Global Journal of Education and Allied Research (GJEAR) Volume.13, Number 9; September-2022; ISSN: 2837-3707 | Impact Factor: 6.79 https://zapjournals.com/Journals/index.php/gjear Published By: Zendo Academic Publishing pg. 11 PROBING INTO THE GENETIC ATTRIBUTES OF PATHOGENIC BACTERIA IN FERMENTED MEAT PROVISIONS 1Dr. Amira Samir Mahmoud, 2Prof. Ahmed Hassan Ibrahim and 3Dr. Yasmine Ahmed El- Masry Article Info Abstract Keywords: foodborne pathogens, foodborne illness, disease outbreak, foodborne infection, foodborne intoxication. Foodborne pathogens are microbial agents that can trigger instances of foodborne illness, leading to disease outbreaks with significant public health and economic implications. The occurrence of multiple similar illnesses resulting from the consumption of contaminated food characterizes a foodborne disease outbreak. Over 200 distinct foodborne diseases have been recognized, each posing a unique threat to human health. These diseases encompass both foodborne infections, characterized by a longer incubation period, and foodborne intoxications, marked by a more rapid onset of symptoms. In foodborne infections, pathogens ingested with food establish themselves within the human host, while in foodborne intoxications, toxins produced by pathogens in food are ingested, causing illness. The consumption of foods contaminated with pathogenic microorganisms and their toxins contributes to fatalities, illnesses, hospitalizations, and economic burdens. Particularly, gastrointestinal infections resulting from foodborne diseases have a pronounced adverse impact on human well-being. Recognizing the significance of foodborne illnesses and their diverse manifestations is vital for effective prevention and control strategies. This paper sheds light on the various aspects of foodborne diseases, their classification, and the significant consequences they impose on individuals and society. 1. Introduction Foodborne pathogens are biological agents that can cause a foodborne illness event. A foodborne disease outbreak has defined the occurrence of two or more cases of a similar illness resulting from the ingestion of a typical food 1Department of Botany & Microbiology, Faculty of Science, Assiut University, Egypt 2Department of Food Hygiene, Faculty of Veterinary Medicine, Assiut University, Egypt 3Molecular Biology Center, Assiut University, Egypt https://zapjournals.com/Journals/index.php/gjear Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 12 (CDC, 2012). More than 200 foodborne diseases have been identified (Mead et al., 1999). Foodborne illness occurs when a pathogen is ingested with food, establishes itself and multiplies in the human host, or produces a toxin that the human host then ingests. Thus, foodborne illness is classified into foodborne infection and foodborne intoxication. In foodborne infections, the time from ingestion of the human host until symptoms occur is much longer than foodborne intoxications (Bintsis, 2017). The consumption of foods contaminated with foodborne pathogenic microorganisms and microbial toxins is responsible for deaths, illnesses, hospitalization, and economic losses. Due to their widespread nature, foodborne diseases (FBD), especially gastrointestinal infections, negatively affect human health (Abd El-Aziz, 2015). Bacteria and fungi usually contaminate meat and meat products. Foodborne pathogenic bacteria as Salmonella, Shigella, Escherichia, Listeria, Clostridium, and Vibrio and their toxins have been health problems (Abd El-Aziz and Yousef, 2017, Abd El Aziz and Yousef, 2018). Salmonella spp., S. aureus, E. coli O157: H7 and L. monocytogenes are the predominant bacteria species that cause public health problems worldwide, and they are the primary pathogens involved in food poisoning (Lei et al., 2008). The presence of pathogenic bacteria such as Salmonella, Listeria monocytogenes, E. coli, and toxigenic fungi in foods poses a poisoning threat (Darwish et al., 2008). As well, the growth of bacteria can lead to organoleptic changes in food, including off-colors and off- odors, rendering it unacceptable to the human consumer (Duffy