id	sid	tid	token	lemma	pos
finefocus-591	1	1	detection	detection	NOUN
finefocus-591	1	2	of	of	ADP
finefocus-591	1	3	borrelia	borrelia	NOUN
finefocus-591	1	4	and	and	CCONJ
finefocus-591	1	5	ehrlichia	ehrlichia	VERB
finefocus-591	1	6	in	in	ADP
finefocus-591	1	7	rhipicephalus	rhipicephalus	PROPN
finefocus-591	1	8	sanguineus	sanguineus	PROPN
finefocus-591	1	9	rosa	rosa	PROPN
finefocus-591	1	10	vasquez	vasquez	PROPN
finefocus-591	1	11	-	-	PUNCT
finefocus-591	1	12	espinoza	espinoza	PROPN
finefocus-591	1	13	and	and	CCONJ
finefocus-591	1	14	david	david	PROPN
finefocus-591	1	15	l.	l.	PROPN
finefocus-591	1	16	beck	beck	PROPN
finefocus-591	1	17	*	*	PROPN
finefocus-591	1	18	department	department	PROPN
finefocus-591	1	19	of	of	ADP
finefocus-591	1	20	biology	biology	NOUN
finefocus-591	1	21	,	,	PUNCT
finefocus-591	1	22	tennessee	tennessee	PROPN
finefocus-591	1	23	technological	technological	PROPN
finefocus-591	1	24	university	university	PROPN
finefocus-591	1	25	,	,	PUNCT
finefocus-591	1	26	cookeville	cookeville	PROPN
finefocus-591	1	27	,	,	PUNCT
finefocus-591	1	28	tn	tn	PROPN
finefocus-591	1	29	,	,	PUNCT
finefocus-591	1	30	usa	usa	PROPN
finefocus-591	1	31	copyright	copyright	NOUN
finefocus-591	1	32	2015	2015	NUM
finefocus-591	1	33	,	,	PUNCT
finefocus-591	1	34	fine	fine	ADJ
finefocus-591	1	35	focus	focus	VERB
finefocus-591	1	36	all	all	DET
finefocus-591	1	37	rights	right	NOUN
finefocus-591	1	38	reserved	reserve	VERB
finefocus-591	1	39	manuscript	manuscript	NOUN
finefocus-591	1	40	received	receive	VERB
finefocus-591	1	41	30	30	NUM
finefocus-591	1	42	april	april	PROPN
finefocus-591	1	43	,	,	PUNCT
finefocus-591	1	44	2015	2015	NUM
finefocus-591	1	45	;	;	PUNCT
finefocus-591	1	46	accepted	accept	VERB
finefocus-591	1	47	6	6	NUM
finefocus-591	1	48	july	july	NOUN
finefocus-591	1	49	,	,	PUNCT
finefocus-591	1	50	2015	2015	NUM
finefocus-591	1	51	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	1	52	109	109	NUM
finefocus-591	1	53	9/25/15	9/25/15	NUM
finefocus-591	1	54	11:38	11:38	NUM
finefocus-591	1	55	am	am	NOUN
finefocus-591	1	56	rhipicephalus	rhipicephalus	ADJ
finefocus-591	1	57	sanguineus	sanguineus	NOUN
finefocus-591	1	58	,	,	PUNCT
finefocus-591	1	59	the	the	DET
finefocus-591	1	60	brown	brown	ADJ
finefocus-591	1	61	dog	dog	NOUN
finefocus-591	1	62	tick	tick	NOUN
finefocus-591	1	63	,	,	PUNCT
finefocus-591	1	64	is	be	AUX
finefocus-591	1	65	endemic	endemic	ADJ
finefocus-591	1	66	throughout	throughout	ADP
finefocus-591	1	67	the	the	DET
finefocus-591	1	68	world	world	NOUN
finefocus-591	1	69	wherever	wherever	SCONJ
finefocus-591	1	70	domestic	domestic	ADJ
finefocus-591	1	71	dogs	dog	NOUN
finefocus-591	1	72	are	be	AUX
finefocus-591	1	73	present	present	ADJ
finefocus-591	1	74	.	.	PUNCT
finefocus-591	2	1	it	it	PRON
finefocus-591	2	2	has	have	AUX
finefocus-591	2	3	been	be	AUX
finefocus-591	2	4	recently	recently	ADV
finefocus-591	2	5	reported	report	VERB
finefocus-591	2	6	by	by	ADP
finefocus-591	2	7	some	some	DET
finefocus-591	2	8	veterinarians	veterinarian	NOUN
finefocus-591	2	9	in	in	ADP
finefocus-591	2	10	the	the	DET
finefocus-591	2	11	city	city	NOUN
finefocus-591	2	12	of	of	ADP
finefocus-591	2	13	laredo	laredo	PROPN
finefocus-591	2	14	,	,	PUNCT
finefocus-591	2	15	texas	texas	PROPN
finefocus-591	2	16	,	,	PUNCT
finefocus-591	2	17	usa	usa	PROPN
finefocus-591	2	18	,	,	PUNCT
finefocus-591	2	19	that	that	SCONJ
finefocus-591	2	20	lyme	lyme	NOUN
finefocus-591	2	21	disease	disease	NOUN
finefocus-591	2	22	,	,	PUNCT
finefocus-591	2	23	the	the	DET
finefocus-591	2	24	most	most	ADV
finefocus-591	2	25	common	common	ADJ
finefocus-591	2	26	tickborne	tickborne	ADJ
finefocus-591	2	27	disease	disease	NOUN
finefocus-591	2	28	in	in	ADP
finefocus-591	2	29	the	the	DET
finefocus-591	2	30	northern	northern	ADJ
finefocus-591	2	31	united	united	PROPN
finefocus-591	2	32	states	states	PROPN
finefocus-591	2	33	,	,	PUNCT
finefocus-591	2	34	is	be	AUX
finefocus-591	2	35	present	present	ADJ
finefocus-591	2	36	in	in	ADP
finefocus-591	2	37	local	local	ADJ
finefocus-591	2	38	domestic	domestic	ADJ
finefocus-591	2	39	dogs	dog	NOUN
finefocus-591	2	40	.	.	PUNCT
finefocus-591	3	1	fully	fully	ADV
finefocus-591	3	2	engorged	engorge	VERB
finefocus-591	3	3	r.	r.	PROPN
finefocus-591	3	4	sanguineus	sanguineus	PROPN
finefocus-591	3	5	ticks	tick	NOUN
finefocus-591	3	6	were	be	AUX
finefocus-591	3	7	collected	collect	VERB
finefocus-591	3	8	and	and	CCONJ
finefocus-591	3	9	their	their	PRON
finefocus-591	3	10	dna	dna	NOUN
finefocus-591	3	11	was	be	AUX
finefocus-591	3	12	purified	purify	VERB
finefocus-591	3	13	.	.	PUNCT
finefocus-591	4	1	the	the	DET
finefocus-591	4	2	ticks	tick	NOUN
finefocus-591	4	3	were	be	AUX
finefocus-591	4	4	screened	screen	VERB
finefocus-591	4	5	to	to	PART
finefocus-591	4	6	determine	determine	VERB
finefocus-591	4	7	the	the	DET
finefocus-591	4	8	prevalence	prevalence	NOUN
finefocus-591	4	9	of	of	ADP
finefocus-591	4	10	borrelia	borrelia	NOUN
finefocus-591	4	11	,	,	PUNCT
finefocus-591	4	12	rickettsia	rickettsia	NOUN
finefocus-591	4	13	and	and	CCONJ
finefocus-591	4	14	ehrlichia	ehrlichia	VERB
finefocus-591	4	15	species	specie	NOUN
finefocus-591	4	16	.	.	PUNCT
finefocus-591	5	1	sequences	sequence	NOUN
finefocus-591	5	2	related	relate	VERB
finefocus-591	5	3	to	to	ADP
finefocus-591	5	4	borrelia	borrelia	ADJ
finefocus-591	5	5	burgdorferi	burgdorferi	NOUN
finefocus-591	5	6	in	in	ADP
finefocus-591	5	7	9.8	9.8	NUM
finefocus-591	5	8	%	%	NOUN
finefocus-591	5	9	(	(	PUNCT
finefocus-591	5	10	n=11/112	n=11/112	PROPN
finefocus-591	5	11	)	)	PUNCT
finefocus-591	5	12	,	,	PUNCT
finefocus-591	5	13	“	"	PUNCT
finefocus-591	5	14	candidatus	candidatus	PROPN
finefocus-591	5	15	borrelia	borrelia	PROPN
finefocus-591	5	16	lonestari	lonestari	NOUN
finefocus-591	5	17	”	"	PUNCT
finefocus-591	5	18	in	in	ADP
finefocus-591	5	19	16.9	16.9	NUM
finefocus-591	5	20	%	%	NOUN
finefocus-591	5	21	(	(	PUNCT
finefocus-591	5	22	n=19/112	n=19/112	NOUN
finefocus-591	5	23	)	)	PUNCT
finefocus-591	5	24	and	and	CCONJ
finefocus-591	5	25	ehrlichia	ehrlichia	VERB
finefocus-591	5	26	canis	canis	NOUN
finefocus-591	5	27	in	in	ADP
finefocus-591	5	28	12.5	12.5	NUM
finefocus-591	5	29	%	%	NOUN
finefocus-591	5	30	(	(	PUNCT
finefocus-591	5	31	n=14/112	n=14/112	PROPN
finefocus-591	5	32	)	)	PUNCT
finefocus-591	5	33	were	be	AUX
finefocus-591	5	34	detected	detect	VERB
finefocus-591	5	35	by	by	ADP
finefocus-591	5	36	pcr	pcr	PROPN
finefocus-591	5	37	.	.	PUNCT
finefocus-591	6	1	sequencing	sequence	VERB
finefocus-591	6	2	has	have	AUX
finefocus-591	6	3	confirmed	confirm	VERB
finefocus-591	6	4	the	the	DET
finefocus-591	6	5	presence	presence	NOUN
finefocus-591	6	6	of	of	ADP
finefocus-591	6	7	dna	dna	NOUN
finefocus-591	6	8	from	from	ADP
finefocus-591	6	9	ehrlichia	ehrlichia	PRON
finefocus-591	6	10	canis	canis	NOUN
finefocus-591	6	11	and	and	CCONJ
finefocus-591	6	12	“	"	PUNCT
finefocus-591	6	13	candidatus	candidatus	PROPN
finefocus-591	6	14	b.	b.	PROPN
finefocus-591	6	15	lonestari	lonestari	PROPN
finefocus-591	6	16	”	"	PUNCT
finefocus-591	6	17	,	,	PUNCT
finefocus-591	6	18	corroborating	corroborate	VERB
finefocus-591	6	19	that	that	SCONJ
finefocus-591	6	20	borrelia	borrelia	NOUN
finefocus-591	6	21	and	and	CCONJ
finefocus-591	6	22	ehrlichia	ehrlichia	NOUN
finefocus-591	6	23	are	be	AUX
finefocus-591	6	24	present	present	ADJ
finefocus-591	6	25	in	in	ADP
finefocus-591	6	26	domestic	domestic	ADJ
finefocus-591	6	27	dogs	dog	NOUN
finefocus-591	6	28	in	in	ADP
finefocus-591	6	29	south	south	PROPN
finefocus-591	6	30	texas	texas	PROPN
finefocus-591	6	31	.	.	PUNCT
finefocus-591	7	1	abstractcorresponding	abstractcorresponde	VERB
finefocus-591	7	2	author	author	NOUN
finefocus-591	7	3	*	*	PUNCT
finefocus-591	7	4	david	david	PROPN
finefocus-591	7	5	l.	l.	PROPN
finefocus-591	7	6	beck	beck	PROPN
finefocus-591	7	7	assistant	assistant	PROPN
finefocus-591	7	8	professor	professor	PROPN
finefocus-591	7	9	of	of	ADP
finefocus-591	7	10	biology	biology	NOUN
finefocus-591	7	11	department	department	PROPN
finefocus-591	7	12	of	of	ADP
finefocus-591	7	13	biology	biology	NOUN
finefocus-591	7	14	tennessee	tennessee	PROPN
finefocus-591	7	15	technological	technological	PROPN
finefocus-591	7	16	university	university	PROPN
finefocus-591	7	17	box	box	PROPN
finefocus-591	7	18	5063	5063	PROPN
finefocus-591	7	19	cookeville	cookeville	PROPN
finefocus-591	7	20	,	,	PUNCT
finefocus-591	7	21	tn	tn	PROPN
finefocus-591	7	22	38505	38505	NUM
finefocus-591	7	23	phone	phone	NOUN
finefocus-591	7	24	–	–	PUNCT
finefocus-591	7	25	(	(	PUNCT
finefocus-591	7	26	931	931	NUM
finefocus-591	7	27	)	)	PUNCT
finefocus-591	7	28	372	372	NUM
finefocus-591	7	29	-	-	PUNCT
finefocus-591	7	30	3375	3375	NUM
finefocus-591	7	31	fax	fax	NOUN
finefocus-591	7	32	–	–	PUNCT
finefocus-591	7	33	(	(	PUNCT
finefocus-591	7	34	931	931	NUM
finefocus-591	7	35	)	)	PUNCT
finefocus-591	7	36	372	372	NUM
finefocus-591	7	37	-	-	PUNCT
finefocus-591	7	38	6257	6257	NUM
finefocus-591	7	39	email	email	NOUN
finefocus-591	7	40	–	–	PUNCT
finefocus-591	7	41	dbeck@tntech.edu	dbeck@tntech.edu	VERB
finefocus-591	7	42	keywords	keyword	NOUN
finefocus-591	7	43	•	•	ADP
finefocus-591	7	44	borrelia	borrelia	NOUN
finefocus-591	7	45	•	•	NOUN
finefocus-591	7	46	ehrlichia	ehrlichia	VERB
finefocus-591	7	47	•	•	NUM
finefocus-591	7	48	rhipicephalus	rhipicephalus	ADJ
finefocus-591	7	49	sanguineus	sanguineus	NOUN
finefocus-591	7	50	•	•	NOUN
finefocus-591	7	51	lyme	lyme	NOUN
finefocus-591	7	52	disease	disease	NOUN
finefocus-591	7	53	•	•	ADP
finefocus-591	7	54	stari	stari	PROPN
finefocus-591	7	55	rhipicephalus	rhipicephalus	PROPN
finefocus-591	7	56	sanguineus	sanguineus	PROPN
finefocus-591	7	57	,	,	PUNCT
finefocus-591	7	58	known	know	VERB
finefocus-591	7	59	as	as	ADP
finefocus-591	7	60	the	the	DET
finefocus-591	7	61	brown	brown	ADJ
finefocus-591	7	62	dog	dog	NOUN
finefocus-591	7	63	tick	tick	NOUN
finefocus-591	7	64	,	,	PUNCT
finefocus-591	7	65	is	be	AUX
finefocus-591	7	66	the	the	DET
finefocus-591	7	67	most	most	ADV
finefocus-591	7	68	widely	widely	ADV
finefocus-591	7	69	distributed	distribute	VERB
finefocus-591	7	70	tick	tick	NOUN
finefocus-591	7	71	in	in	ADP
finefocus-591	7	72	the	the	DET
finefocus-591	7	73	world	world	NOUN
finefocus-591	7	74	(	(	PUNCT
finefocus-591	7	75	13	13	NUM
finefocus-591	7	76	)	)	PUNCT
finefocus-591	7	77	.	.	PUNCT
finefocus-591	8	1	this	this	DET
finefocus-591	8	2	tick	tick	NOUN
finefocus-591	8	3	is	be	AUX
finefocus-591	8	4	a	a	DET
finefocus-591	8	5	known	know	VERB
finefocus-591	8	6	vector	vector	NOUN
finefocus-591	8	7	of	of	ADP
finefocus-591	8	8	ehrlichia	ehrlichia	PRON
finefocus-591	8	9	canis	canis	X
finefocus-591	8	10	(	(	PUNCT
finefocus-591	8	11	23	23	NUM
finefocus-591	8	12	)	)	PUNCT
finefocus-591	8	13	,	,	PUNCT
finefocus-591	8	14	the	the	DET
finefocus-591	8	15	causative	causative	ADJ
finefocus-591	8	16	agent	agent	NOUN
finefocus-591	8	17	of	of	ADP
finefocus-591	8	18	canine	canine	PROPN
finefocus-591	8	19	ehrlichiosis	ehrlichiosis	NOUN
finefocus-591	8	20	(	(	PUNCT
finefocus-591	8	21	1,31	1,31	NUM
finefocus-591	8	22	)	)	PUNCT
finefocus-591	8	23	.	.	PUNCT
finefocus-591	9	1	the	the	DET
finefocus-591	9	2	symptoms	symptom	NOUN
finefocus-591	9	3	of	of	ADP
finefocus-591	9	4	chronic	chronic	ADJ
finefocus-591	9	5	e.	e.	PROPN
finefocus-591	9	6	canis	canis	PROPN
finefocus-591	9	7	infection	infection	NOUN
finefocus-591	9	8	in	in	ADP
finefocus-591	9	9	domestic	domestic	ADJ
finefocus-591	9	10	dogs	dog	NOUN
finefocus-591	9	11	may	may	AUX
finefocus-591	9	12	include	include	VERB
finefocus-591	9	13	thrombocytopenia	thrombocytopenia	PROPN
finefocus-591	9	14	,	,	PUNCT
finefocus-591	9	15	anemia	anemia	NOUN
finefocus-591	9	16	,	,	PUNCT
finefocus-591	9	17	weight	weight	NOUN
finefocus-591	9	18	loss	loss	NOUN
finefocus-591	9	19	,	,	PUNCT
finefocus-591	9	20	bleeding	bleeding	NOUN
finefocus-591	9	21	,	,	PUNCT
finefocus-591	9	22	fever	fever	NOUN
finefocus-591	9	23	,	,	PUNCT
finefocus-591	9	24	inflammation	inflammation	NOUN
finefocus-591	9	25	of	of	ADP
finefocus-591	9	26	the	the	DET
finefocus-591	9	27	eye	eye	NOUN
finefocus-591	9	28	,	,	PUNCT
finefocus-591	9	29	and	and	CCONJ
finefocus-591	9	30	anoxic	anoxic	ADJ
finefocus-591	9	31	hepatitis	hepatitis	NOUN
finefocus-591	9	32	(	(	PUNCT
finefocus-591	9	33	35	35	NUM
finefocus-591	9	34	)	)	PUNCT
finefocus-591	9	35	.	.	PUNCT
finefocus-591	10	1	acute	acute	PROPN
finefocus-591	10	2	ehrlichiosis	ehrlichiosis	PROPN
finefocus-591	10	3	in	in	ADP
finefocus-591	10	4	domestic	domestic	ADJ
finefocus-591	10	5	dogs	dog	NOUN
finefocus-591	10	6	may	may	AUX
finefocus-591	10	7	result	result	VERB
finefocus-591	10	8	in	in	ADP
finefocus-591	10	9	loss	loss	NOUN
finefocus-591	10	10	of	of	ADP
finefocus-591	10	11	appetite	appetite	NOUN
finefocus-591	10	12	,	,	PUNCT
finefocus-591	10	13	lethargy	lethargy	NOUN
finefocus-591	10	14	,	,	PUNCT
finefocus-591	10	15	shortness	shortness	NOUN
finefocus-591	10	16	of	of	ADP
finefocus-591	10	17	breath	breath	NOUN
finefocus-591	10	18	,	,	PUNCT
finefocus-591	10	19	bruises	bruise	NOUN
finefocus-591	10	20	,	,	PUNCT
finefocus-591	10	21	joint	joint	ADJ
finefocus-591	10	22	pain	pain	NOUN
finefocus-591	10	23	and	and	CCONJ
finefocus-591	10	24	depression	depression	NOUN
finefocus-591	10	25	(	(	PUNCT
finefocus-591	10	26	25	25	NUM
finefocus-591	10	27	)	)	PUNCT
finefocus-591	10	28	.	.	PUNCT
finefocus-591	11	1	r.	r.	PROPN
finefocus-591	11	2	sanguineus	sanguineus	PROPN
finefocus-591	11	3	is	be	AUX
finefocus-591	11	4	also	also	ADV
finefocus-591	11	5	thought	think	VERB
finefocus-591	11	6	to	to	PART
finefocus-591	11	7	be	be	AUX
finefocus-591	11	8	a	a	DET
finefocus-591	11	9	vector	vector	NOUN
finefocus-591	11	10	of	of	ADP
finefocus-591	11	11	rickettsia	rickettsia	NOUN
finefocus-591	11	12	rickettsii	rickettsii	NOUN
finefocus-591	11	13	(	(	PUNCT
finefocus-591	11	14	13,22	13,22	NUM
finefocus-591	11	15	)	)	PUNCT
finefocus-591	11	16	,	,	PUNCT
finefocus-591	11	17	the	the	DET
finefocus-591	11	18	cause	cause	NOUN
finefocus-591	11	19	of	of	ADP
finefocus-591	11	20	the	the	DET
finefocus-591	11	21	rocky	rocky	ADJ
finefocus-591	11	22	mountain	mountain	NOUN
finefocus-591	11	23	spotted	spot	VERB
finefocus-591	11	24	fever	fever	NOUN
finefocus-591	11	25	(	(	PUNCT
finefocus-591	11	26	14	14	NUM
finefocus-591	11	27	)	)	PUNCT
finefocus-591	11	28	.	.	PUNCT
finefocus-591	12	1	although	although	SCONJ
finefocus-591	12	2	r.	r.	PROPN
finefocus-591	12	3	sanguineus	sanguineus	PROPN
finefocus-591	12	4	ticks	tick	NOUN
finefocus-591	12	5	typically	typically	ADV
finefocus-591	12	6	prefer	prefer	VERB
finefocus-591	12	7	to	to	PART
finefocus-591	12	8	feed	feed	VERB
finefocus-591	12	9	on	on	ADP
finefocus-591	12	10	domestic	domestic	ADJ
finefocus-591	12	11	dogs	dog	NOUN
finefocus-591	12	12	,	,	PUNCT
finefocus-591	12	13	they	they	PRON
finefocus-591	12	14	have	have	AUX
finefocus-591	12	15	been	be	AUX
finefocus-591	12	16	reported	report	VERB
finefocus-591	12	17	to	to	PART
finefocus-591	12	18	parasitize	parasitize	VERB
finefocus-591	12	19	humans	human	NOUN
finefocus-591	12	20	as	as	ADV
finefocus-591	12	21	well	well	ADV
finefocus-591	12	22	(	(	PUNCT
finefocus-591	12	23	20,33	20,33	NUM
finefocus-591	12	24	)	)	PUNCT
finefocus-591	12	25	.	.	PUNCT
finefocus-591	13	1	the	the	DET
finefocus-591	13	2	presence	presence	NOUN
finefocus-591	13	3	of	of	ADP
finefocus-591	13	4	a	a	DET
finefocus-591	13	5	disease	disease	NOUN
finefocus-591	13	6	agent	agent	NOUN
finefocus-591	13	7	in	in	ADP
finefocus-591	13	8	the	the	DET
finefocus-591	13	9	domestic	domestic	ADJ
finefocus-591	13	10	dog	dog	NOUN
finefocus-591	13	11	population	population	NOUN
finefocus-591	13	12	can	can	AUX
finefocus-591	13	13	indicate	indicate	VERB
finefocus-591	13	14	that	that	SCONJ
finefocus-591	13	15	the	the	DET
finefocus-591	13	16	disease	disease	NOUN
finefocus-591	13	17	could	could	AUX
finefocus-591	13	18	also	also	ADV
finefocus-591	13	19	be	be	AUX
finefocus-591	13	20	present	present	ADJ
finefocus-591	13	21	in	in	ADP
finefocus-591	13	22	humans	human	NOUN
finefocus-591	13	23	(	(	PUNCT
finefocus-591	13	24	29	29	NUM
finefocus-591	13	25	)	)	PUNCT
finefocus-591	13	26	.	.	PUNCT
finefocus-591	14	1	b.	b.	PROPN
finefocus-591	14	2	burgdorferi	burgdorferi	ADJ
finefocus-591	14	3	sensu	sensu	NOUN
finefocus-591	14	4	stricto	stricto	X
finefocus-591	14	5	(	(	PUNCT
finefocus-591	14	6	39	39	NUM
finefocus-591	14	7	)	)	PUNCT
finefocus-591	14	8	has	have	AUX
finefocus-591	14	9	been	be	AUX
finefocus-591	14	10	identified	identify	VERB
finefocus-591	14	11	as	as	ADP
finefocus-591	14	12	the	the	DET
finefocus-591	14	13	sole	sole	ADJ
finefocus-591	14	14	etiologic	etiologic	ADJ
finefocus-591	14	15	agent	agent	NOUN
finefocus-591	14	16	of	of	ADP
finefocus-591	14	17	lyme	lyme	NOUN
finefocus-591	14	18	disease	disease	NOUN
finefocus-591	14	19	in	in	ADP
finefocus-591	14	20	north	north	PROPN
finefocus-591	14	21	america	america	PROPN
finefocus-591	14	22	(	(	PUNCT
finefocus-591	14	23	24,38	24,38	NOUN
finefocus-591	14	24	)	)	PUNCT
finefocus-591	14	25	.	.	PUNCT
finefocus-591	15	1	lyme	lyme	NOUN
finefocus-591	15	2	disease	disease	NOUN
finefocus-591	15	3	is	be	AUX
finefocus-591	15	4	the	the	DET
finefocus-591	15	5	most	most	ADV
finefocus-591	15	6	common	common	ADJ
finefocus-591	15	7	vector	vector	NOUN
finefocus-591	15	8	-	-	PUNCT
finefocus-591	15	9	borne	bear	VERB
finefocus-591	15	10	illness	illness	NOUN
finefocus-591	15	11	in	in	ADP
finefocus-591	15	12	the	the	DET
finefocus-591	15	13	northern	northern	ADJ
finefocus-591	15	14	united	united	PROPN
finefocus-591	15	15	states	states	PROPN
finefocus-591	15	16	(	(	PUNCT
finefocus-591	15	17	8)	8)	NUM
finefocus-591	15	18	and	and	CCONJ
finefocus-591	15	19	is	be	AUX
finefocus-591	15	20	considered	consider	VERB
finefocus-591	15	21	an	an	DET
finefocus-591	15	22	emerging	emerge	VERB
finefocus-591	15	23	infectious	infectious	ADJ
finefocus-591	15	24	disease	disease	NOUN
finefocus-591	15	25	(	(	PUNCT
finefocus-591	15	26	32	32	NUM
finefocus-591	15	27	)	)	PUNCT
finefocus-591	15	28	.	.	PUNCT
finefocus-591	16	1	the	the	DET
finefocus-591	16	2	main	main	ADJ
finefocus-591	16	3	vectors	vector	NOUN
finefocus-591	16	4	are	be	AUX
finefocus-591	16	5	ixodes	ixode	NOUN
finefocus-591	16	6	scapularis	scapularis	PROPN
finefocus-591	16	7	(	(	PUNCT
finefocus-591	16	8	17,18,37	17,18,37	NUM
finefocus-591	16	9	)	)	PUNCT
finefocus-591	16	10	and	and	CCONJ
finefocus-591	16	11	ixodes	ixode	NOUN
finefocus-591	16	12	pacificus	pacificus	PROPN
finefocus-591	16	13	(	(	PUNCT
finefocus-591	16	14	34	34	NUM
finefocus-591	16	15	)	)	PUNCT
finefocus-591	16	16	.	.	PUNCT
finefocus-591	17	1	the	the	DET
finefocus-591	17	2	agent	agent	NOUN
finefocus-591	17	3	has	have	AUX
finefocus-591	17	4	also	also	ADV
finefocus-591	17	5	been	be	AUX
finefocus-591	17	6	detected	detect	VERB
finefocus-591	17	7	at	at	ADP
finefocus-591	17	8	a	a	DET
finefocus-591	17	9	lower	low	ADJ
finefocus-591	17	10	incidence	incidence	NOUN
finefocus-591	17	11	in	in	ADP
finefocus-591	17	12	r.	r.	PROPN
finefocus-591	17	13	sanguineus	sanguineus	PROPN
finefocus-591	17	14	(	(	PUNCT
finefocus-591	17	15	9,21,42	9,21,42	NUM
finefocus-591	17	16	)	)	PUNCT
finefocus-591	17	17	and	and	CCONJ
finefocus-591	17	18	amblyomma	amblyomma	PROPN
finefocus-591	17	19	inornatum	inornatum	PROPN
finefocus-591	17	20	ticks	tick	NOUN
finefocus-591	17	21	(	(	PUNCT
finefocus-591	17	22	30	30	NUM
finefocus-591	17	23	)	)	PUNCT
finefocus-591	17	24	.	.	PUNCT
finefocus-591	18	1	however	however	ADV
finefocus-591	18	2	,	,	PUNCT
finefocus-591	18	3	the	the	DET
finefocus-591	18	4	vector	vector	NOUN
finefocus-591	18	5	potential	potential	NOUN
finefocus-591	18	6	of	of	ADP
finefocus-591	18	7	these	these	DET
finefocus-591	18	8	ticks	tick	NOUN
finefocus-591	18	9	has	have	AUX
finefocus-591	18	10	not	not	PART
finefocus-591	18	11	yet	yet	ADV
finefocus-591	18	12	been	be	AUX
finefocus-591	18	13	characterized	characterize	VERB
finefocus-591	18	14	.	.	PUNCT
finefocus-591	19	1	it	it	PRON
finefocus-591	19	2	has	have	AUX
finefocus-591	19	3	been	be	AUX
finefocus-591	19	4	previously	previously	ADV
finefocus-591	19	5	reported	report	VERB
finefocus-591	19	6	that	that	SCONJ
finefocus-591	19	7	b.	b.	PROPN
finefocus-591	19	8	burgdorferi	burgdorferi	PROPN
finefocus-591	19	9	in	in	ADP
finefocus-591	19	10	domestic	domestic	ADJ
finefocus-591	19	11	dogs	dog	NOUN
finefocus-591	19	12	may	may	AUX
finefocus-591	19	13	result	result	VERB
finefocus-591	19	14	in	in	ADP
finefocus-591	19	15	arthritis	arthritis	NOUN
finefocus-591	19	16	,	,	PUNCT
finefocus-591	19	17	similar	similar	ADJ
finefocus-591	19	18	to	to	ADP
finefocus-591	19	19	introduction	introduction	NOUN
finefocus-591	19	20	110	110	NUM
finefocus-591	19	21	•	•	NUM
finefocus-591	19	22	fine	fine	ADJ
finefocus-591	19	23	focus	focus	NOUN
finefocus-591	19	24	,	,	PUNCT
finefocus-591	19	25	vol	vol	NOUN
finefocus-591	19	26	.	.	NOUN
finefocus-591	19	27	1	1	NUM
finefocus-591	19	28	(	(	PUNCT
finefocus-591	19	29	2	2	NUM
finefocus-591	19	30	)	)	PUNCT
finefocus-591	20	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	20	2	110	110	NUM
finefocus-591	20	3	9/25/15	9/25/15	NUM
finefocus-591	20	4	11:38	11:38	NUM
finefocus-591	20	5	am	am	NOUN
finefocus-591	20	6	humans	human	NOUN
finefocus-591	20	7	suffering	suffer	VERB
finefocus-591	20	8	from	from	ADP
finefocus-591	20	9	lyme	lyme	NOUN
finefocus-591	20	10	disease	disease	NOUN
finefocus-591	20	11	(	(	PUNCT
finefocus-591	20	12	27	27	NUM
finefocus-591	20	13	)	)	PUNCT
finefocus-591	20	14	.	.	PUNCT
finefocus-591	21	1	symptoms	symptom	NOUN
finefocus-591	21	2	in	in	ADP
finefocus-591	21	3	domestic	domestic	ADJ
finefocus-591	21	4	dogs	dog	NOUN
finefocus-591	21	5	from	from	ADP
finefocus-591	21	6	the	the	DET
finefocus-591	21	7	acute	acute	ADJ
finefocus-591	21	8	form	form	NOUN
finefocus-591	21	9	of	of	ADP
finefocus-591	21	10	lyme	lyme	NOUN
finefocus-591	21	11	disease	disease	NOUN
finefocus-591	21	12	may	may	AUX
finefocus-591	21	13	include	include	VERB
finefocus-591	21	14	fever	fever	NOUN
finefocus-591	21	15	,	,	PUNCT
finefocus-591	21	16	swelling	swelling	NOUN
finefocus-591	21	17	,	,	PUNCT
finefocus-591	21	18	pain	pain	NOUN
finefocus-591	21	19	,	,	PUNCT
finefocus-591	21	20	lameness	lameness	NOUN
finefocus-591	21	21	,	,	PUNCT
finefocus-591	21	22	lymphadenopathy	lymphadenopathy	ADJ
finefocus-591	21	23	and	and	CCONJ
finefocus-591	21	24	malaise	malaise	NOUN
finefocus-591	21	25	(	(	PUNCT
finefocus-591	21	26	12	12	NUM
finefocus-591	21	27	)	)	PUNCT
finefocus-591	21	28	.	.	PUNCT
finefocus-591	22	1	acute	acute	ADJ
finefocus-591	22	2	renal	renal	ADJ
finefocus-591	22	3	failure	failure	NOUN
finefocus-591	22	4	,	,	PUNCT
finefocus-591	22	5	myocarditis	myocarditis	ADJ
finefocus-591	22	6	,	,	PUNCT
finefocus-591	22	7	cardiac	cardiac	ADJ
finefocus-591	22	8	arrhythmia	arrhythmia	NOUN
finefocus-591	22	9	,	,	PUNCT
finefocus-591	22	10	peripheral	peripheral	ADJ
finefocus-591	22	11	edema	edema	NOUN
finefocus-591	22	12	,	,	PUNCT
finefocus-591	22	13	neurological	neurological	ADJ
finefocus-591	22	14	syndrome	syndrome	NOUN
finefocus-591	22	15	and	and	CCONJ
finefocus-591	22	16	arthritis	arthritis	NOUN
finefocus-591	22	17	have	have	AUX
finefocus-591	22	18	been	be	AUX
finefocus-591	22	19	described	describe	VERB
finefocus-591	22	20	as	as	ADP
finefocus-591	22	21	clinical	clinical	ADJ
finefocus-591	22	22	signs	sign	NOUN
finefocus-591	22	23	found	find	VERB
finefocus-591	22	24	in	in	ADP
finefocus-591	22	25	the	the	DET
finefocus-591	22	26	chronic	chronic	ADJ
finefocus-591	22	27	form	form	NOUN
finefocus-591	22	28	of	of	ADP
finefocus-591	22	29	lyme	lyme	NOUN
finefocus-591	22	30	disease	disease	NOUN
finefocus-591	22	31	in	in	ADP
finefocus-591	22	32	domestic	domestic	ADJ
finefocus-591	22	33	dogs	dog	NOUN
finefocus-591	22	34	(	(	PUNCT
finefocus-591	22	35	2	2	NUM
finefocus-591	22	36	)	)	PUNCT
finefocus-591	22	37	.	.	PUNCT
finefocus-591	23	1	a	a	DET
finefocus-591	23	2	lyme	lyme	NOUN
finefocus-591	23	3	disease	disease	NOUN
finefocus-591	23	4	-	-	PUNCT
finefocus-591	23	5	like	like	ADJ
finefocus-591	23	6	illness	illness	NOUN
finefocus-591	23	7	has	have	AUX
finefocus-591	23	8	also	also	ADV
finefocus-591	23	9	been	be	AUX
finefocus-591	23	10	described	describe	VERB
finefocus-591	23	11	in	in	ADP
finefocus-591	23	12	the	the	DET
finefocus-591	23	13	southern	southern	ADJ
finefocus-591	23	14	united	united	PROPN
finefocus-591	23	15	states	states	PROPN
finefocus-591	23	16	since	since	SCONJ
finefocus-591	23	17	the	the	DET
finefocus-591	23	18	1980s	1980	NOUN
finefocus-591	23	19	(	(	PUNCT
finefocus-591	23	20	41	41	NUM
finefocus-591	23	21	)	)	PUNCT
finefocus-591	23	22	.	.	PUNCT
finefocus-591	24	1	this	this	DET
finefocus-591	24	2	condition	condition	NOUN
finefocus-591	24	3	is	be	AUX
finefocus-591	24	4	referred	refer	VERB
finefocus-591	24	5	to	to	ADP
finefocus-591	24	6	as	as	SCONJ
finefocus-591	24	7	the	the	DET
finefocus-591	24	8	southern	southern	ADJ
finefocus-591	24	9	tick	tick	NOUN
finefocus-591	24	10	associated	associate	VERB
finefocus-591	24	11	rash	rash	ADJ
finefocus-591	24	12	illness	illness	NOUN
finefocus-591	24	13	(	(	PUNCT
finefocus-591	24	14	stari	stari	NOUN
finefocus-591	24	15	)	)	PUNCT
finefocus-591	24	16	,	,	PUNCT
finefocus-591	24	17	and	and	CCONJ
finefocus-591	24	18	is	be	AUX
finefocus-591	24	19	thought	think	VERB
finefocus-591	24	20	to	to	PART
finefocus-591	24	21	be	be	AUX
finefocus-591	24	22	caused	cause	VERB
finefocus-591	24	23	by	by	ADP
finefocus-591	24	24	“	"	PUNCT
finefocus-591	24	25	candidatus	candidatus	PROPN
finefocus-591	24	26	b.	b.	PROPN
finefocus-591	24	27	lonestari	lonestari	PROPN
finefocus-591	24	28	”	"	PUNCT
finefocus-591	24	29	(	(	PUNCT
finefocus-591	24	30	40	40	NUM
finefocus-591	24	31	)	)	PUNCT
finefocus-591	24	32	after	after	ADP
finefocus-591	24	33	being	be	AUX
finefocus-591	24	34	bitten	bite	VERB
finefocus-591	24	35	by	by	ADP
finefocus-591	24	36	amblyomma	amblyomma	PROPN
finefocus-591	24	37	americanum	americanum	PROPN
finefocus-591	24	38	(	(	PUNCT
finefocus-591	24	39	3	3	NUM
finefocus-591	24	40	)	)	PUNCT
finefocus-591	24	41	.	.	PUNCT
finefocus-591	25	1	the	the	DET
finefocus-591	25	2	symptoms	symptom	NOUN
finefocus-591	25	3	of	of	ADP
finefocus-591	25	4	“	"	PUNCT
finefocus-591	25	5	candidatus	candidatus	PROPN
finefocus-591	25	6	b.	b.	PROPN
finefocus-591	25	7	lonestari	lonestari	PROPN
finefocus-591	25	8	”	"	PUNCT
finefocus-591	25	9	infection	infection	NOUN
finefocus-591	25	10	in	in	ADP
finefocus-591	25	11	domestic	domestic	ADJ
finefocus-591	25	12	dogs	dog	NOUN
finefocus-591	25	13	have	have	AUX
finefocus-591	25	14	not	not	PART
finefocus-591	25	15	been	be	AUX
finefocus-591	25	16	determined	determine	VERB
finefocus-591	25	17	.	.	PUNCT
finefocus-591	26	1	a	a	DET
finefocus-591	26	2	veterinarian	veterinarian	NOUN
finefocus-591	26	3	in	in	ADP
finefocus-591	26	4	laredo	laredo	PROPN
finefocus-591	26	5	,	,	PUNCT
finefocus-591	26	6	texas	texas	PROPN
finefocus-591	26	7	,	,	PUNCT
finefocus-591	26	8	usa	usa	PROPN
finefocus-591	26	9	has	have	AUX
finefocus-591	26	10	reported	report	VERB
finefocus-591	26	11	that	that	SCONJ
finefocus-591	26	12	lyme	lyme	NOUN
finefocus-591	26	13	disease	disease	NOUN
finefocus-591	26	14	is	be	AUX
finefocus-591	26	15	present	present	ADJ
finefocus-591	26	16	in	in	ADP
finefocus-591	26	17	local	local	ADJ
finefocus-591	26	18	domestic	domestic	ADJ
finefocus-591	26	19	dogs	dog	NOUN
finefocus-591	26	20	(	(	PUNCT
finefocus-591	26	21	dr	dr	PROPN
finefocus-591	26	22	.	.	PROPN
finefocus-591	26	23	sandra	sandra	PROPN
finefocus-591	26	24	leyendecker	leyendecker	PROPN
finefocus-591	26	25	,	,	PUNCT
finefocus-591	26	26	personal	personal	ADJ
finefocus-591	26	27	communication	communication	NOUN
finefocus-591	26	28	)	)	PUNCT
finefocus-591	26	29	.	.	PUNCT
finefocus-591	27	1	b.	b.	PROPN
finefocus-591	27	2	burgdorferi	burgdorferi	PROPN
finefocus-591	27	3	has	have	AUX
finefocus-591	27	4	been	be	AUX
finefocus-591	27	5	previously	previously	ADV
finefocus-591	27	6	detected	detect	VERB
finefocus-591	27	7	in	in	ADP
finefocus-591	27	8	coyotes	coyote	NOUN
finefocus-591	27	9	in	in	ADP
finefocus-591	27	10	webb	webb	PROPN
finefocus-591	27	11	county	county	PROPN
finefocus-591	27	12	(	(	PUNCT
finefocus-591	27	13	7	7	NUM
finefocus-591	27	14	)	)	PUNCT
finefocus-591	27	15	,	,	PUNCT
finefocus-591	27	16	texas	texas	PROPN
finefocus-591	27	17	.	.	PUNCT
finefocus-591	28	1	however	however	ADV
finefocus-591	28	2	,	,	PUNCT
finefocus-591	28	3	to	to	ADP
finefocus-591	28	4	the	the	DET
finefocus-591	28	5	extent	extent	NOUN
finefocus-591	28	6	of	of	ADP
finefocus-591	28	7	our	our	PRON
finefocus-591	28	8	knowledge	knowledge	NOUN
finefocus-591	28	9	it	it	PRON
finefocus-591	28	10	has	have	AUX
finefocus-591	28	11	not	not	PART
finefocus-591	28	12	been	be	AUX
finefocus-591	28	13	detected	detect	VERB
finefocus-591	28	14	in	in	ADP
finefocus-591	28	15	domestic	domestic	ADJ
finefocus-591	28	16	dogs	dog	NOUN
finefocus-591	28	17	.	.	PUNCT
finefocus-591	29	1	house	house	NOUN
finefocus-591	29	2	pets	pet	NOUN
finefocus-591	29	3	,	,	PUNCT
finefocus-591	29	4	including	include	VERB
finefocus-591	29	5	dogs	dog	NOUN
finefocus-591	29	6	,	,	PUNCT
finefocus-591	29	7	have	have	VERB
finefocus-591	29	8	an	an	DET
finefocus-591	29	9	increased	increase	VERB
finefocus-591	29	10	exposure	exposure	NOUN
finefocus-591	29	11	to	to	ADP
finefocus-591	29	12	ticks	tick	NOUN
finefocus-591	29	13	,	,	PUNCT
finefocus-591	29	14	and	and	CCONJ
finefocus-591	29	15	can	can	AUX
finefocus-591	29	16	serve	serve	VERB
finefocus-591	29	17	as	as	ADP
finefocus-591	29	18	sentinel	sentinel	ADJ
finefocus-591	29	19	organisms	organism	NOUN
finefocus-591	29	20	for	for	ADP
finefocus-591	29	21	some	some	DET
finefocus-591	29	22	diseases	disease	NOUN
finefocus-591	29	23	that	that	PRON
finefocus-591	29	24	occur	occur	VERB
finefocus-591	29	25	in	in	ADP
finefocus-591	29	26	humans	human	NOUN
finefocus-591	29	27	(	(	PUNCT
finefocus-591	29	28	29	29	NUM
finefocus-591	29	29	)	)	PUNCT
finefocus-591	29	30	.	.	PUNCT
finefocus-591	30	1	given	give	VERB
finefocus-591	30	2	the	the	DET
finefocus-591	30	3	limited	limited	ADJ
finefocus-591	30	4	information	information	NOUN
finefocus-591	30	5	available	available	ADJ
finefocus-591	30	6	on	on	ADP
finefocus-591	30	7	vector	vector	NOUN
finefocus-591	30	8	-	-	PUNCT
finefocus-591	30	9	borne	bear	VERB
finefocus-591	30	10	diseases	disease	NOUN
finefocus-591	30	11	in	in	ADP
finefocus-591	30	12	south	south	PROPN
finefocus-591	30	13	texas	texas	PROPN
finefocus-591	30	14	counties	county	NOUN
finefocus-591	30	15	,	,	PUNCT
finefocus-591	30	16	there	there	PRON
finefocus-591	30	17	is	be	VERB
finefocus-591	30	18	a	a	DET
finefocus-591	30	19	need	need	NOUN
finefocus-591	30	20	for	for	ADP
finefocus-591	30	21	tick	tick	NOUN
finefocus-591	30	22	and	and	CCONJ
finefocus-591	30	23	pathogen	pathogen	NOUN
finefocus-591	30	24	surveillance	surveillance	NOUN
finefocus-591	30	25	in	in	ADP
finefocus-591	30	26	the	the	DET
finefocus-591	30	27	area	area	NOUN
finefocus-591	30	28	.	.	PUNCT
finefocus-591	31	1	this	this	DET
finefocus-591	31	2	surveillance	surveillance	NOUN
finefocus-591	31	3	can	can	AUX
finefocus-591	31	4	help	help	VERB
finefocus-591	31	5	define	define	VERB
