id	sid	tid	token	lemma	pos
fnp-5188	1	1	blocking	block	VERB
fnp-5188	1	2	tgf	tgf	PROPN
fnp-5188	1	3	-	-	PUNCT
fnp-5188	1	4	βand	βand	NOUN
fnp-5188	1	5	epithelial	epithelial	ADJ
fnp-5188	1	6	-	-	PUNCT
fnp-5188	1	7	to	to	ADP
fnp-5188	1	8	-	-	PUNCT
fnp-5188	1	9	mesenchymal	mesenchymal	NOUN
fnp-5188	1	10	transition	transition	NOUN
fnp-5188	1	11	(	(	PUNCT
fnp-5188	1	12	emt)-mediated	emt)-mediate	VERB
fnp-5188	1	13	activation	activation	NOUN
fnp-5188	1	14	of	of	ADP
fnp-5188	1	15	vessel	vessel	NOUN
fnp-5188	1	16	-	-	PUNCT
fnp-5188	1	17	associated	associate	VERB
fnp-5188	1	18	mural	mural	ADJ
fnp-5188	1	19	cells	cell	NOUN
fnp-5188	1	20	in	in	ADP
fnp-5188	1	21	glioblastoma	glioblastoma	NOUN
fnp-5188	1	22	impacts	impact	NOUN
fnp-5188	1	23	tumor	tumor	NOUN
fnp-5188	1	24	angiogenesis	angiogenesis	NOUN
fnp-5188	1	25	feel	feel	VERB
fnp-5188	1	26	free	free	ADJ
fnp-5188	1	27	to	to	PART
fnp-5188	1	28	add	add	VERB
fnp-5188	1	29	comments	comment	NOUN
fnp-5188	1	30	by	by	ADP
fnp-5188	1	31	clicking	click	VERB
fnp-5188	1	32	these	these	DET
fnp-5188	1	33	icons	icon	NOUN
fnp-5188	1	34	on	on	ADP
fnp-5188	1	35	the	the	DET
fnp-5188	1	36	sidebar	sidebar	NOUN
fnp-5188	1	37	free	free	ADJ
fnp-5188	1	38	neuropathology	neuropathology	PROPN
fnp-5188	1	39	5:4	5:4	NUM
fnp-5188	1	40	(	(	PUNCT
fnp-5188	1	41	2024	2024	NUM
fnp-5188	1	42	)	)	PUNCT
fnp-5188	1	43	original	original	ADJ
fnp-5188	1	44	paper	paper	NOUN
fnp-5188	1	45	blocking	block	VERB
fnp-5188	1	46	tgf	tgf	PROPN
fnp-5188	1	47	-	-	PUNCT
fnp-5188	1	48	βand	βand	NOUN
fnp-5188	1	49	epithelial	epithelial	ADJ
fnp-5188	1	50	-	-	PUNCT
fnp-5188	1	51	to	to	ADP
fnp-5188	1	52	-	-	PUNCT
fnp-5188	1	53	mesenchymal	mesenchymal	NOUN
fnp-5188	1	54	transition	transition	NOUN
fnp-5188	1	55	(	(	PUNCT
fnp-5188	1	56	emt)-mediated	emt)-mediate	VERB
fnp-5188	1	57	activation	activation	NOUN
fnp-5188	1	58	of	of	ADP
fnp-5188	1	59	vessel	vessel	NOUN
fnp-5188	1	60	-	-	PUNCT
fnp-5188	1	61	associated	associate	VERB
fnp-5188	1	62	mural	mural	ADJ
fnp-5188	1	63	cells	cell	NOUN
fnp-5188	1	64	in	in	ADP
fnp-5188	1	65	glioblastoma	glioblastoma	NOUN
fnp-5188	1	66	impacts	impact	NOUN
fnp-5188	1	67	tumor	tumor	NOUN
fnp-5188	1	68	angiogenesis	angiogenesis	NOUN
fnp-5188	1	69	luisa	luisa	PROPN
fnp-5188	1	70	merk1	merk1	PROPN
fnp-5188	1	71	,	,	PUNCT
fnp-5188	1	72	katja	katja	PROPN
fnp-5188	1	73	regel1	regel1	PROPN
fnp-5188	1	74	,	,	PUNCT
fnp-5188	1	75	hermann	hermann	PROPN
fnp-5188	1	76	eckhardt1	eckhardt1	PROPN
fnp-5188	1	77	,	,	PUNCT
fnp-5188	1	78	marietheres	mariethere	NOUN
fnp-5188	1	79	evers1	evers1	PROPN
fnp-5188	1	80	,	,	PUNCT
fnp-5188	1	81	ali	ali	PROPN
fnp-5188	1	82	el	el	PROPN
fnp-5188	1	83	-	-	PROPN
fnp-5188	1	84	ayoubi1	ayoubi1	PROPN
fnp-5188	1	85	,	,	PUNCT
fnp-5188	1	86	michel	michel	PROPN
fnp-5188	1	87	mittelbronn2	mittelbronn2	PROPN
fnp-5188	1	88	-	-	PUNCT
fnp-5188	1	89	7	7	PROPN
fnp-5188	1	90	,	,	PUNCT
fnp-5188	1	91	marcel	marcel	PROPN
fnp-5188	1	92	krüger8	krüger8	PROPN
fnp-5188	1	93	,	,	PUNCT
fnp-5188	1	94	jean	jean	PROPN
fnp-5188	1	95	-	-	PUNCT
fnp-5188	1	96	jacques	jacques	PROPN
fnp-5188	1	97	gérardy3,7	gérardy3,7	PROPN
fnp-5188	1	98	,	,	PUNCT
fnp-5188	1	99	andreas	andreas	PROPN
fnp-5188	1	100	f.	f.	PROPN
fnp-5188	1	101	mack9	mack9	PROPN
fnp-5188	1	102	,	,	PUNCT
fnp-5188	1	103	ulrike	ulrike	PROPN
fnp-5188	1	104	naumann1	naumann1	NOUN
fnp-5188	1	105	,	,	PUNCT
fnp-5188	1	106	10	10	NUM
fnp-5188	1	107	molecular	molecular	ADJ
fnp-5188	1	108	neuro	neuro	NOUN
fnp-5188	1	109	-	-	PUNCT
fnp-5188	1	110	oncology	oncology	NOUN
fnp-5188	1	111	,	,	PUNCT
fnp-5188	1	112	department	department	NOUN
fnp-5188	1	113	of	of	ADP
fnp-5188	1	114	vascular	vascular	ADJ
fnp-5188	1	115	neurology	neurology	NOUN
fnp-5188	1	116	,	,	PUNCT
fnp-5188	1	117	hertie	hertie	PROPN
fnp-5188	1	118	institute	institute	PROPN
fnp-5188	1	119	for	for	ADP
fnp-5188	1	120	clinical	clinical	ADJ
fnp-5188	1	121	brain	brain	NOUN
fnp-5188	1	122	research	research	NOUN
fnp-5188	1	123	and	and	CCONJ
fnp-5188	1	124	center	center	NOUN
fnp-5188	1	125	neurology	neurology	NOUN
fnp-5188	1	126	,	,	PUNCT
fnp-5188	1	127	university	university	NOUN
fnp-5188	1	128	hospital	hospital	NOUN
fnp-5188	1	129	of	of	ADP
fnp-5188	1	130	tübingen	tübingen	PROPN
fnp-5188	1	131	,	,	PUNCT
fnp-5188	1	132	germany	germany	PROPN
fnp-5188	1	133	department	department	PROPN
fnp-5188	1	134	of	of	ADP
fnp-5188	1	135	cancer	cancer	PROPN
fnp-5188	1	136	research	research	NOUN
fnp-5188	1	137	(	(	PUNCT
fnp-5188	1	138	docr	docr	ADJ
fnp-5188	1	139	)	)	PUNCT
fnp-5188	1	140	,	,	PUNCT
fnp-5188	1	141	luxembourg	luxembourg	PROPN
fnp-5188	1	142	institute	institute	PROPN
fnp-5188	1	143	of	of	ADP
fnp-5188	1	144	health	health	PROPN
fnp-5188	1	145	(	(	PUNCT
fnp-5188	1	146	lih	lih	PROPN
fnp-5188	1	147	)	)	PUNCT
fnp-5188	1	148	,	,	PUNCT
fnp-5188	1	149	luxembourg	luxembourg	PROPN
fnp-5188	1	150	luxembourg	luxembourg	PROPN
fnp-5188	1	151	centre	centre	PROPN
fnp-5188	1	152	of	of	ADP
fnp-5188	1	153	neuropathology	neuropathology	NOUN
fnp-5188	1	154	(	(	PUNCT
fnp-5188	1	155	lcnp	lcnp	NOUN
fnp-5188	1	156	)	)	PUNCT
fnp-5188	1	157	,	,	PUNCT
fnp-5188	1	158	luxembourg	luxembourg	PROPN
fnp-5188	1	159	luxembourg	luxembourg	PROPN
fnp-5188	1	160	centre	centre	PROPN
fnp-5188	1	161	for	for	ADP
fnp-5188	1	162	systems	system	NOUN
fnp-5188	1	163	biomedicine	biomedicine	NOUN
fnp-5188	1	164	(	(	PUNCT
fnp-5188	1	165	lcsb	lcsb	PROPN
fnp-5188	1	166	)	)	PUNCT
fnp-5188	1	167	,	,	PUNCT
fnp-5188	1	168	university	university	NOUN
fnp-5188	1	169	of	of	ADP
fnp-5188	1	170	luxembourg	luxembourg	PROPN
fnp-5188	1	171	,	,	PUNCT
fnp-5188	1	172	luxembourg	luxembourg	PROPN
fnp-5188	1	173	department	department	PROPN
fnp-5188	1	174	of	of	ADP
fnp-5188	1	175	life	life	PROPN
fnp-5188	1	176	sciences	sciences	PROPN
fnp-5188	1	177	and	and	CCONJ
fnp-5188	1	178	medicine	medicine	NOUN
fnp-5188	1	179	(	(	PUNCT
fnp-5188	1	180	dlsm	dlsm	PROPN
fnp-5188	1	181	)	)	PUNCT
fnp-5188	1	182	,	,	PUNCT
fnp-5188	1	183	university	university	NOUN
fnp-5188	1	184	of	of	ADP
fnp-5188	1	185	luxembourg	luxembourg	PROPN
fnp-5188	1	186	,	,	PUNCT
fnp-5188	1	187	esch	esch	PROPN
fnp-5188	1	188	-	-	PUNCT
fnp-5188	1	189	sur	sur	PROPN
fnp-5188	1	190	-	-	PUNCT
fnp-5188	1	191	alzette	alzette	PROPN
fnp-5188	1	192	,	,	PUNCT
fnp-5188	1	193	luxembourg	luxembourg	PROPN
fnp-5188	1	194	faculty	faculty	NOUN
fnp-5188	1	195	of	of	ADP
fnp-5188	1	196	science	science	NOUN
fnp-5188	1	197	,	,	PUNCT
fnp-5188	1	198	technology	technology	NOUN
fnp-5188	1	199	and	and	CCONJ
fnp-5188	1	200	medicine	medicine	NOUN
fnp-5188	1	201	(	(	PUNCT
fnp-5188	1	202	fstm	fstm	PROPN
fnp-5188	1	203	)	)	PUNCT
fnp-5188	1	204	,	,	PUNCT
fnp-5188	1	205	university	university	NOUN
fnp-5188	1	206	of	of	ADP
fnp-5188	1	207	luxembourg	luxembourg	PROPN
fnp-5188	1	208	,	,	PUNCT
fnp-5188	1	209	esch	esch	PROPN
fnp-5188	1	210	-	-	PUNCT
fnp-5188	1	211	sur	sur	PROPN
fnp-5188	1	212	-	-	PUNCT
fnp-5188	1	213	alzette	alzette	PROPN
fnp-5188	1	214	,	,	PUNCT
fnp-5188	1	215	luxembourg	luxembourg	PROPN
fnp-5188	1	216	national	national	PROPN
fnp-5188	1	217	center	center	PROPN
fnp-5188	1	218	of	of	ADP
fnp-5188	1	219	pathology	pathology	NOUN
fnp-5188	1	220	(	(	PUNCT
fnp-5188	1	221	ncp	ncp	PROPN
fnp-5188	1	222	)	)	PUNCT
fnp-5188	1	223	,	,	PUNCT
fnp-5188	1	224	laboratoire	laboratoire	PROPN
fnp-5188	1	225	nationale	nationale	PROPN
fnp-5188	1	226	de	de	X
fnp-5188	1	227	santé	santé	X
fnp-5188	1	228	(	(	PUNCT
fnp-5188	1	229	lns	lns	PROPN
fnp-5188	1	230	)	)	PUNCT
fnp-5188	1	231	,	,	PUNCT
fnp-5188	1	232	luxembourg	luxembourg	PROPN
fnp-5188	1	233	department	department	PROPN
fnp-5188	1	234	of	of	ADP
fnp-5188	1	235	preclinical	preclinical	ADJ
fnp-5188	1	236	imaging	imaging	NOUN
fnp-5188	1	237	and	and	CCONJ
fnp-5188	1	238	radiopharmacy	radiopharmacy	NOUN
fnp-5188	1	239	,	,	PUNCT
fnp-5188	1	240	university	university	NOUN
fnp-5188	1	241	of	of	ADP
fnp-5188	1	242	tübingen	tübingen	PROPN
fnp-5188	1	243	,	,	PUNCT
fnp-5188	1	244	tübingen	tübingen	PROPN
fnp-5188	1	245	,	,	PUNCT
fnp-5188	1	246	germany	germany	PROPN
fnp-5188	1	247	institute	institute	PROPN
fnp-5188	1	248	for	for	ADP
fnp-5188	1	249	clinical	clinical	ADJ
fnp-5188	1	250	anatomy	anatomy	NOUN
fnp-5188	1	251	and	and	CCONJ
fnp-5188	1	252	cell	cell	NOUN
fnp-5188	1	253	analytics	analytic	NOUN
fnp-5188	1	254	,	,	PUNCT
fnp-5188	1	255	university	university	NOUN
fnp-5188	1	256	of	of	ADP
fnp-5188	1	257	tübingen	tübingen	PROPN
fnp-5188	1	258	,	,	PUNCT
fnp-5188	1	259	germany	germany	PROPN
fnp-5188	1	260	gene	gene	NOUN
fnp-5188	1	261	and	and	CCONJ
fnp-5188	1	262	rna	rna	NOUN
fnp-5188	1	263	therapy	therapy	NOUN
fnp-5188	1	264	center	center	NOUN
fnp-5188	1	265	(	(	PUNCT
fnp-5188	1	266	grtc	grtc	PROPN
fnp-5188	1	267	)	)	PUNCT
fnp-5188	1	268	,	,	PUNCT
fnp-5188	1	269	faculty	faculty	NOUN
fnp-5188	1	270	of	of	ADP
fnp-5188	1	271	medicine	medicine	PROPN
fnp-5188	1	272	university	university	PROPN
fnp-5188	1	273	tübingen	tübingen	PROPN
fnp-5188	1	274	,	,	PUNCT
fnp-5188	1	275	germany	germany	PROPN
fnp-5188	1	276	corresponding	corresponding	ADJ
fnp-5188	1	277	author	author	NOUN
fnp-5188	1	278	:	:	PUNCT
fnp-5188	1	279	ulrike	ulrike	ADJ
fnp-5188	1	280	naumann	naumann	X
fnp-5188	1	281	·	·	PUNCT
fnp-5188	1	282	molecular	molecular	ADJ
fnp-5188	1	283	neuro	neuro	NOUN
fnp-5188	1	284	-	-	PUNCT
fnp-5188	1	285	oncology	oncology	NOUN
fnp-5188	1	286	·	·	PUNCT
fnp-5188	1	287	department	department	NOUN
fnp-5188	1	288	of	of	ADP
fnp-5188	1	289	vascular	vascular	ADJ
fnp-5188	1	290	neurology	neurology	NOUN
fnp-5188	1	291	·	·	PUNCT
fnp-5188	1	292	hertie	hertie	PROPN
fnp-5188	1	293	institute	institute	NOUN
fnp-5188	1	294	for	for	ADP
fnp-5188	1	295	clinical	clinical	ADJ
fnp-5188	1	296	brain	brain	NOUN
fnp-5188	1	297	research	research	NOUN
fnp-5188	1	298	and	and	CCONJ
fnp-5188	1	299	center	center	ADJ
fnp-5188	1	300	neurology	neurology	NOUN
fnp-5188	1	301	·	·	PUNCT
fnp-5188	1	302	university	university	NOUN
fnp-5188	1	303	hospital	hospital	NOUN
fnp-5188	1	304	of	of	ADP
fnp-5188	1	305	tübingen	tübingen	X
fnp-5188	1	306	·	·	PUNCT
fnp-5188	1	307	hoppe	hoppe	PROPN
fnp-5188	1	308	-	-	PUNCT
fnp-5188	1	309	seyler	seyler	NOUN
fnp-5188	1	310	-	-	PUNCT
fnp-5188	1	311	straße	straße	NOUN
fnp-5188	1	312	3	3	NUM
fnp-5188	1	313	·	·	SYM
fnp-5188	1	314	72076	72076	NUM
fnp-5188	1	315	tübingen	tübingen	PROPN
fnp-5188	1	316	·	·	PUNCT
fnp-5188	1	317	germany	germany	PROPN
fnp-5188	1	318	ulrike.naumann@uni-tuebingen.de	ulrike.naumann@uni-tuebingen.de	PRON
fnp-5188	1	319	additional	additional	ADJ
fnp-5188	1	320	resources	resource	NOUN
fnp-5188	1	321	and	and	CCONJ
fnp-5188	1	322	electronic	electronic	ADJ
fnp-5188	1	323	supplementary	supplementary	ADJ
fnp-5188	1	324	material	material	NOUN
fnp-5188	1	325	:	:	PUNCT
fnp-5188	1	326	supplementary	supplementary	ADJ
fnp-5188	1	327	material	material	NOUN
fnp-5188	1	328	submitted	submit	VERB
fnp-5188	1	329	:	:	PUNCT
fnp-5188	1	330	10	10	NUM
fnp-5188	1	331	november	november	PROPN
fnp-5188	1	332	2023	2023	NUM
fnp-5188	1	333	accepted	accept	VERB
fnp-5188	1	334	:	:	PUNCT
fnp-5188	1	335	07	07	NUM
fnp-5188	1	336	february	february	PROPN
fnp-5188	1	337	2024	2024	NUM
fnp-5188	1	338	copyedited	copyedit	VERB
fnp-5188	1	339	by	by	ADP
fnp-5188	1	340	:	:	PUNCT
fnp-5188	1	341	joão	joão	PROPN
fnp-5188	1	342	gama	gama	PROPN
fnp-5188	1	343	published	publish	VERB
fnp-5188	1	344	:	:	PUNCT
fnp-5188	1	345	01	01	NUM
fnp-5188	1	346	march	march	PROPN
fnp-5188	1	347	2024	2024	NUM
fnp-5188	1	348	https://doi.org/10.17879/freeneuropathology-2024-5188	https://doi.org/10.17879/freeneuropathology-2024-5188	PROPN
fnp-5188	1	349	keywords	keyword	NOUN
fnp-5188	1	350	:	:	PUNCT
fnp-5188	1	351	glioblastoma	glioblastoma	NOUN
fnp-5188	1	352	,	,	PUNCT
fnp-5188	1	353	tumor	tumor	NOUN
fnp-5188	1	354	vasculature	vasculature	NOUN
fnp-5188	1	355	,	,	PUNCT
fnp-5188	1	356	pericytes	pericyte	NOUN
fnp-5188	1	357	,	,	PUNCT
fnp-5188	1	358	tgf	tgf	PROPN
fnp-5188	1	359	-	-	PUNCT
fnp-5188	1	360	β	β	PROPN
fnp-5188	1	361	,	,	PUNCT
fnp-5188	1	362	emt	emt	PROPN
fnp-5188	1	363	abstract	abstract	ADJ
fnp-5188	1	364	glioblastoma	glioblastoma	NOUN
fnp-5188	1	365	(	(	PUNCT
fnp-5188	1	366	gbm	gbm	PROPN
fnp-5188	1	367	)	)	PUNCT
fnp-5188	1	368	is	be	AUX
fnp-5188	1	369	the	the	DET
fnp-5188	1	370	most	most	ADV
fnp-5188	1	371	common	common	ADJ
fnp-5188	1	372	malignant	malignant	ADJ
fnp-5188	1	373	primary	primary	ADJ
fnp-5188	1	374	brain	brain	NOUN
fnp-5188	1	375	tumor	tumor	NOUN
fnp-5188	1	376	in	in	ADP
fnp-5188	1	377	adults	adult	NOUN
fnp-5188	1	378	.	.	PUNCT
fnp-5188	2	1	gbm	gbm	NOUN
fnp-5188	2	2	displays	display	NOUN
fnp-5188	2	3	excessive	excessive	ADJ
fnp-5188	2	4	and	and	CCONJ
fnp-5188	2	5	unfunctional	unfunctional	ADJ
fnp-5188	2	6	vascularization	vascularization	NOUN
fnp-5188	2	7	which	which	PRON
fnp-5188	2	8	may	may	AUX
fnp-5188	2	9	,	,	PUNCT
fnp-5188	2	10	among	among	ADP
fnp-5188	2	11	others	other	NOUN
fnp-5188	2	12	,	,	PUNCT
fnp-5188	2	13	be	be	AUX
fnp-5188	2	14	a	a	DET
fnp-5188	2	15	reason	reason	NOUN
fnp-5188	2	16	for	for	ADP
fnp-5188	2	17	its	its	PRON
fnp-5188	2	18	devastating	devastating	ADJ
fnp-5188	2	19	prognosis	prognosis	NOUN
fnp-5188	2	20	.	.	PUNCT
fnp-5188	3	1	pericytes	pericyte	NOUN
fnp-5188	3	2	have	have	AUX
fnp-5188	3	3	been	be	AUX
fnp-5188	3	4	identified	identify	VERB
fnp-5188	3	5	as	as	ADP
fnp-5188	3	6	the	the	DET
fnp-5188	3	7	major	major	ADJ
fnp-5188	3	8	component	component	NOUN
fnp-5188	3	9	of	of	ADP
fnp-5188	3	10	the	the	DET
fnp-5188	3	11	irregular	irregular	ADJ
fnp-5188	3	12	vessel	vessel	NOUN
fnp-5188	3	13	structure	structure	NOUN
fnp-5188	3	14	in	in	ADP
fnp-5188	3	15	gbm	gbm	PROPN
fnp-5188	3	16	.	.	PUNCT
fnp-5188	4	1	in	in	ADP
fnp-5188	4	2	vitro	vitro	X
fnp-5188	4	3	data	datum	NOUN
fnp-5188	4	4	suggest	suggest	VERB
fnp-5188	4	5	an	an	DET
fnp-5188	4	6	epithelial	epithelial	NOUN
fnp-5188	4	7	-	-	PUNCT
fnp-5188	4	8	to	to	ADP
fnp-5188	4	9	-	-	PUNCT
fnp-5188	4	10	mesenchymal	mesenchymal	NOUN
fnp-5188	4	11	transition	transition	NOUN
fnp-5188	4	12	(	(	PUNCT
fnp-5188	4	13	emt)-like	emt)-like	INTJ
fnp-5188	4	14	activation	activation	NOUN
fnp-5188	4	15	of	of	ADP
fnp-5188	4	16	glioma	glioma	NOUN
fnp-5188	4	17	-	-	PUNCT
fnp-5188	4	18	associated	associate	VERB
fnp-5188	4	19	pericytes	pericyte	NOUN
fnp-5188	4	20	,	,	PUNCT
fnp-5188	4	21	stimulated	stimulate	VERB
fnp-5188	4	22	by	by	ADP
fnp-5188	4	23	gbm	gbm	NOUN
fnp-5188	4	24	-	-	PUNCT
fnp-5188	4	25	secreted	secrete	VERB
fnp-5188	4	26	tgf	tgf	PROPN
fnp-5188	4	27	-	-	PUNCT
fnp-5188	4	28	β	β	NOUN
fnp-5188	4	29	,	,	PUNCT
fnp-5188	4	30	to	to	PART
fnp-5188	4	31	be	be	AUX
fnp-5188	4	32	involved	involve	VERB
fnp-5188	4	33	in	in	ADP
fnp-5188	4	34	the	the	DET
fnp-5188	4	35	formation	formation	NOUN
fnp-5188	4	36	of	of	ADP
fnp-5188	4	37	a	a	DET
fnp-5188	4	38	chaotic	chaotic	ADJ
fnp-5188	4	39	and	and	CCONJ
fnp-5188	4	40	dysfunctional	dysfunctional	ADJ
fnp-5188	4	41	tumor	tumor	NOUN
fnp-5188	4	42	vasculature	vasculature	NOUN
fnp-5188	4	43	.	.	PUNCT
fnp-5188	5	1	this	this	DET
fnp-5188	5	2	study	study	NOUN
fnp-5188	5	3	investigated	investigate	VERB
fnp-5188	5	4	whether	whether	SCONJ
fnp-5188	5	5	tgf	tgf	PROPN
fnp-5188	5	6	-	-	PUNCT
fnp-5188	5	7	β	β	NOUN
fnp-5188	5	8	impacts	impact	VERB
fnp-5188	5	9	the	the	DET
fnp-5188	5	10	function	function	NOUN
fnp-5188	5	11	of	of	ADP
fnp-5188	5	12	vessel	vessel	NOUN
fnp-5188	5	13	associated	associate	VERB
fnp-5188	5	14	mural	mural	ADJ
fnp-5188	5	15	cells	cell	NOUN
fnp-5188	5	16	(	(	PUNCT
fnp-5188	5	17	vamcs	vamcs	NOUN
fnp-5188	5	18	)	)	PUNCT
fnp-5188	5	19	in	in	ADP
fnp-5188	5	20	vivo	vivo	NOUN
fnp-5188	5	21	via	via	ADP
fnp-5188	5	22	the	the	DET
fnp-5188	5	23	induction	induction	NOUN
fnp-5188	5	24	of	of	ADP
fnp-5188	5	25	the	the	DET
fnp-5188	5	26	emt	emt	PROPN
fnp-5188	5	27	transcription	transcription	NOUN
fnp-5188	5	28	factor	factor	NOUN
fnp-5188	5	29	slug	slug	NOUN
fnp-5188	5	30	and	and	CCONJ
fnp-5188	5	31	whether	whether	SCONJ
fnp-5188	5	32	this	this	PRON
fnp-5188	5	33	is	be	AUX
fnp-5188	5	34	associated	associate	VERB
fnp-5188	5	35	with	with	ADP
fnp-5188	5	36	the	the	DET
fnp-5188	5	37	development	development	NOUN
fnp-5188	5	38	of	of	ADP
fnp-5188	5	39	gbm	gbm	PROPN
fnp-5188	5	40	-	-	PUNCT
fnp-5188	5	41	associated	associate	VERB
fnp-5188	5	42	vascular	vascular	ADJ
fnp-5188	5	43	abnormalities	abnormality	NOUN
fnp-5188	5	44	.	.	PUNCT
fnp-5188	6	1	upon	upon	SCONJ
fnp-5188	6	2	preventing	prevent	VERB
fnp-5188	6	3	the	the	DET
fnp-5188	6	4	tgf	tgf	PROPN
fnp-5188	6	5	-	-	PUNCT
fnp-5188	6	6	β-/slug	β-/slug	PROPN
fnp-5188	6	7	-	-	PUNCT
fnp-5188	6	8	mediated	mediate	VERB
fnp-5188	6	9	emt	emt	NOUN
fnp-5188	6	10	induction	induction	NOUN
fnp-5188	6	11	in	in	ADP
fnp-5188	6	12	vamcs	vamcs	NOUN
fnp-5188	6	13	,	,	PUNCT
fnp-5188	6	14	the	the	DET
fnp-5188	6	15	number	number	NOUN
fnp-5188	6	16	of	of	ADP
fnp-5188	6	17	pdgfrβ	pdgfrβ	NOUN
fnp-5188	6	18	and	and	CCONJ
fnp-5188	6	19	αsma	αsma	VERB
fnp-5188	6	20	positive	positive	ADJ
fnp-5188	6	21	cells	cell	NOUN
fnp-5188	6	22	was	be	AUX
fnp-5188	6	23	significantly	significantly	ADV
fnp-5188	6	24	reduced	reduce	VERB
fnp-5188	6	25	,	,	PUNCT
fnp-5188	6	26	regardless	regardless	ADV
fnp-5188	6	27	of	of	ADP
fnp-5188	6	28	whether	whether	SCONJ
fnp-5188	6	29	tgf	tgf	PROPN
fnp-5188	6	30	-	-	PUNCT
fnp-5188	6	31	β	β	PROPN
fnp-5188	6	32	secretion	secretion	NOUN
fnp-5188	6	33	by	by	ADP
fnp-5188	6	34	gbm	gbm	PROPN
fnp-5188	6	35	cells	cell	NOUN
fnp-5188	6	36	was	be	AUX
fnp-5188	6	37	blocked	block	VERB
fnp-5188	6	38	or	or	CCONJ
fnp-5188	6	39	whether	whether	SCONJ
fnp-5188	6	40	slug	slug	NOUN
fnp-5188	6	41	was	be	AUX
fnp-5188	6	42	specifically	specifically	ADV
fnp-5188	6	43	knocked	knock	VERB
fnp-5188	6	44	out	out	ADP
fnp-5188	6	45	in	in	ADP
fnp-5188	6	46	vamcs	vamcs	NOUN
fnp-5188	6	47	.	.	PUNCT
fnp-5188	7	1	the	the	DET
fnp-5188	7	2	reduced	reduce	VERB
fnp-5188	7	3	amount	amount	NOUN
fnp-5188	7	4	of	of	ADP
fnp-5188	7	5	pdgfrβ+	pdgfrβ+	ADP
fnp-5188	7	6	or	or	CCONJ
fnp-5188	7	7	αsma+	αsma+	ADP
fnp-5188	7	8	cells	cell	NOUN
fnp-5188	7	9	observed	observe	VERB
fnp-5188	7	10	under	under	ADP
fnp-5188	7	11	those	those	DET
fnp-5188	7	12	conditions	condition	NOUN
fnp-5188	7	13	correlated	correlate	VERB
fnp-5188	7	14	with	with	ADP
fnp-5188	7	15	a	a	DET
fnp-5188	7	16	lower	low	ADJ
fnp-5188	7	17	vessel	vessel	NOUN
fnp-5188	7	18	density	density	NOUN
fnp-5188	7	19	and	and	CCONJ
fnp-5188	7	20	fewer	few	ADJ
fnp-5188	7	21	vascular	vascular	ADJ
fnp-5188	7	22	abnormalities	abnormality	NOUN
fnp-5188	7	23	.	.	PUNCT
fnp-5188	8	1	our	our	PRON
fnp-5188	8	2	data	datum	NOUN
fnp-5188	8	3	provide	provide	VERB
fnp-5188	8	4	evidence	evidence	NOUN
fnp-5188	8	5	that	that	SCONJ
fnp-5188	8	6	the	the	DET
fnp-5188	8	7	slug	slug	NOUN
fnp-5188	8	8	-	-	PUNCT
fnp-5188	8	9	mediated	mediate	VERB
fnp-5188	8	10	modulation	modulation	NOUN
fnp-5188	8	11	of	of	ADP
fnp-5188	8	12	vamc	vamc	NOUN
fnp-5188	8	13	activity	activity	NOUN
fnp-5188	8	14	is	be	AUX
fnp-5188	8	15	induced	induce	VERB
fnp-5188	8	16	by	by	ADP
fnp-5188	8	17	gbm	gbm	NOUN
fnp-5188	8	18	-	-	PUNCT
fnp-5188	8	19	secreted	secrete	VERB
fnp-5188	8	20	tgf	tgf	PROPN
fnp-5188	8	21	-	-	PUNCT
fnp-5188	8	22	β	β	PROPN
fnp-5188	8	23	and	and	CCONJ
fnp-5188	8	24	that	that	SCONJ
fnp-5188	8	25	activated	activate	VERB
fnp-5188	8	26	vamcs	vamcs	NOUN
fnp-5188	8	27	are	be	AUX
fnp-5188	8	28	key	key	ADJ
fnp-5188	8	29	contributors	contributor	NOUN
fnp-5188	8	30	in	in	ADP
fnp-5188	8	31	neo	neo	NOUN
fnp-5188	8	32	-	-	NOUN
fnp-5188	8	33	angiogenic	angiogenic	ADJ
fnp-5188	8	34	processes	process	NOUN
fnp-5188	8	35	.	.	PUNCT
fnp-5188	9	1	we	we	PRON
fnp-5188	9	2	suggest	suggest	VERB
fnp-5188	9	3	that	that	SCONJ
fnp-5188	9	4	a	a	DET
fnp-5188	9	5	pathologically	pathologically	ADV
fnp-5188	9	6	altered	alter	VERB
fnp-5188	9	7	activation	activation	NOUN
fnp-5188	9	8	of	of	ADP
fnp-5188	9	9	ga	ga	PROPN
fnp-5188	9	10	-	-	PUNCT
fnp-5188	9	11	peris	peris	PROPN
fnp-5188	9	12	in	in	ADP
fnp-5188	9	13	the	the	DET
fnp-5188	9	14	tumor	tumor	NOUN
fnp-5188	9	15	microenvironment	microenvironment	NOUN
fnp-5188	9	16	is	be	AUX
fnp-5188	9	17	responsible	responsible	ADJ
fnp-5188	9	18	for	for	ADP
fnp-5188	9	19	the	the	DET
fnp-5188	9	20	unstructured	unstructured	ADJ
fnp-5188	9	21	tumor	tumor	NOUN
fnp-5188	9	22	vasculature	vasculature	NOUN
fnp-5188	9	23	.	.	PUNCT
fnp-5188	10	1	there	there	PRON
fnp-5188	10	2	is	be	VERB
fnp-5188	10	3	emerging	emerge	VERB
fnp-5188	10	4	evidence	evidence	NOUN
fnp-5188	10	5	that	that	SCONJ
fnp-5188	10	6	vessel	vessel	NOUN
fnp-5188	10	7	normalization	normalization	NOUN
fnp-5188	10	8	alleviates	alleviate	VERB
fnp-5188	10	9	tumor	tumor	NOUN
fnp-5188	10	10	hypoxia	hypoxia	NOUN
fnp-5188	10	11	,	,	PUNCT
fnp-5188	10	12	reduces	reduce	VERB
fnp-5188	10	13	tumor	tumor	NOUN
fnp-5188	10	14	-	-	PUNCT
fnp-5188	10	15	associated	associate	VERB
fnp-5188	10	16	edema	edema	NOUN
fnp-5188	10	17	and	and	CCONJ
fnp-5188	10	18	improves	improve	VERB
fnp-5188	10	19	drug	drug	NOUN
fnp-5188	10	20	delivery	delivery	NOUN
fnp-5188	10	21	.	.	PUNCT
fnp-5188	11	1	therefore	therefore	ADV
fnp-5188	11	2	,	,	PUNCT
fnp-5188	11	3	avoiding	avoid	VERB
fnp-5188	11	4	the	the	DET
fnp-5188	11	5	generation	generation	NOUN
fnp-5188	11	6	of	of	ADP
fnp-5188	11	7	an	an	DET
fnp-5188	11	8	unstructured	unstructured	ADJ
fnp-5188	11	9	and	and	CCONJ
fnp-5188	11	10	non	non	ADJ
fnp-5188	11	11	-	-	ADJ
fnp-5188	11	12	functional	functional	ADJ
fnp-5188	11	13	tumor	tumor	NOUN
fnp-5188	11	14	vasculature	vasculature	NOUN
fnp-5188	11	15	during	during	ADP
fnp-5188	11	16	tumor	tumor	NOUN
fnp-5188	11	17	recurrence	recurrence	NOUN
fnp-5188	11	18	might	might	AUX
fnp-5188	11	19	be	be	AUX
fnp-5188	11	20	a	a	DET
fnp-5188	11	21	promising	promising	ADJ
fnp-5188	11	22	treatment	treatment	NOUN
fnp-5188	11	23	approach	approach	NOUN
fnp-5188	11	24	for	for	ADP
fnp-5188	11	25	gbm	gbm	NOUN
fnp-5188	11	26	and	and	CCONJ
fnp-5188	11	27	identifies	identify	VERB
fnp-5188	11	28	pericytes	pericyte	NOUN
fnp-5188	11	29	as	as	ADP
fnp-5188	11	30	a	a	DET
fnp-5188	11	31	potential	potential	ADJ
fnp-5188	11	32	novel	novel	ADJ
fnp-5188	11	33	therapeutic	therapeutic	ADJ
fnp-5188	11	34	target	target	NOUN
fnp-5188	11	35	.	.	PUNCT
fnp-5188	12	1	introduction	introduction	NOUN
fnp-5188	12	2	glioblastoma	glioblastoma	NOUN
fnp-5188	12	3	(	(	PUNCT
fnp-5188	12	4	gbm	gbm	PROPN
fnp-5188	12	5	)	)	PUNCT
fnp-5188	12	6	is	be	AUX
fnp-5188	12	7	the	the	DET
fnp-5188	12	8	most	most	ADV
fnp-5188	12	9	common	common	ADJ
fnp-5188	12	10	malignant	malignant	ADJ
fnp-5188	12	11	primary	primary	ADJ
fnp-5188	12	12	brain	brain	NOUN
fnp-5188	12	13	tumor	tumor	NOUN
fnp-5188	12	14	in	in	ADP
fnp-5188	12	15	adults	adult	NOUN
fnp-5188	12	16	with	with	ADP
fnp-5188	12	17	an	an	DET
fnp-5188	12	18	incidence	incidence	NOUN
fnp-5188	12	19	of	of	ADP
fnp-5188	12	20	2	2	NUM
fnp-5188	12	21	to	to	PART
fnp-5188	12	22	5	5	NUM
fnp-5188	12	23	cases	case	NOUN
fnp-5188	12	24	per	per	ADP
fnp-5188	12	25	100,000	100,000	NUM
fnp-5188	12	26	people	people	NOUN
fnp-5188	12	27	in	in	ADP
fnp-5188	12	28	north	north	PROPN
fnp-5188	12	29	america	america	PROPN
fnp-5188	12	30	and	and	CCONJ
fnp-5188	12	31	europe	europe	PROPN
fnp-5188	12	32	.	.	PUNCT
fnp-5188	13	1	gbm	gbm	NOUN
fnp-5188	13	2	accounts	account	VERB
fnp-5188	13	3	for	for	ADP
fnp-5188	13	4	more	more	ADJ
fnp-5188	13	5	than	than	ADP
fnp-5188	13	6	50	50	NUM
fnp-5188	13	7	 	 	SPACE
fnp-5188	13	8	%	%	NOUN
fnp-5188	13	9	of	of	ADP
fnp-5188	13	10	primary	primary	ADJ
fnp-5188	13	11	malignant	malignant	ADJ
fnp-5188	13	12	brain	brain	NOUN
fnp-5188	13	13	tumors	tumor	NOUN
fnp-5188	13	14	.	.	PUNCT
fnp-5188	14	1	worldwide	worldwide	ADV
fnp-5188	14	2	,	,	PUNCT
fnp-5188	14	3	the	the	DET
fnp-5188	14	4	number	number	NOUN
fnp-5188	14	5	of	of	ADP
fnp-5188	14	6	new	new	ADJ
fnp-5188	14	7	cases	case	NOUN
fnp-5188	14	8	per	per	ADP
fnp-5188	14	9	year	year	NOUN
fnp-5188	14	10	can	can	AUX
fnp-5188	14	11	be	be	AUX
fnp-5188	14	12	estimated	estimate	VERB
fnp-5188	14	13	at	at	ADP
fnp-5188	14	14	around	around	ADP
fnp-5188	14	15	250,000	250,000	NUM
fnp-5188	14	16	.	.	PUNCT
fnp-5188	15	1	the	the	DET
fnp-5188	15	2	median	median	ADJ
fnp-5188	15	3	age	age	NOUN
fnp-5188	15	4	at	at	ADP
fnp-5188	15	5	diagnosis	diagnosis	NOUN
fnp-5188	15	6	is	be	AUX
fnp-5188	15	7	64	64	NUM
fnp-5188	15	8	years	year	NOUN
fnp-5188	15	9	and	and	CCONJ
fnp-5188	15	10	it	it	PRON
fnp-5188	15	11	is	be	AUX
fnp-5188	15	12	more	more	ADV
fnp-5188	15	13	common	common	ADJ
fnp-5188	15	14	in	in	ADP
fnp-5188	15	15	men	man	NOUN
fnp-5188	15	16	as	as	ADP
fnp-5188	15	17	compared	compare	VERB
fnp-5188	15	18	to	to	ADP
fnp-5188	15	19	women	woman	NOUN
fnp-5188	15	20	(	(	PUNCT
fnp-5188	15	21	for	for	ADP
fnp-5188	15	22	review	review	NOUN
fnp-5188	15	23	see	see	VERB
fnp-5188	15	24	[	[	X
fnp-5188	15	25	1	1	NUM
fnp-5188	15	26	]	]	NUM
fnp-5188	15	27	)	)	PUNCT
fnp-5188	15	28	.	.	PUNCT
fnp-5188	16	1	its	its	PRON
fnp-5188	16	2	mean	mean	ADJ
fnp-5188	16	3	progression	progression	NOUN
fnp-5188	16	4	-	-	PUNCT
fnp-5188	16	5	free	free	ADJ
fnp-5188	16	6	survival	survival	NOUN
fnp-5188	16	7	is	be	AUX
fnp-5188	16	8	just	just	ADV
fnp-5188	16	9	a	a	DET
fnp-5188	16	10	few	few	ADJ
fnp-5188	16	11	months	month	NOUN
fnp-5188	16	12	.	.	PUNCT
fnp-5188	17	1	by	by	ADP
fnp-5188	17	2	standard	standard	ADJ
fnp-5188	17	3	therapy	therapy	NOUN
fnp-5188	17	4	using	use	VERB
fnp-5188	17	5	optimal	optimal	ADJ
fnp-5188	17	6	surgical	surgical	ADJ
fnp-5188	17	7	resection	resection	NOUN
fnp-5188	17	8	,	,	PUNCT
fnp-5188	17	9	radiation	radiation	NOUN
fnp-5188	17	10	and	and	CCONJ
fnp-5188	17	11	chemotherapy	chemotherapy	NOUN
fnp-5188	17	12	with	with	ADP
fnp-5188	17	13	temozolomide	temozolomide	NOUN
fnp-5188	17	14	,	,	PUNCT
fnp-5188	17	15	or	or	CCONJ
fnp-5188	17	16	even	even	ADV
fnp-5188	17	17	using	use	VERB
fnp-5188	17	18	more	more	ADV
fnp-5188	17	19	recent	recent	ADJ
fnp-5188	17	20	additional	additional	ADJ
fnp-5188	17	21	treatment	treatment	NOUN
fnp-5188	17	22	approaches	approach	NOUN
fnp-5188	17	23	such	such	ADJ
fnp-5188	17	24	as	as	ADP
fnp-5188	17	25	tumor	tumor	NOUN
fnp-5188	17	26	treating	treat	VERB
fnp-5188	17	27	fields	field	NOUN
fnp-5188	17	28	(	(	PUNCT
fnp-5188	17	29	ttf	ttf	NOUN
fnp-5188	17	30	)	)	PUNCT
fnp-5188	17	31	,	,	PUNCT
fnp-5188	17	32	there	there	PRON
fnp-5188	17	33	is	be	VERB
fnp-5188	17	34	invariably	invariably	ADV
fnp-5188	17	35	tumor	tumor	NOUN
fnp-5188	17	36	recurrence	recurrence	NOUN
fnp-5188	17	37	.	.	PUNCT
fnp-5188	18	1	however	however	ADV
fnp-5188	18	2	,	,	PUNCT
fnp-5188	18	3	this	this	DET
fnp-5188	18	4	combined	combine	VERB
fnp-5188	18	5	treatment	treatment	NOUN
fnp-5188	18	6	only	only	ADV
fnp-5188	18	7	slightly	slightly	ADV
fnp-5188	18	8	prolongs	prolong	VERB
fnp-5188	18	9	the	the	DET
fnp-5188	18	10	median	median	ADJ
fnp-5188	18	11	survival	survival	NOUN
fnp-5188	18	12	,	,	PUNCT
fnp-5188	18	13	but	but	CCONJ
fnp-5188	18	14	usually	usually	ADV
fnp-5188	18	15	not	not	PART
fnp-5188	18	16	more	more	ADJ
fnp-5188	18	17	than	than	ADP
fnp-5188	18	18	up	up	ADP
fnp-5188	18	19	to	to	PART
fnp-5188	18	20	20	20	NUM
fnp-5188	18	21	months	month	NOUN
fnp-5188	18	22	[	[	X
fnp-5188	18	23	2	2	NUM
fnp-5188	18	24	]	]	PUNCT
fnp-5188	18	25	.	.	PUNCT
fnp-5188	19	1	several	several	ADJ
fnp-5188	19	2	characteristics	characteristic	NOUN
fnp-5188	19	3	of	of	ADP
fnp-5188	19	4	gbm	gbm	PROPN
fnp-5188	19	5	account	account	NOUN
fnp-5188	19	6	for	for	ADP
fnp-5188	19	7	its	its	PRON
fnp-5188	19	8	poor	poor	ADJ
fnp-5188	19	9	prognosis	prognosis	NOUN
fnp-5188	19	10	:	:	PUNCT
fnp-5188	19	11	(	(	PUNCT
fnp-5188	19	12	i	i	NOUN
fnp-5188	19	13	)	)	PUNCT
fnp-5188	19	14	gbms	gbms	PROPN
fnp-5188	19	15	are	be	AUX
fnp-5188	19	16	highly	highly	ADV
fnp-5188	19	17	invasively	invasively	ADV
fnp-5188	19	18	growing	grow	VERB
fnp-5188	19	19	tumors	tumor	NOUN
fnp-5188	19	20	which	which	PRON
fnp-5188	19	21	makes	make	VERB
fnp-5188	19	22	a	a	DET
fnp-5188	19	23	complete	complete	ADJ
fnp-5188	19	24	surgical	surgical	ADJ
fnp-5188	19	25	resection	resection	NOUN
fnp-5188	19	26	impossible	impossible	ADJ
fnp-5188	19	27	.	.	PUNCT
fnp-5188	20	1	even	even	ADV
fnp-5188	20	2	after	after	ADP
fnp-5188	20	3	aggressive	aggressive	ADJ
fnp-5188	20	4	surgery	surgery	NOUN
fnp-5188	20	5	,	,	PUNCT
fnp-5188	20	6	tumor	tumor	NOUN
fnp-5188	20	7	cells	cell	NOUN
fnp-5188	20	8	that	that	PRON
fnp-5188	20	9	invaded	invade	VERB
fnp-5188	20	10	healthy	healthy	ADJ
fnp-5188	20	11	brain	brain	NOUN
fnp-5188	20	12	areas	area	NOUN
fnp-5188	20	13	will	will	AUX
fnp-5188	20	14	remain	remain	VERB
fnp-5188	20	15	and	and	CCONJ
fnp-5188	20	16	are	be	AUX
fnp-5188	20	17	the	the	DET
fnp-5188	20	18	source	source	NOUN
fnp-5188	20	19	of	of	ADP
fnp-5188	20	20	recurrence	recurrence	NOUN
fnp-5188	20	21	[	[	X
fnp-5188	20	22	3	3	NUM
fnp-5188	20	23	]	]	PUNCT
fnp-5188	20	24	.	.	PUNCT
fnp-5188	21	1	(	(	PUNCT
fnp-5188	21	2	ii	ii	NOUN
fnp-5188	21	3	)	)	PUNCT
fnp-5188	21	4	gbms	gbms	PROPN
fnp-5188	21	5	show	show	VERB
fnp-5188	21	6	massive	massive	ADJ
fnp-5188	21	7	proliferation	proliferation	NOUN
fnp-5188	21	8	which	which	PRON
fnp-5188	21	9	makes	make	VERB
fnp-5188	21	10	them	they	PRON
fnp-5188	21	11	grow	grow	VERB
fnp-5188	21	12	rapidly	rapidly	ADV
fnp-5188	21	13	.	.	PUNCT
fnp-5188	22	1	the	the	DET
fnp-5188	22	2	growing	grow	VERB
fnp-5188	22	3	tumor	tumor	NOUN
fnp-5188	22	4	mass	mass	NOUN
fnp-5188	22	5	is	be	AUX
fnp-5188	22	6	in	in	ADP
fnp-5188	22	7	turn	turn	NOUN
fnp-5188	22	8	the	the	DET
fnp-5188	22	9	cause	cause	NOUN
fnp-5188	22	10	of	of	ADP
fnp-5188	22	11	several	several	ADJ
fnp-5188	22	12	neurological	neurological	ADJ
fnp-5188	22	13	problems	problem	NOUN
fnp-5188	22	14	such	such	ADJ
fnp-5188	22	15	as	as	ADP
fnp-5188	22	16	seizures	seizure	NOUN
fnp-5188	22	17	,	,	PUNCT
fnp-5188	22	18	impaired	impaired	ADJ
fnp-5188	22	19	vision	vision	NOUN
fnp-5188	22	20	,	,	PUNCT
fnp-5188	22	21	drowsiness	drowsiness	NOUN
fnp-5188	22	22	,	,	PUNCT
fnp-5188	22	23	changes	change	NOUN
fnp-5188	22	24	in	in	ADP
fnp-5188	22	25	personality	personality	NOUN
fnp-5188	22	26	or	or	CCONJ
fnp-5188	22	27	massive	massive	ADJ
fnp-5188	22	28	headache	headache	NOUN
fnp-5188	22	29	,	,	PUNCT
fnp-5188	22	30	dependent	dependent	ADJ
fnp-5188	22	31	on	on	ADP
fnp-5188	22	32	the	the	DET
fnp-5188	22	33	location	location	NOUN
fnp-5188	22	34	of	of	ADP
fnp-5188	22	35	the	the	DET
fnp-5188	22	36	tumor	tumor	NOUN
fnp-5188	22	37	in	in	ADP
fnp-5188	22	38	the	the	DET
fnp-5188	22	39	brain	brain	NOUN
fnp-5188	23	1	[	[	X
fnp-5188	23	2	1	1	NUM
fnp-5188	23	3	]	]	PUNCT
fnp-5188	23	4	.	.	PUNCT
fnp-5188	24	1	(	(	PUNCT
fnp-5188	24	2	iii	iii	X
fnp-5188	24	3	)	)	PUNCT
fnp-5188	24	4	gbms	gbms	NOUN
fnp-5188	24	5	can	can	AUX
fnp-5188	24	6	be	be	AUX
fnp-5188	24	7	categorized	categorize	VERB
fnp-5188	24	8	as	as	ADP
fnp-5188	24	9	highly	highly	ADV
fnp-5188	24	10	immunosuppressive	immunosuppressive	ADJ
fnp-5188	24	11	tumors	tumor	NOUN
fnp-5188	24	12	.	.	PUNCT
fnp-5188	25	1	several	several	ADJ
fnp-5188	25	2	mechanisms	mechanism	NOUN
fnp-5188	25	3	such	such	ADJ
fnp-5188	25	4	as	as	ADP
fnp-5188	25	5	the	the	DET
fnp-5188	25	6	expression	expression	NOUN
fnp-5188	25	7	of	of	ADP
fnp-5188	25	8	immune	immune	ADJ
fnp-5188	25	9	checkpoint	checkpoint	NOUN
fnp-5188	25	10	proteins	protein	NOUN
fnp-5188	25	11	like	like	ADP
fnp-5188	25	12	programmed	program	VERB
fnp-5188	25	13	cell	cell	NOUN
fnp-5188	25	14	death	death	NOUN
fnp-5188	25	15	ligand	ligand	NOUN
fnp-5188	25	16	1	1	NUM
fnp-5188	25	17	(	(	PUNCT
fnp-5188	25	18	pd	pd	NOUN
fnp-5188	25	19	-	-	PUNCT
fnp-5188	25	20	l1	l1	PROPN
fnp-5188	25	21	)	)	PUNCT
fnp-5188	25	22	,	,	PUNCT
fnp-5188	25	23	the	the	DET
fnp-5188	25	24	secretion	secretion	NOUN
fnp-5188	25	25	of	of	ADP
fnp-5188	25	26	immunosuppressive	immunosuppressive	ADJ
fnp-5188	25	27	cytokines	cytokine	NOUN
fnp-5188	25	28	such	such	ADJ
fnp-5188	25	29	as	as	ADP
fnp-5188	25	30	transforming	transform	VERB
fnp-5188	25	31	growth	growth	NOUN
fnp-5188	25	32	factor	factor	NOUN
fnp-5188	25	33	(	(	PUNCT
fnp-5188	25	34	tgf)-β	tgf)-β	NOUN
fnp-5188	25	35	by	by	ADP
fnp-5188	25	36	gbm	gbm	NOUN
fnp-5188	25	37	cells	cell	NOUN
fnp-5188	25	38	or	or	CCONJ
fnp-5188	25	39	tumor	tumor	NOUN
fnp-5188	25	40	vessel	vessel	NOUN
fnp-5188	25	41	associated	associate	VERB
fnp-5188	25	42	pericytes	pericyte	NOUN
fnp-5188	25	43	[	[	X
fnp-5188	25	44	4	4	NUM
fnp-5188	25	45	]	]	PUNCT
fnp-5188	25	46	,	,	PUNCT
fnp-5188	25	47	the	the	DET
fnp-5188	25	48	downregulation	downregulation	NOUN
fnp-5188	25	49	of	of	ADP
fnp-5188	25	50	major	major	ADJ
fnp-5188	25	51	histocompatibility	histocompatibility	NOUN
fnp-5188	25	52	complex	complex	NOUN
fnp-5188	25	53	(	(	PUNCT
fnp-5188	25	54	mhc	mhc	PROPN
fnp-5188	25	55	)	)	PUNCT
fnp-5188	25	56	class	class	NOUN
fnp-5188	25	57	i	i	PRON
fnp-5188	25	58	molecules	molecule	NOUN
fnp-5188	25	59	on	on	ADP
fnp-5188	25	60	gbm	gbm	NOUN
fnp-5188	25	61	cells	cell	NOUN
fnp-5188	25	62	as	as	ADV
fnp-5188	25	63	well	well	ADV
fnp-5188	25	64	as	as	ADP
fnp-5188	25	65	metabolic	metabolic	NOUN
fnp-5188	25	66	changes	change	NOUN
fnp-5188	25	67	in	in	ADP
fnp-5188	25	68	the	the	DET
fnp-5188	25	69	tumor	tumor	NOUN
fnp-5188	25	70	cells	cell	NOUN
fnp-5188	25	71	and	and	CCONJ
fnp-5188	25	72	the	the	DET
fnp-5188	25	73	tumor	tumor	NOUN
fnp-5188	25	74	microenvironment	microenvironment	NOUN
fnp-5188	25	75	(	(	PUNCT
fnp-5188	25	76	tma	tma	PROPN
fnp-5188	25	77	)	)	PUNCT
fnp-5188	25	78	negatively	negatively	ADV
fnp-5188	25	79	influence	influence	VERB
fnp-5188	25	80	the	the	DET
fnp-5188	25	81	immune	immune	ADJ
fnp-5188	25	82	surveillance	surveillance	NOUN
fnp-5188	25	83	of	of	ADP
fnp-5188	25	84	gbms	gbms	NOUN
fnp-5188	25	85	[	[	X
fnp-5188	25	86	5	5	NUM
fnp-5188	25	87	-	-	SYM
fnp-5188	25	88	8	8	NUM
fnp-5188	25	89	]	]	PUNCT
fnp-5188	25	90	.	.	PUNCT
fnp-5188	26	1	(	(	PUNCT
fnp-5188	26	2	vi	vi	NOUN
fnp-5188	26	3	)	)	PUNCT
fnp-5188	26	4	glioma	glioma	NOUN
fnp-5188	26	5	is	be	AUX
fnp-5188	26	6	a	a	DET
fnp-5188	26	7	highly	highly	ADV
fnp-5188	26	8	treatment	treatment	NOUN
fnp-5188	26	9	resistant	resistant	ADJ
fnp-5188	26	10	type	type	NOUN
fnp-5188	26	11	of	of	ADP
fnp-5188	26	12	cancer	cancer	NOUN
fnp-5188	26	13	[	[	X
fnp-5188	26	14	9	9	NUM
fnp-5188	26	15	]	]	PUNCT
fnp-5188	26	16	.	.	PUNCT
fnp-5188	27	1	(	(	PUNCT
fnp-5188	27	2	vii	vii	PROPN
fnp-5188	27	3	)	)	PUNCT
fnp-5188	27	4	finally	finally	ADV
fnp-5188	27	5	,	,	PUNCT
fnp-5188	27	6	gbms	gbms	PROPN
fnp-5188	27	7	are	be	AUX
fnp-5188	27	8	highly	highly	ADV
fnp-5188	27	9	vascularized	vascularized	ADJ
fnp-5188	27	10	tumors	tumor	NOUN
fnp-5188	27	11	,	,	PUNCT
fnp-5188	27	12	and	and	CCONJ
fnp-5188	27	13	the	the	DET
fnp-5188	27	14	interaction	interaction	NOUN
fnp-5188	27	15	between	between	ADP
fnp-5188	27	16	gbm	gbm	PROPN
fnp-5188	27	17	cells	cell	NOUN
fnp-5188	27	18	and	and	CCONJ
fnp-5188	27	19	blood	blood	NOUN
fnp-5188	27	20	vessels	vessel	NOUN
fnp-5188	27	21	promotes	promote	VERB
fnp-5188	27	22	neoangiogenesis	neoangiogenesis	NOUN
fnp-5188	27	23	,	,	PUNCT
fnp-5188	27	24	thereby	thereby	ADV
fnp-5188	27	25	facilitating	facilitate	VERB
fnp-5188	27	26	tumor	tumor	NOUN
fnp-5188	27	27	growth	growth	NOUN
fnp-5188	27	28	[	[	X
fnp-5188	27	29	10	10	NUM
fnp-5188	27	30	]	]	PUNCT
fnp-5188	27	31	.	.	PUNCT
fnp-5188	28	1	numerous	numerous	ADJ
fnp-5188	28	2	mechanisms	mechanism	NOUN
fnp-5188	28	3	contribute	contribute	VERB
fnp-5188	28	4	to	to	ADP
fnp-5188	28	5	the	the	DET
fnp-5188	28	6	robust	robust	ADJ
fnp-5188	28	7	formation	formation	NOUN
fnp-5188	28	8	of	of	ADP
fnp-5188	28	9	blood	blood	NOUN
fnp-5188	28	10	vessels	vessel	NOUN
fnp-5188	28	11	within	within	ADP
fnp-5188	28	12	the	the	DET
fnp-5188	28	13	tumor	tumor	NOUN
fnp-5188	28	14	.	.	PUNCT
fnp-5188	29	1	this	this	PRON
fnp-5188	29	2	involves	involve	VERB
fnp-5188	29	3	endothelial	endothelial	ADJ
fnp-5188	29	4	cell	cell	NOUN
fnp-5188	29	5	(	(	PUNCT
fnp-5188	29	6	ec	ec	NOUN
fnp-5188	29	7	)	)	PUNCT
fnp-5188	29	8	proliferation	proliferation	NOUN
fnp-5188	29	9	,	,	PUNCT
fnp-5188	29	10	which	which	PRON
fnp-5188	29	11	is	be	AUX
fnp-5188	29	12	dependent	dependent	ADJ
fnp-5188	29	13	on	on	ADP
fnp-5188	29	14	hypoxia	hypoxia	NOUN
fnp-5188	29	15	and	and	CCONJ
fnp-5188	29	16	hypoxia	hypoxia	NOUN
fnp-5188	29	17	inducible	inducible	ADJ
fnp-5188	29	18	factor	factor	NOUN
fnp-5188	29	19	(	(	PUNCT
fnp-5188	29	20	hif)-1	hif)-1	ADP
fnp-5188	29	21	induced	induced	ADJ
fnp-5188	29	22	transcription	transcription	NOUN
fnp-5188	29	23	and	and	CCONJ
fnp-5188	29	24	release	release	NOUN
fnp-5188	29	25	of	of	ADP
fnp-5188	29	26	vascular	vascular	ADJ
fnp-5188	29	27	endothelial	endothelial	ADJ
fnp-5188	29	28	growth	growth	NOUN
fnp-5188	29	29	factor	factor	NOUN
fnp-5188	29	30	(	(	PUNCT
fnp-5188	29	31	vegf	vegf	PROPN
fnp-5188	29	32	)	)	PUNCT
fnp-5188	29	33	from	from	ADP
fnp-5188	29	34	gbm	gbm	NOUN
fnp-5188	29	35	cells	cell	NOUN
fnp-5188	29	36	.	.	PUNCT
fnp-5188	30	1	this	this	DET
fnp-5188	30	2	process	process	NOUN
fnp-5188	30	3	leads	lead	VERB
fnp-5188	30	4	to	to	ADP
fnp-5188	30	5	the	the	DET
fnp-5188	30	6	sprouting	sprouting	NOUN
fnp-5188	30	7	of	of	ADP
fnp-5188	30	8	capillaries	capillary	NOUN
fnp-5188	30	9	from	from	ADP
fnp-5188	30	10	pre	pre	ADJ
fnp-5188	30	11	-	-	ADJ
fnp-5188	30	12	existing	exist	VERB
fnp-5188	30	13	blood	blood	NOUN
fnp-5188	30	14	vessels	vessel	NOUN
fnp-5188	30	15	.	.	PUNCT
fnp-5188	31	1	the	the	DET
fnp-5188	31	2	release	release	NOUN
fnp-5188	31	3	of	of	ADP
fnp-5188	31	4	further	further	ADJ
fnp-5188	31	5	angiogenic	angiogenic	ADJ
fnp-5188	31	6	factors	factor	NOUN
fnp-5188	31	7	from	from	ADP
fnp-5188	31	8	gbm	gbm	NOUN
fnp-5188	31	9	cells	cell	NOUN
fnp-5188	31	10	recruits	recruit	VERB
fnp-5188	31	11	a	a	DET
fnp-5188	31	12	variety	variety	NOUN
fnp-5188	31	13	of	of	ADP
fnp-5188	31	14	cells	cell	NOUN
fnp-5188	31	15	that	that	PRON
fnp-5188	31	16	may	may	AUX
fnp-5188	31	17	also	also	ADV
fnp-5188	31	18	participate	participate	VERB
fnp-5188	31	19	in	in	ADP
fnp-5188	31	20	new	new	ADJ
fnp-5188	31	21	blood	blood	NOUN
fnp-5188	31	22	vessel	vessel	NOUN
fnp-5188	31	23	formation	formation	NOUN
fnp-5188	31	24	(	(	PUNCT
fnp-5188	31	25	for	for	ADP
fnp-5188	31	26	review	review	NOUN
fnp-5188	31	27	see	see	VERB
fnp-5188	31	28	[	[	X
fnp-5188	31	29	11	11	NUM
fnp-5188	31	30	]	]	NUM
fnp-5188	31	31	)	)	PUNCT
fnp-5188	31	32	.	.	PUNCT
fnp-5188	32	1	in	in	ADP
fnp-5188	32	2	gbm	gbm	PROPN
fnp-5188	32	3	,	,	PUNCT
fnp-5188	32	4	the	the	DET
fnp-5188	32	5	newly	newly	ADV
fnp-5188	32	6	formed	form	VERB
fnp-5188	32	7	vessels	vessel	NOUN
fnp-5188	32	8	often	often	ADV
fnp-5188	32	9	show	show	VERB
fnp-5188	32	10	abnormalities	abnormality	NOUN
fnp-5188	32	11	in	in	ADP
fnp-5188	32	12	shape	shape	NOUN
fnp-5188	32	13	,	,	PUNCT
fnp-5188	32	14	size	size	NOUN
fnp-5188	32	15	and	and	CCONJ
fnp-5188	32	16	complexity	complexity	NOUN
fnp-5188	32	17	,	,	PUNCT
fnp-5188	32	18	resulting	result	VERB
fnp-5188	32	19	in	in	ADP
fnp-5188	32	20	glomeruloid	glomeruloid	PROPN
fnp-5188	32	21	,	,	PUNCT
fnp-5188	32	22	garland	garland	NOUN
fnp-5188	32	23	-	-	PUNCT
fnp-5188	32	24	like	like	ADJ
fnp-5188	32	25	or	or	CCONJ
fnp-5188	32	26	clustered	clustered	ADJ
fnp-5188	32	27	bizarre	bizarre	ADJ
fnp-5188	32	28	vascular	vascular	ADJ
fnp-5188	32	29	formations	formation	NOUN
fnp-5188	32	30	,	,	PUNCT
fnp-5188	32	31	which	which	PRON
fnp-5188	32	32	negatively	negatively	ADV
fnp-5188	32	33	influences	influence	VERB
fnp-5188	32	34	the	the	DET
fnp-5188	32	35	patient´s	patient´s	PROPN
fnp-5188	32	36	outcome	outcome	NOUN
fnp-5188	33	1	[	[	X
fnp-5188	33	2	12	12	NUM
fnp-5188	33	3	]	]	PUNCT
fnp-5188	33	4	.	.	PUNCT
fnp-5188	34	1	however	however	ADV
fnp-5188	34	2	,	,	PUNCT
fnp-5188	34	3	not	not	PART
fnp-5188	34	4	only	only	ADV
fnp-5188	34	5	ecs	ec	NOUN
fnp-5188	34	6	are	be	AUX
fnp-5188	34	7	involved	involve	VERB
fnp-5188	34	8	in	in	ADP
fnp-5188	34	9	angiogenic	angiogenic	ADJ
fnp-5188	34	10	processes	process	NOUN
fnp-5188	34	11	and	and	CCONJ
fnp-5188	34	12	vessel	vessel	NOUN
fnp-5188	34	13	formation	formation	NOUN
fnp-5188	34	14	.	.	PUNCT
fnp-5188	35	1	especially	especially	ADV
fnp-5188	35	2	pericytes	pericyte	NOUN
fnp-5188	35	3	came	come	VERB
fnp-5188	35	4	into	into	ADP
fnp-5188	35	5	focus	focus	NOUN
fnp-5188	35	6	to	to	PART
fnp-5188	35	7	be	be	AUX
fnp-5188	35	8	the	the	DET
fnp-5188	35	9	responsible	responsible	ADJ
fnp-5188	35	10	cell	cell	NOUN
fnp-5188	35	11	type	type	NOUN
fnp-5188	35	12	for	for	ADP
fnp-5188	35	13	the	the	DET
fnp-5188	35	14	chaotic	chaotic	ADJ
fnp-5188	35	15	vessel	vessel	NOUN
fnp-5188	35	16	structure	structure	NOUN
fnp-5188	35	17	in	in	ADP
fnp-5188	35	18	gbm	gbm	PROPN
fnp-5188	35	19	,	,	PUNCT
fnp-5188	35	20	since	since	SCONJ
fnp-5188	35	21	these	these	DET
fnp-5188	35	22	cells	cell	NOUN
fnp-5188	35	23	are	be	AUX
fnp-5188	35	24	heavily	heavily	ADV
fnp-5188	35	25	modified	modify	VERB
fnp-5188	35	26	under	under	ADP
fnp-5188	35	27	pathological	pathological	ADJ
fnp-5188	35	28	conditions	condition	NOUN
fnp-5188	35	29	(	(	PUNCT
fnp-5188	35	30	reviewed	review	VERB
fnp-5188	35	31	in	in	ADP
fnp-5188	35	32	[	[	X
fnp-5188	35	33	13	13	NUM
fnp-5188	35	34	,	,	PUNCT
fnp-5188	35	35	14	14	NUM
fnp-5188	35	36	]	]	PUNCT
fnp-5188	35	37	)	)	PUNCT
fnp-5188	35	38	.	.	PUNCT
fnp-5188	36	1	pericytes	pericyte	NOUN
fnp-5188	36	2	are	be	AUX
fnp-5188	36	3	cells	cell	NOUN
fnp-5188	36	4	adjacent	adjacent	ADJ
fnp-5188	36	5	to	to	ADP
fnp-5188	36	6	ecs	ecs	PROPN
fnp-5188	36	7	,	,	PUNCT
fnp-5188	36	8	wrapping	wrap	VERB
fnp-5188	36	9	around	around	ADP
fnp-5188	36	10	blood	blood	NOUN
fnp-5188	36	11	vessels	vessel	NOUN
fnp-5188	36	12	.	.	PUNCT
fnp-5188	37	1	in	in	ADP
fnp-5188	37	2	the	the	DET
fnp-5188	37	3	cns	cns	NOUN
fnp-5188	37	4	,	,	PUNCT
fnp-5188	37	5	pericytes	pericyte	NOUN
fnp-5188	37	6	are	be	AUX
fnp-5188	37	7	necessary	necessary	ADJ
fnp-5188	37	8	for	for	ADP
fnp-5188	37	9	the	the	DET
fnp-5188	37	10	formation	formation	NOUN
fnp-5188	37	11	and	and	CCONJ
fnp-5188	37	12	regulation	regulation	NOUN
fnp-5188	37	13	of	of	ADP
fnp-5188	37	14	the	the	DET
fnp-5188	37	15	blood	blood	NOUN
fnp-5188	37	16	-	-	PUNCT
fnp-5188	37	17	brain	brain	NOUN
fnp-5188	37	18	-	-	PUNCT
fnp-5188	37	19	barrier	barrier	NOUN
fnp-5188	37	20	(	(	PUNCT
fnp-5188	37	21	bbb	bbb	NOUN
fnp-5188	37	22	)	)	PUNCT
fnp-5188	37	23	.	.	PUNCT
fnp-5188	38	1	in	in	ADP
fnp-5188	38	2	former	former	ADJ
fnp-5188	38	3	studies	study	NOUN
fnp-5188	38	4	we	we	PRON
fnp-5188	38	5	have	have	AUX
fnp-5188	38	6	demonstrated	demonstrate	VERB
fnp-5188	38	7	that	that	SCONJ
fnp-5188	38	8	pericytes	pericyte	NOUN
fnp-5188	38	9	are	be	AUX
fnp-5188	38	10	prominently	prominently	ADV
fnp-5188	38	11	involved	involve	VERB
fnp-5188	38	12	in	in	ADP
fnp-5188	38	13	the	the	DET
fnp-5188	38	14	formation	formation	NOUN
fnp-5188	38	15	of	of	ADP
fnp-5188	38	16	gbm	gbm	NOUN
fnp-5188	38	17	-	-	PUNCT
fnp-5188	38	18	associated	associate	VERB
fnp-5188	38	19	vascular	vascular	ADJ
fnp-5188	38	20	proliferations	proliferation	NOUN
fnp-5188	38	21	and	and	CCONJ
fnp-5188	38	22	that	that	SCONJ
fnp-5188	38	23	those	those	DET
fnp-5188	38	24	pericytes	pericyte	NOUN
fnp-5188	38	25	covering	cover	VERB
fnp-5188	38	26	gbm	gbm	NOUN
fnp-5188	38	27	-	-	PUNCT
fnp-5188	38	28	associated	associate	VERB
fnp-5188	38	29	vessels	vessel	NOUN
fnp-5188	38	30	can	can	AUX
fnp-5188	38	31	be	be	AUX
fnp-5188	38	32	distinguished	distinguish	VERB
fnp-5188	38	33	from	from	ADP
fnp-5188	38	34	"	"	PUNCT
fnp-5188	38	35	normal	normal	ADJ
fnp-5188	38	36	"	"	PUNCT
fnp-5188	38	37	pericytes	pericyte	NOUN
fnp-5188	38	38	covering	cover	VERB
fnp-5188	38	39	vessels	vessel	NOUN
fnp-5188	38	40	outside	outside	ADP
fnp-5188	38	41	the	the	DET
fnp-5188	38	42	tumor	tumor	NOUN
fnp-5188	38	43	core	core	NOUN
fnp-5188	38	44	by	by	ADP
fnp-5188	38	45	their	their	PRON
fnp-5188	38	46	expression	expression	NOUN
fnp-5188	38	47	profile	profile	NOUN
fnp-5188	38	48	,	,	PUNCT
fnp-5188	38	49	especially	especially	ADV
fnp-5188	38	50	by	by	ADP
fnp-5188	38	51	the	the	DET
fnp-5188	38	52	expression	expression	NOUN
fnp-5188	38	53	of	of	ADP
fnp-5188	38	54	epithelial	epithelial	NOUN
fnp-5188	38	55	-	-	PUNCT
fnp-5188	38	56	to	to	ADP
fnp-5188	38	57	-	-	PUNCT
fnp-5188	38	58	mesenchymal	mesenchymal	NOUN
fnp-5188	38	59	transition	transition	NOUN
fnp-5188	38	60	(	(	PUNCT
fnp-5188	38	61	emt	emt	NOUN
fnp-5188	38	62	)	)	PUNCT
fnp-5188	38	63	factors	factor	NOUN
fnp-5188	38	64	such	such	ADJ
fnp-5188	38	65	as	as	ADP
fnp-5188	38	66	slug	slug	NOUN
fnp-5188	38	67	or	or	CCONJ
fnp-5188	38	68	twist	twist	NOUN
fnp-5188	38	69	[	[	X
fnp-5188	38	70	15	15	NUM
fnp-5188	38	71	]	]	PUNCT
fnp-5188	38	72	.	.	PUNCT
fnp-5188	39	1	in	in	ADP
fnp-5188	39	2	vitro	vitro	X
fnp-5188	39	3	,	,	PUNCT
fnp-5188	39	4	gbm	gbm	NOUN
fnp-5188	39	5	cells	cell	NOUN
fnp-5188	39	6	,	,	PUNCT
fnp-5188	39	7	by	by	ADP
fnp-5188	39	8	secretion	secretion	NOUN
fnp-5188	39	9	of	of	ADP
fnp-5188	39	10	tgf	tgf	PROPN
fnp-5188	39	11	-	-	PUNCT
fnp-5188	39	12	β	β	NOUN
fnp-5188	39	13	,	,	PUNCT
fnp-5188	39	14	induce	induce	VERB
fnp-5188	39	15	an	an	DET
fnp-5188	39	16	emt	emt	NOUN
fnp-5188	39	17	-	-	PUNCT
fnp-5188	39	18	like	like	ADJ
fnp-5188	39	19	program	program	NOUN
fnp-5188	39	20	in	in	ADP
fnp-5188	39	21	human	human	ADJ
fnp-5188	39	22	brain	brain	NOUN
fnp-5188	39	23	microvascular	microvascular	NOUN
fnp-5188	39	24	pericytes	pericyte	NOUN
fnp-5188	39	25	,	,	PUNCT
fnp-5188	39	26	drive	drive	VERB
fnp-5188	39	27	these	these	DET
fnp-5188	39	28	cells	cell	NOUN
fnp-5188	39	29	to	to	PART
fnp-5188	39	30	change	change	VERB
fnp-5188	39	31	their	their	PRON
fnp-5188	39	32	growth	growth	NOUN
fnp-5188	39	33	morphology	morphology	NOUN
fnp-5188	39	34	,	,	PUNCT
fnp-5188	39	35	shift	shift	VERB
fnp-5188	39	36	them	they	PRON
fnp-5188	39	37	towards	towards	ADP
fnp-5188	39	38	energy	energy	NOUN
fnp-5188	39	39	production	production	NOUN
fnp-5188	39	40	by	by	ADP
fnp-5188	39	41	glycolysis	glycolysis	NOUN
fnp-5188	39	42	,	,	PUNCT
fnp-5188	39	43	induce	induce	VERB
fnp-5188	39	44	proliferation	proliferation	NOUN
fnp-5188	39	45	and	and	CCONJ
fnp-5188	39	46	increase	increase	VERB
fnp-5188	39	47	cell	cell	NOUN
fnp-5188	39	48	motility	motility	NOUN
fnp-5188	39	49	,	,	PUNCT
fnp-5188	39	50	and	and	CCONJ
fnp-5188	39	51	impact	impact	VERB
fnp-5188	39	52	the	the	DET
fnp-5188	39	53	bbb	bbb	NOUN
fnp-5188	39	54	integrity	integrity	NOUN
fnp-5188	40	1	[	[	X
fnp-5188	40	2	16	16	NUM
fnp-5188	40	3	,	,	PUNCT
fnp-5188	40	4	17	17	NUM
fnp-5188	40	5	]	]	PUNCT
fnp-5188	40	6	.	.	PUNCT
fnp-5188	41	1	in	in	ADP
fnp-5188	41	2	this	this	DET
fnp-5188	41	3	study	study	NOUN
fnp-5188	41	4	,	,	PUNCT
fnp-5188	41	5	we	we	PRON
fnp-5188	41	6	were	be	AUX
fnp-5188	41	7	interested	interested	ADJ
fnp-5188	41	8	in	in	ADP
fnp-5188	41	9	whether	whether	SCONJ
fnp-5188	41	10	the	the	DET
fnp-5188	41	11	tgf	tgf	PROPN
fnp-5188	41	12	-	-	PUNCT
fnp-5188	41	13	β	β	NOUN
fnp-5188	41	14	-	-	PUNCT
fnp-5188	41	15	mediated	mediate	VERB
fnp-5188	41	16	induction	induction	NOUN
fnp-5188	41	17	of	of	ADP
fnp-5188	41	18	the	the	DET
fnp-5188	41	19	emt	emt	PROPN
fnp-5188	41	20	program	program	NOUN
fnp-5188	41	21	in	in	ADP
fnp-5188	41	22	vamcs	vamcs	NOUN
fnp-5188	41	23	might	might	AUX
fnp-5188	41	24	have	have	AUX
fnp-5188	41	25	impact	impact	NOUN
fnp-5188	41	26	on	on	ADP
fnp-5188	41	27	the	the	DET
fnp-5188	41	28	density	density	NOUN
fnp-5188	41	29	,	,	PUNCT
fnp-5188	41	30	formation	formation	NOUN
fnp-5188	41	31	and	and	CCONJ
fnp-5188	41	32	structure	structure	NOUN
fnp-5188	41	33	of	of	ADP
fnp-5188	41	34	newly	newly	ADV
fnp-5188	41	35	built	build	VERB
fnp-5188	41	36	blood	blood	NOUN
fnp-5188	41	37	vessels	vessel	NOUN
fnp-5188	41	38	in	in	ADP
fnp-5188	41	39	the	the	DET
fnp-5188	41	40	tumor	tumor	NOUN
fnp-5188	41	41	core	core	NOUN
fnp-5188	41	42	of	of	ADP
fnp-5188	41	43	gbm	gbm	NOUN
fnp-5188	41	44	,	,	PUNCT
fnp-5188	41	45	particularly	particularly	ADV
fnp-5188	41	46	in	in	ADP
fnp-5188	41	47	a	a	DET
fnp-5188	41	48	murine	murine	ADJ
fnp-5188	41	49	mouse	mouse	NOUN
fnp-5188	41	50	model	model	NOUN
fnp-5188	41	51	in	in	ADP
fnp-5188	41	52	vivo	vivo	NOUN
fnp-5188	41	53	.	.	PUNCT
fnp-5188	42	1	material	material	NOUN
fnp-5188	42	2	and	and	CCONJ
fnp-5188	42	3	methods	method	NOUN
fnp-5188	42	4	cell	cell	NOUN
fnp-5188	42	5	culturing	culturing	NOUN
fnp-5188	42	6	and	and	CCONJ
fnp-5188	42	7	testing	testing	NOUN
fnp-5188	42	8	primary	primary	ADJ
fnp-5188	42	9	murine	murine	ADJ
fnp-5188	42	10	brain	brain	NOUN
fnp-5188	42	11	vascular	vascular	ADJ
fnp-5188	42	12	pericytes	pericyte	NOUN
fnp-5188	42	13	(	(	PUNCT
fnp-5188	42	14	mbvp	mbvp	ADV
fnp-5188	42	15	)	)	PUNCT
fnp-5188	42	16	were	be	AUX
fnp-5188	42	17	purchased	purchase	VERB
fnp-5188	42	18	from	from	ADP
fnp-5188	42	19	ixcells	ixcells	PROPN
fnp-5188	42	20	(	(	PUNCT
fnp-5188	42	21	san	san	PROPN
fnp-5188	42	22	diego	diego	PROPN
fnp-5188	42	23	,	,	PUNCT
fnp-5188	42	24	ca	ca	PROPN
fnp-5188	42	25	,	,	PUNCT
fnp-5188	42	26	usa	usa	PROPN
fnp-5188	42	27	)	)	PUNCT
fnp-5188	42	28	and	and	CCONJ
fnp-5188	42	29	were	be	AUX
fnp-5188	42	30	cultured	cultured	ADJ
fnp-5188	42	31	in	in	ADP
fnp-5188	42	32	fully	fully	ADV
fnp-5188	42	33	supplemented	supplement	VERB
fnp-5188	42	34	mouse	mouse	NOUN
fnp-5188	42	35	pericyte	pericyte	NOUN
fnp-5188	42	36	growth	growth	NOUN
fnp-5188	42	37	medium	medium	NOUN
fnp-5188	42	38	(	(	PUNCT
fnp-5188	42	39	pm	pm	NOUN
fnp-5188	42	40	,	,	PUNCT
fnp-5188	42	41	ixcells	ixcell	NOUN
fnp-5188	42	42	)	)	PUNCT
fnp-5188	42	43	.	.	PUNCT
fnp-5188	43	1	mbvps	mbvps	PROPN
fnp-5188	43	2	were	be	AUX
fnp-5188	43	3	used	use	VERB
fnp-5188	43	4	up	up	ADP
fnp-5188	43	5	to	to	PART
fnp-5188	43	6	passage	passage	NOUN
fnp-5188	43	7	5	5	NUM
fnp-5188	43	8	.	.	PUNCT
fnp-5188	44	1	gl261	gl261	PROPN
fnp-5188	44	2	mouse	mouse	NOUN
fnp-5188	44	3	glioma	glioma	NOUN
fnp-5188	44	4	cells	cell	NOUN
fnp-5188	44	5	(	(	PUNCT
fnp-5188	44	6	cellosaurus	cellosaurus	ADJ
fnp-5188	44	7	cvcl_y003	cvcl_y003	NOUN
fnp-5188	44	8	)	)	PUNCT
fnp-5188	44	9	,	,	PUNCT
fnp-5188	44	10	known	know	VERB
fnp-5188	44	11	to	to	PART
fnp-5188	44	12	express	express	VERB
fnp-5188	44	13	tgf	tgf	PROPN
fnp-5188	44	14	-	-	PUNCT
fnp-5188	44	15	β	β	NOUN
fnp-5188	44	16	[	[	X
fnp-5188	44	17	18	18	NUM
fnp-5188	44	18	]	]	PUNCT
fnp-5188	44	19	,	,	PUNCT
fnp-5188	44	20	were	be	AUX
fnp-5188	44	21	from	from	ADP
fnp-5188	44	22	the	the	DET
fnp-5188	44	23	institute	institute	NOUN
fnp-5188	44	24	's	's	PART
fnp-5188	44	25	repository	repository	NOUN
fnp-5188	44	26	.	.	PUNCT
fnp-5188	45	1	gl261	gl261	NOUN
fnp-5188	45	2	cells	cell	NOUN
fnp-5188	45	3	were	be	AUX
fnp-5188	45	4	created	create	VERB
fnp-5188	45	5	in	in	ADP
fnp-5188	45	6	1970	1970	NUM
fnp-5188	45	7	via	via	ADP
fnp-5188	45	8	chemical	chemical	ADJ
fnp-5188	45	9	induction	induction	NOUN
fnp-5188	45	10	with	with	ADP
fnp-5188	45	11	methylcholanthrene	methylcholanthrene	ADJ
fnp-5188	45	12	pellets	pellet	NOUN
fnp-5188	45	13	implanted	implant	VERB
fnp-5188	45	14	into	into	ADP
fnp-5188	45	15	the	the	DET
fnp-5188	45	16	brains	brain	NOUN
fnp-5188	45	17	of	of	ADP
fnp-5188	45	18	c57bl/6	c57bl/6	NOUN
fnp-5188	45	19	mice	mouse	NOUN
fnp-5188	45	20	[	[	X
fnp-5188	45	21	19	19	NUM
fnp-5188	45	22	]	]	PUNCT
fnp-5188	45	23	.	.	PUNCT
fnp-5188	46	1	nih/3t3	nih/3t3	NOUN
fnp-5188	46	2	cells	cell	NOUN
fnp-5188	46	3	were	be	AUX
fnp-5188	46	4	from	from	ADP
fnp-5188	46	5	atcc	atcc	ADJ
fnp-5188	46	6	(	(	PUNCT
fnp-5188	46	7	#	#	NOUN
fnp-5188	46	8	crl-1658	crl-1658	NOUN
fnp-5188	46	9	)	)	PUNCT
fnp-5188	46	10	.	.	PUNCT
fnp-5188	47	1	gl261	gl261	PROPN
fnp-5188	47	2	and	and	CCONJ
fnp-5188	47	3	nih/3t3	nih/3t3	NOUN
fnp-5188	47	4	cells	cell	NOUN
fnp-5188	47	5	were	be	AUX
fnp-5188	47	6	cultivated	cultivate	VERB
fnp-5188	47	7	in	in	ADP
fnp-5188	47	8	dulbecco	dulbecco	NOUN
fnp-5188	47	9	's	's	PART
fnp-5188	47	10	modified	modify	VERB
fnp-5188	47	11	eagles	eagle	NOUN
fnp-5188	47	12	medium	medium	ADJ
fnp-5188	47	13	(	(	PUNCT
fnp-5188	47	14	dmem	dmem	ADJ
fnp-5188	47	15	;	;	PUNCT
fnp-5188	47	16	sigma	sigma	PROPN
fnp-5188	47	17	-	-	PUNCT
fnp-5188	47	18	aldrich	aldrich	NOUN
fnp-5188	47	19	,	,	PUNCT
fnp-5188	47	20	taufkirchen	taufkirchen	NOUN
fnp-5188	47	21	,	,	PUNCT
