id	sid	tid	token	lemma	pos
finefocus-615	1	1	cutting	cut	VERB
finefocus-615	1	2	wedge	wedge	NOUN
finefocus-615	1	3	:	:	PUNCT
finefocus-615	1	4	bacterial	bacterial	ADJ
finefocus-615	1	5	community	community	NOUN
finefocus-615	1	6	diversity	diversity	NOUN
finefocus-615	1	7	and	and	CCONJ
finefocus-615	1	8	structure	structure	NOUN
finefocus-615	1	9	associated	associate	VERB
finefocus-615	1	10	with	with	ADP
finefocus-615	1	11	the	the	DET
finefocus-615	1	12	cheese	cheese	NOUN
finefocus-615	1	13	rind	rind	NOUN
finefocus-615	1	14	and	and	CCONJ
finefocus-615	1	15	curd	curd	NOUN
finefocus-615	1	16	of	of	ADP
finefocus-615	1	17	seven	seven	NUM
finefocus-615	1	18	natural	natural	ADJ
finefocus-615	1	19	rind	rind	NOUN
finefocus-615	1	20	cheeses	cheese	NOUN
finefocus-615	1	21	lei	lei	PROPN
finefocus-615	1	22	wei1‡	wei1‡	PROPN
finefocus-615	1	23	,	,	PUNCT
finefocus-615	1	24	rebecca	rebecca	PROPN
finefocus-615	1	25	j.	j.	PROPN
finefocus-615	1	26	rubinstein2‡	rubinstein2‡	PROPN
finefocus-615	1	27	,	,	PUNCT
finefocus-615	1	28	kathleen	kathleen	PROPN
finefocus-615	1	29	m.	m.	NOUN
finefocus-615	1	30	hanlon2	hanlon2	PROPN
finefocus-615	1	31	,	,	PUNCT
finefocus-615	1	32	heidi	heidi	PROPN
finefocus-615	1	33	wade1	wade1	NOUN
finefocus-615	1	34	,	,	PUNCT
finefocus-615	1	35	celeste	celeste	PROPN
finefocus-615	1	36	n.	n.	PROPN
finefocus-615	1	37	peterson3	peterson3	PROPN
finefocus-615	1	38	*	*	PUNCT
finefocus-615	1	39	,	,	PUNCT
finefocus-615	1	40	and	and	CCONJ
finefocus-615	1	41	vanja	vanja	PROPN
finefocus-615	1	42	klepac	klepac	PROPN
finefocus-615	1	43	-	-	PUNCT
finefocus-615	1	44	ceraj2	ceraj2	PROPN
finefocus-615	1	45	*	*	PROPN
finefocus-615	1	46	1	1	NUM
finefocus-615	1	47	department	department	NOUN
finefocus-615	1	48	of	of	ADP
finefocus-615	1	49	chemistry	chemistry	NOUN
finefocus-615	1	50	,	,	PUNCT
finefocus-615	1	51	2	2	NUM
finefocus-615	1	52	department	department	NOUN
finefocus-615	1	53	of	of	ADP
finefocus-615	1	54	biological	biological	PROPN
finefocus-615	1	55	sciences	sciences	PROPN
finefocus-615	1	56	wellesley	wellesley	PROPN
finefocus-615	1	57	college	college	PROPN
finefocus-615	1	58	,	,	PUNCT
finefocus-615	1	59	wellesley	wellesley	PROPN
finefocus-615	1	60	,	,	PUNCT
finefocus-615	1	61	ma	ma	PROPN
finefocus-615	1	62	2	2	PROPN
finefocus-615	1	63	department	department	NOUN
finefocus-615	1	64	of	of	ADP
finefocus-615	1	65	biology	biology	NOUN
finefocus-615	1	66	,	,	PUNCT
finefocus-615	1	67	suffolk	suffolk	PROPN
finefocus-615	1	68	university	university	PROPN
finefocus-615	1	69	,	,	PUNCT
finefocus-615	1	70	boston	boston	PROPN
finefocus-615	1	71	,	,	PUNCT
finefocus-615	1	72	ma	ma	PROPN
finefocus-615	1	73	‡co	‡co	PROPN
finefocus-615	1	74	-	-	PUNCT
finefocus-615	1	75	first	first	ADJ
finefocus-615	1	76	authors	author	NOUN
finefocus-615	1	77	:	:	PUNCT
finefocus-615	1	78	lei	lei	PROPN
finefocus-615	1	79	wei	wei	PROPN
finefocus-615	1	80	,	,	PUNCT
finefocus-615	1	81	rebecca	rebecca	PROPN
finefocus-615	1	82	j.	j.	PROPN
finefocus-615	1	83	rubinstein	rubinstein	PROPN
finefocus-615	1	84	manuscript	manuscript	PROPN
finefocus-615	1	85	received	receive	VERB
finefocus-615	1	86	30	30	NUM
finefocus-615	1	87	june	june	PROPN
finefocus-615	1	88	2016	2016	NUM
finefocus-615	1	89	;	;	PUNCT
finefocus-615	1	90	accepted	accept	VERB
finefocus-615	1	91	5	5	NUM
finefocus-615	1	92	november	november	PROPN
finefocus-615	1	93	2016	2016	NUM
finefocus-615	1	94	copyright	copyright	NOUN
finefocus-615	1	95	2017	2017	NUM
finefocus-615	1	96	,	,	PUNCT
finefocus-615	1	97	fine	fine	ADJ
finefocus-615	1	98	focus	focus	NOUN
finefocus-615	1	99	.	.	PUNCT
finefocus-615	2	1	all	all	DET
finefocus-615	2	2	rights	right	NOUN
finefocus-615	2	3	reserved	reserve	VERB
finefocus-615	2	4	.	.	PUNCT
finefocus-615	3	1	10	10	NUM
finefocus-615	3	2	•	•	NUM
finefocus-615	3	3	fine	fine	ADJ
finefocus-615	3	4	focus	focus	NOUN
finefocus-615	3	5	,	,	PUNCT
finefocus-615	3	6	vol	vol	NOUN
finefocus-615	3	7	.	.	NOUN
finefocus-615	3	8	3	3	NUM
finefocus-615	3	9	(	(	PUNCT
finefocus-615	3	10	1	1	NUM
finefocus-615	3	11	)	)	PUNCT
finefocus-615	3	12	the	the	DET
finefocus-615	3	13	microorganisms	microorganism	NOUN
finefocus-615	3	14	that	that	PRON
finefocus-615	3	15	inhabit	inhabit	NOUN
finefocus-615	3	16	cheese	cheese	NOUN
finefocus-615	3	17	contribute	contribute	VERB
finefocus-615	3	18	greatly	greatly	ADV
finefocus-615	3	19	to	to	ADP
finefocus-615	3	20	the	the	DET
finefocus-615	3	21	flavor	flavor	NOUN
finefocus-615	3	22	and	and	CCONJ
finefocus-615	3	23	development	development	NOUN
finefocus-615	3	24	of	of	ADP
finefocus-615	3	25	the	the	DET
finefocus-615	3	26	final	final	ADJ
finefocus-615	3	27	product	product	NOUN
finefocus-615	3	28	.	.	PUNCT
finefocus-615	4	1	while	while	SCONJ
finefocus-615	4	2	the	the	DET
finefocus-615	4	3	rind	rind	NOUN
finefocus-615	4	4	and	and	CCONJ
finefocus-615	4	5	curd	curd	NOUN
finefocus-615	4	6	microbiota	microbiota	NOUN
finefocus-615	4	7	have	have	AUX
finefocus-615	4	8	been	be	AUX
finefocus-615	4	9	characterized	characterize	VERB
finefocus-615	4	10	separately	separately	ADV
finefocus-615	4	11	,	,	PUNCT
finefocus-615	4	12	there	there	PRON
finefocus-615	4	13	is	be	VERB
finefocus-615	4	14	limited	limited	ADJ
finefocus-615	4	15	information	information	NOUN
finefocus-615	4	16	on	on	ADP
finefocus-615	4	17	how	how	SCONJ
finefocus-615	4	18	the	the	DET
finefocus-615	4	19	structure	structure	NOUN
finefocus-615	4	20	and	and	CCONJ
finefocus-615	4	21	function	function	NOUN
finefocus-615	4	22	of	of	ADP
finefocus-615	4	23	microbial	microbial	ADJ
finefocus-615	4	24	communities	community	NOUN
finefocus-615	4	25	in	in	ADP
finefocus-615	4	26	rinds	rind	NOUN
finefocus-615	4	27	and	and	CCONJ
finefocus-615	4	28	curds	curd	NOUN
finefocus-615	4	29	vary	vary	VERB
finefocus-615	4	30	within	within	ADP
finefocus-615	4	31	and	and	CCONJ
finefocus-615	4	32	amongst	amongst	ADP
finefocus-615	4	33	cheeses	cheese	NOUN
finefocus-615	4	34	.	.	PUNCT
finefocus-615	5	1	to	to	PART
finefocus-615	5	2	better	well	ADV
finefocus-615	5	3	understand	understand	VERB
finefocus-615	5	4	the	the	DET
finefocus-615	5	5	differences	difference	NOUN
finefocus-615	5	6	in	in	ADP
finefocus-615	5	7	community	community	NOUN
finefocus-615	5	8	structure	structure	NOUN
finefocus-615	5	9	and	and	CCONJ
finefocus-615	5	10	function	function	NOUN
finefocus-615	5	11	between	between	ADP
finefocus-615	5	12	communities	community	NOUN
finefocus-615	5	13	of	of	ADP
finefocus-615	5	14	cheese	cheese	NOUN
finefocus-615	5	15	rinds	rind	NOUN
finefocus-615	5	16	and	and	CCONJ
finefocus-615	5	17	curds	curd	NOUN
finefocus-615	5	18	,	,	PUNCT
finefocus-615	5	19	we	we	PRON
finefocus-615	5	20	combined	combine	VERB
finefocus-615	5	21	culture	culture	NOUN
finefocus-615	5	22	-	-	PUNCT
finefocus-615	5	23	based	base	VERB
finefocus-615	5	24	methods	method	NOUN
finefocus-615	5	25	with	with	ADP
finefocus-615	5	26	culture	culture	NOUN
finefocus-615	5	27	-	-	PUNCT
finefocus-615	5	28	independent	independent	ADJ
finefocus-615	5	29	community	community	NOUN
finefocus-615	5	30	profiling	profiling	NOUN
finefocus-615	5	31	of	of	ADP
finefocus-615	5	32	curds	curd	NOUN
finefocus-615	5	33	and	and	CCONJ
finefocus-615	5	34	rinds	rind	NOUN
finefocus-615	5	35	.	.	PUNCT
finefocus-615	6	1	rinds	rind	NOUN
finefocus-615	6	2	contained	contain	VERB
finefocus-615	6	3	greater	great	ADJ
finefocus-615	6	4	taxonomic	taxonomic	ADJ
finefocus-615	6	5	diversity	diversity	NOUN
finefocus-615	6	6	than	than	ADP
finefocus-615	6	7	curds	curd	NOUN
finefocus-615	6	8	.	.	PUNCT
finefocus-615	7	1	lactobacillales	lactobacillale	NOUN
finefocus-615	7	2	dominated	dominate	VERB
finefocus-615	7	3	curd	curd	NOUN
finefocus-615	7	4	communities	community	NOUN
finefocus-615	7	5	while	while	SCONJ
finefocus-615	7	6	members	member	NOUN
finefocus-615	7	7	from	from	ADP
finefocus-615	7	8	the	the	DET
finefocus-615	7	9	order	order	NOUN
finefocus-615	7	10	actinomycetales	actinomycetale	NOUN
finefocus-615	7	11	were	be	AUX
finefocus-615	7	12	found	find	VERB
finefocus-615	7	13	in	in	ADP
finefocus-615	7	14	high	high	ADJ
finefocus-615	7	15	abundance	abundance	NOUN
finefocus-615	7	16	in	in	ADP
finefocus-615	7	17	rind	rind	NOUN
finefocus-615	7	18	communities	community	NOUN
finefocus-615	7	19	.	.	PUNCT
finefocus-615	8	1	communities	community	NOUN
finefocus-615	8	2	varied	vary	VERB
finefocus-615	8	3	more	more	ADV
finefocus-615	8	4	between	between	ADP
finefocus-615	8	5	rinds	rind	NOUN
finefocus-615	8	6	and	and	CCONJ
finefocus-615	8	7	curds	curd	NOUN
finefocus-615	8	8	than	than	ADP
finefocus-615	8	9	among	among	ADP
finefocus-615	8	10	cheeses	cheese	NOUN
finefocus-615	8	11	produced	produce	VERB
finefocus-615	8	12	from	from	ADP
finefocus-615	8	13	different	different	ADJ
finefocus-615	8	14	milk	milk	NOUN
finefocus-615	8	15	types	type	NOUN
finefocus-615	8	16	.	.	PUNCT
finefocus-615	9	1	to	to	PART
finefocus-615	9	2	better	well	ADV
finefocus-615	9	3	understand	understand	VERB
finefocus-615	9	4	microbial	microbial	ADJ
finefocus-615	9	5	community	community	NOUN
finefocus-615	9	6	functions	function	NOUN
finefocus-615	9	7	,	,	PUNCT
finefocus-615	9	8	we	we	PRON
finefocus-615	9	9	cultured	culture	VERB
finefocus-615	9	10	and	and	CCONJ
finefocus-615	9	11	assayed	assayed	ADJ
finefocus-615	9	12	isolates	isolate	NOUN
finefocus-615	9	13	for	for	ADP
finefocus-615	9	14	antibiotic	antibiotic	ADJ
finefocus-615	9	15	susceptibility	susceptibility	NOUN
finefocus-615	9	16	and	and	CCONJ
finefocus-615	9	17	carbon	carbon	NOUN
finefocus-615	9	18	source	source	NOUN
finefocus-615	9	19	utilization	utilization	NOUN
finefocus-615	9	20	.	.	PUNCT
finefocus-615	10	1	among	among	ADP
finefocus-615	10	2	european	european	PROPN
finefocus-615	10	3	and	and	CCONJ
finefocus-615	10	4	u.s	u.s	PROPN
finefocus-615	10	5	.	.	PROPN
finefocus-615	10	6	cheeses	cheese	NOUN
finefocus-615	10	7	,	,	PUNCT
finefocus-615	10	8	70	70	NUM
finefocus-615	10	9	%	%	NOUN
finefocus-615	10	10	of	of	ADP
finefocus-615	10	11	all	all	DET
finefocus-615	10	12	susceptible	susceptible	ADJ
finefocus-615	10	13	isolates	isolate	NOUN
finefocus-615	10	14	were	be	AUX
finefocus-615	10	15	cultured	cultured	ADJ
finefocus-615	10	16	from	from	ADP
finefocus-615	10	17	u.s	u.s	PROPN
finefocus-615	10	18	.	.	PROPN
finefocus-615	10	19	cheeses	cheese	NOUN
finefocus-615	10	20	.	.	PUNCT
finefocus-615	11	1	overall	overall	ADV
finefocus-615	11	2	,	,	PUNCT
finefocus-615	11	3	our	our	PRON
finefocus-615	11	4	study	study	NOUN
finefocus-615	11	5	explored	explore	VERB
finefocus-615	11	6	the	the	DET
finefocus-615	11	7	differences	difference	NOUN
finefocus-615	11	8	within	within	ADP
finefocus-615	11	9	and	and	CCONJ
finefocus-615	11	10	between	between	ADP
finefocus-615	11	11	rind	rind	NOUN
finefocus-615	11	12	and	and	CCONJ
finefocus-615	11	13	curd	curd	NOUN
finefocus-615	11	14	microbial	microbial	ADJ
finefocus-615	11	15	communities	community	NOUN
finefocus-615	11	16	of	of	ADP
finefocus-615	11	17	natural	natural	ADJ
finefocus-615	11	18	rind	rind	NOUN
finefocus-615	11	19	cheeses	cheese	NOUN
finefocus-615	11	20	,	,	PUNCT
finefocus-615	11	21	provided	provide	VERB
finefocus-615	11	22	insights	insight	NOUN
finefocus-615	11	23	into	into	ADP
finefocus-615	11	24	the	the	DET
finefocus-615	11	25	environmental	environmental	ADJ
finefocus-615	11	26	factors	factor	NOUN
finefocus-615	11	27	that	that	PRON
finefocus-615	11	28	shape	shape	VERB
finefocus-615	11	29	microbial	microbial	ADJ
finefocus-615	11	30	communities	community	NOUN
finefocus-615	11	31	,	,	PUNCT
finefocus-615	11	32	and	and	CCONJ
finefocus-615	11	33	demonstrated	demonstrate	VERB
finefocus-615	11	34	that	that	SCONJ
finefocus-615	11	35	at	at	ADP
finefocus-615	11	36	the	the	DET
finefocus-615	11	37	community	community	NOUN
finefocus-615	11	38	and	and	CCONJ
finefocus-615	11	39	isolate	isolate	VERB
finefocus-615	11	40	level	level	NOUN
finefocus-615	11	41	the	the	DET
finefocus-615	11	42	cheese	cheese	NOUN
finefocus-615	11	43	microbiome	microbiome	NOUN
finefocus-615	11	44	was	be	AUX
finefocus-615	11	45	diverse	diverse	ADJ
finefocus-615	11	46	and	and	CCONJ
finefocus-615	11	47	metabolically	metabolically	ADV
finefocus-615	11	48	complex	complex	ADJ
finefocus-615	11	49	.	.	PUNCT
finefocus-615	12	1	abstract	abstract	ADJ
finefocus-615	12	2	corresponding	correspond	VERB
finefocus-615	12	3	authors	author	NOUN
finefocus-615	12	4	vanja	vanja	PROPN
finefocus-615	12	5	klepac	klepac	PROPN
finefocus-615	12	6	-	-	PUNCT
finefocus-615	12	7	ceraj	ceraj	PROPN
finefocus-615	12	8	*	*	PROPN
finefocus-615	12	9	vklepacc@wellesley.edu	vklepacc@wellesley.edu	PROPN
finefocus-615	13	1	celeste	celeste	PROPN
finefocus-615	13	2	peterson	peterson	PROPN
finefocus-615	13	3	*	*	PROPN
finefocus-615	13	4	cnpeterson@suffolk.edu	cnpeterson@suffolk.edu	PROPN
finefocus-615	13	5	keywords	keyword	NOUN
finefocus-615	13	6	•	•	ADJ
finefocus-615	13	7	cheese	cheese	NOUN
finefocus-615	13	8	microbiome	microbiome	NOUN
finefocus-615	13	9	•	•	NOUN
finefocus-615	13	10	rind	rind	NOUN
finefocus-615	13	11	•	•	NOUN
finefocus-615	13	12	curd	curd	NOUN
finefocus-615	13	13	•	•	NOUN
finefocus-615	13	14	diversity	diversity	NOUN
finefocus-615	13	15	•	•	ADP
finefocus-615	13	16	antibiotic	antibiotic	ADJ
finefocus-615	13	17	resistance	resistance	NOUN
finefocus-615	13	18	•	•	NUM
finefocus-615	13	19	16s	16s	PROPN
finefocus-615	13	20	rrna	rrna	PROPN
finefocus-615	13	21	gene	gene	NOUN
finefocus-615	13	22	cheese	cheese	NOUN
finefocus-615	13	23	production	production	NOUN
finefocus-615	13	24	exemplifies	exemplify	VERB
finefocus-615	13	25	a	a	DET
finefocus-615	13	26	reproducible	reproducible	ADJ
finefocus-615	13	27	succession	succession	NOUN
finefocus-615	13	28	of	of	ADP
finefocus-615	13	29	microbial	microbial	ADJ
finefocus-615	13	30	communities	community	NOUN
finefocus-615	13	31	(	(	PUNCT
finefocus-615	13	32	10	10	NUM
finefocus-615	13	33	,	,	PUNCT
finefocus-615	13	34	48	48	NUM
finefocus-615	13	35	,	,	PUNCT
finefocus-615	13	36	49	49	NUM
finefocus-615	13	37	)	)	PUNCT
finefocus-615	13	38	.	.	PUNCT
finefocus-615	14	1	microbes	microbe	NOUN
finefocus-615	14	2	execute	execute	VERB
finefocus-615	14	3	the	the	DET
finefocus-615	14	4	biochemical	biochemical	ADJ
finefocus-615	14	5	transformation	transformation	NOUN
finefocus-615	14	6	of	of	ADP
finefocus-615	14	7	milk	milk	NOUN
finefocus-615	14	8	from	from	ADP
finefocus-615	14	9	a	a	DET
finefocus-615	14	10	liquid	liquid	ADJ
finefocus-615	14	11	suspension	suspension	NOUN
finefocus-615	14	12	of	of	ADP
finefocus-615	14	13	lactose	lactose	NOUN
finefocus-615	14	14	,	,	PUNCT
finefocus-615	14	15	casein	casein	PROPN
finefocus-615	14	16	,	,	PUNCT
finefocus-615	14	17	whey	whey	NOUN
finefocus-615	14	18	,	,	PUNCT
finefocus-615	14	19	and	and	CCONJ
finefocus-615	14	20	fat	fat	ADJ
finefocus-615	14	21	into	into	ADP
finefocus-615	14	22	cheese	cheese	NOUN
finefocus-615	14	23	which	which	PRON
finefocus-615	14	24	is	be	AUX
finefocus-615	14	25	a	a	DET
finefocus-615	14	26	solid	solid	ADJ
finefocus-615	14	27	aggregate	aggregate	NOUN
finefocus-615	14	28	of	of	ADP
finefocus-615	14	29	amino	amino	ADJ
finefocus-615	14	30	acids	acid	NOUN
finefocus-615	14	31	,	,	PUNCT
finefocus-615	14	32	lactate	lactate	NOUN
finefocus-615	14	33	and	and	CCONJ
finefocus-615	14	34	volatile	volatile	ADJ
finefocus-615	14	35	flavor	flavor	NOUN
finefocus-615	14	36	compounds	compound	NOUN
finefocus-615	14	37	and	and	CCONJ
finefocus-615	14	38	pigments	pigment	NOUN
finefocus-615	14	39	(	(	PUNCT
finefocus-615	14	40	6	6	NUM
finefocus-615	14	41	)	)	PUNCT
finefocus-615	14	42	.	.	PUNCT
finefocus-615	15	1	over	over	ADP
finefocus-615	15	2	centuries	century	NOUN
finefocus-615	15	3	,	,	PUNCT
finefocus-615	15	4	humans	human	NOUN
finefocus-615	15	5	optimized	optimize	VERB
finefocus-615	15	6	the	the	DET
finefocus-615	15	7	cheese	cheese	NOUN
finefocus-615	15	8	-	-	PUNCT
finefocus-615	15	9	making	make	VERB
finefocus-615	15	10	process	process	NOUN
finefocus-615	15	11	to	to	PART
finefocus-615	15	12	select	select	VERB
finefocus-615	15	13	for	for	ADP
finefocus-615	15	14	distinct	distinct	ADJ
finefocus-615	15	15	and	and	CCONJ
finefocus-615	15	16	reproducible	reproducible	VERB
finefocus-615	15	17	microbial	microbial	ADJ
finefocus-615	15	18	communities	community	NOUN
finefocus-615	15	19	that	that	PRON
finefocus-615	15	20	give	give	VERB
finefocus-615	15	21	cheeses	cheese	NOUN
finefocus-615	15	22	their	their	PRON
finefocus-615	15	23	individual	individual	ADJ
finefocus-615	15	24	tastes	taste	NOUN
finefocus-615	15	25	,	,	PUNCT
finefocus-615	15	26	consistencies	consistency	NOUN
finefocus-615	15	27	,	,	PUNCT
finefocus-615	15	28	colors	color	NOUN
finefocus-615	15	29	and	and	CCONJ
finefocus-615	15	30	other	other	ADJ
finefocus-615	15	31	desirable	desirable	ADJ
finefocus-615	15	32	properties	property	NOUN
finefocus-615	15	33	(	(	PUNCT
finefocus-615	15	34	6	6	NUM
finefocus-615	15	35	,	,	PUNCT
finefocus-615	15	36	14	14	NUM
finefocus-615	15	37	,	,	PUNCT
finefocus-615	15	38	43	43	NUM
finefocus-615	15	39	,	,	PUNCT
finefocus-615	15	40	49	49	NUM
finefocus-615	15	41	)	)	PUNCT
finefocus-615	15	42	.	.	PUNCT
finefocus-615	16	1	in	in	ADP
finefocus-615	16	2	natural	natural	ADJ
finefocus-615	16	3	-	-	PUNCT
finefocus-615	16	4	rind	rind	NOUN
finefocus-615	16	5	cheeses	cheese	NOUN
finefocus-615	16	6	,	,	PUNCT
finefocus-615	16	7	endogenous	endogenous	ADJ
finefocus-615	16	8	microorganisms	microorganism	NOUN
finefocus-615	16	9	or	or	CCONJ
finefocus-615	16	10	the	the	DET
finefocus-615	16	11	addition	addition	NOUN
finefocus-615	16	12	of	of	ADP
finefocus-615	16	13	bacterial	bacterial	ADJ
finefocus-615	16	14	starter	starter	ADJ
finefocus-615	16	15	culture	culture	NOUN
finefocus-615	16	16	to	to	ADP
finefocus-615	16	17	milk	milk	NOUN
finefocus-615	16	18	are	be	AUX
finefocus-615	16	19	needed	need	VERB
finefocus-615	16	20	to	to	PART
finefocus-615	16	21	acidify	acidify	VERB
finefocus-615	16	22	and	and	CCONJ
finefocus-615	16	23	coagulate	coagulate	VERB
finefocus-615	16	24	the	the	DET
finefocus-615	16	25	milk	milk	NOUN
finefocus-615	16	26	into	into	ADP
finefocus-615	16	27	introduction	introduction	NOUN
finefocus-615	16	28	bacterial	bacterial	ADJ
finefocus-615	16	29	community	community	NOUN
finefocus-615	16	30	structure	structure	NOUN
finefocus-615	16	31	in	in	ADP
finefocus-615	16	32	cheese	cheese	NOUN
finefocus-615	16	33	•	•	NUM
finefocus-615	16	34	11	11	NUM
finefocus-615	16	35	curds	curd	NOUN
finefocus-615	16	36	and	and	CCONJ
finefocus-615	16	37	enable	enable	VERB
finefocus-615	16	38	future	future	ADJ
finefocus-615	16	39	colonization	colonization	NOUN
finefocus-615	16	40	by	by	ADP
finefocus-615	16	41	fungi	fungus	NOUN
finefocus-615	16	42	and	and	CCONJ
finefocus-615	16	43	bacteria	bacteria	NOUN
finefocus-615	16	44	on	on	ADP
finefocus-615	16	45	the	the	DET
finefocus-615	16	46	cheese	cheese	NOUN
finefocus-615	16	47	surface	surface	NOUN
finefocus-615	16	48	(	(	PUNCT
finefocus-615	16	49	26	26	NUM
finefocus-615	16	50	,	,	PUNCT
finefocus-615	16	51	49	49	NUM
finefocus-615	16	52	)	)	PUNCT
finefocus-615	16	53	.	.	PUNCT
finefocus-615	17	1	the	the	DET
finefocus-615	17	2	early	early	ADJ
finefocus-615	17	3	process	process	NOUN
finefocus-615	17	4	of	of	ADP
finefocus-615	17	5	curd	curd	NOUN
finefocus-615	17	6	formation	formation	NOUN
finefocus-615	17	7	is	be	AUX
finefocus-615	17	8	well	well	ADV
finefocus-615	17	9	characterized	characterized	ADJ
finefocus-615	17	10	(	(	PUNCT
finefocus-615	17	11	11	11	NUM
finefocus-615	17	12	,	,	PUNCT
finefocus-615	17	13	16	16	NUM
finefocus-615	17	14	)	)	PUNCT
finefocus-615	17	15	.	.	PUNCT
finefocus-615	18	1	ripening	ripen	VERB
finefocus-615	18	2	begins	begin	VERB
finefocus-615	18	3	in	in	ADP
finefocus-615	18	4	milk	milk	NOUN
finefocus-615	18	5	,	,	PUNCT
finefocus-615	18	6	where	where	SCONJ
finefocus-615	18	7	lactic	lactic	ADJ
finefocus-615	18	8	acid	acid	NOUN
finefocus-615	18	9	bacteria	bacteria	NOUN
finefocus-615	18	10	(	(	PUNCT
finefocus-615	18	11	lab	lab	NOUN
finefocus-615	18	12	)	)	PUNCT
finefocus-615	18	13	such	such	ADJ
finefocus-615	18	14	as	as	ADP
finefocus-615	18	15	streptococcus	streptococcus	NOUN
finefocus-615	18	16	thermophilus	thermophilus	NOUN
finefocus-615	18	17	,	,	PUNCT
finefocus-615	18	18	lactobacillus	lactobacillus	X
finefocus-615	18	19	helveticus	helveticus	NOUN
finefocus-615	18	20	,	,	PUNCT
finefocus-615	18	21	and	and	CCONJ
finefocus-615	18	22	lactobacillus	lactobacillus	NOUN
finefocus-615	18	23	casei	casei	VERB
finefocus-615	18	24	ferment	ferment	NOUN
finefocus-615	18	25	lactose	lactose	NOUN
finefocus-615	18	26	into	into	ADP
finefocus-615	18	27	lactate	lactate	NOUN
finefocus-615	18	28	,	,	PUNCT
finefocus-615	18	29	acidify	acidify	VERB
finefocus-615	18	30	the	the	DET
finefocus-615	18	31	medium	medium	ADJ
finefocus-615	18	32	and	and	CCONJ
finefocus-615	18	33	digest	digest	ADJ
finefocus-615	18	34	proteins	protein	NOUN
finefocus-615	18	35	and	and	CCONJ
finefocus-615	18	36	milk	milk	NOUN
finefocus-615	18	37	(	(	PUNCT
finefocus-615	18	38	11	11	NUM
finefocus-615	18	39	,	,	PUNCT
finefocus-615	18	40	25	25	NUM
finefocus-615	18	41	,	,	PUNCT
finefocus-615	18	42	35	35	NUM
finefocus-615	18	43	,	,	PUNCT
finefocus-615	18	44	36	36	NUM
finefocus-615	18	45	)	)	PUNCT
finefocus-615	18	46	.	.	PUNCT
finefocus-615	19	1	lab	lab	NOUN
finefocus-615	19	2	can	can	AUX
finefocus-615	19	3	be	be	AUX
finefocus-615	19	4	introduced	introduce	VERB
finefocus-615	19	5	by	by	ADP
finefocus-615	19	6	a	a	DET
finefocus-615	19	7	starter	starter	ADJ
finefocus-615	19	8	culture	culture	NOUN
finefocus-615	19	9	,	,	PUNCT
finefocus-615	19	10	or	or	CCONJ
finefocus-615	19	11	the	the	DET
finefocus-615	19	12	milk	milk	NOUN
finefocus-615	19	13	can	can	AUX
finefocus-615	19	14	be	be	AUX
finefocus-615	19	15	permitted	permit	VERB
finefocus-615	19	16	to	to	PART
finefocus-615	19	17	acidify	acidify	VERB
finefocus-615	19	18	naturally	naturally	ADV
finefocus-615	19	19	from	from	ADP
finefocus-615	19	20	the	the	DET
finefocus-615	19	21	microbial	microbial	ADJ
finefocus-615	19	22	community	community	NOUN
finefocus-615	19	23	in	in	ADP
finefocus-615	19	24	it	it	PRON
finefocus-615	19	25	(	(	PUNCT
finefocus-615	19	26	6	6	NUM
finefocus-615	19	27	)	)	PUNCT
finefocus-615	19	28	.	.	PUNCT
finefocus-615	20	1	regardless	regardless	ADV
finefocus-615	20	2	of	of	ADP
finefocus-615	20	3	the	the	DET
finefocus-615	20	4	addition	addition	NOUN
finefocus-615	20	5	of	of	ADP
finefocus-615	20	6	starter	starter	ADJ
finefocus-615	20	7	culture	culture	NOUN
finefocus-615	20	8	,	,	PUNCT
finefocus-615	20	9	most	most	ADJ
finefocus-615	20	10	curds	curd	NOUN
finefocus-615	20	11	become	become	AUX
finefocus-615	20	12	inhabited	inhabit	VERB
finefocus-615	20	13	by	by	ADP
finefocus-615	20	14	a	a	DET
finefocus-615	20	15	simple	simple	ADJ
finefocus-615	20	16	community	community	NOUN
finefocus-615	20	17	,	,	PUNCT
finefocus-615	20	18	dominated	dominate	VERB
finefocus-615	20	19	by	by	ADP
finefocus-615	20	20	lactose	lactose	ADJ
finefocus-615	20	21	fermenters	fermenter	NOUN
finefocus-615	20	22	that	that	PRON
finefocus-615	20	23	may	may	AUX
finefocus-615	20	24	include	include	VERB
finefocus-615	20	25	organisms	organism	NOUN
finefocus-615	20	26	belonging	belong	VERB
finefocus-615	20	27	to	to	ADP
finefocus-615	20	28	genera	genera	NOUN
finefocus-615	20	29	lactococcus	lactococcus	NOUN
finefocus-615	20	30	,	,	PUNCT
finefocus-615	20	31	lactobacillus	lactobacillus	NOUN
finefocus-615	20	32	,	,	PUNCT
finefocus-615	20	33	leuconostoc	leuconostoc	ADJ
finefocus-615	20	34	,	,	PUNCT
finefocus-615	20	35	enterococcus	enterococcus	NOUN
finefocus-615	20	36	,	,	PUNCT
finefocus-615	20	37	staphylococcus	staphylococcus	NOUN
finefocus-615	20	38	,	,	PUNCT
finefocus-615	20	39	enterobacter	enterobacter	NOUN
finefocus-615	20	40	,	,	PUNCT
finefocus-615	20	41	and	and	CCONJ
finefocus-615	20	42	streptococcus	streptococcus	VERB
finefocus-615	20	43	(	(	PUNCT
finefocus-615	20	44	1	1	NUM
finefocus-615	20	45	,	,	PUNCT
finefocus-615	20	46	6	6	NUM
finefocus-615	20	47	,	,	PUNCT
finefocus-615	20	48	16	16	NUM
finefocus-615	20	49	)	)	PUNCT
finefocus-615	20	50	.	.	PUNCT
finefocus-615	21	1	after	after	ADP
finefocus-615	21	2	the	the	DET
finefocus-615	21	3	initial	initial	ADJ
finefocus-615	21	4	curd	curd	NOUN
finefocus-615	21	5	formation	formation	NOUN
finefocus-615	21	6	,	,	PUNCT
finefocus-615	21	7	the	the	DET
finefocus-615	21	8	rind	rind	NOUN
finefocus-615	21	9	begins	begin	VERB
finefocus-615	21	10	to	to	PART
finefocus-615	21	11	form	form	VERB
finefocus-615	21	12	.	.	PUNCT
finefocus-615	22	1	throughout	throughout	ADP
finefocus-615	22	2	the	the	DET
finefocus-615	22	3	ripening	ripening	NOUN
finefocus-615	22	4	,	,	PUNCT
finefocus-615	22	5	excess	excess	ADJ
finefocus-615	22	6	lactate	lactate	NOUN
finefocus-615	22	7	accumulates	accumulate	VERB
finefocus-615	22	8	and	and	CCONJ
finefocus-615	22	9	dissolves	dissolve	VERB
finefocus-615	22	10	into	into	ADP
finefocus-615	22	11	the	the	DET
finefocus-615	22	12	medium	medium	NOUN
finefocus-615	22	13	,	,	PUNCT
finefocus-615	22	14	eventually	eventually	ADV
finefocus-615	22	15	migrating	migrate	VERB
finefocus-615	22	16	upward	upward	ADV
finefocus-615	22	17	to	to	ADP
finefocus-615	22	18	the	the	DET
finefocus-615	22	19	curd	curd	NOUN
finefocus-615	22	20	surface	surface	NOUN
finefocus-615	22	21	(	(	PUNCT
finefocus-615	22	22	22	22	NUM
finefocus-615	22	23	)	)	PUNCT
finefocus-615	22	24	.	.	PUNCT
finefocus-615	23	1	once	once	ADV
finefocus-615	23	2	lactate	lactate	NOUN
finefocus-615	23	3	becomes	become	VERB
finefocus-615	23	4	accessible	accessible	ADJ
finefocus-615	23	5	at	at	ADP
finefocus-615	23	6	the	the	DET
finefocus-615	23	7	outer	outer	ADJ
finefocus-615	23	8	surface	surface	NOUN
finefocus-615	23	9	of	of	ADP
finefocus-615	23	10	the	the	DET
finefocus-615	23	11	cheese	cheese	NOUN
finefocus-615	23	12	,	,	PUNCT
finefocus-615	23	13	aerobic	aerobic	ADJ
finefocus-615	23	14	fungal	fungal	ADJ
finefocus-615	23	15	taxa	taxa	NOUN
finefocus-615	23	16	including	include	VERB
finefocus-615	23	17	candida	candida	PROPN
finefocus-615	23	18	,	,	PUNCT
finefocus-615	23	19	penicillium	penicillium	NOUN
finefocus-615	23	20	,	,	PUNCT
finefocus-615	23	21	and	and	CCONJ
finefocus-615	23	22	scopulariopsis	scopulariopsis	NOUN
finefocus-615	23	23	colonize	colonize	VERB
finefocus-615	23	24	the	the	DET
finefocus-615	23	25	surface	surface	NOUN
finefocus-615	23	26	and	and	CCONJ
finefocus-615	23	27	metabolize	metabolize	NOUN
finefocus-615	23	28	lactate	lactate	NOUN
finefocus-615	23	29	,	,	PUNCT
finefocus-615	23	30	leading	lead	VERB
finefocus-615	23	31	to	to	ADP
finefocus-615	23	32	an	an	DET
finefocus-615	23	33	increase	increase	NOUN
finefocus-615	23	34	in	in	ADP
finefocus-615	23	35	ph	ph	NOUN
finefocus-615	23	36	at	at	ADP
finefocus-615	23	37	the	the	DET
finefocus-615	23	38	surface	surface	NOUN
finefocus-615	23	39	environment	environment	NOUN
finefocus-615	23	40	(	(	PUNCT
finefocus-615	23	41	22	22	NUM
finefocus-615	23	42	,	,	PUNCT
finefocus-615	23	43	49	49	NUM
finefocus-615	23	44	)	)	PUNCT
finefocus-615	23	45	.	.	PUNCT
finefocus-615	24	1	de	de	NOUN
finefocus-615	24	2	-	-	NOUN
finefocus-615	24	3	acidification	acidification	NOUN
finefocus-615	24	4	facilitates	facilitate	VERB
finefocus-615	24	5	the	the	DET
finefocus-615	24	6	colonization	colonization	NOUN
finefocus-615	24	7	and	and	CCONJ
finefocus-615	24	8	succession	succession	NOUN
finefocus-615	24	9	of	of	ADP
finefocus-615	24	10	microbes	microbe	NOUN
finefocus-615	24	11	that	that	PRON
finefocus-615	24	12	prefer	prefer	VERB
finefocus-615	24	13	more	more	ADJ
finefocus-615	24	14	alkaline	alkaline	ADJ
finefocus-615	24	15	and	and	CCONJ
finefocus-615	24	16	salty	salty	ADJ
finefocus-615	24	17	conditions	condition	NOUN
finefocus-615	24	18	including	include	VERB
finefocus-615	24	19	coryneforms	coryneform	NOUN
finefocus-615	24	20	such	such	ADJ
finefocus-615	24	21	as	as	ADP
finefocus-615	24	22	corynebacterium	corynebacterium	NOUN
finefocus-615	24	23	,	,	PUNCT
finefocus-615	24	24	brevibacterium	brevibacterium	NOUN
finefocus-615	24	25	and	and	CCONJ
finefocus-615	24	26	brachybacterium	brachybacterium	NOUN
finefocus-615	24	27	(	(	PUNCT
finefocus-615	24	28	27	27	NUM
finefocus-615	24	29	,	,	PUNCT
finefocus-615	24	30	37	37	NUM
finefocus-615	24	31	,	,	PUNCT
finefocus-615	24	32	41	41	NUM
finefocus-615	24	33	)	)	PUNCT
finefocus-615	24	34	.	.	PUNCT
finefocus-615	25	1	the	the	DET
finefocus-615	25	2	composition	composition	NOUN
finefocus-615	25	3	of	of	ADP
finefocus-615	25	4	the	the	DET
finefocus-615	25	5	external	external	ADJ
finefocus-615	25	6	rind	rind	NOUN
finefocus-615	25	7	communities	community	NOUN
finefocus-615	25	8	is	be	AUX
finefocus-615	25	9	governed	govern	VERB
finefocus-615	25	10	by	by	ADP
finefocus-615	25	11	factors	factor	NOUN
finefocus-615	25	12	beyond	beyond	ADP
finefocus-615	25	13	ph	ph	NOUN
finefocus-615	25	14	,	,	PUNCT
finefocus-615	25	15	including	include	VERB
finefocus-615	25	16	microbe	microbe	NOUN
finefocus-615	25	17	-	-	PUNCT
finefocus-615	25	18	microbe	microbe	NOUN
finefocus-615	25	19	interactions	interaction	NOUN
finefocus-615	25	20	.	.	PUNCT
finefocus-615	26	1	fungal	fungal	ADJ
finefocus-615	26	2	species	specie	NOUN
finefocus-615	26	3	can	can	AUX
finefocus-615	26	4	contribute	contribute	VERB
finefocus-615	26	5	to	to	ADP
finefocus-615	26	6	cheeses	cheese	NOUN
finefocus-615	26	7	’	'	PUNCT
finefocus-615	26	8	unique	unique	ADJ
finefocus-615	26	9	characteristics	characteristic	NOUN
finefocus-615	26	10	,	,	PUNCT
finefocus-615	26	11	such	such	ADJ
finefocus-615	26	12	as	as	ADP
finefocus-615	26	13	the	the	DET
finefocus-615	26	14	blue	blue	ADJ
finefocus-615	26	15	-	-	PUNCT
finefocus-615	26	16	vein	vein	ADJ
finefocus-615	26	17	appearance	appearance	NOUN
finefocus-615	26	18	of	of	ADP
finefocus-615	26	19	roquefort	roquefort	NOUN
finefocus-615	26	20	by	by	ADP
finefocus-615	26	21	the	the	DET
finefocus-615	26	22	fungus	fungus	PROPN
finefocus-615	26	23	penicillium	penicillium	NOUN
finefocus-615	26	24	roqueforti	roqueforti	NOUN
finefocus-615	26	25	,	,	PUNCT
finefocus-615	26	26	and	and	CCONJ
finefocus-615	26	27	can	can	AUX
finefocus-615	26	28	be	be	AUX
finefocus-615	26	29	crucial	crucial	ADJ
finefocus-615	26	30	to	to	ADP
finefocus-615	26	31	the	the	DET
finefocus-615	26	32	survival	survival	NOUN
finefocus-615	26	33	of	of	ADP
finefocus-615	26	34	rind	rind	NOUN
finefocus-615	26	35	bacteria	bacteria	NOUN
finefocus-615	26	36	like	like	ADP
finefocus-615	26	37	corynebacterium	corynebacterium	NOUN
finefocus-615	26	38	,	,	PUNCT
finefocus-615	26	39	halomonas	halomonas	PROPN
finefocus-615	26	40	,	,	PUNCT
finefocus-615	26	41	pseudomonas	pseudomonas	PROPN
finefocus-615	26	42	,	,	PUNCT
finefocus-615	26	43	pseudoalteromonas	pseudoalteromona	NOUN
finefocus-615	26	44	,	,	PUNCT
finefocus-615	26	45	and	and	CCONJ
finefocus-615	26	46	vibrio	vibrio	ADJ
finefocus-615	26	47	spp	spp	NOUN
finefocus-615	26	48	.	.	PUNCT
finefocus-615	27	1	(	(	PUNCT
finefocus-615	27	2	4	4	NUM
finefocus-615	27	3	,	,	PUNCT
finefocus-615	27	4	29	29	NUM
finefocus-615	27	5	,	,	PUNCT
finefocus-615	27	6	49	49	NUM
finefocus-615	27	7	)	)	PUNCT
finefocus-615	27	8	.	.	PUNCT
finefocus-615	28	1	fungi	fungus	NOUN
finefocus-615	28	2	such	such	ADJ
finefocus-615	28	3	as	as	ADP
finefocus-615	28	4	those	those	PRON
finefocus-615	28	5	belonging	belong	VERB
finefocus-615	28	6	to	to	ADP
finefocus-615	28	7	the	the	DET
finefocus-615	28	8	spore	spore	ADV
finefocus-615	28	9	-	-	PUNCT
finefocus-615	28	10	forming	form	VERB
finefocus-615	28	11	penicillium	penicillium	NOUN
finefocus-615	28	12	species	specie	NOUN
finefocus-615	28	13	can	can	AUX
finefocus-615	28	14	also	also	ADV
finefocus-615	28	15	produce	produce	VERB
finefocus-615	28	16	antibacterial	antibacterial	ADJ
finefocus-615	28	17	compounds	compound	NOUN
finefocus-615	28	18	that	that	PRON
finefocus-615	28	19	can	can	AUX
finefocus-615	28	20	lead	lead	VERB
finefocus-615	28	21	to	to	ADP
finefocus-615	28	22	selection	selection	NOUN
finefocus-615	28	23	for	for	ADP
finefocus-615	28	24	more	more	ADJ
finefocus-615	28	25	antibiotic	antibiotic	ADJ
finefocus-615	28	26	-	-	PUNCT
finefocus-615	28	27	resistant	resistant	ADJ
finefocus-615	28	28	bacterial	bacterial	ADJ
finefocus-615	28	29	strains	strain	NOUN
finefocus-615	28	30	(	(	PUNCT
finefocus-615	28	31	28	28	NUM
finefocus-615	28	32	)	)	PUNCT
finefocus-615	28	33	.	.	PUNCT
finefocus-615	29	1	likewise	likewise	ADV
finefocus-615	29	2	,	,	PUNCT
finefocus-615	29	3	bacteria	bacteria	NOUN
finefocus-615	29	4	on	on	ADP
finefocus-615	29	5	the	the	DET
finefocus-615	29	6	rind	rind	NOUN
finefocus-615	29	7	such	such	ADJ
finefocus-615	29	8	as	as	ADP
finefocus-615	29	9	those	those	PRON
finefocus-615	29	10	belonging	belong	VERB
finefocus-615	29	11	to	to	ADP
finefocus-615	29	12	the	the	DET
finefocus-615	29	13	antibioticproducing	antibioticproduce	VERB
finefocus-615	29	14	actinomycetes	actinomycete	NOUN
finefocus-615	29	15	group	group	NOUN
finefocus-615	29	16	can	can	AUX
finefocus-615	29	17	have	have	VERB
finefocus-615	29	18	a	a	DET
finefocus-615	29	19	similar	similar	ADJ
finefocus-615	29	20	effect	effect	NOUN
finefocus-615	29	21	(	(	PUNCT
finefocus-615	29	22	32	32	NUM
finefocus-615	29	23	)	)	PUNCT
finefocus-615	29	24	.	.	PUNCT
finefocus-615	30	1	the	the	DET
finefocus-615	30	2	possibility	possibility	NOUN
finefocus-615	30	3	of	of	ADP
finefocus-615	30	4	cheese	cheese	NOUN
finefocus-615	30	5	bacteria	bacteria	NOUN
finefocus-615	30	6	developing	develop	VERB
finefocus-615	30	7	resistance	resistance	NOUN
finefocus-615	30	8	mechanisms	mechanism	NOUN
finefocus-615	30	9	has	have	AUX
finefocus-615	30	10	warranted	warrant	VERB
finefocus-615	30	11	the	the	DET
finefocus-615	30	12	characterization	characterization	NOUN
finefocus-615	30	13	of	of	ADP
finefocus-615	30	14	antibioticsusceptibility	antibioticsusceptibility	NOUN
finefocus-615	30	15	of	of	ADP
finefocus-615	30	16	bacteria	bacteria	NOUN
finefocus-615	30	17	on	on	ADP
finefocus-615	30	18	various	various	ADJ
finefocus-615	30	19	types	type	NOUN
finefocus-615	30	20	of	of	ADP
finefocus-615	30	21	cheeses	cheese	NOUN
finefocus-615	30	22	(	(	PUNCT
finefocus-615	30	23	4	4	NUM
finefocus-615	30	24	,	,	PUNCT
finefocus-615	30	25	29	29	NUM
finefocus-615	30	26	)	)	PUNCT
finefocus-615	30	27	.	.	PUNCT
finefocus-615	31	1	while	while	SCONJ
finefocus-615	31	2	many	many	ADJ
finefocus-615	31	3	studies	study	NOUN
finefocus-615	31	4	have	have	AUX
finefocus-615	31	5	characterized	characterize	VERB
finefocus-615	31	6	the	the	DET
finefocus-615	31	7	succession	succession	NOUN
finefocus-615	31	8	of	of	ADP
finefocus-615	31	9	early	early	ADJ
finefocus-615	31	10	cheese	cheese	NOUN
finefocus-615	31	11	community	community	NOUN
finefocus-615	31	12	development	development	NOUN
finefocus-615	31	13	from	from	ADP
finefocus-615	31	14	curd	curd	NOUN
finefocus-615	31	15	to	to	ADP
finefocus-615	31	16	rind	rind	NOUN
finefocus-615	31	17	in	in	ADP
finefocus-615	31	18	individual	individual	ADJ
finefocus-615	31	19	natural	natural	ADJ
finefocus-615	31	20	rind	rind	NOUN
finefocus-615	31	21	cheeses	cheese	NOUN
finefocus-615	31	22	(	(	PUNCT
finefocus-615	31	23	1	1	NUM
finefocus-615	31	24	,	,	PUNCT
finefocus-615	31	25	16	16	NUM
finefocus-615	31	26	,	,	PUNCT
finefocus-615	31	27	20	20	NUM
finefocus-615	31	28	,	,	PUNCT
finefocus-615	31	29	21	21	NUM
finefocus-615	31	30	)	)	PUNCT
finefocus-615	31	31	,	,	PUNCT
finefocus-615	31	32	less	less	ADV
finefocus-615	31	33	is	be	AUX
finefocus-615	31	34	known	know	VERB
finefocus-615	31	35	about	about	ADP
finefocus-615	31	36	the	the	DET
finefocus-615	31	37	comparison	comparison	NOUN
finefocus-615	31	38	of	of	ADP
finefocus-615	31	39	microbial	microbial	ADJ
finefocus-615	31	40	composition	composition	NOUN
finefocus-615	31	41	of	of	ADP
finefocus-615	31	42	a	a	DET
finefocus-615	31	43	mature	mature	ADJ
finefocus-615	31	44	rind	rind	NOUN
finefocus-615	31	45	to	to	ADP
finefocus-615	31	46	a	a	DET
finefocus-615	31	47	mature	mature	ADJ
finefocus-615	31	48	curd	curd	NOUN
finefocus-615	31	49	within	within	ADP
finefocus-615	31	50	and	and	CCONJ
finefocus-615	31	51	across	across	ADP
finefocus-615	31	52	natural	natural	ADJ
finefocus-615	31	53	rind	rind	NOUN
finefocus-615	31	54	cheese	cheese	NOUN
finefocus-615	31	55	varieties	variety	NOUN
finefocus-615	31	56	.	.	PUNCT
finefocus-615	32	1	here	here	ADV
finefocus-615	32	2	we	we	PRON
finefocus-615	32	3	compare	compare	VERB
finefocus-615	32	4	microbial	microbial	ADJ
finefocus-615	32	5	community	community	NOUN
finefocus-615	32	6	structure	structure	NOUN
finefocus-615	32	7	between	between	ADP
finefocus-615	32	8	the	the	DET
finefocus-615	32	9	rinds	rind	NOUN
finefocus-615	32	10	and	and	CCONJ
finefocus-615	32	11	curds	curd	NOUN
finefocus-615	32	12	of	of	ADP
finefocus-615	32	13	seven	seven	NUM
finefocus-615	32	14	naturalrind	naturalrind	ADJ
finefocus-615	32	15	cheeses	cheese	NOUN
finefocus-615	32	16	that	that	PRON
finefocus-615	32	17	differ	differ	VERB
finefocus-615	32	18	by	by	ADP
finefocus-615	32	19	ph	ph	ADJ
finefocus-615	32	20	,	,	PUNCT
finefocus-615	32	21	moisture	moisture	NOUN
finefocus-615	32	22	content	content	NOUN
finefocus-615	32	23	,	,	PUNCT
finefocus-615	32	24	and	and	CCONJ
finefocus-615	32	25	milk	milk	NOUN
finefocus-615	32	26	source	source	NOUN
finefocus-615	32	27	.	.	PUNCT
finefocus-615	33	1	to	to	PART
finefocus-615	33	2	obtain	obtain	VERB
finefocus-615	33	3	a	a	DET
finefocus-615	33	4	detailed	detailed	ADJ
finefocus-615	33	5	understanding	understanding	NOUN
finefocus-615	33	6	of	of	ADP
finefocus-615	33	7	the	the	DET
finefocus-615	33	8	rind	rind	NOUN
finefocus-615	33	9	and	and	CCONJ
finefocus-615	33	10	curd	curd	NOUN
finefocus-615	33	11	microbial	microbial	ADJ
finefocus-615	33	12	communities	community	NOUN
finefocus-615	33	13	,	,	PUNCT
finefocus-615	33	14	we	we	PRON
finefocus-615	33	15	used	use	VERB
finefocus-615	33	16	culture	culture	NOUN
finefocus-615	33	17	-	-	PUNCT
finefocus-615	33	18	independent	independent	ADJ
finefocus-615	33	19	,	,	PUNCT
finefocus-615	33	20	high	high	ADJ
finefocus-615	33	21	-	-	PUNCT
finefocus-615	33	22	throughput	throughput	NOUN
finefocus-615	33	23	illumina	illumina	NOUN
finefocus-615	33	24	sequencing	sequencing	NOUN
finefocus-615	33	25	of	of	ADP
finefocus-615	33	26	16s	16s	PROPN
finefocus-615	33	27	rrna	rrna	PROPN
finefocus-615	33	28	genes	gene	NOUN
finefocus-615	33	29	.	.	PUNCT
finefocus-615	34	1	we	we	PRON
finefocus-615	34	2	also	also	ADV
finefocus-615	34	3	sought	seek	VERB
finefocus-615	34	4	to	to	PART
finefocus-615	34	5	characterize	characterize	VERB
finefocus-615	34	6	specific	specific	ADJ
finefocus-615	34	7	bacteria	bacteria	NOUN
finefocus-615	34	8	cultured	cultured	ADJ
finefocus-615	34	9	from	from	ADP
finefocus-615	34	10	the	the	DET
finefocus-615	34	11	cheeses	cheese	NOUN
finefocus-615	34	12	.	.	PUNCT
finefocus-615	35	1	these	these	DET
finefocus-615	35	2	isolates	isolate	NOUN
finefocus-615	35	3	were	be	AUX
finefocus-615	35	4	identified	identify	VERB
finefocus-615	35	5	using	use	VERB
finefocus-615	35	6	sanger	sanger	PROPN
finefocus-615	35	7	sequencing	sequencing	NOUN
finefocus-615	35	8	of	of	ADP
finefocus-615	35	9	the	the	DET
finefocus-615	35	10	16s	16s	PROPN
finefocus-615	35	11	rrna	rrna	PROPN
finefocus-615	35	12	gene	gene	NOUN
finefocus-615	35	13	(	(	PUNCT
finefocus-615	35	14	40	40	NUM
finefocus-615	35	15	)	)	PUNCT
finefocus-615	35	16	and	and	CCONJ
finefocus-615	35	17	were	be	AUX
finefocus-615	35	18	assayed	assayed	ADJ
finefocus-615	35	19	for	for	ADP
finefocus-615	35	20	antibiotic	antibiotic	ADJ
finefocus-615	35	21	susceptibility	susceptibility	NOUN
finefocus-615	35	22	and	and	CCONJ
finefocus-615	35	23	carbon	carbon	NOUN
finefocus-615	35	24	utilization	utilization	NOUN
finefocus-615	35	25	profiles	profile	NOUN
finefocus-615	35	26	using	use	VERB
finefocus-615	35	27	biolog	biolog	PROPN
finefocus-615	35	28	’s	’s	PART
finefocus-615	35	29	ecoplates	ecoplate	NOUN
finefocus-615	35	30	.	.	PUNCT
finefocus-615	36	1	through	through	ADP
finefocus-615	36	2	these	these	DET
finefocus-615	36	3	analyses	analysis	NOUN
finefocus-615	36	4	,	,	PUNCT
finefocus-615	36	5	we	we	PRON
finefocus-615	36	6	aimed	aim	VERB
finefocus-615	36	7	to	to	PART
finefocus-615	36	8	evaluate	evaluate	VERB
finefocus-615	36	9	the	the	DET
finefocus-615	36	10	following	following	ADJ
finefocus-615	36	11	hypotheses	hypothesis	NOUN
finefocus-615	36	12	:	:	PUNCT
finefocus-615	36	13	1	1	X
finefocus-615	36	14	)	)	PUNCT
finefocus-615	36	15	cheese	cheese	NOUN
finefocus-615	36	16	rind	rind	NOUN
finefocus-615	36	17	communities	community	NOUN
finefocus-615	36	18	would	would	AUX
finefocus-615	36	19	exhibit	exhibit	VERB
finefocus-615	36	20	higher	high	ADJ
finefocus-615	36	21	taxonomical	taxonomical	ADJ
finefocus-615	36	22	diversity	diversity	NOUN
finefocus-615	36	23	than	than	ADP
finefocus-615	36	24	curd	curd	NOUN
finefocus-615	36	25	communities	community	NOUN
finefocus-615	36	26	;	;	PUNCT
finefocus-615	36	27	2	2	X
finefocus-615	36	28	)	)	PUNCT
finefocus-615	36	29	antibiotic	antibiotic	ADJ
finefocus-615	36	30	susceptibility	susceptibility	NOUN
finefocus-615	36	31	of	of	ADP
finefocus-615	36	32	cheese	cheese	NOUN
finefocus-615	36	33	isolates	isolate	NOUN
finefocus-615	36	34	would	would	AUX
finefocus-615	36	35	differ	differ	VERB
finefocus-615	36	36	between	between	ADP
finefocus-615	36	37	cheeses	cheese	NOUN
finefocus-615	36	38	and	and	CCONJ
finefocus-615	36	39	between	between	ADP
finefocus-615	36	40	the	the	DET
finefocus-615	36	41	two	two	NUM
finefocus-615	36	42	regions	region	NOUN
finefocus-615	36	43	where	where	SCONJ
finefocus-615	36	44	these	these	DET
finefocus-615	36	45	cheeses	cheese	NOUN
finefocus-615	36	46	originated	originate	VERB
finefocus-615	36	47	,	,	PUNCT
finefocus-615	36	48	europe	europe	PROPN
finefocus-615	36	49	and	and	CCONJ
finefocus-615	36	50	the	the	DET
finefocus-615	36	51	u.s	u.s	PROPN
finefocus-615	36	52	.	.	PROPN
finefocus-615	36	53	;	;	PUNCT
finefocus-615	36	54	and	and	CCONJ
finefocus-615	36	55	3	3	X
finefocus-615	36	56	)	)	PUNCT
finefocus-615	36	57	cheeses	cheese	NOUN
finefocus-615	36	58	with	with	ADP
finefocus-615	36	59	higher	high	ADJ
finefocus-615	36	60	taxonomical	taxonomical	ADJ
finefocus-615	36	61	diversity	diversity	NOUN
finefocus-615	36	62	would	would	AUX
finefocus-615	36	63	be	be	AUX
finefocus-615	36	64	more	more	ADV
finefocus-615	36	65	metabolically	metabolically	ADV
finefocus-615	36	66	active	active	ADJ
finefocus-615	36	67	and	and	CCONJ
finefocus-615	36	68	can	can	AUX
finefocus-615	36	69	utilize	utilize	VERB
finefocus-615	36	70	more	more	ADJ
finefocus-615	36	71	carbon	carbon	NOUN
finefocus-615	36	72	sources	source	NOUN
finefocus-615	36	73	.	.	PUNCT
finefocus-615	37	1	this	this	DET
finefocus-615	37	2	study	study	NOUN
finefocus-615	37	3	contributes	contribute	VERB
finefocus-615	37	4	to	to	ADP
finefocus-615	37	5	the	the	DET
finefocus-615	37	6	characterization	characterization	NOUN
finefocus-615	37	7	of	of	ADP
finefocus-615	37	8	the	the	DET
finefocus-615	37	9	curdand	curdand	NOUN
finefocus-615	37	10	rindassociated	rindassociate	VERB
finefocus-615	37	11	communities	community	NOUN
finefocus-615	37	12	of	of	ADP
finefocus-615	37	13	natural	natural	ADJ
finefocus-615	37	14	rind	rind	NOUN
finefocus-615	37	15	cheeses	cheese	NOUN
finefocus-615	37	16	and	and	CCONJ
finefocus-615	37	17	reveals	reveal	VERB
finefocus-615	37	18	patterns	pattern	NOUN
finefocus-615	37	19	of	of	ADP
finefocus-615	37	20	microbial	microbial	ADJ
finefocus-615	37	21	diversity	diversity	NOUN
finefocus-615	37	22	according	accord	VERB
finefocus-615	37	23	to	to	ADP
finefocus-615	37	24	cheese	cheese	NOUN
finefocus-615	37	25	type	type	NOUN
finefocus-615	37	26	as	as	ADV
finefocus-615	37	27	well	well	ADV
finefocus-615	37	28	as	as	ADP
finefocus-615	37	29	the	the	DET
finefocus-615	37	30	overall	overall	ADJ
finefocus-615	37	31	metabolic	metabolic	NOUN
finefocus-615	37	32	and	and	CCONJ
finefocus-615	37	33	antibiotic	antibiotic	ADJ
finefocus-615	37	34	resistance	resistance	NOUN
finefocus-615	37	35	profile	profile	NOUN
finefocus-615	37	36	of	of	ADP
finefocus-615	37	37	isolates	isolate	NOUN
finefocus-615	37	38	from	from	ADP
finefocus-615	37	39	the	the	DET
finefocus-615	37	40	different	different	ADJ
finefocus-615	37	41	cheeses	cheese	NOUN
finefocus-615	37	42	.	.	PUNCT
finefocus-615	38	1	12	12	NUM
finefocus-615	38	2	•	•	NUM
finefocus-615	38	3	fine	fine	ADJ
finefocus-615	38	4	focus	focus	NOUN
finefocus-615	38	5	,	,	PUNCT
finefocus-615	38	6	vol	vol	NOUN
finefocus-615	38	7	.	.	NOUN
finefocus-615	38	8	3	3	NUM
finefocus-615	38	9	(	(	PUNCT
finefocus-615	38	10	1	1	NUM
finefocus-615	38	11	)	)	PUNCT
finefocus-615	38	12	methods	method	NOUN
finefocus-615	38	13	sample	sample	NOUN
finefocus-615	38	14	collection	collection	NOUN
finefocus-615	38	15	and	and	CCONJ
finefocus-615	38	16	environmental	environmental	ADJ
finefocus-615	38	17	parameters	parameter	NOUN
finefocus-615	38	18	seven	seven	NUM
finefocus-615	38	19	natural	natural	ADJ
finefocus-615	38	20	rind	rind	NOUN
finefocus-615	38	21	cheeses	cheese	NOUN
finefocus-615	38	22	—	—	PUNCT
finefocus-615	38	23	vermont	vermont	NOUN
finefocus-615	38	24	shepherd	shepherd	NOUN
finefocus-615	38	25	,	,	PUNCT
finefocus-615	38	26	stichelton	stichelton	NOUN
finefocus-615	38	27	,	,	PUNCT
finefocus-615	38	28	sonnet	sonnet	NOUN
finefocus-615	38	29	,	,	PUNCT
finefocus-615	38	30	missouri	missouri	PROPN
finefocus-615	38	31	truckle	truckle	PROPN
finefocus-615	38	32	,	,	PUNCT
finefocus-615	38	33	maggie	maggie	PROPN
finefocus-615	38	34	’s	’s	PART
finefocus-615	38	35	round	round	ADJ
finefocus-615	38	36	,	,	PUNCT
finefocus-615	38	37	comte	comte	NOUN
finefocus-615	38	38	,	,	PUNCT
finefocus-615	38	39	and	and	CCONJ
finefocus-615	38	40	alpage	alpage	VERB
finefocus-615	38	41	gruyere	gruyere	NOUN
finefocus-615	38	42	—	—	PUNCT
finefocus-615	38	43	were	be	AUX
finefocus-615	38	44	obtained	obtain	VERB
finefocus-615	38	45	from	from	ADP
finefocus-615	38	46	wasik	wasik	NOUN
finefocus-615	38	47	’s	’s	PART
finefocus-615	38	48	cheese	cheese	NOUN
finefocus-615	38	49	shop	shop	NOUN
finefocus-615	38	50	in	in	ADP
finefocus-615	38	51	wellesley	wellesley	PROPN
finefocus-615	38	52	,	,	PUNCT
finefocus-615	38	53	massachusetts	massachusetts	PROPN
finefocus-615	38	54	.	.	PUNCT
finefocus-615	39	1	a	a	DET
finefocus-615	39	2	100	100	NUM
finefocus-615	39	3	+	+	NOUN
finefocus-615	39	4	/10	/10	ADJ
finefocus-615	39	5	mg	mg	PROPN
finefocus-615	39	6	sample	sample	NOUN
finefocus-615	39	7	from	from	ADP
finefocus-615	39	8	each	each	PRON
finefocus-615	39	9	of	of	ADP
finefocus-615	39	10	the	the	DET
finefocus-615	39	11	rinds	rind	NOUN
finefocus-615	39	12	and	and	CCONJ
finefocus-615	39	13	curds	curd	NOUN
finefocus-615	39	14	of	of	ADP
finefocus-615	39	15	the	the	DET
finefocus-615	39	16	examined	examine	VERB
finefocus-615	39	17	cheeses	cheese	NOUN
finefocus-615	39	18	was	be	AUX
finefocus-615	39	19	collected	collect	VERB
finefocus-615	39	20	aseptically	aseptically	ADV
finefocus-615	39	21	and	and	CCONJ
finefocus-615	39	22	processed	process	VERB
finefocus-615	39	23	immediately	immediately	ADV
finefocus-615	39	24	.	.	PUNCT
finefocus-615	40	1	rind	rind	NOUN
finefocus-615	40	2	samples	sample	NOUN
finefocus-615	40	3	were	be	AUX
finefocus-615	40	4	scraped	scrape	VERB
finefocus-615	40	5	using	use	VERB
finefocus-615	40	6	a	a	DET
finefocus-615	40	7	sterile	sterile	ADJ
finefocus-615	40	8	razor	razor	NOUN
finefocus-615	40	9	blade	blade	NOUN
finefocus-615	40	10	and	and	CCONJ
finefocus-615	40	11	curd	curd	NOUN
finefocus-615	40	12	samples	sample	NOUN
finefocus-615	40	13	were	be	AUX
finefocus-615	40	14	taken	take	VERB
finefocus-615	40	15	from	from	ADP
finefocus-615	40	16	the	the	DET
finefocus-615	40	17	cheese	cheese	NOUN
finefocus-615	40	18	center	center	NOUN
finefocus-615	40	19	after	after	ADP
finefocus-615	40	20	scraping	scrape	VERB
finefocus-615	40	21	off	off	ADP
finefocus-615	40	22	the	the	DET
finefocus-615	40	23	exposed	expose	VERB
finefocus-615	40	24	curd	curd	NOUN
finefocus-615	40	25	layer	layer	NOUN
finefocus-615	40	26	.	.	PUNCT
finefocus-615	41	1	a	a	DET
finefocus-615	41	2	solidstate	solidstate	NOUN
finefocus-615	41	3	ph	ph	ADJ
finefocus-615	41	4	meter	meter	NOUN
finefocus-615	41	5	(	(	PUNCT
finefocus-615	41	6	s175cd	s175cd	NOUN
finefocus-615	41	7	/	/	SYM
finefocus-615	41	8	bnc	bnc	NOUN
finefocus-615	41	9	;	;	PUNCT
finefocus-615	41	10	sensorex	sensorex	PROPN
finefocus-615	41	11	,	,	PUNCT
finefocus-615	41	12	garden	garden	PROPN
finefocus-615	41	13	grove	grove	PROPN
finefocus-615	41	14	,	,	PUNCT
finefocus-615	41	15	ca	ca	NOUN
finefocus-615	41	16	)	)	PUNCT
finefocus-615	41	17	was	be	AUX
finefocus-615	41	18	used	use	VERB
finefocus-615	41	19	to	to	PART
finefocus-615	41	20	determine	determine	VERB
finefocus-615	41	21	the	the	DET
finefocus-615	41	22	ph	ph	NOUN
finefocus-615	41	23	of	of	ADP
finefocus-615	41	24	each	each	DET
finefocus-615	41	25	cheese	cheese	NOUN
finefocus-615	41	26	rind	rind	NOUN
finefocus-615	41	27	and	and	CCONJ
finefocus-615	41	28	curd	curd	NOUN
finefocus-615	41	29	.	.	PUNCT
finefocus-615	42	1	samples	sample	NOUN
finefocus-615	42	2	were	be	AUX
finefocus-615	42	3	dried	dry	VERB
finefocus-615	42	4	for	for	ADP
finefocus-615	42	5	7	7	NUM
finefocus-615	42	6	days	day	NOUN
finefocus-615	42	7	and	and	CCONJ
finefocus-615	42	8	moisture	moisture	NOUN
finefocus-615	42	9	was	be	AUX
finefocus-615	42	10	determined	determine	VERB
finefocus-615	42	11	by	by	ADP
finefocus-615	42	12	subtracting	subtract	VERB
finefocus-615	42	13	the	the	DET
finefocus-615	42	14	dry	dry	ADJ
finefocus-615	42	15	weight	weight	NOUN
finefocus-615	42	16	of	of	ADP
finefocus-615	42	17	the	the	DET
finefocus-615	42	18	sample	sample	NOUN
finefocus-615	42	19	from	from	ADP
finefocus-615	42	20	the	the	DET
finefocus-615	42	21	original	original	ADJ
finefocus-615	42	22	wet	wet	ADJ
finefocus-615	42	23	weight	weight	NOUN
finefocus-615	42	24	of	of	ADP
finefocus-615	42	25	a	a	DET
finefocus-615	42	26	1	1	NUM
finefocus-615	42	27	g	g	NOUN
finefocus-615	42	28	sample	sample	NOUN
finefocus-615	42	29	.	.	PUNCT
finefocus-615	43	1	bacterial	bacterial	ADJ
finefocus-615	43	2	isolation	isolation	NOUN
finefocus-615	43	3	and	and	CCONJ
finefocus-615	43	4	characterization	characterization	NOUN
finefocus-615	43	5	the	the	DET
finefocus-615	43	6	100	100	NUM
finefocus-615	43	7	+	+	NOUN
finefocus-615	43	8	/10	/10	ADJ
finefocus-615	43	9	mg	mg	X
finefocus-615	43	10	of	of	ADP
finefocus-615	43	11	fresh	fresh	ADJ
finefocus-615	43	12	rind	rind	NOUN
finefocus-615	43	13	and	and	CCONJ
finefocus-615	43	14	curd	curd	NOUN
finefocus-615	43	15	samples	sample	NOUN
finefocus-615	43	16	were	be	AUX
finefocus-615	43	17	crushed	crush	VERB
finefocus-615	43	18	using	use	VERB
finefocus-615	43	19	a	a	DET
finefocus-615	43	20	pellet	pellet	NOUN
finefocus-615	43	21	pestle	pestle	NOUN
finefocus-615	43	22	and	and	CCONJ
finefocus-615	43	23	diluted	dilute	VERB
finefocus-615	43	24	in	in	ADP
finefocus-615	43	25	sterile	sterile	ADJ
finefocus-615	43	26	water	water	NOUN
finefocus-615	43	27	to	to	ADP
finefocus-615	43	28	10	10	NUM
finefocus-615	43	29	-	-	SYM
finefocus-615	43	30	3	3	NUM
finefocus-615	43	31	,	,	PUNCT
finefocus-615	43	32	10	10	NUM
finefocus-615	43	33	-	-	SYM
finefocus-615	43	34	4	4	NUM
finefocus-615	43	35	,	,	PUNCT
finefocus-615	43	36	and	and	CCONJ
finefocus-615	43	37	10	10	NUM
finefocus-615	43	38	-	-	SYM
finefocus-615	43	39	5	5	NUM
finefocus-615	43	40	of	of	ADP
finefocus-615	43	41	their	their	PRON
finefocus-615	43	42	original	original	ADJ
finefocus-615	43	43	concentrations	concentration	NOUN
finefocus-615	43	44	.	.	PUNCT
finefocus-615	44	1	all	all	DET
finefocus-615	44	2	diluted	dilute	VERB
finefocus-615	44	3	samples	sample	NOUN
finefocus-615	44	4	were	be	AUX
finefocus-615	44	5	grown	grow	VERB
finefocus-615	44	6	aerobically	aerobically	ADV
finefocus-615	44	7	at	at	ADP
finefocus-615	44	8	room	room	NOUN
finefocus-615	44	9	temperature	temperature	NOUN
finefocus-615	44	10	on	on	ADP
finefocus-615	44	11	three	three	NUM
finefocus-615	44	12	different	different	ADJ
finefocus-615	44	13	media	medium	NOUN
finefocus-615	44	14	:	:	PUNCT
finefocus-615	44	15	plate	plate	NOUN
finefocus-615	44	16	count	count	NOUN
finefocus-615	44	17	agar	agar	NOUN
finefocus-615	44	18	(	(	PUNCT
finefocus-615	44	19	pca	pca	PROPN
finefocus-615	44	20	)	)	PUNCT
finefocus-615	44	21	with	with	ADP
finefocus-615	44	22	milk	milk	NOUN
finefocus-615	44	23	(	(	PUNCT
finefocus-615	44	24	pcam	pcam	NOUN
finefocus-615	44	25	:	:	PUNCT
finefocus-615	44	26	5	5	NUM
finefocus-615	44	27	g	g	NOUN
finefocus-615	44	28	peptone	peptone	NOUN
finefocus-615	44	29	,	,	PUNCT
finefocus-615	44	30	2.5	2.5	NUM
finefocus-615	44	31	g	g	NOUN
finefocus-615	44	32	yeast	yeast	NOUN
finefocus-615	44	33	extract	extract	NOUN
finefocus-615	44	34	,	,	PUNCT
finefocus-615	44	35	1	1	NUM
finefocus-615	44	36	g	g	NOUN
finefocus-615	44	37	dextrose	dextrose	NOUN
finefocus-615	44	38	,	,	PUNCT
finefocus-615	44	39	1	1	NUM
finefocus-615	44	40	g	g	NOUN
finefocus-615	44	41	of	of	ADP
finefocus-615	44	42	whole	whole	ADJ
finefocus-615	44	43	milk	milk	NOUN
finefocus-615	44	44	powder	powder	NOUN
finefocus-615	44	45	,	,	PUNCT
finefocus-615	44	46	15	15	NUM
finefocus-615	44	47	g	g	NOUN
finefocus-615	44	48	agar	agar	NOUN
finefocus-615	44	49	)	)	PUNCT
finefocus-615	44	50	,	,	PUNCT
finefocus-615	44	51	nutrient	nutrient	NOUN
finefocus-615	44	52	agar	agar	NOUN
finefocus-615	44	53	(	(	PUNCT
finefocus-615	44	54	na	na	NOUN
finefocus-615	44	55	:	:	PUNCT
finefocus-615	44	56	0.5	0.5	NUM
finefocus-615	44	57	%	%	NOUN
finefocus-615	44	58	peptone	peptone	NOUN
finefocus-615	44	59	,	,	PUNCT
finefocus-615	44	60	0.3	0.3	NUM
finefocus-615	44	61	%	%	NOUN
finefocus-615	44	62	beef	beef	NOUN
finefocus-615	44	63	extract	extract	NOUN
finefocus-615	44	64	/	/	SYM
finefocus-615	44	65	yeast	yeast	NOUN
finefocus-615	44	66	extract	extract	NOUN
finefocus-615	44	67	,	,	PUNCT
finefocus-615	44	68	1.5	1.5	NUM
finefocus-615	44	69	%	%	NOUN
finefocus-615	44	70	agar	agar	NOUN
finefocus-615	44	71	,	,	PUNCT
finefocus-615	44	72	0.5	0.5	NUM
finefocus-615	44	73	%	%	NOUN
finefocus-615	44	74	nacl	nacl	NOUN
finefocus-615	44	75	)	)	PUNCT
finefocus-615	44	76	and	and	CCONJ
finefocus-615	44	77	pca	pca	NOUN
finefocus-615	44	78	with	with	ADP
finefocus-615	44	79	fermentation	fermentation	NOUN
finefocus-615	44	80	indicators	indicator	NOUN
finefocus-615	44	81	for	for	ADP
finefocus-615	44	82	lactose	lactose	NOUN
finefocus-615	44	83	(	(	PUNCT
finefocus-615	44	84	5	5	NUM
finefocus-615	44	85	g	g	NOUN
finefocus-615	44	86	peptone	peptone	NOUN
finefocus-615	44	87	,	,	PUNCT
finefocus-615	44	88	2.5	2.5	NUM
finefocus-615	44	89	g	g	NOUN
finefocus-615	44	90	yeast	yeast	NOUN
finefocus-615	44	91	extract	extract	NOUN
finefocus-615	44	92	,	,	PUNCT
finefocus-615	44	93	1	1	NUM
finefocus-615	44	94	g	g	NOUN
finefocus-615	44	95	dextrose	dextrose	NOUN
finefocus-615	44	96	,	,	PUNCT
finefocus-615	44	97	10	10	NUM
finefocus-615	44	98	g	g	NOUN
finefocus-615	44	99	lactose	lactose	NOUN
finefocus-615	44	100	,	,	PUNCT
finefocus-615	44	101	0.03	0.03	NUM
finefocus-615	44	102	g	g	NOUN
finefocus-615	44	103	neutral	neutral	ADJ
finefocus-615	44	104	red	red	ADJ
finefocus-615	44	105	,	,	PUNCT
finefocus-615	44	106	15	15	NUM
finefocus-615	44	107	g	g	NOUN
finefocus-615	44	108	agar	agar	NOUN
finefocus-615	44	109	)	)	PUNCT
finefocus-615	44	110	.	.	PUNCT
finefocus-615	45	1	isolates	isolate	NOUN
finefocus-615	45	2	were	be	AUX
finefocus-615	45	3	restreaked	restreake	VERB
finefocus-615	45	4	from	from	ADP
finefocus-615	45	5	single	single	ADJ
finefocus-615	45	6	colonies	colony	NOUN
finefocus-615	45	7	three	three	NUM
finefocus-615	45	8	times	time	NOUN
finefocus-615	45	9	in	in	ADP
finefocus-615	45	10	order	order	NOUN
finefocus-615	45	11	to	to	PART
finefocus-615	45	12	obtain	obtain	VERB
finefocus-615	45	13	pure	pure	ADJ
finefocus-615	45	14	cultures	culture	NOUN
finefocus-615	45	15	.	.	PUNCT
finefocus-615	46	1	dna	dna	PROPN
finefocus-615	46	2	analysis	analysis	NOUN
finefocus-615	46	3	of	of	ADP
finefocus-615	46	4	isolates	isolate	NOUN
finefocus-615	46	5	the	the	DET
finefocus-615	46	6	genomic	genomic	ADJ
finefocus-615	46	7	dna	dna	NOUN
finefocus-615	46	8	of	of	ADP
finefocus-615	46	9	selected	select	VERB
finefocus-615	46	10	bacterial	bacterial	ADJ
finefocus-615	46	11	isolates	isolate	NOUN
finefocus-615	46	12	were	be	AUX
finefocus-615	46	13	extracted	extract	VERB
finefocus-615	46	14	by	by	ADP
finefocus-615	46	15	suspending	suspend	VERB
finefocus-615	46	16	a	a	DET
finefocus-615	46	17	colony	colony	NOUN
finefocus-615	46	18	in	in	ADP
finefocus-615	46	19	polymerase	polymerase	NOUN
finefocus-615	46	20	chain	chain	NOUN
finefocus-615	46	21	reaction	reaction	NOUN
finefocus-615	46	22	(	(	PUNCT
finefocus-615	46	23	pcr)-grade	pcr)-grade	NOUN
finefocus-615	46	24	water	water	NOUN
finefocus-615	46	25	and	and	CCONJ
finefocus-615	46	26	freezing	freezing	NOUN
finefocus-615	46	27	for	for	ADP
finefocus-615	46	28	20	20	NUM
finefocus-615	46	29	min	min	NOUN
finefocus-615	46	30	at	at	ADP
finefocus-615	46	31	-80	-80	NOUN
finefocus-615	46	32	°	°	ADP
finefocus-615	46	33	c	c	NOUN
finefocus-615	46	34	and	and	CCONJ
finefocus-615	46	35	then	then	ADV
finefocus-615	46	36	thawing	thaw	VERB
finefocus-615	46	37	.	.	PUNCT
finefocus-615	47	1	a	a	DET
finefocus-615	47	2	1465	1465	NUM
finefocus-615	47	3	base	base	NOUN
finefocus-615	47	4	pair	pair	NOUN
finefocus-615	47	5	(	(	PUNCT
finefocus-615	47	6	bp	bp	PROPN
finefocus-615	47	7	)	)	PUNCT
finefocus-615	47	8	sequence	sequence	NOUN
finefocus-615	47	9	of	of	ADP
finefocus-615	47	10	the	the	DET
finefocus-615	47	11	16s	16s	PROPN
finefocus-615	47	12	rrna	rrna	PROPN
finefocus-615	47	13	gene	gene	NOUN
finefocus-615	47	14	was	be	AUX
finefocus-615	47	15	pcr	pcr	NOUN
finefocus-615	47	16	-	-	PUNCT
finefocus-615	47	17	amplified	amplify	VERB
finefocus-615	47	18	from	from	ADP
finefocus-615	47	19	genomic	genomic	ADJ
finefocus-615	47	20	dna	dna	NOUN
finefocus-615	47	21	(	(	PUNCT
