	5	catabolism	catabolism	NOUN
finefocus-531	8	6	of	of	ADP
finefocus-531	8	7	l	l	NOUN
finefocus-531	8	8	-	-	PUNCT
finefocus-531	8	9	rhamnose	rhamnose	ADJ
finefocus-531	8	10	and	and	CCONJ
finefocus-531	8	11	l	l	NOUN
finefocus-531	8	12	-	-	NOUN
finefocus-531	8	13	fucose	fucose	NOUN
finefocus-531	8	14	revealed	reveal	VERB
finefocus-531	8	15	that	that	SCONJ
finefocus-531	8	16	the	the	DET
finefocus-531	8	17	dominant	dominant	ADJ
finefocus-531	8	18	product	product	NOUN
finefocus-531	8	19	was	be	AUX
finefocus-531	8	20	1,2	1,2	NUM
finefocus-531	8	21	-	-	NOUN
finefocus-531	8	22	propanediol	propanediol	NOUN
finefocus-531	8	23	while	while	SCONJ
finefocus-531	8	24	under	under	ADP
finefocus-531	8	25	anaerobic	anaerobic	ADJ
finefocus-531	8	26	conditions	condition	NOUN
finefocus-531	8	27	it	it	PRON
finefocus-531	8	28	was	be	AUX
finefocus-531	8	29	a	a	DET
finefocus-531	8	30	mixture	mixture	NOUN
finefocus-531	8	31	of	of	ADP
finefocus-531	8	32	acetate	acetate	NOUN
finefocus-531	8	33	and	and	CCONJ
finefocus-531	8	34	1,2	1,2	NUM
finefocus-531	8	35	-	-	NOUN
finefocus-531	8	36	propanediol	propanediol	NOUN
finefocus-531	8	37	.	.	PUNCT
finefocus-531	9	1	the	the	DET
finefocus-531	9	2	effect	effect	NOUN
finefocus-531	9	3	of	of	ADP
finefocus-531	9	4	increased	increase	VERB
finefocus-531	9	5	initial	initial	ADJ
finefocus-531	9	6	substrate	substrate	NOUN
finefocus-531	9	7	concentration	concentration	NOUN
finefocus-531	9	8	was	be	AUX
finefocus-531	9	9	investigated	investigate	VERB
finefocus-531	9	10	for	for	ADP
finefocus-531	9	11	glucose	glucose	NOUN
finefocus-531	9	12	,	,	PUNCT
finefocus-531	9	13	l	l	NOUN
finefocus-531	9	14	-	-	NOUN
finefocus-531	9	15	fucose	fucose	NOUN
finefocus-531	9	16	,	,	PUNCT
finefocus-531	9	17	and	and	CCONJ
finefocus-531	9	18	l	l	NOUN
finefocus-531	9	19	-	-	VERB
finefocus-531	9	20	rhamnose	rhamnose	VERB
finefocus-531	9	21	with	with	ADP
finefocus-531	9	22	inhibition	inhibition	NOUN
finefocus-531	9	23	apparent	apparent	ADJ
finefocus-531	9	24	at	at	ADP
finefocus-531	9	25	concentrations	concentration	NOUN
finefocus-531	9	26	above	above	ADP
finefocus-531	9	27	20	20	NUM
finefocus-531	9	28	mm	mm	NOUN
finefocus-531	9	29	under	under	ADP
finefocus-531	9	30	both	both	PRON
finefocus-531	9	31	anaerobic	anaerobic	NOUN
finefocus-531	9	32	and	and	CCONJ
finefocus-531	9	33	aerobic	aerobic	ADJ
finefocus-531	9	34	conditions	condition	NOUN
finefocus-531	9	35	.	.	PUNCT
finefocus-531	10	1	although	although	SCONJ
finefocus-531	10	2	,	,	PUNCT
finefocus-531	10	3	differences	difference	NOUN
finefocus-531	10	4	in	in	ADP
finefocus-531	10	5	end	end	NOUN
finefocus-531	10	6	product	product	NOUN
finefocus-531	10	7	formation	formation	NOUN
finefocus-531	10	8	were	be	AUX
finefocus-531	10	9	observed	observe	VERB
finefocus-531	10	10	between	between	ADP
finefocus-531	10	11	aerobic	aerobic	ADJ
finefocus-531	10	12	and	and	CCONJ
finefocus-531	10	13	anaerobic	anaerobic	NOUN
finefocus-531	10	14	conditions	condition	NOUN
finefocus-531	10	15	for	for	ADP
finefocus-531	10	16	l	l	NOUN
finefocus-531	10	17	-	-	PUNCT
finefocus-531	10	18	rhamnose	rhamnose	NOUN
finefocus-531	10	19	.	.	PUNCT
finefocus-531	11	1	strain	strain	PROPN
finefocus-531	11	2	cc5c	cc5c	PROPN
finefocus-531	11	3	rapidly	rapidly	ADV
finefocus-531	11	4	catabolizes	catabolize	VERB
finefocus-531	11	5	rhamnose	rhamnose	VERB
finefocus-531	11	6	and	and	CCONJ
finefocus-531	11	7	produces	produce	VERB
finefocus-531	11	8	1,2	1,2	NUM
finefocus-531	11	9	-	-	NOUN
finefocus-531	11	10	pd	pd	NOUN
finefocus-531	11	11	at	at	ADP
finefocus-531	11	12	a	a	DET
finefocus-531	11	13	rate	rate	NOUN
finefocus-531	11	14	of	of	ADP
finefocus-531	11	15	3.41	3.41	NUM
finefocus-531	11	16	mmol	mmol	NOUN
finefocus-531	11	17	/	/	SYM
finefocus-531	11	18	h	h	NOUN
finefocus-531	11	19	on	on	ADP
finefocus-531	11	20	l	l	NOUN
finefocus-531	11	21	-	-	PUNCT
finefocus-531	11	22	rhamnose	rhamnose	NOUN
finefocus-531	11	23	and	and	CCONJ
finefocus-531	11	24	2.37	2.37	NUM
finefocus-531	11	25	mmol	mmol	NOUN
finefocus-531	11	26	/	/	SYM
finefocus-531	11	27	h	h	NOUN
finefocus-531	11	28	on	on	ADP
finefocus-531	11	29	a	a	DET
finefocus-531	11	30	mixture	mixture	NOUN
finefocus-531	11	31	of	of	ADP
finefocus-531	11	32	glucose	glucose	NOUN
finefocus-531	11	33	and	and	CCONJ
finefocus-531	11	34	rhamnose	rhamnose	VERB
finefocus-531	11	35	with	with	ADP
finefocus-531	11	36	up	up	ADP
finefocus-531	11	37	to	to	PART
finefocus-531	11	38	96	96	NUM
finefocus-531	11	39	%	%	NOUN
finefocus-531	11	40	of	of	ADP
finefocus-531	11	41	the	the	DET
finefocus-531	11	42	theoretical	theoretical	ADJ
finefocus-531	11	43	yield	yield	NOUN
finefocus-531	11	44	on	on	ADP
finefocus-531	11	45	l	l	NOUN
finefocus-531	11	46	-	-	PUNCT
finefocus-531	11	47	rhamnose	rhamnose	NOUN
finefocus-531	11	48	.	.	PUNCT
finefocus-531	12	1	abstract	abstract	ADJ
finefocus-531	12	2	birta	birta	PROPN
finefocus-531	12	3	líf	líf	AUX
finefocus-531	12	4	fjölnisdóttir	fjölnisdóttir	VERB
finefocus-531	12	5	birtaliff@gmail.com	birtaliff@gmail.com	X
finefocus-531	13	1	pálína	pálína	ADJ
finefocus-531	13	2	haraldsdóttir	haraldsdóttir	NOUN
finefocus-531	13	3	haraldsdottir@hotmail.com	haraldsdottir@hotmail.com	X
finefocus-531	14	1	correspondence	correspondence	NOUN
finefocus-531	14	2	should	should	AUX
finefocus-531	14	3	be	be	AUX
finefocus-531	14	4	addressed	address	VERB
finefocus-531	14	5	to	to	ADP
finefocus-531	14	6	birta	birta	PROPN
finefocus-531	14	7	líf	líf	AUX
finefocus-531	14	8	fjölnisdóttir	fjölnisdóttir	VERB
finefocus-531	14	9	and	and	CCONJ
finefocus-531	14	10	pálína	pálína	ADJ
finefocus-531	14	11	haraldsdóttir	haraldsdóttir	NOUN
finefocus-531	14	12	keywords	keyword	NOUN
finefocus-531	14	13	•	•	CCONJ
finefocus-531	14	14	deoxy	deoxy	NOUN
finefocus-531	14	15	sugars	sugar	NOUN
finefocus-531	14	16	•	•	ADP
finefocus-531	14	17	culture	culture	NOUN
finefocus-531	14	18	conditions	condition	NOUN
finefocus-531	14	19	•	•	NOUN
finefocus-531	14	20	propylene	propylene	NOUN
finefocus-531	14	21	glycol	glycol	NOUN
finefocus-531	14	22	•	•	NUM
finefocus-531	14	23	enterobacteriaceae	enterobacteriaceae	NOUN
finefocus-531	14	24	knowledge	knowledge	NOUN
finefocus-531	14	25	regarding	regard	VERB
finefocus-531	14	26	the	the	DET
finefocus-531	14	27	production	production	NOUN
finefocus-531	14	28	of	of	ADP
finefocus-531	14	29	1,2	1,2	NUM
finefocus-531	14	30	-	-	PUNCT
finefocus-531	14	31	propanediol	propanediol	NOUN
finefocus-531	14	32	(	(	PUNCT
finefocus-531	14	33	1,2	1,2	NUM
finefocus-531	14	34	-	-	PUNCT
finefocus-531	14	35	pd	pd	NOUN
finefocus-531	14	36	)	)	PUNCT
finefocus-531	14	37	by	by	ADP
finefocus-531	14	38	bacteria	bacteria	NOUN
finefocus-531	14	39	from	from	ADP
finefocus-531	14	40	methylpentoses	methylpentose	NOUN
finefocus-531	14	41	has	have	AUX
finefocus-531	14	42	been	be	AUX
finefocus-531	14	43	widely	widely	ADV
finefocus-531	14	44	limited	limit	VERB
finefocus-531	14	45	to	to	ADP
finefocus-531	14	46	clinical	clinical	ADJ
finefocus-531	14	47	isolates	isolate	NOUN
finefocus-531	14	48	and	and	CCONJ
finefocus-531	14	49	soil	soil	NOUN
finefocus-531	14	50	bacteria	bacteria	NOUN
finefocus-531	14	51	with	with	ADP
finefocus-531	14	52	work	work	NOUN
finefocus-531	14	53	on	on	ADP
finefocus-531	14	54	organisms	organism	NOUN
finefocus-531	14	55	from	from	ADP
finefocus-531	14	56	extreme	extreme	ADJ
finefocus-531	14	57	environments	environment	NOUN
finefocus-531	14	58	as	as	ADV
finefocus-531	14	59	well	well	ADV
finefocus-531	14	60	as	as	ADP
finefocus-531	14	61	the	the	DET
finefocus-531	14	62	marine	marine	ADJ
finefocus-531	14	63	ecosystems	ecosystem	NOUN
finefocus-531	14	64	being	be	AUX
finefocus-531	14	65	lacking	lack	VERB
finefocus-531	14	66	.	.	PUNCT
finefocus-531	15	1	geothermally	geothermally	ADJ
finefocus-531	15	2	-	-	PUNCT
finefocus-531	15	3	heated	heat	VERB
finefocus-531	15	4	intertidal	intertidal	ADJ
finefocus-531	15	5	pools	pool	NOUN
finefocus-531	15	6	represent	represent	VERB
finefocus-531	15	7	unique	unique	ADJ
finefocus-531	15	8	environments	environment	NOUN
finefocus-531	15	9	that	that	PRON
finefocus-531	15	10	are	be	AUX
finefocus-531	15	11	an	an	DET
finefocus-531	15	12	interface	interface	NOUN
finefocus-531	15	13	between	between	ADP
finefocus-531	15	14	the	the	DET
finefocus-531	15	15	marine	marine	ADJ
finefocus-531	15	16	and	and	CCONJ
finefocus-531	15	17	freshwater	freshwater	NOUN
finefocus-531	15	18	environments	environment	NOUN
finefocus-531	15	19	.	.	PUNCT
finefocus-531	16	1	the	the	DET
finefocus-531	16	2	tides	tide	NOUN
finefocus-531	16	3	bring	bring	VERB
finefocus-531	16	4	a	a	DET
finefocus-531	16	5	regular	regular	ADJ
finefocus-531	16	6	influx	influx	NOUN
finefocus-531	16	7	of	of	ADP
finefocus-531	16	8	nutrients	nutrient	NOUN
finefocus-531	16	9	,	,	PUNCT
finefocus-531	16	10	with	with	ADP
finefocus-531	16	11	some	some	PRON
finefocus-531	16	12	serving	serve	VERB
finefocus-531	16	13	as	as	ADP
finefocus-531	16	14	carbon	carbon	NOUN
finefocus-531	16	15	sources	source	NOUN
finefocus-531	16	16	for	for	ADP
finefocus-531	16	17	multiple	multiple	ADJ
finefocus-531	16	18	microbe	microbe	NOUN
finefocus-531	16	19	species	specie	NOUN
finefocus-531	16	20	.	.	PUNCT
finefocus-531	17	1	organic	organic	ADJ
finefocus-531	17	2	material	material	NOUN
finefocus-531	17	3	deposited	deposit	VERB
finefocus-531	17	4	in	in	ADP
finefocus-531	17	5	intertidal	intertidal	ADJ
finefocus-531	17	6	pools	pool	NOUN
finefocus-531	17	7	can	can	AUX
finefocus-531	17	8	include	include	VERB
finefocus-531	17	9	terrestrial	terrestrial	ADJ
finefocus-531	17	10	and	and	CCONJ
finefocus-531	17	11	marine	marine	ADJ
finefocus-531	17	12	materials	material	NOUN
finefocus-531	17	13	,	,	PUNCT
finefocus-531	17	14	introduction	introduction	NOUN
finefocus-531	17	15	21applied	21applied	NUM
finefocus-531	17	16	&	&	CCONJ
finefocus-531	17	17	environmental	environmental	ADJ
finefocus-531	17	18	microbiology	microbiology	NOUN
finefocus-531	17	19	•	•	ADP
finefocus-531	17	20	which	which	PRON
finefocus-531	17	21	provide	provide	VERB
finefocus-531	17	22	a	a	DET
finefocus-531	17	23	source	source	NOUN
finefocus-531	17	24	of	of	ADP
finefocus-531	17	25	protein	protein	NOUN
finefocus-531	17	26	,	,	PUNCT
finefocus-531	17	27	lipids	lipid	NOUN
finefocus-531	17	28	,	,	PUNCT
finefocus-531	17	29	and	and	CCONJ
finefocus-531	17	30	carbohydrates	carbohydrate	NOUN
finefocus-531	17	31	to	to	ADP
finefocus-531	17	32	microbes	microbe	NOUN
finefocus-531	17	33	existing	exist	VERB
finefocus-531	17	34	within	within	ADP
finefocus-531	17	35	the	the	DET
finefocus-531	17	36	pool	pool	NOUN
finefocus-531	17	37	.	.	PUNCT
finefocus-531	18	1	macro	macro	ADJ
finefocus-531	18	2	algae	algae	NOUN
finefocus-531	18	3	often	often	ADV
finefocus-531	18	4	contain	contain	VERB
finefocus-531	18	5	methylpentoses	methylpentose	NOUN
finefocus-531	18	6	not	not	PART
finefocus-531	18	7	commonly	commonly	ADV
finefocus-531	18	8	found	find	VERB
finefocus-531	18	9	in	in	ADP
finefocus-531	18	10	terrestrial	terrestrial	ADJ
finefocus-531	18	11	biomass	biomass	NOUN
finefocus-531	18	12	;	;	PUNCT
finefocus-531	18	13	the	the	DET
finefocus-531	18	14	methylpentoses	methylpentose	NOUN
finefocus-531	18	15	l	l	NOUN
finefocus-531	18	16	-	-	NOUN
finefocus-531	18	17	fucose	fucose	NOUN
finefocus-531	18	18	and	and	CCONJ
finefocus-531	18	19	l	l	NOUN
finefocus-531	18	20	-	-	ADJ
finefocus-531	18	21	rhamnose	rhamnose	ADJ
finefocus-531	18	22	composition	composition	NOUN
finefocus-531	18	23	of	of	ADP
finefocus-531	18	24	a	a	DET
finefocus-531	18	25	given	give	VERB
finefocus-531	18	26	macro	macro	ADJ
finefocus-531	18	27	algae	algae	NOUN
finefocus-531	18	28	species	specie	NOUN
finefocus-531	18	29	is	be	AUX
finefocus-531	18	30	highly	highly	ADV
finefocus-531	18	31	dependent	dependent	ADJ
finefocus-531	18	32	upon	upon	SCONJ
finefocus-531	18	33	the	the	DET
finefocus-531	18	34	type	type	NOUN
finefocus-531	18	35	of	of	ADP
finefocus-531	18	36	macro	macro	ADJ
finefocus-531	18	37	algae	algae	NOUN
finefocus-531	18	38	.	.	PUNCT
finefocus-531	19	1	for	for	ADP
finefocus-531	19	2	example	example	NOUN
finefocus-531	19	3	,	,	PUNCT
finefocus-531	19	4	green	green	ADJ
finefocus-531	19	5	algae	algae	NOUN
finefocus-531	19	6	within	within	ADP
finefocus-531	19	7	the	the	DET
finefocus-531	19	8	genus	genus	NOUN
finefocus-531	19	9	of	of	ADP
finefocus-531	19	10	ulva	ulva	NOUN
finefocus-531	19	11	contain	contain	VERB
finefocus-531	19	12	ulvan	ulvan	PROPN
finefocus-531	19	13	,	,	PUNCT
finefocus-531	19	14	which	which	PRON
finefocus-531	19	15	is	be	AUX
finefocus-531	19	16	composed	compose	VERB
finefocus-531	19	17	of	of	ADP
finefocus-531	19	18	l	l	NOUN
finefocus-531	19	19	-	-	PUNCT
finefocus-531	19	20	rhamnose	rhamnose	ADJ
finefocus-531	19	21	,	,	PUNCT
finefocus-531	19	22	while	while	SCONJ
finefocus-531	19	23	brown	brown	ADJ
finefocus-531	19	24	algae	algae	NOUN
finefocus-531	19	25	species	specie	NOUN
finefocus-531	19	26	,	,	PUNCT
finefocus-531	19	27	including	include	VERB
finefocus-531	19	28	laminaria	laminaria	NOUN
finefocus-531	19	29	,	,	PUNCT
finefocus-531	19	30	fucus	fucus	NOUN
finefocus-531	19	31	,	,	PUNCT
finefocus-531	19	32	and	and	CCONJ
finefocus-531	19	33	ascophyllum	ascophyllum	PROPN
finefocus-531	19	34	species	specie	NOUN
finefocus-531	19	35	,	,	PUNCT
finefocus-531	19	36	contain	contain	VERB
finefocus-531	19	37	fucoidan	fucoidan	PROPN
finefocus-531	19	38	,	,	PUNCT
finefocus-531	19	39	which	which	PRON
finefocus-531	19	40	is	be	AUX
finefocus-531	19	41	comprised	comprise	VERB
finefocus-531	19	42	on	on	ADP
finefocus-531	19	43	l	l	NOUN
finefocus-531	19	44	-	-	NOUN
finefocus-531	19	45	fucose	fucose	NOUN
finefocus-531	19	46	.	.	PUNCT
finefocus-531	20	1	given	give	VERB
finefocus-531	20	2	the	the	DET
finefocus-531	20	3	influx	influx	NOUN
finefocus-531	20	4	of	of	ADP
finefocus-531	20	5	macro	macro	ADJ
finefocus-531	20	6	algae	algae	NOUN
finefocus-531	20	7	into	into	ADP
finefocus-531	20	8	geothermally	geothermally	ADV
finefocus-531	20	9	-	-	PUNCT
finefocus-531	20	10	heated	heat	VERB
finefocus-531	20	11	intertidal	intertidal	ADJ
finefocus-531	20	12	niches	niche	NOUN
finefocus-531	20	13	,	,	PUNCT
finefocus-531	20	14	this	this	PRON
finefocus-531	20	15	is	be	AUX
finefocus-531	20	16	a	a	DET
finefocus-531	20	17	logical	logical	ADJ
finefocus-531	20	18	environmental	environmental	ADJ
finefocus-531	20	19	niche	niche	NOUN
finefocus-531	20	20	in	in	ADP
finefocus-531	20	21	which	which	PRON
finefocus-531	20	22	to	to	PART
finefocus-531	20	23	look	look	VERB
finefocus-531	20	24	for	for	ADP
finefocus-531	20	25	organisms	organism	NOUN
finefocus-531	20	26	degrading	degrade	VERB
finefocus-531	20	27	macro	macro	ADJ
finefocus-531	20	28	algae	algae	NOUN
finefocus-531	20	29	components	component	NOUN
finefocus-531	20	30	.	.	PUNCT
finefocus-531	21	1	1,2	1,2	NUM
finefocus-531	21	2	-	-	NUM
finefocus-531	21	3	pd	pd	ADJ
finefocus-531	21	4	(	(	PUNCT
finefocus-531	21	5	α	α	NOUN
finefocus-531	21	6	-	-	PUNCT
finefocus-531	21	7	propylene	propylene	NOUN
finefocus-531	21	8	glycol	glycol	NOUN
finefocus-531	21	9	)	)	PUNCT
finefocus-531	21	10	is	be	AUX
finefocus-531	21	11	a	a	DET
finefocus-531	21	12	chiral	chiral	ADJ
finefocus-531	21	13	threecarbon	threecarbon	NOUN
finefocus-531	21	14	diol	diol	NOUN
finefocus-531	21	15	with	with	ADP
finefocus-531	21	16	two	two	NUM
finefocus-531	21	17	enantiomers	enantiomer	NOUN
finefocus-531	21	18	,	,	PUNCT
finefocus-531	21	19	(	(	PUNCT
finefocus-531	21	20	r)-1,2pd	r)-1,2pd	NOUN
finefocus-531	21	21	and	and	CCONJ
finefocus-531	21	22	(	(	PUNCT
finefocus-531	21	23	s)-1,2	s)-1,2	NOUN
finefocus-531	21	24	-	-	PUNCT
finefocus-531	21	25	pd	pd	NOUN
finefocus-531	21	26	,	,	PUNCT
finefocus-531	21	27	although	although	SCONJ
finefocus-531	21	28	it	it	PRON
finefocus-531	21	29	is	be	AUX
finefocus-531	21	30	commonly	commonly	ADV
finefocus-531	21	31	sold	sell	VERB
finefocus-531	21	32	commercially	commercially	ADV
finefocus-531	21	33	as	as	ADP
finefocus-531	21	34	a	a	DET
finefocus-531	21	35	racemic	racemic	ADJ
finefocus-531	21	36	mixture	mixture	NOUN
finefocus-531	21	37	.	.	PUNCT
finefocus-531	22	1	in	in	ADP
finefocus-531	22	2	its	its	PRON
finefocus-531	22	3	pure	pure	ADJ
finefocus-531	22	4	form	form	NOUN
finefocus-531	22	5	,	,	PUNCT
finefocus-531	22	6	1,2	1,2	NUM
finefocus-531	22	7	-	-	SYM
finefocus-531	22	8	pd	pd	NOUN
finefocus-531	22	9	is	be	AUX
finefocus-531	22	10	clear	clear	ADJ
finefocus-531	22	11	,	,	PUNCT
finefocus-531	22	12	colorless	colorless	ADJ
finefocus-531	22	13	,	,	PUNCT
finefocus-531	22	14	and	and	CCONJ
finefocus-531	22	15	highly	highly	ADV
finefocus-531	22	16	viscous	viscous	ADJ
finefocus-531	22	17	which	which	PRON
finefocus-531	22	18	is	be	AUX
finefocus-531	22	19	also	also	ADV
finefocus-531	22	20	odorand	odorand	VERB
finefocus-531	22	21	tasteless	tasteless	ADJ
finefocus-531	22	22	.	.	PUNCT
finefocus-531	23	1	1,2	1,2	NUM
finefocus-531	23	2	-	-	NUM
finefocus-531	23	3	pd	pd	NOUN
finefocus-531	23	4	is	be	AUX
finefocus-531	23	5	generally	generally	ADV
finefocus-531	23	6	regarded	regard	VERB
finefocus-531	23	7	as	as	ADP
finefocus-531	23	8	benign	benign	ADJ
finefocus-531	23	9	and	and	CCONJ
finefocus-531	23	10	has	have	AUX
finefocus-531	23	11	been	be	AUX
finefocus-531	23	12	accepted	accept	VERB
finefocus-531	23	13	as	as	ADP
finefocus-531	23	14	safe	safe	ADJ
finefocus-531	23	15	status	status	NOUN
finefocus-531	23	16	(	(	PUNCT
finefocus-531	23	17	gras	gras	PROPN
finefocus-531	23	18	)	)	PUNCT
finefocus-531	23	19	.	.	PUNCT
finefocus-531	24	1	1,2	1,2	NUM
finefocus-531	24	2	-	-	SYM
finefocus-531	24	3	pd	pd	NOUN
finefocus-531	24	4	has	have	VERB
finefocus-531	24	5	many	many	ADJ
finefocus-531	24	6	applications	application	NOUN
finefocus-531	24	7	and	and	CCONJ
finefocus-531	24	8	is	be	AUX
finefocus-531	24	9	used	use	VERB
finefocus-531	24	10	in	in	ADP
finefocus-531	24	11	antifreeze	antifreeze	ADJ
finefocus-531	24	12	products	product	NOUN
finefocus-531	24	13	,	,	PUNCT
finefocus-531	24	14	disinfectants	disinfectant	NOUN
finefocus-531	24	15	,	,	PUNCT
finefocus-531	24	16	lubricants	lubricant	NOUN
finefocus-531	24	17	,	,	PUNCT
finefocus-531	24	18	artificial	artificial	ADJ
finefocus-531	24	19	smoke	smoke	NOUN
finefocus-531	24	20	,	,	PUNCT
finefocus-531	24	21	as	as	ADP
finefocus-531	24	22	a	a	DET
finefocus-531	24	23	solvent	solvent	NOUN
finefocus-531	24	24	,	,	PUNCT
finefocus-531	24	25	or	or	CCONJ
finefocus-531	24	26	as	as	ADP
finefocus-531	24	27	a	a	DET
finefocus-531	24	28	moisturizer	moisturizer	NOUN
finefocus-531	24	29	in	in	ADP
finefocus-531	24	30	cosmetics	cosmetic	NOUN
finefocus-531	24	31	,	,	PUNCT
finefocus-531	24	32	plastics	plastic	NOUN
finefocus-531	24	33	,	,	PUNCT
finefocus-531	24	34	paint	paint	NOUN
finefocus-531	24	35	,	,	PUNCT
finefocus-531	24	36	pharmaceuticals	pharmaceutical	NOUN
finefocus-531	24	37	,	,	PUNCT
finefocus-531	24	38	and	and	CCONJ
finefocus-531	24	39	food	food	NOUN
finefocus-531	24	40	products	product	NOUN
finefocus-531	24	41	(	(	PUNCT
finefocus-531	24	42	10	10	NUM
finefocus-531	24	43	,	,	PUNCT
finefocus-531	24	44	24	24	NUM
finefocus-531	24	45	)	)	PUNCT
finefocus-531	24	46	.	.	PUNCT
finefocus-531	25	1	commercially	commercially	ADV
finefocus-531	25	2	available	available	ADJ
finefocus-531	25	3	rac-1,2	rac-1,2	NOUN
finefocus-531	25	4	-	-	PUNCT
finefocus-531	25	5	pd	pd	NOUN
finefocus-531	25	6	is	be	AUX
finefocus-531	25	7	produced	produce	VERB
finefocus-531	25	8	by	by	ADP
finefocus-531	25	9	the	the	DET
finefocus-531	25	10	hydrolysis	hydrolysis	NOUN
finefocus-531	25	11	of	of	ADP
finefocus-531	25	12	propylene	propylene	NOUN
finefocus-531	25	13	oxide	oxide	NOUN
finefocus-531	25	14	which	which	PRON
finefocus-531	25	15	is	be	AUX
finefocus-531	25	16	a	a	DET
finefocus-531	25	17	product	product	NOUN
finefocus-531	25	18	of	of	ADP
finefocus-531	25	19	petroleum	petroleum	NOUN
finefocus-531	25	20	reformation	reformation	NOUN
finefocus-531	25	21	,	,	PUNCT
finefocus-531	25	22	while	while	SCONJ
finefocus-531	25	23	enantiomerically	enantiomerically	ADV
finefocus-531	25	24	pure	pure	ADJ
finefocus-531	25	25	(	(	PUNCT
finefocus-531	25	26	s)-1,2	s)-1,2	ADJ
finefocus-531	25	27	-	-	PUNCT
finefocus-531	25	28	pd	pd	NOUN
finefocus-531	25	29	can	can	AUX
finefocus-531	25	30	be	be	AUX
finefocus-531	25	31	produced	produce	VERB
finefocus-531	25	32	microbially	microbially	ADV
finefocus-531	25	33	from	from	ADP
finefocus-531	25	34	l	l	NOUN
finefocus-531	25	35	-	-	NOUN
finefocus-531	25	36	fucose	fucose	NOUN
finefocus-531	25	37	and	and	CCONJ
finefocus-531	25	38	l	l	NOUN
finefocus-531	25	39	-	-	VERB
finefocus-531	25	40	rhamnose	rhamnose	NOUN
finefocus-531	25	41	and	and	CCONJ
finefocus-531	25	42	enantiomerically	enantiomerically	ADV
finefocus-531	25	43	pure	pure	ADJ
finefocus-531	25	44	(	(	PUNCT
finefocus-531	25	45	r)-1,2	r)-1,2	NOUN
finefocus-531	25	46	-	-	NOUN
finefocus-531	25	47	pd	pd	NOUN
finefocus-531	25	48	can	can	AUX
finefocus-531	25	49	be	be	AUX
finefocus-531	25	50	produced	produce	VERB
finefocus-531	25	51	from	from	ADP
finefocus-531	25	52	glucose	glucose	NOUN
finefocus-531	25	53	via	via	ADP
finefocus-531	25	54	the	the	DET
finefocus-531	25	55	methylglyoxal	methylglyoxal	ADJ
finefocus-531	25	56	bypass	bypass	NOUN
finefocus-531	25	57	(	(	PUNCT
finefocus-531	25	58	24	24	NUM
finefocus-531	25	59	)	)	PUNCT
finefocus-531	25	60	.	.	PUNCT
finefocus-531	26	1	during	during	ADP
finefocus-531	26	2	methylpentose	methylpentose	ADJ
finefocus-531	26	3	metabolism	metabolism	NOUN
finefocus-531	26	4	,	,	PUNCT
finefocus-531	26	5	l	l	NOUN
finefocus-531	26	6	-	-	PUNCT
finefocus-531	26	7	rhamnose	rhamnose	ADJ
finefocus-531	26	8	and	and	CCONJ
finefocus-531	26	9	l	l	NOUN
finefocus-531	26	10	-	-	NOUN
finefocus-531	26	11	fucose	fucose	NOUN
finefocus-531	26	12	are	be	AUX
finefocus-531	26	13	converted	convert	VERB
finefocus-531	26	14	to	to	ADP
finefocus-531	26	15	their	their	PRON
finefocus-531	26	16	corresponding	corresponding	ADJ
finefocus-531	26	17	phosphate	phosphate	NOUN
finefocus-531	26	18	intermediates	intermediate	NOUN
finefocus-531	26	19	,	,	PUNCT
finefocus-531	26	20	fuculose-1	fuculose-1	NOUN
finefocus-531	26	21	-	-	PUNCT
finefocus-531	26	22	phosphate	phosphate	NOUN
finefocus-531	26	23	and	and	CCONJ
finefocus-531	26	24	rhamnulose-1phosphate	rhamnulose-1phosphate	NOUN
finefocus-531	26	25	,	,	PUNCT
finefocus-531	26	26	by	by	ADP
finefocus-531	26	27	inducible	inducible	ADJ
finefocus-531	26	28	parallel	parallel	ADJ
finefocus-531	26	29	pathways	pathway	NOUN
finefocus-531	26	30	each	each	PRON
finefocus-531	26	31	including	include	VERB
finefocus-531	26	32	a	a	DET
finefocus-531	26	33	permease	permease	NOUN
finefocus-531	26	34	,	,	PUNCT
finefocus-531	26	35	isomerase	isomerase	NOUN
finefocus-531	26	36	,	,	PUNCT
finefocus-531	26	37	kinase	kinase	NOUN
finefocus-531	26	38	and	and	CCONJ
finefocus-531	26	39	aldolase	aldolase	NOUN
finefocus-531	26	40	,	,	PUNCT
finefocus-531	26	41	which	which	PRON
finefocus-531	26	42	are	be	AUX
finefocus-531	26	43	then	then	ADV
finefocus-531	26	44	converted	convert	VERB
finefocus-531	26	45	to	to	ADP
finefocus-531	26	46	dihydroxyacetone	dihydroxyacetone	NOUN
finefocus-531	26	47	(	(	PUNCT
finefocus-531	26	48	dhap	dhap	NOUN
finefocus-531	26	49	)	)	PUNCT
finefocus-531	26	50	and	and	CCONJ
finefocus-531	26	51	l	l	NOUN
finefocus-531	26	52	-	-	NOUN
finefocus-531	26	53	lactaldehyde	lactaldehyde	NOUN
finefocus-531	26	54	.	.	PUNCT
finefocus-531	27	1	under	under	ADP
finefocus-531	27	2	anaerobic	anaerobic	ADJ
finefocus-531	27	3	conditions	condition	NOUN
finefocus-531	27	4	,	,	PUNCT
finefocus-531	27	5	l	l	NOUN
finefocus-531	27	6	-	-	NOUN
finefocus-531	27	7	lactaldehyde	lactaldehyde	NOUN
finefocus-531	27	8	is	be	AUX
finefocus-531	27	9	reduced	reduce	VERB
finefocus-531	27	10	to	to	ADP
finefocus-531	27	11	(	(	PUNCT
finefocus-531	27	12	s)-1,2	s)-1,2	NOUN
finefocus-531	27	13	-	-	NOUN
finefocus-531	27	14	pd	pd	NOUN
finefocus-531	27	15	via	via	ADP
finefocus-531	27	16	the	the	DET
finefocus-531	27	17	action	action	NOUN
finefocus-531	27	18	of	of	ADP
finefocus-531	27	19	propanediol	propanediol	NOUN
finefocus-531	27	20	oxidoreductase	oxidoreductase	NOUN
finefocus-531	27	21	.	.	PUNCT
finefocus-531	28	1	under	under	ADP
finefocus-531	28	2	aerobic	aerobic	ADJ
finefocus-531	28	3	conditions	condition	NOUN
finefocus-531	28	4	,	,	PUNCT
finefocus-531	28	5	l	l	NOUN
finefocus-531	28	6	-	-	NOUN
finefocus-531	28	7	lactaldehyde	lactaldehyde	NOUN
finefocus-531	28	8	is	be	AUX
finefocus-531	28	9	oxidized	oxidize	VERB
finefocus-531	28	10	to	to	ADP
finefocus-531	28	11	l	l	NOUN
finefocus-531	28	12	-	-	NOUN
finefocus-531	28	13	lactate	lactate	NOUN
finefocus-531	28	14	via	via	ADP
finefocus-531	28	15	lactaldehyde	lactaldehyde	NOUN
finefocus-531	28	16	dehydrogenase	dehydrogenase	NOUN
finefocus-531	28	17	and	and	CCONJ
finefocus-531	28	18	then	then	ADV
finefocus-531	28	19	further	far	ADV
finefocus-531	28	20	to	to	PART
finefocus-531	28	21	pyruvate	pyruvate	VERB
finefocus-531	28	22	.	.	PUNCT
finefocus-531	29	1	the	the	DET
finefocus-531	29	2	methylglyoxal	methylglyoxal	ADJ
finefocus-531	29	3	pathway	pathway	NOUN
finefocus-531	29	4	is	be	AUX
finefocus-531	29	5	an	an	DET
finefocus-531	29	6	offshoot	offshoot	ADJ
finefocus-531	29	7	branch	branch	NOUN
finefocus-531	29	8	of	of	ADP
finefocus-531	29	9	glycolysis	glycolysis	NOUN
finefocus-531	29	10	where	where	SCONJ
finefocus-531	29	11	dhap	dhap	PROPN
finefocus-531	29	12	is	be	AUX
finefocus-531	29	13	converted	convert	VERB
finefocus-531	29	14	to	to	ADP
finefocus-531	29	15	methylglyoxal	methylglyoxal	NOUN
finefocus-531	29	16	and	and	CCONJ
finefocus-531	29	17	then	then	ADV
finefocus-531	29	18	d	d	PROPN
finefocus-531	29	19	-	-	PUNCT
finefocus-531	29	20	lactaldehyde	lactaldehyde	NOUN
finefocus-531	29	21	.	.	PUNCT
finefocus-531	30	1	the	the	DET
finefocus-531	30	2	end	end	NOUN
finefocus-531	30	3	-	-	PUNCT
finefocus-531	30	4	products	product	NOUN
finefocus-531	30	5	,	,	PUNCT
finefocus-531	30	6	depending	depend	VERB
finefocus-531	30	7	on	on	ADP
finefocus-531	30	8	oxygen	oxygen	NOUN
finefocus-531	30	9	conditions	condition	NOUN
finefocus-531	30	10	,	,	PUNCT
finefocus-531	30	11	are	be	AUX
finefocus-531	30	12	either	either	CCONJ
finefocus-531	30	13	(	(	PUNCT
finefocus-531	30	14	r)-1,2	r)-1,2	PROPN
finefocus-531	30	15	-	-	ADJ
finefocus-531	30	16	pd	pd	NOUN
finefocus-531	30	17	or	or	CCONJ
finefocus-531	30	18	pyruvate	pyruvate	NOUN
finefocus-531	30	19	(	(	PUNCT
finefocus-531	30	20	2	2	NUM
finefocus-531	30	21	,	,	PUNCT
finefocus-531	30	22	3	3	NUM
finefocus-531	30	23	)	)	PUNCT
finefocus-531	30	24	.	.	PUNCT
finefocus-531	31	1	the	the	DET
finefocus-531	31	2	catabolism	catabolism	NOUN
finefocus-531	31	3	of	of	ADP
finefocus-531	31	4	sugars	sugar	NOUN
finefocus-531	31	5	leading	lead	VERB
finefocus-531	31	6	to	to	ADP
finefocus-531	31	7	1,2	1,2	NUM
finefocus-531	31	8	-	-	PUNCT
finefocus-531	31	9	pd	pd	NOUN
finefocus-531	31	10	production	production	NOUN
finefocus-531	31	11	has	have	AUX
finefocus-531	31	12	been	be	AUX
finefocus-531	31	13	examined	examine	VERB
finefocus-531	31	14	in	in	ADP
finefocus-531	31	15	several	several	ADJ
finefocus-531	31	16	organisms	organism	NOUN
finefocus-531	31	17	of	of	ADP
finefocus-531	31	18	which	which	PRON
finefocus-531	31	19	the	the	DET
finefocus-531	31	20	methylpentose	methylpentose	ADJ
finefocus-531	31	21	metabolism	metabolism	NOUN
finefocus-531	31	22	of	of	ADP
finefocus-531	31	23	escherichia	escherichia	NOUN
finefocus-531	31	24	coli	coli	NOUN
finefocus-531	31	25	strain	strain	NOUN
finefocus-531	31	26	k-12	k-12	NOUN
finefocus-531	31	27	was	be	AUX
finefocus-531	31	28	extensively	extensively	ADV
finefocus-531	31	29	studied	study	VERB
finefocus-531	31	30	(	(	PUNCT
finefocus-531	31	31	4	4	NUM
finefocus-531	31	32	,	,	PUNCT
finefocus-531	31	33	5	5	NUM
finefocus-531	31	34	)	)	PUNCT
finefocus-531	31	35	.	.	PUNCT
finefocus-531	32	1	under	under	ADP
finefocus-531	32	2	aerobic	aerobic	ADJ
finefocus-531	32	3	conditions	condition	NOUN
finefocus-531	32	4	,	,	PUNCT
finefocus-531	32	5	active	active	ADJ
finefocus-531	32	6	lactaldehyde	lactaldehyde	NOUN
finefocus-531	32	7	dehydrogenase	dehydrogenase	NOUN
finefocus-531	32	8	is	be	AUX
finefocus-531	32	9	induced	induce	VERB
finefocus-531	32	10	in	in	ADP
finefocus-531	32	11	both	both	DET
finefocus-531	32	12	fucoseand	fucoseand	ADV
finefocus-531	32	13	rhamnosegrown	rhamnosegrown	ADJ
finefocus-531	32	14	cells	cell	NOUN
finefocus-531	32	15	and	and	CCONJ
finefocus-531	32	16	a	a	DET
finefocus-531	32	17	basal	basal	ADJ
finefocus-531	32	18	level	level	NOUN
finefocus-531	32	19	expression	expression	NOUN
finefocus-531	32	20	of	of	ADP
finefocus-531	32	21	inactive	inactive	ADJ
finefocus-531	32	22	propanediol	propanediol	NOUN
finefocus-531	32	23	oxidoreductase	oxidoreductase	NOUN
finefocus-531	32	24	is	be	AUX
finefocus-531	32	25	observed	observe	VERB
finefocus-531	32	26	in	in	ADP
finefocus-531	32	27	fucose	fucose	NOUN
finefocus-531	32	28	-	-	PUNCT
finefocus-531	32	29	grown	grow	VERB
finefocus-531	32	30	cells	cell	NOUN
finefocus-531	32	31	.	.	PUNCT
finefocus-531	33	1	this	this	PRON
finefocus-531	33	2	allows	allow	VERB
finefocus-531	33	3	for	for	ADP
finefocus-531	33	4	much	much	ADV
finefocus-531	33	5	quicker	quick	ADJ
finefocus-531	33	6	adaptation	adaptation	NOUN
finefocus-531	33	7	of	of	ADP
finefocus-531	33	8	fucosegrown	fucosegrown	ADJ
finefocus-531	33	9	cells	cell	NOUN
finefocus-531	33	10	to	to	PART
finefocus-531	33	11	anaerobiosis	anaerobiosis	VERB
finefocus-531	33	12	,	,	PUNCT
finefocus-531	33	13	although	although	SCONJ
finefocus-531	33	14	final	final	ADJ
finefocus-531	33	15	enzymatic	enzymatic	ADJ
finefocus-531	33	16	activities	activity	NOUN
finefocus-531	33	17	are	be	AUX
finefocus-531	33	18	the	the	DET
finefocus-531	33	19	same	same	ADJ
finefocus-531	33	20	.	.	PUNCT
finefocus-531	34	1	the	the	DET
finefocus-531	34	2	propanediol	propanediol	NOUN
finefocus-531	34	3	oxidoreductases	oxidoreductase	NOUN
finefocus-531	34	4	produced	produce	VERB
finefocus-531	34	5	by	by	ADP
finefocus-531	34	6	l	l	NOUN
finefocus-531	34	7	-	-	PUNCT
finefocus-531	34	8	rhamnose	rhamnose	NOUN
finefocus-531	34	9	-	-	PUNCT
finefocus-531	34	10	grown	grow	VERB
finefocus-531	34	11	cells	cell	NOUN
finefocus-531	34	12	and	and	CCONJ
finefocus-531	34	13	fucose	fucose	NOUN
finefocus-531	34	14	-	-	PUNCT
finefocus-531	34	15	grown	grow	VERB
finefocus-531	34	16	cells	cell	NOUN
finefocus-531	34	17	are	be	AUX
finefocus-531	34	18	immunologically	immunologically	ADV
finefocus-531	34	19	identical	identical	ADJ
finefocus-531	34	20	,	,	PUNCT
finefocus-531	34	21	which	which	PRON
finefocus-531	34	22	strongly	strongly	ADV
finefocus-531	34	23	suggests	suggest	VERB
finefocus-531	34	24	that	that	SCONJ
finefocus-531	34	25	they	they	PRON
finefocus-531	34	26	are	be	AUX
finefocus-531	34	27	products	product	NOUN
finefocus-531	34	28	of	of	ADP
finefocus-531	34	29	a	a	DET
finefocus-531	34	30	single	single	ADJ
finefocus-531	34	31	gene	gene	NOUN
finefocus-531	34	32	located	locate	VERB
finefocus-531	34	33	in	in	ADP
finefocus-531	34	34	the	the	DET
finefocus-531	34	35	fucose	fucose	ADJ
finefocus-531	34	36	locus	locus	NOUN
finefocus-531	34	37	(	(	PUNCT
finefocus-531	34	38	fuco	fuco	ADJ
finefocus-531	34	39	)	)	PUNCT
finefocus-531	34	40	and	and	CCONJ
finefocus-531	34	41	when	when	SCONJ
finefocus-531	34	42	disrupted	disrupt	VERB
finefocus-531	34	43	,	,	PUNCT
finefocus-531	34	44	l	l	NOUN
finefocus-531	34	45	-	-	PUNCT
finefocus-531	34	46	rhamnose	rhamnose	NOUN
finefocus-531	34	47	(	(	PUNCT
finefocus-531	34	48	as	as	ADV
finefocus-531	34	49	well	well	ADV
finefocus-531	34	50	as	as	ADP
finefocus-531	34	51	l	l	NOUN
finefocus-531	34	52	-	-	NOUN
finefocus-531	34	53	fucose	fucose	NOUN
finefocus-531	34	54	)	)	PUNCT
finefocus-531	34	55	fails	fail	VERB
finefocus-531	34	56	to	to	PART
finefocus-531	34	57	induce	induce	VERB
finefocus-531	34	58	propanediol	propanediol	NOUN
finefocus-531	34	59	oxidoreductase	oxidoreductase	NOUN
finefocus-531	34	60	(	(	PUNCT
finefocus-531	34	61	11	11	NUM
finefocus-531	34	62	)	)	PUNCT
finefocus-531	34	63	.	.	PUNCT
finefocus-531	35	1	22	22	NUM
finefocus-531	35	2	•	•	NUM
finefocus-531	35	3	fine	fine	ADJ
finefocus-531	35	4	focus	focus	NOUN
finefocus-531	35	5	,	,	PUNCT
finefocus-531	35	6	vol	vol	NOUN
finefocus-531	35	7	.	.	PUNCT
finefocus-531	35	8	4(1	4(1	NOUN
finefocus-531	35	9	)	)	PUNCT
finefocus-531	35	10	materials	material	NOUN
finefocus-531	35	11	and	and	CCONJ
finefocus-531	35	12	methods	method	NOUN
finefocus-531	35	13	the	the	DET
finefocus-531	35	14	role	role	NOUN
finefocus-531	35	15	of	of	ADP
finefocus-531	35	16	phosphate	phosphate	ADJ
finefocus-531	35	17	limitation	limitation	NOUN
finefocus-531	35	18	in	in	ADP
finefocus-531	35	19	the	the	DET
finefocus-531	35	20	regulation	regulation	NOUN
finefocus-531	35	21	of	of	ADP
finefocus-531	35	22	the	the	DET
finefocus-531	35	23	methylglyoxal	methylglyoxal	ADJ
finefocus-531	35	24	pathway	pathway	NOUN
finefocus-531	35	25	and	and	CCONJ
finefocus-531	35	26	subsequent	subsequent	ADJ
finefocus-531	35	27	production	production	NOUN
finefocus-531	35	28	of	of	ADP
finefocus-531	35	29	(	(	PUNCT
finefocus-531	35	30	r)-1,2	r)-1,2	NOUN
finefocus-531	35	31	-	-	NOUN
finefocus-531	35	32	pd	pd	NOUN
finefocus-531	35	33	has	have	AUX
finefocus-531	35	34	as	as	ADV
finefocus-531	35	35	well	well	ADV
finefocus-531	35	36	been	be	AUX
finefocus-531	35	37	detailed	detail	VERB
finefocus-531	35	38	for	for	ADP
finefocus-531	35	39	clostridium	clostridium	NOUN
finefocus-531	35	40	sphenoides	sphenoide	NOUN
finefocus-531	35	41	as	as	SCONJ
finefocus-531	35	42	described	describe	VERB
finefocus-531	35	43	by	by	ADP
finefocus-531	35	44	(	(	PUNCT
finefocus-531	35	45	31	31	NUM
finefocus-531	35	46	)	)	PUNCT
finefocus-531	35	47	.	.	PUNCT
finefocus-531	36	1	conversion	conversion	NOUN
finefocus-531	36	2	of	of	ADP
finefocus-531	36	3	sugars	sugar	NOUN
finefocus-531	36	4	,	,	PUNCT
finefocus-531	36	5	including	include	VERB
finefocus-531	36	6	glucose	glucose	NOUN
finefocus-531	36	7	and	and	CCONJ
finefocus-531	36	8	xylose	xylose	PROPN
finefocus-531	36	9	to	to	ADP
finefocus-531	36	10	1,2	1,2	NUM
finefocus-531	36	11	-	-	SYM
finefocus-531	36	12	pd	pd	NOUN
finefocus-531	36	13	has	have	AUX
finefocus-531	36	14	also	also	ADV
finefocus-531	36	15	been	be	AUX
finefocus-531	36	16	reported	report	VERB
finefocus-531	36	17	by	by	ADP
finefocus-531	36	18	salmonella	salmonella	NOUN
finefocus-531	36	19	typhimurium	typhimurium	NUM
finefocus-531	36	20	under	under	ADP
finefocus-531	36	21	aerobic	aerobic	ADJ
finefocus-531	36	22	conditions	condition	NOUN
finefocus-531	36	23	(	(	PUNCT
finefocus-531	36	24	5	5	NUM
finefocus-531	36	25	)	)	PUNCT
finefocus-531	36	26	and	and	CCONJ
finefocus-531	36	27	by	by	ADP
finefocus-531	36	28	the	the	DET
finefocus-531	36	29	strictly	strictly	ADV
finefocus-531	36	30	anaerobic	anaerobic	ADJ
finefocus-531	36	31	thermophilic	thermophilic	ADJ
finefocus-531	36	32	mutant	mutant	NOUN
finefocus-531	36	33	of	of	ADP
finefocus-531	36	34	thermoanerobacterium	thermoanerobacterium	NOUN
finefocus-531	36	35	thermosaccharolyticum	thermosaccharolyticum	NOUN
finefocus-531	36	36	strain	strain	NOUN
finefocus-531	36	37	hg-8	hg-8	PUNCT
finefocus-531	36	38	(	(	PUNCT
finefocus-531	36	39	2	2	NUM
finefocus-531	36	40	,	,	PUNCT
finefocus-531	36	41	8)	8)	NUM
finefocus-531	36	42	.	.	PUNCT
finefocus-531	37	1	more	more	ADV
finefocus-531	37	2	recently	recently	ADV
finefocus-531	37	3	,	,	PUNCT
finefocus-531	37	4	mention	mention	NOUN
finefocus-531	37	5	of	of	ADP
finefocus-531	37	6	the	the	DET
finefocus-531	37	7	ability	ability	NOUN
finefocus-531	37	8	of	of	ADP
finefocus-531	37	9	extremely	extremely	ADV
finefocus-531	37	10	thermophilic	thermophilic	ADJ
finefocus-531	37	11	caldicellulosiruptor	caldicellulosiruptor	NOUN
finefocus-531	37	12	species	specie	NOUN
finefocus-531	37	13	to	to	PART
finefocus-531	37	14	catabolize	catabolize	VERB
finefocus-531	37	15	l	l	NOUN
finefocus-531	37	16	-	-	VERB
finefocus-531	37	17	rhamnose	rhamnose	NOUN
finefocus-531	37	18	to	to	ADP
finefocus-531	37	19	1,2	1,2	NUM
finefocus-531	37	20	-	-	SYM
finefocus-531	37	21	pd	pd	NOUN
finefocus-531	37	22	has	have	AUX
finefocus-531	37	23	also	also	ADV
finefocus-531	37	24	been	be	AUX
finefocus-531	37	25	described	describe	VERB
finefocus-531	37	26	(	(	PUNCT
finefocus-531	37	27	6	6	NUM
finefocus-531	37	28	)	)	PUNCT
finefocus-531	37	29	and	and	CCONJ
finefocus-531	37	30	found	find	VERB
finefocus-531	37	31	to	to	PART
finefocus-531	37	32	be	be	AUX
finefocus-531	37	33	a	a	DET
finefocus-531	37	34	common	common	ADJ
finefocus-531	37	35	feature	feature	NOUN
finefocus-531	37	36	in	in	ADP
finefocus-531	37	37	the	the	DET
finefocus-531	37	38	genus	genus	NOUN
finefocus-531	37	39	(	(	PUNCT
finefocus-531	37	40	14	14	NUM
finefocus-531	37	41	)	)	PUNCT
finefocus-531	37	42	.	.	PUNCT
finefocus-531	38	1	the	the	DET
finefocus-531	38	2	aim	aim	NOUN
finefocus-531	38	3	of	of	ADP
finefocus-531	38	4	this	this	DET
finefocus-531	38	5	study	study	NOUN
finefocus-531	38	6	was	be	AUX
finefocus-531	38	7	to	to	PART
finefocus-531	38	8	examine	examine	VERB
finefocus-531	38	9	escherichia	escherichia	NOUN
finefocus-531	38	10	strain	strain	NOUN
finefocus-531	38	11	cc5c	cc5c	PROPN
finefocus-531	38	12	isolated	isolate	VERB
finefocus-531	38	13	from	from	ADP
finefocus-531	38	14	geothermally	geothermally	ADJ
finefocus-531	38	15	-	-	PUNCT
finefocus-531	38	16	heated	heat	VERB
finefocus-531	38	17	intertidal	intertidal	ADJ
finefocus-531	38	18	pools	pool	NOUN
finefocus-531	38	19	north	north	ADV
finefocus-531	38	20	of	of	ADP
finefocus-531	38	21	húsavík	húsavík	NOUN
finefocus-531	38	22	,	,	PUNCT
finefocus-531	38	23	north	north	PROPN
finefocus-531	38	24	central	central	ADJ
finefocus-531	38	25	iceland	iceland	PROPN
finefocus-531	38	26	,	,	PUNCT
finefocus-531	38	27	which	which	PRON
finefocus-531	38	28	preliminary	preliminary	ADJ
finefocus-531	38	29	screening	screening	NOUN
finefocus-531	38	30	identified	identify	VERB
finefocus-531	38	31	as	as	ADP
finefocus-531	38	32	a	a	DET
finefocus-531	38	33	1,2	1,2	NUM
finefocus-531	38	34	-	-	PUNCT
finefocus-531	38	35	pd	pd	NOUN
finefocus-531	38	36	materials	material	NOUN
finefocus-531	38	37	all	all	DET
finefocus-531	38	38	reagents	reagent	NOUN
finefocus-531	38	39	were	be	AUX
finefocus-531	38	40	acquired	acquire	VERB
finefocus-531	38	41	from	from	ADP
finefocus-531	38	42	sigmaaldrich	sigmaaldrich	NOUN
finefocus-531	38	43	unless	unless	SCONJ
finefocus-531	38	44	stated	state	VERB
finefocus-531	38	45	otherwise	otherwise	ADV
finefocus-531	38	46	.	.	PUNCT
finefocus-531	39	1	brilliant	brilliant	ADJ
finefocus-531	39	2	green	green	ADJ
finefocus-531	39	3	agar	agar	NOUN
finefocus-531	39	4	(	(	PUNCT
finefocus-531	39	5	bga	bga	NOUN
finefocus-531	39	6	)	)	PUNCT
finefocus-531	39	7	,	,	PUNCT
finefocus-531	39	8	eosin	eosin	NOUN
finefocus-531	39	9	-	-	PUNCT
finefocus-531	39	10	methylene	methylene	ADJ
finefocus-531	39	11	blue	blue	ADJ
finefocus-531	39	12	agar	agar	NOUN
finefocus-531	39	13	(	(	PUNCT
finefocus-531	39	14	emb	emb	NOUN
finefocus-531	39	15	)	)	PUNCT
finefocus-531	39	16	,	,	PUNCT
finefocus-531	39	17	macconkey	macconkey	NOUN
finefocus-531	39	18	agar	agar	NOUN
finefocus-531	39	19	(	(	PUNCT
finefocus-531	39	20	mac	mac	PROPN
finefocus-531	39	21	)	)	PUNCT
finefocus-531	39	22	,	,	PUNCT
finefocus-531	39	23	mannitol	mannitol	NOUN
finefocus-531	39	24	salt	salt	NOUN
finefocus-531	39	25	agar	agar	NOUN
finefocus-531	39	26	(	(	PUNCT
finefocus-531	39	27	msa	msa	PROPN
finefocus-531	39	28	)	)	PUNCT
finefocus-531	39	29	,	,	PUNCT
finefocus-531	39	30	yeast	yeast	NOUN
finefocus-531	39	31	extract	extract	NOUN
finefocus-531	39	32	(	(	PUNCT
finefocus-531	39	33	ye	ye	NOUN