fnp-5188	47	22	germany	germany	PROPN
fnp-5188	47	23	)	)	PUNCT
fnp-5188	47	24	supplemented	supplement	VERB
fnp-5188	47	25	with	with	ADP
fnp-5188	47	26	10	10	NUM
fnp-5188	47	27	%	%	NOUN
fnp-5188	47	28	fbs	fbs	PROPN
fnp-5188	47	29	,	,	PUNCT
fnp-5188	47	30	100	100	NUM
fnp-5188	47	31	u	u	NOUN
fnp-5188	47	32	/	/	SYM
fnp-5188	47	33	ml	ml	NOUN
fnp-5188	47	34	penicillin	penicillin	NOUN
fnp-5188	47	35	,	,	PUNCT
fnp-5188	47	36	and	and	CCONJ
fnp-5188	47	37	0.1	0.1	NUM
fnp-5188	47	38	mg	mg	NUM
fnp-5188	47	39	/	/	SYM
fnp-5188	47	40	ml	ml	NOUN
fnp-5188	47	41	streptomycin	streptomycin	PROPN
fnp-5188	47	42	(	(	PUNCT
fnp-5188	47	43	sigma	sigma	PROPN
fnp-5188	47	44	-	-	PUNCT
fnp-5188	47	45	aldrich	aldrich	NOUN
fnp-5188	47	46	)	)	PUNCT
fnp-5188	47	47	at	at	ADP
fnp-5188	47	48	37	37	NUM
fnp-5188	47	49	 	 	SPACE
fnp-5188	47	50	°	°	NOUN
fnp-5188	47	51	c	c	NOUN
fnp-5188	47	52	,	,	PUNCT
fnp-5188	47	53	5	5	NUM
fnp-5188	47	54	 	 	SPACE
fnp-5188	47	55	%	%	NOUN
fnp-5188	47	56	co2	co2	NOUN
fnp-5188	47	57	.	.	PUNCT
fnp-5188	48	1	all	all	DET
fnp-5188	48	2	cell	cell	NOUN
fnp-5188	48	3	lines	line	NOUN
fnp-5188	48	4	were	be	AUX
fnp-5188	48	5	regularly	regularly	ADV
fnp-5188	48	6	tested	test	VERB
fnp-5188	48	7	to	to	PART
fnp-5188	48	8	be	be	AUX
fnp-5188	48	9	free	free	ADJ
fnp-5188	48	10	of	of	ADP
fnp-5188	48	11	mycoplasma	mycoplasma	NOUN
fnp-5188	48	12	using	use	VERB
fnp-5188	48	13	the	the	DET
fnp-5188	48	14	mycoalert	mycoalert	ADJ
fnp-5188	48	15	mycoplasma	mycoplasma	NOUN
fnp-5188	48	16	detection	detection	NOUN
fnp-5188	48	17	kit	kit	NOUN
fnp-5188	48	18	(	(	PUNCT
fnp-5188	48	19	lonza	lonza	NOUN
fnp-5188	48	20	,	,	PUNCT
fnp-5188	48	21	cologne	cologne	NOUN
fnp-5188	48	22	,	,	PUNCT
fnp-5188	48	23	germany	germany	PROPN
fnp-5188	48	24	)	)	PUNCT
fnp-5188	48	25	.	.	PUNCT
fnp-5188	49	1	generation	generation	NOUN
fnp-5188	49	2	and	and	CCONJ
fnp-5188	49	3	characterization	characterization	NOUN
fnp-5188	49	4	of	of	ADP
fnp-5188	49	5	gl261	gl261	PROPN
fnp-5188	49	6	tgf	tgf	PROPN
fnp-5188	49	7	-	-	PUNCT
fnp-5188	49	8	β1	β1	PROPN
fnp-5188	49	9	/	/	SYM
fnp-5188	49	10	β2	β2	NOUN
fnp-5188	49	11	double	double	ADJ
fnp-5188	49	12	knockout	knockout	NOUN
fnp-5188	49	13	,	,	PUNCT
fnp-5188	49	14	mcherry	mcherry	ADJ
fnp-5188	49	15	expressing	express	VERB
fnp-5188	49	16	cells	cell	NOUN
fnp-5188	49	17	for	for	ADP
fnp-5188	49	18	the	the	DET
fnp-5188	49	19	generation	generation	NOUN
fnp-5188	49	20	of	of	ADP
fnp-5188	49	21	gl261	gl261	PROPN
fnp-5188	49	22	tgf	tgf	PROPN
fnp-5188	49	23	-	-	PUNCT
fnp-5188	49	24	β1	β1	PROPN
fnp-5188	49	25	plus	plus	CCONJ
fnp-5188	49	26	-β2	-β2	CCONJ
fnp-5188	49	27	double	double	ADJ
fnp-5188	49	28	knockout	knockout	NOUN
fnp-5188	49	29	cells	cell	NOUN
fnp-5188	49	30	,	,	PUNCT
fnp-5188	49	31	the	the	DET
fnp-5188	49	32	cells	cell	NOUN
fnp-5188	49	33	were	be	AUX
fnp-5188	49	34	transfected	transfecte	VERB
fnp-5188	49	35	by	by	ADP
fnp-5188	49	36	electroporation	electroporation	NOUN
fnp-5188	49	37	with	with	ADP
fnp-5188	49	38	alt	alt	ADJ
fnp-5188	49	39	-	-	PUNCT
fnp-5188	49	40	r	r	NOUN
fnp-5188	49	41	cas9	cas9	NOUN
fnp-5188	49	42	nuclease	nuclease	NOUN
fnp-5188	49	43	,	,	PUNCT
fnp-5188	49	44	atto	atto	NOUN
fnp-5188	49	45	550	550	NUM
fnp-5188	49	46	crispr	crispr	ADJ
fnp-5188	49	47	-	-	PUNCT
fnp-5188	49	48	cas9	cas9	NOUN
fnp-5188	49	49	tracrrna	tracrrna	NOUN
fnp-5188	49	50	,	,	PUNCT
fnp-5188	49	51	mouse	mouse	NOUN
fnp-5188	49	52	tgfb1	tgfb1	NOUN
fnp-5188	49	53	guide	guide	NOUN
fnp-5188	49	54	rnas	rna	NOUN
fnp-5188	49	55	(	(	PUNCT
fnp-5188	49	56	ggcaguagccgcagccccgaguuuuagagcuaugcu	ggcaguagccgcagccccgaguuuuagagcuaugcu	NOUN
fnp-5188	49	57	and	and	CCONJ
fnp-5188	49	58	guacaaagcgagcaccgccuguuuu	guacaaagcgagcaccgccuguuuu	NOUN
fnp-5188	49	59	-	-	PUNCT
fnp-5188	49	60	aga	aga	NOUN
fnp-5188	49	61	-	-	PUNCT
fnp-5188	49	62	gcuaugcu	gcuaugcu	NOUN
fnp-5188	49	63	;	;	PUNCT
fnp-5188	49	64	all	all	PRON
fnp-5188	49	65	from	from	ADP
fnp-5188	49	66	integrated	integrate	VERB
fnp-5188	49	67	dna	dna	PROPN
fnp-5188	49	68	technology	technology	NOUN
fnp-5188	49	69	,	,	PUNCT
fnp-5188	49	70	coralville	coralville	PROPN
fnp-5188	49	71	,	,	PUNCT
fnp-5188	49	72	ia	ia	PROPN
fnp-5188	49	73	,	,	PUNCT
fnp-5188	49	74	usa	usa	PROPN
fnp-5188	49	75	)	)	PUNCT
fnp-5188	49	76	using	use	VERB
fnp-5188	49	77	the	the	DET
fnp-5188	49	78	amaxa	amaxa	NOUN
fnp-5188	49	79	cell	cell	NOUN
fnp-5188	49	80	line	line	NOUN
fnp-5188	49	81	nucleofactor	nucleofactor	NOUN
fnp-5188	49	82	™	™	NOUN
fnp-5188	49	83	kit	kit	NOUN
fnp-5188	49	84	v	v	NOUN
fnp-5188	49	85	(	(	PUNCT
fnp-5188	49	86	lonza	lonza	NOUN
fnp-5188	49	87	)	)	PUNCT
fnp-5188	49	88	as	as	SCONJ
fnp-5188	49	89	described	describe	VERB
fnp-5188	49	90	[	[	X
fnp-5188	49	91	20	20	NUM
fnp-5188	49	92	]	]	PUNCT
fnp-5188	49	93	.	.	PUNCT
fnp-5188	50	1	guide	guide	NOUN
fnp-5188	50	2	rnas	rna	NOUN
fnp-5188	50	3	were	be	AUX
fnp-5188	50	4	designed	design	VERB
fnp-5188	50	5	using	use	VERB
fnp-5188	50	6	benchling	benchle	VERB
fnp-5188	50	7	(	(	PUNCT
fnp-5188	50	8	https://www.benchling.com	https://www.benchling.com	NUM
fnp-5188	50	9	)	)	PUNCT
fnp-5188	50	10	.	.	PUNCT
fnp-5188	51	1	an	an	PRON
fnp-5188	51	2	in	in	ADP
fnp-5188	51	3	silico	silico	NOUN
fnp-5188	51	4	off	off	ADP
fnp-5188	51	5	-	-	PUNCT
fnp-5188	51	6	target	target	NOUN
fnp-5188	51	7	binding	bind	VERB
fnp-5188	51	8	prediction	prediction	NOUN
fnp-5188	51	9	was	be	AUX
fnp-5188	51	10	performed	perform	VERB
fnp-5188	51	11	using	use	VERB
fnp-5188	51	12	the	the	DET
fnp-5188	51	13	online	online	ADJ
fnp-5188	51	14	tool	tool	NOUN
fnp-5188	51	15	off	off	ADP
fnp-5188	51	16	-	-	PUNCT
fnp-5188	51	17	spotter	spotter	NOUN
fnp-5188	51	18	(	(	PUNCT
fnp-5188	51	19	https://cm.jefferson.edu/off-spotter	https://cm.jefferson.edu/off-spotter	X
fnp-5188	51	20	;	;	PUNCT
fnp-5188	51	21	[	[	X
fnp-5188	51	22	21	21	NUM
fnp-5188	51	23	]	]	PUNCT
fnp-5188	51	24	)	)	PUNCT
fnp-5188	51	25	.	.	PUNCT
fnp-5188	52	1	after	after	ADP
fnp-5188	52	2	electroporation	electroporation	NOUN
fnp-5188	52	3	,	,	PUNCT
fnp-5188	52	4	transfected	transfecte	VERB
fnp-5188	52	5	cells	cell	NOUN
fnp-5188	52	6	were	be	AUX
fnp-5188	52	7	sorted	sort	VERB
fnp-5188	52	8	on	on	ADP
fnp-5188	52	9	a	a	DET
fnp-5188	52	10	sh800	sh800	PROPN
fnp-5188	52	11	cell	cell	NOUN
fnp-5188	52	12	sorter	sorter	NOUN
fnp-5188	52	13	(	(	PUNCT
fnp-5188	52	14	sony	sony	PROPN
fnp-5188	52	15	,	,	PUNCT
fnp-5188	52	16	stuttgart	stuttgart	PROPN
fnp-5188	52	17	,	,	PUNCT
fnp-5188	52	18	germany	germany	PROPN
fnp-5188	52	19	)	)	PUNCT
fnp-5188	52	20	.	.	PUNCT
fnp-5188	53	1	after	after	SCONJ
fnp-5188	53	2	expansion	expansion	NOUN
fnp-5188	53	3	of	of	ADP
fnp-5188	53	4	cell	cell	NOUN
fnp-5188	53	5	clones	clone	NOUN
fnp-5188	53	6	,	,	PUNCT
fnp-5188	53	7	biallelic	biallelic	PROPN
fnp-5188	53	8	tgf	tgf	PROPN
fnp-5188	53	9	-	-	PUNCT
fnp-5188	53	10	β1	β1	PROPN
fnp-5188	53	11	knockout	knockout	NOUN
fnp-5188	53	12	gl261	gl261	PROPN
fnp-5188	53	13	cell	cell	NOUN
fnp-5188	53	14	clones	clone	NOUN
fnp-5188	53	15	were	be	AUX
fnp-5188	53	16	identified	identify	VERB
fnp-5188	53	17	by	by	ADP
fnp-5188	53	18	pcr	pcr	PROPN
fnp-5188	53	19	on	on	ADP
fnp-5188	53	20	genomic	genomic	ADJ
fnp-5188	53	21	dna	dna	NOUN
fnp-5188	53	22	on	on	ADP
fnp-5188	53	23	a	a	DET
fnp-5188	53	24	ptc-200	ptc-200	NOUN
fnp-5188	53	25	pcr	pcr	PROPN
fnp-5188	53	26	cycler	cycler	NOUN
fnp-5188	53	27	(	(	PUNCT
fnp-5188	53	28	biorad	biorad	NOUN
fnp-5188	53	29	,	,	PUNCT
fnp-5188	53	30	feldkirchen	feldkirchen	NOUN
fnp-5188	53	31	,	,	PUNCT
fnp-5188	53	32	germany	germany	PROPN
fnp-5188	53	33	)	)	PUNCT
fnp-5188	53	34	using	use	VERB
fnp-5188	53	35	the	the	DET
fnp-5188	53	36	following	follow	VERB
fnp-5188	53	37	detection	detection	NOUN
fnp-5188	53	38	primer	primer	NOUN
fnp-5188	53	39	:	:	PUNCT
fnp-5188	53	40	mtgfb1	mtgfb1	NOUN
fnp-5188	53	41	-	-	PUNCT
fnp-5188	53	42	frw	frw	NOUN
fnp-5188	53	43	gggttcccgctctccgaagtg	gggttcccgctctccgaagtg	NOUN
fnp-5188	53	44	and	and	CCONJ
fnp-5188	53	45	mtgfb1	mtgfb1	NOUN
fnp-5188	53	46	-	-	PUNCT
fnp-5188	53	47	rev	rev	ADJ
fnp-5188	53	48	gtccaccattagcacgcggg	gtccaccattagcacgcggg	NOUN
fnp-5188	53	49	(	(	PUNCT
fnp-5188	53	50	sigma	sigma	PROPN
fnp-5188	53	51	)	)	PUNCT
fnp-5188	53	52	.	.	PUNCT
fnp-5188	54	1	tgf	tgf	PROPN
fnp-5188	54	2	-	-	PUNCT
fnp-5188	54	3	β1	β1	PROPN
fnp-5188	54	4	-	-	PUNCT
fnp-5188	54	5	ko	ko	PROPN
fnp-5188	54	6	cells	cell	NOUN
fnp-5188	54	7	were	be	AUX
fnp-5188	54	8	subsequently	subsequently	ADV
fnp-5188	54	9	transfected	transfecte	VERB
fnp-5188	54	10	using	use	VERB
fnp-5188	54	11	mouse	mouse	NOUN
fnp-5188	54	12	tgfb2	tgfb2	PROPN
fnp-5188	54	13	guide	guide	PROPN
fnp-5188	54	14	rnas	rnas	PROPN
fnp-5188	54	15	(	(	PUNCT
fnp-5188	54	16	gcuccgcucgcgcucgcaggg	gcuccgcucgcgcucgcaggg	NOUN
fnp-5188	54	17	-	-	PUNCT
fnp-5188	54	18	uuuuagagcuaugcu	uuuuagagcuaugcu	NOUN
fnp-5188	54	19	and	and	CCONJ
fnp-5188	54	20	gcgccaccgggaccagaugcguuuuagagcuaugcu	gcgccaccgggaccagaugcguuuuagagcuaugcu	NOUN
fnp-5188	54	21	;	;	PUNCT
fnp-5188	54	22	integrated	integrate	VERB
fnp-5188	54	23	dna	dna	PROPN
fnp-5188	54	24	technology	technology	NOUN
fnp-5188	54	25	)	)	PUNCT
fnp-5188	54	26	as	as	SCONJ
fnp-5188	54	27	described	describe	VERB
fnp-5188	54	28	above	above	ADV
fnp-5188	54	29	.	.	PUNCT
fnp-5188	55	1	after	after	ADP
fnp-5188	55	2	sorting	sort	VERB
fnp-5188	55	3	and	and	CCONJ
fnp-5188	55	4	clonal	clonal	ADJ
fnp-5188	55	5	expansion	expansion	NOUN
fnp-5188	55	6	as	as	SCONJ
fnp-5188	55	7	described	describe	VERB
fnp-5188	55	8	above	above	ADV
fnp-5188	55	9	,	,	PUNCT
fnp-5188	55	10	the	the	DET
fnp-5188	55	11	tgf	tgf	PROPN
fnp-5188	55	12	-	-	PUNCT
fnp-5188	55	13	β2	β2	NOUN
fnp-5188	55	14	knockout	knockout	NOUN
fnp-5188	55	15	was	be	AUX
fnp-5188	55	16	analyzed	analyze	VERB
fnp-5188	55	17	by	by	ADP
fnp-5188	55	18	pcr	pcr	PROPN
fnp-5188	55	19	on	on	ADP
fnp-5188	55	20	genomic	genomic	ADJ
fnp-5188	55	21	dnausing	dnause	VERB
fnp-5188	55	22	tgf	tgf	PROPN
fnp-5188	55	23	-	-	PUNCT
fnp-5188	55	24	β2	β2	VERB
fnp-5188	55	25	specific	specific	ADJ
fnp-5188	55	26	primer	primer	NOUN
fnp-5188	55	27	(	(	PUNCT
fnp-5188	55	28	mtgfb2	mtgfb2	ADJ
fnp-5188	55	29	-	-	PUNCT
fnp-5188	55	30	frw	frw	NOUN
fnp-5188	55	31	cgtttcttccttttaaaaacatg	cgtttcttccttttaaaaacatg	NOUN
fnp-5188	55	32	and	and	CCONJ
fnp-5188	55	33	mtgfb2	mtgfb2	NOUN
fnp-5188	55	34	-	-	PUNCT
fnp-5188	55	35	rev	rev	PROPN
fnp-5188	55	36	tgtcgattttataaacctccttg	tgtcgattttataaacctccttg	PROPN
fnp-5188	55	37	;	;	PUNCT
fnp-5188	55	38	all	all	PRON
fnp-5188	55	39	from	from	ADP
fnp-5188	55	40	sigma	sigma	NOUN
fnp-5188	55	41	)	)	PUNCT
fnp-5188	55	42	.	.	PUNCT
fnp-5188	56	1	further	further	ADJ
fnp-5188	56	2	validation	validation	NOUN
fnp-5188	56	3	of	of	ADP
fnp-5188	56	4	the	the	DET
fnp-5188	56	5	double	double	ADJ
fnp-5188	56	6	knockout	knockout	NOUN
fnp-5188	56	7	was	be	AUX
fnp-5188	56	8	performed	perform	VERB
fnp-5188	56	9	by	by	ADP
fnp-5188	56	10	sequencing	sequence	VERB
fnp-5188	56	11	on	on	ADP
fnp-5188	56	12	an	an	DET
fnp-5188	56	13	abi	abi	NOUN
fnp-5188	56	14	sequencer	sequencer	NOUN
fnp-5188	56	15	using	use	VERB
fnp-5188	56	16	bigdye	bigdye	NOUN
fnp-5188	56	17	®	®	NOUN
fnp-5188	56	18	terminator	terminator	NOUN
fnp-5188	56	19	v	v	ADP
fnp-5188	56	20	3.0	3.0	NUM
fnp-5188	56	21	sequencing	sequence	VERB
fnp-5188	56	22	reaction	reaction	NOUN
fnp-5188	56	23	mix	mix	NOUN
fnp-5188	56	24	(	(	PUNCT
fnp-5188	56	25	applied	apply	VERB
fnp-5188	56	26	biosciences	bioscience	NOUN
fnp-5188	56	27	,	,	PUNCT
fnp-5188	56	28	carlsbad	carlsbad	PROPN
fnp-5188	56	29	,	,	PUNCT
fnp-5188	56	30	germany	germany	PROPN
fnp-5188	56	31	)	)	PUNCT
fnp-5188	56	32	.	.	PUNCT
fnp-5188	57	1	gl261	gl261	PROPN
fnp-5188	57	2	as	as	ADV
fnp-5188	57	3	well	well	ADV
fnp-5188	57	4	as	as	ADP
fnp-5188	57	5	gl261	gl261	PROPN
fnp-5188	57	6	-	-	PUNCT
fnp-5188	57	7	tgf	tgf	NOUN
fnp-5188	57	8	-	-	PUNCT
fnp-5188	57	9	β	β	NOUN
fnp-5188	57	10	-	-	PUNCT
fnp-5188	57	11	ko	ko	ADJ
fnp-5188	57	12	cells	cell	NOUN
fnp-5188	57	13	were	be	AUX
fnp-5188	57	14	grown	grow	VERB
fnp-5188	57	15	up	up	ADP
fnp-5188	57	16	and	and	CCONJ
fnp-5188	57	17	were	be	AUX
fnp-5188	57	18	transduced	transduce	VERB
fnp-5188	57	19	twice	twice	ADV
fnp-5188	57	20	with	with	ADP
fnp-5188	57	21	lenti	lenti	ADJ
fnp-5188	57	22	-	-	ADJ
fnp-5188	57	23	mcherry	mcherry	ADJ
fnp-5188	57	24	(	(	PUNCT
fnp-5188	57	25	addgene	addgene	ADJ
fnp-5188	57	26	;	;	PUNCT
fnp-5188	57	27	#	#	SYM
fnp-5188	57	28	36084	36084	NUM
fnp-5188	57	29	)	)	PUNCT
fnp-5188	57	30	.	.	PUNCT
fnp-5188	58	1	gl261mcherry	gl261mcherry	INTJ
fnp-5188	58	2	(	(	PUNCT
fnp-5188	58	3	par	par	NOUN
fnp-5188	58	4	)	)	PUNCT
fnp-5188	58	5	and	and	CCONJ
fnp-5188	58	6	gl261mcherry	gl261mcherry	PROPN
fnp-5188	58	7	-	-	PUNCT
fnp-5188	58	8	tgf	tgf	NOUN
fnp-5188	58	9	-	-	PUNCT
fnp-5188	58	10	β1/2	β1/2	NOUN
fnp-5188	58	11	-	-	PUNCT
fnp-5188	58	12	knockout	knockout	NOUN
fnp-5188	58	13	(	(	PUNCT
fnp-5188	58	14	tgf	tgf	PROPN
fnp-5188	58	15	-	-	PUNCT
fnp-5188	58	16	β	β	NOUN
fnp-5188	58	17	-	-	PUNCT
fnp-5188	58	18	ko	ko	ADJ
fnp-5188	58	19	)	)	PUNCT
fnp-5188	58	20	cells	cell	NOUN
fnp-5188	58	21	were	be	AUX
fnp-5188	58	22	subsequently	subsequently	ADV
fnp-5188	58	23	characterized	characterize	VERB
fnp-5188	58	24	in	in	ADP
fnp-5188	58	25	terms	term	NOUN
fnp-5188	58	26	of	of	ADP
fnp-5188	58	27	their	their	PRON
fnp-5188	58	28	proliferation	proliferation	NOUN
fnp-5188	58	29	and	and	CCONJ
fnp-5188	58	30	migration	migration	NOUN
fnp-5188	58	31	capacity	capacity	NOUN
fnp-5188	58	32	.	.	PUNCT
fnp-5188	59	1	for	for	ADP
fnp-5188	59	2	this	this	PRON
fnp-5188	59	3	,	,	PUNCT
fnp-5188	59	4	2.000	2.000	NUM
fnp-5188	59	5	cells	cell	NOUN
fnp-5188	59	6	were	be	AUX
fnp-5188	59	7	seeded	seed	VERB
fnp-5188	59	8	in	in	ADP
fnp-5188	59	9	microtiter	microtiter	ADJ
fnp-5188	59	10	plates	plate	NOUN
fnp-5188	59	11	and	and	CCONJ
fnp-5188	59	12	allowed	allow	VERB
fnp-5188	59	13	to	to	PART
fnp-5188	59	14	attach	attach	VERB
fnp-5188	59	15	.	.	PUNCT
fnp-5188	60	1	4	4	NUM
fnp-5188	60	2	h	h	NOUN
fnp-5188	60	3	after	after	ADP
fnp-5188	60	4	seeding	seed	VERB
fnp-5188	60	5	and	and	CCONJ
fnp-5188	60	6	subsequently	subsequently	ADV
fnp-5188	60	7	every	every	DET
fnp-5188	60	8	24	24	NUM
fnp-5188	60	9	h	h	NOUN
fnp-5188	60	10	later	later	ADV
fnp-5188	60	11	,	,	PUNCT
fnp-5188	60	12	cell	cell	NOUN
fnp-5188	60	13	density	density	NOUN
fnp-5188	60	14	was	be	AUX
fnp-5188	60	15	determined	determine	VERB
fnp-5188	60	16	by	by	ADP
fnp-5188	60	17	staining	stain	VERB
fnp-5188	60	18	the	the	DET
fnp-5188	60	19	cells	cell	NOUN
fnp-5188	60	20	with	with	ADP
fnp-5188	60	21	crystal	crystal	NOUN
fnp-5188	60	22	violet	violet	NOUN
fnp-5188	60	23	as	as	SCONJ
fnp-5188	60	24	described	describe	VERB
fnp-5188	60	25	[	[	X
fnp-5188	60	26	22	22	NUM
fnp-5188	60	27	]	]	PUNCT
fnp-5188	60	28	.	.	PUNCT
fnp-5188	61	1	to	to	PART
fnp-5188	61	2	determine	determine	VERB
fnp-5188	61	3	differences	difference	NOUN
fnp-5188	61	4	in	in	ADP
fnp-5188	61	5	cell	cell	NOUN
fnp-5188	61	6	motility	motility	NOUN
fnp-5188	61	7	,	,	PUNCT
fnp-5188	61	8	the	the	DET
fnp-5188	61	9	transwell	transwell	NOUN
fnp-5188	61	10	boyden	boyden	PROPN
fnp-5188	61	11	chamber	chamber	PROPN
fnp-5188	61	12	migration	migration	NOUN
fnp-5188	61	13	assay	assay	NOUN
fnp-5188	61	14	was	be	AUX
fnp-5188	61	15	used	use	VERB
fnp-5188	61	16	as	as	SCONJ
fnp-5188	61	17	described	describe	VERB
fnp-5188	61	18	[	[	X
fnp-5188	61	19	23	23	NUM
fnp-5188	61	20	]	]	PUNCT
fnp-5188	61	21	.	.	PUNCT
fnp-5188	62	1	briefly	briefly	NOUN
fnp-5188	62	2	,	,	PUNCT
fnp-5188	62	3	25.000	25.000	NUM
fnp-5188	62	4	par	par	NOUN
fnp-5188	62	5	or	or	CCONJ
fnp-5188	62	6	tgf	tgf	PROPN
fnp-5188	62	7	-	-	PUNCT
fnp-5188	62	8	β	β	NOUN
fnp-5188	62	9	-	-	PUNCT
fnp-5188	62	10	ko	ko	ADJ
fnp-5188	62	11	cells	cell	NOUN
fnp-5188	62	12	were	be	AUX
fnp-5188	62	13	treated	treat	VERB
fnp-5188	62	14	for	for	ADP
fnp-5188	62	15	3	3	NUM
fnp-5188	62	16	h	h	NOUN
fnp-5188	62	17	with	with	ADP
fnp-5188	62	18	mitomycin	mitomycin	PROPN
fnp-5188	62	19	(	(	PUNCT
fnp-5188	62	20	0.5	0.5	NUM
fnp-5188	62	21	 	 	SPACE
fnp-5188	62	22	µg	µg	NOUN
fnp-5188	62	23	/	/	SYM
fnp-5188	62	24	ml	ml	NOUN
fnp-5188	62	25	,	,	PUNCT
fnp-5188	62	26	sigma	sigma	PROPN
fnp-5188	62	27	)	)	PUNCT
fnp-5188	62	28	to	to	PART
fnp-5188	62	29	block	block	VERB
fnp-5188	62	30	proliferation	proliferation	NOUN
fnp-5188	62	31	,	,	PUNCT
fnp-5188	62	32	were	be	AUX
fnp-5188	62	33	washed	wash	VERB
fnp-5188	62	34	to	to	PART
fnp-5188	62	35	remove	remove	VERB
fnp-5188	62	36	residual	residual	ADJ
fnp-5188	62	37	mitomycin	mitomycin	NOUN
fnp-5188	62	38	,	,	PUNCT
fnp-5188	62	39	then	then	ADV
fnp-5188	62	40	seeded	seed	VERB
fnp-5188	62	41	in	in	ADP
fnp-5188	62	42	the	the	DET
fnp-5188	62	43	top	top	ADJ
fnp-5188	62	44	chamber	chamber	NOUN
fnp-5188	62	45	of	of	ADP
fnp-5188	62	46	an	an	DET
fnp-5188	62	47	8	8	NUM
fnp-5188	62	48	 	 	SPACE
fnp-5188	62	49	µm	µm	NOUN
fnp-5188	62	50	pore	pore	ADJ
fnp-5188	62	51	migration	migration	NOUN
fnp-5188	62	52	cassette	cassette	NOUN
fnp-5188	62	53	(	(	PUNCT
fnp-5188	62	54	corning	corning	NOUN
fnp-5188	62	55	,	,	PUNCT
fnp-5188	62	56	kaiserslautern	kaiserslautern	PROPN
fnp-5188	62	57	,	,	PUNCT
fnp-5188	62	58	germany	germany	PROPN
fnp-5188	62	59	)	)	PUNCT
fnp-5188	62	60	,	,	PUNCT
fnp-5188	62	61	and	and	CCONJ
fnp-5188	62	62	were	be	AUX
fnp-5188	62	63	allowed	allow	VERB
fnp-5188	62	64	to	to	PART
fnp-5188	62	65	migrate	migrate	VERB
fnp-5188	62	66	for	for	ADP
fnp-5188	62	67	24	24	NUM
fnp-5188	62	68	h.	h.	NOUN
fnp-5188	62	69	migrated	migrate	VERB
fnp-5188	62	70	cells	cell	NOUN
fnp-5188	62	71	on	on	ADP
fnp-5188	62	72	the	the	DET
fnp-5188	62	73	bottom	bottom	ADJ
fnp-5188	62	74	side	side	NOUN
fnp-5188	62	75	were	be	AUX
fnp-5188	62	76	stained	stain	VERB
fnp-5188	62	77	with	with	ADP
fnp-5188	62	78	crystal	crystal	NOUN
fnp-5188	62	79	violet	violet	NOUN
fnp-5188	62	80	and	and	CCONJ
fnp-5188	62	81	were	be	AUX
fnp-5188	62	82	counted	count	VERB
fnp-5188	62	83	manually	manually	ADV
fnp-5188	62	84	.	.	PUNCT
fnp-5188	63	1	as	as	ADP
fnp-5188	63	2	attraction	attraction	NOUN
fnp-5188	63	3	medium	medium	NOUN
fnp-5188	63	4	,	,	PUNCT
fnp-5188	63	5	conditioned	condition	VERB
fnp-5188	63	6	medium	medium	NOUN
fnp-5188	63	7	from	from	ADP
fnp-5188	63	8	nih/3t3	nih/3t3	NOUN
fnp-5188	63	9	cells	cell	NOUN
fnp-5188	63	10	was	be	AUX
fnp-5188	63	11	used	use	VERB
fnp-5188	63	12	.	.	PUNCT
fnp-5188	64	1	identification	identification	NOUN
fnp-5188	64	2	of	of	ADP
fnp-5188	64	3	the	the	DET
fnp-5188	64	4	murine	murine	ADJ
fnp-5188	64	5	rgs5	rgs5	PROPN
fnp-5188	64	6	minimal	minimal	ADJ
fnp-5188	64	7	promoter	promoter	NOUN
fnp-5188	64	8	dna	dna	NOUN
fnp-5188	64	9	fragments	fragment	NOUN
fnp-5188	64	10	of	of	ADP
fnp-5188	64	11	different	different	ADJ
fnp-5188	64	12	lengths	length	NOUN
fnp-5188	64	13	located	locate	VERB
fnp-5188	64	14	in	in	ADP
fnp-5188	64	15	the	the	DET
fnp-5188	64	16	mrgs5	mrgs5	NOUN
fnp-5188	64	17	promoter	promoter	NOUN
fnp-5188	64	18	region	region	NOUN
fnp-5188	64	19	(	(	PUNCT
fnp-5188	64	20	ensemble	ensemble	ADJ
fnp-5188	64	21	i	i	PROPN
fnp-5188	64	22	d	d	PROPN
fnp-5188	64	23	grcm39	grcm39	ADV
fnp-5188	64	24	:	:	PUNCT
fnp-5188	64	25	cm000994.3	cm000994.3	X
fnp-5188	64	26	)	)	PUNCT
fnp-5188	64	27	were	be	AUX
fnp-5188	64	28	amplified	amplify	VERB
fnp-5188	64	29	by	by	ADP
fnp-5188	64	30	pcr	pcr	PROPN
fnp-5188	64	31	from	from	ADP
fnp-5188	64	32	genomic	genomic	ADJ
fnp-5188	64	33	dna	dna	NOUN
fnp-5188	64	34	of	of	ADP
fnp-5188	64	35	c57bl6	c57bl6	NOUN
fnp-5188	64	36	using	use	VERB
fnp-5188	64	37	different	different	ADJ
fnp-5188	64	38	primer	primer	NOUN
fnp-5188	64	39	combinations	combination	NOUN
fnp-5188	64	40	(	(	PUNCT
fnp-5188	64	41	f1	f1	NOUN
fnp-5188	64	42	and	and	CCONJ
fnp-5188	64	43	f4	f4	PROPN
fnp-5188	64	44	,	,	PUNCT
fnp-5188	64	45	r1	r1	NOUN
fnp-5188	64	46	-	-	PUNCT
fnp-5188	64	47	r4	r4	NOUN
fnp-5188	64	48	;	;	PUNCT
fnp-5188	64	49	suppl	suppl	PROPN
fnp-5188	64	50	.	.	PROPN
fnp-5188	64	51	table	table	NOUN
fnp-5188	64	52	1	1	NUM
fnp-5188	64	53	,	,	PUNCT
fnp-5188	64	54	suppl	suppl	PROPN
fnp-5188	64	55	.	.	PUNCT
fnp-5188	65	1	fig	fig	NOUN
fnp-5188	65	2	.	.	PUNCT
fnp-5188	66	1	1	1	NUM
fnp-5188	66	2	)	)	PUNCT
fnp-5188	66	3	.	.	PUNCT
fnp-5188	67	1	nhei	nhei	NOUN
fnp-5188	67	2	and	and	CCONJ
fnp-5188	67	3	xbai	xbai	PROPN
fnp-5188	67	4	recognition	recognition	NOUN
fnp-5188	67	5	sites	site	NOUN
fnp-5188	67	6	were	be	AUX
fnp-5188	67	7	added	add	VERB
fnp-5188	67	8	to	to	ADP
fnp-5188	67	9	the	the	DET
fnp-5188	67	10	5	5	NUM
fnp-5188	67	11	’	'	PUNCT
fnp-5188	67	12	and	and	CCONJ
fnp-5188	67	13	3	3	NUM
fnp-5188	67	14	’	'	PUNCT
fnp-5188	67	15	ends	end	NOUN
fnp-5188	67	16	of	of	ADP
fnp-5188	67	17	the	the	DET
fnp-5188	67	18	primer	primer	NOUN
fnp-5188	67	19	.	.	PUNCT
fnp-5188	68	1	subsequently	subsequently	ADV
fnp-5188	68	2	,	,	PUNCT
fnp-5188	68	3	the	the	DET
fnp-5188	68	4	fragments	fragment	NOUN
fnp-5188	68	5	were	be	AUX
fnp-5188	68	6	cloned	clone	VERB
fnp-5188	68	7	into	into	ADP
fnp-5188	68	8	pcr	pcr	PROPN
fnp-5188	68	9	blunt	blunt	PROPN
fnp-5188	68	10	ii	ii	PROPN
fnp-5188	68	11	topo	topo	PROPN
fnp-5188	68	12	using	use	VERB
fnp-5188	68	13	the	the	DET
fnp-5188	68	14	zero	zero	NUM
fnp-5188	68	15	blunt	blunt	ADJ
fnp-5188	68	16	topo	topo	NOUN
fnp-5188	68	17	pcr	pcr	PROPN
fnp-5188	68	18	cloning	cloning	NOUN
fnp-5188	68	19	kit	kit	NOUN
fnp-5188	68	20	(	(	PUNCT
fnp-5188	68	21	thermofisher	thermofisher	PROPN
fnp-5188	68	22	scientific	scientific	PROPN
fnp-5188	68	23	,	,	PUNCT
fnp-5188	68	24	waltham	waltham	PROPN
fnp-5188	68	25	,	,	PUNCT
fnp-5188	68	26	ma	ma	PROPN
fnp-5188	68	27	,	,	PUNCT
fnp-5188	68	28	usa	usa	PROPN
fnp-5188	68	29	)	)	PUNCT
fnp-5188	68	30	and	and	CCONJ
fnp-5188	68	31	sequenced	sequence	VERB
fnp-5188	68	32	.	.	PUNCT
fnp-5188	69	1	after	after	ADP
fnp-5188	69	2	sequencing	sequence	VERB
fnp-5188	69	3	,	,	PUNCT
fnp-5188	69	4	the	the	DET
fnp-5188	69	5	fragments	fragment	NOUN
fnp-5188	69	6	were	be	AUX
fnp-5188	69	7	recloned	reclone	VERB
fnp-5188	69	8	into	into	ADP
fnp-5188	69	9	pgl4.10[luc2	pgl4.10[luc2	NOUN
fnp-5188	69	10	]	]	X
fnp-5188	69	11	(	(	PUNCT
fnp-5188	69	12	promega	promega	PROPN
fnp-5188	69	13	,	,	PUNCT
fnp-5188	69	14	madison	madison	PROPN
fnp-5188	69	15	,	,	PUNCT
fnp-5188	69	16	wi	wi	PROPN
fnp-5188	69	17	,	,	PUNCT
fnp-5188	69	18	usa	usa	PROPN
fnp-5188	69	19	)	)	PUNCT
fnp-5188	69	20	.	.	PUNCT
fnp-5188	70	1	to	to	PART
fnp-5188	70	2	identify	identify	VERB
fnp-5188	70	3	the	the	DET
fnp-5188	70	4	murine	murine	ADJ
fnp-5188	70	5	rgs5	rgs5	VERB
fnp-5188	70	6	minimal	minimal	ADJ
fnp-5188	70	7	promoter	promoter	NOUN
fnp-5188	70	8	,	,	PUNCT
fnp-5188	70	9	mbvps	mbvps	NOUN
fnp-5188	70	10	or	or	CCONJ
fnp-5188	70	11	gl261	gl261	PROPN
fnp-5188	70	12	cells	cell	NOUN
fnp-5188	70	13	were	be	AUX
fnp-5188	70	14	transfected	transfecte	VERB
fnp-5188	70	15	with	with	ADP
fnp-5188	70	16	the	the	DET
fnp-5188	70	17	appropriate	appropriate	ADJ
fnp-5188	70	18	plasmids	plasmid	NOUN
fnp-5188	70	19	expressing	express	VERB
fnp-5188	70	20	the	the	DET
fnp-5188	70	21	luciferase	luciferase	ADJ
fnp-5188	70	22	gene	gene	NOUN
fnp-5188	70	23	under	under	ADP
fnp-5188	70	24	the	the	DET
fnp-5188	70	25	control	control	NOUN
fnp-5188	70	26	of	of	ADP
fnp-5188	70	27	one	one	NUM
fnp-5188	70	28	of	of	ADP
fnp-5188	70	29	the	the	DET
fnp-5188	70	30	mrgs5	mrgs5	NOUN
fnp-5188	70	31	promoter	promoter	NOUN
fnp-5188	70	32	fragments	fragment	NOUN
fnp-5188	70	33	(	(	PUNCT
fnp-5188	70	34	mrgs5	mrgs5	NOUN
fnp-5188	70	35	-	-	PUNCT
fnp-5188	70	36	pro1	pro1	NOUN
fnp-5188	70	37	,	,	PUNCT
fnp-5188	70	38	2	2	NUM
fnp-5188	70	39	,	,	PUNCT
fnp-5188	70	40	3	3	NUM
fnp-5188	70	41	,	,	PUNCT
fnp-5188	70	42	11	11	NUM
fnp-5188	70	43	,	,	PUNCT
fnp-5188	70	44	12	12	NUM
fnp-5188	70	45	,	,	PUNCT
fnp-5188	70	46	14	14	NUM
fnp-5188	70	47	,	,	PUNCT
fnp-5188	70	48	15	15	NUM
fnp-5188	70	49	)	)	PUNCT
fnp-5188	70	50	,	,	PUNCT
fnp-5188	70	51	and	and	CCONJ
fnp-5188	70	52	a	a	DET
fnp-5188	70	53	luciferase	luciferase	NOUN
fnp-5188	70	54	assay	assay	NOUN
fnp-5188	70	55	was	be	AUX
fnp-5188	70	56	performed	perform	VERB
fnp-5188	70	57	48	48	NUM
fnp-5188	70	58	h	h	NOUN
fnp-5188	70	59	after	after	ADP
fnp-5188	70	60	transfection	transfection	NOUN
fnp-5188	70	61	using	use	VERB
fnp-5188	70	62	the	the	DET
fnp-5188	70	63	luc	luc	PROPN
fnp-5188	70	64	-	-	PUNCT
fnp-5188	70	65	pair	pair	NOUN
fnp-5188	70	66	™	™	ADJ
fnp-5188	70	67	firefly	firefly	NOUN
fnp-5188	70	68	luciferase	luciferase	NOUN
fnp-5188	70	69	hs	hs	PROPN
fnp-5188	70	70	assay	assay	PROPN
fnp-5188	70	71	kit	kit	NOUN
fnp-5188	70	72	(	(	PUNCT
fnp-5188	70	73	genecopoeia	genecopoeia	NOUN
fnp-5188	70	74	,	,	PUNCT
fnp-5188	70	75	cat	cat	NOUN
fnp-5188	70	76	#	#	NOUN
fnp-5188	70	77	lf007	lf007	NOUN
fnp-5188	70	78	)	)	PUNCT
fnp-5188	70	79	.	.	PUNCT
fnp-5188	71	1	lentivirus	lentivirus	PROPN
fnp-5188	71	2	cloning	cloning	NOUN
fnp-5188	71	3	and	and	CCONJ
fnp-5188	71	4	preparation	preparation	NOUN
fnp-5188	71	5	to	to	PART
fnp-5188	71	6	knockout	knockout	VERB
fnp-5188	71	7	slug	slug	NOUN
fnp-5188	71	8	in	in	ADP
fnp-5188	71	9	mural	mural	ADJ
fnp-5188	71	10	cells	cell	NOUN
fnp-5188	71	11	in	in	ADP
fnp-5188	71	12	vivo	vivo	NOUN
fnp-5188	71	13	,	,	PUNCT
fnp-5188	71	14	we	we	PRON
fnp-5188	71	15	generated	generate	VERB
fnp-5188	71	16	three	three	NUM
fnp-5188	71	17	different	different	ADJ
fnp-5188	71	18	lentiviruses	lentiviruse	NOUN
fnp-5188	71	19	using	use	VERB
fnp-5188	71	20	the	the	DET
fnp-5188	71	21	plenticrispr	plenticrispr	NOUN
fnp-5188	71	22	v2	v2	PROPN
fnp-5188	71	23	(	(	PUNCT
fnp-5188	72	1	addgene	addgene	PROPN
fnp-5188	72	2	cat	cat	NOUN
fnp-5188	72	3	#	#	NOUN
fnp-5188	72	4	52961	52961	NUM
fnp-5188	72	5	)	)	PUNCT
fnp-5188	72	6	system	system	NOUN
fnp-5188	72	7	in	in	ADP
fnp-5188	72	8	which	which	PRON
fnp-5188	72	9	the	the	DET
fnp-5188	72	10	murine	murine	NOUN
fnp-5188	72	11	slug	slug	VERB
fnp-5188	72	12	specific	specific	ADJ
fnp-5188	72	13	oligonucleotide	oligonucleotide	NOUN
fnp-5188	72	14	that	that	PRON
fnp-5188	72	15	serves	serve	VERB
fnp-5188	72	16	as	as	ADP
fnp-5188	72	17	sgrnas	sgrna	NOUN
fnp-5188	72	18	as	as	ADV
fnp-5188	72	19	well	well	ADV
fnp-5188	72	20	as	as	ADP
fnp-5188	72	21	the	the	DET
fnp-5188	72	22	cas9	cas9	NOUN
fnp-5188	72	23	enzyme	enzyme	NOUN
fnp-5188	72	24	,	,	PUNCT
fnp-5188	72	25	under	under	ADP
fnp-5188	72	26	control	control	NOUN
fnp-5188	72	27	of	of	ADP
fnp-5188	72	28	the	the	DET
fnp-5188	72	29	rgs5	rgs5	NOUN
fnp-5188	72	30	promoter	promoter	NOUN
fnp-5188	72	31	,	,	PUNCT
fnp-5188	72	32	are	be	AUX
fnp-5188	72	33	encoded	encode	VERB
fnp-5188	72	34	on	on	ADP
fnp-5188	72	35	one	one	NUM
fnp-5188	72	36	plasmid	plasmid	NOUN
fnp-5188	72	37	[	[	X
fnp-5188	72	38	24	24	NUM
fnp-5188	72	39	]	]	PUNCT
fnp-5188	72	40	.	.	PUNCT
fnp-5188	73	1	therefore	therefore	ADV
fnp-5188	73	2	,	,	PUNCT
fnp-5188	73	3	we	we	PRON
fnp-5188	73	4	removed	remove	VERB
fnp-5188	73	5	the	the	DET
fnp-5188	73	6	ef1α	ef1α	ADJ
fnp-5188	73	7	promoter	promoter	NOUN
fnp-5188	73	8	in	in	ADP
fnp-5188	73	9	front	front	NOUN
fnp-5188	73	10	of	of	ADP
fnp-5188	73	11	the	the	DET
fnp-5188	73	12	cas9	cas9	NOUN
fnp-5188	73	13	gene	gene	NOUN
fnp-5188	73	14	in	in	ADP
fnp-5188	73	15	plenticrispr	plenticrispr	NOUN
fnp-5188	73	16	v2	v2	PROPN
fnp-5188	73	17	and	and	CCONJ
fnp-5188	73	18	integrated	integrate	VERB
fnp-5188	73	19	the	the	DET
fnp-5188	73	20	identified	identify	VERB
fnp-5188	73	21	murine	murine	NOUN
fnp-5188	73	22	rgs5	rgs5	VERB
fnp-5188	73	23	minimal	minimal	ADJ
fnp-5188	73	24	promoter	promoter	NOUN
fnp-5188	73	25	fragment	fragment	NOUN
fnp-5188	73	26	at	at	ADP
fnp-5188	73	27	this	this	DET
fnp-5188	73	28	position	position	NOUN
fnp-5188	73	29	.	.	PUNCT
fnp-5188	74	1	in	in	ADP
fnp-5188	74	2	a	a	DET
fnp-5188	74	3	second	second	ADJ
fnp-5188	74	4	step	step	NOUN
fnp-5188	74	5	,	,	PUNCT
fnp-5188	74	6	we	we	PRON
fnp-5188	74	7	inserted	insert	VERB
fnp-5188	74	8	three	three	NUM
fnp-5188	74	9	different	different	ADJ
fnp-5188	74	10	oligos	oligo	NOUN
fnp-5188	74	11	(	(	PUNCT
fnp-5188	74	12	suppl	suppl	ADJ
fnp-5188	74	13	.	.	PUNCT
fnp-5188	74	14	table	table	NOUN
fnp-5188	74	15	2	2	NUM
fnp-5188	74	16	)	)	PUNCT
fnp-5188	74	17	that	that	PRON
fnp-5188	74	18	serve	serve	VERB
fnp-5188	74	19	as	as	ADP
fnp-5188	74	20	sgrnas	sgrnas	NOUN
fnp-5188	74	21	for	for	ADP
fnp-5188	74	22	the	the	DET
fnp-5188	74	23	knockout	knockout	NOUN
fnp-5188	74	24	of	of	ADP
fnp-5188	74	25	murine	murine	ADJ
fnp-5188	74	26	slug	slug	PROPN
fnp-5188	74	27	.	.	PUNCT
fnp-5188	75	1	slug	slug	PROPN
fnp-5188	75	2	/	/	SYM
fnp-5188	75	3	snai2	snai2	PROPN
fnp-5188	76	1	genomic	genomic	PROPN
fnp-5188	76	2	dna	dna	PROPN
fnp-5188	76	3	and	and	CCONJ
fnp-5188	76	4	cdna	cdna	PROPN
fnp-5188	76	5	sequences	sequence	NOUN
fnp-5188	76	6	were	be	AUX
fnp-5188	76	7	obtained	obtain	VERB
fnp-5188	76	8	from	from	ADP
fnp-5188	76	9	ensembl	ensembl	PROPN
fnp-5188	76	10	(	(	PUNCT
fnp-5188	76	11	ensmusg00000022676	ensmusg00000022676	PROPN
fnp-5188	76	12	)	)	PUNCT
fnp-5188	76	13	,	,	PUNCT
fnp-5188	76	14	the	the	DET
fnp-5188	76	15	crispr	crispr	ADJ
fnp-5188	76	16	guide	guide	NOUN
fnp-5188	76	17	design	design	NOUN
fnp-5188	76	18	tool	tool	NOUN
fnp-5188	76	19	was	be	AUX
fnp-5188	76	20	from	from	ADP
fnp-5188	76	21	benchling	benchle	VERB
fnp-5188	76	22	,	,	PUNCT
fnp-5188	76	23	in	in	SCONJ
fnp-5188	76	24	silico	silico	NOUN
fnp-5188	76	25	off	off	ADP
fnp-5188	76	26	-	-	PUNCT
fnp-5188	76	27	target	target	NOUN
fnp-5188	76	28	binding	bind	VERB
fnp-5188	76	29	prediction	prediction	NOUN
fnp-5188	76	30	was	be	AUX
fnp-5188	76	31	performed	perform	VERB
fnp-5188	76	32	using	use	VERB
fnp-5188	76	33	off	off	ADP
fnp-5188	76	34	-	-	PUNCT
fnp-5188	76	35	spotter	spotter	NOUN
fnp-5188	76	36	.	.	PUNCT
fnp-5188	77	1	the	the	DET
fnp-5188	77	2	cloning	cloning	NOUN
fnp-5188	77	3	strategy	strategy	NOUN
fnp-5188	77	4	is	be	AUX
fnp-5188	77	5	shown	show	VERB
fnp-5188	77	6	in	in	ADP
fnp-5188	77	7	suppl	suppl	PROPN
fnp-5188	77	8	.	.	PUNCT
fnp-5188	78	1	fig	fig	NOUN
fnp-5188	78	2	.	.	PUNCT
fnp-5188	79	1	2	2	X
fnp-5188	79	2	.	.	X
fnp-5188	79	3	lentiviral	lentiviral	ADJ
fnp-5188	79	4	particles	particle	NOUN
fnp-5188	79	5	were	be	AUX
fnp-5188	79	6	generated	generate	VERB
fnp-5188	79	7	by	by	ADP
fnp-5188	79	8	transfection	transfection	NOUN
fnp-5188	79	9	of	of	ADP
fnp-5188	79	10	hek293	hek293	ADJ
fnp-5188	79	11	ft	ft	NOUN
fnp-5188	79	12	cells	cell	NOUN
fnp-5188	79	13	with	with	ADP
fnp-5188	79	14	the	the	DET
fnp-5188	79	15	modified	modify	VERB
fnp-5188	79	16	plenticrispr	plenticrispr	NOUN
fnp-5188	79	17	v2	v2	NOUN
fnp-5188	79	18	plasmids	plasmid	NOUN
fnp-5188	79	19	in	in	ADP
fnp-5188	79	20	combination	combination	NOUN
fnp-5188	79	21	with	with	ADP
fnp-5188	79	22	plp1	plp1	PROPN
fnp-5188	79	23	,	,	PUNCT
fnp-5188	79	24	plp2	plp2	NOUN
fnp-5188	79	25	and	and	CCONJ
fnp-5188	79	26	plp	plp	NOUN
fnp-5188	79	27	-	-	PUNCT
fnp-5188	79	28	vsvg	vsvg	NOUN
fnp-5188	79	29	(	(	PUNCT
fnp-5188	79	30	the	the	DET
fnp-5188	79	31	latter	latter	ADJ
fnp-5188	79	32	three	three	NUM
fnp-5188	79	33	from	from	ADP
fnp-5188	79	34	invitrogen	invitrogen	PROPN
fnp-5188	79	35	,	,	PUNCT
fnp-5188	79	36	darmstadt	darmstadt	PROPN
fnp-5188	79	37	,	,	PUNCT
fnp-5188	79	38	germany	germany	PROPN
fnp-5188	79	39	)	)	PUNCT
fnp-5188	79	40	using	use	VERB
fnp-5188	79	41	the	the	DET
fnp-5188	79	42	mirus	mirus	NOUN
fnp-5188	79	43	transit	transit	NOUN
fnp-5188	79	44	-	-	PUNCT
fnp-5188	79	45	lenti	lenti	X
fnp-5188	79	46	reagent	reagent	NOUN
fnp-5188	79	47	(	(	PUNCT
fnp-5188	79	48	thermo	thermo	NOUN
fnp-5188	79	49	fisher	fisher	PROPN
fnp-5188	79	50	)	)	PUNCT
fnp-5188	79	51	.	.	PUNCT
fnp-5188	80	1	viral	viral	ADJ
fnp-5188	80	2	particles	particle	NOUN
fnp-5188	80	3	collected	collect	VERB
fnp-5188	80	4	from	from	ADP
fnp-5188	80	5	supernatants	supernatant	NOUN
fnp-5188	80	6	were	be	AUX
fnp-5188	80	7	concentrated	concentrate	VERB
fnp-5188	80	8	and	and	CCONJ
fnp-5188	80	9	purified	purified	ADJ
fnp-5188	80	10	using	use	VERB
fnp-5188	80	11	peg	peg	NOUN
fnp-5188	80	12	6000	6000	NUM
fnp-5188	80	13	precipitation	precipitation	NOUN
fnp-5188	80	14	as	as	SCONJ
fnp-5188	80	15	described	describe	VERB
fnp-5188	80	16	[	[	X
fnp-5188	80	17	25	25	NUM
fnp-5188	80	18	]	]	PUNCT
fnp-5188	80	19	.	.	PUNCT
fnp-5188	81	1	virus	virus	NOUN
fnp-5188	81	2	titers	titer	NOUN
fnp-5188	81	3	were	be	AUX
fnp-5188	81	4	determined	determine	VERB
fnp-5188	81	5	using	use	VERB
fnp-5188	81	6	quicktiter	quicktiter	NOUN
fnp-5188	81	7	™	™	PROPN
fnp-5188	81	8	titration	titration	NOUN
fnp-5188	81	9	kit	kit	NOUN
fnp-5188	81	10	(	(	PUNCT
fnp-5188	81	11	cell	cell	NOUN
fnp-5188	81	12	biolabs	biolabs	PROPN
fnp-5188	81	13	inc	inc	PROPN
fnp-5188	81	14	.	.	PROPN
fnp-5188	81	15	,	,	PUNCT
fnp-5188	81	16	san	san	PROPN
fnp-5188	81	17	diego	diego	PROPN
fnp-5188	81	18	,	,	PUNCT
fnp-5188	81	19	usa	usa	PROPN
fnp-5188	81	20	)	)	PUNCT
fnp-5188	81	21	and	and	CCONJ
fnp-5188	81	22	were	be	AUX
fnp-5188	81	23	stored	store	VERB
fnp-5188	81	24	in	in	ADP
fnp-5188	81	25	aliquots	aliquot	NOUN
fnp-5188	81	26	at	at	ADP
fnp-5188	81	27	-80	-80	NOUN
fnp-5188	81	28	 	 	SPACE
fnp-5188	81	29	°	°	NOUN
fnp-5188	81	30	c	c	NOUN
fnp-5188	81	31	.	.	PUNCT
fnp-5188	82	1	animal	animal	NOUN
fnp-5188	82	2	experiments	experiment	NOUN
fnp-5188	82	3	animal	animal	NOUN
fnp-5188	82	4	work	work	NOUN
fnp-5188	82	5	was	be	AUX
fnp-5188	82	6	performed	perform	VERB
fnp-5188	82	7	in	in	ADP
fnp-5188	82	8	accordance	accordance	NOUN
fnp-5188	82	9	with	with	ADP
fnp-5188	82	10	the	the	DET
fnp-5188	82	11	german	german	ADJ
fnp-5188	82	12	animal	animal	NOUN
fnp-5188	82	13	welfare	welfare	NOUN
fnp-5188	82	14	act	act	NOUN
fnp-5188	82	15	and	and	CCONJ
fnp-5188	82	16	its	its	PRON
fnp-5188	82	17	guidelines	guideline	NOUN
fnp-5188	82	18	(	(	PUNCT
fnp-5188	82	19	e.g.	e.g.	ADV
fnp-5188	82	20	3r	3r	NUM
fnp-5188	82	21	principle	principle	NOUN
fnp-5188	82	22	)	)	PUNCT
fnp-5188	82	23	and	and	CCONJ
fnp-5188	82	24	was	be	AUX
fnp-5188	82	25	approved	approve	VERB
fnp-5188	82	26	by	by	ADP
fnp-5188	82	27	the	the	DET
fnp-5188	82	28	regional	regional	ADJ
fnp-5188	82	29	council	council	PROPN
fnp-5188	82	30	of	of	ADP
fnp-5188	82	31	tübingen	tübingen	PROPN
fnp-5188	82	32	(	(	PUNCT
fnp-5188	82	33	approval	approval	NOUN
fnp-5188	82	34	n05/17	n05/17	NOUN
fnp-5188	82	35	)	)	PUNCT
fnp-5188	82	36	.	.	PUNCT
fnp-5188	83	1	rgs5	rgs5	ADJ
fnp-5188	83	2	-	-	PUNCT
fnp-5188	83	3	gfp	gfp	PROPN
fnp-5188	83	4	pericyte	pericyte	NOUN
fnp-5188	83	5	reporter	reporter	NOUN
fnp-5188	83	6	mice	mouse	NOUN
fnp-5188	83	7	,	,	PUNCT
fnp-5188	83	8	which	which	PRON
fnp-5188	83	9	express	express	VERB
fnp-5188	83	10	gfp	gfp	NOUN
fnp-5188	83	11	under	under	ADP
fnp-5188	83	12	the	the	DET
fnp-5188	83	13	control	control	NOUN
fnp-5188	83	14	of	of	ADP
fnp-5188	83	15	the	the	DET
fnp-5188	83	16	rgs5	rgs5	NOUN
fnp-5188	83	17	promoter	promoter	NOUN
fnp-5188	83	18	,	,	PUNCT
fnp-5188	83	19	were	be	AUX
fnp-5188	83	20	from	from	ADP
fnp-5188	83	21	the	the	DET
fnp-5188	83	22	karolinska	karolinska	PROPN
fnp-5188	83	23	institute	institute	PROPN
fnp-5188	83	24	(	(	PUNCT
fnp-5188	83	25	stockholm	stockholm	PROPN
fnp-5188	83	26	,	,	PUNCT
fnp-5188	83	27	sweden	sweden	PROPN
fnp-5188	83	28	)	)	PUNCT
fnp-5188	83	29	and	and	CCONJ
fnp-5188	83	30	are	be	AUX
fnp-5188	83	31	described	describe	VERB
fnp-5188	83	32	in	in	ADP
fnp-5188	83	33	detail	detail	NOUN
fnp-5188	83	34	in	in	ADP
fnp-5188	83	35	[	[	X
fnp-5188	83	36	26	26	NUM
fnp-5188	83	37	]	]	PUNCT
fnp-5188	83	38	.	.	PUNCT
fnp-5188	84	1	the	the	DET
fnp-5188	84	2	mice	mouse	NOUN
fnp-5188	84	3	were	be	AUX
fnp-5188	84	4	bred	breed	VERB
fnp-5188	84	5	in	in	ADP
fnp-5188	84	6	the	the	DET
fnp-5188	84	7	animal	animal	NOUN
fnp-5188	84	8	facility	facility	NOUN
fnp-5188	84	9	of	of	ADP
fnp-5188	84	10	the	the	DET
fnp-5188	84	11	institute	institute	NOUN
fnp-5188	84	12	under	under	ADP
fnp-5188	84	13	spf	spf	ADJ
fnp-5188	84	14	conditions	condition	NOUN
fnp-5188	84	15	and	and	CCONJ
fnp-5188	84	16	used	use	VERB
fnp-5188	84	17	at	at	ADP
fnp-5188	84	18	an	an	DET
fnp-5188	84	19	age	age	NOUN
fnp-5188	84	20	of	of	ADP
fnp-5188	84	21	3	3	NUM
fnp-5188	84	22	9	9	NUM
fnp-5188	84	23	months	month	NOUN
fnp-5188	84	24	.	.	PUNCT
fnp-5188	85	1	the	the	DET
fnp-5188	85	2	specificity	specificity	NOUN
fnp-5188	85	3	of	of	ADP
fnp-5188	85	4	gfp	gfp	PROPN
fnp-5188	85	5	positivity	positivity	NOUN
fnp-5188	85	6	to	to	PART
fnp-5188	85	7	vamcs	vamcs	VERB
fnp-5188	85	8	in	in	ADP
fnp-5188	85	9	the	the	DET
fnp-5188	85	10	brain	brain	NOUN
fnp-5188	85	11	was	be	AUX
fnp-5188	85	12	determined	determine	VERB
fnp-5188	85	13	by	by	ADP
fnp-5188	85	14	immunofluorescence	immunofluorescence	NOUN
fnp-5188	85	15	for	for	ADP
fnp-5188	85	16	gfp	gfp	NOUN
fnp-5188	85	17	in	in	ADP
fnp-5188	85	18	parallel	parallel	NOUN
fnp-5188	85	19	with	with	ADP
fnp-5188	85	20	the	the	DET
fnp-5188	85	21	staining	staining	NOUN
fnp-5188	85	22	of	of	ADP
fnp-5188	85	23	ecs	ecs	PROPN
fnp-5188	85	24	using	use	VERB
fnp-5188	85	25	a	a	DET
fnp-5188	85	26	cd31	cd31	PROPN
fnp-5188	85	27	specific	specific	NOUN
fnp-5188	85	28	,	,	PUNCT
fnp-5188	85	29	fluorochrome	fluorochrome	NOUN
fnp-5188	85	30	coupled	couple	VERB
fnp-5188	85	31	antibody	antibody	NOUN
fnp-5188	85	32	.	.	PUNCT
fnp-5188	86	1	to	to	PART
fnp-5188	86	2	determine	determine	VERB
fnp-5188	86	3	the	the	DET
fnp-5188	86	4	growth	growth	NOUN
fnp-5188	86	5	of	of	ADP
fnp-5188	86	6	gl261	gl261	PROPN
fnp-5188	86	7	parental	parental	ADJ
fnp-5188	86	8	(	(	PUNCT
fnp-5188	86	9	par	par	NOUN
fnp-5188	86	10	)	)	PUNCT
fnp-5188	86	11	and	and	CCONJ
fnp-5188	86	12	tgf	tgf	PROPN
fnp-5188	86	13	-	-	PUNCT
fnp-5188	86	14	β	β	NOUN
fnp-5188	86	15	-	-	PUNCT
fnp-5188	86	16	knockout	knockout	NOUN
fnp-5188	86	17	(	(	PUNCT
fnp-5188	86	18	tgf	tgf	PROPN
fnp-5188	86	19	-	-	PUNCT
fnp-5188	86	20	β	β	NOUN
fnp-5188	86	21	-	-	PUNCT
fnp-5188	86	22	ko	ko	ADJ
fnp-5188	86	23	)	)	PUNCT
fnp-5188	86	24	tumors	tumor	NOUN
fnp-5188	86	25	,	,	PUNCT
fnp-5188	86	26	under	under	ADP
fnp-5188	86	27	anesthesia	anesthesia	NOUN
fnp-5188	86	28	and	and	CCONJ
fnp-5188	86	29	analgesia	analgesia	NOUN
fnp-5188	86	30	the	the	DET
fnp-5188	86	31	cells	cell	NOUN
fnp-5188	86	32	were	be	AUX
fnp-5188	86	33	stereotaxtically	stereotaxtically	ADV
fnp-5188	86	34	implanted	implant	VERB
fnp-5188	86	35	into	into	ADP
fnp-5188	86	36	the	the	DET
fnp-5188	86	37	right	right	ADJ
fnp-5188	86	38	striatum	striatum	NOUN
fnp-5188	86	39	of	of	ADP
fnp-5188	86	40	the	the	DET
fnp-5188	86	41	mice	mouse	NOUN
fnp-5188	86	42	at	at	ADP
fnp-5188	86	43	the	the	DET
fnp-5188	86	44	following	following	ADJ
fnp-5188	86	45	coordinates	coordinate	NOUN
fnp-5188	86	46	(	(	PUNCT
fnp-5188	86	47	1	1	NUM
fnp-5188	86	48	 	 	SPACE
fnp-5188	86	49	mm	mm	PROPN
fnp-5188	86	50	rostral	rostral	ADJ
fnp-5188	86	51	,	,	PUNCT
fnp-5188	86	52	2	2	NUM
fnp-5188	86	53	 	 	SPACE
fnp-5188	86	54	mm	mm	NOUN
fnp-5188	86	55	lateral	lateral	NOUN
fnp-5188	86	56	of	of	ADP
fnp-5188	86	57	the	the	DET
fnp-5188	86	58	bregma	bregma	NOUN
fnp-5188	86	59	,	,	PUNCT
fnp-5188	86	60	3	3	NUM
fnp-5188	86	61	 	 	SPACE
fnp-5188	86	62	mm	mm	NOUN
fnp-5188	86	63	in	in	ADP
fnp-5188	86	64	depth	depth	NOUN
fnp-5188	86	65	,	,	PUNCT
fnp-5188	86	66	using	use	VERB
fnp-5188	86	67	the	the	DET
fnp-5188	86	68	mouse	mouse	NOUN
fnp-5188	86	69	brain	brain	NOUN
fnp-5188	86	70	atlas	atlas	PROPN
fnp-5188	86	71	coordinates	coordinates	PROPN
fnp-5188	86	72	;	;	PUNCT
fnp-5188	86	73	the	the	DET
fnp-5188	86	74	mouse	mouse	NOUN
fnp-5188	86	75	brain	brain	NOUN
fnp-5188	86	76	atlas	atlas	PROPN
fnp-5188	86	77	(	(	PUNCT
fnp-5188	86	78	gaidi.ca	gaidi.ca	NOUN
fnp-5188	86	79	)	)	PUNCT
fnp-5188	86	80	)	)	PUNCT
fnp-5188	86	81	.	.	PUNCT
fnp-5188	87	1	the	the	DET
fnp-5188	87	2	mice	mouse	NOUN
fnp-5188	87	3	were	be	AUX
fnp-5188	87	4	intensively	intensively	ADV
fnp-5188	87	5	monitored	monitor	VERB
fnp-5188	87	6	to	to	PART
fnp-5188	87	7	avoid	avoid	VERB
fnp-5188	87	8	and	and	CCONJ
fnp-5188	87	9	reduce	reduce	VERB
fnp-5188	87	10	pain	pain	NOUN
fnp-5188	87	11	.	.	PUNCT
fnp-5188	88	1	magnetic	magnetic	ADJ
fnp-5188	88	2	resonance	resonance	NOUN
fnp-5188	88	3	imaging	imaging	NOUN
fnp-5188	88	4	(	(	PUNCT
fnp-5188	88	5	mri	mri	NOUN
fnp-5188	88	6	)	)	PUNCT
fnp-5188	88	7	analyses	analysis	NOUN
fnp-5188	88	8	using	use	VERB
fnp-5188	88	9	intravenously	intravenously	ADV
fnp-5188	88	10	applied	apply	VERB
fnp-5188	88	11	gadovist	gadovist	NOUN
fnp-5188	88	12	(	(	PUNCT
fnp-5188	88	13	600	600	NUM
fnp-5188	88	14	mg	mg	NUM
fnp-5188	88	15	/	/	SYM
fnp-5188	88	16	kg	kg	PROPN
fnp-5188	88	17	of	of	ADP
fnp-5188	88	18	body	body	NOUN
fnp-5188	88	19	weight	weight	NOUN
fnp-5188	88	20	)	)	PUNCT
fnp-5188	88	21	were	be	AUX
fnp-5188	88	22	performed	perform	VERB
fnp-5188	88	23	thrice	thrice	NOUN
fnp-5188	88	24	to	to	PART
fnp-5188	88	25	determine	determine	VERB
fnp-5188	88	26	tumor	tumor	NOUN
fnp-5188	88	27	growth	growth	NOUN
fnp-5188	88	28	.	.	PUNCT
fnp-5188	89	1	to	to	PART
fnp-5188	89	2	investigate	investigate	VERB
fnp-5188	89	3	alteration	alteration	NOUN
fnp-5188	89	4	in	in	ADP
fnp-5188	89	5	tumor	tumor	NOUN
fnp-5188	89	6	angiogenesis	angiogenesis	NOUN
fnp-5188	89	7	induced	induce	VERB
fnp-5188	89	8	by	by	ADP
fnp-5188	89	9	the	the	DET
fnp-5188	89	10	knockout	knockout	NOUN
fnp-5188	89	11	of	of	ADP
fnp-5188	89	12	tgf	tgf	PROPN
fnp-5188	89	13	-	-	PUNCT
fnp-5188	89	14	β	β	PROPN
fnp-5188	89	15	in	in	ADP
fnp-5188	89	16	gbm	gbm	NOUN
fnp-5188	89	17	cells	cell	NOUN
fnp-5188	89	18	,	,	PUNCT
fnp-5188	89	19	either	either	CCONJ
fnp-5188	89	20	100.000	100.000	NUM
fnp-5188	89	21	par	par	NOUN
fnp-5188	89	22	or	or	CCONJ
fnp-5188	89	23	tgf	tgf	PROPN
fnp-5188	89	24	-	-	PUNCT
fnp-5188	89	25	β	β	NOUN
fnp-5188	89	26	-	-	PUNCT
fnp-5188	89	27	ko	ko	ADJ
fnp-5188	89	28	cells	cell	NOUN
fnp-5188	89	29	were	be	AUX
fnp-5188	89	30	intrastriatally	intrastriatally	ADV
fnp-5188	89	31	implanted	implant	VERB
fnp-5188	89	32	as	as	ADP
fnp-5188	89	33	described	describe	VERB
fnp-5188	89	34	above	above	ADV
fnp-5188	89	35	.	.	PUNCT
fnp-5188	90	1	the	the	DET
fnp-5188	90	2	mice	mouse	NOUN
fnp-5188	90	3	were	be	AUX
fnp-5188	90	4	sacrificed	sacrifice	VERB
fnp-5188	90	5	when	when	SCONJ
fnp-5188	90	6	the	the	DET
fnp-5188	90	7	tumors	tumor	NOUN
fnp-5188	90	8	reached	reach	VERB
fnp-5188	90	9	a	a	DET
fnp-5188	90	10	median	median	ADJ
fnp-5188	90	11	size	size	NOUN
fnp-5188	90	12	of	of	ADP
fnp-5188	90	13	1.5	1.5	NUM
fnp-5188	90	14	2.5	2.5	NUM
fnp-5188	90	15	 	 	SPACE
fnp-5188	90	16	mm	mm	NOUN
fnp-5188	90	17	as	as	SCONJ
fnp-5188	90	18	determined	determine	VERB
fnp-5188	90	19	in	in	ADP
fnp-5188	90	20	a	a	DET
fnp-5188	90	21	preliminary	preliminary	ADJ
fnp-5188	90	22	experiment	experiment	NOUN
fnp-5188	90	23	.	.	PUNCT
fnp-5188	91	1	brains	brain	NOUN
fnp-5188	91	2	were	be	AUX
fnp-5188	91	3	collected	collect	VERB
fnp-5188	91	4	and	and	CCONJ
fnp-5188	91	5	processed	process	VERB
fnp-5188	91	6	for	for	ADP
fnp-5188	91	7	further	further	ADJ
fnp-5188	91	8	analyses	analysis	NOUN
fnp-5188	91	9	.	.	PUNCT
fnp-5188	92	1	to	to	PART
fnp-5188	92	2	knockout	knockout	VERB
fnp-5188	92	3	slug	slug	NOUN
fnp-5188	92	4	in	in	ADP
fnp-5188	92	5	vamcs	vamcs	NOUN
fnp-5188	92	6	in	in	ADP
fnp-5188	92	7	the	the	DET
fnp-5188	92	8	tumor	tumor	NOUN
fnp-5188	92	9	region	region	NOUN
fnp-5188	92	10	,	,	PUNCT
fnp-5188	92	11	either	either	CCONJ
fnp-5188	92	12	3x105	3x105	NUM
fnp-5188	92	13	infectious	infectious	ADJ
fnp-5188	92	14	particles	particle	NOUN
fnp-5188	92	15	of	of	ADP
fnp-5188	92	16	lenti	lenti	ADJ
fnp-5188	92	17	-	-	ADJ
fnp-5188	92	18	crispr	crispr	ADJ
fnp-5188	92	19	v2	v2	PROPN
fnp-5188	92	20	(	(	PUNCT
fnp-5188	92	21	control	control	NOUN
fnp-5188	92	22	virus	virus	PROPN
fnp-5188	92	23	)	)	PUNCT
fnp-5188	92	24	or	or	CCONJ
fnp-5188	92	25	a	a	DET
fnp-5188	92	26	mixture	mixture	NOUN
fnp-5188	92	27	of	of	ADP
fnp-5188	92	28	three	three	NUM
fnp-5188	92	29	lenti	lenti	VERB
fnp-5188	92	30	-	-	ADJ
fnp-5188	92	31	slug	slug	VERB
fnp-5188	92	32	-	-	PUNCT
fnp-5188	92	33	ko	ko	PROPN
fnp-5188	92	34	viruses	virus	NOUN
fnp-5188	92	35	were	be	AUX
fnp-5188	92	36	intrastriatally	intrastriatally	ADV
fnp-5188	92	37	injected	inject	VERB
fnp-5188	92	38	3	3	NUM
fnp-5188	92	39	days	day	NOUN
fnp-5188	92	40	before	before	SCONJ
fnp-5188	92	41	par	par	NOUN
fnp-5188	92	42	cells	cell	NOUN
fnp-5188	92	43	were	be	AUX
fnp-5188	92	44	implanted	implant	VERB
fnp-5188	92	45	using	use	VERB
fnp-5188	92	46	the	the	DET
fnp-5188	92	47	same	same	ADJ
fnp-5188	92	48	brain	brain	NOUN
fnp-5188	92	49	coordinates	coordinate	NOUN
fnp-5188	92	50	as	as	SCONJ
fnp-5188	92	51	described	describe	VERB
fnp-5188	92	52	above	above	ADV
fnp-5188	92	53	.	.	PUNCT
fnp-5188	93	1	histology	histology	NOUN
fnp-5188	93	2	and	and	CCONJ
fnp-5188	93	3	immunofluorescence	immunofluorescence	NOUN
fnp-5188	93	4	brains	brain	NOUN
fnp-5188	93	5	were	be	AUX
fnp-5188	93	6	collected	collect	VERB
fnp-5188	93	7	and	and	CCONJ
fnp-5188	93	8	fixed	fix	VERB
fnp-5188	93	9	in	in	ADP
fnp-5188	93	10	4	4	NUM
fnp-5188	93	11	 	 	SPACE
fnp-5188	93	12	%	%	NOUN
fnp-5188	93	13	paraformaldehyde	paraformaldehyde	NOUN
fnp-5188	93	14	(	(	PUNCT
fnp-5188	93	15	pfa	pfa	NOUN
fnp-5188	93	16	)	)	PUNCT
fnp-5188	93	17	for	for	ADP
fnp-5188	93	18	20	20	NUM
fnp-5188	93	19	hours	hour	NOUN
fnp-5188	93	20	.	.	PUNCT
fnp-5188	94	1	after	after	ADP
fnp-5188	94	2	subsequent	subsequent	ADJ
fnp-5188	94	3	dehydration	dehydration	NOUN
fnp-5188	94	4	via	via	ADP
fnp-5188	94	5	sucrose	sucrose	PROPN
fnp-5188	94	6	gradient	gradient	NOUN
fnp-5188	94	7	,	,	PUNCT
fnp-5188	94	8	the	the	DET
fnp-5188	94	9	cells	cell	NOUN
fnp-5188	94	10	were	be	AUX
fnp-5188	94	11	embedded	embed	VERB
fnp-5188	94	12	in	in	ADP
fnp-5188	94	13	tissue	tissue	NOUN
fnp-5188	94	14	tek	tek	NOUN
fnp-5188	95	1	(	(	PUNCT
fnp-5188	95	2	sakura	sakura	NOUN
fnp-5188	95	3	finetek	finetek	PROPN
fnp-5188	95	4	,	,	PUNCT
fnp-5188	95	5	alphen	alphen	PROPN
fnp-5188	95	6	aan	aan	PROPN
fnp-5188	95	7	den	den	PROPN
fnp-5188	95	8	rijn	rijn	PROPN
fnp-5188	95	9	,	,	PUNCT
fnp-5188	95	10	the	the	DET
fnp-5188	95	11	netherlands	netherlands	PROPN
fnp-5188	95	12	)	)	PUNCT
fnp-5188	95	13	and	and	CCONJ
fnp-5188	95	14	were	be	AUX
fnp-5188	95	15	stored	store	VERB
fnp-5188	95	16	frozen	frozen	ADJ
fnp-5188	95	17	at	at	ADP
fnp-5188	95	18	-80	-80	SYM
fnp-5188	95	19	 	 	SPACE
fnp-5188	95	20	°	°	NOUN
fnp-5188	95	21	c	c	NOUN
fnp-5188	95	22	.	.	PUNCT
fnp-5188	96	1	sectioning	section	VERB
fnp-5188	96	2	(	(	PUNCT
fnp-5188	96	3	10	10	NUM
fnp-5188	96	4	 	 	SPACE
fnp-5188	96	5	µm	µm	NOUN
fnp-5188	96	6	slices	slice	NOUN
fnp-5188	96	7	)	)	PUNCT
fnp-5188	96	8	was	be	AUX
fnp-5188	96	9	performed	perform	VERB
fnp-5188	96	10	on	on	ADP
fnp-5188	96	11	a	a	DET
fnp-5188	96	12	leica	leica	PROPN
fnp-5188	96	13	cm3050	cm3050	PROPN
fnp-5188	96	14	cryotome	cryotome	NOUN
fnp-5188	96	15	using	use	VERB
fnp-5188	96	16	superfrost	superfrost	NOUN
fnp-5188	96	17	™	™	ADJ
fnp-5188	96	18	plus	plus	CCONJ
fnp-5188	96	19	slides	slide	NOUN
fnp-5188	96	20	(	(	PUNCT
fnp-5188	96	21	r.	r.	PROPN
fnp-5188	96	22	langenbrinck	langenbrinck	PROPN
fnp-5188	96	23	gmbh	gmbh	PROPN
fnp-5188	96	24	)	)	PUNCT
fnp-5188	96	25	.	.	PUNCT
fnp-5188	97	1	for	for	ADP
fnp-5188	97	2	if	if	SCONJ
fnp-5188	97	3	staining	stain	VERB
fnp-5188	97	4	,	,	PUNCT
fnp-5188	97	5	samples	sample	NOUN
fnp-5188	97	6	were	be	AUX
fnp-5188	97	7	permeabilized	permeabilize	VERB
fnp-5188	97	8	in	in	ADP
fnp-5188	97	9	pbs	pbs	NOUN
fnp-5188	97	10	containing	contain	VERB
fnp-5188	97	11	0.2	0.2	NUM
fnp-5188	97	12	 	 	SPACE
fnp-5188	97	13	%	%	NOUN
fnp-5188	97	14	triton	triton	PROPN
fnp-5188	97	15	®	®	PROPN
fnp-5188	97	16	x-100	x-100	PROPN
fnp-5188	97	17	and	and	CCONJ
fnp-5188	97	18	blocked	block	VERB
fnp-5188	97	19	in	in	ADP
fnp-5188	97	20	5	5	NUM
fnp-5188	97	21	 	 	SPACE
fnp-5188	97	22	%	%	NOUN
fnp-5188	97	23	bovine	bovine	NOUN
fnp-5188	97	24	serum	serum	NOUN
fnp-5188	97	25	albumin	albumin	NOUN
fnp-5188	97	26	(	(	PUNCT
fnp-5188	97	27	bsa)/	bsa)/	NOUN
fnp-5188	97	28	0.5	0.5	NUM
fnp-5188	97	29	 	 	SPACE
fnp-5188	97	30	%	%	NOUN
fnp-5188	97	31	triton	triton	PROPN
fnp-5188	97	32	®	®	PROPN
fnp-5188	97	33	x-100	x-100	PROPN
fnp-5188	97	34	.	.	PUNCT
fnp-5188	98	1	the	the	DET
fnp-5188	98	2	respective	respective	ADJ
fnp-5188	98	3	primary	primary	ADJ
fnp-5188	98	4	antibody	antibody	NOUN
fnp-5188	98	5	dilutions	dilution	NOUN
fnp-5188	98	6	were	be	AUX
fnp-5188	98	7	used	use	VERB
fnp-5188	98	8	for	for	ADP
fnp-5188	98	9	overnight	overnight	ADJ
fnp-5188	98	10	incubation	incubation	NOUN
fnp-5188	98	11	at	at	ADP
fnp-5188	98	12	4	4	NUM
fnp-5188	98	13	 	 	SPACE
fnp-5188	98	14	°	°	NOUN
fnp-5188	98	15	c	c	NOUN
fnp-5188	98	16	:	:	PUNCT
fnp-5188	98	17	αsma	αsma	NOUN
fnp-5188	98	18	,	,	PUNCT
fnp-5188	98	19	1:100	1:100	NUM
fnp-5188	98	20	;	;	PUNCT
fnp-5188	98	21	cd140b	cd140b	PROPN
fnp-5188	98	22	,	,	PUNCT
fnp-5188	98	23	1:100	1:100	NUM
fnp-5188	98	24	;	;	PUNCT
fnp-5188	98	25	cd31	cd31	PROPN
fnp-5188	98	26	,	,	PUNCT
fnp-5188	98	27	1:100	1:100	NUM
fnp-5188	98	28	;	;	PUNCT
fnp-5188	98	29	gfp	gfp	PROPN
fnp-5188	98	30	,	,	PUNCT
fnp-5188	98	31	1:100	1:100	NUM
fnp-5188	98	32	(	(	PUNCT
fnp-5188	98	33	all	all	ADV
fnp-5188	98	34	from	from	ADP
fnp-5188	98	35	invitrogen	invitrogen	PROPN
fnp-5188	98	36	,	,	PUNCT
fnp-5188	98	37	carlsbad	carlsbad	PROPN
fnp-5188	98	38	,	,	PUNCT
fnp-5188	98	39	ca	ca	PROPN
fnp-5188	98	40	,	,	PUNCT
fnp-5188	98	41	usa	usa	PROPN
fnp-5188	98	42	)	)	PUNCT
fnp-5188	98	43	.	.	PUNCT
fnp-5188	99	1	excess	excess	ADJ
fnp-5188	99	2	primary	primary	ADJ
fnp-5188	99	3	antibodies	antibody	NOUN
fnp-5188	99	4	were	be	AUX
fnp-5188	99	5	removed	remove	VERB
fnp-5188	99	6	by	by	ADP
fnp-5188	99	7	washing	wash	VERB
fnp-5188	99	8	the	the	DET
fnp-5188	99	9	slides	slide	NOUN
fnp-5188	99	10	thrice	thrice	NOUN
fnp-5188	99	11	in	in	ADP
fnp-5188	99	12	pbs	pbs	PROPN
fnp-5188	99	13	.	.	PUNCT
fnp-5188	100	1	the	the	DET
fnp-5188	100	2	following	follow	VERB
fnp-5188	100	3	fluorescence	fluorescence	NOUN
fnp-5188	100	4	labeled	label	VERB
fnp-5188	100	5	antibodies	antibody	NOUN
fnp-5188	100	6	were	be	AUX
fnp-5188	100	7	used	use	VERB
fnp-5188	100	8	for	for	ADP
fnp-5188	100	9	incubation	incubation	NOUN
fnp-5188	100	10	at	at	ADP
fnp-5188	100	11	room	room	NOUN
fnp-5188	100	12	temperature	temperature	NOUN
fnp-5188	100	13	for	for	ADP
fnp-5188	100	14	90	90	NUM
fnp-5188	100	15	minutes	minute	NOUN
fnp-5188	100	16	:	:	PUNCT
fnp-5188	100	17	goat	goat	PROPN
fnp-5188	100	18	anti	anti	ADJ
fnp-5188	100	19	-	-	ADJ
fnp-5188	100	20	chicken	chicken	ADJ
fnp-5188	100	21	alexa	alexa	NOUN
fnp-5188	100	22	fluor	fluor	NOUN
fnp-5188	100	23	™	™	NOUN
fnp-5188	100	24	488	488	NUM
fnp-5188	100	25	,	,	PUNCT
fnp-5188	100	26	1:1000	1:1000	NUM
fnp-5188	100	27	;	;	PUNCT
fnp-5188	100	28	goat	goat	PROPN
fnp-5188	100	29	anti	anti	ADJ
fnp-5188	100	30	-	-	ADJ
fnp-5188	100	31	rabbit	rabbit	ADJ
fnp-5188	100	32	alexa	alexa	ADJ
fnp-5188	100	33	fluor	fluor	NOUN
fnp-5188	100	34	™	™	NOUN
fnp-5188	100	35	405	405	NUM
fnp-5188	100	36	,	,	PUNCT
fnp-5188	100	37	1:1000	1:1000	NUM
fnp-5188	100	38	;	;	PUNCT
fnp-5188	100	39	goat	goat	PROPN
fnp-5188	100	40	anti	anti	ADJ
fnp-5188	100	41	-	-	ADJ
fnp-5188	100	42	rabbit	rabbit	ADJ
fnp-5188	100	43	alexa	alexa	ADJ
fnp-5188	100	44	fluor	fluor	NOUN
fnp-5188	100	45	™	™	ADJ
fnp-5188	100	46	647	647	NUM
fnp-5188	100	47	,	,	PUNCT
fnp-5188	100	48	1:1000	1:1000	NUM
fnp-5188	100	49	;	;	PUNCT
fnp-5188	100	50	goat	goat	PROPN
fnp-5188	100	51	anti	anti	ADJ
fnp-5188	100	52	-	-	ADJ
fnp-5188	100	53	rat	rat	ADJ
fnp-5188	100	54	alexa	alexa	ADJ
fnp-5188	100	55	fluor	fluor	NOUN
fnp-5188	100	56	™	™	ADJ
fnp-5188	100	57	647	647	NUM
fnp-5188	100	58	,	,	PUNCT
fnp-5188	100	59	1:1000	1:1000	NUM
fnp-5188	100	60	(	(	PUNCT
fnp-5188	100	61	all	all	ADV
fnp-5188	100	62	from	from	ADP
fnp-5188	100	63	invitrogen	invitrogen	PROPN
fnp-5188	100	64	)	)	PUNCT
fnp-5188	100	65	.	.	PUNCT
fnp-5188	101	1	after	after	ADP
fnp-5188	101	2	washing	wash	VERB
fnp-5188	101	3	three	three	NUM
fnp-5188	101	4	times	time	NOUN
fnp-5188	101	5	in	in	ADP
fnp-5188	101	6	pbs	pbs	PROPN
fnp-5188	101	7	,	,	PUNCT
fnp-5188	101	8	the	the	DET
fnp-5188	101	9	sections	section	NOUN
fnp-5188	101	10	were	be	AUX
fnp-5188	101	11	mounted	mount	VERB
fnp-5188	101	12	either	either	CCONJ
