Phillip C. Betts Jordan T. Froese* Department of Chemistry, Ball State University, Muncie, IN 47306 Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases Keywords: Rieske dioxygenase, toluene dioxygenase, oxidative dearomatization, green chemistry, enzyme engineering, bioremediation © 2024 Betts, Froese. Fine Focus, 10(1), 90-108. doi: 10.33043/FF.10.1.90-108. Shared with CC-BY-NC-ND 4.0 License. Manuscript received 8 April 2023; accepted 19 May 2023 Abstract Rieske dioxygenases are multi-component enzyme systems, naturally found in many soil bacteria, that have been widely applied in the production of fine chemicals, owing to the unique and valuable oxidative dearomatization reactions they catalyze. The range of practical applications for these enzymes in this context has historically been limited, however, due to their limited substrate scope and strict selectivity. To overcome these limitations, our research group has employed the tools of enzyme engineering to expand the substrate scope or improve the reactivity of these enzyme systems in specific contexts. Traditionally, enzyme engineering campaigns targeting metalloenzymes have avoided mutations to metal-coordinating residues, based on the assumption that these residues are essential for enzyme activity. Inspired by the success of other recent enzyme engineering reports, our research group investigated the potential to alter or improve the reactivity of Rieske dioxygenases by altering or eliminating iron coordination in the active site of these enzymes. Herein, we report the modification of all three iron-coordinating residues in the active site of toluene dioxygenase both to alternate residues capable of coordinating iron, and to a residue that would eliminate iron coordination. The enzyme variants produced in this way were tested for their activity in the cis-dihydroxylation of a small library of potential aromatic substrates. The results of these studies demonstrated that all three iron-coordi- nating residues, in their natural state, are essential for enzyme activity in toluene dioxygenase, as the introduction of any mutations at these sites resulted in a complete loss of cis-dihydroxylation activity for all substrates tested. https://creativecommons.org/licenses/by-nc-nd/4.0/ Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 91 Introduction In recent years, the environmentally deleterious effects of the chemical industry have increas- ingly been recognized, leading to a concerted effort to employ more sustainable methods for the production of fine chemicals (19, 36). These environmentally sustainable chemical methods have collectively been referred to as “green chemistry”, which has been defined by a series of principles that serve to guide the application of sustainable chemistry (15, 34). Owing to this increased focus on green chemistry, the application of enzymes as catalysts in the chemical industry has grown in popularity (7). Enzymatic catalysts are entirely biodegradable, they operate in aqueous media as opposed to petroleum-derived solvents, they do not require high-temperature applications, and they are produced from renewable resources, complying with many of the principles of green chemistry (15, 34). One class of enzymes that have been widely applied as catalysts in the production of fine chemicals are the Rieske dioxygenases (16, 23). Rieske dioxygenases are non-heme iron dioxy- genases that are commonly found in soil bacte- ria (39). These enzymes have frequently evolved as a means for soil bacteria to metabolize aromatic pollutants in their environment and to use these pollutants as carbon and energy sources (Figure 1) (12, 42). The ability of these enzymes to catalyze the cis-dihydroxylation of aromatics to produce chemically versatile cis-diene-diol metabolites with high selectivity has made them very useful catalysts in the production of valuable compounds (16, 23). Rieske dioxygenases are produced by a wide range of soil bacteria strains, including Pseudomonas (42), Burkholderia (6), Nocar- dioides (32), and Comamonas (22). In fact, metagenomic sequencing studies have revealed that aromatic dioxygenases are ubiquitous, particularly in contaminated environments (17). Owing to their natural role in the remedi- ation of aromatics in the soil and therefore the detoxification of these environments (12,42), these enzymes play crucial roles in soil ecology. Because of this role for Rieske dioxygenases, these enzymes also have tremendous potential for utility in the field of bioremediation, the use of microorganisms to degrade anthropogenic pollutants in an environment. Aromatic pollut- ants such as benzene and toluene are ubiquitous in the environment and pose significant threats to human health, as these compounds are often Figure 1 Metabolic pathway by which soil organisms break down aromatic pollutants in their en- vironment (12, 42). Note. The role of Rieske dioxygenases in this metabolic pathway is highlighted (red). Fine Focus | Volume 1092 carcinogenic and endocrine disruptors (4). These aromatic pollutants are frequently intro- duced into the environment through fossil fuel combustion, oil spills, and the misuse of petro- leum products and solvents, creating a need for a means to remove these toxic compounds