finefocus-531	39	34	)	)	PUNCT
finefocus-531	39	35	,	,	PUNCT
finefocus-531	39	36	reasoner	reasoner	NOUN
finefocus-531	39	37	’s	’s	PART
finefocus-531	39	38	2a	2a	NUM
finefocus-531	39	39	agar	agar	NOUN
finefocus-531	39	40	(	(	PUNCT
finefocus-531	39	41	r2a	r2a	NOUN
finefocus-531	39	42	)	)	PUNCT
finefocus-531	39	43	,	,	PUNCT
finefocus-531	39	44	and	and	CCONJ
finefocus-531	39	45	plate	plate	NOUN
finefocus-531	39	46	count	count	NOUN
finefocus-531	39	47	agar	agar	NOUN
finefocus-531	39	48	(	(	PUNCT
finefocus-531	39	49	pca	pca	PROPN
finefocus-531	39	50	)	)	PUNCT
finefocus-531	39	51	were	be	AUX
finefocus-531	39	52	obtained	obtain	VERB
finefocus-531	39	53	from	from	ADP
finefocus-531	39	54	difco	difco	NOUN
finefocus-531	39	55	.	.	PUNCT
finefocus-531	40	1	l	l	NOUN
finefocus-531	40	2	-	-	PUNCT
finefocus-531	40	3	fucose	fucose	PROPN
finefocus-531	40	4	and	and	CCONJ
finefocus-531	40	5	fucoidan	fucoidan	PROPN
finefocus-531	40	6	were	be	AUX
finefocus-531	40	7	obtained	obtain	VERB
finefocus-531	40	8	from	from	ADP
finefocus-531	40	9	dextra	dextra	ADJ
finefocus-531	40	10	(	(	PUNCT
finefocus-531	40	11	reading	reading	NOUN
finefocus-531	40	12	,	,	PUNCT
finefocus-531	40	13	uk	uk	PROPN
finefocus-531	40	14	)	)	PUNCT
finefocus-531	40	15	.	.	PUNCT
finefocus-531	41	1	azure	azure	NOUN
finefocus-531	41	2	-	-	PUNCT
finefocus-531	41	3	linked	link	VERB
finefocus-531	41	4	β	β	NOUN
finefocus-531	41	5	-	-	PUNCT
finefocus-531	41	6	glucan	glucan	NOUN
finefocus-531	41	7	and	and	CCONJ
finefocus-531	41	8	xylan	xylan	NOUN
finefocus-531	41	9	were	be	AUX
finefocus-531	41	10	obtained	obtain	VERB
finefocus-531	41	11	from	from	ADP
finefocus-531	41	12	megazyme	megazyme	NOUN
finefocus-531	41	13	.	.	PUNCT
finefocus-531	42	1	nitrogen	nitrogen	PROPN
finefocus-531	42	2	used	use	VERB
finefocus-531	42	3	for	for	ADP
finefocus-531	42	4	headspace	headspace	NOUN
finefocus-531	42	5	gas	gas	NOUN
finefocus-531	42	6	contained	contain	VERB
finefocus-531	42	7	less	less	ADJ
finefocus-531	42	8	than	than	ADP
finefocus-531	42	9	5	5	NUM
finefocus-531	42	10	ppm	ppm	NOUN
finefocus-531	42	11	of	of	ADP
finefocus-531	42	12	oxygen	oxygen	NOUN
finefocus-531	42	13	.	.	PUNCT
finefocus-531	43	1	e.	e.	PROPN
finefocus-531	43	2	coli	coli	PROPN
finefocus-531	43	3	(	(	PUNCT
finefocus-531	43	4	dsm	dsm	PROPN
finefocus-531	43	5	30083	30083	NUM
finefocus-531	43	6	)	)	PUNCT
finefocus-531	43	7	was	be	AUX
finefocus-531	43	8	obtained	obtain	VERB
finefocus-531	43	9	from	from	ADP
finefocus-531	43	10	deutsche	deutsche	NOUN
finefocus-531	43	11	producing	produce	VERB
finefocus-531	43	12	organism	organism	NOUN
finefocus-531	43	13	from	from	ADP
finefocus-531	43	14	methylpentoses	methylpentose	NOUN
finefocus-531	43	15	.	.	PUNCT
finefocus-531	44	1	since	since	SCONJ
finefocus-531	44	2	the	the	DET
finefocus-531	44	3	ecosystem	ecosystem	NOUN
finefocus-531	44	4	of	of	ADP
finefocus-531	44	5	the	the	DET
finefocus-531	44	6	these	these	DET
finefocus-531	44	7	intertidal	intertidal	ADJ
finefocus-531	44	8	pools	pool	NOUN
finefocus-531	44	9	consists	consist	VERB
finefocus-531	44	10	largely	largely	ADV
finefocus-531	44	11	of	of	ADP
finefocus-531	44	12	methylpentoserich	methylpentoserich	ADJ
finefocus-531	44	13	macro	macro	ADJ
finefocus-531	44	14	algae	algae	NOUN
finefocus-531	44	15	,	,	PUNCT
finefocus-531	44	16	serving	serve	VERB
finefocus-531	44	17	as	as	ADP
finefocus-531	44	18	a	a	DET
finefocus-531	44	19	renewable	renewable	ADJ
finefocus-531	44	20	carbon	carbon	NOUN
finefocus-531	44	21	source	source	NOUN
finefocus-531	44	22	,	,	PUNCT
finefocus-531	44	23	it	it	PRON
finefocus-531	44	24	was	be	AUX
finefocus-531	44	25	hypothesized	hypothesize	VERB
finefocus-531	44	26	that	that	SCONJ
finefocus-531	44	27	the	the	DET
finefocus-531	44	28	microbes	microbe	NOUN
finefocus-531	44	29	within	within	ADP
finefocus-531	44	30	that	that	DET
finefocus-531	44	31	ecosystem	ecosystem	NOUN
finefocus-531	44	32	would	would	AUX
finefocus-531	44	33	be	be	AUX
finefocus-531	44	34	able	able	ADJ
finefocus-531	44	35	to	to	PART
finefocus-531	44	36	ferment	ferment	VERB
finefocus-531	44	37	common	common	ADJ
finefocus-531	44	38	sugars	sugar	NOUN
finefocus-531	44	39	to	to	ADP
finefocus-531	44	40	1,2	1,2	NUM
finefocus-531	44	41	-	-	NUM
finefocus-531	44	42	pd	pd	NOUN
finefocus-531	44	43	while	while	SCONJ
finefocus-531	44	44	demonstrating	demonstrate	VERB
finefocus-531	44	45	a	a	DET
finefocus-531	44	46	broader	broad	ADJ
finefocus-531	44	47	tolerance	tolerance	NOUN
finefocus-531	44	48	to	to	ADP
finefocus-531	44	49	environmental	environmental	ADJ
finefocus-531	44	50	stresses	stress	NOUN
finefocus-531	44	51	due	due	ADP
finefocus-531	44	52	to	to	ADP
finefocus-531	44	53	the	the	DET
finefocus-531	44	54	highly	highly	ADV
finefocus-531	44	55	variable	variable	ADJ
finefocus-531	44	56	geophysical	geophysical	ADJ
finefocus-531	44	57	conditions	condition	NOUN
finefocus-531	44	58	associated	associate	VERB
finefocus-531	44	59	with	with	ADP
finefocus-531	44	60	both	both	PRON
finefocus-531	44	61	geothermally	geothermally	ADV
finefocus-531	44	62	heated	heat	VERB
finefocus-531	44	63	fresh	fresh	ADJ
finefocus-531	44	64	water	water	NOUN
finefocus-531	44	65	and	and	CCONJ
finefocus-531	44	66	the	the	DET
finefocus-531	44	67	tidal	tidal	ADJ
finefocus-531	44	68	influx	influx	NOUN
finefocus-531	44	69	of	of	ADP
finefocus-531	44	70	saline	saline	ADJ
finefocus-531	44	71	water	water	NOUN
finefocus-531	44	72	.	.	PUNCT
finefocus-531	45	1	sammlung	sammlung	PROPN
finefocus-531	45	2	von	von	PROPN
finefocus-531	45	3	mikroorganismen	mikroorganismen	PROPN
finefocus-531	45	4	und	und	VERB
finefocus-531	45	5	zellkulturen	zellkulturen	PROPN
finefocus-531	45	6	(	(	PUNCT
finefocus-531	45	7	germany	germany	PROPN
finefocus-531	45	8	)	)	PUNCT
finefocus-531	45	9	.	.	PUNCT
finefocus-531	46	1	cultivation	cultivation	NOUN
finefocus-531	46	2	medium	medium	ADJ
finefocus-531	46	3	anaerobic	anaerobic	NOUN
finefocus-531	46	4	cultivations	cultivation	NOUN
finefocus-531	46	5	were	be	AUX
finefocus-531	46	6	performed	perform	VERB
finefocus-531	46	7	in	in	ADP
finefocus-531	46	8	basal	basal	ADJ
finefocus-531	46	9	mineral	mineral	NOUN
finefocus-531	46	10	medium	medium	NOUN
finefocus-531	46	11	(	(	PUNCT
finefocus-531	46	12	bm	bm	PROPN
finefocus-531	46	13	)	)	PUNCT
finefocus-531	46	14	as	as	SCONJ
finefocus-531	46	15	previously	previously	ADV
finefocus-531	46	16	described	describe	VERB
finefocus-531	46	17	by	by	ADP
finefocus-531	46	18	(	(	PUNCT
finefocus-531	46	19	21	21	NUM
finefocus-531	46	20	)	)	PUNCT
finefocus-531	46	21	.	.	PUNCT
finefocus-531	47	1	the	the	DET
finefocus-531	47	2	culture	culture	NOUN
finefocus-531	47	3	medium	medium	NOUN
finefocus-531	47	4	consisted	consist	VERB
finefocus-531	47	5	of	of	ADP
finefocus-531	47	6	(	(	PUNCT
finefocus-531	47	7	per	per	ADP
finefocus-531	47	8	liter	liter	NOUN
finefocus-531	47	9	):	):	PUNCT
finefocus-531	47	10	nah2po4	nah2po4	PROPN
finefocus-531	47	11	2.34	2.34	NUM
finefocus-531	47	12	g	g	NOUN
finefocus-531	47	13	,	,	PUNCT
finefocus-531	47	14	na2hpo4	na2hpo4	PROPN
finefocus-531	47	15	3.33	3.33	NUM
finefocus-531	47	16	g	g	NOUN
finefocus-531	47	17	,	,	PUNCT
finefocus-531	47	18	nh4cl	nh4cl	PROPN
finefocus-531	47	19	2.2	2.2	NUM
finefocus-531	47	20	g	g	NOUN
finefocus-531	47	21	,	,	PUNCT
finefocus-531	47	22	nacl	nacl	NOUN
finefocus-531	47	23	3.0	3.0	NUM
finefocus-531	47	24	g	g	NOUN
finefocus-531	47	25	,	,	PUNCT
finefocus-531	47	26	cacl2	cacl2	NOUN
finefocus-531	47	27	8.8	8.8	NUM
finefocus-531	47	28	g	g	NOUN
finefocus-531	47	29	,	,	PUNCT
finefocus-531	47	30	mgcl2	mgcl2	PROPN
finefocus-531	48	1	x	x	SYM
finefocus-531	48	2	6h2o	6h2o	NOUN
finefocus-531	48	3	0.8	0.8	NUM
finefocus-531	48	4	g	g	NOUN
finefocus-531	48	5	,	,	PUNCT
finefocus-531	48	6	yeast	yeast	NOUN
finefocus-531	48	7	extract	extract	VERB
finefocus-531	48	8	2.0	2.0	NUM
finefocus-531	48	9	g	g	NOUN
finefocus-531	48	10	,	,	PUNCT
finefocus-531	48	11	resazurin	resazurin	NOUN
finefocus-531	48	12	1	1	NUM
finefocus-531	48	13	mg	mg	PROPN
finefocus-531	48	14	,	,	PUNCT
finefocus-531	48	15	trace	trace	NOUN
finefocus-531	48	16	element	element	NOUN
finefocus-531	48	17	solution	solution	NOUN
finefocus-531	48	18	1	1	NUM
finefocus-531	48	19	ml	ml	NOUN
finefocus-531	48	20	,	,	PUNCT
finefocus-531	48	21	vitamin	vitamin	NOUN
finefocus-531	48	22	solution	solution	NOUN
finefocus-531	48	23	1	1	NUM
finefocus-531	48	24	ml	ml	ADV
finefocus-531	48	25	and	and	CCONJ
finefocus-531	48	26	nahco3	nahco3	VERB
finefocus-531	48	27	0.8	0.8	NUM
finefocus-531	48	28	g.	g.	NOUN
finefocus-531	48	29	carbon	carbon	NOUN
finefocus-531	48	30	and	and	CCONJ
finefocus-531	48	31	energy	energy	NOUN
finefocus-531	48	32	sources	source	NOUN
finefocus-531	48	33	were	be	AUX
finefocus-531	48	34	20	20	NUM
finefocus-531	48	35	mm	mm	NOUN
finefocus-531	48	36	or	or	CCONJ
finefocus-531	48	37	in	in	ADP
finefocus-531	48	38	the	the	DET
finefocus-531	48	39	case	case	NOUN
finefocus-531	48	40	of	of	ADP
finefocus-531	48	41	polymeric	polymeric	ADJ
finefocus-531	48	42	23applied	23applie	VERB
finefocus-531	48	43	&	&	CCONJ
finefocus-531	48	44	environmental	environmental	ADJ
finefocus-531	48	45	microbiology	microbiology	NOUN
finefocus-531	49	1	•	•	NOUN
finefocus-531	49	2	substrates	substrate	NOUN
finefocus-531	49	3	,	,	PUNCT
finefocus-531	49	4	2	2	NUM
finefocus-531	49	5	g	g	PROPN
finefocus-531	49	6	l-1	l-1	NOUN
finefocus-531	49	7	.	.	PUNCT
finefocus-531	50	1	the	the	DET
finefocus-531	50	2	trace	trace	NOUN
finefocus-531	50	3	element	element	NOUN
finefocus-531	50	4	solution	solution	NOUN
finefocus-531	50	5	consisted	consist	VERB
finefocus-531	50	6	of	of	ADP
finefocus-531	50	7	(	(	PUNCT
finefocus-531	50	8	per	per	ADP
finefocus-531	50	9	liter	liter	NOUN
finefocus-531	50	10	):	):	PUNCT
finefocus-531	50	11	fecl2	fecl2	NOUN
finefocus-531	51	1	x	x	SYM
finefocus-531	51	2	4h2o	4h2o	NOUN
finefocus-531	51	3	2.0	2.0	NUM
finefocus-531	51	4	g	g	NOUN
finefocus-531	51	5	,	,	PUNCT
finefocus-531	51	6	edta	edta	X
finefocus-531	51	7	0.5	0.5	NUM
finefocus-531	51	8	g	g	NOUN
finefocus-531	51	9	,	,	PUNCT
finefocus-531	51	10	cucl2	cucl2	NOUN
finefocus-531	51	11	0.03	0.03	NUM
finefocus-531	51	12	g	g	NOUN
finefocus-531	51	13	,	,	PUNCT
finefocus-531	51	14	h3bo3	h3bo3	NOUN
finefocus-531	51	15	,	,	PUNCT
finefocus-531	51	16	zncl2	zncl2	PROPN
finefocus-531	51	17	,	,	PUNCT
finefocus-531	51	18	mncl2	mncl2	NOUN
finefocus-531	51	19	x	x	SYM
finefocus-531	51	20	4h2o	4h2o	NOUN
finefocus-531	51	21	,	,	PUNCT
finefocus-531	51	22	(	(	PUNCT
finefocus-531	51	23	nh4)6mo7o24	nh4)6mo7o24	PROPN
finefocus-531	51	24	,	,	PUNCT
finefocus-531	51	25	alcl3	alcl3	PROPN
finefocus-531	51	26	,	,	PUNCT
finefocus-531	51	27	cocl2	cocl2	NOUN
finefocus-531	51	28	x	x	SYM
finefocus-531	51	29	6h2o	6h2o	NOUN
finefocus-531	51	30	,	,	PUNCT
finefocus-531	51	31	nicl2	nicl2	PROPN
finefocus-531	51	32	,	,	PUNCT
finefocus-531	51	33	all	all	DET
finefocus-531	51	34	0.05	0.05	NUM
finefocus-531	51	35	g	g	NOUN
finefocus-531	51	36	,	,	PUNCT
finefocus-531	51	37	and	and	CCONJ
finefocus-531	51	38	1	1	NUM
finefocus-531	51	39	ml	ml	NOUN
finefocus-531	51	40	of	of	ADP
finefocus-531	51	41	concentrated	concentrate	VERB
finefocus-531	51	42	hcl	hcl	PROPN
finefocus-531	51	43	.	.	PUNCT
finefocus-531	52	1	the	the	DET
finefocus-531	52	2	medium	medium	NOUN
finefocus-531	52	3	was	be	AUX
finefocus-531	52	4	reduced	reduce	VERB
finefocus-531	52	5	with	with	ADP
finefocus-531	52	6	a	a	DET
finefocus-531	52	7	solution	solution	NOUN
finefocus-531	52	8	of	of	ADP
finefocus-531	52	9	na2s	na2s	PROPN
finefocus-531	52	10	x	x	PROPN
finefocus-531	52	11	9h2o	9h2o	NOUN
finefocus-531	52	12	,	,	PUNCT
finefocus-531	52	13	0.3	0.3	NUM
finefocus-531	52	14	g.	g.	NOUN
finefocus-531	52	15	the	the	DET
finefocus-531	52	16	vitamin	vitamin	NOUN
finefocus-531	52	17	solution	solution	NOUN
finefocus-531	52	18	was	be	AUX
finefocus-531	52	19	prepared	prepare	VERB
finefocus-531	52	20	according	accord	VERB
finefocus-531	52	21	to	to	ADP
finefocus-531	52	22	dsm141	dsm141	PROPN
finefocus-531	52	23	.	.	PROPN
finefocus-531	52	24	media	medium	NOUN
finefocus-531	52	25	was	be	AUX
finefocus-531	52	26	autoclaved	autoclave	VERB
finefocus-531	52	27	for	for	ADP
finefocus-531	52	28	60	60	NUM
finefocus-531	52	29	minutes	minute	NOUN
finefocus-531	52	30	after	after	ADP
finefocus-531	52	31	which	which	PRON
finefocus-531	52	32	vitamins	vitamin	NOUN
finefocus-531	52	33	,	,	PUNCT
finefocus-531	52	34	trace	trace	NOUN
finefocus-531	52	35	elements	element	NOUN
finefocus-531	52	36	,	,	PUNCT
finefocus-531	52	37	and	and	CCONJ
finefocus-531	52	38	carbon	carbon	NOUN
finefocus-531	52	39	sources	source	NOUN
finefocus-531	52	40	were	be	AUX
finefocus-531	52	41	added	add	VERB
finefocus-531	52	42	through	through	ADP
finefocus-531	52	43	a	a	DET
finefocus-531	52	44	syringe	syringe	NOUN
finefocus-531	52	45	filter	filter	NOUN
finefocus-531	52	46	(	(	PUNCT
finefocus-531	52	47	whatman	whatman	NOUN
finefocus-531	52	48	,	,	PUNCT
finefocus-531	52	49	pes	pe	VERB
finefocus-531	52	50	0.22	0.22	NUM
finefocus-531	52	51	µm	µm	NOUN
finefocus-531	52	52	)	)	PUNCT
finefocus-531	52	53	from	from	ADP
finefocus-531	52	54	sterile	sterile	ADJ
finefocus-531	52	55	stock	stock	NOUN
finefocus-531	52	56	bottles	bottle	NOUN
finefocus-531	52	57	.	.	PUNCT
finefocus-531	53	1	all	all	DET
finefocus-531	53	2	experiments	experiment	NOUN
finefocus-531	53	3	were	be	AUX
finefocus-531	53	4	performed	perform	VERB
finefocus-531	53	5	at	at	ADP
finefocus-531	53	6	35	35	NUM
finefocus-531	53	7	°	°	NOUN
finefocus-531	53	8	c	c	NOUN
finefocus-531	53	9	at	at	ADP
finefocus-531	53	10	ph	ph	PROPN
finefocus-531	53	11	7.0	7.0	NUM
finefocus-531	53	12	with	with	ADP
finefocus-531	53	13	a	a	DET
finefocus-531	53	14	liquidgas	liquidgas	NOUN
finefocus-531	53	15	phase	phase	NOUN
finefocus-531	53	16	ratio	ratio	NOUN
finefocus-531	53	17	of	of	ADP
finefocus-531	53	18	1:1	1:1	NUM
finefocus-531	53	19	without	without	ADP
finefocus-531	53	20	agitation	agitation	NOUN
finefocus-531	53	21	unless	unless	SCONJ
finefocus-531	53	22	otherwise	otherwise	ADV
finefocus-531	53	23	noted	note	VERB
finefocus-531	53	24	.	.	PUNCT
finefocus-531	54	1	aerobic	aerobic	ADJ
finefocus-531	54	2	cultivations	cultivation	NOUN
finefocus-531	54	3	were	be	AUX
finefocus-531	54	4	performed	perform	VERB
finefocus-531	54	5	using	use	VERB
finefocus-531	54	6	bm	bm	PROPN
finefocus-531	54	7	medium	medium	NOUN
finefocus-531	54	8	with	with	ADP
finefocus-531	54	9	the	the	DET
finefocus-531	54	10	omission	omission	NOUN
finefocus-531	54	11	of	of	ADP
finefocus-531	54	12	sodium	sodium	NOUN
finefocus-531	54	13	sulphide	sulphide	NOUN
finefocus-531	54	14	and	and	CCONJ
finefocus-531	54	15	cysteine	cysteine	NOUN
finefocus-531	54	16	solution	solution	NOUN
finefocus-531	54	17	.	.	PUNCT
finefocus-531	55	1	the	the	DET
finefocus-531	55	2	inoculum	inoculum	NOUN
finefocus-531	55	3	volume	volume	NOUN
finefocus-531	55	4	was	be	AUX
finefocus-531	55	5	2	2	NUM
finefocus-531	55	6	%	%	NOUN
finefocus-531	55	7	(	(	PUNCT
finefocus-531	55	8	v	v	NOUN
finefocus-531	55	9	/	/	SYM
finefocus-531	55	10	v	v	NOUN
finefocus-531	55	11	)	)	PUNCT
finefocus-531	55	12	;	;	PUNCT
finefocus-531	55	13	anaerobic	anaerobic	NOUN
finefocus-531	55	14	cultures	culture	NOUN
finefocus-531	55	15	were	be	AUX
finefocus-531	55	16	cultivated	cultivate	VERB
finefocus-531	55	17	without	without	ADP
finefocus-531	55	18	shaking	shake	VERB
finefocus-531	55	19	while	while	SCONJ
finefocus-531	55	20	those	those	PRON
finefocus-531	55	21	grown	grow	VERB
finefocus-531	55	22	aerobically	aerobically	ADV
finefocus-531	55	23	were	be	AUX
finefocus-531	55	24	shaken	shake	VERB
finefocus-531	55	25	at	at	ADP
finefocus-531	55	26	125	125	NUM
finefocus-531	55	27	rpm	rpm	NOUN
finefocus-531	55	28	unless	unless	SCONJ
finefocus-531	55	29	otherwise	otherwise	ADV
finefocus-531	55	30	noted	note	VERB
finefocus-531	55	31	.	.	PUNCT
finefocus-531	56	1	all	all	DET
finefocus-531	56	2	experiments	experiment	NOUN
finefocus-531	56	3	were	be	AUX
finefocus-531	56	4	performed	perform	VERB
finefocus-531	56	5	in	in	ADP
finefocus-531	56	6	triplicate	triplicate	NOUN
finefocus-531	56	7	.	.	PUNCT
finefocus-531	57	1	2.2	2.2	NUM
finefocus-531	57	2	isolation	isolation	NOUN
finefocus-531	57	3	of	of	ADP
finefocus-531	57	4	strain	strain	NOUN
finefocus-531	57	5	cc5c	cc5c	CCONJ
finefocus-531	57	6	a	a	DET
finefocus-531	57	7	geothermal	geothermal	ADJ
finefocus-531	57	8	fluid	fluid	NOUN
finefocus-531	57	9	sample	sample	NOUN
finefocus-531	57	10	from	from	ADP
finefocus-531	57	11	a	a	DET
finefocus-531	57	12	geothermally	geothermally	ADV
finefocus-531	57	13	heated	heated	ADJ
finefocus-531	57	14	intertidal	intertidal	ADJ
finefocus-531	57	15	pool	pool	NOUN
finefocus-531	57	16	(	(	PUNCT
finefocus-531	57	17	66	66	NUM
finefocus-531	57	18	°	°	NOUN
finefocus-531	57	19	03.451	03.451	NUM
finefocus-531	57	20	n	n	CCONJ
finefocus-531	57	21	,	,	PUNCT
finefocus-531	57	22	17	17	NUM
finefocus-531	57	23	°	°	NOUN
finefocus-531	57	24	21.466	21.466	NUM
finefocus-531	57	25	w	w	NOUN
finefocus-531	57	26	,	,	PUNCT
finefocus-531	57	27	40.3	40.3	NUM
finefocus-531	57	28	°	°	NOUN
finefocus-531	57	29	c	c	NOUN
finefocus-531	57	30	,	,	PUNCT
finefocus-531	57	31	5.7	5.7	NUM
finefocus-531	57	32	ms	ms	NOUN
finefocus-531	57	33	)	)	PUNCT
finefocus-531	57	34	was	be	AUX
finefocus-531	57	35	collected	collect	VERB
finefocus-531	57	36	with	with	ADP
finefocus-531	57	37	a	a	DET
finefocus-531	57	38	sampling	sample	VERB
finefocus-531	57	39	pool	pool	NOUN
finefocus-531	57	40	in	in	ADP
finefocus-531	57	41	a	a	DET
finefocus-531	57	42	sterile	sterile	ADJ
finefocus-531	57	43	50	50	NUM
finefocus-531	57	44	ml	ml	NOUN
finefocus-531	57	45	polypropylene	polypropylene	NOUN
finefocus-531	57	46	sample	sample	NOUN
finefocus-531	57	47	tube	tube	NOUN
finefocus-531	57	48	in	in	ADP
finefocus-531	57	49	an	an	DET
finefocus-531	57	50	area	area	NOUN
finefocus-531	57	51	north	north	ADV
finefocus-531	57	52	of	of	ADP
finefocus-531	57	53	husavik	husavik	NOUN
finefocus-531	57	54	(	(	PUNCT
finefocus-531	57	55	north	north	NOUN
finefocus-531	57	56	central	central	ADJ
finefocus-531	57	57	)	)	PUNCT
finefocus-531	57	58	,	,	PUNCT
finefocus-531	57	59	iceland	iceland	PROPN
finefocus-531	57	60	in	in	ADP
finefocus-531	57	61	june	june	PROPN
finefocus-531	57	62	,	,	PUNCT
finefocus-531	57	63	2015	2015	NUM
finefocus-531	57	64	.	.	PUNCT
finefocus-531	58	1	the	the	DET
finefocus-531	58	2	sample	sample	NOUN
finefocus-531	58	3	was	be	AUX
finefocus-531	58	4	enriched	enrich	VERB
finefocus-531	58	5	using	use	VERB
finefocus-531	58	6	a	a	DET
finefocus-531	58	7	2	2	NUM
finefocus-531	58	8	%	%	NOUN
finefocus-531	58	9	(	(	PUNCT
finefocus-531	58	10	v	v	NOUN
finefocus-531	58	11	/	/	SYM
finefocus-531	58	12	v	v	NOUN
finefocus-531	58	13	)	)	PUNCT
finefocus-531	58	14	inoculation	inoculation	NOUN
finefocus-531	58	15	volume	volume	NOUN
finefocus-531	58	16	in	in	ADP
finefocus-531	58	17	basal	basal	ADJ
finefocus-531	58	18	mineral	mineral	NOUN
finefocus-531	58	19	medium	medium	NOUN
finefocus-531	58	20	(	(	PUNCT
finefocus-531	58	21	bm	bm	PROPN
finefocus-531	58	22	)	)	PUNCT
finefocus-531	58	23	that	that	PRON
finefocus-531	58	24	contained	contain	VERB
finefocus-531	58	25	0.2	0.2	NUM
finefocus-531	58	26	%	%	NOUN
finefocus-531	58	27	(	(	PUNCT
finefocus-531	58	28	v	v	NOUN
finefocus-531	58	29	/	/	SYM
finefocus-531	58	30	v	v	NOUN
finefocus-531	58	31	)	)	PUNCT
finefocus-531	58	32	rapeseed	rapeseed	NOUN
finefocus-531	58	33	oil	oil	NOUN
finefocus-531	58	34	and	and	CCONJ
finefocus-531	58	35	incubated	incubate	VERB
finefocus-531	58	36	at	at	ADP
finefocus-531	58	37	40	40	NUM
finefocus-531	58	38	°	°	NOUN
finefocus-531	58	39	c	c	NOUN
finefocus-531	58	40	under	under	ADP
finefocus-531	58	41	aerobic	aerobic	ADJ
finefocus-531	58	42	conditions	condition	NOUN
finefocus-531	58	43	without	without	ADP
finefocus-531	58	44	shaking	shake	VERB
finefocus-531	58	45	.	.	PUNCT
finefocus-531	59	1	the	the	DET
finefocus-531	59	2	culture	culture	NOUN
finefocus-531	59	3	was	be	AUX
finefocus-531	59	4	subcultured	subculture	VERB
finefocus-531	59	5	three	three	NUM
finefocus-531	59	6	times	time	NOUN
finefocus-531	59	7	prior	prior	ADV
finefocus-531	59	8	to	to	ADP
finefocus-531	59	9	streaking	streaking	NOUN
finefocus-531	59	10	on	on	ADP
finefocus-531	59	11	pca	pca	PROPN
finefocus-531	59	12	.	.	PUNCT
finefocus-531	60	1	a	a	DET
finefocus-531	60	2	single	single	ADJ
finefocus-531	60	3	isolated	isolated	ADJ
finefocus-531	60	4	colony	colony	NOUN
finefocus-531	60	5	was	be	AUX
finefocus-531	60	6	selected	select	VERB
finefocus-531	60	7	and	and	CCONJ
finefocus-531	60	8	repurified	repurifie	VERB
finefocus-531	60	9	two	two	NUM
finefocus-531	60	10	additional	additional	ADJ
finefocus-531	60	11	times	time	NOUN
finefocus-531	60	12	by	by	ADP
finefocus-531	60	13	streaking	streak	VERB
finefocus-531	60	14	on	on	ADP
finefocus-531	60	15	pca	pca	PROPN
finefocus-531	60	16	.	.	PUNCT
finefocus-531	61	1	the	the	DET
finefocus-531	61	2	culture	culture	NOUN
finefocus-531	61	3	was	be	AUX
finefocus-531	61	4	maintained	maintain	VERB
finefocus-531	61	5	on	on	ADP
finefocus-531	61	6	pca	pca	NOUN
finefocus-531	61	7	and	and	CCONJ
finefocus-531	61	8	cryopreserved	cryopreserve	VERB
finefocus-531	61	9	at	at	ADP
finefocus-531	61	10	-20	-20	NUM
finefocus-531	61	11	°	°	NOUN
finefocus-531	61	12	c	c	NOUN
finefocus-531	61	13	in	in	ADP
finefocus-531	61	14	30	30	NUM
finefocus-531	61	15	%	%	NOUN
finefocus-531	61	16	(	(	PUNCT
finefocus-531	61	17	v	v	NOUN
finefocus-531	61	18	/	/	SYM
finefocus-531	61	19	v	v	NOUN
finefocus-531	61	20	)	)	PUNCT
finefocus-531	61	21	glycerol	glycerol	NOUN
finefocus-531	61	22	.	.	PUNCT
finefocus-531	62	1	2.3	2.3	NUM
finefocus-531	62	2	strain	strain	NOUN
finefocus-531	62	3	characterization	characterization	NOUN
finefocus-531	62	4	and	and	CCONJ
finefocus-531	62	5	substrate	substrate	NOUN
finefocus-531	62	6	spectra	spectra	ADJ
finefocus-531	62	7	strain	strain	NOUN
finefocus-531	62	8	cc5c	cc5c	NUM
finefocus-531	62	9	was	be	AUX
finefocus-531	62	10	evaluated	evaluate	VERB
finefocus-531	62	11	using	use	VERB
finefocus-531	62	12	api	api	NOUN
finefocus-531	62	13	20e	20e	NOUN
finefocus-531	62	14	,	,	PUNCT
finefocus-531	62	15	api	api	NOUN
finefocus-531	62	16	20ne	20ne	NOUN
finefocus-531	62	17	,	,	PUNCT
finefocus-531	62	18	api	api	NOUN
finefocus-531	62	19	50ch	50ch	NOUN
finefocus-531	62	20	,	,	PUNCT
finefocus-531	62	21	and	and	CCONJ
finefocus-531	62	22	api	api	NOUN
finefocus-531	62	23	zym	zym	NOUN
finefocus-531	62	24	test	test	NOUN
finefocus-531	62	25	strips	strip	NOUN
finefocus-531	62	26	(	(	PUNCT
finefocus-531	62	27	biomerieux	biomerieux	PROPN
finefocus-531	62	28	,	,	PUNCT
finefocus-531	62	29	france	france	PROPN
finefocus-531	62	30	)	)	PUNCT
finefocus-531	62	31	according	accord	VERB
finefocus-531	62	32	to	to	ADP
finefocus-531	62	33	manufacturer	manufacturer	NOUN
finefocus-531	62	34	’s	’s	PART
finefocus-531	62	35	directions	direction	NOUN
finefocus-531	62	36	using	use	VERB
finefocus-531	62	37	e.	e.	PROPN
finefocus-531	62	38	coli	coli	PROPN
finefocus-531	62	39	dsm	dsm	PROPN
finefocus-531	62	40	30083	30083	NUM
finefocus-531	62	41	as	as	ADP
finefocus-531	62	42	a	a	DET
finefocus-531	62	43	control	control	NOUN
finefocus-531	62	44	.	.	PUNCT
finefocus-531	63	1	voges	voge	NOUN
finefocus-531	63	2	-	-	PUNCT
finefocus-531	63	3	proskauer	proskauer	NOUN
finefocus-531	63	4	,	,	PUNCT
finefocus-531	63	5	3	3	NUM
finefocus-531	63	6	%	%	NOUN
finefocus-531	63	7	koh	koh	PROPN
finefocus-531	63	8	string	string	PROPN
finefocus-531	63	9	test	test	NOUN
finefocus-531	63	10	,	,	PUNCT
finefocus-531	63	11	and	and	CCONJ
finefocus-531	63	12	peroxidase	peroxidase	PROPN
finefocus-531	63	13	test	test	NOUN
finefocus-531	63	14	were	be	AUX
finefocus-531	63	15	performed	perform	VERB
finefocus-531	63	16	using	use	VERB
finefocus-531	63	17	standard	standard	ADJ
finefocus-531	63	18	methods	method	NOUN
finefocus-531	63	19	(	(	PUNCT
finefocus-531	63	20	30	30	NUM
finefocus-531	63	21	)	)	PUNCT
finefocus-531	63	22	.	.	PUNCT
finefocus-531	64	1	oxidase	oxidase	NOUN
finefocus-531	64	2	activity	activity	NOUN
finefocus-531	64	3	was	be	AUX
finefocus-531	64	4	evaluated	evaluate	VERB
finefocus-531	64	5	using	use	VERB
finefocus-531	64	6	test	test	NOUN
finefocus-531	64	7	discs	disc	NOUN
finefocus-531	64	8	(	(	PUNCT
finefocus-531	64	9	sigma	sigma	PROPN
finefocus-531	64	10	-	-	PUNCT
finefocus-531	64	11	aldrich	aldrich	NOUN
finefocus-531	64	12	)	)	PUNCT
finefocus-531	64	13	according	accord	VERB
finefocus-531	64	14	to	to	ADP
finefocus-531	64	15	manufacturer	manufacturer	NOUN
finefocus-531	64	16	’s	’s	PART
finefocus-531	64	17	directions	direction	NOUN
finefocus-531	64	18	.	.	PUNCT
finefocus-531	65	1	gram	gram	NOUN
finefocus-531	65	2	staining	stain	VERB
finefocus-531	65	3	was	be	AUX
finefocus-531	65	4	performed	perform	VERB
finefocus-531	65	5	according	accord	VERB
finefocus-531	65	6	to	to	ADP
finefocus-531	65	7	(	(	PUNCT
finefocus-531	65	8	30	30	NUM
finefocus-531	65	9	)	)	PUNCT
finefocus-531	65	10	.	.	PUNCT
finefocus-531	66	1	oxidative	oxidative	ADJ
finefocus-531	66	2	fermentation	fermentation	NOUN
finefocus-531	66	3	(	(	PUNCT
finefocus-531	66	4	of	of	ADP
finefocus-531	66	5	)	)	PUNCT
finefocus-531	66	6	tests	test	NOUN
finefocus-531	66	7	were	be	AUX
finefocus-531	66	8	conducted	conduct	VERB
finefocus-531	66	9	according	accord	VERB
finefocus-531	66	10	to	to	ADP
finefocus-531	66	11	(	(	PUNCT
finefocus-531	66	12	30	30	NUM
finefocus-531	66	13	)	)	PUNCT
finefocus-531	66	14	.	.	PUNCT
finefocus-531	67	1	characteristics	characteristic	NOUN
finefocus-531	67	2	on	on	ADP
finefocus-531	67	3	selective	selective	ADJ
finefocus-531	67	4	and	and	CCONJ
finefocus-531	67	5	differential	differential	ADJ
finefocus-531	67	6	agars	agar	NOUN
finefocus-531	67	7	(	(	PUNCT
finefocus-531	67	8	30	30	NUM
finefocus-531	67	9	)	)	PUNCT
finefocus-531	67	10	were	be	AUX
finefocus-531	67	11	performed	perform	VERB
finefocus-531	67	12	in	in	ADP
finefocus-531	67	13	accordance	accordance	NOUN
finefocus-531	67	14	with	with	ADP
finefocus-531	67	15	the	the	DET
finefocus-531	67	16	manufacturer	manufacturer	NOUN
finefocus-531	67	17	’s	’s	PART
finefocus-531	67	18	directions	direction	NOUN
finefocus-531	67	19	.	.	PUNCT
finefocus-531	68	1	the	the	DET
finefocus-531	68	2	utilization	utilization	NOUN
finefocus-531	68	3	of	of	ADP
finefocus-531	68	4	starch	starch	NOUN
finefocus-531	68	5	,	,	PUNCT
finefocus-531	68	6	casein	casein	NOUN
finefocus-531	68	7	,	,	PUNCT
finefocus-531	68	8	and	and	CCONJ
finefocus-531	68	9	cellulose	cellulose	NOUN
finefocus-531	68	10	was	be	AUX
finefocus-531	68	11	evaluated	evaluate	VERB
finefocus-531	68	12	on	on	ADP
finefocus-531	68	13	pca	pca	NOUN
finefocus-531	68	14	plates	plate	NOUN
finefocus-531	68	15	containing	contain	VERB
finefocus-531	68	16	2	2	NUM
finefocus-531	68	17	%	%	NOUN
finefocus-531	68	18	(	(	PUNCT
finefocus-531	68	19	w	w	NOUN
finefocus-531	68	20	/	/	SYM
finefocus-531	68	21	v	v	NOUN
finefocus-531	68	22	)	)	PUNCT
finefocus-531	68	23	of	of	ADP
finefocus-531	68	24	the	the	DET
finefocus-531	68	25	target	target	NOUN
finefocus-531	68	26	substrate	substrate	NOUN
finefocus-531	68	27	and	and	CCONJ
finefocus-531	68	28	visualized	visualize	VERB
finefocus-531	68	29	according	accord	VERB
finefocus-531	68	30	to	to	ADP
finefocus-531	68	31	(	(	PUNCT
finefocus-531	68	32	30	30	NUM
finefocus-531	68	33	)	)	PUNCT
finefocus-531	68	34	.	.	PUNCT
finefocus-531	69	1	alginate	alginate	NOUN
finefocus-531	69	2	utilization	utilization	NOUN
finefocus-531	69	3	was	be	AUX
finefocus-531	69	4	evaluated	evaluate	VERB
finefocus-531	69	5	on	on	ADP
finefocus-531	69	6	r2a	r2a	NOUN
finefocus-531	69	7	plates	plate	NOUN
finefocus-531	69	8	prepared	prepare	VERB
finefocus-531	69	9	with	with	ADP
finefocus-531	69	10	the	the	DET
finefocus-531	69	11	inclusion	inclusion	NOUN
finefocus-531	69	12	of	of	ADP
finefocus-531	69	13	2	2	NUM
finefocus-531	69	14	%	%	NOUN
finefocus-531	69	15	(	(	PUNCT
finefocus-531	69	16	w	w	NOUN
finefocus-531	69	17	/	/	SYM
finefocus-531	69	18	v	v	NOUN
finefocus-531	69	19	)	)	PUNCT
finefocus-531	69	20	sodium	sodium	NOUN
finefocus-531	69	21	alginate	alginate	NOUN
finefocus-531	69	22	with	with	ADP
finefocus-531	69	23	the	the	DET
finefocus-531	69	24	exclusion	exclusion	NOUN
finefocus-531	69	25	of	of	ADP
finefocus-531	69	26	starch	starch	NOUN
finefocus-531	69	27	and	and	CCONJ
finefocus-531	69	28	glucose	glucose	NOUN
finefocus-531	69	29	;	;	PUNCT
finefocus-531	69	30	visualization	visualization	NOUN
finefocus-531	69	31	was	be	AUX
finefocus-531	69	32	performed	perform	VERB
finefocus-531	69	33	using	use	VERB
finefocus-531	69	34	gram	gram	PROPN
finefocus-531	69	35	’s	’s	PART
finefocus-531	69	36	iodine	iodine	NOUN
finefocus-531	69	37	solution	solution	NOUN
finefocus-531	69	38	.	.	PUNCT
finefocus-531	70	1	plate	plate	NOUN
finefocus-531	70	2	-	-	PUNCT
finefocus-531	70	3	based	base	VERB
finefocus-531	70	4	inorganic	inorganic	ADJ
finefocus-531	70	5	phosphate	phosphate	NOUN
finefocus-531	70	6	solubilization	solubilization	NOUN
finefocus-531	70	7	was	be	AUX
finefocus-531	70	8	evaluated	evaluate	VERB
finefocus-531	70	9	using	use	VERB
finefocus-531	70	10	nbrip	nbrip	NOUN
finefocus-531	70	11	medium	medium	NOUN
finefocus-531	70	12	according	accord	VERB
finefocus-531	70	13	to	to	ADP
finefocus-531	70	14	the	the	DET
finefocus-531	70	15	method	method	NOUN
finefocus-531	70	16	of	of	ADP
finefocus-531	70	17	nautiyal	nautiyal	NOUN
finefocus-531	70	18	(	(	PUNCT
finefocus-531	70	19	20	20	NUM
finefocus-531	70	20	)	)	PUNCT
finefocus-531	70	21	.	.	PUNCT
finefocus-531	71	1	chitinase	chitinase	NOUN
finefocus-531	71	2	degradation	degradation	NOUN
finefocus-531	71	3	was	be	AUX
finefocus-531	71	4	evaluated	evaluate	VERB
finefocus-531	71	5	using	use	VERB
finefocus-531	71	6	the	the	DET
finefocus-531	71	7	method	method	NOUN
finefocus-531	71	8	of	of	ADP
finefocus-531	71	9	(	(	PUNCT
finefocus-531	71	10	13	13	NUM
finefocus-531	71	11	)	)	PUNCT
finefocus-531	71	12	except	except	SCONJ
finefocus-531	71	13	with	with	ADP
finefocus-531	71	14	the	the	DET
finefocus-531	71	15	omission	omission	NOUN
finefocus-531	71	16	of	of	ADP
finefocus-531	71	17	agar	agar	NOUN
finefocus-531	71	18	for	for	ADP
finefocus-531	71	19	the	the	DET
finefocus-531	71	20	detection	detection	NOUN
finefocus-531	71	21	of	of	ADP
finefocus-531	71	22	24	24	NUM
finefocus-531	71	23	•	•	NUM
finefocus-531	71	24	fine	fine	ADJ
finefocus-531	71	25	focus	focus	NOUN
finefocus-531	71	26	,	,	PUNCT
finefocus-531	71	27	vol	vol	NOUN
finefocus-531	71	28	.	.	PUNCT
finefocus-531	72	1	4(1	4(1	NOUN
finefocus-531	72	2	)	)	PUNCT
finefocus-531	73	1	chitin	chitin	NOUN
finefocus-531	73	2	degradation	degradation	NOUN
finefocus-531	73	3	in	in	ADP
finefocus-531	73	4	liquid	liquid	ADJ
finefocus-531	73	5	medium	medium	NOUN
finefocus-531	73	6	.	.	PUNCT
finefocus-531	74	1	azurelinked	azurelinke	VERB
finefocus-531	74	2	β	β	X
finefocus-531	74	3	-	-	PUNCT
finefocus-531	74	4	glucan	glucan	NOUN
finefocus-531	74	5	and	and	CCONJ
finefocus-531	74	6	xylan	xylan	PROPN
finefocus-531	74	7	(	(	PUNCT
finefocus-531	74	8	0.2	0.2	NUM
finefocus-531	74	9	%	%	NOUN
finefocus-531	74	10	w	w	NOUN
finefocus-531	74	11	/	/	SYM
finefocus-531	74	12	v	v	NOUN
finefocus-531	74	13	)	)	PUNCT
finefocus-531	74	14	was	be	AUX
finefocus-531	74	15	used	use	VERB
finefocus-531	74	16	to	to	PART
finefocus-531	74	17	evaluate	evaluate	VERB
finefocus-531	74	18	the	the	DET
finefocus-531	74	19	degradation	degradation	NOUN
finefocus-531	74	20	of	of	ADP
finefocus-531	74	21	β	β	NOUN
finefocus-531	74	22	-	-	ADJ
finefocus-531	74	23	glucan	glucan	NOUN
finefocus-531	74	24	and	and	CCONJ
finefocus-531	74	25	xylan	xylan	NOUN
finefocus-531	74	26	by	by	ADP
finefocus-531	74	27	supplementing	supplement	VERB
finefocus-531	74	28	reasoner	reasoner	NOUN
finefocus-531	74	29	’s	’s	PART
finefocus-531	74	30	2a	2a	NUM
finefocus-531	74	31	agar	agar	NOUN
finefocus-531	74	32	.	.	PUNCT
finefocus-531	75	1	the	the	DET
finefocus-531	75	2	temperature	temperature	NOUN
finefocus-531	75	3	range	range	NOUN
finefocus-531	75	4	was	be	AUX
finefocus-531	75	5	determined	determine	VERB
finefocus-531	75	6	qualitatively	qualitatively	ADV
finefocus-531	75	7	by	by	ADP
finefocus-531	75	8	incubating	incubate	VERB
finefocus-531	75	9	streaked	streaked	ADJ
finefocus-531	75	10	pca	pca	NOUN
finefocus-531	75	11	plates	plate	NOUN
finefocus-531	75	12	at	at	ADP
finefocus-531	75	13	temperatures	temperature	NOUN
finefocus-531	75	14	ranging	range	VERB
finefocus-531	75	15	from	from	ADP
finefocus-531	75	16	5	5	NUM
finefocus-531	75	17	to	to	PART
finefocus-531	75	18	60	60	NUM
finefocus-531	75	19	°	°	NOUN
finefocus-531	75	20	c	c	NOUN
finefocus-531	75	21	in	in	ADP
finefocus-531	75	22	5	5	NUM
finefocus-531	75	23	°	°	NOUN
finefocus-531	75	24	c	c	NOUN
finefocus-531	75	25	increments	increment	NOUN
finefocus-531	75	26	.	.	PUNCT
finefocus-531	76	1	growth	growth	NOUN
finefocus-531	76	2	curves	curve	NOUN
finefocus-531	76	3	were	be	AUX
finefocus-531	76	4	generated	generate	VERB
finefocus-531	76	5	by	by	ADP
finefocus-531	76	6	performing	perform	VERB
finefocus-531	76	7	kinetic	kinetic	ADJ
finefocus-531	76	8	experiments	experiment	NOUN
finefocus-531	76	9	in	in	ADP
finefocus-531	76	10	triplicate	triplicate	NOUN
finefocus-531	76	11	using	use	VERB
finefocus-531	76	12	tryptic	tryptic	ADJ
finefocus-531	76	13	soy	soy	NOUN
finefocus-531	76	14	broth	broth	NOUN
finefocus-531	76	15	(	(	PUNCT
finefocus-531	76	16	difco	difco	PROPN
finefocus-531	76	17	,	,	PUNCT
finefocus-531	76	18	tsb	tsb	PROPN
finefocus-531	76	19	)	)	PUNCT
finefocus-531	76	20	,	,	PUNCT
finefocus-531	76	21	in	in	ADP
finefocus-531	76	22	microtiter	microtiter	ADJ
finefocus-531	76	23	plate	plate	NOUN
finefocus-531	76	24	from	from	ADP
finefocus-531	76	25	a	a	DET
finefocus-531	76	26	stock	stock	NOUN
finefocus-531	76	27	culture	culture	NOUN
finefocus-531	76	28	in	in	ADP
finefocus-531	76	29	the	the	DET
finefocus-531	76	30	exponential	exponential	ADJ
finefocus-531	76	31	growth	growth	NOUN
finefocus-531	76	32	phase	phase	NOUN
finefocus-531	76	33	;	;	PUNCT
finefocus-531	76	34	a	a	DET
finefocus-531	76	35	2	2	NUM
finefocus-531	76	36	%	%	NOUN
finefocus-531	76	37	(	(	PUNCT
finefocus-531	76	38	v	v	NOUN
finefocus-531	76	39	/	/	SYM
finefocus-531	76	40	v	v	NOUN
finefocus-531	76	41	)	)	PUNCT
finefocus-531	76	42	inoculation	inoculation	NOUN
finefocus-531	76	43	volume	volume	NOUN
finefocus-531	76	44	was	be	AUX
finefocus-531	76	45	used	use	VERB
finefocus-531	76	46	in	in	ADP
finefocus-531	76	47	all	all	DET
finefocus-531	76	48	cases	case	NOUN
finefocus-531	76	49	.	.	PUNCT
finefocus-531	77	1	the	the	DET
finefocus-531	77	2	increase	increase	NOUN
finefocus-531	77	3	in	in	ADP
finefocus-531	77	4	od	od	PROPN
finefocus-531	77	5	was	be	AUX
finefocus-531	77	6	measured	measure	VERB
finefocus-531	77	7	using	use	VERB
finefocus-531	77	8	a	a	DET
finefocus-531	77	9	bioscreen	bioscreen	NOUN
finefocus-531	77	10	c	c	PROPN
finefocus-531	77	11	(	(	PUNCT
finefocus-531	77	12	growthcurves	growthcurves	PROPN
finefocus-531	77	13	ltd	ltd	PROPN
finefocus-531	77	14	,	,	PUNCT
finefocus-531	77	15	finland	finland	PROPN
finefocus-531	77	16	)	)	PUNCT
finefocus-531	77	17	as	as	ADP
finefocus-531	77	18	independent	independent	ADJ
finefocus-531	77	19	triplicates	triplicate	NOUN
finefocus-531	77	20	at	at	ADP
finefocus-531	77	21	each	each	DET
finefocus-531	77	22	temperature	temperature	NOUN
finefocus-531	77	23	from	from	ADP
finefocus-531	77	24	20	20	NUM
finefocus-531	77	25	to	to	PART
finefocus-531	77	26	65	65	NUM
finefocus-531	77	27	°	°	NOUN
finefocus-531	77	28	c	c	NOUN
finefocus-531	77	29	in	in	ADP
finefocus-531	77	30	5	5	NUM
finefocus-531	77	31	°	°	NOUN
finefocus-531	77	32	c	c	NOUN
finefocus-531	77	33	increments	increment	NOUN
finefocus-531	77	34	.	.	PUNCT
finefocus-531	78	1	maximum	maximum	ADJ
finefocus-531	78	2	specific	specific	ADJ
finefocus-531	78	3	growth	growth	NOUN
finefocus-531	78	4	rate	rate	NOUN
finefocus-531	78	5	(	(	PUNCT
finefocus-531	78	6	µmax	µmax	ADJ
finefocus-531	78	7	)	)	PUNCT
finefocus-531	78	8	and	and	CCONJ
finefocus-531	78	9	generation	generation	NOUN
finefocus-531	78	10	time	time	NOUN
finefocus-531	78	11	(	(	PUNCT
finefocus-531	78	12	g	g	NOUN
finefocus-531	78	13	)	)	PUNCT
finefocus-531	78	14	were	be	AUX
finefocus-531	78	15	calculated	calculate	VERB
finefocus-531	78	16	according	accord	VERB
finefocus-531	78	17	to	to	ADP
finefocus-531	78	18	(	(	PUNCT
finefocus-531	78	19	1	1	NUM
finefocus-531	78	20	)	)	PUNCT
finefocus-531	78	21	.	.	PUNCT
finefocus-531	79	1	ph	ph	PROPN
finefocus-531	79	2	and	and	CCONJ
finefocus-531	79	3	sodium	sodium	NOUN
finefocus-531	79	4	chloride	chloride	NOUN
finefocus-531	79	5	growth	growth	NOUN
finefocus-531	79	6	range	range	NOUN
finefocus-531	79	7	and	and	CCONJ
finefocus-531	79	8	optima	optima	PROPN
finefocus-531	79	9	were	be	AUX
finefocus-531	79	10	examined	examine	VERB
finefocus-531	79	11	in	in	ADP
finefocus-531	79	12	tsb	tsb	NOUN
finefocus-531	79	13	containing	contain	VERB
finefocus-531	79	14	50	50	NUM
finefocus-531	79	15	mm	mm	NOUN
finefocus-531	79	16	phosphate	phosphate	NOUN
finefocus-531	79	17	buffer	buffer	NOUN
finefocus-531	79	18	(	(	PUNCT
finefocus-531	79	19	from	from	ADP
finefocus-531	79	20	ph	ph	PROPN
finefocus-531	79	21	4	4	NUM
finefocus-531	79	22	to	to	PART
finefocus-531	79	23	9	9	NUM
finefocus-531	79	24	in	in	ADP
finefocus-531	79	25	0.5	0.5	NUM
finefocus-531	79	26	unit	unit	NOUN
finefocus-531	79	27	increments	increment	NOUN
finefocus-531	79	28	)	)	PUNCT
finefocus-531	79	29	and	and	CCONJ
finefocus-531	79	30	sodium	sodium	NOUN
finefocus-531	79	31	chloride	chloride	NOUN
finefocus-531	79	32	(	(	PUNCT
finefocus-531	79	33	from	from	ADP
finefocus-531	79	34	0	0	NUM
finefocus-531	79	35	to	to	PART
finefocus-531	79	36	9	9	NUM
finefocus-531	79	37	%	%	NOUN
finefocus-531	79	38	w	w	PROPN
finefocus-531	79	39	/	/	SYM
finefocus-531	79	40	v	v	NOUN
finefocus-531	79	41	)	)	PUNCT
finefocus-531	79	42	at	at	ADP
finefocus-531	79	43	the	the	DET
finefocus-531	79	44	topt	topt	NOUN
finefocus-531	79	45	of	of	ADP
finefocus-531	79	46	the	the	DET
finefocus-531	79	47	strain	strain	NOUN
finefocus-531	79	48	in	in	ADP
finefocus-531	79	49	the	the	DET
finefocus-531	79	50	manner	manner	NOUN
finefocus-531	79	51	described	describe	VERB
finefocus-531	79	52	above	above	ADV
finefocus-531	79	53	.	.	PUNCT
finefocus-531	80	1	2.2	2.2	NUM
finefocus-531	80	2	fermentation	fermentation	NOUN
finefocus-531	80	3	of	of	ADP
finefocus-531	80	4	single	single	ADJ
finefocus-531	80	5	substrates	substrate	NOUN
finefocus-531	80	6	hexoses	hexose	NOUN
finefocus-531	80	7	,	,	PUNCT
finefocus-531	80	8	pentoses	pentose	NOUN
finefocus-531	80	9	,	,	PUNCT
finefocus-531	80	10	methylpentoses	methylpentose	NOUN
finefocus-531	80	11	,	,	PUNCT
finefocus-531	80	12	sugar	sugar	NOUN
finefocus-531	80	13	alcohols	alcohol	NOUN
finefocus-531	80	14	,	,	PUNCT
finefocus-531	80	15	and	and	CCONJ
finefocus-531	80	16	polyalcohols	polyalcohol	NOUN
finefocus-531	80	17	were	be	AUX
finefocus-531	80	18	used	use	VERB
finefocus-531	80	19	at	at	ADP
finefocus-531	80	20	a	a	DET
finefocus-531	80	21	concentration	concentration	NOUN
finefocus-531	80	22	of	of	ADP
finefocus-531	80	23	20	20	NUM
finefocus-531	80	24	mm	mm	NOUN
finefocus-531	80	25	while	while	SCONJ
finefocus-531	80	26	disaccharides	disaccharide	NOUN
finefocus-531	80	27	were	be	AUX
finefocus-531	80	28	used	use	VERB
finefocus-531	80	29	at	at	ADP
finefocus-531	80	30	a	a	DET
finefocus-531	80	31	concentration	concentration	NOUN
finefocus-531	80	32	of	of	ADP
finefocus-531	80	33	10	10	NUM
finefocus-531	80	34	mm	mm	NOUN
finefocus-531	80	35	.	.	PUNCT
finefocus-531	81	1	all	all	DET