et al., 2006). Several PCR tests for detecting pathogens in foods have been validated, harmonized, and commercialized to make PCR, a standard tool used by food microbiology laboratories (Maurer, 2011; Postollec et al., 2011). PCR based on oligonucleotide primers has been developed quickly and more quickly than the bacterial culture (Abd El-Aziz, 2013). So, the main objective of this study was to detect the prevalence of foodborne pathogenic bacteria in fermented meat products. To confirm the identification of the bacterial isolates, the DNA lysate of pure colonies was amplified by PCR- based method using specific primers for each genus. 2. Materials and Methods 2.1. Collection of meat product samples Twenty fermented meat products: Hotdog, pepperoni, salami, sausage, and luncheon (four from each) were included in the study. These samples were purchased from different Assiut cities, Egypt, and collected from September to December 2018. The samples were transferred in an icebox to the laboratory and kept frozen until microbiological analyses for pathogenic bacteria. The following primers, which were used to PCR-amplify specific genes, were synthesized by Invitrogen, Germany (Table 1). Table 1: Primer nucleotide sequences for amplification of target genes from isolated foodborne pathogenic bacteria. Primer Name Bacterial strain Amplifie d product [bp] Characteristi cs Annealing Ta Primer Sequence 5`- 3` F .FLICH 7 R FLICH 7 E. coli 0157:H7 247 48 °C TACCATCGCAAAAGCAACTCC- GTCGGCAACGTTAGTGATACC- Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 13 907R 27F Listeria 900 48 °C CCGTCAATTCCTTTGAGTTTAGAGTTTGATCCTGGC TCAG- hIyA-F hIyA-R Listeria monocytogen es 200 48 °C CCGTGCGCCCTTTCTAACTT- TTTGTTCAGTTTTGAGAGGT- ST11-F ST15-R Salmonella 429 48 °C GCCAACCATTGCTAAATTGGCGCA- GGTAGAAATTCCCAGCGGGTACTG G- F-16S R-16S S. aureus 228 52 °C GTAGGTGGCAAGCGTTATCC- CGCACA TCA GCG TCA G- mecA1 mecA2 S. aureus mecA 532 50 °C AAAATCGATGGTAAAGGTTGC- AGTTCT GCA GTA CCG GAT TTGC- 2.2. Isolation procedures of foodborne pathogenic bacteria 2.2.1. Isolation of Enterohemorrhagic E. coli O157:H7 Each meat sample was enriched at a 1:10 ratio in Vancomycin Trypticase Soy Broth (VTSB) and shaked for 2 min in stomacher then incubated for 24 h at 37 °C (Samadpour et al., 2002; Ethelberg et al., 2009). One loopful from each enrichment VTSB culture was streaked on Sorbitol MacConkey agar plates then incubated at 37 °C for 24 h. E. coli O157:H7 colonies are sorbitol negative (appear pale yellow as compared with pink sorbitol positive). 2.3. Biochemical reactions of E. coli O157:H7 2.3.1. Sugar fermentation test The pure culture of E. coli O157:H7 inoculated in peptone water contains 1% sorbitol using phenol red as an indicator, and then incubated at 37 °C for 24 h (Cowan and Steel., 1974). The appearance of no yellow color could not ferment sorbitol and be suspected to be E. coli O157:H7. 2.3.2. Isolation of Listeria spp. Each meat sample was enriched at a 1:10 ratio in Listeria Enrichment Broth (LEB) and shaked for 2 min, then incubated at 35 °C for 48 h. A Loopful from LEB culture was streaked on oxford agar plates and incubated at 35 °C for 48 h. Gray colonies with black centers were suspected to be Listeria spp. were picked up onto nutrient agar slants for further confirmation. 2.3.3. Isolation of Salmonella spp. Each meat sample was pre-enriched at a 1:10 ratio in lactose broth and blended for 2 min in stomacher, then incubated at 35 °C for 24 h. For enrichment, after incubation, the mixture was shaken well, and 1 mL was transferred to a sterile test tube containing 10 mL Rappaport Vassiliadis broth (R.V broth), then incubated at 35 °C for 24 h. A loopful from enrichment R.V broth culture was streaked on the surface of Salmonella-Shigella agar plates, and then the plates were incubated at 37 °C for 24 h. The small colorless colony with a black center was picked up onto nutrient agar slants to confirm Salmonella (APHA, 1992). 