id	sid	tid	token	lemma	pos
hls-11302	1	1	hrev_master	hrev_master	NOUN
hls-11302	2	1	[	[	X
hls-11302	2	2	page	page	NOUN
hls-11302	2	3	35	35	NUM
hls-11302	2	4	]	]	PUNCT
hls-11302	3	1	[	[	X
hls-11302	3	2	healthcare	healthcare	NOUN
hls-11302	3	3	in	in	ADP
hls-11302	3	4	low	low	ADJ
hls-11302	3	5	-	-	PUNCT
hls-11302	3	6	resource	resource	NOUN
hls-11302	3	7	settings	setting	NOUN
hls-11302	3	8	2023	2023	NUM
hls-11302	3	9	;	;	PUNCT
hls-11302	3	10	11:11302	11:11302	NUM
hls-11302	3	11	]	]	X
hls-11302	3	12	pityriasis	pityriasis	NOUN
hls-11302	3	13	versicolor	versicolor	NOUN
hls-11302	3	14	:	:	PUNCT
hls-11302	3	15	host	host	NOUN
hls-11302	3	16	susceptibility	susceptibility	NOUN
hls-11302	3	17	in	in	ADP
hls-11302	3	18	relation	relation	NOUN
hls-11302	3	19	to	to	ADP
hls-11302	3	20	il-10	il-10	NOUN
hls-11302	3	21	and	and	CCONJ
hls-11302	3	22	ifn	ifn	PROPN
hls-11302	3	23	g	g	PROPN
hls-11302	3	24	cytokine	cytokine	ADJ
hls-11302	3	25	gene	gene	NOUN
hls-11302	3	26	polymorphism	polymorphism	NOUN
hls-11302	3	27	charu	charu	PROPN
hls-11302	3	28	jain,1	jain,1	PROPN
hls-11302	3	29	shukla	shukla	PROPN
hls-11302	3	30	das,1	das,1	NOUN
hls-11302	4	1	vishnampettai	vishnampettai	PROPN
hls-11302	4	2	g.	g.	PROPN
hls-11302	4	3	ramachandran,1	ramachandran,1	PROPN
hls-11302	4	4	rumpa	rumpa	PROPN
hls-11302	4	5	saha,1	saha,1	PROPN
hls-11302	4	6	sambit	sambit	PROPN
hls-11302	4	7	nath	nath	PROPN
hls-11302	4	8	bhattacharyak,2	bhattacharyak,2	PROPN
hls-11302	4	9	sajad	sajad	PROPN
hls-11302	4	10	ahmad	ahmad	PROPN
hls-11302	4	11	dar,1	dar,1	PROPN
hls-11302	4	12	nikita	nikita	PROPN
hls-11302	4	13	birhman,1	birhman,1	PROPN
hls-11302	4	14	narendra	narendra	PROPN
hls-11302	4	15	pal	pal	PROPN
hls-11302	4	16	singh1	singh1	PROPN
hls-11302	5	1	1department	1department	NUM
hls-11302	5	2	of	of	ADP
hls-11302	5	3	microbiology	microbiology	NOUN
hls-11302	5	4	,	,	PUNCT
hls-11302	5	5	ucms	ucms	PROPN
hls-11302	5	6	&	&	CCONJ
hls-11302	5	7	gtb	gtb	PROPN
hls-11302	5	8	hospital	hospital	NOUN
hls-11302	5	9	;	;	PUNCT
hls-11302	6	1	2department	2department	NUM
hls-11302	6	2	of	of	ADP
hls-11302	6	3	dermatology	dermatology	NOUN
hls-11302	6	4	and	and	CCONJ
hls-11302	6	5	venerology	venerology	NOUN
hls-11302	6	6	,	,	PUNCT
hls-11302	6	7	ucms	ucms	PROPN
hls-11302	6	8	&	&	CCONJ
hls-11302	6	9	gtb	gtb	PROPN
hls-11302	6	10	hospital	hospital	PROPN
hls-11302	6	11	,	,	PUNCT
hls-11302	6	12	india	india	PROPN
hls-11302	6	13	abstract	abstract	ADJ
hls-11302	6	14	pityriasis	pityriasis	NOUN
hls-11302	6	15	versicolor	versicolor	NOUN
hls-11302	6	16	is	be	AUX
hls-11302	6	17	a	a	DET
hls-11302	6	18	skin	skin	NOUN
hls-11302	6	19	condition	condition	NOUN
hls-11302	6	20	caused	cause	VERB
hls-11302	6	21	by	by	ADP
hls-11302	6	22	the	the	DET
hls-11302	6	23	commensal	commensal	ADJ
hls-11302	6	24	yeast	yeast	NOUN
hls-11302	6	25	malassezia	malassezia	NOUN
hls-11302	6	26	.	.	PUNCT
hls-11302	7	1	little	little	ADJ
hls-11302	7	2	is	be	AUX
hls-11302	7	3	known	know	VERB
hls-11302	7	4	about	about	ADP
hls-11302	7	5	the	the	DET
hls-11302	7	6	pathogenesis	pathogenesis	NOUN
hls-11302	7	7	of	of	ADP
hls-11302	7	8	why	why	SCONJ
hls-11302	7	9	a	a	DET
hls-11302	7	10	commensal	commensal	NOUN
hls-11302	7	11	only	only	ADV
hls-11302	7	12	causes	cause	VERB
hls-11302	7	13	symptoms	symptom	NOUN
hls-11302	7	14	in	in	ADP
hls-11302	7	15	a	a	DET
hls-11302	7	16	subset	subset	NOUN
hls-11302	7	17	of	of	ADP
hls-11302	7	18	infected	infect	VERB
hls-11302	7	19	individuals	individual	NOUN
hls-11302	7	20	.	.	PUNCT
hls-11302	8	1	understanding	understand	VERB
hls-11302	8	2	the	the	DET
hls-11302	8	3	susceptibility	susceptibility	NOUN
hls-11302	8	4	of	of	ADP
hls-11302	8	5	the	the	DET
hls-11302	8	6	host	host	NOUN
hls-11302	8	7	to	to	ADP
hls-11302	8	8	these	these	DET
hls-11302	8	9	commensal	commensal	NOUN
hls-11302	8	10	-	-	PUNCT
hls-11302	8	11	associated	associate	VERB
hls-11302	8	12	diseases	disease	NOUN
hls-11302	8	13	may	may	AUX
hls-11302	8	14	be	be	AUX
hls-11302	8	15	facilitated	facilitate	VERB
hls-11302	8	16	by	by	ADP
hls-11302	8	17	knowledge	knowledge	NOUN
hls-11302	8	18	of	of	ADP
hls-11302	8	19	genetic	genetic	ADJ
hls-11302	8	20	polymorphism	polymorphism	NOUN
hls-11302	8	21	.	.	PUNCT
hls-11302	9	1	the	the	DET
hls-11302	9	2	purpose	purpose	NOUN
hls-11302	9	3	was	be	AUX
hls-11302	9	4	to	to	PART
hls-11302	9	5	investigate	investigate	VERB
hls-11302	9	6	the	the	DET
hls-11302	9	7	relationship	relationship	NOUN
hls-11302	9	8	between	between	ADP
hls-11302	9	9	single	single	ADJ
hls-11302	9	10	nucleotide	nucleotide	ADJ
hls-11302	9	11	polymorphism	polymorphism	NOUN
hls-11302	9	12	in	in	ADP
hls-11302	9	13	the	the	DET
hls-11302	9	14	il10	il10	PROPN
hls-11302	9	15	and	and	CCONJ
hls-11302	9	16	ifn	ifn	PROPN
hls-11302	9	17	genes	gene	NOUN
hls-11302	9	18	of	of	ADP
hls-11302	9	19	the	the	DET
hls-11302	9	20	host	host	NOUN
hls-11302	9	21	and	and	CCONJ
hls-11302	9	22	susceptibility	susceptibility	NOUN
hls-11302	9	23	to	to	ADP
hls-11302	9	24	malassezia	malassezia	NOUN
hls-11302	9	25	infection	infection	NOUN
hls-11302	9	26	.	.	PUNCT
hls-11302	10	1	there	there	PRON
hls-11302	10	2	were	be	VERB
hls-11302	10	3	38	38	NUM
hls-11302	10	4	cases	case	NOUN
hls-11302	10	5	of	of	ADP
hls-11302	10	6	pityriasis	pityriasis	NOUN
hls-11302	10	7	versicolor	versicolor	NOUN
hls-11302	10	8	(	(	PUNCT
hls-11302	10	9	pv	pv	NOUN
hls-11302	10	10	)	)	PUNCT
hls-11302	10	11	and	and	CCONJ
hls-11302	10	12	38	38	NUM
hls-11302	10	13	healthy	healthy	ADJ
hls-11302	10	14	controls	control	NOUN
hls-11302	10	15	in	in	ADP
hls-11302	10	16	the	the	DET
hls-11302	10	17	sample	sample	NOUN
hls-11302	10	18	.	.	PUNCT
hls-11302	11	1	blood	blood	NOUN
hls-11302	11	2	samples	sample	NOUN
hls-11302	11	3	were	be	AUX
hls-11302	11	4	extracted	extract	VERB
hls-11302	11	5	for	for	ADP
hls-11302	11	6	genomic	genomic	ADJ
hls-11302	11	7	dna	dna	NOUN
hls-11302	11	8	from	from	ADP
hls-11302	11	9	all	all	DET
hls-11302	11	10	study	study	NOUN
hls-11302	11	11	participants	participant	NOUN
hls-11302	11	12	.	.	PUNCT
hls-11302	12	1	amplification	amplification	NOUN
hls-11302	12	2	refractory	refractory	NOUN
hls-11302	12	3	mutations	mutation	NOUN
hls-11302	12	4	systempolymerase	systempolymerase	NOUN
hls-11302	12	5	chain	chain	NOUN
hls-11302	12	6	reaction	reaction	NOUN
hls-11302	12	7	(	(	PUNCT
hls-11302	12	8	arms	arm	NOUN
hls-11302	12	9	-	-	PUNCT
hls-11302	12	10	pcr	pcr	NOUN
hls-11302	12	11	)	)	PUNCT
hls-11302	12	12	with	with	ADP
hls-11302	12	13	sequence	sequence	NOUN
hls-11302	12	14	-	-	PUNCT
hls-11302	12	15	specific	specific	ADJ
hls-11302	12	16	primers	primer	NOUN
hls-11302	12	17	was	be	AUX
hls-11302	12	18	used	use	VERB
hls-11302	12	19	to	to	PART
hls-11302	12	20	genotype	genotype	VERB
hls-11302	12	21	cytokines	cytokine	NOUN
hls-11302	12	22	.	.	PUNCT
hls-11302	13	1	in	in	ADP
hls-11302	13	2	all	all	DET
hls-11302	13	3	patients	patient	NOUN
hls-11302	13	4	and	and	CCONJ
hls-11302	13	5	healthy	healthy	ADJ
hls-11302	13	6	controls	control	NOUN
hls-11302	13	7	,	,	PUNCT
hls-11302	13	8	three	three	NUM
hls-11302	13	9	snps	snps	NOUN
hls-11302	13	10	(	(	PUNCT
hls-11302	13	11	il10	il10	PROPN
hls-11302	13	12	-	-	PUNCT
hls-11302	13	13	1082a	1082a	NUM
hls-11302	13	14	/	/	SYM
hls-11302	13	15	g	g	NOUN
hls-11302	13	16	;	;	PUNCT
hls-11302	13	17	il10	il10	PROPN
hls-11302	13	18	-	-	PUNCT
hls-11302	13	19	819/592c	819/592c	NUM
hls-11302	13	20	/	/	SYM
hls-11302	13	21	t	t	PROPN
hls-11302	13	22	;	;	PUNCT
hls-11302	13	23	ifn+874a	ifn+874a	PROPN
hls-11302	13	24	/	/	SYM
hls-11302	13	25	t	t	PROPN
hls-11302	13	26	)	)	PUNCT
hls-11302	13	27	in	in	ADP
hls-11302	13	28	two	two	NUM
hls-11302	13	29	cytokine	cytokine	ADJ
hls-11302	13	30	loci	locus	NOUN
hls-11302	13	31	were	be	AUX
hls-11302	13	32	analyzed	analyze	VERB
hls-11302	13	33	.	.	PUNCT
hls-11302	14	1	in	in	ADP
hls-11302	14	2	the	the	DET
hls-11302	14	3	pv	pv	PROPN
hls-11302	14	4	group	group	NOUN
hls-11302	14	5	,	,	PUNCT
hls-11302	14	6	we	we	PRON
hls-11302	14	7	observed	observe	VERB
hls-11302	14	8	significant	significant	ADJ
hls-11302	14	9	differences	difference	NOUN
hls-11302	14	10	in	in	ADP
hls-11302	14	11	allele	allele	NOUN
hls-11302	14	12	or	or	CCONJ
hls-11302	14	13	genotype	genotype	NOUN
hls-11302	14	14	distribution	distribution	NOUN
hls-11302	14	15	for	for	ADP
hls-11302	14	16	the	the	DET
hls-11302	14	17	il10	il10	PROPN
hls-11302	14	18	-	-	PUNCT
hls-11302	14	19	819/592c	819/592c	NUM
hls-11302	14	20	/	/	SYM
hls-11302	14	21	t	t	NOUN
hls-11302	14	22	and	and	CCONJ
hls-11302	14	23	ifn+874a	ifn+874a	PROPN
hls-11302	14	24	/	/	SYM
hls-11302	14	25	t	t	PROPN
hls-11302	14	26	gene	gene	NOUN
hls-11302	14	27	polymorphisms	polymorphism	NOUN
hls-11302	14	28	.	.	PUNCT
hls-11302	15	1	in	in	ADP
hls-11302	15	2	the	the	DET
hls-11302	15	3	present	present	ADJ
hls-11302	15	4	investigation	investigation	NOUN
hls-11302	15	5	,	,	PUNCT
hls-11302	15	6	cytokine	cytokine	ADJ
hls-11302	15	7	gene	gene	NOUN
hls-11302	15	8	polymorphism	polymorphism	NOUN
hls-11302	15	9	revealed	reveal	VERB
hls-11302	15	10	that	that	SCONJ
hls-11302	15	11	the	the	DET
hls-11302	15	12	host	host	NOUN
hls-11302	15	13	was	be	AUX
hls-11302	15	14	susceptible	susceptible	ADJ
hls-11302	15	15	to	to	ADP
hls-11302	15	16	malassezia	malassezia	NOUN
hls-11302	15	17	infection	infection	NOUN
hls-11302	15	18	.	.	PUNCT
hls-11302	16	1	introduction	introduction	NOUN
hls-11302	16	2	malassezia	malassezia	NOUN
hls-11302	16	3	is	be	AUX
hls-11302	16	4	part	part	NOUN
hls-11302	16	5	of	of	ADP
hls-11302	16	6	cutaneous	cutaneous	ADJ
hls-11302	16	7	commensal	commensal	ADJ
hls-11302	16	8	flora	flora	NOUN
hls-11302	16	9	and	and	CCONJ
hls-11302	16	10	is	be	AUX
hls-11302	16	11	associated	associate	VERB
hls-11302	16	12	with	with	ADP
hls-11302	16	13	certain	certain	ADJ
hls-11302	16	14	superficial	superficial	ADJ
hls-11302	16	15	cutaneous	cutaneous	ADJ
hls-11302	16	16	disorders	disorder	NOUN
hls-11302	16	17	like	like	ADP
hls-11302	16	18	pityriasis	pityriasis	NOUN
hls-11302	16	19	versicolor	versicolor	NOUN
hls-11302	16	20	(	(	PUNCT
hls-11302	16	21	pv	pv	NOUN
hls-11302	16	22	)	)	PUNCT
hls-11302	16	23	,	,	PUNCT
hls-11302	16	24	atopic	atopic	NOUN
hls-11302	16	25	dermatitis	dermatitis	NOUN
hls-11302	16	26	(	(	PUNCT
hls-11302	16	27	ad	ad	NOUN
hls-11302	16	28	)	)	PUNCT
hls-11302	16	29	,	,	PUNCT
hls-11302	16	30	and	and	CCONJ
hls-11302	16	31	seborrheic	seborrheic	PROPN
hls-11302	16	32	dermatitis	dermatitis	NOUN
hls-11302	16	33	(	(	PUNCT
hls-11302	16	34	sd	sd	NOUN
hls-11302	16	35	)	)	PUNCT
hls-11302	16	36	,	,	PUNCT
hls-11302	16	37	etc.1	etc.1	VERB
hls-11302	16	38	malassezia	malassezia	NOUN
hls-11302	16	39	demonstrates	demonstrate	VERB
hls-11302	16	40	two	two	NUM
hls-11302	16	41	distinct	distinct	ADJ
hls-11302	16	42	phenotypes	phenotype	NOUN
hls-11302	16	43	:	:	PUNCT
hls-11302	16	44	one	one	NUM
hls-11302	16	45	stimulates	stimulate	VERB
hls-11302	16	46	the	the	DET
hls-11302	16	47	immune	immune	ADJ
hls-11302	16	48	system	system	NOUN
hls-11302	16	49	,	,	PUNCT
hls-11302	16	50	significantly	significantly	ADV
hls-11302	16	51	activating	activate	VERB
hls-11302	16	52	several	several	ADJ
hls-11302	16	53	immunological	immunological	ADJ
hls-11302	16	54	pathways	pathway	NOUN
hls-11302	16	55	,	,	PUNCT
hls-11302	16	56	while	while	SCONJ
hls-11302	16	57	the	the	DET
hls-11302	16	58	other	other	ADJ
hls-11302	16	59	greatly	greatly	ADV
hls-11302	16	60	restricts	restrict	VERB
hls-11302	16	61	immune	immune	ADJ
hls-11302	16	62	stimulation	stimulation	NOUN
hls-11302	16	63	,	,	PUNCT
hls-11302	16	64	possibly	possibly	ADV
hls-11302	16	65	allowing	allow	VERB
hls-11302	16	66	it	it	PRON
hls-11302	16	67	to	to	PART
hls-11302	16	68	coexist	coexist	VERB
hls-11302	16	69	as	as	ADP
hls-11302	16	70	a	a	DET
hls-11302	16	71	commensal	commensal	NOUN
hls-11302	16	72	in	in	ADP
hls-11302	16	73	the	the	DET
hls-11302	16	74	majority	majority	NOUN
hls-11302	16	75	of	of	ADP
hls-11302	16	76	people.1	people.1	PROPN
hls-11302	16	77	-	-	PUNCT
hls-11302	16	78	3	3	NUM
hls-11302	16	79	the	the	DET
hls-11302	16	80	immunomodulatory	immunomodulatory	ADJ
hls-11302	16	81	ability	ability	NOUN
hls-11302	16	82	of	of	ADP
hls-11302	16	83	malassezia	malassezia	NOUN
hls-11302	16	84	has	have	AUX
hls-11302	16	85	been	be	AUX
hls-11302	16	86	shown	show	VERB
hls-11302	16	87	to	to	PART
hls-11302	16	88	downregulate	downregulate	VERB
hls-11302	16	89	the	the	DET
hls-11302	16	90	production	production	NOUN
hls-11302	16	91	of	of	ADP
hls-11302	16	92	proinflammatory	proinflammatory	ADJ
hls-11302	16	93	cytokines	cytokine	NOUN
hls-11302	16	94	which	which	PRON
hls-11302	16	95	is	be	AUX
hls-11302	16	96	in	in	ADP
hls-11302	16	97	marked	marked	ADJ
hls-11302	16	98	contrast	contrast	NOUN
hls-11302	16	99	to	to	ADP
hls-11302	16	100	the	the	DET
hls-11302	16	101	effect	effect	NOUN
hls-11302	16	102	of	of	ADP
hls-11302	16	103	many	many	ADJ
hls-11302	16	104	other	other	ADJ
hls-11302	16	105	organisms.1	organisms.1	NOUN
hls-11302	16	106	pityriasis	pityriasis	NOUN
hls-11302	16	107	versicolor	versicolor	NOUN
hls-11302	16	108	(	(	PUNCT
hls-11302	16	109	pv	pv	NOUN
hls-11302	16	110	)	)	PUNCT
hls-11302	16	111	is	be	AUX
hls-11302	16	112	a	a	DET
hls-11302	16	113	mild	mild	ADJ
hls-11302	16	114	,	,	PUNCT
hls-11302	16	115	chronic	chronic	ADJ
hls-11302	16	116	superficial	superficial	ADJ
hls-11302	16	117	cutaneous	cutaneous	ADJ
hls-11302	16	118	condition	condition	NOUN
hls-11302	16	119	characterized	characterize	VERB
hls-11302	16	120	by	by	ADP
hls-11302	16	121	hypo	hypo	ADJ
hls-11302	16	122	or	or	CCONJ
hls-11302	16	123	hyper	hyper	ADV
hls-11302	16	124	-	-	ADJ
hls-11302	16	125	pigmented	pigmented	ADJ
hls-11302	16	126	plaques	plaque	NOUN
hls-11302	16	127	that	that	PRON
hls-11302	16	128	are	be	AUX
hls-11302	16	129	covered	cover	VERB
hls-11302	16	130	by	by	ADP
hls-11302	16	131	fine	fine	ADJ
hls-11302	16	132	scales	scale	NOUN
hls-11302	16	133	,	,	PUNCT
hls-11302	16	134	sometimes	sometimes	ADV
hls-11302	16	135	associated	associate	VERB
hls-11302	16	136	with	with	ADP
hls-11302	16	137	mild	mild	ADJ
hls-11302	16	138	pruritus.4	pruritus.4	NOUN
hls-11302	16	139	pv	pv	NOUN
hls-11302	16	140	is	be	AUX
hls-11302	16	141	mostly	mostly	ADV
hls-11302	16	142	distributed	distribute	VERB
hls-11302	16	143	in	in	ADP
hls-11302	16	144	the	the	DET
hls-11302	16	145	sebum	sebum	NOUN
hls-11302	16	146	-	-	PUNCT
hls-11302	16	147	rich	rich	ADJ
hls-11302	16	148	areas	area	NOUN
hls-11302	16	149	of	of	ADP
hls-11302	16	150	the	the	DET
hls-11302	16	151	skin	skin	NOUN
hls-11302	16	152	such	such	ADJ
hls-11302	16	153	as	as	ADP
hls-11302	16	154	the	the	DET
hls-11302	16	155	back	back	NOUN
hls-11302	16	156	,	,	PUNCT
hls-11302	16	157	chest	chest	NOUN
hls-11302	16	158	,	,	PUNCT
hls-11302	16	159	and	and	CCONJ
hls-11302	16	160	neck.4	neck.4	NOUN
hls-11302	16	161	there	there	PRON
hls-11302	16	162	is	be	VERB
hls-11302	16	163	a	a	DET
hls-11302	16	164	significant	significant	ADJ
hls-11302	16	165	fungal	fungal	ADJ
hls-11302	16	166	load	load	NOUN
hls-11302	16	167	on	on	ADP
hls-11302	16	168	the	the	DET
hls-11302	16	169	skin	skin	NOUN
hls-11302	16	170	but	but	CCONJ
hls-11302	16	171	no	no	DET
hls-11302	16	172	inflammatory	inflammatory	ADJ
hls-11302	16	173	alterations	alteration	NOUN
hls-11302	16	174	are	be	AUX
hls-11302	16	175	observed	observe	VERB
hls-11302	16	176	.	.	PUNCT
hls-11302	17	1	the	the	DET
hls-11302	17	2	excellent	excellent	ADJ
hls-11302	17	3	adaptive	adaptive	ADJ
hls-11302	17	4	mechanism	mechanism	NOUN
hls-11302	17	5	is	be	AUX
hls-11302	17	6	attributed	attribute	VERB
hls-11302	17	7	to	to	ADP
hls-11302	17	8	the	the	DET
hls-11302	17	9	presence	presence	NOUN
hls-11302	17	10	of	of	ADP
hls-11302	17	11	various	various	ADJ
hls-11302	17	12	metabolites	metabolite	NOUN
hls-11302	17	13	produced	produce	VERB
hls-11302	17	14	by	by	ADP
hls-11302	17	15	the	the	DET
hls-11302	17	16	yeast.5	yeast.5	PROPN
hls-11302	17	17	cytokine	cytokine	NOUN
hls-11302	17	18	gene	gene	NOUN
hls-11302	17	19	polymorphism	polymorphism	NOUN
hls-11302	17	20	(	(	PUNCT
hls-11302	17	21	single	single	ADJ
hls-11302	17	22	nucleotide	nucleotide	ADJ
hls-11302	17	23	polymorphism	polymorphism	NOUN
hls-11302	17	24	)	)	PUNCT
hls-11302	17	25	governing	govern	VERB
hls-11302	17	26	the	the	DET
hls-11302	17	27	cytokine	cytokine	ADJ
hls-11302	17	28	production	production	NOUN
hls-11302	17	29	could	could	AUX
hls-11302	17	30	determine	determine	VERB
hls-11302	17	31	the	the	DET
hls-11302	17	32	susceptibility	susceptibility	NOUN
hls-11302	17	33	of	of	ADP
hls-11302	17	34	the	the	DET
hls-11302	17	35	host	host	NOUN
hls-11302	17	36	to	to	ADP
hls-11302	17	37	the	the	DET
hls-11302	17	38	disease.6	disease.6	NOUN
hls-11302	17	39	the	the	DET
hls-11302	17	40	occasional	occasional	ADJ
hls-11302	17	41	polymorphisms	polymorphism	NOUN
hls-11302	17	42	that	that	PRON
hls-11302	17	43	occur	occur	VERB
hls-11302	17	44	in	in	ADP
hls-11302	17	45	the	the	DET
hls-11302	17	46	normal	normal	ADJ
hls-11302	17	47	healthy	healthy	ADJ
hls-11302	17	48	population	population	NOUN
hls-11302	17	49	are	be	AUX
hls-11302	17	50	compatible	compatible	ADJ
hls-11302	17	51	with	with	ADP
hls-11302	17	52	normal	normal	ADJ
hls-11302	17	53	immune	immune	ADJ
hls-11302	17	54	function	function	NOUN
hls-11302	17	55	.	.	PUNCT
hls-11302	18	1	but	but	CCONJ
hls-11302	18	2	when	when	SCONJ
hls-11302	18	3	present	present	ADJ
hls-11302	18	4	with	with	ADP
hls-11302	18	5	certain	certain	ADJ
hls-11302	18	6	other	other	ADJ
hls-11302	18	7	susceptibility	susceptibility	NOUN
hls-11302	18	8	genes	gene	NOUN
hls-11302	18	9	they	they	PRON
hls-11302	18	10	may	may	AUX
hls-11302	18	11	contribute	contribute	VERB
hls-11302	18	12	to	to	ADP
hls-11302	18	13	the	the	DET
hls-11302	18	14	disease	disease	NOUN
hls-11302	18	15	.	.	PUNCT
hls-11302	19	1	cytokine	cytokine	ADJ
hls-11302	19	2	secretion	secretion	NOUN
hls-11302	19	3	profiles	profile	NOUN
hls-11302	19	4	can	can	AUX
hls-11302	19	5	be	be	AUX
hls-11302	19	6	considered	consider	VERB
hls-11302	19	7	as	as	ADP
hls-11302	19	8	promoting	promote	VERB
hls-11302	19	9	cell	cell	NOUN
hls-11302	19	10	-	-	PUNCT
hls-11302	19	11	mediated	mediate	VERB
hls-11302	19	12	immunity	immunity	NOUN
hls-11302	19	13	or	or	CCONJ
hls-11302	19	14	humoral	humoral	ADJ
hls-11302	19	15	immunity	immunity	NOUN
hls-11302	19	16	.	.	PUNCT
hls-11302	20	1	il10	il10	NOUN
hls-11302	20	2	shifts	shift	NOUN
hls-11302	20	3	the	the	DET
hls-11302	20	4	balance	balance	NOUN
hls-11302	20	5	by	by	ADP
hls-11302	20	6	down	down	ADV
hls-11302	20	7	-	-	PUNCT
hls-11302	20	8	regulating	regulate	VERB
hls-11302	20	9	th1	th1	NOUN
hls-11302	20	10	response	response	NOUN
hls-11302	20	11	and	and	CCONJ
hls-11302	20	12	by	by	ADP
hls-11302	20	13	suppressing	suppress	VERB
hls-11302	20	14	proinflammatory	proinflammatory	ADJ
hls-11302	20	15	cytokine	cytokine	NOUN
hls-11302	20	16	ifn	ifn	NOUN
hls-11302	20	17	γ	γ	NOUN
hls-11302	20	18	secretion	secretion	NOUN
hls-11302	20	19	.	.	PUNCT
