id	sid	tid	token	lemma	pos
bioscience-222	1	1	highlights	highlight	NOUN
bioscience-222	1	2	in	in	ADP
bioscience-222	1	3	bioscience	bioscience	PROPN
bioscience-222	1	4	issn:2682	issn:2682	PROPN
bioscience-222	1	5	-	-	PUNCT
bioscience-222	1	6	4043	4043	NUM
bioscience-222	1	7	doi:10.36462	doi:10.36462	NOUN
bioscience-222	1	8	/	/	SYM
bioscience-222	1	9	h.biosci.202405	h.biosci.202405	PROPN
bioscience-222	1	10	research	research	NOUN
bioscience-222	1	11	article	article	NOUN
bioscience-222	1	12	open	open	VERB
bioscience-222	1	13	access	access	NOUN
bioscience-222	1	14	1	1	NUM
bioscience-222	1	15	international	international	ADJ
bioscience-222	1	16	center	center	NOUN
bioscience-222	1	17	for	for	ADP
bioscience-222	1	18	agricultural	agricultural	ADJ
bioscience-222	1	19	research	research	NOUN
bioscience-222	1	20	in	in	ADP
bioscience-222	1	21	the	the	DET
bioscience-222	1	22	dry	dry	ADJ
bioscience-222	1	23	areas	area	NOUN
bioscience-222	1	24	(	(	PUNCT
bioscience-222	1	25	icarda	icarda	NOUN
bioscience-222	1	26	)	)	PUNCT
bioscience-222	1	27	,	,	PUNCT
bioscience-222	1	28	p.o	p.o	PROPN
bioscience-222	1	29	.	.	PROPN
bioscience-222	1	30	box	box	PROPN
bioscience-222	1	31	114/5055	114/5055	NUM
bioscience-222	1	32	,	,	PUNCT
bioscience-222	1	33	beirut	beirut	PROPN
bioscience-222	1	34	,	,	PUNCT
bioscience-222	1	35	lebanon	lebanon	PROPN
bioscience-222	1	36	.	.	PROPN
bioscience-222	1	37	2	2	NUM
bioscience-222	1	38	international	international	ADJ
bioscience-222	1	39	maize	maize	NOUN
bioscience-222	1	40	and	and	CCONJ
bioscience-222	1	41	wheat	wheat	NOUN
bioscience-222	1	42	improvement	improvement	NOUN
bioscience-222	1	43	center	center	NOUN
bioscience-222	1	44	(	(	PUNCT
bioscience-222	1	45	cimmyt	cimmyt	NOUN
bioscience-222	1	46	)	)	PUNCT
bioscience-222	1	47	pakistan	pakistan	PROPN
bioscience-222	1	48	office	office	NOUN
bioscience-222	1	49	,	,	PUNCT
bioscience-222	1	50	csi	csi	PROPN
bioscience-222	1	51	building	building	NOUN
bioscience-222	1	52	,	,	PUNCT
bioscience-222	1	53	narc	narc	NOUN
bioscience-222	1	54	,	,	PUNCT
bioscience-222	1	55	park	park	NOUN
bioscience-222	1	56	road	road	NOUN
bioscience-222	1	57	,	,	PUNCT
bioscience-222	1	58	islamabad	islamabad	NOUN
bioscience-222	1	59	44000	44000	NUM
bioscience-222	1	60	,	,	PUNCT
bioscience-222	1	61	pakistan	pakistan	PROPN
bioscience-222	1	62	.	.	PUNCT
bioscience-222	2	1	3	3	NUM
bioscience-222	2	2	agricultural	agricultural	ADJ
bioscience-222	2	3	genetic	genetic	ADJ
bioscience-222	2	4	engineering	engineering	NOUN
bioscience-222	2	5	research	research	PROPN
bioscience-222	2	6	institute	institute	PROPN
bioscience-222	2	7	(	(	PUNCT
bioscience-222	2	8	ageri	ageri	PROPN
bioscience-222	2	9	)	)	PUNCT
bioscience-222	2	10	,	,	PUNCT
bioscience-222	2	11	9	9	NUM
bioscience-222	2	12	gamaa	gamaa	NOUN
bioscience-222	2	13	street	street	PROPN
bioscience-222	2	14	,	,	PUNCT
bioscience-222	2	15	giza	giza	PROPN
bioscience-222	2	16	,	,	PUNCT
bioscience-222	2	17	egypt	egypt	PROPN
bioscience-222	2	18	.	.	PUNCT
bioscience-222	3	1	*	*	PUNCT
bioscience-222	3	2	to	to	PART
bioscience-222	3	3	whom	whom	PRON
bioscience-222	3	4	correspondence	correspondence	NOUN
bioscience-222	3	5	should	should	AUX
bioscience-222	3	6	be	be	AUX
bioscience-222	3	7	addressed	address	VERB
bioscience-222	3	8	:	:	PUNCT
bioscience-222	3	9	a.hamwieh@cgiar.org	a.hamwieh@cgiar.org	ADJ
bioscience-222	3	10	editor	editor	NOUN
bioscience-222	3	11	:	:	PUNCT
bioscience-222	3	12	jean	jean	PROPN
bioscience-222	3	13	legeay	legeay	PROPN
bioscience-222	3	14	,	,	PUNCT
bioscience-222	3	15	university	university	NOUN
bioscience-222	3	16	mohammed	mohammed	PROPN
bioscience-222	3	17	vi	vi	PROPN
bioscience-222	3	18	polytechnic	polytechnic	PROPN
bioscience-222	3	19	,	,	PUNCT
bioscience-222	3	20	morocco	morocco	PROPN
bioscience-222	3	21	.	.	PUNCT
bioscience-222	4	1	reviewer(s	reviewer(s	PROPN
bioscience-222	4	2	):	):	PUNCT
bioscience-222	4	3	ahmed	ahmed	PROPN
bioscience-222	4	4	sallam	sallam	PROPN
bioscience-222	4	5	,	,	PUNCT
bioscience-222	4	6	leibniz	leibniz	PROPN
bioscience-222	4	7	institute	institute	PROPN
bioscience-222	4	8	of	of	ADP
bioscience-222	4	9	plant	plant	NOUN
bioscience-222	4	10	genetics	genetic	NOUN
bioscience-222	4	11	and	and	CCONJ
bioscience-222	4	12	crop	crop	NOUN
bioscience-222	4	13	plant	plant	NOUN
bioscience-222	4	14	research	research	NOUN
bioscience-222	4	15	(	(	PUNCT
bioscience-222	4	16	ipk	ipk	NOUN
bioscience-222	4	17	)	)	PUNCT
bioscience-222	4	18	,	,	PUNCT
bioscience-222	4	19	stadt	stadt	NOUN
bioscience-222	4	20	seeland	seeland	PROPN
bioscience-222	4	21	,	,	PUNCT
bioscience-222	4	22	germany	germany	PROPN
bioscience-222	4	23	..	..	PROPN
bioscience-222	4	24	clara	clara	PROPN
bioscience-222	4	25	r.	r.	PROPN
bioscience-222	4	26	azzam	azzam	PROPN
bioscience-222	4	27	,	,	PUNCT
bioscience-222	4	28	cell	cell	NOUN
bioscience-222	4	29	research	research	NOUN
bioscience-222	4	30	department	department	PROPN
bioscience-222	4	31	,	,	PUNCT
bioscience-222	4	32	field	field	NOUN
bioscience-222	4	33	crops	crop	NOUN
bioscience-222	4	34	research	research	PROPN
bioscience-222	4	35	institute	institute	PROPN
bioscience-222	4	36	,	,	PUNCT
bioscience-222	4	37	agricultural	agricultural	ADJ
bioscience-222	4	38	research	research	NOUN
bioscience-222	4	39	center	center	NOUN
bioscience-222	4	40	(	(	PUNCT
bioscience-222	4	41	arc	arc	NOUN
bioscience-222	4	42	)	)	PUNCT
bioscience-222	4	43	,	,	PUNCT
bioscience-222	4	44	egypt	egypt	PROPN
bioscience-222	4	45	.	.	PUNCT
bioscience-222	4	46	received	receive	VERB
bioscience-222	4	47	:	:	PUNCT
bioscience-222	4	48	june	june	PROPN
bioscience-222	4	49	15	15	NUM
bioscience-222	4	50	,	,	PUNCT
bioscience-222	4	51	2024	2024	NUM
bioscience-222	4	52	accepted	accept	VERB
bioscience-222	4	53	:	:	PUNCT
bioscience-222	4	54	september	september	PROPN
bioscience-222	4	55	9	9	NUM
bioscience-222	4	56	,	,	PUNCT
bioscience-222	4	57	2024	2024	NUM
bioscience-222	4	58	published	publish	VERB
bioscience-222	4	59	:	:	PUNCT
bioscience-222	4	60	december	december	PROPN
bioscience-222	4	61	26	26	NUM
bioscience-222	4	62	,	,	PUNCT
bioscience-222	4	63	2024	2024	NUM
bioscience-222	4	64	citation	citation	NOUN
bioscience-222	4	65	:	:	PUNCT
bioscience-222	4	66	hamwieh	hamwieh	PROPN
bioscience-222	4	67	a	a	PROPN
bioscience-222	4	68	,	,	PUNCT
bioscience-222	4	69	muhammad	muhammad	PROPN
bioscience-222	4	70	i	i	PROPN
bioscience-222	4	71	,	,	PUNCT
bioscience-222	4	72	ahmed	ahmed	PROPN
bioscience-222	4	73	s	s	PROPN
bioscience-222	4	74	,	,	PUNCT
bioscience-222	4	75	kababeh	kababeh	PROPN
bioscience-222	4	76	s	s	PROPN
bioscience-222	4	77	,	,	PUNCT
bioscience-222	4	78	alsamman	alsamman	PROPN
bioscience-222	4	79	am	be	AUX
bioscience-222	4	80	,	,	PUNCT
bioscience-222	4	81	istanbuli	istanbuli	PROPN
bioscience-222	4	82	t.	t.	PROPN
bioscience-222	4	83	exploring	explore	VERB
bioscience-222	4	84	qtl	qtl	PROPN
bioscience-222	4	85	genes	gene	NOUN
bioscience-222	4	86	contribute	contribute	VERB
bioscience-222	4	87	to	to	ADP
bioscience-222	4	88	chickpea	chickpea	PROPN
bioscience-222	4	89	ascochyta	ascochyta	NOUN
bioscience-222	4	90	blight	blight	NOUN
bioscience-222	4	91	resistance	resistance	NOUN
bioscience-222	4	92	across	across	ADP
bioscience-222	4	93	multiple	multiple	ADJ
bioscience-222	4	94	environments	environment	NOUN
bioscience-222	4	95	using	use	VERB
bioscience-222	4	96	ssr	ssr	NOUN
bioscience-222	4	97	,	,	PUNCT
bioscience-222	4	98	dart	dart	NOUN
bioscience-222	4	99	and	and	CCONJ
bioscience-222	4	100	snp	snp	ADJ
bioscience-222	4	101	assays	assay	NOUN
bioscience-222	4	102	.	.	PUNCT
bioscience-222	5	1	2024	2024	NUM
bioscience-222	5	2	dec	dec	PROPN
bioscience-222	5	3	.	.	PROPN
bioscience-222	5	4	26;7	26;7	NUM
bioscience-222	5	5	:	:	PUNCT
bioscience-222	5	6	bs202405	bs202405	PROPN
bioscience-222	5	7	copyright	copyright	NOUN
bioscience-222	5	8	:	:	PUNCT
bioscience-222	5	9	©	©	PROPN
bioscience-222	5	10	2024	2024	NUM
bioscience-222	5	11	hamwieh	hamwieh	NOUN
bioscience-222	5	12	et	et	PROPN
bioscience-222	5	13	al	al	PROPN
bioscience-222	5	14	..	..	PROPN
bioscience-222	5	15	this	this	PRON
bioscience-222	5	16	is	be	AUX
bioscience-222	5	17	an	an	DET
bioscience-222	5	18	open	open	ADJ
bioscience-222	5	19	access	access	NOUN
bioscience-222	5	20	article	article	NOUN
bioscience-222	5	21	distributed	distribute	VERB
bioscience-222	5	22	under	under	ADP
bioscience-222	5	23	the	the	DET
bioscience-222	5	24	terms	term	NOUN
bioscience-222	5	25	of	of	ADP
bioscience-222	5	26	the	the	DET
bioscience-222	5	27	creative	creative	ADJ
bioscience-222	5	28	commons	common	NOUN
bioscience-222	5	29	attribution	attribution	NOUN
bioscience-222	5	30	license	license	NOUN
bioscience-222	5	31	,	,	PUNCT
bioscience-222	5	32	which	which	PRON
bioscience-222	5	33	permits	permit	VERB
bioscience-222	5	34	unrestricted	unrestricted	ADJ
bioscience-222	5	35	use	use	NOUN
bioscience-222	5	36	,	,	PUNCT
bioscience-222	5	37	distribution	distribution	NOUN
bioscience-222	5	38	,	,	PUNCT
bioscience-222	5	39	and	and	CCONJ
bioscience-222	5	40	reproduction	reproduction	NOUN
bioscience-222	5	41	in	in	ADP
bioscience-222	5	42	any	any	DET
bioscience-222	5	43	medium	medium	NOUN
bioscience-222	5	44	,	,	PUNCT
bioscience-222	5	45	provided	provide	VERB
bioscience-222	5	46	the	the	DET
bioscience-222	5	47	original	original	ADJ
bioscience-222	5	48	author	author	NOUN
bioscience-222	5	49	and	and	CCONJ
bioscience-222	5	50	source	source	NOUN
bioscience-222	5	51	are	be	AUX
bioscience-222	5	52	credited	credit	VERB
bioscience-222	5	53	.	.	PUNCT
bioscience-222	6	1	data	datum	NOUN
bioscience-222	6	2	availability	availability	NOUN
bioscience-222	6	3	statement	statement	NOUN
bioscience-222	6	4	:	:	PUNCT
bioscience-222	6	5	all	all	DET
bioscience-222	6	6	relevant	relevant	ADJ
bioscience-222	6	7	data	datum	NOUN
bioscience-222	6	8	are	be	AUX
bioscience-222	6	9	within	within	ADP
bioscience-222	6	10	the	the	DET
bioscience-222	6	11	paper	paper	NOUN
bioscience-222	6	12	and	and	CCONJ
bioscience-222	6	13	supplementary	supplementary	ADJ
bioscience-222	6	14	materials	material	NOUN
bioscience-222	6	15	.	.	PUNCT
bioscience-222	7	1	funding	funding	NOUN
bioscience-222	7	2	:	:	PUNCT
bioscience-222	7	3	this	this	DET
bioscience-222	7	4	work	work	NOUN
bioscience-222	7	5	was	be	AUX
bioscience-222	7	6	supported	support	VERB
bioscience-222	7	7	by	by	ADP
bioscience-222	7	8	grains	grain	NOUN
bioscience-222	7	9	research	research	NOUN
bioscience-222	7	10	and	and	CCONJ
bioscience-222	7	11	development	development	NOUN
bioscience-222	7	12	corporation	corporation	NOUN
bioscience-222	7	13	(	(	PUNCT
bioscience-222	7	14	grdc	grdc	NOUN
bioscience-222	7	15	)	)	PUNCT
bioscience-222	7	16	,	,	PUNCT
bioscience-222	7	17	australia	australia	PROPN
bioscience-222	7	18	.	.	PUNCT
bioscience-222	8	1	competing	compete	VERB
bioscience-222	8	2	interests	interest	NOUN
bioscience-222	8	3	:	:	PUNCT
bioscience-222	8	4	the	the	DET
bioscience-222	8	5	authors	author	NOUN
bioscience-222	8	6	declare	declare	VERB
bioscience-222	8	7	that	that	SCONJ
bioscience-222	8	8	they	they	PRON
bioscience-222	8	9	have	have	VERB
bioscience-222	8	10	no	no	DET
bioscience-222	8	11	competing	compete	VERB
bioscience-222	8	12	interests	interest	NOUN
bioscience-222	8	13	.	.	PUNCT
bioscience-222	9	1	exploring	explore	VERB
bioscience-222	9	2	qtl	qtl	PROPN
bioscience-222	9	3	genes	gene	NOUN
bioscience-222	9	4	contribute	contribute	VERB
bioscience-222	9	5	to	to	ADP
bioscience-222	9	6	chickpea	chickpea	PROPN
bioscience-222	9	7	ascochyta	ascochyta	NOUN
bioscience-222	9	8	blight	blight	NOUN
bioscience-222	9	9	resistance	resistance	NOUN
bioscience-222	9	10	across	across	ADP
bioscience-222	9	11	multiple	multiple	ADJ
bioscience-222	9	12	environments	environment	NOUN
bioscience-222	9	13	using	use	VERB
bioscience-222	9	14	ssr	ssr	NOUN
bioscience-222	9	15	,	,	PUNCT
bioscience-222	9	16	dart	dart	NOUN
bioscience-222	9	17	and	and	CCONJ
bioscience-222	9	18	snp	snp	ADJ
bioscience-222	9	19	assays	assay	NOUN
bioscience-222	9	20	aladdin	aladdin	VERB
bioscience-222	9	21	hamwieh1	hamwieh1	PROPN
bioscience-222	9	22	>	>	X
bioscience-222	9	23	<	<	X
bioscience-222	9	24	�	�	PROPN
bioscience-222	9	25	,	,	PUNCT
bioscience-222	9	26	imtiaz	imtiaz	PROPN
bioscience-222	9	27	muhammad2	muhammad2	PROPN
bioscience-222	10	1	>	>	X
bioscience-222	10	2	<	<	X
bioscience-222	10	3	�	�	PROPN
bioscience-222	10	4	,	,	PUNCT
bioscience-222	10	5	seid	seid	NOUN
bioscience-222	10	6	ahmed1	ahmed1	NOUN
bioscience-222	10	7	>	>	X
bioscience-222	10	8	<	<	X
bioscience-222	10	9	�	�	PROPN
bioscience-222	10	10	,	,	PUNCT
bioscience-222	10	11	siham	siham	NOUN
bioscience-222	10	12	kababeh1	kababeh1	PROPN
bioscience-222	10	13	>	>	X
bioscience-222	10	14	<	<	X
bioscience-222	10	15	�	�	PROPN
bioscience-222	10	16	,	,	PUNCT
bioscience-222	10	17	alsamman	alsamman	NOUN
bioscience-222	10	18	m.	m.	NOUN
bioscience-222	10	19	alsamman1,3	alsamman1,3	PROPN
bioscience-222	10	20	>	>	X
bioscience-222	10	21	<	<	X
bioscience-222	10	22	�	�	PROPN
bioscience-222	10	23	,	,	PUNCT
bioscience-222	10	24	tawffiq	tawffiq	NOUN
bioscience-222	10	25	istanbuli1	istanbuli1	NOUN
bioscience-222	10	26	>	>	X
bioscience-222	10	27	<	<	X
bioscience-222	10	28	�	�	PROPN
bioscience-222	10	29	abstract	abstract	ADJ
bioscience-222	10	30	chickpea	chickpea	NOUN
bioscience-222	10	31	(	(	PUNCT
bioscience-222	10	32	cicer	cicer	VERB
bioscience-222	10	33	arietinum	arietinum	DET
bioscience-222	10	34	l.	l.	PROPN
bioscience-222	10	35	)	)	PUNCT
bioscience-222	10	36	occupies	occupy	VERB
bioscience-222	10	37	the	the	DET
bioscience-222	10	38	third	third	ADJ
bioscience-222	10	39	leading	lead	VERB
bioscience-222	10	40	position	position	NOUN
bioscience-222	10	41	among	among	ADP
bioscience-222	10	42	grain	grain	NOUN
bioscience-222	10	43	legumes	legume	NOUN
bioscience-222	10	44	in	in	ADP
bioscience-222	10	45	cultivated	cultivate	VERB
bioscience-222	10	46	area	area	NOUN
bioscience-222	10	47	around	around	ADP
bioscience-222	10	48	the	the	DET
bioscience-222	10	49	world	world	NOUN
bioscience-222	10	50	.	.	PUNCT
bioscience-222	11	1	ascochyta	ascochyta	NOUN
bioscience-222	11	2	blight	blight	PROPN
bioscience-222	11	3	(	(	PUNCT
bioscience-222	11	4	ab	ab	NOUN
bioscience-222	11	5	)	)	PUNCT
bioscience-222	11	6	caused	cause	VERB
bioscience-222	11	7	by	by	ADP
bioscience-222	11	8	ascochytarabiei	ascochytarabiei	PROPN
bioscience-222	11	9	(	(	PUNCT
bioscience-222	11	10	pass	pass	PROPN
bioscience-222	11	11	.	.	PUNCT
bioscience-222	11	12	)	)	PUNCT
bioscience-222	11	13	labr	labr	NOUN
bioscience-222	11	14	.	.	PUNCT
bioscience-222	12	1	is	be	AUX
bioscience-222	12	2	one	one	NUM
bioscience-222	12	3	of	of	ADP
bioscience-222	12	4	the	the	DET
bioscience-222	12	5	most	most	ADV
bioscience-222	12	6	destructive	destructive	ADJ
bioscience-222	12	7	foliar	foliar	ADJ
bioscience-222	12	8	diseases	disease	NOUN
bioscience-222	12	9	of	of	ADP
bioscience-222	12	10	chickpea	chickpea	NOUN
bioscience-222	12	11	and	and	CCONJ
bioscience-222	12	12	can	can	AUX
bioscience-222	12	13	cause	cause	VERB
bioscience-222	12	14	complete	complete	ADJ
bioscience-222	12	15	crop	crop	NOUN
bioscience-222	12	16	failure	failure	NOUN
bioscience-222	12	17	in	in	ADP
bioscience-222	12	18	many	many	ADJ
bioscience-222	12	19	chickpea	chickpea	NOUN
bioscience-222	12	20	growing	grow	VERB
bioscience-222	12	21	regions	region	NOUN
bioscience-222	12	22	around	around	ADP
bioscience-222	12	23	the	the	DET
bioscience-222	12	24	world	world	NOUN
bioscience-222	12	25	.	.	PUNCT
bioscience-222	13	1	a	a	DET
bioscience-222	13	2	recombinant	recombinant	ADJ
bioscience-222	13	3	inbred	inbred	ADJ
bioscience-222	13	4	line	line	NOUN
bioscience-222	13	5	(	(	PUNCT
bioscience-222	13	6	ril	ril	NOUN
bioscience-222	13	7	)	)	PUNCT
bioscience-222	13	8	population	population	NOUN
bioscience-222	13	9	,	,	PUNCT
bioscience-222	13	10	comprising	comprise	VERB
bioscience-222	13	11	165	165	NUM
bioscience-222	13	12	lines	line	NOUN
bioscience-222	13	13	derived	derive	VERB
bioscience-222	13	14	from	from	ADP
bioscience-222	13	15	the	the	DET
bioscience-222	13	16	cross	cross	NOUN
bioscience-222	13	17	flip98	flip98	PROPN
bioscience-222	13	18	-	-	PUNCT
bioscience-222	13	19	1065	1065	NUM
bioscience-222	13	20	(	(	PUNCT
bioscience-222	13	21	r	r	NOUN
bioscience-222	13	22	)	)	PUNCT
bioscience-222	13	23	×ilc1929	×ilc1929	NOUN
bioscience-222	13	24	(	(	PUNCT
bioscience-222	13	25	s),were	s),were	NOUN
bioscience-222	13	26	evaluated	evaluate	VERB
bioscience-222	13	27	in	in	ADP
bioscience-222	13	28	six	six	NUM
bioscience-222	13	29	environments	environment	NOUN
bioscience-222	13	30	over	over	ADP
bioscience-222	13	31	three	three	NUM
bioscience-222	13	32	years	year	NOUN
bioscience-222	13	33	(	(	PUNCT
bioscience-222	13	34	2008	2008	NUM
bioscience-222	13	35	–	–	PUNCT
bioscience-222	13	36	2011	2011	NUM
bioscience-222	13	37	)	)	PUNCT
bioscience-222	13	38	and	and	CCONJ
bioscience-222	13	39	three	three	NUM
bioscience-222	13	40	locations	location	NOUN
bioscience-222	13	41	in	in	ADP
bioscience-222	13	42	syria	syria	PROPN
bioscience-222	13	43	(	(	PUNCT
bioscience-222	13	44	field	field	NOUN
bioscience-222	13	45	and	and	CCONJ
bioscience-222	13	46	greenhouse	greenhouse	NOUN
bioscience-222	13	47	locations	location	NOUN
bioscience-222	13	48	in	in	ADP
bioscience-222	13	49	tel	tel	PROPN
bioscience-222	13	50	hadya	hadya	NOUN
bioscience-222	13	51	“	"	PUNCT
bioscience-222	13	52	th	th	X
bioscience-222	13	53	“	"	PUNCT
bioscience-222	13	54	and	and	CCONJ
bioscience-222	13	55	a	a	DET
bioscience-222	13	56	field	field	NOUN
bioscience-222	13	57	location	location	NOUN
bioscience-222	13	58	at	at	ADP
bioscience-222	13	59	lattakia	lattakia	NOUN
bioscience-222	13	60	“	"	PUNCT
bioscience-222	13	61	lat	lat	NOUN
bioscience-222	13	62	“	"	PUNCT
bioscience-222	13	63	)	)	PUNCT
bioscience-222	13	64	.	.	PUNCT
bioscience-222	14	1	the	the	DET
bioscience-222	14	2	greenhouse	greenhouse	NOUN
bioscience-222	14	3	experiments	experiment	NOUN
bioscience-222	14	4	were	be	AUX
bioscience-222	14	5	conducted	conduct	VERB
bioscience-222	14	6	against	against	ADP
bioscience-222	14	7	ab	ab	PROPN
bioscience-222	14	8	pathotype	pathotype	PROPN
bioscience-222	14	9	ii	ii	PROPN
bioscience-222	14	10	.	.	PUNCT
bioscience-222	15	1	anova	anova	PROPN
bioscience-222	15	2	analysis	analysis	NOUN
bioscience-222	15	3	indicated	indicate	VERB
bioscience-222	15	4	significant	significant	ADJ
bioscience-222	15	5	differences	difference	NOUN
bioscience-222	15	6	both	both	CCONJ
bioscience-222	15	7	among	among	ADP
bioscience-222	15	8	the	the	DET
bioscience-222	15	9	rils	ril	NOUN
bioscience-222	15	10	and	and	CCONJ
bioscience-222	15	11	among	among	ADP
bioscience-222	15	12	the	the	DET
bioscience-222	15	13	environments	environment	NOUN
bioscience-222	15	14	.	.	PUNCT
bioscience-222	16	1	we	we	PRON
bioscience-222	16	2	produced	produce	VERB
bioscience-222	16	3	a	a	DET
bioscience-222	16	4	total	total	NOUN
bioscience-222	16	5	of	of	ADP
bioscience-222	16	6	1398	1398	NUM
bioscience-222	16	7	(	(	PUNCT
bioscience-222	16	8	134	134	NUM
bioscience-222	16	9	ssr	ssr	NOUN
bioscience-222	16	10	,	,	PUNCT
bioscience-222	16	11	652	652	NUM
bioscience-222	16	12	dartseq	dartseq	VERB
bioscience-222	16	13	and	and	CCONJ
bioscience-222	16	14	612	612	NUM
bioscience-222	16	15	snp	snp	ADJ
bioscience-222	16	16	)	)	PUNCT
bioscience-222	16	17	markers	marker	NOUN
bioscience-222	16	18	and	and	CCONJ
bioscience-222	16	19	developed	develop	VERB
bioscience-222	16	20	a	a	DET
bioscience-222	16	21	high	high	ADJ
bioscience-222	16	22	-	-	PUNCT
bioscience-222	16	23	resolution	resolution	NOUN
bioscience-222	16	24	genetic	genetic	ADJ
bioscience-222	16	25	map	map	NOUN
bioscience-222	16	26	(	(	PUNCT
bioscience-222	16	27	1244	1244	NUM
bioscience-222	16	28	markers	marker	NOUN
bioscience-222	16	29	spanning	span	VERB
bioscience-222	16	30	2503	2503	NUM
bioscience-222	16	31	cm	cm	NOUN
bioscience-222	16	32	on	on	ADP
bioscience-222	16	33	eight	eight	NUM
bioscience-222	16	34	linkage	linkage	NOUN
bioscience-222	16	35	groups	group	NOUN
bioscience-222	16	36	)	)	PUNCT
bioscience-222	16	37	.	.	PUNCT
bioscience-222	17	1	three	three	NUM
bioscience-222	17	2	major	major	ADJ
bioscience-222	17	3	conserved	conserve	VERB
bioscience-222	17	4	quantitative	quantitative	ADJ
bioscience-222	17	5	trait	trait	NOUN
bioscience-222	17	6	loci	loci	NOUN
bioscience-222	17	7	(	(	PUNCT
bioscience-222	17	8	qtls	qtls	PROPN
bioscience-222	17	9	)	)	PUNCT
bioscience-222	17	10	that	that	PRON
bioscience-222	17	11	confer	confer	VERB
bioscience-222	17	12	ab	ab	PROPN
bioscience-222	17	13	resistance	resistance	NOUN
bioscience-222	17	14	were	be	AUX
bioscience-222	17	15	identified	identify	VERB
bioscience-222	17	16	:	:	PUNCT
bioscience-222	17	17	two	two	NUM
bioscience-222	17	18	on	on	ADP
bioscience-222	17	19	linkage	linkage	NOUN
bioscience-222	17	20	group	group	NOUN
bioscience-222	17	21	2	2	NUM
bioscience-222	17	22	(	(	PUNCT
bioscience-222	17	23	indicated	indicate	VERB
bioscience-222	17	24	as	as	ADP
bioscience-222	17	25	lg2	lg2	X
bioscience-222	17	26	-	-	PUNCT
bioscience-222	17	27	a	a	NOUN
bioscience-222	17	28	and	and	CCONJ
bioscience-222	17	29	lg2	lg2	NOUN
bioscience-222	17	30	-	-	PUNCT
bioscience-222	17	31	b	b	NOUN
bioscience-222	17	32	)	)	PUNCT
bioscience-222	17	33	and	and	CCONJ
bioscience-222	17	34	one	one	NUM
bioscience-222	17	35	on	on	ADP
bioscience-222	17	36	linkage	linkage	NOUN
bioscience-222	17	37	group	group	NOUN
bioscience-222	17	38	4	4	NUM
bioscience-222	17	39	(	(	PUNCT
bioscience-222	17	40	indicated	indicate	VERB
bioscience-222	17	41	as	as	ADP
bioscience-222	17	42	lg4	lg4	PROPN
bioscience-222	17	43	)	)	PUNCT
bioscience-222	17	44	.	.	PUNCT
bioscience-222	18	1	these	these	PRON
bioscience-222	18	2	explain	explain	VERB
bioscience-222	18	3	,	,	PUNCT
bioscience-222	18	4	respectively	respectively	ADV
bioscience-222	18	5	,	,	PUNCT
bioscience-222	18	6	a	a	DET
bioscience-222	18	7	maximum	maximum	NOUN
bioscience-222	18	8	of	of	ADP
bioscience-222	18	9	18.5	18.5	NUM
bioscience-222	18	10	%	%	NOUN
bioscience-222	18	11	,	,	PUNCT
bioscience-222	18	12	11.1	11.1	NUM
bioscience-222	18	13	%	%	NOUN
bioscience-222	18	14	and	and	CCONJ
bioscience-222	18	15	25	25	NUM