2.3.4. Isolation of Staphylococcus aureus Sodium chloride 10% broth tubes (Finegold and Martin, 1982) were inoculated with an appropriate amount from each prepared sample. Inoculated tubes were incubated at 37 °C for 24 h. Loops from incubated tubes were streaked on mannitol salt agar (MSA) plates (Finegold and Martin, 1982). Inoculated plates were incubated at 37 °C for 24 h. Mannitol fermented colonies (surrounded by yellow halo) were picked up onto nutrient agar slants for further confirmation. Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 14 2.3.5. Identification of foodborne pathogenic bacteria The bacterial isolates were identified based on morphological examination include colony characteristics, shape, spore, motility, Gram’s reaction and growth on differential medium (MacConkey agar, Endo agar medium). The bacterial identification was carried out following the standard methods described in Bergey’s Manual of Determinative Bacteriology (Holt et al., 1994). 2.4. Molecular identification 2.4.1. Bacterial lysis and DNA extraction A single colony of each isolate was picked and suspended in 200 μL of nuclease-free distilled water. After vortexing, the suspension was boiled for 5 min followed by snap chilling on ice for 10 min. 50 μL of the supernatant was collected after centrifuging for 10 min at 10956 × g. It was used as a template for PCR reactions. The concentration of DNA was measured using spectrophotometer Gene Quant1300 (Ali and Yousef, 2014). 2.4.2. Primers and PCR amplification Specific primers were used for the amplification of each isolated foodborne pathogenic bacteria. The primer fliCH7was specific for E. coli O157:H7 (Samadpour et al., 2002; Wang et al., 2002). The primer16SrRNA gene was used for the detection of the Listeria genus. In addition, specific primers of the hemolysin (hlyA) gene were used to detect L. monocytogenes isolates (Sanlibaba et al., 2018). The primer ST11-ST15 was specific for the genus Salmonella (Soumet et al., 1999). The primer mecA gene was used for the detection of methicillin resistance (MRSA) of S. aureus (Khan et al., 2012) (Table 1). The polymerase chain reaction was done by using a total volume of 25 µL. The optimal amplification reaction mixture contained 12.5 µL of master mix, 1 µL of forwarding primer (10 pmoL),1 µL of reverse primer (10 pmoL), 5 µL of DNAase and RNAse free water by using Deionizer water (Millipore-Direct-Q UV) and 5 µL of DNA (bacterial lysate). Go Taq ®Green Master mix is a premixed ready to use solution (Promega, USA): 608-274-4330 was used. PCR was carried out in a thermal cycler (Biometra, German). The PCR products were separated on 1% agarose gel containing ethidium bromide at 100 volts for 1 hour. The results were analyzed by UV illuminator (viberloumat) and photographed by Gel documentation system, including Bio-Doc Analyze (BDA) software (Biometra) for measuring and analyzing the PCR products. 3. Results and Discussion 3.1. Morphological identification of E. coli O157:H7 Examination of fermented meat samples revealed that one sample of 20 samples was positive for E. coli O157:H7 (Figure 1A). It was isolated from luncheon samples. It appears as Gram-negative short rods and facultative anaerobe. It can grow on sorbitol MacConkey agar medium. E. coli O157:H7 do not ferment sorbitol (colorless colony) (Cowan and Steel, 1974) (Figure 1A). Sheikh et al. (2013) isolated E. coli O157:H7 from ground beef hamburger. Also, E. coli O157:H7 was isolated by Chinen et al. (2001) from hamburger and ground beef. 3.2. Molecular identification of E. coli O157:H7 For confirming the identity of isolated E. coli O157:H7, the amplification PCR results of the target gene for Shiga toxinproducing Escherichia coli (STEC), E. coli O157:H7 was used to confirm the isolated colony. Specific PCR was used to determine the identities of E. coliO157:H7 through amplification of fliCH7 band gene fragments for E. coli O157:H7. Figure (1B) showed agarose (1%, w/v) gel indicating fliCH7 band gene fragments generated by PCR using genomic DNA extracted from E. coli O157:H7 isolated from luncheon. Gel electrophoresis of PCR products revealed the desired 247 bp fragment for the fliCH7 band. Abd El-Aziz (2015) found that 12 out of 90 meat-based sandwiches contain portions of rfb (O-antigen-encoding) regions of E. coli STEC