GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 Indonesian Scholars’ Alliance Open Access Research Article The 1st Cirebon International Health Symposium: Faculty of Medicine, Universitas Swadaya Gunung Jati Update on Non-Communicable Diseases: Global Perspective on Health Challenges and Innovation Angiotensin-Converting Enzyme Insertion/Deletion (ACE I/D) Gene Polymorphism as a Risk Factor for Essential Hypertension Hasna Nurazizah Kuswara* , Donny Nauphar# , Ariestya Indah Permata Sari Department of Genetics, Faculty of Medicine, Universitas Swadaya Gunung Jati, Indonesia. *Corresponding author’s e-mail: kuswarahasnanurazizah@gmail.com*; dnauphar@yahoo.com# DOI: 10.35898/ghmj-741044 ABSTRACT Background: Hypertension is the leading cause of death globally due to its complications, including coronary heart disease and stroke. In 2018, hypertension cases in West Java were the second highest among all populations in Indonesia. Genetics is one of the unmodifiable risk factors for hypertension. Angiotensin-converting enzyme insertion/deletion (ACE I/D) gene polymorphism could affect ACE production in the renin-angiotensin-aldosterone system (RAAS), which is linked to the blood pressure regulation. Aims: To analyze ACE I/D gene polymorphism as a risk factor for hypertension in Cirebon. Methods: An observational analysis with a case-control design was used in this study. Blood samples were collected from 30 hypertensive patients and 30 healthy individuals at Talun Health Center. DNA extraction was performed to evaluate polymorphisms using ARMS-PCR. Statistical analyses, including the Chi-square test, Fisher’s exact test, Mann-Whitney test, and Kruskal-Wallis test, were conducted to compare the case and control groups. The odds ratio was calculated to see the risk of the assessed variables, including genotype, allele frequency, and the presence of ACE I/D gene polymorphism. Results: In the case group, the frequency of the II genotype was 2 (6.7%), the ID genotype was 25 (83.3%), and the DD genotype was 3 (10.0%). In the control group, the frequency of the II genotype was 2 (6.7%), the ID genotype was 26 (86.7%), and the DD genotype was 2 (6.7%). Statistically, there was no significant association between ACE I/D gene polymorphisms in essential hypertension patients and healthy people (p=0.500; OR=1.556; 95% CI=0.241-10.049). Conclusion: ACE I/D gene polymorphism was not significantly associated with essential hypertension in Cirebon, West Java, Indonesia. Keywords: Polymorphism, ACE gene, Insertion-deletion mutation, Blood pressure, Hypertension. Received: 25 September 2024 Reviewed: 21 October 2024 Revised: 23 November 2024 Accepted: 30 November 2024 © Yayasan Aliansi Cendekiawan Indonesia Thailand (Indonesian Scholars’ Alliance). This is an open-access following Creative Commons License Deed - Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) mailto:kuswarahasnanurazizah@gmail.com mailto:dnauphar@yahoo.com https://doi.org/10.35898/ghmj-741044 https://orcid.org/0009-0008-2203-1824 https://orcid.org/0000-0002-8708-4715 https://orcid.org/0000-0003-4037-937X 181 GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 Kuswara, et. al. 1. Introduction One of the risk factors for diseases that cause death globally is hypertension, including coronary heart disease, ischemic stroke, and hemorrhagic stroke (World Health Organization, 2023, 2024). Hypertension is a condition in which systolic blood pressure ≥140 mmHg and/or diastolic blood pressure ≥90 mmHg (World Health Organization, 2023). According to the World Health Organization (WHO), an estimated 1.13 billion people in the world suffer from hypertension. Hypertension accounts for about 12.8% (estimated 7.5 million) of all deaths in the world (World Health Organization, 2023). The prevalence of hypertension in Indonesia is 34.11% of individuals aged ≥18 years, while in West Java Province, the prevalence of hypertension is 39.6% (Badan Penelitian Dan Pengembangan Kesehatan Kementerian Kesehatan RI, 2019). The estimated number of hypertension patients in Cirebon Regency in 2021 is 648.030, and 73.173, or 11.3% of the total number of hypertension patients, have received medical treatment according to standards (Dinas Kesehatan Kabupaten Cirebon, 2021). The estimated number of hypertension patients aged ≥15 years at the Talun Health Center is 12.182 (Dinas Kesehatan Kabupaten Cirebon, 2021). Essential hypertension and secondary hypertension are the two types of hypertensions that are classified according to their causes. Essential hypertension is hypertension of unknown cause. The percentage of essential hypertension is 90%, while the percentage of secondary hypertension, whose cause is known to be 10% (Kumar & Clark, 2021; Tortora & Derrickson, 2014). Among the factors that cause essential hypertension are genetic factors. An example is the polymorphism of genes that regulate blood pressure, such as angiotensin-converting enzyme (ACE). (Setiati et al., 2014). The ACE gene plays a crucial role in the renin-angiotensin-aldosterone system (RAAS), which raises blood pressure by converting the inert peptide angiotensin I into the potent vasoconstrictor angiotensin II. It also deactivates the vasodilator bradykinin (Sayed-Tabatabaei, Oostra, Isaacs, Duijn, & Witteman, 2006). Differences in the ACE enzymes produced can be caused by mutations in the