finefocus-591	31	6	areas	area	NOUN
finefocus-591	31	7	at	at	ADP
finefocus-591	31	8	high	high	ADJ
finefocus-591	31	9	risk	risk	NOUN
finefocus-591	31	10	for	for	ADP
finefocus-591	31	11	transmission	transmission	NOUN
finefocus-591	31	12	(	(	PUNCT
finefocus-591	31	13	26	26	NUM
finefocus-591	31	14	)	)	PUNCT
finefocus-591	31	15	of	of	ADP
finefocus-591	31	16	infection	infection	NOUN
finefocus-591	31	17	to	to	ADP
finefocus-591	31	18	mammals	mammal	NOUN
finefocus-591	31	19	,	,	PUNCT
finefocus-591	31	20	including	include	VERB
finefocus-591	31	21	humans	human	NOUN
finefocus-591	31	22	.	.	PUNCT
finefocus-591	32	1	identifying	identify	VERB
finefocus-591	32	2	areas	area	NOUN
finefocus-591	32	3	at	at	ADP
finefocus-591	32	4	high	high	ADJ
finefocus-591	32	5	risk	risk	NOUN
finefocus-591	32	6	of	of	ADP
finefocus-591	32	7	transmission	transmission	NOUN
finefocus-591	32	8	can	can	AUX
finefocus-591	32	9	increase	increase	VERB
finefocus-591	32	10	awareness	awareness	NOUN
finefocus-591	32	11	,	,	PUNCT
finefocus-591	32	12	potentially	potentially	ADV
finefocus-591	32	13	leading	lead	VERB
finefocus-591	32	14	to	to	ADP
finefocus-591	32	15	the	the	DET
finefocus-591	32	16	implementation	implementation	NOUN
finefocus-591	32	17	of	of	ADP
finefocus-591	32	18	better	well	ADJ
finefocus-591	32	19	diagnosis	diagnosis	NOUN
finefocus-591	32	20	and	and	CCONJ
finefocus-591	32	21	prevention	prevention	NOUN
finefocus-591	32	22	methods	method	NOUN
finefocus-591	32	23	.	.	PUNCT
finefocus-591	33	1	in	in	ADP
finefocus-591	33	2	addition	addition	NOUN
finefocus-591	33	3	,	,	PUNCT
finefocus-591	33	4	as	as	SCONJ
finefocus-591	33	5	laredo	laredo	PROPN
finefocus-591	33	6	is	be	AUX
finefocus-591	33	7	the	the	DET
finefocus-591	33	8	largest	large	ADJ
finefocus-591	33	9	land	land	NOUN
finefocus-591	33	10	-	-	PUNCT
finefocus-591	33	11	based	base	VERB
finefocus-591	33	12	port	port	NOUN
finefocus-591	33	13	of	of	ADP
finefocus-591	33	14	entry	entry	NOUN
finefocus-591	33	15	in	in	ADP
finefocus-591	33	16	the	the	DET
finefocus-591	33	17	united	united	PROPN
finefocus-591	33	18	states	states	PROPN
finefocus-591	33	19	,	,	PUNCT
finefocus-591	33	20	there	there	PRON
finefocus-591	33	21	is	be	VERB
finefocus-591	33	22	the	the	DET
finefocus-591	33	23	movement	movement	NOUN
finefocus-591	33	24	of	of	ADP
finefocus-591	33	25	a	a	DET
finefocus-591	33	26	large	large	ADJ
finefocus-591	33	27	number	number	NOUN
finefocus-591	33	28	of	of	ADP
finefocus-591	33	29	people	people	NOUN
finefocus-591	33	30	and	and	CCONJ
finefocus-591	33	31	animals	animal	NOUN
finefocus-591	33	32	to	to	ADP
finefocus-591	33	33	and	and	CCONJ
finefocus-591	33	34	from	from	ADP
finefocus-591	33	35	this	this	DET
finefocus-591	33	36	city	city	NOUN
finefocus-591	33	37	into	into	ADP
finefocus-591	33	38	the	the	DET
finefocus-591	33	39	rest	rest	NOUN
finefocus-591	33	40	of	of	ADP
finefocus-591	33	41	united	united	PROPN
finefocus-591	33	42	states	states	PROPN
finefocus-591	33	43	(	(	PUNCT
finefocus-591	33	44	11	11	NUM
finefocus-591	33	45	)	)	PUNCT
finefocus-591	33	46	.	.	PUNCT
finefocus-591	34	1	for	for	ADP
finefocus-591	34	2	example	example	NOUN
finefocus-591	34	3	,	,	PUNCT
finefocus-591	34	4	truck	truck	NOUN
finefocus-591	34	5	drivers	driver	NOUN
finefocus-591	34	6	frequently	frequently	ADV
finefocus-591	34	7	travel	travel	VERB
finefocus-591	34	8	to	to	ADP
finefocus-591	34	9	laredo	laredo	PROPN
finefocus-591	34	10	,	,	PUNCT
finefocus-591	34	11	tx	tx	VERB
finefocus-591	34	12	with	with	ADP
finefocus-591	34	13	their	their	PRON
finefocus-591	34	14	domestic	domestic	ADJ
finefocus-591	34	15	dogs	dog	NOUN
finefocus-591	34	16	to	to	ADP
finefocus-591	34	17	warehouses	warehouse	NOUN
finefocus-591	34	18	in	in	ADP
finefocus-591	34	19	the	the	DET
finefocus-591	34	20	city	city	NOUN
finefocus-591	34	21	.	.	PUNCT
finefocus-591	35	1	they	they	PRON
finefocus-591	35	2	may	may	AUX
finefocus-591	35	3	have	have	VERB
finefocus-591	35	4	to	to	PART
finefocus-591	35	5	wait	wait	VERB
finefocus-591	35	6	a	a	DET
finefocus-591	35	7	day	day	NOUN
finefocus-591	35	8	or	or	CCONJ
finefocus-591	35	9	two	two	NUM
finefocus-591	35	10	before	before	ADP
finefocus-591	35	11	leaving	leave	VERB
finefocus-591	35	12	to	to	ADP
finefocus-591	35	13	their	their	PRON
finefocus-591	35	14	destination	destination	NOUN
finefocus-591	35	15	.	.	PUNCT
finefocus-591	36	1	the	the	DET
finefocus-591	36	2	purpose	purpose	NOUN
finefocus-591	36	3	of	of	ADP
finefocus-591	36	4	this	this	DET
finefocus-591	36	5	study	study	NOUN
finefocus-591	36	6	was	be	AUX
finefocus-591	36	7	to	to	PART
finefocus-591	36	8	determine	determine	VERB
finefocus-591	36	9	the	the	DET
finefocus-591	36	10	prevalence	prevalence	NOUN
finefocus-591	36	11	of	of	ADP
finefocus-591	36	12	dna	dna	NOUN
finefocus-591	36	13	from	from	ADP
finefocus-591	36	14	tick	tick	NOUN
finefocus-591	36	15	-	-	PUNCT
finefocus-591	36	16	borne	bear	VERB
finefocus-591	36	17	disease	disease	NOUN
finefocus-591	36	18	agents	agent	NOUN
finefocus-591	36	19	in	in	ADP
finefocus-591	36	20	domestic	domestic	ADJ
finefocus-591	36	21	dogs	dog	NOUN
finefocus-591	36	22	from	from	ADP
finefocus-591	36	23	laredo	laredo	PROPN
finefocus-591	36	24	,	,	PUNCT
finefocus-591	36	25	texas	texas	PROPN
finefocus-591	36	26	,	,	PUNCT
finefocus-591	36	27	by	by	ADP
finefocus-591	36	28	investigating	investigate	VERB
finefocus-591	36	29	the	the	DET
finefocus-591	36	30	prevalence	prevalence	NOUN
finefocus-591	36	31	of	of	ADP
finefocus-591	36	32	borrelia	borrelia	NOUN
finefocus-591	36	33	,	,	PUNCT
finefocus-591	36	34	ehrlichia	ehrlichia	VERB
finefocus-591	36	35	and	and	CCONJ
finefocus-591	36	36	rickettsia	rickettsia	NOUN
finefocus-591	36	37	species	specie	NOUN
finefocus-591	36	38	in	in	ADP
finefocus-591	36	39	r.	r.	PROPN
finefocus-591	36	40	sanguineus	sanguineus	PROPN
finefocus-591	36	41	ticks	tick	NOUN
finefocus-591	36	42	.	.	PUNCT
finefocus-591	37	1	pathogens	pathogen	NOUN
finefocus-591	37	2	and	and	CCONJ
finefocus-591	37	3	antimicrobial	antimicrobial	ADJ
finefocus-591	37	4	factors	factor	NOUN
finefocus-591	37	5	•	•	NOUN
finefocus-591	37	6	111	111	NUM
finefocus-591	37	7	tick	tick	NOUN
finefocus-591	37	8	collection	collection	NOUN
finefocus-591	37	9	and	and	CCONJ
finefocus-591	37	10	identification	identification	NOUN
finefocus-591	37	11	fully	fully	ADV
finefocus-591	37	12	engorged	engorge	VERB
finefocus-591	37	13	adult	adult	NOUN
finefocus-591	37	14	r.	r.	PROPN
finefocus-591	37	15	sanguineus	sanguineus	PROPN
finefocus-591	37	16	ticks	tick	NOUN
finefocus-591	37	17	were	be	AUX
finefocus-591	37	18	collected	collect	VERB
finefocus-591	37	19	at	at	ADP
finefocus-591	37	20	multiple	multiple	ADJ
finefocus-591	37	21	sites	site	NOUN
finefocus-591	37	22	in	in	ADP
finefocus-591	37	23	laredo	laredo	PROPN
finefocus-591	37	24	,	,	PUNCT
finefocus-591	37	25	texas	texas	PROPN
finefocus-591	37	26	.	.	PUNCT
finefocus-591	38	1	the	the	DET
finefocus-591	38	2	ticks	tick	NOUN
finefocus-591	38	3	were	be	AUX
finefocus-591	38	4	collected	collect	VERB
finefocus-591	38	5	from	from	ADP
finefocus-591	38	6	the	the	DET
finefocus-591	38	7	walls	wall	NOUN
finefocus-591	38	8	of	of	ADP
finefocus-591	38	9	dog	dog	NOUN
finefocus-591	38	10	kennels	kennel	NOUN
finefocus-591	38	11	,	,	PUNCT
finefocus-591	38	12	or	or	CCONJ
finefocus-591	38	13	from	from	ADP
finefocus-591	38	14	a	a	DET
finefocus-591	38	15	co2	co2	NOUN
finefocus-591	38	16	trap	trap	NOUN
finefocus-591	38	17	placed	place	VERB
finefocus-591	38	18	in	in	ADP
finefocus-591	38	19	the	the	DET
finefocus-591	38	20	laredo	laredo	PROPN
finefocus-591	38	21	animal	animal	NOUN
finefocus-591	38	22	shelter	shelter	NOUN
finefocus-591	38	23	.	.	PUNCT
finefocus-591	39	1	ticks	tick	NOUN
finefocus-591	39	2	that	that	PRON
finefocus-591	39	3	were	be	AUX
finefocus-591	39	4	removed	remove	VERB
finefocus-591	39	5	while	while	SCONJ
finefocus-591	39	6	grooming	groom	VERB
finefocus-591	39	7	dogs	dog	NOUN
finefocus-591	39	8	were	be	AUX
finefocus-591	39	9	also	also	ADV
finefocus-591	39	10	collected	collect	VERB
finefocus-591	39	11	from	from	ADP
finefocus-591	39	12	animal	animal	NOUN
finefocus-591	39	13	caregivers/	caregivers/	NUM
finefocus-591	39	14	owners	owner	NOUN
finefocus-591	39	15	.	.	PUNCT
finefocus-591	40	1	the	the	DET
finefocus-591	40	2	researchers	researcher	NOUN
finefocus-591	40	3	had	have	VERB
finefocus-591	40	4	no	no	DET
finefocus-591	40	5	contact	contact	NOUN
finefocus-591	40	6	with	with	ADP
finefocus-591	40	7	any	any	DET
finefocus-591	40	8	animal	animal	NOUN
finefocus-591	40	9	in	in	ADP
finefocus-591	40	10	the	the	DET
finefocus-591	40	11	study	study	NOUN
finefocus-591	40	12	.	.	PUNCT
finefocus-591	41	1	the	the	DET
finefocus-591	41	2	ticks	tick	NOUN
finefocus-591	41	3	were	be	AUX
finefocus-591	41	4	counted	count	VERB
finefocus-591	41	5	and	and	CCONJ
finefocus-591	41	6	individually	individually	ADV
finefocus-591	41	7	examined	examine	VERB
finefocus-591	41	8	under	under	ADP
finefocus-591	41	9	the	the	DET
finefocus-591	41	10	microscope	microscope	NOUN
finefocus-591	41	11	to	to	PART
finefocus-591	41	12	identify	identify	VERB
finefocus-591	41	13	them	they	PRON
finefocus-591	41	14	to	to	ADP
finefocus-591	41	15	the	the	DET
finefocus-591	41	16	species	species	NOUN
finefocus-591	41	17	level	level	NOUN
finefocus-591	41	18	using	use	VERB
finefocus-591	41	19	a	a	DET
finefocus-591	41	20	published	publish	VERB
finefocus-591	41	21	key	key	NOUN
finefocus-591	41	22	(	(	PUNCT
finefocus-591	41	23	10	10	NUM
finefocus-591	41	24	)	)	PUNCT
finefocus-591	41	25	.	.	PUNCT
finefocus-591	42	1	dna	dna	PROPN
finefocus-591	42	2	extraction	extraction	VERB
finefocus-591	42	3	a	a	DET
finefocus-591	42	4	total	total	NOUN
finefocus-591	42	5	of	of	ADP
finefocus-591	42	6	124	124	NUM
finefocus-591	42	7	r.	r.	PROPN
finefocus-591	42	8	sanguineus	sanguineus	PROPN
finefocus-591	42	9	ticks	tick	NOUN
finefocus-591	42	10	(	(	PUNCT
finefocus-591	42	11	55	55	NUM
finefocus-591	42	12	males	male	NOUN
finefocus-591	42	13	and	and	CCONJ
finefocus-591	42	14	69	69	NUM
finefocus-591	42	15	females	female	NOUN
finefocus-591	42	16	)	)	PUNCT
finefocus-591	42	17	were	be	AUX
finefocus-591	42	18	used	use	VERB
finefocus-591	42	19	for	for	ADP
finefocus-591	42	20	dna	dna	NOUN
finefocus-591	42	21	extraction	extraction	NOUN
finefocus-591	42	22	using	use	VERB
finefocus-591	42	23	the	the	DET
finefocus-591	42	24	e.z.n.a	e.z.n.a	PROPN
finefocus-591	42	25	.	.	PUNCT
finefocus-591	42	26	mollusk	mollusk	PROPN
finefocus-591	42	27	dna	dna	PROPN
finefocus-591	42	28	isolation	isolation	NOUN
finefocus-591	42	29	kits	kit	NOUN
finefocus-591	42	30	(	(	PUNCT
finefocus-591	42	31	omega	omega	NOUN
finefocus-591	42	32	bio	bio	PROPN
finefocus-591	42	33	-	-	PUNCT
finefocus-591	42	34	tek	tek	PROPN
finefocus-591	42	35	,	,	PUNCT
finefocus-591	42	36	norcross	norcross	PROPN
finefocus-591	42	37	,	,	PUNCT
finefocus-591	42	38	ga	ga	PROPN
finefocus-591	42	39	,	,	PUNCT
finefocus-591	42	40	usa	usa	PROPN
finefocus-591	42	41	)	)	PUNCT
finefocus-591	42	42	.	.	PUNCT
finefocus-591	43	1	a	a	DET
finefocus-591	43	2	previously	previously	ADV
finefocus-591	43	3	reported	report	VERB
finefocus-591	43	4	protocol	protocol	NOUN
finefocus-591	43	5	was	be	AUX
finefocus-591	43	6	followed	follow	VERB
finefocus-591	43	7	and	and	CCONJ
finefocus-591	43	8	modified	modify	VERB
finefocus-591	43	9	as	as	ADP
finefocus-591	43	10	previously	previously	ADV
finefocus-591	43	11	described	describe	VERB
finefocus-591	43	12	(	(	PUNCT
finefocus-591	43	13	30	30	NUM
finefocus-591	43	14	)	)	PUNCT
finefocus-591	43	15	.	.	PUNCT
finefocus-591	44	1	briefly	briefly	NOUN
finefocus-591	44	2	,	,	PUNCT
finefocus-591	44	3	the	the	DET
finefocus-591	44	4	tick	tick	NOUN
finefocus-591	44	5	was	be	AUX
finefocus-591	44	6	homogenized	homogenize	VERB
finefocus-591	44	7	in	in	ADP
finefocus-591	44	8	300	300	NUM
finefocus-591	44	9	µl	µl	ADP
finefocus-591	44	10	lysis	lysis	NOUN
finefocus-591	44	11	buffer	buffer	NOUN
finefocus-591	44	12	.	.	PUNCT
finefocus-591	45	1	materials	material	NOUN
finefocus-591	45	2	and	and	CCONJ
finefocus-591	45	3	methods	method	NOUN
finefocus-591	45	4	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	45	5	111	111	NUM
finefocus-591	45	6	9/25/15	9/25/15	NUM
finefocus-591	45	7	11:38	11:38	NUM
finefocus-591	45	8	am	be	AUX
finefocus-591	45	9	112	112	NUM
finefocus-591	45	10	•	•	NUM
finefocus-591	45	11	fine	fine	ADJ
finefocus-591	45	12	focus	focus	NOUN
finefocus-591	45	13	,	,	PUNCT
finefocus-591	45	14	vol	vol	NOUN
finefocus-591	45	15	.	.	NOUN
finefocus-591	45	16	1	1	NUM
finefocus-591	45	17	(	(	PUNCT
finefocus-591	45	18	2	2	NUM
finefocus-591	45	19	)	)	PUNCT
finefocus-591	45	20	table	table	NOUN
finefocus-591	45	21	1	1	NUM
finefocus-591	45	22	.	.	PUNCT
finefocus-591	45	23	primers	primer	NOUN
finefocus-591	45	24	and	and	CCONJ
finefocus-591	45	25	thermal	thermal	ADJ
finefocus-591	45	26	cycler	cycler	NOUN
finefocus-591	45	27	settings	setting	NOUN
finefocus-591	45	28	used	use	VERB
finefocus-591	45	29	in	in	ADP
finefocus-591	45	30	this	this	DET
finefocus-591	45	31	study	study	NOUN
finefocus-591	45	32	primers	primer	NOUN
finefocus-591	45	33	amplicon	amplicon	NOUN
finefocus-591	45	34	length	length	NOUN
finefocus-591	45	35	pcr	pcr	PROPN
finefocus-591	45	36	conditions	condition	NOUN
finefocus-591	45	37	gene	gene	NOUN
finefocus-591	45	38	name	name	NOUN
finefocus-591	45	39	sequence	sequence	NOUN
finefocus-591	45	40	(	(	PUNCT
finefocus-591	45	41	5	5	NUM
finefocus-591	45	42	’	'	PUNCT
finefocus-591	45	43	→	→	SYM
finefocus-591	45	44	3	3	NUM
finefocus-591	45	45	’	'	PUNCT
finefocus-591	45	46	)	)	PUNCT
finefocus-591	45	47	specificity	specificity	NOUN
finefocus-591	45	48	denaturing	denature	VERB
finefocus-591	45	49	annealing	anneal	VERB
finefocus-591	45	50	extension	extension	NOUN
finefocus-591	45	51	cycles	cycle	NOUN
finefocus-591	45	52	12s	12s	X
finefocus-591	45	53	rrna	rrna	PROPN
finefocus-591	45	54	85f	85f	NOUN
finefocus-591	45	55	ttaagcttttcagaggaatttgctc	ttaagcttttcagaggaatttgctc	VERB
finefocus-591	45	56	140	140	NUM
finefocus-591	45	57	bp	bp	PROPN
finefocus-591	45	58	95	95	NUM
finefocus-591	45	59	°	°	SYM
finefocus-591	45	60	c	c	NOUN
finefocus-591	45	61	,	,	PUNCT
finefocus-591	45	62	30sec	30sec	NOUN
finefocus-591	45	63	45	45	NUM
finefocus-591	45	64	°	°	NOUN
finefocus-591	45	65	c	c	NOUN
finefocus-591	45	66	,	,	PUNCT
finefocus-591	45	67	30sec	30sec	NOUN
finefocus-591	45	68	72	72	NUM
finefocus-591	45	69	°	°	SYM
finefocus-591	45	70	c	c	NOUN
finefocus-591	45	71	,	,	PUNCT
finefocus-591	45	72	1min	1min	NUM
finefocus-591	45	73	40	40	NUM
finefocus-591	45	74	225r	225r	PROPN
finefocus-591	45	75	tttwwgctgcaccttgacttaa	tttwwgctgcaccttgacttaa	PROPN
finefocus-591	45	76	not	not	PART
finefocus-591	45	77	reported	report	VERB
finefocus-591	45	78	flab	flab	NOUN
finefocus-591	45	79	flals	flal	NOUN
finefocus-591	45	80	aacagctgaagagcttggaatg	aacagctgaagagcttggaatg	PROPN
finefocus-591	45	81	353	353	NUM
finefocus-591	45	82	bp	bp	PROPN
finefocus-591	45	83	95	95	NUM
finefocus-591	45	84	°	°	SYM
finefocus-591	45	85	c	c	X
finefocus-591	45	86	,	,	PUNCT
finefocus-591	45	87	1min	1min	NUM
finefocus-591	45	88	55	55	NUM
finefocus-591	45	89	°	°	NOUN
finefocus-591	45	90	c	c	NOUN
finefocus-591	45	91	,	,	PUNCT
finefocus-591	45	92	1min	1min	NUM
finefocus-591	45	93	72	72	NUM
finefocus-591	45	94	°	°	NOUN
finefocus-591	45	95	c	c	NOUN
finefocus-591	45	96	,	,	PUNCT
finefocus-591	45	97	1min	1min	NUM
finefocus-591	45	98	36	36	NUM
finefocus-591	45	99	flars	flar	NOUN
finefocus-591	45	100	ctttgatcacttatcattctaatagc	ctttgatcacttatcattctaatagc	NOUN
finefocus-591	45	101	borrelia	borrelia	PROPN
finefocus-591	45	102	genus	genus	NOUN
finefocus-591	45	103	bl	bl	NOUN
finefocus-591	45	104	-	-	PUNCT
finefocus-591	45	105	fla522f	fla522f	NOUN
finefocus-591	45	106	ggtacatattcagatgcagacagaggg	ggtacatattcagatgcagacagaggg	NOUN
finefocus-591	45	107	660	660	NUM
finefocus-591	45	108	bp	bp	PROPN
finefocus-591	45	109	95	95	NUM
finefocus-591	45	110	°	°	SYM
finefocus-591	45	111	c	c	X
finefocus-591	45	112	,	,	PUNCT
finefocus-591	45	113	1min	1min	NUM
finefocus-591	45	114	55	55	NUM
finefocus-591	45	115	°	°	NOUN
finefocus-591	45	116	c	c	NOUN
finefocus-591	45	117	,	,	PUNCT
finefocus-591	45	118	1min	1min	NUM
finefocus-591	45	119	72	72	NUM
finefocus-591	45	120	°	°	NOUN
finefocus-591	45	121	c	c	NOUN
finefocus-591	45	122	,	,	PUNCT
finefocus-591	45	123	1min	1min	NUM
finefocus-591	45	124	46	46	NUM
finefocus-591	45	125	bl	bl	NOUN
finefocus-591	45	126	-	-	PUNCT
finefocus-591	45	127	fla1182r	fla1182r	PROPN
finefocus-591	45	128	gcacttgatttgcttgtgcaatcatagcc	gcacttgatttgcttgtgcaatcatagcc	NOUN
finefocus-591	45	129	“	"	PUNCT
finefocus-591	45	130	candidatus	candidatus	PROPN
finefocus-591	45	131	b.	b.	PROPN
finefocus-591	45	132	lonestari	lonestari	PROPN
finefocus-591	45	133	”	"	PUNCT
finefocus-591	45	134	bl	bl	PROPN
finefocus-591	45	135	-	-	PUNCT
finefocus-591	45	136	fla662f	fla662f	X
finefocus-591	45	137	aactgctgaagagcttggaatgc	aactgctgaagagcttggaatgc	ADJ
finefocus-591	45	138	198	198	NUM
finefocus-591	45	139	bp	bp	PROPN
finefocus-591	45	140	95	95	NUM
finefocus-591	45	141	°	°	SYM
finefocus-591	45	142	c	c	X
finefocus-591	45	143	,	,	PUNCT
finefocus-591	45	144	1min	1min	NUM
finefocus-591	45	145	55	55	NUM
finefocus-591	45	146	°	°	NOUN
finefocus-591	45	147	c	c	NOUN
finefocus-591	45	148	,	,	PUNCT
finefocus-591	45	149	1min	1min	NUM
finefocus-591	45	150	72	72	NUM
finefocus-591	45	151	°	°	NOUN
finefocus-591	45	152	c	c	NOUN
finefocus-591	45	153	,	,	PUNCT
finefocus-591	45	154	1min	1min	NUM
finefocus-591	45	155	36	36	NUM
finefocus-591	45	156	dsb	dsb	NOUN
finefocus-591	45	157	bl	bl	PROPN
finefocus-591	45	158	-	-	PUNCT
finefocus-591	45	159	fla860r	fla860r	NOUN
finefocus-591	45	160	agctggttgaactccttcctgttgt	agctggttgaactccttcctgttgt	ADJ
finefocus-591	45	161	“	"	PUNCT
finefocus-591	45	162	candidatus	candidatus	PROPN
finefocus-591	45	163	b.	b.	PROPN
finefocus-591	45	164	lonestari	lonestari	PROPN
finefocus-591	45	165	”	"	PUNCT
finefocus-591	45	166	ehr	ehr	NOUN
finefocus-591	45	167	-	-	PUNCT
finefocus-591	45	168	dsb-330f	dsb-330f	NOUN
finefocus-591	45	169	gatgatgtctgaagatatgaaacaaat	gatgatgtctgaagatatgaaacaaat	VERB
finefocus-591	45	170	398	398	NUM
finefocus-591	45	171	bp	bp	PROPN
finefocus-591	45	172	95	95	NUM
finefocus-591	45	173	°	°	SYM
finefocus-591	45	174	c	c	X
finefocus-591	45	175	,	,	PUNCT
finefocus-591	45	176	1min	1min	NUM
finefocus-591	45	177	55	55	NUM
finefocus-591	45	178	°	°	NOUN
finefocus-591	45	179	c	c	NOUN
finefocus-591	45	180	,	,	PUNCT
finefocus-591	45	181	1min	1min	NUM
finefocus-591	45	182	72	72	NUM
finefocus-591	45	183	°	°	NOUN
finefocus-591	45	184	c	c	NOUN
finefocus-591	45	185	,	,	PUNCT
finefocus-591	45	186	1min	1min	NUM
finefocus-591	45	187	46	46	NUM
finefocus-591	45	188	16s	16	NOUN
finefocus-591	45	189	rrna	rrna	PROPN
finefocus-591	45	190	ehr	ehr	NOUN
finefocus-591	45	191	-	-	PUNCT
finefocus-591	45	192	dsb-728r	dsb-728r	NOUN
finefocus-591	45	193	ctgctcgtctattttacttcttaaagt	ctgctcgtctattttacttcttaaagt	NOUN
finefocus-591	45	194	ehrlichia	ehrlichia	VERB
finefocus-591	45	195	genus	genus	PROPN
finefocus-591	45	196	b16s	b16s	PROPN
finefocus-591	45	197	-	-	PUNCT
finefocus-591	45	198	fl	fl	PRON
finefocus-591	45	199	gactcgtcaagactgacgctaagtc	gactcgtcaagactgacgctaagtc	PROPN
finefocus-591	45	200	131	131	NUM
finefocus-591	45	201	bp	bp	PROPN
finefocus-591	45	202	95	95	NUM
finefocus-591	45	203	°	°	SYM
finefocus-591	45	204	c	c	NOUN
finefocus-591	45	205	,	,	PUNCT
finefocus-591	45	206	15sec	15sec	NOUN
finefocus-591	45	207	58	58	NUM
finefocus-591	45	208	°	°	NOUN
finefocus-591	45	209	c	c	NOUN
finefocus-591	45	210	,	,	PUNCT
finefocus-591	45	211	30sec	30sec	NOUN
finefocus-591	45	212	72	72	NUM
finefocus-591	45	213	°	°	PRON
finefocus-591	45	214	c,30sec	c,30sec	PROPN
finefocus-591	45	215	40	40	NUM
finefocus-591	45	216	b16s	b16	NOUN
finefocus-591	45	217	-	-	PUNCT
finefocus-591	45	218	r	r	NOUN
finefocus-591	45	219	gcacacttaacacgttagcttcggtactaa	gcacacttaacacgttagcttcggtactaa	NOUN
finefocus-591	45	220	borrelia	borrelia	NOUN
finefocus-591	45	221	genus	genus	NOUN
finefocus-591	45	222	bl-16s5f	bl-16s5f	ADP
finefocus-591	45	223	cagtgcgtcttaagcatgcaagtcagacgg	cagtgcgtcttaagcatgcaagtcagacgg	NOUN
finefocus-591	46	1	481	481	NUM
finefocus-591	46	2	bp	bp	PROPN
finefocus-591	46	3	95	95	NUM
finefocus-591	46	4	°	°	SYM
finefocus-591	46	5	c	c	X
finefocus-591	46	6	,	,	PUNCT
finefocus-591	46	7	1min	1min	NUM
finefocus-591	46	8	60	60	NUM
finefocus-591	46	9	°	°	NOUN
finefocus-591	46	10	c	c	NOUN
finefocus-591	46	11	,	,	PUNCT
finefocus-591	46	12	1min	1min	NUM
finefocus-591	46	13	72	72	NUM
finefocus-591	46	14	°	°	NOUN
finefocus-591	46	15	c	c	NOUN
finefocus-591	46	16	,	,	PUNCT
finefocus-591	46	17	1min	1min	NUM
finefocus-591	46	18	36	36	NUM
finefocus-591	46	19	bl-16s486r	bl-16s486r	PROPN
finefocus-591	46	20	ctgctggcacgtaattagccgggg	ctgctggcacgtaattagccgggg	NOUN
finefocus-591	46	21	“	"	PUNCT
finefocus-591	46	22	candidatus	candidatus	PROPN
finefocus-591	46	23	b.	b.	PROPN
finefocus-591	46	24	lonestari	lonestari	PROPN
finefocus-591	46	25	”	"	PUNCT
finefocus-591	46	26	b16s-23s	b16s-23s	PROPN
finefocus-591	46	27	-	-	PUNCT
finefocus-591	46	28	igsf	igsf	ADJ
finefocus-591	46	29	gtatgtttagtgaggggggtg	gtatgtttagtgaggggggtg	NOUN
finefocus-591	46	30	variable	variable	NOUN
finefocus-591	46	31	94	94	NUM
finefocus-591	46	32	°	°	SYM
finefocus-591	46	33	c	c	NOUN
finefocus-591	46	34	,	,	PUNCT
finefocus-591	46	35	30sec	30sec	NOUN
finefocus-591	46	36	56	56	NUM
finefocus-591	46	37	°	°	NOUN
finefocus-591	46	38	c	c	NOUN
finefocus-591	46	39	,	,	PUNCT
finefocus-591	46	40	30sec	30sec	NOUN
finefocus-591	46	41	74	74	NUM
finefocus-591	46	42	°	°	NOUN
finefocus-591	46	43	c	c	NOUN
finefocus-591	46	44	,	,	PUNCT
finefocus-591	46	45	1min	1min	NUM
finefocus-591	46	46	35	35	NUM
finefocus-591	46	47	b16s-23s	b16s-23s	NUM
finefocus-591	46	48	-	-	PUNCT
finefocus-591	46	49	igsr	igsr	NOUN
finefocus-591	46	50	ggatcatagctcaggtggttag	ggatcatagctcaggtggttag	NOUN
finefocus-591	46	51	borrelia	borrelia	NOUN
finefocus-591	46	52	genus	genus	NOUN
finefocus-591	46	53	b16s-23s	b16s-23s	NUM
finefocus-591	46	54	-	-	PUNCT
finefocus-591	46	55	igsfn	igsfn	NOUN
finefocus-591	46	56	aggggggtgaagtcgtaacaag	aggggggtgaagtcgtaacaag	NOUN
finefocus-591	46	57	variable	variable	ADJ
finefocus-591	46	58	94	94	NUM
finefocus-591	46	59	°	°	SYM
finefocus-591	46	60	c	c	NOUN
finefocus-591	46	61	,	,	PUNCT
finefocus-591	46	62	30sec	30sec	NOUN
finefocus-591	46	63	60	60	NUM
finefocus-591	46	64	°	°	NOUN
finefocus-591	46	65	c	c	NOUN
finefocus-591	46	66	,	,	PUNCT
finefocus-591	46	67	30sec	30sec	NOUN
finefocus-591	46	68	74	74	NUM
finefocus-591	46	69	°	°	NOUN
finefocus-591	46	70	c	c	NOUN
finefocus-591	46	71	,	,	PUNCT
finefocus-591	46	72	1min	1min	NUM
finefocus-591	46	73	40	40	NUM
finefocus-591	46	74	b16s-23s	b16s-23s	NUM
finefocus-591	46	75	-	-	PUNCT
finefocus-591	46	76	igsrn	igsrn	PROPN
finefocus-591	46	77	gtctgataaacctgaggtcgga	gtctgataaacctgaggtcgga	PROPN
finefocus-591	46	78	borrelia	borrelia	PROPN
finefocus-591	46	79	genus	genus	NOUN
finefocus-591	46	80	ecan	ecan	PROPN
finefocus-591	46	81	-	-	PUNCT
finefocus-591	46	82	f	f	PROPN
finefocus-591	46	83	atttatagcctctggctatagga	atttatagcctctggctatagga	PROPN
finefocus-591	46	84	383	383	NUM
finefocus-591	46	85	bp	bp	PROPN
finefocus-591	46	86	94	94	NUM
finefocus-591	46	87	°	°	SYM
finefocus-591	46	88	c	c	NOUN
finefocus-591	46	89	,	,	PUNCT
finefocus-591	46	90	30sec	30sec	NOUN
finefocus-591	46	91	52	52	NUM
finefocus-591	46	92	°	°	NOUN
finefocus-591	46	93	c	c	NOUN
finefocus-591	46	94	,	,	PUNCT
finefocus-591	46	95	30sec	30sec	NOUN
finefocus-591	46	96	72	72	NUM
finefocus-591	46	97	°	°	SYM
finefocus-591	46	98	c	c	NOUN
finefocus-591	46	99	,	,	PUNCT
finefocus-591	46	100	1min	1min	NUM
finefocus-591	46	101	36	36	NUM
finefocus-591	46	102	e.	e.	PROPN
finefocus-591	46	103	canis	canis	PROPN
finefocus-591	46	104	he1	he1	PROPN
finefocus-591	46	105	-	-	PUNCT
finefocus-591	46	106	f	f	PROPN
finefocus-591	46	107	caattgcttataaccttttggttataaat	caattgcttataaccttttggttataaat	PROPN
finefocus-591	46	108	383	383	NUM
finefocus-591	46	109	bp	bp	PROPN
finefocus-591	46	110	94	94	NUM
finefocus-591	46	111	°	°	SYM
finefocus-591	46	112	c	c	NOUN
finefocus-591	46	113	,	,	PUNCT
finefocus-591	46	114	30sec	30sec	NOUN
finefocus-591	46	115	52	52	NUM
finefocus-591	46	116	°	°	NOUN
finefocus-591	46	117	c	c	NOUN
finefocus-591	46	118	,	,	PUNCT
finefocus-591	46	119	30sec	30sec	NOUN
finefocus-591	46	120	72	72	NUM
finefocus-591	46	121	°	°	SYM
finefocus-591	46	122	c	c	NOUN
finefocus-591	46	123	,	,	PUNCT
finefocus-591	46	124	1min	1min	NUM
finefocus-591	46	125	36	36	NUM
finefocus-591	46	126	e.	e.	PROPN
finefocus-591	46	127	chaffeensis	chaffeensis	PROPN
finefocus-591	46	128	rompa	rompa	NOUN
finefocus-591	46	129	he3	he3	NOUN
finefocus-591	46	130	-	-	PUNCT
finefocus-591	46	131	r	r	NOUN
finefocus-591	46	132	tataggtaccgtcattatcttccctat	tataggtaccgtcattatcttccctat	NOUN
finefocus-591	46	133	ehrlichia	ehrlichia	VERB
finefocus-591	46	134	genus	genus	NOUN
finefocus-591	46	135	94	94	NUM
finefocus-591	46	136	°	°	SYM
finefocus-591	46	137	c	c	NOUN
finefocus-591	46	138	,	,	PUNCT
finefocus-591	46	139	30sec	30sec	NOUN
finefocus-591	46	140	52	52	NUM
finefocus-591	46	141	°	°	NOUN
finefocus-591	46	142	c	c	NOUN
finefocus-591	46	143	,	,	PUNCT
finefocus-591	46	144	30sec	30sec	NOUN
finefocus-591	46	145	72	72	NUM
finefocus-591	46	146	°	°	SYM
finefocus-591	46	147	c	c	NOUN
finefocus-591	46	148	,	,	PUNCT
finefocus-591	46	149	1min	1min	NUM
finefocus-591	46	150	36	36	NUM
finefocus-591	46	151	rr190	rr190	PROPN
finefocus-591	46	152	70p	70p	NOUN
finefocus-591	46	153	atggcgaatatttctccaaaa	atggcgaatatttctccaaaa	VERB
finefocus-591	46	154	532	532	NUM
finefocus-591	46	155	bp	bp	PROPN
finefocus-591	46	156	95	95	NUM
finefocus-591	46	157	°	°	SYM
finefocus-591	46	158	c	c	X
finefocus-591	46	159	,	,	PUNCT
finefocus-591	46	160	1min	1min	NUM
finefocus-591	46	161	55	55	NUM
finefocus-591	46	162	°	°	NOUN
finefocus-591	46	163	c	c	NOUN
finefocus-591	46	164	,	,	PUNCT
finefocus-591	46	165	1min	1min	NUM
finefocus-591	46	166	72	72	NUM
finefocus-591	46	167	°	°	NOUN
finefocus-591	46	168	c	c	NOUN
finefocus-591	46	169	,	,	PUNCT
finefocus-591	46	170	1min	1min	NUM
finefocus-591	46	171	46	46	NUM
finefocus-591	46	172	rr190	rr190	PROPN
finefocus-591	46	173	602n	602n	NOUN
finefocus-591	46	174	agtgcagcattcgctccccct	agtgcagcattcgctccccct	ADP
finefocus-591	46	175	rickettsia	rickettsia	NOUN
finefocus-591	46	176	genus	genus	NOUN
finefocus-591	46	177	the	the	DET
finefocus-591	46	178	tick	tick	NOUN
finefocus-591	46	179	was	be	AUX
finefocus-591	46	180	crushed	crush	VERB
finefocus-591	46	181	for	for	ADP
finefocus-591	46	182	5	5	NUM
finefocus-591	46	183	minutes	minute	NOUN
finefocus-591	46	184	using	use	VERB
finefocus-591	46	185	a	a	DET
finefocus-591	46	186	sterile	sterile	ADJ
finefocus-591	46	187	microtube	microtube	NOUN
finefocus-591	46	188	and	and	CCONJ
finefocus-591	46	189	pestle	pestle	NOUN
finefocus-591	46	190	.	.	PUNCT
finefocus-591	47	1	after	after	ADP
finefocus-591	47	2	adding	add	VERB
finefocus-591	47	3	proteinase	proteinase	PROPN
finefocus-591	47	4	k	k	PROPN
finefocus-591	47	5	,	,	PUNCT
finefocus-591	47	6	the	the	DET
finefocus-591	47	7	samples	sample	NOUN
finefocus-591	47	8	were	be	AUX
finefocus-591	47	9	incubated	incubate	VERB
finefocus-591	47	10	at	at	ADP
finefocus-591	47	11	55	55	NUM
finefocus-591	47	12	°	°	ADP
finefocus-591	47	13	c	c	NOUN
finefocus-591	47	14	for	for	ADP
finefocus-591	47	15	3h	3h	NUM
finefocus-591	47	16	.	.	PUNCT
finefocus-591	48	1	the	the	DET
finefocus-591	48	2	sample	sample	NOUN
finefocus-591	48	3	purification	purification	NOUN
finefocus-591	48	4	was	be	AUX
finefocus-591	48	5	then	then	ADV
finefocus-591	48	6	completed	complete	VERB
finefocus-591	48	7	following	follow	VERB
finefocus-591	48	8	the	the	DET
finefocus-591	48	9	manufacturer	manufacturer	NOUN
finefocus-591	48	10	’s	’s	PART
finefocus-591	48	11	protocol	protocol	NOUN
finefocus-591	48	12	.	.	PUNCT
finefocus-591	49	1	polymerase	polymerase	NOUN
finefocus-591	49	2	chain	chain	NOUN
finefocus-591	49	3	reaction	reaction	NOUN
finefocus-591	49	4	(	(	PUNCT
finefocus-591	49	5	pcr	pcr	PROPN
finefocus-591	49	6	)	)	PUNCT
finefocus-591	49	7	the	the	DET
finefocus-591	49	8	samples	sample	NOUN
finefocus-591	49	9	were	be	AUX
finefocus-591	49	10	screened	screen	VERB
finefocus-591	49	11	using	use	VERB
finefocus-591	49	12	pcr	pcr	NOUN
finefocus-591	49	13	for	for	ADP
finefocus-591	49	14	the	the	DET
finefocus-591	49	15	tick	tick	PROPN
finefocus-591	49	16	12s	12s	X
finefocus-591	49	17	rrna	rrna	PROPN
finefocus-591	49	18	gene	gene	NOUN
finefocus-591	49	19	as	as	ADP
finefocus-591	49	20	previously	previously	ADV
finefocus-591	49	21	described	describe	VERB
finefocus-591	49	22	(	(	PUNCT
finefocus-591	49	23	30	30	NUM
finefocus-591	49	24	)	)	PUNCT
finefocus-591	49	25	.	.	PUNCT
finefocus-591	50	1	samples	sample	NOUN
finefocus-591	50	2	positive	positive	ADJ
finefocus-591	50	3	for	for	ADP
finefocus-591	50	4	tick	tick	NOUN
finefocus-591	50	5	rdna	rdna	NOUN
finefocus-591	50	6	(	(	PUNCT
finefocus-591	50	7	n=112	n=112	NOUN
finefocus-591	50	8	)	)	PUNCT
finefocus-591	50	9	were	be	AUX
finefocus-591	50	10	subjected	subject	VERB
finefocus-591	50	11	to	to	ADP
finefocus-591	50	12	pcr	pcr	NOUN
finefocus-591	50	13	for	for	ADP
finefocus-591	50	14	amplification	amplification	NOUN
finefocus-591	50	15	of	of	ADP
finefocus-591	50	16	borrelia	borrelia	NOUN
finefocus-591	50	17	,	,	PUNCT
finefocus-591	50	18	“	"	PUNCT
finefocus-591	50	19	candidatus	candidatus	PROPN
finefocus-591	50	20	b.	b.	PROPN
finefocus-591	50	21	lonestari	lonestari	PROPN
finefocus-591	50	22	”	"	PUNCT
finefocus-591	50	23	,	,	PUNCT
finefocus-591	50	24	ehrlichia	ehrlichia	VERB
finefocus-591	50	25	and	and	CCONJ
finefocus-591	50	26	rickettsia	rickettsia	NOUN
finefocus-591	50	27	bacteria	bacteria	NOUN
finefocus-591	50	28	species	specie	NOUN
finefocus-591	50	29	(	(	PUNCT
finefocus-591	50	30	43,44	43,44	NOUN
finefocus-591	50	31	)	)	PUNCT
finefocus-591	50	32	.	.	PUNCT
finefocus-591	51	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	51	2	112	112	NUM
finefocus-591	51	3	9/25/15	9/25/15	NUM
finefocus-591	51	4	11:38	11:38	NUM
finefocus-591	51	5	am	am	NOUN
finefocus-591	51	6	pathogens	pathogen	NOUN
finefocus-591	51	7	and	and	CCONJ
finefocus-591	51	8	antimicrobial	antimicrobial	ADJ
finefocus-591	51	9	factors	factor	NOUN
finefocus-591	51	10	•	•	NOUN
finefocus-591	51	11	113	113	NUM
finefocus-591	51	12	table	table	NOUN
finefocus-591	51	13	1	1	NUM
finefocus-591	51	14	(	(	PUNCT
finefocus-591	51	15	ctd	ctd	PROPN
finefocus-591	51	16	.	.	PUNCT
finefocus-591	51	17	)	)	PUNCT
finefocus-591	51	18	.	.	PUNCT
finefocus-591	52	1	primers	primer	NOUN
finefocus-591	52	2	and	and	CCONJ
finefocus-591	52	3	thermal	thermal	ADJ
finefocus-591	52	4	cycler	cycler	NOUN
finefocus-591	52	5	settings	setting	NOUN
finefocus-591	52	6	used	use	VERB
finefocus-591	52	7	in	in	ADP
finefocus-591	52	8	this	this	DET
finefocus-591	52	9	study	study	NOUN
finefocus-591	52	10	primers	primer	NOUN
finefocus-591	52	11	amplicon	amplicon	NOUN
finefocus-591	52	12	length	length	NOUN
finefocus-591	52	13	pcr	pcr	PROPN