serogroups O157 and O111. Also, Pavithra and Ghosh (2013) found 36 out of 215 samples from meat shops, fast foods, and fish stalls samples (16.7%) were identified with E. coli; 12 out of 100 samples were from fast foods. Out of 36 E. coli Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 15 positive samples, nine (25%) possessed the gene encoding Shiga toxin (stx1) gene, including two samples from fast food (Baschera et al., 2019) as well as Hessain et al. (2015) isolated E. coli O157:H7 from beef burgers and chicken burgers. While Rasheed et al. (2014) and Ozbey et al. (2017) could not isolate STEC pathogen from the examined street vended samples, they stated that efficient cooking and other suitable hygienic prophylactic measures are needed decrease the incidence of STEC in food items. B Figure 1. A; Streaking of E. coli O157:H7 on sorbitol MacConkey agar media. B; 1% agarose gel electrophoresis of PCR products to detect E. coli O157:H7 gene fliCH7: Lane 1: DNA Marker; Lane 2: PCR product of E. coli O157:H7 at 247 bp. Escherichia coli are essential intestinal microbiota of humans and warm-blooded mammals. While E. coli typically harmlessly colonizes the intestinal tract, several E. coli strains can cause a variety of diseases within the intestinal tract and elsewhere in the host. The strains that because enteric infections are called diarrheagenic or pathogenic E. coli strains (Duffy et al. 2006; Abd El-Aziz, 2015). A strain O157:H7 of E. coli, one that expressed O-antigen 157 and H-antigen 7, was shown to belong to a category of E. coli that produce toxins similar to Shiga toxin of Shigella dysenteriae and distinct from E. coli heat-stable and heat-labile toxins. Strain O157:H7 is estimated to cause 63,000 illnesses, 2,100 hospitalizations, and 20 deaths each year (Scallan, 2011). The principal reservoir for this zoonotic pathogen is the intestinal tract of cattle, and other animals may also serve as reservoirs. Transmission of E. coli O157:H7occurs when food or water contaminated with feces of infected animals or humans is consumed. Contamination of animal products often occurs during the slaughter and processing of animals or cattle manure as fertilizer for crops (Garcia et al., 2010). E. coli can survive for long periods in the environment and proliferate in vegetables and other foods (Garcia et al., 2010). 3.3. Isolation and molecular identification of Salmonella spp. Salmonella spp. was isolated from two samples of chicken luncheon. It appears as a small colorless colony with a black center, Gram-negative short rods. The amplification PCR results of the target gene set for genus Salmonella confirmed the desired 429 bp fragment (Figure 2). Also, Tarabees et al. (2017) and Fahim et al. (2019) isolated Salmonella spp. from chicken meats. Salmonella typhimurium was isolated from chicken carcass meat and molecularly identified (Abd El-Aziz, 2013). Also, Ozbey et al. (2017) isolated Salmonella spp. from sausage. A Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 16 Figure 2. DNA gel electrophoresis on 1% agarose gel showing the PCR products: Lane 1: DNA size marker; lanes 2 & 3 PCR products of Salmonella spp. at 429 bp. Salmonella spp, one group of Enterobactericiae, has pathogenic characteristics and is considered one of the most common causes of enteric infections (food poisoning) worldwide. Salmonella spp. lives in the intestines of most livestock and many wild animals. Salmonella spp. infection usually occurs when a person eats food contaminated with the feces of infected animals or humans. Salmonella outbreaks are commonly associated with meat, poultry, and eggs, but these bacteria can also contaminate other foods such as fruits and vegetables (Abd El-Aziz, 2013). Poultry products have consistently topped the incidence of salmonellosis in many developing countries, including India, Egypt, Brazil, and Zimbabwe (Yang et al., 2011). Contamination with Salmonella in poultry products can occur at multiple steps along the food chain, including processing, handling, preparation production, distribution, and retail marketing (Dookeran et al., 2012). 