finefocus-615	47	22	10	10	NUM
finefocus-615	47	23	-	-	SYM
finefocus-615	47	24	30	30	NUM
finefocus-615	47	25	ng	ng	PROPN
finefocus-615	47	26	)	)	PUNCT
finefocus-615	47	27	.	.	PUNCT
finefocus-615	48	1	mastermix	mastermix	AUX
finefocus-615	48	2	reagents	reagent	NOUN
finefocus-615	48	3	consisted	consist	VERB
finefocus-615	48	4	of	of	ADP
finefocus-615	48	5	1	1	NUM
finefocus-615	48	6	μg	μg	PROPN
finefocus-615	48	7	/	/	SYM
finefocus-615	48	8	μl	μl	PROPN
finefocus-615	48	9	bovine	bovine	PROPN
finefocus-615	48	10	serum	serum	NOUN
finefocus-615	48	11	albumin	albumin	NOUN
finefocus-615	48	12	,	,	PUNCT
finefocus-615	48	13	200	200	NUM
finefocus-615	48	14	μm	μm	NUM
finefocus-615	48	15	dntp	dntp	NOUN
finefocus-615	48	16	mix	mix	NOUN
finefocus-615	48	17	,	,	PUNCT
finefocus-615	48	18	1x	1x	NUM
finefocus-615	48	19	buffer	buffer	NOUN
finefocus-615	48	20	w/	w/	PROPN
finefocus-615	48	21	mgcl2	mgcl2	PROPN
finefocus-615	48	22	,	,	PUNCT
finefocus-615	48	23	300	300	NUM
finefocus-615	48	24	pm	pm	NOUN
finefocus-615	48	25	27f	27f	NUM
finefocus-615	48	26	primer	primer	NOUN
finefocus-615	48	27	(	(	PUNCT
finefocus-615	48	28	aga	aga	PROPN
finefocus-615	48	29	gtt	gtt	PROPN
finefocus-615	48	30	tga	tga	PROPN
finefocus-615	48	31	tcc	tcc	PROPN
finefocus-615	48	32	tgg	tgg	PROPN
finefocus-615	48	33	ctc	ctc	PROPN
finefocus-615	48	34	ag	ag	PROPN
finefocus-615	48	35	)	)	PUNCT
finefocus-615	48	36	,	,	PUNCT
finefocus-615	48	37	300	300	NUM
finefocus-615	48	38	pm	pm	NOUN
finefocus-615	48	39	1492r	1492r	NUM
finefocus-615	48	40	primer	primer	NOUN
finefocus-615	48	41	(	(	PUNCT
finefocus-615	48	42	acg	acg	PROPN
finefocus-615	48	43	gct	gct	PROPN
finefocus-615	48	44	acc	acc	PROPN
finefocus-615	48	45	ttg	ttg	PROPN
finefocus-615	48	46	tta	tta	PROPN
finefocus-615	48	47	cga	cga	PROPN
finefocus-615	48	48	ctt	ctt	PROPN
finefocus-615	48	49	)	)	PUNCT
finefocus-615	48	50	(	(	PUNCT
finefocus-615	48	51	idt	idt	PROPN
finefocus-615	48	52	integrated	integrate	VERB
finefocus-615	48	53	dna	dna	PROPN
finefocus-615	48	54	technologies	technology	NOUN
finefocus-615	48	55	,	,	PUNCT
finefocus-615	48	56	inc	inc	PROPN
finefocus-615	48	57	.	.	PROPN
finefocus-615	48	58	,	,	PUNCT
finefocus-615	48	59	coralville	coralville	PROPN
finefocus-615	48	60	,	,	PUNCT
finefocus-615	48	61	ia	ia	PROPN
finefocus-615	48	62	)	)	PUNCT
finefocus-615	48	63	(	(	PUNCT
finefocus-615	48	64	30	30	NUM
finefocus-615	48	65	)	)	PUNCT
finefocus-615	48	66	,	,	PUNCT
finefocus-615	48	67	and	and	CCONJ
finefocus-615	48	68	0.2	0.2	NUM
finefocus-615	48	69	u	u	NOUN
finefocus-615	48	70	takara	takara	PROPN
finefocus-615	48	71	ex	ex	PROPN
finefocus-615	48	72	.	.	PROPN
finefocus-615	48	73	taq	taq	PROPN
finefocus-615	48	74	polymerase	polymerase	NOUN
finefocus-615	48	75	(	(	PUNCT
finefocus-615	48	76	takara	takara	PROPN
finefocus-615	48	77	clontech	clontech	NOUN
finefocus-615	48	78	,	,	PUNCT
finefocus-615	48	79	mountain	mountain	NOUN
finefocus-615	48	80	view	view	NOUN
finefocus-615	48	81	,	,	PUNCT
finefocus-615	48	82	ca	ca	NOUN
finefocus-615	48	83	)	)	PUNCT
finefocus-615	48	84	.	.	PUNCT
finefocus-615	49	1	dna	dna	PROPN
finefocus-615	49	2	extracts	extract	NOUN
finefocus-615	49	3	from	from	ADP
finefocus-615	49	4	escherichia	escherichia	NOUN
finefocus-615	49	5	coli	coli	NOUN
finefocus-615	49	6	and	and	CCONJ
finefocus-615	49	7	sterile	sterile	ADJ
finefocus-615	49	8	pcrgrade	pcrgrade	NOUN
finefocus-615	49	9	water	water	NOUN
finefocus-615	49	10	were	be	AUX
finefocus-615	49	11	used	use	VERB
finefocus-615	49	12	as	as	ADP
finefocus-615	49	13	positive	positive	ADJ
finefocus-615	49	14	and	and	CCONJ
finefocus-615	49	15	negative	negative	ADJ
finefocus-615	49	16	controls	control	NOUN
finefocus-615	49	17	,	,	PUNCT
finefocus-615	49	18	respectively	respectively	ADV
finefocus-615	49	19	.	.	PUNCT
finefocus-615	50	1	the	the	DET
finefocus-615	50	2	thermal	thermal	ADJ
finefocus-615	50	3	cycler	cycler	NOUN
finefocus-615	50	4	program	program	NOUN
finefocus-615	50	5	ran	run	VERB
finefocus-615	50	6	for	for	ADP
finefocus-615	50	7	34	34	NUM
finefocus-615	50	8	cycles	cycle	NOUN
finefocus-615	50	9	in	in	ADP
finefocus-615	50	10	the	the	DET
finefocus-615	50	11	following	follow	VERB
finefocus-615	50	12	order	order	NOUN
finefocus-615	50	13	:	:	PUNCT
finefocus-615	50	14	1	1	NUM
finefocus-615	50	15	cycle	cycle	NOUN
finefocus-615	50	16	of	of	ADP
finefocus-615	50	17	initial	initial	ADJ
finefocus-615	50	18	denaturation	denaturation	NOUN
finefocus-615	50	19	(	(	PUNCT
finefocus-615	50	20	3	3	NUM
finefocus-615	50	21	min	min	NOUN
finefocus-615	50	22	at	at	ADP
finefocus-615	50	23	95	95	NUM
finefocus-615	50	24	°	°	NOUN
finefocus-615	50	25	c	c	NOUN
finefocus-615	50	26	)	)	PUNCT
finefocus-615	50	27	;	;	PUNCT
finefocus-615	50	28	32	32	NUM
finefocus-615	50	29	cycles	cycle	NOUN
finefocus-615	50	30	of	of	ADP
finefocus-615	50	31	denaturation	denaturation	NOUN
finefocus-615	50	32	(	(	PUNCT
finefocus-615	50	33	30	30	NUM
finefocus-615	50	34	sec	sec	PROPN
finefocus-615	50	35	at	at	ADP
finefocus-615	50	36	95	95	NUM
finefocus-615	50	37	°	°	NOUN
finefocus-615	50	38	c	c	NOUN
finefocus-615	50	39	)	)	PUNCT
finefocus-615	50	40	,	,	PUNCT
finefocus-615	50	41	annealing	anneal	VERB
finefocus-615	50	42	(	(	PUNCT
finefocus-615	50	43	25	25	NUM
finefocus-615	50	44	-	-	SYM
finefocus-615	50	45	30	30	NUM
finefocus-615	50	46	sec	sec	PROPN
finefocus-615	50	47	at	at	ADP
finefocus-615	50	48	50	50	NUM
finefocus-615	50	49	°	°	NOUN
finefocus-615	50	50	c	c	NOUN
finefocus-615	50	51	)	)	PUNCT
finefocus-615	50	52	,	,	PUNCT
finefocus-615	50	53	and	and	CCONJ
finefocus-615	50	54	extension	extension	NOUN
finefocus-615	50	55	(	(	PUNCT
finefocus-615	50	56	1.5	1.5	NUM
finefocus-615	50	57	min	min	NOUN
finefocus-615	50	58	at	at	ADP
finefocus-615	50	59	72	72	NUM
finefocus-615	50	60	°	°	NOUN
finefocus-615	50	61	c	c	NOUN
finefocus-615	50	62	)	)	PUNCT
finefocus-615	50	63	;	;	PUNCT
finefocus-615	50	64	1	1	NUM
finefocus-615	50	65	cycle	cycle	NOUN
finefocus-615	50	66	of	of	ADP
finefocus-615	50	67	final	final	ADJ
finefocus-615	50	68	extension	extension	NOUN
finefocus-615	50	69	(	(	PUNCT
finefocus-615	50	70	10	10	NUM
finefocus-615	50	71	min	min	NOUN
finefocus-615	50	72	at	at	ADP
finefocus-615	50	73	72	72	NUM
finefocus-615	50	74	°	°	NOUN
finefocus-615	50	75	c	c	NOUN
finefocus-615	50	76	)	)	PUNCT
finefocus-615	50	77	;	;	PUNCT
finefocus-615	50	78	and	and	CCONJ
finefocus-615	50	79	hold	hold	VERB
finefocus-615	50	80	(	(	PUNCT
finefocus-615	50	81	4	4	NUM
finefocus-615	50	82	°	°	NOUN
finefocus-615	50	83	c	c	NOUN
finefocus-615	50	84	)	)	PUNCT
finefocus-615	50	85	.	.	PUNCT
finefocus-615	51	1	amplicons	amplicon	NOUN
finefocus-615	51	2	were	be	AUX
finefocus-615	51	3	detected	detect	VERB
finefocus-615	51	4	from	from	ADP
finefocus-615	51	5	banding	band	VERB
finefocus-615	51	6	patterns	pattern	NOUN
finefocus-615	51	7	on	on	ADP
finefocus-615	51	8	1.5	1.5	NUM
finefocus-615	51	9	%	%	NOUN
finefocus-615	51	10	agarose	agarose	NOUN
finefocus-615	51	11	gel	gel	NOUN
finefocus-615	51	12	electrophoresis	electrophoresis	NOUN
finefocus-615	51	13	and	and	CCONJ
finefocus-615	51	14	quantified	quantify	VERB
finefocus-615	51	15	on	on	ADP
finefocus-615	51	16	the	the	DET
finefocus-615	51	17	nanodrop	nanodrop	NOUN
finefocus-615	51	18	2000	2000	NUM
finefocus-615	51	19	uv	uv	NOUN
finefocus-615	51	20	-	-	PUNCT
finefocus-615	51	21	vis	vis	X
finefocus-615	51	22	spectrophotometer	spectrophotometer	X
finefocus-615	51	23	(	(	PUNCT
finefocus-615	51	24	nanodrop	nanodrop	NOUN
finefocus-615	51	25	products	product	NOUN
finefocus-615	51	26	,	,	PUNCT
finefocus-615	51	27	thermo	thermo	NOUN
finefocus-615	51	28	fisher	fisher	PROPN
finefocus-615	51	29	scientific	scientific	PROPN
finefocus-615	51	30	,	,	PUNCT
finefocus-615	51	31	inc	inc	PROPN
finefocus-615	51	32	.	.	PROPN
finefocus-615	51	33	,	,	PUNCT
finefocus-615	51	34	wilmington	wilmington	PROPN
finefocus-615	51	35	,	,	PUNCT
finefocus-615	51	36	de	de	PROPN
finefocus-615	51	37	)	)	PUNCT
finefocus-615	51	38	.	.	PUNCT
finefocus-615	52	1	excess	excess	ADJ
finefocus-615	52	2	taq	taq	NOUN
finefocus-615	52	3	polymerase	polymerase	NOUN
finefocus-615	52	4	,	,	PUNCT
finefocus-615	52	5	primer	primer	NOUN
finefocus-615	52	6	and	and	CCONJ
finefocus-615	52	7	nucleotides	nucleotide	NOUN
finefocus-615	52	8	were	be	AUX
finefocus-615	52	9	precipitated	precipitate	VERB
finefocus-615	52	10	from	from	ADP
finefocus-615	52	11	the	the	DET
finefocus-615	52	12	amplicon	amplicon	NOUN
finefocus-615	52	13	solution	solution	NOUN
finefocus-615	52	14	by	by	ADP
finefocus-615	52	15	adding	add	VERB
finefocus-615	52	16	1μl	1μl	ADJ
finefocus-615	52	17	usb	usb	NOUN
finefocus-615	52	18	exosap	exosap	NOUN
finefocus-615	52	19	-	-	PUNCT
finefocus-615	52	20	it	it	PRON
finefocus-615	52	21	reagent	reagent	ADJ
finefocus-615	52	22	(	(	PUNCT
finefocus-615	52	23	affymetrix	affymetrix	ADJ
finefocus-615	52	24	,	,	PUNCT
finefocus-615	52	25	inc	inc	PROPN
finefocus-615	52	26	.	.	PROPN
finefocus-615	52	27	,	,	PUNCT
finefocus-615	52	28	santa	santa	PROPN
finefocus-615	52	29	clara	clara	PROPN
finefocus-615	52	30	,	,	PUNCT
finefocus-615	52	31	ca	ca	NOUN
finefocus-615	52	32	)	)	PUNCT
finefocus-615	52	33	to	to	ADP
finefocus-615	52	34	9μl	9μl	NOUN
finefocus-615	52	35	of	of	ADP
finefocus-615	52	36	amplicon	amplicon	NOUN
finefocus-615	52	37	.	.	PUNCT
finefocus-615	53	1	purified	purified	ADJ
finefocus-615	53	2	products	product	NOUN
finefocus-615	53	3	were	be	AUX
finefocus-615	53	4	identified	identify	VERB
finefocus-615	53	5	via	via	ADP
finefocus-615	53	6	sanger	sanger	PROPN
finefocus-615	53	7	sequencing	sequencing	NOUN
finefocus-615	53	8	of	of	ADP
finefocus-615	53	9	the	the	DET
finefocus-615	53	10	16s	16s	PROPN
finefocus-615	53	11	rrna	rrna	PROPN
finefocus-615	53	12	gene	gene	NOUN
finefocus-615	53	13	using	use	VERB
finefocus-615	53	14	27f	27f	NUM
finefocus-615	53	15	primer	primer	NOUN
finefocus-615	53	16	(	(	PUNCT
finefocus-615	53	17	5’-agagtttgatcctggctcag-3	5’-agagtttgatcctggctcag-3	NUM
finefocus-615	53	18	’	'	PUNCT
finefocus-615	53	19	)	)	PUNCT
finefocus-615	53	20	(	(	PUNCT
finefocus-615	53	21	genewiz	genewiz	NOUN
finefocus-615	53	22	,	,	PUNCT
finefocus-615	53	23	madison	madison	PROPN
finefocus-615	53	24	,	,	PUNCT
finefocus-615	53	25	wi	wi	PROPN
finefocus-615	53	26	,	,	PUNCT
finefocus-615	53	27	usa	usa	PROPN
finefocus-615	53	28	)	)	PUNCT
finefocus-615	53	29	.	.	PUNCT
finefocus-615	54	1	from	from	ADP
finefocus-615	54	2	each	each	DET
finefocus-615	54	3	sequence	sequence	NOUN
finefocus-615	54	4	we	we	PRON
finefocus-615	54	5	extracted	extract	VERB
finefocus-615	54	6	>	>	PUNCT
finefocus-615	54	7	750	750	NUM
finefocus-615	54	8	consecutive	consecutive	ADJ
finefocus-615	54	9	nucleotides	nucleotide	NOUN
finefocus-615	54	10	with	with	ADP
finefocus-615	54	11	quality	quality	NOUN
finefocus-615	54	12	score	score	NOUN
finefocus-615	54	13	q>20	q>20	PUNCT
finefocus-615	54	14	and	and	CCONJ
finefocus-615	54	15	each	each	DET
finefocus-615	54	16	chromatogram	chromatogram	NOUN
finefocus-615	54	17	was	be	AUX
finefocus-615	54	18	visually	visually	ADV
finefocus-615	54	19	inspected	inspect	VERB
finefocus-615	54	20	to	to	PART
finefocus-615	54	21	insure	insure	VERB
finefocus-615	54	22	there	there	PRON
finefocus-615	54	23	were	be	VERB
finefocus-615	54	24	no	no	DET
finefocus-615	54	25	base	base	ADJ
finefocus-615	54	26	caller	caller	NOUN
finefocus-615	54	27	errors	error	NOUN
finefocus-615	54	28	(	(	PUNCT
finefocus-615	54	29	supplementary	supplementary	ADJ
finefocus-615	54	30	table	table	NOUN
finefocus-615	54	31	1	1	NUM
finefocus-615	54	32	)	)	PUNCT
finefocus-615	54	33	.	.	PUNCT
finefocus-615	55	1	bacterial	bacterial	ADJ
finefocus-615	55	2	community	community	NOUN
finefocus-615	55	3	structure	structure	NOUN
finefocus-615	55	4	in	in	ADP
finefocus-615	55	5	cheese	cheese	NOUN
finefocus-615	55	6	•	•	NUM
finefocus-615	55	7	13	13	NUM
finefocus-615	55	8	is	be	AUX
finefocus-615	55	9	o	o	NOUN
finefocus-615	55	10	la	la	X
finefocus-615	55	11	te	te	PROPN
finefocus-615	55	12	n	n	DET
finefocus-615	55	13	a	a	DET
finefocus-615	55	14	m	m	NOUN
finefocus-615	55	15	e	e	X
finefocus-615	55	16	se	se	X
finefocus-615	55	17	q	q	PROPN
finefocus-615	55	18	u	u	PROPN
finefocus-615	55	19	en	en	X
finefocus-615	55	20	c	c	PROPN
finefocus-615	55	21	e	e	PROPN
finefocus-615	55	22	i	i	PROPN
finefocus-615	55	23	d	d	PROPN
finefocus-615	55	24	en	en	X
finefocus-615	55	25	ti	ti	PROPN
finefocus-615	55	26	fi	fi	NOUN
finefocus-615	55	27	c	c	PROPN
finefocus-615	55	28	a	a	DET
finefocus-615	55	29	ti	ti	NOUN
finefocus-615	55	30	o	o	NOUN
finefocus-615	55	31	n	n	INTJ
finefocus-615	55	32	m	m	PROPN
finefocus-615	55	33	il	il	PROPN
finefocus-615	56	1	k	k	NOUN
finefocus-615	57	1	ty	ty	INTJ
finefocus-615	57	2	pe	pe	INTJ
finefocus-615	57	3	ch	ch	PROPN
finefocus-615	57	4	ee	ee	PROPN
finefocus-615	57	5	se	se	PROPN
finefocus-615	57	6	n	n	PROPN
finefocus-615	57	7	a	a	DET
finefocus-615	57	8	m	m	NOUN
finefocus-615	57	9	e	e	NOUN
finefocus-615	57	10	c	c	NOUN
finefocus-615	57	11	o	o	X
finefocus-615	57	12	u	u	NOUN
finefocus-615	57	13	n	n	PRON
finefocus-615	57	14	tr	tr	NOUN
finefocus-615	57	15	y	y	PROPN
finefocus-615	57	16	g	g	PROPN
finefocus-615	57	17	en	en	ADP
finefocus-615	57	18	u	u	PROPN
finefocus-615	57	19	s	s	PROPN
finefocus-615	57	20	lw	lw	NOUN
finefocus-615	57	21	h	h	PROPN
finefocus-615	57	22	w	w	PROPN
finefocus-615	57	23	227	227	NUM
finefocus-615	57	24	f	f	PROPN
finefocus-615	57	25	u	u	PROPN
finefocus-615	57	26	nc	nc	PROPN
finefocus-615	57	27	ul	ul	PROPN
finefocus-615	57	28	tu	tu	PROPN
finefocus-615	57	29	re	re	PROPN
finefocus-615	57	30	d	d	PROPN
finefocus-615	57	31	br	br	X
finefocus-615	57	32	ev	ev	INTJ
finefocus-615	57	33	ib	ib	PROPN
finefocus-615	57	34	ac	ac	PROPN
finefocus-615	57	35	te	te	PROPN
finefocus-615	57	36	riu	riu	PROPN
finefocus-615	57	37	m	m	PROPN
finefocus-615	57	38	s	s	PROPN
finefocus-615	57	39	p.	p.	NOUN
finefocus-615	57	40	c	c	PUNCT
finefocus-615	58	1	lo	lo	PROPN
finefocus-615	58	2	ne	ne	PROPN
finefocus-615	58	3	p	p	X
finefocus-615	58	4	ts	ts	ADP
finefocus-615	58	5	-l	-l	PROPN
finefocus-615	58	6	-c	-c	PUNCT
finefocus-615	58	7	l11	l11	PROPN
finefocus-615	58	8	co	co	PROPN
finefocus-615	58	9	w	w	PROPN
finefocus-615	58	10	a	a	DET
finefocus-615	58	11	lp	lp	ADJ
finefocus-615	58	12	ag	ag	PROPN
finefocus-615	58	13	e	e	PROPN
finefocus-615	58	14	g	g	PROPN
finefocus-615	58	15	ru	ru	PROPN
finefocus-615	58	16	ye	ye	PROPN
finefocus-615	58	17	re	re	PROPN
finefocus-615	58	18	sw	sw	PROPN
finefocus-615	58	19	itz	itz	PROPN
finefocus-615	58	20	er	er	INTJ
finefocus-615	58	21	la	la	INTJ
finefocus-615	58	22	nd	nd	ADV
finefocus-615	58	23	br	br	PROPN
finefocus-615	58	24	ev	ev	INTJ
finefocus-615	58	25	ib	ib	PROPN
finefocus-615	58	26	ac	ac	PROPN
finefocus-615	58	27	te	te	PROPN
finefocus-615	58	28	riu	riu	PROPN
finefocus-615	58	29	m	m	PROPN
finefocus-615	58	30	lw	lw	PROPN
finefocus-615	58	31	h	h	PROPN
finefocus-615	58	32	w	w	PROPN
finefocus-615	58	33	327	327	NUM
finefocus-615	58	34	f	f	PROPN
finefocus-615	58	35	u	u	PROPN
finefocus-615	58	36	nc	nc	PROPN
finefocus-615	58	37	ul	ul	PROPN
finefocus-615	58	38	tu	tu	PROPN
finefocus-615	58	39	re	re	PROPN
finefocus-615	58	40	d	d	PROPN
finefocus-615	58	41	br	br	X
finefocus-615	58	42	ev	ev	INTJ
finefocus-615	58	43	ib	ib	PROPN
finefocus-615	58	44	ac	ac	PROPN
finefocus-615	58	45	te	te	PROPN
finefocus-615	58	46	riu	riu	PROPN
finefocus-615	58	47	m	m	PROPN
finefocus-615	58	48	s	s	PROPN
finefocus-615	58	49	p.	p.	NOUN
finefocus-615	58	50	c	c	PUNCT
finefocus-615	59	1	lo	lo	PROPN
finefocus-615	59	2	ne	ne	PROPN
finefocus-615	59	3	p	p	X
finefocus-615	59	4	ts	ts	ADP
finefocus-615	59	5	-l	-l	PROPN
finefocus-615	59	6	-c	-c	PUNCT
finefocus-615	59	7	l11	l11	PROPN
finefocus-615	59	8	co	co	PROPN
finefocus-615	59	9	w	w	PROPN
finefocus-615	59	10	a	a	DET
finefocus-615	59	11	lp	lp	ADJ
finefocus-615	59	12	ag	ag	PROPN
finefocus-615	59	13	e	e	PROPN
finefocus-615	59	14	g	g	PROPN
finefocus-615	59	15	ru	ru	PROPN
finefocus-615	59	16	ye	ye	PROPN
finefocus-615	59	17	re	re	PROPN
finefocus-615	59	18	sw	sw	PROPN
finefocus-615	59	19	itz	itz	PROPN
finefocus-615	59	20	er	er	INTJ
finefocus-615	59	21	la	la	INTJ
finefocus-615	59	22	nd	nd	ADV
finefocus-615	59	23	br	br	PROPN
finefocus-615	59	24	ev	ev	INTJ
finefocus-615	59	25	ib	ib	PROPN
finefocus-615	59	26	ac	ac	PROPN
finefocus-615	59	27	te	te	PROPN
finefocus-615	59	28	riu	riu	PROPN
finefocus-615	59	29	m	m	PROPN
finefocus-615	59	30	lw	lw	PROPN
finefocus-615	59	31	h	h	PROPN
finefocus-615	59	32	w	w	PROPN
finefocus-615	59	33	427	427	NUM
finefocus-615	60	1	f	f	NOUN
finefocus-615	60	2	br	br	NOUN
finefocus-615	60	3	ev	ev	INTJ
finefocus-615	60	4	ib	ib	PROPN
finefocus-615	60	5	ac	ac	PROPN
finefocus-615	60	6	te	te	PROPN
finefocus-615	60	7	riu	riu	PROPN
finefocus-615	60	8	m	m	PROPN
finefocus-615	60	9	a	a	DET
finefocus-615	60	10	ur	ur	INTJ
finefocus-615	61	1	an	an	DET
finefocus-615	61	2	tia	tia	PROPN
finefocus-615	61	3	cu	cu	PROPN
finefocus-615	61	4	m	m	PROPN
finefocus-615	61	5	,	,	PUNCT
finefocus-615	62	1	i	i	PRON
finefocus-615	62	2	so	so	ADV
finefocus-615	62	3	la	la	ADV
finefocus-615	62	4	te	te	PROPN
finefocus-615	62	5	0	0	NUM
finefocus-615	62	6	91	91	NUM
finefocus-615	62	7	1	1	NUM
finefocus-615	62	8	t	t	NOUN
finefocus-615	62	9	es	es	X
finefocus-615	62	10	25	25	NUM
finefocus-615	62	11	y	y	PROPN
finefocus-615	62	12	3	3	NUM
finefocus-615	62	13	co	co	NOUN
finefocus-615	62	14	w	w	PROPN
finefocus-615	62	15	a	a	DET
finefocus-615	62	16	lp	lp	ADJ
finefocus-615	62	17	ag	ag	PROPN
finefocus-615	62	18	e	e	PROPN
finefocus-615	62	19	g	g	PROPN
finefocus-615	62	20	ru	ru	PROPN
finefocus-615	62	21	ye	ye	PROPN
finefocus-615	62	22	re	re	PROPN
finefocus-615	62	23	sw	sw	PROPN
finefocus-615	62	24	itz	itz	PROPN
finefocus-615	62	25	er	er	INTJ
finefocus-615	62	26	la	la	INTJ
finefocus-615	62	27	nd	nd	ADV
finefocus-615	62	28	br	br	PROPN
finefocus-615	62	29	ev	ev	INTJ
finefocus-615	62	30	ib	ib	PROPN
finefocus-615	62	31	ac	ac	PROPN
finefocus-615	62	32	te	te	PROPN
finefocus-615	62	33	riu	riu	PROPN
finefocus-615	62	34	m	m	PROPN
finefocus-615	62	35	lw	lw	PROPN
finefocus-615	62	36	h	h	PROPN
finefocus-615	62	37	w	w	PROPN
finefocus-615	62	38	627	627	NUM
finefocus-615	62	39	f	f	NOUN
finefocus-615	62	40	br	br	NOUN
finefocus-615	62	41	ev	ev	INTJ
finefocus-615	62	42	ib	ib	PROPN
finefocus-615	62	43	ac	ac	PROPN
finefocus-615	63	1	te	te	PROPN
finefocus-615	63	2	riu	riu	PROPN
finefocus-615	63	3	m	m	PROPN
finefocus-615	63	4	s	s	PROPN
finefocus-615	63	5	p.	p.	NOUN
finefocus-615	63	6	e	e	PROPN
finefocus-615	63	7	p1	p1	NOUN
finefocus-615	63	8	1	1	NUM
finefocus-615	63	9	s	s	PART
finefocus-615	63	10	tr	tr	NOUN
finefocus-615	63	11	ai	ai	NOUN
finefocus-615	63	12	n	n	ADV
finefocus-615	63	13	ep	ep	PROPN
finefocus-615	63	14	11	11	NUM
finefocus-615	63	15	co	co	NOUN
finefocus-615	63	16	w	w	PROPN
finefocus-615	63	17	a	a	DET
finefocus-615	63	18	lp	lp	ADJ
finefocus-615	63	19	ag	ag	PROPN
finefocus-615	63	20	e	e	PROPN
finefocus-615	63	21	g	g	PROPN
finefocus-615	63	22	ru	ru	PROPN
finefocus-615	63	23	ye	ye	PROPN
finefocus-615	63	24	re	re	PROPN
finefocus-615	63	25	sw	sw	PROPN
finefocus-615	63	26	itz	itz	PROPN
finefocus-615	63	27	er	er	INTJ
finefocus-615	63	28	la	la	INTJ
finefocus-615	63	29	nd	nd	ADV
finefocus-615	63	30	br	br	PROPN
finefocus-615	63	31	ev	ev	INTJ
finefocus-615	63	32	ib	ib	PROPN
finefocus-615	63	33	ac	ac	PROPN
finefocus-615	63	34	te	te	PROPN
finefocus-615	63	35	riu	riu	PROPN
finefocus-615	63	36	m	m	PROPN
finefocus-615	63	37	lw	lw	PROPN
finefocus-615	63	38	h	h	PROPN
finefocus-615	63	39	w	w	PROPN
finefocus-615	63	40	727	727	NUM
finefocus-615	63	41	f	f	NOUN
finefocus-615	63	42	c	c	NOUN
finefocus-615	64	1	or	or	CCONJ
finefocus-615	64	2	yn	yn	INTJ
finefocus-615	64	3	eb	eb	PROPN
finefocus-615	64	4	ac	ac	PROPN
finefocus-615	65	1	te	te	PROPN
finefocus-615	65	2	riu	riu	PROPN
finefocus-615	65	3	m	m	VERB
finefocus-615	65	4	g	g	PROPN
finefocus-615	65	5	ly	ly	ADP
finefocus-615	65	6	ci	ci	NOUN
finefocus-615	65	7	no	no	DET
finefocus-615	65	8	ph	ph	ADJ
finefocus-615	65	9	ilu	ilu	NOUN
finefocus-615	65	10	m	m	VERB
finefocus-615	65	11	co	co	NOUN
finefocus-615	65	12	w	w	PROPN
finefocus-615	65	13	a	a	DET
finefocus-615	65	14	lp	lp	ADJ
finefocus-615	65	15	ag	ag	PROPN
finefocus-615	65	16	e	e	PROPN
finefocus-615	65	17	g	g	PROPN
finefocus-615	65	18	ru	ru	PROPN
finefocus-615	65	19	ye	ye	PROPN
finefocus-615	65	20	re	re	PROPN
finefocus-615	65	21	sw	sw	PROPN
finefocus-615	65	22	itz	itz	PROPN
finefocus-615	65	23	er	er	INTJ
finefocus-615	65	24	la	la	PROPN
finefocus-615	65	25	nd	nd	PROPN
finefocus-615	65	26	c	c	PROPN
finefocus-615	65	27	or	or	CCONJ
finefocus-615	65	28	yn	yn	INTJ
finefocus-615	65	29	eb	eb	PROPN
finefocus-615	65	30	ac	ac	PROPN
finefocus-615	65	31	te	te	PROPN
finefocus-615	65	32	riu	riu	PROPN
finefocus-615	65	33	m	m	PROPN
finefocus-615	65	34	z	z	VERB
finefocus-615	65	35	m	m	VERB
finefocus-615	65	36	bb	bb	NOUN
finefocus-615	65	37	127	127	NUM
finefocus-615	65	38	f	f	PROPN
finefocus-615	65	39	st	st	PROPN
finefocus-615	65	40	ap	ap	PROPN
finefocus-615	65	41	hy	hy	PROPN
finefocus-615	66	1	lo	lo	PROPN
finefocus-615	66	2	co	co	NOUN
finefocus-615	66	3	cc	cc	VERB
finefocus-615	66	4	us	us	PROPN
finefocus-615	66	5	e	e	PROPN
finefocus-615	66	6	qu	qu	PROPN
finefocus-615	66	7	or	or	CCONJ
finefocus-615	66	8	um	um	INTJ
finefocus-615	66	9	co	co	PROPN
finefocus-615	66	10	w	w	PROPN
finefocus-615	66	11	st	st	PROPN
finefocus-615	66	12	ic	ic	PROPN
finefocus-615	66	13	he	he	PRON
finefocus-615	66	14	lto	lto	PROPN
finefocus-615	66	15	n	n	PROPN
finefocus-615	66	16	en	en	X
finefocus-615	66	17	gl	gl	X
finefocus-615	67	1	an	an	PROPN
finefocus-615	67	2	d	d	PROPN
finefocus-615	67	3	st	st	PROPN
finefocus-615	67	4	ap	ap	PROPN
finefocus-615	67	5	hy	hy	PROPN
finefocus-615	67	6	lo	lo	PROPN
finefocus-615	67	7	co	co	NOUN
finefocus-615	67	8	cc	cc	VERB
finefocus-615	67	9	us	we	PRON
finefocus-615	67	10	z	z	NOUN
finefocus-615	67	11	m	m	VERB
finefocus-615	67	12	bb	bb	INTJ
finefocus-615	67	13	227	227	NUM
finefocus-615	68	1	f	f	NOUN
finefocus-615	68	2	br	br	INTJ
finefocus-615	69	1	ac	ac	PROPN
finefocus-615	70	1	hy	hy	INTJ
finefocus-615	71	1	ba	ba	PROPN
finefocus-615	72	1	ct	ct	INTJ
finefocus-615	73	1	er	er	INTJ
finefocus-615	73	2	iu	iu	ADP
finefocus-615	73	3	m	m	PROPN
finefocus-615	73	4	a	a	DET
finefocus-615	73	5	lim	lim	PROPN
finefocus-615	73	6	en	en	PROPN
finefocus-615	73	7	ta	ta	PROPN
finefocus-615	73	8	riu	riu	PROPN
finefocus-615	73	9	m	m	PROPN
finefocus-615	73	10	co	co	PROPN
finefocus-615	73	11	w	w	PROPN
finefocus-615	73	12	st	st	PROPN
finefocus-615	74	1	ic	ic	PROPN
finefocus-615	74	2	he	he	PRON
finefocus-615	74	3	lto	lto	PROPN
finefocus-615	74	4	n	n	PROPN
finefocus-615	74	5	en	en	X
finefocus-615	74	6	gl	gl	X
finefocus-615	74	7	an	an	PROPN
finefocus-615	74	8	d	d	X
finefocus-615	74	9	br	br	NOUN
finefocus-615	74	10	ac	ac	PROPN
finefocus-615	74	11	hy	hy	INTJ
finefocus-615	75	1	ba	ba	PROPN
finefocus-615	75	2	ct	ct	INTJ
finefocus-615	75	3	er	er	INTJ
finefocus-615	75	4	iu	iu	ADP
finefocus-615	75	5	m	m	PROPN
finefocus-615	75	6	z	z	VERB
finefocus-615	75	7	m	m	VERB
finefocus-615	75	8	bb	bb	NOUN
finefocus-615	76	1	327	327	NUM
finefocus-615	76	2	f	f	NOUN
finefocus-615	76	3	br	br	INTJ
finefocus-615	76	4	ac	ac	PROPN
finefocus-615	77	1	hy	hy	INTJ
finefocus-615	77	2	ba	ba	PROPN
finefocus-615	78	1	ct	ct	INTJ
finefocus-615	78	2	er	er	INTJ
finefocus-615	78	3	iu	iu	ADP
finefocus-615	78	4	m	m	PROPN
finefocus-615	78	5	a	a	DET
finefocus-615	78	6	lim	lim	PROPN
finefocus-615	78	7	en	en	PROPN
finefocus-615	78	8	ta	ta	PROPN
finefocus-615	78	9	riu	riu	PROPN
finefocus-615	78	10	m	m	PROPN
finefocus-615	78	11	co	co	PROPN
finefocus-615	78	12	w	w	PROPN
finefocus-615	78	13	st	st	PROPN
finefocus-615	79	1	ic	ic	PROPN
finefocus-615	79	2	he	he	PRON
finefocus-615	79	3	lto	lto	PROPN
finefocus-615	79	4	n	n	PROPN
finefocus-615	79	5	en	en	X
finefocus-615	79	6	gl	gl	X
finefocus-615	79	7	an	an	PROPN
finefocus-615	79	8	d	d	X
finefocus-615	79	9	br	br	NOUN
finefocus-615	79	10	ac	ac	PROPN
finefocus-615	79	11	hy	hy	INTJ
finefocus-615	80	1	ba	ba	PROPN
finefocus-615	80	2	ct	ct	INTJ
finefocus-615	80	3	er	er	INTJ
finefocus-615	80	4	iu	iu	ADP
finefocus-615	80	5	m	m	PROPN
finefocus-615	80	6	z	z	VERB
finefocus-615	80	7	m	m	VERB
finefocus-615	80	8	bb	bb	NOUN
finefocus-615	80	9	427	427	NUM
finefocus-615	81	1	f	f	NOUN
finefocus-615	81	2	br	br	INTJ
finefocus-615	81	3	ac	ac	PROPN
finefocus-615	81	4	hy	hy	INTJ
finefocus-615	82	1	ba	ba	PROPN
finefocus-615	82	2	ct	ct	INTJ
finefocus-615	82	3	er	er	INTJ
finefocus-615	82	4	iu	iu	ADP
finefocus-615	82	5	m	m	PROPN
finefocus-615	82	6	a	a	DET
finefocus-615	82	7	lim	lim	PROPN
finefocus-615	82	8	en	en	PROPN
finefocus-615	82	9	ta	ta	PROPN
finefocus-615	82	10	riu	riu	PROPN
finefocus-615	82	11	m	m	PROPN
finefocus-615	82	12	co	co	PROPN
finefocus-615	82	13	w	w	PROPN
finefocus-615	82	14	st	st	PROPN
finefocus-615	83	1	ic	ic	PROPN
finefocus-615	83	2	he	he	PRON
finefocus-615	83	3	lto	lto	PROPN
finefocus-615	83	4	n	n	PROPN
finefocus-615	83	5	en	en	X
finefocus-615	83	6	gl	gl	X
finefocus-615	83	7	an	an	PROPN
finefocus-615	83	8	d	d	X
finefocus-615	83	9	br	br	NOUN
finefocus-615	83	10	ac	ac	PROPN
finefocus-615	83	11	hy	hy	INTJ
finefocus-615	84	1	ba	ba	PROPN
finefocus-615	84	2	ct	ct	INTJ
finefocus-615	84	3	er	er	INTJ
finefocus-615	84	4	iu	iu	ADP
finefocus-615	84	5	m	m	PROPN
finefocus-615	84	6	z	z	VERB
finefocus-615	84	7	m	m	VERB
finefocus-615	84	8	bb	bb	NOUN
finefocus-615	84	9	527	527	NUM
finefocus-615	84	10	f	f	X
finefocus-615	84	11	la	la	INTJ
finefocus-615	84	12	ct	ct	PROPN
finefocus-615	84	13	ob	ob	INTJ
finefocus-615	84	14	ac	ac	PROPN
finefocus-615	84	15	ill	ill	VERB
finefocus-615	84	16	us	we	PRON
finefocus-615	84	17	p	p	PROPN
finefocus-615	84	18	la	la	PROPN
finefocus-615	84	19	nt	not	PART
finefocus-615	84	20	ar	ar	PROPN
finefocus-615	84	21	um	um	INTJ
finefocus-615	84	22	o	o	NOUN
finefocus-615	85	1	r	r	NOUN
finefocus-615	85	2	ca	can	AUX
finefocus-615	85	3	se	se	ADV
finefocus-615	86	1	i	i	PRON
finefocus-615	86	2	co	co	VERB
finefocus-615	86	3	w	w	PROPN
finefocus-615	86	4	st	st	PROPN
finefocus-615	87	1	ic	ic	PROPN
finefocus-615	87	2	he	he	PRON
finefocus-615	87	3	lto	lto	PROPN
finefocus-615	87	4	n	n	PROPN
finefocus-615	87	5	en	en	X
finefocus-615	87	6	gl	gl	X
finefocus-615	88	1	an	an	PRON
finefocus-615	88	2	d	d	X
finefocus-615	88	3	la	la	X
finefocus-615	88	4	ct	ct	PROPN
finefocus-615	88	5	ob	ob	INTJ
finefocus-615	88	6	ac	ac	PROPN
finefocus-615	88	7	ill	ill	PROPN
finefocus-615	88	8	us	we	PRON
finefocus-615	88	9	z	z	NOUN
finefocus-615	88	10	m	m	VERB
finefocus-615	88	11	bb	bb	NOUN
finefocus-615	89	1	627	627	NUM
finefocus-615	89	2	f	f	NOUN
finefocus-615	89	3	br	br	NOUN
finefocus-615	90	1	ev	ev	INTJ
finefocus-615	91	1	ib	ib	PROPN
finefocus-615	92	1	ac	ac	PROPN
finefocus-615	93	1	te	te	PROPN
finefocus-615	93	2	riu	riu	PROPN
finefocus-615	93	3	m	m	PROPN
finefocus-615	93	4	li	li	PROPN
finefocus-615	93	5	ne	ne	PROPN
finefocus-615	93	6	ns	ns	NUM
finefocus-615	93	7	o	o	NOUN
finefocus-615	93	8	r	r	NOUN
finefocus-615	93	9	ep	ep	PROPN
finefocus-615	94	1	i	i	PROPN
finefocus-615	94	2	d	d	PROPN
finefocus-615	95	1	er	er	INTJ
finefocus-615	95	2	m	m	VERB
finefocus-615	95	3	i	i	NOUN
finefocus-615	95	4	d	d	PROPN
finefocus-615	95	5	is	be	AUX
finefocus-615	95	6	co	co	PROPN
finefocus-615	95	7	w	w	PROPN
finefocus-615	95	8	st	st	PROPN
finefocus-615	96	1	ic	ic	PROPN
finefocus-615	96	2	he	he	PRON
finefocus-615	96	3	lto	lto	PROPN
finefocus-615	96	4	n	n	PROPN
finefocus-615	96	5	en	en	X
finefocus-615	96	6	gl	gl	X
finefocus-615	96	7	an	an	PROPN
finefocus-615	96	8	d	d	X
finefocus-615	96	9	br	br	NOUN
finefocus-615	96	10	ev	ev	PROPN
finefocus-615	96	11	ib	ib	PROPN
finefocus-615	96	12	ac	ac	PROPN
finefocus-615	96	13	te	te	PROPN
finefocus-615	96	14	riu	riu	PROPN
finefocus-615	96	15	m	m	PROPN
finefocus-615	96	16	z	z	VERB
finefocus-615	96	17	m	m	VERB
finefocus-615	96	18	bb	bb	NOUN
finefocus-615	96	19	727	727	NUM
finefocus-615	96	20	f	f	PROPN
finefocus-615	96	21	st	st	PROPN
finefocus-615	96	22	ap	ap	PROPN
finefocus-615	97	1	hy	hy	PROPN
finefocus-615	98	1	lo	lo	PROPN
finefocus-615	98	2	co	co	NOUN
finefocus-615	98	3	cc	cc	VERB
finefocus-615	98	4	us	we	PRON
finefocus-615	98	5	s	s	VERB
finefocus-615	98	6	i	i	PRON
finefocus-615	98	7	m	m	VERB
finefocus-615	98	8	ul	ul	INTJ
finefocus-615	98	9	an	an	DET
finefocus-615	98	10	s	s	X
finefocus-615	98	11	co	co	NOUN
finefocus-615	98	12	w	w	PROPN
finefocus-615	98	13	st	st	PROPN
finefocus-615	98	14	ic	ic	PROPN
finefocus-615	98	15	he	he	PRON
finefocus-615	98	16	lto	lto	PROPN
finefocus-615	98	17	n	n	PROPN
finefocus-615	98	18	en	en	X
finefocus-615	98	19	gl	gl	X
finefocus-615	99	1	an	an	PROPN
finefocus-615	99	2	d	d	PROPN
finefocus-615	99	3	st	st	PROPN
finefocus-615	99	4	ap	ap	PROPN
finefocus-615	99	5	hy	hy	PROPN
finefocus-615	99	6	lo	lo	PROPN
finefocus-615	99	7	co	co	NOUN
finefocus-615	99	8	cc	cc	VERB
finefocus-615	99	9	us	we	PRON
finefocus-615	99	10	z	z	NOUN
finefocus-615	99	11	m	m	VERB
finefocus-615	99	12	bb	bb	INTJ
finefocus-615	100	1	827	827	NUM
finefocus-615	101	1	f	f	PROPN
finefocus-615	101	2	st	st	PROPN
finefocus-615	101	3	ap	ap	PROPN
finefocus-615	102	1	hy	hy	PROPN
finefocus-615	103	1	lo	lo	PROPN
finefocus-615	103	2	co	co	NOUN
finefocus-615	103	3	cc	cc	VERB
finefocus-615	103	4	us	we	PRON
finefocus-615	103	5	p	p	PROPN
finefocus-615	103	6	as	as	ADP
finefocus-615	103	7	te	te	INTJ
finefocus-615	103	8	ur	ur	INTJ
finefocus-615	104	1	i	i	PRON
finefocus-615	104	2	co	co	VERB
finefocus-615	104	3	w	w	PROPN
finefocus-615	104	4	st	st	PROPN
finefocus-615	104	5	ic	ic	PROPN
finefocus-615	104	6	he	he	PRON
finefocus-615	104	7	lto	lto	PROPN
finefocus-615	104	8	n	n	PROPN
finefocus-615	104	9	en	en	X
finefocus-615	104	10	gl	gl	X
finefocus-615	104	11	an	an	PROPN
finefocus-615	104	12	d	d	PROPN
finefocus-615	104	13	st	st	PROPN
finefocus-615	104	14	ap	ap	PROPN
finefocus-615	104	15	hy	hy	PROPN
finefocus-615	105	1	lo	lo	PROPN
finefocus-615	105	2	co	co	NOUN
finefocus-615	105	3	cc	cc	VERB
finefocus-615	105	4	us	we	PRON
finefocus-615	105	5	z	z	NOUN
finefocus-615	105	6	m	m	VERB
finefocus-615	106	1	bb	bb	NOUN
finefocus-615	107	1	927	927	NUM
finefocus-615	108	1	f	f	PROPN
finefocus-615	108	2	st	st	PROPN
finefocus-615	108	3	ap	ap	PROPN
finefocus-615	108	4	hy	hy	PROPN
finefocus-615	109	1	lo	lo	PROPN
finefocus-615	109	2	co	co	NOUN
finefocus-615	109	3	cc	cc	VERB
finefocus-615	109	4	us	us	PROPN
finefocus-615	109	5	e	e	PROPN
finefocus-615	109	6	qu	qu	PROPN
finefocus-615	109	7	or	or	CCONJ
finefocus-615	109	8	um	um	INTJ
finefocus-615	109	9	co	co	PROPN
finefocus-615	109	10	w	w	PROPN
finefocus-615	109	11	st	st	PROPN
finefocus-615	109	12	ic	ic	PROPN
finefocus-615	109	13	he	he	PRON
finefocus-615	109	14	lto	lto	PROPN
finefocus-615	109	15	n	n	PROPN
finefocus-615	109	16	en	en	X
finefocus-615	109	17	gl	gl	X
finefocus-615	110	1	an	an	PROPN
finefocus-615	110	2	d	d	PROPN
finefocus-615	110	3	st	st	PROPN
finefocus-615	110	4	ap	ap	PROPN
finefocus-615	110	5	hy	hy	PROPN
finefocus-615	110	6	lo	lo	PROPN
finefocus-615	110	7	co	co	NOUN
finefocus-615	110	8	cc	cc	VERB
finefocus-615	110	9	us	we	PRON
finefocus-615	110	10	z	z	NOUN
finefocus-615	110	11	m	m	VERB
finefocus-615	110	12	bb	bb	INTJ
finefocus-615	111	1	10	10	NUM
finefocus-615	112	1	-2	-2	NOUN
finefocus-615	112	2	7f	7f	PROPN
finefocus-615	112	3	st	st	PROPN
finefocus-615	112	4	ap	ap	PROPN
finefocus-615	113	1	hy	hy	PROPN
finefocus-615	114	1	lo	lo	PROPN
finefocus-615	114	2	co	co	NOUN
finefocus-615	114	3	cc	cc	VERB
finefocus-615	114	4	us	us	PROPN
finefocus-615	114	5	e	e	PROPN
finefocus-615	114	6	qu	qu	PROPN
finefocus-615	114	7	or	or	CCONJ
finefocus-615	114	8	um	um	INTJ
finefocus-615	114	9	co	co	PROPN
finefocus-615	114	10	w	w	PROPN
finefocus-615	114	11	st	st	PROPN
finefocus-615	114	12	ic	ic	PROPN
finefocus-615	114	13	he	he	PRON
finefocus-615	114	14	lto	lto	PROPN
finefocus-615	114	15	n	n	PROPN
finefocus-615	114	16	en	en	X
finefocus-615	114	17	gl	gl	X
finefocus-615	115	1	an	an	PROPN
finefocus-615	115	2	d	d	PROPN
finefocus-615	115	3	st	st	PROPN
finefocus-615	115	4	ap	ap	PROPN
finefocus-615	115	5	hy	hy	PROPN
finefocus-615	115	6	lo	lo	PROPN
finefocus-615	115	7	co	co	NOUN
finefocus-615	115	8	cc	cc	VERB
finefocus-615	115	9	us	we	PRON
finefocus-615	115	10	a	a	PRON
finefocus-615	115	11	x	x	SYM
finefocus-615	115	12	127	127	NUM
finefocus-615	115	13	f	f	PROPN
finefocus-615	115	14	st	st	PROPN
finefocus-615	115	15	ap	ap	PROPN
finefocus-615	115	16	hy	hy	PROPN
finefocus-615	116	1	lo	lo	PROPN
finefocus-615	116	2	co	co	NOUN
finefocus-615	116	3	cc	cc	VERB
finefocus-615	116	4	us	us	PROPN
finefocus-615	116	5	e	e	PROPN
finefocus-615	116	6	qu	qu	PROPN
finefocus-615	116	7	or	or	CCONJ
finefocus-615	116	8	um	um	INTJ
finefocus-615	116	9	co	co	INTJ
finefocus-615	116	10	w	w	PROPN
finefocus-615	116	11	m	m	PROPN
finefocus-615	116	12	is	be	AUX
finefocus-615	116	13	so	so	ADV
finefocus-615	116	14	ur	ur	INTJ
finefocus-615	117	1	i	i	PRON
finefocus-615	117	2	t	t	PROPN
finefocus-615	117	3	ru	ru	NOUN
finefocus-615	117	4	ck	ck	PROPN
finefocus-615	117	5	le	le	X
finefocus-615	117	6	u	u	PROPN
finefocus-615	118	1	sa	sa	PROPN
finefocus-615	118	2	st	st	PROPN
finefocus-615	118	3	ap	ap	PROPN
finefocus-615	118	4	hy	hy	PROPN
finefocus-615	119	1	lo	lo	PROPN
finefocus-615	119	2	co	co	NOUN
finefocus-615	119	3	cc	cc	VERB
finefocus-615	119	4	us	we	PRON
finefocus-615	119	5	a	a	PRON
finefocus-615	119	6	x	x	SYM
finefocus-615	119	7	227	227	NUM
finefocus-615	119	8	f	f	NOUN
finefocus-615	119	9	br	br	INTJ
finefocus-615	119	10	ac	ac	PROPN
finefocus-615	120	1	hy	hy	INTJ
finefocus-615	121	1	ba	ba	PROPN
finefocus-615	122	1	ct	ct	INTJ
finefocus-615	123	1	er	er	INTJ
finefocus-615	123	2	iu	iu	ADP
finefocus-615	123	3	m	m	PROPN
finefocus-615	123	4	a	a	PRON
finefocus-615	124	1	i	i	NOUN
finefocus-615	124	2	m	m	VERB
finefocus-615	124	3	en	en	ADP
finefocus-615	124	4	ta	ta	X
finefocus-615	124	5	riu	riu	PROPN
finefocus-615	124	6	m	m	PROPN
finefocus-615	124	7	co	co	PROPN
finefocus-615	124	8	w	w	PROPN
finefocus-615	124	9	m	m	PROPN
finefocus-615	124	10	is	be	AUX
finefocus-615	125	1	so	so	ADV
finefocus-615	125	2	ur	ur	INTJ
finefocus-615	126	1	i	i	PRON
finefocus-615	126	2	t	t	PROPN
finefocus-615	126	3	ru	ru	NOUN
finefocus-615	126	4	ck	ck	PROPN
finefocus-615	126	5	le	le	X
finefocus-615	126	6	u	u	PROPN
finefocus-615	126	7	sa	sa	PROPN
finefocus-615	126	8	br	br	PROPN
finefocus-615	126	9	ac	ac	PROPN
finefocus-615	126	10	hy	hy	INTJ
finefocus-615	127	1	ba	ba	PROPN
finefocus-615	127	2	ct	ct	INTJ
finefocus-615	127	3	er	er	INTJ
finefocus-615	127	4	iu	iu	ADP
finefocus-615	127	5	m	m	PROPN
finefocus-615	127	6	a	a	PRON
finefocus-615	127	7	x	x	SYM
finefocus-615	127	8	527	527	NUM
finefocus-615	127	9	f	f	NOUN
finefocus-615	127	10	br	br	INTJ
finefocus-615	127	11	ac	ac	PROPN
finefocus-615	127	12	hy	hy	INTJ
finefocus-615	128	1	ba	ba	PROPN
finefocus-615	128	2	ct	ct	INTJ
finefocus-615	128	3	er	er	INTJ
finefocus-615	128	4	iu	iu	ADP
finefocus-615	128	5	m	m	PROPN
finefocus-615	128	6	a	a	DET
finefocus-615	128	7	lim	lim	PROPN
finefocus-615	128	8	en	en	PROPN
finefocus-615	128	9	ta	ta	PROPN
finefocus-615	128	10	riu	riu	PROPN
finefocus-615	128	11	m	m	PROPN
finefocus-615	128	12	co	co	PROPN
finefocus-615	129	1	w	w	PROPN
finefocus-615	129	2	m	m	PROPN
finefocus-615	129	3	is	be	AUX
finefocus-615	129	4	so	so	ADV
finefocus-615	130	1	ur	ur	INTJ
finefocus-615	131	1	i	i	PRON
finefocus-615	131	2	t	t	PROPN
finefocus-615	131	3	ru	ru	NOUN
finefocus-615	131	4	ck	ck	PROPN
finefocus-615	131	5	le	le	X
finefocus-615	131	6	u	u	PROPN
finefocus-615	131	7	sa	sa	PROPN
finefocus-615	131	8	br	br	PROPN
finefocus-615	131	9	ac	ac	PROPN
finefocus-615	131	10	hy	hy	INTJ
finefocus-615	132	1	ba	ba	PROPN
finefocus-615	132	2	ct	ct	INTJ
finefocus-615	132	3	er	er	INTJ
finefocus-615	132	4	iu	iu	ADP
finefocus-615	132	5	m	m	PROPN
finefocus-615	132	6	a	a	PRON
finefocus-615	132	7	x	x	SYM
finefocus-615	132	8	727	727	NUM
finefocus-615	132	9	f	f	PROPN
finefocus-615	132	10	st	st	PROPN
finefocus-615	132	11	ap	ap	PROPN
finefocus-615	133	1	hy	hy	PROPN
finefocus-615	134	1	lo	lo	PROPN
finefocus-615	134	2	co	co	NOUN
finefocus-615	134	3	cc	cc	PROPN
finefocus-615	134	4	us	us	PROPN
finefocus-615	134	5	w	w	PROPN
finefocus-615	134	6	ar	ar	PROPN
finefocus-615	134	7	ne	ne	PROPN
finefocus-615	134	8	ri	ri	PROPN
finefocus-615	134	9	co	co	PROPN
finefocus-615	134	10	w	w	PROPN
finefocus-615	134	11	m	m	PROPN
finefocus-615	134	12	is	be	AUX
finefocus-615	135	1	so	so	ADV
finefocus-615	135	2	ur	ur	INTJ
finefocus-615	136	1	i	i	PRON
finefocus-615	136	2	t	t	PROPN
finefocus-615	136	3	ru	ru	NOUN
finefocus-615	136	4	ck	ck	PROPN
finefocus-615	136	5	le	le	X
finefocus-615	136	6	u	u	PROPN
finefocus-615	137	1	sa	sa	PROPN
finefocus-615	137	2	st	st	PROPN
finefocus-615	137	3	ap	ap	PROPN
finefocus-615	137	4	hy	hy	PROPN
finefocus-615	138	1	lo	lo	PROPN
finefocus-615	138	2	co	co	NOUN
finefocus-615	138	3	cc	cc	VERB
finefocus-615	138	4	us	we	PRON
finefocus-615	138	5	r	r	NOUN
finefocus-615	138	6	r	r	NOUN
finefocus-615	138	7	sh	sh	PUNCT
finefocus-615	139	1	127	127	NUM
finefocus-615	139	2	f	f	PROPN
finefocus-615	139	3	st	st	PROPN
finefocus-615	139	4	ap	ap	PROPN
finefocus-615	140	1	hy	hy	PROPN
finefocus-615	141	1	lo	lo	PROPN
finefocus-615	141	2	co	co	NOUN
finefocus-615	141	3	cc	cc	VERB
finefocus-615	141	4	us	we	PRON
finefocus-615	141	5	x	x	X
finefocus-615	141	6	yl	yl	NOUN
finefocus-615	141	7	os	os	PROPN
finefocus-615	141	8	us	us	PROPN
finefocus-615	142	1	co	co	PROPN
finefocus-615	142	2	w	w	PROPN
finefocus-615	142	3	m	m	PROPN
finefocus-615	142	4	ag	ag	NOUN
finefocus-615	142	5	gi	gi	NOUN
finefocus-615	142	6	es	es	NOUN
finefocus-615	142	7	r	r	NOUN
finefocus-615	142	8	ou	ou	NOUN
finefocus-615	142	9	nd	nd	NOUN
finefocus-615	142	10	m	m	NOUN
finefocus-615	142	11	as	as	ADP
finefocus-615	142	12	sa	sa	PROPN
finefocus-615	142	13	ch	ch	PROPN
finefocus-615	142	14	us	us	PROPN
finefocus-615	142	15	et	et	PROPN
finefocus-615	142	16	ts	ts	ADP
finefocus-615	143	1	st	st	PROPN
finefocus-615	143	2	ap	ap	PROPN
finefocus-615	143	3	hy	hy	PROPN
finefocus-615	143	4	lo	lo	PROPN
finefocus-615	143	5	co	co	NOUN
finefocus-615	143	6	cc	cc	VERB
finefocus-615	143	7	us	we	PRON
finefocus-615	143	8	r	r	NOUN
finefocus-615	143	9	r	r	NOUN
finefocus-615	143	10	sh	sh	NUM
finefocus-615	143	11	327	327	NUM
finefocus-615	144	1	f	f	NOUN
finefocus-615	144	2	br	br	INTJ
finefocus-615	145	1	ac	ac	PROPN
finefocus-615	146	1	hy	hy	INTJ
finefocus-615	147	1	ba	ba	PROPN
finefocus-615	148	1	ct	ct	INTJ
finefocus-615	149	1	er	er	INTJ
finefocus-615	149	2	iu	iu	ADP
finefocus-615	149	3	m	m	PROPN
finefocus-615	149	4	s	s	PROPN
finefocus-615	149	5	p.	p.	NOUN
finefocus-615	149	6	co	co	NOUN
finefocus-615	150	1	w	w	PROPN
finefocus-615	150	2	m	m	PROPN
finefocus-615	150	3	ag	ag	NOUN
finefocus-615	150	4	gi	gi	NOUN
finefocus-615	150	5	es	es	NOUN
finefocus-615	150	6	r	r	NOUN
finefocus-615	150	7	ou	ou	NOUN
finefocus-615	150	8	nd	nd	NOUN
finefocus-615	150	9	m	m	NOUN
finefocus-615	150	10	as	as	ADP
finefocus-615	150	11	sa	sa	PROPN
finefocus-615	150	12	ch	ch	PROPN
finefocus-615	150	13	us	us	PROPN
finefocus-615	150	14	et	et	NOUN
finefocus-615	150	15	ts	ts	ADP
finefocus-615	150	16	br	br	PROPN
finefocus-615	150	17	ac	ac	PROPN
finefocus-615	151	1	hy	hy	PROPN
finefocus-615	151	2	ba	ba	PROPN
finefocus-615	152	1	ct	ct	INTJ
finefocus-615	152	2	er	er	INTJ
finefocus-615	152	3	iu	iu	ADP
finefocus-615	152	4	m	m	PROPN
finefocus-615	152	5	r	r	NOUN
finefocus-615	152	6	r	r	NOUN
finefocus-615	152	7	sh	sh	NOUN
finefocus-615	152	8	427	427	NUM
finefocus-615	153	1	f	f	NOUN
finefocus-615	153	2	ba	ba	PROPN
finefocus-615	153	3	ci	ci	PROPN
finefocus-615	153	4	llu	llu	PROPN
finefocus-615	153	5	s	s	PROPN
finefocus-615	153	6	sp	sp	NOUN
finefocus-615	153	7	.	.	PUNCT
finefocus-615	154	1	co	co	PROPN
finefocus-615	154	2	w	w	PROPN
finefocus-615	154	3	m	m	PROPN
finefocus-615	154	4	ag	ag	NOUN
finefocus-615	154	5	gi	gi	NOUN
finefocus-615	154	6	es	es	NOUN
finefocus-615	154	7	r	r	NOUN
finefocus-615	154	8	ou	ou	NOUN
finefocus-615	154	9	nd	nd	NOUN
finefocus-615	154	10	m	m	NOUN
finefocus-615	154	11	as	as	ADP
finefocus-615	154	12	sa	sa	PROPN
finefocus-615	154	13	ch	ch	PROPN
finefocus-615	154	14	us	us	PROPN
finefocus-615	154	15	et	et	NOUN
finefocus-615	154	16	ts	ts	ADP
finefocus-615	154	17	ba	ba	PROPN
finefocus-615	154	18	ci	ci	PROPN
finefocus-615	154	19	llu	llu	PROPN
finefocus-615	154	20	s	s	PART
finefocus-615	154	21	r	r	NOUN
finefocus-615	154	22	r	r	NOUN
finefocus-615	154	23	sh	sh	PROPN
finefocus-615	154	24	627	627	NUM
finefocus-615	154	25	f	f	PROPN
finefocus-615	154	26	st	st	PROPN
finefocus-615	154	27	ap	ap	PROPN
finefocus-615	155	1	hy	hy	PROPN
finefocus-615	155	2	lo	lo	PROPN
finefocus-615	155	3	co	co	NOUN
finefocus-615	155	4	cc	cc	VERB
finefocus-615	155	5	us	we	PRON
finefocus-615	155	6	x	x	X
finefocus-615	155	7	yl	yl	NOUN
finefocus-615	155	8	os	os	PROPN
finefocus-615	155	9	us	us	PROPN
finefocus-615	156	1	co	co	PROPN
finefocus-615	156	2	w	w	PROPN
finefocus-615	156	3	m	m	PROPN
finefocus-615	156	4	ag	ag	NOUN
finefocus-615	156	5	gi	gi	NOUN
finefocus-615	156	6	es	es	NOUN
finefocus-615	156	7	r	r	NOUN
finefocus-615	156	8	ou	ou	NOUN
finefocus-615	156	9	nd	nd	NOUN
finefocus-615	156	10	m	m	NOUN
finefocus-615	156	11	as	as	ADP
finefocus-615	156	12	sa	sa	PROPN
finefocus-615	156	13	ch	ch	PROPN
finefocus-615	156	14	us	us	PROPN
finefocus-615	156	15	et	et	PROPN
finefocus-615	156	16	ts	ts	ADP
finefocus-615	157	1	st	st	PROPN
finefocus-615	157	2	ap	ap	PROPN
finefocus-615	157	3	hy	hy	PROPN
finefocus-615	157	4	lo	lo	PROPN
finefocus-615	157	5	co	co	NOUN
finefocus-615	157	6	cc	cc	VERB
finefocus-615	157	7	us	we	PRON
finefocus-615	157	8	r	r	NOUN
finefocus-615	157	9	r	r	NOUN
finefocus-615	157	10	sh	sh	NUM
finefocus-615	158	1	727	727	NUM
finefocus-615	158	2	f	f	PROPN
finefocus-615	158	3	st	st	PROPN
finefocus-615	158	4	ap	ap	PROPN
finefocus-615	158	5	hy	hy	PROPN
finefocus-615	159	1	lo	lo	PROPN
finefocus-615	159	2	co	co	NOUN
finefocus-615	159	3	cc	cc	VERB
finefocus-615	159	4	us	we	PRON
finefocus-615	159	5	x	x	X
finefocus-615	159	6	yl	yl	NOUN
finefocus-615	159	7	os	os	PROPN
finefocus-615	159	8	us	us	PROPN
finefocus-615	160	1	co	co	PROPN
finefocus-615	160	2	w	w	PROPN
finefocus-615	160	3	m	m	PROPN
finefocus-615	160	4	ag	ag	NOUN
finefocus-615	160	5	gi	gi	NOUN
finefocus-615	160	6	es	es	NOUN
finefocus-615	160	7	r	r	NOUN
finefocus-615	160	8	ou	ou	NOUN
finefocus-615	160	9	nd	nd	NOUN
finefocus-615	160	10	m	m	NOUN
finefocus-615	160	11	as	as	ADP
finefocus-615	160	12	sa	sa	PROPN
finefocus-615	160	13	ch	ch	PROPN
finefocus-615	160	14	us	us	PROPN
finefocus-615	160	15	et	et	PROPN
finefocus-615	160	16	ts	ts	ADP
finefocus-615	161	1	st	st	PROPN
finefocus-615	161	2	ap	ap	PROPN
finefocus-615	161	3	hy	hy	PROPN
finefocus-615	161	4	lo	lo	PROPN
finefocus-615	161	5	co	co	NOUN
finefocus-615	161	6	cc	cc	VERB
finefocus-615	161	7	us	we	PRON
finefocus-615	161	8	r	r	NOUN
finefocus-615	161	9	r	r	NOUN
finefocus-615	161	10	sh	sh	INTJ
finefocus-615	161	11	827	827	NUM
finefocus-615	161	12	f	f	NOUN
finefocus-615	161	13	ba	ba	PROPN
finefocus-615	161	14	ci	ci	PROPN
finefocus-615	161	15	llu	llu	PROPN
finefocus-615	161	16	s	s	PART
finefocus-615	161	17	m	m	NOUN
finefocus-615	161	18	oj	oj	ADP
finefocus-615	161	19	av	av	PROPN
finefocus-615	161	20	en	en	ADP
finefocus-615	161	21	sis	sis	PROPN
finefocus-615	161	22	co	co	PROPN
finefocus-615	161	23	w	w	PROPN
finefocus-615	161	24	m	m	PROPN
finefocus-615	161	25	ag	ag	NOUN
finefocus-615	161	26	gi	gi	NOUN
finefocus-615	161	27	es	es	NOUN
finefocus-615	161	28	r	r	NOUN
finefocus-615	161	29	ou	ou	NOUN
finefocus-615	161	30	nd	nd	NOUN
finefocus-615	161	31	m	m	NOUN
finefocus-615	161	32	as	as	ADP
finefocus-615	161	33	sa	sa	PROPN
finefocus-615	161	34	ch	ch	PROPN
finefocus-615	161	35	us	us	PROPN
finefocus-615	161	36	et	et	NOUN
finefocus-615	161	37	ts	ts	ADP
finefocus-615	161	38	ba	ba	PROPN
finefocus-615	161	39	ci	ci	PROPN
finefocus-615	161	40	llu	llu	PROPN
finefocus-615	161	41	s	s	PART
finefocus-615	161	42	c	c	NOUN
finefocus-615	161	43	h	h	NOUN
finefocus-615	162	1	127	127	NUM
finefocus-615	162	2	f	f	PROPN
finefocus-615	162	3	st	st	PROPN
finefocus-615	162	4	ap	ap	PROPN
finefocus-615	162	5	hy	hy	PROPN
finefocus-615	163	1	lo	lo	PROPN
finefocus-615	163	2	co	co	NOUN
finefocus-615	163	3	cc	cc	VERB
finefocus-615	163	4	us	we	PRON
finefocus-615	163	5	s	s	PART
finefocus-615	163	6	p.	p.	NOUN
finefocus-615	163	7	u	u	NOUN
finefocus-615	163	8	13	13	NUM
finefocus-615	163	9	71	71	NUM
finefocus-615	163	10	-1	-1	SYM
finefocus-615	163	11	01	01	NUM
finefocus-615	163	12	22	22	NUM
finefocus-615	163	13	7x	7x	NUM
finefocus-615	163	14	h	h	NOUN
finefocus-615	163	15	13	13	NUM
finefocus-615	163	16	6	6	NUM
finefocus-615	163	17	sh	sh	INTJ
finefocus-615	163	18	ee	ee	INTJ
finefocus-615	163	19	p	p	X
finefocus-615	163	20	v	v	NOUN
finefocus-615	163	21	t.	t.	NOUN
finefocus-615	164	1	sh	sh	PROPN
finefocus-615	165	1	ep	ep	PROPN
finefocus-615	166	1	he	he	PRON
finefocus-615	166	2	rd	rd	VERB
finefocus-615	166	3	u	u	PROPN
finefocus-615	166	4	sa	sa	PROPN
finefocus-615	166	5	st	st	PROPN
finefocus-615	166	6	ap	ap	PROPN
finefocus-615	166	7	hy	hy	PROPN
finefocus-615	167	1	lo	lo	PROPN
finefocus-615	167	2	co	co	NOUN
finefocus-615	167	3	cc	cc	VERB
finefocus-615	167	4	us	we	PRON
finefocus-615	167	5	c	c	PROPN
finefocus-615	167	6	h	h	NOUN
finefocus-615	168	1	327	327	NUM
finefocus-615	168	2	f	f	NOUN
finefocus-615	168	3	br	br	NOUN
finefocus-615	168	4	ev	ev	INTJ
finefocus-615	168	5	ib	ib	PROPN
finefocus-615	168	6	ac	ac	PROPN
finefocus-615	168	7	te	te	PROPN
finefocus-615	168	8	riu	riu	PROPN
finefocus-615	168	9	m	m	PROPN
finefocus-615	168	10	s	s	PROPN
finefocus-615	168	11	p.	p.	NOUN
finefocus-615	168	12	e	e	PROPN
finefocus-615	168	13	p1	p1	NOUN
finefocus-615	168	14	1	1	NUM
finefocus-615	168	15	sh	sh	INTJ
finefocus-615	168	16	ee	ee	INTJ
finefocus-615	168	17	p	p	X
finefocus-615	168	18	v	v	NOUN
finefocus-615	168	19	t.	t.	NOUN
finefocus-615	168	20	sh	sh	PROPN
finefocus-615	169	1	ep	ep	PROPN
finefocus-615	169	2	he	he	PRON
finefocus-615	169	3	rd	rd	VERB
finefocus-615	169	4	u	u	PROPN
finefocus-615	169	5	sa	sa	PROPN
finefocus-615	169	6	br	br	PROPN
finefocus-615	169	7	ev	ev	PROPN
finefocus-615	169	8	ib	ib	PROPN
finefocus-615	169	9	ac	ac	PROPN
finefocus-615	169	10	te	te	PROPN
finefocus-615	169	11	riu	riu	PROPN
finefocus-615	170	1	m	m	PROPN
finefocus-615	170	2	c	c	NOUN
finefocus-615	170	3	h	h	NOUN
finefocus-615	171	1	727	727	NUM
finefocus-615	171	2	f	f	PROPN
finefocus-615	171	3	st	st	PROPN
finefocus-615	171	4	ap	ap	PROPN
finefocus-615	171	5	hy	hy	PROPN
finefocus-615	172	1	lo	lo	PROPN
finefocus-615	172	2	co	co	NOUN
finefocus-615	172	3	cc	cc	VERB
finefocus-615	172	4	us	us	PROPN
finefocus-615	172	5	e	e	PROPN
finefocus-615	172	6	qu	qu	PROPN
finefocus-615	172	7	or	or	CCONJ
finefocus-615	172	8	um	um	INTJ
finefocus-615	172	9	sh	sh	INTJ
finefocus-615	172	10	ee	ee	INTJ
finefocus-615	172	11	p	p	X
finefocus-615	172	12	v	v	NOUN
finefocus-615	172	13	t.	t.	NOUN
finefocus-615	172	14	sh	sh	PROPN
finefocus-615	172	15	ep	ep	PROPN
finefocus-615	173	1	he	he	PRON
finefocus-615	173	2	rd	rd	VERB
finefocus-615	173	3	u	u	PROPN
finefocus-615	173	4	sa	sa	PROPN
finefocus-615	173	5	st	st	PROPN
finefocus-615	173	6	ap	ap	PROPN
finefocus-615	173	7	hy	hy	PROPN
finefocus-615	174	1	lo	lo	PROPN
finefocus-615	174	2	co	co	NOUN
finefocus-615	174	3	cc	cc	VERB
finefocus-615	174	4	us	us	PROPN
finefocus-615	174	5	supplementary	supplementary	ADJ
finefocus-615	174	6	table	table	NOUN
finefocus-615	174	7	1	1	NUM
finefocus-615	174	8	14	14	NUM
finefocus-615	174	9	•	•	NUM
finefocus-615	174	10	fine	fine	ADJ
finefocus-615	174	11	focus	focus	NOUN
finefocus-615	174	12	,	,	PUNCT
finefocus-615	174	13	vol	vol	NOUN
finefocus-615	174	14	.	.	NOUN
finefocus-615	174	15	3	3	NUM
finefocus-615	174	16	(	(	PUNCT
finefocus-615	174	17	1	1	NUM
finefocus-615	174	18	)	)	PUNCT
finefocus-615	174	19	direct	direct	ADJ
finefocus-615	174	20	dna	dna	PROPN
finefocus-615	174	21	analysis	analysis	NOUN
finefocus-615	174	22	of	of	ADP
finefocus-615	174	23	cheese	cheese	NOUN
finefocus-615	174	24	microbial	microbial	ADJ
finefocus-615	174	25	communities	community	NOUN
finefocus-615	174	26	total	total	VERB
finefocus-615	174	27	dna	dna	NOUN
finefocus-615	174	28	from	from	ADP
finefocus-615	174	29	the	the	DET
finefocus-615	174	30	cheese	cheese	NOUN
finefocus-615	174	31	rind	rind	NOUN
finefocus-615	174	32	and	and	CCONJ
finefocus-615	174	33	curd	curd	NOUN
finefocus-615	174	34	samples	sample	NOUN
finefocus-615	174	35	was	be	AUX
finefocus-615	174	36	extracted	extract	VERB
finefocus-615	174	37	using	use	VERB
finefocus-615	174	38	the	the	DET
finefocus-615	174	39	mo	mo	PROPN
finefocus-615	174	40	bio	bio	PROPN
finefocus-615	174	41	power	power	PROPN
finefocus-615	174	42	®	®	PROPN
finefocus-615	174	43	soil	soil	NOUN
finefocus-615	174	44	dna	dna	NOUN
finefocus-615	174	45	isolation	isolation	NOUN
finefocus-615	174	46	kit	kit	NOUN
finefocus-615	174	47	(	(	PUNCT
finefocus-615	174	48	mobio	mobio	PROPN
finefocus-615	174	49	,	,	PUNCT
finefocus-615	174	50	carlsbad	carlsbad	PROPN
finefocus-615	174	51	,	,	PUNCT
finefocus-615	174	52	ca	ca	NOUN
finefocus-615	174	53	)	)	PUNCT
finefocus-615	174	54	.	.	PUNCT
finefocus-615	175	1	the	the	DET
finefocus-615	175	2	16s	16s	PROPN
finefocus-615	175	3	rrna	rrna	PROPN
finefocus-615	175	4	gene	gene	NOUN
finefocus-615	175	5	from	from	ADP
finefocus-615	175	6	community	community	NOUN
finefocus-615	175	7	genomic	genomic	NOUN
finefocus-615	175	8	dna	dna	NOUN
finefocus-615	175	9	was	be	AUX
finefocus-615	175	10	amplified	amplify	VERB
finefocus-615	175	11	,	,	PUNCT
finefocus-615	175	12	detected	detect	VERB
finefocus-615	175	13	,	,	PUNCT
finefocus-615	175	14	quantified	quantify	VERB
finefocus-615	175	15	,	,	PUNCT
finefocus-615	175	16	and	and	CCONJ
finefocus-615	175	17	purified	purify	VERB
finefocus-615	175	18	as	as	SCONJ
finefocus-615	175	19	described	describe	VERB
finefocus-615	175	20	for	for	ADP
finefocus-615	175	21	the	the	DET
finefocus-615	175	22	isolates	isolate	NOUN
finefocus-615	175	23	.	.	PUNCT
finefocus-615	176	1	samples	sample	NOUN
finefocus-615	176	2	were	be	AUX
finefocus-615	176	3	sequenced	sequence	VERB
finefocus-615	176	4	on	on	ADP
finefocus-615	176	5	a	a	DET
finefocus-615	176	6	miseq	miseq	ADJ
finefocus-615	176	7	instrument	instrument	NOUN
finefocus-615	176	8	at	at	ADP
finefocus-615	176	9	the	the	DET
finefocus-615	176	10	forsyth	forsyth	PROPN
finefocus-615	176	11	institute	institute	PROPN
finefocus-615	176	12	,	,	PUNCT
finefocus-615	176	13	cambridge	cambridge	PROPN
finefocus-615	176	14	,	,	PUNCT
finefocus-615	176	15	ma	ma	PROPN
finefocus-615	176	16	.	.	PROPN
finefocus-615	177	1	the	the	DET
finefocus-615	177	2	v3	v3	PROPN
finefocus-615	177	3	/	/	SYM
finefocus-615	177	4	v4	v4	PROPN
finefocus-615	177	5	region	region	NOUN
finefocus-615	177	6	of	of	ADP
finefocus-615	177	7	the	the	DET
finefocus-615	177	8	16s	16s	PROPN
finefocus-615	177	9	rrna	rrna	PROPN
finefocus-615	177	10	gene	gene	NOUN
finefocus-615	177	11	was	be	AUX
finefocus-615	177	12	amplified	amplify	VERB
finefocus-615	177	13	from	from	ADP
finefocus-615	177	14	each	each	DET
finefocus-615	177	15	sample	sample	NOUN
finefocus-615	177	16	using	use	VERB
finefocus-615	177	17	the	the	DET
finefocus-615	177	18	forward	forward	ADJ
finefocus-615	177	19	primer	primer	NOUN
finefocus-615	177	20	341f	341f	NUM
finefocus-615	177	21	5’-aatgatacggcgaccaccgagatctacac	5’-aatgatacggcgaccaccgagatctacac	NUM
finefocus-615	177	22	tatggtaatt	tatggtaatt	NOUN
finefocus-615	177	23	gt	gt	PROPN
finefocus-615	177	24	cctacgggaggcagcag-3	cctacgggaggcagcag-3	PROPN
finefocus-615	177	25	’	'	PUNCT
finefocus-615	177	26	;	;	PUNCT
finefocus-615	177	27	where	where	SCONJ
finefocus-615	177	28	italicized	italicize	VERB
finefocus-615	177	29	text	text	NOUN
finefocus-615	177	30	indicates	indicate	VERB
finefocus-615	177	31	illumina	illumina	PROPN
finefocus-615	177	32	adaptor	adaptor	NOUN
finefocus-615	177	33	,	,	PUNCT
finefocus-615	177	34	bold	bold	ADJ
finefocus-615	177	35	text	text	NOUN
finefocus-615	177	36	indicates	indicate	VERB
finefocus-615	177	37	primer	primer	NOUN
finefocus-615	177	38	pad	pad	NOUN
finefocus-615	177	39	,	,	PUNCT
finefocus-615	177	40	italicized	italicize	VERB
finefocus-615	177	41	bold	bold	ADJ
finefocus-615	177	42	indicates	indicate	VERB
finefocus-615	177	43	primer	primer	NOUN
finefocus-615	177	44	linker	linker	NOUN
finefocus-615	177	45	and	and	CCONJ
finefocus-615	177	46	an	an	DET
finefocus-615	177	47	underlined	underline	VERB
finefocus-615	177	48	text	text	NOUN
finefocus-615	177	49	a	a	DET
finefocus-615	177	50	conserved	conserved	ADJ
finefocus-615	177	51	bacterial	bacterial	ADJ
finefocus-615	177	52	primer	primer	NOUN
finefocus-615	177	53	314f	314f	PROPN
finefocus-615	177	54	.	.	PUNCT
finefocus-615	178	1	the	the	DET
finefocus-615	178	2	reverse	reverse	ADJ
finefocus-615	178	3	primer	primer	NOUN
finefocus-615	178	4	was	be	AUX
finefocus-615	178	5	806r	806r	NOUN
finefocus-615	178	6	5’caagcagaagacggcatacgagat	5’caagcagaagacggcatacgagat	NUM
finefocus-615	178	7	xxxxxxxxxxxx	xxxxxxxxxxxx	PROPN
finefocus-615	178	8	agtcagtcag	agtcagtcag	PROPN
finefocus-615	178	9	cc	cc	PROPN
finefocus-615	178	10	ggactachvgggtwtctaat-3	ggactachvgggtwtctaat-3	PROPN
finefocus-615	178	11	’	'	PUNCT
finefocus-615	178	12	;	;	PUNCT
finefocus-615	178	13	where	where	SCONJ
finefocus-615	178	14	italicized	italicize	VERB
finefocus-615	178	15	text	text	NOUN
finefocus-615	178	16	indicates	indicate	VERB
finefocus-615	178	17	reverse	reverse	ADJ
finefocus-615	178	18	complement	complement	NOUN
finefocus-615	178	19	of	of	ADP
finefocus-615	178	20	the	the	DET
finefocus-615	178	21	illumina	illumina	PROPN
finefocus-615	178	22	adaptor	adaptor	NOUN
finefocus-615	178	23	,	,	PUNCT
finefocus-615	178	24	12	12	NUM
finefocus-615	178	25	x	x	NOUN
finefocus-615	178	26	-	-	NOUN
finefocus-615	178	27	letters	letter	NOUN
finefocus-615	178	28	in	in	ADP
finefocus-615	178	29	bold	bold	ADJ
finefocus-615	178	30	are	be	AUX
finefocus-615	178	31	the	the	DET
finefocus-615	178	32	golay	golay	PROPN
finefocus-615	178	33	barcode	barcode	NOUN
finefocus-615	178	34	primer	primer	NOUN
finefocus-615	178	35	followed	follow	VERB
finefocus-615	178	36	by	by	ADP
finefocus-615	178	37	barcode	barcode	NOUN
finefocus-615	178	38	primer	primer	NOUN
finefocus-615	178	39	and	and	CCONJ
finefocus-615	178	40	primer	primer	NOUN
finefocus-615	178	41	linker	linker	NOUN
finefocus-615	178	42	(	(	PUNCT
finefocus-615	178	43	italicized	italicize	VERB
finefocus-615	178	44	bold	bold	ADJ
finefocus-615	178	45	letters	letter	NOUN
finefocus-615	178	46	)	)	PUNCT
finefocus-615	178	47	.	.	PUNCT
finefocus-615	179	1	the	the	DET
finefocus-615	179	2	conserved	conserved	ADJ
finefocus-615	179	3	bacterial	bacterial	ADJ
finefocus-615	179	4	primer	primer	NOUN
finefocus-615	179	5	806r	806r	PROPN
finefocus-615	179	6	is	be	AUX
finefocus-615	179	7	indicated	indicate	VERB
finefocus-615	179	8	by	by	ADP
finefocus-615	179	9	underlined	underlined	ADJ
finefocus-615	179	10	letters	letter	NOUN
finefocus-615	179	11	.	.	PUNCT
finefocus-615	180	1	pcr	pcr	ADJ
finefocus-615	180	2	products	product	NOUN
finefocus-615	180	3	from	from	ADP
finefocus-615	180	4	respective	respective	ADJ
finefocus-615	180	5	samples	sample	NOUN
finefocus-615	180	6	were	be	AUX
finefocus-615	180	7	each	each	PRON
finefocus-615	180	8	tagged	tag	VERB
finefocus-615	180	9	by	by	ADP
finefocus-615	180	10	a	a	DET
finefocus-615	180	11	sample	sample	NOUN
finefocus-615	180	12	-	-	PUNCT
finefocus-615	180	13	specific	specific	ADJ
finefocus-615	180	14	12	12	NUM
finefocus-615	180	15	-	-	PUNCT
finefocus-615	180	16	base	base	NOUN
finefocus-615	180	17	barcode	barcode	NOUN
finefocus-615	180	18	(	(	PUNCT
finefocus-615	180	19	9	9	NUM
finefocus-615	180	20	)	)	PUNCT
finefocus-615	180	21	.	.	PUNCT
finefocus-615	181	1	all	all	DET
finefocus-615	181	2	samples	sample	NOUN
finefocus-615	181	3	were	be	AUX
finefocus-615	181	4	amplified	amplify	VERB
finefocus-615	181	5	in	in	ADP
finefocus-615	181	6	triplicates	triplicate	NOUN
finefocus-615	181	7	with	with	ADP
finefocus-615	181	8	5	5	NUM
finefocus-615	181	9	prime	prime	ADJ
finefocus-615	181	10	hot	hot	ADJ
finefocus-615	181	11	master	master	NOUN
finefocus-615	181	12	pcr	pcr	NOUN
finefocus-615	181	13	mix	mix	NOUN
finefocus-615	181	14	(	(	PUNCT
finefocus-615	181	15	five	five	NUM
finefocus-615	181	16	prime	prime	NOUN
finefocus-615	181	17	)	)	PUNCT
finefocus-615	181	18	on	on	ADP
finefocus-615	181	19	an	an	DET
finefocus-615	181	20	eppendorf	eppendorf	PROPN
finefocus-615	181	21	master	master	PROPN
finefocus-615	181	22	cycler	cycler	PROPN
finefocus-615	181	23	pro	pro	X
finefocus-615	181	24	pcr	pcr	PROPN
finefocus-615	181	25	thermocycler	thermocycler	NOUN
finefocus-615	181	26	using	use	VERB
finefocus-615	181	27	0.2	0.2	NUM
finefocus-615	181	28	μm	μm	NUM
finefocus-615	181	29	of	of	ADP
finefocus-615	181	30	each	each	DET
finefocus-615	181	31	primer	primer	NOUN
finefocus-615	181	32	and	and	CCONJ
finefocus-615	181	33	10	10	NUM
finefocus-615	181	34	ng	ng	PROPN
finefocus-615	181	35	template	template	NOUN
finefocus-615	181	36	.	.	PUNCT
finefocus-615	182	1	reaction	reaction	NOUN
finefocus-615	182	2	conditions	condition	NOUN
finefocus-615	182	3	were	be	AUX
finefocus-615	182	4	:	:	PUNCT
finefocus-615	182	5	94	94	NUM
finefocus-615	183	1	°	°	ADP
finefocus-615	183	2	c	c	NOUN
finefocus-615	183	3	for	for	ADP
finefocus-615	183	4	3	3	NUM
finefocus-615	183	5	min	min	NOUN
finefocus-615	183	6	,	,	PUNCT
finefocus-615	183	7	followed	follow	VERB
finefocus-615	183	8	by	by	ADP
finefocus-615	183	9	35	35	NUM
finefocus-615	183	10	cycles	cycle	NOUN
finefocus-615	183	11	at	at	ADP
finefocus-615	183	12	94	94	NUM
finefocus-615	183	13	°	°	ADP
finefocus-615	183	14	c	c	NOUN
finefocus-615	183	15	for	for	ADP
finefocus-615	183	16	45	45	NUM
finefocus-615	183	17	secs	sec	NOUN
finefocus-615	183	18	,	,	PUNCT
finefocus-615	183	19	50	50	NUM