ACE gene. One of the most common variations is the insertion/deletion (I/D) of ACE gene. Insertion (I) refers to additional deoxyribonucleic acid (DNA) segments in the ACE gene. On the other hand, deletion (D) denotes the absence of specific segments in the ACE gene. Possible genotype combinations are II, ID, and DD (Eleni et al., 2008; Sayed-Tabatabaei et al., 2006). The Alu 287 bp sequence in intron 16 is where the ACE I/D polymorphism is found (Sayed-Tabatabaei et al., 2006). ACE I/D variants have been associated in multiple studies with an increased risk of cardiovascular diseases such as hypertension, stroke, kidney disease, psoriasis, and Alzheimer's disease. (Sayed-Tabatabaei et al., 2006; X. Wang et al., 2004). Individuals carrying the D allele tend to have higher ACE enzyme activity, resulting in increased angiotensin II production, which can cause vasoconstriction and elevated blood pressure, thereby increasing the risk of essential hypertension (Eleni et al., 2008; Qadar Pasha et al., 2002; L. Wang, Song, & Dong, 2023). Studies on ACE I/D polymorphisms have produced conflicting results, possibly due to population differences and other risk factors. For instance, research conducted on the Ethiopian population found a significant association between the ACE I/D polymorphism and the risk of hypertension (Birhan, Molla, Abdulkadir, & Tesfa, 2022). A correlation between hypertension and the ACE I/D gene polymorphism was discovered in studies conducted on the Chinese steelworker community (X. Zhang et al., 2022). Meanwhile, a study in the Hefei region of Anhui, China, found no relationship between ACE I/D gene polymorphism and hypertension in the Hefei region of Anhui, China (L. Wang et al., 2023). The ACE I/D polymorphism was not significantly associated with hypertension in a research conducted in South Sulawesi, Indonesia, involving 99 non-hypertensive and 104 hypertensive patients. (Rasyid, Bakri, & Yusuf, 2012). To date, no studies have examined the connection between ACE I/D polymorphisms and risk factors for hypertension in the population of Cirebon, West Java, Indonesia, in 2024. Therefore, this study aims to investigate the role of the ACE I/D polymorphism as a risk factor for hypertension in the population of Cirebon, West Java, Indonesia, in 2024. Kuswara, et. al. GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 182 2. Methods Study design and Research procedures This observational analytical study employed a case-control design to investigate the relationship between ACE I/D polymorphism and essential hypertension in Cirebon, West Java, Indonesia. This study compared hypertensive patients, who represented the affected individuals (cases), and healthy individuals as the unaffected controls. Participants were selected through purposive sampling based on predefined inclusion and exclusion criteria. The case-control approach determined a total sample size of 60 participants, comprising 30 individuals in the case group and 30 individuals in the control group. The subjects were categorized into two groups: the case group, which included patients diagnosed with essential hypertension according to JNC VIII criteria, and those with a history of essential hypertension, receiving antihypertensive medications for more than 3 months. The control group consisted of healthy individuals without a history of essential or secondary hypertension, and who were not taking antihypertensive medications. Control subjects were matched with case subjects by age (± 2 years). To reduce bias, patients who were pregnant or breastfeeding, or had a history of diabetes mellitus, renal disease, coronary heart disease, or other cardiovascular disease were excluded from the case group. Measurements Screening and Blood Collection of Subjects Data collection and sample acquisition were conducted between March and August 2024 at the Talun Public Health Center in Cirebon. Genetic analysis was performed at the Research Laboratory of the Faculty of Medicine at Universitas Swadaya Gunung Jati. After obtaining informed consent, participants who met the study criteria were screened using a questionnaire. Clinical characteristics collected during screening included age, gender, occupation, ethnicity, body mass index (BMI), smoking status, dietary habits, and family history of hypertension. Furthermore, blood pressure was measured three times, with 3 to 5 minutes between each measurement. Blood samples (3–5 cc) were collected at the Talun Public Health Center, placed in EDTA tubes, and sent to the Research Laboratory at Universitas Swadaya Gunung Jati Cirebon for genetic analysis. DNA Extraction The DNA extraction was performed using the salting-out method with the TianGen TIANamp DNA/RNA Extraction kit. Upon completion of the extraction process, the DNA was stored at -20 ℃ in the freezer. DNA Amplification The extracted genomic DNA from hypertensive patients was amplified using the ARMS-PCR technique. The forward primer used was 5’–CTGGAGACCACTCCCATCCTTTCT–3’, and the reverse primer was 5’– GATGTGGCCATCACATTCGTCAGAT–3’. The total volume for the amplification reaction was 25 μl, which included 12.5 μl of PCR Taq Master Mix, 1.0 μl each of upstream and downstream primers, 1.0 μl of DNA template, and 9.5 μl of deionized water. The ARMS-PCR condition included an initial pre-denaturation step at 95 °C for 5 minutes, followed by denaturation at 94 °C for 30 seconds, annealing at 58 °C for 30 seconds, and extension at 72 °C for 40 seconds. Starting from denaturation to extension, the cycle was repeated 35 times. A final terminal extension was performed at 72 °C for 5 minutes (X. Zhang et al., 2022). PCR Visualization An insertion/deletion site characterized the ACE I/D polymorphism, and genotypes were identified by visualizing ARMS-PCR amplification products under an ultraviolet analyzer. The DNA fragments were stained with GelRed and subjected to electrophoresis on a 1.5% agarose gel in TAE buffer for 30 minutes at 100 volts. The expected results were II genotype (490 bp); ID genotype (190 bp, 490 bp); and DD genotype (190 bp). 