bioscience-222	18	16	%	%	NOUN
bioscience-222	18	17	of	of	ADP
bioscience-222	18	18	the	the	DET
bioscience-222	18	19	total	total	ADJ
bioscience-222	18	20	variation	variation	NOUN
bioscience-222	18	21	.	.	PUNCT
bioscience-222	19	1	in	in	ADP
bioscience-222	19	2	total	total	ADJ
bioscience-222	19	3	,	,	PUNCT
bioscience-222	19	4	18	18	NUM
bioscience-222	19	5	predicted	predict	VERB
bioscience-222	19	6	genes	gene	NOUN
bioscience-222	19	7	were	be	AUX
bioscience-222	19	8	located	locate	VERB
bioscience-222	19	9	in	in	ADP
bioscience-222	19	10	lg4	lg4	PROPN
bioscience-222	19	11	,	,	PUNCT
bioscience-222	19	12	and	and	CCONJ
bioscience-222	19	13	9	9	NUM
bioscience-222	19	14	and10	and10	PROPN
bioscience-222	19	15	predicted	predict	VERB
bioscience-222	19	16	genes	gene	NOUN
bioscience-222	19	17	,	,	PUNCT
bioscience-222	19	18	respectively	respectively	ADV
bioscience-222	19	19	,	,	PUNCT
bioscience-222	19	20	were	be	AUX
bioscience-222	19	21	located	locate	VERB
bioscience-222	19	22	in	in	ADP
bioscience-222	19	23	lg2	lg2	NOUN
bioscience-222	19	24	-	-	PUNCT
bioscience-222	19	25	a	a	NOUN
bioscience-222	19	26	and	and	CCONJ
bioscience-222	19	27	lg2	lg2	NOUN
bioscience-222	19	28	-	-	PUNCT
bioscience-222	19	29	b.	b.	NOUN
bioscience-222	19	30	this	this	DET
bioscience-222	19	31	study	study	NOUN
bioscience-222	19	32	presents	present	VERB
bioscience-222	19	33	a	a	DET
bioscience-222	19	34	first	first	ADJ
bioscience-222	19	35	set	set	NOUN
bioscience-222	19	36	of	of	ADP
bioscience-222	19	37	snp	snp	ADJ
bioscience-222	19	38	markers	marker	NOUN
bioscience-222	19	39	located	locate	VERB
bioscience-222	19	40	within	within	ADP
bioscience-222	19	41	genes	gene	NOUN
bioscience-222	19	42	associated	associate	VERB
bioscience-222	19	43	with	with	ADP
bioscience-222	19	44	ab	ab	PROPN
bioscience-222	19	45	resistance	resistance	NOUN
bioscience-222	19	46	in	in	ADP
bioscience-222	19	47	chickpea	chickpea	NOUN
bioscience-222	19	48	,	,	PUNCT
bioscience-222	19	49	which	which	PRON
bioscience-222	19	50	could	could	AUX
bioscience-222	19	51	be	be	AUX
bioscience-222	19	52	applied	apply	VERB
bioscience-222	19	53	in	in	ADP
bioscience-222	19	54	marker	marker	NOUN
bioscience-222	19	55	-	-	PUNCT
bioscience-222	19	56	assisted	assist	VERB
bioscience-222	19	57	selection	selection	NOUN
bioscience-222	19	58	programs	program	NOUN
bioscience-222	19	59	for	for	ADP
bioscience-222	19	60	breeding	breed	VERB
bioscience-222	19	61	ab	ab	ADJ
bioscience-222	19	62	-	-	PUNCT
bioscience-222	19	63	resistant	resistant	ADJ
bioscience-222	19	64	chickpeas	chickpea	NOUN
bioscience-222	19	65	.	.	PUNCT
bioscience-222	20	1	keywords	keyword	NOUN
bioscience-222	20	2	:	:	PUNCT
bioscience-222	20	3	ascochyta	ascochyta	NOUN
bioscience-222	20	4	blight	blight	PROPN
bioscience-222	20	5	,	,	PUNCT
bioscience-222	20	6	ascochytarabiei	ascochytarabiei	PROPN
bioscience-222	20	7	,	,	PUNCT
bioscience-222	20	8	chickpea	chickpea	NOUN
bioscience-222	20	9	,	,	PUNCT
bioscience-222	20	10	ammi	ammi	PROPN
bioscience-222	20	11	analysis	analysis	PROPN
bioscience-222	20	12	,	,	PUNCT
bioscience-222	20	13	qtl	qtl	PROPN
bioscience-222	20	14	,	,	PUNCT
bioscience-222	20	15	snp	snp	ADJ
bioscience-222	20	16	introduction	introduction	NOUN
bioscience-222	20	17	ascochyta	ascochyta	NOUN
bioscience-222	20	18	blight	blight	NOUN
bioscience-222	20	19	(	(	PUNCT
bioscience-222	20	20	ab	ab	NOUN
bioscience-222	20	21	)	)	PUNCT
bioscience-222	20	22	of	of	ADP
bioscience-222	20	23	chickpea	chickpea	NOUN
bioscience-222	20	24	,	,	PUNCT
bioscience-222	20	25	caused	cause	VERB
bioscience-222	20	26	by	by	ADP
bioscience-222	20	27	ascochyta	ascochyta	NOUN
bioscience-222	20	28	rabiei	rabiei	PROPN
bioscience-222	20	29	(	(	PUNCT
bioscience-222	20	30	pass	pass	PROPN
bioscience-222	20	31	.	.	PUNCT
bioscience-222	20	32	)	)	PUNCT
bioscience-222	20	33	lab	lab	NOUN
bioscience-222	20	34	.	.	PUNCT
bioscience-222	20	35	,	,	PUNCT
bioscience-222	20	36	is	be	AUX
bioscience-222	20	37	one	one	NUM
bioscience-222	20	38	of	of	ADP
bioscience-222	20	39	the	the	DET
bioscience-222	20	40	most	most	ADV
bioscience-222	20	41	important	important	ADJ
bioscience-222	20	42	diseases	disease	NOUN
bioscience-222	20	43	in	in	ADP
bioscience-222	20	44	many	many	ADJ
bioscience-222	20	45	chickpea	chickpea	NOUN
bioscience-222	20	46	production	production	NOUN
bioscience-222	20	47	areas	area	NOUN
bioscience-222	20	48	.	.	PUNCT
bioscience-222	21	1	four	four	NUM
bioscience-222	21	2	pathotypes	pathotype	NOUN
bioscience-222	21	3	have	have	AUX
bioscience-222	21	4	been	be	AUX
bioscience-222	21	5	identified	identify	VERB
bioscience-222	21	6	within	within	ADP
bioscience-222	21	7	a.rabiei	a.rabiei	PROPN
bioscience-222	21	8	populations	population	NOUN
bioscience-222	21	9	in	in	ADP
bioscience-222	21	10	syria	syria	PROPN
bioscience-222	21	11	and	and	CCONJ
bioscience-222	21	12	other	other	ADJ
bioscience-222	21	13	countries	country	NOUN
bioscience-222	21	14	[	[	X
bioscience-222	21	15	1	1	NUM
bioscience-222	21	16	;	;	PUNCT
bioscience-222	21	17	2	2	NUM
bioscience-222	21	18	;	;	PUNCT
bioscience-222	21	19	3	3	NUM
bioscience-222	21	20	]	]	PUNCT
bioscience-222	21	21	.	.	PUNCT
bioscience-222	22	1	chemical	chemical	NOUN
bioscience-222	22	2	control	control	NOUN
bioscience-222	22	3	of	of	ADP
bioscience-222	22	4	ab	ab	PROPN
bioscience-222	22	5	has	have	AUX
bioscience-222	22	6	proved	prove	VERB
bioscience-222	22	7	inefficient	inefficient	ADJ
bioscience-222	22	8	and	and	CCONJ
bioscience-222	22	9	very	very	ADV
bioscience-222	22	10	expensive	expensive	ADJ
bioscience-222	22	11	;	;	PUNCT
bioscience-222	22	12	therefore	therefore	ADV
bioscience-222	22	13	,	,	PUNCT
bioscience-222	22	14	new	new	ADJ
bioscience-222	22	15	varieties	variety	NOUN
bioscience-222	22	16	with	with	ADP
bioscience-222	22	17	improved	improved	ADJ
bioscience-222	22	18	resistance	resistance	NOUN
bioscience-222	22	19	are	be	AUX
bioscience-222	22	20	needed	need	VERB
bioscience-222	22	21	to	to	PART
bioscience-222	22	22	manage	manage	VERB
bioscience-222	22	23	the	the	DET
bioscience-222	22	24	impact	impact	NOUN
bioscience-222	22	25	of	of	ADP
bioscience-222	22	26	the	the	DET
bioscience-222	22	27	disease	disease	NOUN
bioscience-222	22	28	.	.	PUNCT
bioscience-222	23	1	breeders	breeder	NOUN
bioscience-222	23	2	using	use	VERB
bioscience-222	23	3	conventional	conventional	ADJ
bioscience-222	23	4	methods	method	NOUN
bioscience-222	23	5	have	have	AUX
bioscience-222	23	6	made	make	VERB
bioscience-222	23	7	considerable	considerable	ADJ
bioscience-222	23	8	progress	progress	NOUN
bioscience-222	23	9	toward	toward	ADP
bioscience-222	23	10	developing	develop	VERB
bioscience-222	23	11	chickpea	chickpea	NOUN
bioscience-222	23	12	varieties	variety	NOUN
bioscience-222	23	13	with	with	ADP
bioscience-222	23	14	increased	increase	VERB
bioscience-222	23	15	ab	ab	PROPN
bioscience-222	23	16	resistance	resistance	NOUN
bioscience-222	23	17	[	[	X
bioscience-222	23	18	4	4	NUM
bioscience-222	23	19	;	;	PUNCT
bioscience-222	23	20	5	5	NUM
bioscience-222	23	21	]	]	PUNCT
bioscience-222	23	22	.	.	PUNCT
bioscience-222	24	1	research	research	NOUN
bioscience-222	24	2	teams	team	NOUN
bioscience-222	24	3	investigating	investigate	VERB
bioscience-222	24	4	ab	ab	PROPN
bioscience-222	24	5	of	of	ADP
bioscience-222	24	6	chickpea	chickpea	PROPN
bioscience-222	24	7	have	have	AUX
bioscience-222	24	8	identified	identify	VERB
bioscience-222	24	9	14	14	NUM
bioscience-222	24	10	quantitative	quantitative	ADJ
bioscience-222	24	11	trait	trait	NOUN
bioscience-222	24	12	loci	loci	NOUN
bioscience-222	24	13	(	(	PUNCT
bioscience-222	24	14	qtls	qtls	PROPN
bioscience-222	24	15	)	)	PUNCT
bioscience-222	24	16	in	in	ADP
bioscience-222	24	17	eight	eight	NUM
bioscience-222	24	18	linkage	linkage	NOUN
bioscience-222	24	19	groups	group	NOUN
bioscience-222	24	20	(	(	PUNCT
bioscience-222	24	21	lgs	lgs	NOUN
bioscience-222	24	22	)	)	PUNCT
bioscience-222	24	23	that	that	PRON
bioscience-222	24	24	each	each	PRON
bioscience-222	24	25	contribute	contribute	VERB
bioscience-222	24	26	to	to	ADP
bioscience-222	24	27	a.	a.	PROPN
bioscience-222	24	28	rabiei	rabiei	PROPN
bioscience-222	24	29	resistance	resistance	NOUN
bioscience-222	25	1	[	[	X
bioscience-222	25	2	6	6	NUM
bioscience-222	25	3	;	;	PUNCT
bioscience-222	25	4	7	7	NUM
bioscience-222	25	5	;	;	PUNCT
bioscience-222	25	6	8	8	NUM
bioscience-222	25	7	;	;	PUNCT
bioscience-222	25	8	9	9	NUM
bioscience-222	25	9	;	;	PUNCT
bioscience-222	25	10	10	10	NUM
bioscience-222	25	11	;	;	PUNCT
bioscience-222	25	12	11	11	NUM
bioscience-222	25	13	;	;	PUNCT
bioscience-222	25	14	12	12	NUM
bioscience-222	25	15	;	;	PUNCT
bioscience-222	25	16	13	13	NUM
bioscience-222	25	17	;	;	PUNCT
bioscience-222	25	18	14	14	NUM
bioscience-222	25	19	;	;	PUNCT
bioscience-222	25	20	15	15	NUM
bioscience-222	25	21	]	]	PUNCT
bioscience-222	25	22	.	.	PUNCT
bioscience-222	26	1	this	this	PRON
bioscience-222	26	2	indicates	indicate	VERB
bioscience-222	26	3	that	that	SCONJ
bioscience-222	26	4	several	several	ADJ
bioscience-222	26	5	mechanisms	mechanism	NOUN
bioscience-222	26	6	are	be	AUX
bioscience-222	26	7	likely	likely	ADV
bioscience-222	26	8	responsible	responsible	ADJ
bioscience-222	26	9	for	for	ADP
bioscience-222	26	10	ab	ab	PROPN
bioscience-222	26	11	resistance	resistance	NOUN
bioscience-222	26	12	,	,	PUNCT
bioscience-222	26	13	but	but	CCONJ
bioscience-222	26	14	very	very	ADV
bioscience-222	26	15	little	little	ADJ
bioscience-222	26	16	is	be	AUX
bioscience-222	26	17	known	know	VERB
bioscience-222	26	18	about	about	ADP
bioscience-222	26	19	the	the	DET
bioscience-222	26	20	identity	identity	NOUN
bioscience-222	26	21	and	and	CCONJ
bioscience-222	26	22	functions	function	NOUN
bioscience-222	26	23	of	of	ADP
bioscience-222	26	24	the	the	DET
bioscience-222	26	25	genes	gene	NOUN
bioscience-222	26	26	involved	involve	VERB
bioscience-222	26	27	.	.	PUNCT
bioscience-222	27	1	two	two	NUM
bioscience-222	27	2	major	major	ADJ
bioscience-222	27	3	qtls	qtl	NOUN
bioscience-222	27	4	,	,	PUNCT
bioscience-222	27	5	located	locate	VERB
bioscience-222	27	6	on	on	ADP
bioscience-222	27	7	lg2	lg2	CCONJ
bioscience-222	27	8	close	close	ADJ
bioscience-222	27	9	to	to	ADP
bioscience-222	27	10	the	the	DET
bioscience-222	27	11	markers	marker	NOUN
bioscience-222	27	12	ga16	ga16	PROPN
bioscience-222	27	13	and	and	CCONJ
bioscience-222	27	14	ta37	ta37	PROPN
bioscience-222	27	15	,	,	PUNCT
bioscience-222	27	16	control	control	NOUN
bioscience-222	27	17	resistance	resistance	NOUN
bioscience-222	27	18	to	to	ADP
bioscience-222	27	19	ab	ab	PROPN
bioscience-222	27	20	pathotype	pathotype	NOUN
bioscience-222	27	21	i	i	PROPN
bioscience-222	28	1	[	[	X
bioscience-222	28	2	10	10	NUM
bioscience-222	28	3	]	]	PUNCT
bioscience-222	28	4	,	,	PUNCT
bioscience-222	28	5	while	while	SCONJ
bioscience-222	28	6	another	another	DET
bioscience-222	28	7	qtl	qtl	PROPN
bioscience-222	28	8	contributing	contribute	VERB
bioscience-222	28	9	to	to	ADP
bioscience-222	28	10	resistance	resistance	NOUN
bioscience-222	28	11	to	to	PART
bioscience-222	28	12	pathotype	pathotype	PROPN
bioscience-222	28	13	ii	ii	PROPN
bioscience-222	28	14	is	be	AUX
bioscience-222	28	15	located	locate	VERB
bioscience-222	28	16	on	on	ADP
bioscience-222	28	17	lg4	lg4	PROPN
bioscience-222	28	18	near	near	ADP
bioscience-222	28	19	simple	simple	ADJ
bioscience-222	28	20	sequence	sequence	NOUN
bioscience-222	28	21	repeat	repeat	NOUN
bioscience-222	28	22	(	(	PUNCT
bioscience-222	28	23	ssr	ssr	ADJ
bioscience-222	28	24	)	)	PUNCT
bioscience-222	28	25	loci	loci	NOUN
bioscience-222	28	26	gaa47	gaa47	PROPN
bioscience-222	28	27	,	,	PUNCT
bioscience-222	28	28	ta130	ta130	PROPN
bioscience-222	28	29	,	,	PUNCT
bioscience-222	28	30	tr20	tr20	PROPN
bioscience-222	28	31	,	,	PUNCT
bioscience-222	28	32	ta72	ta72	PROPN
bioscience-222	28	33	,	,	PUNCT
bioscience-222	28	34	ts72	ts72	PROPN
bioscience-222	28	35	,	,	PUNCT
bioscience-222	28	36	and	and	CCONJ
bioscience-222	28	37	ta2	ta2	PROPN
bioscience-222	29	1	[	[	X
bioscience-222	29	2	16	16	NUM
bioscience-222	29	3	;	;	PUNCT
bioscience-222	29	4	9	9	NUM
bioscience-222	29	5	;	;	PUNCT
bioscience-222	29	6	10	10	NUM
bioscience-222	29	7	]	]	PUNCT
bioscience-222	29	8	.	.	PUNCT
bioscience-222	30	1	[	[	X
bioscience-222	30	2	10	10	NUM
bioscience-222	30	3	]	]	PUNCT
bioscience-222	30	4	traced	trace	VERB
bioscience-222	30	5	the	the	DET
bioscience-222	30	6	ab	ab	PROPN
bioscience-222	30	7	resistance	resistance	NOUN
bioscience-222	30	8	of	of	ADP
bioscience-222	30	9	the	the	DET
bioscience-222	30	10	chickpea	chickpea	NOUN
bioscience-222	30	11	line	line	NOUN
bioscience-222	30	12	flip84	flip84	NOUN
bioscience-222	30	13	-	-	PUNCT
bioscience-222	30	14	92c	92c	NOUN
bioscience-222	30	15	to	to	ADP
bioscience-222	30	16	regions	region	NOUN
bioscience-222	30	17	on	on	ADP
bioscience-222	30	18	lg2	lg2	ADV
bioscience-222	30	19	and	and	CCONJ
bioscience-222	30	20	lg4	lg4	PROPN
bioscience-222	30	21	associated	associate	VERB
bioscience-222	30	22	with	with	ADP
bioscience-222	30	23	the	the	DET
bioscience-222	30	24	resistance	resistance	NOUN
bioscience-222	30	25	in	in	ADP
bioscience-222	30	26	flip84	flip84	NOUN
bioscience-222	30	27	-	-	PUNCT
bioscience-222	30	28	92c	92c	NOUN
bioscience-222	30	29	to	to	PART
bioscience-222	30	30	pathotype	pathotype	PROPN
bioscience-222	30	31	ii	ii	PROPN
bioscience-222	30	32	.	.	PUNCT
bioscience-222	31	1	in	in	ADP
bioscience-222	31	2	that	that	DET
bioscience-222	31	3	study	study	NOUN
bioscience-222	31	4	,	,	PUNCT
bioscience-222	31	5	the	the	DET
bioscience-222	31	6	ta46	ta46	PROPN
bioscience-222	31	7	marker	marker	NOUN
bioscience-222	31	8	explained	explain	VERB
bioscience-222	31	9	a	a	DET
bioscience-222	31	10	maximum	maximum	NOUN
bioscience-222	31	11	of	of	ADP
bioscience-222	31	12	69	69	NUM
bioscience-222	31	13	%	%	NOUN
bioscience-222	31	14	of	of	ADP
bioscience-222	31	15	that	that	DET
bioscience-222	31	16	lines	line	NOUN
bioscience-222	31	17	total	total	VERB
bioscience-222	31	18	ab	ab	PROPN
bioscience-222	31	19	resistance	resistance	NOUN
bioscience-222	31	20	;	;	PUNCT
bioscience-222	31	21	furthermore	furthermore	ADV
bioscience-222	31	22	,	,	PUNCT
bioscience-222	31	23	additional	additional	ADJ
bioscience-222	31	24	markers	marker	NOUN
bioscience-222	31	25	(	(	PUNCT
bioscience-222	31	26	gaa47	gaa47	PROPN
bioscience-222	31	27	,	,	PUNCT
bioscience-222	31	28	ga24	ga24	PROPN
bioscience-222	31	29	,	,	PUNCT
bioscience-222	31	30	and	and	CCONJ
bioscience-222	31	31	ga16	ga16	PROPN
bioscience-222	31	32	)	)	PUNCT
bioscience-222	31	33	were	be	AUX
bioscience-222	31	34	identified	identify	VERB
bioscience-222	31	35	on	on	ADP
bioscience-222	31	36	lg2	lg2	NOUN
bioscience-222	31	37	,	,	PUNCT
bioscience-222	31	38	each	each	PRON
bioscience-222	31	39	explaining	explain	VERB
bioscience-222	31	40	10.4	10.4	NUM
bioscience-222	31	41	–	–	PUNCT
bioscience-222	31	42	19.3	19.3	NUM
bioscience-222	31	43	%	%	NOUN
bioscience-222	31	44	of	of	ADP
bioscience-222	31	45	the	the	DET
bioscience-222	31	46	line	line	NOUN
bioscience-222	31	47	's	's	PART
bioscience-222	31	48	total	total	ADJ
bioscience-222	31	49	ab	ab	PROPN
bioscience-222	31	50	resistance	resistance	NOUN
bioscience-222	32	1	[	[	X
bioscience-222	32	2	10	10	NUM
bioscience-222	32	3	]	]	PUNCT
bioscience-222	32	4	.	.	PUNCT
bioscience-222	33	1	additional	additional	ADJ
bioscience-222	33	2	markers	marker	NOUN
bioscience-222	33	3	on	on	ADP
bioscience-222	33	4	lg1	lg1	PROPN
bioscience-222	33	5	(	(	PUNCT
bioscience-222	33	6	ts12b	ts12b	NOUN
bioscience-222	33	7	,	,	PUNCT
bioscience-222	33	8	stms28	stms28	NOUN
bioscience-222	33	9	,	,	PUNCT
bioscience-222	33	10	and	and	CCONJ
bioscience-222	33	11	ts45	ts45	PROPN
bioscience-222	33	12	)	)	PUNCT
bioscience-222	33	13	have	have	AUX
bioscience-222	33	14	been	be	AUX
bioscience-222	33	15	reported	report	VERB
bioscience-222	33	16	to	to	PART
bioscience-222	33	17	be	be	AUX
bioscience-222	33	18	associated	associate	VERB
bioscience-222	33	19	with	with	ADP
bioscience-222	33	20	ab	ab	PROPN
bioscience-222	33	21	resistance	resistance	NOUN
bioscience-222	33	22	under	under	ADP
bioscience-222	33	23	controlled	control	VERB
bioscience-222	33	24	conditions	condition	NOUN
bioscience-222	33	25	[	[	X
bioscience-222	33	26	7	7	NUM
bioscience-222	33	27	;	;	PUNCT
bioscience-222	33	28	8	8	NUM
bioscience-222	33	29	]	]	PUNCT
bioscience-222	33	30	.	.	PUNCT
bioscience-222	34	1	highlights	highlight	NOUN
bioscience-222	34	2	in	in	ADP
bioscience-222	34	3	bioscience	bioscience	NOUN
bioscience-222	34	4	page	page	NOUN
bioscience-222	34	5	1	1	NUM
bioscience-222	34	6	of	of	ADP
bioscience-222	34	7	11	11	NUM
bioscience-222	34	8	december	december	PROPN
bioscience-222	34	9	2024|volume	2024|volume	NUM
bioscience-222	34	10	7	7	NUM
bioscience-222	34	11	https://doi.org/10.36462/h.biosci.202405	https://doi.org/10.36462/h.biosci.202405	NOUN
bioscience-222	34	12	https://creativecommons.org/licenses/by/4.0/	https://creativecommons.org/licenses/by/4.0/	PROPN
bioscience-222	34	13	mailto:a.hamwieh@cgiar.org	mailto:a.hamwieh@cgiar.org	PROPN
bioscience-222	34	14	https://orcid.org/0000-0001-6060-5560	https://orcid.org/0000-0001-6060-5560	PROPN
bioscience-222	34	15	mailto:m.imtiaz@cgiar.org	mailto:m.imtiaz@cgiar.org	PRON
bioscience-222	34	16	mailto:s.a.kemal@cgiar.org	mailto:s.a.kemal@cgiar.org	PROPN
bioscience-222	34	17	https://orcid.org/0000-0002-1791-9369	https://orcid.org/0000-0002-1791-9369	PROPN
bioscience-222	34	18	mailto:sihamkababe1989@gmail.com	mailto:sihamkababe1989@gmail.com	PROPN
bioscience-222	34	19	mailto:smahmoud@ageri.sci.eg	mailto:smahmoud@ageri.sci.eg	PROPN
bioscience-222	34	20	https://orcid.org/0000-0002-7765-5035	https://orcid.org/0000-0002-7765-5035	PROPN
bioscience-222	34	21	mailto:t.istanbuli@cgiar.org	mailto:t.istanbuli@cgiar.org	PROPN
bioscience-222	34	22	https://orcid.org/0000-0001-7450-6408	https://orcid.org/0000-0001-7450-6408	VERB
bioscience-222	34	23	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	ADV
bioscience-222	34	24	hamwieh	hamwieh	NOUN
bioscience-222	34	25	et	et	PROPN
bioscience-222	34	26	al	al	PROPN
bioscience-222	34	27	.	.	PROPN
bioscience-222	34	28	,	,	PUNCT
bioscience-222	34	29	2024	2024	NUM
bioscience-222	34	30	exploring	explore	VERB
bioscience-222	34	31	qtl	qtl	PROPN
bioscience-222	34	32	genes	gene	NOUN
bioscience-222	34	33	contribute	contribute	VERB
bioscience-222	34	34	to	to	ADP
bioscience-222	34	35	chickpea	chickpea	PROPN
bioscience-222	34	36	ascochyta	ascochyta	NOUN
bioscience-222	34	37	blight	blight	NOUN
bioscience-222	34	38	resistance	resistance	NOUN
bioscience-222	34	39	a	a	DET
bioscience-222	34	40	scar	scar	NOUN
bioscience-222	34	41	marker	marker	NOUN
bioscience-222	34	42	scy17590	scy17590	NOUN
bioscience-222	34	43	was	be	AUX
bioscience-222	34	44	reported	report	VERB
bioscience-222	34	45	as	as	SCONJ
bioscience-222	34	46	linked	link	VERB
bioscience-222	34	47	to	to	ADP
bioscience-222	34	48	ab	ab	PROPN
bioscience-222	34	49	resistance	resistance	NOUN
bioscience-222	35	1	[	[	X
bioscience-222	35	2	11	11	NUM
bioscience-222	35	3	]	]	PUNCT
bioscience-222	35	4	,	,	PUNCT
bioscience-222	35	5	and	and	CCONJ
bioscience-222	35	6	this	this	DET
bioscience-222	35	7	marker	marker	NOUN
bioscience-222	35	8	was	be	AUX
bioscience-222	35	9	applied	apply	VERB
bioscience-222	35	10	successfully	successfully	ADV
bioscience-222	35	11	to	to	ADP
bioscience-222	35	12	selected	select	VERB
bioscience-222	35	13	resistant	resistant	ADJ
bioscience-222	35	14	genotypes	genotype	NOUN
bioscience-222	35	15	in	in	ADP
bioscience-222	35	16	australian	australian	ADJ
bioscience-222	35	17	chickpea	chickpea	NOUN
bioscience-222	35	18	breeding	breeding	NOUN
bioscience-222	35	19	materials	material	NOUN
bioscience-222	35	20	[	[	X
bioscience-222	35	21	17	17	NUM
bioscience-222	35	22	]	]	PUNCT
bioscience-222	35	23	.	.	PUNCT
bioscience-222	36	1	this	this	DET
bioscience-222	36	2	marker	marker	NOUN
bioscience-222	36	3	was	be	AUX
bioscience-222	36	4	further	far	ADV
bioscience-222	36	5	applied	apply	VERB
bioscience-222	36	6	together	together	ADV
bioscience-222	36	7	with	with	ADP
bioscience-222	36	8	an	an	DET
bioscience-222	36	9	allelespecific	allelespecific	ADJ
bioscience-222	36	10	primer	primer	NOUN
bioscience-222	36	11	for	for	ADP
bioscience-222	36	12	the	the	DET
bioscience-222	36	13	gene	gene	NOUN
bioscience-222	36	14	caetr-1	caetr-1	NUM
bioscience-222	36	15	for	for	ADP
bioscience-222	36	16	genotyping	genotype	VERB
bioscience-222	36	17	qtlar1	qtlar1	NOUN
bioscience-222	36	18	and	and	CCONJ
bioscience-222	36	19	qtlar2	qtlar2	ADV
bioscience-222	36	20	in	in	ADP
bioscience-222	36	21	chickpea	chickpea	NOUN
bioscience-222	36	22	germplasm	germplasm	NOUN
bioscience-222	37	1	[	[	X
bioscience-222	37	2	18	18	NUM
bioscience-222	37	3	;	;	PUNCT
bioscience-222	37	4	19	19	NUM
bioscience-222	37	5	]	]	PUNCT
bioscience-222	37	6	.	.	PUNCT
bioscience-222	38	1	a	a	DET
bioscience-222	38	2	study	study	NOUN
bioscience-222	38	3	by	by	ADP
bioscience-222	38	4	[	[	X
bioscience-222	38	5	20	20	NUM
bioscience-222	38	6	]	]	PUNCT
bioscience-222	38	7	using	use	VERB
bioscience-222	38	8	an	an	DET
bioscience-222	38	9	fst	fst	NOUN
bioscience-222	38	10	genome	genome	NOUN
bioscience-222	38	11	scan	scan	NOUN
bioscience-222	38	12	and	and	CCONJ
bioscience-222	38	13	genome	genome	NOUN
bioscience-222	38	14	-	-	PUNCT
bioscience-222	38	15	wide	wide	ADJ
bioscience-222	38	16	association	association	NOUN
bioscience-222	38	17	methods	method	NOUN
bioscience-222	38	18	indicated	indicate	VERB
bioscience-222	38	19	that	that	SCONJ
bioscience-222	38	20	a	a	DET
bioscience-222	38	21	100	100	NUM
bioscience-222	38	22	kb	kb	PROPN
bioscience-222	38	23	region	region	NOUN
bioscience-222	38	24	on	on	ADP
bioscience-222	38	25	chromosome	chromosome	NOUN
bioscience-222	38	26	4	4	NUM
bioscience-222	38	27	was	be	AUX
bioscience-222	38	28	significantly	significantly	ADV
bioscience-222	38	29	associated	associate	VERB
bioscience-222	38	30	with	with	ADP
bioscience-222	38	31	ab	ab	PROPN
bioscience-222	38	32	resistance	resistance	NOUN
bioscience-222	38	33	.	.	PUNCT
bioscience-222	39	1	this	this	DET
bioscience-222	39	2	region	region	NOUN
bioscience-222	39	3	covered	cover	VERB