hls-11302	21	1	il10	il10	PROPN
hls-11302	21	2	is	be	AUX
hls-11302	21	3	a	a	DET
hls-11302	21	4	th2	th2	PROPN
hls-11302	21	5	anti	anti	ADJ
hls-11302	21	6	-	-	ADJ
hls-11302	21	7	inflammatory	inflammatory	ADJ
hls-11302	21	8	cytokine	cytokine	NOUN
hls-11302	21	9	and	and	CCONJ
hls-11302	21	10	inter	inter	ADJ
hls-11302	21	11	-	-	ADJ
hls-11302	21	12	individual	individual	ADJ
hls-11302	21	13	variations	variation	NOUN
hls-11302	21	14	in	in	ADP
hls-11302	21	15	il10	il10	PROPN
hls-11302	21	16	production	production	NOUN
hls-11302	21	17	are	be	AUX
hls-11302	21	18	genetically	genetically	ADV
hls-11302	21	19	determined	determine	VERB
hls-11302	21	20	by	by	ADP
hls-11302	21	21	polymorphism	polymorphism	NOUN
hls-11302	21	22	within	within	ADP
hls-11302	21	23	the	the	DET
hls-11302	21	24	il10	il10	PROPN
hls-11302	21	25	promoter	promoter	NOUN
hls-11302	21	26	region	region	NOUN
hls-11302	21	27	-1082	-1082	PROPN
hls-11302	22	1	g	g	NOUN
hls-11302	22	2	/	/	SYM
hls-11302	22	3	a	a	NOUN
hls-11302	22	4	,	,	PUNCT
hls-11302	22	5	-819	-819	PROPN
hls-11302	22	6	c	c	PROPN
hls-11302	22	7	/	/	SYM
hls-11302	22	8	t	t	PROPN
hls-11302	22	9	,	,	PUNCT
hls-11302	22	10	and	and	CCONJ
hls-11302	22	11	-592	-592	PROPN
hls-11302	22	12	c	c	NOUN
hls-11302	22	13	/	/	SYM
hls-11302	22	14	a.	a.	NOUN
hls-11302	22	15	the	the	DET
hls-11302	22	16	polymorphism	polymorphism	NOUN
hls-11302	22	17	at	at	ADP
hls-11302	22	18	-810	-810	PROPN
hls-11302	22	19	c	c	PROPN
hls-11302	22	20	/	/	SYM
hls-11302	22	21	t	t	PROPN
hls-11302	22	22	and	and	CCONJ
hls-11302	22	23	-592	-592	PROPN
hls-11302	22	24	c	c	X
hls-11302	22	25	/	/	SYM
hls-11302	22	26	a	a	PRON
hls-11302	22	27	are	be	AUX
hls-11302	22	28	in	in	ADP
hls-11302	22	29	linkage	linkage	NOUN
hls-11302	22	30	disequilibrium	disequilibrium	NOUN
hls-11302	22	31	with	with	SCONJ
hls-11302	22	32	each	each	DET
hls-11302	22	33	other.7	other.7	PRON
hls-11302	22	34	ifn	ifn	PROPN
hls-11302	22	35	γ	γ	X
hls-11302	22	36	is	be	AUX
hls-11302	22	37	a	a	DET
hls-11302	22	38	th1	th1	NOUN
hls-11302	22	39	proinflammatory	proinflammatory	ADJ
hls-11302	22	40	cytokine	cytokine	NOUN
hls-11302	22	41	that	that	PRON
hls-11302	22	42	can	can	AUX
hls-11302	22	43	augment	augment	VERB
hls-11302	22	44	the	the	DET
hls-11302	22	45	immune	immune	ADJ
hls-11302	22	46	response	response	NOUN
hls-11302	22	47	.	.	PUNCT
hls-11302	23	1	the	the	DET
hls-11302	23	2	functional	functional	ADJ
hls-11302	23	3	single	single	ADJ
hls-11302	23	4	nucleotide	nucleotide	NOUN
hls-11302	23	5	polymorphism	polymorphism	NOUN
hls-11302	23	6	(	(	PUNCT
hls-11302	23	7	snp	snp	PROPN
hls-11302	23	8	)	)	PUNCT
hls-11302	23	9	+874	+874	NUM
hls-11302	23	10	t	t	PROPN
hls-11302	23	11	/	/	SYM
hls-11302	23	12	a	a	PRON
hls-11302	23	13	is	be	AUX
hls-11302	23	14	located	locate	VERB
hls-11302	23	15	at	at	ADP
hls-11302	23	16	the	the	DET
hls-11302	23	17	5	5	NUM
hls-11302	23	18	’	'	PUNCT
hls-11302	23	19	end	end	NOUN
hls-11302	23	20	of	of	ADP
hls-11302	23	21	a	a	DET
hls-11302	23	22	ca	ca	NOUN
hls-11302	23	23	repeat	repeat	NOUN
hls-11302	23	24	at	at	ADP
hls-11302	23	25	the	the	DET
hls-11302	23	26	first	first	ADJ
hls-11302	23	27	intron	intron	NOUN
hls-11302	23	28	of	of	ADP
hls-11302	23	29	the	the	DET
hls-11302	23	30	human	human	ADJ
hls-11302	23	31	ifn	ifn	PROPN
hls-11302	23	32	γ	γ	PROPN
hls-11302	23	33	gene	gene	NOUN
hls-11302	23	34	.	.	PUNCT
hls-11302	24	1	the	the	DET
hls-11302	24	2	t	t	PROPN
hls-11302	24	3	allele	allele	NOUN
hls-11302	24	4	of	of	ADP
hls-11302	24	5	ifn	ifn	PROPN
hls-11302	24	6	γ	γ	X
hls-11302	24	7	at	at	ADP
hls-11302	24	8	+874	+874	PRON
hls-11302	24	9	provides	provide	VERB
hls-11302	24	10	the	the	DET
hls-11302	24	11	binding	bind	VERB
hls-11302	24	12	site	site	NOUN
hls-11302	24	13	for	for	ADP
hls-11302	24	14	the	the	DET
hls-11302	24	15	transcription	transcription	NOUN
hls-11302	24	16	factor	factor	NOUN
hls-11302	24	17	,	,	PUNCT
hls-11302	24	18	kb	kb	PROPN
hls-11302	24	19	(	(	PUNCT
hls-11302	24	20	nf	nf	PROPN
hls-11302	24	21	-	-	PUNCT
hls-11302	24	22	kb	kb	NOUN
hls-11302	24	23	)	)	PUNCT
hls-11302	24	24	,	,	PUNCT
hls-11302	24	25	which	which	PRON
hls-11302	24	26	in	in	ADP
hls-11302	24	27	turn	turn	NOUN
hls-11302	24	28	leads	lead	VERB
hls-11302	24	29	to	to	ADP
hls-11302	24	30	high	high	ADJ
hls-11302	24	31	ifn	ifn	PROPN
hls-11302	24	32	γ	γ	NOUN
hls-11302	24	33	production.8	production.8	VERB
hls-11302	24	34	the	the	DET
hls-11302	24	35	goal	goal	NOUN
hls-11302	24	36	of	of	ADP
hls-11302	24	37	the	the	DET
hls-11302	24	38	current	current	ADJ
hls-11302	24	39	study	study	NOUN
hls-11302	24	40	is	be	AUX
hls-11302	24	41	to	to	PART
hls-11302	24	42	compare	compare	VERB
hls-11302	24	43	the	the	DET
hls-11302	24	44	genetic	genetic	ADJ
hls-11302	24	45	susceptibility	susceptibility	NOUN
hls-11302	24	46	of	of	ADP
hls-11302	24	47	the	the	DET
hls-11302	24	48	host	host	NOUN
hls-11302	24	49	to	to	ADP
hls-11302	24	50	infections	infection	NOUN
hls-11302	24	51	by	by	ADP
hls-11302	24	52	relating	relate	VERB
hls-11302	24	53	the	the	DET
hls-11302	24	54	polymorphism	polymorphism	NOUN
hls-11302	24	55	of	of	ADP
hls-11302	24	56	the	the	DET
hls-11302	24	57	cytokine	cytokine	ADJ
hls-11302	24	58	gene	gene	NOUN
hls-11302	24	59	to	to	ADP
hls-11302	24	60	any	any	DET
hls-11302	24	61	inherited	inherit	VERB
hls-11302	24	62	susceptibility	susceptibility	NOUN
hls-11302	24	63	and	and	CCONJ
hls-11302	24	64	comparing	compare	VERB
hls-11302	24	65	the	the	DET
hls-11302	24	66	polymorphism	polymorphism	NOUN
hls-11302	24	67	between	between	ADP
hls-11302	24	68	the	the	DET
hls-11302	24	69	study	study	NOUN
hls-11302	24	70	and	and	CCONJ
hls-11302	24	71	control	control	NOUN
hls-11302	24	72	groups	group	NOUN
hls-11302	24	73	.	.	PUNCT
hls-11302	25	1	pityriasis	pityriasis	NOUN
hls-11302	25	2	versicolor	versicolor	NOUN
hls-11302	25	3	aetiologically	aetiologically	ADV
hls-11302	25	4	related	relate	VERB
hls-11302	25	5	to	to	ADP
hls-11302	25	6	malassezia	malassezia	NOUN
hls-11302	25	7	was	be	AUX
hls-11302	25	8	chosen	choose	VERB
hls-11302	25	9	to	to	PART
hls-11302	25	10	explore	explore	VERB
hls-11302	25	11	this	this	DET
hls-11302	25	12	immunological	immunological	ADJ
hls-11302	25	13	tenet	tenet	NOUN
hls-11302	25	14	.	.	PUNCT
hls-11302	26	1	materials	material	NOUN
hls-11302	26	2	and	and	CCONJ
hls-11302	26	3	methods	method	NOUN
hls-11302	26	4	the	the	DET
hls-11302	26	5	study	study	NOUN
hls-11302	26	6	is	be	AUX
hls-11302	26	7	an	an	DET
hls-11302	26	8	observational	observational	ADJ
hls-11302	26	9	prospective	prospective	ADJ
hls-11302	26	10	laboratory	laboratory	NOUN
hls-11302	26	11	-	-	PUNCT
hls-11302	26	12	based	base	VERB
hls-11302	26	13	study	study	NOUN
hls-11302	26	14	and	and	CCONJ
hls-11302	26	15	included	include	VERB
hls-11302	26	16	38	38	NUM
hls-11302	26	17	consecutive	consecutive	ADJ
hls-11302	26	18	untreated	untreated	ADJ
hls-11302	26	19	clinically	clinically	ADV
hls-11302	26	20	diagnosed	diagnose	VERB
hls-11302	26	21	cases	case	NOUN
hls-11302	26	22	of	of	ADP
hls-11302	26	23	pv	pv	NOUN
hls-11302	26	24	irrespective	irrespective	ADV
hls-11302	26	25	of	of	ADP
hls-11302	26	26	age	age	NOUN
hls-11302	26	27	and	and	CCONJ
hls-11302	26	28	sex	sex	NOUN
hls-11302	26	29	recruited	recruit	VERB
hls-11302	26	30	from	from	ADP
hls-11302	26	31	the	the	DET
hls-11302	26	32	outpatient	outpatient	NOUN
hls-11302	26	33	department	department	NOUN
hls-11302	26	34	of	of	ADP
hls-11302	26	35	dermatology	dermatology	NOUN
hls-11302	26	36	of	of	ADP
hls-11302	26	37	a	a	DET
hls-11302	26	38	tertiary	tertiary	ADJ
hls-11302	26	39	care	care	NOUN
hls-11302	26	40	hospital	hospital	NOUN
hls-11302	26	41	,	,	PUNCT
hls-11302	26	42	delhi	delhi	ADJ
hls-11302	26	43	over	over	ADP
hls-11302	26	44	a	a	DET
hls-11302	26	45	year	year	NOUN
hls-11302	26	46	,	,	PUNCT
hls-11302	26	47	january	january	PROPN
hls-11302	26	48	2012	2012	NUM
hls-11302	26	49	-	-	SYM
hls-11302	26	50	january	january	PROPN
hls-11302	26	51	2013	2013	NUM
hls-11302	26	52	.	.	PUNCT
hls-11302	27	1	an	an	DET
hls-11302	27	2	equal	equal	ADJ
hls-11302	27	3	number	number	NOUN
hls-11302	27	4	of	of	ADP
hls-11302	27	5	healthy	healthy	ADJ
hls-11302	27	6	volunteers	volunteer	NOUN
hls-11302	27	7	were	be	AUX
hls-11302	27	8	also	also	ADV
hls-11302	27	9	included	include	VERB
hls-11302	27	10	as	as	ADP
hls-11302	27	11	controls	control	NOUN
hls-11302	27	12	.	.	PUNCT
hls-11302	28	1	a	a	DET
hls-11302	28	2	clearance	clearance	NOUN
hls-11302	28	3	from	from	ADP
hls-11302	28	4	the	the	DET
hls-11302	28	5	college	college	PROPN
hls-11302	28	6	ethical	ethical	PROPN
hls-11302	28	7	committee	committee	NOUN
hls-11302	28	8	was	be	AUX
hls-11302	28	9	obtained	obtain	VERB
hls-11302	28	10	as	as	ADP
hls-11302	28	11	per	per	ADP
hls-11302	28	12	the	the	DET
hls-11302	28	13	institu	institu	ADJ
hls-11302	28	14	healthcare	healthcare	NOUN
hls-11302	28	15	in	in	ADP
hls-11302	28	16	low	low	ADJ
hls-11302	28	17	-	-	PUNCT
hls-11302	28	18	resource	resource	NOUN
hls-11302	28	19	settings	setting	NOUN
hls-11302	28	20	2023	2023	NUM
hls-11302	28	21	;	;	PUNCT
hls-11302	28	22	volume	volume	NOUN
hls-11302	28	23	11:11302	11:11302	DET
hls-11302	28	24	correspondence	correspondence	NOUN
hls-11302	28	25	:	:	PUNCT
hls-11302	28	26	shukla	shukla	PROPN
hls-11302	28	27	das	das	PROPN
hls-11302	28	28	,	,	PUNCT
hls-11302	28	29	department	department	NOUN
hls-11302	28	30	of	of	ADP
hls-11302	28	31	microbiology	microbiology	NOUN
hls-11302	28	32	,	,	PUNCT
hls-11302	28	33	room	room	NOUN
hls-11302	28	34	no	no	NOUN
hls-11302	28	35	.	.	NOUN
hls-11302	29	1	312	312	NUM
hls-11302	29	2	,	,	PUNCT
hls-11302	29	3	university	university	NOUN
hls-11302	29	4	college	college	NOUN
hls-11302	29	5	of	of	ADP
hls-11302	29	6	medical	medical	ADJ
hls-11302	29	7	sciences	sciences	PROPN
hls-11302	29	8	,	,	PUNCT
hls-11302	29	9	gtb	gtb	NOUN
hls-11302	29	10	hospital	hospital	NOUN
hls-11302	29	11	,	,	PUNCT
hls-11302	29	12	dilshad	dilshad	ADJ
hls-11302	29	13	garden	garden	NOUN
hls-11302	29	14	,	,	PUNCT
hls-11302	29	15	110095	110095	NUM
hls-11302	29	16	new	new	PROPN
hls-11302	29	17	delhi	delhi	PROPN
hls-11302	29	18	,	,	PUNCT
hls-11302	29	19	india	india	PROPN
hls-11302	29	20	.	.	PUNCT
hls-11302	30	1	e	e	X
hls-11302	30	2	-	-	NOUN
hls-11302	30	3	mail	mail	NOUN
hls-11302	30	4	:	:	PUNCT
hls-11302	30	5	cjain@ucms.ac.in	cjain@ucms.ac.in	ADV
hls-11302	30	6	key	key	ADJ
hls-11302	30	7	words	word	NOUN
hls-11302	30	8	:	:	PUNCT
hls-11302	30	9	cytokine	cytokine	NOUN
hls-11302	30	10	,	,	PUNCT
hls-11302	30	11	polymorphism	polymorphism	NOUN
hls-11302	30	12	,	,	PUNCT
hls-11302	30	13	pityriasis	pityriasis	NOUN
hls-11302	30	14	versicolor	versicolor	NOUN
hls-11302	30	15	,	,	PUNCT
hls-11302	30	16	snp	snp	PROPN
hls-11302	30	17	.	.	PROPN
hls-11302	30	18	conflict	conflict	NOUN
hls-11302	30	19	of	of	ADP
hls-11302	30	20	interest	interest	NOUN
hls-11302	30	21	:	:	PUNCT
hls-11302	30	22	the	the	DET
hls-11302	30	23	authors	author	NOUN
hls-11302	30	24	declare	declare	VERB
hls-11302	30	25	no	no	DET
hls-11302	30	26	potential	potential	ADJ
hls-11302	30	27	conflict	conflict	NOUN
hls-11302	30	28	of	of	ADP
hls-11302	30	29	interest	interest	NOUN
hls-11302	30	30	,	,	PUNCT
hls-11302	30	31	and	and	CCONJ
hls-11302	30	32	all	all	DET
hls-11302	30	33	authors	author	NOUN
hls-11302	30	34	confirm	confirm	VERB
hls-11302	30	35	accuracy	accuracy	NOUN
hls-11302	30	36	.	.	PUNCT
hls-11302	31	1	ethics	ethic	NOUN
hls-11302	31	2	approval	approval	NOUN
hls-11302	31	3	:	:	PUNCT
hls-11302	31	4	university	university	NOUN
hls-11302	31	5	college	college	NOUN
hls-11302	31	6	of	of	ADP
hls-11302	31	7	medical	medical	PROPN
hls-11302	31	8	sciences	sciences	PROPN
hls-11302	31	9	ethical	ethical	PROPN
hls-11302	31	10	committee	committee	PROPN
hls-11302	31	11	approval	approval	NOUN
hls-11302	31	12	was	be	AUX
hls-11302	31	13	taken	take	VERB
hls-11302	31	14	as	as	ADP
hls-11302	31	15	per	per	ADP
hls-11302	31	16	the	the	DET
hls-11302	31	17	institutional	institutional	ADJ
hls-11302	31	18	guidelines	guideline	NOUN
hls-11302	31	19	before	before	ADP
hls-11302	31	20	recruiting	recruit	VERB
hls-11302	31	21	patients	patient	NOUN
hls-11302	31	22	.	.	PUNCT
hls-11302	32	1	the	the	DET
hls-11302	32	2	study	study	NOUN
hls-11302	32	3	is	be	AUX
hls-11302	32	4	conformed	conform	VERB
hls-11302	32	5	with	with	ADP
hls-11302	32	6	the	the	DET
hls-11302	32	7	helsinki	helsinki	PROPN
hls-11302	32	8	declaration	declaration	NOUN
hls-11302	32	9	of	of	ADP
hls-11302	32	10	1964	1964	NUM
hls-11302	32	11	,	,	PUNCT
hls-11302	32	12	as	as	SCONJ
hls-11302	32	13	revised	revise	VERB
hls-11302	32	14	in	in	ADP
hls-11302	32	15	2013	2013	NUM
hls-11302	32	16	,	,	PUNCT
hls-11302	32	17	concerning	concern	VERB
hls-11302	32	18	human	human	ADJ
hls-11302	32	19	and	and	CCONJ
hls-11302	32	20	animal	animal	NOUN
hls-11302	32	21	rights	right	NOUN
hls-11302	32	22	.	.	PUNCT
hls-11302	33	1	informed	informed	ADJ
hls-11302	33	2	consent	consent	NOUN
hls-11302	33	3	:	:	PUNCT
hls-11302	33	4	all	all	DET
hls-11302	33	5	patients	patient	NOUN
hls-11302	33	6	participating	participate	VERB
hls-11302	33	7	in	in	ADP
hls-11302	33	8	this	this	DET
hls-11302	33	9	study	study	NOUN
hls-11302	33	10	signed	sign	VERB
hls-11302	33	11	a	a	DET
hls-11302	33	12	written	write	VERB
hls-11302	33	13	informed	inform	VERB
hls-11302	33	14	consent	consent	NOUN
hls-11302	33	15	form	form	NOUN
hls-11302	33	16	for	for	ADP
hls-11302	33	17	participating	participate	VERB
hls-11302	33	18	in	in	ADP
hls-11302	33	19	this	this	DET
hls-11302	33	20	study	study	NOUN
hls-11302	33	21	.	.	PUNCT
hls-11302	34	1	patient	patient	ADJ
hls-11302	34	2	consent	consent	NOUN
hls-11302	34	3	for	for	ADP
hls-11302	34	4	publication	publication	NOUN
hls-11302	34	5	:	:	PUNCT
hls-11302	34	6	written	write	VERB
hls-11302	34	7	informed	informed	ADJ
hls-11302	34	8	consent	consent	NOUN
hls-11302	34	9	was	be	AUX
hls-11302	34	10	obtained	obtain	VERB
hls-11302	34	11	from	from	ADP
hls-11302	34	12	a	a	DET
hls-11302	34	13	legally	legally	ADV
hls-11302	34	14	authorized	authorize	VERB
hls-11302	34	15	representative(s	representative(s	NOUN
hls-11302	34	16	)	)	PUNCT
hls-11302	34	17	for	for	ADP
hls-11302	34	18	anonymized	anonymize	VERB
hls-11302	34	19	patient	patient	ADJ
hls-11302	34	20	information	information	NOUN
hls-11302	34	21	to	to	PART
hls-11302	34	22	be	be	AUX
hls-11302	34	23	published	publish	VERB
hls-11302	34	24	in	in	ADP
hls-11302	34	25	this	this	DET
hls-11302	34	26	article	article	NOUN
hls-11302	34	27	.	.	PUNCT
hls-11302	35	1	acknowledgments	acknowledgment	NOUN
hls-11302	35	2	:	:	PUNCT
hls-11302	35	3	the	the	DET
hls-11302	35	4	authors	author	NOUN
hls-11302	35	5	are	be	AUX
hls-11302	35	6	grateful	grateful	ADJ
hls-11302	35	7	for	for	ADP
hls-11302	35	8	the	the	DET
hls-11302	35	9	financial	financial	ADJ
hls-11302	35	10	support	support	NOUN
hls-11302	35	11	rendered	render	VERB
hls-11302	35	12	by	by	ADP
hls-11302	35	13	university	university	NOUN
hls-11302	35	14	grant	grant	PROPN
hls-11302	35	15	commission	commission	PROPN
hls-11302	35	16	and	and	CCONJ
hls-11302	35	17	intramural	intramural	ADJ
hls-11302	35	18	research	research	NOUN
hls-11302	35	19	grant	grant	NOUN
hls-11302	35	20	.	.	PUNCT
hls-11302	36	1	received	receive	VERB
hls-11302	36	2	for	for	ADP
hls-11302	36	3	publication	publication	NOUN
hls-11302	36	4	:	:	PUNCT
hls-11302	36	5	9	9	NUM
hls-11302	36	6	march	march	NOUN
hls-11302	36	7	2023	2023	NUM
hls-11302	36	8	.	.	PUNCT
hls-11302	37	1	accepted	accept	VERB
hls-11302	37	2	for	for	ADP
hls-11302	37	3	publication	publication	NOUN
hls-11302	37	4	:	:	PUNCT
hls-11302	37	5	7	7	NUM
hls-11302	37	6	june	june	PROPN
hls-11302	37	7	2023	2023	NUM
hls-11302	37	8	.	.	PUNCT
hls-11302	38	1	this	this	DET
hls-11302	38	2	work	work	NOUN
hls-11302	38	3	is	be	AUX
hls-11302	38	4	licensed	license	VERB
hls-11302	38	5	under	under	ADP
hls-11302	38	6	a	a	DET
hls-11302	38	7	creative	creative	ADJ
hls-11302	38	8	commons	common	NOUN
hls-11302	38	9	attribution	attribution	NOUN
hls-11302	38	10	4.0	4.0	NUM
hls-11302	38	11	license	license	NOUN
hls-11302	38	12	(	(	PUNCT
hls-11302	38	13	by	by	ADP
hls-11302	38	14	-	-	PUNCT
hls-11302	38	15	nc	nc	PROPN
hls-11302	38	16	4.0	4.0	NUM
hls-11302	38	17	)	)	PUNCT
hls-11302	38	18	.	.	PUNCT
hls-11302	39	1	©	©	PROPN
hls-11302	39	2	copyright	copyright	NOUN
hls-11302	39	3	:	:	PUNCT
hls-11302	39	4	the	the	DET
hls-11302	39	5	author(s	author(s	PROPN
hls-11302	39	6	)	)	PUNCT
hls-11302	39	7	,	,	PUNCT
hls-11302	39	8	2023	2023	NUM
hls-11302	39	9	licensee	licensee	NOUN
hls-11302	39	10	pagepress	pagepress	NOUN
hls-11302	39	11	,	,	PUNCT
hls-11302	39	12	italy	italy	PROPN
hls-11302	39	13	healthcare	healthcare	PROPN
hls-11302	39	14	in	in	ADP
hls-11302	39	15	low	low	ADJ
hls-11302	39	16	-	-	PUNCT
hls-11302	39	17	resource	resource	NOUN
hls-11302	39	18	settings	setting	NOUN
hls-11302	39	19	2023	2023	NUM
hls-11302	39	20	;	;	PUNCT
hls-11302	39	21	11:11302	11:11302	PROPN
hls-11302	39	22	doi:10.4081	doi:10.4081	NOUN
hls-11302	39	23	/	/	SYM
hls-11302	39	24	hls.2023.11302	hls.2023.11302	PROPN
hls-11302	39	25	publisher	publisher	NOUN
hls-11302	39	26	's	's	PART
hls-11302	39	27	note	note	NOUN
hls-11302	39	28	:	:	PUNCT
hls-11302	39	29	all	all	DET
hls-11302	39	30	claims	claim	NOUN
hls-11302	39	31	expressed	express	VERB
hls-11302	39	32	in	in	ADP
hls-11302	39	33	this	this	DET
hls-11302	39	34	article	article	NOUN
hls-11302	39	35	are	be	AUX
hls-11302	39	36	solely	solely	ADV
hls-11302	39	37	those	those	PRON
hls-11302	39	38	of	of	ADP
hls-11302	39	39	the	the	DET
hls-11302	39	40	authors	author	NOUN
hls-11302	39	41	and	and	CCONJ
hls-11302	39	42	do	do	AUX
hls-11302	39	43	not	not	PART
hls-11302	39	44	necessarily	necessarily	ADV
hls-11302	39	45	represent	represent	VERB
hls-11302	39	46	those	those	PRON
hls-11302	39	47	of	of	ADP
hls-11302	39	48	their	their	PRON
hls-11302	39	49	affiliated	affiliated	ADJ
hls-11302	39	50	organizations	organization	NOUN
hls-11302	39	51	,	,	PUNCT
hls-11302	39	52	or	or	CCONJ
hls-11302	39	53	those	those	PRON
hls-11302	39	54	of	of	ADP
hls-11302	39	55	the	the	DET
hls-11302	39	56	publisher	publisher	NOUN
hls-11302	39	57	,	,	PUNCT
hls-11302	39	58	the	the	DET
hls-11302	39	59	editors	editor	NOUN
hls-11302	39	60	and	and	CCONJ
hls-11302	39	61	the	the	DET
hls-11302	39	62	reviewers	reviewer	NOUN
hls-11302	39	63	.	.	PUNCT
hls-11302	40	1	any	any	DET
hls-11302	40	2	product	product	NOUN
hls-11302	40	3	that	that	PRON
hls-11302	40	4	may	may	AUX
hls-11302	40	5	be	be	AUX
hls-11302	40	6	evaluated	evaluate	VERB
hls-11302	40	7	in	in	ADP
hls-11302	40	8	this	this	DET
hls-11302	40	9	article	article	NOUN
hls-11302	40	10	or	or	CCONJ
hls-11302	40	11	claim	claim	NOUN
hls-11302	40	12	that	that	PRON
hls-11302	40	13	may	may	AUX
hls-11302	40	14	be	be	AUX
hls-11302	40	15	made	make	VERB
hls-11302	40	16	by	by	ADP
hls-11302	40	17	its	its	PRON
hls-11302	40	18	manufacturer	manufacturer	NOUN
hls-11302	40	19	is	be	AUX
hls-11302	40	20	not	not	PART
hls-11302	40	21	guaranteed	guarantee	VERB