183 GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 Kuswara, et. al. Statistical techniques Statistical analysis was performed using Chi-square, Fisher’s exact test, Mann-Whitney, and Kruskal-Wallis tests to compare case and control groups. Odds ratios (OR) with 95% confidence intervals (CI) were calculated to assess the risk associated with the variables such as genotype, allele frequency, and the presence of ACE I/D gene polymorphism, with significance set at p<0.05. Ethical Clearance This study was conducted after receiving ethical clearance from the Medical Research Ethics Committee of Universitas Swadaya Gunung Jati on April 30, 2024, under approval number 29/EC/FKUGJ/IV/2024. 3. Results Overview of the Characteristics of the Research Subject Based on the results of the analysis of 60 respondents in Table 1, it was found that the frequency of the highest age characteristics was around 23 (76.7%) subjects in the age range of 40-59 years in the control group and 22 (73.3%) in the case group. The most dominant frequency of ethnic characteristics was Javanese, with 26 (57.8%) in the control group and 19 (42.2%) in the case group. The highest frequency of subjects with a family history of hypertension was observed in the control group, with 27 individuals (90.0%) categorized as having no history of hypertension. The highest frequency of BMI characteristics in both the case and control groups was Obesity I, followed by Overweight, Obesity II, and Normal. In the case group, the frequencies were 13 (43.3%), 6 (20.0%), 6 (20.0%), 4 (13.3%), and 1 (3.3%) subjects, respectively. In contrast, the BMI distribution in the control group was as follows: 12 (40.0%) subjects had Obesity I, 10 (33.3%) had Overweight, 4 (13.3%) had Obesity II, 4 (13.3%) had Normal BMI, and 0 (0.0%) subjects had other BMI categories. Table 1. Frequency Distribution of Characteristics of Research Subjects Characteristics N (%) P- Value OR (95 % CI) Case Control Total 30 (100) 30 (100) Age 18-39 40-59 ≥60 4 (13.3) 22 (73.3) 4 (13.3) 3 (10.0) 23 (76.7) 4 (13.3) 0.800a NA Sex Male Female 15 (50.0) 15 (50.0) 15 (50.0) 15 (50.0) 1.000b 1.00 (0.363-2.751) Ethnicity Javanese Non-Javanese 19 (42.2) 11 (73.3) 26 (57.8) 4 (26.7) 0.037*b 0.266 (0.073-0.964) Family History of Hypertension Yes No 19 (63.3) 11 (36.7) 3 (10.0) 27 (90.0) 0.000*b 15.545 (3.814-63.359) BMI Underweight Normal Overweight Obesity I Obesity II 1 (3.3) 4 (13.3) 6 (20.0) 13 (43.3) 6 (20.0) 0 (0.0) 4 (13.3) 10 (33.3) 12 (40.0) 4 (13.3) 0.533c NA Smoking Yes No 9 (30.0) 21 (70.0) 6 (20.0) 24 (80.0) 0.371b 1.714 (0.523-5.621) *Significant (P<0.05) aMann-Whitney Test. bChi-Square Test. cKruskal-Wallis test. Kuswara, et. al. GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 184 The highest frequency of smoking status was observed in the non-smoking category, with 24 (80.0%) subjects in the control group and 21 (70.0%) in the case group. The p-value for ethnicity and family history of hypertension showed statistical significance (p=0.037; p=0.000), while age, gender, BMI, and smoking did not demonstrate significant associations with the incidence of hypertension (p=0.800; p=1.000; p=0.533; P=0.371). The OR (95% CI) value for ethnicity was 0.266 (0.073-0.964), while for family history of hypertension was 15.545 (3.814- 63.359). The OR (95% CI) value for smoking status was 1.714 (0.523-5.621). Standard Descriptive Analysis of Research Subjects Descriptive analysis (Table 2) reveals that the case and control groups had the same age range and median age, with a range of 42 years and a median of 51 years. The standard deviation of the case group was 9.640, whereas that of the control group was 9.481. Table 2. Standard Descriptive Analysis of Research Subjects Range Median Std. Deviation Control Age 42 51 9.413 Case Age 42 51 9.640 Total Age 42 51 9.448 Genotype and Allele Frequency Distribution The genotype frequency distribution of the ACE I/D gene was determined using ARMS-PCR, yielding three possible outcomes: II (490 bp), ID (190 bp, 490 bp), and DD (190 bp). The allele frequency distribution of the ACE I/D gene consisted of allele I and allele D, as shown in Table 3. According to the table, the most common genotype was ID, found in 25 subjects (83.3%) in both the case and control groups. The least common genotype was II, identified in only 2 subjects (6.7%) in the case group. The most frequent allele in the case group was allele I (51.7%), while in the control group, allele D was more prevalent (51.7%). The p-value for genotype (Kruskal- Wallis test) and allele (Fisher’s exact test) did not show significance (p=0.531; p=0.715). The OR (95% CI) for the alleles was 1.143 (0.558-2.338). Table 3. Genotype and Allele Frequency Distribution N (%) P-Value OR (95% CI) Case Control Genotype II ID DD 2 (6.7) 25 (83.3) 3 (10.0) 3 (10.0) 25 (83.3) 2 (6.7) 0.531a 1.00 (Ref) 0.667 (0.102-4.339) 2.25 (0.179-28.254) Allele I D 31 (51.7) 29 (48.3) 29 (48.3) 31 (51.7) 0.715b 1.00 (Ref) 1.143 (0.558-2.338) aKruskal-Wallis test. bChi-Square Test. Moreover, Table 4 demonstrates that there is no significant association between hypertension and the ACE I/D genotype when Fisher's exact test is applied. The ID+DD vs. II (reference) comparison yielded an odds ratio (OR) of 0.643 and a 95% CI of 0.100–4.153. 