bioscience-222	39	4	a	a	DET
bioscience-222	39	5	large	large	ADJ
bioscience-222	39	6	qtl	qtl	PROPN
bioscience-222	39	7	interval	interval	NOUN
bioscience-222	39	8	of	of	ADP
bioscience-222	39	9	7	7	NUM
bioscience-222	39	10	mb30	mb30	PROPN
bioscience-222	39	11	mb	mb	PROPN
bioscience-222	39	12	,	,	PUNCT
bioscience-222	39	13	which	which	PRON
bioscience-222	39	14	had	have	AUX
bioscience-222	39	15	been	be	AUX
bioscience-222	39	16	genotyped	genotype	VERB
bioscience-222	39	17	at	at	ADP
bioscience-222	39	18	relatively	relatively	ADV
bioscience-222	39	19	low	low	ADJ
bioscience-222	39	20	density	density	NOUN
bioscience-222	39	21	with	with	ADP
bioscience-222	39	22	ssr	ssr	ADJ
bioscience-222	39	23	or	or	CCONJ
bioscience-222	39	24	single	single	ADJ
bioscience-222	39	25	nucleotide	nucleotide	ADJ
bioscience-222	39	26	polymorphism	polymorphism	NOUN
bioscience-222	39	27	(	(	PUNCT
bioscience-222	39	28	snp	snp	ADJ
bioscience-222	39	29	)	)	PUNCT
bioscience-222	39	30	markers	marker	NOUN
bioscience-222	39	31	through	through	ADP
bioscience-222	39	32	previous	previous	ADJ
bioscience-222	39	33	mapping	mapping	NOUN
bioscience-222	39	34	population	population	NOUN
bioscience-222	39	35	studies	study	NOUN
bioscience-222	39	36	.	.	PUNCT
bioscience-222	40	1	[	[	X
bioscience-222	40	2	20	20	NUM
bioscience-222	40	3	]	]	PUNCT
bioscience-222	40	4	and	and	CCONJ
bioscience-222	40	5	colleagues	colleague	NOUN
bioscience-222	40	6	validated	validate	VERB
bioscience-222	40	7	this	this	DET
bioscience-222	40	8	qtl	qtl	PROPN
bioscience-222	40	9	region	region	PROPN
bioscience-222	40	10	on	on	ADP
bioscience-222	40	11	lg4	lg4	PROPN
bioscience-222	40	12	in	in	ADP
bioscience-222	40	13	a	a	DET
bioscience-222	40	14	genome	genome	NOUN
bioscience-222	40	15	-	-	PUNCT
bioscience-222	40	16	wide	wide	ADJ
bioscience-222	40	17	association	association	NOUN
bioscience-222	40	18	study	study	NOUN
bioscience-222	40	19	(	(	PUNCT
bioscience-222	40	20	gwas	gwas	PROPN
bioscience-222	40	21	)	)	PUNCT
bioscience-222	40	22	using	use	VERB
bioscience-222	40	23	approximately	approximately	ADV
bioscience-222	40	24	144,000	144,000	NUM
bioscience-222	40	25	snps	snps	NOUN
bioscience-222	40	26	and	and	CCONJ
bioscience-222	40	27	a	a	DET
bioscience-222	40	28	collection	collection	NOUN
bioscience-222	40	29	of	of	ADP
bioscience-222	40	30	132	132	NUM
bioscience-222	40	31	advanced	advanced	ADJ
bioscience-222	40	32	breeding	breeding	NOUN
bioscience-222	40	33	lines	line	NOUN
bioscience-222	40	34	from	from	ADP
bioscience-222	40	35	the	the	DET
bioscience-222	40	36	australian	australian	ADJ
bioscience-222	40	37	chickpea	chickpea	NOUN
bioscience-222	40	38	breeding	breeding	NOUN
bioscience-222	40	39	program	program	NOUN
bioscience-222	40	40	.	.	PUNCT
bioscience-222	41	1	in	in	ADP
bioscience-222	41	2	total	total	ADJ
bioscience-222	41	3	,	,	PUNCT
bioscience-222	41	4	12	12	NUM
bioscience-222	41	5	predicted	predict	VERB
bioscience-222	41	6	genes	gene	NOUN
bioscience-222	41	7	were	be	AUX
bioscience-222	41	8	located	locate	VERB
bioscience-222	41	9	in	in	ADP
bioscience-222	41	10	the	the	DET
bioscience-222	41	11	region	region	NOUN
bioscience-222	41	12	associated	associate	VERB
bioscience-222	41	13	with	with	ADP
bioscience-222	41	14	ab	ab	PROPN
bioscience-222	41	15	resistance	resistance	NOUN
bioscience-222	41	16	,	,	PUNCT
bioscience-222	41	17	including	include	VERB
bioscience-222	41	18	sequences	sequence	NOUN
bioscience-222	41	19	annotated	annotate	VERB
bioscience-222	41	20	as	as	ADP
bioscience-222	41	21	encoding	encode	VERB
bioscience-222	41	22	an	an	DET
bioscience-222	41	23	nbs	nbs	NOUN
bioscience-222	41	24	-	-	PUNCT
bioscience-222	41	25	lrr	lrr	ADJ
bioscience-222	41	26	receptor	receptor	NOUN
bioscience-222	41	27	-	-	PUNCT
bioscience-222	41	28	like	like	ADJ
bioscience-222	41	29	kinase	kinase	NOUN
bioscience-222	41	30	,	,	PUNCT
bioscience-222	41	31	a	a	DET
bioscience-222	41	32	wall	wall	NOUN
bioscience-222	41	33	-	-	PUNCT
bioscience-222	41	34	associated	associate	VERB
bioscience-222	41	35	kinase	kinase	NOUN
bioscience-222	41	36	,	,	PUNCT
bioscience-222	41	37	a	a	DET
bioscience-222	41	38	zinc	zinc	NOUN
bioscience-222	41	39	finger	finger	NOUN
bioscience-222	41	40	protein	protein	NOUN
bioscience-222	41	41	,	,	PUNCT
bioscience-222	41	42	and	and	CCONJ
bioscience-222	41	43	serine	serine	NOUN
bioscience-222	41	44	/	/	SYM
bioscience-222	41	45	threonine	threonine	ADJ
bioscience-222	41	46	protein	protein	NOUN
bioscience-222	41	47	kinases	kinase	NOUN
bioscience-222	41	48	.	.	PUNCT
bioscience-222	42	1	one	one	NUM
bioscience-222	42	2	significant	significant	ADJ
bioscience-222	42	3	snp	snp	NOUN
bioscience-222	42	4	located	locate	VERB
bioscience-222	42	5	in	in	ADP
bioscience-222	42	6	the	the	DET
bioscience-222	42	7	conserved	conserved	ADJ
bioscience-222	42	8	catalytic	catalytic	ADJ
bioscience-222	42	9	domain	domain	NOUN
bioscience-222	42	10	of	of	ADP
bioscience-222	42	11	an	an	DET
bioscience-222	42	12	nbs	nbs	NOUN
bioscience-222	42	13	-	-	PUNCT
bioscience-222	42	14	lrr	lrr	ADJ
bioscience-222	42	15	receptor	receptor	NOUN
bioscience-222	42	16	-	-	PUNCT
bioscience-222	42	17	like	like	ADJ
bioscience-222	42	18	kinase	kinase	NOUN
bioscience-222	42	19	led	lead	VERB
bioscience-222	42	20	to	to	ADP
bioscience-222	42	21	an	an	DET
bioscience-222	42	22	amino	amino	NOUN
bioscience-222	42	23	acid	acid	NOUN
bioscience-222	42	24	substitution	substitution	NOUN
bioscience-222	42	25	[	[	X
bioscience-222	42	26	20	20	NUM
bioscience-222	42	27	]	]	PUNCT
bioscience-222	42	28	.	.	PUNCT
bioscience-222	43	1	researchers	researcher	NOUN
bioscience-222	43	2	could	could	AUX
bioscience-222	43	3	use	use	VERB
bioscience-222	43	4	high	high	ADJ
bioscience-222	43	5	-	-	PUNCT
bioscience-222	43	6	throughput	throughput	NOUN
bioscience-222	43	7	genotyping	genotyping	NOUN
bioscience-222	43	8	systems	system	NOUN
bioscience-222	43	9	to	to	PART
bioscience-222	43	10	identify	identify	VERB
bioscience-222	43	11	markers	marker	NOUN
bioscience-222	43	12	such	such	ADJ
bioscience-222	43	13	as	as	ADP
bioscience-222	43	14	single	single	ADJ
bioscience-222	43	15	nucleotide	nucleotide	ADJ
bioscience-222	43	16	polymorphisms	polymorphism	NOUN
bioscience-222	43	17	(	(	PUNCT
bioscience-222	43	18	snp	snp	ADJ
bioscience-222	43	19	)	)	PUNCT
bioscience-222	43	20	markers	marker	NOUN
bioscience-222	43	21	and	and	CCONJ
bioscience-222	43	22	diversity	diversity	NOUN
bioscience-222	43	23	array	array	NOUN
bioscience-222	43	24	technology	technology	NOUN
bioscience-222	43	25	(	(	PUNCT
bioscience-222	43	26	dart	dart	NOUN
bioscience-222	43	27	)	)	PUNCT
bioscience-222	43	28	markers	marker	NOUN
bioscience-222	43	29	.	.	PUNCT
bioscience-222	44	1	therefore	therefore	ADV
bioscience-222	44	2	,	,	PUNCT
bioscience-222	44	3	we	we	PRON
bioscience-222	44	4	aimed	aim	VERB
bioscience-222	44	5	to	to	PART
bioscience-222	44	6	study	study	VERB
bioscience-222	44	7	the	the	DET
bioscience-222	44	8	interaction	interaction	NOUN
bioscience-222	44	9	between	between	ADP
bioscience-222	44	10	different	different	ADJ
bioscience-222	44	11	environments	environment	NOUN
bioscience-222	44	12	and	and	CCONJ
bioscience-222	44	13	ab	ab	PROPN
bioscience-222	44	14	resistance	resistance	NOUN
bioscience-222	44	15	,	,	PUNCT
bioscience-222	44	16	to	to	PART
bioscience-222	44	17	produce	produce	VERB
bioscience-222	44	18	a	a	DET
bioscience-222	44	19	highly	highly	ADV
bioscience-222	44	20	saturated	saturated	ADJ
bioscience-222	44	21	genetic	genetic	ADJ
bioscience-222	44	22	map	map	NOUN
bioscience-222	44	23	,	,	PUNCT
bioscience-222	44	24	and	and	CCONJ
bioscience-222	44	25	to	to	PART
bioscience-222	44	26	identify	identify	VERB
bioscience-222	44	27	markers	marker	NOUN
bioscience-222	44	28	closer	close	ADV
bioscience-222	44	29	to	to	ADP
bioscience-222	44	30	potential	potential	VERB
bioscience-222	44	31	ab	ab	PROPN
bioscience-222	44	32	resistance	resistance	NOUN
bioscience-222	44	33	genes	gene	NOUN
bioscience-222	44	34	using	use	VERB
bioscience-222	44	35	a	a	DET
bioscience-222	44	36	recombinant	recombinant	ADJ
bioscience-222	44	37	inbred	inbreed	VERB
bioscience-222	44	38	line	line	NOUN
bioscience-222	44	39	(	(	PUNCT
bioscience-222	44	40	ril	ril	NOUN
bioscience-222	44	41	)	)	PUNCT
bioscience-222	44	42	population	population	NOUN
bioscience-222	44	43	of	of	ADP
bioscience-222	44	44	chickpea	chickpea	NOUN
bioscience-222	44	45	,	,	PUNCT
bioscience-222	44	46	enabling	enable	VERB
bioscience-222	44	47	practical	practical	ADJ
bioscience-222	44	48	application	application	NOUN
bioscience-222	44	49	of	of	ADP
bioscience-222	44	50	marker(s	marker(s	NOUN
bioscience-222	44	51	)	)	PUNCT
bioscience-222	44	52	in	in	ADP
bioscience-222	44	53	chickpea	chickpea	NOUN
bioscience-222	44	54	breeding	breeding	NOUN
bioscience-222	44	55	programs	program	NOUN
bioscience-222	44	56	.	.	PUNCT
bioscience-222	45	1	materials	material	NOUN
bioscience-222	45	2	and	and	CCONJ
bioscience-222	45	3	methods	method	NOUN
bioscience-222	45	4	plant	plant	NOUN
bioscience-222	45	5	materials	material	NOUN
bioscience-222	45	6	and	and	CCONJ
bioscience-222	45	7	dna	dna	NOUN
bioscience-222	45	8	isolation	isolation	NOUN
bioscience-222	45	9	a	a	DET
bioscience-222	45	10	mapping	mapping	NOUN
bioscience-222	45	11	population	population	NOUN
bioscience-222	45	12	consisting	consist	VERB
bioscience-222	45	13	of	of	ADP
bioscience-222	45	14	165	165	NUM
bioscience-222	45	15	(	(	PUNCT
bioscience-222	45	16	f8	f8	PROPN
bioscience-222	45	17	)	)	PUNCT
bioscience-222	45	18	rils	ril	NOUN
bioscience-222	45	19	derived	derive	VERB
bioscience-222	45	20	from	from	ADP
bioscience-222	45	21	an	an	DET
bioscience-222	45	22	intra	intra	ADJ
bioscience-222	45	23	-	-	ADJ
bioscience-222	45	24	specific	specific	ADJ
bioscience-222	45	25	cross	cross	NOUN
bioscience-222	45	26	between	between	ADP
bioscience-222	45	27	an	an	DET
bioscience-222	45	28	ab	ab	ADJ
bioscience-222	45	29	-	-	PUNCT
bioscience-222	45	30	resistant	resistant	ADJ
bioscience-222	45	31	chickpea	chickpea	NOUN
bioscience-222	45	32	,	,	PUNCT
bioscience-222	45	33	flip98	flip98	PROPN
bioscience-222	45	34	-	-	PUNCT
bioscience-222	45	35	1065	1065	NUM
bioscience-222	45	36	,	,	PUNCT
bioscience-222	45	37	and	and	CCONJ
bioscience-222	45	38	an	an	DET
bioscience-222	45	39	ab	ab	ADJ
bioscience-222	45	40	-	-	PUNCT
bioscience-222	45	41	susceptible	susceptible	ADJ
bioscience-222	45	42	chickpea	chickpea	NOUN
bioscience-222	45	43	,	,	PUNCT
bioscience-222	45	44	ilc1929	ilc1929	NOUN
bioscience-222	45	45	,	,	PUNCT
bioscience-222	45	46	was	be	AUX
bioscience-222	45	47	used	use	VERB
bioscience-222	45	48	in	in	ADP
bioscience-222	45	49	this	this	DET
bioscience-222	45	50	study	study	NOUN
bioscience-222	45	51	.	.	PUNCT
bioscience-222	46	1	the	the	DET
bioscience-222	46	2	rils	ril	NOUN
bioscience-222	46	3	were	be	AUX
bioscience-222	46	4	developed	develop	VERB
bioscience-222	46	5	using	use	VERB
bioscience-222	46	6	the	the	DET
bioscience-222	46	7	single	single	ADJ
bioscience-222	46	8	seed	seed	NOUN
bioscience-222	46	9	descent	descent	NOUN
bioscience-222	46	10	(	(	PUNCT
bioscience-222	46	11	ssd	ssd	NOUN
bioscience-222	46	12	)	)	PUNCT
bioscience-222	46	13	method	method	NOUN
bioscience-222	46	14	from	from	ADP
bioscience-222	46	15	f2	f2	PROPN
bioscience-222	46	16	to	to	ADP
bioscience-222	46	17	f7	f7	PROPN
bioscience-222	46	18	.	.	PUNCT
bioscience-222	47	1	dna	dna	PROPN
bioscience-222	47	2	was	be	AUX
bioscience-222	47	3	extracted	extract	VERB
bioscience-222	47	4	from	from	ADP
bioscience-222	47	5	fresh	fresh	ADJ
bioscience-222	47	6	leaves	leave	NOUN
bioscience-222	47	7	of	of	ADP
bioscience-222	47	8	six	six	NUM
bioscience-222	47	9	-	-	PUNCT
bioscience-222	47	10	week	week	NOUN
bioscience-222	47	11	-	-	PUNCT
bioscience-222	47	12	old	old	ADJ
bioscience-222	47	13	seedlings	seedling	NOUN
bioscience-222	47	14	using	use	VERB
bioscience-222	47	15	the	the	DET
bioscience-222	47	16	cetyltrimethyl	cetyltrimethyl	NOUN
bioscience-222	47	17	ammonium	ammonium	NOUN
bioscience-222	47	18	bromide	bromide	NOUN
bioscience-222	47	19	(	(	PUNCT
bioscience-222	47	20	ctab	ctab	NOUN
bioscience-222	47	21	)	)	PUNCT
bioscience-222	47	22	method	method	NOUN
bioscience-222	47	23	[	[	X
bioscience-222	47	24	21	21	NUM
bioscience-222	47	25	;	;	PUNCT
bioscience-222	47	26	22	22	NUM
bioscience-222	47	27	]	]	PUNCT
bioscience-222	47	28	.	.	PUNCT
bioscience-222	48	1	the	the	DET
bioscience-222	48	2	sequences	sequence	NOUN
bioscience-222	48	3	of	of	ADP
bioscience-222	48	4	chickpea	chickpea	ADJ
bioscience-222	48	5	ssr	ssr	ADJ
bioscience-222	48	6	primers	primer	NOUN
bioscience-222	48	7	were	be	AUX
bioscience-222	48	8	obtained	obtain	VERB
bioscience-222	48	9	from	from	ADP
bioscience-222	48	10	published	publish	VERB
bioscience-222	48	11	papers	paper	NOUN
bioscience-222	48	12	[	[	X
bioscience-222	48	13	16	16	NUM
bioscience-222	48	14	;	;	PUNCT
bioscience-222	48	15	23	23	NUM
bioscience-222	48	16	;	;	PUNCT
bioscience-222	48	17	24	24	NUM
bioscience-222	48	18	]	]	PUNCT
bioscience-222	48	19	.	.	PUNCT
bioscience-222	49	1	the	the	DET
bioscience-222	49	2	pcr	pcr	PROPN
bioscience-222	49	3	mixture	mixture	NOUN
bioscience-222	49	4	(	(	PUNCT
bioscience-222	49	5	20	20	NUM
bioscience-222	49	6	µl	µl	NOUN
bioscience-222	49	7	)	)	PUNCT
bioscience-222	49	8	contained	contain	VERB
bioscience-222	49	9	10	10	NUM
bioscience-222	49	10	ng	ng	PROPN
bioscience-222	49	11	genomic	genomic	PROPN
bioscience-222	49	12	dna	dna	NOUN
bioscience-222	49	13	,	,	PUNCT
bioscience-222	49	14	0.2	0.2	NUM
bioscience-222	49	15	mm	mm	NUM
bioscience-222	49	16	dntp	dntp	NOUN
bioscience-222	49	17	,	,	PUNCT
bioscience-222	49	18	1	1	NUM
bioscience-222	49	19	u	u	NOUN
bioscience-222	49	20	taq	taq	PROPN
bioscience-222	49	21	dna	dna	NOUN
bioscience-222	49	22	polymerase	polymerase	NOUN
bioscience-222	49	23	(	(	PUNCT
bioscience-222	49	24	invitrogen	invitrogen	PROPN
bioscience-222	49	25	,	,	PUNCT
bioscience-222	49	26	carlsbad	carlsbad	PROPN
bioscience-222	49	27	,	,	PUNCT
bioscience-222	49	28	calif	calif	PROPN
bioscience-222	49	29	.	.	PROPN
bioscience-222	49	30	)	)	PUNCT
bioscience-222	50	1	,	,	PUNCT
bioscience-222	50	2	10	10	NUM
bioscience-222	50	3	pmol	pmol	NOUN
bioscience-222	50	4	of	of	ADP
bioscience-222	50	5	each	each	DET
bioscience-222	50	6	forward	forward	ADV
bioscience-222	50	7	and	and	CCONJ
bioscience-222	50	8	reverse	reverse	ADJ
bioscience-222	50	9	primer	primer	NOUN
bioscience-222	50	10	,	,	PUNCT
bioscience-222	50	11	and	and	CCONJ
bioscience-222	50	12	1x	1x	NUM
bioscience-222	50	13	pcr	pcr	ADJ
bioscience-222	50	14	buffer	buffer	NOUN
bioscience-222	50	15	(	(	PUNCT
bioscience-222	50	16	invitrogen	invitrogen	PROPN
bioscience-222	50	17	,	,	PUNCT
bioscience-222	50	18	carlsbad	carlsbad	PROPN
bioscience-222	50	19	,	,	PUNCT
bioscience-222	50	20	calif	calif	PROPN
bioscience-222	50	21	.	.	PUNCT
bioscience-222	50	22	)	)	PUNCT
bioscience-222	50	23	.	.	PUNCT
bioscience-222	51	1	polymerase	polymerase	NOUN
bioscience-222	51	2	chain	chain	NOUN
bioscience-222	51	3	reaction	reaction	NOUN
bioscience-222	51	4	(	(	PUNCT
bioscience-222	51	5	pcr	pcr	PROPN
bioscience-222	51	6	)	)	PUNCT
bioscience-222	51	7	was	be	AUX
bioscience-222	51	8	conducted	conduct	VERB
bioscience-222	51	9	using	use	VERB
bioscience-222	51	10	a	a	DET
bioscience-222	51	11	thermocycler	thermocycler	NOUN
bioscience-222	51	12	(	(	PUNCT
bioscience-222	51	13	abi	abi	PROPN
bioscience-222	51	14	geneamp2720	geneamp2720	PROPN
bioscience-222	51	15	)	)	PUNCT
bioscience-222	51	16	with	with	ADP
bioscience-222	51	17	the	the	DET
bioscience-222	51	18	following	follow	VERB
bioscience-222	51	19	program	program	NOUN
bioscience-222	51	20	:	:	PUNCT
bioscience-222	51	21	a	a	DET
bioscience-222	51	22	denaturing	denature	VERB
bioscience-222	51	23	cycle	cycle	NOUN
bioscience-222	51	24	of	of	ADP
bioscience-222	51	25	94oc	94oc	NOUN
bioscience-222	51	26	for	for	ADP
bioscience-222	51	27	3	3	NUM
bioscience-222	51	28	minutes	minute	NOUN
bioscience-222	51	29	,	,	PUNCT
bioscience-222	51	30	followed	follow	VERB
bioscience-222	51	31	by	by	ADP
bioscience-222	51	32	35	35	NUM
bioscience-222	51	33	cycles	cycle	NOUN
bioscience-222	51	34	of	of	ADP
bioscience-222	51	35	94oc	94oc	NOUN
bioscience-222	51	36	for	for	ADP
bioscience-222	51	37	15	15	NUM
bioscience-222	51	38	seconds	second	NOUN
bioscience-222	51	39	(	(	PUNCT
bioscience-222	51	40	denaturation	denaturation	NOUN
bioscience-222	51	41	)	)	PUNCT
bioscience-222	51	42	,	,	PUNCT
bioscience-222	51	43	a	a	DET
bioscience-222	51	44	specific	specific	ADJ
bioscience-222	51	45	temperature	temperature	NOUN
bioscience-222	51	46	depending	depend	VERB
bioscience-222	51	47	upon	upon	SCONJ
bioscience-222	51	48	the	the	DET
bioscience-222	51	49	primer	primer	NOUN
bioscience-222	51	50	pair	pair	NOUN
bioscience-222	51	51	for	for	ADP
bioscience-222	51	52	15	15	NUM
bioscience-222	51	53	seconds	second	NOUN
bioscience-222	51	54	(	(	PUNCT
bioscience-222	51	55	annealing	anneal	VERB
bioscience-222	51	56	)	)	PUNCT
bioscience-222	51	57	,	,	PUNCT
bioscience-222	51	58	and	and	CCONJ
bioscience-222	51	59	72oc	72oc	NOUN
bioscience-222	51	60	for	for	ADP
bioscience-222	51	61	30	30	NUM
bioscience-222	51	62	seconds	second	NOUN
bioscience-222	51	63	(	(	PUNCT
bioscience-222	51	64	extension	extension	NOUN
bioscience-222	51	65	)	)	PUNCT
bioscience-222	51	66	,	,	PUNCT
bioscience-222	51	67	followed	follow	VERB
bioscience-222	51	68	by	by	ADP
bioscience-222	51	69	a	a	DET
bioscience-222	51	70	final	final	ADJ
bioscience-222	51	71	extension	extension	NOUN
bioscience-222	51	72	at	at	ADP
bioscience-222	51	73	72oc	72oc	NOUN
bioscience-222	51	74	for	for	ADP
bioscience-222	51	75	5	5	NUM
bioscience-222	51	76	minutes	minute	NOUN
bioscience-222	51	77	.	.	PUNCT
bioscience-222	52	1	the	the	DET
bioscience-222	52	2	pcr	pcr	PROPN
bioscience-222	52	3	products	product	NOUN
bioscience-222	52	4	were	be	AUX
bioscience-222	52	5	separated	separate	VERB
bioscience-222	52	6	on	on	ADP
bioscience-222	52	7	an	an	DET
bioscience-222	52	8	8	8	NUM
bioscience-222	52	9	%	%	NOUN
bioscience-222	52	10	polyacrylamide	polyacrylamide	NOUN
bioscience-222	52	11	gel	gel	NOUN
bioscience-222	52	12	according	accord	VERB
bioscience-222	52	13	to	to	ADP
bioscience-222	52	14	the	the	DET
bioscience-222	52	15	electrophoresis	electrophoresis	NOUN
bioscience-222	52	16	user	user	NOUN
bioscience-222	52	17	guide	guide	NOUN
bioscience-222	52	18	(	(	PUNCT
bioscience-222	52	19	invitrogen	invitrogen	PROPN
bioscience-222	52	20	)	)	PUNCT
bioscience-222	52	21	.	.	PUNCT
bioscience-222	53	1	dart	dart	NOUN
bioscience-222	53	2	and	and	CCONJ
bioscience-222	53	3	dartseq	dartseq	VERB
bioscience-222	53	4	dartseq	dartseq	NOUN
bioscience-222	53	5	is	be	AUX
bioscience-222	53	6	a	a	DET
bioscience-222	53	7	genotyping	genotyping	NOUN
bioscience-222	53	8	by	by	ADP
bioscience-222	53	9	sequencing	sequence	VERB
bioscience-222	53	10	(	(	PUNCT
bioscience-222	53	11	gbs	gbs	NOUN
bioscience-222	53	12	)	)	PUNCT
bioscience-222	53	13	platform	platform	NOUN
bioscience-222	53	14	developed	develop	VERB
bioscience-222	53	15	by	by	ADP
bioscience-222	53	16	dart	dart	PROPN
bioscience-222	53	17	pl	pl	PROPN
bioscience-222	53	18	,	,	PUNCT
bioscience-222	53	19	canberra	canberra	PROPN
bioscience-222	53	20	,	,	PUNCT
bioscience-222	53	21	australia	australia	PROPN
bioscience-222	53	22	(	(	PUNCT
bioscience-222	53	23	http://www.diversityarrays.com/dart-application-dartseq	http://www.diversityarrays.com/dart-application-dartseq	PROPN
bioscience-222	53	24	)	)	PUNCT
bioscience-222	53	25	.	.	PUNCT
bioscience-222	54	1	dartseq	dartseq	VERB
bioscience-222	54	2	is	be	AUX
bioscience-222	54	3	a	a	DET
bioscience-222	54	4	combination	combination	NOUN
bioscience-222	54	5	of	of	ADP
bioscience-222	54	6	complexity	complexity	NOUN
bioscience-222	54	7	reduction	reduction	NOUN
bioscience-222	54	8	methods	method	NOUN
bioscience-222	54	9	that	that	PRON
bioscience-222	54	10	were	be	AUX
bioscience-222	54	11	initially	initially	ADV
bioscience-222	54	12	developed	develop	VERB
bioscience-222	54	13	for	for	ADP
bioscience-222	54	14	array	array	NOUN
bioscience-222	54	15	-	-	PUNCT
bioscience-222	54	16	based	base	VERB
bioscience-222	54	17	dart	dart	NOUN
bioscience-222	54	18	with	with	ADP
bioscience-222	54	19	sequencing	sequence	VERB
bioscience-222	54	20	of	of	ADP
bioscience-222	54	21	resulting	result	VERB
bioscience-222	54	22	representations	representation	NOUN
bioscience-222	54	23	on	on	ADP
bioscience-222	54	24	next	next	ADJ
bioscience-222	54	25	-	-	PUNCT
bioscience-222	54	26	generation	generation	NOUN
bioscience-222	54	27	sequencing	sequencing	NOUN
bioscience-222	54	28	platforms	platform	NOUN
bioscience-222	54	29	.	.	PUNCT
bioscience-222	55	1	experimental	experimental	ADJ
bioscience-222	55	2	design	design	NOUN
bioscience-222	55	3	and	and	CCONJ
bioscience-222	55	4	locations	location	NOUN
bioscience-222	55	5	four	four	NUM
bioscience-222	55	6	field	field	NOUN
bioscience-222	55	7	experiments	experiment	NOUN
bioscience-222	55	8	and	and	CCONJ
bioscience-222	55	9	two	two	NUM
bioscience-222	55	10	greenhouse	greenhouse	NOUN
bioscience-222	55	11	experiments	experiment	NOUN
bioscience-222	55	12	were	be	AUX
bioscience-222	55	13	performed	perform	VERB
bioscience-222	55	14	at	at	ADP
bioscience-222	55	15	different	different	ADJ
bioscience-222	55	16	locations	location	NOUN
bioscience-222	55	17	in	in	ADP
bioscience-222	55	18	syria	syria	PROPN
bioscience-222	55	19	,	,	PUNCT
bioscience-222	55	20	enabling	enable	VERB
bioscience-222	55	21	us	we	PRON
bioscience-222	55	22	to	to	PART
bioscience-222	55	23	examine	examine	VERB
bioscience-222	55	24	disease	disease	NOUN
bioscience-222	55	25	susceptibility	susceptibility	NOUN
bioscience-222	55	26	of	of	ADP
bioscience-222	55	27	the	the	DET
bioscience-222	55	28	chickpea	chickpea	NOUN
bioscience-222	55	29	lines	line	NOUN
bioscience-222	55	30	under	under	ADP
bioscience-222	55	31	six	six	NUM
bioscience-222	55	32	sets	set	NOUN
bioscience-222	55	33	of	of	ADP
bioscience-222	55	34	environmental	environmental	ADJ
bioscience-222	55	35	conditions	condition	NOUN
bioscience-222	55	36	(	(	PUNCT
bioscience-222	55	37	table	table	NOUN
bioscience-222	55	38	1	1	NUM
bioscience-222	55	39	)	)	PUNCT