fnp-5188	101	13	with	with	ADP
fnp-5188	101	14	dako	dako	PROPN
fnp-5188	101	15	mounting	mount	VERB
fnp-5188	101	16	medium	medium	NOUN
fnp-5188	101	17	or	or	CCONJ
fnp-5188	101	18	alternatively	alternatively	ADV
fnp-5188	101	19	with	with	ADP
fnp-5188	101	20	vectashield	vectashield	ADJ
fnp-5188	101	21	®	®	NOUN
fnp-5188	101	22	antifade	antifade	VERB
fnp-5188	101	23	mounting	mount	VERB
fnp-5188	101	24	media	medium	NOUN
fnp-5188	101	25	containing	contain	VERB
fnp-5188	101	26	dapi	dapi	ADV
fnp-5188	101	27	in	in	ADP
fnp-5188	101	28	case	case	NOUN
fnp-5188	101	29	no	no	DET
fnp-5188	101	30	af405	af405	ADJ
fnp-5188	101	31	secondary	secondary	ADJ
fnp-5188	101	32	antibody	antibody	NOUN
fnp-5188	101	33	was	be	AUX
fnp-5188	101	34	used	use	VERB
fnp-5188	101	35	for	for	ADP
fnp-5188	101	36	staining	stain	VERB
fnp-5188	101	37	and	and	CCONJ
fnp-5188	101	38	were	be	AUX
fnp-5188	101	39	stored	store	VERB
fnp-5188	101	40	at	at	ADP
fnp-5188	101	41	4	4	NUM
fnp-5188	101	42	 	 	SPACE
fnp-5188	101	43	°	°	NOUN
fnp-5188	101	44	c	c	NOUN
fnp-5188	101	45	.	.	PUNCT
fnp-5188	102	1	all	all	DET
fnp-5188	102	2	stained	stain	VERB
fnp-5188	102	3	tissue	tissue	NOUN
fnp-5188	102	4	samples	sample	NOUN
fnp-5188	102	5	were	be	AUX
fnp-5188	102	6	evaluated	evaluate	VERB
fnp-5188	102	7	for	for	ADP
fnp-5188	102	8	the	the	DET
fnp-5188	102	9	proteins	protein	NOUN
fnp-5188	102	10	of	of	ADP
fnp-5188	102	11	interest	interest	NOUN
fnp-5188	102	12	using	use	VERB
fnp-5188	102	13	the	the	DET
fnp-5188	102	14	zeiss	zeiss	PROPN
fnp-5188	102	15	axio	axio	PROPN
fnp-5188	102	16	imager	imager	PROPN
fnp-5188	102	17	with	with	ADP
fnp-5188	102	18	apotome2	apotome2	PROPN
fnp-5188	102	19	(	(	PUNCT
fnp-5188	102	20	carl	carl	PROPN
fnp-5188	102	21	zeiss	zeiss	PROPN
fnp-5188	102	22	,	,	PUNCT
fnp-5188	102	23	jena	jena	PROPN
fnp-5188	102	24	,	,	PUNCT
fnp-5188	102	25	germany	germany	PROPN
fnp-5188	102	26	)	)	PUNCT
fnp-5188	102	27	.	.	PUNCT
fnp-5188	103	1	images	image	NOUN
fnp-5188	103	2	were	be	AUX
fnp-5188	103	3	taken	take	VERB
fnp-5188	103	4	in	in	ADP
fnp-5188	103	5	different	different	ADJ
fnp-5188	103	6	magnifications	magnification	NOUN
fnp-5188	103	7	(	(	PUNCT
fnp-5188	103	8	10x	10x	NOUN
fnp-5188	103	9	,	,	PUNCT
fnp-5188	103	10	25x	25x	NUM
fnp-5188	103	11	,	,	PUNCT
fnp-5188	103	12	40x	40x	NOUN
fnp-5188	103	13	and	and	CCONJ
fnp-5188	103	14	63x	63x	NOUN
fnp-5188	103	15	)	)	PUNCT
fnp-5188	103	16	with	with	ADP
fnp-5188	103	17	fixed	fix	VERB
fnp-5188	103	18	exposure	exposure	NOUN
fnp-5188	103	19	settings	setting	NOUN
fnp-5188	103	20	and	and	CCONJ
fnp-5188	103	21	were	be	AUX
fnp-5188	103	22	processed	process	VERB
fnp-5188	103	23	using	use	VERB
fnp-5188	103	24	the	the	DET
fnp-5188	103	25	zen	zen	ADJ
fnp-5188	103	26	blue	blue	ADJ
fnp-5188	103	27	3.6	3.6	NUM
fnp-5188	103	28	software	software	NOUN
fnp-5188	103	29	(	(	PUNCT
fnp-5188	103	30	carl	carl	PROPN
fnp-5188	103	31	zeiss	zeiss	PROPN
fnp-5188	103	32	)	)	PUNCT
fnp-5188	103	33	.	.	PUNCT
fnp-5188	104	1	subsequent	subsequent	ADJ
fnp-5188	104	2	quantification	quantification	NOUN
fnp-5188	104	3	analyses	analysis	NOUN
fnp-5188	104	4	were	be	AUX
fnp-5188	104	5	performed	perform	VERB
fnp-5188	104	6	using	use	VERB
fnp-5188	104	7	image	image	NOUN
fnp-5188	104	8	j	j	PROPN
fnp-5188	104	9	(	(	PUNCT
fnp-5188	104	10	fiji	fiji	PROPN
fnp-5188	104	11	,	,	PUNCT
fnp-5188	104	12	[	[	X
fnp-5188	104	13	27	27	NUM
fnp-5188	104	14	]	]	NUM
fnp-5188	104	15	)	)	PUNCT
fnp-5188	104	16	.	.	PUNCT
fnp-5188	105	1	double	double	ADJ
fnp-5188	105	2	and	and	CCONJ
fnp-5188	105	3	triple	triple	ADJ
fnp-5188	105	4	positive	positive	ADJ
fnp-5188	105	5	cells	cell	NOUN
fnp-5188	105	6	were	be	AUX
fnp-5188	105	7	counted	count	VERB
fnp-5188	105	8	manually	manually	ADV
fnp-5188	105	9	.	.	PUNCT
fnp-5188	106	1	clarity	clarity	NOUN
fnp-5188	106	2	brains	brain	NOUN
fnp-5188	106	3	were	be	AUX
fnp-5188	106	4	fixed	fix	VERB
fnp-5188	106	5	and	and	CCONJ
fnp-5188	106	6	incubated	incubate	VERB
fnp-5188	106	7	in	in	ADP
fnp-5188	106	8	cold	cold	ADJ
fnp-5188	106	9	hydrogen	hydrogen	NOUN
fnp-5188	106	10	monomers	monomer	NOUN
fnp-5188	106	11	(	(	PUNCT
fnp-5188	106	12	hm	hm	INTJ
fnp-5188	106	13	)	)	PUNCT
fnp-5188	106	14	solution	solution	NOUN
fnp-5188	106	15	contain	contain	VERB
fnp-5188	106	16	4	4	NUM
fnp-5188	106	17	 	 	SPACE
fnp-5188	106	18	%	%	NOUN
fnp-5188	106	19	acrylamide	acrylamide	NOUN
fnp-5188	106	20	,	,	PUNCT
fnp-5188	106	21	4	4	NUM
fnp-5188	106	22	 	 	SPACE
fnp-5188	106	23	%	%	NOUN
fnp-5188	106	24	paraformaldehyde	paraformaldehyde	NOUN
fnp-5188	106	25	and	and	CCONJ
fnp-5188	106	26	0.25	0.25	NUM
fnp-5188	106	27	 	 	SPACE
fnp-5188	106	28	%	%	NOUN
fnp-5188	106	29	va-044	va-044	NOUN
fnp-5188	106	30	initiator	initiator	NOUN
fnp-5188	106	31	(	(	PUNCT
fnp-5188	106	32	wak0	wak0	NOUN
fnp-5188	106	33	fisher	fisher	PROPN
fnp-5188	106	34	scientific	scientific	PROPN
fnp-5188	106	35	,	,	PUNCT
fnp-5188	106	36	waltham	waltham	PROPN
fnp-5188	106	37	,	,	PUNCT
fnp-5188	106	38	ma	ma	PROPN
fnp-5188	106	39	,	,	PUNCT
fnp-5188	106	40	usa	usa	PROPN
fnp-5188	106	41	)	)	PUNCT
fnp-5188	106	42	for	for	ADP
fnp-5188	106	43	1	1	NUM
fnp-5188	106	44	-	-	SYM
fnp-5188	106	45	2	2	NUM
fnp-5188	106	46	days	day	NOUN
fnp-5188	106	47	.	.	PUNCT
fnp-5188	107	1	afterwards	afterwards	ADV
fnp-5188	107	2	,	,	PUNCT
fnp-5188	107	3	polymerization	polymerization	NOUN
fnp-5188	107	4	was	be	AUX
fnp-5188	107	5	performed	perform	VERB
fnp-5188	107	6	under	under	ADP
fnp-5188	107	7	vacuum	vacuum	NOUN
fnp-5188	107	8	for	for	ADP
fnp-5188	107	9	2	2	NUM
fnp-5188	107	10	-	-	SYM
fnp-5188	107	11	3	3	NUM
fnp-5188	107	12	h	h	NOUN
fnp-5188	107	13	at	at	ADP
fnp-5188	107	14	42	42	NUM
fnp-5188	107	15	 	 	SPACE
fnp-5188	107	16	°	°	NOUN
fnp-5188	107	17	c	c	NOUN
fnp-5188	107	18	as	as	ADV
fnp-5188	107	19	previously	previously	ADV
fnp-5188	107	20	described	describe	VERB
fnp-5188	107	21	[	[	X
fnp-5188	107	22	28	28	NUM
fnp-5188	107	23	,	,	PUNCT
fnp-5188	107	24	29	29	NUM
fnp-5188	107	25	]	]	PUNCT
fnp-5188	107	26	.	.	PUNCT
fnp-5188	108	1	fixed	fix	VERB
fnp-5188	108	2	brains	brain	NOUN
fnp-5188	108	3	were	be	AUX
fnp-5188	108	4	cut	cut	VERB
fnp-5188	108	5	into	into	ADP
fnp-5188	108	6	2	2	NUM
fnp-5188	108	7	-	-	SYM
fnp-5188	108	8	3	3	NUM
fnp-5188	108	9	 	 	SPACE
fnp-5188	108	10	mm	mm	PROPN
fnp-5188	108	11	coronal	coronal	ADJ
fnp-5188	108	12	slices	slice	NOUN
fnp-5188	108	13	.	.	PUNCT
fnp-5188	109	1	for	for	ADP
fnp-5188	109	2	the	the	DET
fnp-5188	109	3	lipid	lipid	NOUN
fnp-5188	109	4	removal	removal	NOUN
fnp-5188	109	5	,	,	PUNCT
fnp-5188	109	6	the	the	DET
fnp-5188	109	7	brain	brain	NOUN
fnp-5188	109	8	slides	slide	NOUN
fnp-5188	109	9	were	be	AUX
fnp-5188	109	10	put	put	VERB
fnp-5188	109	11	in	in	ADP
fnp-5188	109	12	8	8	NUM
fnp-5188	109	13	 	 	SPACE
fnp-5188	109	14	%	%	NOUN
fnp-5188	109	15	sds	sds	PROPN
fnp-5188	109	16	/	/	SYM
fnp-5188	109	17	pbs	pbs	PROPN
fnp-5188	109	18	and	and	CCONJ
fnp-5188	109	19	were	be	AUX
fnp-5188	109	20	incubated	incubate	VERB
fnp-5188	109	21	at	at	ADP
fnp-5188	109	22	50	50	NUM
fnp-5188	109	23	 	 	SPACE
fnp-5188	109	24	°	°	NOUN
fnp-5188	109	25	c	c	NOUN
fnp-5188	109	26	with	with	ADP
fnp-5188	109	27	continuous	continuous	ADJ
fnp-5188	109	28	movement	movement	NOUN
fnp-5188	109	29	in	in	ADP
fnp-5188	109	30	a	a	DET
fnp-5188	109	31	rotator	rotator	NOUN
fnp-5188	109	32	by	by	ADP
fnp-5188	109	33	changing	change	VERB
fnp-5188	109	34	of	of	ADP
fnp-5188	109	35	sds	sds	PROPN
fnp-5188	109	36	once	once	ADV
fnp-5188	109	37	a	a	DET
fnp-5188	109	38	week	week	NOUN
fnp-5188	109	39	until	until	SCONJ
fnp-5188	109	40	the	the	DET
fnp-5188	109	41	tissue	tissue	NOUN
fnp-5188	109	42	had	have	AUX
fnp-5188	109	43	reached	reach	VERB
fnp-5188	109	44	a	a	DET
fnp-5188	109	45	homogeneous	homogeneous	ADJ
fnp-5188	109	46	transparency	transparency	NOUN
fnp-5188	109	47	.	.	PUNCT
fnp-5188	110	1	tissue	tissue	NOUN
fnp-5188	110	2	transparency	transparency	NOUN
fnp-5188	110	3	was	be	AUX
fnp-5188	110	4	assessed	assess	VERB
fnp-5188	110	5	by	by	ADP
fnp-5188	110	6	visualization	visualization	NOUN
fnp-5188	110	7	of	of	ADP
fnp-5188	110	8	high	high	ADJ
fnp-5188	110	9	-	-	PUNCT
fnp-5188	110	10	contrast	contrast	NOUN
fnp-5188	110	11	signals	signal	NOUN
fnp-5188	110	12	through	through	ADP
fnp-5188	110	13	the	the	DET
fnp-5188	110	14	tissue	tissue	NOUN
fnp-5188	110	15	and	and	CCONJ
fnp-5188	110	16	was	be	AUX
fnp-5188	110	17	reached	reach	VERB
fnp-5188	110	18	after	after	ADP
fnp-5188	110	19	approximately	approximately	ADV
fnp-5188	110	20	4	4	NUM
fnp-5188	110	21	weeks	week	NOUN
fnp-5188	110	22	.	.	PUNCT
fnp-5188	111	1	samples	sample	NOUN
fnp-5188	111	2	were	be	AUX
fnp-5188	111	3	washed	wash	VERB
fnp-5188	111	4	thrice	thrice	NOUN
fnp-5188	111	5	in	in	ADP
fnp-5188	111	6	pbst	pbst	ADV
fnp-5188	111	7	before	before	SCONJ
fnp-5188	111	8	they	they	PRON
fnp-5188	111	9	were	be	AUX
fnp-5188	111	10	put	put	VERB
fnp-5188	111	11	in	in	ADP
fnp-5188	111	12	pbs	pbs	PROPN
fnp-5188	111	13	overnight	overnight	ADV
fnp-5188	111	14	.	.	PUNCT
fnp-5188	112	1	samples	sample	NOUN
fnp-5188	112	2	were	be	AUX
fnp-5188	112	3	incubated	incubate	VERB
fnp-5188	112	4	for	for	ADP
fnp-5188	112	5	2	2	NUM
fnp-5188	112	6	days	day	NOUN
fnp-5188	112	7	at	at	ADP
fnp-5188	112	8	37	37	NUM
fnp-5188	112	9	 	 	SPACE
fnp-5188	112	10	°	°	NOUN
fnp-5188	112	11	c	c	PROPN
fnp-5188	112	12	in	in	ADP
fnp-5188	112	13	pre	pre	ADJ
fnp-5188	112	14	-	-	ADJ
fnp-5188	112	15	incubation	incubation	ADJ
fnp-5188	112	16	solution	solution	NOUN
fnp-5188	112	17	consisting	consist	VERB
fnp-5188	112	18	of	of	ADP
fnp-5188	112	19	4	4	NUM
fnp-5188	112	20	 	 	SPACE
fnp-5188	112	21	%	%	NOUN
fnp-5188	112	22	goat	goat	NOUN
fnp-5188	112	23	-	-	PUNCT
fnp-5188	112	24	serum	serum	NOUN
fnp-5188	112	25	,	,	PUNCT
fnp-5188	112	26	1	1	NUM
fnp-5188	112	27	 	 	SPACE
fnp-5188	112	28	%	%	NOUN
fnp-5188	112	29	bsa	bsa	NOUN
fnp-5188	112	30	,	,	PUNCT
fnp-5188	112	31	0.25	0.25	NUM
fnp-5188	112	32	 	 	SPACE
fnp-5188	112	33	%	%	NOUN
fnp-5188	112	34	triton	triton	PROPN
fnp-5188	112	35	and	and	CCONJ
fnp-5188	112	36	0.01	0.01	NUM
fnp-5188	112	37	 	 	SPACE
fnp-5188	112	38	%	%	NOUN
fnp-5188	112	39	sodium	sodium	NOUN
fnp-5188	112	40	azide	azide	NOUN
fnp-5188	112	41	.	.	PUNCT
fnp-5188	113	1	subsequently	subsequently	ADV
fnp-5188	113	2	,	,	PUNCT
fnp-5188	113	3	the	the	DET
fnp-5188	113	4	brains	brain	NOUN
fnp-5188	113	5	were	be	AUX
fnp-5188	113	6	incubated	incubate	VERB
fnp-5188	113	7	for	for	ADP
fnp-5188	113	8	5	5	NUM
fnp-5188	113	9	days	day	NOUN
fnp-5188	113	10	with	with	ADP
fnp-5188	113	11	the	the	DET
fnp-5188	113	12	following	following	ADJ
fnp-5188	113	13	primary	primary	ADJ
fnp-5188	113	14	antibodies	antibody	NOUN
fnp-5188	113	15	diluted	dilute	VERB
fnp-5188	113	16	in	in	ADP
fnp-5188	113	17	pre	pre	ADJ
fnp-5188	113	18	-	-	ADJ
fnp-5188	113	19	incubation	incubation	ADJ
fnp-5188	113	20	solution	solution	NOUN
fnp-5188	113	21	at	at	ADP
fnp-5188	113	22	37	37	NUM
fnp-5188	113	23	 	 	SPACE
fnp-5188	113	24	°	°	NOUN
fnp-5188	113	25	c	c	NOUN
fnp-5188	113	26	:	:	PUNCT
fnp-5188	113	27	anti	anti	ADJ
fnp-5188	113	28	-	-	ADJ
fnp-5188	113	29	cd31	cd31	PROPN
fnp-5188	113	30	(	(	PUNCT
fnp-5188	113	31	1:25	1:25	NUM
fnp-5188	113	32	-	-	NUM
fnp-5188	113	33	1:50	1:50	NUM
fnp-5188	113	34	;	;	PUNCT
fnp-5188	113	35	abcam	abcam	PROPN
fnp-5188	113	36	,	,	PUNCT
fnp-5188	113	37	cambridge	cambridge	PROPN
fnp-5188	113	38	,	,	PUNCT
fnp-5188	113	39	uk	uk	PROPN
fnp-5188	113	40	)	)	PUNCT
fnp-5188	113	41	and	and	CCONJ
fnp-5188	113	42	anti	anti	ADJ
fnp-5188	113	43	-	-	ADJ
fnp-5188	113	44	mcherry	mcherry	ADJ
fnp-5188	113	45	(	(	PUNCT
fnp-5188	113	46	1:500	1:500	NUM
fnp-5188	113	47	;	;	PUNCT
fnp-5188	113	48	novus	novus	PROPN
fnp-5188	113	49	/	/	SYM
fnp-5188	113	50	biotechne	biotechne	PROPN
fnp-5188	113	51	,	,	PUNCT
fnp-5188	113	52	minneapolis	minneapolis	PROPN
fnp-5188	113	53	,	,	PUNCT
fnp-5188	113	54	mn	mn	PROPN
fnp-5188	113	55	,	,	PUNCT
fnp-5188	113	56	usa	usa	PROPN
fnp-5188	113	57	)	)	PUNCT
fnp-5188	113	58	.	.	PUNCT
fnp-5188	114	1	after	after	ADP
fnp-5188	114	2	washing	wash	VERB
fnp-5188	114	3	the	the	DET
fnp-5188	114	4	samples	sample	NOUN
fnp-5188	114	5	thrice	thrice	NOUN
fnp-5188	114	6	for	for	ADP
fnp-5188	114	7	2	2	NUM
fnp-5188	114	8	hours	hour	NOUN
fnp-5188	114	9	in	in	ADP
fnp-5188	114	10	pbs	pbs	NOUN
fnp-5188	114	11	containing	contain	VERB
fnp-5188	114	12	0.1	0.1	NUM
fnp-5188	114	13	 	 	SPACE
fnp-5188	114	14	%	%	NOUN
fnp-5188	114	15	triton	triton	PROPN
fnp-5188	114	16	x	x	PROPN
fnp-5188	114	17	,	,	PUNCT
fnp-5188	114	18	they	they	PRON
fnp-5188	114	19	were	be	AUX
fnp-5188	114	20	incubated	incubate	VERB
fnp-5188	114	21	for	for	ADP
fnp-5188	114	22	2	2	NUM
fnp-5188	114	23	days	day	NOUN
fnp-5188	114	24	at	at	ADP
fnp-5188	114	25	37	37	NUM
fnp-5188	114	26	 	 	SPACE
fnp-5188	114	27	°	°	NOUN
fnp-5188	114	28	c	c	NOUN
fnp-5188	114	29	in	in	ADP
fnp-5188	114	30	the	the	DET
fnp-5188	114	31	following	follow	VERB
fnp-5188	114	32	secondary	secondary	ADJ
fnp-5188	114	33	antibodies	antibody	NOUN
fnp-5188	114	34	:	:	PUNCT
fnp-5188	114	35	goat	goat	NOUN
fnp-5188	114	36	-	-	PUNCT
fnp-5188	114	37	anti	anti	ADJ
fnp-5188	114	38	-	-	ADJ
fnp-5188	114	39	rabbit	rabbit	ADJ
fnp-5188	114	40	alexa	alexa	NOUN
fnp-5188	114	41	488	488	NUM
fnp-5188	114	42	,	,	PUNCT
fnp-5188	114	43	1:200	1:200	NUM
fnp-5188	114	44	;	;	PUNCT
fnp-5188	114	45	goat	goat	NOUN
fnp-5188	114	46	-	-	PUNCT
fnp-5188	114	47	anti	anti	ADJ
fnp-5188	114	48	-	-	ADJ
fnp-5188	114	49	chicken	chicken	ADJ
fnp-5188	114	50	alexa	alexa	NOUN
fnp-5188	114	51	546	546	NUM
fnp-5188	114	52	,	,	PUNCT
fnp-5188	114	53	1:200	1:200	NUM
fnp-5188	114	54	(	(	PUNCT
fnp-5188	114	55	both	both	CCONJ
fnp-5188	114	56	from	from	ADP
fnp-5188	114	57	invitrogen	invitrogen	PROPN
fnp-5188	114	58	)	)	PUNCT
fnp-5188	114	59	and	and	CCONJ
fnp-5188	114	60	draq5	draq5	NOUN
fnp-5188	114	61	for	for	ADP
fnp-5188	114	62	nuclear	nuclear	ADJ
fnp-5188	114	63	staining	staining	NOUN
fnp-5188	114	64	(	(	PUNCT
fnp-5188	114	65	1:500	1:500	NUM
fnp-5188	114	66	,	,	PUNCT
fnp-5188	114	67	thermo	thermo	NOUN
fnp-5188	114	68	fisher	fisher	PROPN
fnp-5188	114	69	scientific	scientific	PROPN
fnp-5188	114	70	,	,	PUNCT
fnp-5188	114	71	waltham	waltham	PROPN
fnp-5188	114	72	,	,	PUNCT
fnp-5188	114	73	ma	ma	PROPN
fnp-5188	114	74	,	,	PUNCT
fnp-5188	114	75	usa	usa	PROPN
fnp-5188	114	76	)	)	PUNCT
fnp-5188	114	77	.	.	PUNCT
fnp-5188	115	1	afterwards	afterwards	ADV
fnp-5188	115	2	,	,	PUNCT
fnp-5188	115	3	the	the	DET
fnp-5188	115	4	samples	sample	NOUN
fnp-5188	115	5	were	be	AUX
fnp-5188	115	6	washed	wash	VERB
fnp-5188	115	7	three	three	NUM
fnp-5188	115	8	times	time	NOUN
fnp-5188	115	9	in	in	ADP
fnp-5188	115	10	pbst	pbst	ADV
fnp-5188	115	11	for	for	ADP
fnp-5188	115	12	2	2	NUM
fnp-5188	115	13	hours	hour	NOUN
fnp-5188	115	14	each	each	PRON
fnp-5188	115	15	followed	follow	VERB
fnp-5188	115	16	by	by	ADP
fnp-5188	115	17	washing	wash	VERB
fnp-5188	115	18	with	with	ADP
fnp-5188	115	19	either	either	CCONJ
fnp-5188	115	20	pbs	pbs	PROPN
fnp-5188	115	21	containing	contain	VERB
fnp-5188	115	22	0.01	0.01	NUM
fnp-5188	115	23	 	 	SPACE
fnp-5188	115	24	%	%	NOUN
fnp-5188	115	25	sodium	sodium	NOUN
fnp-5188	115	26	azide	azide	NOUN
fnp-5188	115	27	or	or	CCONJ
fnp-5188	115	28	pbst	pbst	ADJ
fnp-5188	115	29	overnight	overnight	ADV
fnp-5188	115	30	.	.	PUNCT
fnp-5188	116	1	after	after	ADP
fnp-5188	116	2	further	far	ADV
fnp-5188	116	3	washing	washing	NOUN
fnp-5188	116	4	in	in	ADP
fnp-5188	116	5	pbs	pbs	PROPN
fnp-5188	116	6	for	for	ADP
fnp-5188	116	7	2	2	NUM
fnp-5188	116	8	hours	hour	NOUN
fnp-5188	116	9	,	,	PUNCT
fnp-5188	116	10	samples	sample	NOUN
fnp-5188	116	11	were	be	AUX
fnp-5188	116	12	transferred	transfer	VERB
fnp-5188	116	13	in	in	ADP
fnp-5188	116	14	80	80	NUM
fnp-5188	116	15	 	 	SPACE
fnp-5188	116	16	%	%	NOUN
fnp-5188	116	17	glycerol	glycerol	NOUN
fnp-5188	116	18	at	at	ADP
fnp-5188	116	19	37	37	NUM
fnp-5188	116	20	 	 	SPACE
fnp-5188	116	21	°	°	ADP
fnp-5188	116	22	c	c	NOUN
fnp-5188	116	23	to	to	PART
fnp-5188	116	24	match	match	VERB
fnp-5188	116	25	the	the	DET
fnp-5188	116	26	refractive	refractive	ADJ
fnp-5188	116	27	index	index	NOUN
fnp-5188	116	28	within	within	ADP
fnp-5188	116	29	the	the	DET
fnp-5188	116	30	hydrogel	hydrogel	NOUN
fnp-5188	116	31	[	[	X
fnp-5188	116	32	30	30	NUM
fnp-5188	116	33	]	]	PUNCT
fnp-5188	116	34	.	.	PUNCT
fnp-5188	117	1	confocal	confocal	ADJ
fnp-5188	117	2	microscopy	microscopy	NOUN
fnp-5188	117	3	was	be	AUX
fnp-5188	117	4	performed	perform	VERB
fnp-5188	117	5	on	on	ADP
fnp-5188	117	6	a	a	DET
fnp-5188	117	7	zeiss	zeiss	PROPN
fnp-5188	117	8	lsm	lsm	PROPN
fnp-5188	117	9	510	510	NUM
fnp-5188	117	10	followed	follow	VERB
fnp-5188	117	11	by	by	ADP
fnp-5188	117	12	image	image	NOUN
fnp-5188	117	13	processing	processing	NOUN
fnp-5188	117	14	using	use	VERB
fnp-5188	117	15	the	the	DET
fnp-5188	117	16	zen	zen	PROPN
fnp-5188	117	17	black	black	ADJ
fnp-5188	117	18	software	software	NOUN
fnp-5188	117	19	(	(	PUNCT
fnp-5188	117	20	carl	carl	PROPN
fnp-5188	117	21	zeiss	zeiss	PROPN
fnp-5188	117	22	)	)	PUNCT
fnp-5188	117	23	and	and	CCONJ
fnp-5188	117	24	image	image	NOUN
fnp-5188	117	25	j.	j.	PROPN
fnp-5188	117	26	subsequent	subsequent	ADJ
fnp-5188	117	27	analysis	analysis	NOUN
fnp-5188	117	28	was	be	AUX
fnp-5188	117	29	performed	perform	VERB
fnp-5188	117	30	using	use	VERB
fnp-5188	117	31	imaris	imaris	NOUN
fnp-5188	117	32	(	(	PUNCT
fnp-5188	117	33	oxford	oxford	PROPN
fnp-5188	117	34	instruments	instrument	NOUN
fnp-5188	117	35	,	,	PUNCT
fnp-5188	117	36	oxford	oxford	PROPN
fnp-5188	117	37	,	,	PUNCT
fnp-5188	117	38	uk	uk	PROPN
fnp-5188	117	39	)	)	PUNCT
fnp-5188	117	40	.	.	PUNCT
fnp-5188	118	1	statistical	statistical	ADJ
fnp-5188	118	2	analyses	analysis	NOUN
fnp-5188	118	3	all	all	PRON
fnp-5188	118	4	in	in	ADP
fnp-5188	118	5	vitro	vitro	X
fnp-5188	118	6	experiments	experiment	NOUN
fnp-5188	118	7	were	be	AUX
fnp-5188	118	8	performed	perform	VERB
fnp-5188	118	9	at	at	ADP
fnp-5188	118	10	least	least	ADJ
fnp-5188	118	11	thrice	thrice	NOUN
fnp-5188	118	12	if	if	SCONJ
fnp-5188	118	13	not	not	PART
fnp-5188	118	14	mentioned	mention	VERB
fnp-5188	118	15	otherwise	otherwise	ADV
fnp-5188	118	16	.	.	PUNCT
fnp-5188	119	1	for	for	ADP
fnp-5188	119	2	in	in	ADP
fnp-5188	119	3	vivo	vivo	ADJ
fnp-5188	119	4	experiments	experiment	NOUN
fnp-5188	119	5	,	,	PUNCT
fnp-5188	119	6	the	the	DET
fnp-5188	119	7	group	group	NOUN
fnp-5188	119	8	and	and	CCONJ
fnp-5188	119	9	sample	sample	NOUN
fnp-5188	119	10	size	size	NOUN
fnp-5188	119	11	are	be	AUX
fnp-5188	119	12	indicated	indicate	VERB
fnp-5188	119	13	in	in	ADP
fnp-5188	119	14	the	the	DET
fnp-5188	119	15	figure	figure	NOUN
fnp-5188	119	16	legends	legend	NOUN
fnp-5188	119	17	.	.	PUNCT
fnp-5188	120	1	to	to	PART
fnp-5188	120	2	assume	assume	VERB
fnp-5188	120	3	a	a	DET
fnp-5188	120	4	gaussian	gaussian	ADJ
fnp-5188	120	5	distribution	distribution	NOUN
fnp-5188	120	6	,	,	PUNCT
fnp-5188	120	7	all	all	DET
fnp-5188	120	8	data	datum	NOUN
fnp-5188	120	9	received	receive	VERB
fnp-5188	120	10	from	from	ADP
fnp-5188	120	11	in	in	ADP
fnp-5188	120	12	vitro	vitro	X
fnp-5188	120	13	experiments	experiment	NOUN
fnp-5188	120	14	passed	pass	VERB
fnp-5188	120	15	a	a	DET
fnp-5188	120	16	normality	normality	NOUN
fnp-5188	120	17	test	test	NOUN
fnp-5188	120	18	(	(	PUNCT
fnp-5188	120	19	shapiro	shapiro	NOUN
fnp-5188	120	20	-	-	PUNCT
fnp-5188	120	21	wilk	wilk	NOUN
fnp-5188	120	22	and	and	CCONJ
fnp-5188	120	23	tukey	tukey	NOUN
fnp-5188	120	24	’s	’s	PART
fnp-5188	120	25	multiple	multiple	ADJ
fnp-5188	120	26	comparison	comparison	NOUN
fnp-5188	120	27	tests	test	NOUN
fnp-5188	120	28	)	)	PUNCT
fnp-5188	120	29	.	.	PUNCT
fnp-5188	121	1	further	further	ADJ
fnp-5188	121	2	statistical	statistical	ADJ
fnp-5188	121	3	analyses	analysis	NOUN
fnp-5188	121	4	were	be	AUX
fnp-5188	121	5	done	do	VERB
fnp-5188	121	6	with	with	ADP
fnp-5188	121	7	a	a	DET
fnp-5188	121	8	two	two	NUM
fnp-5188	121	9	-	-	PUNCT
fnp-5188	121	10	tailed	tail	VERB
fnp-5188	121	11	student	student	NOUN
fnp-5188	121	12	’s	’s	PART
fnp-5188	121	13	t	t	PROPN
fnp-5188	121	14	-	-	PUNCT
fnp-5188	121	15	test	test	NOUN
fnp-5188	121	16	or	or	CCONJ
fnp-5188	121	17	one	one	NUM
fnp-5188	121	18	-	-	PUNCT
fnp-5188	121	19	way	way	NOUN
fnp-5188	121	20	anova	anova	X
fnp-5188	121	21	using	use	VERB
fnp-5188	121	22	graphpad	graphpad	NOUN
fnp-5188	121	23	prism	prism	NOUN
fnp-5188	121	24	7.0	7.0	NUM
fnp-5188	121	25	(	(	PUNCT
fnp-5188	121	26	graphpad	graphpad	PROPN
fnp-5188	121	27	inc	inc	PROPN
fnp-5188	121	28	.	.	PROPN
fnp-5188	121	29	,	,	PUNCT
fnp-5188	121	30	san	san	PROPN
fnp-5188	121	31	diego	diego	PROPN
fnp-5188	121	32	,	,	PUNCT
fnp-5188	121	33	ca	ca	PROPN
fnp-5188	121	34	,	,	PUNCT
fnp-5188	121	35	usa	usa	PROPN
fnp-5188	121	36	)	)	PUNCT
fnp-5188	121	37	or	or	CCONJ
fnp-5188	121	38	excel	excel	PROPN
fnp-5188	121	39	(	(	PUNCT
fnp-5188	121	40	microsoft	microsoft	PROPN
fnp-5188	121	41	corp	corp	PROPN
fnp-5188	121	42	,	,	PUNCT
fnp-5188	121	43	redmond	redmond	PROPN
fnp-5188	121	44	,	,	PUNCT
fnp-5188	121	45	wa	wa	PROPN
fnp-5188	121	46	,	,	PUNCT
fnp-5188	121	47	usa	usa	PROPN
fnp-5188	121	48	)	)	PUNCT
fnp-5188	121	49	,	,	PUNCT
fnp-5188	121	50	followed	follow	VERB
fnp-5188	121	51	by	by	ADP
fnp-5188	121	52	bonferroni	bonferroni	NOUN
fnp-5188	121	53	correction	correction	NOUN
fnp-5188	121	54	.	.	PUNCT
fnp-5188	122	1	the	the	DET
fnp-5188	122	2	results	result	NOUN
fnp-5188	122	3	are	be	AUX
fnp-5188	122	4	represented	represent	VERB
fnp-5188	122	5	as	as	ADP
fnp-5188	122	6	mean	mean	NOUN
fnp-5188	122	7	±	±	NUM
fnp-5188	122	8	standard	standard	ADJ
fnp-5188	122	9	deviation	deviation	NOUN
fnp-5188	122	10	(	(	PUNCT
fnp-5188	122	11	sd	sd	NOUN
fnp-5188	122	12	)	)	PUNCT
fnp-5188	122	13	.	.	PUNCT
fnp-5188	123	1	p	p	X
fnp-5188	123	2	-	-	PUNCT
fnp-5188	123	3	values	value	NOUN
fnp-5188	123	4	of	of	ADP
fnp-5188	123	5	<	<	X
fnp-5188	123	6	0.05	0.05	NUM
fnp-5188	123	7	are	be	AUX
fnp-5188	123	8	considered	consider	VERB
fnp-5188	123	9	as	as	ADP
fnp-5188	123	10	statistically	statistically	ADV
fnp-5188	123	11	significant	significant	ADJ
fnp-5188	123	12	(	(	PUNCT
fnp-5188	123	13	ns	ns	NUM
fnp-5188	123	14	:	:	PUNCT
fnp-5188	123	15	not	not	PART
fnp-5188	123	16	significant	significant	ADJ
fnp-5188	123	17	;	;	PUNCT
fnp-5188	123	18	*	*	PUNCT
fnp-5188	123	19	p	p	X
fnp-5188	123	20	<	<	X
fnp-5188	123	21	0.05	0.05	NUM
fnp-5188	123	22	;	;	PUNCT
fnp-5188	123	23	*	*	PUNCT
fnp-5188	123	24	*	*	PUNCT
fnp-5188	124	1	p	p	X
fnp-5188	124	2	<	<	X
fnp-5188	124	3	0.01	0.01	NUM
fnp-5188	124	4	;	;	PUNCT
fnp-5188	124	5	*	*	PUNCT
fnp-5188	124	6	*	*	PUNCT
fnp-5188	124	7	*	*	PUNCT
fnp-5188	125	1	p	p	X
fnp-5188	125	2	<	<	X
fnp-5188	125	3	0.001	0.001	NUM
fnp-5188	125	4	;	;	PUNCT
fnp-5188	125	5	*	*	PUNCT
fnp-5188	125	6	*	*	PUNCT
fnp-5188	125	7	*	*	PUNCT
fnp-5188	125	8	*	*	PUNCT
fnp-5188	125	9	p	p	X
fnp-5188	125	10	<	<	X
fnp-5188	125	11	0.0001	0.0001	NUM
fnp-5188	125	12	)	)	PUNCT
fnp-5188	125	13	.	.	PUNCT
fnp-5188	126	1	results	result	VERB
fnp-5188	126	2	characterization	characterization	NOUN
fnp-5188	126	3	of	of	ADP
fnp-5188	126	4	the	the	DET
fnp-5188	126	5	tgf	tgf	PROPN
fnp-5188	126	6	-	-	PUNCT
fnp-5188	126	7	β	β	NOUN
fnp-5188	126	8	knockout	knockout	NOUN
fnp-5188	126	9	in	in	ADP
fnp-5188	126	10	gl261	gl261	PROPN
fnp-5188	126	11	cells	cell	NOUN
fnp-5188	126	12	in	in	ADP
fnp-5188	126	13	vitro	vitro	X
fnp-5188	126	14	and	and	CCONJ
fnp-5188	126	15	in	in	ADP
fnp-5188	126	16	vivo	vivo	VERB
fnp-5188	126	17	the	the	DET
fnp-5188	126	18	knockout	knockout	NOUN
fnp-5188	126	19	of	of	ADP
fnp-5188	126	20	tgf	tgf	PROPN
fnp-5188	126	21	-	-	PUNCT
fnp-5188	126	22	β1	β1	PROPN
fnp-5188	126	23	and	and	CCONJ
fnp-5188	126	24	-β2	-β2	PROPN
fnp-5188	126	25	was	be	AUX
fnp-5188	126	26	verified	verify	VERB
fnp-5188	126	27	by	by	ADP
fnp-5188	126	28	pcr	pcr	NOUN
fnp-5188	126	29	and	and	CCONJ
fnp-5188	126	30	sequencing	sequencing	NOUN
fnp-5188	126	31	and	and	CCONJ
fnp-5188	126	32	was	be	AUX
fnp-5188	126	33	found	find	VERB
fnp-5188	126	34	to	to	PART
fnp-5188	126	35	be	be	AUX
fnp-5188	126	36	complete	complete	ADJ
fnp-5188	126	37	in	in	ADP
fnp-5188	126	38	the	the	DET
fnp-5188	126	39	gl261	gl261	PROPN
fnp-5188	126	40	tumor	tumor	NOUN
fnp-5188	126	41	cells	cell	NOUN
fnp-5188	126	42	,	,	PUNCT
fnp-5188	126	43	since	since	SCONJ
fnp-5188	126	44	no	no	DET
fnp-5188	126	45	full	full	ADJ
fnp-5188	126	46	length	length	NOUN
fnp-5188	126	47	tgf	tgf	PROPN
fnp-5188	126	48	-	-	PUNCT
fnp-5188	126	49	β	β	PROPN
fnp-5188	126	50	mrna	mrna	PROPN
fnp-5188	126	51	was	be	AUX
fnp-5188	126	52	detected	detect	VERB
fnp-5188	126	53	in	in	ADP
fnp-5188	126	54	tgf	tgf	PROPN
fnp-5188	126	55	-	-	PUNCT
fnp-5188	126	56	β	β	NOUN
fnp-5188	126	57	-	-	PUNCT
fnp-5188	126	58	knockout	knockout	NOUN
fnp-5188	126	59	(	(	PUNCT
fnp-5188	126	60	tgf	tgf	PROPN
fnp-5188	126	61	-	-	PUNCT
fnp-5188	126	62	β	β	NOUN
fnp-5188	126	63	-	-	PUNCT
fnp-5188	126	64	ko	ko	ADJ
fnp-5188	126	65	)	)	PUNCT
fnp-5188	126	66	cells	cell	NOUN
fnp-5188	126	67	(	(	PUNCT
fnp-5188	126	68	suppl	suppl	PROPN
fnp-5188	126	69	.	.	PUNCT
fnp-5188	126	70	fig	fig	NOUN
fnp-5188	126	71	.	.	PUNCT
fnp-5188	127	1	1	1	NUM
fnp-5188	127	2	)	)	PUNCT
fnp-5188	127	3	.	.	PUNCT
fnp-5188	128	1	as	as	SCONJ
fnp-5188	128	2	tumor	tumor	NOUN
fnp-5188	128	3	angiogenesis	angiogenesis	NOUN
fnp-5188	128	4	is	be	AUX
fnp-5188	128	5	correlated	correlate	VERB
fnp-5188	128	6	to	to	ADP
fnp-5188	128	7	tumor	tumor	NOUN
fnp-5188	128	8	growth	growth	NOUN
fnp-5188	128	9	and	and	CCONJ
fnp-5188	128	10	invasion	invasion	NOUN
fnp-5188	128	11	,	,	PUNCT
fnp-5188	128	12	it	it	PRON
fnp-5188	128	13	is	be	AUX
fnp-5188	128	14	of	of	ADP
fnp-5188	128	15	importance	importance	NOUN
fnp-5188	128	16	to	to	PART
fnp-5188	128	17	determine	determine	VERB
fnp-5188	128	18	the	the	DET
fnp-5188	128	19	growth	growth	NOUN
fnp-5188	128	20	rate	rate	NOUN
fnp-5188	128	21	of	of	ADP
fnp-5188	128	22	tgf	tgf	PROPN
fnp-5188	128	23	-	-	PUNCT
fnp-5188	128	24	β	β	NOUN
fnp-5188	128	25	-	-	PUNCT
fnp-5188	128	26	ko	ko	ADJ
fnp-5188	128	27	cells	cell	NOUN
fnp-5188	128	28	compared	compare	VERB
fnp-5188	128	29	to	to	ADP
fnp-5188	128	30	that	that	PRON
fnp-5188	128	31	of	of	ADP
fnp-5188	128	32	parental	parental	ADJ
fnp-5188	128	33	(	(	PUNCT
fnp-5188	128	34	par	par	ADJ
fnp-5188	128	35	)	)	PUNCT
fnp-5188	128	36	cells	cell	NOUN
fnp-5188	128	37	.	.	PUNCT
fnp-5188	129	1	in	in	ADP
fnp-5188	129	2	this	this	DET
fnp-5188	129	3	regard	regard	NOUN
fnp-5188	129	4	,	,	PUNCT
fnp-5188	129	5	and	and	CCONJ
fnp-5188	129	6	to	to	PART
fnp-5188	129	7	later	later	ADV
fnp-5188	129	8	on	on	ADV
fnp-5188	129	9	avoid	avoid	VERB
fnp-5188	129	10	effects	effect	NOUN
fnp-5188	129	11	of	of	ADP
fnp-5188	129	12	different	different	ADJ
fnp-5188	129	13	tumor	tumor	NOUN
fnp-5188	129	14	size	size	NOUN
fnp-5188	129	15	of	of	ADP
fnp-5188	129	16	par	par	NOUN
fnp-5188	129	17	and	and	CCONJ
fnp-5188	129	18	tgf	tgf	PROPN
fnp-5188	129	19	-	-	PUNCT
fnp-5188	129	20	β	β	NOUN
fnp-5188	129	21	-	-	PUNCT
fnp-5188	129	22	ko	ko	ADJ
fnp-5188	129	23	tumors	tumor	NOUN
fnp-5188	129	24	on	on	ADP
fnp-5188	129	25	angiogenesis	angiogenesis	NOUN
fnp-5188	129	26	in	in	ADP
fnp-5188	129	27	our	our	PRON
fnp-5188	129	28	mouse	mouse	NOUN
fnp-5188	129	29	gbm	gbm	PROPN
fnp-5188	129	30	model	model	NOUN
fnp-5188	129	31	,	,	PUNCT
fnp-5188	129	32	we	we	PRON
fnp-5188	129	33	determined	determine	VERB
fnp-5188	129	34	proliferation	proliferation	NOUN
fnp-5188	129	35	as	as	ADV
fnp-5188	129	36	well	well	ADV
fnp-5188	129	37	as	as	ADP
fnp-5188	129	38	cell	cell	NOUN
fnp-5188	129	39	motility	motility	NOUN
fnp-5188	129	40	of	of	ADP
fnp-5188	129	41	the	the	DET
fnp-5188	129	42	cells	cell	NOUN
fnp-5188	129	43	.	.	PUNCT
fnp-5188	130	1	as	as	SCONJ
fnp-5188	130	2	shown	show	VERB
fnp-5188	130	3	in	in	ADP
fnp-5188	130	4	fig	fig	NOUN
fnp-5188	130	5	.	.	PUNCT
fnp-5188	131	1	1	1	X
fnp-5188	131	2	.	.	X
fnp-5188	131	3	tgf	tgf	PROPN
fnp-5188	131	4	-	-	PUNCT
fnp-5188	131	5	β	β	NOUN
fnp-5188	131	6	-	-	PUNCT
fnp-5188	131	7	ko	ko	ADJ
fnp-5188	131	8	cells	cell	NOUN
fnp-5188	131	9	have	have	VERB
fnp-5188	131	10	a	a	DET
fnp-5188	131	11	significantly	significantly	ADV
fnp-5188	131	12	lower	low	ADJ
fnp-5188	131	13	capacity	capacity	NOUN
fnp-5188	131	14	to	to	PART
fnp-5188	131	15	proliferate	proliferate	VERB
fnp-5188	131	16	and	and	CCONJ
fnp-5188	131	17	also	also	ADV
fnp-5188	131	18	showed	show	VERB
fnp-5188	131	19	lesser	less	ADJ
fnp-5188	131	20	cell	cell	NOUN
fnp-5188	131	21	motility	motility	NOUN
fnp-5188	131	22	than	than	ADP
fnp-5188	131	23	par	par	NOUN
fnp-5188	131	24	cells	cell	NOUN
fnp-5188	131	25	.	.	PUNCT
fnp-5188	132	1	figure	figure	VERB
fnp-5188	132	2	1	1	NUM
fnp-5188	132	3	:	:	PUNCT
fnp-5188	132	4	characterization	characterization	NOUN
fnp-5188	132	5	of	of	ADP
fnp-5188	132	6	gl261	gl261	PROPN
fnp-5188	132	7	tgf	tgf	PROPN
fnp-5188	132	8	-	-	PUNCT
fnp-5188	132	9	β	β	NOUN
fnp-5188	132	10	knockout	knockout	NOUN
fnp-5188	132	11	cells	cell	NOUN
fnp-5188	132	12	indicates	indicate	VERB
fnp-5188	132	13	lower	low	ADJ
fnp-5188	132	14	proliferation	proliferation	NOUN
fnp-5188	132	15	and	and	CCONJ
fnp-5188	132	16	cell	cell	NOUN
fnp-5188	132	17	motility	motility	NOUN
fnp-5188	132	18	upon	upon	SCONJ
fnp-5188	132	19	knocking	knock	VERB
fnp-5188	132	20	out	out	ADP
fnp-5188	132	21	tgf	tgf	PROPN
fnp-5188	132	22	-	-	PUNCT
fnp-5188	132	23	β	β	PROPN
fnp-5188	132	24	.	.	PUNCT
fnp-5188	133	1	a.	a.	NOUN
fnp-5188	133	2	cell	cell	NOUN
fnp-5188	133	3	growth	growth	NOUN
fnp-5188	133	4	of	of	ADP
fnp-5188	133	5	parental	parental	ADJ
fnp-5188	133	6	(	(	PUNCT
fnp-5188	133	7	par	par	NOUN
fnp-5188	133	8	)	)	PUNCT
fnp-5188	133	9	,	,	PUNCT
fnp-5188	133	10	tgf	tgf	PROPN
fnp-5188	133	11	-	-	PUNCT
fnp-5188	133	12	β1	β1	PROPN
fnp-5188	133	13	knockout	knockout	NOUN
fnp-5188	133	14	(	(	PUNCT
fnp-5188	133	15	β1	β1	PROPN
fnp-5188	133	16	-	-	PUNCT
fnp-5188	133	17	ko	ko	PROPN
fnp-5188	133	18	)	)	PUNCT
fnp-5188	133	19	,	,	PUNCT
fnp-5188	133	20	tgf	tgf	PROPN
fnp-5188	133	21	-	-	PUNCT
fnp-5188	133	22	β2	β2	NOUN
fnp-5188	133	23	knockout	knockout	NOUN
fnp-5188	133	24	(	(	PUNCT
fnp-5188	133	25	β2	β2	NOUN
fnp-5188	133	26	-	-	PUNCT
fnp-5188	133	27	ko	ko	PROPN
fnp-5188	133	28	)	)	PUNCT
fnp-5188	133	29	and	and	CCONJ
fnp-5188	133	30	tgf	tgf	PROPN
fnp-5188	133	31	-	-	PUNCT
fnp-5188	133	32	β1	β1	PROPN
fnp-5188	133	33	+	+	CCONJ
fnp-5188	133	34	β2	β2	ADJ
fnp-5188	133	35	double	double	ADJ
fnp-5188	133	36	knockout	knockout	NOUN
fnp-5188	133	37	gl261	gl261	NOUN
fnp-5188	133	38	cells	cell	NOUN
fnp-5188	133	39	(	(	PUNCT
fnp-5188	133	40	β1/2	β1/2	PROPN
fnp-5188	133	41	-	-	PUNCT
fnp-5188	133	42	ko	ko	PROPN
fnp-5188	133	43	;	;	PUNCT
fnp-5188	133	44	n=3	n=3	NOUN
fnp-5188	133	45	,	,	PUNCT
fnp-5188	133	46	sd	sd	NOUN
fnp-5188	133	47	,	,	PUNCT
fnp-5188	133	48	*	*	PUNCT
fnp-5188	133	49	*	*	PUNCT
fnp-5188	133	50	*	*	PUNCT
fnp-5188	133	51	*	*	PUNCT
fnp-5188	133	52	p<0.0001	p<0.0001	NOUN
fnp-5188	133	53	)	)	PUNCT
fnp-5188	133	54	.	.	PUNCT
fnp-5188	134	1	b.	b.	PROPN
fnp-5188	134	2	transwell	transwell	PROPN
fnp-5188	134	3	migration	migration	NOUN
fnp-5188	134	4	of	of	ADP
fnp-5188	134	5	the	the	DET
fnp-5188	134	6	cells	cell	NOUN
fnp-5188	134	7	indicated	indicate	VERB
fnp-5188	134	8	in	in	ADP
fnp-5188	134	9	a	a	DET
fnp-5188	134	10	(	(	PUNCT
fnp-5188	134	11	n=4	n=4	NOUN
fnp-5188	134	12	,	,	PUNCT
fnp-5188	134	13	sd	sd	NOUN
fnp-5188	134	14	,	,	PUNCT
fnp-5188	134	15	*	*	PUNCT
fnp-5188	134	16	p<0.05	p<0.05	NOUN
fnp-5188	134	17	,	,	PUNCT
fnp-5188	134	18	*	*	PUNCT
fnp-5188	134	19	*	*	PUNCT
fnp-5188	134	20	p<0.01	p<0.01	PROPN
fnp-5188	134	21	,	,	PUNCT
fnp-5188	134	22	n.s	n.s	PROPN
fnp-5188	134	23	.	.	PROPN
fnp-5188	134	24	:	:	PUNCT
fnp-5188	134	25	not	not	PART
fnp-5188	134	26	significant	significant	ADJ
fnp-5188	134	27	)	)	PUNCT
fnp-5188	134	28	.	.	PUNCT
fnp-5188	135	1	c.	c.	NOUN
fnp-5188	135	2	cells	cell	NOUN
fnp-5188	135	3	on	on	ADP
fnp-5188	135	4	the	the	DET
fnp-5188	135	5	bottom	bottom	ADJ
fnp-5188	135	6	side	side	NOUN
fnp-5188	135	7	of	of	ADP
fnp-5188	135	8	the	the	DET
fnp-5188	135	9	transwell	transwell	NOUN
fnp-5188	135	10	migration	migration	NOUN
fnp-5188	135	11	membrane	membrane	NOUN
fnp-5188	135	12	after	after	ADP
fnp-5188	135	13	migration	migration	NOUN
fnp-5188	135	14	,	,	PUNCT
fnp-5188	135	15	one	one	NUM
fnp-5188	135	16	picture	picture	NOUN
fnp-5188	135	17	is	be	AUX
fnp-5188	135	18	exemplary	exemplary	ADJ
fnp-5188	135	19	shown	show	VERB
fnp-5188	135	20	.	.	PUNCT
fnp-5188	136	1	identification	identification	NOUN
fnp-5188	136	2	of	of	ADP
fnp-5188	136	3	the	the	DET
fnp-5188	136	4	murine	murine	ADJ
fnp-5188	136	5	rgs5	rgs5	PROPN
fnp-5188	136	6	minimal	minimal	ADJ
fnp-5188	136	7	promoter	promoter	NOUN
fnp-5188	136	8	used	use	VERB
fnp-5188	136	9	to	to	PART
fnp-5188	136	10	knockout	knockout	VERB
fnp-5188	136	11	slug	slug	NOUN
fnp-5188	136	12	in	in	ADP
fnp-5188	136	13	tumor	tumor	NOUN
fnp-5188	136	14	-	-	PUNCT
fnp-5188	136	15	associated	associate	VERB
fnp-5188	136	16	vamcs	vamcs	NOUN
fnp-5188	136	17	to	to	PART
fnp-5188	136	18	knockout	knockout	VERB
fnp-5188	136	19	slug	slug	VERB
fnp-5188	136	20	in	in	ADP
fnp-5188	136	21	vivo	vivo	NOUN
fnp-5188	136	22	in	in	ADP
fnp-5188	136	23	our	our	PRON
fnp-5188	136	24	mouse	mouse	NOUN
fnp-5188	136	25	gbm	gbm	PROPN
fnp-5188	136	26	model	model	NOUN
fnp-5188	136	27	,	,	PUNCT
fnp-5188	136	28	and	and	CCONJ
fnp-5188	136	29	as	as	ADP
fnp-5188	136	30	the	the	DET
fnp-5188	136	31	murine	murine	ADJ
fnp-5188	136	32	,	,	PUNCT
fnp-5188	136	33	vamc	vamc	ADJ
fnp-5188	136	34	specific	specific	ADJ
fnp-5188	136	35	rgs5	rgs5	NOUN
fnp-5188	136	36	promoter	promoter	NOUN
fnp-5188	137	1	[	[	X
fnp-5188	137	2	31	31	NUM
fnp-5188	137	3	]	]	PUNCT
fnp-5188	137	4	has	have	AUX
fnp-5188	137	5	not	not	PART
fnp-5188	137	6	been	be	AUX
fnp-5188	137	7	described	describe	VERB
fnp-5188	137	8	in	in	ADP
fnp-5188	137	9	detail	detail	NOUN
fnp-5188	137	10	so	so	ADV
fnp-5188	137	11	far	far	ADV
fnp-5188	137	12	,	,	PUNCT
fnp-5188	137	13	we	we	PRON
fnp-5188	137	14	firstly	firstly	ADV
fnp-5188	137	15	had	have	VERB
fnp-5188	137	16	to	to	PART
fnp-5188	137	17	identify	identify	VERB
fnp-5188	137	18	the	the	DET
fnp-5188	137	19	minimal	minimal	ADJ
fnp-5188	137	20	rgs5	rgs5	NOUN
fnp-5188	137	21	promoter	promoter	NOUN
fnp-5188	137	22	that	that	PRON
fnp-5188	137	23	can	can	AUX
fnp-5188	137	24	be	be	AUX
fnp-5188	137	25	used	use	VERB
fnp-5188	137	26	to	to	PART
fnp-5188	137	27	induce	induce	VERB
fnp-5188	137	28	gene	gene	NOUN
fnp-5188	137	29	expression	expression	NOUN
fnp-5188	137	30	.	.	PUNCT
fnp-5188	138	1	for	for	ADP
fnp-5188	138	2	this	this	PRON
fnp-5188	138	3	,	,	PUNCT
fnp-5188	138	4	by	by	ADP
fnp-5188	138	5	pcr	pcr	NOUN
fnp-5188	138	6	we	we	PRON
fnp-5188	138	7	amplified	amplify	VERB
fnp-5188	138	8	different	different	ADJ
fnp-5188	138	9	fragments	fragment	NOUN
fnp-5188	138	10	of	of	ADP
fnp-5188	138	11	the	the	DET
fnp-5188	138	12	murine	murine	ADJ
fnp-5188	138	13	rgs	rgs	PROPN
fnp-5188	138	14	promoter	promoter	NOUN
fnp-5188	138	15	,	,	PUNCT
fnp-5188	138	16	cloned	clone	VERB
fnp-5188	138	17	overlapping	overlap	VERB
fnp-5188	138	18	fragments	fragment	NOUN
fnp-5188	138	19	in	in	ADP
fnp-5188	138	20	pgl4.10	pgl4.10	PROPN
fnp-5188	138	21	[	[	X
fnp-5188	138	22	luc2	luc2	X
fnp-5188	138	23	]	]	PUNCT
fnp-5188	138	24	and	and	CCONJ
fnp-5188	138	25	determined	determine	VERB
fnp-5188	138	26	luciferase	luciferase	ADJ
fnp-5188	138	27	activity	activity	NOUN
fnp-5188	138	28	in	in	ADP
fnp-5188	138	29	mbvps	mbvps	PROPN
fnp-5188	138	30	.	.	PUNCT
fnp-5188	139	1	fragment	fragment	NOUN
fnp-5188	139	2	14	14	NUM
fnp-5188	139	3	covers	cover	VERB
fnp-5188	139	4	the	the	DET
fnp-5188	139	5	entire	entire	ADJ
fnp-5188	139	6	region	region	NOUN
fnp-5188	139	7	from	from	ADP
fnp-5188	139	8	the	the	DET
fnp-5188	139	9	enhancer	enhancer	NOUN
fnp-5188	139	10	,	,	PUNCT
fnp-5188	139	11	ending	end	VERB
fnp-5188	139	12	at	at	ADP
fnp-5188	139	13	the	the	DET
fnp-5188	139	14	start	start	NOUN
fnp-5188	139	15	of	of	ADP
fnp-5188	139	16	exon	exon	NOUN
fnp-5188	139	17	1	1	NUM
fnp-5188	139	18	of	of	ADP
fnp-5188	139	19	the	the	DET
fnp-5188	139	20	murine	murine	ADJ
fnp-5188	139	21	slug	slug	NOUN
fnp-5188	139	22	gene	gene	NOUN
fnp-5188	139	23	.	.	PUNCT
fnp-5188	140	1	fragment	fragment	NOUN
fnp-5188	140	2	12	12	NUM
fnp-5188	140	3	additionally	additionally	ADV
fnp-5188	140	4	includes	include	VERB
fnp-5188	140	5	exon	exon	NOUN
fnp-5188	140	6	1	1	NUM
fnp-5188	140	7	,	,	PUNCT
fnp-5188	140	8	and	and	CCONJ
fnp-5188	140	9	fragment	fragment	NOUN
fnp-5188	140	10	15	15	NUM
fnp-5188	140	11	contains	contain	VERB
fnp-5188	140	12	597	597	NUM
fnp-5188	140	13	bp	bp	PROPN
fnp-5188	140	14	directly	directly	ADV
fnp-5188	140	15	upstream	upstream	ADV
fnp-5188	140	16	of	of	ADP
fnp-5188	140	17	exon	exon	PROPN
fnp-5188	140	18	1	1	NUM
fnp-5188	140	19	(	(	PUNCT
fnp-5188	140	20	fig	fig	NOUN
fnp-5188	140	21	.	.	PUNCT
fnp-5188	140	22	2a	2a	NUM
fnp-5188	140	23	)	)	PUNCT
fnp-5188	140	24	.	.	PUNCT
fnp-5188	141	1	fragments	fragment	NOUN
fnp-5188	141	2	12	12	NUM
fnp-5188	141	3	and	and	CCONJ
fnp-5188	141	4	14	14	NUM
fnp-5188	141	5	showed	show	VERB
fnp-5188	141	6	highest	high	ADJ
fnp-5188	141	7	luciferase	luciferase	ADJ
fnp-5188	141	8	activation	activation	NOUN
fnp-5188	141	9	,	,	PUNCT
fnp-5188	141	10	whilst	whilst	SCONJ
fnp-5188	141	11	luciferase	luciferase	VERB
fnp-5188	141	12	induction	induction	NOUN
fnp-5188	141	13	by	by	ADP
fnp-5188	141	14	fragment	fragment	NOUN
fnp-5188	141	15	15	15	NUM
fnp-5188	141	16	was	be	AUX
fnp-5188	141	17	only	only	ADV
fnp-5188	141	18	half	half	ADJ
fnp-5188	141	19	(	(	PUNCT
fnp-5188	141	20	fig	fig	NOUN
fnp-5188	141	21	.	.	PUNCT
fnp-5188	141	22	2b	2b	NUM
fnp-5188	141	23	)	)	PUNCT
fnp-5188	141	24	.	.	PUNCT
fnp-5188	142	1	to	to	PART
fnp-5188	142	2	determine	determine	VERB
fnp-5188	142	3	specificity	specificity	NOUN
fnp-5188	142	4	of	of	ADP
fnp-5188	142	5	the	the	DET
fnp-5188	142	6	rgs5	rgs5	ADJ
fnp-5188	142	7	promoter	promoter	NOUN
fnp-5188	142	8	regions	region	NOUN
fnp-5188	142	9	,	,	PUNCT
fnp-5188	142	10	we	we	PRON
fnp-5188	142	11	measured	measure	VERB
fnp-5188	142	12	luciferase	luciferase	ADJ
fnp-5188	142	13	activity	activity	NOUN
fnp-5188	142	14	also	also	ADV
fnp-5188	142	15	in	in	ADP
fnp-5188	142	16	gl261	gl261	PROPN
fnp-5188	142	17	gbm	gbm	NOUN
fnp-5188	142	18	cells	cell	NOUN
fnp-5188	142	19	.	.	PUNCT
fnp-5188	143	1	for	for	ADP
fnp-5188	143	2	fragment	fragment	NOUN
fnp-5188	143	3	14	14	NUM
fnp-5188	143	4	,	,	PUNCT
fnp-5188	143	5	luciferase	luciferase	VERB
fnp-5188	143	6	activity	activity	NOUN
fnp-5188	143	7	in	in	ADP
fnp-5188	143	8	mbvps	mbvps	NOUN
fnp-5188	143	9	was	be	AUX
fnp-5188	143	10	25	25	NUM
fnp-5188	143	11	times	time	NOUN
fnp-5188	143	12	increased	increase	VERB
fnp-5188	143	13	compared	compare	VERB
fnp-5188	143	14	to	to	ADP
fnp-5188	143	15	the	the	DET
fnp-5188	143	16	empty	empty	ADJ
fnp-5188	143	17	vector	vector	NOUN
fnp-5188	143	18	construct	construct	NOUN
fnp-5188	143	19	whilst	whilst	SCONJ
fnp-5188	143	20	we	we	PRON
fnp-5188	143	21	only	only	ADV
fnp-5188	143	22	saw	see	VERB
fnp-5188	143	23	a	a	DET
fnp-5188	143	24	weak	weak	ADJ
fnp-5188	143	25	and	and	CCONJ
fnp-5188	143	26	not	not	PART
fnp-5188	143	27	significant	significant	ADJ
fnp-5188	143	28	induction	induction	NOUN
fnp-5188	143	29	in	in	ADP
fnp-5188	143	30	gl261	gl261	PROPN
fnp-5188	143	31	cells	cell	NOUN
fnp-5188	143	32	(	(	PUNCT
fnp-5188	143	33	appr	appr	PROPN
fnp-5188	143	34	.	.	PROPN
fnp-5188	143	35	2	2	NUM
fnp-5188	143	36	-	-	NUM
fnp-5188	143	37	fold	fold	ADJ
fnp-5188	143	38	)	)	PUNCT
fnp-5188	143	39	.	.	PUNCT
fnp-5188	144	1	for	for	ADP
fnp-5188	144	2	fragment	fragment	NOUN
fnp-5188	144	3	15	15	NUM
fnp-5188	144	4	,	,	PUNCT
fnp-5188	144	5	induction	induction	NOUN
fnp-5188	144	6	of	of	ADP
fnp-5188	144	7	luciferase	luciferase	ADJ
fnp-5188	144	8	activity	activity	NOUN
fnp-5188	144	9	was	be	AUX
fnp-5188	144	10	about	about	ADP
fnp-5188	144	11	12x	12x	NOUN
fnp-5188	144	12	in	in	ADP
fnp-5188	144	13	mbvp	mbvp	NOUN
fnp-5188	144	14	and	and	CCONJ
fnp-5188	144	15	4x	4x	NOUN
fnp-5188	144	16	in	in	ADP
fnp-5188	144	17	gl261	gl261	PROPN
fnp-5188	144	18	cells	cell	NOUN
fnp-5188	144	19	(	(	PUNCT
fnp-5188	144	20	fig	fig	NOUN
fnp-5188	144	21	.	.	PUNCT
fnp-5188	145	1	2c	2c	NUM
fnp-5188	145	2	)	)	PUNCT
fnp-5188	145	3	.	.	PUNCT
fnp-5188	146	1	therefore	therefore	ADV
fnp-5188	146	2	,	,	PUNCT
fnp-5188	146	3	we	we	PRON
fnp-5188	146	4	chose	choose	VERB
fnp-5188	146	5	to	to	PART
fnp-5188	146	6	use	use	VERB
fnp-5188	146	7	fragment	fragment	NOUN
fnp-5188	146	8	14	14	NUM
fnp-5188	146	9	as	as	SCONJ
fnp-5188	146	10	this	this	DET
fnp-5188	146	11	fragment	fragment	NOUN
fnp-5188	146	12	seemed	seem	VERB
fnp-5188	146	13	to	to	PART
fnp-5188	146	14	be	be	AUX
fnp-5188	146	15	the	the	DET
fnp-5188	146	16	most	most	ADV
fnp-5188	146	17	specific	specific	ADJ
fnp-5188	146	18	part	part	NOUN
fnp-5188	146	19	of	of	ADP
fnp-5188	146	20	the	the	DET
fnp-5188	146	21	murine	murine	ADJ
fnp-5188	146	22	rgs5	rgs5	NOUN
fnp-5188	146	23	promoter	promoter	NOUN
fnp-5188	146	24	.	.	PUNCT
fnp-5188	147	1	fragment	fragment	NOUN
fnp-5188	147	2	14	14	NUM
fnp-5188	147	3	was	be	AUX
fnp-5188	147	4	cloned	clone	VERB
fnp-5188	147	5	upstream	upstream	NOUN
fnp-5188	147	6	of	of	ADP
fnp-5188	147	7	the	the	DET
fnp-5188	147	8	cas9	cas9	NOUN
fnp-5188	147	9	gene	gene	NOUN
fnp-5188	147	10	of	of	ADP
fnp-5188	147	11	plenticrispr	plenticrispr	NOUN
fnp-5188	147	12	v2	v2	NOUN
fnp-5188	147	13	to	to	PART
fnp-5188	147	14	specifically	specifically	ADV
fnp-5188	147	15	express	express	VERB
fnp-5188	147	16	cas9	cas9	NOUN
fnp-5188	147	17	in	in	ADP
fnp-5188	147	18	rgs5	rgs5	NOUN
fnp-5188	147	19	expressing	express	VERB
fnp-5188	147	20	cells	cell	NOUN
fnp-5188	147	21	(	(	PUNCT
fnp-5188	147	22	plenti	plenti	ADJ
fnp-5188	147	23	-	-	ADJ
fnp-5188	147	24	rgs5	rgs5	ADJ
fnp-5188	147	25	-	-	PUNCT
fnp-5188	147	26	crispr	crispr	NOUN
fnp-5188	147	27	)	)	PUNCT
fnp-5188	147	28	.	.	PUNCT
fnp-5188	148	1	the	the	DET
fnp-5188	148	2	plenticrispr	plenticrispr	NOUN
fnp-5188	148	3	v2	v2	NOUN
fnp-5188	148	4	system	system	NOUN
fnp-5188	148	5	that	that	PRON
fnp-5188	148	6	allows	allow	VERB
fnp-5188	148	7	the	the	DET
fnp-5188	148	8	expression	expression	NOUN
fnp-5188	148	9	of	of	ADP
fnp-5188	148	10	cas9	cas9	NOUN
fnp-5188	148	11	and	and	CCONJ
fnp-5188	148	12	guide	guide	VERB
fnp-5188	148	13	rnas	rna	NOUN
fnp-5188	148	14	from	from	ADP
fnp-5188	148	15	the	the	DET
fnp-5188	148	16	same	same	ADJ
fnp-5188	148	17	vector	vector	NOUN
fnp-5188	148	18	(	(	PUNCT
fnp-5188	148	19	suppl	suppl	PROPN
fnp-5188	148	20	.	.	PROPN
fnp-5188	148	21	fig	fig	PROPN
fnp-5188	148	22	2a	2a	NUM
fnp-5188	148	23	)	)	PUNCT
fnp-5188	148	24	was	be	AUX
fnp-5188	148	25	used	use	VERB
fnp-5188	148	26	to	to	PART
fnp-5188	148	27	knockout	knockout	VERB
fnp-5188	148	28	slug	slug	NOUN
fnp-5188	148	29	in	in	ADP
fnp-5188	148	30	tumor	tumor	NOUN
fnp-5188	148	31	-	-	PUNCT
fnp-5188	148	32	associated	associate	VERB
fnp-5188	148	33	mural	mural	ADJ
fnp-5188	148	34	cells	cell	NOUN
fnp-5188	148	35	in	in	ADP
fnp-5188	148	36	our	our	PRON
fnp-5188	148	37	mouse	mouse	NOUN
fnp-5188	148	38	model	model	NOUN
fnp-5188	148	39	.	.	PUNCT
fnp-5188	149	1	three	three	NUM
fnp-5188	149	2	specific	specific	ADJ
fnp-5188	149	3	guide	guide	NOUN
fnp-5188	149	4	rnas	rna	NOUN
fnp-5188	149	5	(	(	PUNCT
fnp-5188	149	6	sgrna	sgrna	NOUN
fnp-5188	149	7	#	#	NOUN
fnp-5188	149	8	1	1	NUM
fnp-5188	149	9	,	,	PUNCT
fnp-5188	149	10	4	4	NUM
fnp-5188	149	11	and	and	CCONJ
fnp-5188	149	12	5	5	NUM
fnp-5188	149	13	)	)	PUNCT
fnp-5188	149	14	were	be	AUX
fnp-5188	149	15	designed	design	VERB
fnp-5188	149	16	using	use	VERB
fnp-5188	149	17	the	the	DET
fnp-5188	149	18	tool	tool	NOUN
fnp-5188	149	19	provided	provide	VERB
fnp-5188	149	20	by	by	ADP
fnp-5188	149	21	benchling	benchle	VERB
fnp-5188	149	22	(	(	PUNCT
fnp-5188	149	23	san	san	PROPN
fnp-5188	149	24	francisco	francisco	PROPN
fnp-5188	149	25	,	,	PUNCT
fnp-5188	149	26	ca	ca	PROPN
fnp-5188	149	27	,	,	PUNCT
fnp-5188	149	28	usa	usa	PROPN
fnp-5188	149	29	)	)	PUNCT
fnp-5188	149	30	.	.	PUNCT
fnp-5188	150	1	off	off	ADP
fnp-5188	150	2	-	-	PUNCT
fnp-5188	150	3	target	target	NOUN
fnp-5188	150	4	analyses	analysis	NOUN
fnp-5188	150	5	(	(	PUNCT
fnp-5188	150	6	off	off	ADP
fnp-5188	150	7	-	-	PUNCT
fnp-5188	150	8	spotter	spotter	NOUN
fnp-5188	150	9	;	;	PUNCT
fnp-5188	150	10	[	[	X
fnp-5188	150	11	32	32	NUM
fnp-5188	150	12	]	]	PUNCT
fnp-5188	150	13	)	)	PUNCT
fnp-5188	150	14	indicate	indicate	VERB
fnp-5188	150	15	no	no	DET
fnp-5188	150	16	further	further	ADJ
fnp-5188	150	17	targets	target	NOUN
fnp-5188	150	18	outside	outside	ADV
fnp-5188	150	19	of	of	ADP
fnp-5188	150	20	slug	slug	NOUN
fnp-5188	150	21	for	for	ADP
fnp-5188	150	22	the	the	DET
fnp-5188	150	23	designed	design	VERB
fnp-5188	150	24	guides	guide	NOUN
fnp-5188	150	25	.	.	PUNCT
fnp-5188	151	1	the	the	DET
fnp-5188	151	2	slug	slug	NOUN
fnp-5188	151	3	oligos	oligo	NOUN
fnp-5188	151	4	were	be	AUX
fnp-5188	151	5	cloned	clone	VERB
fnp-5188	151	6	into	into	ADP
fnp-5188	151	7	plenticrispr	plenticrispr	NOUN
fnp-5188	151	8	v2	v2	PROPN
fnp-5188	151	9	(	(	PUNCT
fnp-5188	151	10	cas9	cas9	NOUN
fnp-5188	151	11	under	under	ADP
fnp-5188	151	12	control	control	NOUN
fnp-5188	151	13	of	of	ADP
fnp-5188	151	14	the	the	DET
fnp-5188	151	15	ef1α	ef1α	ADJ
fnp-5188	151	16	promoter	promoter	NOUN
fnp-5188	151	17	)	)	PUNCT
fnp-5188	151	18	and	and	CCONJ
fnp-5188	151	19	target	target	VERB
fnp-5188	151	20	efficacy	efficacy	NOUN
fnp-5188	151	21	of	of	ADP
fnp-5188	151	22	the	the	DET
fnp-5188	151	23	slug	slug	NOUN
fnp-5188	151	24	knockout	knockout	NOUN
fnp-5188	151	25	was	be	AUX
fnp-5188	151	26	tested	test	VERB
fnp-5188	151	27	by	by	ADP
fnp-5188	151	28	infection	infection	NOUN
fnp-5188	151	29	of	of	ADP
fnp-5188	151	30	gl261	gl261	PROPN
fnp-5188	151	31	cells	cell	NOUN
fnp-5188	151	32	with	with	ADP
fnp-5188	151	33	these	these	DET
fnp-5188	151	34	lentiviruses	lentiviruse	NOUN
fnp-5188	151	35	either	either	CCONJ
fnp-5188	151	36	alone	alone	ADJ
fnp-5188	151	37	or	or	CCONJ
fnp-5188	151	38	in	in	ADP
fnp-5188	151	39	combination	combination	NOUN
fnp-5188	151	40	,	,	PUNCT
fnp-5188	151	41	followed	follow	VERB
fnp-5188	151	42	by	by	ADP
fnp-5188	151	43	sequencing	sequence	VERB
fnp-5188	151	44	.	.	PUNCT
fnp-5188	152	1	using	use	VERB
fnp-5188	152	2	a	a	DET
fnp-5188	152	3	combination	combination	NOUN
fnp-5188	152	4	of	of	ADP
fnp-5188	152	5	the	the	DET
fnp-5188	152	6	three	three	NUM
fnp-5188	152	7	sgrnas	sgrna	NOUN
fnp-5188	152	8	,	,	PUNCT
fnp-5188	152	9	the	the	DET
fnp-5188	152	10	total	total	ADJ
fnp-5188	152	11	editing	editing	NOUN
fnp-5188	152	12	efficiency	efficiency	NOUN
fnp-5188	152	13	was	be	AUX
fnp-5188	152	14	notably	notably	ADV
fnp-5188	152	15	higher	high	ADJ
fnp-5188	152	16	than	than	ADP
fnp-5188	152	17	for	for	ADP
fnp-5188	152	18	single	single	ADJ
fnp-5188	152	19	sgrnas	sgrna	NOUN
fnp-5188	152	20	and	and	CCONJ
fnp-5188	152	21	reached	reach	VERB
fnp-5188	152	22	85	85	NUM
fnp-5188	152	23	 	 	SPACE
fnp-5188	152	24	%	%	NOUN
fnp-5188	152	25	.	.	PUNCT
fnp-5188	153	1	indels	indel	NOUN
fnp-5188	153	2	were	be	AUX
fnp-5188	153	3	found	find	VERB
fnp-5188	153	4	at	at	ADP
fnp-5188	153	5	the	the	DET
fnp-5188	153	6	target	target	NOUN
fnp-5188	153	7	sites	site	NOUN
fnp-5188	153	8	for	for	ADP
fnp-5188	153	9	all	all	DET
fnp-5188	153	10	three	three	NUM
fnp-5188	153	11	sgrnas	sgrna	NOUN
fnp-5188	153	12	(	(	PUNCT
fnp-5188	153	13	suppl	suppl	PROPN
fnp-5188	153	14	.	.	PUNCT
fnp-5188	153	15	fig	fig	PROPN
fnp-5188	153	16	.	.	PUNCT
fnp-5188	154	1	2e	2e	NUM
fnp-5188	154	2	)	)	PUNCT
fnp-5188	154	3	.	.	PUNCT
fnp-5188	155	1	we	we	PRON
fnp-5188	155	2	therefore	therefore	ADV
fnp-5188	155	3	cloned	clone	VERB
fnp-5188	155	4	sgrnas	sgrna	NOUN
fnp-5188	155	5	#	#	NOUN
fnp-5188	155	6	1,4	1,4	NUM
fnp-5188	155	7	and	and	CCONJ
fnp-5188	155	8	5	5	NUM
fnp-5188	155	9	into	into	ADP
fnp-5188	155	10	plenti	plenti	ADJ
fnp-5188	155	11	-	-	ADJ
fnp-5188	155	12	rgs5	rgs5	ADJ
fnp-5188	155	13	-	-	PUNCT
fnp-5188	155	14	crispr	crispr	NOUN
fnp-5188	155	15	,	,	PUNCT
fnp-5188	155	16	creating	create	VERB
fnp-5188	155	17	lenti	lenti	ADJ
fnp-5188	155	18	-	-	ADJ
fnp-5188	155	19	slug	slug	VERB
fnp-5188	155	20	-	-	PUNCT
fnp-5188	155	21	ko	ko	PROPN
fnp-5188	155	22	#	#	SYM
fnp-5188	155	23	1	1	NUM
fnp-5188	155	24	,	,	PUNCT
fnp-5188	155	25	#	#	SYM
fnp-5188	155	26	4	4	NUM
fnp-5188	155	27	and	and	CCONJ
fnp-5188	155	28	#	#	SYM
fnp-5188	155	29	5	5	NUM
fnp-5188	155	30	,	,	PUNCT
fnp-5188	155	31	and	and	CCONJ
fnp-5188	155	32	used	use	VERB
fnp-5188	155	33	a	a	DET
fnp-5188	155	34	combination	combination	NOUN
fnp-5188	155	35	of	of	ADP
fnp-5188	155	36	these	these	DET
fnp-5188	155	37	three	three	NUM
fnp-5188	155	38	viruses	virus	NOUN
fnp-5188	155	39	to	to	PART
fnp-5188	155	40	specifically	specifically	ADV
fnp-5188	155	41	knockout	knockout	VERB
fnp-5188	155	42	slug	slug	NOUN
fnp-5188	155	43	in	in	ADP
fnp-5188	155	44	gbm	gbm	PROPN
fnp-5188	155	45	adjacent	adjacent	ADJ
fnp-5188	155	46	vamcs	vamcs	NOUN
fnp-5188	155	47	in	in	ADP
fnp-5188	155	48	our	our	PRON
fnp-5188	155	49	mouse	mouse	NOUN
fnp-5188	155	50	in	in	ADP
fnp-5188	155	51	vivo	vivo	NOUN
fnp-5188	155	52	model	model	NOUN
fnp-5188	155	53	.	.	PUNCT
fnp-5188	156	1	figure	figure	VERB
fnp-5188	156	2	2	2	NUM
fnp-5188	156	3	:	:	PUNCT
fnp-5188	156	4	identification	identification	NOUN
fnp-5188	156	5	and	and	CCONJ
fnp-5188	156	6	specificity	specificity	NOUN
fnp-5188	156	7	of	of	ADP
fnp-5188	156	8	the	the	DET
fnp-5188	156	9	murine	murine	ADJ
fnp-5188	156	10	rgs5	rgs5	NOUN
fnp-5188	156	11	promoter	promoter	NOUN
fnp-5188	156	12	.	.	PUNCT
fnp-5188	157	1	a.	a.	NOUN
fnp-5188	157	2	structure	structure	NOUN
fnp-5188	157	3	of	of	ADP
fnp-5188	157	4	the	the	DET
fnp-5188	157	5	mrgs5	mrgs5	NOUN
fnp-5188	157	6	promoter	promoter	NOUN
fnp-5188	157	7	region	region	NOUN
fnp-5188	157	8	(	(	PUNCT
fnp-5188	157	9	e1	e1	PROPN
fnp-5188	157	10	:	:	PUNCT
fnp-5188	157	11	exon	exon	NOUN
fnp-5188	157	12	1	1	NUM
fnp-5188	157	13	)	)	PUNCT
fnp-5188	157	14	.	.	PUNCT
fnp-5188	158	1	numbered	number	VERB
fnp-5188	158	2	lanes	lane	NOUN
fnp-5188	158	3	indicate	indicate	VERB
fnp-5188	158	4	fragments	fragment	NOUN
fnp-5188	158	5	that	that	PRON
fnp-5188	158	6	have	have	AUX
fnp-5188	158	7	been	be	AUX
fnp-5188	158	8	cloned	clone	VERB
fnp-5188	158	9	into	into	ADP
fnp-5188	158	10	pgl19	pgl19	PROPN
fnp-5188	158	11	[	[	X
fnp-5188	158	12	luc2	luc2	X
fnp-5188	158	13	]	]	PUNCT
fnp-5188	158	14	and	and	CCONJ
fnp-5188	158	15	used	use	VERB
fnp-5188	158	16	for	for	ADP
fnp-5188	158	17	luciferase	luciferase	ADJ
fnp-5188	158	18	assays	assay	NOUN
fnp-5188	158	19	.	.	PUNCT
fnp-5188	159	1	b	b	X
fnp-5188	159	2	/	/	SYM
fnp-5188	159	3	c.	c.	PROPN
fnp-5188	159	4	luciferase	luciferase	PROPN
fnp-5188	159	5	reporter	reporter	NOUN
fnp-5188	159	6	assay	assay	VERB
fnp-5188	159	7	for	for	ADP
fnp-5188	159	8	the	the	DET
fnp-5188	159	9	murine	murine	ADJ
fnp-5188	159	10	rgs5	rgs5	ADJ
fnp-5188	159	11	promoter	promoter	NOUN
fnp-5188	159	12	fragments	fragment	NOUN
fnp-5188	159	13	.	.	PUNCT
fnp-5188	160	1	mbvps	mbvps	PROPN
fnp-5188	160	2	(	(	PUNCT
fnp-5188	160	3	b	b	X
fnp-5188	160	4	/	/	SYM
fnp-5188	160	5	c	c	NOUN
fnp-5188	160	6	)	)	PUNCT
fnp-5188	160	7	or	or	CCONJ
fnp-5188	160	8	gl261	gl261	PROPN
fnp-5188	160	9	cells	cell	NOUN
fnp-5188	160	10	(	(	PUNCT
fnp-5188	160	11	c	c	NOUN
fnp-5188	160	12	)	)	PUNCT
fnp-5188	160	13	were	be	AUX
fnp-5188	160	14	transfected	transfecte	VERB
fnp-5188	160	15	with	with	ADP
fnp-5188	160	16	pgl4.10[luc2	pgl4.10[luc2	NOUN
fnp-5188	160	17	]	]	PUNCT
fnp-5188	160	18	containing	contain	VERB
fnp-5188	160	19	the	the	DET
fnp-5188	160	20	promoter	promoter	NOUN
fnp-5188	160	21	fragments	fragment	NOUN
fnp-5188	160	22	as	as	SCONJ
fnp-5188	160	23	indicated	indicate	VERB
fnp-5188	160	24	in	in	ADP
fnp-5188	160	25	a.	a.	NOUN
fnp-5188	160	26	luminescence	luminescence	NOUN
fnp-5188	160	27	was	be	AUX
fnp-5188	160	28	measured	measure	VERB
fnp-5188	160	29	48	48	NUM
fnp-5188	160	30	h	h	NOUN
fnp-5188	160	31	post	post	NOUN
fnp-5188	160	32	transfection	transfection	NOUN
fnp-5188	160	33	and	and	CCONJ