finefocus-615	183	20	°	°	NOUN
finefocus-615	183	21	c	c	NOUN
finefocus-615	183	22	for	for	ADP
finefocus-615	183	23	1	1	NUM
finefocus-615	183	24	min	min	NOUN
finefocus-615	183	25	and	and	CCONJ
finefocus-615	183	26	72	72	NUM
finefocus-615	183	27	°	°	NOUN
finefocus-615	183	28	c	c	NOUN
finefocus-615	183	29	for	for	ADP
finefocus-615	183	30	1.5	1.5	NUM
finefocus-615	183	31	min	min	NOUN
finefocus-615	183	32	.	.	PROPN
finefocus-615	183	33	following	follow	VERB
finefocus-615	183	34	the	the	DET
finefocus-615	183	35	35th	35th	ADJ
finefocus-615	183	36	cycle	cycle	NOUN
finefocus-615	183	37	,	,	PUNCT
finefocus-615	183	38	samples	sample	NOUN
finefocus-615	183	39	were	be	AUX
finefocus-615	183	40	incubated	incubate	VERB
finefocus-615	183	41	at	at	ADP
finefocus-615	183	42	72	72	NUM
finefocus-615	183	43	°	°	ADP
finefocus-615	183	44	c	c	NOUN
finefocus-615	183	45	for	for	ADP
finefocus-615	183	46	10	10	NUM
finefocus-615	183	47	min	min	NOUN
finefocus-615	183	48	.	.	PROPN
finefocus-615	183	49	amplicons	amplicon	NOUN
finefocus-615	183	50	were	be	AUX
finefocus-615	183	51	purified	purify	VERB
finefocus-615	183	52	using	use	VERB
finefocus-615	183	53	ampure	ampure	NOUN
finefocus-615	183	54	magnetic	magnetic	ADJ
finefocus-615	183	55	beads	bead	NOUN
finefocus-615	183	56	according	accord	VERB
finefocus-615	183	57	to	to	ADP
finefocus-615	183	58	the	the	DET
finefocus-615	183	59	manufacturer	manufacturer	NOUN
finefocus-615	183	60	’s	’s	PART
finefocus-615	183	61	instructions	instruction	NOUN
finefocus-615	183	62	(	(	PUNCT
finefocus-615	183	63	agencourt	agencourt	NOUN
finefocus-615	183	64	from	from	ADP
finefocus-615	183	65	beckman	beckman	PROPN
finefocus-615	183	66	coulter	coulter	PROPN
finefocus-615	183	67	,	,	PUNCT
finefocus-615	183	68	danvers	danvers	PROPN
finefocus-615	183	69	,	,	PUNCT
finefocus-615	183	70	ma	ma	PROPN
finefocus-615	183	71	)	)	PUNCT
finefocus-615	183	72	,	,	PUNCT
finefocus-615	183	73	quantified	quantify	VERB
finefocus-615	183	74	by	by	ADP
finefocus-615	183	75	nanodrop	nanodrop	NOUN
finefocus-615	183	76	,	,	PUNCT
finefocus-615	183	77	and	and	CCONJ
finefocus-615	183	78	further	far	ADV
finefocus-615	183	79	purified	purified	ADJ
finefocus-615	183	80	using	use	VERB
finefocus-615	183	81	the	the	DET
finefocus-615	183	82	qiagen	qiagen	NOUN
finefocus-615	183	83	minielute	minielute	NOUN
finefocus-615	183	84	gel	gel	NOUN
finefocus-615	183	85	extraction	extraction	NOUN
finefocus-615	183	86	kit	kit	NOUN
finefocus-615	183	87	(	(	PUNCT
finefocus-615	183	88	qiagen	qiagen	PROPN
finefocus-615	183	89	,	,	PUNCT
finefocus-615	183	90	valencia	valencia	PROPN
finefocus-615	183	91	,	,	PUNCT
finefocus-615	183	92	ca	ca	NOUN
finefocus-615	183	93	)	)	PUNCT
finefocus-615	183	94	.	.	PUNCT
finefocus-615	184	1	libraries	library	NOUN
finefocus-615	184	2	were	be	AUX
finefocus-615	184	3	quantified	quantify	VERB
finefocus-615	184	4	on	on	ADP
finefocus-615	184	5	a	a	DET
finefocus-615	184	6	bioanalyzer	bioanalyzer	NOUN
finefocus-615	184	7	instrument	instrument	NOUN
finefocus-615	184	8	according	accord	VERB
finefocus-615	184	9	to	to	ADP
finefocus-615	184	10	the	the	DET
finefocus-615	184	11	bioanalyzer	bioanalyzer	ADJ
finefocus-615	184	12	manual	manual	NOUN
finefocus-615	184	13	using	use	VERB
finefocus-615	184	14	a	a	DET
finefocus-615	184	15	dna	dna	PROPN
finefocus-615	184	16	high	high	ADJ
finefocus-615	184	17	sensitivity	sensitivity	NOUN
finefocus-615	184	18	chip	chip	NOUN
finefocus-615	184	19	,	,	PUNCT
finefocus-615	184	20	pooled	pool	VERB
finefocus-615	184	21	,	,	PUNCT
finefocus-615	184	22	and	and	CCONJ
finefocus-615	184	23	sequenced	sequence	VERB
finefocus-615	184	24	on	on	ADP
finefocus-615	184	25	a	a	DET
finefocus-615	184	26	miseq	miseq	ADJ
finefocus-615	184	27	illumina	illumina	ADJ
finefocus-615	184	28	sequencer	sequencer	NOUN
finefocus-615	184	29	(	(	PUNCT
finefocus-615	184	30	illumina	illumina	PROPN
finefocus-615	184	31	,	,	PUNCT
finefocus-615	184	32	san	san	PROPN
finefocus-615	184	33	diego	diego	PROPN
finefocus-615	184	34	,	,	PUNCT
finefocus-615	184	35	ca	ca	NOUN
finefocus-615	184	36	)	)	PUNCT
finefocus-615	184	37	.	.	PUNCT
finefocus-615	185	1	forward	forward	ADV
finefocus-615	185	2	and	and	CCONJ
finefocus-615	185	3	reverse	reverse	ADJ
finefocus-615	185	4	reads	read	NOUN
finefocus-615	185	5	were	be	AUX
finefocus-615	185	6	joined	join	VERB
finefocus-615	185	7	using	use	VERB
finefocus-615	185	8	flash	flash	NOUN
finefocus-615	185	9	software	software	NOUN
finefocus-615	185	10	(	(	PUNCT
finefocus-615	185	11	31	31	NUM
finefocus-615	185	12	)	)	PUNCT
finefocus-615	185	13	.	.	PUNCT
finefocus-615	186	1	libraries	library	NOUN
finefocus-615	186	2	were	be	AUX
finefocus-615	186	3	demultiplexed	demultiplexe	VERB
finefocus-615	186	4	and	and	CCONJ
finefocus-615	186	5	filtered	filter	VERB
finefocus-615	186	6	using	use	VERB
finefocus-615	186	7	a	a	DET
finefocus-615	186	8	q	q	ADJ
finefocus-615	186	9	-	-	PUNCT
finefocus-615	186	10	score	score	NOUN
finefocus-615	186	11	cutoff	cutoff	NOUN
finefocus-615	186	12	of	of	ADP
finefocus-615	186	13	20	20	NUM
finefocus-615	186	14	using	use	VERB
finefocus-615	186	15	split_libraries_fasq.py	split_libraries_fasq.py	NOUN
finefocus-615	186	16	in	in	ADP
finefocus-615	186	17	quantitative	quantitative	ADJ
finefocus-615	186	18	insights	insight	NOUN
finefocus-615	186	19	into	into	ADP
finefocus-615	186	20	microbial	microbial	ADJ
finefocus-615	186	21	ecology	ecology	NOUN
finefocus-615	186	22	(	(	PUNCT
finefocus-615	186	23	qiime	qiime	NOUN
finefocus-615	186	24	)	)	PUNCT
finefocus-615	186	25	v1.8.0	v1.8.0	NOUN
finefocus-615	186	26	(	(	PUNCT
finefocus-615	186	27	9	9	NUM
finefocus-615	186	28	)	)	PUNCT
finefocus-615	186	29	.	.	PUNCT
finefocus-615	187	1	any	any	DET
finefocus-615	187	2	reads	read	NOUN
finefocus-615	187	3	that	that	PRON
finefocus-615	187	4	did	do	AUX
finefocus-615	187	5	not	not	PART
finefocus-615	187	6	assemble	assemble	VERB
finefocus-615	187	7	or	or	CCONJ
finefocus-615	187	8	meet	meet	VERB
finefocus-615	187	9	the	the	DET
finefocus-615	187	10	q	q	ADJ
finefocus-615	187	11	-	-	PUNCT
finefocus-615	187	12	score	score	NOUN
finefocus-615	187	13	threshold	threshold	NOUN
finefocus-615	187	14	were	be	AUX
finefocus-615	187	15	removed	remove	VERB
finefocus-615	187	16	and	and	CCONJ
finefocus-615	187	17	were	be	AUX
finefocus-615	187	18	not	not	PART
finefocus-615	187	19	used	use	VERB
finefocus-615	187	20	in	in	ADP
finefocus-615	187	21	subsequent	subsequent	ADJ
finefocus-615	187	22	analyses	analysis	NOUN
finefocus-615	187	23	.	.	PUNCT
finefocus-615	188	1	sequences	sequence	NOUN
finefocus-615	188	2	were	be	AUX
finefocus-615	188	3	clustered	cluster	VERB
finefocus-615	188	4	into	into	ADP
finefocus-615	188	5	operational	operational	ADJ
finefocus-615	188	6	taxonomic	taxonomic	ADJ
finefocus-615	188	7	units	unit	NOUN
finefocus-615	188	8	(	(	PUNCT
finefocus-615	188	9	otus	otus	NOUN
finefocus-615	188	10	)	)	PUNCT
finefocus-615	188	11	using	use	VERB
finefocus-615	188	12	the	the	DET
finefocus-615	188	13	uclust	uclust	ADJ
finefocus-615	188	14	algorithm	algorithm	NOUN
finefocus-615	188	15	(	(	PUNCT
finefocus-615	188	16	15	15	NUM
finefocus-615	188	17	)	)	PUNCT
finefocus-615	188	18	at	at	ADP
finefocus-615	188	19	97	97	NUM
finefocus-615	188	20	%	%	NOUN
finefocus-615	188	21	sequence	sequence	NOUN
finefocus-615	188	22	identity	identity	NOUN
finefocus-615	188	23	level	level	NOUN
finefocus-615	188	24	with	with	ADP
finefocus-615	188	25	the	the	DET
finefocus-615	188	26	generation	generation	NOUN
finefocus-615	188	27	of	of	ADP
finefocus-615	188	28	new	new	ADJ
finefocus-615	188	29	clusters	cluster	NOUN
finefocus-615	188	30	with	with	ADP
finefocus-615	188	31	sequences	sequence	NOUN
finefocus-615	188	32	that	that	PRON
finefocus-615	188	33	match	match	VERB
finefocus-615	188	34	the	the	DET
finefocus-615	188	35	reference	reference	NOUN
finefocus-615	188	36	,	,	PUNCT
finefocus-615	188	37	and	and	CCONJ
finefocus-615	188	38	classified	classify	VERB
finefocus-615	188	39	using	use	VERB
finefocus-615	188	40	the	the	DET
finefocus-615	188	41	greengenes	greengene	NOUN
finefocus-615	188	42	97	97	NUM
finefocus-615	188	43	%	%	NOUN
finefocus-615	188	44	reference	reference	NOUN
finefocus-615	188	45	dataset	dataset	NOUN
finefocus-615	188	46	released	release	VERB
finefocus-615	188	47	on	on	ADP
finefocus-615	188	48	may	may	PROPN
finefocus-615	188	49	2013	2013	NUM
finefocus-615	188	50	(	(	PUNCT
finefocus-615	188	51	12	12	NUM
finefocus-615	188	52	,	,	PUNCT
finefocus-615	188	53	33	33	NUM
finefocus-615	188	54	)	)	PUNCT
finefocus-615	188	55	.	.	PUNCT
finefocus-615	189	1	raw	raw	ADJ
finefocus-615	189	2	sequence	sequence	NOUN
finefocus-615	189	3	data	datum	NOUN
finefocus-615	189	4	were	be	AUX
finefocus-615	189	5	submitted	submit	VERB
finefocus-615	189	6	to	to	ADP
finefocus-615	189	7	sequence	sequence	NOUN
finefocus-615	189	8	read	read	VERB
finefocus-615	189	9	archive	archive	NOUN
finefocus-615	189	10	in	in	ADP
finefocus-615	189	11	genbank	genbank	NOUN
finefocus-615	189	12	under	under	ADP
finefocus-615	189	13	accession	accession	NOUN
finefocus-615	189	14	number	number	NOUN
finefocus-615	189	15	prjna354727	prjna354727	PROPN
finefocus-615	189	16	.	.	PUNCT
finefocus-615	190	1	antibiotic	antibiotic	ADJ
finefocus-615	190	2	disc	disc	NOUN
finefocus-615	190	3	susceptibility	susceptibility	NOUN
finefocus-615	190	4	assay	assay	ADV
finefocus-615	190	5	we	we	PRON
finefocus-615	190	6	used	use	VERB
finefocus-615	190	7	a	a	DET
finefocus-615	190	8	modified	modify	VERB
finefocus-615	190	9	version	version	NOUN
finefocus-615	190	10	of	of	ADP
finefocus-615	190	11	antibiotic	antibiotic	ADJ
finefocus-615	190	12	disc	disc	NOUN
finefocus-615	190	13	diffusion	diffusion	NOUN
finefocus-615	190	14	susceptibility	susceptibility	NOUN
finefocus-615	190	15	test	test	NOUN
finefocus-615	190	16	to	to	PART
finefocus-615	190	17	compare	compare	VERB
finefocus-615	190	18	fungal	fungal	ADJ
finefocus-615	190	19	and	and	CCONJ
finefocus-615	190	20	bacterial	bacterial	ADJ
finefocus-615	190	21	-	-	PUNCT
finefocus-615	190	22	derived	derive	VERB
finefocus-615	190	23	antibiotic	antibiotic	ADJ
finefocus-615	190	24	susceptibility	susceptibility	NOUN
finefocus-615	190	25	of	of	ADP
finefocus-615	190	26	cheese	cheese	NOUN
finefocus-615	190	27	bacteria	bacteria	NOUN
finefocus-615	190	28	isolates	isolate	NOUN
finefocus-615	190	29	,	,	PUNCT
finefocus-615	190	30	focusing	focus	VERB
finefocus-615	190	31	on	on	ADP
finefocus-615	190	32	antibiotic	antibiotic	ADJ
finefocus-615	190	33	susceptibility	susceptibility	NOUN
finefocus-615	190	34	trends	trend	NOUN
finefocus-615	190	35	among	among	ADP
finefocus-615	190	36	isolates	isolate	NOUN
finefocus-615	190	37	cultured	cultured	ADJ
finefocus-615	190	38	from	from	ADP
finefocus-615	190	39	cheeses	cheese	NOUN
finefocus-615	190	40	of	of	ADP
finefocus-615	190	41	different	different	ADJ
finefocus-615	190	42	regions	region	NOUN
finefocus-615	190	43	(	(	PUNCT
finefocus-615	190	44	5	5	NUM
finefocus-615	190	45	,	,	PUNCT
finefocus-615	190	46	7	7	NUM
finefocus-615	190	47	)	)	PUNCT
finefocus-615	190	48	.	.	PUNCT
finefocus-615	191	1	ten	ten	NUM
finefocus-615	191	2	morphologically	morphologically	ADV
finefocus-615	191	3	diverse	diverse	ADJ
finefocus-615	191	4	isolates	isolate	NOUN
finefocus-615	191	5	were	be	AUX
finefocus-615	191	6	cultured	cultured	ADJ
finefocus-615	191	7	in	in	ADP
finefocus-615	191	8	nutrient	nutrient	ADJ
finefocus-615	191	9	broth	broth	NOUN
finefocus-615	191	10	(	(	PUNCT
finefocus-615	191	11	nb	nb	INTJ
finefocus-615	191	12	;	;	PUNCT
finefocus-615	191	13	becton	becton	PROPN
finefocus-615	191	14	,	,	PUNCT
finefocus-615	191	15	dickinson	dickinson	PROPN
finefocus-615	191	16	and	and	CCONJ
finefocus-615	191	17	company	company	NOUN
finefocus-615	191	18	,	,	PUNCT
finefocus-615	191	19	franklin	franklin	PROPN
finefocus-615	191	20	lakes	lakes	PROPN
finefocus-615	191	21	,	,	PUNCT
finefocus-615	191	22	nj	nj	PROPN
finefocus-615	191	23	,	,	PUNCT
finefocus-615	191	24	usa	usa	PROPN
finefocus-615	191	25	)	)	PUNCT
finefocus-615	191	26	for	for	ADP
finefocus-615	191	27	40	40	NUM
finefocus-615	191	28	48	48	NUM
finefocus-615	191	29	hours	hour	NOUN
finefocus-615	191	30	.	.	PUNCT
finefocus-615	192	1	the	the	DET
finefocus-615	192	2	liquid	liquid	ADJ
finefocus-615	192	3	culture	culture	NOUN
finefocus-615	192	4	of	of	ADP
finefocus-615	192	5	bacteria	bacteria	NOUN
finefocus-615	192	6	was	be	AUX
finefocus-615	192	7	diluted	dilute	VERB
finefocus-615	192	8	using	use	VERB
finefocus-615	192	9	nb	nb	NOUN
finefocus-615	192	10	to	to	PART
finefocus-615	192	11	match	match	VERB
finefocus-615	192	12	the	the	DET
finefocus-615	192	13	turbidity	turbidity	NOUN
finefocus-615	192	14	of	of	ADP
finefocus-615	192	15	a	a	DET
finefocus-615	192	16	0.5	0.5	NUM
finefocus-615	192	17	mcfarland	mcfarland	PROPN
finefocus-615	192	18	standard	standard	NOUN
finefocus-615	192	19	to	to	PART
finefocus-615	192	20	ensure	ensure	VERB
finefocus-615	192	21	roughly	roughly	ADV
finefocus-615	192	22	equivalent	equivalent	ADJ
finefocus-615	192	23	densities	density	NOUN
finefocus-615	192	24	of	of	ADP
finefocus-615	192	25	each	each	DET
finefocus-615	192	26	inoculum	inoculum	NOUN
finefocus-615	192	27	.	.	PUNCT
finefocus-615	193	1	bacterial	bacterial	ADJ
finefocus-615	193	2	culture	culture	NOUN
finefocus-615	193	3	was	be	AUX
finefocus-615	193	4	evenly	evenly	ADV
finefocus-615	193	5	streaked	streak	VERB
finefocus-615	193	6	onto	onto	ADP
finefocus-615	193	7	the	the	DET
finefocus-615	193	8	dried	dry	VERB
finefocus-615	193	9	surface	surface	NOUN
finefocus-615	193	10	of	of	ADP
finefocus-615	193	11	a	a	DET
finefocus-615	193	12	nutrient	nutrient	NOUN
finefocus-615	193	13	agar	agar	NOUN
finefocus-615	193	14	plate	plate	NOUN
finefocus-615	193	15	using	use	VERB
finefocus-615	193	16	a	a	DET
finefocus-615	193	17	sterile	sterile	ADJ
finefocus-615	193	18	swab	swab	NOUN
finefocus-615	193	19	and	and	CCONJ
finefocus-615	193	20	allowed	allow	VERB
finefocus-615	193	21	to	to	PART
finefocus-615	193	22	be	be	AUX
finefocus-615	193	23	absorbed	absorb	VERB
finefocus-615	193	24	into	into	ADP
finefocus-615	193	25	the	the	DET
finefocus-615	193	26	agar	agar	NOUN
finefocus-615	193	27	for	for	ADP
finefocus-615	193	28	at	at	ADV
finefocus-615	193	29	least	least	ADV
finefocus-615	193	30	3	3	NUM
finefocus-615	193	31	5	5	NUM
finefocus-615	193	32	minutes	minute	NOUN
finefocus-615	193	33	.	.	PUNCT
finefocus-615	194	1	six	six	NUM
finefocus-615	194	2	antimicrobialbacterial	antimicrobialbacterial	ADJ
finefocus-615	194	3	community	community	NOUN
finefocus-615	194	4	structure	structure	NOUN
finefocus-615	194	5	in	in	ADP
finefocus-615	194	6	cheese	cheese	NOUN
finefocus-615	194	7	•	•	NUM
finefocus-615	194	8	15	15	NUM
finefocus-615	194	9	impregnated	impregnated	ADJ
finefocus-615	194	10	discs	disc	NOUN
finefocus-615	194	11	(	(	PUNCT
finefocus-615	194	12	am10	am10	PROPN
finefocus-615	194	13	:	:	PUNCT
finefocus-615	194	14	ampicillin	ampicillin	PROPN
finefocus-615	194	15	10	10	NUM
finefocus-615	194	16	μg	μg	PROPN
finefocus-615	194	17	;	;	PUNCT
finefocus-615	194	18	p10	p10	PROPN
finefocus-615	194	19	:	:	PUNCT
finefocus-615	194	20	penicillin	penicillin	NOUN
finefocus-615	194	21	10	10	NUM
finefocus-615	194	22	iu	iu	NOUN
finefocus-615	194	23	/	/	SYM
finefocus-615	194	24	ie	ie	X
finefocus-615	194	25	/	/	SYM
finefocus-615	194	26	ui	ui	PROPN
finefocus-615	194	27	;	;	PUNCT
finefocus-615	194	28	e15	e15	PROPN
finefocus-615	194	29	:	:	PUNCT
finefocus-615	194	30	erythromycin	erythromycin	VERB
finefocus-615	194	31	15	15	NUM
finefocus-615	194	32	μg	μg	NOUN
finefocus-615	194	33	;	;	PUNCT
finefocus-615	194	34	ra5	ra5	PROPN
finefocus-615	194	35	:	:	PUNCT
finefocus-615	194	36	rifampin	rifampin	VERB
finefocus-615	194	37	5	5	NUM
finefocus-615	194	38	μg	μg	PROPN
finefocus-615	194	39	;	;	PUNCT
finefocus-615	194	40	n30	n30	NUM
finefocus-615	194	41	:	:	PUNCT
finefocus-615	194	42	neomycin	neomycin	PROPN
finefocus-615	194	43	30	30	NUM
finefocus-615	194	44	μg	μg	NOUN
finefocus-615	194	45	;	;	PUNCT
finefocus-615	194	46	nb30	nb30	PROPN
finefocus-615	194	47	:	:	PUNCT
finefocus-615	194	48	novobiocin	novobiocin	PROPN
finefocus-615	194	49	30	30	NUM
finefocus-615	194	50	μg	μg	NOUN
finefocus-615	194	51	)	)	PUNCT
finefocus-615	194	52	were	be	AUX
finefocus-615	194	53	evenly	evenly	ADV
finefocus-615	194	54	pressed	press	VERB
finefocus-615	194	55	onto	onto	ADP
finefocus-615	194	56	the	the	DET
finefocus-615	194	57	bacterial	bacterial	ADJ
finefocus-615	194	58	-	-	PUNCT
finefocus-615	194	59	containing	contain	VERB
finefocus-615	194	60	agar	agar	NOUN
finefocus-615	194	61	surface	surface	NOUN
finefocus-615	194	62	using	use	VERB
finefocus-615	194	63	a	a	DET
finefocus-615	194	64	disc	disc	NOUN
finefocus-615	194	65	dispenser	dispenser	NOUN
finefocus-615	194	66	.	.	PUNCT
finefocus-615	195	1	plates	plate	NOUN
finefocus-615	195	2	were	be	AUX
finefocus-615	195	3	incubated	incubate	VERB
finefocus-615	195	4	for	for	ADP
finefocus-615	195	5	one	one	NUM
finefocus-615	195	6	week	week	NOUN
finefocus-615	195	7	at	at	ADP
finefocus-615	195	8	room	room	NOUN
finefocus-615	195	9	temperature	temperature	NOUN
finefocus-615	195	10	prior	prior	ADV
finefocus-615	195	11	to	to	ADP
finefocus-615	195	12	examination	examination	NOUN
finefocus-615	195	13	for	for	ADP
finefocus-615	195	14	antibiotic	antibiotic	ADJ
finefocus-615	195	15	susceptibility	susceptibility	NOUN
finefocus-615	195	16	.	.	PUNCT
finefocus-615	196	1	diameter	diameter	NOUN
finefocus-615	196	2	measurements	measurement	NOUN
finefocus-615	196	3	in	in	ADP
finefocus-615	196	4	millimeters	millimeter	NOUN
finefocus-615	196	5	of	of	ADP
finefocus-615	196	6	the	the	DET
finefocus-615	196	7	zone	zone	NOUN
finefocus-615	196	8	of	of	ADP
finefocus-615	196	9	clearance	clearance	NOUN
finefocus-615	196	10	around	around	ADP
finefocus-615	196	11	the	the	DET
finefocus-615	196	12	individual	individual	ADJ
finefocus-615	196	13	antibiotic	antibiotic	ADJ
finefocus-615	196	14	discs	disc	NOUN
finefocus-615	196	15	for	for	ADP
finefocus-615	196	16	cheese	cheese	NOUN
finefocus-615	196	17	isolates	isolate	NOUN
finefocus-615	196	18	were	be	AUX
finefocus-615	196	19	used	use	VERB
finefocus-615	196	20	to	to	PART
finefocus-615	196	21	categorize	categorize	VERB
finefocus-615	196	22	each	each	DET
finefocus-615	196	23	cheese	cheese	NOUN
finefocus-615	196	24	isolate	isolate	VERB
finefocus-615	196	25	into	into	ADP
finefocus-615	196	26	one	one	NUM
finefocus-615	196	27	of	of	ADP
finefocus-615	196	28	the	the	DET
finefocus-615	196	29	three	three	NUM
finefocus-615	196	30	susceptibility	susceptibility	NOUN
finefocus-615	196	31	levels	level	NOUN
finefocus-615	196	32	based	base	VERB
finefocus-615	196	33	on	on	ADP
finefocus-615	196	34	the	the	DET
finefocus-615	196	35	following	follow	VERB
finefocus-615	196	36	zone	zone	NOUN
finefocus-615	196	37	clearance	clearance	NOUN
finefocus-615	196	38	interpretation	interpretation	NOUN
finefocus-615	196	39	:	:	PUNCT
finefocus-615	196	40	resistant	resistant	ADJ
finefocus-615	196	41	(	(	PUNCT
finefocus-615	196	42	13	13	NUM
finefocus-615	196	43	mm	mm	NOUN
finefocus-615	196	44	or	or	CCONJ
finefocus-615	196	45	less	less	ADJ
finefocus-615	196	46	)	)	PUNCT
finefocus-615	196	47	;	;	PUNCT
finefocus-615	196	48	intermediate	intermediate	ADJ
finefocus-615	196	49	susceptible	susceptible	ADJ
finefocus-615	196	50	(	(	PUNCT
finefocus-615	196	51	14	14	NUM
finefocus-615	196	52	–	–	SYM
finefocus-615	196	53	16	16	NUM
finefocus-615	196	54	mm	mm	NOUN
finefocus-615	196	55	)	)	PUNCT
finefocus-615	196	56	;	;	PUNCT
finefocus-615	196	57	and	and	CCONJ
finefocus-615	196	58	susceptible	susceptible	ADJ
finefocus-615	196	59	(	(	PUNCT
finefocus-615	196	60	17	17	NUM
finefocus-615	196	61	mm	mm	NOUN
finefocus-615	196	62	or	or	CCONJ
finefocus-615	196	63	more	more	ADJ
finefocus-615	196	64	)	)	PUNCT
finefocus-615	196	65	(	(	PUNCT
finefocus-615	196	66	45	45	NUM
finefocus-615	196	67	)	)	PUNCT
finefocus-615	196	68	.	.	PUNCT
finefocus-615	197	1	carbon	carbon	NOUN
finefocus-615	197	2	source	source	NOUN
finefocus-615	197	3	utilization	utilization	NOUN
finefocus-615	197	4	profiling	profile	VERB
finefocus-615	197	5	community	community	NOUN
finefocus-615	197	6	-	-	PUNCT
finefocus-615	197	7	level	level	NOUN
finefocus-615	197	8	physiological	physiological	ADJ
finefocus-615	197	9	profiling	profiling	NOUN
finefocus-615	197	10	(	(	PUNCT
finefocus-615	197	11	clpp	clpp	NOUN
finefocus-615	197	12	)	)	PUNCT
finefocus-615	197	13	,	,	PUNCT
finefocus-615	197	14	a	a	DET
finefocus-615	197	15	metabolic	metabolic	NOUN
finefocus-615	197	16	profile	profile	NOUN
finefocus-615	197	17	,	,	PUNCT
finefocus-615	197	18	of	of	ADP
finefocus-615	197	19	both	both	CCONJ
finefocus-615	197	20	the	the	DET
finefocus-615	197	21	cheese	cheese	NOUN
finefocus-615	197	22	rind	rind	NOUN
finefocus-615	197	23	and	and	CCONJ
finefocus-615	197	24	selected	select	VERB
finefocus-615	197	25	curd	curd	NOUN
finefocus-615	197	26	communities	community	NOUN
finefocus-615	197	27	and	and	CCONJ
finefocus-615	197	28	individual	individual	ADJ
finefocus-615	197	29	bacterial	bacterial	ADJ
finefocus-615	197	30	isolates	isolate	NOUN
finefocus-615	197	31	were	be	AUX
finefocus-615	197	32	analyzed	analyze	VERB
finefocus-615	197	33	using	use	VERB
finefocus-615	197	34	biolog	biolog	PROPN
finefocus-615	197	35	ecoplatetm	ecoplatetm	PROPN
finefocus-615	197	36	assay	assay	PROPN
finefocus-615	197	37	(	(	PUNCT
finefocus-615	197	38	biolog	biolog	PROPN
finefocus-615	197	39	,	,	PUNCT
finefocus-615	197	40	hayward	hayward	PROPN
finefocus-615	197	41	,	,	PUNCT
finefocus-615	197	42	ca	ca	NOUN
finefocus-615	197	43	)	)	PUNCT
finefocus-615	197	44	.	.	PUNCT
finefocus-615	198	1	the	the	DET
finefocus-615	198	2	capacity	capacity	NOUN
finefocus-615	198	3	of	of	ADP
finefocus-615	198	4	either	either	CCONJ
finefocus-615	198	5	a	a	DET
finefocus-615	198	6	bacterial	bacterial	ADJ
finefocus-615	198	7	community	community	NOUN
finefocus-615	198	8	or	or	CCONJ
finefocus-615	198	9	a	a	DET
finefocus-615	198	10	single	single	ADJ
finefocus-615	198	11	bacterial	bacterial	ADJ
finefocus-615	198	12	isolate	isolate	NOUN
finefocus-615	198	13	to	to	PART
finefocus-615	198	14	utilize	utilize	VERB
finefocus-615	198	15	31	31	NUM
finefocus-615	198	16	distinct	distinct	ADJ
finefocus-615	198	17	carbon	carbon	NOUN
finefocus-615	198	18	sources	source	NOUN
finefocus-615	198	19	over	over	ADP
finefocus-615	198	20	a	a	DET
finefocus-615	198	21	7	7	NUM
finefocus-615	198	22	-	-	PUNCT
finefocus-615	198	23	day	day	NOUN
finefocus-615	198	24	period	period	NOUN
finefocus-615	198	25	was	be	AUX
finefocus-615	198	26	examined	examine	VERB
finefocus-615	198	27	and	and	CCONJ
finefocus-615	198	28	compared	compare	VERB
finefocus-615	198	29	between	between	ADP
finefocus-615	198	30	the	the	DET
finefocus-615	198	31	community	community	NOUN
finefocus-615	198	32	sample	sample	NOUN
finefocus-615	198	33	and	and	CCONJ
finefocus-615	198	34	isolates	isolate	NOUN
finefocus-615	198	35	of	of	ADP
finefocus-615	198	36	the	the	DET
finefocus-615	198	37	same	same	ADJ
finefocus-615	198	38	cheese	cheese	NOUN
finefocus-615	198	39	and	and	CCONJ
finefocus-615	198	40	among	among	ADP
finefocus-615	198	41	different	different	ADJ
finefocus-615	198	42	cheese	cheese	NOUN
finefocus-615	198	43	types	type	NOUN
finefocus-615	198	44	.	.	PUNCT
finefocus-615	199	1	the	the	DET
finefocus-615	199	2	100	100	NUM
finefocus-615	199	3	+	+	NOUN
finefocus-615	199	4	/10	/10	ADJ
finefocus-615	199	5	mg	mg	X
finefocus-615	199	6	of	of	ADP
finefocus-615	199	7	fresh	fresh	ADJ
finefocus-615	199	8	rind	rind	NOUN
finefocus-615	199	9	and	and	CCONJ
finefocus-615	199	10	curd	curd	NOUN
finefocus-615	199	11	samples	sample	NOUN
finefocus-615	199	12	were	be	AUX
finefocus-615	199	13	crushed	crush	VERB
finefocus-615	199	14	with	with	ADP
finefocus-615	199	15	a	a	DET
finefocus-615	199	16	pestle	pestle	NOUN
finefocus-615	199	17	and	and	CCONJ
finefocus-615	199	18	diluted	dilute	VERB
finefocus-615	199	19	in	in	ADP
finefocus-615	199	20	sterile	sterile	ADJ
finefocus-615	199	21	water	water	NOUN
finefocus-615	199	22	to	to	ADP
finefocus-615	199	23	10	10	NUM
finefocus-615	199	24	-	-	SYM
finefocus-615	199	25	3	3	NUM
finefocus-615	199	26	in	in	ADP
finefocus-615	199	27	10	10	NUM
finefocus-615	199	28	mm	mm	NOUN
finefocus-615	199	29	phosphate	phosphate	NOUN
finefocus-615	199	30	buffer	buffer	NOUN
finefocus-615	199	31	.	.	PUNCT
finefocus-615	200	1	subsequently	subsequently	ADV
finefocus-615	200	2	,	,	PUNCT
finefocus-615	200	3	100	100	NUM
finefocus-615	200	4	μl	μl	ADP
finefocus-615	200	5	of	of	ADP
finefocus-615	200	6	the	the	DET
finefocus-615	200	7	solution	solution	NOUN
finefocus-615	200	8	was	be	AUX
finefocus-615	200	9	inoculated	inoculate	VERB
finefocus-615	200	10	into	into	ADP
finefocus-615	200	11	separate	separate	ADJ
finefocus-615	200	12	biolog	biolog	PROPN
finefocus-615	200	13	ecoplatetm	ecoplatetm	PROPN
finefocus-615	200	14	wells	wells	PROPN
finefocus-615	200	15	.	.	PUNCT
finefocus-615	201	1	individual	individual	ADJ
finefocus-615	201	2	isolates	isolate	NOUN
finefocus-615	201	3	were	be	AUX
finefocus-615	201	4	incubated	incubate	VERB
finefocus-615	201	5	in	in	ADP
finefocus-615	201	6	nb	nb	PROPN
finefocus-615	201	7	overnight	overnight	ADV
finefocus-615	201	8	at	at	ADP
finefocus-615	201	9	room	room	NOUN
finefocus-615	201	10	temperature	temperature	NOUN
finefocus-615	201	11	and	and	CCONJ
finefocus-615	201	12	diluted	dilute	VERB
finefocus-615	201	13	to	to	ADP
finefocus-615	201	14	104	104	NUM
finefocus-615	201	15	cells	cell	NOUN
finefocus-615	201	16	/	/	SYM
finefocus-615	201	17	ml	ml	NOUN
finefocus-615	201	18	and	and	CCONJ
finefocus-615	201	19	100	100	NUM
finefocus-615	201	20	μl	μl	ADV
finefocus-615	201	21	was	be	AUX
finefocus-615	201	22	inoculated	inoculate	VERB
finefocus-615	201	23	into	into	ADP
finefocus-615	201	24	each	each	DET
finefocus-615	201	25	well	well	NOUN
finefocus-615	201	26	of	of	ADP
finefocus-615	201	27	the	the	DET
finefocus-615	201	28	new	new	ADJ
finefocus-615	201	29	biolog	biolog	PROPN
finefocus-615	201	30	ecoplatetm	ecoplatetm	PROPN
finefocus-615	201	31	.	.	PUNCT
finefocus-615	202	1	growth	growth	NOUN
finefocus-615	202	2	was	be	AUX
finefocus-615	202	3	measured	measure	VERB
finefocus-615	202	4	using	use	VERB
finefocus-615	202	5	the	the	DET
finefocus-615	202	6	molecular	molecular	ADJ
finefocus-615	202	7	devices	device	NOUN
finefocus-615	202	8	spectramax	spectramax	NOUN
finefocus-615	202	9	190	190	NUM
finefocus-615	202	10	and	and	CCONJ
finefocus-615	202	11	the	the	DET
finefocus-615	202	12	softmaxpro6.3	softmaxpro6.3	ADJ
finefocus-615	202	13	™	™	ADJ
finefocus-615	202	14	program	program	NOUN
finefocus-615	202	15	at	at	ADP
finefocus-615	202	16	a590	a590	PROPN
finefocus-615	202	17	absorbance	absorbance	NOUN
finefocus-615	202	18	,	,	PUNCT
finefocus-615	202	19	for	for	ADP
finefocus-615	202	20	six	six	NUM
finefocus-615	202	21	consecutive	consecutive	ADJ
finefocus-615	202	22	days	day	NOUN
finefocus-615	202	23	where	where	SCONJ
finefocus-615	202	24	day	day	NOUN
finefocus-615	202	25	1	1	NUM
finefocus-615	202	26	was	be	AUX
finefocus-615	202	27	the	the	DET
finefocus-615	202	28	day	day	NOUN
finefocus-615	202	29	of	of	ADP
finefocus-615	202	30	inoculation	inoculation	NOUN
finefocus-615	202	31	.	.	PUNCT
finefocus-615	203	1	metabolic	metabolic	NOUN
finefocus-615	203	2	diversity	diversity	NOUN
finefocus-615	203	3	(	(	PUNCT
finefocus-615	203	4	cmd	cmd	NOUN
finefocus-615	203	5	)	)	PUNCT
finefocus-615	203	6	was	be	AUX
finefocus-615	203	7	defined	define	VERB
finefocus-615	203	8	as	as	ADP
finefocus-615	203	9	the	the	DET
finefocus-615	203	10	number	number	NOUN
finefocus-615	203	11	of	of	ADP
finefocus-615	203	12	carbon	carbon	NOUN
finefocus-615	203	13	sources	source	NOUN
finefocus-615	203	14	utilized	utilize	VERB
finefocus-615	203	15	by	by	ADP
finefocus-615	203	16	the	the	DET
finefocus-615	203	17	sample	sample	NOUN
finefocus-615	203	18	.	.	PUNCT
finefocus-615	204	1	top	top	ADJ
finefocus-615	204	2	carbon	carbon	NOUN
finefocus-615	204	3	sources	source	NOUN
finefocus-615	204	4	were	be	AUX
finefocus-615	204	5	defined	define	VERB
finefocus-615	204	6	as	as	ADP
finefocus-615	204	7	carbon	carbon	NOUN
finefocus-615	204	8	sources	source	NOUN
finefocus-615	204	9	that	that	PRON
finefocus-615	204	10	exhibited	exhibit	VERB
finefocus-615	204	11	the	the	DET
finefocus-615	204	12	maximum	maximum	ADJ
finefocus-615	204	13	absorbance	absorbance	NOUN
finefocus-615	204	14	value	value	NOUN
finefocus-615	204	15	for	for	ADP
finefocus-615	204	16	from	from	ADP
finefocus-615	204	17	fluorescence	fluorescence	NOUN
finefocus-615	204	18	of	of	ADP
finefocus-615	204	19	tetrazolium	tetrazolium	NOUN
finefocus-615	204	20	salt	salt	NOUN
finefocus-615	204	21	reduction	reduction	NOUN
finefocus-615	204	22	in	in	ADP
finefocus-615	204	23	the	the	DET
finefocus-615	204	24	biolog	biolog	PROPN
finefocus-615	204	25	ecoplatetm	ecoplatetm	PROPN
finefocus-615	204	26	assay	assay	PROPN
finefocus-615	204	27	.	.	PUNCT
finefocus-615	205	1	cheese	cheese	NOUN
finefocus-615	205	2	origin	origin	NOUN
finefocus-615	205	3	country	country	NOUN
finefocus-615	205	4	milk	milk	NOUN
finefocus-615	205	5	curd	curd	NOUN
finefocus-615	205	6	ph	ph	NOUN
finefocus-615	205	7	rind	rind	NOUN
finefocus-615	205	8	ph	ph	NOUN
finefocus-615	205	9	curd	curd	NOUN
finefocus-615	205	10	%	%	NOUN
finefocus-615	205	11	moisture	moisture	NOUN
finefocus-615	205	12	rind	rind	NOUN
finefocus-615	205	13	%	%	NOUN
finefocus-615	205	14	moisture	moisture	NOUN
finefocus-615	205	15	alpage	alpage	NOUN
finefocus-615	205	16	gruyere	gruyere	NOUN
finefocus-615	205	17	gruyere	gruyere	PROPN
finefocus-615	205	18	switzerland	switzerland	PROPN
finefocus-615	205	19	cow	cow	PROPN
finefocus-615	205	20	7.45	7.45	NUM
finefocus-615	205	21	6.42	6.42	NUM
finefocus-615	205	22	9.71	9.71	NUM
finefocus-615	205	23	28.43	28.43	NUM
finefocus-615	205	24	comte	comte	NOUN
finefocus-615	205	25	french	french	ADJ
finefocus-615	205	26	alps	alps	PROPN
finefocus-615	205	27	france	france	PROPN
finefocus-615	205	28	cow	cow	PROPN
finefocus-615	205	29	7.14	7.14	NUM
finefocus-615	205	30	6.5	6.5	NUM
finefocus-615	205	31	21	21	NUM
finefocus-615	205	32	26	26	NUM
finefocus-615	205	33	maggie	maggie	NOUN
finefocus-615	205	34	’s	’s	PART
finefocus-615	205	35	round	round	PROPN
finefocus-615	205	36	ma	ma	PROPN
finefocus-615	205	37	usa	usa	PROPN
finefocus-615	205	38	cow	cow	PROPN
finefocus-615	205	39	5.34	5.34	NUM
finefocus-615	205	40	5.04	5.04	NUM
finefocus-615	205	41	4	4	NUM
finefocus-615	205	42	26	26	NUM
finefocus-615	205	43	missouri	missouri	PROPN
finefocus-615	205	44	truckle	truckle	PROPN
finefocus-615	205	45	mo	mo	PROPN
finefocus-615	205	46	usa	usa	PROPN
finefocus-615	205	47	cow	cow	PROPN
finefocus-615	205	48	6.01	6.01	NUM
finefocus-615	205	49	5.73	5.73	NUM
finefocus-615	205	50	27	27	NUM
finefocus-615	205	51	24	24	NUM
finefocus-615	205	52	vermont	vermont	PROPN
finefocus-615	205	53	shepherd	shepherd	PROPN
finefocus-615	205	54	vt	vt	PROPN
finefocus-615	205	55	usa	usa	PROPN
finefocus-615	205	56	sheep	sheep	PROPN
finefocus-615	205	57	nd	nd	INTJ
finefocus-615	205	58	nd	nd	NOUN
finefocus-615	205	59	nd	nd	NOUN
finefocus-615	205	60	nd	nd	PROPN
finefocus-615	205	61	sonnet	sonnet	PROPN
finefocus-615	205	62	vt	vt	PROPN
finefocus-615	205	63	usa	usa	PROPN
finefocus-615	205	64	goat	goat	PROPN
finefocus-615	205	65	6.44	6.44	NUM
finefocus-615	205	66	5.55	5.55	NUM
finefocus-615	205	67	nd	nd	PRON
finefocus-615	205	68	nd	nd	PRON
finefocus-615	205	69	stichelton	stichelton	PROPN
finefocus-615	205	70	nottingham	nottingham	PROPN
finefocus-615	205	71	england	england	PROPN
finefocus-615	205	72	cow	cow	PROPN
finefocus-615	205	73	8.17	8.17	NUM
finefocus-615	205	74	blue	blue	ADJ
finefocus-615	205	75	8.24	8.24	NUM
finefocus-615	205	76	white	white	ADJ
finefocus-615	205	77	6.96	6.96	NUM
finefocus-615	205	78	nd	nd	NOUN
finefocus-615	205	79	nd	nd	NOUN
finefocus-615	205	80	table	table	NOUN
finefocus-615	205	81	1	1	NUM
finefocus-615	205	82	.	.	PUNCT
finefocus-615	206	1	characteristics	characteristic	NOUN
finefocus-615	206	2	of	of	ADP
finefocus-615	206	3	the	the	DET
finefocus-615	206	4	seven	seven	NUM
finefocus-615	206	5	investigated	investigate	VERB
finefocus-615	206	6	natural	natural	ADJ
finefocus-615	206	7	rind	rind	NOUN
finefocus-615	206	8	cheeses	cheese	NOUN
finefocus-615	206	9	.	.	PUNCT
finefocus-615	207	1	nd	nd	AUX
finefocus-615	207	2	=	=	SYM
finefocus-615	207	3	not	not	PART
finefocus-615	207	4	determined	determine	VERB
finefocus-615	207	5	.	.	PUNCT
finefocus-615	208	1	16	16	NUM
finefocus-615	208	2	•	•	NUM
finefocus-615	208	3	fine	fine	ADJ
finefocus-615	208	4	focus	focus	NOUN
finefocus-615	208	5	,	,	PUNCT
finefocus-615	208	6	vol	vol	NOUN
finefocus-615	208	7	.	.	NOUN
finefocus-615	208	8	3	3	NUM
finefocus-615	208	9	(	(	PUNCT
finefocus-615	208	10	1	1	NUM
finefocus-615	208	11	)	)	PUNCT
finefocus-615	208	12	environmental	environmental	ADJ
finefocus-615	208	13	parameters	parameter	NOUN
finefocus-615	208	14	of	of	ADP
finefocus-615	208	15	natural	natural	ADJ
finefocus-615	208	16	rind	rind	NOUN
finefocus-615	208	17	cheeses	cheese	NOUN
finefocus-615	208	18	to	to	PART
finefocus-615	208	19	explore	explore	VERB
finefocus-615	208	20	the	the	DET
finefocus-615	208	21	relationship	relationship	NOUN
finefocus-615	208	22	between	between	ADP
finefocus-615	208	23	the	the	DET
finefocus-615	208	24	rind	rind	NOUN
finefocus-615	208	25	and	and	CCONJ
finefocus-615	208	26	curd	curd	NOUN
finefocus-615	208	27	within	within	ADP
finefocus-615	208	28	and	and	CCONJ
finefocus-615	208	29	between	between	ADP
finefocus-615	208	30	natural	natural	ADJ
finefocus-615	208	31	rind	rind	NOUN
finefocus-615	208	32	cheeses	cheese	NOUN
finefocus-615	208	33	,	,	PUNCT
finefocus-615	208	34	and	and	CCONJ
finefocus-615	208	35	to	to	PART
finefocus-615	208	36	determine	determine	VERB
finefocus-615	208	37	how	how	SCONJ
finefocus-615	208	38	the	the	DET
finefocus-615	208	39	physical	physical	ADJ
finefocus-615	208	40	factors	factor	NOUN
finefocus-615	208	41	of	of	ADP
finefocus-615	208	42	cheese	cheese	NOUN
finefocus-615	208	43	environments	environment	NOUN
finefocus-615	208	44	(	(	PUNCT
finefocus-615	208	45	ph	ph	NOUN
finefocus-615	208	46	and	and	CCONJ
finefocus-615	208	47	moisture	moisture	NOUN
finefocus-615	208	48	)	)	PUNCT
finefocus-615	208	49	correlate	correlate	VERB
finefocus-615	208	50	with	with	ADP
finefocus-615	208	51	microbial	microbial	ADJ
finefocus-615	208	52	community	community	NOUN
finefocus-615	208	53	diversity	diversity	NOUN
finefocus-615	208	54	,	,	PUNCT
finefocus-615	208	55	we	we	PRON
finefocus-615	208	56	analyzed	analyze	VERB
finefocus-615	208	57	the	the	DET
finefocus-615	208	58	microbial	microbial	ADJ
finefocus-615	208	59	communities	community	NOUN
finefocus-615	208	60	from	from	ADP
finefocus-615	208	61	seven	seven	NUM
finefocus-615	208	62	different	different	ADJ
finefocus-615	208	63	cheeses	cheese	NOUN
finefocus-615	208	64	.	.	PUNCT
finefocus-615	209	1	the	the	DET
finefocus-615	209	2	seven	seven	NUM
finefocus-615	209	3	natural	natural	ADJ
finefocus-615	209	4	rind	rind	NOUN
finefocus-615	209	5	cheeses	cheese	NOUN
finefocus-615	209	6	varied	varied	ADJ
finefocus-615	209	7	in	in	ADP
finefocus-615	209	8	appearance	appearance	NOUN
finefocus-615	209	9	,	,	PUNCT
finefocus-615	209	10	place	place	NOUN
finefocus-615	209	11	of	of	ADP
finefocus-615	209	12	origin	origin	NOUN
finefocus-615	209	13	,	,	PUNCT
finefocus-615	209	14	and	and	CCONJ
finefocus-615	209	15	type	type	NOUN
finefocus-615	209	16	of	of	ADP
finefocus-615	209	17	milk	milk	NOUN
finefocus-615	209	18	used	use	VERB
finefocus-615	209	19	in	in	ADP
finefocus-615	209	20	the	the	DET
finefocus-615	209	21	cheese	cheese	NOUN
finefocus-615	209	22	-	-	PUNCT
finefocus-615	209	23	making	make	VERB
finefocus-615	209	24	process	process	NOUN
finefocus-615	209	25	.	.	PUNCT
finefocus-615	210	1	four	four	NUM
finefocus-615	210	2	cheeses	cheese	NOUN
finefocus-615	210	3	came	come	VERB
finefocus-615	210	4	from	from	ADP
finefocus-615	210	5	the	the	DET
finefocus-615	210	6	united	united	PROPN
finefocus-615	210	7	states	states	PROPN
finefocus-615	210	8	and	and	CCONJ
finefocus-615	210	9	three	three	NUM
finefocus-615	210	10	came	come	VERB
finefocus-615	210	11	from	from	ADP
finefocus-615	210	12	switzerland	switzerland	PROPN
finefocus-615	210	13	,	,	PUNCT
finefocus-615	210	14	france	france	PROPN
finefocus-615	210	15	,	,	PUNCT
finefocus-615	210	16	and	and	CCONJ
finefocus-615	210	17	england	england	PROPN
finefocus-615	210	18	.	.	PUNCT
finefocus-615	211	1	all	all	PRON
finefocus-615	211	2	of	of	ADP
finefocus-615	211	3	the	the	DET
finefocus-615	211	4	european	european	ADJ
finefocus-615	211	5	cheeses	cheese	NOUN
finefocus-615	211	6	and	and	CCONJ
finefocus-615	211	7	two	two	NUM
finefocus-615	211	8	of	of	ADP
finefocus-615	211	9	the	the	DET
finefocus-615	211	10	u.s	u.s	PROPN
finefocus-615	211	11	.	.	PROPN
finefocus-615	211	12	cheeses	cheese	NOUN
finefocus-615	211	13	were	be	AUX
finefocus-615	211	14	made	make	VERB
finefocus-615	211	15	from	from	ADP
finefocus-615	211	16	cow	cow	NOUN
finefocus-615	211	17	milk	milk	NOUN
finefocus-615	211	18	.	.	PUNCT
finefocus-615	212	1	the	the	DET
finefocus-615	212	2	remaining	remain	VERB
finefocus-615	212	3	two	two	NUM
finefocus-615	212	4	u.s	u.s	PROPN
finefocus-615	212	5	.	.	PROPN
finefocus-615	212	6	cheeses	cheese	NOUN
finefocus-615	212	7	were	be	AUX
finefocus-615	212	8	made	make	VERB
finefocus-615	212	9	from	from	ADP
finefocus-615	212	10	sheep	sheep	NOUN
finefocus-615	212	11	(	(	PUNCT
finefocus-615	212	12	vermont	vermont	NOUN
finefocus-615	212	13	shepherd	shepherd	NOUN
finefocus-615	212	14	)	)	PUNCT
finefocus-615	212	15	and	and	CCONJ
finefocus-615	212	16	goat	goat	PROPN
finefocus-615	212	17	(	(	PUNCT
finefocus-615	212	18	sonnet	sonnet	NOUN
finefocus-615	212	19	)	)	PUNCT
finefocus-615	212	20	milk	milk	NOUN
finefocus-615	212	21	.	.	PUNCT
finefocus-615	213	1	in	in	ADP
finefocus-615	213	2	each	each	DET
finefocus-615	213	3	cheese	cheese	NOUN
finefocus-615	213	4	the	the	DET
finefocus-615	213	5	curd	curd	NOUN
finefocus-615	213	6	was	be	AUX
finefocus-615	213	7	slightly	slightly	ADV
finefocus-615	213	8	more	more	ADV
finefocus-615	213	9	acidic	acidic	ADJ
finefocus-615	213	10	and	and	CCONJ
finefocus-615	213	11	contained	contain	VERB
finefocus-615	213	12	more	more	ADJ
finefocus-615	213	13	moisture	moisture	NOUN
finefocus-615	213	14	than	than	ADP
finefocus-615	213	15	the	the	DET
finefocus-615	213	16	corresponding	correspond	VERB
finefocus-615	213	17	rind	rind	NOUN
finefocus-615	213	18	(	(	PUNCT
finefocus-615	213	19	table	table	NOUN
finefocus-615	213	20	1	1	NUM
finefocus-615	213	21	)	)	PUNCT
finefocus-615	213	22	.	.	PUNCT
finefocus-615	214	1	moisture	moisture	NOUN
finefocus-615	214	2	in	in	ADP
finefocus-615	214	3	the	the	DET
finefocus-615	214	4	curd	curd	NOUN
finefocus-615	214	5	varied	varied	ADJ
finefocus-615	214	6	slightly	slightly	ADV
finefocus-615	214	7	between	between	ADP
finefocus-615	214	8	cheeses	cheese	NOUN
finefocus-615	214	9	,	,	PUNCT
finefocus-615	214	10	from	from	ADP
finefocus-615	214	11	24	24	NUM
finefocus-615	214	12	%	%	NOUN
finefocus-615	214	13	to	to	PART
finefocus-615	214	14	28	28	NUM
finefocus-615	214	15	%	%	NOUN
finefocus-615	214	16	,	,	PUNCT
finefocus-615	214	17	while	while	SCONJ
finefocus-615	214	18	moisture	moisture	NOUN
finefocus-615	214	19	in	in	ADP
finefocus-615	214	20	the	the	DET
finefocus-615	214	21	rind	rind	NOUN
finefocus-615	214	22	had	have	VERB
finefocus-615	214	23	a	a	DET
finefocus-615	214	24	larger	large	ADJ
finefocus-615	214	25	range	range	NOUN
finefocus-615	214	26	between	between	ADP
finefocus-615	214	27	cheeses	cheese	NOUN
finefocus-615	214	28	,	,	PUNCT
finefocus-615	214	29	from	from	ADP
finefocus-615	214	30	4	4	NUM
finefocus-615	214	31	%	%	NOUN
finefocus-615	214	32	to	to	PART
finefocus-615	214	33	27	27	NUM
finefocus-615	214	34	%	%	NOUN
finefocus-615	214	35	(	(	PUNCT
finefocus-615	214	36	table	table	NOUN
finefocus-615	214	37	1	1	NUM
finefocus-615	214	38	)	)	PUNCT
finefocus-615	214	39	.	.	PUNCT
finefocus-615	215	1	to	to	PART
finefocus-615	215	2	determine	determine	VERB
finefocus-615	215	3	the	the	DET
finefocus-615	215	4	types	type	NOUN
finefocus-615	215	5	of	of	ADP
finefocus-615	215	6	bacteria	bacteria	NOUN
finefocus-615	215	7	that	that	PRON
finefocus-615	215	8	were	be	AUX
finefocus-615	215	9	present	present	ADJ
finefocus-615	215	10	in	in	ADP
finefocus-615	215	11	the	the	DET
finefocus-615	215	12	cheese	cheese	NOUN
finefocus-615	215	13	communities	community	NOUN
finefocus-615	215	14	,	,	PUNCT
finefocus-615	215	15	we	we	PRON
finefocus-615	215	16	analyzed	analyze	VERB
finefocus-615	215	17	the	the	DET
finefocus-615	215	18	16s	16s	PROPN
finefocus-615	215	19	rrna	rrna	PROPN
finefocus-615	215	20	gene	gene	NOUN
finefocus-615	215	21	using	use	VERB
finefocus-615	215	22	illumina	illumina	NOUN
finefocus-615	215	23	sequencing	sequencing	NOUN
finefocus-615	215	24	of	of	ADP
finefocus-615	215	25	the	the	DET
finefocus-615	215	26	total	total	NOUN
finefocus-615	215	27	extracted	extract	VERB
finefocus-615	215	28	dna	dna	NOUN
finefocus-615	215	29	from	from	ADP
finefocus-615	215	30	cheese	cheese	NOUN
finefocus-615	215	31	curd	curd	NOUN
finefocus-615	215	32	and	and	CCONJ
finefocus-615	215	33	rind	rind	NOUN
finefocus-615	215	34	,	,	PUNCT
finefocus-615	215	35	and	and	CCONJ
finefocus-615	215	36	sanger	sanger	PROPN
finefocus-615	215	37	sequencing	sequencing	NOUN
finefocus-615	215	38	of	of	ADP
finefocus-615	215	39	cultured	cultured	ADJ
finefocus-615	215	40	cheese	cheese	NOUN
finefocus-615	215	41	isolates	isolate	NOUN
finefocus-615	215	42	.	.	PUNCT
finefocus-615	216	1	there	there	PRON
finefocus-615	216	2	were	be	VERB
finefocus-615	216	3	more	more	ADJ
finefocus-615	216	4	organisms	organism	NOUN
finefocus-615	216	5	identified	identify	VERB
finefocus-615	216	6	to	to	ADP
finefocus-615	216	7	the	the	DET
finefocus-615	216	8	genus	genus	ADJ
finefocus-615	216	9	level	level	NOUN
finefocus-615	216	10	in	in	ADP
finefocus-615	216	11	the	the	DET
finefocus-615	216	12	cultureindependent	cultureindependent	ADJ
finefocus-615	216	13	approach	approach	NOUN
finefocus-615	216	14	than	than	ADP
finefocus-615	216	15	culture	culture	NOUN
finefocus-615	216	16	-	-	PUNCT
finefocus-615	216	17	dependent	dependent	ADJ
finefocus-615	216	18	approach	approach	NOUN
finefocus-615	216	19	(	(	PUNCT
finefocus-615	216	20	see	see	VERB
finefocus-615	216	21	“	"	PUNCT
finefocus-615	216	22	other	other	ADJ
finefocus-615	216	23	”	"	PUNCT
finefocus-615	216	24	category	category	NOUN
finefocus-615	216	25	,	,	PUNCT
finefocus-615	216	26	figure	figure	NOUN
finefocus-615	216	27	1	1	NUM
finefocus-615	216	28	)	)	PUNCT
finefocus-615	216	29	.	.	PUNCT
finefocus-615	217	1	unculturable	unculturable	ADJ
finefocus-615	217	2	organisms	organism	NOUN
finefocus-615	217	3	that	that	PRON
finefocus-615	217	4	were	be	AUX
finefocus-615	217	5	common	common	ADJ
finefocus-615	217	6	to	to	ADP
finefocus-615	217	7	the	the	DET
finefocus-615	217	8	cheese	cheese	NOUN
finefocus-615	217	9	rinds	rind	NOUN
finefocus-615	217	10	included	include	VERB
finefocus-615	217	11	streptococcus	streptococcus	NOUN
finefocus-615	217	12	spp	spp	NOUN
finefocus-615	217	13	.	.	PUNCT
finefocus-615	218	1	(	(	PUNCT
finefocus-615	218	2	comprising	comprise	VERB
finefocus-615	218	3	24	24	NUM
finefocus-615	218	4	%	%	NOUN
finefocus-615	218	5	of	of	ADP
finefocus-615	218	6	total	total	ADJ
finefocus-615	218	7	bacterial	bacterial	ADJ
finefocus-615	218	8	cells	cell	NOUN
finefocus-615	218	9	in	in	ADP
finefocus-615	218	10	the	the	DET
finefocus-615	218	11	comte	comte	NOUN
finefocus-615	218	12	rind	rind	NOUN
finefocus-615	218	13	and	and	CCONJ
finefocus-615	218	14	55	55	NUM
finefocus-615	218	15	%	%	NOUN
finefocus-615	218	16	of	of	ADP
finefocus-615	218	17	the	the	DET
finefocus-615	218	18	maggie	maggie	NOUN
finefocus-615	218	19	’s	’s	PART
finefocus-615	218	20	round	round	PROPN
finefocus-615	218	21	rind	rind	NOUN
finefocus-615	218	22	)	)	PUNCT
finefocus-615	218	23	,	,	PUNCT
finefocus-615	218	24	lactococcus	lactococcus	PROPN
finefocus-615	218	25	spp	spp	PROPN
finefocus-615	218	26	.	.	PUNCT
finefocus-615	219	1	(	(	PUNCT
finefocus-615	219	2	39	39	NUM
finefocus-615	219	3	%	%	NOUN
finefocus-615	219	4	of	of	ADP
finefocus-615	219	5	all	all	DET
finefocus-615	219	6	cells	cell	NOUN
finefocus-615	219	7	in	in	ADP
finefocus-615	219	8	missouri	missouri	PROPN
finefocus-615	219	9	truckle	truckle	PROPN
finefocus-615	219	10	rind	rind	PROPN
finefocus-615	219	11	)	)	PUNCT
finefocus-615	219	12	,	,	PUNCT
finefocus-615	219	13	yaniella	yaniella	PROPN
finefocus-615	219	14	spp	spp	PROPN
finefocus-615	219	15	.	.	PUNCT
finefocus-615	220	1	(	(	PUNCT
finefocus-615	220	2	20	20	NUM
finefocus-615	220	3	%	%	NOUN
finefocus-615	220	4	of	of	ADP
finefocus-615	220	5	stichelton	stichelton	PROPN
finefocus-615	220	6	rind	rind	NOUN
finefocus-615	220	7	)	)	PUNCT
finefocus-615	220	8	,	,	PUNCT
finefocus-615	220	9	prauseria	prauseria	PROPN
finefocus-615	220	10	spp	spp	PROPN
finefocus-615	220	11	.	.	PUNCT
finefocus-615	221	1	(	(	PUNCT
finefocus-615	221	2	18	18	NUM
finefocus-615	221	3	%	%	NOUN
finefocus-615	221	4	of	of	ADP
finefocus-615	221	5	vermont	vermont	PROPN
finefocus-615	221	6	shepherd	shepherd	PROPN
finefocus-615	221	7	rind	rind	NOUN
finefocus-615	221	8	)	)	PUNCT
finefocus-615	221	9	,	,	PUNCT
finefocus-615	221	10	halomonas	halomonas	PROPN
finefocus-615	221	11	spp	spp	PROPN
finefocus-615	221	12	.	.	PUNCT
finefocus-615	222	1	(	(	PUNCT
finefocus-615	222	2	17	17	NUM
finefocus-615	222	3	%	%	NOUN
finefocus-615	222	4	of	of	ADP
finefocus-615	222	5	stichelton	stichelton	NOUN
finefocus-615	222	6	rind	rind	NOUN
finefocus-615	222	7	and	and	CCONJ
finefocus-615	222	8	7	7	NUM
finefocus-615	222	9	%	%	NOUN
finefocus-615	222	10	of	of	ADP
finefocus-615	222	11	alpage	alpage	NOUN
finefocus-615	222	12	gruyere	gruyere	NOUN
finefocus-615	222	13	rind	rind	NOUN
finefocus-615	222	14	)	)	PUNCT
finefocus-615	222	15	and	and	CCONJ
finefocus-615	222	16	lactobacillus	lactobacillus	PROPN
finefocus-615	222	17	spp	spp	NOUN
finefocus-615	222	18	.	.	PUNCT
finefocus-615	223	1	(	(	PUNCT
finefocus-615	223	2	16	16	NUM
finefocus-615	223	3	%	%	NOUN
finefocus-615	223	4	of	of	ADP
finefocus-615	223	5	missouri	missouri	PROPN
finefocus-615	223	6	truckle	truckle	PROPN
finefocus-615	223	7	rind	rind	NOUN
finefocus-615	223	8	and	and	CCONJ
finefocus-615	223	9	13	13	NUM
finefocus-615	223	10	%	%	NOUN
finefocus-615	223	11	of	of	ADP
finefocus-615	223	12	comte	comte	NOUN
finefocus-615	223	13	rind	rind	NOUN
finefocus-615	223	14	)	)	PUNCT
finefocus-615	223	15	.	.	PUNCT
finefocus-615	224	1	in	in	ADP
finefocus-615	224	2	the	the	DET
finefocus-615	224	3	curds	curd	NOUN
finefocus-615	224	4	,	,	PUNCT
finefocus-615	224	5	prevalent	prevalent	ADJ
finefocus-615	224	6	uncultured	uncultured	ADJ
finefocus-615	224	7	taxa	taxa	NOUN
finefocus-615	224	8	included	include	VERB
finefocus-615	224	9	lactococcus	lactococcus	PROPN
finefocus-615	224	10	spp	spp	PROPN
finefocus-615	224	11	.	.	PUNCT
finefocus-615	225	1	(	(	PUNCT
finefocus-615	225	2	91	91	NUM
finefocus-615	225	3	%	%	NOUN
finefocus-615	225	4	of	of	ADP
finefocus-615	225	5	missouri	missouri	PROPN
finefocus-615	225	6	truckle	truckle	PROPN
finefocus-615	225	7	rind	rind	NOUN
finefocus-615	225	8	and	and	CCONJ
finefocus-615	225	9	89	89	NUM
finefocus-615	225	10	%	%	NOUN
finefocus-615	225	11	of	of	ADP
finefocus-615	225	12	stichelton	stichelton	PROPN
finefocus-615	225	13	rind	rind	NOUN
finefocus-615	225	14	)	)	PUNCT
finefocus-615	225	15	,	,	PUNCT
finefocus-615	225	16	streptococcus	streptococcus	VERB
finefocus-615	225	17	spp	spp	NOUN
finefocus-615	225	18	.	.	PUNCT
finefocus-615	226	1	(	(	PUNCT
finefocus-615	226	2	78	78	NUM
finefocus-615	226	3	%	%	NOUN
finefocus-615	226	4	of	of	ADP
finefocus-615	226	5	maggie	maggie	PROPN
finefocus-615	226	6	’s	’s	PART
finefocus-615	226	7	round	round	PROPN
finefocus-615	226	8	rind	rind	NOUN
finefocus-615	226	9	,	,	PUNCT
finefocus-615	226	10	73	73	NUM
finefocus-615	226	11	%	%	NOUN
finefocus-615	226	12	of	of	ADP
finefocus-615	226	13	comte	comte	NOUN
finefocus-615	226	14	rind	rind	NOUN
finefocus-615	226	15	,	,	PUNCT
finefocus-615	226	16	and	and	CCONJ
finefocus-615	226	17	26	26	NUM
finefocus-615	226	18	%	%	NOUN
finefocus-615	226	19	of	of	ADP
finefocus-615	226	20	alpage	alpage	NOUN
finefocus-615	226	21	gruyere	gruyere	NOUN
finefocus-615	226	22	rind	rind	NOUN
finefocus-615	226	23	)	)	PUNCT
finefocus-615	226	24	,	,	PUNCT
finefocus-615	226	25	and	and	CCONJ
finefocus-615	226	26	lactobacillus	lactobacillus	PROPN
finefocus-615	226	27	spp	spp	NOUN
finefocus-615	226	28	.	.	PUNCT
finefocus-615	227	1	(	(	PUNCT
finefocus-615	227	2	71	71	NUM
finefocus-615	227	3	%	%	NOUN
finefocus-615	227	4	of	of	ADP
finefocus-615	227	5	alpage	alpage	NOUN
finefocus-615	227	6	gruyere	gruyere	NOUN
finefocus-615	227	7	rind	rind	NOUN
finefocus-615	227	8	,	,	PUNCT
finefocus-615	227	9	35	35	NUM
finefocus-615	227	10	%	%	NOUN
finefocus-615	227	11	of	of	ADP
finefocus-615	227	12	comte	comte	NOUN
finefocus-615	227	13	rind	rind	NOUN
finefocus-615	227	14	)	)	PUNCT
finefocus-615	227	15	.	.	PUNCT
finefocus-615	228	1	in	in	ADP
finefocus-615	228	2	the	the	DET
finefocus-615	228	3	curd	curd	NOUN
finefocus-615	228	4	,	,	PUNCT
finefocus-615	228	5	43	43	NUM
finefocus-615	228	6	%	%	NOUN
finefocus-615	228	7	(	(	PUNCT
finefocus-615	228	8	figure	figure	NOUN
finefocus-615	228	9	1b	1b	NUM
finefocus-615	228	10	)	)	PUNCT
finefocus-615	228	11	,	,	PUNCT
finefocus-615	228	12	and	and	CCONJ
finefocus-615	228	13	in	in	ADP
finefocus-615	228	14	the	the	DET
finefocus-615	228	15	rind	rind	NOUN
finefocus-615	228	16	,	,	PUNCT
finefocus-615	228	17	65	65	NUM
finefocus-615	228	18	%	%	NOUN
finefocus-615	228	19	(	(	PUNCT
finefocus-615	228	20	figure	figure	NOUN
finefocus-615	228	21	1c	1c	NOUN
finefocus-615	228	22	)	)	PUNCT
finefocus-615	228	23	of	of	ADP
finefocus-615	228	24	bacteria	bacteria	NOUN
finefocus-615	228	25	were	be	AUX
finefocus-615	228	26	not	not	PART
finefocus-615	228	27	culturable	culturable	ADJ
finefocus-615	228	28	on	on	ADP
finefocus-615	228	29	pcam	pcam	NOUN
finefocus-615	228	30	agar	agar	NOUN
finefocus-615	228	31	.	.	PUNCT
finefocus-615	229	1	thus	thus	ADV
finefocus-615	229	2	,	,	PUNCT
finefocus-615	229	3	a	a	DET
finefocus-615	229	4	significant	significant	ADJ
finefocus-615	229	5	fraction	fraction	NOUN
finefocus-615	229	6	of	of	ADP
finefocus-615	229	7	bacterial	bacterial	ADJ
finefocus-615	229	8	species	specie	NOUN
finefocus-615	229	9	was	be	AUX
finefocus-615	229	10	not	not	PART
finefocus-615	229	11	recovered	recover	VERB
finefocus-615	229	12	on	on	ADP
finefocus-615	229	13	pcam	pcam	NOUN
finefocus-615	229	14	plates	plate	NOUN
finefocus-615	229	15	.	.	PUNCT
finefocus-615	230	1	the	the	DET
finefocus-615	230	2	rind	rind	NOUN
finefocus-615	230	3	harbors	harbor	VERB
finefocus-615	230	4	a	a	DET
finefocus-615	230	5	more	more	ADV
finefocus-615	230	6	complex	complex	ADJ
finefocus-615	230	7	bacterial	bacterial	ADJ
finefocus-615	230	8	community	community	NOUN
finefocus-615	230	9	than	than	ADP
finefocus-615	230	10	the	the	DET
finefocus-615	230	11	curd	curd	NOUN
finefocus-615	230	12	in	in	ADP
finefocus-615	230	13	order	order	NOUN
finefocus-615	230	14	to	to	PART
finefocus-615	230	15	determine	determine	VERB
finefocus-615	230	16	the	the	DET
finefocus-615	230	17	bacterial	bacterial	ADJ
finefocus-615	230	18	diversity	diversity	NOUN
finefocus-615	230	19	of	of	ADP
finefocus-615	230	20	the	the	DET
finefocus-615	230	21	rind	rind	NOUN
finefocus-615	230	22	and	and	CCONJ
finefocus-615	230	23	curd	curd	NOUN
finefocus-615	230	24	,	,	PUNCT
finefocus-615	230	25	we	we	PRON
finefocus-615	230	26	carried	carry	VERB
finefocus-615	230	27	out	out	ADP
finefocus-615	230	28	illumina	illumina	NOUN
finefocus-615	230	29	sequencing	sequencing	NOUN
finefocus-615	230	30	of	of	ADP
finefocus-615	230	31	the	the	DET
finefocus-615	230	32	16s	16s	PROPN
finefocus-615	230	33	rrna	rrna	PROPN
finefocus-615	230	34	gene	gene	NOUN
finefocus-615	230	35	.	.	PUNCT
finefocus-615	231	1	rarefaction	rarefaction	NOUN
finefocus-615	231	2	curve	curve	NOUN
finefocus-615	231	3	analysis	analysis	NOUN
finefocus-615	231	4	,	,	PUNCT
finefocus-615	231	5	which	which	PRON
finefocus-615	231	6	assesses	assess	VERB
finefocus-615	231	7	species	specie	NOUN
finefocus-615	231	8	richness	richness	NOUN
finefocus-615	231	9	from	from	ADP
finefocus-615	231	10	samples	sample	NOUN
finefocus-615	231	11	,	,	PUNCT
finefocus-615	231	12	showed	show	VERB
finefocus-615	231	13	all	all	DET
finefocus-615	231	14	samples	sample	NOUN
finefocus-615	231	15	approached	approach	VERB
finefocus-615	231	16	the	the	DET
finefocus-615	231	17	asymptote	asymptote	NOUN
finefocus-615	231	18	and	and	CCONJ
finefocus-615	231	19	revealed	reveal	VERB
finefocus-615	231	20	that	that	SCONJ
finefocus-615	231	21	the	the	DET
finefocus-615	231	22	overall	overall	ADJ
finefocus-615	231	23	bacterial	bacterial	ADJ
finefocus-615	231	24	diversity	diversity	NOUN
finefocus-615	231	25	was	be	AUX
finefocus-615	231	26	well	well	ADV
finefocus-615	231	27	represented	represent	VERB
finefocus-615	231	28	(	(	PUNCT
finefocus-615	231	29	figure	figure	NOUN
finefocus-615	231	30	2	2	NUM
finefocus-615	231	31	)	)	PUNCT
finefocus-615	231	32	.	.	PUNCT
finefocus-615	232	1	the	the	DET
finefocus-615	232	2	curds	curd	NOUN
finefocus-615	232	3	of	of	ADP
finefocus-615	232	4	alpage	alpage	VERB
finefocus-615	232	5	gruyere	gruyere	NOUN
finefocus-615	232	6	and	and	CCONJ
finefocus-615	232	7	comte	comte	NOUN
finefocus-615	232	8	had	have	VERB
finefocus-615	232	9	the	the	DET
finefocus-615	232	10	fewest	few	ADJ
finefocus-615	232	11	unique	unique	ADJ
finefocus-615	232	12	otus	otus	NOUN
finefocus-615	232	13	(	(	PUNCT
finefocus-615	232	14	figure	figure	NOUN
finefocus-615	232	15	2a	2a	NUM
finefocus-615	232	16	)	)	PUNCT
finefocus-615	232	17	while	while	SCONJ
finefocus-615	232	18	the	the	DET
finefocus-615	232	19	largest	large	ADJ
finefocus-615	232	20	number	number	NOUN
finefocus-615	232	21	of	of	ADP
finefocus-615	232	22	unique	unique	ADJ
finefocus-615	232	23	otus	otus	NOUN
finefocus-615	232	24	was	be	AUX
finefocus-615	232	25	found	find	VERB
finefocus-615	232	26	in	in	ADP
finefocus-615	232	27	the	the	DET
finefocus-615	232	28	rind	rind	NOUN
finefocus-615	232	29	of	of	ADP
finefocus-615	232	30	alpage	alpage	NOUN
finefocus-615	232	31	gruyere	gruyere	NOUN
finefocus-615	232	32	cheese	cheese	NOUN
finefocus-615	232	33	,	,	PUNCT
finefocus-615	232	34	followed	follow	VERB
finefocus-615	232	35	by	by	ADP
finefocus-615	232	36	the	the	DET
finefocus-615	232	37	rinds	rind	NOUN
finefocus-615	232	38	of	of	ADP
finefocus-615	232	39	stichelton	stichelton	NOUN
finefocus-615	232	40	and	and	CCONJ
finefocus-615	232	41	comte	comte	NOUN
finefocus-615	232	42	cheeses	cheese	NOUN
finefocus-615	232	43	(	(	PUNCT
finefocus-615	232	44	figure	figure	NOUN
finefocus-615	232	45	2b	2b	NOUN
finefocus-615	232	46	)	)	PUNCT
finefocus-615	232	47	.	.	PUNCT
finefocus-615	233	1	the	the	DET
finefocus-615	233	2	shannon	shannon	PROPN
finefocus-615	233	3	diversity	diversity	PROPN
finefocus-615	233	4	index	index	NOUN
finefocus-615	233	5	,	,	PUNCT
finefocus-615	233	6	a	a	DET
finefocus-615	233	7	measurement	measurement	NOUN
finefocus-615	233	8	of	of	ADP
finefocus-615	233	9	overall	overall	ADJ
finefocus-615	233	10	diversity	diversity	NOUN
finefocus-615	233	11	,	,	PUNCT
finefocus-615	233	12	of	of	ADP
finefocus-615	233	13	pooled	pool	VERB
finefocus-615	233	14	data	datum	NOUN
finefocus-615	233	15	from	from	ADP
finefocus-615	233	16	the	the	DET
finefocus-615	233	17	rinds	rind	NOUN
finefocus-615	233	18	and	and	CCONJ
finefocus-615	233	19	curds	curd	NOUN
finefocus-615	233	20	of	of	ADP
finefocus-615	233	21	the	the	DET
finefocus-615	233	22	seven	seven	NUM
finefocus-615	233	23	cheeses	cheese	NOUN
finefocus-615	233	24	indicated	indicate	VERB
finefocus-615	233	25	more	more	ADJ
finefocus-615	233	26	species	specie	NOUN
finefocus-615	233	27	richness	richness	NOUN
finefocus-615	233	28	and	and	CCONJ
finefocus-615	233	29	evenness	evenness	NOUN
finefocus-615	233	30	in	in	ADP
finefocus-615	233	31	the	the	DET
finefocus-615	233	32	rind	rind	NOUN
finefocus-615	233	33	communities	community	NOUN
finefocus-615	233	34	than	than	ADP
finefocus-615	233	35	the	the	DET
finefocus-615	233	36	curd	curd	NOUN
finefocus-615	233	37	(	(	PUNCT
finefocus-615	233	38	figure	figure	NOUN
finefocus-615	233	39	2c	2c	NUM
finefocus-615	233	40	)	)	PUNCT
finefocus-615	233	41	.	.	PUNCT
finefocus-615	234	1	together	together	ADV
finefocus-615	234	2	,	,	PUNCT
finefocus-615	234	3	otu	otu	PROPN
finefocus-615	234	4	distribution	distribution	NOUN
finefocus-615	234	5	and	and	CCONJ
finefocus-615	234	6	richness	richness	NOUN
finefocus-615	234	7	data	datum	NOUN
finefocus-615	234	8	demonstrate	demonstrate	VERB
finefocus-615	234	9	higher	high	ADJ
finefocus-615	234	10	alpha	alpha	NOUN
finefocus-615	234	11	diversity	diversity	NOUN
finefocus-615	234	12	in	in	ADP
finefocus-615	234	13	rind	rind	NOUN
finefocus-615	234	14	communities	community	NOUN
finefocus-615	234	15	.	.	PUNCT
finefocus-615	235	1	results	result	NOUN
finefocus-615	235	2	through	through	ADP
finefocus-615	235	3	the	the	DET
finefocus-615	235	4	identification	identification	NOUN
finefocus-615	235	5	of	of	ADP
finefocus-615	235	6	the	the	DET
finefocus-615	235	7	organisms	organism	NOUN
finefocus-615	235	8	present	present	ADJ
finefocus-615	235	9	in	in	ADP
finefocus-615	235	10	the	the	DET
finefocus-615	235	11	cheese	cheese	NOUN
finefocus-615	235	12	samples	sample	NOUN
finefocus-615	235	13	,	,	PUNCT
finefocus-615	235	14	we	we	PRON
finefocus-615	235	15	found	find	VERB
finefocus-615	235	16	that	that	SCONJ
finefocus-615	235	17	,	,	PUNCT
finefocus-615	235	18	with	with	ADP
finefocus-615	235	19	the	the	DET
finefocus-615	235	20	exception	exception	NOUN
