SHORT COMMUNICATION Genetic Resources (2023), 4 (7), 46–55 DOI: 10.46265/genresj.ALFV3636 https://www.genresj.org ISSN: 2708-3764 Characterization of microsatellite markers for the duckweed Spirodela polyrhiza and Lemna minor tested on samples from Europe or the United States of America Jae E Kerstetter a,b, Andrea L Reid c, Joshua T Armstrong a,d, Taylor A Zallek a, Trapper T Hobble a and Martin M Turcotte *,a a Department of Biological Sciences, University of Pittsburgh, PA, 15260, Pittsburgh, USA b Department of Entomology, Rutgers University, NJ, 08901, New Brunswick, USA c Department of Geodesy and Geomatics Engineering, University of New Brunswick, NB, Fredericton, Canada d Center for Environmental Studies, Virginia Commonwealth University, VA, 23284, Richmond, USA Abstract: Microsatellite primers are a valuable tool to use for both observational and experimental studies in numerous taxa. Here, we develop 18 and 16 microsatellite markers for the widespread duckweeds Lemna minor L. and Spirodela polyrhiza (L.) Schleid, respectively. All 18 L. minor primers and 12 of the 16 S. polyrhiza primers amplified polymorphic loci when tested on samples from Europe or Western Pennsylvania, USA. Keywords: Lemnaceae, simple sequence repeats, genotyping, genetic identification, molecular markers Citation: Kerstetter, J. E., Reid, A. L., Armstrong, J. T., Zallek, T. A., Hobble, T. T., Turcotte, M. M. (2023). Characterization of microsatellite markers for the duckweed Spirodela polyrhiza and Lemna minor tested on samples from Europe or the United States of America. Genetic Resources 4 (7), 46–55. doi: 10.46265/genresj.ALFV3636. © Copyright 2023 the Authors. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Introduction The globally distributed duckweed family (Lem- naceae) or subfamily (Lemnoideae) is composed of 36 species (Bog et al, 2020) of very small floating or submerged aquatic plants (Landolt, 1986; Sree et al, 2016). Duckweeds have a long history of scientific study given their highly specialized morphology, widespread distribution, high abundance and production of the world’s smallest flowers (Jacobs, 1947; Hillman, 1961; Landolt, 1986, 1992). More recently, there has been an explosion in research interest given their potential applied uses including for agricultural feed (Cheng and Stomp, 2009), bioremediation (Gupta and Prakash, 2013; Ekperusi et al, 2019) and biofuel production (Cui and Cheng, 2015). Furthermore, their use as a model ∗Corresponding author: Martin M Turcotte (turcotte@pitt.edu) system to experimentally study numerous topics in ecol- ogy and evolutionary biology is quickly expanding (Laird and Barks, 2018). This growing basic and applied inter- est stems from their ability to reproduce clonally very quickly with population doubling times in as little as 1.5 days (Ziegler et al, 2015). In addition, they are amenable to large-scale manipulative experiments in both the lab and field mesocosms (Armitage and Jones, 2019; Hart et al, 2019; Tan et al, 2021; O’Brien et al, 2022), and have growing genomic data and tools (Wang et al, 2014; Ho et al, 2019; Xu et al, 2019; Cao et al, 2020) and characterization of their microbiome and her- bivore communities (Acosta et al, 2020; Subramanian and Turcotte, 2020). Finally, duckweed express variation in numerous traits across species and among genotypes (clonal lineages) within species (Van Steveninck et al, 1992; Hart et al, 2019; Chen et al, 2020; Hitsman and Simons, 2020; Anneberg et al, 2023). Therefore, being able to identify genotypes may also be beneficial in many Received: 16.10.2022 Accepted: 25.02.2023 Published online: 05.05.2023 https://www.genresj.org https://www.dx.doi.org/10.46265/genresj.ALFV3636 https://www.genresj.org https://www.dx.doi.org/10.46265/genresj.ALFV3636 mailto:turcotte@pitt.edu Genetic Resources (2023), 4 (7), 46–55 47 ecological studies to assess differences in traits among genotypes and to determine how these genotypes may respond to different environmental conditions. Genetic markers, such as microsatellite markers, are important tools to study population genetics. Microsatel- lites, also known as simple sequence repeats (SSR), are tandem repeats two to ten base pairs in length, that are flanked by conserved sequences and occur ubiquitously throughout eukaryotic genomes (Tautz and Renz, 1984). They are highly informative as locus-specific genetic markers due to their high abundance, high reproducibil- ity, co-dominance, and polymorphic nature (Morgante and Olivieri, 1993; Powell et al, 1996). The length of the sequence repeats can be determined through PCR amplification using primers specific to their flanking regions; variation in PCR product length is a function of the number of repeated sequences. The high levels of polymorphisms observed in SSR markers (Tautz, 1989; Schlötterer and