from the environment (4). To this end, Rieske dioxygenases have been employed as biore- mediation catalysts, including applications in the degradation of polychlorinated biphenyls (PCBs), which remain a hazardous presence in many environments (14, 21). Despite their applications in chemical synthesis and in bioremediation, the utility of Rieske dioxygenases in these contexts has remained limited by their strict selectivity and by their finite substrate scopes. As many Rieske dioxy- genases have evolved to metabolize non-polar aromatics, their active sites are organized to effectively bind non-polar substrates and orient them for 2,3-dihydroxylation (9, 18, 28). This results in the substrate scopes and the activities of these enzymes being restricted by the size and by the electronics of any potential substrates (10, 35). To alleviate these restric- tions on the utility of Rieske dioxygenases, multiple research groups have applied the tools of enzyme engineering to improve their reactivity or to expand their substrate scopes (5, 3, 11, 20, 26, 33, 37, 38). This has included studies that have engineered Rieske dioxygen- ases specifically to improve their utility in the bioremediation of aromatic pollutants in the soil (1, 21). Our lab has recently reported the development of improved Rieske dioxygenase variants through the application of rational enzyme engineering (27). These studies have led to the development of Rieske dioxygenases with improved reactivity or expanded substrate scopes, increasing the practical utility of these green chemical tools (1, 3, 5, 11, 20, 21, 26, 27, 33, 37, 38). When engineering metalloenzymes, studies have traditionally avoided mutations to the residues responsible for coordinating metal ions, based upon the assumption that these residues are essential for enzyme activity. Recently, however, studies have shown this assumption to be incorrect (29, 40). These studies have shown that mutations altering, or even eliminating, iron coordination in heme proteins can alter or improve the reactivity of these proteins in specific contexts (29, 40). Our laboratory was inspired by these studies to investigate whether a similar strategy could result in the development of improved Rieske dioxygenase variants. To our knowledge, no such study has been reported for Rieske dioxy- genases, thus this investigation would serve to inform future engineering studies performed with this enzyme class. Based upon reported results with other metalloenzymes (29, 40), it is predicted that mutating the iron-coordinat- ing residues of a Rieske dioxygenase enzyme will result in altered enzyme activity and/or substrate scope. This strategy has the potential to improve the activity of Rieske dioxygenases for specific substrates or expand their substrate scopes. Materials and Methods General Experimental E. coli BL21 (DE3) competent cells were obtained from ThermoFisher. Plasmid isola- tion/purification was performed using New Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 93 Table 1 Sequences of mutagenic primers used. Primer Name Primer Sequence TDO H222A fwd CGACATGTACGCGGCCGGGACGACCTCGCATCTGTCTGGCATCCTG TDO H222A rev GTCGTCCCGGCCGCGTACATGTCGCTGCAAAACTGCTCTGCGGCG TDO H222C fwd CGACATGTACTGCGCCGGGACGACCTCGCATCTGTCTGGCATCCTG TDO H222C rev GTCGTCCCGGCGCAGTACATGTCGCTGCAAAACTGCTCTGCGGCG TDO H222D fwd CGACATGTACGATGCCGGGACGACCTCGCATCTGTCTGGCATCCTG TDO H222D rev GTCGTCCCGGCATCGTACATGTCGCTGCAAAACTGCTCTGCGGCG TDO H222E fwd CGACATGTACGAAGCCGGGACGACCTCGCATCTGTCTGGCATCCTG TDO H222E rev GTCGTCCCGGCTTCGTACATGTCGCTGCAAAACTGCTCTGCGGCG TDO H228A fwd GACGACCTCGGCGCTGTCTGGCATCCTGGCAGGCCTGCCAGAAGAC TDO H228A rev GATGCCAGACAGCGCCGAGGTCGTCCCGGCATGGTACATGTCGCTGC TDO H228C fwd GACGACCTCGTGCCTGTCTGGCATCCTGGCAGGCCTGCCAGAAGAC TDO H228C rev GATGCCAGACAGGCACGAGGTCGTCCCGGCATGGTACATGTCGCTGC TDO H228D fwd GACGACCTCGGATCTGTCTGGCATCCTGGCAGGCCTGCCAGAAGAC TDO H228D rev GATGCCAGACAGATCCGAGGTCGTCCCGGCATGGTACATGTCGCTGC TDO H228E fwd GACGACCTCGGAACTGTCTGGCATCCTGGCAGGCCTGCCAGAAGAC TDO H228E rev GATGCCAGACAGTTCCGAGGTCGTCCCGGCATGGTACATGTCGCTGC TDO D376A fwd CGAGCAGGACGCGGGGGAGAACTGGGTCGAGATCCAGCACATCCTG TDO D376A rev CAGTTCTCCCCCGCGTCCTGCTCGAACACGCCACCGGCAGAGAAGG TDO D376C fwd CGAGCAGGACTGCGGGGAGAACTGGGTCGAGATCCAGCACATCCTG TDO D376C rev CAGTTCTCCCCGCAGTCCTGCTCGAACACGCCACCGGCAGAGAAGG TDO D376E fwd CGAGCAGGACGAAGGGGAGAACTGGGTCGAGATCCAGCACATCCTG TDO D376E rev CAGTTCTCCCCTTCGTCCTGCTCGAACACGCCACCGGCAGAGAAGG TDO D376H fwd CGAGCAGGACCATGGGGAGAACTGGGTCGAGATCCAGCACATCCTG TDO D376H rev CAGTTCTCCCCATGGTCCTGCTCGAACACGCCACCGGCAGAGAAGG Fine Focus | Volume 1094 England Biolabs Monarch® miniprep kit. Transformations of electrocompetent cells were performed on an Eppendorf Eporator®. Whole-cell assay cultures were grown in Greiner Bio-One polystyrene clear, round-bot- tom 96-well plates. All cultures were incubated in a Barnstead MaxQ 4000 Digital Orbital Incubator Shaker equipped with an Enzyscreen universal clamp system unless otherwise stated. Fluorescence analyses were performed using a Biotek® Synergy™ H1 monochromator-based multi-mode plate reader, using Corning® polystyrene black, opaque, flat-bottom 96-well plates. All reagents were obtained from Milli- poreSigma unless otherwise stated. Media were made at pH 7.2 and streptomycin was added at 50 