finefocus-615	235	21	of	of	ADP
finefocus-615	235	22	the	the	DET
finefocus-615	235	23	sonnet	sonnet	NOUN
finefocus-615	235	24	cheese	cheese	NOUN
finefocus-615	235	25	,	,	PUNCT
finefocus-615	235	26	the	the	DET
finefocus-615	235	27	only	only	ADJ
finefocus-615	235	28	phylum	phylum	NOUN
finefocus-615	235	29	represented	represent	VERB
finefocus-615	235	30	in	in	ADP
finefocus-615	235	31	the	the	DET
finefocus-615	235	32	curd	curd	NOUN
finefocus-615	235	33	communities	community	NOUN
finefocus-615	235	34	was	be	AUX
finefocus-615	235	35	firmicutes	firmicute	NOUN
finefocus-615	235	36	(	(	PUNCT
finefocus-615	235	37	figure	figure	NOUN
finefocus-615	235	38	3	3	NUM
finefocus-615	235	39	)	)	PUNCT
finefocus-615	235	40	.	.	PUNCT
finefocus-615	236	1	in	in	ADP
finefocus-615	236	2	contrast	contrast	NOUN
finefocus-615	236	3	,	,	PUNCT
finefocus-615	236	4	firmicutes	firmicute	NOUN
finefocus-615	236	5	,	,	PUNCT
finefocus-615	236	6	actinobacteria	actinobacteria	NOUN
finefocus-615	236	7	,	,	PUNCT
finefocus-615	236	8	and	and	CCONJ
finefocus-615	236	9	proteobacteria	proteobacteria	NOUN
finefocus-615	236	10	were	be	AUX
finefocus-615	236	11	found	find	VERB
finefocus-615	236	12	in	in	ADP
finefocus-615	236	13	the	the	DET
finefocus-615	236	14	rind	rind	NOUN
finefocus-615	236	15	communities	community	NOUN
finefocus-615	236	16	.	.	PUNCT
finefocus-615	237	1	in	in	ADP
finefocus-615	237	2	a	a	DET
finefocus-615	237	3	similar	similar	ADJ
finefocus-615	237	4	trend	trend	NOUN
finefocus-615	237	5	,	,	PUNCT
finefocus-615	237	6	no	no	DET
finefocus-615	237	7	more	more	ADJ
finefocus-615	237	8	than	than	ADP
finefocus-615	237	9	ten	ten	NUM
finefocus-615	237	10	taxonomic	taxonomic	ADJ
finefocus-615	237	11	units	unit	NOUN
finefocus-615	237	12	were	be	AUX
finefocus-615	237	13	found	find	VERB
finefocus-615	237	14	in	in	ADP
finefocus-615	237	15	each	each	PRON
finefocus-615	237	16	of	of	ADP
finefocus-615	237	17	the	the	DET
finefocus-615	237	18	curd	curd	NOUN
finefocus-615	237	19	communities	community	NOUN
finefocus-615	237	20	,	,	PUNCT
finefocus-615	237	21	while	while	SCONJ
finefocus-615	237	22	no	no	DET
finefocus-615	237	23	less	less	ADJ
finefocus-615	237	24	than	than	ADP
finefocus-615	237	25	ten	ten	NUM
finefocus-615	237	26	genera	genera	NOUN
finefocus-615	237	27	were	be	AUX
finefocus-615	237	28	identified	identify	VERB
finefocus-615	237	29	in	in	ADP
finefocus-615	237	30	each	each	PRON
finefocus-615	237	31	of	of	ADP
finefocus-615	237	32	the	the	DET
finefocus-615	237	33	rind	rind	NOUN
finefocus-615	237	34	communities	community	NOUN
finefocus-615	237	35	(	(	PUNCT
finefocus-615	237	36	figure	figure	NOUN
finefocus-615	237	37	3	3	NUM
finefocus-615	237	38	)	)	PUNCT
finefocus-615	237	39	.	.	PUNCT
finefocus-615	238	1	in	in	ADP
finefocus-615	238	2	general	general	ADJ
finefocus-615	238	3	,	,	PUNCT
finefocus-615	238	4	dominant	dominant	ADJ
finefocus-615	238	5	genera	genera	NOUN
finefocus-615	238	6	in	in	ADP
finefocus-615	238	7	the	the	DET
finefocus-615	238	8	rinds	rind	NOUN
finefocus-615	238	9	and	and	CCONJ
finefocus-615	238	10	curds	curd	NOUN
finefocus-615	238	11	were	be	AUX
finefocus-615	238	12	widespread	widespread	ADJ
finefocus-615	238	13	among	among	ADP
finefocus-615	238	14	sampled	sample	VERB
finefocus-615	238	15	cheeses	cheese	NOUN
finefocus-615	238	16	.	.	PUNCT
finefocus-615	239	1	cheese	cheese	NOUN
finefocus-615	239	2	curds	curd	NOUN
finefocus-615	239	3	were	be	AUX
finefocus-615	239	4	dominated	dominate	VERB
finefocus-615	239	5	by	by	ADP
finefocus-615	239	6	lactic	lactic	ADJ
finefocus-615	239	7	acid	acid	NOUN
finefocus-615	239	8	fermenters	fermenter	NOUN
finefocus-615	239	9	including	include	VERB
finefocus-615	239	10	lactobacillus	lactobacillus	NOUN
finefocus-615	239	11	,	,	PUNCT
finefocus-615	239	12	streptococcus	streptococcus	NOUN
finefocus-615	239	13	,	,	PUNCT
finefocus-615	239	14	and	and	CCONJ
finefocus-615	239	15	lactococcus	lactococcus	NOUN
finefocus-615	239	16	while	while	SCONJ
finefocus-615	239	17	the	the	DET
finefocus-615	239	18	rind	rind	NOUN
finefocus-615	239	19	communities	community	NOUN
finefocus-615	239	20	showed	show	VERB
finefocus-615	239	21	a	a	DET
finefocus-615	239	22	greater	great	ADJ
finefocus-615	239	23	relative	relative	ADJ
finefocus-615	239	24	abundance	abundance	NOUN
finefocus-615	239	25	of	of	ADP
finefocus-615	239	26	brevibacterium	brevibacterium	NOUN
finefocus-615	239	27	and	and	CCONJ
finefocus-615	239	28	actinomycetaceae	actinomycetaceae	PROPN
finefocus-615	239	29	(	(	PUNCT
finefocus-615	239	30	figure	figure	NOUN
finefocus-615	239	31	3	3	NUM
finefocus-615	239	32	;	;	PUNCT
finefocus-615	239	33	rind	rind	NOUN
finefocus-615	239	34	)	)	PUNCT
finefocus-615	239	35	.	.	PUNCT
finefocus-615	240	1	however	however	ADV
finefocus-615	240	2	,	,	PUNCT
finefocus-615	240	3	variation	variation	NOUN
finefocus-615	240	4	was	be	AUX
finefocus-615	240	5	present	present	ADJ
finefocus-615	240	6	within	within	ADP
finefocus-615	240	7	both	both	CCONJ
finefocus-615	240	8	the	the	DET
finefocus-615	240	9	rind	rind	NOUN
finefocus-615	240	10	and	and	CCONJ
finefocus-615	240	11	curd	curd	NOUN
finefocus-615	240	12	communities	community	NOUN
finefocus-615	240	13	.	.	PUNCT
finefocus-615	241	1	for	for	ADP
finefocus-615	241	2	example	example	NOUN
finefocus-615	241	3	,	,	PUNCT
finefocus-615	241	4	while	while	SCONJ
finefocus-615	241	5	the	the	DET
finefocus-615	241	6	missouri	missouri	PROPN
finefocus-615	241	7	truckle	truckle	NOUN
finefocus-615	241	8	,	,	PUNCT
finefocus-615	241	9	sonnet	sonnet	NOUN
finefocus-615	241	10	,	,	PUNCT
finefocus-615	241	11	and	and	CCONJ
finefocus-615	241	12	stichelton	stichelton	PROPN
finefocus-615	241	13	curds	curd	NOUN
finefocus-615	241	14	were	be	AUX
finefocus-615	241	15	almost	almost	ADV
finefocus-615	241	16	completely	completely	ADV
finefocus-615	241	17	dominated	dominate	VERB
finefocus-615	241	18	by	by	ADP
finefocus-615	241	19	lactococcus	lactococcus	PROPN
finefocus-615	241	20	,	,	PUNCT
finefocus-615	241	21	this	this	DET
finefocus-615	241	22	organism	organism	NOUN
finefocus-615	241	23	made	make	VERB
finefocus-615	241	24	up	up	ADP
finefocus-615	241	25	less	less	ADJ
finefocus-615	241	26	than	than	ADP
finefocus-615	241	27	2	2	NUM
finefocus-615	241	28	%	%	NOUN
finefocus-615	241	29	of	of	ADP
finefocus-615	241	30	the	the	DET
finefocus-615	241	31	maggie	maggie	NOUN
finefocus-615	241	32	’s	’s	PART
finefocus-615	241	33	round	round	ADJ
finefocus-615	241	34	,	,	PUNCT
finefocus-615	241	35	comte	comte	NOUN
finefocus-615	241	36	,	,	PUNCT
finefocus-615	241	37	and	and	CCONJ
finefocus-615	241	38	alpage	alpage	VERB
finefocus-615	241	39	gruyere	gruyere	NOUN
finefocus-615	241	40	cheeses	cheese	NOUN
finefocus-615	241	41	(	(	PUNCT
finefocus-615	241	42	figure	figure	NOUN
finefocus-615	241	43	3	3	NUM
finefocus-615	241	44	;	;	PUNCT
finefocus-615	241	45	curd	curd	NOUN
finefocus-615	241	46	,	,	PUNCT
finefocus-615	241	47	purple	purple	ADJ
finefocus-615	241	48	)	)	PUNCT
finefocus-615	241	49	.	.	PUNCT
finefocus-615	242	1	we	we	PRON
finefocus-615	242	2	next	next	ADV
finefocus-615	242	3	sought	seek	VERB
finefocus-615	242	4	to	to	PART
finefocus-615	242	5	investigate	investigate	VERB
finefocus-615	242	6	whether	whether	SCONJ
finefocus-615	242	7	the	the	DET
finefocus-615	242	8	differences	difference	NOUN
finefocus-615	242	9	in	in	ADP
finefocus-615	242	10	community	community	NOUN
finefocus-615	242	11	composition	composition	NOUN
finefocus-615	242	12	could	could	AUX
finefocus-615	242	13	be	be	AUX
finefocus-615	242	14	associated	associate	VERB
finefocus-615	242	15	with	with	ADP
finefocus-615	242	16	other	other	ADJ
finefocus-615	242	17	abiotic	abiotic	ADJ
finefocus-615	242	18	factors	factor	NOUN
finefocus-615	242	19	such	such	ADJ
finefocus-615	242	20	as	as	ADP
finefocus-615	242	21	moisture	moisture	NOUN
finefocus-615	242	22	content	content	NOUN
finefocus-615	242	23	,	,	PUNCT
finefocus-615	242	24	ph	ph	VERB
finefocus-615	242	25	,	,	PUNCT
finefocus-615	242	26	or	or	CCONJ
finefocus-615	242	27	milk	milk	NOUN
finefocus-615	242	28	type	type	NOUN
finefocus-615	242	29	.	.	PUNCT
finefocus-615	243	1	principal	principal	ADJ
finefocus-615	243	2	coordinates	coordinate	NOUN
finefocus-615	243	3	of	of	ADP
finefocus-615	243	4	analysis	analysis	NOUN
finefocus-615	243	5	(	(	PUNCT
finefocus-615	243	6	pcoa	pcoa	NOUN
finefocus-615	243	7	)	)	PUNCT
finefocus-615	243	8	demonstrated	demonstrate	VERB
finefocus-615	243	9	that	that	SCONJ
finefocus-615	243	10	communities	community	NOUN
finefocus-615	243	11	were	be	AUX
finefocus-615	243	12	found	find	VERB
finefocus-615	243	13	to	to	PART
finefocus-615	243	14	cluster	cluster	VERB
finefocus-615	243	15	by	by	ADP
finefocus-615	243	16	rind	rind	NOUN
finefocus-615	243	17	or	or	CCONJ
finefocus-615	243	18	curd	curd	NOUN
finefocus-615	243	19	(	(	PUNCT
finefocus-615	243	20	figure	figure	NOUN
finefocus-615	243	21	4	4	NUM
finefocus-615	243	22	)	)	PUNCT
finefocus-615	243	23	,	,	PUNCT
finefocus-615	243	24	but	but	CCONJ
finefocus-615	243	25	not	not	PART
finefocus-615	243	26	by	by	ADP
finefocus-615	243	27	milk	milk	NOUN
finefocus-615	243	28	type	type	NOUN
finefocus-615	243	29	or	or	CCONJ
finefocus-615	243	30	moisture	moisture	NOUN
finefocus-615	243	31	content	content	NOUN
finefocus-615	243	32	(	(	PUNCT
finefocus-615	243	33	supplementary	supplementary	ADJ
finefocus-615	243	34	figure	figure	NOUN
finefocus-615	243	35	1	1	NUM
finefocus-615	243	36	)	)	PUNCT
finefocus-615	243	37	.	.	PUNCT
finefocus-615	244	1	a	a	DET
finefocus-615	244	2	trend	trend	NOUN
finefocus-615	244	3	towards	towards	ADP
finefocus-615	244	4	clustering	clustering	NOUN
finefocus-615	244	5	was	be	AUX
finefocus-615	244	6	seen	see	VERB
finefocus-615	244	7	with	with	ADP
finefocus-615	244	8	ph	ph	PROPN
finefocus-615	244	9	(	(	PUNCT
finefocus-615	244	10	supplementary	supplementary	ADJ
finefocus-615	244	11	figure	figure	NOUN
finefocus-615	244	12	1	1	NUM
finefocus-615	244	13	)	)	PUNCT
finefocus-615	244	14	.	.	PUNCT
finefocus-615	245	1	figure	figure	NOUN
finefocus-615	245	2	1	1	NUM
finefocus-615	245	3	.	.	PUNCT
finefocus-615	246	1	prevalence	prevalence	NOUN
finefocus-615	246	2	(	(	PUNCT
finefocus-615	246	3	in	in	ADP
finefocus-615	246	4	%	%	NOUN
finefocus-615	246	5	operational	operational	ADJ
finefocus-615	246	6	taxonomic	taxonomic	ADJ
finefocus-615	246	7	units	unit	NOUN
finefocus-615	246	8	,	,	PUNCT
finefocus-615	246	9	otus	otus	NOUN
finefocus-615	246	10	)	)	PUNCT
finefocus-615	246	11	of	of	ADP
finefocus-615	246	12	cheese	cheese	NOUN
finefocus-615	246	13	microbes	microbe	NOUN
finefocus-615	246	14	successfully	successfully	ADV
finefocus-615	246	15	identified	identify	VERB
finefocus-615	246	16	to	to	ADP
finefocus-615	246	17	the	the	DET
finefocus-615	246	18	genus	genus	ADJ
finefocus-615	246	19	level	level	NOUN
finefocus-615	246	20	through	through	ADP
finefocus-615	246	21	a	a	DET
finefocus-615	246	22	)	)	PUNCT
finefocus-615	246	23	culture	culture	NOUN
finefocus-615	246	24	-	-	PUNCT
finefocus-615	246	25	dependent	dependent	ADJ
finefocus-615	246	26	sanger	sanger	PROPN
finefocus-615	246	27	sequencing	sequencing	NOUN
finefocus-615	246	28	of	of	ADP
finefocus-615	246	29	the	the	DET
finefocus-615	246	30	16s	16s	PROPN
finefocus-615	246	31	rrna	rrna	PROPN
finefocus-615	246	32	gene	gene	NOUN
finefocus-615	246	33	of	of	ADP
finefocus-615	246	34	organisms	organism	NOUN
finefocus-615	246	35	isolated	isolate	VERB
finefocus-615	246	36	from	from	ADP
finefocus-615	246	37	both	both	CCONJ
finefocus-615	246	38	the	the	DET
finefocus-615	246	39	rind	rind	NOUN
finefocus-615	246	40	and	and	CCONJ
finefocus-615	246	41	the	the	DET
finefocus-615	246	42	curd	curd	NOUN
finefocus-615	246	43	,	,	PUNCT
finefocus-615	246	44	as	as	SCONJ
finefocus-615	246	45	compared	compare	VERB
finefocus-615	246	46	to	to	ADP
finefocus-615	246	47	the	the	DET
finefocus-615	246	48	prevalence	prevalence	NOUN
finefocus-615	246	49	of	of	ADP
finefocus-615	246	50	these	these	DET
finefocus-615	246	51	organisms	organism	NOUN
finefocus-615	246	52	found	find	VERB
finefocus-615	246	53	through	through	ADP
finefocus-615	246	54	high	high	ADJ
finefocus-615	246	55	-	-	PUNCT
finefocus-615	246	56	throughput	throughput	NOUN
finefocus-615	246	57	community	community	NOUN
finefocus-615	246	58	sequencing	sequence	VERB
finefocus-615	246	59	in	in	ADP
finefocus-615	246	60	either	either	DET
finefocus-615	246	61	b	b	X
finefocus-615	246	62	)	)	PUNCT
finefocus-615	246	63	the	the	DET
finefocus-615	246	64	curd	curd	NOUN
finefocus-615	246	65	or	or	CCONJ
finefocus-615	246	66	c	c	NOUN
finefocus-615	246	67	)	)	PUNCT
finefocus-615	246	68	the	the	DET
finefocus-615	246	69	rind	rind	NOUN
finefocus-615	246	70	.	.	PUNCT
finefocus-615	247	1	the	the	DET
finefocus-615	247	2	green	green	ADJ
finefocus-615	247	3	“	"	PUNCT
finefocus-615	247	4	other	other	ADJ
finefocus-615	247	5	”	"	PUNCT
finefocus-615	247	6	category	category	NOUN
finefocus-615	247	7	in	in	ADP
finefocus-615	247	8	figure	figure	NOUN
finefocus-615	247	9	1	1	NUM
finefocus-615	247	10	represents	represent	VERB
finefocus-615	247	11	bacteria	bacteria	NOUN
finefocus-615	247	12	identified	identify	VERB
finefocus-615	247	13	by	by	ADP
finefocus-615	247	14	illumina	illumina	NOUN
finefocus-615	247	15	sequencing	sequencing	NOUN
finefocus-615	247	16	but	but	CCONJ
finefocus-615	247	17	not	not	PART
finefocus-615	247	18	detected	detect	VERB
finefocus-615	247	19	by	by	ADP
finefocus-615	247	20	culturing	culture	VERB
finefocus-615	247	21	.	.	PUNCT
finefocus-615	248	1	brevibacterium	brevibacterium	PROPN
finefocus-615	248	2	corynebacterium	corynebacterium	PROPN
finefocus-615	248	3	staphylococcus	staphylococcus	PROPN
finefocus-615	248	4	brachybacterium	brachybacterium	NOUN
finefocus-615	248	5	bacillus	bacillus	NOUN
finefocus-615	248	6	other	other	ADJ
finefocus-615	248	7	39	39	NUM
finefocus-615	248	8	%	%	NOUN
finefocus-615	248	9	22	22	NUM
finefocus-615	248	10	%	%	NOUN
finefocus-615	248	11	17	17	NUM
finefocus-615	248	12	%	%	NOUN
finefocus-615	248	13	13	13	NUM
finefocus-615	248	14	%	%	NOUN
finefocus-615	248	15	9	9	NUM
finefocus-615	248	16	%	%	NOUN
finefocus-615	248	17	a	a	NOUN
finefocus-615	248	18	)	)	PUNCT
finefocus-615	248	19	43	43	NUM
finefocus-615	248	20	%	%	NOUN
finefocus-615	248	21	33	33	NUM
finefocus-615	248	22	%	%	NOUN
finefocus-615	248	23	14	14	NUM
finefocus-615	248	24	%	%	NOUN
finefocus-615	248	25	9	9	NUM
finefocus-615	248	26	%	%	NOUN
finefocus-615	248	27	1%b	1%b	NUM
finefocus-615	248	28	)	)	PUNCT
finefocus-615	248	29	65	65	NUM
finefocus-615	248	30	%	%	NOUN
finefocus-615	248	31	16	16	NUM
finefocus-615	248	32	%	%	NOUN
finefocus-615	248	33	10	10	NUM
finefocus-615	248	34	%	%	NOUN
finefocus-615	248	35	5	5	NUM
finefocus-615	248	36	%	%	NOUN
finefocus-615	248	37	4%c	4%c	NUM
finefocus-615	248	38	)	)	PUNCT
finefocus-615	248	39	bacterial	bacterial	ADJ
finefocus-615	248	40	community	community	NOUN
finefocus-615	248	41	structure	structure	NOUN
finefocus-615	248	42	in	in	ADP
finefocus-615	248	43	cheese	cheese	NOUN
finefocus-615	248	44	•	•	NUM
finefocus-615	248	45	17	17	NUM
finefocus-615	248	46	18	18	NUM
finefocus-615	248	47	•	•	NUM
finefocus-615	248	48	fine	fine	ADJ
finefocus-615	248	49	focus	focus	NOUN
finefocus-615	248	50	,	,	PUNCT
finefocus-615	248	51	vol	vol	NOUN
finefocus-615	248	52	.	.	NOUN
finefocus-615	248	53	3	3	NUM
finefocus-615	248	54	(	(	PUNCT
finefocus-615	248	55	1	1	NUM
finefocus-615	248	56	)	)	PUNCT
finefocus-615	248	57	figure	figure	NOUN
finefocus-615	248	58	2	2	NUM
finefocus-615	248	59	.	.	PUNCT
finefocus-615	248	60	rarefaction	rarefaction	NOUN
finefocus-615	248	61	curves	curve	NOUN
finefocus-615	248	62	of	of	ADP
finefocus-615	248	63	microbial	microbial	ADJ
finefocus-615	248	64	populations	population	NOUN
finefocus-615	248	65	from	from	ADP
finefocus-615	248	66	the	the	DET
finefocus-615	248	67	a	a	NOUN
finefocus-615	248	68	)	)	PUNCT
finefocus-615	248	69	curd	curd	NOUN
finefocus-615	248	70	and	and	CCONJ
finefocus-615	248	71	b	b	NOUN
finefocus-615	248	72	)	)	PUNCT
finefocus-615	248	73	rind	rind	NOUN
finefocus-615	248	74	of	of	ADP
finefocus-615	248	75	natural	natural	ADJ
finefocus-615	248	76	rind	rind	NOUN
finefocus-615	248	77	cheeses	cheese	NOUN
finefocus-615	248	78	show	show	VERB
finefocus-615	248	79	greater	great	ADJ
finefocus-615	248	80	species	specie	NOUN
finefocus-615	248	81	richness	richness	NOUN
finefocus-615	248	82	in	in	ADP
finefocus-615	248	83	the	the	DET
finefocus-615	248	84	rind	rind	NOUN
finefocus-615	248	85	than	than	ADP
finefocus-615	248	86	the	the	DET
finefocus-615	248	87	curd	curd	NOUN
finefocus-615	248	88	.	.	PUNCT
finefocus-615	249	1	each	each	DET
finefocus-615	249	2	line	line	NOUN
finefocus-615	249	3	represents	represent	VERB
finefocus-615	249	4	the	the	DET
finefocus-615	249	5	standard	standard	ADJ
finefocus-615	249	6	error	error	NOUN
finefocus-615	249	7	of	of	ADP
finefocus-615	249	8	the	the	DET
finefocus-615	249	9	mean	mean	NOUN
finefocus-615	249	10	(	(	PUNCT
finefocus-615	249	11	±sem	±sem	NOUN
finefocus-615	249	12	)	)	PUNCT
finefocus-615	249	13	of	of	ADP
finefocus-615	249	14	10	10	NUM
finefocus-615	249	15	samples	sample	NOUN
finefocus-615	249	16	from	from	ADP
finefocus-615	249	17	the	the	DET
finefocus-615	249	18	rind	rind	NOUN
finefocus-615	249	19	or	or	CCONJ
finefocus-615	249	20	curd	curd	NOUN
finefocus-615	249	21	of	of	ADP
finefocus-615	249	22	a	a	DET
finefocus-615	249	23	cheese	cheese	NOUN
finefocus-615	249	24	sequenced	sequence	VERB
finefocus-615	249	25	using	use	VERB
finefocus-615	249	26	16s	16s	PROPN
finefocus-615	249	27	rrna	rrna	PROPN
finefocus-615	249	28	gene	gene	NOUN
finefocus-615	249	29	.	.	PUNCT
finefocus-615	250	1	c	c	X
finefocus-615	250	2	)	)	PUNCT
finefocus-615	250	3	rind	rind	NOUN
finefocus-615	250	4	communities	community	NOUN
finefocus-615	250	5	are	be	AUX
finefocus-615	250	6	significantly	significantly	ADV
finefocus-615	250	7	more	more	ADV
finefocus-615	250	8	evenly	evenly	ADV
finefocus-615	250	9	and	and	CCONJ
finefocus-615	250	10	richly	richly	ADV
finefocus-615	250	11	distributed	distribute	VERB
finefocus-615	250	12	than	than	ADP
finefocus-615	250	13	curd	curd	NOUN
finefocus-615	250	14	communities	community	NOUN
finefocus-615	250	15	(	(	PUNCT
finefocus-615	250	16	t	t	NOUN
finefocus-615	250	17	-	-	PUNCT
finefocus-615	250	18	test	test	NOUN
finefocus-615	250	19	,	,	PUNCT
finefocus-615	250	20	tstat	tstat	NOUN
finefocus-615	250	21	=	=	NUM
finefocus-615	250	22	2.56	2.56	NUM
finefocus-615	250	23	,	,	PUNCT
finefocus-615	250	24	df	df	PROPN
finefocus-615	250	25	=	=	SYM
finefocus-615	250	26	14	14	NUM
finefocus-615	250	27	,	,	PUNCT
finefocus-615	250	28	p	p	X
finefocus-615	250	29	<	<	X
finefocus-615	250	30	0.05	0.05	NUM
finefocus-615	250	31	)	)	PUNCT
finefocus-615	250	32	.	.	PUNCT
finefocus-615	251	1	bar	bar	NOUN
finefocus-615	251	2	heights	height	NOUN
finefocus-615	251	3	represent	represent	VERB
finefocus-615	251	4	mean	mean	ADJ
finefocus-615	251	5	shannon	shannon	PROPN
finefocus-615	251	6	-	-	PUNCT
finefocus-615	251	7	weaver	weaver	NOUN
finefocus-615	251	8	diversity	diversity	NOUN
finefocus-615	251	9	within	within	ADP
finefocus-615	251	10	communities	community	NOUN
finefocus-615	251	11	sampled	sample	VERB
finefocus-615	251	12	from	from	ADP
finefocus-615	251	13	the	the	DET
finefocus-615	251	14	rind	rind	NOUN
finefocus-615	251	15	and	and	CCONJ
finefocus-615	251	16	the	the	DET
finefocus-615	251	17	curd	curd	NOUN
finefocus-615	251	18	.	.	PUNCT
finefocus-615	252	1	rind	rind	NOUN
finefocus-615	252	2	:	:	PUNCT
finefocus-615	252	3	n	n	PROPN
finefocus-615	252	4	=	=	SYM
finefocus-615	252	5	9	9	NUM
finefocus-615	252	6	;	;	PUNCT
finefocus-615	252	7	curd	curd	NOUN
finefocus-615	252	8	:	:	PUNCT
finefocus-615	252	9	n	n	NOUN
finefocus-615	252	10	=	=	SYM
finefocus-615	252	11	10	10	NUM
finefocus-615	252	12	for	for	ADP
finefocus-615	252	13	all	all	DET
finefocus-615	252	14	means	mean	NOUN
finefocus-615	252	15	.	.	PUNCT
finefocus-615	253	1	error	error	NOUN
finefocus-615	253	2	bars	bar	NOUN
finefocus-615	253	3	=	=	SYM
finefocus-615	253	4	mean	mean	NOUN
finefocus-615	253	5	±	±	NUM
finefocus-615	253	6	sem	sem	NOUN
finefocus-615	253	7	.	.	PUNCT
finefocus-615	254	1	sequences	sequence	NOUN
finefocus-615	254	2	per	per	ADP
finefocus-615	254	3	sample	sample	NOUN
finefocus-615	255	1	o	o	NOUN
finefocus-615	255	2	bs	bs	INTJ
finefocus-615	255	3	er	er	INTJ
finefocus-615	255	4	ve	ve	VERB
finefocus-615	255	5	d	d	X
finefocus-615	255	6	o	o	X
finefocus-615	255	7	tu	tu	PROPN
finefocus-615	255	8	s	s	PROPN
finefocus-615	255	9	10000	10000	NUM
finefocus-615	255	10	20000	20000	NUM
finefocus-615	255	11	30000	30000	NUM
finefocus-615	255	12	40000	40000	NUM
finefocus-615	255	13	500000	500000	NUM
finefocus-615	255	14	200	200	NUM
finefocus-615	255	15	400	400	NUM
finefocus-615	255	16	600a	600a	NOUN
finefocus-615	255	17	)	)	PUNCT
finefocus-615	256	1	o	o	NOUN
finefocus-615	256	2	bs	bs	INTJ
finefocus-615	256	3	er	er	INTJ
finefocus-615	256	4	ve	ve	VERB
finefocus-615	256	5	d	d	X
finefocus-615	256	6	o	o	X
finefocus-615	257	1	tu	tu	PROPN
finefocus-615	257	2	s	s	PART
finefocus-615	257	3	sequences	sequence	NOUN
finefocus-615	257	4	per	per	ADP
finefocus-615	257	5	sample	sample	NOUN
finefocus-615	257	6	10000	10000	NUM
finefocus-615	257	7	20000	20000	NUM
finefocus-615	257	8	30000	30000	NUM
finefocus-615	257	9	40000	40000	NUM
finefocus-615	257	10	500000	500000	NUM
finefocus-615	257	11	200	200	NUM
finefocus-615	257	12	400	400	NUM
finefocus-615	257	13	600	600	NUM
finefocus-615	257	14	800	800	NUM
finefocus-615	257	15	1000	1000	NUM
finefocus-615	257	16	1200	1200	NUM
finefocus-615	257	17	1400	1400	NUM
finefocus-615	257	18	1600	1600	NUM
finefocus-615	257	19	1800	1800	NUM
finefocus-615	257	20	b	b	NOUN
finefocus-615	257	21	)	)	PUNCT
finefocus-615	257	22	sh	sh	ADP
finefocus-615	258	1	an	an	DET
finefocus-615	258	2	no	no	INTJ
finefocus-615	258	3	nw	nw	NOUN
finefocus-615	258	4	ea	ea	PROPN
finefocus-615	258	5	ve	ve	PROPN
finefocus-615	258	6	r	r	NOUN
finefocus-615	258	7	di	di	NOUN
finefocus-615	258	8	ve	ve	NOUN
finefocus-615	258	9	rs	rs	NOUN
finefocus-615	258	10	ity	ity	NOUN
finefocus-615	258	11	sampling	sample	VERB
finefocus-615	258	12	location	location	NOUN
finefocus-615	258	13	rind	rind	NOUN
finefocus-615	258	14	curd	curd	NOUN
finefocus-615	258	15	0.2	0.2	NUM
finefocus-615	258	16	0.4	0.4	NUM
finefocus-615	258	17	0.6	0.6	NUM
finefocus-615	258	18	0.8	0.8	NUM
finefocus-615	258	19	1.0	1.0	NUM
finefocus-615	258	20	1.2	1.2	NUM
finefocus-615	258	21	1.4	1.4	NUM
finefocus-615	258	22	1.6	1.6	NUM
finefocus-615	258	23	1.8	1.8	NUM
finefocus-615	258	24	c	c	NOUN
finefocus-615	258	25	)	)	PUNCT
finefocus-615	258	26	alpage	alpage	NOUN
finefocus-615	258	27	gruyere	gruyere	NOUN
finefocus-615	258	28	alpage	alpage	NOUN
finefocus-615	258	29	gruyere	gruyere	NOUN
finefocus-615	258	30	2	2	NUM
finefocus-615	258	31	comte	comte	NOUN
finefocus-615	258	32	stichelton	stichelton	NOUN
finefocus-615	258	33	maggies	maggie	NOUN
finefocus-615	258	34	round	round	VERB
finefocus-615	258	35	sonnet	sonnet	PROPN
finefocus-615	258	36	missouri	missouri	PROPN
finefocus-615	258	37	truckle	truckle	PROPN
finefocus-615	258	38	vt	vt	PROPN
finefocus-615	258	39	.	.	PROPN
finefocus-615	259	1	shepherd	shepherd	PROPN
finefocus-615	259	2	stichelton	stichelton	PROPN
finefocus-615	259	3	2	2	NUM
finefocus-615	259	4	comte	comte	NOUN
finefocus-615	259	5	2	2	NUM
finefocus-615	259	6	bacterial	bacterial	ADJ
finefocus-615	259	7	community	community	NOUN
finefocus-615	259	8	structure	structure	NOUN
finefocus-615	259	9	in	in	ADP
finefocus-615	259	10	cheese	cheese	NOUN
finefocus-615	259	11	•	•	NUM
finefocus-615	259	12	19	19	NUM
finefocus-615	259	13	figure	figure	NOUN
finefocus-615	259	14	4	4	NUM
finefocus-615	259	15	.	.	PUNCT
finefocus-615	259	16	principal	principal	ADJ
finefocus-615	259	17	coordinate	coordinate	NOUN
finefocus-615	259	18	analysis	analysis	NOUN
finefocus-615	259	19	of	of	ADP
finefocus-615	259	20	rind	rind	NOUN
finefocus-615	259	21	and	and	CCONJ
finefocus-615	259	22	curd	curd	NOUN
finefocus-615	259	23	microbial	microbial	ADJ
finefocus-615	259	24	communities	community	NOUN
finefocus-615	259	25	.	.	PUNCT
finefocus-615	260	1	clustering	clustering	NOUN
finefocus-615	260	2	is	be	AUX
finefocus-615	260	3	seen	see	VERB
finefocus-615	260	4	with	with	ADP
finefocus-615	260	5	rind	rind	NOUN
finefocus-615	260	6	samples	sample	NOUN
finefocus-615	260	7	and	and	CCONJ
finefocus-615	260	8	curd	curd	NOUN
finefocus-615	260	9	samples	sample	NOUN
finefocus-615	260	10	,	,	PUNCT
finefocus-615	260	11	regardless	regardless	ADV
finefocus-615	260	12	of	of	ADP
finefocus-615	260	13	the	the	DET
finefocus-615	260	14	cheese	cheese	NOUN
finefocus-615	260	15	type	type	NOUN
finefocus-615	260	16	.	.	PUNCT
finefocus-615	261	1	a	a	DET
finefocus-615	261	2	16s	16s	PROPN
finefocus-615	261	3	rrna	rrna	PROPN
finefocus-615	261	4	gene	gene	NOUN
finefocus-615	261	5	dataset	dataset	PROPN
finefocus-615	261	6	was	be	AUX
finefocus-615	261	7	analyzed	analyze	VERB
finefocus-615	261	8	with	with	ADP
finefocus-615	261	9	qiime	qiime	NOUN
finefocus-615	261	10	and	and	CCONJ
finefocus-615	261	11	r	r	NOUN
finefocus-615	261	12	was	be	AUX
finefocus-615	261	13	used	use	VERB
finefocus-615	261	14	to	to	PART
finefocus-615	261	15	generate	generate	VERB
finefocus-615	261	16	the	the	DET
finefocus-615	261	17	principal	principal	ADJ
finefocus-615	261	18	coordinate	coordinate	NOUN
finefocus-615	261	19	analysis	analysis	NOUN
finefocus-615	261	20	.	.	PUNCT
finefocus-615	262	1	each	each	DET
finefocus-615	262	2	white	white	ADJ
finefocus-615	262	3	or	or	CCONJ
finefocus-615	262	4	black	black	ADJ
finefocus-615	262	5	mark	mark	NOUN
finefocus-615	262	6	represents	represents	AUX
finefocus-615	262	7	averaged	average	VERB
finefocus-615	262	8	community	community	NOUN
finefocus-615	262	9	composition	composition	NOUN
finefocus-615	262	10	data	datum	NOUN
finefocus-615	262	11	of	of	ADP
finefocus-615	262	12	the	the	DET
finefocus-615	262	13	rind	rind	NOUN
finefocus-615	262	14	or	or	CCONJ
finefocus-615	262	15	curd	curd	NOUN
finefocus-615	262	16	for	for	ADP
finefocus-615	262	17	the	the	DET
finefocus-615	262	18	cheese	cheese	NOUN
finefocus-615	262	19	sampled	sample	VERB
finefocus-615	262	20	.	.	PUNCT
finefocus-615	263	1	pc1	pc1	PROPN
finefocus-615	263	2	(	(	PUNCT
finefocus-615	263	3	76.4	76.4	NUM
finefocus-615	263	4	%	%	NOUN
finefocus-615	263	5	)	)	PUNCT
finefocus-615	263	6	pc	pc	NOUN
finefocus-615	263	7	2	2	NUM
finefocus-615	263	8	(	(	PUNCT
finefocus-615	263	9	9	9	NUM
finefocus-615	263	10	.3	.3	NUM
finefocus-615	263	11	%	%	NOUN
finefocus-615	263	12	)	)	PUNCT
finefocus-615	263	13	rind	rind	NOUN
finefocus-615	263	14	curd	curd	NOUN
finefocus-615	263	15	figure	figure	NOUN
finefocus-615	263	16	3	3	NUM
finefocus-615	263	17	.	.	PUNCT
finefocus-615	263	18	relative	relative	ADJ
finefocus-615	263	19	abundance	abundance	NOUN
finefocus-615	263	20	of	of	ADP
finefocus-615	263	21	microbial	microbial	ADJ
finefocus-615	263	22	phyla	phyla	NOUN
finefocus-615	263	23	and	and	CCONJ
finefocus-615	263	24	genera	genera	NOUN
finefocus-615	263	25	from	from	ADP
finefocus-615	263	26	the	the	DET
finefocus-615	263	27	rind	rind	NOUN
finefocus-615	263	28	and	and	CCONJ
finefocus-615	263	29	curd	curd	NOUN
finefocus-615	263	30	of	of	ADP
finefocus-615	263	31	six	six	NUM
finefocus-615	263	32	natural	natural	ADJ
finefocus-615	263	33	rind	rind	NOUN
finefocus-615	263	34	cheeses	cheese	NOUN
finefocus-615	263	35	.	.	PUNCT
finefocus-615	264	1	horizontal	horizontal	ADJ
finefocus-615	264	2	bars	bar	NOUN
finefocus-615	264	3	represent	represent	VERB
finefocus-615	264	4	microbiome	microbiome	ADJ
finefocus-615	264	5	samples	sample	NOUN
finefocus-615	264	6	from	from	ADP
finefocus-615	264	7	six	six	NUM
finefocus-615	264	8	cheeses	cheese	NOUN
finefocus-615	264	9	in	in	ADP
finefocus-615	264	10	the	the	DET
finefocus-615	264	11	rind	rind	NOUN
finefocus-615	264	12	and	and	CCONJ
finefocus-615	264	13	the	the	DET
finefocus-615	264	14	curd	curd	NOUN
finefocus-615	264	15	and	and	CCONJ
finefocus-615	264	16	are	be	AUX
finefocus-615	264	17	colored	color	VERB
finefocus-615	264	18	according	accord	VERB
finefocus-615	264	19	to	to	ADP
finefocus-615	264	20	the	the	DET
finefocus-615	264	21	microbial	microbial	ADJ
finefocus-615	264	22	phyla	phyla	NOUN
finefocus-615	264	23	and	and	CCONJ
finefocus-615	264	24	genus	genus	NOUN
finefocus-615	264	25	found	find	VERB
finefocus-615	264	26	in	in	ADP
finefocus-615	264	27	these	these	DET
finefocus-615	264	28	environments	environment	NOUN
finefocus-615	264	29	through	through	ADP
finefocus-615	264	30	illumina	illumina	NOUN
finefocus-615	264	31	sequencing	sequencing	NOUN
finefocus-615	264	32	of	of	ADP
finefocus-615	264	33	the	the	DET
finefocus-615	264	34	16s	16s	PROPN
finefocus-615	264	35	rrna	rrna	PROPN
finefocus-615	264	36	gene	gene	NOUN
finefocus-615	264	37	.	.	PUNCT
finefocus-615	265	1	darker	dark	ADJ
finefocus-615	265	2	shades	shade	NOUN
finefocus-615	265	3	represent	represent	VERB
finefocus-615	265	4	actinobacteria	actinobacteria	NOUN
finefocus-615	265	5	while	while	SCONJ
finefocus-615	265	6	lighter	light	ADJ
finefocus-615	265	7	shades	shade	NOUN
finefocus-615	265	8	represent	represent	VERB
finefocus-615	265	9	either	either	CCONJ
finefocus-615	265	10	firmicutes	firmicute	NOUN
finefocus-615	265	11	or	or	CCONJ
finefocus-615	265	12	proteobacteria	proteobacteria	NOUN
finefocus-615	265	13	.	.	PUNCT
finefocus-615	266	1	represented	represent	VERB
finefocus-615	266	2	organisms	organism	NOUN
finefocus-615	266	3	were	be	AUX
finefocus-615	266	4	found	find	VERB
finefocus-615	266	5	at	at	ADP
finefocus-615	266	6	≥	≥	NOUN
finefocus-615	266	7	2	2	NUM
finefocus-615	266	8	%	%	NOUN
finefocus-615	266	9	relative	relative	ADJ
finefocus-615	266	10	abundance	abundance	NOUN
finefocus-615	266	11	.	.	PUNCT
finefocus-615	267	1	actinobacteria	actinobacteria	NOUN
finefocus-615	267	2	actinobacteria	actinobacteria	NOUN
finefocus-615	267	3	;	;	PUNCT
finefocus-615	267	4	arthrobacter	arthrobacter	NOUN
finefocus-615	267	5	actinobacteria	actinobacteria	NOUN
finefocus-615	267	6	;	;	PUNCT
finefocus-615	267	7	brevibacterium	brevibacterium	NOUN
finefocus-615	267	8	actinobacteria	actinobacteria	NOUN
finefocus-615	267	9	;	;	PUNCT
finefocus-615	267	10	corynebacterium	corynebacterium	NOUN
finefocus-615	267	11	actinobacteria	actinobacteria	NOUN
finefocus-615	267	12	;	;	PUNCT
finefocus-615	267	13	intrasporangiaceae	intrasporangiaceae	PROPN
finefocus-615	267	14	actinobacteria	actinobacteria	NOUN
finefocus-615	267	15	;	;	PUNCT
finefocus-615	267	16	leucobacter	leucobacter	NOUN
finefocus-615	267	17	actinobacteria	actinobacteria	NOUN
finefocus-615	267	18	;	;	PUNCT
finefocus-615	267	19	prauseria	prauseria	NOUN
finefocus-615	267	20	actinobacteria	actinobacteria	NOUN
finefocus-615	267	21	;	;	PUNCT
finefocus-615	267	22	sanguibacter	sanguibacter	ADJ
finefocus-615	267	23	actinobacteria	actinobacteria	NOUN
finefocus-615	267	24	;	;	PUNCT
finefocus-615	267	25	yaniella	yaniella	NOUN
finefocus-615	267	26	actinobacteria	actinobacteria	NOUN
finefocus-615	267	27	;	;	PUNCT
finefocus-615	267	28	branchybacterium	branchybacterium	NOUN
finefocus-615	267	29	firmicutes	firmicute	NOUN
finefocus-615	267	30	;	;	PUNCT
finefocus-615	267	31	aerococcaceae	aerococcaceae	ADJ
finefocus-615	267	32	firmicutes	firmicute	NOUN
finefocus-615	267	33	;	;	PUNCT
finefocus-615	267	34	clostridiales	clostridiale	NOUN
finefocus-615	267	35	firmicutes	firmicute	NOUN
finefocus-615	267	36	;	;	PUNCT
finefocus-615	267	37	clostridiisalibacter	clostridiisalibacter	ADJ
finefocus-615	267	38	firmicutes	firmicute	NOUN
finefocus-615	267	39	;	;	PUNCT
finefocus-615	267	40	lactobacillaceae	lactobacillaceae	NOUN
finefocus-615	267	41	firmicutes	firmicute	NOUN
finefocus-615	267	42	;	;	PUNCT
finefocus-615	267	43	lactobacillus	lactobacillus	NOUN
finefocus-615	267	44	firmicutes	firmicute	NOUN
finefocus-615	267	45	;	;	PUNCT
finefocus-615	267	46	lactococcus	lactococcus	NOUN
finefocus-615	267	47	firmicutes	firmicute	NOUN
finefocus-615	267	48	;	;	PUNCT
finefocus-615	267	49	planococcacus	planococcacus	NOUN
finefocus-615	267	50	firmicutes	firmicute	NOUN
finefocus-615	267	51	;	;	PUNCT
finefocus-615	267	52	staphylococcus	staphylococcus	NOUN
finefocus-615	267	53	firmicutes	firmicute	NOUN
finefocus-615	267	54	;	;	PUNCT
finefocus-615	267	55	streptococcus	streptococcus	NOUN
finefocus-615	267	56	protobacteria	protobacteria	NOUN
finefocus-615	267	57	;	;	PUNCT
finefocus-615	267	58	halomonas	halomonas	PROPN
finefocus-615	267	59	proteobacteria	proteobacteria	PROPN
finefocus-615	267	60	;	;	PUNCT
finefocus-615	267	61	psychrobacter	psychrobacter	NOUN
finefocus-615	267	62	1	1	NUM
finefocus-615	267	63	10.8	10.8	NUM
finefocus-615	267	64	0.80.6	0.80.6	NUM
finefocus-615	267	65	0.60.4	0.60.4	NUM
finefocus-615	267	66	0.40.2	0.40.2	NUM
finefocus-615	267	67	0.20	0.20	NUM
finefocus-615	267	68	vt	vt	PROPN
finefocus-615	267	69	.	.	PUNCT
finefocus-615	267	70	shepherd	shepherd	PROPN
finefocus-615	267	71	stichelton	stichelton	PROPN
finefocus-615	267	72	sonnet	sonnet	PROPN
finefocus-615	267	73	missouri	missouri	PROPN
finefocus-615	267	74	truckle	truckle	PROPN
finefocus-615	267	75	missouri	missouri	PROPN
finefocus-615	267	76	truckle	truckle	PROPN
finefocus-615	267	77	comte	comte	PROPN
finefocus-615	267	78	comte	comte	NOUN
finefocus-615	267	79	alpage	alpage	VERB
finefocus-615	267	80	gruyere	gruyere	NOUN
finefocus-615	267	81	alpage	alpage	NOUN
finefocus-615	267	82	gruyere	gruyere	NOUN
finefocus-615	267	83	rind	rind	NOUN
finefocus-615	267	84	curd	curd	NOUN
finefocus-615	267	85	20	20	NUM
finefocus-615	267	86	•	•	NUM
finefocus-615	267	87	fine	fine	ADJ
finefocus-615	267	88	focus	focus	NOUN
finefocus-615	267	89	,	,	PUNCT
finefocus-615	267	90	vol	vol	NOUN
finefocus-615	267	91	.	.	NOUN
finefocus-615	267	92	3	3	NUM
finefocus-615	267	93	(	(	PUNCT
finefocus-615	267	94	1	1	NUM
finefocus-615	267	95	)	)	PUNCT
finefocus-615	267	96	isolates	isolate	NOUN
finefocus-615	267	97	from	from	ADP
finefocus-615	267	98	u.s	u.s	PROPN
finefocus-615	267	99	.	.	PROPN
finefocus-615	267	100	cheeses	cheese	NOUN
finefocus-615	267	101	display	display	VERB
finefocus-615	267	102	higher	high	ADJ
finefocus-615	267	103	overall	overall	ADJ
finefocus-615	267	104	susceptibility	susceptibility	NOUN
finefocus-615	267	105	to	to	ADP
finefocus-615	267	106	antibiotics	antibiotic	NOUN
finefocus-615	267	107	than	than	ADP
finefocus-615	267	108	european	european	ADJ
finefocus-615	267	109	cheeses	cheese	NOUN
finefocus-615	267	110	to	to	PART
finefocus-615	267	111	explore	explore	VERB
finefocus-615	267	112	the	the	DET
finefocus-615	267	113	outcomes	outcome	NOUN
finefocus-615	267	114	of	of	ADP
finefocus-615	267	115	potential	potential	ADJ
finefocus-615	267	116	interactions	interaction	NOUN
finefocus-615	267	117	between	between	ADP
finefocus-615	267	118	bacteria	bacteria	NOUN
finefocus-615	267	119	and	and	CCONJ
finefocus-615	267	120	fungi	fungus	NOUN
finefocus-615	267	121	in	in	ADP
finefocus-615	267	122	the	the	DET
finefocus-615	267	123	cheese	cheese	NOUN
finefocus-615	267	124	communities	community	NOUN
finefocus-615	267	125	from	from	ADP
finefocus-615	267	126	regionally	regionally	ADV
finefocus-615	267	127	diverse	diverse	ADJ
finefocus-615	267	128	cheeses	cheese	NOUN
finefocus-615	267	129	,	,	PUNCT
finefocus-615	267	130	inhibition	inhibition	NOUN
finefocus-615	267	131	of	of	ADP
finefocus-615	267	132	bacterial	bacterial	ADJ
finefocus-615	267	133	growth	growth	NOUN
finefocus-615	267	134	by	by	ADP
finefocus-615	267	135	fungal	fungal	ADJ
finefocus-615	267	136	and	and	CCONJ
finefocus-615	267	137	bacterially	bacterially	ADV
finefocus-615	267	138	derived	derive	VERB
finefocus-615	267	139	antimicrobials	antimicrobial	NOUN
finefocus-615	267	140	was	be	AUX
finefocus-615	267	141	examined	examine	VERB
finefocus-615	267	142	for	for	ADP
finefocus-615	267	143	cheese	cheese	NOUN
finefocus-615	267	144	isolates	isolate	NOUN
finefocus-615	267	145	.	.	PUNCT
finefocus-615	268	1	isolate	isolate	VERB
finefocus-615	268	2	susceptibility	susceptibility	NOUN
finefocus-615	268	3	levels	level	NOUN
finefocus-615	268	4	were	be	AUX
finefocus-615	268	5	compared	compare	VERB
finefocus-615	268	6	between	between	ADP
finefocus-615	268	7	cheeses	cheese	NOUN
finefocus-615	268	8	and	and	CCONJ
finefocus-615	268	9	their	their	PRON
finefocus-615	268	10	two	two	NUM
finefocus-615	268	11	respective	respective	ADJ
finefocus-615	268	12	geographical	geographical	ADJ
finefocus-615	268	13	regions	region	NOUN
finefocus-615	268	14	of	of	ADP
finefocus-615	268	15	origin	origin	NOUN
finefocus-615	268	16	:	:	PUNCT
finefocus-615	268	17	the	the	DET
finefocus-615	268	18	u.s	u.s	PROPN
finefocus-615	268	19	.	.	PROPN
finefocus-615	268	20	and	and	CCONJ
finefocus-615	268	21	europe	europe	PROPN
finefocus-615	268	22	(	(	PUNCT
finefocus-615	268	23	figure	figure	NOUN
finefocus-615	268	24	5	5	NUM
finefocus-615	268	25	)	)	PUNCT
finefocus-615	268	26	.	.	PUNCT
finefocus-615	269	1	thirty	thirty	NUM
finefocus-615	269	2	-	-	PUNCT
finefocus-615	269	3	five	five	NUM
finefocus-615	269	4	bacterial	bacterial	ADJ
finefocus-615	269	5	isolates	isolate	NOUN
finefocus-615	269	6	sampled	sample	VERB
finefocus-615	269	7	from	from	ADP
finefocus-615	269	8	six	six	NUM
finefocus-615	269	9	cheeses	cheese	NOUN
finefocus-615	269	10	were	be	AUX
finefocus-615	269	11	tested	test	VERB
finefocus-615	269	12	for	for	ADP
finefocus-615	269	13	their	their	PRON
finefocus-615	269	14	susceptibility	susceptibility	NOUN
finefocus-615	269	15	or	or	CCONJ
finefocus-615	269	16	resistance	resistance	NOUN
finefocus-615	269	17	to	to	ADP
finefocus-615	269	18	six	six	NUM
finefocus-615	269	19	antibiotics	antibiotic	NOUN
finefocus-615	269	20	on	on	ADP
finefocus-615	269	21	nutrient	nutrient	NOUN
finefocus-615	269	22	agar	agar	NOUN
finefocus-615	269	23	plates	plate	NOUN
finefocus-615	269	24	:	:	PUNCT
finefocus-615	269	25	ampicillin	ampicillin	NOUN
finefocus-615	269	26	(	(	PUNCT
finefocus-615	269	27	am10	am10	PROPN
finefocus-615	269	28	)	)	PUNCT
finefocus-615	269	29	,	,	PUNCT
finefocus-615	269	30	penicillin	penicillin	NOUN
finefocus-615	269	31	(	(	PUNCT
finefocus-615	269	32	p10	p10	PROPN
finefocus-615	269	33	)	)	PUNCT
finefocus-615	269	34	,	,	PUNCT
finefocus-615	269	35	erythromycin	erythromycin	NOUN
finefocus-615	269	36	(	(	PUNCT
finefocus-615	269	37	e15	e15	PROPN
finefocus-615	269	38	)	)	PUNCT
finefocus-615	269	39	,	,	PUNCT
finefocus-615	269	40	rifampin	rifampin	PROPN
finefocus-615	269	41	(	(	PUNCT
finefocus-615	269	42	ra5	ra5	PROPN
finefocus-615	269	43	)	)	PUNCT
finefocus-615	269	44	,	,	PUNCT
finefocus-615	269	45	neomycin	neomycin	PROPN
finefocus-615	269	46	(	(	PUNCT
finefocus-615	269	47	n30	n30	PROPN
finefocus-615	269	48	)	)	PUNCT
finefocus-615	269	49	,	,	PUNCT
finefocus-615	269	50	and	and	CCONJ
finefocus-615	269	51	novobiocin	novobiocin	PROPN
finefocus-615	269	52	(	(	PUNCT
finefocus-615	269	53	nb30	nb30	PROPN
finefocus-615	269	54	)	)	PUNCT
finefocus-615	269	55	.	.	PUNCT
finefocus-615	270	1	among	among	ADP
finefocus-615	270	2	the	the	DET
finefocus-615	270	3	six	six	NUM
finefocus-615	270	4	cheeses	cheese	NOUN
finefocus-615	270	5	examined	examine	VERB
finefocus-615	270	6	,	,	PUNCT
finefocus-615	270	7	french	french	ADJ
finefocus-615	270	8	comte	comte	NOUN
finefocus-615	270	9	has	have	VERB
finefocus-615	270	10	the	the	DET
finefocus-615	270	11	highest	high	ADJ
finefocus-615	270	12	percentage	percentage	NOUN
finefocus-615	270	13	of	of	ADP
finefocus-615	270	14	resistant	resistant	ADJ
finefocus-615	270	15	isolates	isolate	NOUN
finefocus-615	270	16	while	while	SCONJ
finefocus-615	270	17	u.s	u.s	PROPN
finefocus-615	270	18	.	.	PROPN
finefocus-615	270	19	maggie	maggie	PROPN
finefocus-615	270	20	’s	’s	PART
finefocus-615	270	21	round	round	NOUN
finefocus-615	270	22	and	and	CCONJ
finefocus-615	270	23	sonnet	sonnet	NOUN
finefocus-615	270	24	cheeses	cheese	NOUN
finefocus-615	270	25	have	have	VERB
finefocus-615	270	26	the	the	DET
finefocus-615	270	27	lowest	low	ADJ
finefocus-615	270	28	percentage	percentage	NOUN
finefocus-615	270	29	of	of	ADP
finefocus-615	270	30	resistant	resistant	ADJ
finefocus-615	270	31	isolates	isolate	NOUN
finefocus-615	270	32	(	(	PUNCT
finefocus-615	270	33	supplementary	supplementary	ADJ
finefocus-615	270	34	figure	figure	NOUN
finefocus-615	270	35	2	2	NUM
finefocus-615	270	36	)	)	PUNCT
finefocus-615	270	37	.	.	PUNCT
finefocus-615	271	1	between	between	ADP
finefocus-615	271	2	the	the	DET
finefocus-615	271	3	two	two	NUM
finefocus-615	271	4	geographical	geographical	ADJ
finefocus-615	271	5	regions	region	NOUN
finefocus-615	271	6	,	,	PUNCT
finefocus-615	271	7	fifty	fifty	NUM
finefocus-615	271	8	-	-	PUNCT
finefocus-615	271	9	five	five	NUM
finefocus-615	271	10	percent	percent	NOUN
finefocus-615	271	11	of	of	ADP
finefocus-615	271	12	the	the	DET
finefocus-615	271	13	total	total	ADJ
finefocus-615	271	14	resistant	resistant	ADJ
finefocus-615	271	15	isolates	isolate	NOUN
finefocus-615	271	16	belong	belong	VERB
finefocus-615	271	17	to	to	ADP
finefocus-615	271	18	the	the	DET
finefocus-615	271	19	european	european	ADJ
finefocus-615	271	20	cheeses	cheese	NOUN
finefocus-615	271	21	while	while	SCONJ
finefocus-615	271	22	bacterial	bacterial	ADJ
finefocus-615	271	23	isolates	isolate	NOUN
finefocus-615	271	24	from	from	ADP
finefocus-615	271	25	the	the	DET
finefocus-615	271	26	u.s	u.s	PROPN
finefocus-615	271	27	.	.	PROPN
finefocus-615	271	28	cheeses	cheese	NOUN
finefocus-615	271	29	constitute	constitute	VERB
finefocus-615	271	30	seventy	seventy	NUM
finefocus-615	271	31	percent	percent	NOUN
finefocus-615	271	32	of	of	ADP
finefocus-615	271	33	the	the	DET
finefocus-615	271	34	total	total	ADJ
finefocus-615	271	35	susceptible	susceptible	ADJ
finefocus-615	271	36	isolates	isolate	NOUN
finefocus-615	271	37	(	(	PUNCT
finefocus-615	271	38	figure	figure	NOUN
finefocus-615	271	39	5a	5a	NUM
finefocus-615	271	40	and	and	CCONJ
finefocus-615	271	41	5c	5c	NUM
finefocus-615	271	42	)	)	PUNCT
finefocus-615	271	43	.	.	PUNCT
finefocus-615	272	1	compared	compare	VERB
finefocus-615	272	2	to	to	ADP
finefocus-615	272	3	european	european	ADJ
finefocus-615	272	4	cheese	cheese	NOUN
finefocus-615	272	5	isolates	isolate	NOUN
finefocus-615	272	6	,	,	PUNCT
finefocus-615	272	7	american	american	ADJ
finefocus-615	272	8	cheese	cheese	NOUN
finefocus-615	272	9	isolates	isolate	NOUN
finefocus-615	272	10	showed	show	VERB
finefocus-615	272	11	larger	large	ADJ
finefocus-615	272	12	percentages	percentage	NOUN
finefocus-615	272	13	of	of	ADP
finefocus-615	272	14	intermediate	intermediate	ADJ
finefocus-615	272	15	susceptibility	susceptibility	NOUN
finefocus-615	272	16	when	when	SCONJ
finefocus-615	272	17	exposed	expose	VERB
finefocus-615	272	18	to	to	ADP
finefocus-615	272	19	ampicillin	ampicillin	NOUN
finefocus-615	272	20	(	(	PUNCT
finefocus-615	272	21	am10	am10	PROPN
finefocus-615	272	22	)	)	PUNCT
finefocus-615	272	23	,	,	PUNCT
finefocus-615	272	24	penicillin	penicillin	NOUN
finefocus-615	272	25	(	(	PUNCT
finefocus-615	272	26	p10	p10	NOUN
finefocus-615	272	27	)	)	PUNCT
finefocus-615	272	28	,	,	PUNCT
finefocus-615	272	29	and	and	CCONJ
finefocus-615	272	30	rifampin	rifampin	X
finefocus-615	272	31	(	(	PUNCT
finefocus-615	272	32	ra5	ra5	PROPN
finefocus-615	272	33	)	)	PUNCT
finefocus-615	272	34	(	(	PUNCT
finefocus-615	272	35	figure	figure	NOUN
finefocus-615	272	36	5b	5b	NUM
finefocus-615	272	37	)	)	PUNCT
finefocus-615	272	38	.	.	PUNCT
finefocus-615	273	1	isolates	isolate	NOUN
finefocus-615	273	2	from	from	ADP
finefocus-615	273	3	the	the	DET
finefocus-615	273	4	three	three	NUM
finefocus-615	273	5	european	european	ADJ
finefocus-615	273	6	cheeses	cheese	NOUN
finefocus-615	273	7	exhibited	exhibit	VERB
finefocus-615	273	8	higher	high	ADJ
finefocus-615	273	9	percentages	percentage	NOUN
finefocus-615	273	10	of	of	ADP
finefocus-615	273	11	resistant	resistant	ADJ
finefocus-615	273	12	isolates	isolate	NOUN
finefocus-615	273	13	,	,	PUNCT
finefocus-615	273	14	especially	especially	ADV
finefocus-615	273	15	those	those	PRON
finefocus-615	273	16	isolated	isolate	VERB
finefocus-615	273	17	from	from	ADP
finefocus-615	273	18	french	french	ADJ
finefocus-615	273	19	comte	comte	NOUN
finefocus-615	273	20	(	(	PUNCT
finefocus-615	273	21	supplementary	supplementary	ADJ
finefocus-615	273	22	figure	figure	NOUN
finefocus-615	273	23	2a	2a	NUM
finefocus-615	273	24	)	)	PUNCT
finefocus-615	273	25	.	.	PUNCT
finefocus-615	274	1	in	in	ADP
finefocus-615	274	2	general	general	ADJ
finefocus-615	274	3	,	,	PUNCT
finefocus-615	274	4	american	american	ADJ
finefocus-615	274	5	cheese	cheese	NOUN
finefocus-615	274	6	isolates	isolate	NOUN
finefocus-615	274	7	revealed	reveal	VERB
finefocus-615	274	8	higher	high	ADJ
finefocus-615	274	9	percentages	percentage	NOUN
finefocus-615	274	10	of	of	ADP
finefocus-615	274	11	susceptible	susceptible	ADJ
finefocus-615	274	12	isolates	isolate	NOUN
finefocus-615	274	13	,	,	PUNCT
finefocus-615	274	14	especially	especially	ADV
finefocus-615	274	15	maggie	maggie	PROPN
finefocus-615	274	16	’s	’s	PART
finefocus-615	274	17	round	round	NOUN
finefocus-615	274	18	and	and	CCONJ
finefocus-615	274	19	sonnet	sonnet	NOUN
finefocus-615	274	20	(	(	PUNCT
finefocus-615	274	21	supplementary	supplementary	ADJ
finefocus-615	274	22	figure	figure	NOUN
finefocus-615	274	23	2	2	NUM
finefocus-615	274	24	)	)	PUNCT
finefocus-615	274	25	.	.	PUNCT
finefocus-615	275	1	however	however	ADV
finefocus-615	275	2	,	,	PUNCT
finefocus-615	275	3	the	the	DET
finefocus-615	275	4	small	small	ADJ
finefocus-615	275	5	and	and	CCONJ
finefocus-615	275	6	uneven	uneven	ADJ
finefocus-615	275	7	numbers	number	NOUN
finefocus-615	275	8	of	of	ADP
finefocus-615	275	9	cultured	cultured	ADJ
finefocus-615	275	10	isolates	isolate	NOUN
finefocus-615	275	11	and	and	CCONJ
finefocus-615	275	12	cheese	cheese	NOUN
finefocus-615	275	13	types	type	NOUN
finefocus-615	275	14	for	for	ADP
finefocus-615	275	15	each	each	PRON
finefocus-615	275	16	of	of	ADP
finefocus-615	275	17	the	the	DET
finefocus-615	275	18	regions	region	NOUN
finefocus-615	275	19	limited	limit	VERB
finefocus-615	275	20	the	the	DET
finefocus-615	275	21	ability	ability	NOUN
finefocus-615	275	22	to	to	PART
finefocus-615	275	23	further	far	ADV
finefocus-615	275	24	analyze	analyze	VERB
finefocus-615	275	25	the	the	DET
finefocus-615	275	26	correlation	correlation	NOUN
finefocus-615	275	27	between	between	ADP
finefocus-615	275	28	the	the	DET
finefocus-615	275	29	cheese	cheese	NOUN
finefocus-615	275	30	origin	origin	NOUN
finefocus-615	275	31	and	and	CCONJ
finefocus-615	275	32	susceptibility	susceptibility	NOUN
finefocus-615	275	33	to	to	ADP
finefocus-615	275	34	antibiotics	antibiotic	NOUN
finefocus-615	275	35	.	.	PUNCT
finefocus-615	276	1	supplementary	supplementary	ADJ
finefocus-615	276	2	figure	figure	NOUN
finefocus-615	276	3	1	1	NUM
finefocus-615	276	4	.	.	PUNCT
finefocus-615	276	5	principal	principal	ADJ
finefocus-615	276	6	coordinate	coordinate	NOUN
finefocus-615	276	7	analysis	analysis	NOUN
finefocus-615	276	8	of	of	ADP
finefocus-615	276	9	weighted	weight	VERB
finefocus-615	276	10	unifrac	unifrac	ADJ
finefocus-615	276	11	showing	showing	NOUN
finefocus-615	276	12	clustering	clustering	NOUN
finefocus-615	276	13	based	base	VERB
finefocus-615	276	14	on	on	ADP
finefocus-615	276	15	other	other	ADJ
finefocus-615	276	16	abiotic	abiotic	ADJ
finefocus-615	276	17	factors	factor	NOUN
finefocus-615	276	18	without	without	ADP
finefocus-615	276	19	consideration	consideration	NOUN
finefocus-615	276	20	for	for	ADP
finefocus-615	276	21	rind	rind	NOUN
finefocus-615	276	22	or	or	CCONJ
finefocus-615	276	23	curd	curd	NOUN
finefocus-615	276	24	sampling	sampling	NOUN
finefocus-615	276	25	location	location	NOUN
finefocus-615	276	26	.	.	PUNCT
finefocus-615	277	1	a	a	DET
finefocus-615	277	2	)	)	PUNCT
finefocus-615	277	3	milk	milk	NOUN
finefocus-615	277	4	type	type	NOUN
finefocus-615	277	5	b	b	NOUN
finefocus-615	277	6	)	)	PUNCT
finefocus-615	277	7	moisture	moisture	NOUN
finefocus-615	277	8	and	and	CCONJ
finefocus-615	277	9	c	c	NOUN
finefocus-615	277	10	)	)	PUNCT
finefocus-615	277	11	ph	ph	PROPN
finefocus-615	277	12	.	.	PROPN
finefocus-615	277	13	values	value	NOUN
finefocus-615	277	14	range	range	VERB
finefocus-615	277	15	from	from	ADP
finefocus-615	277	16	5.04	5.04	NUM
finefocus-615	277	17	to	to	ADP
finefocus-615	277	18	8.24	8.24	NUM
finefocus-615	277	19	.	.	PUNCT
finefocus-615	278	1	pc1	pc1	PROPN
finefocus-615	278	2	(	(	PUNCT
finefocus-615	278	3	76.4	76.4	NUM
finefocus-615	278	4	%	%	NOUN
finefocus-615	278	5	)	)	PUNCT
finefocus-615	278	6	pc	pc	NOUN
finefocus-615	278	7	2	2	NUM
finefocus-615	278	8	(	(	PUNCT
finefocus-615	278	9	9	9	NUM
finefocus-615	278	10	.3	.3	NUM
finefocus-615	278	11	%	%	NOUN
finefocus-615	278	12	)	)	PUNCT
finefocus-615	278	13	a	a	X
finefocus-615	278	14	)	)	PUNCT
finefocus-615	278	15	goat	goat	PROPN
finefocus-615	278	16	milkcow	milkcow	PROPN
finefocus-615	278	17	milk	milk	NOUN
finefocus-615	278	18	sheep	sheep	PROPN
finefocus-615	278	19	milk	milk	NOUN
finefocus-615	278	20	pc1	pc1	PROPN
finefocus-615	278	21	(	(	PUNCT
finefocus-615	278	22	76.4	76.4	NUM
finefocus-615	278	23	%	%	NOUN
finefocus-615	278	24	)	)	PUNCT
finefocus-615	278	25	pc	pc	NOUN
finefocus-615	278	26	2	2	NUM
finefocus-615	278	27	(	(	PUNCT
finefocus-615	278	28	9	9	NUM
finefocus-615	278	29	.3	.3	NUM
finefocus-615	278	30	%	%	NOUN
finefocus-615	278	31	)	)	PUNCT
finefocus-615	279	1	b	b	NOUN
finefocus-615	279	2	)	)	PUNCT
finefocus-615	279	3	10	10	NUM
finefocus-615	279	4	-	-	PUNCT
finefocus-615	279	5	25%5	25%5	NUM
finefocus-615	279	6	-	-	SYM
finefocus-615	279	7	10	10	NUM
finefocus-615	279	8	%	%	NOUN
finefocus-615	279	9	25	25	NUM
finefocus-615	279	10	-	-	SYM
finefocus-615	279	11	28	28	NUM
finefocus-615	279	12	%	%	NOUN
finefocus-615	279	13	na	na	X
finefocus-615	279	14	pc1	pc1	PROPN
finefocus-615	279	15	(	(	PUNCT
finefocus-615	279	16	76.4	76.4	NUM
finefocus-615	279	17	%	%	NOUN
finefocus-615	279	18	)	)	PUNCT
finefocus-615	279	19	pc	pc	NOUN
finefocus-615	279	20	2	2	NUM
finefocus-615	279	21	(	(	PUNCT
finefocus-615	279	22	9	9	NUM
finefocus-615	279	23	.3	.3	NUM
finefocus-615	279	24	%	%	NOUN
finefocus-615	279	25	)	)	PUNCT
finefocus-615	280	1	c	c	X
finefocus-615	280	2	)	)	PUNCT
finefocus-615	280	3	ph6	ph6	NOUN
finefocus-615	280	4	-	-	PUNCT
finefocus-615	280	5	7ph	7ph	ADJ
finefocus-615	280	6	5	5	NUM
finefocus-615	280	7	-	-	SYM
finefocus-615	280	8	6	6	NUM
finefocus-615	280	9	ph7	ph7	PROPN
finefocus-615	280	10	-	-	PUNCT
finefocus-615	280	11	8	8	NUM
finefocus-615	280	12	ph	ph	NOUN
finefocus-615	280	13	>	>	SYM
finefocus-615	280	14	8	8	NUM
finefocus-615	280	15	bacterial	bacterial	ADJ
finefocus-615	280	16	community	community	NOUN
finefocus-615	280	17	structure	structure	NOUN
finefocus-615	280	18	in	in	ADP
finefocus-615	280	19	cheese	cheese	NOUN
finefocus-615	280	20	•	•	NUM
finefocus-615	280	21	21	21	NUM
finefocus-615	280	22	figure	figure	NOUN
finefocus-615	280	23	5	5	NUM
finefocus-615	280	24	.	.	PUNCT
finefocus-615	281	1	antibiotics	antibiotic	NOUN
finefocus-615	281	2	assay	assay	NOUN
finefocus-615	281	3	reveals	reveal	VERB
finefocus-615	281	4	u.s	u.s	PROPN
finefocus-615	281	5	.	.	PROPN
finefocus-615	281	6	cheese	cheese	PROPN
finefocus-615	281	7	bacterial	bacterial	ADJ
finefocus-615	281	8	isolates	isolate	NOUN
finefocus-615	281	9	constitute	constitute	VERB
finefocus-615	281	10	a	a	DET
finefocus-615	281	11	larger	large	ADJ
finefocus-615	281	12	percentage	percentage	NOUN
finefocus-615	281	13	of	of	ADP
finefocus-615	281	14	the	the	DET
finefocus-615	281	15	total	total	ADJ
finefocus-615	281	16	susceptible	susceptible	ADJ
finefocus-615	281	17	cheese	cheese	NOUN
finefocus-615	281	18	isolates	isolate	NOUN
finefocus-615	281	19	than	than	ADP
finefocus-615	281	20	european	european	ADJ
finefocus-615	281	21	cheese	cheese	NOUN
finefocus-615	281	22	bacterial	bacterial	ADJ
finefocus-615	281	23	isolates	isolate	NOUN
finefocus-615	281	24	.	.	PUNCT
finefocus-615	282	1	growth	growth	NOUN
finefocus-615	282	2	inhibition	inhibition	NOUN
finefocus-615	282	3	by	by	ADP
finefocus-615	282	4	six	six	NUM
finefocus-615	282	5	distinct	distinct	ADJ
finefocus-615	282	6	antibiotics	antibiotic	NOUN
finefocus-615	282	7	was	be	AUX
finefocus-615	282	8	tested	test	VERB
finefocus-615	282	9	among	among	ADP
finefocus-615	282	10	35	35	NUM
finefocus-615	282	11	bacterial	bacterial	ADJ
finefocus-615	282	12	isolates	isolate	NOUN
finefocus-615	282	13	sampled	sample	VERB
finefocus-615	282	14	from	from	ADP
finefocus-615	282	15	6	6	NUM
finefocus-615	282	16	cheeses	cheese	NOUN
finefocus-615	282	17	,	,	PUNCT
finefocus-615	282	18	which	which	PRON
finefocus-615	282	19	represent	represent	VERB
finefocus-615	282	20	two	two	NUM
finefocus-615	282	21	geographical	geographical	ADJ
finefocus-615	282	22	regions	region	NOUN
finefocus-615	282	23	,	,	PUNCT
finefocus-615	282	24	europe	europe	PROPN
finefocus-615	282	25	(	(	PUNCT
finefocus-615	282	26	blue	blue	ADJ
finefocus-615	282	27	)	)	PUNCT
finefocus-615	282	28	and	and	CCONJ
finefocus-615	282	29	usa	usa	PROPN
finefocus-615	282	30	(	(	PUNCT
finefocus-615	282	31	red	red	PROPN
finefocus-615	282	32	)	)	PUNCT
finefocus-615	282	33	.	.	PUNCT
finefocus-615	283	1	a	a	DET
finefocus-615	283	2	)	)	PUNCT
finefocus-615	283	3	resistant	resistant	ADJ
finefocus-615	283	4	isolates	isolate	NOUN
finefocus-615	283	5	,	,	PUNCT
finefocus-615	283	6	b	b	NOUN
finefocus-615	283	7	)	)	PUNCT
finefocus-615	283	8	intermediate	intermediate	ADJ
finefocus-615	283	9	susceptible	susceptible	ADJ
finefocus-615	283	10	isolates	isolate	NOUN
finefocus-615	283	11	and	and	CCONJ
finefocus-615	283	12	c	c	NOUN
finefocus-615	283	13	)	)	PUNCT
finefocus-615	283	14	susceptible	susceptible	ADJ
finefocus-615	283	15	isolates	isolate	NOUN
finefocus-615	283	16	.	.	PUNCT
finefocus-615	284	1	diameter	diameter	NOUN
finefocus-615	284	2	measurements	measurement	NOUN
finefocus-615	284	3	of	of	ADP
finefocus-615	284	4	the	the	DET
finefocus-615	284	5	zone	zone	NOUN
finefocus-615	284	6	of	of	ADP
finefocus-615	284	7	clearance	clearance	NOUN
finefocus-615	284	8	(	(	PUNCT
finefocus-615	284	9	in	in	ADP
finefocus-615	284	10	mm	mm	PROPN
finefocus-615	284	11	)	)	PUNCT
finefocus-615	284	12	were	be	AUX
finefocus-615	284	13	grouped	group	VERB
finefocus-615	284	14	into	into	ADP
finefocus-615	284	15	the	the	DET
finefocus-615	284	16	following	follow	VERB
finefocus-615	284	17	susceptibility	susceptibility	NOUN
finefocus-615	284	18	categories	category	NOUN
finefocus-615	284	19	:	:	PUNCT
finefocus-615	284	20	a	a	X
finefocus-615	284	21	)	)	PUNCT
finefocus-615	284	22	resistant	resistant	ADJ
finefocus-615	284	23	(	(	PUNCT
finefocus-615	284	24	13	13	NUM
finefocus-615	284	25	mm	mm	NOUN
finefocus-615	284	26	or	or	CCONJ
finefocus-615	284	27	less	less	ADJ
finefocus-615	284	28	)	)	PUNCT
finefocus-615	284	29	;	;	PUNCT
finefocus-615	284	30	b	b	X
finefocus-615	284	31	)	)	PUNCT
finefocus-615	284	32	intermediate	intermediate	ADJ
finefocus-615	284	33	susceptible	susceptible	ADJ
finefocus-615	284	34	(	(	PUNCT
finefocus-615	284	35	14	14	NUM
finefocus-615	284	36	–	–	SYM
finefocus-615	284	37	16	16	NUM
finefocus-615	284	38	mm	mm	NOUN
finefocus-615	284	39	)	)	PUNCT
finefocus-615	284	40	;	;	PUNCT
finefocus-615	284	41	and	and	CCONJ
finefocus-615	284	42	c	c	X
finefocus-615	284	43	)	)	PUNCT
finefocus-615	284	44	susceptible	susceptible	ADJ
finefocus-615	284	45	(	(	PUNCT
finefocus-615	284	46	17	17	NUM
finefocus-615	284	47	mm	mm	NOUN
finefocus-615	284	48	or	or	CCONJ
finefocus-615	284	49	more	more	ADJ
finefocus-615	284	50	)	)	PUNCT
finefocus-615	284	51	.	.	PUNCT
finefocus-615	285	1	cheeses	cheese	NOUN
finefocus-615	285	2	:	:	PUNCT
finefocus-615	286	1	[	[	X
finefocus-615	286	2	france	france	X
finefocus-615	286	3	]	]	PUNCT
finefocus-615	286	4	comte	comte	NOUN
finefocus-615	286	5	,	,	PUNCT
finefocus-615	286	6	[	[	X
finefocus-615	286	7	england	england	X
finefocus-615	286	8	]	]	X
finefocus-615	286	9	stichelton	stichelton	PROPN
finefocus-615	286	10	,	,	PUNCT
finefocus-615	286	11	[	[	X
finefocus-615	286	12	switzerland	switzerland	X
finefocus-615	286	13	]	]	X
finefocus-615	286	14	alpage	alpage	VERB
finefocus-615	286	15	gruyere	gruyere	NOUN
finefocus-615	286	16	,	,	PUNCT
finefocus-615	286	17	and	and	CCONJ
finefocus-615	286	18	[	[	X
finefocus-615	286	19	usa	usa	NOUN
finefocus-615	286	20	]	]	X
finefocus-615	286	21	sonnet	sonnet	NOUN
finefocus-615	286	22	,	,	PUNCT
finefocus-615	286	23	missouri	missouri	PROPN
finefocus-615	286	24	truckle	truckle	NOUN
finefocus-615	286	25	,	,	PUNCT
finefocus-615	286	26	and	and	CCONJ
finefocus-615	286	27	maggie	maggie	NOUN
finefocus-615	286	28	’s	’s	PART
finefocus-615	286	29	round	round	NOUN
finefocus-615	286	30	.	.	PUNCT
finefocus-615	287	1	am10	am10	PROPN
finefocus-615	287	2	=	=	SYM
finefocus-615	287	3	ampicillin	ampicillin	PROPN
finefocus-615	287	4	10	10	NUM
finefocus-615	287	5	ug	ug	ADP
finefocus-615	287	6	;	;	PUNCT
finefocus-615	287	7	p10	p10	NOUN
finefocus-615	287	8	=	=	SYM
finefocus-615	287	9	penicillin	penicillin	PROPN
finefocus-615	287	10	10	10	NUM
finefocus-615	287	11	iu	iu	NOUN
finefocus-615	287	12	/	/	SYM
finefocus-615	287	13	ie	ie	X
finefocus-615	287	14	/	/	SYM
finefocus-615	287	15	ui	ui	PROPN
finefocus-615	287	16	;	;	PUNCT
finefocus-615	287	17	e15	e15	PROPN
finefocus-615	287	18	=	=	PUNCT
finefocus-615	287	19	erythromycin	erythromycin	VERB
finefocus-615	287	20	15	15	NUM
finefocus-615	287	21	ug	ug	ADP
finefocus-615	287	22	;	;	PUNCT
finefocus-615	287	23	ra5	ra5	X
finefocus-615	287	24	=	=	PRON
finefocus-615	287	25	rifampin	rifampin	VERB
finefocus-615	287	26	5	5	NUM
finefocus-615	287	27	ug	ug	ADP
finefocus-615	287	28	;	;	PUNCT
finefocus-615	287	29	n30	n30	PROPN
finefocus-615	287	30	=	=	PUNCT
finefocus-615	287	31	neomycin	neomycin	PROPN
finefocus-615	287	32	30	30	NUM
finefocus-615	287	33	ug	ug	ADP
finefocus-615	287	34	;	;	PUNCT
finefocus-615	287	35	nb30	nb30	PROPN