bioscience-222	55	40	.	.	PUNCT
bioscience-222	56	1	field	field	NOUN
bioscience-222	56	2	experiments	experiment	NOUN
bioscience-222	56	3	were	be	AUX
bioscience-222	56	4	performed	perform	VERB
bioscience-222	56	5	in	in	ADP
bioscience-222	56	6	lattakia	lattakia	PROPN
bioscience-222	56	7	,	,	PUNCT
bioscience-222	56	8	syria	syria	PROPN
bioscience-222	56	9	in	in	ADP
bioscience-222	56	10	2009	2009	NUM
bioscience-222	56	11	(	(	PUNCT
bioscience-222	56	12	lat09	lat09	NOUN
bioscience-222	56	13	)	)	PUNCT
bioscience-222	56	14	and	and	CCONJ
bioscience-222	56	15	at	at	ADP
bioscience-222	56	16	the	the	DET
bioscience-222	56	17	tel	tel	PROPN
bioscience-222	56	18	hadya	hadya	ADJ
bioscience-222	56	19	station	station	NOUN
bioscience-222	56	20	,	,	PUNCT
bioscience-222	56	21	aleppo	aleppo	PROPN
bioscience-222	56	22	,	,	PUNCT
bioscience-222	56	23	syria	syria	PROPN
bioscience-222	56	24	,	,	PUNCT
bioscience-222	56	25	in	in	ADP
bioscience-222	56	26	2008	2008	NUM
bioscience-222	56	27	,	,	PUNCT
bioscience-222	56	28	2009	2009	NUM
bioscience-222	56	29	,	,	PUNCT
bioscience-222	56	30	and	and	CCONJ
bioscience-222	56	31	2010	2010	NUM
bioscience-222	56	32	(	(	PUNCT
bioscience-222	56	33	th08	th08	PROPN
bioscience-222	56	34	,	,	PUNCT
bioscience-222	56	35	th09	th09	PROPN
bioscience-222	56	36	,	,	PUNCT
bioscience-222	56	37	and	and	CCONJ
bioscience-222	56	38	th10	th10	PROPN
bioscience-222	56	39	)	)	PUNCT
bioscience-222	56	40	.	.	PUNCT
bioscience-222	57	1	these	these	DET
bioscience-222	57	2	locations	location	NOUN
bioscience-222	57	3	differed	differ	VERB
bioscience-222	57	4	in	in	ADP
bioscience-222	57	5	the	the	DET
bioscience-222	57	6	average	average	ADJ
bioscience-222	57	7	rainfall	rainfall	NOUN
bioscience-222	57	8	they	they	PRON
bioscience-222	57	9	received	receive	VERB
bioscience-222	57	10	during	during	ADP
bioscience-222	57	11	the	the	DET
bioscience-222	57	12	experiments	experiment	NOUN
bioscience-222	57	13	:	:	PUNCT
bioscience-222	57	14	in	in	ADP
bioscience-222	57	15	lattakia	lattakia	NOUN
bioscience-222	57	16	,	,	PUNCT
bioscience-222	57	17	the	the	DET
bioscience-222	57	18	average	average	NOUN
bioscience-222	57	19	was	be	AUX
bioscience-222	57	20	around	around	ADV
bioscience-222	57	21	750	750	NUM
bioscience-222	57	22	mm	mm	NOUN
bioscience-222	57	23	,	,	PUNCT
bioscience-222	57	24	but	but	CCONJ
bioscience-222	57	25	in	in	ADP
bioscience-222	57	26	tel	tel	PROPN
bioscience-222	57	27	hadya	hadya	NOUN
bioscience-222	57	28	,	,	PUNCT
bioscience-222	57	29	the	the	DET
bioscience-222	57	30	average	average	NOUN
bioscience-222	57	31	was	be	AUX
bioscience-222	57	32	350	350	NUM
bioscience-222	57	33	mm	mm	NOUN
bioscience-222	57	34	.	.	PUNCT
bioscience-222	58	1	each	each	DET
bioscience-222	58	2	experiment	experiment	NOUN
bioscience-222	58	3	was	be	AUX
bioscience-222	58	4	laid	lay	VERB
bioscience-222	58	5	out	out	ADP
bioscience-222	58	6	in	in	ADP
bioscience-222	58	7	an	an	DET
bioscience-222	58	8	alpha	alpha	NOUN
bioscience-222	58	9	lattice	lattice	NOUN
bioscience-222	58	10	design	design	NOUN
bioscience-222	58	11	with	with	ADP
bioscience-222	58	12	two	two	NUM
bioscience-222	58	13	replications	replication	NOUN
bioscience-222	58	14	using	use	VERB
bioscience-222	58	15	multiple	multiple	ADJ
bioscience-222	58	16	row	row	NOUN
bioscience-222	58	17	plots	plot	NOUN
bioscience-222	58	18	.	.	PUNCT
bioscience-222	59	1	the	the	DET
bioscience-222	59	2	length	length	NOUN
bioscience-222	59	3	of	of	ADP
bioscience-222	59	4	each	each	DET
bioscience-222	59	5	plot	plot	NOUN
bioscience-222	59	6	was	be	AUX
bioscience-222	59	7	5	5	NUM
bioscience-222	59	8	m	m	NOUN
bioscience-222	59	9	and	and	CCONJ
bioscience-222	59	10	rows	row	NOUN
bioscience-222	59	11	were	be	AUX
bioscience-222	59	12	spaced	space	VERB
bioscience-222	59	13	45	45	NUM
bioscience-222	59	14	cm	cm	NOUN
bioscience-222	59	15	apart	apart	ADV
bioscience-222	59	16	in	in	ADP
bioscience-222	59	17	all	all	DET
bioscience-222	59	18	trials	trial	NOUN
bioscience-222	59	19	.	.	PUNCT
bioscience-222	60	1	two	two	NUM
bioscience-222	60	2	experiments	experiment	NOUN
bioscience-222	60	3	were	be	AUX
bioscience-222	60	4	performed	perform	VERB
bioscience-222	60	5	in	in	ADP
bioscience-222	60	6	the	the	DET
bioscience-222	60	7	greenhouse	greenhouse	NOUN
bioscience-222	60	8	at	at	ADP
bioscience-222	60	9	icarda	icarda	NOUN
bioscience-222	60	10	headquarters	headquarters	NOUN
bioscience-222	60	11	in	in	ADP
bioscience-222	60	12	aleppo	aleppo	PROPN
bioscience-222	60	13	,	,	PUNCT
bioscience-222	60	14	syria	syria	PROPN
bioscience-222	60	15	in	in	ADP
bioscience-222	60	16	2009	2009	NUM
bioscience-222	60	17	and	and	CCONJ
bioscience-222	60	18	2010	2010	NUM
bioscience-222	60	19	(	(	PUNCT
bioscience-222	60	20	pii-2009	pii-2009	NOUN
bioscience-222	60	21	and	and	CCONJ
bioscience-222	60	22	pii-2010	pii-2010	NOUN
bioscience-222	60	23	)	)	PUNCT
bioscience-222	60	24	.	.	PUNCT
bioscience-222	61	1	in	in	ADP
bioscience-222	61	2	the	the	DET
bioscience-222	61	3	greenhouse	greenhouse	NOUN
bioscience-222	61	4	,	,	PUNCT
bioscience-222	61	5	five	five	NUM
bioscience-222	61	6	healthy	healthy	ADJ
bioscience-222	61	7	seeds	seed	NOUN
bioscience-222	61	8	of	of	ADP
bioscience-222	61	9	each	each	DET
bioscience-222	61	10	line	line	NOUN
bioscience-222	61	11	were	be	AUX
bioscience-222	61	12	planted	plant	VERB
bioscience-222	61	13	in	in	ADP
bioscience-222	61	14	a	a	DET
bioscience-222	61	15	pot	pot	NOUN
bioscience-222	61	16	(	(	PUNCT
bioscience-222	61	17	15	15	NUM
bioscience-222	61	18	cm	cm	NOUN
bioscience-222	61	19	diameter	diameter	NOUN
bioscience-222	61	20	)	)	PUNCT
bioscience-222	61	21	.	.	PUNCT
bioscience-222	62	1	the	the	DET
bioscience-222	62	2	experiments	experiment	NOUN
bioscience-222	62	3	were	be	AUX
bioscience-222	62	4	conducted	conduct	VERB
bioscience-222	62	5	in	in	ADP
bioscience-222	62	6	a	a	DET
bioscience-222	62	7	growth	growth	NOUN
bioscience-222	62	8	chamber	chamber	NOUN
bioscience-222	62	9	(	(	PUNCT
bioscience-222	62	10	temperature	temperature	NOUN
bioscience-222	62	11	22oc	22oc	ADJ
bioscience-222	62	12	and	and	CCONJ
bioscience-222	62	13	12	12	NUM
bioscience-222	62	14	hours/12	hours/12	NOUN
bioscience-222	62	15	hours	hour	NOUN
bioscience-222	62	16	light	light	ADJ
bioscience-222	62	17	/	/	SYM
bioscience-222	62	18	dark	dark	ADJ
bioscience-222	62	19	)	)	PUNCT
bioscience-222	62	20	.	.	PUNCT
bioscience-222	63	1	locations	location	NOUN
bioscience-222	63	2	,	,	PUNCT
bioscience-222	63	3	years	year	NOUN
bioscience-222	63	4	,	,	PUNCT
bioscience-222	63	5	and	and	CCONJ
bioscience-222	63	6	planting	planting	NOUN
bioscience-222	63	7	dates	date	NOUN
bioscience-222	63	8	for	for	ADP
bioscience-222	63	9	the	the	DET
bioscience-222	63	10	six	six	NUM
bioscience-222	63	11	experiments	experiment	NOUN
bioscience-222	63	12	are	be	AUX
bioscience-222	63	13	summarized	summarize	VERB
bioscience-222	63	14	in	in	ADP
bioscience-222	63	15	(	(	PUNCT
bioscience-222	63	16	table	table	NOUN
bioscience-222	63	17	1	1	NUM
bioscience-222	63	18	)	)	PUNCT
bioscience-222	63	19	.	.	PUNCT
bioscience-222	64	1	the	the	DET
bioscience-222	64	2	ab	ab	PROPN
bioscience-222	64	3	cultures	culture	NOUN
bioscience-222	64	4	were	be	AUX
bioscience-222	64	5	obtained	obtain	VERB
bioscience-222	64	6	from	from	ADP
bioscience-222	64	7	the	the	DET
bioscience-222	64	8	legume	legume	NOUN
bioscience-222	64	9	pathology	pathology	NOUN
bioscience-222	64	10	laboratory	laboratory	NOUN
bioscience-222	64	11	at	at	ADP
bioscience-222	64	12	icarda	icarda	NOUN
bioscience-222	64	13	.	.	PUNCT
bioscience-222	65	1	the	the	DET
bioscience-222	65	2	experiments	experiment	NOUN
bioscience-222	65	3	were	be	AUX
bioscience-222	65	4	laid	lay	VERB
bioscience-222	65	5	out	out	ADP
bioscience-222	65	6	in	in	ADP
bioscience-222	65	7	a	a	DET
bioscience-222	65	8	randomized	randomized	ADJ
bioscience-222	65	9	complete	complete	ADJ
bioscience-222	65	10	block	block	NOUN
bioscience-222	65	11	design	design	NOUN
bioscience-222	65	12	with	with	ADP
bioscience-222	65	13	two	two	NUM
bioscience-222	65	14	replications	replication	NOUN
bioscience-222	65	15	.	.	PUNCT
bioscience-222	66	1	a	a	DET
bioscience-222	66	2	spore	spore	ADJ
bioscience-222	66	3	suspension	suspension	NOUN
bioscience-222	66	4	of	of	ADP
bioscience-222	66	5	ab	ab	PROPN
bioscience-222	66	6	pathotype	pathotype	PROPN
bioscience-222	66	7	ii	ii	PROPN
bioscience-222	66	8	(	(	PUNCT
bioscience-222	66	9	concentration	concentration	NOUN
bioscience-222	66	10	of	of	ADP
bioscience-222	66	11	105	105	NUM
bioscience-222	66	12	spores	spore	NOUN
bioscience-222	66	13	/	/	SYM
bioscience-222	66	14	ml−1	ml−1	NOUN
bioscience-222	66	15	)	)	PUNCT
bioscience-222	66	16	was	be	AUX
bioscience-222	66	17	prepared	prepare	VERB
bioscience-222	66	18	from	from	ADP
bioscience-222	66	19	14	14	NUM
bioscience-222	66	20	-	-	PUNCT
bioscience-222	66	21	day	day	NOUN
bioscience-222	66	22	old	old	ADJ
bioscience-222	66	23	ascochyta	ascochyta	NOUN
bioscience-222	66	24	rabiei	rabiei	PROPN
bioscience-222	66	25	culture	culture	PROPN
bioscience-222	66	26	grown	grow	VERB
bioscience-222	66	27	on	on	ADP
bioscience-222	66	28	chickpea	chickpea	NOUN
bioscience-222	66	29	dextrose	dextrose	NOUN
bioscience-222	66	30	agar	agar	NOUN
bioscience-222	66	31	(	(	PUNCT
bioscience-222	66	32	4	4	NUM
bioscience-222	66	33	%	%	NOUN
bioscience-222	66	34	chickpea	chickpea	NOUN
bioscience-222	66	35	flour	flour	NOUN
bioscience-222	66	36	,	,	PUNCT
bioscience-222	66	37	2	2	NUM
bioscience-222	66	38	%	%	NOUN
bioscience-222	66	39	dextrose	dextrose	NOUN
bioscience-222	66	40	,	,	PUNCT
bioscience-222	66	41	and	and	CCONJ
bioscience-222	66	42	2	2	NUM
bioscience-222	66	43	%	%	NOUN
bioscience-222	66	44	agar	agar	NOUN
bioscience-222	66	45	in	in	ADP
bioscience-222	66	46	1	1	NUM
bioscience-222	66	47	liter	liter	NOUN
bioscience-222	66	48	of	of	ADP
bioscience-222	66	49	distilled	distil	VERB
bioscience-222	66	50	water	water	NOUN
bioscience-222	66	51	)	)	PUNCT
bioscience-222	66	52	and	and	CCONJ
bioscience-222	66	53	used	use	VERB
bioscience-222	66	54	for	for	ADP
bioscience-222	66	55	seedling	seedling	NOUN
bioscience-222	66	56	inoculations	inoculation	NOUN
bioscience-222	66	57	.	.	PUNCT
bioscience-222	67	1	the	the	DET
bioscience-222	67	2	disease	disease	NOUN
bioscience-222	67	3	was	be	AUX
bioscience-222	67	4	scored	score	VERB
bioscience-222	67	5	when	when	SCONJ
bioscience-222	67	6	symptoms	symptom	NOUN
bioscience-222	67	7	were	be	AUX
bioscience-222	67	8	observed	observe	VERB
bioscience-222	67	9	on	on	ADP
bioscience-222	67	10	the	the	DET
bioscience-222	67	11	susceptible	susceptible	ADJ
bioscience-222	67	12	chickpea	chickpea	NOUN
bioscience-222	67	13	control	control	NOUN
bioscience-222	67	14	(	(	PUNCT
bioscience-222	67	15	ilc-263	ilc-263	PROPN
bioscience-222	67	16	)	)	PUNCT
bioscience-222	67	17	.	.	PUNCT
bioscience-222	68	1	scoring	score	VERB
bioscience-222	68	2	plants	plant	NOUN
bioscience-222	68	3	for	for	ADP
bioscience-222	68	4	ab	ab	PROPN
bioscience-222	68	5	symptom	symptom	PROPN
bioscience-222	68	6	severity	severity	PROPN
bioscience-222	68	7	ascochyta	ascochyta	NOUN
bioscience-222	68	8	blight	blight	NOUN
bioscience-222	68	9	symptom	symptom	NOUN
bioscience-222	68	10	scoring	scoring	NOUN
bioscience-222	68	11	was	be	AUX
bioscience-222	68	12	based	base	VERB
bioscience-222	68	13	on	on	ADP
bioscience-222	68	14	a	a	DET
bioscience-222	68	15	nine	nine	NUM
bioscience-222	68	16	-	-	PUNCT
bioscience-222	68	17	point	point	NOUN
bioscience-222	68	18	rating	rating	NOUN
bioscience-222	68	19	scale	scale	NOUN
bioscience-222	68	20	[	[	X
bioscience-222	68	21	25	25	NUM
bioscience-222	68	22	]	]	PUNCT
bioscience-222	68	23	in	in	ADP
bioscience-222	68	24	which	which	PRON
bioscience-222	68	25	plants	plant	NOUN
bioscience-222	68	26	are	be	AUX
bioscience-222	68	27	scored	score	VERB
bioscience-222	68	28	as	as	SCONJ
bioscience-222	68	29	follows	follow	VERB
bioscience-222	68	30	:	:	PUNCT
bioscience-222	68	31	1	1	X
bioscience-222	68	32	.	.	X
bioscience-222	68	33	immune	immune	ADJ
bioscience-222	68	34	,	,	PUNCT
bioscience-222	68	35	no	no	DET
bioscience-222	68	36	symptoms	symptom	NOUN
bioscience-222	68	37	of	of	ADP
bioscience-222	68	38	disease	disease	NOUN
bioscience-222	68	39	;	;	PUNCT
bioscience-222	68	40	2	2	X
bioscience-222	68	41	.	.	NOUN
bioscience-222	68	42	few	few	ADJ
bioscience-222	68	43	,	,	PUNCT
bioscience-222	68	44	very	very	ADV
bioscience-222	68	45	small	small	ADJ
bioscience-222	68	46	lesions	lesion	NOUN
bioscience-222	68	47	(	(	PUNCT
bioscience-222	68	48	<	<	X
bioscience-222	68	49	2	2	NUM
bioscience-222	68	50	mm	mm	NOUN
bioscience-222	68	51	)	)	PUNCT
bioscience-222	68	52	on	on	ADP
bioscience-222	68	53	leaves	leave	NOUN
bioscience-222	68	54	and	and	CCONJ
bioscience-222	68	55	stems	stem	VERB
bioscience-222	68	56	(	(	PUNCT
bioscience-222	68	57	1	1	NUM
bioscience-222	68	58	to	to	PART
bioscience-222	68	59	2	2	NUM
bioscience-222	68	60	%	%	NOUN
bioscience-222	68	61	of	of	ADP
bioscience-222	68	62	the	the	DET
bioscience-222	68	63	plant	plant	NOUN
bioscience-222	68	64	area	area	NOUN
bioscience-222	68	65	infected	infect	VERB
bioscience-222	68	66	)	)	PUNCT
bioscience-222	68	67	;	;	PUNCT
bioscience-222	69	1	3	3	X
bioscience-222	69	2	.	.	X
bioscience-222	69	3	many	many	ADJ
bioscience-222	69	4	small	small	ADJ
bioscience-222	69	5	lesions	lesion	NOUN
bioscience-222	69	6	(	(	PUNCT
bioscience-222	69	7	6	6	NUM
bioscience-222	69	8	to	to	PART
bioscience-222	69	9	10	10	NUM
bioscience-222	69	10	%	%	NOUN
bioscience-222	69	11	of	of	ADP
bioscience-222	69	12	the	the	DET
bioscience-222	69	13	plant	plant	NOUN
bioscience-222	69	14	area	area	NOUN
bioscience-222	69	15	infected	infect	VERB
bioscience-222	69	16	)	)	PUNCT
bioscience-222	69	17	;	;	PUNCT
bioscience-222	69	18	4	4	X
bioscience-222	69	19	.	.	X
bioscience-222	69	20	many	many	ADJ
bioscience-222	69	21	small	small	ADJ
bioscience-222	69	22	and	and	CCONJ
bioscience-222	69	23	large	large	ADJ
bioscience-222	69	24	lesions	lesion	NOUN
bioscience-222	69	25	(	(	PUNCT
bioscience-222	69	26	26	26	NUM
bioscience-222	69	27	to	to	PART
bioscience-222	69	28	50	50	NUM
bioscience-222	69	29	%	%	NOUN
bioscience-222	69	30	of	of	ADP
bioscience-222	69	31	the	the	DET
bioscience-222	69	32	plant	plant	NOUN
bioscience-222	69	33	area	area	NOUN
bioscience-222	69	34	infected	infect	VERB
bioscience-222	69	35	)	)	PUNCT
bioscience-222	69	36	;	;	PUNCT
bioscience-222	69	37	5	5	X
bioscience-222	69	38	.	.	X
bioscience-222	70	1	many	many	ADJ
bioscience-222	70	2	small	small	ADJ
bioscience-222	70	3	lesions	lesion	NOUN
bioscience-222	70	4	on	on	ADP
bioscience-222	70	5	the	the	DET
bioscience-222	70	6	stem	stem	NOUN
bioscience-222	70	7	(	(	PUNCT
bioscience-222	70	8	51	51	NUM
bioscience-222	70	9	to	to	PART
bioscience-222	70	10	75	75	NUM
bioscience-222	70	11	%	%	NOUN
bioscience-222	70	12	of	of	ADP
bioscience-222	70	13	the	the	DET
bioscience-222	70	14	plant	plant	NOUN
bioscience-222	70	15	area	area	NOUN
bioscience-222	70	16	infected	infect	VERB
bioscience-222	70	17	)	)	PUNCT
bioscience-222	70	18	;	;	PUNCT
bioscience-222	71	1	6	6	X
bioscience-222	71	2	.	.	X
bioscience-222	72	1	many	many	ADJ
bioscience-222	72	2	large	large	ADJ
bioscience-222	72	3	lesions	lesion	NOUN
bioscience-222	72	4	,	,	PUNCT
bioscience-222	72	5	lesions	lesion	NOUN
bioscience-222	72	6	coalescing	coalescing	NOUN
bioscience-222	72	7	,	,	PUNCT
bioscience-222	72	8	stem	stem	NOUN
bioscience-222	72	9	girdled	girdle	VERB
bioscience-222	72	10	(	(	PUNCT
bioscience-222	72	11	76	76	NUM
bioscience-222	72	12	to	to	PART
bioscience-222	72	13	90	90	NUM
bioscience-222	72	14	%	%	NOUN
bioscience-222	72	15	of	of	ADP
bioscience-222	72	16	the	the	DET
bioscience-222	72	17	plant	plant	NOUN
bioscience-222	72	18	area	area	NOUN
bioscience-222	72	19	infected	infect	VERB
bioscience-222	72	20	)	)	PUNCT
bioscience-222	72	21	;	;	PUNCT
bioscience-222	72	22	7	7	X
bioscience-222	72	23	.	.	X
bioscience-222	72	24	many	many	ADJ
bioscience-222	72	25	small	small	ADJ
bioscience-222	72	26	and	and	CCONJ
bioscience-222	72	27	large	large	ADJ
bioscience-222	72	28	lesions	lesion	NOUN
bioscience-222	72	29	,	,	PUNCT
bioscience-222	72	30	lesions	lesion	NOUN
bioscience-222	72	31	coalescing	coalescing	NOUN
bioscience-222	72	32	,	,	PUNCT
bioscience-222	72	33	girdling	girdle	VERB
bioscience-222	72	34	stem	stem	NOUN
bioscience-222	72	35	breakage	breakage	NOUN
bioscience-222	72	36	(	(	PUNCT
bioscience-222	72	37	>	>	SYM
bioscience-222	72	38	90	90	NUM
bioscience-222	72	39	%	%	NOUN
bioscience-222	72	40	of	of	ADP
bioscience-222	72	41	the	the	DET
bioscience-222	72	42	plant	plant	NOUN
bioscience-222	72	43	area	area	NOUN
bioscience-222	72	44	infected	infect	VERB
bioscience-222	72	45	)	)	PUNCT
bioscience-222	72	46	;	;	PUNCT
bioscience-222	72	47	8	8	X
bioscience-222	72	48	.	.	X
bioscience-222	72	49	plant	plant	NOUN
bioscience-222	72	50	is	be	AUX
bioscience-222	72	51	almost	almost	ADV
bioscience-222	72	52	dead	dead	ADJ
bioscience-222	72	53	;	;	PUNCT
bioscience-222	72	54	and	and	CCONJ
bioscience-222	72	55	9	9	X
bioscience-222	72	56	.	.	X
bioscience-222	72	57	plant	plant	NOUN
bioscience-222	72	58	is	be	AUX
bioscience-222	72	59	dead	dead	ADJ
bioscience-222	72	60	.	.	PUNCT
bioscience-222	73	1	highlights	highlight	NOUN
bioscience-222	73	2	in	in	ADP
bioscience-222	73	3	bioscience	bioscience	NOUN
bioscience-222	73	4	page	page	NOUN
bioscience-222	73	5	2	2	NUM
bioscience-222	73	6	of	of	ADP
bioscience-222	73	7	11	11	NUM
bioscience-222	73	8	december	december	PROPN
bioscience-222	73	9	2024|volume	2024|volume	NUM
bioscience-222	73	10	7	7	NUM
bioscience-222	73	11	http://www.diversityarrays.com/dart-application-dartseq	http://www.diversityarrays.com/dart-application-dartseq	X
bioscience-222	73	12	http://www.diversityarrays.com/dart-application-dartseq	http://www.diversityarrays.com/dart-application-dartseq	PUNCT
bioscience-222	73	13	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	73	14	hamwieh	hamwieh	VERB
bioscience-222	73	15	et	et	PROPN
bioscience-222	73	16	al	al	PROPN
bioscience-222	73	17	.	.	PROPN
bioscience-222	73	18	,	,	PUNCT
bioscience-222	73	19	2024	2024	NUM
bioscience-222	73	20	exploring	explore	VERB
bioscience-222	73	21	qtl	qtl	PROPN
bioscience-222	73	22	genes	gene	NOUN
bioscience-222	73	23	contribute	contribute	VERB
bioscience-222	73	24	to	to	ADP
bioscience-222	73	25	chickpea	chickpea	PROPN
bioscience-222	73	26	ascochyta	ascochyta	NOUN
bioscience-222	73	27	blight	blight	NOUN
bioscience-222	73	28	resistance	resistance	NOUN
bioscience-222	73	29	table	table	NOUN
bioscience-222	73	30	1	1	NUM
bioscience-222	73	31	.	.	PUNCT
bioscience-222	74	1	rainfall	rainfall	NOUN
bioscience-222	74	2	"	"	PUNCT
bioscience-222	74	3	mm	mm	NOUN
bioscience-222	74	4	"	"	PUNCT
bioscience-222	74	5	,	,	PUNCT
bioscience-222	74	6	temperature	temperature	NOUN
bioscience-222	74	7	"	"	PUNCT
bioscience-222	74	8	oc	oc	NOUN
bioscience-222	74	9	"	"	PUNCT
bioscience-222	74	10	(	(	PUNCT
bioscience-222	74	11	between	between	ADP
bioscience-222	74	12	brackets	bracket	NOUN
bioscience-222	74	13	)	)	PUNCT
bioscience-222	74	14	and	and	CCONJ
bioscience-222	74	15	planting	planting	NOUN
bioscience-222	74	16	dates	date	NOUN
bioscience-222	74	17	during	during	ADP
bioscience-222	74	18	3	3	NUM
bioscience-222	74	19	years	year	NOUN
bioscience-222	74	20	(	(	PUNCT
bioscience-222	74	21	2008–2010	2008–2010	NUM
bioscience-222	74	22	)	)	PUNCT
bioscience-222	74	23	for	for	ADP
bioscience-222	74	24	experiments	experiment	NOUN
bioscience-222	74	25	conducted	conduct	VERB
bioscience-222	74	26	in	in	ADP
bioscience-222	74	27	six	six	NUM
bioscience-222	74	28	environments	environment	NOUN
bioscience-222	74	29	in	in	ADP
bioscience-222	74	30	syria	syria	PROPN
bioscience-222	74	31	(	(	PUNCT
bioscience-222	74	32	three	three	NUM
bioscience-222	74	33	in	in	ADP
bioscience-222	74	34	the	the	DET
bioscience-222	74	35	field	field	NOUN
bioscience-222	74	36	and	and	CCONJ
bioscience-222	74	37	two	two	NUM
bioscience-222	74	38	in	in	ADP
bioscience-222	74	39	the	the	DET
bioscience-222	74	40	greenhouse	greenhouse	NOUN
bioscience-222	74	41	at	at	ADP
bioscience-222	74	42	tel	tel	PROPN
bioscience-222	74	43	hadya	hadya	PROPN
bioscience-222	74	44	th	th	X
bioscience-222	74	45	;	;	PUNCT
bioscience-222	74	46	one	one	NUM
bioscience-222	74	47	in	in	ADP
bioscience-222	74	48	the	the	DET
bioscience-222	74	49	field	field	NOUN
bioscience-222	74	50	at	at	ADP
bioscience-222	74	51	lattakia	lattakia	NOUN
bioscience-222	74	52	"	"	PUNCT
bioscience-222	74	53	lat	lat	NOUN
bioscience-222	74	54	"	"	PUNCT
bioscience-222	74	55	)	)	PUNCT
bioscience-222	74	56	.	.	PUNCT
bioscience-222	75	1	environment	environment	PROPN
bioscience-222	75	2	code	code	NOUN
bioscience-222	75	3	greenhouse	greenhouse	NOUN
bioscience-222	75	4	field	field	NOUN
bioscience-222	75	5	pji-2009	pji-2009	NOUN
bioscience-222	75	6	pji-2010	pji-2010	NOUN
bioscience-222	75	7	lat09	lat09	ADJ
bioscience-222	75	8	th08	th08	PROPN
bioscience-222	75	9	th09	th09	PROPN
bioscience-222	75	10	th10	th10	PROPN
bioscience-222	75	11	location	location	NOUN
bioscience-222	75	12	tel	tel	ADP
bioscience-222	75	13	hadya	hadya	ADJ
bioscience-222	75	14	greenhouse	greenhouse	NOUN
bioscience-222	75	15	tel	tel	ADP
bioscience-222	75	16	hadya	hadya	ADJ
bioscience-222	75	17	greenhouse	greenhouse	NOUN
bioscience-222	75	18	lattakia	lattakia	NOUN
bioscience-222	75	19	tel	tel	ADP
bioscience-222	75	20	hadya	hadya	ADJ
bioscience-222	75	21	greenhouse	greenhouse	NOUN
bioscience-222	75	22	tel	tel	ADP
bioscience-222	75	23	hadya	hadya	ADJ
bioscience-222	75	24	greenhouse	greenhouse	NOUN
bioscience-222	75	25	tel	tel	ADP
bioscience-222	75	26	hadya	hadya	ADJ
bioscience-222	75	27	greenhouse	greenhouse	NOUN
bioscience-222	75	28	year	year	NOUN
bioscience-222	75	29	2009	2009	NUM
bioscience-222	75	30	2010	2010	NUM
bioscience-222	75	31	2009	2009	NUM
bioscience-222	75	32	2008	2008	NUM
bioscience-222	75	33	2009	2009	NUM
bioscience-222	75	34	2010	2010	NUM
bioscience-222	75	35	planting	planting	NOUN
bioscience-222	75	36	date	date	NOUN
bioscience-222	75	37	15	15	NUM
bioscience-222	75	38	nov	nov	NOUN
bioscience-222	75	39	.	.	PROPN
bioscience-222	75	40	2008	2008	NUM
bioscience-222	75	41	13	13	NUM
bioscience-222	75	42	nov	nov	PROPN