fnp-5188	160	34	normalized	normalize	VERB
fnp-5188	160	35	to	to	ADP
fnp-5188	160	36	the	the	DET
fnp-5188	160	37	mean	mean	ADJ
fnp-5188	160	38	luminescence	luminescence	NOUN
fnp-5188	160	39	measured	measure	VERB
fnp-5188	160	40	in	in	ADP
fnp-5188	160	41	cells	cell	NOUN
fnp-5188	160	42	transfected	transfecte	VERB
fnp-5188	160	43	with	with	ADP
fnp-5188	160	44	empty	empty	ADJ
fnp-5188	160	45	pgl4.10[luc2	pgl4.10[luc2	NOUN
fnp-5188	160	46	]	]	X
fnp-5188	160	47	(	(	PUNCT
fnp-5188	160	48	rfu	rfu	NOUN
fnp-5188	160	49	:	:	PUNCT
fnp-5188	160	50	relative	relative	ADJ
fnp-5188	160	51	fluorescence	fluorescence	NOUN
fnp-5188	160	52	units	unit	NOUN
fnp-5188	160	53	;	;	PUNCT
fnp-5188	160	54	n=3	n=3	NOUN
fnp-5188	160	55	-	-	SYM
fnp-5188	160	56	4	4	NUM
fnp-5188	160	57	,	,	PUNCT
fnp-5188	160	58	sd	sd	NOUN
fnp-5188	160	59	,	,	PUNCT
fnp-5188	160	60	*	*	PUNCT
fnp-5188	160	61	p<0.05	p<0.05	NOUN
fnp-5188	160	62	,	,	PUNCT
fnp-5188	160	63	*	*	PUNCT
fnp-5188	160	64	*	*	PUNCT
fnp-5188	160	65	p<0.01	p<0.01	PROPN
fnp-5188	160	66	,	,	PUNCT
fnp-5188	160	67	n.s	n.s	PROPN
fnp-5188	160	68	.	.	PROPN
fnp-5188	160	69	not	not	PART
fnp-5188	160	70	significant	significant	ADJ
fnp-5188	160	71	)	)	PUNCT
fnp-5188	160	72	.	.	PUNCT
fnp-5188	161	1	knocking	knock	VERB
fnp-5188	161	2	out	out	ADP
fnp-5188	161	3	tgf	tgf	PROPN
fnp-5188	161	4	-	-	PUNCT
fnp-5188	161	5	β	β	PROPN
fnp-5188	161	6	in	in	ADP
fnp-5188	161	7	gl261	gl261	PROPN
fnp-5188	161	8	gbms	gbms	NOUN
fnp-5188	161	9	reduces	reduce	VERB
fnp-5188	161	10	slug	slug	NOUN
fnp-5188	161	11	,	,	PUNCT
fnp-5188	161	12	αsma	αsma	NOUN
fnp-5188	161	13	and	and	CCONJ
fnp-5188	161	14	pdgfrβ	pdgfrβ	NOUN
fnp-5188	161	15	expression	expression	NOUN
fnp-5188	161	16	in	in	ADP
fnp-5188	161	17	tumor	tumor	NOUN
fnp-5188	161	18	-	-	PUNCT
fnp-5188	161	19	associated	associate	VERB
fnp-5188	161	20	vamcs	vamcs	NOUN
fnp-5188	161	21	and	and	CCONJ
fnp-5188	161	22	is	be	AUX
fnp-5188	161	23	associated	associate	VERB
fnp-5188	161	24	with	with	ADP
fnp-5188	161	25	reduced	reduced	ADJ
fnp-5188	161	26	tumoral	tumoral	ADJ
fnp-5188	161	27	vamc	vamc	NOUN
fnp-5188	161	28	and	and	CCONJ
fnp-5188	161	29	ec	ec	PROPN
fnp-5188	161	30	density	density	NOUN
fnp-5188	161	31	in	in	ADP
fnp-5188	161	32	our	our	PRON
fnp-5188	161	33	previous	previous	ADJ
fnp-5188	161	34	studies	study	NOUN
fnp-5188	161	35	we	we	PRON
fnp-5188	161	36	observed	observe	VERB
fnp-5188	161	37	that	that	SCONJ
fnp-5188	161	38	in	in	ADP
fnp-5188	161	39	human	human	ADJ
fnp-5188	161	40	brain	brain	NOUN
fnp-5188	161	41	microvascular	microvascular	NOUN
fnp-5188	161	42	pericytes	pericyte	NOUN
fnp-5188	161	43	slug	slug	VERB
fnp-5188	161	44	and	and	CCONJ
fnp-5188	161	45	αsma	αsma	NOUN
fnp-5188	161	46	expression	expression	NOUN
fnp-5188	161	47	was	be	AUX
fnp-5188	161	48	induced	induce	VERB
fnp-5188	161	49	by	by	ADP
fnp-5188	161	50	tgf	tgf	PROPN
fnp-5188	161	51	-	-	PUNCT
fnp-5188	161	52	β	β	NOUN
fnp-5188	161	53	.	.	PUNCT
fnp-5188	162	1	this	this	DET
fnp-5188	162	2	observation	observation	NOUN
fnp-5188	162	3	correlates	correlate	VERB
fnp-5188	162	4	with	with	ADP
fnp-5188	162	5	the	the	DET
fnp-5188	162	6	finding	finding	NOUN
fnp-5188	162	7	that	that	SCONJ
fnp-5188	162	8	in	in	ADP
fnp-5188	162	9	human	human	ADJ
fnp-5188	162	10	gbms	gbms	NOUN
fnp-5188	162	11	,	,	PUNCT
fnp-5188	162	12	slug	slug	NOUN
fnp-5188	162	13	expression	expression	NOUN
fnp-5188	162	14	is	be	AUX
fnp-5188	162	15	associated	associate	VERB
fnp-5188	162	16	with	with	ADP
fnp-5188	162	17	pdgfrβ	pdgfrβ	NOUN
fnp-5188	162	18	and	and	CCONJ
fnp-5188	162	19	αsma	αsma	NOUN
fnp-5188	162	20	[	[	X
fnp-5188	162	21	16	16	NUM
fnp-5188	162	22	]	]	PUNCT
fnp-5188	162	23	.	.	PUNCT
fnp-5188	163	1	therefore	therefore	ADV
fnp-5188	163	2	,	,	PUNCT
fnp-5188	163	3	in	in	ADP
fnp-5188	163	4	our	our	PRON
fnp-5188	163	5	mouse	mouse	NOUN
fnp-5188	163	6	gbm	gbm	PROPN
fnp-5188	163	7	model	model	NOUN
fnp-5188	163	8	we	we	PRON
fnp-5188	163	9	sought	seek	VERB
fnp-5188	163	10	to	to	PART
fnp-5188	163	11	investigate	investigate	VERB
fnp-5188	163	12	whether	whether	SCONJ
fnp-5188	163	13	the	the	DET
fnp-5188	163	14	knockout	knockout	NOUN
fnp-5188	163	15	of	of	ADP
fnp-5188	163	16	tgf	tgf	PROPN
fnp-5188	163	17	-	-	PUNCT
fnp-5188	163	18	β	β	PROPN
fnp-5188	163	19	in	in	ADP
fnp-5188	163	20	gl261	gl261	PROPN
fnp-5188	163	21	cells	cell	NOUN
fnp-5188	163	22	also	also	ADV
fnp-5188	163	23	influences	influence	VERB
fnp-5188	163	24	the	the	DET
fnp-5188	163	25	expression	expression	NOUN
fnp-5188	163	26	of	of	ADP
fnp-5188	163	27	these	these	DET
fnp-5188	163	28	proteins	protein	NOUN
fnp-5188	163	29	.	.	PUNCT
fnp-5188	164	1	as	as	SCONJ
fnp-5188	164	2	tumor	tumor	NOUN
fnp-5188	164	3	angiogenesis	angiogenesis	NOUN
fnp-5188	164	4	correlates	correlate	VERB
fnp-5188	164	5	with	with	ADP
fnp-5188	164	6	tumor	tumor	NOUN
fnp-5188	164	7	size	size	NOUN
fnp-5188	164	8	and	and	CCONJ
fnp-5188	164	9	growth	growth	NOUN
fnp-5188	164	10	,	,	PUNCT
fnp-5188	164	11	we	we	PRON
fnp-5188	164	12	determined	determine	VERB
fnp-5188	164	13	the	the	DET
fnp-5188	164	14	growth	growth	NOUN
fnp-5188	164	15	rate	rate	NOUN
fnp-5188	164	16	of	of	ADP
fnp-5188	164	17	par	par	NOUN
fnp-5188	164	18	and	and	CCONJ
fnp-5188	164	19	tgf	tgf	PROPN
fnp-5188	164	20	-	-	PUNCT
fnp-5188	164	21	β	β	NOUN
fnp-5188	164	22	-	-	PUNCT
fnp-5188	164	23	ko	ko	ADJ
fnp-5188	164	24	cells	cell	NOUN
fnp-5188	164	25	and	and	CCONJ
fnp-5188	164	26	tumors	tumor	NOUN
fnp-5188	164	27	in	in	ADP
fnp-5188	164	28	a	a	DET
fnp-5188	164	29	preliminary	preliminary	ADJ
fnp-5188	164	30	experiment	experiment	NOUN
fnp-5188	164	31	to	to	PART
fnp-5188	164	32	avoid	avoid	VERB
fnp-5188	164	33	artifacts	artifact	NOUN
fnp-5188	164	34	generated	generate	VERB
fnp-5188	164	35	by	by	ADP
fnp-5188	164	36	different	different	ADJ
fnp-5188	164	37	sizes	size	NOUN
fnp-5188	164	38	of	of	ADP
fnp-5188	164	39	par	par	NOUN
fnp-5188	164	40	and	and	CCONJ
fnp-5188	164	41	tgf	tgf	PROPN
fnp-5188	164	42	-	-	PUNCT
fnp-5188	164	43	β	β	NOUN
fnp-5188	164	44	-	-	PUNCT
fnp-5188	164	45	ko	ko	PROPN
fnp-5188	164	46	gbms	gbms	NOUN
fnp-5188	164	47	.	.	PUNCT
fnp-5188	165	1	in	in	ADP
fnp-5188	165	2	a	a	DET
fnp-5188	165	3	preliminary	preliminary	ADJ
fnp-5188	165	4	experiment	experiment	NOUN
fnp-5188	165	5	using	use	VERB
fnp-5188	165	6	mri	mri	NOUN
fnp-5188	165	7	analyses	analysis	NOUN
fnp-5188	165	8	,	,	PUNCT
fnp-5188	165	9	we	we	PRON
fnp-5188	165	10	observed	observe	VERB
fnp-5188	165	11	that	that	SCONJ
fnp-5188	165	12	tgf	tgf	PROPN
fnp-5188	165	13	-	-	PUNCT
fnp-5188	165	14	β	β	NOUN
fnp-5188	165	15	-	-	PUNCT
fnp-5188	165	16	ko	ko	ADJ
fnp-5188	165	17	gl261	gl261	PROPN
fnp-5188	165	18	cells	cell	NOUN
fnp-5188	165	19	showed	show	VERB
fnp-5188	165	20	a	a	DET
fnp-5188	165	21	delayed	delay	VERB
fnp-5188	165	22	tumor	tumor	NOUN
fnp-5188	165	23	growth	growth	NOUN
fnp-5188	165	24	also	also	ADV
fnp-5188	165	25	in	in	ADP
fnp-5188	165	26	vivo	vivo	NOUN
fnp-5188	165	27	.	.	PUNCT
fnp-5188	166	1	therefore	therefore	ADV
fnp-5188	166	2	,	,	PUNCT
fnp-5188	166	3	we	we	PRON
fnp-5188	166	4	determined	determine	VERB
fnp-5188	166	5	the	the	DET
fnp-5188	166	6	time	time	NOUN
fnp-5188	166	7	point	point	NOUN
fnp-5188	166	8	when	when	SCONJ
fnp-5188	166	9	the	the	DET
fnp-5188	166	10	tumors	tumor	NOUN
fnp-5188	166	11	reached	reach	VERB
fnp-5188	166	12	a	a	DET
fnp-5188	166	13	size	size	NOUN
fnp-5188	166	14	of	of	ADP
fnp-5188	166	15	1.5	1.5	NUM
fnp-5188	166	16	to	to	PART
fnp-5188	166	17	3	3	NUM
fnp-5188	166	18	 	 	SPACE
fnp-5188	166	19	mm	mm	PROPN
fnp-5188	166	20	in	in	ADP
fnp-5188	166	21	diameter	diameter	NOUN
fnp-5188	166	22	.	.	PUNCT
fnp-5188	167	1	material	material	NOUN
fnp-5188	167	2	for	for	ADP
fnp-5188	167	3	analyses	analysis	NOUN
fnp-5188	167	4	was	be	AUX
fnp-5188	167	5	collected	collect	VERB
fnp-5188	167	6	when	when	SCONJ
fnp-5188	167	7	tumors	tumor	NOUN
fnp-5188	167	8	were	be	AUX
fnp-5188	167	9	in	in	ADP
fnp-5188	167	10	that	that	DET
fnp-5188	167	11	range	range	NOUN
fnp-5188	167	12	of	of	ADP
fnp-5188	167	13	size	size	NOUN
fnp-5188	167	14	(	(	PUNCT
fnp-5188	167	15	day	day	NOUN
fnp-5188	167	16	29	29	NUM
fnp-5188	167	17	after	after	ADP
fnp-5188	167	18	implantation	implantation	NOUN
fnp-5188	167	19	for	for	ADP
fnp-5188	167	20	par	par	NOUN
fnp-5188	167	21	tumors	tumor	NOUN
fnp-5188	167	22	and	and	CCONJ
fnp-5188	167	23	day	day	NOUN
fnp-5188	167	24	59	59	NUM
fnp-5188	167	25	after	after	ADP
fnp-5188	167	26	implantation	implantation	NOUN
fnp-5188	167	27	of	of	ADP
fnp-5188	167	28	tgf	tgf	PROPN
fnp-5188	167	29	-	-	PUNCT
fnp-5188	167	30	β	β	NOUN
fnp-5188	167	31	-	-	PUNCT
fnp-5188	167	32	ko	ko	NOUN
fnp-5188	167	33	-	-	PUNCT
fnp-5188	167	34	tumors	tumor	NOUN
fnp-5188	167	35	(	(	PUNCT
fnp-5188	167	36	suppl	suppl	PROPN
fnp-5188	167	37	.	.	PUNCT
fnp-5188	167	38	fig	fig	PROPN
fnp-5188	167	39	.	.	PUNCT
fnp-5188	168	1	3a	3a	NUM
fnp-5188	168	2	)	)	PUNCT
fnp-5188	168	3	.	.	PUNCT
fnp-5188	169	1	even	even	ADV
fnp-5188	169	2	if	if	SCONJ
fnp-5188	169	3	in	in	ADP
fnp-5188	169	4	some	some	DET
fnp-5188	169	5	mice	mouse	NOUN
fnp-5188	169	6	par	par	NOUN
fnp-5188	169	7	tumor	tumor	NOUN
fnp-5188	169	8	grew	grow	VERB
fnp-5188	169	9	very	very	ADV
fnp-5188	169	10	fast	fast	ADV
fnp-5188	170	1	(	(	PUNCT
fnp-5188	170	2	suppl	suppl	PROPN
fnp-5188	170	3	.	.	PUNCT
fnp-5188	170	4	fig	fig	NOUN
fnp-5188	170	5	.	.	PUNCT
fnp-5188	171	1	3c	3c	NUM
fnp-5188	171	2	)	)	PUNCT
fnp-5188	171	3	,	,	PUNCT
fnp-5188	171	4	we	we	PRON
fnp-5188	171	5	did	do	AUX
fnp-5188	171	6	not	not	PART
fnp-5188	171	7	observe	observe	VERB
fnp-5188	171	8	any	any	DET
fnp-5188	171	9	significant	significant	ADJ
fnp-5188	171	10	differences	difference	NOUN
fnp-5188	171	11	in	in	ADP
fnp-5188	171	12	the	the	DET
fnp-5188	171	13	size	size	NOUN
fnp-5188	171	14	of	of	ADP
fnp-5188	171	15	par	par	NOUN
fnp-5188	171	16	and	and	CCONJ
fnp-5188	171	17	tgf	tgf	PROPN
fnp-5188	171	18	-	-	PUNCT
fnp-5188	171	19	β	β	NOUN
fnp-5188	171	20	-	-	PUNCT
fnp-5188	171	21	ko	ko	ADJ
fnp-5188	171	22	tumors	tumor	NOUN
fnp-5188	171	23	in	in	ADP
fnp-5188	171	24	the	the	DET
fnp-5188	171	25	collected	collect	VERB
fnp-5188	171	26	brain	brain	NOUN
fnp-5188	171	27	tissues	tissue	NOUN
fnp-5188	171	28	in	in	ADP
fnp-5188	171	29	retrospective	retrospective	ADJ
fnp-5188	171	30	analyses	analysis	NOUN
fnp-5188	171	31	(	(	PUNCT
fnp-5188	171	32	suppl	suppl	PROPN
fnp-5188	171	33	.	.	PUNCT
fnp-5188	171	34	fig	fig	NOUN
fnp-5188	171	35	.	.	PUNCT
fnp-5188	172	1	3	3	NUM
fnp-5188	172	2	d	d	NOUN
fnp-5188	172	3	/	/	SYM
fnp-5188	172	4	f	f	NOUN
fnp-5188	172	5	)	)	PUNCT
fnp-5188	172	6	.	.	PUNCT
fnp-5188	173	1	we	we	PRON
fnp-5188	173	2	also	also	ADV
fnp-5188	173	3	determined	determine	VERB
fnp-5188	173	4	the	the	DET
fnp-5188	173	5	specificity	specificity	NOUN
fnp-5188	173	6	of	of	ADP
fnp-5188	173	7	gfp	gfp	PROPN
fnp-5188	173	8	positivity	positivity	NOUN
fnp-5188	173	9	in	in	ADP
fnp-5188	173	10	mural	mural	ADJ
fnp-5188	173	11	cells	cell	NOUN
fnp-5188	173	12	of	of	ADP
fnp-5188	173	13	rgs5	rgs5	ADJ
fnp-5188	173	14	-	-	PUNCT
fnp-5188	173	15	gfp	gfp	NOUN
fnp-5188	173	16	reporter	reporter	NOUN
fnp-5188	173	17	mice	mouse	NOUN
fnp-5188	173	18	by	by	ADP
fnp-5188	173	19	cd31	cd31	PROPN
fnp-5188	173	20	and	and	CCONJ
fnp-5188	173	21	gfp	gfp	PROPN
fnp-5188	173	22	staining	stain	VERB
fnp-5188	173	23	.	.	PUNCT
fnp-5188	174	1	as	as	SCONJ
fnp-5188	174	2	indicated	indicate	VERB
fnp-5188	174	3	in	in	ADP
fnp-5188	174	4	suppl	suppl	PROPN
fnp-5188	174	5	.	.	PUNCT
fnp-5188	175	1	fig	fig	NOUN
fnp-5188	175	2	.	.	PUNCT
fnp-5188	176	1	4	4	NUM
fnp-5188	176	2	,	,	PUNCT
fnp-5188	176	3	gfp	gfp	PROPN
fnp-5188	176	4	was	be	AUX
fnp-5188	176	5	only	only	ADV
fnp-5188	176	6	present	present	ADJ
fnp-5188	176	7	in	in	ADP
fnp-5188	176	8	cells	cell	NOUN
fnp-5188	176	9	wrapping	wrap	VERB
fnp-5188	176	10	around	around	ADP
fnp-5188	176	11	cd31	cd31	PROPN
fnp-5188	176	12	+	+	CCONJ
fnp-5188	176	13	endothelial	endothelial	ADJ
fnp-5188	176	14	cells	cell	NOUN
fnp-5188	176	15	.	.	PUNCT
fnp-5188	177	1	in	in	ADP
fnp-5188	177	2	tgf	tgf	PROPN
fnp-5188	177	3	-	-	PUNCT
fnp-5188	177	4	β	β	PROPN
fnp-5188	177	5	-	-	PUNCT
fnp-5188	177	6	ko	ko	ADJ
fnp-5188	177	7	-	-	PUNCT
fnp-5188	177	8	gbm	gbm	PROPN
fnp-5188	177	9	bearing	bear	VERB
fnp-5188	177	10	mice	mouse	NOUN
fnp-5188	177	11	,	,	PUNCT
fnp-5188	177	12	in	in	ADP
fnp-5188	177	13	the	the	DET
fnp-5188	177	14	tumor	tumor	NOUN
fnp-5188	177	15	core	core	NOUN
fnp-5188	177	16	the	the	DET
fnp-5188	177	17	number	number	NOUN
fnp-5188	177	18	of	of	ADP
fnp-5188	177	19	gfp	gfp	PROPN
fnp-5188	177	20	positive	positive	ADJ
fnp-5188	177	21	cells	cell	NOUN
fnp-5188	177	22	was	be	AUX
fnp-5188	177	23	reduced	reduce	VERB
fnp-5188	177	24	2	2	NUM
fnp-5188	177	25	-	-	NOUN
fnp-5188	177	26	fold	fold	ADJ
fnp-5188	177	27	(	(	PUNCT
fnp-5188	177	28	p	p	X
fnp-5188	177	29	<	<	X
fnp-5188	177	30	0.01	0.01	NUM
fnp-5188	177	31	)	)	PUNCT
fnp-5188	177	32	,	,	PUNCT
fnp-5188	177	33	accompanied	accompany	VERB
fnp-5188	177	34	by	by	ADP
fnp-5188	177	35	a	a	DET
fnp-5188	177	36	highly	highly	ADV
fnp-5188	177	37	significant	significant	ADJ
fnp-5188	177	38	reduction	reduction	NOUN
fnp-5188	177	39	of	of	ADP
fnp-5188	177	40	slug	slug	NOUN
fnp-5188	177	41	(	(	PUNCT
fnp-5188	177	42	3.2	3.2	NUM
fnp-5188	177	43	x	x	NOUN
fnp-5188	177	44	)	)	PUNCT
fnp-5188	177	45	,	,	PUNCT
fnp-5188	177	46	pdgfrβ	pdgfrβ	NOUN
fnp-5188	177	47	(	(	PUNCT
fnp-5188	177	48	2.0	2.0	NUM
fnp-5188	177	49	x	x	NOUN
fnp-5188	177	50	)	)	PUNCT
fnp-5188	177	51	and	and	CCONJ
fnp-5188	177	52	αsma	αsma	PROPN
fnp-5188	177	53	(	(	PUNCT
fnp-5188	177	54	3.3	3.3	NUM
fnp-5188	177	55	x	x	NOUN
fnp-5188	177	56	)	)	PUNCT
fnp-5188	177	57	expressing	express	VERB
fnp-5188	177	58	cells	cell	NOUN
fnp-5188	177	59	.	.	PUNCT
fnp-5188	178	1	notably	notably	ADV
fnp-5188	178	2	the	the	DET
fnp-5188	178	3	number	number	NOUN
fnp-5188	178	4	of	of	ADP
fnp-5188	178	5	gfp+/pdgfrβ+/slug+	gfp+/pdgfrβ+/slug+	NOUN
fnp-5188	178	6	(	(	PUNCT
fnp-5188	178	7	7.4	7.4	NUM
fnp-5188	178	8	x	x	NOUN
fnp-5188	178	9	)	)	PUNCT
fnp-5188	178	10	and	and	CCONJ
fnp-5188	178	11	gfp+/pdgfrβ+/αsma+	gfp+/pdgfrβ+/αsma+	VERB
fnp-5188	178	12	cells	cell	NOUN
fnp-5188	178	13	(	(	PUNCT
fnp-5188	178	14	2.26	2.26	NUM
fnp-5188	178	15	x	x	NOUN
fnp-5188	178	16	)	)	PUNCT
fnp-5188	178	17	,	,	PUNCT
fnp-5188	178	18	indicating	indicate	VERB
fnp-5188	178	19	activated	activated	ADJ
fnp-5188	178	20	vamcs	vamcs	NOUN
fnp-5188	178	21	,	,	PUNCT
fnp-5188	178	22	was	be	AUX
fnp-5188	178	23	significantly	significantly	ADV
fnp-5188	178	24	reduced	reduce	VERB
fnp-5188	178	25	(	(	PUNCT
fnp-5188	178	26	figs	fig	NOUN
fnp-5188	178	27	.	.	X
fnp-5188	178	28	3	3	NUM
fnp-5188	178	29	and	and	CCONJ
fnp-5188	178	30	4	4	NUM
fnp-5188	178	31	)	)	PUNCT
fnp-5188	178	32	.	.	PUNCT
fnp-5188	179	1	similar	similar	ADJ
fnp-5188	179	2	results	result	NOUN
fnp-5188	179	3	,	,	PUNCT
fnp-5188	179	4	though	though	SCONJ
fnp-5188	179	5	not	not	PART
fnp-5188	179	6	as	as	SCONJ
fnp-5188	179	7	pronounced	pronounce	VERB
fnp-5188	179	8	,	,	PUNCT
fnp-5188	179	9	were	be	AUX
fnp-5188	179	10	observed	observe	VERB
fnp-5188	179	11	in	in	ADP
fnp-5188	179	12	the	the	DET
fnp-5188	179	13	tumor	tumor	NOUN
fnp-5188	179	14	infiltration	infiltration	NOUN
fnp-5188	179	15	zone	zone	NOUN
fnp-5188	179	16	(	(	PUNCT
fnp-5188	179	17	suppl	suppl	PROPN
fnp-5188	179	18	.	.	PUNCT
fnp-5188	179	19	figs	fig	NOUN
fnp-5188	179	20	.	.	PUNCT
fnp-5188	180	1	5	5	NUM
fnp-5188	180	2	and	and	CCONJ
fnp-5188	180	3	6	6	NUM
fnp-5188	180	4	)	)	PUNCT
fnp-5188	180	5	.	.	PUNCT
fnp-5188	181	1	figure	figure	VERB
fnp-5188	181	2	3	3	NUM
fnp-5188	181	3	.	.	PUNCT
fnp-5188	182	1	gfp+	gfp+	PROPN
fnp-5188	182	2	vamcs	vamcs	PROPN
fnp-5188	182	3	expressing	express	VERB
fnp-5188	182	4	slug	slug	NOUN
fnp-5188	182	5	and/or	and/or	CCONJ
fnp-5188	182	6	pdgfrβ	pdgfrβ	NOUN
fnp-5188	182	7	were	be	AUX
fnp-5188	182	8	significantly	significantly	ADV
fnp-5188	182	9	reduced	reduce	VERB
fnp-5188	182	10	in	in	ADP
fnp-5188	182	11	tgf	tgf	PROPN
fnp-5188	182	12	-	-	PUNCT
fnp-5188	182	13	β	β	NOUN
fnp-5188	182	14	-	-	PUNCT
fnp-5188	182	15	ko	ko	PROPN
fnp-5188	182	16	gbms	gbms	NOUN
fnp-5188	182	17	.	.	PUNCT
fnp-5188	183	1	a.	a.	NOUN
fnp-5188	183	2	immunofluorescence	immunofluorescence	NOUN
fnp-5188	183	3	of	of	ADP
fnp-5188	183	4	vamcs	vamcs	NOUN
fnp-5188	183	5	(	(	PUNCT
fnp-5188	183	6	green	green	ADJ
fnp-5188	183	7	)	)	PUNCT
fnp-5188	183	8	,	,	PUNCT
fnp-5188	183	9	slug	slug	NOUN
fnp-5188	183	10	(	(	PUNCT
fnp-5188	183	11	blue	blue	PROPN
fnp-5188	183	12	)	)	PUNCT
fnp-5188	183	13	,	,	PUNCT
fnp-5188	183	14	pdgfrβ	pdgfrβ	NOUN
fnp-5188	183	15	(	(	PUNCT
fnp-5188	183	16	dark	dark	ADJ
fnp-5188	183	17	red	red	NOUN
fnp-5188	183	18	)	)	PUNCT
fnp-5188	183	19	in	in	ADP
fnp-5188	183	20	the	the	DET
fnp-5188	183	21	tumor	tumor	NOUN
fnp-5188	183	22	core	core	NOUN
fnp-5188	183	23	.	.	PUNCT
fnp-5188	184	1	in	in	ADP
fnp-5188	184	2	the	the	DET
fnp-5188	184	3	merged	merged	ADJ
fnp-5188	184	4	picture	picture	NOUN
fnp-5188	184	5	(	(	PUNCT
fnp-5188	184	6	second	second	ADJ
fnp-5188	184	7	right	right	NOUN
fnp-5188	184	8	)	)	PUNCT
fnp-5188	184	9	gfp	gfp	PROPN
fnp-5188	184	10	/	/	SYM
fnp-5188	184	11	slug	slug	NOUN
fnp-5188	184	12	/	/	SYM
fnp-5188	184	13	pdgfrβ	pdgfrβ	NOUN
fnp-5188	184	14	triple	triple	ADJ
fnp-5188	184	15	positive	positive	ADJ
fnp-5188	184	16	cells	cell	NOUN
fnp-5188	184	17	are	be	AUX
fnp-5188	184	18	indicated	indicate	VERB
fnp-5188	184	19	by	by	ADP
fnp-5188	184	20	white	white	ADJ
fnp-5188	184	21	arrows	arrow	NOUN
fnp-5188	184	22	.	.	PUNCT
fnp-5188	185	1	in	in	ADP
fnp-5188	185	2	the	the	DET
fnp-5188	185	3	merged	merged	ADJ
fnp-5188	185	4	picture	picture	NOUN
fnp-5188	185	5	(	(	PUNCT
fnp-5188	185	6	right	right	ADJ
fnp-5188	185	7	)	)	PUNCT
fnp-5188	185	8	mcherry+	mcherry+	PART
fnp-5188	185	9	gl261	gl261	NOUN
fnp-5188	185	10	tumor	tumor	NOUN
fnp-5188	185	11	cells	cell	NOUN
fnp-5188	185	12	are	be	AUX
fnp-5188	185	13	also	also	ADV
fnp-5188	185	14	shown	show	VERB
fnp-5188	185	15	.	.	PUNCT
fnp-5188	186	1	(	(	PUNCT
fnp-5188	186	2	one	one	NUM
fnp-5188	186	3	picture	picture	NOUN
fnp-5188	186	4	each	each	PRON
fnp-5188	186	5	is	be	AUX
fnp-5188	186	6	exemplary	exemplary	ADJ
fnp-5188	186	7	shown	show	VERB
fnp-5188	186	8	;	;	PUNCT
fnp-5188	186	9	63x	63x	X
fnp-5188	186	10	magnification	magnification	NOUN
fnp-5188	186	11	;	;	PUNCT
fnp-5188	186	12	bars	bar	NOUN
fnp-5188	186	13	:	:	PUNCT
fnp-5188	186	14	10	10	NUM
fnp-5188	186	15	µm	µm	NOUN
fnp-5188	186	16	)	)	PUNCT
fnp-5188	186	17	.	.	PUNCT
fnp-5188	187	1	b.	b.	PROPN
fnp-5188	187	2	overview	overview	NOUN
fnp-5188	187	3	of	of	ADP
fnp-5188	187	4	gfp	gfp	PROPN
fnp-5188	187	5	,	,	PUNCT
fnp-5188	187	6	slug	slug	NOUN
fnp-5188	187	7	,	,	PUNCT
fnp-5188	187	8	pdgfrβ	pdgfrβ	NOUN
fnp-5188	187	9	and	and	CCONJ
fnp-5188	187	10	mcherry	mcherry	ADJ
fnp-5188	187	11	positive	positive	ADJ
fnp-5188	187	12	cells	cell	NOUN
fnp-5188	187	13	in	in	ADP
fnp-5188	187	14	the	the	DET
fnp-5188	187	15	tumor	tumor	NOUN
fnp-5188	187	16	area	area	NOUN
fnp-5188	187	17	(	(	PUNCT
fnp-5188	187	18	25x	25x	NOUN
fnp-5188	187	19	magnification	magnification	NOUN
fnp-5188	187	20	;	;	PUNCT
fnp-5188	187	21	bars	bar	NOUN
fnp-5188	187	22	=	=	NOUN
fnp-5188	187	23	50	50	NUM
fnp-5188	187	24	µm	µm	NOUN
fnp-5188	187	25	)	)	PUNCT
fnp-5188	187	26	.	.	PUNCT
fnp-5188	188	1	c	c	X
fnp-5188	188	2	-	-	PUNCT
fnp-5188	188	3	e.	e.	NOUN
fnp-5188	188	4	quantification	quantification	NOUN
fnp-5188	188	5	of	of	ADP
fnp-5188	188	6	gfp+	gfp+	PROPN
fnp-5188	188	7	cells	cell	NOUN
fnp-5188	188	8	(	(	PUNCT
fnp-5188	188	9	c	c	NOUN
fnp-5188	188	10	)	)	PUNCT
fnp-5188	188	11	,	,	PUNCT
fnp-5188	188	12	slug+	slug+	VERB
fnp-5188	188	13	(	(	PUNCT
fnp-5188	188	14	d	d	NOUN
fnp-5188	188	15	)	)	PUNCT
fnp-5188	188	16	and	and	CCONJ
fnp-5188	188	17	pdgfrβ+	pdgfrβ+	ADJ
fnp-5188	188	18	(	(	PUNCT
fnp-5188	188	19	e	e	NOUN
fnp-5188	188	20	)	)	PUNCT
fnp-5188	188	21	cells	cell	NOUN
fnp-5188	188	22	(	(	PUNCT
fnp-5188	188	23	n=3	n=3	PUNCT
fnp-5188	188	24	mice	mouse	NOUN
fnp-5188	188	25	per	per	ADP
fnp-5188	188	26	group	group	NOUN
fnp-5188	188	27	,	,	PUNCT
fnp-5188	188	28	9	9	NUM
fnp-5188	188	29	-	-	SYM
fnp-5188	188	30	60	60	NUM
fnp-5188	188	31	slices	slice	NOUN
fnp-5188	188	32	per	per	ADP
fnp-5188	188	33	group	group	NOUN
fnp-5188	188	34	)	)	PUNCT
fnp-5188	188	35	.	.	PUNCT
fnp-5188	189	1	f.	f.	PROPN
fnp-5188	189	2	quantification	quantification	NOUN
fnp-5188	189	3	of	of	ADP
fnp-5188	189	4	slug+/pdgfrβ+/gfp+	slug+/pdgfrβ+/gfp+	PROPN
fnp-5188	189	5	triple	triple	ADJ
fnp-5188	189	6	positive	positive	ADJ
fnp-5188	189	7	cells	cell	NOUN
fnp-5188	189	8	(	(	PUNCT
fnp-5188	189	9	n=3	n=3	PUNCT
fnp-5188	189	10	mice	mouse	NOUN
fnp-5188	189	11	,	,	PUNCT
fnp-5188	189	12	3	3	NUM
fnp-5188	189	13	sections	section	NOUN
fnp-5188	189	14	/	/	SYM
fnp-5188	189	15	mouse	mouse	NOUN
fnp-5188	189	16	)	)	PUNCT
fnp-5188	189	17	.	.	PUNCT
fnp-5188	190	1	c	c	X
fnp-5188	190	2	-	-	PUNCT
fnp-5188	190	3	f	f	ADJ
fnp-5188	190	4	:	:	PUNCT
fnp-5188	190	5	sem	sem	PROPN
fnp-5188	190	6	,	,	PUNCT
fnp-5188	190	7	t	t	NOUN
fnp-5188	190	8	-	-	PUNCT
fnp-5188	190	9	test	test	NOUN
fnp-5188	190	10	,	,	PUNCT
fnp-5188	190	11	*	*	PUNCT
fnp-5188	190	12	p<0.05	p<0.05	NOUN
fnp-5188	190	13	,	,	PUNCT
fnp-5188	190	14	*	*	PUNCT
fnp-5188	190	15	*	*	PUNCT
fnp-5188	190	16	p<0.01	p<0.01	PROPN
fnp-5188	190	17	*	*	PROPN
fnp-5188	190	18	*	*	PUNCT
fnp-5188	190	19	*	*	PUNCT
fnp-5188	190	20	p<0.001	p<0.001	X
fnp-5188	190	21	,	,	PUNCT
fnp-5188	190	22	*	*	PUNCT
fnp-5188	190	23	*	*	PUNCT
fnp-5188	190	24	*	*	PUNCT
fnp-5188	190	25	*	*	PUNCT
fnp-5188	190	26	p<0.0001	p<0.0001	NOUN
fnp-5188	190	27	.	.	PUNCT
fnp-5188	190	28	figure	figure	NOUN
fnp-5188	190	29	4	4	NUM
fnp-5188	190	30	.	.	PUNCT
fnp-5188	191	1	gfp+	gfp+	PROPN
fnp-5188	191	2	vamcs	vamcs	PROPN
fnp-5188	191	3	expressing	express	VERB
fnp-5188	191	4	αsma	αsma	NOUN
fnp-5188	191	5	and/or	and/or	CCONJ
fnp-5188	191	6	pdgfrβ	pdgfrβ	NOUN
fnp-5188	191	7	were	be	AUX
fnp-5188	191	8	significantly	significantly	ADV
fnp-5188	191	9	reduced	reduce	VERB
fnp-5188	191	10	in	in	ADP
fnp-5188	191	11	tgf	tgf	PROPN
fnp-5188	191	12	-	-	PUNCT
fnp-5188	191	13	β	β	NOUN
fnp-5188	191	14	-	-	PUNCT
fnp-5188	191	15	ko	ko	PROPN
fnp-5188	191	16	gbms	gbms	NOUN
fnp-5188	191	17	.	.	PUNCT
fnp-5188	192	1	a.	a.	NOUN
fnp-5188	192	2	immunofluorescence	immunofluorescence	NOUN
fnp-5188	192	3	of	of	ADP
fnp-5188	192	4	vamcs	vamcs	NOUN
fnp-5188	192	5	(	(	PUNCT
fnp-5188	192	6	green	green	NOUN
fnp-5188	192	7	)	)	PUNCT
fnp-5188	192	8	,	,	PUNCT
fnp-5188	192	9	αsma	αsma	PROPN
fnp-5188	192	10	(	(	PUNCT
fnp-5188	192	11	blue	blue	PROPN
fnp-5188	192	12	)	)	PUNCT
fnp-5188	192	13	,	,	PUNCT
fnp-5188	192	14	pdgfrβ	pdgfrβ	NOUN
fnp-5188	192	15	(	(	PUNCT
fnp-5188	192	16	magenta	magenta	PROPN
fnp-5188	192	17	)	)	PUNCT
fnp-5188	192	18	in	in	ADP
fnp-5188	192	19	the	the	DET
fnp-5188	192	20	tumor	tumor	NOUN
fnp-5188	192	21	core	core	NOUN
fnp-5188	192	22	.	.	PUNCT
fnp-5188	193	1	in	in	ADP
fnp-5188	193	2	the	the	DET
fnp-5188	193	3	merged	merged	ADJ
fnp-5188	193	4	picture	picture	NOUN
fnp-5188	193	5	(	(	PUNCT
fnp-5188	193	6	second	second	ADV
fnp-5188	193	7	right	right	NOUN
fnp-5188	193	8	)	)	PUNCT
fnp-5188	193	9	,	,	PUNCT
fnp-5188	193	10	gfp	gfp	PROPN
fnp-5188	193	11	/	/	SYM
fnp-5188	193	12	αsma	αsma	PROPN
fnp-5188	193	13	/	/	SYM
fnp-5188	193	14	pdgfrβ	pdgfrβ	NOUN
fnp-5188	193	15	triple	triple	ADJ
fnp-5188	193	16	positive	positive	ADJ
fnp-5188	193	17	cells	cell	NOUN
fnp-5188	193	18	are	be	AUX
fnp-5188	193	19	indicated	indicate	VERB
fnp-5188	193	20	by	by	ADP
fnp-5188	193	21	white	white	ADJ
fnp-5188	193	22	arrows	arrow	NOUN
fnp-5188	193	23	.	.	PUNCT
fnp-5188	194	1	in	in	ADP
fnp-5188	194	2	the	the	DET
fnp-5188	194	3	merged	merged	ADJ
fnp-5188	194	4	picture	picture	NOUN
fnp-5188	194	5	(	(	PUNCT
fnp-5188	194	6	right	right	ADJ
fnp-5188	194	7	)	)	PUNCT
fnp-5188	194	8	mcherry+	mcherry+	PART
fnp-5188	194	9	gl261	gl261	NOUN
fnp-5188	194	10	tumor	tumor	NOUN
fnp-5188	194	11	cells	cell	NOUN
fnp-5188	194	12	are	be	AUX
fnp-5188	194	13	also	also	ADV
fnp-5188	194	14	shown	show	VERB
fnp-5188	194	15	(	(	PUNCT
fnp-5188	194	16	one	one	NUM
fnp-5188	194	17	representative	representative	ADJ
fnp-5188	194	18	picture	picture	NOUN
fnp-5188	194	19	is	be	AUX
fnp-5188	194	20	shown	show	VERB
fnp-5188	194	21	;	;	PUNCT
fnp-5188	194	22	63x	63x	NOUN
fnp-5188	194	23	magnification	magnification	NOUN
fnp-5188	194	24	;	;	PUNCT
fnp-5188	194	25	bars	bar	NOUN
fnp-5188	194	26	:	:	PUNCT
fnp-5188	194	27	10	10	NUM
fnp-5188	194	28	µm	µm	NOUN
fnp-5188	194	29	)	)	PUNCT
fnp-5188	194	30	.	.	PUNCT
fnp-5188	195	1	b.	b.	PROPN
fnp-5188	195	2	overview	overview	NOUN
fnp-5188	195	3	of	of	ADP
fnp-5188	195	4	gfp	gfp	PROPN
fnp-5188	195	5	,	,	PUNCT
fnp-5188	195	6	αsma	αsma	NOUN
fnp-5188	195	7	,	,	PUNCT
fnp-5188	195	8	pdgfrβ	pdgfrβ	NOUN
fnp-5188	195	9	and	and	CCONJ
fnp-5188	195	10	mcherry	mcherry	ADJ
fnp-5188	195	11	positive	positive	ADJ
fnp-5188	195	12	cells	cell	NOUN
fnp-5188	195	13	in	in	ADP
fnp-5188	195	14	the	the	DET
fnp-5188	195	15	tumor	tumor	NOUN
fnp-5188	195	16	area	area	NOUN
fnp-5188	195	17	(	(	PUNCT
fnp-5188	195	18	25x	25x	NOUN
fnp-5188	195	19	magnification	magnification	NOUN
fnp-5188	195	20	;	;	PUNCT
fnp-5188	195	21	bars	bar	NOUN
fnp-5188	195	22	=	=	NOUN
fnp-5188	195	23	50	50	NUM
fnp-5188	195	24	µm	µm	NOUN
fnp-5188	195	25	)	)	PUNCT
fnp-5188	195	26	.	.	PUNCT
fnp-5188	196	1	c.	c.	NOUN
fnp-5188	196	2	quantification	quantification	NOUN
fnp-5188	196	3	of	of	ADP
fnp-5188	196	4	αsma+	αsma+	X
fnp-5188	196	5	and	and	CCONJ
fnp-5188	196	6	d.	d.	NOUN
fnp-5188	196	7	of	of	ADP
fnp-5188	196	8	αsma+/pdgfrβ+/gfp+	αsma+/pdgfrβ+/gfp+	PROPN
fnp-5188	196	9	triple	triple	ADJ
fnp-5188	196	10	positive	positive	ADJ
fnp-5188	196	11	cells	cell	NOUN
fnp-5188	196	12	(	(	PUNCT
fnp-5188	196	13	n=3	n=3	PUNCT
fnp-5188	196	14	mice	mouse	NOUN
fnp-5188	196	15	,	,	PUNCT
fnp-5188	196	16	9	9	NUM
fnp-5188	196	17	-	-	SYM
fnp-5188	196	18	40	40	NUM
fnp-5188	196	19	sections	section	NOUN
fnp-5188	196	20	per	per	ADP
fnp-5188	196	21	mouse	mouse	NOUN
fnp-5188	196	22	,	,	PUNCT
fnp-5188	196	23	sem	sem	PROPN
fnp-5188	196	24	,	,	PUNCT
fnp-5188	196	25	t	t	NOUN
fnp-5188	196	26	-	-	PUNCT
fnp-5188	196	27	test	test	NOUN
fnp-5188	196	28	,	,	PUNCT
fnp-5188	196	29	*	*	PUNCT
fnp-5188	196	30	*	*	PUNCT
fnp-5188	196	31	*	*	PUNCT
fnp-5188	196	32	*	*	PUNCT
fnp-5188	196	33	p<0.0001	p<0.0001	NOUN
fnp-5188	196	34	)	)	PUNCT
fnp-5188	196	35	.	.	PUNCT
fnp-5188	197	1	as	as	SCONJ
fnp-5188	197	2	gbm	gbm	PROPN
fnp-5188	197	3	is	be	AUX
fnp-5188	197	4	a	a	DET
fnp-5188	197	5	highly	highly	ADV
fnp-5188	197	6	vascularized	vascularized	ADJ
fnp-5188	197	7	tumor	tumor	NOUN
fnp-5188	197	8	and	and	CCONJ
fnp-5188	197	9	pericyte	pericyte	NOUN
fnp-5188	197	10	coverage	coverage	NOUN
fnp-5188	197	11	provides	provide	VERB
fnp-5188	197	12	vascular	vascular	ADJ
fnp-5188	197	13	stability	stability	NOUN
fnp-5188	197	14	whereas	whereas	SCONJ
fnp-5188	197	15	tgf	tgf	PROPN
fnp-5188	197	16	-	-	PUNCT
fnp-5188	197	17	β	β	X
fnp-5188	197	18	negatively	negatively	ADV
fnp-5188	197	19	influences	influence	VERB
fnp-5188	197	20	vessel	vessel	NOUN
fnp-5188	197	21	architecture	architecture	NOUN
fnp-5188	197	22	,	,	PUNCT
fnp-5188	197	23	we	we	PRON
fnp-5188	197	24	determined	determine	VERB
fnp-5188	197	25	vessel	vessel	NOUN
fnp-5188	197	26	density	density	NOUN
fnp-5188	197	27	in	in	ADP
fnp-5188	197	28	par	par	NOUN
fnp-5188	197	29	and	and	CCONJ
fnp-5188	197	30	tgf	tgf	PROPN
fnp-5188	197	31	-	-	PUNCT
fnp-5188	197	32	β	β	NOUN
fnp-5188	197	33	-	-	PUNCT
fnp-5188	197	34	ko	ko	ADJ
fnp-5188	197	35	tumors	tumor	NOUN
fnp-5188	197	36	.	.	PUNCT
fnp-5188	198	1	compared	compare	VERB
fnp-5188	198	2	to	to	ADP
fnp-5188	198	3	the	the	DET
fnp-5188	198	4	brain	brain	NOUN
fnp-5188	198	5	parenchyma	parenchyma	NOUN
fnp-5188	198	6	of	of	ADP
fnp-5188	198	7	the	the	DET
fnp-5188	198	8	non	non	ADJ
fnp-5188	198	9	-	-	ADJ
fnp-5188	198	10	tumor	tumor	ADJ
fnp-5188	198	11	bearing	bear	VERB
fnp-5188	198	12	contralateral	contralateral	ADJ
fnp-5188	198	13	hemisphere	hemisphere	ADV
fnp-5188	198	14	,	,	PUNCT
fnp-5188	198	15	tumor	tumor	NOUN
fnp-5188	198	16	areas	area	NOUN
fnp-5188	198	17	of	of	ADP
fnp-5188	198	18	both	both	PRON
fnp-5188	198	19	,	,	PUNCT
fnp-5188	198	20	par	par	NOUN
fnp-5188	198	21	and	and	CCONJ
fnp-5188	198	22	tgf	tgf	PROPN
fnp-5188	198	23	-	-	PUNCT
fnp-5188	198	24	β	β	NOUN
fnp-5188	198	25	-	-	PUNCT
fnp-5188	198	26	ko	ko	ADJ
fnp-5188	198	27	mice	mouse	NOUN
fnp-5188	198	28	showed	show	VERB
fnp-5188	198	29	a	a	DET
fnp-5188	198	30	massive	massive	ADJ
fnp-5188	198	31	enrichment	enrichment	NOUN
fnp-5188	198	32	in	in	ADP
fnp-5188	198	33	the	the	DET
fnp-5188	198	34	density	density	NOUN
fnp-5188	198	35	of	of	ADP
fnp-5188	198	36	cd31	cd31	PROPN
fnp-5188	198	37	cells	cell	NOUN
fnp-5188	198	38	.	.	PUNCT
fnp-5188	199	1	cd31	cd31	PROPN
fnp-5188	199	2	was	be	AUX
fnp-5188	199	3	used	use	VERB
fnp-5188	199	4	to	to	PART
fnp-5188	199	5	demonstrate	demonstrate	VERB
fnp-5188	199	6	the	the	DET
fnp-5188	199	7	presence	presence	NOUN
fnp-5188	199	8	of	of	ADP
fnp-5188	199	9	endothelial	endothelial	ADJ
fnp-5188	199	10	cells	cell	NOUN
fnp-5188	199	11	(	(	PUNCT
fnp-5188	199	12	ecs	ec	NOUN
fnp-5188	199	13	)	)	PUNCT
fnp-5188	199	14	and	and	CCONJ
fnp-5188	199	15	to	to	PART
fnp-5188	199	16	determine	determine	VERB
fnp-5188	199	17	vessel	vessel	NOUN
fnp-5188	199	18	density	density	NOUN
fnp-5188	199	19	.	.	PUNCT
fnp-5188	200	1	however	however	ADV
fnp-5188	200	2	,	,	PUNCT
fnp-5188	200	3	in	in	ADP
fnp-5188	200	4	tgf	tgf	PROPN
fnp-5188	200	5	-	-	PUNCT
fnp-5188	200	6	β	β	NOUN
fnp-5188	200	7	-	-	PUNCT
fnp-5188	200	8	ko	ko	ADJ
fnp-5188	200	9	mice	mouse	NOUN
fnp-5188	200	10	,	,	PUNCT
fnp-5188	200	11	the	the	DET
fnp-5188	200	12	vessel	vessel	NOUN
fnp-5188	200	13	density	density	NOUN
fnp-5188	200	14	in	in	ADP
fnp-5188	200	15	the	the	DET
fnp-5188	200	16	tumor	tumor	NOUN
fnp-5188	200	17	core	core	NOUN
fnp-5188	200	18	was	be	AUX
fnp-5188	200	19	half	half	NOUN
fnp-5188	200	20	that	that	PRON
fnp-5188	200	21	observed	observe	VERB
fnp-5188	200	22	in	in	ADP
fnp-5188	200	23	par	par	NOUN
fnp-5188	200	24	mice	mouse	NOUN
fnp-5188	200	25	(	(	PUNCT
fnp-5188	200	26	fig	fig	NOUN
fnp-5188	200	27	.	.	PUNCT
fnp-5188	200	28	5	5	NUM
fnp-5188	200	29	)	)	PUNCT
fnp-5188	200	30	.	.	PUNCT
fnp-5188	201	1	figure	figure	NOUN
fnp-5188	201	2	5	5	NUM
fnp-5188	201	3	.	.	PUNCT
fnp-5188	202	1	cd31	cd31	PROPN
fnp-5188	202	2	+	+	CCONJ
fnp-5188	202	3	ecs	ec	NOUN
fnp-5188	202	4	were	be	AUX
fnp-5188	202	5	significantly	significantly	ADV
fnp-5188	202	6	reduced	reduce	VERB
fnp-5188	202	7	in	in	ADP
fnp-5188	202	8	tgf	tgf	PROPN
fnp-5188	202	9	-	-	PUNCT
fnp-5188	202	10	β	β	NOUN
fnp-5188	202	11	-	-	PUNCT
fnp-5188	202	12	ko	ko	PROPN
fnp-5188	202	13	gbms	gbms	NOUN
fnp-5188	202	14	.	.	PUNCT
fnp-5188	203	1	a.	a.	PROPN
fnp-5188	203	2	merged	merge	VERB
fnp-5188	203	3	pictures	picture	NOUN
fnp-5188	203	4	showing	show	VERB
fnp-5188	203	5	immunofluorescence	immunofluorescence	NOUN
fnp-5188	203	6	of	of	ADP
fnp-5188	203	7	gbm	gbm	NOUN
fnp-5188	203	8	cells	cell	NOUN
fnp-5188	203	9	(	(	PUNCT
fnp-5188	203	10	red	red	ADJ
fnp-5188	203	11	)	)	PUNCT
fnp-5188	203	12	,	,	PUNCT
fnp-5188	203	13	gfp+	gfp+	PROPN
fnp-5188	203	14	vamcs	vamcs	NOUN
fnp-5188	203	15	(	(	PUNCT
fnp-5188	203	16	green	green	ADJ
fnp-5188	203	17	)	)	PUNCT
fnp-5188	203	18	and	and	CCONJ
fnp-5188	203	19	cd31	cd31	PROPN
fnp-5188	203	20	+	+	CCONJ
fnp-5188	203	21	endothelial	endothelial	ADJ
fnp-5188	203	22	cells	cell	NOUN
fnp-5188	203	23	(	(	PUNCT
fnp-5188	203	24	magenta	magenta	NOUN
fnp-5188	203	25	)	)	PUNCT
fnp-5188	203	26	in	in	ADP
fnp-5188	203	27	the	the	DET
fnp-5188	203	28	tumor	tumor	NOUN
fnp-5188	203	29	core	core	NOUN
fnp-5188	203	30	,	,	PUNCT
fnp-5188	203	31	transition	transition	NOUN
fnp-5188	203	32	and	and	CCONJ
fnp-5188	203	33	infiltration	infiltration	NOUN
fnp-5188	203	34	zone	zone	NOUN
fnp-5188	203	35	(	(	PUNCT
fnp-5188	203	36	one	one	NUM
fnp-5188	203	37	picture	picture	NOUN
fnp-5188	203	38	is	be	AUX
fnp-5188	203	39	exemplary	exemplary	ADJ
fnp-5188	203	40	shown	show	VERB
fnp-5188	203	41	;	;	PUNCT
fnp-5188	203	42	25x	25x	NOUN
fnp-5188	203	43	magnification	magnification	NOUN
fnp-5188	203	44	,	,	PUNCT
fnp-5188	203	45	bars	bar	NOUN
fnp-5188	203	46	:	:	PUNCT
fnp-5188	203	47	50	50	NUM
fnp-5188	203	48	µm	µm	NOUN
fnp-5188	203	49	)	)	PUNCT
fnp-5188	203	50	.	.	PUNCT
fnp-5188	204	1	b.	b.	PROPN
fnp-5188	204	2	immunofluorescence	immunofluorescence	NOUN
fnp-5188	204	3	of	of	ADP
fnp-5188	204	4	gbm	gbm	PROPN
fnp-5188	204	5	cells	cell	NOUN
fnp-5188	204	6	(	(	PUNCT
fnp-5188	204	7	red	red	ADJ
fnp-5188	204	8	)	)	PUNCT
fnp-5188	204	9	,	,	PUNCT
fnp-5188	204	10	gfp+	gfp+	PROPN
fnp-5188	204	11	vamcs	vamcs	NOUN
fnp-5188	204	12	(	(	PUNCT
fnp-5188	204	13	green	green	ADJ
fnp-5188	204	14	)	)	PUNCT
fnp-5188	204	15	,	,	PUNCT
fnp-5188	204	16	cd31	cd31	PROPN
fnp-5188	204	17	+	+	CCONJ
fnp-5188	204	18	ecs	ecs	PROPN
fnp-5188	204	19	(	(	PUNCT
fnp-5188	204	20	magenta	magenta	PROPN
fnp-5188	204	21	)	)	PUNCT
fnp-5188	204	22	,	,	PUNCT
fnp-5188	204	23	cd31	cd31	PROPN
fnp-5188	204	24	and	and	CCONJ
fnp-5188	204	25	gfp+	gfp+	PROPN
fnp-5188	204	26	cells	cell	NOUN
fnp-5188	204	27	(	(	PUNCT
fnp-5188	204	28	second	second	ADV
fnp-5188	204	29	right	right	NOUN
fnp-5188	204	30	)	)	PUNCT
fnp-5188	204	31	and	and	CCONJ
fnp-5188	204	32	merged	merge	VERB
fnp-5188	204	33	picture	picture	NOUN
fnp-5188	204	34	(	(	PUNCT
fnp-5188	204	35	right	right	ADJ
fnp-5188	204	36	;	;	PUNCT
fnp-5188	204	37	one	one	NUM
fnp-5188	204	38	picture	picture	NOUN
fnp-5188	204	39	is	be	AUX
fnp-5188	204	40	exemplary	exemplary	ADJ
fnp-5188	204	41	shown	show	VERB
fnp-5188	204	42	,	,	PUNCT
fnp-5188	204	43	63x	63x	NOUN
fnp-5188	204	44	magnification	magnification	NOUN
fnp-5188	204	45	,	,	PUNCT
fnp-5188	204	46	bars	bar	NOUN
fnp-5188	204	47	:	:	PUNCT
fnp-5188	204	48	10	10	NUM
fnp-5188	204	49	µm	µm	NOUN
fnp-5188	204	50	)	)	PUNCT
fnp-5188	204	51	.	.	PUNCT
fnp-5188	205	1	c.	c.	NOUN
fnp-5188	205	2	staining	stain	VERB
fnp-5188	205	3	for	for	ADP
fnp-5188	205	4	cd31	cd31	PROPN
fnp-5188	205	5	in	in	ADP
fnp-5188	205	6	the	the	DET
fnp-5188	205	7	tumor	tumor	NOUN
fnp-5188	205	8	area	area	NOUN
fnp-5188	205	9	of	of	ADP
fnp-5188	205	10	par	par	NOUN
fnp-5188	205	11	and	and	CCONJ
fnp-5188	205	12	tgf	tgf	PROPN
fnp-5188	205	13	-	-	PUNCT
fnp-5188	205	14	β	β	PROPN
fnp-5188	205	15	gbms	gbms	PROPN
fnp-5188	205	16	as	as	ADV
fnp-5188	205	17	well	well	ADV
fnp-5188	205	18	as	as	ADP
fnp-5188	205	19	in	in	ADP
fnp-5188	205	20	the	the	DET
fnp-5188	205	21	non	non	ADJ
fnp-5188	205	22	-	-	ADJ
fnp-5188	205	23	tumor	tumor	ADJ
fnp-5188	205	24	containing	contain	VERB
fnp-5188	205	25	contralateral	contralateral	ADJ
fnp-5188	205	26	hemisphere	hemisphere	ADV
fnp-5188	205	27	(	(	PUNCT
fnp-5188	205	28	normal	normal	ADJ
fnp-5188	205	29	brain	brain	NOUN
fnp-5188	205	30	;	;	PUNCT
fnp-5188	205	31	bars	bar	NOUN
fnp-5188	205	32	=	=	SYM
fnp-5188	205	33	100	100	NUM
fnp-5188	205	34	µm	µm	NOUN
fnp-5188	205	35	)	)	PUNCT
fnp-5188	205	36	.	.	PUNCT
fnp-5188	206	1	d.	d.	PROPN
fnp-5188	206	2	quantification	quantification	NOUN
fnp-5188	206	3	of	of	ADP
fnp-5188	206	4	cd31	cd31	PROPN
fnp-5188	206	5	+	+	CCONJ
fnp-5188	206	6	cells	cell	NOUN
fnp-5188	206	7	(	(	PUNCT
fnp-5188	206	8	n=3	n=3	PUNCT
fnp-5188	206	9	mice	mouse	NOUN
fnp-5188	206	10	per	per	ADP
fnp-5188	206	11	group	group	NOUN
fnp-5188	206	12	,	,	PUNCT
fnp-5188	206	13	24	24	NUM
fnp-5188	206	14	-	-	SYM
fnp-5188	206	15	70	70	NUM
fnp-5188	206	16	slices	slice	NOUN
fnp-5188	206	17	per	per	ADP
fnp-5188	206	18	group	group	NOUN
fnp-5188	206	19	,	,	PUNCT
fnp-5188	206	20	sd	sd	PROPN
fnp-5188	206	21	,	,	PUNCT
fnp-5188	206	22	t	t	NOUN
fnp-5188	206	23	-	-	PUNCT
fnp-5188	206	24	test	test	NOUN
fnp-5188	206	25	,	,	PUNCT
fnp-5188	206	26	*	*	PUNCT
fnp-5188	206	27	*	*	PUNCT
fnp-5188	206	28	*	*	PUNCT
fnp-5188	206	29	*	*	PUNCT
fnp-5188	206	30	p<0.0001	p<0.0001	NOUN
fnp-5188	206	31	)	)	PUNCT
fnp-5188	206	32	.	.	PUNCT
fnp-5188	207	1	abolishing	abolish	VERB
fnp-5188	207	2	the	the	DET
fnp-5188	207	3	gbm	gbm	NOUN
fnp-5188	207	4	-	-	PUNCT
fnp-5188	207	5	mediated	mediate	VERB
fnp-5188	207	6	induction	induction	NOUN
fnp-5188	207	7	of	of	ADP
fnp-5188	207	8	slug	slug	NOUN
fnp-5188	207	9	expression	expression	NOUN
fnp-5188	207	10	in	in	ADP
fnp-5188	207	11	vamcs	vamcs	NOUN
fnp-5188	207	12	reduces	reduce	VERB
fnp-5188	207	13	pdgfrβ	pdgfrβ	NOUN
fnp-5188	207	14	and	and	CCONJ
fnp-5188	207	15	αsma	αsma	NOUN
fnp-5188	207	16	levels	level	NOUN
fnp-5188	207	17	and	and	CCONJ
fnp-5188	207	18	lowers	lower	VERB
fnp-5188	207	19	vessel	vessel	NOUN
fnp-5188	207	20	density	density	NOUN
fnp-5188	207	21	in	in	ADP
fnp-5188	207	22	the	the	DET
fnp-5188	207	23	tumor	tumor	NOUN
fnp-5188	207	24	area	area	NOUN
fnp-5188	207	25	in	in	ADP
fnp-5188	207	26	a	a	DET
fnp-5188	207	27	former	former	ADJ
fnp-5188	207	28	study	study	NOUN
fnp-5188	207	29	we	we	PRON
fnp-5188	207	30	identified	identify	VERB
fnp-5188	207	31	tgf	tgf	PROPN
fnp-5188	207	32	-	-	PUNCT
fnp-5188	207	33	β	β	PROPN
fnp-5188	207	34	as	as	ADP
fnp-5188	207	35	an	an	DET
fnp-5188	207	36	inducer	inducer	NOUN
fnp-5188	207	37	of	of	ADP
fnp-5188	207	38	emt	emt	PROPN
fnp-5188	207	39	transcriptional	transcriptional	ADJ
fnp-5188	207	40	regulators	regulator	NOUN
fnp-5188	207	41	such	such	ADJ
fnp-5188	207	42	as	as	ADP
fnp-5188	207	43	slug	slug	NOUN
fnp-5188	207	44	/	/	SYM
fnp-5188	207	45	snai2	snai2	PROPN
fnp-5188	207	46	in	in	ADP
fnp-5188	207	47	human	human	ADJ
fnp-5188	207	48	primary	primary	ADJ
fnp-5188	207	49	brain	brain	NOUN
fnp-5188	207	50	microvascular	microvascular	NOUN
fnp-5188	207	51	pericytes	pericyte	NOUN
fnp-5188	207	52	(	(	PUNCT
fnp-5188	207	53	hbvp	hbvp	NOUN
fnp-5188	207	54	)	)	PUNCT
fnp-5188	207	55	.	.	PUNCT
fnp-5188	208	1	slug	slug	PROPN
fnp-5188	208	2	was	be	AUX
fnp-5188	208	3	responsible	responsible	ADJ
fnp-5188	208	4	for	for	ADP
fnp-5188	208	5	the	the	DET
fnp-5188	208	6	elevated	elevated	ADJ
fnp-5188	208	7	proliferation	proliferation	NOUN
fnp-5188	208	8	and	and	CCONJ
fnp-5188	208	9	migration	migration	NOUN
fnp-5188	208	10	capacity	capacity	NOUN
fnp-5188	208	11	of	of	ADP
fnp-5188	208	12	these	these	DET
fnp-5188	208	13	cells	cell	NOUN
fnp-5188	208	14	,	,	PUNCT
fnp-5188	208	15	pushing	push	VERB
fnp-5188	208	16	hbvps	hbvps	NOUN
fnp-5188	208	17	towards	towards	ADP
fnp-5188	208	18	a	a	DET
fnp-5188	208	19	more	more	ADV
fnp-5188	208	20	activated	activated	ADJ
fnp-5188	208	21	phenotype	phenotype	NOUN
fnp-5188	208	22	[	[	X
fnp-5188	208	23	16	16	NUM
fnp-5188	208	24	]	]	PUNCT
fnp-5188	208	25	.	.	PUNCT
fnp-5188	209	1	in	in	ADP
fnp-5188	209	2	this	this	DET
fnp-5188	209	3	regard	regard	NOUN
fnp-5188	209	4	,	,	PUNCT
fnp-5188	209	5	we	we	PRON
fnp-5188	209	6	wondered	wonder	VERB
fnp-5188	209	7	whether	whether	SCONJ
fnp-5188	209	8	the	the	DET
fnp-5188	209	9	tgf	tgf	PROPN
fnp-5188	209	10	-	-	PUNCT
fnp-5188	209	11	β	β	NOUN
fnp-5188	209	12	-	-	PUNCT
fnp-5188	209	13	mediated	mediate	VERB
fnp-5188	209	14	effects	effect	NOUN
fnp-5188	209	15	on	on	ADP
fnp-5188	209	16	vamcs	vamcs	NOUN
fnp-5188	209	17	and	and	CCONJ
fnp-5188	209	18	ec	ec	PROPN
fnp-5188	209	19	density	density	NOUN
fnp-5188	209	20	observed	observe	VERB
fnp-5188	209	21	in	in	ADP
fnp-5188	209	22	our	our	PRON
fnp-5188	209	23	mouse	mouse	NOUN
fnp-5188	209	24	gbm	gbm	NOUN
fnp-5188	209	25	model	model	NOUN
fnp-5188	209	26	could	could	AUX
fnp-5188	209	27	be	be	AUX
fnp-5188	209	28	prevented	prevent	VERB
fnp-5188	209	29	by	by	ADP
fnp-5188	209	30	inhibiting	inhibit	VERB
fnp-5188	209	31	the	the	DET
fnp-5188	209	32	induction	induction	NOUN
fnp-5188	209	33	of	of	ADP
fnp-5188	209	34	slug	slug	NOUN
fnp-5188	209	35	in	in	ADP
fnp-5188	209	36	tumor	tumor	NOUN
fnp-5188	209	37	associated	associate	VERB
fnp-5188	209	38	vamcs	vamcs	NOUN
fnp-5188	209	39	.	.	PUNCT
fnp-5188	210	1	for	for	ADP
fnp-5188	210	2	this	this	PRON
fnp-5188	210	3	,	,	PUNCT
fnp-5188	210	4	we	we	PRON
fnp-5188	210	5	intrastriatally	intrastriatally	ADV
fnp-5188	210	6	injected	inject	VERB
fnp-5188	210	7	a	a	DET
fnp-5188	210	8	mixture	mixture	NOUN
fnp-5188	210	9	of	of	ADP
fnp-5188	210	10	3	3	NUM
fnp-5188	210	11	lentiviruses	lentiviruse	NOUN
fnp-5188	210	12	that	that	PRON
fnp-5188	210	13	express	express	VERB
fnp-5188	210	14	cas9	cas9	NOUN
fnp-5188	210	15	under	under	ADP
fnp-5188	210	16	the	the	DET
fnp-5188	210	17	control	control	NOUN
fnp-5188	210	18	of	of	ADP
fnp-5188	210	19	the	the	DET
fnp-5188	210	20	rgs5	rgs5	NOUN
fnp-5188	210	21	promoter	promoter	NOUN
fnp-5188	210	22	as	as	ADV
fnp-5188	210	23	well	well	ADV
fnp-5188	210	24	as	as	ADP
fnp-5188	210	25	sgrnas	sgrnas	NOUN
fnp-5188	210	26	specific	specific	ADJ
fnp-5188	210	27	for	for	ADP
fnp-5188	210	28	murine	murine	ADJ
fnp-5188	210	29	slug	slug	NOUN
fnp-5188	210	30	(	(	PUNCT
fnp-5188	210	31	lenti	lenti	ADJ
fnp-5188	210	32	-	-	ADJ
fnp-5188	210	33	slug	slug	VERB
fnp-5188	210	34	-	-	PUNCT
fnp-5188	210	35	ko	ko	PROPN
fnp-5188	210	36	#	#	SYM
fnp-5188	210	37	1	1	NUM
fnp-5188	210	38	,	,	PUNCT
fnp-5188	210	39	4	4	NUM
fnp-5188	210	40	and	and	CCONJ
fnp-5188	210	41	5	5	NUM
fnp-5188	210	42	;	;	PUNCT
fnp-5188	211	1	suppl	suppl	PROPN
fnp-5188	211	2	.	.	PUNCT
fnp-5188	211	3	fig	fig	PROPN
fnp-5188	211	4	.	.	PUNCT
fnp-5188	212	1	2	2	NUM
fnp-5188	212	2	)	)	PUNCT
fnp-5188	212	3	three	three	NUM
fnp-5188	212	4	days	day	NOUN
fnp-5188	212	5	prior	prior	ADV
fnp-5188	212	6	to	to	ADP
fnp-5188	212	7	implantation	implantation	NOUN
fnp-5188	212	8	of	of	ADP
fnp-5188	212	9	par	par	NOUN
fnp-5188	212	10	cells	cell	NOUN
fnp-5188	212	11	using	use	VERB
fnp-5188	212	12	the	the	DET
fnp-5188	212	13	same	same	ADJ
fnp-5188	212	14	stereotactic	stereotactic	NOUN
fnp-5188	212	15	coordinates	coordinate	NOUN
fnp-5188	212	16	and	and	CCONJ
fnp-5188	212	17	collected	collect	VERB
fnp-5188	212	18	the	the	DET
fnp-5188	212	19	brains	brain	NOUN
fnp-5188	212	20	29	29	NUM
fnp-5188	212	21	days	day	NOUN
fnp-5188	212	22	after	after	ADP
fnp-5188	212	23	tumor	tumor	NOUN
fnp-5188	212	24	cell	cell	NOUN
fnp-5188	212	25	implantation	implantation	NOUN
fnp-5188	212	26	(	(	PUNCT
fnp-5188	212	27	suppl	suppl	PROPN
fnp-5188	212	28	.	.	PUNCT
fnp-5188	212	29	fig	fig	PROPN
fnp-5188	212	30	.	.	PUNCT
fnp-5188	213	1	3b	3b	NUM
fnp-5188	213	2	)	)	PUNCT
fnp-5188	213	3	.	.	PUNCT
fnp-5188	214	1	to	to	PART
fnp-5188	214	2	avoid	avoid	VERB
fnp-5188	214	3	artifacts	artifact	NOUN
fnp-5188	214	4	that	that	PRON
fnp-5188	214	5	might	might	AUX
fnp-5188	214	6	be	be	AUX
fnp-5188	214	7	induced	induce	VERB
fnp-5188	214	8	by	by	ADP
fnp-5188	214	9	differences	difference	NOUN
fnp-5188	214	10	in	in	ADP
fnp-5188	214	11	the	the	DET
fnp-5188	214	12	tumor	tumor	NOUN
fnp-5188	214	13	size	size	NOUN
fnp-5188	214	14	after	after	ADP
fnp-5188	214	15	knocking	knock	VERB
fnp-5188	214	16	out	out	ADP
fnp-5188	214	17	slug	slug	NOUN
fnp-5188	214	18	in	in	ADP
fnp-5188	214	19	mural	mural	ADJ
fnp-5188	214	20	cells	cell	NOUN
fnp-5188	214	21	in	in	ADP
fnp-5188	214	22	the	the	DET
fnp-5188	214	23	tumor	tumor	NOUN
fnp-5188	214	24	environment	environment	NOUN
fnp-5188	214	25	,	,	PUNCT
fnp-5188	214	26	we	we	PRON
fnp-5188	214	27	firstly	firstly	ADV
fnp-5188	214	28	analyzed	analyze	VERB
fnp-5188	214	29	the	the	DET
fnp-5188	214	30	tumor	tumor	NOUN
fnp-5188	214	31	size	size	NOUN
fnp-5188	214	32	in	in	ADP
fnp-5188	214	33	the	the	DET
fnp-5188	214	34	mice	mouse	NOUN
fnp-5188	214	35	that	that	PRON
fnp-5188	214	36	received	receive	VERB
fnp-5188	214	37	either	either	CCONJ
fnp-5188	214	38	the	the	DET
fnp-5188	214	39	empty	empty	ADJ
fnp-5188	214	40	control	control	NOUN
fnp-5188	214	41	lentivirus	lentivirus	NOUN
fnp-5188	214	42	(	(	PUNCT
fnp-5188	214	43	lenti	lenti	NOUN
fnp-5188	214	44	-	-	ADJ
fnp-5188	214	45	v2	v2	NOUN
fnp-5188	214	46	)	)	PUNCT
fnp-5188	214	47	or	or	CCONJ
fnp-5188	214	48	the	the	DET
fnp-5188	214	49	mixture	mixture	NOUN
fnp-5188	214	50	of	of	ADP
fnp-5188	214	51	lenti	lenti	ADJ
fnp-5188	214	52	-	-	ADJ
fnp-5188	214	53	slug	slug	VERB
fnp-5188	214	54	-	-	PUNCT
fnp-5188	214	55	ko	ko	PROPN
fnp-5188	214	56	viruses	virus	NOUN
fnp-5188	214	57	.	.	PUNCT
fnp-5188	215	1	however	however	ADV
fnp-5188	215	2	,	,	PUNCT
fnp-5188	215	3	we	we	PRON
fnp-5188	215	4	did	do	AUX
fnp-5188	215	5	not	not	PART
fnp-5188	215	6	observe	observe	VERB
fnp-5188	215	7	any	any	DET
fnp-5188	215	8	significant	significant	ADJ
fnp-5188	215	9	differences	difference	NOUN
fnp-5188	215	10	in	in	ADP
fnp-5188	215	11	tumor	tumor	NOUN
fnp-5188	215	12	size	size	NOUN
fnp-5188	215	13	(	(	PUNCT
fnp-5188	215	14	suppl	suppl	PROPN
fnp-5188	215	15	.	.	PUNCT
fnp-5188	215	16	fig	fig	PROPN
fnp-5188	215	17	.	.	PUNCT
fnp-5188	216	1	3	3	NUM
fnp-5188	216	2	e	e	NOUN
fnp-5188	216	3	/	/	SYM
fnp-5188	216	4	g	g	NOUN
fnp-5188	216	5	)	)	PUNCT
fnp-5188	216	6	.	.	PUNCT
fnp-5188	217	1	after	after	ADP
fnp-5188	217	2	collecting	collect	VERB
fnp-5188	217	3	the	the	DET
fnp-5188	217	4	brains	brain	NOUN
fnp-5188	217	5	,	,	PUNCT
fnp-5188	217	6	we	we	PRON
fnp-5188	217	7	determined	determine	VERB
fnp-5188	217	8	slug	slug	PROPN
fnp-5188	217	9	,	,	PUNCT
fnp-5188	217	10	αsma	αsma	NOUN
fnp-5188	217	11	and	and	CCONJ
fnp-5188	217	12	pdgfrβ	pdgfrβ	NOUN
fnp-5188	217	13	levels	level	NOUN
fnp-5188	217	14	in	in	ADP
fnp-5188	217	15	the	the	DET
fnp-5188	217	16	tumor	tumor	NOUN
fnp-5188	217	17	core	core	NOUN
fnp-5188	217	18	,	,	PUNCT
fnp-5188	217	19	its	its	PRON
fnp-5188	217	20	transition	transition	NOUN
fnp-5188	217	21	zone	zone	NOUN
fnp-5188	217	22	,	,	PUNCT
fnp-5188	217	23	defined	define	VERB
fnp-5188	217	24	by	by	ADP
fnp-5188	217	25	the	the	DET
fnp-5188	217	26	border	border	NOUN
fnp-5188	217	27	zone	zone	NOUN
fnp-5188	217	28	between	between	ADP
fnp-5188	217	29	the	the	DET
fnp-5188	217	30	tumor	tumor	NOUN
fnp-5188	217	31	core	core	NOUN
fnp-5188	217	32	and	and	CCONJ
fnp-5188	217	33	brain	brain	NOUN
fnp-5188	217	34	parenchyma	parenchyma	NOUN
fnp-5188	217	35	infiltrating	infiltrate	VERB
fnp-5188	217	36	gbm	gbm	NOUN
fnp-5188	217	37	cells	cell	NOUN
fnp-5188	217	38	,	,	PUNCT
fnp-5188	217	39	as	as	ADV
fnp-5188	217	40	well	well	ADV
fnp-5188	217	41	as	as	ADP
fnp-5188	217	42	in	in	ADP
fnp-5188	217	43	the	the	DET
fnp-5188	217	44	more	more	ADV
fnp-5188	217	45	distant	distant	ADJ
fnp-5188	217	46	area	area	NOUN
fnp-5188	217	47	of	of	ADP
fnp-5188	217	48	gbm	gbm	PROPN
fnp-5188	217	49	cell	cell	NOUN
fnp-5188	217	50	infiltration	infiltration	NOUN
fnp-5188	217	51	.	.	PUNCT
fnp-5188	218	1	in	in	ADP
fnp-5188	218	2	lenti	lenti	ADJ
fnp-5188	218	3	-	-	ADJ
fnp-5188	218	4	slug	slug	ADJ
fnp-5188	218	5	-	-	PUNCT
fnp-5188	218	6	ko	ko	NOUN
fnp-5188	218	7	injected	inject	VERB
fnp-5188	218	8	mice	mouse	NOUN
fnp-5188	218	9	,	,	PUNCT
fnp-5188	218	10	no	no	DET
fnp-5188	218	11	slug	slug	NOUN
fnp-5188	218	12	expression	expression	NOUN
fnp-5188	218	13	in	in	ADP
fnp-5188	218	14	the	the	DET
fnp-5188	218	15	tumor	tumor	NOUN
fnp-5188	218	16	area	area	NOUN
fnp-5188	218	17	was	be	AUX
fnp-5188	218	18	detectable	detectable	ADJ
fnp-5188	218	19	anymore	anymore	ADV
fnp-5188	218	20	(	(	PUNCT
fnp-5188	218	21	suppl	suppl	PROPN
fnp-5188	218	22	.	.	PROPN
fnp-5188	218	23	fig	fig	PROPN
fnp-5188	218	24	7	7	NUM
fnp-5188	218	25	)	)	PUNCT
fnp-5188	218	26	,	,	PUNCT
fnp-5188	218	27	indicating	indicate	VERB
fnp-5188	218	28	that	that	SCONJ
fnp-5188	218	29	the	the	DET
fnp-5188	218	30	slug	slug	NOUN
fnp-5188	218	31	-	-	PUNCT
fnp-5188	218	32	ko	ko	PROPN
fnp-5188	218	33	in	in	ADP
fnp-5188	218	34	vamcs	vamcs	NOUN
fnp-5188	218	35	is	be	AUX
fnp-5188	218	36	functional	functional	ADJ
fnp-5188	218	37	.	.	PUNCT
fnp-5188	219	1	compared	compare	VERB
fnp-5188	219	2	to	to	ADP
fnp-5188	219	3	the	the	DET
fnp-5188	219	4	knockout	knockout	NOUN
fnp-5188	219	5	of	of	ADP
fnp-5188	219	6	tgf	tgf	PROPN
fnp-5188	219	7	-	-	PUNCT
fnp-5188	219	8	β	β	PROPN
fnp-5188	219	9	in	in	ADP
fnp-5188	219	10	gl261	gl261	NOUN
fnp-5188	219	11	cells	cell	NOUN
fnp-5188	219	12	,	,	PUNCT
fnp-5188	219	13	we	we	PRON
fnp-5188	219	14	observed	observe	VERB
fnp-5188	219	15	a	a	DET
fnp-5188	219	16	significant	significant	ADJ
fnp-5188	219	17	reduction	reduction	NOUN
fnp-5188	219	18	,	,	PUNCT
fnp-5188	219	19	even	even	ADV
fnp-5188	219	20	at	at	ADP
fnp-5188	219	21	a	a	DET
fnp-5188	219	22	higher	high	ADJ
fnp-5188	219	23	magnitude	magnitude	NOUN
fnp-5188	219	24	,	,	PUNCT
fnp-5188	219	25	in	in	ADP
fnp-5188	219	26	the	the	DET
fnp-5188	219	27	number	number	NOUN
fnp-5188	219	28	of	of	ADP
fnp-5188	219	29	pdgfrβ+	pdgfrβ+	ADJ
fnp-5188	219	30	(	(	PUNCT
fnp-5188	219	31	4.9	4.9	NUM
fnp-5188	219	32	-	-	NUM
fnp-5188	219	33	fold	fold	ADJ
fnp-5188	219	34	)	)	PUNCT
fnp-5188	219	35	and	and	CCONJ
fnp-5188	219	36	αsma+	αsma+	X
fnp-5188	219	37	(	(	PUNCT
fnp-5188	219	38	10.7	10.7	NUM
fnp-5188	219	39	-	-	ADJ
fnp-5188	219	40	fold	fold	ADJ
fnp-5188	219	41	)	)	PUNCT
fnp-5188	219	42	cells	cell	NOUN
fnp-5188	219	43	,	,	PUNCT
fnp-5188	219	44	as	as	ADV
fnp-5188	219	45	well	well	ADV
fnp-5188	219	46	as	as	ADP
fnp-5188	219	47	in	in	ADP
fnp-5188	219	48	slug+/pdgfrβ+/gfp+	slug+/pdgfrβ+/gfp+	PROPN
fnp-5188	219	49	(	(	PUNCT
fnp-5188	219	50	15.9	15.9	NUM
fnp-5188	219	51	-	-	ADJ
fnp-5188	219	52	fold	fold	ADJ
fnp-5188	219	53	)	)	PUNCT
fnp-5188	219	54	and	and	CCONJ
fnp-5188	219	55	αsma+/pdgfrβ+/gfp+	αsma+/pdgfrβ+/gfp+	PROPN
fnp-5188	219	56	(	(	PUNCT
fnp-5188	219	57	11.4	11.4	NUM
fnp-5188	219	58	-	-	ADJ
fnp-5188	219	59	fold	fold	ADJ
fnp-5188	219	60	)	)	PUNCT
fnp-5188	219	61	cells	cell	NOUN
fnp-5188	219	62	within	within	ADP
fnp-5188	219	63	the	the	DET
fnp-5188	219	64	tumor	tumor	NOUN
fnp-5188	219	65	core	core	NOUN
fnp-5188	219	66	,	,	PUNCT
fnp-5188	219	67	the	the	DET
fnp-5188	219	68	transition	transition	NOUN
fnp-5188	219	69	zone	zone	NOUN
fnp-5188	219	70	,	,	PUNCT
fnp-5188	219	71	and	and	CCONJ
fnp-5188	219	72	the	the	DET
fnp-5188	219	73	infiltration	infiltration	NOUN
fnp-5188	219	74	zone	zone	NOUN
fnp-5188	219	75	of	of	ADP
fnp-5188	219	76	mice	mouse	NOUN
fnp-5188	219	77	with	with	ADP
fnp-5188	219	78	knocked	knock	VERB
fnp-5188	219	79	-	-	PUNCT
fnp-5188	219	80	out	out	ADP
fnp-5188	219	81	slug	slug	NOUN
fnp-5188	219	82	in	in	ADP
fnp-5188	219	83	tumor	tumor	NOUN
fnp-5188	219	84	-	-	PUNCT
fnp-5188	219	85	associated	associate	VERB
fnp-5188	219	86	vamcs	vamcs	NOUN
fnp-5188	219	87	(	(	PUNCT
fnp-5188	219	88	fig	fig	NOUN
fnp-5188	219	89	.	.	PUNCT
fnp-5188	220	1	6	6	NUM
fnp-5188	220	2	,	,	PUNCT
fnp-5188	220	3	7	7	NUM
fnp-5188	220	4	,	,	PUNCT
fnp-5188	220	5	suppl	suppl	PROPN
fnp-5188	220	6	.	.	PUNCT
fnp-5188	220	7	fig	fig	PROPN
fnp-5188	220	8	.	.	PUNCT
fnp-5188	221	1	8	8	NUM
fnp-5188	221	2	,	,	PUNCT
fnp-5188	221	3	9	9	NUM
fnp-5188	221	4	)	)	PUNCT
fnp-5188	221	5	.	.	PUNCT
fnp-5188	222	1	figure	figure	VERB
fnp-5188	222	2	6	6	NUM
fnp-5188	222	3	.	.	PUNCT
fnp-5188	223	1	gfp+	gfp+	PROPN
fnp-5188	223	2	cells	cell	NOUN
fnp-5188	223	3	expressing	express	VERB
fnp-5188	223	4	slug	slug	NOUN
fnp-5188	223	5	and/or	and/or	CCONJ
fnp-5188	223	6	pdgfrβ	pdgfrβ	NOUN
fnp-5188	223	7	were	be	AUX
fnp-5188	223	8	significantly	significantly	ADV
fnp-5188	223	9	reduced	reduce	VERB
fnp-5188	223	10	in	in	ADP
fnp-5188	223	11	mice	mouse	NOUN
fnp-5188	223	12	injected	inject	VERB
fnp-5188	223	13	with	with	ADP
fnp-5188	223	14	lenti	lenti	ADJ
fnp-5188	223	15	-	-	ADJ
fnp-5188	223	16	slug	slug	ADJ
fnp-5188	223	17	-	-	PUNCT
fnp-5188	223	18	ko	ko	PROPN
fnp-5188	223	19	.	.	PUNCT
fnp-5188	224	1	a.	a.	PROPN
fnp-5188	224	2	merged	merge	VERB
fnp-5188	224	3	pictures	picture	NOUN
fnp-5188	224	4	showing	show	VERB
fnp-5188	224	5	immunofluorescence	immunofluorescence	NOUN
fnp-5188	224	6	of	of	ADP
fnp-5188	224	7	gbm	gbm	NOUN
fnp-5188	224	8	cells	cell	NOUN
fnp-5188	224	9	(	(	PUNCT
fnp-5188	224	10	red	red	ADJ
fnp-5188	224	11	)	)	PUNCT
fnp-5188	224	12	,	,	PUNCT
fnp-5188	224	13	vamcs	vamcs	NOUN
fnp-5188	224	14	(	(	PUNCT
fnp-5188	224	15	green	green	ADJ
fnp-5188	224	16	)	)	PUNCT
fnp-5188	224	17	,	,	PUNCT
fnp-5188	224	18	pdgfrβ+	pdgfrβ+	X
fnp-5188	224	19	(	(	PUNCT
fnp-5188	224	20	magenta	magenta	PROPN
fnp-5188	224	21	)	)	PUNCT
fnp-5188	224	22	and	and	CCONJ
fnp-5188	224	23	slug+	slug+	VERB
fnp-5188	224	24	cells	cell	NOUN