μg mL−1. All E. coli cultures were maintained at 37 °C unless otherwise stated. Targeted Mutagenesis Protocol The pCP-02 expression system was used as the template for toluene dioxygenase mutant generation (30). Saturation mutagenesis was performed following the polymerase chain reaction (PCR)-based procedure of Liu and Naismith (24, 41). Amplification was performed using an ABI GeneAmp® 9700 Thermal Cycler and Q5® DNA polymerase (New England Biolabs). Mutagenic primers were designed according to the procedure of Liu and Naismith (24, 41). Primer sequences are shown below (Table 1). Parameters for the relevant PCR reactions are shown below (Table 2). Sequenc- ing analyses were performed by Eurofins Genomics© (Louisville, KY). Whole-cell fermentation 96 well-plate assay protocol E. coli (BL21 (DE3)) electrocompetent cells were transformed with isolated pCP-02 plasmids expressing toluene dioxygenase (parent and/or mutant libraries), and with isolated pCP-01 plasmids as negative controls (30). The transformation cultures were selected on LB + streptomycin plates overnight. Single colonies were inoculated into 160 µL LB + streptomycin media with 0.3% glucose in a 96-well round bottom seed plate and incubated Table 2 PCR reaction components and thermocycling protocol utilized for the generation of toluene dioxygenase mutants. PCR reaction components Thermocycling protocol Sterile H2O – 22.5 µL 98 °C – 30 s Q5® reaction buffer – 10 µL 98 °C – 10 s }x20Q5® high GC enhancer – 10 µL 72 °C – 4 min dNTPs (10 mM) – 1 µL 72 °C – 2 min Forward primer (10 µM)- 2.5 µL Reverse primer (10 µM)- 2.5 µL Template DNA (pCP-02) – 1 µL Q5® DNA polymerase – 0.5 µL Total – 50 µL Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 95 with shaking overnight. All plates included 3 or more wells containing E. coli (BL21 (DE3)) pCP-02 cells expressing the parent toluene dioxygenase enzyme, and 3 or more wells containing E. coli (BL21 (DE3)) pCP-01 (negative control) (30). Seed plates were used to inoculate 5 µL into 155 µL LB media containing streptomycin in a fresh 96-well round bottom assay plate, and the cultures were incubated with shaking for 2.75 h. The assay plates were then pelleted, and the supernatant discarded. Cultures were resuspended in 150 µL minimal media (KH2PO4 – 7.5 g L−1; citric acid – 2 g L−1; MgSO4·7H2O – 5 g L−1; trace metal solution – 2 mL L−1 [Na2SO4 – 1 g L−1; MnSO4 – 2 g L−1; ZnCl2 – 2 g L−1; CoCl2·6H2O – 2 g L−1; CuSO4·5H2O – 0.3 g L−1; FeSO4·7H2O – 10 g L−1; pH 1.0]; conc. H2SO4 – 1.2 mL L−1; ferric ammonium citrate – 0.3 g L−1; glucose – 4 g L−1; thiamine – 0.034 g L−1; pH 7.2) (8) containing streptomycin and incubated for a 1 h recovery period. Following this, the cultures were induced to a final concentration of 0.5 mM IPTG and the incubation temperature was reduced to 30 °C. After a 2 h induction period, aromatic substrates were added as 68 mM stock solutions in DMSO to a final concentration of 2 mM. Cultures were incubated with aromatic substrates for 1.5 h at 30 °C, after which the cultures were pelleted. A 100 µL portion of supernatant from each well was transferred to 96-well black opaque assay plates. The reaction was initiated by adding a 50 µL of NaIO4 stock solution to each well to a final concentration of 10 mM, and the assay plates were incubated with shaking at room temperature for 30 min. Cleaved diols were detected by adding 50 µL of fluoresceinamine stock solution (prepared with 3 µL conc. HCl (11.65 M)/1 mL fluorescein- amine solution) to each well to a final concen- tration of 0.1 mM (30). Assay plates were incubated with shaking at room temperature for 5 h. The fluorescence response from each well was analyzed at 485 nm (ex), 520 nm (em), and normalized to the mean fluorescence response of the negative controls ([I − I0]/I0). Results Identification of Iron-Coordinating Residues Because our lab has extensive experience working with toluene dioxygenase (TDO) (27, 30), and because TDO has been one of the most widely used Rieske dioxygenases in the field of organic synthesis (16), this enzyme was selected as the template for mutagenesis in this study. To identify the residues that would be targeted for mutagenesis, the reported crystal structure of toluene dioxygenase was analyzed using the molecular visualization software ChimeraX (9, 13). This analysis revealed that the catalytic iron atom of toluene dioxygenase is coordinated by two histidine residues (HIS222 and HIS228) and by one aspartate residue (ASP376) (Figure 1). These residues were therefore determined to be the appropriate targets for mutagenesis in this study. Production of Targeted Toluene Dioxygenase Variants To test the hypothesis of this study, it was determined that each iron-coordinating residue of TDO would be mutated to three alternate residues capable of coordinating iron (aspar- tate, glutamate, and cysteine for native histidine residues; glutamate, cysteine, and histidine for the native aspartate residue) and to one residue that would eliminate iron-coordination at that Fine Focus | Volume 1096 site (alanine). To generate the desired variants of toluene dioxygenase, targeted mutations were introduced through the PCR-based method of Liu and Naismith (24, 41). Mutagenic primers were designed according to this