finefocus-531	81	2	polymeric	polymeric	ADJ
finefocus-531	81	3	substrates	substrate	NOUN
finefocus-531	81	4	were	be	AUX
finefocus-531	81	5	used	use	VERB
finefocus-531	81	6	at	at	ADP
finefocus-531	81	7	a	a	DET
finefocus-531	81	8	concentration	concentration	NOUN
finefocus-531	81	9	of	of	ADP
finefocus-531	81	10	0.2	0.2	NUM
finefocus-531	81	11	%	%	NOUN
finefocus-531	81	12	(	(	PUNCT
finefocus-531	81	13	w	w	NOUN
finefocus-531	81	14	/	/	SYM
finefocus-531	81	15	v	v	NOUN
finefocus-531	81	16	)	)	PUNCT
finefocus-531	81	17	.	.	PUNCT
finefocus-531	82	1	experiments	experiment	NOUN
finefocus-531	82	2	were	be	AUX
finefocus-531	82	3	performed	perform	VERB
finefocus-531	82	4	anaerobically	anaerobically	ADV
finefocus-531	82	5	in	in	ADP
finefocus-531	82	6	serum	serum	NOUN
finefocus-531	82	7	bottles	bottle	NOUN
finefocus-531	82	8	at	at	ADP
finefocus-531	82	9	ph	ph	PROPN
finefocus-531	82	10	7	7	NUM
finefocus-531	82	11	with	with	ADP
finefocus-531	82	12	liquid	liquid	ADJ
finefocus-531	82	13	-	-	PUNCT
finefocus-531	82	14	gas	gas	NOUN
finefocus-531	82	15	phase	phase	NOUN
finefocus-531	82	16	ratio	ratio	NOUN
finefocus-531	82	17	of	of	ADP
finefocus-531	82	18	1:1	1:1	NUM
finefocus-531	82	19	for	for	ADP
finefocus-531	82	20	all	all	DET
finefocus-531	82	21	experiments	experiment	NOUN
finefocus-531	82	22	.	.	PUNCT
finefocus-531	83	1	2.3	2.3	NUM
finefocus-531	83	2	effect	effect	NOUN
finefocus-531	83	3	of	of	ADP
finefocus-531	83	4	initial	initial	ADJ
finefocus-531	83	5	substrate	substrate	NOUN
finefocus-531	83	6	concentration	concentration	NOUN
finefocus-531	83	7	the	the	DET
finefocus-531	83	8	effect	effect	NOUN
finefocus-531	83	9	of	of	ADP
finefocus-531	83	10	initial	initial	ADJ
finefocus-531	83	11	substrate	substrate	NOUN
finefocus-531	83	12	concentration	concentration	NOUN
finefocus-531	83	13	was	be	AUX
finefocus-531	83	14	evaluated	evaluate	VERB
finefocus-531	83	15	for	for	ADP
finefocus-531	83	16	three	three	NUM
finefocus-531	83	17	substrates	substrate	NOUN
finefocus-531	83	18	(	(	PUNCT
finefocus-531	83	19	glucose	glucose	NOUN
finefocus-531	83	20	,	,	PUNCT
finefocus-531	83	21	l	l	NOUN
finefocus-531	83	22	-	-	PUNCT
finefocus-531	83	23	rhamnose	rhamnose	NOUN
finefocus-531	83	24	,	,	PUNCT
finefocus-531	83	25	and	and	CCONJ
finefocus-531	83	26	l	l	NOUN
finefocus-531	83	27	-	-	NOUN
finefocus-531	83	28	fucose	fucose	NOUN
finefocus-531	83	29	)	)	PUNCT
finefocus-531	83	30	in	in	ADP
finefocus-531	83	31	batch	batch	NOUN
finefocus-531	83	32	cultures	culture	NOUN
finefocus-531	83	33	from	from	ADP
finefocus-531	83	34	10	10	NUM
finefocus-531	83	35	to	to	PART
finefocus-531	83	36	60	60	NUM
finefocus-531	83	37	mm	mm	NOUN
finefocus-531	83	38	.	.	PUNCT
finefocus-531	84	1	the	the	DET
finefocus-531	84	2	cultures	culture	NOUN
finefocus-531	84	3	were	be	AUX
finefocus-531	84	4	incubated	incubate	VERB
finefocus-531	84	5	at	at	ADP
finefocus-531	84	6	35	35	NUM
finefocus-531	84	7	°	°	ADP
finefocus-531	84	8	c	c	NOUN
finefocus-531	84	9	for	for	ADP
finefocus-531	84	10	five	five	NUM
finefocus-531	84	11	days	day	NOUN
finefocus-531	84	12	under	under	ADP
finefocus-531	84	13	both	both	CCONJ
finefocus-531	84	14	aerobic	aerobic	ADJ
finefocus-531	84	15	and	and	CCONJ
finefocus-531	84	16	anaerobic	anaerobic	ADJ
finefocus-531	84	17	conditions	condition	NOUN
finefocus-531	84	18	.	.	PUNCT
finefocus-531	85	1	after	after	ADP
finefocus-531	85	2	incubation	incubation	NOUN
finefocus-531	85	3	the	the	DET
finefocus-531	85	4	end	end	NOUN
finefocus-531	85	5	products	product	NOUN
finefocus-531	85	6	were	be	AUX
finefocus-531	85	7	analyzed	analyze	VERB
finefocus-531	85	8	.	.	PUNCT
finefocus-531	86	1	2.4	2.4	NUM
finefocus-531	86	2	kinetic	kinetic	ADJ
finefocus-531	86	3	experiments	experiment	NOUN
finefocus-531	86	4	kinetic	kinetic	ADJ
finefocus-531	86	5	experiments	experiment	NOUN
finefocus-531	86	6	were	be	AUX
finefocus-531	86	7	performed	perform	VERB
finefocus-531	86	8	both	both	CCONJ
finefocus-531	86	9	aerobically	aerobically	ADV
finefocus-531	86	10	and	and	CCONJ
finefocus-531	86	11	anaerobically	anaerobically	ADV
finefocus-531	86	12	in	in	ADP
finefocus-531	86	13	125	125	NUM
finefocus-531	86	14	ml	ml	NOUN
finefocus-531	86	15	erlenmeyer	erlenmeyer	PROPN
finefocus-531	86	16	flasks	flask	NOUN
finefocus-531	86	17	or	or	CCONJ
finefocus-531	86	18	serum	serum	NOUN
finefocus-531	86	19	bottles	bottle	NOUN
finefocus-531	86	20	without	without	ADP
finefocus-531	86	21	agitation	agitation	NOUN
finefocus-531	86	22	.	.	PUNCT
finefocus-531	87	1	substrates	substrate	NOUN
finefocus-531	87	2	were	be	AUX
finefocus-531	87	3	used	use	VERB
finefocus-531	87	4	at	at	ADP
finefocus-531	87	5	a	a	DET
finefocus-531	87	6	concentration	concentration	NOUN
finefocus-531	87	7	of	of	ADP
finefocus-531	87	8	20	20	NUM
finefocus-531	87	9	mm	mm	NUM
finefocus-531	87	10	glucose	glucose	NOUN
finefocus-531	87	11	,	,	PUNCT
finefocus-531	87	12	l	l	NOUN
finefocus-531	87	13	-	-	PUNCT
finefocus-531	87	14	rhamnose	rhamnose	ADJ
finefocus-531	87	15	,	,	PUNCT
finefocus-531	87	16	l	l	NOUN
finefocus-531	87	17	-	-	NOUN
finefocus-531	87	18	fucose	fucose	ADJ
finefocus-531	87	19	,	,	PUNCT
finefocus-531	87	20	rac-1,2	rac-1,2	NOUN
finefocus-531	87	21	-	-	PUNCT
finefocus-531	87	22	pd	pd	NOUN
finefocus-531	87	23	,	,	PUNCT
finefocus-531	87	24	and	and	CCONJ
finefocus-531	87	25	control	control	NOUN
finefocus-531	87	26	.	.	PUNCT
finefocus-531	88	1	fermentation	fermentation	NOUN
finefocus-531	88	2	broths	broth	NOUN
finefocus-531	88	3	were	be	AUX
finefocus-531	88	4	sampled	sample	VERB
finefocus-531	88	5	(	(	PUNCT
finefocus-531	88	6	1	1	NUM
finefocus-531	88	7	ml	ml	NOUN
finefocus-531	88	8	)	)	PUNCT
finefocus-531	88	9	and	and	CCONJ
finefocus-531	88	10	analysed	analyse	VERB
finefocus-531	88	11	for	for	ADP
finefocus-531	88	12	optical	optical	ADJ
finefocus-531	88	13	density	density	NOUN
finefocus-531	88	14	over	over	ADP
finefocus-531	88	15	a	a	DET
finefocus-531	88	16	period	period	NOUN
finefocus-531	88	17	of	of	ADP
finefocus-531	88	18	46	46	NUM
finefocus-531	88	19	hours	hour	NOUN
finefocus-531	88	20	;	;	PUNCT
finefocus-531	88	21	withdrawn	withdraw	VERB
finefocus-531	88	22	samples	sample	NOUN
finefocus-531	88	23	were	be	AUX
finefocus-531	88	24	stored	store	VERB
finefocus-531	88	25	at	at	ADP
finefocus-531	88	26	-20	-20	NUM
finefocus-531	88	27	°	°	NOUN
finefocus-531	88	28	c	c	NOUN
finefocus-531	88	29	for	for	ADP
finefocus-531	88	30	further	further	ADJ
finefocus-531	88	31	analysis	analysis	NOUN
finefocus-531	88	32	.	.	PUNCT
finefocus-531	89	1	2.5	2.5	NUM
finefocus-531	89	2	analytical	analytical	ADJ
finefocus-531	89	3	methods	method	NOUN
finefocus-531	89	4	optical	optical	ADJ
finefocus-531	89	5	density	density	NOUN
finefocus-531	89	6	was	be	AUX
finefocus-531	89	7	determined	determine	VERB
finefocus-531	89	8	using	use	VERB
finefocus-531	89	9	a	a	DET
finefocus-531	89	10	shimadzu	shimadzu	ADJ
finefocus-531	89	11	uv-1800	uv-1800	NOUN
finefocus-531	89	12	uv	uv	NOUN
finefocus-531	89	13	-	-	PUNCT
finefocus-531	89	14	visible	visible	ADJ
finefocus-531	89	15	spectrophotometer	spectrophotometer	NOUN
finefocus-531	89	16	at	at	ADP
finefocus-531	89	17	a	a	DET
finefocus-531	89	18	wavelength	wavelength	NOUN
finefocus-531	89	19	of	of	ADP
finefocus-531	89	20	600	600	NUM
finefocus-531	89	21	nm	nm	NOUN
finefocus-531	89	22	and	and	CCONJ
finefocus-531	89	23	a	a	DET
finefocus-531	89	24	pathlength	pathlength	NOUN
finefocus-531	89	25	of	of	ADP
finefocus-531	89	26	1	1	NUM
finefocus-531	89	27	cm	cm	NOUN
finefocus-531	89	28	.	.	PUNCT
finefocus-531	90	1	cell	cell	NOUN
finefocus-531	90	2	-	-	PUNCT
finefocus-531	90	3	free	free	ADJ
finefocus-531	90	4	solutions	solution	NOUN
finefocus-531	90	5	were	be	AUX
finefocus-531	90	6	prepared	prepare	VERB
finefocus-531	90	7	by	by	ADP
finefocus-531	90	8	centrifugation	centrifugation	NOUN
finefocus-531	90	9	at	at	ADP
finefocus-531	90	10	13000	13000	NUM
finefocus-531	90	11	g	g	NOUN
finefocus-531	90	12	for	for	ADP
finefocus-531	90	13	5	5	NUM
finefocus-531	90	14	min	min	NOUN
finefocus-531	90	15	.	.	PROPN
finefocus-531	90	16	volatile	volatile	ADJ
finefocus-531	90	17	end	end	NOUN
finefocus-531	90	18	products	product	NOUN
finefocus-531	90	19	,	,	PUNCT
finefocus-531	90	20	such	such	ADJ
finefocus-531	90	21	as	as	ADP
finefocus-531	90	22	ethanol	ethanol	NOUN
finefocus-531	90	23	and	and	CCONJ
finefocus-531	90	24	volatile	volatile	ADJ
finefocus-531	90	25	fatty	fatty	NOUN
finefocus-531	90	26	acids	acid	NOUN
finefocus-531	90	27	were	be	AUX
finefocus-531	90	28	measured	measure	VERB
finefocus-531	90	29	using	use	VERB
finefocus-531	90	30	a	a	DET
finefocus-531	90	31	clarus	clarus	NOUN
finefocus-531	90	32	580	580	NUM
finefocus-531	90	33	(	(	PUNCT
finefocus-531	90	34	perkin	perkin	PROPN
finefocus-531	90	35	elmer	elmer	PROPN
finefocus-531	90	36	)	)	PUNCT
finefocus-531	90	37	gas	gas	NOUN
finefocus-531	90	38	chromatograph	chromatograph	NOUN
finefocus-531	90	39	equipped	equip	VERB
finefocus-531	90	40	with	with	ADP
finefocus-531	90	41	a	a	DET
finefocus-531	90	42	fid	fid	NOUN
finefocus-531	90	43	as	as	SCONJ
finefocus-531	90	44	described	describe	VERB
finefocus-531	90	45	by	by	ADP
finefocus-531	90	46	orlygsson	orlygsson	PROPN
finefocus-531	90	47	&	&	CCONJ
finefocus-531	90	48	baldursson	baldursson	PROPN
finefocus-531	90	49	(	(	PUNCT
finefocus-531	90	50	18	18	NUM
finefocus-531	90	51	)	)	PUNCT
finefocus-531	90	52	;	;	PUNCT
finefocus-531	90	53	samples	sample	NOUN
finefocus-531	90	54	were	be	AUX
finefocus-531	90	55	prepared	prepare	VERB
finefocus-531	90	56	by	by	ADP
finefocus-531	90	57	mixing	mix	VERB
finefocus-531	90	58	100	100	NUM
finefocus-531	90	59	µl	µl	ADP
finefocus-531	90	60	25applied	25applied	PROPN
finefocus-531	90	61	&	&	CCONJ
finefocus-531	90	62	environmental	environmental	ADJ
finefocus-531	90	63	microbiology	microbiology	NOUN
finefocus-531	90	64	•	•	NOUN
finefocus-531	90	65	formic	formic	NOUN
finefocus-531	90	66	acid	acid	NOUN
finefocus-531	90	67	(	(	PUNCT
finefocus-531	90	68	25	25	NUM
finefocus-531	90	69	%	%	NOUN
finefocus-531	90	70	w	w	PROPN
finefocus-531	90	71	/	/	SYM
finefocus-531	90	72	v	v	NOUN
finefocus-531	90	73	)	)	PUNCT
finefocus-531	90	74	,	,	PUNCT
finefocus-531	90	75	100	100	NUM
finefocus-531	90	76	µl	µl	ADP
finefocus-531	90	77	crotonic	crotonic	ADJ
finefocus-531	90	78	acid	acid	NOUN
finefocus-531	90	79	(	(	PUNCT
finefocus-531	90	80	0.1	0.1	NUM
finefocus-531	90	81	%	%	NOUN
finefocus-531	90	82	w	w	NOUN
finefocus-531	90	83	/	/	SYM
finefocus-531	90	84	v	v	NOUN
finefocus-531	90	85	)	)	PUNCT
finefocus-531	90	86	,	,	PUNCT
finefocus-531	90	87	and	and	CCONJ
finefocus-531	90	88	600	600	NUM
finefocus-531	90	89	µl	µl	ADP
finefocus-531	90	90	dh2o	dh2o	NOUN
finefocus-531	90	91	with	with	ADP
finefocus-531	90	92	200	200	NUM
finefocus-531	90	93	µl	µl	NOUN
finefocus-531	90	94	of	of	ADP
finefocus-531	90	95	cell	cell	NOUN
finefocus-531	90	96	-	-	PUNCT
finefocus-531	90	97	free	free	ADJ
finefocus-531	90	98	sample	sample	NOUN
finefocus-531	90	99	.	.	PUNCT
finefocus-531	91	1	hydrogen	hydrogen	PROPN
finefocus-531	91	2	was	be	AUX
finefocus-531	91	3	analysed	analyse	VERB
finefocus-531	91	4	using	use	VERB
finefocus-531	91	5	a	a	DET
finefocus-531	91	6	autosystem	autosystem	NOUN
finefocus-531	91	7	xl	xl	PROPN
finefocus-531	91	8	(	(	PUNCT
finefocus-531	91	9	perkin	perkin	PROPN
finefocus-531	91	10	elmer	elmer	PROPN
finefocus-531	91	11	)	)	PUNCT
finefocus-531	91	12	gas	gas	NOUN
finefocus-531	91	13	chromatograph	chromatograph	NOUN
finefocus-531	91	14	equipped	equip	VERB
finefocus-531	91	15	with	with	ADP
finefocus-531	91	16	a	a	DET
finefocus-531	91	17	tcd	tcd	NOUN
finefocus-531	91	18	using	use	VERB
finefocus-531	91	19	the	the	DET
finefocus-531	91	20	method	method	NOUN
finefocus-531	91	21	of	of	ADP
finefocus-531	91	22	(	(	PUNCT
finefocus-531	91	23	21	21	NUM
finefocus-531	91	24	)	)	PUNCT
finefocus-531	91	25	.	.	PUNCT
finefocus-531	92	1	glucose	glucose	NOUN
finefocus-531	92	2	concentration	concentration	NOUN
finefocus-531	92	3	was	be	AUX
finefocus-531	92	4	determined	determine	VERB
finefocus-531	92	5	colorimetrically	colorimetrically	ADV
finefocus-531	92	6	using	use	VERB
finefocus-531	92	7	the	the	DET
finefocus-531	92	8	anthrone	anthrone	NOUN
finefocus-531	92	9	method	method	NOUN
finefocus-531	92	10	described	describe	VERB
finefocus-531	92	11	(	(	PUNCT
finefocus-531	92	12	18	18	NUM
finefocus-531	92	13	)	)	PUNCT
finefocus-531	92	14	with	with	ADP
finefocus-531	92	15	minor	minor	ADJ
finefocus-531	92	16	modifications	modification	NOUN
finefocus-531	92	17	;	;	PUNCT
finefocus-531	92	18	50	50	NUM
finefocus-531	92	19	µl	µl	ADP
finefocus-531	92	20	cell	cell	NOUN
finefocus-531	92	21	-	-	PUNCT
finefocus-531	92	22	free	free	ADJ
finefocus-531	92	23	sample	sample	NOUN
finefocus-531	92	24	was	be	AUX
finefocus-531	92	25	mixed	mix	VERB
finefocus-531	92	26	with	with	ADP
finefocus-531	92	27	250	250	NUM
finefocus-531	92	28	µl	µl	ADP
finefocus-531	92	29	of	of	ADP
finefocus-531	92	30	0.1	0.1	NUM
finefocus-531	92	31	%	%	NOUN
finefocus-531	92	32	(	(	PUNCT
finefocus-531	92	33	w	w	NOUN
finefocus-531	92	34	/	/	SYM
finefocus-531	92	35	v	v	NOUN
finefocus-531	92	36	)	)	PUNCT
finefocus-531	92	37	anthrone	anthrone	NOUN
finefocus-531	92	38	in	in	ADP
finefocus-531	92	39	concentrated	concentrated	ADJ
finefocus-531	92	40	sulphuric	sulphuric	ADJ
finefocus-531	92	41	acid	acid	NOUN
finefocus-531	92	42	and	and	CCONJ
finefocus-531	92	43	incubated	incubate	VERB
finefocus-531	92	44	for	for	ADP
finefocus-531	92	45	20	20	NUM
finefocus-531	92	46	minutes	minute	NOUN
finefocus-531	92	47	at	at	ADP
finefocus-531	92	48	100	100	NUM
finefocus-531	92	49	°	°	NOUN
finefocus-531	92	50	c	c	NOUN
finefocus-531	92	51	,	,	PUNCT
finefocus-531	92	52	cooled	cool	VERB
finefocus-531	92	53	to	to	ADP
finefocus-531	92	54	room	room	NOUN
finefocus-531	92	55	temperature	temperature	NOUN
finefocus-531	92	56	and	and	CCONJ
finefocus-531	92	57	then	then	ADV
finefocus-531	92	58	read	read	VERB
finefocus-531	92	59	on	on	ADP
finefocus-531	92	60	a	a	DET
finefocus-531	92	61	microplate	microplate	NOUN
finefocus-531	92	62	reader	reader	NOUN
finefocus-531	92	63	(	(	PUNCT
finefocus-531	92	64	bioscreen	bioscreen	PROPN
finefocus-531	92	65	c	c	NOUN
finefocus-531	92	66	,	,	PUNCT
finefocus-531	92	67	growth	growth	NOUN
finefocus-531	92	68	curves	curves	PROPN
finefocus-531	92	69	ltd	ltd	PROPN
finefocus-531	92	70	,	,	PUNCT
finefocus-531	92	71	finland	finland	PROPN
finefocus-531	92	72	)	)	PUNCT
finefocus-531	92	73	at	at	ADP
finefocus-531	92	74	600	600	NUM
finefocus-531	92	75	nm	nm	NOUN
finefocus-531	92	76	against	against	ADP
finefocus-531	92	77	a	a	DET
finefocus-531	92	78	water	water	NOUN
finefocus-531	92	79	blank	blank	NOUN
finefocus-531	92	80	.	.	PUNCT
finefocus-531	93	1	methylpentoses	methylpentose	NOUN
finefocus-531	93	2	were	be	AUX
finefocus-531	93	3	analysed	analyse	VERB
finefocus-531	93	4	colorimetrically	colorimetrically	ADV
finefocus-531	93	5	according	accord	VERB
finefocus-531	93	6	to	to	ADP
finefocus-531	93	7	the	the	DET
finefocus-531	93	8	method	method	NOUN
finefocus-531	93	9	of	of	ADP
finefocus-531	93	10	(	(	PUNCT
finefocus-531	93	11	12	12	NUM
finefocus-531	93	12	)	)	PUNCT
finefocus-531	93	13	.	.	PUNCT
finefocus-531	94	1	1,2	1,2	NUM
finefocus-531	94	2	-	-	NOUN
finefocus-531	94	3	propanediol	propanediol	NOUN
finefocus-531	94	4	was	be	AUX
finefocus-531	94	5	analysed	analyse	VERB
finefocus-531	94	6	using	use	VERB
finefocus-531	94	7	the	the	DET
finefocus-531	94	8	colorimetric	colorimetric	ADJ
finefocus-531	94	9	method	method	NOUN
finefocus-531	94	10	of	of	ADP
finefocus-531	94	11	jones	jones	PROPN
finefocus-531	94	12	(	(	PUNCT
finefocus-531	94	13	15	15	NUM
finefocus-531	94	14	)	)	PUNCT
finefocus-531	94	15	modified	modify	VERB
finefocus-531	94	16	for	for	ADP
finefocus-531	94	17	use	use	NOUN
finefocus-531	94	18	in	in	ADP
finefocus-531	94	19	microplates	microplate	NOUN
finefocus-531	94	20	;	;	PUNCT
finefocus-531	94	21	250	250	NUM
finefocus-531	94	22	µl	µl	NOUN
finefocus-531	94	23	of	of	ADP
finefocus-531	94	24	concentrated	concentrate	VERB
finefocus-531	94	25	sulphuric	sulphuric	PROPN
finefocus-531	94	26	acid	acid	NOUN
finefocus-531	94	27	was	be	AUX
finefocus-531	94	28	added	add	VERB
finefocus-531	94	29	with	with	ADP
finefocus-531	94	30	50	50	NUM
finefocus-531	94	31	µl	µl	NOUN
finefocus-531	94	32	of	of	ADP
finefocus-531	94	33	cell	cell	NOUN
finefocus-531	94	34	-	-	PUNCT
finefocus-531	94	35	free	free	ADJ
finefocus-531	94	36	sample	sample	NOUN
finefocus-531	94	37	in	in	ADP
finefocus-531	94	38	a	a	DET
finefocus-531	94	39	microplate	microplate	NOUN
finefocus-531	94	40	which	which	PRON
finefocus-531	94	41	was	be	AUX
finefocus-531	94	42	then	then	ADV
finefocus-531	94	43	incubated	incubate	VERB
finefocus-531	94	44	at	at	ADP
finefocus-531	94	45	70	70	NUM
finefocus-531	94	46	°	°	ADP
finefocus-531	94	47	c	c	NOUN
finefocus-531	94	48	for	for	ADP
finefocus-531	94	49	20	20	NUM
finefocus-531	94	50	min	min	NOUN
finefocus-531	94	51	;	;	PUNCT
finefocus-531	94	52	after	after	ADP
finefocus-531	94	53	cooling	cool	VERB
finefocus-531	94	54	to	to	ADP
finefocus-531	94	55	room	room	NOUN
finefocus-531	94	56	temperature	temperature	NOUN
finefocus-531	94	57	,	,	PUNCT
finefocus-531	94	58	10	10	NUM
finefocus-531	94	59	µl	µl	NOUN
finefocus-531	94	60	of	of	ADP
finefocus-531	94	61	a	a	DET
finefocus-531	94	62	3	3	NUM
finefocus-531	94	63	%	%	NOUN
finefocus-531	94	64	w	w	PROPN
finefocus-531	94	65	/	/	SYM
finefocus-531	94	66	v	v	NOUN
finefocus-531	94	67	ninhydrin	ninhydrin	NOUN
finefocus-531	94	68	solution	solution	NOUN
finefocus-531	94	69	in	in	ADP
finefocus-531	94	70	5	5	NUM
finefocus-531	94	71	%	%	NOUN
finefocus-531	94	72	w	w	NOUN
finefocus-531	94	73	/	/	SYM
finefocus-531	94	74	v	v	NUM
finefocus-531	94	75	sodium	sodium	NOUN
finefocus-531	94	76	bisulfite	bisulfite	NOUN
finefocus-531	94	77	was	be	AUX
finefocus-531	94	78	added	add	VERB
finefocus-531	94	79	and	and	CCONJ
finefocus-531	94	80	the	the	DET
finefocus-531	94	81	plate	plate	NOUN
finefocus-531	94	82	was	be	AUX
finefocus-531	94	83	mixed	mix	VERB
finefocus-531	94	84	(	(	PUNCT
finefocus-531	94	85	200	200	NUM
finefocus-531	94	86	rpm	rpm	NOUN
finefocus-531	94	87	,	,	PUNCT
finefocus-531	94	88	60	60	NUM
finefocus-531	94	89	sec	sec	PROPN
finefocus-531	94	90	)	)	PUNCT
finefocus-531	94	91	and	and	CCONJ
finefocus-531	94	92	allowed	allow	VERB
finefocus-531	94	93	to	to	PART
finefocus-531	94	94	develop	develop	VERB
finefocus-531	94	95	for	for	ADP
finefocus-531	94	96	1	1	NUM
finefocus-531	94	97	hr	hr	NOUN
finefocus-531	94	98	in	in	ADP
finefocus-531	94	99	the	the	DET
finefocus-531	94	100	absence	absence	NOUN
finefocus-531	94	101	of	of	ADP
finefocus-531	94	102	light	light	NOUN
finefocus-531	94	103	and	and	CCONJ
finefocus-531	94	104	then	then	ADV
finefocus-531	94	105	read	read	VERB
finefocus-531	94	106	on	on	ADP
finefocus-531	94	107	a	a	DET
finefocus-531	94	108	microplate	microplate	NOUN
finefocus-531	94	109	reader	reader	NOUN
finefocus-531	94	110	(	(	PUNCT
finefocus-531	94	111	bioscreen	bioscreen	PROPN
finefocus-531	94	112	c	c	PROPN
finefocus-531	94	113	)	)	PUNCT
finefocus-531	94	114	at	at	ADP
finefocus-531	94	115	a	a	DET
finefocus-531	94	116	wavelength	wavelength	NOUN
finefocus-531	94	117	of	of	ADP
finefocus-531	94	118	600	600	NUM
finefocus-531	94	119	nm	nm	NOUN
finefocus-531	94	120	.	.	PUNCT
finefocus-531	95	1	lactate	lactate	PROPN
finefocus-531	95	2	was	be	AUX
finefocus-531	95	3	quantified	quantify	VERB
finefocus-531	95	4	colorimetrically	colorimetrically	ADV
finefocus-531	95	5	according	accord	VERB
finefocus-531	95	6	to	to	ADP
finefocus-531	95	7	the	the	DET
finefocus-531	95	8	method	method	NOUN
finefocus-531	95	9	of	of	ADP
finefocus-531	95	10	taylor	taylor	PROPN
finefocus-531	95	11	(	(	PUNCT
finefocus-531	95	12	28	28	NUM
finefocus-531	95	13	)	)	PUNCT
finefocus-531	95	14	with	with	ADP
finefocus-531	95	15	the	the	DET
finefocus-531	95	16	following	follow	VERB
finefocus-531	95	17	modifications	modification	NOUN
finefocus-531	95	18	:	:	PUNCT
finefocus-531	95	19	300	300	NUM
finefocus-531	95	20	µl	µl	NOUN
finefocus-531	95	21	of	of	ADP
finefocus-531	95	22	concentrated	concentrated	ADJ
finefocus-531	95	23	sulphuric	sulphuric	PROPN
finefocus-531	95	24	acid	acid	NOUN
finefocus-531	95	25	was	be	AUX
finefocus-531	95	26	added	add	VERB
finefocus-531	95	27	with	with	ADP
finefocus-531	95	28	50	50	NUM
finefocus-531	95	29	µl	µl	NOUN
finefocus-531	95	30	of	of	ADP
finefocus-531	95	31	sample	sample	NOUN
finefocus-531	95	32	in	in	ADP
finefocus-531	95	33	an	an	DET
finefocus-531	95	34	eppendorf	eppendorf	ADJ
finefocus-531	95	35	tube	tube	NOUN
finefocus-531	95	36	.	.	PUNCT
finefocus-531	96	1	the	the	DET
finefocus-531	96	2	sample	sample	NOUN
finefocus-531	96	3	was	be	AUX
finefocus-531	96	4	incubated	incubate	VERB
finefocus-531	96	5	in	in	ADP
finefocus-531	96	6	a	a	DET
finefocus-531	96	7	boiling	boil	VERB
finefocus-531	96	8	water	water	NOUN
finefocus-531	96	9	bath	bath	NOUN
finefocus-531	96	10	(	(	PUNCT
finefocus-531	96	11	~100	~100	PROPN
finefocus-531	96	12	°	°	SYM
finefocus-531	96	13	c	c	NOUN
finefocus-531	96	14	)	)	PUNCT
finefocus-531	96	15	for	for	ADP
finefocus-531	96	16	10	10	NUM
finefocus-531	96	17	minutes	minute	NOUN
finefocus-531	96	18	and	and	CCONJ
finefocus-531	96	19	then	then	ADV
finefocus-531	96	20	cooled	cool	VERB
finefocus-531	96	21	to	to	ADP
finefocus-531	96	22	room	room	NOUN
finefocus-531	96	23	temperature	temperature	NOUN
finefocus-531	96	24	,	,	PUNCT
finefocus-531	96	25	after	after	ADP
finefocus-531	96	26	cooling	cool	VERB
finefocus-531	96	27	5	5	NUM
finefocus-531	96	28	µl	µl	NOUN
finefocus-531	96	29	of	of	ADP
finefocus-531	96	30	4	4	NUM
finefocus-531	96	31	%	%	NOUN
finefocus-531	96	32	(	(	PUNCT
finefocus-531	96	33	w	w	NOUN
finefocus-531	96	34	/	/	SYM
finefocus-531	96	35	v	v	NOUN
finefocus-531	96	36	)	)	PUNCT
finefocus-531	96	37	copper(ii	copper(ii	NOUN
finefocus-531	96	38	)	)	PUNCT
finefocus-531	96	39	sulphate	sulphate	NOUN
finefocus-531	96	40	and	and	CCONJ
finefocus-531	96	41	10	10	NUM
finefocus-531	96	42	µl	µl	NOUN
finefocus-531	96	43	of	of	ADP
finefocus-531	96	44	1.5	1.5	NUM
finefocus-531	96	45	%	%	NOUN
finefocus-531	96	46	(	(	PUNCT
finefocus-531	96	47	w	w	NOUN
finefocus-531	96	48	/	/	SYM
finefocus-531	96	49	v	v	NOUN
finefocus-531	96	50	)	)	PUNCT
finefocus-531	96	51	p	p	ADJ
finefocus-531	96	52	-	-	PUNCT
finefocus-531	96	53	phenyl	phenyl	NOUN
finefocus-531	96	54	phenol	phenol	NOUN
finefocus-531	96	55	(	(	PUNCT
finefocus-531	96	56	in	in	ADP
finefocus-531	96	57	95	95	NUM
finefocus-531	96	58	%	%	NOUN
finefocus-531	96	59	v	v	ADP
finefocus-531	96	60	/	/	SYM
finefocus-531	96	61	v	v	NOUN
finefocus-531	96	62	ethanol	ethanol	NOUN
finefocus-531	96	63	)	)	PUNCT
finefocus-531	96	64	was	be	AUX
finefocus-531	96	65	added	add	VERB
finefocus-531	96	66	.	.	PUNCT
finefocus-531	97	1	the	the	DET
finefocus-531	97	2	sample	sample	NOUN
finefocus-531	97	3	was	be	AUX
finefocus-531	97	4	vortexed	vortexe	VERB
finefocus-531	97	5	and	and	CCONJ
finefocus-531	97	6	incubated	incubate	VERB
finefocus-531	97	7	at	at	ADP
finefocus-531	97	8	room	room	NOUN
finefocus-531	97	9	temperature	temperature	NOUN
finefocus-531	97	10	for	for	ADP
finefocus-531	97	11	30	30	NUM
finefocus-531	97	12	minutes	minute	NOUN
finefocus-531	97	13	.	.	PUNCT
finefocus-531	98	1	samples	sample	NOUN
finefocus-531	98	2	were	be	AUX
finefocus-531	98	3	read	read	VERB
finefocus-531	98	4	at	at	ADP
finefocus-531	98	5	580	580	NUM
finefocus-531	98	6	nm	nm	NOUN
finefocus-531	98	7	against	against	ADP
finefocus-531	98	8	a	a	DET
finefocus-531	98	9	water	water	NOUN
finefocus-531	98	10	blank	blank	NOUN
finefocus-531	98	11	.	.	PUNCT
finefocus-531	99	1	2.6	2.6	NUM
finefocus-531	99	2	molecular	molecular	ADJ
finefocus-531	99	3	methods	method	NOUN
finefocus-531	99	4	the	the	DET
finefocus-531	99	5	16s	16s	PROPN
finefocus-531	99	6	rrna	rrna	PROPN
finefocus-531	99	7	gene	gene	NOUN
finefocus-531	99	8	from	from	ADP
finefocus-531	99	9	escherichia	escherichia	NOUN
finefocus-531	99	10	strain	strain	NOUN
finefocus-531	99	11	cc5c	cc5c	PROPN
finefocus-531	99	12	was	be	AUX
finefocus-531	99	13	sequenced	sequence	VERB
finefocus-531	99	14	(	(	PUNCT
finefocus-531	99	15	1507	1507	NUM
finefocus-531	99	16	nt	nt	NOUN
finefocus-531	99	17	)	)	PUNCT
finefocus-531	99	18	.	.	PUNCT
finefocus-531	100	1	the	the	DET
finefocus-531	100	2	sequence	sequence	NOUN
finefocus-531	100	3	was	be	AUX
finefocus-531	100	4	originally	originally	ADV
finefocus-531	100	5	compared	compare	VERB
finefocus-531	100	6	to	to	ADP
finefocus-531	100	7	sequences	sequence	NOUN
finefocus-531	100	8	in	in	ADP
finefocus-531	100	9	the	the	DET
finefocus-531	100	10	ncbi	ncbi	NOUN
finefocus-531	100	11	(	(	PUNCT
finefocus-531	100	12	national	national	ADJ
finefocus-531	100	13	center	center	NOUN
finefocus-531	100	14	for	for	ADP
finefocus-531	100	15	biotechnology	biotechnology	NOUN
finefocus-531	100	16	information	information	NOUN
finefocus-531	100	17	)	)	PUNCT
finefocus-531	101	1	database	database	NOUN
finefocus-531	101	2	using	use	VERB
finefocus-531	101	3	the	the	DET
finefocus-531	101	4	nucleotide	nucleotide	NOUN
finefocus-531	101	5	blast	blast	NOUN
finefocus-531	101	6	.	.	PUNCT
finefocus-531	102	1	the	the	DET
finefocus-531	102	2	top	top	ADJ
finefocus-531	102	3	sequences	sequence	NOUN
finefocus-531	102	4	with	with	ADP
finefocus-531	102	5	the	the	DET
finefocus-531	102	6	highest	high	ADJ
finefocus-531	102	7	scores	score	NOUN
finefocus-531	102	8	were	be	AUX
finefocus-531	102	9	then	then	ADV
finefocus-531	102	10	selected	select	VERB
finefocus-531	102	11	for	for	ADP
finefocus-531	102	12	the	the	DET
finefocus-531	102	13	calculation	calculation	NOUN
finefocus-531	102	14	of	of	ADP
finefocus-531	102	15	pairwise	pairwise	NOUN
finefocus-531	102	16	sequence	sequence	NOUN
finefocus-531	102	17	similarity	similarity	NOUN
finefocus-531	102	18	using	use	VERB
finefocus-531	102	19	a	a	DET
finefocus-531	102	20	global	global	ADJ
finefocus-531	102	21	alignment	alignment	NOUN
finefocus-531	102	22	algorithm	algorithm	NOUN
finefocus-531	102	23	which	which	PRON
finefocus-531	102	24	was	be	AUX
finefocus-531	102	25	implemented	implement	VERB
finefocus-531	102	26	at	at	ADP
finefocus-531	102	27	the	the	DET
finefocus-531	102	28	eztaxon	eztaxon	ADJ
finefocus-531	102	29	server	server	NOUN
finefocus-531	102	30	(	(	PUNCT
finefocus-531	102	31	23	23	NUM
finefocus-531	102	32	)	)	PUNCT
finefocus-531	102	33	.	.	PUNCT
finefocus-531	103	1	the	the	DET
finefocus-531	103	2	most	most	ADV
finefocus-531	103	3	similar	similar	ADJ
finefocus-531	103	4	sequences	sequence	NOUN
finefocus-531	103	5	obtained	obtain	VERB
finefocus-531	103	6	were	be	AUX
finefocus-531	103	7	aligned	align	VERB
finefocus-531	103	8	with	with	ADP
finefocus-531	103	9	sequencing	sequence	VERB
finefocus-531	103	10	results	result	NOUN
finefocus-531	103	11	in	in	ADP
finefocus-531	103	12	mega6	mega6	NOUN
finefocus-531	103	13	(	(	PUNCT
finefocus-531	103	14	27	27	NUM
finefocus-531	103	15	)	)	PUNCT
finefocus-531	103	16	and	and	CCONJ
finefocus-531	103	17	the	the	DET
finefocus-531	103	18	maximum	maximum	ADJ
finefocus-531	103	19	likelihood	likelihood	NOUN
finefocus-531	103	20	method	method	NOUN
finefocus-531	103	21	based	base	VERB
finefocus-531	103	22	on	on	ADP
finefocus-531	103	23	the	the	DET
finefocus-531	103	24	tamura	tamura	PROPN
finefocus-531	103	25	-	-	PUNCT
finefocus-531	103	26	nei	nei	NOUN
finefocus-531	103	27	model	model	NOUN
finefocus-531	103	28	was	be	AUX
finefocus-531	103	29	used	use	VERB
finefocus-531	103	30	to	to	PART
finefocus-531	103	31	generate	generate	VERB
finefocus-531	103	32	a	a	DET
finefocus-531	103	33	phylogenetic	phylogenetic	ADJ
finefocus-531	103	34	tree	tree	NOUN
finefocus-531	103	35	(	(	PUNCT
finefocus-531	103	36	26	26	NUM
finefocus-531	103	37	)	)	PUNCT
finefocus-531	103	38	.	.	PUNCT
finefocus-531	104	1	genomic	genomic	PROPN
finefocus-531	104	2	dna	dna	PROPN
finefocus-531	104	3	extraction	extraction	NOUN
finefocus-531	104	4	was	be	AUX
finefocus-531	104	5	carried	carry	VERB
finefocus-531	104	6	out	out	ADP
finefocus-531	104	7	,	,	PUNCT
finefocus-531	104	8	by	by	ADP
finefocus-531	104	9	using	use	VERB
finefocus-531	104	10	ultraclean	ultraclean	ADJ
finefocus-531	104	11	™	™	ADJ
finefocus-531	104	12	microbial	microbial	ADJ
finefocus-531	104	13	dna	dna	NOUN
finefocus-531	104	14	isolation	isolation	NOUN
finefocus-531	104	15	kit	kit	NOUN
finefocus-531	104	16	from	from	ADP
finefocus-531	104	17	mobio	mobio	PROPN
finefocus-531	104	18	laboratories	laboratory	NOUN
finefocus-531	104	19	,	,	PUNCT
finefocus-531	104	20	according	accord	VERB
finefocus-531	104	21	to	to	ADP
finefocus-531	104	22	the	the	DET
finefocus-531	104	23	manufacturer	manufacturer	NOUN
finefocus-531	104	24	’s	’s	PART
finefocus-531	104	25	protocol	protocol	NOUN
finefocus-531	104	26	.	.	PUNCT
finefocus-531	105	1	pcr	pcr	ADJ
finefocus-531	105	2	mediated	mediate	VERB
finefocus-531	105	3	amplification	amplification	NOUN
finefocus-531	105	4	of	of	ADP
finefocus-531	105	5	the	the	DET
finefocus-531	105	6	16s	16	NOUN
finefocus-531	105	7	rdna	rdna	NOUN
finefocus-531	105	8	and	and	CCONJ
finefocus-531	105	9	purification	purification	NOUN
finefocus-531	105	10	of	of	ADP
finefocus-531	105	11	the	the	DET
finefocus-531	105	12	pcr	pcr	ADJ
finefocus-531	105	13	product	product	NOUN
finefocus-531	105	14	was	be	AUX
finefocus-531	105	15	carried	carry	VERB
finefocus-531	105	16	out	out	ADP
finefocus-531	105	17	with	with	ADP
finefocus-531	105	18	519f	519f	PROPN
finefocus-531	105	19	(	(	PUNCT
finefocus-531	105	20	cagcagccgcggtaatac	cagcagccgcggtaatac	ADJ
finefocus-531	105	21	)	)	PUNCT
finefocus-531	105	22	and	and	CCONJ
finefocus-531	105	23	926r	926r	NOUN
finefocus-531	105	24	(	(	PUNCT
finefocus-531	105	25	ccgtcaattcctttgagttt	ccgtcaattcctttgagttt	ADV
finefocus-531	105	26	)	)	PUNCT
finefocus-531	105	27	universal	universal	ADJ
finefocus-531	105	28	primers	primer	NOUN
finefocus-531	105	29	as	as	SCONJ
finefocus-531	105	30	previously	previously	ADV
finefocus-531	105	31	described	describe	VERB
finefocus-531	105	32	(	(	PUNCT
finefocus-531	105	33	21	21	NUM
finefocus-531	105	34	)	)	PUNCT
finefocus-531	105	35	.	.	PUNCT
finefocus-531	106	1	the	the	DET
finefocus-531	106	2	amplified	amplify	VERB
finefocus-531	106	3	pcr	pcr	ADJ
finefocus-531	106	4	products	product	NOUN
finefocus-531	106	5	were	be	AUX
finefocus-531	106	6	purified	purify	VERB
finefocus-531	106	7	with	with	ADP
finefocus-531	106	8	exo	exo	NOUN
finefocus-531	106	9	-	-	PUNCT
finefocus-531	106	10	sap	sap	PROPN
finefocus-531	106	11	reaction	reaction	NOUN
finefocus-531	106	12	;	;	PUNCT
finefocus-531	106	13	substrate	substrate	NOUN
finefocus-531	106	14	preparation	preparation	NOUN
finefocus-531	106	15	was	be	AUX
finefocus-531	106	16	prepared	prepare	VERB
finefocus-531	106	17	by	by	ADP
finefocus-531	106	18	mixing	mix	VERB
finefocus-531	106	19	0,025	0,025	NUM
finefocus-531	106	20	µl	µl	NOUN
finefocus-531	106	21	of	of	ADP
finefocus-531	106	22	exonuclease	exonuclease	NOUN
finefocus-531	107	1	i	i	PROPN
finefocus-531	107	2	(	(	PUNCT
finefocus-531	107	3	neb	neb	PROPN
finefocus-531	107	4	,	,	PUNCT
finefocus-531	107	5	england	england	PROPN
finefocus-531	107	6	)	)	PUNCT
finefocus-531	107	7	,	,	PUNCT
finefocus-531	107	8	0,05	0,05	PROPN
finefocus-531	107	9	µl	µl	ADP
finefocus-531	107	10	of	of	ADP
finefocus-531	107	11	antarctic	antarctic	ADJ
finefocus-531	107	12	shrimp	shrimp	NOUN
finefocus-531	107	13	phosphatase	phosphatase	NOUN
finefocus-531	107	14	(	(	PUNCT
finefocus-531	107	15	neb	neb	PROPN
finefocus-531	107	16	,	,	PUNCT
finefocus-531	107	17	england	england	PROPN
finefocus-531	107	18	)	)	PUNCT
finefocus-531	107	19	and	and	CCONJ
finefocus-531	107	20	9,925	9,925	NUM
finefocus-531	107	21	µl	µl	NOUN
finefocus-531	107	22	of	of	ADP
finefocus-531	107	23	mq	mq	NOUN
finefocus-531	107	24	water	water	NOUN
finefocus-531	107	25	for	for	ADP
finefocus-531	107	26	each	each	DET
finefocus-531	107	27	sample	sample	NOUN
finefocus-531	107	28	.	.	PUNCT
finefocus-531	108	1	10	10	NUM
finefocus-531	108	2	µl	µl	NOUN
finefocus-531	108	3	of	of	ADP
finefocus-531	108	4	the	the	DET
finefocus-531	108	5	reagent	reagent	ADJ
finefocus-531	108	6	substrate	substrate	NOUN
finefocus-531	108	7	was	be	AUX
finefocus-531	108	8	26	26	NUM
finefocus-531	108	9	•	•	NUM
finefocus-531	108	10	fine	fine	ADJ
finefocus-531	108	11	focus	focus	NOUN
finefocus-531	108	12	,	,	PUNCT
finefocus-531	108	13	vol	vol	NOUN
finefocus-531	108	14	.	.	PUNCT
finefocus-531	108	15	4(1	4(1	NOUN
finefocus-531	108	16	)	)	PUNCT
finefocus-531	109	1	results	result	NOUN
finefocus-531	109	2	then	then	ADV
finefocus-531	109	3	mixed	mix	VERB
finefocus-531	109	4	with	with	ADP
finefocus-531	109	5	20	20	NUM
finefocus-531	109	6	µl	µl	NOUN
finefocus-531	109	7	of	of	ADP
finefocus-531	109	8	amplified	amplify	VERB
finefocus-531	109	9	pcr	pcr	ADJ
finefocus-531	109	10	products	product	NOUN
finefocus-531	109	11	.	.	PUNCT
finefocus-531	110	1	the	the	DET
finefocus-531	110	2	reaction	reaction	NOUN
finefocus-531	110	3	was	be	AUX
finefocus-531	110	4	carried	carry	VERB
finefocus-531	110	5	out	out	ADP
finefocus-531	110	6	with	with	ADP
finefocus-531	110	7	ptc-200	ptc-200	PROPN
finefocus-531	110	8	(	(	PUNCT
finefocus-531	110	9	mj	mj	NOUN
finefocus-531	110	10	-	-	PUNCT
finefocus-531	110	11	research	research	NOUN
finefocus-531	110	12	)	)	PUNCT
finefocus-531	110	13	for	for	ADP
finefocus-531	110	14	3	3	NUM
finefocus-531	110	15	min	min	NOUN
finefocus-531	110	16	at	at	ADP
finefocus-531	110	17	95	95	NUM
finefocus-531	110	18	°	°	ADP
finefocus-531	110	19	c	c	NOUN
finefocus-531	110	20	for	for	ADP
finefocus-531	110	21	the	the	DET
finefocus-531	110	22	initial	initial	ADJ
finefocus-531	110	23	denaturation	denaturation	NOUN
finefocus-531	110	24	,	,	PUNCT
finefocus-531	110	25	30	30	NUM
finefocus-531	110	26	sec	sec	PROPN
finefocus-531	110	27	at	at	ADP
finefocus-531	110	28	95	95	NUM
finefocus-531	110	29	°	°	ADP
finefocus-531	110	30	c	c	NOUN
finefocus-531	110	31	for	for	ADP
finefocus-531	110	32	denaturation	denaturation	NOUN
finefocus-531	110	33	,	,	PUNCT
finefocus-531	110	34	30	30	NUM
finefocus-531	110	35	sec	sec	PROPN
finefocus-531	110	36	at	at	ADP
finefocus-531	110	37	50	50	NUM
finefocus-531	110	38	°	°	NOUN
finefocus-531	110	39	c	c	NOUN
finefocus-531	110	40	for	for	ADP
finefocus-531	110	41	annealing	annealing	NOUN
finefocus-531	110	42	,	,	PUNCT
finefocus-531	110	43	90	90	NUM
finefocus-531	110	44	sec	sec	PROPN
finefocus-531	110	45	at	at	ADP
finefocus-531	110	46	68	68	NUM
finefocus-531	110	47	°	°	NOUN
finefocus-531	110	48	c	c	NOUN
finefocus-531	110	49	for	for	ADP
finefocus-531	110	50	extension	extension	NOUN
finefocus-531	110	51	,	,	PUNCT
finefocus-531	110	52	and	and	CCONJ
finefocus-531	110	53	a	a	DET
finefocus-531	110	54	final	final	ADJ
finefocus-531	110	55	extension	extension	NOUN
finefocus-531	110	56	time	time	NOUN
finefocus-531	110	57	of	of	ADP
finefocus-531	110	58	7	7	NUM
finefocus-531	110	59	min	min	NOUN
finefocus-531	110	60	at	at	ADP
finefocus-531	110	61	68	68	NUM
finefocus-531	110	62	°	°	NOUN
finefocus-531	110	63	c	c	NOUN
finefocus-531	110	64	followed	follow	VERB
finefocus-531	110	65	by	by	ADP
finefocus-531	110	66	strain	strain	NOUN
finefocus-531	110	67	isolation	isolation	NOUN
finefocus-531	110	68	and	and	CCONJ
finefocus-531	110	69	16s	16	NOUN
finefocus-531	110	70	sequencing	sequence	VERB
finefocus-531	110	71	strain	strain	NOUN
finefocus-531	110	72	cc5c	cc5c	NUM
finefocus-531	110	73	was	be	AUX
finefocus-531	110	74	isolated	isolate	VERB
finefocus-531	110	75	from	from	ADP
finefocus-531	110	76	a	a	DET
finefocus-531	110	77	geothermally	geothermally	ADV
finefocus-531	110	78	-	-	PUNCT
finefocus-531	110	79	heated	heat	VERB
finefocus-531	110	80	intertidal	intertidal	ADJ
finefocus-531	110	81	pool	pool	NOUN
finefocus-531	110	82	north	north	ADV
finefocus-531	110	83	of	of	ADP
finefocus-531	110	84	husavik	husavik	NOUN
finefocus-531	110	85	in	in	ADP
finefocus-531	110	86	north	north	PROPN
finefocus-531	110	87	central	central	PROPN
finefocus-531	110	88	iceland	iceland	PROPN
finefocus-531	110	89	.	.	PUNCT
finefocus-531	111	1	the	the	DET
finefocus-531	111	2	strain	strain	NOUN
finefocus-531	111	3	produced	produce	VERB
finefocus-531	111	4	creamy	creamy	ADJ
finefocus-531	111	5	circular	circular	ADJ
finefocus-531	111	6	colonies	colony	NOUN
finefocus-531	111	7	that	that	PRON
finefocus-531	111	8	are	be	AUX
finefocus-531	111	9	off	off	ADV
finefocus-531	111	10	-	-	PUNCT
finefocus-531	111	11	white	white	ADJ
finefocus-531	111	12	in	in	ADP
finefocus-531	111	13	color	color	NOUN
finefocus-531	111	14	when	when	SCONJ
finefocus-531	111	15	grown	grow	VERB
finefocus-531	111	16	on	on	ADP
finefocus-531	111	17	pca	pca	PROPN
finefocus-531	111	18	and	and	CCONJ
finefocus-531	111	19	r2a	r2a	NOUN
finefocus-531	111	20	.	.	PUNCT
finefocus-531	112	1	the	the	DET
finefocus-531	112	2	strain	strain	NOUN
finefocus-531	112	3	was	be	AUX
finefocus-531	112	4	more	more	ADJ
finefocus-531	112	5	than	than	ADP
finefocus-531	112	6	99	99	NUM
finefocus-531	112	7	%	%	NOUN
finefocus-531	112	8	similar	similar	ADJ
finefocus-531	112	9	to	to	ADP
finefocus-531	112	10	escherichia	escherichia	NOUN
finefocus-531	112	11	coli	coli	NOUN
finefocus-531	112	12	based	base	VERB
finefocus-531	112	13	upon	upon	SCONJ
finefocus-531	112	14	analysis	analysis	NOUN
finefocus-531	112	15	of	of	ADP
finefocus-531	112	16	partial	partial	ADJ
finefocus-531	112	17	16s	16	NOUN
finefocus-531	112	18	rdna	rdna	NOUN
finefocus-531	112	19	(	(	PUNCT
finefocus-531	112	20	1507	1507	NUM
finefocus-531	112	21	nt	not	PART
finefocus-531	112	22	)	)	PUNCT
finefocus-531	112	23	using	use	VERB
finefocus-531	112	24	nucleotide	nucleotide	NOUN
finefocus-531	112	25	blast	blast	NOUN
finefocus-531	112	26	.	.	PUNCT
finefocus-531	113	1	further	further	ADJ
finefocus-531	113	2	analysis	analysis	NOUN
finefocus-531	113	3	of	of	ADP
finefocus-531	113	4	the	the	DET
finefocus-531	113	5	sequence	sequence	NOUN
finefocus-531	113	6	with	with	ADP
finefocus-531	113	7	ez	ez	PROPN
finefocus-531	113	8	taxon	taxon	PROPN
finefocus-531	113	9	indicates	indicate	VERB
finefocus-531	113	10	that	that	SCONJ
finefocus-531	113	11	cc5c	cc5c	PROPN
finefocus-531	113	12	is	be	AUX
finefocus-531	113	13	highly	highly	ADV
finefocus-531	113	14	similar	similar	ADJ
finefocus-531	113	15	to	to	PART
finefocus-531	113	16	escherichia	escherichia	VERB
finefocus-531	113	17	marmotae	marmotae	NOUN
finefocus-531	113	18	(	(	PUNCT
finefocus-531	113	19	99.13	99.13	NUM
finefocus-531	113	20	%	%	NOUN
finefocus-531	113	21	)	)	PUNCT
finefocus-531	113	22	,	,	PUNCT
finefocus-531	113	23	shigella	shigella	PROPN
finefocus-531	113	24	dysenteriae	dysenteriae	NOUN
finefocus-531	113	25	(	(	PUNCT
finefocus-531	113	26	99.13	99.13	NUM
finefocus-531	113	27	%	%	NOUN
finefocus-531	113	28	)	)	PUNCT
finefocus-531	113	29	,	,	PUNCT
finefocus-531	113	30	escherichia	escherichia	NOUN
finefocus-531	113	31	fergusonii	fergusonii	ADJ
finefocus-531	113	32	(	(	PUNCT
finefocus-531	113	33	99.06	99.06	NUM
finefocus-531	113	34	%	%	NOUN
finefocus-531	113	35	)	)	PUNCT
finefocus-531	113	36	,	,	PUNCT
finefocus-531	113	37	escherichia	escherichia	NOUN
finefocus-531	113	38	coli	coli	NOUN
finefocus-531	113	39	(	(	PUNCT
finefocus-531	113	40	98.99	98.99	NUM
finefocus-531	113	41	%	%	NOUN
finefocus-531	113	42	)	)	PUNCT
finefocus-531	113	43	,	,	PUNCT
finefocus-531	113	44	shigella	shigella	PROPN
finefocus-531	113	45	flexneri	flexneri	PROPN
finefocus-531	113	46	(	(	PUNCT
finefocus-531	113	47	98.99	98.99	NUM
finefocus-531	113	48	%	%	NOUN
finefocus-531	113	49	)	)	PUNCT
finefocus-531	113	50	,	,	PUNCT
finefocus-531	113	51	and	and	CCONJ