finefocus-591	52	14	conditions	condition	NOUN
finefocus-591	52	15	gene	gene	NOUN
finefocus-591	52	16	name	name	NOUN
finefocus-591	52	17	sequence	sequence	NOUN
finefocus-591	52	18	(	(	PUNCT
finefocus-591	52	19	5	5	NUM
finefocus-591	52	20	’	'	PUNCT
finefocus-591	52	21	→	→	SYM
finefocus-591	52	22	3	3	NUM
finefocus-591	52	23	’	'	PUNCT
finefocus-591	52	24	)	)	PUNCT
finefocus-591	52	25	specificity	specificity	NOUN
finefocus-591	52	26	denaturing	denature	VERB
finefocus-591	52	27	annealing	anneal	VERB
finefocus-591	52	28	extension	extension	NOUN
finefocus-591	52	29	cycles	cycle	NOUN
finefocus-591	52	30	12s	12s	X
finefocus-591	52	31	rrna	rrna	PROPN
finefocus-591	52	32	85f	85f	NOUN
finefocus-591	52	33	ttaagcttttcagaggaatttgctc	ttaagcttttcagaggaatttgctc	VERB
finefocus-591	52	34	140	140	NUM
finefocus-591	52	35	bp	bp	PROPN
finefocus-591	52	36	95	95	NUM
finefocus-591	52	37	°	°	SYM
finefocus-591	52	38	c	c	NOUN
finefocus-591	52	39	,	,	PUNCT
finefocus-591	52	40	30sec	30sec	NOUN
finefocus-591	52	41	45	45	NUM
finefocus-591	52	42	°	°	NOUN
finefocus-591	52	43	c	c	NOUN
finefocus-591	52	44	,	,	PUNCT
finefocus-591	52	45	30sec	30sec	NOUN
finefocus-591	52	46	72	72	NUM
finefocus-591	52	47	°	°	SYM
finefocus-591	52	48	c	c	NOUN
finefocus-591	52	49	,	,	PUNCT
finefocus-591	52	50	1min	1min	NUM
finefocus-591	52	51	40	40	NUM
finefocus-591	52	52	225r	225r	PROPN
finefocus-591	52	53	tttwwgctgcaccttgacttaa	tttwwgctgcaccttgacttaa	PROPN
finefocus-591	52	54	not	not	PART
finefocus-591	52	55	reported	report	VERB
finefocus-591	52	56	flab	flab	NOUN
finefocus-591	52	57	flals	flal	NOUN
finefocus-591	52	58	aacagctgaagagcttggaatg	aacagctgaagagcttggaatg	PROPN
finefocus-591	52	59	353	353	NUM
finefocus-591	52	60	bp	bp	PROPN
finefocus-591	52	61	95	95	NUM
finefocus-591	52	62	°	°	SYM
finefocus-591	52	63	c	c	X
finefocus-591	52	64	,	,	PUNCT
finefocus-591	52	65	1min	1min	NUM
finefocus-591	52	66	55	55	NUM
finefocus-591	52	67	°	°	NOUN
finefocus-591	52	68	c	c	NOUN
finefocus-591	52	69	,	,	PUNCT
finefocus-591	52	70	1min	1min	NUM
finefocus-591	52	71	72	72	NUM
finefocus-591	52	72	°	°	NOUN
finefocus-591	52	73	c	c	NOUN
finefocus-591	52	74	,	,	PUNCT
finefocus-591	52	75	1min	1min	NUM
finefocus-591	52	76	36	36	NUM
finefocus-591	52	77	flars	flar	NOUN
finefocus-591	52	78	ctttgatcacttatcattctaatagc	ctttgatcacttatcattctaatagc	NOUN
finefocus-591	52	79	borrelia	borrelia	PROPN
finefocus-591	52	80	genus	genus	NOUN
finefocus-591	52	81	bl	bl	NOUN
finefocus-591	52	82	-	-	PUNCT
finefocus-591	52	83	fla522f	fla522f	NOUN
finefocus-591	52	84	ggtacatattcagatgcagacagaggg	ggtacatattcagatgcagacagaggg	NOUN
finefocus-591	52	85	660	660	NUM
finefocus-591	52	86	bp	bp	PROPN
finefocus-591	52	87	95	95	NUM
finefocus-591	52	88	°	°	SYM
finefocus-591	52	89	c	c	X
finefocus-591	52	90	,	,	PUNCT
finefocus-591	52	91	1min	1min	NUM
finefocus-591	52	92	55	55	NUM
finefocus-591	52	93	°	°	NOUN
finefocus-591	52	94	c	c	NOUN
finefocus-591	52	95	,	,	PUNCT
finefocus-591	52	96	1min	1min	NUM
finefocus-591	52	97	72	72	NUM
finefocus-591	52	98	°	°	NOUN
finefocus-591	52	99	c	c	NOUN
finefocus-591	52	100	,	,	PUNCT
finefocus-591	52	101	1min	1min	NUM
finefocus-591	52	102	46	46	NUM
finefocus-591	52	103	bl	bl	NOUN
finefocus-591	52	104	-	-	PUNCT
finefocus-591	52	105	fla1182r	fla1182r	PROPN
finefocus-591	52	106	gcacttgatttgcttgtgcaatcatagcc	gcacttgatttgcttgtgcaatcatagcc	NOUN
finefocus-591	52	107	“	"	PUNCT
finefocus-591	52	108	candidatus	candidatus	PROPN
finefocus-591	52	109	b.	b.	PROPN
finefocus-591	52	110	lonestari	lonestari	PROPN
finefocus-591	52	111	”	"	PUNCT
finefocus-591	52	112	bl	bl	PROPN
finefocus-591	52	113	-	-	PUNCT
finefocus-591	52	114	fla662f	fla662f	X
finefocus-591	52	115	aactgctgaagagcttggaatgc	aactgctgaagagcttggaatgc	ADJ
finefocus-591	52	116	198	198	NUM
finefocus-591	52	117	bp	bp	PROPN
finefocus-591	52	118	95	95	NUM
finefocus-591	52	119	°	°	SYM
finefocus-591	52	120	c	c	X
finefocus-591	52	121	,	,	PUNCT
finefocus-591	52	122	1min	1min	NUM
finefocus-591	52	123	55	55	NUM
finefocus-591	52	124	°	°	NOUN
finefocus-591	52	125	c	c	NOUN
finefocus-591	52	126	,	,	PUNCT
finefocus-591	52	127	1min	1min	NUM
finefocus-591	52	128	72	72	NUM
finefocus-591	52	129	°	°	NOUN
finefocus-591	52	130	c	c	NOUN
finefocus-591	52	131	,	,	PUNCT
finefocus-591	52	132	1min	1min	NUM
finefocus-591	52	133	36	36	NUM
finefocus-591	52	134	dsb	dsb	NOUN
finefocus-591	52	135	bl	bl	PROPN
finefocus-591	52	136	-	-	PUNCT
finefocus-591	52	137	fla860r	fla860r	NOUN
finefocus-591	52	138	agctggttgaactccttcctgttgt	agctggttgaactccttcctgttgt	ADJ
finefocus-591	52	139	“	"	PUNCT
finefocus-591	52	140	candidatus	candidatus	PROPN
finefocus-591	52	141	b.	b.	PROPN
finefocus-591	52	142	lonestari	lonestari	PROPN
finefocus-591	52	143	”	"	PUNCT
finefocus-591	52	144	ehr	ehr	NOUN
finefocus-591	52	145	-	-	PUNCT
finefocus-591	52	146	dsb-330f	dsb-330f	NOUN
finefocus-591	52	147	gatgatgtctgaagatatgaaacaaat	gatgatgtctgaagatatgaaacaaat	VERB
finefocus-591	52	148	398	398	NUM
finefocus-591	52	149	bp	bp	PROPN
finefocus-591	52	150	95	95	NUM
finefocus-591	52	151	°	°	SYM
finefocus-591	52	152	c	c	X
finefocus-591	52	153	,	,	PUNCT
finefocus-591	52	154	1min	1min	NUM
finefocus-591	52	155	55	55	NUM
finefocus-591	52	156	°	°	NOUN
finefocus-591	52	157	c	c	NOUN
finefocus-591	52	158	,	,	PUNCT
finefocus-591	52	159	1min	1min	NUM
finefocus-591	52	160	72	72	NUM
finefocus-591	52	161	°	°	NOUN
finefocus-591	52	162	c	c	NOUN
finefocus-591	52	163	,	,	PUNCT
finefocus-591	52	164	1min	1min	NUM
finefocus-591	52	165	46	46	NUM
finefocus-591	52	166	16s	16	NOUN
finefocus-591	52	167	rrna	rrna	PROPN
finefocus-591	52	168	ehr	ehr	NOUN
finefocus-591	52	169	-	-	PUNCT
finefocus-591	52	170	dsb-728r	dsb-728r	NOUN
finefocus-591	52	171	ctgctcgtctattttacttcttaaagt	ctgctcgtctattttacttcttaaagt	NOUN
finefocus-591	52	172	ehrlichia	ehrlichia	VERB
finefocus-591	52	173	genus	genus	PROPN
finefocus-591	52	174	b16s	b16s	PROPN
finefocus-591	52	175	-	-	PUNCT
finefocus-591	52	176	fl	fl	PRON
finefocus-591	52	177	gactcgtcaagactgacgctaagtc	gactcgtcaagactgacgctaagtc	PROPN
finefocus-591	52	178	131	131	NUM
finefocus-591	52	179	bp	bp	PROPN
finefocus-591	52	180	95	95	NUM
finefocus-591	52	181	°	°	SYM
finefocus-591	52	182	c	c	NOUN
finefocus-591	52	183	,	,	PUNCT
finefocus-591	52	184	15sec	15sec	NOUN
finefocus-591	52	185	58	58	NUM
finefocus-591	52	186	°	°	NOUN
finefocus-591	52	187	c	c	NOUN
finefocus-591	52	188	,	,	PUNCT
finefocus-591	52	189	30sec	30sec	NOUN
finefocus-591	52	190	72	72	NUM
finefocus-591	52	191	°	°	PRON
finefocus-591	52	192	c,30sec	c,30sec	PROPN
finefocus-591	52	193	40	40	NUM
finefocus-591	52	194	b16s	b16	NOUN
finefocus-591	52	195	-	-	PUNCT
finefocus-591	52	196	r	r	NOUN
finefocus-591	52	197	gcacacttaacacgttagcttcggtactaa	gcacacttaacacgttagcttcggtactaa	NOUN
finefocus-591	52	198	borrelia	borrelia	NOUN
finefocus-591	52	199	genus	genus	NOUN
finefocus-591	52	200	bl-16s5f	bl-16s5f	ADP
finefocus-591	52	201	cagtgcgtcttaagcatgcaagtcagacgg	cagtgcgtcttaagcatgcaagtcagacgg	NOUN
finefocus-591	53	1	481	481	NUM
finefocus-591	53	2	bp	bp	PROPN
finefocus-591	53	3	95	95	NUM
finefocus-591	53	4	°	°	SYM
finefocus-591	53	5	c	c	X
finefocus-591	53	6	,	,	PUNCT
finefocus-591	53	7	1min	1min	NUM
finefocus-591	53	8	60	60	NUM
finefocus-591	53	9	°	°	NOUN
finefocus-591	53	10	c	c	NOUN
finefocus-591	53	11	,	,	PUNCT
finefocus-591	53	12	1min	1min	NUM
finefocus-591	53	13	72	72	NUM
finefocus-591	53	14	°	°	NOUN
finefocus-591	53	15	c	c	NOUN
finefocus-591	53	16	,	,	PUNCT
finefocus-591	53	17	1min	1min	NUM
finefocus-591	53	18	36	36	NUM
finefocus-591	53	19	bl-16s486r	bl-16s486r	PROPN
finefocus-591	53	20	ctgctggcacgtaattagccgggg	ctgctggcacgtaattagccgggg	NOUN
finefocus-591	53	21	“	"	PUNCT
finefocus-591	53	22	candidatus	candidatus	PROPN
finefocus-591	53	23	b.	b.	PROPN
finefocus-591	53	24	lonestari	lonestari	PROPN
finefocus-591	53	25	”	"	PUNCT
finefocus-591	53	26	b16s-23s	b16s-23s	PROPN
finefocus-591	53	27	-	-	PUNCT
finefocus-591	53	28	igsf	igsf	ADJ
finefocus-591	53	29	gtatgtttagtgaggggggtg	gtatgtttagtgaggggggtg	NOUN
finefocus-591	53	30	variable	variable	NOUN
finefocus-591	53	31	94	94	NUM
finefocus-591	53	32	°	°	SYM
finefocus-591	53	33	c	c	NOUN
finefocus-591	53	34	,	,	PUNCT
finefocus-591	53	35	30sec	30sec	NOUN
finefocus-591	53	36	56	56	NUM
finefocus-591	53	37	°	°	NOUN
finefocus-591	53	38	c	c	NOUN
finefocus-591	53	39	,	,	PUNCT
finefocus-591	53	40	30sec	30sec	NOUN
finefocus-591	53	41	74	74	NUM
finefocus-591	53	42	°	°	NOUN
finefocus-591	53	43	c	c	NOUN
finefocus-591	53	44	,	,	PUNCT
finefocus-591	53	45	1min	1min	NUM
finefocus-591	53	46	35	35	NUM
finefocus-591	53	47	b16s-23s	b16s-23s	NUM
finefocus-591	53	48	-	-	PUNCT
finefocus-591	53	49	igsr	igsr	NOUN
finefocus-591	53	50	ggatcatagctcaggtggttag	ggatcatagctcaggtggttag	NOUN
finefocus-591	53	51	borrelia	borrelia	NOUN
finefocus-591	53	52	genus	genus	NOUN
finefocus-591	53	53	b16s-23s	b16s-23s	NUM
finefocus-591	53	54	-	-	PUNCT
finefocus-591	53	55	igsfn	igsfn	NOUN
finefocus-591	53	56	aggggggtgaagtcgtaacaag	aggggggtgaagtcgtaacaag	NOUN
finefocus-591	53	57	variable	variable	ADJ
finefocus-591	53	58	94	94	NUM
finefocus-591	53	59	°	°	SYM
finefocus-591	53	60	c	c	NOUN
finefocus-591	53	61	,	,	PUNCT
finefocus-591	53	62	30sec	30sec	NOUN
finefocus-591	53	63	60	60	NUM
finefocus-591	53	64	°	°	NOUN
finefocus-591	53	65	c	c	NOUN
finefocus-591	53	66	,	,	PUNCT
finefocus-591	53	67	30sec	30sec	NOUN
finefocus-591	53	68	74	74	NUM
finefocus-591	53	69	°	°	NOUN
finefocus-591	53	70	c	c	NOUN
finefocus-591	53	71	,	,	PUNCT
finefocus-591	53	72	1min	1min	NUM
finefocus-591	53	73	40	40	NUM
finefocus-591	53	74	b16s-23s	b16s-23s	NUM
finefocus-591	53	75	-	-	PUNCT
finefocus-591	53	76	igsrn	igsrn	PROPN
finefocus-591	53	77	gtctgataaacctgaggtcgga	gtctgataaacctgaggtcgga	PROPN
finefocus-591	53	78	borrelia	borrelia	PROPN
finefocus-591	53	79	genus	genus	NOUN
finefocus-591	53	80	ecan	ecan	PROPN
finefocus-591	53	81	-	-	PUNCT
finefocus-591	53	82	f	f	PROPN
finefocus-591	53	83	atttatagcctctggctatagga	atttatagcctctggctatagga	PROPN
finefocus-591	53	84	383	383	NUM
finefocus-591	53	85	bp	bp	PROPN
finefocus-591	53	86	94	94	NUM
finefocus-591	53	87	°	°	SYM
finefocus-591	53	88	c	c	NOUN
finefocus-591	53	89	,	,	PUNCT
finefocus-591	53	90	30sec	30sec	NOUN
finefocus-591	53	91	52	52	NUM
finefocus-591	53	92	°	°	NOUN
finefocus-591	53	93	c	c	NOUN
finefocus-591	53	94	,	,	PUNCT
finefocus-591	53	95	30sec	30sec	NOUN
finefocus-591	53	96	72	72	NUM
finefocus-591	53	97	°	°	SYM
finefocus-591	53	98	c	c	NOUN
finefocus-591	53	99	,	,	PUNCT
finefocus-591	53	100	1min	1min	NUM
finefocus-591	53	101	36	36	NUM
finefocus-591	53	102	e.	e.	PROPN
finefocus-591	53	103	canis	canis	PROPN
finefocus-591	53	104	he1	he1	PROPN
finefocus-591	53	105	-	-	PUNCT
finefocus-591	53	106	f	f	PROPN
finefocus-591	53	107	caattgcttataaccttttggttataaat	caattgcttataaccttttggttataaat	PROPN
finefocus-591	53	108	383	383	NUM
finefocus-591	53	109	bp	bp	PROPN
finefocus-591	53	110	94	94	NUM
finefocus-591	53	111	°	°	SYM
finefocus-591	53	112	c	c	NOUN
finefocus-591	53	113	,	,	PUNCT
finefocus-591	53	114	30sec	30sec	NOUN
finefocus-591	53	115	52	52	NUM
finefocus-591	53	116	°	°	NOUN
finefocus-591	53	117	c	c	NOUN
finefocus-591	53	118	,	,	PUNCT
finefocus-591	53	119	30sec	30sec	NOUN
finefocus-591	53	120	72	72	NUM
finefocus-591	53	121	°	°	SYM
finefocus-591	53	122	c	c	NOUN
finefocus-591	53	123	,	,	PUNCT
finefocus-591	53	124	1min	1min	NUM
finefocus-591	53	125	36	36	NUM
finefocus-591	53	126	e.	e.	PROPN
finefocus-591	53	127	chaffeensis	chaffeensis	PROPN
finefocus-591	53	128	rompa	rompa	NOUN
finefocus-591	53	129	he3	he3	NOUN
finefocus-591	53	130	-	-	PUNCT
finefocus-591	53	131	r	r	NOUN
finefocus-591	53	132	tataggtaccgtcattatcttccctat	tataggtaccgtcattatcttccctat	NOUN
finefocus-591	53	133	ehrlichia	ehrlichia	VERB
finefocus-591	53	134	genus	genus	NOUN
finefocus-591	53	135	94	94	NUM
finefocus-591	53	136	°	°	SYM
finefocus-591	53	137	c	c	NOUN
finefocus-591	53	138	,	,	PUNCT
finefocus-591	53	139	30sec	30sec	NOUN
finefocus-591	53	140	52	52	NUM
finefocus-591	53	141	°	°	NOUN
finefocus-591	53	142	c	c	NOUN
finefocus-591	53	143	,	,	PUNCT
finefocus-591	53	144	30sec	30sec	NOUN
finefocus-591	53	145	72	72	NUM
finefocus-591	53	146	°	°	SYM
finefocus-591	53	147	c	c	NOUN
finefocus-591	53	148	,	,	PUNCT
finefocus-591	53	149	1min	1min	NUM
finefocus-591	53	150	36	36	NUM
finefocus-591	53	151	rr190	rr190	PROPN
finefocus-591	53	152	70p	70p	NOUN
finefocus-591	53	153	atggcgaatatttctccaaaa	atggcgaatatttctccaaaa	VERB
finefocus-591	53	154	532	532	NUM
finefocus-591	53	155	bp	bp	PROPN
finefocus-591	53	156	95	95	NUM
finefocus-591	53	157	°	°	SYM
finefocus-591	53	158	c	c	X
finefocus-591	53	159	,	,	PUNCT
finefocus-591	53	160	1min	1min	NUM
finefocus-591	53	161	55	55	NUM
finefocus-591	53	162	°	°	NOUN
finefocus-591	53	163	c	c	NOUN
finefocus-591	53	164	,	,	PUNCT
finefocus-591	53	165	1min	1min	NUM
finefocus-591	53	166	72	72	NUM
finefocus-591	53	167	°	°	NOUN
finefocus-591	53	168	c	c	NOUN
finefocus-591	53	169	,	,	PUNCT
finefocus-591	53	170	1min	1min	NUM
finefocus-591	53	171	46	46	NUM
finefocus-591	53	172	rr190	rr190	PROPN
finefocus-591	53	173	602n	602n	NOUN
finefocus-591	53	174	agtgcagcattcgctccccct	agtgcagcattcgctccccct	ADP
finefocus-591	53	175	rickettsia	rickettsia	NOUN
finefocus-591	53	176	genus	genus	NOUN
finefocus-591	53	177	the	the	DET
finefocus-591	53	178	pcr	pcr	NOUN
finefocus-591	53	179	mixture	mixture	NOUN
finefocus-591	53	180	was	be	AUX
finefocus-591	53	181	a	a	DET
finefocus-591	53	182	25	25	NUM
finefocus-591	53	183	µl	µl	ADP
finefocus-591	53	184	reaction	reaction	NOUN
finefocus-591	53	185	volume	volume	NOUN
finefocus-591	53	186	containing	contain	VERB
finefocus-591	53	187	0.25	0.25	NUM
finefocus-591	53	188	µl	µl	NOUN
finefocus-591	53	189	of	of	ADP
finefocus-591	53	190	gotaq	gotaq	PROPN
finefocus-591	53	191	polymerase	polymerase	NOUN
finefocus-591	53	192	(	(	PUNCT
finefocus-591	53	193	promega	promega	PROPN
finefocus-591	53	194	,	,	PUNCT
finefocus-591	53	195	madison	madison	PROPN
finefocus-591	53	196	,	,	PUNCT
finefocus-591	53	197	wi	wi	PROPN
finefocus-591	53	198	)	)	PUNCT
finefocus-591	53	199	,	,	PUNCT
finefocus-591	53	200	1x	1x	NUM
finefocus-591	53	201	gotaq	gotaq	PROPN
finefocus-591	53	202	buffer	buffer	NOUN
finefocus-591	53	203	,	,	PUNCT
finefocus-591	53	204	160	160	NUM
finefocus-591	53	205	ng/µl	ng/µl	NUM
finefocus-591	53	206	bovine	bovine	NOUN
finefocus-591	53	207	serum	serum	NOUN
finefocus-591	53	208	albumin	albumin	NOUN
finefocus-591	53	209	,	,	PUNCT
finefocus-591	53	210	1.0	1.0	NUM
finefocus-591	53	211	mm	mm	NOUN
finefocus-591	53	212	mgcl2	mgcl2	PROPN
finefocus-591	53	213	,	,	PUNCT
finefocus-591	53	214	200	200	NUM
finefocus-591	53	215	µm	µm	NOUN
finefocus-591	53	216	of	of	ADP
finefocus-591	53	217	each	each	DET
finefocus-591	53	218	dntp	dntp	NOUN
finefocus-591	53	219	,	,	PUNCT
finefocus-591	53	220	2	2	NUM
finefocus-591	53	221	pmol	pmol	NOUN
finefocus-591	53	222	primers	primer	NOUN
finefocus-591	53	223	,	,	PUNCT
finefocus-591	53	224	and	and	CCONJ
finefocus-591	53	225	5µl	5µl	NOUN
finefocus-591	53	226	of	of	ADP
finefocus-591	53	227	template	template	NOUN
finefocus-591	53	228	(	(	PUNCT
finefocus-591	53	229	1	1	NUM
finefocus-591	53	230	µl	µl	NOUN
finefocus-591	53	231	for	for	ADP
finefocus-591	53	232	nested	nested	ADJ
finefocus-591	53	233	reactions	reaction	NOUN
finefocus-591	53	234	)	)	PUNCT
finefocus-591	53	235	.	.	PUNCT
finefocus-591	54	1	amplifications	amplification	NOUN
finefocus-591	54	2	were	be	AUX
finefocus-591	54	3	performed	perform	VERB
finefocus-591	54	4	on	on	ADP
finefocus-591	54	5	a	a	DET
finefocus-591	54	6	bio	bio	ADJ
finefocus-591	54	7	-	-	ADJ
finefocus-591	54	8	rad	rad	PROPN
finefocus-591	54	9	mycycler	mycycler	PROPN
finefocus-591	54	10	thermal	thermal	ADJ
finefocus-591	54	11	cycler	cycler	PROPN
finefocus-591	54	12	(	(	PUNCT
finefocus-591	54	13	bio	bio	NOUN
finefocus-591	54	14	-	-	PROPN
finefocus-591	54	15	rad	rad	PROPN
finefocus-591	54	16	,	,	PUNCT
finefocus-591	54	17	carlsbad	carlsbad	PROPN
finefocus-591	54	18	,	,	PUNCT
finefocus-591	54	19	ca	ca	NOUN
finefocus-591	54	20	)	)	PUNCT
finefocus-591	54	21	(	(	PUNCT
finefocus-591	54	22	30	30	NUM
finefocus-591	54	23	)	)	PUNCT
finefocus-591	54	24	.	.	PUNCT
finefocus-591	55	1	different	different	ADJ
finefocus-591	55	2	thermal	thermal	ADJ
finefocus-591	55	3	cycler	cycler	NOUN
finefocus-591	55	4	settings	setting	NOUN
finefocus-591	55	5	,	,	PUNCT
finefocus-591	55	6	as	as	SCONJ
finefocus-591	55	7	indicated	indicate	VERB
finefocus-591	55	8	in	in	ADP
finefocus-591	55	9	table	table	NOUN
finefocus-591	55	10	1	1	NUM
finefocus-591	55	11	,	,	PUNCT
finefocus-591	55	12	were	be	AUX
finefocus-591	55	13	used	use	VERB
finefocus-591	55	14	for	for	ADP
finefocus-591	55	15	different	different	ADJ
finefocus-591	55	16	primers	primer	NOUN
finefocus-591	55	17	due	due	ADJ
finefocus-591	55	18	to	to	ADP
finefocus-591	55	19	different	different	ADJ
finefocus-591	55	20	optimal	optimal	ADJ
finefocus-591	55	21	annealing	anneal	VERB
finefocus-591	55	22	temperatures	temperature	NOUN
finefocus-591	55	23	.	.	PUNCT
finefocus-591	56	1	an	an	DET
finefocus-591	56	2	initial	initial	ADJ
finefocus-591	56	3	denaturation	denaturation	NOUN
finefocus-591	56	4	step	step	NOUN
finefocus-591	56	5	(	(	PUNCT
finefocus-591	56	6	95	95	NUM
finefocus-591	56	7	°	°	NUM
finefocus-591	56	8	c	c	NOUN
finefocus-591	56	9	)	)	PUNCT
finefocus-591	56	10	of	of	ADP
finefocus-591	56	11	5	5	NUM
finefocus-591	56	12	min	min	NOUN
finefocus-591	56	13	.	.	PROPN
finefocus-591	56	14	and	and	CCONJ
finefocus-591	56	15	a	a	DET
finefocus-591	56	16	final	final	ADJ
finefocus-591	56	17	extension	extension	NOUN
finefocus-591	56	18	step	step	NOUN
finefocus-591	56	19	(	(	PUNCT
finefocus-591	56	20	72	72	NUM
finefocus-591	56	21	°	°	SYM
finefocus-591	56	22	c	c	NOUN
finefocus-591	56	23	)	)	PUNCT
finefocus-591	56	24	of	of	ADP
finefocus-591	56	25	5	5	NUM
finefocus-591	56	26	min	min	NOUN
finefocus-591	56	27	.	.	PROPN
finefocus-591	56	28	were	be	AUX
finefocus-591	56	29	used	use	VERB
finefocus-591	56	30	.	.	PUNCT
finefocus-591	57	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	57	2	113	113	NUM
finefocus-591	57	3	9/25/15	9/25/15	NUM
finefocus-591	57	4	11:38	11:38	NUM
finefocus-591	57	5	am	be	AUX
finefocus-591	57	6	114	114	NUM
finefocus-591	57	7	•	•	NUM
finefocus-591	57	8	fine	fine	ADJ
finefocus-591	57	9	focus	focus	NOUN
finefocus-591	57	10	,	,	PUNCT
finefocus-591	57	11	vol	vol	NOUN
finefocus-591	57	12	.	.	NOUN
finefocus-591	57	13	1	1	NUM
finefocus-591	57	14	(	(	PUNCT
finefocus-591	57	15	2	2	NUM
finefocus-591	57	16	)	)	PUNCT
finefocus-591	57	17	nested	nest	VERB
finefocus-591	57	18	pcr	pcr	ADJ
finefocus-591	57	19	procedures	procedure	NOUN
finefocus-591	57	20	were	be	AUX
finefocus-591	57	21	performed	perform	VERB
finefocus-591	57	22	for	for	ADP
finefocus-591	57	23	borrelia	borrelia	NOUN
finefocus-591	57	24	and	and	CCONJ
finefocus-591	57	25	“	"	PUNCT
finefocus-591	57	26	candidatus	candidatus	PROPN
finefocus-591	57	27	b.	b.	PROPN
finefocus-591	57	28	lonestari	lonestari	PROPN
finefocus-591	57	29	”	"	PUNCT
finefocus-591	57	30	using	use	VERB
finefocus-591	57	31	1µl	1µl	NOUN
finefocus-591	57	32	from	from	ADP
finefocus-591	57	33	the	the	DET
finefocus-591	57	34	initial	initial	ADJ
finefocus-591	57	35	reaction	reaction	NOUN
finefocus-591	57	36	as	as	ADP
finefocus-591	57	37	a	a	DET
finefocus-591	57	38	template	template	NOUN
finefocus-591	57	39	.	.	PUNCT
finefocus-591	58	1	amplification	amplification	NOUN
finefocus-591	58	2	of	of	ADP
finefocus-591	58	3	target	target	NOUN
finefocus-591	58	4	sequences	sequence	NOUN
finefocus-591	58	5	was	be	AUX
finefocus-591	58	6	performed	perform	VERB
finefocus-591	58	7	in	in	ADP
finefocus-591	58	8	a	a	DET
finefocus-591	58	9	bio	bio	ADJ
finefocus-591	58	10	-	-	ADJ
finefocus-591	58	11	rad	rad	PROPN
finefocus-591	58	12	mycycler	mycycler	PROPN
finefocus-591	58	13	thermal	thermal	ADJ
finefocus-591	58	14	cycler	cycler	PROPN
finefocus-591	58	15	(	(	PUNCT
finefocus-591	58	16	bio	bio	NOUN
finefocus-591	58	17	-	-	PROPN
finefocus-591	58	18	rad	rad	PROPN
finefocus-591	58	19	,	,	PUNCT
finefocus-591	58	20	carlsbad	carlsbad	PROPN
finefocus-591	58	21	,	,	PUNCT
finefocus-591	58	22	ca	ca	NOUN
finefocus-591	58	23	)	)	PUNCT
finefocus-591	58	24	with	with	ADP
finefocus-591	58	25	several	several	ADJ
finefocus-591	58	26	denaturing	denaturing	NOUN
finefocus-591	58	27	,	,	PUNCT
finefocus-591	58	28	annealing	annealing	NOUN
finefocus-591	58	29	,	,	PUNCT
finefocus-591	58	30	and	and	CCONJ
finefocus-591	58	31	extension	extension	NOUN
finefocus-591	58	32	times	time	NOUN
finefocus-591	58	33	and	and	CCONJ
finefocus-591	58	34	temperatures	temperature	NOUN
finefocus-591	58	35	(	(	PUNCT
finefocus-591	58	36	table	table	NOUN
finefocus-591	58	37	1	1	NUM
finefocus-591	58	38	)	)	PUNCT
finefocus-591	58	39	.	.	PUNCT
finefocus-591	59	1	for	for	SCONJ
finefocus-591	59	2	each	each	DET
finefocus-591	59	3	pcr	pcr	PROPN
finefocus-591	59	4	assay	assay	VERB
finefocus-591	59	5	,	,	PUNCT
finefocus-591	59	6	5µl	5µl	NOUN
finefocus-591	59	7	of	of	ADP
finefocus-591	59	8	sterile	sterile	ADJ
finefocus-591	59	9	distilled	distil	VERB
finefocus-591	59	10	water	water	NOUN
finefocus-591	59	11	was	be	AUX
finefocus-591	59	12	used	use	VERB
finefocus-591	59	13	instead	instead	ADV
finefocus-591	59	14	of	of	ADP
finefocus-591	59	15	template	template	NOUN
finefocus-591	59	16	dna	dna	NOUN
finefocus-591	59	17	as	as	ADP
finefocus-591	59	18	a	a	DET
finefocus-591	59	19	negative	negative	ADJ
finefocus-591	59	20	control	control	NOUN
finefocus-591	59	21	.	.	PUNCT
finefocus-591	60	1	the	the	DET
finefocus-591	60	2	positive	positive	ADJ
finefocus-591	60	3	controls	control	NOUN
finefocus-591	60	4	,	,	PUNCT
finefocus-591	60	5	when	when	SCONJ
finefocus-591	60	6	used	use	VERB
finefocus-591	60	7	,	,	PUNCT
finefocus-591	60	8	were	be	AUX
finefocus-591	60	9	added	add	VERB
finefocus-591	60	10	using	use	VERB
finefocus-591	60	11	separate	separate	ADJ
finefocus-591	60	12	hoods	hood	NOUN
finefocus-591	60	13	and	and	CCONJ
finefocus-591	60	14	pipettors	pipettor	NOUN
finefocus-591	60	15	to	to	PART
finefocus-591	60	16	reduce	reduce	VERB
finefocus-591	60	17	the	the	DET
finefocus-591	60	18	risk	risk	NOUN
finefocus-591	60	19	of	of	ADP
finefocus-591	60	20	cross	cross	NOUN
finefocus-591	60	21	contamination	contamination	NOUN
finefocus-591	60	22	.	.	PUNCT
finefocus-591	61	1	visualization	visualization	NOUN
finefocus-591	61	2	and	and	CCONJ
finefocus-591	61	3	sequencing	sequencing	NOUN
finefocus-591	61	4	of	of	ADP
finefocus-591	61	5	pcr	pcr	ADJ
finefocus-591	61	6	products	product	NOUN
finefocus-591	61	7	five	five	NUM
finefocus-591	61	8	microliters	microliter	NOUN
finefocus-591	61	9	of	of	ADP
finefocus-591	61	10	each	each	DET
finefocus-591	61	11	pcr	pcr	ADJ
finefocus-591	61	12	reaction	reaction	NOUN
finefocus-591	61	13	was	be	AUX
finefocus-591	61	14	subjected	subject	VERB
finefocus-591	61	15	to	to	ADP
finefocus-591	61	16	gel	gel	NOUN
finefocus-591	61	17	electrophoresis	electrophoresis	NOUN
finefocus-591	61	18	,	,	PUNCT
finefocus-591	61	19	using	use	VERB
finefocus-591	61	20	2	2	NUM
finefocus-591	61	21	%	%	NOUN
finefocus-591	61	22	agarose	agarose	NOUN
finefocus-591	61	23	gels	gel	NOUN
finefocus-591	61	24	stained	stain	VERB
finefocus-591	61	25	with	with	ADP
finefocus-591	61	26	ethidium	ethidium	NOUN
finefocus-591	61	27	bromide	bromide	NOUN
finefocus-591	61	28	in	in	ADP
finefocus-591	61	29	0.5x	0.5x	NUM
finefocus-591	61	30	tbe	tbe	NOUN
finefocus-591	61	31	(	(	PUNCT
finefocus-591	61	32	45	45	NUM
finefocus-591	61	33	mm	mm	PROPN
finefocus-591	61	34	tris	tris	NOUN
finefocus-591	61	35	,	,	PUNCT
finefocus-591	61	36	45	45	NUM
finefocus-591	61	37	mm	mm	NOUN
finefocus-591	61	38	boric	boric	ADJ
finefocus-591	61	39	acid	acid	NOUN
finefocus-591	61	40	,	,	PUNCT
finefocus-591	61	41	1	1	NUM
finefocus-591	61	42	mm	mm	NOUN
finefocus-591	61	43	disodium	disodium	NOUN
finefocus-591	61	44	ethylene	ethylene	NOUN
finefocus-591	61	45	diamine	diamine	NOUN
finefocus-591	61	46	tetraacetic	tetraacetic	NOUN
finefocus-591	61	47	acid	acid	NOUN
finefocus-591	61	48	)	)	PUNCT
finefocus-591	61	49	with	with	ADP
finefocus-591	61	50	0.00005	0.00005	NUM
finefocus-591	61	51	%	%	NOUN
finefocus-591	61	52	ethidium	ethidium	NOUN
finefocus-591	61	53	bromide	bromide	NOUN
finefocus-591	61	54	.	.	PUNCT
finefocus-591	62	1	the	the	DET
finefocus-591	62	2	gels	gel	NOUN
finefocus-591	62	3	were	be	AUX
finefocus-591	62	4	run	run	VERB
finefocus-591	62	5	at	at	ADP
finefocus-591	62	6	100	100	NUM
finefocus-591	62	7	v	v	NOUN
finefocus-591	62	8	for	for	ADP
finefocus-591	62	9	40min	40min	PROPN
finefocus-591	62	10	..	..	PUNCT
finefocus-591	62	11	after	after	ADP
finefocus-591	62	12	electrophoresis	electrophoresis	NOUN
finefocus-591	62	13	,	,	PUNCT
finefocus-591	62	14	the	the	DET
finefocus-591	62	15	gels	gel	NOUN
finefocus-591	62	16	were	be	AUX
finefocus-591	62	17	examined	examine	VERB
finefocus-591	62	18	under	under	ADP
finefocus-591	62	19	uv	uv	NOUN
finefocus-591	62	20	light	light	NOUN
finefocus-591	62	21	.	.	PUNCT
finefocus-591	63	1	positive	positive	ADJ
finefocus-591	63	2	samples	sample	NOUN
finefocus-591	63	3	were	be	AUX
finefocus-591	63	4	purified	purify	VERB
finefocus-591	63	5	using	use	VERB
finefocus-591	63	6	spinprep	spinprep	PROPN
finefocus-591	63	7	pcr	pcr	PROPN
finefocus-591	63	8	clean	clean	PROPN
finefocus-591	63	9	-	-	PUNCT
finefocus-591	63	10	up	up	ADP
finefocus-591	63	11	kits	kit	NOUN
finefocus-591	63	12	(	(	PUNCT
finefocus-591	63	13	novagen	novagen	PROPN
finefocus-591	63	14	,	,	PUNCT
finefocus-591	63	15	la	la	PROPN
finefocus-591	63	16	jolla	jolla	PROPN
finefocus-591	63	17	ca	ca	PROPN
finefocus-591	63	18	,	,	PUNCT
finefocus-591	63	19	usa	usa	PROPN
finefocus-591	63	20	)	)	PUNCT
finefocus-591	63	21	following	follow	VERB
finefocus-591	63	22	the	the	DET
finefocus-591	63	23	manufacturer	manufacturer	NOUN
finefocus-591	63	24	’s	’s	PART
finefocus-591	63	25	protocols	protocol	NOUN
finefocus-591	63	26	.	.	PUNCT
finefocus-591	64	1	each	each	DET
finefocus-591	64	2	purified	purified	ADJ
finefocus-591	64	3	pcr	pcr	ADJ
finefocus-591	64	4	product	product	NOUN
finefocus-591	64	5	was	be	AUX
finefocus-591	64	6	sent	send	VERB
finefocus-591	64	7	for	for	ADP
finefocus-591	64	8	sanger	sanger	PROPN
finefocus-591	64	9	sequencing	sequence	VERB
finefocus-591	64	10	at	at	ADP
finefocus-591	64	11	eurofins	eurofins	PROPN
finefocus-591	64	12	(	(	PUNCT
finefocus-591	64	13	alabama	alabama	PROPN
finefocus-591	64	14	,	,	PUNCT
finefocus-591	64	15	usa	usa	PROPN
finefocus-591	64	16	)	)	PUNCT
finefocus-591	64	17	or	or	CCONJ
finefocus-591	64	18	mclab	mclab	ADJ
finefocus-591	64	19	(	(	PUNCT
finefocus-591	64	20	san	san	PROPN
finefocus-591	64	21	francisco	francisco	PROPN
finefocus-591	64	22	,	,	PUNCT
finefocus-591	64	23	ca	ca	NOUN
finefocus-591	64	24	)	)	PUNCT
finefocus-591	64	25	using	use	VERB
finefocus-591	64	26	the	the	DET
finefocus-591	64	27	primers	primer	NOUN
finefocus-591	64	28	used	use	VERB
finefocus-591	64	29	for	for	ADP
finefocus-591	64	30	pcr	pcr	PROPN
finefocus-591	64	31	.	.	PUNCT
finefocus-591	65	1	nucleotide	nucleotide	ADJ
finefocus-591	65	2	sequence	sequence	NOUN
finefocus-591	65	3	accession	accession	NOUN
finefocus-591	65	4	numbers	number	NOUN
finefocus-591	65	5	the	the	DET
finefocus-591	65	6	dna	dna	PROPN
finefocus-591	65	7	sequences	sequence	NOUN
finefocus-591	65	8	were	be	AUX
finefocus-591	65	9	visualized	visualize	VERB
finefocus-591	65	10	using	use	VERB
finefocus-591	65	11	finch	finch	PROPN
finefocus-591	65	12	tv	tv	PROPN
finefocus-591	65	13	,	,	PUNCT
finefocus-591	65	14	geospiza	geospiza	ADJ
finefocus-591	65	15	,	,	PUNCT
finefocus-591	65	16	inc	inc	PROPN
finefocus-591	65	17	software	software	PROPN
finefocus-591	65	18	version	version	NOUN
finefocus-591	65	19	1.5.0	1.5.0	NUM
finefocus-591	65	20	and	and	CCONJ
finefocus-591	65	21	compared	compare	VERB
finefocus-591	65	22	to	to	ADP
finefocus-591	65	23	reported	report	VERB
finefocus-591	65	24	sequences	sequence	NOUN
finefocus-591	65	25	in	in	ADP
finefocus-591	65	26	the	the	DET
finefocus-591	65	27	ncbi	ncbi	PROPN
finefocus-591	65	28	genbank	genbank	PROPN
finefocus-591	65	29	using	use	VERB
finefocus-591	65	30	blast	blast	NOUN
finefocus-591	65	31	.	.	PUNCT
finefocus-591	66	1	the	the	DET
finefocus-591	66	2	assigned	assign	VERB
finefocus-591	66	3	genbank	genbank	NOUN
finefocus-591	66	4	accession	accession	NOUN
finefocus-591	66	5	numbers	number	NOUN
finefocus-591	66	6	are	be	AUX
finefocus-591	66	7	:	:	PUNCT
finefocus-591	66	8	kr183798	kr183798	PROPN
finefocus-591	66	9	-	-	PUNCT
finefocus-591	66	10	kr183823	kr183823	PROPN
finefocus-591	66	11	.	.	PUNCT
finefocus-591	67	1	phylogenetic	phylogenetic	ADJ
finefocus-591	67	2	analysis	analysis	NOUN
finefocus-591	67	3	initial	initial	ADJ
finefocus-591	67	4	alignments	alignment	NOUN
finefocus-591	67	5	for	for	ADP
finefocus-591	67	6	borrelia	borrelia	NOUN
finefocus-591	67	7	and	and	CCONJ
finefocus-591	67	8	ehrlichia	ehrlichia	PRON
finefocus-591	67	9	genes	gene	NOUN
finefocus-591	67	10	were	be	AUX
finefocus-591	67	11	executed	execute	VERB
finefocus-591	67	12	using	use	VERB
finefocus-591	67	13	the	the	DET
finefocus-591	67	14	multiple	multiple	ADJ
finefocus-591	67	15	sequence	sequence	NOUN
finefocus-591	67	16	comparison	comparison	NOUN
finefocus-591	67	17	by	by	ADP
finefocus-591	67	18	log	log	NOUN
finefocus-591	67	19	-	-	PUNCT
finefocus-591	67	20	expectation	expectation	NOUN
finefocus-591	67	21	(	(	PUNCT
finefocus-591	67	22	muscle	muscle	NOUN
finefocus-591	67	23	)	)	PUNCT
finefocus-591	67	24	(	(	PUNCT
finefocus-591	67	25	16	16	NUM
finefocus-591	67	26	)	)	PUNCT
finefocus-591	67	27	as	as	SCONJ
finefocus-591	67	28	performed	perform	VERB
finefocus-591	67	29	by	by	ADP
finefocus-591	67	30	the	the	DET
finefocus-591	67	31	european	european	PROPN
finefocus-591	67	32	bioinformatics	bioinformatics	PROPN
finefocus-591	67	33	institute	institute	PROPN
finefocus-591	67	34	’s	’s	PART
finefocus-591	67	35	table	table	NOUN
finefocus-591	67	36	2	2	NUM
finefocus-591	67	37	.	.	PUNCT
finefocus-591	67	38	detection	detection	NOUN
finefocus-591	67	39	of	of	ADP
finefocus-591	67	40	bacterial	bacterial	ADJ
finefocus-591	67	41	dna	dna	NOUN
finefocus-591	67	42	in	in	ADP
finefocus-591	67	43	adult	adult	PROPN
finefocus-591	67	44	r.	r.	PROPN
finefocus-591	67	45	sanguineus	sanguineus	PROPN
finefocus-591	67	46	ticks	tick	NOUN
finefocus-591	67	47	by	by	ADP
finefocus-591	67	48	pcr	pcr	PROPN
finefocus-591	67	49	b.	b.	PROPN
finefocus-591	67	50	burgdorferilike	burgdorferilike	PROPN
finefocus-591	67	51	species	species	PROPN
finefocus-591	67	52	“	"	PUNCT
finefocus-591	67	53	candidatus	candidatus	PROPN
finefocus-591	67	54	b.	b.	PROPN
finefocus-591	67	55	lonestari	lonestari	PROPN
finefocus-591	67	56	”	"	PUNCT
finefocus-591	67	57	e.	e.	PROPN
finefocus-591	67	58	canis	canis	PROPN
finefocus-591	67	59	rickettsia	rickettsia	PROPN
finefocus-591	67	60	b.	b.	PROPN
finefocus-591	67	61	burgdorferilike	burgdorferilike	PROPN
finefocus-591	67	62	species	specie	NOUN
finefocus-591	67	63	+	+	ADJ
finefocus-591	67	64	“	"	PUNCT
finefocus-591	67	65	candidatus	candidatus	PROPN
finefocus-591	67	66	b.	b.	PROPN
finefocus-591	67	67	lonestari	lonestari	PROPN