fnp-5188	224	25	in	in	ADP
fnp-5188	224	26	the	the	DET
fnp-5188	224	27	tumor	tumor	NOUN
fnp-5188	224	28	core	core	NOUN
fnp-5188	224	29	,	,	PUNCT
fnp-5188	224	30	transition	transition	NOUN
fnp-5188	224	31	and	and	CCONJ
fnp-5188	224	32	infiltration	infiltration	NOUN
fnp-5188	224	33	zone	zone	NOUN
fnp-5188	224	34	(	(	PUNCT
fnp-5188	224	35	one	one	NUM
fnp-5188	224	36	picture	picture	NOUN
fnp-5188	224	37	is	be	AUX
fnp-5188	224	38	exemplary	exemplary	ADJ
fnp-5188	224	39	shown	show	VERB
fnp-5188	224	40	;	;	PUNCT
fnp-5188	224	41	25x	25x	NOUN
fnp-5188	224	42	magnification	magnification	NOUN
fnp-5188	224	43	,	,	PUNCT
fnp-5188	224	44	bars	bar	NOUN
fnp-5188	224	45	:	:	PUNCT
fnp-5188	224	46	50	50	NUM
fnp-5188	224	47	µm	µm	NOUN
fnp-5188	224	48	)	)	PUNCT
fnp-5188	224	49	.	.	PUNCT
fnp-5188	225	1	b.	b.	PROPN
fnp-5188	225	2	immunofluorescence	immunofluorescence	NOUN
fnp-5188	225	3	of	of	ADP
fnp-5188	225	4	slug	slug	NOUN
fnp-5188	225	5	(	(	PUNCT
fnp-5188	225	6	blue	blue	PROPN
fnp-5188	225	7	)	)	PUNCT
fnp-5188	225	8	,	,	PUNCT
fnp-5188	225	9	pdgfrβ	pdgfrβ	NOUN
fnp-5188	225	10	(	(	PUNCT
fnp-5188	225	11	magenta	magenta	PROPN
fnp-5188	225	12	)	)	PUNCT
fnp-5188	225	13	and	and	CCONJ
fnp-5188	225	14	gfp+	gfp+	PROPN
fnp-5188	225	15	vamcs	vamcs	PROPN
fnp-5188	225	16	(	(	PUNCT
fnp-5188	225	17	green	green	ADJ
fnp-5188	225	18	)	)	PUNCT
fnp-5188	225	19	.	.	PUNCT
fnp-5188	226	1	the	the	DET
fnp-5188	226	2	merged	merged	ADJ
fnp-5188	226	3	pictures	picture	NOUN
fnp-5188	226	4	(	(	PUNCT
fnp-5188	226	5	right	right	ADJ
fnp-5188	226	6	)	)	PUNCT
fnp-5188	226	7	also	also	ADV
fnp-5188	226	8	show	show	VERB
fnp-5188	226	9	gbm	gbm	PROPN
fnp-5188	226	10	cells	cell	NOUN
fnp-5188	226	11	(	(	PUNCT
fnp-5188	226	12	red	red	ADJ
fnp-5188	226	13	)	)	PUNCT
fnp-5188	226	14	.	.	PUNCT
fnp-5188	227	1	one	one	NUM
fnp-5188	227	2	picture	picture	NOUN
fnp-5188	227	3	each	each	PRON
fnp-5188	227	4	is	be	AUX
fnp-5188	227	5	exemplary	exemplary	ADJ
fnp-5188	227	6	shown	show	VERB
fnp-5188	227	7	,	,	PUNCT
fnp-5188	227	8	63x	63x	NOUN
fnp-5188	227	9	magnification	magnification	NOUN
fnp-5188	227	10	,	,	PUNCT
fnp-5188	227	11	bars	bar	NOUN
fnp-5188	227	12	:	:	PUNCT
fnp-5188	227	13	10	10	NUM
fnp-5188	227	14	µm	µm	NOUN
fnp-5188	227	15	.	.	PUNCT
fnp-5188	228	1	c	c	X
fnp-5188	228	2	-	-	PUNCT
fnp-5188	228	3	f.	f.	NOUN
fnp-5188	228	4	quantification	quantification	NOUN
fnp-5188	228	5	of	of	ADP
fnp-5188	228	6	gfp+	gfp+	PROPN
fnp-5188	228	7	mural	mural	ADJ
fnp-5188	228	8	cells	cell	NOUN
fnp-5188	228	9	(	(	PUNCT
fnp-5188	228	10	c	c	X
fnp-5188	228	11	)	)	PUNCT
fnp-5188	228	12	slug+	slug+	NOUN
fnp-5188	228	13	(	(	PUNCT
fnp-5188	228	14	d	d	NOUN
fnp-5188	228	15	)	)	PUNCT
fnp-5188	228	16	,	,	PUNCT
fnp-5188	228	17	pdgfrβ+	pdgfrβ+	X
fnp-5188	228	18	(	(	PUNCT
fnp-5188	228	19	e	e	NOUN
fnp-5188	228	20	)	)	PUNCT
fnp-5188	228	21	and	and	CCONJ
fnp-5188	228	22	slug+/pdgfrβ+	slug+/pdgfrβ+	ADJ
fnp-5188	228	23	double	double	ADJ
fnp-5188	228	24	positive	positive	ADJ
fnp-5188	228	25	cells	cell	NOUN
fnp-5188	228	26	(	(	PUNCT
fnp-5188	228	27	f	f	NOUN
fnp-5188	228	28	)	)	PUNCT
fnp-5188	228	29	.	.	PUNCT
fnp-5188	229	1	n=3	n=3	PUNCT
fnp-5188	229	2	mice	mouse	NOUN
fnp-5188	229	3	per	per	ADP
fnp-5188	229	4	group	group	NOUN
fnp-5188	229	5	and	and	CCONJ
fnp-5188	229	6	24	24	NUM
fnp-5188	229	7	-	-	PUNCT
fnp-5188	229	8	70	70	NUM
fnp-5188	229	9	slices	slice	NOUN
fnp-5188	229	10	per	per	ADP
fnp-5188	229	11	group	group	NOUN
fnp-5188	229	12	have	have	AUX
fnp-5188	229	13	been	be	AUX
fnp-5188	229	14	used	use	VERB
fnp-5188	229	15	for	for	ADP
fnp-5188	229	16	quantification	quantification	NOUN
fnp-5188	229	17	(	(	PUNCT
fnp-5188	229	18	sd	sd	NOUN
fnp-5188	229	19	,	,	PUNCT
fnp-5188	229	20	t	t	NOUN
fnp-5188	229	21	-	-	PUNCT
fnp-5188	229	22	test	test	NOUN
fnp-5188	229	23	,	,	PUNCT
fnp-5188	229	24	*	*	PUNCT
fnp-5188	229	25	*	*	PUNCT
fnp-5188	229	26	*	*	PUNCT
fnp-5188	229	27	*	*	PUNCT
fnp-5188	229	28	p<0.0001	p<0.0001	NOUN
fnp-5188	229	29	)	)	PUNCT
fnp-5188	229	30	.	.	PUNCT
fnp-5188	230	1	figure	figure	VERB
fnp-5188	230	2	7	7	NUM
fnp-5188	230	3	.	.	PUNCT
fnp-5188	231	1	gfp+	gfp+	PROPN
fnp-5188	231	2	vamcs	vamcs	PROPN
fnp-5188	231	3	expressing	express	VERB
fnp-5188	231	4	αsma	αsma	NOUN
fnp-5188	231	5	and/or	and/or	CCONJ
fnp-5188	231	6	pdgfrβ	pdgfrβ	NOUN
fnp-5188	231	7	were	be	AUX
fnp-5188	231	8	significantly	significantly	ADV
fnp-5188	231	9	reduced	reduce	VERB
fnp-5188	231	10	in	in	ADP
fnp-5188	231	11	mice	mouse	NOUN
fnp-5188	231	12	injected	inject	VERB
fnp-5188	231	13	with	with	ADP
fnp-5188	231	14	lenti	lenti	ADJ
fnp-5188	231	15	-	-	ADJ
fnp-5188	231	16	slug	slug	ADJ
fnp-5188	231	17	-	-	PUNCT
fnp-5188	231	18	ko	ko	PROPN
fnp-5188	231	19	.	.	PUNCT
fnp-5188	232	1	a.	a.	PROPN
fnp-5188	232	2	merged	merge	VERB
fnp-5188	232	3	pictures	picture	NOUN
fnp-5188	232	4	showing	show	VERB
fnp-5188	232	5	immunofluorescence	immunofluorescence	NOUN
fnp-5188	232	6	of	of	ADP
fnp-5188	232	7	gbm	gbm	NOUN
fnp-5188	232	8	cells	cell	NOUN
fnp-5188	232	9	(	(	PUNCT
fnp-5188	232	10	red	red	ADJ
fnp-5188	232	11	)	)	PUNCT
fnp-5188	232	12	,	,	PUNCT
fnp-5188	232	13	vamcs	vamcs	NOUN
fnp-5188	232	14	(	(	PUNCT
fnp-5188	232	15	green	green	ADJ
fnp-5188	232	16	)	)	PUNCT
fnp-5188	232	17	,	,	PUNCT
fnp-5188	232	18	pdgfrβ+	pdgfrβ+	X
fnp-5188	232	19	(	(	PUNCT
fnp-5188	232	20	magenta	magenta	NOUN
fnp-5188	232	21	)	)	PUNCT
fnp-5188	232	22	and	and	CCONJ
fnp-5188	232	23	αsma+	αsma+	ADP
fnp-5188	232	24	cells	cell	NOUN
fnp-5188	232	25	in	in	ADP
fnp-5188	232	26	the	the	DET
fnp-5188	232	27	tumor	tumor	NOUN
fnp-5188	232	28	core	core	NOUN
fnp-5188	232	29	,	,	PUNCT
fnp-5188	232	30	transition	transition	NOUN
fnp-5188	232	31	and	and	CCONJ
fnp-5188	232	32	infiltration	infiltration	NOUN
fnp-5188	232	33	zone	zone	NOUN
fnp-5188	232	34	(	(	PUNCT
fnp-5188	232	35	one	one	NUM
fnp-5188	232	36	picture	picture	NOUN
fnp-5188	232	37	is	be	AUX
fnp-5188	232	38	exemplary	exemplary	ADJ
fnp-5188	232	39	shown	show	VERB
fnp-5188	232	40	;	;	PUNCT
fnp-5188	232	41	25x	25x	NOUN
fnp-5188	232	42	magnification	magnification	NOUN
fnp-5188	232	43	,	,	PUNCT
fnp-5188	232	44	bars	bar	NOUN
fnp-5188	232	45	:	:	PUNCT
fnp-5188	232	46	50	50	NUM
fnp-5188	232	47	µm	µm	NOUN
fnp-5188	232	48	)	)	PUNCT
fnp-5188	232	49	.	.	PUNCT
fnp-5188	233	1	b.	b.	PROPN
fnp-5188	233	2	immunofluorescence	immunofluorescence	NOUN
fnp-5188	233	3	of	of	ADP
fnp-5188	233	4	αsma	αsma	NOUN
fnp-5188	233	5	(	(	PUNCT
fnp-5188	233	6	blue	blue	NOUN
fnp-5188	233	7	)	)	PUNCT
fnp-5188	233	8	,	,	PUNCT
fnp-5188	233	9	pdgfrβ	pdgfrβ	NOUN
fnp-5188	233	10	(	(	PUNCT
fnp-5188	233	11	magenta	magenta	PROPN
fnp-5188	233	12	)	)	PUNCT
fnp-5188	233	13	and	and	CCONJ
fnp-5188	233	14	gfp+	gfp+	PROPN
fnp-5188	233	15	mural	mural	ADJ
fnp-5188	233	16	cells	cell	NOUN
fnp-5188	233	17	(	(	PUNCT
fnp-5188	233	18	green	green	ADJ
fnp-5188	233	19	)	)	PUNCT
fnp-5188	233	20	.	.	PUNCT
fnp-5188	234	1	the	the	DET
fnp-5188	234	2	merged	merged	ADJ
fnp-5188	234	3	pictures	picture	NOUN
fnp-5188	234	4	(	(	PUNCT
fnp-5188	234	5	right	right	ADJ
fnp-5188	234	6	)	)	PUNCT
fnp-5188	234	7	also	also	ADV
fnp-5188	234	8	show	show	VERB
fnp-5188	234	9	gbm	gbm	PROPN
fnp-5188	234	10	cells	cell	NOUN
fnp-5188	234	11	(	(	PUNCT
fnp-5188	234	12	red	red	ADJ
fnp-5188	234	13	)	)	PUNCT
fnp-5188	234	14	.	.	PUNCT
fnp-5188	235	1	one	one	NUM
fnp-5188	235	2	picture	picture	NOUN
fnp-5188	235	3	each	each	PRON
fnp-5188	235	4	is	be	AUX
fnp-5188	235	5	exemplary	exemplary	ADJ
fnp-5188	235	6	shown	show	VERB
fnp-5188	235	7	,	,	PUNCT
fnp-5188	235	8	63x	63x	NOUN
fnp-5188	235	9	magnification	magnification	NOUN
fnp-5188	235	10	,	,	PUNCT
fnp-5188	235	11	bars	bar	NOUN
fnp-5188	235	12	:	:	PUNCT
fnp-5188	235	13	10	10	NUM
fnp-5188	235	14	µm	µm	NOUN
fnp-5188	235	15	.	.	PUNCT
fnp-5188	236	1	c.	c.	NOUN
fnp-5188	236	2	quantification	quantification	NOUN
fnp-5188	236	3	of	of	ADP
fnp-5188	236	4	αsma+	αsma+	ADJ
fnp-5188	236	5	cells	cell	NOUN
fnp-5188	236	6	.	.	PUNCT
fnp-5188	237	1	d.	d.	PROPN
fnp-5188	237	2	quantification	quantification	NOUN
fnp-5188	237	3	of	of	ADP
fnp-5188	237	4	αsma	αsma	NOUN
fnp-5188	237	5	+	+	X
fnp-5188	237	6	/pdgfrβ+	/pdgfrβ+	ADJ
fnp-5188	237	7	double	double	ADJ
fnp-5188	237	8	positive	positive	ADJ
fnp-5188	237	9	cells	cell	NOUN
fnp-5188	237	10	(	(	PUNCT
fnp-5188	237	11	n=3	n=3	PUNCT
fnp-5188	237	12	mice	mouse	NOUN
fnp-5188	237	13	per	per	ADP
fnp-5188	237	14	group	group	NOUN
fnp-5188	237	15	and	and	CCONJ
fnp-5188	237	16	24	24	NUM
fnp-5188	237	17	-	-	PUNCT
fnp-5188	237	18	70	70	NUM
fnp-5188	237	19	slices	slice	NOUN
fnp-5188	237	20	per	per	ADP
fnp-5188	237	21	group	group	NOUN
fnp-5188	237	22	have	have	AUX
fnp-5188	237	23	been	be	AUX
fnp-5188	237	24	used	use	VERB
fnp-5188	237	25	for	for	ADP
fnp-5188	237	26	quantification	quantification	NOUN
fnp-5188	237	27	;	;	PUNCT
fnp-5188	237	28	sd	sd	NOUN
fnp-5188	237	29	,	,	PUNCT
fnp-5188	237	30	t	t	NOUN
fnp-5188	237	31	-	-	PUNCT
fnp-5188	237	32	test	test	NOUN
fnp-5188	237	33	,	,	PUNCT
fnp-5188	237	34	*	*	PUNCT
fnp-5188	237	35	*	*	PUNCT
fnp-5188	237	36	*	*	PUNCT
fnp-5188	237	37	*	*	PUNCT
fnp-5188	237	38	p<0.0001	p<0.0001	NOUN
fnp-5188	237	39	)	)	PUNCT
fnp-5188	237	40	.	.	PUNCT
fnp-5188	238	1	this	this	PRON
fnp-5188	238	2	indicates	indicate	VERB
fnp-5188	238	3	that	that	SCONJ
fnp-5188	238	4	the	the	DET
fnp-5188	238	5	activation	activation	NOUN
fnp-5188	238	6	of	of	ADP
fnp-5188	238	7	vamcs	vamcs	NOUN
fnp-5188	238	8	(	(	PUNCT
fnp-5188	238	9	identified	identify	VERB
fnp-5188	238	10	by	by	ADP
fnp-5188	238	11	the	the	DET
fnp-5188	238	12	expression	expression	NOUN
fnp-5188	238	13	of	of	ADP
fnp-5188	238	14	pdgfrβ	pdgfrβ	NOUN
fnp-5188	238	15	and/or	and/or	CCONJ
fnp-5188	238	16	αsma	αsma	PROPN
fnp-5188	238	17	)	)	PUNCT
fnp-5188	238	18	in	in	ADP
fnp-5188	238	19	the	the	DET
fnp-5188	238	20	tumor	tumor	NOUN
fnp-5188	238	21	core	core	NOUN
fnp-5188	238	22	is	be	AUX
fnp-5188	238	23	provoked	provoke	VERB
fnp-5188	238	24	by	by	ADP
fnp-5188	238	25	tgf	tgf	PROPN
fnp-5188	238	26	-	-	PUNCT
fnp-5188	238	27	β	β	PROPN
fnp-5188	238	28	released	release	VERB
fnp-5188	238	29	from	from	ADP
fnp-5188	238	30	gl261	gl261	PROPN
fnp-5188	238	31	cells	cell	NOUN
fnp-5188	238	32	and	and	CCONJ
fnp-5188	238	33	the	the	DET
fnp-5188	238	34	subsequent	subsequent	ADJ
fnp-5188	238	35	induction	induction	NOUN
fnp-5188	238	36	of	of	ADP
fnp-5188	238	37	slug	slug	NOUN
fnp-5188	238	38	expression	expression	NOUN
fnp-5188	238	39	in	in	ADP
fnp-5188	238	40	vamcs	vamcs	NOUN
fnp-5188	238	41	located	locate	VERB
fnp-5188	238	42	adjacent	adjacent	ADJ
fnp-5188	238	43	to	to	ADP
fnp-5188	238	44	gbm	gbm	PROPN
fnp-5188	238	45	cells	cell	NOUN
fnp-5188	238	46	.	.	PUNCT
fnp-5188	239	1	furthermore	furthermore	ADV
fnp-5188	239	2	,	,	PUNCT
fnp-5188	239	3	vessel	vessel	NOUN
fnp-5188	239	4	density	density	NOUN
fnp-5188	239	5	was	be	AUX
fnp-5188	239	6	also	also	ADV
fnp-5188	239	7	significantly	significantly	ADV
fnp-5188	239	8	decreased	decrease	VERB
fnp-5188	239	9	due	due	ADP
fnp-5188	239	10	to	to	ADP
fnp-5188	239	11	the	the	DET
fnp-5188	239	12	slug	slug	NOUN
fnp-5188	239	13	knockout	knockout	NOUN
fnp-5188	239	14	in	in	ADP
fnp-5188	239	15	all	all	DET
fnp-5188	239	16	regions	region	NOUN
fnp-5188	239	17	of	of	ADP
fnp-5188	239	18	the	the	DET
fnp-5188	239	19	tumor	tumor	NOUN
fnp-5188	239	20	,	,	PUNCT
fnp-5188	239	21	although	although	SCONJ
fnp-5188	239	22	it	it	PRON
fnp-5188	239	23	did	do	AUX
fnp-5188	239	24	not	not	PART
fnp-5188	239	25	reach	reach	VERB
fnp-5188	239	26	the	the	DET
fnp-5188	239	27	baseline	baseline	ADJ
fnp-5188	239	28	levels	level	NOUN
fnp-5188	239	29	of	of	ADP
fnp-5188	239	30	ec	ec	PROPN
fnp-5188	239	31	density	density	NOUN
fnp-5188	239	32	observed	observe	VERB
fnp-5188	239	33	in	in	ADP
fnp-5188	239	34	non	non	ADJ
fnp-5188	239	35	-	-	ADJ
fnp-5188	239	36	tumor	tumor	ADJ
fnp-5188	239	37	-	-	PUNCT
fnp-5188	239	38	bearing	bear	VERB
fnp-5188	239	39	brain	brain	NOUN
fnp-5188	239	40	regions	region	NOUN
fnp-5188	239	41	.	.	PUNCT
fnp-5188	240	1	(	(	PUNCT
fnp-5188	240	2	fig	fig	NOUN
fnp-5188	240	3	.	.	PUNCT
fnp-5188	241	1	8)	8)	NUM
fnp-5188	241	2	.	.	PUNCT
fnp-5188	241	3	figure	figure	NOUN
fnp-5188	241	4	8	8	NUM
fnp-5188	241	5	.	.	PUNCT
fnp-5188	242	1	cd31	cd31	PROPN
fnp-5188	242	2	+	+	CCONJ
fnp-5188	242	3	ecs	ec	NOUN
fnp-5188	242	4	were	be	AUX
fnp-5188	242	5	significantly	significantly	ADV
fnp-5188	242	6	reduced	reduce	VERB
fnp-5188	242	7	in	in	ADP
fnp-5188	242	8	mice	mouse	NOUN
fnp-5188	242	9	injected	inject	VERB
fnp-5188	242	10	with	with	ADP
fnp-5188	242	11	lenti	lenti	ADJ
fnp-5188	242	12	-	-	ADJ
fnp-5188	242	13	slug	slug	ADJ
fnp-5188	242	14	-	-	PUNCT
fnp-5188	242	15	ko	ko	PROPN
fnp-5188	242	16	.	.	PUNCT
fnp-5188	243	1	a.	a.	PROPN
fnp-5188	243	2	merged	merge	VERB
fnp-5188	243	3	pictures	picture	NOUN
fnp-5188	243	4	showing	show	VERB
fnp-5188	243	5	immunofluorescence	immunofluorescence	NOUN
fnp-5188	243	6	of	of	ADP
fnp-5188	243	7	gbm	gbm	NOUN
fnp-5188	243	8	cells	cell	NOUN
fnp-5188	243	9	(	(	PUNCT
fnp-5188	243	10	red	red	ADJ
fnp-5188	243	11	)	)	PUNCT
fnp-5188	243	12	,	,	PUNCT
fnp-5188	243	13	vamcs	vamcs	NOUN
fnp-5188	243	14	(	(	PUNCT
fnp-5188	243	15	green	green	ADJ
fnp-5188	243	16	)	)	PUNCT
fnp-5188	243	17	and	and	CCONJ
fnp-5188	243	18	cd31	cd31	PROPN
fnp-5188	243	19	+	+	CCONJ
fnp-5188	243	20	ecs	ecs	PROPN
fnp-5188	243	21	(	(	PUNCT
fnp-5188	243	22	magenta	magenta	PROPN
fnp-5188	243	23	)	)	PUNCT
fnp-5188	243	24	in	in	ADP
fnp-5188	243	25	the	the	DET
fnp-5188	243	26	tumor	tumor	NOUN
fnp-5188	243	27	core	core	NOUN
fnp-5188	243	28	,	,	PUNCT
fnp-5188	243	29	transition	transition	NOUN
fnp-5188	243	30	and	and	CCONJ
fnp-5188	243	31	infiltration	infiltration	NOUN
fnp-5188	243	32	zone	zone	NOUN
fnp-5188	243	33	(	(	PUNCT
fnp-5188	243	34	one	one	NUM
fnp-5188	243	35	picture	picture	NOUN
fnp-5188	243	36	is	be	AUX
fnp-5188	243	37	exemplary	exemplary	ADJ
fnp-5188	243	38	shown	show	VERB
fnp-5188	243	39	;	;	PUNCT
fnp-5188	243	40	25x	25x	NOUN
fnp-5188	243	41	magnification	magnification	NOUN
fnp-5188	243	42	,	,	PUNCT
fnp-5188	243	43	bars	bar	NOUN
fnp-5188	243	44	:	:	PUNCT
fnp-5188	243	45	50	50	NUM
fnp-5188	243	46	µm	µm	NOUN
fnp-5188	243	47	)	)	PUNCT
fnp-5188	243	48	.	.	PUNCT
fnp-5188	244	1	b.	b.	PROPN
fnp-5188	244	2	immunofluorescence	immunofluorescence	NOUN
fnp-5188	244	3	of	of	ADP
fnp-5188	244	4	gbm	gbm	PROPN
fnp-5188	244	5	cells	cell	NOUN
fnp-5188	244	6	(	(	PUNCT
fnp-5188	244	7	red	red	ADJ
fnp-5188	244	8	)	)	PUNCT
fnp-5188	244	9	,	,	PUNCT
fnp-5188	244	10	gfp+	gfp+	PROPN
fnp-5188	244	11	vamcs	vamcs	NOUN
fnp-5188	244	12	(	(	PUNCT
fnp-5188	244	13	green	green	ADJ
fnp-5188	244	14	)	)	PUNCT
fnp-5188	244	15	and	and	CCONJ
fnp-5188	244	16	cd31	cd31	PROPN
fnp-5188	244	17	+	+	CCONJ
fnp-5188	244	18	ecs	ecs	PROPN
fnp-5188	244	19	(	(	PUNCT
fnp-5188	244	20	magenta	magenta	PROPN
fnp-5188	244	21	)	)	PUNCT
fnp-5188	244	22	and	and	CCONJ
fnp-5188	244	23	merged	merged	ADJ
fnp-5188	244	24	pictures	picture	NOUN
fnp-5188	244	25	.	.	PUNCT
fnp-5188	245	1	one	one	NUM
fnp-5188	245	2	picture	picture	NOUN
fnp-5188	245	3	each	each	PRON
fnp-5188	245	4	is	be	AUX
fnp-5188	245	5	exemplary	exemplary	ADJ
fnp-5188	245	6	shown	show	VERB
fnp-5188	245	7	(	(	PUNCT
fnp-5188	245	8	63x	63x	NOUN
fnp-5188	245	9	magnification	magnification	NOUN
fnp-5188	245	10	,	,	PUNCT
fnp-5188	245	11	bars	bar	NOUN
fnp-5188	245	12	:	:	PUNCT
fnp-5188	245	13	10	10	NUM
fnp-5188	245	14	µm	µm	NOUN
fnp-5188	245	15	)	)	PUNCT
fnp-5188	245	16	.	.	PUNCT
fnp-5188	246	1	c.	c.	PROPN
fnp-5188	246	2	detection	detection	PROPN
fnp-5188	246	3	of	of	ADP
fnp-5188	246	4	gfp+	gfp+	PROPN
fnp-5188	246	5	mural	mural	ADJ
fnp-5188	246	6	cells	cell	NOUN
fnp-5188	246	7	(	(	PUNCT
fnp-5188	246	8	green	green	ADJ
fnp-5188	246	9	)	)	PUNCT
fnp-5188	246	10	and	and	CCONJ
fnp-5188	246	11	cd31	cd31	PROPN
fnp-5188	246	12	positive	positive	ADJ
fnp-5188	246	13	cells	cell	NOUN
fnp-5188	246	14	(	(	PUNCT
fnp-5188	246	15	magenta	magenta	NOUN
fnp-5188	246	16	)	)	PUNCT
fnp-5188	246	17	in	in	ADP
fnp-5188	246	18	the	the	DET
fnp-5188	246	19	normal	normal	ADJ
fnp-5188	246	20	mouse	mouse	NOUN
fnp-5188	246	21	brain	brain	NOUN
fnp-5188	246	22	(	(	PUNCT
fnp-5188	246	23	bars	bar	NOUN
fnp-5188	246	24	:	:	PUNCT
fnp-5188	246	25	100	100	NUM
fnp-5188	246	26	µm	µm	NOUN
fnp-5188	246	27	)	)	PUNCT
fnp-5188	246	28	.	.	PUNCT
fnp-5188	247	1	d.	d.	PROPN
fnp-5188	247	2	quantification	quantification	NOUN
fnp-5188	247	3	of	of	ADP
fnp-5188	247	4	cd31	cd31	PROPN
fnp-5188	247	5	positive	positive	ADJ
fnp-5188	247	6	cells	cell	NOUN
fnp-5188	247	7	in	in	ADP
fnp-5188	247	8	the	the	DET
fnp-5188	247	9	tumor	tumor	NOUN
fnp-5188	247	10	area	area	NOUN
fnp-5188	247	11	of	of	ADP
fnp-5188	247	12	lenti	lenti	ADJ
fnp-5188	247	13	-	-	ADJ
fnp-5188	247	14	v2	v2	ADJ
fnp-5188	247	15	and	and	CCONJ
fnp-5188	247	16	lenti	lenti	ADJ
fnp-5188	247	17	-	-	ADJ
fnp-5188	247	18	slug	slug	NOUN
fnp-5188	247	19	-	-	PUNCT
fnp-5188	247	20	ko	ko	NOUN
fnp-5188	247	21	injected	inject	VERB
fnp-5188	247	22	mice	mouse	NOUN
fnp-5188	247	23	as	as	ADV
fnp-5188	247	24	well	well	ADV
fnp-5188	247	25	as	as	ADP
fnp-5188	247	26	in	in	ADP
fnp-5188	247	27	the	the	DET
fnp-5188	247	28	contralateral	contralateral	ADJ
fnp-5188	247	29	hemisphere	hemisphere	NOUN
fnp-5188	247	30	(	(	PUNCT
fnp-5188	247	31	normal	normal	ADJ
fnp-5188	247	32	brain	brain	NOUN
fnp-5188	247	33	;	;	PUNCT
fnp-5188	247	34	n=2	n=2	X
fnp-5188	247	35	mice	mouse	NOUN
fnp-5188	247	36	per	per	ADP
fnp-5188	247	37	group	group	NOUN
fnp-5188	247	38	,	,	PUNCT
fnp-5188	247	39	24	24	NUM
fnp-5188	247	40	-	-	SYM
fnp-5188	247	41	48	48	NUM
fnp-5188	247	42	slices	slice	NOUN
fnp-5188	247	43	/	/	SYM
fnp-5188	247	44	group	group	NOUN
fnp-5188	247	45	,	,	PUNCT
fnp-5188	247	46	sd	sd	NOUN
fnp-5188	247	47	,	,	PUNCT
fnp-5188	247	48	t	t	NOUN
fnp-5188	247	49	-	-	PUNCT
fnp-5188	247	50	test	test	NOUN
fnp-5188	247	51	,	,	PUNCT
fnp-5188	247	52	*	*	PUNCT
fnp-5188	247	53	*	*	PUNCT
fnp-5188	247	54	*	*	PUNCT
fnp-5188	247	55	*	*	PUNCT
fnp-5188	247	56	p<0.0001	p<0.0001	NOUN
fnp-5188	247	57	)	)	PUNCT
fnp-5188	247	58	.	.	PUNCT
fnp-5188	248	1	knocking	knock	VERB
fnp-5188	248	2	out	out	ADP
fnp-5188	248	3	tgf	tgf	PROPN
fnp-5188	248	4	-	-	PUNCT
fnp-5188	248	5	β	β	PROPN
fnp-5188	248	6	in	in	ADP
fnp-5188	248	7	gbm	gbm	PROPN
fnp-5188	248	8	cells	cell	NOUN
fnp-5188	248	9	or	or	CCONJ
fnp-5188	248	10	slug	slug	VERB
fnp-5188	248	11	in	in	ADP
fnp-5188	248	12	vamcs	vamcs	NOUN
fnp-5188	248	13	attenuates	attenuate	NOUN
fnp-5188	248	14	pathological	pathological	ADJ
fnp-5188	248	15	alterations	alteration	NOUN
fnp-5188	248	16	of	of	ADP
fnp-5188	248	17	the	the	DET
fnp-5188	248	18	intratumoral	intratumoral	ADJ
fnp-5188	248	19	vasculature	vasculature	NOUN
fnp-5188	248	20	vessels	vessel	NOUN
fnp-5188	248	21	of	of	ADP
fnp-5188	248	22	par	par	NOUN
fnp-5188	248	23	cell	cell	NOUN
fnp-5188	248	24	derived	derive	VERB
fnp-5188	248	25	gbms	gbms	NOUN
fnp-5188	248	26	clearly	clearly	ADV
fnp-5188	248	27	displayed	display	VERB
fnp-5188	248	28	abundant	abundant	ADJ
fnp-5188	248	29	structural	structural	ADJ
fnp-5188	248	30	alterations	alteration	NOUN
fnp-5188	248	31	consisting	consist	VERB
fnp-5188	248	32	of	of	ADP
fnp-5188	248	33	vascular	vascular	ADJ
fnp-5188	248	34	tangles	tangle	NOUN
fnp-5188	248	35	or	or	CCONJ
fnp-5188	248	36	glomeroid	glomeroid	NOUN
fnp-5188	248	37	-	-	PUNCT
fnp-5188	248	38	like	like	ADJ
fnp-5188	248	39	structures	structure	NOUN
fnp-5188	248	40	.	.	PUNCT
fnp-5188	249	1	they	they	PRON
fnp-5188	249	2	exhibited	exhibit	VERB
fnp-5188	249	3	a	a	DET
fnp-5188	249	4	more	more	ADV
fnp-5188	249	5	interconnected	interconnected	ADJ
fnp-5188	249	6	,	,	PUNCT
fnp-5188	249	7	"	"	PUNCT
fnp-5188	249	8	net	net	ADJ
fnp-5188	249	9	-	-	PUNCT
fnp-5188	249	10	like	like	ADJ
fnp-5188	249	11	"	"	PUNCT
fnp-5188	249	12	appearance	appearance	NOUN
fnp-5188	249	13	and	and	CCONJ
fnp-5188	249	14	were	be	AUX
fnp-5188	249	15	positioned	position	VERB
fnp-5188	249	16	in	in	ADP
fnp-5188	249	17	closer	close	ADJ
fnp-5188	249	18	proximity	proximity	NOUN
fnp-5188	249	19	to	to	ADP
fnp-5188	249	20	each	each	DET
fnp-5188	249	21	other	other	ADJ
fnp-5188	249	22	compared	compare	VERB
fnp-5188	249	23	to	to	ADP
fnp-5188	249	24	the	the	DET
fnp-5188	249	25	vessels	vessel	NOUN
fnp-5188	249	26	found	find	VERB
fnp-5188	249	27	in	in	ADP
fnp-5188	249	28	tgf	tgf	PROPN
fnp-5188	249	29	-	-	PUNCT
fnp-5188	249	30	β	β	NOUN
fnp-5188	249	31	-	-	PUNCT
fnp-5188	249	32	ko	ko	ADJ
fnp-5188	249	33	tumors	tumor	NOUN
fnp-5188	249	34	or	or	CCONJ
fnp-5188	249	35	when	when	SCONJ
fnp-5188	249	36	slug	slug	VERB
fnp-5188	249	37	induction	induction	NOUN
fnp-5188	249	38	in	in	ADP
fnp-5188	249	39	vamcs	vamcs	NOUN
fnp-5188	249	40	was	be	AUX
fnp-5188	249	41	inhibited	inhibit	VERB
fnp-5188	249	42	by	by	ADP
fnp-5188	249	43	lenti	lenti	ADJ
fnp-5188	249	44	-	-	ADJ
fnp-5188	249	45	slug	slug	ADJ
fnp-5188	249	46	-	-	PUNCT
fnp-5188	249	47	ko	ko	NOUN
fnp-5188	249	48	injection	injection	NOUN
fnp-5188	249	49	.	.	PUNCT
fnp-5188	250	1	the	the	DET
fnp-5188	250	2	vasculature	vasculature	NOUN
fnp-5188	250	3	in	in	ADP
fnp-5188	250	4	par	par	NOUN
fnp-5188	250	5	cell	cell	NOUN
fnp-5188	250	6	derived	derive	VERB
fnp-5188	250	7	gbms	gbms	NOUN
fnp-5188	250	8	not	not	PART
fnp-5188	250	9	only	only	ADV
fnp-5188	250	10	showed	show	VERB
fnp-5188	250	11	a	a	DET
fnp-5188	250	12	higher	high	ADJ
fnp-5188	250	13	vessel	vessel	NOUN
fnp-5188	250	14	density	density	NOUN
fnp-5188	250	15	,	,	PUNCT
fnp-5188	250	16	but	but	CCONJ
fnp-5188	250	17	also	also	ADV
fnp-5188	250	18	greater	great	ADJ
fnp-5188	250	19	variations	variation	NOUN
fnp-5188	250	20	.	.	PUNCT
fnp-5188	251	1	vessels	vessel	NOUN
fnp-5188	251	2	in	in	ADP
fnp-5188	251	3	tgf	tgf	PROPN
fnp-5188	251	4	-	-	PUNCT
fnp-5188	251	5	β	β	NOUN
fnp-5188	251	6	-	-	PUNCT
fnp-5188	251	7	ko	ko	ADJ
fnp-5188	251	8	tumors	tumor	NOUN
fnp-5188	251	9	as	as	ADV
fnp-5188	251	10	well	well	ADV
fnp-5188	251	11	as	as	ADP
fnp-5188	251	12	in	in	ADP
fnp-5188	251	13	those	those	DET
fnp-5188	251	14	tumors	tumor	NOUN
fnp-5188	251	15	where	where	SCONJ
fnp-5188	251	16	slug	slug	NOUN
fnp-5188	251	17	was	be	AUX
fnp-5188	251	18	knocked	knock	VERB
fnp-5188	251	19	out	out	ADP
fnp-5188	251	20	in	in	ADP
fnp-5188	251	21	vamcs	vamcs	NOUN
fnp-5188	251	22	exhibited	exhibit	VERB
fnp-5188	251	23	less	less	ADV
fnp-5188	251	24	pronounced	pronounced	ADJ
fnp-5188	251	25	structural	structural	ADJ
fnp-5188	251	26	vessel	vessel	NOUN
fnp-5188	251	27	abnormalities	abnormality	NOUN
fnp-5188	251	28	and	and	CCONJ
fnp-5188	251	29	a	a	DET
fnp-5188	251	30	reduced	reduced	ADJ
fnp-5188	251	31	number	number	NOUN
fnp-5188	251	32	of	of	ADP
fnp-5188	251	33	these	these	DET
fnp-5188	251	34	cells	cell	NOUN
fnp-5188	251	35	.	.	PUNCT
fnp-5188	252	1	however	however	ADV
fnp-5188	252	2	,	,	PUNCT
fnp-5188	252	3	the	the	DET
fnp-5188	252	4	intratumoral	intratumoral	ADJ
fnp-5188	252	5	vessels	vessel	NOUN
fnp-5188	252	6	were	be	AUX
fnp-5188	252	7	still	still	ADV
fnp-5188	252	8	chaotically	chaotically	ADV
fnp-5188	252	9	organized	organize	VERB
fnp-5188	252	10	compared	compare	VERB
fnp-5188	252	11	to	to	ADP
fnp-5188	252	12	the	the	DET
fnp-5188	252	13	vascular	vascular	ADJ
fnp-5188	252	14	structure	structure	NOUN
fnp-5188	252	15	of	of	ADP
fnp-5188	252	16	the	the	DET
fnp-5188	252	17	brain	brain	NOUN
fnp-5188	252	18	in	in	ADP
fnp-5188	252	19	the	the	DET
fnp-5188	252	20	contralateral	contralateral	ADJ
fnp-5188	252	21	,	,	PUNCT
fnp-5188	252	22	tumor	tumor	NOUN
fnp-5188	252	23	-	-	PUNCT
fnp-5188	252	24	free	free	ADJ
fnp-5188	252	25	hemisphere	hemisphere	ADV
fnp-5188	252	26	of	of	ADP
fnp-5188	252	27	the	the	DET
fnp-5188	252	28	same	same	ADJ
fnp-5188	252	29	animal	animal	NOUN
fnp-5188	252	30	(	(	PUNCT
fnp-5188	252	31	suppl	suppl	PROPN
fnp-5188	252	32	.	.	PUNCT
fnp-5188	252	33	fig	fig	NOUN
fnp-5188	252	34	.	.	PUNCT
fnp-5188	253	1	10	10	NUM
fnp-5188	253	2	)	)	PUNCT
fnp-5188	253	3	.	.	PUNCT
fnp-5188	254	1	for	for	ADP
fnp-5188	254	2	further	further	ADJ
fnp-5188	254	3	detailed	detailed	ADJ
fnp-5188	254	4	analysis	analysis	NOUN
fnp-5188	254	5	,	,	PUNCT
fnp-5188	254	6	we	we	PRON
fnp-5188	254	7	conducted	conduct	VERB
fnp-5188	254	8	tissue	tissue	NOUN
fnp-5188	254	9	clearing	clearing	NOUN
fnp-5188	254	10	of	of	ADP
fnp-5188	254	11	the	the	DET
fnp-5188	254	12	brain	brain	NOUN
fnp-5188	254	13	of	of	ADP
fnp-5188	254	14	one	one	NUM
fnp-5188	254	15	mouse	mouse	NOUN
fnp-5188	254	16	per	per	ADP
fnp-5188	254	17	experimental	experimental	ADJ
fnp-5188	254	18	group	group	NOUN
fnp-5188	254	19	and	and	CCONJ
fnp-5188	254	20	performed	perform	VERB
fnp-5188	254	21	3d	3d	NUM
fnp-5188	254	22	reconstruction	reconstruction	NOUN
fnp-5188	254	23	of	of	ADP
fnp-5188	254	24	the	the	DET
fnp-5188	254	25	tumor	tumor	NOUN
fnp-5188	254	26	vasculature	vasculature	NOUN
fnp-5188	254	27	.	.	PUNCT
fnp-5188	255	1	the	the	DET
fnp-5188	255	2	3d	3d	PROPN
fnp-5188	255	3	vessel	vessel	NOUN
fnp-5188	255	4	reconstruction	reconstruction	NOUN
fnp-5188	255	5	strikingly	strikingly	ADV
fnp-5188	255	6	shows	show	VERB
fnp-5188	255	7	that	that	SCONJ
fnp-5188	255	8	mouse	mouse	NOUN
fnp-5188	255	9	brains	brain	NOUN
fnp-5188	255	10	bearing	bear	VERB
fnp-5188	255	11	par	par	NOUN
fnp-5188	255	12	tumor	tumor	NOUN
fnp-5188	255	13	not	not	PART
fnp-5188	255	14	only	only	ADV
fnp-5188	255	15	displayed	display	VERB
fnp-5188	255	16	a	a	DET
fnp-5188	255	17	high	high	ADJ
fnp-5188	255	18	vessel	vessel	NOUN
fnp-5188	255	19	density	density	NOUN
fnp-5188	255	20	but	but	CCONJ
fnp-5188	255	21	also	also	ADV
fnp-5188	255	22	several	several	ADJ
fnp-5188	255	23	structural	structural	ADJ
fnp-5188	255	24	alterations	alteration	NOUN
fnp-5188	255	25	such	such	ADJ
fnp-5188	255	26	as	as	ADP
fnp-5188	255	27	vascular	vascular	ADJ
fnp-5188	255	28	tangles	tangle	NOUN
fnp-5188	255	29	or	or	CCONJ
fnp-5188	255	30	glomeroid	glomeroid	NOUN
fnp-5188	255	31	-	-	PUNCT
fnp-5188	255	32	like	like	ADJ
fnp-5188	255	33	structures	structure	NOUN
fnp-5188	255	34	instead	instead	ADV
fnp-5188	255	35	of	of	ADP
fnp-5188	255	36	the	the	DET
fnp-5188	255	37	straight	straight	ADJ
fnp-5188	255	38	vessel	vessel	NOUN
fnp-5188	255	39	course	course	NOUN
fnp-5188	255	40	seen	see	VERB
fnp-5188	255	41	in	in	ADP
fnp-5188	255	42	the	the	DET
fnp-5188	255	43	contralateral	contralateral	ADJ
fnp-5188	255	44	brain	brain	NOUN
fnp-5188	255	45	hemisphere	hemisphere	ADV
fnp-5188	255	46	.	.	PUNCT
fnp-5188	256	1	we	we	PRON
fnp-5188	256	2	further	far	ADV
fnp-5188	256	3	observed	observe	VERB
fnp-5188	256	4	that	that	SCONJ
fnp-5188	256	5	this	this	DET
fnp-5188	256	6	altered	alter	VERB
fnp-5188	256	7	and	and	CCONJ
fnp-5188	256	8	chaotic	chaotic	ADJ
fnp-5188	256	9	vessel	vessel	NOUN
fnp-5188	256	10	structure	structure	NOUN
fnp-5188	256	11	was	be	AUX
fnp-5188	256	12	clearly	clearly	ADV
fnp-5188	256	13	attenuated	attenuate	VERB
fnp-5188	256	14	after	after	ADP
fnp-5188	256	15	knocking	knock	VERB
fnp-5188	256	16	out	out	ADP
fnp-5188	256	17	tgf	tgf	PROPN
fnp-5188	256	18	-	-	PUNCT
fnp-5188	256	19	β	β	PROPN
fnp-5188	256	20	in	in	ADP
fnp-5188	256	21	tumor	tumor	NOUN
fnp-5188	256	22	cells	cell	NOUN
fnp-5188	256	23	or	or	CCONJ
fnp-5188	256	24	slug	slug	VERB
fnp-5188	256	25	in	in	ADP
fnp-5188	256	26	vamcs	vamcs	NOUN
fnp-5188	256	27	(	(	PUNCT
fnp-5188	256	28	fig	fig	NOUN
fnp-5188	256	29	.	.	PUNCT
fnp-5188	257	1	9	9	NUM
fnp-5188	257	2	;	;	PUNCT
fnp-5188	257	3	suppl	suppl	PROPN
fnp-5188	257	4	.	.	PUNCT
fnp-5188	257	5	fig	fig	PROPN
fnp-5188	257	6	.	.	PUNCT
fnp-5188	258	1	11	11	NUM
fnp-5188	258	2	)	)	PUNCT
fnp-5188	258	3	.	.	PUNCT
fnp-5188	259	1	figure	figure	VERB
fnp-5188	259	2	9	9	NUM
fnp-5188	259	3	:	:	SYM
fnp-5188	259	4	three	three	NUM
fnp-5188	259	5	-	-	PUNCT
fnp-5188	259	6	dimensional	dimensional	ADJ
fnp-5188	259	7	reconstruction	reconstruction	NOUN
fnp-5188	259	8	of	of	ADP
fnp-5188	259	9	tumor	tumor	NOUN
fnp-5188	259	10	-	-	PUNCT
fnp-5188	259	11	associated	associate	VERB
fnp-5188	259	12	vessels	vessel	NOUN
fnp-5188	259	13	indicates	indicate	VERB
fnp-5188	259	14	a	a	DET
fnp-5188	259	15	normalized	normalize	VERB
fnp-5188	259	16	vessel	vessel	NOUN
fnp-5188	259	17	structure	structure	NOUN
fnp-5188	259	18	in	in	ADP
fnp-5188	259	19	mice	mouse	NOUN
fnp-5188	259	20	harboring	harbor	VERB
fnp-5188	259	21	tgf	tgf	PROPN
fnp-5188	259	22	-	-	PUNCT
fnp-5188	259	23	β	β	NOUN
fnp-5188	259	24	-	-	PUNCT
fnp-5188	259	25	ko	ko	ADJ
fnp-5188	259	26	gbms	gbms	PROPN
fnp-5188	259	27	as	as	ADV
fnp-5188	259	28	well	well	ADV
fnp-5188	259	29	as	as	ADP
fnp-5188	259	30	in	in	ADP
fnp-5188	259	31	mice	mouse	NOUN
fnp-5188	259	32	with	with	ADP
fnp-5188	259	33	par	par	NOUN
fnp-5188	259	34	tumors	tumor	NOUN
fnp-5188	259	35	that	that	PRON
fnp-5188	259	36	received	receive	VERB
fnp-5188	259	37	lenti	lenti	ADJ
fnp-5188	259	38	-	-	ADJ
fnp-5188	259	39	slug	slug	ADJ
fnp-5188	259	40	-	-	PUNCT
fnp-5188	259	41	ko	ko	NOUN
fnp-5188	259	42	.	.	PUNCT
fnp-5188	260	1	3d	3d	NUM
fnp-5188	260	2	reconstruction	reconstruction	NOUN
fnp-5188	260	3	after	after	ADP
fnp-5188	260	4	image	image	NOUN
fnp-5188	260	5	improvement	improvement	NOUN
fnp-5188	260	6	using	use	VERB
fnp-5188	260	7	imaris	imaris	NOUN
fnp-5188	260	8	.	.	PUNCT
fnp-5188	261	1	ecs	ecs	PROPN
fnp-5188	261	2	(	(	PUNCT
fnp-5188	261	3	cd31	cd31	PROPN
fnp-5188	261	4	+	+	PROPN
fnp-5188	261	5	,	,	PUNCT
fnp-5188	261	6	green	green	ADJ
fnp-5188	261	7	)	)	PUNCT
fnp-5188	261	8	were	be	AUX
fnp-5188	261	9	shown	show	VERB
fnp-5188	261	10	within	within	ADP
fnp-5188	261	11	the	the	DET
fnp-5188	261	12	tumor	tumor	NOUN
fnp-5188	261	13	region	region	NOUN
fnp-5188	261	14	in	in	ADP
fnp-5188	261	15	rgs5	rgs5	ADJ
fnp-5188	261	16	-	-	PUNCT
fnp-5188	261	17	gfp	gfp	PROPN
fnp-5188	261	18	reporter	reporter	NOUN
fnp-5188	261	19	mice	mouse	NOUN
fnp-5188	261	20	bearing	bear	VERB
fnp-5188	261	21	either	either	CCONJ
fnp-5188	261	22	parental	parental	ADJ
fnp-5188	261	23	gl261	gl261	PROPN
fnp-5188	261	24	derived	derived	ADJ
fnp-5188	261	25	gbms	gbms	NOUN
fnp-5188	261	26	(	(	PUNCT
fnp-5188	261	27	red	red	PROPN
fnp-5188	261	28	)	)	PUNCT
fnp-5188	261	29	without	without	ADP
fnp-5188	261	30	further	further	ADJ
fnp-5188	261	31	treatment	treatment	NOUN
fnp-5188	261	32	(	(	PUNCT
fnp-5188	261	33	par	par	NOUN
fnp-5188	261	34	,	,	PUNCT
fnp-5188	261	35	upper	upper	ADJ
fnp-5188	261	36	panel	panel	NOUN
fnp-5188	261	37	)	)	PUNCT
fnp-5188	261	38	,	,	PUNCT
fnp-5188	261	39	of	of	ADP
fnp-5188	261	40	an	an	DET
fnp-5188	261	41	animal	animal	NOUN
fnp-5188	261	42	bearing	bear	VERB
fnp-5188	261	43	a	a	DET
fnp-5188	261	44	tgf	tgf	PROPN
fnp-5188	261	45	-	-	PUNCT
fnp-5188	261	46	β	β	NOUN
fnp-5188	261	47	-	-	PUNCT
fnp-5188	261	48	ko	ko	ADJ
fnp-5188	261	49	gbm	gbm	PROPN
fnp-5188	261	50	(	(	PUNCT
fnp-5188	261	51	tgf	tgf	PROPN
fnp-5188	261	52	-	-	PUNCT
fnp-5188	261	53	β	β	NOUN
fnp-5188	261	54	-	-	PUNCT
fnp-5188	261	55	ko	ko	ADJ
fnp-5188	261	56	,	,	PUNCT
fnp-5188	261	57	middle	middle	ADJ
fnp-5188	261	58	panel	panel	NOUN
fnp-5188	261	59	)	)	PUNCT
fnp-5188	261	60	,	,	PUNCT
fnp-5188	261	61	and	and	CCONJ
fnp-5188	261	62	of	of	ADP
fnp-5188	261	63	a	a	DET
fnp-5188	261	64	mouse	mouse	NOUN
fnp-5188	261	65	bearing	bear	VERB
fnp-5188	261	66	a	a	DET
fnp-5188	261	67	par	par	NOUN
fnp-5188	261	68	tumor	tumor	NOUN
fnp-5188	261	69	and	and	CCONJ
fnp-5188	261	70	that	that	PRON
fnp-5188	261	71	have	have	AUX
fnp-5188	261	72	been	be	AUX
fnp-5188	261	73	intrastriatally	intrastriatally	ADV
fnp-5188	261	74	injected	inject	VERB
fnp-5188	261	75	with	with	ADP
fnp-5188	261	76	lenti	lenti	ADJ
fnp-5188	261	77	-	-	ADJ
fnp-5188	261	78	slug	slug	ADJ
fnp-5188	261	79	-	-	PUNCT
fnp-5188	261	80	ko	ko	PROPN
fnp-5188	261	81	(	(	PUNCT
fnp-5188	261	82	slug	slug	NOUN
fnp-5188	261	83	-	-	PUNCT
fnp-5188	261	84	ko	ko	PROPN
fnp-5188	261	85	,	,	PUNCT
fnp-5188	261	86	lower	low	ADJ
fnp-5188	261	87	panels	panel	NOUN
fnp-5188	261	88	)	)	PUNCT
fnp-5188	261	89	.	.	PUNCT
fnp-5188	262	1	black	black	ADJ
fnp-5188	262	2	/	/	SYM
fnp-5188	262	3	white	white	ADJ
fnp-5188	262	4	pictures	picture	NOUN
fnp-5188	262	5	(	(	PUNCT
fnp-5188	262	6	right	right	ADJ
fnp-5188	262	7	side	side	NOUN
fnp-5188	262	8	)	)	PUNCT
fnp-5188	262	9	showing	show	VERB
fnp-5188	262	10	vascular	vascular	ADJ
fnp-5188	262	11	alterations	alteration	NOUN
fnp-5188	262	12	(	(	PUNCT
fnp-5188	262	13	triangles	triangle	NOUN
fnp-5188	262	14	exemplary	exemplary	PROPN
fnp-5188	262	15	show	show	VERB
fnp-5188	262	16	glomeroid	glomeroid	ADJ
fnp-5188	262	17	-	-	PUNCT
fnp-5188	262	18	like	like	ADJ
fnp-5188	262	19	vessel	vessel	NOUN
fnp-5188	262	20	structures	structure	NOUN
fnp-5188	262	21	and	and	CCONJ
fnp-5188	262	22	arrows	arrow	VERB
fnp-5188	262	23	normal	normal	ADJ
fnp-5188	262	24	branches	branch	NOUN
fnp-5188	262	25	)	)	PUNCT
fnp-5188	262	26	.	.	PUNCT
fnp-5188	263	1	all	all	DET
fnp-5188	263	2	images	image	NOUN
fnp-5188	263	3	are	be	AUX
fnp-5188	263	4	taken	take	VERB
fnp-5188	263	5	at	at	ADP
fnp-5188	263	6	20x	20x	NOUN
fnp-5188	263	7	magnification	magnification	NOUN
fnp-5188	263	8	(	(	PUNCT
fnp-5188	263	9	n=1	n=1	PROPN
fnp-5188	263	10	mouse	mouse	PROPN
fnp-5188	263	11	per	per	ADP
fnp-5188	263	12	group	group	NOUN
fnp-5188	263	13	;	;	PUNCT
fnp-5188	263	14	scale	scale	NOUN
fnp-5188	263	15	bars	bar	NOUN
fnp-5188	263	16	=	=	NOUN
fnp-5188	263	17	50	50	NUM
fnp-5188	263	18	µm	µm	NOUN
fnp-5188	263	19	)	)	PUNCT
fnp-5188	263	20	.	.	PUNCT
fnp-5188	264	1	discussion	discussion	NOUN
fnp-5188	264	2	gbm	gbm	PROPN
fnp-5188	264	3	is	be	AUX
fnp-5188	264	4	a	a	DET
fnp-5188	264	5	highly	highly	ADV
fnp-5188	264	6	vascularized	vascularized	ADJ
fnp-5188	264	7	tumor	tumor	NOUN
fnp-5188	264	8	showing	show	VERB
fnp-5188	264	9	altered	alter	VERB
fnp-5188	264	10	vascular	vascular	ADJ
fnp-5188	264	11	morphology	morphology	NOUN
fnp-5188	264	12	with	with	ADP
fnp-5188	264	13	chaotically	chaotically	ADV
fnp-5188	264	14	organized	organize	VERB
fnp-5188	264	15	vessels	vessel	NOUN
fnp-5188	264	16	,	,	PUNCT
fnp-5188	264	17	for	for	ADP
fnp-5188	264	18	which	which	PRON
fnp-5188	264	19	anti	anti	ADJ
fnp-5188	264	20	-	-	ADJ
fnp-5188	264	21	angiogenic	angiogenic	ADJ
fnp-5188	264	22	therapies	therapy	NOUN
fnp-5188	264	23	were	be	AUX
fnp-5188	264	24	considered	consider	VERB
fnp-5188	264	25	as	as	ADP
fnp-5188	264	26	promising	promise	VERB
fnp-5188	264	27	therapeutic	therapeutic	ADJ
fnp-5188	264	28	option	option	NOUN
fnp-5188	264	29	.	.	PUNCT
fnp-5188	265	1	however	however	ADV
fnp-5188	265	2	,	,	PUNCT
fnp-5188	265	3	until	until	ADP
fnp-5188	265	4	now	now	ADV
fnp-5188	265	5	these	these	DET
fnp-5188	265	6	therapies	therapy	NOUN
fnp-5188	265	7	lack	lack	VERB
fnp-5188	265	8	a	a	DET
fnp-5188	265	9	remarkable	remarkable	ADJ
fnp-5188	265	10	increase	increase	NOUN
fnp-5188	265	11	in	in	ADP
fnp-5188	265	12	patient	patient	ADJ
fnp-5188	265	13	overall	overall	ADJ
fnp-5188	265	14	survival	survival	NOUN
fnp-5188	265	15	[	[	X
fnp-5188	265	16	33	33	NUM
fnp-5188	265	17	,	,	PUNCT
fnp-5188	265	18	34	34	NUM
fnp-5188	265	19	]	]	PUNCT
fnp-5188	265	20	.	.	PUNCT
fnp-5188	266	1	rather	rather	ADV
fnp-5188	266	2	,	,	PUNCT
fnp-5188	266	3	vascular	vascular	ADJ
fnp-5188	266	4	remodeling	remodeling	NOUN
fnp-5188	266	5	induced	induce	VERB
fnp-5188	266	6	by	by	ADP
fnp-5188	266	7	anti	anti	ADJ
fnp-5188	266	8	-	-	ADJ
fnp-5188	266	9	vegf	vegf	ADJ
fnp-5188	266	10	treatment	treatment	NOUN
fnp-5188	266	11	results	result	NOUN
fnp-5188	266	12	in	in	ADP
fnp-5188	266	13	hypoxia	hypoxia	NOUN
fnp-5188	266	14	,	,	PUNCT
fnp-5188	266	15	is	be	AUX
fnp-5188	266	16	associated	associate	VERB
fnp-5188	266	17	with	with	ADP
fnp-5188	266	18	excessive	excessive	ADJ
fnp-5188	266	19	tumor	tumor	NOUN
fnp-5188	266	20	growth	growth	NOUN
fnp-5188	266	21	with	with	ADP
fnp-5188	266	22	simultaneous	simultaneous	ADJ
fnp-5188	266	23	insufficient	insufficient	ADJ
fnp-5188	266	24	vascularization	vascularization	NOUN
fnp-5188	266	25	after	after	ADP
fnp-5188	266	26	an	an	DET
fnp-5188	266	27	initial	initial	ADJ
fnp-5188	266	28	transient	transient	ADJ
fnp-5188	266	29	vascular	vascular	ADJ
fnp-5188	266	30	"	"	PUNCT
fnp-5188	266	31	normalization	normalization	NOUN
fnp-5188	266	32	"	"	PUNCT
fnp-5188	266	33	,	,	PUNCT
fnp-5188	266	34	but	but	CCONJ
fnp-5188	266	35	finally	finally	ADV
fnp-5188	266	36	favoring	favor	VERB
fnp-5188	266	37	invasiveness	invasiveness	NOUN
fnp-5188	266	38	[	[	X
fnp-5188	266	39	35	35	NUM
fnp-5188	266	40	]	]	PUNCT
fnp-5188	266	41	.	.	PUNCT
fnp-5188	267	1	for	for	ADP
fnp-5188	267	2	a	a	DET
fnp-5188	267	3	long	long	ADJ
fnp-5188	267	4	time	time	NOUN
fnp-5188	267	5	,	,	PUNCT
fnp-5188	267	6	it	it	PRON
fnp-5188	267	7	has	have	AUX
fnp-5188	267	8	been	be	AUX
fnp-5188	267	9	thought	think	VERB
fnp-5188	267	10	that	that	SCONJ
fnp-5188	267	11	irregular	irregular	ADJ
fnp-5188	267	12	vessel	vessel	NOUN
fnp-5188	267	13	development	development	NOUN
fnp-5188	267	14	in	in	ADP
fnp-5188	267	15	tumors	tumor	NOUN
fnp-5188	267	16	depends	depend	VERB
fnp-5188	267	17	on	on	ADP
fnp-5188	267	18	the	the	DET
fnp-5188	267	19	activation	activation	NOUN
fnp-5188	267	20	of	of	ADP
fnp-5188	267	21	ecs	ecs	PROPN
fnp-5188	267	22	resulting	result	VERB
fnp-5188	267	23	in	in	ADP
fnp-5188	267	24	proliferation	proliferation	NOUN
fnp-5188	267	25	,	,	PUNCT
fnp-5188	267	26	migration	migration	NOUN
fnp-5188	267	27	and	and	CCONJ
fnp-5188	267	28	chaotic	chaotic	ADJ
fnp-5188	267	29	vascular	vascular	ADJ
fnp-5188	267	30	structures	structure	NOUN
fnp-5188	267	31	.	.	PUNCT
fnp-5188	268	1	more	more	ADV
fnp-5188	268	2	recently	recently	ADV
fnp-5188	268	3	,	,	PUNCT
fnp-5188	268	4	increased	increase	VERB
fnp-5188	268	5	attention	attention	NOUN
fnp-5188	268	6	has	have	AUX
fnp-5188	268	7	been	be	AUX
fnp-5188	268	8	paid	pay	VERB
fnp-5188	268	9	to	to	ADP
fnp-5188	268	10	vessel	vessel	NOUN
fnp-5188	268	11	-	-	PUNCT
fnp-5188	268	12	covering	cover	VERB
fnp-5188	268	13	pericytes	pericyte	NOUN
fnp-5188	268	14	and	and	CCONJ
fnp-5188	268	15	their	their	PRON
fnp-5188	268	16	interaction	interaction	NOUN
fnp-5188	268	17	with	with	ADP
fnp-5188	268	18	ecs	ecs	PROPN
fnp-5188	268	19	during	during	ADP
fnp-5188	268	20	vessel	vessel	NOUN
fnp-5188	268	21	formation	formation	NOUN
fnp-5188	268	22	processes	process	NOUN
fnp-5188	268	23	in	in	ADP
fnp-5188	268	24	tumors	tumor	NOUN
fnp-5188	268	25	,	,	PUNCT
fnp-5188	268	26	including	include	VERB
fnp-5188	268	27	gbm	gbm	PROPN
fnp-5188	268	28	.	.	PUNCT
fnp-5188	269	1	brain	brain	NOUN
fnp-5188	269	2	pericytes	pericyte	NOUN
fnp-5188	269	3	are	be	AUX
fnp-5188	269	4	known	know	VERB
fnp-5188	269	5	to	to	PART
fnp-5188	269	6	be	be	AUX
fnp-5188	269	7	crucial	crucial	ADJ
fnp-5188	269	8	for	for	ADP
fnp-5188	269	9	angiogenesis	angiogenesis	NOUN
fnp-5188	269	10	,	,	PUNCT
fnp-5188	269	11	they	they	PRON
fnp-5188	269	12	regulate	regulate	VERB
fnp-5188	269	13	perfusion	perfusion	NOUN
fnp-5188	269	14	and	and	CCONJ
fnp-5188	269	15	maintain	maintain	VERB
fnp-5188	269	16	vessel	vessel	NOUN
fnp-5188	269	17	structure	structure	NOUN
fnp-5188	269	18	as	as	ADV
fnp-5188	269	19	well	well	ADV
fnp-5188	269	20	as	as	ADP
fnp-5188	269	21	bbb	bbb	PROPN
fnp-5188	269	22	integrity	integrity	NOUN
fnp-5188	270	1	[	[	X
fnp-5188	270	2	36	36	NUM
fnp-5188	270	3	-	-	SYM
fnp-5188	270	4	38	38	NUM
fnp-5188	270	5	]	]	PUNCT
fnp-5188	270	6	.	.	PUNCT
fnp-5188	271	1	in	in	ADP
fnp-5188	271	2	addition	addition	NOUN
fnp-5188	271	3	,	,	PUNCT
fnp-5188	271	4	they	they	PRON
fnp-5188	271	5	can	can	AUX
fnp-5188	271	6	facilitate	facilitate	VERB
fnp-5188	271	7	cerebral	cerebral	ADJ
fnp-5188	271	8	inflammatory	inflammatory	ADJ
fnp-5188	271	9	processes	process	NOUN
fnp-5188	271	10	,	,	PUNCT
fnp-5188	271	11	control	control	VERB
fnp-5188	271	12	the	the	DET
fnp-5188	271	13	interaction	interaction	NOUN
fnp-5188	271	14	between	between	ADP
fnp-5188	271	15	neurons	neuron	NOUN
fnp-5188	271	16	and	and	CCONJ
fnp-5188	271	17	vascular	vascular	ADJ
fnp-5188	271	18	cells	cell	NOUN
fnp-5188	271	19	to	to	PART
fnp-5188	271	20	assist	assist	VERB
fnp-5188	271	21	the	the	DET
fnp-5188	271	22	energy	energy	NOUN
fnp-5188	271	23	demand	demand	NOUN
fnp-5188	271	24	of	of	ADP
fnp-5188	271	25	the	the	DET
fnp-5188	271	26	brain	brain	NOUN
fnp-5188	271	27	and	and	CCONJ
fnp-5188	271	28	are	be	AUX
fnp-5188	271	29	an	an	DET
fnp-5188	271	30	inherent	inherent	ADJ
fnp-5188	271	31	part	part	NOUN
fnp-5188	271	32	of	of	ADP
fnp-5188	271	33	the	the	DET
fnp-5188	271	34	neurovascular	neurovascular	ADJ
fnp-5188	271	35	unit	unit	NOUN
fnp-5188	271	36	[	[	X
fnp-5188	271	37	39	39	NUM
fnp-5188	271	38	]	]	PUNCT
fnp-5188	271	39	.	.	PUNCT
fnp-5188	272	1	in	in	ADP
fnp-5188	272	2	the	the	DET
fnp-5188	272	3	healthy	healthy	ADJ
fnp-5188	272	4	brain	brain	NOUN
fnp-5188	272	5	pericyte	pericyte	NOUN
fnp-5188	272	6	coverage	coverage	NOUN
fnp-5188	272	7	is	be	AUX
fnp-5188	272	8	heterogeneous	heterogeneous	ADJ
fnp-5188	272	9	and	and	CCONJ
fnp-5188	272	10	dependent	dependent	ADJ
fnp-5188	272	11	on	on	ADP
fnp-5188	272	12	the	the	DET
fnp-5188	272	13	cell´s	cell´s	NOUN
fnp-5188	272	14	subtype	subtype	NOUN
fnp-5188	272	15	.	.	PUNCT
fnp-5188	273	1	in	in	ADP
fnp-5188	273	2	humans	human	NOUN
fnp-5188	273	3	,	,	PUNCT
fnp-5188	273	4	brain	brain	NOUN
fnp-5188	273	5	pericytes	pericyte	NOUN
fnp-5188	273	6	are	be	AUX
fnp-5188	273	7	classified	classify	VERB
fnp-5188	273	8	into	into	ADP
fnp-5188	273	9	two	two	NUM
fnp-5188	273	10	subtypes	subtype	NOUN
fnp-5188	273	11	with	with	ADP
fnp-5188	273	12	either	either	CCONJ
fnp-5188	273	13	elevated	elevated	ADJ
fnp-5188	273	14	expression	expression	NOUN
fnp-5188	273	15	of	of	ADP
fnp-5188	273	16	transmembrane	transmembrane	ADJ
fnp-5188	273	17	transporters	transporter	NOUN
fnp-5188	273	18	(	(	PUNCT
fnp-5188	273	19	t	t	NOUN
fnp-5188	273	20	pericytes	pericyte	NOUN
fnp-5188	273	21	)	)	PUNCT
fnp-5188	273	22	or	or	CCONJ
fnp-5188	273	23	of	of	ADP
fnp-5188	273	24	extracellular	extracellular	ADJ
fnp-5188	273	25	matrix	matrix	NOUN
fnp-5188	273	26	(	(	PUNCT
fnp-5188	273	27	ecm	ecm	NOUN
fnp-5188	273	28	)	)	PUNCT
fnp-5188	273	29	regulation	regulation	NOUN
fnp-5188	273	30	genes	gene	NOUN
fnp-5188	273	31	(	(	PUNCT
fnp-5188	273	32	m	m	NOUN
fnp-5188	273	33	pericytes	pericyte	NOUN
fnp-5188	273	34	)	)	PUNCT
fnp-5188	273	35	.	.	PUNCT
fnp-5188	274	1	in	in	ADP
fnp-5188	274	2	mice	mouse	NOUN
fnp-5188	274	3	,	,	PUNCT
fnp-5188	274	4	studies	study	NOUN
fnp-5188	274	5	found	find	VERB
fnp-5188	274	6	two	two	NUM
fnp-5188	274	7	major	major	ADJ
fnp-5188	274	8	subtypes	subtype	NOUN
fnp-5188	274	9	of	of	ADP
fnp-5188	274	10	pericytes	pericyte	NOUN
fnp-5188	274	11	which	which	PRON
fnp-5188	274	12	either	either	CCONJ
fnp-5188	274	13	express	express	VERB
fnp-5188	274	14	αsma	αsma	NOUN
fnp-5188	274	15	(	(	PUNCT
fnp-5188	274	16	ensheathing	ensheathe	VERB
fnp-5188	274	17	pericytes	pericyte	NOUN
fnp-5188	274	18	)	)	PUNCT
fnp-5188	274	19	or	or	CCONJ
fnp-5188	274	20	not	not	PART
fnp-5188	274	21	(	(	PUNCT
fnp-5188	274	22	mesh	mesh	NOUN
fnp-5188	274	23	pericytes	pericyte	NOUN
fnp-5188	274	24	)	)	PUNCT
fnp-5188	274	25	,	,	PUNCT
fnp-5188	274	26	the	the	DET
fnp-5188	274	27	latter	latter	ADJ
fnp-5188	274	28	ones	one	NOUN
fnp-5188	274	29	mainly	mainly	ADV
fnp-5188	274	30	located	locate	VERB
fnp-5188	274	31	on	on	ADP
fnp-5188	274	32	small	small	ADJ
fnp-5188	274	33	capillaries	capillary	NOUN
fnp-5188	274	34	[	[	X
fnp-5188	274	35	40	40	NUM
fnp-5188	274	36	,	,	PUNCT
fnp-5188	274	37	41	41	NUM
fnp-5188	274	38	]	]	PUNCT
fnp-5188	274	39	.	.	PUNCT
fnp-5188	275	1	however	however	ADV
fnp-5188	275	2	,	,	PUNCT
fnp-5188	275	3	within	within	ADP
fnp-5188	275	4	gbm	gbm	PROPN
fnp-5188	275	5	,	,	PUNCT
fnp-5188	275	6	the	the	DET
fnp-5188	275	7	tumor	tumor	NOUN
fnp-5188	275	8	vasculature	vasculature	NOUN
fnp-5188	275	9	displays	display	VERB
fnp-5188	275	10	structural	structural	ADJ
fnp-5188	275	11	and	and	CCONJ
fnp-5188	275	12	functional	functional	ADJ
fnp-5188	275	13	abnormalities	abnormality	NOUN
fnp-5188	275	14	with	with	ADP
fnp-5188	275	15	increased	increase	VERB
fnp-5188	275	16	and	and	CCONJ
fnp-5188	275	17	irregular	irregular	ADJ
fnp-5188	275	18	pericyte	pericyte	NOUN
fnp-5188	275	19	coverage	coverage	NOUN
fnp-5188	275	20	,	,	PUNCT
fnp-5188	275	21	that	that	PRON
fnp-5188	275	22	is	be	AUX
fnp-5188	275	23	associated	associate	VERB
fnp-5188	275	24	with	with	ADP
fnp-5188	275	25	worse	bad	ADJ
fnp-5188	275	26	prognosis	prognosis	NOUN
fnp-5188	275	27	and	and	CCONJ
fnp-5188	275	28	accelerated	accelerate	VERB
fnp-5188	275	29	tumor	tumor	NOUN
fnp-5188	275	30	recurrence	recurrence	NOUN
fnp-5188	275	31	[	[	X
fnp-5188	275	32	42	42	NUM
fnp-5188	275	33	]	]	PUNCT
fnp-5188	275	34	.	.	PUNCT
fnp-5188	276	1	in	in	ADP
fnp-5188	276	2	our	our	PRON
fnp-5188	276	3	study	study	NOUN
fnp-5188	276	4	,	,	PUNCT
fnp-5188	276	5	after	after	ADP
fnp-5188	276	6	knocking	knock	VERB
fnp-5188	276	7	out	out	ADP
fnp-5188	276	8	tgf	tgf	PROPN
fnp-5188	276	9	-	-	PUNCT
fnp-5188	276	10	β	β	PROPN
fnp-5188	276	11	in	in	ADP
fnp-5188	276	12	gbm	gbm	PROPN
fnp-5188	276	13	cells	cell	NOUN
fnp-5188	276	14	or	or	CCONJ
fnp-5188	276	15	slug	slug	VERB
fnp-5188	276	16	in	in	ADP
fnp-5188	276	17	vamcs	vamcs	NOUN
fnp-5188	276	18	,	,	PUNCT
fnp-5188	276	19	we	we	PRON
fnp-5188	276	20	saw	see	VERB
fnp-5188	276	21	a	a	DET
fnp-5188	276	22	significant	significant	ADJ
fnp-5188	276	23	reduction	reduction	NOUN
fnp-5188	276	24	of	of	ADP
fnp-5188	276	25	the	the	DET
fnp-5188	276	26	total	total	ADJ
fnp-5188	276	27	number	number	NOUN
fnp-5188	276	28	of	of	ADP
fnp-5188	276	29	gfp+	gfp+	PROPN
fnp-5188	276	30	(	(	PUNCT
fnp-5188	276	31	fig	fig	NOUN
fnp-5188	276	32	.	.	PUNCT
fnp-5188	276	33	3	3	NUM
fnp-5188	276	34	and	and	CCONJ
fnp-5188	276	35	6	6	NUM
fnp-5188	276	36	)	)	PUNCT
fnp-5188	276	37	as	as	ADV
fnp-5188	276	38	well	well	ADV
fnp-5188	276	39	as	as	ADP
fnp-5188	276	40	of	of	ADP
fnp-5188	276	41	αsma+	αsma+	ADJ
fnp-5188	276	42	cells	cell	NOUN
fnp-5188	276	43	(	(	PUNCT
fnp-5188	276	44	fig	fig	NOUN
fnp-5188	276	45	.	.	NOUN
fnp-5188	276	46	4	4	NUM
fnp-5188	276	47	and	and	CCONJ
fnp-5188	276	48	7	7	NUM
fnp-5188	276	49	)	)	PUNCT
fnp-5188	276	50	.	.	PUNCT
fnp-5188	277	1	as	as	ADP
fnp-5188	277	2	in	in	ADP
fnp-5188	277	3	our	our	PRON
fnp-5188	277	4	mouse	mouse	NOUN
fnp-5188	277	5	model	model	NOUN
fnp-5188	277	6	,	,	PUNCT
fnp-5188	277	7	we	we	PRON
fnp-5188	277	8	can	can	AUX
fnp-5188	277	9	not	not	PART
fnp-5188	277	10	distinguish	distinguish	VERB
fnp-5188	277	11	between	between	ADP
fnp-5188	277	12	ensheathing	ensheathing	NOUN
fnp-5188	277	13	and	and	CCONJ
fnp-5188	277	14	mesh	mesh	NOUN
fnp-5188	277	15	pericytes	pericyte	NOUN
fnp-5188	277	16	,	,	PUNCT
fnp-5188	277	17	we	we	PRON
fnp-5188	277	18	therefore	therefore	ADV
fnp-5188	277	19	can	can	AUX
fnp-5188	277	20	not	not	PART
fnp-5188	277	21	clarify	clarify	VERB
fnp-5188	277	22	to	to	ADP
fnp-5188	277	23	the	the	DET
fnp-5188	277	24	end	end	NOUN
fnp-5188	277	25	whether	whether	SCONJ
fnp-5188	277	26	lesser	less	ADJ
fnp-5188	277	27	numbers	number	NOUN
fnp-5188	277	28	of	of	ADP
fnp-5188	277	29	the	the	DET
fnp-5188	277	30	one	one	NUM
fnp-5188	277	31	or	or	CCONJ
fnp-5188	277	32	other	other	ADJ
fnp-5188	277	33	subtype	subtype	NOUN
fnp-5188	277	34	of	of	ADP
fnp-5188	277	35	pericytes	pericyte	NOUN
fnp-5188	277	36	were	be	AUX
fnp-5188	277	37	observed	observe	VERB
fnp-5188	277	38	.	.	PUNCT
fnp-5188	278	1	one	one	NUM
fnp-5188	278	2	further	further	ADJ
fnp-5188	278	3	limitation	limitation	NOUN
fnp-5188	278	4	of	of	ADP
fnp-5188	278	5	the	the	DET
fnp-5188	278	6	rgs5	rgs5	ADJ
fnp-5188	278	7	-	-	PUNCT
fnp-5188	278	8	gfp	gfp	PROPN
fnp-5188	278	9	mouse	mouse	NOUN
fnp-5188	278	10	model	model	NOUN
fnp-5188	278	11	we	we	PRON
fnp-5188	278	12	used	use	VERB
fnp-5188	278	13	in	in	ADP
fnp-5188	278	14	our	our	PRON
fnp-5188	278	15	study	study	NOUN
fnp-5188	278	16	is	be	AUX
fnp-5188	278	17	that	that	SCONJ
fnp-5188	278	18	we	we	PRON
fnp-5188	278	19	can	can	AUX
fnp-5188	278	20	not	not	PART
fnp-5188	278	21	clearly	clearly	ADV
fnp-5188	278	22	distinguish	distinguish	VERB
fnp-5188	278	23	between	between	ADP
fnp-5188	278	24	pericytes	pericyte	NOUN
fnp-5188	278	25	and	and	CCONJ
fnp-5188	278	26	vascular	vascular	ADJ
fnp-5188	278	27	smooth	smooth	ADJ
fnp-5188	278	28	muscle	muscle	NOUN
fnp-5188	278	29	cells	cell	NOUN
fnp-5188	278	30	(	(	PUNCT
fnp-5188	278	31	vsmc	vsmc	NOUN
fnp-5188	278	32	)	)	PUNCT
fnp-5188	278	33	as	as	SCONJ
fnp-5188	278	34	also	also	ADV
fnp-5188	278	35	vsmcs	vsmcs	ADV
fnp-5188	278	36	express	express	VERB
fnp-5188	278	37	rgs5	rgs5	NOUN
fnp-5188	278	38	and	and	CCONJ
fnp-5188	278	39	might	might	AUX
fnp-5188	278	40	therefore	therefore	ADV
fnp-5188	278	41	be	be	AUX
fnp-5188	278	42	positive	positive	ADJ
fnp-5188	278	43	for	for	ADP
fnp-5188	278	44	gfp	gfp	PROPN
fnp-5188	278	45	[	[	X
fnp-5188	278	46	41	41	NUM
fnp-5188	278	47	]	]	PUNCT
fnp-5188	278	48	.	.	PUNCT
fnp-5188	279	1	in	in	ADP
fnp-5188	279	2	gbm	gbm	PROPN
fnp-5188	279	3	,	,	PUNCT
fnp-5188	279	4	there	there	PRON
fnp-5188	279	5	is	be	VERB
fnp-5188	279	6	a	a	DET
fnp-5188	279	7	pathogenic	pathogenic	ADJ
fnp-5188	279	8	crosstalk	crosstalk	NOUN
fnp-5188	279	9	between	between	ADP
fnp-5188	279	10	tumor	tumor	NOUN
fnp-5188	279	11	cells	cell	NOUN
fnp-5188	279	12	and	and	CCONJ
fnp-5188	279	13	pericytes	pericyte	NOUN
fnp-5188	279	14	.	.	PUNCT
fnp-5188	280	1	gbm	gbm	NOUN
fnp-5188	280	2	cells	cell	NOUN
fnp-5188	280	3	modify	modify	VERB
fnp-5188	280	4	the	the	DET
fnp-5188	280	5	contractile	contractile	ADJ
fnp-5188	280	6	activity	activity	NOUN
fnp-5188	280	7	of	of	ADP
fnp-5188	280	8	pericytes	pericyte	NOUN
fnp-5188	280	9	,	,	PUNCT
fnp-5188	280	10	resulting	result	VERB
fnp-5188	280	11	in	in	ADP
fnp-5188	280	12	the	the	DET
fnp-5188	280	13	cooption	cooption	NOUN
fnp-5188	280	14	of	of	ADP
fnp-5188	280	15	existing	exist	VERB
fnp-5188	280	16	blood	blood	NOUN
fnp-5188	280	17	vessels	vessel	NOUN
fnp-5188	280	18	,	,	PUNCT
fnp-5188	280	19	by	by	ADP
fnp-5188	280	20	this	this	PRON
fnp-5188	280	21	supporting	support	VERB
fnp-5188	280	22	the	the	DET
fnp-5188	280	23	expansion	expansion	NOUN
fnp-5188	280	24	of	of	ADP
fnp-5188	280	25	the	the	DET
fnp-5188	280	26	tumor	tumor	NOUN
fnp-5188	280	27	[	[	X
fnp-5188	280	28	43	43	NUM
fnp-5188	280	29	]	]	PUNCT
fnp-5188	280	30	.	.	PUNCT
fnp-5188	281	1	in	in	ADP
fnp-5188	281	2	addition	addition	NOUN
fnp-5188	281	3	,	,	PUNCT
fnp-5188	281	4	glioma	glioma	NOUN
fnp-5188	281	5	vessel	vessel	NOUN
fnp-5188	281	6	associated	associate	VERB
fnp-5188	281	7	pericytes	pericyte	NOUN
fnp-5188	281	8	support	support	VERB
fnp-5188	281	9	tumor	tumor	NOUN
fnp-5188	281	10	growth	growth	NOUN
fnp-5188	281	11	by	by	ADP
fnp-5188	281	12	the	the	DET
fnp-5188	281	13	induction	induction	NOUN
fnp-5188	281	14	of	of	ADP
fnp-5188	281	15	an	an	DET
fnp-5188	281	16	immunosuppressive	immunosuppressive	ADJ
fnp-5188	281	17	microenvironment	microenvironment	NOUN
fnp-5188	281	18	[	[	X
fnp-5188	281	19	5	5	NUM
fnp-5188	281	20	]	]	PUNCT
fnp-5188	281	21	.	.	PUNCT
fnp-5188	282	1	due	due	ADP
fnp-5188	282	2	to	to	ADP
fnp-5188	282	3	these	these	DET
fnp-5188	282	4	tumor	tumor	NOUN
fnp-5188	282	5	promoting	promote	VERB
fnp-5188	282	6	function	function	NOUN
fnp-5188	282	7	of	of	ADP
fnp-5188	282	8	pericytes	pericyte	NOUN
fnp-5188	282	9	,	,	PUNCT
fnp-5188	282	10	these	these	DET
fnp-5188	282	11	cells	cell	NOUN
fnp-5188	282	12	have	have	AUX
fnp-5188	282	13	been	be	AUX
fnp-5188	282	14	recently	recently	ADV
fnp-5188	282	15	identified	identify	VERB
fnp-5188	282	16	as	as	ADP
fnp-5188	282	17	novel	novel	ADJ
fnp-5188	282	18	targets	target	NOUN
fnp-5188	282	19	for	for	ADP
fnp-5188	282	20	the	the	DET
fnp-5188	282	21	treatment	treatment	NOUN
fnp-5188	282	22	of	of	ADP
fnp-5188	282	23	gbm	gbm	NOUN
fnp-5188	282	24	[	[	X
fnp-5188	282	25	44	44	NUM
fnp-5188	282	26	]	]	PUNCT
fnp-5188	282	27	.	.	PUNCT
fnp-5188	283	1	in	in	ADP
fnp-5188	283	2	our	our	PRON
fnp-5188	283	3	recent	recent	ADJ
fnp-5188	283	4	studies	study	NOUN
fnp-5188	283	5	we	we	PRON
fnp-5188	283	6	found	find	VERB
fnp-5188	283	7	that	that	SCONJ
fnp-5188	283	8	vamcs	vamcs	NOUN
fnp-5188	283	9	express	express	VERB
fnp-5188	283	10	emt	emt	NOUN
fnp-5188	283	11	-	-	PUNCT
fnp-5188	283	12	transcription	transcription	NOUN