finefocus-615	287	36	=	=	PRON
finefocus-615	287	37	novobiocin	novobiocin	VERB
finefocus-615	287	38	30	30	NUM
finefocus-615	287	39	ug	ug	NOUN
finefocus-615	287	40	.	.	PUNCT
finefocus-615	288	1	usa	usa	PROPN
finefocus-615	288	2	europe	europe	PROPN
finefocus-615	288	3	antibiotics	antibiotic	NOUN
finefocus-615	288	4	%	%	NOUN
finefocus-615	288	5	s	s	VERB
finefocus-615	288	6	us	us	PROPN
finefocus-615	288	7	ce	ce	PROPN
finefocus-615	288	8	pt	pt	PROPN
finefocus-615	288	9	ib	ib	PROPN
finefocus-615	288	10	ili	ili	PROPN
finefocus-615	289	1	ty	ty	INTJ
finefocus-615	289	2	is	be	AUX
finefocus-615	289	3	ol	ol	ADJ
finefocus-615	289	4	at	at	ADP
finefocus-615	289	5	es	es	X
finefocus-615	289	6	%	%	NOUN
finefocus-615	289	7	in	in	ADP
finefocus-615	289	8	te	te	PROPN
finefocus-615	289	9	rm	rm	PROPN
finefocus-615	289	10	ed	ed	PROPN
finefocus-615	289	11	ia	ia	PROPN
finefocus-615	289	12	te	te	PROPN
finefocus-615	289	13	su	su	PROPN
finefocus-615	289	14	sc	sc	PROPN
finefocus-615	290	1	ep	ep	PROPN
finefocus-615	290	2	tib	tib	PROPN
finefocus-615	290	3	ili	ili	PROPN
finefocus-615	291	1	ty	ty	INTJ
finefocus-615	291	2	is	be	AUX
finefocus-615	291	3	ol	ol	ADJ
finefocus-615	291	4	at	at	ADP
finefocus-615	291	5	es	es	ADP
finefocus-615	291	6	%	%	NOUN
finefocus-615	291	7	r	r	NOUN
finefocus-615	291	8	es	es	NOUN
finefocus-615	291	9	ist	ist	NOUN
finefocus-615	291	10	an	an	DET
finefocus-615	291	11	t	t	NOUN
finefocus-615	292	1	i	i	PRON
finefocus-615	292	2	so	so	ADV
finefocus-615	292	3	la	la	PRON
finefocus-615	292	4	te	te	PROPN
finefocus-615	292	5	s	s	PART
finefocus-615	292	6	am10	am10	PROPN
finefocus-615	292	7	am10	am10	PROPN
finefocus-615	292	8	p10	p10	NOUN
finefocus-615	292	9	p10	p10	NOUN
finefocus-615	292	10	e15	e15	PROPN
finefocus-615	292	11	e15	e15	PROPN
finefocus-615	292	12	ra5	ra5	PROPN
finefocus-615	292	13	ra5	ra5	PROPN
finefocus-615	292	14	n30	n30	PROPN
finefocus-615	292	15	n30	n30	PROPN
finefocus-615	293	1	nb30	nb30	PROPN
finefocus-615	293	2	nb30	nb30	PROPN
finefocus-615	293	3	overall	overall	ADJ
finefocus-615	293	4	overall	overall	ADJ
finefocus-615	293	5	100	100	NUM
finefocus-615	293	6	80	80	NUM
finefocus-615	293	7	60	60	NUM
finefocus-615	293	8	40	40	NUM
finefocus-615	293	9	20	20	NUM
finefocus-615	293	10	0	0	NUM
finefocus-615	293	11	100	100	NUM
finefocus-615	293	12	80	80	NUM
finefocus-615	293	13	60	60	NUM
finefocus-615	293	14	40	40	NUM
finefocus-615	293	15	20	20	NUM
finefocus-615	293	16	0	0	X
finefocus-615	293	17	am10	am10	PROPN
finefocus-615	293	18	p10	p10	NOUN
finefocus-615	293	19	e15	e15	PROPN
finefocus-615	293	20	ra5	ra5	PROPN
finefocus-615	293	21	n30	n30	PROPN
finefocus-615	294	1	nb30	nb30	PROPN
finefocus-615	294	2	overall	overall	ADJ
finefocus-615	294	3	100	100	NUM
finefocus-615	294	4	80	80	NUM
finefocus-615	294	5	60	60	NUM
finefocus-615	294	6	40	40	NUM
finefocus-615	294	7	20	20	NUM
finefocus-615	294	8	0	0	NUM
finefocus-615	294	9	a	a	DET
finefocus-615	294	10	)	)	PUNCT
finefocus-615	294	11	b	b	NOUN
finefocus-615	294	12	)	)	PUNCT
finefocus-615	294	13	c	c	NOUN
finefocus-615	294	14	)	)	PUNCT
finefocus-615	294	15	22	22	NUM
finefocus-615	294	16	•	•	NUM
finefocus-615	294	17	fine	fine	ADJ
finefocus-615	294	18	focus	focus	NOUN
finefocus-615	294	19	,	,	PUNCT
finefocus-615	294	20	vol	vol	NOUN
finefocus-615	294	21	.	.	NOUN
finefocus-615	294	22	3	3	NUM
finefocus-615	294	23	(	(	PUNCT
finefocus-615	294	24	1	1	NUM
finefocus-615	294	25	)	)	PUNCT
finefocus-615	294	26	supplementary	supplementary	ADJ
finefocus-615	294	27	figure	figure	NOUN
finefocus-615	294	28	2	2	NUM
finefocus-615	294	29	.	.	PUNCT
finefocus-615	295	1	antibiotic	antibiotic	ADJ
finefocus-615	295	2	assay	assay	NOUN
finefocus-615	295	3	shows	show	VERB
finefocus-615	295	4	a	a	DET
finefocus-615	295	5	higher	high	ADJ
finefocus-615	295	6	percentage	percentage	NOUN
finefocus-615	295	7	of	of	ADP
finefocus-615	295	8	european	european	ADJ
finefocus-615	295	9	cheese	cheese	NOUN
finefocus-615	295	10	bacterial	bacterial	ADJ
finefocus-615	295	11	isolates	isolate	NOUN
finefocus-615	295	12	that	that	PRON
finefocus-615	295	13	are	be	AUX
finefocus-615	295	14	resistant	resistant	ADJ
finefocus-615	295	15	to	to	ADP
finefocus-615	295	16	the	the	DET
finefocus-615	295	17	antibiotics	antibiotic	NOUN
finefocus-615	295	18	tested	test	VERB
finefocus-615	295	19	than	than	ADP
finefocus-615	295	20	u.s	u.s	PROPN
finefocus-615	295	21	.	.	PROPN
finefocus-615	295	22	cheese	cheese	NOUN
finefocus-615	295	23	bacterial	bacterial	ADJ
finefocus-615	295	24	isolates	isolate	NOUN
finefocus-615	295	25	.	.	PUNCT
finefocus-615	296	1	susceptibility	susceptibility	NOUN
finefocus-615	296	2	level	level	NOUN
finefocus-615	296	3	to	to	ADP
finefocus-615	296	4	six	six	NUM
finefocus-615	296	5	distinct	distinct	ADJ
finefocus-615	296	6	antibiotics	antibiotic	NOUN
finefocus-615	296	7	was	be	AUX
finefocus-615	296	8	tested	test	VERB
finefocus-615	296	9	among	among	ADP
finefocus-615	296	10	35	35	NUM
finefocus-615	296	11	bacterial	bacterial	ADJ
finefocus-615	296	12	isolates	isolate	NOUN
finefocus-615	296	13	sampled	sample	VERB
finefocus-615	296	14	from	from	ADP
finefocus-615	296	15	6	6	NUM
finefocus-615	296	16	cheeses	cheese	NOUN
finefocus-615	296	17	,	,	PUNCT
finefocus-615	296	18	which	which	PRON
finefocus-615	296	19	represent	represent	VERB
finefocus-615	296	20	two	two	NUM
finefocus-615	296	21	geographical	geographical	ADJ
finefocus-615	296	22	regions	region	NOUN
finefocus-615	296	23	,	,	PUNCT
finefocus-615	296	24	europe	europe	PROPN
finefocus-615	296	25	:	:	PUNCT
finefocus-615	296	26	france	france	PROPN
finefocus-615	296	27	(	(	PUNCT
finefocus-615	296	28	comte	comte	NOUN
finefocus-615	296	29	n=3	n=3	PUNCT
finefocus-615	296	30	isolates	isolate	NOUN
finefocus-615	296	31	)	)	PUNCT
finefocus-615	296	32	,	,	PUNCT
finefocus-615	296	33	england	england	PROPN
finefocus-615	296	34	(	(	PUNCT
finefocus-615	296	35	stichelton	stichelton	VERB
finefocus-615	296	36	n=6	n=6	NOUN
finefocus-615	296	37	isolates	isolate	NOUN
finefocus-615	296	38	)	)	PUNCT
finefocus-615	296	39	,	,	PUNCT
finefocus-615	296	40	switzerland	switzerland	PROPN
finefocus-615	296	41	(	(	PUNCT
finefocus-615	296	42	alpage	alpage	VERB
finefocus-615	296	43	gruyere	gruyere	NOUN
finefocus-615	296	44	n=6	n=6	NOUN
finefocus-615	296	45	isolates	isolate	NOUN
finefocus-615	296	46	)	)	PUNCT
finefocus-615	296	47	,	,	PUNCT
finefocus-615	296	48	and	and	CCONJ
finefocus-615	296	49	usa	usa	PROPN
finefocus-615	296	50	:	:	PUNCT
finefocus-615	296	51	(	(	PUNCT
finefocus-615	296	52	sonnet	sonnet	NOUN
finefocus-615	296	53	n=6	n=6	NOUN
finefocus-615	296	54	isolates	isolate	NOUN
finefocus-615	296	55	,	,	PUNCT
finefocus-615	296	56	missouri	missouri	PROPN
finefocus-615	296	57	truckle	truckle	PROPN
finefocus-615	296	58	n=6	n=6	PROPN
finefocus-615	296	59	isolates	isolate	NOUN
finefocus-615	296	60	,	,	PUNCT
finefocus-615	296	61	and	and	CCONJ
finefocus-615	296	62	maggie	maggie	PROPN
finefocus-615	296	63	’s	’s	PART
finefocus-615	296	64	round	round	NOUN
finefocus-615	296	65	n=8	n=8	ADP
finefocus-615	296	66	isolates	isolate	NOUN
finefocus-615	296	67	)	)	PUNCT
finefocus-615	296	68	.	.	PUNCT
finefocus-615	297	1	diameter	diameter	NOUN
finefocus-615	297	2	measurements	measurement	NOUN
finefocus-615	297	3	of	of	ADP
finefocus-615	297	4	the	the	DET
finefocus-615	297	5	zone	zone	NOUN
finefocus-615	297	6	of	of	ADP
finefocus-615	297	7	clearance	clearance	NOUN
finefocus-615	297	8	(	(	PUNCT
finefocus-615	297	9	in	in	ADP
finefocus-615	297	10	mm	mm	PROPN
finefocus-615	297	11	)	)	PUNCT
finefocus-615	297	12	were	be	AUX
finefocus-615	297	13	grouped	group	VERB
finefocus-615	297	14	into	into	ADP
finefocus-615	297	15	the	the	DET
finefocus-615	297	16	following	follow	VERB
finefocus-615	297	17	susceptibility	susceptibility	NOUN
finefocus-615	297	18	categories	category	NOUN
finefocus-615	297	19	:	:	PUNCT
finefocus-615	297	20	a	a	X
finefocus-615	297	21	)	)	PUNCT
finefocus-615	297	22	resistant	resistant	ADJ
finefocus-615	297	23	(	(	PUNCT
finefocus-615	297	24	13	13	NUM
finefocus-615	297	25	mm	mm	NOUN
finefocus-615	297	26	or	or	CCONJ
finefocus-615	297	27	less	less	ADJ
finefocus-615	297	28	)	)	PUNCT
finefocus-615	297	29	;	;	PUNCT
finefocus-615	297	30	b	b	X
finefocus-615	297	31	)	)	PUNCT
finefocus-615	297	32	intermediate	intermediate	ADJ
finefocus-615	297	33	susceptible	susceptible	ADJ
finefocus-615	297	34	(	(	PUNCT
finefocus-615	297	35	14	14	NUM
finefocus-615	297	36	–	–	SYM
finefocus-615	297	37	16	16	NUM
finefocus-615	297	38	mm	mm	NOUN
finefocus-615	297	39	)	)	PUNCT
finefocus-615	297	40	;	;	PUNCT
finefocus-615	297	41	and	and	CCONJ
finefocus-615	297	42	c	c	X
finefocus-615	297	43	)	)	PUNCT
finefocus-615	297	44	susceptible	susceptible	ADJ
finefocus-615	297	45	(	(	PUNCT
finefocus-615	297	46	17	17	NUM
finefocus-615	297	47	mm	mm	NOUN
finefocus-615	297	48	or	or	CCONJ
finefocus-615	297	49	more	more	ADJ
finefocus-615	297	50	)	)	PUNCT
finefocus-615	297	51	.	.	PUNCT
finefocus-615	298	1	percentages	percentage	NOUN
finefocus-615	298	2	of	of	ADP
finefocus-615	298	3	isolates	isolate	NOUN
finefocus-615	298	4	belonging	belong	VERB
finefocus-615	298	5	to	to	ADP
finefocus-615	298	6	one	one	NUM
finefocus-615	298	7	of	of	ADP
finefocus-615	298	8	the	the	DET
finefocus-615	298	9	three	three	NUM
finefocus-615	298	10	susceptibility	susceptibility	NOUN
finefocus-615	298	11	levels	level	NOUN
finefocus-615	298	12	against	against	ADP
finefocus-615	298	13	each	each	PRON
finefocus-615	298	14	of	of	ADP
finefocus-615	298	15	the	the	DET
finefocus-615	298	16	six	six	NUM
finefocus-615	298	17	antibiotics	antibiotic	NOUN
finefocus-615	298	18	examined	examine	VERB
finefocus-615	298	19	were	be	AUX
finefocus-615	298	20	plotted	plot	VERB
finefocus-615	298	21	for	for	ADP
finefocus-615	298	22	all	all	DET
finefocus-615	298	23	six	six	NUM
finefocus-615	298	24	cheese	cheese	NOUN
finefocus-615	298	25	types	type	NOUN
finefocus-615	298	26	.	.	PUNCT
finefocus-615	299	1	am10	am10	PROPN
finefocus-615	299	2	(	(	PUNCT
finefocus-615	299	3	blue	blue	ADJ
finefocus-615	299	4	)	)	PUNCT
finefocus-615	299	5	=	=	SYM
finefocus-615	299	6	ampicillin	ampicillin	NOUN
finefocus-615	299	7	10	10	NUM
finefocus-615	299	8	ug	ug	ADP
finefocus-615	299	9	;	;	PUNCT
finefocus-615	299	10	p10	p10	NOUN
finefocus-615	299	11	(	(	PUNCT
finefocus-615	299	12	red	red	ADJ
finefocus-615	299	13	)	)	PUNCT
finefocus-615	299	14	=	=	SYM
finefocus-615	299	15	penicillin	penicillin	NOUN
finefocus-615	299	16	10	10	NUM
finefocus-615	299	17	iu	iu	NOUN
finefocus-615	299	18	/	/	SYM
finefocus-615	299	19	ie	ie	X
finefocus-615	299	20	/	/	SYM
finefocus-615	299	21	ui	ui	PROPN
finefocus-615	299	22	;	;	PUNCT
finefocus-615	299	23	e15	e15	PROPN
finefocus-615	299	24	(	(	PUNCT
finefocus-615	299	25	green	green	NOUN
finefocus-615	299	26	)	)	PUNCT
finefocus-615	299	27	=	=	PRON
finefocus-615	299	28	erythromycin	erythromycin	VERB
finefocus-615	299	29	15	15	NUM
finefocus-615	299	30	ug	ug	ADP
finefocus-615	299	31	;	;	PUNCT
finefocus-615	299	32	ra5	ra5	PROPN
finefocus-615	299	33	(	(	PUNCT
finefocus-615	299	34	purple	purple	ADJ
finefocus-615	299	35	)	)	PUNCT
finefocus-615	299	36	=	=	SYM
finefocus-615	300	1	rifampin	rifampin	VERB
finefocus-615	300	2	5	5	NUM
finefocus-615	300	3	ug	ug	ADP
finefocus-615	300	4	;	;	PUNCT
finefocus-615	300	5	n30	n30	PROPN
finefocus-615	300	6	(	(	PUNCT
finefocus-615	300	7	cyan	cyan	PROPN
finefocus-615	300	8	)	)	PUNCT
finefocus-615	300	9	=	=	PUNCT
finefocus-615	301	1	neomycin	neomycin	NOUN
finefocus-615	301	2	30	30	NUM
finefocus-615	301	3	ug	ug	ADP
finefocus-615	301	4	;	;	PUNCT
finefocus-615	301	5	nb30	nb30	PROPN
finefocus-615	301	6	(	(	PUNCT
finefocus-615	301	7	orange	orange	PROPN
finefocus-615	301	8	)	)	PUNCT
finefocus-615	301	9	=	=	PRON
finefocus-615	301	10	novobiocin	novobiocin	VERB
finefocus-615	301	11	30	30	NUM
finefocus-615	301	12	ug	ug	NOUN
finefocus-615	301	13	.	.	PUNCT
finefocus-615	302	1	a	a	PRON
finefocus-615	302	2	)	)	PUNCT
finefocus-615	302	3	0	0	NUM
finefocus-615	302	4	20	20	NUM
finefocus-615	302	5	40	40	NUM
finefocus-615	302	6	60	60	NUM
finefocus-615	302	7	80	80	NUM
finefocus-615	302	8	100	100	NUM
finefocus-615	302	9	comte	comte	NOUN
finefocus-615	302	10	(	(	PUNCT
finefocus-615	302	11	france	france	PROPN
finefocus-615	302	12	)	)	PUNCT
finefocus-615	302	13	stichelton	stichelton	PROPN
finefocus-615	302	14	(	(	PUNCT
finefocus-615	302	15	england	england	PROPN
finefocus-615	302	16	)	)	PUNCT
finefocus-615	302	17	alpage	alpage	VERB
finefocus-615	302	18	gruyere	gruyere	NOUN
finefocus-615	302	19	(	(	PUNCT
finefocus-615	302	20	switzerland	switzerland	PROPN
finefocus-615	302	21	)	)	PUNCT
finefocus-615	302	22	maggie	maggie	PROPN
finefocus-615	302	23	’s	’s	PART
finefocus-615	302	24	round	round	NOUN
finefocus-615	302	25	(	(	PUNCT
finefocus-615	302	26	us	us	PROPN
finefocus-615	302	27	)	)	PUNCT
finefocus-615	302	28	missouri	missouri	PROPN
finefocus-615	302	29	truckle	truckle	NOUN
finefocus-615	302	30	(	(	PUNCT
finefocus-615	302	31	us	us	PROPN
finefocus-615	302	32	)	)	PUNCT
finefocus-615	302	33	sonnet	sonnet	NOUN
finefocus-615	302	34	(	(	PUNCT
finefocus-615	302	35	us	us	PROPN
finefocus-615	302	36	)	)	PUNCT
finefocus-615	302	37	b	b	NOUN
finefocus-615	302	38	)	)	PUNCT
finefocus-615	302	39	0	0	NUM
finefocus-615	302	40	20	20	NUM
finefocus-615	302	41	40	40	NUM
finefocus-615	302	42	60	60	NUM
finefocus-615	302	43	80	80	NUM
finefocus-615	302	44	100	100	NUM
finefocus-615	302	45	comte	comte	NOUN
finefocus-615	302	46	(	(	PUNCT
finefocus-615	302	47	france	france	PROPN
finefocus-615	302	48	)	)	PUNCT
finefocus-615	302	49	stichelton	stichelton	PROPN
finefocus-615	302	50	(	(	PUNCT
finefocus-615	302	51	england	england	PROPN
finefocus-615	302	52	)	)	PUNCT
finefocus-615	302	53	alpage	alpage	VERB
finefocus-615	302	54	gruyere	gruyere	NOUN
finefocus-615	302	55	(	(	PUNCT
finefocus-615	302	56	switzerland	switzerland	PROPN
finefocus-615	302	57	)	)	PUNCT
finefocus-615	302	58	maggie	maggie	PROPN
finefocus-615	302	59	’s	’s	PART
finefocus-615	302	60	round	round	NOUN
finefocus-615	302	61	(	(	PUNCT
finefocus-615	302	62	us	us	PROPN
finefocus-615	302	63	)	)	PUNCT
finefocus-615	302	64	missouri	missouri	PROPN
finefocus-615	302	65	truckle	truckle	NOUN
finefocus-615	302	66	(	(	PUNCT
finefocus-615	302	67	us	us	PROPN
finefocus-615	302	68	)	)	PUNCT
finefocus-615	302	69	sonnet	sonnet	NOUN
finefocus-615	302	70	(	(	PUNCT
finefocus-615	302	71	us	us	PROPN
finefocus-615	302	72	)	)	PUNCT
finefocus-615	302	73	c	c	NOUN
finefocus-615	302	74	)	)	PUNCT
finefocus-615	302	75	0	0	NUM
finefocus-615	302	76	20	20	NUM
finefocus-615	302	77	40	40	NUM
finefocus-615	302	78	60	60	NUM
finefocus-615	302	79	80	80	NUM
finefocus-615	302	80	100	100	NUM
finefocus-615	302	81	comte	comte	NOUN
finefocus-615	302	82	(	(	PUNCT
finefocus-615	302	83	france	france	PROPN
finefocus-615	302	84	)	)	PUNCT
finefocus-615	302	85	stichelton	stichelton	PROPN
finefocus-615	302	86	(	(	PUNCT
finefocus-615	302	87	england	england	PROPN
finefocus-615	302	88	)	)	PUNCT
finefocus-615	302	89	alpage	alpage	VERB
finefocus-615	302	90	gruyere	gruyere	NOUN
finefocus-615	302	91	(	(	PUNCT
finefocus-615	302	92	switzerland	switzerland	PROPN
finefocus-615	302	93	)	)	PUNCT
finefocus-615	302	94	maggie	maggie	PROPN
finefocus-615	302	95	’s	’s	PART
finefocus-615	302	96	round	round	NOUN
finefocus-615	302	97	(	(	PUNCT
finefocus-615	302	98	us	us	PROPN
finefocus-615	302	99	)	)	PUNCT
finefocus-615	302	100	missouri	missouri	PROPN
finefocus-615	302	101	truckle	truckle	NOUN
finefocus-615	302	102	(	(	PUNCT
finefocus-615	302	103	us	us	PROPN
finefocus-615	302	104	)	)	PUNCT
finefocus-615	302	105	sonnet	sonnet	NOUN
finefocus-615	302	106	(	(	PUNCT
finefocus-615	302	107	us	us	PROPN
finefocus-615	302	108	)	)	PUNCT
finefocus-615	302	109	am	be	AUX
finefocus-615	302	110	10	10	NUM
finefocus-615	302	111	p	p	NOUN
finefocus-615	302	112	10	10	NUM
finefocus-615	302	113	e	e	SYM
finefocus-615	302	114	15	15	NUM
finefocus-615	302	115	ra	ra	NOUN
finefocus-615	302	116	5	5	NUM
finefocus-615	302	117	n	n	NUM
finefocus-615	302	118	30	30	NUM
finefocus-615	302	119	nb	nb	NOUN
finefocus-615	302	120	30	30	NUM
finefocus-615	302	121	bacterial	bacterial	ADJ
finefocus-615	302	122	community	community	NOUN
finefocus-615	302	123	structure	structure	NOUN
finefocus-615	302	124	in	in	ADP
finefocus-615	302	125	cheese	cheese	NOUN
finefocus-615	303	1	•	•	NUM
finefocus-615	303	2	23	23	NUM
finefocus-615	303	3	community	community	NOUN
finefocus-615	303	4	level	level	NOUN
finefocus-615	303	5	physiological	physiological	ADJ
finefocus-615	303	6	profiling	profiling	NOUN
finefocus-615	303	7	(	(	PUNCT
finefocus-615	303	8	clpp	clpp	NOUN
finefocus-615	303	9	)	)	PUNCT
finefocus-615	303	10	on	on	ADP
finefocus-615	303	11	both	both	CCONJ
finefocus-615	303	12	cheese	cheese	NOUN
finefocus-615	303	13	community	community	NOUN
finefocus-615	303	14	samples	sample	NOUN
finefocus-615	303	15	and	and	CCONJ
finefocus-615	303	16	cultured	cultured	ADJ
finefocus-615	303	17	isolates	isolate	NOUN
finefocus-615	303	18	was	be	AUX
finefocus-615	303	19	performed	perform	VERB
finefocus-615	303	20	to	to	PART
finefocus-615	303	21	examine	examine	VERB
finefocus-615	303	22	their	their	PRON
finefocus-615	303	23	metabolic	metabolic	NOUN
finefocus-615	303	24	potential	potential	NOUN
finefocus-615	303	25	and	and	CCONJ
finefocus-615	303	26	diversity	diversity	NOUN
finefocus-615	303	27	through	through	ADP
finefocus-615	303	28	their	their	PRON
finefocus-615	303	29	utilization	utilization	NOUN
finefocus-615	303	30	of	of	ADP
finefocus-615	303	31	31	31	NUM
finefocus-615	303	32	distinct	distinct	ADJ
finefocus-615	303	33	carbon	carbon	NOUN
finefocus-615	303	34	sources	source	NOUN
finefocus-615	303	35	(	(	PUNCT
finefocus-615	303	36	46	46	NUM
finefocus-615	303	37	)	)	PUNCT
finefocus-615	303	38	(	(	PUNCT
finefocus-615	303	39	supplementary	supplementary	ADJ
finefocus-615	303	40	table	table	NOUN
finefocus-615	303	41	2	2	NUM
finefocus-615	303	42	)	)	PUNCT
finefocus-615	303	43	.	.	PUNCT
finefocus-615	304	1	we	we	PRON
finefocus-615	304	2	expected	expect	VERB
finefocus-615	304	3	that	that	SCONJ
finefocus-615	304	4	1	1	X
finefocus-615	304	5	)	)	PUNCT
finefocus-615	304	6	cheeses	cheese	NOUN
finefocus-615	304	7	with	with	ADP
finefocus-615	304	8	greater	great	ADJ
finefocus-615	304	9	taxonomical	taxonomical	ADJ
finefocus-615	304	10	diversity	diversity	NOUN
finefocus-615	304	11	would	would	AUX
finefocus-615	304	12	also	also	ADV
finefocus-615	304	13	have	have	VERB
finefocus-615	304	14	community	community	NOUN
finefocus-615	304	15	samples	sample	NOUN
finefocus-615	304	16	that	that	PRON
finefocus-615	304	17	are	be	AUX
finefocus-615	304	18	more	more	ADV
finefocus-615	304	19	metabolically	metabolically	ADV
finefocus-615	304	20	active	active	ADJ
finefocus-615	304	21	,	,	PUNCT
finefocus-615	304	22	with	with	ADP
finefocus-615	304	23	higher	high	ADJ
finefocus-615	304	24	numbers	number	NOUN
finefocus-615	304	25	of	of	ADP
finefocus-615	304	26	utilized	utilize	VERB
finefocus-615	304	27	carbon	carbon	NOUN
finefocus-615	304	28	sources	source	NOUN
finefocus-615	304	29	,	,	PUNCT
finefocus-615	304	30	than	than	ADP
finefocus-615	304	31	their	their	PRON
finefocus-615	304	32	counterparts	counterpart	NOUN
finefocus-615	304	33	;	;	PUNCT
finefocus-615	304	34	and	and	CCONJ
finefocus-615	304	35	2	2	X
finefocus-615	304	36	)	)	PUNCT
finefocus-615	304	37	cheese	cheese	NOUN
finefocus-615	304	38	community	community	NOUN
finefocus-615	304	39	samples	sample	NOUN
finefocus-615	304	40	would	would	AUX
finefocus-615	304	41	be	be	AUX
finefocus-615	304	42	able	able	ADJ
finefocus-615	304	43	to	to	PART
finefocus-615	304	44	utilize	utilize	VERB
finefocus-615	304	45	higher	high	ADJ
finefocus-615	304	46	numbers	number	NOUN
finefocus-615	304	47	of	of	ADP
finefocus-615	304	48	carbon	carbon	NOUN
finefocus-615	304	49	sources	source	NOUN
finefocus-615	304	50	than	than	ADP
finefocus-615	304	51	their	their	PRON
finefocus-615	304	52	respective	respective	ADJ
finefocus-615	304	53	individual	individual	ADJ
finefocus-615	304	54	isolates	isolate	NOUN
finefocus-615	304	55	within	within	ADP
finefocus-615	304	56	the	the	DET
finefocus-615	304	57	same	same	ADJ
finefocus-615	304	58	cheese	cheese	NOUN
finefocus-615	304	59	.	.	PUNCT
finefocus-615	305	1	metabolic	metabolic	NOUN
finefocus-615	305	2	diversity	diversity	NOUN
finefocus-615	305	3	(	(	PUNCT
finefocus-615	305	4	cmd	cmd	NOUN
finefocus-615	305	5	)	)	PUNCT
finefocus-615	305	6	,	,	PUNCT
finefocus-615	305	7	defined	define	VERB
finefocus-615	305	8	as	as	ADP
finefocus-615	305	9	the	the	DET
finefocus-615	305	10	number	number	NOUN
finefocus-615	305	11	of	of	ADP
finefocus-615	305	12	carbon	carbon	NOUN
finefocus-615	305	13	sources	source	NOUN
finefocus-615	305	14	utilized	utilize	VERB
finefocus-615	305	15	by	by	ADP
finefocus-615	305	16	the	the	DET
finefocus-615	305	17	sample	sample	NOUN
finefocus-615	305	18	,	,	PUNCT
finefocus-615	305	19	increased	increase	VERB
finefocus-615	305	20	for	for	ADP
finefocus-615	305	21	all	all	DET
finefocus-615	305	22	isolates	isolate	NOUN
finefocus-615	305	23	and	and	CCONJ
finefocus-615	305	24	for	for	ADP
finefocus-615	305	25	whole	whole	ADJ
finefocus-615	305	26	cheese	cheese	NOUN
finefocus-615	305	27	communities	community	NOUN
finefocus-615	305	28	over	over	ADP
finefocus-615	305	29	time	time	NOUN
finefocus-615	305	30	(	(	PUNCT
finefocus-615	305	31	figure	figure	NOUN
finefocus-615	305	32	6	6	NUM
finefocus-615	305	33	;	;	PUNCT
finefocus-615	305	34	supplementary	supplementary	ADJ
finefocus-615	305	35	figure	figure	NOUN
finefocus-615	305	36	3	3	NUM
finefocus-615	305	37	)	)	PUNCT
finefocus-615	305	38	.	.	PUNCT
finefocus-615	306	1	alpage	alpage	VERB
finefocus-615	306	2	gruyere	gruyere	NOUN
finefocus-615	306	3	community	community	NOUN
finefocus-615	306	4	sample	sample	NOUN
finefocus-615	306	5	was	be	AUX
finefocus-615	306	6	found	find	VERB
finefocus-615	306	7	to	to	PART
finefocus-615	306	8	be	be	AUX
finefocus-615	306	9	the	the	DET
finefocus-615	306	10	most	most	ADV
finefocus-615	306	11	metabolically	metabolically	ADV
finefocus-615	306	12	active	active	ADJ
finefocus-615	306	13	,	,	PUNCT
finefocus-615	306	14	with	with	ADP
finefocus-615	306	15	the	the	DET
finefocus-615	306	16	highest	high	ADJ
finefocus-615	306	17	number	number	NOUN
finefocus-615	306	18	of	of	ADP
finefocus-615	306	19	utilized	utilize	VERB
finefocus-615	306	20	carbon	carbon	NOUN
finefocus-615	306	21	sources	source	NOUN
finefocus-615	306	22	(	(	PUNCT
finefocus-615	306	23	23	23	NUM
finefocus-615	306	24	carbon	carbon	NOUN
finefocus-615	306	25	sources	source	NOUN
finefocus-615	306	26	)	)	PUNCT
finefocus-615	306	27	(	(	PUNCT
finefocus-615	306	28	supplementary	supplementary	ADJ
finefocus-615	306	29	table	table	NOUN
finefocus-615	306	30	2	2	NUM
finefocus-615	306	31	)	)	PUNCT
finefocus-615	306	32	.	.	PUNCT
finefocus-615	307	1	consistent	consistent	ADJ
finefocus-615	307	2	with	with	ADP
finefocus-615	307	3	our	our	PRON
finefocus-615	307	4	first	first	ADJ
finefocus-615	307	5	hypothesis	hypothesis	NOUN
finefocus-615	307	6	,	,	PUNCT
finefocus-615	307	7	alpage	alpage	VERB
finefocus-615	307	8	gruyere	gruyere	NOUN
finefocus-615	307	9	rind	rind	NOUN
finefocus-615	307	10	was	be	AUX
finefocus-615	307	11	also	also	ADV
finefocus-615	307	12	the	the	DET
finefocus-615	307	13	most	most	ADV
finefocus-615	307	14	taxonomically	taxonomically	ADV
finefocus-615	307	15	diverse	diverse	ADJ
finefocus-615	307	16	out	out	ADP
finefocus-615	307	17	of	of	ADP
finefocus-615	307	18	all	all	DET
finefocus-615	307	19	the	the	DET
finefocus-615	307	20	examined	examine	VERB
finefocus-615	307	21	rind	rind	NOUN
finefocus-615	307	22	communities	community	NOUN
finefocus-615	307	23	,	,	PUNCT
finefocus-615	307	24	containing	contain	VERB
finefocus-615	307	25	the	the	DET
finefocus-615	307	26	most	most	ADV
finefocus-615	307	27	observed	observed	ADJ
finefocus-615	307	28	otus	otus	NOUN
finefocus-615	307	29	(	(	PUNCT
finefocus-615	307	30	figure	figure	NOUN
finefocus-615	307	31	2b	2b	NOUN
finefocus-615	307	32	)	)	PUNCT
finefocus-615	307	33	.	.	PUNCT
finefocus-615	308	1	however	however	ADV
finefocus-615	308	2	,	,	PUNCT
finefocus-615	308	3	the	the	DET
finefocus-615	308	4	second	second	ADJ
finefocus-615	308	5	and	and	CCONJ
finefocus-615	308	6	third	third	ADV
finefocus-615	308	7	most	most	ADV
finefocus-615	308	8	metabolically	metabolically	ADV
finefocus-615	308	9	active	active	ADJ
finefocus-615	308	10	cheese	cheese	NOUN
finefocus-615	308	11	community	community	NOUN
finefocus-615	308	12	samples	sample	NOUN
finefocus-615	308	13	,	,	PUNCT
finefocus-615	308	14	missouri	missouri	PROPN
finefocus-615	308	15	truckle	truckle	NOUN
finefocus-615	308	16	(	(	PUNCT
finefocus-615	308	17	21	21	NUM
finefocus-615	308	18	utilized	utilize	VERB
finefocus-615	308	19	carbon	carbon	NOUN
finefocus-615	308	20	sources	source	NOUN
finefocus-615	308	21	)	)	PUNCT
finefocus-615	308	22	and	and	CCONJ
finefocus-615	308	23	maggie	maggie	PROPN
finefocus-615	308	24	’s	’s	PART
finefocus-615	308	25	round	round	NOUN
finefocus-615	308	26	(	(	PUNCT
finefocus-615	308	27	19	19	NUM
finefocus-615	308	28	utilized	utilize	VERB
finefocus-615	308	29	carbon	carbon	NOUN
finefocus-615	308	30	sources	source	NOUN
finefocus-615	308	31	)	)	PUNCT
finefocus-615	308	32	,	,	PUNCT
finefocus-615	308	33	respectively	respectively	ADV
finefocus-615	308	34	,	,	PUNCT
finefocus-615	308	35	contained	contain	VERB
finefocus-615	308	36	the	the	DET
finefocus-615	308	37	least	least	ADJ
finefocus-615	308	38	numbers	number	NOUN
finefocus-615	308	39	of	of	ADP
finefocus-615	308	40	otus	otus	NOUN
finefocus-615	308	41	in	in	ADP
finefocus-615	308	42	their	their	PRON
finefocus-615	308	43	curd	curd	NOUN
finefocus-615	308	44	samples	sample	NOUN
finefocus-615	308	45	(	(	PUNCT
finefocus-615	308	46	supplementary	supplementary	ADJ
finefocus-615	308	47	table	table	NOUN
finefocus-615	308	48	2	2	NUM
finefocus-615	308	49	and	and	CCONJ
finefocus-615	308	50	figure	figure	NOUN
finefocus-615	308	51	2a	2a	NUM
finefocus-615	308	52	)	)	PUNCT
finefocus-615	308	53	.	.	PUNCT
finefocus-615	309	1	this	this	DET
finefocus-615	309	2	inconsistency	inconsistency	NOUN
finefocus-615	309	3	may	may	AUX
finefocus-615	309	4	be	be	AUX
finefocus-615	309	5	attributed	attribute	VERB
finefocus-615	309	6	to	to	ADP
finefocus-615	309	7	the	the	DET
finefocus-615	309	8	overall	overall	ADJ
finefocus-615	309	9	lower	low	ADJ
finefocus-615	309	10	taxonomical	taxonomical	ADJ
finefocus-615	309	11	diversity	diversity	NOUN
finefocus-615	309	12	in	in	ADP
finefocus-615	309	13	the	the	DET
finefocus-615	309	14	curd	curd	NOUN
finefocus-615	309	15	communities	community	NOUN
finefocus-615	309	16	and	and	CCONJ
finefocus-615	309	17	that	that	SCONJ
finefocus-615	309	18	the	the	DET
finefocus-615	309	19	community	community	NOUN
finefocus-615	309	20	samples	sample	NOUN
finefocus-615	309	21	collected	collect	VERB
finefocus-615	309	22	for	for	ADP
finefocus-615	309	23	metabolic	metabolic	NOUN
finefocus-615	309	24	analysis	analysis	NOUN
finefocus-615	309	25	were	be	AUX
finefocus-615	309	26	mainly	mainly	ADV
finefocus-615	309	27	derived	derive	VERB
finefocus-615	309	28	from	from	ADP
finefocus-615	309	29	cheese	cheese	NOUN
finefocus-615	309	30	rinds	rind	NOUN
finefocus-615	309	31	,	,	PUNCT
finefocus-615	309	32	contributing	contribute	VERB
finefocus-615	309	33	higher	high	ADJ
finefocus-615	309	34	diversity	diversity	NOUN
finefocus-615	309	35	.	.	PUNCT
finefocus-615	310	1	in	in	ADP
finefocus-615	310	2	addition	addition	NOUN
finefocus-615	310	3	,	,	PUNCT
finefocus-615	310	4	with	with	ADP
finefocus-615	310	5	the	the	DET
finefocus-615	310	6	exception	exception	NOUN
finefocus-615	310	7	of	of	ADP
finefocus-615	310	8	the	the	DET
finefocus-615	310	9	stichelton	stichelton	NOUN
finefocus-615	310	10	cheese	cheese	NOUN
finefocus-615	310	11	,	,	PUNCT
finefocus-615	310	12	cheese	cheese	NOUN
finefocus-615	310	13	microbial	microbial	ADJ
finefocus-615	310	14	community	community	NOUN
finefocus-615	310	15	samples	sample	NOUN
finefocus-615	310	16	utilized	utilize	VERB
finefocus-615	310	17	more	more	ADJ
finefocus-615	310	18	carbon	carbon	NOUN
finefocus-615	310	19	sources	source	NOUN
finefocus-615	310	20	than	than	ADP
finefocus-615	310	21	their	their	PRON
finefocus-615	310	22	respective	respective	ADJ
finefocus-615	310	23	individual	individual	ADJ
finefocus-615	310	24	isolates	isolate	NOUN
finefocus-615	310	25	at	at	ADP
finefocus-615	310	26	the	the	DET
finefocus-615	310	27	end	end	NOUN
finefocus-615	310	28	of	of	ADP
finefocus-615	310	29	the	the	DET
finefocus-615	310	30	7	7	NUM
finefocus-615	310	31	-	-	PUNCT
finefocus-615	310	32	day	day	NOUN
finefocus-615	310	33	sampling	sampling	NOUN
finefocus-615	310	34	period	period	NOUN
finefocus-615	310	35	,	,	PUNCT
finefocus-615	310	36	partially	partially	ADV
finefocus-615	310	37	confirming	confirm	VERB
finefocus-615	310	38	our	our	PRON
finefocus-615	310	39	expectation	expectation	NOUN
finefocus-615	310	40	that	that	SCONJ
finefocus-615	310	41	,	,	PUNCT
finefocus-615	310	42	in	in	ADP
finefocus-615	310	43	general	general	ADJ
finefocus-615	310	44	,	,	PUNCT
finefocus-615	310	45	community	community	NOUN
finefocus-615	310	46	samples	sample	NOUN
finefocus-615	310	47	are	be	AUX
finefocus-615	310	48	more	more	ADV
finefocus-615	310	49	metabolically	metabolically	ADV
finefocus-615	310	50	active	active	ADJ
finefocus-615	310	51	compared	compare	VERB
finefocus-615	310	52	to	to	ADP
finefocus-615	310	53	their	their	PRON
finefocus-615	310	54	respective	respective	ADJ
finefocus-615	310	55	isolates	isolate	NOUN
finefocus-615	310	56	(	(	PUNCT
finefocus-615	310	57	supplementary	supplementary	ADJ
finefocus-615	310	58	figure	figure	NOUN
finefocus-615	310	59	3	3	NUM
finefocus-615	310	60	)	)	PUNCT
finefocus-615	310	61	.	.	PUNCT
finefocus-615	311	1	a	a	DET
finefocus-615	311	2	closer	close	ADJ
finefocus-615	311	3	examination	examination	NOUN
finefocus-615	311	4	of	of	ADP
finefocus-615	311	5	the	the	DET
finefocus-615	311	6	top	top	ADJ
finefocus-615	311	7	carbon	carbon	NOUN
finefocus-615	311	8	sources	source	NOUN
finefocus-615	311	9	utilized	utilize	VERB
finefocus-615	311	10	by	by	ADP
finefocus-615	311	11	the	the	DET
finefocus-615	311	12	cheese	cheese	NOUN
finefocus-615	311	13	community	community	NOUN
finefocus-615	311	14	samples	sample	NOUN
finefocus-615	311	15	revealed	reveal	VERB
finefocus-615	311	16	that	that	SCONJ
finefocus-615	311	17	there	there	PRON
finefocus-615	311	18	was	be	VERB
finefocus-615	311	19	large	large	ADJ
finefocus-615	311	20	diversity	diversity	NOUN
finefocus-615	311	21	of	of	ADP
finefocus-615	311	22	top	top	ADJ
finefocus-615	311	23	carbon	carbon	NOUN
finefocus-615	311	24	sources	source	NOUN
finefocus-615	311	25	utilized	utilize	VERB
finefocus-615	311	26	.	.	PUNCT
finefocus-615	312	1	cyclodextrin	cyclodextrin	NOUN
finefocus-615	312	2	,	,	PUNCT
finefocus-615	312	3	tween-40	tween-40	PROPN
finefocus-615	312	4	and	and	CCONJ
finefocus-615	312	5	alpha	alpha	NOUN
finefocus-615	312	6	-	-	PUNCT
finefocus-615	312	7	d	d	NOUN
finefocus-615	312	8	-	-	NOUN
finefocus-615	312	9	lactose	lactose	NOUN
finefocus-615	312	10	were	be	AUX
finefocus-615	312	11	the	the	DET
finefocus-615	312	12	top	top	ADJ
finefocus-615	312	13	carbon	carbon	NOUN
finefocus-615	312	14	sources	source	NOUN
finefocus-615	312	15	most	most	ADV
finefocus-615	312	16	frequently	frequently	ADV
finefocus-615	312	17	found	find	VERB
finefocus-615	312	18	,	,	PUNCT
finefocus-615	312	19	though	though	SCONJ
finefocus-615	312	20	they	they	PRON
finefocus-615	312	21	were	be	AUX
finefocus-615	312	22	the	the	DET
finefocus-615	312	23	top	top	ADJ
finefocus-615	312	24	carbon	carbon	NOUN
finefocus-615	312	25	sources	source	NOUN
finefocus-615	312	26	in	in	ADP
finefocus-615	312	27	only	only	ADV
finefocus-615	312	28	two	two	NUM
finefocus-615	312	29	cheeses	cheese	NOUN
finefocus-615	312	30	each	each	PRON
finefocus-615	312	31	.	.	PUNCT
finefocus-615	313	1	none	none	NOUN
finefocus-615	313	2	of	of	ADP
finefocus-615	313	3	the	the	DET
finefocus-615	313	4	cheeses	cheese	NOUN
finefocus-615	313	5	metabolized	metabolize	VERB
finefocus-615	313	6	the	the	DET
finefocus-615	313	7	phosphate	phosphate	NOUN
finefocus-615	313	8	-	-	PUNCT
finefocus-615	313	9	activated	activate	VERB
finefocus-615	313	10	substrates	substrate	NOUN
finefocus-615	313	11	(	(	PUNCT
finefocus-615	313	12	glucose-1phosphate	glucose-1phosphate	NOUN
finefocus-615	313	13	and	and	CCONJ
finefocus-615	313	14	alpha	alpha	NOUN
finefocus-615	313	15	glycerol	glycerol	NOUN
finefocus-615	313	16	phosphate	phosphate	NOUN
finefocus-615	313	17	)	)	PUNCT
finefocus-615	313	18	.	.	PUNCT
finefocus-615	314	1	discussion	discussion	NOUN
finefocus-615	314	2	cheese	cheese	NOUN
finefocus-615	314	3	is	be	AUX
finefocus-615	314	4	an	an	DET
finefocus-615	314	5	excellent	excellent	ADJ
finefocus-615	314	6	model	model	NOUN
finefocus-615	314	7	system	system	NOUN
finefocus-615	314	8	for	for	ADP
finefocus-615	314	9	studying	study	VERB
finefocus-615	314	10	the	the	DET
finefocus-615	314	11	mechanisms	mechanism	NOUN
finefocus-615	314	12	and	and	CCONJ
finefocus-615	314	13	patterns	pattern	NOUN
finefocus-615	314	14	of	of	ADP
finefocus-615	314	15	microbial	microbial	ADJ
finefocus-615	314	16	diversity	diversity	NOUN
finefocus-615	314	17	because	because	SCONJ
finefocus-615	314	18	the	the	DET
finefocus-615	314	19	microbial	microbial	ADJ
finefocus-615	314	20	communities	community	NOUN
finefocus-615	314	21	form	form	VERB
finefocus-615	314	22	under	under	ADP
finefocus-615	314	23	controlled	control	VERB
finefocus-615	314	24	and	and	CCONJ
finefocus-615	314	25	easily	easily	ADV
finefocus-615	314	26	manipulated	manipulate	VERB
finefocus-615	314	27	conditions	condition	NOUN
finefocus-615	314	28	.	.	PUNCT
finefocus-615	315	1	while	while	SCONJ
finefocus-615	315	2	the	the	DET
finefocus-615	315	3	succession	succession	NOUN
finefocus-615	315	4	of	of	ADP
finefocus-615	315	5	the	the	DET
finefocus-615	315	6	microbial	microbial	ADJ
finefocus-615	315	7	community	community	NOUN
finefocus-615	315	8	during	during	ADP
finefocus-615	315	9	the	the	DET
finefocus-615	315	10	early	early	ADJ
finefocus-615	315	11	curd	curd	NOUN
finefocus-615	315	12	and	and	CCONJ
finefocus-615	315	13	rind	rind	NOUN
finefocus-615	315	14	formation	formation	NOUN
finefocus-615	315	15	has	have	AUX
finefocus-615	315	16	been	be	AUX
finefocus-615	315	17	well	well	ADV
finefocus-615	315	18	characterized	characterize	VERB
finefocus-615	315	19	,	,	PUNCT
finefocus-615	315	20	the	the	DET
finefocus-615	315	21	differences	difference	NOUN
finefocus-615	315	22	between	between	ADP
finefocus-615	315	23	the	the	DET
finefocus-615	315	24	microbial	microbial	ADJ
finefocus-615	315	25	composition	composition	NOUN
finefocus-615	315	26	of	of	ADP
finefocus-615	315	27	the	the	DET
finefocus-615	315	28	mature	mature	ADJ
finefocus-615	315	29	rind	rind	NOUN
finefocus-615	315	30	and	and	CCONJ
finefocus-615	315	31	curd	curd	NOUN
finefocus-615	315	32	are	be	AUX
finefocus-615	315	33	not	not	PART
finefocus-615	315	34	well	well	ADV
finefocus-615	315	35	understood	understand	VERB
finefocus-615	315	36	,	,	PUNCT
finefocus-615	315	37	especially	especially	ADV
finefocus-615	315	38	when	when	SCONJ
finefocus-615	315	39	compared	compare	VERB
finefocus-615	315	40	between	between	ADP
finefocus-615	315	41	different	different	ADJ
finefocus-615	315	42	cheeses	cheese	NOUN
finefocus-615	315	43	(	(	PUNCT
finefocus-615	315	44	1	1	NUM
finefocus-615	315	45	,	,	PUNCT
finefocus-615	315	46	10	10	NUM
finefocus-615	315	47	,	,	PUNCT
finefocus-615	315	48	16	16	NUM
finefocus-615	315	49	,	,	PUNCT
finefocus-615	315	50	20	20	NUM
finefocus-615	315	51	,	,	PUNCT
finefocus-615	315	52	21	21	NUM
finefocus-615	315	53	)	)	PUNCT
finefocus-615	315	54	.	.	PUNCT
finefocus-615	316	1	we	we	PRON
finefocus-615	316	2	characterized	characterize	VERB
finefocus-615	316	3	the	the	DET
finefocus-615	316	4	microbial	microbial	ADJ
finefocus-615	316	5	communities	community	NOUN
finefocus-615	316	6	present	present	ADJ
finefocus-615	316	7	within	within	ADP
finefocus-615	316	8	the	the	DET
finefocus-615	316	9	mature	mature	ADJ
finefocus-615	316	10	rinds	rind	NOUN
finefocus-615	316	11	and	and	CCONJ
finefocus-615	316	12	curds	curd	NOUN
finefocus-615	316	13	of	of	ADP
finefocus-615	316	14	seven	seven	NUM
finefocus-615	316	15	different	different	ADJ
finefocus-615	316	16	natural	natural	ADJ
finefocus-615	316	17	rind	rind	NOUN
finefocus-615	316	18	cheeses	cheese	NOUN
finefocus-615	316	19	using	use	VERB
finefocus-615	316	20	culture	culture	NOUN
finefocus-615	316	21	-	-	PUNCT
finefocus-615	316	22	independent	independent	ADJ
finefocus-615	316	23	,	,	PUNCT
finefocus-615	316	24	highthroughput	highthroughput	VERB
finefocus-615	316	25	illumina	illumina	ADJ
finefocus-615	316	26	sequencing	sequencing	NOUN
finefocus-615	316	27	and	and	CCONJ
finefocus-615	316	28	culture	culture	NOUN
finefocus-615	316	29	-	-	PUNCT
finefocus-615	316	30	dependent	dependent	ADJ
finefocus-615	316	31	sanger	sanger	PROPN
finefocus-615	316	32	sequencing	sequencing	NOUN
finefocus-615	316	33	of	of	ADP
finefocus-615	316	34	the	the	DET
finefocus-615	316	35	16s	16s	PROPN
finefocus-615	316	36	rrna	rrna	PROPN
finefocus-615	316	37	gene	gene	NOUN
finefocus-615	316	38	.	.	PUNCT
finefocus-615	317	1	these	these	DET
finefocus-615	317	2	seven	seven	NUM
finefocus-615	317	3	cheeses	cheese	NOUN
finefocus-615	317	4	vary	vary	VERB
finefocus-615	317	5	in	in	ADP
finefocus-615	317	6	their	their	PRON
finefocus-615	317	7	geographic	geographic	ADJ
finefocus-615	317	8	region	region	NOUN
finefocus-615	317	9	of	of	ADP
finefocus-615	317	10	production	production	NOUN
finefocus-615	317	11	and	and	CCONJ
finefocus-615	317	12	milk	milk	NOUN
finefocus-615	317	13	type	type	NOUN
finefocus-615	317	14	used	use	VERB
finefocus-615	317	15	in	in	ADP
finefocus-615	317	16	the	the	DET
finefocus-615	317	17	cheese	cheese	NOUN
finefocus-615	317	18	-	-	PUNCT
finefocus-615	317	19	making	make	VERB
finefocus-615	317	20	process	process	NOUN
finefocus-615	317	21	.	.	PUNCT
finefocus-615	318	1	additionally	additionally	ADV
finefocus-615	318	2	,	,	PUNCT
finefocus-615	318	3	we	we	PRON
finefocus-615	318	4	examined	examine	VERB
finefocus-615	318	5	the	the	DET
finefocus-615	318	6	antibiotic	antibiotic	ADJ
finefocus-615	318	7	susceptibility	susceptibility	NOUN
finefocus-615	318	8	and	and	CCONJ
finefocus-615	318	9	carbon	carbon	NOUN
finefocus-615	318	10	source	source	NOUN
finefocus-615	318	11	utilization	utilization	NOUN
finefocus-615	318	12	of	of	ADP
finefocus-615	318	13	the	the	DET
finefocus-615	318	14	microbial	microbial	ADJ
finefocus-615	318	15	communities	community	NOUN
finefocus-615	318	16	in	in	ADP
finefocus-615	318	17	each	each	PRON
finefocus-615	318	18	of	of	ADP
finefocus-615	318	19	the	the	DET
finefocus-615	318	20	cheeses	cheese	NOUN
finefocus-615	318	21	.	.	PUNCT
finefocus-615	319	1	24	24	NUM
finefocus-615	319	2	•	•	NUM
finefocus-615	319	3	fine	fine	ADJ
finefocus-615	319	4	focus	focus	NOUN
finefocus-615	319	5	,	,	PUNCT
finefocus-615	319	6	vol	vol	NOUN
finefocus-615	319	7	.	.	NOUN
finefocus-615	319	8	3	3	NUM
finefocus-615	319	9	(	(	PUNCT
finefocus-615	319	10	1	1	X
finefocus-615	319	11	)	)	PUNCT
finefocus-615	319	12	we	we	PRON
finefocus-615	319	13	found	find	VERB
finefocus-615	319	14	that	that	SCONJ
finefocus-615	319	15	sampling	sample	VERB
finefocus-615	319	16	site	site	NOUN
finefocus-615	319	17	(	(	PUNCT
finefocus-615	319	18	curd	curd	NOUN
finefocus-615	319	19	or	or	CCONJ
finefocus-615	319	20	rind	rind	NOUN
finefocus-615	319	21	)	)	PUNCT
finefocus-615	319	22	was	be	AUX
finefocus-615	319	23	a	a	DET
finefocus-615	319	24	strong	strong	ADJ
finefocus-615	319	25	predictor	predictor	NOUN
finefocus-615	319	26	of	of	ADP
finefocus-615	319	27	community	community	NOUN
finefocus-615	319	28	structure	structure	NOUN
finefocus-615	319	29	but	but	CCONJ
finefocus-615	319	30	milk	milk	NOUN
finefocus-615	319	31	type	type	NOUN
finefocus-615	319	32	(	(	PUNCT
finefocus-615	319	33	cow	cow	PROPN
finefocus-615	319	34	,	,	PUNCT
finefocus-615	319	35	goat	goat	PROPN
finefocus-615	319	36	,	,	PUNCT
finefocus-615	319	37	or	or	CCONJ
finefocus-615	319	38	sheep	sheep	NOUN
finefocus-615	319	39	)	)	PUNCT
finefocus-615	319	40	,	,	PUNCT
finefocus-615	319	41	geographic	geographic	ADJ
finefocus-615	319	42	origin	origin	NOUN
finefocus-615	319	43	,	,	PUNCT
finefocus-615	319	44	moisture	moisture	NOUN
finefocus-615	319	45	content	content	NOUN
finefocus-615	319	46	,	,	PUNCT
finefocus-615	319	47	and	and	CCONJ
finefocus-615	319	48	ph	ph	NOUN
finefocus-615	319	49	had	have	VERB
finefocus-615	319	50	little	little	ADJ
finefocus-615	319	51	influence	influence	NOUN
finefocus-615	319	52	on	on	ADP
finefocus-615	319	53	the	the	DET
finefocus-615	319	54	microbial	microbial	ADJ
finefocus-615	319	55	community	community	NOUN
finefocus-615	319	56	structure	structure	NOUN
finefocus-615	319	57	,	,	PUNCT
finefocus-615	319	58	in	in	ADP
finefocus-615	319	59	contrast	contrast	NOUN
finefocus-615	319	60	to	to	ADP
finefocus-615	319	61	wolfe	wolfe	PROPN
finefocus-615	319	62	and	and	CCONJ
finefocus-615	319	63	colleagues	colleague	NOUN
finefocus-615	319	64	,	,	PUNCT
finefocus-615	319	65	2014	2014	NUM
finefocus-615	319	66	.	.	PUNCT
finefocus-615	320	1	it	it	PRON
finefocus-615	320	2	was	be	AUX
finefocus-615	320	3	found	find	VERB
finefocus-615	320	4	that	that	SCONJ
finefocus-615	320	5	rinds	rind	NOUN
finefocus-615	320	6	of	of	ADP
finefocus-615	320	7	all	all	DET
finefocus-615	320	8	seven	seven	NUM
finefocus-615	320	9	of	of	ADP
finefocus-615	320	10	the	the	DET
finefocus-615	320	11	cheeses	cheese	NOUN
finefocus-615	320	12	had	have	VERB
finefocus-615	320	13	greater	great	ADJ
finefocus-615	320	14	microbial	microbial	ADJ
finefocus-615	320	15	richness	richness	NOUN
finefocus-615	320	16	,	,	PUNCT
finefocus-615	320	17	measured	measure	VERB
finefocus-615	320	18	as	as	ADP
finefocus-615	320	19	the	the	DET
finefocus-615	320	20	number	number	NOUN
finefocus-615	320	21	of	of	ADP
finefocus-615	320	22	unique	unique	ADJ
finefocus-615	320	23	otus	otus	NOUN
finefocus-615	320	24	,	,	PUNCT
finefocus-615	320	25	compared	compare	VERB
finefocus-615	320	26	to	to	ADP
finefocus-615	320	27	the	the	DET
finefocus-615	320	28	respective	respective	ADJ
finefocus-615	320	29	curds	curd	NOUN
finefocus-615	320	30	of	of	ADP
finefocus-615	320	31	the	the	DET
finefocus-615	320	32	seven	seven	NUM
finefocus-615	320	33	characterized	characterize	VERB
finefocus-615	320	34	cheeses	cheese	NOUN
finefocus-615	320	35	(	(	PUNCT
finefocus-615	320	36	figure	figure	NOUN
finefocus-615	320	37	4b	4b	PROPN
finefocus-615	320	38	)	)	PUNCT
finefocus-615	320	39	.	.	PUNCT
finefocus-615	321	1	the	the	DET
finefocus-615	321	2	only	only	ADJ
finefocus-615	321	3	phylum	phylum	NOUN
finefocus-615	321	4	represented	represent	VERB
finefocus-615	321	5	within	within	ADP
finefocus-615	321	6	the	the	DET
finefocus-615	321	7	curds	curd	NOUN
finefocus-615	321	8	of	of	ADP
finefocus-615	321	9	all	all	DET
finefocus-615	321	10	seven	seven	NUM
finefocus-615	321	11	cheeses	cheese	NOUN
finefocus-615	321	12	,	,	PUNCT
finefocus-615	321	13	except	except	SCONJ
finefocus-615	321	14	for	for	ADP
finefocus-615	321	15	that	that	PRON
finefocus-615	321	16	of	of	ADP
finefocus-615	321	17	sonnet	sonnet	NOUN
finefocus-615	321	18	,	,	PUNCT
finefocus-615	321	19	was	be	AUX
finefocus-615	321	20	firmicutes	firmicute	NOUN
finefocus-615	321	21	.	.	PUNCT
finefocus-615	322	1	streptococcus	streptococcus	NOUN
finefocus-615	322	2	,	,	PUNCT
finefocus-615	322	3	lactobacillus	lactobacillus	NOUN
finefocus-615	322	4	and	and	CCONJ
finefocus-615	322	5	lactococcus	lactococcus	PROPN
finefocus-615	322	6	,	,	PUNCT
finefocus-615	322	7	which	which	PRON
finefocus-615	322	8	are	be	AUX
finefocus-615	322	9	genera	genera	NOUN
finefocus-615	322	10	commonly	commonly	ADV
finefocus-615	322	11	used	use	VERB
finefocus-615	322	12	as	as	ADP
finefocus-615	322	13	starting	start	VERB
finefocus-615	322	14	cultures	culture	NOUN
finefocus-615	322	15	during	during	ADP
finefocus-615	322	16	cheese	cheese	NOUN
finefocus-615	322	17	production	production	NOUN
finefocus-615	322	18	,	,	PUNCT
finefocus-615	322	19	were	be	AUX
finefocus-615	322	20	the	the	DET
finefocus-615	322	21	most	most	ADV
finefocus-615	322	22	abundant	abundant	ADJ
finefocus-615	322	23	genera	genera	NOUN
finefocus-615	322	24	in	in	ADP
finefocus-615	322	25	the	the	DET
finefocus-615	322	26	curd	curd	NOUN
finefocus-615	322	27	and	and	CCONJ
finefocus-615	322	28	have	have	AUX
finefocus-615	322	29	been	be	AUX
finefocus-615	322	30	previously	previously	ADV
finefocus-615	322	31	shown	show	VERB
finefocus-615	322	32	to	to	PART
finefocus-615	322	33	dominate	dominate	VERB
finefocus-615	322	34	the	the	DET
finefocus-615	322	35	curd	curd	NOUN
finefocus-615	322	36	even	even	ADV
finefocus-615	322	37	in	in	ADP
finefocus-615	322	38	cheese	cheese	NOUN
finefocus-615	322	39	made	make	VERB
finefocus-615	322	40	without	without	ADP
finefocus-615	322	41	starter	starter	ADJ
finefocus-615	322	42	cultures	culture	NOUN
finefocus-615	322	43	(	(	PUNCT
finefocus-615	322	44	1	1	NUM
finefocus-615	322	45	,	,	PUNCT
finefocus-615	322	46	6	6	NUM
finefocus-615	322	47	,	,	PUNCT
finefocus-615	322	48	16	16	NUM
finefocus-615	322	49	,	,	PUNCT
finefocus-615	322	50	17	17	NUM
finefocus-615	322	51	)	)	PUNCT
finefocus-615	322	52	.	.	PUNCT
finefocus-615	323	1	in	in	ADP
finefocus-615	323	2	contrast	contrast	NOUN
finefocus-615	323	3	,	,	PUNCT
finefocus-615	323	4	the	the	DET
finefocus-615	323	5	rinds	rind	NOUN
finefocus-615	323	6	of	of	ADP
finefocus-615	323	7	these	these	DET
finefocus-615	323	8	cheeses	cheese	NOUN
finefocus-615	323	9	hosted	host	VERB
finefocus-615	323	10	community	community	NOUN
finefocus-615	323	11	members	member	NOUN
finefocus-615	323	12	from	from	ADP
finefocus-615	323	13	the	the	DET
finefocus-615	323	14	firmicutes	firmicute	NOUN
finefocus-615	323	15	,	,	PUNCT
finefocus-615	323	16	actinobacteria	actinobacteria	NOUN
finefocus-615	323	17	,	,	PUNCT
finefocus-615	323	18	and	and	CCONJ
finefocus-615	323	19	proteobacteria	proteobacteria	NOUN
finefocus-615	323	20	phyla	phyla	NOUN
finefocus-615	323	21	and	and	CCONJ
finefocus-615	323	22	,	,	PUNCT
finefocus-615	323	23	compared	compare	VERB
finefocus-615	323	24	to	to	ADP
finefocus-615	323	25	the	the	DET
finefocus-615	323	26	curd	curd	NOUN
finefocus-615	323	27	,	,	PUNCT
finefocus-615	323	28	had	have	VERB
finefocus-615	323	29	a	a	DET
finefocus-615	323	30	greater	great	ADJ
finefocus-615	323	31	relative	relative	ADJ
finefocus-615	323	32	abundance	abundance	NOUN
finefocus-615	323	33	of	of	ADP
finefocus-615	323	34	the	the	DET
finefocus-615	323	35	known	know	VERB
finefocus-615	323	36	rind	rind	NOUN
finefocus-615	323	37	colonizers	colonizer	NOUN
finefocus-615	323	38	brevibacterium	brevibacterium	NOUN
finefocus-615	323	39	and	and	CCONJ
finefocus-615	323	40	actinomyceteacae	actinomyceteacae	NOUN
finefocus-615	323	41	(	(	PUNCT
finefocus-615	323	42	49	49	NUM
finefocus-615	323	43	)	)	PUNCT
finefocus-615	323	44	.	.	PUNCT
finefocus-615	324	1	the	the	DET
finefocus-615	324	2	differences	difference	NOUN
finefocus-615	324	3	in	in	ADP
finefocus-615	324	4	community	community	NOUN
finefocus-615	324	5	composition	composition	NOUN
finefocus-615	324	6	and	and	CCONJ
finefocus-615	324	7	complexity	complexity	NOUN
finefocus-615	324	8	between	between	ADP
finefocus-615	324	9	the	the	DET
finefocus-615	324	10	rind	rind	NOUN
finefocus-615	324	11	and	and	CCONJ
finefocus-615	324	12	the	the	DET
finefocus-615	324	13	curd	curd	NOUN
finefocus-615	324	14	is	be	AUX
finefocus-615	324	15	likely	likely	ADJ
finefocus-615	324	16	due	due	ADJ
finefocus-615	324	17	to	to	ADP
finefocus-615	324	18	differential	differential	VERB
finefocus-615	324	19	exposure	exposure	NOUN
finefocus-615	324	20	to	to	ADP
finefocus-615	324	21	environmental	environmental	ADJ
finefocus-615	324	22	conditions	condition	NOUN
finefocus-615	324	23	during	during	ADP
finefocus-615	324	24	ripening	ripen	VERB
finefocus-615	324	25	.	.	PUNCT
finefocus-615	325	1	while	while	SCONJ
finefocus-615	325	2	the	the	DET
finefocus-615	325	3	curd	curd	NOUN
finefocus-615	325	4	is	be	AUX
finefocus-615	325	5	an	an	DET
finefocus-615	325	6	anaerobic	anaerobic	ADJ
finefocus-615	325	7	environment	environment	NOUN
finefocus-615	325	8	that	that	PRON
finefocus-615	325	9	is	be	AUX
finefocus-615	325	10	largely	largely	ADV
finefocus-615	325	11	protected	protect	VERB
finefocus-615	325	12	from	from	ADP
finefocus-615	325	13	environmental	environmental	ADJ
finefocus-615	325	14	exposures	exposure	NOUN
finefocus-615	325	15	,	,	PUNCT
finefocus-615	325	16	the	the	DET
finefocus-615	325	17	rind	rind	NOUN
finefocus-615	325	18	is	be	AUX
finefocus-615	325	19	exposed	expose	VERB
finefocus-615	325	20	to	to	ADP
finefocus-615	325	21	ambient	ambient	ADJ
finefocus-615	325	22	air	air	NOUN
finefocus-615	325	23	and	and	CCONJ
finefocus-615	325	24	is	be	AUX
finefocus-615	325	25	in	in	ADP
finefocus-615	325	26	direct	direct	ADJ
finefocus-615	325	27	contact	contact	NOUN
finefocus-615	325	28	with	with	ADP
finefocus-615	325	29	the	the	DET
finefocus-615	325	30	surface	surface	NOUN
finefocus-615	325	31	on	on	ADP
finefocus-615	325	32	which	which	PRON
finefocus-615	325	33	the	the	DET
finefocus-615	325	34	cheese	cheese	NOUN
finefocus-615	325	35	is	be	AUX
finefocus-615	325	36	aged	age	VERB
finefocus-615	325	37	,	,	PUNCT
finefocus-615	325	38	providing	provide	VERB
finefocus-615	325	39	opportunities	opportunity	NOUN
finefocus-615	325	40	for	for	ADP
finefocus-615	325	41	colonization	colonization	NOUN
finefocus-615	325	42	and	and	CCONJ
finefocus-615	325	43	succession	succession	NOUN
finefocus-615	325	44	of	of	ADP
finefocus-615	325	45	the	the	DET
finefocus-615	325	46	rind	rind	NOUN
finefocus-615	325	47	microbial	microbial	ADJ
finefocus-615	325	48	community	community	NOUN
finefocus-615	325	49	by	by	ADP
finefocus-615	325	50	secondary	secondary	ADJ
finefocus-615	325	51	microorganisms	microorganism	NOUN
finefocus-615	325	52	from	from	ADP
finefocus-615	325	53	the	the	DET
finefocus-615	325	54	environment	environment	NOUN
finefocus-615	325	55	.	.	PUNCT
finefocus-615	326	1	the	the	DET
finefocus-615	326	2	colonizing	colonize	VERB
finefocus-615	326	3	microbes	microbe	NOUN
finefocus-615	326	4	from	from	ADP
finefocus-615	326	5	the	the	DET
finefocus-615	326	6	environment	environment	NOUN
finefocus-615	326	7	can	can	AUX
finefocus-615	326	8	influence	influence	VERB
finefocus-615	326	9	characteristics	characteristic	NOUN
finefocus-615	326	10	of	of	ADP
finefocus-615	326	11	the	the	DET
finefocus-615	326	12	rind	rind	NOUN
finefocus-615	326	13	such	such	ADJ
finefocus-615	326	14	as	as	ADP
finefocus-615	326	15	ph	ph	NOUN
finefocus-615	326	16	that	that	PRON
finefocus-615	326	17	can	can	AUX
finefocus-615	326	18	influence	influence	VERB
finefocus-615	326	19	further	further	ADJ
finefocus-615	326	20	colonization	colonization	NOUN
finefocus-615	326	21	and	and	CCONJ
finefocus-615	326	22	succession	succession	NOUN
finefocus-615	326	23	.	.	PUNCT
finefocus-615	327	1	for	for	ADP
finefocus-615	327	2	example	example	NOUN
finefocus-615	327	3	,	,	PUNCT
finefocus-615	327	4	de	de	NOUN
finefocus-615	327	5	-	-	NOUN
finefocus-615	327	6	acidification	acidification	NOUN
finefocus-615	327	7	of	of	ADP
finefocus-615	327	8	the	the	DET
finefocus-615	327	9	rind	rind	NOUN
finefocus-615	327	10	by	by	ADP
finefocus-615	327	11	certain	certain	ADJ
finefocus-615	327	12	species	specie	NOUN
finefocus-615	327	13	of	of	ADP
finefocus-615	327	14	yeast	yeast	NOUN
finefocus-615	327	15	facilitates	facilitate	VERB
finefocus-615	327	16	the	the	DET
finefocus-615	327	17	colonization	colonization	NOUN
finefocus-615	327	18	and	and	CCONJ
finefocus-615	327	19	succession	succession	NOUN
finefocus-615	327	20	of	of	ADP
finefocus-615	327	21	microbes	microbe	NOUN
finefocus-615	327	22	that	that	PRON
finefocus-615	327	23	prefer	prefer	VERB
finefocus-615	327	24	more	more	ADJ
finefocus-615	327	25	alkaline	alkaline	ADJ
finefocus-615	327	26	environments	environment	NOUN
finefocus-615	327	27	such	such	ADJ
finefocus-615	327	28	as	as	ADP
finefocus-615	327	29	corynebacterium	corynebacterium	NOUN
finefocus-615	327	30	,	,	PUNCT
finefocus-615	327	31	brevibacterium	brevibacterium	NOUN
finefocus-615	327	32	and	and	CCONJ
finefocus-615	327	33	brachybacterium	brachybacterium	NOUN
finefocus-615	327	34	,	,	PUNCT
finefocus-615	327	35	in	in	ADP
finefocus-615	327	36	keeping	keep	VERB
finefocus-615	327	37	with	with	ADP
finefocus-615	327	38	our	our	PRON
finefocus-615	327	39	observation	observation	NOUN
finefocus-615	327	40	of	of	ADP
finefocus-615	327	41	an	an	DET
finefocus-615	327	42	increase	increase	NOUN
finefocus-615	327	43	in	in	ADP
finefocus-615	327	44	relative	relative	ADJ
finefocus-615	327	45	abundance	abundance	NOUN
finefocus-615	327	46	of	of	ADP
finefocus-615	327	47	brevibacterium	brevibacterium	NOUN
finefocus-615	327	48	in	in	ADP
finefocus-615	327	49	rind	rind	NOUN
finefocus-615	327	50	samples	sample	NOUN
finefocus-615	327	51	(	(	PUNCT
finefocus-615	327	52	27	27	NUM
finefocus-615	327	53	,	,	PUNCT
finefocus-615	327	54	37	37	NUM
finefocus-615	327	55	)	)	PUNCT
finefocus-615	327	56	.	.	PUNCT
finefocus-615	328	1	antibiotic	antibiotic	ADJ
finefocus-615	328	2	assays	assay	NOUN
finefocus-615	328	3	another	another	DET
finefocus-615	328	4	contributing	contribute	VERB
finefocus-615	328	5	factor	factor	NOUN
finefocus-615	328	6	to	to	ADP
finefocus-615	328	7	cheese	cheese	NOUN
finefocus-615	328	8	community	community	NOUN
finefocus-615	328	9	structure	structure	NOUN
finefocus-615	328	10	is	be	AUX
finefocus-615	328	11	the	the	DET
finefocus-615	328	12	interaction	interaction	NOUN
finefocus-615	328	13	between	between	ADP
finefocus-615	328	14	bacteria	bacteria	NOUN
finefocus-615	328	15	and	and	CCONJ
finefocus-615	328	16	fungi	fungus	NOUN
finefocus-615	328	17	.	.	PUNCT
finefocus-615	329	1	in	in	ADP
finefocus-615	329	2	many	many	ADJ
finefocus-615	329	3	cases	case	NOUN
finefocus-615	329	4	,	,	PUNCT
finefocus-615	329	5	interactions	interaction	NOUN
finefocus-615	329	6	among	among	ADP
finefocus-615	329	7	bacteria	bacteria	NOUN
finefocus-615	329	8	and	and	CCONJ
finefocus-615	329	9	yeast	yeast	NOUN
finefocus-615	329	10	may	may	AUX
finefocus-615	329	11	prevent	prevent	VERB
finefocus-615	329	12	pathogens	pathogen	NOUN
finefocus-615	329	13	(	(	PUNCT
finefocus-615	329	14	27	27	NUM
finefocus-615	329	15	,	,	PUNCT
finefocus-615	329	16	29	29	NUM
finefocus-615	329	17	)	)	PUNCT
finefocus-615	329	18	,	,	PUNCT
finefocus-615	329	19	and	and	CCONJ
finefocus-615	329	20	opportunistic	opportunistic	ADJ
finefocus-615	329	21	pathogens	pathogen	NOUN
finefocus-615	329	22	like	like	ADP
finefocus-615	329	23	staphylococcus	staphylococcus	NOUN
finefocus-615	329	24	aureus	aureus	NOUN
finefocus-615	329	25	from	from	ADP
finefocus-615	329	26	dominating	dominate	VERB
finefocus-615	329	27	the	the	DET
finefocus-615	329	28	rind	rind	NOUN
finefocus-615	329	29	community	community	NOUN
finefocus-615	329	30	and	and	CCONJ
finefocus-615	329	31	spoiling	spoil	VERB
finefocus-615	329	32	food	food	NOUN
finefocus-615	329	33	(	(	PUNCT
finefocus-615	329	34	3	3	NUM
finefocus-615	329	35	)	)	PUNCT
finefocus-615	329	36	.	.	PUNCT
finefocus-615	330	1	a	a	DET
finefocus-615	330	2	major	major	ADJ
finefocus-615	330	3	means	mean	NOUN
finefocus-615	330	4	of	of	ADP
finefocus-615	330	5	interaction	interaction	NOUN
finefocus-615	330	6	involves	involve	VERB
finefocus-615	330	7	the	the	DET
finefocus-615	330	8	release	release	NOUN
finefocus-615	330	9	of	of	ADP
finefocus-615	330	10	antimicrobial	antimicrobial	ADJ
finefocus-615	330	11	chemical	chemical	NOUN
finefocus-615	330	12	compounds	compound	NOUN
finefocus-615	330	13	from	from	ADP
finefocus-615	330	14	one	one	NUM
finefocus-615	330	15	microbe	microbe	NOUN
finefocus-615	330	16	to	to	ADP
finefocus-615	330	17	the	the	DET
finefocus-615	330	18	other	other	ADJ
finefocus-615	330	19	(	(	PUNCT
finefocus-615	330	20	23	23	NUM
finefocus-615	330	21	)	)	PUNCT
finefocus-615	330	22	.	.	PUNCT
finefocus-615	331	1	from	from	ADP
finefocus-615	331	2	the	the	DET
finefocus-615	331	3	antibiotic	antibiotic	ADJ
finefocus-615	331	4	susceptibility	susceptibility	NOUN
finefocus-615	331	5	assays	assay	NOUN
finefocus-615	331	6	,	,	PUNCT
finefocus-615	331	7	we	we	PRON
finefocus-615	331	8	observed	observe	VERB
finefocus-615	331	9	that	that	SCONJ
finefocus-615	331	10	isolates	isolate	NOUN
finefocus-615	331	11	taken	take	VERB
finefocus-615	331	12	from	from	ADP
finefocus-615	331	13	microbial	microbial	ADJ
finefocus-615	331	14	communities	community	NOUN
finefocus-615	331	15	in	in	ADP
finefocus-615	331	16	the	the	DET
finefocus-615	331	17	rind	rind	NOUN
finefocus-615	331	18	and	and	CCONJ
finefocus-615	331	19	curd	curd	NOUN
finefocus-615	331	20	of	of	ADP
finefocus-615	331	21	six	six	NUM
finefocus-615	331	22	of	of	ADP
finefocus-615	331	23	the	the	DET
finefocus-615	331	24	seven	seven	NUM
finefocus-615	331	25	cheeses	cheese	NOUN
finefocus-615	331	26	were	be	AUX
finefocus-615	331	27	resistant	resistant	ADJ
finefocus-615	331	28	to	to	ADP
finefocus-615	331	29	a	a	DET
finefocus-615	331	30	variety	variety	NOUN
finefocus-615	331	31	of	of	ADP
finefocus-615	331	32	antibiotics	antibiotic	NOUN
finefocus-615	331	33	.	.	PUNCT
finefocus-615	332	1	in	in	ADP
finefocus-615	332	2	order	order	NOUN
finefocus-615	332	3	to	to	PART
finefocus-615	332	4	survive	survive	VERB
finefocus-615	332	5	on	on	ADP
finefocus-615	332	6	the	the	DET
finefocus-615	332	7	rind	rind	NOUN
finefocus-615	332	8	,	,	PUNCT
finefocus-615	332	9	bacteria	bacteria	NOUN
finefocus-615	332	10	most	most	ADV
finefocus-615	332	11	likely	likely	ADV
finefocus-615	332	12	develop	develop	VERB
finefocus-615	332	13	resistance	resistance	NOUN
finefocus-615	332	14	mechanisms	mechanism	NOUN