Tautz, 1992) and the relative ease of detection of these polymorphisms by PCR amplification have led to the wide applications of microsatellites as genetic markers (Vieira et al, 2016). Such within-species markers have numerous applications including quan- tifying biogeographic distributions, population genetic structure, evolutionary history, and mating systems. Moreover, a growing number of experimental evo- lution studies use SSR markers to track changes in genotypic composition of asexually reproducing popu- lations over multiple generations (Turcotte et al, 2011; Hart et al, 2019; Agrawal et al, 2013) in large repli- cated experiments for which genotyping-by-sequencing remains too costly. These cost savings are magnified when several loci can be multiplexed and genotyped in the same reaction (Markoulatos et al, 2002). With the growing interest in duckweed, microsatellite markers have been developed for a few duckweed species. Wani et al (2014) developed nine polymorphic and 24 monomorphic haplotype chloroplast DNA- based microsatellite primers for L. minor. Xu et al (2018) developed 60 microsatellite primers for Spirodela polyrhiza, 19 of which were polymorphic within three populations of S. polyrhiza from China. Feng et al (2017) developed three microsatellite primers for the identification of S. polyrhiza and Landoltia punctata (G. Mey.) Les & D. J. Crawford haplotypes. More recently, Fu et al (2020) developed 70 microsatellite primers within coding regions for L. gibba L. It is important to continue developing and reporting new microsatellite markers as populations can differ in which markers function (e.g. due to null alleles) and are polymorphic Chapuis and Estoup (2007). Here, we report on the successful development of 18 and 16 new microsatellite markers, respectively, for two commonly studied and widespread duckweed species: the common duckweed Lemna minor L. and the greater duckweed Spirodela polyrhiza (L.) Schleid. A small subset of these microsatellite primers was used to differentiate genotypes in our experimental studies on evolutionary coexistence (Hart et al, 2019). In addition, we report genotyping results using these markers on individuals sampled in Europe and the United States of America (USA). We thus provide new tools and evidence that they function, which can be utilized by the growing community of duckweed researchers (Laird and Barks, 2018). Materials and methods Sample collection Our objective when sampling was not to genetically characterize duckweed populations, but instead find genotypes that differ in ecologically relevant traits to use in various experiments. Thus, we genotyped few individuals from numerous bodies of water in various locations. Primers were developed at ETH Zurich (Europe) and the University of Pittsburgh (USA), and thus were tested on different collections of duckweeds. We collected duckweeds from numerous still bodies of water (e.g. ponds, lakes, wetlands) primarily in Switzerland and Western Pennsylvania (USA); however, a few samples were also collected from the Netherlands and Germany. In addition, some European duckweed samples included in the set were obtained from the Landolt Duckweed Collection (formerly in Zurich, Switzerland, see Supplemental Tables S1 and S2 for collection locations). Given the two-part development of the primers, some duckweed samples were only tested on the primers developed in that country (as noted in Supplemental Tables S1 and S2). Duckweeds mostly reproduce clonally via meristem- atic pockets from which clonal daughters emerge, creat- ing clonal clusters of one to eight individuals that even- tually split into smaller clusters (Landolt, 1986). We sampled single duckweed clusters and established isofe- male laboratory colonies from these clusters. We then sterilized each colony using sodium hypochlorite follow- ing a method adapted from Barks et al (2018). From each colony, we put single individuals into individual sterile petri dishes (one individual per dish) contain- ing sterile 0.5 strength Schenk and Hildebrandt growth medium (Schenk and Hildebrandt, 1972) supplemented with sucrose (6.7g/L), yeast extract (0.067g/L), and tryptone (0.34g/L) for 24 hours to encourage algal and bacterial spore germination. Then each individual was exposed to one of an array of concentrations of sodium hypochlorite (0.3% or 0.5%) for varying amounts of time (3 or 6 minutes for L. minor, 4 or 7 minutes for S. polyrhiza respectively), then rinsed with auto- claved distilled water and allowed to grow (Barks et al, 2018). Sterile colonies were maintained in sterile 0.25 strength Schenk and Hildebrandt media (Schenk and Hildebrandt, 1972) without the additional supplements in room temperature laboratories or growth chambers under plant grow lights. These collections do not repro- duce sexually under lab