finefocus-591	67	68	”	"	PUNCT
finefocus-591	67	69	e.	e.	PROPN
finefocus-591	67	70	canis	canis	PROPN
finefocus-591	67	71	+	+	CCONJ
finefocus-591	67	72	b.	b.	PROPN
finefocus-591	67	73	burgdorferilike	burgdorferilike	PROPN
finefocus-591	67	74	species	species	PROPN
finefocus-591	67	75	male	male	NOUN
finefocus-591	67	76	12.2	12.2	NUM
finefocus-591	67	77	%	%	NOUN
finefocus-591	67	78	(	(	PUNCT
finefocus-591	67	79	6/49	6/49	NUM
finefocus-591	67	80	)	)	PUNCT
finefocus-591	67	81	16.3	16.3	NUM
finefocus-591	67	82	%	%	NOUN
finefocus-591	67	83	(	(	PUNCT
finefocus-591	67	84	8/49	8/49	NUM
finefocus-591	67	85	)	)	PUNCT
finefocus-591	67	86	8.2	8.2	NUM
finefocus-591	67	87	%	%	NOUN
finefocus-591	67	88	(	(	PUNCT
finefocus-591	67	89	4/49	4/49	NUM
finefocus-591	67	90	)	)	PUNCT
finefocus-591	67	91	0	0	NUM
finefocus-591	67	92	%	%	NOUN
finefocus-591	67	93	(	(	PUNCT
finefocus-591	67	94	0/49	0/49	NUM
finefocus-591	67	95	)	)	PUNCT
finefocus-591	67	96	2.0%(1/49	2.0%(1/49	NUM
finefocus-591	67	97	)	)	PUNCT
finefocus-591	67	98	4.1	4.1	NUM
finefocus-591	67	99	%	%	NOUN
finefocus-591	67	100	(	(	PUNCT
finefocus-591	67	101	2/49	2/49	NUM
finefocus-591	67	102	)	)	PUNCT
finefocus-591	67	103	female	female	NOUN
finefocus-591	67	104	7.9	7.9	NUM
finefocus-591	67	105	%	%	NOUN
finefocus-591	67	106	(	(	PUNCT
finefocus-591	67	107	5/63	5/63	NUM
finefocus-591	67	108	)	)	PUNCT
finefocus-591	67	109	17.5%(11/63	17.5%(11/63	NOUN
finefocus-591	67	110	)	)	PUNCT
finefocus-591	67	111	15.9	15.9	NUM
finefocus-591	67	112	%	%	NOUN
finefocus-591	67	113	(	(	PUNCT
finefocus-591	67	114	10/63	10/63	NUM
finefocus-591	67	115	)	)	PUNCT
finefocus-591	67	116	0	0	NUM
finefocus-591	67	117	%	%	NOUN
finefocus-591	67	118	(	(	PUNCT
finefocus-591	67	119	0/63	0/63	NOUN
finefocus-591	67	120	)	)	PUNCT
finefocus-591	67	121	1.6%(1/63	1.6%(1/63	NUM
finefocus-591	67	122	)	)	PUNCT
finefocus-591	67	123	0	0	NUM
finefocus-591	67	124	%	%	NOUN
finefocus-591	67	125	(	(	PUNCT
finefocus-591	67	126	0/63	0/63	NUM
finefocus-591	67	127	)	)	PUNCT
finefocus-591	67	128	total	total	ADJ
finefocus-591	67	129	9.8	9.8	NUM
finefocus-591	67	130	%	%	NOUN
finefocus-591	67	131	(	(	PUNCT
finefocus-591	67	132	11/112	11/112	NUM
finefocus-591	67	133	)	)	PUNCT
finefocus-591	67	134	16.9	16.9	NUM
finefocus-591	67	135	%	%	NOUN
finefocus-591	67	136	(	(	PUNCT
finefocus-591	67	137	19/112	19/112	NUM
finefocus-591	67	138	)	)	PUNCT
finefocus-591	67	139	12.5	12.5	NUM
finefocus-591	67	140	%	%	NOUN
finefocus-591	67	141	(	(	PUNCT
finefocus-591	67	142	14/112	14/112	NUM
finefocus-591	67	143	)	)	PUNCT
finefocus-591	67	144	0	0	NUM
finefocus-591	67	145	%	%	NOUN
finefocus-591	67	146	(	(	PUNCT
finefocus-591	67	147	0/112	0/112	NUM
finefocus-591	67	148	)	)	PUNCT
finefocus-591	67	149	1.8	1.8	NUM
finefocus-591	67	150	%	%	NOUN
finefocus-591	67	151	(	(	PUNCT
finefocus-591	67	152	2/112	2/112	NUM
finefocus-591	67	153	)	)	PUNCT
finefocus-591	67	154	1.8	1.8	NUM
finefocus-591	67	155	%	%	NOUN
finefocus-591	67	156	(	(	PUNCT
finefocus-591	67	157	2/112	2/112	NUM
finefocus-591	67	158	)	)	PUNCT
finefocus-591	67	159	2005	2005	NUM
finefocus-591	68	1	9/85	9/85	NUM
finefocus-591	69	1	16/85	16/85	NUM
finefocus-591	69	2	11/85	11/85	NUM
finefocus-591	69	3	0/85	0/85	NUM
finefocus-591	69	4	2/85	2/85	NUM
finefocus-591	69	5	2/85	2/85	NUM
finefocus-591	69	6	2006	2006	NUM
finefocus-591	69	7	1/7	1/7	NUM
finefocus-591	69	8	1/7	1/7	NUM
finefocus-591	69	9	0/7	0/7	NUM
finefocus-591	69	10	0/7	0/7	NUM
finefocus-591	69	11	0/7	0/7	NUM
finefocus-591	69	12	0/7	0/7	NUM
finefocus-591	69	13	2009	2009	NUM
finefocus-591	69	14	1/11	1/11	NUM
finefocus-591	70	1	2/11	2/11	NUM
finefocus-591	70	2	1/11	1/11	NUM
finefocus-591	70	3	0/11	0/11	NUM
finefocus-591	70	4	0/11	0/11	NUM
finefocus-591	70	5	0/11	0/11	NUM
finefocus-591	70	6	2010	2010	NUM
finefocus-591	70	7	0/4	0/4	NUM
finefocus-591	71	1	0/4	0/4	NUM
finefocus-591	71	2	1/4	1/4	NUM
finefocus-591	71	3	0/4	0/4	NUM
finefocus-591	71	4	0/4	0/4	NUM
finefocus-591	71	5	0/4	0/4	NUM
finefocus-591	71	6	2011	2011	NUM
finefocus-591	71	7	0/5	0/5	NUM
finefocus-591	71	8	0/5	0/5	NUM
finefocus-591	71	9	1/5	1/5	NUM
finefocus-591	71	10	0/5	0/5	NUM
finefocus-591	71	11	0/5	0/5	NUM
finefocus-591	71	12	0/5	0/5	NUM
finefocus-591	71	13	total	total	NOUN
finefocus-591	71	14	11	11	NUM
finefocus-591	71	15	of	of	ADP
finefocus-591	71	16	112	112	NUM
finefocus-591	71	17	19	19	NUM
finefocus-591	71	18	of	of	ADP
finefocus-591	71	19	112	112	NUM
finefocus-591	71	20	14	14	NUM
finefocus-591	71	21	of	of	ADP
finefocus-591	71	22	112	112	NUM
finefocus-591	71	23	0	0	NUM
finefocus-591	71	24	of	of	ADP
finefocus-591	71	25	112	112	NUM
finefocus-591	71	26	2	2	NUM
finefocus-591	71	27	of	of	ADP
finefocus-591	71	28	112	112	NUM
finefocus-591	71	29	2	2	NUM
finefocus-591	71	30	of	of	ADP
finefocus-591	71	31	112	112	NUM
finefocus-591	71	32	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	71	33	114	114	NUM
finefocus-591	71	34	9/25/15	9/25/15	NUM
finefocus-591	71	35	11:38	11:38	NUM
finefocus-591	71	36	am	am	NOUN
finefocus-591	71	37	pathogens	pathogen	NOUN
finefocus-591	71	38	and	and	CCONJ
finefocus-591	71	39	antimicrobial	antimicrobial	ADJ
finefocus-591	71	40	factors	factor	NOUN
finefocus-591	71	41	•	•	ADP
finefocus-591	71	42	115	115	NUM
finefocus-591	71	43	b.	b.	PROPN
finefocus-591	71	44	turdi	turdi	PROPN
finefocus-591	71	45	d82851	d82851	PROPN
finefocus-591	71	46	b.	b.	PROPN
finefocus-591	71	47	garinii	garinii	PROPN
finefocus-591	71	48	kf422823	kf422823	PROPN
finefocus-591	71	49	borrelia	borrelia	PROPN
finefocus-591	71	50	sp	sp	PROPN
finefocus-591	71	51	.	.	PUNCT
finefocus-591	71	52	e49z02	e49z02	PROPN
finefocus-591	71	53	-	-	PROPN
finefocus-591	71	54	m1	m1	PROPN
finefocus-591	71	55	“	"	PUNCT
finefocus-591	71	56	candidatus	candidatus	PROPN
finefocus-591	71	57	b.	b.	PROPN
finefocus-591	71	58	lonestari	lonestari	PROPN
finefocus-591	71	59	”	"	PUNCT
finefocus-591	71	60	a25b	a25b	NOUN
finefocus-591	71	61	-	-	PUNCT
finefocus-591	71	62	m16	m16	NOUN
finefocus-591	71	63	“	"	PUNCT
finefocus-591	71	64	candidatus	candidatus	PROPN
finefocus-591	71	65	b.	b.	PROPN
finefocus-591	71	66	lonestari	lonestari	PROPN
finefocus-591	71	67	”	"	PUNCT
finefocus-591	71	68	ay442142	ay442142	PROPN
finefocus-591	71	69	b.	b.	PROPN
finefocus-591	71	70	burgdorferi	burgdorferi	PROPN
finefocus-591	71	71	kf422803	kf422803	PROPN
finefocus-591	71	72	“	"	PUNCT
finefocus-591	71	73	candidatus	candidatus	PROPN
finefocus-591	71	74	b.	b.	PROPN
finefocus-591	71	75	lonestari	lonestari	PROPN
finefocus-591	71	76	”	"	PUNCT
finefocus-591	71	77	ay166716	ay166716	NOUN
finefocus-591	71	78	borrelia	borrelia	NOUN
finefocus-591	71	79	sp	sp	NOUN
finefocus-591	71	80	.	.	PUNCT
finefocus-591	71	81	a46bb	a46bb	NOUN
finefocus-591	71	82	-	-	PUNCT
finefocus-591	71	83	f1	f1	NOUN
finefocus-591	71	84	borrelia	borrelia	NOUN
finefocus-591	71	85	sp	sp	NOUN
finefocus-591	71	86	.	.	PUNCT
finefocus-591	71	87	b17z10	b17z10	PROPN
finefocus-591	71	88	-	-	PUNCT
finefocus-591	71	89	f1	f1	NOUN
finefocus-591	71	90	b.	b.	PROPN
finefocus-591	71	91	tanukii	tanukii	PROPN
finefocus-591	71	92	d82848	d82848	PROPN
finefocus-591	71	93	“	"	PUNCT
finefocus-591	71	94	candidatus	candidatus	PROPN
finefocus-591	71	95	b.	b.	PROPN
finefocus-591	71	96	lonestari	lonestari	PROPN
finefocus-591	71	97	”	"	PUNCT
finefocus-591	71	98	a25b	a25b	ADJ
finefocus-591	71	99	-	-	PUNCT
finefocus-591	71	100	f5	f5	ADJ
finefocus-591	71	101	“	"	PUNCT
finefocus-591	71	102	candidatus	candidatus	PROPN
finefocus-591	71	103	b.	b.	PROPN
finefocus-591	71	104	lonestari	lonestari	PROPN
finefocus-591	71	105	”	"	PUNCT
finefocus-591	71	106	a32b	a32b	NOUN
finefocus-591	71	107	-	-	PUNCT
finefocus-591	71	108	f2	f2	VERB
finefocus-591	71	109	borrelia	borrelia	NOUN
finefocus-591	71	110	sp	sp	NOUN
finefocus-591	71	111	.	.	PUNCT
finefocus-591	71	112	a25b	a25b	PROPN
finefocus-591	71	113	-	-	PUNCT
finefocus-591	71	114	m2	m2	PROPN
finefocus-591	71	115	borrelia	borrelia	PROPN
finefocus-591	71	116	sp	sp	PROPN
finefocus-591	71	117	.	.	PROPN
finefocus-591	71	118	km458251	km458251	PROPN
finefocus-591	71	119	borrelia	borrelia	PROPN
finefocus-591	71	120	sp	sp	PROPN
finefocus-591	71	121	.	.	PUNCT
finefocus-591	71	122	a25b	a25b	PROPN
finefocus-591	71	123	-	-	PUNCT
finefocus-591	71	124	m18	m18	PROPN
finefocus-591	71	125	b.	b.	PROPN
finefocus-591	71	126	parkeri	parkeri	PROPN
finefocus-591	71	127	ay604980	ay604980	PROPN
finefocus-591	71	128	borrelia	borrelia	PROPN
finefocus-591	71	129	sp	sp	NOUN
finefocus-591	71	130	.	.	PUNCT
finefocus-591	71	131	a46bb	a46bb	NOUN
finefocus-591	71	132	-	-	PUNCT
finefocus-591	71	133	f3	f3	PROPN
finefocus-591	71	134	b.	b.	PROPN
finefocus-591	71	135	miyamotoi	miyamotoi	PROPN
finefocus-591	71	136	jq926187	jq926187	PROPN
finefocus-591	71	137	“	"	PUNCT
finefocus-591	71	138	candidatus	candidatus	PROPN
finefocus-591	71	139	b.	b.	PROPN
finefocus-591	71	140	lonestari	lonestari	PROPN
finefocus-591	71	141	”	"	PUNCT
finefocus-591	71	142	ay237721	ay237721	PROPN
finefocus-591	71	143	“	"	PUNCT
finefocus-591	71	144	candidatus	candidatus	PROPN
finefocus-591	71	145	b.	b.	PROPN
finefocus-591	71	146	lonestari	lonestari	PROPN
finefocus-591	71	147	”	"	PUNCT
finefocus-591	71	148	a25b	a25b	ADJ
finefocus-591	71	149	-	-	PUNCT
finefocus-591	71	150	m11	m11	PROPN
finefocus-591	71	151	b.	b.	PROPN
finefocus-591	71	152	microti	microti	PROPN
finefocus-591	71	153	jf825472	jf825472	ADJ
finefocus-591	71	154	“	"	PUNCT
finefocus-591	71	155	candidatus	candidatus	PROPN
finefocus-591	71	156	b.	b.	PROPN
finefocus-591	71	157	lonestari	lonestari	PROPN
finefocus-591	71	158	”	"	PUNCT
finefocus-591	71	159	a32c	a32c	NOUN
finefocus-591	71	160	-	-	PUNCT
finefocus-591	71	161	f5	f5	PROPN
finefocus-591	71	162	b.	b.	NOUN
finefocus-591	71	163	burgdorferi	burgdorferi	PROPN
finefocus-591	71	164	cp009656	cp009656	PROPN
finefocus-591	71	165	b.	b.	PROPN
finefocus-591	71	166	hermsii	hermsii	PROPN
finefocus-591	71	167	dq855534	dq855534	PROPN
finefocus-591	71	168	b.	b.	PROPN
finefocus-591	71	169	lusitaniae	lusitaniae	PROPN
finefocus-591	71	170	kf836507	kf836507	PROPN
finefocus-591	71	171	b.	b.	PROPN
finefocus-591	71	172	andersonii	andersonii	PROPN
finefocus-591	71	173	d83764	d83764	PROPN
finefocus-591	71	174	“	"	PUNCT
finefocus-591	71	175	candidatus	candidatus	PROPN
finefocus-591	71	176	b.	b.	PROPN
finefocus-591	71	177	lonestari	lonestari	PROPN
finefocus-591	71	178	”	"	PUNCT
finefocus-591	71	179	ay237722	ay237722	PROPN
finefocus-591	71	180	“	"	PUNCT
finefocus-591	71	181	candidatus	candidatus	PROPN
finefocus-591	71	182	b.	b.	PROPN
finefocus-591	71	183	lonestari	lonestari	PROPN
finefocus-591	71	184	”	"	PUNCT
finefocus-591	71	185	b17z09	b17z09	PROPN
finefocus-591	71	186	-	-	PUNCT
finefocus-591	71	187	f2	f2	PROPN
finefocus-591	71	188	b.	b.	PROPN
finefocus-591	72	1	valaisiana	valaisiana	PROPN
finefocus-591	72	2	jf732880	jf732880	ADJ
finefocus-591	72	3	“	"	PUNCT
finefocus-591	72	4	candidatus	candidatus	PROPN
finefocus-591	72	5	b.	b.	PROPN
finefocus-591	72	6	lonestari	lonestari	PROPN
finefocus-591	72	7	”	"	PUNCT
finefocus-591	72	8	ay850063	ay850063	PROPN
finefocus-591	72	9	borrelia	borrelia	NOUN
finefocus-591	72	10	genomosp	genomosp	NOUN
finefocus-591	72	11	.	.	PUNCT
finefocus-591	73	1	1	1	NUM
finefocus-591	73	2	kf918619	kf918619	PROPN
finefocus-591	73	3	b.	b.	PROPN
finefocus-591	73	4	duttonii	duttonii	PROPN
finefocus-591	73	5	ab113314	ab113314	PROPN
finefocus-591	73	6	“	"	PUNCT
finefocus-591	73	7	candidatus	candidatus	PROPN
finefocus-591	73	8	b.	b.	PROPN
finefocus-591	73	9	californiensis	californiensis	PROPN
finefocus-591	73	10	”	"	PUNCT
finefocus-591	73	11	kf422809	kf422809	PROPN
finefocus-591	73	12	“	"	PUNCT
finefocus-591	73	13	candidatus	candidatus	PROPN
finefocus-591	73	14	b.	b.	PROPN
finefocus-591	73	15	lonestari	lonestari	PROPN
finefocus-591	73	16	”	"	PUNCT
finefocus-591	73	17	a25b	a25b	PROPN
finefocus-591	73	18	-	-	PUNCT
finefocus-591	73	19	m17	m17	PROPN
finefocus-591	73	20	b.	b.	PROPN
finefocus-591	73	21	crocidurae	crocidurae	PROPN
finefocus-591	73	22	jx292925	jx292925	PROPN
finefocus-591	73	23	borrelia	borrelia	PROPN
finefocus-591	73	24	sp	sp	NOUN
finefocus-591	73	25	.	.	PUNCT
finefocus-591	73	26	km458263	km458263	PROPN
finefocus-591	73	27	“	"	PUNCT
finefocus-591	73	28	candidatus	candidatus	PROPN
finefocus-591	73	29	b.	b.	PROPN
finefocus-591	73	30	lonestari	lonestari	PROPN
finefocus-591	73	31	”	"	PUNCT
finefocus-591	73	32	a35a	a35a	NOUN
finefocus-591	73	33	-	-	PUNCT
finefocus-591	73	34	m3	m3	PROPN
finefocus-591	73	35	b.	b.	PROPN
finefocus-591	73	36	americana	americana	PROPN
finefocus-591	73	37	eu081293	eu081293	PROPN
finefocus-591	73	38	b.	b.	PROPN
finefocus-591	73	39	spielmanii	spielmanii	PROPN
finefocus-591	73	40	hm802196	hm802196	PROPN
finefocus-591	73	41	b.	b.	PROPN
finefocus-591	73	42	microti	microti	PROPN
finefocus-591	73	43	jf708951	jf708951	PROPN
finefocus-591	73	44	b.	b.	PROPN
finefocus-591	73	45	burgdorferi	burgdorferi	ADJ
finefocus-591	73	46	eu220791	eu220791	NOUN
finefocus-591	73	47	“	"	PUNCT
finefocus-591	73	48	candidatus	candidatus	PROPN
finefocus-591	73	49	b.	b.	PROPN
finefocus-591	73	50	californiensis	californiensis	PROPN
finefocus-591	73	51	”	"	PUNCT
finefocus-591	73	52	eu076499	eu076499	PROPN
finefocus-591	73	53	b.	b.	PROPN
finefocus-591	73	54	turicatae	turicatae	PROPN
finefocus-591	73	55	ay604979	ay604979	PROPN
finefocus-591	73	56	“	"	PUNCT
finefocus-591	73	57	candidatus	candidatus	PROPN
finefocus-591	73	58	b.	b.	PROPN
finefocus-591	73	59	lonestari	lonestari	PROPN
finefocus-591	73	60	”	"	PUNCT
finefocus-591	73	61	a46bb	a46bb	ADJ
finefocus-591	73	62	-	-	PUNCT
finefocus-591	73	63	f4	f4	PROPN
finefocus-591	73	64	b.	b.	PROPN
finefocus-591	73	65	sinica	sinica	PROPN
finefocus-591	73	66	ab022137	ab022137	PROPN
finefocus-591	73	67	borrelia	borrelia	PROPN
finefocus-591	73	68	sp	sp	NOUN
finefocus-591	73	69	.	.	PUNCT
finefocus-591	73	70	km458264	km458264	PROPN
finefocus-591	73	71	b.	b.	PROPN
finefocus-591	73	72	burgdorferi	burgdorferi	PROPN
finefocus-591	73	73	hm345910	hm345910	PROPN
finefocus-591	73	74	“	"	PUNCT
finefocus-591	73	75	candidatus	candidatus	PROPN
finefocus-591	73	76	b.	b.	PROPN
finefocus-591	73	77	lonestari	lonestari	PROPN
finefocus-591	73	78	”	"	PUNCT
finefocus-591	73	79	ay237706	ay237706	PROPN
finefocus-591	73	80	b.	b.	PROPN
finefocus-591	73	81	recurrentis	recurrentis	PROPN
finefocus-591	74	1	dq346831	dq346831	PROPN
finefocus-591	74	2	b.	b.	PROPN
finefocus-591	75	1	japonica	japonica	PROPN
finefocus-591	75	2	d82852	d82852	PROPN
finefocus-591	75	3	b.	b.	PROPN
finefocus-591	75	4	americana	americana	PROPN
finefocus-591	75	5	hm802231	hm802231	PROPN
finefocus-591	75	6	borrelia	borrelia	PROPN
finefocus-591	75	7	genomosp	genomosp	NOUN
finefocus-591	75	8	.	.	PUNCT
finefocus-591	76	1	2	2	NUM
finefocus-591	76	2	kf422812	kf422812	PROPN
finefocus-591	76	3	b.	b.	PROPN
finefocus-591	76	4	anserina	anserina	PROPN
finefocus-591	76	5	dq849626	dq849626	PROPN
finefocus-591	76	6	b.	b.	PROPN
finefocus-591	77	1	hispanica	hispanica	PROPN
finefocus-591	77	2	gu357616	gu357616	PROPN
finefocus-591	77	3	borrelia	borrelia	PROPN
finefocus-591	77	4	sp	sp	PROPN
finefocus-591	77	5	.	.	PUNCT
finefocus-591	77	6	a25b	a25b	PROPN
finefocus-591	77	7	-	-	PUNCT
finefocus-591	77	8	m1	m1	PROPN
finefocus-591	77	9	b.	b.	PROPN
finefocus-591	77	10	afzelii	afzelii	PROPN
finefocus-591	77	11	kf422796	kf422796	PROPN
finefocus-591	77	12	borrelia	borrelia	PROPN
finefocus-591	77	13	sp	sp	PROPN
finefocus-591	77	14	.	.	PUNCT
finefocus-591	77	15	a25b	a25b	PROPN
finefocus-591	77	16	-	-	PUNCT
finefocus-591	77	17	m19	m19	PROPN
finefocus-591	77	18	50	50	NUM
finefocus-591	77	19	100	100	NUM
finefocus-591	77	20	99	99	NUM
finefocus-591	77	21	88	88	NUM
finefocus-591	77	22	97	97	NUM
finefocus-591	77	23	100	100	NUM
finefocus-591	77	24	97	97	NUM
finefocus-591	77	25	62	62	NUM
finefocus-591	77	26	82	82	NUM
finefocus-591	77	27	90	90	NUM
finefocus-591	77	28	100	100	NUM
finefocus-591	77	29	100	100	NUM
finefocus-591	77	30	88	88	NUM
finefocus-591	77	31	100	100	NUM
finefocus-591	77	32	100	100	NUM
finefocus-591	77	33	100	100	NUM
finefocus-591	77	34	99	99	NUM
finefocus-591	77	35	92	92	NUM
finefocus-591	77	36	85	85	NUM
finefocus-591	77	37	79	79	NUM
finefocus-591	77	38	100	100	NUM
finefocus-591	77	39	51	51	NUM
finefocus-591	77	40	fig	fig	NOUN
finefocus-591	77	41	.	.	PUNCT
finefocus-591	78	1	1	1	X
finefocus-591	78	2	.	.	X
finefocus-591	78	3	baysian	baysian	ADJ
finefocus-591	78	4	inference	inference	NOUN
finefocus-591	78	5	consensus	consensus	NOUN
finefocus-591	78	6	tree	tree	NOUN
finefocus-591	78	7	inferred	infer	VERB
finefocus-591	78	8	from	from	ADP
finefocus-591	78	9	flab	flab	NOUN
finefocus-591	78	10	of	of	ADP
finefocus-591	78	11	borrelia	borrelia	NOUN
finefocus-591	78	12	species	specie	NOUN
finefocus-591	78	13	.	.	PUNCT
finefocus-591	79	1	node	node	ADJ
finefocus-591	79	2	support	support	NOUN
finefocus-591	79	3	is	be	AUX
finefocus-591	79	4	indicated	indicate	VERB
finefocus-591	79	5	by	by	ADP
finefocus-591	79	6	the	the	DET
finefocus-591	79	7	posterior	posterior	ADJ
finefocus-591	79	8	probabilities	probability	NOUN
finefocus-591	79	9	at	at	ADP
finefocus-591	79	10	the	the	DET
finefocus-591	79	11	node	node	NOUN
finefocus-591	79	12	.	.	PUNCT
finefocus-591	80	1	the	the	DET
finefocus-591	80	2	name	name	NOUN
finefocus-591	80	3	of	of	ADP
finefocus-591	80	4	the	the	DET
finefocus-591	80	5	species	specie	NOUN
finefocus-591	80	6	is	be	AUX
finefocus-591	80	7	followed	follow	VERB
finefocus-591	80	8	by	by	ADP
finefocus-591	80	9	the	the	DET
finefocus-591	80	10	genbank	genbank	PROPN
finefocus-591	80	11	accession	accession	NOUN
finefocus-591	80	12	number	number	NOUN
finefocus-591	80	13	.	.	PUNCT
finefocus-591	81	1	a25b	a25b	NOUN
finefocus-591	81	2	-	-	PUNCT
finefocus-591	81	3	f5	f5	NOUN
finefocus-591	81	4	,	,	PUNCT
finefocus-591	81	5	a25b	a25b	NOUN
finefocus-591	81	6	-	-	PUNCT
finefocus-591	81	7	m1	m1	NOUN
finefocus-591	81	8	,	,	PUNCT
finefocus-591	81	9	a25b	a25b	PROPN
finefocus-591	81	10	-	-	PUNCT
finefocus-591	81	11	m2	m2	PROPN
finefocus-591	81	12	,	,	PUNCT
finefocus-591	81	13	a25b	a25b	NOUN
finefocus-591	81	14	-	-	PUNCT
finefocus-591	81	15	m11	m11	NOUN
finefocus-591	81	16	,	,	PUNCT
finefocus-591	81	17	a25b	a25b	NOUN
finefocus-591	81	18	-	-	PUNCT
finefocus-591	81	19	m16	m16	NOUN
finefocus-591	81	20	,	,	PUNCT
finefocus-591	81	21	a25b	a25b	PROPN
finefocus-591	81	22	-	-	PUNCT
finefocus-591	81	23	m17	m17	NOUN
finefocus-591	81	24	,	,	PUNCT
finefocus-591	81	25	a25b	a25b	PROPN
finefocus-591	81	26	-	-	PUNCT
finefocus-591	81	27	m18	m18	PROPN
finefocus-591	81	28	,	,	PUNCT
finefocus-591	81	29	a25b	a25b	NOUN
finefocus-591	81	30	-	-	PUNCT
finefocus-591	81	31	m19	m19	NOUN
finefocus-591	81	32	,	,	PUNCT
finefocus-591	81	33	a32b	a32b	NOUN
finefocus-591	81	34	-	-	PUNCT
finefocus-591	81	35	f2	f2	ADJ
finefocus-591	81	36	,	,	PUNCT
finefocus-591	81	37	a32c	a32c	NOUN
finefocus-591	81	38	-	-	NOUN
finefocus-591	81	39	f5	f5	NOUN
finefocus-591	81	40	,	,	PUNCT
finefocus-591	81	41	a35a	a35a	NOUN
finefocus-591	81	42	-	-	PUNCT
finefocus-591	81	43	m3	m3	NOUN
finefocus-591	81	44	,	,	PUNCT
finefocus-591	81	45	a46bb	a46bb	NOUN
finefocus-591	81	46	-	-	PUNCT
finefocus-591	81	47	f1	f1	NOUN
finefocus-591	81	48	,	,	PUNCT
finefocus-591	81	49	a46bb	a46bb	NOUN
finefocus-591	81	50	-	-	PUNCT
finefocus-591	81	51	f3	f3	ADJ
finefocus-591	81	52	,	,	PUNCT
finefocus-591	81	53	a46bb	a46bb	NOUN
finefocus-591	81	54	-	-	PUNCT
finefocus-591	81	55	f4	f4	NOUN
finefocus-591	81	56	,	,	PUNCT
finefocus-591	81	57	b17z09	b17z09	PROPN
finefocus-591	81	58	-	-	PUNCT
finefocus-591	81	59	f2	f2	ADV
finefocus-591	81	60	,	,	PUNCT
finefocus-591	81	61	b17z10	b17z10	NOUN
finefocus-591	81	62	-	-	PUNCT
finefocus-591	81	63	f1	f1	NOUN
finefocus-591	81	64	and	and	CCONJ
finefocus-591	81	65	e49z02	e49z02	PROPN
finefocus-591	81	66	-	-	PROPN
finefocus-591	81	67	m1	m1	PROPN
finefocus-591	81	68	represent	represent	VERB
finefocus-591	81	69	amplicons	amplicon	NOUN
finefocus-591	81	70	from	from	ADP
finefocus-591	81	71	r.	r.	PROPN
finefocus-591	81	72	sanguineus	sanguineus	PROPN
finefocus-591	81	73	and	and	CCONJ
finefocus-591	81	74	are	be	AUX
finefocus-591	81	75	underlined	underline	VERB
finefocus-591	81	76	.	.	PUNCT
finefocus-591	82	1	the	the	DET
finefocus-591	82	2	scale	scale	NOUN
finefocus-591	82	3	bar	bar	NOUN
finefocus-591	82	4	indicates	indicate	VERB
finefocus-591	82	5	the	the	DET
finefocus-591	82	6	mean	mean	ADJ
finefocus-591	82	7	number	number	NOUN
finefocus-591	82	8	of	of	ADP
finefocus-591	82	9	nucleotide	nucleotide	ADJ
finefocus-591	82	10	substitutions	substitution	NOUN
finefocus-591	82	11	per	per	ADP
finefocus-591	82	12	site	site	NOUN
finefocus-591	82	13	.	.	PUNCT
finefocus-591	83	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	83	2	115	115	NUM
finefocus-591	83	3	9/25/15	9/25/15	NUM
finefocus-591	83	4	11:38	11:38	NUM
finefocus-591	83	5	am	be	AUX
finefocus-591	83	6	116	116	NUM
finefocus-591	83	7	•	•	NUM
finefocus-591	83	8	fine	fine	ADJ
finefocus-591	83	9	focus	focus	NOUN
finefocus-591	83	10	,	,	PUNCT
finefocus-591	83	11	vol	vol	NOUN
finefocus-591	83	12	.	.	NOUN
finefocus-591	83	13	1	1	NUM
finefocus-591	83	14	(	(	PUNCT
finefocus-591	83	15	2	2	NUM
finefocus-591	83	16	)	)	PUNCT
finefocus-591	83	17	muscle	muscle	NOUN
finefocus-591	83	18	server	server	NOUN
finefocus-591	83	19	(	(	PUNCT
finefocus-591	83	20	http://www.ebi.ac.uk/	http://www.ebi.ac.uk/	PROPN
finefocus-591	83	21	tools	tool	NOUN
finefocus-591	83	22	/	/	SYM
finefocus-591	83	23	muscle/	muscle/	NUM
finefocus-591	83	24	)	)	PUNCT
finefocus-591	83	25	.	.	PUNCT
finefocus-591	84	1	default	default	NOUN
finefocus-591	84	2	settings	setting	NOUN
finefocus-591	84	3	were	be	AUX
finefocus-591	84	4	used	use	VERB
finefocus-591	84	5	,	,	PUNCT
finefocus-591	84	6	with	with	ADP
finefocus-591	84	7	posterior	posterior	ADJ
finefocus-591	84	8	manual	manual	ADJ
finefocus-591	84	9	adjustments	adjustment	NOUN
finefocus-591	84	10	if	if	SCONJ
finefocus-591	84	11	needed	need	VERB
finefocus-591	84	12	.	.	PUNCT
finefocus-591	85	1	bayesian	bayesian	NOUN
finefocus-591	85	2	inference	inference	NOUN
finefocus-591	85	3	phylogenetic	phylogenetic	ADJ
finefocus-591	85	4	analyses	analysis	NOUN
finefocus-591	85	5	were	be	AUX
finefocus-591	85	6	performed	perform	VERB
finefocus-591	85	7	using	use	VERB
finefocus-591	85	8	mrbayes	mrbaye	NOUN
finefocus-591	85	9	v.3.2.5	v.3.2.5	NOUN
finefocus-591	85	10	(	(	PUNCT
finefocus-591	85	11	36	36	NUM
finefocus-591	85	12	)	)	PUNCT
finefocus-591	85	13	using	use	VERB
finefocus-591	85	14	two	two	NUM
finefocus-591	85	15	runs	run	NOUN
finefocus-591	85	16	,	,	PUNCT
finefocus-591	85	17	for	for	ADP
finefocus-591	85	18	10,000,000	10,000,000	NUM
finefocus-591	85	19	generations	generation	NOUN
finefocus-591	85	20	each	each	PRON
finefocus-591	85	21	,	,	PUNCT
finefocus-591	85	22	using	use	VERB
finefocus-591	85	23	eight	eight	NUM
finefocus-591	85	24	chains	chain	NOUN
finefocus-591	85	25	and	and	CCONJ
finefocus-591	85	26	a	a	DET
finefocus-591	85	27	temperature	temperature	NOUN
finefocus-591	85	28	coefficient	coefficient	NOUN
finefocus-591	85	29	of	of	ADP
finefocus-591	85	30	0.1	0.1	NUM
finefocus-591	85	31	,	,	PUNCT
finefocus-591	85	32	and	and	CCONJ
finefocus-591	85	33	trees	tree	NOUN
finefocus-591	85	34	sampled	sample	VERB
finefocus-591	85	35	every	every	DET
finefocus-591	85	36	5,000	5,000	NUM
finefocus-591	85	37	generations	generation	NOUN
finefocus-591	85	38	.	.	PUNCT
finefocus-591	86	1	determination	determination	NOUN
finefocus-591	86	2	of	of	ADP
finefocus-591	86	3	the	the	DET
finefocus-591	86	4	appropriate	appropriate	ADJ
finefocus-591	86	5	model	model	NOUN
finefocus-591	86	6	for	for	ADP
finefocus-591	86	7	each	each	DET
finefocus-591	86	8	genus	genus	NOUN
finefocus-591	86	9	was	be	AUX
finefocus-591	86	10	completed	complete	VERB
finefocus-591	86	11	via	via	ADP
finefocus-591	86	12	jmodeltest	jmodeltest	ADJ
finefocus-591	86	13	2	2	NUM
finefocus-591	86	14	(	(	PUNCT
finefocus-591	86	15	15	15	NUM
finefocus-591	86	16	):	):	PUNCT
finefocus-591	86	17	gtr	gtr	NOUN
finefocus-591	86	18	+	+	CCONJ
finefocus-591	86	19	i	i	PRON
finefocus-591	86	20	+	+	CCONJ
finefocus-591	86	21	ґ	ґ	NOUN
finefocus-591	86	22	for	for	ADP
finefocus-591	86	23	borrelia	borrelia	NOUN
finefocus-591	86	24	and	and	CCONJ
finefocus-591	86	25	ehrlichia	ehrlichia	PRON
finefocus-591	86	26	.	.	PUNCT
finefocus-591	87	1	the	the	DET
finefocus-591	87	2	gamma	gamma	NOUN
finefocus-591	87	3	distribution	distribution	NOUN
finefocus-591	87	4	included	include	VERB
finefocus-591	87	5	six	six	NUM
finefocus-591	87	6	categories	category	NOUN
finefocus-591	87	7	for	for	ADP
finefocus-591	87	8	all	all	DET
finefocus-591	87	9	models	model	NOUN
finefocus-591	87	10	obtained	obtain	VERB
finefocus-591	87	11	.	.	PUNCT
finefocus-591	88	1	after	after	SCONJ
finefocus-591	88	2	analysis	analysis	NOUN
finefocus-591	88	3	was	be	AUX
finefocus-591	88	4	completed	complete	VERB
finefocus-591	88	5	,	,	PUNCT
finefocus-591	88	6	the	the	DET
finefocus-591	88	7	first	first	ADJ
finefocus-591	88	8	25	25	NUM
finefocus-591	88	9	%	%	NOUN
finefocus-591	88	10	of	of	ADP
finefocus-591	88	11	trees	tree	NOUN
finefocus-591	88	12	from	from	ADP
finefocus-591	88	13	each	each	DET
finefocus-591	88	14	run	run	NOUN
finefocus-591	88	15	were	be	AUX
finefocus-591	88	16	discarded	discard	VERB
finefocus-591	88	17	as	as	ADP
finefocus-591	88	18	burnin	burnin	NOUN
finefocus-591	88	19	.	.	PUNCT
finefocus-591	89	1	the	the	DET
finefocus-591	89	2	consensus	consensus	NOUN
finefocus-591	89	3	trees	tree	NOUN
finefocus-591	89	4	were	be	AUX
finefocus-591	89	5	observed	observe	VERB
finefocus-591	89	6	in	in	ADP
finefocus-591	89	7	figtree	figtree	ADJ
finefocus-591	89	8	v1.4.2	v1.4.2	NOUN
finefocus-591	89	9	(	(	PUNCT
finefocus-591	89	10	http://tree.bio.ed.ac.uk/	http://tree.bio.ed.ac.uk/	PROPN
finefocus-591	89	11	software	software	PROPN
finefocus-591	89	12	/	/	SYM
finefocus-591	89	13	figtree/	figtree/	NUM
finefocus-591	89	14	)	)	PUNCT
finefocus-591	89	15	.	.	PUNCT
finefocus-591	90	1	e.	e.	PROPN
finefocus-591	90	2	species	species	PROPN
finefocus-591	90	3	ab024928	ab024928	PROPN
finefocus-591	90	4	e.	e.	PROPN
finefocus-591	90	5	canis	canis	PROPN
finefocus-591	90	6	a17s	a17s	PROPN
finefocus-591	90	7	-	-	PROPN
finefocus-591	90	8	m1	m1	PROPN
finefocus-591	90	9	e.	e.	PROPN
finefocus-591	90	10	canis	canis	PROPN
finefocus-591	90	11	a17s	a17s	PROPN
finefocus-591	90	12	-	-	PUNCT
finefocus-591	90	13	f5	f5	PROPN
finefocus-591	90	14	e.	e.	PROPN
finefocus-591	90	15	ruminantium	ruminantium	PROPN
finefocus-591	90	16	af069758	af069758	PROPN
finefocus-591	90	17	e.	e.	PROPN
finefocus-591	90	18	canis	canis	PROPN
finefocus-591	90	19	a17s	a17s	PROPN
finefocus-591	90	20	-	-	PROPN
finefocus-591	90	21	f7	f7	PROPN
finefocus-591	90	22	e.	e.	PROPN
finefocus-591	90	23	muris	muris	PROPN
finefocus-591	90	24	u15527	u15527	PROPN
finefocus-591	90	25	e.	e.	PROPN
finefocus-591	90	26	canis	canis	PROPN
finefocus-591	90	27	kc479022	kc479022	PROPN
finefocus-591	90	28	spain	spain	PROPN
finefocus-591	90	29	e.	e.	PROPN
finefocus-591	90	30	canis	canis	PROPN
finefocus-591	90	31	a25b	a25b	PROPN
finefocus-591	90	32	-	-	PUNCT
finefocus-591	90	33	f22	f22	ADJ
finefocus-591	90	34	e.	e.	PROPN
finefocus-591	90	35	species	species	PROPN
finefocus-591	91	1	gu075696	gu075696	PROPN
finefocus-591	91	2	e.	e.	PROPN
finefocus-591	91	3	canis	canis	PROPN
finefocus-591	91	4	kp844663	kp844663	PROPN
finefocus-591	91	5	mexico	mexico	PROPN
finefocus-591	91	6	e.	e.	PROPN
finefocus-591	91	7	canis	canis	PROPN
finefocus-591	91	8	a17s	a17s	PROPN
finefocus-591	91	9	-	-	PUNCT
finefocus-591	91	10	f3	f3	ADJ
finefocus-591	91	11	e.	e.	PROPN
finefocus-591	91	12	canis	canis	PROPN
finefocus-591	91	13	kj659037	kj659037	PROPN
finefocus-591	91	14	china	china	PROPN
finefocus-591	91	15	e.	e.	PROPN
finefocus-591	91	16	chaffeensis	chaffeensis	PROPN
finefocus-591	92	1	u60476	u60476	PROPN
finefocus-591	92	2	e.	e.	PROPN
finefocus-591	92	3	canis	canis	PROPN
finefocus-591	92	4	a25b	a25b	PROPN
finefocus-591	92	5	-	-	PUNCT
finefocus-591	92	6	f16	f16	PROPN
finefocus-591	92	7	e.	e.	PROPN
finefocus-591	92	8	species	species	PROPN
finefocus-591	92	9	ab196303	ab196303	PROPN
finefocus-591	92	10	e.	e.	PROPN
finefocus-591	92	11	canis	canis	PROPN
finefocus-591	92	12	a17s	a17s	PROPN
finefocus-591	92	13	-	-	PUNCT
finefocus-591	92	14	f1	f1	ADJ
finefocus-591	92	15	e.	e.	PROPN
finefocus-591	92	16	species	species	PROPN
finefocus-591	92	17	af497581	af497581	PROPN
finefocus-591	92	18	e.	e.	PROPN
finefocus-591	92	19	canis	canis	PROPN
finefocus-591	92	20	a25b	a25b	PROPN
finefocus-591	92	21	-	-	PUNCT
finefocus-591	92	22	f19	f19	ADJ
finefocus-591	92	23	“	"	PUNCT
finefocus-591	92	24	candidatus	candidatus	NOUN
finefocus-591	92	25	ehrlichia	ehrlichia	PROPN
finefocus-591	92	26	shimanensis”ab074459	shimanensis”ab074459	PROPN
finefocus-591	92	27	e.	e.	PROPN
finefocus-591	92	28	canis	canis	PROPN
finefocus-591	92	29	kj995841	kj995841	PROPN
finefocus-591	92	30	brazil	brazil	PROPN
finefocus-591	92	31	e.	e.	PROPN
finefocus-591	92	32	species	species	PROPN
finefocus-591	92	33	ab028319	ab028319	PROPN
finefocus-591	92	34	e.	e.	PROPN
finefocus-591	92	35	species	species	PROPN
finefocus-591	92	36	dq324547	dq324547	PROPN
finefocus-591	92	37	e.	e.	PROPN
finefocus-591	92	38	ewingii	ewingii	PROPN
finefocus-591	92	39	m73227	m73227	PROPN
finefocus-591	92	40	e.	e.	PROPN
finefocus-591	92	41	canis	canis	PROPN
finefocus-591	92	42	u54805	u54805	PROPN
finefocus-591	92	43	south	south	PROPN
finefocus-591	92	44	africa	africa	PROPN
finefocus-591	92	45	72	72	NUM
finefocus-591	92	46	100	100	NUM
finefocus-591	92	47	100	100	NUM
finefocus-591	92	48	99	99	NUM
finefocus-591	92	49	93	93	NUM
finefocus-591	92	50	fig	fig	NOUN
finefocus-591	92	51	.	.	PUNCT
finefocus-591	93	1	2	2	X
finefocus-591	93	2	.	.	X
finefocus-591	93	3	baysian	baysian	ADJ
finefocus-591	93	4	inference	inference	NOUN
finefocus-591	93	5	consensus	consensus	NOUN
finefocus-591	93	6	tree	tree	NOUN
finefocus-591	93	7	inferred	infer	VERB
finefocus-591	93	8	from	from	ADP
finefocus-591	93	9	16s	16s	PROPN
finefocus-591	93	10	rdna	rdna	PROPN
finefocus-591	93	11	of	of	ADP
finefocus-591	93	12	erhlichia	erhlichia	ADJ
finefocus-591	93	13	species	specie	NOUN
finefocus-591	93	14	.	.	PUNCT
finefocus-591	94	1	node	node	ADJ
finefocus-591	94	2	support	support	NOUN
finefocus-591	94	3	is	be	AUX
finefocus-591	94	4	indicated	indicate	VERB
finefocus-591	94	5	by	by	ADP
finefocus-591	94	6	the	the	DET
finefocus-591	94	7	posterior	posterior	ADJ
finefocus-591	94	8	probabilities	probability	NOUN
finefocus-591	94	9	at	at	ADP
finefocus-591	94	10	the	the	DET
finefocus-591	94	11	node	node	NOUN
finefocus-591	94	12	.	.	PUNCT
finefocus-591	95	1	the	the	DET
finefocus-591	95	2	name	name	NOUN
finefocus-591	95	3	of	of	ADP
finefocus-591	95	4	the	the	DET
finefocus-591	95	5	species	specie	NOUN
finefocus-591	95	6	is	be	AUX
finefocus-591	95	7	followed	follow	VERB
finefocus-591	95	8	by	by	ADP
finefocus-591	95	9	the	the	DET
finefocus-591	95	10	genbank	genbank	PROPN
finefocus-591	95	11	accession	accession	NOUN
finefocus-591	95	12	number	number	NOUN
finefocus-591	95	13	.	.	PUNCT