hls-11302	40	22	or	or	CCONJ
hls-11302	40	23	endorsed	endorse	VERB
hls-11302	40	24	by	by	ADP
hls-11302	40	25	the	the	DET
hls-11302	40	26	publisher	publisher	NOUN
hls-11302	40	27	.	.	PUNCT
hls-11302	41	1	non	non	ADJ
hls-11302	41	2	-co	-co	PROPN
hls-11302	41	3	mmerc	mmerc	PROPN
hls-11302	41	4	ial	ial	PROPN
hls-11302	41	5	us	us	PROPN
hls-11302	41	6	e	e	NOUN
hls-11302	41	7	o	o	NOUN
hls-11302	41	8	nly	nly	ADV
hls-11302	41	9	[	[	X
hls-11302	41	10	healthcare	healthcare	NOUN
hls-11302	41	11	in	in	ADP
hls-11302	41	12	low	low	ADJ
hls-11302	41	13	-	-	PUNCT
hls-11302	41	14	resource	resource	NOUN
hls-11302	41	15	settings	setting	NOUN
hls-11302	41	16	2023	2023	NUM
hls-11302	41	17	;	;	PUNCT
hls-11302	41	18	11:11302	11:11302	X
hls-11302	41	19	]	]	X
hls-11302	42	1	[	[	X
hls-11302	42	2	page	page	NOUN
hls-11302	42	3	36	36	NUM
hls-11302	42	4	]	]	X
hls-11302	42	5	tional	tional	ADJ
hls-11302	42	6	guidelines	guideline	NOUN
hls-11302	42	7	before	before	ADP
hls-11302	42	8	recruiting	recruit	VERB
hls-11302	42	9	patients	patient	NOUN
hls-11302	42	10	.	.	PUNCT
hls-11302	43	1	informed	inform	VERB
hls-11302	43	2	consent	consent	NOUN
hls-11302	43	3	was	be	AUX
hls-11302	43	4	obtained	obtain	VERB
hls-11302	43	5	from	from	ADP
hls-11302	43	6	the	the	DET
hls-11302	43	7	patients	patient	NOUN
hls-11302	43	8	.	.	PUNCT
hls-11302	44	1	three	three	NUM
hls-11302	44	2	ml	ml	ADP
hls-11302	44	3	venous	venous	ADJ
hls-11302	44	4	blood	blood	NOUN
hls-11302	44	5	sample	sample	NOUN
hls-11302	44	6	in	in	ADP
hls-11302	44	7	an	an	DET
hls-11302	44	8	edta	edta	NOUN
hls-11302	44	9	vial	vial	NOUN
hls-11302	44	10	was	be	AUX
hls-11302	44	11	collected	collect	VERB
hls-11302	44	12	aseptically	aseptically	ADV
hls-11302	44	13	from	from	ADP
hls-11302	44	14	all	all	DET
hls-11302	44	15	patients	patient	NOUN
hls-11302	44	16	and	and	CCONJ
hls-11302	44	17	healthy	healthy	ADJ
hls-11302	44	18	controls	control	NOUN
hls-11302	44	19	for	for	ADP
hls-11302	44	20	dna	dna	NOUN
hls-11302	44	21	extraction	extraction	NOUN
hls-11302	44	22	and	and	CCONJ
hls-11302	44	23	subsequent	subsequent	ADJ
hls-11302	44	24	study	study	NOUN
hls-11302	44	25	for	for	ADP
hls-11302	44	26	single	single	ADJ
hls-11302	44	27	nucleotide	nucleotide	ADJ
hls-11302	44	28	polymorphism	polymorphism	NOUN
hls-11302	44	29	the	the	DET
hls-11302	44	30	diagnosis	diagnosis	NOUN
hls-11302	44	31	is	be	AUX
hls-11302	44	32	based	base	VERB
hls-11302	44	33	on	on	ADP
hls-11302	44	34	clinical	clinical	ADJ
hls-11302	44	35	suspicion	suspicion	NOUN
hls-11302	44	36	,	,	PUNCT
hls-11302	44	37	woods	woods	PROPN
hls-11302	44	38	lamp	lamp	NOUN
hls-11302	44	39	(	(	PUNCT
hls-11302	44	40	365	365	NUM
hls-11302	44	41	nm	nm	NOUN
hls-11302	44	42	)	)	PUNCT
hls-11302	44	43	examination	examination	NOUN
hls-11302	44	44	showing	show	VERB
hls-11302	44	45	reddish	reddish	ADJ
hls-11302	44	46	or	or	CCONJ
hls-11302	44	47	yellowish	yellowish	VERB
hls-11302	44	48	green	green	ADJ
hls-11302	44	49	fluorescence	fluorescence	NOUN
hls-11302	44	50	and	and	CCONJ
hls-11302	44	51	the	the	DET
hls-11302	44	52	so	so	ADV
hls-11302	44	53	-	-	PUNCT
hls-11302	44	54	called	call	VERB
hls-11302	44	55	evoked	evoked	ADJ
hls-11302	44	56	scale	scale	NOUN
hls-11302	44	57	sign.9.10	sign.9.10	PROPN
hls-11302	44	58	direct	direct	ADJ
hls-11302	44	59	microscopic	microscopic	ADJ
hls-11302	44	60	examinations	examination	NOUN
hls-11302	44	61	with	with	ADP
hls-11302	44	62	10	10	NUM
hls-11302	44	63	%	%	NOUN
hls-11302	44	64	koh	koh	PROPN
hls-11302	44	65	were	be	AUX
hls-11302	44	66	done	do	VERB
hls-11302	44	67	for	for	ADP
hls-11302	44	68	numerous	numerous	ADJ
hls-11302	44	69	budding	bud	VERB
hls-11302	44	70	yeast	yeast	NOUN
hls-11302	44	71	cells	cell	NOUN
hls-11302	44	72	and	and	CCONJ
hls-11302	44	73	short	short	ADJ
hls-11302	44	74	hyphae	hyphae	ADJ
hls-11302	44	75	characteristic	characteristic	NOUN
hls-11302	44	76	of	of	ADP
hls-11302	44	77	the	the	DET
hls-11302	44	78	‘	'	PUNCT
hls-11302	44	79	spaghetti	spaghetti	NOUN
hls-11302	44	80	and	and	CCONJ
hls-11302	44	81	meatball	meatball	NOUN
hls-11302	44	82	’	'	PUNCT
hls-11302	44	83	appearance	appearance	NOUN
hls-11302	44	84	.	.	PUNCT
hls-11302	45	1	blood	blood	NOUN
hls-11302	45	2	samples	sample	NOUN
hls-11302	45	3	were	be	AUX
hls-11302	45	4	kept	keep	VERB
hls-11302	45	5	at	at	ADP
hls-11302	45	6	40	40	NUM
hls-11302	45	7	°	°	NOUN
hls-11302	45	8	c	c	NOUN
hls-11302	45	9	till	till	SCONJ
hls-11302	45	10	further	further	ADJ
hls-11302	45	11	use	use	NOUN
hls-11302	45	12	.	.	PUNCT
hls-11302	46	1	genomic	genomic	ADJ
hls-11302	46	2	dna	dna	PROPN
hls-11302	46	3	extraction	extraction	NOUN
hls-11302	46	4	genomic	genomic	NOUN
hls-11302	46	5	dna	dna	PROPN
hls-11302	46	6	was	be	AUX
hls-11302	46	7	extracted	extract	VERB
hls-11302	46	8	from	from	ADP
hls-11302	46	9	blood	blood	NOUN
hls-11302	46	10	samples	sample	NOUN
hls-11302	46	11	of	of	ADP
hls-11302	46	12	all	all	DET
hls-11302	46	13	study	study	NOUN
hls-11302	46	14	subjects	subject	NOUN
hls-11302	46	15	for	for	ADP
hls-11302	46	16	determining	determine	VERB
hls-11302	46	17	three	three	NUM
hls-11302	46	18	snps	snps	NOUN
hls-11302	46	19	in	in	ADP
hls-11302	46	20	two	two	NUM
hls-11302	46	21	cytokine	cytokine	ADJ
hls-11302	46	22	genes	gene	NOUN
hls-11302	46	23	through	through	ADP
hls-11302	46	24	amplification	amplification	NOUN
hls-11302	46	25	refractory	refractory	NOUN
hls-11302	46	26	mutation	mutation	NOUN
hls-11302	46	27	system	system	NOUN
hls-11302	46	28	-	-	PUNCT
hls-11302	46	29	polymerase	polymerase	NOUN
hls-11302	46	30	chain	chain	NOUN
hls-11302	46	31	reaction	reaction	NOUN
hls-11302	46	32	using	use	VERB
hls-11302	46	33	sequence	sequence	NOUN
hls-11302	46	34	-	-	PUNCT
hls-11302	46	35	specific	specific	ADJ
hls-11302	46	36	primers.11	primers.11	NOUN
hls-11302	46	37	genomic	genomic	ADJ
hls-11302	46	38	dna	dna	NOUN
hls-11302	46	39	was	be	AUX
hls-11302	46	40	extracted	extract	VERB
hls-11302	46	41	from	from	ADP
hls-11302	46	42	edta	edta	NOUN
hls-11302	47	1	anticoagulated	anticoagulate	VERB
hls-11302	47	2	peripheral	peripheral	ADJ
hls-11302	47	3	blood	blood	NOUN
hls-11302	47	4	using	use	VERB
hls-11302	47	5	a	a	DET
hls-11302	47	6	hipuratm	hipuratm	ADJ
hls-11302	47	7	blood	blood	NOUN
hls-11302	47	8	genomic	genomic	NOUN
hls-11302	47	9	dna	dna	PROPN
hls-11302	47	10	extraction	extraction	NOUN
hls-11302	47	11	kit	kit	NOUN
hls-11302	47	12	(	(	PUNCT
hls-11302	47	13	himedia	himedia	NOUN
hls-11302	47	14	laboratories	laboratory	NOUN
hls-11302	47	15	,	,	PUNCT
hls-11302	47	16	mumbai	mumbai	PROPN
hls-11302	47	17	,	,	PUNCT
hls-11302	47	18	india	india	PROPN
hls-11302	47	19	)	)	PUNCT
hls-11302	47	20	following	follow	VERB
hls-11302	47	21	the	the	DET
hls-11302	47	22	manufacturer	manufacturer	NOUN
hls-11302	47	23	’s	’s	PART
hls-11302	47	24	instructions	instruction	NOUN
hls-11302	47	25	.	.	PUNCT
hls-11302	48	1	200µl	200µl	ADJ
hls-11302	48	2	blood	blood	NOUN
hls-11302	48	3	sample	sample	NOUN
hls-11302	48	4	was	be	AUX
hls-11302	48	5	collected	collect	VERB
hls-11302	48	6	in	in	ADP
hls-11302	48	7	a	a	DET
hls-11302	48	8	2.0ml	2.0ml	NUM
hls-11302	48	9	collection	collection	NOUN
hls-11302	48	10	tube	tube	NOUN
hls-11302	48	11	,	,	PUNCT
hls-11302	48	12	and	and	CCONJ
hls-11302	48	13	20	20	NUM
hls-11302	48	14	µl	µl	NOUN
hls-11302	48	15	of	of	ADP
hls-11302	48	16	the	the	DET
hls-11302	48	17	reconstituted	reconstitute	VERB
hls-11302	48	18	proteinase	proteinase	NOUN
hls-11302	48	19	k	k	PROPN
hls-11302	48	20	solution	solution	NOUN
hls-11302	48	21	(	(	PUNCT
hls-11302	48	22	20	20	NUM
hls-11302	48	23	mg	mg	NUM
hls-11302	48	24	/	/	SYM
hls-11302	48	25	ml	ml	NOUN
hls-11302	48	26	)	)	PUNCT
hls-11302	48	27	was	be	AUX
hls-11302	48	28	added	add	VERB
hls-11302	48	29	.	.	PUNCT
hls-11302	49	1	the	the	DET
hls-11302	49	2	sample	sample	NOUN
hls-11302	49	3	was	be	AUX
hls-11302	49	4	vortexed	vortexe	VERB
hls-11302	49	5	for	for	ADP
hls-11302	49	6	10	10	NUM
hls-11302	49	7	-	-	SYM
hls-11302	49	8	15	15	NUM
hls-11302	49	9	seconds	second	NOUN
hls-11302	49	10	to	to	PART
hls-11302	49	11	ensure	ensure	VERB
hls-11302	49	12	thorough	thorough	ADJ
hls-11302	49	13	mixing	mixing	NOUN
hls-11302	49	14	.	.	PUNCT
hls-11302	50	1	to	to	PART
hls-11302	50	2	extract	extract	VERB
hls-11302	50	3	rna	rna	NOUN
hls-11302	50	4	-	-	PUNCT
hls-11302	50	5	free	free	ADJ
hls-11302	50	6	genomic	genomic	NOUN
hls-11302	50	7	dna	dna	NOUN
hls-11302	50	8	,	,	PUNCT
hls-11302	50	9	20	20	NUM
hls-11302	50	10	µl	µl	NOUN
hls-11302	50	11	of	of	ADP
hls-11302	50	12	rnase	rnase	PROPN
hls-11302	50	13	a	a	DET
hls-11302	50	14	solution	solution	NOUN
hls-11302	50	15	(	(	PUNCT
hls-11302	50	16	20	20	NUM
hls-11302	50	17	mg	mg	NUM
hls-11302	50	18	/	/	SYM
hls-11302	50	19	ml	ml	NOUN
hls-11302	50	20	)	)	PUNCT
hls-11302	50	21	was	be	AUX
hls-11302	50	22	added	add	VERB
hls-11302	50	23	,	,	PUNCT
hls-11302	50	24	and	and	CCONJ
hls-11302	50	25	the	the	DET
hls-11302	50	26	mixture	mixture	NOUN
hls-11302	50	27	vortexed	vortexe	VERB
hls-11302	50	28	again	again	ADV
hls-11302	50	29	for	for	ADP
hls-11302	50	30	10	10	NUM
hls-11302	50	31	-	-	SYM
hls-11302	50	32	15	15	NUM
hls-11302	50	33	seconds	second	NOUN
hls-11302	50	34	.	.	PUNCT
hls-11302	51	1	the	the	DET
hls-11302	51	2	sample	sample	NOUN
hls-11302	51	3	was	be	AUX
hls-11302	51	4	then	then	ADV
hls-11302	51	5	incubated	incubate	VERB
hls-11302	51	6	for	for	ADP
hls-11302	51	7	2	2	NUM
hls-11302	51	8	minutes	minute	NOUN
hls-11302	51	9	at	at	ADP
hls-11302	51	10	room	room	NOUN
hls-11302	51	11	temperature	temperature	NOUN
hls-11302	51	12	(	(	PUNCT
hls-11302	51	13	15	15	NUM
hls-11302	51	14	-	-	SYM
hls-11302	51	15	250	250	NUM
hls-11302	51	16	°	°	NOUN
hls-11302	51	17	c	c	NOUN
hls-11302	51	18	)	)	PUNCT
hls-11302	51	19	.	.	PUNCT
hls-11302	52	1	following	follow	VERB
hls-11302	52	2	this	this	PRON
hls-11302	52	3	,	,	PUNCT
hls-11302	52	4	200	200	NUM
hls-11302	52	5	µl	µl	NOUN
hls-11302	52	6	of	of	ADP
hls-11302	52	7	the	the	DET
hls-11302	52	8	lysis	lysis	NOUN
hls-11302	52	9	solution	solution	NOUN
hls-11302	52	10	(	(	PUNCT
hls-11302	52	11	c1	c1	PROPN
hls-11302	52	12	)	)	PUNCT
hls-11302	52	13	was	be	AUX
hls-11302	52	14	added	add	VERB
hls-11302	52	15	to	to	ADP
hls-11302	52	16	the	the	DET
hls-11302	52	17	sample	sample	NOUN
hls-11302	52	18	and	and	CCONJ
hls-11302	52	19	vortexed	vortexe	VERB
hls-11302	52	20	thoroughly	thoroughly	ADV
hls-11302	52	21	for	for	ADP
hls-11302	52	22	a	a	DET
hls-11302	52	23	few	few	ADJ
hls-11302	52	24	seconds	second	NOUN
hls-11302	52	25	to	to	PART
hls-11302	52	26	obtain	obtain	VERB
hls-11302	52	27	a	a	DET
hls-11302	52	28	homogenous	homogenous	ADJ
hls-11302	52	29	mixture	mixture	NOUN
hls-11302	52	30	.	.	PUNCT
hls-11302	53	1	the	the	DET
hls-11302	53	2	sample	sample	NOUN
hls-11302	53	3	was	be	AUX
hls-11302	53	4	incubated	incubate	VERB
hls-11302	53	5	at	at	ADP
hls-11302	53	6	550	550	NUM
hls-11302	53	7	°	°	ADP
hls-11302	53	8	c	c	NOUN
hls-11302	53	9	for	for	ADP
hls-11302	53	10	10	10	NUM
hls-11302	53	11	minutes	minute	NOUN
hls-11302	53	12	in	in	ADP
hls-11302	53	13	a	a	DET
hls-11302	53	14	water	water	NOUN
hls-11302	53	15	bath	bath	NOUN
hls-11302	53	16	.	.	PUNCT
hls-11302	54	1	the	the	DET
hls-11302	54	2	lysate	lysate	NOUN
hls-11302	54	3	for	for	ADP
hls-11302	54	4	binding	bind	VERB
hls-11302	54	5	to	to	ADP
hls-11302	54	6	the	the	DET
hls-11302	54	7	spin	spin	NOUN
hls-11302	54	8	column	column	NOUN
hls-11302	54	9	was	be	AUX
hls-11302	54	10	prepared	prepare	VERB
hls-11302	54	11	as	as	SCONJ
hls-11302	54	12	follows	follow	VERB
hls-11302	54	13	;	;	PUNCT
hls-11302	54	14	200	200	NUM
hls-11302	54	15	µl	µl	ADP
hls-11302	54	16	ethanol	ethanol	NOUN
hls-11302	54	17	(	(	PUNCT
hls-11302	54	18	96	96	NUM
hls-11302	54	19	-	-	SYM
hls-11302	54	20	100	100	NUM
hls-11302	54	21	%	%	NOUN
hls-11302	54	22	)	)	PUNCT
hls-11302	54	23	was	be	AUX
hls-11302	54	24	added	add	VERB
hls-11302	54	25	to	to	ADP
hls-11302	54	26	the	the	DET
hls-11302	54	27	lysate	lysate	NOUN
hls-11302	54	28	obtained	obtain	VERB
hls-11302	54	29	from	from	ADP
hls-11302	54	30	the	the	DET
hls-11302	54	31	above	above	ADJ
hls-11302	54	32	step	step	NOUN
hls-11302	54	33	and	and	CCONJ
hls-11302	54	34	mixed	mix	VERB
hls-11302	54	35	thoroughly	thoroughly	ADV
hls-11302	54	36	by	by	ADP
hls-11302	54	37	gentle	gentle	ADJ
hls-11302	54	38	pipetting	pipetting	NOUN
hls-11302	54	39	.	.	PUNCT
hls-11302	55	1	lysate	lysate	PROPN
hls-11302	55	2	was	be	AUX
hls-11302	55	3	transferred	transfer	VERB
hls-11302	55	4	into	into	ADP
hls-11302	55	5	the	the	DET
hls-11302	55	6	spin	spin	NOUN
hls-11302	55	7	column	column	NOUN
hls-11302	55	8	provided	provide	VERB
hls-11302	55	9	with	with	ADP
hls-11302	55	10	the	the	DET
hls-11302	55	11	kit	kit	NOUN
hls-11302	55	12	and	and	CCONJ
hls-11302	55	13	centrifuged	centrifuge	VERB
hls-11302	55	14	at	at	ADP
hls-11302	55	15	10,000	10,000	NUM
hls-11302	55	16	rpm	rpm	NOUN
hls-11302	55	17	for	for	ADP
hls-11302	55	18	1	1	NUM
hls-11302	55	19	minute	minute	NOUN
hls-11302	55	20	.	.	PUNCT
hls-11302	56	1	the	the	DET
hls-11302	56	2	flow	flow	NOUN
hls-11302	56	3	-	-	PUNCT
hls-11302	56	4	through	through	ADP
hls-11302	56	5	liquid	liquid	NOUN
hls-11302	56	6	was	be	AUX
hls-11302	56	7	discarded	discard	VERB
hls-11302	56	8	and	and	CCONJ
hls-11302	56	9	the	the	DET
hls-11302	56	10	column	column	NOUN
hls-11302	56	11	was	be	AUX
hls-11302	56	12	placed	place	VERB
hls-11302	56	13	in	in	ADP
hls-11302	56	14	a	a	DET
hls-11302	56	15	new	new	ADJ
hls-11302	56	16	2.0	2.0	NUM
hls-11302	56	17	ml	ml	NOUN
hls-11302	56	18	collection	collection	NOUN
hls-11302	56	19	tube	tube	NOUN
hls-11302	56	20	;	;	PUNCT
hls-11302	56	21	500µl	500µl	NOUN
hls-11302	56	22	of	of	ADP
hls-11302	56	23	diluted	diluted	ADJ
hls-11302	56	24	pre	pre	ADJ
hls-11302	56	25	-	-	ADJ
hls-11302	56	26	wash	wash	ADJ
hls-11302	56	27	solution	solution	NOUN
hls-11302	56	28	was	be	AUX
hls-11302	56	29	added	add	VERB
hls-11302	56	30	to	to	ADP
hls-11302	56	31	the	the	DET
hls-11302	56	32	column	column	NOUN
hls-11302	56	33	and	and	CCONJ
hls-11302	56	34	centrifuged	centrifuge	VERB
hls-11302	56	35	at	at	ADP
hls-11302	56	36	10,000	10,000	NUM
hls-11302	56	37	rpm	rpm	NOUN
hls-11302	56	38	for	for	ADP
hls-11302	56	39	1	1	NUM
hls-11302	56	40	minute	minute	NOUN
hls-11302	56	41	.	.	PUNCT
hls-11302	57	1	after	after	ADP
hls-11302	57	2	discarding	discard	VERB
hls-11302	57	3	the	the	DET
hls-11302	57	4	flow	flow	NOUN
hls-11302	57	5	-	-	PUNCT
hls-11302	57	6	through	through	ADP
hls-11302	57	7	liquid	liquid	NOUN
hls-11302	57	8	,	,	PUNCT
hls-11302	57	9	500	500	NUM
hls-11302	57	10	µl	µl	NOUN
hls-11302	57	11	of	of	ADP
hls-11302	57	12	diluted	dilute	VERB
hls-11302	57	13	wash	wash	NOUN
hls-11302	57	14	solution	solution	NOUN
hls-11302	57	15	was	be	AUX
hls-11302	57	16	added	add	VERB
hls-11302	57	17	to	to	ADP
hls-11302	57	18	the	the	DET
hls-11302	57	19	column	column	NOUN
hls-11302	57	20	and	and	CCONJ
hls-11302	57	21	centrifuged	centrifuge	VERB
hls-11302	57	22	at	at	ADP
hls-11302	57	23	13,00016,000	13,00016,000	NUM
hls-11302	57	24	rpm	rpm	NOUN
hls-11302	57	25	for	for	ADP
hls-11302	57	26	3	3	NUM
hls-11302	57	27	minutes	minute	NOUN
hls-11302	57	28	to	to	PART
hls-11302	57	29	dry	dry	VERB
hls-11302	57	30	the	the	DET
hls-11302	57	31	column	column	NOUN
hls-11302	57	32	.	.	PUNCT
hls-11302	58	1	flow	flow	NOUN
hls-11302	58	2	-	-	PUNCT
hls-11302	58	3	through	through	ADP
hls-11302	58	4	liquid	liquid	NOUN
hls-11302	58	5	was	be	AUX
hls-11302	58	6	discarded	discard	VERB
hls-11302	58	7	and	and	CCONJ
hls-11302	58	8	a	a	DET
hls-11302	58	9	dry	dry	ADJ
hls-11302	58	10	spin	spin	NOUN
hls-11302	58	11	was	be	AUX
hls-11302	58	12	given	give	VERB
hls-11302	58	13	at	at	ADP
hls-11302	58	14	the	the	DET
hls-11302	58	15	same	same	ADJ
hls-11302	58	16	speed	speed	NOUN
hls-11302	58	17	to	to	PART
hls-11302	58	18	remove	remove	VERB
hls-11302	58	19	the	the	DET
hls-11302	58	20	residual	residual	ADJ
hls-11302	58	21	ethanol	ethanol	NOUN
hls-11302	58	22	,	,	PUNCT
hls-11302	58	23	if	if	SCONJ
hls-11302	58	24	any	any	PRON
hls-11302	58	25	.	.	PUNCT
hls-11302	59	1	the	the	DET
hls-11302	59	2	column	column	NOUN
hls-11302	59	3	was	be	AUX
hls-11302	59	4	put	put	VERB
hls-11302	59	5	in	in	ADP
hls-11302	59	6	a	a	DET
hls-11302	59	7	new	new	ADJ
hls-11302	59	8	2.0ml	2.0ml	NUM
hls-11302	59	9	collection	collection	NOUN
hls-11302	59	10	tube	tube	NOUN
hls-11302	59	11	and	and	CCONJ
hls-11302	59	12	200	200	NUM
hls-11302	59	13	µl	µl	ADP
hls-11302	59	14	elution	elution	NOUN
hls-11302	59	15	buffer	buffer	NOUN
hls-11302	59	16	was	be	AUX
hls-11302	59	17	added	add	VERB
hls-11302	59	18	without	without	ADP
hls-11302	59	19	spilling	spill	VERB
hls-11302	59	20	to	to	ADP
hls-11302	59	21	the	the	DET
hls-11302	59	22	sides	side	NOUN
hls-11302	59	23	.	.	PUNCT
hls-11302	60	1	the	the	DET
hls-11302	60	2	column	column	NOUN
hls-11302	60	3	was	be	AUX
hls-11302	60	4	incubated	incubate	VERB
hls-11302	60	5	at	at	ADP
hls-11302	60	6	room	room	NOUN
hls-11302	60	7	temperature	temperature	NOUN
hls-11302	60	8	for	for	ADP
hls-11302	60	9	5	5	NUM
hls-11302	60	10	minutes	minute	NOUN
hls-11302	60	11	for	for	ADP
hls-11302	60	12	a	a	DET
hls-11302	60	13	high	high	ADJ
hls-11302	60	14	yield	yield	NOUN
hls-11302	60	15	of	of	ADP
hls-11302	60	16	dna	dna	NOUN
hls-11302	60	17	and	and	CCONJ
hls-11302	60	18	then	then	ADV
hls-11302	60	19	centrifuged	centrifuge	VERB
hls-11302	60	20	at	at	ADP
hls-11302	60	21	10,000	10,000	NUM
hls-11302	60	22	rpm	rpm	NOUN
hls-11302	60	23	for	for	ADP
hls-11302	60	24	1	1	NUM
hls-11302	60	25	minute	minute	NOUN
hls-11302	60	26	to	to	PART
hls-11302	60	27	elute	elute	VERB
hls-11302	60	28	the	the	DET
hls-11302	60	29	dna	dna	NOUN
hls-11302	60	30	.	.	PUNCT
hls-11302	61	1	the	the	DET
hls-11302	61	2	samples	sample	NOUN
hls-11302	61	3	were	be	AUX
hls-11302	61	4	stored	store	VERB
hls-11302	61	5	at	at	ADP
hls-11302	61	6	-200c	-200c	PROPN
hls-11302	61	7	until	until	SCONJ
hls-11302	61	8	used	use	VERB
hls-11302	61	9	.	.	PUNCT
hls-11302	62	1	dna	dna	PROPN
hls-11302	62	2	samples	sample	NOUN
hls-11302	62	3	were	be	AUX
hls-11302	62	4	subjected	subject	VERB
hls-11302	62	5	to	to	ADP
hls-11302	62	6	specific	specific	ADJ
hls-11302	62	7	pcr	pcr	ADJ
hls-11302	62	8	reactions	reaction	NOUN
hls-11302	62	9	in	in	ADP
hls-11302	62	10	cytokine	cytokine	ADJ
hls-11302	62	11	genotyping	genotyping	NOUN
hls-11302	62	12	.	.	PUNCT
hls-11302	63	1	cytokine	cytokine	NOUN
hls-11302	63	2	genotyping	genotype	VERB
hls-11302	63	3	by	by	ADP
hls-11302	63	4	amplification	amplification	NOUN
hls-11302	63	5	refractory	refractory	NOUN
hls-11302	63	6	mutations	mutation	NOUN
hls-11302	63	7	systempolymerase	systempolymerase	NOUN
hls-11302	63	8	chain	chain	NOUN
hls-11302	63	9	reaction	reaction	NOUN
hls-11302	63	10	(	(	PUNCT
hls-11302	63	11	armspcr	armspcr	ADJ
hls-11302	63	12	)	)	PUNCT
hls-11302	63	13	amplification	amplification	NOUN
hls-11302	63	14	refractory	refractory	NOUN
hls-11302	63	15	mutations	mutation	NOUN
hls-11302	63	16	system	system	NOUN