bioscience-222	75	43	.	.	PROPN
bioscience-222	75	44	2009	2009	NUM
bioscience-222	75	45	22	22	NUM
bioscience-222	75	46	mar	mar	PROPN
bioscience-222	75	47	.	.	PROPN
bioscience-222	75	48	2009	2009	NUM
bioscience-222	75	49	11	11	NUM
bioscience-222	75	50	dec	dec	PROPN
bioscience-222	75	51	.	.	PROPN
bioscience-222	75	52	2007	2007	NUM
bioscience-222	75	53	12	12	NUM
bioscience-222	75	54	dec	dec	PROPN
bioscience-222	75	55	.	.	PROPN
bioscience-222	75	56	2008	2008	NUM
bioscience-222	75	57	9	9	NUM
bioscience-222	75	58	dec	dec	PROPN
bioscience-222	75	59	.	.	PROPN
bioscience-222	75	60	2009	2009	NUM
bioscience-222	75	61	february	february	PROPN
bioscience-222	75	62	mi	mi	PROPN
bioscience-222	75	63	(	(	PUNCT
bioscience-222	75	64	21	21	NUM
bioscience-222	75	65	řc	řc	PROPN
bioscience-222	75	66	)	)	PUNCT
bioscience-222	75	67	mi	mi	PROPN
bioscience-222	75	68	(	(	PUNCT
bioscience-222	75	69	21	21	NUM
bioscience-222	75	70	řc	řc	PROPN
bioscience-222	75	71	)	)	PUNCT
bioscience-222	75	72	98.4	98.4	NUM
bioscience-222	75	73	(	(	PUNCT
bioscience-222	75	74	13.2	13.2	NUM
bioscience-222	75	75	řc	řc	PROPN
bioscience-222	75	76	)	)	PUNCT
bioscience-222	75	77	22.0	22.0	NUM
bioscience-222	75	78	(	(	PUNCT
bioscience-222	75	79	14.3	14.3	NUM
bioscience-222	75	80	řc	řc	PROPN
bioscience-222	75	81	)	)	PUNCT
bioscience-222	75	82	84.3	84.3	NUM
bioscience-222	75	83	(	(	PUNCT
bioscience-222	75	84	14.2	14.2	NUM
bioscience-222	75	85	řc	řc	PROPN
bioscience-222	75	86	)	)	PUNCT
bioscience-222	75	87	50.6	50.6	NUM
bioscience-222	75	88	(	(	PUNCT
bioscience-222	75	89	15.2	15.2	NUM
bioscience-222	75	90	řc	řc	PROPN
bioscience-222	75	91	)	)	PUNCT
bioscience-222	75	92	march	march	PROPN
bioscience-222	75	93	mi	mi	PROPN
bioscience-222	75	94	(	(	PUNCT
bioscience-222	75	95	21	21	NUM
bioscience-222	75	96	řc	řc	PROPN
bioscience-222	75	97	)	)	PUNCT
bioscience-222	75	98	mi	mi	PROPN
bioscience-222	75	99	(	(	PUNCT
bioscience-222	75	100	21	21	NUM
bioscience-222	75	101	řc	řc	PROPN
bioscience-222	75	102	)	)	PUNCT
bioscience-222	75	103	93.3	93.3	NUM
bioscience-222	75	104	(	(	PUNCT
bioscience-222	75	105	20.3	20.3	NUM
bioscience-222	75	106	řc	řc	PROPN
bioscience-222	75	107	)	)	PUNCT
bioscience-222	75	108	27.9	27.9	NUM
bioscience-222	75	109	(	(	PUNCT
bioscience-222	75	110	22.9	22.9	NUM
bioscience-222	75	111	řc	řc	PROPN
bioscience-222	75	112	)	)	PUNCT
bioscience-222	75	113	36.2	36.2	NUM
bioscience-222	75	114	(	(	PUNCT
bioscience-222	75	115	17.1	17.1	NUM
bioscience-222	75	116	řc	řc	PROPN
bioscience-222	75	117	)	)	PUNCT
bioscience-222	75	118	12.4	12.4	NUM
bioscience-222	75	119	(	(	PUNCT
bioscience-222	75	120	20.8	20.8	NUM
bioscience-222	75	121	řc	řc	PROPN
bioscience-222	75	122	)	)	PUNCT
bioscience-222	75	123	april	april	PROPN
bioscience-222	75	124	mi	mi	PROPN
bioscience-222	75	125	(	(	PUNCT
bioscience-222	75	126	21	21	NUM
bioscience-222	75	127	řc	řc	PROPN
bioscience-222	75	128	)	)	PUNCT
bioscience-222	75	129	mi	mi	PROPN
bioscience-222	75	130	(	(	PUNCT
bioscience-222	75	131	21	21	NUM
bioscience-222	75	132	řc	řc	PROPN
bioscience-222	75	133	)	)	PUNCT
bioscience-222	75	134	56.6	56.6	NUM
bioscience-222	75	135	(	(	PUNCT
bioscience-222	75	136	23.4	23.4	NUM
bioscience-222	75	137	řc	řc	PROPN
bioscience-222	75	138	)	)	PUNCT
bioscience-222	75	139	1.9	1.9	NUM
bioscience-222	75	140	(	(	PUNCT
bioscience-222	75	141	27.9	27.9	NUM
bioscience-222	75	142	řc	řc	PROPN
bioscience-222	75	143	)	)	PUNCT
bioscience-222	75	144	23.4	23.4	NUM
bioscience-222	75	145	(	(	PUNCT
bioscience-222	75	146	24.0	24.0	NUM
bioscience-222	75	147	řc	řc	PROPN
bioscience-222	75	148	)	)	PUNCT
bioscience-222	75	149	12.7	12.7	NUM
bioscience-222	75	150	(	(	PUNCT
bioscience-222	75	151	25.8	25.8	NUM
bioscience-222	75	152	řc	řc	PROPN
bioscience-222	75	153	)	)	PUNCT
bioscience-222	75	154	may	may	AUX
bioscience-222	75	155	34.6	34.6	NUM
bioscience-222	75	156	(	(	PUNCT
bioscience-222	75	157	25.1	25.1	NUM
bioscience-222	75	158	řc	řc	PROPN
bioscience-222	75	159	)	)	PUNCT
bioscience-222	75	160	10.9	10.9	NUM
bioscience-222	75	161	(	(	PUNCT
bioscience-222	75	162	29.2	29.2	NUM
bioscience-222	75	163	řc	řc	PROPN
bioscience-222	75	164	)	)	PUNCT
bioscience-222	75	165	4.0	4.0	NUM
bioscience-222	75	166	(	(	PUNCT
bioscience-222	75	167	30.1	30.1	NUM
bioscience-222	75	168	řc	řc	PROPN
bioscience-222	75	169	)	)	PUNCT
bioscience-222	75	170	0.0	0.0	NUM
bioscience-222	75	171	(	(	PUNCT
bioscience-222	75	172	31.7	31.7	NUM
bioscience-222	75	173	řc	řc	ADJ
bioscience-222	75	174	)	)	PUNCT
bioscience-222	75	175	date	date	NOUN
bioscience-222	75	176	of	of	ADP
bioscience-222	75	177	score	score	NOUN
bioscience-222	75	178	22/5/2009	22/5/2009	NUM
bioscience-222	75	179	25/5/2008	25/5/2008	NUM
bioscience-222	75	180	17/5/2009	17/5/2009	NUM
bioscience-222	75	181	16/5/2010	16/5/2010	NUM
bioscience-222	75	182	total	total	ADJ
bioscience-222	75	183	rainfall	rainfall	NOUN
bioscience-222	75	184	(	(	PUNCT
bioscience-222	75	185	mm	mm	NOUN
bioscience-222	75	186	)	)	PUNCT
bioscience-222	75	187	282.9	282.9	NUM
bioscience-222	75	188	62.7	62.7	NUM
bioscience-222	75	189	147.9	147.9	NUM
bioscience-222	75	190	75.7	75.7	NUM
bioscience-222	75	191	mi	mi	NOUN
bioscience-222	75	192	:	:	PUNCT
bioscience-222	75	193	mist	mist	NOUN
bioscience-222	75	194	irrigation	irrigation	NOUN
bioscience-222	75	195	used	use	VERB
bioscience-222	75	196	to	to	PART
bioscience-222	75	197	keep	keep	VERB
bioscience-222	75	198	relative	relative	ADJ
bioscience-222	75	199	humidity	humidity	NOUN
bioscience-222	75	200	around	around	ADP
bioscience-222	75	201	80	80	NUM
bioscience-222	75	202	%	%	NOUN
bioscience-222	75	203	under	under	ADP
bioscience-222	75	204	controlled	control	VERB
bioscience-222	75	205	environments	environment	NOUN
bioscience-222	75	206	.	.	PUNCT
bioscience-222	76	1	statistical	statistical	ADJ
bioscience-222	76	2	analysis	analysis	NOUN
bioscience-222	76	3	the	the	DET
bioscience-222	76	4	disease	disease	NOUN
bioscience-222	76	5	rating	rating	NOUN
bioscience-222	76	6	data	datum	NOUN
bioscience-222	76	7	collected	collect	VERB
bioscience-222	76	8	from	from	ADP
bioscience-222	76	9	the	the	DET
bioscience-222	76	10	experiments	experiment	NOUN
bioscience-222	76	11	were	be	AUX
bioscience-222	76	12	analyzed	analyze	VERB
bioscience-222	76	13	using	use	VERB
bioscience-222	76	14	genstat	genstat	PROPN
bioscience-222	76	15	12th	12th	PROPN
bioscience-222	76	16	edition	edition	NOUN
bioscience-222	76	17	(	(	PUNCT
bioscience-222	76	18	vsni	vsni	PROPN
bioscience-222	76	19	,	,	PUNCT
bioscience-222	76	20	hemel	hemel	PROPN
bioscience-222	76	21	hempstead	hempstead	PROPN
bioscience-222	76	22	,	,	PUNCT
bioscience-222	76	23	uk	uk	PROPN
bioscience-222	76	24	)	)	PUNCT
bioscience-222	76	25	.	.	PUNCT
bioscience-222	77	1	to	to	PART
bioscience-222	77	2	evaluate	evaluate	VERB
bioscience-222	77	3	ab	ab	PROPN
bioscience-222	77	4	scores	score	NOUN
bioscience-222	77	5	,	,	PUNCT
bioscience-222	77	6	analysis	analysis	NOUN
bioscience-222	77	7	of	of	ADP
bioscience-222	77	8	variance	variance	NOUN
bioscience-222	77	9	(	(	PUNCT
bioscience-222	77	10	anova	anova	PROPN
bioscience-222	77	11	)	)	PUNCT
bioscience-222	77	12	with	with	ADP
bioscience-222	77	13	multiplicative	multiplicative	ADJ
bioscience-222	77	14	interactions	interaction	NOUN
bioscience-222	77	15	analysis	analysis	NOUN
bioscience-222	77	16	(	(	PUNCT
bioscience-222	77	17	ammi	ammi	PROPN
bioscience-222	77	18	)	)	PUNCT
bioscience-222	77	19	was	be	AUX
bioscience-222	77	20	performed	perform	VERB
bioscience-222	77	21	.	.	PUNCT
bioscience-222	78	1	ammi	ammi	PROPN
bioscience-222	78	2	analysis	analysis	NOUN
bioscience-222	78	3	was	be	AUX
bioscience-222	78	4	described	describe	VERB
bioscience-222	78	5	by	by	ADP
bioscience-222	78	6	[	[	X
bioscience-222	78	7	26	26	NUM
bioscience-222	78	8	]	]	PUNCT
bioscience-222	78	9	based	base	VERB
bioscience-222	78	10	on	on	ADP
bioscience-222	78	11	the	the	DET
bioscience-222	78	12	following	follow	VERB
bioscience-222	78	13	formula	formula	NOUN
bioscience-222	78	14	:	:	PUNCT
bioscience-222	79	1	yi	yi	PROPN
bioscience-222	79	2	j	j	PROPN
bioscience-222	79	3	=	=	SYM
bioscience-222	79	4	µ	µ	PROPN
bioscience-222	79	5	+	+	X
bioscience-222	79	6	gi	gi	VERB
bioscience-222	79	7	+	+	CCONJ
bioscience-222	79	8	a	a	DET
bioscience-222	79	9	j	j	PROPN
bioscience-222	80	1	+	+	CCONJ
bioscience-222	80	2	n∑	n∑	INTJ
bioscience-222	80	3	k=1	k=1	PUNCT
bioscience-222	81	1	λk	λk	INTJ
bioscience-222	81	2	xiky	xiky	PROPN
bioscience-222	82	1	jk	jk	PROPN
bioscience-222	83	1	+	+	CCONJ
bioscience-222	83	2	ri	ri	PROPN
bioscience-222	83	3	j	j	PROPN
bioscience-222	83	4	+	+	CCONJ
bioscience-222	83	5	s̄	s̄	NOUN
bioscience-222	84	1	i	i	PRON
bioscience-222	84	2	j	j	PROPN
bioscience-222	84	3	where	where	SCONJ
bioscience-222	84	4	µ	µ	NOUN
bioscience-222	84	5	is	be	AUX
bioscience-222	84	6	the	the	DET
bioscience-222	84	7	overall	overall	ADJ
bioscience-222	84	8	mean	mean	NOUN
bioscience-222	84	9	of	of	ADP
bioscience-222	84	10	the	the	DET
bioscience-222	84	11	test	test	NOUN
bioscience-222	84	12	;	;	PUNCT
bioscience-222	84	13	gi	gi	X
bioscience-222	84	14	is	be	AUX
bioscience-222	84	15	the	the	DET
bioscience-222	84	16	fixed	fixed	ADJ
bioscience-222	84	17	effect	effect	NOUN
bioscience-222	84	18	of	of	ADP
bioscience-222	84	19	genotype	genotype	NOUN
bioscience-222	85	1	i	i	PRON
bioscience-222	85	2	(	(	PUNCT
bioscience-222	85	3	i	i	NOUN
bioscience-222	85	4	=	=	NOUN
bioscience-222	85	5	1	1	NUM
bioscience-222	85	6	,	,	PUNCT
bioscience-222	85	7	2	2	NUM
bioscience-222	85	8	,	,	PUNCT
bioscience-222	85	9	.	.	PUNCT
bioscience-222	85	10	.	.	PUNCT
bioscience-222	85	11	.	.	PUNCT
bioscience-222	86	1	,	,	PUNCT
bioscience-222	86	2	g	g	NOUN
bioscience-222	86	3	)	)	PUNCT
bioscience-222	86	4	;	;	PUNCT
bioscience-222	86	5	a	a	DET
bioscience-222	86	6	j	j	NOUN
bioscience-222	86	7	is	be	AUX
bioscience-222	86	8	the	the	DET
bioscience-222	86	9	fixed	fixed	ADJ
bioscience-222	86	10	effect	effect	NOUN
bioscience-222	86	11	of	of	ADP
bioscience-222	86	12	environment	environment	NOUN
bioscience-222	86	13	j	j	PROPN
bioscience-222	86	14	(	(	PUNCT
bioscience-222	86	15	j	j	PROPN
bioscience-222	86	16	=	=	SYM
bioscience-222	86	17	1	1	NUM
bioscience-222	86	18	,	,	PUNCT
bioscience-222	86	19	2	2	NUM
bioscience-222	86	20	,	,	PUNCT
bioscience-222	86	21	.	.	PUNCT
bioscience-222	86	22	.	.	PUNCT
bioscience-222	87	1	.	.	PUNCT
bioscience-222	88	1	,	,	PUNCT
bioscience-222	88	2	a	a	X
bioscience-222	88	3	)	)	PUNCT
bioscience-222	88	4	;	;	PUNCT
bioscience-222	88	5	yi	yi	PROPN
bioscience-222	88	6	j	j	PROPN
bioscience-222	88	7	is	be	AUX
bioscience-222	88	8	the	the	DET
bioscience-222	88	9	mean	mean	ADJ
bioscience-222	88	10	response	response	NOUN
bioscience-222	88	11	of	of	ADP
bioscience-222	88	12	genotype	genotype	NOUN
bioscience-222	88	13	i	i	PRON
bioscience-222	88	14	in	in	ADP
bioscience-222	88	15	environment	environment	PROPN
bioscience-222	88	16	j	j	PROPN
bioscience-222	88	17	;	;	PUNCT
bioscience-222	88	18	λk	λk	X
bioscience-222	88	19	is	be	AUX
bioscience-222	88	20	the	the	DET
bioscience-222	88	21	singular	singular	ADJ
bioscience-222	88	22	value	value	NOUN
bioscience-222	88	23	of	of	ADP
bioscience-222	88	24	the	the	DET
bioscience-222	88	25	k	k	PROPN
bioscience-222	88	26	-	-	PUNCT
bioscience-222	88	27	th	th	VERB
bioscience-222	88	28	ipca	ipca	NOUN
bioscience-222	88	29	,	,	PUNCT
bioscience-222	88	30	(	(	PUNCT
bioscience-222	88	31	k	k	NOUN
bioscience-222	88	32	=	=	SYM
bioscience-222	88	33	1	1	NUM
bioscience-222	88	34	,	,	PUNCT
bioscience-222	88	35	2	2	NUM
bioscience-222	88	36	,	,	PUNCT
bioscience-222	88	37	.	.	PUNCT
bioscience-222	88	38	.	.	PUNCT
bioscience-222	89	1	.	.	PUNCT
bioscience-222	90	1	,	,	PUNCT
bioscience-222	90	2	p	p	X
bioscience-222	90	3	,	,	PUNCT
bioscience-222	90	4	where	where	SCONJ
bioscience-222	90	5	p	p	NOUN
bioscience-222	90	6	is	be	AUX
bioscience-222	90	7	the	the	DET
bioscience-222	90	8	maximum	maximum	ADJ
bioscience-222	90	9	number	number	NOUN
bioscience-222	90	10	of	of	ADP
bioscience-222	90	11	estimable	estimable	ADJ
bioscience-222	90	12	principal	principal	ADJ
bioscience-222	90	13	components	component	NOUN
bioscience-222	90	14	)	)	PUNCT
bioscience-222	90	15	;	;	PUNCT
bioscience-222	90	16	xik	xik	X
bioscience-222	90	17	is	be	AUX
bioscience-222	90	18	the	the	DET
bioscience-222	90	19	singular	singular	ADJ
bioscience-222	90	20	value	value	NOUN
bioscience-222	90	21	of	of	ADP
bioscience-222	90	22	the	the	DET
bioscience-222	90	23	i	i	PROPN
bioscience-222	90	24	-	-	PUNCT
bioscience-222	90	25	th	th	VERB
bioscience-222	90	26	genotype	genotype	NOUN
bioscience-222	90	27	in	in	ADP
bioscience-222	90	28	the	the	DET
bioscience-222	90	29	k	k	PROPN
bioscience-222	90	30	-	-	PUNCT
bioscience-222	90	31	th	th	VERB
bioscience-222	90	32	ipca	ipca	NOUN
bioscience-222	90	33	;	;	PUNCT
bioscience-222	90	34	y	y	PROPN
bioscience-222	90	35	jk	jk	PROPN
bioscience-222	90	36	is	be	AUX
bioscience-222	90	37	the	the	DET
bioscience-222	90	38	singular	singular	ADJ
bioscience-222	90	39	value	value	NOUN
bioscience-222	90	40	of	of	ADP
bioscience-222	90	41	the	the	DET
bioscience-222	90	42	j	j	PROPN
bioscience-222	90	43	-	-	PUNCT
bioscience-222	90	44	th	th	VERB
bioscience-222	90	45	environment	environment	NOUN
bioscience-222	90	46	in	in	ADP
bioscience-222	90	47	the	the	DET
bioscience-222	90	48	k	k	PROPN
bioscience-222	90	49	-	-	PUNCT
bioscience-222	90	50	th	th	VERB
bioscience-222	90	51	ipca	ipca	NOUN
bioscience-222	90	52	;	;	PUNCT
bioscience-222	90	53	ri	ri	PROPN
bioscience-222	90	54	j	j	PROPN
bioscience-222	90	55	is	be	AUX
bioscience-222	90	56	the	the	DET
bioscience-222	90	57	residue	residue	NOUN
bioscience-222	90	58	of	of	ADP
bioscience-222	90	59	the	the	DET
bioscience-222	90	60	gei	gei	PROPN
bioscience-222	90	61	or	or	CCONJ
bioscience-222	90	62	ammi	ammi	PROPN
bioscience-222	90	63	residue	residue	NOUN
bioscience-222	90	64	(	(	PUNCT
bioscience-222	90	65	data	data	NOUN
bioscience-222	90	66	noise	noise	NOUN
bioscience-222	90	67	)	)	PUNCT
bioscience-222	90	68	;	;	PUNCT
bioscience-222	90	69	k	k	X
bioscience-222	90	70	is	be	AUX
bioscience-222	90	71	the	the	DET
bioscience-222	90	72	characteristic	characteristic	ADJ
bioscience-222	90	73	non	non	ADJ
bioscience-222	90	74	-	-	ADJ
bioscience-222	90	75	zero	zero	NUM
bioscience-222	90	76	root	root	NOUN
bioscience-222	90	77	,	,	PUNCT
bioscience-222	90	78	k	k	X
bioscience-222	91	1	=	=	PUNCT
bioscience-222	92	1	[	[	X
bioscience-222	92	2	1	1	NUM
bioscience-222	92	3	,	,	PUNCT
bioscience-222	92	4	2	2	NUM
bioscience-222	92	5	,	,	PUNCT
bioscience-222	92	6	.	.	PUNCT
bioscience-222	92	7	.	.	PUNCT
bioscience-222	93	1	.	.	PUNCT
bioscience-222	94	1	,	,	PUNCT
bioscience-222	94	2	min(g	min(g	PROPN
bioscience-222	94	3	−	−	PROPN
bioscience-222	94	4	1	1	NUM
bioscience-222	94	5	,	,	PUNCT
bioscience-222	94	6	e	e	NOUN
bioscience-222	94	7	−	−	PROPN
bioscience-222	94	8	1	1	NUM
bioscience-222	94	9	)	)	PUNCT
bioscience-222	94	10	]	]	PUNCT
bioscience-222	94	11	.	.	PUNCT
bioscience-222	95	1	the	the	DET
bioscience-222	95	2	plot	plot	NOUN
bioscience-222	95	3	genotype	genotype	NOUN
bioscience-222	95	4	and	and	CCONJ
bioscience-222	95	5	environment	environment	NOUN
bioscience-222	95	6	interactions	interaction	NOUN
bioscience-222	95	7	were	be	AUX
bioscience-222	95	8	analyzed	analyze	VERB
bioscience-222	95	9	against	against	ADP
bioscience-222	95	10	four	four	NUM
bioscience-222	95	11	interaction	interaction	NOUN
bioscience-222	95	12	principal	principal	ADJ
bioscience-222	95	13	component	component	NOUN
bioscience-222	95	14	axes	axis	NOUN
bioscience-222	95	15	(	(	PUNCT
bioscience-222	95	16	ipcas	ipcas	NOUN
bioscience-222	95	17	)	)	PUNCT
bioscience-222	95	18	.	.	PUNCT
bioscience-222	96	1	the	the	DET
bioscience-222	96	2	ratio	ratio	NOUN
bioscience-222	96	3	of	of	ADP
bioscience-222	96	4	the	the	DET
bioscience-222	96	5	genetic	genetic	ADJ
bioscience-222	96	6	variance	variance	NOUN
bioscience-222	96	7	to	to	ADP
bioscience-222	96	8	the	the	DET
bioscience-222	96	9	total	total	ADJ
bioscience-222	96	10	phenotypic	phenotypic	ADJ
bioscience-222	96	11	variance	variance	NOUN
bioscience-222	96	12	was	be	AUX
bioscience-222	96	13	calculated	calculate	VERB
bioscience-222	96	14	to	to	PART
bioscience-222	96	15	estimate	estimate	VERB
bioscience-222	96	16	heritability	heritability	NOUN
bioscience-222	96	17	.	.	PUNCT
bioscience-222	97	1	genetic	genetic	ADJ
bioscience-222	97	2	mapping	mapping	NOUN
bioscience-222	97	3	was	be	AUX
bioscience-222	97	4	conducted	conduct	VERB
bioscience-222	97	5	using	use	VERB
bioscience-222	97	6	joinmap	joinmap	NOUN
bioscience-222	97	7	4	4	NUM
bioscience-222	97	8	®	®	NOUN
bioscience-222	97	9	software	software	NOUN
bioscience-222	97	10	,	,	PUNCT
bioscience-222	97	11	kyazma	kyazma	PROPN
bioscience-222	98	1	[	[	X
bioscience-222	98	2	27	27	NUM
bioscience-222	98	3	]	]	PUNCT
bioscience-222	98	4	.	.	PUNCT
bioscience-222	99	1	linkage	linkage	NOUN
bioscience-222	99	2	groups	group	NOUN
bioscience-222	99	3	were	be	AUX
bioscience-222	99	4	created	create	VERB
bioscience-222	99	5	based	base	VERB
bioscience-222	99	6	on	on	ADP
bioscience-222	99	7	a	a	DET
bioscience-222	99	8	logarithm	logarithm	NOUN
bioscience-222	99	9	of	of	ADP
bioscience-222	99	10	odds	odd	NOUN
bioscience-222	99	11	(	(	PUNCT
bioscience-222	99	12	lod	lod	PROPN
bioscience-222	99	13	)	)	PUNCT
bioscience-222	99	14	score	score	NOUN
bioscience-222	99	15	greater	great	ADJ
bioscience-222	99	16	than	than	ADP
bioscience-222	99	17	3	3	NUM
bioscience-222	99	18	and	and	CCONJ
bioscience-222	99	19	a	a	DET
bioscience-222	99	20	recombination	recombination	NOUN
bioscience-222	99	21	frequency	frequency	NOUN
bioscience-222	99	22	below	below	ADP
bioscience-222	99	23	0.45	0.45	NUM
bioscience-222	99	24	.	.	PUNCT
bioscience-222	100	1	map	map	NOUN
bioscience-222	100	2	distances	distance	NOUN
bioscience-222	100	3	in	in	ADP
bioscience-222	100	4	centimorgans	centimorgan	NOUN
bioscience-222	100	5	(	(	PUNCT
bioscience-222	100	6	cm	cm	NOUN
bioscience-222	100	7	)	)	PUNCT
bioscience-222	100	8	were	be	AUX
bioscience-222	100	9	estimated	estimate	VERB
bioscience-222	100	10	using	use	VERB
bioscience-222	100	11	the	the	DET
bioscience-222	100	12	kosambi	kosambi	PROPN
bioscience-222	100	13	function	function	NOUN
bioscience-222	101	1	[	[	X
bioscience-222	101	2	28	28	NUM
bioscience-222	101	3	]	]	PUNCT
bioscience-222	101	4	.	.	PUNCT
bioscience-222	102	1	qtl	qtl	PROPN
bioscience-222	102	2	analysis	analysis	NOUN
bioscience-222	102	3	was	be	AUX
bioscience-222	102	4	conducted	conduct	VERB
bioscience-222	102	5	using	use	VERB
bioscience-222	102	6	mapqtl	mapqtl	NOUN
bioscience-222	102	7	6	6	NUM
bioscience-222	102	8	®	®	NOUN
bioscience-222	102	9	software	software	NOUN
bioscience-222	102	10	,	,	PUNCT
bioscience-222	102	11	kyazma	kyazma	PROPN
bioscience-222	103	1	[	[	X
bioscience-222	103	2	29	29	NUM
bioscience-222	103	3	]	]	PUNCT
bioscience-222	103	4	,	,	PUNCT
bioscience-222	103	5	and	and	CCONJ
bioscience-222	103	6	the	the	DET
bioscience-222	103	7	fraction	fraction	NOUN
bioscience-222	103	8	of	of	ADP
bioscience-222	103	9	the	the	DET
bioscience-222	103	10	variation	variation	NOUN
bioscience-222	103	11	explained	explain	VERB
bioscience-222	103	12	by	by	ADP
bioscience-222	103	13	the	the	DET
bioscience-222	103	14	qtl	qtl	PROPN
bioscience-222	103	15	and	and	CCONJ
bioscience-222	103	16	the	the	DET
bioscience-222	103	17	additive	additive	ADJ
bioscience-222	103	18	effects	effect	NOUN
bioscience-222	103	19	were	be	AUX
bioscience-222	103	20	calculated	calculate	VERB
bioscience-222	103	21	.	.	PUNCT
bioscience-222	104	1	the	the	DET
bioscience-222	104	2	potential	potential	ADJ
bioscience-222	104	3	qtls	qtls	NOUN
bioscience-222	104	4	were	be	AUX
bioscience-222	104	5	estimated	estimate	VERB
bioscience-222	104	6	based	base	VERB
bioscience-222	104	7	on	on	ADP
bioscience-222	104	8	a	a	DET
bioscience-222	104	9	2,000	2,000	NUM
bioscience-222	104	10	permutation	permutation	NOUN
bioscience-222	104	11	test	test	NOUN
bioscience-222	104	12	using	use	VERB
bioscience-222	104	13	lod	lod	PROPN
bioscience-222	104	14	≥2	≥2	PROPN
bioscience-222	104	15	as	as	ADP
bioscience-222	104	16	the	the	DET
bioscience-222	104	17	significance	significance	NOUN
bioscience-222	104	18	threshold	threshold	NOUN
bioscience-222	104	19	.	.	PUNCT
bioscience-222	105	1	predicted	predict	VERB
bioscience-222	105	2	genes	gene	NOUN
bioscience-222	105	3	within	within	ADP
bioscience-222	105	4	the	the	DET
bioscience-222	105	5	qtl	qtl	PROPN
bioscience-222	105	6	regions	region	NOUN
bioscience-222	105	7	were	be	AUX
bioscience-222	105	8	identified	identify	VERB
bioscience-222	105	9	across	across	ADP
bioscience-222	105	10	the	the	DET
bioscience-222	105	11	chickpea	chickpea	NOUN
bioscience-222	105	12	genome	genome	NOUN
bioscience-222	105	13	using	use	VERB
bioscience-222	105	14	the	the	DET
bioscience-222	105	15	blast	blast	NOUN
bioscience-222	105	16	package	package	NOUN
bioscience-222	106	1	[	[	X
bioscience-222	106	2	30	30	NUM
bioscience-222	106	3	]	]	PUNCT
bioscience-222	106	4	,	,	PUNCT
bioscience-222	106	5	and	and	CCONJ
bioscience-222	106	6	homologous	homologous	ADJ
bioscience-222	106	7	protein	protein	NOUN
bioscience-222	106	8	-	-	PUNCT
bioscience-222	106	9	encoding	encoding	NOUN
bioscience-222	106	10	genes	gene	NOUN
bioscience-222	106	11	were	be	AUX
bioscience-222	106	12	extracted	extract	VERB
bioscience-222	106	13	from	from	ADP
bioscience-222	106	14	the	the	DET
bioscience-222	106	15	chickpea	chickpea	NOUN
bioscience-222	106	16	genome	genome	NOUN
bioscience-222	106	17	sequence	sequence	NOUN
bioscience-222	106	18	.	.	PUNCT
bioscience-222	107	1	the	the	DET
bioscience-222	107	2	snpeff	snpeff	NOUN
bioscience-222	107	3	tool	tool	NOUN
bioscience-222	107	4	was	be	AUX
bioscience-222	107	5	used	use	VERB
bioscience-222	107	6	to	to	PART
bioscience-222	107	7	detect	detect	VERB
bioscience-222	107	8	the	the	DET
bioscience-222	107	9	genetic	genetic	ADJ
bioscience-222	107	10	sequence	sequence	NOUN
bioscience-222	107	11	effect	effect	NOUN
bioscience-222	107	12	for	for	ADP
bioscience-222	107	13	potential	potential	ADJ
bioscience-222	107	14	snps	snps	PROPN
bioscience-222	107	15	with	with	ADP
bioscience-222	107	16	a	a	DET