conditions. Spirodela polyrhiza and Lemna minor microsatellite markers 48 Kerstetter et al G enetic Resources (2023),4 (7),46–55 Table 1. Lemna minor microsatellite markers and motifs including the location of initial primer development (USA or Europe), optimized MgCl2 concentrations, and annealing temperatures (TA). In addition, we report marker success rate, which is the number of samples successfully genotyped divided by those attempted, the number of unique alleles, and number of unique genotypes for each primer. Average heterozygosity (H) is the fraction of individuals that are heterozygotic for each primer. See Supplemental Table S1 for specific allele values. Allele lengths with an * denote that these lengths include the M13 tail sequence. Primers Forward Primer (5’-3’) Reverse Primer (5’-3’) Motif Location of Development MgCl2 (mM) TA (◦C) Observed Product Length (bp) Marker Success Rate Unique Alleles Unique Genotypes Average H LmR.1.A F: GTTCCTAAGGATTCATCACC R: TACGAGGAGGGACACGAG AAG Europe 2.0 60 178–185* 75/81 2 2 0 LmR.4.A F: AGTGGCTACGAACGGAAGAG R: AGAGGAACGTTGTGTCTGGG AAG Europe 0.9 63 219–234 28/28 5 5 0.036 LmR.4.B F: CTTATTGGATCTTCGCGCCG R: AAGATATCTGACGGCGTTGG AG Europe 1.2 63 366–392 28/28 6 6 0.071 LmR.5.C F: GATGCCAGTAGATCCGGC R: ACGCCTGAACACGATTGATG AGAT Europe 2.0 60 320–444 104/109 25 41 0.846 LmR.8.B F: TGTACTCATCTGTGGGCGAG R: AACAATTTGGCCACCGTCAG AGAT USA 1.2 63 306–376 28/28 10 9 0.036 LmR.8.C F: GACAACTTAGGGTGCACGC R: GGAGTGAGAGCTGAGGACTG AGG USA 1.2 60 435–450 28/28 3 3 0 LmR.10.A F: TCCTTTCTCGTGTCTCCCAG R: ATGCCCGACCTAGTCC AG Europe 2.0 60 222–254* 31/81 4 5 0.032 LmR.10.C F: CTCTCCTTTCTCCTCCACGG R: ATCGCAACCCTCTAGCCG AGAT Europe 2.0 60 179–254* 79/81 4 4 0.278 LmR.12.B F: TCTCTGCTGACCGACTCAAG R: GCCGTTGGATCTTTCTCACG AT USA 1.2 60 274–320 27/28 8 9 0.111 Continued on next page G enetic Resources (2023), 4 (7), 46–55 49 Table 1 continued Primers Forward Primer (5’-3’) Reverse Primer (5’-3’) Motif Location of Development MgCl2 (mM) TA (◦C) Observed Product Length (bp) Marker Success Rate Unique Alleles Unique Genotypes Average H LmR.14.A F: TCGCACTAGAGAGATGGGTG R: TCCCATTACCAGGATGCGAG AAT USA 1.2 60 261–270 24/28 3 3 0.042 LmR.14.B F: CATGCCAGGTAAATGCCCTC R: TCGAGCTCCTTCTCCAAACC ATC USA 0.9 63 430–440 28/28 3 3 0 LmR.14.C F: TTCGTCGAGGGTATGAGCTG R: TCTCTTATTTGACACGCGCG AG USA 0.9 63 162–178 28/28 7 7 0.036 LmR.15.A F: GTGACAGCGTATCCTTGTGC R: CAGCGGCAAGATCATCAAG ATC Europe 1.2 60 222–285 109/109 13 15 0.578 LmR.15.B F: TCGAGCTAATCAGTGGAGCC R: GAGTGCTCGGCTTGACTTTC AG Europe 1.2 60 170–210 104/109 13 25 0.692 LmR.15.C F: CATGTTCCCACCCACTTGAC R: AAGGAAGAGGGAGCAAGGG AT Europe 1.2 60 368–400 109/109 14 26 0.743 LmR.26.B F: GTGTCTCCGAGAGCCTACAG R: TTTAAAGCTCGGTGGGTCCC AG USA 1.2 63 283–329 28/28 10 7 0.964 LmR.31.A F: GGTGATCTCAGGTAGCCGAG R: TGAGATCACCACTGTCTGCC AAG USA 0.9 63 402–432 26/28 5 6 0.077 LmR.31.B F: AGTCGGCATAGTACTTCCCG R: CTTCTTCAAGACCGTTCCGC AAG USA 1.2 63 155–239 28/28 7 9 0.071 Spirodela polyrhiza and Lem na m inor m icrosatellite m arkers 50 Kerstetter et al G enetic Resources (2023),4 (7),46–55 Table 2. Spirodela polyrhiza microsatellite markers and sampling results as described in Table 1 with allele calls in Supplemental Table S2. Primers Forward Primer (5’-3’) Reverse Primer (5’-3’) Repeat Motif Location of development MgCl2 (mM) TA (◦C) Observed Product Length (bp) Marker Success Rate Unique Alleles Unique Genotypes Average H Sp.1035 F: TGCTTGGTCACTCTTGTCTG R: CGATTCCTAGCTCCTCTGC AT Europe 1.2 60 361–369 42/42 4 5 0.381 Sp.1467 F: AGTTGAGGAAGCTTCATGG R: ATTACCTCCAGCACCTCTCC AG Europe 2.0 58 386–411* 9/20 5 4 0.444 Sp.2597 F: TCCCATTCACCACAGTCTCC R: TCATTCCACCACGTCCCAC AT Europe 2.0 58 397–399* 14/20 2 2 0.071 Sp.5050 F: ATTAACCTTGGGCGCAGAG R: TAGCAGCAGAGTGTGAGGG AAT Europe 2.0 58 287* 14/20 1 1 0 Sp.5250 F: AAACGAGACCTCCTACGCC R: GCCTGCGAGTAATATGTGC ATGCCC Europe 2.0 58 385* 19/20 1 1 0 Sp.7286 F: CGAATATGCCGAGGAATGC R: TCCTCGATCTGCCGCTTTAG CG Europe 1.2 60 386–394 42/42 5 7 0.310 Sp.7688 F: AATGGTTGACTCGACGCTG R: TCACACCGCCATAATTTCGC AGC Europe 2.0 58 199–211* 19/20 2 2 0.158 Sp.7814 F: AGTGTAGGGTGCAGCTGTG R: TTCGTGAAAGGCCTAGCAC AG Europe 1.2 60 220–228 42/42 5 6 0.095 Sp.7908 F: GAGACACATCATTGCCAGC R: TAATGCAGGCCACACAACC AG Europe 2.0 58 234–236 20/20 2 2 0.850 Sp.8563 F: GTATTGGGTGGGCAAATCG R: AAGGGATAGGGTCGTGTCC AG Europe 2.0 58 350–354* 14/20 3 4 0.071 Continued on next page G enetic Resources (2023), 4 (7), 46–55 51 Table 2 continued Primers Forward Primer (5’-3’) Reverse Primer (5’-3’) Repeat Motif Location of development MgCl2 (mM) TA (◦C) Observed Product Length (bp) Marker Success Rate Unique Alleles Unique Genotypes Average H Sp.8910 F: CCTTCCCTACGTTGACTCCC R: GCGTTTCTCTGATCAGCACC ACG –> CGT Europe 2.0 58 358 20/20 1 1 0 Sp.9307 F: GGGAGCGAGCTGTATGAAG R: TTTCAACACCCTCACCATGC AG Europe 2.0 58 450–452* 9/20 2 3 0.444 