finefocus-591	96	1	a17s	a17s	PROPN
finefocus-591	96	2	-	-	PROPN
finefocus-591	96	3	m1	m1	NOUN
finefocus-591	96	4	,	,	PUNCT
finefocus-591	96	5	a17s	a17s	PROPN
finefocus-591	96	6	-	-	PUNCT
finefocus-591	96	7	f1	f1	NOUN
finefocus-591	96	8	,	,	PUNCT
finefocus-591	96	9	a17s	a17s	PROPN
finefocus-591	96	10	-	-	PUNCT
finefocus-591	96	11	f3	f3	ADJ
finefocus-591	96	12	,	,	PUNCT
finefocus-591	96	13	a17s	a17	NOUN
finefocus-591	96	14	-	-	PUNCT
finefocus-591	96	15	f5	f5	NOUN
finefocus-591	96	16	,	,	PUNCT
finefocus-591	96	17	a17s	a17s	PROPN
finefocus-591	96	18	-	-	PUNCT
finefocus-591	96	19	f7	f7	PROPN
finefocus-591	96	20	,	,	PUNCT
finefocus-591	96	21	a25b	a25b	NOUN
finefocus-591	96	22	-	-	PUNCT
finefocus-591	96	23	f16	f16	PROPN
finefocus-591	96	24	,	,	PUNCT
finefocus-591	96	25	a25b	a25b	NOUN
finefocus-591	96	26	-	-	PUNCT
finefocus-591	96	27	f19	f19	PROPN
finefocus-591	96	28	and	and	CCONJ
finefocus-591	96	29	a25b	a25b	ADJ
finefocus-591	96	30	-	-	PUNCT
finefocus-591	96	31	f22	f22	NOUN
finefocus-591	96	32	represent	represent	ADJ
finefocus-591	96	33	amplicons	amplicon	NOUN
finefocus-591	96	34	from	from	ADP
finefocus-591	96	35	r.	r.	PROPN
finefocus-591	96	36	sanguineus	sanguineus	PROPN
finefocus-591	96	37	and	and	CCONJ
finefocus-591	96	38	are	be	AUX
finefocus-591	96	39	underlined	underline	VERB
finefocus-591	96	40	.	.	PUNCT
finefocus-591	97	1	the	the	DET
finefocus-591	97	2	scale	scale	NOUN
finefocus-591	97	3	bar	bar	NOUN
finefocus-591	97	4	indicates	indicate	VERB
finefocus-591	97	5	the	the	DET
finefocus-591	97	6	mean	mean	ADJ
finefocus-591	97	7	number	number	NOUN
finefocus-591	97	8	of	of	ADP
finefocus-591	97	9	nucleotide	nucleotide	ADJ
finefocus-591	97	10	substitutions	substitution	NOUN
finefocus-591	97	11	per	per	ADP
finefocus-591	97	12	site	site	NOUN
finefocus-591	97	13	.	.	PUNCT
finefocus-591	98	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	98	2	116	116	NUM
finefocus-591	98	3	9/25/15	9/25/15	NUM
finefocus-591	98	4	11:38	11:38	NUM
finefocus-591	98	5	am	am	NOUN
finefocus-591	98	6	pathogens	pathogen	NOUN
finefocus-591	98	7	and	and	CCONJ
finefocus-591	98	8	antimicrobial	antimicrobial	ADJ
finefocus-591	98	9	factors	factor	NOUN
finefocus-591	98	10	•	•	NOUN
finefocus-591	98	11	117	117	NUM
finefocus-591	98	12	results	result	VERB
finefocus-591	98	13	pcr	pcr	ADJ
finefocus-591	98	14	detection	detection	NOUN
finefocus-591	98	15	of	of	ADP
finefocus-591	98	16	borrelia	borrelia	NOUN
finefocus-591	98	17	and	and	CCONJ
finefocus-591	98	18	ehrlichia	ehrlichia	NOUN
finefocus-591	98	19	of	of	ADP
finefocus-591	98	20	the	the	DET
finefocus-591	98	21	112	112	NUM
finefocus-591	98	22	positive	positive	ADJ
finefocus-591	98	23	samples	sample	NOUN
finefocus-591	98	24	for	for	ADP
finefocus-591	98	25	tick	tick	NOUN
finefocus-591	98	26	rdna	rdna	NOUN
finefocus-591	98	27	,	,	PUNCT
finefocus-591	98	28	44	44	NUM
finefocus-591	98	29	ticks	tick	NOUN
finefocus-591	98	30	(	(	PUNCT
finefocus-591	98	31	18	18	NUM
finefocus-591	98	32	males	male	NOUN
finefocus-591	98	33	and	and	CCONJ
finefocus-591	98	34	26	26	NUM
finefocus-591	98	35	females	female	NOUN
finefocus-591	98	36	)	)	PUNCT
finefocus-591	98	37	were	be	AUX
finefocus-591	98	38	positive	positive	ADJ
finefocus-591	98	39	for	for	ADP
finefocus-591	98	40	b.	b.	PROPN
finefocus-591	98	41	burgdorferi	burgdorferi	PROPN
finefocus-591	98	42	-	-	PUNCT
finefocus-591	98	43	like	like	ADJ
finefocus-591	98	44	species	specie	NOUN
finefocus-591	98	45	,	,	PUNCT
finefocus-591	98	46	“	"	PUNCT
finefocus-591	98	47	candidatus	candidatus	PROPN
finefocus-591	98	48	b.	b.	PROPN
finefocus-591	98	49	lonestari	lonestari	PROPN
finefocus-591	98	50	”	"	PUNCT
finefocus-591	98	51	or	or	CCONJ
finefocus-591	98	52	ehrlichia	ehrlichia	VERB
finefocus-591	98	53	bacteria	bacteria	NOUN
finefocus-591	98	54	species	specie	NOUN
finefocus-591	98	55	(	(	PUNCT
finefocus-591	98	56	table	table	NOUN
finefocus-591	98	57	2	2	NUM
finefocus-591	98	58	)	)	PUNCT
finefocus-591	98	59	.	.	PUNCT
finefocus-591	99	1	“	"	PUNCT
finefocus-591	99	2	candidatus	candidatus	PROPN
finefocus-591	99	3	b.	b.	PROPN
finefocus-591	99	4	lonestari	lonestari	PROPN
finefocus-591	99	5	”	"	PUNCT
finefocus-591	99	6	,	,	PUNCT
finefocus-591	99	7	the	the	DET
finefocus-591	99	8	most	most	ADV
finefocus-591	99	9	commonly	commonly	ADV
finefocus-591	99	10	detected	detect	VERB
finefocus-591	99	11	tick	tick	NOUN
finefocus-591	99	12	-	-	PUNCT
finefocus-591	99	13	borne	bear	VERB
finefocus-591	99	14	pathogen	pathogen	NOUN
finefocus-591	99	15	,	,	PUNCT
finefocus-591	99	16	was	be	AUX
finefocus-591	99	17	detected	detect	VERB
finefocus-591	99	18	in	in	ADP
finefocus-591	99	19	16.9	16.9	NUM
finefocus-591	99	20	%	%	NOUN
finefocus-591	99	21	(	(	PUNCT
finefocus-591	99	22	n=19	n=19	PROPN
finefocus-591	99	23	,	,	PUNCT
finefocus-591	99	24	16.3	16.3	NUM
finefocus-591	99	25	%	%	NOUN
finefocus-591	99	26	of	of	ADP
finefocus-591	99	27	males	male	NOUN
finefocus-591	99	28	(	(	PUNCT
finefocus-591	99	29	8/49	8/49	NUM
finefocus-591	99	30	)	)	PUNCT
finefocus-591	99	31	and	and	CCONJ
finefocus-591	99	32	17.5	17.5	NUM
finefocus-591	99	33	%	%	NOUN
finefocus-591	99	34	(	(	PUNCT
finefocus-591	99	35	11/63	11/63	NUM
finefocus-591	99	36	)	)	PUNCT
finefocus-591	99	37	of	of	ADP
finefocus-591	99	38	females	female	NOUN
finefocus-591	99	39	)	)	PUNCT
finefocus-591	99	40	of	of	ADP
finefocus-591	99	41	all	all	DET
finefocus-591	99	42	ticks	tick	NOUN
finefocus-591	99	43	.	.	PUNCT
finefocus-591	100	1	b.	b.	PROPN
finefocus-591	100	2	burgdorferi	burgdorferi	PROPN
finefocus-591	100	3	-	-	PUNCT
finefocus-591	100	4	like	like	ADJ
finefocus-591	100	5	species	specie	NOUN
finefocus-591	100	6	were	be	AUX
finefocus-591	100	7	detected	detect	VERB
finefocus-591	100	8	in	in	ADP
finefocus-591	100	9	9.8	9.8	NUM
finefocus-591	100	10	%	%	NOUN
finefocus-591	100	11	(	(	PUNCT
finefocus-591	100	12	n=11	n=11	NOUN
finefocus-591	100	13	,	,	PUNCT
finefocus-591	100	14	12.2	12.2	NUM
finefocus-591	100	15	%	%	NOUN
finefocus-591	100	16	(	(	PUNCT
finefocus-591	100	17	6/49	6/49	NUM
finefocus-591	100	18	)	)	PUNCT
finefocus-591	100	19	of	of	ADP
finefocus-591	100	20	males	male	NOUN
finefocus-591	100	21	and	and	CCONJ
finefocus-591	100	22	7.9	7.9	NUM
finefocus-591	100	23	%	%	NOUN
finefocus-591	100	24	(	(	PUNCT
finefocus-591	100	25	5/63	5/63	NOUN
finefocus-591	100	26	)	)	PUNCT
finefocus-591	100	27	of	of	ADP
finefocus-591	100	28	females	female	NOUN
finefocus-591	100	29	)	)	PUNCT
finefocus-591	100	30	of	of	ADP
finefocus-591	100	31	all	all	DET
finefocus-591	100	32	ticks	tick	NOUN
finefocus-591	100	33	.	.	PUNCT
finefocus-591	101	1	e.	e.	PROPN
finefocus-591	101	2	canis	canis	PROPN
finefocus-591	101	3	was	be	AUX
finefocus-591	101	4	detected	detect	VERB
finefocus-591	101	5	in	in	ADP
finefocus-591	101	6	12.5	12.5	NUM
finefocus-591	101	7	%	%	NOUN
finefocus-591	101	8	(	(	PUNCT
finefocus-591	101	9	n=	n=	ADJ
finefocus-591	101	10	14	14	NUM
finefocus-591	101	11	,	,	PUNCT
finefocus-591	101	12	8.2	8.2	NUM
finefocus-591	101	13	%	%	NOUN
finefocus-591	101	14	(	(	PUNCT
finefocus-591	101	15	4/49	4/49	NUM
finefocus-591	101	16	)	)	PUNCT
finefocus-591	101	17	of	of	ADP
finefocus-591	101	18	males	male	NOUN
finefocus-591	101	19	and	and	CCONJ
finefocus-591	101	20	15.9	15.9	NUM
finefocus-591	101	21	%	%	NOUN
finefocus-591	101	22	(	(	PUNCT
finefocus-591	101	23	10/63	10/63	NUM
finefocus-591	101	24	)	)	PUNCT
finefocus-591	101	25	of	of	ADP
finefocus-591	101	26	females	female	NOUN
finefocus-591	101	27	)	)	PUNCT
finefocus-591	101	28	of	of	ADP
finefocus-591	101	29	all	all	DET
finefocus-591	101	30	samples	sample	NOUN
finefocus-591	101	31	.	.	PUNCT
finefocus-591	102	1	two	two	NUM
finefocus-591	102	2	male	male	ADJ
finefocus-591	102	3	ticks	tick	NOUN
finefocus-591	102	4	(	(	PUNCT
finefocus-591	102	5	4.1	4.1	NUM
finefocus-591	102	6	%	%	NOUN
finefocus-591	102	7	,	,	PUNCT
finefocus-591	102	8	n=2	n=2	ADV
finefocus-591	102	9	of	of	ADP
finefocus-591	102	10	49	49	NUM
finefocus-591	102	11	)	)	PUNCT
finefocus-591	102	12	were	be	AUX
finefocus-591	102	13	positive	positive	ADJ
finefocus-591	102	14	for	for	ADP
finefocus-591	102	15	both	both	PRON
finefocus-591	102	16	e.	e.	PROPN
finefocus-591	102	17	canis	canis	PROPN
finefocus-591	102	18	and	and	CCONJ
finefocus-591	102	19	b.	b.	PROPN
finefocus-591	102	20	burgdorferilike	burgdorferilike	PROPN
finefocus-591	102	21	species	species	PROPN
finefocus-591	102	22	,	,	PUNCT
finefocus-591	102	23	indicating	indicate	VERB
finefocus-591	102	24	a	a	DET
finefocus-591	102	25	1.8	1.8	NUM
finefocus-591	102	26	%	%	NOUN
finefocus-591	102	27	co	co	NOUN
finefocus-591	102	28	-	-	NOUN
finefocus-591	102	29	infection	infection	ADJ
finefocus-591	102	30	rate	rate	NOUN
finefocus-591	102	31	(	(	PUNCT
finefocus-591	102	32	2	2	NUM
finefocus-591	102	33	of	of	ADP
finefocus-591	102	34	112	112	NUM
finefocus-591	102	35	)	)	PUNCT
finefocus-591	102	36	of	of	ADP
finefocus-591	102	37	all	all	DET
finefocus-591	102	38	ticks	tick	NOUN
finefocus-591	102	39	.	.	PUNCT
finefocus-591	103	1	one	one	NUM
finefocus-591	103	2	male	male	NOUN
finefocus-591	103	3	and	and	CCONJ
finefocus-591	103	4	one	one	NUM
finefocus-591	103	5	female	female	ADJ
finefocus-591	103	6	tick	tick	NOUN
finefocus-591	103	7	(	(	PUNCT
finefocus-591	103	8	male	male	NOUN
finefocus-591	103	9	:	:	PUNCT
finefocus-591	103	10	2.0	2.0	NUM
finefocus-591	103	11	%	%	NOUN
finefocus-591	103	12	,	,	PUNCT
finefocus-591	103	13	n=1	n=1	PROPN
finefocus-591	103	14	of	of	ADP
finefocus-591	103	15	49	49	NUM
finefocus-591	103	16	;	;	PUNCT
finefocus-591	103	17	female	female	NOUN
finefocus-591	103	18	:	:	PUNCT
finefocus-591	103	19	1.6	1.6	NUM
finefocus-591	103	20	%	%	NOUN
finefocus-591	103	21	,	,	PUNCT
finefocus-591	103	22	n=1	n=1	PROPN
finefocus-591	103	23	of	of	ADP
finefocus-591	103	24	63	63	NUM
finefocus-591	103	25	)	)	PUNCT
finefocus-591	103	26	were	be	AUX
finefocus-591	103	27	positive	positive	ADJ
finefocus-591	103	28	for	for	ADP
finefocus-591	103	29	both	both	PRON
finefocus-591	103	30	“	"	PUNCT
finefocus-591	103	31	candidatus	candidatus	PROPN
finefocus-591	103	32	b.	b.	PROPN
finefocus-591	103	33	lonestari	lonestari	PROPN
finefocus-591	103	34	”	"	PUNCT
finefocus-591	103	35	and	and	CCONJ
finefocus-591	103	36	b.	b.	PROPN
finefocus-591	103	37	burgdorferilike	burgdorferilike	PROPN
finefocus-591	103	38	species	species	PROPN
finefocus-591	103	39	,	,	PUNCT
finefocus-591	103	40	indicating	indicate	VERB
finefocus-591	103	41	a	a	DET
finefocus-591	103	42	1.8	1.8	NUM
finefocus-591	103	43	%	%	NOUN
finefocus-591	103	44	co	co	NOUN
finefocus-591	103	45	-	-	NOUN
finefocus-591	103	46	infection	infection	ADJ
finefocus-591	103	47	rate	rate	NOUN
finefocus-591	103	48	(	(	PUNCT
finefocus-591	103	49	2	2	NUM
finefocus-591	103	50	of	of	ADP
finefocus-591	103	51	112	112	NUM
finefocus-591	103	52	)	)	PUNCT
finefocus-591	103	53	of	of	ADP
finefocus-591	103	54	all	all	DET
finefocus-591	103	55	ticks	tick	NOUN
finefocus-591	103	56	.	.	PUNCT
finefocus-591	104	1	no	no	DET
finefocus-591	104	2	tick	tick	NOUN
finefocus-591	104	3	was	be	AUX
finefocus-591	104	4	positive	positive	ADJ
finefocus-591	104	5	for	for	ADP
finefocus-591	104	6	the	the	DET
finefocus-591	104	7	spotted	spot	VERB
finefocus-591	104	8	fever	fever	NOUN
finefocus-591	104	9	group	group	NOUN
finefocus-591	104	10	rickettsial	rickettsial	ADJ
finefocus-591	104	11	rompa	rompa	NOUN
finefocus-591	104	12	gene	gene	NOUN
finefocus-591	104	13	.	.	PUNCT
finefocus-591	105	1	phylogenetic	phylogenetic	ADJ
finefocus-591	105	2	analysis	analysis	NOUN
finefocus-591	105	3	samples	sample	NOUN
finefocus-591	105	4	with	with	ADP
finefocus-591	105	5	strong	strong	ADJ
finefocus-591	105	6	bands	band	NOUN
finefocus-591	105	7	by	by	ADP
finefocus-591	105	8	gel	gel	NOUN
finefocus-591	105	9	electrophoresis	electrophoresis	NOUN
finefocus-591	105	10	were	be	AUX
finefocus-591	105	11	prepared	prepare	VERB
finefocus-591	105	12	for	for	ADP
finefocus-591	105	13	sequencing	sequence	VERB
finefocus-591	105	14	.	.	PUNCT
finefocus-591	106	1	sequencing	sequence	VERB
finefocus-591	106	2	confirmed	confirm	VERB
finefocus-591	106	3	the	the	DET
finefocus-591	106	4	pcr	pcr	ADJ
finefocus-591	106	5	results	result	NOUN
finefocus-591	106	6	.	.	PUNCT
finefocus-591	107	1	a	a	DET
finefocus-591	107	2	bayesian	bayesian	NOUN
finefocus-591	107	3	inference	inference	NOUN
finefocus-591	107	4	tree	tree	NOUN
finefocus-591	107	5	including	include	VERB
finefocus-591	107	6	these	these	DET
finefocus-591	107	7	sequences	sequence	NOUN
finefocus-591	107	8	and	and	CCONJ
finefocus-591	107	9	other	other	ADJ
finefocus-591	107	10	published	publish	VERB
finefocus-591	107	11	sequences	sequence	NOUN
finefocus-591	107	12	are	be	AUX
finefocus-591	107	13	shown	show	VERB
finefocus-591	107	14	in	in	ADP
finefocus-591	107	15	figs	fig	NOUN
finefocus-591	107	16	.	.	PUNCT
finefocus-591	108	1	1	1	NUM
finefocus-591	108	2	and	and	CCONJ
finefocus-591	108	3	2	2	NUM
finefocus-591	108	4	.	.	X
finefocus-591	108	5	phylogenetic	phylogenetic	ADJ
finefocus-591	108	6	analysis	analysis	NOUN
finefocus-591	108	7	showed	show	VERB
finefocus-591	108	8	that	that	SCONJ
finefocus-591	108	9	“	"	PUNCT
finefocus-591	108	10	candidatus	candidatus	PROPN
finefocus-591	108	11	b.	b.	PROPN
finefocus-591	108	12	lonestari	lonestari	PROPN
finefocus-591	108	13	”	"	PUNCT
finefocus-591	108	14	amplicons	amplicon	NOUN
finefocus-591	108	15	were	be	AUX
finefocus-591	108	16	in	in	ADP
finefocus-591	108	17	the	the	DET
finefocus-591	108	18	same	same	ADJ
finefocus-591	108	19	clade	clade	NOUN
finefocus-591	108	20	as	as	ADP
finefocus-591	108	21	known	know	VERB
finefocus-591	108	22	sequences	sequence	NOUN
finefocus-591	108	23	of	of	ADP
finefocus-591	108	24	“	"	PUNCT
finefocus-591	108	25	candidatus	candidatus	PROPN
finefocus-591	108	26	b.	b.	PROPN
finefocus-591	108	27	lonestari	lonestari	PROPN
finefocus-591	108	28	”	"	PUNCT
finefocus-591	108	29	and	and	CCONJ
finefocus-591	108	30	b.	b.	PROPN
finefocus-591	108	31	burgdorferilike	burgdorferilike	PROPN
finefocus-591	108	32	species	specie	NOUN
finefocus-591	108	33	amplicons	amplicon	NOUN
finefocus-591	108	34	clustered	cluster	VERB
finefocus-591	108	35	with	with	ADP
finefocus-591	108	36	b.	b.	PROPN
finefocus-591	108	37	burgdorferi	burgdorferi	ADJ
finefocus-591	108	38	species	specie	NOUN
finefocus-591	108	39	complex	complex	NOUN
finefocus-591	108	40	(	(	PUNCT
finefocus-591	108	41	fig	fig	NOUN
finefocus-591	108	42	.	.	NOUN
finefocus-591	109	1	1	1	NUM
finefocus-591	109	2	)	)	PUNCT
finefocus-591	109	3	.	.	PUNCT
finefocus-591	110	1	“	"	PUNCT
finefocus-591	110	2	candidatus	candidatus	PROPN
finefocus-591	110	3	b.	b.	PROPN
finefocus-591	110	4	lonestari	lonestari	PROPN
finefocus-591	110	5	”	"	PUNCT
finefocus-591	110	6	sequences	sequence	NOUN
finefocus-591	110	7	were	be	AUX
finefocus-591	110	8	all	all	ADV
finefocus-591	110	9	identical	identical	ADJ
finefocus-591	110	10	except	except	SCONJ
finefocus-591	110	11	a25b	a25b	NOUN
finefocus-591	110	12	-	-	PUNCT
finefocus-591	110	13	f5	f5	NOUN
finefocus-591	110	14	,	,	PUNCT
finefocus-591	110	15	which	which	PRON
finefocus-591	110	16	was	be	AUX
finefocus-591	110	17	polymorphic	polymorphic	ADJ
finefocus-591	110	18	at	at	ADP
finefocus-591	110	19	one	one	NUM
finefocus-591	110	20	position	position	NOUN
finefocus-591	110	21	.	.	PUNCT
finefocus-591	111	1	three	three	NUM
finefocus-591	111	2	of	of	ADP
finefocus-591	111	3	the	the	DET
finefocus-591	111	4	b.	b.	PROPN
finefocus-591	111	5	burgdorferi	burgdorferi	PROPN
finefocus-591	111	6	-	-	PUNCT
finefocus-591	111	7	like	like	ADJ
finefocus-591	111	8	species	species	NOUN
finefocus-591	111	9	sequences	sequence	NOUN
finefocus-591	111	10	(	(	PUNCT
finefocus-591	111	11	b17z10	b17z10	NOUN
finefocus-591	111	12	-	-	PUNCT
finefocus-591	111	13	f1	f1	NOUN
finefocus-591	111	14	,	,	PUNCT
finefocus-591	111	15	a25b	a25b	NOUN
finefocus-591	111	16	-	-	PUNCT
finefocus-591	111	17	m1	m1	PROPN
finefocus-591	111	18	and	and	CCONJ
finefocus-591	111	19	e49z02	e49z02	PROPN
finefocus-591	111	20	-	-	PUNCT
finefocus-591	111	21	m1	m1	NOUN
finefocus-591	111	22	)	)	PUNCT
finefocus-591	111	23	were	be	AUX
finefocus-591	111	24	different	different	ADJ
finefocus-591	111	25	at	at	ADP
finefocus-591	111	26	one	one	NUM
finefocus-591	111	27	position	position	NOUN
finefocus-591	111	28	.	.	PUNCT
finefocus-591	112	1	ehrlichia	ehrlichia	VERB
finefocus-591	112	2	amplicons	amplicon	NOUN
finefocus-591	112	3	were	be	AUX
finefocus-591	112	4	in	in	ADP
finefocus-591	112	5	the	the	DET
finefocus-591	112	6	same	same	ADJ
finefocus-591	112	7	clade	clade	NOUN
finefocus-591	112	8	as	as	ADP
finefocus-591	112	9	known	know	VERB
finefocus-591	112	10	sequences	sequence	NOUN
finefocus-591	112	11	of	of	ADP
finefocus-591	112	12	e.	e.	PROPN
finefocus-591	112	13	canis	canis	PROPN
finefocus-591	112	14	(	(	PUNCT
finefocus-591	112	15	fig	fig	NOUN
finefocus-591	112	16	.	.	PUNCT
finefocus-591	113	1	2	2	NUM
finefocus-591	113	2	)	)	PUNCT
finefocus-591	113	3	.	.	PUNCT
finefocus-591	114	1	discussion	discussion	NOUN
finefocus-591	114	2	the	the	DET
finefocus-591	114	3	ticks	tick	NOUN
finefocus-591	114	4	used	use	VERB
finefocus-591	114	5	for	for	ADP
finefocus-591	114	6	this	this	DET
finefocus-591	114	7	study	study	NOUN
finefocus-591	114	8	were	be	AUX
finefocus-591	114	9	fully	fully	ADV
finefocus-591	114	10	engorged	engorge	VERB
finefocus-591	114	11	.	.	PUNCT
finefocus-591	115	1	thus	thus	ADV
finefocus-591	115	2	,	,	PUNCT
finefocus-591	115	3	the	the	DET
finefocus-591	115	4	detection	detection	NOUN
finefocus-591	115	5	of	of	ADP
finefocus-591	115	6	pathogen	pathogen	NOUN
finefocus-591	115	7	dna	dna	NOUN
finefocus-591	115	8	either	either	CCONJ
finefocus-591	115	9	represents	represent	VERB
finefocus-591	115	10	the	the	DET
finefocus-591	115	11	most	most	ADV
finefocus-591	115	12	recent	recent	ADJ
finefocus-591	115	13	blood	blood	NOUN
finefocus-591	115	14	meal	meal	NOUN
finefocus-591	115	15	or	or	CCONJ
finefocus-591	115	16	potentially	potentially	ADV
finefocus-591	115	17	a	a	DET
finefocus-591	115	18	prior	prior	ADJ
finefocus-591	115	19	infection	infection	NOUN
finefocus-591	115	20	of	of	ADP
finefocus-591	115	21	the	the	DET
finefocus-591	115	22	tick	tick	NOUN
finefocus-591	115	23	.	.	PUNCT
finefocus-591	116	1	we	we	PRON
finefocus-591	116	2	detected	detect	VERB
finefocus-591	116	3	the	the	DET
finefocus-591	116	4	presence	presence	NOUN
finefocus-591	116	5	of	of	ADP
finefocus-591	116	6	b.	b.	PROPN
finefocus-591	116	7	burgdorferi	burgdorferi	PROPN
finefocus-591	116	8	-	-	PUNCT
finefocus-591	116	9	like	like	ADJ
finefocus-591	116	10	species	specie	NOUN
finefocus-591	116	11	,	,	PUNCT
finefocus-591	116	12	“	"	PUNCT
finefocus-591	116	13	candidatus	candidatus	PROPN
finefocus-591	116	14	b.	b.	PROPN
finefocus-591	116	15	lonestari	lonestari	PROPN
finefocus-591	116	16	”	"	PUNCT
finefocus-591	116	17	and	and	CCONJ
finefocus-591	116	18	e.	e.	PROPN
finefocus-591	116	19	canis	canis	PROPN
finefocus-591	116	20	dna	dna	PROPN
finefocus-591	116	21	in	in	ADP
finefocus-591	116	22	r.	r.	PROPN
finefocus-591	116	23	sanguineus	sanguineus	PROPN
finefocus-591	116	24	ticks	tick	NOUN
finefocus-591	116	25	from	from	ADP
finefocus-591	116	26	laredo	laredo	PROPN
finefocus-591	116	27	,	,	PUNCT
finefocus-591	116	28	texas	texas	PROPN
finefocus-591	116	29	.	.	PUNCT
finefocus-591	117	1	our	our	PRON
finefocus-591	117	2	study	study	NOUN
finefocus-591	117	3	does	do	AUX
finefocus-591	117	4	not	not	PART
finefocus-591	117	5	address	address	VERB
finefocus-591	117	6	the	the	DET
finefocus-591	117	7	issue	issue	NOUN
finefocus-591	117	8	of	of	ADP
finefocus-591	117	9	vector	vector	NOUN
finefocus-591	117	10	competency	competency	NOUN
finefocus-591	117	11	of	of	ADP
finefocus-591	117	12	r.	r.	PROPN
finefocus-591	117	13	sanguineus	sanguineus	PROPN
finefocus-591	117	14	ticks	tick	VERB
finefocus-591	117	15	in	in	ADP
finefocus-591	117	16	regard	regard	NOUN
finefocus-591	117	17	to	to	ADP
finefocus-591	117	18	b.	b.	PROPN
finefocus-591	117	19	burgdorferilike	burgdorferilike	PROPN
finefocus-591	117	20	species	specie	NOUN
finefocus-591	117	21	and	and	CCONJ
finefocus-591	117	22	“	"	PUNCT
finefocus-591	117	23	candidatus	candidatus	PROPN
finefocus-591	117	24	b.	b.	PROPN
finefocus-591	117	25	lonestari	lonestari	PROPN
finefocus-591	117	26	”	"	PUNCT
finefocus-591	117	27	.	.	PUNCT
finefocus-591	118	1	the	the	DET
finefocus-591	118	2	detection	detection	NOUN
finefocus-591	118	3	of	of	ADP
finefocus-591	118	4	pathogens	pathogen	NOUN
finefocus-591	118	5	in	in	ADP
finefocus-591	118	6	canines	canine	NOUN
finefocus-591	118	7	can	can	AUX
finefocus-591	118	8	indicate	indicate	VERB
finefocus-591	118	9	a	a	DET
finefocus-591	118	10	potential	potential	ADJ
finefocus-591	118	11	risk	risk	NOUN
finefocus-591	118	12	for	for	ADP
finefocus-591	118	13	infection	infection	NOUN
finefocus-591	118	14	of	of	ADP
finefocus-591	118	15	humans	human	NOUN
finefocus-591	118	16	(	(	PUNCT
finefocus-591	118	17	28,29	28,29	NUM
finefocus-591	118	18	)	)	PUNCT
finefocus-591	118	19	.	.	PUNCT
finefocus-591	119	1	we	we	PRON
finefocus-591	119	2	have	have	AUX
finefocus-591	119	3	detected	detect	VERB
finefocus-591	119	4	b.	b.	PROPN
finefocus-591	119	5	burgdorferi	burgdorferi	PROPN
finefocus-591	119	6	-	-	PUNCT
finefocus-591	119	7	like	like	ADJ
finefocus-591	119	8	species	specie	NOUN
finefocus-591	119	9	dna	dna	NOUN
finefocus-591	119	10	in	in	ADP
finefocus-591	119	11	9.8	9.8	NUM
finefocus-591	119	12	%	%	NOUN
finefocus-591	119	13	of	of	ADP
finefocus-591	119	14	ticks	tick	NOUN
finefocus-591	119	15	collected	collect	VERB
finefocus-591	119	16	from	from	ADP
finefocus-591	119	17	the	the	DET
finefocus-591	119	18	local	local	ADJ
finefocus-591	119	19	animal	animal	NOUN
finefocus-591	119	20	shelter	shelter	NOUN
finefocus-591	119	21	,	,	PUNCT
finefocus-591	119	22	as	as	ADV
finefocus-591	119	23	well	well	ADV
finefocus-591	119	24	as	as	ADP
finefocus-591	119	25	ticks	tick	NOUN
finefocus-591	119	26	submitted	submit	VERB
finefocus-591	119	27	by	by	ADP
finefocus-591	119	28	pet	pet	ADJ
finefocus-591	119	29	caregivers	caregiver	NOUN
finefocus-591	119	30	.	.	PUNCT
finefocus-591	120	1	the	the	DET
finefocus-591	120	2	main	main	ADJ
finefocus-591	120	3	vector	vector	NOUN
finefocus-591	120	4	for	for	ADP
finefocus-591	120	5	b.	b.	PROPN
finefocus-591	120	6	burgdorferi	burgdorferi	NOUN
finefocus-591	120	7	in	in	ADP
finefocus-591	120	8	the	the	DET
finefocus-591	120	9	northeastern	northeastern	ADJ
finefocus-591	120	10	united	united	PROPN
finefocus-591	120	11	states	states	PROPN
finefocus-591	120	12	is	be	AUX
finefocus-591	120	13	i.	i.	PROPN
finefocus-591	120	14	scapularis	scapularis	PROPN
finefocus-591	120	15	(	(	PUNCT
finefocus-591	120	16	17,18,37	17,18,37	NUM
finefocus-591	120	17	)	)	PUNCT
finefocus-591	120	18	.	.	PUNCT
finefocus-591	121	1	this	this	DET
finefocus-591	121	2	tick	tick	NOUN
finefocus-591	121	3	is	be	AUX
finefocus-591	121	4	present	present	ADJ
finefocus-591	121	5	throughout	throughout	ADP
finefocus-591	121	6	much	much	ADJ
finefocus-591	121	7	of	of	ADP
finefocus-591	121	8	texas	texas	PROPN
finefocus-591	121	9	and	and	CCONJ
finefocus-591	121	10	northern	northern	PROPN
finefocus-591	121	11	mexico	mexico	PROPN
finefocus-591	121	12	.	.	PUNCT
finefocus-591	122	1	b.	b.	PROPN
finefocus-591	122	2	burgdorferi	burgdorferi	PROPN
finefocus-591	122	3	was	be	AUX
finefocus-591	122	4	previously	previously	ADV
finefocus-591	122	5	detected	detect	VERB
finefocus-591	122	6	in	in	ADP
finefocus-591	122	7	45	45	NUM
finefocus-591	122	8	%	%	NOUN
finefocus-591	122	9	of	of	ADP
finefocus-591	122	10	tested	test	VERB
finefocus-591	122	11	i.	i.	PROPN
finefocus-591	122	12	scapularis	scapularis	PROPN
finefocus-591	122	13	ticks	tick	NOUN
finefocus-591	122	14	(	(	PUNCT
finefocus-591	122	15	19	19	NUM
finefocus-591	122	16	)	)	PUNCT
finefocus-591	122	17	.	.	PUNCT
finefocus-591	123	1	however	however	ADV
finefocus-591	123	2	,	,	PUNCT
finefocus-591	123	3	in	in	ADP
finefocus-591	123	4	webb	webb	PROPN
finefocus-591	123	5	county	county	PROPN
finefocus-591	123	6	tx	tx	PROPN
finefocus-591	123	7	,	,	PUNCT
finefocus-591	123	8	no	no	DET
finefocus-591	123	9	i.	i.	NOUN
finefocus-591	123	10	scapularis	scapularis	PROPN
finefocus-591	123	11	were	be	AUX
finefocus-591	123	12	identified	identify	VERB
finefocus-591	123	13	in	in	ADP
finefocus-591	123	14	the	the	DET
finefocus-591	123	15	combined	combine	VERB
finefocus-591	123	16	collection	collection	NOUN
finefocus-591	123	17	of	of	ADP
finefocus-591	123	18	over	over	ADP
finefocus-591	123	19	70,000	70,000	NUM
finefocus-591	123	20	ticks	tick	NOUN
finefocus-591	123	21	(	(	PUNCT
finefocus-591	123	22	5	5	NUM
finefocus-591	123	23	)	)	PUNCT
finefocus-591	123	24	.	.	PUNCT
finefocus-591	124	1	b.	b.	PROPN
finefocus-591	124	2	burgdorferi	burgdorferi	PROPN
finefocus-591	124	3	-	-	PUNCT
finefocus-591	124	4	like	like	ADP
finefocus-591	124	5	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	124	6	117	117	NUM
finefocus-591	124	7	9/25/15	9/25/15	NUM
finefocus-591	124	8	11:38	11:38	NUM
finefocus-591	124	9	am	be	AUX
finefocus-591	124	10	118	118	NUM
finefocus-591	124	11	•	•	NUM
finefocus-591	124	12	fine	fine	ADJ
finefocus-591	124	13	focus	focus	NOUN
finefocus-591	124	14	,	,	PUNCT
finefocus-591	124	15	vol	vol	NOUN
finefocus-591	124	16	.	.	NOUN
finefocus-591	124	17	1	1	NUM
finefocus-591	124	18	(	(	PUNCT
finefocus-591	124	19	2	2	NUM
finefocus-591	124	20	)	)	PUNCT
finefocus-591	124	21	species	specie	NOUN
finefocus-591	124	22	have	have	AUX
finefocus-591	124	23	been	be	AUX
finefocus-591	124	24	previously	previously	ADV
finefocus-591	124	25	reported	report	VERB
finefocus-591	124	26	in	in	ADP
finefocus-591	124	27	a.	a.	NOUN
finefocus-591	124	28	inornatum	inornatum	PROPN
finefocus-591	124	29	from	from	ADP
finefocus-591	124	30	webb	webb	PROPN
finefocus-591	124	31	county	county	PROPN
finefocus-591	124	32	(	(	PUNCT
finefocus-591	124	33	30	30	NUM
finefocus-591	124	34	)	)	PUNCT
finefocus-591	124	35	and	and	CCONJ
finefocus-591	124	36	a.	a.	NOUN
finefocus-591	124	37	mixtum	mixtum	PROPN
finefocus-591	124	38	from	from	ADP
finefocus-591	124	39	northeastern	northeastern	PROPN
finefocus-591	124	40	mexico	mexico	PROPN
finefocus-591	124	41	(	(	PUNCT
finefocus-591	124	42	21	21	NUM
finefocus-591	124	43	)	)	PUNCT
finefocus-591	124	44	.	.	PUNCT
finefocus-591	125	1	we	we	PRON
finefocus-591	125	2	also	also	ADV
finefocus-591	125	3	detected	detect	VERB
finefocus-591	125	4	“	"	PUNCT
finefocus-591	125	5	candidatus	candidatus	PROPN
finefocus-591	125	6	b.	b.	PROPN
finefocus-591	125	7	lonestari	lonestari	PROPN
finefocus-591	125	8	”	"	PUNCT
finefocus-591	125	9	,	,	PUNCT
finefocus-591	125	10	which	which	PRON
finefocus-591	125	11	is	be	AUX
finefocus-591	125	12	thought	think	VERB
finefocus-591	125	13	to	to	PART
finefocus-591	125	14	be	be	AUX
finefocus-591	125	15	the	the	DET
finefocus-591	125	16	cause	cause	NOUN
finefocus-591	125	17	of	of	ADP
finefocus-591	125	18	stari	stari	X
finefocus-591	125	19	(	(	PUNCT
finefocus-591	125	20	40	40	NUM
finefocus-591	125	21	)	)	PUNCT
finefocus-591	125	22	,	,	PUNCT
finefocus-591	125	23	in	in	ADP
finefocus-591	125	24	16.9	16.9	NUM
finefocus-591	125	25	%	%	NOUN
finefocus-591	125	26	of	of	ADP
finefocus-591	125	27	ticks	tick	NOUN
finefocus-591	125	28	.	.	PUNCT
finefocus-591	126	1	cohen	cohen	PROPN
finefocus-591	126	2	et	et	PROPN
finefocus-591	126	3	al	al	PROPN
finefocus-591	126	4	.	.	PROPN
finefocus-591	127	1	(	(	PUNCT
finefocus-591	127	2	1990	1990	NUM
finefocus-591	127	3	)	)	PUNCT
finefocus-591	127	4	reported	report	VERB
finefocus-591	127	5	a	a	DET
finefocus-591	127	6	5.5	5.5	NUM
finefocus-591	127	7	%	%	NOUN
finefocus-591	127	8	seroprevalence	seroprevalence	NOUN
finefocus-591	127	9	for	for	ADP
finefocus-591	127	10	borrelia	borrelia	NOUN
finefocus-591	127	11	in	in	ADP
finefocus-591	127	12	domestic	domestic	ADJ
finefocus-591	127	13	dogs	dog	NOUN
finefocus-591	127	14	from	from	ADP
finefocus-591	127	15	texas	texas	PROPN
finefocus-591	127	16	.	.	PUNCT
finefocus-591	128	1	however	however	ADV
finefocus-591	128	2	,	,	PUNCT
finefocus-591	128	3	of	of	ADP
finefocus-591	128	4	the	the	DET
finefocus-591	128	5	dogs	dog	NOUN
finefocus-591	128	6	in	in	ADP
finefocus-591	128	7	their	their	PRON
finefocus-591	128	8	study	study	NOUN
finefocus-591	128	9	0	0	NUM
finefocus-591	128	10	of	of	ADP
finefocus-591	128	11	5	5	NUM
finefocus-591	128	12	dogs	dog	NOUN
finefocus-591	128	13	that	that	PRON
finefocus-591	128	14	came	come	VERB
finefocus-591	128	15	from	from	ADP
finefocus-591	128	16	webb	webb	PROPN
finefocus-591	128	17	county	county	PROPN
finefocus-591	128	18	were	be	AUX
finefocus-591	128	19	seropositive	seropositive	ADJ
finefocus-591	128	20	(	(	PUNCT
finefocus-591	128	21	9	9	NUM
finefocus-591	128	22	)	)	PUNCT
finefocus-591	128	23	.	.	PUNCT
finefocus-591	129	1	likewise	likewise	ADV
finefocus-591	129	2	,	,	PUNCT
finefocus-591	129	3	bowman	bowman	PROPN
finefocus-591	129	4	et	et	PROPN
finefocus-591	129	5	al	al	PROPN
finefocus-591	129	6	.	.	PROPN
finefocus-591	130	1	(	(	PUNCT
finefocus-591	130	2	2009	2009	NUM
finefocus-591	130	3	)	)	PUNCT
finefocus-591	130	4	reported	report	VERB
finefocus-591	130	5	b.	b.	PROPN
finefocus-591	130	6	burgdorferi	burgdorferi	PROPN
finefocus-591	130	7	in	in	ADP
finefocus-591	130	8	central	central	ADJ
finefocus-591	130	9	and	and	CCONJ
finefocus-591	130	10	northern	northern	PROPN
finefocus-591	130	11	texas	texas	PROPN
finefocus-591	130	12	,	,	PUNCT
finefocus-591	130	13	but	but	CCONJ
finefocus-591	130	14	did	do	AUX
finefocus-591	130	15	not	not	PART
finefocus-591	130	16	have	have	VERB
finefocus-591	130	17	any	any	DET
finefocus-591	130	18	results	result	NOUN
finefocus-591	130	19	for	for	ADP
finefocus-591	130	20	south	south	PROPN
finefocus-591	130	21	texas	texas	PROPN
finefocus-591	130	22	.	.	PUNCT
finefocus-591	131	1	this	this	PRON
finefocus-591	131	2	is	be	AUX
finefocus-591	131	3	the	the	DET
finefocus-591	131	4	first	first	ADJ
finefocus-591	131	5	report	report	NOUN
finefocus-591	131	6	of	of	ADP
finefocus-591	131	7	borrelia	borrelia	NOUN
finefocus-591	131	8	from	from	ADP
finefocus-591	131	9	r.	r.	PROPN
finefocus-591	131	10	sanguineus	sanguineus	PROPN
finefocus-591	131	11	ticks	tick	NOUN
finefocus-591	131	12	and	and	CCONJ
finefocus-591	131	13	domestic	domestic	ADJ
finefocus-591	131	14	dogs	dog	NOUN
finefocus-591	131	15	in	in	ADP
finefocus-591	131	16	webb	webb	PROPN
finefocus-591	131	17	county	county	PROPN
finefocus-591	131	18	,	,	PUNCT
finefocus-591	131	19	texas	texas	PROPN
finefocus-591	131	20	.	.	PUNCT
finefocus-591	132	1	r.	r.	PROPN
finefocus-591	132	2	sanguineus	sanguineus	PROPN
finefocus-591	132	3	is	be	AUX
finefocus-591	132	4	the	the	DET
finefocus-591	132	5	only	only	ADJ
finefocus-591	132	6	known	know	VERB
finefocus-591	132	7	vector	vector	NOUN
finefocus-591	132	8	of	of	ADP
finefocus-591	132	9	e.	e.	PROPN
finefocus-591	132	10	canis	canis	PROPN
finefocus-591	132	11	(	(	PUNCT
finefocus-591	132	12	23	23	NUM
finefocus-591	132	13	)	)	PUNCT
finefocus-591	132	14	,	,	PUNCT
finefocus-591	132	15	and	and	CCONJ
finefocus-591	132	16	is	be	AUX
finefocus-591	132	17	widely	widely	ADV
finefocus-591	132	18	distributed	distribute	VERB
finefocus-591	132	19	throughout	throughout	ADP