finefocus-531	113	52	shigella	shigella	PROPN
finefocus-531	113	53	sonnei	sonnei	PROPN
finefocus-531	113	54	(	(	PUNCT
finefocus-531	113	55	98.85	98.85	NUM
finefocus-531	113	56	%	%	NOUN
finefocus-531	113	57	)	)	PUNCT
finefocus-531	113	58	,	,	PUNCT
finefocus-531	113	59	respectively	respectively	ADV
finefocus-531	113	60	.	.	PUNCT
finefocus-531	114	1	preliminary	preliminary	ADJ
finefocus-531	114	2	screening	screening	NOUN
finefocus-531	114	3	of	of	ADP
finefocus-531	114	4	the	the	DET
finefocus-531	114	5	strain	strain	NOUN
finefocus-531	114	6	revealed	reveal	VERB
finefocus-531	114	7	that	that	SCONJ
finefocus-531	114	8	the	the	DET
finefocus-531	114	9	isolate	isolate	NOUN
finefocus-531	114	10	cc5c	cc5c	PROPN
finefocus-531	114	11	was	be	AUX
finefocus-531	114	12	capable	capable	ADJ
finefocus-531	114	13	of	of	ADP
finefocus-531	114	14	producing	produce	VERB
finefocus-531	114	15	1,2	1,2	NUM
finefocus-531	114	16	-	-	NOUN
finefocus-531	114	17	pd	pd	NOUN
finefocus-531	114	18	from	from	ADP
finefocus-531	114	19	l	l	NOUN
finefocus-531	114	20	-	-	PUNCT
finefocus-531	114	21	rhamnose	rhamnose	NOUN
finefocus-531	114	22	and	and	CCONJ
finefocus-531	114	23	was	be	AUX
finefocus-531	114	24	chosen	choose	VERB
finefocus-531	114	25	for	for	ADP
finefocus-531	114	26	further	further	ADJ
finefocus-531	114	27	investigation	investigation	NOUN
finefocus-531	114	28	.	.	PUNCT
finefocus-531	115	1	storage	storage	NOUN
finefocus-531	115	2	at	at	ADP
finefocus-531	115	3	4	4	NUM
finefocus-531	115	4	°	°	NOUN
finefocus-531	115	5	c	c	NOUN
finefocus-531	115	6	.	.	PUNCT
finefocus-531	116	1	purified	purified	ADJ
finefocus-531	116	2	pcr	pcr	ADJ
finefocus-531	116	3	products	product	NOUN
finefocus-531	116	4	were	be	AUX
finefocus-531	116	5	then	then	ADV
finefocus-531	116	6	transferred	transfer	VERB
finefocus-531	116	7	into	into	ADP
finefocus-531	116	8	96	96	NUM
finefocus-531	116	9	-	-	PUNCT
finefocus-531	116	10	well	well	NOUN
finefocus-531	116	11	microamp	microamp	NOUN
finefocus-531	116	12	plate	plate	NOUN
finefocus-531	116	13	,	,	PUNCT
finefocus-531	116	14	with	with	ADP
finefocus-531	116	15	either	either	PRON
finefocus-531	116	16	519f	519f	NUM
finefocus-531	116	17	or	or	CCONJ
finefocus-531	116	18	926r	926r	NUM
finefocus-531	116	19	primer	primer	NOUN
finefocus-531	116	20	,	,	PUNCT
finefocus-531	116	21	since	since	SCONJ
finefocus-531	116	22	the	the	DET
finefocus-531	116	23	products	product	NOUN
finefocus-531	116	24	were	be	AUX
finefocus-531	116	25	sequenced	sequence	VERB
finefocus-531	116	26	from	from	ADP
finefocus-531	116	27	each	each	DET
finefocus-531	116	28	end	end	NOUN
finefocus-531	116	29	,	,	PUNCT
finefocus-531	116	30	and	and	CCONJ
finefocus-531	116	31	sent	send	VERB
finefocus-531	116	32	to	to	ADP
finefocus-531	116	33	macrogen	macrogen	PROPN
finefocus-531	116	34	(	(	PUNCT
finefocus-531	116	35	netherlands	netherlands	PROPN
finefocus-531	116	36	)	)	PUNCT
finefocus-531	116	37	for	for	ADP
finefocus-531	116	38	sequencing	sequence	VERB
finefocus-531	116	39	.	.	PUNCT
finefocus-531	117	1	train	train	NOUN
finefocus-531	117	2	characterization	characterization	NOUN
finefocus-531	117	3	and	and	CCONJ
finefocus-531	117	4	substrate	substrate	NOUN
finefocus-531	117	5	spectra	spectra	ADJ
finefocus-531	117	6	strain	strain	NOUN
finefocus-531	117	7	cc5c	cc5c	PROPN
finefocus-531	117	8	is	be	AUX
finefocus-531	117	9	gram	gram	NOUN
finefocus-531	117	10	-	-	PUNCT
finefocus-531	117	11	negative	negative	ADJ
finefocus-531	117	12	,	,	PUNCT
finefocus-531	117	13	string	string	NOUN
finefocus-531	117	14	test	test	NOUN
finefocus-531	117	15	positive	positive	ADJ
finefocus-531	117	16	,	,	PUNCT
finefocus-531	117	17	oxidase	oxidase	NOUN
finefocus-531	117	18	,	,	PUNCT
finefocus-531	117	19	and	and	CCONJ
finefocus-531	117	20	catalase	catalase	ADJ
finefocus-531	117	21	positive	positive	ADJ
finefocus-531	117	22	.	.	PUNCT
finefocus-531	118	1	strain	strain	PROPN
finefocus-531	118	2	cc5c	cc5c	NUM
finefocus-531	118	3	is	be	AUX
finefocus-531	118	4	both	both	PRON
finefocus-531	118	5	oxidative	oxidative	ADJ
finefocus-531	118	6	and	and	CCONJ
finefocus-531	118	7	fermentative	fermentative	ADJ
finefocus-531	118	8	based	base	VERB
finefocus-531	118	9	upon	upon	SCONJ
finefocus-531	118	10	positive	positive	ADJ
finefocus-531	118	11	oxidative	oxidative	ADJ
finefocus-531	118	12	fermentation	fermentation	NOUN
finefocus-531	118	13	tests	test	NOUN
finefocus-531	118	14	.	.	PUNCT
finefocus-531	119	1	colonies	colony	NOUN
finefocus-531	119	2	grown	grow	VERB
finefocus-531	119	3	on	on	ADP
finefocus-531	119	4	pca	pca	PROPN
finefocus-531	119	5	had	have	VERB
finefocus-531	119	6	an	an	DET
finefocus-531	119	7	offwhite	offwhite	ADJ
finefocus-531	119	8	circular	circular	ADJ
finefocus-531	119	9	morphology	morphology	NOUN
finefocus-531	119	10	.	.	PUNCT
finefocus-531	120	1	colonies	colony	NOUN
finefocus-531	120	2	of	of	ADP
finefocus-531	120	3	cc5c	cc5c	PROPN
finefocus-531	120	4	produced	produce	VERB
finefocus-531	120	5	positive	positive	ADJ
finefocus-531	120	6	reaction	reaction	NOUN
finefocus-531	120	7	on	on	ADP
finefocus-531	120	8	brilliant	brilliant	ADJ
finefocus-531	120	9	green	green	ADJ
finefocus-531	120	10	agar	agar	NOUN
finefocus-531	120	11	,	,	PUNCT
finefocus-531	120	12	growth	growth	NOUN
finefocus-531	120	13	on	on	ADP
finefocus-531	120	14	macconkey	macconkey	NOUN
finefocus-531	120	15	’s	’s	NOUN
finefocus-531	120	16	with	with	ADP
finefocus-531	120	17	colonies	colony	NOUN
finefocus-531	120	18	presenting	present	VERB
finefocus-531	120	19	as	as	ADP
finefocus-531	120	20	pink	pink	ADJ
finefocus-531	120	21	,	,	PUNCT
finefocus-531	120	22	and	and	CCONJ
finefocus-531	120	23	produced	produce	VERB
finefocus-531	120	24	purple	purple	ADJ
finefocus-531	120	25	colonies	colony	NOUN
finefocus-531	120	26	with	with	ADP
finefocus-531	120	27	a	a	DET
finefocus-531	120	28	metallic	metallic	ADJ
finefocus-531	120	29	green	green	ADJ
finefocus-531	120	30	sheen	sheen	NOUN
finefocus-531	120	31	on	on	ADP
finefocus-531	120	32	emb	emb	NUM
finefocus-531	120	33	agar	agar	NOUN
finefocus-531	120	34	plates	plate	NOUN
finefocus-531	120	35	characteristic	characteristic	ADJ
finefocus-531	120	36	of	of	ADP
finefocus-531	120	37	e.	e.	PROPN
finefocus-531	120	38	coli	coli	PROPN
finefocus-531	120	39	.	.	PUNCT
finefocus-531	121	1	no	no	DET
finefocus-531	121	2	growth	growth	NOUN
finefocus-531	121	3	was	be	AUX
finefocus-531	121	4	observed	observe	VERB
finefocus-531	121	5	on	on	ADP
finefocus-531	121	6	mannitol	mannitol	NOUN
finefocus-531	121	7	salt	salt	NOUN
finefocus-531	121	8	agar	agar	NOUN
finefocus-531	121	9	.	.	PUNCT
finefocus-531	122	1	growth	growth	NOUN
finefocus-531	122	2	on	on	ADP
finefocus-531	122	3	starch	starch	NOUN
finefocus-531	122	4	impregnated	impregnate	VERB
finefocus-531	122	5	plates	plate	NOUN
finefocus-531	122	6	followed	follow	VERB
finefocus-531	122	7	by	by	ADP
finefocus-531	122	8	staining	stain	VERB
finefocus-531	122	9	with	with	ADP
finefocus-531	122	10	gram´s	gram´s	PROPN
finefocus-531	122	11	iodine	iodine	NOUN
finefocus-531	122	12	solution	solution	NOUN
finefocus-531	122	13	indicated	indicate	VERB
finefocus-531	122	14	starch	starch	NOUN
finefocus-531	122	15	being	be	AUX
finefocus-531	122	16	degraded	degrade	VERB
finefocus-531	122	17	.	.	PUNCT
finefocus-531	123	1	cc5c	cc5c	PROPN
finefocus-531	123	2	has	have	VERB
finefocus-531	123	3	a	a	DET
finefocus-531	123	4	growth	growth	NOUN
finefocus-531	123	5	range	range	NOUN
finefocus-531	123	6	from	from	ADP
finefocus-531	123	7	5	5	NUM
finefocus-531	123	8	to	to	PART
finefocus-531	123	9	45	45	NUM
finefocus-531	123	10	°	°	NOUN
finefocus-531	123	11	c	c	NOUN
finefocus-531	123	12	with	with	ADP
finefocus-531	123	13	a	a	DET
finefocus-531	123	14	temperature	temperature	NOUN
finefocus-531	123	15	optimum	optimum	NOUN
finefocus-531	123	16	of	of	ADP
finefocus-531	123	17	40	40	NUM
finefocus-531	123	18	°	°	NOUN
finefocus-531	123	19	c	c	NOUN
finefocus-531	123	20	(	(	PUNCT
finefocus-531	123	21	figure	figure	NOUN
finefocus-531	123	22	1	1	NUM
finefocus-531	123	23	)	)	PUNCT
finefocus-531	123	24	.	.	PUNCT
finefocus-531	124	1	growth	growth	NOUN
finefocus-531	124	2	was	be	AUX
finefocus-531	124	3	observed	observe	VERB
finefocus-531	124	4	between	between	ADP
finefocus-531	124	5	ph	ph	PROPN
finefocus-531	124	6	4.0	4.0	NUM
finefocus-531	124	7	and	and	CCONJ
finefocus-531	124	8	9.0	9.0	NUM
finefocus-531	124	9	with	with	ADP
finefocus-531	124	10	an	an	DET
finefocus-531	124	11	optima	optima	NOUN
finefocus-531	124	12	of	of	ADP
finefocus-531	124	13	ph	ph	ADJ
finefocus-531	124	14	7.5	7.5	NUM
finefocus-531	124	15	,	,	PUNCT
finefocus-531	124	16	and	and	CCONJ
finefocus-531	124	17	between	between	ADP
finefocus-531	124	18	sodium	sodium	NOUN
finefocus-531	124	19	chloride	chloride	NOUN
finefocus-531	124	20	concentrations	concentration	NOUN
finefocus-531	124	21	between	between	ADP
finefocus-531	124	22	0	0	NUM
finefocus-531	124	23	and	and	CCONJ
finefocus-531	124	24	7	7	NUM
finefocus-531	124	25	%	%	NOUN
finefocus-531	124	26	w	w	NOUN
finefocus-531	124	27	/	/	SYM
finefocus-531	124	28	v	v	NOUN
finefocus-531	124	29	with	with	ADP
finefocus-531	124	30	optima	optima	PROPN
finefocus-531	124	31	of	of	ADP
finefocus-531	124	32	0.5	0.5	NUM
finefocus-531	124	33	%	%	NOUN
finefocus-531	124	34	(	(	PUNCT
finefocus-531	124	35	figure	figure	NOUN
finefocus-531	124	36	2	2	NUM
finefocus-531	124	37	)	)	PUNCT
finefocus-531	124	38	.	.	PUNCT
finefocus-531	125	1	maximum	maximum	ADJ
finefocus-531	125	2	specific	specific	ADJ
finefocus-531	125	3	growth	growth	NOUN
finefocus-531	125	4	was	be	AUX
finefocus-531	125	5	1.10	1.10	NUM
finefocus-531	125	6	h-1	h-1	NOUN
finefocus-531	125	7	with	with	ADP
finefocus-531	125	8	a	a	DET
finefocus-531	125	9	generation	generation	NOUN
finefocus-531	125	10	time	time	NOUN
finefocus-531	125	11	of	of	ADP
finefocus-531	125	12	37.8	37.8	NUM
finefocus-531	125	13	min	min	NOUN
finefocus-531	125	14	.	.	PROPN
finefocus-531	125	15	27applied	27applied	NUM
finefocus-531	125	16	&	&	CCONJ
finefocus-531	125	17	environmental	environmental	ADJ
finefocus-531	125	18	microbiology	microbiology	NOUN
finefocus-531	125	19	•	•	NOUN
finefocus-531	125	20	figure	figure	NOUN
finefocus-531	125	21	1	1	NUM
finefocus-531	125	22	temperature	temperature	NOUN
finefocus-531	125	23	optima	optima	NOUN
finefocus-531	125	24	of	of	ADP
finefocus-531	125	25	strain	strain	NOUN
finefocus-531	125	26	cc5c	cc5c	PROPN
finefocus-531	125	27	(	(	PUNCT
finefocus-531	125	28	black	black	ADJ
finefocus-531	125	29	line	line	NOUN
finefocus-531	125	30	)	)	PUNCT
finefocus-531	125	31	and	and	CCONJ
finefocus-531	125	32	e.	e.	PROPN
finefocus-531	125	33	coli	coli	PROPN
finefocus-531	125	34	(	(	PUNCT
finefocus-531	125	35	red	red	ADJ
finefocus-531	125	36	line	line	NOUN
finefocus-531	125	37	,	,	PUNCT
finefocus-531	125	38	dsm	dsm	PROPN
finefocus-531	125	39	30083	30083	NUM
finefocus-531	125	40	)	)	PUNCT
finefocus-531	125	41	grown	grow	VERB
finefocus-531	125	42	in	in	ADP
finefocus-531	125	43	tsb	tsb	PROPN
finefocus-531	125	44	.	.	PUNCT
finefocus-531	126	1	values	value	NOUN
finefocus-531	126	2	represent	represent	VERB
finefocus-531	126	3	average	average	NOUN
finefocus-531	126	4	of	of	ADP
finefocus-531	126	5	triplicates	triplicate	NOUN
finefocus-531	126	6	with	with	ADP
finefocus-531	126	7	the	the	DET
finefocus-531	126	8	standard	standard	ADJ
finefocus-531	126	9	deviation	deviation	NOUN
finefocus-531	126	10	presented	present	VERB
finefocus-531	126	11	as	as	ADP
finefocus-531	126	12	error	error	NOUN
finefocus-531	126	13	bars	bar	NOUN
finefocus-531	126	14	.	.	PUNCT
finefocus-531	127	1	figure	figure	NOUN
finefocus-531	127	2	2	2	NUM
finefocus-531	127	3	optimization	optimization	NOUN
finefocus-531	127	4	of	of	ADP
finefocus-531	127	5	ph	ph	NOUN
finefocus-531	127	6	and	and	CCONJ
finefocus-531	127	7	nacl	nacl	NOUN
finefocus-531	127	8	for	for	ADP
finefocus-531	127	9	maximum	maximum	ADJ
finefocus-531	127	10	specific	specific	ADJ
finefocus-531	127	11	growth	growth	NOUN
finefocus-531	127	12	rate	rate	NOUN
finefocus-531	127	13	at	at	ADP
finefocus-531	127	14	topt	topt	NOUN
finefocus-531	127	15	(	(	PUNCT
finefocus-531	127	16	40	40	NUM
finefocus-531	127	17	°	°	NOUN
finefocus-531	127	18	c	c	NOUN
finefocus-531	127	19	)	)	PUNCT
finefocus-531	127	20	;	;	PUNCT
finefocus-531	127	21	values	value	NOUN
finefocus-531	127	22	represent	represent	VERB
finefocus-531	127	23	the	the	DET
finefocus-531	127	24	average	average	NOUN
finefocus-531	127	25	of	of	ADP
finefocus-531	127	26	triplicates	triplicate	NOUN
finefocus-531	127	27	(	(	PUNCT
finefocus-531	127	28	standard	standard	ADJ
finefocus-531	127	29	deviation	deviation	NOUN
finefocus-531	127	30	not	not	PART
finefocus-531	127	31	shown	show	VERB
finefocus-531	127	32	)	)	PUNCT
finefocus-531	127	33	.	.	PUNCT
finefocus-531	128	1	28	28	NUM
finefocus-531	128	2	•	•	NUM
finefocus-531	128	3	fine	fine	ADJ
finefocus-531	128	4	focus	focus	NOUN
finefocus-531	128	5	,	,	PUNCT
finefocus-531	128	6	vol	vol	NOUN
finefocus-531	128	7	.	.	PUNCT
finefocus-531	128	8	4(1	4(1	NOUN
finefocus-531	128	9	)	)	PUNCT
finefocus-531	128	10	table	table	NOUN
finefocus-531	128	11	1	1	NUM
finefocus-531	128	12	–	–	PUNCT
finefocus-531	128	13	comparison	comparison	NOUN
finefocus-531	128	14	of	of	ADP
finefocus-531	128	15	biochemical	biochemical	ADJ
finefocus-531	128	16	characteristics	characteristic	NOUN
finefocus-531	128	17	between	between	ADP
finefocus-531	128	18	strain	strain	NOUN
finefocus-531	128	19	cc5c	cc5c	NUM
finefocus-531	128	20	and	and	CCONJ
finefocus-531	128	21	closely	closely	ADV
finefocus-531	128	22	related	relate	VERB
finefocus-531	128	23	species	specie	NOUN
finefocus-531	128	24	.	.	PUNCT
finefocus-531	129	1	strains	strain	NOUN
finefocus-531	129	2	:	:	PUNCT
finefocus-531	129	3	1	1	NUM
finefocus-531	129	4	,	,	PUNCT
finefocus-531	129	5	strain	strain	NOUN
finefocus-531	129	6	cc5c	cc5c	NUM
finefocus-531	130	1	(	(	PUNCT
finefocus-531	130	2	this	this	DET
finefocus-531	130	3	study	study	NOUN
finefocus-531	130	4	)	)	PUNCT
finefocus-531	130	5	;	;	PUNCT
finefocus-531	130	6	2	2	X
finefocus-531	130	7	,	,	PUNCT
finefocus-531	130	8	escherichia	escherichia	VERB
finefocus-531	130	9	marmotae	marmotae	NOUN
finefocus-531	130	10	ht073016	ht073016	PROPN
finefocus-531	130	11	t	t	PROPN
finefocus-531	130	12	;	;	PUNCT
finefocus-531	130	13	3	3	NUM
finefocus-531	130	14	,	,	PUNCT
finefocus-531	130	15	escherichia	escherichia	NOUN
finefocus-531	130	16	coli	coli	NOUN
finefocus-531	130	17	;	;	PUNCT
finefocus-531	130	18	3a	3a	NUM
finefocus-531	130	19	,	,	PUNCT
finefocus-531	130	20	escherichia	escherichia	NOUN
finefocus-531	130	21	coli	coli	NOUN
finefocus-531	130	22	(	(	PUNCT
finefocus-531	130	23	dsm	dsm	PROPN
finefocus-531	130	24	30083	30083	NUM
finefocus-531	130	25	,	,	PUNCT
finefocus-531	130	26	this	this	DET
finefocus-531	130	27	study	study	NOUN
finefocus-531	130	28	)	)	PUNCT
finefocus-531	130	29	,	,	PUNCT
finefocus-531	130	30	4	4	X
finefocus-531	130	31	,	,	PUNCT
finefocus-531	130	32	escherichia	escherichia	NOUN
finefocus-531	130	33	albertii	albertii	PROPN
finefocus-531	130	34	lmg	lmg	PROPN
finefocus-531	130	35	20976	20976	NUM
finefocus-531	130	36	t	t	NOUN
finefocus-531	130	37	;	;	PUNCT
finefocus-531	130	38	5	5	NUM
finefocus-531	130	39	,	,	PUNCT
finefocus-531	130	40	escherichia	escherichia	VERB
finefocus-531	130	41	hermannii	hermannii	ADJ
finefocus-531	130	42	cip	cip	PROPN
finefocus-531	130	43	103176	103176	NUM
finefocus-531	130	44	t	t	NOUN
finefocus-531	130	45	;	;	PUNCT
finefocus-531	130	46	6	6	NUM
finefocus-531	130	47	,	,	PUNCT
finefocus-531	130	48	escherichia	escherichia	NOUN
finefocus-531	130	49	vulneris	vulneris	PROPN
finefocus-531	130	50	atcc	atcc	PROPN
finefocus-531	130	51	33821	33821	NUM
finefocus-531	130	52	t	t	NOUN
finefocus-531	130	53	;	;	PUNCT
finefocus-531	130	54	7	7	NUM
finefocus-531	130	55	,	,	PUNCT
finefocus-531	130	56	shigella	shigella	PROPN
finefocus-531	130	57	dysenteriae	dysenteriae	NOUN
finefocus-531	130	58	;	;	PUNCT
finefocus-531	130	59	8	8	NUM
finefocus-531	130	60	,	,	PUNCT
finefocus-531	130	61	shigella	shigella	PROPN
finefocus-531	130	62	sonnei	sonnei	PROPN
finefocus-531	130	63	.	.	PUNCT
finefocus-531	131	1	data	datum	NOUN
finefocus-531	131	2	for	for	ADP
finefocus-531	131	3	escherichia	escherichia	NOUN
finefocus-531	131	4	spp	spp	NOUN
finefocus-531	131	5	.	.	PUNCT
finefocus-531	132	1	from	from	ADP
finefocus-531	132	2	(	(	PUNCT
finefocus-531	132	3	19	19	NUM
finefocus-531	132	4	)	)	PUNCT
finefocus-531	132	5	and	and	CCONJ
finefocus-531	132	6	(	(	PUNCT
finefocus-531	132	7	17	17	NUM
finefocus-531	132	8	)	)	PUNCT
finefocus-531	132	9	and	and	CCONJ
finefocus-531	132	10	references	reference	NOUN
finefocus-531	132	11	therein	therein	ADV
finefocus-531	132	12	,	,	PUNCT
finefocus-531	132	13	data	datum	NOUN
finefocus-531	132	14	for	for	ADP
finefocus-531	132	15	shigella	shigella	PROPN
finefocus-531	132	16	spp	spp	PROPN
finefocus-531	132	17	.	.	PUNCT
finefocus-531	132	18	is	be	AUX
finefocus-531	132	19	from	from	ADP
finefocus-531	132	20	(	(	PUNCT
finefocus-531	132	21	25	25	NUM
finefocus-531	132	22	)	)	PUNCT
finefocus-531	132	23	.	.	PUNCT
finefocus-531	133	1	a	a	DET
finefocus-531	133	2	onpg	onpg	NOUN
finefocus-531	133	3	,	,	PUNCT
finefocus-531	133	4	o	o	NOUN
finefocus-531	133	5	-	-	ADJ
finefocus-531	133	6	nitrophenyl	nitrophenyl	ADJ
finefocus-531	133	7	-	-	PUNCT
finefocus-531	133	8	β	β	NOUN
finefocus-531	133	9	-	-	NOUN
finefocus-531	133	10	dgalactopyranoside	dgalactopyranoside	ADV
finefocus-531	133	11	;	;	PUNCT
finefocus-531	133	12	b	b	X
finefocus-531	133	13	data	datum	NOUN
finefocus-531	133	14	from	from	ADP
finefocus-531	133	15	(	(	PUNCT
finefocus-531	133	16	29	29	NUM
finefocus-531	133	17	)	)	PUNCT
finefocus-531	133	18	;	;	PUNCT
finefocus-531	134	1	+	+	X
finefocus-531	134	2	,	,	PUNCT
finefocus-531	134	3	more	more	ADJ
finefocus-531	134	4	than	than	ADP
finefocus-531	134	5	90	90	NUM
finefocus-531	134	6	%	%	NOUN
finefocus-531	134	7	of	of	ADP
finefocus-531	134	8	strains	strain	NOUN
finefocus-531	134	9	are	be	AUX
finefocus-531	134	10	positive	positive	ADJ
finefocus-531	134	11	;	;	PUNCT
finefocus-531	134	12	10	10	NUM
finefocus-531	134	13	%	%	NOUN
finefocus-531	134	14	or	or	CCONJ
finefocus-531	134	15	less	less	ADJ
finefocus-531	134	16	of	of	ADP
finefocus-531	134	17	strains	strain	NOUN
finefocus-531	134	18	are	be	AUX
finefocus-531	134	19	positive	positive	ADJ
finefocus-531	134	20	;	;	PUNCT
finefocus-531	134	21	nd	nd	NUM
finefocus-531	134	22	,	,	PUNCT
finefocus-531	134	23	not	not	PART
finefocus-531	134	24	determined	determine	VERB
finefocus-531	134	25	;	;	PUNCT
finefocus-531	134	26	nr	nr	PRON
finefocus-531	134	27	,	,	PUNCT
finefocus-531	134	28	not	not	PART
finefocus-531	134	29	reported	report	VERB
finefocus-531	134	30	;	;	PUNCT
finefocus-531	134	31	d	d	X
finefocus-531	134	32	,	,	PUNCT
finefocus-531	134	33	11	11	NUM
finefocus-531	134	34	-	-	SYM
finefocus-531	134	35	89	89	NUM
finefocus-531	134	36	%	%	NOUN
finefocus-531	134	37	of	of	ADP
finefocus-531	134	38	strains	strain	NOUN
finefocus-531	134	39	are	be	AUX
finefocus-531	134	40	positive	positive	ADJ
finefocus-531	134	41	.	.	PUNCT
finefocus-531	135	1	*	*	PUNCT
finefocus-531	135	2	weak	weak	ADJ
finefocus-531	135	3	growth	growth	NOUN
finefocus-531	135	4	observed	observe	VERB
finefocus-531	135	5	at	at	ADP
finefocus-531	135	6	7	7	NUM
finefocus-531	135	7	%	%	NOUN
finefocus-531	135	8	w	w	NOUN
finefocus-531	135	9	/	/	SYM
finefocus-531	135	10	v	v	NOUN
finefocus-531	135	11	nacl	nacl	NOUN
finefocus-531	135	12	.	.	PUNCT
finefocus-531	136	1	strain	strain	PROPN
finefocus-531	136	2	cc5c	cc5c	PROPN
finefocus-531	136	3	degrades	degrade	VERB
finefocus-531	136	4	a	a	DET
finefocus-531	136	5	variety	variety	NOUN
finefocus-531	136	6	of	of	ADP
finefocus-531	136	7	hexoses	hexose	NOUN
finefocus-531	136	8	,	,	PUNCT
finefocus-531	136	9	pentoses	pentose	NOUN
finefocus-531	136	10	,	,	PUNCT
finefocus-531	136	11	l	l	NOUN
finefocus-531	136	12	-	-	NOUN
finefocus-531	136	13	methylpentoses	methylpentose	NOUN
finefocus-531	136	14	,	,	PUNCT
finefocus-531	136	15	and	and	CCONJ
finefocus-531	136	16	sugar	sugar	NOUN
finefocus-531	136	17	alcohols	alcohol	NOUN
finefocus-531	136	18	as	as	SCONJ
finefocus-531	136	19	summarized	summarize	VERB
finefocus-531	136	20	in	in	ADP
finefocus-531	136	21	(	(	PUNCT
finefocus-531	136	22	supplementary	supplementary	ADJ
finefocus-531	136	23	tables	table	NOUN
finefocus-531	136	24	1	1	NUM
finefocus-531	136	25	-	-	SYM
finefocus-531	136	26	3	3	NUM
finefocus-531	136	27	)	)	PUNCT
finefocus-531	136	28	.	.	PUNCT
finefocus-531	137	1	strain	strain	PROPN
finefocus-531	137	2	cc5c	cc5c	PROPN
finefocus-531	137	3	also	also	ADV
finefocus-531	137	4	has	have	VERB
finefocus-531	137	5	various	various	ADJ
finefocus-531	137	6	enzyme	enzyme	NOUN
finefocus-531	137	7	activities	activity	NOUN
finefocus-531	137	8	including	include	VERB
finefocus-531	137	9	alkaline	alkaline	NOUN
finefocus-531	137	10	and	and	CCONJ
finefocus-531	137	11	acid	acid	ADJ
finefocus-531	137	12	phosphatase	phosphatase	NOUN
finefocus-531	137	13	activity	activity	NOUN
finefocus-531	137	14	as	as	ADV
finefocus-531	137	15	well	well	ADV
finefocus-531	137	16	as	as	ADP
finefocus-531	137	17	c4	c4	NOUN
finefocus-531	137	18	and	and	CCONJ
finefocus-531	137	19	c8	c8	PROPN
finefocus-531	137	20	esterase	esterase	NOUN
finefocus-531	137	21	activity	activity	NOUN
finefocus-531	137	22	the	the	DET
finefocus-531	137	23	substrate	substrate	NOUN
finefocus-531	137	24	spectra	spectra	NOUN
finefocus-531	137	25	of	of	ADP
finefocus-531	137	26	cc5c	cc5c	PROPN
finefocus-531	137	27	was	be	AUX
finefocus-531	137	28	evaluated	evaluate	VERB
finefocus-531	137	29	using	use	VERB
finefocus-531	137	30	api	api	NOUN
finefocus-531	137	31	test	test	NOUN
finefocus-531	137	32	panels	panel	NOUN
finefocus-531	137	33	in	in	ADP
finefocus-531	137	34	parallel	parallel	NOUN
finefocus-531	137	35	with	with	ADP
finefocus-531	137	36	the	the	DET
finefocus-531	137	37	type	type	NOUN
finefocus-531	137	38	strain	strain	NOUN
finefocus-531	137	39	of	of	ADP
finefocus-531	137	40	e.	e.	PROPN
finefocus-531	137	41	coli	coli	PROPN
finefocus-531	137	42	(	(	PUNCT
finefocus-531	137	43	dsm	dsm	PROPN
finefocus-531	137	44	30083	30083	NUM
finefocus-531	137	45	)	)	PUNCT
finefocus-531	137	46	;	;	PUNCT
finefocus-531	137	47	results	result	NOUN
finefocus-531	137	48	for	for	ADP
finefocus-531	137	49	(	(	PUNCT
finefocus-531	137	50	supplementary	supplementary	ADJ
finefocus-531	137	51	table	table	NOUN
finefocus-531	137	52	4	4	NUM
finefocus-531	137	53	)	)	PUNCT
finefocus-531	137	54	.	.	PUNCT
finefocus-531	138	1	additionally	additionally	ADV
finefocus-531	138	2	,	,	PUNCT
finefocus-531	138	3	strain	strain	NOUN
finefocus-531	138	4	cc5c	cc5c	PROPN
finefocus-531	138	5	degrades	degrade	VERB
finefocus-531	138	6	starch	starch	NOUN
finefocus-531	138	7	,	,	PUNCT
finefocus-531	138	8	casein	casein	NOUN
finefocus-531	138	9	,	,	PUNCT
finefocus-531	138	10	and	and	CCONJ
finefocus-531	138	11	β	β	X
finefocus-531	138	12	-	-	NOUN
finefocus-531	138	13	glucan	glucan	NOUN
finefocus-531	138	14	,	,	PUNCT
finefocus-531	138	15	a	a	DET
finefocus-531	138	16	weak	weak	ADJ
finefocus-531	138	17	positive	positive	ADJ
finefocus-531	138	18	reaction	reaction	NOUN
finefocus-531	138	19	on	on	ADP
finefocus-531	138	20	chitin	chitin	NOUN
finefocus-531	138	21	,	,	PUNCT
finefocus-531	138	22	but	but	CCONJ
finefocus-531	138	23	does	do	AUX
finefocus-531	138	24	not	not	PART
finefocus-531	138	25	degrade	degrade	VERB
finefocus-531	138	26	cellulose	cellulose	NOUN
finefocus-531	138	27	or	or	CCONJ
finefocus-531	138	28	xylan	xylan	PROPN
finefocus-531	138	29	.	.	PUNCT
finefocus-531	139	1	strain	strain	PROPN
finefocus-531	139	2	cc5c	cc5c	NUM
finefocus-531	139	3	solubilizes	solubilize	VERB
finefocus-531	139	4	phosphate	phosphate	ADJ
finefocus-531	139	5	on	on	ADP
finefocus-531	139	6	plates	plate	NOUN
finefocus-531	139	7	containing	contain	VERB
finefocus-531	139	8	inorganic	inorganic	ADJ
finefocus-531	139	9	phosphate	phosphate	NOUN
finefocus-531	139	10	.	.	PUNCT
finefocus-531	140	1	commonly	commonly	ADV
finefocus-531	140	2	used	use	VERB
finefocus-531	140	3	taxonomic	taxonomic	ADJ
finefocus-531	140	4	features	feature	NOUN
finefocus-531	140	5	of	of	ADP
finefocus-531	140	6	closely	closely	ADV
finefocus-531	140	7	related	relate	VERB
finefocus-531	140	8	escherichia	escherichia	NOUN
finefocus-531	140	9	and	and	CCONJ
finefocus-531	140	10	shigella	shigella	PROPN
finefocus-531	140	11	type	type	NOUN
finefocus-531	140	12	strains	strain	NOUN
finefocus-531	140	13	are	be	AUX
finefocus-531	140	14	presented	present	VERB
finefocus-531	140	15	in	in	ADP
finefocus-531	140	16	table	table	NOUN
finefocus-531	140	17	1	1	NUM
finefocus-531	140	18	.	.	PUNCT
finefocus-531	141	1	29applied	29applied	PROPN
finefocus-531	141	2	&	&	CCONJ
finefocus-531	141	3	environmental	environmental	ADJ
finefocus-531	141	4	microbiology	microbiology	NOUN
finefocus-531	141	5	•	•	NOUN
finefocus-531	141	6	30	30	NUM
finefocus-531	141	7	•	•	NUM
finefocus-531	141	8	fine	fine	ADJ
finefocus-531	141	9	focus	focus	NOUN
finefocus-531	141	10	,	,	PUNCT
finefocus-531	141	11	vol	vol	NOUN
finefocus-531	141	12	.	.	PUNCT
finefocus-531	141	13	4(1	4(1	NOUN
finefocus-531	141	14	)	)	PUNCT
finefocus-531	141	15	figure	figure	VERB
finefocus-531	141	16	3	3	NUM
finefocus-531	141	17	end	end	NOUN
finefocus-531	141	18	products	product	NOUN
finefocus-531	141	19	of	of	ADP
finefocus-531	141	20	selected	select	VERB
finefocus-531	141	21	substrates	substrate	NOUN
finefocus-531	141	22	after	after	ADP
finefocus-531	141	23	fermentation	fermentation	NOUN
finefocus-531	141	24	by	by	ADP
finefocus-531	141	25	strain	strain	NOUN
finefocus-531	141	26	cc5c	cc5c	NUM
finefocus-531	141	27	grown	grow	VERB
finefocus-531	141	28	under	under	ADP
finefocus-531	141	29	anaerobic	anaerobic	ADJ
finefocus-531	141	30	conditions	condition	NOUN
finefocus-531	141	31	;	;	PUNCT
finefocus-531	141	32	initial	initial	ADJ
finefocus-531	141	33	concentrations	concentration	NOUN
finefocus-531	141	34	were	be	AUX
finefocus-531	141	35	20	20	NUM
finefocus-531	141	36	mm	mm	NOUN
finefocus-531	141	37	for	for	ADP
finefocus-531	141	38	monosaccharides	monosaccharide	NOUN
finefocus-531	141	39	and	and	CCONJ
finefocus-531	141	40	organic	organic	ADJ
finefocus-531	141	41	acids	acid	NOUN
finefocus-531	141	42	and	and	CCONJ
finefocus-531	141	43	polyalcohols	polyalcohol	NOUN
finefocus-531	141	44	,	,	PUNCT
finefocus-531	141	45	10	10	NUM
finefocus-531	141	46	mm	mm	NOUN
finefocus-531	141	47	for	for	ADP
finefocus-531	141	48	dissacharides	dissacharide	NOUN
finefocus-531	141	49	,	,	PUNCT
finefocus-531	141	50	and	and	CCONJ
finefocus-531	141	51	0.2	0.2	NUM
finefocus-531	141	52	%	%	NOUN
finefocus-531	141	53	w	w	NOUN
finefocus-531	141	54	/	/	SYM
finefocus-531	141	55	v	v	NOUN
finefocus-531	141	56	for	for	ADP
finefocus-531	141	57	polymers	polymer	NOUN
finefocus-531	141	58	.	.	PUNCT
finefocus-531	142	1	values	value	NOUN
finefocus-531	142	2	represent	represent	VERB
finefocus-531	142	3	the	the	DET
finefocus-531	142	4	average	average	NOUN
finefocus-531	142	5	of	of	ADP
finefocus-531	142	6	triplicates	triplicate	NOUN
finefocus-531	142	7	;	;	PUNCT
finefocus-531	142	8	standard	standard	ADJ
finefocus-531	142	9	deviation	deviation	NOUN
finefocus-531	142	10	is	be	AUX
finefocus-531	142	11	not	not	PART
finefocus-531	142	12	shown	show	VERB
finefocus-531	142	13	.	.	PUNCT
finefocus-531	143	1	3.3	3.3	NUM
finefocus-531	143	2	fermentation	fermentation	NOUN
finefocus-531	143	3	of	of	ADP
finefocus-531	143	4	single	single	ADJ
finefocus-531	143	5	substrates	substrate	NOUN
finefocus-531	143	6	single	single	ADJ
finefocus-531	143	7	substrates	substrate	NOUN
finefocus-531	143	8	and	and	CCONJ
finefocus-531	143	9	polymers	polymer	NOUN
finefocus-531	143	10	present	present	ADJ
finefocus-531	143	11	in	in	ADP
finefocus-531	143	12	various	various	ADJ
finefocus-531	143	13	terrestrial	terrestrial	ADJ
finefocus-531	143	14	and	and	CCONJ
finefocus-531	143	15	marine	marine	ADJ
finefocus-531	143	16	biomass	biomass	NOUN
finefocus-531	143	17	were	be	AUX
finefocus-531	143	18	examined	examine	VERB
finefocus-531	143	19	in	in	ADP
finefocus-531	143	20	anaerobic	anaerobic	ADJ
finefocus-531	143	21	batch	batch	NOUN
finefocus-531	143	22	culture	culture	NOUN
finefocus-531	143	23	.	.	PUNCT
finefocus-531	144	1	hexoses	hexose	NOUN
finefocus-531	144	2	,	,	PUNCT
finefocus-531	144	3	pentoses	pentose	NOUN
finefocus-531	144	4	,	,	PUNCT
finefocus-531	144	5	disaccharides	disaccharide	NOUN
finefocus-531	144	6	except	except	SCONJ
finefocus-531	144	7	cellobiose	cellobiose	NOUN
finefocus-531	144	8	,	,	PUNCT
finefocus-531	144	9	and	and	CCONJ
finefocus-531	144	10	starch	starch	NOUN
finefocus-531	144	11	gave	give	VERB
finefocus-531	144	12	a	a	DET
finefocus-531	144	13	mixture	mixture	NOUN
finefocus-531	144	14	of	of	ADP
finefocus-531	144	15	end	end	NOUN
finefocus-531	144	16	products	product	NOUN
finefocus-531	144	17	consisting	consist	VERB
finefocus-531	144	18	of	of	ADP
finefocus-531	144	19	ethanol	ethanol	NOUN
finefocus-531	144	20	,	,	PUNCT
finefocus-531	144	21	acetate	acetate	NOUN
finefocus-531	144	22	,	,	PUNCT
finefocus-531	144	23	lactate	lactate	NOUN
finefocus-531	144	24	,	,	PUNCT
finefocus-531	144	25	and	and	CCONJ
finefocus-531	144	26	hydrogen	hydrogen	NOUN
finefocus-531	144	27	.	.	PUNCT
finefocus-531	145	1	the	the	DET
finefocus-531	145	2	sugar	sugar	NOUN
finefocus-531	145	3	alcohols	alcohol	NOUN
finefocus-531	145	4	(	(	PUNCT
finefocus-531	145	5	mannitol	mannitol	NOUN
finefocus-531	145	6	and	and	CCONJ
finefocus-531	145	7	xylitol	xylitol	NOUN
finefocus-531	145	8	)	)	PUNCT
finefocus-531	145	9	yielded	yield	VERB
finefocus-531	145	10	ethanol	ethanol	NOUN
finefocus-531	145	11	as	as	ADP
finefocus-531	145	12	a	a	DET
finefocus-531	145	13	major	major	ADJ
finefocus-531	145	14	end	end	NOUN
finefocus-531	145	15	product	product	NOUN
finefocus-531	145	16	with	with	ADP
finefocus-531	145	17	traces	trace	NOUN
finefocus-531	145	18	of	of	ADP
finefocus-531	145	19	acetate	acetate	NOUN
finefocus-531	145	20	,	,	PUNCT
finefocus-531	145	21	lactate	lactate	NOUN
finefocus-531	145	22	,	,	PUNCT
finefocus-531	145	23	and	and	CCONJ
finefocus-531	145	24	hydrogen	hydrogen	NOUN
finefocus-531	145	25	.	.	PUNCT
finefocus-531	145	26	strain	strain	NOUN
finefocus-531	145	27	cc5c	cc5c	NUM
finefocus-531	145	28	fermented	ferment	VERB
finefocus-531	145	29	methylpentoses	methylpentose	NOUN
finefocus-531	145	30	(	(	PUNCT
finefocus-531	145	31	l	l	NOUN
finefocus-531	145	32	-	-	NOUN
finefocus-531	145	33	fucose	fucose	NOUN
finefocus-531	145	34	and	and	CCONJ
finefocus-531	145	35	l	l	NOUN
finefocus-531	145	36	-	-	VERB
finefocus-531	145	37	rhamnose	rhamnose	NOUN
finefocus-531	145	38	)	)	PUNCT
finefocus-531	145	39	and	and	CCONJ
finefocus-531	145	40	yielded	yield	VERB
finefocus-531	145	41	1,2	1,2	NUM
finefocus-531	145	42	-	-	NOUN
finefocus-531	145	43	propanediol	propanediol	NOUN
finefocus-531	145	44	as	as	ADP
finefocus-531	145	45	the	the	DET
finefocus-531	145	46	dominant	dominant	ADJ
finefocus-531	145	47	end	end	NOUN
finefocus-531	145	48	product	product	NOUN
finefocus-531	145	49	with	with	ADP
finefocus-531	145	50	acetate	acetate	NOUN
finefocus-531	145	51	and	and	CCONJ
finefocus-531	145	52	lactate	lactate	NOUN
finefocus-531	145	53	present	present	ADJ
finefocus-531	145	54	in	in	ADP
finefocus-531	145	55	lower	low	ADJ
finefocus-531	145	56	concentrations	concentration	NOUN
finefocus-531	145	57	.	.	PUNCT
finefocus-531	146	1	laminarin	laminarin	PROPN
finefocus-531	146	2	,	,	PUNCT
finefocus-531	146	3	a	a	DET
finefocus-531	146	4	β-1,3	β-1,3	PROPN
finefocus-531	146	5	glycan	glycan	NOUN
finefocus-531	146	6	,	,	PUNCT
finefocus-531	146	7	yielded	yield	VERB
finefocus-531	146	8	acetate	acetate	NOUN
finefocus-531	146	9	and	and	CCONJ
finefocus-531	146	10	lactate	lactate	NOUN
finefocus-531	146	11	above	above	ADP
finefocus-531	146	12	controls	control	NOUN
finefocus-531	146	13	while	while	SCONJ
finefocus-531	146	14	other	other	ADJ
finefocus-531	146	15	polymers	polymer	NOUN
finefocus-531	146	16	,	,	PUNCT
finefocus-531	146	17	the	the	DET
finefocus-531	146	18	end	end	NOUN
finefocus-531	146	19	product	product	NOUN
finefocus-531	146	20	formation	formation	NOUN
finefocus-531	146	21	patterns	pattern	NOUN
finefocus-531	146	22	,	,	PUNCT
finefocus-531	146	23	from	from	ADP
finefocus-531	146	24	various	various	ADJ
finefocus-531	146	25	substrates	substrate	NOUN
finefocus-531	146	26	,	,	PUNCT
finefocus-531	146	27	were	be	AUX
finefocus-531	146	28	evaluated	evaluate	VERB
finefocus-531	146	29	,	,	PUNCT
finefocus-531	146	30	and	and	CCONJ
finefocus-531	146	31	is	be	AUX
finefocus-531	146	32	presented	present	VERB
finefocus-531	146	33	for	for	ADP
finefocus-531	146	34	each	each	DET
finefocus-531	146	35	individual	individual	ADJ
finefocus-531	146	36	substrate	substrate	NOUN
finefocus-531	146	37	in	in	ADP
finefocus-531	146	38	figure	figure	NOUN
finefocus-531	146	39	3	3	NUM
finefocus-531	146	40	.	.	NOUN
finefocus-531	147	1	1,2	1,2	NUM
finefocus-531	147	2	-	-	NOUN
finefocus-531	147	3	propanediol	propanediol	NOUN
finefocus-531	147	4	was	be	AUX
finefocus-531	147	5	only	only	ADV
finefocus-531	147	6	observed	observe	VERB
finefocus-531	147	7	as	as	ADP
finefocus-531	147	8	a	a	DET
finefocus-531	147	9	fermentation	fermentation	NOUN
finefocus-531	147	10	product	product	NOUN
finefocus-531	147	11	when	when	SCONJ
finefocus-531	147	12	l	l	NOUN
finefocus-531	147	13	-	-	NOUN
finefocus-531	147	14	fucose	fucose	NOUN
finefocus-531	147	15	and	and	CCONJ
finefocus-531	147	16	l	l	NOUN
finefocus-531	147	17	-	-	PUNCT
finefocus-531	147	18	rhamnose	rhamnose	NOUN
finefocus-531	147	19	were	be	AUX
finefocus-531	147	20	used	use	VERB
finefocus-531	147	21	as	as	ADP
finefocus-531	147	22	substrates	substrate	NOUN
finefocus-531	147	23	.	.	PUNCT
finefocus-531	148	1	lactate	lactate	NOUN
finefocus-531	148	2	,	,	PUNCT
finefocus-531	148	3	and	and	CCONJ
finefocus-531	148	4	rac-1,2	rac-1,2	NOUN
finefocus-531	148	5	-	-	PUNCT
finefocus-531	148	6	pd	pd	PROPN
finefocus-531	148	7	were	be	AUX
finefocus-531	148	8	not	not	PART
finefocus-531	148	9	degraded	degrade	VERB
finefocus-531	148	10	.	.	PUNCT
finefocus-531	149	1	3.4	3.4	NUM
finefocus-531	149	2	effect	effect	NOUN
finefocus-531	149	3	of	of	ADP
finefocus-531	149	4	initial	initial	ADJ
finefocus-531	149	5	substrate	substrate	NOUN
finefocus-531	149	6	concentration	concentration	NOUN
finefocus-531	149	7	and	and	CCONJ
finefocus-531	149	8	oxygen	oxygen	NOUN
finefocus-531	149	9	on	on	ADP
finefocus-531	149	10	1,2	1,2	NUM
finefocus-531	149	11	-	-	PUNCT
finefocus-531	149	12	propanediol	propanediol	NOUN
finefocus-531	149	13	yields	yield	NOUN
finefocus-531	149	14	to	to	PART
finefocus-531	149	15	investigate	investigate	VERB
finefocus-531	149	16	the	the	DET
finefocus-531	149	17	production	production	NOUN
finefocus-531	149	18	of	of	ADP
finefocus-531	149	19	1,2	1,2	NUM
finefocus-531	149	20	-	-	NOUN
finefocus-531	149	21	propanediol	propanediol	NOUN
finefocus-531	149	22	by	by	ADP
finefocus-531	149	23	strain	strain	NOUN
finefocus-531	149	24	cc5c	cc5c	PROPN
finefocus-531	149	25	,	,	PUNCT
finefocus-531	149	26	the	the	DET
finefocus-531	149	27	strain	strain	NOUN
finefocus-531	149	28	was	be	AUX
finefocus-531	149	29	evaluated	evaluate	VERB
finefocus-531	149	30	at	at	ADP
finefocus-531	149	31	different	different	ADJ
finefocus-531	149	32	initial	initial	ADJ
finefocus-531	149	33	substrate	substrate	NOUN
finefocus-531	149	34	concentrations	concentration	NOUN
finefocus-531	149	35	up	up	ADP
finefocus-531	149	36	to	to	PART
finefocus-531	149	37	60	60	NUM
finefocus-531	149	38	mm	mm	NOUN
finefocus-531	149	39	on	on	ADP
finefocus-531	149	40	d	d	NOUN
finefocus-531	149	41	-	-	NOUN
finefocus-531	149	42	glucose	glucose	NOUN
finefocus-531	149	43	,	,	PUNCT
finefocus-531	149	44	l	l	NOUN
finefocus-531	149	45	-	-	NOUN
finefocus-531	149	46	fucose	fucose	NOUN
finefocus-531	149	47	,	,	PUNCT
finefocus-531	149	48	and	and	CCONJ
finefocus-531	149	49	l	l	NOUN
finefocus-531	149	50	-	-	PUNCT
finefocus-531	149	51	rhamnose	rhamnose	NOUN
finefocus-531	149	52	under	under	ADP
finefocus-531	149	53	both	both	CCONJ
finefocus-531	149	54	aerobic	aerobic	ADJ
finefocus-531	149	55	and	and	CCONJ
finefocus-531	149	56	anaerobic	anaerobic	ADJ
finefocus-531	149	57	conditions	condition	NOUN
finefocus-531	149	58	.	.	PUNCT
finefocus-531	150	1	31applied	31applie	VERB
finefocus-531	150	2	&	&	CCONJ
finefocus-531	150	3	environmental	environmental	ADJ
finefocus-531	150	4	microbiology	microbiology	NOUN
finefocus-531	150	5	•	•	NOUN
finefocus-531	150	6	figure	figure	NOUN
finefocus-531	150	7	4	4	NUM
finefocus-531	150	8	end	end	NOUN
finefocus-531	150	9	product	product	NOUN
finefocus-531	150	10	formation	formation	NOUN
finefocus-531	150	11	of	of	ADP
finefocus-531	150	12	strain	strain	NOUN
finefocus-531	150	13	cc5c	cc5c	PROPN
finefocus-531	150	14	on	on	ADP
finefocus-531	150	15	glucose	glucose	NOUN
finefocus-531	150	16	,	,	PUNCT
finefocus-531	150	17	l	l	NOUN
finefocus-531	150	18	-	-	PUNCT
finefocus-531	150	19	rhamnose	rhamnose	NOUN
finefocus-531	150	20	,	,	PUNCT
finefocus-531	150	21	and	and	CCONJ
finefocus-531	150	22	l	l	NOUN
finefocus-531	150	23	-	-	NOUN
finefocus-531	150	24	fucose	fucose	ADJ
finefocus-531	150	25	under	under	ADP
finefocus-531	150	26	aerobic	aerobic	ADJ
finefocus-531	150	27	(	(	PUNCT
finefocus-531	150	28	a	a	NOUN
finefocus-531	150	29	)	)	PUNCT
finefocus-531	150	30	and	and	CCONJ
finefocus-531	150	31	anaerobic	anaerobic	NOUN
finefocus-531	150	32	(	(	PUNCT
finefocus-531	150	33	b	b	NOUN
finefocus-531	150	34	)	)	PUNCT
finefocus-531	150	35	conditions	condition	NOUN
finefocus-531	150	36	.	.	PUNCT
finefocus-531	151	1	values	value	NOUN
finefocus-531	151	2	represent	represent	VERB
finefocus-531	151	3	the	the	DET
finefocus-531	151	4	average	average	NOUN
finefocus-531	151	5	of	of	ADP
finefocus-531	151	6	triplicates	triplicate	NOUN
finefocus-531	151	7	with	with	ADP
finefocus-531	151	8	standard	standard	ADJ
finefocus-531	151	9	deviation	deviation	NOUN
finefocus-531	151	10	shown	show	VERB
finefocus-531	151	11	as	as	ADP
finefocus-531	151	12	error	error	NOUN
finefocus-531	151	13	bars	bar	NOUN
finefocus-531	151	14	.	.	PUNCT
finefocus-531	152	1	end	end	NOUN
finefocus-531	152	2	products	product	NOUN
finefocus-531	152	3	were	be	AUX
finefocus-531	152	4	evaluated	evaluate	VERB
finefocus-531	152	5	after	after	ADP
finefocus-531	152	6	5	5	NUM
finefocus-531	152	7	days	day	NOUN
finefocus-531	152	8	of	of	ADP
finefocus-531	152	9	incubation	incubation	NOUN
finefocus-531	152	10	as	as	SCONJ
finefocus-531	152	11	shown	show	VERB
finefocus-531	152	12	in	in	ADP
finefocus-531	152	13	figure	figure	NOUN
finefocus-531	152	14	4	4	NUM
finefocus-531	152	15	for	for	ADP
finefocus-531	152	16	both	both	CCONJ
finefocus-531	152	17	aerobic	aerobic	ADJ
finefocus-531	152	18	(	(	PUNCT
finefocus-531	152	19	4a	4a	NUM
finefocus-531	152	20	)	)	PUNCT
finefocus-531	152	21	and	and	CCONJ
finefocus-531	152	22	anaerobic	anaerobic	NOUN
finefocus-531	152	23	conditions	condition	NOUN
finefocus-531	152	24	(	(	PUNCT
finefocus-531	152	25	4b	4b	PROPN
finefocus-531	152	26	)	)	PUNCT
finefocus-531	152	27	.	.	PUNCT
finefocus-531	153	1	substrate	substrate	NOUN
finefocus-531	153	2	inhibition	inhibition	NOUN
finefocus-531	153	3	was	be	AUX
finefocus-531	153	4	observed	observe	VERB
finefocus-531	153	5	on	on	ADP
finefocus-531	153	6	all	all	DET
finefocus-531	153	7	substrates	substrate	NOUN
finefocus-531	153	8	at	at	ADP
finefocus-531	153	9	concentrations	concentration	NOUN
finefocus-531	153	10	greater	great	ADJ
finefocus-531	153	11	than	than	ADP