Sp.9311 F: GTGAGAAAGGAAAGGTGGC R: TGCTCAGGATTCTATGGGCC AG Europe 2.0 58 253–255* 10/20 2 3 0.400 Sp.Pso27 F: AAGGGTTTCAGTGCGGACG R: CTCGCCTTCTCGTACATCATC AAG Europe 2.0 58 133* 9/20 1 1 0 Sp.Pso31 F: TCCACCGTCTCCCTGTAATG R: CCACTCCCTCGTCGTGAAG AAG Europe 1.2 60 240–270 32/42 7 7 0.406 Sp.Pso32 F: TGCTGGCGATGTCAATGTTG R: CTTCAGCACCAAGAGAGCTC ATC Europe 2.0 58 377–380* 19/20 2 3 0.895 Spirodela polyrhiza and Lem na m inor m icrosatellite m arkers 52 Kerstetter et al Genetic Resources (2023), 4 (7), 46–55 Microsatellite marker development A total of 18 L. minor and 16 S. polyrhiza microsatellite markers were developed across Europe or the USA. We downloaded the whole genome shotgun sequence data for S. polyrhiza strain 7498 from the National Center for Biotechnology Information’s GenBank database (accession ATDW01000001.1) deposited by Wang et al (2014). For L. minor, a draft genome (strain 8627) was downloaded from www.lemna.org on 16 October 2015 (genome draft lm8627.ASMv0.1). A recent study using tubulin-based polymorphism suggests that this lineage is in fact an interspecific hybrid of L. japonica Landolt and L. turionifera Landolt both closely related to L. minor (Braglia et al, 2021). The species identity for most samples on which we report below has been confirmed using morphology and/or barcoding (Fazekas et al, 2012; Barks et al, 2018). While some microsatellite markers are known to amplify across more than one duckweed species (Xu et al, 2018), we have not yet explicitly tested these markers against other species. Using msatcommander (version 1.0.8, Faircloth 2008), we identified microsatellite loci using the default settings, avoiding mononucleotide repeat motifs. We then selected loci that would produce products of different lengths, had different motif lengths and were found on different contigs. The 5’ end of forward primers were labelled with one of several fluorescent dyes from various suppliers. Primers developed at ETH Zurich were M13-tailed to reduce cost during development (Boutin-Ganache et al, 2001). This entailed adding the full or a partial M13 sequence of TGTAAAACGACGGCCAGT for the S. polyrhiza primers and GGAAACAGCTATGACCAT for L. minor primers to the 5’ end of the forward primer. The M13-labelled forward primers were used in combination with an M13 primer that had the same sequence but was fluorescently dye-labelled at its 5’ end. Some primers amplified loci that were fully or mostly monomorphic or did not amplify as consistently as others. For these primers, we only have fragment lengths that include the M13 tail (see Table 1 and Table 2), and we estimate that this lengthens the PCR product by 12–19 base pairs. For most primers, however, following initial testing with M13, we ordered new labelled primers that did not include the M13 tail. At least 20 duckweed samples were tested using each primer. European duckweed samples were tested across 7 L. minor and 16 S. polyrhiza primers, and USA duckweed samples were tested across 15 L. minor and 4 S. polyrhiza primers (see Supplemental Tables S1 and S2 for details). Each duckweed sample was tested with each primer using at least two independently extracted DNA samples. We only report allele lengths that were consistent in both samples. Microsatellite amplification and optimization All duckweed collections were extracted and genotyped at least twice by first sampling four to ten individuals from each monoclonal collection and lyophilizing them for 24 hours. We then extracted DNA using a modified CTAB-based method by Healey et al (2014). For primers developed in Europe, the conditions were the following: PCR amplification was conducted in 15µL volume reactions containing 3µL of template DNA, 3µL of 5X Colorless GoTaq Flexi buffer (Promega, USA), 2.0mM MgCl2, 0.2mM dNTP mix, 0.05µM of forward primer, 0.2µM of reverse primer, 0.2µM of M13 primer tagged with a fluorescent probe (e.g. 5’ 6-FAM or 5’ HEX), and 1 unit of GoTaq G2 Flexi DNA Polymerase (Promega, USA). DNA concentrations were rarely quantified as amplification was successful across a range of values (e.g. 2–40ng/µL). Thermocycling conditions for both S. polyrhiza and L. minor from Europe that were M13 tagged were: initial denaturing at 94◦C for 5 min, followed by 30 cycles of 1 min at 94◦C, 1 min at 60◦C, 1 min at 72◦C, followed by eight M13 cycles consisting of 1 min at 94◦C, 1 min at 53◦C, 1 min at 72◦C, followed by a final extension at 72◦C for 10 min. For all primers developed in the USA, the conditions were the following: PCR amplification was conducted in 15µL volume reactions containing 3µL of template DNA, 3µL of 5X Colorless GoTaq Flexi buffer (Promega, USA), 1.2mM MgCl2, 0.2mM dNTP mix, 0.08µg/µL of Bovine Serum Albumin (BSA), 0.2µM of each forward and reverse primer, and 1 unit of GoTaq G2 Flexi DNA Polymerase (Promega, USA). Thermocycling