bioscience-222	107	17	correlation	correlation	NOUN
bioscience-222	107	18	to	to	ADP
bioscience-222	107	19	ascochyta	ascochyta	NOUN
bioscience-222	107	20	blight	blight	NOUN
bioscience-222	107	21	resistance	resistance	NOUN
bioscience-222	107	22	.	.	PUNCT
bioscience-222	108	1	results	result	VERB
bioscience-222	108	2	phenotypic	phenotypic	ADJ
bioscience-222	108	3	characterization	characterization	NOUN
bioscience-222	108	4	we	we	PRON
bioscience-222	108	5	collected	collect	VERB
bioscience-222	108	6	data	datum	NOUN
bioscience-222	108	7	from	from	ADP
bioscience-222	108	8	three	three	NUM
bioscience-222	108	9	growing	grow	VERB
bioscience-222	108	10	seasons	season	NOUN
bioscience-222	108	11	(	(	PUNCT
bioscience-222	108	12	2008	2008	NUM
bioscience-222	108	13	–	–	PUNCT
bioscience-222	108	14	2010	2010	NUM
bioscience-222	108	15	)	)	PUNCT
bioscience-222	108	16	and	and	CCONJ
bioscience-222	108	17	from	from	ADP
bioscience-222	108	18	one	one	NUM
bioscience-222	108	19	greenhouse	greenhouse	NOUN
bioscience-222	108	20	and	and	CCONJ
bioscience-222	108	21	two	two	NUM
bioscience-222	108	22	field	field	NOUN
bioscience-222	108	23	locations	location	NOUN
bioscience-222	108	24	;	;	PUNCT
bioscience-222	108	25	this	this	PRON
bioscience-222	108	26	allowed	allow	VERB
bioscience-222	108	27	us	we	PRON
bioscience-222	108	28	to	to	PART
bioscience-222	108	29	analyze	analyze	VERB
bioscience-222	108	30	plants	plant	NOUN
bioscience-222	108	31	exposed	expose	VERB
bioscience-222	108	32	to	to	ADP
bioscience-222	108	33	six	six	NUM
bioscience-222	108	34	different	different	ADJ
bioscience-222	108	35	environmental	environmental	ADJ
bioscience-222	108	36	conditions	condition	NOUN
bioscience-222	108	37	.	.	PUNCT
bioscience-222	109	1	we	we	PRON
bioscience-222	109	2	observed	observe	VERB
bioscience-222	109	3	significant	significant	ADJ
bioscience-222	109	4	differences	difference	NOUN
bioscience-222	109	5	(	(	PUNCT
bioscience-222	109	6	p	p	X
bioscience-222	109	7	<	<	X
bioscience-222	109	8	0.001	0.001	NUM
bioscience-222	109	9	)	)	PUNCT
bioscience-222	109	10	in	in	ADP
bioscience-222	109	11	the	the	DET
bioscience-222	109	12	ab	ab	PROPN
bioscience-222	109	13	severity	severity	NOUN
bioscience-222	109	14	scores	score	NOUN
bioscience-222	109	15	(	(	PUNCT
bioscience-222	109	16	on	on	ADP
bioscience-222	109	17	a	a	DET
bioscience-222	109	18	scale	scale	NOUN
bioscience-222	109	19	from	from	ADP
bioscience-222	109	20	1	1	NUM
bioscience-222	109	21	through	through	ADP
bioscience-222	109	22	9	9	NUM
bioscience-222	109	23	)	)	PUNCT
bioscience-222	109	24	among	among	ADP
bioscience-222	109	25	the	the	DET
bioscience-222	109	26	165	165	NUM
bioscience-222	109	27	rils	ril	NOUN
bioscience-222	109	28	and	and	CCONJ
bioscience-222	109	29	among	among	ADP
bioscience-222	109	30	plants	plant	NOUN
bioscience-222	109	31	exposed	expose	VERB
bioscience-222	109	32	to	to	ADP
bioscience-222	109	33	the	the	DET
bioscience-222	109	34	six	six	NUM
bioscience-222	109	35	environments	environment	NOUN
bioscience-222	109	36	.	.	PUNCT
bioscience-222	110	1	however	however	ADV
bioscience-222	110	2	,	,	PUNCT
bioscience-222	110	3	the	the	DET
bioscience-222	110	4	mean	mean	ADJ
bioscience-222	110	5	values	value	NOUN
bioscience-222	110	6	of	of	ADP
bioscience-222	110	7	the	the	DET
bioscience-222	110	8	ab	ab	PROPN
bioscience-222	110	9	severity	severity	NOUN
bioscience-222	110	10	scores	score	NOUN
bioscience-222	110	11	showed	show	VERB
bioscience-222	110	12	a	a	DET
bioscience-222	110	13	continuous	continuous	ADJ
bioscience-222	110	14	distribution	distribution	NOUN
bioscience-222	110	15	from	from	ADP
bioscience-222	110	16	3	3	NUM
bioscience-222	110	17	to	to	ADP
bioscience-222	110	18	9	9	NUM
bioscience-222	110	19	(	(	PUNCT
bioscience-222	110	20	figure	figure	NOUN
bioscience-222	110	21	1	1	NUM
bioscience-222	110	22	(	(	PUNCT
bioscience-222	110	23	a	a	NOUN
bioscience-222	110	24	)	)	PUNCT
bioscience-222	110	25	)	)	PUNCT
bioscience-222	110	26	that	that	PRON
bioscience-222	110	27	fit	fit	VERB
bioscience-222	110	28	the	the	DET
bioscience-222	110	29	normal	normal	ADJ
bioscience-222	110	30	distribution	distribution	NOUN
bioscience-222	110	31	.	.	PUNCT
bioscience-222	111	1	to	to	PART
bioscience-222	111	2	estimate	estimate	VERB
bioscience-222	111	3	the	the	DET
bioscience-222	111	4	interactions	interaction	NOUN
bioscience-222	111	5	between	between	ADP
bioscience-222	111	6	ab	ab	PROPN
bioscience-222	111	7	resistance	resistance	NOUN
bioscience-222	111	8	and	and	CCONJ
bioscience-222	111	9	the	the	DET
bioscience-222	111	10	environments	environment	NOUN
bioscience-222	111	11	we	we	PRON
bioscience-222	111	12	tested	test	VERB
bioscience-222	111	13	,	,	PUNCT
bioscience-222	111	14	the	the	DET
bioscience-222	111	15	ab	ab	PROPN
bioscience-222	111	16	scores	score	NOUN
bioscience-222	111	17	were	be	AUX
bioscience-222	111	18	further	far	ADV
bioscience-222	111	19	analyzed	analyze	VERB
bioscience-222	111	20	using	use	VERB
bioscience-222	111	21	the	the	DET
bioscience-222	111	22	ammi	ammi	PROPN
bioscience-222	111	23	model	model	PROPN
bioscience-222	111	24	,	,	PUNCT
bioscience-222	111	25	which	which	PRON
bioscience-222	111	26	combines	combine	VERB
bioscience-222	111	27	features	feature	NOUN
bioscience-222	111	28	of	of	ADP
bioscience-222	111	29	anova	anova	PROPN
bioscience-222	111	30	and	and	CCONJ
bioscience-222	111	31	principal	principal	ADJ
bioscience-222	111	32	component	component	NOUN
bioscience-222	111	33	analysis	analysis	NOUN
bioscience-222	111	34	.	.	PUNCT
bioscience-222	112	1	the	the	DET
bioscience-222	112	2	analysis	analysis	NOUN
bioscience-222	112	3	indicated	indicate	VERB
bioscience-222	112	4	that	that	SCONJ
bioscience-222	112	5	25	25	NUM
bioscience-222	112	6	%	%	NOUN
bioscience-222	112	7	of	of	ADP
bioscience-222	112	8	the	the	DET
bioscience-222	112	9	total	total	ADJ
bioscience-222	112	10	sum	sum	NOUN
bioscience-222	112	11	of	of	ADP
bioscience-222	112	12	squares	square	NOUN
bioscience-222	112	13	(	(	PUNCT
bioscience-222	112	14	ss	ss	NOUN
bioscience-222	112	15	)	)	PUNCT
bioscience-222	112	16	was	be	AUX
bioscience-222	112	17	due	due	ADJ
bioscience-222	112	18	to	to	ADP
bioscience-222	112	19	environmental	environmental	ADJ
bioscience-222	112	20	factors	factor	NOUN
bioscience-222	112	21	,	,	PUNCT
bioscience-222	112	22	and	and	CCONJ
bioscience-222	112	23	only	only	ADV
bioscience-222	112	24	26.5	26.5	NUM
bioscience-222	112	25	%	%	NOUN
bioscience-222	112	26	and	and	CCONJ
bioscience-222	112	27	32.9	32.9	NUM
bioscience-222	112	28	%	%	NOUN
bioscience-222	112	29	,	,	PUNCT
bioscience-222	112	30	respectively	respectively	ADV
bioscience-222	112	31	,	,	PUNCT
bioscience-222	112	32	was	be	AUX
bioscience-222	112	33	due	due	ADJ
bioscience-222	112	34	to	to	ADP
bioscience-222	112	35	genotypic	genotypic	NOUN
bioscience-222	112	36	and	and	CCONJ
bioscience-222	112	37	gene	gene	NOUN
bioscience-222	112	38	-	-	PUNCT
bioscience-222	112	39	environment	environment	NOUN
bioscience-222	112	40	interaction	interaction	NOUN
bioscience-222	112	41	(	(	PUNCT
bioscience-222	112	42	gei	gei	ADJ
bioscience-222	112	43	)	)	PUNCT
bioscience-222	112	44	factors	factor	NOUN
bioscience-222	112	45	(	(	PUNCT
bioscience-222	112	46	table	table	NOUN
bioscience-222	112	47	2	2	NUM
bioscience-222	112	48	)	)	PUNCT
bioscience-222	112	49	.	.	PUNCT
bioscience-222	113	1	the	the	DET
bioscience-222	113	2	percentage	percentage	NOUN
bioscience-222	113	3	attributed	attribute	VERB
bioscience-222	113	4	to	to	ADP
bioscience-222	113	5	gei	gei	PROPN
bioscience-222	113	6	was	be	AUX
bioscience-222	113	7	about	about	ADV
bioscience-222	113	8	1.2	1.2	NUM
bioscience-222	113	9	times	time	NOUN
bioscience-222	113	10	the	the	DET
bioscience-222	113	11	percentage	percentage	NOUN
bioscience-222	113	12	attributed	attribute	VERB
bioscience-222	113	13	to	to	ADP
bioscience-222	113	14	genotype	genotype	NOUN
bioscience-222	113	15	,	,	PUNCT
bioscience-222	113	16	indicating	indicate	VERB
bioscience-222	113	17	substantial	substantial	ADJ
bioscience-222	113	18	differences	difference	NOUN
bioscience-222	113	19	in	in	ADP
bioscience-222	113	20	genotypic	genotypic	ADJ
bioscience-222	113	21	responses	response	NOUN
bioscience-222	113	22	across	across	ADP
bioscience-222	113	23	environhighlights	environhighlight	NOUN
bioscience-222	113	24	in	in	ADP
bioscience-222	113	25	bioscience	bioscience	NOUN
bioscience-222	113	26	page	page	NOUN
bioscience-222	113	27	3	3	NUM
bioscience-222	113	28	of	of	ADP
bioscience-222	113	29	11	11	NUM
bioscience-222	113	30	december	december	PROPN
bioscience-222	113	31	2024|volume	2024|volume	NUM
bioscience-222	113	32	7	7	NUM
bioscience-222	113	33	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	113	34	hamwieh	hamwieh	NOUN
bioscience-222	113	35	et	et	PROPN
bioscience-222	113	36	al	al	PROPN
bioscience-222	113	37	.	.	PROPN
bioscience-222	113	38	,	,	PUNCT
bioscience-222	113	39	2024	2024	NUM
bioscience-222	113	40	exploring	explore	VERB
bioscience-222	113	41	qtl	qtl	PROPN
bioscience-222	113	42	genes	gene	NOUN
bioscience-222	113	43	contribute	contribute	VERB
bioscience-222	113	44	to	to	ADP
bioscience-222	113	45	chickpea	chickpea	PROPN
bioscience-222	113	46	ascochyta	ascochyta	NOUN
bioscience-222	113	47	blight	blight	NOUN
bioscience-222	113	48	resistance	resistance	NOUN
bioscience-222	113	49	figure	figure	NOUN
bioscience-222	113	50	1	1	NUM
bioscience-222	113	51	.	.	PUNCT
bioscience-222	114	1	(	(	PUNCT
bioscience-222	114	2	a	a	DET
bioscience-222	114	3	)	)	PUNCT
bioscience-222	114	4	frequency	frequency	NOUN
bioscience-222	114	5	distributions	distribution	NOUN
bioscience-222	114	6	of	of	ADP
bioscience-222	114	7	ab	ab	PROPN
bioscience-222	114	8	disease	disease	NOUN
bioscience-222	114	9	scores	score	NOUN
bioscience-222	114	10	for	for	ADP
bioscience-222	114	11	165chickpea	165chickpea	PROPN
bioscience-222	114	12	rils	ril	NOUN
bioscience-222	114	13	derived	derive	VERB
bioscience-222	114	14	from	from	ADP
bioscience-222	114	15	flip98	flip98	PROPN
bioscience-222	114	16	-	-	PUNCT
bioscience-222	114	17	1065	1065	NUM
bioscience-222	114	18	(	(	PUNCT
bioscience-222	114	19	ab	ab	X
bioscience-222	114	20	resistant	resistant	ADJ
bioscience-222	114	21	)	)	PUNCT
bioscience-222	114	22	œ	œ	NOUN
bioscience-222	114	23	ilc1929	ilc1929	NOUN
bioscience-222	114	24	(	(	PUNCT
bioscience-222	114	25	ab	ab	PROPN
bioscience-222	114	26	susceptible	susceptible	ADJ
bioscience-222	114	27	)	)	PUNCT
bioscience-222	114	28	.	.	PUNCT
bioscience-222	115	1	arrows	arrow	NOUN
bioscience-222	115	2	indicate	indicate	VERB
bioscience-222	115	3	disease	disease	NOUN
bioscience-222	115	4	score	score	NOUN
bioscience-222	115	5	for	for	ADP
bioscience-222	115	6	each	each	DET
bioscience-222	115	7	parental	parental	ADJ
bioscience-222	115	8	genotype	genotype	NOUN
bioscience-222	115	9	.	.	PUNCT
bioscience-222	116	1	(	(	PUNCT
bioscience-222	116	2	b	b	X
bioscience-222	116	3	)	)	PUNCT
bioscience-222	116	4	ammi	ammi	PROPN
bioscience-222	116	5	model	model	NOUN
bioscience-222	116	6	2	2	NUM
bioscience-222	116	7	biplot	biplot	NOUN
bioscience-222	116	8	of	of	ADP
bioscience-222	116	9	ab	ab	PROPN
bioscience-222	116	10	resistance	resistance	NOUN
bioscience-222	116	11	scores	score	NOUN
bioscience-222	116	12	for	for	ADP
bioscience-222	116	13	165	165	NUM
bioscience-222	116	14	rils	ril	NOUN
bioscience-222	116	15	and	and	CCONJ
bioscience-222	116	16	6environments	6environment	NOUN
bioscience-222	116	17	.	.	PUNCT
bioscience-222	116	18	ments	ment	NOUN
bioscience-222	116	19	.	.	PUNCT
bioscience-222	117	1	however	however	ADV
bioscience-222	117	2	,	,	PUNCT
bioscience-222	117	3	the	the	DET
bioscience-222	117	4	large	large	ADJ
bioscience-222	117	5	ss	ss	NOUN
bioscience-222	117	6	value	value	NOUN
bioscience-222	117	7	for	for	ADP
bioscience-222	117	8	environmental	environmental	ADJ
bioscience-222	117	9	factors	factor	NOUN
bioscience-222	117	10	indicated	indicate	VERB
bioscience-222	117	11	that	that	SCONJ
bioscience-222	117	12	diverse	diverse	ADJ
bioscience-222	117	13	environments	environment	NOUN
bioscience-222	117	14	caused	cause	VERB
bioscience-222	117	15	a	a	DET
bioscience-222	117	16	significant	significant	ADJ
bioscience-222	117	17	portion	portion	NOUN
bioscience-222	117	18	of	of	ADP
bioscience-222	117	19	the	the	DET
bioscience-222	117	20	variation	variation	NOUN
bioscience-222	117	21	in	in	ADP
bioscience-222	117	22	the	the	DET
bioscience-222	117	23	ab	ab	PROPN
bioscience-222	117	24	values	value	NOUN
bioscience-222	117	25	.	.	PUNCT
bioscience-222	118	1	the	the	DET
bioscience-222	118	2	first	first	ADJ
bioscience-222	118	3	principal	principal	ADJ
bioscience-222	118	4	component	component	NOUN
bioscience-222	118	5	axis	axis	NOUN
bioscience-222	118	6	(	(	PUNCT
bioscience-222	118	7	pca1	pca1	PROPN
bioscience-222	118	8	)	)	PUNCT
bioscience-222	118	9	captured	capture	VERB
bioscience-222	118	10	40.11	40.11	NUM
bioscience-222	118	11	%	%	NOUN
bioscience-222	118	12	of	of	ADP
bioscience-222	118	13	the	the	DET
bioscience-222	118	14	gei	gei	PROPN
bioscience-222	118	15	-	-	PUNCT
bioscience-222	118	16	ss	ss	PROPN
bioscience-222	118	17	,	,	PUNCT
bioscience-222	118	18	while	while	SCONJ
bioscience-222	118	19	the	the	DET
bioscience-222	118	20	second	second	ADJ
bioscience-222	118	21	(	(	PUNCT
bioscience-222	118	22	pca2	pca2	PROPN
bioscience-222	118	23	)	)	PUNCT
bioscience-222	118	24	captured	capture	VERB
bioscience-222	118	25	only	only	ADV
bioscience-222	118	26	27.4	27.4	NUM
bioscience-222	118	27	%	%	NOUN
bioscience-222	118	28	.	.	PUNCT
bioscience-222	119	1	the	the	DET
bioscience-222	119	2	sum	sum	NOUN
bioscience-222	119	3	of	of	ADP
bioscience-222	119	4	squares	square	NOUN
bioscience-222	119	5	for	for	ADP
bioscience-222	119	6	pca1	pca1	NOUN
bioscience-222	119	7	and	and	CCONJ
bioscience-222	119	8	pca2	pca2	NOUN
bioscience-222	119	9	was	be	AUX
bioscience-222	119	10	1484	1484	NUM
bioscience-222	119	11	,	,	PUNCT
bioscience-222	119	12	which	which	PRON
bioscience-222	119	13	is	be	AUX
bioscience-222	119	14	smaller	small	ADJ
bioscience-222	119	15	than	than	ADP
bioscience-222	119	16	the	the	DET
bioscience-222	119	17	1774	1774	NUM
bioscience-222	119	18	captured	capture	VERB
bioscience-222	119	19	for	for	ADP
bioscience-222	119	20	genotype	genotype	NOUN
bioscience-222	119	21	.	.	PUNCT
bioscience-222	120	1	since	since	SCONJ
bioscience-222	120	2	mean	mean	ADJ
bioscience-222	120	3	squares	square	NOUN
bioscience-222	120	4	for	for	ADP
bioscience-222	120	5	both	both	DET
bioscience-222	120	6	pca1	pca1	NOUN
bioscience-222	120	7	and	and	CCONJ
bioscience-222	120	8	pca2	pca2	NOUN
bioscience-222	120	9	were	be	AUX
bioscience-222	120	10	significant	significant	ADJ
bioscience-222	120	11	at	at	ADP
bioscience-222	120	12	p	p	X
bioscience-222	120	13	<	<	X
bioscience-222	120	14	0.001	0.001	NUM
bioscience-222	120	15	and	and	CCONJ
bioscience-222	120	16	contributed	contribute	VERB
bioscience-222	120	17	about	about	ADV
bioscience-222	120	18	67.52	67.52	NUM
bioscience-222	120	19	%	%	NOUN
bioscience-222	120	20	of	of	ADP
bioscience-222	120	21	the	the	DET
bioscience-222	120	22	total	total	ADJ
bioscience-222	120	23	gei	gei	PROPN
bioscience-222	120	24	,	,	PUNCT
bioscience-222	120	25	the	the	DET
bioscience-222	120	26	postdictive	postdictive	ADJ
bioscience-222	120	27	evaluation	evaluation	NOUN
bioscience-222	120	28	suggested	suggest	VERB
bioscience-222	120	29	that	that	SCONJ
bioscience-222	120	30	two	two	NUM
bioscience-222	120	31	axes	axis	NOUN
bioscience-222	120	32	(	(	PUNCT
bioscience-222	120	33	pca1	pca1	NOUN
bioscience-222	120	34	and	and	CCONJ
bioscience-222	120	35	pca2	pca2	PROPN
bioscience-222	120	36	)	)	PUNCT
bioscience-222	120	37	were	be	AUX
bioscience-222	120	38	significant	significant	ADJ
bioscience-222	120	39	for	for	ADP
bioscience-222	120	40	the	the	DET
bioscience-222	120	41	model	model	NOUN
bioscience-222	120	42	with	with	ADP
bioscience-222	120	43	334	334	NUM
bioscience-222	120	44	degrees	degree	NOUN
bioscience-222	120	45	of	of	ADP
bioscience-222	120	46	freedom	freedom	NOUN
bioscience-222	120	47	(	(	PUNCT
bioscience-222	120	48	table	table	NOUN
bioscience-222	120	49	2	2	NUM
bioscience-222	120	50	)	)	PUNCT
bioscience-222	120	51	.	.	PUNCT
bioscience-222	121	1	the	the	DET
bioscience-222	121	2	ammi	ammi	ADJ
bioscience-222	121	3	2	2	NUM
bioscience-222	121	4	biplot	biplot	NOUN
bioscience-222	121	5	analysis	analysis	NOUN
bioscience-222	121	6	for	for	ADP
bioscience-222	121	7	the	the	DET
bioscience-222	121	8	six	six	NUM
bioscience-222	121	9	environments	environment	NOUN
bioscience-222	121	10	is	be	AUX
bioscience-222	121	11	shown	show	VERB
bioscience-222	121	12	in	in	ADP
bioscience-222	121	13	(	(	PUNCT
bioscience-222	121	14	figure	figure	NOUN
bioscience-222	121	15	1	1	NUM
bioscience-222	121	16	(	(	PUNCT
bioscience-222	121	17	b	b	NOUN
bioscience-222	121	18	)	)	PUNCT
bioscience-222	121	19	)	)	PUNCT
bioscience-222	121	20	.	.	PUNCT
bioscience-222	122	1	the	the	DET
bioscience-222	122	2	high	high	ADJ
bioscience-222	122	3	rainfall	rainfall	NOUN
bioscience-222	122	4	environment	environment	NOUN
bioscience-222	122	5	in	in	ADP
bioscience-222	122	6	lattakia	lattakia	PROPN
bioscience-222	122	7	(	(	PUNCT
bioscience-222	122	8	lat09	lat09	NOUN
bioscience-222	122	9	)	)	PUNCT
bioscience-222	122	10	,	,	PUNCT
bioscience-222	122	11	which	which	PRON
bioscience-222	122	12	received	receive	VERB
bioscience-222	122	13	184.5	184.5	NUM
bioscience-222	122	14	mm	mm	NOUN
bioscience-222	122	15	rainfall	rainfall	NOUN
bioscience-222	122	16	after	after	ADP
bioscience-222	122	17	planting	plant	VERB
bioscience-222	122	18	,	,	PUNCT
bioscience-222	122	19	was	be	AUX
bioscience-222	122	20	located	locate	VERB
bioscience-222	122	21	in	in	ADP
bioscience-222	122	22	quadrant	quadrant	PROPN
bioscience-222	122	23	ii	ii	PROPN
bioscience-222	122	24	.	.	PUNCT
bioscience-222	123	1	the	the	DET
bioscience-222	123	2	environments	environment	NOUN
bioscience-222	123	3	th08	th08	PROPN
bioscience-222	123	4	,	,	PUNCT
bioscience-222	123	5	th09	th09	PROPN
bioscience-222	123	6	and	and	CCONJ
bioscience-222	123	7	th10	th10	PROPN
bioscience-222	123	8	were	be	AUX
bioscience-222	123	9	located	locate	VERB
bioscience-222	123	10	in	in	ADP
bioscience-222	123	11	quadrants	quadrant	NOUN
bioscience-222	123	12	iv	iv	NUM
bioscience-222	123	13	,	,	PUNCT
bioscience-222	123	14	iii	iii	NOUN
bioscience-222	123	15	,	,	PUNCT
bioscience-222	123	16	and	and	CCONJ
bioscience-222	123	17	i	i	PROPN
bioscience-222	123	18	,	,	PUNCT
bioscience-222	123	19	respectively	respectively	ADV
bioscience-222	123	20	.	.	PUNCT
bioscience-222	124	1	this	this	DET
bioscience-222	124	2	variation	variation	NOUN
bioscience-222	124	3	is	be	AUX
bioscience-222	124	4	expected	expect	VERB
bioscience-222	124	5	because	because	SCONJ
bioscience-222	124	6	the	the	DET
bioscience-222	124	7	tel	tel	PROPN
bioscience-222	124	8	hadya	hadya	ADJ
bioscience-222	124	9	location	location	NOUN
bioscience-222	124	10	received	receive	VERB
bioscience-222	124	11	different	different	ADJ
bioscience-222	124	12	amounts	amount	NOUN
bioscience-222	124	13	and	and	CCONJ
bioscience-222	124	14	distributions	distribution	NOUN
bioscience-222	124	15	of	of	ADP
bioscience-222	124	16	rainfall	rainfall	NOUN
bioscience-222	124	17	in	in	ADP
bioscience-222	124	18	the	the	DET
bioscience-222	124	19	three	three	NUM
bioscience-222	124	20	growing	grow	VERB
bioscience-222	124	21	table	table	NOUN
bioscience-222	124	22	2	2	NUM
bioscience-222	124	23	.	.	PUNCT
bioscience-222	124	24	anova	anova	PROPN
bioscience-222	124	25	(	(	PUNCT
bioscience-222	124	26	ammi	ammi	PROPN
bioscience-222	124	27	model	model	PROPN
bioscience-222	124	28	)	)	PUNCT
bioscience-222	124	29	for	for	ADP
bioscience-222	124	30	ab	ab	PROPN
bioscience-222	124	31	score	score	NOUN
bioscience-222	124	32	of	of	ADP
bioscience-222	124	33	165	165	NUM
bioscience-222	124	34	rils	ril	NOUN
bioscience-222	124	35	evaluated	evaluate	VERB
bioscience-222	124	36	in	in	ADP
bioscience-222	124	37	six	six	NUM
bioscience-222	124	38	different	different	ADJ
bioscience-222	124	39	environments	environment	NOUN
bioscience-222	124	40	in	in	ADP
bioscience-222	124	41	field	field	NOUN
bioscience-222	124	42	and	and	CCONJ
bioscience-222	124	43	greenhouse	greenhouse	NOUN
bioscience-222	124	44	.	.	PUNCT
bioscience-222	125	1	source	source	NOUN
bioscience-222	125	2	d.f	d.f	PROPN
bioscience-222	125	3	.	.	PROPN
bioscience-222	125	4	s.s	s.s	PROPN
bioscience-222	125	5	.	.	PROPN
bioscience-222	125	6	m.s	m.s	PROPN
bioscience-222	125	7	.	.	PUNCT
bioscience-222	126	1	f	f	PROPN
bioscience-222	126	2	explained	explain	VERB
bioscience-222	126	3	(	(	PUNCT
bioscience-222	126	4	%	%	INTJ
bioscience-222	126	5	)	)	PUNCT
bioscience-222	126	6	genotypes	genotype	NOUN
bioscience-222	126	7	164	164	NUM
bioscience-222	126	8	1774	1774	NUM
bioscience-222	126	9	10.82	10.82	NUM
bioscience-222	126	10	10.37	10.37	NUM
bioscience-222	126	11	*	*	PUNCT
bioscience-222	126	12	*	*	PUNCT
bioscience-222	126	13	*	*	X
bioscience-222	126	14	26.53	26.53	NUM
bioscience-222	126	15	environments	environment	NOUN
bioscience-222	126	16	5	5	NUM
bioscience-222	126	17	1673	1673	NUM
bioscience-222	126	18	334.58	334.58	NUM
bioscience-222	126	19	95.99	95.99	NUM
bioscience-222	126	20	*	*	PUNCT
bioscience-222	126	21	*	*	PUNCT
bioscience-222	126	22	*	*	X
bioscience-222	126	23	25.02	25.02	NUM
bioscience-222	126	24	interactions	interaction	NOUN
bioscience-222	126	25	819	819	NUM
bioscience-222	126	26	2198	2198	NUM
bioscience-222	126	27	2.68	2.68	NUM
bioscience-222	126	28	2.57	2.57	NUM
bioscience-222	126	29	*	*	PUNCT
bioscience-222	126	30	*	*	PUNCT
bioscience-222	126	31	*	*	PROPN
bioscience-222	126	32	32.87	32.87	NUM
bioscience-222	126	33	ipca	ipca	NOUN
bioscience-222	126	34	1	1	NUM
bioscience-222	126	35	168	168	NUM
bioscience-222	126	36	882	882	NUM
bioscience-222	126	37	5.25	5.25	NUM
bioscience-222	126	38	5.03	5.03	NUM
bioscience-222	126	39	*	*	PUNCT
bioscience-222	126	40	*	*	PUNCT
bioscience-222	126	41	*	*	X
bioscience-222	126	42	40.13	40.13	NUM
bioscience-222	126	43	ipca	ipca	NOUN
bioscience-222	126	44	2	2	NUM
bioscience-222	126	45	166	166	NUM
bioscience-222	126	46	602	602	NUM
bioscience-222	126	47	3.63	3.63	NUM