185 GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 Kuswara, et. al. Table 4. Compound Allele Analysis N (%) P-Value OR (95% CI) Case Control Total 30 (100) 30 (100) DD 3 (10.7) 2 (7.4) 1.00 (Ref) • ID 25 (89.3) 25 (93.6) 0.518a 1.500 (0.230-9.763) DD 3 (60.0) 2 (40.0) 1.00 (Ref) • II 2 (40.0) 3 (60.0) 0.500a 2.250 (0.179-28.254) DD 3 (10.0) 2 (6.7) 1.00 (Ref) • ID+II 27 (90.0) 28 (93.3) 0.500a 1.556 (0.241-10.049) II 2 (6.7) 3 (10.0) 1.00 (Ref) • ID+DD 28 (93.3) 27 (90.0) 0.500a 0.643 (0.100-4.153) aFisher’s Exact Test Gel Electrophoresis Visualization Results Figure 1 illustrates the results of gel electrophoresis conducted on 1.5% agarose gel, run for 30 minutes at 100 volts. Bands labeled 3, 5, 8, and 11 showed a single band representing II (490 bp), while bands labeled 1, 4, 6, 7, and 9 showed two bands corresponding to ID (190 bp, 490 bp), and bands 2 and 10 indicated a single band for DD (190 bp). Figure 1. Gel Electrophoresis of ACE I/D Relationship between ACE I/D Polymorphism and Essential Hypertension Table 5 reveals that 28 (93.3%) subjects in the case group had the ACE I/D polymorphism, while only 2 (6.7%) did not. In the control group, 27 (90.0%) subjects had the polymorphism, while 3 (10.0%) did not. Due to the small number of subjects in each category, the data did not meet the minimum expected count for the Chi-square test. Therefore, Fisher's exact test yielded a p-value of 0.500, indicating no statistical significance (p>0.05). The OR (95% CI) was 1.556 (0.241-10.049), suggesting that subjects with the ACE I/D polymorphism were 1.556 times more likely to develop essential hypertension than those without the polymorphism. In this study, the ACE I/D polymorphism was considered a risk factor for essential hypertension. Kuswara, et. al. GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 186 Table 5. Association of ACE I/D Gene Polymorphism with Essential Hypertension Polymorphism N (%) P-Value OR (95% CI) Case Control Yes (DD and ID) 28 (93.3) 27 (90.0) 0.500a 1.556 (0.241-10.049) No (II) 2 (6.7) 3 (10.0) 1.00 (Ref) Total 30 (100.0) 30 (100.0) aFisher Exact Test 4. Discussion One of the primary contributors to cardiovascular disease-related mortality is hypertension, a disorder characterized by elevated blood pressure. The complications of hypertension can affect multiple target organs, with the extent of organ damage depending on the severity and duration of high blood pressure. Common complications include ischemic heart disease, heart failure, stroke, kidney failure, retinopathy, and other related disorders (Muhadi, 2016). Family history or genetic predisposition is a significant non-modifiable risk factor for hypertension (Rahmadhani, 2021). More than 150 genes have been linked to hypertension, with various genetic variations evolving according to the study population (Y. Zhang et al., 2019). One of the most critical genes involved in hypertension is the ACE gene, which plays a vital role in the RAAS (Sayed-Tabatabaei et al., 2006). In this study, a family history of hypertension was statistically significant (p<0.05), with an OR (95% CI) of 15.545 (3.814-63.359), indicating that individuals with a family history of hypertension are 15.545 times more likely to develop hypertension than those without such a history. These findings are consistent with a study conducted in 2023 in Kendari, Indonesia, which also demonstrated a significant association between family history and hypertension risk, where subjects with a family history of hypertension were 12 times more likely to develop the condition (Sudayasa, Husdaningsih, & Alifariki, 2023). This study involved 30 hypertensive patients and 30 healthy individuals. The significance of ethnicity was observed in both groups, with a p-value of 0.037 (p<0.05), similar to the finding from a study conducted in India that also reported a significant association with hypertension in both the case and control groups (Qadar Pasha et al., 2002). The OR (95% CI) for ethnicity was 0.266 (0.073-0.964), suggesting that it may serve as a protective factor against hypertension in this study. A study in Banyuwangi, East Java, Indonesia, showed similar results, indicating that ethnicity was not a risk factor for hypertension (Astutik, Puspikawati, Dewi, Mandagi, & Sebayang, 2020). BMI characteristics did not show statistical significance in either group, with a p-value of 0.585 (p>0.05), consistent with studies conducted in Kazakh populations in China’s Barkol Pasture (X. Wang et al., 2004), Mataram, Indonesia (Rezqi, Fathana, & Dirja, 2023), and Bogor, Indonesia (Agustiani, Anggie Nauli, & Masitha Arsyati, 2023). However, studies conducted in Anhui, China (L. Wang et al., 2023), Lorestan, Iran (Hadian, Zafarmohtashami, Chaghervand, & Nouryazdan, 2022), and Yogyakarta, Indonesia (Bawazier, Sja’bani, Haryana, Soesatyo, & Sadewa, 2010) reported significant associations between BMI and hypertension. Smoking status in this study also did not demonstrate statistical significance between the two groups, with a p-value of 0.371 (p>0.05). This finding aligns with studies conducted in Banyuwangi (Bawazier et al., 2010), and South Hulu Sungai, Kalimantan Selatan, Indonesia (Mufaidah, 2019), which similarly found no significant association between smoking and the incidence of hypertension (Hidayat & Milenia Saputri, 2023). Likewise, a recent study in Anhui, China, reported no significant association between smoking and essential hypertension (L. Wang et al., 2023). The ACE gene influences plasma ACE levels and blood pressure regulation through the RAAS. Approximately 47% of the variation in serum ACE levels is attributed to the Insertion/Deletion (I/D) polymorphism (Sudayasa et al., 2023). In this study, the ID genotype was the most common among both case and control groups, followed by the DD and II genotypes. The most frequent allele in the case group was allele I, while allele D was more prevalent in the control group. Genotype and allele frequencies were not significantly associated with hypertension, consistent with findings from a study involving 203 subjects in South Sulawesi, Indonesia (Rasyid et al., 2012). Similar results were observed in a cross-sectional study with 69 postmenopausal women in Java 187 GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 Kuswara, et. al. (Utami, Simamora, Idawati, & Widjaja, 2024). According to that study, the II genotype was more prevalent among healthy individuals; however, the DD genotype was exclusively present among hypertensive patients. A study conducted in Japan similarly reported no significant association between genotype and allele frequencies among case and control groups (Ishigami et al., 1995). In this study, the II genotype was more frequently observed in healthy individuals. The I allele is associated with lower concentrations of angiotensin II in tissues and reduced enzyme levels. In contrast, the D allele is linked to higher serum ACE levels, resulting in increased angiotensin II concentration and bradykinin degradation, which leads to hypertension (Barley et al., 1994). A study conducted in Yogyakarta, Indonesia (Bawazier et al., 2010) found that the ID+DD genotypes were significantly associated with hypertension compared to the II genotype. However, the comparison between ID+DD vs. II genotypes in this study was not statistically significant, although it suggested a protective effect (OR<1). Similar results were observed in a study conducted in Burkina Faso, West Africa, where the ID+DD vs. II genotypes were found to be protective, with an OR of 0.34 and a 95% CI of 0.14– 0.76 (Tchelougou et al., 2015). This study aimed to investigate the association between the risk of hypertension and ACE I/D gene polymorphisms. The results indicated no significant association between ACE I/D polymorphisms and hypertension; however, the OR values suggested that ACE I/D polymorphisms could still be considered a risk factor for essential hypertension. These findings are consistent with a study conducted in South Sulawesi, Indonesia, involving 99 non-hypertensive and 104 hypertensive subjects (Rasyid et al., 2012). The lack of significant differences between the two groups in that study suggests that essential hypertension may not be associated with the ACE I/D polymorphism. A cross-sectional study in the Spanish-Mediterranean population also found no association between the ACE I/D gene and hypertension, although the D allele was statistically linked to increased serum ACE activity (Martínez et al., 2000). Similarly, a study in the Perm region of Russia in 2022 reported a risk ratio of 1.87 (95% CI: 1.07–3.61), suggesting that the ACE I/D polymorphism may serve as a potential marker for susceptibility to essential hypertension (Starkova, Dolgikh, Kazakova, & Legostaeva, 2022). A large-scale analysis of data from 5.561 participants in the NHANES III survey found limited support for an association between the ACE I/D variant and blood pressure or hypertension across various racial and ethnic groups, although significant genotype-sex interactions were observed specifically in Mexican Americans. Overall, there was a notable lack of significant associations in most cases (Ned et al., 2012). In contrast, several previous studies have demonstrated a strong association between essential hypertension and the ACE I/D gene polymorphism. A case-control study conducted in Lorestan Province, Iran, in 2022 found that the II genotype increased the incidence of essential hypertension among 102 hypertensive patients and 104 healthy individuals (Hadian et al., 2022). In Gondar, Ethiopia, another case-control study conducted in 2022 discovered a high association between essential hypertension and both the D allele and DD genotype (Birhan et al., 2022). Additionally, a study involving 725 male steelworkers in China concluded that the DD genotype increased the risk of essential hypertension (X. Zhang et al., 2022). A meta-analysis conducted in 2020 on the Chinese population also concluded that the ACE I/D gene is associated with the development of essential