conditions for S. polyrhiza were: initial denaturing at 94◦C for 5 min, followed by 34 cycles of: 1 min of denaturing at 94◦C, 1 min of annealing at 60◦C, and 1 min of extension at 72◦C, followed by a final extension at 72◦C for 10 min. For L. minor, touchdown PCR was employed with an initial denaturation of 94◦C for 5 min, followed by five cycles of denaturation (94◦C, 1 min), annealing (67◦C, 1 min; decreasing by 1◦C per cycle), and extension (72◦C, 1 min). Then 25 cycles of 1 min at 94◦C, 1 min at 63◦C, and 2 min at 72◦C, followed by a final extension at 72◦C for 15 minutes. Primers were then optimized for annealing temperatures and MgCl2 concentration (Table 1 and Table 2 ). Fragment length analyses for all primers were con- ducted on ABI 3730 Genetic Analyzers (Applied Biosys- tems) at either the ETH Zurich Genetic Diversity Center (Switzerland), Keck DNA Sequencing Lab at Yale Uni- versity (USA), or the University of Pittsburgh Genomics Research Core (USA), using either GeneScanTM 500 or 600 LIZTM Dye Size Standards (Applied Biosystems). Allele calls were made using either Geneious (version 9.1.6, Kearse et al (2012)) or GeneMarker software (ver- sion 3.0.0, SoftGenetics, State College, Pennsylvania). Results and discussion We successfully developed 18 L. minor and 16 S. polyrhiza microsatellite primers (Table 1 and Table 2) which were tested on samples of duckweeds from Europe or Western Pennsylvania (USA). Some markers were more successful than others (Table 1 and Table 2). All markers amplified in some samples; of these, all Genetic Resources (2023), 4 (7), 46–55 53 18 L. minor primers and 12 of the 16 S. polyrhiza primers amplified polymorphic loci, having more than one allele. Moreover, these polymorphic loci differed in product length and can be used in multiplex reactions to increase efficiency and lower genotyping costs. We also found that some loci were much more polymorphic than others. For L. minor, these included loci amplified by primers LmR.5.C, LmR.8.B, LmR.15.A, LmR.15.B, LmR.15.C and LmR.26.B, some of which showed high allele richness even when tested on only 28 samples (Table 1). For S. polyrhiza these included loci amplified by primers Sp.1467, Sp.7286, Sp.7814, and Sp.Pso31 (Table 2). Monomorphic loci may still be useful in different duckweed populations (Chapuis and Estoup, 2007). Many microsatellite loci also showed heterogeneity (Supplemental Tables S1 and S2), which helps make the primers more informative to distinguish genotypes. We note that some primers developed in one continent were not tested on samples from the other continent (see caption in Supplemental Tables S1 and S2); we suspect these primers will work across continents given patterns observed in the others, but this remains to be tested. Comparing between species, we saw that S. polyrhiza has lower allelic and genotypic richness across most primers, although we also tested fewer samples of this species. This is consistent with our own recent large- scale sampling (Hobble et al. In preparation) as well as other studies using different genotyping methods, that similarly found low genetic diversity in S. polyrhiza (Bog et al, 2015; Xu et al, 2015; Feng et al, 2017). It has been hypothesized that this low genetic variation in S. polyrhiza is due to its low mutation rate (Xu et al, 2019). In addition, primers differed greatly in average observed heterozygosity, but species had similar mean heterozygosities (0.256 for L. minor and 0.283 for S. polyrhiza). Given that our sampling was designed to find unique genotypes (shallow and widespread) and not characterize populations, we limit our discussion of population genetic indices. The primers we developed can help researchers address various ecological and evolutionary questions as well as better identify and catalogue genotypes for the expanding applied uses of duckweed in bioremediation, biofuel production and as a forage crop. Supplemental data Supplemental Table S1: Lemna minor sample collection sites and allele lengths. Supplemental Table S2: Spirodela polyrhiza sample collection sites and allele lengths. Acknowledgements We thank Walter Lämmler for sharing duckweed lineages from the Landolt Duckweed Collection. We are grateful to the former Levine Plant Ecology Group at ETH Zurich and the Turcotte Lab for their assistance in maintaining collections. We thank ETH Zurich Genetic Diversity Center and Mary Janecka for help troubleshooting primer development. M.M.T. was supported by the ETH Zurich Center for Adaptation to Changing Environments and now by an NSF grant DEB- 1935410. Author contributions All authors contributed to testing, optimizing, and evaluating marker data, and contributed to reviewing the manuscript. JEK and MMT wrote the initial draft of the manuscript. Conflict of interest statement The authors have no conflicts