finefocus-531	153	12	20	20	NUM
finefocus-531	153	13	mm	mm	NOUN
finefocus-531	153	14	as	as	SCONJ
finefocus-531	153	15	evidenced	evidence	VERB
finefocus-531	153	16	by	by	ADP
finefocus-531	153	17	the	the	DET
finefocus-531	153	18	decreased	decrease	VERB
finefocus-531	153	19	substrate	substrate	NOUN
finefocus-531	153	20	utilization	utilization	NOUN
finefocus-531	153	21	and	and	CCONJ
finefocus-531	153	22	levelling	levelling	NOUN
finefocus-531	153	23	off	off	ADP
finefocus-531	153	24	of	of	ADP
finefocus-531	153	25	end	end	NOUN
finefocus-531	153	26	product	product	NOUN
finefocus-531	153	27	formation	formation	NOUN
finefocus-531	153	28	.	.	PUNCT
finefocus-531	154	1	32	32	NUM
finefocus-531	154	2	•	•	NUM
finefocus-531	154	3	fine	fine	ADJ
finefocus-531	154	4	focus	focus	NOUN
finefocus-531	154	5	,	,	PUNCT
finefocus-531	154	6	vol	vol	NOUN
finefocus-531	154	7	.	.	PUNCT
finefocus-531	154	8	4(1	4(1	NOUN
finefocus-531	154	9	)	)	PUNCT
finefocus-531	154	10	a	a	DET
finefocus-531	154	11	nm	nm	NOUN
finefocus-531	154	12	)	)	PUNCT
finefocus-531	154	13	figure	figure	NOUN
finefocus-531	154	14	5	5	NUM
finefocus-531	154	15	–	–	PUNCT
finefocus-531	154	16	utilization	utilization	NOUN
finefocus-531	154	17	of	of	ADP
finefocus-531	154	18	selected	select	VERB
finefocus-531	154	19	substrates	substrate	NOUN
finefocus-531	154	20	over	over	ADP
finefocus-531	154	21	time	time	NOUN
finefocus-531	154	22	by	by	ADP
finefocus-531	154	23	strain	strain	NOUN
finefocus-531	154	24	cc5c	cc5c	PROPN
finefocus-531	154	25	.	.	PUNCT
finefocus-531	155	1	values	value	NOUN
finefocus-531	155	2	represent	represent	VERB
finefocus-531	155	3	the	the	DET
finefocus-531	155	4	average	average	NOUN
finefocus-531	155	5	of	of	ADP
finefocus-531	155	6	triplicates	triplicate	NOUN
finefocus-531	155	7	with	with	ADP
finefocus-531	155	8	standard	standard	ADJ
finefocus-531	155	9	deviation	deviation	NOUN
finefocus-531	155	10	presented	present	VERB
finefocus-531	155	11	as	as	ADP
finefocus-531	155	12	error	error	NOUN
finefocus-531	155	13	bars	bar	NOUN
finefocus-531	155	14	.	.	PUNCT
finefocus-531	156	1	a	a	DET
finefocus-531	156	2	:	:	SYM
finefocus-531	156	3	20	20	NUM
finefocus-531	156	4	mm	mm	NOUN
finefocus-531	156	5	glucose	glucose	NOUN
finefocus-531	156	6	,	,	PUNCT
finefocus-531	156	7	b	b	NOUN
finefocus-531	156	8	:	:	PUNCT
finefocus-531	156	9	20	20	NUM
finefocus-531	156	10	mm	mm	NOUN
finefocus-531	156	11	l	l	NOUN
finefocus-531	156	12	-	-	NOUN
finefocus-531	156	13	rhamnose	rhamnose	ADJ
finefocus-531	156	14	,	,	PUNCT
finefocus-531	156	15	c	c	NOUN
finefocus-531	156	16	:	:	PUNCT
finefocus-531	156	17	20	20	NUM
finefocus-531	156	18	mm	mm	NOUN
finefocus-531	156	19	glucose	glucose	NOUN
finefocus-531	156	20	and	and	CCONJ
finefocus-531	156	21	20	20	NUM
finefocus-531	156	22	mm	mm	NUM
finefocus-531	156	23	l	l	NOUN
finefocus-531	156	24	-	-	NOUN
finefocus-531	156	25	rhamnose	rhamnose	NOUN
finefocus-531	156	26	,	,	PUNCT
finefocus-531	156	27	d	d	NOUN
finefocus-531	156	28	:	:	PUNCT
finefocus-531	156	29	20	20	NUM
finefocus-531	156	30	mm	mm	NOUN
finefocus-531	156	31	rac-1,2	rac-1,2	NOUN
finefocus-531	156	32	-	-	PUNCT
finefocus-531	156	33	propanediol	propanediol	NOUN
finefocus-531	156	34	;	;	PUNCT
finefocus-531	156	35	■	■	PUNCT
finefocus-531	156	36	–	–	PUNCT
finefocus-531	156	37	1,2	1,2	NUM
finefocus-531	156	38	-	-	NOUN
finefocus-531	156	39	propanediol	propanediol	NOUN
finefocus-531	156	40	,	,	PUNCT
finefocus-531	156	41	♦	♦	PROPN
finefocus-531	156	42	optical	optical	ADJ
finefocus-531	156	43	density	density	NOUN
finefocus-531	156	44	(	(	PUNCT
finefocus-531	156	45	600	600	NUM
finefocus-531	156	46	nm	nm	NOUN
finefocus-531	156	47	)	)	PUNCT
finefocus-531	156	48	.	.	PUNCT
finefocus-531	157	1	3.5	3.5	NUM
finefocus-531	157	2	kinetic	kinetic	ADJ
finefocus-531	157	3	experiments	experiment	NOUN
finefocus-531	157	4	kinetic	kinetic	ADJ
finefocus-531	157	5	experiments	experiment	NOUN
finefocus-531	157	6	were	be	AUX
finefocus-531	157	7	performed	perform	VERB
finefocus-531	157	8	aerobically	aerobically	ADV
finefocus-531	157	9	on	on	ADP
finefocus-531	157	10	20	20	NUM
finefocus-531	157	11	mm	mm	NOUN
finefocus-531	157	12	of	of	ADP
finefocus-531	157	13	d	d	PROPN
finefocus-531	157	14	-	-	NOUN
finefocus-531	157	15	glucose	glucose	NOUN
finefocus-531	157	16	,	,	PUNCT
finefocus-531	157	17	l	l	NOUN
finefocus-531	157	18	-	-	PUNCT
finefocus-531	157	19	rhamnose	rhamnose	ADJ
finefocus-531	157	20	,	,	PUNCT
finefocus-531	157	21	l	l	NOUN
finefocus-531	157	22	-	-	NOUN
finefocus-531	157	23	fucose	fucose	NOUN
finefocus-531	157	24	,	,	PUNCT
finefocus-531	157	25	a	a	DET
finefocus-531	157	26	mixture	mixture	NOUN
finefocus-531	157	27	of	of	ADP
finefocus-531	157	28	d	d	NOUN
finefocus-531	157	29	-	-	NOUN
finefocus-531	157	30	glucose	glucose	NOUN
finefocus-531	157	31	and	and	CCONJ
finefocus-531	157	32	l	l	NOUN
finefocus-531	157	33	-	-	VERB
finefocus-531	157	34	rhamnose	rhamnose	ADJ
finefocus-531	157	35	(	(	PUNCT
finefocus-531	157	36	20	20	NUM
finefocus-531	157	37	mm	mm	NOUN
finefocus-531	157	38	each	each	PRON
finefocus-531	157	39	)	)	PUNCT
finefocus-531	157	40	,	,	PUNCT
finefocus-531	157	41	and	and	CCONJ
finefocus-531	157	42	20	20	NUM
finefocus-531	157	43	mm	mm	NOUN
finefocus-531	157	44	of	of	ADP
finefocus-531	157	45	rac-1,2	rac-1,2	NOUN
finefocus-531	157	46	-	-	PUNCT
finefocus-531	157	47	propanediol	propanediol	NOUN
finefocus-531	157	48	as	as	SCONJ
finefocus-531	157	49	shown	show	VERB
finefocus-531	157	50	in	in	ADP
finefocus-531	157	51	figure	figure	NOUN
finefocus-531	157	52	5a	5a	NUM
finefocus-531	157	53	-	-	SYM
finefocus-531	157	54	d	d	NOUN
finefocus-531	157	55	,	,	PUNCT
finefocus-531	157	56	as	as	ADV
finefocus-531	157	57	well	well	ADV
finefocus-531	157	58	as	as	ADP
finefocus-531	157	59	a	a	DET
finefocus-531	157	60	control	control	NOUN
finefocus-531	157	61	containing	contain	VERB
finefocus-531	157	62	only	only	ADV
finefocus-531	157	63	yeast	yeast	NOUN
finefocus-531	157	64	extract	extract	NOUN
finefocus-531	157	65	.	.	PUNCT
finefocus-531	158	1	the	the	DET
finefocus-531	158	2	fermentation	fermentation	NOUN
finefocus-531	158	3	characteristics	characteristic	NOUN
finefocus-531	158	4	for	for	ADP
finefocus-531	158	5	the	the	DET
finefocus-531	158	6	production	production	NOUN
finefocus-531	158	7	of	of	ADP
finefocus-531	158	8	1,2	1,2	NUM
finefocus-531	158	9	-	-	SYM
finefocus-531	158	10	pd	pd	NOUN
finefocus-531	158	11	are	be	AUX
finefocus-531	158	12	summarized	summarize	VERB
finefocus-531	158	13	in	in	ADP
finefocus-531	158	14	table	table	NOUN
finefocus-531	158	15	2	2	NUM
finefocus-531	158	16	.	.	PUNCT
finefocus-531	158	17	table	table	NOUN
finefocus-531	158	18	2	2	NUM
finefocus-531	158	19	–	–	PUNCT
finefocus-531	158	20	fermentation	fermentation	NOUN
finefocus-531	158	21	characteristics	characteristic	NOUN
finefocus-531	158	22	of	of	ADP
finefocus-531	158	23	1,2	1,2	NUM
finefocus-531	158	24	propanediol	propanediol	NOUN
finefocus-531	158	25	production	production	NOUN
finefocus-531	158	26	on	on	ADP
finefocus-531	158	27	selected	select	VERB
finefocus-531	158	28	substrates	substrate	NOUN
finefocus-531	158	29	substrate	substrate	NOUN
finefocus-531	158	30	(	(	PUNCT
finefocus-531	158	31	20	20	NUM
finefocus-531	158	32	mm	mm	NOUN
finefocus-531	158	33	)	)	PUNCT
finefocus-531	158	34	maximum	maximum	ADJ
finefocus-531	158	35	1,2	1,2	NUM
finefocus-531	158	36	-	-	PUNCT
finefocus-531	158	37	pd	pd	NOUN
finefocus-531	158	38	yield	yield	NOUN
finefocus-531	158	39	maximum	maximum	ADJ
finefocus-531	158	40	1,2	1,2	NUM
finefocus-531	158	41	-	-	PUNCT
finefocus-531	158	42	pd	pd	NOUN
finefocus-531	158	43	production	production	NOUN
finefocus-531	158	44	rate	rate	NOUN
finefocus-531	158	45	(	(	PUNCT
finefocus-531	158	46	%	%	NOUN
finefocus-531	158	47	of	of	ADP
finefocus-531	158	48	theoretical	theoretical	ADJ
finefocus-531	158	49	)	)	PUNCT
finefocus-531	158	50	(	(	PUNCT
finefocus-531	158	51	mmol	mmol	NOUN
finefocus-531	158	52	/	/	SYM
finefocus-531	158	53	hr	hr	NOUN
finefocus-531	158	54	)	)	PUNCT
finefocus-531	158	55	d	d	NOUN
finefocus-531	158	56	-	-	PUNCT
finefocus-531	158	57	glucose	glucose	NOUN
finefocus-531	158	58	9.93	9.93	NUM
finefocus-531	158	59	0.99	0.99	NUM
finefocus-531	158	60	l	l	NOUN
finefocus-531	158	61	-	-	PUNCT
finefocus-531	158	62	rhamnose	rhamnose	VERB
finefocus-531	158	63	96.89	96.89	NUM
finefocus-531	158	64	3.41	3.41	NUM
finefocus-531	158	65	glucose	glucose	NOUN
finefocus-531	158	66	+	+	CCONJ
finefocus-531	158	67	rhamnose	rhamnose	VERB
finefocus-531	158	68	75.84	75.84	NUM
finefocus-531	158	69	2.37	2.37	NUM
finefocus-531	158	70	rac-1,2	rac-1,2	PROPN
finefocus-531	158	71	-	-	PUNCT
finefocus-531	158	72	pd	pd	NOUN
finefocus-531	158	73	69.90	69.90	NUM
finefocus-531	158	74	-1.86	-1.86	NOUN
finefocus-531	158	75	table	table	NOUN
finefocus-531	158	76	2	2	NUM
finefocus-531	158	77	–	–	PUNCT
finefocus-531	158	78	fermentation	fermentation	NOUN
finefocus-531	158	79	characteristics	characteristic	NOUN
finefocus-531	158	80	of	of	ADP
finefocus-531	158	81	1,2	1,2	NUM
finefocus-531	158	82	propanediol	propanediol	NOUN
finefocus-531	158	83	production	production	NOUN
finefocus-531	158	84	on	on	ADP
finefocus-531	158	85	selected	select	VERB
finefocus-531	158	86	substrates	substrate	NOUN
finefocus-531	158	87	substrate	substrate	NOUN
finefocus-531	158	88	(	(	PUNCT
finefocus-531	158	89	20	20	NUM
finefocus-531	158	90	mm	mm	NOUN
finefocus-531	158	91	)	)	PUNCT
finefocus-531	158	92	maximum	maximum	ADJ
finefocus-531	158	93	1,2	1,2	NUM
finefocus-531	158	94	-	-	PUNCT
finefocus-531	158	95	pd	pd	NOUN
finefocus-531	158	96	yield	yield	NOUN
finefocus-531	158	97	maximum	maximum	ADJ
finefocus-531	158	98	1,2	1,2	NUM
finefocus-531	158	99	-	-	PUNCT
finefocus-531	158	100	pd	pd	NOUN
finefocus-531	158	101	production	production	NOUN
finefocus-531	158	102	rate	rate	NOUN
finefocus-531	158	103	(	(	PUNCT
finefocus-531	158	104	%	%	NOUN
finefocus-531	158	105	of	of	ADP
finefocus-531	158	106	theoretical	theoretical	ADJ
finefocus-531	158	107	)	)	PUNCT
finefocus-531	158	108	(	(	PUNCT
finefocus-531	158	109	mmol	mmol	NOUN
finefocus-531	158	110	/	/	SYM
finefocus-531	158	111	hr	hr	NOUN
finefocus-531	158	112	)	)	PUNCT
finefocus-531	158	113	d	d	NOUN
finefocus-531	158	114	-	-	PUNCT
finefocus-531	158	115	glucose	glucose	NOUN
finefocus-531	158	116	9.93	9.93	NUM
finefocus-531	158	117	0.99	0.99	NUM
finefocus-531	158	118	l	l	NOUN
finefocus-531	158	119	-	-	PUNCT
finefocus-531	158	120	rhamnose	rhamnose	VERB
finefocus-531	158	121	96.89	96.89	NUM
finefocus-531	158	122	3.41	3.41	NUM
finefocus-531	158	123	glucose	glucose	NOUN
finefocus-531	158	124	+	+	CCONJ
finefocus-531	158	125	rhamnose	rhamnose	VERB
finefocus-531	158	126	75.84	75.84	NUM
finefocus-531	158	127	2.37	2.37	NUM
finefocus-531	158	128	rac-1,2	rac-1,2	PROPN
finefocus-531	158	129	-	-	PUNCT
finefocus-531	158	130	pd	pd	NOUN
finefocus-531	158	131	69.90	69.90	NUM
finefocus-531	158	132	-1.86	-1.86	NOUN
finefocus-531	158	133	table	table	NOUN
finefocus-531	158	134	2	2	NUM
finefocus-531	158	135	–	–	PUNCT
finefocus-531	158	136	fermentation	fermentation	NOUN
finefocus-531	158	137	characteristics	characteristic	NOUN
finefocus-531	158	138	of	of	ADP
finefocus-531	158	139	1,2	1,2	NUM
finefocus-531	158	140	propanediol	propanediol	NOUN
finefocus-531	158	141	production	production	NOUN
finefocus-531	158	142	on	on	ADP
finefocus-531	158	143	selected	select	VERB
finefocus-531	158	144	substrates	substrate	NOUN
finefocus-531	158	145	substrate	substrate	NOUN
finefocus-531	158	146	(	(	PUNCT
finefocus-531	158	147	20	20	NUM
finefocus-531	158	148	mm	mm	NOUN
finefocus-531	158	149	)	)	PUNCT
finefocus-531	158	150	maximum	maximum	ADJ
finefocus-531	158	151	1,2	1,2	NUM
finefocus-531	158	152	-	-	PUNCT
finefocus-531	158	153	pd	pd	NOUN
finefocus-531	158	154	yield	yield	NOUN
finefocus-531	158	155	maximum	maximum	ADJ
finefocus-531	158	156	1,2	1,2	NUM
finefocus-531	158	157	-	-	PUNCT
finefocus-531	158	158	pd	pd	NOUN
finefocus-531	158	159	production	production	NOUN
finefocus-531	158	160	rate	rate	NOUN
finefocus-531	158	161	(	(	PUNCT
finefocus-531	158	162	%	%	NOUN
finefocus-531	158	163	of	of	ADP
finefocus-531	158	164	theoretical	theoretical	ADJ
finefocus-531	158	165	)	)	PUNCT
finefocus-531	158	166	(	(	PUNCT
finefocus-531	158	167	mmol	mmol	NOUN
finefocus-531	158	168	/	/	SYM
finefocus-531	158	169	hr	hr	NOUN
finefocus-531	158	170	)	)	PUNCT
finefocus-531	158	171	d	d	NOUN
finefocus-531	158	172	-	-	PUNCT
finefocus-531	158	173	glucose	glucose	NOUN
finefocus-531	158	174	9.93	9.93	NUM
finefocus-531	158	175	0.99	0.99	NUM
finefocus-531	158	176	l	l	NOUN
finefocus-531	158	177	-	-	PUNCT
finefocus-531	158	178	rhamnose	rhamnose	VERB
finefocus-531	158	179	96.89	96.89	NUM
finefocus-531	158	180	3.41	3.41	NUM
finefocus-531	158	181	glucose	glucose	NOUN
finefocus-531	158	182	+	+	CCONJ
finefocus-531	158	183	rhamnose	rhamnose	VERB
finefocus-531	158	184	75.84	75.84	NUM
finefocus-531	158	185	2.37	2.37	NUM
finefocus-531	158	186	rac-1,2	rac-1,2	PROPN
finefocus-531	158	187	-	-	PUNCT
finefocus-531	158	188	pd	pd	NOUN
finefocus-531	158	189	69.90	69.90	NUM
finefocus-531	158	190	-1.86	-1.86	NOUN
finefocus-531	158	191	33applied	33applied	NUM
finefocus-531	158	192	&	&	CCONJ
finefocus-531	158	193	environmental	environmental	ADJ
finefocus-531	158	194	microbiology	microbiology	NOUN
finefocus-531	158	195	•	•	NOUN
finefocus-531	158	196	strain	strain	NOUN
finefocus-531	158	197	cc5c	cc5c	NUM
finefocus-531	158	198	is	be	AUX
finefocus-531	158	199	very	very	ADV
finefocus-531	158	200	closely	closely	ADV
finefocus-531	158	201	related	relate	VERB
finefocus-531	158	202	to	to	ADP
finefocus-531	158	203	a	a	DET
finefocus-531	158	204	number	number	NOUN
finefocus-531	158	205	of	of	ADP
finefocus-531	158	206	organisms	organism	NOUN
finefocus-531	158	207	within	within	ADP
finefocus-531	158	208	the	the	DET
finefocus-531	158	209	genera	genera	NOUN
finefocus-531	158	210	of	of	ADP
finefocus-531	158	211	escherichia	escherichia	NOUN
finefocus-531	158	212	and	and	CCONJ
finefocus-531	158	213	shigella	shigella	PROPN
finefocus-531	158	214	,	,	PUNCT
finefocus-531	158	215	the	the	DET
finefocus-531	158	216	latter	latter	NOUN
finefocus-531	158	217	of	of	ADP
finefocus-531	158	218	which	which	PRON
finefocus-531	158	219	are	be	AUX
finefocus-531	158	220	widely	widely	ADV
finefocus-531	158	221	regarded	regard	VERB
finefocus-531	158	222	as	as	ADP
finefocus-531	158	223	likely	likely	ADV
finefocus-531	158	224	being	be	AUX
finefocus-531	158	225	representatives	representative	NOUN
finefocus-531	158	226	of	of	ADP
finefocus-531	158	227	e.	e.	PROPN
finefocus-531	158	228	coli	coli	NOUN
finefocus-531	158	229	clones	clone	NOUN
finefocus-531	158	230	(	(	PUNCT
finefocus-531	158	231	25	25	NUM
finefocus-531	158	232	)	)	PUNCT
finefocus-531	158	233	.	.	PUNCT
finefocus-531	159	1	other	other	ADJ
finefocus-531	159	2	techniques	technique	NOUN
finefocus-531	159	3	,	,	PUNCT
finefocus-531	159	4	such	such	ADJ
finefocus-531	159	5	as	as	ADP
finefocus-531	159	6	dna	dna	PROPN
finefocus-531	159	7	-	-	PUNCT
finefocus-531	159	8	dna	dna	PROPN
finefocus-531	159	9	hybridization	hybridization	NOUN
finefocus-531	159	10	are	be	AUX
finefocus-531	159	11	required	require	VERB
finefocus-531	159	12	to	to	PART
finefocus-531	159	13	determine	determine	VERB
finefocus-531	159	14	conclusively	conclusively	ADV
finefocus-531	159	15	if	if	SCONJ
finefocus-531	159	16	strain	strain	NOUN
finefocus-531	159	17	cc5c	cc5c	PROPN
finefocus-531	159	18	represent	represent	VERB
finefocus-531	159	19	a	a	DET
finefocus-531	159	20	novel	novel	ADJ
finefocus-531	159	21	species	specie	NOUN
finefocus-531	159	22	given	give	VERB
finefocus-531	159	23	the	the	DET
finefocus-531	159	24	high	high	ADJ
finefocus-531	159	25	degree	degree	NOUN
finefocus-531	159	26	of	of	ADP
finefocus-531	159	27	similarity	similarity	NOUN
finefocus-531	159	28	among	among	ADP
finefocus-531	159	29	species	specie	NOUN
finefocus-531	159	30	within	within	ADP
finefocus-531	159	31	these	these	DET
finefocus-531	159	32	genera	genera	NOUN
finefocus-531	159	33	.	.	PUNCT
finefocus-531	160	1	strain	strain	PROPN
finefocus-531	160	2	cc5c	cc5c	PROPN
finefocus-531	160	3	’s	’s	PART
finefocus-531	160	4	topt	topt	NOUN
finefocus-531	160	5	matches	match	VERB
finefocus-531	160	6	the	the	DET
finefocus-531	160	7	temperature	temperature	NOUN
finefocus-531	160	8	of	of	ADP
finefocus-531	160	9	the	the	DET
finefocus-531	160	10	geothermal	geothermal	ADJ
finefocus-531	160	11	pool	pool	NOUN
finefocus-531	160	12	(	(	PUNCT
finefocus-531	160	13	40	40	NUM
finefocus-531	160	14	°	°	SYM
finefocus-531	160	15	c	c	NOUN
finefocus-531	160	16	)	)	PUNCT
finefocus-531	160	17	from	from	ADP
finefocus-531	160	18	which	which	PRON
finefocus-531	160	19	it	it	PRON
finefocus-531	160	20	was	be	AUX
finefocus-531	160	21	isolated	isolate	VERB
finefocus-531	160	22	from	from	ADP
finefocus-531	160	23	.	.	PUNCT
finefocus-531	161	1	similarly	similarly	ADV
finefocus-531	161	2	,	,	PUNCT
finefocus-531	161	3	e.	e.	PROPN
finefocus-531	161	4	marmatoae	marmatoae	PROPN
finefocus-531	161	5	can	can	AUX
finefocus-531	161	6	grow	grow	VERB
finefocus-531	161	7	at	at	ADP
finefocus-531	161	8	25–37	25–37	NUM
finefocus-531	161	9	°	°	NOUN
finefocus-531	161	10	c	c	NOUN
finefocus-531	161	11	,	,	PUNCT
finefocus-531	161	12	and	and	CCONJ
finefocus-531	161	13	with	with	ADP
finefocus-531	161	14	0–6	0–6	NUM
finefocus-531	161	15	%	%	NOUN
finefocus-531	161	16	nacl	nacl	NOUN
finefocus-531	161	17	with	with	ADP
finefocus-531	161	18	optimum	optimum	ADJ
finefocus-531	161	19	growth	growth	NOUN
finefocus-531	161	20	conditions	condition	NOUN
finefocus-531	161	21	are	be	AUX
finefocus-531	161	22	37	37	NUM
finefocus-531	161	23	°	°	ADP
finefocus-531	161	24	c	c	NOUN
finefocus-531	161	25	and	and	CCONJ
finefocus-531	161	26	1	1	NUM
finefocus-531	161	27	%	%	NOUN
finefocus-531	161	28	nacl	nacl	NOUN
finefocus-531	161	29	.	.	PUNCT
finefocus-531	162	1	interestingly	interestingly	ADV
finefocus-531	162	2	,	,	PUNCT
finefocus-531	162	3	enteric	enteric	ADJ
finefocus-531	162	4	bacteria	bacteria	NOUN
finefocus-531	162	5	are	be	AUX
finefocus-531	162	6	not	not	PART
finefocus-531	162	7	typically	typically	ADV
finefocus-531	162	8	associated	associate	VERB
finefocus-531	162	9	with	with	ADP
finefocus-531	162	10	a	a	DET
finefocus-531	162	11	highlysaline	highlysaline	ADJ
finefocus-531	162	12	marine	marine	ADJ
finefocus-531	162	13	environment	environment	NOUN
finefocus-531	162	14	or	or	CCONJ
finefocus-531	162	15	geothermal	geothermal	ADJ
finefocus-531	162	16	feature	feature	NOUN
finefocus-531	162	17	as	as	ADP
finefocus-531	162	18	escherichia	escherichia	NOUN
finefocus-531	162	19	species	specie	NOUN
finefocus-531	162	20	are	be	AUX
finefocus-531	162	21	typically	typically	ADV
finefocus-531	162	22	associated	associate	VERB
finefocus-531	162	23	with	with	ADP
finefocus-531	162	24	the	the	DET
finefocus-531	162	25	digestive	digestive	ADJ
finefocus-531	162	26	tract	tract	NOUN
finefocus-531	162	27	of	of	ADP
finefocus-531	162	28	mammals	mammal	NOUN
finefocus-531	162	29	and	and	CCONJ
finefocus-531	162	30	,	,	PUNCT
finefocus-531	162	31	less	less	ADV
finefocus-531	162	32	commonly	commonly	ADV
finefocus-531	162	33	,	,	PUNCT
finefocus-531	162	34	other	other	ADJ
finefocus-531	162	35	animals	animal	NOUN
finefocus-531	162	36	.	.	PUNCT
finefocus-531	163	1	however	however	ADV
finefocus-531	163	2	,	,	PUNCT
finefocus-531	163	3	there	there	PRON
finefocus-531	163	4	is	be	VERB
finefocus-531	163	5	at	at	ADV
finefocus-531	163	6	least	least	ADJ
finefocus-531	163	7	one	one	NUM
finefocus-531	163	8	example	example	NOUN
finefocus-531	163	9	of	of	ADP
finefocus-531	163	10	an	an	DET
finefocus-531	163	11	organism	organism	NOUN
finefocus-531	163	12	within	within	ADP
finefocus-531	163	13	family	family	NOUN
finefocus-531	163	14	enterobacteriaceae	enterobacteriaceae	PROPN
finefocus-531	163	15	being	be	AUX
finefocus-531	163	16	found	find	VERB
finefocus-531	163	17	in	in	ADP
finefocus-531	163	18	intertidal	intertidal	ADJ
finefocus-531	163	19	hot	hot	ADJ
finefocus-531	163	20	springs	spring	NOUN
finefocus-531	163	21	,	,	PUNCT
finefocus-531	163	22	that	that	PRON
finefocus-531	163	23	being	be	AUX
finefocus-531	163	24	the	the	DET
finefocus-531	163	25	moderately	moderately	ADV
finefocus-531	163	26	thermophilic	thermophilic	ADJ
finefocus-531	163	27	halophile	halophile	NOUN
finefocus-531	163	28	alterococcus	alterococcus	NOUN
finefocus-531	163	29	agarolyticus	agarolyticus	PROPN
finefocus-531	163	30	which	which	PRON
finefocus-531	163	31	was	be	AUX
finefocus-531	163	32	isolated	isolate	VERB
finefocus-531	163	33	in	in	ADP
finefocus-531	163	34	taiwan	taiwan	PROPN
finefocus-531	163	35	(	(	PUNCT
finefocus-531	163	36	32	32	NUM
finefocus-531	163	37	)	)	PUNCT
finefocus-531	163	38	.	.	PUNCT
finefocus-531	164	1	their	their	PRON
finefocus-531	164	2	secondary	secondary	ADJ
finefocus-531	164	3	presence	presence	NOUN
finefocus-531	164	4	in	in	ADP
finefocus-531	164	5	other	other	ADJ
finefocus-531	164	6	environments	environment	NOUN
finefocus-531	164	7	is	be	AUX
finefocus-531	164	8	often	often	ADV
finefocus-531	164	9	the	the	DET
finefocus-531	164	10	result	result	NOUN
finefocus-531	164	11	of	of	ADP
finefocus-531	164	12	fecal	fecal	ADJ
finefocus-531	164	13	contamination	contamination	NOUN
finefocus-531	164	14	(	(	PUNCT
finefocus-531	164	15	32	32	NUM
finefocus-531	164	16	)	)	PUNCT
finefocus-531	164	17	,	,	PUNCT
finefocus-531	164	18	thus	thus	ADV
finefocus-531	164	19	the	the	DET
finefocus-531	164	20	presence	presence	NOUN
finefocus-531	164	21	of	of	ADP
finefocus-531	164	22	this	this	DET
finefocus-531	164	23	organism	organism	NOUN
finefocus-531	164	24	could	could	AUX
finefocus-531	164	25	be	be	AUX
finefocus-531	164	26	the	the	DET
finefocus-531	164	27	result	result	NOUN
finefocus-531	164	28	of	of	ADP
finefocus-531	164	29	nesting	nest	VERB
finefocus-531	164	30	birds	bird	NOUN
finefocus-531	164	31	near	near	ADP
finefocus-531	164	32	the	the	DET
finefocus-531	164	33	sampling	sample	VERB
finefocus-531	164	34	location	location	NOUN
finefocus-531	164	35	observed	observe	VERB
finefocus-531	164	36	at	at	ADP
finefocus-531	164	37	the	the	DET
finefocus-531	164	38	time	time	NOUN
finefocus-531	164	39	that	that	PRON
finefocus-531	164	40	the	the	DET
finefocus-531	164	41	sample	sample	NOUN
finefocus-531	164	42	was	be	AUX
finefocus-531	164	43	taken	take	VERB
finefocus-531	164	44	.	.	PUNCT
finefocus-531	165	1	the	the	DET
finefocus-531	165	2	high	high	ADJ
finefocus-531	165	3	conductivity	conductivity	NOUN
finefocus-531	165	4	of	of	ADP
finefocus-531	165	5	the	the	DET
finefocus-531	165	6	sample	sample	NOUN
finefocus-531	165	7	taken	take	VERB
finefocus-531	165	8	from	from	ADP
finefocus-531	165	9	the	the	DET
finefocus-531	165	10	pool	pool	NOUN
finefocus-531	165	11	,	,	PUNCT
finefocus-531	165	12	which	which	PRON
finefocus-531	165	13	is	be	AUX
finefocus-531	165	14	equivalent	equivalent	ADJ
finefocus-531	165	15	to	to	PART
finefocus-531	165	16	strain	strain	VERB
finefocus-531	165	17	cc5c	cc5c	PROPN
finefocus-531	165	18	rapidly	rapidly	ADV
finefocus-531	165	19	catabolizes	catabolize	VERB
finefocus-531	165	20	glucose	glucose	NOUN
finefocus-531	165	21	and	and	CCONJ
finefocus-531	165	22	rhamnose	rhamnose	VERB
finefocus-531	165	23	and	and	CCONJ
finefocus-531	165	24	produces	produce	VERB
finefocus-531	165	25	1,2	1,2	NUM
finefocus-531	165	26	-	-	NOUN
finefocus-531	165	27	pd	pd	NOUN
finefocus-531	165	28	at	at	ADP
finefocus-531	165	29	a	a	DET
finefocus-531	165	30	rate	rate	NOUN
finefocus-531	165	31	of	of	ADP
finefocus-531	165	32	3.41	3.41	NUM
finefocus-531	165	33	mmol	mmol	NOUN
finefocus-531	165	34	/	/	SYM
finefocus-531	165	35	h	h	NOUN
finefocus-531	165	36	on	on	ADP
finefocus-531	165	37	l	l	NOUN
finefocus-531	165	38	-	-	PUNCT
finefocus-531	165	39	rhamnose	rhamnose	NOUN
finefocus-531	165	40	and	and	CCONJ
finefocus-531	165	41	2.37	2.37	NUM
finefocus-531	165	42	mmol	mmol	NOUN
finefocus-531	165	43	/	/	SYM
finefocus-531	165	44	h	h	NOUN
finefocus-531	165	45	on	on	ADP
finefocus-531	165	46	a	a	DET
finefocus-531	165	47	mixture	mixture	NOUN
finefocus-531	165	48	of	of	ADP
finefocus-531	165	49	glucose	glucose	NOUN
finefocus-531	165	50	and	and	CCONJ
finefocus-531	165	51	rhamnose	rhamnose	VERB
finefocus-531	165	52	with	with	ADP
finefocus-531	165	53	up	up	ADP
finefocus-531	165	54	to	to	PART
finefocus-531	165	55	96	96	NUM
finefocus-531	165	56	%	%	NOUN
finefocus-531	165	57	on	on	ADP
finefocus-531	165	58	l	l	NOUN
finefocus-531	165	59	-	-	PUNCT
finefocus-531	165	60	rhamnose	rhamnose	NOUN
finefocus-531	165	61	.	.	PUNCT
finefocus-531	166	1	approximately	approximately	ADV
finefocus-531	166	2	3.1	3.1	NUM
finefocus-531	166	3	%	%	NOUN
finefocus-531	166	4	sodium	sodium	NOUN
finefocus-531	166	5	chloride	chloride	NOUN
finefocus-531	166	6	is	be	AUX
finefocus-531	166	7	less	less	ADV
finefocus-531	166	8	saline	saline	ADJ
finefocus-531	166	9	than	than	ADP
finefocus-531	166	10	seawater	seawater	NOUN
finefocus-531	166	11	.	.	PUNCT
finefocus-531	167	1	as	as	SCONJ
finefocus-531	167	2	members	member	NOUN
finefocus-531	167	3	of	of	ADP
finefocus-531	167	4	the	the	DET
finefocus-531	167	5	family	family	NOUN
finefocus-531	167	6	enterobacteriaceae	enterobacteriaceae	PROPN
finefocus-531	167	7	are	be	AUX
finefocus-531	167	8	typically	typically	ADV
finefocus-531	167	9	not	not	PART
finefocus-531	167	10	halophilic	halophilic	ADJ
finefocus-531	167	11	(	(	PUNCT
finefocus-531	167	12	brenner	brenner	NOUN
finefocus-531	167	13	,	,	PUNCT
finefocus-531	167	14	2005	2005	NUM
finefocus-531	167	15	)	)	PUNCT
finefocus-531	167	16	,	,	PUNCT
finefocus-531	167	17	it	it	PRON
finefocus-531	167	18	is	be	AUX
finefocus-531	167	19	somewhat	somewhat	ADV
finefocus-531	167	20	surprising	surprising	ADJ
finefocus-531	167	21	that	that	SCONJ
finefocus-531	167	22	strain	strain	NOUN
finefocus-531	167	23	cc5c	cc5c	NUM
finefocus-531	167	24	persists	persist	NOUN
finefocus-531	167	25	in	in	ADP
finefocus-531	167	26	this	this	DET
finefocus-531	167	27	environment	environment	NOUN
finefocus-531	167	28	.	.	PUNCT
finefocus-531	168	1	strain	strain	PROPN
finefocus-531	168	2	cc5c	cc5c	PROPN
finefocus-531	168	3	may	may	AUX
finefocus-531	168	4	be	be	AUX
finefocus-531	168	5	thriving	thrive	VERB
finefocus-531	168	6	in	in	ADP
finefocus-531	168	7	this	this	DET
finefocus-531	168	8	environment	environment	NOUN
finefocus-531	168	9	due	due	ADP
finefocus-531	168	10	to	to	ADP
finefocus-531	168	11	the	the	DET
finefocus-531	168	12	influx	influx	NOUN
finefocus-531	168	13	of	of	ADP
finefocus-531	168	14	fresh	fresh	ADJ
finefocus-531	168	15	geothermal	geothermal	ADJ
finefocus-531	168	16	water	water	NOUN
finefocus-531	168	17	into	into	ADP
finefocus-531	168	18	the	the	DET
finefocus-531	168	19	intertidal	intertidal	ADJ
finefocus-531	168	20	pool	pool	NOUN
finefocus-531	168	21	from	from	ADP
finefocus-531	168	22	the	the	DET
finefocus-531	168	23	geothermal	geothermal	ADJ
finefocus-531	168	24	system	system	NOUN
finefocus-531	168	25	and	and	CCONJ
finefocus-531	168	26	due	due	ADP
finefocus-531	168	27	to	to	ADP
finefocus-531	168	28	the	the	DET
finefocus-531	168	29	abundance	abundance	NOUN
finefocus-531	168	30	of	of	ADP
finefocus-531	168	31	marine	marine	ADJ
finefocus-531	168	32	biomass	biomass	NOUN
finefocus-531	168	33	in	in	ADP
finefocus-531	168	34	the	the	DET
finefocus-531	168	35	pool	pool	NOUN
finefocus-531	168	36	such	such	ADJ
finefocus-531	168	37	as	as	ADP
finefocus-531	168	38	protein	protein	NOUN
finefocus-531	168	39	and	and	CCONJ
finefocus-531	168	40	carbohydrates	carbohydrate	NOUN
finefocus-531	168	41	from	from	ADP
finefocus-531	168	42	macro	macro	ADJ
finefocus-531	168	43	algae	algae	NOUN
finefocus-531	168	44	.	.	PUNCT
finefocus-531	169	1	metagenomic	metagenomic	ADJ
finefocus-531	169	2	studies	study	NOUN
finefocus-531	169	3	of	of	ADP
finefocus-531	169	4	these	these	DET
finefocus-531	169	5	intertidal	intertidal	ADJ
finefocus-531	169	6	pools	pool	NOUN
finefocus-531	169	7	over	over	ADP
finefocus-531	169	8	the	the	DET
finefocus-531	169	9	course	course	NOUN
finefocus-531	169	10	of	of	ADP
finefocus-531	169	11	multiple	multiple	ADJ
finefocus-531	169	12	seasons	season	NOUN
finefocus-531	169	13	are	be	AUX
finefocus-531	169	14	needed	need	VERB
finefocus-531	169	15	to	to	PART
finefocus-531	169	16	resolve	resolve	VERB
finefocus-531	169	17	whether	whether	SCONJ
finefocus-531	169	18	strains	strain	NOUN
finefocus-531	169	19	such	such	ADJ
finefocus-531	169	20	as	as	ADP
finefocus-531	169	21	cc5c	cc5c	PROPN
finefocus-531	169	22	are	be	AUX
finefocus-531	169	23	stable	stable	ADJ
finefocus-531	169	24	members	member	NOUN
finefocus-531	169	25	of	of	ADP
finefocus-531	169	26	the	the	DET
finefocus-531	169	27	geothermal	geothermal	ADJ
finefocus-531	169	28	intertidal	intertidal	ADJ
finefocus-531	169	29	community	community	NOUN
finefocus-531	169	30	or	or	CCONJ
finefocus-531	169	31	not	not	PART
finefocus-531	169	32	.	.	PUNCT
finefocus-531	170	1	strain	strain	PROPN
finefocus-531	170	2	cc5c	cc5c	NUM
finefocus-531	170	3	is	be	AUX
finefocus-531	170	4	phenotypically	phenotypically	ADV
finefocus-531	170	5	similar	similar	ADJ
finefocus-531	170	6	to	to	ADP
finefocus-531	170	7	e.	e.	PROPN
finefocus-531	170	8	coli	coli	PROPN
finefocus-531	170	9	and	and	CCONJ
finefocus-531	170	10	other	other	ADJ
finefocus-531	170	11	closely	closely	ADV
finefocus-531	170	12	related	relate	VERB
finefocus-531	170	13	species	specie	NOUN
finefocus-531	170	14	with	with	ADP
finefocus-531	170	15	several	several	ADJ
finefocus-531	170	16	notable	notable	ADJ
finefocus-531	170	17	differences	difference	NOUN
finefocus-531	170	18	in	in	ADP
finefocus-531	170	19	substrate	substrate	NOUN
finefocus-531	170	20	utilization	utilization	NOUN
finefocus-531	170	21	and	and	CCONJ
finefocus-531	170	22	growth	growth	NOUN
finefocus-531	170	23	conditions	condition	NOUN
finefocus-531	170	24	as	as	SCONJ
finefocus-531	170	25	compared	compare	VERB
finefocus-531	170	26	to	to	ADP
finefocus-531	170	27	related	related	ADJ
finefocus-531	170	28	species	specie	NOUN
finefocus-531	170	29	;	;	PUNCT
finefocus-531	170	30	the	the	DET
finefocus-531	170	31	majority	majority	NOUN
finefocus-531	170	32	of	of	ADP
finefocus-531	170	33	the	the	DET
finefocus-531	170	34	biochemical	biochemical	ADJ
finefocus-531	170	35	tests	test	NOUN
finefocus-531	170	36	reveal	reveal	VERB
finefocus-531	170	37	traits	trait	NOUN
finefocus-531	170	38	similar	similar	ADJ
finefocus-531	170	39	to	to	ADP
finefocus-531	170	40	other	other	ADJ
finefocus-531	170	41	enteric	enteric	ADJ
finefocus-531	170	42	bacteria	bacteria	NOUN
finefocus-531	170	43	that	that	PRON
finefocus-531	170	44	are	be	AUX
finefocus-531	170	45	facultative	facultative	ADJ
finefocus-531	170	46	anaerobes	anaerobe	NOUN
finefocus-531	170	47	within	within	ADP
finefocus-531	170	48	the	the	DET
finefocus-531	170	49	family	family	NOUN
finefocus-531	170	50	of	of	ADP
finefocus-531	170	51	enterobacteriaceae	enterobacteriaceae	PROPN
finefocus-531	170	52	.	.	PUNCT
finefocus-531	171	1	from	from	ADP
finefocus-531	171	2	a	a	DET
finefocus-531	171	3	purely	purely	ADV
finefocus-531	171	4	taxonomic	taxonomic	ADJ
finefocus-531	171	5	standpoint	standpoint	NOUN
finefocus-531	171	6	,	,	PUNCT
finefocus-531	171	7	a	a	DET
finefocus-531	171	8	lack	lack	NOUN
finefocus-531	171	9	of	of	ADP
finefocus-531	171	10	lysine	lysine	NOUN
finefocus-531	171	11	decarboxylation	decarboxylation	NOUN
finefocus-531	171	12	is	be	AUX
finefocus-531	171	13	a	a	DET
finefocus-531	171	14	defining	define	VERB
finefocus-531	171	15	feature	feature	NOUN
finefocus-531	171	16	of	of	ADP
finefocus-531	171	17	the	the	DET
finefocus-531	171	18	genus	genus	NOUN
finefocus-531	171	19	shigella	shigella	NOUN
finefocus-531	171	20	,	,	PUNCT
finefocus-531	171	21	and	and	CCONJ
finefocus-531	171	22	therefore	therefore	ADV
finefocus-531	171	23	it	it	PRON
finefocus-531	171	24	is	be	AUX
finefocus-531	171	25	suggested	suggest	VERB
finefocus-531	171	26	that	that	SCONJ
finefocus-531	171	27	cc5c	cc5c	PROPN
finefocus-531	171	28	is	be	AUX
finefocus-531	171	29	a	a	DET
finefocus-531	171	30	member	member	NOUN
finefocus-531	171	31	of	of	ADP
finefocus-531	171	32	the	the	DET
finefocus-531	171	33	genus	genus	PROPN
finefocus-531	171	34	escherichia	escherichia	NOUN
finefocus-531	171	35	.	.	PUNCT
finefocus-531	172	1	strain	strain	PROPN
finefocus-531	172	2	cc5c	cc5c	PROPN
finefocus-531	172	3	has	have	VERB
finefocus-531	172	4	a	a	DET
finefocus-531	172	5	broader	broad	ADJ
finefocus-531	172	6	temperature	temperature	NOUN
finefocus-531	172	7	range	range	NOUN
finefocus-531	172	8	than	than	SCONJ
finefocus-531	172	9	both	both	DET
finefocus-531	172	10	e.	e.	PROPN
finefocus-531	172	11	marmatoa	marmatoa	PROPN
finefocus-531	172	12	(	(	PUNCT
finefocus-531	172	13	reported	report	VERB
finefocus-531	172	14	as	as	ADP
finefocus-531	172	15	only	only	ADV
finefocus-531	172	16	growing	grow	VERB
finefocus-531	172	17	between	between	ADP
finefocus-531	172	18	25	25	NUM
finefocus-531	172	19	and	and	CCONJ
finefocus-531	172	20	37	37	NUM
finefocus-531	172	21	°	°	NOUN
finefocus-531	172	22	c	c	NOUN
finefocus-531	172	23	)	)	PUNCT
finefocus-531	172	24	and	and	CCONJ
finefocus-531	172	25	e.	e.	PROPN
finefocus-531	172	26	coli	coli	PROPN
finefocus-531	172	27	while	while	SCONJ
finefocus-531	172	28	demonstrating	demonstrate	VERB
finefocus-531	172	29	higher	high	ADJ
finefocus-531	172	30	specific	specific	ADJ
finefocus-531	172	31	growth	growth	NOUN
finefocus-531	172	32	rates	rate	NOUN
finefocus-531	172	33	at	at	ADP
finefocus-531	172	34	40	40	NUM
finefocus-531	172	35	and	and	CCONJ
finefocus-531	172	36	45	45	NUM
finefocus-531	173	1	°	°	NOUN
finefocus-531	173	2	c	c	NOUN
finefocus-531	173	3	as	as	SCONJ
finefocus-531	173	4	compared	compare	VERB
finefocus-531	173	5	to	to	ADP
finefocus-531	173	6	e.	e.	PROPN
finefocus-531	173	7	coli	coli	PROPN
finefocus-531	173	8	(	(	PUNCT
finefocus-531	173	9	dsm	dsm	PROPN
finefocus-531	173	10	given	give	VERB
finefocus-531	173	11	a	a	DET
finefocus-531	173	12	solution	solution	NOUN
finefocus-531	173	13	of	of	ADP
finefocus-531	173	14	rac-1,2	rac-1,2	NOUN
finefocus-531	173	15	-	-	PUNCT
finefocus-531	173	16	pd	pd	NOUN
finefocus-531	173	17	,	,	PUNCT
finefocus-531	173	18	strain	strain	NOUN
finefocus-531	173	19	cc5c	cc5c	PROPN
finefocus-531	173	20	degrades	degrade	VERB
finefocus-531	173	21	approximately	approximately	ADV
finefocus-531	173	22	half	half	NOUN
finefocus-531	173	23	of	of	ADP
finefocus-531	173	24	the	the	DET
finefocus-531	173	25	initial	initial	ADJ
finefocus-531	173	26	1,2	1,2	NUM
finefocus-531	173	27	-	-	PUNCT
finefocus-531	173	28	pd	pd	NOUN
finefocus-531	173	29	concentration	concentration	NOUN
finefocus-531	173	30	at	at	ADP
finefocus-531	173	31	a	a	DET
finefocus-531	173	32	rate	rate	NOUN
finefocus-531	173	33	of	of	ADP
finefocus-531	173	34	1.86	1.86	NUM
finefocus-531	173	35	mmol	mmol	NOUN
finefocus-531	173	36	/	/	SYM
finefocus-531	173	37	h.	h.	NOUN
finefocus-531	173	38	discussion	discussion	NOUN
finefocus-531	173	39	34	34	NUM
finefocus-531	173	40	•	•	NUM
finefocus-531	173	41	fine	fine	ADJ
finefocus-531	173	42	focus	focus	NOUN
finefocus-531	173	43	,	,	PUNCT
finefocus-531	173	44	vol	vol	NOUN
finefocus-531	173	45	.	.	PUNCT
finefocus-531	173	46	4(1	4(1	NOUN
finefocus-531	173	47	)	)	PUNCT
finefocus-531	173	48	30083	30083	NUM
finefocus-531	173	49	)	)	PUNCT
finefocus-531	173	50	under	under	ADP
finefocus-531	173	51	equivalent	equivalent	ADJ
finefocus-531	173	52	conditions	condition	NOUN
finefocus-531	173	53	.	.	PUNCT
finefocus-531	174	1	while	while	SCONJ
finefocus-531	174	2	strain	strain	NOUN
finefocus-531	174	3	cc5c	cc5c	PROPN
finefocus-531	174	4	is	be	AUX
finefocus-531	174	5	not	not	PART
finefocus-531	174	6	thermophilic	thermophilic	ADJ
finefocus-531	174	7	,	,	PUNCT
finefocus-531	174	8	it	it	PRON
finefocus-531	174	9	does	do	AUX
finefocus-531	174	10	seem	seem	VERB
finefocus-531	174	11	better	well	ADV
finefocus-531	174	12	adapted	adapt	VERB
finefocus-531	174	13	to	to	ADP
finefocus-531	174	14	growth	growth	NOUN
finefocus-531	174	15	at	at	ADP
finefocus-531	174	16	elevated	elevated	ADJ
finefocus-531	174	17	temperatures	temperature	NOUN
finefocus-531	174	18	than	than	ADP
finefocus-531	174	19	the	the	DET
finefocus-531	174	20	reference	reference	NOUN
finefocus-531	174	21	strain	strain	NOUN
finefocus-531	174	22	used	use	VERB
finefocus-531	174	23	(	(	PUNCT
finefocus-531	174	24	e.	e.	PROPN
finefocus-531	174	25	coli	coli	PROPN
finefocus-531	174	26	dsm	dsm	PROPN
finefocus-531	174	27	30083	30083	NUM
finefocus-531	174	28	)	)	PUNCT
finefocus-531	174	29	.	.	PUNCT
finefocus-531	175	1	additionally	additionally	ADV
finefocus-531	175	2	,	,	PUNCT
finefocus-531	175	3	cc5c´s	cc5c´s	PROPN
finefocus-531	175	4	growth	growth	NOUN
finefocus-531	175	5	rates	rate	NOUN
finefocus-531	175	6	at	at	ADP
finefocus-531	175	7	elevated	elevated	ADJ
finefocus-531	175	8	salt	salt	NOUN
finefocus-531	175	9	concentrations	concentration	NOUN
finefocus-531	175	10	are	be	AUX
finefocus-531	175	11	higher	high	ADJ
finefocus-531	175	12	than	than	ADP
finefocus-531	175	13	the	the	DET
finefocus-531	175	14	type	type	NOUN
finefocus-531	175	15	strain	strain	NOUN
finefocus-531	175	16	of	of	ADP
finefocus-531	175	17	e.	e.	PROPN
finefocus-531	175	18	coli	coli	PROPN
finefocus-531	175	19	.	.	PUNCT
finefocus-531	176	1	this	this	PRON
finefocus-531	176	2	may	may	AUX
finefocus-531	176	3	suggest	suggest	VERB
finefocus-531	176	4	that	that	SCONJ
finefocus-531	176	5	cc5c	cc5c	PROPN
finefocus-531	176	6	has	have	AUX
finefocus-531	176	7	adapted	adapt	VERB
finefocus-531	176	8	to	to	ADP
finefocus-531	176	9	its	its	PRON
finefocus-531	176	10	environmental	environmental	ADJ
finefocus-531	176	11	niche	niche	NOUN
finefocus-531	176	12	(	(	PUNCT
finefocus-531	176	13	40	40	NUM
finefocus-531	176	14	°	°	NOUN
finefocus-531	176	15	c	c	NOUN
finefocus-531	176	16	or	or	CCONJ
finefocus-531	176	17	more	more	ADJ
finefocus-531	176	18	with	with	ADP
finefocus-531	176	19	regular	regular	ADJ
finefocus-531	176	20	saline	saline	NOUN
finefocus-531	176	21	intrusion	intrusion	NOUN
finefocus-531	176	22	)	)	PUNCT
finefocus-531	176	23	.	.	PUNCT
finefocus-531	177	1	cc5c	cc5c	PROPN
finefocus-531	177	2	has	have	VERB
finefocus-531	177	3	a	a	DET
finefocus-531	177	4	broader	broad	ADJ
finefocus-531	177	5	substrate	substrate	NOUN
finefocus-531	177	6	spectra	spectra	NOUN
finefocus-531	177	7	than	than	ADP
finefocus-531	177	8	closely	closely	ADV
finefocus-531	177	9	related	relate	VERB
finefocus-531	177	10	species	specie	NOUN
finefocus-531	177	11	as	as	SCONJ
finefocus-531	177	12	it	it	PRON
finefocus-531	177	13	degrades	degrade	VERB
finefocus-531	177	14	hexoses	hexose	NOUN
finefocus-531	177	15	,	,	PUNCT
finefocus-531	177	16	pentoses	pentose	NOUN
finefocus-531	177	17	,	,	PUNCT
finefocus-531	177	18	methylpentoses	methylpentose	NOUN
finefocus-531	177	19	,	,	PUNCT
finefocus-531	177	20	sugar	sugar	NOUN
finefocus-531	177	21	alcohols	alcohol	NOUN
finefocus-531	177	22	,	,	PUNCT
finefocus-531	177	23	and	and	CCONJ
finefocus-531	177	24	disaccharides	disaccharide	VERB
finefocus-531	177	25	as	as	ADV
finefocus-531	177	26	well	well	ADV
finefocus-531	177	27	as	as	ADP
finefocus-531	177	28	some	some	DET
finefocus-531	177	29	polysaccharides	polysaccharide	NOUN
finefocus-531	177	30	.	.	PUNCT
finefocus-531	178	1	four	four	NUM
finefocus-531	178	2	substrates	substrate	NOUN
finefocus-531	178	3	stand	stand	VERB
finefocus-531	178	4	out	out	ADP
finefocus-531	178	5	at	at	ADP
finefocus-531	178	6	differentiating	differentiate	VERB
finefocus-531	178	7	strain	strain	NOUN
finefocus-531	178	8	cc5c	cc5c	PROPN
finefocus-531	178	9	from	from	ADP