hls-11302	63	17	-	-	PUNCT
hls-11302	63	18	polymerase	polymerase	NOUN
hls-11302	63	19	chain	chain	NOUN
hls-11302	63	20	reaction	reaction	NOUN
hls-11302	63	21	(	(	PUNCT
hls-11302	63	22	armspcr	armspcr	ADJ
hls-11302	63	23	)	)	PUNCT
hls-11302	63	24	with	with	ADP
hls-11302	63	25	sequence	sequence	NOUN
hls-11302	63	26	-	-	PUNCT
hls-11302	63	27	specific	specific	ADJ
hls-11302	63	28	primers	primer	NOUN
hls-11302	63	29	was	be	AUX
hls-11302	63	30	used	use	VERB
hls-11302	63	31	to	to	PART
hls-11302	63	32	genotype	genotype	VERB
hls-11302	63	33	cytokines	cytokine	NOUN
hls-11302	63	34	from	from	ADP
hls-11302	63	35	genomic	genomic	ADJ
hls-11302	63	36	dna	dna	PROPN
hls-11302	63	37	(	(	PUNCT
hls-11302	63	38	sigma	sigma	PROPN
hls-11302	63	39	aldrich	aldrich	PROPN
hls-11302	63	40	,	,	PUNCT
hls-11302	63	41	banglore	banglore	PROPN
hls-11302	63	42	,	,	PUNCT
hls-11302	63	43	india).7,8	india).7,8	NOUN
hls-11302	63	44	all	all	PRON
hls-11302	63	45	of	of	ADP
hls-11302	63	46	the	the	DET
hls-11302	63	47	patients	patient	NOUN
hls-11302	63	48	and	and	CCONJ
hls-11302	63	49	healthy	healthy	ADJ
hls-11302	63	50	controls	control	NOUN
hls-11302	63	51	were	be	AUX
hls-11302	63	52	tested	test	VERB
hls-11302	63	53	for	for	ADP
hls-11302	63	54	three	three	NUM
hls-11302	63	55	snps	snps	NOUN
hls-11302	63	56	(	(	PUNCT
hls-11302	63	57	il10	il10	PROPN
hls-11302	63	58	-	-	PUNCT
hls-11302	63	59	1082a	1082a	NUM
hls-11302	63	60	/	/	SYM
hls-11302	63	61	g	g	NOUN
hls-11302	63	62	,	,	PUNCT
hls-11302	63	63	il10819/592c	il10819/592c	NOUN
hls-11302	63	64	/	/	SYM
hls-11302	63	65	t	t	PROPN
hls-11302	63	66	,	,	PUNCT
hls-11302	63	67	and	and	CCONJ
hls-11302	63	68	ifn	ifn	PROPN
hls-11302	63	69	+874a	+874a	PROPN
hls-11302	63	70	/	/	SYM
hls-11302	63	71	t	t	PROPN
hls-11302	63	72	)	)	PUNCT
hls-11302	63	73	in	in	ADP
hls-11302	63	74	two	two	NUM
hls-11302	63	75	cytokine	cytokine	ADJ
hls-11302	63	76	genes	gene	NOUN
hls-11302	63	77	.	.	PUNCT
hls-11302	64	1	the	the	DET
hls-11302	64	2	pcr	pcr	PROPN
hls-11302	64	3	products	product	NOUN
hls-11302	64	4	were	be	AUX
hls-11302	64	5	loaded	load	VERB
hls-11302	64	6	onto	onto	ADP
hls-11302	64	7	a	a	DET
hls-11302	64	8	1	1	NUM
hls-11302	64	9	percent	percent	NOUN
hls-11302	64	10	agarose	agarose	NOUN
hls-11302	64	11	gel	gel	NOUN
hls-11302	64	12	in	in	ADP
hls-11302	64	13	a	a	DET
hls-11302	64	14	specific	specific	ADJ
hls-11302	64	15	order	order	NOUN
hls-11302	64	16	for	for	ADP
hls-11302	64	17	electrophoresis	electrophoresis	NOUN
hls-11302	64	18	and	and	CCONJ
hls-11302	64	19	run	run	VERB
hls-11302	64	20	at	at	ADP
hls-11302	64	21	150	150	NUM
hls-11302	64	22	volts	volt	NOUN
hls-11302	64	23	for	for	ADP
hls-11302	64	24	20	20	NUM
hls-11302	64	25	-	-	SYM
hls-11302	64	26	25	25	NUM
hls-11302	64	27	minutes	minute	NOUN
hls-11302	64	28	for	for	ADP
hls-11302	64	29	separating	separate	VERB
hls-11302	64	30	the	the	DET
hls-11302	64	31	dna	dna	NOUN
hls-11302	64	32	.	.	PUNCT
hls-11302	65	1	ethidium	ethidium	ADJ
hls-11302	65	2	bromide	bromide	NOUN
hls-11302	65	3	-	-	PUNCT
hls-11302	65	4	stained	stain	VERB
hls-11302	65	5	gel	gel	NOUN
hls-11302	65	6	was	be	AUX
hls-11302	65	7	taken	take	VERB
hls-11302	65	8	and	and	CCONJ
hls-11302	65	9	examined	examine	VERB
hls-11302	65	10	for	for	ADP
hls-11302	65	11	distinct	distinct	ADJ
hls-11302	65	12	amplification	amplification	NOUN
hls-11302	65	13	patterns	pattern	NOUN
hls-11302	65	14	following	follow	VERB
hls-11302	65	15	electrophoresis	electrophoresis	NOUN
hls-11302	65	16	.	.	PUNCT
hls-11302	66	1	a	a	DET
hls-11302	66	2	control	control	NOUN
hls-11302	66	3	band	band	NOUN
hls-11302	66	4	was	be	AUX
hls-11302	66	5	confirmed	confirm	VERB
hls-11302	66	6	to	to	PART
hls-11302	66	7	be	be	AUX
hls-11302	66	8	present	present	ADJ
hls-11302	66	9	in	in	ADP
hls-11302	66	10	each	each	DET
hls-11302	66	11	lane	lane	NOUN
hls-11302	66	12	(	(	PUNCT
hls-11302	66	13	globulin	globulin	NOUN
hls-11302	66	14	,	,	PUNCT
hls-11302	66	15	100	100	NUM
hls-11302	66	16	bp	bp	NOUN
hls-11302	66	17	)	)	PUNCT
hls-11302	66	18	.	.	PUNCT
hls-11302	67	1	the	the	DET
hls-11302	67	2	bands	band	NOUN
hls-11302	67	3	in	in	ADP
hls-11302	67	4	the	the	DET
hls-11302	67	5	wells	well	NOUN
hls-11302	67	6	used	use	VERB
hls-11302	67	7	to	to	PART
hls-11302	67	8	detect	detect	VERB
hls-11302	67	9	the	the	DET
hls-11302	67	10	cytokines	cytokine	NOUN
hls-11302	67	11	il101082	il101082	PROPN
hls-11302	67	12	and	and	CCONJ
hls-11302	67	13	il10	il10	PROPN
hls-11302	67	14	-	-	PUNCT
hls-11302	67	15	819/592	819/592	PROPN
hls-11302	67	16	were	be	AUX
hls-11302	67	17	258	258	NUM
hls-11302	67	18	bp	bp	NOUN
hls-11302	67	19	and	and	CCONJ
hls-11302	67	20	233	233	NUM
hls-11302	67	21	bp	bp	NOUN
hls-11302	67	22	,	,	PUNCT
hls-11302	67	23	respectively.7	respectively.7	VERB
hls-11302	67	24	wells	wells	PROPN
hls-11302	67	25	identified	identify	VERB
hls-11302	67	26	the	the	DET
hls-11302	67	27	ifnγ	ifnγ	NOUN
hls-11302	67	28	+874	+874	NUM
hls-11302	67	29	cytokines	cytokine	NOUN
hls-11302	67	30	contained	contain	VERB
hls-11302	67	31	a	a	DET
hls-11302	67	32	band	band	NOUN
hls-11302	67	33	of	of	ADP
hls-11302	67	34	261bp.12	261bp.12	NUM
hls-11302	67	35	the	the	DET
hls-11302	67	36	primer	primer	NOUN
hls-11302	67	37	sequence	sequence	NOUN
hls-11302	67	38	is	be	AUX
hls-11302	67	39	as	as	SCONJ
hls-11302	67	40	follows	follow	VERB
hls-11302	67	41	:	:	PUNCT
hls-11302	67	42	il-10	il-10	NOUN
hls-11302	67	43	-1082g	-1082g	ADJ
hls-11302	67	44	/	/	SYM
hls-11302	67	45	a	a	DET
hls-11302	67	46	common	common	ADJ
hls-11302	67	47	primer	primer	NOUN
hls-11302	67	48	:	:	PUNCT
hls-11302	67	49	5	5	NUM
hls-11302	67	50	’	'	PUNCT
hls-11302	67	51	–	–	PUNCT
hls-11302	67	52	cagtgccaactgagaatttgg	cagtgccaactgagaatttgg	NOUN
hls-11302	67	53	–	–	PUNCT
hls-11302	67	54	3	3	NUM
hls-11302	67	55	’	'	PUNCT
hls-11302	67	56	g	g	NOUN
hls-11302	67	57	allele	allele	NOUN
hls-11302	67	58	:	:	PUNCT
hls-11302	67	59	5	5	NUM
hls-11302	67	60	’	'	PUNCT
hls-11302	67	61	–	–	PUNCT
hls-11302	67	62	ctactaaggcttctttgggag	ctactaaggcttctttgggag	NOUN
hls-11302	67	63	–	–	PUNCT
hls-11302	67	64	3	3	NUM
hls-11302	67	65	’	'	PUNCT
hls-11302	67	66	a	a	DET
hls-11302	67	67	allele	allele	NOUN
hls-11302	67	68	:	:	PUNCT
hls-11302	67	69	5	5	NUM
hls-11302	67	70	’	'	PUNCT
hls-11302	67	71	–	–	PUNCT
hls-11302	67	72	actactaaggcttctttgggaa	actactaaggcttctttgggaa	NUM
hls-11302	67	73	–	–	PUNCT
hls-11302	67	74	3	3	NUM
hls-11302	67	75	’	'	PUNCT
hls-11302	67	76	il-10	il-10	NOUN
hls-11302	67	77	-819c	-819c	PROPN
hls-11302	67	78	/	/	SYM
hls-11302	67	79	t	t	PROPN
hls-11302	67	80	/	/	SYM
hls-11302	67	81	-592c	-592c	PROPN
hls-11302	67	82	/	/	SYM
hls-11302	67	83	a	a	DET
hls-11302	67	84	common	common	ADJ
hls-11302	67	85	primer	primer	NOUN
hls-11302	67	86	:	:	PUNCT
hls-11302	67	87	5	5	NUM
hls-11302	67	88	’	'	PUNCT
hls-11302	67	89	–	–	PUNCT
hls-11302	67	90	aggatgtgttccaggctcct	aggatgtgttccaggctcct	NOUN
hls-11302	67	91	–	–	PUNCT
hls-11302	67	92	3	3	NUM
hls-11302	67	93	’	'	PUNCT
hls-11302	67	94	c	c	NOUN
hls-11302	67	95	allele	allele	NOUN
hls-11302	67	96	:	:	PUNCT
hls-11302	67	97	5	5	NUM
hls-11302	67	98	’	'	PUNCT
hls-11302	67	99	–	–	PUNCT
hls-11302	67	100	cccttgtacaggtgatgtaac	cccttgtacaggtgatgtaac	ADJ
hls-11302	67	101	–	–	PUNCT
hls-11302	67	102	3	3	NUM
hls-11302	67	103	’	'	PUNCT
hls-11302	67	104	t	t	NOUN
hls-11302	67	105	allele	allele	PROPN
hls-11302	67	106	:	:	PUNCT
hls-11302	67	107	5	5	NUM
hls-11302	67	108	’	'	PUNCT
hls-11302	67	109	–	–	PUNCT
hls-11302	67	110	acccttgtacaggtgatgtaat	acccttgtacaggtgatgtaat	INTJ
hls-11302	67	111	–	–	PUNCT
hls-11302	67	112	3	3	NUM
hls-11302	67	113	’	'	PUNCT
hls-11302	67	114	ifn	ifn	PROPN
hls-11302	67	115	-	-	PUNCT
hls-11302	67	116	γ	γ	NOUN
hls-11302	67	117	+874t	+874t	PROPN
hls-11302	67	118	/	/	SYM
hls-11302	67	119	a	a	DET
hls-11302	67	120	common	common	ADJ
hls-11302	67	121	primer	primer	NOUN
hls-11302	67	122	:	:	PUNCT
hls-11302	67	123	5	5	NUM
hls-11302	67	124	’	'	PUNCT
hls-11302	67	125	–	–	PUNCT
hls-11302	67	126	tcaacaaagctgatactcca	tcaacaaagctgatactcca	NOUN
hls-11302	67	127	–	–	PUNCT
hls-11302	67	128	3	3	NUM
hls-11302	67	129	’	'	PUNCT
hls-11302	67	130	a	a	DET
hls-11302	67	131	allele	allele	NOUN
hls-11302	67	132	:	:	PUNCT
hls-11302	67	133	5	5	NUM
hls-11302	67	134	’	'	PUNCT
hls-11302	67	135	–	–	PUNCT
hls-11302	67	136	ttcttacaacacaaaatcaaatca	ttcttacaacacaaaatcaaatca	ADJ
hls-11302	67	137	–	–	PUNCT
hls-11302	67	138	3	3	NUM
hls-11302	67	139	’	'	PUNCT
hls-11302	67	140	t	t	NOUN
hls-11302	67	141	allele	allele	PROPN
hls-11302	67	142	:	:	PUNCT
hls-11302	67	143	5	5	NUM
hls-11302	67	144	’	'	PUNCT
hls-11302	67	145	–	–	PUNCT
hls-11302	67	146	ttcttacaacacaaaatcaaatct	ttcttacaacacaaaatcaaatct	NOUN
hls-11302	67	147	–	–	PUNCT
hls-11302	67	148	3	3	NUM
hls-11302	67	149	’	'	PUNCT
hls-11302	67	150	β	β	NOUN
hls-11302	67	151	-	-	NOUN
hls-11302	67	152	globulin	globulin	NOUN
hls-11302	67	153	(	(	PUNCT
hls-11302	67	154	internal	internal	ADJ
hls-11302	67	155	control	control	NOUN
hls-11302	67	156	)	)	PUNCT
hls-11302	67	157	forward	forward	ADV
hls-11302	67	158	:	:	PUNCT
hls-11302	67	159	5	5	NUM
hls-11302	67	160	’	'	PUNCT
hls-11302	67	161	acacaactgtgttcactagc	acacaactgtgttcactagc	NOUN
hls-11302	67	162	–	–	PUNCT
hls-11302	67	163	3	3	NUM
hls-11302	67	164	’	'	PUNCT
hls-11302	67	165	reverse	reverse	NOUN
hls-11302	67	166	:	:	PUNCT
hls-11302	67	167	5	5	NUM
hls-11302	67	168	’	'	PUNCT
hls-11302	67	169	–	–	PUNCT
hls-11302	67	170	caacttcatccacgttcacc	caacttcatccacgttcacc	ADJ
hls-11302	67	171	–	–	PUNCT
hls-11302	67	172	3	3	NUM
hls-11302	67	173	’	'	PUNCT
hls-11302	67	174	statistical	statistical	ADJ
hls-11302	67	175	analysis	analysis	NOUN
hls-11302	67	176	cytokine	cytokine	ADJ
hls-11302	67	177	polymorphisms	polymorphism	NOUN
hls-11302	67	178	and	and	CCONJ
hls-11302	67	179	genotype	genotype	NOUN
hls-11302	67	180	frequencies	frequency	NOUN
hls-11302	67	181	were	be	AUX
hls-11302	67	182	evaluated	evaluate	VERB
hls-11302	67	183	by	by	ADP
hls-11302	67	184	gene	gene	NOUN
hls-11302	67	185	counts	count	NOUN
hls-11302	67	186	.	.	PUNCT
hls-11302	68	1	the	the	DET
hls-11302	68	2	observed	observe	VERB
hls-11302	68	3	and	and	CCONJ
hls-11302	68	4	expected	expect	VERB
hls-11302	68	5	genotype	genotype	NOUN
hls-11302	68	6	frequencies	frequency	NOUN
hls-11302	68	7	data	datum	NOUN
hls-11302	68	8	was	be	AUX
hls-11302	68	9	analyzed	analyze	VERB
hls-11302	68	10	using	use	VERB
hls-11302	68	11	chi	chi	PROPN
hls-11302	68	12	square	square	PROPN
hls-11302	68	13	test	test	NOUN
hls-11302	68	14	.	.	PUNCT
hls-11302	69	1	as	as	SCONJ
hls-11302	69	2	multiple	multiple	ADJ
hls-11302	69	3	comparisons	comparison	NOUN
hls-11302	69	4	were	be	AUX
hls-11302	69	5	made	make	VERB
hls-11302	69	6	,	,	PUNCT
hls-11302	69	7	bonferroni	bonferroni	PROPN
hls-11302	69	8	’s	’s	PART
hls-11302	69	9	correction	correction	NOUN
hls-11302	69	10	was	be	AUX
hls-11302	69	11	applied	apply	VERB
hls-11302	69	12	to	to	ADP
hls-11302	69	13	significant	significant	ADJ
hls-11302	69	14	p	p	NOUN
hls-11302	69	15	values	value	NOUN
hls-11302	69	16	(	(	PUNCT
hls-11302	69	17	p<0.02	p<0.02	NOUN
hls-11302	69	18	)	)	PUNCT
hls-11302	69	19	that	that	PRON
hls-11302	69	20	were	be	AUX
hls-11302	69	21	multiplied	multiply	VERB
hls-11302	69	22	for	for	ADP
hls-11302	69	23	the	the	DET
hls-11302	69	24	number	number	NOUN
hls-11302	69	25	of	of	ADP
hls-11302	69	26	genotypes	genotype	NOUN
hls-11302	69	27	detected.13	detected.13	ADV
hls-11302	70	1	but	but	CCONJ
hls-11302	70	2	,	,	PUNCT
hls-11302	70	3	as	as	SCONJ
hls-11302	70	4	p<0.05	p<0.05	NOUN
hls-11302	70	5	is	be	AUX
hls-11302	70	6	also	also	ADV
hls-11302	70	7	considered	consider	VERB
hls-11302	70	8	statistically	statistically	ADV
hls-11302	70	9	significant	significant	ADJ
hls-11302	70	10	in	in	ADP
hls-11302	70	11	a	a	DET
hls-11302	70	12	small	small	ADJ
hls-11302	70	13	study	study	NOUN
hls-11302	70	14	group	group	NOUN
hls-11302	70	15	,	,	PUNCT
hls-11302	70	16	our	our	PRON
hls-11302	70	17	discussion	discussion	NOUN
hls-11302	70	18	included	include	VERB
hls-11302	70	19	all	all	DET
hls-11302	70	20	variables	variable	NOUN
hls-11302	70	21	considering	consider	VERB
hls-11302	70	22	p<0.05	p<0.05	NOUN
hls-11302	70	23	as	as	ADP
hls-11302	70	24	significant	significant	ADJ
hls-11302	70	25	.	.	PUNCT
hls-11302	71	1	results	result	NOUN
hls-11302	71	2	clinically	clinically	ADV
hls-11302	71	3	diagnosed	diagnose	VERB
hls-11302	71	4	patients	patient	NOUN
hls-11302	71	5	with	with	ADP
hls-11302	71	6	pv	pv	INTJ
hls-11302	71	7	(	(	PUNCT
hls-11302	71	8	n=38	n=38	ADJ
hls-11302	71	9	;	;	PUNCT
hls-11302	71	10	23	23	NUM
hls-11302	71	11	males	male	NOUN
hls-11302	71	12	,	,	PUNCT
hls-11302	71	13	15	15	NUM
hls-11302	71	14	females	female	NOUN
hls-11302	71	15	)	)	PUNCT
hls-11302	71	16	were	be	AUX
hls-11302	71	17	included	include	VERB
hls-11302	71	18	in	in	ADP
hls-11302	71	19	the	the	DET
hls-11302	71	20	study	study	NOUN
hls-11302	71	21	.	.	PUNCT
hls-11302	72	1	healthy	healthy	ADJ
hls-11302	72	2	controls	control	NOUN
hls-11302	72	3	(	(	PUNCT
hls-11302	72	4	n=38	n=38	ADJ
hls-11302	72	5	;	;	PUNCT
hls-11302	72	6	21	21	NUM
hls-11302	72	7	males	male	NOUN
hls-11302	72	8	and	and	CCONJ
hls-11302	72	9	17	17	NUM
hls-11302	72	10	females	female	NOUN
hls-11302	72	11	)	)	PUNCT
hls-11302	72	12	were	be	AUX
hls-11302	72	13	unrelated	unrelated	ADJ
hls-11302	72	14	individuals	individual	NOUN
hls-11302	72	15	without	without	ADP
hls-11302	72	16	a	a	DET
hls-11302	72	17	clinical	clinical	ADJ
hls-11302	72	18	history	history	NOUN
hls-11302	72	19	of	of	ADP
hls-11302	72	20	any	any	DET
hls-11302	72	21	skin	skin	NOUN
hls-11302	72	22	disease	disease	NOUN
hls-11302	72	23	were	be	AUX
hls-11302	72	24	also	also	ADV
hls-11302	72	25	included	include	VERB
hls-11302	72	26	.	.	PUNCT
hls-11302	73	1	three	three	NUM
hls-11302	73	2	snps	snps	NOUN
hls-11302	73	3	in	in	ADP
hls-11302	73	4	2	2	NUM
hls-11302	73	5	cytokine	cytokine	NOUN
hls-11302	73	6	genes	gene	NOUN
hls-11302	73	7	were	be	AUX
hls-11302	73	8	investigated	investigate	VERB
hls-11302	73	9	in	in	ADP
hls-11302	73	10	all	all	DET
hls-11302	73	11	the	the	DET
hls-11302	73	12	subjects	subject	NOUN
hls-11302	73	13	by	by	ADP
hls-11302	73	14	cytokine	cytokine	ADJ
hls-11302	73	15	genotyping	genotyping	NOUN
hls-11302	73	16	using	use	VERB
hls-11302	73	17	sequence	sequence	NOUN
hls-11302	73	18	-	-	PUNCT
hls-11302	73	19	specific	specific	ADJ
hls-11302	73	20	primers	primer	NOUN
hls-11302	73	21	.	.	PUNCT
hls-11302	74	1	in	in	ADP
hls-11302	74	2	the	the	DET
hls-11302	74	3	case	case	NOUN
hls-11302	74	4	-	-	PUNCT
hls-11302	74	5	control	control	NOUN
hls-11302	74	6	study	study	NOUN
hls-11302	74	7	,	,	PUNCT
hls-11302	74	8	significant	significant	ADJ
hls-11302	74	9	differences	difference	NOUN
hls-11302	74	10	in	in	ADP
hls-11302	74	11	allele	allele	NOUN
hls-11302	74	12	,	,	PUNCT
hls-11302	74	13	or	or	CCONJ
hls-11302	74	14	genotype	genotype	NOUN
hls-11302	74	15	distribution	distribution	NOUN
hls-11302	74	16	were	be	AUX
hls-11302	74	17	observed	observe	VERB
hls-11302	74	18	in	in	ADP
hls-11302	74	19	il10	il10	PROPN
hls-11302	74	20	-	-	PUNCT
hls-11302	74	21	819/592c	819/592c	NUM
hls-11302	74	22	/	/	SYM
hls-11302	74	23	t	t	NOUN
hls-11302	74	24	(	(	PUNCT
hls-11302	74	25	rs1800871	rs1800871	PROPN
hls-11302	74	26	:	:	PUNCT
hls-11302	74	27	rs1800872	rs1800872	PROPN
hls-11302	74	28	)	)	PUNCT
hls-11302	74	29	and	and	CCONJ
hls-11302	74	30	ifnγ+874t	ifnγ+874t	NOUN
hls-11302	74	31	/	/	SYM
hls-11302	74	32	a	a	DET
hls-11302	74	33	(	(	PUNCT
hls-11302	74	34	rs2430561	rs2430561	NOUN
hls-11302	74	35	)	)	PUNCT
hls-11302	74	36	gene	gene	NOUN
hls-11302	74	37	polymorphisms	polymorphism	NOUN
hls-11302	74	38	(	(	PUNCT
hls-11302	74	39	table	table	NOUN
hls-11302	74	40	1	1	NUM
hls-11302	74	41	)	)	PUNCT
hls-11302	74	42	.	.	PUNCT
hls-11302	75	1	il10	il10	PROPN
hls-11302	75	2	-	-	PUNCT
hls-11302	75	3	1082	1082	NUM
hls-11302	75	4	g	g	NOUN
hls-11302	75	5	/	/	SYM
hls-11302	75	6	a	a	DET
hls-11302	75	7	(	(	PUNCT
hls-11302	75	8	rs1800896	rs1800896	PROPN
hls-11302	75	9	)	)	PUNCT
hls-11302	75	10	genotype	genotype	NOUN
hls-11302	75	11	and	and	CCONJ
hls-11302	75	12	allele	allele	NOUN
hls-11302	75	13	frequency	frequency	NOUN
hls-11302	75	14	was	be	AUX
hls-11302	75	15	not	not	PART
hls-11302	75	16	found	find	VERB
hls-11302	75	17	to	to	PART
hls-11302	75	18	be	be	AUX
hls-11302	75	19	significant	significant	ADJ
hls-11302	75	20	.	.	PUNCT
hls-11302	76	1	the	the	DET
hls-11302	76	2	distribution	distribution	NOUN
hls-11302	76	3	of	of	ADP
hls-11302	76	4	ifn	ifn	PROPN
hls-11302	76	5	γ+874t	γ+874t	PROPN
hls-11302	76	6	/	/	SYM
hls-11302	76	7	a	a	PRON
hls-11302	76	8	(	(	PUNCT
hls-11302	76	9	p=0.012	p=0.012	NUM
hls-11302	76	10	)	)	PUNCT
hls-11302	76	11	and	and	CCONJ
hls-11302	76	12	il10	il10	PROPN
hls-11302	76	13	-	-	PUNCT
hls-11302	76	14	819/592c	819/592c	NUM
hls-11302	76	15	/	/	SYM
hls-11302	76	16	t	t	NOUN
hls-11302	76	17	(	(	PUNCT
hls-11302	76	18	p=0.036	p=0.036	NOUN
hls-11302	76	19	)	)	PUNCT
hls-11302	76	20	alleles	allele	NOUN
hls-11302	76	21	were	be	AUX
hls-11302	76	22	significantly	significantly	ADV
hls-11302	76	23	different	different	ADJ
hls-11302	76	24	between	between	ADP
hls-11302	76	25	patients	patient	NOUN
hls-11302	76	26	and	and	CCONJ
hls-11302	76	27	healthy	healthy	ADJ
hls-11302	76	28	control	control	NOUN
hls-11302	76	29	.	.	PUNCT
hls-11302	77	1	pv	pv	NOUN
hls-11302	77	2	patients	patient	NOUN
hls-11302	77	3	were	be	AUX
hls-11302	77	4	more	more	ADV
hls-11302	77	5	likely	likely	ADJ
hls-11302	77	6	to	to	PART
hls-11302	77	7	carry	carry	VERB
hls-11302	77	8	the	the	DET
hls-11302	77	9	il10	il10	PROPN
hls-11302	77	10	-	-	PUNCT
hls-11302	77	11	819/592	819/592	PROPN
hls-11302	77	12	t	t	NOUN
hls-11302	77	13	allele	allele	NOUN
hls-11302	77	14	(	(	PUNCT
hls-11302	77	15	p=0.036	p=0.036	NOUN
hls-11302	77	16	)	)	PUNCT
hls-11302	77	17	and	and	CCONJ
hls-11302	77	18	it	it	PRON
hls-11302	77	19	was	be	AUX
hls-11302	77	20	significantly	significantly	ADV
hls-11302	77	21	associated	associate	VERB
hls-11302	77	22	with	with	ADP
hls-11302	77	23	the	the	DET
hls-11302	77	24	disease	disease	NOUN
hls-11302	77	25	(	(	PUNCT
hls-11302	77	26	or=0.476	or=0.476	NOUN
hls-11302	77	27	,	,	PUNCT
hls-11302	77	28	95	95	NUM
hls-11302	77	29	%	%	NOUN
hls-11302	77	30	ci	ci	NOUN
hls-11302	77	31	0.236	0.236	NUM
hls-11302	77	32	-	-	PUNCT
hls-11302	77	33	0.959	0.959	NUM
hls-11302	77	34	)	)	PUNCT
hls-11302	77	35	.	.	PUNCT
hls-11302	78	1	ifn	ifn	PROPN
hls-11302	79	1	γ+874	γ+874	X
hls-11302	79	2	allele	allele	PROPN
hls-11302	79	3	was	be	AUX
hls-11302	79	4	significantly	significantly	ADV
hls-11302	79	5	associated	associate	VERB
hls-11302	79	6	with	with	ADP
hls-11302	79	7	pv	pv	PROPN
hls-11302	79	8	(	(	PUNCT
hls-11302	79	9	or=0.424	or=0.424	INTJ
hls-11302	79	10	,	,	PUNCT
hls-11302	79	11	95	95	NUM
hls-11302	79	12	%	%	NOUN
hls-11302	79	13	ci	ci	NOUN
hls-11302	79	14	0.216	0.216	NUM
hls-11302	79	15	-	-	PUNCT
hls-11302	79	16	0.833	0.833	NUM
hls-11302	79	17	)	)	PUNCT