finefocus-615	332	15	to	to	ADP
finefocus-615	332	16	these	these	DET
finefocus-615	332	17	antibiotics	antibiotic	NOUN
finefocus-615	332	18	and	and	CCONJ
finefocus-615	332	19	mycotoxins	mycotoxin	NOUN
finefocus-615	332	20	produced	produce	VERB
finefocus-615	332	21	by	by	ADP
finefocus-615	332	22	species	specie	NOUN
finefocus-615	332	23	known	know	VERB
finefocus-615	332	24	to	to	ADP
finefocus-615	332	25	inhabit	inhabit	NOUN
finefocus-615	332	26	cheese	cheese	NOUN
finefocus-615	332	27	,	,	PUNCT
finefocus-615	332	28	such	such	ADJ
finefocus-615	332	29	as	as	ADP
finefocus-615	332	30	that	that	PRON
finefocus-615	332	31	of	of	ADP
finefocus-615	332	32	penicillium	penicillium	NOUN
finefocus-615	332	33	nalgiovense	nalgiovense	NOUN
finefocus-615	332	34	(	(	PUNCT
finefocus-615	332	35	2	2	NUM
finefocus-615	332	36	,	,	PUNCT
finefocus-615	332	37	8	8	NUM
finefocus-615	332	38	,	,	PUNCT
finefocus-615	332	39	13	13	NUM
finefocus-615	332	40	,	,	PUNCT
finefocus-615	332	41	18	18	NUM
finefocus-615	332	42	,	,	PUNCT
finefocus-615	332	43	19	19	NUM
finefocus-615	332	44	,	,	PUNCT
finefocus-615	332	45	24	24	NUM
finefocus-615	332	46	,	,	PUNCT
finefocus-615	332	47	38	38	NUM
finefocus-615	332	48	)	)	PUNCT
finefocus-615	332	49	.	.	PUNCT
finefocus-615	333	1	our	our	PRON
finefocus-615	333	2	limited	limited	ADJ
finefocus-615	333	3	analysis	analysis	NOUN
finefocus-615	333	4	suggested	suggest	VERB
finefocus-615	333	5	that	that	SCONJ
finefocus-615	333	6	american	american	ADJ
finefocus-615	333	7	cheeses	cheese	NOUN
finefocus-615	333	8	overall	overall	ADV
finefocus-615	333	9	have	have	VERB
finefocus-615	333	10	a	a	DET
finefocus-615	333	11	higher	high	ADJ
finefocus-615	333	12	susceptibility	susceptibility	NOUN
finefocus-615	333	13	to	to	ADP
finefocus-615	333	14	antibiotics	antibiotic	NOUN
finefocus-615	333	15	than	than	SCONJ
finefocus-615	333	16	do	do	VERB
finefocus-615	333	17	european	european	ADJ
finefocus-615	333	18	cheeses	cheese	NOUN
finefocus-615	333	19	.	.	PUNCT
finefocus-615	334	1	we	we	PRON
finefocus-615	334	2	speculate	speculate	VERB
finefocus-615	334	3	that	that	SCONJ
finefocus-615	334	4	the	the	DET
finefocus-615	334	5	difference	difference	NOUN
finefocus-615	334	6	we	we	PRON
finefocus-615	334	7	observed	observe	VERB
finefocus-615	334	8	could	could	AUX
finefocus-615	334	9	be	be	AUX
finefocus-615	334	10	ascribed	ascribe	VERB
finefocus-615	334	11	to	to	ADP
finefocus-615	334	12	the	the	DET
finefocus-615	334	13	different	different	ADJ
finefocus-615	334	14	mechanisms	mechanism	NOUN
finefocus-615	334	15	by	by	ADP
finefocus-615	334	16	which	which	PRON
finefocus-615	334	17	european	european	ADJ
finefocus-615	334	18	and	and	CCONJ
finefocus-615	334	19	american	american	ADJ
finefocus-615	334	20	cheeses	cheese	NOUN
finefocus-615	334	21	are	be	AUX
finefocus-615	334	22	aged	age	VERB
finefocus-615	334	23	.	.	PUNCT
finefocus-615	335	1	european	european	ADJ
finefocus-615	335	2	cheeses	cheese	NOUN
finefocus-615	335	3	are	be	AUX
finefocus-615	335	4	more	more	ADV
finefocus-615	335	5	commonly	commonly	ADV
finefocus-615	335	6	aged	age	VERB
finefocus-615	335	7	on	on	ADP
finefocus-615	335	8	older	old	ADJ
finefocus-615	335	9	surfaces	surface	NOUN
finefocus-615	335	10	than	than	ADP
finefocus-615	335	11	american	american	ADJ
finefocus-615	335	12	cheeses	cheese	NOUN
finefocus-615	335	13	,	,	PUNCT
finefocus-615	335	14	such	such	ADJ
finefocus-615	335	15	as	as	ADP
finefocus-615	335	16	wooden	wooden	ADJ
finefocus-615	335	17	shelves	shelf	NOUN
finefocus-615	335	18	or	or	CCONJ
finefocus-615	335	19	caves	cave	NOUN
finefocus-615	335	20	constructed	construct	VERB
finefocus-615	335	21	centuries	century	NOUN
finefocus-615	335	22	ago	ago	ADV
finefocus-615	335	23	.	.	PUNCT
finefocus-615	336	1	thus	thus	ADV
finefocus-615	336	2	,	,	PUNCT
finefocus-615	336	3	the	the	DET
finefocus-615	336	4	microorganisms	microorganism	NOUN
finefocus-615	336	5	on	on	ADP
finefocus-615	336	6	such	such	ADJ
finefocus-615	336	7	surfaces	surface	NOUN
finefocus-615	336	8	could	could	AUX
finefocus-615	336	9	have	have	AUX
finefocus-615	336	10	had	have	VERB
finefocus-615	336	11	an	an	DET
finefocus-615	336	12	opportunity	opportunity	NOUN
finefocus-615	336	13	to	to	PART
finefocus-615	336	14	develop	develop	VERB
finefocus-615	336	15	resistance	resistance	NOUN
finefocus-615	336	16	over	over	ADP
finefocus-615	336	17	a	a	DET
finefocus-615	336	18	longer	long	ADJ
finefocus-615	336	19	period	period	NOUN
finefocus-615	336	20	of	of	ADP
finefocus-615	336	21	time	time	NOUN
finefocus-615	336	22	.	.	PUNCT
finefocus-615	337	1	the	the	DET
finefocus-615	337	2	documentation	documentation	NOUN
finefocus-615	337	3	of	of	ADP
finefocus-615	337	4	antibiotic	antibiotic	ADJ
finefocus-615	337	5	resistance	resistance	NOUN
finefocus-615	337	6	within	within	ADP
finefocus-615	337	7	cheese	cheese	NOUN
finefocus-615	337	8	microbiota	microbiota	NOUN
finefocus-615	337	9	is	be	AUX
finefocus-615	337	10	a	a	DET
finefocus-615	337	11	public	public	ADJ
finefocus-615	337	12	health	health	NOUN
finefocus-615	337	13	concern	concern	NOUN
finefocus-615	337	14	due	due	ADP
finefocus-615	337	15	to	to	ADP
finefocus-615	337	16	the	the	DET
finefocus-615	337	17	possibility	possibility	NOUN
finefocus-615	337	18	of	of	ADP
finefocus-615	337	19	a	a	DET
finefocus-615	337	20	transfer	transfer	NOUN
finefocus-615	337	21	of	of	ADP
finefocus-615	337	22	resistance	resistance	NOUN
finefocus-615	337	23	to	to	ADP
finefocus-615	337	24	pathogenic	pathogenic	ADJ
finefocus-615	337	25	bacteria	bacteria	NOUN
finefocus-615	337	26	in	in	ADP
finefocus-615	337	27	the	the	DET
finefocus-615	337	28	human	human	ADJ
finefocus-615	337	29	colon	colon	NOUN
finefocus-615	337	30	upon	upon	SCONJ
finefocus-615	337	31	consumption	consumption	NOUN
finefocus-615	337	32	(	(	PUNCT
finefocus-615	337	33	42	42	NUM
finefocus-615	337	34	)	)	PUNCT
finefocus-615	337	35	.	.	PUNCT
finefocus-615	338	1	consequently	consequently	ADV
finefocus-615	338	2	,	,	PUNCT
finefocus-615	338	3	an	an	DET
finefocus-615	338	4	understanding	understanding	NOUN
finefocus-615	338	5	of	of	ADP
finefocus-615	338	6	the	the	DET
finefocus-615	338	7	stability	stability	NOUN
finefocus-615	338	8	,	,	PUNCT
finefocus-615	338	9	diversity	diversity	NOUN
finefocus-615	338	10	,	,	PUNCT
finefocus-615	338	11	metabolism	metabolism	NOUN
finefocus-615	338	12	,	,	PUNCT
finefocus-615	338	13	and	and	CCONJ
finefocus-615	338	14	antimicrobial	antimicrobial	ADJ
finefocus-615	338	15	resistance	resistance	NOUN
finefocus-615	338	16	of	of	ADP
finefocus-615	338	17	rind	rind	NOUN
finefocus-615	338	18	and	and	CCONJ
finefocus-615	338	19	curd	curd	NOUN
finefocus-615	338	20	microbiota	microbiota	NOUN
finefocus-615	338	21	would	would	AUX
finefocus-615	338	22	advance	advance	VERB
finefocus-615	338	23	cheese	cheese	NOUN
finefocus-615	338	24	production	production	NOUN
finefocus-615	338	25	and	and	CCONJ
finefocus-615	338	26	safety	safety	NOUN
finefocus-615	338	27	.	.	PUNCT
finefocus-615	339	1	bacterial	bacterial	ADJ
finefocus-615	339	2	community	community	NOUN
finefocus-615	339	3	structure	structure	NOUN
finefocus-615	339	4	in	in	ADP
finefocus-615	339	5	cheese	cheese	NOUN
finefocus-615	339	6	•	•	NUM
finefocus-615	339	7	25	25	NUM
finefocus-615	339	8	supplementary	supplementary	ADJ
finefocus-615	339	9	table	table	NOUN
finefocus-615	339	10	2	2	NUM
finefocus-615	339	11	m	m	NOUN
finefocus-615	339	12	is	be	AUX
finefocus-615	339	13	so	so	ADV
finefocus-615	339	14	u	u	NOUN
finefocus-615	340	1	r	r	NOUN
finefocus-615	341	1	i	i	PRON
finefocus-615	341	2	t	t	PROPN
finefocus-615	341	3	ru	ru	NOUN
finefocus-615	341	4	ck	ck	PROPN
finefocus-615	341	5	le	le	X
finefocus-615	341	6	br	br	PROPN
finefocus-615	341	7	a	a	DET
finefocus-615	341	8	ch	ch	NOUN
finefocus-615	342	1	y	y	PROPN
finefocus-615	342	2	ba	ba	PROPN
finefocus-615	342	3	c	c	NOUN
finefocus-615	342	4	te	te	PROPN
finefocus-615	342	5	r	r	PROPN
finefocus-615	342	6	iu	iu	ADP
finefocus-615	342	7	m	m	PROPN
finefocus-615	342	8	a	a	PRON
finefocus-615	342	9	i	i	NOUN
finefocus-615	342	10	m	m	VERB
finefocus-615	342	11	en	en	ADP
finefocus-615	342	12	ta	ta	X
finefocus-615	342	13	r	r	NOUN
finefocus-615	342	14	iu	iu	PROPN
finefocus-615	342	15	m	m	PROPN
finefocus-615	342	16	st	st	PROPN
finefocus-615	342	17	a	a	DET
finefocus-615	342	18	ph	ph	PROPN
finefocus-615	342	19	y	y	PROPN
finefocus-615	342	20	lo	lo	NOUN
finefocus-615	343	1	c	c	NOUN
finefocus-615	344	1	o	o	NOUN
finefocus-615	344	2	c	c	NOUN
finefocus-615	344	3	c	c	X
finefocus-615	344	4	u	u	NOUN
finefocus-615	344	5	s	s	PROPN
finefocus-615	344	6	w	w	NOUN
finefocus-615	344	7	a	a	DET
finefocus-615	344	8	r	r	NOUN
finefocus-615	344	9	n	n	NOUN
finefocus-615	345	1	er	er	INTJ
finefocus-615	345	2	i	i	PRON
finefocus-615	345	3	a	a	DET
finefocus-615	345	4	lp	lp	NOUN
finefocus-615	345	5	a	a	DET
finefocus-615	345	6	g	g	NOUN
finefocus-615	346	1	e	e	NOUN
finefocus-615	346	2	g	g	PROPN
finefocus-615	346	3	ru	ru	PROPN
finefocus-615	346	4	y	y	PROPN
finefocus-615	346	5	er	er	INTJ
finefocus-615	346	6	e	e	X
finefocus-615	347	1	c	c	NOUN
finefocus-615	347	2	o	o	X
finefocus-615	347	3	ry	ry	VERB
finefocus-615	347	4	n	n	PROPN
finefocus-615	347	5	eb	eb	PROPN
finefocus-615	347	6	a	a	PRON
finefocus-615	347	7	c	c	NOUN
finefocus-615	347	8	te	te	ADP
finefocus-615	347	9	r	r	NOUN
finefocus-615	347	10	iu	iu	ADP
finefocus-615	347	11	m	m	PROPN
finefocus-615	347	12	c	c	NOUN
finefocus-615	348	1	a	a	X
finefocus-615	348	2	se	se	INTJ
finefocus-615	349	1	i	i	PRON
finefocus-615	349	2	br	br	VERB
finefocus-615	349	3	ev	ev	INTJ
finefocus-615	349	4	ib	ib	PROPN
finefocus-615	350	1	a	a	PRON
finefocus-615	350	2	c	c	NOUN
finefocus-615	350	3	te	te	ADP
finefocus-615	350	4	r	r	NOUN
finefocus-615	350	5	iu	iu	ADP
finefocus-615	350	6	m	m	PROPN
finefocus-615	350	7	a	a	DET
finefocus-615	350	8	u	u	NOUN
finefocus-615	350	9	r	r	NOUN
finefocus-615	350	10	a	a	PRON
finefocus-615	350	11	n	n	NOUN
finefocus-615	350	12	ti	ti	NOUN
finefocus-615	350	13	a	a	DET
finefocus-615	350	14	c	c	NOUN
finefocus-615	350	15	u	u	NOUN
finefocus-615	350	16	m	m	NOUN
finefocus-615	350	17	c	c	NOUN
finefocus-615	350	18	o	o	NOUN
finefocus-615	350	19	m	m	VERB
finefocus-615	350	20	te	te	ADP
finefocus-615	350	21	u	u	PROPN
finefocus-615	350	22	n	n	ADP
finefocus-615	350	23	c	c	X
finefocus-615	350	24	le	le	X
finefocus-615	351	1	a	a	DET
finefocus-615	351	2	r	r	NOUN
finefocus-615	351	3	u	u	NOUN
finefocus-615	351	4	n	n	ADP
finefocus-615	351	5	c	c	X
finefocus-615	351	6	le	le	X
finefocus-615	352	1	a	a	DET
finefocus-615	352	2	r	r	NOUN
finefocus-615	352	3	m	m	VERB
finefocus-615	352	4	a	a	DET
finefocus-615	352	5	g	g	NOUN
finefocus-615	352	6	g	g	PROPN
finefocus-615	352	7	ie	ie	X
finefocus-615	352	8	’s	’s	PART
finefocus-615	352	9	r	r	NOUN
finefocus-615	352	10	o	o	NOUN
finefocus-615	352	11	u	u	NOUN
finefocus-615	352	12	n	n	PROPN
finefocus-615	352	13	d	d	PROPN
finefocus-615	352	14	s	s	VERB
finefocus-615	352	15	ba	ba	PROPN
finefocus-615	352	16	ci	ci	PROPN
finefocus-615	352	17	ll	ll	PROPN
finefocus-615	352	18	u	u	PROPN
finefocus-615	352	19	s	s	NOUN
finefocus-615	352	20	m	m	VERB
finefocus-615	352	21	o	o	NOUN
finefocus-615	352	22	ja	ja	INTJ
finefocus-615	352	23	v	v	INTJ
finefocus-615	352	24	en	en	INTJ
finefocus-615	352	25	si	si	PROPN
finefocus-615	352	26	s	s	PROPN
finefocus-615	352	27	u	u	PROPN
finefocus-615	352	28	n	n	ADP
finefocus-615	352	29	c	c	X
finefocus-615	352	30	le	le	X
finefocus-615	353	1	a	a	DET
finefocus-615	353	2	r	r	NOUN
finefocus-615	353	3	st	st	PROPN
finefocus-615	353	4	ic	ic	PROPN
finefocus-615	353	5	h	h	PROPN
finefocus-615	353	6	el	el	PROPN
finefocus-615	353	7	to	to	ADP
finefocus-615	353	8	n	n	PROPN
finefocus-615	353	9	g	g	PROPN
finefocus-615	353	10	r	r	NOUN
finefocus-615	353	11	ee	ee	PROPN
finefocus-615	353	12	n	n	PROPN
finefocus-615	353	13	c	c	NOUN
finefocus-615	353	14	u	u	NOUN
finefocus-615	354	1	r	r	NOUN
finefocus-615	354	2	d	d	PROPN
finefocus-615	354	3	w	w	NOUN
finefocus-615	354	4	h	h	NOUN
finefocus-615	354	5	it	it	PRON
finefocus-615	354	6	e	e	X
finefocus-615	354	7	c	c	NOUN
finefocus-615	354	8	u	u	NOUN
finefocus-615	354	9	r	r	NOUN
finefocus-615	354	10	d	d	PROPN
finefocus-615	354	11	u	u	NOUN
finefocus-615	354	12	n	n	PROPN
finefocus-615	354	13	c	c	X
finefocus-615	354	14	le	le	X
finefocus-615	354	15	a	a	DET
finefocus-615	354	16	r	r	NOUN
finefocus-615	354	17	u	u	NOUN
finefocus-615	354	18	n	n	ADP
finefocus-615	354	19	c	c	X
finefocus-615	354	20	le	le	X
finefocus-615	355	1	a	a	DET
finefocus-615	355	2	r	r	NOUN
finefocus-615	355	3	u	u	NOUN
finefocus-615	355	4	n	n	ADP
finefocus-615	355	5	c	c	X
finefocus-615	355	6	le	le	X
finefocus-615	356	1	a	a	DET
finefocus-615	356	2	r	r	NOUN
finefocus-615	356	3	pyruvic	pyruvic	ADJ
finefocus-615	356	4	acid	acid	NOUN
finefocus-615	356	5	methyl	methyl	NOUN
finefocus-615	356	6	ester	ester	NOUN
finefocus-615	356	7	1	1	NUM
finefocus-615	356	8	1	1	NUM
finefocus-615	356	9	1	1	NUM
finefocus-615	356	10	1	1	NUM
finefocus-615	356	11	1	1	NUM
finefocus-615	356	12	1	1	NUM
finefocus-615	356	13	1	1	NUM
finefocus-615	356	14	0	0	NUM
finefocus-615	356	15	1	1	NUM
finefocus-615	356	16	1	1	NUM
finefocus-615	356	17	1	1	NUM
finefocus-615	356	18	0	0	NUM
finefocus-615	356	19	1	1	NUM
finefocus-615	356	20	1	1	NUM
finefocus-615	356	21	1	1	NUM
finefocus-615	356	22	1	1	NUM
finefocus-615	356	23	1	1	NUM
finefocus-615	356	24	0	0	NUM
finefocus-615	356	25	tween-40	tween-40	NOUN
finefocus-615	356	26	1	1	NUM
finefocus-615	356	27	1	1	NUM
finefocus-615	356	28	1	1	NUM
finefocus-615	356	29	1	1	NUM
finefocus-615	356	30	1	1	NUM
finefocus-615	356	31	1	1	NUM
finefocus-615	356	32	1	1	NUM
finefocus-615	356	33	1	1	NUM
finefocus-615	356	34	1	1	NUM
finefocus-615	356	35	1	1	NUM
finefocus-615	356	36	1	1	NUM
finefocus-615	356	37	1	1	NUM
finefocus-615	356	38	1	1	NUM
finefocus-615	356	39	1	1	NUM
finefocus-615	356	40	1	1	NUM
finefocus-615	356	41	1	1	NUM
finefocus-615	356	42	1	1	NUM
finefocus-615	356	43	0	0	NUM
finefocus-615	356	44	tween-80	tween-80	NUM
finefocus-615	356	45	1	1	NUM
finefocus-615	356	46	1	1	NUM
finefocus-615	356	47	1	1	NUM
finefocus-615	356	48	1	1	NUM
finefocus-615	356	49	1	1	NUM
finefocus-615	356	50	1	1	NUM
finefocus-615	356	51	1	1	NUM
finefocus-615	356	52	1	1	NUM
finefocus-615	356	53	1	1	NUM
finefocus-615	356	54	1	1	NUM
finefocus-615	356	55	1	1	NUM
finefocus-615	356	56	1	1	NUM
finefocus-615	356	57	0	0	NUM
finefocus-615	356	58	0	0	NUM
finefocus-615	356	59	0	0	NUM
finefocus-615	357	1	1‡	1‡	NUM
finefocus-615	357	2	1‡	1‡	NUM
finefocus-615	357	3	0	0	NUM
finefocus-615	357	4	cyclodextrin	cyclodextrin	NOUN
finefocus-615	357	5	1	1	NUM
finefocus-615	357	6	1	1	NUM
finefocus-615	357	7	1	1	NUM
finefocus-615	357	8	1	1	NUM
finefocus-615	357	9	1	1	NUM
finefocus-615	357	10	1	1	NUM
finefocus-615	357	11	1	1	NUM
finefocus-615	357	12	1	1	NUM
finefocus-615	357	13	1	1	NUM
finefocus-615	357	14	1	1	NUM
finefocus-615	357	15	0	0	NUM
finefocus-615	357	16	1	1	NUM
finefocus-615	357	17	1	1	NUM
finefocus-615	357	18	*	*	SYM
finefocus-615	357	19	1	1	NUM
finefocus-615	357	20	0	0	NUM
finefocus-615	357	21	0	0	NUM
finefocus-615	357	22	0	0	NUM
finefocus-615	357	23	0	0	NUM
finefocus-615	357	24	glycogen	glycogen	NOUN
finefocus-615	357	25	1	1	NUM
finefocus-615	357	26	1	1	NUM
finefocus-615	357	27	1	1	NUM
finefocus-615	357	28	1	1	NUM
finefocus-615	357	29	1	1	NUM
finefocus-615	357	30	1	1	NUM
finefocus-615	357	31	1	1	NUM
finefocus-615	357	32	1	1	NUM
finefocus-615	357	33	0	0	NUM
finefocus-615	357	34	1	1	NUM
finefocus-615	357	35	1	1	NUM
finefocus-615	357	36	0	0	NUM
finefocus-615	357	37	0	0	NUM
finefocus-615	357	38	0	0	NUM
finefocus-615	357	39	0	0	NUM
finefocus-615	357	40	0	0	NUM
finefocus-615	357	41	0	0	NUM
finefocus-615	357	42	0	0	NUM
finefocus-615	357	43	d	d	X
finefocus-615	357	44	-	-	PUNCT
finefocus-615	357	45	cellobiose	cellobiose	VERB
finefocus-615	357	46	1	1	NUM
finefocus-615	357	47	1	1	NUM
finefocus-615	357	48	1	1	NUM
finefocus-615	357	49	1	1	NUM
finefocus-615	357	50	1	1	NUM
finefocus-615	357	51	1	1	NUM
finefocus-615	357	52	1	1	NUM
finefocus-615	357	53	1	1	NUM
finefocus-615	357	54	1	1	NUM
finefocus-615	357	55	1	1	NUM
finefocus-615	357	56	1	1	NUM
finefocus-615	357	57	1	1	NUM
finefocus-615	357	58	1	1	NUM
finefocus-615	357	59	1	1	NUM
finefocus-615	357	60	1	1	NUM
finefocus-615	357	61	1	1	NUM
finefocus-615	357	62	1	1	NUM
finefocus-615	357	63	0	0	NUM
finefocus-615	357	64	alpha	alpha	NOUN
finefocus-615	357	65	-	-	PUNCT
finefocus-615	357	66	d	d	NOUN
finefocus-615	357	67	-	-	NOUN
finefocus-615	357	68	lactose	lactose	ADJ
finefocus-615	357	69	1	1	NUM
finefocus-615	357	70	*	*	SYM
finefocus-615	357	71	0	0	NUM
finefocus-615	357	72	0	0	NUM
finefocus-615	357	73	1	1	NUM
finefocus-615	357	74	*	*	SYM
finefocus-615	357	75	0	0	NUM
finefocus-615	357	76	0	0	NUM
finefocus-615	357	77	1	1	NUM
finefocus-615	357	78	1	1	NUM
finefocus-615	357	79	0	0	NUM
finefocus-615	357	80	1	1	NUM
finefocus-615	357	81	*	*	SYM
finefocus-615	357	82	0	0	NUM
finefocus-615	357	83	0	0	NUM
finefocus-615	357	84	0	0	NUM
finefocus-615	357	85	1	1	NUM
finefocus-615	357	86	0	0	NUM
finefocus-615	357	87	1	1	NUM
finefocus-615	357	88	0	0	NUM
finefocus-615	357	89	0	0	NUM
finefocus-615	357	90	beta	beta	ADJ
finefocus-615	357	91	-methyl	-methyl	NOUN
finefocus-615	357	92	-	-	PUNCT
finefocus-615	357	93	d	d	NOUN
finefocus-615	357	94	-	-	NOUN
finefocus-615	357	95	dlucoside	dlucoside	NOUN
finefocus-615	357	96	1	1	NUM
finefocus-615	357	97	1	1	NUM
finefocus-615	357	98	1	1	NUM
finefocus-615	357	99	0	0	NUM
finefocus-615	357	100	1	1	NUM
finefocus-615	357	101	1	1	NUM
finefocus-615	357	102	0	0	NUM
finefocus-615	358	1	1‡	1‡	NUM
finefocus-615	358	2	0	0	NUM
finefocus-615	358	3	0	0	NUM
finefocus-615	358	4	1	1	NUM
finefocus-615	358	5	0	0	NUM
finefocus-615	358	6	0	0	NUM
finefocus-615	358	7	0	0	NUM
finefocus-615	358	8	0	0	NUM
finefocus-615	358	9	0	0	NUM
finefocus-615	358	10	0	0	NUM
finefocus-615	358	11	0	0	NUM
finefocus-615	359	1	d	d	X
finefocus-615	359	2	-	-	PUNCT
finefocus-615	359	3	xylose	xylose	ADJ
finefocus-615	359	4	1	1	NUM
finefocus-615	359	5	1	1	NUM
finefocus-615	359	6	1	1	NUM
finefocus-615	359	7	1	1	NUM
finefocus-615	359	8	1	1	NUM
finefocus-615	359	9	1	1	NUM
finefocus-615	359	10	1	1	NUM
finefocus-615	359	11	*	*	SYM
finefocus-615	359	12	0	0	NUM
finefocus-615	359	13	0	0	NUM
finefocus-615	359	14	1	1	NUM
finefocus-615	359	15	1	1	NUM
finefocus-615	359	16	1	1	NUM
finefocus-615	359	17	0	0	NUM
finefocus-615	359	18	0	0	NUM
finefocus-615	359	19	0	0	NUM
finefocus-615	359	20	0	0	NUM
finefocus-615	359	21	0	0	NUM
finefocus-615	359	22	0	0	NUM
finefocus-615	360	1	i	i	PRON
finefocus-615	360	2	-	-	PUNCT
finefocus-615	360	3	erythroitol	erythroitol	VERB
finefocus-615	360	4	1	1	NUM
finefocus-615	360	5	1	1	NUM
finefocus-615	360	6	1	1	NUM
finefocus-615	360	7	1	1	NUM
finefocus-615	360	8	1	1	NUM
finefocus-615	360	9	0	0	NUM
finefocus-615	360	10	1	1	NUM
finefocus-615	360	11	1	1	NUM
finefocus-615	360	12	0	0	NUM
finefocus-615	360	13	1	1	NUM
finefocus-615	360	14	1	1	NUM
finefocus-615	360	15	1	1	NUM
finefocus-615	360	16	1	1	NUM
finefocus-615	360	17	0	0	NUM
finefocus-615	360	18	0	0	NUM
finefocus-615	360	19	1	1	NUM
finefocus-615	360	20	1	1	NUM
finefocus-615	360	21	1	1	NUM
finefocus-615	360	22	d	d	NOUN
finefocus-615	360	23	mannitol	mannitol	NOUN
finefocus-615	360	24	1	1	NUM
finefocus-615	360	25	1	1	NUM
finefocus-615	360	26	1	1	NUM
finefocus-615	360	27	1	1	NUM
finefocus-615	360	28	1	1	NUM
finefocus-615	360	29	1	1	NUM
finefocus-615	360	30	1	1	NUM
finefocus-615	360	31	1	1	NUM
finefocus-615	360	32	0	0	NUM
finefocus-615	360	33	1	1	NUM
finefocus-615	360	34	1	1	NUM
finefocus-615	360	35	0	0	NUM
finefocus-615	360	36	1	1	NUM
finefocus-615	360	37	1	1	NUM
finefocus-615	360	38	1	1	NUM
finefocus-615	360	39	1	1	NUM
finefocus-615	360	40	1	1	NUM
finefocus-615	360	41	1	1	NUM
finefocus-615	360	42	n	n	CCONJ
finefocus-615	360	43	-	-	PUNCT
finefocus-615	360	44	acetyl	acetyl	NOUN
finefocus-615	360	45	-	-	PUNCT
finefocus-615	360	46	d	d	NOUN
finefocus-615	360	47	-	-	NOUN
finefocus-615	360	48	glucosamine	glucosamine	NOUN
finefocus-615	360	49	1	1	NUM
finefocus-615	360	50	1	1	NUM
finefocus-615	360	51	1	1	NUM
finefocus-615	360	52	1	1	NUM
finefocus-615	360	53	1	1	NUM
finefocus-615	360	54	1	1	NUM
finefocus-615	360	55	1	1	NUM
finefocus-615	360	56	*	*	SYM
finefocus-615	360	57	0	0	NUM
finefocus-615	360	58	0	0	NUM
finefocus-615	360	59	1	1	NUM
finefocus-615	360	60	1	1	NUM
finefocus-615	360	61	1	1	NUM
finefocus-615	360	62	0	0	NUM
finefocus-615	360	63	0	0	NUM
finefocus-615	360	64	0	0	NUM
finefocus-615	360	65	0	0	NUM
finefocus-615	360	66	0	0	NUM
finefocus-615	360	67	0	0	NUM
finefocus-615	361	1	d	d	ADJ
finefocus-615	361	2	-	-	ADJ
finefocus-615	361	3	glucosaminic	glucosaminic	ADJ
finefocus-615	361	4	acid	acid	NOUN
finefocus-615	361	5	1	1	NUM
finefocus-615	361	6	*	*	SYM
finefocus-615	361	7	0	0	NUM
finefocus-615	361	8	0	0	NUM
finefocus-615	361	9	0	0	NUM
finefocus-615	361	10	0	0	NUM
finefocus-615	361	11	0	0	NUM
finefocus-615	361	12	0	0	NUM
finefocus-615	362	1	1‡	1‡	NUM
finefocus-615	362	2	0	0	NUM
finefocus-615	362	3	0	0	NUM
finefocus-615	362	4	0	0	NUM
finefocus-615	363	1	1‡	1‡	NUM
finefocus-615	363	2	1	1	NUM
finefocus-615	363	3	1	1	NUM
finefocus-615	363	4	1	1	NUM
finefocus-615	363	5	1	1	NUM
finefocus-615	363	6	1	1	NUM
finefocus-615	363	7	1	1	NUM
finefocus-615	363	8	glucose-1	glucose-1	NOUN
finefocus-615	363	9	-	-	NOUN
finefocus-615	363	10	phosphate	phosphate	NOUN
finefocus-615	363	11	0	0	NUM
finefocus-615	363	12	0	0	NUM
finefocus-615	363	13	0	0	NUM
finefocus-615	363	14	0	0	NUM
finefocus-615	363	15	0	0	NUM
finefocus-615	363	16	0	0	NUM
finefocus-615	363	17	0	0	NUM
finefocus-615	363	18	0	0	NUM
finefocus-615	363	19	0	0	NUM
finefocus-615	363	20	0	0	NUM
finefocus-615	363	21	0	0	NUM
finefocus-615	363	22	0	0	NUM
finefocus-615	363	23	0	0	NUM
finefocus-615	363	24	0	0	NUM
finefocus-615	363	25	0	0	NUM
finefocus-615	363	26	0	0	NUM
finefocus-615	363	27	0	0	NUM
finefocus-615	363	28	0	0	NUM
finefocus-615	364	1	d	d	NOUN
finefocus-615	364	2	,	,	PUNCT
finefocus-615	364	3	l	l	ADJ
finefocus-615	364	4	-	-	ADJ
finefocus-615	364	5	alpha	alpha	ADJ
finefocus-615	364	6	-	-	PUNCT
finefocus-615	364	7	glycerol	glycerol	NOUN
finefocus-615	364	8	phosphate	phosphate	NOUN
finefocus-615	364	9	0	0	NUM
finefocus-615	364	10	0	0	NUM
finefocus-615	364	11	0	0	NUM
finefocus-615	364	12	0	0	NUM
finefocus-615	364	13	0	0	NUM
finefocus-615	364	14	0	0	NUM
finefocus-615	364	15	0	0	NUM
finefocus-615	365	1	1‡	1‡	NUM
finefocus-615	365	2	0	0	NUM
finefocus-615	365	3	0	0	NUM
finefocus-615	365	4	0	0	NUM
finefocus-615	365	5	0	0	NUM
finefocus-615	365	6	0	0	NUM
finefocus-615	365	7	0	0	NUM
finefocus-615	365	8	0	0	NUM
finefocus-615	365	9	0	0	NUM
finefocus-615	365	10	0	0	NUM
finefocus-615	365	11	0	0	NUM
finefocus-615	366	1	d	d	ADJ
finefocus-615	366	2	-	-	ADJ
finefocus-615	366	3	galactonic	galactonic	ADJ
finefocus-615	366	4	acid	acid	NOUN
finefocus-615	366	5	,	,	PUNCT
finefocus-615	366	6	gamma	gamma	NOUN
finefocus-615	366	7	-	-	PUNCT
finefocus-615	366	8	lactone	lactone	NOUN
finefocus-615	366	9	0	0	NUM
finefocus-615	366	10	0	0	NUM
finefocus-615	366	11	0	0	NUM
finefocus-615	366	12	0	0	NUM
finefocus-615	366	13	0	0	NUM
finefocus-615	366	14	0	0	NUM
finefocus-615	366	15	0	0	NUM
finefocus-615	366	16	0	0	NUM
finefocus-615	366	17	0	0	NUM
finefocus-615	366	18	0	0	NUM
finefocus-615	366	19	0	0	NUM
finefocus-615	366	20	0	0	NUM
finefocus-615	366	21	1	1	NUM
finefocus-615	366	22	1	1	NUM
finefocus-615	366	23	1	1	NUM
finefocus-615	366	24	1	1	NUM
finefocus-615	366	25	1	1	NUM
finefocus-615	366	26	1	1	NUM
finefocus-615	366	27	d	d	ADJ
finefocus-615	366	28	-	-	PUNCT
finefocus-615	366	29	galacturonic	galacturonic	ADJ
finefocus-615	366	30	acid	acid	NOUN
finefocus-615	366	31	1	1	NUM
finefocus-615	366	32	1	1	NUM
finefocus-615	366	33	1	1	NUM
finefocus-615	366	34	1	1	NUM
finefocus-615	366	35	1	1	NUM
finefocus-615	366	36	1	1	NUM
finefocus-615	366	37	0	0	NUM
finefocus-615	366	38	0	0	NUM
finefocus-615	366	39	0	0	NUM
finefocus-615	366	40	1	1	NUM
finefocus-615	366	41	*	*	SYM
finefocus-615	366	42	0	0	NUM
finefocus-615	366	43	0	0	NUM
finefocus-615	366	44	1	1	NUM
finefocus-615	366	45	1	1	NUM
finefocus-615	366	46	1	1	NUM
finefocus-615	366	47	1	1	NUM
finefocus-615	366	48	1	1	NUM
finefocus-615	366	49	1	1	NUM
finefocus-615	366	50	2	2	NUM
finefocus-615	366	51	-	-	PUNCT
finefocus-615	366	52	hydroxy	hydroxy	NOUN
finefocus-615	366	53	benzoic	benzoic	NOUN
finefocus-615	366	54	acid	acid	NOUN
finefocus-615	366	55	0	0	NUM
finefocus-615	366	56	0	0	NUM
finefocus-615	366	57	0	0	NUM
finefocus-615	366	58	1	1	NUM
finefocus-615	366	59	*	*	SYM
finefocus-615	366	60	0	0	NUM
finefocus-615	366	61	0	0	NUM
finefocus-615	366	62	0	0	NUM
finefocus-615	366	63	0	0	NUM
finefocus-615	366	64	0	0	NUM
finefocus-615	366	65	0	0	NUM
finefocus-615	366	66	0	0	NUM
finefocus-615	366	67	0	0	NUM
finefocus-615	366	68	0	0	NUM
finefocus-615	366	69	0	0	NUM
finefocus-615	366	70	0	0	NUM
finefocus-615	366	71	0	0	NUM
finefocus-615	366	72	0	0	NUM
finefocus-615	366	73	0	0	NUM
finefocus-615	366	74	4	4	NUM
finefocus-615	366	75	-	-	PUNCT
finefocus-615	366	76	hydroxy	hydroxy	ADJ
finefocus-615	366	77	benzoic	benzoic	NOUN
finefocus-615	366	78	acid	acid	NOUN
finefocus-615	366	79	0	0	NUM
finefocus-615	366	80	0	0	NUM
finefocus-615	366	81	0	0	NUM
finefocus-615	366	82	1	1	NUM
finefocus-615	366	83	*	*	SYM
finefocus-615	366	84	0	0	NUM
finefocus-615	366	85	0	0	NUM
finefocus-615	366	86	0	0	NUM
finefocus-615	366	87	0	0	NUM
finefocus-615	366	88	0	0	NUM
finefocus-615	366	89	1	1	NUM
finefocus-615	366	90	*	*	SYM
finefocus-615	366	91	0	0	NUM
finefocus-615	366	92	0	0	NUM
finefocus-615	366	93	1	1	NUM
finefocus-615	366	94	1	1	NUM
finefocus-615	366	95	1	1	NUM
finefocus-615	366	96	1	1	NUM
finefocus-615	366	97	1	1	NUM
finefocus-615	366	98	1	1	NUM
finefocus-615	366	99	hydroxybutyric	hydroxybutyric	ADJ
finefocus-615	366	100	acid	acid	NOUN
finefocus-615	366	101	0	0	NUM
finefocus-615	366	102	0	0	NUM
finefocus-615	367	1	1‡	1‡	NUM
finefocus-615	367	2	1	1	NUM
finefocus-615	367	3	*	*	SYM
finefocus-615	367	4	0	0	NUM
finefocus-615	367	5	0	0	NUM
finefocus-615	367	6	0	0	NUM
finefocus-615	368	1	1‡	1‡	NUM
finefocus-615	368	2	0	0	NUM
finefocus-615	368	3	0	0	NUM
finefocus-615	368	4	0	0	NUM
finefocus-615	368	5	0	0	NUM
finefocus-615	368	6	0	0	NUM
finefocus-615	368	7	0	0	NUM
finefocus-615	368	8	0	0	NUM
finefocus-615	368	9	0	0	NUM
finefocus-615	368	10	0	0	NUM
finefocus-615	368	11	0	0	NUM
finefocus-615	368	12	itaconic	itaconic	ADJ
finefocus-615	368	13	acid	acid	NOUN
finefocus-615	368	14	0	0	NUM
finefocus-615	368	15	0	0	NUM
finefocus-615	368	16	0	0	NUM
finefocus-615	368	17	1	1	NUM
finefocus-615	368	18	*	*	SYM
finefocus-615	368	19	0	0	NUM
finefocus-615	368	20	0	0	NUM
finefocus-615	368	21	0	0	NUM
finefocus-615	368	22	0	0	NUM
finefocus-615	368	23	0	0	NUM
finefocus-615	368	24	1	1	NUM
finefocus-615	368	25	*	*	SYM
finefocus-615	368	26	0	0	NUM
finefocus-615	368	27	0	0	NUM
finefocus-615	368	28	1	1	NUM
finefocus-615	368	29	1	1	NUM
finefocus-615	368	30	1	1	NUM
finefocus-615	368	31	1	1	NUM
finefocus-615	368	32	1	1	NUM
finefocus-615	368	33	1	1	NUM
finefocus-615	368	34	alpha	alpha	NOUN
finefocus-615	368	35	-	-	PUNCT
finefocus-615	368	36	ketobutyric	ketobutyric	ADJ
finefocus-615	368	37	acid	acid	NOUN
finefocus-615	368	38	0	0	NUM
finefocus-615	368	39	0	0	NUM
finefocus-615	368	40	0	0	NUM
finefocus-615	368	41	1	1	NUM
finefocus-615	368	42	*	*	SYM
finefocus-615	368	43	0	0	NUM
finefocus-615	368	44	0	0	NUM
finefocus-615	368	45	0	0	NUM
finefocus-615	368	46	0	0	NUM
finefocus-615	368	47	0	0	NUM
finefocus-615	368	48	1	1	NUM
finefocus-615	368	49	*	*	SYM
finefocus-615	368	50	0	0	NUM
finefocus-615	368	51	0	0	NUM
finefocus-615	368	52	0	0	NUM
finefocus-615	368	53	0	0	NUM
finefocus-615	368	54	0	0	NUM
finefocus-615	369	1	1‡	1‡	NUM
finefocus-615	369	2	0	0	NUM
finefocus-615	369	3	0	0	NUM
finefocus-615	369	4	d	d	X
finefocus-615	369	5	-	-	PUNCT
finefocus-615	369	6	malic	malic	ADJ
finefocus-615	369	7	acid	acid	NOUN
finefocus-615	369	8	0	0	NUM
finefocus-615	369	9	0	0	NUM
finefocus-615	369	10	0	0	NUM
finefocus-615	369	11	1	1	NUM
finefocus-615	369	12	0	0	NUM
finefocus-615	369	13	1	1	NUM
finefocus-615	369	14	1	1	NUM
finefocus-615	369	15	*	*	SYM
finefocus-615	369	16	0	0	NUM
finefocus-615	369	17	0	0	NUM
finefocus-615	369	18	1	1	NUM
finefocus-615	369	19	*	*	SYM
finefocus-615	369	20	0	0	NUM
finefocus-615	369	21	0	0	NUM
finefocus-615	369	22	1	1	NUM
finefocus-615	369	23	1	1	NUM
finefocus-615	369	24	1	1	NUM
finefocus-615	369	25	1	1	NUM
finefocus-615	369	26	1	1	NUM
finefocus-615	369	27	1	1	NUM
finefocus-615	369	28	l	l	NOUN
finefocus-615	369	29	-	-	NOUN
finefocus-615	369	30	arginine	arginine	NOUN
finefocus-615	369	31	1	1	NUM
finefocus-615	369	32	*	*	SYM
finefocus-615	369	33	0	0	NUM
finefocus-615	369	34	0	0	NUM
finefocus-615	369	35	0	0	NUM
finefocus-615	369	36	0	0	NUM
finefocus-615	369	37	0	0	NUM
finefocus-615	369	38	0	0	NUM
finefocus-615	369	39	0	0	NUM
finefocus-615	369	40	0	0	NUM
finefocus-615	369	41	0	0	NUM
finefocus-615	369	42	0	0	NUM
finefocus-615	369	43	0	0	NUM
finefocus-615	369	44	1	1	NUM
finefocus-615	369	45	1	1	NUM
finefocus-615	369	46	1	1	NUM
finefocus-615	369	47	1	1	NUM
finefocus-615	369	48	0	0	NUM
finefocus-615	369	49	1	1	NUM
finefocus-615	369	50	l	l	NOUN
finefocus-615	369	51	-	-	NOUN
finefocus-615	369	52	asparagine	asparagine	ADJ
finefocus-615	369	53	1	1	NUM
finefocus-615	369	54	1	1	NUM
finefocus-615	369	55	1	1	NUM
finefocus-615	369	56	1	1	NUM
finefocus-615	369	57	1	1	NUM
finefocus-615	369	58	1	1	NUM
finefocus-615	369	59	0	0	NUM
finefocus-615	369	60	0	0	NUM
finefocus-615	369	61	0	0	NUM
finefocus-615	369	62	1	1	NUM
finefocus-615	369	63	1	1	NUM
finefocus-615	369	64	0	0	NUM
finefocus-615	369	65	1	1	NUM
finefocus-615	369	66	1	1	NUM
finefocus-615	369	67	1	1	NUM
finefocus-615	369	68	1	1	NUM
finefocus-615	369	69	1	1	NUM
finefocus-615	369	70	1	1	NUM
finefocus-615	369	71	l	l	NOUN
finefocus-615	369	72	-	-	NOUN
finefocus-615	369	73	phenylalanine	phenylalanine	ADJ
finefocus-615	369	74	1	1	NUM
finefocus-615	369	75	*	*	SYM
finefocus-615	369	76	0	0	NUM
finefocus-615	369	77	0	0	NUM
finefocus-615	369	78	0	0	NUM
finefocus-615	369	79	0	0	NUM
finefocus-615	369	80	0	0	NUM
finefocus-615	369	81	0	0	NUM
finefocus-615	369	82	0	0	NUM
finefocus-615	369	83	0	0	NUM
finefocus-615	369	84	0	0	NUM
finefocus-615	369	85	0	0	NUM
finefocus-615	369	86	0	0	NUM
finefocus-615	369	87	0	0	NUM
finefocus-615	369	88	0	0	NUM
finefocus-615	369	89	0	0	NUM
finefocus-615	369	90	0	0	NUM
finefocus-615	369	91	0	0	NUM
finefocus-615	369	92	0	0	NUM
finefocus-615	370	1	l	l	NOUN
finefocus-615	370	2	-	-	NOUN
finefocus-615	370	3	serine	serine	ADJ
finefocus-615	370	4	1	1	NUM
finefocus-615	370	5	0	0	NUM
finefocus-615	370	6	1	1	NUM
finefocus-615	370	7	1	1	NUM
finefocus-615	370	8	1	1	NUM
finefocus-615	370	9	0	0	NUM
finefocus-615	370	10	0	0	NUM
finefocus-615	370	11	0	0	NUM
finefocus-615	370	12	0	0	NUM
finefocus-615	370	13	0	0	NUM
finefocus-615	370	14	1	1	NUM
finefocus-615	370	15	1	1	NUM
finefocus-615	370	16	0	0	NUM
finefocus-615	370	17	0	0	NUM
finefocus-615	370	18	0	0	NUM
finefocus-615	371	1	1‡	1‡	NUM
finefocus-615	371	2	1‡	1‡	NUM
finefocus-615	371	3	0	0	NUM
finefocus-615	372	1	l	l	ADJ
finefocus-615	372	2	-	-	ADJ
finefocus-615	372	3	threonine	threonine	ADJ
finefocus-615	372	4	1	1	NUM
finefocus-615	372	5	0	0	NUM
finefocus-615	372	6	1	1	NUM
finefocus-615	372	7	1	1	NUM
finefocus-615	372	8	1	1	NUM
finefocus-615	372	9	1	1	NUM
finefocus-615	372	10	0	0	NUM
finefocus-615	372	11	0	0	NUM
finefocus-615	372	12	0	0	NUM
finefocus-615	372	13	0	0	NUM
finefocus-615	373	1	1‡	1‡	NUM
finefocus-615	373	2	0	0	NUM
finefocus-615	373	3	0	0	NUM
finefocus-615	373	4	0	0	NUM
finefocus-615	373	5	0	0	NUM
finefocus-615	374	1	1‡	1‡	NUM
finefocus-615	374	2	1‡	1‡	NUM
finefocus-615	374	3	0	0	NUM
finefocus-615	374	4	glycyl	glycyl	NOUN
finefocus-615	374	5	-	-	PUNCT
finefocus-615	374	6	l	l	NOUN
finefocus-615	374	7	-	-	ADJ
finefocus-615	374	8	glutamic	glutamic	ADJ
finefocus-615	374	9	acid	acid	NOUN
finefocus-615	374	10	1	1	NUM
finefocus-615	374	11	*	*	SYM
finefocus-615	374	12	0	0	NUM
finefocus-615	374	13	0	0	NUM
finefocus-615	374	14	1	1	NUM
finefocus-615	374	15	1	1	NUM
finefocus-615	374	16	1	1	NUM
finefocus-615	374	17	1	1	NUM
finefocus-615	374	18	*	*	SYM
finefocus-615	374	19	0	0	NUM
finefocus-615	374	20	0	0	NUM
finefocus-615	374	21	1	1	NUM
finefocus-615	374	22	0	0	NUM
finefocus-615	374	23	1	1	NUM
finefocus-615	374	24	1	1	NUM
finefocus-615	374	25	0	0	NUM
finefocus-615	374	26	0	0	NUM
finefocus-615	375	1	1‡	1‡	NUM
finefocus-615	375	2	1‡	1‡	NUM
finefocus-615	375	3	0	0	NUM
finefocus-615	375	4	phenylethyl	phenylethyl	ADV
finefocus-615	375	5	-	-	PUNCT
finefocus-615	375	6	amine	amine	ADJ
finefocus-615	375	7	1	1	NUM
finefocus-615	375	8	*	*	SYM
finefocus-615	375	9	0	0	NUM
finefocus-615	375	10	0	0	NUM
finefocus-615	375	11	0	0	NUM
finefocus-615	375	12	0	0	NUM
finefocus-615	375	13	0	0	NUM
finefocus-615	375	14	0	0	NUM
finefocus-615	375	15	0	0	NUM
finefocus-615	375	16	0	0	NUM
finefocus-615	375	17	0	0	NUM
finefocus-615	375	18	0	0	NUM
finefocus-615	375	19	0	0	NUM
finefocus-615	375	20	0	0	NUM
finefocus-615	375	21	0	0	NUM
finefocus-615	375	22	0	0	NUM
finefocus-615	376	1	1‡	1‡	NUM
finefocus-615	376	2	0	0	NUM
finefocus-615	376	3	0	0	NUM
finefocus-615	376	4	putrescine	putrescine	NOUN
finefocus-615	376	5	0	0	NUM
finefocus-615	376	6	1	1	NUM
finefocus-615	377	1	1‡	1‡	NUM
finefocus-615	377	2	1	1	NUM
finefocus-615	377	3	1	1	NUM
finefocus-615	377	4	1	1	NUM
finefocus-615	377	5	1	1	NUM
finefocus-615	377	6	*	*	SYM
finefocus-615	377	7	0	0	NUM
finefocus-615	377	8	0	0	NUM
finefocus-615	377	9	1	1	NUM
finefocus-615	377	10	*	*	SYM
finefocus-615	377	11	0	0	NUM
finefocus-615	377	12	0	0	NUM
finefocus-615	377	13	0	0	NUM
finefocus-615	377	14	0	0	NUM
finefocus-615	377	15	0	0	NUM
finefocus-615	377	16	0	0	NUM
finefocus-615	377	17	0	0	NUM
finefocus-615	377	18	0	0	NUM
finefocus-615	377	19	total	total	NOUN
finefocus-615	377	20	21	21	NUM
finefocus-615	377	21	14	14	NUM
finefocus-615	377	22	17	17	NUM
finefocus-615	377	23	23	23	NUM
finefocus-615	377	24	17	17	NUM
finefocus-615	377	25	16	16	NUM
finefocus-615	377	26	14	14	NUM
finefocus-615	377	27	12	12	NUM
finefocus-615	377	28	5	5	NUM
finefocus-615	377	29	19	19	NUM
finefocus-615	377	30	13	13	NUM
finefocus-615	377	31	10	10	NUM
finefocus-615	377	32	15	15	NUM
finefocus-615	377	33	14	14	NUM
finefocus-615	377	34	12	12	NUM
finefocus-615	377	35	20	20	NUM
finefocus-615	377	36	16	16	NUM
finefocus-615	377	37	10	10	NUM
finefocus-615	377	38	*	*	PUNCT
finefocus-615	377	39	carbon	carbon	NOUN
finefocus-615	377	40	source	source	NOUN
finefocus-615	377	41	utlized	utlized	ADJ
finefocus-615	377	42	only	only	ADV
finefocus-615	377	43	in	in	ADP
finefocus-615	377	44	cheese	cheese	NOUN
finefocus-615	377	45	community	community	NOUN
finefocus-615	377	46	and/or	and/or	CCONJ
finefocus-615	377	47	curd	curd	NOUN
finefocus-615	377	48	community	community	NOUN
finefocus-615	377	49	sample(s	sample(s	NOUN
finefocus-615	377	50	)	)	PUNCT
finefocus-615	377	51	‡	‡	NOUN
finefocus-615	377	52	carbon	carbon	NOUN
finefocus-615	377	53	source	source	NOUN
finefocus-615	377	54	utilized	utilize	VERB
finefocus-615	377	55	only	only	ADV
finefocus-615	377	56	in	in	ADP
finefocus-615	377	57	isolate	isolate	NOUN
finefocus-615	377	58	sample(s	sample(s	ADJ
finefocus-615	377	59	)	)	PUNCT
finefocus-615	377	60	cheese	cheese	NOUN
finefocus-615	377	61	community	community	NOUN
finefocus-615	377	62	sample	sample	NOUN
finefocus-615	377	63	isolate	isolate	VERB
finefocus-615	377	64	sample	sample	NOUN
finefocus-615	377	65	curd	curd	NOUN
finefocus-615	377	66	community	community	NOUN
finefocus-615	377	67	sample	sample	NOUN
finefocus-615	377	68	utilized	utilize	VERB
finefocus-615	377	69	carbon	carbon	NOUN
finefocus-615	377	70	source	source	NOUN
finefocus-615	377	71	26	26	NUM
finefocus-615	377	72	•	•	NUM
finefocus-615	377	73	fine	fine	ADJ
finefocus-615	377	74	focus	focus	NOUN
finefocus-615	377	75	,	,	PUNCT
finefocus-615	377	76	vol	vol	NOUN
finefocus-615	377	77	.	.	NOUN
finefocus-615	377	78	3	3	NUM
finefocus-615	377	79	(	(	PUNCT
finefocus-615	377	80	1	1	NUM
finefocus-615	377	81	)	)	PUNCT
finefocus-615	377	82	supplementary	supplementary	ADJ
finefocus-615	377	83	figure	figure	NOUN
finefocus-615	377	84	3	3	NUM
finefocus-615	377	85	.	.	PUNCT
finefocus-615	377	86	carbon	carbon	NOUN
finefocus-615	377	87	source	source	NOUN
finefocus-615	377	88	utilization	utilization	NOUN
finefocus-615	377	89	profiling	profiling	NOUN
finefocus-615	377	90	shows	show	VERB
finefocus-615	377	91	that	that	SCONJ
finefocus-615	377	92	,	,	PUNCT
finefocus-615	377	93	in	in	ADP
finefocus-615	377	94	general	general	ADJ
finefocus-615	377	95	,	,	PUNCT
finefocus-615	377	96	cheese	cheese	NOUN
finefocus-615	377	97	community	community	NOUN
finefocus-615	377	98	utilizes	utilize	VERB
finefocus-615	377	99	higher	high	ADJ
finefocus-615	377	100	number	number	NOUN
finefocus-615	377	101	of	of	ADP
finefocus-615	377	102	carbon	carbon	NOUN
finefocus-615	377	103	sources	source	NOUN
finefocus-615	377	104	at	at	ADP
finefocus-615	377	105	the	the	DET
finefocus-615	377	106	end	end	NOUN
finefocus-615	377	107	of	of	ADP
finefocus-615	377	108	the	the	DET
finefocus-615	377	109	seven	seven	NUM
finefocus-615	377	110	day	day	NOUN
finefocus-615	377	111	sample	sample	NOUN
finefocus-615	377	112	period	period	NOUN
finefocus-615	377	113	than	than	ADP
finefocus-615	377	114	the	the	DET
finefocus-615	377	115	individual	individual	ADJ
finefocus-615	377	116	isolates	isolate	NOUN
finefocus-615	377	117	,	,	PUNCT
finefocus-615	377	118	with	with	ADP
finefocus-615	377	119	the	the	DET
finefocus-615	377	120	exception	exception	NOUN
finefocus-615	377	121	of	of	ADP
finefocus-615	377	122	two	two	NUM
finefocus-615	377	123	isolated	isolate	VERB
finefocus-615	377	124	from	from	ADP
finefocus-615	377	125	stichelton	stichelton	NOUN
finefocus-615	377	126	.	.	PUNCT
finefocus-615	378	1	blue	blue	ADJ
finefocus-615	378	2	=	=	NOUN
finefocus-615	378	3	cheese	cheese	NOUN
finefocus-615	378	4	community	community	NOUN
finefocus-615	378	5	sample	sample	NOUN
finefocus-615	378	6	;	;	PUNCT
finefocus-615	378	7	red	red	ADJ
finefocus-615	378	8	=	=	SYM
finefocus-615	378	9	first	first	ADJ
finefocus-615	378	10	isolate	isolate	NOUN
finefocus-615	378	11	;	;	PUNCT
finefocus-615	378	12	green	green	ADJ
finefocus-615	378	13	=	=	SYM
finefocus-615	378	14	second	second	ADJ
finefocus-615	378	15	isolate	isolate	NOUN
finefocus-615	378	16	;	;	PUNCT
finefocus-615	378	17	a	a	PRON
finefocus-615	378	18	)	)	PUNCT
finefocus-615	378	19	missouri	missouri	PROPN
finefocus-615	378	20	trucke	trucke	PROPN
finefocus-615	378	21	;	;	PUNCT
finefocus-615	378	22	b	b	X
finefocus-615	378	23	)	)	PUNCT
finefocus-615	378	24	vermont	vermont	NOUN
finefocus-615	378	25	shepherd	shepherd	NOUN
finefocus-615	378	26	;	;	PUNCT
finefocus-615	378	27	c	c	X
finefocus-615	378	28	)	)	PUNCT
finefocus-615	378	29	alpage	alpage	VERB
finefocus-615	378	30	gruyere	gruyere	NOUN
finefocus-615	378	31	;	;	PUNCT
finefocus-615	378	32	d	d	X
finefocus-615	378	33	)	)	PUNCT
finefocus-615	378	34	comte	comte	NOUN
finefocus-615	378	35	;	;	PUNCT
finefocus-615	378	36	e	e	X
finefocus-615	378	37	)	)	PUNCT
finefocus-615	378	38	maggie	maggie	PROPN
finefocus-615	378	39	’s	’s	PART
finefocus-615	378	40	round	round	NOUN
finefocus-615	378	41	;	;	PUNCT
finefocus-615	378	42	f	f	X
finefocus-615	378	43	)	)	PUNCT
finefocus-615	378	44	stichelton	stichelton	NOUN
finefocus-615	378	45	:	:	PUNCT
finefocus-615	378	46	green	green	ADJ
finefocus-615	378	47	curd	curd	NOUN
finefocus-615	378	48	(	(	PUNCT
finefocus-615	378	49	red	red	NOUN
finefocus-615	378	50	)	)	PUNCT
finefocus-615	378	51	,	,	PUNCT
finefocus-615	378	52	white	white	ADJ
finefocus-615	378	53	curd	curd	NOUN
finefocus-615	378	54	(	(	PUNCT
finefocus-615	378	55	green	green	NOUN
finefocus-615	378	56	)	)	PUNCT
finefocus-615	378	57	,	,	PUNCT
finefocus-615	378	58	yellow	yellow	ADJ
finefocus-615	378	59	isolate	isolate	NOUN
finefocus-615	378	60	(	(	PUNCT
finefocus-615	378	61	purple	purple	ADJ
finefocus-615	378	62	)	)	PUNCT
finefocus-615	378	63	,	,	PUNCT
finefocus-615	378	64	white	white	PROPN
finefocus-615	378	65	isolate	isolate	PROPN
finefocus-615	378	66	(	(	PUNCT
finefocus-615	378	67	cyan	cyan	PROPN
finefocus-615	378	68	)	)	PUNCT
finefocus-615	378	69	,	,	PUNCT
finefocus-615	378	70	orange	orange	PROPN
finefocus-615	378	71	isolate	isolate	PROPN
finefocus-615	378	72	(	(	PUNCT
finefocus-615	378	73	orange	orange	PROPN
finefocus-615	378	74	)	)	PUNCT
finefocus-615	378	75	.	.	PUNCT
finefocus-615	379	1	a	a	PRON
finefocus-615	379	2	)	)	PUNCT
finefocus-615	379	3	25	25	NUM
finefocus-615	379	4	20	20	NUM
finefocus-615	379	5	15	15	NUM
finefocus-615	379	6	10	10	NUM
finefocus-615	379	7	5	5	NUM
finefocus-615	379	8	0	0	NUM
finefocus-615	379	9	0	0	NUM
finefocus-615	379	10	1	1	NUM
finefocus-615	379	11	2	2	NUM
finefocus-615	379	12	3	3	NUM
finefocus-615	379	13	4	4	NUM
finefocus-615	379	14	5	5	NUM
finefocus-615	379	15	6	6	NUM
finefocus-615	379	16	7	7	NUM
finefocus-615	379	17	8	8	NUM
finefocus-615	379	18	av	av	PROPN
finefocus-615	379	19	er	er	INTJ
finefocus-615	379	20	ag	ag	PROPN
finefocus-615	380	1	e	e	PROPN
finefocus-615	380	2	c	c	NOUN
finefocus-615	380	3	m	m	VERB
finefocus-615	380	4	d	d	NOUN
finefocus-615	380	5	time	time	NOUN
finefocus-615	380	6	(	(	PUNCT
finefocus-615	380	7	days	day	NOUN
finefocus-615	380	8	)	)	PUNCT
finefocus-615	380	9	c	c	NOUN
finefocus-615	380	10	)	)	PUNCT
finefocus-615	380	11	25	25	NUM
finefocus-615	380	12	20	20	NUM
finefocus-615	380	13	15	15	NUM
finefocus-615	380	14	10	10	NUM
finefocus-615	380	15	5	5	NUM
finefocus-615	380	16	0	0	NUM
finefocus-615	380	17	0	0	NUM
finefocus-615	380	18	1	1	NUM
finefocus-615	380	19	2	2	NUM
finefocus-615	380	20	3	3	NUM
finefocus-615	380	21	4	4	NUM
finefocus-615	380	22	5	5	NUM
finefocus-615	380	23	6	6	NUM
finefocus-615	380	24	7	7	NUM
finefocus-615	380	25	8	8	NUM
finefocus-615	380	26	av	av	PROPN
finefocus-615	380	27	er	er	INTJ
finefocus-615	380	28	ag	ag	PROPN
finefocus-615	381	1	e	e	PROPN
finefocus-615	381	2	c	c	NOUN
finefocus-615	381	3	m	m	VERB
finefocus-615	381	4	d	d	NOUN
finefocus-615	381	5	time	time	NOUN
finefocus-615	381	6	(	(	PUNCT
finefocus-615	381	7	days	day	NOUN
finefocus-615	381	8	)	)	PUNCT
finefocus-615	381	9	f	f	X
finefocus-615	381	10	)	)	PUNCT
finefocus-615	381	11	25	25	NUM
finefocus-615	381	12	20	20	NUM
finefocus-615	381	13	15	15	NUM
finefocus-615	381	14	10	10	NUM
finefocus-615	381	15	5	5	NUM
finefocus-615	381	16	0	0	NUM
finefocus-615	381	17	0	0	NUM
finefocus-615	381	18	1	1	NUM
finefocus-615	381	19	2	2	NUM
finefocus-615	381	20	3	3	NUM
finefocus-615	381	21	4	4	NUM
finefocus-615	381	22	5	5	NUM
finefocus-615	381	23	6	6	NUM
finefocus-615	381	24	7	7	NUM
finefocus-615	381	25	8	8	NUM
finefocus-615	381	26	av	av	PROPN
finefocus-615	381	27	er	er	INTJ
finefocus-615	381	28	ag	ag	PROPN
finefocus-615	382	1	e	e	PROPN
finefocus-615	382	2	c	c	NOUN
finefocus-615	382	3	m	m	VERB
finefocus-615	382	4	d	d	NOUN
finefocus-615	382	5	time	time	NOUN
finefocus-615	382	6	(	(	PUNCT
finefocus-615	382	7	days	day	NOUN
finefocus-615	382	8	)	)	PUNCT
finefocus-615	382	9	b	b	NOUN
finefocus-615	382	10	)	)	PUNCT
finefocus-615	382	11	14	14	NUM
finefocus-615	382	12	12	12	NUM
finefocus-615	382	13	10	10	NUM
finefocus-615	382	14	8	8	NUM
finefocus-615	382	15	6	6	NUM
finefocus-615	382	16	4	4	NUM
finefocus-615	382	17	2	2	NUM
finefocus-615	382	18	0	0	NUM
finefocus-615	382	19	0	0	NUM
finefocus-615	382	20	1	1	NUM
finefocus-615	382	21	2	2	NUM
finefocus-615	382	22	3	3	NUM
finefocus-615	382	23	4	4	NUM
finefocus-615	382	24	5	5	NUM
finefocus-615	382	25	6	6	NUM
finefocus-615	382	26	7	7	NUM
finefocus-615	382	27	8	8	NUM
finefocus-615	382	28	av	av	PROPN
finefocus-615	382	29	er	er	INTJ
finefocus-615	382	30	ag	ag	PROPN
finefocus-615	382	31	e	e	PROPN
finefocus-615	382	32	c	c	NOUN
finefocus-615	382	33	m	m	VERB
finefocus-615	382	34	d	d	NOUN
finefocus-615	382	35	time	time	NOUN
finefocus-615	382	36	(	(	PUNCT
finefocus-615	382	37	days	day	NOUN
finefocus-615	382	38	)	)	PUNCT
finefocus-615	382	39	d	d	NOUN
finefocus-615	382	40	)	)	PUNCT
finefocus-615	382	41	14	14	NUM
finefocus-615	382	42	16	16	NUM
finefocus-615	382	43	12	12	NUM
finefocus-615	382	44	10	10	NUM
finefocus-615	382	45	8	8	NUM
finefocus-615	382	46	6	6	NUM
finefocus-615	382	47	4	4	NUM
finefocus-615	382	48	2	2	NUM
finefocus-615	382	49	0	0	NUM
finefocus-615	382	50	0	0	NUM
finefocus-615	382	51	1	1	NUM
finefocus-615	382	52	2	2	NUM
finefocus-615	382	53	3	3	NUM
finefocus-615	382	54	4	4	NUM
finefocus-615	382	55	5	5	NUM
finefocus-615	382	56	6	6	NUM
finefocus-615	382	57	7	7	NUM
finefocus-615	382	58	8	8	NUM
finefocus-615	382	59	av	av	PROPN
finefocus-615	382	60	er	er	INTJ
finefocus-615	382	61	ag	ag	PROPN
finefocus-615	382	62	e	e	PROPN
finefocus-615	382	63	c	c	NOUN
finefocus-615	382	64	m	m	VERB
finefocus-615	382	65	d	d	NOUN
finefocus-615	382	66	time	time	NOUN
finefocus-615	382	67	(	(	PUNCT
finefocus-615	382	68	days	day	NOUN
finefocus-615	382	69	)	)	PUNCT
finefocus-615	382	70	e	e	NOUN
finefocus-615	382	71	)	)	PUNCT
finefocus-615	382	72	14	14	NUM
finefocus-615	382	73	16	16	NUM
finefocus-615	382	74	18	18	NUM
finefocus-615	382	75	20	20	NUM
finefocus-615	382	76	12	12	NUM
finefocus-615	382	77	10	10	NUM
finefocus-615	382	78	8	8	NUM
finefocus-615	382	79	6	6	NUM
finefocus-615	382	80	4	4	NUM
finefocus-615	382	81	2	2	NUM
finefocus-615	382	82	0	0	NUM
finefocus-615	382	83	0	0	NUM
finefocus-615	382	84	1	1	NUM
finefocus-615	382	85	2	2	NUM
finefocus-615	382	86	3	3	NUM
finefocus-615	382	87	4	4	NUM
finefocus-615	382	88	5	5	NUM
finefocus-615	382	89	6	6	NUM
finefocus-615	382	90	7	7	NUM
finefocus-615	382	91	8	8	NUM
finefocus-615	382	92	av	av	PROPN
finefocus-615	382	93	er	er	INTJ
finefocus-615	382	94	ag	ag	PROPN
finefocus-615	383	1	e	e	PROPN
finefocus-615	383	2	c	c	NOUN
finefocus-615	383	3	m	m	VERB
finefocus-615	383	4	d	d	NOUN
finefocus-615	383	5	time	time	NOUN
finefocus-615	383	6	(	(	PUNCT
finefocus-615	383	7	days	day	NOUN
finefocus-615	383	8	)	)	PUNCT
finefocus-615	383	9	bacterial	bacterial	ADJ
finefocus-615	383	10	community	community	NOUN
finefocus-615	383	11	structure	structure	NOUN
finefocus-615	383	12	in	in	ADP
finefocus-615	383	13	cheese	cheese	NOUN
finefocus-615	383	14	•	•	NUM
finefocus-615	383	15	27	27	NUM
finefocus-615	383	16	carbon	carbon	NOUN
finefocus-615	383	17	source	source	NOUN
finefocus-615	383	18	utilization	utilization	NOUN
finefocus-615	383	19	an	an	DET
finefocus-615	383	20	alternative	alternative	NOUN
finefocus-615	383	21	to	to	ADP
finefocus-615	383	22	measuring	measure	VERB
finefocus-615	383	23	taxonomic	taxonomic	ADJ
finefocus-615	383	24	diversity	diversity	NOUN
finefocus-615	383	25	in	in	ADP
finefocus-615	383	26	a	a	DET
finefocus-615	383	27	microbial	microbial	ADJ
finefocus-615	383	28	community	community	NOUN
finefocus-615	383	29	is	be	AUX
finefocus-615	383	30	measuring	measure	VERB
finefocus-615	383	31	functional	functional	ADJ
finefocus-615	383	32	diversity	diversity	NOUN
finefocus-615	383	33	,	,	PUNCT
finefocus-615	383	34	in	in	ADP
finefocus-615	383	35	this	this	DET
finefocus-615	383	36	case	case	NOUN
finefocus-615	383	37	the	the	DET
finefocus-615	383	38	composite	composite	ADJ
finefocus-615	383	39	signature	signature	NOUN
finefocus-615	383	40	of	of	ADP
finefocus-615	383	41	various	various	ADJ
finefocus-615	383	42	microbial	microbial	ADJ
finefocus-615	383	43	metabolic	metabolic	NOUN
finefocus-615	383	44	pathways	pathway	NOUN
finefocus-615	383	45	(	(	PUNCT
finefocus-615	383	46	34	34	NUM
finefocus-615	383	47	,	,	PUNCT
finefocus-615	383	48	39	39	NUM
finefocus-615	383	49	)	)	PUNCT
finefocus-615	383	50	.	.	PUNCT
finefocus-615	384	1	communitylevel	communitylevel	ADJ
finefocus-615	384	2	physiological	physiological	ADJ
finefocus-615	384	3	profiling	profiling	NOUN
finefocus-615	384	4	(	(	PUNCT
finefocus-615	384	5	clpp	clpp	NOUN
finefocus-615	384	6	)	)	PUNCT
finefocus-615	384	7	was	be	AUX
finefocus-615	384	8	conducted	conduct	VERB
finefocus-615	384	9	on	on	ADP
finefocus-615	384	10	microbiota	microbiota	NOUN
finefocus-615	384	11	and	and	CCONJ
finefocus-615	384	12	isolates	isolate	NOUN
finefocus-615	384	13	from	from	ADP
finefocus-615	384	14	the	the	DET
finefocus-615	384	15	rind	rind	NOUN
finefocus-615	384	16	and	and	CCONJ
finefocus-615	384	17	curd	curd	NOUN
finefocus-615	384	18	over	over	ADP
finefocus-615	384	19	a	a	DET
finefocus-615	384	20	seven	seven	NUM
finefocus-615	384	21	-	-	PUNCT
finefocus-615	384	22	day	day	NOUN
finefocus-615	384	23	period	period	NOUN
finefocus-615	384	24	using	use	VERB
finefocus-615	384	25	the	the	DET
finefocus-615	384	26	biolog	biolog	PROPN
finefocus-615	384	27	ecoplatetm	ecoplatetm	PROPN
finefocus-615	384	28	assay	assay	PROPN
finefocus-615	384	29	(	(	PUNCT
finefocus-615	384	30	46	46	NUM
finefocus-615	384	31	)	)	PUNCT
finefocus-615	384	32	.	.	PUNCT
finefocus-615	385	1	sources	source	NOUN
finefocus-615	385	2	included	include	VERB
finefocus-615	385	3	detergents	detergent	NOUN
finefocus-615	385	4	,	,	PUNCT
finefocus-615	385	5	amino	amino	NOUN
finefocus-615	385	6	acids	acid	NOUN
finefocus-615	385	7	,	,	PUNCT
finefocus-615	385	8	and	and	CCONJ
finefocus-615	385	9	simple	simple	ADJ
finefocus-615	385	10	and	and	CCONJ
finefocus-615	385	11	complex	complex	ADJ
finefocus-615	385	12	sugars	sugar	NOUN
finefocus-615	385	13	,	,	PUNCT
finefocus-615	385	14	among	among	ADP
finefocus-615	385	15	other	other	ADJ
finefocus-615	385	16	compounds	compound	NOUN
finefocus-615	385	17	.	.	PUNCT
finefocus-615	386	1	the	the	DET
finefocus-615	386	2	number	number	NOUN
finefocus-615	386	3	of	of	ADP
finefocus-615	386	4	unique	unique	ADJ
finefocus-615	386	5	carbon	carbon	NOUN
finefocus-615	386	6	sources	source	NOUN
finefocus-615	386	7	utilized	utilize	VERB
finefocus-615	386	8	,	,	PUNCT
finefocus-615	386	9	here	here	ADV
finefocus-615	386	10	described	describe	VERB
finefocus-615	386	11	as	as	ADP
finefocus-615	386	12	metabolic	metabolic	NOUN
finefocus-615	386	13	diversity	diversity	NOUN
finefocus-615	386	14	(	(	PUNCT
finefocus-615	386	15	cmd	cmd	NOUN
finefocus-615	386	16	)	)	PUNCT
finefocus-615	386	17	,	,	PUNCT
finefocus-615	386	18	increased	increase	VERB
finefocus-615	386	19	for	for	ADP
finefocus-615	386	20	all	all	DET
finefocus-615	386	21	isolates	isolate	NOUN
finefocus-615	386	22	and	and	CCONJ
finefocus-615	386	23	communities	community	NOUN
finefocus-615	386	24	over	over	ADP
finefocus-615	386	25	time	time	NOUN
finefocus-615	386	26	,	,	PUNCT
finefocus-615	386	27	albeit	albeit	SCONJ
finefocus-615	386	28	at	at	ADP
finefocus-615	386	29	different	different	ADJ
finefocus-615	386	30	rates	rate	NOUN
finefocus-615	386	31	(	(	PUNCT
finefocus-615	386	32	figure	figure	NOUN
finefocus-615	386	33	6	6	NUM
finefocus-615	386	34	;	;	PUNCT
finefocus-615	386	35	supplementary	supplementary	ADJ
finefocus-615	386	36	figure	figure	NOUN
finefocus-615	386	37	3	3	NUM
finefocus-615	386	38	)	)	PUNCT
finefocus-615	386	39	.	.	PUNCT
finefocus-615	387	1	it	it	PRON
finefocus-615	387	2	appeared	appear	VERB
finefocus-615	387	3	that	that	SCONJ
finefocus-615	387	4	digestion	digestion	NOUN
finefocus-615	387	5	by	by	ADP
finefocus-615	387	6	some	some	DET
finefocus-615	387	7	enzymes	enzyme	NOUN
finefocus-615	387	8	occurred	occur	VERB
finefocus-615	387	9	more	more	ADV
finefocus-615	387	10	quickly	quickly	ADV
finefocus-615	387	11	than	than	ADP
finefocus-615	387	12	others	other	NOUN
finefocus-615	387	13	.	.	PUNCT
finefocus-615	388	1	stichelton	stichelton	PROPN
finefocus-615	388	2	had	have	VERB
finefocus-615	388	3	the	the	DET
finefocus-615	388	4	most	most	ADV
finefocus-615	388	5	unique	unique	ADJ
finefocus-615	388	6	metabolic	metabolic	NOUN
finefocus-615	388	7	signature	signature	NOUN
finefocus-615	388	8	,	,	PUNCT
finefocus-615	388	9	and	and	CCONJ
finefocus-615	388	10	was	be	AUX
finefocus-615	388	11	not	not	PART
finefocus-615	388	12	able	able	ADJ
finefocus-615	388	13	to	to	PART
finefocus-615	388	14	metabolize	metabolize	VERB
finefocus-615	388	15	any	any	PRON
finefocus-615	388	16	of	of	ADP
finefocus-615	388	17	the	the	DET
finefocus-615	388	18	commonly	commonly	ADV
finefocus-615	388	19	used	use	VERB
finefocus-615	388	20	polysaccharides	polysaccharide	NOUN
finefocus-615	388	21	(	(	PUNCT
finefocus-615	388	22	cyclodextrin	cyclodextrin	NOUN
finefocus-615	388	23	,	,	PUNCT
finefocus-615	388	24	xylose	xylose	PROPN
finefocus-615	388	25	and	and	CCONJ
finefocus-615	388	26	n	n	CCONJ
finefocus-615	388	27	-	-	PUNCT
finefocus-615	388	28	acetyl	acetyl	NOUN
finefocus-615	388	29	-	-	PUNCT
finefocus-615	388	30	d	d	NOUN
finefocus-615	388	31	-	-	NOUN
finefocus-615	388	32	glucosamine	glucosamine	NOUN
finefocus-615	388	33	)	)	PUNCT
finefocus-615	388	34	.	.	PUNCT
finefocus-615	389	1	perhaps	perhaps	ADV
finefocus-615	389	2	this	this	DET
finefocus-615	389	3	metabolic	metabolic	NOUN
finefocus-615	389	4	signature	signature	NOUN
finefocus-615	389	5	is	be	AUX
finefocus-615	389	6	related	relate	VERB
finefocus-615	389	7	to	to	ADP
finefocus-615	389	8	the	the	DET
finefocus-615	389	9	fact	fact	NOUN
finefocus-615	389	10	it	it	PRON
finefocus-615	389	11	is	be	AUX
finefocus-615	389	12	a	a	DET
finefocus-615	389	13	blue	blue	ADJ
finefocus-615	389	14	cheese	cheese	NOUN
finefocus-615	389	15	and	and	CCONJ
finefocus-615	389	16	there	there	PRON
finefocus-615	389	17	is	be	VERB
finefocus-615	389	18	contact	contact	NOUN
finefocus-615	389	19	with	with	ADP
finefocus-615	389	20	the	the	DET
finefocus-615	389	21	mold	mold	NOUN
finefocus-615	389	22	inside	inside	ADP
finefocus-615	389	23	the	the	DET
finefocus-615	389	24	cheese	cheese	NOUN
finefocus-615	389	25	.	.	PUNCT
finefocus-615	390	1	further	further	ADJ
finefocus-615	390	2	study	study	NOUN
finefocus-615	390	3	is	be	AUX
finefocus-615	390	4	needed	need	VERB
finefocus-615	390	5	to	to	PART
finefocus-615	390	6	elucidate	elucidate	VERB
finefocus-615	390	7	a	a	DET
finefocus-615	390	8	relationship	relationship	NOUN
finefocus-615	390	9	between	between	ADP
finefocus-615	390	10	community	community	NOUN
finefocus-615	390	11	composition	composition	NOUN
finefocus-615	390	12	and	and	CCONJ
finefocus-615	390	13	metabolic	metabolic	NOUN
finefocus-615	390	14	functions	function	NOUN
finefocus-615	390	15	including	include	VERB
finefocus-615	390	16	mineralization	mineralization	NOUN
finefocus-615	390	17	.	.	PUNCT
finefocus-615	391	1	various	various	ADJ
finefocus-615	391	2	rind	rind	NOUN
finefocus-615	391	3	communities	community	NOUN
finefocus-615	391	4	have	have	AUX
finefocus-615	391	5	shown	show	VERB
finefocus-615	391	6	to	to	PART
finefocus-615	391	7	be	be	AUX
finefocus-615	391	8	largely	largely	ADV
finefocus-615	391	9	culturable	culturable	ADJ
finefocus-615	391	10	and	and	CCONJ
finefocus-615	391	11	reproducible	reproducible	ADJ
finefocus-615	391	12	(	(	PUNCT
finefocus-615	391	13	49	49	NUM
finefocus-615	391	14	)	)	PUNCT
finefocus-615	391	15	suggesting	suggest	VERB
finefocus-615	391	16	that	that	SCONJ
finefocus-615	391	17	such	such	ADJ
finefocus-615	391	18	study	study	NOUN
finefocus-615	391	19	is	be	AUX
finefocus-615	391	20	possible	possible	ADJ
finefocus-615	391	21	.	.	PUNCT
finefocus-615	392	1	figure	figure	VERB
finefocus-615	392	2	6	6	NUM
finefocus-615	392	3	.	.	PUNCT
finefocus-615	393	1	diversity	diversity	NOUN
finefocus-615	393	2	of	of	ADP
finefocus-615	393	3	carbon	carbon	NOUN
finefocus-615	393	4	metabolism	metabolism	NOUN
finefocus-615	393	5	in	in	ADP
finefocus-615	393	6	cheeses	cheese	NOUN
finefocus-615	393	7	over	over	ADP
finefocus-615	393	8	a	a	DET
finefocus-615	393	9	seven	seven	NUM
finefocus-615	393	10	-	-	PUNCT
finefocus-615	393	11	day	day	NOUN
finefocus-615	393	12	period	period	NOUN
finefocus-615	393	13	.	.	PUNCT
finefocus-615	394	1	utilization	utilization	NOUN
finefocus-615	394	2	of	of	ADP
finefocus-615	394	3	a	a	DET
finefocus-615	394	4	carbon	carbon	NOUN
finefocus-615	394	5	source	source	NOUN
finefocus-615	394	6	was	be	AUX
finefocus-615	394	7	determined	determine	VERB
finefocus-615	394	8	by	by	ADP
finefocus-615	394	9	measuring	measure	VERB
finefocus-615	394	10	the	the	DET
finefocus-615	394	11	reduction	reduction	NOUN
finefocus-615	394	12	of	of	ADP
finefocus-615	394	13	tetrazolium	tetrazolium	NOUN
finefocus-615	394	14	salts	salt	NOUN
finefocus-615	394	15	wts-1	wts-1	ADP
finefocus-615	394	16	and	and	CCONJ
finefocus-615	394	17	wts-2	wts-2	PUNCT
finefocus-615	394	18	to	to	AUX
finefocus-615	394	19	fluorescent	fluorescent	VERB
finefocus-615	394	20	purple	purple	ADJ
finefocus-615	394	21	formazans	formazan	NOUN
finefocus-615	394	22	with	with	ADP
finefocus-615	394	23	the	the	DET
finefocus-615	394	24	biolog	biolog	PROPN
finefocus-615	394	25	communitylevel	communitylevel	ADJ
finefocus-615	394	26	physiological	physiological	ADJ
finefocus-615	394	27	profiling	profiling	NOUN
finefocus-615	394	28	(	(	PUNCT
finefocus-615	394	29	clpp	clpp	NOUN
finefocus-615	394	30	)	)	PUNCT
finefocus-615	394	31	kit	kit	NOUN
finefocus-615	394	32	and	and	CCONJ
finefocus-615	394	33	protocol	protocol	NOUN
finefocus-615	394	34	.	.	PUNCT
finefocus-615	395	1	for	for	ADP
finefocus-615	395	2	a	a	DET
finefocus-615	395	3	list	list	NOUN
finefocus-615	395	4	of	of	ADP
finefocus-615	395	5	carbon	carbon	NOUN
finefocus-615	395	6	sources	source	NOUN
finefocus-615	395	7	see	see	VERB
finefocus-615	395	8	supplementary	supplementary	ADJ
finefocus-615	395	9	information	information	NOUN
finefocus-615	395	10	.	.	PUNCT
finefocus-615	396	1	sonnet	sonnet	NOUN
finefocus-615	396	2	missoury	missoury	PROPN
finefocus-615	396	3	truckle	truckle	PROPN
finefocus-615	396	4	vermont	vermont	PROPN
finefocus-615	396	5	shepherd	shepherd	NOUN
finefocus-615	396	6	alpage	alpage	VERB
finefocus-615	396	7	gruyere	gruyere	NOUN
finefocus-615	396	8	comte	comte	NOUN
finefocus-615	396	9	maggie	maggie	PROPN
finefocus-615	396	10	’s	’s	PART
finefocus-615	396	11	round	round	PROPN
finefocus-615	396	12	stichelton	stichelton	PROPN
finefocus-615	396	13	legend	legend	PROPN