hypertension (Xu, Chen, Li, Zhang, & Li, 2020). Furthermore, a systematic review and meta-analysis found that the D allele of the ACE gene is strongly associated as a risk factor for essential hypertension across Asian, Caucasian, and mixed populations (Liu, Yi, & Tang, 2021). The discrepancies in research findings may be attributed to several factors, including variations in sample size, ethnicity, environment, and lifestyle. This study had a limited sample size because certain factors that could bias hypertension results, such as kidney disease, diabetes mellitus, and alcohol use, were excluded. Future research should involve a larger sample size to account for broader demographic differences and ethnic diversity. Ethnic diversity worldwide significantly impacts research outcomes because genetic variations can lead to changes in the frequency distribution of ACE genotypes within each community (Burchard et al., 2003). Additionally, environmental factors and lifestyle variations within each ethnicity produce diverse and complex interactions that can affect research outcomes. Kuswara, et. al. GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 188 Lifestyle is one of the risk factors for hypertension, which includes exercise (Dida, Nayoan, & Sir, 2023), diet (Frisoli, Schmieder, Grodzicki, & Messerli, 2012), and stress levels (Bhelkar, Deshpande, & Mankar, 2019). Aerobic exercise influences blood pressure responses differently based on the ACE I/D genotype. In a study involving elderly hypertensive individuals, those with the D/D genotype exhibited impaired mean arterial pressure responses following exercise, particularly during sleep, as well as reduced heart rate variability and nitric oxide release (Moreira et al., 2018). High salt intake interacts with the ACE I/D polymorphism to affect blood pressure. A study on Japanese men found that high salt intake increased blood pressure in individuals with ID+II genotypes but not in those with DD genotypes. This interaction was more pronounced among overweight individuals, leading to diastolic blood pressure of 10.5 mmHg in those with ID+II genotypes compared to DD genotypes (L. Zhang et al., 2006). Diets high in potassium, soy protein, alpha-linolenic acid, and low in sodium can decrease ACE activity and potentially reduce hypertension risk. Conversely, diets high in sodium may increase ACE activity and contribute to higher blood pressure, especially among individuals with certain ACE I/D genotypes (Zambrano et al., 2023). Therefore, further research is needed to assess these factors comprehensively. This study aims to provide an evaluation for future researchers and create opportunities for subsequent studies to expand knowledge on related topics. 5. Conclusion In both the case and control groups, the ID genotype was the most commonly observed. Essential hypertension was not associated with genotype frequency. The case group exhibited a higher frequency of the I allele, while the control group had a higher frequency of the D allele. There was no significant association between essential hypertension and the frequency of a specific allele. Polymorphisms in the ACE I/D gene were not significantly associated with essential hypertension. Conflict of Interest The authors declare that they have no conflicts of interest relevant to the results presented. References Agustiani, Y., Anggie Nauli, H., & Masitha Arsyati, A. (2023). Hubungan antara Obesitas, Kebiasaan Merokok dan Aktivitas Fisik dengan Kejadian Hipertensi pada Lansia di Wilayah Kerja Puskesmas Gang Kelor. Promotor, 6(2), 141–149. https://doi.org/10.32832/pro.v6i4.277 Astutik, E., Puspikawati, S. I., Dewi, D. M. S. K., Mandagi, A. M., & Sebayang, S. K. (2020). Prevalence and Risk Factors of High Blood Pressure among Adults in Banyuwangi Coastal Communities, Indonesia. Ethiopian Journal of Health Sciences, 30(6), 941–950. https://doi.org/10.4314/ejhs.v30i6.12 Badan Penelitian Dan Pengembangan Kesehatan Kementerian Kesehatan RI. (2019). Laporan Riskesdas 2018 Nasional. In Kementerian Kesehatan Republik Indonesia. Jakarta: Lembaga Penerbit Badan Penelitian dan Pengembangan Kesehatan RI. Barley, J., Blackwood, A., Carter, N. D., Crews, D. E., Cruickshank, J. K., Jeffery, S., … Sagnella, G. A. (1994). Angiotensin converting enzyme insertion/deletion polymorphism. Journal of Hypertension, 12(8), 995. https://doi.org/10.1097/00004872- 199408000-00014 Bawazier, L. A., Sja’bani, M., Haryana, S. M., Soesatyo, M. H. N. E., & Sadewa, A. H. (2010). Relationship of angiotensin converting enzyme gene polymorphism and hypertension in Yogyakarta, Indonesia. Acta Medica Indonesiana, 42(4), 192–198. Bhelkar, S., Deshpande, S., & Mankar, S. (2019). Association between Stress and Hypertension among Adults More Than 30 Years: A Case-Control Study. National Journal of Community Medicine│Volume, 9(6), 430–433. Birhan, T. A., Molla, M. D., Abdulkadir, M., & Tesfa, K. H. (2022). Association of angiotensin-converting enzyme gene insertion/deletion polymorphisms with risk of hypertension among the Ethiopian population. PLoS ONE, 17(11 November), 1–14. https://doi.org/10.1371/journal.pone.0276021 Burchard, E. G., Ziv, E., Coyle, N., Gomez, S. L., Tang, H., Karter, A. J., … Pérez-stable, E. J. (2003). The Importance of Race and Ethnic Background in Biomedical Research and Clinical Practice. The New England Journal