3.4. Listeria monocytogenes Listeria monocytogeneswas isolated from two samples of sausage. The genus of Listeria appears as Gram-positive short rods bacteria. 3.5. Molecular identification of L. monocytogenes The amplification PCR results of the target genes for Listeria spp. were used to confirm the isolated colony. A total of 20 samples were examined for the presence of Listeria spp. Two samples of sausage were identified as Listeria spp. (Figure 3A). The amplification results of the target gene for the identification of Listeria spp. showed that 2 samples from 20 samples were defined as Listeria monocytogenes (Figure 3B). Hosseini et al. (2014) and Natratilova et al. (2004) isolated Listeria monocytogenesfrom sausages, salami, and burgers meat products. Ozbey et al. (2017) isolated Listeria sp. from sausage, salami, and sosis. Meloni (2015) reported that L. monocytogenesis among the most frequently detected pathogens in dry fermented sausages. Also, Bohaychuk et al. (2006) isolated Listeria monocytogenes from fermented sausages. B A Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 17 Figure. 3. A-PCR results of 16S rRNA gene for the detection of Listeria spp. Lane 1: DNA Marker; lanes 2, 3 amplification of Listeria spp. at 900 bp. B; 1% agarose gel electrophoresis showing the PCR results: Lane 1: DNA Marker; Lanes 2, 3 PCR products hly gene of Listeria monocytogenes at 200 bp. Listeria monocytogenesis one of the leading causes of death from foodborne pathogens, especially in newborns, pregnant women, the elderly, and immuno-compromised individuals. The bacteria Listeria spp have been found in various raw foods, such as vegetables, uncooked meats, and contaminated foods after cooking or processing. It causes meningitis, septicemia and gastroenteritis (Ferreira et al., 2014; Buchanan, 2017). Listeriosis is a severe infection usually caused by eating food contaminated with L. monocytogenes. Although it is a relatively rare disease with a high mortality rate (20-30%), it is one of the deadliest food-borne threats (Jemmi and Stephen, 2006). Unlike many other pathogenic bacteria, Listeria multiplies in cold environments such as refrigerators and has tolerance to freezing temperature, high salt, and low pH (Ghandhi and Chikindas, 2007; Raheem, 2016). Ready-To-Eat (RTE) foods pose a higher risk for listeriosis as they are ingested without any further processing, such as cooking, that could kill L. monocytogenes (Raheem, 2016). 3.6. Staphylococcus aureus Out of 20 samples, S. aureus was isolated from 6 samples of chicken luncheon and sausage (three from each). S. aureus is nonmotile, Gram-positive cocci that appear singly or in pairs, tetrads, short chains, or characteristic "grapelike" clusters and facultative anaerobes. All S. aureus samples were tested for the presence of the 16S rRNA gene in order to ensure the correct interpretation of toxin-negative isolates. Detection of the mecA gene by the polymerase chain reaction is considered the ''Gold standard'' in MRSA diagnosis. The primer mecA gene was used for the detection of methicillin resistance of S. aureus. A B Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 18 Figure 4. A: PCR results of 16S rRNA gene for the detection of S. aureus Lane 1: DNA Marker; lanes 2 to 7 amplification of S. aureus. B: Electrophoresis on 1% agarose gel showing the PCR results: Lane 1: DNA Marker; Lane7: MecA of S. aureus 3.7. Molecular identification of S. aureus The amplification PCR results of the target genes for S. aureus was used to confirm the isolated colony. A total of 20 samples were examined for the presence of S. aureus. Six samples were identified as S. aureus (Figure 4A). The amplification results of the target gene for the identification of S. aureus showed that one sample from 20 samples defined as S. aureus contains mecA gene, which was isolated from sausage (Figure 4B). S. aureus was isolated from the beef burger and sausage (Mohammad et al., 2018). Bacon and Sofos (2003) reported that S. aureus was recorded in pork, ground beef, sausage, ground turkey. Most Staphylococcal food poisoning cases being traced to food contamination during preparation because of