finefocus-531	178	10	its	its	PRON
finefocus-531	178	11	nearest	near	ADJ
finefocus-531	178	12	phylogenetic	phylogenetic	ADJ
finefocus-531	178	13	neighbours	neighbour	NOUN
finefocus-531	178	14	,	,	PUNCT
finefocus-531	178	15	namely	namely	ADV
finefocus-531	178	16	the	the	DET
finefocus-531	178	17	utilization	utilization	NOUN
finefocus-531	178	18	of	of	ADP
finefocus-531	178	19	starch	starch	NOUN
finefocus-531	178	20	,	,	PUNCT
finefocus-531	178	21	sucrose	sucrose	PROPN
finefocus-531	178	22	,	,	PUNCT
finefocus-531	178	23	dulcitol	dulcitol	NOUN
finefocus-531	178	24	,	,	PUNCT
finefocus-531	178	25	and	and	CCONJ
finefocus-531	178	26	possibly	possibly	ADV
finefocus-531	178	27	cellobiose	cellobiose	VERB
finefocus-531	178	28	.	.	PUNCT
finefocus-531	179	1	strain	strain	PROPN
finefocus-531	179	2	cc5c	cc5c	PROPN
finefocus-531	179	3	degrades	degrade	VERB
finefocus-531	179	4	starch	starch	NOUN
finefocus-531	179	5	as	as	SCONJ
finefocus-531	179	6	evidenced	evidence	VERB
finefocus-531	179	7	by	by	ADP
finefocus-531	179	8	positive	positive	ADJ
finefocus-531	179	9	tests	test	NOUN
finefocus-531	179	10	on	on	ADP
finefocus-531	179	11	both	both	CCONJ
finefocus-531	179	12	the	the	DET
finefocus-531	179	13	api	api	NOUN
finefocus-531	179	14	50ch	50ch	ADJ
finefocus-531	179	15	test	test	NOUN
finefocus-531	179	16	strips	strip	NOUN
finefocus-531	179	17	,	,	PUNCT
finefocus-531	179	18	starch	starch	NOUN
finefocus-531	179	19	plate	plate	NOUN
finefocus-531	179	20	assay	assay	VERB
finefocus-531	179	21	,	,	PUNCT
finefocus-531	179	22	as	as	ADV
finefocus-531	179	23	well	well	ADV
finefocus-531	179	24	as	as	ADP
finefocus-531	179	25	the	the	DET
finefocus-531	179	26	appearance	appearance	NOUN
finefocus-531	179	27	of	of	ADP
finefocus-531	179	28	organic	organic	ADJ
finefocus-531	179	29	acids	acid	NOUN
finefocus-531	179	30	under	under	ADP
finefocus-531	179	31	fermentative	fermentative	ADJ
finefocus-531	179	32	conditions	condition	NOUN
finefocus-531	179	33	suggesting	suggest	VERB
finefocus-531	179	34	the	the	DET
finefocus-531	179	35	strain	strain	NOUN
finefocus-531	179	36	has	have	VERB
finefocus-531	179	37	the	the	DET
finefocus-531	179	38	required	require	VERB
finefocus-531	179	39	amylase	amylase	NOUN
finefocus-531	179	40	activity	activity	NOUN
finefocus-531	179	41	and	and	CCONJ
finefocus-531	179	42	potentially	potentially	ADV
finefocus-531	179	43	an	an	DET
finefocus-531	179	44	import	import	NOUN
finefocus-531	179	45	mechanism	mechanism	NOUN
finefocus-531	179	46	for	for	ADP
finefocus-531	179	47	maltose	maltose	NOUN
finefocus-531	179	48	,	,	PUNCT
finefocus-531	179	49	which	which	PRON
finefocus-531	179	50	is	be	AUX
finefocus-531	179	51	supported	support	VERB
finefocus-531	179	52	by	by	ADP
finefocus-531	179	53	growth	growth	NOUN
finefocus-531	179	54	on	on	ADP
finefocus-531	179	55	maltose	maltose	ADJ
finefocus-531	179	56	,	,	PUNCT
finefocus-531	179	57	or	or	CCONJ
finefocus-531	179	58	higher	high	ADJ
finefocus-531	179	59	order	order	NOUN
finefocus-531	179	60	oligosaccharides	oligosaccharide	NOUN
finefocus-531	179	61	.	.	PUNCT
finefocus-531	180	1	this	this	PRON
finefocus-531	180	2	stands	stand	VERB
finefocus-531	180	3	in	in	ADP
finefocus-531	180	4	contrast	contrast	NOUN
finefocus-531	180	5	to	to	ADP
finefocus-531	180	6	other	other	ADJ
finefocus-531	180	7	organisms	organism	NOUN
finefocus-531	180	8	within	within	ADP
finefocus-531	180	9	the	the	DET
finefocus-531	180	10	genus	genus	NOUN
finefocus-531	180	11	of	of	ADP
finefocus-531	180	12	escherichia	escherichia	NOUN
finefocus-531	180	13	,	,	PUNCT
finefocus-531	180	14	which	which	PRON
finefocus-531	180	15	can	can	AUX
finefocus-531	180	16	not	not	PART
finefocus-531	180	17	degrade	degrade	VERB
finefocus-531	180	18	starch	starch	NOUN
finefocus-531	180	19	but	but	CCONJ
finefocus-531	180	20	can	can	AUX
finefocus-531	180	21	utilize	utilize	VERB
finefocus-531	180	22	maltose	maltose	NOUN
finefocus-531	180	23	.	.	PUNCT
finefocus-531	181	1	remarkably	remarkably	ADV
finefocus-531	181	2	,	,	PUNCT
finefocus-531	181	3	strain	strain	ADJ
finefocus-531	181	4	cc5c	cc5c	NUM
finefocus-531	181	5	utilizes	utilize	NOUN
finefocus-531	181	6	cellobiose	cellobiose	NOUN
finefocus-531	181	7	and	and	CCONJ
finefocus-531	181	8	sucrose	sucrose	VERB
finefocus-531	181	9	,	,	PUNCT
finefocus-531	181	10	which	which	PRON
finefocus-531	181	11	is	be	AUX
finefocus-531	181	12	uncharacteristic	uncharacteristic	ADJ
finefocus-531	181	13	for	for	ADP
finefocus-531	181	14	e.	e.	PROPN
finefocus-531	181	15	coli	coli	PROPN
finefocus-531	181	16	and	and	CCONJ
finefocus-531	181	17	other	other	ADJ
finefocus-531	181	18	closely	closely	ADV
finefocus-531	181	19	related	relate	VERB
finefocus-531	181	20	enteroacteriaceae	enteroacteriaceae	ADJ
finefocus-531	181	21	.	.	PUNCT
finefocus-531	182	1	a	a	DET
finefocus-531	182	2	follow	follow	VERB
finefocus-531	182	3	-	-	PUNCT
finefocus-531	182	4	up	up	ADP
finefocus-531	182	5	experiment	experiment	NOUN
finefocus-531	182	6	examining	examine	VERB
finefocus-531	182	7	the	the	DET
finefocus-531	182	8	fermentation	fermentation	NOUN
finefocus-531	182	9	of	of	ADP
finefocus-531	182	10	cellobiose	cellobiose	NOUN
finefocus-531	182	11	found	find	VERB
finefocus-531	182	12	that	that	SCONJ
finefocus-531	182	13	no	no	DET
finefocus-531	182	14	end	end	NOUN
finefocus-531	182	15	products	product	NOUN
finefocus-531	182	16	were	be	AUX
finefocus-531	182	17	detected	detect	VERB
finefocus-531	182	18	suggesting	suggest	VERB
finefocus-531	182	19	that	that	SCONJ
finefocus-531	182	20	the	the	DET
finefocus-531	182	21	result	result	NOUN
finefocus-531	182	22	of	of	ADP
finefocus-531	182	23	the	the	DET
finefocus-531	182	24	api	api	NOUN
finefocus-531	182	25	50ch	50ch	ADJ
finefocus-531	182	26	test	test	NOUN
finefocus-531	182	27	strip	strip	NOUN
finefocus-531	182	28	was	be	AUX
finefocus-531	182	29	a	a	DET
finefocus-531	182	30	false	false	ADJ
finefocus-531	182	31	positive	positive	ADJ
finefocus-531	182	32	or	or	CCONJ
finefocus-531	182	33	utilization	utilization	NOUN
finefocus-531	182	34	of	of	ADP
finefocus-531	182	35	cellobiose	cellobiose	NOUN
finefocus-531	182	36	is	be	AUX
finefocus-531	182	37	limited	limit	VERB
finefocus-531	182	38	to	to	ADP
finefocus-531	182	39	aerobic	aerobic	ADJ
finefocus-531	182	40	conditions	condition	NOUN
finefocus-531	182	41	.	.	PUNCT
finefocus-531	183	1	the	the	DET
finefocus-531	183	2	utilization	utilization	NOUN
finefocus-531	183	3	of	of	ADP
finefocus-531	183	4	dulcitol	dulcitol	PROPN
finefocus-531	183	5	,	,	PUNCT
finefocus-531	183	6	the	the	DET
finefocus-531	183	7	sugar	sugar	NOUN
finefocus-531	183	8	alcohol	alcohol	NOUN
finefocus-531	183	9	formed	form	VERB
finefocus-531	183	10	from	from	ADP
finefocus-531	183	11	the	the	DET
finefocus-531	183	12	reduction	reduction	NOUN
finefocus-531	183	13	of	of	ADP
finefocus-531	183	14	galactose	galactose	NOUN
finefocus-531	183	15	,	,	PUNCT
finefocus-531	183	16	is	be	AUX
finefocus-531	183	17	a	a	DET
finefocus-531	183	18	somewhat	somewhat	ADV
finefocus-531	183	19	unusual	unusual	ADJ
finefocus-531	183	20	feature	feature	NOUN
finefocus-531	183	21	.	.	PUNCT
finefocus-531	184	1	as	as	SCONJ
finefocus-531	184	2	can	can	AUX
finefocus-531	184	3	be	be	AUX
finefocus-531	184	4	seen	see	VERB
finefocus-531	184	5	in	in	ADP
finefocus-531	184	6	table	table	NOUN
finefocus-531	184	7	1	1	NUM
finefocus-531	184	8	,	,	PUNCT
finefocus-531	184	9	cc5c´s	cc5c´s	PROPN
finefocus-531	184	10	substrate	substrate	NOUN
finefocus-531	184	11	spectra	spectra	NOUN
finefocus-531	184	12	is	be	AUX
finefocus-531	184	13	more	more	ADV
finefocus-531	184	14	similar	similar	ADJ
finefocus-531	184	15	to	to	ADP
finefocus-531	184	16	e.	e.	PROPN
finefocus-531	184	17	coli	coli	PROPN
finefocus-531	184	18	than	than	ADP
finefocus-531	184	19	e.	e.	PROPN
finefocus-531	184	20	marmatoa	marmatoa	PROPN
finefocus-531	184	21	,	,	PUNCT
finefocus-531	184	22	its	its	PRON
finefocus-531	184	23	nearest	near	ADJ
finefocus-531	184	24	phylogenetic	phylogenetic	ADJ
finefocus-531	184	25	neighbour	neighbour	NOUN
finefocus-531	184	26	based	base	VERB
finefocus-531	184	27	on	on	ADP
finefocus-531	184	28	analysis	analysis	NOUN
finefocus-531	184	29	of	of	ADP
finefocus-531	184	30	the	the	DET
finefocus-531	184	31	16s	16	NOUN
finefocus-531	184	32	gene	gene	NOUN
finefocus-531	184	33	but	but	CCONJ
finefocus-531	184	34	also	also	ADV
finefocus-531	184	35	possesses	possess	VERB
finefocus-531	184	36	features	feature	VERB
finefocus-531	184	37	somewhat	somewhat	ADV
finefocus-531	184	38	similar	similar	ADJ
finefocus-531	184	39	to	to	ADP
finefocus-531	184	40	e.	e.	PROPN
finefocus-531	184	41	coli	coli	PROPN
finefocus-531	184	42	with	with	ADP
finefocus-531	184	43	some	some	PRON
finefocus-531	184	44	of	of	ADP
finefocus-531	184	45	the	the	DET
finefocus-531	184	46	aforementioned	aforementioned	ADJ
finefocus-531	184	47	differentiating	differentiate	VERB
finefocus-531	184	48	characteristics	characteristic	NOUN
finefocus-531	184	49	.	.	PUNCT
finefocus-531	185	1	the	the	DET
finefocus-531	185	2	number	number	NOUN
finefocus-531	185	3	of	of	ADP
finefocus-531	185	4	divergent	divergent	ADJ
finefocus-531	185	5	features	feature	NOUN
finefocus-531	185	6	may	may	AUX
finefocus-531	185	7	suggest	suggest	VERB
finefocus-531	185	8	that	that	SCONJ
finefocus-531	185	9	cc5c	cc5c	PROPN
finefocus-531	185	10	is	be	AUX
finefocus-531	185	11	a	a	DET
finefocus-531	185	12	novel	novel	ADJ
finefocus-531	185	13	species	specie	NOUN
finefocus-531	185	14	within	within	ADP
finefocus-531	185	15	the	the	DET
finefocus-531	185	16	genus	genus	NOUN
finefocus-531	185	17	.	.	PUNCT
finefocus-531	186	1	as	as	SCONJ
finefocus-531	186	2	the	the	DET
finefocus-531	186	3	environment	environment	NOUN
finefocus-531	186	4	from	from	ADP
finefocus-531	186	5	which	which	PRON
finefocus-531	186	6	cc5c	cc5c	PROPN
finefocus-531	186	7	was	be	AUX
finefocus-531	186	8	isolated	isolate	VERB
finefocus-531	186	9	is	be	AUX
finefocus-531	186	10	rich	rich	ADJ
finefocus-531	186	11	with	with	ADP
finefocus-531	186	12	macro	macro	ADJ
finefocus-531	186	13	algae	algae	NOUN
finefocus-531	186	14	species	specie	NOUN
finefocus-531	186	15	with	with	ADP
finefocus-531	186	16	high	high	ADJ
finefocus-531	186	17	protein	protein	NOUN
finefocus-531	186	18	fractions	fraction	NOUN
finefocus-531	186	19	as	as	ADV
finefocus-531	186	20	well	well	ADV
finefocus-531	186	21	as	as	ADP
finefocus-531	186	22	polysaccharides	polysaccharide	NOUN
finefocus-531	186	23	containing	contain	VERB
finefocus-531	186	24	methylpentoses	methylpentose	NOUN
finefocus-531	186	25	and	and	CCONJ
finefocus-531	186	26	other	other	ADJ
finefocus-531	186	27	sugars	sugar	NOUN
finefocus-531	186	28	not	not	PART
finefocus-531	186	29	common	common	ADJ
finefocus-531	186	30	within	within	ADP
finefocus-531	186	31	the	the	DET
finefocus-531	186	32	terrestrial	terrestrial	ADJ
finefocus-531	186	33	biosphere	biosphere	NOUN
finefocus-531	186	34	,	,	PUNCT
finefocus-531	186	35	the	the	DET
finefocus-531	186	36	strain	strain	NOUN
finefocus-531	186	37	will	will	AUX
finefocus-531	186	38	likely	likely	ADV
finefocus-531	186	39	thrive	thrive	VERB
finefocus-531	186	40	in	in	ADP
finefocus-531	186	41	this	this	DET
finefocus-531	186	42	substrate	substrate	NOUN
finefocus-531	186	43	-	-	PUNCT
finefocus-531	186	44	rich	rich	ADJ
finefocus-531	186	45	niche	niche	NOUN
finefocus-531	186	46	.	.	PUNCT
finefocus-531	187	1	the	the	DET
finefocus-531	187	2	strain	strain	NOUN
finefocus-531	187	3	also	also	ADV
finefocus-531	187	4	has	have	VERB
finefocus-531	187	5	acid	acid	ADJ
finefocus-531	187	6	and	and	CCONJ
finefocus-531	187	7	alkaline	alkaline	NOUN
finefocus-531	187	8	phosphatase	phosphatase	NOUN
finefocus-531	187	9	activities	activity	NOUN
finefocus-531	187	10	suggesting	suggest	VERB
finefocus-531	187	11	that	that	SCONJ
finefocus-531	187	12	cc5c	cc5c	PROPN
finefocus-531	187	13	might	might	AUX
finefocus-531	187	14	serve	serve	VERB
finefocus-531	187	15	a	a	DET
finefocus-531	187	16	role	role	NOUN
finefocus-531	187	17	mobilizing	mobilize	VERB
finefocus-531	187	18	phosphate	phosphate	NOUN
finefocus-531	187	19	in	in	ADP
finefocus-531	187	20	the	the	DET
finefocus-531	187	21	environment	environment	NOUN
finefocus-531	187	22	.	.	PUNCT
finefocus-531	188	1	cc5c	cc5c	PROPN
finefocus-531	188	2	also	also	ADV
finefocus-531	188	3	degrades	degrade	VERB
finefocus-531	188	4	casein	casein	NOUN
finefocus-531	188	5	and	and	CCONJ
finefocus-531	188	6	gelatin	gelatin	NOUN
finefocus-531	188	7	but	but	CCONJ
finefocus-531	188	8	lacks	lack	VERB
finefocus-531	188	9	trypsin	trypsin	NOUN
finefocus-531	188	10	and	and	CCONJ
finefocus-531	188	11	chymotrypsin	chymotrypsin	NOUN
finefocus-531	188	12	activities	activity	NOUN
finefocus-531	188	13	suggesting	suggest	VERB
finefocus-531	188	14	other	other	ADJ
finefocus-531	188	15	protease	protease	NOUN
finefocus-531	188	16	chemistries	chemistry	NOUN
finefocus-531	188	17	are	be	AUX
finefocus-531	188	18	present	present	ADJ
finefocus-531	188	19	.	.	PUNCT
finefocus-531	189	1	the	the	DET
finefocus-531	189	2	strain	strain	NOUN
finefocus-531	189	3	showed	show	VERB
finefocus-531	189	4	esterase	esterase	NOUN
finefocus-531	189	5	activity	activity	NOUN
finefocus-531	189	6	but	but	CCONJ
finefocus-531	189	7	not	not	PART
finefocus-531	189	8	lipase	lipase	NOUN
finefocus-531	189	9	activity	activity	NOUN
finefocus-531	189	10	,	,	PUNCT
finefocus-531	189	11	which	which	PRON
finefocus-531	189	12	is	be	AUX
finefocus-531	189	13	surprising	surprising	ADJ
finefocus-531	189	14	since	since	SCONJ
finefocus-531	189	15	this	this	DET
finefocus-531	189	16	bacterium	bacterium	NOUN
finefocus-531	189	17	was	be	AUX
finefocus-531	189	18	enriched	enrich	VERB
finefocus-531	189	19	on	on	ADP
finefocus-531	189	20	rapeseed	rapeseed	NOUN
finefocus-531	189	21	oil	oil	NOUN
finefocus-531	189	22	;	;	PUNCT
finefocus-531	189	23	this	this	PRON
finefocus-531	189	24	might	might	AUX
finefocus-531	189	25	suggest	suggest	VERB
finefocus-531	189	26	that	that	SCONJ
finefocus-531	189	27	cc5c	cc5c	PROPN
finefocus-531	189	28	was	be	AUX
finefocus-531	189	29	utilizing	utilize	VERB
finefocus-531	189	30	the	the	DET
finefocus-531	189	31	yeast	yeast	NOUN
finefocus-531	189	32	extract	extract	NOUN
finefocus-531	189	33	present	present	ADJ
finefocus-531	189	34	in	in	ADP
finefocus-531	189	35	the	the	DET
finefocus-531	189	36	medium	medium	NOUN
finefocus-531	189	37	.	.	PUNCT
finefocus-531	190	1	it	it	PRON
finefocus-531	190	2	is	be	AUX
finefocus-531	190	3	worth	worth	ADJ
finefocus-531	190	4	noting	note	VERB
finefocus-531	190	5	that	that	SCONJ
finefocus-531	190	6	cc5c	cc5c	PROPN
finefocus-531	190	7	possessed	possess	VERB
finefocus-531	190	8	at	at	ADP
finefocus-531	190	9	c8	c8	PROPN
finefocus-531	190	10	esterase	esterase	NOUN
finefocus-531	190	11	activity	activity	NOUN
finefocus-531	190	12	,	,	PUNCT
finefocus-531	190	13	unlike	unlike	ADP
finefocus-531	190	14	e.	e.	PROPN
finefocus-531	190	15	coli	coli	PROPN
finefocus-531	190	16	(	(	PUNCT
finefocus-531	190	17	dsm	dsm	PROPN
finefocus-531	190	18	30083	30083	NUM
finefocus-531	190	19	)	)	PUNCT
finefocus-531	190	20	.	.	PUNCT
finefocus-531	191	1	cc5c	cc5c	PROPN
finefocus-531	191	2	also	also	ADV
finefocus-531	191	3	showed	show	VERB
finefocus-531	191	4	phosphatase	phosphatase	NOUN
finefocus-531	191	5	activity	activity	NOUN
finefocus-531	191	6	which	which	PRON
finefocus-531	191	7	may	may	AUX
finefocus-531	191	8	help	help	VERB
finefocus-531	191	9	the	the	DET
finefocus-531	191	10	strain	strain	NOUN
finefocus-531	191	11	in	in	ADP
finefocus-531	191	12	scavenging	scavenge	VERB
finefocus-531	191	13	phosphate	phosphate	NOUN
finefocus-531	191	14	from	from	ADP
finefocus-531	191	15	inorganic	inorganic	ADJ
finefocus-531	191	16	or	or	CCONJ
finefocus-531	191	17	polyphosphates	polyphosphate	NOUN
finefocus-531	191	18	in	in	ADP
finefocus-531	191	19	the	the	DET
finefocus-531	191	20	environment	environment	NOUN
finefocus-531	191	21	to	to	PART
finefocus-531	191	22	support	support	VERB
finefocus-531	191	23	growth	growth	NOUN
finefocus-531	191	24	.	.	PUNCT
finefocus-531	192	1	to	to	PART
finefocus-531	192	2	further	far	ADV
finefocus-531	192	3	examine	examine	VERB
finefocus-531	192	4	the	the	DET
finefocus-531	192	5	end	end	NOUN
finefocus-531	192	6	products	product	NOUN
finefocus-531	192	7	produced	produce	VERB
finefocus-531	192	8	by	by	ADP
finefocus-531	192	9	cc5c	cc5c	PROPN
finefocus-531	192	10	,	,	PUNCT
finefocus-531	192	11	the	the	DET
finefocus-531	192	12	fermentation	fermentation	NOUN
finefocus-531	192	13	of	of	ADP
finefocus-531	192	14	selected	select	VERB
finefocus-531	192	15	substrates	substrate	NOUN
finefocus-531	192	16	was	be	AUX
finefocus-531	192	17	examined	examine	VERB
finefocus-531	192	18	.	.	PUNCT
finefocus-531	193	1	under	under	ADP
finefocus-531	193	2	anaerobic	anaerobic	ADJ
finefocus-531	193	3	conditions	condition	NOUN
finefocus-531	193	4	,	,	PUNCT
finefocus-531	193	5	the	the	DET
finefocus-531	193	6	dominant	dominant	ADJ
finefocus-531	193	7	end	end	NOUN
finefocus-531	193	8	products	product	NOUN
finefocus-531	193	9	are	be	AUX
finefocus-531	193	10	a	a	DET
finefocus-531	193	11	mixture	mixture	NOUN
finefocus-531	193	12	of	of	ADP
finefocus-531	193	13	ethanol	ethanol	NOUN
finefocus-531	193	14	,	,	PUNCT
finefocus-531	193	15	acetate	acetate	NOUN
finefocus-531	193	16	,	,	PUNCT
finefocus-531	193	17	and	and	CCONJ
finefocus-531	193	18	hydrogen	hydrogen	NOUN
finefocus-531	193	19	on	on	ADP
finefocus-531	193	20	most	most	ADJ
finefocus-531	193	21	substrates	substrate	NOUN
finefocus-531	193	22	examined	examine	VERB
finefocus-531	193	23	,	,	PUNCT
finefocus-531	193	24	with	with	ADP
finefocus-531	193	25	the	the	DET
finefocus-531	193	26	exception	exception	NOUN
finefocus-531	193	27	of	of	ADP
finefocus-531	193	28	l	l	NOUN
finefocus-531	193	29	-	-	NOUN
finefocus-531	193	30	fucose	fucose	NOUN
finefocus-531	193	31	and	and	CCONJ
finefocus-531	193	32	l	l	NOUN
finefocus-531	193	33	-	-	VERB
finefocus-531	193	34	rhamnose	rhamnose	NOUN
finefocus-531	193	35	,	,	PUNCT
finefocus-531	193	36	which	which	PRON
finefocus-531	193	37	yielded	yield	VERB
finefocus-531	193	38	1,2pd	1,2pd	NUM
finefocus-531	193	39	.	.	PUNCT
finefocus-531	194	1	the	the	DET
finefocus-531	194	2	observed	observe	VERB
finefocus-531	194	3	substrate	substrate	NOUN
finefocus-531	194	4	spectrum	spectrum	NOUN
finefocus-531	194	5	and	and	CCONJ
finefocus-531	194	6	end	end	VERB
finefocus-531	194	7	product	product	NOUN
finefocus-531	194	8	formation	formation	NOUN
finefocus-531	194	9	patterns	pattern	NOUN
finefocus-531	194	10	observed	observe	VERB
finefocus-531	194	11	for	for	ADP
finefocus-531	194	12	strain	strain	NOUN
finefocus-531	194	13	cc5c	cc5c	NUM
finefocus-531	194	14	is	be	AUX
finefocus-531	194	15	quite	quite	ADV
finefocus-531	194	16	similar	similar	ADJ
finefocus-531	194	17	to	to	ADP
finefocus-531	194	18	other	other	ADJ
finefocus-531	194	19	members	member	NOUN
finefocus-531	194	20	of	of	ADP
finefocus-531	194	21	the	the	DET
finefocus-531	194	22	family	family	NOUN
finefocus-531	194	23	of	of	ADP
finefocus-531	194	24	35applied	35applied	PROPN
finefocus-531	194	25	&	&	CCONJ
finefocus-531	194	26	environmental	environmental	ADJ
finefocus-531	194	27	microbiology	microbiology	NOUN
finefocus-531	194	28	•	•	PROPN
finefocus-531	194	29	enterobacteriaceae	enterobacteriaceae	PROPN
finefocus-531	194	30	,	,	PUNCT
finefocus-531	194	31	with	with	ADP
finefocus-531	194	32	members	member	NOUN
finefocus-531	194	33	such	such	ADJ
finefocus-531	194	34	as	as	ADP
finefocus-531	194	35	e.	e.	PROPN
finefocus-531	194	36	coli	coli	PROPN
finefocus-531	194	37	being	be	AUX
finefocus-531	194	38	well	well	ADV
finefocus-531	194	39	-	-	PUNCT
finefocus-531	194	40	established	establish	VERB
finefocus-531	194	41	mixed	mixed	ADJ
finefocus-531	194	42	acid	acid	NOUN
finefocus-531	194	43	producers	producer	NOUN
finefocus-531	194	44	as	as	ADV
finefocus-531	194	45	well	well	ADV
finefocus-531	194	46	as	as	ADP
finefocus-531	194	47	producers	producer	NOUN
finefocus-531	194	48	of	of	ADP
finefocus-531	194	49	1,2	1,2	NUM
finefocus-531	194	50	-	-	NOUN
finefocus-531	194	51	pd	pd	NOUN
finefocus-531	194	52	in	in	ADP
finefocus-531	194	53	the	the	DET
finefocus-531	194	54	presence	presence	NOUN
finefocus-531	194	55	of	of	ADP
finefocus-531	194	56	methylpentoses	methylpentose	NOUN
finefocus-531	194	57	.	.	PUNCT
finefocus-531	195	1	to	to	PART
finefocus-531	195	2	further	far	ADV
finefocus-531	195	3	investigate	investigate	VERB
finefocus-531	195	4	the	the	DET
finefocus-531	195	5	production	production	NOUN
finefocus-531	195	6	of	of	ADP
finefocus-531	195	7	1,2	1,2	NUM
finefocus-531	195	8	-	-	NOUN
finefocus-531	195	9	pd	pd	NOUN
finefocus-531	195	10	from	from	ADP
finefocus-531	195	11	cc5c	cc5c	PROPN
finefocus-531	195	12	,	,	PUNCT
finefocus-531	195	13	the	the	DET
finefocus-531	195	14	strain	strain	NOUN
finefocus-531	195	15	was	be	AUX
finefocus-531	195	16	cultivated	cultivate	VERB
finefocus-531	195	17	in	in	ADP
finefocus-531	195	18	the	the	DET
finefocus-531	195	19	presence	presence	NOUN
finefocus-531	195	20	of	of	ADP
finefocus-531	195	21	d	d	NOUN
finefocus-531	195	22	-	-	PUNCT
finefocus-531	195	23	glucose	glucose	NOUN
finefocus-531	195	24	as	as	ADV
finefocus-531	195	25	well	well	ADV
finefocus-531	195	26	as	as	ADP
finefocus-531	195	27	the	the	DET
finefocus-531	195	28	methylpentoses	methylpentose	NOUN
finefocus-531	195	29	l	l	NOUN
finefocus-531	195	30	-	-	NOUN
finefocus-531	195	31	fucose	fucose	NOUN
finefocus-531	195	32	and	and	CCONJ
finefocus-531	195	33	l	l	NOUN
finefocus-531	195	34	-	-	VERB
finefocus-531	195	35	rhamnose	rhamnose	NOUN
finefocus-531	195	36	at	at	ADP
finefocus-531	195	37	initial	initial	ADJ
finefocus-531	195	38	concentrations	concentration	NOUN
finefocus-531	195	39	ranging	range	VERB
finefocus-531	195	40	from	from	ADP
finefocus-531	195	41	10	10	NUM
finefocus-531	195	42	mm	mm	NOUN
finefocus-531	195	43	to	to	ADP
finefocus-531	195	44	60	60	NUM
finefocus-531	195	45	mm	mm	NOUN
finefocus-531	195	46	.	.	PUNCT
finefocus-531	195	47	strain	strain	PROPN
finefocus-531	195	48	cc5c	cc5c	NUM
finefocus-531	195	49	was	be	AUX
finefocus-531	195	50	clearly	clearly	ADV
finefocus-531	195	51	inhibited	inhibit	VERB
finefocus-531	195	52	by	by	ADP
finefocus-531	195	53	high	high	ADJ
finefocus-531	195	54	initial	initial	ADJ
finefocus-531	195	55	substrate	substrate	NOUN
finefocus-531	195	56	concentrations	concentration	NOUN
finefocus-531	195	57	of	of	ADP
finefocus-531	195	58	all	all	DET
finefocus-531	195	59	three	three	NUM
finefocus-531	195	60	monosaccharides	monosaccharide	NOUN
finefocus-531	195	61	examined	examine	VERB
finefocus-531	195	62	under	under	ADP
finefocus-531	195	63	aerobic	aerobic	ADJ
finefocus-531	195	64	and	and	CCONJ
finefocus-531	195	65	strictly	strictly	ADV
finefocus-531	195	66	anaerobic	anaerobic	ADJ
finefocus-531	195	67	conditions	condition	NOUN
finefocus-531	195	68	.	.	PUNCT
finefocus-531	196	1	1,2	1,2	NUM
finefocus-531	196	2	-	-	NUM
finefocus-531	196	3	pd	pd	NOUN
finefocus-531	196	4	was	be	AUX
finefocus-531	196	5	the	the	DET
finefocus-531	196	6	primary	primary	ADJ
finefocus-531	196	7	end	end	NOUN
finefocus-531	196	8	product	product	NOUN
finefocus-531	196	9	when	when	SCONJ
finefocus-531	196	10	cc5c	cc5c	PROPN
finefocus-531	196	11	was	be	AUX
finefocus-531	196	12	grown	grow	VERB
finefocus-531	196	13	on	on	ADP
finefocus-531	196	14	l	l	NOUN
finefocus-531	196	15	-	-	PUNCT
finefocus-531	196	16	rhamnose	rhamnose	ADJ
finefocus-531	196	17	and	and	CCONJ
finefocus-531	196	18	l	l	NOUN
finefocus-531	196	19	-	-	NOUN
finefocus-531	196	20	fucose	fucose	NOUN
finefocus-531	196	21	under	under	ADP
finefocus-531	196	22	both	both	CCONJ
finefocus-531	196	23	aerobic	aerobic	ADJ
finefocus-531	196	24	and	and	CCONJ
finefocus-531	196	25	anaerobic	anaerobic	ADJ
finefocus-531	196	26	conditions	condition	NOUN
finefocus-531	196	27	.	.	PUNCT
finefocus-531	197	1	interestingly	interestingly	ADV
finefocus-531	197	2	,	,	PUNCT
finefocus-531	197	3	very	very	ADV
finefocus-531	197	4	little	little	ADJ
finefocus-531	197	5	1,2	1,2	NUM
finefocus-531	197	6	-	-	SYM
finefocus-531	197	7	pd	pd	NOUN
finefocus-531	197	8	was	be	AUX
finefocus-531	197	9	produced	produce	VERB
finefocus-531	197	10	from	from	ADP
finefocus-531	197	11	l	l	NOUN
finefocus-531	197	12	-	-	VERB
finefocus-531	197	13	rhamnose	rhamnose	NOUN
finefocus-531	197	14	under	under	ADP
finefocus-531	197	15	anaerobic	anaerobic	ADJ
finefocus-531	197	16	conditions	condition	NOUN
finefocus-531	197	17	at	at	ADP
finefocus-531	197	18	all	all	DET
finefocus-531	197	19	concentrations	concentration	NOUN
finefocus-531	197	20	.	.	PUNCT
finefocus-531	198	1	under	under	ADP
finefocus-531	198	2	aerobic	aerobic	ADJ
finefocus-531	198	3	conditions	condition	NOUN
finefocus-531	198	4	,	,	PUNCT
finefocus-531	198	5	1,2	1,2	NUM
finefocus-531	198	6	-	-	PUNCT
finefocus-531	198	7	pd	pd	ADJ
finefocus-531	198	8	yields	yield	NOUN
finefocus-531	198	9	were	be	AUX
finefocus-531	198	10	much	much	ADV
finefocus-531	198	11	higher	high	ADJ
finefocus-531	198	12	although	although	SCONJ
finefocus-531	198	13	inhibition	inhibition	NOUN
finefocus-531	198	14	phenomena	phenomenon	NOUN
finefocus-531	198	15	were	be	AUX
finefocus-531	198	16	apparent	apparent	ADJ
finefocus-531	198	17	at	at	ADP
finefocus-531	198	18	higher	high	ADJ
finefocus-531	198	19	substrate	substrate	NOUN
finefocus-531	198	20	concentrations	concentration	NOUN
finefocus-531	198	21	.	.	PUNCT
finefocus-531	199	1	this	this	DET
finefocus-531	199	2	stark	stark	ADJ
finefocus-531	199	3	shift	shift	NOUN
finefocus-531	199	4	in	in	ADP
finefocus-531	199	5	end	end	NOUN
finefocus-531	199	6	product	product	NOUN
finefocus-531	199	7	formation	formation	NOUN
finefocus-531	199	8	could	could	AUX
finefocus-531	199	9	implicate	implicate	VERB
finefocus-531	199	10	the	the	DET
finefocus-531	199	11	importance	importance	NOUN
finefocus-531	199	12	of	of	ADP
finefocus-531	199	13	oxygen	oxygen	NOUN
finefocus-531	199	14	in	in	ADP
finefocus-531	199	15	the	the	DET
finefocus-531	199	16	ability	ability	NOUN
finefocus-531	199	17	of	of	ADP
finefocus-531	199	18	the	the	DET
finefocus-531	199	19	strain	strain	NOUN
finefocus-531	199	20	to	to	PART
finefocus-531	199	21	produce	produce	VERB
finefocus-531	199	22	1,2	1,2	NUM
finefocus-531	199	23	-	-	SYM
finefocus-531	199	24	pd	pd	NOUN
finefocus-531	199	25	.	.	PUNCT
finefocus-531	200	1	it	it	PRON
finefocus-531	200	2	is	be	AUX
finefocus-531	200	3	known	know	VERB
finefocus-531	200	4	that	that	SCONJ
finefocus-531	200	5	during	during	ADP
finefocus-531	200	6	the	the	DET
finefocus-531	200	7	production	production	NOUN
finefocus-531	200	8	of	of	ADP
finefocus-531	200	9	2,3	2,3	NOUN
finefocus-531	200	10	-	-	NOUN
finefocus-531	200	11	butanediol	butanediol	NOUN
finefocus-531	200	12	by	by	ADP
finefocus-531	200	13	organisms	organism	NOUN
finefocus-531	200	14	such	such	ADJ
finefocus-531	200	15	as	as	ADP
finefocus-531	200	16	paenibacillus	paenibacillus	ADJ
finefocus-531	200	17	polymyxa	polymyxa	NOUN
finefocus-531	200	18	,	,	PUNCT
finefocus-531	200	19	that	that	SCONJ
finefocus-531	200	20	the	the	DET
finefocus-531	200	21	oxygen	oxygen	NOUN
finefocus-531	200	22	concentration	concentration	NOUN
finefocus-531	200	23	is	be	AUX
finefocus-531	200	24	of	of	ADP
finefocus-531	200	25	critical	critical	ADJ
finefocus-531	200	26	importance	importance	NOUN
finefocus-531	200	27	(	(	PUNCT
finefocus-531	200	28	22	22	NUM
finefocus-531	200	29	)	)	PUNCT
finefocus-531	200	30	.	.	PUNCT
finefocus-531	201	1	furthermore	furthermore	ADV
finefocus-531	201	2	,	,	PUNCT
finefocus-531	201	3	studies	study	NOUN
finefocus-531	201	4	in	in	ADP
finefocus-531	201	5	the	the	DET
finefocus-531	201	6	1980s	1980	NOUN
finefocus-531	201	7	examined	examine	VERB
finefocus-531	201	8	changes	change	NOUN
finefocus-531	201	9	in	in	ADP
finefocus-531	201	10	the	the	DET
finefocus-531	201	11	regulation	regulation	NOUN
finefocus-531	201	12	,	,	PUNCT
finefocus-531	201	13	expression	expression	NOUN
finefocus-531	201	14	and	and	CCONJ
finefocus-531	201	15	activity	activity	NOUN
finefocus-531	201	16	of	of	ADP
finefocus-531	201	17	propanediol	propanediol	NOUN
finefocus-531	201	18	oxidoreductase	oxidoreductase	NOUN
finefocus-531	201	19	by	by	ADP
finefocus-531	201	20	e.	e.	PROPN
finefocus-531	201	21	coli	coli	PROPN
finefocus-531	201	22	under	under	ADP
finefocus-531	201	23	specific	specific	ADJ
finefocus-531	201	24	oxygen	oxygen	NOUN
finefocus-531	201	25	conditions	condition	NOUN
finefocus-531	201	26	(	(	PUNCT
finefocus-531	201	27	5	5	NUM
finefocus-531	201	28	,	,	PUNCT
finefocus-531	201	29	7	7	NUM
finefocus-531	201	30	)	)	PUNCT
finefocus-531	201	31	.	.	PUNCT
finefocus-531	202	1	it	it	PRON
finefocus-531	202	2	is	be	AUX
finefocus-531	202	3	possible	possible	ADJ
finefocus-531	202	4	that	that	SCONJ
finefocus-531	202	5	reducing	reduce	VERB
finefocus-531	202	6	potential	potential	NOUN
finefocus-531	202	7	from	from	ADP
finefocus-531	202	8	rhamnose	rhamnose	ADJ
finefocus-531	202	9	metabolism	metabolism	NOUN
finefocus-531	202	10	is	be	AUX
finefocus-531	202	11	being	be	AUX
finefocus-531	202	12	shifted	shift	VERB
finefocus-531	202	13	to	to	ADP
finefocus-531	202	14	other	other	ADJ
finefocus-531	202	15	end	end	NOUN
finefocus-531	202	16	products	product	NOUN
finefocus-531	202	17	or	or	CCONJ
finefocus-531	202	18	that	that	SCONJ
finefocus-531	202	19	highly	highly	ADV
finefocus-531	202	20	reduced	reduce	VERB
finefocus-531	202	21	conditions	condition	NOUN
finefocus-531	202	22	interfere	interfere	VERB
finefocus-531	202	23	with	with	ADP
finefocus-531	202	24	enzymes	enzyme	NOUN
finefocus-531	202	25	necessary	necessary	ADJ
finefocus-531	202	26	for	for	ADP
finefocus-531	202	27	rhamnose	rhamnose	NOUN
finefocus-531	202	28	catabolism	catabolism	NOUN
finefocus-531	202	29	that	that	PRON
finefocus-531	202	30	are	be	AUX
finefocus-531	202	31	specific	specific	ADJ
finefocus-531	202	32	to	to	PART
finefocus-531	202	33	rhamnose	rhamnose	VERB
finefocus-531	202	34	regulation	regulation	NOUN
finefocus-531	202	35	but	but	CCONJ
finefocus-531	202	36	do	do	AUX
finefocus-531	202	37	not	not	PART
finefocus-531	202	38	affect	affect	VERB
finefocus-531	202	39	the	the	DET
finefocus-531	202	40	enzymes	enzyme	NOUN
finefocus-531	202	41	involved	involve	VERB
finefocus-531	202	42	in	in	ADP
finefocus-531	202	43	fucose	fucose	ADJ
finefocus-531	202	44	catabolism	catabolism	NOUN
finefocus-531	202	45	.	.	PUNCT
finefocus-531	203	1	the	the	DET
finefocus-531	203	2	presence	presence	NOUN
finefocus-531	203	3	and	and	CCONJ
finefocus-531	203	4	organization	organization	NOUN
finefocus-531	203	5	of	of	ADP
finefocus-531	203	6	the	the	DET
finefocus-531	203	7	rhamnose	rhamnose	NOUN
finefocus-531	203	8	and	and	CCONJ
finefocus-531	203	9	fucose	fucose	ADJ
finefocus-531	203	10	operons	operon	NOUN
finefocus-531	203	11	,	,	PUNCT
finefocus-531	203	12	if	if	SCONJ
finefocus-531	203	13	present	present	ADJ
finefocus-531	203	14	,	,	PUNCT
finefocus-531	203	15	should	should	AUX
finefocus-531	203	16	be	be	AUX
finefocus-531	203	17	investigated	investigate	VERB
finefocus-531	203	18	via	via	ADP
finefocus-531	203	19	whole	whole	ADJ
finefocus-531	203	20	genome	genome	NOUN
finefocus-531	203	21	sequencing	sequencing	NOUN
finefocus-531	203	22	or	or	CCONJ
finefocus-531	203	23	specific	specific	ADJ
finefocus-531	203	24	assays	assay	NOUN
finefocus-531	203	25	to	to	PART
finefocus-531	203	26	confirm	confirm	VERB
finefocus-531	203	27	the	the	DET
finefocus-531	203	28	presence	presence	NOUN
finefocus-531	203	29	and	and	CCONJ
finefocus-531	203	30	functionality	functionality	NOUN
finefocus-531	203	31	of	of	ADP
finefocus-531	203	32	specific	specific	ADJ
finefocus-531	203	33	gene	gene	NOUN
finefocus-531	203	34	products	product	NOUN
finefocus-531	203	35	.	.	PUNCT
finefocus-531	204	1	analysis	analysis	NOUN
finefocus-531	204	2	of	of	ADP
finefocus-531	204	3	cc5c	cc5c	PROPN
finefocus-531	204	4	’s	’s	PART
finefocus-531	204	5	transcriptome	transcriptome	NOUN
finefocus-531	204	6	,	,	PUNCT
finefocus-531	204	7	as	as	ADV
finefocus-531	204	8	well	well	ADV
finefocus-531	204	9	as	as	ADP
finefocus-531	204	10	the	the	DET
finefocus-531	204	11	activities	activity	NOUN
finefocus-531	204	12	of	of	ADP
finefocus-531	204	13	specific	specific	ADJ
finefocus-531	204	14	enzymes	enzyme	NOUN
finefocus-531	204	15	,	,	PUNCT
finefocus-531	204	16	such	such	ADJ
finefocus-531	204	17	as	as	ADP
finefocus-531	204	18	propanediol	propanediol	NOUN
finefocus-531	204	19	oxidoreductase	oxidoreductase	NOUN
finefocus-531	204	20	as	as	ADP
finefocus-531	204	21	a	a	DET
finefocus-531	204	22	function	function	NOUN
finefocus-531	204	23	of	of	ADP
finefocus-531	204	24	oxygen	oxygen	NOUN
finefocus-531	204	25	concentration	concentration	NOUN
finefocus-531	204	26	,	,	PUNCT
finefocus-531	204	27	should	should	AUX
finefocus-531	204	28	also	also	ADV
finefocus-531	204	29	be	be	AUX
finefocus-531	204	30	considered	consider	VERB
finefocus-531	204	31	in	in	ADP
finefocus-531	204	32	future	future	ADJ
finefocus-531	204	33	work	work	NOUN
finefocus-531	204	34	.	.	PUNCT
finefocus-531	205	1	at	at	ADP
finefocus-531	205	2	high	high	ADJ
finefocus-531	205	3	glucose	glucose	NOUN
finefocus-531	205	4	concentrations	concentration	NOUN
finefocus-531	205	5	,	,	PUNCT
finefocus-531	205	6	the	the	DET
finefocus-531	205	7	amount	amount	NOUN
finefocus-531	205	8	of	of	ADP
finefocus-531	205	9	1,2	1,2	NUM
finefocus-531	205	10	-	-	PUNCT
finefocus-531	205	11	pd	pd	NOUN
finefocus-531	205	12	increased	increase	VERB
finefocus-531	205	13	to	to	ADP
finefocus-531	205	14	7.9	7.9	NUM
finefocus-531	205	15	mm	mm	NOUN
finefocus-531	205	16	at	at	ADP
finefocus-531	205	17	an	an	DET
finefocus-531	205	18	initial	initial	ADJ
finefocus-531	205	19	glucose	glucose	NOUN
finefocus-531	205	20	concentration	concentration	NOUN
finefocus-531	205	21	of	of	ADP
finefocus-531	205	22	60	60	NUM
finefocus-531	205	23	mm	mm	NOUN
finefocus-531	205	24	as	as	SCONJ
finefocus-531	205	25	compared	compare	VERB
finefocus-531	205	26	to	to	ADP
finefocus-531	205	27	only	only	ADV
finefocus-531	205	28	0.3	0.3	NUM
finefocus-531	205	29	mm	mm	NOUN
finefocus-531	205	30	of	of	ADP
finefocus-531	205	31	1,2	1,2	NUM
finefocus-531	205	32	-	-	NOUN
finefocus-531	205	33	pd	pd	NOUN
finefocus-531	205	34	at	at	ADP
finefocus-531	205	35	an	an	DET
finefocus-531	205	36	initial	initial	ADJ
finefocus-531	205	37	glucose	glucose	NOUN
finefocus-531	205	38	concentration	concentration	NOUN
finefocus-531	205	39	of	of	ADP
finefocus-531	205	40	10	10	NUM
finefocus-531	205	41	mm	mm	NOUN
finefocus-531	205	42	.	.	PUNCT
finefocus-531	206	1	this	this	PRON
finefocus-531	206	2	may	may	AUX
finefocus-531	206	3	be	be	AUX
finefocus-531	206	4	due	due	ADJ
finefocus-531	206	5	to	to	ADP
finefocus-531	206	6	the	the	DET
finefocus-531	206	7	rapid	rapid	ADJ
finefocus-531	206	8	metabolism	metabolism	NOUN
finefocus-531	206	9	of	of	ADP
finefocus-531	206	10	glucose	glucose	NOUN
finefocus-531	206	11	to	to	ADP
finefocus-531	206	12	glycolysis	glycolysis	NOUN
finefocus-531	206	13	intermediates	intermediate	NOUN
finefocus-531	206	14	such	such	ADJ
finefocus-531	206	15	as	as	ADP
finefocus-531	206	16	dihydroxyacetone	dihydroxyacetone	NOUN
finefocus-531	206	17	phosphate	phosphate	NOUN
finefocus-531	206	18	(	(	PUNCT
finefocus-531	206	19	dhap	dhap	NOUN
finefocus-531	206	20	)	)	PUNCT
finefocus-531	206	21	,	,	PUNCT
finefocus-531	206	22	while	while	SCONJ
finefocus-531	206	23	further	further	ADJ
finefocus-531	206	24	metabolism	metabolism	NOUN
finefocus-531	206	25	to	to	ADP
finefocus-531	206	26	other	other	ADJ
finefocus-531	206	27	end	end	NOUN
finefocus-531	206	28	products	product	NOUN
finefocus-531	206	29	was	be	AUX
finefocus-531	206	30	inhibited	inhibit	VERB
finefocus-531	206	31	.	.	PUNCT
finefocus-531	207	1	to	to	PART
finefocus-531	207	2	proceed	proceed	VERB
finefocus-531	207	3	through	through	ADP
finefocus-531	207	4	glycolysis	glycolysis	NOUN
finefocus-531	207	5	,	,	PUNCT
finefocus-531	207	6	dhap	dhap	PROPN
finefocus-531	207	7	must	must	AUX
finefocus-531	207	8	be	be	AUX
finefocus-531	207	9	converted	convert	VERB
finefocus-531	207	10	to	to	ADP
finefocus-531	207	11	glyceraldehyde3	glyceraldehyde3	NOUN
finefocus-531	207	12	-	-	PUNCT
finefocus-531	207	13	phosphate	phosphate	NOUN
finefocus-531	207	14	(	(	PUNCT
finefocus-531	207	15	g3p	g3p	NOUN
finefocus-531	207	16	)	)	PUNCT
finefocus-531	207	17	,	,	PUNCT
finefocus-531	207	18	which	which	PRON
finefocus-531	207	19	serves	serve	VERB
finefocus-531	207	20	as	as	ADP
finefocus-531	207	21	a	a	DET
finefocus-531	207	22	metabolic	metabolic	NOUN
finefocus-531	207	23	bottleneck	bottleneck	NOUN
finefocus-531	207	24	resulting	result	VERB
finefocus-531	207	25	in	in	ADP
finefocus-531	207	26	carbon	carbon	NOUN
finefocus-531	207	27	flowing	flow	VERB
finefocus-531	207	28	into	into	ADP
finefocus-531	207	29	the	the	DET
finefocus-531	207	30	methyglyoxal	methyglyoxal	NOUN
finefocus-531	207	31	bypass	bypass	NOUN
finefocus-531	207	32	.	.	PUNCT
finefocus-531	208	1	this	this	DET
finefocus-531	208	2	pathway	pathway	NOUN
finefocus-531	208	3	is	be	AUX
finefocus-531	208	4	well	well	ADV
finefocus-531	208	5	known	know	VERB
finefocus-531	208	6	to	to	PART
finefocus-531	208	7	produce	produce	VERB
finefocus-531	208	8	(	(	PUNCT
finefocus-531	208	9	r)1,2	r)1,2	NOUN
finefocus-531	208	10	-	-	PUNCT
finefocus-531	208	11	propanediol	propanediol	NOUN
finefocus-531	208	12	in	in	ADP
finefocus-531	208	13	e.	e.	PROPN
finefocus-531	208	14	coli	coli	NOUN
finefocus-531	208	15	and	and	CCONJ
finefocus-531	208	16	yeasts	yeast	NOUN
finefocus-531	208	17	and	and	CCONJ
finefocus-531	208	18	could	could	AUX
finefocus-531	208	19	be	be	AUX
finefocus-531	208	20	active	active	ADJ
finefocus-531	208	21	in	in	ADP
finefocus-531	208	22	thermoanaerobacterium	thermoanaerobacterium	ADJ
finefocus-531	208	23	saccharolyticum	saccharolyticum	NOUN
finefocus-531	208	24	hg-8	hg-8	X
finefocus-531	208	25	(	(	PUNCT
finefocus-531	208	26	3	3	NUM
finefocus-531	208	27	)	)	PUNCT
finefocus-531	208	28	.	.	PUNCT
finefocus-531	209	1	phosphate	phosphate	ADJ
finefocus-531	209	2	limitation	limitation	NOUN
finefocus-531	209	3	could	could	AUX
finefocus-531	209	4	also	also	ADV
finefocus-531	209	5	be	be	AUX
finefocus-531	209	6	a	a	DET
finefocus-531	209	7	factor	factor	NOUN
finefocus-531	209	8	at	at	ADP
finefocus-531	209	9	higher	high	ADJ
finefocus-531	209	10	initial	initial	ADJ
finefocus-531	209	11	substrate	substrate	NOUN
finefocus-531	209	12	concentrations	concentration	NOUN
finefocus-531	209	13	as	as	SCONJ
finefocus-531	209	14	phosphate	phosphate	ADJ
finefocus-531	209	15	limiting	limiting	NOUN
finefocus-531	209	16	conditions	condition	NOUN
finefocus-531	209	17	is	be	AUX
finefocus-531	209	18	known	know	VERB
finefocus-531	209	19	to	to	PART
finefocus-531	209	20	influence	influence	VERB
finefocus-531	209	21	the	the	DET
finefocus-531	209	22	flow	flow	NOUN
finefocus-531	209	23	of	of	ADP
finefocus-531	209	24	carbon	carbon	NOUN
finefocus-531	209	25	into	into	ADP
finefocus-531	209	26	the	the	DET
finefocus-531	209	27	methylglyoxal	methylglyoxal	ADJ
finefocus-531	209	28	pathway	pathway	NOUN
finefocus-531	209	29	as	as	SCONJ
finefocus-531	209	30	has	have	AUX
finefocus-531	209	31	been	be	AUX
finefocus-531	209	32	demonstrated	demonstrate	VERB
finefocus-531	209	33	with	with	ADP
finefocus-531	209	34	clostridium	clostridium	NOUN
finefocus-531	209	35	sphenoides	sphenoide	NOUN
finefocus-531	209	36	(	(	PUNCT
finefocus-531	209	37	31	31	NUM
finefocus-531	209	38	)	)	PUNCT
finefocus-531	209	39	.	.	PUNCT
finefocus-531	210	1	there	there	PRON
finefocus-531	210	2	have	have	AUX
finefocus-531	210	3	been	be	AUX