of Medicine, 348(12), 1170– 1175. Dida, G. Y., Nayoan, C. R., & Sir, A. B. (2023). The Risk Factors of Hypertension Among the Elderly in the Working Area of Sikumana Primary Health Care Center. Journal of Public Health for Tropical and Coastal Region, 6(1), 21–29. https://doi.org/10.14710/jphtcr.v6i1.17541 https://doi.org/10.32832/pro.v6i4.277 https://doi.org/10.4314/ejhs.v30i6.12 https://doi.org/10.1097/00004872-199408000-00014 https://doi.org/10.1097/00004872-199408000-00014 https://doi.org/10.1371/journal.pone.0276021 https://doi.org/10.14710/jphtcr.v6i1.17541 189 GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 Kuswara, et. al. Dinas Kesehatan Kabupaten Cirebon. (2021). Profil Kesehatan Kabupaten Cirebon Tahun 2021. Dinas Kesehatan Kabupaten Cirebon. Eleni, S., Dimitrios, K., Vaya, P., Areti, M., Norma, V., & Magdalini, G. (2008). Angiotensin-I converting enzyme gene and I/D polymorphism distribution in the Greek population and a comparison with other European populations. Journal of Genetics, 87(1), 91–93. https://doi.org/10.1007/s12041-008-0013-7 Frisoli, T. M., Schmieder, R. E., Grodzicki, T., & Messerli, F. H. (2012). Salt and hypertension: Is salt dietary reduction worth the effort? American Journal of Medicine, 125(5), 433–439. https://doi.org/10.1016/j.amjmed.2011.10.023 Hadian, B., Zafarmohtashami, A., Chaghervand, Z., & Nouryazdan, N. (2022). Angiotensin-converting enzyme gene insertion/deletion polymorphism and hypertension disease. Archives of Physiology and Biochemistry, 128(5), 1165–1169. https://doi.org/10.1080/13813455.2020.1762225 Hidayat, T., & Milenia Saputri, R. (2023). Hubungan Tingkat Ketergantungan Nikotin Dengan Tekanan Darah Pada Kelompok Perokok Laki-Laki Dengan Hipertensi. Jurnal Ilmu Kesehatan Insan Sehat, 11(2), 52–57. https://doi.org/10.54004/jikis.v11i2.135 Ishigami, T., Iwamoto, T., Tamura, K., Yamaguchi, S., Iwasawa, K., Uchino, K., … Ishii, M. (1995). Angiotensin I Converting Enzyme (ACE) Gene Polymorphism and Essential Hypertension in Japan. 7061(94), 95–97. Kumar, D. P. J., & Clark, M. L. (2021). Kumar and Clark’s Clinical Medicine (10th Ed; A. Feather, D. Randall, & M. Waterhouse, eds.). United Kingdom: Elsevier. Liu, M., Yi, J., & Tang, W. (2021). Association between angiotensin converting enzyme gene polymorphism and essential hypertension: A systematic review and meta-analysis. JRAAS - Journal of the Renin-Angiotensin-Aldosterone System, 22(1). https://doi.org/10.1177/1470320321995074 Martínez, E., Puras, A., Escribano, J., Sanchis, C., Carrión, L., Artigao, M., … Fernández, J. A. (2000). Angiotensin-converting enzyme (ACE) gene polymorphisms, serum ACE activity and blood pressure in a Spanish-Mediterranean population. Journal of Human Hypertension, 14(2), 131–135. https://doi.org/10.1038/sj.jhh.1000958 Moreira, S. R., Nóbrega, O. T., Santana, H. A. P., Sales, M. M., Farinatti, P. T. V., & Simões, H. G. (2018). Impacto del polimorfismo I/D del gen de la Enzima Conversora de la Angiotensina en la presión sanguínea, variacion de la frecuencia cardíaca y óxido nítrico en respuesta a ejercicios aeróbicos en mayores hipertensos. Revista Andaluza de Medicina Del Deporte, 11(2), 57– 62. https://doi.org/10.1016/j.ramd.2015.10.001 Mufaidah, S. (2019). Hubungan Imt, Usia Dan Kebiasaan Merokok Terhadap Kejadian Hipertensi Pada Nelayan Kub Pondok Layar. Journal of Community Mental Health and Public Policy, 1(2), 1–12. https://doi.org/10.51602/cmhp.v1i2.29 Muhadi. (2016). JNC 8 : Evidence-based Guideline Penanganan Pasien Hipertensi Dewasa. Cermin Dunia Kedokteran, 43(1), 54– 59. Ned, R. M., Yesupriya, A., Imperatore, G., Smelser, D. T., Moonesinghe, R., Chang, M. H., & Dowling, N. F. (2012). The ACE I/D polymorphism in US adults: Limited evidence of association with hypertension-related traits and sex-specific effects by race/ethnicity. American Journal of Hypertension, 25(2), 209–215. https://doi.org/10.1038/ajh.2011.182 Qadar Pasha, M. A., Khan, A. P., Kumar, R., Ram, R. B., Grover, S. K., Srivastava, K. K., … Brahmachari, S. K. (2002). Variations in angiotensin-converting enzyme gene insertion/deletion polymorphism in Indian populations of different ethnic origins. Journal of Biosciences, 27(1 SUPPL. 1), 67–70. https://doi.org/10.1007/bf02703684 Rahmadhani, M. (2021). Faktor-Faktor yang Mempengaruhi Terjadinya Hipertensi Pada Masyarakat di Kampung Bedagai Kota Pinang. Jurnal Kedokteran STM (Sains Dan Teknologi Medik), IV(I), 52–62. https://doi.org/10.30743/stm.v4i1.132 Rasyid, H., Bakri, S., & Yusuf, I. (2012). Angiotensin-converting enzyme gene polymorphisms, blood pressure and pulse pressure in subjects with essential hypertension in a South Sulawesi Indonesian population. Acta Medica Indonesiana, 44(4), 280–283. Rezqi, E. G., Fathana, P. B., & Dirja, B. T. (2023). Hubungan perilaku merokok dan obesitas dengan kejadian hipertensi pada guru sman di kota mataram. Intisari Sains Medis, 14(1), 237–242. https://doi.org/10.15562/ism.v14i1.1569 Sayed-Tabatabaei, F. A., Oostra, B. A., Isaacs, A., Duijn, C. M. Van, & Witteman, J. C. M. (2006). ACE Polymorphisms. Lippincott Williams & Wilkins, 1123–1133. https://doi.org/10.1161/01.RES.0000223145.74217.e7 Setiati, S., Alwi, I., Sudoyo, A. W., Simadibrata K, M., Setiyohadi, B., & Syam, A. F. (2014). Buku Ajar Ilmu Penyakit Dalam. In Interna Publishing (Edisi 6). Jakarta: Interna