inadequate refrigeration, inadequate cooking or heating, or poor personal hygiene (Bacon and Sofos, 2003). After ingestion of the enterotoxin and an incubation period of less than 6 and up to 10 h, symptoms may include headache, vomiting, nausea, abdominal cramps, dizziness, chills, perspiration, general weakness, muscular cramping and prostration, and diarrhea that may or may not contain blood (Bacon and Sofos, 2003). S. aureus in food is considered a public health hazard because of its ability to produce enterotoxin and the subsequent risk of food poisoning. They are challenging to inactivate with heat because temperatures required to inactivate them are higher than those needed to kill the organism (Bacon and Sofos, 2003). S. aureus is considered one of the most resistant non-spore-forming pathogens (FDA, 2012). 4. Conclusion The results showed the moderate incidence of foodborne pathogenic bacteria in the examined meat samples, and greater emphasis should be applied in prevention and control of contamination during processing for reducing foodborne risk for consumers. Also, the results cleared that PCR is an ideal method for identifying foodborne pathogenic bacteria, as it was effective, more sensitive, reduces effort and time. PCR can be used as a diagnostic tool to correct foodborne pathogenic bacteria from meat samples. Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 19 Acknowledgment Authors would thanks to Research Finance Unit, Faculty of Science, Assiut University, Egypt, for their funding of this research. Conflict of interest We declare that we have no conflict of interest. ORCID ID Naeima M. H. Yousef: https://orcid.org/0000-0002-6327-141X Doaa M. Abd El- Aziz: https://orcid.org/0000-0002-3075-4968 Martina A. Mansour: https://orcid.org/0000-0002-8134-3157 References American Public Health Association (APHA, 1992). Standard methods for the examination of dairy products. 16th Ed., American Public Health Association, New York. Abd El-Aziz, D.M. (2013). Detection of Salmonella typhimuriumin retail chicken meat and chicken giblets. Asian Pacific Journal of Tropical Biomedicine, 3(9), 678-681. Abd El-Aziz, D. (2015). Prevelance of E. coli with special concern to shiga-toxigenic E. coli O157 and O111 in street-vended sandwiches. Annals. Food Science and Technology, 16(1), 257-261. Abd El-Aziz, D. & Yousef, N. (2017). Antimicrobial effects of calcium oxide nanoparticles and some spices in minced meat. ARC Journal of Animal and Veterinary Sciences, 3(2), 38-45. Abd El-Aziz, D. & Yousef, N. (2018). Enhancement of antimicrobial effect of some spices extracts by using biosynthesized silver nanoparticles. International Food Research Journal, 25(2), 589-596. Ali, Y. & Yousef, N. (2014). Detection and characterization of bacteriophages attacking dairy Streptococcus thermophilus starter cultures. African Journal of Microbiology Research, 7(27), 2598-2603. Bacon, R.T. & Sofos, J.N. (2003). Characteristics of Biological Hazards in Foods, In: Schmidt, R.H., Rodrick, G.E., Editors, Food Safety Handbook, New Jersey: John Wiley & Sons, Inc., p.157-195. Baschera, M., Cernela, N., Stevens, M.J.A., Liljander, A., Jores, J., Corman, V.M., Nüesch-Inderbinen, M. & Stephan, R. (2019). Shiga toxin-producing Escherichia coli (STEC) isolated from fecal samples of African dromedary camels. One Health, 7, 100087. Bintsis, T. (2017). Foodborne pathogens Review. AIMS Microbiology, 3(3), 529-563. Bohaychuk, V.M., Gensler, G.E., King, R.K., Manninen, K.I., Sorensen, O., Wu, J.T., Stiles, M.E. & Mcmullen, L.M. (2006). Occurrence of pathogens in raw and ready-to-eat meat and poultry products collected from the retail marketplace in Edmonton, Alberta, Canada. Journal of Food Protection, 69(9), 2176-2182 Buchanan, R.L., Goris, L.G.M., Hayman, M. M., Jackson, T.C. & Whiting, R.C. (2017). A review of Listeria monocytogenes: An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control, 75, 1-13. https://orcid.org/0000-0002-8134-3157 https://orcid.org/0000-0002-8134-3157 https://orcid.org/0000-0002-8134-3157 https://orcid.org/0000-0002-8134-3157 https://orcid.org/0000-0002-8134-3157 https://orcid.org/0000-0002-8134-3157 