fnp-5188	283	13	factors	factor	NOUN
fnp-5188	283	14	like	like	ADP
fnp-5188	283	15	slug	slug	NOUN
fnp-5188	283	16	,	,	PUNCT
fnp-5188	283	17	indicating	indicate	VERB
fnp-5188	283	18	that	that	SCONJ
fnp-5188	283	19	,	,	PUNCT
fnp-5188	283	20	induced	induce	VERB
fnp-5188	283	21	by	by	ADP
fnp-5188	283	22	gbm	gbm	PROPN
fnp-5188	283	23	cell	cell	NOUN
fnp-5188	283	24	secreted	secrete	VERB
fnp-5188	283	25	tgf	tgf	PROPN
fnp-5188	283	26	-	-	PUNCT
fnp-5188	283	27	β	β	NOUN
fnp-5188	283	28	,	,	PUNCT
fnp-5188	283	29	these	these	DET
fnp-5188	283	30	cells	cell	NOUN
fnp-5188	283	31	undergo	undergo	VERB
fnp-5188	283	32	an	an	DET
fnp-5188	283	33	emt	emt	NOUN
fnp-5188	283	34	-	-	PUNCT
fnp-5188	283	35	like	like	ADJ
fnp-5188	283	36	"	"	PUNCT
fnp-5188	283	37	activation	activation	NOUN
fnp-5188	283	38	"	"	PUNCT
fnp-5188	283	39	process	process	NOUN
fnp-5188	283	40	[	[	X
fnp-5188	283	41	15	15	NUM
fnp-5188	283	42	]	]	PUNCT
fnp-5188	283	43	.	.	PUNCT
fnp-5188	284	1	this	this	DET
fnp-5188	284	2	observation	observation	NOUN
fnp-5188	284	3	was	be	AUX
fnp-5188	284	4	underpinned	underpin	VERB
fnp-5188	284	5	by	by	ADP
fnp-5188	284	6	our	our	PRON
fnp-5188	284	7	data	datum	NOUN
fnp-5188	284	8	that	that	PRON
fnp-5188	284	9	in	in	ADP
fnp-5188	284	10	vitro	vitro	X
fnp-5188	284	11	tgf	tgf	PROPN
fnp-5188	284	12	-	-	PUNCT
fnp-5188	284	13	β	β	NOUN
fnp-5188	284	14	treatment	treatment	NOUN
fnp-5188	284	15	of	of	ADP
fnp-5188	284	16	human	human	ADJ
fnp-5188	284	17	primary	primary	ADJ
fnp-5188	284	18	microvascular	microvascular	NOUN
fnp-5188	284	19	pericytes	pericyte	NOUN
fnp-5188	284	20	induced	induce	VERB
fnp-5188	284	21	proliferation	proliferation	NOUN
fnp-5188	284	22	,	,	PUNCT
fnp-5188	284	23	cell	cell	NOUN
fnp-5188	284	24	motility	motility	NOUN
fnp-5188	284	25	and	and	CCONJ
fnp-5188	284	26	morphological	morphological	ADJ
fnp-5188	284	27	changes	change	NOUN
fnp-5188	284	28	[	[	X
fnp-5188	284	29	16	16	NUM
fnp-5188	284	30	]	]	PUNCT
fnp-5188	284	31	and	and	CCONJ
fnp-5188	284	32	mitigates	mitigate	VERB
fnp-5188	284	33	the	the	DET
fnp-5188	284	34	integrity	integrity	NOUN
fnp-5188	284	35	to	to	ADP
fnp-5188	284	36	the	the	DET
fnp-5188	284	37	bbb	bbb	PROPN
fnp-5188	285	1	[	[	X
fnp-5188	285	2	17	17	NUM
fnp-5188	285	3	]	]	PUNCT
fnp-5188	285	4	.	.	PUNCT
fnp-5188	286	1	in	in	ADP
fnp-5188	286	2	our	our	PRON
fnp-5188	286	3	study	study	NOUN
fnp-5188	286	4	,	,	PUNCT
fnp-5188	286	5	we	we	PRON
fnp-5188	286	6	were	be	AUX
fnp-5188	286	7	interested	interested	ADJ
fnp-5188	286	8	whether	whether	SCONJ
fnp-5188	286	9	this	this	DET
fnp-5188	286	10	emt	emt	NOUN
fnp-5188	286	11	-	-	PUNCT
fnp-5188	286	12	like	like	ADJ
fnp-5188	286	13	"	"	PUNCT
fnp-5188	286	14	activation	activation	NOUN
fnp-5188	286	15	"	"	PUNCT
fnp-5188	286	16	of	of	ADP
fnp-5188	286	17	glioma	glioma	NOUN
fnp-5188	286	18	-	-	PUNCT
fnp-5188	286	19	associated	associate	VERB
fnp-5188	286	20	vamcs	vamcs	NOUN
fnp-5188	286	21	might	might	AUX
fnp-5188	286	22	also	also	ADV
fnp-5188	286	23	be	be	AUX
fnp-5188	286	24	associated	associate	VERB
fnp-5188	286	25	with	with	ADP
fnp-5188	286	26	vascular	vascular	ADJ
fnp-5188	286	27	alterations	alteration	NOUN
fnp-5188	286	28	in	in	ADP
fnp-5188	286	29	vivo	vivo	NOUN
fnp-5188	286	30	.	.	PUNCT
fnp-5188	287	1	in	in	ADP
fnp-5188	287	2	a	a	DET
fnp-5188	287	3	syngeneic	syngeneic	NOUN
fnp-5188	287	4	mouse	mouse	NOUN
fnp-5188	287	5	gbm	gbm	PROPN
fnp-5188	287	6	model	model	NOUN
fnp-5188	287	7	that	that	PRON
fnp-5188	287	8	allows	allow	VERB
fnp-5188	287	9	to	to	PART
fnp-5188	287	10	track	track	VERB
fnp-5188	287	11	both	both	DET
fnp-5188	287	12	gbm	gbm	NOUN
fnp-5188	287	13	cells	cell	NOUN
fnp-5188	287	14	as	as	ADV
fnp-5188	287	15	well	well	ADV
fnp-5188	287	16	as	as	ADP
fnp-5188	287	17	rgs5	rgs5	VERB
fnp-5188	287	18	positive	positive	ADJ
fnp-5188	287	19	vamcs	vamcs	NOUN
fnp-5188	287	20	,	,	PUNCT
fnp-5188	287	21	we	we	PRON
fnp-5188	287	22	prevented	prevent	VERB
fnp-5188	287	23	the	the	DET
fnp-5188	287	24	induction	induction	NOUN
fnp-5188	287	25	of	of	ADP
fnp-5188	287	26	this	this	DET
fnp-5188	287	27	emt	emt	PROPN
fnp-5188	287	28	-like	-like	ADJ
fnp-5188	287	29	activation	activation	NOUN
fnp-5188	287	30	by	by	ADP
fnp-5188	287	31	knocking	knock	VERB
fnp-5188	287	32	out	out	ADP
fnp-5188	287	33	tgf	tgf	PROPN
fnp-5188	287	34	-	-	PUNCT
fnp-5188	287	35	β	β	PROPN
fnp-5188	287	36	in	in	ADP
fnp-5188	287	37	the	the	DET
fnp-5188	287	38	tumor	tumor	NOUN
fnp-5188	287	39	cells	cell	NOUN
fnp-5188	287	40	(	(	PUNCT
fnp-5188	287	41	suppl	suppl	PROPN
fnp-5188	287	42	.	.	PUNCT
fnp-5188	287	43	fig	fig	NOUN
fnp-5188	287	44	.	.	PUNCT
fnp-5188	288	1	1	1	NUM
fnp-5188	288	2	)	)	PUNCT
fnp-5188	288	3	on	on	ADP
fnp-5188	288	4	the	the	DET
fnp-5188	288	5	one	one	NUM
fnp-5188	288	6	hand	hand	NOUN
fnp-5188	288	7	,	,	PUNCT
fnp-5188	288	8	or	or	CCONJ
fnp-5188	288	9	by	by	ADP
fnp-5188	288	10	knocking	knock	VERB
fnp-5188	288	11	out	out	ADP
fnp-5188	288	12	slug	slug	NOUN
fnp-5188	288	13	in	in	ADP
fnp-5188	288	14	tumor	tumor	NOUN
fnp-5188	288	15	adjacent	adjacent	ADJ
fnp-5188	288	16	,	,	PUNCT
fnp-5188	288	17	rgs5	rgs5	VERB
fnp-5188	288	18	expressing	express	VERB
fnp-5188	288	19	vamcs	vamcs	NOUN
fnp-5188	288	20	(	(	PUNCT
fnp-5188	289	1	suppl	suppl	PROPN
fnp-5188	289	2	.	.	PUNCT
fnp-5188	289	3	fig	fig	NOUN
fnp-5188	289	4	.	.	PUNCT
fnp-5188	290	1	7	7	NUM
fnp-5188	290	2	)	)	PUNCT
fnp-5188	290	3	on	on	ADP
fnp-5188	290	4	the	the	DET
fnp-5188	290	5	other	other	ADJ
fnp-5188	290	6	.	.	PUNCT
fnp-5188	291	1	as	as	SCONJ
fnp-5188	291	2	tumor	tumor	NOUN
fnp-5188	291	3	angiogenesis	angiogenesis	NOUN
fnp-5188	291	4	is	be	AUX
fnp-5188	291	5	correlated	correlate	VERB
fnp-5188	291	6	to	to	ADP
fnp-5188	291	7	tumor	tumor	NOUN
fnp-5188	291	8	size	size	NOUN
fnp-5188	291	9	and	and	CCONJ
fnp-5188	291	10	growth	growth	NOUN
fnp-5188	291	11	,	,	PUNCT
fnp-5188	291	12	we	we	PRON
fnp-5188	291	13	firstly	firstly	ADV
fnp-5188	291	14	determined	determine	VERB
fnp-5188	291	15	the	the	DET
fnp-5188	291	16	growth	growth	NOUN
fnp-5188	291	17	rate	rate	NOUN
fnp-5188	291	18	of	of	ADP
fnp-5188	291	19	par	par	NOUN
fnp-5188	291	20	and	and	CCONJ
fnp-5188	291	21	tgf	tgf	PROPN
fnp-5188	291	22	-	-	PUNCT
fnp-5188	291	23	β	β	NOUN
fnp-5188	291	24	-	-	PUNCT
fnp-5188	291	25	ko	ko	ADJ
fnp-5188	291	26	cells	cell	NOUN
fnp-5188	291	27	and	and	CCONJ
fnp-5188	291	28	tumors	tumor	NOUN
fnp-5188	291	29	to	to	PART
fnp-5188	291	30	avoid	avoid	VERB
fnp-5188	291	31	artifacts	artifact	NOUN
fnp-5188	291	32	generated	generate	VERB
fnp-5188	291	33	by	by	ADP
fnp-5188	291	34	different	different	ADJ
fnp-5188	291	35	sizes	size	NOUN
fnp-5188	291	36	of	of	ADP
fnp-5188	291	37	par	par	NOUN
fnp-5188	291	38	and	and	CCONJ
fnp-5188	291	39	tgf	tgf	PROPN
fnp-5188	291	40	-	-	PUNCT
fnp-5188	291	41	β	β	NOUN
fnp-5188	291	42	-	-	PUNCT
fnp-5188	291	43	ko	ko	PROPN
fnp-5188	291	44	gbms	gbms	NOUN
fnp-5188	291	45	.	.	PUNCT
fnp-5188	292	1	after	after	ADP
fnp-5188	292	2	knocking	knock	VERB
fnp-5188	292	3	out	out	ADP
fnp-5188	292	4	tgf	tgf	PROPN
fnp-5188	292	5	-	-	PUNCT
fnp-5188	292	6	β	β	PROPN
fnp-5188	292	7	in	in	ADP
fnp-5188	292	8	gl261	gl261	PROPN
fnp-5188	292	9	cells	cell	NOUN
fnp-5188	292	10	these	these	DET
fnp-5188	292	11	cells	cell	NOUN
fnp-5188	292	12	showed	show	VERB
fnp-5188	292	13	a	a	DET
fnp-5188	292	14	diminished	diminished	ADJ
fnp-5188	292	15	proliferation	proliferation	NOUN
fnp-5188	292	16	rate	rate	NOUN
fnp-5188	292	17	and	and	CCONJ
fnp-5188	292	18	cell	cell	NOUN
fnp-5188	292	19	motility	motility	NOUN
fnp-5188	292	20	in	in	ADP
fnp-5188	292	21	vitro	vitro	X
fnp-5188	292	22	(	(	PUNCT
fnp-5188	292	23	fig	fig	NOUN
fnp-5188	292	24	.	.	NOUN
fnp-5188	292	25	1	1	NUM
fnp-5188	292	26	)	)	PUNCT
fnp-5188	292	27	,	,	PUNCT
fnp-5188	292	28	and	and	CCONJ
fnp-5188	292	29	also	also	ADV
fnp-5188	292	30	a	a	DET
fnp-5188	292	31	delayed	delay	VERB
fnp-5188	292	32	tumor	tumor	NOUN
fnp-5188	292	33	growth	growth	NOUN
fnp-5188	292	34	in	in	ADP
fnp-5188	292	35	vivo	vivo	NOUN
fnp-5188	292	36	.	.	PUNCT
fnp-5188	293	1	however	however	ADV
fnp-5188	293	2	,	,	PUNCT
fnp-5188	293	3	by	by	ADP
fnp-5188	293	4	using	use	VERB
fnp-5188	293	5	mri	mri	NOUN
fnp-5188	293	6	we	we	PRON
fnp-5188	293	7	determined	determine	VERB
fnp-5188	293	8	the	the	DET
fnp-5188	293	9	time	time	NOUN
fnp-5188	293	10	point	point	NOUN
fnp-5188	293	11	the	the	DET
fnp-5188	293	12	tumors	tumor	NOUN
fnp-5188	293	13	reached	reach	VERB
fnp-5188	293	14	a	a	DET
fnp-5188	293	15	size	size	NOUN
fnp-5188	293	16	of	of	ADP
fnp-5188	293	17	1.5	1.5	NUM
fnp-5188	293	18	to	to	PART
fnp-5188	293	19	3	3	NUM
fnp-5188	293	20	 	 	SPACE
fnp-5188	293	21	mm	mm	PROPN
fnp-5188	293	22	in	in	ADP
fnp-5188	293	23	diameter	diameter	NOUN
fnp-5188	293	24	,	,	PUNCT
fnp-5188	293	25	and	and	CCONJ
fnp-5188	293	26	therefore	therefore	ADV
fnp-5188	293	27	material	material	NOUN
fnp-5188	293	28	for	for	ADP
fnp-5188	293	29	analyses	analysis	NOUN
fnp-5188	293	30	was	be	AUX
fnp-5188	293	31	collected	collect	VERB
fnp-5188	293	32	when	when	SCONJ
fnp-5188	293	33	tumors	tumor	NOUN
fnp-5188	293	34	were	be	AUX
fnp-5188	293	35	in	in	ADP
fnp-5188	293	36	that	that	DET
fnp-5188	293	37	range	range	NOUN
fnp-5188	293	38	of	of	ADP
fnp-5188	293	39	size	size	NOUN
fnp-5188	293	40	,	,	PUNCT
fnp-5188	293	41	which	which	PRON
fnp-5188	293	42	was	be	AUX
fnp-5188	293	43	also	also	ADV
fnp-5188	293	44	retrospectively	retrospectively	ADV
fnp-5188	293	45	validated	validate	VERB
fnp-5188	293	46	in	in	ADP
fnp-5188	293	47	the	the	DET
fnp-5188	293	48	collected	collect	VERB
fnp-5188	293	49	material	material	NOUN
fnp-5188	293	50	(	(	PUNCT
fnp-5188	293	51	suppl	suppl	PROPN
fnp-5188	293	52	.	.	PUNCT
fnp-5188	293	53	fig	fig	NOUN
fnp-5188	293	54	.	.	PUNCT
fnp-5188	294	1	3	3	NUM
fnp-5188	294	2	)	)	PUNCT
fnp-5188	294	3	.	.	PUNCT
fnp-5188	295	1	nevertheless	nevertheless	ADV
fnp-5188	295	2	,	,	PUNCT
fnp-5188	295	3	this	this	PRON
fnp-5188	295	4	might	might	AUX
fnp-5188	295	5	be	be	AUX
fnp-5188	295	6	a	a	DET
fnp-5188	295	7	limitation	limitation	NOUN
fnp-5188	295	8	of	of	ADP
fnp-5188	295	9	this	this	DET
fnp-5188	295	10	study	study	NOUN
fnp-5188	295	11	because	because	SCONJ
fnp-5188	295	12	even	even	ADV
fnp-5188	295	13	if	if	SCONJ
fnp-5188	295	14	we	we	PRON
fnp-5188	295	15	analyzed	analyze	VERB
fnp-5188	295	16	the	the	DET
fnp-5188	295	17	vascular	vascular	ADJ
fnp-5188	295	18	structure	structure	NOUN
fnp-5188	295	19	of	of	ADP
fnp-5188	295	20	gbms	gbms	NOUN
fnp-5188	295	21	when	when	SCONJ
fnp-5188	295	22	par	par	NOUN
fnp-5188	295	23	and	and	CCONJ
fnp-5188	295	24	tgf	tgf	PROPN
fnp-5188	295	25	-	-	PUNCT
fnp-5188	295	26	β	β	NOUN
fnp-5188	295	27	-	-	PUNCT
fnp-5188	295	28	ko	ko	ADJ
fnp-5188	295	29	tumor	tumor	NOUN
fnp-5188	295	30	reached	reach	VERB
fnp-5188	295	31	the	the	DET
fnp-5188	295	32	same	same	ADJ
fnp-5188	295	33	size	size	NOUN
fnp-5188	295	34	,	,	PUNCT
fnp-5188	295	35	we	we	PRON
fnp-5188	295	36	can	can	AUX
fnp-5188	295	37	not	not	PART
fnp-5188	295	38	completely	completely	ADV
fnp-5188	295	39	exclude	exclude	VERB
fnp-5188	295	40	that	that	SCONJ
fnp-5188	295	41	a	a	DET
fnp-5188	295	42	delayed	delay	VERB
fnp-5188	295	43	tumor	tumor	NOUN
fnp-5188	295	44	growth	growth	NOUN
fnp-5188	295	45	also	also	ADV
fnp-5188	295	46	influences	influence	VERB
fnp-5188	295	47	its	its	PRON
fnp-5188	295	48	vascularity	vascularity	NOUN
fnp-5188	295	49	.	.	PUNCT
fnp-5188	296	1	for	for	ADP
fnp-5188	296	2	the	the	DET
fnp-5188	296	3	slug	slug	NOUN
fnp-5188	296	4	-	-	PUNCT
fnp-5188	296	5	ko	ko	PROPN
fnp-5188	296	6	in	in	ADP
fnp-5188	296	7	glioma	glioma	NOUN
fnp-5188	296	8	-	-	PUNCT
fnp-5188	296	9	associated	associate	VERB
fnp-5188	296	10	vamcs	vamcs	NOUN
fnp-5188	296	11	and	and	CCONJ
fnp-5188	296	12	to	to	PART
fnp-5188	296	13	avoid	avoid	VERB
fnp-5188	296	14	artifacts	artifact	NOUN
fnp-5188	296	15	that	that	PRON
fnp-5188	296	16	might	might	AUX
fnp-5188	296	17	be	be	AUX
fnp-5188	296	18	induced	induce	VERB
fnp-5188	296	19	by	by	ADP
fnp-5188	296	20	knocking	knock	VERB
fnp-5188	296	21	out	out	ADP
fnp-5188	296	22	slug	slug	NOUN
fnp-5188	296	23	in	in	ADP
fnp-5188	296	24	other	other	ADJ
fnp-5188	296	25	cell	cell	NOUN
fnp-5188	296	26	types	type	NOUN
fnp-5188	296	27	within	within	ADP
fnp-5188	296	28	the	the	DET
fnp-5188	296	29	tumor	tumor	NOUN
fnp-5188	296	30	area	area	NOUN
fnp-5188	296	31	,	,	PUNCT
fnp-5188	296	32	we	we	PRON
fnp-5188	296	33	examined	examine	VERB
fnp-5188	296	34	the	the	DET
fnp-5188	296	35	expression	expression	NOUN
fnp-5188	296	36	of	of	ADP
fnp-5188	296	37	slug	slug	NOUN
fnp-5188	296	38	in	in	ADP
fnp-5188	296	39	the	the	DET
fnp-5188	296	40	tumor	tumor	NOUN
fnp-5188	296	41	area	area	NOUN
fnp-5188	296	42	of	of	ADP
fnp-5188	296	43	par	par	PROPN
fnp-5188	296	44	gbms	gbms	PROPN
fnp-5188	296	45	and	and	CCONJ
fnp-5188	296	46	found	find	VERB
fnp-5188	296	47	it	it	PRON
fnp-5188	296	48	to	to	PART
fnp-5188	296	49	be	be	AUX
fnp-5188	296	50	colocalized	colocalize	VERB
fnp-5188	296	51	invariably	invariably	ADV
fnp-5188	296	52	with	with	ADP
fnp-5188	296	53	gfp	gfp	PROPN
fnp-5188	296	54	,	,	PUNCT
fnp-5188	296	55	but	but	CCONJ
fnp-5188	296	56	not	not	PART
fnp-5188	296	57	with	with	ADP
fnp-5188	296	58	the	the	DET
fnp-5188	296	59	tumor	tumor	NOUN
fnp-5188	296	60	cells	cell	NOUN
fnp-5188	296	61	.	.	PUNCT
fnp-5188	297	1	in	in	ADP
fnp-5188	297	2	contrast	contrast	NOUN
fnp-5188	297	3	,	,	PUNCT
fnp-5188	297	4	slug	slug	NOUN
fnp-5188	297	5	was	be	AUX
fnp-5188	297	6	absent	absent	ADJ
fnp-5188	297	7	in	in	ADP
fnp-5188	297	8	gfp+	gfp+	PROPN
fnp-5188	297	9	vamcs	vamcs	NOUN
fnp-5188	297	10	in	in	ADP
fnp-5188	297	11	those	those	DET
fnp-5188	297	12	mice	mouse	NOUN
fnp-5188	297	13	we	we	PRON
fnp-5188	297	14	injected	inject	VERB
fnp-5188	297	15	with	with	ADP
fnp-5188	297	16	lenti	lenti	ADJ
fnp-5188	297	17	-	-	ADJ
fnp-5188	297	18	slug	slug	ADJ
fnp-5188	297	19	-	-	PUNCT
fnp-5188	297	20	ko	ko	PROPN
fnp-5188	297	21	(	(	PUNCT
fnp-5188	297	22	suppl	suppl	PROPN
fnp-5188	297	23	.	.	PUNCT
fnp-5188	297	24	fig	fig	NOUN
fnp-5188	297	25	.	.	PUNCT
fnp-5188	298	1	7	7	NUM
fnp-5188	298	2	)	)	PUNCT
fnp-5188	298	3	.	.	PUNCT
fnp-5188	299	1	however	however	ADV
fnp-5188	299	2	,	,	PUNCT
fnp-5188	299	3	even	even	ADV
fnp-5188	299	4	if	if	SCONJ
fnp-5188	299	5	cas9	cas9	NOUN
fnp-5188	299	6	expression	expression	NOUN
fnp-5188	299	7	in	in	ADP
fnp-5188	299	8	lenti	lenti	ADJ
fnp-5188	299	9	-	-	ADJ
fnp-5188	299	10	slug	slug	NOUN
fnp-5188	299	11	-	-	PUNCT
fnp-5188	299	12	ko	ko	PROPN
fnp-5188	299	13	was	be	AUX
fnp-5188	299	14	driven	drive	VERB
fnp-5188	299	15	by	by	ADP
fnp-5188	299	16	the	the	DET
fnp-5188	299	17	rgs5	rgs5	PROPN
fnp-5188	299	18	minimal	minimal	ADJ
fnp-5188	299	19	promoter	promoter	NOUN
fnp-5188	299	20	,	,	PUNCT
fnp-5188	299	21	which	which	PRON
fnp-5188	299	22	significantly	significantly	ADV
fnp-5188	299	23	induced	induce	VERB
fnp-5188	299	24	luciferase	luciferase	ADJ
fnp-5188	299	25	activity	activity	NOUN
fnp-5188	299	26	in	in	ADP
fnp-5188	299	27	mbvps	mbvps	PROPN
fnp-5188	299	28	,	,	PUNCT
fnp-5188	299	29	but	but	CCONJ
fnp-5188	299	30	not	not	PART
fnp-5188	299	31	in	in	ADP
fnp-5188	299	32	gl261	gl261	PROPN
fnp-5188	299	33	gbm	gbm	NOUN
fnp-5188	299	34	cells	cell	NOUN
fnp-5188	299	35	(	(	PUNCT
fnp-5188	299	36	fig	fig	NOUN
fnp-5188	299	37	.	.	NOUN
fnp-5188	300	1	2	2	X
fnp-5188	300	2	)	)	PUNCT
fnp-5188	300	3	we	we	PRON
fnp-5188	300	4	can	can	AUX
fnp-5188	300	5	not	not	PART
fnp-5188	300	6	completely	completely	ADV
fnp-5188	300	7	exclude	exclude	VERB
fnp-5188	300	8	that	that	DET
fnp-5188	300	9	minimal	minimal	ADJ
fnp-5188	300	10	slug	slug	NOUN
fnp-5188	300	11	levels	level	NOUN
fnp-5188	300	12	(	(	PUNCT
fnp-5188	300	13	below	below	ADP
fnp-5188	300	14	the	the	DET
fnp-5188	300	15	immunofluorescence	immunofluorescence	NOUN
fnp-5188	300	16	detection	detection	NOUN
fnp-5188	300	17	limit	limit	NOUN
fnp-5188	300	18	)	)	PUNCT
fnp-5188	300	19	in	in	ADP
fnp-5188	300	20	other	other	ADJ
fnp-5188	300	21	cell	cell	NOUN
fnp-5188	300	22	types	type	NOUN
fnp-5188	300	23	will	will	AUX
fnp-5188	300	24	be	be	AUX
fnp-5188	300	25	also	also	ADV
fnp-5188	300	26	reduced	reduce	VERB
fnp-5188	300	27	by	by	ADP
fnp-5188	300	28	intrastriatally	intrastriatally	ADV
fnp-5188	300	29	applied	apply	VERB
fnp-5188	300	30	lenti	lenti	ADJ
fnp-5188	300	31	-	-	ADJ
fnp-5188	300	32	slug	slug	ADJ
fnp-5188	300	33	-	-	PUNCT
fnp-5188	300	34	ko	ko	PROPN
fnp-5188	300	35	.	.	PUNCT
fnp-5188	301	1	previous	previous	ADJ
fnp-5188	301	2	in	in	ADP
fnp-5188	301	3	vitro	vitro	X
fnp-5188	301	4	data	datum	NOUN
fnp-5188	301	5	showed	show	VERB
fnp-5188	301	6	an	an	DET
fnp-5188	301	7	upregulation	upregulation	NOUN
fnp-5188	301	8	of	of	ADP
fnp-5188	301	9	αsma	αsma	NOUN
fnp-5188	301	10	and	and	CCONJ
fnp-5188	301	11	pdgfrβ	pdgfrβ	NOUN
fnp-5188	301	12	in	in	ADP
fnp-5188	301	13	hbvps	hbvps	NOUN
fnp-5188	301	14	in	in	ADP
fnp-5188	301	15	response	response	NOUN
fnp-5188	301	16	to	to	ADP
fnp-5188	301	17	tgf	tgf	PROPN
fnp-5188	301	18	-	-	PUNCT
fnp-5188	301	19	β	β	PROPN
fnp-5188	301	20	or	or	CCONJ
fnp-5188	301	21	conditioned	condition	VERB
fnp-5188	301	22	medium	medium	NOUN
fnp-5188	301	23	from	from	ADP
fnp-5188	301	24	gbm	gbm	NOUN
fnp-5188	301	25	cells	cell	NOUN
fnp-5188	301	26	in	in	ADP
fnp-5188	301	27	vitro	vitro	X
fnp-5188	301	28	as	as	ADV
fnp-5188	301	29	well	well	ADV
fnp-5188	301	30	as	as	ADP
fnp-5188	301	31	a	a	DET
fnp-5188	301	32	correlation	correlation	NOUN
fnp-5188	301	33	of	of	ADP
fnp-5188	301	34	αsma	αsma	NOUN
fnp-5188	301	35	and	and	CCONJ
fnp-5188	301	36	pdgfrβ	pdgfrβ	NOUN
fnp-5188	301	37	with	with	ADP
fnp-5188	301	38	slug	slug	NOUN
fnp-5188	301	39	in	in	ADP
fnp-5188	301	40	human	human	ADJ
fnp-5188	301	41	gbms	gbms	NOUN
fnp-5188	301	42	[	[	X
fnp-5188	301	43	15	15	NUM
fnp-5188	301	44	,	,	PUNCT
fnp-5188	301	45	16	16	NUM
fnp-5188	301	46	]	]	PUNCT
fnp-5188	301	47	.	.	PUNCT
fnp-5188	302	1	in	in	ADP
fnp-5188	302	2	accordance	accordance	NOUN
fnp-5188	302	3	with	with	ADP
fnp-5188	302	4	those	those	DET
fnp-5188	302	5	findings	finding	NOUN
fnp-5188	302	6	,	,	PUNCT
fnp-5188	302	7	strong	strong	ADJ
fnp-5188	302	8	signals	signal	NOUN
fnp-5188	302	9	of	of	ADP
fnp-5188	302	10	αsma	αsma	NOUN
fnp-5188	302	11	and	and	CCONJ
fnp-5188	302	12	pdgfrβ	pdgfrβ	NOUN
fnp-5188	302	13	have	have	AUX
fnp-5188	302	14	been	be	AUX
fnp-5188	302	15	detected	detect	VERB
fnp-5188	302	16	in	in	ADP
fnp-5188	302	17	mice	mice	NOUN
fnp-5188	302	18	brains	brain	NOUN
fnp-5188	302	19	bearing	bear	VERB
fnp-5188	302	20	tgf	tgf	PROPN
fnp-5188	302	21	-	-	PUNCT
fnp-5188	302	22	β	β	X
fnp-5188	302	23	secreting	secrete	VERB
fnp-5188	302	24	par	par	ADJ
fnp-5188	302	25	tumors	tumor	NOUN
fnp-5188	302	26	(	(	PUNCT
fnp-5188	302	27	figs	fig	NOUN
fnp-5188	302	28	.	.	PUNCT
fnp-5188	303	1	3	3	NUM
fnp-5188	303	2	,	,	PUNCT
fnp-5188	303	3	4	4	NUM
fnp-5188	303	4	,	,	PUNCT
fnp-5188	303	5	6	6	NUM
fnp-5188	303	6	,	,	PUNCT
fnp-5188	303	7	7	7	NUM
fnp-5188	303	8	)	)	PUNCT
fnp-5188	303	9	.	.	PUNCT
fnp-5188	304	1	during	during	ADP
fnp-5188	304	2	fibrosis	fibrosis	NOUN
fnp-5188	304	3	,	,	PUNCT
fnp-5188	304	4	αsma	αsma	NOUN
fnp-5188	304	5	and	and	CCONJ
fnp-5188	304	6	pdgfrβ	pdgfrβ	NOUN
fnp-5188	304	7	are	be	AUX
fnp-5188	304	8	considered	consider	VERB
fnp-5188	304	9	as	as	ADP
fnp-5188	304	10	pericyte	pericyte	NOUN
fnp-5188	304	11	activation	activation	NOUN
fnp-5188	304	12	markers	marker	NOUN
fnp-5188	304	13	,	,	PUNCT
fnp-5188	304	14	and	and	CCONJ
fnp-5188	304	15	in	in	ADP
fnp-5188	304	16	renal	renal	ADJ
fnp-5188	304	17	carcinoma	carcinoma	NOUN
fnp-5188	304	18	,	,	PUNCT
fnp-5188	304	19	perivascular	perivascular	ADJ
fnp-5188	304	20	αsma	αsma	NOUN
fnp-5188	304	21	and	and	CCONJ
fnp-5188	304	22	pdgfrβ	pdgfrβ	NOUN
fnp-5188	304	23	expression	expression	NOUN
fnp-5188	304	24	is	be	AUX
fnp-5188	304	25	correlated	correlate	VERB
fnp-5188	304	26	with	with	ADP
fnp-5188	304	27	poorer	poor	ADJ
fnp-5188	304	28	survival	survival	NOUN
fnp-5188	305	1	[	[	X
fnp-5188	305	2	45	45	NUM
fnp-5188	305	3	,	,	PUNCT
fnp-5188	305	4	46	46	NUM
fnp-5188	305	5	]	]	PUNCT
fnp-5188	305	6	.	.	PUNCT
fnp-5188	306	1	this	this	PRON
fnp-5188	306	2	suggests	suggest	VERB
fnp-5188	306	3	that	that	SCONJ
fnp-5188	306	4	in	in	ADP
fnp-5188	306	5	vascularized	vascularized	ADJ
fnp-5188	306	6	high	high	ADJ
fnp-5188	306	7	-	-	PUNCT
fnp-5188	306	8	grade	grade	NOUN
fnp-5188	306	9	glioma	glioma	NOUN
fnp-5188	306	10	,	,	PUNCT
fnp-5188	306	11	glioma	glioma	NOUN
fnp-5188	306	12	-	-	PUNCT
fnp-5188	306	13	associated	associate	VERB
fnp-5188	306	14	vamcs	vamcs	NOUN
fnp-5188	306	15	are	be	AUX
fnp-5188	306	16	pathologically	pathologically	ADV
fnp-5188	306	17	activated	activate	VERB
fnp-5188	306	18	.	.	PUNCT
fnp-5188	307	1	in	in	ADP
fnp-5188	307	2	parallel	parallel	NOUN
fnp-5188	307	3	with	with	ADP
fnp-5188	307	4	the	the	DET
fnp-5188	307	5	high	high	ADJ
fnp-5188	307	6	levels	level	NOUN
fnp-5188	307	7	of	of	ADP
fnp-5188	307	8	pdgfrβ	pdgfrβ	NOUN
fnp-5188	307	9	and	and	CCONJ
fnp-5188	307	10	αsma	αsma	NOUN
fnp-5188	307	11	we	we	PRON
fnp-5188	307	12	observed	observe	VERB
fnp-5188	307	13	in	in	ADP
fnp-5188	307	14	tgf	tgf	PROPN
fnp-5188	307	15	-	-	PUNCT
fnp-5188	307	16	β	β	X
fnp-5188	307	17	secreting	secrete	VERB
fnp-5188	307	18	gbms	gbms	NOUN
fnp-5188	307	19	,	,	PUNCT
fnp-5188	307	20	we	we	PRON
fnp-5188	307	21	detected	detect	VERB
fnp-5188	307	22	slug	slug	NOUN
fnp-5188	307	23	that	that	PRON
fnp-5188	307	24	was	be	AUX
fnp-5188	307	25	nearly	nearly	ADV
fnp-5188	307	26	virtually	virtually	ADV
fnp-5188	307	27	invisible	invisible	ADJ
fnp-5188	307	28	in	in	ADP
fnp-5188	307	29	tgf	tgf	PROPN
fnp-5188	307	30	-	-	PUNCT
fnp-5188	307	31	β	β	NOUN
fnp-5188	307	32	-	-	PUNCT
fnp-5188	307	33	ko	ko	ADJ
fnp-5188	307	34	gbms	gbms	PROPN
fnp-5188	307	35	(	(	PUNCT
fnp-5188	307	36	fig	fig	NOUN
fnp-5188	307	37	.	.	PUNCT
fnp-5188	308	1	3	3	NUM
fnp-5188	308	2	,	,	PUNCT
fnp-5188	308	3	suppl	suppl	PROPN
fnp-5188	308	4	.	.	PUNCT
fnp-5188	308	5	fig	fig	NOUN
fnp-5188	308	6	.	.	PUNCT
fnp-5188	309	1	5	5	NUM
fnp-5188	309	2	)	)	PUNCT
fnp-5188	309	3	.	.	PUNCT
fnp-5188	310	1	after	after	ADP
fnp-5188	310	2	knocking	knock	VERB
fnp-5188	310	3	out	out	ADP
fnp-5188	310	4	tgf	tgf	PROPN
fnp-5188	310	5	-	-	PUNCT
fnp-5188	310	6	β	β	PROPN
fnp-5188	310	7	in	in	ADP
fnp-5188	310	8	the	the	DET
fnp-5188	310	9	tumor	tumor	NOUN
fnp-5188	310	10	cells	cell	NOUN
fnp-5188	310	11	,	,	PUNCT
fnp-5188	310	12	or	or	CCONJ
fnp-5188	310	13	slug	slug	VERB
fnp-5188	310	14	in	in	ADP
fnp-5188	310	15	glioma	glioma	NOUN
fnp-5188	310	16	-	-	PUNCT
fnp-5188	310	17	associated	associate	VERB
fnp-5188	310	18	vamcs	vamcs	NOUN
fnp-5188	310	19	,	,	PUNCT
fnp-5188	310	20	both	both	CCONJ
fnp-5188	310	21	pdgfrβ	pdgfrβ	NOUN
fnp-5188	310	22	and	and	CCONJ
fnp-5188	310	23	αsma	αsma	VERB
fnp-5188	310	24	positive	positive	ADJ
fnp-5188	310	25	cells	cell	NOUN
fnp-5188	310	26	were	be	AUX
fnp-5188	310	27	markedly	markedly	ADJ
fnp-5188	310	28	and	and	CCONJ
fnp-5188	310	29	significantly	significantly	ADV
fnp-5188	310	30	reduced	reduce	VERB
fnp-5188	310	31	.	.	PUNCT
fnp-5188	311	1	in	in	ADP
fnp-5188	311	2	accordance	accordance	NOUN
fnp-5188	311	3	with	with	ADP
fnp-5188	311	4	our	our	PRON
fnp-5188	311	5	previous	previous	ADJ
fnp-5188	311	6	in	in	ADP
fnp-5188	311	7	vitro	vitro	X
fnp-5188	311	8	data	datum	NOUN
fnp-5188	311	9	[	[	X
fnp-5188	311	10	16	16	NUM
fnp-5188	311	11	]	]	PUNCT
fnp-5188	311	12	,	,	PUNCT
fnp-5188	311	13	this	this	DET
fnp-5188	311	14	observation	observation	NOUN
fnp-5188	311	15	reinforces	reinforce	VERB
fnp-5188	311	16	our	our	PRON
fnp-5188	311	17	assumption	assumption	NOUN
fnp-5188	311	18	,	,	PUNCT
fnp-5188	311	19	that	that	SCONJ
fnp-5188	311	20	also	also	ADV
fnp-5188	311	21	in	in	ADP
fnp-5188	311	22	vivo	vivo	NOUN
fnp-5188	311	23	in	in	ADP
fnp-5188	311	24	gbms	gbms	NOUN
fnp-5188	311	25	the	the	DET
fnp-5188	311	26	induction	induction	NOUN
fnp-5188	311	27	of	of	ADP
fnp-5188	311	28	a	a	DET
fnp-5188	311	29	slug	slug	NOUN
fnp-5188	311	30	dependent	dependent	ADJ
fnp-5188	311	31	emt	emt	PROPN
fnp-5188	311	32	-	-	PUNCT
fnp-5188	311	33	like	like	ADJ
fnp-5188	311	34	program	program	NOUN
fnp-5188	311	35	especially	especially	ADV
fnp-5188	311	36	in	in	ADP
fnp-5188	311	37	glioma	glioma	NOUN
fnp-5188	311	38	-	-	PUNCT
fnp-5188	311	39	associated	associate	VERB
fnp-5188	311	40	vamcs	vamcs	NOUN
fnp-5188	311	41	is	be	AUX
fnp-5188	311	42	conveyed	convey	VERB
fnp-5188	311	43	by	by	ADP
fnp-5188	311	44	gbm	gbm	PROPN
fnp-5188	311	45	cell	cell	NOUN
fnp-5188	311	46	secreted	secrete	VERB
fnp-5188	311	47	tgf	tgf	PROPN
fnp-5188	311	48	-	-	PUNCT
fnp-5188	311	49	β	β	NOUN
fnp-5188	311	50	.	.	PUNCT
fnp-5188	312	1	nevertheless	nevertheless	ADV
fnp-5188	312	2	,	,	PUNCT
fnp-5188	312	3	apart	apart	ADV
fnp-5188	312	4	from	from	ADP
fnp-5188	312	5	gbm	gbm	NOUN
fnp-5188	312	6	cells	cell	NOUN
fnp-5188	312	7	,	,	PUNCT
fnp-5188	312	8	several	several	ADJ
fnp-5188	312	9	other	other	ADJ
fnp-5188	312	10	cell	cell	NOUN
fnp-5188	312	11	types	type	NOUN
fnp-5188	312	12	in	in	ADP
fnp-5188	312	13	the	the	DET
fnp-5188	312	14	cns	cns	NOUN
fnp-5188	312	15	have	have	AUX
fnp-5188	312	16	been	be	AUX
fnp-5188	312	17	shown	show	VERB
fnp-5188	312	18	to	to	PART
fnp-5188	312	19	secrete	secrete	VERB
fnp-5188	312	20	tgf	tgf	PROPN
fnp-5188	312	21	-	-	PUNCT
fnp-5188	312	22	β	β	PROPN
fnp-5188	312	23	,	,	PUNCT
fnp-5188	312	24	including	include	VERB
fnp-5188	312	25	ecs	ec	NOUN
fnp-5188	312	26	and	and	CCONJ
fnp-5188	312	27	microglial	microglial	ADJ
fnp-5188	312	28	cells	cell	NOUN
fnp-5188	312	29	,	,	PUNCT
fnp-5188	312	30	which	which	PRON
fnp-5188	312	31	could	could	AUX
fnp-5188	312	32	also	also	ADV
fnp-5188	312	33	stimulate	stimulate	VERB
fnp-5188	312	34	vamcs	vamcs	NOUN
fnp-5188	312	35	to	to	ADP
fnp-5188	312	36	a	a	DET
fnp-5188	312	37	certain	certain	ADJ
fnp-5188	312	38	amount	amount	NOUN
fnp-5188	312	39	[	[	X
fnp-5188	312	40	47	47	NUM
fnp-5188	312	41	]	]	PUNCT
fnp-5188	312	42	.	.	PUNCT
fnp-5188	313	1	moreover	moreover	ADV
fnp-5188	313	2	,	,	PUNCT
fnp-5188	313	3	additional	additional	ADJ
fnp-5188	313	4	influence	influence	NOUN
fnp-5188	313	5	on	on	ADP
fnp-5188	313	6	this	this	DET
fnp-5188	313	7	stimulation	stimulation	NOUN
fnp-5188	313	8	mediated	mediate	VERB
fnp-5188	313	9	by	by	ADP
fnp-5188	313	10	different	different	ADJ
fnp-5188	313	11	cytokines	cytokine	NOUN
fnp-5188	313	12	can	can	AUX
fnp-5188	313	13	not	not	PART
fnp-5188	313	14	be	be	AUX
fnp-5188	313	15	excluded	exclude	VERB
fnp-5188	313	16	.	.	PUNCT
fnp-5188	314	1	particularly	particularly	ADV
fnp-5188	314	2	the	the	DET
fnp-5188	314	3	hypoxic	hypoxic	ADJ
fnp-5188	314	4	microenvironment	microenvironment	NOUN
fnp-5188	314	5	in	in	ADP
fnp-5188	314	6	gbm	gbm	PROPN
fnp-5188	314	7	is	be	AUX
fnp-5188	314	8	known	know	VERB
fnp-5188	314	9	to	to	PART
fnp-5188	314	10	be	be	AUX
fnp-5188	314	11	a	a	DET
fnp-5188	314	12	potent	potent	ADJ
fnp-5188	314	13	inducer	inducer	NOUN
fnp-5188	314	14	of	of	ADP
fnp-5188	314	15	emt	emt	PROPN
fnp-5188	314	16	and	and	CCONJ
fnp-5188	314	17	morphological	morphological	ADJ
fnp-5188	314	18	alterations	alteration	NOUN
fnp-5188	314	19	[	[	X
fnp-5188	314	20	48	48	NUM
fnp-5188	314	21	]	]	PUNCT
fnp-5188	314	22	.	.	PUNCT
fnp-5188	315	1	until	until	ADP
fnp-5188	315	2	now	now	ADV
fnp-5188	315	3	it	it	PRON
fnp-5188	315	4	remains	remain	VERB
fnp-5188	315	5	unclear	unclear	ADJ
fnp-5188	315	6	whether	whether	SCONJ
fnp-5188	315	7	vegf	vegf	PROPN
fnp-5188	315	8	signaling	signal	VERB
fnp-5188	315	9	also	also	ADV
fnp-5188	315	10	influences	influence	VERB
fnp-5188	315	11	pericytes	pericyte	NOUN
fnp-5188	315	12	or	or	CCONJ
fnp-5188	315	13	other	other	ADJ
fnp-5188	315	14	mural	mural	ADJ
fnp-5188	315	15	cells	cell	NOUN
fnp-5188	315	16	.	.	PUNCT
fnp-5188	316	1	it	it	PRON
fnp-5188	316	2	is	be	AUX
fnp-5188	316	3	known	know	VERB
fnp-5188	316	4	that	that	SCONJ
fnp-5188	316	5	vegf	vegf	PROPN
fnp-5188	316	6	primarily	primarily	ADV
fnp-5188	316	7	signals	signal	VERB
fnp-5188	316	8	proliferation	proliferation	NOUN
fnp-5188	316	9	,	,	PUNCT
fnp-5188	316	10	survival	survival	NOUN
fnp-5188	316	11	and	and	CCONJ
fnp-5188	316	12	migration	migration	NOUN
fnp-5188	316	13	.	.	PUNCT
fnp-5188	317	1	however	however	ADV
fnp-5188	317	2	,	,	PUNCT
fnp-5188	317	3	a	a	DET
fnp-5188	317	4	via	via	ADP
fnp-5188	317	5	the	the	DET
fnp-5188	317	6	vegf	vegf	NOUN
fnp-5188	317	7	receptor	receptor	NOUN
fnp-5188	317	8	(	(	PUNCT
fnp-5188	317	9	vegfr)-2	vegfr)-2	PROPN
fnp-5188	317	10	leading	lead	VERB
fnp-5188	317	11	to	to	ADP
fnp-5188	317	12	ec	ec	PROPN
fnp-5188	317	13	vegf	vegf	PROPN
fnp-5188	317	14	-	-	PUNCT
fnp-5188	317	15	mediated	mediate	VERB
fnp-5188	317	16	activation	activation	NOUN
fnp-5188	317	17	of	of	ADP
fnp-5188	317	18	vegfr-1	vegfr-1	PROPN
fnp-5188	317	19	has	have	AUX
fnp-5188	317	20	recently	recently	ADV
fnp-5188	317	21	been	be	AUX
fnp-5188	317	22	shown	show	VERB
fnp-5188	317	23	to	to	PART
fnp-5188	317	24	be	be	AUX
fnp-5188	317	25	not	not	PART
fnp-5188	317	26	only	only	ADV
fnp-5188	317	27	involved	involve	VERB
fnp-5188	317	28	in	in	ADP
fnp-5188	317	29	the	the	DET
fnp-5188	317	30	recruitment	recruitment	NOUN
fnp-5188	317	31	of	of	ADP
fnp-5188	317	32	mural	mural	ADJ
fnp-5188	317	33	cells	cell	NOUN
fnp-5188	317	34	which	which	PRON
fnp-5188	317	35	is	be	AUX
fnp-5188	317	36	required	require	VERB
fnp-5188	317	37	for	for	ADP
fnp-5188	317	38	maturation	maturation	NOUN
fnp-5188	317	39	and	and	CCONJ
fnp-5188	317	40	stabilization	stabilization	NOUN
fnp-5188	317	41	of	of	ADP
fnp-5188	317	42	neo	neo	NOUN
fnp-5188	317	43	-	-	NOUN
fnp-5188	317	44	vessels	vessel	NOUN
fnp-5188	317	45	,	,	PUNCT
fnp-5188	317	46	but	but	CCONJ
fnp-5188	317	47	also	also	ADV
fnp-5188	317	48	to	to	PART
fnp-5188	317	49	affect	affect	VERB
fnp-5188	317	50	vascular	vascular	ADJ
fnp-5188	317	51	permeability	permeability	NOUN
fnp-5188	318	1	[	[	X
fnp-5188	318	2	49	49	NUM
fnp-5188	318	3	,	,	PUNCT
fnp-5188	318	4	50	50	NUM
fnp-5188	318	5	]	]	PUNCT
fnp-5188	318	6	.	.	PUNCT
fnp-5188	319	1	as	as	SCONJ
fnp-5188	319	2	pericytes	pericyte	NOUN
fnp-5188	319	3	are	be	AUX
fnp-5188	319	4	known	know	VERB
fnp-5188	319	5	to	to	PART
fnp-5188	319	6	express	express	VERB
fnp-5188	319	7	vegfr-1	vegfr-1	NUM
fnp-5188	319	8	particularly	particularly	ADV
fnp-5188	319	9	under	under	ADP
fnp-5188	319	10	hypoxic	hypoxic	ADJ
fnp-5188	319	11	conditions	condition	NOUN
fnp-5188	319	12	[	[	X
fnp-5188	319	13	51	51	NUM
fnp-5188	319	14	]	]	PUNCT
fnp-5188	319	15	,	,	PUNCT
fnp-5188	319	16	vegf	vegf	NOUN
fnp-5188	319	17	-	-	PUNCT
fnp-5188	319	18	mediated	mediate	VERB
fnp-5188	319	19	changes	change	NOUN
fnp-5188	319	20	of	of	ADP
fnp-5188	319	21	pericytes	pericyte	NOUN
fnp-5188	319	22	towards	towards	ADP
fnp-5188	319	23	a	a	DET
fnp-5188	319	24	more	more	ADV
fnp-5188	319	25	mesenchymal	mesenchymal	ADJ
fnp-5188	319	26	phenotype	phenotype	NOUN
fnp-5188	319	27	enabling	enable	VERB
fnp-5188	319	28	their	their	PRON
fnp-5188	319	29	recruitment	recruitment	NOUN
fnp-5188	319	30	might	might	AUX
fnp-5188	319	31	be	be	AUX
fnp-5188	319	32	considered	consider	VERB
fnp-5188	319	33	.	.	PUNCT
fnp-5188	320	1	by	by	ADP
fnp-5188	320	2	preventing	prevent	VERB
fnp-5188	320	3	the	the	DET
fnp-5188	320	4	emt	emt	NOUN
fnp-5188	320	5	mediated	mediate	VERB
fnp-5188	320	6	"	"	PUNCT
fnp-5188	320	7	activation	activation	NOUN
fnp-5188	320	8	"	"	PUNCT
fnp-5188	320	9	of	of	ADP
fnp-5188	320	10	glioma	glioma	NOUN
fnp-5188	320	11	-	-	PUNCT
fnp-5188	320	12	associated	associate	VERB
fnp-5188	320	13	vamcs	vamcs	NOUN
fnp-5188	320	14	,	,	PUNCT
fnp-5188	320	15	we	we	PRON
fnp-5188	320	16	observed	observe	VERB
fnp-5188	320	17	a	a	DET
fnp-5188	320	18	significant	significant	ADJ
fnp-5188	320	19	reduction	reduction	NOUN
fnp-5188	320	20	of	of	ADP
fnp-5188	320	21	gfp+	gfp+	PROPN
fnp-5188	320	22	cells	cell	NOUN
fnp-5188	320	23	in	in	ADP
fnp-5188	320	24	all	all	DET
fnp-5188	320	25	tumor	tumor	NOUN
fnp-5188	320	26	areas	area	NOUN
fnp-5188	320	27	(	(	PUNCT
fnp-5188	320	28	fig	fig	NOUN
fnp-5188	320	29	.	.	PUNCT
fnp-5188	321	1	3	3	NUM
fnp-5188	321	2	,	,	PUNCT
fnp-5188	321	3	6	6	NUM
fnp-5188	321	4	,	,	PUNCT
fnp-5188	321	5	suppl	suppl	PROPN
fnp-5188	321	6	.	.	PUNCT
fnp-5188	321	7	fig	fig	NOUN
fnp-5188	321	8	.	.	PUNCT
fnp-5188	322	1	5	5	NUM
fnp-5188	322	2	)	)	PUNCT
fnp-5188	322	3	.	.	PUNCT
fnp-5188	323	1	in	in	ADP
fnp-5188	323	2	this	this	DET
fnp-5188	323	3	regard	regard	NOUN
fnp-5188	323	4	,	,	PUNCT
fnp-5188	323	5	the	the	DET
fnp-5188	323	6	source	source	NOUN
fnp-5188	323	7	of	of	ADP
fnp-5188	323	8	pericytes	pericyte	NOUN
fnp-5188	323	9	on	on	ADP
fnp-5188	323	10	gbm	gbm	PROPN
fnp-5188	323	11	vessels	vessel	NOUN
fnp-5188	323	12	remains	remain	VERB
fnp-5188	323	13	controversial	controversial	ADJ
fnp-5188	323	14	as	as	SCONJ
fnp-5188	323	15	it	it	PRON
fnp-5188	323	16	has	have	AUX
fnp-5188	323	17	been	be	AUX
fnp-5188	323	18	postulated	postulate	VERB
fnp-5188	323	19	that	that	SCONJ
fnp-5188	323	20	pericytes	pericyte	NOUN
fnp-5188	323	21	might	might	AUX
fnp-5188	323	22	also	also	ADV
fnp-5188	323	23	originate	originate	VERB
fnp-5188	323	24	from	from	ADP
fnp-5188	323	25	glioma	glioma	NOUN
fnp-5188	323	26	stem	stem	NOUN
fnp-5188	323	27	like	like	ADP
fnp-5188	323	28	cells	cell	NOUN
fnp-5188	323	29	[	[	X
fnp-5188	323	30	52	52	NUM
fnp-5188	323	31	]	]	PUNCT
fnp-5188	323	32	.	.	PUNCT
fnp-5188	324	1	it	it	PRON
fnp-5188	324	2	has	have	AUX
fnp-5188	324	3	been	be	AUX
fnp-5188	324	4	published	publish	VERB
fnp-5188	324	5	that	that	SCONJ
fnp-5188	324	6	gl261	gl261	PROPN
fnp-5188	324	7	cells	cell	NOUN
fnp-5188	324	8	grown	grow	VERB
fnp-5188	324	9	as	as	ADP
fnp-5188	324	10	neurospheres	neurosphere	NOUN
fnp-5188	324	11	under	under	ADP
fnp-5188	324	12	reduced	reduce	VERB
fnp-5188	324	13	fcs	fcs	NOUN
fnp-5188	324	14	concentrations	concentration	NOUN
fnp-5188	324	15	contain	contain	VERB
fnp-5188	324	16	a	a	DET
fnp-5188	324	17	population	population	NOUN
fnp-5188	324	18	of	of	ADP
fnp-5188	324	19	cells	cell	NOUN
fnp-5188	324	20	with	with	ADP
fnp-5188	324	21	stem	stem	NOUN
fnp-5188	324	22	cell	cell	NOUN
fnp-5188	324	23	characteristics	characteristic	NOUN
fnp-5188	324	24	[	[	X
fnp-5188	324	25	53	53	NUM
fnp-5188	324	26	]	]	PUNCT
fnp-5188	324	27	.	.	PUNCT
fnp-5188	325	1	to	to	PART
fnp-5188	325	2	avoid	avoid	VERB
fnp-5188	325	3	stemness	stemness	NOUN
fnp-5188	325	4	,	,	PUNCT
fnp-5188	325	5	in	in	ADP
fnp-5188	325	6	our	our	PRON
fnp-5188	325	7	study	study	NOUN
fnp-5188	325	8	gl216	gl216	NOUN
fnp-5188	325	9	cells	cell	NOUN
fnp-5188	325	10	were	be	AUX
fnp-5188	325	11	grown	grow	VERB
fnp-5188	325	12	in	in	ADP
fnp-5188	325	13	10	10	NUM
fnp-5188	325	14	%	%	NOUN
fnp-5188	325	15	fcs	fcs	NOUN
fnp-5188	325	16	before	before	ADP
fnp-5188	325	17	implantation	implantation	NOUN
fnp-5188	325	18	.	.	PUNCT
fnp-5188	326	1	however	however	ADV
fnp-5188	326	2	,	,	PUNCT
fnp-5188	326	3	we	we	PRON
fnp-5188	326	4	can	can	AUX
fnp-5188	326	5	not	not	PART
fnp-5188	326	6	exclude	exclude	VERB
fnp-5188	326	7	that	that	PRON
fnp-5188	326	8	in	in	ADP
fnp-5188	326	9	vivo	vivo	NOUN
fnp-5188	326	10	in	in	ADP
fnp-5188	326	11	the	the	DET
fnp-5188	326	12	growing	grow	VERB
fnp-5188	326	13	tumor	tumor	NOUN
fnp-5188	326	14	,	,	PUNCT
fnp-5188	326	15	stem	stem	NOUN
fnp-5188	326	16	cell	cell	NOUN
fnp-5188	326	17	characteristics	characteristic	NOUN
fnp-5188	326	18	were	be	AUX
fnp-5188	326	19	induced	induce	VERB
fnp-5188	326	20	in	in	ADP
fnp-5188	326	21	the	the	DET
fnp-5188	326	22	tumor	tumor	NOUN
fnp-5188	326	23	cells	cell	NOUN
fnp-5188	326	24	.	.	PUNCT
fnp-5188	327	1	as	as	SCONJ
fnp-5188	327	2	gl261	gl261	PROPN
fnp-5188	327	3	cells	cell	NOUN
fnp-5188	327	4	do	do	AUX
fnp-5188	327	5	not	not	PART
fnp-5188	327	6	express	express	VERB
fnp-5188	327	7	gfp	gfp	NOUN
fnp-5188	327	8	and	and	CCONJ
fnp-5188	327	9	therefore	therefore	ADV
fnp-5188	327	10	gl261	gl261	ADJ
fnp-5188	327	11	derived	derived	ADJ
fnp-5188	327	12	pericytes	pericyte	NOUN
fnp-5188	327	13	can	can	AUX
fnp-5188	327	14	not	not	PART
fnp-5188	327	15	be	be	AUX
fnp-5188	327	16	detected	detect	VERB
fnp-5188	327	17	by	by	ADP
fnp-5188	327	18	our	our	PRON
fnp-5188	327	19	approach	approach	NOUN
fnp-5188	327	20	,	,	PUNCT
fnp-5188	327	21	we	we	PRON
fnp-5188	327	22	can	can	AUX
fnp-5188	327	23	not	not	PART
fnp-5188	327	24	exclude	exclude	VERB
fnp-5188	327	25	that	that	SCONJ
fnp-5188	327	26	a	a	DET
fnp-5188	327	27	small	small	ADJ
fnp-5188	327	28	population	population	NOUN
fnp-5188	327	29	of	of	ADP
fnp-5188	327	30	gl261	gl261	PROPN
fnp-5188	327	31	with	with	ADP
fnp-5188	327	32	stem	stem	NOUN
fnp-5188	327	33	cell	cell	NOUN
fnp-5188	327	34	characteristics	characteristic	NOUN
fnp-5188	327	35	might	might	AUX
fnp-5188	327	36	develop	develop	VERB
fnp-5188	327	37	into	into	ADP
fnp-5188	327	38	pericytes	pericyte	NOUN
fnp-5188	327	39	.	.	PUNCT
fnp-5188	328	1	however	however	ADV
fnp-5188	328	2	,	,	PUNCT
fnp-5188	328	3	we	we	PRON
fnp-5188	328	4	did	do	AUX
fnp-5188	328	5	not	not	PART
fnp-5188	328	6	observe	observe	VERB
fnp-5188	328	7	any	any	DET
fnp-5188	328	8	cells	cell	NOUN
fnp-5188	328	9	that	that	PRON
fnp-5188	328	10	are	be	AUX
fnp-5188	328	11	double	double	ADV
fnp-5188	328	12	positive	positive	ADJ
fnp-5188	328	13	of	of	ADP
fnp-5188	328	14	mcherry	mcherry	NOUN
fnp-5188	328	15	and	and	CCONJ
fnp-5188	328	16	a	a	DET
fnp-5188	328	17	mural	mural	ADJ
fnp-5188	328	18	cell	cell	NOUN
fnp-5188	328	19	marker	marker	NOUN
fnp-5188	328	20	such	such	ADJ
fnp-5188	328	21	as	as	ADP
fnp-5188	328	22	αsma	αsma	NOUN
fnp-5188	328	23	or	or	CCONJ
fnp-5188	328	24	,	,	PUNCT
fnp-5188	328	25	in	in	ADP
fnp-5188	328	26	tgf	tgf	PROPN
fnp-5188	328	27	-	-	PUNCT
fnp-5188	328	28	β	β	NOUN
fnp-5188	328	29	-	-	PUNCT
fnp-5188	328	30	secreting	secrete	VERB
fnp-5188	328	31	par	par	NOUN
fnp-5188	328	32	tumors	tumor	NOUN
fnp-5188	328	33	,	,	PUNCT
fnp-5188	328	34	positive	positive	ADJ
fnp-5188	328	35	for	for	ADP
fnp-5188	328	36	slug	slug	NOUN
fnp-5188	328	37	(	(	PUNCT
fnp-5188	328	38	fig	fig	NOUN
fnp-5188	328	39	.	.	NOUN
fnp-5188	328	40	3	3	NUM
fnp-5188	328	41	and	and	CCONJ
fnp-5188	328	42	4	4	NUM
fnp-5188	328	43	)	)	PUNCT
fnp-5188	328	44	.	.	PUNCT
fnp-5188	329	1	besides	besides	SCONJ
fnp-5188	329	2	,	,	PUNCT
fnp-5188	329	3	it	it	PRON
fnp-5188	329	4	has	have	AUX
fnp-5188	329	5	been	be	AUX
fnp-5188	329	6	published	publish	VERB
fnp-5188	329	7	that	that	SCONJ
fnp-5188	329	8	in	in	ADP
fnp-5188	329	9	gl261	gl261	PROPN
fnp-5188	329	10	tumor	tumor	NOUN
fnp-5188	329	11	bearing	bear	VERB
fnp-5188	329	12	mice	mouse	NOUN
fnp-5188	329	13	the	the	DET
fnp-5188	329	14	vast	vast	ADJ
fnp-5188	329	15	majority	majority	NOUN
fnp-5188	329	16	of	of	ADP
fnp-5188	329	17	pericytes	pericyte	NOUN
fnp-5188	329	18	within	within	ADP
fnp-5188	329	19	gbms	gbms	NOUN
fnp-5188	329	20	are	be	AUX
fnp-5188	329	21	definitely	definitely	ADV
fnp-5188	329	22	endogenous	endogenous	ADJ
fnp-5188	329	23	,	,	PUNCT
fnp-5188	329	24	host	host	NOUN
fnp-5188	329	25	-	-	PUNCT
fnp-5188	329	26	derived	derive	VERB
fnp-5188	329	27	cells	cell	NOUN
fnp-5188	329	28	originating	originate	VERB
fnp-5188	329	29	from	from	ADP
fnp-5188	329	30	either	either	CCONJ
fnp-5188	329	31	mesenchymal	mesenchymal	NOUN
fnp-5188	329	32	or	or	CCONJ
fnp-5188	329	33	neural	neural	ADJ
fnp-5188	329	34	crest	crest	NOUN
fnp-5188	329	35	cells	cell	NOUN
fnp-5188	329	36	[	[	X
fnp-5188	329	37	54	54	NUM
fnp-5188	329	38	]	]	PUNCT
fnp-5188	329	39	.	.	PUNCT
fnp-5188	330	1	hence	hence	ADV
fnp-5188	330	2	,	,	PUNCT
fnp-5188	330	3	we	we	PRON
fnp-5188	330	4	believe	believe	VERB
fnp-5188	330	5	that	that	SCONJ
fnp-5188	330	6	our	our	PRON
fnp-5188	330	7	mouse	mouse	NOUN
fnp-5188	330	8	gbm	gbm	NOUN
fnp-5188	330	9	model	model	NOUN
fnp-5188	330	10	is	be	AUX
fnp-5188	330	11	suitable	suitable	ADJ
fnp-5188	330	12	to	to	PART
fnp-5188	330	13	investigate	investigate	VERB
fnp-5188	330	14	the	the	DET
fnp-5188	330	15	tgf	tgf	PROPN
fnp-5188	330	16	-	-	PUNCT
fnp-5188	330	17	β	β	NOUN
fnp-5188	330	18	/	/	SYM
fnp-5188	330	19	slug	slug	ADJ
fnp-5188	330	20	mediated	mediate	VERB
fnp-5188	330	21	modulation	modulation	NOUN
fnp-5188	330	22	of	of	ADP
fnp-5188	330	23	glioma	glioma	NOUN
fnp-5188	330	24	-	-	PUNCT
fnp-5188	330	25	associated	associate	VERB
fnp-5188	330	26	vamcs	vamcs	NOUN
fnp-5188	330	27	in	in	ADP
fnp-5188	330	28	vivo	vivo	NOUN
fnp-5188	330	29	.	.	PUNCT
fnp-5188	331	1	vascularization	vascularization	NOUN
fnp-5188	331	2	not	not	PART
fnp-5188	331	3	only	only	ADV
fnp-5188	331	4	involves	involve	VERB
fnp-5188	331	5	ec	ec	PROPN
fnp-5188	331	6	proliferation	proliferation	NOUN
fnp-5188	331	7	,	,	PUNCT
fnp-5188	331	8	migration	migration	NOUN
fnp-5188	331	9	,	,	PUNCT
fnp-5188	331	10	branching	branch	VERB
fnp-5188	331	11	and	and	CCONJ
fnp-5188	331	12	anastomosis	anastomosis	NOUN
fnp-5188	331	13	,	,	PUNCT
fnp-5188	331	14	it	it	PRON
fnp-5188	331	15	also	also	ADV
fnp-5188	331	16	requires	require	VERB
fnp-5188	331	17	adequate	adequate	ADJ
fnp-5188	331	18	pericyte	pericyte	NOUN
fnp-5188	331	19	coverage	coverage	NOUN
fnp-5188	331	20	of	of	ADP
fnp-5188	331	21	vascular	vascular	ADJ
fnp-5188	331	22	sprouts	sprout	NOUN
fnp-5188	331	23	for	for	ADP
fnp-5188	331	24	vessel	vessel	NOUN
fnp-5188	331	25	stabilization	stabilization	NOUN
fnp-5188	331	26	and	and	CCONJ
fnp-5188	331	27	maturation	maturation	NOUN
fnp-5188	331	28	(	(	PUNCT
fnp-5188	331	29	for	for	ADP
fnp-5188	331	30	review	review	NOUN
fnp-5188	331	31	see	see	VERB
fnp-5188	331	32	[	[	X
fnp-5188	331	33	55	55	NUM
fnp-5188	331	34	]	]	NUM
fnp-5188	331	35	)	)	PUNCT
fnp-5188	331	36	.	.	PUNCT
fnp-5188	332	1	at	at	ADP
fnp-5188	332	2	least	least	ADJ
fnp-5188	332	3	in	in	ADP
fnp-5188	332	4	gl261	gl261	ADJ
fnp-5188	332	5	tumors	tumor	NOUN
fnp-5188	332	6	,	,	PUNCT
fnp-5188	332	7	the	the	DET
fnp-5188	332	8	knockout	knockout	NOUN
fnp-5188	332	9	of	of	ADP
fnp-5188	332	10	tgf	tgf	PROPN
fnp-5188	332	11	-	-	PUNCT
fnp-5188	332	12	β	β	PROPN
fnp-5188	332	13	or	or	CCONJ
fnp-5188	332	14	the	the	DET
fnp-5188	332	15	prevention	prevention	NOUN
fnp-5188	332	16	of	of	ADP
fnp-5188	332	17	a	a	DET
fnp-5188	332	18	slug	slug	NOUN
fnp-5188	332	19	-	-	PUNCT
fnp-5188	332	20	mediated	mediate	VERB
fnp-5188	332	21	emt	emt	NOUN
fnp-5188	332	22	-	-	PUNCT
fnp-5188	332	23	like	like	ADJ
fnp-5188	332	24	activation	activation	NOUN
fnp-5188	332	25	of	of	ADP
fnp-5188	332	26	vamcs	vamcs	NOUN
fnp-5188	332	27	in	in	ADP
fnp-5188	332	28	the	the	DET
fnp-5188	332	29	tumor	tumor	NOUN
fnp-5188	332	30	environment	environment	NOUN
fnp-5188	332	31	,	,	PUNCT
fnp-5188	332	32	reduces	reduce	VERB
fnp-5188	332	33	the	the	DET
fnp-5188	332	34	number	number	NOUN
fnp-5188	332	35	of	of	ADP
fnp-5188	332	36	gfp+	gfp+	PROPN
fnp-5188	332	37	cell	cell	NOUN
fnp-5188	332	38	numbers	number	NOUN
fnp-5188	332	39	as	as	ADV
fnp-5188	332	40	well	well	ADV
fnp-5188	332	41	as	as	ADP
fnp-5188	332	42	that	that	PRON
fnp-5188	332	43	of	of	ADP
fnp-5188	332	44	cd31	cd31	PROPN
fnp-5188	332	45	+	+	CCONJ
fnp-5188	332	46	cells	cell	NOUN
fnp-5188	332	47	,	,	PUNCT
fnp-5188	332	48	suggesting	suggest	VERB
fnp-5188	332	49	that	that	SCONJ
fnp-5188	332	50	not	not	PART
fnp-5188	332	51	only	only	ADV
fnp-5188	332	52	ecs	ec	NOUN
fnp-5188	332	53	,	,	PUNCT
fnp-5188	332	54	but	but	CCONJ
fnp-5188	332	55	also	also	ADV
fnp-5188	332	56	vamcs	vamcs	NOUN
fnp-5188	332	57	are	be	AUX
fnp-5188	332	58	main	main	ADJ
fnp-5188	332	59	cells	cell	NOUN
fnp-5188	332	60	that	that	PRON
fnp-5188	332	61	constitute	constitute	VERB
fnp-5188	332	62	the	the	DET
fnp-5188	332	63	multiplicity	multiplicity	NOUN
fnp-5188	332	64	and	and	CCONJ
fnp-5188	332	65	altered	alter	VERB
fnp-5188	332	66	morphology	morphology	NOUN
fnp-5188	332	67	of	of	ADP
fnp-5188	332	68	tumor	tumor	NOUN
fnp-5188	332	69	microvessels	microvessel	NOUN
fnp-5188	332	70	.	.	PUNCT
fnp-5188	333	1	physiologically	physiologically	ADV
fnp-5188	333	2	,	,	PUNCT
fnp-5188	333	3	pericytes	pericyte	NOUN
fnp-5188	333	4	constitute	constitute	VERB
fnp-5188	333	5	a	a	DET
fnp-5188	333	6	monolayer	monolayer	NOUN
fnp-5188	333	7	surrounding	surround	VERB
fnp-5188	333	8	ecs	ec	NOUN
fnp-5188	333	9	(	(	PUNCT
fnp-5188	333	10	for	for	ADP
fnp-5188	333	11	review	review	NOUN
fnp-5188	333	12	see	see	VERB
fnp-5188	333	13	[	[	X
fnp-5188	333	14	56	56	NUM
fnp-5188	333	15	]	]	NUM
fnp-5188	333	16	)	)	PUNCT
fnp-5188	333	17	.	.	PUNCT
fnp-5188	334	1	however	however	ADV
fnp-5188	334	2	,	,	PUNCT
fnp-5188	334	3	even	even	ADV
fnp-5188	334	4	if	if	SCONJ
fnp-5188	334	5	the	the	DET
fnp-5188	334	6	vessel	vessel	NOUN
fnp-5188	334	7	coverage	coverage	NOUN
fnp-5188	334	8	with	with	ADP
fnp-5188	334	9	gfp+	gfp+	PROPN
fnp-5188	334	10	vamcs	vamcs	NOUN
fnp-5188	334	11	in	in	ADP
fnp-5188	334	12	the	the	DET
fnp-5188	334	13	tumor	tumor	NOUN
fnp-5188	334	14	area	area	NOUN
fnp-5188	334	15	was	be	AUX
fnp-5188	334	16	heterogeneous	heterogeneous	ADJ
fnp-5188	334	17	and	and	CCONJ
fnp-5188	334	18	areas	area	NOUN
fnp-5188	334	19	with	with	ADP
fnp-5188	334	20	multilayers	multilayer	NOUN
fnp-5188	334	21	of	of	ADP
fnp-5188	334	22	overlapping	overlap	VERB
fnp-5188	334	23	gfp+	gfp+	PROPN
fnp-5188	334	24	cells	cell	NOUN
fnp-5188	334	25	can	can	AUX
fnp-5188	334	26	be	be	AUX
fnp-5188	334	27	distinguished	distinguish	VERB
fnp-5188	334	28	from	from	ADP
fnp-5188	334	29	vessels	vessel	NOUN
fnp-5188	334	30	that	that	PRON
fnp-5188	334	31	display	display	VERB
fnp-5188	334	32	almost	almost	ADV
fnp-5188	334	33	no	no	PRON
fnp-5188	334	34	coverage	coverage	NOUN
fnp-5188	334	35	,	,	PUNCT
fnp-5188	334	36	the	the	DET
fnp-5188	334	37	irregular	irregular	ADJ
fnp-5188	334	38	covering	covering	NOUN
fnp-5188	334	39	correlated	correlate	VERB
fnp-5188	334	40	significantly	significantly	ADV
fnp-5188	334	41	with	with	ADP
fnp-5188	334	42	elevated	elevate	VERB
fnp-5188	334	43	slug	slug	NOUN
fnp-5188	334	44	,	,	PUNCT
fnp-5188	334	45	pdgfrβ	pdgfrβ	NOUN
fnp-5188	334	46	and	and	CCONJ
fnp-5188	334	47	αsma	αsma	NOUN
fnp-5188	334	48	levels	level	NOUN
fnp-5188	334	49	.	.	PUNCT
fnp-5188	335	1	this	this	PRON
fnp-5188	335	2	underpins	underpin	VERB
fnp-5188	335	3	that	that	SCONJ
fnp-5188	335	4	the	the	DET
fnp-5188	335	5	shift	shift	NOUN
fnp-5188	335	6	towards	towards	ADP
fnp-5188	335	7	a	a	DET
fnp-5188	335	8	more	more	ADV
fnp-5188	335	9	mesenchymal	mesenchymal	ADJ
fnp-5188	335	10	phenotype	phenotype	NOUN
fnp-5188	335	11	of	of	ADP
fnp-5188	335	12	glioma	glioma	NOUN
fnp-5188	335	13	-	-	PUNCT
fnp-5188	335	14	associated	associate	VERB
fnp-5188	335	15	vamcs	vamcs	NOUN
fnp-5188	335	16	and	and	CCONJ
fnp-5188	335	17	their	their	PRON
fnp-5188	335	18	subsequent	subsequent	ADJ
fnp-5188	335	19	activation	activation	NOUN
fnp-5188	335	20	might	might	AUX
fnp-5188	335	21	contribute	contribute	VERB
fnp-5188	335	22	to	to	ADP
fnp-5188	335	23	the	the	DET
fnp-5188	335	24	development	development	NOUN
fnp-5188	335	25	of	of	ADP
fnp-5188	335	26	vascular	vascular	ADJ
fnp-5188	335	27	alterations	alteration	NOUN
fnp-5188	335	28	in	in	ADP
fnp-5188	335	29	gbm	gbm	PROPN
fnp-5188	335	30	.	.	PUNCT
fnp-5188	336	1	unlike	unlike	ADP
fnp-5188	336	2	the	the	DET
fnp-5188	336	3	tight	tight	ADJ
fnp-5188	336	4	association	association	NOUN
fnp-5188	336	5	of	of	ADP
fnp-5188	336	6	gfp+	gfp+	PROPN
fnp-5188	336	7	vamcs	vamcs	PROPN
fnp-5188	336	8	and	and	CCONJ
fnp-5188	336	9	ecs	ec	NOUN
fnp-5188	336	10	that	that	PRON
fnp-5188	336	11	can	can	AUX
fnp-5188	336	12	be	be	AUX
fnp-5188	336	13	observed	observe	VERB
fnp-5188	336	14	in	in	ADP
fnp-5188	336	15	normal	normal	ADJ
fnp-5188	336	16	vessels	vessel	NOUN
fnp-5188	336	17	,	,	PUNCT
fnp-5188	336	18	cells	cell	NOUN
fnp-5188	336	19	with	with	ADP
fnp-5188	336	20	elevated	elevated	ADJ
fnp-5188	336	21	pdgfrβ	pdgfrβ	NOUN
fnp-5188	336	22	and	and	CCONJ
fnp-5188	336	23	αsma	αsma	NOUN
fnp-5188	336	24	levels	level	NOUN
fnp-5188	336	25	display	display	VERB
fnp-5188	336	26	an	an	DET
fnp-5188	336	27	abnormal	abnormal	ADJ
fnp-5188	336	28	separation	separation	NOUN
fnp-5188	336	29	,	,	PUNCT
fnp-5188	336	30	but	but	CCONJ
fnp-5188	336	31	also	also	ADV
fnp-5188	336	32	multi	multi	ADJ
fnp-5188	336	33	-	-	ADJ
fnp-5188	336	34	layered	layered	ADJ
fnp-5188	336	35	coverage	coverage	NOUN
fnp-5188	336	36	of	of	ADP
fnp-5188	336	37	vessels	vessel	NOUN
fnp-5188	336	38	(	(	PUNCT
fnp-5188	336	39	suppl	suppl	PROPN
fnp-5188	336	40	.	.	PUNCT
fnp-5188	336	41	fig	fig	NOUN
fnp-5188	336	42	.	.	PUNCT
fnp-5188	337	1	10	10	NUM
fnp-5188	337	2	)	)	PUNCT
fnp-5188	337	3	.	.	PUNCT
fnp-5188	338	1	as	as	SCONJ
fnp-5188	338	2	the	the	DET
fnp-5188	338	3	direct	direct	ADJ
fnp-5188	338	4	contact	contact	NOUN
fnp-5188	338	5	and	and	CCONJ
fnp-5188	338	6	communication	communication	NOUN
fnp-5188	338	7	between	between	ADP
fnp-5188	338	8	pericytes	pericyte	NOUN
fnp-5188	338	9	and	and	CCONJ
fnp-5188	338	10	ecs	ec	NOUN
fnp-5188	338	11	are	be	AUX
fnp-5188	338	12	critical	critical	ADJ
fnp-5188	338	13	for	for	ADP
fnp-5188	338	14	maintenance	maintenance	NOUN
fnp-5188	338	15	of	of	ADP
fnp-5188	338	16	cerebrovascular	cerebrovascular	ADJ
fnp-5188	338	17	stability	stability	NOUN
fnp-5188	338	18	and	and	CCONJ
fnp-5188	338	19	blood	blood	NOUN
fnp-5188	338	20	-	-	PUNCT
fnp-5188	338	21	brain	brain	NOUN
fnp-5188	338	22	-	-	PUNCT
fnp-5188	338	23	barrier	barrier	NOUN
fnp-5188	338	24	function	function	NOUN
fnp-5188	338	25	,	,	PUNCT
fnp-5188	338	26	the	the	DET
fnp-5188	338	27	observed	observe	VERB
fnp-5188	338	28	loose	loose	ADJ
fnp-5188	338	29	association	association	NOUN
fnp-5188	338	30	of	of	ADP
fnp-5188	338	31	gfp+	gfp+	PROPN
fnp-5188	338	32	cells	cell	NOUN
fnp-5188	338	33	to	to	ADP
fnp-5188	338	34	tumor	tumor	NOUN
fnp-5188	338	35	vessels	vessel	NOUN
fnp-5188	338	36	might	might	AUX
fnp-5188	338	37	result	result	VERB
fnp-5188	338	38	in	in	ADP
fnp-5188	338	39	vascular	vascular	ADJ
fnp-5188	338	40	dysfunction	dysfunction	NOUN
fnp-5188	338	41	.	.	PUNCT
fnp-5188	339	1	aberrations	aberration	NOUN
fnp-5188	339	2	in	in	ADP
fnp-5188	339	3	pericyte	pericyte	NOUN
fnp-5188	339	4	-	-	PUNCT
fnp-5188	339	5	ec	ec	PROPN
fnp-5188	339	6	signaling	signaling	NOUN
fnp-5188	339	7	are	be	AUX
fnp-5188	339	8	already	already	ADV
fnp-5188	339	9	known	know	VERB
fnp-5188	339	10	to	to	PART
fnp-5188	339	11	contribute	contribute	VERB
fnp-5188	339	12	to	to	ADP
fnp-5188	339	13	tumor	tumor	NOUN
fnp-5188	339	14	angiogenesis	angiogenesis	NOUN
fnp-5188	340	1	[	[	X
fnp-5188	340	2	57	57	NUM
fnp-5188	340	3	,	,	PUNCT
fnp-5188	340	4	58	58	NUM
fnp-5188	340	5	]	]	PUNCT
fnp-5188	340	6	.	.	PUNCT
fnp-5188	341	1	apart	apart	ADV
fnp-5188	341	2	from	from	ADP
fnp-5188	341	3	abnormal	abnormal	ADJ
fnp-5188	341	4	pericyte	pericyte	NOUN
fnp-5188	341	5	coverage	coverage	NOUN
fnp-5188	341	6	,	,	PUNCT
fnp-5188	341	7	tumor	tumor	NOUN
fnp-5188	341	8	vessels	vessel	NOUN
fnp-5188	341	9	displayed	display	VERB
fnp-5188	341	10	various	various	ADJ
fnp-5188	341	11	structural	structural	ADJ
fnp-5188	341	12	abnormalities	abnormality	NOUN
fnp-5188	341	13	.	.	PUNCT
fnp-5188	342	1	the	the	DET
fnp-5188	342	2	observed	observe	VERB
fnp-5188	342	3	high	high	ADJ
fnp-5188	342	4	amount	amount	NOUN
fnp-5188	342	5	of	of	ADP
fnp-5188	342	6	"	"	PUNCT
fnp-5188	342	7	emt	emt	NOUN
fnp-5188	342	8	-	-	PUNCT
fnp-5188	342	9	activated	activate	VERB
fnp-5188	342	10	-	-	PUNCT
fnp-5188	342	11	state	state	NOUN
fnp-5188	342	12	"	"	PUNCT
fnp-5188	342	13	gfp+	gfp+	PROPN
fnp-5188	342	14	glioma	glioma	NOUN
fnp-5188	342	15	-	-	PUNCT
fnp-5188	342	16	associated	associate	VERB
fnp-5188	342	17	vamcs	vamcs	NOUN
fnp-5188	342	18	in	in	ADP
fnp-5188	342	19	par	par	NOUN
fnp-5188	342	20	tumors	tumor	NOUN
fnp-5188	342	21	was	be	AUX
fnp-5188	342	22	paralleled	parallel	VERB
fnp-5188	342	23	by	by	ADP
fnp-5188	342	24	an	an	DET
fnp-5188	342	25	increased	increase	VERB
fnp-5188	342	26	vascular	vascular	ADJ
fnp-5188	342	27	density	density	NOUN
fnp-5188	342	28	and	and	CCONJ
fnp-5188	342	29	vascular	vascular	ADJ
fnp-5188	342	30	abnormalities	abnormality	NOUN
fnp-5188	342	31	which	which	PRON
fnp-5188	342	32	suggests	suggest	VERB
fnp-5188	342	33	an	an	DET
fnp-5188	342	34	important	important	ADJ
fnp-5188	342	35	role	role	NOUN
fnp-5188	342	36	of	of	ADP
fnp-5188	342	37	activated	activate	VERB
fnp-5188	342	38	pericytes	pericyte	NOUN
fnp-5188	342	39	in	in	ADP