hls-11302	79	18	.	.	PUNCT
hls-11302	80	1	in	in	ADP
hls-11302	80	2	pv	pv	PROPN
hls-11302	80	3	patients	patient	NOUN
hls-11302	80	4	,	,	PUNCT
hls-11302	80	5	the	the	DET
hls-11302	80	6	il10	il10	PROPN
hls-11302	80	7	-819/592	-819/592	PUNCT
hls-11302	80	8	ct	ct	NUM
hls-11302	80	9	genotype	genotype	NOUN
hls-11302	80	10	frequency	frequency	NOUN
hls-11302	80	11	was	be	AUX
hls-11302	80	12	found	find	VERB
hls-11302	80	13	to	to	PART
hls-11302	80	14	be	be	AUX
hls-11302	80	15	lower	low	ADJ
hls-11302	80	16	(	(	PUNCT
hls-11302	80	17	or	or	CCONJ
hls-11302	80	18	0.260	0.260	NUM
hls-11302	80	19	,	,	PUNCT
hls-11302	80	20	95	95	NUM
hls-11302	80	21	%	%	NOUN
hls-11302	80	22	ci	ci	PROPN
hls-11302	80	23	0.0990.683	0.0990.683	PROPN
hls-11302	80	24	;	;	PUNCT
hls-11302	80	25	p=0.005	p=0.005	X
hls-11302	80	26	)	)	PUNCT
hls-11302	80	27	.	.	PUNCT
hls-11302	81	1	the	the	DET
hls-11302	81	2	cc	cc	PROPN
hls-11302	81	3	genotype	genotype	NOUN
hls-11302	81	4	frequency	frequency	NOUN
hls-11302	81	5	was	be	AUX
hls-11302	81	6	found	find	VERB
hls-11302	81	7	to	to	PART
hls-11302	81	8	be	be	AUX
hls-11302	81	9	higher	high	ADJ
hls-11302	81	10	(	(	PUNCT
hls-11302	81	11	p=0.05	p=0.05	NOUN
hls-11302	81	12	)	)	PUNCT
hls-11302	81	13	in	in	ADP
hls-11302	81	14	pv	pv	NOUN
hls-11302	81	15	patients	patient	NOUN
hls-11302	81	16	as	as	SCONJ
hls-11302	81	17	compared	compare	VERB
hls-11302	81	18	to	to	ADP
hls-11302	81	19	healthy	healthy	ADJ
hls-11302	81	20	controls	control	NOUN
hls-11302	81	21	.	.	PUNCT
hls-11302	82	1	similarly	similarly	ADV
hls-11302	82	2	,	,	PUNCT
hls-11302	82	3	the	the	DET
hls-11302	82	4	ifn	ifn	PROPN
hls-11302	82	5	γ+874	γ+874	PUNCT
hls-11302	82	6	aa	aa	PROPN
hls-11302	82	7	genotype	genotype	NOUN
hls-11302	82	8	frequency	frequency	NOUN
hls-11302	82	9	was	be	AUX
hls-11302	82	10	found	find	VERB
hls-11302	82	11	to	to	PART
hls-11302	82	12	be	be	AUX
hls-11302	82	13	higher	high	ADJ
hls-11302	82	14	(	(	PUNCT
hls-11302	82	15	p=0.037	p=0.037	NOUN
hls-11302	82	16	)	)	PUNCT
hls-11302	82	17	in	in	ADP
hls-11302	82	18	pv	pv	NOUN
hls-11302	82	19	patients	patient	NOUN
hls-11302	82	20	than	than	ADP
hls-11302	82	21	in	in	ADP
hls-11302	82	22	controls	control	NOUN
hls-11302	82	23	.	.	PUNCT
hls-11302	83	1	discussion	discussion	NOUN
hls-11302	83	2	yeasts	yeast	NOUN
hls-11302	83	3	of	of	ADP
hls-11302	83	4	the	the	DET
hls-11302	83	5	genus	genus	ADJ
hls-11302	83	6	malassezia	malassezia	NOUN
hls-11302	83	7	are	be	AUX
hls-11302	83	8	part	part	NOUN
hls-11302	83	9	of	of	ADP
hls-11302	83	10	the	the	DET
hls-11302	83	11	normal	normal	ADJ
hls-11302	83	12	cutaneous	cutaneous	ADJ
hls-11302	83	13	commensal	commensal	NOUN
hls-11302	83	14	microflora	microflora	NOUN
hls-11302	83	15	and	and	CCONJ
hls-11302	83	16	also	also	ADV
hls-11302	83	17	an	an	DET
hls-11302	83	18	etiologic	etiologic	ADJ
hls-11302	83	19	agent	agent	NOUN
hls-11302	83	20	of	of	ADP
hls-11302	83	21	certain	certain	ADJ
hls-11302	83	22	diseases.1	diseases.1	NOUN
hls-11302	83	23	colonization	colonization	NOUN
hls-11302	83	24	occurs	occur	VERB
hls-11302	83	25	in	in	ADP
hls-11302	83	26	infancy	infancy	NOUN
hls-11302	83	27	and	and	CCONJ
hls-11302	83	28	reaches	reach	VERB
hls-11302	83	29	its	its	PRON
hls-11302	83	30	highest	high	ADJ
hls-11302	83	31	concentration	concentration	NOUN
hls-11302	83	32	after	after	ADP
hls-11302	83	33	puberty	puberty	NOUN
hls-11302	83	34	and	and	CCONJ
hls-11302	83	35	in	in	ADP
hls-11302	83	36	early	early	ADJ
hls-11302	83	37	adulthood	adulthood	NOUN
hls-11302	83	38	.	.	PUNCT
hls-11302	84	1	malassezia	malassezia	NOUN
hls-11302	84	2	yeast	yeast	NOUN
hls-11302	84	3	is	be	AUX
hls-11302	84	4	found	find	VERB
hls-11302	84	5	in	in	ADP
hls-11302	84	6	75	75	NUM
hls-11302	84	7	to	to	PART
hls-11302	84	8	78	78	NUM
hls-11302	84	9	percent	percent	NOUN
hls-11302	84	10	of	of	ADP
hls-11302	84	11	healthy	healthy	ADJ
hls-11302	84	12	adults	adult	NOUN
hls-11302	84	13	as	as	ADP
hls-11302	84	14	normal	normal	ADJ
hls-11302	84	15	flora	flora	NOUN
hls-11302	84	16	of	of	ADP
hls-11302	84	17	the	the	DET
hls-11302	84	18	skin.4,14	skin.4,14	PROPN
hls-11302	84	19	malassezia	malassezia	PROPN
hls-11302	84	20	’s	’s	PART
hls-11302	84	21	pathogenic	pathogenic	ADJ
hls-11302	84	22	and	and	CCONJ
hls-11302	84	23	commensal	commensal	NOUN
hls-11302	84	24	stages	stage	NOUN
hls-11302	84	25	are	be	AUX
hls-11302	84	26	not	not	PART
hls-11302	84	27	easily	easily	ADV
hls-11302	84	28	distinguished	distinguish	VERB
hls-11302	84	29	from	from	ADP
hls-11302	84	30	one	one	NUM
hls-11302	84	31	another.1	another.1	NOUN
hls-11302	84	32	the	the	DET
hls-11302	84	33	transition	transition	NOUN
hls-11302	84	34	from	from	ADP
hls-11302	84	35	commensal	commensal	NOUN
hls-11302	84	36	to	to	ADP
hls-11302	84	37	pathogenic	pathogenic	ADJ
hls-11302	84	38	state	state	NOUN
hls-11302	84	39	is	be	AUX
hls-11302	84	40	probably	probably	ADV
hls-11302	84	41	a	a	DET
hls-11302	84	42	continuum	continuum	ADJ
hls-11302	84	43	and	and	CCONJ
hls-11302	84	44	not	not	PART
hls-11302	84	45	an	an	DET
hls-11302	84	46	on	on	ADP
hls-11302	84	47	/	/	SYM
hls-11302	84	48	off	off	ADP
hls-11302	84	49	condition	condition	NOUN
hls-11302	84	50	.	.	PUNCT
hls-11302	85	1	malassezia	malassezia	NOUN
hls-11302	85	2	-	-	PUNCT
hls-11302	85	3	associated	associate	VERB
hls-11302	85	4	skin	skin	NOUN
hls-11302	85	5	conditions	condition	NOUN
hls-11302	85	6	span	span	VERB
hls-11302	85	7	the	the	DET
hls-11302	85	8	whole	whole	ADJ
hls-11302	85	9	spectrum	spectrum	NOUN
hls-11302	85	10	between	between	ADP
hls-11302	85	11	overt	overt	ADJ
hls-11302	85	12	inflammatory	inflammatory	ADJ
hls-11302	85	13	response	response	NOUN
hls-11302	85	14	(	(	PUNCT
hls-11302	85	15	seborrheic	seborrheic	PROPN
hls-11302	85	16	dermatitis	dermatitis	NOUN
hls-11302	85	17	)	)	PUNCT
hls-11302	85	18	and	and	CCONJ
hls-11302	85	19	a	a	DET
hls-11302	85	20	distinct	distinct	ADJ
hls-11302	85	21	absence	absence	NOUN
hls-11302	85	22	of	of	ADP
hls-11302	85	23	inflammation	inflammation	NOUN
hls-11302	85	24	article	article	NOUN
hls-11302	85	25	non	non	ADJ
hls-11302	85	26	-co	-co	PROPN
hls-11302	85	27	mmerc	mmerc	PROPN
hls-11302	85	28	ial	ial	PROPN
hls-11302	86	1	us	us	PROPN
hls-11302	86	2	e	e	NOUN
hls-11302	86	3	o	o	NOUN
hls-11302	86	4	nly	nly	ADV
hls-11302	86	5	(	(	PUNCT
hls-11302	86	6	pv	pv	NOUN
hls-11302	86	7	)	)	PUNCT
hls-11302	86	8	.	.	PUNCT
hls-11302	87	1	the	the	DET
hls-11302	87	2	annual	annual	ADJ
hls-11302	87	3	incidence	incidence	NOUN
hls-11302	87	4	of	of	ADP
hls-11302	87	5	pv	pv	NOUN
hls-11302	87	6	has	have	AUX
hls-11302	87	7	been	be	AUX
hls-11302	87	8	reported	report	VERB
hls-11302	87	9	to	to	PART
hls-11302	87	10	range	range	VERB
hls-11302	87	11	from	from	ADP
hls-11302	87	12	5.2	5.2	NUM
hls-11302	87	13	percent	percent	NOUN
hls-11302	87	14	to	to	ADP
hls-11302	87	15	8.3	8.3	NUM
hls-11302	87	16	percent.15	percent.15	NOUN
hls-11302	87	17	composition	composition	NOUN
hls-11302	87	18	of	of	ADP
hls-11302	87	19	the	the	DET
hls-11302	87	20	cell	cell	NOUN
hls-11302	87	21	wall	wall	NOUN
hls-11302	87	22	lipids	lipid	NOUN
hls-11302	87	23	and	and	CCONJ
hls-11302	87	24	various	various	ADJ
hls-11302	87	25	metabolites	metabolite	NOUN
hls-11302	87	26	produced	produce	VERB
hls-11302	87	27	by	by	ADP
hls-11302	87	28	malassezia	malassezia	NOUN
hls-11302	87	29	are	be	AUX
hls-11302	87	30	known	know	VERB
hls-11302	87	31	to	to	PART
hls-11302	87	32	be	be	AUX
hls-11302	87	33	responsible	responsible	ADJ
hls-11302	87	34	for	for	ADP
hls-11302	87	35	altering	alter	VERB
hls-11302	87	36	the	the	DET
hls-11302	87	37	host	host	NOUN
hls-11302	87	38	immunological	immunological	ADJ
hls-11302	87	39	response	response	NOUN
hls-11302	87	40	and	and	CCONJ
hls-11302	87	41	thus	thus	ADV
hls-11302	87	42	preventing	prevent	VERB
hls-11302	87	43	the	the	DET
hls-11302	87	44	killing	killing	NOUN
hls-11302	87	45	of	of	ADP
hls-11302	87	46	the	the	DET
hls-11302	87	47	yeast.3,16	yeast.3,16	NOUN
hls-11302	87	48	the	the	DET
hls-11302	87	49	role	role	NOUN
hls-11302	87	50	of	of	ADP
hls-11302	87	51	the	the	DET
hls-11302	87	52	host	host	NOUN
hls-11302	87	53	immune	immune	ADJ
hls-11302	87	54	system	system	NOUN
hls-11302	87	55	in	in	ADP
hls-11302	87	56	disease	disease	NOUN
hls-11302	87	57	manifestation	manifestation	NOUN
hls-11302	87	58	and	and	CCONJ
hls-11302	87	59	severity	severity	NOUN
hls-11302	87	60	is	be	AUX
hls-11302	87	61	critical	critical	ADJ
hls-11302	87	62	.	.	PUNCT
hls-11302	88	1	hence	hence	ADV
hls-11302	88	2	,	,	PUNCT
hls-11302	88	3	polymorphism	polymorphism	NOUN
hls-11302	88	4	in	in	ADP
hls-11302	88	5	the	the	DET
hls-11302	88	6	genes	gene	NOUN
hls-11302	88	7	responsible	responsible	ADJ
hls-11302	88	8	for	for	ADP
hls-11302	88	9	cytokine	cytokine	ADJ
hls-11302	88	10	production	production	NOUN
hls-11302	88	11	can	can	AUX
hls-11302	88	12	influence	influence	VERB
hls-11302	88	13	the	the	DET
hls-11302	88	14	susceptibility	susceptibility	NOUN
hls-11302	88	15	of	of	ADP
hls-11302	88	16	the	the	DET
hls-11302	88	17	host	host	NOUN
hls-11302	88	18	to	to	PART
hls-11302	88	19	develop	develop	VERB
hls-11302	88	20	and	and	CCONJ
hls-11302	88	21	manifest	manifest	VERB
hls-11302	88	22	the	the	DET
hls-11302	88	23	disease	disease	NOUN
hls-11302	88	24	.	.	PUNCT
hls-11302	89	1	association	association	NOUN
hls-11302	89	2	between	between	ADP
hls-11302	89	3	specific	specific	ADJ
hls-11302	89	4	cytokine	cytokine	ADJ
hls-11302	89	5	gene	gene	NOUN
hls-11302	89	6	polymorphism	polymorphism	NOUN
hls-11302	89	7	and	and	CCONJ
hls-11302	89	8	clinical	clinical	ADJ
hls-11302	89	9	outcome	outcome	NOUN
hls-11302	89	10	if	if	SCONJ
hls-11302	89	11	found	find	VERB
hls-11302	89	12	to	to	PART
hls-11302	89	13	be	be	AUX
hls-11302	89	14	significant	significant	ADJ
hls-11302	89	15	can	can	AUX
hls-11302	89	16	determine	determine	VERB
hls-11302	89	17	whether	whether	SCONJ
hls-11302	89	18	an	an	DET
hls-11302	89	19	individual	individual	NOUN
hls-11302	89	20	will	will	AUX
hls-11302	89	21	develop	develop	VERB
hls-11302	89	22	the	the	DET
hls-11302	89	23	disorder	disorder	NOUN
hls-11302	89	24	if	if	SCONJ
hls-11302	89	25	he	he	PRON
hls-11302	89	26	/	/	PUNCT
hls-11302	89	27	she	she	PRON
hls-11302	89	28	carries	carry	VERB
hls-11302	89	29	the	the	DET
hls-11302	89	30	particular	particular	ADJ
hls-11302	89	31	allele	allele	NOUN
hls-11302	89	32	in	in	ADP
hls-11302	89	33	comparison	comparison	NOUN
hls-11302	89	34	to	to	ADP
hls-11302	89	35	the	the	DET
hls-11302	89	36	individual	individual	NOUN
hls-11302	89	37	without	without	ADP
hls-11302	89	38	the	the	DET
hls-11302	89	39	allele.6	allele.6	NOUN
hls-11302	89	40	it	it	PRON
hls-11302	89	41	is	be	AUX
hls-11302	89	42	important	important	ADJ
hls-11302	89	43	to	to	PART
hls-11302	89	44	determine	determine	VERB
hls-11302	89	45	the	the	DET
hls-11302	89	46	allelic	allelic	ADJ
hls-11302	89	47	frequency	frequency	NOUN
hls-11302	89	48	of	of	ADP
hls-11302	89	49	both	both	CCONJ
hls-11302	89	50	th1	th1	PROPN
hls-11302	89	51	and	and	CCONJ
hls-11302	89	52	th2	th2	PROPN
hls-11302	89	53	representative	representative	ADJ
hls-11302	89	54	genes	gene	NOUN
hls-11302	89	55	as	as	SCONJ
hls-11302	89	56	the	the	DET
hls-11302	89	57	disease	disease	NOUN
hls-11302	89	58	outcome	outcome	NOUN
hls-11302	89	59	is	be	AUX
hls-11302	89	60	influenced	influence	VERB
hls-11302	89	61	by	by	ADP
hls-11302	89	62	their	their	PRON
hls-11302	89	63	mutual	mutual	ADJ
hls-11302	89	64	antagonism	antagonism	NOUN
hls-11302	89	65	and	and	CCONJ
hls-11302	89	66	therefore	therefore	ADV
hls-11302	89	67	individual	individual	ADJ
hls-11302	89	68	association	association	NOUN
hls-11302	89	69	may	may	AUX
hls-11302	89	70	be	be	AUX
hls-11302	89	71	non	non	ADJ
hls-11302	89	72	-	-	ADJ
hls-11302	89	73	informative.6	informative.6	NOUN
hls-11302	89	74	so	so	ADV
hls-11302	89	75	far	far	ADV
hls-11302	89	76	,	,	PUNCT
hls-11302	89	77	immunological	immunological	ADJ
hls-11302	89	78	studies	study	NOUN
hls-11302	89	79	on	on	ADP
hls-11302	89	80	the	the	DET
hls-11302	89	81	association	association	NOUN
hls-11302	89	82	with	with	ADP
hls-11302	89	83	pv	pv	NOUN
hls-11302	89	84	have	have	AUX
hls-11302	89	85	been	be	AUX
hls-11302	89	86	scarce	scarce	ADJ
hls-11302	89	87	.	.	PUNCT
hls-11302	90	1	the	the	DET
hls-11302	90	2	interaction	interaction	NOUN
hls-11302	90	3	of	of	ADP
hls-11302	90	4	malassezia	malassezia	NOUN
hls-11302	90	5	with	with	ADP
hls-11302	90	6	the	the	DET
hls-11302	90	7	dendritic	dendritic	ADJ
hls-11302	90	8	cells	cell	NOUN
hls-11302	90	9	,	,	PUNCT
hls-11302	90	10	keratinocytes	keratinocyte	NOUN
hls-11302	90	11	,	,	PUNCT
hls-11302	90	12	and	and	CCONJ
hls-11302	90	13	pbmc	pbmc	NOUN
hls-11302	90	14	has	have	AUX
hls-11302	90	15	led	lead	VERB
hls-11302	90	16	to	to	ADP
hls-11302	90	17	varied	varied	ADJ
hls-11302	90	18	results	result	NOUN
hls-11302	90	19	in	in	ADP
hls-11302	90	20	different	different	ADJ
hls-11302	90	21	human	human	ADJ
hls-11302	90	22	and	and	CCONJ
hls-11302	90	23	animal	animal	NOUN
hls-11302	90	24	studies.17,21	studies.17,21	NOUN
hls-11302	90	25	il10	il10	PROPN
hls-11302	90	26	,	,	PUNCT
hls-11302	90	27	a	a	DET
hls-11302	90	28	th2	th2	PROPN
hls-11302	90	29	pleiotropic	pleiotropic	ADJ
hls-11302	90	30	anti	anti	ADJ
hls-11302	90	31	-	-	ADJ
hls-11302	90	32	inflammatory	inflammatory	ADJ
hls-11302	90	33	cytokine	cytokine	NOUN
hls-11302	90	34	,	,	PUNCT
hls-11302	90	35	acts	act	VERB
hls-11302	90	36	on	on	ADP
hls-11302	90	37	monocytes	monocyte	NOUN
hls-11302	90	38	and	and	CCONJ
hls-11302	90	39	macrophages	macrophage	NOUN
hls-11302	90	40	and	and	CCONJ
hls-11302	90	41	downregulates	downregulate	VERB
hls-11302	90	42	the	the	DET
hls-11302	90	43	expression	expression	NOUN
hls-11302	90	44	of	of	ADP
hls-11302	90	45	mhc	mhc	PROPN
hls-11302	90	46	class	class	PROPN
hls-11302	90	47	ii	ii	PROPN
hls-11302	90	48	antigens	antigen	NOUN
hls-11302	90	49	on	on	ADP
hls-11302	90	50	antigenpresenting	antigenpresente	VERB
hls-11302	90	51	cells	cell	NOUN
hls-11302	90	52	.	.	PUNCT
hls-11302	91	1	il10	il10	PROPN
hls-11302	91	2	also	also	ADV
hls-11302	91	3	suppresses	suppress	VERB
hls-11302	91	4	the	the	DET
hls-11302	91	5	production	production	NOUN
hls-11302	91	6	of	of	ADP
hls-11302	91	7	nitric	nitric	ADJ
hls-11302	91	8	oxide	oxide	NOUN
hls-11302	91	9	and	and	CCONJ
hls-11302	91	10	other	other	ADJ
hls-11302	91	11	metabolites	metabolite	NOUN
hls-11302	91	12	responsible	responsible	ADJ
hls-11302	91	13	for	for	ADP
hls-11302	91	14	killing	kill	VERB
hls-11302	91	15	pathogens	pathogen	NOUN
hls-11302	91	16	.	.	PUNCT
hls-11302	92	1	they	they	PRON
hls-11302	92	2	also	also	ADV
hls-11302	92	3	suppress	suppress	VERB
hls-11302	92	4	the	the	DET
hls-11302	92	5	production	production	NOUN
hls-11302	92	6	of	of	ADP
hls-11302	92	7	inflammatory	inflammatory	ADJ
hls-11302	92	8	mediators	mediator	NOUN
hls-11302	92	9	e.g.	e.g.	ADV
hls-11302	92	10	il1	il1	PROPN
hls-11302	92	11	,	,	PUNCT
hls-11302	92	12	il6	il6	PROPN
hls-11302	92	13	,	,	PUNCT
hls-11302	92	14	il8	il8	PROPN
hls-11302	92	15	,	,	PUNCT
hls-11302	92	16	etc	etc	X
hls-11302	92	17	.	.	X
hls-11302	93	1	ifn	ifn	PROPN
hls-11302	93	2	γ	γ	PROPN
hls-11302	93	3	is	be	AUX
hls-11302	93	4	the	the	DET
hls-11302	93	5	signature	signature	NOUN
hls-11302	93	6	th1	th1	NOUN
hls-11302	93	7	proinflammatory	proinflammatory	ADJ
hls-11302	93	8	cytokines	cytokine	NOUN
hls-11302	93	9	,	,	PUNCT
hls-11302	93	10	responsible	responsible	ADJ
hls-11302	93	11	for	for	ADP
hls-11302	93	12	acute	acute	ADJ
hls-11302	93	13	flare	flare	NOUN
hls-11302	93	14	-	-	PUNCT
hls-11302	93	15	up	up	ADP
hls-11302	93	16	inflammatory	inflammatory	ADJ
hls-11302	93	17	responses	response	NOUN
hls-11302	93	18	.	.	PUNCT
hls-11302	94	1	along	along	ADP
hls-11302	94	2	with	with	ADP
hls-11302	94	3	other	other	ADJ
hls-11302	94	4	cytokines	cytokine	NOUN
hls-11302	94	5	of	of	ADP
hls-11302	94	6	the	the	DET
hls-11302	94	7	th1	th1	NOUN
hls-11302	94	8	subset	subset	NOUN
hls-11302	94	9	,	,	PUNCT
hls-11302	94	10	it	it	PRON
hls-11302	94	11	dampens	dampen	VERB
hls-11302	94	12	the	the	DET
hls-11302	94	13	th2	th2	PROPN
hls-11302	94	14	response	response	NOUN
hls-11302	94	15	.	.	PUNCT
hls-11302	95	1	in	in	ADP
hls-11302	95	2	our	our	PRON
hls-11302	95	3	study	study	NOUN
hls-11302	95	4	,	,	PUNCT
hls-11302	95	5	polymorphism	polymorphism	NOUN
hls-11302	95	6	in	in	ADP
hls-11302	95	7	the	the	DET
hls-11302	95	8	gene	gene	NOUN
hls-11302	95	9	ifn	ifn	PROPN
hls-11302	95	10	γ	γ	X
hls-11302	95	11	at	at	ADP
hls-11302	95	12	position	position	NOUN
hls-11302	95	13	+874	+874	NUM
hls-11302	95	14	t	t	NOUN
hls-11302	95	15	/	/	SYM
hls-11302	95	16	a	a	NOUN
hls-11302	95	17	in	in	ADP
hls-11302	95	18	the	the	DET
hls-11302	95	19	first	first	ADJ
hls-11302	95	20	intron	intron	NOUN
hls-11302	95	21	was	be	AUX
hls-11302	95	22	identified	identify	VERB
hls-11302	95	23	in	in	ADP
hls-11302	95	24	pv	pv	NOUN
hls-11302	95	25	.	.	PUNCT
hls-11302	96	1	ifn	ifn	PROPN
hls-11302	96	2	γ+874	γ+874	NUM
hls-11302	96	3	aa	aa	PROPN
hls-11302	96	4	genotype	genotype	NOUN
hls-11302	96	5	frequency	frequency	NOUN
hls-11302	96	6	was	be	AUX
hls-11302	96	7	found	find	VERB
hls-11302	96	8	to	to	PART
hls-11302	96	9	be	be	AUX
hls-11302	96	10	higher	high	ADJ
hls-11302	96	11	in	in	ADP
hls-11302	96	12	pv	pv	ADV
hls-11302	96	13	than	than	ADP
hls-11302	96	14	in	in	ADP
hls-11302	96	15	controls	control	NOUN
hls-11302	96	16	and	and	CCONJ
hls-11302	96	17	the	the	DET
hls-11302	96	18	t	t	PROPN
hls-11302	96	19	allele	allele	NOUN
hls-11302	96	20	was	be	AUX
hls-11302	96	21	significantly	significantly	ADV
hls-11302	96	22	associated	associate	VERB
hls-11302	96	23	with	with	ADP
hls-11302	96	24	the	the	DET
hls-11302	96	25	disease	disease	NOUN
hls-11302	96	26	.	.	PUNCT
hls-11302	97	1	this	this	DET
hls-11302	97	2	finding	finding	NOUN
hls-11302	97	3	is	be	AUX
hls-11302	97	4	in	in	ADP
hls-11302	97	5	parallel	parallel	NOUN
hls-11302	97	6	with	with	ADP
hls-11302	97	7	other	other	ADJ
hls-11302	97	8	studies	study	NOUN
hls-11302	97	9	suggesting	suggest	VERB
hls-11302	97	10	that	that	SCONJ
hls-11302	97	11	pv	pv	PROPN
hls-11302	97	12	patients	patient	NOUN
hls-11302	97	13	may	may	AUX
hls-11302	97	14	produce	produce	VERB
hls-11302	97	15	a	a	DET
hls-11302	97	16	lower	low	ADJ
hls-11302	97	17	level	level	NOUN
hls-11302	97	18	of	of	ADP
hls-11302	97	19	ifn	ifn	PROPN
hls-11302	97	20	γ.17	γ.17	PROPN
hls-11302	97	21	-	-	ADJ
hls-11302	97	22	21	21	NUM
hls-11302	97	23	we	we	PRON
hls-11302	97	24	postulate	postulate	VERB
hls-11302	97	25	that	that	SCONJ
hls-11302	97	26	the	the	DET
hls-11302	97	27	time	time	NOUN
hls-11302	97	28	of	of	ADP
hls-11302	97	29	production	production	NOUN
hls-11302	97	30	and	and	CCONJ
hls-11302	97	31	concentration	concentration	NOUN
hls-11302	97	32	of	of	ADP
hls-11302	97	33	proinflammatory	proinflammatory	ADJ
hls-11302	97	34	cytokines	cytokine	NOUN
hls-11302	97	35	during	during	ADP
hls-11302	97	36	the	the	DET
hls-11302	97	37	inflammation	inflammation	NOUN
hls-11302	97	38	process	process	NOUN