well-established protocol (Table 1), and the corresponding mutagenic PCR reactions were carried out as described. The successful introduction of the targeted mutations was confirmed through sequencing analysis performed by a third-party contractor. Representative aligned sequencing data is shown for the H222 mutants in Figure 3. Upon completion of this work, expression systems had been developed for twelve novel toluene dioxygenase variants with mutations introduced at the iron-coordinating residues (H222A, H222C, H222D, H222E, H228A, H228C, H228D, H228E, D376A, D376C, D376E, D376H). Figure 2 Visualization of the TDO active site with bound substrate (toluene, purple) (9). Note. The catalytic iron atom (orange) and iron-coordinating residues are highlighted (yellow). Residues within 7 Å of the substrate (toluene) are shown. Image generated with ChimeraX software (13). Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 97 Figure 3 Multiple sequence alignment of sequencing data from TDO variants with single active site mutations. Note. Alignment performed with M-Coffee (25). Image generated with ESPript (31). Fine Focus | Volume 1098 Screening of Toluene Dioxygenase Variants To test the cis-dihydroxylation activity of the TDO variants produced in this study, a fluores- cence-based assay that had previously been reported by our laboratory was applied (30). This assay, performed in 96-well plates, detects the presence of cis-diol metabolites produced by active dioxygenases in the bacterial growth media through the conversion of the cis-diol metabolites to a corresponding dialdehyde, and subsequent conjugation of the dialdehyde to a fluorescent probe (30) (Figure 4). In this way, the amount of fluorescence detected in each well provides information as to the amount of cis-diol metabolite produced by the enzyme variant present in the corresponding well. As the possibility existed that the introduced mutations would cause the structure of the TDO active site to be altered, while retaining some cis-dihydroxylation activity, it was determined that the enzyme variants should be tested on a small library of diverse aromatic substrates (Figure 5). This would afford the opportunity to determine the effect of the introduced mutations on the enzyme’s activity for a wide range of substrates, including those the native enzyme has high activity for, those the native enzyme has low activity for, and those the native enzyme has no activity for. To test the cis-dihydroxylation activity of the designed TDO variants, vectors expressing each set of variants were separately transformed into E. coli (BL21 (DE3)) alongside vectors express- ing the parent enzyme (pCP-02) and a negative control (pCP-01) (30). Six colonies expressing each variant were then inoculated into separate wells of a 96-well plate and cultured according to an optimized assay protocol (30), before being treated with the relevant aromatic substrate. Following an incubation period in the presence of the relevant substrate, the cells were removed, and the growth media was carried through the fluorescence-based assay protocol (Figure 4). Analysis of the resultant data from these assays revealed that all twelve of the designed TDO variants (H222A, H222C, H222D, H222E, H228A, H228C, H228D, H228E, D376A, D376C, D376E, D376H) lacked any activity for all eight substrates used in the screens (Figure 6). This included a Figure 4 Coupled reactions employed by the fluorescence-based assay to detect and quantify the cis-diol metabolites produced by active dioxygenases (30). Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 99 complete loss of activity for the native substrate (toluene), and other substrates for which the native enzyme possesses activity (benzyl alcohol, benzyl acetate, n-butyl benzene, t-butyl benzene, methyl benzoate) and no gain in activity for substrates that are not metabolized by the parent enzyme (benzyl acetamide and benzylamine) (Figure 6). Discussion To study the effect of mutating the iron-coor- dinating residues of Rieske dioxygenases on the activity of these enzymes, the first step was to select a member of this class of enzymes to act as the template for mutagenesis. Toluene dioxygenase (TDO) is a well-characterized member of the Rieske dioxygenase enzyme family, which is derived from the soil bacteri- um Pseudomonas putida F1 (42). Due to the historic importance of TDO in the production of valuable compounds (16), and because of our laboratory’s experience working with this Rieske dioxygenase system (27, 30), TDO was chosen as the engineering scaffold for this study. Due to the structural similarity observed with many Rieske dioxygenases (2), the results of this study would be expected to be applicable across many members of this enzyme family. The goals of this study were to investigate the effects of both altering and eliminating the iron-coordination of key residues in the active site of toluene dioxygenase. As TDO has been well characterized (9), the identification of the iron-coordinating residues of this enzyme (HIS222/HIS228/ASP376) using ChimeraX (13) was trivial (Figure 2). To effectively test the hypothesis of this study, it was determined Figure 5 Aromatic substrates used to screen for cis-dihydroxylation activity among the TDO mu- tants produced. Fine Focus | Volume 10100 Note. Fluorescence response was normalized to the mean fluorescence response of the negative control (E. coli BL21 (DE3) pCP-01) ([I – I0]/I0) (21). Parent activity was determined from positive controls (E. coli BL21 (DE3) pCP-02), with the fluorescence response normalized to the negative control ([I – I0]/ I0) (30). Figure 6 cis-Dihydroxylation activity of H222 TDO variants (A), H228 TDO variants (B) and D376 TDO variants (C) for representative aromatic substrates (n = 6). Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 101 that all three of the residues coordinating the catalytic iron would be mutated to three alternate residues capable of coordinating iron (aspartate, glutamate, and cysteine for native histidine residues; glutamate, cysteine, and histidine for the native aspartate residue) and to one residue that would eliminate iron-co- ordination at that site (alanine). This afforded the opportunity to evaluate the effects not only of eliminating iron coordination at specific sites, but also the potential beneficial effects of remodeling the active site and/or altering the electronics of the catalytic iron center by changing the iron coordinating residues while maintaining iron coordination. Once the successful generation of the targeted TDO variants had been confirmed, the next step was to test the cis-dihydroxylation activity of these variants. As the possibility existed that the introduced mutations would cause the structure of the TDO active site to be altered, while retaining some cis-dihydroxylation activ- ity, it was determined that the enzyme variants should be tested on a small library of diverse aromatic substrates. These aromatic substrates included the native substrate (toluene), one polar substrate for which the native enzyme possesses high activity (benzyl alcohol), one polar substrate for which the native enzyme possesses moderate activity (benzyl acetate), three polar substrates for which the native enzyme possess little or no activity (methyl benzoate, benzyl acetamide, and benzylamine), and two sterically bulky substrates for which the native enzyme possesses low activity (n-butyl benzene and t-butyl benzene) (Figure 5). By testing the activity of the designed mutants across these substrates, it would be possible to determine whether the introduced mutations had advantageous or detrimental effects in the cis-dihydroxylation of the native substrate, as well as in the cis-dihydroxylation of both steri- cally bulky and polar classes of substrates. Upon testing the activity of each designed TDO mutant for all the designated substrates, it was revealed that none of the mutants designed in this study possessed activity for any of the diverse substrates selected (Figure 6). These results revealed the critical role played by the iron-coordinating residues of Rieske dioxygen- ases in their native state, as any alteration of these residues, either to other residues with the potential for iron-coordination or to residues incapable of coordinating iron, resulted in complete ablation of enzyme activity. Although the hypothesis that the mutations introduced in this study would significantly alter the activity and/or substrate scope of the enzyme was proven correct, these changes were shown not to be beneficial for enzyme activity. The loss of activity observed with mutations to non-coordi- nating alanine likely indicates that coordination by three residues is essential for iron to be bound to the active site of Rieske dioxygenases in a catalytically active state. The loss of activity observed with mutations to alternate iron-co- ordinating resides may indicate that these alterations result in a significant remodeling of the active site that prevents iron from binding in a catalytically active state. Alternately, these results may indicate that the active site iron of Rieske dioxygenases must specifically be bound by two histidine residues and one aspartate residue to effectively participate in the catalytic mechanism. Further studies, including enzyme structure elucidation/homology modeling, Fine Focus | Volume 10102 docking analysis, and molecular dynamics simulations are required to precisely elucidate the cause of the loss of activity observed from these alterations to the iron-coordinating residues. These studies will be performed in due course. Although this study did not succeed in produc- ing novel TDO variants with improved or expanded activity, the results described will serve to guide future studies targeting the engineering of Rieske dioxygenases. With the increasing recognition of the need to employ more sustainable techniques in the chemical industry, and to remove harmful pollutants in contaminated environments, the field of enzyme engineering will continue to increase in importance. This is reflected in the fact that the engineering of Rieske dioxygenases to improve their utility either as green-chemical catalysts or as tools for the bioremediation of contaminated environments continues to be an active area of research (1, 3, 5, 20, 21, 26, 27, 33, 37, 38). Metagenomics research has shown that Rieske dioxygenases commonly evolve among soil bacteria (17), meaning that many unannotated Rieske dioxygenases remain to be