of interest to report. References Acosta, K., Xu, J., Gilbert, S., Denison, E., Brinkman, T., Lebeis, S., and Lam, E. (2020). Duckweed hosts a taxonomically similar bacterial assemblage as the terrestrial leaf microbiome. PLOS ONE 15. doi: https: //doi.org/10.1371/journal.pone.0228560 Agrawal, A. A., Johnson, M. T. J., Hastings, A. P., and Maron, J. L. (2013). A field experiment demonstrating plant life-history evolution and its eco-evolutionary feedback to seed predator populations. The American Naturalist 181. doi: https://doi.org/10.1086/666727 Anneberg, T. J., O’neill, E. M., Ashman, T. L., and Turcotte, M. M. (2023). Polyploidy impacts population growth and competition with diploids: multigenerational experiments reveal key life history tradeoffs. New Phytologist 238, 1294–1304. doi: https: //doi.org/10.1111/nph.18794 Armitage, D. W. and Jones, S. E. (2019). Negative frequency-dependent growth underlies the stable coexistence of two cosmopolitan aquatic plants. Ecology 100, 2657–2657. doi: https://doi.org/10. 1002/ecy.2657 Barks, P. M., Dempsey, Z. W., Burg, T. M., and Laird, R. A. (2018). Among-strain consistency in the pace and shape of senescence in duckweed. Journal of Ecology 106, 2132–2145. doi: https://doi.org/10. 1111/1365-2745.12937 Bog, M., Lautenschlager, U., Landrock, M. F., Landolt, E., Fuchs, J., Sree, K. S., Oberprieler, C., and K.-J, A. (2015). Genetic characterization and barcoding of taxa in the genera Landoltia and Spirodela (Lemnaceae) by three plastidic markers and amplified fragment length polymorphism (AFLP). Hydrobiologia 749, 169–182. doi: https://doi.org/10.1007/s10750- 014-2163-3 Bog, M., Sree, K. S., Fuchs, J., Hoang, P. T. N., Schubert, I., Kuever, J., Rabenstein, A., Paolacci, S., Jansen, M. A. K., and Appenroth, K. J. (2020). A taxonomic revision of Lemna sect. Uninerves (Lemnaceae). TAXON 69, 56–66. doi: https://doi.org/10.1002/tax. 12188 Boutin-Ganache, I., Raposo, M., Raymond, M., and Deschepper, C. F. (2001). M13-tailed primers improve Spirodela polyrhiza and Lemna minor microsatellite markers https://doi.org/10.1371/journal.pone.0228560 https://doi.org/10.1371/journal.pone.0228560 https://doi.org/10.1086/666727 https://doi.org/10.1111/nph.18794 https://doi.org/10.1111/nph.18794 https://doi.org/10.1002/ecy.2657 https://doi.org/10.1002/ecy.2657 https://doi.org/10.1111/1365-2745.12937 https://doi.org/10.1111/1365-2745.12937 https://doi.org/10.1007/s10750-014-2163-3 https://doi.org/10.1007/s10750-014-2163-3 https://doi.org/10.1002/tax.12188 https://doi.org/10.1002/tax.12188 https://www.genresj.org/index.php/grj/article/view/genresj.ALFV3636/suppdata108 https://www.genresj.org/index.php/grj/article/view/genresj.ALFV3636/suppdata108 https://www.genresj.org/index.php/grj/article/view/genresj.ALFV3636/suppdata108 54 Kerstetter et al Genetic Resources (2023), 4 (7), 46–55 the readability and usability of microsatellite analyses performed with two different allele- sizing methods. BioTechniques 31, 25–28. doi: https://doi.org/10. 2144/01311bm02 Braglia, L., Lauria, M., Appenroth, K. J., Bog, M., Bre- viario, D., Grasso, A., Gavazzi, F., and L, M. (2021). Duckweed species genotyping and interspecific hybrid discovery by tubulin-based polymorphism fingerprint- ing. Frontiers in Plant Science 12, 625670–625670. doi: https://doi.org/10.3389/fpls.2021.625670 Cao, X. H., Fourounjian, P., and Wang, W. (2020). The Duckweed Genomes, ed. Cao, X. H., Fourounjian, P., and Wang, W. (Switzerland: Springer Cham), 185p. doi: https://doi.org/10.1007/978-3-030-11045-1 Chapuis, M. P. and Estoup, A. (2007). Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24, 621–631. doi: https://doi.org/10.1093/molbev/msl191 Chen, D., Zhang, H., Wang, Q., Shao, M., Li, X., Chen, D., Zeng, R., and Song, Y. (2020). Intraspecific variations in cadmium tolerance and phytoaccumulation in giant duckweed (Spirodela polyrhiza). J Hazard Mater 395, 122672–122672. doi: https://doi.org/10.1016/ j.jhazmat.2020.122672 Cheng, J. J. and Stomp, A. M. (2009). Growing duckweed to recover nutrients from wastewaters and for production of fuel ethanol and animal Feed. CLEAN - Soil, Air, Water 37, 17–26. doi: https://doi. org/10.1002/clen.200800210 Cui, W. and Cheng, J. J. (2015). Growing duckweed for biofuel production: a review. Plant Biology 17, 16–23. doi: https://doi.org/10.1111/plb.12216 Ekperusi, A. O., Sikoki, F. D., and Nwachukwu, E. O. (2019). Application of common duckweed (Lemna minor) in phytoremediation of chemicals in the environment: State and future perspective. Chemosphere 223, 285–309. doi: https://doi.org/10. 