bioscience-222	126	48	3.48	3.48	NUM
bioscience-222	126	49	*	*	PUNCT
bioscience-222	126	50	*	*	PUNCT
bioscience-222	126	51	*	*	X
bioscience-222	126	52	27.39	27.39	NUM
bioscience-222	126	53	ipca	ipca	NOUN
bioscience-222	126	54	3	3	NUM
bioscience-222	126	55	164	164	NUM
bioscience-222	126	56	293	293	NUM
bioscience-222	126	57	1.79	1.79	NUM
bioscience-222	126	58	1.71	1.71	NUM
bioscience-222	126	59	*	*	PUNCT
bioscience-222	126	60	*	*	PUNCT
bioscience-222	126	61	*	*	PROPN
bioscience-222	126	62	13.33	13.33	NUM
bioscience-222	126	63	ipca	ipca	NOUN
bioscience-222	126	64	4	4	NUM
bioscience-222	126	65	162	162	NUM
bioscience-222	126	66	225	225	NUM
bioscience-222	126	67	1.39	1.39	NUM
bioscience-222	126	68	1.33	1.33	NUM
bioscience-222	126	69	error	error	NOUN
bioscience-222	126	70	978	978	NUM
bioscience-222	126	71	1020	1020	NUM
bioscience-222	126	72	1.04	1.04	NUM
bioscience-222	126	73	total	total	NOUN
bioscience-222	126	74	1979	1979	NUM
bioscience-222	126	75	6686	6686	NUM
bioscience-222	126	76	3.38	3.38	NUM
bioscience-222	126	77	*	*	PUNCT
bioscience-222	126	78	*	*	PUNCT
bioscience-222	126	79	*	*	PUNCT
bioscience-222	126	80	highly	highly	ADV
bioscience-222	126	81	significant	significant	ADJ
bioscience-222	126	82	at	at	ADP
bioscience-222	126	83	the	the	DET
bioscience-222	126	84	0.001	0.001	NUM
bioscience-222	126	85	probability	probability	NOUN
bioscience-222	126	86	level	level	NOUN
bioscience-222	126	87	;	;	PUNCT
bioscience-222	126	88	d.f	d.f	NOUN
bioscience-222	126	89	:	:	PUNCT
bioscience-222	126	90	degree	degree	NOUN
bioscience-222	126	91	of	of	ADP
bioscience-222	126	92	freedom	freedom	NOUN
bioscience-222	126	93	,	,	PUNCT
bioscience-222	126	94	f	f	X
bioscience-222	126	95	:	:	PUNCT
bioscience-222	126	96	tabulated	tabulate	VERB
bioscience-222	126	97	frequency	frequency	NOUN
bioscience-222	126	98	.	.	PUNCT
bioscience-222	127	1	seasons	season	NOUN
bioscience-222	127	2	,	,	PUNCT
bioscience-222	127	3	notably	notably	ADV
bioscience-222	127	4	during	during	ADP
bioscience-222	127	5	february	february	PROPN
bioscience-222	127	6	and	and	CCONJ
bioscience-222	127	7	march	march	PROPN
bioscience-222	127	8	when	when	SCONJ
bioscience-222	127	9	the	the	DET
bioscience-222	127	10	temperature	temperature	NOUN
bioscience-222	127	11	is	be	AUX
bioscience-222	127	12	around	around	ADV
bioscience-222	127	13	20	20	NUM
bioscience-222	127	14	oc	oc	NOUN
bioscience-222	127	15	in	in	ADP
bioscience-222	127	16	tel	tel	PROPN
bioscience-222	127	17	hadya	hadya	NOUN
bioscience-222	127	18	(	(	PUNCT
bioscience-222	127	19	th	th	NOUN
bioscience-222	127	20	)	)	PUNCT
bioscience-222	127	21	.	.	PUNCT
bioscience-222	128	1	these	these	DET
bioscience-222	128	2	conditions	condition	NOUN
bioscience-222	128	3	provide	provide	VERB
bioscience-222	128	4	the	the	DET
bioscience-222	128	5	best	good	ADJ
bioscience-222	128	6	environment	environment	NOUN
bioscience-222	128	7	for	for	ADP
bioscience-222	128	8	ab	ab	PROPN
bioscience-222	128	9	disease	disease	PROPN
bioscience-222	128	10	development	development	NOUN
bioscience-222	128	11	.	.	PUNCT
bioscience-222	129	1	the	the	DET
bioscience-222	129	2	environments	environment	NOUN
bioscience-222	129	3	(	(	PUNCT
bioscience-222	129	4	pii-2009	pii-2009	NOUN
bioscience-222	129	5	,	,	PUNCT
bioscience-222	129	6	pii-2010	pii-2010	NOUN
bioscience-222	129	7	,	,	PUNCT
bioscience-222	129	8	th08	th08	PROPN
bioscience-222	129	9	and	and	CCONJ
bioscience-222	129	10	th09	th09	PROPN
bioscience-222	129	11	)	)	PUNCT
bioscience-222	129	12	were	be	AUX
bioscience-222	129	13	located	locate	VERB
bioscience-222	129	14	close	close	ADV
bioscience-222	129	15	to	to	ADP
bioscience-222	129	16	the	the	DET
bioscience-222	129	17	biplot	biplot	NOUN
bioscience-222	129	18	origin	origin	NOUN
bioscience-222	129	19	.	.	PUNCT
bioscience-222	130	1	however	however	ADV
bioscience-222	130	2	,	,	PUNCT
bioscience-222	130	3	one	one	NUM
bioscience-222	130	4	environment	environment	NOUN
bioscience-222	130	5	,	,	PUNCT
bioscience-222	130	6	th10	th10	PROPN
bioscience-222	130	7	(	(	PUNCT
bioscience-222	130	8	located	locate	VERB
bioscience-222	130	9	in	in	ADP
bioscience-222	130	10	quadrant	quadrant	PROPN
bioscience-222	130	11	i	i	PROPN
bioscience-222	130	12	)	)	PUNCT
bioscience-222	130	13	received	receive	VERB
bioscience-222	130	14	75.7	75.7	NUM
bioscience-222	130	15	mm	mm	NOUN
bioscience-222	130	16	of	of	ADP
bioscience-222	130	17	rain	rain	NOUN
bioscience-222	130	18	in	in	ADP
bioscience-222	130	19	2010	2010	NUM
bioscience-222	130	20	,	,	PUNCT
bioscience-222	130	21	only	only	ADV
bioscience-222	130	22	12.4	12.4	NUM
bioscience-222	130	23	mm	mm	NOUN
bioscience-222	130	24	of	of	ADP
bioscience-222	130	25	which	which	PRON
bioscience-222	130	26	was	be	AUX
bioscience-222	130	27	received	receive	VERB
bioscience-222	130	28	in	in	ADP
bioscience-222	130	29	march	march	PROPN
bioscience-222	130	30	,	,	PUNCT
bioscience-222	130	31	the	the	DET
bioscience-222	130	32	most	most	ADV
bioscience-222	130	33	important	important	ADJ
bioscience-222	130	34	time	time	NOUN
bioscience-222	130	35	for	for	ADP
bioscience-222	130	36	the	the	DET
bioscience-222	130	37	ab	ab	PROPN
bioscience-222	130	38	disease	disease	PROPN
bioscience-222	130	39	development	development	NOUN
bioscience-222	130	40	.	.	PUNCT
bioscience-222	131	1	this	this	DET
bioscience-222	131	2	amount	amount	NOUN
bioscience-222	131	3	is	be	AUX
bioscience-222	131	4	50	50	NUM
bioscience-222	131	5	%	%	NOUN
bioscience-222	131	6	lower	low	ADJ
bioscience-222	131	7	than	than	ADP
bioscience-222	131	8	the	the	DET
bioscience-222	131	9	amounts	amount	NOUN
bioscience-222	131	10	received	receive	VERB
bioscience-222	131	11	in	in	ADP
bioscience-222	131	12	2008	2008	NUM
bioscience-222	131	13	and	and	CCONJ
bioscience-222	131	14	2009	2009	NUM
bioscience-222	131	15	.	.	PUNCT
bioscience-222	132	1	mapping	mapping	NOUN
bioscience-222	132	2	and	and	CCONJ
bioscience-222	132	3	qtl	qtl	PROPN
bioscience-222	132	4	analyses	analysis	NOUN
bioscience-222	132	5	of	of	ADP
bioscience-222	132	6	the	the	DET
bioscience-222	132	7	650	650	NUM
bioscience-222	132	8	ssr	ssr	ADJ
bioscience-222	132	9	primer	primer	NOUN
bioscience-222	132	10	pairs	pair	NOUN
bioscience-222	132	11	we	we	PRON
bioscience-222	132	12	tested	test	VERB
bioscience-222	132	13	,	,	PUNCT
bioscience-222	132	14	only	only	ADV
bioscience-222	132	15	134	134	NUM
bioscience-222	132	16	(	(	PUNCT
bioscience-222	132	17	20.6	20.6	NUM
bioscience-222	132	18	%	%	NOUN
bioscience-222	132	19	)	)	PUNCT
bioscience-222	132	20	of	of	ADP
bioscience-222	132	21	the	the	DET
bioscience-222	132	22	primer	primer	NOUN
bioscience-222	132	23	pairs	pair	NOUN
bioscience-222	132	24	produced	produce	VERB
bioscience-222	132	25	different	different	ADJ
bioscience-222	132	26	pcr	pcr	ADJ
bioscience-222	132	27	products	product	NOUN
bioscience-222	132	28	for	for	ADP
bioscience-222	132	29	the	the	DET
bioscience-222	132	30	two	two	NUM
bioscience-222	132	31	parental	parental	ADJ
bioscience-222	132	32	lines	line	NOUN
bioscience-222	132	33	,	,	PUNCT
bioscience-222	132	34	flip98	flip98	PROPN
bioscience-222	132	35	-	-	PUNCT
bioscience-222	132	36	1065	1065	NUM
bioscience-222	132	37	and	and	CCONJ
bioscience-222	132	38	ilc1929	ilc1929	NOUN
bioscience-222	132	39	.	.	PUNCT
bioscience-222	133	1	a	a	DET
bioscience-222	133	2	total	total	NOUN
bioscience-222	133	3	of	of	ADP
bioscience-222	133	4	652	652	NUM
bioscience-222	133	5	dartseq	dartseq	NOUN
bioscience-222	133	6	markers	marker	NOUN
bioscience-222	133	7	and	and	CCONJ
bioscience-222	133	8	612	612	NUM
bioscience-222	133	9	snps	snps	NOUN
bioscience-222	133	10	obtained	obtain	VERB
bioscience-222	133	11	from	from	ADP
bioscience-222	133	12	dart	dart	PROPN
bioscience-222	133	13	pl	pl	PROPN
bioscience-222	133	14	were	be	AUX
bioscience-222	133	15	merged	merge	VERB
bioscience-222	133	16	with	with	ADP
bioscience-222	133	17	134	134	NUM
bioscience-222	133	18	ssr	ssr	ADJ
bioscience-222	133	19	markers	marker	NOUN
bioscience-222	133	20	and	and	CCONJ
bioscience-222	133	21	used	use	VERB
bioscience-222	133	22	to	to	PART
bioscience-222	133	23	develop	develop	VERB
bioscience-222	133	24	the	the	DET
bioscience-222	133	25	genetic	genetic	ADJ
bioscience-222	133	26	map	map	NOUN
bioscience-222	133	27	.	.	PUNCT
bioscience-222	134	1	the	the	DET
bioscience-222	134	2	linkage	linkage	NOUN
bioscience-222	134	3	map	map	NOUN
bioscience-222	134	4	comprised	comprise	VERB
bioscience-222	134	5	1244	1244	NUM
bioscience-222	134	6	markers	marker	NOUN
bioscience-222	134	7	spanning	span	VERB
bioscience-222	134	8	2503	2503	NUM
bioscience-222	134	9	cm	cm	NOUN
bioscience-222	134	10	on	on	ADP
bioscience-222	134	11	eight	eight	NUM
bioscience-222	134	12	lgs	lgs	NOUN
bioscience-222	134	13	(	(	PUNCT
bioscience-222	134	14	table	table	NOUN
bioscience-222	134	15	3	3	NUM
bioscience-222	134	16	)	)	PUNCT
bioscience-222	134	17	.	.	PUNCT
bioscience-222	135	1	the	the	DET
bioscience-222	135	2	distance	distance	NOUN
bioscience-222	135	3	between	between	ADP
bioscience-222	135	4	the	the	DET
bioscience-222	135	5	markers	marker	NOUN
bioscience-222	135	6	was	be	AUX
bioscience-222	135	7	2	2	NUM
bioscience-222	135	8	cm	cm	NOUN
bioscience-222	135	9	on	on	ADP
bioscience-222	135	10	average	average	ADJ
bioscience-222	135	11	;	;	PUNCT
bioscience-222	135	12	however	however	ADV
bioscience-222	135	13	,	,	PUNCT
bioscience-222	135	14	156	156	NUM
bioscience-222	135	15	(	(	PUNCT
bioscience-222	135	16	11.4	11.4	NUM
bioscience-222	135	17	%	%	NOUN
bioscience-222	135	18	)	)	PUNCT
bioscience-222	135	19	of	of	ADP
bioscience-222	135	20	the	the	DET
bioscience-222	135	21	markers	marker	NOUN
bioscience-222	135	22	remained	remain	VERB
bioscience-222	135	23	unlinked	unlinked	ADJ
bioscience-222	135	24	.	.	PUNCT
bioscience-222	136	1	the	the	DET
bioscience-222	136	2	qtl	qtl	PROPN
bioscience-222	136	3	analysis	analysis	NOUN
bioscience-222	136	4	identified	identify	VERB
bioscience-222	136	5	three	three	NUM
bioscience-222	136	6	major	major	ADJ
bioscience-222	136	7	qtl	qtl	PROPN
bioscience-222	136	8	regions	region	NOUN
bioscience-222	136	9	,	,	PUNCT
bioscience-222	136	10	one	one	NUM
bioscience-222	136	11	on	on	ADP
bioscience-222	136	12	lg4	lg4	PROPN
bioscience-222	136	13	and	and	CCONJ
bioscience-222	136	14	two	two	NUM
bioscience-222	136	15	on	on	ADP
bioscience-222	136	16	lg2	lg2	X
bioscience-222	136	17	(	(	PUNCT
bioscience-222	136	18	referred	refer	VERB
bioscience-222	136	19	to	to	ADP
bioscience-222	136	20	as	as	ADP
bioscience-222	136	21	lg2	lg2	X
bioscience-222	136	22	-	-	PUNCT
bioscience-222	136	23	a	a	NOUN
bioscience-222	136	24	and	and	CCONJ
bioscience-222	136	25	lg2	lg2	NOUN
bioscience-222	136	26	-	-	PUNCT
bioscience-222	136	27	b	b	NOUN
bioscience-222	136	28	;	;	PUNCT
bioscience-222	136	29	(	(	PUNCT
bioscience-222	136	30	figure	figure	NOUN
bioscience-222	136	31	2	2	NUM
bioscience-222	136	32	)	)	PUNCT
bioscience-222	136	33	.	.	PUNCT
bioscience-222	137	1	the	the	DET
bioscience-222	137	2	qtl	qtl	PROPN
bioscience-222	137	3	on	on	ADP
bioscience-222	137	4	lg4	lg4	PROPN
bioscience-222	137	5	was	be	AUX
bioscience-222	137	6	consistently	consistently	ADV
bioscience-222	137	7	identified	identify	VERB
bioscience-222	137	8	in	in	ADP
bioscience-222	137	9	all	all	DET
bioscience-222	137	10	six	six	NUM
bioscience-222	137	11	environments	environment	NOUN
bioscience-222	137	12	used	use	VERB
bioscience-222	137	13	in	in	ADP
bioscience-222	137	14	this	this	DET
bioscience-222	137	15	study	study	NOUN
bioscience-222	137	16	and	and	CCONJ
bioscience-222	137	17	was	be	AUX
bioscience-222	137	18	considered	consider	VERB
bioscience-222	137	19	a	a	DET
bioscience-222	137	20	major	major	ADJ
bioscience-222	137	21	qtl	qtl	PROPN
bioscience-222	137	22	,	,	PUNCT
bioscience-222	137	23	explaining	explain	VERB
bioscience-222	137	24	a	a	DET
bioscience-222	137	25	maximum	maximum	NOUN
bioscience-222	137	26	of	of	ADP
bioscience-222	137	27	25	25	NUM
bioscience-222	137	28	%	%	NOUN
bioscience-222	137	29	of	of	ADP
bioscience-222	137	30	the	the	DET
bioscience-222	137	31	total	total	ADJ
bioscience-222	137	32	variation	variation	NOUN
bioscience-222	137	33	at	at	ADP
bioscience-222	137	34	marker	marker	NOUN
bioscience-222	137	35	drt100004682	drt100004682	NOUN
bioscience-222	137	36	.	.	PUNCT
bioscience-222	138	1	the	the	DET
bioscience-222	138	2	two	two	NUM
bioscience-222	138	3	qtls	qtls	NOUN
bioscience-222	138	4	on	on	ADP
bioscience-222	138	5	lg2	lg2	X
bioscience-222	138	6	(	(	PUNCT
bioscience-222	138	7	lg2	lg2	X
bioscience-222	138	8	-	-	PUNCT
bioscience-222	138	9	a	a	NOUN
bioscience-222	138	10	and	and	CCONJ
bioscience-222	138	11	lg2	lg2	NOUN
bioscience-222	138	12	-	-	PUNCT
bioscience-222	138	13	b	b	NOUN
bioscience-222	138	14	)	)	PUNCT
bioscience-222	138	15	were	be	AUX
bioscience-222	138	16	identified	identify	VERB
bioscience-222	138	17	in	in	ADP
bioscience-222	138	18	only	only	ADV
bioscience-222	138	19	the	the	DET
bioscience-222	138	20	three	three	NUM
bioscience-222	138	21	th	th	NOUN
bioscience-222	138	22	field	field	NOUN
bioscience-222	138	23	environments	environment	NOUN
bioscience-222	138	24	(	(	PUNCT
bioscience-222	138	25	th08	th08	PROPN
bioscience-222	138	26	,	,	PUNCT
bioscience-222	138	27	th09	th09	PROPN
bioscience-222	138	28	,	,	PUNCT
bioscience-222	138	29	and	and	CCONJ
bioscience-222	138	30	th10	th10	PROPN
bioscience-222	138	31	)	)	PUNCT
bioscience-222	138	32	and	and	CCONJ
bioscience-222	138	33	explained	explain	VERB
bioscience-222	138	34	a	a	DET
bioscience-222	138	35	maximum	maximum	NOUN
bioscience-222	138	36	of	of	ADP
bioscience-222	138	37	18.5	18.5	NUM
bioscience-222	138	38	%	%	NOUN
bioscience-222	138	39	of	of	ADP
bioscience-222	138	40	the	the	DET
bioscience-222	138	41	total	total	ADJ
bioscience-222	138	42	variation	variation	NOUN
bioscience-222	138	43	at	at	ADP
bioscience-222	138	44	marker	marker	NOUN
bioscience-222	138	45	sn-100021968	sn-100021968	NOUN
bioscience-222	138	46	.	.	PUNCT
bioscience-222	139	1	on	on	ADP
bioscience-222	139	2	lg4	lg4	PROPN
bioscience-222	139	3	,	,	PUNCT
bioscience-222	139	4	36	36	NUM
bioscience-222	139	5	markers	marker	NOUN
bioscience-222	139	6	were	be	AUX
bioscience-222	139	7	located	locate	VERB
bioscience-222	139	8	within	within	ADP
bioscience-222	139	9	the	the	DET
bioscience-222	139	10	qtl	qtl	PROPN
bioscience-222	139	11	region	region	NOUN
bioscience-222	139	12	,	,	PUNCT
bioscience-222	139	13	and	and	CCONJ
bioscience-222	139	14	fifteen	fifteen	NUM
bioscience-222	139	15	of	of	ADP
bioscience-222	139	16	them	they	PRON
bioscience-222	139	17	were	be	AUX
bioscience-222	139	18	tightly	tightly	ADV
bioscience-222	139	19	linked	link	VERB
bioscience-222	139	20	to	to	ADP
bioscience-222	139	21	15	15	NUM
bioscience-222	139	22	genes	gene	NOUN
bioscience-222	139	23	within	within	ADP
bioscience-222	139	24	a	a	DET
bioscience-222	139	25	span	span	NOUN
bioscience-222	139	26	of	of	ADP
bioscience-222	139	27	430,944	430,944	NUM
bioscience-222	139	28	bp	bp	NOUN
bioscience-222	139	29	(	(	PUNCT
bioscience-222	139	30	figure	figure	NOUN
bioscience-222	139	31	3	3	NUM
bioscience-222	139	32	(	(	PUNCT
bioscience-222	139	33	a	a	NOUN
bioscience-222	139	34	)	)	PUNCT
bioscience-222	139	35	)	)	PUNCT
bioscience-222	139	36	.	.	PUNCT
bioscience-222	140	1	the	the	DET
bioscience-222	140	2	qtl	qtl	PROPN
bioscience-222	140	3	lg2	lg2	X
bioscience-222	140	4	-	-	PUNCT
bioscience-222	140	5	a	a	PRON
bioscience-222	140	6	included	include	VERB
bioscience-222	140	7	53	53	NUM
bioscience-222	140	8	markers	marker	NOUN
bioscience-222	140	9	,	,	PUNCT
bioscience-222	140	10	and	and	CCONJ
bioscience-222	140	11	12	12	NUM
bioscience-222	140	12	of	of	ADP
bioscience-222	140	13	them	they	PRON
bioscience-222	140	14	were	be	AUX
bioscience-222	140	15	tightly	tightly	ADV
bioscience-222	140	16	linked	link	VERB
bioscience-222	140	17	to	to	ADP
bioscience-222	140	18	genes	gene	NOUN
bioscience-222	140	19	(	(	PUNCT
bioscience-222	140	20	figure	figure	NOUN
bioscience-222	140	21	3	3	NUM
bioscience-222	140	22	(	(	PUNCT
bioscience-222	140	23	b	b	NOUN
bioscience-222	140	24	)	)	PUNCT
bioscience-222	140	25	)	)	PUNCT
bioscience-222	140	26	.	.	PUNCT
bioscience-222	141	1	the	the	DET
bioscience-222	141	2	qtl	qtl	PROPN
bioscience-222	141	3	lg2	lg2	PROPN
bioscience-222	141	4	-	-	PUNCT
bioscience-222	141	5	b	b	NOUN
bioscience-222	141	6	comprised	comprise	VERB
bioscience-222	141	7	31	31	NUM
bioscience-222	141	8	markers	marker	NOUN
bioscience-222	141	9	,	,	PUNCT
bioscience-222	141	10	seven	seven	NUM
bioscience-222	141	11	of	of	ADP
bioscience-222	141	12	which	which	PRON
bioscience-222	141	13	were	be	AUX
bioscience-222	141	14	linked	link	VERB
bioscience-222	141	15	to	to	ADP
bioscience-222	141	16	genes	gene	NOUN
bioscience-222	141	17	.	.	PUNCT
bioscience-222	142	1	the	the	DET
bioscience-222	142	2	most	most	ADV
bioscience-222	142	3	important	important	ADJ
bioscience-222	142	4	genes	gene	NOUN
bioscience-222	142	5	identified	identify	VERB
bioscience-222	142	6	in	in	ADP
bioscience-222	142	7	the	the	DET
bioscience-222	142	8	three	three	NUM
bioscience-222	142	9	qtl	qtl	PROPN
bioscience-222	142	10	regions	region	NOUN
bioscience-222	142	11	are	be	AUX
bioscience-222	142	12	listed	list	VERB
bioscience-222	142	13	in	in	ADP
bioscience-222	142	14	(	(	PUNCT
bioscience-222	142	15	table	table	NOUN
bioscience-222	142	16	4	4	NUM
bioscience-222	142	17	)	)	PUNCT
bioscience-222	142	18	,	,	PUNCT
bioscience-222	142	19	such	such	ADJ
bioscience-222	142	20	as	as	ADP
bioscience-222	142	21	serine	serine	NOUN
bioscience-222	142	22	/	/	SYM
bioscience-222	142	23	threonine	threonine	ADJ
bioscience-222	142	24	protein	protein	NOUN
bioscience-222	142	25	kinase	kinase	PROPN
bioscience-222	142	26	blus1	blus1	PROPN
bioscience-222	142	27	,	,	PUNCT
bioscience-222	142	28	coiled	coil	VERB
bioscience-222	142	29	-	-	PUNCT
bioscience-222	142	30	coil	coil	NOUN
bioscience-222	142	31	domain	domain	NOUN
bioscience-222	142	32	-	-	PUNCT
bioscience-222	142	33	containing	contain	VERB
bioscience-222	142	34	protein	protein	NOUN
bioscience-222	142	35	,	,	PUNCT
bioscience-222	142	36	transcription	transcription	NOUN
bioscience-222	142	37	factor	factor	NOUN
bioscience-222	142	38	bhlh157	bhlh157	PROPN
bioscience-222	142	39	,	,	PUNCT
bioscience-222	142	40	metalhighlights	metalhighlight	NOUN
bioscience-222	142	41	in	in	ADP
bioscience-222	142	42	bioscience	bioscience	NOUN
bioscience-222	142	43	page	page	NOUN
bioscience-222	142	44	4	4	NUM
bioscience-222	142	45	of	of	ADP
bioscience-222	142	46	11	11	NUM
bioscience-222	142	47	december	december	PROPN
bioscience-222	142	48	2024|volume	2024|volume	NUM
bioscience-222	142	49	7	7	NUM
bioscience-222	142	50	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	142	51	hamwieh	hamwieh	NOUN
bioscience-222	142	52	et	et	PROPN
bioscience-222	142	53	al	al	PROPN
bioscience-222	142	54	.	.	PROPN
bioscience-222	142	55	,	,	PUNCT
bioscience-222	142	56	2024	2024	NUM
bioscience-222	142	57	exploring	explore	VERB
bioscience-222	142	58	qtl	qtl	PROPN
bioscience-222	142	59	genes	gene	NOUN
bioscience-222	142	60	contribute	contribute	VERB
bioscience-222	142	61	to	to	ADP
bioscience-222	142	62	chickpea	chickpea	PROPN
bioscience-222	142	63	ascochyta	ascochyta	NOUN
bioscience-222	142	64	blight	blight	NOUN
bioscience-222	142	65	resistance	resistance	NOUN
bioscience-222	142	66	nicotianamine	nicotianamine	ADV
bioscience-222	142	67	transporter	transporter	VERB
bioscience-222	142	68	ysl1	ysl1	PROPN
bioscience-222	142	69	,	,	PUNCT
bioscience-222	142	70	leucine	leucine	NOUN
bioscience-222	142	71	-	-	PUNCT
bioscience-222	142	72	rich	rich	ADJ
bioscience-222	142	73	repeat	repeat	NOUN
bioscience-222	142	74	receptor	receptor	NOUN
bioscience-222	142	75	-	-	PUNCT
bioscience-222	142	76	like	like	ADJ
bioscience-222	142	77	tyrosine	tyrosine	NOUN
bioscience-222	142	78	-	-	PUNCT
bioscience-222	142	79	protein	protein	NOUN
bioscience-222	142	80	kinase	kinase	NOUN
bioscience-222	142	81	pxc3	pxc3	PROPN
bioscience-222	142	82	,	,	PUNCT
bioscience-222	142	83	tmv	tmv	ADJ
bioscience-222	142	84	resistance	resistance	NOUN
bioscience-222	142	85	protein	protein	NOUN
bioscience-222	142	86	n	n	CCONJ
bioscience-222	142	87	-	-	PUNCT
bioscience-222	142	88	like	like	ADJ
bioscience-222	142	89	,	,	PUNCT
bioscience-222	142	90	chitin	chitin	NOUN
bioscience-222	142	91	elicitor	elicitor	NOUN
bioscience-222	142	92	receptor	receptor	NOUN
bioscience-222	142	93	kinase	kinase	PROPN
bioscience-222	142	94	1	1	NUM
bioscience-222	142	95	-	-	PUNCT
bioscience-222	142	96	like	like	ADJ
bioscience-222	142	97	,	,	PUNCT
bioscience-222	142	98	and	and	CCONJ
bioscience-222	142	99	snf1	snf1	ADJ
bioscience-222	142	100	-	-	PUNCT
bioscience-222	142	101	related	relate	VERB
bioscience-222	142	102	protein	protein	NOUN
bioscience-222	142	103	kinase	kinase	NOUN
bioscience-222	142	104	regulatory	regulatory	ADJ
bioscience-222	142	105	subunit	subunit	NOUN
bioscience-222	142	106	beta-1	beta-1	NUM
bioscience-222	142	107	.	.	PUNCT
bioscience-222	143	1	one	one	NUM
bioscience-222	143	2	ssr	ssr	ADJ
bioscience-222	143	3	marker	marker	NOUN
bioscience-222	143	4	within	within	ADP
bioscience-222	143	5	lg2	lg2	NOUN
bioscience-222	143	6	-	-	PUNCT
bioscience-222	143	7	b	b	NOUN
bioscience-222	143	8	(	(	PUNCT
bioscience-222	143	9	ga16	ga16	PROPN
bioscience-222	143	10	)	)	PUNCT
bioscience-222	143	11	was	be	AUX
bioscience-222	143	12	linked	link	VERB
bioscience-222	143	13	to	to	ADP
bioscience-222	143	14	an	an	DET
bioscience-222	143	15	uncharacterized	uncharacterized	ADJ
bioscience-222	143	16	protein	protein	NOUN
bioscience-222	143	17	and	and	CCONJ
bioscience-222	143	18	explains	explain	VERB
bioscience-222	143	19	a	a	DET
bioscience-222	143	20	maximum	maximum	NOUN
bioscience-222	143	21	of	of	ADP
bioscience-222	143	22	16	16	NUM
bioscience-222	143	23	%	%	NOUN
bioscience-222	143	24	of	of	ADP
bioscience-222	143	25	the	the	DET
bioscience-222	143	26	total	total	ADJ
bioscience-222	143	27	variation	variation	NOUN
bioscience-222	143	28	(	(	PUNCT
bioscience-222	143	29	figure	figure	NOUN
bioscience-222	143	30	3	3	NUM
bioscience-222	143	31	(	(	PUNCT
bioscience-222	143	32	c	c	NOUN
bioscience-222	143	33	)	)	PUNCT
bioscience-222	143	34	)	)	PUNCT