finefocus-615	396	14	day	day	PROPN
finefocus-615	396	15	c	c	PROPN
finefocus-615	396	16	ar	ar	PROPN
finefocus-615	396	17	bo	bo	PROPN
finefocus-615	396	18	n	n	PROPN
finefocus-615	396	19	m	m	VERB
finefocus-615	396	20	et	et	NOUN
finefocus-615	396	21	ab	ab	PROPN
finefocus-615	396	22	ol	ol	PROPN
finefocus-615	396	23	ic	ic	PROPN
finefocus-615	396	24	d	d	PROPN
finefocus-615	396	25	iv	iv	PROPN
finefocus-615	396	26	er	er	INTJ
finefocus-615	396	27	sit	sit	VERB
finefocus-615	396	28	y	y	PROPN
finefocus-615	396	29	sc	sc	PROPN
finefocus-615	396	30	or	or	CCONJ
finefocus-615	396	31	e	e	NOUN
finefocus-615	396	32	0	0	NUM
finefocus-615	396	33	1	1	NUM
finefocus-615	396	34	5	5	NUM
finefocus-615	396	35	10	10	NUM
finefocus-615	396	36	15	15	NUM
finefocus-615	396	37	20	20	NUM
finefocus-615	396	38	25	25	NUM
finefocus-615	396	39	2	2	NUM
finefocus-615	396	40	3	3	NUM
finefocus-615	396	41	4	4	NUM
finefocus-615	396	42	5	5	NUM
finefocus-615	396	43	6	6	NUM
finefocus-615	396	44	7	7	NUM
finefocus-615	396	45	8	8	NUM
finefocus-615	396	46	28	28	NUM
finefocus-615	396	47	•	•	NUM
finefocus-615	396	48	fine	fine	ADJ
finefocus-615	396	49	focus	focus	NOUN
finefocus-615	396	50	,	,	PUNCT
finefocus-615	396	51	vol	vol	NOUN
finefocus-615	396	52	.	.	NOUN
finefocus-615	396	53	3	3	NUM
finefocus-615	396	54	(	(	PUNCT
finefocus-615	396	55	1	1	NUM
finefocus-615	396	56	)	)	PUNCT
finefocus-615	396	57	cheese	cheese	NOUN
finefocus-615	396	58	type	type	NOUN
finefocus-615	396	59	isolate	isolate	NOUN
finefocus-615	396	60	total	total	ADJ
finefocus-615	396	61	cmd	cmd	NOUN
finefocus-615	396	62	cmd	cmd	NOUN
finefocus-615	396	63	in	in	ADP
finefocus-615	396	64	isolate	isolate	VERB
finefocus-615	396	65	top	top	ADJ
finefocus-615	396	66	carbon	carbon	NOUN
finefocus-615	396	67	sources	source	NOUN
finefocus-615	396	68	top	top	VERB
finefocus-615	396	69	carbon	carbon	NOUN
finefocus-615	396	70	sources	source	NOUN
finefocus-615	396	71	per	per	ADP
finefocus-615	396	72	isolate	isolate	PROPN
finefocus-615	396	73	*	*	PUNCT
finefocus-615	396	74	missouri	missouri	PROPN
finefocus-615	396	75	truckle	truckle	PROPN
finefocus-615	396	76	brachybacterium	brachybacterium	PROPN
finefocus-615	396	77	21	21	NUM
finefocus-615	396	78	14	14	NUM
finefocus-615	396	79	glycogen	glycogen	NOUN
finefocus-615	396	80	alpha	alpha	NOUN
finefocus-615	396	81	-	-	PUNCT
finefocus-615	396	82	d	d	NOUN
finefocus-615	396	83	-	-	NOUN
finefocus-615	396	84	lactose	lactose	ADJ
finefocus-615	396	85	d	d	NOUN
finefocus-615	396	86	-	-	NOUN
finefocus-615	396	87	mannitol	mannitol	ADJ
finefocus-615	396	88	d	d	ADJ
finefocus-615	396	89	-	-	PUNCT
finefocus-615	396	90	cellobiose	cellobiose	ADJ
finefocus-615	396	91	glycogen	glycogen	NOUN
finefocus-615	396	92	staphylococcus	staphylococcus	NOUN
finefocus-615	396	93	21	21	NUM
finefocus-615	396	94	17	17	NUM
finefocus-615	396	95	glycyl	glycyl	NOUN
finefocus-615	396	96	-	-	PUNCT
finefocus-615	396	97	l	l	NOUN
finefocus-615	396	98	glutamic	glutamic	ADJ
finefocus-615	396	99	d	d	NOUN
finefocus-615	396	100	-	-	PUNCT
finefocus-615	396	101	cellobiose	cellobiose	ADJ
finefocus-615	396	102	d	d	ADJ
finefocus-615	396	103	-	-	PUNCT
finefocus-615	396	104	mannitol	mannitol	NOUN
finefocus-615	396	105	glycogen	glycogen	NOUN
finefocus-615	396	106	alpage	alpage	NOUN
finefocus-615	396	107	gruyère	gruyère	NOUN
finefocus-615	396	108	corynebacterium	corynebacterium	NOUN
finefocus-615	396	109	23	23	NUM
finefocus-615	396	110	17	17	NUM
finefocus-615	396	111	alpha	alpha	NOUN
finefocus-615	396	112	-	-	PUNCT
finefocus-615	396	113	d	d	NOUN
finefocus-615	396	114	-	-	NOUN
finefocus-615	396	115	lactose	lactose	ADJ
finefocus-615	396	116	tween-80	tween-80	NOUN
finefocus-615	396	117	d	d	NOUN
finefocus-615	396	118	-	-	PUNCT
finefocus-615	396	119	cellobiose	cellobiose	ADJ
finefocus-615	396	120	d	d	NOUN
finefocus-615	396	121	-	-	NOUN
finefocus-615	396	122	mannitol	mannitol	ADJ
finefocus-615	396	123	n	n	CCONJ
finefocus-615	396	124	-	-	PUNCT
finefocus-615	396	125	acetyl	acetyl	NOUN
finefocus-615	396	126	glucosamine	glucosamine	NOUN
finefocus-615	396	127	brevibacterium	brevibacterium	NOUN
finefocus-615	396	128	23	23	NUM
finefocus-615	397	1	16	16	NUM
finefocus-615	397	2	d	d	ADJ
finefocus-615	397	3	-	-	PUNCT
finefocus-615	397	4	cellobiose	cellobiose	ADJ
finefocus-615	397	5	cyclodextrin	cyclodextrin	NOUN
finefocus-615	397	6	tween-80	tween-80	NUM
finefocus-615	397	7	comté	comté	NOUN
finefocus-615	397	8	(	(	PUNCT
finefocus-615	397	9	unclear	unclear	ADJ
finefocus-615	397	10	)	)	PUNCT
finefocus-615	397	11	#	#	SYM
finefocus-615	397	12	3	3	NUM
finefocus-615	397	13	14	14	NUM
finefocus-615	397	14	12	12	NUM
finefocus-615	397	15	d	d	ADJ
finefocus-615	397	16	-	-	PUNCT
finefocus-615	397	17	cellobiose	cellobiose	NOUN
finefocus-615	397	18	cyclodextrin	cyclodextrin	NOUN
finefocus-615	397	19	tween-40	tween-40	PROPN
finefocus-615	397	20	d	d	PROPN
finefocus-615	397	21	,	,	PUNCT
finefocus-615	397	22	l	l	ADJ
finefocus-615	397	23	-	-	ADJ
finefocus-615	397	24	alpha	alpha	NOUN
finefocus-615	397	25	-	-	PUNCT
finefocus-615	397	26	glycerol	glycerol	NOUN
finefocus-615	397	27	,	,	PUNCT
finefocus-615	397	28	phosphate	phosphate	NOUN
finefocus-615	397	29	,	,	PUNCT
finefocus-615	397	30	beta	beta	NOUN
finefocus-615	397	31	-	-	PUNCT
finefocus-615	397	32	methyl	methyl	NOUN
finefocus-615	397	33	-	-	PUNCT
finefocus-615	397	34	dglucoside	dglucoside	ADJ
finefocus-615	397	35	,	,	PUNCT
finefocus-615	397	36	cyclodextrin	cyclodextrin	NOUN
finefocus-615	397	37	(	(	PUNCT
finefocus-615	397	38	unclear	unclear	ADJ
finefocus-615	397	39	)	)	PUNCT
finefocus-615	397	40	#	#	SYM
finefocus-615	397	41	9	9	NUM
finefocus-615	397	42	14	14	NUM
finefocus-615	397	43	5	5	NUM
finefocus-615	397	44	tween-40	tween-40	PROPN
finefocus-615	397	45	,	,	PUNCT
finefocus-615	397	46	cyclodextrin	cyclodextrin	NOUN
finefocus-615	397	47	d	d	ADJ
finefocus-615	397	48	-	-	PUNCT
finefocus-615	397	49	cellobiose	cellobiose	ADJ
finefocus-615	397	50	maggie	maggie	NOUN
finefocus-615	397	51	’s	’s	PART
finefocus-615	397	52	round	round	ADJ
finefocus-615	397	53	bacillus	bacillus	NOUN
finefocus-615	397	54	19	19	NUM
finefocus-615	397	55	13	13	NUM
finefocus-615	397	56	d	d	ADJ
finefocus-615	397	57	-	-	PUNCT
finefocus-615	397	58	mannitol	mannitol	NOUN
finefocus-615	397	59	cyclodextrin	cyclodextrin	NOUN
finefocus-615	397	60	tween-80	tween-80	NUM
finefocus-615	397	61	,	,	PUNCT
finefocus-615	397	62	beta	beta	NOUN
finefocus-615	397	63	-	-	PUNCT
finefocus-615	397	64	mthyl	mthyl	NOUN
finefocus-615	397	65	-	-	PUNCT
finefocus-615	397	66	d	d	NOUN
finefocus-615	397	67	-	-	NOUN
finefocus-615	397	68	glucoside	glucoside	NOUN
finefocus-615	397	69	,	,	PUNCT
finefocus-615	397	70	d	d	ADJ
finefocus-615	397	71	-	-	PUNCT
finefocus-615	397	72	mannitol	mannitol	ADJ
finefocus-615	397	73	unclear#10	unclear#10	PROPN
finefocus-615	397	74	19	19	NUM
finefocus-615	397	75	10	10	NUM
finefocus-615	397	76	tween-40	tween-40	PROPN
finefocus-615	397	77	cyclodextrin	cyclodextrin	NOUN
finefocus-615	397	78	,	,	PUNCT
finefocus-615	397	79	tween-40	tween-40	NOUN
finefocus-615	397	80	,	,	PUNCT
finefocus-615	397	81	n	n	CCONJ
finefocus-615	397	82	-	-	PUNCT
finefocus-615	397	83	acetyl	acetyl	NOUN
finefocus-615	397	84	-	-	PUNCT
finefocus-615	397	85	glucosamine	glucosamine	NOUN
finefocus-615	397	86	stichelton	stichelton	NOUN
finefocus-615	397	87	green	green	ADJ
finefocus-615	397	88	curd	curd	NOUN
finefocus-615	397	89	15	15	NUM
finefocus-615	397	90	14	14	NUM
finefocus-615	397	91	d	d	ADJ
finefocus-615	397	92	-	-	ADJ
finefocus-615	397	93	malic	malic	ADJ
finefocus-615	397	94	acid	acid	PROPN
finefocus-615	397	95	l	l	PROPN
finefocus-615	397	96	-	-	NOUN
finefocus-615	397	97	asparagine	asparagine	ADJ
finefocus-615	397	98	d	d	ADJ
finefocus-615	397	99	-	-	ADJ
finefocus-615	397	100	glucosaminic	glucosaminic	ADJ
finefocus-615	397	101	acid	acid	NOUN
finefocus-615	397	102	d	d	PROPN
finefocus-615	397	103	-	-	PUNCT
finefocus-615	397	104	malic	malic	ADJ
finefocus-615	397	105	acid	acid	NOUN
finefocus-615	397	106	,	,	PUNCT
finefocus-615	397	107	l	l	NOUN
finefocus-615	397	108	-	-	NOUN
finefocus-615	397	109	asparagine	asparagine	ADJ
finefocus-615	397	110	,	,	PUNCT
finefocus-615	397	111	d	d	ADJ
finefocus-615	397	112	-	-	ADJ
finefocus-615	397	113	glucosaminic	glucosaminic	ADJ
finefocus-615	397	114	acid	acid	NOUN
finefocus-615	397	115	orange	orange	PROPN
finefocus-615	397	116	isolate	isolate	PROPN
finefocus-615	397	117	unkown	unkown	ADJ
finefocus-615	397	118	20	20	NUM
finefocus-615	397	119	d	d	ADJ
finefocus-615	397	120	-	-	ADJ
finefocus-615	397	121	glucosaminic	glucosaminic	ADJ
finefocus-615	397	122	acid	acid	NOUN
finefocus-615	397	123	,	,	PUNCT
finefocus-615	397	124	d	d	ADJ
finefocus-615	397	125	-	-	PUNCT
finefocus-615	397	126	malic	malic	ADJ
finefocus-615	397	127	acid	acid	NOUN
finefocus-615	397	128	,	,	PUNCT
finefocus-615	397	129	l	l	NOUN
finefocus-615	397	130	-	-	ADJ
finefocus-615	397	131	asparagine	asparagine	ADJ
finefocus-615	397	132	white	white	ADJ
finefocus-615	397	133	curd	curd	NOUN
finefocus-615	397	134	12	12	NUM
finefocus-615	397	135	d	d	ADJ
finefocus-615	397	136	-	-	ADJ
finefocus-615	397	137	glucosaminic	glucosaminic	ADJ
finefocus-615	397	138	acid	acid	NOUN
finefocus-615	397	139	,	,	PUNCT
finefocus-615	397	140	d	d	ADJ
finefocus-615	397	141	-	-	PUNCT
finefocus-615	397	142	malic	malic	ADJ
finefocus-615	397	143	acid	acid	NOUN
finefocus-615	397	144	,	,	PUNCT
finefocus-615	397	145	l	l	NOUN
finefocus-615	397	146	-	-	ADJ
finefocus-615	397	147	asparagine	asparagine	ADJ
finefocus-615	397	148	white	white	PROPN
finefocus-615	397	149	isolate	isolate	PROPN
finefocus-615	397	150	unknown	unknown	ADJ
finefocus-615	397	151	10	10	NUM
finefocus-615	397	152	l	l	NOUN
finefocus-615	397	153	-	-	NOUN
finefocus-615	397	154	asparagine	asparagine	ADJ
finefocus-615	397	155	,	,	PUNCT
finefocus-615	397	156	d	d	ADJ
finefocus-615	397	157	-	-	ADJ
finefocus-615	397	158	glucosaminic	glucosaminic	ADJ
finefocus-615	397	159	acid	acid	NOUN
finefocus-615	397	160	,	,	PUNCT
finefocus-615	397	161	d	d	X
finefocus-615	397	162	-	-	ADJ
finefocus-615	397	163	malic	malic	ADJ
finefocus-615	397	164	acid	acid	NOUN
finefocus-615	397	165	yellow	yellow	PROPN
finefocus-615	397	166	isolate	isolate	PROPN
finefocus-615	397	167	unknown	unknown	ADJ
finefocus-615	397	168	16	16	NUM
finefocus-615	397	169	d	d	ADJ
finefocus-615	397	170	-	-	ADJ
finefocus-615	397	171	glucosaminic	glucosaminic	ADJ
finefocus-615	397	172	acid	acid	NOUN
finefocus-615	397	173	,	,	PUNCT
finefocus-615	397	174	d	d	ADJ
finefocus-615	397	175	-	-	ADJ
finefocus-615	397	176	galactuonic	galactuonic	ADJ
finefocus-615	397	177	acid	acid	NOUN
finefocus-615	397	178	,	,	PUNCT
finefocus-615	397	179	l	l	NOUN
finefocus-615	397	180	-	-	ADJ
finefocus-615	397	181	asparagine	asparagine	ADJ
finefocus-615	397	182	table	table	NOUN
finefocus-615	397	183	2	2	NUM
finefocus-615	397	184	.	.	X
finefocus-615	397	185	top	top	ADJ
finefocus-615	397	186	carbon	carbon	NOUN
finefocus-615	397	187	sources	source	NOUN
finefocus-615	397	188	utilized	utilize	VERB
finefocus-615	397	189	by	by	ADP
finefocus-615	397	190	the	the	DET
finefocus-615	397	191	cheese	cheese	NOUN
finefocus-615	397	192	community	community	NOUN
finefocus-615	397	193	samples	sample	NOUN
finefocus-615	397	194	and	and	CCONJ
finefocus-615	397	195	their	their	PRON
finefocus-615	397	196	respective	respective	ADJ
finefocus-615	397	197	isolates	isolate	NOUN
finefocus-615	397	198	for	for	ADP
finefocus-615	397	199	five	five	NUM
finefocus-615	397	200	cheeses	cheese	NOUN
finefocus-615	397	201	:	:	PUNCT
finefocus-615	397	202	missouri	missouri	PROPN
finefocus-615	397	203	truckle	truckle	NOUN
finefocus-615	397	204	,	,	PUNCT
finefocus-615	397	205	alpage	alpage	NOUN
finefocus-615	397	206	gruyère	gruyère	NOUN
finefocus-615	397	207	,	,	PUNCT
finefocus-615	397	208	comte	comte	NOUN
finefocus-615	397	209	,	,	PUNCT
finefocus-615	397	210	maggie	maggie	NOUN
finefocus-615	397	211	’s	’s	PART
finefocus-615	397	212	round	round	NOUN
finefocus-615	397	213	,	,	PUNCT
finefocus-615	397	214	and	and	CCONJ
finefocus-615	397	215	stichelton	stichelton	NOUN
finefocus-615	397	216	.	.	PUNCT
finefocus-615	398	1	total	total	ADJ
finefocus-615	398	2	cmd	cmd	NOUN
finefocus-615	398	3	and	and	CCONJ
finefocus-615	398	4	top	top	ADJ
finefocus-615	398	5	carbon	carbon	NOUN
finefocus-615	398	6	sources	source	NOUN
finefocus-615	398	7	refer	refer	VERB
finefocus-615	398	8	to	to	ADP
finefocus-615	398	9	that	that	PRON
finefocus-615	398	10	of	of	ADP
finefocus-615	398	11	the	the	DET
finefocus-615	398	12	whole	whole	ADJ
finefocus-615	398	13	cheese	cheese	NOUN
finefocus-615	398	14	microbial	microbial	ADJ
finefocus-615	398	15	community	community	NOUN
finefocus-615	398	16	samples	sample	NOUN
finefocus-615	398	17	;	;	PUNCT
finefocus-615	398	18	cmd	cmd	NOUN
finefocus-615	398	19	in	in	ADP
finefocus-615	398	20	isolates	isolate	NOUN
finefocus-615	398	21	and	and	CCONJ
finefocus-615	398	22	top	top	ADJ
finefocus-615	398	23	carbon	carbon	NOUN
finefocus-615	398	24	sources	source	NOUN
finefocus-615	398	25	per	per	ADP
finefocus-615	398	26	isolate	isolate	NOUN
finefocus-615	398	27	refer	refer	VERB
finefocus-615	398	28	to	to	ADP
finefocus-615	398	29	the	the	DET
finefocus-615	398	30	individual	individual	NOUN
finefocus-615	398	31	isolate	isolate	NOUN
finefocus-615	398	32	samples	sample	NOUN
finefocus-615	398	33	.	.	PUNCT
finefocus-615	399	1	bacterial	bacterial	ADJ
finefocus-615	399	2	community	community	NOUN
finefocus-615	399	3	structure	structure	NOUN
finefocus-615	399	4	in	in	ADP
finefocus-615	399	5	cheese	cheese	NOUN
finefocus-615	399	6	•	•	NUM
finefocus-615	399	7	29	29	NUM
finefocus-615	399	8	acknowledgements	acknowledgement	NOUN
finefocus-615	399	9	we	we	PRON
finefocus-615	399	10	would	would	AUX
finefocus-615	399	11	like	like	VERB
finefocus-615	399	12	to	to	PART
finefocus-615	399	13	thank	thank	VERB
finefocus-615	399	14	bisc	bisc	PROPN
finefocus-615	399	15	314	314	NUM
finefocus-615	399	16	spring	spring	NOUN
finefocus-615	399	17	2015	2015	NUM
finefocus-615	399	18	students	student	NOUN
finefocus-615	399	19	:	:	PUNCT
finefocus-615	399	20	carley	carley	PROPN
finefocus-615	399	21	allen	allen	PROPN
finefocus-615	399	22	,	,	PUNCT
finefocus-615	399	23	becca	becca	PROPN
finefocus-615	399	24	berger	berger	PROPN
finefocus-615	399	25	,	,	PUNCT
finefocus-615	399	26	synthia	synthia	PROPN
finefocus-615	399	27	v.	v.	ADP
finefocus-615	399	28	hernandez	hernandez	PROPN
finefocus-615	399	29	,	,	PUNCT
finefocus-615	399	30	anita	anita	PROPN
finefocus-615	399	31	z.	z.	PROPN
finefocus-615	399	32	li	li	PROPN
finefocus-615	399	33	,	,	PUNCT
finefocus-615	399	34	iris	iris	PROPN
finefocus-615	399	35	w.	w.	PROPN
finefocus-615	399	36	lin	lin	PROPN
finefocus-615	399	37	,	,	PUNCT
finefocus-615	399	38	zoe	zoe	PROPN
finefocus-615	399	39	e.	e.	PROPN
finefocus-615	399	40	moyer	moyer	PROPN
finefocus-615	399	41	,	,	PUNCT
finefocus-615	399	42	harini	harini	PROPN
finefocus-615	399	43	natarajan	natarajan	PROPN
finefocus-615	399	44	,	,	PUNCT
finefocus-615	399	45	and	and	CCONJ
finefocus-615	399	46	alice	alice	PROPN
finefocus-615	399	47	sun	sun	PROPN
finefocus-615	399	48	.	.	PUNCT
finefocus-615	400	1	special	special	ADJ
finefocus-615	400	2	thanks	thank	NOUN
finefocus-615	400	3	to	to	ADP
finefocus-615	400	4	sherly	sherly	NOUN
finefocus-615	400	5	veeragavan	veeragavan	PROPN
finefocus-615	400	6	for	for	ADP
finefocus-615	400	7	helping	help	VERB
finefocus-615	400	8	with	with	ADP
finefocus-615	400	9	the	the	DET
finefocus-615	400	10	course	course	NOUN
finefocus-615	400	11	,	,	PUNCT
finefocus-615	400	12	and	and	CCONJ
finefocus-615	400	13	bruce	bruce	PROPN
finefocus-615	400	14	paster	paster	NOUN
finefocus-615	400	15	(	(	PUNCT
finefocus-615	400	16	forstyth	forstyth	PROPN
finefocus-615	400	17	institute	institute	PROPN
finefocus-615	400	18	)	)	PUNCT
finefocus-615	400	19	and	and	CCONJ
finefocus-615	400	20	forsyth	forsyth	PROPN
finefocus-615	400	21	institute	institute	NOUN
finefocus-615	400	22	for	for	ADP
finefocus-615	400	23	sequencing	sequence	VERB
finefocus-615	400	24	our	our	PRON
finefocus-615	400	25	samples	sample	NOUN
finefocus-615	400	26	on	on	ADP
finefocus-615	400	27	a	a	DET
finefocus-615	400	28	miseq	miseq	ADJ
finefocus-615	400	29	illumina	illumina	ADJ
finefocus-615	400	30	sequencer	sequencer	NOUN
finefocus-615	400	31	.	.	PUNCT
finefocus-615	401	1	we	we	PRON
finefocus-615	401	2	thank	thank	VERB
finefocus-615	401	3	the	the	DET
finefocus-615	401	4	two	two	NUM
finefocus-615	401	5	reviewers	reviewer	NOUN
finefocus-615	401	6	for	for	ADP
finefocus-615	401	7	their	their	PRON
finefocus-615	401	8	insightful	insightful	ADJ
finefocus-615	401	9	comments	comment	NOUN
finefocus-615	401	10	.	.	PUNCT
finefocus-615	402	1	wellesley	wellesley	PROPN
finefocus-615	402	2	college	college	PROPN
finefocus-615	402	3	’s	’s	PART
finefocus-615	402	4	bisc	bisc	NOUN
finefocus-615	402	5	314	314	NUM
finefocus-615	402	6	environmental	environmental	ADJ
finefocus-615	402	7	microbiology	microbiology	NOUN
finefocus-615	402	8	course	course	NOUN
finefocus-615	402	9	funds	fund	NOUN
finefocus-615	402	10	were	be	AUX
finefocus-615	402	11	used	use	VERB
finefocus-615	402	12	to	to	PART
finefocus-615	402	13	fund	fund	VERB
finefocus-615	402	14	this	this	DET
finefocus-615	402	15	project	project	NOUN
finefocus-615	402	16	.	.	PUNCT
finefocus-615	403	1	cheese	cheese	NOUN
finefocus-615	403	2	communities	community	NOUN
finefocus-615	403	3	maintained	maintain	VERB
finefocus-615	403	4	higher	high	ADJ
finefocus-615	403	5	cmd	cmd	NOUN
finefocus-615	403	6	than	than	ADP
finefocus-615	403	7	isolates	isolate	NOUN
finefocus-615	403	8	(	(	PUNCT
finefocus-615	403	9	supplementary	supplementary	ADJ
finefocus-615	403	10	figure	figure	NOUN
finefocus-615	403	11	3	3	NUM
finefocus-615	403	12	)	)	PUNCT
finefocus-615	403	13	.	.	PUNCT
finefocus-615	404	1	it	it	PRON
finefocus-615	404	2	is	be	AUX
finefocus-615	404	3	likely	likely	ADJ
finefocus-615	404	4	that	that	SCONJ
finefocus-615	404	5	the	the	DET
finefocus-615	404	6	purified	purified	ADJ
finefocus-615	404	7	isolates	isolate	NOUN
finefocus-615	404	8	did	do	AUX
finefocus-615	404	9	not	not	PART
finefocus-615	404	10	represent	represent	VERB
finefocus-615	404	11	the	the	DET
finefocus-615	404	12	majority	majority	NOUN
finefocus-615	404	13	of	of	ADP
finefocus-615	404	14	the	the	DET
finefocus-615	404	15	community	community	NOUN
finefocus-615	404	16	.	.	PUNCT
finefocus-615	405	1	secondly	secondly	ADV
finefocus-615	405	2	,	,	PUNCT
finefocus-615	405	3	many	many	ADJ
finefocus-615	405	4	isolates	isolate	NOUN
finefocus-615	405	5	purified	purify	VERB
finefocus-615	405	6	from	from	ADP
finefocus-615	405	7	cheese	cheese	NOUN
finefocus-615	405	8	rinds	rind	NOUN
finefocus-615	405	9	were	be	AUX
finefocus-615	405	10	exposed	expose	VERB
finefocus-615	405	11	to	to	ADP
finefocus-615	405	12	substrates	substrate	NOUN
finefocus-615	405	13	typical	typical	ADJ
finefocus-615	405	14	of	of	ADP
finefocus-615	405	15	milk	milk	NOUN
finefocus-615	405	16	curds	curd	NOUN
finefocus-615	405	17	in	in	ADP
finefocus-615	405	18	the	the	DET
finefocus-615	405	19	ecoplatetm	ecoplatetm	NOUN
finefocus-615	405	20	assay	assay	PROPN
finefocus-615	405	21	(	(	PUNCT
finefocus-615	405	22	table	table	NOUN
finefocus-615	405	23	2	2	NUM
finefocus-615	405	24	)	)	PUNCT
finefocus-615	405	25	.	.	PUNCT
finefocus-615	406	1	rind	rind	NOUN
finefocus-615	406	2	microbes	microbe	NOUN
finefocus-615	406	3	are	be	AUX
finefocus-615	406	4	not	not	PART
finefocus-615	406	5	selected	select	VERB
finefocus-615	406	6	for	for	ADP
finefocus-615	406	7	in	in	ADP
finefocus-615	406	8	an	an	DET
finefocus-615	406	9	environment	environment	NOUN
finefocus-615	406	10	with	with	ADP
finefocus-615	406	11	a	a	DET
finefocus-615	406	12	predominance	predominance	NOUN
finefocus-615	406	13	of	of	ADP
finefocus-615	406	14	substrates	substrate	NOUN
finefocus-615	406	15	found	find	VERB
finefocus-615	406	16	in	in	ADP
finefocus-615	406	17	raw	raw	ADJ
finefocus-615	406	18	milk	milk	NOUN
finefocus-615	406	19	.	.	PUNCT
finefocus-615	407	1	strikingly	strikingly	ADV
finefocus-615	407	2	,	,	PUNCT
finefocus-615	407	3	in	in	ADP
finefocus-615	407	4	the	the	DET
finefocus-615	407	5	missouri	missouri	PROPN
finefocus-615	407	6	truckle	truckle	PROPN
finefocus-615	407	7	cheese	cheese	NOUN
finefocus-615	407	8	,	,	PUNCT
finefocus-615	407	9	isolates	isolate	NOUN
finefocus-615	407	10	were	be	AUX
finefocus-615	407	11	able	able	ADJ
finefocus-615	407	12	to	to	PART
finefocus-615	407	13	digest	digest	VERB
finefocus-615	407	14	two	two	NUM
finefocus-615	407	15	carbon	carbon	NOUN
finefocus-615	407	16	sources	source	NOUN
finefocus-615	407	17	that	that	PRON
finefocus-615	407	18	were	be	AUX
finefocus-615	407	19	inaccessible	inaccessible	ADJ
finefocus-615	407	20	by	by	ADP
finefocus-615	407	21	the	the	DET
finefocus-615	407	22	community	community	NOUN
finefocus-615	407	23	(	(	PUNCT
finefocus-615	407	24	supplementary	supplementary	ADJ
finefocus-615	407	25	table	table	NOUN
finefocus-615	407	26	2	2	NUM
finefocus-615	407	27	)	)	PUNCT
finefocus-615	407	28	.	.	PUNCT
finefocus-615	408	1	this	this	PRON
finefocus-615	408	2	suggests	suggest	VERB
finefocus-615	408	3	that	that	SCONJ
finefocus-615	408	4	those	those	DET
finefocus-615	408	5	microbes	microbe	NOUN
finefocus-615	408	6	that	that	PRON
finefocus-615	408	7	are	be	AUX
finefocus-615	408	8	best	well	ADV
finefocus-615	408	9	suited	suited	ADJ
finefocus-615	408	10	to	to	ADP
finefocus-615	408	11	aerobic	aerobic	ADJ
finefocus-615	408	12	growth	growth	NOUN
finefocus-615	408	13	on	on	ADP
finefocus-615	408	14	agar	agar	NOUN
finefocus-615	408	15	plates	plate	NOUN
finefocus-615	408	16	may	may	AUX
finefocus-615	408	17	not	not	PART
finefocus-615	408	18	accurately	accurately	ADV
finefocus-615	408	19	represent	represent	VERB
finefocus-615	408	20	the	the	DET
finefocus-615	408	21	taxonomic	taxonomic	ADJ
finefocus-615	408	22	or	or	CCONJ
finefocus-615	408	23	functional	functional	ADJ
finefocus-615	408	24	makeup	makeup	NOUN
finefocus-615	408	25	of	of	ADP
finefocus-615	408	26	the	the	DET
finefocus-615	408	27	community	community	NOUN
finefocus-615	408	28	.	.	PUNCT
finefocus-615	409	1	given	give	VERB
finefocus-615	409	2	that	that	PRON
finefocus-615	409	3	most	most	ADJ
finefocus-615	409	4	clpp	clpp	NOUN
finefocus-615	409	5	of	of	ADP
finefocus-615	409	6	cheese	cheese	NOUN
finefocus-615	409	7	microbes	microbe	NOUN
finefocus-615	409	8	have	have	AUX
finefocus-615	409	9	used	use	VERB
finefocus-615	409	10	exclusively	exclusively	ADV
finefocus-615	409	11	culture	culture	NOUN
finefocus-615	409	12	-	-	PUNCT
finefocus-615	409	13	dependent	dependent	ADJ
finefocus-615	409	14	methods	method	NOUN
finefocus-615	409	15	(	(	PUNCT
finefocus-615	409	16	44	44	NUM
finefocus-615	409	17	,	,	PUNCT
finefocus-615	409	18	47	47	NUM
finefocus-615	409	19	)	)	PUNCT
finefocus-615	409	20	our	our	PRON
finefocus-615	409	21	findings	finding	NOUN
finefocus-615	409	22	suggest	suggest	VERB
finefocus-615	409	23	that	that	SCONJ
finefocus-615	409	24	future	future	ADJ
finefocus-615	409	25	analyses	analysis	NOUN
finefocus-615	409	26	of	of	ADP
finefocus-615	409	27	cheese	cheese	NOUN
finefocus-615	409	28	community	community	NOUN
finefocus-615	409	29	metabolism	metabolism	NOUN
finefocus-615	409	30	using	use	VERB
finefocus-615	409	31	clpp	clpp	NOUN
finefocus-615	409	32	should	should	AUX
finefocus-615	409	33	incorporate	incorporate	VERB
finefocus-615	409	34	culture	culture	NOUN
finefocus-615	409	35	-	-	PUNCT
finefocus-615	409	36	independent	independent	ADJ
finefocus-615	409	37	methods	method	NOUN
finefocus-615	409	38	in	in	ADP
finefocus-615	409	39	addition	addition	NOUN
finefocus-615	409	40	to	to	ADP
finefocus-615	409	41	culture	culture	NOUN
finefocus-615	409	42	-	-	PUNCT
finefocus-615	409	43	dependent	dependent	ADJ
finefocus-615	409	44	methods	method	NOUN
finefocus-615	409	45	.	.	PUNCT
finefocus-615	410	1	references	reference	NOUN
finefocus-615	410	2	1	1	NUM
finefocus-615	410	3	.	.	PUNCT
finefocus-615	410	4	alegría	alegría	PROPN
finefocus-615	410	5	,	,	PUNCT
finefocus-615	410	6	á	á	PROPN
finefocus-615	410	7	.	.	PROPN
finefocus-615	410	8	,	,	PUNCT
finefocus-615	410	9	álvarez	álvarez	NOUN
finefocus-615	410	10	-	-	PUNCT
finefocus-615	410	11	martín	martín	NOUN
finefocus-615	410	12	,	,	PUNCT
finefocus-615	410	13	p.	p.	NOUN
finefocus-615	410	14	,	,	PUNCT
finefocus-615	410	15	sacristán	sacristán	ADJ
finefocus-615	410	16	,	,	PUNCT
finefocus-615	410	17	n.	n.	NOUN
finefocus-615	410	18	,	,	PUNCT
finefocus-615	410	19	fernández	fernández	PROPN
finefocus-615	410	20	,	,	PUNCT
finefocus-615	410	21	e.	e.	PROPN
finefocus-615	410	22	,	,	PUNCT
finefocus-615	410	23	delgado	delgado	PROPN
finefocus-615	410	24	,	,	PUNCT
finefocus-615	410	25	s.	s.	PROPN
finefocus-615	410	26	,	,	PUNCT
finefocus-615	410	27	&	&	CCONJ
finefocus-615	410	28	mayo	mayo	PROPN
finefocus-615	410	29	,	,	PUNCT
finefocus-615	410	30	b.	b.	PROPN
finefocus-615	410	31	(	(	PUNCT
finefocus-615	410	32	2009	2009	NUM
finefocus-615	410	33	)	)	PUNCT
finefocus-615	410	34	.	.	PUNCT
finefocus-615	411	1	diversity	diversity	NOUN
finefocus-615	411	2	and	and	CCONJ
finefocus-615	411	3	evolution	evolution	NOUN
finefocus-615	411	4	of	of	ADP
finefocus-615	411	5	the	the	DET
finefocus-615	411	6	microbial	microbial	ADJ
finefocus-615	411	7	populations	population	NOUN
finefocus-615	411	8	during	during	ADP
finefocus-615	411	9	manufacture	manufacture	NOUN
finefocus-615	411	10	and	and	CCONJ
finefocus-615	411	11	ripening	ripening	NOUN
finefocus-615	411	12	of	of	ADP
finefocus-615	411	13	casín	casín	PROPN
finefocus-615	411	14	,	,	PUNCT
finefocus-615	411	15	a	a	DET
finefocus-615	411	16	traditional	traditional	ADJ
finefocus-615	411	17	spanish	spanish	ADJ
finefocus-615	411	18	,	,	PUNCT
finefocus-615	411	19	starter	starter	ADV
finefocus-615	411	20	-	-	PUNCT
finefocus-615	411	21	free	free	ADJ
finefocus-615	411	22	cheese	cheese	NOUN
finefocus-615	411	23	made	make	VERB
finefocus-615	411	24	from	from	ADP
finefocus-615	411	25	cow	cow	NOUN
finefocus-615	411	26	’s	’s	PART
finefocus-615	411	27	milk	milk	NOUN
finefocus-615	411	28	.	.	PUNCT
finefocus-615	412	1	intl	intl	PROPN
finefocus-615	412	2	.	.	PUNCT
finefocus-615	413	1	j.	j.	PROPN
finefocus-615	413	2	food	food	PROPN
finefocus-615	413	3	microbiol	microbiol	PROPN
finefocus-615	413	4	,	,	PUNCT
finefocus-615	413	5	136(1	136(1	NUM
finefocus-615	413	6	):	):	PUNCT
finefocus-615	413	7	44	44	NUM
finefocus-615	413	8	-	-	SYM
finefocus-615	413	9	51	51	NUM
finefocus-615	413	10	.	.	NOUN
finefocus-615	414	1	2	2	NUM
finefocus-615	414	2	.	.	X
finefocus-615	414	3	andersen	andersen	PROPN
finefocus-615	414	4	,	,	PUNCT
finefocus-615	414	5	s.	s.	PROPN
finefocus-615	414	6	j.	j.	PROPN
finefocus-615	414	7	,	,	PUNCT
finefocus-615	414	8	&	&	CCONJ
finefocus-615	414	9	frisvad	frisvad	PROPN
finefocus-615	414	10	,	,	PUNCT
finefocus-615	414	11	j.	j.	PROPN
finefocus-615	414	12	c.	c.	PROPN
finefocus-615	414	13	(	(	PUNCT
finefocus-615	414	14	1994	1994	NUM
finefocus-615	414	15	)	)	PUNCT
finefocus-615	414	16	.	.	PUNCT
finefocus-615	415	1	penicillin	penicillin	NOUN
finefocus-615	415	2	production	production	NOUN
finefocus-615	415	3	by	by	ADP
finefocus-615	415	4	penicillium	penicillium	NOUN
finefocus-615	415	5	nalgiovense	nalgiovense	NOUN
finefocus-615	415	6	.	.	PUNCT
finefocus-615	416	1	lett	lett	PROPN
finefocus-615	416	2	.	.	PUNCT
finefocus-615	416	3	appl	appl	PROPN
finefocus-615	416	4	.	.	PUNCT
finefocus-615	417	1	microbiol	microbiol	PROPN
finefocus-615	417	2	.	.	PUNCT
finefocus-615	418	1	19(6	19(6	NUM
finefocus-615	418	2	):	):	PUNCT
finefocus-615	418	3	486488	486488	NUM
finefocus-615	418	4	.	.	PUNCT
finefocus-615	419	1	3	3	X
finefocus-615	419	2	.	.	X
finefocus-615	419	3	aroutcheva	aroutcheva	PROPN
finefocus-615	419	4	,	,	PUNCT
finefocus-615	419	5	a.	a.	NOUN
finefocus-615	419	6	a.	a.	PROPN
finefocus-615	419	7	,	,	PUNCT
finefocus-615	419	8	simoes	simoe	NOUN
finefocus-615	419	9	,	,	PUNCT
finefocus-615	419	10	jose	jose	PROPN
finefocus-615	419	11	a.	a.	PROPN
finefocus-615	419	12	,	,	PUNCT
finefocus-615	419	13	&	&	CCONJ
finefocus-615	419	14	faro	faro	PROPN
finefocus-615	419	15	,	,	PUNCT
finefocus-615	419	16	s.	s.	PROPN
finefocus-615	419	17	(	(	PUNCT
finefocus-615	419	18	2001	2001	NUM
finefocus-615	419	19	)	)	PUNCT
finefocus-615	419	20	.	.	PUNCT
finefocus-615	420	1	antimicrobial	antimicrobial	ADJ
finefocus-615	420	2	protein	protein	NOUN
finefocus-615	420	3	produced	produce	VERB
finefocus-615	420	4	by	by	ADP
finefocus-615	420	5	vaginal	vaginal	ADJ
finefocus-615	420	6	lactobacillus	lactobacillus	NOUN
finefocus-615	420	7	acidophilus	acidophilus	NOUN
finefocus-615	420	8	that	that	PRON
finefocus-615	420	9	inhibits	inhibit	VERB
finefocus-615	420	10	gardnerella	gardnerella	NOUN
finefocus-615	420	11	vaginalis	vaginali	NOUN
finefocus-615	420	12	.	.	PUNCT
finefocus-615	421	1	infec	infec	PROPN
finefocus-615	421	2	.	.	PUNCT
finefocus-615	422	1	dis	dis	PROPN
finefocus-615	422	2	.	.	PUNCT
finefocus-615	423	1	ob	ob	PROPN
finefocus-615	423	2	.	.	PUNCT
finefocus-615	423	3	gyn	gyn	PROPN
finefocus-615	423	4	.	.	PUNCT
finefocus-615	424	1	9(1	9(1	NUM
finefocus-615	424	2	):	):	PUNCT
finefocus-615	424	3	33	33	NUM
finefocus-615	424	4	-	-	SYM
finefocus-615	424	5	39	39	NUM
finefocus-615	424	6	.	.	PUNCT
finefocus-615	425	1	4	4	X
finefocus-615	425	2	.	.	X
finefocus-615	426	1	banjara	banjara	PROPN
finefocus-615	426	2	,	,	PUNCT
finefocus-615	426	3	n.	n.	NOUN
finefocus-615	426	4	,	,	PUNCT
finefocus-615	426	5	suhr	suhr	PROPN
finefocus-615	426	6	,	,	PUNCT
finefocus-615	426	7	m.	m.	NOUN
finefocus-615	426	8	j.	j.	PROPN
finefocus-615	426	9	,	,	PUNCT
finefocus-615	426	10	&	&	CCONJ
finefocus-615	426	11	hallen	hallen	PROPN
finefocus-615	426	12	-	-	PUNCT
finefocus-615	426	13	adams	adams	PROPN
finefocus-615	426	14	,	,	PUNCT
finefocus-615	426	15	h.	h.	PROPN
finefocus-615	426	16	e.	e.	PROPN
finefocus-615	426	17	(	(	PUNCT
finefocus-615	426	18	2015	2015	NUM
finefocus-615	426	19	)	)	PUNCT
finefocus-615	426	20	.	.	PUNCT
finefocus-615	427	1	diversity	diversity	NOUN
finefocus-615	427	2	of	of	ADP
finefocus-615	427	3	yeast	yeast	NOUN
finefocus-615	427	4	and	and	CCONJ
finefocus-615	427	5	mold	mold	NOUN
finefocus-615	427	6	species	specie	NOUN
finefocus-615	427	7	from	from	ADP
finefocus-615	427	8	a	a	DET
finefocus-615	427	9	variety	variety	NOUN
finefocus-615	427	10	of	of	ADP
finefocus-615	427	11	cheese	cheese	NOUN
finefocus-615	427	12	types	type	NOUN
finefocus-615	427	13	.	.	PUNCT
finefocus-615	428	1	curr	curr	PROPN
finefocus-615	428	2	.	.	PUNCT
finefocus-615	428	3	microbiol	microbiol	PROPN
finefocus-615	428	4	.	.	PUNCT
finefocus-615	429	1	70(6	70(6	NOUN
finefocus-615	429	2	):	):	PUNCT
finefocus-615	429	3	792	792	NUM
finefocus-615	429	4	-	-	SYM
finefocus-615	429	5	800	800	NUM
finefocus-615	429	6	.	.	PUNCT
finefocus-615	430	1	doi	doi	NOUN
finefocus-615	430	2	:	:	PUNCT
finefocus-615	430	3	10.1007/	10.1007/	NUM
finefocus-615	430	4	s00284	s00284	NOUN
finefocus-615	430	5	-	-	PUNCT
finefocus-615	430	6	015	015	NUM
finefocus-615	430	7	-	-	PUNCT
finefocus-615	430	8	0790	0790	NUM
finefocus-615	430	9	-	-	PUNCT
finefocus-615	430	10	1	1	NUM
finefocus-615	430	11	.	.	NOUN
finefocus-615	430	12	5	5	NUM
finefocus-615	430	13	.	.	X
finefocus-615	430	14	bauer	bauer	PROPN
finefocus-615	430	15	,	,	PUNCT
finefocus-615	430	16	a.	a.	PROPN
finefocus-615	430	17	w.	w.	PROPN
finefocus-615	430	18	,	,	PUNCT
finefocus-615	430	19	kirby	kirby	PROPN
finefocus-615	430	20	,	,	PUNCT
finefocus-615	430	21	w.	w.	PROPN
finefocus-615	430	22	m.	m.	PROPN
finefocus-615	430	23	,	,	PUNCT
finefocus-615	430	24	sherris	sherris	PROPN
finefocus-615	430	25	,	,	PUNCT
finefocus-615	430	26	j.	j.	PROPN
finefocus-615	430	27	c.	c.	PROPN
finefocus-615	430	28	,	,	PUNCT
finefocus-615	430	29	&	&	CCONJ
finefocus-615	430	30	turck	turck	ADV
finefocus-615	430	31	,	,	PUNCT
finefocus-615	430	32	m.	m.	NOUN
finefocus-615	430	33	(	(	PUNCT
finefocus-615	430	34	1966	1966	NUM
finefocus-615	430	35	)	)	PUNCT
finefocus-615	430	36	.	.	PUNCT
finefocus-615	431	1	antibiotic	antibiotic	ADJ
finefocus-615	431	2	susceptibility	susceptibility	NOUN
finefocus-615	431	3	testing	testing	NOUN
finefocus-615	431	4	by	by	ADP
finefocus-615	431	5	a	a	DET
finefocus-615	431	6	standardized	standardized	ADJ
finefocus-615	431	7	single	single	ADJ
finefocus-615	431	8	disk	disk	NOUN
finefocus-615	431	9	method	method	NOUN
finefocus-615	431	10	.	.	PUNCT
finefocus-615	432	1	amer	amer	PROPN
finefocus-615	432	2	.	.	PUNCT
finefocus-615	433	1	j.	j.	PROPN
finefocus-615	433	2	clin	clin	PROPN
finefocus-615	433	3	.	.	PUNCT
finefocus-615	434	1	pathol	pathol	PROPN
finefocus-615	434	2	.	.	PUNCT
finefocus-615	435	1	45(4	45(4	NUM
finefocus-615	435	2	):	):	PUNCT
finefocus-615	435	3	493	493	NUM
finefocus-615	435	4	-	-	SYM
finefocus-615	435	5	496	496	NUM
finefocus-615	435	6	.	.	PUNCT
finefocus-615	436	1	6	6	NUM
finefocus-615	436	2	.	.	X
finefocus-615	436	3	beresford	beresford	NOUN
finefocus-615	436	4	,	,	PUNCT
finefocus-615	436	5	t.	t.	PROPN
finefocus-615	436	6	p.	p.	PROPN
finefocus-615	436	7	,	,	PUNCT
finefocus-615	436	8	fitzsimons	fitzsimon	NOUN
finefocus-615	436	9	,	,	PUNCT
finefocus-615	436	10	n.	n.	PROPN
finefocus-615	436	11	a.	a.	PROPN
finefocus-615	436	12	,	,	PUNCT
finefocus-615	436	13	brennan	brennan	PROPN
finefocus-615	436	14	,	,	PUNCT
finefocus-615	436	15	n.	n.	PROPN
finefocus-615	436	16	l.	l.	PROPN
finefocus-615	436	17	,	,	PUNCT
finefocus-615	436	18	&	&	CCONJ
finefocus-615	436	19	cogan	cogan	PROPN
finefocus-615	436	20	,	,	PUNCT
finefocus-615	436	21	tim	tim	PROPN
finefocus-615	436	22	m.	m.	NOUN
finefocus-615	436	23	(	(	PUNCT
finefocus-615	436	24	2001	2001	NUM
finefocus-615	436	25	)	)	PUNCT
finefocus-615	436	26	.	.	PUNCT
finefocus-615	437	1	recent	recent	ADJ
finefocus-615	437	2	advances	advance	NOUN
finefocus-615	437	3	in	in	ADP
finefocus-615	437	4	cheese	cheese	NOUN
finefocus-615	437	5	microbiology	microbiology	NOUN
finefocus-615	437	6	.	.	PUNCT
finefocus-615	438	1	intl	intl	PROPN
finefocus-615	438	2	.	.	PUNCT
finefocus-615	439	1	dairy	dairy	NOUN
finefocus-615	439	2	j.	j.	PROPN
finefocus-615	439	3	11(4	11(4	NUM
finefocus-615	439	4	):	):	PUNCT
finefocus-615	439	5	259	259	NUM
finefocus-615	439	6	-	-	SYM
finefocus-615	439	7	274	274	NUM
finefocus-615	439	8	.	.	PUNCT
finefocus-615	439	9	7	7	X
finefocus-615	439	10	.	.	X
finefocus-615	439	11	bonev	bonev	PROPN
finefocus-615	439	12	,	,	PUNCT
finefocus-615	439	13	b.	b.	PROPN
finefocus-615	439	14	,	,	PUNCT
finefocus-615	439	15	hooper	hooper	PROPN
finefocus-615	439	16	,	,	PUNCT
finefocus-615	439	17	j.	j.	PROPN
finefocus-615	439	18	,	,	PUNCT
finefocus-615	439	19	&	&	CCONJ
finefocus-615	439	20	parisot	parisot	PROPN
finefocus-615	439	21	,	,	PUNCT
finefocus-615	439	22	j.	j.	PROPN
finefocus-615	439	23	(	(	PUNCT
finefocus-615	439	24	2008	2008	NUM
finefocus-615	439	25	)	)	PUNCT
finefocus-615	439	26	.	.	PUNCT
finefocus-615	439	27	principles	principle	NOUN
finefocus-615	439	28	of	of	ADP
finefocus-615	439	29	assessing	assess	VERB
finefocus-615	439	30	bacterial	bacterial	ADJ
finefocus-615	439	31	susceptibility	susceptibility	NOUN
finefocus-615	439	32	to	to	ADP
finefocus-615	439	33	antibiotics	antibiotic	NOUN
finefocus-615	439	34	using	use	VERB
finefocus-615	439	35	the	the	DET
finefocus-615	439	36	agar	agar	NOUN
finefocus-615	439	37	diffusion	diffusion	NOUN
finefocus-615	439	38	method	method	NOUN
finefocus-615	439	39	.	.	PUNCT
finefocus-615	440	1	j	j	PROPN
finefocus-615	440	2	antimicrob	antimicrob	PROPN
finefocus-615	440	3	.	.	PUNCT
finefocus-615	441	1	chemother	chemother	PROPN
finefocus-615	441	2	.	.	PUNCT
finefocus-615	442	1	61(6	61(6	NUM
finefocus-615	442	2	):	):	PUNCT
finefocus-615	442	3	1295	1295	NUM
finefocus-615	442	4	-	-	SYM
finefocus-615	442	5	1301	1301	NUM
finefocus-615	442	6	.	.	PUNCT
finefocus-615	443	1	doi	doi	NOUN
finefocus-615	443	2	:	:	PUNCT
finefocus-615	443	3	10.1093	10.1093	NUM
finefocus-615	443	4	/	/	SYM
finefocus-615	443	5	jac	jac	PROPN
finefocus-615	443	6	/	/	SYM
finefocus-615	443	7	dkn090	dkn090	PROPN
finefocus-615	443	8	.	.	PUNCT
finefocus-615	444	1	8	8	NUM
finefocus-615	444	2	.	.	PUNCT
finefocus-615	444	3	caggia	caggia	NOUN
finefocus-615	444	4	,	,	PUNCT
finefocus-615	444	5	c.	c.	PROPN
finefocus-615	444	6	,	,	PUNCT
finefocus-615	444	7	de	de	PROPN
finefocus-615	444	8	angelis	angelis	PROPN
finefocus-615	444	9	,	,	PUNCT
finefocus-615	444	10	m.	m.	NOUN
finefocus-615	444	11	,	,	PUNCT
finefocus-615	444	12	pitino	pitino	PROPN
finefocus-615	444	13	,	,	PUNCT
finefocus-615	444	14	i.	i.	NOUN
finefocus-615	444	15	,	,	PUNCT
finefocus-615	444	16	pino	pino	PROPN
finefocus-615	444	17	,	,	PUNCT
finefocus-615	444	18	a.	a.	NOUN
finefocus-615	444	19	,	,	PUNCT
finefocus-615	444	20	&	&	CCONJ
finefocus-615	444	21	randazzo	randazzo	PROPN
finefocus-615	444	22	,	,	PUNCT
finefocus-615	444	23	c.	c.	PROPN
finefocus-615	444	24	l.	l.	PROPN
finefocus-615	444	25	(	(	PUNCT
finefocus-615	444	26	2015	2015	NUM
finefocus-615	444	27	)	)	PUNCT
finefocus-615	444	28	.	.	PUNCT
finefocus-615	445	1	probiotic	probiotic	ADJ
finefocus-615	445	2	features	feature	NOUN
finefocus-615	445	3	of	of	ADP
finefocus-615	445	4	lactobacillus	lactobacillus	NOUN
finefocus-615	445	5	strains	strain	NOUN
finefocus-615	445	6	isolated	isolate	VERB
finefocus-615	445	7	from	from	ADP
finefocus-615	445	8	ragusano	ragusano	ADJ
finefocus-615	445	9	and	and	CCONJ
finefocus-615	445	10	pecorino	pecorino	PROPN
finefocus-615	445	11	siciliano	siciliano	PROPN
finefocus-615	445	12	cheeses	cheese	NOUN
finefocus-615	445	13	.	.	PUNCT
finefocus-615	446	1	food	food	NOUN
finefocus-615	446	2	microbiol	microbiol	PROPN
finefocus-615	446	3	.	.	PUNCT
finefocus-615	447	1	50	50	NUM
finefocus-615	447	2	:	:	SYM
finefocus-615	447	3	109	109	NUM
finefocus-615	447	4	-	-	SYM
finefocus-615	447	5	117	117	NUM
finefocus-615	447	6	.	.	PUNCT
finefocus-615	448	1	doi	doi	NOUN
finefocus-615	448	2	:	:	PUNCT
finefocus-615	448	3	10.1016	10.1016	NUM
finefocus-615	448	4	/	/	SYM
finefocus-615	448	5	j.fm.2015.03.010	j.fm.2015.03.010	PROPN
finefocus-615	448	6	.	.	PROPN
finefocus-615	448	7	30	30	NUM
finefocus-615	448	8	•	•	NUM
finefocus-615	448	9	fine	fine	ADJ
finefocus-615	448	10	focus	focus	NOUN
finefocus-615	448	11	,	,	PUNCT
finefocus-615	448	12	vol	vol	NOUN
finefocus-615	448	13	.	.	NOUN
finefocus-615	448	14	3	3	NUM
finefocus-615	448	15	(	(	PUNCT
finefocus-615	448	16	1	1	NUM
finefocus-615	448	17	)	)	PUNCT
finefocus-615	448	18	9	9	NUM
finefocus-615	448	19	.	.	PUNCT
finefocus-615	449	1	caporaso	caporaso	PROPN
finefocus-615	449	2	,	,	PUNCT
finefocus-615	449	3	j.	j.	PROPN
finefocus-615	449	4	g.	g.	PROPN
finefocus-615	449	5	,	,	PUNCT
finefocus-615	449	6	lauber	lauber	NOUN
finefocus-615	449	7	,	,	PUNCT
finefocus-615	449	8	c.	c.	PROPN
finefocus-615	449	9	l.	l.	PROPN
finefocus-615	449	10	,	,	PUNCT
finefocus-615	449	11	walters	walters	PROPN
finefocus-615	449	12	,	,	PUNCT
finefocus-615	449	13	w.	w.	PROPN
finefocus-615	449	14	a.	a.	PROPN
finefocus-615	449	15	,	,	PUNCT
finefocus-615	449	16	berg	berg	PROPN
finefocus-615	449	17	-	-	PUNCT
finefocus-615	449	18	lyons	lyons	PROPN
finefocus-615	449	19	,	,	PUNCT
finefocus-615	449	20	d.	d.	PROPN
finefocus-615	449	21	,	,	PUNCT
finefocus-615	449	22	huntley	huntley	PROPN
finefocus-615	449	23	,	,	PUNCT
finefocus-615	449	24	j.	j.	PROPN
finefocus-615	449	25	,	,	PUNCT
finefocus-615	449	26	fierer	fierer	NOUN
finefocus-615	449	27	,	,	PUNCT
finefocus-615	449	28	n.	n.	PROPN
finefocus-615	449	29	,	,	PUNCT
finefocus-615	449	30	owens	owens	PROPN
finefocus-615	449	31	,	,	PUNCT
finefocus-615	449	32	s.	s.	PROPN
finefocus-615	449	33	m.	m.	PROPN
finefocus-615	449	34	,	,	PUNCT
finefocus-615	449	35	betley	betley	PROPN
finefocus-615	449	36	,	,	PUNCT
finefocus-615	449	37	j.	j.	PROPN
finefocus-615	449	38	,	,	PUNCT
finefocus-615	449	39	fraser	fraser	PROPN
finefocus-615	449	40	,	,	PUNCT
finefocus-615	449	41	l.	l.	PROPN
finefocus-615	449	42	,	,	PUNCT
finefocus-615	449	43	bauer	bauer	PROPN
finefocus-615	449	44	,	,	PUNCT
finefocus-615	449	45	m.	m.	NOUN
finefocus-615	449	46	,	,	PUNCT
finefocus-615	449	47	gormley	gormley	PROPN
finefocus-615	449	48	,	,	PUNCT
finefocus-615	449	49	n.	n.	PROPN
finefocus-615	449	50	,	,	PUNCT
finefocus-615	449	51	gilbert	gilbert	PROPN
finefocus-615	449	52	,	,	PUNCT
finefocus-615	449	53	j.	j.	PROPN
finefocus-615	449	54	a.	a.	PROPN
finefocus-615	449	55	,	,	PUNCT
finefocus-615	449	56	smith	smith	PROPN
finefocus-615	449	57	,	,	PUNCT
finefocus-615	449	58	g.	g.	PROPN
finefocus-615	449	59	,	,	PUNCT
finefocus-615	449	60	&	&	CCONJ
finefocus-615	449	61	knight	knight	PROPN
finefocus-615	449	62	,	,	PUNCT
finefocus-615	449	63	r.	r.	PROPN
finefocus-615	449	64	(	(	PUNCT
finefocus-615	449	65	2012	2012	NUM
finefocus-615	449	66	)	)	PUNCT
finefocus-615	449	67	.	.	PUNCT
finefocus-615	450	1	ultra	ultra	ADJ
finefocus-615	450	2	-	-	ADJ
finefocus-615	450	3	high	high	ADJ
finefocus-615	450	4	-	-	PUNCT
finefocus-615	450	5	throughput	throughput	NOUN
finefocus-615	450	6	microbial	microbial	ADJ
finefocus-615	450	7	community	community	NOUN
finefocus-615	450	8	analysis	analysis	NOUN
finefocus-615	450	9	on	on	ADP
finefocus-615	450	10	the	the	DET
finefocus-615	450	11	illumina	illumina	PROPN
finefocus-615	450	12	hiseq	hiseq	PROPN
finefocus-615	450	13	and	and	CCONJ
finefocus-615	450	14	miseq	miseq	NOUN
finefocus-615	450	15	platforms	platform	NOUN
finefocus-615	450	16	.	.	PUNCT
finefocus-615	451	1	isme	isme	PROPN
finefocus-615	451	2	j.	j.	PROPN
finefocus-615	451	3	6(8	6(8	PROPN
finefocus-615	451	4	):	):	PUNCT
finefocus-615	451	5	1621	1621	NUM
finefocus-615	451	6	-	-	SYM
finefocus-615	451	7	1624	1624	NUM
finefocus-615	451	8	.	.	PUNCT
finefocus-615	452	1	doi	doi	NOUN
finefocus-615	452	2	:	:	PUNCT
finefocus-615	452	3	10.1038	10.1038	NUM
finefocus-615	452	4	/	/	SYM
finefocus-615	452	5	ismej.2012.8	ismej.2012.8	NOUN
finefocus-615	452	6	.	.	PUNCT
finefocus-615	453	1	10	10	NUM
finefocus-615	453	2	.	.	X
finefocus-615	453	3	de	de	X
finefocus-615	453	4	filippis	filippis	PROPN
finefocus-615	453	5	,	,	PUNCT
finefocus-615	453	6	f.	f.	PROPN
finefocus-615	453	7	,	,	PUNCT
finefocus-615	453	8	la	la	PROPN
finefocus-615	453	9	storia	storia	PROPN
finefocus-615	453	10	,	,	PUNCT
finefocus-615	453	11	a.	a.	NOUN
finefocus-615	453	12	,	,	PUNCT
finefocus-615	453	13	stellato	stellato	NOUN
finefocus-615	453	14	,	,	PUNCT
finefocus-615	453	15	g.	g.	PROPN
finefocus-615	453	16	,	,	PUNCT
finefocus-615	453	17	gatti	gatti	PROPN
finefocus-615	453	18	,	,	PUNCT
finefocus-615	453	19	m.	m.	NOUN
finefocus-615	453	20	,	,	PUNCT
finefocus-615	453	21	&	&	CCONJ
finefocus-615	453	22	ercolini	ercolini	PROPN
finefocus-615	453	23	,	,	PUNCT
finefocus-615	453	24	d.	d.	PROPN
finefocus-615	453	25	(	(	PUNCT
finefocus-615	453	26	2014	2014	NUM
finefocus-615	453	27	)	)	PUNCT
finefocus-615	453	28	.	.	PUNCT
finefocus-615	454	1	a	a	DET
finefocus-615	454	2	selected	select	VERB
finefocus-615	454	3	core	core	NOUN
finefocus-615	454	4	microbiome	microbiome	NOUN
finefocus-615	454	5	drives	drive	VERB
finefocus-615	454	6	the	the	DET
finefocus-615	454	7	early	early	ADJ
finefocus-615	454	8	stages	stage	NOUN
finefocus-615	454	9	of	of	ADP
finefocus-615	454	10	three	three	NUM
finefocus-615	454	11	popular	popular	ADJ
finefocus-615	454	12	italian	italian	ADJ
finefocus-615	454	13	cheese	cheese	NOUN
finefocus-615	454	14	manufactures	manufacture	NOUN
finefocus-615	454	15	.	.	PUNCT
finefocus-615	455	1	plos	plos	PROPN
finefocus-615	455	2	one	one	NUM
finefocus-615	455	3	9(2	9(2	NUM
finefocus-615	455	4	)	)	PUNCT
finefocus-615	455	5	.	.	PUNCT
finefocus-615	456	1	11	11	NUM
finefocus-615	456	2	.	.	X
finefocus-615	456	3	delbès	delbès	NOUN
finefocus-615	456	4	,	,	PUNCT
finefocus-615	456	5	céline	céline	NOUN
finefocus-615	456	6	,	,	PUNCT
finefocus-615	456	7	ali	ali	PROPN
finefocus-615	456	8	-	-	PUNCT
finefocus-615	456	9	mandjee	mandjee	PROPN
finefocus-615	456	10	,	,	PUNCT
finefocus-615	456	11	leila	leila	PROPN
finefocus-615	456	12	,	,	PUNCT
finefocus-615	456	13	&	&	CCONJ
finefocus-615	456	14	montel	montel	PROPN
finefocus-615	456	15	,	,	PUNCT
finefocus-615	456	16	mariechristine	mariechristine	NOUN
finefocus-615	456	17	.	.	PUNCT
finefocus-615	457	1	(	(	PUNCT
finefocus-615	457	2	2007	2007	NUM
finefocus-615	457	3	)	)	PUNCT
finefocus-615	457	4	.	.	PUNCT
finefocus-615	458	1	monitoring	monitor	VERB
finefocus-615	458	2	bacterial	bacterial	ADJ
finefocus-615	458	3	communities	community	NOUN
finefocus-615	458	4	in	in	ADP
finefocus-615	458	5	raw	raw	ADJ
finefocus-615	458	6	milk	milk	NOUN
finefocus-615	458	7	and	and	CCONJ
finefocus-615	458	8	cheese	cheese	NOUN
finefocus-615	458	9	by	by	ADP
finefocus-615	458	10	culture	culture	NOUN
finefocus-615	458	11	-	-	PUNCT
finefocus-615	458	12	dependent	dependent	ADJ
finefocus-615	458	13	andindependent	andindependent	NOUN
finefocus-615	458	14	16s	16s	PROPN
finefocus-615	458	15	rrna	rrna	PROPN
finefocus-615	458	16	gene	gene	NOUN
finefocus-615	458	17	-	-	PUNCT
finefocus-615	458	18	based	base	VERB
finefocus-615	458	19	analyses	analysis	NOUN
finefocus-615	458	20	.	.	PUNCT
finefocus-615	459	1	appl	appl	PROPN
finefocus-615	459	2	.	.	PUNCT
finefocus-615	460	1	environ	environ	PROPN
finefocus-615	460	2	.	.	PUNCT
finefocus-615	460	3	microbial	microbial	ADJ
finefocus-615	460	4	.	.	PUNCT
finefocus-615	461	1	73(6	73(6	NUM
finefocus-615	461	2	):	):	PUNCT
finefocus-615	461	3	1882	1882	NUM
finefocus-615	461	4	-	-	SYM
finefocus-615	461	5	1891	1891	NUM
finefocus-615	461	6	.	.	PUNCT
finefocus-615	462	1	12	12	NUM
finefocus-615	462	2	.	.	PUNCT
finefocus-615	462	3	desantis	desantis	PROPN
finefocus-615	462	4	,	,	PUNCT
finefocus-615	462	5	t.	t.	PROPN
finefocus-615	462	6	z.	z.	PROPN
finefocus-615	462	7	,	,	PUNCT
finefocus-615	462	8	hugenholtz	hugenholtz	NOUN
finefocus-615	462	9	,	,	PUNCT
finefocus-615	462	10	p.	p.	NOUN
finefocus-615	462	11	,	,	PUNCT
finefocus-615	462	12	larsen	larsen	PROPN
finefocus-615	462	13	,	,	PUNCT
finefocus-615	462	14	n.	n.	PROPN
finefocus-615	462	15	,	,	PUNCT
finefocus-615	462	16	rojas	rojas	PROPN
finefocus-615	462	17	,	,	PUNCT
finefocus-615	462	18	m.	m.	NOUN
finefocus-615	462	19	,	,	PUNCT
finefocus-615	462	20	brodie	brodie	PROPN
finefocus-615	462	21	,	,	PUNCT
finefocus-615	462	22	e.	e.	PROPN
finefocus-615	462	23	l.	l.	PROPN
finefocus-615	462	24	,	,	PUNCT
finefocus-615	462	25	keller	keller	PROPN
finefocus-615	462	26	,	,	PUNCT
finefocus-615	462	27	k.	k.	PROPN
finefocus-615	462	28	,	,	PUNCT
finefocus-615	462	29	huber	huber	PROPN
finefocus-615	462	30	,	,	PUNCT
finefocus-615	462	31	t.	t.	PROPN
finefocus-615	462	32	,	,	PUNCT
finefocus-615	462	33	dalevi	dalevi	PROPN
finefocus-615	462	34	,	,	PUNCT
finefocus-615	462	35	d.	d.	PROPN
finefocus-615	462	36	,	,	PUNCT
finefocus-615	462	37	hu	hu	PROPN
finefocus-615	462	38	,	,	PUNCT
finefocus-615	462	39	p.	p.	PROPN
finefocus-615	462	40	,	,	PUNCT
finefocus-615	462	41	&	&	CCONJ
finefocus-615	462	42	andersen	andersen	PROPN
finefocus-615	462	43	,	,	PUNCT
finefocus-615	462	44	g.	g.	PROPN
finefocus-615	462	45	l.	l.	PROPN
finefocus-615	462	46	(	(	PUNCT
finefocus-615	462	47	2006	2006	NUM
finefocus-615	462	48	)	)	PUNCT
finefocus-615	462	49	.	.	PUNCT
finefocus-615	463	1	greengenes	greengene	NOUN
finefocus-615	463	2	,	,	PUNCT
finefocus-615	463	3	a	a	DET
finefocus-615	463	4	chimera	chimera	NOUN
finefocus-615	463	5	-	-	PUNCT
finefocus-615	463	6	checked	check	VERB
finefocus-615	463	7	16s	16s	PROPN
finefocus-615	463	8	rrna	rrna	PROPN
finefocus-615	463	9	gene	gene	NOUN
finefocus-615	463	10	database	database	NOUN
finefocus-615	463	11	and	and	CCONJ
finefocus-615	463	12	workbench	workbench	VERB
finefocus-615	463	13	compatible	compatible	ADJ
finefocus-615	463	14	with	with	ADP
finefocus-615	463	15	arb	arb	PROPN
finefocus-615	463	16	.	.	PROPN
finefocus-615	463	17	appl	appl	PROPN
finefocus-615	463	18	.	.	PUNCT
finefocus-615	464	1	environ	environ	PROPN
finefocus-615	464	2	.	.	PUNCT
finefocus-615	464	3	microbiol	microbiol	PROPN
finefocus-615	464	4	.	.	PUNCT
finefocus-615	465	1	72(7	72(7	NUM
finefocus-615	465	2	):	):	PUNCT
finefocus-615	465	3	5069	5069	NUM
finefocus-615	465	4	-	-	SYM
finefocus-615	465	5	5072	5072	NUM
finefocus-615	465	6	.	.	PUNCT
finefocus-615	466	1	13	13	NUM
finefocus-615	466	2	.	.	PUNCT
finefocus-615	467	1	devirgiliis	devirgiliis	PROPN
finefocus-615	467	2	,	,	PUNCT
finefocus-615	467	3	c.	c.	PROPN
finefocus-615	467	4	,	,	PUNCT
finefocus-615	467	5	caravelli	caravelli	PROPN
finefocus-615	467	6	,	,	PUNCT
finefocus-615	467	7	a.	a.	PROPN
finefocus-615	467	8	,	,	PUNCT
finefocus-615	467	9	coppola	coppola	PROPN
finefocus-615	467	10	,	,	PUNCT
finefocus-615	467	11	d.	d.	PROPN
finefocus-615	467	12	,	,	PUNCT
finefocus-615	467	13	barile	barile	NOUN
finefocus-615	467	14	,	,	PUNCT
finefocus-615	467	15	s.	s.	PROPN
finefocus-615	467	16	,	,	PUNCT
finefocus-615	467	17	&	&	CCONJ
finefocus-615	467	18	perozzi	perozzi	PROPN
finefocus-615	467	19	,	,	PUNCT
finefocus-615	467	20	g.	g.	PROPN
finefocus-615	467	21	(	(	PUNCT
finefocus-615	467	22	2008	2008	NUM
finefocus-615	467	23	)	)	PUNCT
finefocus-615	467	24	.	.	PUNCT
finefocus-615	468	1	antibiotic	antibiotic	ADJ
finefocus-615	468	2	resistance	resistance	NOUN
finefocus-615	468	3	and	and	CCONJ
finefocus-615	468	4	microbial	microbial	ADJ
finefocus-615	468	5	composition	composition	NOUN
finefocus-615	468	6	along	along	ADP
finefocus-615	468	7	the	the	DET
finefocus-615	468	8	manufacturing	manufacturing	NOUN
finefocus-615	468	9	process	process	NOUN
finefocus-615	468	10	of	of	ADP
finefocus-615	468	11	mozzarella	mozzarella	NOUN
finefocus-615	468	12	di	di	PROPN
finefocus-615	468	13	bufala	bufala	PROPN
finefocus-615	468	14	campana	campana	PROPN
finefocus-615	468	15	.	.	PROPN
finefocus-615	468	16	int	int	PROPN
finefocus-615	468	17	.	.	PUNCT
finefocus-615	469	1	j.	j.	PROPN
finefocus-615	469	2	food	food	PROPN
finefocus-615	469	3	microbiol	microbiol	PROPN
finefocus-615	469	4	.	.	PUNCT
finefocus-615	470	1	128(2	128(2	NUM
finefocus-615	470	2	):	):	PUNCT
finefocus-615	470	3	378	378	NUM
finefocus-615	470	4	-	-	SYM
finefocus-615	470	5	384	384	NUM
finefocus-615	470	6	.	.	PUNCT
finefocus-615	470	7	doi	doi	NOUN
finefocus-615	470	8	:	:	PUNCT
finefocus-615	470	9	10.1016	10.1016	NUM
finefocus-615	470	10	/	/	SYM
finefocus-615	470	11	j.ijfoodmicro.2008.09.021	j.ijfoodmicro.2008.09.021	PROPN
finefocus-615	470	12	.	.	PROPN
finefocus-615	471	1	14	14	NUM
finefocus-615	471	2	.	.	PUNCT
finefocus-615	472	1	dugat	dugat	NOUN
finefocus-615	472	2	-	-	NOUN
finefocus-615	472	3	bony	bony	NOUN
finefocus-615	472	4	,	,	PUNCT
finefocus-615	472	5	e.	e.	PROPN
finefocus-615	472	6	,	,	PUNCT
finefocus-615	472	7	straub	straub	PROPN
finefocus-615	472	8	,	,	PUNCT
finefocus-615	472	9	c.	c.	PROPN
finefocus-615	472	10	,	,	PUNCT
finefocus-615	472	11	teissandier	teissandier	NOUN
finefocus-615	472	12	,	,	PUNCT
finefocus-615	472	13	a.	a.	PROPN
finefocus-615	472	14	,	,	PUNCT
finefocus-615	472	15	onesime	onesime	ADV
finefocus-615	472	16	,	,	PUNCT
finefocus-615	472	17	d.	d.	PROPN
finefocus-615	472	18	,	,	PUNCT
finefocus-615	472	19	loux	loux	VERB
finefocus-615	472	20	,	,	PUNCT
finefocus-615	472	21	v.	v.	ADV
finefocus-615	472	22	,	,	PUNCT
finefocus-615	472	23	monnet	monnet	PROPN
finefocus-615	472	24	,	,	PUNCT
finefocus-615	472	25	c.	c.	NOUN
finefocus-615	472	26	,	,	PUNCT
finefocus-615	472	27	irlinger	irlinger	NOUN
finefocus-615	472	28	,	,	PUNCT
finefocus-615	472	29	f.	f.	PROPN
finefocus-615	472	30	,	,	PUNCT
finefocus-615	472	31	landaud	landaud	PROPN
finefocus-615	472	32	,	,	PUNCT
finefocus-615	472	33	s.	s.	PROPN
finefocus-615	472	34	,	,	PUNCT
finefocus-615	472	35	leclercqperlat	leclercqperlat	NOUN
finefocus-615	472	36	,	,	PUNCT
finefocus-615	472	37	m.	m.	NOUN
finefocus-615	472	38	n.	n.	PROPN
finefocus-615	472	39	,	,	PUNCT
finefocus-615	472	40	bento	bento	NOUN
finefocus-615	472	41	,	,	PUNCT
finefocus-615	472	42	p.	p.	NOUN
finefocus-615	472	43	,	,	PUNCT
finefocus-615	472	44	fraud	fraud	NOUN
finefocus-615	472	45	,	,	PUNCT
finefocus-615	472	46	s.	s.	PROPN
finefocus-615	472	47	,	,	PUNCT
finefocus-615	472	48	gibrat	gibrat	PROPN
finefocus-615	472	49	,	,	PUNCT
finefocus-615	472	50	j.	j.	PROPN
finefocus-615	472	51	f.	f.	PROPN
finefocus-615	472	52	,	,	PUNCT
finefocus-615	472	53	aubert	aubert	PROPN
finefocus-615	472	54	,	,	PUNCT
finefocus-615	472	55	j.	j.	PROPN
finefocus-615	472	56	,	,	PUNCT
finefocus-615	472	57	fer	fer	PROPN
finefocus-615	472	58	,	,	PUNCT
finefocus-615	472	59	f.	f.	PROPN
finefocus-615	472	60	,	,	PUNCT
finefocus-615	472	61	guedon	guedon	PROPN
finefocus-615	472	62	,	,	PUNCT
finefocus-615	472	63	e.	e.	PROPN
finefocus-615	472	64	,	,	PUNCT
finefocus-615	472	65	pons	pon	NOUN
finefocus-615	472	66	,	,	PUNCT
finefocus-615	472	67	n.	n.	PROPN
finefocus-615	472	68	,	,	PUNCT
finefocus-615	472	69	kennedy	kennedy	PROPN
finefocus-615	472	70	,	,	PUNCT
finefocus-615	472	71	s.	s.	PROPN
finefocus-615	472	72	,	,	PUNCT
finefocus-615	472	73	beckerich	beckerich	PROPN
finefocus-615	472	74	,	,	PUNCT
finefocus-615	472	75	j.	j.	PROPN
finefocus-615	472	76	m.	m.	PROPN
finefocus-615	472	77	,	,	PUNCT
finefocus-615	472	78	swennen	swennen	NOUN
finefocus-615	472	79	,	,	PUNCT
finefocus-615	472	80	d.	d.	PROPN
finefocus-615	472	81	,	,	PUNCT
finefocus-615	472	82	&	&	CCONJ
finefocus-615	472	83	bonnarme	bonnarme	PROPN
finefocus-615	472	84	,	,	PUNCT
finefocus-615	472	85	p.	p.	NOUN
finefocus-615	472	86	(	(	PUNCT
finefocus-615	472	87	2015	2015	NUM
finefocus-615	472	88	)	)	PUNCT
finefocus-615	472	89	.	.	PUNCT
finefocus-615	473	1	overview	overview	NOUN
finefocus-615	473	2	of	of	ADP
finefocus-615	473	3	a	a	DET
finefocus-615	473	4	surface	surface	NOUN
finefocus-615	473	5	-	-	PUNCT
finefocus-615	473	6	ripened	ripen	VERB
finefocus-615	473	7	cheese	cheese	NOUN
finefocus-615	473	8	community	community	NOUN
finefocus-615	473	9	functioning	function	VERB
finefocus-615	473	10	by	by	ADP
finefocus-615	473	11	meta	meta	ADJ
finefocus-615	473	12	-	-	PUNCT
finefocus-615	473	13	omics	omic	NOUN
finefocus-615	473	14	analyses	analysis	NOUN
finefocus-615	473	15	.	.	PUNCT
finefocus-615	474	1	plos	plos	PROPN
finefocus-615	474	2	one	one	NUM
finefocus-615	474	3	10(4	10(4	NUM
finefocus-615	474	4	)	)	PUNCT
finefocus-615	474	5	,	,	PUNCT
finefocus-615	474	6	e0124360	e0124360	PROPN
finefocus-615	474	7	.	.	PUNCT
finefocus-615	475	1	doi	doi	NOUN
finefocus-615	475	2	:	:	PUNCT
finefocus-615	475	3	10.1371	10.1371	NUM
finefocus-615	475	4	/	/	SYM
finefocus-615	475	5	journal.pone.0124360	journal.pone.0124360	PROPN
finefocus-615	475	6	.	.	PROPN
finefocus-615	476	1	15	15	NUM
finefocus-615	476	2	.	.	X
finefocus-615	476	3	edgar	edgar	PROPN
finefocus-615	476	4	,	,	PUNCT
finefocus-615	476	5	robert	robert	PROPN
finefocus-615	476	6	c.	c.	PROPN
finefocus-615	476	7	(	(	PUNCT
finefocus-615	476	8	2010	2010	NUM
finefocus-615	476	9	)	)	PUNCT
finefocus-615	476	10	.	.	PUNCT
finefocus-615	477	1	search	search	NOUN
finefocus-615	477	2	and	and	CCONJ
finefocus-615	477	3	clustering	clustering	ADJ
finefocus-615	477	4	orders	order	NOUN
finefocus-615	477	5	of	of	ADP
finefocus-615	477	6	magnitude	magnitude	NOUN
finefocus-615	477	7	faster	fast	ADV
finefocus-615	477	8	than	than	ADP
finefocus-615	477	9	blast	blast	NOUN
finefocus-615	477	10	.	.	PUNCT
finefocus-615	478	1	bioinformatics	bioinformatic	NOUN
finefocus-615	478	2	,	,	PUNCT
finefocus-615	478	3	26(19	26(19	NUM
finefocus-615	478	4	):	):	PUNCT
finefocus-615	478	5	2460	2460	NUM
finefocus-615	478	6	-	-	SYM
finefocus-615	478	7	2461	2461	NUM
finefocus-615	478	8	.	.	PUNCT
finefocus-615	479	1	16	16	NUM
finefocus-615	479	2	.	.	PUNCT
finefocus-615	480	1	ercolini	ercolini	PROPN
finefocus-615	480	2	,	,	PUNCT
finefocus-615	480	3	d.	d.	PROPN
finefocus-615	480	4	,	,	PUNCT
finefocus-615	480	5	mauriello	mauriello	PROPN
finefocus-615	480	6	,	,	PUNCT
finefocus-615	480	7	g.	g.	PROPN
finefocus-615	480	8	,	,	PUNCT
finefocus-615	480	9	blaiotta	blaiotta	PROPN
finefocus-615	480	10	,	,	PUNCT
finefocus-615	480	11	g.	g.	PROPN
finefocus-615	480	12	,	,	PUNCT
finefocus-615	480	13	moschetti	moschetti	PROPN
finefocus-615	480	14	,	,	PUNCT
finefocus-615	480	15	g.	g.	PROPN
finefocus-615	480	16	,	,	PUNCT
finefocus-615	480	17	&	&	CCONJ
finefocus-615	480	18	coppola	coppola	PROPN
finefocus-615	480	19	,	,	PUNCT
finefocus-615	480	20	s.	s.	PROPN
finefocus-615	480	21	(	(	PUNCT
finefocus-615	480	22	2004	2004	NUM
finefocus-615	480	23	)	)	PUNCT
finefocus-615	480	24	.	.	PUNCT
finefocus-615	481	1	pcr	pcr	ADJ
finefocus-615	481	2	–	–	PUNCT
finefocus-615	481	3	dgge	dgge	ADJ
finefocus-615	481	4	fingerprints	fingerprint	NOUN
finefocus-615	481	5	of	of	ADP
finefocus-615	481	6	microbial	microbial	ADJ
finefocus-615	481	7	succession	succession	NOUN
finefocus-615	481	8	during	during	ADP
finefocus-615	481	9	a	a	DET
finefocus-615	481	10	manufacture	manufacture	NOUN
finefocus-615	481	11	of	of	ADP
finefocus-615	481	12	traditional	traditional	ADJ
finefocus-615	481	13	water	water	NOUN
finefocus-615	481	14	buffalo	buffalo	NOUN
finefocus-615	481	15	mozzarella	mozzarella	NOUN
finefocus-615	481	16	cheese	cheese	NOUN
finefocus-615	481	17	.	.	PUNCT
finefocus-615	482	1	j.	j.	PROPN
finefocus-615	482	2	appl	appl	PROPN
finefocus-615	482	3	.	.	PROPN
finefocus-615	483	1	microbiol	microbiol	PROPN
finefocus-615	483	2	.	.	PUNCT
finefocus-615	484	1	96(2	96(2	PROPN
finefocus-615	484	2	):	):	PUNCT
finefocus-615	484	3	263270	263270	NUM
finefocus-615	484	4	.	.	PUNCT
finefocus-615	485	1	17	17	NUM
finefocus-615	485	2	.	.	PUNCT
finefocus-615	486	1	escobar	escobar	PROPN
finefocus-615	486	2	-	-	PUNCT
finefocus-615	486	3	zepeda	zepeda	PROPN
finefocus-615	486	4	,	,	PUNCT
finefocus-615	486	5	a.	a.	PROPN
finefocus-615	486	6	,	,	PUNCT
finefocus-615	486	7	sanchez	sanchez	PROPN
finefocus-615	486	8	-	-	PUNCT
finefocus-615	486	9	flores	flores	PROPN
finefocus-615	486	10	,	,	PUNCT
finefocus-615	486	11	a.	a.	NOUN
finefocus-615	486	12	,	,	PUNCT
finefocus-615	486	13	&	&	CCONJ
finefocus-615	486	14	quirasco	quirasco	VERB