hls-11302	97	39	may	may	AUX
hls-11302	97	40	be	be	AUX
hls-11302	97	41	critical	critical	ADJ
hls-11302	97	42	but	but	CCONJ
hls-11302	97	43	a	a	DET
hls-11302	97	44	dampened	dampened	ADJ
hls-11302	97	45	t	t	PROPN
hls-11302	97	46	-	-	PUNCT
hls-11302	97	47	cell	cell	NOUN
hls-11302	97	48	response	response	NOUN
hls-11302	97	49	was	be	AUX
hls-11302	97	50	observed	observe	VERB
hls-11302	97	51	due	due	ADJ
hls-11302	97	52	to	to	ADP
hls-11302	97	53	allelic	allelic	ADJ
hls-11302	97	54	polymorphisms	polymorphism	NOUN
hls-11302	97	55	.	.	PUNCT
hls-11302	98	1	the	the	DET
hls-11302	98	2	c	c	PROPN
hls-11302	98	3	/	/	SYM
hls-11302	98	4	t	t	NOUN
hls-11302	98	5	allele	allele	NOUN
hls-11302	98	6	of	of	ADP
hls-11302	98	7	il10	il10	PROPN
hls-11302	98	8	-	-	PUNCT
hls-11302	98	9	819	819	NUM
hls-11302	98	10	was	be	AUX
hls-11302	98	11	significantly	significantly	ADV
hls-11302	98	12	associated	associate	VERB
hls-11302	98	13	with	with	ADP
hls-11302	98	14	pv	pv	INTJ
hls-11302	98	15	.	.	PUNCT
hls-11302	99	1	in	in	ADP
hls-11302	99	2	pv	pv	PROPN
hls-11302	99	3	patients	patient	NOUN
hls-11302	99	4	compared	compare	VERB
hls-11302	99	5	to	to	ADP
hls-11302	99	6	healthy	healthy	ADJ
hls-11302	99	7	controls	control	NOUN
hls-11302	99	8	,	,	PUNCT
hls-11302	99	9	the	the	DET
hls-11302	99	10	frequency	frequency	NOUN
hls-11302	99	11	of	of	ADP
hls-11302	99	12	the	the	DET
hls-11302	99	13	il10	il10	PROPN
hls-11302	99	14	-819/592	-819/592	PUNCT
hls-11302	99	15	ct	ct	NUM
hls-11302	99	16	genotype	genotype	NOUN
hls-11302	99	17	was	be	AUX
hls-11302	99	18	found	find	VERB
hls-11302	99	19	to	to	PART
hls-11302	99	20	be	be	AUX
hls-11302	99	21	lower	low	ADJ
hls-11302	99	22	and	and	CCONJ
hls-11302	99	23	the	the	DET
hls-11302	99	24	frequency	frequency	NOUN
hls-11302	99	25	of	of	ADP
hls-11302	99	26	the	the	DET
hls-11302	99	27	cc	cc	PROPN
hls-11302	99	28	genotype	genotype	NOUN
hls-11302	99	29	to	to	PART
hls-11302	99	30	be	be	AUX
hls-11302	99	31	higher	high	ADJ
hls-11302	99	32	.	.	PUNCT
hls-11302	100	1	the	the	DET
hls-11302	100	2	reason	reason	NOUN
hls-11302	100	3	for	for	ADP
hls-11302	100	4	the	the	DET
hls-11302	100	5	underlying	underlie	VERB
hls-11302	100	6	inflammatory	inflammatory	ADJ
hls-11302	100	7	response	response	NOUN
hls-11302	100	8	in	in	ADP
hls-11302	100	9	pv	pv	ADV
hls-11302	100	10	in	in	ADP
hls-11302	100	11	the	the	DET
hls-11302	100	12	presence	presence	NOUN
hls-11302	100	13	of	of	ADP
hls-11302	100	14	gene	gene	NOUN
hls-11302	100	15	polymorphism	polymorphism	NOUN
hls-11302	100	16	(	(	PUNCT
hls-11302	100	17	il10819/592	il10819/592	DET
hls-11302	100	18	cc	cc	PROPN
hls-11302	100	19	)	)	PUNCT
hls-11302	100	20	which	which	PRON
hls-11302	100	21	is	be	AUX
hls-11302	100	22	associated	associate	VERB
hls-11302	100	23	with	with	ADP
hls-11302	100	24	high	high	ADJ
hls-11302	100	25	production	production	NOUN
hls-11302	100	26	of	of	ADP
hls-11302	100	27	il-10	il-10	NOUN
hls-11302	100	28	in	in	ADP
hls-11302	100	29	our	our	PRON
hls-11302	100	30	study	study	NOUN
hls-11302	100	31	,	,	PUNCT
hls-11302	100	32	is	be	AUX
hls-11302	100	33	probably	probably	ADV
hls-11302	100	34	suggestive	suggestive	ADJ
hls-11302	100	35	of	of	ADP
hls-11302	100	36	th17	th17	PROPN
hls-11302	100	37	-	-	PUNCT
hls-11302	100	38	induced	induce	VERB
hls-11302	100	39	production	production	NOUN
hls-11302	100	40	of	of	ADP
hls-11302	100	41	inflammation	inflammation	NOUN
hls-11302	100	42	and	and	CCONJ
hls-11302	100	43	hence	hence	ADV
hls-11302	100	44	also	also	ADV
hls-11302	100	45	explains	explain	VERB
hls-11302	100	46	the	the	DET
hls-11302	100	47	neutrophilic	neutrophilic	ADJ
hls-11302	100	48	infiltration	infiltration	NOUN
hls-11302	100	49	in	in	ADP
hls-11302	100	50	the	the	DET
hls-11302	100	51	pv	pv	NOUN
hls-11302	100	52	lesions	lesion	NOUN
hls-11302	100	53	as	as	SCONJ
hls-11302	100	54	documented	document	VERB
hls-11302	100	55	in	in	ADP
hls-11302	100	56	studies.5	studies.5	PROPN
hls-11302	100	57	increased	increase	VERB
hls-11302	100	58	il10	il10	PROPN
hls-11302	100	59	levels	level	NOUN
hls-11302	100	60	have	have	AUX
hls-11302	100	61	been	be	AUX
hls-11302	100	62	demonstrated	demonstrate	VERB
hls-11302	100	63	in	in	ADP
hls-11302	100	64	pbmc	pbmc	NOUN
hls-11302	100	65	challenge	challenge	NOUN
hls-11302	100	66	studies	study	NOUN
hls-11302	100	67	with	with	ADP
hls-11302	100	68	malassezia	malassezia	NOUN
hls-11302	100	69	antigens	antigen	NOUN
hls-11302	100	70	in	in	ADP
hls-11302	100	71	different	different	ADJ
hls-11302	100	72	patient	patient	ADJ
hls-11302	100	73	groups	group	NOUN
hls-11302	100	74	and	and	CCONJ
hls-11302	100	75	also	also	ADV
hls-11302	100	76	in	in	ADP
hls-11302	100	77	keratinocyte	keratinocyte	NOUN
hls-11302	100	78	stimulation	stimulation	NOUN
hls-11302	100	79	studies	study	NOUN
hls-11302	100	80	using	use	VERB
hls-11302	100	81	different	different	ADJ
hls-11302	100	82	species	specie	NOUN
hls-11302	100	83	of	of	ADP
hls-11302	100	84	malassezia.22	malassezia.22	NOUN
hls-11302	100	85	the	the	DET
hls-11302	100	86	finding	finding	NOUN
hls-11302	100	87	also	also	ADV
hls-11302	100	88	suggests	suggest	VERB
hls-11302	100	89	the	the	DET
hls-11302	100	90	involvement	involvement	NOUN
hls-11302	100	91	of	of	ADP
hls-11302	100	92	the	the	DET
hls-11302	100	93	regulatory	regulatory	ADJ
hls-11302	100	94	t	t	NOUN
hls-11302	100	95	cell	cell	NOUN
hls-11302	100	96	subset	subset	VERB
hls-11302	100	97	in	in	ADP
hls-11302	100	98	the	the	DET
hls-11302	100	99	pathogenesis	pathogenesis	NOUN
hls-11302	100	100	of	of	ADP
hls-11302	100	101	the	the	DET
hls-11302	100	102	disease	disease	NOUN
hls-11302	100	103	since	since	SCONJ
hls-11302	100	104	elevated	elevate	VERB
hls-11302	100	105	il10	il10	PROPN
hls-11302	100	106	production	production	NOUN
hls-11302	100	107	as	as	SCONJ
hls-11302	100	108	suggested	suggest	VERB
hls-11302	100	109	by	by	ADP
hls-11302	100	110	the	the	DET
hls-11302	100	111	genotypic	genotypic	NOUN
hls-11302	100	112	result	result	NOUN
hls-11302	100	113	has	have	AUX
hls-11302	100	114	been	be	AUX
hls-11302	100	115	known	know	VERB
hls-11302	100	116	to	to	PART
hls-11302	100	117	be	be	AUX
hls-11302	100	118	implicated	implicate	VERB
hls-11302	100	119	in	in	ADP
hls-11302	100	120	limiting	limit	VERB
hls-11302	100	121	the	the	DET
hls-11302	100	122	development	development	NOUN
hls-11302	100	123	of	of	ADP
hls-11302	100	124	the	the	DET
hls-11302	100	125	inflammatory	inflammatory	ADJ
hls-11302	100	126	response	response	NOUN
hls-11302	100	127	towards	towards	ADP
hls-11302	100	128	invading	invade	VERB
hls-11302	100	129	pathogens	pathogen	NOUN
hls-11302	100	130	and	and	CCONJ
hls-11302	100	131	allowing	allow	VERB
hls-11302	100	132	its	its	PRON
hls-11302	100	133	persistence	persistence	NOUN
hls-11302	100	134	.	.	PUNCT
hls-11302	101	1	thus	thus	ADV
hls-11302	101	2	,	,	PUNCT
hls-11302	101	3	the	the	DET
hls-11302	101	4	development	development	NOUN
hls-11302	101	5	of	of	ADP
hls-11302	101	6	the	the	DET
hls-11302	101	7	disease	disease	NOUN
hls-11302	101	8	in	in	ADP
hls-11302	101	9	the	the	DET
hls-11302	101	10	host	host	NOUN
hls-11302	101	11	could	could	AUX
hls-11302	101	12	be	be	AUX
hls-11302	101	13	explained	explain	VERB
hls-11302	101	14	,	,	PUNCT
hls-11302	101	15	in	in	ADP
hls-11302	101	16	part	part	NOUN
hls-11302	101	17	,	,	PUNCT
hls-11302	101	18	by	by	ADP
hls-11302	101	19	the	the	DET
hls-11302	101	20	th1/	th1/	PROPN
hls-11302	101	21	th2	th2	PROPN
hls-11302	101	22	balance	balance	NOUN
hls-11302	101	23	.	.	PUNCT
hls-11302	102	1	however	however	ADV
hls-11302	102	2	,	,	PUNCT
hls-11302	102	3	a	a	DET
hls-11302	102	4	larger	large	ADJ
hls-11302	102	5	number	number	NOUN
hls-11302	102	6	of	of	ADP
hls-11302	102	7	subjects	subject	NOUN
hls-11302	102	8	need	need	VERB
hls-11302	102	9	to	to	PART
hls-11302	102	10	be	be	AUX
hls-11302	102	11	studied	study	VERB
hls-11302	102	12	to	to	PART
hls-11302	102	13	understand	understand	VERB
hls-11302	102	14	the	the	DET
hls-11302	102	15	development	development	NOUN
hls-11302	102	16	of	of	ADP
hls-11302	102	17	the	the	DET
hls-11302	102	18	disease	disease	NOUN
hls-11302	102	19	better	well	ADV
hls-11302	102	20	.	.	PUNCT
hls-11302	103	1	the	the	DET
hls-11302	103	2	determination	determination	NOUN
hls-11302	103	3	of	of	ADP
hls-11302	103	4	the	the	DET
hls-11302	103	5	genetic	genetic	ADJ
hls-11302	103	6	profile	profile	NOUN
hls-11302	103	7	of	of	ADP
hls-11302	103	8	the	the	DET
hls-11302	103	9	host	host	NOUN
hls-11302	103	10	might	might	AUX
hls-11302	103	11	allow	allow	VERB
hls-11302	103	12	assessing	assess	VERB
hls-11302	103	13	the	the	DET
hls-11302	103	14	susceptibility	susceptibility	NOUN
hls-11302	103	15	towards	towards	ADP
hls-11302	103	16	the	the	DET
hls-11302	103	17	disease	disease	NOUN
hls-11302	103	18	and	and	CCONJ
hls-11302	103	19	also	also	ADV
hls-11302	103	20	explain	explain	VERB
hls-11302	103	21	the	the	DET
hls-11302	103	22	differential	differential	ADJ
hls-11302	103	23	association	association	NOUN
hls-11302	103	24	of	of	ADP
hls-11302	103	25	a	a	DET
hls-11302	103	26	known	know	VERB
hls-11302	103	27	commensal	commensal	NOUN
hls-11302	103	28	to	to	PART
hls-11302	103	29	cause	cause	VERB
hls-11302	103	30	symptoms	symptom	NOUN
hls-11302	103	31	in	in	ADP
hls-11302	103	32	a	a	DET
hls-11302	103	33	selected	select	VERB
hls-11302	103	34	group	group	NOUN
hls-11302	103	35	of	of	ADP
hls-11302	103	36	population	population	NOUN
hls-11302	103	37	.	.	PUNCT
hls-11302	104	1	the	the	DET
hls-11302	104	2	association	association	NOUN
hls-11302	104	3	of	of	ADP
hls-11302	104	4	certain	certain	ADJ
hls-11302	104	5	polymorphisms	polymorphism	NOUN
hls-11302	104	6	with	with	ADP
hls-11302	104	7	a	a	DET
hls-11302	104	8	disease	disease	NOUN
hls-11302	104	9	phenotype	phenotype	NOUN
hls-11302	104	10	needs	need	VERB
hls-11302	104	11	to	to	PART
hls-11302	104	12	be	be	AUX
hls-11302	104	13	assessed	assess	VERB
hls-11302	104	14	on	on	ADP
hls-11302	104	15	a	a	DET
hls-11302	104	16	larger	large	ADJ
hls-11302	104	17	scale	scale	NOUN
hls-11302	104	18	taking	take	VERB
hls-11302	104	19	into	into	ADP
hls-11302	104	20	consideration	consideration	NOUN
hls-11302	104	21	the	the	DET
hls-11302	104	22	role	role	NOUN
hls-11302	104	23	of	of	ADP
hls-11302	104	24	other	other	ADJ
hls-11302	104	25	cytokine	cytokine	ADJ
hls-11302	104	26	mediators	mediator	NOUN
hls-11302	104	27	to	to	PART
hls-11302	104	28	further	far	ADV
hls-11302	104	29	expand	expand	VERB
hls-11302	104	30	our	our	PRON
hls-11302	104	31	knowledge	knowledge	NOUN
hls-11302	104	32	regarding	regard	VERB
hls-11302	104	33	the	the	DET
hls-11302	104	34	pathogenesis	pathogenesis	NOUN
hls-11302	104	35	of	of	ADP
hls-11302	104	36	infectious	infectious	ADJ
hls-11302	104	37	diseases	disease	NOUN
hls-11302	104	38	.	.	PUNCT
hls-11302	105	1	these	these	DET
hls-11302	105	2	studies	study	NOUN
hls-11302	105	3	on	on	ADP
hls-11302	105	4	the	the	DET
hls-11302	105	5	host	host	NOUN
hls-11302	105	6	factors	factor	NOUN
hls-11302	105	7	could	could	AUX
hls-11302	105	8	pave	pave	VERB
hls-11302	105	9	the	the	DET
hls-11302	105	10	way	way	NOUN
hls-11302	105	11	for	for	ADP
hls-11302	105	12	determining	determine	VERB
hls-11302	105	13	the	the	DET
hls-11302	105	14	changing	change	VERB
hls-11302	105	15	trend	trend	NOUN
hls-11302	105	16	of	of	ADP
hls-11302	105	17	individual	individual	NOUN
hls-11302	105	18	-	-	PUNCT
hls-11302	105	19	based	base	VERB
hls-11302	105	20	diagnosis	diagnosis	NOUN
hls-11302	105	21	and	and	CCONJ
hls-11302	105	22	future	future	ADJ
hls-11302	105	23	treatment.23	treatment.23	NOUN
hls-11302	105	24	the	the	DET
hls-11302	105	25	understanding	understanding	NOUN
hls-11302	105	26	of	of	ADP
hls-11302	105	27	the	the	DET
hls-11302	105	28	disease	disease	NOUN
hls-11302	105	29	pathogenesis	pathogenesis	NOUN
hls-11302	105	30	of	of	ADP
hls-11302	105	31	pv	pv	NOUN
hls-11302	105	32	has	have	AUX
hls-11302	105	33	been	be	AUX
hls-11302	105	34	a	a	DET
hls-11302	105	35	topic	topic	NOUN
hls-11302	105	36	of	of	ADP
hls-11302	105	37	debate	debate	NOUN
hls-11302	105	38	as	as	SCONJ
hls-11302	105	39	the	the	DET
hls-11302	105	40	malassezia	malassezia	NOUN
hls-11302	105	41	yeasts	yeast	NOUN
hls-11302	105	42	,	,	PUNCT
hls-11302	105	43	a	a	DET
hls-11302	105	44	known	know	VERB
hls-11302	105	45	commensal	commensal	NOUN
hls-11302	105	46	,	,	PUNCT
hls-11302	105	47	is	be	AUX
hls-11302	105	48	responsible	responsible	ADJ
hls-11302	105	49	to	to	PART
hls-11302	105	50	cause	cause	VERB
hls-11302	105	51	symptoms	symptom	NOUN
hls-11302	105	52	in	in	ADP
hls-11302	105	53	only	only	ADV
hls-11302	105	54	a	a	DET
hls-11302	105	55	subset	subset	NOUN
hls-11302	105	56	of	of	ADP
hls-11302	105	57	the	the	DET
hls-11302	105	58	population	population	NOUN
hls-11302	105	59	who	who	PRON
hls-11302	105	60	are	be	AUX
hls-11302	105	61	colonized	colonize	VERB
hls-11302	105	62	with	with	ADP
hls-11302	105	63	it	it	PRON
hls-11302	105	64	.	.	PUNCT
hls-11302	106	1	our	our	PRON
hls-11302	106	2	study	study	NOUN
hls-11302	106	3	was	be	AUX
hls-11302	106	4	able	able	ADJ
hls-11302	106	5	to	to	PART
hls-11302	106	6	provide	provide	VERB
hls-11302	106	7	an	an	DET
hls-11302	106	8	understanding	understanding	NOUN
hls-11302	106	9	of	of	ADP
hls-11302	106	10	the	the	DET
hls-11302	106	11	susceptibility	susceptibility	NOUN
hls-11302	106	12	of	of	ADP
hls-11302	106	13	this	this	DET
hls-11302	106	14	subset	subset	NOUN
hls-11302	106	15	of	of	ADP
hls-11302	106	16	the	the	DET
hls-11302	106	17	population	population	NOUN
hls-11302	106	18	by	by	ADP
hls-11302	106	19	comparing	compare	VERB
hls-11302	106	20	their	their	PRON
hls-11302	106	21	genetic	genetic	ADJ
hls-11302	106	22	profile	profile	NOUN
hls-11302	106	23	with	with	ADP
hls-11302	106	24	the	the	DET
hls-11302	106	25	normal	normal	ADJ
hls-11302	106	26	population	population	NOUN
hls-11302	106	27	through	through	ADP
hls-11302	106	28	a	a	DET
hls-11302	106	29	study	study	NOUN
hls-11302	106	30	of	of	ADP
hls-11302	106	31	the	the	DET
hls-11302	106	32	cytokine	cytokine	ADJ
hls-11302	106	33	gene	gene	NOUN
hls-11302	106	34	polymorphism	polymorphism	NOUN
hls-11302	106	35	in	in	ADP
hls-11302	106	36	the	the	DET
hls-11302	106	37	il10	il10	PROPN
hls-11302	106	38	and	and	CCONJ
hls-11302	106	39	ifn	ifn	PROPN
hls-11302	106	40	γ	γ	PROPN
hls-11302	106	41	snps	snps	PROPN
hls-11302	106	42	.	.	PUNCT
hls-11302	107	1	the	the	DET
hls-11302	107	2	results	result	NOUN
hls-11302	107	3	reflected	reflect	VERB
hls-11302	107	4	a	a	DET
hls-11302	107	5	significant	significant	ADJ
hls-11302	107	6	level	level	NOUN
hls-11302	107	7	of	of	ADP
hls-11302	107	8	polymorphism	polymorphism	NOUN
hls-11302	107	9	in	in	ADP
hls-11302	107	10	all	all	DET
hls-11302	107	11	the	the	DET
hls-11302	107	12	snps	snps	NOUN
hls-11302	107	13	.	.	PUNCT
hls-11302	108	1	the	the	DET
hls-11302	108	2	genotype	genotype	NOUN
hls-11302	108	3	responsible	responsible	ADJ
hls-11302	108	4	for	for	ADP
hls-11302	108	5	higher	high	ADJ
hls-11302	108	6	production	production	NOUN
hls-11302	108	7	of	of	ADP
hls-11302	108	8	il10	il10	PROPN
hls-11302	108	9	was	be	AUX
hls-11302	108	10	found	find	VERB
hls-11302	108	11	to	to	PART
hls-11302	108	12	be	be	AUX
hls-11302	108	13	significantly	significantly	ADV
hls-11302	108	14	higher	high	ADJ
hls-11302	108	15	in	in	ADP
hls-11302	108	16	the	the	DET
hls-11302	108	17	patient	patient	NOUN
hls-11302	108	18	group	group	NOUN
hls-11302	108	19	as	as	ADP
hls-11302	108	20	compared	compare	VERB
hls-11302	108	21	to	to	ADP
hls-11302	108	22	the	the	DET
hls-11302	108	23	healthy	healthy	ADJ
hls-11302	108	24	.	.	PUNCT
hls-11302	109	1	and	and	CCONJ
hls-11302	109	2	also	also	ADV
hls-11302	109	3	the	the	DET
hls-11302	109	4	proinflammatory	proinflammatory	ADJ
hls-11302	109	5	response	response	NOUN
hls-11302	109	6	mediated	mediate	VERB
hls-11302	109	7	by	by	ADP
hls-11302	109	8	the	the	DET
hls-11302	109	9	ifn	ifn	PROPN
hls-11302	109	10	γ	γ	X
hls-11302	109	11	,	,	PUNCT
hls-11302	109	12	determined	determine	VERB
hls-11302	109	13	by	by	ADP
hls-11302	109	14	the	the	DET
hls-11302	109	15	snp	snp	NOUN
hls-11302	109	16	in	in	ADP
hls-11302	109	17	its	its	PRON
hls-11302	109	18	promoter	promoter	NOUN
hls-11302	109	19	was	be	AUX
hls-11302	109	20	found	find	VERB
hls-11302	109	21	to	to	PART
hls-11302	109	22	be	be	AUX
hls-11302	109	23	in	in	ADP
hls-11302	109	24	favor	favor	NOUN
hls-11302	109	25	of	of	ADP
hls-11302	109	26	a	a	DET
hls-11302	109	27	decreased	decrease	VERB
hls-11302	109	28	th1	th1	NOUN
hls-11302	109	29	outcome	outcome	NOUN
hls-11302	109	30	.	.	PUNCT
hls-11302	110	1	in	in	ADP
hls-11302	110	2	conclusion	conclusion	NOUN
hls-11302	110	3	,	,	PUNCT
hls-11302	110	4	the	the	DET
hls-11302	110	5	above	above	ADJ
hls-11302	110	6	findings	finding	NOUN
hls-11302	110	7	suggest	suggest	VERB
hls-11302	110	8	a	a	DET
hls-11302	110	9	genetic	genetic	ADJ
hls-11302	110	10	level	level	NOUN
hls-11302	110	11	of	of	ADP
hls-11302	110	12	susceptibility	susceptibility	NOUN
hls-11302	110	13	in	in	ADP
hls-11302	110	14	the	the	DET
hls-11302	110	15	host	host	NOUN
hls-11302	110	16	toward	toward	ADP
hls-11302	110	17	the	the	DET
hls-11302	110	18	development	development	NOUN
hls-11302	110	19	of	of	ADP
hls-11302	110	20	disease	disease	NOUN
hls-11302	110	21	,	,	PUNCT
hls-11302	110	22	with	with	ADP
hls-11302	110	23	the	the	DET
hls-11302	110	24	immune	immune	ADJ
hls-11302	110	25	response	response	NOUN
hls-11302	110	26	of	of	ADP
hls-11302	110	27	the	the	DET
hls-11302	110	28	host	host	NOUN
hls-11302	110	29	as	as	ADP
hls-11302	110	30	an	an	DET
hls-11302	110	31	important	important	ADJ
hls-11302	110	32	determinant	determinant	ADJ
hls-11302	110	33	in	in	ADP
hls-11302	110	34	the	the	DET
hls-11302	110	35	hostpathogens	hostpathogen	NOUN
hls-11302	110	36	’	’	PART
hls-11302	110	37	interaction	interaction	NOUN
hls-11302	110	38	.	.	PUNCT
hls-11302	111	1	article	article	NOUN
hls-11302	111	2	table	table	VERB
hls-11302	111	3	1	1	NUM
hls-11302	111	4	.	.	PUNCT
hls-11302	112	1	allele	allele	NOUN
hls-11302	112	2	and	and	CCONJ
hls-11302	112	3	genotype	genotype	NOUN
hls-11302	112	4	frequencies	frequency	NOUN
hls-11302	112	5	of	of	ADP
hls-11302	112	6	cytokine	cytokine	ADJ
hls-11302	112	7	polymorphisms	polymorphism	NOUN
hls-11302	112	8	in	in	ADP
hls-11302	112	9	pityriasis	pityriasis	NOUN
hls-11302	112	10	versicolor	versicolor	NOUN
hls-11302	112	11	patients	patient	NOUN
hls-11302	112	12	and	and	CCONJ
hls-11302	112	13	healthy	healthy	ADJ
hls-11302	112	14	controls	control	NOUN
hls-11302	112	15	.	.	PUNCT
hls-11302	113	1	cytokine	cytokine	ADJ
hls-11302	113	2	polymorphism	polymorphism	NOUN
hls-11302	113	3	pv	pv	INTJ
hls-11302	113	4	,	,	PUNCT
hls-11302	114	1	n=38	n=38	ADV
hls-11302	114	2	(	(	PUNCT
hls-11302	114	3	%	%	INTJ
hls-11302	114	4	)	)	PUNCT
hls-11302	114	5	hc	hc	NOUN
hls-11302	114	6	,	,	PUNCT
hls-11302	114	7	n=38	n=38	ADV
hls-11302	114	8	(	(	PUNCT
hls-11302	114	9	%	%	INTJ
hls-11302	114	10	)	)	PUNCT
hls-11302	114	11	p	p	NOUN
hls-11302	114	12	value	value	NOUN