studied in the context of enzyme engineering. As the field of microbiology continues to discover more diverse organisms and the powerful natural catalysts they produce, these new catalysts will provide valuable templates for the field of enzyme engineering. In this way, the natural ecological role of soil organisms can be harnessed and enhanced to create a safer and more sustainable future. This study, by demonstrating the impor- tance of preserving key active site residues in the generation of Rieske dioxygenase mutant libraries in the pursuit of enzyme engineering, will inform and expedite these efforts. Conclusions Inspired by recent reports that have shown that the alteration of iron-coordinating residues in metalloenzymes can alter or even improve the activity of these enzymes in certain contexts (29, 40), the iron-coordinating residues of toluene dioxygenase (TDO) were comprehen- sively mutated in this study. These residues were mutated both to alternate residues that are capable of coordinating iron and to a residue that is incapable of iron coordination. Following the confirmation of successful mutagenesis, these new TDO variants were tested for their ability to catalyze the cis-dihydroxylation of a diverse group of potential aromatic substrates through a fluorescence-based assay system (30). The results of this study demonstrated the critical role played by the iron-coordinating residues of Rieske dioxygenases in their native state. These results revealed that any alteration of these residues, either to other residues with the potential for iron-coordination or to a residue incapable of coordinating iron, result- ed in a complete loss of cis-dihydroxylation activity for any of the classes of substrates tested in this study. Although this study did not produce any Rieske dioxygenase variants with improved or altered cis-dihydroxylation activity, the findings of this study will serve to inform future engineering studies targeting these enzymes. Based on these results, it is clear that any attempts to engineer novel variants of Rieske dioxygenases should make every effort to preserve the iron-coordinating residues in their native state. Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 103 Acknowledgements This material is based upon work supported by the National Science Foundation under Grant No. 2147098 (Research in Undergraduate Insti- tutions) and by the Ball State University Junior Faculty ASPiRE grant program. This work was made possible in part by the Ball State Univer- sity Provost Start-Up program. Author Correspondence Correspondence concerning this article should be addressed to: Jordan T. Froese, jtfroese@ bsu.edu. mailto:jtfroese%40bsu.edu?subject= mailto:jtfroese%40bsu.edu?subject= Fine Focus | Volume 10104 References 1. Ang, E. L., Obbard, J. P., & Zhao, H. M. (2009) Directed evolution of aniline dioxygenase for enhanced bioremediation of aromatic amines. Applied Microbiology and Biotechnology, 81, 1063-1070. https://doi.org/10.1007/s-00253-008-1710-0 2. Bagneris, C.; Cammack, R.; & Mason, J. R. (2005) Subtle Difference between Benzene and Toluene Dioxygenases of Pseudomonas putida. Applied and Environmental Microbiology, 71, 1570-1580. https://doi.org/10.1128/AEM.71.3.1570-1580.2005 3. Bernath-Levin, K., Shainsky, J., Sigawi, L., & Fishman, A. (2014) Directed evolution of nitroben- zene dioxygenase for the synthesis of the antioxidant hydroxytyrosol. Applied Microbiology and Biotechnology, 98, 4975-4985. https://doi.org/10.1007/s00253-013-5505-6 4. Bolden, A. L., Kwiatkowski, C. F., & Colborn, T. (2015) New Look at BTEX: Are Ambient Levels a Problem? Environmental Science and Technology, 49, 5261-5276. https://doi.org/10.1021/es505316f 5. Brimberry, M., Garcia, A. A., Liu, J., Tian, J., & Bridwell-Rabb, J. (2023) Engineering Rieske oxygenase activity one piece at a time. Current Opinion in Chemical Biology, 72, 102227. https://doi.org/10.1016/j.cbpa.2022.102227 6. Chang, H. K. & Zylstra, G. J. (1998) Novel organization of the genes for phthalate degra- dation from Burkholderia cepacia DBO1. Journal of Bacteriology, 180, 6529-6537. https://doi.org/10.1128/JB.180.24.6529-6537.1998 7. Cipolatti, E. P., Pinto, M. C. C., Henriques, R. O., Pinto, J. C. C., Castro, A. M., Freire, D. M. G., & Manoel, E. A. (2019) in Advances in Enzyme Technology (Eds.: Singh, R. S.; Singhania, R. R.; Pandey, A.; Larroche, C.) Amsterdam: Elsevier, p. 137-151. 8. Endoma, M. A., Bui, V. P., Hansen, J., Hudlicky, T. (2002) Medium-scale preparation of useful metabolites of aromatic compounds via whole-cell fermentation with recombinant organisms. Organic Process Research and Development, 6, 525-532. https://doi.org/10.1021/op020013s 9. Friemann, R., Lee, K., Brown, E. N., Gibson, D. T., Eklund, H., & Ramaswamy, S. (2009) Struc- tures of the multicomponent Rieske non-heme iron toluene 2,3-dioxygenase enzyme system. Acta Crystallographica, D65, 24. https://doi.org/10.1107/S0907444908036524 10. Froese, J., Endoma-Arias, M.