finefocus-591	132	20	the	the	DET
finefocus-591	132	21	united	united	PROPN
finefocus-591	132	22	states	states	PROPN
finefocus-591	132	23	(	(	PUNCT
finefocus-591	132	24	6	6	NUM
finefocus-591	132	25	)	)	PUNCT
finefocus-591	132	26	.	.	PUNCT
finefocus-591	133	1	we	we	PRON
finefocus-591	133	2	detected	detect	VERB
finefocus-591	133	3	e.	e.	PROPN
finefocus-591	133	4	canis	canis	PROPN
finefocus-591	133	5	in	in	ADP
finefocus-591	133	6	12.5	12.5	NUM
finefocus-591	133	7	%	%	NOUN
finefocus-591	133	8	of	of	ADP
finefocus-591	133	9	ticks	tick	NOUN
finefocus-591	133	10	.	.	PUNCT
finefocus-591	134	1	however	however	ADV
finefocus-591	134	2	,	,	PUNCT
finefocus-591	134	3	all	all	PRON
finefocus-591	134	4	of	of	ADP
finefocus-591	134	5	the	the	DET
finefocus-591	134	6	ticks	tick	NOUN
finefocus-591	134	7	that	that	PRON
finefocus-591	134	8	were	be	AUX
finefocus-591	134	9	positive	positive	ADJ
finefocus-591	134	10	for	for	ADP
finefocus-591	134	11	e.	e.	PROPN
finefocus-591	134	12	canis	canis	PROPN
finefocus-591	134	13	were	be	AUX
finefocus-591	134	14	collected	collect	VERB
finefocus-591	134	15	from	from	ADP
finefocus-591	134	16	the	the	DET
finefocus-591	134	17	laredo	laredo	PROPN
finefocus-591	134	18	animal	animal	NOUN
finefocus-591	134	19	shelter	shelter	NOUN
finefocus-591	134	20	.	.	PUNCT
finefocus-591	135	1	many	many	ADJ
finefocus-591	135	2	pet	pet	ADJ
finefocus-591	135	3	owners	owner	NOUN
finefocus-591	135	4	acquire	acquire	VERB
finefocus-591	135	5	their	their	PRON
finefocus-591	135	6	pet	pet	NOUN
finefocus-591	135	7	from	from	ADP
finefocus-591	135	8	the	the	DET
finefocus-591	135	9	animal	animal	NOUN
finefocus-591	135	10	shelter	shelter	NOUN
finefocus-591	135	11	.	.	PUNCT
finefocus-591	136	1	these	these	DET
finefocus-591	136	2	dogs	dog	NOUN
finefocus-591	136	3	are	be	AUX
finefocus-591	136	4	at	at	ADP
finefocus-591	136	5	a	a	DET
finefocus-591	136	6	high	high	ADJ
finefocus-591	136	7	risk	risk	NOUN
finefocus-591	136	8	for	for	ADP
finefocus-591	136	9	acquiring	acquire	VERB
finefocus-591	136	10	e.	e.	PROPN
finefocus-591	136	11	canis	canis	PROPN
finefocus-591	136	12	at	at	ADP
finefocus-591	136	13	this	this	DET
finefocus-591	136	14	location	location	NOUN
finefocus-591	136	15	.	.	PUNCT
finefocus-591	137	1	however	however	ADV
finefocus-591	137	2	,	,	PUNCT
finefocus-591	137	3	domestic	domestic	ADJ
finefocus-591	137	4	dogs	dog	NOUN
finefocus-591	137	5	in	in	ADP
finefocus-591	137	6	the	the	DET
finefocus-591	137	7	city	city	NOUN
finefocus-591	137	8	of	of	ADP
finefocus-591	137	9	laredo	laredo	PROPN
finefocus-591	137	10	appear	appear	VERB
finefocus-591	137	11	to	to	PART
finefocus-591	137	12	be	be	AUX
finefocus-591	137	13	at	at	ADP
finefocus-591	137	14	a	a	DET
finefocus-591	137	15	low	low	ADJ
finefocus-591	137	16	risk	risk	NOUN
finefocus-591	137	17	for	for	ADP
finefocus-591	137	18	acquiring	acquire	VERB
finefocus-591	137	19	e.	e.	PROPN
finefocus-591	137	20	canis	canis	PROPN
finefocus-591	137	21	.	.	PUNCT
finefocus-591	138	1	the	the	DET
finefocus-591	138	2	previously	previously	ADV
finefocus-591	138	3	reported	report	VERB
finefocus-591	138	4	seroprevalence	seroprevalence	NOUN
finefocus-591	138	5	for	for	ADP
finefocus-591	138	6	e.	e.	PROPN
finefocus-591	138	7	canis	canis	PROPN
finefocus-591	138	8	(	(	PUNCT
finefocus-591	138	9	2.0	2.0	NUM
finefocus-591	138	10	%	%	NOUN
finefocus-591	138	11	)	)	PUNCT
finefocus-591	138	12	was	be	AUX
finefocus-591	138	13	higher	high	ADJ
finefocus-591	138	14	in	in	ADP
finefocus-591	138	15	texas	texas	PROPN
finefocus-591	138	16	than	than	ADP
finefocus-591	138	17	in	in	ADP
finefocus-591	138	18	much	much	ADJ
finefocus-591	138	19	of	of	ADP
finefocus-591	138	20	the	the	DET
finefocus-591	138	21	united	united	PROPN
finefocus-591	138	22	states	states	PROPN
finefocus-591	138	23	(	(	PUNCT
finefocus-591	138	24	4	4	NUM
finefocus-591	138	25	)	)	PUNCT
finefocus-591	138	26	.	.	PUNCT
finefocus-591	139	1	we	we	PRON
finefocus-591	139	2	did	do	AUX
finefocus-591	139	3	not	not	PART
finefocus-591	139	4	detect	detect	VERB
finefocus-591	139	5	e.	e.	PROPN
finefocus-591	139	6	chaffeensis	chaffeensis	PROPN
finefocus-591	139	7	and	and	CCONJ
finefocus-591	139	8	e.	e.	PROPN
finefocus-591	139	9	ewingii	ewingii	PROPN
finefocus-591	139	10	in	in	ADP
finefocus-591	139	11	r.	r.	PROPN
finefocus-591	139	12	sanguineus	sanguineus	PROPN
finefocus-591	139	13	,	,	PUNCT
finefocus-591	139	14	even	even	ADV
finefocus-591	139	15	though	though	SCONJ
finefocus-591	139	16	they	they	PRON
finefocus-591	139	17	are	be	AUX
finefocus-591	139	18	present	present	ADJ
finefocus-591	139	19	in	in	ADP
finefocus-591	139	20	the	the	DET
finefocus-591	139	21	area	area	NOUN
finefocus-591	139	22	(	(	PUNCT
finefocus-591	139	23	30	30	NUM
finefocus-591	139	24	)	)	PUNCT
finefocus-591	139	25	.	.	PUNCT
finefocus-591	140	1	we	we	PRON
finefocus-591	140	2	also	also	ADV
finefocus-591	140	3	did	do	AUX
finefocus-591	140	4	not	not	PART
finefocus-591	140	5	detect	detect	VERB
finefocus-591	140	6	any	any	DET
finefocus-591	140	7	spotted	spot	VERB
finefocus-591	140	8	fever	fever	NOUN
finefocus-591	140	9	group	group	NOUN
finefocus-591	140	10	rickettsia	rickettsia	NOUN
finefocus-591	140	11	.	.	PUNCT
finefocus-591	141	1	this	this	PRON
finefocus-591	141	2	would	would	AUX
finefocus-591	141	3	suggest	suggest	VERB
finefocus-591	141	4	that	that	SCONJ
finefocus-591	141	5	any	any	DET
finefocus-591	141	6	spotted	spot	VERB
finefocus-591	141	7	fever	fever	NOUN
finefocus-591	141	8	group	group	NOUN
finefocus-591	141	9	rickettsia	rickettsia	NOUN
finefocus-591	141	10	are	be	AUX
finefocus-591	141	11	either	either	ADV
finefocus-591	141	12	absent	absent	ADJ
finefocus-591	141	13	from	from	ADP
finefocus-591	141	14	the	the	DET
finefocus-591	141	15	area	area	NOUN
finefocus-591	141	16	or	or	CCONJ
finefocus-591	141	17	were	be	AUX
finefocus-591	141	18	present	present	ADJ
finefocus-591	141	19	at	at	ADP
finefocus-591	141	20	a	a	DET
finefocus-591	141	21	very	very	ADV
finefocus-591	141	22	low	low	ADJ
finefocus-591	141	23	prevalence	prevalence	NOUN
finefocus-591	141	24	.	.	PUNCT
finefocus-591	142	1	further	further	ADJ
finefocus-591	142	2	research	research	NOUN
finefocus-591	142	3	on	on	ADP
finefocus-591	142	4	r.	r.	PROPN
finefocus-591	142	5	sanguineus	sanguineus	PROPN
finefocus-591	142	6	distribution	distribution	NOUN
finefocus-591	142	7	and	and	CCONJ
finefocus-591	142	8	the	the	DET
finefocus-591	142	9	prevalence	prevalence	NOUN
finefocus-591	142	10	of	of	ADP
finefocus-591	142	11	b.	b.	PROPN
finefocus-591	142	12	burgdorferi	burgdorferi	PROPN
finefocus-591	142	13	-	-	PUNCT
finefocus-591	142	14	like	like	ADJ
finefocus-591	142	15	species	specie	NOUN
finefocus-591	142	16	,	,	PUNCT
finefocus-591	142	17	“	"	PUNCT
finefocus-591	142	18	candidatus	candidatus	PROPN
finefocus-591	142	19	b.	b.	PROPN
finefocus-591	142	20	lonestari	lonestari	PROPN
finefocus-591	142	21	”	"	PUNCT
finefocus-591	142	22	and	and	CCONJ
finefocus-591	142	23	ehrlichia	ehrlichia	VERB
finefocus-591	142	24	species	specie	NOUN
finefocus-591	142	25	in	in	ADP
finefocus-591	142	26	south	south	PROPN
finefocus-591	142	27	texas	texas	PROPN
finefocus-591	142	28	is	be	AUX
finefocus-591	142	29	needed	need	VERB
finefocus-591	142	30	.	.	PUNCT
finefocus-591	143	1	further	further	ADJ
finefocus-591	143	2	research	research	NOUN
finefocus-591	143	3	will	will	AUX
finefocus-591	143	4	help	help	VERB
finefocus-591	143	5	elucidate	elucidate	VERB
finefocus-591	143	6	if	if	SCONJ
finefocus-591	143	7	r.	r.	PROPN
finefocus-591	143	8	sanguineus	sanguineus	PROPN
finefocus-591	143	9	is	be	AUX
finefocus-591	143	10	a	a	DET
finefocus-591	143	11	vector	vector	NOUN
finefocus-591	143	12	of	of	ADP
finefocus-591	143	13	a	a	DET
finefocus-591	143	14	b.	b.	PROPN
finefocus-591	143	15	burgdorferi	burgdorferi	PROPN
finefocus-591	143	16	-	-	PUNCT
finefocus-591	143	17	like	like	ADJ
finefocus-591	143	18	species	specie	NOUN
finefocus-591	143	19	.	.	PUNCT
finefocus-591	144	1	this	this	DET
finefocus-591	144	2	additional	additional	ADJ
finefocus-591	144	3	research	research	NOUN
finefocus-591	144	4	would	would	AUX
finefocus-591	144	5	allow	allow	VERB
finefocus-591	144	6	for	for	ADP
finefocus-591	144	7	better	well	ADJ
finefocus-591	144	8	and	and	CCONJ
finefocus-591	144	9	more	more	ADV
finefocus-591	144	10	accurate	accurate	ADJ
finefocus-591	144	11	diagnosis	diagnosis	NOUN
finefocus-591	144	12	of	of	ADP
finefocus-591	144	13	tick	tick	NOUN
finefocus-591	144	14	-	-	PUNCT
finefocus-591	144	15	borne	bear	VERB
finefocus-591	144	16	illnesses	illness	NOUN
finefocus-591	144	17	,	,	PUNCT
finefocus-591	144	18	ultimately	ultimately	ADV
finefocus-591	144	19	leading	lead	VERB
finefocus-591	144	20	to	to	ADP
finefocus-591	144	21	better	well	ADJ
finefocus-591	144	22	treatment	treatment	NOUN
finefocus-591	144	23	and	and	CCONJ
finefocus-591	144	24	health	health	NOUN
finefocus-591	144	25	care	care	NOUN
finefocus-591	144	26	for	for	ADP
finefocus-591	144	27	domestic	domestic	ADJ
finefocus-591	144	28	dogs	dog	NOUN
finefocus-591	144	29	and	and	CCONJ
finefocus-591	144	30	humans	human	NOUN
finefocus-591	144	31	.	.	PUNCT
finefocus-591	145	1	this	this	DET
finefocus-591	145	2	research	research	NOUN
finefocus-591	145	3	supports	support	VERB
finefocus-591	145	4	the	the	DET
finefocus-591	145	5	observation	observation	NOUN
finefocus-591	145	6	of	of	ADP
finefocus-591	145	7	dr	dr	PROPN
finefocus-591	145	8	.	.	PROPN
finefocus-591	145	9	sandra	sandra	PROPN
finefocus-591	145	10	leyendecker	leyendecker	PROPN
finefocus-591	145	11	and	and	CCONJ
finefocus-591	145	12	suggests	suggest	VERB
finefocus-591	145	13	that	that	SCONJ
finefocus-591	145	14	domestic	domestic	ADJ
finefocus-591	145	15	dogs	dog	NOUN
finefocus-591	145	16	should	should	AUX
finefocus-591	145	17	be	be	AUX
finefocus-591	145	18	screened	screen	VERB
finefocus-591	145	19	for	for	ADP
finefocus-591	145	20	lyme	lyme	NOUN
finefocus-591	145	21	disease	disease	NOUN
finefocus-591	145	22	if	if	SCONJ
finefocus-591	145	23	they	they	PRON
finefocus-591	145	24	present	present	VERB
finefocus-591	145	25	with	with	ADP
finefocus-591	145	26	appropriate	appropriate	ADJ
finefocus-591	145	27	symptoms	symptom	NOUN
finefocus-591	145	28	.	.	PUNCT
finefocus-591	146	1	rosa	rosa	PROPN
finefocus-591	146	2	vasquez	vasquez	PROPN
finefocus-591	146	3	-	-	PUNCT
finefocus-591	146	4	espinoza	espinoza	PROPN
finefocus-591	146	5	was	be	AUX
finefocus-591	146	6	supported	support	VERB
finefocus-591	146	7	by	by	ADP
finefocus-591	146	8	the	the	DET
finefocus-591	146	9	ureca	ureca	NOUN
finefocus-591	146	10	!	!	PUNCT
finefocus-591	147	1	grants	grant	NOUN
finefocus-591	147	2	program	program	NOUN
finefocus-591	147	3	.	.	PUNCT
finefocus-591	148	1	david	david	PROPN
finefocus-591	148	2	l.	l.	PROPN
finefocus-591	148	3	beck	beck	PROPN
finefocus-591	148	4	was	be	AUX
finefocus-591	148	5	funded	fund	VERB
finefocus-591	148	6	for	for	ADP
finefocus-591	148	7	this	this	DET
finefocus-591	148	8	project	project	NOUN
finefocus-591	148	9	by	by	ADP
finefocus-591	148	10	faculty	faculty	NOUN
finefocus-591	148	11	development	development	NOUN
finefocus-591	148	12	funds	fund	NOUN
finefocus-591	148	13	.	.	PUNCT
finefocus-591	149	1	we	we	PRON
finefocus-591	149	2	thank	thank	VERB
finefocus-591	149	3	g.t	g.t	PROPN
finefocus-591	149	4	.	.	PROPN
finefocus-591	149	5	pugh	pugh	PROPN
finefocus-591	149	6	and	and	CCONJ
finefocus-591	149	7	m.	m.	NOUN
finefocus-591	149	8	weems	weem	NOUN
finefocus-591	149	9	for	for	ADP
finefocus-591	149	10	technical	technical	ADJ
finefocus-591	149	11	assistance	assistance	NOUN
finefocus-591	149	12	.	.	PUNCT
finefocus-591	150	1	acknowledgements	acknowledgement	NOUN
finefocus-591	150	2	references	reference	NOUN
finefocus-591	150	3	1	1	NUM
finefocus-591	150	4	.	.	X
finefocus-591	150	5	aguiar	aguiar	PROPN
finefocus-591	150	6	,	,	PUNCT
finefocus-591	150	7	d.	d.	PROPN
finefocus-591	150	8	m.	m.	PROPN
finefocus-591	150	9	,	,	PUNCT
finefocus-591	150	10	cavalcante	cavalcante	NOUN
finefocus-591	150	11	,	,	PUNCT
finefocus-591	150	12	g.	g.	PROPN
finefocus-591	150	13	t.	t.	PROPN
finefocus-591	150	14	,	,	PUNCT
finefocus-591	150	15	pinter	pinter	PROPN
finefocus-591	150	16	,	,	PUNCT
finefocus-591	150	17	a.	a.	NOUN
finefocus-591	150	18	,	,	PUNCT
finefocus-591	150	19	gennari	gennari	PROPN
finefocus-591	150	20	,	,	PUNCT
finefocus-591	150	21	s.	s.	PROPN
finefocus-591	150	22	m.	m.	PROPN
finefocus-591	150	23	,	,	PUNCT
finefocus-591	150	24	camargo	camargo	PROPN
finefocus-591	150	25	,	,	PUNCT
finefocus-591	150	26	l.	l.	PROPN
finefocus-591	150	27	m.	m.	PROPN
finefocus-591	150	28	a.	a.	PROPN
finefocus-591	150	29	,	,	PUNCT
finefocus-591	150	30	&	&	CCONJ
finefocus-591	150	31	labruna	labruna	PROPN
finefocus-591	150	32	,	,	PUNCT
finefocus-591	150	33	m.	m.	PROPN
finefocus-591	150	34	b.	b.	PROPN
finefocus-591	150	35	2007	2007	NUM
finefocus-591	150	36	.	.	PUNCT
finefocus-591	151	1	prevalence	prevalence	NOUN
finefocus-591	151	2	of	of	ADP
finefocus-591	151	3	ehrlichia	ehrlichia	PRON
finefocus-591	151	4	canis	canis	X
finefocus-591	151	5	(	(	PUNCT
finefocus-591	151	6	rickettsiales	rickettsiale	NOUN
finefocus-591	151	7	:	:	PUNCT
finefocus-591	151	8	anaplasmataceae	anaplasmataceae	PROPN
finefocus-591	151	9	)	)	PUNCT
finefocus-591	151	10	in	in	ADP
finefocus-591	151	11	dogs	dog	NOUN
finefocus-591	151	12	and	and	CCONJ
finefocus-591	151	13	rhipicephalus	rhipicephalus	ADJ
finefocus-591	151	14	sanguineus	sanguineus	NOUN
finefocus-591	151	15	(	(	PUNCT
finefocus-591	151	16	acari	acari	ADJ
finefocus-591	151	17	:	:	PUNCT
finefocus-591	151	18	ixodidae	ixodidae	NOUN
finefocus-591	151	19	)	)	PUNCT
finefocus-591	151	20	ticks	tick	NOUN
finefocus-591	151	21	from	from	ADP
finefocus-591	151	22	brazil	brazil	PROPN
finefocus-591	151	23	.	.	PUNCT
finefocus-591	152	1	j.	j.	PROPN
finefocus-591	152	2	med	med	PROPN
finefocus-591	152	3	.	.	PUNCT
finefocus-591	152	4	entomol	entomol	PROPN
finefocus-591	152	5	.	.	PUNCT
finefocus-591	153	1	44	44	NUM
finefocus-591	153	2	:	:	PUNCT
finefocus-591	153	3	126	126	NUM
finefocus-591	153	4	-	-	SYM
finefocus-591	153	5	132	132	NUM
finefocus-591	153	6	.	.	PUNCT
finefocus-591	154	1	doi:10.1093	doi:10.1093	NOUN
finefocus-591	154	2	/	/	SYM
finefocus-591	154	3	jmedent/41.5.126	jmedent/41.5.126	NOUN
finefocus-591	154	4	2	2	NUM
finefocus-591	154	5	.	.	X
finefocus-591	154	6	appel	appel	PROPN
finefocus-591	154	7	,	,	PUNCT
finefocus-591	154	8	m.	m.	PROPN
finefocus-591	154	9	j.	j.	PROPN
finefocus-591	154	10	,	,	PUNCT
finefocus-591	154	11	allan	allan	PROPN
finefocus-591	154	12	,	,	PUNCT
finefocus-591	154	13	s.	s.	PROPN
finefocus-591	154	14	,	,	PUNCT
finefocus-591	154	15	jacobson	jacobson	PROPN
finefocus-591	154	16	,	,	PUNCT
finefocus-591	154	17	r.	r.	PROPN
finefocus-591	154	18	h.	h.	PROPN
finefocus-591	154	19	,	,	PUNCT
finefocus-591	154	20	lauderdale	lauderdale	PROPN
finefocus-591	154	21	,	,	PUNCT
finefocus-591	154	22	t.	t.	PROPN
finefocus-591	154	23	l.	l.	PROPN
finefocus-591	154	24	,	,	PUNCT
finefocus-591	154	25	chang	chang	PROPN
finefocus-591	154	26	,	,	PUNCT
finefocus-591	154	27	y.	y.	PROPN
finefocus-591	154	28	f.	f.	PROPN
finefocus-591	154	29	,	,	PUNCT
finefocus-591	154	30	shin	shin	PROPN
finefocus-591	154	31	,	,	PUNCT
finefocus-591	154	32	s.	s.	PROPN
finefocus-591	154	33	j.	j.	PROPN
finefocus-591	154	34	,	,	PUNCT
finefocus-591	154	35	thomford	thomford	PROPN
finefocus-591	154	36	,	,	PUNCT
finefocus-591	154	37	j.	j.	PROPN
finefocus-591	154	38	w.	w.	PROPN
finefocus-591	154	39	,	,	PUNCT
finefocus-591	154	40	todhunter	todhunter	PROPN
finefocus-591	154	41	,	,	PUNCT
finefocus-591	154	42	r.	r.	PROPN
finefocus-591	154	43	j.	j.	PROPN
finefocus-591	154	44	,	,	PUNCT
finefocus-591	154	45	&	&	CCONJ
finefocus-591	154	46	summers	summers	PROPN
finefocus-591	154	47	,	,	PUNCT
finefocus-591	154	48	b.	b.	PROPN
finefocus-591	154	49	a.	a.	PROPN
finefocus-591	154	50	1993	1993	NUM
finefocus-591	154	51	.	.	PUNCT
finefocus-591	155	1	experimental	experimental	ADJ
finefocus-591	155	2	lyme	lyme	NOUN
finefocus-591	155	3	disease	disease	NOUN
finefocus-591	155	4	in	in	ADP
finefocus-591	155	5	dogs	dog	NOUN
finefocus-591	155	6	produces	produce	VERB
finefocus-591	155	7	arthritis	arthritis	NOUN
finefocus-591	155	8	and	and	CCONJ
finefocus-591	155	9	persistent	persistent	ADJ
finefocus-591	155	10	infection	infection	NOUN
finefocus-591	155	11	.	.	PUNCT
finefocus-591	156	1	j.	j.	PROPN
finefocus-591	156	2	infect	infect	PROPN
finefocus-591	156	3	.	.	PUNCT
finefocus-591	157	1	dis	dis	PROPN
finefocus-591	157	2	.	.	PUNCT
finefocus-591	158	1	167	167	NUM
finefocus-591	158	2	:	:	PUNCT
finefocus-591	158	3	651	651	NUM
finefocus-591	158	4	-	-	SYM
finefocus-591	158	5	654	654	NUM
finefocus-591	158	6	.	.	PUNCT
finefocus-591	159	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	159	2	118	118	NUM
finefocus-591	159	3	9/25/15	9/25/15	NUM
finefocus-591	159	4	11:38	11:38	NUM
finefocus-591	159	5	am	am	NOUN
finefocus-591	159	6	pathogens	pathogen	NOUN
finefocus-591	159	7	and	and	CCONJ
finefocus-591	159	8	antimicrobial	antimicrobial	ADJ
finefocus-591	159	9	factors	factor	NOUN
finefocus-591	159	10	•	•	NOUN
finefocus-591	159	11	119	119	NUM
finefocus-591	159	12	3	3	NUM
finefocus-591	159	13	.	.	PUNCT
finefocus-591	159	14	bacon	bacon	NOUN
finefocus-591	159	15	,	,	PUNCT
finefocus-591	159	16	r.	r.	PROPN
finefocus-591	159	17	m.	m.	PROPN
finefocus-591	159	18	,	,	PUNCT
finefocus-591	159	19	gilmore	gilmore	PROPN
finefocus-591	159	20	,	,	PUNCT
finefocus-591	159	21	r.	r.	PROPN
finefocus-591	159	22	d.	d.	PROPN
finefocus-591	159	23	,	,	PUNCT
finefocus-591	159	24	quintana	quintana	PROPN
finefocus-591	159	25	,	,	PUNCT
finefocus-591	159	26	m.	m.	NOUN
finefocus-591	159	27	,	,	PUNCT
finefocus-591	159	28	piesman	piesman	NOUN
finefocus-591	159	29	,	,	PUNCT
finefocus-591	159	30	j.	j.	PROPN
finefocus-591	159	31	,	,	PUNCT
finefocus-591	159	32	&	&	CCONJ
finefocus-591	159	33	johnson	johnson	PROPN
finefocus-591	159	34	,	,	PUNCT
finefocus-591	159	35	b.	b.	PROPN
finefocus-591	159	36	j.	j.	PROPN
finefocus-591	159	37	2003	2003	NUM
finefocus-591	159	38	.	.	PUNCT
finefocus-591	160	1	dna	dna	PROPN
finefocus-591	160	2	evidence	evidence	NOUN
finefocus-591	160	3	of	of	ADP
finefocus-591	160	4	borrelia	borrelia	PROPN
finefocus-591	160	5	lonestari	lonestari	ADJ
finefocus-591	160	6	in	in	ADP
finefocus-591	160	7	amblyomma	amblyomma	PROPN
finefocus-591	160	8	americanum	americanum	PROPN
finefocus-591	160	9	(	(	PUNCT
finefocus-591	160	10	acari	acari	ADJ
finefocus-591	160	11	:	:	PUNCT
finefocus-591	160	12	ixodidae	ixodidae	NOUN
finefocus-591	160	13	)	)	PUNCT
finefocus-591	160	14	in	in	ADP
finefocus-591	160	15	southeast	southeast	PROPN
finefocus-591	160	16	missouri	missouri	PROPN
finefocus-591	160	17	.	.	PUNCT
finefocus-591	161	1	j.	j.	PROPN
finefocus-591	161	2	med	med	PROPN
finefocus-591	161	3	.	.	PUNCT
finefocus-591	161	4	entomol	entomol	PROPN
finefocus-591	161	5	.	.	PUNCT
finefocus-591	162	1	40	40	NUM
finefocus-591	162	2	:	:	PUNCT
finefocus-591	163	1	590	590	NUM
finefocus-591	163	2	-	-	SYM
finefocus-591	163	3	592	592	NUM
finefocus-591	163	4	.	.	PUNCT
finefocus-591	163	5	doi:10.1603/0022	doi:10.1603/0022	NOUN
finefocus-591	163	6	-	-	PUNCT
finefocus-591	163	7	2585	2585	NUM
finefocus-591	163	8	-	-	SYM
finefocus-591	163	9	40.4.590	40.4.590	NUM
finefocus-591	163	10	4	4	NUM
finefocus-591	163	11	.	.	PUNCT
finefocus-591	163	12	beall	beall	PROPN
finefocus-591	163	13	,	,	PUNCT
finefocus-591	163	14	m.	m.	PROPN
finefocus-591	163	15	j.	j.	PROPN
finefocus-591	163	16	,	,	PUNCT
finefocus-591	163	17	alleman	alleman	PROPN
finefocus-591	163	18	,	,	PUNCT
finefocus-591	163	19	a.	a.	PROPN
finefocus-591	163	20	r.	r.	PROPN
finefocus-591	163	21	,	,	PUNCT
finefocus-591	163	22	breitschwerdt	breitschwerdt	PROPN
finefocus-591	163	23	,	,	PUNCT
finefocus-591	163	24	e.	e.	PROPN
finefocus-591	163	25	b.	b.	PROPN
finefocus-591	163	26	,	,	PUNCT
finefocus-591	163	27	cohn	cohn	PROPN
finefocus-591	163	28	,	,	PUNCT
finefocus-591	163	29	l.	l.	PROPN
finefocus-591	163	30	a.	a.	PROPN
finefocus-591	163	31	,	,	PUNCT
finefocus-591	163	32	couto	couto	PROPN
finefocus-591	163	33	,	,	PUNCT
finefocus-591	163	34	c.	c.	PROPN
finefocus-591	163	35	g.	g.	PROPN
finefocus-591	163	36	,	,	PUNCT
finefocus-591	163	37	dryden	dryden	PROPN
finefocus-591	163	38	,	,	PUNCT
finefocus-591	163	39	m.	m.	PROPN
finefocus-591	163	40	w.	w.	PROPN
finefocus-591	163	41	,	,	PUNCT
finefocus-591	163	42	guptill	guptill	PROPN
finefocus-591	163	43	,	,	PUNCT
finefocus-591	163	44	l.c	l.c	PROPN
finefocus-591	163	45	.	.	PROPN
finefocus-591	163	46	,	,	PUNCT
finefocus-591	163	47	iazbik	iazbik	PROPN
finefocus-591	163	48	,	,	PUNCT
finefocus-591	163	49	c.	c.	PROPN
finefocus-591	163	50	,	,	PUNCT
finefocus-591	163	51	kania	kania	PROPN
finefocus-591	163	52	,	,	PUNCT
finefocus-591	163	53	s.	s.	PROPN
finefocus-591	163	54	a.	a.	PROPN
finefocus-591	163	55	,	,	PUNCT
finefocus-591	163	56	lathan	lathan	PROPN
finefocus-591	163	57	,	,	PUNCT
finefocus-591	163	58	p.	p.	PROPN
finefocus-591	163	59	,	,	PUNCT
finefocus-591	163	60	little	little	PROPN
finefocus-591	163	61	,	,	PUNCT
finefocus-591	163	62	s.	s.	PROPN
finefocus-591	163	63	e.	e.	PROPN
finefocus-591	163	64	,	,	PUNCT
finefocus-591	163	65	roy	roy	PROPN
finefocus-591	163	66	,	,	PUNCT
finefocus-591	163	67	a.	a.	NOUN
finefocus-591	163	68	,	,	PUNCT
finefocus-591	163	69	sayler	sayler	NOUN
finefocus-591	163	70	,	,	PUNCT
finefocus-591	163	71	k.	k.	PROPN
finefocus-591	163	72	a.	a.	PROPN
finefocus-591	163	73	,	,	PUNCT
finefocus-591	163	74	stillman	stillman	PROPN
finefocus-591	163	75	,	,	PUNCT
finefocus-591	163	76	b.	b.	PROPN
finefocus-591	163	77	a.	a.	PROPN
finefocus-591	163	78	,	,	PUNCT
finefocus-591	163	79	welles	welles	PROPN
finefocus-591	163	80	,	,	PUNCT
finefocus-591	163	81	e.	e.	PROPN
finefocus-591	163	82	g.	g.	PROPN
finefocus-591	163	83	,	,	PUNCT
finefocus-591	163	84	wolfson	wolfson	PROPN
finefocus-591	163	85	,	,	PUNCT
finefocus-591	163	86	w.	w.	PROPN
finefocus-591	163	87	,	,	PUNCT
finefocus-591	163	88	&	&	CCONJ
finefocus-591	163	89	yabsley	yabsley	NOUN
finefocus-591	163	90	,	,	PUNCT
finefocus-591	163	91	m.	m.	NOUN
finefocus-591	163	92	j.	j.	PROPN
finefocus-591	163	93	2012	2012	NUM
finefocus-591	163	94	.	.	PUNCT
finefocus-591	164	1	seroprevalence	seroprevalence	NOUN
finefocus-591	164	2	of	of	ADP
finefocus-591	164	3	ehrlichia	ehrlichia	PRON
finefocus-591	164	4	canis	canis	NOUN
finefocus-591	164	5	,	,	PUNCT
finefocus-591	164	6	ehrlichia	ehrlichia	VERB
finefocus-591	164	7	chaffeensis	chaffeensis	NOUN
finefocus-591	164	8	and	and	CCONJ
finefocus-591	164	9	ehrlichia	ehrlichia	VERB
finefocus-591	164	10	ewingii	ewingii	NOUN
finefocus-591	164	11	in	in	ADP
finefocus-591	164	12	dogs	dog	NOUN
finefocus-591	164	13	in	in	ADP
finefocus-591	164	14	north	north	PROPN
finefocus-591	164	15	america	america	PROPN
finefocus-591	164	16	.	.	PUNCT
finefocus-591	165	1	parasit	parasit	PROPN
finefocus-591	165	2	.	.	PUNCT
finefocus-591	166	1	vectors	vector	NOUN
finefocus-591	166	2	.	.	PUNCT
finefocus-591	167	1	5	5	NUM
finefocus-591	167	2	:	:	SYM
finefocus-591	167	3	29	29	NUM
finefocus-591	167	4	.	.	X
finefocus-591	167	5	5	5	NUM
finefocus-591	167	6	.	.	X
finefocus-591	167	7	beck	beck	PROPN
finefocus-591	167	8	,	,	PUNCT
finefocus-591	167	9	d.l	d.l	PROPN
finefocus-591	167	10	.	.	PROPN
finefocus-591	167	11	,	,	PUNCT
finefocus-591	167	12	zavala	zavala	PROPN
finefocus-591	167	13	,	,	PUNCT
finefocus-591	167	14	j.	j.	PROPN
finefocus-591	167	15	,	,	PUNCT
finefocus-591	167	16	montalvo	montalvo	PROPN
finefocus-591	167	17	,	,	PUNCT
finefocus-591	167	18	e.o	e.o	PROPN
finefocus-591	167	19	.	.	PROPN
finefocus-591	167	20	,	,	PUNCT
finefocus-591	167	21	&	&	CCONJ
finefocus-591	167	22	quintana	quintana	PROPN
finefocus-591	167	23	,	,	PUNCT
finefocus-591	167	24	f.g	f.g	NOUN
finefocus-591	167	25	.	.	PROPN
finefocus-591	167	26	2011	2011	NUM
finefocus-591	167	27	.	.	PUNCT
finefocus-591	168	1	meteorological	meteorological	ADJ
finefocus-591	168	2	indicators	indicator	NOUN
finefocus-591	168	3	for	for	ADP
finefocus-591	168	4	amblyomma	amblyomma	PROPN
finefocus-591	168	5	cajennense	cajennense	VERB
finefocus-591	168	6	population	population	NOUN
finefocus-591	168	7	dynamics	dynamic	NOUN
finefocus-591	168	8	in	in	ADP
finefocus-591	168	9	the	the	DET
finefocus-591	168	10	tamaulipan	tamaulipan	NOUN
finefocus-591	168	11	biotic	biotic	ADJ
finefocus-591	168	12	province	province	NOUN
finefocus-591	168	13	in	in	ADP
finefocus-591	168	14	texas	texas	PROPN
finefocus-591	168	15	.	.	PUNCT
finefocus-591	169	1	j.	j.	PROPN
finefocus-591	169	2	vector	vector	PROPN
finefocus-591	169	3	ecol	ecol	PROPN
finefocus-591	169	4	.	.	PUNCT
finefocus-591	170	1	36	36	NUM
finefocus-591	170	2	:	:	SYM
finefocus-591	170	3	135	135	NUM
finefocus-591	170	4	-	-	SYM
finefocus-591	170	5	146	146	NUM
finefocus-591	170	6	.	.	NOUN
finefocus-591	171	1	6	6	NUM
finefocus-591	171	2	.	.	X
finefocus-591	171	3	bowman	bowman	PROPN
finefocus-591	171	4	,	,	PUNCT
finefocus-591	171	5	d.	d.	PROPN
finefocus-591	171	6	,	,	PUNCT
finefocus-591	171	7	little	little	PROPN
finefocus-591	171	8	,	,	PUNCT
finefocus-591	171	9	s.	s.	PROPN
finefocus-591	171	10	e.	e.	PROPN
finefocus-591	171	11	,	,	PUNCT
finefocus-591	171	12	lorentzen	lorentzen	PROPN
finefocus-591	171	13	,	,	PUNCT
finefocus-591	171	14	l.	l.	PROPN
finefocus-591	171	15	,	,	PUNCT
finefocus-591	171	16	shields	shield	NOUN
finefocus-591	171	17	,	,	PUNCT
finefocus-591	171	18	j.	j.	PROPN
finefocus-591	171	19	,	,	PUNCT
finefocus-591	171	20	sullivan	sullivan	PROPN
finefocus-591	171	21	,	,	PUNCT
finefocus-591	171	22	m.	m.	PROPN
finefocus-591	171	23	p.	p.	PROPN
finefocus-591	171	24	,	,	PUNCT
finefocus-591	171	25	&	&	CCONJ
finefocus-591	171	26	carlin	carlin	PROPN
finefocus-591	171	27	,	,	PUNCT
finefocus-591	171	28	e.	e.	PROPN
finefocus-591	171	29	p.	p.	PROPN
finefocus-591	171	30	2009	2009	NUM
finefocus-591	171	31	.	.	PUNCT
finefocus-591	172	1	prevalence	prevalence	NOUN
finefocus-591	172	2	and	and	CCONJ
finefocus-591	172	3	geographic	geographic	ADJ
finefocus-591	172	4	distribution	distribution	NOUN
finefocus-591	172	5	of	of	ADP
finefocus-591	172	6	dirofilaria	dirofilaria	PROPN
finefocus-591	172	7	immitis	immitis	PROPN
finefocus-591	172	8	,	,	PUNCT
finefocus-591	172	9	borrelia	borrelia	X
finefocus-591	172	10	burgdorferi	burgdorferi	NOUN
finefocus-591	172	11	,	,	PUNCT
finefocus-591	172	12	ehrlichia	ehrlichia	VERB
finefocus-591	172	13	canis	canis	NOUN
finefocus-591	172	14	,	,	PUNCT
finefocus-591	172	15	and	and	CCONJ
finefocus-591	172	16	anaplasma	anaplasma	NOUN
finefocus-591	172	17	phagocytophilum	phagocytophilum	NOUN
finefocus-591	172	18	in	in	ADP
finefocus-591	172	19	dogs	dog	NOUN
finefocus-591	172	20	in	in	ADP
finefocus-591	172	21	the	the	DET
finefocus-591	172	22	united	united	PROPN
finefocus-591	172	23	states	states	PROPN
finefocus-591	172	24	:	:	PUNCT
finefocus-591	172	25	results	result	NOUN
finefocus-591	172	26	of	of	ADP
finefocus-591	172	27	a	a	DET
finefocus-591	172	28	national	national	ADJ
finefocus-591	172	29	clinic	clinic	NOUN
finefocus-591	172	30	-	-	PUNCT
finefocus-591	172	31	based	base	VERB
finefocus-591	172	32	serologic	serologic	NOUN
finefocus-591	172	33	survey	survey	NOUN
finefocus-591	172	34	.	.	PUNCT
finefocus-591	173	1	vet	vet	NOUN
finefocus-591	173	2	.	.	PUNCT
finefocus-591	174	1	parasitol	parasitol	NOUN
finefocus-591	174	2	.	.	PUNCT
finefocus-591	175	1	160	160	NUM
finefocus-591	175	2	:	:	PUNCT
finefocus-591	175	3	138	138	NUM
finefocus-591	175	4	-	-	SYM
finefocus-591	175	5	148	148	NUM
finefocus-591	175	6	.	.	PUNCT
finefocus-591	176	1	7	7	X
finefocus-591	176	2	.	.	X
finefocus-591	176	3	burgess	burgess	PROPN
finefocus-591	176	4	,	,	PUNCT
finefocus-591	176	5	e.	e.	PROPN
finefocus-591	176	6	c.	c.	PROPN
finefocus-591	176	7	,	,	PUNCT
finefocus-591	176	8	&	&	CCONJ
finefocus-591	176	9	windberg	windberg	PROPN
finefocus-591	176	10	,	,	PUNCT
finefocus-591	176	11	l.	l.	PROPN
finefocus-591	176	12	a.	a.	PROPN
finefocus-591	176	13	1989	1989	NUM
finefocus-591	176	14	.	.	PUNCT
finefocus-591	177	1	borrelia	borrelia	PROPN
finefocus-591	177	2	sp	sp	NOUN
finefocus-591	177	3	.	.	PUNCT
finefocus-591	177	4	infection	infection	NOUN
finefocus-591	177	5	in	in	ADP
finefocus-591	177	6	coyotes	coyote	NOUN
finefocus-591	177	7	,	,	PUNCT
finefocus-591	177	8	black	black	NOUN
finefocus-591	177	9	-	-	PUNCT
finefocus-591	177	10	tailed	tail	VERB
finefocus-591	177	11	jack	jack	NOUN
finefocus-591	177	12	rabbits	rabbit	NOUN
finefocus-591	177	13	and	and	CCONJ
finefocus-591	177	14	desert	desert	NOUN
finefocus-591	177	15	cottontails	cottontail	NOUN
finefocus-591	177	16	in	in	ADP
finefocus-591	177	17	southern	southern	PROPN
finefocus-591	177	18	texas	texas	PROPN
finefocus-591	177	19	.	.	PUNCT
finefocus-591	178	1	j.	j.	PROPN
finefocus-591	178	2	wildlife	wildlife	PROPN
finefocus-591	178	3	dis	dis	PROPN
finefocus-591	178	4	.	.	PUNCT
finefocus-591	179	1	25	25	NUM
finefocus-591	179	2	:	:	PUNCT
finefocus-591	179	3	47	47	NUM
finefocus-591	179	4	-	-	SYM
finefocus-591	179	5	51	51	NUM
finefocus-591	179	6	.	.	NOUN
finefocus-591	179	7	8	8	NUM
finefocus-591	179	8	.	.	PUNCT
finefocus-591	180	1	centers	center	NOUN
finefocus-591	180	2	for	for	ADP
finefocus-591	180	3	disease	disease	NOUN
finefocus-591	180	4	control	control	NOUN
finefocus-591	180	5	and	and	CCONJ
finefocus-591	180	6	prevention	prevention	NOUN
finefocus-591	180	7	.	.	PUNCT
finefocus-591	181	1	2014	2014	NUM
finefocus-591	181	2	.	.	PUNCT
finefocus-591	182	1	summary	summary	NOUN
finefocus-591	182	2	of	of	ADP
finefocus-591	182	3	notifiable	notifiable	ADJ
finefocus-591	182	4	diseases	disease	NOUN
finefocus-591	182	5	,	,	PUNCT
finefocus-591	182	6	united	united	PROPN
finefocus-591	182	7	states	states	PROPN
finefocus-591	182	8	,	,	PUNCT
finefocus-591	182	9	2012	2012	NUM
finefocus-591	182	10	.	.	PUNCT
finefocus-591	183	1	mmwr	mmwr	ADJ
finefocus-591	183	2	morb	morb	NOUN
finefocus-591	183	3	.	.	PUNCT
finefocus-591	184	1	mortal	mortal	ADJ
finefocus-591	184	2	.	.	PUNCT
finefocus-591	185	1	wkly	wkly	PROPN
finefocus-591	185	2	.	.	PUNCT
finefocus-591	186	1	rep	rep	PROPN
finefocus-591	186	2	.	.	PROPN
finefocus-591	186	3	,	,	PUNCT
finefocus-591	186	4	61	61	NUM
finefocus-591	186	5	(	(	PUNCT
finefocus-591	186	6	no	no	NOUN
finefocus-591	186	7	.	.	NOUN
finefocus-591	186	8	53	53	NUM
finefocus-591	186	9	):	):	PUNCT
finefocus-591	186	10	25	25	NUM
finefocus-591	186	11	.	.	NOUN
finefocus-591	186	12	9	9	NUM
finefocus-591	186	13	.	.	X
finefocus-591	186	14	cohen	cohen	PROPN
finefocus-591	186	15	,	,	PUNCT
finefocus-591	186	16	n.	n.	PROPN
finefocus-591	186	17	d.	d.	PROPN
finefocus-591	186	18	,	,	PUNCT
finefocus-591	186	19	carter	carter	PROPN
finefocus-591	186	20	,	,	PUNCT
finefocus-591	186	21	c.	c.	PROPN
finefocus-591	186	22	n.	n.	PROPN
finefocus-591	186	23	,	,	PUNCT
finefocus-591	186	24	thomas	thomas	PROPN
finefocus-591	186	25	jr	jr	PROPN
finefocus-591	186	26	,	,	PUNCT
finefocus-591	186	27	m.	m.	NOUN
finefocus-591	186	28	a.	a.	PROPN
finefocus-591	186	29	,	,	PUNCT
finefocus-591	186	30	angulo	angulo	PROPN
finefocus-591	186	31	,	,	PUNCT
finefocus-591	186	32	a.	a.	PROPN
finefocus-591	186	33	b.	b.	PROPN
finefocus-591	186	34	,	,	PUNCT
finefocus-591	186	35	&	&	CCONJ