hls-11302	114	13	odds	odd	NOUN
hls-11302	114	14	ratio	ratio	NOUN
hls-11302	114	15	95	95	NUM
hls-11302	114	16	%	%	NOUN
hls-11302	114	17	ci	ci	NOUN
hls-11302	115	1	il10	il10	PROPN
hls-11302	115	2	-	-	PUNCT
hls-11302	115	3	1082	1082	NUM
hls-11302	115	4	alleles	allele	VERB
hls-11302	115	5	a	a	DET
hls-11302	115	6	48(63.2	48(63.2	NOUN
hls-11302	115	7	)	)	PUNCT
hls-11302	115	8	45(59.2	45(59.2	NOUN
hls-11302	115	9	)	)	PUNCT
hls-11302	116	1	0.739	0.739	NUM
hls-11302	116	2	1.181	1.181	NUM
hls-11302	116	3	0.615	0.615	NUM
hls-11302	116	4	-	-	SYM
hls-11302	116	5	2.269	2.269	NUM
hls-11302	116	6	g	g	NOUN
hls-11302	116	7	28(36.8	28(36.8	NOUN
hls-11302	116	8	)	)	PUNCT
hls-11302	116	9	31(40.8	31(40.8	NUM
hls-11302	116	10	)	)	PUNCT
hls-11302	116	11	0.618	0.618	NUM
hls-11302	116	12	0.847	0.847	NUM
hls-11302	116	13	0.441	0.441	NUM
hls-11302	116	14	-	-	SYM
hls-11302	116	15	1.627	1.627	NUM
hls-11302	116	16	genotypes	genotype	NOUN
hls-11302	116	17	aa	aa	NOUN
hls-11302	116	18	10(26.3	10(26.3	NUM
hls-11302	116	19	)	)	PUNCT
hls-11302	116	20	7(18.4	7(18.4	NOUN
hls-11302	116	21	)	)	PUNCT
hls-11302	116	22	0.409	0.409	NUM
hls-11302	116	23	1.582	1.582	NUM
hls-11302	116	24	0.530	0.530	NUM
hls-11302	116	25	-	-	PUNCT
hls-11302	116	26	4.717	4.717	NUM
hls-11302	116	27	ag	ag	PROPN
hls-11302	116	28	28(73.7	28(73.7	NOUN
hls-11302	116	29	)	)	PUNCT
hls-11302	116	30	31(81.6	31(81.6	NOUN
hls-11302	116	31	)	)	PUNCT
hls-11302	116	32	0.409	0.409	NUM
hls-11302	116	33	0.632	0.632	NUM
hls-11302	116	34	0.212	0.212	NUM
hls-11302	116	35	-	-	SYM
hls-11302	116	36	1.886	1.886	NUM
hls-11302	116	37	gg	gg	NOUN
hls-11302	116	38	0(0.0	0(0.0	NUM
hls-11302	116	39	)	)	PUNCT
hls-11302	116	40	0(0.0	0(0.0	NUM
hls-11302	116	41	)	)	PUNCT
hls-11302	116	42	il10	il10	PROPN
hls-11302	116	43	-	-	PUNCT
hls-11302	116	44	819/592	819/592	PROPN
hls-11302	116	45	alleles	allele	NOUN
hls-11302	116	46	c	c	NOUN
hls-11302	116	47	58(76.3	58(76.3	NOUN
hls-11302	116	48	)	)	PUNCT
hls-11302	116	49	46(63.2	46(63.2	NOUN
hls-11302	116	50	)	)	PUNCT
hls-11302	116	51	0.036	0.036	NUM
hls-11302	116	52	*	*	NUM
hls-11302	116	53	2.101	2.101	NUM
hls-11302	116	54	1.043	1.043	NUM
hls-11302	116	55	-	-	SYM
hls-11302	116	56	4.235	4.235	NUM
hls-11302	116	57	t	t	NOUN
hls-11302	116	58	18(23.763.2	18(23.763.2	NUM
hls-11302	116	59	)	)	PUNCT
hls-11302	116	60	30(63.2	30(63.2	NOUN
hls-11302	116	61	)	)	PUNCT
hls-11302	116	62	0.036	0.036	NUM
hls-11302	116	63	*	*	NUM
hls-11302	116	64	0.476	0.476	NUM
hls-11302	116	65	0.236	0.236	NUM
hls-11302	116	66	-	-	PUNCT
hls-11302	116	67	0.959	0.959	NUM
hls-11302	116	68	genotypes	genotype	NOUN
hls-11302	116	69	cc	cc	VERB
hls-11302	116	70	21(55.3	21(55.3	NUM
hls-11302	116	71	)	)	PUNCT
hls-11302	116	72	9(23.7	9(23.7	NOUN
hls-11302	116	73	)	)	PUNCT
hls-11302	116	74	0.05	0.05	NUM
hls-11302	116	75	*	*	PUNCT
hls-11302	116	76	3.980	3.980	NUM
hls-11302	116	77	1.488	1.488	NUM
hls-11302	116	78	-	-	SYM
hls-11302	116	79	10.648	10.648	NUM
hls-11302	116	80	ct	ct	NUM
hls-11302	116	81	16(42.1	16(42.1	NUM
hls-11302	116	82	)	)	PUNCT
hls-11302	116	83	28(72.7	28(72.7	NUM
hls-11302	116	84	)	)	PUNCT
hls-11302	116	85	0.005	0.005	NUM
hls-11302	116	86	*	*	NUM
hls-11302	116	87	#	#	NOUN
hls-11302	116	88	0.260	0.260	NUM
hls-11302	116	89	0.099	0.099	NUM
hls-11302	116	90	-	-	PUNCT
hls-11302	116	91	0.683	0.683	NUM
hls-11302	116	92	tt	tt	PROPN
hls-11302	116	93	1(2.6	1(2.6	NUM
hls-11302	116	94	)	)	PUNCT
hls-11302	116	95	1(2.6	1(2.6	NUM
hls-11302	116	96	)	)	PUNCT
hls-11302	116	97	1.000	1.000	NUM
hls-11302	116	98	1.000	1.000	NUM
hls-11302	116	99	0.060	0.060	NUM
hls-11302	116	100	-	-	SYM
hls-11302	116	101	16.594	16.594	NUM
hls-11302	116	102	ifn	ifn	NOUN
hls-11302	116	103	g	g	PROPN
hls-11302	116	104	+874	+874	PROPN
hls-11302	116	105	alleles	allele	VERB
hls-11302	116	106	a	a	DET
hls-11302	116	107	55(72.4	55(72.4	NUM
hls-11302	116	108	)	)	PUNCT
hls-11302	116	109	40(52.6	40(52.6	NOUN
hls-11302	116	110	)	)	PUNCT
hls-11302	116	111	0.012	0.012	NUM
hls-11302	116	112	*	*	NUM
hls-11302	116	113	#	#	NOUN
hls-11302	116	114	2.357	2.357	NUM
hls-11302	116	115	1.200	1.200	NUM
hls-11302	116	116	-	-	SYM
hls-11302	116	117	4.629	4.629	NUM
hls-11302	116	118	t	t	NOUN
hls-11302	116	119	21(27.6	21(27.6	NUM
hls-11302	116	120	)	)	PUNCT
hls-11302	116	121	36(47.4	36(47.4	NUM
hls-11302	116	122	)	)	PUNCT
hls-11302	116	123	0.012	0.012	NUM
hls-11302	116	124	*	*	NUM
hls-11302	116	125	#	#	NOUN
hls-11302	116	126	0.424	0.424	NUM
hls-11302	116	127	0.216	0.216	NUM
hls-11302	116	128	-	-	SYM
hls-11302	116	129	0.833	0.833	NUM
hls-11302	116	130	genotypes	genotype	NOUN
hls-11302	116	131	aa	aa	NOUN
hls-11302	116	132	21(55.3	21(55.3	NUM
hls-11302	116	133	)	)	PUNCT
hls-11302	116	134	12(31.6	12(31.6	NOUN
hls-11302	116	135	)	)	PUNCT
hls-11302	116	136	0.037	0.037	NUM
hls-11302	116	137	*	*	NUM
hls-11302	116	138	2.676	2.676	NUM
hls-11302	116	139	1.049	1.049	NUM
hls-11302	116	140	-	-	SYM
hls-11302	116	141	6.827	6.827	NUM
hls-11302	116	142	at	at	ADP
hls-11302	116	143	13(34.2	13(34.2	NOUN
hls-11302	116	144	)	)	PUNCT
hls-11302	116	145	16(42.1	16(42.1	NUM
hls-11302	116	146	)	)	PUNCT
hls-11302	116	147	0.479	0.479	NUM
hls-11302	116	148	0.715	0.715	NUM
hls-11302	116	149	0	0	NUM
hls-11302	116	150	..	..	SYM
hls-11302	116	151	282	282	NUM
hls-11302	116	152	-	-	SYM
hls-11302	116	153	1.811	1.811	NUM
hls-11302	116	154	tt	tt	PROPN
hls-11302	116	155	4(10.5	4(10.5	NUM
hls-11302	116	156	)	)	PUNCT
hls-11302	116	157	10(26.3	10(26.3	NUM
hls-11302	116	158	)	)	PUNCT
hls-11302	116	159	0.076	0.076	NUM
hls-11302	116	160	0.329	0.329	NUM
hls-11302	116	161	0.093	0.093	NUM
hls-11302	116	162	-	-	SYM
hls-11302	116	163	1.165	1.165	NUM
hls-11302	116	164	pv	pv	NOUN
hls-11302	116	165	,	,	PUNCT
hls-11302	116	166	pityriasis	pityriasis	NOUN
hls-11302	116	167	versicolor	versicolor	NOUN
hls-11302	116	168	;	;	PUNCT
hls-11302	116	169	hc	hc	PROPN
hls-11302	116	170	,	,	PUNCT
hls-11302	116	171	healthy	healthy	ADJ
hls-11302	116	172	control	control	NOUN
hls-11302	116	173	;	;	PUNCT
hls-11302	116	174	ci	ci	NOUN
hls-11302	116	175	,	,	PUNCT
hls-11302	116	176	confidence	confidence	NOUN
hls-11302	116	177	interval	interval	NOUN
hls-11302	116	178	;	;	PUNCT
hls-11302	116	179	n	n	CCONJ
hls-11302	116	180	,	,	PUNCT
hls-11302	116	181	number	number	NOUN
hls-11302	116	182	of	of	ADP
hls-11302	116	183	subjects	subject	NOUN
hls-11302	116	184	.	.	PUNCT
hls-11302	117	1	*	*	PUNCT
hls-11302	117	2	significant	significant	ADJ
hls-11302	117	3	according	accord	VERB
hls-11302	117	4	to	to	ADP
hls-11302	117	5	(	(	PUNCT
hls-11302	117	6	p<0.05	p<0.05	PROPN
hls-11302	117	7	)	)	PUNCT
hls-11302	117	8	;	;	PUNCT
hls-11302	117	9	#	#	SYM
hls-11302	117	10	significant	significant	ADJ
hls-11302	117	11	according	accord	VERB
hls-11302	117	12	to	to	ADP
hls-11302	117	13	bonferroni	bonferroni	NOUN
hls-11302	117	14	correction	correction	NOUN
hls-11302	117	15	(	(	PUNCT
hls-11302	117	16	p<0.02	p<0.02	PROPN
hls-11302	117	17	)	)	PUNCT
hls-11302	117	18	.	.	PUNCT
hls-11302	118	1	[	[	X
hls-11302	118	2	page	page	NOUN
hls-11302	118	3	37	37	NUM
hls-11302	118	4	]	]	PUNCT
hls-11302	119	1	[	[	X
hls-11302	119	2	healthcare	healthcare	NOUN
hls-11302	119	3	in	in	ADP
hls-11302	119	4	low	low	ADJ
hls-11302	119	5	-	-	PUNCT
hls-11302	119	6	resource	resource	NOUN
hls-11302	119	7	settings	setting	NOUN
hls-11302	119	8	2023	2023	NUM
hls-11302	119	9	;	;	PUNCT
hls-11302	119	10	11:11302	11:11302	X
hls-11302	119	11	]	]	X
hls-11302	119	12	non	non	ADJ
hls-11302	119	13	-co	-co	PROPN
hls-11302	119	14	mmerc	mmerc	PROPN
hls-11302	119	15	ial	ial	PROPN
hls-11302	119	16	us	us	PROPN
hls-11302	119	17	e	e	NOUN
hls-11302	119	18	o	o	NOUN
hls-11302	120	1	nly	nly	ADV
hls-11302	120	2	[	[	X
hls-11302	120	3	healthcare	healthcare	NOUN
hls-11302	120	4	in	in	ADP
hls-11302	120	5	low	low	ADJ
hls-11302	120	6	-	-	PUNCT
hls-11302	120	7	resource	resource	NOUN
hls-11302	120	8	settings	setting	NOUN
hls-11302	120	9	2023	2023	NUM
hls-11302	120	10	;	;	PUNCT
hls-11302	120	11	11:11302	11:11302	X
hls-11302	120	12	]	]	X
hls-11302	121	1	[	[	X
hls-11302	121	2	page	page	NOUN
hls-11302	121	3	38	38	NUM
hls-11302	121	4	]	]	PUNCT
hls-11302	121	5	conclusions	conclusion	NOUN
hls-11302	121	6	cytokine	cytokine	VERB
hls-11302	121	7	gene	gene	NOUN
hls-11302	121	8	polymorphism	polymorphism	NOUN
hls-11302	121	9	data	datum	NOUN
hls-11302	121	10	demonstrated	demonstrate	VERB
hls-11302	121	11	the	the	DET
hls-11302	121	12	susceptibility	susceptibility	NOUN
hls-11302	121	13	of	of	ADP
hls-11302	121	14	the	the	DET
hls-11302	121	15	host	host	NOUN
hls-11302	121	16	to	to	ADP
hls-11302	121	17	malassezia	malassezia	NOUN
hls-11302	121	18	infections	infection	NOUN
hls-11302	121	19	in	in	ADP
hls-11302	121	20	our	our	PRON
hls-11302	121	21	study	study	NOUN
hls-11302	121	22	.	.	PUNCT
hls-11302	122	1	data	datum	NOUN
hls-11302	122	2	could	could	AUX
hls-11302	122	3	help	help	VERB
hls-11302	122	4	to	to	PART
hls-11302	122	5	find	find	VERB
hls-11302	122	6	out	out	ADP
hls-11302	122	7	who	who	PRON
hls-11302	122	8	is	be	AUX
hls-11302	122	9	disease	disease	NOUN
hls-11302	122	10	prone	prone	ADJ
hls-11302	122	11	,	,	PUNCT
hls-11302	122	12	i.e.	i.e.	X
hls-11302	122	13	,	,	PUNCT
hls-11302	122	14	risk	risk	NOUN
hls-11302	122	15	prediction	prediction	NOUN
hls-11302	122	16	which	which	PRON
hls-11302	122	17	might	might	AUX
hls-11302	122	18	influence	influence	VERB
hls-11302	122	19	the	the	DET
hls-11302	122	20	use	use	NOUN
hls-11302	122	21	of	of	ADP
hls-11302	122	22	prophylactic	prophylactic	ADJ
hls-11302	122	23	measures	measure	NOUN
hls-11302	122	24	,	,	PUNCT
hls-11302	122	25	avoid	avoid	VERB
hls-11302	122	26	risk	risk	NOUN
hls-11302	122	27	factors	factor	NOUN
hls-11302	122	28	.	.	PUNCT
hls-11302	123	1	this	this	PRON
hls-11302	123	2	helps	help	VERB
hls-11302	123	3	in	in	ADP
hls-11302	123	4	understanding	understand	VERB
hls-11302	123	5	particular	particular	ADJ
hls-11302	123	6	pathways	pathway	NOUN
hls-11302	123	7	used	use	VERB
hls-11302	123	8	in	in	ADP
hls-11302	123	9	host	host	NOUN
hls-11302	123	10	resistance	resistance	NOUN
hls-11302	123	11	to	to	ADP
hls-11302	123	12	infection	infection	NOUN
hls-11302	123	13	and	and	CCONJ
hls-11302	123	14	augmenting	augment	VERB
hls-11302	123	15	those	those	PRON
hls-11302	123	16	using	use	VERB
hls-11302	123	17	scientific	scientific	ADJ
hls-11302	123	18	approaches	approach	NOUN
hls-11302	123	19	and	and	CCONJ
hls-11302	123	20	also	also	ADV
hls-11302	123	21	devising	devise	VERB
hls-11302	123	22	therapeutic	therapeutic	ADJ
hls-11302	123	23	modalities	modality	NOUN
hls-11302	123	24	via	via	ADP
hls-11302	123	25	exogenously	exogenously	ADV
hls-11302	123	26	supplementing	supplement	VERB
hls-11302	123	27	cytokines	cytokine	NOUN
hls-11302	123	28	to	to	PART
hls-11302	123	29	balance	balance	VERB
hls-11302	123	30	out	out	ADP
hls-11302	123	31	the	the	DET
hls-11302	123	32	immune	immune	ADJ
hls-11302	123	33	response	response	NOUN
hls-11302	123	34	.	.	PUNCT
hls-11302	124	1	vaccines	vaccine	NOUN
hls-11302	124	2	targeting	target	VERB
hls-11302	124	3	specific	specific	ADJ
hls-11302	124	4	genes	gene	NOUN
hls-11302	124	5	can	can	AUX
hls-11302	124	6	be	be	AUX
hls-11302	124	7	developed	develop	VERB
hls-11302	124	8	to	to	PART
hls-11302	124	9	resolve	resolve	VERB
hls-11302	124	10	cases	case	NOUN
hls-11302	124	11	of	of	ADP
hls-11302	124	12	chronic	chronic	ADJ
hls-11302	124	13	and	and	CCONJ
hls-11302	124	14	recurrent	recurrent	ADJ
hls-11302	124	15	lesions	lesion	NOUN
hls-11302	124	16	.	.	PUNCT
hls-11302	125	1	detailed	detailed	ADJ
hls-11302	125	2	further	further	ADJ
hls-11302	125	3	studies	study	NOUN
hls-11302	125	4	might	might	AUX
hls-11302	125	5	direct	direct	VERB
hls-11302	125	6	individual	individual	NOUN
hls-11302	125	7	-	-	PUNCT
hls-11302	125	8	based	base	VERB
hls-11302	125	9	treatment	treatment	NOUN
hls-11302	125	10	depending	depend	VERB
hls-11302	125	11	on	on	ADP
hls-11302	125	12	the	the	DET
hls-11302	125	13	genetic	genetic	ADJ
hls-11302	125	14	makeup	makeup	NOUN
hls-11302	125	15	of	of	ADP
hls-11302	125	16	the	the	DET
hls-11302	125	17	patient	patient	NOUN
hls-11302	125	18	.	.	PUNCT
hls-11302	126	1	references	reference	NOUN
hls-11302	126	2	1	1	NUM
hls-11302	126	3	.	.	PUNCT
hls-11302	126	4	ashbee	ashbee	PROPN
hls-11302	126	5	hr	hr	PROPN
hls-11302	126	6	,	,	PUNCT
hls-11302	126	7	evans	evans	PROPN
hls-11302	126	8	eg	eg	PROPN
hls-11302	126	9	.	.	PUNCT
hls-11302	127	1	immunology	immunology	NOUN
hls-11302	127	2	of	of	ADP
hls-11302	127	3	diseases	disease	NOUN
hls-11302	127	4	associated	associate	VERB
hls-11302	127	5	with	with	ADP
hls-11302	127	6	malassezia	malassezia	NOUN
hls-11302	127	7	species	specie	NOUN
hls-11302	127	8	.	.	PUNCT
hls-11302	128	1	clin	clin	PROPN
hls-11302	128	2	microbiol	microbiol	PROPN
hls-11302	128	3	rev	rev	VERB
hls-11302	128	4	2002;15	2002;15	NUM
hls-11302	128	5	:	:	PUNCT
hls-11302	128	6	21	21	NUM
hls-11302	128	7	-	-	SYM
hls-11302	128	8	57	57	NUM
hls-11302	128	9	.	.	PUNCT
hls-11302	129	1	2	2	NUM
hls-11302	129	2	.	.	X
hls-11302	129	3	thomas	thomas	PROPN
hls-11302	129	4	ds	ds	PROPN
hls-11302	129	5	,	,	PUNCT
hls-11302	129	6	ingham	ingham	PROPN
hls-11302	129	7	e	e	PROPN
hls-11302	129	8	,	,	PUNCT
hls-11302	129	9	bojar	bojar	PROPN
hls-11302	129	10	ra	ra	PROPN
hls-11302	129	11	,	,	PUNCT
hls-11302	129	12	holland	holland	PROPN
hls-11302	129	13	kt	kt	PROPN
hls-11302	129	14	.	.	PROPN
hls-11302	130	1	in	in	ADP
hls-11302	130	2	vitro	vitro	X
hls-11302	130	3	modulation	modulation	NOUN
hls-11302	130	4	of	of	ADP
hls-11302	130	5	human	human	PROPN
hls-11302	130	6	keratinocyte	keratinocyte	NOUN
hls-11302	130	7	proand	proand	PROPN
hls-11302	130	8	antiinflammatory	antiinflammatory	NOUN
hls-11302	130	9	cytokine	cytokine	NOUN
hls-11302	130	10	production	production	NOUN
hls-11302	130	11	by	by	ADP
hls-11302	130	12	the	the	DET
hls-11302	130	13	capsule	capsule	NOUN
hls-11302	130	14	of	of	ADP
hls-11302	130	15	malassezia	malassezia	NOUN
hls-11302	130	16	species	specie	NOUN
hls-11302	130	17	.	.	PUNCT
hls-11302	131	1	fems	fems	PROPN
hls-11302	131	2	immunol	immunol	PROPN
hls-11302	131	3	med	med	PROPN
hls-11302	131	4	microbiol	microbiol	PROPN
hls-11302	131	5	2008	2008	NUM
hls-11302	131	6	;	;	PUNCT
hls-11302	131	7	54:203	54:203	NUM
hls-11302	131	8	-	-	SYM
hls-11302	131	9	14	14	NUM
hls-11302	131	10	.	.	PUNCT
hls-11302	132	1	3	3	X
hls-11302	132	2	.	.	X
hls-11302	132	3	cafarchia	cafarchia	PROPN
hls-11302	132	4	c	c	NOUN
hls-11302	132	5	,	,	PUNCT
hls-11302	132	6	otranto	otranto	ADP
hls-11302	132	7	d.	d.	PROPN
hls-11302	132	8	association	association	PROPN
hls-11302	132	9	between	between	ADP
hls-11302	132	10	phospholipase	phospholipase	NOUN
hls-11302	132	11	production	production	NOUN
hls-11302	132	12	by	by	ADP
hls-11302	132	13	malassezia	malassezia	NOUN
hls-11302	132	14	pachydermatis	pachydermatis	NOUN
hls-11302	132	15	and	and	CCONJ
hls-11302	132	16	skin	skin	NOUN
hls-11302	132	17	lesions	lesion	NOUN
hls-11302	132	18	.	.	PUNCT
hls-11302	133	1	j	j	PROPN
hls-11302	133	2	clin	clin	PROPN
hls-11302	133	3	microbiol	microbiol	PROPN
hls-11302	133	4	2004;42:4868	2004;42:4868	PROPN
hls-11302	133	5	-	-	SYM
hls-11302	133	6	9	9	NUM
hls-11302	133	7	.	.	NOUN
hls-11302	133	8	4	4	NUM
hls-11302	133	9	.	.	X
hls-11302	133	10	choe	choe	PROPN
hls-11302	133	11	yb	yb	PROPN
hls-11302	133	12	,	,	PUNCT
hls-11302	133	13	jang	jang	PROPN
hls-11302	133	14	sj	sj	PROPN
hls-11302	133	15	,	,	PUNCT
hls-11302	133	16	yim	yim	PROPN
hls-11302	133	17	sm	sm	PROPN
hls-11302	133	18	,	,	PUNCT
hls-11302	133	19	ahn	ahn	PROPN
hls-11302	133	20	kj.the	kj.the	DET
hls-11302	133	21	quantitative	quantitative	ADJ
hls-11302	133	22	study	study	NOUN
hls-11302	133	23	on	on	ADP
hls-11302	133	24	the	the	DET
hls-11302	133	25	distribution	distribution	NOUN
hls-11302	133	26	of	of	ADP
hls-11302	133	27	malasseziayeasts	malasseziayeast	NOUN
hls-11302	133	28	on	on	ADP
hls-11302	133	29	the	the	DET
hls-11302	133	30	normal	normal	ADJ
hls-11302	133	31	skin	skin	NOUN
hls-11302	133	32	of	of	ADP
hls-11302	133	33	the	the	DET
hls-11302	133	34	young	young	ADJ
hls-11302	133	35	adults	adult	NOUN
hls-11302	133	36	.	.	PUNCT
hls-11302	134	1	korean	korean	PROPN
hls-11302	134	2	j	j	PROPN
hls-11302	134	3	med	me	VERB
hls-11302	134	4	mycol	mycol	CCONJ
hls-11302	134	5	2004;9:174	2004;9:174	PROPN
hls-11302	134	6	-	-	PUNCT
hls-11302	134	7	81	81	NUM
hls-11302	134	8	.	.	PUNCT
hls-11302	135	1	5	5	NUM
hls-11302	135	2	.	.	X
hls-11302	135	3	forke	forke	PROPN
hls-11302	135	4	r	r	PROPN
hls-11302	135	5	,	,	PUNCT
hls-11302	135	6	jäger	jäger	PROPN
hls-11302	135	7	a	a	PROPN
hls-11302	135	8	,	,	PUNCT
hls-11302	135	9	knölker	knölker	PROPN
hls-11302	135	10	hj	hj	PROPN
hls-11302	135	11	.	.	PROPN
hls-11302	136	1	first	first	ADJ
hls-11302	136	2	total	total	ADJ
hls-11302	136	3	synthesis	synthesis	NOUN
hls-11302	136	4	of	of	ADP
hls-11302	136	5	clausine	clausine	ADJ
hls-11302	136	6	l	l	NOUN
hls-11302	136	7	and	and	CCONJ
hls-11302	136	8	pityriazole	pityriazole	PROPN
hls-11302	136	9	,	,	PUNCT
hls-11302	136	10	a	a	DET
hls-11302	136	11	metabolite	metabolite	NOUN
hls-11302	136	12	of	of	ADP
hls-11302	136	13	the	the	DET
hls-11302	136	14	human	human	ADJ
hls-11302	136	15	pathogenic	pathogenic	ADJ
hls-11302	136	16	yeast	yeast	NOUN
hls-11302	136	17	malassezia	malassezia	NOUN
hls-11302	136	18	furfur	furfur	NOUN
hls-11302	136	19	.	.	PUNCT
hls-11302	137	1	org	org	PROPN
hls-11302	137	2	biomol	biomol	PROPN
hls-11302	137	3	chem	chem	NOUN
hls-11302	137	4	2008;21:2481	2008;21:2481	NUM
hls-11302	137	5	-	-	SYM
hls-11302	137	6	3	3	NUM
hls-11302	137	7	.	.	NOUN
hls-11302	137	8	6	6	NUM
hls-11302	137	9	.	.	X
hls-11302	137	10	carvalho	carvalho	PROPN
hls-11302	137	11	a	a	PROPN
hls-11302	137	12	,	,	PUNCT
hls-11302	137	13	cunha	cunha	PROPN
hls-11302	137	14	c	c	PROPN
hls-11302	137	15	,	,	PUNCT
hls-11302	137	16	pasqualotto	pasqualotto	ADJ
hls-11302	137	17	ac	ac	PROPN
hls-11302	137	18	,	,	PUNCT
hls-11302	137	19	et	et	PROPN
hls-11302	137	20	al	al	PROPN
hls-11302	137	21	.	.	PUNCT
hls-11302	138	1	genetic	genetic	ADJ
hls-11302	138	2	variability	variability	NOUN
hls-11302	138	3	of	of	ADP
hls-11302	138	4	innate	innate	ADJ
hls-11302	138	5	immunity	immunity	NOUN
hls-11302	138	6	impacts	impact	VERB
hls-11302	138	7	human	human	ADJ
hls-11302	138	8	susceptibility	susceptibility	NOUN
hls-11302	138	9	to	to	ADP
hls-11302	138	10	fungal	fungal	ADJ
hls-11302	138	11	diseases	disease	NOUN
hls-11302	138	12	.	.	PUNCT
hls-11302	139	1	int	int	NOUN
hls-11302	139	2	j	j	PROPN
hls-11302	139	3	infect	infect	VERB
hls-11302	139	4	dis	dis	PROPN
hls-11302	139	5	,	,	PUNCT
hls-11302	139	6	2010	2010	NUM
hls-11302	139	7	;	;	PUNCT
hls-11302	139	8	14:460	14:460	NUM
hls-11302	139	9	-	-	SYM
hls-11302	139	10	8	8	NUM
hls-11302	139	11	.	.	NOUN
hls-11302	139	12	7	7	NUM
hls-11302	139	13	.	.	X
hls-11302	139	14	afzal	afzal	PROPN
hls-11302	139	15	ms	ms	PROPN
hls-11302	139	16	,	,	PUNCT
hls-11302	139	17	tahir	tahir	PROPN