-A., Hudlicky, T. (2014) Processing of o-halobenzoates by toluene dioxygenase. The role of the alkoxy functionality in the regioselectivity of the enzymatic dihydroxylation reaction. Organic Process Research and Development, 18, 801–809. https://doi.org/10.1021/op400343c https://doi.org/10.1007/s-00253-008-1710-0 https://doi.org/10.1021/es505316f https://doi.org/10.1007/s00253-013-5505-6 https://doi.org/10.1021/es505316f https://doi.org/10.1021/es505316f https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.1021/op400343c Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 105 11. a) Gally, C., Nestl, B. M., & Hauer, B. (2015) Engineering rieske non-heme iron oxygenases for the asymmetric dihydroxylation of alkenes. Angewandte Chemie, International Edition, 54, 12952-12956. https://doi.org/10.1002/anie.201506527; b) Halder, J. M., Nestl, B. M., & Hauer, B. (2018) Semirational engineering of the naphthalene dioxygenase from Pseudomo- nas sp. NCIB 9816-4 towards selective asymmetric dihydroxylation. ChemCatChem, 10, 178. https://doi.org/10.1002/cctc.201701262; c) Heinemann, P. M., Armbruster, D., & Hauer, B. (2021) Active-site loop variations adjust activity and selectivity of the cumene dioxygenase. Nature Communications, 12, 1095. https://doi.org/10.1038/s41467-021-21328-8; d) Wissner, J. L., Escobedo-Hinojosa, W., Vogel, A., & Hauer, B. (2021) An engineered toluene dioxygen- ase for a single step biocatalytical production of (-)-(1S,2R)-cis-1,2-dihydro-1,2-naphthalene- diol. Journal of Biotechnology, 326, 37-39. https://doi.org/10.1016/j.jbiotec.2020.12.007; e) Wissner, J. L., Schelle, J. T., Escobedo-Hinojosa, W., Vogel, A., & Hauer, B. (2021) Semi-ra- tional engineering of toluene dioxygenase from Pseudomonas putida F1 towards oxyfunc- tionalization of Bicyclic Aromatics. Advanced Synthesis and Catalysis, 363, 37, 4905-4914. https://doi.org/10.1002/adsc.202100296 12. Gibson, D. T., Koch, J. R., Schuld, C. L., & Kallio, R.E. (1968) Oxidative degradation of aromatic hydrocarbons by microorganisms. II. Metabolism of halogenated aromatic hydrocarbons. Biochemistry, 7, 3795-3802. https://doi.org/10.1021/bi00851a003 13. Goddard, T. D., Huang, C. C., Meng, E. C., Pettersen, E. F., Couch, G. S., Morris, J. H., & Ferrin, T. E. (2018) UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Science, 27, 14–25. https://doi.org/10.1002/pro.3235 14. Gómez-Gil, L., Kumar, P., Barriault, D., Bolin, J. T., Sylvestre, M., & Eltis, L. D. (2007) Characterization of biphenyl dioxygenase of Pandoraea pnomenusa B-356 as a potent polychlorinated biphenyl-degrading enzyme. Journal of Bacteriology, 189, 5705-5715. https://doi.org/10.1128/JB.01476-06 15. Gujral, S. S., Sheela, M. A., Khatri, S. K., & Singla, R. A. (2012) Focus & Review on the Advance- ment of Green Chemistry. Indo Global Journal of Pharmaceutical Sciences, 2, 397–408. https://doi.org/10.35652/IGJPS.2012.46 16. Hudlicky, T., & Reed, J. W. (2009) Celebrating 20 years of SYNLETT - Special account on the merits of biocatalysis and the impact of arene cis-dihydrodiols on enantioselective synthesis. Synlett, 5, 685-703. https://doi.org/10.1055/s-0028-1087946 17. Iwai, S., Chai, B., Sul, W. J., Cole, J. R., Hashsham, S. A., & Tiedje, J. M. (2010) Gene-target- ed-metagenomics reveals extensive diversity of aromatic dioxygenase genes in the environ- ment. The ISME Journal, 4, 279-285. https://doi.org/10.1038/ismej.2009.104 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.1038/s41467-021-21328-8 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/ https://doi.org/ https://doi.org/10.1128/JB.01476-06 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 Fine Focus | Volume 10106 18. Karlsson, A., Parales, J. V., Parales, R. E., Gibson, D. T., Eklund, H., & Ramaswamy, S. (2003) Crystal structure of naphthalene dioxygenase: side-on binding of dioxygen to iron. Science, 299, 1039-1042. https://doi.org/10.1126/science.1078020 19. Kätelhöhn, A., Meys, R., Deutz, S., Suh, S., & Bardow, A. (2019) Climate change mitigation potential of carbon capture and utilization in the chemical industry. Proceedings of the National Academy of Science USA, 116, 11187-11194. https://doi.org/10.1073/pnas.1821029116 20. Kim, D., Yoo, M., Choi, K. Y., Kang, B. S., & Kim, E. (2013) Characterization and engineering of an o-xylene dioxygenase for biocatalytic applications. Bioresource Technology, 145, 123-127. https://doi.org/10.1016/j.biortech.2013.03.034 21. a) Kimura, N., Nishi, A., Goto, M., & Furukawa, K. (1997) Functional analyses of a variety of chimeric dioxygenases constructed from two biphenyl dioxygenases that are similar structurally but different functionally. Journal of Bacteriology, 179, 3936-3943. https://doi.org/10.1128/jb.179.12.3936-3943.1997; b) Kumamaru, T., Suenaga, H., Mitsuoka, M., Watanabe, T., Furukawa, K. (1998) Enhanced degradation of polychlorinated biphe- nyls by directed evolution of biphenyl dioxygenase. Nature Biotechnology, 16, 663-666. https://doi.org/10.1038/nbt0798-663 22. Lessner, D. J., Johnson, G. R., Parales, R. E., Spain, J. C., Gibson, D. T. (2002) Molec- ular characterization and substrate specificity of nitrobenzene dioxygenase from Comamonas sp. strain JS765. Applied and Environmental Microbiology, 68, 634-641. https://doi.org/10.1128/AEM.68.2.634-641.2002 23. Lewis, S. E. (2016) in Asymmetric Dearomatization Under Enzymatic Conditions (Ed. You, S.-L.), Chichester: Wiley, p. 279-346. 