https://orcid.org/0000-0002-8134-3157 Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 20 CDC, (2012). What is a foodborne disease outbreak, and why do they occur. https://www.cdc.gov/foodsafety/foodbornegerms.html (accessed on July 2021) Chinen, I., Tanaro J., Miliwebsky, E. & Lound, L. (2001). Isolation and characterization of Escherichia coli O157:H7 from retail meats in Argentina. Journal of Food Protection, 64 (9), 1346-1351. Cowan, S.T., & Steel, K.J. (1974). Manual for the identification of medical bacteria, 2nd edn. Revised by S.T. Cowan. Cambridge, UK: Cambridge University Press. Darwish, S., Yousef, N. & Ismail, M. (2008). Microbiological quality and elemental analysis of some ready-to- eat meat products. Journal of Agricultural Science, Mansoura University, 33(8), 5601-5613 Dookeran, M.M., Baccus-Taylor, G.S., Akingbala, J.O., Tameru, B. & Lammerding A.M. (2012). Transmission of Salmonellaon broiler chickens and carcasses from production to retail in Trinidad and Tobago. Journal of Agriculture and Biodiversity Research, 1(5), 78-84. Duffy, G., Cummins, E., Nally, P., Brien, S.O. & Butler, F. (2006). A review of quantitative microbial risk assessment in the management of Escherichia coli O157:H7 on beef. Meat Science, 74, 76-88. Ethelberg, S., Smith, B., Torpdahl, M., Lisby, M., Boel, M., Jensen, T. & Molbak, K. (2009). Outbreak of non- O157 Shiga toxinproducing Escherichia coli infection from consumption of beef sausage. Clinical Infectious Diseases, 48, 78-81. Fahim, A.T., Bouzia, Z., Branham, K.H., Kumaran, N., Vargas, M.E., Feathers, K.L., Perera, N.D., Young, K., Khan, N.W., Heckenlively, J.R., et al. (2019). Detailed clinical characterization, unique features, and natural history of autosomal recessive RDH12-associated retinal degeneration. British Journal of Ophthalmology, 103(12), 1789-1796. FDA, (2012). Bad Bug Book, Foodborne Pathogenic Microorganisms and Natural Toxins, Second Edition. Ferreira, V., Wiedmann, M., Teixaira, P. & Stasiewicz, M.J. (2014). Listeria monocytogenes persistence in food- associated environments: Epidemiology, strain characteristics, and implications for public health. Journal of Food Protection, 77(1), 150-170. Finegold, S.M. & Martin, W.J. (1982). Diagnostic microbiology, 6th Edition, C.V. Mosby Co. St. Louis, Toronto, London. Garcia, A., Fox, J.G. & Besser, T.E. (2010). Zoonotic enterohemorrhagic Eschericia coli: A one health perspective. ILAR Journal, 51 (3), 221-232 Ghandhi, M. & Chikindas, M.L. (2007). Listeria: A foodborne pathogen that knows how to survive. International Journal of Food Microbiology, 113, 1-15. Hessain, A.M., Al-Arfaj, A.A., Zakri, A.M., El-Jakee, J.K., Al-Zogibi, O.G., Hemeg, H.A. & Ibrahim, I.M. (2015). Molecular characterization of Escherichia coli O157:H7 recovered from meat and meat products relevant to human health in Riyadh, Saudi Arabia. Saudi Journal of Biological Sciences, 22(6), 725-729. Global Research Journal of Management and Social Sciences (GRJMSS) Vol. 13 (9) pg. 21 Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T. & Williams, S.T. (1994). Bergey’s Manual of Determinative Bacteriology, 9th ed., Williams and Wilkins, Maryland, U.S.A Hosseini, A., Sharifan, A. & Akram, T. (2014). Isolation of Listeriamonocytogenes from Meat and Dairy Products. Journal of Medical Microbiology and Infectious Diseases, 2(4), 159-162. Jemmi, T. & Stephen, R. (2006). Listeria monocytogenes: food-borne pathogen and hygiene indicator. Revue Scientifique et Technique, 25, 571-580. Khan, S., Preetha, A., Shetty, K. J., Lakshmi Sarayu Y., Chidambaram, A. & Ranganathan, R. (2012). Detection of mec A genes of Methicillin-Resistant Staphylococcus aureus by Polymerase chain reaction. International Journal of Health and Rehabilitation Sciences, 1(2), 64-68. Lei, M.I.-F, Roffey, P., Blanchard, C. & Gu, K. (2008). Development of a multiplex PCR method for the detection of six common foodborne pathogens. Journal of Food and Drug Analysis, 16(4), 37-43. Maurer, J. (2011). Rapid detection and limitations of molecular techniques. Annual Review of Food Science and Technology, 2, 259-79. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M. & Tauxe, R.V. (1999). Food-related illness and death in the United States. Emerging Infectious Diseases, 5(5), 607-625. Meloni, D. (2015). Presence of Listeria monocytogenesin Mediterranean-Style dry fermented sausages. Foods, 4, 34-50. Mohammad, A., Nossair, H. Ibrahim, A., Khalifa, E. & Abo Yussef, H. (2018). Staphylococcus aureus isolated from raw meat products and food handlers: prevalence, antimicrobial susceptibility, and molecular characterization. Life Science Journal, 15(6), 13-21. https://pubmed.ncbi.nlm.nih.gov/?term=Maurer+JJ&cauthor_id=22129383 https://pubmed.ncbi.nlm.nih.gov/?term=Maurer+JJ&cauthor_id=22129383 https://pubmed.ncbi.nlm.nih.gov/?term=Maurer+JJ&cauthor_id=22129383 J. Multidiscip. Sci. 2021, 3(2),1-12. 22 of 12 pg. 22 Page Natratilova, P., Schlegelova, J., Sustackova, A., Napravnikova, E. & Lukasola, J. (2004). Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinary Medicine- Czech, 49, 243-152. Ozbey, G., Ozbey, U. & Kok, F. (2017). Seasonal prevalence of Escherichia coli O157:H7, Listeria spp. and Salmonella spp. in Sausages, Sosis, and Salami in Elazig, Turkey. Pakistan Veterinary Journal, 37(3), 364-367. Pavithra, M. & Ghosh, A.R. (2013) Multidrug-Resistant stx1 Harboring Escherichia coli from Meat Shop and Fast Food. Journal of Food Safety, 33(4), 453-460. Sanlibaba, P., Tezel, B.U. & Cakmak, G.A. (2018). Detection of Listeria spp. in raw milk and dairy products retailed in Ankara. GIDA The Journal of Food, 43(2), 273-282. Postollec, F., Falentin, H., Pavan, S., Combrisson, J. & Sohier, D. (2011). Recent advances in quantitative PCR (qPCR) applications in food microbiology. Food Microbiology, 28(5), 848-861. Raheem, D. (2016). Outbreaks of listeriosis associated with deli meats and cheese: an overview. AIMS Microbiology, 2, 230-250. Rasheed, M.U., Kaiser, J., Thajuddin, N., Pasupuleti, M., Parveez, A. & Muthukumaresan, K.P. (2014). Distribution of the stx1, stx2, and hlyAgenes: Antibiotic profiling in Shiga-toxigenic E. coli strains isolated from food sources. International Journal of Current Microbiology and Applied Sciences, 3(5), 348-361. Samadpour, M., Kubler, M., Buck, F.C., Depavia, G.A., Mazengia, E., Stewart, J., Yang, P. & Alfi, D. (2002). Prevalence of Shiga toxin-producing Escherichia coli in ground beef and cattle feces from King County, Washington. Journal of Food Protection, 65, 1322-1325. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.-A., Roy, S.L., Jones, J.L. & Griffin, P.M. (2011). Foodborne illness acquired in the United States-major pathogens. Emerging Infectious Diseases, 17(1), 7-15. Sheikh, C.S., Deshmuku, V., Waghamare, R.N., Markandya, N.M. & Vaidya, M.S. (2013). Isolation of pathogenic E. coli from buffalo meat sold in Parbhani city, Maharushtra, India. Veterinary World, 6(5), 277-297. Soumet, C., Ermel, G., Rose, N., Rose, V., Drouin, P., Salvat, G. & colin, P. (1999). Evaluation of multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella enteritidis, and Salmonella typhimurium from environmental swabs of poultry houses. Letters in Applied Microbiology, 28, 113-117. Tarabees, R., Shawish, R., Elsayed, M. & Shehata, A. (2017). Isolation and characterization of Salmonella enteritidis and Salmonella typhimurium from chicken meat in Egypt. Journal of Infection in Developing Countries, 11(4), 314-319. Wang, G., Clark, C.G. & Rodgerst, F.G. (2002). Detection in Escherichia coli of the genes encoding the major virulence factors, the genes are defining the O157:H7 serotype, and components of the type2 Shiga toxin family by multiplex PCR. Journal of Clinical Microbiology, 40, 3613-3619. Yang, B., Xi, M., Wang, X., Cui, S., Yue, T., Hao, H., Wang, Y., Cui, Y., Alali, W.Q., Meng, J., Walls, I., Wong, D.M.L.F. & Doyle, M.P. (2011). Prevalence of Salmonella on raw poultry at retail markets in China. Journal of Food Protection, 74(10), 1724-1728. © Licensee Multidisciplines. This work is an open-access article assigned in Creative Commons Attribution (CC BY 4.0) license terms and conditions (http://creativecommons.org/licenses/by/4.0/) http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/