finefocus-591	186	36	eugster	eugster	PROPN
finefocus-591	186	37	,	,	PUNCT
finefocus-591	186	38	a.	a.	PROPN
finefocus-591	186	39	k.	k.	PROPN
finefocus-591	186	40	1990	1990	NUM
finefocus-591	186	41	.	.	PUNCT
finefocus-591	187	1	clinical	clinical	ADJ
finefocus-591	187	2	and	and	CCONJ
finefocus-591	187	3	epizootiologic	epizootiologic	ADJ
finefocus-591	187	4	characteristics	characteristic	NOUN
finefocus-591	187	5	of	of	ADP
finefocus-591	187	6	dogs	dog	NOUN
finefocus-591	187	7	seropositive	seropositive	ADJ
finefocus-591	187	8	for	for	ADP
finefocus-591	187	9	borrelia	borrelia	ADJ
finefocus-591	187	10	burgdorferi	burgdorferi	NOUN
finefocus-591	187	11	in	in	ADP
finefocus-591	187	12	texas	texas	PROPN
finefocus-591	187	13	:	:	PUNCT
finefocus-591	187	14	110	110	NUM
finefocus-591	187	15	cases	case	NOUN
finefocus-591	187	16	(	(	PUNCT
finefocus-591	187	17	1988	1988	NUM
finefocus-591	187	18	)	)	PUNCT
finefocus-591	187	19	.	.	PUNCT
finefocus-591	188	1	j.	j.	PROPN
finefocus-591	188	2	am	am	PROPN
finefocus-591	188	3	.	.	PUNCT
finefocus-591	189	1	vet	vet	NOUN
finefocus-591	189	2	.	.	PUNCT
finefocus-591	190	1	med	med	PROPN
finefocus-591	190	2	.	.	PROPN
finefocus-591	190	3	assoc	assoc	PROPN
finefocus-591	190	4	.	.	PUNCT
finefocus-591	191	1	197	197	NUM
finefocus-591	191	2	:	:	SYM
finefocus-591	191	3	893	893	NUM
finefocus-591	191	4	-	-	SYM
finefocus-591	191	5	898	898	NUM
finefocus-591	191	6	.	.	PUNCT
finefocus-591	191	7	pmid:2228777	pmid:2228777	NOUN
finefocus-591	191	8	10	10	NUM
finefocus-591	191	9	.	.	PUNCT
finefocus-591	192	1	cooley	cooley	PROPN
finefocus-591	192	2	,	,	PUNCT
finefocus-591	192	3	r.a	r.a	PROPN
finefocus-591	192	4	.	.	PROPN
finefocus-591	192	5	1946	1946	NUM
finefocus-591	192	6	.	.	PUNCT
finefocus-591	193	1	the	the	DET
finefocus-591	193	2	genera	genera	NOUN
finefocus-591	193	3	boophilus	boophilus	NOUN
finefocus-591	193	4	,	,	PUNCT
finefocus-591	193	5	rhipicephalus	rhipicephalus	ADJ
finefocus-591	193	6	and	and	CCONJ
finefocus-591	193	7	haemaphysalis	haemaphysalis	PROPN
finefocus-591	193	8	(	(	PUNCT
finefocus-591	193	9	ixodidae	ixodidae	NOUN
finefocus-591	193	10	)	)	PUNCT
finefocus-591	193	11	of	of	ADP
finefocus-591	193	12	the	the	DET
finefocus-591	193	13	new	new	ADJ
finefocus-591	193	14	world	world	NOUN
finefocus-591	193	15	.	.	PUNCT
finefocus-591	194	1	natl	natl	PROPN
finefocus-591	194	2	.	.	PUNCT
finefocus-591	194	3	inst	inst	PROPN
finefocus-591	194	4	.	.	PUNCT
finefocus-591	195	1	health	health	NOUN
finefocus-591	195	2	bull	bull	NOUN
finefocus-591	195	3	.	.	PUNCT
finefocus-591	196	1	187:1	187:1	NUM
finefocus-591	196	2	-	-	SYM
finefocus-591	196	3	54	54	NUM
finefocus-591	196	4	.	.	PUNCT
finefocus-591	197	1	11	11	NUM
finefocus-591	197	2	.	.	X
finefocus-591	198	1	curtis	curtis	PROPN
finefocus-591	198	2	,	,	PUNCT
finefocus-591	198	3	j.	j.	PROPN
finefocus-591	198	4	r.	r.	PROPN
finefocus-591	198	5	1993	1993	NUM
finefocus-591	198	6	.	.	PUNCT
finefocus-591	199	1	central	central	ADJ
finefocus-591	199	2	business	business	NOUN
finefocus-591	199	3	districts	district	NOUN
finefocus-591	199	4	of	of	ADP
finefocus-591	199	5	the	the	DET
finefocus-591	199	6	two	two	NUM
finefocus-591	199	7	laredos	laredo	NOUN
finefocus-591	199	8	.	.	PUNCT
finefocus-591	200	1	geographical	geographical	ADJ
finefocus-591	200	2	review	review	NOUN
finefocus-591	200	3	.	.	PUNCT
finefocus-591	201	1	83	83	NUM
finefocus-591	201	2	:	:	PUNCT
finefocus-591	201	3	54	54	NUM
finefocus-591	201	4	-	-	SYM
finefocus-591	201	5	65	65	NUM
finefocus-591	201	6	12	12	NUM
finefocus-591	201	7	.	.	PUNCT
finefocus-591	202	1	dambach	dambach	NOUN
finefocus-591	202	2	,	,	PUNCT
finefocus-591	202	3	d.	d.	PROPN
finefocus-591	202	4	m.	m.	PROPN
finefocus-591	202	5	,	,	PUNCT
finefocus-591	202	6	smith	smith	PROPN
finefocus-591	202	7	,	,	PUNCT
finefocus-591	202	8	c.	c.	PROPN
finefocus-591	202	9	a.	a.	PROPN
finefocus-591	202	10	,	,	PUNCT
finefocus-591	202	11	lewis	lewis	PROPN
finefocus-591	202	12	,	,	PUNCT
finefocus-591	202	13	r.	r.	PROPN
finefocus-591	202	14	m.	m.	PROPN
finefocus-591	202	15	,	,	PUNCT
finefocus-591	202	16	&	&	CCONJ
finefocus-591	202	17	van	van	PROPN
finefocus-591	202	18	winkle	winkle	PROPN
finefocus-591	202	19	,	,	PUNCT
finefocus-591	202	20	t.	t.	PROPN
finefocus-591	202	21	j.	j.	PROPN
finefocus-591	202	22	1997	1997	NUM
finefocus-591	202	23	.	.	PUNCT
finefocus-591	203	1	morphologic	morphologic	ADJ
finefocus-591	203	2	,	,	PUNCT
finefocus-591	203	3	immunohistochemical	immunohistochemical	ADJ
finefocus-591	203	4	,	,	PUNCT
finefocus-591	203	5	and	and	CCONJ
finefocus-591	203	6	ultrastructural	ultrastructural	ADJ
finefocus-591	203	7	characterization	characterization	NOUN
finefocus-591	203	8	of	of	ADP
finefocus-591	203	9	a	a	DET
finefocus-591	203	10	distinctive	distinctive	ADJ
finefocus-591	203	11	renal	renal	ADJ
finefocus-591	203	12	lesion	lesion	NOUN
finefocus-591	203	13	in	in	ADP
finefocus-591	203	14	dogs	dog	NOUN
finefocus-591	203	15	putatively	putatively	ADV
finefocus-591	203	16	associated	associate	VERB
finefocus-591	203	17	with	with	ADP
finefocus-591	203	18	borrelia	borrelia	ADJ
finefocus-591	203	19	burgdorferi	burgdorferi	ADJ
finefocus-591	203	20	infection	infection	NOUN
finefocus-591	203	21	:	:	PUNCT
finefocus-591	203	22	49	49	NUM
finefocus-591	203	23	cases	case	NOUN
finefocus-591	203	24	(	(	PUNCT
finefocus-591	203	25	1987	1987	NUM
finefocus-591	203	26	-	-	SYM
finefocus-591	203	27	1992	1992	NUM
finefocus-591	203	28	)	)	PUNCT
finefocus-591	203	29	.	.	PUNCT
finefocus-591	204	1	vet	vet	NOUN
finefocus-591	204	2	.	.	PUNCT
finefocus-591	204	3	pathol	pathol	PROPN
finefocus-591	204	4	.	.	PUNCT
finefocus-591	205	1	online	online	INTJ
finefocus-591	205	2	.	.	PUNCT
finefocus-591	206	1	34	34	NUM
finefocus-591	206	2	:	:	SYM
finefocus-591	206	3	85	85	NUM
finefocus-591	206	4	-	-	SYM
finefocus-591	206	5	96	96	NUM
finefocus-591	206	6	.	.	NOUN
finefocus-591	207	1	13	13	NUM
finefocus-591	207	2	.	.	PUNCT
finefocus-591	208	1	dantas	danta	NOUN
finefocus-591	208	2	-	-	PUNCT
finefocus-591	208	3	torres	torre	NOUN
finefocus-591	208	4	,	,	PUNCT
finefocus-591	208	5	f.	f.	PROPN
finefocus-591	208	6	2010	2010	NUM
finefocus-591	208	7	.	.	PUNCT
finefocus-591	209	1	biology	biology	NOUN
finefocus-591	209	2	and	and	CCONJ
finefocus-591	209	3	ecology	ecology	NOUN
finefocus-591	209	4	of	of	ADP
finefocus-591	209	5	the	the	DET
finefocus-591	209	6	brown	brown	ADJ
finefocus-591	209	7	dog	dog	NOUN
finefocus-591	209	8	tick	tick	NOUN
finefocus-591	209	9	,	,	PUNCT
finefocus-591	209	10	rhipicephalus	rhipicephalus	ADJ
finefocus-591	209	11	sanguineus	sanguineus	PROPN
finefocus-591	209	12	.	.	PUNCT
finefocus-591	210	1	parasit	parasit	PROPN
finefocus-591	210	2	.	.	PUNCT
finefocus-591	211	1	vectors	vector	NOUN
finefocus-591	211	2	.	.	PUNCT
finefocus-591	212	1	3:26	3:26	NUM
finefocus-591	212	2	.	.	PUNCT
finefocus-591	212	3	doi:10.1186/1756	doi:10.1186/1756	NOUN
finefocus-591	212	4	-	-	PUNCT
finefocus-591	212	5	3305	3305	NUM
finefocus-591	212	6	-	-	PUNCT
finefocus-591	212	7	3	3	NUM
finefocus-591	212	8	-	-	SYM
finefocus-591	212	9	26	26	NUM
finefocus-591	212	10	14	14	NUM
finefocus-591	212	11	.	.	PUNCT
finefocus-591	213	1	dantas	danta	NOUN
finefocus-591	213	2	-	-	PUNCT
finefocus-591	213	3	torres	torre	NOUN
finefocus-591	213	4	,	,	PUNCT
finefocus-591	213	5	f.	f.	PROPN
finefocus-591	213	6	,	,	PUNCT
finefocus-591	213	7	chomel	chomel	PROPN
finefocus-591	213	8	,	,	PUNCT
finefocus-591	213	9	b.	b.	PROPN
finefocus-591	213	10	b.	b.	PROPN
finefocus-591	213	11	,	,	PUNCT
finefocus-591	213	12	&	&	CCONJ
finefocus-591	213	13	otranto	otranto	PROPN
finefocus-591	213	14	,	,	PUNCT
finefocus-591	213	15	d.	d.	PROPN
finefocus-591	213	16	2012	2012	NUM
finefocus-591	213	17	.	.	PUNCT
finefocus-591	214	1	ticks	tick	NOUN
finefocus-591	214	2	and	and	CCONJ
finefocus-591	214	3	tick	tick	NOUN
finefocus-591	214	4	-	-	PUNCT
finefocus-591	214	5	borne	bear	VERB
finefocus-591	214	6	diseases	disease	NOUN
finefocus-591	214	7	:	:	PUNCT
finefocus-591	214	8	a	a	DET
finefocus-591	214	9	one	one	NUM
finefocus-591	214	10	health	health	NOUN
finefocus-591	214	11	perspective	perspective	NOUN
finefocus-591	214	12	.	.	PUNCT
finefocus-591	215	1	trends	trend	NOUN
finefocus-591	215	2	parasitol	parasitol	NOUN
finefocus-591	215	3	.	.	PUNCT
finefocus-591	216	1	28	28	NUM
finefocus-591	216	2	:	:	PUNCT
finefocus-591	216	3	437	437	NUM
finefocus-591	216	4	-	-	SYM
finefocus-591	216	5	446	446	NUM
finefocus-591	216	6	.	.	PUNCT
finefocus-591	217	1	doi:10.1016	doi:10.1016	PROPN
finefocus-591	217	2	/	/	SYM
finefocus-591	217	3	j.pt.2012.07.003	j.pt.2012.07.003	PROPN
finefocus-591	217	4	15	15	NUM
finefocus-591	217	5	.	.	PUNCT
finefocus-591	218	1	darriba	darriba	PROPN
finefocus-591	218	2	,	,	PUNCT
finefocus-591	218	3	d.	d.	PROPN
finefocus-591	218	4	,	,	PUNCT
finefocus-591	218	5	taboada	taboada	PROPN
finefocus-591	218	6	,	,	PUNCT
finefocus-591	218	7	g.l	g.l	PROPN
finefocus-591	218	8	.	.	PROPN
finefocus-591	218	9	,	,	PUNCT
finefocus-591	218	10	doalla	doalla	PROPN
finefocus-591	218	11	,	,	PUNCT
finefocus-591	218	12	r.	r.	PROPN
finefocus-591	218	13	&	&	CCONJ
finefocus-591	218	14	posada	posada	PROPN
finefocus-591	218	15	,	,	PUNCT
finefocus-591	218	16	d.	d.	PROPN
finefocus-591	218	17	2012	2012	NUM
finefocus-591	218	18	.	.	PUNCT
finefocus-591	219	1	jmodeltest	jmodelt	ADJ
finefocus-591	220	1	2	2	NUM
finefocus-591	220	2	:	:	PUNCT
finefocus-591	220	3	more	more	ADJ
finefocus-591	220	4	models	model	NOUN
finefocus-591	220	5	,	,	PUNCT
finefocus-591	220	6	new	new	ADJ
finefocus-591	220	7	heuristics	heuristic	NOUN
finefocus-591	220	8	and	and	CCONJ
finefocus-591	220	9	parallel	parallel	ADJ
finefocus-591	220	10	computing	computing	NOUN
finefocus-591	220	11	.	.	PUNCT
finefocus-591	221	1	nat	nat	PROPN
finefocus-591	221	2	.	.	PUNCT
finefocus-591	222	1	methods	method	NOUN
finefocus-591	222	2	.	.	PUNCT
finefocus-591	223	1	9	9	NUM
finefocus-591	223	2	:	:	SYM
finefocus-591	223	3	772	772	NUM
finefocus-591	223	4	.	.	NOUN
finefocus-591	224	1	16	16	NUM
finefocus-591	224	2	.	.	PUNCT
finefocus-591	225	1	edgar	edgar	PROPN
finefocus-591	225	2	,	,	PUNCT
finefocus-591	225	3	r.c	r.c	PROPN
finefocus-591	225	4	.	.	PROPN
finefocus-591	225	5	2004	2004	NUM
finefocus-591	225	6	.	.	PUNCT
finefocus-591	226	1	muscle	muscle	NOUN
finefocus-591	226	2	:	:	PUNCT
finefocus-591	226	3	multiple	multiple	ADJ
finefocus-591	226	4	sequence	sequence	NOUN
finefocus-591	226	5	alignment	alignment	NOUN
finefocus-591	226	6	with	with	ADP
finefocus-591	226	7	high	high	ADJ
finefocus-591	226	8	accuracy	accuracy	NOUN
finefocus-591	226	9	and	and	CCONJ
finefocus-591	226	10	high	high	ADJ
finefocus-591	226	11	throughput	throughput	NOUN
finefocus-591	226	12	.	.	PUNCT
finefocus-591	227	1	nucleic	nucleic	ADJ
finefocus-591	227	2	acids	acid	NOUN
finefocus-591	227	3	res	re	NOUN
finefocus-591	227	4	.	.	PUNCT
finefocus-591	228	1	32	32	NUM
finefocus-591	228	2	:	:	SYM
finefocus-591	229	1	1792	1792	NUM
finefocus-591	229	2	-	-	SYM
finefocus-591	229	3	1797	1797	NUM
finefocus-591	229	4	17	17	NUM
finefocus-591	229	5	.	.	PUNCT
finefocus-591	229	6	falco	falco	PROPN
finefocus-591	229	7	,	,	PUNCT
finefocus-591	229	8	r.	r.	PROPN
finefocus-591	229	9	c.	c.	PROPN
finefocus-591	229	10	&	&	CCONJ
finefocus-591	229	11	fish	fish	PROPN
finefocus-591	229	12	,	,	PUNCT
finefocus-591	229	13	d.	d.	PROPN
finefocus-591	229	14	1988	1988	NUM
finefocus-591	229	15	.	.	PUNCT
finefocus-591	230	1	ticks	tick	NOUN
finefocus-591	230	2	parasitizing	parasitize	VERB
finefocus-591	230	3	humans	human	NOUN
finefocus-591	230	4	in	in	ADP
finefocus-591	230	5	a	a	DET
finefocus-591	230	6	lyme	lyme	NOUN
finefocus-591	230	7	disease	disease	NOUN
finefocus-591	230	8	endemic	endemic	ADJ
finefocus-591	230	9	area	area	NOUN
finefocus-591	230	10	of	of	ADP
finefocus-591	230	11	southern	southern	ADJ
finefocus-591	230	12	new	new	PROPN
finefocus-591	230	13	york	york	PROPN
finefocus-591	230	14	state	state	PROPN
finefocus-591	230	15	.	.	PUNCT
finefocus-591	231	1	am	be	AUX
finefocus-591	231	2	.	.	PUNCT
finefocus-591	232	1	j.	j.	PROPN
finefocus-591	232	2	epidemiol	epidemiol	PROPN
finefocus-591	232	3	.	.	PUNCT
finefocus-591	233	1	128	128	NUM
finefocus-591	233	2	:	:	PUNCT
finefocus-591	233	3	11461152	11461152	NUM
finefocus-591	233	4	.	.	PUNCT
finefocus-591	234	1	18	18	NUM
finefocus-591	234	2	.	.	X
finefocus-591	234	3	felz	felz	PROPN
finefocus-591	234	4	,	,	PUNCT
finefocus-591	234	5	m.	m.	PROPN
finefocus-591	234	6	w.	w.	PROPN
finefocus-591	234	7	,	,	PUNCT
finefocus-591	234	8	durden	durden	PROPN
finefocus-591	234	9	,	,	PUNCT
finefocus-591	234	10	l.	l.	PROPN
finefocus-591	234	11	a.	a.	PROPN
finefocus-591	234	12	,	,	PUNCT
finefocus-591	234	13	&	&	CCONJ
finefocus-591	234	14	oliver	oliver	PROPN
finefocus-591	234	15	jr	jr	PROPN
finefocus-591	234	16	,	,	PUNCT
finefocus-591	234	17	j.	j.	PROPN
finefocus-591	234	18	h.	h.	PROPN
finefocus-591	234	19	1996	1996	NUM
finefocus-591	234	20	.	.	PUNCT
finefocus-591	235	1	ticks	tick	NOUN
finefocus-591	235	2	parasitizing	parasitize	VERB
finefocus-591	235	3	humans	human	NOUN
finefocus-591	235	4	in	in	ADP
finefocus-591	235	5	georgia	georgia	PROPN
finefocus-591	235	6	and	and	CCONJ
finefocus-591	235	7	south	south	PROPN
finefocus-591	235	8	carolina	carolina	PROPN
finefocus-591	235	9	.	.	PUNCT
finefocus-591	236	1	j.	j.	PROPN
finefocus-591	236	2	parasitol	parasitol	PROPN
finefocus-591	236	3	.	.	PUNCT
finefocus-591	237	1	505	505	NUM
finefocus-591	237	2	-	-	SYM
finefocus-591	237	3	508	508	NUM
finefocus-591	237	4	.	.	PUNCT
finefocus-591	238	1	19	19	NUM
finefocus-591	238	2	.	.	PUNCT
finefocus-591	238	3	feria	feria	NOUN
finefocus-591	238	4	-	-	PUNCT
finefocus-591	238	5	arroyo	arroyo	NOUN
finefocus-591	238	6	,	,	PUNCT
finefocus-591	238	7	t.	t.	PROPN
finefocus-591	238	8	p.	p.	PROPN
finefocus-591	238	9	,	,	PUNCT
finefocus-591	238	10	castro	castro	PROPN
finefocus-591	238	11	-	-	PUNCT
finefocus-591	238	12	arellano	arellano	PROPN
finefocus-591	238	13	,	,	PUNCT
finefocus-591	238	14	i.	i.	PROPN
finefocus-591	238	15	,	,	PUNCT
finefocus-591	238	16	gordilloperez	gordilloperez	PROPN
finefocus-591	238	17	,	,	PUNCT
finefocus-591	238	18	g.	g.	PROPN
finefocus-591	238	19	,	,	PUNCT
finefocus-591	238	20	cavazos	cavazos	PROPN
finefocus-591	238	21	,	,	PUNCT
finefocus-591	238	22	a.	a.	PROPN
finefocus-591	238	23	l.	l.	PROPN
finefocus-591	238	24	,	,	PUNCT
finefocus-591	238	25	vargas	vargas	NOUN
finefocus-591	238	26	-	-	PUNCT
finefocus-591	238	27	sandoval	sandoval	NOUN
finefocus-591	238	28	,	,	PUNCT
finefocus-591	238	29	m.	m.	NOUN
finefocus-591	238	30	,	,	PUNCT
finefocus-591	238	31	grover	grover	PROPN
finefocus-591	238	32	,	,	PUNCT
finefocus-591	238	33	a.	a.	PROPN
finefocus-591	238	34	,	,	PUNCT
finefocus-591	238	35	torres	torre	NOUN
finefocus-591	238	36	,	,	PUNCT
finefocus-591	238	37	j.	j.	PROPN
finefocus-591	238	38	,	,	PUNCT
finefocus-591	238	39	medina	medina	PROPN
finefocus-591	238	40	,	,	PUNCT
finefocus-591	238	41	r.	r.	PROPN
finefocus-591	238	42	,	,	PUNCT
finefocus-591	238	43	perez	perez	PROPN
finefocus-591	238	44	de	de	PROPN
finefocus-591	238	45	león	león	PROPN
finefocus-591	238	46	,	,	PUNCT
finefocus-591	238	47	a.	a.	PROPN
finefocus-591	238	48	a.	a.	PROPN
finefocus-591	238	49	&	&	CCONJ
finefocus-591	238	50	esteve	esteve	PROPN
finefocus-591	238	51	-	-	PROPN
finefocus-591	238	52	gassent	gassent	NOUN
finefocus-591	238	53	,	,	PUNCT
finefocus-591	238	54	m.	m.	NOUN
finefocus-591	238	55	d.	d.	PROPN
finefocus-591	238	56	2014	2014	NUM
finefocus-591	238	57	.	.	PUNCT
finefocus-591	239	1	implications	implication	NOUN
finefocus-591	239	2	of	of	ADP
finefocus-591	239	3	climate	climate	NOUN
finefocus-591	239	4	change	change	NOUN
finefocus-591	239	5	on	on	ADP
finefocus-591	239	6	the	the	DET
finefocus-591	239	7	distribution	distribution	NOUN
finefocus-591	239	8	of	of	ADP
finefocus-591	239	9	the	the	DET
finefocus-591	239	10	tick	tick	NOUN
finefocus-591	239	11	vector	vector	NOUN
finefocus-591	239	12	ixodes	ixode	NOUN
finefocus-591	239	13	scapularis	scapularis	NOUN
finefocus-591	239	14	and	and	CCONJ
finefocus-591	239	15	risk	risk	NOUN
finefocus-591	239	16	for	for	ADP
finefocus-591	239	17	lyme	lyme	NOUN
finefocus-591	239	18	disease	disease	NOUN
finefocus-591	239	19	in	in	ADP
finefocus-591	239	20	the	the	DET
finefocus-591	239	21	texas	texas	PROPN
finefocus-591	239	22	-	-	PUNCT
finefocus-591	239	23	mexico	mexico	PROPN
finefocus-591	239	24	transboundary	transboundary	ADJ
finefocus-591	239	25	region	region	NOUN
finefocus-591	239	26	.	.	PUNCT
finefocus-591	240	1	parasit	parasit	PROPN
finefocus-591	240	2	.	.	PUNCT
finefocus-591	241	1	vectors	vector	NOUN
finefocus-591	241	2	.	.	PUNCT
finefocus-591	242	1	7:1	7:1	NUM
finefocus-591	242	2	,	,	PUNCT
finefocus-591	242	3	199	199	NUM
finefocus-591	242	4	.	.	NOUN
finefocus-591	242	5	20	20	NUM
finefocus-591	242	6	.	.	PUNCT
finefocus-591	243	1	goddard	goddard	PROPN
finefocus-591	243	2	,	,	PUNCT
finefocus-591	243	3	j.	j.	PROPN
finefocus-591	243	4	1989	1989	NUM
finefocus-591	243	5	.	.	PUNCT
finefocus-591	244	1	focus	focus	NOUN
finefocus-591	244	2	of	of	ADP
finefocus-591	244	3	human	human	ADJ
finefocus-591	244	4	parasitism	parasitism	NOUN
finefocus-591	244	5	by	by	ADP
finefocus-591	244	6	the	the	DET
finefocus-591	244	7	brown	brown	ADJ
finefocus-591	244	8	dog	dog	NOUN
finefocus-591	244	9	tick	tick	NOUN
finefocus-591	244	10	,	,	PUNCT
finefocus-591	244	11	rhipicephalus	rhipicephalus	ADJ
finefocus-591	244	12	sanguineus	sanguineus	NOUN
finefocus-591	244	13	(	(	PUNCT
finefocus-591	244	14	acari	acari	ADJ
finefocus-591	244	15	:	:	PUNCT
finefocus-591	244	16	ixodidae	ixodidae	NOUN
finefocus-591	244	17	)	)	PUNCT
finefocus-591	244	18	.	.	PUNCT
finefocus-591	245	1	j.	j.	PROPN
finefocus-591	245	2	med	med	PROPN
finefocus-591	245	3	.	.	PUNCT
finefocus-591	245	4	entomol	entomol	PROPN
finefocus-591	245	5	.	.	PUNCT
finefocus-591	246	1	26	26	NUM
finefocus-591	246	2	:	:	PUNCT
finefocus-591	246	3	628	628	NUM
finefocus-591	246	4	-	-	SYM
finefocus-591	246	5	631	631	NUM
finefocus-591	246	6	.	.	PUNCT
finefocus-591	247	1	doi:10.1093/	doi:10.1093/	VERB
finefocus-591	247	2	jmedent/26.6.628	jmedent/26.6.628	PROPN
finefocus-591	247	3	21	21	NUM
finefocus-591	247	4	.	.	PUNCT
finefocus-591	248	1	gordillo	gordillo	NOUN
finefocus-591	248	2	-	-	PUNCT
finefocus-591	248	3	pérez	pérez	NOUN
finefocus-591	248	4	,	,	PUNCT
finefocus-591	248	5	g.	g.	PROPN
finefocus-591	248	6	,	,	PUNCT
finefocus-591	248	7	vargas	vargas	NOUN
finefocus-591	248	8	,	,	PUNCT
finefocus-591	248	9	m.	m.	NOUN
finefocus-591	248	10	,	,	PUNCT
finefocus-591	248	11	solórzano	solórzano	NOUN
finefocus-591	248	12	-	-	PUNCT
finefocus-591	248	13	santos	santo	NOUN
finefocus-591	248	14	,	,	PUNCT
finefocus-591	248	15	f.	f.	PROPN
finefocus-591	248	16	,	,	PUNCT
finefocus-591	248	17	rivera	rivera	PROPN
finefocus-591	248	18	,	,	PUNCT
finefocus-591	248	19	a.	a.	NOUN
finefocus-591	248	20	,	,	PUNCT
finefocus-591	248	21	polaco	polaco	NOUN
finefocus-591	248	22	,	,	PUNCT
finefocus-591	248	23	o.	o.	PROPN
finefocus-591	248	24	j.	j.	PROPN
finefocus-591	248	25	,	,	PUNCT
finefocus-591	248	26	alvarado	alvarado	PROPN
finefocus-591	248	27	,	,	PUNCT
finefocus-591	248	28	l.	l.	PROPN
finefocus-591	248	29	&	&	CCONJ
finefocus-591	248	30	torres	torres	PROPN
finefocus-591	248	31	,	,	PUNCT
finefocus-591	248	32	j.	j.	PROPN
finefocus-591	248	33	2009	2009	NUM
finefocus-591	248	34	.	.	PUNCT
finefocus-591	249	1	demonstration	demonstration	NOUN
finefocus-591	249	2	of	of	ADP
finefocus-591	249	3	borrelia	borrelia	ADJ
finefocus-591	249	4	burgdorferi	burgdorferi	ADJ
finefocus-591	249	5	sensu	sensu	NOUN
finefocus-591	249	6	stricto	stricto	PROPN
finefocus-591	249	7	infection	infection	NOUN
finefocus-591	249	8	in	in	ADP
finefocus-591	249	9	ticks	tick	NOUN
finefocus-591	249	10	from	from	ADP
finefocus-591	249	11	the	the	DET
finefocus-591	249	12	northeast	northeast	NOUN
finefocus-591	249	13	of	of	ADP
finefocus-591	249	14	mexico	mexico	PROPN
finefocus-591	249	15	.	.	PUNCT
finefocus-591	250	1	clin	clin	PROPN
finefocus-591	250	2	.	.	PUNCT
finefocus-591	251	1	microbiol	microbiol	PROPN
finefocus-591	251	2	.	.	PUNCT
finefocus-591	252	1	infect	infect	VERB
finefocus-591	252	2	.	.	PUNCT
finefocus-591	253	1	15	15	NUM
finefocus-591	253	2	:	:	PUNCT
finefocus-591	253	3	496	496	NUM
finefocus-591	253	4	-	-	SYM
finefocus-591	253	5	498	498	NUM
finefocus-591	253	6	.	.	PUNCT
finefocus-591	254	1	doi:10.1111	doi:10.1111	PROPN
finefocus-591	254	2	/	/	SYM
finefocus-591	254	3	j.14690691.2009.02776.x	j.14690691.2009.02776.x	PROPN
finefocus-591	254	4	22	22	NUM
finefocus-591	254	5	.	.	PUNCT
finefocus-591	255	1	gray	gray	ADJ
finefocus-591	255	2	,	,	PUNCT
finefocus-591	255	3	j.	j.	PROPN
finefocus-591	255	4	,	,	PUNCT
finefocus-591	255	5	dantas	danta	NOUN
finefocus-591	255	6	-	-	PUNCT
finefocus-591	255	7	torres	torre	NOUN
finefocus-591	255	8	,	,	PUNCT
finefocus-591	255	9	f.	f.	PROPN
finefocus-591	255	10	,	,	PUNCT
finefocus-591	255	11	estrada	estrada	PROPN
finefocus-591	255	12	-	-	PUNCT
finefocus-591	255	13	peña	peña	PROPN
finefocus-591	255	14	,	,	PUNCT
finefocus-591	255	15	a.	a.	NOUN
finefocus-591	255	16	,	,	PUNCT
finefocus-591	255	17	&	&	CCONJ
finefocus-591	255	18	levin	levin	PROPN
finefocus-591	255	19	,	,	PUNCT
finefocus-591	255	20	m.	m.	NOUN
finefocus-591	255	21	2013	2013	NUM
finefocus-591	255	22	.	.	PUNCT
finefocus-591	256	1	systematics	systematic	NOUN
finefocus-591	256	2	and	and	CCONJ
finefocus-591	256	3	ecology	ecology	NOUN
finefocus-591	256	4	of	of	ADP
finefocus-591	256	5	the	the	DET
finefocus-591	256	6	brown	brown	ADJ
finefocus-591	256	7	dog	dog	NOUN
finefocus-591	256	8	tick	tick	NOUN
finefocus-591	256	9	,	,	PUNCT
finefocus-591	256	10	rhipicephalus	rhipicephalus	ADJ
finefocus-591	256	11	sanguineus	sanguineus	NOUN
finefocus-591	256	12	.	.	PUNCT
finefocus-591	257	1	ticks	tick	NOUN
finefocus-591	257	2	tick	tick	NOUN
finefocus-591	257	3	-	-	PUNCT
finefocus-591	257	4	borne	bear	VERB
finefocus-591	257	5	dis	di	NOUN
finefocus-591	257	6	.	.	PUNCT
finefocus-591	258	1	4	4	NUM
finefocus-591	258	2	:	:	SYM
finefocus-591	258	3	171	171	NUM
finefocus-591	258	4	-	-	SYM
finefocus-591	258	5	180	180	NUM
finefocus-591	258	6	.	.	PUNCT
finefocus-591	259	1	doi:10.1016	doi:10.1016	PROPN
finefocus-591	259	2	/	/	SYM
finefocus-591	259	3	j.ttbdis.2012.12.003	j.ttbdis.2012.12.003	PROPN
finefocus-591	259	4	23	23	NUM
finefocus-591	259	5	.	.	PUNCT
finefocus-591	260	1	groves	grove	NOUN
finefocus-591	260	2	,	,	PUNCT
finefocus-591	260	3	m.	m.	NOUN
finefocus-591	260	4	g.	g.	PROPN
finefocus-591	260	5	,	,	PUNCT
finefocus-591	260	6	dennis	dennis	PROPN
finefocus-591	260	7	,	,	PUNCT
finefocus-591	260	8	g.	g.	PROPN
finefocus-591	260	9	l.	l.	PROPN
finefocus-591	260	10	,	,	PUNCT
finefocus-591	260	11	amyx	amyx	PROPN
finefocus-591	260	12	,	,	PUNCT
finefocus-591	260	13	h.	h.	PROPN
finefocus-591	260	14	l.	l.	PROPN
finefocus-591	260	15	,	,	PUNCT
finefocus-591	260	16	&	&	CCONJ
finefocus-591	260	17	huxsoll	huxsoll	PROPN
finefocus-591	260	18	,	,	PUNCT
finefocus-591	260	19	d.	d.	PROPN
finefocus-591	260	20	l.	l.	PROPN
finefocus-591	260	21	1975	1975	NUM
finefocus-591	260	22	.	.	PUNCT
finefocus-591	261	1	transmission	transmission	NOUN
finefocus-591	261	2	of	of	ADP
finefocus-591	261	3	ehrlichia	ehrlichia	PRON
finefocus-591	261	4	canis	canis	NOUN
finefocus-591	261	5	to	to	ADP
finefocus-591	261	6	dogs	dog	NOUN
finefocus-591	261	7	by	by	ADP
finefocus-591	261	8	ticks	tick	NOUN
finefocus-591	261	9	(	(	PUNCT
finefocus-591	261	10	rhipicephalus	rhipicephalus	ADJ
finefocus-591	261	11	sanguineus	sanguineus	PROPN
finefocus-591	261	12	)	)	PUNCT
finefocus-591	261	13	.	.	PUNCT
finefocus-591	262	1	am	be	AUX
finefocus-591	262	2	.	.	PUNCT
finefocus-591	263	1	j.	j.	PROPN
finefocus-591	263	2	vet	vet	PROPN
finefocus-591	263	3	.	.	PUNCT
finefocus-591	264	1	res	re	NOUN
finefocus-591	264	2	.	.	PUNCT
finefocus-591	265	1	36:7	36:7	NUM
finefocus-591	265	2	,	,	PUNCT
finefocus-591	265	3	937	937	NUM
finefocus-591	265	4	-	-	SYM
finefocus-591	265	5	940	940	NUM
finefocus-591	265	6	.	.	PUNCT
finefocus-591	266	1	pmid:1147359	pmid:1147359	NOUN
finefocus-591	266	2	24	24	NUM
finefocus-591	266	3	.	.	PUNCT
finefocus-591	267	1	heymann	heymann	PROPN
finefocus-591	267	2	,	,	PUNCT
finefocus-591	267	3	w.	w.	PROPN
finefocus-591	267	4	r.	r.	PROPN
finefocus-591	267	5	,	,	PUNCT
finefocus-591	267	6	&	&	CCONJ
finefocus-591	267	7	ellis	ellis	PROPN
finefocus-591	267	8	,	,	PUNCT
finefocus-591	267	9	d.	d.	PROPN
finefocus-591	267	10	l.	l.	PROPN
finefocus-591	267	11	2012	2012	NUM
finefocus-591	267	12	.	.	PUNCT
finefocus-591	268	1	borrelia	borrelia	NOUN
finefocus-591	268	2	burgdorferi	burgdorferi	ADJ
finefocus-591	268	3	infections	infection	NOUN
finefocus-591	268	4	in	in	ADP
finefocus-591	268	5	the	the	DET
finefocus-591	268	6	united	united	PROPN
finefocus-591	268	7	states	states	PROPN
finefocus-591	268	8	.	.	PUNCT
finefocus-591	269	1	j.	j.	PROPN
finefocus-591	269	2	clin	clin	PROPN
finefocus-591	269	3	.	.	PUNCT
finefocus-591	270	1	aesthetic	aesthetic	ADJ
finefocus-591	270	2	derm	derm	NOUN
finefocus-591	270	3	.	.	PUNCT
finefocus-591	271	1	5	5	NUM
finefocus-591	271	2	:	:	SYM
finefocus-591	271	3	18	18	NUM
finefocus-591	271	4	-	-	SYM
finefocus-591	271	5	28	28	NUM
finefocus-591	271	6	.	.	PUNCT
finefocus-591	272	1	pmcid	pmcid	NOUN
finefocus-591	272	2	:	:	PUNCT
finefocus-591	272	3	pmc3424593	pmc3424593	NOUN
finefocus-591	272	4	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	272	5	119	119	NUM
finefocus-591	273	1	9/25/15	9/25/15	NUM
finefocus-591	273	2	11:38	11:38	NUM
finefocus-591	273	3	am	be	AUX
finefocus-591	273	4	120	120	NUM
finefocus-591	273	5	•	•	NUM
finefocus-591	273	6	fine	fine	ADJ
finefocus-591	273	7	focus	focus	NOUN
finefocus-591	273	8	,	,	PUNCT
finefocus-591	273	9	vol	vol	NOUN
finefocus-591	273	10	.	.	NOUN
finefocus-591	273	11	1	1	NUM
finefocus-591	273	12	(	(	PUNCT
finefocus-591	273	13	2	2	NUM
finefocus-591	273	14	)	)	PUNCT
finefocus-591	273	15	25	25	NUM
finefocus-591	273	16	.	.	PUNCT
finefocus-591	274	1	hildebrandt	hildebrandt	PROPN
finefocus-591	274	2	,	,	PUNCT
finefocus-591	274	3	p.	p.	PROPN
finefocus-591	274	4	k.	k.	PROPN
finefocus-591	274	5	,	,	PUNCT
finefocus-591	274	6	huxsoll	huxsoll	PROPN
finefocus-591	274	7	,	,	PUNCT
finefocus-591	274	8	d.	d.	PROPN
finefocus-591	274	9	l.	l.	PROPN
finefocus-591	274	10	,	,	PUNCT
finefocus-591	274	11	walker	walker	PROPN
finefocus-591	274	12	,	,	PUNCT
finefocus-591	274	13	j.	j.	PROPN
finefocus-591	274	14	s.	s.	PROPN
finefocus-591	274	15	,	,	PUNCT
finefocus-591	274	16	nims	nims	PROPN
finefocus-591	274	17	,	,	PUNCT
finefocus-591	274	18	r.	r.	PROPN
finefocus-591	274	19	m.	m.	PROPN
finefocus-591	274	20	,	,	PUNCT
finefocus-591	274	21	taylor	taylor	PROPN
finefocus-591	274	22	,	,	PUNCT
finefocus-591	274	23	r.	r.	PROPN
finefocus-591	274	24	,	,	PUNCT
finefocus-591	274	25	&	&	CCONJ
finefocus-591	274	26	andrews	andrews	PROPN
finefocus-591	274	27	,	,	PUNCT
finefocus-591	274	28	m.	m.	NOUN
finefocus-591	274	29	1973	1973	NUM
finefocus-591	274	30	.	.	PUNCT
finefocus-591	275	1	pathology	pathology	NOUN
finefocus-591	275	2	of	of	ADP
finefocus-591	275	3	canine	canine	PROPN
finefocus-591	275	4	ehrlichiosis	ehrlichiosis	PROPN
finefocus-591	275	5	(	(	PUNCT
finefocus-591	275	6	tropical	tropical	ADJ
finefocus-591	275	7	canine	canine	NOUN
finefocus-591	275	8	pancytopenia	pancytopenia	PROPN
finefocus-591	275	9	)	)	PUNCT
finefocus-591	275	10	.	.	PUNCT
finefocus-591	276	1	am	be	AUX
finefocus-591	276	2	.	.	PUNCT
finefocus-591	277	1	j.	j.	PROPN
finefocus-591	277	2	vet	vet	PROPN
finefocus-591	277	3	.	.	PUNCT
finefocus-591	278	1	res	re	NOUN
finefocus-591	278	2	.	.	PUNCT
finefocus-591	279	1	34	34	NUM
finefocus-591	279	2	:	:	PUNCT
finefocus-591	279	3	1309	1309	NUM
finefocus-591	279	4	-	-	SYM
finefocus-591	279	5	1320	1320	NUM
finefocus-591	279	6	.	.	PUNCT
finefocus-591	280	1	26	26	NUM
finefocus-591	280	2	.	.	X
finefocus-591	280	3	jongejan	jongejan	PROPN
finefocus-591	280	4	,	,	PUNCT
finefocus-591	280	5	f.	f.	PROPN
finefocus-591	280	6	,	,	PUNCT
finefocus-591	280	7	&	&	CCONJ
finefocus-591	280	8	uilenberg	uilenberg	PROPN
finefocus-591	280	9	,	,	PUNCT
finefocus-591	280	10	g.	g.	PROPN
finefocus-591	280	11	2004	2004	NUM
finefocus-591	280	12	.	.	PUNCT
finefocus-591	281	1	the	the	DET
finefocus-591	281	2	global	global	ADJ
finefocus-591	281	3	importance	importance	NOUN
finefocus-591	281	4	of	of	ADP
finefocus-591	281	5	ticks	tick	NOUN
finefocus-591	281	6	.	.	PUNCT
finefocus-591	282	1	parasitology	parasitology	NOUN
finefocus-591	282	2	.	.	PUNCT
finefocus-591	283	1	129	129	NUM
finefocus-591	283	2	:	:	PUNCT
finefocus-591	283	3	s3	s3	NOUN
finefocus-591	283	4	-	-	PUNCT
finefocus-591	283	5	s14	s14	NOUN
finefocus-591	283	6	.	.	PUNCT
finefocus-591	284	1	doi:10.1017	doi:10.1017	PROPN
finefocus-591	284	2	/	/	SYM
finefocus-591	284	3	s0031182004005967	s0031182004005967	PROPN
finefocus-591	284	4	27	27	NUM
finefocus-591	284	5	.	.	PUNCT
finefocus-591	285	1	kornblatt	kornblatt	PROPN
finefocus-591	285	2	,	,	PUNCT
finefocus-591	285	3	a.	a.	NOUN
finefocus-591	285	4	n.	n.	PROPN
finefocus-591	285	5	,	,	PUNCT
finefocus-591	285	6	urband	urband	PROPN
finefocus-591	285	7	,	,	PUNCT
finefocus-591	285	8	p.	p.	PROPN
finefocus-591	285	9	h.	h.	PROPN
finefocus-591	285	10	,	,	PUNCT
finefocus-591	285	11	&	&	CCONJ
finefocus-591	285	12	steere	steere	PROPN
finefocus-591	285	13	,	,	PUNCT
finefocus-591	285	14	a.	a.	PROPN
finefocus-591	285	15	c.	c.	PROPN
finefocus-591	285	16	1985	1985	NUM
finefocus-591	285	17	.	.	PUNCT
finefocus-591	286	1	arthritis	arthritis	NOUN
finefocus-591	286	2	caused	cause	VERB
finefocus-591	286	3	by	by	ADP
finefocus-591	286	4	borrelia	borrelia	NOUN
finefocus-591	286	5	burgdorferi	burgdorferi	NOUN
finefocus-591	286	6	in	in	ADP
finefocus-591	286	7	dogs	dog	NOUN
finefocus-591	286	8	.	.	PUNCT
finefocus-591	287	1	j.	j.	PROPN
finefocus-591	287	2	am	am	PROPN
finefocus-591	287	3	.	.	PUNCT
finefocus-591	288	1	vet	vet	NOUN
finefocus-591	288	2	.	.	PUNCT
finefocus-591	289	1	med	med	PROPN
finefocus-591	289	2	.	.	PROPN
finefocus-591	289	3	assoc	assoc	PROPN
finefocus-591	289	4	.	.	PUNCT
finefocus-591	290	1	186	186	NUM
finefocus-591	290	2	:	:	PUNCT
finefocus-591	290	3	960	960	NUM
finefocus-591	290	4	-	-	SYM
finefocus-591	290	5	964	964	NUM
finefocus-591	290	6	.	.	PUNCT
finefocus-591	291	1	28	28	NUM
finefocus-591	291	2	.	.	PUNCT
finefocus-591	292	1	lemon	lemon	NOUN
finefocus-591	292	2	,	,	PUNCT
finefocus-591	292	3	s.	s.	PROPN
finefocus-591	292	4	m.	m.	PROPN
finefocus-591	292	5	,	,	PUNCT
finefocus-591	292	6	sparling	sparling	NOUN
finefocus-591	292	7	,	,	PUNCT
finefocus-591	292	8	p.	p.	PROPN
finefocus-591	292	9	f.	f.	PROPN
finefocus-591	292	10	,	,	PUNCT
finefocus-591	292	11	hamburg	hamburg	PROPN
finefocus-591	292	12	,	,	PUNCT
finefocus-591	292	13	m.	m.	NOUN
finefocus-591	292	14	a.	a.	PROPN
finefocus-591	292	15	,	,	PUNCT
finefocus-591	292	16	relman	relman	NOUN
finefocus-591	292	17	,	,	PUNCT
finefocus-591	292	18	d.	d.	PROPN
finefocus-591	292	19	a.	a.	PROPN
finefocus-591	292	20	,	,	PUNCT
finefocus-591	292	21	choffnes	choffnes	PROPN
finefocus-591	292	22	,	,	PUNCT
finefocus-591	292	23	e.	e.	PROPN
finefocus-591	292	24	r.	r.	PROPN
finefocus-591	292	25	,	,	PUNCT