1016/j.chemosphere.2019.02.025 Fazekas, A. J., Kuzmina, M. L., Newmaster, S. G., and Hollingsworth, P. M. (2012). DNA Barcoding Methods for Land Plants. In DNA Barcodes. Methods in Molecular Biology, ed. Kress, W. and Erickson, D. (Humana Press), volume 858, 223-252. Feng, B., Fang, Y., Xu, Z., Xiang, C., Zhou, C., Jiang, F., Wang, T., and Zhao, H. (2017). Development of a new marker system for identification of Spirodela polyrhiza and Landoltia punctata. International Journal of Genomics. doi: https://doi.org/10.1155/ 2017/5196763 Fu, L., Ding, Z., Kumpeangkeaw, A., Tan, D., Han, B., Sun, X., and Zhang, J. (2020). De novo assembly, transcriptome characterization, and simple sequence repeat marker development in duckweed Lemna gibba. Physiol Mol Biol Plants 26, 133–142. doi: https: //doi.org/10.1007/s12298-019-00726-9 Gupta, C. and Prakash, D. (2013). Duckweed: an effective tool for phyto-remediation. Toxicological & Environmental Chemistry 95, 1256–1266. doi: https: //doi.org/10.1080/02772248.2013.879309 Hart, S. P., Turcotte, M. M., and Levine, J. M. (2019). Effects of rapid evolution on species coexistence. Proceedings of the National Academy of Sciences 116, 2112–2117. doi: https://doi.org/10.1073/pnas. 1816298116 Healey, A., Furtado, A., Cooper, T., and Henry, R. J. (2014). Protocol: a simple method for extracting next- generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods 10. doi: https://doi.org/10.1186/1746-4811-10-21 Hillman, W. S. (1961). The Lemnaceae, or duckweeds. Bot. Rev 27, 221–287. doi: https://doi.org/10.1007/ BF02860083 Hitsman, H. W. and Simons, A. M. (2020). Latitudinal variation in norms of reaction of phenology in the greater duckweed Spirodela polyrhiza. Journal of Evolutionary Biology 33, 1405–1416. doi: https://doi. org/10.1111/jeb.13678 Ho, E. K. H., Bartkowska, M., Wright, S. I., and F, A. (2019). Population genomics of the facultatively asex- ual duckweed Spirodela polyrhiza. New Phytologist 224, 1361–1371. doi: https://doi.org/10.1111/nph. 16056 Jacobs, D. L. (1947). An ecological life-history of Spirodela polyrhiza (greater duckweed) with emphasis on the turion phase. Ecological Monographs 17, 437–469. doi: https://doi.org/10.2307/1948596 Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., and Drummond, A. (2012). Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649. doi: https://doi. org/10.1093/bioinformatics/bts199 Laird, R. A. and Barks, P. M. (2018). Skimming the surface: duckweed as a model system in ecology and evolution. Am J Bot 105, 1962–1966. doi: https: //doi.org/10.1002/ajb2.1194 Landolt, E. (1986). Biosystematic investigations in the family of duckweeds (Lemnaceae), Vol. 2. In The family of Lemnaceae—A Monographic Study, volume 1, ETH Zürich. Landolt, E. (1992). Lemnaceae duckweed family. Journal of the Arizona-Nevada Academy of Science 26, 10–14. Markoulatos, P., Siafakas, N., and Moncany, M. (2002). Multiplex polymerase chain reaction: A practical approach. J Clin Lab Anal 16, 47–51. doi: https: //doi.org/10.1002/jcla.2058 Morgante, M. and Olivieri, A. M. (1993). PCR-amplified microsatellites as markers in plant genetics. Plant J 3, 175–182. O’Brien, A. M., Yu, Z. H., Pencer, C., Frederickson, M. E., Lefevre, G. H., and E, P. (2022). Harnessing plant- microbiome interactions for bioremediation across a freshwater urbanization gradient. Water Research 223, 118926–118926. doi: https://doi.org/10.1016/ j.watres.2022.118926 https://doi.org/10.2144/01311bm02 https://doi.org/10.2144/01311bm02 https://doi.org/10.3389/fpls.2021.625670 https://doi.org/10.1007/978-3-030-11045-1 https://doi.org/10.1093/molbev/msl191 https://doi.org/10.1016/j.jhazmat.2020.122672 https://doi.org/10.1016/j.jhazmat.2020.122672 https://doi.org/10.1002/clen.200800210 https://doi.org/10.1002/clen.200800210 https://doi.org/10.1111/plb.12216 https://doi.org/10.1016/j.chemosphere.2019.02.025 https://doi.org/10.1016/j.chemosphere.2019.02.025 https://doi.org/10.1155/2017/5196763 https://doi.org/10.1155/2017/5196763 https://doi.org/10.1007/s12298-019-00726-9 https://doi.org/10.1007/s12298-019-00726-9 https://doi.org/10.1080/02772248.2013.879309 https://doi.org/10.1080/02772248.2013.879309 https://doi.org/10.1073/pnas.1816298116 https://doi.org/10.1073/pnas.1816298116 https://doi.org/10.1186/1746-4811-10-21 https://doi.org/10.1007/BF02860083 https://doi.org/10.1007/BF02860083 https://doi.org/10.1111/jeb.13678 https://doi.org/10.1111/jeb.13678 https://doi.org/10.1111/nph.16056 https://doi.org/10.1111/nph.16056 https://doi.org/10.2307/1948596 https://doi.org/10.1093/bioinformatics/bts199 https://doi.org/10.1093/bioinformatics/bts199 https://doi.org/10.1002/ajb2.1194 https://doi.org/10.1002/ajb2.1194 https://doi.org/10.1002/jcla.2058 https://doi.org/10.1002/jcla.2058 https://doi.org/10.1016/j.watres.2022.118926 https://doi.org/10.1016/j.watres.2022.118926 Genetic Resources (2023), 4 (7), 46–55 55 Powell, W., Machray, G. C., and Provan, J. (1996). Polymorphism revealed by simple sequence repeats. Trends in Plant Science 1, 215–222. Schenk, R. U. and Hildebrandt, A. C. (1972). Medium and techniques for induction and growth of mono- cotyledonous and dicotyledonous plant cell cultures. Can. J. Bot 50, 199–204. doi: https://doi.org/10. 