finefocus-531	210	4	many	many	ADJ
finefocus-531	210	5	recent	recent	ADJ
finefocus-531	210	6	efforts	effort	NOUN
finefocus-531	210	7	to	to	PART
finefocus-531	210	8	engineer	engineer	VERB
finefocus-531	210	9	(	(	PUNCT
finefocus-531	210	10	r)-1,2	r)-1,2	NOUN
finefocus-531	210	11	-	-	ADJ
finefocus-531	210	12	pd	pd	ADJ
finefocus-531	210	13	producing	produce	VERB
finefocus-531	210	14	pathways	pathway	NOUN
finefocus-531	210	15	into	into	ADP
finefocus-531	210	16	e.	e.	PROPN
finefocus-531	210	17	coli	coli	NOUN
finefocus-531	210	18	to	to	PART
finefocus-531	210	19	improve	improve	VERB
finefocus-531	210	20	yields	yield	NOUN
finefocus-531	210	21	although	although	SCONJ
finefocus-531	210	22	efforts	effort	NOUN
finefocus-531	210	23	to	to	PART
finefocus-531	210	24	improve	improve	VERB
finefocus-531	210	25	(	(	PUNCT
finefocus-531	210	26	s)-1,2	s)-1,2	ADJ
finefocus-531	210	27	-	-	PUNCT
finefocus-531	210	28	pd	pd	NOUN
finefocus-531	210	29	production	production	NOUN
finefocus-531	210	30	have	have	AUX
finefocus-531	210	31	been	be	AUX
finefocus-531	210	32	largely	largely	ADV
finefocus-531	210	33	ignored	ignore	VERB
finefocus-531	210	34	.	.	PUNCT
finefocus-531	211	1	a	a	DET
finefocus-531	211	2	kinetic	kinetic	ADJ
finefocus-531	211	3	study	study	NOUN
finefocus-531	211	4	of	of	ADP
finefocus-531	211	5	1,2	1,2	NUM
finefocus-531	211	6	-	-	PUNCT
finefocus-531	211	7	pd	pd	NOUN
finefocus-531	211	8	production	production	NOUN
finefocus-531	211	9	by	by	ADP
finefocus-531	211	10	strain	strain	NOUN
finefocus-531	211	11	cc5c	cc5c	NUM
finefocus-531	211	12	reveals	reveal	VERB
finefocus-531	211	13	that	that	SCONJ
finefocus-531	211	14	the	the	DET
finefocus-531	211	15	methylpentoses	methylpentose	NOUN
finefocus-531	211	16	are	be	AUX
finefocus-531	211	17	rapidly	rapidly	ADV
finefocus-531	211	18	consumed	consume	VERB
finefocus-531	211	19	while	while	SCONJ
finefocus-531	211	20	1,2	1,2	NUM
finefocus-531	211	21	-	-	PUNCT
finefocus-531	211	22	pd	pd	NOUN
finefocus-531	211	23	production	production	NOUN
finefocus-531	211	24	lags	lag	VERB
finefocus-531	211	25	.	.	PUNCT
finefocus-531	212	1	this	this	PRON
finefocus-531	212	2	suggests	suggest	VERB
finefocus-531	212	3	that	that	SCONJ
finefocus-531	212	4	the	the	DET
finefocus-531	212	5	metabolism	metabolism	NOUN
finefocus-531	212	6	of	of	ADP
finefocus-531	212	7	intermediates	intermediate	NOUN
finefocus-531	212	8	involved	involve	VERB
finefocus-531	212	9	in	in	ADP
finefocus-531	212	10	methylpentose	methylpentose	ADJ
finefocus-531	212	11	catabolism	catabolism	NOUN
finefocus-531	212	12	is	be	AUX
finefocus-531	212	13	slower	slow	ADJ
finefocus-531	212	14	than	than	ADP
finefocus-531	212	15	that	that	PRON
finefocus-531	212	16	of	of	ADP
finefocus-531	212	17	the	the	DET
finefocus-531	212	18	glycolytic	glycolytic	ADJ
finefocus-531	212	19	intermediates	intermediate	NOUN
finefocus-531	212	20	of	of	ADP
finefocus-531	212	21	cells	cell	NOUN
finefocus-531	212	22	grown	grow	VERB
finefocus-531	212	23	on	on	ADP
finefocus-531	212	24	glucose	glucose	NOUN
finefocus-531	212	25	.	.	PUNCT
finefocus-531	213	1	36	36	NUM
finefocus-531	213	2	•	•	NUM
finefocus-531	213	3	fine	fine	ADJ
finefocus-531	213	4	focus	focus	NOUN
finefocus-531	213	5	,	,	PUNCT
finefocus-531	213	6	vol	vol	NOUN
finefocus-531	213	7	.	.	PUNCT
finefocus-531	213	8	4(1	4(1	NOUN
finefocus-531	213	9	)	)	PUNCT
finefocus-531	213	10	conclusions	conclusion	NOUN
finefocus-531	213	11	cc5c	cc5c	PROPN
finefocus-531	213	12	partially	partially	ADV
finefocus-531	213	13	degraded	degrade	VERB
finefocus-531	213	14	rac-1,2	rac-1,2	NOUN
finefocus-531	213	15	-	-	PUNCT
finefocus-531	213	16	pd	pd	NOUN
finefocus-531	213	17	to	to	ADP
finefocus-531	213	18	roughly	roughly	ADV
finefocus-531	213	19	50	50	NUM
finefocus-531	213	20	%	%	NOUN
finefocus-531	213	21	of	of	ADP
finefocus-531	213	22	its	its	PRON
finefocus-531	213	23	initial	initial	ADJ
finefocus-531	213	24	concentration	concentration	NOUN
finefocus-531	213	25	.	.	PUNCT
finefocus-531	214	1	this	this	PRON
finefocus-531	214	2	suggests	suggest	VERB
finefocus-531	214	3	that	that	SCONJ
finefocus-531	214	4	the	the	DET
finefocus-531	214	5	strain	strain	NOUN
finefocus-531	214	6	may	may	AUX
finefocus-531	214	7	only	only	ADV
finefocus-531	214	8	degrade	degrade	VERB
finefocus-531	214	9	one	one	NUM
finefocus-531	214	10	enantiomer	enantiomer	NOUN
finefocus-531	214	11	of	of	ADP
finefocus-531	214	12	1,2	1,2	NUM
finefocus-531	214	13	-	-	PUNCT
finefocus-531	214	14	pd	pd	NOUN
finefocus-531	214	15	.	.	PROPN
finefocus-531	215	1	as	as	SCONJ
finefocus-531	215	2	the	the	DET
finefocus-531	215	3	1,2	1,2	NUM
finefocus-531	215	4	-	-	PUNCT
finefocus-531	215	5	pd	pd	ADJ
finefocus-531	215	6	concentrations	concentration	NOUN
finefocus-531	215	7	were	be	AUX
finefocus-531	215	8	stable	stable	ADJ
finefocus-531	215	9	in	in	ADP
finefocus-531	215	10	the	the	DET
finefocus-531	215	11	experiments	experiment	NOUN
finefocus-531	215	12	using	use	VERB
finefocus-531	215	13	l	l	NOUN
finefocus-531	215	14	-	-	NOUN
finefocus-531	215	15	fucose	fucose	NOUN
finefocus-531	215	16	and	and	CCONJ
finefocus-531	215	17	l	l	NOUN
finefocus-531	215	18	-	-	VERB
finefocus-531	215	19	rhamnose	rhamnose	NOUN
finefocus-531	215	20	as	as	ADP
finefocus-531	215	21	a	a	DET
finefocus-531	215	22	carbon	carbon	NOUN
finefocus-531	215	23	source	source	NOUN
finefocus-531	215	24	cc5c	cc5c	PROPN
finefocus-531	215	25	likely	likely	ADV
finefocus-531	215	26	produces	produce	VERB
finefocus-531	215	27	the	the	DET
finefocus-531	215	28	s	s	PART
finefocus-531	215	29	enantiomer	enantiomer	NOUN
finefocus-531	215	30	.	.	PUNCT
finefocus-531	216	1	it	it	PRON
finefocus-531	216	2	is	be	AUX
finefocus-531	216	3	likely	likely	ADJ
finefocus-531	216	4	that	that	SCONJ
finefocus-531	216	5	cc5c	cc5c	PROPN
finefocus-531	216	6	can	can	AUX
finefocus-531	216	7	only	only	ADV
finefocus-531	216	8	degrade	degrade	VERB
finefocus-531	216	9	the	the	DET
finefocus-531	216	10	r	r	NOUN
finefocus-531	216	11	enantiomer	enantiomer	NOUN
finefocus-531	216	12	or	or	CCONJ
finefocus-531	216	13	degrades	degrade	VERB
finefocus-531	216	14	one	one	NUM
finefocus-531	216	15	enantiomer	enantiomer	NOUN
finefocus-531	216	16	at	at	ADP
finefocus-531	216	17	a	a	DET
finefocus-531	216	18	faster	fast	ADJ
finefocus-531	216	19	rate	rate	NOUN
finefocus-531	216	20	.	.	PUNCT
finefocus-531	217	1	this	this	PRON
finefocus-531	217	2	may	may	AUX
finefocus-531	217	3	have	have	VERB
finefocus-531	217	4	potential	potential	ADJ
finefocus-531	217	5	biotechnological	biotechnological	ADJ
finefocus-531	217	6	applications	application	NOUN
finefocus-531	217	7	in	in	ADP
finefocus-531	217	8	the	the	DET
finefocus-531	217	9	production	production	NOUN
finefocus-531	217	10	of	of	ADP
finefocus-531	217	11	enantiomerically	enantiomerically	ADV
finefocus-531	217	12	pure	pure	ADJ
finefocus-531	217	13	1,2	1,2	NUM
finefocus-531	217	14	-	-	NOUN
finefocus-531	217	15	pd	pd	NOUN
finefocus-531	217	16	from	from	ADP
finefocus-531	217	17	inexpensive	inexpensive	ADJ
finefocus-531	217	18	commercially	commercially	ADV
finefocus-531	217	19	available	available	ADJ
finefocus-531	217	20	racemic	racemic	ADJ
finefocus-531	217	21	1,2	1,2	NUM
finefocus-531	217	22	-	-	NOUN
finefocus-531	217	23	pd	pd	NOUN
finefocus-531	217	24	as	as	SCONJ
finefocus-531	217	25	has	have	AUX
finefocus-531	217	26	been	be	AUX
finefocus-531	217	27	done	do	VERB
finefocus-531	217	28	with	with	ADP
finefocus-531	217	29	strains	strain	NOUN
finefocus-531	217	30	of	of	ADP
finefocus-531	217	31	baker	baker	PROPN
finefocus-531	217	32	’s	’s	PART
finefocus-531	217	33	yeast	yeast	NOUN
finefocus-531	217	34	(	(	PUNCT
finefocus-531	217	35	16	16	NUM
finefocus-531	217	36	)	)	PUNCT
finefocus-531	217	37	.	.	PUNCT
finefocus-531	218	1	further	further	ADJ
finefocus-531	218	2	work	work	NOUN
finefocus-531	218	3	is	be	AUX
finefocus-531	218	4	needed	need	VERB
finefocus-531	218	5	to	to	PART
finefocus-531	218	6	confirm	confirm	VERB
finefocus-531	218	7	the	the	DET
finefocus-531	218	8	enantiomeric	enantiomeric	ADJ
finefocus-531	218	9	selectivity	selectivity	NOUN
finefocus-531	218	10	of	of	ADP
finefocus-531	218	11	1,2	1,2	NUM
finefocus-531	218	12	-	-	PUNCT
finefocus-531	218	13	pd	pd	NOUN
finefocus-531	218	14	degradation	degradation	NOUN
finefocus-531	218	15	by	by	ADP
finefocus-531	218	16	cc5c	cc5c	PROPN
finefocus-531	218	17	.	.	PUNCT
finefocus-531	219	1	the	the	DET
finefocus-531	219	2	high	high	ADJ
finefocus-531	219	3	yields	yield	NOUN
finefocus-531	219	4	of	of	ADP
finefocus-531	219	5	1,2	1,2	NUM
finefocus-531	219	6	-	-	PUNCT
finefocus-531	219	7	pd	pd	NOUN
finefocus-531	219	8	observed	observe	VERB
finefocus-531	219	9	on	on	ADP
finefocus-531	219	10	l	l	NOUN
finefocus-531	219	11	-	-	NOUN
finefocus-531	219	12	fucose	fucose	NOUN
finefocus-531	219	13	are	be	AUX
finefocus-531	219	14	promising	promise	VERB
finefocus-531	219	15	although	although	SCONJ
finefocus-531	219	16	l	l	NOUN
finefocus-531	219	17	-	-	NOUN
finefocus-531	219	18	fucose	fucose	NOUN
finefocus-531	219	19	is	be	AUX
finefocus-531	219	20	an	an	DET
finefocus-531	219	21	expensive	expensive	ADJ
finefocus-531	219	22	substrate	substrate	NOUN
finefocus-531	219	23	.	.	PUNCT
finefocus-531	220	1	thus	thus	ADV
finefocus-531	220	2	,	,	PUNCT
finefocus-531	220	3	inexpensive	inexpensive	ADJ
finefocus-531	220	4	sources	source	NOUN
finefocus-531	220	5	of	of	ADP
finefocus-531	220	6	l	l	NOUN
finefocus-531	220	7	-	-	NOUN
finefocus-531	220	8	fucose	fucose	NOUN
finefocus-531	220	9	should	should	AUX
finefocus-531	220	10	be	be	AUX
finefocus-531	220	11	examined	examine	VERB
finefocus-531	220	12	,	,	PUNCT
finefocus-531	220	13	potentially	potentially	ADV
finefocus-531	220	14	including	include	VERB
finefocus-531	220	15	hydrolysates	hydrolysate	NOUN
finefocus-531	220	16	of	of	ADP
finefocus-531	220	17	components	component	NOUN
finefocus-531	220	18	found	find	VERB
finefocus-531	220	19	in	in	ADP
finefocus-531	220	20	brown	brown	ADJ
finefocus-531	220	21	macro	macro	ADJ
finefocus-531	220	22	algae	algae	NOUN
finefocus-531	220	23	.	.	PUNCT
finefocus-531	221	1	further	further	ADJ
finefocus-531	221	2	work	work	VERB
finefocus-531	221	3	to	to	PART
finefocus-531	221	4	evaluate	evaluate	VERB
finefocus-531	221	5	the	the	DET
finefocus-531	221	6	ubiquity	ubiquity	NOUN
finefocus-531	221	7	of	of	ADP
finefocus-531	221	8	methylpentose	methylpentose	ADJ
finefocus-531	221	9	metabolism	metabolism	NOUN
finefocus-531	221	10	resulting	result	VERB
finefocus-531	221	11	in	in	ADP
finefocus-531	221	12	1,2pd	1,2pd	NUM
finefocus-531	221	13	production	production	NOUN
finefocus-531	221	14	by	by	ADP
finefocus-531	221	15	members	member	NOUN
finefocus-531	221	16	of	of	ADP
finefocus-531	221	17	the	the	DET
finefocus-531	221	18	genus	genus	NOUN
finefocus-531	221	19	requires	require	VERB
finefocus-531	221	20	further	further	ADJ
finefocus-531	221	21	examination	examination	NOUN
finefocus-531	221	22	.	.	PUNCT
finefocus-531	222	1	additionally	additionally	ADV
finefocus-531	222	2	,	,	PUNCT
finefocus-531	222	3	bioprospecting	bioprospecte	VERB
finefocus-531	222	4	efforts	effort	NOUN
finefocus-531	222	5	to	to	PART
finefocus-531	222	6	find	find	VERB
finefocus-531	222	7	1,2	1,2	NUM
finefocus-531	222	8	-	-	PUNCT
finefocus-531	222	9	pd	pd	ADJ
finefocus-531	222	10	strain	strain	NOUN
finefocus-531	222	11	cc5c	cc5c	PROPN
finefocus-531	222	12	is	be	AUX
finefocus-531	222	13	a	a	DET
finefocus-531	222	14	gram	gram	NOUN
finefocus-531	222	15	-	-	PUNCT
finefocus-531	222	16	negative	negative	ADJ
finefocus-531	222	17	,	,	PUNCT
finefocus-531	222	18	facultative	facultative	ADJ
finefocus-531	222	19	anaerobe	anaerobe	NOUN
finefocus-531	222	20	isolated	isolate	VERB
finefocus-531	222	21	from	from	ADP
finefocus-531	222	22	a	a	DET
finefocus-531	222	23	geothermally	geothermally	ADV
finefocus-531	222	24	-	-	PUNCT
finefocus-531	222	25	heated	heat	VERB
finefocus-531	222	26	intertidal	intertidal	ADJ
finefocus-531	222	27	pool	pool	NOUN
finefocus-531	222	28	in	in	ADP
finefocus-531	222	29	husavik	husavik	NOUN
finefocus-531	222	30	,	,	PUNCT
finefocus-531	222	31	iceland	iceland	PROPN
finefocus-531	222	32	,	,	PUNCT
finefocus-531	222	33	and	and	CCONJ
finefocus-531	222	34	is	be	AUX
finefocus-531	222	35	closely	closely	ADV
finefocus-531	222	36	related	relate	VERB
finefocus-531	222	37	to	to	PART
finefocus-531	222	38	escherichia	escherichia	VERB
finefocus-531	222	39	marmotae	marmotae	NOUN
finefocus-531	222	40	(	(	PUNCT
finefocus-531	222	41	99.13	99.13	NUM
finefocus-531	222	42	%	%	NOUN
finefocus-531	222	43	)	)	PUNCT
finefocus-531	222	44	and	and	CCONJ
finefocus-531	222	45	shigella	shigella	PROPN
finefocus-531	222	46	dysenteriae(99.13	dysenteriae(99.13	PROPN
finefocus-531	222	47	%	%	NOUN
finefocus-531	222	48	)	)	PUNCT
finefocus-531	222	49	.	.	PUNCT
finefocus-531	223	1	the	the	DET
finefocus-531	223	2	strain	strain	NOUN
finefocus-531	223	3	had	have	VERB
finefocus-531	223	4	optimum	optimum	ADJ
finefocus-531	223	5	growth	growth	NOUN
finefocus-531	223	6	conditions	condition	NOUN
finefocus-531	223	7	of	of	ADP
finefocus-531	223	8	40	40	NUM
finefocus-531	223	9	°	°	NOUN
finefocus-531	223	10	c	c	NOUN
finefocus-531	223	11	,	,	PUNCT
finefocus-531	223	12	ph	ph	NOUN
finefocus-531	223	13	7.5	7.5	NUM
finefocus-531	223	14	and	and	CCONJ
finefocus-531	223	15	0.5	0.5	NUM
finefocus-531	223	16	%	%	NOUN
finefocus-531	223	17	nacl	nacl	NOUN
finefocus-531	223	18	with	with	ADP
finefocus-531	223	19	a	a	DET
finefocus-531	223	20	maximum	maximum	ADJ
finefocus-531	223	21	specific	specific	ADJ
finefocus-531	223	22	growth	growth	NOUN
finefocus-531	223	23	rate	rate	NOUN
finefocus-531	223	24	of	of	ADP
finefocus-531	223	25	1.10	1.10	NUM
finefocus-531	223	26	h-1	h-1	NOUN
finefocus-531	223	27	.	.	PUNCT
finefocus-531	224	1	the	the	DET
finefocus-531	224	2	strain	strain	NOUN
finefocus-531	224	3	has	have	VERB
finefocus-531	224	4	a	a	DET
finefocus-531	224	5	broad	broad	ADJ
finefocus-531	224	6	substrate	substrate	NOUN
finefocus-531	224	7	spectrum	spectrum	NOUN
finefocus-531	224	8	and	and	CCONJ
finefocus-531	224	9	grew	grow	VERB
finefocus-531	224	10	on	on	ADP
finefocus-531	224	11	a	a	DET
finefocus-531	224	12	number	number	NOUN
finefocus-531	224	13	of	of	ADP
finefocus-531	224	14	substrates	substrate	NOUN
finefocus-531	224	15	(	(	PUNCT
finefocus-531	224	16	dulcitol	dulcitol	PROPN
finefocus-531	224	17	,	,	PUNCT
finefocus-531	224	18	cellobiose	cellobiose	NOUN
finefocus-531	224	19	,	,	PUNCT
finefocus-531	224	20	starch	starch	NOUN
finefocus-531	224	21	,	,	PUNCT
finefocus-531	224	22	producing	produce	VERB
finefocus-531	224	23	strains	strain	NOUN
finefocus-531	224	24	adapted	adapt	VERB
finefocus-531	224	25	in	in	ADP
finefocus-531	224	26	situ	situ	NOUN
finefocus-531	224	27	to	to	ADP
finefocus-531	224	28	more	more	ADV
finefocus-531	224	29	extreme	extreme	ADJ
finefocus-531	224	30	environments	environment	NOUN
finefocus-531	224	31	as	as	ADV
finefocus-531	224	32	well	well	ADV
finefocus-531	224	33	as	as	ADP
finefocus-531	224	34	possessing	possess	VERB
finefocus-531	224	35	expanded	expand	VERB
finefocus-531	224	36	substrate	substrate	NOUN
finefocus-531	224	37	spectra	spectra	NOUN
finefocus-531	224	38	would	would	AUX
finefocus-531	224	39	be	be	AUX
finefocus-531	224	40	of	of	ADP
finefocus-531	224	41	potential	potential	ADJ
finefocus-531	224	42	interest	interest	NOUN
finefocus-531	224	43	to	to	ADP
finefocus-531	224	44	the	the	DET
finefocus-531	224	45	industry	industry	NOUN
finefocus-531	224	46	.	.	PUNCT
finefocus-531	225	1	further	further	ADJ
finefocus-531	225	2	work	work	NOUN
finefocus-531	225	3	is	be	AUX
finefocus-531	225	4	needed	need	VERB
finefocus-531	225	5	to	to	PART
finefocus-531	225	6	investigate	investigate	VERB
finefocus-531	225	7	the	the	DET
finefocus-531	225	8	influence	influence	NOUN
finefocus-531	225	9	of	of	ADP
finefocus-531	225	10	culture	culture	NOUN
finefocus-531	225	11	parameters	parameter	NOUN
finefocus-531	225	12	,	,	PUNCT
finefocus-531	225	13	such	such	ADJ
finefocus-531	225	14	as	as	ADP
finefocus-531	225	15	the	the	DET
finefocus-531	225	16	partial	partial	ADJ
finefocus-531	225	17	pressure	pressure	NOUN
finefocus-531	225	18	of	of	ADP
finefocus-531	225	19	oxygen	oxygen	NOUN
finefocus-531	225	20	and	and	CCONJ
finefocus-531	225	21	hydrogen	hydrogen	NOUN
finefocus-531	225	22	,	,	PUNCT
finefocus-531	225	23	effect	effect	NOUN
finefocus-531	225	24	of	of	ADP
finefocus-531	225	25	ph	ph	NOUN
finefocus-531	225	26	and	and	CCONJ
finefocus-531	225	27	temperature	temperature	NOUN
finefocus-531	225	28	,	,	PUNCT
finefocus-531	225	29	as	as	ADV
finefocus-531	225	30	well	well	ADV
finefocus-531	225	31	as	as	ADP
finefocus-531	225	32	the	the	DET
finefocus-531	225	33	effect	effect	NOUN
finefocus-531	225	34	of	of	ADP
finefocus-531	225	35	phosphate	phosphate	ADJ
finefocus-531	225	36	limitation	limitation	NOUN
finefocus-531	225	37	on	on	ADP
finefocus-531	225	38	the	the	DET
finefocus-531	225	39	production	production	NOUN
finefocus-531	225	40	of	of	ADP
finefocus-531	225	41	1,2	1,2	NUM
finefocus-531	225	42	-	-	NOUN
finefocus-531	225	43	pd	pd	NOUN
finefocus-531	225	44	on	on	ADP
finefocus-531	225	45	specific	specific	ADJ
finefocus-531	225	46	substrates	substrate	NOUN
finefocus-531	225	47	.	.	PUNCT
finefocus-531	226	1	the	the	DET
finefocus-531	226	2	molecular	molecular	ADJ
finefocus-531	226	3	biology	biology	NOUN
finefocus-531	226	4	involved	involve	VERB
finefocus-531	226	5	in	in	ADP
finefocus-531	226	6	the	the	DET
finefocus-531	226	7	changes	change	NOUN
finefocus-531	226	8	in	in	ADP
finefocus-531	226	9	1,2pd	1,2pd	NUM
finefocus-531	226	10	production	production	NOUN
finefocus-531	226	11	from	from	ADP
finefocus-531	226	12	l	l	NOUN
finefocus-531	226	13	-	-	VERB
finefocus-531	226	14	rhamnose	rhamnose	NOUN
finefocus-531	226	15	under	under	ADP
finefocus-531	226	16	aerobic	aerobic	ADJ
finefocus-531	226	17	versus	versus	ADP
finefocus-531	226	18	strictly	strictly	ADV
finefocus-531	226	19	anaerobic	anaerobic	ADJ
finefocus-531	226	20	conditions	condition	NOUN
finefocus-531	226	21	warrants	warrant	NOUN
finefocus-531	226	22	further	further	ADJ
finefocus-531	226	23	study	study	NOUN
finefocus-531	226	24	.	.	PUNCT
finefocus-531	227	1	the	the	DET
finefocus-531	227	2	response	response	NOUN
finefocus-531	227	3	of	of	ADP
finefocus-531	227	4	cc5c	cc5c	PROPN
finefocus-531	227	5	to	to	ADP
finefocus-531	227	6	inhibitory	inhibitory	ADJ
finefocus-531	227	7	compounds	compound	NOUN
finefocus-531	227	8	such	such	ADJ
finefocus-531	227	9	as	as	ADP
finefocus-531	227	10	5	5	NUM
finefocus-531	227	11	-	-	NUM
finefocus-531	227	12	hydroxylmethylfurfuraldhyde	hydroxylmethylfurfuraldhyde	NOUN
finefocus-531	227	13	and	and	CCONJ
finefocus-531	227	14	2	2	NUM
finefocus-531	227	15	-	-	PUNCT
finefocus-531	227	16	furfuraldehyde	furfuraldehyde	NOUN
finefocus-531	227	17	,	,	PUNCT
finefocus-531	227	18	and	and	CCONJ
finefocus-531	227	19	production	production	NOUN
finefocus-531	227	20	of	of	ADP
finefocus-531	227	21	1,2	1,2	NUM
finefocus-531	227	22	-	-	NOUN
finefocus-531	227	23	pd	pd	NOUN
finefocus-531	227	24	from	from	ADP
finefocus-531	227	25	biomass	biomass	NOUN
finefocus-531	227	26	,	,	PUNCT
finefocus-531	227	27	containing	contain	VERB
finefocus-531	227	28	methylpentoses	methylpentose	NOUN
finefocus-531	227	29	should	should	AUX
finefocus-531	227	30	be	be	AUX
finefocus-531	227	31	investigated	investigate	VERB
finefocus-531	227	32	.	.	PUNCT
finefocus-531	228	1	due	due	ADP
finefocus-531	228	2	to	to	ADP
finefocus-531	228	3	the	the	DET
finefocus-531	228	4	observed	observe	VERB
finefocus-531	228	5	substrate	substrate	NOUN
finefocus-531	228	6	inhibition	inhibition	NOUN
finefocus-531	228	7	,	,	PUNCT
finefocus-531	228	8	other	other	ADJ
finefocus-531	228	9	fermentations	fermentation	NOUN
finefocus-531	228	10	modes	mode	NOUN
finefocus-531	228	11	such	such	ADJ
finefocus-531	228	12	as	as	ADP
finefocus-531	228	13	fed	fed	PROPN
finefocus-531	228	14	batch	batch	NOUN
finefocus-531	228	15	or	or	CCONJ
finefocus-531	228	16	continuous	continuous	ADJ
finefocus-531	228	17	culture	culture	NOUN
finefocus-531	228	18	should	should	AUX
finefocus-531	228	19	be	be	AUX
finefocus-531	228	20	investigated	investigate	VERB
finefocus-531	228	21	.	.	PUNCT
finefocus-531	229	1	also	also	ADV
finefocus-531	229	2	,	,	PUNCT
finefocus-531	229	3	the	the	DET
finefocus-531	229	4	inhibitory	inhibitory	ADJ
finefocus-531	229	5	effects	effect	NOUN
finefocus-531	229	6	of	of	ADP
finefocus-531	229	7	end	end	NOUN
finefocus-531	229	8	products	product	NOUN
finefocus-531	229	9	,	,	PUNCT
finefocus-531	229	10	such	such	ADJ
finefocus-531	229	11	as	as	ADP
finefocus-531	229	12	acetate	acetate	NOUN
finefocus-531	229	13	,	,	PUNCT
finefocus-531	229	14	lactate	lactate	NOUN
finefocus-531	229	15	,	,	PUNCT
finefocus-531	229	16	and	and	CCONJ
finefocus-531	229	17	1,2	1,2	NUM
finefocus-531	229	18	-	-	SYM
finefocus-531	229	19	pd	pd	ADJ
finefocus-531	229	20	,	,	PUNCT
finefocus-531	229	21	should	should	AUX
finefocus-531	229	22	be	be	AUX
finefocus-531	229	23	investigated	investigate	VERB
finefocus-531	229	24	to	to	PART
finefocus-531	229	25	better	well	ADV
finefocus-531	229	26	understand	understand	VERB
finefocus-531	229	27	whether	whether	SCONJ
finefocus-531	229	28	the	the	DET
finefocus-531	229	29	observed	observed	ADJ
finefocus-531	229	30	inhibition	inhibition	NOUN
finefocus-531	229	31	is	be	AUX
finefocus-531	229	32	solely	solely	ADV
finefocus-531	229	33	to	to	ADP
finefocus-531	229	34	the	the	DET
finefocus-531	229	35	initial	initial	ADJ
finefocus-531	229	36	concentration	concentration	NOUN
finefocus-531	229	37	of	of	ADP
finefocus-531	229	38	the	the	DET
finefocus-531	229	39	substrate	substrate	NOUN
finefocus-531	229	40	or	or	CCONJ
finefocus-531	229	41	another	another	DET
finefocus-531	229	42	type	type	NOUN
finefocus-531	229	43	of	of	ADP
finefocus-531	229	44	inhibition	inhibition	NOUN
finefocus-531	229	45	.	.	PUNCT
finefocus-531	230	1	and	and	CCONJ
finefocus-531	230	2	sucrose	sucrose	VERB
finefocus-531	230	3	)	)	PUNCT
finefocus-531	230	4	unlike	unlike	ADP
finefocus-531	230	5	a	a	DET
finefocus-531	230	6	number	number	NOUN
finefocus-531	230	7	of	of	ADP
finefocus-531	230	8	closely	closely	ADV
finefocus-531	230	9	related	relate	VERB
finefocus-531	230	10	species	specie	NOUN
finefocus-531	230	11	potentially	potentially	ADV
finefocus-531	230	12	suggesting	suggest	VERB
finefocus-531	230	13	that	that	SCONJ
finefocus-531	230	14	cc5c	cc5c	PROPN
finefocus-531	230	15	is	be	AUX
finefocus-531	230	16	a	a	DET
finefocus-531	230	17	novel	novel	NOUN
finefocus-531	230	18	isolate	isolate	NOUN
finefocus-531	230	19	.	.	PUNCT
finefocus-531	231	1	strain	strain	PROPN
finefocus-531	231	2	cc5c	cc5c	PROPN
finefocus-531	231	3	is	be	AUX
finefocus-531	231	4	also	also	ADV
finefocus-531	231	5	a	a	DET
finefocus-531	231	6	potent	potent	ADJ
finefocus-531	231	7	1,2	1,2	NUM
finefocus-531	231	8	-	-	PUNCT
finefocus-531	231	9	propaendiol	propaendiol	NOUN
finefocus-531	231	10	producing	produce	VERB
finefocus-531	231	11	organisms	organism	NOUN
finefocus-531	231	12	fermenting	ferment	VERB
finefocus-531	231	13	methylpentoses	methylpentose	NOUN
finefocus-531	231	14	to	to	ADP
finefocus-531	231	15	1,2	1,2	NUM
finefocus-531	231	16	-	-	NUM
finefocus-531	231	17	pd	pd	NOUN
finefocus-531	231	18	in	in	ADP
finefocus-531	231	19	good	good	ADJ
finefocus-531	231	20	yield	yield	NOUN
finefocus-531	231	21	(	(	PUNCT
finefocus-531	231	22	>	>	SYM
finefocus-531	231	23	95	95	NUM
finefocus-531	231	24	%	%	NOUN
finefocus-531	231	25	of	of	ADP
finefocus-531	231	26	theoretical	theoretical	ADJ
finefocus-531	231	27	)	)	PUNCT
finefocus-531	231	28	although	although	SCONJ
finefocus-531	231	29	some	some	DET
finefocus-531	231	30	1,2	1,2	NUM
finefocus-531	231	31	-	-	NUM
finefocus-531	231	32	pd	pd	NOUN
finefocus-531	231	33	was	be	AUX
finefocus-531	231	34	observed	observe	VERB
finefocus-531	231	35	on	on	ADP
finefocus-531	231	36	glucose	glucose	NOUN
finefocus-531	231	37	under	under	ADP
finefocus-531	231	38	high	high	ADJ
finefocus-531	231	39	initial	initial	ADJ
finefocus-531	231	40	substrate	substrate	NOUN
finefocus-531	231	41	concentrations	concentration	NOUN
finefocus-531	231	42	(	(	PUNCT
finefocus-531	231	43	aerobic	aerobic	ADJ
finefocus-531	231	44	versus	versus	ADP
finefocus-531	231	45	anaerobic	anaerobic	NOUN
finefocus-531	231	46	)	)	PUNCT
finefocus-531	231	47	.	.	PUNCT
finefocus-531	232	1	strain	strain	PROPN
finefocus-531	232	2	cc5c	cc5c	PROPN
finefocus-531	232	3	had	have	VERB
finefocus-531	232	4	a	a	DET
finefocus-531	232	5	maximum	maximum	ADJ
finefocus-531	232	6	production	production	NOUN
finefocus-531	232	7	rate	rate	NOUN
finefocus-531	232	8	of	of	ADP
finefocus-531	232	9	3.41	3.41	NUM
finefocus-531	232	10	mmol	mmol	NOUN
finefocus-531	232	11	/	/	SYM
finefocus-531	232	12	l	l	NOUN
finefocus-531	232	13	/	/	SYM
finefocus-531	232	14	h	h	NOUN
finefocus-531	232	15	from	from	ADP
finefocus-531	232	16	l	l	NOUN
finefocus-531	232	17	-	-	VERB
finefocus-531	232	18	rhamnose	rhamnose	NOUN
finefocus-531	232	19	under	under	ADP
finefocus-531	232	20	aerobic	aerobic	ADJ
finefocus-531	232	21	conditions	condition	NOUN
finefocus-531	232	22	.	.	PUNCT
finefocus-531	233	1	37applied	37applied	NUM
finefocus-531	233	2	&	&	CCONJ
finefocus-531	233	3	environmental	environmental	ADJ
finefocus-531	233	4	microbiology	microbiology	NOUN
finefocus-531	233	5	•	•	PROPN
finefocus-531	233	6	references	reference	NOUN
finefocus-531	233	7	1	1	NUM
finefocus-531	233	8	.	.	PUNCT
finefocus-531	233	9	almarsdottir	almarsdottir	PROPN
finefocus-531	233	10	,	,	PUNCT
finefocus-531	233	11	a.	a.	PROPN
finefocus-531	233	12	r.	r.	PROPN
finefocus-531	233	13	,	,	PUNCT
finefocus-531	233	14	tarazewicz	tarazewicz	NOUN
finefocus-531	233	15	,	,	PUNCT
finefocus-531	233	16	a.	a.	NOUN
finefocus-531	233	17	,	,	PUNCT
finefocus-531	233	18	gunnarsson	gunnarsson	PROPN
finefocus-531	233	19	,	,	PUNCT
finefocus-531	233	20	i.	i.	PROPN
finefocus-531	233	21	,	,	PUNCT
finefocus-531	233	22	&	&	CCONJ
finefocus-531	233	23	orlygsson	orlygsson	PROPN
finefocus-531	233	24	,	,	PUNCT
finefocus-531	233	25	j.	j.	PROPN
finefocus-531	233	26	(	(	PUNCT
finefocus-531	233	27	2010	2010	NUM
finefocus-531	233	28	)	)	PUNCT
finefocus-531	233	29	.	.	PUNCT
finefocus-531	234	1	hydrogen	hydrogen	NOUN
finefocus-531	234	2	production	production	NOUN
finefocus-531	234	3	from	from	ADP
finefocus-531	234	4	sugars	sugar	NOUN
finefocus-531	234	5	and	and	CCONJ
finefocus-531	234	6	complex	complex	ADJ
finefocus-531	234	7	biomass	biomass	NOUN
finefocus-531	234	8	by	by	ADP
finefocus-531	234	9	clostridium	clostridium	NOUN
finefocus-531	234	10	species	specie	NOUN
finefocus-531	234	11	,	,	PUNCT
finefocus-531	234	12	ak14	ak14	PROPN
finefocus-531	234	13	,	,	PUNCT
finefocus-531	234	14	isolated	isolate	VERB
finefocus-531	234	15	from	from	ADP
finefocus-531	234	16	icelandic	icelandic	ADJ
finefocus-531	234	17	hot	hot	ADJ
finefocus-531	234	18	spring	spring	NOUN
finefocus-531	234	19	.	.	PUNCT
finefocus-531	235	1	icelandic	icelandic	ADJ
finefocus-531	235	2	agricultural	agricultural	ADJ
finefocus-531	235	3	sciences	sciences	PROPN
finefocus-531	235	4	,	,	PUNCT
finefocus-531	235	5	23(1	23(1	NUM
finefocus-531	235	6	)	)	PUNCT
finefocus-531	235	7	,	,	PUNCT
finefocus-531	235	8	61–71	61–71	NOUN
finefocus-531	235	9	.	.	PUNCT
finefocus-531	236	1	2	2	NUM
finefocus-531	236	2	.	.	X
finefocus-531	236	3	altaras	altaras	PROPN
finefocus-531	236	4	,	,	PUNCT
finefocus-531	236	5	n.	n.	PROPN
finefocus-531	236	6	e.	e.	PROPN
finefocus-531	236	7	,	,	PUNCT
finefocus-531	236	8	&	&	CCONJ
finefocus-531	236	9	cameron	cameron	PROPN
finefocus-531	236	10	,	,	PUNCT
finefocus-531	236	11	d.	d.	PROPN
finefocus-531	236	12	c.	c.	PROPN
finefocus-531	236	13	(	(	PUNCT
finefocus-531	236	14	1999	1999	NUM
finefocus-531	236	15	)	)	PUNCT
finefocus-531	236	16	.	.	PUNCT
finefocus-531	237	1	metabolic	metabolic	NOUN
finefocus-531	237	2	engineering	engineering	NOUN
finefocus-531	237	3	of	of	ADP
finefocus-531	237	4	a	a	DET
finefocus-531	237	5	1,2	1,2	NUM
finefocus-531	237	6	-	-	PUNCT
finefocus-531	237	7	propanediol	propanediol	NOUN
finefocus-531	237	8	pathway	pathway	NOUN
finefocus-531	237	9	in	in	ADP
finefocus-531	237	10	escherichia	escherichia	NOUN
finefocus-531	237	11	coli	coli	NOUN
finefocus-531	237	12	.	.	PUNCT
finefocus-531	238	1	applied	apply	VERB
finefocus-531	238	2	and	and	CCONJ
finefocus-531	238	3	environmental	environmental	ADJ
finefocus-531	238	4	microbiology	microbiology	NOUN
finefocus-531	238	5	,	,	PUNCT
finefocus-531	238	6	65(3	65(3	NUM
finefocus-531	238	7	)	)	PUNCT
finefocus-531	238	8	,	,	PUNCT
finefocus-531	238	9	1180–5	1180–5	NUM
finefocus-531	238	10	.	.	NOUN
finefocus-531	239	1	3	3	NUM
finefocus-531	239	2	.	.	X
finefocus-531	239	3	altaras	altaras	PROPN
finefocus-531	239	4	,	,	PUNCT
finefocus-531	239	5	n.	n.	PROPN
finefocus-531	239	6	e.	e.	PROPN
finefocus-531	239	7	,	,	PUNCT
finefocus-531	239	8	etzel	etzel	PROPN
finefocus-531	239	9	,	,	PUNCT
finefocus-531	239	10	m.	m.	NOUN
finefocus-531	239	11	r.	r.	PROPN
finefocus-531	239	12	,	,	PUNCT
finefocus-531	239	13	&	&	CCONJ
finefocus-531	239	14	cameron	cameron	PROPN
finefocus-531	239	15	,	,	PUNCT
finefocus-531	239	16	d.	d.	PROPN
finefocus-531	239	17	c.	c.	PROPN
finefocus-531	239	18	(	(	PUNCT
finefocus-531	239	19	2001	2001	NUM
finefocus-531	239	20	)	)	PUNCT
finefocus-531	239	21	.	.	PUNCT
finefocus-531	240	1	conversion	conversion	NOUN
finefocus-531	240	2	of	of	ADP
finefocus-531	240	3	sugars	sugar	NOUN
finefocus-531	240	4	to	to	ADP
finefocus-531	240	5	1,2	1,2	NUM
finefocus-531	240	6	-	-	NOUN
finefocus-531	240	7	propanediol	propanediol	NOUN
finefocus-531	240	8	by	by	ADP
finefocus-531	240	9	thermoanaerobacterium	thermoanaerobacterium	PROPN
finefocus-531	240	10	thermosaccharolyticum	thermosaccharolyticum	PROPN
finefocus-531	240	11	hg-8	hg-8	PUNCT
finefocus-531	240	12	.	.	PUNCT
finefocus-531	241	1	biotechnology	biotechnology	NOUN
finefocus-531	241	2	progress	progress	NOUN
finefocus-531	241	3	,	,	PUNCT
finefocus-531	241	4	17	17	NUM
finefocus-531	241	5	,	,	PUNCT
finefocus-531	241	6	52–56	52–56	NUM
finefocus-531	241	7	.	.	NOUN
finefocus-531	241	8	4	4	NUM
finefocus-531	241	9	.	.	X
finefocus-531	241	10	baldomà	baldomà	PROPN
finefocus-531	241	11	,	,	PUNCT
finefocus-531	241	12	l.	l.	PROPN
finefocus-531	241	13	,	,	PUNCT
finefocus-531	241	14	&	&	CCONJ
finefocus-531	241	15	aguilar	aguilar	PROPN
finefocus-531	241	16	,	,	PUNCT
finefocus-531	241	17	j.	j.	PROPN
finefocus-531	241	18	(	(	PUNCT
finefocus-531	241	19	1988	1988	NUM
finefocus-531	241	20	)	)	PUNCT
finefocus-531	241	21	.	.	PUNCT
finefocus-531	242	1	metabolism	metabolism	NOUN
finefocus-531	242	2	of	of	ADP
finefocus-531	242	3	l	l	NOUN
finefocus-531	242	4	-	-	NOUN
finefocus-531	242	5	fucose	fucose	NOUN
finefocus-531	242	6	and	and	CCONJ
finefocus-531	242	7	l	l	NOUN
finefocus-531	242	8	-	-	VERB
finefocus-531	242	9	rhamnose	rhamnose	NOUN
finefocus-531	242	10	in	in	ADP
finefocus-531	242	11	escherichia	escherichia	NOUN
finefocus-531	242	12	coli	coli	NOUN
finefocus-531	242	13	:	:	PUNCT
finefocus-531	242	14	aerobic	aerobic	ADJ
finefocus-531	242	15	-	-	PUNCT
finefocus-531	242	16	anaerobic	anaerobic	NOUN
finefocus-531	242	17	regulation	regulation	NOUN
finefocus-531	242	18	of	of	ADP
finefocus-531	242	19	l	l	NOUN
finefocus-531	242	20	-	-	NOUN
finefocus-531	242	21	lactaldehyde	lactaldehyde	NOUN
finefocus-531	242	22	dissimilation	dissimilation	NOUN
finefocus-531	242	23	.	.	PUNCT
finefocus-531	243	1	journal	journal	PROPN
finefocus-531	243	2	of	of	ADP
finefocus-531	243	3	bacteriology	bacteriology	NOUN
finefocus-531	243	4	,	,	PUNCT
finefocus-531	243	5	170(1	170(1	NUM
finefocus-531	243	6	)	)	PUNCT
finefocus-531	243	7	,	,	PUNCT
finefocus-531	243	8	416–21	416–21	NOUN
finefocus-531	243	9	.	.	PUNCT
finefocus-531	244	1	5	5	NUM
finefocus-531	244	2	.	.	X
finefocus-531	244	3	baldoma	baldoma	PROPN
finefocus-531	244	4	,	,	PUNCT
finefocus-531	244	5	l.	l.	PROPN
finefocus-531	244	6	,	,	PUNCT
finefocus-531	244	7	badia	badia	PROPN
finefocus-531	244	8	,	,	PUNCT
finefocus-531	244	9	j.	j.	PROPN
finefocus-531	244	10	,	,	PUNCT
finefocus-531	244	11	obradors	obrador	NOUN
finefocus-531	244	12	,	,	PUNCT
finefocus-531	244	13	n.	n.	NOUN
finefocus-531	244	14	,	,	PUNCT
finefocus-531	244	15	&	&	CCONJ
finefocus-531	244	16	aguilar	aguilar	PROPN
finefocus-531	244	17	,	,	PUNCT
finefocus-531	244	18	j.	j.	PROPN
finefocus-531	244	19	(	(	PUNCT
finefocus-531	244	20	1988	1988	NUM
finefocus-531	244	21	)	)	PUNCT
finefocus-531	244	22	.	.	PUNCT
finefocus-531	245	1	aerobic	aerobic	ADJ
finefocus-531	245	2	excretion	excretion	NOUN
finefocus-531	245	3	of	of	ADP
finefocus-531	245	4	1,2	1,2	NUM
finefocus-531	245	5	-	-	NOUN
finefocus-531	245	6	propanediol	propanediol	NOUN
finefocus-531	245	7	by	by	ADP
finefocus-531	245	8	salmonella	salmonella	PROPN
finefocus-531	245	9	typhimurium	typhimurium	PROPN
finefocus-531	245	10	.	.	PUNCT
finefocus-531	246	1	journal	journal	PROPN
finefocus-531	246	2	of	of	ADP
finefocus-531	246	3	bacteriology	bacteriology	NOUN
finefocus-531	246	4	,	,	PUNCT
finefocus-531	246	5	170(6	170(6	NUM
finefocus-531	246	6	)	)	PUNCT
finefocus-531	246	7	,	,	PUNCT
finefocus-531	246	8	2884–5	2884–5	NUM
finefocus-531	246	9	.	.	NOUN
finefocus-531	246	10	6	6	NUM
finefocus-531	246	11	.	.	X
finefocus-531	247	1	bielen	bielen	PROPN
finefocus-531	247	2	,	,	PUNCT
finefocus-531	247	3	a.	a.	NOUN
finefocus-531	247	4	a.	a.	NOUN
finefocus-531	247	5	m.	m.	PROPN
finefocus-531	247	6	,	,	PUNCT
finefocus-531	247	7	verhaart	verhaart	NOUN
finefocus-531	247	8	,	,	PUNCT
finefocus-531	247	9	m.	m.	PROPN
finefocus-531	247	10	r.	r.	PROPN
finefocus-531	247	11	a.	a.	PROPN
finefocus-531	247	12	,	,	PUNCT
finefocus-531	247	13	van	van	PROPN
finefocus-531	247	14	der	der	PROPN
finefocus-531	247	15	oost	oost	PROPN
finefocus-531	247	16	,	,	PUNCT
finefocus-531	247	17	j.	j.	PROPN
finefocus-531	247	18	,	,	PUNCT
finefocus-531	247	19	&	&	CCONJ
finefocus-531	247	20	kengen	kengen	PROPN
finefocus-531	247	21	,	,	PUNCT
finefocus-531	247	22	s.	s.	PROPN
finefocus-531	247	23	w.	w.	PROPN
finefocus-531	247	24	m.	m.	PROPN
finefocus-531	247	25	(	(	PUNCT
finefocus-531	247	26	2013	2013	NUM
finefocus-531	247	27	)	)	PUNCT
finefocus-531	247	28	.	.	PUNCT
finefocus-531	248	1	biohydrogen	biohydrogen	ADJ
finefocus-531	248	2	production	production	NOUN
finefocus-531	248	3	by	by	ADP
finefocus-531	248	4	the	the	DET
finefocus-531	248	5	thermophilic	thermophilic	ADJ
finefocus-531	248	6	bacterium	bacterium	NOUN
finefocus-531	248	7	caldicellulosiruptor	caldicellulosiruptor	NOUN
finefocus-531	248	8	saccharolyticus	saccharolyticus	NOUN
finefocus-531	248	9	:	:	PUNCT
finefocus-531	248	10	current	current	ADJ
finefocus-531	248	11	status	status	NOUN
finefocus-531	248	12	and	and	CCONJ
finefocus-531	248	13	perspectives	perspective	NOUN
finefocus-531	248	14	.	.	PUNCT
finefocus-531	249	1	life	life	NOUN
finefocus-531	249	2	,	,	PUNCT
finefocus-531	249	3	3(1	3(1	NUM
finefocus-531	249	4	)	)	PUNCT
finefocus-531	249	5	,	,	PUNCT
finefocus-531	249	6	52–85	52–85	NUM
finefocus-531	249	7	.	.	PUNCT
finefocus-531	250	1	http://doi	http://doi	X
finefocus-531	250	2	.	.	PUNCT
finefocus-531	251	1	org/10.3390	org/10.3390	PROPN
finefocus-531	251	2	/	/	SYM
finefocus-531	251	3	life3010052	life3010052	PROPN
finefocus-531	251	4	7	7	NUM
finefocus-531	251	5	.	.	X
finefocus-531	251	6	boronat	boronat	PROPN
finefocus-531	251	7	,	,	PUNCT
finefocus-531	251	8	a.	a.	PROPN
finefocus-531	251	9	,	,	PUNCT
finefocus-531	251	10	&	&	CCONJ
finefocus-531	251	11	aguilar	aguilar	PROPN
finefocus-531	251	12	,	,	PUNCT
finefocus-531	251	13	j.	j.	PROPN
finefocus-531	251	14	(	(	PUNCT
finefocus-531	251	15	1981	1981	NUM
finefocus-531	251	16	)	)	PUNCT
finefocus-531	251	17	.	.	PUNCT
finefocus-531	252	1	metabolism	metabolism	NOUN
finefocus-531	252	2	of	of	ADP
finefocus-531	252	3	l	l	NOUN
finefocus-531	252	4	-	-	NOUN
finefocus-531	252	5	fucose	fucose	NOUN
finefocus-531	252	6	and	and	CCONJ
finefocus-531	252	7	l	l	NOUN
finefocus-531	252	8	-	-	VERB
finefocus-531	252	9	rhamnose	rhamnose	NOUN
finefocus-531	252	10	in	in	ADP
finefocus-531	252	11	escherichia	escherichia	NOUN
finefocus-531	252	12	coli	coli	NOUN
finefocus-531	252	13	:	:	PUNCT
finefocus-531	252	14	differences	difference	NOUN
finefocus-531	252	15	in	in	ADP
finefocus-531	252	16	induction	induction	NOUN
finefocus-531	252	17	of	of	ADP
finefocus-531	252	18	propanediol	propanediol	NOUN
finefocus-531	252	19	oxidoreductase	oxidoreductase	NOUN
finefocus-531	252	20	.	.	PUNCT
finefocus-531	253	1	journal	journal	PROPN
finefocus-531	253	2	of	of	ADP
finefocus-531	253	3	bacteriology	bacteriology	NOUN
finefocus-531	253	4	,	,	PUNCT
finefocus-531	253	5	147(1	147(1	NUM
finefocus-531	253	6	)	)	PUNCT
finefocus-531	253	7	,	,	PUNCT
finefocus-531	253	8	181–5.8.1	181–5.8.1	NUM
finefocus-531	253	9	8	8	NUM
finefocus-531	253	10	.	.	PUNCT
finefocus-531	253	11	brenner	brenner	PROPN
finefocus-531	253	12	,	,	PUNCT
finefocus-531	253	13	d.	d.	PROPN
finefocus-531	253	14	j.	j.	PROPN
finefocus-531	253	15	(	(	PUNCT
finefocus-531	253	16	2005	2005	NUM
finefocus-531	253	17	)	)	PUNCT
finefocus-531	253	18	.	.	PUNCT
finefocus-531	254	1	family	family	NOUN
finefocus-531	254	2	i.	i.	PROPN
finefocus-531	254	3	enterobacteriaceae	enterobacteriaceae	PROPN
finefocus-531	254	4	.	.	PUNCT
finefocus-531	255	1	in	in	ADP
finefocus-531	255	2	farmer	farmer	PROPN
finefocus-531	255	3	,	,	PUNCT
finefocus-531	255	4	j.j	j.j	PROPN
finefocus-531	255	5	.	.	PROPN
finefocus-531	255	6	(	(	PUNCT
finefocus-531	255	7	2nd	2nd	ADJ
finefocus-531	255	8	ed	ed	NOUN
finefocus-531	255	9	.	.	PROPN
finefocus-531	255	10	,	,	PUNCT
finefocus-531	255	11	pp	pp	ADP
finefocus-531	255	12	.	.	PUNCT
finefocus-531	256	1	587–607	587–607	NUM
finefocus-531	256	2	)	)	PUNCT
finefocus-531	256	3	.	.	PUNCT
finefocus-531	257	1	new	new	PROPN
finefocus-531	257	2	york	york	PROPN
finefocus-531	257	3	:	:	PUNCT
finefocus-531	257	4	springer	springer	NOUN
finefocus-531	257	5	.	.	PUNCT
finefocus-531	258	1	9	9	X
finefocus-531	258	2	.	.	X
finefocus-531	258	3	cameron	cameron	PROPN
finefocus-531	258	4	,	,	PUNCT
finefocus-531	258	5	d.	d.	PROPN
finefocus-531	258	6	c.	c.	PROPN
finefocus-531	258	7	,	,	PUNCT
finefocus-531	258	8	&	&	CCONJ
finefocus-531	258	9	cooney	cooney	PROPN
finefocus-531	258	10	,	,	PUNCT
finefocus-531	258	11	c.	c.	PROPN
finefocus-531	258	12	l.	l.	PROPN
finefocus-531	258	13	(	(	PUNCT
finefocus-531	258	14	1986	1986	NUM
finefocus-531	258	15	)	)	PUNCT
finefocus-531	258	16	.	.	PUNCT
finefocus-531	259	1	a	a	DET
finefocus-531	259	2	novel	novel	ADJ
finefocus-531	259	3	fermentation	fermentation	NOUN
finefocus-531	259	4	:	:	PUNCT
finefocus-531	259	5	the	the	DET
finefocus-531	259	6	production	production	NOUN
finefocus-531	259	7	of	of	ADP
finefocus-531	259	8	(	(	PUNCT
finefocus-531	259	9	r)-1,2	r)-1,2	NOUN
finefocus-531	259	10	-	-	NOUN
finefocus-531	259	11	propanediol	propanediol	NOUN
finefocus-531	259	12	and	and	CCONJ
finefocus-531	259	13	acetol	acetol	NOUN
finefocus-531	259	14	by	by	ADP
finefocus-531	259	15	clostridium	clostridium	NOUN
finefocus-531	259	16	thermosaccharolyticum	thermosaccharolyticum	NOUN
finefocus-531	259	17	.	.	PUNCT
finefocus-531	260	1	biotechnology	biotechnology	NOUN
finefocus-531	260	2	,	,	PUNCT
finefocus-531	260	3	4	4	NUM
finefocus-531	260	4	,	,	PUNCT
finefocus-531	260	5	651–654	651–654	NUM
finefocus-531	260	6	.	.	PUNCT
finefocus-531	261	1	10	10	NUM
finefocus-531	261	2	.	.	X
finefocus-531	261	3	chauvel	chauvel	PROPN
finefocus-531	261	4	,	,	PUNCT
finefocus-531	261	5	a.	a.	NOUN
finefocus-531	261	6	;	;	PUNCT
finefocus-531	261	7	lefebvre	lefebvre	PROPN
finefocus-531	261	8	,	,	PUNCT