fnp-5188	342	40	glioma	glioma	NOUN
fnp-5188	342	41	-	-	PUNCT
fnp-5188	342	42	associated	associate	VERB
fnp-5188	342	43	neoangiogenic	neoangiogenic	ADJ
fnp-5188	342	44	processes	process	NOUN
fnp-5188	342	45	.	.	PUNCT
fnp-5188	343	1	tumor	tumor	NOUN
fnp-5188	343	2	blood	blood	NOUN
fnp-5188	343	3	vessels	vessel	NOUN
fnp-5188	343	4	displayed	display	VERB
fnp-5188	343	5	inconsistent	inconsistent	ADJ
fnp-5188	343	6	diameter	diameter	NOUN
fnp-5188	343	7	and	and	CCONJ
fnp-5188	343	8	uneven	uneven	ADJ
fnp-5188	343	9	shape	shape	NOUN
fnp-5188	343	10	with	with	ADP
fnp-5188	343	11	abnormal	abnormal	ADJ
fnp-5188	343	12	bulges	bulge	NOUN
fnp-5188	343	13	,	,	PUNCT
fnp-5188	343	14	blind	blind	ADJ
fnp-5188	343	15	ends	end	NOUN
fnp-5188	343	16	and	and	CCONJ
fnp-5188	343	17	glomeroid	glomeroid	ADJ
fnp-5188	343	18	-	-	PUNCT
fnp-5188	343	19	like	like	ADJ
fnp-5188	343	20	structures	structure	NOUN
fnp-5188	343	21	(	(	PUNCT
fnp-5188	343	22	fig	fig	NOUN
fnp-5188	343	23	.	.	PUNCT
fnp-5188	344	1	5	5	NUM
fnp-5188	344	2	,	,	PUNCT
fnp-5188	344	3	8	8	NUM
fnp-5188	344	4	,	,	PUNCT
fnp-5188	344	5	9	9	NUM
fnp-5188	344	6	,	,	PUNCT
fnp-5188	344	7	suppl	suppl	PROPN
fnp-5188	344	8	.	.	PUNCT
fnp-5188	344	9	fig	fig	PROPN
fnp-5188	344	10	.	.	PUNCT
fnp-5188	345	1	10	10	NUM
fnp-5188	345	2	,	,	PUNCT
fnp-5188	345	3	11	11	NUM
fnp-5188	345	4	)	)	PUNCT
fnp-5188	345	5	.	.	PUNCT
fnp-5188	346	1	in	in	ADP
fnp-5188	346	2	gbms	gbms	NOUN
fnp-5188	346	3	,	,	PUNCT
fnp-5188	346	4	structural	structural	ADJ
fnp-5188	346	5	and	and	CCONJ
fnp-5188	346	6	functional	functional	ADJ
fnp-5188	346	7	abnormalities	abnormality	NOUN
fnp-5188	346	8	of	of	ADP
fnp-5188	346	9	peritumoral	peritumoral	ADJ
fnp-5188	346	10	vessels	vessel	NOUN
fnp-5188	346	11	are	be	AUX
fnp-5188	346	12	often	often	ADV
fnp-5188	346	13	associated	associate	VERB
fnp-5188	346	14	with	with	ADP
fnp-5188	346	15	an	an	DET
fnp-5188	346	16	inconsistent	inconsistent	ADJ
fnp-5188	346	17	,	,	PUNCT
fnp-5188	346	18	disrupted	disrupt	VERB
fnp-5188	346	19	bbb	bbb	PROPN
fnp-5188	346	20	that	that	PRON
fnp-5188	346	21	may	may	AUX
fnp-5188	346	22	constitute	constitute	VERB
fnp-5188	346	23	a	a	DET
fnp-5188	346	24	main	main	ADJ
fnp-5188	346	25	hurdle	hurdle	NOUN
fnp-5188	346	26	for	for	ADP
fnp-5188	346	27	targeting	target	VERB
fnp-5188	346	28	gbm	gbm	NOUN
fnp-5188	346	29	by	by	ADP
fnp-5188	346	30	limiting	limit	VERB
fnp-5188	346	31	adequate	adequate	ADJ
fnp-5188	346	32	drug	drug	NOUN
fnp-5188	346	33	delivery	delivery	NOUN
fnp-5188	346	34	.	.	PUNCT
fnp-5188	347	1	pericytes	pericyte	NOUN
fnp-5188	347	2	,	,	PUNCT
fnp-5188	347	3	being	be	AUX
fnp-5188	347	4	important	important	ADJ
fnp-5188	347	5	contributors	contributor	NOUN
fnp-5188	347	6	to	to	ADP
fnp-5188	347	7	the	the	DET
fnp-5188	347	8	establishment	establishment	NOUN
fnp-5188	347	9	and	and	CCONJ
fnp-5188	347	10	maintenance	maintenance	NOUN
fnp-5188	347	11	of	of	ADP
fnp-5188	347	12	bbb	bbb	PROPN
fnp-5188	347	13	integrity	integrity	NOUN
fnp-5188	347	14	by	by	ADP
fnp-5188	347	15	regulating	regulate	VERB
fnp-5188	347	16	tight	tight	ADJ
fnp-5188	347	17	and	and	CCONJ
fnp-5188	347	18	adherens	adheren	NOUN
fnp-5188	347	19	junctions	junction	NOUN
fnp-5188	347	20	as	as	ADV
fnp-5188	347	21	well	well	ADV
fnp-5188	347	22	as	as	ADP
fnp-5188	347	23	transcytosis	transcytosis	NOUN
fnp-5188	347	24	across	across	ADP
fnp-5188	347	25	endothelial	endothelial	ADJ
fnp-5188	347	26	cells	cell	NOUN
fnp-5188	347	27	[	[	X
fnp-5188	347	28	59	59	NUM
fnp-5188	347	29	]	]	PUNCT
fnp-5188	347	30	,	,	PUNCT
fnp-5188	347	31	can	can	AUX
fnp-5188	347	32	be	be	AUX
fnp-5188	347	33	functionally	functionally	ADV
fnp-5188	347	34	modified	modify	VERB
fnp-5188	347	35	by	by	ADP
fnp-5188	347	36	gbm	gbm	NOUN
fnp-5188	347	37	cells	cell	NOUN
fnp-5188	347	38	[	[	X
fnp-5188	347	39	60	60	NUM
fnp-5188	347	40	]	]	PUNCT
fnp-5188	347	41	.	.	PUNCT
fnp-5188	348	1	via	via	ADP
fnp-5188	348	2	the	the	DET
fnp-5188	348	3	tgf	tgf	PROPN
fnp-5188	348	4	-	-	PUNCT
fnp-5188	348	5	β	β	NOUN
fnp-5188	348	6	-	-	PUNCT
fnp-5188	348	7	mediated	mediate	VERB
fnp-5188	348	8	induction	induction	NOUN
fnp-5188	348	9	of	of	ADP
fnp-5188	348	10	emt	emt	NOUN
fnp-5188	348	11	-	-	PUNCT
fnp-5188	348	12	factors	factor	NOUN
fnp-5188	348	13	in	in	ADP
fnp-5188	348	14	vamcs	vamcs	NOUN
fnp-5188	348	15	,	,	PUNCT
fnp-5188	348	16	gbm	gbm	PROPN
fnp-5188	348	17	cells	cell	NOUN
fnp-5188	348	18	are	be	AUX
fnp-5188	348	19	able	able	ADJ
fnp-5188	348	20	to	to	PART
fnp-5188	348	21	induce	induce	VERB
fnp-5188	348	22	proliferation	proliferation	NOUN
fnp-5188	348	23	and	and	CCONJ
fnp-5188	348	24	cell	cell	NOUN
fnp-5188	348	25	motility	motility	NOUN
fnp-5188	349	1	[	[	X
fnp-5188	349	2	15	15	NUM
fnp-5188	349	3	,	,	PUNCT
fnp-5188	349	4	16	16	NUM
fnp-5188	349	5	]	]	PUNCT
fnp-5188	349	6	and	and	CCONJ
fnp-5188	349	7	notably	notably	ADV
fnp-5188	349	8	change	change	VERB
fnp-5188	349	9	the	the	DET
fnp-5188	349	10	metabolic	metabolic	NOUN
fnp-5188	349	11	behavior	behavior	NOUN
fnp-5188	349	12	of	of	ADP
fnp-5188	349	13	pericytes	pericyte	NOUN
fnp-5188	349	14	.	.	PUNCT
fnp-5188	350	1	schumacher	schumacher	PROPN
fnp-5188	350	2	et	et	PROPN
fnp-5188	350	3	al	al	PROPN
fnp-5188	350	4	.	.	PROPN
fnp-5188	350	5	demonstrated	demonstrate	VERB
fnp-5188	350	6	that	that	SCONJ
fnp-5188	350	7	tgf	tgf	PROPN
fnp-5188	350	8	-	-	PUNCT
fnp-5188	350	9	β	β	NOUN
fnp-5188	350	10	treatment	treatment	NOUN
fnp-5188	350	11	of	of	ADP
fnp-5188	350	12	hbvps	hbvps	PROPN
fnp-5188	350	13	results	result	NOUN
fnp-5188	350	14	in	in	ADP
fnp-5188	350	15	bbb	bbb	NOUN
fnp-5188	350	16	disruption	disruption	NOUN
fnp-5188	350	17	at	at	ADP
fnp-5188	350	18	least	least	ADJ
fnp-5188	350	19	in	in	ADP
fnp-5188	350	20	vitro	vitro	X
fnp-5188	350	21	.	.	PUNCT
fnp-5188	351	1	additional	additional	ADJ
fnp-5188	351	2	metabolomic	metabolomic	ADJ
fnp-5188	351	3	and	and	CCONJ
fnp-5188	351	4	transcriptomic	transcriptomic	ADJ
fnp-5188	351	5	analyses	analysis	NOUN
fnp-5188	351	6	underscored	underscore	VERB
fnp-5188	351	7	that	that	SCONJ
fnp-5188	351	8	the	the	DET
fnp-5188	351	9	tgf	tgf	PROPN
fnp-5188	351	10	-	-	PUNCT
fnp-5188	351	11	β	β	NOUN
fnp-5188	351	12	-	-	PUNCT
fnp-5188	351	13	mediated	mediate	VERB
fnp-5188	351	14	functional	functional	ADJ
fnp-5188	351	15	and	and	CCONJ
fnp-5188	351	16	metabolic	metabolic	NOUN
fnp-5188	351	17	changes	change	NOUN
fnp-5188	351	18	in	in	ADP
fnp-5188	351	19	pericytes	pericyte	NOUN
fnp-5188	351	20	are	be	AUX
fnp-5188	351	21	closely	closely	ADV
fnp-5188	351	22	connected	connect	VERB
fnp-5188	351	23	with	with	ADP
fnp-5188	351	24	their	their	PRON
fnp-5188	351	25	role	role	NOUN
fnp-5188	351	26	during	during	ADP
fnp-5188	351	27	angiogenic	angiogenic	ADJ
fnp-5188	351	28	processes	process	NOUN
fnp-5188	351	29	[	[	X
fnp-5188	351	30	17	17	NUM
fnp-5188	351	31	]	]	PUNCT
fnp-5188	351	32	.	.	PUNCT
fnp-5188	352	1	in	in	ADP
fnp-5188	352	2	combination	combination	NOUN
fnp-5188	352	3	with	with	ADP
fnp-5188	352	4	the	the	DET
fnp-5188	352	5	lower	low	ADJ
fnp-5188	352	6	mural	mural	ADJ
fnp-5188	352	7	cell	cell	NOUN
fnp-5188	352	8	activation	activation	NOUN
fnp-5188	352	9	state	state	NOUN
fnp-5188	352	10	and	and	CCONJ
fnp-5188	352	11	the	the	DET
fnp-5188	352	12	less	less	ADV
fnp-5188	352	13	chaotic	chaotic	ADJ
fnp-5188	352	14	vessel	vessel	NOUN
fnp-5188	352	15	structure	structure	NOUN
fnp-5188	352	16	,	,	PUNCT
fnp-5188	352	17	we	we	PRON
fnp-5188	352	18	observed	observe	VERB
fnp-5188	352	19	after	after	ADP
fnp-5188	352	20	preventing	prevent	VERB
fnp-5188	352	21	the	the	DET
fnp-5188	352	22	induction	induction	NOUN
fnp-5188	352	23	of	of	ADP
fnp-5188	352	24	slug	slug	NOUN
fnp-5188	352	25	expression	expression	NOUN
fnp-5188	352	26	in	in	ADP
fnp-5188	352	27	glioma	glioma	NOUN
fnp-5188	352	28	associated	associate	VERB
fnp-5188	352	29	vamcs	vamcs	NOUN
fnp-5188	352	30	in	in	ADP
fnp-5188	352	31	vivo	vivo	NOUN
fnp-5188	352	32	,	,	PUNCT
fnp-5188	352	33	our	our	PRON
fnp-5188	352	34	findings	finding	NOUN
fnp-5188	352	35	suggest	suggest	VERB
fnp-5188	352	36	that	that	SCONJ
fnp-5188	352	37	the	the	DET
fnp-5188	352	38	bbb	bbb	PROPN
fnp-5188	352	39	integrity	integrity	NOUN
fnp-5188	352	40	might	might	AUX
fnp-5188	352	41	also	also	ADV
fnp-5188	352	42	be	be	AUX
fnp-5188	352	43	affected	affect	VERB
fnp-5188	352	44	.	.	PUNCT
fnp-5188	353	1	however	however	ADV
fnp-5188	353	2	,	,	PUNCT
fnp-5188	353	3	this	this	PRON
fnp-5188	353	4	has	have	VERB
fnp-5188	353	5	to	to	PART
fnp-5188	353	6	be	be	AUX
fnp-5188	353	7	further	far	ADV
fnp-5188	353	8	evaluated	evaluate	VERB
fnp-5188	353	9	for	for	ADP
fnp-5188	353	10	example	example	NOUN
fnp-5188	353	11	by	by	ADP
fnp-5188	353	12	measuring	measure	VERB
fnp-5188	353	13	the	the	DET
fnp-5188	353	14	uptake	uptake	NOUN
fnp-5188	353	15	of	of	ADP
fnp-5188	353	16	contrast	contrast	NOUN
fnp-5188	353	17	agents	agent	NOUN
fnp-5188	353	18	using	use	VERB
fnp-5188	353	19	small	small	ADJ
fnp-5188	353	20	animal	animal	NOUN
fnp-5188	353	21	mri	mri	NOUN
fnp-5188	353	22	.	.	PUNCT
fnp-5188	354	1	conclusions	conclusion	NOUN
fnp-5188	354	2	induced	induce	VERB
fnp-5188	354	3	by	by	ADP
fnp-5188	354	4	gbm	gbm	PROPN
fnp-5188	354	5	cell	cell	NOUN
fnp-5188	354	6	secreted	secrete	VERB
fnp-5188	354	7	tgf	tgf	PROPN
fnp-5188	354	8	-	-	PUNCT
fnp-5188	354	9	β	β	NOUN
fnp-5188	354	10	,	,	PUNCT
fnp-5188	354	11	microvascular	microvascular	ADJ
fnp-5188	354	12	brain	brain	NOUN
fnp-5188	354	13	pericytes	pericyte	NOUN
fnp-5188	354	14	undergo	undergo	VERB
fnp-5188	354	15	an	an	DET
fnp-5188	354	16	emt	emt	NOUN
fnp-5188	354	17	-	-	PUNCT
fnp-5188	354	18	like	like	ADJ
fnp-5188	354	19	"	"	PUNCT
fnp-5188	354	20	activation	activation	NOUN
fnp-5188	354	21	"	"	PUNCT
fnp-5188	354	22	process	process	NOUN
fnp-5188	354	23	,	,	PUNCT
fnp-5188	354	24	indicated	indicate	VERB
fnp-5188	354	25	by	by	ADP
fnp-5188	354	26	an	an	DET
fnp-5188	354	27	induction	induction	NOUN
fnp-5188	354	28	of	of	ADP
fnp-5188	354	29	the	the	DET
fnp-5188	354	30	emt	emt	PROPN
fnp-5188	354	31	-	-	PUNCT
fnp-5188	354	32	associated	associate	VERB
fnp-5188	354	33	expressional	expressional	ADJ
fnp-5188	354	34	regulator	regulator	NOUN
fnp-5188	354	35	slug	slug	NOUN
fnp-5188	354	36	.	.	PUNCT
fnp-5188	355	1	in	in	ADP
fnp-5188	355	2	vitro	vitro	X
fnp-5188	355	3	,	,	PUNCT
fnp-5188	355	4	this	this	DET
fnp-5188	355	5	phenomenon	phenomenon	NOUN
fnp-5188	355	6	is	be	AUX
fnp-5188	355	7	associated	associate	VERB
fnp-5188	355	8	with	with	ADP
fnp-5188	355	9	elevated	elevated	ADJ
fnp-5188	355	10	proliferation	proliferation	NOUN
fnp-5188	355	11	,	,	PUNCT
fnp-5188	355	12	cell	cell	NOUN
fnp-5188	355	13	motility	motility	NOUN
fnp-5188	355	14	and	and	CCONJ
fnp-5188	355	15	morphological	morphological	ADJ
fnp-5188	355	16	changes	change	NOUN
fnp-5188	355	17	.	.	PUNCT
fnp-5188	356	1	in	in	ADP
fnp-5188	356	2	our	our	PRON
fnp-5188	356	3	study	study	NOUN
fnp-5188	356	4	,	,	PUNCT
fnp-5188	356	5	we	we	PRON
fnp-5188	356	6	demonstrate	demonstrate	VERB
fnp-5188	356	7	that	that	SCONJ
fnp-5188	356	8	an	an	DET
fnp-5188	356	9	emt	emt	NOUN
fnp-5188	356	10	-	-	PUNCT
fnp-5188	356	11	like	like	ADJ
fnp-5188	356	12	"	"	PUNCT
fnp-5188	356	13	activation	activation	NOUN
fnp-5188	356	14	"	"	PUNCT
fnp-5188	356	15	of	of	ADP
fnp-5188	356	16	glioma	glioma	NOUN
fnp-5188	356	17	-	-	PUNCT
fnp-5188	356	18	associated	associate	VERB
fnp-5188	356	19	,	,	PUNCT
fnp-5188	356	20	rgs5	rgs5	VERB
fnp-5188	356	21	expressing	express	VERB
fnp-5188	356	22	vamcs	vamcs	NOUN
fnp-5188	356	23	is	be	AUX
fnp-5188	356	24	also	also	ADV
fnp-5188	356	25	associated	associate	VERB
fnp-5188	356	26	with	with	ADP
fnp-5188	356	27	vascular	vascular	ADJ
fnp-5188	356	28	malformation	malformation	NOUN
fnp-5188	356	29	.	.	PUNCT
fnp-5188	357	1	both	both	CCONJ
fnp-5188	357	2	the	the	DET
fnp-5188	357	3	knockout	knockout	NOUN
fnp-5188	357	4	of	of	ADP
fnp-5188	357	5	tgf	tgf	PROPN
fnp-5188	357	6	-	-	PUNCT
fnp-5188	357	7	β	β	PROPN
fnp-5188	357	8	in	in	ADP
fnp-5188	357	9	glioma	glioma	NOUN
fnp-5188	357	10	cells	cell	NOUN
fnp-5188	357	11	and	and	CCONJ
fnp-5188	357	12	the	the	DET
fnp-5188	357	13	prevention	prevention	NOUN
fnp-5188	357	14	of	of	ADP
fnp-5188	357	15	slug	slug	NOUN
fnp-5188	357	16	-	-	PUNCT
fnp-5188	357	17	induction	induction	NOUN
fnp-5188	357	18	in	in	ADP
fnp-5188	357	19	glioma	glioma	NOUN
fnp-5188	357	20	-	-	PUNCT
fnp-5188	357	21	associated	associate	VERB
fnp-5188	357	22	vamcs	vamcs	NOUN
fnp-5188	357	23	mitigated	mitigate	VERB
fnp-5188	357	24	the	the	DET
fnp-5188	357	25	amount	amount	NOUN
fnp-5188	357	26	of	of	ADP
fnp-5188	357	27	activated	activate	VERB
fnp-5188	357	28	pericytes	pericyte	NOUN
fnp-5188	357	29	or	or	CCONJ
fnp-5188	357	30	vamcs	vamcs	NOUN
fnp-5188	357	31	in	in	ADP
fnp-5188	357	32	the	the	DET
fnp-5188	357	33	tumor	tumor	NOUN
fnp-5188	357	34	core	core	NOUN
fnp-5188	357	35	,	,	PUNCT
fnp-5188	357	36	as	as	SCONJ
fnp-5188	357	37	shown	show	VERB
fnp-5188	357	38	by	by	ADP
fnp-5188	357	39	a	a	DET
fnp-5188	357	40	reduced	reduced	ADJ
fnp-5188	357	41	expression	expression	NOUN
fnp-5188	357	42	of	of	ADP
fnp-5188	357	43	activation	activation	NOUN
fnp-5188	357	44	markers	marker	NOUN
fnp-5188	357	45	such	such	ADJ
fnp-5188	357	46	as	as	ADP
fnp-5188	357	47	pdgfrβ	pdgfrβ	NOUN
fnp-5188	357	48	or	or	CCONJ
fnp-5188	357	49	αsma	αsma	NOUN
fnp-5188	357	50	.	.	PUNCT
fnp-5188	358	1	in	in	ADP
fnp-5188	358	2	addition	addition	NOUN
fnp-5188	358	3	,	,	PUNCT
fnp-5188	358	4	the	the	DET
fnp-5188	358	5	prevention	prevention	NOUN
fnp-5188	358	6	of	of	ADP
fnp-5188	358	7	this	this	DET
fnp-5188	358	8	activation	activation	NOUN
fnp-5188	358	9	diminished	diminish	VERB
fnp-5188	358	10	the	the	DET
fnp-5188	358	11	total	total	ADJ
fnp-5188	358	12	amount	amount	NOUN
fnp-5188	358	13	of	of	ADP
fnp-5188	358	14	gfp+	gfp+	PROPN
fnp-5188	358	15	vamcs	vamcs	NOUN
fnp-5188	358	16	covering	cover	VERB
fnp-5188	358	17	the	the	DET
fnp-5188	358	18	tumor	tumor	NOUN
fnp-5188	358	19	vasculature	vasculature	NOUN
fnp-5188	358	20	and	and	CCONJ
fnp-5188	358	21	also	also	ADV
fnp-5188	358	22	,	,	PUNCT
fnp-5188	358	23	at	at	ADP
fnp-5188	358	24	least	least	ADJ
fnp-5188	358	25	partially	partially	ADV
fnp-5188	358	26	,	,	PUNCT
fnp-5188	358	27	led	lead	VERB
fnp-5188	358	28	to	to	ADP
fnp-5188	358	29	a	a	DET
fnp-5188	358	30	restoration	restoration	NOUN
fnp-5188	358	31	of	of	ADP
fnp-5188	358	32	the	the	DET
fnp-5188	358	33	chaotic	chaotic	ADJ
fnp-5188	358	34	vessel	vessel	NOUN
fnp-5188	358	35	structure	structure	NOUN
fnp-5188	358	36	towards	towards	ADP
fnp-5188	358	37	a	a	DET
fnp-5188	358	38	more	more	ADV
fnp-5188	358	39	normal	normal	ADJ
fnp-5188	358	40	vascular	vascular	ADJ
fnp-5188	358	41	morphology	morphology	NOUN
fnp-5188	358	42	.	.	PUNCT
fnp-5188	359	1	in	in	ADP
fnp-5188	359	2	summary	summary	NOUN
fnp-5188	359	3	,	,	PUNCT
fnp-5188	359	4	our	our	PRON
fnp-5188	359	5	findings	finding	NOUN
fnp-5188	359	6	suggest	suggest	VERB
fnp-5188	359	7	that	that	SCONJ
fnp-5188	359	8	the	the	DET
fnp-5188	359	9	induction	induction	NOUN
fnp-5188	359	10	of	of	ADP
fnp-5188	359	11	an	an	DET
fnp-5188	359	12	emt	emt	NOUN
fnp-5188	359	13	-	-	PUNCT
fnp-5188	359	14	like	like	ADJ
fnp-5188	359	15	program	program	NOUN
fnp-5188	359	16	in	in	ADP
fnp-5188	359	17	glioma	glioma	NOUN
fnp-5188	359	18	-	-	PUNCT
fnp-5188	359	19	associated	associate	VERB
fnp-5188	359	20	vamcs	vamcs	NOUN
fnp-5188	359	21	is	be	AUX
fnp-5188	359	22	the	the	DET
fnp-5188	359	23	prominent	prominent	ADJ
fnp-5188	359	24	cause	cause	NOUN
fnp-5188	359	25	of	of	ADP
fnp-5188	359	26	vessel	vessel	NOUN
fnp-5188	359	27	abnormalities	abnormality	NOUN
fnp-5188	359	28	frequently	frequently	ADV
fnp-5188	359	29	observed	observe	VERB
fnp-5188	359	30	in	in	ADP
fnp-5188	359	31	gbm	gbm	PROPN
fnp-5188	359	32	.	.	PROPN
fnp-5188	360	1	acknowledgment	acknowledgment	NOUN
fnp-5188	360	2	we	we	PRON
fnp-5188	360	3	would	would	AUX
fnp-5188	360	4	like	like	VERB
fnp-5188	360	5	to	to	PART
fnp-5188	360	6	acknowledge	acknowledge	VERB
fnp-5188	360	7	dr	dr	PROPN
fnp-5188	360	8	.	.	PROPN
fnp-5188	360	9	olga	olga	PROPN
fnp-5188	361	1	oleksiuk	oleksiuk	PROPN
fnp-5188	361	2	of	of	ADP
fnp-5188	361	3	the	the	DET
fnp-5188	361	4	hih	hih	PROPN
fnp-5188	361	5	-	-	PUNCT
fnp-5188	361	6	cin	cin	PROPN
fnp-5188	361	7	imaging	imaging	NOUN
fnp-5188	361	8	cluster	cluster	NOUN
fnp-5188	361	9	for	for	ADP
fnp-5188	361	10	her	her	PRON
fnp-5188	361	11	support	support	NOUN
fnp-5188	361	12	in	in	ADP
fnp-5188	361	13	all	all	DET
fnp-5188	361	14	microscopy	microscopy	NOUN
fnp-5188	361	15	and	and	CCONJ
fnp-5188	361	16	microanalysis	microanalysis	ADJ
fnp-5188	361	17	experiments	experiment	NOUN
fnp-5188	361	18	.	.	PUNCT
fnp-5188	362	1	we	we	PRON
fnp-5188	362	2	also	also	ADV
fnp-5188	362	3	like	like	VERB
fnp-5188	362	4	to	to	PART
fnp-5188	362	5	thank	thank	VERB
fnp-5188	362	6	ulrich	ulrich	PROPN
fnp-5188	362	7	mattheus	mattheus	NOUN
fnp-5188	362	8	for	for	ADP
fnp-5188	362	9	his	his	PRON
fnp-5188	362	10	support	support	NOUN
fnp-5188	362	11	in	in	ADP
fnp-5188	362	12	the	the	DET
fnp-5188	362	13	clarity	clarity	NOUN
fnp-5188	362	14	experiments	experiment	NOUN
fnp-5188	362	15	.	.	PUNCT
fnp-5188	363	1	michel	michel	PROPN
fnp-5188	363	2	mittelbronn	mittelbronn	PROPN
fnp-5188	363	3	would	would	AUX
fnp-5188	363	4	like	like	VERB
fnp-5188	363	5	to	to	PART
fnp-5188	363	6	thank	thank	VERB
fnp-5188	363	7	the	the	DET
fnp-5188	363	8	luxembourg	luxembourg	PROPN
fnp-5188	363	9	national	national	PROPN
fnp-5188	363	10	research	research	PROPN
fnp-5188	363	11	fond	fond	ADJ
fnp-5188	363	12	(	(	PUNCT
fnp-5188	363	13	fnr	fnr	PROPN
fnp-5188	363	14	)	)	PUNCT
fnp-5188	363	15	for	for	ADP
fnp-5188	363	16	the	the	DET
fnp-5188	363	17	support	support	NOUN
fnp-5188	363	18	(	(	PUNCT
fnp-5188	363	19	fnr	fnr	PROPN
fnp-5188	363	20	pearl	pearl	NOUN
fnp-5188	363	21	p16	p16	PROPN
fnp-5188	363	22	/	/	SYM
fnp-5188	363	23	bm/11192868	bm/11192868	ADJ
fnp-5188	363	24	grant	grant	NOUN
fnp-5188	363	25	)	)	PUNCT
fnp-5188	363	26	.	.	PUNCT
fnp-5188	364	1	authors	author	NOUN
fnp-5188	364	2	'	'	PART
fnp-5188	364	3	contributions	contribution	NOUN
fnp-5188	364	4	un	un	PROPN
fnp-5188	364	5	has	have	AUX
fnp-5188	364	6	designed	design	VERB
fnp-5188	364	7	and	and	CCONJ
fnp-5188	364	8	supervised	supervise	VERB
fnp-5188	364	9	the	the	DET
fnp-5188	364	10	study	study	NOUN
fnp-5188	364	11	,	,	PUNCT
fnp-5188	364	12	has	have	VERB
fnp-5188	364	13	full	full	ADJ
fnp-5188	364	14	access	access	NOUN
fnp-5188	364	15	to	to	ADP
fnp-5188	364	16	all	all	DET
fnp-5188	364	17	data	datum	NOUN
fnp-5188	364	18	in	in	ADP
fnp-5188	364	19	the	the	DET
fnp-5188	364	20	study	study	NOUN
fnp-5188	364	21	and	and	CCONJ
fnp-5188	364	22	takes	take	VERB
fnp-5188	364	23	responsibility	responsibility	NOUN
fnp-5188	364	24	for	for	ADP
fnp-5188	364	25	the	the	DET
fnp-5188	364	26	integrity	integrity	NOUN
fnp-5188	364	27	of	of	ADP
fnp-5188	364	28	the	the	DET
fnp-5188	364	29	data	datum	NOUN
fnp-5188	364	30	and	and	CCONJ
fnp-5188	364	31	the	the	DET
fnp-5188	364	32	accuracy	accuracy	NOUN
fnp-5188	364	33	of	of	ADP
fnp-5188	364	34	the	the	DET
fnp-5188	364	35	data	datum	NOUN
fnp-5188	364	36	analysis	analysis	NOUN
fnp-5188	364	37	.	.	PUNCT
fnp-5188	365	1	un	un	PROPN
fnp-5188	365	2	and	and	CCONJ
fnp-5188	365	3	lm	lm	PROPN
fnp-5188	365	4	wrote	write	VERB
fnp-5188	365	5	the	the	DET
fnp-5188	365	6	manuscript	manuscript	NOUN
fnp-5188	365	7	.	.	PUNCT
fnp-5188	366	1	mm	mm	PROPN
fnp-5188	366	2	performed	perform	VERB
fnp-5188	366	3	critical	critical	ADJ
fnp-5188	366	4	review	review	NOUN
fnp-5188	366	5	of	of	ADP
fnp-5188	366	6	the	the	DET
fnp-5188	366	7	manuscript	manuscript	NOUN
fnp-5188	366	8	.	.	PUNCT
fnp-5188	367	1	lm	lm	PROPN
fnp-5188	367	2	,	,	PUNCT
fnp-5188	367	3	kr	kr	PROPN
fnp-5188	367	4	,	,	PUNCT
fnp-5188	367	5	he	he	PRON
fnp-5188	367	6	,	,	PUNCT
fnp-5188	367	7	me	i	PRON
fnp-5188	367	8	,	,	PUNCT
fnp-5188	367	9	aea	aea	PROPN
fnp-5188	367	10	,	,	PUNCT
fnp-5188	367	11	mm	mm	PROPN
fnp-5188	367	12	,	,	PUNCT
fnp-5188	367	13	jjg	jjg	PROPN
fnp-5188	367	14	and	and	CCONJ
fnp-5188	367	15	mk	mk	PROPN
fnp-5188	367	16	performed	perform	VERB
fnp-5188	367	17	experiments	experiment	NOUN
fnp-5188	367	18	and	and	CCONJ
fnp-5188	367	19	analyzed	analyze	VERB
fnp-5188	367	20	data	datum	NOUN
fnp-5188	367	21	.	.	PUNCT
fnp-5188	368	1	institutional	institutional	ADJ
fnp-5188	368	2	review	review	PROPN
fnp-5188	368	3	board	board	NOUN
fnp-5188	368	4	statement	statement	NOUN
fnp-5188	368	5	all	all	DET
fnp-5188	368	6	research	research	NOUN
fnp-5188	368	7	meets	meet	VERB
fnp-5188	368	8	ethical	ethical	ADJ
fnp-5188	368	9	guidelines	guideline	NOUN
fnp-5188	368	10	and	and	CCONJ
fnp-5188	368	11	adheres	adhere	NOUN
fnp-5188	368	12	to	to	ADP
fnp-5188	368	13	the	the	DET
fnp-5188	368	14	legal	legal	ADJ
fnp-5188	368	15	requirements	requirement	NOUN
fnp-5188	368	16	of	of	ADP
fnp-5188	368	17	the	the	DET
fnp-5188	368	18	study	study	NOUN
fnp-5188	368	19	country	country	NOUN
fnp-5188	368	20	.	.	PUNCT
fnp-5188	369	1	animal	animal	NOUN
fnp-5188	369	2	work	work	NOUN
fnp-5188	369	3	was	be	AUX
fnp-5188	369	4	performed	perform	VERB
fnp-5188	369	5	in	in	ADP
fnp-5188	369	6	accordance	accordance	NOUN
fnp-5188	369	7	with	with	ADP
fnp-5188	369	8	the	the	DET
fnp-5188	369	9	german	german	ADJ
fnp-5188	369	10	animal	animal	NOUN
fnp-5188	369	11	welfare	welfare	NOUN
fnp-5188	369	12	act	act	NOUN
fnp-5188	369	13	and	and	CCONJ
fnp-5188	369	14	its	its	PRON
fnp-5188	369	15	guidelines	guideline	NOUN
fnp-5188	369	16	and	and	CCONJ
fnp-5188	369	17	was	be	AUX
fnp-5188	369	18	approved	approve	VERB
fnp-5188	369	19	by	by	ADP
fnp-5188	369	20	the	the	DET
fnp-5188	369	21	regional	regional	ADJ
fnp-5188	369	22	council	council	PROPN
fnp-5188	369	23	of	of	ADP
fnp-5188	369	24	tübingen	tübingen	PROPN
fnp-5188	369	25	(	(	PUNCT
fnp-5188	369	26	approval	approval	NOUN
fnp-5188	369	27	n7/17	n7/17	NOUN
fnp-5188	369	28	)	)	PUNCT
fnp-5188	369	29	.	.	PUNCT
fnp-5188	370	1	data	datum	NOUN
fnp-5188	370	2	availability	availability	NOUN
fnp-5188	370	3	statement	statement	NOUN
fnp-5188	370	4	the	the	DET
fnp-5188	370	5	datasets	dataset	NOUN
fnp-5188	370	6	and	and	CCONJ
fnp-5188	370	7	material	material	NOUN
fnp-5188	370	8	generated	generate	VERB
fnp-5188	370	9	and/or	and/or	CCONJ
fnp-5188	370	10	analyzed	analyze	VERB
fnp-5188	370	11	during	during	ADP
fnp-5188	370	12	the	the	DET
fnp-5188	370	13	current	current	ADJ
fnp-5188	370	14	study	study	NOUN
fnp-5188	370	15	are	be	AUX
fnp-5188	370	16	available	available	ADJ
fnp-5188	370	17	on	on	ADP
fnp-5188	370	18	demand	demand	NOUN
fnp-5188	370	19	.	.	PUNCT
fnp-5188	371	1	conflict	conflict	NOUN
fnp-5188	371	2	of	of	ADP
fnp-5188	371	3	interest	interest	NOUN
fnp-5188	371	4	the	the	DET
fnp-5188	371	5	authors	author	NOUN
fnp-5188	371	6	declare	declare	VERB
fnp-5188	371	7	no	no	DET
fnp-5188	371	8	conflicts	conflict	NOUN
fnp-5188	371	9	of	of	ADP
fnp-5188	371	10	interest	interest	NOUN
fnp-5188	371	11	.	.	PUNCT
fnp-5188	372	1	all	all	DET
fnp-5188	372	2	coauthors	coauthor	NOUN
fnp-5188	372	3	have	have	AUX
fnp-5188	372	4	reviewed	review	VERB
fnp-5188	372	5	and	and	CCONJ
fnp-5188	372	6	approved	approve	VERB
fnp-5188	372	7	the	the	DET
fnp-5188	372	8	contents	content	NOUN
fnp-5188	372	9	of	of	ADP
fnp-5188	372	10	the	the	DET
fnp-5188	372	11	manuscript	manuscript	NOUN
fnp-5188	372	12	and	and	CCONJ
fnp-5188	372	13	that	that	SCONJ
fnp-5188	372	14	the	the	DET
fnp-5188	372	15	requirements	requirement	NOUN
fnp-5188	372	16	for	for	ADP
fnp-5188	372	17	authorship	authorship	NOUN
fnp-5188	372	18	have	have	AUX
fnp-5188	372	19	been	be	AUX
fnp-5188	372	20	met	meet	VERB
fnp-5188	372	21	.	.	PUNCT
fnp-5188	373	1	institutional	institutional	ADJ
fnp-5188	373	2	review	review	PROPN
fnp-5188	373	3	board	board	NOUN
fnp-5188	373	4	statement	statement	NOUN
fnp-5188	373	5	all	all	DET
fnp-5188	373	6	research	research	NOUN
fnp-5188	373	7	meets	meet	VERB
fnp-5188	373	8	ethical	ethical	ADJ
fnp-5188	373	9	guidelines	guideline	NOUN
fnp-5188	373	10	and	and	CCONJ
fnp-5188	373	11	adheres	adhere	NOUN
fnp-5188	373	12	to	to	ADP
fnp-5188	373	13	the	the	DET
fnp-5188	373	14	legal	legal	ADJ
fnp-5188	373	15	requirements	requirement	NOUN
fnp-5188	373	16	of	of	ADP
fnp-5188	373	17	the	the	DET
fnp-5188	373	18	study	study	NOUN
fnp-5188	373	19	country	country	NOUN
fnp-5188	373	20	.	.	PUNCT
fnp-5188	374	1	animal	animal	NOUN
fnp-5188	374	2	work	work	NOUN
fnp-5188	374	3	was	be	AUX
fnp-5188	374	4	performed	perform	VERB
fnp-5188	374	5	in	in	ADP
fnp-5188	374	6	accordance	accordance	NOUN
fnp-5188	374	7	with	with	ADP
fnp-5188	374	8	the	the	DET
fnp-5188	374	9	german	german	ADJ
fnp-5188	374	10	animal	animal	NOUN
fnp-5188	374	11	welfare	welfare	NOUN
fnp-5188	374	12	act	act	NOUN
fnp-5188	374	13	and	and	CCONJ
fnp-5188	374	14	its	its	PRON
fnp-5188	374	15	guidelines	guideline	NOUN
fnp-5188	374	16	and	and	CCONJ
fnp-5188	374	17	was	be	AUX
fnp-5188	374	18	approved	approve	VERB
fnp-5188	374	19	by	by	ADP
fnp-5188	374	20	the	the	DET
fnp-5188	374	21	regional	regional	ADJ
fnp-5188	374	22	council	council	PROPN
fnp-5188	374	23	of	of	ADP
fnp-5188	374	24	tübingen	tübingen	PROPN
fnp-5188	374	25	(	(	PUNCT
fnp-5188	374	26	approval	approval	NOUN
fnp-5188	374	27	n5/17	n5/17	NOUN
fnp-5188	374	28	)	)	PUNCT
fnp-5188	374	29	.	.	PUNCT
fnp-5188	375	1	funding	funding	NOUN
fnp-5188	375	2	statement	statement	NOUN
fnp-5188	375	3	this	this	DET
fnp-5188	375	4	study	study	NOUN
fnp-5188	375	5	has	have	AUX
fnp-5188	375	6	been	be	AUX
fnp-5188	375	7	funded	fund	VERB
fnp-5188	375	8	by	by	ADP
fnp-5188	375	9	the	the	DET
fnp-5188	375	10	izkf	izkf	NOUN
fnp-5188	375	11	promotionsprogramm	promotionsprogramm	NOUN
fnp-5188	375	12	of	of	ADP
fnp-5188	375	13	the	the	DET
fnp-5188	375	14	medical	medical	ADJ
fnp-5188	375	15	faculty	faculty	NOUN
fnp-5188	375	16	,	,	PUNCT
fnp-5188	375	17	university	university	NOUN
fnp-5188	375	18	of	of	ADP
fnp-5188	375	19	tübingen	tübingen	PROPN
fnp-5188	375	20	.	.	PUNCT
fnp-5188	376	1	references	reference	NOUN
fnp-5188	376	2	1	1	NUM
fnp-5188	376	3	.	.	PUNCT
fnp-5188	377	1	schaff	schaff	NOUN
fnp-5188	377	2	,	,	PUNCT
fnp-5188	377	3	l.r	l.r	PROPN
fnp-5188	377	4	.	.	PROPN
fnp-5188	377	5	and	and	CCONJ
fnp-5188	377	6	i.k	i.k	PROPN
fnp-5188	377	7	.	.	PROPN
fnp-5188	377	8	mellinghoff	mellinghoff	PROPN
fnp-5188	377	9	,	,	PUNCT
fnp-5188	377	10	glioblastoma	glioblastoma	NOUN
fnp-5188	377	11	and	and	CCONJ
fnp-5188	377	12	other	other	ADJ
fnp-5188	377	13	primary	primary	ADJ
fnp-5188	377	14	brain	brain	NOUN
fnp-5188	377	15	malignancies	malignancy	NOUN
fnp-5188	377	16	in	in	ADP
fnp-5188	377	17	adults	adult	NOUN
fnp-5188	377	18	:	:	PUNCT
fnp-5188	377	19	a	a	DET
fnp-5188	377	20	review	review	NOUN
fnp-5188	377	21	.	.	PUNCT
fnp-5188	378	1	jama	jama	PROPN
fnp-5188	378	2	,	,	PUNCT
fnp-5188	378	3	2023	2023	NUM
fnp-5188	378	4	.	.	PUNCT
fnp-5188	379	1	329(7	329(7	NUM
fnp-5188	379	2	):	):	PUNCT
fnp-5188	379	3	p.	p.	NOUN
fnp-5188	379	4	574	574	NUM
fnp-5188	379	5	-	-	SYM
fnp-5188	379	6	587	587	NUM
fnp-5188	379	7	.	.	PUNCT
fnp-5188	380	1	https://doi.org/10.1001/jama.2023.0023	https://doi.org/10.1001/jama.2023.0023	PROPN
fnp-5188	380	2	2	2	NUM
fnp-5188	380	3	.	.	PUNCT
fnp-5188	380	4	stupp	stupp	PROPN
fnp-5188	380	5	,	,	PUNCT
fnp-5188	380	6	r.	r.	PROPN
fnp-5188	380	7	,	,	PUNCT
fnp-5188	380	8	et	et	PROPN
fnp-5188	380	9	al	al	PROPN
fnp-5188	380	10	.	.	PROPN
fnp-5188	380	11	,	,	PUNCT
fnp-5188	380	12	effect	effect	NOUN
fnp-5188	380	13	of	of	ADP
fnp-5188	380	14	tumor	tumor	NOUN
fnp-5188	380	15	-	-	PUNCT
fnp-5188	380	16	treating	treat	VERB
fnp-5188	380	17	fields	field	NOUN
fnp-5188	380	18	plus	plus	CCONJ
fnp-5188	380	19	maintenance	maintenance	NOUN
fnp-5188	380	20	temozolomide	temozolomide	NOUN
fnp-5188	380	21	vs	vs	ADP
fnp-5188	380	22	maintenance	maintenance	NOUN
fnp-5188	380	23	temozolomide	temozolomide	NOUN
fnp-5188	380	24	alone	alone	ADV
fnp-5188	380	25	on	on	ADP
fnp-5188	380	26	survival	survival	NOUN
fnp-5188	380	27	in	in	ADP
fnp-5188	380	28	patients	patient	NOUN
fnp-5188	380	29	with	with	ADP
fnp-5188	380	30	glioblastoma	glioblastoma	NOUN
fnp-5188	380	31	:	:	PUNCT
fnp-5188	380	32	a	a	DET
fnp-5188	380	33	randomized	randomized	ADJ
fnp-5188	380	34	clinical	clinical	ADJ
fnp-5188	380	35	trial	trial	NOUN
fnp-5188	380	36	.	.	PUNCT
fnp-5188	381	1	jama	jama	NOUN
fnp-5188	381	2	:	:	PUNCT
fnp-5188	381	3	the	the	DET
fnp-5188	381	4	journal	journal	NOUN
fnp-5188	381	5	of	of	ADP
fnp-5188	381	6	the	the	DET
fnp-5188	381	7	american	american	PROPN
fnp-5188	381	8	medical	medical	PROPN
fnp-5188	381	9	association	association	PROPN
fnp-5188	381	10	,	,	PUNCT
fnp-5188	381	11	2017	2017	NUM
fnp-5188	381	12	.	.	PUNCT
fnp-5188	382	1	318(23	318(23	NOUN
fnp-5188	382	2	):	):	PUNCT
fnp-5188	382	3	p.	p.	NOUN
fnp-5188	382	4	2306	2306	NUM
fnp-5188	382	5	-	-	SYM
fnp-5188	382	6	2316	2316	NUM
fnp-5188	382	7	.	.	PUNCT
fnp-5188	383	1	https://doi.org/10.1001/jama.2017.18718	https://doi.org/10.1001/jama.2017.18718	PROPN
fnp-5188	383	2	3	3	NUM
fnp-5188	383	3	.	.	PUNCT
fnp-5188	383	4	hochberg	hochberg	PROPN
fnp-5188	383	5	,	,	PUNCT
fnp-5188	383	6	f.h	f.h	PROPN
fnp-5188	383	7	.	.	PROPN
fnp-5188	383	8	,	,	PUNCT
fnp-5188	383	9	et	et	PROPN
fnp-5188	383	10	al	al	PROPN
fnp-5188	383	11	.	.	PROPN
fnp-5188	383	12	,	,	PUNCT
fnp-5188	383	13	glioma	glioma	NOUN
fnp-5188	383	14	diagnostics	diagnostic	NOUN
fnp-5188	383	15	and	and	CCONJ
fnp-5188	383	16	biomarkers	biomarker	NOUN
fnp-5188	383	17	:	:	PUNCT
fnp-5188	383	18	an	an	DET
fnp-5188	383	19	ongoing	ongoing	ADJ
fnp-5188	383	20	challenge	challenge	NOUN
fnp-5188	383	21	in	in	ADP
fnp-5188	383	22	the	the	DET
fnp-5188	383	23	field	field	NOUN
fnp-5188	383	24	of	of	ADP
fnp-5188	383	25	medicine	medicine	NOUN
fnp-5188	383	26	and	and	CCONJ
fnp-5188	383	27	science	science	NOUN
fnp-5188	383	28	.	.	PUNCT
fnp-5188	384	1	expert	expert	PROPN
fnp-5188	384	2	rev	rev	VERB
fnp-5188	384	3	mol	mol	ADP
fnp-5188	384	4	diagn	diagn	PROPN
fnp-5188	384	5	,	,	PUNCT
fnp-5188	384	6	2014	2014	NUM
fnp-5188	384	7	.	.	PUNCT
fnp-5188	385	1	14(4	14(4	NUM
fnp-5188	385	2	):	):	PUNCT
fnp-5188	385	3	p.	p.	NOUN
fnp-5188	385	4	439	439	NUM
fnp-5188	385	5	-	-	SYM
fnp-5188	385	6	52	52	NUM
fnp-5188	385	7	.	.	PUNCT
fnp-5188	386	1	https://doi.org/10.1586/14737159.905202	https://doi.org/10.1586/14737159.905202	NOUN
fnp-5188	386	2	4	4	NUM
fnp-5188	386	3	.	.	PUNCT
fnp-5188	386	4	ochs	och	NOUN
fnp-5188	386	5	,	,	PUNCT
fnp-5188	386	6	k.	k.	PROPN
fnp-5188	386	7	,	,	PUNCT
fnp-5188	386	8	et	et	PROPN
fnp-5188	386	9	al	al	PROPN
fnp-5188	386	10	.	.	PROPN
fnp-5188	386	11	,	,	PUNCT
fnp-5188	386	12	immature	immature	ADJ
fnp-5188	386	13	mesenchymal	mesenchymal	ADJ
fnp-5188	386	14	stem	stem	NOUN
fnp-5188	386	15	cell	cell	NOUN
fnp-5188	386	16	-	-	PUNCT
fnp-5188	386	17	like	like	ADJ
fnp-5188	386	18	pericytes	pericyte	NOUN
fnp-5188	386	19	as	as	ADP
fnp-5188	386	20	mediators	mediator	NOUN
fnp-5188	386	21	of	of	ADP
fnp-5188	386	22	immunosuppression	immunosuppression	NOUN
fnp-5188	386	23	in	in	ADP
fnp-5188	386	24	human	human	ADJ
fnp-5188	386	25	malignant	malignant	ADJ
fnp-5188	386	26	glioma	glioma	NOUN
fnp-5188	386	27	.	.	PUNCT
fnp-5188	387	1	journal	journal	PROPN
fnp-5188	387	2	of	of	ADP
fnp-5188	387	3	neuroimmunology	neuroimmunology	PROPN
fnp-5188	387	4	,	,	PUNCT
fnp-5188	387	5	2013	2013	NUM
fnp-5188	387	6	.	.	PUNCT
fnp-5188	388	1	265(1	265(1	NUM
fnp-5188	388	2	-	-	SYM
fnp-5188	388	3	2	2	NUM
fnp-5188	388	4	):	):	PUNCT
fnp-5188	388	5	p.	p.	NOUN
fnp-5188	388	6	106	106	NUM
fnp-5188	388	7	-	-	SYM
fnp-5188	388	8	16	16	NUM
fnp-5188	388	9	.	.	PUNCT
fnp-5188	389	1	https://doi.org/10.1016/j.neuroim.2013.09.011	https://doi.org/10.1016/j.neuroim.2013.09.011	NUM
fnp-5188	389	2	5	5	NUM
fnp-5188	389	3	.	.	X
fnp-5188	389	4	sena	sena	PROPN
fnp-5188	389	5	,	,	PUNCT
fnp-5188	389	6	i.f.g	i.f.g	PROPN
fnp-5188	389	7	.	.	PROPN
fnp-5188	389	8	,	,	PUNCT
fnp-5188	389	9	et	et	PROPN
fnp-5188	389	10	al	al	PROPN
fnp-5188	389	11	.	.	PROPN
fnp-5188	389	12	,	,	PUNCT
fnp-5188	389	13	glioblastoma	glioblastoma	NOUN
fnp-5188	389	14	-	-	PUNCT
fnp-5188	389	15	activated	activate	VERB
fnp-5188	389	16	pericytes	pericyte	NOUN
fnp-5188	389	17	support	support	VERB
fnp-5188	389	18	tumor	tumor	NOUN
fnp-5188	389	19	growth	growth	NOUN
fnp-5188	389	20	via	via	ADP
fnp-5188	389	21	immunosuppression	immunosuppression	NOUN
fnp-5188	389	22	.	.	PUNCT
fnp-5188	390	1	cancer	cancer	NOUN
fnp-5188	390	2	med	med	PROPN
fnp-5188	390	3	,	,	PUNCT
fnp-5188	390	4	2018	2018	NUM
fnp-5188	390	5	.	.	PUNCT
fnp-5188	391	1	7(4	7(4	NUM
fnp-5188	391	2	):	):	PUNCT
fnp-5188	391	3	p.	p.	NOUN
fnp-5188	391	4	1232	1232	NUM
fnp-5188	391	5	-	-	SYM
fnp-5188	391	6	1239	1239	NUM
fnp-5188	391	7	.	.	PUNCT
fnp-5188	392	1	https://doi.org/10.1002/cam4.1375	https://doi.org/10.1002/cam4.1375	ADP
fnp-5188	392	2	6	6	NUM
fnp-5188	392	3	.	.	PUNCT
fnp-5188	392	4	waziri	waziri	PROPN
fnp-5188	392	5	,	,	PUNCT
fnp-5188	392	6	a.	a.	NOUN
fnp-5188	392	7	,	,	PUNCT
fnp-5188	392	8	glioblastoma	glioblastoma	NOUN
fnp-5188	392	9	-	-	PUNCT
fnp-5188	392	10	derived	derive	VERB
fnp-5188	392	11	mechanisms	mechanism	NOUN
fnp-5188	392	12	of	of	ADP
fnp-5188	392	13	systemic	systemic	ADJ
fnp-5188	392	14	immunosuppression	immunosuppression	NOUN
fnp-5188	392	15	.	.	PUNCT
fnp-5188	393	1	neurosurg	neurosurg	PROPN
fnp-5188	393	2	clin	clin	PROPN
fnp-5188	393	3	n	n	PRON
fnp-5188	393	4	am	be	AUX
fnp-5188	393	5	,	,	PUNCT
fnp-5188	393	6	2010	2010	NUM
fnp-5188	393	7	.	.	PUNCT
fnp-5188	394	1	21(1	21(1	NUM
fnp-5188	394	2	):	):	PUNCT
fnp-5188	394	3	p.	p.	NOUN
fnp-5188	394	4	31	31	NUM
fnp-5188	394	5	-	-	SYM
fnp-5188	394	6	42	42	NUM
fnp-5188	394	7	.	.	PUNCT
fnp-5188	395	1	https://doi.org/10.1016/j.nec.2009.08.005	https://doi.org/10.1016/j.nec.2009.08.005	PROPN
fnp-5188	395	2	7	7	X
fnp-5188	395	3	.	.	PUNCT
fnp-5188	396	1	himes	himes	PROPN
fnp-5188	396	2	,	,	PUNCT
fnp-5188	396	3	b.t	b.t	PROPN
fnp-5188	396	4	.	.	PROPN
fnp-5188	396	5	,	,	PUNCT
fnp-5188	396	6	et	et	PROPN
fnp-5188	396	7	al	al	PROPN
fnp-5188	396	8	.	.	PROPN
fnp-5188	396	9	,	,	PUNCT
fnp-5188	396	10	immunosuppression	immunosuppression	NOUN
fnp-5188	396	11	in	in	ADP
fnp-5188	396	12	glioblastoma	glioblastoma	NOUN
fnp-5188	396	13	:	:	PUNCT
fnp-5188	396	14	current	current	ADJ
fnp-5188	396	15	understanding	understanding	NOUN
fnp-5188	396	16	and	and	CCONJ
fnp-5188	396	17	therapeutic	therapeutic	ADJ
fnp-5188	396	18	implications	implication	NOUN
fnp-5188	396	19	.	.	PUNCT
fnp-5188	397	1	front	front	ADJ
fnp-5188	397	2	oncol	oncol	ADJ
fnp-5188	397	3	,	,	PUNCT
fnp-5188	397	4	2021	2021	NUM
fnp-5188	397	5	.	.	PUNCT
fnp-5188	398	1	11	11	NUM
fnp-5188	398	2	:	:	PUNCT
fnp-5188	399	1	p.	p.	NOUN
fnp-5188	399	2	770561	770561	NUM
fnp-5188	399	3	.	.	PUNCT
fnp-5188	400	1	https://doi.org/10.3389/fonc.2021.770561	https://doi.org/10.3389/fonc.2021.770561	PROPN
fnp-5188	400	2	8	8	NUM
fnp-5188	400	3	.	.	PUNCT
fnp-5188	401	1	gong	gong	PROPN
fnp-5188	401	2	,	,	PUNCT
fnp-5188	401	3	l.	l.	PROPN
fnp-5188	401	4	,	,	PUNCT
fnp-5188	401	5	et	et	PROPN
fnp-5188	401	6	al	al	PROPN
fnp-5188	401	7	.	.	PROPN
fnp-5188	401	8	,	,	PUNCT
fnp-5188	401	9	tgf	tgf	PROPN
fnp-5188	401	10	-	-	PUNCT
fnp-5188	401	11	beta	beta	NOUN
fnp-5188	401	12	links	link	NOUN
fnp-5188	401	13	glycolysis	glycolysis	NOUN
fnp-5188	401	14	and	and	CCONJ
fnp-5188	401	15	immunosuppression	immunosuppression	NOUN
fnp-5188	401	16	in	in	ADP
fnp-5188	401	17	glioblastoma	glioblastoma	NOUN
fnp-5188	401	18	.	.	PUNCT
fnp-5188	402	1	histol	histol	PROPN
fnp-5188	402	2	histopathol	histopathol	NOUN
fnp-5188	402	3	,	,	PUNCT
fnp-5188	402	4	2021	2021	NUM
fnp-5188	402	5	.	.	PUNCT
fnp-5188	403	1	36(11	36(11	NUM
fnp-5188	403	2	):	):	PUNCT
fnp-5188	403	3	p.	p.	NOUN
fnp-5188	403	4	1111	1111	NUM
fnp-5188	403	5	-	-	SYM
fnp-5188	403	6	1124	1124	NUM
fnp-5188	403	7	.	.	PUNCT
fnp-5188	404	1	https://doi.org/10.14670/hh-18-366	https://doi.org/10.14670/hh-18-366	VERB
fnp-5188	404	2	9	9	NUM
fnp-5188	404	3	.	.	PUNCT
fnp-5188	405	1	auffinger	auffinger	PROPN
fnp-5188	405	2	,	,	PUNCT
fnp-5188	405	3	b.	b.	PROPN
fnp-5188	405	4	,	,	PUNCT
fnp-5188	405	5	et	et	PROPN
fnp-5188	405	6	al	al	PROPN
fnp-5188	405	7	.	.	PROPN
fnp-5188	405	8	,	,	PUNCT
fnp-5188	405	9	the	the	DET
fnp-5188	405	10	role	role	NOUN
fnp-5188	405	11	of	of	ADP
fnp-5188	405	12	glioma	glioma	NOUN
fnp-5188	405	13	stem	stem	NOUN
fnp-5188	405	14	cells	cell	NOUN
fnp-5188	405	15	in	in	ADP
fnp-5188	405	16	chemotherapy	chemotherapy	NOUN
fnp-5188	405	17	resistance	resistance	NOUN
fnp-5188	405	18	and	and	CCONJ
fnp-5188	405	19	glioblastoma	glioblastoma	NOUN
fnp-5188	405	20	multiforme	multiforme	NOUN
fnp-5188	405	21	recurrence	recurrence	NOUN
fnp-5188	405	22	.	.	PUNCT
fnp-5188	406	1	expert	expert	NOUN
fnp-5188	406	2	review	review	PROPN
fnp-5188	406	3	of	of	ADP
fnp-5188	406	4	neurotherapeutics	neurotherapeutic	NOUN
fnp-5188	406	5	,	,	PUNCT
fnp-5188	406	6	2015	2015	NUM
fnp-5188	406	7	.	.	PUNCT
fnp-5188	407	1	15(7	15(7	NUM
fnp-5188	407	2	):	):	PUNCT
fnp-5188	408	1	p.	p.	NOUN
fnp-5188	408	2	741	741	NUM
fnp-5188	408	3	-	-	SYM
fnp-5188	408	4	52	52	NUM
fnp-5188	408	5	.	.	PUNCT
fnp-5188	409	1	https://doi.org/10.1586/14737175.2015.1051968	https://doi.org/10.1586/14737175.2015.1051968	PROPN
fnp-5188	410	1	10	10	NUM
fnp-5188	410	2	.	.	X
fnp-5188	410	3	d'alessio	d'alessio	PROPN
fnp-5188	410	4	,	,	PUNCT
fnp-5188	410	5	a.	a.	PROPN
fnp-5188	410	6	,	,	PUNCT
fnp-5188	410	7	et	et	PROPN
fnp-5188	410	8	al	al	PROPN
fnp-5188	410	9	.	.	PROPN
fnp-5188	410	10	,	,	PUNCT
fnp-5188	410	11	pathological	pathological	ADJ
fnp-5188	410	12	and	and	CCONJ
fnp-5188	410	13	molecular	molecular	ADJ
fnp-5188	410	14	features	feature	NOUN
fnp-5188	410	15	of	of	ADP
fnp-5188	410	16	glioblastoma	glioblastoma	NOUN
fnp-5188	410	17	and	and	CCONJ
fnp-5188	410	18	its	its	PRON
fnp-5188	410	19	peritumoral	peritumoral	ADJ
fnp-5188	410	20	tissue	tissue	NOUN
fnp-5188	410	21	.	.	PUNCT
fnp-5188	411	1	cancers	cancer	NOUN
fnp-5188	411	2	(	(	PUNCT
fnp-5188	411	3	basel	basel	PROPN
fnp-5188	411	4	)	)	PUNCT
fnp-5188	411	5	,	,	PUNCT
fnp-5188	411	6	2019	2019	NUM
fnp-5188	411	7	.	.	PUNCT
fnp-5188	411	8	11(4	11(4	NUM
fnp-5188	411	9	)	)	PUNCT
fnp-5188	411	10	.	.	PUNCT
fnp-5188	412	1	https://doi.org/10.3390/cancers11040469	https://doi.org/10.3390/cancers11040469	PROPN
fnp-5188	412	2	11	11	NUM
fnp-5188	412	3	.	.	PUNCT
fnp-5188	413	1	das	das	PROPN
fnp-5188	413	2	,	,	PUNCT
fnp-5188	413	3	s.	s.	PROPN
fnp-5188	413	4	and	and	CCONJ
fnp-5188	413	5	p.a	p.a	PROPN
fnp-5188	413	6	.	.	PUNCT
fnp-5188	413	7	marsden	marsden	PROPN
fnp-5188	413	8	,	,	PUNCT
fnp-5188	413	9	angiogenesis	angiogenesis	NOUN
fnp-5188	413	10	in	in	ADP
fnp-5188	413	11	glioblastoma	glioblastoma	NOUN
fnp-5188	413	12	.	.	PUNCT
fnp-5188	414	1	n	n	PROPN
fnp-5188	414	2	engl	engl	PROPN
fnp-5188	414	3	j	j	PROPN
fnp-5188	414	4	med	med	PROPN
fnp-5188	414	5	,	,	PUNCT
fnp-5188	414	6	2013	2013	NUM
fnp-5188	414	7	.	.	PUNCT
fnp-5188	415	1	369(16	369(16	NUM
fnp-5188	415	2	):	):	PUNCT
fnp-5188	416	1	p.	p.	NOUN
fnp-5188	416	2	1561	1561	NUM
fnp-5188	416	3	-	-	SYM
fnp-5188	416	4	3	3	NUM
fnp-5188	416	5	.	.	PUNCT
fnp-5188	416	6	https://doi.org/10.1056/nejmcibr1309402	https://doi.org/10.1056/nejmcibr1309402	PROPN
fnp-5188	416	7	12	12	NUM
fnp-5188	416	8	.	.	PUNCT
fnp-5188	416	9	birner	birner	NOUN
fnp-5188	416	10	,	,	PUNCT
fnp-5188	416	11	p.	p.	PROPN
fnp-5188	416	12	,	,	PUNCT
fnp-5188	416	13	et	et	PROPN
fnp-5188	416	14	al	al	PROPN
fnp-5188	416	15	.	.	PROPN
fnp-5188	416	16	,	,	PUNCT
fnp-5188	417	1	vascular	vascular	ADJ
fnp-5188	417	2	patterns	pattern	NOUN
fnp-5188	417	3	in	in	ADP
fnp-5188	417	4	glioblastoma	glioblastoma	NOUN
fnp-5188	417	5	influence	influence	NOUN
fnp-5188	417	6	clinical	clinical	ADJ
fnp-5188	417	7	outcome	outcome	NOUN
fnp-5188	417	8	and	and	CCONJ
fnp-5188	417	9	associate	associate	VERB
fnp-5188	417	10	with	with	ADP
fnp-5188	417	11	variable	variable	ADJ
fnp-5188	417	12	expression	expression	NOUN
fnp-5188	417	13	of	of	ADP
fnp-5188	417	14	angiogenic	angiogenic	ADJ
fnp-5188	417	15	proteins	protein	NOUN
fnp-5188	417	16	:	:	PUNCT
fnp-5188	417	17	evidence	evidence	NOUN
fnp-5188	417	18	for	for	ADP
fnp-5188	417	19	distinct	distinct	ADJ
fnp-5188	417	20	angiogenic	angiogenic	ADJ
fnp-5188	417	21	subtypes	subtype	NOUN
fnp-5188	417	22	.	.	PUNCT
fnp-5188	418	1	brain	brain	NOUN
fnp-5188	418	2	pathol	pathol	NOUN
fnp-5188	418	3	,	,	PUNCT
fnp-5188	418	4	2003	2003	NUM
fnp-5188	418	5	.	.	PUNCT
fnp-5188	419	1	13(2	13(2	NOUN
fnp-5188	419	2	):	):	PUNCT
fnp-5188	420	1	p.	p.	NOUN
fnp-5188	420	2	133	133	NUM
fnp-5188	420	3	-	-	SYM
fnp-5188	420	4	43	43	NUM
fnp-5188	420	5	.	.	PUNCT
fnp-5188	421	1	https://doi.org/10.1111/j.1750-3639.2003.tb00013.x	https://doi.org/10.1111/j.1750-3639.2003.tb00013.x	PROPN
fnp-5188	421	2	13	13	NUM
fnp-5188	421	3	.	.	PUNCT
fnp-5188	422	1	jackson	jackson	PROPN
fnp-5188	422	2	,	,	PUNCT
fnp-5188	422	3	s.	s.	PROPN
fnp-5188	422	4	,	,	PUNCT
fnp-5188	422	5	et	et	PROPN
fnp-5188	422	6	al	al	PROPN
fnp-5188	422	7	.	.	PROPN
fnp-5188	422	8	,	,	PUNCT
fnp-5188	422	9	blood	blood	NOUN
fnp-5188	422	10	-	-	PUNCT
fnp-5188	422	11	brain	brain	NOUN
fnp-5188	422	12	barrier	barrier	NOUN
fnp-5188	422	13	pericyte	pericyte	NOUN
fnp-5188	422	14	importance	importance	NOUN
fnp-5188	422	15	in	in	ADP
fnp-5188	422	16	malignant	malignant	ADJ
fnp-5188	422	17	gliomas	glioma	NOUN
fnp-5188	422	18	:	:	PUNCT
fnp-5188	422	19	what	what	PRON
fnp-5188	422	20	we	we	PRON
fnp-5188	422	21	can	can	AUX
fnp-5188	422	22	learn	learn	VERB
fnp-5188	422	23	from	from	ADP
fnp-5188	422	24	stroke	stroke	NOUN
fnp-5188	422	25	and	and	CCONJ
fnp-5188	422	26	alzheimer	alzheimer	PROPN
fnp-5188	422	27	's	's	PART
fnp-5188	422	28	disease	disease	NOUN
fnp-5188	422	29	.	.	PUNCT
fnp-5188	423	1	neuro	neuro	PROPN
fnp-5188	423	2	oncol	oncol	PROPN
fnp-5188	423	3	,	,	PUNCT
fnp-5188	423	4	2017	2017	NUM
fnp-5188	423	5	.	.	PUNCT
fnp-5188	424	1	19(9	19(9	NOUN
fnp-5188	424	2	):	):	PUNCT
fnp-5188	424	3	p.	p.	NOUN
fnp-5188	424	4	1173	1173	NUM
fnp-5188	424	5	-	-	SYM
fnp-5188	424	6	1182	1182	NUM
fnp-5188	424	7	.	.	PUNCT
fnp-5188	425	1	https://doi.org/10.1093/neuonc/nox058	https://doi.org/10.1093/neuonc/nox058	PROPN
fnp-5188	425	2	14	14	NUM
fnp-5188	425	3	.	.	PUNCT
fnp-5188	425	4	sattiraju	sattiraju	PROPN
fnp-5188	425	5	,	,	PUNCT
fnp-5188	425	6	a.	a.	NOUN
fnp-5188	425	7	and	and	CCONJ
fnp-5188	425	8	a.	a.	PROPN
fnp-5188	425	9	mintz	mintz	PROPN
fnp-5188	425	10	,	,	PUNCT
fnp-5188	425	11	pericytes	pericyte	NOUN
fnp-5188	425	12	in	in	ADP
fnp-5188	425	13	glioblastomas	glioblastoma	NOUN
fnp-5188	425	14	:	:	PUNCT
fnp-5188	425	15	multifaceted	multifaceted	ADJ
fnp-5188	425	16	role	role	NOUN
fnp-5188	425	17	within	within	ADP
fnp-5188	425	18	tumor	tumor	NOUN
fnp-5188	425	19	microenvironments	microenvironment	NOUN
fnp-5188	425	20	and	and	CCONJ
fnp-5188	425	21	potential	potential	NOUN
fnp-5188	425	22	for	for	ADP
fnp-5188	425	23	therapeutic	therapeutic	ADJ
fnp-5188	425	24	interventions	intervention	NOUN
fnp-5188	425	25	.	.	PUNCT
fnp-5188	426	1	adv	adv	PROPN
fnp-5188	426	2	exp	exp	NUM
fnp-5188	426	3	med	med	ADJ
fnp-5188	426	4	biol	biol	NOUN
fnp-5188	426	5	,	,	PUNCT
fnp-5188	426	6	2019	2019	NUM
fnp-5188	426	7	.	.	PUNCT
fnp-5188	427	1	1147	1147	NUM
fnp-5188	427	2	:	:	PUNCT
fnp-5188	428	1	p.	p.	NOUN
fnp-5188	428	2	65	65	NUM
fnp-5188	428	3	-	-	SYM
fnp-5188	428	4	91	91	NUM
fnp-5188	428	5	.	.	PUNCT
fnp-5188	429	1	https://doi.org/10.1007/978-3-030-16908-4_2	https://doi.org/10.1007/978-3-030-16908-4_2	PROPN
fnp-5188	429	2	15	15	NUM
fnp-5188	429	3	.	.	PUNCT
fnp-5188	430	1	mader	mader	NOUN
fnp-5188	430	2	,	,	PUNCT
fnp-5188	430	3	l.	l.	PROPN
fnp-5188	430	4	,	,	PUNCT
fnp-5188	430	5	et	et	PROPN
fnp-5188	430	6	al	al	PROPN
fnp-5188	430	7	.	.	PROPN
fnp-5188	430	8	,	,	PUNCT
fnp-5188	430	9	pericytes	pericyte	NOUN
fnp-5188	430	10	/	/	SYM
fnp-5188	430	11	vessel	vessel	NOUN
fnp-5188	430	12	-	-	PUNCT
fnp-5188	430	13	associated	associate	VERB
fnp-5188	430	14	mural	mural	ADJ
fnp-5188	430	15	cells	cell	NOUN
fnp-5188	430	16	(	(	PUNCT
fnp-5188	430	17	vamcs	vamcs	NOUN
fnp-5188	430	18	)	)	PUNCT
fnp-5188	430	19	are	be	AUX
fnp-5188	430	20	the	the	DET
fnp-5188	430	21	major	major	ADJ
fnp-5188	430	22	source	source	NOUN
fnp-5188	430	23	of	of	ADP
fnp-5188	430	24	key	key	ADJ
fnp-5188	430	25	epithelial	epithelial	ADJ
fnp-5188	430	26	-	-	PUNCT
fnp-5188	430	27	mesenchymal	mesenchymal	NOUN
fnp-5188	430	28	transition	transition	NOUN
fnp-5188	430	29	(	(	PUNCT
fnp-5188	430	30	emt	emt	NOUN
fnp-5188	430	31	)	)	PUNCT
fnp-5188	430	32	factors	factor	NOUN
fnp-5188	430	33	slug	slug	VERB
fnp-5188	430	34	and	and	CCONJ
fnp-5188	430	35	twist	twist	VERB
fnp-5188	430	36	in	in	ADP
fnp-5188	430	37	human	human	ADJ
fnp-5188	430	38	glioma	glioma	NOUN
fnp-5188	430	39	.	.	PUNCT
fnp-5188	431	1	oncotarget	oncotarget	NOUN
fnp-5188	431	2	,	,	PUNCT
fnp-5188	431	3	2018	2018	NUM
fnp-5188	431	4	.	.	PUNCT
fnp-5188	432	1	9(35	9(35	NUM
fnp-5188	432	2	):	):	PUNCT
fnp-5188	432	3	p.	p.	NOUN
fnp-5188	432	4	24041	24041	NUM
fnp-5188	432	5	-	-	SYM
fnp-5188	432	6	24053	24053	NUM
fnp-5188	432	7	.	.	PUNCT
fnp-5188	433	1	https://doi.org/10.18632/oncotarget.25275	https://doi.org/10.18632/oncotarget.25275	PROPN
fnp-5188	433	2	16	16	NUM
fnp-5188	433	3	.	.	PUNCT
fnp-5188	434	1	wirsik	wirsik	PROPN
fnp-5188	434	2	,	,	PUNCT
fnp-5188	434	3	n.m	n.m	PROPN
fnp-5188	434	4	.	.	PROPN
fnp-5188	434	5	,	,	PUNCT
fnp-5188	434	6	et	et	PROPN
fnp-5188	434	7	al	al	PROPN
fnp-5188	434	8	.	.	PROPN
fnp-5188	434	9	,	,	PUNCT
fnp-5188	434	10	tgf	tgf	PROPN
fnp-5188	434	11	-	-	PUNCT
fnp-5188	434	12	beta	beta	NOUN
fnp-5188	434	13	activates	activate	VERB
fnp-5188	434	14	pericytes	pericyte	NOUN
fnp-5188	434	15	via	via	ADP
fnp-5188	434	16	induction	induction	NOUN
fnp-5188	434	17	of	of	ADP
fnp-5188	434	18	the	the	DET
fnp-5188	434	19	epithelial	epithelial	NOUN
fnp-5188	434	20	to	to	ADP
fnp-5188	434	21	mesenchymal	mesenchymal	ADJ
fnp-5188	434	22	transition	transition	NOUN
fnp-5188	434	23	protein	protein	NOUN
fnp-5188	434	24	slug	slug	VERB
fnp-5188	434	25	in	in	ADP
fnp-5188	434	26	glioblastoma	glioblastoma	NOUN
fnp-5188	434	27	.	.	PUNCT
fnp-5188	435	1	neuropathol	neuropathol	PROPN
fnp-5188	435	2	appl	appl	PROPN
fnp-5188	435	3	neurobiol	neurobiol	PROPN
fnp-5188	435	4	,	,	PUNCT
fnp-5188	435	5	2021	2021	NUM
fnp-5188	435	6	.	.	PUNCT
fnp-5188	436	1	47(6):p	47(6):p	NUM
fnp-5188	436	2	.	.	NOUN
fnp-5188	436	3	768	768	NUM
fnp-5188	436	4	-	-	SYM
fnp-5188	436	5	780	780	NUM
fnp-5188	436	6	.	.	PUNCT
fnp-5188	437	1	https://doi.org/10.1111/nan.12714	https://doi.org/10.1111/nan.12714	NOUN
fnp-5188	437	2	17	17	NUM
fnp-5188	437	3	.	.	PUNCT
fnp-5188	438	1	schumacher	schumacher	PROPN
fnp-5188	438	2	,	,	PUNCT
fnp-5188	438	3	l.	l.	PROPN
fnp-5188	438	4	,	,	PUNCT
fnp-5188	438	5	et	et	PROPN
fnp-5188	438	6	al	al	PROPN
fnp-5188	438	7	.	.	PROPN
fnp-5188	438	8	,	,	PUNCT
fnp-5188	438	9	tgf	tgf	PROPN
fnp-5188	438	10	-	-	PUNCT
fnp-5188	438	11	beta	beta	NOUN
fnp-5188	438	12	modulates	modulate	NOUN
fnp-5188	438	13	the	the	DET
fnp-5188	438	14	integrity	integrity	NOUN
fnp-5188	438	15	of	of	ADP
fnp-5188	438	16	the	the	DET
fnp-5188	438	17	blood	blood	NOUN
fnp-5188	438	18	brain	brain	NOUN
fnp-5188	438	19	barrier	barrier	NOUN
fnp-5188	438	20	in	in	ADP
fnp-5188	438	21	vitro	vitro	NOUN
fnp-5188	438	22	,	,	PUNCT
fnp-5188	438	23	and	and	CCONJ
fnp-5188	438	24	is	be	AUX
fnp-5188	438	25	associated	associate	VERB
fnp-5188	438	26	with	with	ADP
fnp-5188	438	27	metabolic	metabolic	NOUN
fnp-5188	438	28	alterations	alteration	NOUN
fnp-5188	438	29	in	in	ADP
fnp-5188	438	30	pericytes	pericyte	NOUN
fnp-5188	438	31	.	.	PUNCT
fnp-5188	439	1	biomedicines	biomedicine	NOUN
fnp-5188	439	2	,	,	PUNCT
fnp-5188	439	3	2023	2023	NUM
fnp-5188	439	4	.	.	PUNCT
fnp-5188	440	1	special	special	ADJ
fnp-5188	440	2	issue	issue	NOUN
fnp-5188	440	3	"	"	PUNCT
fnp-5188	440	4	angiogenesis	angiogenesis	NOUN
fnp-5188	440	5	in	in	ADP
fnp-5188	440	6	heath	heath	NOUN
fnp-5188	440	7	and	and	CCONJ
fnp-5188	440	8	disease	disease	NOUN
fnp-5188	440	9	2.0	2.0	NUM
fnp-5188	440	10	"	"	PUNCT
fnp-5188	440	11	,	,	PUNCT
fnp-5188	440	12	(	(	PUNCT
fnp-5188	440	13	11	11	NUM
fnp-5188	440	14	,	,	PUNCT
fnp-5188	440	15	214	214	NUM
fnp-5188	440	16	):	):	PUNCT
fnp-5188	440	17	p.	p.	NOUN
fnp-5188	440	18	1	1	NUM
fnp-5188	440	19	-	-	SYM
fnp-5188	440	20	19	19	NUM
fnp-5188	440	21	.	.	NOUN
fnp-5188	440	22	https://doi.org/10.3390/biomedicines11010214	https://doi.org/10.3390/biomedicines11010214	PROPN
fnp-5188	440	23	18	18	NUM
fnp-5188	440	24	.	.	PUNCT
fnp-5188	441	1	ueda	ueda	PROPN
fnp-5188	441	2	,	,	PUNCT
fnp-5188	441	3	r.	r.	PROPN
fnp-5188	441	4	,	,	PUNCT
fnp-5188	441	5	et	et	PROPN
fnp-5188	441	6	al	al	PROPN
fnp-5188	441	7	.	.	PROPN
fnp-5188	441	8	,	,	PUNCT
fnp-5188	441	9	systemic	systemic	ADJ
fnp-5188	441	10	inhibition	inhibition	NOUN
fnp-5188	441	11	of	of	ADP
fnp-5188	441	12	transforming	transform	VERB
fnp-5188	441	13	growth	growth	NOUN
fnp-5188	441	14	factor	factor	NOUN
fnp-5188	441	15	-	-	PUNCT
fnp-5188	441	16	beta	beta	NOUN
fnp-5188	441	17	in	in	ADP
fnp-5188	441	18	glioma	glioma	NOUN
fnp-5188	441	19	-	-	PUNCT
fnp-5188	441	20	bearing	bear	VERB
fnp-5188	441	21	mice	mouse	NOUN
fnp-5188	441	22	improves	improve	VERB
fnp-5188	441	23	the	the	DET
fnp-5188	441	24	therapeutic	therapeutic	ADJ
fnp-5188	441	25	efficacy	efficacy	NOUN
fnp-5188	441	26	of	of	ADP
fnp-5188	441	27	glioma	glioma	NOUN
fnp-5188	441	28	-	-	PUNCT
fnp-5188	441	29	associated	associate	VERB
fnp-5188	441	30	antigen	antigen	ADJ
fnp-5188	441	31	peptide	peptide	ADJ
fnp-5188	441	32	vaccines	vaccine	NOUN
fnp-5188	441	33	.	.	PUNCT
fnp-5188	442	1	clin	clin	PROPN
fnp-5188	442	2	cancer	cancer	NOUN
fnp-5188	442	3	res	re	NOUN
fnp-5188	442	4	,	,	PUNCT
fnp-5188	442	5	2009	2009	NUM
fnp-5188	442	6	.	.	PUNCT
fnp-5188	443	1	15(21	15(21	NUM
fnp-5188	443	2	):	):	PUNCT
fnp-5188	443	3	p.	p.	NOUN
fnp-5188	443	4	6551	6551	NUM
fnp-5188	443	5	-	-	SYM
fnp-5188	443	6	9	9	NUM
fnp-5188	443	7	.	.	PUNCT
fnp-5188	443	8	https://doi.org/10.1158/1078-0432.ccr-09-1067	https://doi.org/10.1158/1078-0432.ccr-09-1067	NUM
fnp-5188	443	9	19	19	NUM
fnp-5188	443	10	.	.	X
fnp-5188	443	11	ausman	ausman	PROPN
fnp-5188	443	12	,	,	PUNCT
fnp-5188	443	13	j.i	j.i	PROPN
fnp-5188	443	14	.	.	PROPN
fnp-5188	443	15	,	,	PUNCT
fnp-5188	443	16	w.r	w.r	PROPN
fnp-5188	443	17	.	.	PROPN
fnp-5188	443	18	shapiro	shapiro	PROPN
fnp-5188	443	19	,	,	PUNCT
fnp-5188	443	20	and	and	CCONJ
fnp-5188	443	21	d.p	d.p	PROPN
fnp-5188	443	22	.	.	PROPN
fnp-5188	443	23	rall	rall	PROPN
fnp-5188	443	24	,	,	PUNCT
fnp-5188	443	25	studies	study	NOUN
fnp-5188	443	26	on	on	ADP
fnp-5188	443	27	the	the	DET
fnp-5188	443	28	chemotherapy	chemotherapy	NOUN
fnp-5188	443	29	of	of	ADP
fnp-5188	443	30	experimental	experimental	ADJ
fnp-5188	443	31	brain	brain	NOUN
fnp-5188	443	32	tumors	tumor	NOUN
fnp-5188	443	33	:	:	PUNCT
fnp-5188	443	34	development	development	NOUN
fnp-5188	443	35	of	of	ADP
fnp-5188	443	36	an	an	DET
fnp-5188	443	37	experimental	experimental	ADJ
fnp-5188	443	38	model	model	NOUN
fnp-5188	443	39	.	.	PUNCT
fnp-5188	444	1	cancer	cancer	NOUN
fnp-5188	444	2	res	re	NOUN
fnp-5188	444	3	,	,	PUNCT
fnp-5188	444	4	1970	1970	NUM
fnp-5188	444	5	.	.	PUNCT
fnp-5188	445	1	30(9	30(9	NUM
fnp-5188	445	2	):	):	PUNCT
fnp-5188	445	3	p.	p.	NOUN
fnp-5188	445	4	2394	2394	NUM
fnp-5188	445	5	-	-	SYM
fnp-5188	445	6	400	400	NUM
fnp-5188	445	7	.	.	PUNCT
fnp-5188	446	1	20	20	NUM
fnp-5188	446	2	.	.	PUNCT
fnp-5188	447	1	oh	oh	INTJ
fnp-5188	447	2	,	,	PUNCT
fnp-5188	447	3	s.a	s.a	PROPN
fnp-5188	447	4	.	.	PROPN
fnp-5188	447	5	,	,	PUNCT
fnp-5188	447	6	a.	a.	PROPN
fnp-5188	447	7	seki	seki	PROPN
fnp-5188	447	8	,	,	PUNCT
fnp-5188	447	9	and	and	CCONJ
fnp-5188	447	10	s.	s.	PROPN
fnp-5188	447	11	rutz	rutz	PROPN
fnp-5188	447	12	,	,	PUNCT
fnp-5188	447	13	ribonucleoprotein	ribonucleoprotein	NOUN
fnp-5188	447	14	transfection	transfection	NOUN
fnp-5188	447	15	for	for	ADP
fnp-5188	447	16	crispr	crispr	ADJ
fnp-5188	447	17	/	/	SYM
fnp-5188	447	18	cas9	cas9	NOUN
fnp-5188	447	19	-	-	PUNCT
fnp-5188	447	20	mediated	mediate	VERB
fnp-5188	447	21	gene	gene	NOUN
fnp-5188	447	22	knockout	knockout	NOUN