Publishing. Starkova, K. G., Dolgikh, О. V., Kazakova, О. А., & Legostaeva, Т. А. (2022). ACE I/D genetic polymorphism as a risk factor of essential hypertension. Health Risk Analysis, 7(3), 169–175. https://doi.org/10.21668/health.risk/2022.3.16.eng Sudayasa, I. P., Husdaningsih, F., & Alifariki, L. O. (2023). Polymorphism of Gene ACE I/D and Family History of Hypertension as the predisposition of Hypertension. Malaysian Journal of Medicine and Health Sciences, 18(2), 236–241. https://doi.org/10.47836/mjmhs.19.2.34 Tchelougou, D., Kologo, J. K., Karou, S. D., Yaméogo, V. N., Bisseye, C., Djigma, F. W., … Simpore, J. (2015). Renin-angiotensin system genes polymorphisms and essential hypertension in Burkina Faso, West Africa. International Journal of Hypertension, 2015. https://doi.org/10.1155/2015/979631 Tortora, G. J., & Derrickson, B. (2014). Principles of Anatomy and Physiology. In Physiotherapy (14th ed., Vol. 86). United States of America: John Wiley & Sons, Inc. https://doi.org/10.1016/s0031-9406(05)60992-3 Utami, S. L., Simamora, D., Idawati, I., & Widjaja, J. H. (2024). ACE I/D and A2350G Polymorphisms are Correlated with Body Mass Index, but Not with Body Weight and Essential Hypertension: Study in Javanese Postmenopausal Women. Molecular and Cellular Biomedical Sciences, 8(2), 96. https://doi.org/10.21705/mcbs.v8i2.426 Wang, L., Song, T. T., & Dong, C. W. (2023). Association between Interactions among ACE Gene Polymorphisms and Essential Hypertension in Patients in the Hefei Region, Anhui, China. Journal of the Renin-Angiotensin-Aldosterone System : JRAAS, 2023, 1159973. https://doi.org/10.1155/2023/1159973 https://doi.org/10.1007/s12041-008-0013-7 https://doi.org/10.1016/j.amjmed.2011.10.023 https://doi.org/10.1080/13813455.2020.1762225 https://doi.org/10.54004/jikis.v11i2.135 https://doi.org/10.1177/1470320321995074 https://doi.org/10.1038/sj.jhh.1000958 https://doi.org/10.1016/j.ramd.2015.10.001 https://doi.org/10.51602/cmhp.v1i2.29 https://doi.org/10.1038/ajh.2011.182 https://doi.org/10.1007/bf02703684 https://doi.org/10.30743/stm.v4i1.132 https://doi.org/10.15562/ism.v14i1.1569 https://doi.org/10.1161/01.RES.0000223145.74217.e7 https://doi.org/10.21668/health.risk/2022.3.16.eng https://doi.org/10.47836/mjmhs.19.2.34 https://doi.org/10.1155/2015/979631 https://doi.org/10.1016/s0031-9406(05)60992-3 https://doi.org/10.21705/mcbs.v8i2.426 https://doi.org/10.1155/2023/1159973 Kuswara, et. al. GHMJ (Global Health Management Journal) 2024, Vol. 7, No. 4 190 Wang, X., Wang, S., Lin, R., Jiang, X., Cheng, Z., Turdi, J., … Wen, H. (2004). GNB3 gene C825T and ACE gene I/D polymorphisms in essential hypertension in a Kazakh genetic isolate. Journal of Human Hypertension, 18(9), 663–668. https://doi.org/10.1038/sj.jhh.1001700 World Health Organization. (2023). Hypertension. Retrieved January 10, 2024, from World Health Organization website: https://www.who.int/news-room/fact-sheets/detail/hypertension World Health Organization. (2024). Global Health Estimates: Life expectancy and leading causes of death and disability. Retrieved January 10, 2024, from World Health Organization website: https://www.who.int/data/gho/data/themes/mortality-and- global-health-estimates Xu, J., Chen, J., Li, Y., Zhang, D., & Li, X. (2020). Association of angiotensin-converting enzyme gene insertion/deletion polymorphism and obstructive sleep apnoea in a Chinese population: A meta-analysis. JRAAS - Journal of the Renin- Angiotensin-Aldosterone System, 21(2). https://doi.org/10.1177/1470320320934716 Zambrano, A. K., Cadena-Ullauri, S., Guevara-Ramírez, P., Ruiz-Pozo, V. A., Tamayo-Trujillo, R., Paz-Cruz, E., … Doménech, N. (2023). Genetic diet interactions of ACE: the increased hypertension predisposition in the Latin American population. Frontiers in Nutrition, 10(October). https://doi.org/10.3389/fnut.2023.1241017 Zhang, L., Miyaki, K., Araki, J., Song, Y., Kimura, T., Omae, K., & Muramatsu, M. (2006). Interaction of angiotensin I-Converting enzyme insertion-deletion polymorphism and daily salt intake influences hypertension in Japanese men. Hypertension Research, 29(10), 751–758. https://doi.org/10.1291/hypres.29.751 Zhang, X., Wang, Y., Zheng, Y., Yuan, J., Tong, J., Xu, J., … Li, X. (2022). Effect of ACE, ACE2 and CYP11B2 gene polymorphisms and noise on essential hypertension among steelworkers in China: a case–control study. BMC Medical Genomics, 15(1), 1–10. https://doi.org/10.1186/s12920-022-01177-0 Zhang, Y., Shi, F., Yu, Z., Yang, A., Zeng, M., Wang, J., … Ma, X. (2019). A cross-sectional study on factors associated with hypertension and genetic polymorphisms of renin-angiotensin- aldosterone system in Chinese hui pilgrims to hajj. BMC Public Health, 19(1223), 1–11. https://doi.org/10.1186/s12889-019-7357-1 Cite this article as: Kuswara, H. N., Nauphar, D., & Sari, A. I. P. (2024). Angiotensin-Converting Enzyme Insertion/Deletion (ACE I/D) Gene Polymorphism as a Risk Factor for Essential Hypertension. GHMJ (Global Health Management Journal), 7(4), 180–190. https://doi.org/10.35898/ghmj-741044 https://doi.org/10.1038/sj.jhh.1001700 https://www.who.int/news-room/fact-sheets/detail/hypertension https://doi.org/10.1177/1470320320934716 https://doi.org/10.3389/fnut.2023.1241017 https://doi.org/10.1291/hypres.29.751 https://doi.org/10.1186/s12920-022-01177-0 https://doi.org/10.1186/s12889-019-7357-1 https://doi.org/10.35898/ghmj-741044