hls-11302	139	18	s	s	PROPN
hls-11302	139	19	,	,	PUNCT
hls-11302	139	20	salman	salman	PROPN
hls-11302	139	21	a	a	PROPN
hls-11302	139	22	,	,	PUNCT
hls-11302	139	23	et	et	PROPN
hls-11302	139	24	al	al	PROPN
hls-11302	139	25	.	.	PUNCT
hls-11302	140	1	analysis	analysis	NOUN
hls-11302	140	2	of	of	ADP
hls-11302	140	3	interleukin-10	interleukin-10	ADJ
hls-11302	140	4	gene	gene	NOUN
hls-11302	140	5	polymorphisms	polymorphism	NOUN
hls-11302	140	6	and	and	CCONJ
hls-11302	140	7	hepatitis	hepatitis	NOUN
hls-11302	140	8	c	c	PROPN
hls-11302	140	9	susceptibility	susceptibility	NOUN
hls-11302	140	10	in	in	ADP
hls-11302	140	11	pakistan	pakistan	PROPN
hls-11302	140	12	.	.	PUNCT
hls-11302	141	1	j	j	PROPN
hls-11302	141	2	infect	infect	PROPN
hls-11302	141	3	dev	dev	PROPN
hls-11302	141	4	ctries	ctrie	NOUN
hls-11302	141	5	2011;5:473	2011;5:473	NOUN
hls-11302	141	6	-	-	SYM
hls-11302	141	7	9	9	NUM
hls-11302	141	8	.	.	NOUN
hls-11302	141	9	8	8	NUM
hls-11302	141	10	.	.	PUNCT
hls-11302	141	11	ansari	ansari	PROPN
hls-11302	141	12	a	a	PROPN
hls-11302	141	13	,	,	PUNCT
hls-11302	141	14	hasan	hasan	PROPN
hls-11302	141	15	z	z	PROPN
hls-11302	141	16	,	,	PUNCT
hls-11302	141	17	dawood	dawood	PROPN
hls-11302	141	18	g	g	PROPN
hls-11302	141	19	,	,	PUNCT
hls-11302	141	20	hussain	hussain	PROPN
hls-11302	141	21	r.	r.	PROPN
hls-11302	141	22	differential	differential	PROPN
hls-11302	141	23	combination	combination	NOUN
hls-11302	141	24	of	of	ADP
hls-11302	141	25	cytokine	cytokine	NOUN
hls-11302	141	26	and	and	CCONJ
hls-11302	141	27	interferon	interferon	ADJ
hls-11302	141	28	-	-	PUNCT
hls-11302	141	29	γ	γ	NOUN
hls-11302	141	30	+874	+874	NUM
hls-11302	141	31	t	t	PROPN
hls-11302	141	32	/	/	SYM
hls-11302	141	33	a	a	DET
hls-11302	141	34	polymorphisms	polymorphism	NOUN
hls-11302	141	35	determines	determine	VERB
hls-11302	141	36	disease	disease	NOUN
hls-11302	141	37	severity	severity	NOUN
hls-11302	141	38	in	in	ADP
hls-11302	141	39	pulmonary	pulmonary	ADJ
hls-11302	141	40	tuberculosis	tuberculosis	NOUN
hls-11302	141	41	.	.	PUNCT
hls-11302	142	1	plos	plos	PROPN
hls-11302	142	2	one	one	NUM
hls-11302	142	3	2011;6:27848	2011;6:27848	NUM
hls-11302	142	4	.	.	PUNCT
hls-11302	143	1	9	9	X
hls-11302	143	2	.	.	X
hls-11302	143	3	han	han	PROPN
hls-11302	143	4	a	a	PROPN
hls-11302	143	5	,	,	PUNCT
hls-11302	143	6	calcara	calcara	PROPN
hls-11302	143	7	da	da	PROPN
hls-11302	143	8	,	,	PUNCT
hls-11302	143	9	stoecker	stoecker	PROPN
hls-11302	143	10	wv	wv	PROPN
hls-11302	143	11	,	,	PUNCT
hls-11302	143	12	daly	daly	PROPN
hls-11302	143	13	j	j	PROPN
hls-11302	143	14	,	,	PUNCT
hls-11302	143	15	siegel	siegel	PROPN
hls-11302	143	16	dm	dm	PROPN
hls-11302	143	17	,	,	PUNCT
hls-11302	143	18	shell	shell	ADJ
hls-11302	143	19	a.	a.	NOUN
hls-11302	143	20	evoked	evoke	VERB
hls-11302	143	21	scale	scale	NOUN
hls-11302	143	22	sign	sign	NOUN
hls-11302	143	23	of	of	ADP
hls-11302	143	24	tinea	tinea	PROPN
hls-11302	143	25	versicolor	versicolor	PROPN
hls-11302	143	26	.	.	PUNCT
hls-11302	144	1	arch	arch	ADJ
hls-11302	144	2	dermatol	dermatol	NOUN
hls-11302	144	3	2009;145:1078	2009;145:1078	NUM
hls-11302	144	4	.	.	PUNCT
hls-11302	145	1	10	10	NUM
hls-11302	145	2	.	.	PUNCT
hls-11302	146	1	shi	shi	PROPN
hls-11302	146	2	vs	vs	ADP
hls-11302	146	3	,	,	PUNCT
hls-11302	146	4	lio	lio	PROPN
hls-11302	146	5	pa	pa	PROPN
hls-11302	146	6	.	.	PROPN
hls-11302	146	7	diagnosis	diagnosis	NOUN
hls-11302	146	8	of	of	ADP
hls-11302	146	9	pityriasis	pityriasis	NOUN
hls-11302	146	10	versicolor	versicolor	NOUN
hls-11302	146	11	in	in	ADP
hls-11302	146	12	paediatrics	paediatric	NOUN
hls-11302	146	13	:	:	PUNCT
hls-11302	146	14	the	the	DET
hls-11302	146	15	evoked	evoked	ADJ
hls-11302	146	16	scale	scale	NOUN
hls-11302	146	17	sign	sign	NOUN
hls-11302	146	18	.	.	PUNCT
hls-11302	147	1	arch	arch	PROPN
hls-11302	147	2	dis	dis	PROPN
hls-11302	147	3	child	child	PROPN
hls-11302	147	4	2011;96:392–3	2011;96:392–3	NUM
hls-11302	147	5	.	.	PUNCT
hls-11302	148	1	11	11	NUM
hls-11302	148	2	.	.	PUNCT
hls-11302	149	1	little	little	ADJ
hls-11302	149	2	,	,	PUNCT
hls-11302	149	3	s.	s.	PROPN
hls-11302	149	4	amplification	amplification	NOUN
hls-11302	149	5	-	-	PUNCT
hls-11302	149	6	refractory	refractory	NOUN
hls-11302	149	7	mutation	mutation	NOUN
hls-11302	149	8	system	system	NOUN
hls-11302	149	9	(	(	PUNCT
hls-11302	149	10	arms	arm	NOUN
hls-11302	149	11	)	)	PUNCT
hls-11302	149	12	analysis	analysis	NOUN
hls-11302	149	13	of	of	ADP
hls-11302	149	14	point	point	NOUN
hls-11302	149	15	mutations	mutation	NOUN
hls-11302	149	16	.	.	PUNCT
hls-11302	150	1	curr	curr	PROPN
hls-11302	150	2	protoc	protoc	VERB
hls-11302	150	3	hum	hum	PROPN
hls-11302	150	4	genet	genet	PROPN
hls-11302	150	5	2001;9:9.8	2001;9:9.8	NUM
hls-11302	150	6	.	.	PUNCT
hls-11302	150	7	12	12	NUM
hls-11302	150	8	.	.	PUNCT
hls-11302	151	1	manne	manne	PROPN
hls-11302	151	2	m	m	PROPN
hls-11302	151	3	,	,	PUNCT
hls-11302	151	4	gunde	gunde	VERB
hls-11302	151	5	s	s	PROPN
hls-11302	151	6	,	,	PUNCT
hls-11302	151	7	kondreddy	kondreddy	PROPN
hls-11302	151	8	rk	rk	PROPN
hls-11302	151	9	,	,	PUNCT
hls-11302	151	10	et	et	PROPN
hls-11302	151	11	al	al	PROPN
hls-11302	151	12	.	.	PROPN
hls-11302	151	13	association	association	PROPN
hls-11302	151	14	of	of	ADP
hls-11302	151	15	ifn	ifn	PROPN
hls-11302	151	16	-	-	PUNCT
hls-11302	151	17	g+874(t	g+874(t	VERB
hls-11302	151	18	/	/	SYM
hls-11302	151	19	a	a	NOUN
hls-11302	151	20	)	)	PUNCT
hls-11302	151	21	polymorphism	polymorphism	NOUN
hls-11302	151	22	with	with	ADP
hls-11302	151	23	female	female	ADJ
hls-11302	151	24	patients	patient	NOUN
hls-11302	151	25	of	of	ADP
hls-11302	151	26	agerelated	agerelate	VERB
hls-11302	151	27	cataracts	cataract	NOUN
hls-11302	151	28	.	.	PUNCT
hls-11302	152	1	j	j	PROPN
hls-11302	152	2	ophthalmol	ophthalmol	PROPN
hls-11302	152	3	2012;5	2012;5	NUM
hls-11302	152	4	:	:	PUNCT
hls-11302	152	5	32	32	NUM
hls-11302	152	6	-	-	SYM
hls-11302	152	7	6	6	NUM
hls-11302	152	8	.	.	NOUN
hls-11302	152	9	13	13	NUM
hls-11302	152	10	.	.	PUNCT
hls-11302	153	1	armstrong	armstrong	PROPN
hls-11302	153	2	ra	ra	PROPN
hls-11302	153	3	.	.	PUNCT
hls-11302	154	1	when	when	SCONJ
hls-11302	154	2	to	to	PART
hls-11302	154	3	use	use	VERB
hls-11302	154	4	the	the	DET
hls-11302	154	5	bonferroni	bonferroni	NOUN
hls-11302	154	6	correction	correction	NOUN
hls-11302	154	7	.	.	PUNCT
hls-11302	155	1	ophthalmic	ophthalmic	ADJ
hls-11302	155	2	physiol	physiol	PROPN
hls-11302	155	3	opt	opt	VERB
hls-11302	155	4	2014;34:502	2014;34:502	ADV
hls-11302	155	5	-	-	SYM
hls-11302	155	6	8	8	NUM
hls-11302	155	7	.	.	PUNCT
hls-11302	155	8	14	14	NUM
hls-11302	155	9	.	.	PUNCT
hls-11302	156	1	ahn	ahn	PROPN
hls-11302	156	2	,	,	PUNCT
hls-11302	156	3	kj	kj	PROPN
hls-11302	156	4	.	.	PUNCT
hls-11302	156	5	taxonomy	taxonomy	NOUN
hls-11302	156	6	of	of	ADP
hls-11302	156	7	the	the	DET
hls-11302	156	8	genus	genus	ADJ
hls-11302	156	9	malassezia	malassezia	NOUN
hls-11302	156	10	.	.	PUNCT
hls-11302	157	1	korean	korean	PROPN
hls-11302	157	2	j	j	PROPN
hls-11302	157	3	med	me	VERB
hls-11302	157	4	mycol	mycol	CCONJ
hls-11302	157	5	1998;3:81	1998;3:81	NOUN
hls-11302	157	6	-	-	PUNCT
hls-11302	157	7	8	8	NUM
hls-11302	157	8	.	.	NOUN
hls-11302	157	9	15	15	NUM
hls-11302	157	10	.	.	PUNCT
hls-11302	158	1	el	el	PROPN
hls-11302	158	2	-	-	PUNCT
hls-11302	158	3	hefnawi	hefnawi	PROPN
hls-11302	158	4	h	h	PROPN
hls-11302	158	5	,	,	PUNCT
hls-11302	158	6	el	el	PROPN
hls-11302	158	7	-	-	PUNCT
hls-11302	158	8	gothamy	gothamy	PROPN
hls-11302	158	9	z	z	PROPN
hls-11302	158	10	,	,	PUNCT
hls-11302	158	11	refai	refai	NOUN
hls-11302	158	12	m.	m.	NOUN
hls-11302	158	13	studies	study	NOUN
hls-11302	158	14	on	on	ADP
hls-11302	158	15	pityriasis	pityriasis	NOUN
hls-11302	158	16	versicolor	versicolor	NOUN
hls-11302	158	17	in	in	ADP
hls-11302	158	18	egypt	egypt	PROPN
hls-11302	158	19	.	.	PUNCT
hls-11302	159	1	i	i	PRON
hls-11302	159	2	incidence	incidence	VERB
hls-11302	159	3	mykosen	mykosen	NOUN
hls-11302	159	4	1971;14:225–31	1971;14:225–31	PROPN
hls-11302	159	5	.	.	PUNCT
hls-11302	160	1	16	16	NUM
hls-11302	160	2	.	.	PUNCT
hls-11302	161	1	mayser	mayser	PROPN
hls-11302	161	2	p	p	NOUN
hls-11302	161	3	,	,	PUNCT
hls-11302	161	4	gaitanis	gaitanis	NOUN
hls-11302	161	5	g.	g.	PROPN
hls-11302	161	6	physiology	physiology	NOUN
hls-11302	161	7	and	and	CCONJ
hls-11302	161	8	biochemistry	biochemistry	NOUN
hls-11302	161	9	.	.	PUNCT
hls-11302	162	1	in	in	ADP
hls-11302	162	2	:	:	PUNCT
hls-11302	162	3	malassezia	malassezia	NOUN
hls-11302	162	4	and	and	CCONJ
hls-11302	162	5	the	the	DET
hls-11302	162	6	skin	skin	NOUN
hls-11302	162	7	.	.	PUNCT
hls-11302	163	1	science	science	NOUN
hls-11302	163	2	and	and	CCONJ
hls-11302	163	3	clinical	clinical	ADJ
hls-11302	163	4	practice	practice	NOUN
hls-11302	163	5	.	.	PUNCT
hls-11302	164	1	2010th	2010th	ADJ
hls-11302	164	2	edition	edition	NOUN
hls-11302	164	3	.	.	PUNCT
hls-11302	165	1	boekhout	boekhout	PROPN
hls-11302	165	2	t	t	PROPN
hls-11302	165	3	,	,	PUNCT
hls-11302	165	4	guého	guého	NOUN
hls-11302	165	5	e	e	NOUN
hls-11302	165	6	,	,	PUNCT
hls-11302	165	7	mayser	mayser	NOUN
hls-11302	165	8	p	p	NOUN
hls-11302	165	9	,	,	PUNCT
hls-11302	165	10	velegraki	velegraki	VERB
hls-11302	165	11	a	a	DET
hls-11302	165	12	,	,	PUNCT
hls-11302	165	13	eds	ed	NOUN
hls-11302	165	14	.	.	PROPN
hls-11302	165	15	springer	springer	NOUN
hls-11302	165	16	,	,	PUNCT
hls-11302	165	17	berlin	berlin	PROPN
hls-11302	165	18	,	,	PUNCT
hls-11302	165	19	germany	germany	PROPN
hls-11302	165	20	,	,	PUNCT
hls-11302	165	21	2010	2010	NUM
hls-11302	165	22	;	;	PUNCT
hls-11302	166	1	p.	p.	NOUN
hls-11302	166	2	121–38	121–38	NUM
hls-11302	166	3	.	.	PUNCT
hls-11302	167	1	17	17	NUM
hls-11302	167	2	.	.	PUNCT
hls-11302	168	1	rezaee	rezaee	PROPN
hls-11302	168	2	ma	ma	PROPN
hls-11302	168	3	,	,	PUNCT
hls-11302	168	4	motaharinia	motaharinia	PROPN
hls-11302	168	5	y	y	PROPN
hls-11302	168	6	,	,	PUNCT
hls-11302	168	7	hosseini	hosseini	PROPN
hls-11302	168	8	w	w	PROPN
hls-11302	168	9	,	,	PUNCT
hls-11302	168	10	et	et	PROPN
hls-11302	168	11	al	al	PROPN
hls-11302	168	12	.	.	PUNCT
hls-11302	168	13	natural	natural	ADJ
hls-11302	168	14	oils	oil	NOUN
hls-11302	168	15	enhance	enhance	VERB
hls-11302	168	16	il-10	il-10	PRON
hls-11302	168	17	&	&	CCONJ
hls-11302	168	18	ifn	ifn	PROPN
hls-11302	168	19	gamma	gamma	PROPN
hls-11302	168	20	production	production	NOUN
hls-11302	168	21	by	by	ADP
hls-11302	168	22	human	human	ADJ
hls-11302	168	23	pbmcs	pbmcs	NOUN
hls-11302	168	24	cultured	culture	VERB
hls-11302	168	25	with	with	ADP
hls-11302	168	26	malassezia	malassezia	NOUN
hls-11302	168	27	furfur	furfur	NOUN
hls-11302	168	28	.	.	PUNCT
hls-11302	169	1	iran	iran	PROPN
hls-11302	169	2	j	j	PROPN
hls-11302	169	3	immunol	immunol	PROPN
hls-11302	169	4	2012;9:100	2012;9:100	PROPN
hls-11302	169	5	-	-	SYM
hls-11302	169	6	19	19	NUM
hls-11302	169	7	.	.	NOUN
hls-11302	169	8	18	18	NUM
hls-11302	169	9	.	.	PUNCT
hls-11302	169	10	buentke	buentke	PROPN
hls-11302	169	11	e	e	NOUN
hls-11302	169	12	,	,	PUNCT
hls-11302	169	13	zargari	zargari	PROPN
hls-11302	169	14	a	a	X
hls-11302	169	15	,	,	PUNCT
hls-11302	169	16	heffler	heffler	NOUN
hls-11302	169	17	lc	lc	PROPN
hls-11302	169	18	,	,	PUNCT
hls-11302	169	19	et	et	PROPN
hls-11302	169	20	al	al	PROPN
hls-11302	169	21	.	.	PUNCT
hls-11302	169	22	update	update	NOUN
hls-11302	169	23	on	on	ADP
hls-11302	169	24	the	the	DET
hls-11302	169	25	genus	genus	ADJ
hls-11302	169	26	malassezia	malassezia	NOUN
hls-11302	169	27	furfur	furfur	NOUN
hls-11302	169	28	&	&	CCONJ
hls-11302	169	29	its	its	PRON
hls-11302	169	30	allergenic	allergenic	ADJ
hls-11302	169	31	components	component	NOUN
hls-11302	169	32	by	by	ADP
hls-11302	169	33	human	human	ADJ
hls-11302	169	34	immature	immature	ADJ
hls-11302	169	35	cd1a+	cd1a+	PROPN
hls-11302	169	36	dendritic	dendritic	ADJ
hls-11302	169	37	cells	cell	NOUN
hls-11302	169	38	.	.	PUNCT
hls-11302	170	1	clin	clin	PROPN
hls-11302	170	2	exp	exp	PROPN
hls-11302	170	3	allergy	allergy	PROPN
hls-11302	170	4	2000;30:1759	2000;30:1759	PROPN
hls-11302	170	5	-	-	SYM
hls-11302	170	6	70	70	NUM
hls-11302	170	7	.	.	PUNCT
hls-11302	170	8	19	19	NUM
hls-11302	170	9	.	.	PUNCT
hls-11302	171	1	valli	valli	PROPN
hls-11302	171	2	jl	jl	PROPN
hls-11302	171	3	,	,	PUNCT
hls-11302	171	4	williamson	williamson	PROPN
hls-11302	171	5	a	a	PROPN
hls-11302	171	6	,	,	PUNCT
hls-11302	171	7	sharif	sharif	PROPN
hls-11302	171	8	s	s	PROPN
hls-11302	171	9	,	,	PUNCT
hls-11302	171	10	et	et	PROPN
hls-11302	171	11	al	al	PROPN
hls-11302	171	12	.	.	PUNCT
hls-11302	172	1	in	in	ADP
hls-11302	172	2	vitro	vitro	X
hls-11302	172	3	cytokine	cytokine	ADJ
hls-11302	172	4	responses	response	NOUN
hls-11302	172	5	of	of	ADP
hls-11302	172	6	peripheral	peripheral	ADJ
hls-11302	172	7	blood	blood	NOUN
hls-11302	172	8	mononuclear	mononuclear	ADJ
hls-11302	172	9	cells	cell	NOUN
hls-11302	172	10	from	from	ADP
hls-11302	172	11	healthy	healthy	ADJ
hls-11302	172	12	dogs	dog	NOUN
hls-11302	172	13	to	to	ADP
hls-11302	172	14	distemper	distemper	NOUN
hls-11302	172	15	virus	virus	NOUN
hls-11302	172	16	,	,	PUNCT
hls-11302	172	17	malassezia	malassezia	PROPN
hls-11302	172	18	&	&	CCONJ
hls-11302	172	19	toxocara	toxocara	PROPN
hls-11302	172	20	.	.	PUNCT
hls-11302	173	1	vet	vet	NOUN
hls-11302	173	2	immunol	immunol	NOUN
hls-11302	173	3	immunopathol	immunopathol	PROPN
hls-11302	173	4	2010;134:218	2010;134:218	NUM
hls-11302	173	5	-	-	SYM
hls-11302	173	6	29	29	NUM
hls-11302	173	7	.	.	PUNCT
hls-11302	173	8	20	20	NUM
hls-11302	173	9	.	.	PUNCT
hls-11302	174	1	akaza	akaza	PROPN
hls-11302	174	2	n	n	CCONJ
hls-11302	174	3	,	,	PUNCT
hls-11302	174	4	akamatsu	akamatsu	NOUN
hls-11302	174	5	h	h	NOUN
hls-11302	174	6	,	,	PUNCT
hls-11302	174	7	takeoka	takeoka	NOUN
hls-11302	174	8	s	s	PROPN
hls-11302	174	9	,	,	PUNCT
hls-11302	174	10	et	et	PROPN
hls-11302	174	11	al	al	PROPN
hls-11302	174	12	.	.	PROPN
hls-11302	174	13	increased	increase	VERB
hls-11302	174	14	hydrophobicity	hydrophobicity	NOUN
hls-11302	174	15	in	in	ADP
hls-11302	174	16	malassezia	malassezia	NOUN
hls-11302	174	17	species	specie	NOUN
hls-11302	174	18	correlates	correlate	VERB
hls-11302	174	19	with	with	ADP
hls-11302	174	20	increase	increase	NOUN
hls-11302	174	21	proinflammatory	proinflammatory	ADJ
hls-11302	174	22	cytokine	cytokine	NOUN
hls-11302	174	23	expression	expression	NOUN
hls-11302	174	24	in	in	ADP
hls-11302	174	25	human	human	ADJ
hls-11302	174	26	kertatinocytes	kertatinocyte	NOUN
hls-11302	174	27	.	.	PUNCT
hls-11302	175	1	med	med	ADJ
hls-11302	175	2	mycol	mycol	CCONJ
hls-11302	175	3	2012;50:802	2012;50:802	NOUN
hls-11302	175	4	-	-	SYM
hls-11302	175	5	10	10	NUM
hls-11302	175	6	.	.	PUNCT
hls-11302	176	1	21	21	NUM
hls-11302	176	2	.	.	PUNCT
hls-11302	177	1	buentke	buentke	PROPN
hls-11302	177	2	e	e	PROPN
hls-11302	177	3	,	,	PUNCT
hls-11302	177	4	heffler	heffler	PROPN
hls-11302	177	5	lc	lc	PROPN
hls-11302	177	6	,	,	PUNCT
hls-11302	177	7	wallin	wallin	NOUN
hls-11302	177	8	rp	rp	NOUN
hls-11302	177	9	,	,	PUNCT
hls-11302	177	10	et	et	PROPN
hls-11302	177	11	al	al	PROPN
hls-11302	177	12	.	.	PUNCT
hls-11302	178	1	the	the	DET
hls-11302	178	2	allergenic	allergenic	ADJ
hls-11302	178	3	yeast	yeast	NOUN
hls-11302	178	4	malassezia	malassezia	NOUN
hls-11302	178	5	furfur	furfur	NOUN
hls-11302	178	6	induces	induce	VERB
hls-11302	178	7	maturation	maturation	NOUN
hls-11302	178	8	of	of	ADP
hls-11302	178	9	human	human	ADJ
hls-11302	178	10	dendritic	dendritic	ADJ
hls-11302	178	11	cells	cell	NOUN
hls-11302	178	12	.	.	PUNCT
hls-11302	179	1	clin	clin	PROPN
hls-11302	179	2	exp	exp	PROPN
hls-11302	179	3	allergy	allergy	PROPN
hls-11302	179	4	2001;31:158393	2001;31:158393	NUM
hls-11302	179	5	.	.	PUNCT
hls-11302	179	6	22	22	NUM
hls-11302	179	7	.	.	PUNCT
hls-11302	180	1	neuber	neuber	PROPN
hls-11302	180	2	k	k	PROPN
hls-11302	180	3	,	,	PUNCT
hls-11302	180	4	kroger	kroger	PROPN
hls-11302	180	5	s	s	PROPN
hls-11302	180	6	,	,	PUNCT
hls-11302	180	7	gruseck	gruseck	NOUN
hls-11302	180	8	e	e	NOUN
hls-11302	180	9	,	,	PUNCT
hls-11302	180	10	et	et	PROPN
hls-11302	180	11	al	al	PROPN
hls-11302	180	12	.	.	PUNCT
hls-11302	181	1	effects	effect	NOUN
hls-11302	181	2	of	of	ADP
hls-11302	181	3	pityrosporum	pityrosporum	ADJ
hls-11302	181	4	ovale	ovale	NOUN
hls-11302	181	5	on	on	ADP
hls-11302	181	6	proliferation	proliferation	NOUN
hls-11302	181	7	,	,	PUNCT
hls-11302	181	8	immunoglobulin	immunoglobulin	NOUN
hls-11302	181	9	(	(	PUNCT
hls-11302	181	10	iga	iga	PROPN
hls-11302	181	11	,	,	PUNCT
hls-11302	181	12	g	g	PROPN
hls-11302	181	13	,	,	PUNCT
hls-11302	181	14	m	m	NOUN
hls-11302	181	15	)	)	PUNCT
hls-11302	181	16	synthesis	synthesis	NOUN
hls-11302	181	17	and	and	CCONJ
hls-11302	181	18	cytokine	cytokine	VERB
hls-11302	181	19	(	(	PUNCT
hls-11302	181	20	il-2	il-2	NUM
hls-11302	181	21	,	,	PUNCT
hls-11302	181	22	il-10	il-10	PRON
hls-11302	181	23	,	,	PUNCT
hls-11302	181	24	ifn	ifn	PROPN
hls-11302	181	25	gamma	gamma	NOUN
hls-11302	181	26	)	)	PUNCT
hls-11302	181	27	production	production	NOUN
hls-11302	181	28	of	of	ADP
hls-11302	181	29	peripheral	peripheral	ADJ
hls-11302	181	30	blood	blood	NOUN
hls-11302	181	31	mononuclear	mononuclear	ADJ
hls-11302	181	32	cells	cell	NOUN
hls-11302	181	33	from	from	ADP
hls-11302	181	34	patients	patient	NOUN
hls-11302	181	35	with	with	ADP
hls-11302	181	36	seborrhoeic	seborrhoeic	PROPN
hls-11302	181	37	dermatitis	dermatitis	PROPN
hls-11302	181	38	.	.	PUNCT
hls-11302	182	1	arch	arch	ADJ
hls-11302	182	2	dermatol	dermatol	NOUN
hls-11302	182	3	res	re	VERB
hls-11302	182	4	1996;288:532–6	1996;288:532–6	PRON
hls-11302	182	5	.	.	PUNCT
hls-11302	183	1	23	23	NUM
hls-11302	183	2	.	.	X
hls-11302	183	3	balestri	balestri	PROPN
hls-11302	183	4	r	r	NOUN
hls-11302	183	5	,	,	PUNCT
hls-11302	183	6	rech	rech	VERB
hls-11302	183	7	g	g	NOUN
hls-11302	183	8	,	,	PUNCT
hls-11302	183	9	piraccini	piraccini	PROPN
hls-11302	183	10	b	b	PROPN
hls-11302	183	11	,	,	PUNCT
hls-11302	183	12	et	et	PROPN
hls-11302	183	13	al	al	PROPN
hls-11302	183	14	.	.	PUNCT
hls-11302	183	15	pityriasis	pityriasis	PROPN
hls-11302	183	16	versicolor	versicolor	NOUN
hls-11302	183	17	during	during	ADP
hls-11302	183	18	anti	anti	PROPN
hls-11302	183	19	tnf	tnf	PROPN
hls-11302	183	20	alpha	alpha	NOUN
hls-11302	183	21	monoclonal	monoclonal	NOUN
hls-11302	183	22	antibody	antibody	NOUN
hls-11302	183	23	therapy	therapy	NOUN
hls-11302	183	24	:	:	PUNCT
hls-11302	183	25	therapeutic	therapeutic	ADJ
hls-11302	183	26	consideration	consideration	NOUN
hls-11302	183	27	.	.	PUNCT
hls-11302	184	1	mycoses	mycose	NOUN
hls-11302	184	2	2012;55:444	2012;55:444	NOUN
hls-11302	184	3	-	-	SYM
hls-11302	184	4	6	6	NUM
hls-11302	184	5	.	.	PUNCT
hls-11302	185	1	article	article	PROPN
hls-11302	185	2	non	non	ADJ
hls-11302	185	3	-co	-co	PROPN
hls-11302	185	4	mmerc	mmerc	PROPN
hls-11302	185	5	ial	ial	PROPN
hls-11302	185	6	us	us	PROPN
hls-11302	185	7	e	e	NOUN
hls-11302	185	8	o	o	NOUN
hls-11302	185	9	nly	nly	ADV