fnp-5188	447	23	in	in	ADP
fnp-5188	447	24	primary	primary	ADJ
fnp-5188	447	25	t	t	NOUN
fnp-5188	447	26	cells	cell	NOUN
fnp-5188	447	27	.	.	PUNCT
fnp-5188	448	1	curr	curr	PROPN
fnp-5188	448	2	protoc	protoc	PROPN
fnp-5188	448	3	immunol	immunol	NOUN
fnp-5188	448	4	,	,	PUNCT
fnp-5188	448	5	2019	2019	NUM
fnp-5188	448	6	.	.	PUNCT
fnp-5188	449	1	124(1	124(1	NUM
fnp-5188	449	2	):	):	PUNCT
fnp-5188	449	3	p.	p.	NOUN
fnp-5188	449	4	e69	e69	NUM
fnp-5188	449	5	.	.	PUNCT
fnp-5188	450	1	https://doi.org/10.1002/cpim.69	https://doi.org/10.1002/cpim.69	PROPN
fnp-5188	450	2	21	21	NUM
fnp-5188	450	3	.	.	PUNCT
fnp-5188	451	1	stemmer	stemmer	PROPN
fnp-5188	451	2	,	,	PUNCT
fnp-5188	451	3	m.	m.	NOUN
fnp-5188	451	4	,	,	PUNCT
fnp-5188	451	5	et	et	PROPN
fnp-5188	451	6	al	al	PROPN
fnp-5188	451	7	.	.	PROPN
fnp-5188	451	8	,	,	PUNCT
fnp-5188	451	9	cctop	cctop	VERB
fnp-5188	451	10	:	:	PUNCT
fnp-5188	451	11	an	an	DET
fnp-5188	451	12	intuitive	intuitive	ADJ
fnp-5188	451	13	,	,	PUNCT
fnp-5188	451	14	flexible	flexible	ADJ
fnp-5188	451	15	and	and	CCONJ
fnp-5188	451	16	reliable	reliable	ADJ
fnp-5188	451	17	crispr	crispr	ADJ
fnp-5188	451	18	/	/	SYM
fnp-5188	451	19	cas9	cas9	NOUN
fnp-5188	451	20	target	target	NOUN
fnp-5188	451	21	prediction	prediction	NOUN
fnp-5188	451	22	tool	tool	NOUN
fnp-5188	451	23	.	.	PUNCT
fnp-5188	452	1	plos	plos	PROPN
fnp-5188	452	2	one	one	NUM
fnp-5188	452	3	,	,	PUNCT
fnp-5188	452	4	2015	2015	NUM
fnp-5188	452	5	.	.	PUNCT
fnp-5188	453	1	10(4	10(4	NUM
fnp-5188	453	2	):	):	PUNCT
fnp-5188	453	3	p.	p.	NOUN
fnp-5188	453	4	e0124633	e0124633	NOUN
fnp-5188	453	5	.	.	PUNCT
fnp-5188	454	1	https://doi.org/10.1371/journal.pone.0124633	https://doi.org/10.1371/journal.pone.0124633	PROPN
fnp-5188	454	2	22	22	NUM
fnp-5188	454	3	.	.	PUNCT
fnp-5188	454	4	bartussek	bartussek	PROPN
fnp-5188	454	5	,	,	PUNCT
fnp-5188	454	6	c.	c.	PROPN
fnp-5188	454	7	,	,	PUNCT
fnp-5188	454	8	u.	u.	NOUN
fnp-5188	454	9	naumann	naumann	PROPN
fnp-5188	454	10	,	,	PUNCT
fnp-5188	454	11	and	and	CCONJ
fnp-5188	454	12	m.	m.	NOUN
fnp-5188	454	13	weller	weller	NOUN
fnp-5188	454	14	,	,	PUNCT
fnp-5188	454	15	accumulation	accumulation	NOUN
fnp-5188	454	16	of	of	ADP
fnp-5188	454	17	mutant	mutant	ADJ
fnp-5188	454	18	p53(v143a	p53(v143a	NUM
fnp-5188	454	19	)	)	PUNCT
fnp-5188	454	20	modulates	modulate	VERB
fnp-5188	454	21	the	the	DET
fnp-5188	454	22	growth	growth	NOUN
fnp-5188	454	23	,	,	PUNCT
fnp-5188	454	24	clonogenicity	clonogenicity	NOUN
fnp-5188	454	25	,	,	PUNCT
fnp-5188	454	26	and	and	CCONJ
fnp-5188	454	27	radiochemosensitivity	radiochemosensitivity	NOUN
fnp-5188	454	28	of	of	ADP
fnp-5188	454	29	malignant	malignant	ADJ
fnp-5188	454	30	glioma	glioma	NOUN
fnp-5188	454	31	cells	cell	NOUN
fnp-5188	454	32	independent	independent	ADJ
fnp-5188	454	33	of	of	ADP
fnp-5188	454	34	endogenous	endogenous	ADJ
fnp-5188	454	35	p53	p53	NOUN
fnp-5188	454	36	status	status	NOUN
fnp-5188	454	37	.	.	PUNCT
fnp-5188	455	1	exp	exp	NOUN
fnp-5188	455	2	cell	cell	NOUN
fnp-5188	455	3	res	re	NOUN
fnp-5188	455	4	,	,	PUNCT
fnp-5188	455	5	1999	1999	NUM
fnp-5188	455	6	.	.	PUNCT
fnp-5188	456	1	253(2	253(2	NUM
fnp-5188	456	2	):	):	PUNCT
fnp-5188	456	3	p.	p.	NOUN
fnp-5188	456	4	432	432	NUM
fnp-5188	456	5	-	-	SYM
fnp-5188	456	6	9	9	NUM
fnp-5188	456	7	.	.	PUNCT
fnp-5188	457	1	https://doi.org/10.1006/excr.1999.4654	https://doi.org/10.1006/excr.1999.4654	PROPN
fnp-5188	457	2	23	23	NUM
fnp-5188	457	3	.	.	PUNCT
fnp-5188	457	4	schotterl	schotterl	PROPN
fnp-5188	457	5	,	,	PUNCT
fnp-5188	457	6	s.	s.	PROPN
fnp-5188	457	7	,	,	PUNCT
fnp-5188	457	8	et	et	PROPN
fnp-5188	457	9	al	al	PROPN
fnp-5188	457	10	.	.	PROPN
fnp-5188	457	11	,	,	PUNCT
fnp-5188	457	12	viscumins	viscumin	VERB
fnp-5188	457	13	functionally	functionally	ADV
fnp-5188	457	14	modulate	modulate	VERB
fnp-5188	457	15	cell	cell	NOUN
fnp-5188	457	16	motility	motility	NOUN
fnp-5188	457	17	-	-	PUNCT
fnp-5188	457	18	associated	associate	VERB
fnp-5188	457	19	gene	gene	NOUN
fnp-5188	457	20	expression	expression	NOUN
fnp-5188	457	21	.	.	PUNCT
fnp-5188	458	1	int	int	NOUN
fnp-5188	458	2	j	j	PROPN
fnp-5188	458	3	oncol	oncol	ADJ
fnp-5188	458	4	,	,	PUNCT
fnp-5188	458	5	2017	2017	NUM
fnp-5188	458	6	.	.	PUNCT
fnp-5188	459	1	50(2	50(2	NUM
fnp-5188	459	2	):	):	PUNCT
fnp-5188	459	3	p.	p.	NOUN
fnp-5188	459	4	684	684	NUM
fnp-5188	459	5	-	-	SYM
fnp-5188	459	6	696	696	NUM
fnp-5188	459	7	.	.	PUNCT
fnp-5188	460	1	https://doi.org/10.3892/ijo.2017.3838	https://doi.org/10.3892/ijo.2017.3838	ADP
fnp-5188	460	2	24	24	NUM
fnp-5188	460	3	.	.	PUNCT
fnp-5188	461	1	shalem	shalem	NOUN
fnp-5188	461	2	,	,	PUNCT
fnp-5188	461	3	o.	o.	PROPN
fnp-5188	461	4	,	,	PUNCT
fnp-5188	461	5	et	et	PROPN
fnp-5188	461	6	al	al	PROPN
fnp-5188	461	7	.	.	PROPN
fnp-5188	461	8	,	,	PUNCT
fnp-5188	461	9	genome	genome	NOUN
fnp-5188	461	10	-	-	PUNCT
fnp-5188	461	11	scale	scale	NOUN
fnp-5188	461	12	crispr	crispr	NOUN
fnp-5188	461	13	-	-	PUNCT
fnp-5188	461	14	cas9	cas9	NOUN
fnp-5188	461	15	knockout	knockout	NOUN
fnp-5188	461	16	screening	screen	VERB
fnp-5188	461	17	in	in	ADP
fnp-5188	461	18	human	human	ADJ
fnp-5188	461	19	cells	cell	NOUN
fnp-5188	461	20	.	.	PUNCT
fnp-5188	462	1	science	science	NOUN
fnp-5188	462	2	,	,	PUNCT
fnp-5188	462	3	2014	2014	NUM
fnp-5188	462	4	.	.	PUNCT
fnp-5188	463	1	343(6166	343(6166	NUM
fnp-5188	463	2	):	):	PUNCT
fnp-5188	463	3	p.	p.	NOUN
fnp-5188	463	4	84	84	NUM
fnp-5188	463	5	-	-	SYM
fnp-5188	463	6	87	87	NUM
fnp-5188	463	7	.	.	PUNCT
fnp-5188	464	1	https://doi.org/10.1126/science.1247005	https://doi.org/10.1126/science.1247005	PROPN
fnp-5188	465	1	25	25	NUM
fnp-5188	465	2	.	.	PUNCT
fnp-5188	465	3	fricano	fricano	ADJ
fnp-5188	465	4	-	-	PUNCT
fnp-5188	465	5	kugler	kugler	PROPN
fnp-5188	465	6	,	,	PUNCT
fnp-5188	465	7	c.j	c.j	PROPN
fnp-5188	465	8	.	.	PROPN
fnp-5188	465	9	,	,	PUNCT
fnp-5188	465	10	et	et	PROPN
fnp-5188	465	11	al	al	PROPN
fnp-5188	465	12	.	.	PROPN
fnp-5188	465	13	,	,	PUNCT
fnp-5188	465	14	designing	designing	NOUN
fnp-5188	465	15	,	,	PUNCT
fnp-5188	465	16	packaging	packaging	NOUN
fnp-5188	465	17	,	,	PUNCT
fnp-5188	465	18	and	and	CCONJ
fnp-5188	465	19	delivery	delivery	NOUN
fnp-5188	465	20	of	of	ADP
fnp-5188	465	21	high	high	ADJ
fnp-5188	465	22	titer	titer	NOUN
fnp-5188	465	23	crispr	crispr	NOUN
fnp-5188	465	24	retro	retro	NOUN
fnp-5188	465	25	and	and	CCONJ
fnp-5188	465	26	lentiviruses	lentiviruse	NOUN
fnp-5188	465	27	via	via	ADP
fnp-5188	465	28	stereotaxic	stereotaxic	ADJ
fnp-5188	465	29	injection	injection	NOUN
fnp-5188	465	30	.	.	PUNCT
fnp-5188	466	1	j	j	PROPN
fnp-5188	466	2	vis	vis	X
fnp-5188	466	3	exp	exp	PROPN
fnp-5188	466	4	,	,	PUNCT
fnp-5188	466	5	2016(111	2016(111	NUM
fnp-5188	466	6	)	)	PUNCT
fnp-5188	466	7	.	.	PUNCT
fnp-5188	467	1	https://doi.org/10.3791/53783	https://doi.org/10.3791/53783	NOUN
fnp-5188	467	2	26	26	NUM
fnp-5188	467	3	.	.	PUNCT
fnp-5188	468	1	nisancioglu	nisancioglu	PROPN
fnp-5188	468	2	,	,	PUNCT
fnp-5188	468	3	m.h	m.h	PROPN
fnp-5188	468	4	.	.	PROPN
fnp-5188	468	5	,	,	PUNCT
fnp-5188	468	6	et	et	PROPN
fnp-5188	468	7	al	al	PROPN
fnp-5188	468	8	.	.	PROPN
fnp-5188	468	9	,	,	PUNCT
fnp-5188	468	10	generation	generation	NOUN
fnp-5188	468	11	and	and	CCONJ
fnp-5188	468	12	characterization	characterization	NOUN
fnp-5188	468	13	of	of	ADP
fnp-5188	468	14	rgs5	rgs5	ADJ
fnp-5188	468	15	mutant	mutant	ADJ
fnp-5188	468	16	mice	mouse	NOUN
fnp-5188	468	17	.	.	PUNCT
fnp-5188	469	1	molecular	molecular	ADJ
fnp-5188	469	2	and	and	CCONJ
fnp-5188	469	3	cellular	cellular	ADJ
fnp-5188	469	4	biology	biology	NOUN
fnp-5188	469	5	,	,	PUNCT
fnp-5188	469	6	2008	2008	NUM
fnp-5188	469	7	.	.	PUNCT
fnp-5188	470	1	28(7	28(7	NUM
fnp-5188	470	2	):	):	PUNCT
fnp-5188	471	1	p.	p.	NOUN
fnp-5188	471	2	2324	2324	NUM
fnp-5188	471	3	-	-	SYM
fnp-5188	471	4	31	31	NUM
fnp-5188	471	5	.	.	PUNCT
fnp-5188	472	1	https://doi.org/10.1128/mcb.01252-07	https://doi.org/10.1128/mcb.01252-07	ADV
fnp-5188	472	2	27	27	NUM
fnp-5188	472	3	.	.	PUNCT
fnp-5188	473	1	schindelin	schindelin	PROPN
fnp-5188	473	2	,	,	PUNCT
fnp-5188	473	3	j.	j.	PROPN
fnp-5188	473	4	,	,	PUNCT
fnp-5188	473	5	et	et	PROPN
fnp-5188	473	6	al	al	PROPN
fnp-5188	473	7	.	.	PROPN
fnp-5188	473	8	,	,	PUNCT
fnp-5188	473	9	fiji	fiji	PROPN
fnp-5188	473	10	:	:	PUNCT
fnp-5188	473	11	an	an	DET
fnp-5188	473	12	open	open	ADJ
fnp-5188	473	13	-	-	PUNCT
fnp-5188	473	14	source	source	NOUN
fnp-5188	473	15	platform	platform	NOUN
fnp-5188	473	16	for	for	ADP
fnp-5188	473	17	biological	biological	ADJ
fnp-5188	473	18	-	-	PUNCT
fnp-5188	473	19	image	image	NOUN
fnp-5188	473	20	analysis	analysis	NOUN
fnp-5188	473	21	.	.	PUNCT
fnp-5188	474	1	nature	nature	NOUN
fnp-5188	474	2	methods	method	NOUN
fnp-5188	474	3	,	,	PUNCT
fnp-5188	474	4	2012	2012	NUM
fnp-5188	474	5	.	.	PUNCT
fnp-5188	475	1	9(7	9(7	NUM
fnp-5188	475	2	):	):	PUNCT
fnp-5188	475	3	p.	p.	NOUN
fnp-5188	475	4	676	676	NUM
fnp-5188	475	5	-	-	SYM
fnp-5188	475	6	82	82	NUM
fnp-5188	475	7	.	.	PUNCT
fnp-5188	475	8	https://doi.org/10.1038/nmeth.2019	https://doi.org/10.1038/nmeth.2019	X
fnp-5188	475	9	28	28	NUM
fnp-5188	475	10	.	.	PUNCT
fnp-5188	476	1	neckel	neckel	PROPN
fnp-5188	476	2	,	,	PUNCT
fnp-5188	476	3	p.h	p.h	PROPN
fnp-5188	476	4	.	.	PROPN
fnp-5188	476	5	,	,	PUNCT
fnp-5188	476	6	et	et	PROPN
fnp-5188	476	7	al	al	PROPN
fnp-5188	476	8	.	.	PROPN
fnp-5188	476	9	,	,	PUNCT
fnp-5188	476	10	large	large	ADJ
fnp-5188	476	11	-	-	PUNCT
fnp-5188	476	12	scale	scale	NOUN
fnp-5188	476	13	tissue	tissue	NOUN
fnp-5188	476	14	clearing	clearing	NOUN
fnp-5188	476	15	(	(	PUNCT
fnp-5188	476	16	pact	pact	NOUN
fnp-5188	476	17	):	):	PUNCT
fnp-5188	476	18	technical	technical	ADJ
fnp-5188	476	19	evaluation	evaluation	NOUN
fnp-5188	476	20	and	and	CCONJ
fnp-5188	476	21	new	new	ADJ
fnp-5188	476	22	perspectives	perspective	NOUN
fnp-5188	476	23	in	in	ADP
fnp-5188	476	24	immunofluorescence	immunofluorescence	NOUN
fnp-5188	476	25	,	,	PUNCT
fnp-5188	476	26	histology	histology	NOUN
fnp-5188	476	27	,	,	PUNCT
fnp-5188	476	28	and	and	CCONJ
fnp-5188	476	29	ultrastructure	ultrastructure	NOUN
fnp-5188	476	30	.	.	PUNCT
fnp-5188	477	1	sci	sci	PROPN
fnp-5188	477	2	rep	rep	PROPN
fnp-5188	477	3	,	,	PUNCT
fnp-5188	477	4	2016	2016	NUM
fnp-5188	477	5	.	.	PUNCT
fnp-5188	478	1	6	6	NUM
fnp-5188	478	2	:	:	PUNCT
fnp-5188	478	3	p.	p.	NOUN
fnp-5188	478	4	34331	34331	NUM
fnp-5188	478	5	.	.	PUNCT
fnp-5188	479	1	https://doi.org/10.1038/srep34331	https://doi.org/10.1038/srep34331	PROPN
fnp-5188	479	2	29	29	NUM
fnp-5188	479	3	.	.	PUNCT
fnp-5188	480	1	chung	chung	PROPN
fnp-5188	480	2	,	,	PUNCT
fnp-5188	480	3	k.	k.	PROPN
fnp-5188	480	4	and	and	CCONJ
fnp-5188	480	5	k.	k.	PROPN
fnp-5188	480	6	deisseroth	deisseroth	PROPN
fnp-5188	480	7	,	,	PUNCT
fnp-5188	480	8	clarity	clarity	NOUN
fnp-5188	480	9	for	for	ADP
fnp-5188	480	10	mapping	map	VERB
fnp-5188	480	11	the	the	DET
fnp-5188	480	12	nervous	nervous	ADJ
fnp-5188	480	13	system	system	NOUN
fnp-5188	480	14	.	.	PUNCT
fnp-5188	481	1	nat	nat	NOUN
fnp-5188	481	2	methods	method	NOUN
fnp-5188	481	3	,	,	PUNCT
fnp-5188	481	4	2013	2013	NUM
fnp-5188	481	5	.	.	PUNCT
fnp-5188	482	1	10(6	10(6	ADV
fnp-5188	482	2	):	):	PUNCT
fnp-5188	482	3	p.	p.	NOUN
fnp-5188	482	4	508	508	NUM
fnp-5188	482	5	-	-	SYM
fnp-5188	482	6	13	13	NUM
fnp-5188	482	7	.	.	PUNCT
fnp-5188	483	1	https://doi.org/10.1038/nmeth.2481	https://doi.org/10.1038/nmeth.2481	VERB
fnp-5188	483	2	30	30	NUM
fnp-5188	483	3	.	.	PUNCT
fnp-5188	484	1	du	du	PROPN
fnp-5188	484	2	,	,	PUNCT
fnp-5188	484	3	h.	h.	PROPN
fnp-5188	484	4	,	,	PUNCT
fnp-5188	484	5	et	et	PROPN
fnp-5188	484	6	al	al	PROPN
fnp-5188	484	7	.	.	PROPN
fnp-5188	484	8	,	,	PUNCT
fnp-5188	484	9	advances	advance	VERB
fnp-5188	484	10	in	in	ADP
fnp-5188	484	11	clarity	clarity	NOUN
fnp-5188	484	12	-	-	PUNCT
fnp-5188	484	13	based	base	VERB
fnp-5188	484	14	tissue	tissue	NOUN
fnp-5188	484	15	clearing	clearing	NOUN
fnp-5188	484	16	and	and	CCONJ
fnp-5188	484	17	imaging	imaging	NOUN
fnp-5188	484	18	.	.	PUNCT
fnp-5188	485	1	exp	exp	NOUN
fnp-5188	485	2	ther	ther	PROPN
fnp-5188	485	3	med	me	VERB
fnp-5188	485	4	,	,	PUNCT
fnp-5188	485	5	2018	2018	NUM
fnp-5188	485	6	.	.	PUNCT
fnp-5188	486	1	16(3	16(3	X
fnp-5188	486	2	):	):	PUNCT
fnp-5188	486	3	p.	p.	NOUN
fnp-5188	486	4	1567	1567	NUM
fnp-5188	486	5	-	-	SYM
fnp-5188	486	6	1576	1576	NUM
fnp-5188	486	7	.	.	PUNCT
fnp-5188	487	1	https://doi.org/10.3892/etm.2018.6374	https://doi.org/10.3892/etm.2018.6374	NOUN
fnp-5188	487	2	31	31	NUM
fnp-5188	487	3	.	.	PUNCT
fnp-5188	488	1	bondjers	bondjer	NOUN
fnp-5188	488	2	,	,	PUNCT
fnp-5188	488	3	c.	c.	PROPN
fnp-5188	488	4	,	,	PUNCT
fnp-5188	488	5	et	et	PROPN
fnp-5188	488	6	al	al	PROPN
fnp-5188	488	7	.	.	PROPN
fnp-5188	488	8	,	,	PUNCT
fnp-5188	488	9	transcription	transcription	NOUN
fnp-5188	488	10	profiling	profiling	NOUN
fnp-5188	488	11	of	of	ADP
fnp-5188	488	12	platelet	platelet	NOUN
fnp-5188	488	13	-	-	PUNCT
fnp-5188	488	14	derived	derive	VERB
fnp-5188	488	15	growth	growth	NOUN
fnp-5188	488	16	factor	factor	NOUN
fnp-5188	488	17	-	-	PUNCT
fnp-5188	488	18	b	b	NOUN
fnp-5188	488	19	-	-	PUNCT
fnp-5188	488	20	deficient	deficient	ADJ
fnp-5188	488	21	mouse	mouse	NOUN
fnp-5188	488	22	embryos	embryo	NOUN
fnp-5188	488	23	identifies	identify	VERB
fnp-5188	488	24	rgs5	rgs5	VERB
fnp-5188	488	25	as	as	ADP
fnp-5188	488	26	a	a	DET
fnp-5188	488	27	novel	novel	ADJ
fnp-5188	488	28	marker	marker	NOUN
fnp-5188	488	29	for	for	ADP
fnp-5188	488	30	pericytes	pericyte	NOUN
fnp-5188	488	31	and	and	CCONJ
fnp-5188	488	32	vascular	vascular	ADJ
fnp-5188	488	33	smooth	smooth	ADJ
fnp-5188	488	34	muscle	muscle	NOUN
fnp-5188	488	35	cells	cell	NOUN
fnp-5188	488	36	.	.	PUNCT
fnp-5188	489	1	the	the	DET
fnp-5188	489	2	american	american	PROPN
fnp-5188	489	3	journal	journal	PROPN
fnp-5188	489	4	of	of	ADP
fnp-5188	489	5	pathology	pathology	PROPN
fnp-5188	489	6	,	,	PUNCT
fnp-5188	489	7	2003	2003	NUM
fnp-5188	489	8	.	.	PUNCT
fnp-5188	490	1	162(3	162(3	NUM
fnp-5188	490	2	):	):	PUNCT
fnp-5188	490	3	p.	p.	NOUN
fnp-5188	490	4	721	721	NUM
fnp-5188	490	5	-	-	SYM
fnp-5188	490	6	9	9	NUM
fnp-5188	490	7	.	.	PUNCT
fnp-5188	490	8	https://doi.org/10.1016/s0002-9440(10)63868-0	https://doi.org/10.1016/s0002-9440(10)63868-0	PROPN
fnp-5188	490	9	32	32	NUM
fnp-5188	490	10	.	.	PUNCT
fnp-5188	491	1	pliatsika	pliatsika	NOUN
fnp-5188	491	2	,	,	PUNCT
fnp-5188	491	3	v.	v.	PROPN
fnp-5188	491	4	and	and	CCONJ
fnp-5188	491	5	i.	i.	PROPN
fnp-5188	491	6	rigoutsos	rigoutsos	PROPN
fnp-5188	491	7	,	,	PUNCT
fnp-5188	491	8	"	"	PUNCT
fnp-5188	491	9	off	off	ADP
fnp-5188	491	10	-	-	PUNCT
fnp-5188	491	11	spotter	spotter	NOUN
fnp-5188	491	12	"	"	PUNCT
fnp-5188	491	13	:	:	PUNCT
fnp-5188	491	14	very	very	ADV
fnp-5188	491	15	fast	fast	ADJ
fnp-5188	491	16	and	and	CCONJ
fnp-5188	491	17	exhaustive	exhaustive	ADJ
fnp-5188	491	18	enumeration	enumeration	NOUN
fnp-5188	491	19	of	of	ADP
fnp-5188	491	20	genomic	genomic	ADJ
fnp-5188	491	21	lookalikes	lookalike	NOUN
fnp-5188	491	22	for	for	ADP
fnp-5188	491	23	designing	design	VERB
fnp-5188	491	24	crispr	crispr	ADJ
fnp-5188	491	25	/	/	SYM
fnp-5188	491	26	cas	cas	PROPN
fnp-5188	491	27	guide	guide	NOUN
fnp-5188	491	28	rnas	rna	NOUN
fnp-5188	491	29	.	.	PUNCT
fnp-5188	492	1	biol	biol	PROPN
fnp-5188	492	2	direct	direct	ADJ
fnp-5188	492	3	,	,	PUNCT
fnp-5188	492	4	2015	2015	NUM
fnp-5188	492	5	.	.	PUNCT
fnp-5188	493	1	10	10	NUM
fnp-5188	493	2	:	:	PUNCT
fnp-5188	493	3	p.	p.	NOUN
fnp-5188	493	4	4	4	NUM
fnp-5188	493	5	.	.	PUNCT
fnp-5188	494	1	https://doi.org/10.1186/s13062-015-0035-z	https://doi.org/10.1186/s13062-015-0035-z	PROPN
fnp-5188	494	2	33	33	NUM
fnp-5188	494	3	.	.	PUNCT
fnp-5188	495	1	hamza	hamza	PROPN
fnp-5188	495	2	,	,	PUNCT
fnp-5188	495	3	m.a	m.a	PROPN
fnp-5188	495	4	.	.	PROPN
fnp-5188	495	5	,	,	PUNCT
fnp-5188	495	6	et	et	PROPN
fnp-5188	495	7	al	al	PROPN
fnp-5188	495	8	.	.	PROPN
fnp-5188	495	9	,	,	PUNCT
fnp-5188	495	10	survival	survival	NOUN
fnp-5188	495	11	outcome	outcome	NOUN
fnp-5188	495	12	of	of	ADP
fnp-5188	495	13	early	early	ADJ
fnp-5188	495	14	versus	versus	ADP
fnp-5188	495	15	delayed	delayed	ADJ
fnp-5188	495	16	bevacizumab	bevacizumab	NOUN
fnp-5188	495	17	treatment	treatment	NOUN
fnp-5188	495	18	in	in	ADP
fnp-5188	495	19	patients	patient	NOUN
fnp-5188	495	20	with	with	ADP
fnp-5188	495	21	recurrent	recurrent	ADJ
fnp-5188	495	22	glioblastoma	glioblastoma	NOUN
fnp-5188	495	23	.	.	PUNCT
fnp-5188	496	1	j	j	PROPN
fnp-5188	496	2	neurooncol	neurooncol	PROPN
fnp-5188	496	3	,	,	PUNCT
fnp-5188	496	4	2014	2014	NUM
fnp-5188	496	5	.	.	PUNCT
fnp-5188	497	1	119(1	119(1	NUM
fnp-5188	497	2	):	):	PUNCT
fnp-5188	498	1	p.	p.	NOUN
fnp-5188	498	2	135	135	NUM
fnp-5188	498	3	-	-	SYM
fnp-5188	498	4	40	40	NUM
fnp-5188	498	5	.	.	PUNCT
fnp-5188	499	1	https://doi.org/10.1007/s11060-014-1460-z	https://doi.org/10.1007/s11060-014-1460-z	PROPN
fnp-5188	499	2	34	34	NUM
fnp-5188	499	3	.	.	PUNCT
fnp-5188	500	1	gilbert	gilbert	PROPN
fnp-5188	500	2	,	,	PUNCT
fnp-5188	500	3	m.r	m.r	PROPN
fnp-5188	500	4	.	.	PROPN
fnp-5188	500	5	,	,	PUNCT
fnp-5188	500	6	et	et	PROPN
fnp-5188	500	7	al	al	PROPN
fnp-5188	500	8	.	.	PROPN
fnp-5188	500	9	,	,	PUNCT
fnp-5188	500	10	a	a	DET
fnp-5188	500	11	randomized	randomized	ADJ
fnp-5188	500	12	trial	trial	NOUN
fnp-5188	500	13	of	of	ADP
fnp-5188	500	14	bevacizumab	bevacizumab	NOUN
fnp-5188	500	15	for	for	ADP
fnp-5188	500	16	newly	newly	ADV
fnp-5188	500	17	diagnosed	diagnose	VERB
fnp-5188	500	18	glioblastoma	glioblastoma	NOUN
fnp-5188	500	19	.	.	PUNCT
fnp-5188	501	1	n	n	PROPN
fnp-5188	501	2	engl	engl	PROPN
fnp-5188	501	3	j	j	PROPN
fnp-5188	501	4	med	med	PROPN
fnp-5188	501	5	,	,	PUNCT
fnp-5188	501	6	2014	2014	NUM
fnp-5188	501	7	.	.	PUNCT
fnp-5188	502	1	370(8	370(8	NUM
fnp-5188	502	2	):	):	PUNCT
fnp-5188	502	3	p.	p.	NOUN
fnp-5188	502	4	699	699	NUM
fnp-5188	502	5	-	-	SYM
fnp-5188	502	6	708	708	NUM
fnp-5188	502	7	.	.	PUNCT
fnp-5188	503	1	https://doi.org/10.1056/nejmoa1308573	https://doi.org/10.1056/nejmoa1308573	NOUN
fnp-5188	503	2	35	35	NUM
fnp-5188	503	3	.	.	PUNCT
fnp-5188	504	1	keunen	keunen	PROPN
fnp-5188	504	2	,	,	PUNCT
fnp-5188	504	3	o.	o.	PROPN
fnp-5188	504	4	,	,	PUNCT
fnp-5188	504	5	et	et	PROPN
fnp-5188	504	6	al	al	PROPN
fnp-5188	504	7	.	.	PROPN
fnp-5188	504	8	,	,	PUNCT
fnp-5188	504	9	anti	anti	ADJ
fnp-5188	504	10	-	-	ADJ
fnp-5188	504	11	vegf	vegf	ADJ
fnp-5188	504	12	treatment	treatment	NOUN
fnp-5188	504	13	reduces	reduce	VERB
fnp-5188	504	14	blood	blood	NOUN
fnp-5188	504	15	supply	supply	NOUN
fnp-5188	504	16	and	and	CCONJ
fnp-5188	504	17	increases	increase	VERB
fnp-5188	504	18	tumor	tumor	NOUN
fnp-5188	504	19	cell	cell	NOUN
fnp-5188	504	20	invasion	invasion	NOUN
fnp-5188	504	21	in	in	ADP
fnp-5188	504	22	glioblastoma	glioblastoma	NOUN
fnp-5188	504	23	.	.	PUNCT
fnp-5188	505	1	proc	proc	PROPN
fnp-5188	505	2	natl	natl	PROPN
fnp-5188	505	3	acad	acad	PROPN
fnp-5188	505	4	sci	sci	PROPN
fnp-5188	505	5	u	u	PROPN
fnp-5188	505	6	s	s	PROPN
fnp-5188	505	7	a	a	PRON
fnp-5188	505	8	,	,	PUNCT
fnp-5188	505	9	2011	2011	NUM
fnp-5188	505	10	.	.	PUNCT
fnp-5188	506	1	108(9	108(9	NUM
fnp-5188	506	2	):	):	PUNCT
fnp-5188	506	3	p.	p.	NOUN
fnp-5188	506	4	3749	3749	NUM
fnp-5188	506	5	-	-	SYM
fnp-5188	506	6	54	54	NUM
fnp-5188	506	7	.	.	PUNCT
fnp-5188	506	8	https://doi.org/10.1073/pnas.1014480108	https://doi.org/10.1073/pnas.1014480108	VERB
fnp-5188	507	1	36	36	NUM
fnp-5188	507	2	.	.	PUNCT
fnp-5188	507	3	hill	hill	PROPN
fnp-5188	507	4	,	,	PUNCT
fnp-5188	507	5	j.	j.	PROPN
fnp-5188	507	6	,	,	PUNCT
fnp-5188	507	7	et	et	PROPN
fnp-5188	507	8	al	al	PROPN
fnp-5188	507	9	.	.	PROPN
fnp-5188	507	10	,	,	PUNCT
fnp-5188	507	11	emerging	emerge	VERB
fnp-5188	507	12	roles	role	NOUN
fnp-5188	507	13	of	of	ADP
fnp-5188	507	14	pericytes	pericyte	NOUN
fnp-5188	507	15	in	in	ADP
fnp-5188	507	16	the	the	DET
fnp-5188	507	17	regulation	regulation	NOUN
fnp-5188	507	18	of	of	ADP
fnp-5188	507	19	the	the	DET
fnp-5188	507	20	neurovascular	neurovascular	ADJ
fnp-5188	507	21	unit	unit	NOUN
fnp-5188	507	22	in	in	ADP
fnp-5188	507	23	health	health	NOUN
fnp-5188	507	24	and	and	CCONJ
fnp-5188	507	25	disease	disease	NOUN
fnp-5188	507	26	.	.	PUNCT
fnp-5188	508	1	j	j	PROPN
fnp-5188	508	2	neuroimmune	neuroimmune	PROPN
fnp-5188	508	3	pharmacol	pharmacol	PROPN
fnp-5188	508	4	,	,	PUNCT
fnp-5188	508	5	2014	2014	NUM
fnp-5188	508	6	.	.	PUNCT
fnp-5188	509	1	9(5	9(5	NUM
fnp-5188	509	2	):	):	PUNCT
fnp-5188	509	3	p.	p.	NOUN
fnp-5188	509	4	591	591	NUM
fnp-5188	509	5	-	-	SYM
fnp-5188	509	6	605	605	NUM
fnp-5188	509	7	.	.	PUNCT
fnp-5188	510	1	https://doi.org/10.1007/s11481-014-9557-x	https://doi.org/10.1007/s11481-014-9557-x	PROPN
fnp-5188	510	2	37	37	NUM
fnp-5188	510	3	.	.	PUNCT
fnp-5188	511	1	sweeney	sweeney	PROPN
fnp-5188	511	2	,	,	PUNCT
fnp-5188	511	3	m.d	m.d	PROPN
fnp-5188	511	4	.	.	PROPN
fnp-5188	511	5	,	,	PUNCT
fnp-5188	511	6	s.	s.	PROPN
fnp-5188	511	7	ayyadurai	ayyadurai	PROPN
fnp-5188	511	8	,	,	PUNCT
fnp-5188	511	9	and	and	CCONJ
fnp-5188	511	10	b.v	b.v	PROPN
fnp-5188	511	11	.	.	PROPN
fnp-5188	511	12	zlokovic	zlokovic	PROPN
fnp-5188	511	13	,	,	PUNCT
fnp-5188	511	14	pericytes	pericyte	NOUN
fnp-5188	511	15	of	of	ADP
fnp-5188	511	16	the	the	DET
fnp-5188	511	17	neurovascular	neurovascular	ADJ
fnp-5188	511	18	unit	unit	NOUN
fnp-5188	511	19	:	:	PUNCT
fnp-5188	511	20	key	key	ADJ
fnp-5188	511	21	functions	function	NOUN
fnp-5188	511	22	and	and	CCONJ
fnp-5188	511	23	signaling	signal	VERB
fnp-5188	511	24	pathways	pathway	NOUN
fnp-5188	511	25	.	.	PUNCT
fnp-5188	512	1	nat	nat	PROPN
fnp-5188	512	2	neurosci	neurosci	PROPN
fnp-5188	512	3	,	,	PUNCT
fnp-5188	512	4	2016	2016	NUM
fnp-5188	512	5	.	.	PUNCT
fnp-5188	513	1	19(6	19(6	NUM
fnp-5188	513	2	):	):	PUNCT
fnp-5188	513	3	p.	p.	NOUN
fnp-5188	513	4	771	771	NUM
fnp-5188	513	5	-	-	SYM
fnp-5188	513	6	83	83	NUM
fnp-5188	513	7	.	.	PUNCT
fnp-5188	514	1	https://doi.org/10.1038/nn.4288	https://doi.org/10.1038/nn.4288	PROPN
fnp-5188	514	2	38	38	NUM
fnp-5188	514	3	.	.	PUNCT
fnp-5188	515	1	liu	liu	PROPN
fnp-5188	515	2	,	,	PUNCT
fnp-5188	515	3	s.	s.	PROPN
fnp-5188	515	4	,	,	PUNCT
fnp-5188	515	5	et	et	PROPN
fnp-5188	515	6	al	al	PROPN
fnp-5188	515	7	.	.	PROPN
fnp-5188	515	8	,	,	PUNCT
fnp-5188	515	9	the	the	DET
fnp-5188	515	10	role	role	NOUN
fnp-5188	515	11	of	of	ADP
fnp-5188	515	12	pericytes	pericyte	NOUN
fnp-5188	515	13	in	in	ADP
fnp-5188	515	14	blood	blood	NOUN
fnp-5188	515	15	-	-	PUNCT
fnp-5188	515	16	brain	brain	NOUN
fnp-5188	515	17	barrier	barrier	NOUN
fnp-5188	515	18	function	function	NOUN
fnp-5188	515	19	and	and	CCONJ
fnp-5188	515	20	stroke	stroke	NOUN
fnp-5188	515	21	.	.	PUNCT
fnp-5188	516	1	current	current	ADJ
fnp-5188	516	2	pharmaceutical	pharmaceutical	ADJ
fnp-5188	516	3	design	design	NOUN
fnp-5188	516	4	,	,	PUNCT
fnp-5188	516	5	2012	2012	NUM
fnp-5188	516	6	.	.	PUNCT
fnp-5188	517	1	18(25	18(25	NUM
fnp-5188	517	2	):	):	PUNCT
fnp-5188	517	3	p.	p.	NOUN
fnp-5188	517	4	3653	3653	NUM
fnp-5188	517	5	-	-	SYM
fnp-5188	517	6	62	62	NUM
fnp-5188	517	7	.	.	PUNCT
fnp-5188	518	1	https://doi.org/10.2174/138161212802002706	https://doi.org/10.2174/138161212802002706	X
fnp-5188	519	1	39	39	NUM
fnp-5188	519	2	.	.	PUNCT
fnp-5188	520	1	brown	brown	PROPN
fnp-5188	520	2	,	,	PUNCT
fnp-5188	520	3	l.s	l.s	PROPN
fnp-5188	520	4	.	.	PROPN
fnp-5188	520	5	,	,	PUNCT
fnp-5188	520	6	et	et	PROPN
fnp-5188	520	7	al	al	PROPN
fnp-5188	520	8	.	.	PROPN
fnp-5188	520	9	,	,	PUNCT
fnp-5188	520	10	pericytes	pericyte	NOUN
fnp-5188	520	11	and	and	CCONJ
fnp-5188	520	12	neurovascular	neurovascular	ADJ
fnp-5188	520	13	function	function	NOUN
fnp-5188	520	14	in	in	ADP
fnp-5188	520	15	the	the	DET
fnp-5188	520	16	healthy	healthy	ADJ
fnp-5188	520	17	and	and	CCONJ
fnp-5188	520	18	diseased	diseased	ADJ
fnp-5188	520	19	brain	brain	NOUN
fnp-5188	520	20	.	.	PUNCT
fnp-5188	521	1	front	front	ADJ
fnp-5188	521	2	cell	cell	NOUN
fnp-5188	521	3	neurosci	neurosci	NOUN
fnp-5188	521	4	,	,	PUNCT
fnp-5188	521	5	2019	2019	NUM
fnp-5188	521	6	.	.	PUNCT
fnp-5188	522	1	13	13	NUM
fnp-5188	522	2	:	:	PUNCT
fnp-5188	523	1	p.	p.	NOUN
fnp-5188	523	2	282	282	NUM
fnp-5188	523	3	.	.	PUNCT
fnp-5188	524	1	https://doi.org/10.3389/fncel.2019.00282	https://doi.org/10.3389/fncel.2019.00282	PROPN
fnp-5188	524	2	40	40	NUM
fnp-5188	524	3	.	.	PUNCT
fnp-5188	525	1	yang	yang	PROPN
fnp-5188	525	2	,	,	PUNCT
fnp-5188	525	3	a.c	a.c	PROPN
fnp-5188	525	4	.	.	PROPN
fnp-5188	525	5	,	,	PUNCT
fnp-5188	525	6	et	et	PROPN
fnp-5188	525	7	al	al	PROPN
fnp-5188	525	8	.	.	PROPN
fnp-5188	525	9	,	,	PUNCT
fnp-5188	525	10	a	a	DET
fnp-5188	525	11	human	human	ADJ
fnp-5188	525	12	brain	brain	NOUN
fnp-5188	525	13	vascular	vascular	NOUN
fnp-5188	525	14	atlas	atlas	PROPN
fnp-5188	525	15	reveals	reveal	VERB
fnp-5188	525	16	diverse	diverse	ADJ
fnp-5188	525	17	mediators	mediator	NOUN
fnp-5188	525	18	of	of	ADP
fnp-5188	525	19	alzheimer	alzheimer	PROPN
fnp-5188	525	20	's	's	PART
fnp-5188	525	21	risk	risk	NOUN
fnp-5188	525	22	.	.	PUNCT
fnp-5188	526	1	nature	nature	NOUN
fnp-5188	526	2	,	,	PUNCT
fnp-5188	526	3	2022	2022	NUM
fnp-5188	526	4	.	.	PUNCT
fnp-5188	527	1	603(7903	603(7903	NUM
fnp-5188	527	2	):	):	PUNCT
fnp-5188	528	1	p.	p.	NOUN
fnp-5188	528	2	885	885	NUM
fnp-5188	528	3	-	-	SYM
fnp-5188	528	4	892	892	NUM
fnp-5188	528	5	.	.	PUNCT
fnp-5188	529	1	https://doi.org/10.1038/s41586-021-04369-3	https://doi.org/10.1038/s41586-021-04369-3	PROPN
fnp-5188	529	2	41	41	NUM
fnp-5188	529	3	.	.	PUNCT
fnp-5188	530	1	bohannon	bohannon	PROPN
fnp-5188	530	2	,	,	PUNCT
fnp-5188	530	3	d.g	d.g	PROPN
fnp-5188	530	4	.	.	PROPN
fnp-5188	530	5	,	,	PUNCT
fnp-5188	530	6	d.	d.	PROPN
fnp-5188	530	7	long	long	ADV
fnp-5188	530	8	,	,	PUNCT
fnp-5188	530	9	and	and	CCONJ
fnp-5188	530	10	w.k	w.k	PROPN
fnp-5188	530	11	.	.	PUNCT
fnp-5188	530	12	kim	kim	PROPN
fnp-5188	530	13	,	,	PUNCT
fnp-5188	530	14	understanding	understand	VERB
fnp-5188	530	15	the	the	DET
fnp-5188	530	16	heterogeneity	heterogeneity	NOUN
fnp-5188	530	17	of	of	ADP
fnp-5188	530	18	human	human	ADJ
fnp-5188	530	19	pericyte	pericyte	NOUN
fnp-5188	530	20	subsets	subset	NOUN
fnp-5188	530	21	in	in	ADP
fnp-5188	530	22	blood	blood	NOUN
fnp-5188	530	23	-	-	PUNCT
fnp-5188	530	24	brain	brain	NOUN
fnp-5188	530	25	barrier	barrier	NOUN
fnp-5188	530	26	homeostasis	homeostasis	NOUN
fnp-5188	530	27	and	and	CCONJ
fnp-5188	530	28	neurological	neurological	ADJ
fnp-5188	530	29	diseases	disease	NOUN
fnp-5188	530	30	.	.	PUNCT
fnp-5188	531	1	cells	cell	NOUN
fnp-5188	531	2	,	,	PUNCT
fnp-5188	531	3	2021	2021	NUM
fnp-5188	531	4	.	.	PUNCT
fnp-5188	532	1	10(4	10(4	NUM
fnp-5188	532	2	)	)	PUNCT
fnp-5188	532	3	.	.	PUNCT
fnp-5188	533	1	https://doi.org/10.3390/cells10040890	https://doi.org/10.3390/cells10040890	NOUN
fnp-5188	533	2	42	42	NUM
fnp-5188	533	3	.	.	PUNCT
fnp-5188	534	1	zhang	zhang	PROPN
fnp-5188	534	2	,	,	PUNCT
fnp-5188	534	3	x.n	x.n	PROPN
fnp-5188	534	4	.	.	PROPN
fnp-5188	534	5	,	,	PUNCT
fnp-5188	534	6	et	et	PROPN
fnp-5188	534	7	al	al	PROPN
fnp-5188	534	8	.	.	PROPN
fnp-5188	534	9	,	,	PUNCT
fnp-5188	534	10	pericytes	pericyte	NOUN
fnp-5188	534	11	augment	augment	VERB
fnp-5188	534	12	glioblastoma	glioblastoma	NOUN
fnp-5188	534	13	cell	cell	NOUN
fnp-5188	534	14	resistance	resistance	NOUN
fnp-5188	534	15	to	to	PART
fnp-5188	534	16	temozolomide	temozolomide	VERB
fnp-5188	534	17	through	through	ADP
fnp-5188	534	18	ccl5	ccl5	PROPN
fnp-5188	534	19	-	-	PUNCT
fnp-5188	534	20	ccr5	ccr5	NOUN
fnp-5188	534	21	paracrine	paracrine	NOUN
fnp-5188	534	22	signaling	signal	VERB
fnp-5188	534	23	.	.	PUNCT
fnp-5188	535	1	cell	cell	NOUN
fnp-5188	535	2	res	re	NOUN
fnp-5188	535	3	,	,	PUNCT
fnp-5188	535	4	2021	2021	NUM
fnp-5188	535	5	.	.	PUNCT
fnp-5188	536	1	31(10	31(10	NUM
fnp-5188	536	2	):	):	PUNCT
fnp-5188	536	3	p.	p.	NOUN
fnp-5188	536	4	1072	1072	NUM
fnp-5188	536	5	-	-	SYM
fnp-5188	536	6	1087	1087	NUM
fnp-5188	536	7	.	.	PUNCT
fnp-5188	537	1	https://doi.org/10.1038/s41422-021-00528-3	https://doi.org/10.1038/s41422-021-00528-3	NUM
fnp-5188	537	2	43	43	NUM
fnp-5188	537	3	.	.	PUNCT
fnp-5188	538	1	caspani	caspani	PROPN
fnp-5188	538	2	,	,	PUNCT
fnp-5188	538	3	e.m	e.m	PROPN
fnp-5188	538	4	.	.	PROPN
fnp-5188	538	5	,	,	PUNCT
fnp-5188	538	6	et	et	PROPN
fnp-5188	538	7	al	al	PROPN
fnp-5188	538	8	.	.	PROPN
fnp-5188	538	9	,	,	PUNCT
fnp-5188	538	10	glioblastoma	glioblastoma	NOUN
fnp-5188	538	11	:	:	PUNCT
fnp-5188	538	12	a	a	DET
fnp-5188	538	13	pathogenic	pathogenic	ADJ
fnp-5188	538	14	crosstalk	crosstalk	NOUN
fnp-5188	538	15	between	between	ADP
fnp-5188	538	16	tumor	tumor	NOUN
fnp-5188	538	17	cells	cell	NOUN
fnp-5188	538	18	and	and	CCONJ
fnp-5188	538	19	pericytes	pericyte	NOUN
fnp-5188	538	20	.	.	PUNCT
fnp-5188	539	1	plos	plos	PROPN
fnp-5188	539	2	one	one	NUM
fnp-5188	539	3	,	,	PUNCT
fnp-5188	539	4	2014	2014	NUM
fnp-5188	539	5	.	.	PUNCT
fnp-5188	540	1	9(7	9(7	NUM
fnp-5188	540	2	):	):	PUNCT
fnp-5188	540	3	p.	p.	NOUN
fnp-5188	540	4	e101402	e101402	PROPN
fnp-5188	540	5	.	.	PUNCT
fnp-5188	541	1	https://doi.org/10.1371/journal.pone.0101402	https://doi.org/10.1371/journal.pone.0101402	NOUN
fnp-5188	541	2	44	44	NUM
fnp-5188	541	3	.	.	PUNCT
fnp-5188	542	1	guerra	guerra	PROPN
fnp-5188	542	2	,	,	PUNCT
fnp-5188	542	3	d.a.p	d.a.p	NOUN
fnp-5188	542	4	.	.	PROPN
fnp-5188	542	5	,	,	PUNCT
fnp-5188	542	6	et	et	PROPN
fnp-5188	542	7	al	al	PROPN
fnp-5188	542	8	.	.	PROPN
fnp-5188	542	9	,	,	PUNCT
fnp-5188	542	10	targeting	target	VERB
fnp-5188	542	11	glioblastoma	glioblastoma	NOUN
fnp-5188	542	12	-	-	PUNCT
fnp-5188	542	13	derived	derive	VERB
fnp-5188	542	14	pericytes	pericyte	NOUN
fnp-5188	542	15	improves	improve	VERB
fnp-5188	542	16	chemotherapeutic	chemotherapeutic	ADJ
fnp-5188	542	17	outcome	outcome	NOUN
fnp-5188	542	18	.	.	PUNCT
fnp-5188	543	1	angiogenesis	angiogenesis	NOUN
fnp-5188	543	2	,	,	PUNCT
fnp-5188	543	3	2018	2018	NUM
fnp-5188	543	4	.	.	PUNCT
fnp-5188	544	1	21(4	21(4	NUM
fnp-5188	544	2	):	):	PUNCT
fnp-5188	544	3	p.	p.	NOUN
fnp-5188	544	4	667	667	NUM
fnp-5188	544	5	-	-	SYM
fnp-5188	544	6	675	675	NUM
fnp-5188	544	7	.	.	PUNCT
fnp-5188	545	1	https://doi.org/10.1007/s10456-018-9621-x	https://doi.org/10.1007/s10456-018-9621-x	NOUN
fnp-5188	545	2	45	45	NUM
fnp-5188	545	3	.	.	PUNCT
fnp-5188	546	1	chen	chen	PROPN
fnp-5188	546	2	,	,	PUNCT
fnp-5188	546	3	y.t	y.t	PROPN
fnp-5188	546	4	.	.	PROPN
fnp-5188	546	5	,	,	PUNCT
fnp-5188	546	6	et	et	PROPN
fnp-5188	546	7	al	al	PROPN
fnp-5188	546	8	.	.	PROPN
fnp-5188	546	9	,	,	PUNCT
fnp-5188	546	10	platelet	platelet	NOUN
fnp-5188	546	11	-	-	PUNCT
fnp-5188	546	12	derived	derive	VERB
fnp-5188	546	13	growth	growth	NOUN
fnp-5188	546	14	factor	factor	NOUN
fnp-5188	546	15	receptor	receptor	NOUN
fnp-5188	546	16	signaling	signal	VERB
fnp-5188	546	17	activates	activate	VERB
fnp-5188	546	18	pericyte	pericyte	NOUN
fnp-5188	546	19	-	-	PUNCT
fnp-5188	546	20	myofibroblast	myofibroblast	NOUN
fnp-5188	546	21	transition	transition	NOUN
fnp-5188	546	22	in	in	ADP
fnp-5188	546	23	obstructive	obstructive	ADJ
fnp-5188	546	24	and	and	CCONJ
fnp-5188	546	25	post	post	ADJ
fnp-5188	546	26	-	-	ADJ
fnp-5188	546	27	ischemic	ischemic	ADJ
fnp-5188	546	28	kidney	kidney	NOUN
fnp-5188	546	29	fibrosis	fibrosis	NOUN
fnp-5188	546	30	.	.	PUNCT
fnp-5188	547	1	kidney	kidney	PROPN
fnp-5188	547	2	int	int	PROPN
fnp-5188	547	3	,	,	PUNCT
fnp-5188	547	4	2011	2011	NUM
fnp-5188	547	5	.	.	PUNCT
fnp-5188	548	1	80(11	80(11	NUM
fnp-5188	548	2	):	):	PUNCT
fnp-5188	548	3	p.	p.	NOUN
fnp-5188	548	4	1170	1170	NUM
fnp-5188	548	5	-	-	SYM
fnp-5188	548	6	81	81	NUM
fnp-5188	548	7	.	.	PUNCT
fnp-5188	549	1	https://doi.org/10.1038/ki.2011.208	https://doi.org/10.1038/ki.2011.208	NOUN
fnp-5188	549	2	46	46	NUM
fnp-5188	549	3	.	.	PUNCT
fnp-5188	549	4	frodin	frodin	VERB
fnp-5188	549	5	,	,	PUNCT
fnp-5188	549	6	m.	m.	NOUN
fnp-5188	549	7	,	,	PUNCT
fnp-5188	549	8	et	et	PROPN
fnp-5188	549	9	al	al	PROPN
fnp-5188	549	10	.	.	PROPN
fnp-5188	549	11	,	,	PUNCT
fnp-5188	549	12	perivascular	perivascular	ADJ
fnp-5188	549	13	pdgfr	pdgfr	ADJ
fnp-5188	549	14	-	-	PUNCT
fnp-5188	549	15	beta	beta	NOUN
fnp-5188	549	16	is	be	AUX
fnp-5188	549	17	an	an	DET
fnp-5188	549	18	independent	independent	ADJ
fnp-5188	549	19	marker	marker	NOUN
fnp-5188	549	20	for	for	ADP
fnp-5188	549	21	prognosis	prognosis	NOUN
fnp-5188	549	22	in	in	ADP
fnp-5188	549	23	renal	renal	ADJ
fnp-5188	549	24	cell	cell	NOUN
fnp-5188	549	25	carcinoma	carcinoma	NOUN
fnp-5188	549	26	.	.	PUNCT
fnp-5188	550	1	br	br	PROPN
fnp-5188	550	2	j	j	PROPN
fnp-5188	550	3	cancer	cancer	NOUN
fnp-5188	550	4	,	,	PUNCT
fnp-5188	550	5	2017	2017	NUM
fnp-5188	550	6	.	.	PUNCT
fnp-5188	551	1	116(2	116(2	NUM
fnp-5188	551	2	):	):	PUNCT
fnp-5188	551	3	p.	p.	NOUN
fnp-5188	551	4	195	195	NUM
fnp-5188	551	5	-	-	PUNCT
fnp-5188	551	6	201	201	NUM
fnp-5188	551	7	.	.	PUNCT
fnp-5188	552	1	https://doi.org/10.1038/bjc.2016.407	https://doi.org/10.1038/bjc.2016.407	PROPN
fnp-5188	552	2	47	47	NUM
fnp-5188	552	3	.	.	PUNCT
fnp-5188	553	1	rustenhoven	rustenhoven	ADJ
fnp-5188	553	2	,	,	PUNCT
fnp-5188	553	3	j.	j.	PROPN
fnp-5188	553	4	,	,	PUNCT
fnp-5188	553	5	et	et	PROPN
fnp-5188	553	6	al	al	PROPN
fnp-5188	553	7	.	.	PROPN
fnp-5188	553	8	,	,	PUNCT
fnp-5188	553	9	tgf	tgf	PROPN
fnp-5188	553	10	-	-	PUNCT
fnp-5188	553	11	beta1	beta1	NOUN
fnp-5188	553	12	regulates	regulate	VERB
fnp-5188	553	13	human	human	ADJ
fnp-5188	553	14	brain	brain	NOUN
fnp-5188	553	15	pericyte	pericyte	NOUN
fnp-5188	553	16	inflammatory	inflammatory	ADJ
fnp-5188	553	17	processes	process	NOUN
fnp-5188	553	18	involved	involve	VERB
fnp-5188	553	19	in	in	ADP
fnp-5188	553	20	neurovasculature	neurovasculature	NOUN
fnp-5188	553	21	function	function	NOUN
fnp-5188	553	22	.	.	PUNCT
fnp-5188	554	1	j	j	PROPN
fnp-5188	554	2	neuroinflammation	neuroinflammation	PROPN
fnp-5188	554	3	,	,	PUNCT
fnp-5188	554	4	2016	2016	NUM
fnp-5188	554	5	.	.	PUNCT
fnp-5188	555	1	13	13	NUM
fnp-5188	555	2	:	:	PUNCT
fnp-5188	555	3	p.	p.	NOUN
fnp-5188	555	4	37	37	NUM
fnp-5188	555	5	.	.	PUNCT
fnp-5188	556	1	https://doi.org/10.1186/s12974-016-0503-0	https://doi.org/10.1186/s12974-016-0503-0	ADV
fnp-5188	556	2	48	48	NUM
fnp-5188	556	3	.	.	PUNCT
fnp-5188	557	1	iwadate	iwadate	NOUN
fnp-5188	557	2	,	,	PUNCT
fnp-5188	557	3	y.	y.	NOUN
fnp-5188	557	4	,	,	PUNCT
fnp-5188	557	5	epithelial	epithelial	ADJ
fnp-5188	557	6	-	-	PUNCT
fnp-5188	557	7	mesenchymal	mesenchymal	ADJ
fnp-5188	557	8	transition	transition	NOUN
fnp-5188	557	9	in	in	ADP
fnp-5188	557	10	glioblastoma	glioblastoma	NOUN
fnp-5188	557	11	progression	progression	NOUN
fnp-5188	557	12	.	.	PUNCT
fnp-5188	558	1	oncology	oncology	NOUN
fnp-5188	558	2	letters	letter	NOUN
fnp-5188	558	3	,	,	PUNCT
fnp-5188	558	4	2016	2016	NUM
fnp-5188	558	5	.	.	PUNCT
fnp-5188	559	1	11(3	11(3	NUM
fnp-5188	559	2	):	):	PUNCT
fnp-5188	560	1	p.	p.	NOUN
fnp-5188	560	2	1615	1615	NUM
fnp-5188	560	3	-	-	SYM
fnp-5188	560	4	1620	1620	NUM
fnp-5188	560	5	.	.	PUNCT
fnp-5188	561	1	https://doi.org/10.3892/ol.2016.4113	https://doi.org/10.3892/ol.2016.4113	PROPN
fnp-5188	561	2	49	49	NUM
fnp-5188	561	3	.	.	PUNCT
fnp-5188	562	1	uemura	uemura	PROPN
fnp-5188	562	2	,	,	PUNCT
fnp-5188	562	3	a.	a.	PROPN
fnp-5188	562	4	,	,	PUNCT
fnp-5188	562	5	et	et	PROPN
fnp-5188	562	6	al	al	PROPN
fnp-5188	562	7	.	.	PROPN
fnp-5188	562	8	,	,	PUNCT
fnp-5188	562	9	vegfr1	vegfr1	NOUN
fnp-5188	562	10	signaling	signal	VERB
fnp-5188	562	11	in	in	ADP
fnp-5188	562	12	retinal	retinal	ADJ
fnp-5188	562	13	angiogenesis	angiogenesis	NOUN
fnp-5188	562	14	and	and	CCONJ
fnp-5188	562	15	microinflammation	microinflammation	NOUN
fnp-5188	562	16	.	.	PUNCT
fnp-5188	563	1	prog	prog	PROPN
fnp-5188	563	2	retin	retin	PROPN
fnp-5188	563	3	eye	eye	PROPN
fnp-5188	563	4	res	re	NOUN
fnp-5188	563	5	,	,	PUNCT
fnp-5188	563	6	2021	2021	NUM
fnp-5188	563	7	.	.	PUNCT
fnp-5188	564	1	84	84	NUM
fnp-5188	564	2	:	:	PUNCT
fnp-5188	565	1	p.	p.	NOUN
fnp-5188	565	2	100954	100954	NUM
fnp-5188	565	3	.	.	PUNCT
fnp-5188	566	1	https://doi.org/10.1016/j.preteyeres.2021.100954	https://doi.org/10.1016/j.preteyeres.2021.100954	VERB
fnp-5188	566	2	50	50	NUM
fnp-5188	566	3	.	.	PUNCT
fnp-5188	567	1	cicatiello	cicatiello	PROPN
fnp-5188	567	2	,	,	PUNCT
fnp-5188	567	3	v.	v.	ADV
fnp-5188	567	4	,	,	PUNCT
fnp-5188	567	5	et	et	PROPN
fnp-5188	567	6	al	al	PROPN
fnp-5188	567	7	.	.	PROPN
fnp-5188	567	8	,	,	PUNCT
fnp-5188	567	9	powerful	powerful	ADJ
fnp-5188	567	10	anti	anti	ADJ
fnp-5188	567	11	-	-	ADJ
fnp-5188	567	12	tumor	tumor	ADJ
fnp-5188	567	13	and	and	CCONJ
fnp-5188	567	14	anti	anti	ADJ
fnp-5188	567	15	-	-	ADJ
fnp-5188	567	16	angiogenic	angiogenic	ADJ
fnp-5188	567	17	activity	activity	NOUN
fnp-5188	567	18	of	of	ADP
fnp-5188	567	19	a	a	DET
fnp-5188	567	20	new	new	ADJ
fnp-5188	567	21	anti	anti	ADJ
fnp-5188	567	22	-	-	ADJ
fnp-5188	567	23	vascular	vascular	ADJ
fnp-5188	567	24	endothelial	endothelial	ADJ
fnp-5188	567	25	growth	growth	NOUN
fnp-5188	567	26	factor	factor	NOUN
fnp-5188	567	27	receptor	receptor	NOUN
fnp-5188	567	28	1	1	NUM
fnp-5188	567	29	peptide	peptide	NOUN
fnp-5188	567	30	in	in	ADP
fnp-5188	567	31	colorectal	colorectal	ADJ
fnp-5188	567	32	cancer	cancer	NOUN
fnp-5188	567	33	models	model	NOUN
fnp-5188	567	34	.	.	PUNCT
fnp-5188	568	1	oncotarget	oncotarget	NOUN
fnp-5188	568	2	,	,	PUNCT
fnp-5188	568	3	2015	2015	NUM
fnp-5188	568	4	.	.	PUNCT
fnp-5188	569	1	6(12	6(12	NUM
fnp-5188	569	2	):	):	PUNCT
fnp-5188	569	3	p.	p.	NOUN
fnp-5188	569	4	10563	10563	NUM
fnp-5188	569	5	-	-	SYM
fnp-5188	569	6	76	76	NUM
fnp-5188	569	7	.	.	PUNCT
fnp-5188	570	1	https://doi.org/10.18632/oncotarget.3384	https://doi.org/10.18632/oncotarget.3384	PROPN
fnp-5188	570	2	51	51	NUM
fnp-5188	570	3	.	.	PUNCT
fnp-5188	571	1	eilken	eilken	VERB
fnp-5188	571	2	,	,	PUNCT
fnp-5188	571	3	h.m	h.m	PROPN
fnp-5188	571	4	.	.	PROPN
fnp-5188	571	5	,	,	PUNCT
fnp-5188	571	6	et	et	PROPN
fnp-5188	571	7	al	al	PROPN
fnp-5188	571	8	.	.	PROPN
fnp-5188	571	9	,	,	PUNCT
fnp-5188	571	10	pericytes	pericyte	NOUN
fnp-5188	571	11	regulate	regulate	VERB
fnp-5188	571	12	vegf	vegf	NOUN
fnp-5188	571	13	-	-	PUNCT
fnp-5188	571	14	induced	induce	VERB
fnp-5188	571	15	endothelial	endothelial	NOUN
fnp-5188	571	16	sprouting	sprout	VERB
fnp-5188	571	17	through	through	ADP
fnp-5188	571	18	vegfr1	vegfr1	NOUN
fnp-5188	571	19	.	.	PUNCT
fnp-5188	572	1	nat	nat	PROPN
fnp-5188	572	2	commun	commun	PROPN
fnp-5188	572	3	,	,	PUNCT
fnp-5188	572	4	2017	2017	NUM
fnp-5188	572	5	.	.	PUNCT
fnp-5188	573	1	8(1	8(1	NOUN
fnp-5188	573	2	):	):	PUNCT
fnp-5188	573	3	p.	p.	NOUN
fnp-5188	573	4	1574	1574	NUM
fnp-5188	573	5	.	.	PUNCT
fnp-5188	574	1	https://doi.org/10.1038/s41467-017-01738-3	https://doi.org/10.1038/s41467-017-01738-3	NUM
fnp-5188	574	2	52	52	NUM
fnp-5188	574	3	.	.	PUNCT
fnp-5188	575	1	cheng	cheng	PROPN
fnp-5188	575	2	,	,	PUNCT
fnp-5188	575	3	l.	l.	PROPN
fnp-5188	575	4	,	,	PUNCT
fnp-5188	575	5	et	et	PROPN
fnp-5188	575	6	al	al	PROPN
fnp-5188	575	7	.	.	PROPN
fnp-5188	575	8	,	,	PUNCT
fnp-5188	575	9	glioblastoma	glioblastoma	NOUN
fnp-5188	575	10	stem	stem	NOUN
fnp-5188	575	11	cells	cell	NOUN
fnp-5188	575	12	generate	generate	VERB
fnp-5188	575	13	vascular	vascular	ADJ
fnp-5188	575	14	pericytes	pericyte	NOUN
fnp-5188	575	15	to	to	PART
fnp-5188	575	16	support	support	VERB
fnp-5188	575	17	vessel	vessel	NOUN
fnp-5188	575	18	function	function	NOUN
fnp-5188	575	19	and	and	CCONJ
fnp-5188	575	20	tumor	tumor	NOUN
fnp-5188	575	21	growth	growth	NOUN
fnp-5188	575	22	.	.	PUNCT
fnp-5188	576	1	cell	cell	NOUN
fnp-5188	576	2	,	,	PUNCT
fnp-5188	576	3	2013	2013	NUM
fnp-5188	576	4	.	.	PUNCT
fnp-5188	577	1	153(1	153(1	NUM
fnp-5188	577	2	):	):	PUNCT
fnp-5188	577	3	p.	p.	NOUN
fnp-5188	577	4	139	139	NUM
fnp-5188	577	5	-	-	SYM
fnp-5188	577	6	52	52	NUM
fnp-5188	577	7	.	.	PUNCT
fnp-5188	578	1	https://doi.org/10.1016/j.cell.2013.02.021	https://doi.org/10.1016/j.cell.2013.02.021	NOUN
fnp-5188	578	2	53	53	NUM
fnp-5188	578	3	.	.	PUNCT
fnp-5188	579	1	yi	yi	PROPN
fnp-5188	579	2	,	,	PUNCT
fnp-5188	579	3	l.	l.	PROPN
fnp-5188	579	4	,	,	PUNCT
fnp-5188	579	5	et	et	PROPN
fnp-5188	579	6	al	al	PROPN
fnp-5188	579	7	.	.	PROPN
fnp-5188	579	8	,	,	PUNCT
fnp-5188	579	9	implantation	implantation	NOUN
fnp-5188	579	10	of	of	ADP
fnp-5188	579	11	gl261	gl261	PROPN
fnp-5188	579	12	neurospheres	neurosphere	NOUN
fnp-5188	579	13	into	into	ADP
fnp-5188	579	14	c57	c57	NOUN
fnp-5188	579	15	/	/	SYM
fnp-5188	579	16	bl6	bl6	NOUN
fnp-5188	579	17	mice	mouse	NOUN
fnp-5188	579	18	:	:	PUNCT
fnp-5188	579	19	a	a	DET
fnp-5188	579	20	more	more	ADV
fnp-5188	579	21	reliable	reliable	ADJ
fnp-5188	579	22	syngeneic	syngeneic	NOUN
fnp-5188	579	23	graft	graft	NOUN
fnp-5188	579	24	model	model	NOUN
fnp-5188	579	25	for	for	ADP
fnp-5188	579	26	research	research	NOUN
fnp-5188	579	27	on	on	ADP
fnp-5188	579	28	glioma	glioma	NOUN
fnp-5188	579	29	-	-	PUNCT
fnp-5188	579	30	initiating	initiate	VERB
fnp-5188	579	31	cells	cell	NOUN
fnp-5188	579	32	.	.	PUNCT
fnp-5188	580	1	int	int	NOUN
fnp-5188	580	2	j	j	PROPN
fnp-5188	580	3	oncol	oncol	ADJ
fnp-5188	580	4	,	,	PUNCT
fnp-5188	580	5	2013	2013	NUM
fnp-5188	580	6	.	.	PUNCT
fnp-5188	581	1	43(2	43(2	NUM
fnp-5188	581	2	):	):	PUNCT
fnp-5188	582	1	p.	p.	NOUN
fnp-5188	582	2	477	477	NUM
fnp-5188	582	3	-	-	SYM
fnp-5188	582	4	84	84	NUM
fnp-5188	582	5	.	.	PUNCT
fnp-5188	583	1	https://doi.org/10.3892/ijo.2013.1962	https://doi.org/10.3892/ijo.2013.1962	PROPN
fnp-5188	583	2	54	54	NUM
fnp-5188	583	3	.	.	PUNCT
fnp-5188	584	1	svensson	svensson	PROPN
fnp-5188	584	2	,	,	PUNCT
fnp-5188	584	3	a.	a.	PROPN
fnp-5188	584	4	,	,	PUNCT
fnp-5188	584	5	et	et	PROPN
fnp-5188	584	6	al	al	PROPN
fnp-5188	584	7	.	.	PROPN
fnp-5188	584	8	,	,	PUNCT
fnp-5188	584	9	endogenous	endogenous	ADJ
fnp-5188	584	10	brain	brain	NOUN
fnp-5188	584	11	pericytes	pericyte	NOUN
fnp-5188	584	12	are	be	AUX
fnp-5188	584	13	widely	widely	ADV
fnp-5188	584	14	activated	activate	VERB
fnp-5188	584	15	and	and	CCONJ
fnp-5188	584	16	contribute	contribute	VERB
fnp-5188	584	17	to	to	ADP
fnp-5188	584	18	mouse	mouse	NOUN
fnp-5188	584	19	glioma	glioma	ADJ
fnp-5188	584	20	microvasculature	microvasculature	NOUN
fnp-5188	584	21	.	.	PUNCT
fnp-5188	585	1	plos	plos	PROPN
fnp-5188	585	2	one	one	NUM
fnp-5188	585	3	,	,	PUNCT
fnp-5188	585	4	2015	2015	NUM
fnp-5188	585	5	.	.	PUNCT
fnp-5188	586	1	10(4	10(4	NUM
fnp-5188	586	2	):	):	PUNCT
fnp-5188	586	3	p.	p.	NOUN
fnp-5188	586	4	e0123553	e0123553	PROPN
fnp-5188	586	5	.	.	PUNCT
fnp-5188	587	1	https://doi.org/10.1371/journal.pone.0123553	https://doi.org/10.1371/journal.pone.0123553	PROPN
fnp-5188	587	2	55	55	NUM
fnp-5188	587	3	.	.	PUNCT
fnp-5188	588	1	girolamo	girolamo	PROPN
fnp-5188	588	2	,	,	PUNCT
fnp-5188	588	3	f.	f.	PROPN
fnp-5188	588	4	,	,	PUNCT
fnp-5188	588	5	et	et	PROPN
fnp-5188	588	6	al	al	PROPN
fnp-5188	588	7	.	.	PROPN
fnp-5188	588	8	,	,	PUNCT
fnp-5188	588	9	central	central	ADJ
fnp-5188	588	10	nervous	nervous	ADJ
fnp-5188	588	11	system	system	NOUN
fnp-5188	588	12	pericytes	pericyte	NOUN
fnp-5188	588	13	contribute	contribute	VERB
fnp-5188	588	14	to	to	ADP
fnp-5188	588	15	health	health	NOUN
fnp-5188	588	16	and	and	CCONJ
fnp-5188	588	17	disease	disease	NOUN
fnp-5188	588	18	.	.	PUNCT
fnp-5188	589	1	cells	cell	NOUN
fnp-5188	589	2	,	,	PUNCT
fnp-5188	589	3	2022	2022	NUM
fnp-5188	589	4	.	.	PUNCT
fnp-5188	589	5	11(10	11(10	NUM
fnp-5188	589	6	)	)	PUNCT
fnp-5188	589	7	.	.	PUNCT
fnp-5188	590	1	https://doi.org/10.3390/cells11101707	https://doi.org/10.3390/cells11101707	PROPN
fnp-5188	590	2	56	56	NUM
fnp-5188	590	3	.	.	PUNCT
fnp-5188	590	4	berthiaume	berthiaume	PROPN
fnp-5188	590	5	,	,	PUNCT
fnp-5188	590	6	a.a	a.a	PROPN
fnp-5188	590	7	.	.	PROPN
fnp-5188	590	8	,	,	PUNCT
fnp-5188	590	9	et	et	PROPN
fnp-5188	590	10	al	al	PROPN
fnp-5188	590	11	.	.	PROPN
fnp-5188	590	12	,	,	PUNCT
fnp-5188	590	13	pericyte	pericyte	NOUN
fnp-5188	590	14	structural	structural	ADJ
fnp-5188	590	15	remodeling	remodeling	NOUN
fnp-5188	590	16	in	in	ADP
fnp-5188	590	17	cerebrovascular	cerebrovascular	ADJ
fnp-5188	590	18	health	health	NOUN
fnp-5188	590	19	and	and	CCONJ
fnp-5188	590	20	homeostasis	homeostasis	NOUN
fnp-5188	590	21	.	.	PUNCT
fnp-5188	591	1	front	front	ADJ
fnp-5188	591	2	aging	age	VERB
fnp-5188	591	3	neurosci	neurosci	NOUN
fnp-5188	591	4	,	,	PUNCT
fnp-5188	591	5	2018	2018	NUM
fnp-5188	591	6	.	.	PUNCT
fnp-5188	592	1	10	10	NUM
fnp-5188	592	2	:	:	PUNCT
fnp-5188	592	3	p.	p.	NOUN
fnp-5188	592	4	210	210	NUM
fnp-5188	592	5	.	.	PUNCT
fnp-5188	593	1	https://doi.org/10.3389/fnagi.2018.00210	https://doi.org/10.3389/fnagi.2018.00210	PROPN
fnp-5188	593	2	57	57	NUM
fnp-5188	593	3	.	.	PUNCT
fnp-5188	593	4	schiffer	schiffer	PROPN
fnp-5188	593	5	,	,	PUNCT
fnp-5188	593	6	d.	d.	PROPN
fnp-5188	593	7	,	,	PUNCT
fnp-5188	593	8	et	et	PROPN
fnp-5188	593	9	al	al	PROPN
fnp-5188	593	10	.	.	PROPN
fnp-5188	593	11	,	,	PUNCT
fnp-5188	593	12	glioblastoma	glioblastoma	NOUN
fnp-5188	593	13	niches	niche	NOUN
fnp-5188	593	14	:	:	PUNCT
fnp-5188	593	15	from	from	ADP
fnp-5188	593	16	the	the	DET
fnp-5188	593	17	concept	concept	NOUN
fnp-5188	593	18	to	to	ADP
fnp-5188	593	19	the	the	DET
fnp-5188	593	20	phenotypical	phenotypical	ADJ
fnp-5188	593	21	reality	reality	NOUN
fnp-5188	593	22	.	.	PUNCT
fnp-5188	594	1	neurol	neurol	PROPN
fnp-5188	594	2	sci	sci	PROPN
fnp-5188	594	3	,	,	PUNCT
fnp-5188	594	4	2018	2018	NUM
fnp-5188	594	5	.	.	PUNCT
fnp-5188	595	1	39(7	39(7	NUM
fnp-5188	595	2	):	):	PUNCT
fnp-5188	595	3	p.	p.	NOUN
fnp-5188	595	4	1161	1161	NUM
fnp-5188	595	5	-	-	SYM
fnp-5188	595	6	1168	1168	NUM
fnp-5188	595	7	.	.	PUNCT
fnp-5188	596	1	https://doi.org/10.1007/s10072-018-3408-0	https://doi.org/10.1007/s10072-018-3408-0	NUM
fnp-5188	596	2	58	58	NUM
fnp-5188	596	3	.	.	PUNCT
fnp-5188	597	1	schiffer	schiffer	PROPN
fnp-5188	597	2	,	,	PUNCT
fnp-5188	597	3	d.	d.	PROPN
fnp-5188	597	4	,	,	PUNCT
fnp-5188	597	5	et	et	PROPN
fnp-5188	597	6	al	al	PROPN
fnp-5188	597	7	.	.	PROPN
fnp-5188	597	8	,	,	PUNCT
fnp-5188	597	9	glioblastoma	glioblastoma	NOUN
fnp-5188	597	10	:	:	PUNCT
fnp-5188	597	11	microenvironment	microenvironment	NOUN
fnp-5188	597	12	and	and	CCONJ
fnp-5188	597	13	niche	niche	NOUN
fnp-5188	597	14	concept	concept	NOUN
fnp-5188	597	15	.	.	PUNCT
fnp-5188	598	1	cancers	cancer	NOUN
fnp-5188	598	2	,	,	PUNCT
fnp-5188	598	3	2018	2018	NUM
fnp-5188	598	4	.	.	PUNCT
fnp-5188	599	1	11(1	11(1	NUM
fnp-5188	599	2	)	)	PUNCT
fnp-5188	599	3	.	.	PUNCT
fnp-5188	600	1	https://doi.org/10.3390/cancers11010005	https://doi.org/10.3390/cancers11010005	PROPN
fnp-5188	600	2	59	59	NUM
fnp-5188	600	3	.	.	PUNCT
fnp-5188	600	4	liebner	liebner	PROPN
fnp-5188	600	5	,	,	PUNCT
fnp-5188	600	6	s.	s.	PROPN
fnp-5188	600	7	,	,	PUNCT
fnp-5188	600	8	et	et	PROPN
fnp-5188	600	9	al	al	PROPN
fnp-5188	600	10	.	.	PROPN
fnp-5188	600	11	,	,	PUNCT
fnp-5188	600	12	functional	functional	ADJ
fnp-5188	600	13	morphology	morphology	NOUN
fnp-5188	600	14	of	of	ADP
fnp-5188	600	15	the	the	DET
fnp-5188	600	16	blood	blood	NOUN
fnp-5188	600	17	-	-	PUNCT
fnp-5188	600	18	brain	brain	NOUN
fnp-5188	600	19	barrier	barrier	NOUN
fnp-5188	600	20	in	in	ADP
fnp-5188	600	21	health	health	NOUN
fnp-5188	600	22	and	and	CCONJ
fnp-5188	600	23	disease	disease	NOUN
fnp-5188	600	24	.	.	PUNCT
fnp-5188	601	1	acta	acta	PROPN
fnp-5188	601	2	neuropathol	neuropathol	PROPN
fnp-5188	601	3	,	,	PUNCT
fnp-5188	601	4	2018	2018	NUM
fnp-5188	601	5	.	.	PUNCT
fnp-5188	602	1	135(3	135(3	NUM
fnp-5188	602	2	):	):	PUNCT
fnp-5188	602	3	p.	p.	NOUN
fnp-5188	602	4	311	311	NUM
fnp-5188	602	5	-	-	SYM
fnp-5188	602	6	336	336	NUM
fnp-5188	602	7	.	.	PUNCT
fnp-5188	603	1	https://doi.org/10.1007/s00401-018-1815-1	https://doi.org/10.1007/s00401-018-1815-1	NUM
fnp-5188	603	2	60	60	NUM
fnp-5188	603	3	.	.	PUNCT
fnp-5188	604	1	thanabalasundaram	thanabalasundaram	NOUN
fnp-5188	604	2	,	,	PUNCT
fnp-5188	604	3	g.	g.	PROPN
fnp-5188	604	4	,	,	PUNCT
fnp-5188	604	5	et	et	PROPN
fnp-5188	604	6	al	al	PROPN
fnp-5188	604	7	.	.	PROPN
fnp-5188	604	8	,	,	PUNCT
fnp-5188	604	9	the	the	DET
fnp-5188	604	10	impact	impact	NOUN
fnp-5188	604	11	of	of	ADP
fnp-5188	604	12	pericytes	pericyte	NOUN
fnp-5188	604	13	on	on	ADP
fnp-5188	604	14	the	the	DET
fnp-5188	604	15	blood	blood	NOUN
fnp-5188	604	16	-	-	PUNCT
fnp-5188	604	17	brain	brain	NOUN
fnp-5188	604	18	barrier	barrier	NOUN
fnp-5188	604	19	integrity	integrity	NOUN
fnp-5188	604	20	depends	depend	VERB
fnp-5188	604	21	critically	critically	ADV
fnp-5188	604	22	on	on	ADP
fnp-5188	604	23	the	the	DET
fnp-5188	604	24	pericyte	pericyte	NOUN
fnp-5188	604	25	differentiation	differentiation	NOUN
fnp-5188	604	26	stage	stage	NOUN
fnp-5188	604	27	.	.	PUNCT
fnp-5188	605	1	int	int	PROPN
fnp-5188	605	2	j	j	PROPN
fnp-5188	605	3	biochem	biochem	PROPN
fnp-5188	605	4	cell	cell	NOUN
fnp-5188	605	5	biol	biol	PROPN
fnp-5188	605	6	,	,	PUNCT
fnp-5188	605	7	2011	2011	NUM
fnp-5188	605	8	.	.	PUNCT
fnp-5188	606	1	43(9	43(9	NUM
fnp-5188	606	2	):	):	PUNCT
fnp-5188	606	3	p.	p.	NOUN
fnp-5188	606	4	1284	1284	NUM
fnp-5188	606	5	-	-	SYM
fnp-5188	606	6	93	93	NUM
fnp-5188	606	7	.	.	PUNCT
fnp-5188	607	1	https://doi.org/10.1016/j.biocel.2011.05.002	https://doi.org/10.1016/j.biocel.2011.05.002	NUM
fnp-5188	607	2	copyright	copyright	NOUN
fnp-5188	607	3	:	:	PUNCT
fnp-5188	607	4	©	©	PROPN
fnp-5188	607	5	2024	2024	NUM
fnp-5188	607	6	the	the	DET
fnp-5188	607	7	author(s	author(s	NOUN
fnp-5188	607	8	)	)	PUNCT
fnp-5188	607	9	.	.	PUNCT
fnp-5188	608	1	this	this	PRON
fnp-5188	608	2	is	be	AUX
fnp-5188	608	3	an	an	DET
fnp-5188	608	4	open	open	ADJ
fnp-5188	608	5	access	access	NOUN
fnp-5188	608	6	article	article	NOUN
fnp-5188	608	7	distributed	distribute	VERB
fnp-5188	608	8	under	under	ADP
fnp-5188	608	9	the	the	DET
fnp-5188	608	10	terms	term	NOUN
fnp-5188	608	11	of	of	ADP
fnp-5188	608	12	the	the	DET
fnp-5188	608	13	creative	creative	ADJ
fnp-5188	608	14	commons	common	NOUN
fnp-5188	608	15	attribution	attribution	NOUN
fnp-5188	608	16	4.0	4.0	NUM
fnp-5188	608	17	international	international	ADJ
fnp-5188	608	18	license	license	NOUN
fnp-5188	608	19	(	(	PUNCT
fnp-5188	608	20	https://creativecommons.org/licenses/by/4.0/	https://creativecommons.org/licenses/by/4.0/	PROPN
fnp-5188	608	21	)	)	PUNCT
fnp-5188	608	22	,	,	PUNCT
fnp-5188	608	23	which	which	PRON
fnp-5188	608	24	permits	permit	VERB
fnp-5188	608	25	unrestricted	unrestricted	ADJ
fnp-5188	608	26	use	use	NOUN
fnp-5188	608	27	,	,	PUNCT
fnp-5188	608	28	distribution	distribution	NOUN
fnp-5188	608	29	,	,	PUNCT
fnp-5188	608	30	and	and	CCONJ
fnp-5188	608	31	reproduction	reproduction	NOUN
fnp-5188	608	32	in	in	ADP
fnp-5188	608	33	any	any	DET
fnp-5188	608	34	medium	medium	NOUN
fnp-5188	608	35	,	,	PUNCT
fnp-5188	608	36	provided	provide	VERB
fnp-5188	608	37	the	the	DET
fnp-5188	608	38	original	original	ADJ
fnp-5188	608	39	author	author	NOUN
fnp-5188	608	40	and	and	CCONJ
fnp-5188	608	41	source	source	NOUN
fnp-5188	608	42	are	be	AUX
fnp-5188	608	43	credited	credit	VERB
fnp-5188	608	44	,	,	PUNCT
fnp-5188	608	45	a	a	DET
fnp-5188	608	46	link	link	NOUN
fnp-5188	608	47	to	to	ADP
fnp-5188	608	48	the	the	DET
fnp-5188	608	49	creative	creative	ADJ
fnp-5188	608	50	commons	common	NOUN
fnp-5188	608	51	license	license	NOUN
fnp-5188	608	52	is	be	AUX
fnp-5188	608	53	provided	provide	VERB
fnp-5188	608	54	,	,	PUNCT
fnp-5188	608	55	and	and	CCONJ
fnp-5188	608	56	any	any	DET
fnp-5188	608	57	changes	change	NOUN
fnp-5188	608	58	are	be	AUX
fnp-5188	608	59	indicated	indicate	VERB
fnp-5188	608	60	.	.	PUNCT
fnp-5188	609	1	the	the	DET
fnp-5188	609	2	creative	creative	ADJ
fnp-5188	609	3	commons	common	NOUN
fnp-5188	609	4	public	public	ADJ
fnp-5188	609	5	domain	domain	NOUN
fnp-5188	609	6	dedication	dedication	NOUN
fnp-5188	609	7	waiver	waiver	NOUN
fnp-5188	609	8	(	(	PUNCT
fnp-5188	609	9	https://creativecommons.org/publicdomain/zero/1.0/	https://creativecommons.org/publicdomain/zero/1.0/	PROPN
fnp-5188	609	10	)	)	PUNCT
fnp-5188	609	11	applies	apply	VERB
fnp-5188	609	12	to	to	ADP
fnp-5188	609	13	the	the	DET
fnp-5188	609	14	data	datum	NOUN
fnp-5188	609	15	made	make	VERB
fnp-5188	609	16	available	available	ADJ
fnp-5188	609	17	in	in	ADP
fnp-5188	609	18	this	this	DET
fnp-5188	609	19	article	article	NOUN
fnp-5188	609	20	,	,	PUNCT
fnp-5188	609	21	unless	unless	SCONJ
fnp-5188	609	22	otherwise	otherwise	ADV
fnp-5188	609	23	stated	state	VERB
fnp-5188	609	24	.	.	PUNCT