finefocus-591	292	26	mack	mack	PROPN
finefocus-591	292	27	,	,	PUNCT
finefocus-591	292	28	a.	a.	PROPN
finefocus-591	292	29	,	,	PUNCT
finefocus-591	292	30	&	&	CCONJ
finefocus-591	292	31	sparling	sparling	PROPN
finefocus-591	292	32	,	,	PUNCT
finefocus-591	292	33	f.	f.	PROPN
finefocus-591	292	34	2008	2008	NUM
finefocus-591	292	35	.	.	PUNCT
finefocus-591	293	1	vector	vector	NOUN
finefocus-591	293	2	-	-	PUNCT
finefocus-591	293	3	borne	borne	ADJ
finefocus-591	293	4	diseases	disease	NOUN
finefocus-591	293	5	:	:	PUNCT
finefocus-591	293	6	understanding	understand	VERB
finefocus-591	293	7	the	the	DET
finefocus-591	293	8	environmental	environmental	ADJ
finefocus-591	293	9	,	,	PUNCT
finefocus-591	293	10	human	human	ADJ
finefocus-591	293	11	health	health	NOUN
finefocus-591	293	12	,	,	PUNCT
finefocus-591	293	13	and	and	CCONJ
finefocus-591	293	14	ecological	ecological	ADJ
finefocus-591	293	15	connections	connection	NOUN
finefocus-591	293	16	.	.	PUNCT
finefocus-591	294	1	workshop	workshop	NOUN
finefocus-591	294	2	summary	summary	NOUN
finefocus-591	294	3	.	.	PUNCT
finefocus-591	295	1	national	national	PROPN
finefocus-591	295	2	academies	academies	PROPN
finefocus-591	295	3	press	press	PROPN
finefocus-591	295	4	.	.	PUNCT
finefocus-591	296	1	isbn:0	isbn:0	NOUN
finefocus-591	296	2	-	-	PUNCT
finefocus-591	296	3	309	309	NUM
finefocus-591	296	4	-	-	PUNCT
finefocus-591	296	5	10897	10897	NUM
finefocus-591	296	6	-	-	SYM
finefocus-591	296	7	7	7	NUM
finefocus-591	296	8	29	29	NUM
finefocus-591	296	9	.	.	PUNCT
finefocus-591	297	1	mead	mead	PROPN
finefocus-591	297	2	p.	p.	PROPN
finefocus-591	297	3	,	,	PUNCT
finefocus-591	297	4	goel	goel	PROPN
finefocus-591	297	5	r.	r.	PROPN
finefocus-591	297	6	&	&	CCONJ
finefocus-591	297	7	kugeler	kugeler	PROPN
finefocus-591	297	8	k.	k.	PROPN
finefocus-591	297	9	2011	2011	NUM
finefocus-591	297	10	.	.	PUNCT
finefocus-591	298	1	canine	canine	NOUN
finefocus-591	298	2	serology	serology	NOUN
finefocus-591	298	3	as	as	SCONJ
finefocus-591	298	4	adjunct	adjunct	ADJ
finefocus-591	298	5	to	to	ADP
finefocus-591	298	6	human	human	ADJ
finefocus-591	298	7	lyme	lyme	NOUN
finefocus-591	298	8	disease	disease	NOUN
finefocus-591	298	9	surveillance	surveillance	NOUN
finefocus-591	298	10	.	.	PUNCT
finefocus-591	299	1	emerg	emerg	PROPN
finefocus-591	299	2	infect	infect	PROPN
finefocus-591	299	3	dis	dis	PROPN
finefocus-591	299	4	.	.	PUNCT
finefocus-591	300	1	17	17	NUM
finefocus-591	300	2	:	:	PUNCT
finefocus-591	300	3	1710	1710	NUM
finefocus-591	300	4	-	-	SYM
finefocus-591	300	5	1712	1712	NUM
finefocus-591	300	6	.	.	PUNCT
finefocus-591	301	1	doi	doi	NOUN
finefocus-591	301	2	:	:	PUNCT
finefocus-591	301	3	http://dx.doi	http://dx.doi	NOUN
finefocus-591	301	4	.	.	PUNCT
finefocus-591	302	1	org/10.3201/1709.110210	org/10.3201/1709.110210	PROPN
finefocus-591	302	2	30	30	NUM
finefocus-591	302	3	.	.	PUNCT
finefocus-591	303	1	medlin	medlin	PROPN
finefocus-591	303	2	,	,	PUNCT
finefocus-591	303	3	j.s	j.s	PROPN
finefocus-591	303	4	.	.	PROPN
finefocus-591	303	5	,	,	PUNCT
finefocus-591	303	6	cohen	cohen	PROPN
finefocus-591	303	7	,	,	PUNCT
finefocus-591	303	8	j.i	j.i	PROPN
finefocus-591	303	9	.	.	PROPN
finefocus-591	303	10	&	&	CCONJ
finefocus-591	303	11	beck	beck	PROPN
finefocus-591	303	12	,	,	PUNCT
finefocus-591	303	13	d.l	d.l	PROPN
finefocus-591	303	14	.	.	PROPN
finefocus-591	303	15	2015	2015	NUM
finefocus-591	303	16	.	.	PUNCT
finefocus-591	304	1	vector	vector	NOUN
finefocus-591	304	2	potential	potential	NOUN
finefocus-591	304	3	and	and	CCONJ
finefocus-591	304	4	population	population	NOUN
finefocus-591	304	5	dynamics	dynamic	NOUN
finefocus-591	304	6	for	for	ADP
finefocus-591	304	7	amblyomma	amblyomma	PROPN
finefocus-591	304	8	inornatum	inornatum	PROPN
finefocus-591	304	9	.	.	PUNCT
finefocus-591	305	1	ticks	tick	VERB
finefocus-591	305	2	tick	tick	NOUN
finefocus-591	305	3	-	-	PUNCT
finefocus-591	305	4	born	bear	VERB
finefocus-591	305	5	dis	dis	NOUN
finefocus-591	305	6	.	.	PUNCT
finefocus-591	306	1	6:463	6:463	NUM
finefocus-591	306	2	-	-	SYM
finefocus-591	306	3	472	472	NUM
finefocus-591	306	4	.	.	PUNCT
finefocus-591	307	1	doi:10.1016	doi:10.1016	PROPN
finefocus-591	307	2	/	/	SYM
finefocus-591	307	3	j.ttbdis.2015.03.014	j.ttbdis.2015.03.014	PROPN
finefocus-591	307	4	31	31	NUM
finefocus-591	307	5	.	.	PUNCT
finefocus-591	308	1	ndip	ndip	PROPN
finefocus-591	308	2	,	,	PUNCT
finefocus-591	308	3	l.	l.	PROPN
finefocus-591	308	4	m.	m.	PROPN
finefocus-591	308	5	,	,	PUNCT
finefocus-591	308	6	ndip	ndip	PROPN
finefocus-591	308	7	,	,	PUNCT
finefocus-591	308	8	r.	r.	PROPN
finefocus-591	308	9	n.	n.	PROPN
finefocus-591	308	10	,	,	PUNCT
finefocus-591	308	11	ndive	ndive	PROPN
finefocus-591	308	12	,	,	PUNCT
finefocus-591	308	13	v.	v.	PROPN
finefocus-591	308	14	e.	e.	PROPN
finefocus-591	308	15	,	,	PUNCT
finefocus-591	308	16	awuh	awuh	PROPN
finefocus-591	308	17	,	,	PUNCT
finefocus-591	308	18	j.	j.	PROPN
finefocus-591	308	19	a.	a.	PROPN
finefocus-591	308	20	,	,	PUNCT
finefocus-591	308	21	walker	walker	PROPN
finefocus-591	308	22	,	,	PUNCT
finefocus-591	308	23	d.	d.	PROPN
finefocus-591	308	24	h.	h.	PROPN
finefocus-591	308	25	,	,	PUNCT
finefocus-591	308	26	&	&	CCONJ
finefocus-591	308	27	mcbride	mcbride	PROPN
finefocus-591	308	28	,	,	PUNCT
finefocus-591	308	29	j.	j.	PROPN
finefocus-591	308	30	w.	w.	PROPN
finefocus-591	308	31	2007	2007	NUM
finefocus-591	308	32	.	.	PUNCT
finefocus-591	309	1	ehrlichia	ehrlichia	VERB
finefocus-591	309	2	species	specie	NOUN
finefocus-591	309	3	in	in	ADP
finefocus-591	309	4	rhipicephalus	rhipicephalus	ADJ
finefocus-591	309	5	sanguineus	sanguineus	NOUN
finefocus-591	309	6	ticks	tick	NOUN
finefocus-591	309	7	in	in	ADP
finefocus-591	309	8	cameroon	cameroon	NOUN
finefocus-591	309	9	.	.	PUNCT
finefocus-591	310	1	vectorborne	vectorborne	PROPN
finefocus-591	310	2	zoonotic	zoonotic	PROPN
finefocus-591	310	3	dis	dis	PROPN
finefocus-591	310	4	.	.	PUNCT
finefocus-591	311	1	7	7	NUM
finefocus-591	311	2	:	:	SYM
finefocus-591	311	3	221	221	NUM
finefocus-591	311	4	-	-	SYM
finefocus-591	311	5	227	227	NUM
finefocus-591	311	6	.	.	PUNCT
finefocus-591	311	7	doi:10.1089	doi:10.1089	NOUN
finefocus-591	311	8	/	/	SYM
finefocus-591	311	9	vbz.2006.0608	vbz.2006.0608	NOUN
finefocus-591	311	10	32	32	NUM
finefocus-591	311	11	.	.	PUNCT
finefocus-591	312	1	parola	parola	NOUN
finefocus-591	312	2	,	,	PUNCT
finefocus-591	312	3	p.	p.	NOUN
finefocus-591	312	4	,	,	PUNCT
finefocus-591	312	5	&	&	CCONJ
finefocus-591	312	6	raoult	raoult	PROPN
finefocus-591	312	7	,	,	PUNCT
finefocus-591	312	8	d.	d.	PROPN
finefocus-591	312	9	2001	2001	NUM
finefocus-591	312	10	.	.	PUNCT
finefocus-591	313	1	ticks	tick	NOUN
finefocus-591	313	2	and	and	CCONJ
finefocus-591	313	3	tickborne	tickborne	VERB
finefocus-591	313	4	bacterial	bacterial	ADJ
finefocus-591	313	5	diseases	disease	NOUN
finefocus-591	313	6	in	in	ADP
finefocus-591	313	7	humans	human	NOUN
finefocus-591	313	8	:	:	PUNCT
finefocus-591	313	9	an	an	DET
finefocus-591	313	10	emerging	emerge	VERB
finefocus-591	313	11	infectious	infectious	ADJ
finefocus-591	313	12	threat	threat	NOUN
finefocus-591	313	13	.	.	PUNCT
finefocus-591	314	1	clin	clin	PROPN
finefocus-591	314	2	.	.	PUNCT
finefocus-591	315	1	infect	infect	VERB
finefocus-591	315	2	.	.	PUNCT
finefocus-591	316	1	dis	dis	PROPN
finefocus-591	316	2	.	.	PUNCT
finefocus-591	317	1	32	32	NUM
finefocus-591	317	2	:	:	PUNCT
finefocus-591	317	3	897	897	NUM
finefocus-591	317	4	-	-	SYM
finefocus-591	317	5	928	928	NUM
finefocus-591	317	6	.	.	PUNCT
finefocus-591	318	1	doi	doi	NOUN
finefocus-591	318	2	:	:	PUNCT
finefocus-591	318	3	10.1086/319347	10.1086/319347	NUM
finefocus-591	318	4	33	33	NUM
finefocus-591	318	5	.	.	PUNCT
finefocus-591	319	1	perez	perez	PROPN
finefocus-591	319	2	,	,	PUNCT
finefocus-591	319	3	m.	m.	NOUN
finefocus-591	319	4	,	,	PUNCT
finefocus-591	319	5	bodor	bodor	PROPN
finefocus-591	319	6	,	,	PUNCT
finefocus-591	319	7	m.	m.	NOUN
finefocus-591	319	8	,	,	PUNCT
finefocus-591	319	9	zhang	zhang	PROPN
finefocus-591	319	10	,	,	PUNCT
finefocus-591	319	11	c.	c.	PROPN
finefocus-591	319	12	,	,	PUNCT
finefocus-591	319	13	xiong	xiong	PROPN
finefocus-591	319	14	,	,	PUNCT
finefocus-591	319	15	q.	q.	PROPN
finefocus-591	319	16	,	,	PUNCT
finefocus-591	319	17	&	&	CCONJ
finefocus-591	319	18	rikihisa	rikihisa	NOUN
finefocus-591	319	19	,	,	PUNCT
finefocus-591	319	20	y.	y.	PROPN
finefocus-591	319	21	2006	2006	NUM
finefocus-591	319	22	.	.	PUNCT
finefocus-591	320	1	human	human	ADJ
finefocus-591	320	2	infection	infection	NOUN
finefocus-591	320	3	with	with	ADP
finefocus-591	320	4	ehrlichia	ehrlichia	ADJ
finefocus-591	320	5	canis	canis	NOUN
finefocus-591	320	6	accompanied	accompany	VERB
finefocus-591	320	7	by	by	ADP
finefocus-591	320	8	clinical	clinical	ADJ
finefocus-591	320	9	signs	sign	NOUN
finefocus-591	320	10	in	in	ADP
finefocus-591	320	11	venezuela	venezuela	PROPN
finefocus-591	320	12	.	.	PUNCT
finefocus-591	321	1	ann	ann	PROPN
finefocus-591	321	2	.	.	PUNCT
finefocus-591	321	3	ny	ny	PROPN
finefocus-591	321	4	.	.	PROPN
finefocus-591	321	5	acad	acad	PROPN
finefocus-591	321	6	.	.	PUNCT
finefocus-591	322	1	sci	sci	PROPN
finefocus-591	322	2	.	.	PROPN
finefocus-591	322	3	1078	1078	NUM
finefocus-591	322	4	:	:	PUNCT
finefocus-591	322	5	110	110	NUM
finefocus-591	322	6	-	-	SYM
finefocus-591	322	7	117	117	NUM
finefocus-591	322	8	.	.	PUNCT
finefocus-591	323	1	doi/10.1196/	doi/10.1196/	NOUN
finefocus-591	323	2	annals.1374.016	annals.1374.016	PROPN
finefocus-591	323	3	34	34	NUM
finefocus-591	323	4	.	.	PUNCT
finefocus-591	324	1	piesman	piesman	PROPN
finefocus-591	324	2	,	,	PUNCT
finefocus-591	324	3	j.	j.	PROPN
finefocus-591	324	4	&	&	CCONJ
finefocus-591	324	5	sinsky	sinsky	PROPN
finefocus-591	324	6	,	,	PUNCT
finefocus-591	324	7	r.	r.	PROPN
finefocus-591	324	8	j.	j.	PROPN
finefocus-591	324	9	1988	1988	NUM
finefocus-591	324	10	.	.	PUNCT
finefocus-591	325	1	ability	ability	NOUN
finefocus-591	325	2	of	of	ADP
finefocus-591	325	3	ixodes	ixode	NOUN
finefocus-591	325	4	scapularis	scapularis	PROPN
finefocus-591	325	5	,	,	PUNCT
finefocus-591	325	6	dermacentor	dermacentor	NOUN
finefocus-591	325	7	variabilis	variabilis	PROPN
finefocus-591	325	8	,	,	PUNCT
finefocus-591	325	9	and	and	CCONJ
finefocus-591	325	10	amblyomma	amblyomma	PROPN
finefocus-591	325	11	americanum	americanum	PROPN
finefocus-591	325	12	(	(	PUNCT
finefocus-591	325	13	acari	acari	ADJ
finefocus-591	325	14	:	:	PUNCT
finefocus-591	325	15	ixodidae	ixodidae	NOUN
finefocus-591	325	16	)	)	PUNCT
finefocus-591	325	17	to	to	PART
finefocus-591	325	18	acquire	acquire	VERB
finefocus-591	325	19	,	,	PUNCT
finefocus-591	325	20	maintain	maintain	VERB
finefocus-591	325	21	,	,	PUNCT
finefocus-591	325	22	and	and	CCONJ
finefocus-591	325	23	transmit	transmit	VERB
finefocus-591	325	24	lyme	lyme	NOUN
finefocus-591	325	25	disease	disease	NOUN
finefocus-591	325	26	spirochetes	spirochete	NOUN
finefocus-591	325	27	(	(	PUNCT
finefocus-591	325	28	borrelia	borrelia	NOUN
finefocus-591	325	29	burgdorferi	burgdorferi	NOUN
finefocus-591	325	30	)	)	PUNCT
finefocus-591	325	31	.	.	PUNCT
finefocus-591	326	1	j.	j.	PROPN
finefocus-591	326	2	med	med	PROPN
finefocus-591	326	3	.	.	PUNCT
finefocus-591	326	4	entomol	entomol	PROPN
finefocus-591	326	5	.	.	PUNCT
finefocus-591	327	1	25	25	NUM
finefocus-591	327	2	:	:	PUNCT
finefocus-591	327	3	336	336	NUM
finefocus-591	327	4	-	-	SYM
finefocus-591	327	5	339	339	NUM
finefocus-591	327	6	.	.	PUNCT
finefocus-591	328	1	doi:10.1093	doi:10.1093	NOUN
finefocus-591	328	2	/	/	SYM
finefocus-591	328	3	jmedent/25.5.336	jmedent/25.5.336	PROPN
finefocus-591	328	4	35	35	NUM
finefocus-591	328	5	.	.	PUNCT
finefocus-591	329	1	reardon	reardon	PROPN
finefocus-591	329	2	,	,	PUNCT
finefocus-591	329	3	m.	m.	NOUN
finefocus-591	329	4	j.	j.	PROPN
finefocus-591	329	5	,	,	PUNCT
finefocus-591	329	6	&	&	CCONJ
finefocus-591	329	7	pierce	pierce	PROPN
finefocus-591	329	8	,	,	PUNCT
finefocus-591	329	9	k.	k.	PROPN
finefocus-591	329	10	r.	r.	PROPN
finefocus-591	329	11	1981	1981	NUM
finefocus-591	329	12	.	.	PUNCT
finefocus-591	330	1	acute	acute	PROPN
finefocus-591	330	2	experimental	experimental	PROPN
finefocus-591	330	3	canine	canine	PROPN
finefocus-591	330	4	ehrlichiosis	ehrlichiosis	PROPN
finefocus-591	330	5	i.	i.	PROPN
finefocus-591	330	6	sequential	sequential	PROPN
finefocus-591	330	7	reaction	reaction	NOUN
finefocus-591	330	8	of	of	ADP
finefocus-591	330	9	the	the	DET
finefocus-591	330	10	hemic	hemic	ADJ
finefocus-591	330	11	and	and	CCONJ
finefocus-591	330	12	lymphoreticular	lymphoreticular	ADJ
finefocus-591	330	13	systems	system	NOUN
finefocus-591	330	14	.	.	PUNCT
finefocus-591	331	1	vet	vet	NOUN
finefocus-591	331	2	.	.	PUNCT
finefocus-591	331	3	pathol	pathol	PROPN
finefocus-591	331	4	.	.	PUNCT
finefocus-591	332	1	online	online	INTJ
finefocus-591	332	2	.	.	PUNCT
finefocus-591	333	1	18	18	NUM
finefocus-591	333	2	:	:	SYM
finefocus-591	333	3	48	48	NUM
finefocus-591	333	4	-	-	SYM
finefocus-591	333	5	61	61	NUM
finefocus-591	333	6	.	.	PUNCT
finefocus-591	334	1	36	36	NUM
finefocus-591	334	2	.	.	PUNCT
finefocus-591	335	1	ronquist	ronquist	PROPN
finefocus-591	335	2	,	,	PUNCT
finefocus-591	335	3	f.	f.	PROPN
finefocus-591	335	4	&	&	CCONJ
finefocus-591	335	5	huelsenbeck	huelsenbeck	PROPN
finefocus-591	335	6	,	,	PUNCT
finefocus-591	335	7	j.p	j.p	PROPN
finefocus-591	335	8	.	.	PROPN
finefocus-591	335	9	2003	2003	NUM
finefocus-591	335	10	.	.	PUNCT
finefocus-591	336	1	mrbayes	mrbaye	NOUN
finefocus-591	336	2	3	3	NUM
finefocus-591	336	3	:	:	PUNCT
finefocus-591	336	4	bayesian	bayesian	NOUN
finefocus-591	336	5	phylogenetic	phylogenetic	ADJ
finefocus-591	336	6	inference	inference	NOUN
finefocus-591	336	7	under	under	ADP
finefocus-591	336	8	mixed	mixed	ADJ
finefocus-591	336	9	models	model	NOUN
finefocus-591	336	10	.	.	PUNCT
finefocus-591	337	1	bioinform	bioinform	NOUN
finefocus-591	337	2	.	.	PUNCT
finefocus-591	338	1	19	19	NUM
finefocus-591	338	2	:	:	SYM
finefocus-591	338	3	1572	1572	NUM
finefocus-591	338	4	-	-	SYM
finefocus-591	338	5	1574	1574	NUM
finefocus-591	338	6	37	37	NUM
finefocus-591	338	7	.	.	PUNCT
finefocus-591	339	1	stafford	stafford	PROPN
finefocus-591	339	2	,	,	PUNCT
finefocus-591	339	3	k.	k.	PROPN
finefocus-591	339	4	c.	c.	PROPN
finefocus-591	339	5	,	,	PUNCT
finefocus-591	339	6	cartter	cartter	PROPN
finefocus-591	339	7	,	,	PUNCT
finefocus-591	339	8	m.	m.	NOUN
finefocus-591	339	9	l.	l.	PROPN
finefocus-591	339	10	,	,	PUNCT
finefocus-591	339	11	magnarelli	magnarelli	PROPN
finefocus-591	339	12	,	,	PUNCT
finefocus-591	339	13	l.	l.	PROPN
finefocus-591	339	14	a.	a.	PROPN
finefocus-591	339	15	,	,	PUNCT
finefocus-591	339	16	ertel	ertel	PROPN
finefocus-591	339	17	,	,	PUNCT
finefocus-591	339	18	s.	s.	PROPN
finefocus-591	339	19	h.	h.	PROPN
finefocus-591	339	20	,	,	PUNCT
finefocus-591	339	21	&	&	CCONJ
finefocus-591	339	22	mshar	mshar	PROPN
finefocus-591	339	23	,	,	PUNCT
finefocus-591	339	24	p.	p.	NOUN
finefocus-591	339	25	a.	a.	NOUN
finefocus-591	340	1	1998	1998	NUM
finefocus-591	340	2	.	.	PUNCT
finefocus-591	341	1	temporal	temporal	ADJ
finefocus-591	341	2	correlations	correlation	NOUN
finefocus-591	341	3	between	between	ADP
finefocus-591	341	4	tick	tick	NOUN
finefocus-591	341	5	abundance	abundance	NOUN
finefocus-591	341	6	and	and	CCONJ
finefocus-591	341	7	prevalence	prevalence	NOUN
finefocus-591	341	8	of	of	ADP
finefocus-591	341	9	ticks	tick	NOUN
finefocus-591	341	10	infected	infect	VERB
finefocus-591	341	11	with	with	ADP
finefocus-591	341	12	borrelia	borrelia	NOUN
finefocus-591	341	13	burgdorferi	burgdorferi	NOUN
finefocus-591	341	14	and	and	CCONJ
finefocus-591	341	15	increasing	increase	VERB
finefocus-591	341	16	incidence	incidence	NOUN
finefocus-591	341	17	of	of	ADP
finefocus-591	341	18	lyme	lyme	NOUN
finefocus-591	341	19	disease	disease	NOUN
finefocus-591	341	20	.	.	PUNCT
finefocus-591	342	1	j.	j.	PROPN
finefocus-591	342	2	clin	clin	PROPN
finefocus-591	342	3	.	.	PUNCT
finefocus-591	343	1	microbiol	microbiol	PROPN
finefocus-591	343	2	.	.	PUNCT
finefocus-591	344	1	36	36	NUM
finefocus-591	344	2	:	:	SYM
finefocus-591	344	3	1240	1240	NUM
finefocus-591	344	4	-	-	SYM
finefocus-591	344	5	1244	1244	NUM
finefocus-591	344	6	.	.	PUNCT
finefocus-591	345	1	38	38	NUM
finefocus-591	345	2	.	.	PUNCT
finefocus-591	345	3	steere	steere	PROPN
finefocus-591	345	4	,	,	PUNCT
finefocus-591	345	5	a.	a.	PROPN
finefocus-591	345	6	c.	c.	PROPN
finefocus-591	345	7	,	,	PUNCT
finefocus-591	345	8	coburn	coburn	PROPN
finefocus-591	345	9	,	,	PUNCT
finefocus-591	345	10	j.	j.	PROPN
finefocus-591	345	11	,	,	PUNCT
finefocus-591	345	12	&	&	CCONJ
finefocus-591	345	13	glickstein	glickstein	PROPN
finefocus-591	345	14	,	,	PUNCT
finefocus-591	345	15	l.	l.	PROPN
finefocus-591	345	16	2004	2004	NUM
finefocus-591	345	17	.	.	PUNCT
finefocus-591	346	1	the	the	DET
finefocus-591	346	2	emergence	emergence	NOUN
finefocus-591	346	3	of	of	ADP
finefocus-591	346	4	lyme	lyme	NOUN
finefocus-591	346	5	disease	disease	NOUN
finefocus-591	346	6	.	.	PUNCT
finefocus-591	347	1	j.	j.	PROPN
finefocus-591	347	2	clin	clin	PROPN
finefocus-591	347	3	.	.	PUNCT
finefocus-591	348	1	inv	inv	VERB
finefocus-591	348	2	.	.	PUNCT
finefocus-591	349	1	113	113	NUM
finefocus-591	349	2	:	:	PUNCT
finefocus-591	349	3	1093	1093	NUM
finefocus-591	349	4	-	-	SYM
finefocus-591	349	5	1101	1101	NUM
finefocus-591	349	6	.	.	PUNCT
finefocus-591	350	1	doi:10.1172	doi:10.1172	PROPN
finefocus-591	350	2	/	/	SYM
finefocus-591	350	3	jci21681	jci21681	PROPN
finefocus-591	350	4	39	39	NUM
finefocus-591	350	5	.	.	PUNCT
finefocus-591	351	1	steere	steere	PROPN
finefocus-591	351	2	,	,	PUNCT
finefocus-591	351	3	a.	a.	PROPN
finefocus-591	351	4	c.	c.	PROPN
finefocus-591	351	5	,	,	PUNCT
finefocus-591	351	6	&	&	CCONJ
finefocus-591	351	7	sikand	sikand	PROPN
finefocus-591	351	8	,	,	PUNCT
finefocus-591	351	9	v.	v.	PROPN
finefocus-591	351	10	k.	k.	PROPN
finefocus-591	351	11	2003	2003	NUM
finefocus-591	351	12	.	.	PUNCT
finefocus-591	352	1	the	the	DET
finefocus-591	352	2	presenting	present	VERB
finefocus-591	352	3	manifestations	manifestation	NOUN
finefocus-591	352	4	of	of	ADP
finefocus-591	352	5	lyme	lyme	NOUN
finefocus-591	352	6	disease	disease	NOUN
finefocus-591	352	7	and	and	CCONJ
finefocus-591	352	8	the	the	DET
finefocus-591	352	9	outcomes	outcome	NOUN
finefocus-591	352	10	of	of	ADP
finefocus-591	352	11	treatment	treatment	NOUN
finefocus-591	352	12	.	.	PUNCT
finefocus-591	353	1	new	new	PROPN
finefocus-591	353	2	england	england	PROPN
finefocus-591	353	3	j.	j.	PROPN
finefocus-591	353	4	med	med	PROPN
finefocus-591	353	5	.	.	PUNCT
finefocus-591	354	1	348	348	NUM
finefocus-591	354	2	:	:	PUNCT
finefocus-591	354	3	2472	2472	NUM
finefocus-591	354	4	-	-	SYM
finefocus-591	354	5	2474	2474	NUM
finefocus-591	354	6	.	.	PUNCT
finefocus-591	355	1	doi:10.1056	doi:10.1056	PROPN
finefocus-591	355	2	/	/	SYM
finefocus-591	355	3	nejm200306123482423	nejm200306123482423	PROPN
finefocus-591	355	4	40	40	NUM
finefocus-591	355	5	.	.	PUNCT
finefocus-591	356	1	stromdahl	stromdahl	PROPN
finefocus-591	356	2	,	,	PUNCT
finefocus-591	356	3	e.	e.	PROPN
finefocus-591	356	4	y.	y.	PROPN
finefocus-591	356	5	,	,	PUNCT
finefocus-591	356	6	williamson	williamson	PROPN
finefocus-591	356	7	,	,	PUNCT
finefocus-591	356	8	p.	p.	PROPN
finefocus-591	356	9	c.	c.	PROPN
finefocus-591	356	10	,	,	PUNCT
finefocus-591	356	11	kollars	kollar	NOUN
finefocus-591	356	12	,	,	PUNCT
finefocus-591	356	13	t.	t.	NOUN
finefocus-591	356	14	m.	m.	PROPN
finefocus-591	356	15	,	,	PUNCT
finefocus-591	356	16	evans	evans	PROPN
finefocus-591	356	17	,	,	PUNCT
finefocus-591	356	18	s.	s.	PROPN
finefocus-591	356	19	r.	r.	PROPN
finefocus-591	356	20	,	,	PUNCT
finefocus-591	356	21	barry	barry	PROPN
finefocus-591	356	22	,	,	PUNCT
finefocus-591	356	23	r.	r.	PROPN
finefocus-591	356	24	k.	k.	PROPN
finefocus-591	356	25	,	,	PUNCT
finefocus-591	356	26	vince	vince	PROPN
finefocus-591	356	27	,	,	PUNCT
finefocus-591	356	28	m.	m.	NOUN
finefocus-591	356	29	a.	a.	PROPN
finefocus-591	356	30	,	,	PUNCT
finefocus-591	356	31	&	&	CCONJ
finefocus-591	356	32	dobbs	dobbs	PROPN
finefocus-591	356	33	,	,	PUNCT
finefocus-591	356	34	n.	n.	PROPN
finefocus-591	356	35	a.	a.	PROPN
finefocus-591	356	36	2003	2003	NUM
finefocus-591	356	37	.	.	PUNCT
finefocus-591	357	1	evidence	evidence	NOUN
finefocus-591	357	2	of	of	ADP
finefocus-591	357	3	borrelia	borrelia	PROPN
finefocus-591	357	4	lonestari	lonestari	ADJ
finefocus-591	357	5	dna	dna	PROPN
finefocus-591	357	6	in	in	ADP
finefocus-591	357	7	amblyomma	amblyomma	PROPN
finefocus-591	357	8	americanum	americanum	PROPN
finefocus-591	357	9	(	(	PUNCT
finefocus-591	357	10	acari	acari	ADJ
finefocus-591	357	11	:	:	PUNCT
finefocus-591	357	12	ixodidae	ixodidae	NOUN
finefocus-591	357	13	)	)	PUNCT
finefocus-591	357	14	removed	remove	VERB
finefocus-591	357	15	from	from	ADP
finefocus-591	357	16	humans	human	NOUN
finefocus-591	357	17	.	.	PUNCT
finefocus-591	358	1	j.	j.	PROPN
finefocus-591	358	2	clin	clin	PROPN
finefocus-591	358	3	.	.	PUNCT
finefocus-591	359	1	microbiol	microbiol	PROPN
finefocus-591	359	2	.	.	PUNCT
finefocus-591	360	1	41	41	NUM
finefocus-591	360	2	:	:	SYM
finefocus-591	360	3	55575562	55575562	NUM
finefocus-591	360	4	.	.	PUNCT
finefocus-591	361	1	doi	doi	NOUN
finefocus-591	361	2	:	:	PUNCT
finefocus-591	361	3	10.1128	10.1128	NUM
finefocus-591	361	4	/	/	SYM
finefocus-591	361	5	jcm.41.12.5557	jcm.41.12.5557	NOUN
finefocus-591	361	6	-	-	PUNCT
finefocus-591	361	7	5562.2003	5562.2003	NOUN
finefocus-591	361	8	41	41	NUM
finefocus-591	361	9	.	.	PUNCT
finefocus-591	362	1	varela	varela	PROPN
finefocus-591	362	2	,	,	PUNCT
finefocus-591	362	3	a.	a.	PROPN
finefocus-591	362	4	s.	s.	PROPN
finefocus-591	362	5	,	,	PUNCT
finefocus-591	362	6	luttrell	luttrell	PROPN
finefocus-591	362	7	,	,	PUNCT
finefocus-591	362	8	m.	m.	NOUN
finefocus-591	362	9	p.	p.	PROPN
finefocus-591	362	10	,	,	PUNCT
finefocus-591	362	11	howerth	howerth	PROPN
finefocus-591	362	12	,	,	PUNCT
finefocus-591	362	13	e.	e.	PROPN
finefocus-591	362	14	w.	w.	PROPN
finefocus-591	362	15	,	,	PUNCT
finefocus-591	362	16	moore	moore	PROPN
finefocus-591	362	17	,	,	PUNCT
finefocus-591	362	18	v.	v.	PROPN
finefocus-591	362	19	a.	a.	PROPN
finefocus-591	362	20	,	,	PUNCT
finefocus-591	362	21	davidson	davidson	PROPN
finefocus-591	362	22	,	,	PUNCT
finefocus-591	362	23	w.	w.	PROPN
finefocus-591	362	24	r.	r.	PROPN
finefocus-591	362	25	,	,	PUNCT
finefocus-591	362	26	stallknecht	stallknecht	PROPN
finefocus-591	362	27	,	,	PUNCT
finefocus-591	362	28	d.	d.	PROPN
finefocus-591	362	29	e.	e.	PROPN
finefocus-591	362	30	,	,	PUNCT
finefocus-591	362	31	&	&	CCONJ
finefocus-591	362	32	little	little	ADJ
finefocus-591	362	33	,	,	PUNCT
finefocus-591	362	34	s.	s.	PROPN
finefocus-591	362	35	e.	e.	PROPN
finefocus-591	362	36	2004	2004	PROPN
finefocus-591	362	37	.	.	PUNCT
finefocus-591	363	1	first	first	ADJ
finefocus-591	363	2	culture	culture	NOUN
finefocus-591	363	3	isolation	isolation	NOUN
finefocus-591	363	4	of	of	ADP
finefocus-591	363	5	borrelia	borrelia	NOUN
finefocus-591	363	6	lonestari	lonestari	ADJ
finefocus-591	363	7	,	,	PUNCT
finefocus-591	363	8	putative	putative	ADJ
finefocus-591	363	9	agent	agent	NOUN
finefocus-591	363	10	of	of	ADP
finefocus-591	363	11	southern	southern	ADJ
finefocus-591	363	12	tick	tick	NOUN
finefocus-591	363	13	-	-	PUNCT
finefocus-591	363	14	associated	associate	VERB
finefocus-591	363	15	rash	rash	ADJ
finefocus-591	363	16	illness	illness	NOUN
finefocus-591	363	17	.	.	PUNCT
finefocus-591	364	1	j.	j.	PROPN
finefocus-591	364	2	clin	clin	PROPN
finefocus-591	364	3	.	.	PUNCT
finefocus-591	365	1	microbiol	microbiol	PROPN
finefocus-591	365	2	.	.	PUNCT
finefocus-591	366	1	42	42	NUM
finefocus-591	366	2	:	:	PUNCT
finefocus-591	366	3	1163	1163	NUM
finefocus-591	366	4	-	-	SYM
finefocus-591	366	5	1169	1169	NUM
finefocus-591	366	6	.	.	PUNCT
finefocus-591	367	1	doi	doi	NOUN
finefocus-591	367	2	:	:	PUNCT
finefocus-591	367	3	10.1128/	10.1128/	NUM
finefocus-591	367	4	jcm.42.3.1163	jcm.42.3.1163	PROPN
finefocus-591	367	5	-	-	ADJ
finefocus-591	367	6	1169.2004	1169.2004	NUM
finefocus-591	367	7	42	42	NUM
finefocus-591	367	8	.	.	PUNCT
finefocus-591	368	1	whitney	whitney	PROPN
finefocus-591	368	2	,	,	PUNCT
finefocus-591	368	3	m.	m.	PROPN
finefocus-591	368	4	s.	s.	PROPN
finefocus-591	368	5	,	,	PUNCT
finefocus-591	368	6	schwan	schwan	PROPN
finefocus-591	368	7	,	,	PUNCT
finefocus-591	368	8	t.	t.	PROPN
finefocus-591	368	9	g.	g.	PROPN
finefocus-591	368	10	,	,	PUNCT
finefocus-591	368	11	sultemeier	sultemeier	NOUN
finefocus-591	368	12	,	,	PUNCT
finefocus-591	368	13	k.	k.	PROPN
finefocus-591	368	14	b.	b.	PROPN
finefocus-591	368	15	,	,	PUNCT
finefocus-591	368	16	mcdonald	mcdonald	PROPN
finefocus-591	368	17	,	,	PUNCT
finefocus-591	368	18	p.	p.	PROPN
finefocus-591	368	19	s.	s.	PROPN
finefocus-591	368	20	,	,	PUNCT
finefocus-591	368	21	&	&	CCONJ
finefocus-591	368	22	brillhart	brillhart	NOUN
finefocus-591	368	23	,	,	PUNCT
finefocus-591	368	24	m.	m.	NOUN
finefocus-591	368	25	n.	n.	PROPN
finefocus-591	368	26	2007	2007	NUM
finefocus-591	368	27	.	.	PUNCT
finefocus-591	369	1	spirochetemia	spirochetemia	NOUN
finefocus-591	369	2	caused	cause	VERB
finefocus-591	369	3	by	by	ADP
finefocus-591	369	4	borrelia	borrelia	NOUN
finefocus-591	369	5	turicatae	turicatae	NOUN
finefocus-591	369	6	infection	infection	NOUN
finefocus-591	369	7	in	in	ADP
finefocus-591	369	8	3	3	NUM
finefocus-591	369	9	dogs	dog	NOUN
finefocus-591	369	10	in	in	ADP
finefocus-591	369	11	texas	texas	PROPN
finefocus-591	369	12	.	.	PUNCT
finefocus-591	370	1	vet	vet	NOUN
finefocus-591	370	2	.	.	PUNCT
finefocus-591	371	1	clin	clin	PROPN
finefocus-591	371	2	.	.	PUNCT
finefocus-591	372	1	path	path	PROPN
finefocus-591	372	2	.	.	PUNCT
finefocus-591	373	1	36	36	NUM
finefocus-591	373	2	:	:	PUNCT
finefocus-591	373	3	212	212	NUM
finefocus-591	373	4	-	-	SYM
finefocus-591	373	5	216	216	NUM
finefocus-591	373	6	.	.	PUNCT
finefocus-591	373	7	doi	doi	NOUN
finefocus-591	373	8	:	:	PUNCT
finefocus-591	373	9	10.1111	10.1111	NUM
finefocus-591	373	10	/	/	SYM
finefocus-591	373	11	j.1939	j.1939	PROPN
finefocus-591	373	12	-	-	PUNCT
finefocus-591	373	13	165x.2007.tb00213.x	165x.2007.tb00213.x	NUM
finefocus-591	373	14	43	43	NUM
finefocus-591	373	15	.	.	PUNCT
finefocus-591	374	1	wilhelmsson	wilhelmsson	NOUN
finefocus-591	374	2	,	,	PUNCT
finefocus-591	374	3	p.	p.	NOUN
finefocus-591	374	4	,	,	PUNCT
finefocus-591	374	5	fryland	fryland	PROPN
finefocus-591	374	6	,	,	PUNCT
finefocus-591	374	7	l.	l.	PROPN
finefocus-591	374	8	,	,	PUNCT
finefocus-591	374	9	börjesson	börjesson	PROPN
finefocus-591	374	10	,	,	PUNCT
finefocus-591	374	11	s.	s.	PROPN
finefocus-591	374	12	,	,	PUNCT
finefocus-591	374	13	nordgren	nordgren	PROPN
finefocus-591	374	14	,	,	PUNCT
finefocus-591	374	15	j.	j.	PROPN
finefocus-591	374	16	,	,	PUNCT
finefocus-591	374	17	bergström	bergström	NOUN
finefocus-591	374	18	,	,	PUNCT
finefocus-591	374	19	s.	s.	PROPN
finefocus-591	374	20	,	,	PUNCT
finefocus-591	374	21	ernerudh	ernerudh	PROPN
finefocus-591	374	22	,	,	PUNCT
finefocus-591	374	23	j.	j.	PROPN
finefocus-591	374	24	,	,	PUNCT
finefocus-591	374	25	forsberg	forsberg	PROPN
finefocus-591	374	26	,	,	PUNCT
finefocus-591	374	27	p.	p.	PROPN
finefocus-591	374	28	,	,	PUNCT
finefocus-591	374	29	&	&	CCONJ
finefocus-591	374	30	lindgren	lindgren	PROPN
finefocus-591	374	31	,	,	PUNCT
finefocus-591	374	32	p.e	p.e	PROPN
finefocus-591	374	33	.	.	PROPN
finefocus-591	374	34	2010	2010	NUM
finefocus-591	374	35	.	.	PUNCT
finefocus-591	375	1	prevalence	prevalence	NOUN
finefocus-591	375	2	and	and	CCONJ
finefocus-591	375	3	diversity	diversity	NOUN
finefocus-591	375	4	of	of	ADP
finefocus-591	375	5	borrelia	borrelia	NOUN
finefocus-591	375	6	species	specie	NOUN
finefocus-591	375	7	in	in	ADP
finefocus-591	375	8	ticks	tick	NOUN
finefocus-591	375	9	that	that	PRON
finefocus-591	375	10	have	have	AUX
finefocus-591	375	11	bitten	bite	VERB
finefocus-591	375	12	humans	human	NOUN
finefocus-591	375	13	in	in	ADP
finefocus-591	375	14	sweden	sweden	PROPN
finefocus-591	375	15	.	.	PUNCT
finefocus-591	376	1	j.	j.	PROPN
finefocus-591	376	2	clin	clin	PROPN
finefocus-591	376	3	.	.	PUNCT
finefocus-591	377	1	microbiol	microbiol	PROPN
finefocus-591	377	2	.	.	PUNCT
finefocus-591	378	1	48	48	NUM
finefocus-591	378	2	:	:	SYM
finefocus-591	378	3	4169	4169	NUM
finefocus-591	378	4	-	-	SYM
finefocus-591	378	5	4176	4176	NUM
finefocus-591	378	6	.	.	PUNCT
finefocus-591	379	1	doi	doi	NOUN
finefocus-591	379	2	:	:	PUNCT
finefocus-591	379	3	10.1128	10.1128	NUM
finefocus-591	379	4	/	/	SYM
finefocus-591	379	5	jcm.01061	jcm.01061	NOUN
finefocus-591	379	6	-	-	SYM
finefocus-591	379	7	10	10	NUM
finefocus-591	379	8	44	44	NUM
finefocus-591	379	9	.	.	PUNCT
finefocus-591	380	1	williamson	williamson	PROPN
finefocus-591	380	2	,	,	PUNCT
finefocus-591	380	3	p.	p.	PROPN
finefocus-591	380	4	c.	c.	PROPN
finefocus-591	380	5	,	,	PUNCT
finefocus-591	380	6	billingsley	billingsley	PROPN
finefocus-591	380	7	,	,	PUNCT
finefocus-591	380	8	p.	p.	NOUN
finefocus-591	380	9	m.	m.	NOUN
finefocus-591	380	10	,	,	PUNCT
finefocus-591	380	11	teltow	teltow	PROPN
finefocus-591	380	12	,	,	PUNCT
finefocus-591	380	13	g.	g.	PROPN
finefocus-591	380	14	j.	j.	PROPN
finefocus-591	380	15	,	,	PUNCT
finefocus-591	380	16	seals	seals	PROPN
finefocus-591	380	17	,	,	PUNCT
finefocus-591	380	18	j.	j.	PROPN
finefocus-591	380	19	p.	p.	PROPN
finefocus-591	380	20	,	,	PUNCT
finefocus-591	380	21	turnbough	turnbough	PROPN
finefocus-591	380	22	,	,	PUNCT
finefocus-591	380	23	m.	m.	NOUN
finefocus-591	380	24	a.	a.	PROPN
finefocus-591	380	25	,	,	PUNCT
finefocus-591	380	26	&	&	CCONJ
finefocus-591	380	27	atkinson	atkinson	PROPN
finefocus-591	380	28	,	,	PUNCT
finefocus-591	380	29	s.	s.	PROPN
finefocus-591	380	30	f.	f.	PROPN
finefocus-591	380	31	2010	2010	NUM
finefocus-591	380	32	.	.	PUNCT
finefocus-591	381	1	borrelia	borrelia	PROPN
finefocus-591	381	2	,	,	PUNCT
finefocus-591	381	3	ehrlichia	ehrlichia	VERB
finefocus-591	381	4	,	,	PUNCT
finefocus-591	381	5	and	and	CCONJ
finefocus-591	381	6	rickettsia	rickettsia	NOUN
finefocus-591	381	7	in	in	ADP
finefocus-591	381	8	ticks	tick	NOUN
finefocus-591	381	9	removed	remove	VERB
finefocus-591	381	10	from	from	ADP
finefocus-591	381	11	persons	person	NOUN
finefocus-591	381	12	,	,	PUNCT
finefocus-591	381	13	texas	texas	PROPN
finefocus-591	381	14	,	,	PUNCT
finefocus-591	381	15	usa	usa	PROPN
finefocus-591	381	16	.	.	PROPN
finefocus-591	381	17	emerg	emerg	PROPN
finefocus-591	381	18	.	.	PUNCT
finefocus-591	382	1	infect	infect	VERB
finefocus-591	382	2	.	.	PUNCT
finefocus-591	383	1	dis	dis	INTJ
finefocus-591	383	2	.	.	PUNCT
finefocus-591	384	1	16:3	16:3	NUM
finefocus-591	384	2	,	,	PUNCT
finefocus-591	384	3	441	441	NUM
finefocus-591	384	4	-	-	SYM
finefocus-591	384	5	446	446	NUM
finefocus-591	384	6	.	.	PUNCT
finefocus-591	385	1	doi	doi	NOUN
finefocus-591	385	2	:	:	PUNCT
finefocus-591	385	3	10.3201	10.3201	NUM
finefocus-591	385	4	/	/	SYM
finefocus-591	385	5	eid1603.091333	eid1603.091333	NOUN
finefocus-591	386	1	finaljournal.indd	finaljournal.indd	NUM
finefocus-591	386	2	120	120	NUM
finefocus-591	386	3	9/25/15	9/25/15	NUM
finefocus-591	386	4	11:38	11:38	NUM
finefocus-591	386	5	am	am	NOUN