finefocus-615	486	15	baruch	baruch	PRON
finefocus-615	486	16	,	,	PUNCT
finefocus-615	486	17	m.	m.	NOUN
finefocus-615	486	18	(	(	PUNCT
finefocus-615	486	19	2016	2016	NUM
finefocus-615	486	20	)	)	PUNCT
finefocus-615	486	21	.	.	PUNCT
finefocus-615	487	1	metagenomic	metagenomic	ADJ
finefocus-615	487	2	analysis	analysis	NOUN
finefocus-615	487	3	of	of	ADP
finefocus-615	487	4	a	a	DET
finefocus-615	487	5	mexican	mexican	ADJ
finefocus-615	487	6	ripened	ripen	VERB
finefocus-615	487	7	cheese	cheese	NOUN
finefocus-615	487	8	reveals	reveal	VERB
finefocus-615	487	9	a	a	DET
finefocus-615	487	10	unique	unique	ADJ
finefocus-615	487	11	complex	complex	ADJ
finefocus-615	487	12	microbiota	microbiota	NOUN
finefocus-615	487	13	.	.	PUNCT
finefocus-615	488	1	food	food	NOUN
finefocus-615	488	2	microbial	microbial	NOUN
finefocus-615	488	3	.	.	PUNCT
finefocus-615	489	1	57	57	NUM
finefocus-615	489	2	:	:	SYM
finefocus-615	489	3	116	116	NUM
finefocus-615	489	4	-	-	SYM
finefocus-615	489	5	127	127	NUM
finefocus-615	489	6	.	.	PUNCT
finefocus-615	490	1	doi	doi	NOUN
finefocus-615	490	2	:	:	PUNCT
finefocus-615	490	3	10.1016	10.1016	NUM
finefocus-615	490	4	/	/	SYM
finefocus-615	490	5	j.fm.2016.02.004	j.fm.2016.02.004	PROPN
finefocus-615	490	6	18	18	NUM
finefocus-615	490	7	.	.	PUNCT
finefocus-615	491	1	farber	farber	PROPN
finefocus-615	491	2	,	,	PUNCT
finefocus-615	491	3	p.	p.	PROPN
finefocus-615	491	4	,	,	PUNCT
finefocus-615	491	5	&	&	CCONJ
finefocus-615	491	6	geisen	geisen	PROPN
finefocus-615	491	7	,	,	PUNCT
finefocus-615	491	8	r.	r.	PROPN
finefocus-615	491	9	(	(	PUNCT
finefocus-615	491	10	1994	1994	NUM
finefocus-615	491	11	)	)	PUNCT
finefocus-615	491	12	.	.	PUNCT
finefocus-615	492	1	antagonistic	antagonistic	ADJ
finefocus-615	492	2	activity	activity	NOUN
finefocus-615	492	3	of	of	ADP
finefocus-615	492	4	the	the	DET
finefocus-615	492	5	food	food	NOUN
finefocus-615	492	6	-	-	PUNCT
finefocus-615	492	7	related	relate	VERB
finefocus-615	492	8	filamentous	filamentous	ADJ
finefocus-615	492	9	fungus	fungus	ADJ
finefocus-615	492	10	penicillium	penicillium	NOUN
finefocus-615	492	11	nalgiovense	nalgiovense	NOUN
finefocus-615	492	12	by	by	ADP
finefocus-615	492	13	the	the	DET
finefocus-615	492	14	production	production	NOUN
finefocus-615	492	15	of	of	ADP
finefocus-615	492	16	penicillin	penicillin	PROPN
finefocus-615	492	17	.	.	PUNCT
finefocus-615	493	1	appl	appl	PROPN
finefocus-615	493	2	.	.	PUNCT
finefocus-615	494	1	environ	environ	PROPN
finefocus-615	494	2	.	.	PUNCT
finefocus-615	494	3	microbiol	microbiol	PROPN
finefocus-615	494	4	.	.	PUNCT
finefocus-615	495	1	60(9	60(9	NUM
finefocus-615	495	2	):	):	PUNCT
finefocus-615	495	3	3401	3401	NUM
finefocus-615	495	4	-	-	SYM
finefocus-615	495	5	3404	3404	NUM
finefocus-615	495	6	.	.	PUNCT
finefocus-615	496	1	19	19	NUM
finefocus-615	496	2	.	.	X
finefocus-615	496	3	florez	florez	PROPN
finefocus-615	496	4	,	,	PUNCT
finefocus-615	496	5	a.	a.	PROPN
finefocus-615	496	6	b.	b.	PROPN
finefocus-615	496	7	,	,	PUNCT
finefocus-615	496	8	&	&	CCONJ
finefocus-615	496	9	mayo	mayo	PROPN
finefocus-615	496	10	,	,	PUNCT
finefocus-615	496	11	b.	b.	PROPN
finefocus-615	496	12	(	(	PUNCT
finefocus-615	496	13	2015	2015	NUM
finefocus-615	496	14	)	)	PUNCT
finefocus-615	496	15	.	.	PUNCT
finefocus-615	497	1	diversity	diversity	NOUN
finefocus-615	497	2	and	and	CCONJ
finefocus-615	497	3	dynamics	dynamic	NOUN
finefocus-615	497	4	of	of	ADP
finefocus-615	497	5	antibiotic	antibiotic	ADJ
finefocus-615	497	6	-	-	PUNCT
finefocus-615	497	7	resistant	resistant	ADJ
finefocus-615	497	8	bacteria	bacteria	NOUN
finefocus-615	497	9	in	in	ADP
finefocus-615	497	10	cheese	cheese	NOUN
finefocus-615	497	11	as	as	SCONJ
finefocus-615	497	12	determined	determine	VERB
finefocus-615	497	13	by	by	ADP
finefocus-615	497	14	pcr	pcr	NOUN
finefocus-615	497	15	denaturing	denaturing	NOUN
finefocus-615	497	16	gradient	gradient	NOUN
finefocus-615	497	17	gel	gel	NOUN
finefocus-615	497	18	electrophoresis	electrophoresis	NOUN
finefocus-615	497	19	.	.	PUNCT
finefocus-615	498	1	int	int	NOUN
finefocus-615	498	2	.	.	PUNCT
finefocus-615	499	1	j.	j.	PROPN
finefocus-615	499	2	food	food	PROPN
finefocus-615	499	3	microbiol	microbiol	PROPN
finefocus-615	499	4	.	.	PUNCT
finefocus-615	500	1	214	214	NUM
finefocus-615	500	2	:	:	PUNCT
finefocus-615	500	3	63	63	NUM
finefocus-615	500	4	-	-	SYM
finefocus-615	500	5	69	69	NUM
finefocus-615	500	6	.	.	PUNCT
finefocus-615	501	1	doi	doi	NOUN
finefocus-615	501	2	:	:	PUNCT
finefocus-615	501	3	10.1016	10.1016	NUM
finefocus-615	501	4	/	/	SYM
finefocus-615	501	5	j.	j.	PROPN
finefocus-615	501	6	ijfoodmicro.2015.07.027	ijfoodmicro.2015.07.027	PROPN
finefocus-615	501	7	.	.	PROPN
finefocus-615	502	1	20	20	NUM
finefocus-615	502	2	.	.	PUNCT
finefocus-615	503	1	flórez	flórez	NOUN
finefocus-615	503	2	,	,	PUNCT
finefocus-615	503	3	a.	a.	PROPN
finefocus-615	503	4	b.	b.	PROPN
finefocus-615	503	5	,	,	PUNCT
finefocus-615	503	6	&	&	CCONJ
finefocus-615	503	7	mayo	mayo	PROPN
finefocus-615	503	8	,	,	PUNCT
finefocus-615	503	9	b.	b.	PROPN
finefocus-615	503	10	(	(	PUNCT
finefocus-615	503	11	2006	2006	NUM
finefocus-615	503	12	)	)	PUNCT
finefocus-615	503	13	.	.	PUNCT
finefocus-615	504	1	microbial	microbial	ADJ
finefocus-615	504	2	diversity	diversity	NOUN
finefocus-615	504	3	and	and	CCONJ
finefocus-615	504	4	succession	succession	NOUN
finefocus-615	504	5	during	during	ADP
finefocus-615	504	6	the	the	DET
finefocus-615	504	7	manufacture	manufacture	NOUN
finefocus-615	504	8	and	and	CCONJ
finefocus-615	504	9	ripening	ripening	NOUN
finefocus-615	504	10	of	of	ADP
finefocus-615	504	11	traditional	traditional	ADJ
finefocus-615	504	12	,	,	PUNCT
finefocus-615	504	13	spanish	spanish	ADJ
finefocus-615	504	14	,	,	PUNCT
finefocus-615	504	15	blue	blue	ADJ
finefocus-615	504	16	-	-	PUNCT
finefocus-615	504	17	veined	veined	ADJ
finefocus-615	504	18	cabrales	cabrale	NOUN
finefocus-615	504	19	cheese	cheese	NOUN
finefocus-615	504	20	,	,	PUNCT
finefocus-615	504	21	as	as	SCONJ
finefocus-615	504	22	determined	determine	VERB
finefocus-615	504	23	by	by	ADP
finefocus-615	504	24	pcr	pcr	NOUN
finefocus-615	504	25	-	-	PUNCT
finefocus-615	504	26	dgge	dgge	NOUN
finefocus-615	504	27	.	.	PUNCT
finefocus-615	505	1	int	int	NOUN
finefocus-615	505	2	.	.	PUNCT
finefocus-615	506	1	j.	j.	PROPN
finefocus-615	506	2	food	food	PROPN
finefocus-615	506	3	microbiol	microbiol	PROPN
finefocus-615	506	4	.	.	PUNCT
finefocus-615	507	1	110(2	110(2	NUM
finefocus-615	507	2	):	):	PUNCT
finefocus-615	507	3	165	165	NUM
finefocus-615	507	4	-	-	SYM
finefocus-615	507	5	171	171	NUM
finefocus-615	507	6	.	.	PUNCT
finefocus-615	508	1	21	21	NUM
finefocus-615	508	2	.	.	PUNCT
finefocus-615	509	1	fontana	fontana	PROPN
finefocus-615	509	2	,	,	PUNCT
finefocus-615	509	3	c.	c.	PROPN
finefocus-615	509	4	,	,	PUNCT
finefocus-615	509	5	cappa	cappa	PROPN
finefocus-615	509	6	,	,	PUNCT
finefocus-615	509	7	f.	f.	PROPN
finefocus-615	509	8	,	,	PUNCT
finefocus-615	509	9	rebecchi	rebecchi	PROPN
finefocus-615	509	10	,	,	PUNCT
finefocus-615	509	11	a.	a.	PROPN
finefocus-615	509	12	,	,	PUNCT
finefocus-615	509	13	&	&	CCONJ
finefocus-615	509	14	cocconcelli	cocconcelli	PROPN
finefocus-615	509	15	,	,	PUNCT
finefocus-615	509	16	pier	pier	PROPN
finefocus-615	509	17	s.	s.	PROPN
finefocus-615	509	18	(	(	PUNCT
finefocus-615	509	19	2010	2010	NUM
finefocus-615	509	20	)	)	PUNCT
finefocus-615	509	21	.	.	PUNCT
finefocus-615	510	1	surface	surface	NOUN
finefocus-615	510	2	microbiota	microbiota	NOUN
finefocus-615	510	3	analysis	analysis	NOUN
finefocus-615	510	4	of	of	ADP
finefocus-615	510	5	taleggio	taleggio	NOUN
finefocus-615	510	6	,	,	PUNCT
finefocus-615	510	7	gorgonzola	gorgonzola	NOUN
finefocus-615	510	8	,	,	PUNCT
finefocus-615	510	9	casera	casera	NOUN
finefocus-615	510	10	,	,	PUNCT
finefocus-615	510	11	scimudin	scimudin	PROPN
finefocus-615	510	12	and	and	CCONJ
finefocus-615	510	13	formaggio	formaggio	PROPN
finefocus-615	510	14	di	di	X
finefocus-615	510	15	fossa	fossa	ADJ
finefocus-615	510	16	italian	italian	ADJ
finefocus-615	510	17	cheeses	cheese	NOUN
finefocus-615	510	18	.	.	PUNCT
finefocus-615	511	1	int	int	NOUN
finefocus-615	511	2	.	.	PUNCT
finefocus-615	512	1	j.	j.	PROPN
finefocus-615	512	2	food	food	PROPN
finefocus-615	512	3	microbiol	microbiol	PROPN
finefocus-615	512	4	.	.	PUNCT
finefocus-615	513	1	138(3	138(3	NUM
finefocus-615	513	2	):	):	PUNCT
finefocus-615	513	3	205	205	NUM
finefocus-615	513	4	-	-	SYM
finefocus-615	513	5	211	211	NUM
finefocus-615	513	6	.	.	PUNCT
finefocus-615	514	1	22	22	NUM
finefocus-615	514	2	.	.	PUNCT
finefocus-615	515	1	fox	fox	PROPN
finefocus-615	515	2	,	,	PUNCT
finefocus-615	515	3	p.	p.	PROPN
finefocus-615	515	4	f.	f.	PROPN
finefocus-615	515	5	,	,	PUNCT
finefocus-615	515	6	mcsweeney	mcsweeney	PROPN
finefocus-615	515	7	,	,	PUNCT
finefocus-615	515	8	p.	p.	PROPN
finefocus-615	515	9	l.	l.	PROPN
finefocus-615	515	10	h.	h.	PROPN
finefocus-615	515	11	,	,	PUNCT
finefocus-615	515	12	cogan	cogan	NOUN
finefocus-615	515	13	,	,	PUNCT
finefocus-615	515	14	t.	t.	NOUN
finefocus-615	515	15	m.	m.	NOUN
finefocus-615	515	16	,	,	PUNCT
finefocus-615	515	17	&	&	CCONJ
finefocus-615	515	18	guinee	guinee	PROPN
finefocus-615	515	19	,	,	PUNCT
finefocus-615	515	20	t.	t.	PROPN
finefocus-615	515	21	p.	p.	PROPN
finefocus-615	515	22	(	(	PUNCT
finefocus-615	515	23	2004	2004	NUM
finefocus-615	515	24	)	)	PUNCT
finefocus-615	515	25	.	.	PUNCT
finefocus-615	516	1	cheese	cheese	NOUN
finefocus-615	516	2	:	:	PUNCT
finefocus-615	516	3	chemistry	chemistry	NOUN
finefocus-615	516	4	,	,	PUNCT
finefocus-615	516	5	physics	physics	NOUN
finefocus-615	516	6	and	and	CCONJ
finefocus-615	516	7	microbiology	microbiology	NOUN
finefocus-615	516	8	:	:	PUNCT
finefocus-615	516	9	general	general	ADJ
finefocus-615	516	10	aspects	aspect	NOUN
finefocus-615	516	11	(	(	PUNCT
finefocus-615	516	12	vol	vol	NOUN
finefocus-615	516	13	.	.	NOUN
finefocus-615	516	14	1	1	NUM
finefocus-615	516	15	):	):	PUNCT
finefocus-615	516	16	academic	academic	ADJ
finefocus-615	516	17	press	press	NOUN
finefocus-615	516	18	.	.	PUNCT
finefocus-615	517	1	23	23	NUM
finefocus-615	517	2	.	.	PUNCT
finefocus-615	518	1	frey	frey	NOUN
finefocus-615	518	2	-	-	PUNCT
finefocus-615	518	3	klett	klett	PROPN
finefocus-615	518	4	,	,	PUNCT
finefocus-615	518	5	p.	p.	PROPN
finefocus-615	518	6	,	,	PUNCT
finefocus-615	518	7	burlinson	burlinson	PROPN
finefocus-615	518	8	,	,	PUNCT
finefocus-615	518	9	p.	p.	PROPN
finefocus-615	518	10	,	,	PUNCT
finefocus-615	518	11	deveau	deveau	PROPN
finefocus-615	518	12	,	,	PUNCT
finefocus-615	518	13	a.	a.	NOUN
finefocus-615	518	14	,	,	PUNCT
finefocus-615	518	15	barret	barret	ADJ
finefocus-615	518	16	,	,	PUNCT
finefocus-615	518	17	m.	m.	NOUN
finefocus-615	518	18	,	,	PUNCT
finefocus-615	518	19	tarkka	tarkka	NOUN
finefocus-615	518	20	,	,	PUNCT
finefocus-615	518	21	m.	m.	NOUN
finefocus-615	518	22	,	,	PUNCT
finefocus-615	518	23	&	&	CCONJ
finefocus-615	518	24	sarniguet	sarniguet	NOUN
finefocus-615	518	25	,	,	PUNCT
finefocus-615	518	26	a.	a.	NOUN
finefocus-615	518	27	(	(	PUNCT
finefocus-615	518	28	2011	2011	NUM
finefocus-615	518	29	)	)	PUNCT
finefocus-615	518	30	.	.	PUNCT
finefocus-615	519	1	bacterial	bacterial	ADJ
finefocus-615	519	2	-	-	ADJ
finefocus-615	519	3	fungal	fungal	ADJ
finefocus-615	519	4	interactions	interaction	NOUN
finefocus-615	519	5	:	:	PUNCT
finefocus-615	519	6	hyphens	hyphen	NOUN
finefocus-615	519	7	between	between	ADP
finefocus-615	519	8	agricultural	agricultural	ADJ
finefocus-615	519	9	,	,	PUNCT
finefocus-615	519	10	clinical	clinical	ADJ
finefocus-615	519	11	,	,	PUNCT
finefocus-615	519	12	environmental	environmental	ADJ
finefocus-615	519	13	,	,	PUNCT
finefocus-615	519	14	and	and	CCONJ
finefocus-615	519	15	food	food	NOUN
finefocus-615	519	16	microbiologists	microbiologist	NOUN
finefocus-615	519	17	.	.	PUNCT
finefocus-615	520	1	microbiol	microbiol	PROPN
finefocus-615	520	2	.	.	PUNCT
finefocus-615	521	1	mol	mol	PROPN
finefocus-615	521	2	.	.	PUNCT
finefocus-615	522	1	biol	biol	PROPN
finefocus-615	522	2	.	.	PUNCT
finefocus-615	523	1	rev	rev	PROPN
finefocus-615	523	2	.	.	PUNCT
finefocus-615	524	1	75(4	75(4	NOUN
finefocus-615	524	2	):	):	PUNCT
finefocus-615	524	3	583	583	NUM
finefocus-615	524	4	-	-	SYM
finefocus-615	524	5	609	609	NUM
finefocus-615	524	6	.	.	PUNCT
finefocus-615	525	1	24	24	NUM
finefocus-615	525	2	.	.	PUNCT
finefocus-615	525	3	geisen	geisen	NOUN
finefocus-615	525	4	,	,	PUNCT
finefocus-615	525	5	r.	r.	PROPN
finefocus-615	525	6	(	(	PUNCT
finefocus-615	525	7	1999	1999	NUM
finefocus-615	525	8	)	)	PUNCT
finefocus-615	525	9	.	.	PUNCT
finefocus-615	526	1	inhibition	inhibition	NOUN
finefocus-615	526	2	of	of	ADP
finefocus-615	526	3	food	food	NOUN
finefocus-615	526	4	-	-	PUNCT
finefocus-615	526	5	related	relate	VERB
finefocus-615	526	6	pathogenic	pathogenic	ADJ
finefocus-615	526	7	bacteria	bacteria	NOUN
finefocus-615	526	8	by	by	ADP
finefocus-615	526	9	god	god	PROPN
finefocus-615	526	10	-	-	PUNCT
finefocus-615	526	11	transformed	transform	VERB
finefocus-615	526	12	penicillium	penicillium	NOUN
finefocus-615	526	13	nalgiovense	nalgiovense	NOUN
finefocus-615	526	14	strains	strain	VERB
finefocus-615	526	15	.	.	PUNCT
finefocus-615	527	1	j.	j.	PROPN
finefocus-615	527	2	food	food	PROPN
finefocus-615	527	3	prot	prot	NOUN
finefocus-615	527	4	.	.	PUNCT
finefocus-615	528	1	62(8	62(8	NOUN
finefocus-615	528	2	):	):	PUNCT
finefocus-615	528	3	940	940	NUM
finefocus-615	528	4	-	-	SYM
finefocus-615	528	5	943	943	NUM
finefocus-615	528	6	.	.	PUNCT
finefocus-615	529	1	25	25	NUM
finefocus-615	529	2	.	.	PUNCT
finefocus-615	529	3	giannino	giannino	PROPN
finefocus-615	529	4	,	,	PUNCT
finefocus-615	529	5	m.	m.	NOUN
finefocus-615	529	6	l.	l.	PROPN
finefocus-615	529	7	,	,	PUNCT
finefocus-615	529	8	marzotto	marzotto	PROPN
finefocus-615	529	9	,	,	PUNCT
finefocus-615	529	10	marta	marta	PROPN
finefocus-615	529	11	,	,	PUNCT
finefocus-615	529	12	dellaglio	dellaglio	PROPN
finefocus-615	529	13	,	,	PUNCT
finefocus-615	529	14	f.	f.	PROPN
finefocus-615	529	15	,	,	PUNCT
finefocus-615	529	16	&	&	CCONJ
finefocus-615	529	17	feligini	feligini	PROPN
finefocus-615	529	18	,	,	PUNCT
finefocus-615	529	19	m.	m.	NOUN
finefocus-615	529	20	(	(	PUNCT
finefocus-615	529	21	2009	2009	NUM
finefocus-615	529	22	)	)	PUNCT
finefocus-615	529	23	.	.	PUNCT
finefocus-615	530	1	study	study	NOUN
finefocus-615	530	2	of	of	ADP
finefocus-615	530	3	microbial	microbial	ADJ
finefocus-615	530	4	diversity	diversity	NOUN
finefocus-615	530	5	in	in	ADP
finefocus-615	530	6	raw	raw	ADJ
finefocus-615	530	7	milk	milk	NOUN
finefocus-615	530	8	and	and	CCONJ
finefocus-615	530	9	fresh	fresh	ADJ
finefocus-615	530	10	curd	curd	NOUN
finefocus-615	530	11	used	use	VERB
finefocus-615	530	12	for	for	ADP
finefocus-615	530	13	fontina	fontina	NOUN
finefocus-615	530	14	cheese	cheese	NOUN
finefocus-615	530	15	production	production	NOUN
finefocus-615	530	16	by	by	ADP
finefocus-615	530	17	culture	culture	NOUN
finefocus-615	530	18	-	-	PUNCT
finefocus-615	530	19	independent	independent	ADJ
finefocus-615	530	20	methods	method	NOUN
finefocus-615	530	21	.	.	PUNCT
finefocus-615	531	1	intl	intl	PROPN
finefocus-615	531	2	.	.	PUNCT
finefocus-615	532	1	j.	j.	PROPN
finefocus-615	532	2	food	food	PROPN
finefocus-615	532	3	microbiol	microbiol	PROPN
finefocus-615	532	4	.	.	PUNCT
finefocus-615	533	1	130(3	130(3	NUM
finefocus-615	533	2	):	):	PUNCT
finefocus-615	533	3	188	188	NUM
finefocus-615	533	4	-	-	SYM
finefocus-615	533	5	195	195	NUM
finefocus-615	533	6	.	.	NOUN
finefocus-615	533	7	26	26	NUM
finefocus-615	533	8	.	.	PUNCT
finefocus-615	534	1	irlinger	irlinger	PROPN
finefocus-615	534	2	,	,	PUNCT
finefocus-615	534	3	f.	f.	PROPN
finefocus-615	534	4	,	,	PUNCT
finefocus-615	534	5	layec	layec	PROPN
finefocus-615	534	6	,	,	PUNCT
finefocus-615	534	7	s.	s.	PROPN
finefocus-615	534	8	,	,	PUNCT
finefocus-615	534	9	helinck	helinck	NOUN
finefocus-615	534	10	,	,	PUNCT
finefocus-615	534	11	s.	s.	PROPN
finefocus-615	534	12	,	,	PUNCT
finefocus-615	534	13	&	&	CCONJ
finefocus-615	534	14	dugat	dugat	NOUN
finefocus-615	534	15	-	-	NOUN
finefocus-615	534	16	bony	bony	NOUN
finefocus-615	534	17	,	,	PUNCT
finefocus-615	534	18	e.	e.	PROPN
finefocus-615	534	19	(	(	PUNCT
finefocus-615	534	20	2015	2015	NUM
finefocus-615	534	21	)	)	PUNCT
finefocus-615	534	22	.	.	PUNCT
finefocus-615	535	1	cheese	cheese	NOUN
finefocus-615	535	2	rind	rind	NOUN
finefocus-615	535	3	microbial	microbial	ADJ
finefocus-615	535	4	communities	community	NOUN
finefocus-615	535	5	:	:	PUNCT
finefocus-615	535	6	diversity	diversity	NOUN
finefocus-615	535	7	,	,	PUNCT
finefocus-615	535	8	composition	composition	NOUN
finefocus-615	535	9	and	and	CCONJ
finefocus-615	535	10	origin	origin	NOUN
finefocus-615	535	11	.	.	PUNCT
finefocus-615	536	1	fems	fems	PROPN
finefocus-615	536	2	microbiol	microbiol	PROPN
finefocus-615	536	3	.	.	PUNCT
finefocus-615	537	1	lett	lett	PROPN
finefocus-615	537	2	.	.	PUNCT
finefocus-615	538	1	362(2	362(2	NUM
finefocus-615	538	2	):	):	PUNCT
finefocus-615	538	3	1	1	NUM
finefocus-615	538	4	-	-	SYM
finefocus-615	538	5	11	11	NUM
finefocus-615	538	6	.	.	PUNCT
finefocus-615	539	1	doi	doi	NOUN
finefocus-615	539	2	:	:	PUNCT
finefocus-615	539	3	10.1093	10.1093	NUM
finefocus-615	539	4	/	/	SYM
finefocus-615	539	5	femsle	femsle	PROPN
finefocus-615	539	6	/	/	SYM
finefocus-615	539	7	fnu015	fnu015	PROPN
finefocus-615	539	8	.	.	PUNCT
finefocus-615	540	1	27	27	NUM
finefocus-615	540	2	.	.	X
finefocus-615	540	3	irlinger	irlinger	PROPN
finefocus-615	540	4	,	,	PUNCT
finefocus-615	540	5	f.	f.	PROPN
finefocus-615	540	6	,	,	PUNCT
finefocus-615	540	7	&	&	CCONJ
finefocus-615	540	8	mounier	mounier	PROPN
finefocus-615	540	9	,	,	PUNCT
finefocus-615	540	10	j.	j.	PROPN
finefocus-615	540	11	(	(	PUNCT
finefocus-615	540	12	2009	2009	NUM
finefocus-615	540	13	)	)	PUNCT
finefocus-615	540	14	.	.	PUNCT
finefocus-615	541	1	microbial	microbial	ADJ
finefocus-615	541	2	interactions	interaction	NOUN
finefocus-615	541	3	in	in	ADP
finefocus-615	541	4	cheese	cheese	NOUN
finefocus-615	541	5	:	:	PUNCT
finefocus-615	541	6	implications	implication	NOUN
finefocus-615	541	7	for	for	ADP
finefocus-615	541	8	cheese	cheese	NOUN
finefocus-615	541	9	quality	quality	NOUN
finefocus-615	541	10	and	and	CCONJ
finefocus-615	541	11	safety	safety	NOUN
finefocus-615	541	12	.	.	PUNCT
finefocus-615	542	1	curr	curr	PROPN
finefocus-615	542	2	.	.	PUNCT
finefocus-615	542	3	opinion	opinion	NOUN
finefocus-615	542	4	in	in	ADP
finefocus-615	542	5	biotechnol	biotechnol	NOUN
finefocus-615	542	6	.	.	PUNCT
finefocus-615	542	7	,	,	PUNCT
finefocus-615	542	8	20(2	20(2	NUM
finefocus-615	542	9	):	):	PUNCT
finefocus-615	542	10	142	142	NUM
finefocus-615	542	11	-	-	SYM
finefocus-615	542	12	148	148	NUM
finefocus-615	542	13	.	.	PUNCT
finefocus-615	543	1	doi	doi	NOUN
finefocus-615	543	2	:	:	PUNCT
finefocus-615	543	3	10.1016	10.1016	NUM
finefocus-615	543	4	/	/	SYM
finefocus-615	543	5	j.	j.	PROPN
finefocus-615	543	6	copbio.2009.02.016	copbio.2009.02.016	PROPN
finefocus-615	543	7	.	.	PROPN
finefocus-615	544	1	28	28	NUM
finefocus-615	544	2	.	.	PUNCT
finefocus-615	545	1	laich	laich	PROPN
finefocus-615	545	2	,	,	PUNCT
finefocus-615	545	3	f.	f.	PROPN
finefocus-615	545	4	,	,	PUNCT
finefocus-615	545	5	fierro	fierro	PROPN
finefocus-615	545	6	,	,	PUNCT
finefocus-615	545	7	f.	f.	PROPN
finefocus-615	545	8	,	,	PUNCT
finefocus-615	545	9	&	&	CCONJ
finefocus-615	545	10	martin	martin	PROPN
finefocus-615	545	11	,	,	PUNCT
finefocus-615	545	12	j.	j.	PROPN
finefocus-615	545	13	f.	f.	PROPN
finefocus-615	545	14	(	(	PUNCT
finefocus-615	545	15	2002	2002	NUM
finefocus-615	545	16	)	)	PUNCT
finefocus-615	545	17	.	.	PUNCT
finefocus-615	546	1	production	production	NOUN
finefocus-615	546	2	of	of	ADP
finefocus-615	546	3	penicillin	penicillin	NOUN
finefocus-615	546	4	by	by	ADP
finefocus-615	546	5	fungi	fungus	NOUN
finefocus-615	546	6	growing	grow	VERB
finefocus-615	546	7	on	on	ADP
finefocus-615	546	8	food	food	NOUN
finefocus-615	546	9	products	product	NOUN
finefocus-615	546	10	:	:	PUNCT
finefocus-615	546	11	identification	identification	NOUN
finefocus-615	546	12	of	of	ADP
finefocus-615	546	13	a	a	DET
finefocus-615	546	14	complete	complete	ADJ
finefocus-615	546	15	penicillin	penicillin	NOUN
finefocus-615	546	16	gene	gene	NOUN
finefocus-615	546	17	cluster	cluster	NOUN
finefocus-615	546	18	in	in	ADP
finefocus-615	546	19	penicillium	penicillium	NOUN
finefocus-615	546	20	griseofulvum	griseofulvum	NOUN
finefocus-615	546	21	and	and	CCONJ
finefocus-615	546	22	a	a	DET
finefocus-615	546	23	truncated	truncated	ADJ
finefocus-615	546	24	cluster	cluster	NOUN
finefocus-615	546	25	in	in	ADP
finefocus-615	546	26	penicillium	penicillium	NOUN
finefocus-615	546	27	verrucosum	verrucosum	NOUN
finefocus-615	546	28	.	.	PUNCT
finefocus-615	547	1	appl	appl	PROPN
finefocus-615	547	2	.	.	PUNCT
finefocus-615	548	1	environ	environ	PROPN
finefocus-615	548	2	.	.	PUNCT
finefocus-615	548	3	microbiol	microbiol	PROPN
finefocus-615	548	4	.	.	PUNCT
finefocus-615	549	1	68(3	68(3	NUM
finefocus-615	549	2	):	):	PUNCT
finefocus-615	549	3	1211	1211	NUM
finefocus-615	549	4	-	-	SYM
finefocus-615	549	5	1219	1219	NUM
finefocus-615	549	6	.	.	PUNCT
finefocus-615	550	1	29	29	NUM
finefocus-615	550	2	.	.	X
finefocus-615	550	3	lane	lane	PROPN
finefocus-615	550	4	,	,	PUNCT
finefocus-615	550	5	d.	d.	PROPN
finefocus-615	550	6	j.	j.	PROPN
finefocus-615	550	7	,	,	PUNCT
finefocus-615	550	8	pace	pace	NOUN
finefocus-615	550	9	,	,	PUNCT
finefocus-615	550	10	b.	b.	PROPN
finefocus-615	550	11	,	,	PUNCT
finefocus-615	550	12	olsen	olsen	PROPN
finefocus-615	550	13	,	,	PUNCT
finefocus-615	550	14	g.	g.	PROPN
finefocus-615	550	15	j.	j.	PROPN
finefocus-615	550	16	,	,	PUNCT
finefocus-615	550	17	stahl	stahl	PROPN
finefocus-615	550	18	,	,	PUNCT
finefocus-615	550	19	d.	d.	PROPN
finefocus-615	550	20	a.	a.	PROPN
finefocus-615	550	21	,	,	PUNCT
finefocus-615	550	22	sogin	sogin	PROPN
finefocus-615	550	23	,	,	PUNCT
finefocus-615	550	24	m.	m.	NOUN
finefocus-615	550	25	l.	l.	PROPN
finefocus-615	550	26	,	,	PUNCT
finefocus-615	550	27	&	&	CCONJ
finefocus-615	550	28	pace	pace	NOUN
finefocus-615	550	29	,	,	PUNCT
finefocus-615	550	30	n.	n.	PROPN
finefocus-615	550	31	r.	r.	PROPN
finefocus-615	550	32	(	(	PUNCT
finefocus-615	550	33	1985	1985	NUM
finefocus-615	550	34	)	)	PUNCT
finefocus-615	550	35	.	.	PUNCT
finefocus-615	551	1	rapid	rapid	ADJ
finefocus-615	551	2	determination	determination	NOUN
finefocus-615	551	3	of	of	ADP
finefocus-615	551	4	16s	16s	PROPN
finefocus-615	551	5	ribosomal	ribosomal	NOUN
finefocus-615	551	6	rna	rna	NOUN
finefocus-615	551	7	sequences	sequence	NOUN
finefocus-615	551	8	for	for	ADP
finefocus-615	551	9	phylogenetic	phylogenetic	ADJ
finefocus-615	551	10	analyses	analysis	NOUN
finefocus-615	551	11	.	.	PUNCT
finefocus-615	552	1	proc	proc	NOUN
finefocus-615	552	2	.	.	PUNCT
finefocus-615	553	1	natl	natl	PROPN
finefocus-615	553	2	.	.	PUNCT
finefocus-615	554	1	acad	acad	PROPN
finefocus-615	554	2	.	.	PUNCT
finefocus-615	555	1	sci	sci	PROPN
finefocus-615	555	2	.	.	PROPN
finefocus-615	555	3	usa	usa	PROPN
finefocus-615	555	4	82(20	82(20	NUM
finefocus-615	555	5	):	):	PUNCT
finefocus-615	555	6	6955	6955	NUM
finefocus-615	555	7	-	-	SYM
finefocus-615	555	8	6959	6959	NUM
finefocus-615	555	9	.	.	PUNCT
finefocus-615	556	1	bacterial	bacterial	ADJ
finefocus-615	556	2	community	community	NOUN
finefocus-615	556	3	structure	structure	NOUN
finefocus-615	556	4	in	in	ADP
finefocus-615	556	5	cheese	cheese	NOUN
finefocus-615	556	6	•	•	NUM
finefocus-615	556	7	31	31	NUM
finefocus-615	556	8	30	30	NUM
finefocus-615	556	9	.	.	PUNCT
finefocus-615	557	1	magoč	magoč	PROPN
finefocus-615	557	2	,	,	PUNCT
finefocus-615	557	3	t.	t.	PROPN
finefocus-615	557	4	,	,	PUNCT
finefocus-615	557	5	&	&	CCONJ
finefocus-615	557	6	salzberg	salzberg	PROPN
finefocus-615	557	7	,	,	PUNCT
finefocus-615	557	8	s.	s.	PROPN
finefocus-615	557	9	l.	l.	PROPN
finefocus-615	557	10	(	(	PUNCT
finefocus-615	557	11	2011	2011	NUM
finefocus-615	557	12	)	)	PUNCT
finefocus-615	557	13	.	.	PUNCT
finefocus-615	558	1	flash	flash	NOUN
finefocus-615	558	2	:	:	PUNCT
finefocus-615	558	3	fast	fast	ADJ
finefocus-615	558	4	length	length	NOUN
finefocus-615	558	5	adjustment	adjustment	NOUN
finefocus-615	558	6	of	of	ADP
finefocus-615	558	7	short	short	ADJ
finefocus-615	558	8	reads	read	NOUN
finefocus-615	558	9	to	to	PART
finefocus-615	558	10	improve	improve	VERB
finefocus-615	558	11	genome	genome	NOUN
finefocus-615	558	12	assemblies	assembly	NOUN
finefocus-615	558	13	.	.	PUNCT
finefocus-615	559	1	bioinformatics	bioinformatic	NOUN
finefocus-615	559	2	27(21	27(21	ADV
finefocus-615	559	3	):	):	PUNCT
finefocus-615	559	4	2957	2957	NUM
finefocus-615	559	5	-	-	SYM
finefocus-615	559	6	2963	2963	NUM
finefocus-615	559	7	.	.	PUNCT
finefocus-615	560	1	31	31	NUM
finefocus-615	560	2	.	.	PUNCT
finefocus-615	561	1	mahajan	mahajan	PROPN
finefocus-615	561	2	,	,	PUNCT
finefocus-615	561	3	g.	g.	PROPN
finefocus-615	561	4	b.	b.	PROPN
finefocus-615	561	5	,	,	PUNCT
finefocus-615	561	6	&	&	CCONJ
finefocus-615	561	7	balachandran	balachandran	PROPN
finefocus-615	561	8	,	,	PUNCT
finefocus-615	561	9	l.	l.	PROPN
finefocus-615	561	10	(	(	PUNCT
finefocus-615	561	11	2012	2012	NUM
finefocus-615	561	12	)	)	PUNCT
finefocus-615	561	13	.	.	PUNCT
finefocus-615	562	1	antibacterial	antibacterial	ADJ
finefocus-615	562	2	agents	agent	NOUN
finefocus-615	562	3	from	from	ADP
finefocus-615	562	4	actinomycetes	actinomycete	NOUN
finefocus-615	562	5	a	a	DET
finefocus-615	562	6	review	review	NOUN
finefocus-615	562	7	.	.	PUNCT
finefocus-615	563	1	frontiers	frontier	NOUN
finefocus-615	563	2	biosci	biosci	PROPN
finefocus-615	563	3	.	.	PUNCT
finefocus-615	564	1	(	(	PUNCT
finefocus-615	564	2	elite	elite	ADJ
finefocus-615	564	3	ed	ed	NOUN
finefocus-615	564	4	)	)	PUNCT
finefocus-615	564	5	,	,	PUNCT
finefocus-615	564	6	4	4	NUM
finefocus-615	564	7	:	:	SYM
finefocus-615	564	8	240	240	NUM
finefocus-615	564	9	-	-	SYM
finefocus-615	564	10	253	253	NUM
finefocus-615	564	11	.	.	PUNCT
finefocus-615	565	1	32	32	NUM
finefocus-615	565	2	.	.	PUNCT
finefocus-615	566	1	mcdonald	mcdonald	PROPN
finefocus-615	566	2	,	,	PUNCT
finefocus-615	566	3	d.	d.	PROPN
finefocus-615	566	4	,	,	PUNCT
finefocus-615	566	5	price	price	NOUN
finefocus-615	566	6	,	,	PUNCT
finefocus-615	566	7	m.	m.	NOUN
finefocus-615	566	8	n.	n.	PROPN
finefocus-615	566	9	,	,	PUNCT
finefocus-615	566	10	goodrich	goodrich	PROPN
finefocus-615	566	11	,	,	PUNCT
finefocus-615	566	12	j.	j.	PROPN
finefocus-615	566	13	,	,	PUNCT
finefocus-615	566	14	nawrocki	nawrocki	PROPN
finefocus-615	566	15	,	,	PUNCT
finefocus-615	566	16	e.	e.	PROPN
finefocus-615	566	17	p.	p.	PROPN
finefocus-615	566	18	,	,	PUNCT
finefocus-615	566	19	desantis	desantis	PROPN
finefocus-615	566	20	,	,	PUNCT
finefocus-615	566	21	t.	t.	PROPN
finefocus-615	566	22	z.	z.	PROPN
finefocus-615	566	23	,	,	PUNCT
finefocus-615	566	24	probst	probst	PROPN
finefocus-615	566	25	,	,	PUNCT
finefocus-615	566	26	a.	a.	PROPN
finefocus-615	566	27	,	,	PUNCT
finefocus-615	566	28	andersen	andersen	PROPN
finefocus-615	566	29	,	,	PUNCT
finefocus-615	566	30	g.	g.	PROPN
finefocus-615	566	31	l.	l.	PROPN
finefocus-615	566	32	,	,	PUNCT
finefocus-615	566	33	knight	knight	PROPN
finefocus-615	566	34	,	,	PUNCT
finefocus-615	566	35	rob	rob	PROPN
finefocus-615	566	36	,	,	PUNCT
finefocus-615	566	37	&	&	CCONJ
finefocus-615	566	38	hugenholtz	hugenholtz	PROPN
finefocus-615	566	39	,	,	PUNCT
finefocus-615	566	40	philip	philip	PROPN
finefocus-615	566	41	.	.	PUNCT
finefocus-615	566	42	(	(	PUNCT
finefocus-615	566	43	2012	2012	NUM
finefocus-615	566	44	)	)	PUNCT
finefocus-615	566	45	.	.	PUNCT
finefocus-615	567	1	an	an	DET
finefocus-615	567	2	improved	improve	VERB
finefocus-615	567	3	greengenes	greengene	NOUN
finefocus-615	567	4	taxonomy	taxonomy	NOUN
finefocus-615	567	5	with	with	ADP
finefocus-615	567	6	explicit	explicit	ADJ
finefocus-615	567	7	ranks	rank	NOUN
finefocus-615	567	8	for	for	ADP
finefocus-615	567	9	ecological	ecological	ADJ
finefocus-615	567	10	and	and	CCONJ
finefocus-615	567	11	evolutionary	evolutionary	ADJ
finefocus-615	567	12	analyses	analysis	NOUN
finefocus-615	567	13	of	of	ADP
finefocus-615	567	14	bacteria	bacteria	NOUN
finefocus-615	567	15	and	and	CCONJ
finefocus-615	567	16	archaea	archaea	NOUN
finefocus-615	567	17	.	.	PUNCT
finefocus-615	568	1	the	the	DET
finefocus-615	568	2	isme	isme	PROPN
finefocus-615	568	3	j.	j.	PROPN
finefocus-615	568	4	6(3	6(3	PROPN
finefocus-615	568	5	):	):	PUNCT
finefocus-615	568	6	610	610	NUM
finefocus-615	568	7	-	-	SYM
finefocus-615	568	8	618	618	NUM
finefocus-615	568	9	.	.	PUNCT
finefocus-615	569	1	33	33	NUM
finefocus-615	569	2	.	.	PUNCT
finefocus-615	570	1	peter	peter	PROPN
finefocus-615	570	2	,	,	PUNCT
finefocus-615	570	3	h.	h.	PROPN
finefocus-615	570	4	,	,	PUNCT
finefocus-615	570	5	ylla	ylla	PROPN
finefocus-615	570	6	,	,	PUNCT
finefocus-615	570	7	i.	i.	PROPN
finefocus-615	570	8	,	,	PUNCT
finefocus-615	570	9	gudasz	gudasz	PROPN
finefocus-615	570	10	,	,	PUNCT
finefocus-615	570	11	c.	c.	PROPN
finefocus-615	570	12	,	,	PUNCT
finefocus-615	570	13	romani	romani	PROPN
finefocus-615	570	14	,	,	PUNCT
finefocus-615	570	15	a.	a.	NOUN
finefocus-615	570	16	m.	m.	NOUN
finefocus-615	570	17	,	,	PUNCT
finefocus-615	570	18	sabater	sabater	PROPN
finefocus-615	570	19	,	,	PUNCT
finefocus-615	570	20	s.	s.	PROPN
finefocus-615	570	21	,	,	PUNCT
finefocus-615	570	22	&	&	CCONJ
finefocus-615	570	23	tranvik	tranvik	PROPN
finefocus-615	570	24	,	,	PUNCT
finefocus-615	570	25	l.	l.	PROPN
finefocus-615	570	26	j.	j.	PROPN
finefocus-615	570	27	(	(	PUNCT
finefocus-615	570	28	2011	2011	NUM
finefocus-615	570	29	)	)	PUNCT
finefocus-615	570	30	.	.	PUNCT
finefocus-615	571	1	multifunctionality	multifunctionality	NOUN
finefocus-615	571	2	and	and	CCONJ
finefocus-615	571	3	diversity	diversity	NOUN
finefocus-615	571	4	in	in	ADP
finefocus-615	571	5	bacterial	bacterial	ADJ
finefocus-615	571	6	biofilms	biofilm	NOUN
finefocus-615	571	7	.	.	PUNCT
finefocus-615	572	1	plos	plos	PROPN
finefocus-615	572	2	one	one	NUM
finefocus-615	572	3	,	,	PUNCT
finefocus-615	572	4	6(8	6(8	NUM
finefocus-615	572	5	):	):	PUNCT
finefocus-615	572	6	e23225	e23225	NOUN
finefocus-615	572	7	.	.	PUNCT
finefocus-615	573	1	doi	doi	NOUN
finefocus-615	573	2	:	:	PUNCT
finefocus-615	573	3	10.1371/	10.1371/	NUM
finefocus-615	573	4	journal.pone.0023225	journal.pone.0023225	PROPN
finefocus-615	573	5	.	.	PUNCT
finefocus-615	574	1	34	34	NUM
finefocus-615	574	2	.	.	PUNCT
finefocus-615	574	3	randazzo	randazzo	PROPN
finefocus-615	574	4	,	,	PUNCT
finefocus-615	574	5	c.	c.	PROPN
finefocus-615	574	6	l.	l.	PROPN
finefocus-615	574	7	,	,	PUNCT
finefocus-615	574	8	torriani	torriani	PROPN
finefocus-615	574	9	,	,	PUNCT
finefocus-615	574	10	s.	s.	PROPN
finefocus-615	574	11	,	,	PUNCT
finefocus-615	574	12	akkermans	akkerman	NOUN
finefocus-615	574	13	,	,	PUNCT
finefocus-615	574	14	a.	a.	PROPN
finefocus-615	574	15	d.	d.	PROPN
finefocus-615	574	16	l.	l.	PROPN
finefocus-615	574	17	,	,	PUNCT
finefocus-615	574	18	de	de	X
finefocus-615	574	19	vos	vos	PROPN
finefocus-615	574	20	,	,	PUNCT
finefocus-615	574	21	willem	willem	PROPN
finefocus-615	574	22	m.	m.	NOUN
finefocus-615	574	23	,	,	PUNCT
finefocus-615	574	24	&	&	CCONJ
finefocus-615	574	25	vaughan	vaughan	PROPN
finefocus-615	574	26	,	,	PUNCT
finefocus-615	574	27	e.	e.	PROPN
finefocus-615	574	28	e.	e.	PROPN
finefocus-615	574	29	(	(	PUNCT
finefocus-615	574	30	2002	2002	NUM
finefocus-615	574	31	)	)	PUNCT
finefocus-615	574	32	.	.	PUNCT
finefocus-615	575	1	diversity	diversity	NOUN
finefocus-615	575	2	,	,	PUNCT
finefocus-615	575	3	dynamics	dynamic	NOUN
finefocus-615	575	4	,	,	PUNCT
finefocus-615	575	5	and	and	CCONJ
finefocus-615	575	6	activity	activity	NOUN
finefocus-615	575	7	of	of	ADP
finefocus-615	575	8	bacterial	bacterial	ADJ
finefocus-615	575	9	communities	community	NOUN
finefocus-615	575	10	during	during	ADP
finefocus-615	575	11	production	production	NOUN
finefocus-615	575	12	of	of	ADP
finefocus-615	575	13	an	an	DET
finefocus-615	575	14	artisanal	artisanal	ADJ
finefocus-615	575	15	sicilian	sicilian	ADJ
finefocus-615	575	16	cheese	cheese	NOUN
finefocus-615	575	17	as	as	SCONJ
finefocus-615	575	18	evaluated	evaluate	VERB
finefocus-615	575	19	by	by	ADP
finefocus-615	575	20	16s	16s	PROPN
finefocus-615	575	21	rrna	rrna	PROPN
finefocus-615	575	22	analysis	analysis	NOUN
finefocus-615	575	23	.	.	PUNCT
finefocus-615	576	1	appl	appl	PROPN
finefocus-615	576	2	.	.	PUNCT
finefocus-615	577	1	environ	environ	PROPN
finefocus-615	577	2	.	.	PUNCT
finefocus-615	577	3	microbiol	microbiol	PROPN
finefocus-615	577	4	.	.	PUNCT
finefocus-615	578	1	68(4	68(4	NUM
finefocus-615	578	2	):	):	PUNCT
finefocus-615	578	3	1882	1882	NUM
finefocus-615	578	4	-	-	SYM
finefocus-615	578	5	1892	1892	NUM
finefocus-615	578	6	.	.	PUNCT
finefocus-615	579	1	35	35	NUM
finefocus-615	579	2	.	.	PUNCT
finefocus-615	579	3	randazzo	randazzo	PROPN
finefocus-615	579	4	,	,	PUNCT
finefocus-615	579	5	c.	c.	PROPN
finefocus-615	579	6	l.	l.	PROPN
finefocus-615	579	7	,	,	PUNCT
finefocus-615	579	8	vaughan	vaughan	PROPN
finefocus-615	579	9	,	,	PUNCT
finefocus-615	579	10	e.	e.	PROPN
finefocus-615	579	11	e.	e.	PROPN
finefocus-615	579	12	,	,	PUNCT
finefocus-615	579	13	&	&	CCONJ
finefocus-615	579	14	caggia	caggia	PROPN
finefocus-615	579	15	,	,	PUNCT
finefocus-615	579	16	c.	c.	PROPN
finefocus-615	579	17	(	(	PUNCT
finefocus-615	579	18	2006	2006	NUM
finefocus-615	579	19	)	)	PUNCT
finefocus-615	579	20	.	.	PUNCT
finefocus-615	580	1	artisanal	artisanal	ADJ
finefocus-615	580	2	and	and	CCONJ
finefocus-615	580	3	experimental	experimental	ADJ
finefocus-615	580	4	pecorino	pecorino	PROPN
finefocus-615	580	5	siciliano	siciliano	PROPN
finefocus-615	580	6	cheese	cheese	NOUN
finefocus-615	580	7	:	:	PUNCT
finefocus-615	580	8	microbial	microbial	ADJ
finefocus-615	580	9	dynamics	dynamic	NOUN
finefocus-615	580	10	during	during	ADP
finefocus-615	580	11	manufacture	manufacture	NOUN
finefocus-615	580	12	assessed	assess	VERB
finefocus-615	580	13	by	by	ADP
finefocus-615	580	14	culturing	culture	VERB
finefocus-615	580	15	and	and	CCONJ
finefocus-615	580	16	pcr	pcr	ADJ
finefocus-615	580	17	–	–	PUNCT
finefocus-615	580	18	dgge	dgge	NOUN
finefocus-615	580	19	analyses	analysis	NOUN
finefocus-615	580	20	.	.	PUNCT
finefocus-615	581	1	intl	intl	PROPN
finefocus-615	581	2	.	.	PUNCT
finefocus-615	582	1	j.	j.	PROPN
finefocus-615	582	2	food	food	PROPN
finefocus-615	582	3	microbiol	microbiol	PROPN
finefocus-615	582	4	.	.	PUNCT
finefocus-615	583	1	109(1	109(1	NUM
finefocus-615	583	2	):	):	PUNCT
finefocus-615	583	3	1	1	NUM
finefocus-615	583	4	-	-	SYM
finefocus-615	583	5	8	8	NUM
finefocus-615	583	6	.	.	X
finefocus-615	584	1	36	36	NUM
finefocus-615	584	2	.	.	X
finefocus-615	585	1	rea	rea	PROPN
finefocus-615	585	2	,	,	PUNCT
finefocus-615	585	3	m.	m.	PROPN
finefocus-615	585	4	c.	c.	PROPN
finefocus-615	585	5	,	,	PUNCT
finefocus-615	585	6	görges	görge	NOUN
finefocus-615	585	7	,	,	PUNCT
finefocus-615	585	8	s.	s.	PROPN
finefocus-615	585	9	,	,	PUNCT
finefocus-615	585	10	gelsomino	gelsomino	PROPN
finefocus-615	585	11	,	,	PUNCT
finefocus-615	585	12	roberto	roberto	PROPN
finefocus-615	585	13	,	,	PUNCT
finefocus-615	585	14	brennan	brennan	PROPN
finefocus-615	585	15	,	,	PUNCT
finefocus-615	585	16	n.	n.	NOUN
finefocus-615	585	17	m.	m.	NOUN
finefocus-615	585	18	,	,	PUNCT
finefocus-615	585	19	mounier	mounier	NOUN
finefocus-615	585	20	,	,	PUNCT
finefocus-615	585	21	j.	j.	PROPN
finefocus-615	585	22	,	,	PUNCT
finefocus-615	585	23	vancanneyt	vancanneyt	PROPN
finefocus-615	585	24	,	,	PUNCT
finefocus-615	585	25	marc	marc	PROPN
finefocus-615	585	26	,	,	PUNCT
finefocus-615	585	27	scherer	scherer	PROPN
finefocus-615	585	28	,	,	PUNCT
finefocus-615	585	29	s.	s.	PROPN
finefocus-615	585	30	,	,	PUNCT
finefocus-615	585	31	swings	swing	NOUN
finefocus-615	585	32	,	,	PUNCT
finefocus-615	585	33	jean	jean	PROPN
finefocus-615	585	34	,	,	PUNCT
finefocus-615	585	35	&	&	CCONJ
finefocus-615	585	36	cogan	cogan	NOUN
finefocus-615	585	37	,	,	PUNCT
finefocus-615	585	38	t.	t.	NOUN
finefocus-615	585	39	m.	m.	NOUN
finefocus-615	585	40	(	(	PUNCT
finefocus-615	585	41	2007	2007	NUM
finefocus-615	585	42	)	)	PUNCT
finefocus-615	585	43	.	.	PUNCT
finefocus-615	586	1	stability	stability	NOUN
finefocus-615	586	2	of	of	ADP
finefocus-615	586	3	the	the	DET
finefocus-615	586	4	biodiversity	biodiversity	NOUN
finefocus-615	586	5	of	of	ADP
finefocus-615	586	6	the	the	DET
finefocus-615	586	7	surface	surface	NOUN
finefocus-615	586	8	consortia	consortia	NOUN
finefocus-615	586	9	of	of	ADP
finefocus-615	586	10	gubbeen	gubbeen	PROPN
finefocus-615	586	11	,	,	PUNCT
finefocus-615	586	12	a	a	DET
finefocus-615	586	13	red	red	ADJ
finefocus-615	586	14	-	-	PUNCT
finefocus-615	586	15	smear	smear	NOUN
finefocus-615	586	16	cheese	cheese	NOUN
finefocus-615	586	17	.	.	PUNCT
finefocus-615	587	1	j.	j.	PROPN
finefocus-615	587	2	dairy	dairy	PROPN
finefocus-615	587	3	sci	sci	PROPN
finefocus-615	587	4	.	.	PUNCT
finefocus-615	588	1	90(5	90(5	NUM
finefocus-615	588	2	):	):	PUNCT
finefocus-615	588	3	2200	2200	NUM
finefocus-615	588	4	-	-	SYM
finefocus-615	588	5	2210	2210	NUM
finefocus-615	588	6	.	.	PUNCT
finefocus-615	589	1	37	37	NUM
finefocus-615	589	2	.	.	PUNCT
finefocus-615	590	1	rodriguez	rodriguez	NOUN
finefocus-615	590	2	-	-	PUNCT
finefocus-615	590	3	alonso	alonso	PROPN
finefocus-615	590	4	,	,	PUNCT
finefocus-615	590	5	p.	p.	NOUN
finefocus-615	590	6	,	,	PUNCT
finefocus-615	590	7	fernandez	fernandez	PROPN
finefocus-615	590	8	-	-	PUNCT
finefocus-615	590	9	otero	otero	PROPN
finefocus-615	590	10	,	,	PUNCT
finefocus-615	590	11	c.	c.	PROPN
finefocus-615	590	12	,	,	PUNCT
finefocus-615	590	13	centeno	centeno	PROPN
finefocus-615	590	14	,	,	PUNCT
finefocus-615	590	15	j.	j.	PROPN
finefocus-615	590	16	a.	a.	PROPN
finefocus-615	590	17	,	,	PUNCT
finefocus-615	590	18	&	&	CCONJ
finefocus-615	590	19	garabal	garabal	PROPN
finefocus-615	590	20	,	,	PUNCT
finefocus-615	590	21	j.	j.	PROPN
finefocus-615	590	22	i.	i.	PROPN
finefocus-615	590	23	(	(	PUNCT
finefocus-615	590	24	2009	2009	NUM
finefocus-615	590	25	)	)	PUNCT
finefocus-615	590	26	.	.	PUNCT
finefocus-615	591	1	antibiotic	antibiotic	ADJ
finefocus-615	591	2	resistance	resistance	NOUN
finefocus-615	591	3	in	in	ADP
finefocus-615	591	4	lactic	lactic	ADJ
finefocus-615	591	5	acid	acid	NOUN
finefocus-615	591	6	bacteria	bacteria	NOUN
finefocus-615	591	7	and	and	CCONJ
finefocus-615	591	8	micrococcaceae	micrococcaceae	ADV
finefocus-615	591	9	/	/	SYM
finefocus-615	591	10	staphylococcaceae	staphylococcaceae	VERB
finefocus-615	591	11	isolates	isolate	NOUN
finefocus-615	591	12	from	from	ADP
finefocus-615	591	13	artisanal	artisanal	ADJ
finefocus-615	591	14	raw	raw	ADJ
finefocus-615	591	15	milk	milk	NOUN
finefocus-615	591	16	cheeses	cheese	NOUN
finefocus-615	591	17	,	,	PUNCT
finefocus-615	591	18	and	and	CCONJ
finefocus-615	591	19	potential	potential	ADJ
finefocus-615	591	20	implications	implication	NOUN
finefocus-615	591	21	on	on	ADP
finefocus-615	591	22	cheese	cheese	NOUN
finefocus-615	591	23	making	making	NOUN
finefocus-615	591	24	.	.	PUNCT
finefocus-615	592	1	j.	j.	PROPN
finefocus-615	592	2	food	food	PROPN
finefocus-615	592	3	sci	sci	PROPN
finefocus-615	592	4	.	.	PUNCT
finefocus-615	593	1	74(6	74(6	NUM
finefocus-615	593	2	):	):	PUNCT
finefocus-615	593	3	m284293	m284293	PROPN
finefocus-615	593	4	.	.	PUNCT
finefocus-615	593	5	doi	doi	PROPN
finefocus-615	593	6	:	:	PUNCT
finefocus-615	593	7	10.1111	10.1111	NUM
finefocus-615	593	8	/	/	SYM
finefocus-615	593	9	j.1750	j.1750	PROPN
finefocus-615	593	10	-	-	PUNCT
finefocus-615	593	11	3841.2009.01217.x	3841.2009.01217.x	NUM
finefocus-615	593	12	38	38	NUM
finefocus-615	593	13	.	.	PUNCT
finefocus-615	594	1	salles	salles	PROPN
finefocus-615	594	2	,	,	PUNCT
finefocus-615	594	3	j.	j.	PROPN
finefocus-615	594	4	f.	f.	PROPN
finefocus-615	594	5	,	,	PUNCT
finefocus-615	594	6	poly	poly	NOUN
finefocus-615	594	7	,	,	PUNCT
finefocus-615	594	8	f.	f.	PROPN
finefocus-615	594	9	,	,	PUNCT
finefocus-615	594	10	schmid	schmid	PROPN
finefocus-615	594	11	,	,	PUNCT
finefocus-615	594	12	b.	b.	PROPN
finefocus-615	594	13	,	,	PUNCT
finefocus-615	594	14	&	&	CCONJ
finefocus-615	594	15	le	le	X
finefocus-615	594	16	roux	roux	NOUN
finefocus-615	594	17	,	,	PUNCT
finefocus-615	594	18	x.	x.	NOUN
finefocus-615	594	19	(	(	PUNCT
finefocus-615	594	20	2009	2009	NUM
finefocus-615	594	21	)	)	PUNCT
finefocus-615	594	22	.	.	PUNCT
finefocus-615	595	1	community	community	NOUN
finefocus-615	595	2	niche	niche	NOUN
finefocus-615	595	3	predicts	predict	VERB
finefocus-615	595	4	the	the	DET
finefocus-615	595	5	functioning	functioning	NOUN
finefocus-615	595	6	of	of	ADP
finefocus-615	595	7	denitrifying	denitrify	VERB
finefocus-615	595	8	bacterial	bacterial	ADJ
finefocus-615	595	9	assemblages	assemblage	NOUN
finefocus-615	595	10	.	.	PUNCT
finefocus-615	596	1	ecology	ecology	NOUN
finefocus-615	596	2	90(12	90(12	NUM
finefocus-615	596	3	):	):	PUNCT
finefocus-615	596	4	3324	3324	NUM
finefocus-615	596	5	-	-	SYM
finefocus-615	596	6	3332	3332	NUM
finefocus-615	596	7	.	.	PUNCT
finefocus-615	597	1	39	39	NUM
finefocus-615	597	2	.	.	PUNCT
finefocus-615	598	1	sanger	sanger	PROPN
finefocus-615	598	2	,	,	PUNCT
finefocus-615	598	3	f.	f.	PROPN
finefocus-615	598	4	,	,	PUNCT
finefocus-615	598	5	nicklen	nicklen	PROPN
finefocus-615	598	6	,	,	PUNCT
finefocus-615	598	7	s.	s.	PROPN
finefocus-615	598	8	,	,	PUNCT
finefocus-615	598	9	&	&	CCONJ
finefocus-615	598	10	coulson	coulson	PROPN
finefocus-615	598	11	,	,	PUNCT
finefocus-615	598	12	a.	a.	PROPN
finefocus-615	598	13	r.	r.	PROPN
finefocus-615	598	14	(	(	PUNCT
finefocus-615	598	15	1977	1977	NUM
finefocus-615	598	16	)	)	PUNCT
finefocus-615	598	17	.	.	PUNCT
finefocus-615	599	1	dna	dna	PROPN
finefocus-615	599	2	sequencing	sequence	VERB
finefocus-615	599	3	with	with	ADP
finefocus-615	599	4	chain	chain	NOUN
finefocus-615	599	5	-	-	PUNCT
finefocus-615	599	6	terminating	terminate	VERB
finefocus-615	599	7	inhibitors	inhibitor	NOUN
finefocus-615	599	8	.	.	PUNCT
finefocus-615	600	1	proceedings	proceeding	NOUN
finefocus-615	600	2	of	of	ADP
finefocus-615	600	3	the	the	DET
finefocus-615	600	4	natl	natl	NOUN
finefocus-615	600	5	.	.	PUNCT
finefocus-615	601	1	acad	acad	PROPN
finefocus-615	601	2	.	.	PUNCT
finefocus-615	602	1	sci	sci	PROPN
finefocus-615	602	2	.	.	PROPN
finefocus-615	602	3	usa	usa	PROPN
finefocus-615	602	4	74(12	74(12	NUM
finefocus-615	602	5	):	):	PUNCT
finefocus-615	602	6	5463	5463	NUM
finefocus-615	602	7	-	-	SYM
finefocus-615	602	8	5467	5467	NUM
finefocus-615	602	9	.	.	PUNCT
finefocus-615	603	1	40	40	NUM
finefocus-615	603	2	.	.	PUNCT
finefocus-615	603	3	santarelli	santarelli	PROPN
finefocus-615	603	4	,	,	PUNCT
finefocus-615	603	5	m.	m.	NOUN
finefocus-615	603	6	,	,	PUNCT
finefocus-615	603	7	wolfe	wolfe	PROPN
finefocus-615	603	8	,	,	PUNCT
finefocus-615	603	9	b.	b.	PROPN
finefocus-615	603	10	,	,	PUNCT
finefocus-615	603	11	gatti	gatti	PROPN
finefocus-615	603	12	,	,	PUNCT
finefocus-615	603	13	monica	monica	PROPN
finefocus-615	603	14	,	,	PUNCT
finefocus-615	603	15	&	&	CCONJ
finefocus-615	603	16	dutton	dutton	PROPN
finefocus-615	603	17	,	,	PUNCT
finefocus-615	603	18	r.	r.	PROPN
finefocus-615	603	19	(	(	PUNCT
finefocus-615	603	20	2012	2012	NUM
finefocus-615	603	21	)	)	PUNCT
finefocus-615	603	22	.	.	PUNCT
finefocus-615	604	1	3.5	3.5	NUM
finefocus-615	604	2	characterization	characterization	NOUN
finefocus-615	604	3	and	and	CCONJ
finefocus-615	604	4	dynamics	dynamic	NOUN
finefocus-615	604	5	of	of	ADP
finefocus-615	604	6	surface	surface	NOUN
finefocus-615	604	7	microbiota	microbiota	NOUN
finefocus-615	604	8	during	during	ADP
finefocus-615	604	9	natural	natural	ADJ
finefocus-615	604	10	rind	rind	NOUN
finefocus-615	604	11	development	development	NOUN
finefocus-615	604	12	.	.	PUNCT
finefocus-615	605	1	composition	composition	NOUN
finefocus-615	605	2	and	and	CCONJ
finefocus-615	605	3	dynamics	dynamic	NOUN
finefocus-615	605	4	of	of	ADP
finefocus-615	605	5	microbiota	microbiota	NOUN
finefocus-615	605	6	in	in	ADP
finefocus-615	605	7	different	different	ADJ
finefocus-615	605	8	dairy	dairy	NOUN
finefocus-615	605	9	ecosystems	ecosystem	NOUN
finefocus-615	605	10	,	,	PUNCT
finefocus-615	605	11	101127	101127	NUM
finefocus-615	605	12	.	.	PUNCT
finefocus-615	606	1	41	41	NUM
finefocus-615	606	2	.	.	PUNCT
finefocus-615	606	3	shoemaker	shoemaker	PROPN
finefocus-615	606	4	,	,	PUNCT
finefocus-615	606	5	n.	n.	PROPN
finefocus-615	606	6	b.	b.	PROPN
finefocus-615	606	7	,	,	PUNCT
finefocus-615	606	8	vlamakis	vlamakis	PROPN
finefocus-615	606	9	,	,	PUNCT
finefocus-615	606	10	h.	h.	PROPN
finefocus-615	606	11	,	,	PUNCT
finefocus-615	606	12	hayes	hayes	PROPN
finefocus-615	606	13	,	,	PUNCT
finefocus-615	606	14	k.	k.	PROPN
finefocus-615	606	15	,	,	PUNCT
finefocus-615	606	16	&	&	CCONJ
finefocus-615	606	17	salyers	salyer	NOUN
finefocus-615	606	18	,	,	PUNCT
finefocus-615	606	19	a.	a.	NOUN
finefocus-615	606	20	a.	a.	NOUN
finefocus-615	606	21	(	(	PUNCT
finefocus-615	606	22	2001	2001	NUM
finefocus-615	606	23	)	)	PUNCT
finefocus-615	606	24	.	.	PUNCT
finefocus-615	607	1	evidence	evidence	NOUN
finefocus-615	607	2	for	for	ADP
finefocus-615	607	3	extensive	extensive	ADJ
finefocus-615	607	4	resistance	resistance	NOUN
finefocus-615	607	5	gene	gene	NOUN
finefocus-615	607	6	transfer	transfer	NOUN
finefocus-615	607	7	among	among	ADP
finefocus-615	607	8	bacteroides	bacteroide	NOUN
finefocus-615	607	9	spp	spp	NOUN
finefocus-615	607	10	.	.	PUNCT
finefocus-615	608	1	and	and	CCONJ
finefocus-615	608	2	among	among	ADP
finefocus-615	608	3	bacteroides	bacteroide	NOUN
finefocus-615	608	4	and	and	CCONJ
finefocus-615	608	5	other	other	ADJ
finefocus-615	608	6	genera	genera	NOUN
finefocus-615	608	7	in	in	ADP
finefocus-615	608	8	the	the	DET
finefocus-615	608	9	human	human	ADJ
finefocus-615	608	10	colon	colon	NOUN
finefocus-615	608	11	.	.	PUNCT
finefocus-615	609	1	appl	appl	PROPN
finefocus-615	609	2	.	.	PUNCT
finefocus-615	610	1	environ	environ	PROPN
finefocus-615	610	2	.	.	PUNCT
finefocus-615	610	3	microbiol	microbiol	PROPN
finefocus-615	610	4	.	.	PUNCT
finefocus-615	611	1	67(2	67(2	NOUN
finefocus-615	611	2	):	):	PUNCT
finefocus-615	611	3	561	561	NUM
finefocus-615	611	4	-	-	SYM
finefocus-615	611	5	568	568	NUM
finefocus-615	611	6	.	.	PUNCT
finefocus-615	612	1	42	42	NUM
finefocus-615	612	2	.	.	PUNCT
finefocus-615	612	3	sieuwerts	sieuwert	NOUN
finefocus-615	612	4	,	,	PUNCT
finefocus-615	612	5	s.	s.	PROPN
finefocus-615	612	6	,	,	PUNCT
finefocus-615	612	7	de	de	PROPN
finefocus-615	612	8	bok	bok	PROPN
finefocus-615	612	9	,	,	PUNCT
finefocus-615	612	10	f.	f.	PROPN
finefocus-615	612	11	a.	a.	PROPN
finefocus-615	612	12	m.	m.	PROPN
finefocus-615	612	13	,	,	PUNCT
finefocus-615	612	14	hugenholtz	hugenholtz	NOUN
finefocus-615	612	15	,	,	PUNCT
finefocus-615	612	16	j.	j.	PROPN
finefocus-615	612	17	,	,	PUNCT
finefocus-615	612	18	&	&	CCONJ
finefocus-615	612	19	van	van	PROPN
finefocus-615	612	20	hylckama	hylckama	PROPN
finefocus-615	612	21	vlieg	vlieg	PROPN
finefocus-615	612	22	,	,	PUNCT
finefocus-615	612	23	j.	j.	PROPN
finefocus-615	612	24	e.	e.	PROPN
finefocus-615	612	25	t.	t.	PROPN
finefocus-615	612	26	(	(	PUNCT
finefocus-615	612	27	2008	2008	NUM
finefocus-615	612	28	)	)	PUNCT
finefocus-615	612	29	.	.	PUNCT
finefocus-615	613	1	unraveling	unravel	VERB
finefocus-615	613	2	microbial	microbial	ADJ
finefocus-615	613	3	interactions	interaction	NOUN
finefocus-615	613	4	in	in	ADP
finefocus-615	613	5	food	food	NOUN
finefocus-615	613	6	fermentations	fermentation	NOUN
finefocus-615	613	7	:	:	PUNCT
finefocus-615	613	8	from	from	ADP
finefocus-615	613	9	classical	classical	ADJ
finefocus-615	613	10	to	to	ADP
finefocus-615	613	11	genomics	genomics	NOUN
finefocus-615	613	12	approaches	approach	NOUN
finefocus-615	613	13	.	.	PUNCT
finefocus-615	614	1	appl	appl	PROPN
finefocus-615	614	2	.	.	PUNCT
finefocus-615	615	1	environ	environ	PROPN
finefocus-615	615	2	.	.	PUNCT
finefocus-615	615	3	microbiol	microbiol	PROPN
finefocus-615	615	4	.	.	PUNCT
finefocus-615	616	1	74(16	74(16	NUM
finefocus-615	616	2	):	):	PUNCT
finefocus-615	616	3	4997	4997	NUM
finefocus-615	616	4	-	-	SYM
finefocus-615	616	5	5007	5007	NUM
finefocus-615	616	6	.	.	PUNCT
finefocus-615	617	1	43	43	NUM
finefocus-615	617	2	.	.	PUNCT
finefocus-615	617	3	tammam	tammam	NOUN
finefocus-615	617	4	,	,	PUNCT
finefocus-615	617	5	j.	j.	PROPN
finefocus-615	617	6	d.	d.	PROPN
finefocus-615	617	7	,	,	PUNCT
finefocus-615	617	8	williams	williams	PROPN
finefocus-615	617	9	,	,	PUNCT
finefocus-615	617	10	a.	a.	PROPN
finefocus-615	617	11	g.	g.	PROPN
finefocus-615	617	12	,	,	PUNCT
finefocus-615	617	13	noble	noble	ADJ
finefocus-615	617	14	,	,	PUNCT
finefocus-615	617	15	j.	j.	PROPN
finefocus-615	617	16	,	,	PUNCT
finefocus-615	617	17	&	&	CCONJ
finefocus-615	617	18	lloyd	lloyd	PROPN
finefocus-615	617	19	,	,	PUNCT
finefocus-615	617	20	d.	d.	PROPN
finefocus-615	617	21	(	(	PUNCT
finefocus-615	617	22	2000	2000	NUM
finefocus-615	617	23	)	)	PUNCT
finefocus-615	617	24	.	.	PUNCT
finefocus-615	618	1	amino	amino	NOUN
finefocus-615	618	2	acid	acid	NOUN
finefocus-615	618	3	fermentation	fermentation	NOUN
finefocus-615	618	4	in	in	ADP
finefocus-615	618	5	non	non	ADJ
finefocus-615	618	6	-	-	ADJ
finefocus-615	618	7	starter	starter	ADJ
finefocus-615	618	8	lactobacillus	lactobacillus	NOUN
finefocus-615	618	9	spp	spp	NOUN
finefocus-615	618	10	.	.	PUNCT
finefocus-615	618	11	isolated	isolate	VERB
finefocus-615	618	12	from	from	ADP
finefocus-615	618	13	cheddar	cheddar	NOUN
finefocus-615	618	14	cheese	cheese	NOUN
finefocus-615	618	15	.	.	PUNCT
finefocus-615	619	1	lett	lett	PROPN
finefocus-615	619	2	.	.	PUNCT
finefocus-615	620	1	appl	appl	PROPN
finefocus-615	620	2	.	.	PUNCT
finefocus-615	621	1	microbiol	microbiol	PROPN
finefocus-615	621	2	.	.	PUNCT
finefocus-615	622	1	30(5	30(5	NUM
finefocus-615	622	2	):	):	PUNCT
finefocus-615	622	3	370	370	NUM
finefocus-615	622	4	-	-	SYM
finefocus-615	622	5	374	374	NUM
finefocus-615	622	6	.	.	NUM
finefocus-615	623	1	44	44	NUM
finefocus-615	623	2	.	.	PUNCT
finefocus-615	624	1	turnidge	turnidge	PROPN
finefocus-615	624	2	,	,	PUNCT
finefocus-615	624	3	j.	j.	PROPN
finefocus-615	624	4	,	,	PUNCT
finefocus-615	624	5	&	&	CCONJ
finefocus-615	624	6	paterson	paterson	PROPN
finefocus-615	624	7	,	,	PUNCT
finefocus-615	624	8	d.	d.	PROPN
finefocus-615	624	9	l.	l.	PROPN
finefocus-615	624	10	(	(	PUNCT
finefocus-615	624	11	2007	2007	NUM
finefocus-615	624	12	)	)	PUNCT
finefocus-615	624	13	.	.	PUNCT
finefocus-615	625	1	setting	set	VERB
finefocus-615	625	2	and	and	CCONJ
finefocus-615	625	3	revising	revise	VERB
finefocus-615	625	4	antibacterial	antibacterial	ADJ
finefocus-615	625	5	susceptibility	susceptibility	NOUN
finefocus-615	625	6	breakpoints	breakpoint	NOUN
finefocus-615	625	7	.	.	PUNCT
finefocus-615	626	1	clin	clin	PROPN
finefocus-615	626	2	.	.	PUNCT
finefocus-615	627	1	microbiol	microbiol	PROPN
finefocus-615	627	2	.	.	PUNCT
finefocus-615	628	1	rev	rev	PROPN
finefocus-615	628	2	.	.	PROPN
finefocus-615	629	1	20(3	20(3	NOUN
finefocus-615	629	2	):	):	PUNCT
finefocus-615	629	3	391	391	NUM
finefocus-615	629	4	-	-	SYM
finefocus-615	629	5	408	408	NUM
finefocus-615	629	6	.	.	PUNCT
finefocus-615	630	1	doi	doi	NOUN
finefocus-615	630	2	:	:	PUNCT
finefocus-615	630	3	10.1128	10.1128	NUM
finefocus-615	630	4	/	/	SYM
finefocus-615	630	5	cmr.00047	cmr.00047	NUM
finefocus-615	630	6	-	-	PUNCT
finefocus-615	630	7	06	06	NUM
finefocus-615	630	8	.	.	PUNCT
finefocus-615	631	1	45	45	NUM
finefocus-615	631	2	.	.	PUNCT
finefocus-615	631	3	weber	weber	PROPN
finefocus-615	631	4	,	,	PUNCT
finefocus-615	631	5	k.	k.	PROPN
finefocus-615	631	6	p.	p.	PROPN
finefocus-615	631	7	,	,	PUNCT
finefocus-615	631	8	&	&	CCONJ
finefocus-615	631	9	legge	legge	PROPN
finefocus-615	631	10	,	,	PUNCT
finefocus-615	631	11	r.	r.	PROPN
finefocus-615	631	12	l.	l.	PROPN
finefocus-615	631	13	(	(	PUNCT
finefocus-615	631	14	2010	2010	NUM
finefocus-615	631	15	)	)	PUNCT
finefocus-615	631	16	.	.	PUNCT
finefocus-615	632	1	community	community	NOUN
finefocus-615	632	2	-	-	PUNCT
finefocus-615	632	3	level	level	NOUN
finefocus-615	632	4	physiological	physiological	ADJ
finefocus-615	632	5	profiling	profiling	NOUN
finefocus-615	632	6	.	.	PUNCT
finefocus-615	633	1	meth	meth	NOUN
finefocus-615	633	2	.	.	PUNCT
finefocus-615	634	1	mol	mol	PROPN
finefocus-615	634	2	.	.	PROPN
finefocus-615	634	3	bio	bio	PROPN
finefocus-615	634	4	.	.	PROPN
finefocus-615	635	1	599	599	NUM
finefocus-615	635	2	:	:	PUNCT
finefocus-615	635	3	263	263	NUM
finefocus-615	635	4	-	-	SYM
finefocus-615	635	5	281	281	NUM
finefocus-615	635	6	.	.	PUNCT
finefocus-615	636	1	doi	doi	NOUN
finefocus-615	636	2	:	:	PUNCT
finefocus-615	636	3	10.1007/978	10.1007/978	NUM
finefocus-615	636	4	-	-	SYM
finefocus-615	636	5	1	1	NUM
finefocus-615	636	6	-	-	PUNCT
finefocus-615	636	7	60761	60761	NUM
finefocus-615	636	8	-	-	SYM
finefocus-615	636	9	439	439	NUM
finefocus-615	636	10	-	-	PUNCT
finefocus-615	636	11	5_16	5_16	NUM
finefocus-615	636	12	.	.	PUNCT
finefocus-615	636	13	46	46	NUM
finefocus-615	636	14	.	.	PUNCT
finefocus-615	637	1	williams	williams	PROPN
finefocus-615	637	2	,	,	PUNCT
finefocus-615	637	3	alan	alan	PROPN
finefocus-615	637	4	g.	g.	PROPN
finefocus-615	637	5	,	,	PUNCT
finefocus-615	637	6	withers	wither	NOUN
finefocus-615	637	7	,	,	PUNCT
finefocus-615	637	8	susan	susan	PROPN
finefocus-615	637	9	e.	e.	PROPN
finefocus-615	637	10	,	,	PUNCT
finefocus-615	637	11	&	&	CCONJ
finefocus-615	637	12	banks	banks	PROPN
finefocus-615	637	13	,	,	PUNCT
finefocus-615	637	14	jean	jean	PROPN
finefocus-615	637	15	m.	m.	PROPN
finefocus-615	637	16	(	(	PUNCT
finefocus-615	637	17	2000	2000	NUM
finefocus-615	637	18	)	)	PUNCT
finefocus-615	637	19	.	.	PUNCT
finefocus-615	638	1	energy	energy	NOUN
finefocus-615	638	2	sources	source	NOUN
finefocus-615	638	3	of	of	ADP
finefocus-615	638	4	non	non	ADJ
finefocus-615	638	5	-	-	ADJ
finefocus-615	638	6	starter	starter	ADJ
finefocus-615	638	7	lactic	lactic	ADJ
finefocus-615	638	8	acid	acid	NOUN
finefocus-615	638	9	bacteria	bacteria	NOUN
finefocus-615	638	10	isolated	isolate	VERB
finefocus-615	638	11	from	from	ADP
finefocus-615	638	12	cheddar	cheddar	NOUN
finefocus-615	638	13	cheese	cheese	NOUN
finefocus-615	638	14	.	.	PUNCT
finefocus-615	639	1	intl	intl	PROPN
finefocus-615	639	2	.	.	PUNCT
finefocus-615	640	1	dairy	dairy	NOUN
finefocus-615	640	2	j.	j.	PROPN
finefocus-615	640	3	10(1	10(1	NUM
finefocus-615	640	4	):	):	PUNCT
finefocus-615	640	5	17	17	NUM
finefocus-615	640	6	-	-	SYM
finefocus-615	640	7	23	23	NUM
finefocus-615	640	8	.	.	PUNCT
finefocus-615	641	1	47	47	NUM
finefocus-615	641	2	.	.	PUNCT
finefocus-615	642	1	wolfe	wolfe	PROPN
finefocus-615	642	2	,	,	PUNCT
finefocus-615	642	3	b.	b.	PROPN
finefocus-615	642	4	e.	e.	PROPN
finefocus-615	642	5	,	,	PUNCT
finefocus-615	642	6	&	&	CCONJ
finefocus-615	642	7	dutton	dutton	PROPN
finefocus-615	642	8	,	,	PUNCT
finefocus-615	642	9	r.	r.	PROPN
finefocus-615	642	10	j.	j.	PROPN
finefocus-615	642	11	(	(	PUNCT
finefocus-615	642	12	2015	2015	NUM
finefocus-615	642	13	)	)	PUNCT
finefocus-615	642	14	.	.	PUNCT
finefocus-615	643	1	fermented	ferment	VERB
finefocus-615	643	2	foods	food	NOUN
finefocus-615	643	3	as	as	ADP
finefocus-615	643	4	experimentally	experimentally	ADV
finefocus-615	643	5	tractable	tractable	ADJ
finefocus-615	643	6	microbial	microbial	ADJ
finefocus-615	643	7	ecosystems	ecosystem	NOUN
finefocus-615	643	8	.	.	PUNCT
finefocus-615	644	1	cell	cell	NOUN
finefocus-615	644	2	161(1	161(1	NUM
finefocus-615	644	3	):	):	PUNCT
finefocus-615	644	4	49	49	NUM
finefocus-615	644	5	-	-	SYM
finefocus-615	644	6	55	55	NUM
finefocus-615	644	7	.	.	PUNCT
finefocus-615	645	1	doi	doi	NOUN
finefocus-615	645	2	:	:	PUNCT
finefocus-615	645	3	10.1016	10.1016	NUM
finefocus-615	645	4	/	/	SYM
finefocus-615	645	5	j.cell.2015.02.034	j.cell.2015.02.034	PROPN
finefocus-615	645	6	.	.	PUNCT
finefocus-615	646	1	48	48	NUM
finefocus-615	646	2	.	.	PUNCT
finefocus-615	647	1	wolfe	wolfe	PROPN
finefocus-615	647	2	,	,	PUNCT
finefocus-615	647	3	b.	b.	PROPN
finefocus-615	647	4	e	e	PROPN
finefocus-615	647	5	,	,	PUNCT
finefocus-615	647	6	button	button	NOUN
finefocus-615	647	7	,	,	PUNCT
finefocus-615	647	8	j.	j.	PROPN
finefocus-615	647	9	e	e	PROPN
finefocus-615	647	10	,	,	PUNCT
finefocus-615	647	11	santarelli	santarelli	PROPN
finefocus-615	647	12	,	,	PUNCT
finefocus-615	647	13	m.	m.	NOUN
finefocus-615	647	14	,	,	PUNCT
finefocus-615	647	15	&	&	CCONJ
finefocus-615	647	16	dutton	dutton	PROPN
finefocus-615	647	17	,	,	PUNCT
finefocus-615	647	18	r.	r.	PROPN
finefocus-615	647	19	j.	j.	PROPN
finefocus-615	647	20	(	(	PUNCT
finefocus-615	647	21	2014	2014	NUM
finefocus-615	647	22	)	)	PUNCT
finefocus-615	647	23	.	.	PUNCT
finefocus-615	648	1	cheese	cheese	NOUN
finefocus-615	648	2	rind	rind	NOUN
finefocus-615	648	3	communities	community	NOUN
finefocus-615	648	4	provide	provide	VERB
finefocus-615	648	5	tractable	tractable	ADJ
finefocus-615	648	6	systems	system	NOUN
finefocus-615	648	7	for	for	ADP
finefocus-615	648	8	in	in	ADP
finefocus-615	648	9	situ	situ	NOUN
finefocus-615	648	10	and	and	CCONJ
finefocus-615	648	11	in	in	ADP
finefocus-615	648	12	vitro	vitro	X
finefocus-615	648	13	studies	study	NOUN
finefocus-615	648	14	of	of	ADP
finefocus-615	648	15	microbial	microbial	ADJ
finefocus-615	648	16	diversity	diversity	NOUN
finefocus-615	648	17	.	.	PUNCT
finefocus-615	649	1	cell	cell	NOUN
finefocus-615	649	2	158(2	158(2	NUM
finefocus-615	649	3	):	):	PUNCT
finefocus-615	649	4	422	422	NUM
finefocus-615	649	5	-	-	SYM
finefocus-615	649	6	433	433	NUM
finefocus-615	649	7	.	.	PUNCT
finefocus-615	650	1	doi	doi	NOUN
finefocus-615	650	2	:	:	PUNCT
finefocus-615	650	3	10.1016	10.1016	NUM
finefocus-615	650	4	/	/	SYM
finefocus-615	650	5	j.cell.2014.05.041	j.cell.2014.05.041	PROPN
finefocus-615	650	6	.	.	PUNCT