finefocus-531	261	9	g.	g.	PROPN
finefocus-531	261	10	(	(	PUNCT
finefocus-531	261	11	1989	1989	NUM
finefocus-531	261	12	)	)	PUNCT
finefocus-531	261	13	.	.	PUNCT
finefocus-531	262	1	petrochemical	petrochemical	NOUN
finefocus-531	262	2	processes	process	NOUN
finefocus-531	262	3	volume	volume	NOUN
finefocus-531	262	4	2	2	NUM
finefocus-531	262	5	major	major	ADJ
finefocus-531	262	6	oxygenated	oxygenate	VERB
finefocus-531	262	7	,	,	PUNCT
finefocus-531	262	8	chlorinated	chlorinate	VERB
finefocus-531	262	9	,	,	PUNCT
finefocus-531	262	10	and	and	CCONJ
finefocus-531	262	11	nitrated	nitrated	ADJ
finefocus-531	262	12	derivatives	derivative	NOUN
finefocus-531	262	13	(	(	PUNCT
finefocus-531	262	14	2nd	2nd	ADJ
finefocus-531	262	15	ed	ed	NOUN
finefocus-531	262	16	.	.	PUNCT
finefocus-531	262	17	)	)	PUNCT
finefocus-531	262	18	.	.	PUNCT
finefocus-531	263	1	paris	paris	PROPN
finefocus-531	263	2	:	:	PUNCT
finefocus-531	263	3	institut	institut	PROPN
finefocus-531	263	4	francais	francais	PROPN
finefocus-531	263	5	du	du	PROPN
finefocus-531	263	6	pétrole	pétrole	PROPN
finefocus-531	263	7	publications	publication	NOUN
finefocus-531	263	8	.	.	PUNCT
finefocus-531	264	1	11	11	NUM
finefocus-531	264	2	.	.	PUNCT
finefocus-531	265	1	chen	chen	PROPN
finefocus-531	265	2	,	,	PUNCT
finefocus-531	265	3	y.	y.	PROPN
finefocus-531	265	4	m.	m.	PROPN
finefocus-531	265	5	,	,	PUNCT
finefocus-531	265	6	&	&	CCONJ
finefocus-531	265	7	lin	lin	PROPN
finefocus-531	265	8	,	,	PUNCT
finefocus-531	265	9	e.	e.	PROPN
finefocus-531	265	10	c.	c.	PROPN
finefocus-531	265	11	(	(	PUNCT
finefocus-531	265	12	1984	1984	NUM
finefocus-531	265	13	)	)	PUNCT
finefocus-531	265	14	.	.	PUNCT
finefocus-531	266	1	posttranscriptional	posttranscriptional	ADJ
finefocus-531	266	2	control	control	NOUN
finefocus-531	266	3	of	of	ADP
finefocus-531	266	4	l-1,2	l-1,2	ADJ
finefocus-531	266	5	-	-	PUNCT
finefocus-531	266	6	propanediol	propanediol	NOUN
finefocus-531	266	7	oxidoreductase	oxidoreductase	NOUN
finefocus-531	266	8	in	in	ADP
finefocus-531	266	9	the	the	DET
finefocus-531	266	10	l	l	NOUN
finefocus-531	266	11	-	-	NOUN
finefocus-531	266	12	fucose	fucose	ADJ
finefocus-531	266	13	pathway	pathway	NOUN
finefocus-531	266	14	of	of	ADP
finefocus-531	266	15	escherichia	escherichia	NOUN
finefocus-531	266	16	coli	coli	NOUN
finefocus-531	266	17	k-12	k-12	PROPN
finefocus-531	266	18	.	.	PUNCT
finefocus-531	266	19	journal	journal	PROPN
finefocus-531	266	20	of	of	ADP
finefocus-531	266	21	bacteriology	bacteriology	NOUN
finefocus-531	266	22	,	,	PUNCT
finefocus-531	266	23	157(1	157(1	NUM
finefocus-531	266	24	)	)	PUNCT
finefocus-531	266	25	,	,	PUNCT
finefocus-531	266	26	341–4	341–4	NOUN
finefocus-531	266	27	.	.	PROPN
finefocus-531	266	28	12	12	NUM
finefocus-531	266	29	.	.	PUNCT
finefocus-531	267	1	dische	dische	PROPN
finefocus-531	267	2	,	,	PUNCT
finefocus-531	267	3	z.	z.	PROPN
finefocus-531	267	4	,	,	PUNCT
finefocus-531	267	5	&	&	CCONJ
finefocus-531	267	6	shettles	shettle	NOUN
finefocus-531	267	7	,	,	PUNCT
finefocus-531	267	8	l.	l.	PROPN
finefocus-531	267	9	b.	b.	PROPN
finefocus-531	267	10	(	(	PUNCT
finefocus-531	267	11	1948	1948	NUM
finefocus-531	267	12	)	)	PUNCT
finefocus-531	267	13	.	.	PUNCT
finefocus-531	268	1	a	a	DET
finefocus-531	268	2	specific	specific	ADJ
finefocus-531	268	3	color	color	NOUN
finefocus-531	268	4	reaction	reaction	NOUN
finefocus-531	268	5	of	of	ADP
finefocus-531	268	6	methylpentoses	methylpentose	NOUN
finefocus-531	268	7	and	and	CCONJ
finefocus-531	268	8	a	a	DET
finefocus-531	268	9	spectrophotometric	spectrophotometric	ADJ
finefocus-531	268	10	micromethod	micromethod	NOUN
finefocus-531	268	11	for	for	ADP
finefocus-531	268	12	38	38	NUM
finefocus-531	268	13	•	•	NUM
finefocus-531	268	14	fine	fine	ADJ
finefocus-531	268	15	focus	focus	NOUN
finefocus-531	268	16	,	,	PUNCT
finefocus-531	268	17	vol	vol	NOUN
finefocus-531	268	18	.	.	PUNCT
finefocus-531	268	19	4(1	4(1	NOUN
finefocus-531	268	20	)	)	PUNCT
finefocus-531	268	21	their	their	PRON
finefocus-531	268	22	determination	determination	NOUN
finefocus-531	268	23	.	.	PUNCT
finefocus-531	269	1	journal	journal	NOUN
finefocus-531	269	2	of	of	ADP
finefocus-531	269	3	biological	biological	ADJ
finefocus-531	269	4	chemistry	chemistry	NOUN
finefocus-531	269	5	,	,	PUNCT
finefocus-531	269	6	175	175	NUM
finefocus-531	269	7	,	,	PUNCT
finefocus-531	269	8	595–603	595–603	NUM
finefocus-531	269	9	.	.	PUNCT
finefocus-531	269	10	13	13	NUM
finefocus-531	269	11	.	.	X
finefocus-531	269	12	ferrari	ferrari	PROPN
finefocus-531	269	13	,	,	PUNCT
finefocus-531	269	14	a.	a.	PROPN
finefocus-531	269	15	r.	r.	PROPN
finefocus-531	269	16	,	,	PUNCT
finefocus-531	269	17	gaber	gaber	PROPN
finefocus-531	269	18	,	,	PUNCT
finefocus-531	269	19	y.	y.	PROPN
finefocus-531	269	20	,	,	PUNCT
finefocus-531	269	21	&	&	CCONJ
finefocus-531	269	22	fraaije	fraaije	NOUN
finefocus-531	269	23	,	,	PUNCT
finefocus-531	269	24	m.	m.	NOUN
finefocus-531	269	25	w.	w.	PROPN
finefocus-531	269	26	(	(	PUNCT
finefocus-531	269	27	2014	2014	NUM
finefocus-531	269	28	)	)	PUNCT
finefocus-531	269	29	.	.	PUNCT
finefocus-531	270	1	a	a	DET
finefocus-531	270	2	fast	fast	ADJ
finefocus-531	270	3	,	,	PUNCT
finefocus-531	270	4	sensitive	sensitive	ADJ
finefocus-531	270	5	and	and	CCONJ
finefocus-531	270	6	easy	easy	ADJ
finefocus-531	270	7	colorimetric	colorimetric	ADJ
finefocus-531	270	8	assay	assay	NOUN
finefocus-531	270	9	for	for	ADP
finefocus-531	270	10	chitinase	chitinase	NOUN
finefocus-531	270	11	and	and	CCONJ
finefocus-531	270	12	cellulase	cellulase	NOUN
finefocus-531	270	13	activity	activity	NOUN
finefocus-531	270	14	detection	detection	NOUN
finefocus-531	270	15	.	.	PUNCT
finefocus-531	271	1	biotechnology	biotechnology	NOUN
finefocus-531	271	2	for	for	ADP
finefocus-531	271	3	biofuels	biofuel	NOUN
finefocus-531	271	4	,	,	PUNCT
finefocus-531	271	5	7(1	7(1	NUM
finefocus-531	271	6	)	)	PUNCT
finefocus-531	271	7	,	,	PUNCT
finefocus-531	271	8	37	37	NUM
finefocus-531	271	9	.	.	NOUN
finefocus-531	271	10	14	14	NUM
finefocus-531	271	11	.	.	PUNCT
finefocus-531	271	12	ingvadottir	ingvadottir	PROPN
finefocus-531	271	13	,	,	PUNCT
finefocus-531	271	14	e.	e.	PROPN
finefocus-531	271	15	m.	m.	PROPN
finefocus-531	271	16	,	,	PUNCT
finefocus-531	271	17	scully	scully	ADV
finefocus-531	271	18	,	,	PUNCT
finefocus-531	271	19	s.	s.	PROPN
finefocus-531	271	20	m.	m.	PROPN
finefocus-531	271	21	,	,	PUNCT
finefocus-531	271	22	&	&	CCONJ
finefocus-531	271	23	orlygsson	orlygsson	PROPN
finefocus-531	271	24	,	,	PUNCT
finefocus-531	271	25	j.	j.	PROPN
finefocus-531	271	26	(	(	PUNCT
finefocus-531	271	27	2017	2017	NUM
finefocus-531	271	28	)	)	PUNCT
finefocus-531	271	29	.	.	PUNCT
finefocus-531	272	1	evaluation	evaluation	NOUN
finefocus-531	272	2	of	of	ADP
finefocus-531	272	3	the	the	DET
finefocus-531	272	4	genus	genus	NOUN
finefocus-531	272	5	of	of	ADP
finefocus-531	272	6	caldicellulosiruptor	caldicellulosiruptor	NOUN
finefocus-531	272	7	for	for	ADP
finefocus-531	272	8	producation	producation	NOUN
finefocus-531	272	9	of	of	ADP
finefocus-531	272	10	1,2	1,2	NUM
finefocus-531	272	11	-	-	NOUN
finefocus-531	272	12	propanedil	propanedil	NOUN
finefocus-531	272	13	from	from	ADP
finefocus-531	272	14	methylpentoses	methylpentose	NOUN
finefocus-531	272	15	.	.	PUNCT
finefocus-531	273	1	anaerobe	anaerobe	PROPN
finefocus-531	273	2	,	,	PUNCT
finefocus-531	273	3	47	47	NUM
finefocus-531	273	4	,	,	PUNCT
finefocus-531	273	5	86–88	86–88	NUM
finefocus-531	273	6	.	.	PUNCT
finefocus-531	274	1	15	15	NUM
finefocus-531	274	2	.	.	PUNCT
finefocus-531	274	3	jones	jones	PROPN
finefocus-531	274	4	,	,	PUNCT
finefocus-531	274	5	l.	l.	PROPN
finefocus-531	274	6	r.	r.	PROPN
finefocus-531	274	7	(	(	PUNCT
finefocus-531	274	8	1957	1957	NUM
finefocus-531	274	9	)	)	PUNCT
finefocus-531	274	10	.	.	PUNCT
finefocus-531	275	1	colorimetric	colorimetric	ADJ
finefocus-531	275	2	determination	determination	NOUN
finefocus-531	275	3	of	of	ADP
finefocus-531	275	4	1,2	1,2	NUM
finefocus-531	275	5	-	-	PUNCT
finefocus-531	275	6	propanediol	propanediol	NOUN
finefocus-531	275	7	and	and	CCONJ
finefocus-531	275	8	related	related	ADJ
finefocus-531	275	9	compounds	compound	NOUN
finefocus-531	275	10	.	.	PUNCT
finefocus-531	276	1	analytical	analytical	ADJ
finefocus-531	276	2	chemistry	chemistry	NOUN
finefocus-531	276	3	,	,	PUNCT
finefocus-531	276	4	29(8	29(8	NOUN
finefocus-531	276	5	)	)	PUNCT
finefocus-531	276	6	,	,	PUNCT
finefocus-531	276	7	1214–1216	1214–1216	NUM
finefocus-531	276	8	.	.	PUNCT
finefocus-531	277	1	16	16	NUM
finefocus-531	277	2	.	.	PUNCT
finefocus-531	278	1	kometani	kometani	PROPN
finefocus-531	278	2	,	,	PUNCT
finefocus-531	278	3	t.	t.	PROPN
finefocus-531	278	4	,	,	PUNCT
finefocus-531	278	5	toide	toide	INTJ
finefocus-531	278	6	,	,	PUNCT
finefocus-531	278	7	h.	h.	PROPN
finefocus-531	278	8	,	,	PUNCT
finefocus-531	278	9	kaikaiji	kaikaiji	PROPN
finefocus-531	278	10	,	,	PUNCT
finefocus-531	278	11	y.	y.	PROPN
finefocus-531	278	12	,	,	PUNCT
finefocus-531	278	13	&	&	CCONJ
finefocus-531	278	14	goto	goto	NOUN
finefocus-531	278	15	,	,	PUNCT
finefocus-531	278	16	m.	m.	NOUN
finefocus-531	278	17	(	(	PUNCT
finefocus-531	278	18	2001	2001	NUM
finefocus-531	278	19	)	)	PUNCT
finefocus-531	278	20	.	.	PUNCT
finefocus-531	279	1	practical	practical	ADJ
finefocus-531	279	2	production	production	NOUN
finefocus-531	279	3	of	of	ADP
finefocus-531	279	4	(	(	PUNCT
finefocus-531	279	5	s)1,2	s)1,2	ADJ
finefocus-531	279	6	-	-	NOUN
finefocus-531	279	7	propanediol	propanediol	NOUN
finefocus-531	279	8	and	and	CCONJ
finefocus-531	279	9	its	its	PRON
finefocus-531	279	10	derivative	derivative	NOUN
finefocus-531	279	11	through	through	ADP
finefocus-531	279	12	baker	baker	PROPN
finefocus-531	279	13	’s	’s	PART
finefocus-531	279	14	yeast	yeast	NOUN
finefocus-531	279	15	-	-	PUNCT
finefocus-531	279	16	mediated	mediate	VERB
finefocus-531	279	17	reduction.pdf	reduction.pdf	PROPN
finefocus-531	279	18	.	.	PROPN
finefocus-531	279	19	journal	journal	PROPN
finefocus-531	279	20	of	of	ADP
finefocus-531	279	21	bioscience	bioscience	NOUN
finefocus-531	279	22	and	and	CCONJ
finefocus-531	279	23	bioengineering	bioengineering	NOUN
finefocus-531	279	24	,	,	PUNCT
finefocus-531	279	25	91(5	91(5	NUM
finefocus-531	279	26	)	)	PUNCT
finefocus-531	279	27	,	,	PUNCT
finefocus-531	279	28	525–527	525–527	NUM
finefocus-531	279	29	.	.	PUNCT
finefocus-531	279	30	17	17	NUM
finefocus-531	279	31	.	.	PUNCT
finefocus-531	280	1	huys	huy	NOUN
finefocus-531	280	2	,	,	PUNCT
finefocus-531	280	3	g.	g.	PROPN
finefocus-531	280	4	,	,	PUNCT
finefocus-531	280	5	cnockaert	cnockaert	NOUN
finefocus-531	280	6	,	,	PUNCT
finefocus-531	280	7	m.	m.	NOUN
finefocus-531	280	8	,	,	PUNCT
finefocus-531	280	9	janda	janda	PROPN
finefocus-531	280	10	,	,	PUNCT
finefocus-531	280	11	j.	j.	PROPN
finefocus-531	280	12	m.	m.	PROPN
finefocus-531	280	13	,	,	PUNCT
finefocus-531	280	14	&	&	CCONJ
finefocus-531	280	15	swings	swing	NOUN
finefocus-531	280	16	,	,	PUNCT
finefocus-531	280	17	j.	j.	PROPN
finefocus-531	280	18	(	(	PUNCT
finefocus-531	280	19	2017	2017	NUM
finefocus-531	280	20	)	)	PUNCT
finefocus-531	280	21	.	.	PUNCT
finefocus-531	281	1	escherichia	escherichia	NOUN
finefocus-531	281	2	albertii	albertii	NOUN
finefocus-531	281	3	sp	sp	PROPN
finefocus-531	281	4	.	.	PUNCT
finefocus-531	282	1	nov	nov	PROPN
finefocus-531	282	2	.	.	PROPN
finefocus-531	282	3	,	,	PUNCT
finefocus-531	282	4	a	a	DET
finefocus-531	282	5	diarrhoeagenic	diarrhoeagenic	ADJ
finefocus-531	282	6	species	specie	NOUN
finefocus-531	282	7	isolated	isolate	VERB
finefocus-531	282	8	from	from	ADP
finefocus-531	282	9	stool	stool	NOUN
finefocus-531	282	10	specimens	specimen	NOUN
finefocus-531	282	11	of	of	ADP
finefocus-531	282	12	bangladeshi	bangladeshi	ADJ
finefocus-531	282	13	children	child	NOUN
finefocus-531	282	14	.	.	PUNCT
finefocus-531	283	1	international	international	ADJ
finefocus-531	283	2	journal	journal	PROPN
finefocus-531	283	3	of	of	ADP
finefocus-531	283	4	systematic	systematic	ADJ
finefocus-531	283	5	and	and	CCONJ
finefocus-531	283	6	evolutionary	evolutionary	ADJ
finefocus-531	283	7	bacteriology	bacteriology	NOUN
finefocus-531	283	8	,	,	PUNCT
finefocus-531	283	9	53(2003	53(2003	NUM
finefocus-531	283	10	)	)	PUNCT
finefocus-531	283	11	,	,	PUNCT
finefocus-531	283	12	807–810	807–810	NUM
finefocus-531	283	13	.	.	PUNCT
finefocus-531	284	1	http://doi.org/10.1099/ijs.0.02475-0	http://doi.org/10.1099/ijs.0.02475-0	PROPN
finefocus-531	284	2	18	18	NUM
finefocus-531	284	3	.	.	PUNCT
finefocus-531	285	1	leyva	leyva	PROPN
finefocus-531	285	2	,	,	PUNCT
finefocus-531	285	3	a.	a.	NOUN
finefocus-531	285	4	,	,	PUNCT
finefocus-531	285	5	quintana	quintana	PROPN
finefocus-531	285	6	,	,	PUNCT
finefocus-531	285	7	a.	a.	PROPN
finefocus-531	285	8	,	,	PUNCT
finefocus-531	285	9	sánchez	sánchez	PROPN
finefocus-531	285	10	,	,	PUNCT
finefocus-531	285	11	m.	m.	NOUN
finefocus-531	285	12	,	,	PUNCT
finefocus-531	285	13	rodríguez	rodríguez	PROPN
finefocus-531	285	14	,	,	PUNCT
finefocus-531	285	15	e.	e.	PROPN
finefocus-531	285	16	n.	n.	PROPN
finefocus-531	285	17	,	,	PUNCT
finefocus-531	285	18	cremata	cremata	PROPN
finefocus-531	285	19	,	,	PUNCT
finefocus-531	285	20	j.	j.	PROPN
finefocus-531	285	21	,	,	PUNCT
finefocus-531	285	22	&	&	CCONJ
finefocus-531	285	23	sánchez	sánchez	PROPN
finefocus-531	285	24	,	,	PUNCT
finefocus-531	285	25	j.	j.	PROPN
finefocus-531	285	26	c.	c.	PROPN
finefocus-531	285	27	(	(	PUNCT
finefocus-531	285	28	2008	2008	NUM
finefocus-531	285	29	)	)	PUNCT
finefocus-531	285	30	.	.	PUNCT
finefocus-531	286	1	rapid	rapid	ADJ
finefocus-531	286	2	and	and	CCONJ
finefocus-531	286	3	sensitive	sensitive	ADJ
finefocus-531	286	4	anthrone	anthrone	NOUN
finefocus-531	286	5	-	-	PUNCT
finefocus-531	286	6	sulfuric	sulfuric	NOUN
finefocus-531	286	7	acid	acid	NOUN
finefocus-531	286	8	assay	assay	PROPN
finefocus-531	286	9	in	in	ADP
finefocus-531	286	10	microplate	microplate	ADJ
finefocus-531	286	11	format	format	NOUN
finefocus-531	286	12	to	to	PART
finefocus-531	286	13	quantify	quantify	VERB
finefocus-531	286	14	carbohydrate	carbohydrate	NOUN
finefocus-531	286	15	in	in	ADP
finefocus-531	286	16	biopharmaceutical	biopharmaceutical	ADJ
finefocus-531	286	17	products	product	NOUN
finefocus-531	286	18	:	:	PUNCT
finefocus-531	286	19	method	method	NOUN
finefocus-531	286	20	development	development	NOUN
finefocus-531	286	21	and	and	CCONJ
finefocus-531	286	22	validation	validation	NOUN
finefocus-531	286	23	.	.	PUNCT
finefocus-531	287	1	biologicals	biological	NOUN
finefocus-531	287	2	:	:	PUNCT
finefocus-531	287	3	journal	journal	NOUN
finefocus-531	287	4	of	of	ADP
finefocus-531	287	5	the	the	DET
finefocus-531	287	6	international	international	ADJ
finefocus-531	287	7	association	association	NOUN
finefocus-531	287	8	of	of	ADP
finefocus-531	287	9	biological	biological	ADJ
finefocus-531	287	10	standardization	standardization	NOUN
finefocus-531	287	11	,	,	PUNCT
finefocus-531	287	12	36(2	36(2	NUM
finefocus-531	287	13	)	)	PUNCT
finefocus-531	287	14	,	,	PUNCT
finefocus-531	287	15	134–41	134–41	PROPN
finefocus-531	287	16	.	.	PROPN
finefocus-531	288	1	19	19	NUM
finefocus-531	288	2	.	.	PUNCT
finefocus-531	289	1	liu	liu	PROPN
finefocus-531	289	2	,	,	PUNCT
finefocus-531	289	3	s.	s.	PROPN
finefocus-531	289	4	,	,	PUNCT
finefocus-531	289	5	jin	jin	PROPN
finefocus-531	289	6	,	,	PUNCT
finefocus-531	289	7	d.	d.	PROPN
finefocus-531	289	8	,	,	PUNCT
finefocus-531	289	9	lan	lan	PROPN
finefocus-531	289	10	,	,	PUNCT
finefocus-531	289	11	r.	r.	PROPN
finefocus-531	289	12	,	,	PUNCT
finefocus-531	289	13	wang	wang	PROPN
finefocus-531	289	14	,	,	PUNCT
finefocus-531	289	15	y.	y.	PROPN
finefocus-531	289	16	,	,	PUNCT
finefocus-531	289	17	meng	meng	PROPN
finefocus-531	289	18	,	,	PUNCT
finefocus-531	289	19	q.	q.	PROPN
finefocus-531	289	20	,	,	PUNCT
finefocus-531	289	21	dai	dai	PROPN
finefocus-531	289	22	,	,	PUNCT
finefocus-531	289	23	h.	h.	PROPN
finefocus-531	289	24	,	,	PUNCT
finefocus-531	289	25	…	…	PUNCT
finefocus-531	289	26	xu	xu	INTJ
finefocus-531	289	27	,	,	PUNCT
finefocus-531	289	28	j.	j.	PROPN
finefocus-531	289	29	(	(	PUNCT
finefocus-531	289	30	2015	2015	NUM
finefocus-531	289	31	)	)	PUNCT
finefocus-531	289	32	.	.	PUNCT
finefocus-531	290	1	escherichia	escherichia	NOUN
finefocus-531	290	2	marmotae	marmotae	PROPN
finefocus-531	290	3	sp	sp	ADP
finefocus-531	290	4	.	.	PUNCT
finefocus-531	291	1	nov	nov	PROPN
finefocus-531	291	2	.	.	PROPN
finefocus-531	291	3	,	,	PUNCT
finefocus-531	292	1	isolated	isolate	VERB
finefocus-531	292	2	from	from	ADP
finefocus-531	292	3	faeces	faece	NOUN
finefocus-531	292	4	of	of	ADP
finefocus-531	292	5	marmota	marmota	NOUN
finefocus-531	292	6	himalayana	himalayana	PROPN
finefocus-531	292	7	.	.	PUNCT
finefocus-531	293	1	international	international	ADJ
finefocus-531	293	2	journal	journal	PROPN
finefocus-531	293	3	of	of	ADP
finefocus-531	293	4	systematic	systematic	ADJ
finefocus-531	293	5	and	and	CCONJ
finefocus-531	293	6	evolutionary	evolutionary	ADJ
finefocus-531	293	7	bacteriology	bacteriology	NOUN
finefocus-531	293	8	,	,	PUNCT
finefocus-531	293	9	65	65	NUM
finefocus-531	293	10	,	,	PUNCT
finefocus-531	293	11	2130–2134	2130–2134	NUM
finefocus-531	293	12	.	.	NOUN
finefocus-531	293	13	20	20	NUM
finefocus-531	293	14	.	.	PUNCT
finefocus-531	294	1	nautiyal	nautiyal	PROPN
finefocus-531	294	2	,	,	PUNCT
finefocus-531	294	3	c.	c.	PROPN
finefocus-531	294	4	s.	s.	PROPN
finefocus-531	294	5	(	(	PUNCT
finefocus-531	294	6	1999	1999	NUM
finefocus-531	294	7	)	)	PUNCT
finefocus-531	294	8	.	.	PUNCT
finefocus-531	295	1	an	an	DET
finefocus-531	295	2	efficient	efficient	ADJ
finefocus-531	295	3	microbiological	microbiological	ADJ
finefocus-531	295	4	growth	growth	NOUN
finefocus-531	295	5	medium	medium	NOUN
finefocus-531	295	6	for	for	ADP
finefocus-531	295	7	screening	screen	VERB
finefocus-531	295	8	phosphate	phosphate	NOUN
finefocus-531	295	9	solubilizing	solubilizing	NOUN
finefocus-531	295	10	microorganisms	microorganism	NOUN
finefocus-531	295	11	.	.	PUNCT
finefocus-531	296	1	fems	fems	PROPN
finefocus-531	296	2	microbial	microbial	ADJ
finefocus-531	296	3	ecology	ecology	NOUN
finefocus-531	296	4	,	,	PUNCT
finefocus-531	296	5	170	170	NUM
finefocus-531	296	6	,	,	PUNCT
finefocus-531	296	7	265–270	265–270	NUM
finefocus-531	296	8	.	.	PUNCT
finefocus-531	297	1	21	21	NUM
finefocus-531	297	2	.	.	X
finefocus-531	297	3	orlygsson	orlygsson	PROPN
finefocus-531	297	4	,	,	PUNCT
finefocus-531	297	5	j.	j.	PROPN
finefocus-531	297	6	,	,	PUNCT
finefocus-531	297	7	&	&	CCONJ
finefocus-531	297	8	baldursson	baldursson	PROPN
finefocus-531	297	9	,	,	PUNCT
finefocus-531	297	10	s.	s.	PROPN
finefocus-531	297	11	r.	r.	PROPN
finefocus-531	297	12	b.	b.	PROPN
finefocus-531	297	13	(	(	PUNCT
finefocus-531	297	14	2007	2007	NUM
finefocus-531	297	15	)	)	PUNCT
finefocus-531	297	16	.	.	PUNCT
finefocus-531	298	1	phylogenetic	phylogenetic	ADJ
finefocus-531	298	2	and	and	CCONJ
finefocus-531	298	3	physiological	physiological	ADJ
finefocus-531	298	4	studies	study	NOUN
finefocus-531	298	5	of	of	ADP
finefocus-531	298	6	four	four	NUM
finefocus-531	298	7	hydrogen	hydrogen	NOUN
finefocus-531	298	8	-	-	PUNCT
finefocus-531	298	9	producing	produce	VERB
finefocus-531	298	10	thermoanareobes	thermoanareobe	NOUN
finefocus-531	298	11	.	.	PUNCT
finefocus-531	299	1	icelandic	icelandic	ADJ
finefocus-531	299	2	agricultural	agricultural	ADJ
finefocus-531	299	3	science	science	NOUN
finefocus-531	299	4	,	,	PUNCT
finefocus-531	299	5	20	20	NUM
finefocus-531	299	6	,	,	PUNCT
finefocus-531	299	7	93–105	93–105	NUM
finefocus-531	299	8	.	.	NOUN
finefocus-531	299	9	22	22	NUM
finefocus-531	299	10	.	.	PUNCT
finefocus-531	300	1	rogers	roger	NOUN
finefocus-531	300	2	,	,	PUNCT
finefocus-531	300	3	p.	p.	PROPN
finefocus-531	300	4	,	,	PUNCT
finefocus-531	300	5	chen	chen	PROPN
finefocus-531	300	6	,	,	PUNCT
finefocus-531	300	7	j.-s	j.-s	PROPN
finefocus-531	300	8	.	.	PUNCT
finefocus-531	300	9	,	,	PUNCT
finefocus-531	300	10	&	&	CCONJ
finefocus-531	300	11	zidwich	zidwich	PROPN
finefocus-531	300	12	,	,	PUNCT
finefocus-531	300	13	m.	m.	NOUN
finefocus-531	300	14	j.	j.	PROPN
finefocus-531	300	15	(	(	PUNCT
finefocus-531	300	16	2006	2006	NUM
finefocus-531	300	17	)	)	PUNCT
finefocus-531	300	18	.	.	PUNCT
finefocus-531	301	1	organic	organic	ADJ
finefocus-531	301	2	acid	acid	NOUN
finefocus-531	301	3	and	and	CCONJ
finefocus-531	301	4	solvent	solvent	ADJ
finefocus-531	301	5	production	production	NOUN
finefocus-531	301	6	part	part	NOUN
finefocus-531	301	7	iii	iii	NOUN
finefocus-531	301	8	:	:	PUNCT
finefocus-531	301	9	butanol	butanol	NOUN
finefocus-531	301	10	,	,	PUNCT
finefocus-531	301	11	acetone	acetone	NOUN
finefocus-531	301	12	,	,	PUNCT
finefocus-531	301	13	and	and	CCONJ
finefocus-531	301	14	isopropanol	isopropanol	NOUN
finefocus-531	301	15	;	;	PUNCT
finefocus-531	301	16	1,3and	1,3and	NUM
finefocus-531	301	17	1,2	1,2	NUM
finefocus-531	301	18	-	-	PUNCT
finefocus-531	301	19	propanediol	propanediol	NOUN
finefocus-531	301	20	production	production	NOUN
finefocus-531	301	21	;	;	PUNCT
finefocus-531	301	22	and	and	CCONJ
finefocus-531	301	23	2,3	2,3	NUM
finefocus-531	301	24	-	-	NOUN
finefocus-531	301	25	butanediol	butanediol	NOUN
finefocus-531	301	26	production	production	NOUN
finefocus-531	301	27	.	.	PUNCT
finefocus-531	302	1	in	in	ADP
finefocus-531	302	2	e.	e.	PROPN
finefocus-531	302	3	dworkin	dworkin	PROPN
finefocus-531	302	4	,	,	PUNCT
finefocus-531	302	5	marin	marin	NOUN
finefocus-531	302	6	;	;	PUNCT
finefocus-531	302	7	falkow	falkow	NOUN
finefocus-531	302	8	,	,	PUNCT
finefocus-531	302	9	stanely	stanely	ADV
finefocus-531	302	10	;	;	PUNCT
finefocus-531	302	11	rosenberg	rosenberg	PROPN
finefocus-531	302	12	,	,	PUNCT
finefocus-531	302	13	eugene	eugene	PROPN
finefocus-531	302	14	;	;	PUNCT
finefocus-531	302	15	20	20	NUM
finefocus-531	302	16	.	.	X
finefocus-531	302	17	schleifer	schleifer	PROPN
finefocus-531	302	18	,	,	PUNCT
finefocus-531	302	19	karl	karl	PROPN
finefocus-531	302	20	-	-	PUNCT
finefocus-531	302	21	heinz	heinz	PROPN
finefocus-531	302	22	;	;	PUNCT
finefocus-531	302	23	stackebndt	stackebndt	PROPN
finefocus-531	302	24	(	(	PUNCT
finefocus-531	302	25	ed	ed	NOUN
finefocus-531	302	26	.	.	PUNCT
finefocus-531	302	27	)	)	PUNCT
finefocus-531	302	28	,	,	PUNCT
finefocus-531	302	29	the	the	DET
finefocus-531	302	30	prokaryotes	prokaryote	NOUN
finefocus-531	302	31	:	:	PUNCT
finefocus-531	302	32	a	a	DET
finefocus-531	302	33	handbook	handbook	NOUN
finefocus-531	302	34	on	on	ADP
finefocus-531	302	35	the	the	DET
finefocus-531	302	36	biology	biology	NOUN
finefocus-531	302	37	of	of	ADP
finefocus-531	302	38	bacteria	bacteria	NOUN
finefocus-531	302	39	(	(	PUNCT
finefocus-531	302	40	3rd	3rd	ADJ
finefocus-531	302	41	ed	ed	NOUN
finefocus-531	302	42	.	.	PUNCT
finefocus-531	302	43	)	)	PUNCT
finefocus-531	302	44	.	.	PUNCT
finefocus-531	303	1	new	new	PROPN
finefocus-531	303	2	york	york	PROPN
finefocus-531	303	3	:	:	PUNCT
finefocus-531	303	4	springer	springer	NOUN
finefocus-531	303	5	.	.	PUNCT
finefocus-531	304	1	23	23	NUM
finefocus-531	304	2	.	.	X
finefocus-531	305	1	santamaria	santamaria	PROPN
finefocus-531	305	2	,	,	PUNCT
finefocus-531	305	3	m.	m.	NOUN
finefocus-531	305	4	,	,	PUNCT
finefocus-531	305	5	fosso	fosso	PROPN
finefocus-531	305	6	,	,	PUNCT
finefocus-531	305	7	b.	b.	PROPN
finefocus-531	305	8	,	,	PUNCT
finefocus-531	305	9	consiglio	consiglio	PROPN
finefocus-531	305	10	,	,	PUNCT
finefocus-531	305	11	a.	a.	NOUN
finefocus-531	305	12	,	,	PUNCT
finefocus-531	305	13	de	de	X
finefocus-531	305	14	caro	caro	NOUN
finefocus-531	305	15	,	,	PUNCT
finefocus-531	305	16	g.	g.	PROPN
finefocus-531	305	17	,	,	PUNCT
finefocus-531	305	18	grillo	grillo	PROPN
finefocus-531	305	19	,	,	PUNCT
finefocus-531	305	20	g.	g.	PROPN
finefocus-531	305	21	,	,	PUNCT
finefocus-531	305	22	licciulli	licciulli	PROPN
finefocus-531	305	23	,	,	PUNCT
finefocus-531	305	24	f.	f.	PROPN
finefocus-531	305	25	,	,	PUNCT
finefocus-531	305	26	pesole	pesole	NOUN
finefocus-531	305	27	,	,	PUNCT
finefocus-531	305	28	g.	g.	PROPN
finefocus-531	305	29	(	(	PUNCT
finefocus-531	305	30	2012	2012	NUM
finefocus-531	305	31	)	)	PUNCT
finefocus-531	305	32	.	.	PUNCT
finefocus-531	306	1	reference	reference	NOUN
finefocus-531	306	2	databases	database	NOUN
finefocus-531	306	3	for	for	ADP
finefocus-531	306	4	taxonomic	taxonomic	ADJ
finefocus-531	306	5	assignment	assignment	NOUN
finefocus-531	306	6	in	in	ADP
finefocus-531	306	7	metagenomics	metagenomic	NOUN
finefocus-531	306	8	.	.	PUNCT
finefocus-531	307	1	briefings	briefing	NOUN
finefocus-531	307	2	in	in	ADP
finefocus-531	307	3	bioinformatics	bioinformatics	NOUN
finefocus-531	307	4	,	,	PUNCT
finefocus-531	307	5	13(6	13(6	NUM
finefocus-531	307	6	)	)	PUNCT
finefocus-531	307	7	,	,	PUNCT
finefocus-531	307	8	682–695	682–695	NUM
finefocus-531	307	9	.	.	PUNCT
finefocus-531	308	1	http://doi	http://doi	X
finefocus-531	308	2	.	.	PROPN
finefocus-531	308	3	39applied	39applied	NUM
finefocus-531	308	4	&	&	CCONJ
finefocus-531	308	5	environmental	environmental	ADJ
finefocus-531	308	6	microbiology	microbiology	NOUN
finefocus-531	308	7	•	•	ADP
finefocus-531	308	8	org/10.1093	org/10.1093	PROPN
finefocus-531	308	9	/	/	SYM
finefocus-531	308	10	bib	bib	NOUN
finefocus-531	308	11	/	/	SYM
finefocus-531	308	12	bbs036	bbs036	NOUN
finefocus-531	308	13	24	24	NUM
finefocus-531	308	14	.	.	PUNCT
finefocus-531	309	1	saxena	saxena	PROPN
finefocus-531	309	2	,	,	PUNCT
finefocus-531	309	3	r.	r.	PROPN
finefocus-531	309	4	k.	k.	PROPN
finefocus-531	309	5	,	,	PUNCT
finefocus-531	309	6	anand	anand	PROPN
finefocus-531	309	7	,	,	PUNCT
finefocus-531	309	8	p.	p.	PROPN
finefocus-531	309	9	,	,	PUNCT
finefocus-531	309	10	saran	saran	PROPN
finefocus-531	309	11	,	,	PUNCT
finefocus-531	309	12	s.	s.	PROPN
finefocus-531	309	13	,	,	PUNCT
finefocus-531	309	14	isar	isar	PROPN
finefocus-531	309	15	,	,	PUNCT
finefocus-531	309	16	j.	j.	PROPN
finefocus-531	309	17	,	,	PUNCT
finefocus-531	309	18	&	&	CCONJ
finefocus-531	309	19	agarwal	agarwal	PROPN
finefocus-531	309	20	,	,	PUNCT
finefocus-531	309	21	l.	l.	PROPN
finefocus-531	309	22	(	(	PUNCT
finefocus-531	309	23	2010	2010	NUM
finefocus-531	309	24	)	)	PUNCT
finefocus-531	309	25	.	.	PUNCT
finefocus-531	310	1	microbial	microbial	ADJ
finefocus-531	310	2	production	production	NOUN
finefocus-531	310	3	and	and	CCONJ
finefocus-531	310	4	applications	application	NOUN
finefocus-531	310	5	of	of	ADP
finefocus-531	310	6	1,2	1,2	NUM
finefocus-531	310	7	-	-	PUNCT
finefocus-531	310	8	propanediol	propanediol	NOUN
finefocus-531	310	9	.	.	PUNCT
finefocus-531	311	1	industrial	industrial	ADJ
finefocus-531	311	2	journal	journal	PROPN
finefocus-531	311	3	of	of	ADP
finefocus-531	311	4	microbiology	microbiology	NOUN
finefocus-531	311	5	,	,	PUNCT
finefocus-531	311	6	50(1	50(1	NUM
finefocus-531	311	7	)	)	PUNCT
finefocus-531	311	8	,	,	PUNCT
finefocus-531	311	9	2–11	2–11	NOUN
finefocus-531	311	10	.	.	PUNCT
finefocus-531	312	1	http://	http://	PROPN
finefocus-531	312	2	doi.org/10.1007/s12088-010-0017-x	doi.org/10.1007/s12088-010-0017-x	NUM
finefocus-531	312	3	25	25	NUM
finefocus-531	312	4	.	.	PUNCT
finefocus-531	312	5	strockbine	strockbine	PROPN
finefocus-531	312	6	,	,	PUNCT
finefocus-531	312	7	n.	n.	PROPN
finefocus-531	312	8	a.	a.	PROPN
finefocus-531	312	9	,	,	PUNCT
finefocus-531	312	10	&	&	CCONJ
finefocus-531	312	11	maurelli	maurelli	PROPN
finefocus-531	312	12	,	,	PUNCT
finefocus-531	312	13	a.	a.	NOUN
finefocus-531	312	14	t.	t.	PROPN
finefocus-531	312	15	(	(	PUNCT
finefocus-531	312	16	2005	2005	NUM
finefocus-531	312	17	)	)	PUNCT
finefocus-531	312	18	.	.	PUNCT
finefocus-531	313	1	genus	genus	PROPN
finefocus-531	313	2	xxxv	xxxv	PROPN
finefocus-531	313	3	.	.	PUNCT
finefocus-531	314	1	shigella	shigella	PROPN
finefocus-531	314	2	.	.	PUNCT
finefocus-531	315	1	in	in	ADP
finefocus-531	315	2	garrity	garrity	PROPN
finefocus-531	315	3	,	,	PUNCT
finefocus-531	315	4	g.m	g.m	PROPN
finefocus-531	315	5	.	.	PUNCT
finefocus-531	316	1	(	(	PUNCT
finefocus-531	316	2	ed	ed	NOUN
finefocus-531	316	3	.	.	PUNCT
finefocus-531	316	4	)	)	PUNCT
finefocus-531	317	1	,	,	PUNCT
finefocus-531	317	2	bergey´s	bergey´s	NOUN
finefocus-531	317	3	manual	manual	NOUN
finefocus-531	317	4	of	of	ADP
finefocus-531	317	5	systematic	systematic	ADJ
finefocus-531	317	6	bacteriology	bacteriology	NOUN
finefocus-531	317	7	.	.	PUNCT
finefocus-531	318	1	volume	volume	NOUN
finefocus-531	318	2	ii	ii	PROPN
finefocus-531	318	3	part	part	PROPN
finefocus-531	318	4	b	b	PROPN
finefocus-531	318	5	(	(	PUNCT
finefocus-531	318	6	2nd	2nd	ADJ
finefocus-531	318	7	ed	ed	NOUN
finefocus-531	318	8	.	.	PUNCT
finefocus-531	318	9	)	)	PUNCT
finefocus-531	318	10	.	.	PUNCT
finefocus-531	319	1	new	new	PROPN
finefocus-531	319	2	york	york	PROPN
finefocus-531	319	3	:	:	PUNCT
finefocus-531	319	4	springer	springer	NOUN
finefocus-531	319	5	.	.	PUNCT
finefocus-531	320	1	811	811	NUM
finefocus-531	320	2	-	-	SYM
finefocus-531	320	3	823	823	NUM
finefocus-531	320	4	.	.	NOUN
finefocus-531	321	1	26	26	NUM
finefocus-531	321	2	.	.	PUNCT
finefocus-531	322	1	tamura	tamura	PROPN
finefocus-531	322	2	,	,	PUNCT
finefocus-531	322	3	k.	k.	PROPN
finefocus-531	322	4	,	,	PUNCT
finefocus-531	322	5	&	&	CCONJ
finefocus-531	322	6	nei	nei	PROPN
finefocus-531	322	7	,	,	PUNCT
finefocus-531	322	8	m.	m.	NOUN
finefocus-531	322	9	(	(	PUNCT
finefocus-531	322	10	1993	1993	NUM
finefocus-531	322	11	)	)	PUNCT
finefocus-531	322	12	.	.	PUNCT
finefocus-531	323	1	estimation	estimation	NOUN
finefocus-531	323	2	of	of	ADP
finefocus-531	323	3	the	the	DET
finefocus-531	323	4	number	number	NOUN
finefocus-531	323	5	of	of	ADP
finefocus-531	323	6	base	base	NOUN
finefocus-531	323	7	nucleotide	nucleotide	NOUN
finefocus-531	323	8	substitutions	substitution	NOUN
finefocus-531	323	9	in	in	ADP
finefocus-531	323	10	the	the	DET
finefocus-531	323	11	control	control	NOUN
finefocus-531	323	12	region	region	NOUN
finefocus-531	323	13	of	of	ADP
finefocus-531	323	14	mitochondrial	mitochondrial	ADJ
finefocus-531	323	15	dna	dna	NOUN
finefocus-531	323	16	in	in	ADP
finefocus-531	323	17	humans	human	NOUN
finefocus-531	323	18	and	and	CCONJ
finefocus-531	323	19	chimpanzees	chimpanzee	NOUN
finefocus-531	323	20	.	.	PUNCT
finefocus-531	324	1	molecular	molecular	ADJ
finefocus-531	324	2	biology	biology	NOUN
finefocus-531	324	3	and	and	CCONJ
finefocus-531	324	4	evolution	evolution	NOUN
finefocus-531	324	5	,	,	PUNCT
finefocus-531	324	6	10(3	10(3	NUM
finefocus-531	324	7	)	)	PUNCT
finefocus-531	324	8	,	,	PUNCT
finefocus-531	324	9	512–526	512–526	NUM
finefocus-531	324	10	.	.	PUNCT
finefocus-531	325	1	27	27	NUM
finefocus-531	325	2	.	.	PUNCT
finefocus-531	326	1	tamura	tamura	PROPN
finefocus-531	326	2	,	,	PUNCT
finefocus-531	326	3	k.	k.	PROPN
finefocus-531	326	4	,	,	PUNCT
finefocus-531	326	5	stecher	stecher	PROPN
finefocus-531	326	6	,	,	PUNCT
finefocus-531	326	7	g.	g.	PROPN
finefocus-531	326	8	,	,	PUNCT
finefocus-531	326	9	peterson	peterson	PROPN
finefocus-531	326	10	,	,	PUNCT
finefocus-531	326	11	d.	d.	PROPN
finefocus-531	326	12	,	,	PUNCT
finefocus-531	326	13	filipski	filipski	PROPN
finefocus-531	326	14	,	,	PUNCT
finefocus-531	326	15	a.	a.	PROPN
finefocus-531	326	16	,	,	PUNCT
finefocus-531	326	17	&	&	CCONJ
finefocus-531	326	18	kumar	kumar	PROPN
finefocus-531	326	19	,	,	PUNCT
finefocus-531	326	20	s.	s.	PROPN
finefocus-531	326	21	(	(	PUNCT
finefocus-531	326	22	2013	2013	NUM
finefocus-531	326	23	)	)	PUNCT
finefocus-531	326	24	.	.	PUNCT
finefocus-531	327	1	mega6	mega6	NOUN
finefocus-531	327	2	:	:	PUNCT
finefocus-531	327	3	molecular	molecular	ADJ
finefocus-531	327	4	evolutionary	evolutionary	ADJ
finefocus-531	327	5	genetics	genetic	NOUN
finefocus-531	327	6	analysis	analysis	NOUN
finefocus-531	327	7	version	version	NOUN
finefocus-531	327	8	6.0	6.0	NUM
finefocus-531	327	9	.	.	PUNCT
finefocus-531	328	1	molecular	molecular	ADJ
finefocus-531	328	2	biology	biology	NOUN
finefocus-531	328	3	and	and	CCONJ
finefocus-531	328	4	evolution	evolution	NOUN
finefocus-531	328	5	,	,	PUNCT
finefocus-531	328	6	30(12	30(12	NUM
finefocus-531	328	7	)	)	PUNCT
finefocus-531	328	8	,	,	PUNCT
finefocus-531	328	9	2725–2729	2725–2729	NUM
finefocus-531	328	10	.	.	PUNCT
finefocus-531	328	11	28	28	NUM
finefocus-531	328	12	.	.	PUNCT
finefocus-531	329	1	taylor	taylor	PROPN
finefocus-531	329	2	,	,	PUNCT
finefocus-531	329	3	k.	k.	PROPN
finefocus-531	329	4	a.	a.	PROPN
finefocus-531	329	5	c.	c.	PROPN
finefocus-531	329	6	c.	c.	PROPN
finefocus-531	329	7	(	(	PUNCT
finefocus-531	329	8	1996	1996	NUM
finefocus-531	329	9	)	)	PUNCT
finefocus-531	329	10	.	.	PUNCT
finefocus-531	330	1	a	a	DET
finefocus-531	330	2	simple	simple	ADJ
finefocus-531	330	3	colorimetric	colorimetric	ADJ
finefocus-531	330	4	assay	assay	NOUN
finefocus-531	330	5	for	for	ADP
finefocus-531	330	6	muramic	muramic	ADJ
finefocus-531	330	7	acid	acid	NOUN
finefocus-531	330	8	and	and	CCONJ
finefocus-531	330	9	lactic	lactic	ADJ
finefocus-531	330	10	acid	acid	NOUN
finefocus-531	330	11	.	.	PUNCT
finefocus-531	331	1	applied	apply	VERB
finefocus-531	331	2	biochemistry	biochemistry	NOUN
finefocus-531	331	3	and	and	CCONJ
finefocus-531	331	4	biotechnology	biotechnology	NOUN
finefocus-531	331	5	,	,	PUNCT
finefocus-531	331	6	56	56	NUM
finefocus-531	331	7	,	,	PUNCT
finefocus-531	331	8	49–58	49–58	NUM
finefocus-531	331	9	.	.	PUNCT
finefocus-531	332	1	29	29	NUM
finefocus-531	332	2	.	.	PUNCT
finefocus-531	333	1	tilly	tilly	PROPN
finefocus-531	333	2	,	,	PUNCT
finefocus-531	333	3	b.	b.	PROPN
finefocus-531	333	4	,	,	PUNCT
finefocus-531	333	5	gonthier	gonthier	NOUN
finefocus-531	333	6	,	,	PUNCT
finefocus-531	333	7	a.	a.	PROPN
finefocus-531	333	8	,	,	PUNCT
finefocus-531	333	9	&	&	CCONJ
finefocus-531	333	10	gue	gue	PROPN
finefocus-531	333	11	,	,	PUNCT
finefocus-531	333	12	v.	v.	PROPN
finefocus-531	333	13	(	(	PUNCT
finefocus-531	333	14	2001	2001	NUM
finefocus-531	333	15	)	)	PUNCT
finefocus-531	333	16	.	.	PUNCT
finefocus-531	334	1	optimal	optimal	ADJ
finefocus-531	334	2	growth	growth	NOUN
finefocus-531	334	3	temperature	temperature	NOUN
finefocus-531	334	4	of	of	ADP
finefocus-531	334	5	o157	o157	PROPN
finefocus-531	334	6	and	and	CCONJ
finefocus-531	334	7	non	non	ADJ
finefocus-531	334	8	-	-	ADJ
finefocus-531	334	9	o157	o157	ADJ
finefocus-531	334	10	escherichia	escherichia	NOUN
finefocus-531	334	11	coli	coli	NOUN
finefocus-531	334	12	strains	strain	NOUN
finefocus-531	334	13	,	,	PUNCT
finefocus-531	334	14	352–356	352–356	NUM
finefocus-531	334	15	.	.	PUNCT
finefocus-531	334	16	30	30	NUM
finefocus-531	334	17	.	.	PUNCT
finefocus-531	335	1	tindall	tindall	PROPN
finefocus-531	335	2	,	,	PUNCT
finefocus-531	335	3	b.	b.	PROPN
finefocus-531	335	4	j.	j.	PROPN
finefocus-531	335	5	,	,	PUNCT
finefocus-531	335	6	sikorski	sikorski	PROPN
finefocus-531	335	7	,	,	PUNCT
finefocus-531	335	8	j.	j.	PROPN
finefocus-531	335	9	,	,	PUNCT
finefocus-531	335	10	smibert	smibert	PROPN
finefocus-531	335	11	,	,	PUNCT
finefocus-531	335	12	r.	r.	PROPN
finefocus-531	335	13	a.	a.	PROPN
finefocus-531	335	14	,	,	PUNCT
finefocus-531	335	15	&	&	CCONJ
finefocus-531	335	16	krieg	krieg	PROPN
finefocus-531	335	17	,	,	PUNCT
finefocus-531	335	18	n.	n.	PROPN
finefocus-531	335	19	r.	r.	PROPN
finefocus-531	335	20	(	(	PUNCT
finefocus-531	335	21	2007	2007	NUM
finefocus-531	335	22	)	)	PUNCT
finefocus-531	335	23	.	.	PUNCT
finefocus-531	336	1	phenotypic	phenotypic	ADJ
finefocus-531	336	2	characterization	characterization	NOUN
finefocus-531	336	3	and	and	CCONJ
finefocus-531	336	4	the	the	DET
finefocus-531	336	5	principles	principle	NOUN
finefocus-531	336	6	of	of	ADP
finefocus-531	336	7	comparative	comparative	ADJ
finefocus-531	336	8	systematics	systematic	NOUN
finefocus-531	336	9	.	.	PUNCT
finefocus-531	337	1	in	in	ADP
finefocus-531	337	2	c.	c.	PROPN
finefocus-531	337	3	a.	a.	PROPN
finefocus-531	337	4	reddy	reddy	PROPN
finefocus-531	337	5	(	(	PUNCT
finefocus-531	337	6	ed	ed	NOUN
finefocus-531	337	7	.	.	PUNCT
finefocus-531	337	8	)	)	PUNCT
finefocus-531	337	9	,	,	PUNCT
finefocus-531	337	10	methods	method	NOUN
finefocus-531	337	11	for	for	ADP
finefocus-531	337	12	general	general	ADJ
finefocus-531	337	13	and	and	CCONJ
finefocus-531	337	14	molecular	molecular	ADJ
finefocus-531	337	15	microbiology	microbiology	NOUN
finefocus-531	337	16	(	(	PUNCT
finefocus-531	337	17	3rd	3rd	ADJ
finefocus-531	337	18	ed	ed	NOUN
finefocus-531	337	19	.	.	PROPN
finefocus-531	337	20	,	,	PUNCT
finefocus-531	337	21	pp	pp	ADJ
finefocus-531	337	22	.	.	PUNCT
finefocus-531	337	23	330–393	330–393	NUM
finefocus-531	337	24	)	)	PUNCT
finefocus-531	337	25	.	.	PUNCT
finefocus-531	338	1	washington	washington	PROPN
finefocus-531	338	2	,	,	PUNCT
finefocus-531	338	3	d.c	d.c	PROPN
finefocus-531	338	4	.	.	PUNCT
finefocus-531	338	5	:	:	PUNCT
finefocus-531	339	1	asm	asm	NOUN
finefocus-531	339	2	press	press	NOUN
finefocus-531	339	3	.	.	PUNCT
finefocus-531	340	1	31	31	NUM
finefocus-531	340	2	.	.	X
finefocus-531	341	1	tran	tran	PROPN
finefocus-531	341	2	-	-	PUNCT
finefocus-531	341	3	din	din	PROPN
finefocus-531	341	4	,	,	PUNCT
finefocus-531	341	5	k.	k.	PROPN
finefocus-531	341	6	,	,	PUNCT
finefocus-531	341	7	&	&	CCONJ
finefocus-531	341	8	gottschalk	gottschalk	PROPN
finefocus-531	341	9	,	,	PUNCT
finefocus-531	341	10	g.	g.	PROPN
finefocus-531	341	11	(	(	PUNCT
finefocus-531	341	12	1985	1985	NUM
finefocus-531	341	13	)	)	PUNCT
finefocus-531	341	14	.	.	PUNCT
finefocus-531	342	1	formation	formation	NOUN
finefocus-531	342	2	of	of	ADP
finefocus-531	342	3	d(-)-1,2	d(-)-1,2	NOUN
finefocus-531	342	4	-	-	PUNCT
finefocus-531	342	5	propanediol	propanediol	NOUN
finefocus-531	342	6	and	and	CCONJ
finefocus-531	342	7	d(-)-lactate	d(-)-lactate	PROPN
finefocus-531	342	8	from	from	ADP
finefocus-531	342	9	glucose	glucose	NOUN
finefocus-531	342	10	by	by	ADP
finefocus-531	342	11	clostridium	clostridium	NOUN
finefocus-531	342	12	sphenoides	sphenoide	NOUN
finefocus-531	342	13	under	under	ADP
finefocus-531	342	14	phosphate	phosphate	ADJ
finefocus-531	342	15	limitation	limitation	NOUN
finefocus-531	342	16	*	*	PUNCT
finefocus-531	342	17	.	.	PUNCT
finefocus-531	343	1	archives	archive	NOUN
finefocus-531	343	2	of	of	ADP
finefocus-531	343	3	microbiology	microbiology	NOUN
finefocus-531	343	4	,	,	PUNCT
finefocus-531	343	5	142	142	NUM
finefocus-531	343	6	,	,	PUNCT
finefocus-531	343	7	87–92	87–92	NUM
finefocus-531	343	8	.	.	PUNCT
finefocus-531	344	1	32	32	NUM
finefocus-531	344	2	.	.	PUNCT
finefocus-531	344	3	welch	welch	PROPN
finefocus-531	344	4	,	,	PUNCT
finefocus-531	344	5	r.	r.	PROPN
finefocus-531	344	6	a.	a.	PROPN
finefocus-531	344	7	(	(	PUNCT
finefocus-531	344	8	2006	2006	NUM
finefocus-531	344	9	)	)	PUNCT
finefocus-531	344	10	.	.	PUNCT
finefocus-531	345	1	the	the	DET
finefocus-531	345	2	genus	genus	PROPN
finefocus-531	345	3	escherichia	escherichia	NOUN
finefocus-531	345	4	.	.	PUNCT
finefocus-531	346	1	in	in	ADP
finefocus-531	346	2	m.	m.	PROPN
finefocus-531	346	3	dworkin	dworkin	PROPN
finefocus-531	346	4	(	(	PUNCT
finefocus-531	346	5	ed	ed	NOUN
finefocus-531	346	6	.	.	PUNCT
finefocus-531	346	7	)	)	PUNCT
finefocus-531	346	8	,	,	PUNCT
finefocus-531	346	9	the	the	DET
finefocus-531	346	10	prokaryotes	prokaryote	NOUN
finefocus-531	346	11	(	(	PUNCT
finefocus-531	346	12	3rd	3rd	ADJ
finefocus-531	346	13	ed	ed	NOUN
finefocus-531	346	14	.	.	PROPN
finefocus-531	346	15	,	,	PUNCT
finefocus-531	346	16	pp	pp	ADJ
finefocus-531	346	17	.	.	PUNCT
finefocus-531	346	18	60–71	60–71	NOUN
finefocus-531	346	19	)	)	PUNCT
finefocus-531	346	20	.	.	PUNCT
finefocus-531	347	1	new	new	PROPN
finefocus-531	347	2	york	york	PROPN
finefocus-531	347	3	:	:	PUNCT
finefocus-531	347	4	springer	springer	NOUN
finefocus-531	347	5	.	.	PUNCT