1139/b72-026 Schlötterer, C. and Tautz, D. (1992). Slippage synthesis of simple sequence DNA. Nucleic Acids Res 20, 211– 215. Sree, K. S., Bog, M., and Appenroth, K. J. (2016). Taxonomy of duckweeds (Lemnaceae), potential new crop plants. Emirates Journal of Food and Agriculture 291-302. doi: https://doi.org/10.9755/ejfa.2016-01- 038 Subramanian, S. K. and Turcotte, M. M. (2020). Preference, performance, and impact of the water-lily aphid on multiple species of duckweed. Ecological Entomology 45, 1466–1475. doi: https://doi.org/10. 1111/een.12932 Tan, J., Kerstetter, J. E., and Turcotte, M. M. (2021). Eco-evolutionary interaction between microbiome presence and rapid biofilm evolution determines plant host fitness. Nat Ecol Evol 5, 670–676. doi: https: //doi.org/10.1038/s41559-021-01406-2 Tautz, D. (1989). Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res 17, 6463–6471. Tautz, D. and Renz, M. (1984). Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Res 12, 4127–4138. Turcotte, M. M., Reznick, D. N., and Hare, J. D. (2011). The impact of rapid evolution on population dynamics in the wild: experimental test of eco-evolutionary dynamics. Ecology Letters 14, 1084–1092. doi: https: //doi.org/10.1111/j.1461-0248.2011.01676.x Van Steveninck, R. F. M., Van Steveninck, M. E., and Fernando, D. R. (1992). Heavy-metal (Zn, Cd) tolerance in selected clones of duck weed (Lemna minor). Plant and Soil 146, 271–280. Vieira, M. L. C., Santini, L., Diniz, A. L., and de F Munhoz, C. (2016). Microsatellite markers: what they mean and why they are so useful. Genet Mol Biol 39, 312–328. doi: https://doi.org/10.1590/ 1678-4685-GMB-2016-0027 Wang, W., Haberer, G., Gundlach, H., Gläßer, C., Nuss- baumer, T., Luo, M. C., Lomsadze, A., Borodovsky, M., Kerstetter, R. A., Shanklin, J., Byrant, D. W., Mock- ler, T. C., Appenroth, K. J., Grimwood, J., Jenkins, J., Chow, J., Choi, C., Adam, C., Cao, X. H., Fuchs, J., Schubert, I., Rokhsar, D., Schmutz, J., Michael, T. P., Mayer, K. F. X., and Messing, J. (2014). The Spirodela polyrhiza genome reveals insights into its neotenous reduction fast growth and aquatic lifestyle. Nat Commun 5, 3311–3311. doi: https://doi.org/10. 1038/ncomms4311 Wani, G., Shah, M., Reshi, Z., Atangana, A., and Khasa, D. (2014). cpDNA microsatellite markers for lemna minor (ARACEAE): Phylogeographic Implications. Applications in plant sciences 2(7). doi: https://doi. org/10.3732/apps.1300099 Xu, N., Hu, F., Wu, J., Zhang, W., Wang, M., Zhu, M., and Ke, J. (2018). Characterization of 19 polymorphic SSR markers in Spirodela polyrhiza (Lemnaceae) and cross-amplification in Lemna perpusilla. Applications in Plant Sciences 6. doi: https://doi.org/10.1002/ap- s3.1153 Xu, S., Stapley, J., Gablenz, S., Boyer, J., Appenroth, K. J., Sree, K. S., Gershenzon, J., Widmer, A., and Huber, M. (2019). Low genetic variation is associated with low mutation rate in the giant duckweed. Nat Commun 10, 1243–1243. doi: https://doi.org/10. 1038/s41467-019-09235-5 Xu, Y., Ma, S., Huang, M., Peng, M., Bog, M., Sree, K. S., Appenroth, K. J., and Zhang, J. (2015). Species distribution, genetic diversity and barcoding in the duckweed family (Lemnaceae). Hydrobiologia 743, 75–87. doi: https://doi.org/10.1007/s10750- 014-2163-3 Ziegler, P., Adelmann, K., Zimmer, S., Schmidt, C., and Appenroth, K. J. (2015). Relative in vitro growth rates of duckweeds (Lemnaceae) - the most rapidly growing higher plants. Plant Biol 17, 33–41. doi: https://doi.org/10.1111/plb.12184 Spirodela polyrhiza and Lemna minor microsatellite markers https://doi.org/10.1139/b72-026 https://doi.org/10.1139/b72-026 https://doi.org/10.9755/ejfa.2016-01-038 https://doi.org/10.9755/ejfa.2016-01-038 https://doi.org/10.1111/een.12932 https://doi.org/10.1111/een.12932 https://doi.org/10.1038/s41559-021-01406-2 https://doi.org/10.1038/s41559-021-01406-2 https://doi.org/10.1111/j.1461-0248.2011.01676.x https://doi.org/10.1111/j.1461-0248.2011.01676.x https://doi.org/10.1590/1678-4685-GMB-2016-0027 https://doi.org/10.1590/1678-4685-GMB-2016-0027 https://doi.org/10.1038/ncomms4311 https://doi.org/10.1038/ncomms4311 https://doi.org/10.3732/apps.1300099 https://doi.org/10.3732/apps.1300099 https://doi.org/http://dx.doi.org/10.1002/aps3.1153 https://doi.org/http://dx.doi.org/10.1002/aps3.1153 https://doi.org/10.1038/s41467-019-09235-5 https://doi.org/10.1038/s41467-019-09235-5 https://doi.org/10.1007/s10750-014-2163-3 https://doi.org/10.1007/s10750-014-2163-3 https://doi.org/10.1111/plb.12184 Introduction Materials and methods Sample collection Microsatellite marker development Microsatellite amplification and optimization Results and discussion Supplemental data Acknowledgements Author contributions Conflict of interest statement