24. Liu, H., Naismith, J. H. (2008) An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnology, 8, 91. https://doi.org/10.1186/1472-6750-8-91 25. Moretti, S., Armougom, F., Wallace, I. M., Higgins, D. G., Jongeneel, C. V., & Notredame, C. (2007) The M-Coffee web server: a meta-method for computing multiple sequence alignments by combining alternative alignment methods. Nucleic Acids Research, 35, W645-W648. https://doi.org/10.1093/nar/gkm333 26. Newman, L. M., Garcia, H., Hudlicky, T., & Selifonov, S. A. (2004) Directed evolution of the dioxygenase complex for the synthesis of furanone flavor compounds. Tetrahedron, 60, 729-734. https://doi.org/10.1016/j.tet.2003.10.105 27. Osifalujo, E. A., Preston-Herrera, C., Betts, P. C., Satterwhite, L. R., & Froese, J. T. (2022) Improving toluene dioxygenase activity for ester-functionalized substrates through enzyme engineering. ChemistrySelect, 7, e202200753. https://doi.org/10.1002/slct.202200753 https://doi.org/10.3390/molecules26113431 https://doi.org/10.1073/pnas.1821029116 https://doi.org/10.3390/molecules26113431 https://doi.org/10.1128/jb.179.12.3936-3943.1997 https://doi.org/10.1038/nbt0798-663 https://doi.org/10.1128/AEM.68.2.634-641.2002 https://doi.org/10.1186/1472-6750-8-91 https://doi.org/10.1002/slct.202200753 https://doi.org/10.1016/j.tet.2003.10.105 https://doi.org/10.1002/slct.202200753 Betts & Froese | Investigation of the Effects of Mutating Iron-Coordinating Residues in Rieske Dioxygenases 107 28. Parales R.E., & Resnick S.M. (2007) in Biodegradation and Bioremediation. Soil Biology, Vol 2. (Eds. Singh, A.; Ward, O. P.) Berlin: Springer, p. 175-195. 29. Pott, M., Tinzl, M., Hayashi, T., Ota, Y., Dunkelmann, D., Mittl, P. R. E., & Hilvert, D. (2021) Noncanonical heme ligands steer carbene transfer reactivity in an artifi- cial metalloenzyme. Angewandte Chemie International Edition, 27, 15063-15068. https://doi.org/10.1002/anie.202103437 30. Preston-Herrera, C., Jackson, A. S., Bachmann, B. O., & Froese, J. T. (2021) Development and Application of a High Throughput Assay System for the Detection of Rieske Dioxygenase Activity. Organic and Biomolecular Chemistry, 19, 775-784. https://doi.org/10.1039/ D0OB02412K 31. Robert, X., & Gouet, P. (2014) Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Research, 42, W320-W324. https://doi.org/10.1093/nar/gku316 32. Saito, A., Iwabuchi, T., Harayama, S. (2000) A novel phenanthrene dioxygenase from Nocardi- oides sp. strain KP7: expression in Escherichia coli. Journal of Bacteriology, 182, 2134-2141. https://doi.org/10.1128/JB.182.8.2134-2141.2000 33. Sakamoto, T., Joern, J. M., Arisawa, A., & Arnold, F. H. (2001) Laboratory evolution of toluene dioxygenase to accept 4-picoline as a substrate. Applied and Environmental Microbiology, 67, 3882-3887. https://doi.org/10.1128/AEM.67.9.3882-3887.2001 34. Sharma, P., Kumar, M., Sharma, A., Arora, D., Patial, A., & Rana, M. (2020) An overview on green chemistry. World Journal of Pharmacy and Pharmaceutical Sciences, 8, 202-208. https://doi.org/10.20959/wjpps20195-13602 35. Sheldrake, G. N. (1992) in Chirality in Industry: the commercial manufacture and application of optically active compounds (Ed. A. N. Collins, G. N. Sheldrake, J. Crosby) Chichester: John Wiley & Sons Ltd, pp. 127–166. 36. Van Geem, K. M., Galvita, V. V., & Marin, G. B. (2019) Making chemicals with electricity. Science, 364, 734-735. https://doi.org/10.1126/science.aax5179 37. Vila, M. A., Umpierrez, D., Veiga, N., Seoane, G., Carrera, I., & Giordano, S. R. (2017) Site-Di- rected Mutagenesis Studies on the Toluene Dioxygenase Enzymatic System: Role of Phenyl- alanine 366, Threonine 365 and Isoleucine 324 in the Chemo-, Regio-, and Stereoselectivity. Advanced Synthesis and Catalysis, 359, 2149-2157. https://doi.org/10.1002/adsc.201700444 38. Wang, Y., Sun, C., Min, J., Li, B., Li, J., Chen, W., Kong, Y. & Hu, X. (2021) The engineered biphe- nyl dioxygenases enhanced the metabolism of dibenzofuran. International Biodeterioration and Biodegradation, 161, 105228. https://doi.org/10.1016/j.ibiod.2021.105228 https://doi.org/10.1002/slct.202200753 https://doi.org/10.1039/D0OB02412K https://doi.org/10.1039/D0OB02412K https://doi.org/10.1039/D0OB02412K https://doi.org/10.1128/JB.182.8.2134-2141.2000 https://doi.org/10.1128/AEM.67.9.3882-3887.2001 https://doi.org/ https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 Fine Focus | Volume 10108 39. Williams, P. A., & Sayers, J. R. (1994) The evolution of pathways for aromatic hydrocarbon oxida- tion in Pseudomonas. Biodegradation, 5, 195–217. https://doi.org/10.1007/BF00696460 40. Yang, Y., & Arnold, F. A. (2021) Navigating the unnatural reaction space: directed evolution of heme proteins for selective carbene and nitrene transfer. Accounts of Chemical Research, 5, 1209-1225. https://doi.org/10.1021/acs.accounts.0c00591 41. Zheng, L., Baumann, U., Reymond, J. L. (2004) An efficient one-step site-direct- ed and site-saturation mutagenesis protocol. Nucleic Acids Research, 32, e115. https://doi.org/10.1093/nar/gnh110 42. Zylstra, G., & Gibson, D.T. (1989) Toluene degradation by Pseudomonas putida F1. Nucleotide sequence of the todC1C2BADE genes and their expression in Escherichia coli. Journal of Biological Chemistry, 264, 14940-14946. https://doi.org/10.1016/S0021-9258(18)63793-7 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431 https://doi.org/10.3390/molecules26113431