bioscience-222	143	35	.	.	PUNCT
bioscience-222	144	1	table	table	NOUN
bioscience-222	145	1	3	3	NUM
bioscience-222	145	2	.	.	PUNCT
bioscience-222	146	1	summary	summary	NOUN
bioscience-222	146	2	of	of	ADP
bioscience-222	146	3	the	the	DET
bioscience-222	146	4	distribution	distribution	NOUN
bioscience-222	146	5	of	of	ADP
bioscience-222	146	6	markers	marker	NOUN
bioscience-222	146	7	on	on	ADP
bioscience-222	146	8	different	different	ADJ
bioscience-222	146	9	linkage	linkage	NOUN
bioscience-222	146	10	groups	group	NOUN
bioscience-222	146	11	in	in	ADP
bioscience-222	146	12	chickpea	chickpea	NOUN
bioscience-222	146	13	.	.	PUNCT
bioscience-222	147	1	lg	lg	NOUN
bioscience-222	147	2	ssr	ssr	PROPN
bioscience-222	147	3	snp	snp	PROPN
bioscience-222	147	4	dart	dart	NOUN
bioscience-222	147	5	total	total	ADJ
bioscience-222	147	6	length	length	NOUN
bioscience-222	147	7	(	(	PUNCT
bioscience-222	147	8	cm	cm	NOUN
bioscience-222	147	9	)	)	PUNCT
bioscience-222	147	10	lg1	lg1	VERB
bioscience-222	147	11	11	11	NUM
bioscience-222	147	12	214	214	NUM
bioscience-222	147	13	274	274	NUM
bioscience-222	147	14	499	499	NUM
bioscience-222	147	15	1010.1	1010.1	NUM
bioscience-222	147	16	lg2	lg2	CCONJ
bioscience-222	147	17	5	5	NUM
bioscience-222	147	18	83	83	NUM
bioscience-222	147	19	109	109	NUM
bioscience-222	147	20	197	197	NUM
bioscience-222	147	21	201.8	201.8	NUM
bioscience-222	147	22	lg3	lg3	NOUN
bioscience-222	147	23	0	0	NUM
bioscience-222	147	24	29	29	NUM
bioscience-222	147	25	0	0	NUM
bioscience-222	147	26	29	29	NUM
bioscience-222	147	27	166.5	166.5	NUM
bioscience-222	147	28	lg4	lg4	PROPN
bioscience-222	147	29	34	34	NUM
bioscience-222	147	30	34	34	NUM
bioscience-222	147	31	48	48	NUM
bioscience-222	147	32	116	116	NUM
bioscience-222	147	33	287.0	287.0	NUM
bioscience-222	147	34	lg5	lg5	NOUN
bioscience-222	147	35	6	6	NUM
bioscience-222	147	36	38	38	NUM
bioscience-222	147	37	41	41	NUM
bioscience-222	147	38	85	85	NUM
bioscience-222	147	39	156.8	156.8	NUM
bioscience-222	147	40	lg6	lg6	NOUN
bioscience-222	147	41	7	7	NUM
bioscience-222	147	42	48	48	NUM
bioscience-222	147	43	59	59	NUM
bioscience-222	147	44	114	114	NUM
bioscience-222	147	45	180.3	180.3	NUM
bioscience-222	147	46	lg7	lg7	NOUN
bioscience-222	147	47	19	19	NUM
bioscience-222	147	48	40	40	NUM
bioscience-222	147	49	55	55	NUM
bioscience-222	147	50	114	114	NUM
bioscience-222	147	51	293.0	293.0	NUM
bioscience-222	147	52	lg8	lg8	NOUN
bioscience-222	147	53	12	12	NUM
bioscience-222	147	54	28	28	NUM
bioscience-222	147	55	50	50	NUM
bioscience-222	147	56	90	90	NUM
bioscience-222	147	57	207.7	207.7	NUM
bioscience-222	147	58	total	total	NOUN
bioscience-222	147	59	94	94	NUM
bioscience-222	148	1	514	514	NUM
bioscience-222	148	2	636	636	NUM
bioscience-222	148	3	1244	1244	NUM
bioscience-222	148	4	2503.0	2503.0	NUM
bioscience-222	148	5	discussion	discussion	NOUN
bioscience-222	148	6	ascochyta	ascochyta	NOUN
bioscience-222	148	7	blight	blight	NOUN
bioscience-222	148	8	(	(	PUNCT
bioscience-222	148	9	ab	ab	PROPN
bioscience-222	148	10	)	)	PUNCT
bioscience-222	148	11	,	,	PUNCT
bioscience-222	148	12	which	which	PRON
bioscience-222	148	13	is	be	AUX
bioscience-222	148	14	caused	cause	VERB
bioscience-222	148	15	by	by	ADP
bioscience-222	148	16	ascochyta	ascochyta	NOUN
bioscience-222	148	17	rabiei	rabiei	PROPN
bioscience-222	148	18	(	(	PUNCT
bioscience-222	148	19	pass	pass	PROPN
bioscience-222	148	20	.	.	PUNCT
bioscience-222	148	21	)	)	PUNCT
bioscience-222	148	22	labr	labr	NOUN
bioscience-222	148	23	.	.	PUNCT
bioscience-222	149	1	,	,	PUNCT
bioscience-222	149	2	is	be	AUX
bioscience-222	149	3	a	a	DET
bioscience-222	149	4	major	major	ADJ
bioscience-222	149	5	disease	disease	NOUN
bioscience-222	149	6	that	that	PRON
bioscience-222	149	7	limits	limit	VERB
bioscience-222	149	8	chickpea	chickpea	NOUN
bioscience-222	149	9	production	production	NOUN
bioscience-222	149	10	in	in	ADP
bioscience-222	149	11	cool	cool	ADJ
bioscience-222	149	12	and	and	CCONJ
bioscience-222	149	13	humid	humid	ADJ
bioscience-222	149	14	environments	environment	NOUN
bioscience-222	149	15	and	and	CCONJ
bioscience-222	149	16	is	be	AUX
bioscience-222	149	17	the	the	DET
bioscience-222	149	18	largest	large	ADJ
bioscience-222	149	19	contributor	contributor	NOUN
bioscience-222	149	20	to	to	ADP
bioscience-222	149	21	high	high	ADJ
bioscience-222	149	22	yield	yield	NOUN
bioscience-222	149	23	gaps	gap	NOUN
bioscience-222	149	24	in	in	ADP
bioscience-222	149	25	chickpea	chickpea	NOUN
bioscience-222	149	26	production	production	NOUN
bioscience-222	149	27	in	in	ADP
bioscience-222	149	28	many	many	ADJ
bioscience-222	149	29	countries	country	NOUN
bioscience-222	149	30	[	[	X
bioscience-222	149	31	31	31	NUM
bioscience-222	149	32	;	;	PUNCT
bioscience-222	149	33	4	4	NUM
bioscience-222	149	34	]	]	PUNCT
bioscience-222	149	35	.	.	PUNCT
bioscience-222	150	1	we	we	PRON
bioscience-222	150	2	expected	expect	VERB
bioscience-222	150	3	to	to	PART
bioscience-222	150	4	observe	observe	VERB
bioscience-222	150	5	significant	significant	ADJ
bioscience-222	150	6	g	g	PROPN
bioscience-222	150	7	×	×	NOUN
bioscience-222	150	8	e	e	NOUN
bioscience-222	150	9	in	in	ADP
bioscience-222	150	10	this	this	DET
bioscience-222	150	11	study	study	NOUN
bioscience-222	150	12	,	,	PUNCT
bioscience-222	150	13	as	as	SCONJ
bioscience-222	150	14	ab	ab	PROPN
bioscience-222	150	15	severity	severity	NOUN
bioscience-222	150	16	in	in	ADP
bioscience-222	150	17	chickpea	chickpea	NOUN
bioscience-222	150	18	is	be	AUX
bioscience-222	150	19	greatly	greatly	ADV
bioscience-222	150	20	affected	affect	VERB
bioscience-222	150	21	by	by	ADP
bioscience-222	150	22	environmental	environmental	ADJ
bioscience-222	150	23	conditions	condition	NOUN
bioscience-222	150	24	[	[	X
bioscience-222	150	25	32	32	NUM
bioscience-222	150	26	]	]	PUNCT
bioscience-222	150	27	.	.	PUNCT
bioscience-222	151	1	a	a	DET
bioscience-222	151	2	study	study	NOUN
bioscience-222	151	3	by	by	ADP
bioscience-222	151	4	pande	pande	NOUN
bioscience-222	151	5	and	and	CCONJ
bioscience-222	151	6	colleagues	colleague	NOUN
bioscience-222	151	7	[	[	X
bioscience-222	151	8	33	33	NUM
bioscience-222	151	9	]	]	PUNCT
bioscience-222	151	10	revealed	reveal	VERB
bioscience-222	151	11	significant	significant	ADJ
bioscience-222	151	12	genotypic	genotypic	NOUN
bioscience-222	151	13	effects	effect	NOUN
bioscience-222	151	14	and	and	CCONJ
bioscience-222	151	15	g	g	NOUN
bioscience-222	151	16	×	×	NOUN
bioscience-222	151	17	e	e	NOUN
bioscience-222	151	18	interactions	interaction	NOUN
bioscience-222	151	19	in	in	ADP
bioscience-222	151	20	ab	ab	PROPN
bioscience-222	151	21	severity	severity	NOUN
bioscience-222	151	22	.	.	PUNCT
bioscience-222	152	1	however	however	ADV
bioscience-222	152	2	,	,	PUNCT
bioscience-222	152	3	very	very	ADV
bioscience-222	152	4	few	few	ADJ
bioscience-222	152	5	studies	study	NOUN
bioscience-222	152	6	regarding	regard	VERB
bioscience-222	152	7	g	g	PROPN
bioscience-222	152	8	×	×	NOUN
bioscience-222	152	9	e	e	NOUN
bioscience-222	152	10	interactions	interaction	NOUN
bioscience-222	152	11	in	in	ADP
bioscience-222	152	12	ab	ab	PROPN
bioscience-222	152	13	susceptibility	susceptibility	NOUN
bioscience-222	152	14	of	of	ADP
bioscience-222	152	15	chickpea	chickpea	NOUN
bioscience-222	152	16	in	in	ADP
bioscience-222	152	17	multi	multi	ADJ
bioscience-222	152	18	-	-	NOUN
bioscience-222	152	19	environments	environment	NOUN
bioscience-222	152	20	have	have	AUX
bioscience-222	152	21	been	be	AUX
bioscience-222	152	22	reported	report	VERB
bioscience-222	152	23	.	.	PUNCT
bioscience-222	153	1	[	[	X
bioscience-222	153	2	11	11	NUM
bioscience-222	153	3	]	]	PUNCT
bioscience-222	153	4	evaluated	evaluate	VERB
bioscience-222	153	5	106	106	NUM
bioscience-222	153	6	f	f	PROPN
bioscience-222	153	7	6:7	6:7	NUM
bioscience-222	153	8	ril	ril	NOUN
bioscience-222	153	9	population	population	NOUN
bioscience-222	153	10	over	over	ADP
bioscience-222	153	11	two	two	NUM
bioscience-222	153	12	cropping	crop	VERB
bioscience-222	153	13	seasons	season	NOUN
bioscience-222	153	14	under	under	ADP
bioscience-222	153	15	field	field	NOUN
bioscience-222	153	16	conditions	condition	NOUN
bioscience-222	153	17	,	,	PUNCT
bioscience-222	153	18	and	and	CCONJ
bioscience-222	153	19	they	they	PRON
bioscience-222	153	20	identified	identify	VERB
bioscience-222	153	21	a	a	DET
bioscience-222	153	22	significant	significant	ADJ
bioscience-222	153	23	ril	ril	NOUN
bioscience-222	153	24	×	×	NOUN
bioscience-222	153	25	year	year	NOUN
bioscience-222	153	26	interaction	interaction	NOUN
bioscience-222	153	27	,	,	PUNCT
bioscience-222	153	28	which	which	PRON
bioscience-222	153	29	they	they	PRON
bioscience-222	153	30	attributed	attribute	VERB
bioscience-222	153	31	to	to	ADP
bioscience-222	153	32	differences	difference	NOUN
bioscience-222	153	33	between	between	ADP
bioscience-222	153	34	the	the	DET
bioscience-222	153	35	two	two	NUM
bioscience-222	153	36	years	year	NOUN
bioscience-222	153	37	in	in	ADP
bioscience-222	153	38	environmental	environmental	ADJ
bioscience-222	153	39	conditions	condition	NOUN
bioscience-222	153	40	,	,	PUNCT
bioscience-222	153	41	fungus	fungus	NOUN
bioscience-222	153	42	pathotype	pathotype	NOUN
bioscience-222	153	43	,	,	PUNCT
bioscience-222	153	44	or	or	CCONJ
bioscience-222	153	45	both	both	PRON
bioscience-222	153	46	.	.	PUNCT
bioscience-222	154	1	for	for	ADP
bioscience-222	154	2	this	this	DET
bioscience-222	154	3	study	study	NOUN
bioscience-222	154	4	,	,	PUNCT
bioscience-222	154	5	we	we	PRON
bioscience-222	154	6	generated	generate	VERB
bioscience-222	154	7	data	datum	NOUN
bioscience-222	154	8	from	from	ADP
bioscience-222	154	9	six	six	NUM
bioscience-222	154	10	different	different	ADJ
bioscience-222	154	11	environments	environment	NOUN
bioscience-222	154	12	by	by	ADP
bioscience-222	154	13	conducting	conduct	VERB
bioscience-222	154	14	four	four	NUM
bioscience-222	154	15	field	field	NOUN
bioscience-222	154	16	and	and	CCONJ
bioscience-222	154	17	two	two	NUM
bioscience-222	154	18	greenhouse	greenhouse	NOUN
bioscience-222	154	19	experiments	experiment	NOUN
bioscience-222	154	20	over	over	ADP
bioscience-222	154	21	the	the	DET
bioscience-222	154	22	course	course	NOUN
bioscience-222	154	23	of	of	ADP
bioscience-222	154	24	three	three	NUM
bioscience-222	154	25	years	year	NOUN
bioscience-222	154	26	(	(	PUNCT
bioscience-222	154	27	2008	2008	NUM
bioscience-222	154	28	–	–	PUNCT
bioscience-222	154	29	2010	2010	NUM
bioscience-222	154	30	)	)	PUNCT
bioscience-222	154	31	in	in	ADP
bioscience-222	154	32	two	two	NUM
bioscience-222	154	33	locations	location	NOUN
bioscience-222	154	34	(	(	PUNCT
bioscience-222	154	35	tel	tel	X
bioscience-222	154	36	hadya	hadya	NOUN
bioscience-222	154	37	and	and	CCONJ
bioscience-222	154	38	lattakia	lattakia	NOUN
bioscience-222	154	39	)	)	PUNCT
bioscience-222	154	40	.	.	PUNCT
bioscience-222	155	1	these	these	DET
bioscience-222	155	2	environments	environment	NOUN
bioscience-222	155	3	provided	provide	VERB
bioscience-222	155	4	different	different	ADJ
bioscience-222	155	5	moisture	moisture	NOUN
bioscience-222	155	6	conditions	condition	NOUN
bioscience-222	155	7	(	(	PUNCT
bioscience-222	155	8	rainfall	rainfall	NOUN
bioscience-222	155	9	varied	varied	ADJ
bioscience-222	155	10	in	in	ADP
bioscience-222	155	11	amount	amount	NOUN
bioscience-222	155	12	and	and	CCONJ
bioscience-222	155	13	distribution	distribution	NOUN
bioscience-222	155	14	among	among	ADP
bioscience-222	155	15	the	the	DET
bioscience-222	155	16	field	field	NOUN
bioscience-222	155	17	experiments	experiment	NOUN
bioscience-222	155	18	)	)	PUNCT
bioscience-222	155	19	.	.	PUNCT
bioscience-222	156	1	therefore	therefore	ADV
bioscience-222	156	2	,	,	PUNCT
bioscience-222	156	3	our	our	PRON
bioscience-222	156	4	results	result	NOUN
bioscience-222	156	5	will	will	AUX
bioscience-222	156	6	contribute	contribute	VERB
bioscience-222	156	7	to	to	ADP
bioscience-222	156	8	the	the	DET
bioscience-222	156	9	field	field	NOUN
bioscience-222	156	10	’s	’s	PART
bioscience-222	156	11	understanding	understanding	NOUN
bioscience-222	156	12	of	of	ADP
bioscience-222	156	13	gene	gene	NOUN
bioscience-222	156	14	-	-	PUNCT
bioscience-222	156	15	environment	environment	NOUN
bioscience-222	156	16	interactions	interaction	NOUN
bioscience-222	156	17	in	in	ADP
bioscience-222	156	18	ab	ab	PROPN
bioscience-222	156	19	disease	disease	NOUN
bioscience-222	156	20	susceptibility	susceptibility	NOUN
bioscience-222	156	21	.	.	PUNCT
bioscience-222	157	1	as	as	SCONJ
bioscience-222	157	2	indicated	indicate	VERB
bioscience-222	157	3	by	by	ADP
bioscience-222	157	4	[	[	X
bioscience-222	157	5	34	34	NUM
bioscience-222	157	6	]	]	PUNCT
bioscience-222	157	7	and	and	CCONJ
bioscience-222	157	8	[	[	X
bioscience-222	157	9	35	35	NUM
bioscience-222	157	10	]	]	PUNCT
bioscience-222	157	11	,	,	PUNCT
bioscience-222	157	12	the	the	DET
bioscience-222	157	13	results	result	NOUN
bioscience-222	157	14	of	of	ADP
bioscience-222	157	15	the	the	DET
bioscience-222	157	16	ammi	ammi	PROPN
bioscience-222	157	17	analysis	analysis	NOUN
bioscience-222	157	18	can	can	AUX
bioscience-222	157	19	be	be	AUX
bioscience-222	157	20	predicted	predict	VERB
bioscience-222	157	21	by	by	ADP
bioscience-222	157	22	using	use	VERB
bioscience-222	157	23	the	the	DET
bioscience-222	157	24	first	first	ADJ
bioscience-222	157	25	two	two	NUM
bioscience-222	157	26	pcas	pca	NOUN
bioscience-222	157	27	.	.	PUNCT
bioscience-222	158	1	conversely	conversely	ADV
bioscience-222	158	2	,	,	PUNCT
bioscience-222	158	3	the	the	DET
bioscience-222	158	4	g	g	PROPN
bioscience-222	158	5	×	×	PROPN
bioscience-222	158	6	e	e	NOUN
bioscience-222	158	7	-	-	NOUN
bioscience-222	158	8	ss	ss	NOUN
bioscience-222	158	9	(	(	PUNCT
bioscience-222	158	10	sum	sum	NOUN
bioscience-222	158	11	of	of	ADP
bioscience-222	158	12	squares	square	NOUN
bioscience-222	158	13	)	)	PUNCT
bioscience-222	158	14	in	in	ADP
bioscience-222	158	15	our	our	PRON
bioscience-222	158	16	study	study	NOUN
bioscience-222	158	17	was	be	AUX
bioscience-222	158	18	about	about	ADV
bioscience-222	158	19	1.2	1.2	NUM
bioscience-222	158	20	times	time	NOUN
bioscience-222	158	21	higher	high	ADJ
bioscience-222	158	22	than	than	ADP
bioscience-222	158	23	that	that	PRON
bioscience-222	158	24	reported	report	VERB
bioscience-222	158	25	for	for	ADP
bioscience-222	158	26	the	the	DET
bioscience-222	158	27	genotypes	genotype	NOUN
bioscience-222	158	28	,	,	PUNCT
bioscience-222	158	29	and	and	CCONJ
bioscience-222	158	30	this	this	PRON
bioscience-222	158	31	indicates	indicate	VERB
bioscience-222	158	32	substantial	substantial	ADJ
bioscience-222	158	33	differences	difference	NOUN
bioscience-222	158	34	in	in	ADP
bioscience-222	158	35	genotypic	genotypic	ADJ
bioscience-222	158	36	reactions	reaction	NOUN
bioscience-222	158	37	across	across	ADP
bioscience-222	158	38	the	the	DET
bioscience-222	158	39	environments	environment	NOUN
bioscience-222	158	40	we	we	PRON
bioscience-222	158	41	studied	study	VERB
bioscience-222	158	42	.	.	PUNCT
bioscience-222	159	1	the	the	DET
bioscience-222	159	2	results	result	NOUN
bioscience-222	159	3	from	from	ADP
bioscience-222	159	4	our	our	PRON
bioscience-222	159	5	previous	previous	ADJ
bioscience-222	159	6	study	study	NOUN
bioscience-222	159	7	on	on	ADP
bioscience-222	159	8	drought	drought	NOUN
bioscience-222	159	9	tolerance	tolerance	NOUN
bioscience-222	159	10	performance	performance	NOUN
bioscience-222	159	11	of	of	ADP
bioscience-222	159	12	181	181	NUM
bioscience-222	159	13	chickpea	chickpea	NOUN
bioscience-222	159	14	rils	ril	NOUN
bioscience-222	159	15	in	in	ADP
bioscience-222	159	16	nine	nine	NUM
bioscience-222	159	17	environments	environment	NOUN
bioscience-222	159	18	found	find	VERB
bioscience-222	159	19	that	that	SCONJ
bioscience-222	159	20	the	the	DET
bioscience-222	159	21	gei	gei	PROPN
bioscience-222	159	22	-	-	PUNCT
bioscience-222	159	23	ss	ss	PROPN
bioscience-222	159	24	was	be	AUX
bioscience-222	159	25	2.3	2.3	NUM
bioscience-222	159	26	times	time	NOUN
bioscience-222	159	27	more	more	ADJ
bioscience-222	159	28	than	than	ADP
bioscience-222	159	29	that	that	PRON
bioscience-222	159	30	obtained	obtain	VERB
bioscience-222	159	31	for	for	ADP
bioscience-222	159	32	genotype	genotype	NOUN
bioscience-222	159	33	[	[	X
bioscience-222	159	34	22	22	NUM
bioscience-222	159	35	]	]	PUNCT
bioscience-222	159	36	.	.	PUNCT
bioscience-222	160	1	the	the	DET
bioscience-222	160	2	ammi	ammi	PROPN
bioscience-222	160	3	analysis	analysis	NOUN
bioscience-222	160	4	showed	show	VERB
bioscience-222	160	5	significant	significant	ADJ
bioscience-222	160	6	differences	difference	NOUN
bioscience-222	160	7	for	for	ADP
bioscience-222	160	8	all	all	DET
bioscience-222	160	9	genotypes	genotype	NOUN
bioscience-222	160	10	,	,	PUNCT
bioscience-222	160	11	environments	environment	NOUN
bioscience-222	160	12	,	,	PUNCT
bioscience-222	160	13	and	and	CCONJ
bioscience-222	160	14	gei	gei	PROPN
bioscience-222	160	15	.	.	PUNCT
bioscience-222	161	1	furthermore	furthermore	ADV
bioscience-222	161	2	,	,	PUNCT
bioscience-222	161	3	the	the	DET
bioscience-222	161	4	gei	gei	PROPN
bioscience-222	161	5	revealed	reveal	VERB
bioscience-222	161	6	that	that	SCONJ
bioscience-222	161	7	the	the	DET
bioscience-222	161	8	ipca	ipca	NOUN
bioscience-222	161	9	(	(	PUNCT
bioscience-222	161	10	1	1	NUM
bioscience-222	161	11	-	-	SYM
bioscience-222	161	12	3	3	NUM
bioscience-222	161	13	)	)	PUNCT
bioscience-222	161	14	together	together	ADV
bioscience-222	161	15	with	with	ADP
bioscience-222	161	16	the	the	DET
bioscience-222	161	17	ss	ss	NOUN
bioscience-222	161	18	(	(	PUNCT
bioscience-222	161	19	1,777	1,777	NUM
bioscience-222	161	20	)	)	PUNCT
bioscience-222	161	21	was	be	AUX
bioscience-222	161	22	slightly	slightly	ADV
bioscience-222	161	23	larger	large	ADJ
bioscience-222	161	24	than	than	ADP
bioscience-222	161	25	what	what	PRON
bioscience-222	161	26	was	be	AUX
bioscience-222	161	27	obtained	obtain	VERB
bioscience-222	161	28	for	for	ADP
bioscience-222	161	29	the	the	DET
bioscience-222	161	30	genotypes	genotype	NOUN
bioscience-222	161	31	(	(	PUNCT
bioscience-222	161	32	1,774	1,774	NUM
bioscience-222	161	33	)	)	PUNCT
bioscience-222	161	34	,	,	PUNCT
bioscience-222	161	35	suggesting	suggest	VERB
bioscience-222	161	36	that	that	SCONJ
bioscience-222	161	37	the	the	DET
bioscience-222	161	38	ammi	ammi	PROPN
bioscience-222	161	39	model	model	NOUN
bioscience-222	161	40	excluded	exclude	VERB
bioscience-222	161	41	most	most	ADJ
bioscience-222	161	42	of	of	ADP
bioscience-222	161	43	the	the	DET
bioscience-222	161	44	actual	actual	ADJ
bioscience-222	161	45	data	data	NOUN
bioscience-222	161	46	noise	noise	NOUN
bioscience-222	161	47	.	.	PUNCT
bioscience-222	162	1	the	the	DET
bioscience-222	162	2	broad	broad	ADJ
bioscience-222	162	3	-	-	PUNCT
bioscience-222	162	4	sense	sense	NOUN
bioscience-222	162	5	heritability	heritability	NOUN
bioscience-222	162	6	of	of	ADP
bioscience-222	162	7	ab	ab	PROPN
bioscience-222	162	8	resistance	resistance	NOUN
bioscience-222	162	9	in	in	ADP
bioscience-222	162	10	the	the	DET
bioscience-222	162	11	six	six	NUM
bioscience-222	162	12	environments	environment	NOUN
bioscience-222	162	13	in	in	ADP
bioscience-222	162	14	our	our	PRON
bioscience-222	162	15	study	study	NOUN
bioscience-222	162	16	indicates	indicate	VERB
bioscience-222	162	17	high	high	ADJ
bioscience-222	162	18	heritability	heritability	NOUN
bioscience-222	162	19	(	(	PUNCT
bioscience-222	162	20	0.75	0.75	NUM
bioscience-222	162	21	)	)	PUNCT
bioscience-222	162	22	,	,	PUNCT
bioscience-222	162	23	which	which	PRON
bioscience-222	162	24	shows	show	VERB
bioscience-222	162	25	that	that	SCONJ
bioscience-222	162	26	ab	ab	PROPN
bioscience-222	162	27	is	be	AUX
bioscience-222	162	28	controlled	control	VERB
bioscience-222	162	29	by	by	ADP
bioscience-222	162	30	major	major	ADJ
bioscience-222	162	31	genes	gene	NOUN
bioscience-222	162	32	with	with	ADP
bioscience-222	162	33	large	large	ADJ
bioscience-222	162	34	effect	effect	NOUN
bioscience-222	162	35	size	size	NOUN
bioscience-222	162	36	in	in	ADP
bioscience-222	162	37	this	this	DET
bioscience-222	162	38	study	study	NOUN
bioscience-222	162	39	.	.	PUNCT
bioscience-222	163	1	however	however	ADV
bioscience-222	163	2	,	,	PUNCT
bioscience-222	163	3	this	this	PRON
bioscience-222	163	4	is	be	AUX
bioscience-222	163	5	much	much	ADV
bioscience-222	163	6	higher	high	ADJ
bioscience-222	163	7	than	than	ADP
bioscience-222	163	8	the	the	DET
bioscience-222	163	9	heritability	heritability	NOUN
bioscience-222	163	10	values	value	NOUN
bioscience-222	163	11	(	(	PUNCT
bioscience-222	163	12	0.38	0.38	NUM
bioscience-222	163	13	-	-	SYM
bioscience-222	163	14	0.43	0.43	NUM
bioscience-222	163	15	)	)	PUNCT
bioscience-222	163	16	calculated	calculate	VERB
bioscience-222	163	17	in	in	ADP
bioscience-222	163	18	a	a	DET
bioscience-222	163	19	study	study	NOUN
bioscience-222	163	20	of	of	ADP
bioscience-222	163	21	three	three	NUM
bioscience-222	163	22	f2	f2	ADJ
bioscience-222	163	23	populations	population	NOUN
bioscience-222	163	24	derived	derive	VERB
bioscience-222	163	25	from	from	ADP
bioscience-222	163	26	crosses	crosse	NOUN
bioscience-222	163	27	of	of	ADP
bioscience-222	163	28	genotypes	genotype	NOUN
bioscience-222	163	29	that	that	PRON
bioscience-222	163	30	are	be	AUX
bioscience-222	163	31	moderately	moderately	ADV
bioscience-222	163	32	resistant	resistant	ADJ
bioscience-222	163	33	to	to	ADP
bioscience-222	163	34	ab	ab	PROPN
bioscience-222	164	1	[	[	X
bioscience-222	164	2	13	13	NUM
bioscience-222	164	3	]	]	PUNCT
bioscience-222	164	4	.	.	PUNCT
bioscience-222	165	1	this	this	PRON
bioscience-222	165	2	may	may	AUX
bioscience-222	165	3	be	be	AUX
bioscience-222	165	4	attributed	attribute	VERB
bioscience-222	165	5	to	to	ADP
bioscience-222	165	6	our	our	PRON
bioscience-222	165	7	use	use	NOUN
bioscience-222	165	8	of	of	ADP
bioscience-222	165	9	multi	multi	ADJ
bioscience-222	165	10	-	-	ADJ
bioscience-222	165	11	environment	environment	ADJ
bioscience-222	165	12	data	datum	NOUN
bioscience-222	165	13	in	in	ADP
bioscience-222	165	14	our	our	PRON
bioscience-222	165	15	study	study	NOUN
bioscience-222	165	16	.	.	PUNCT
bioscience-222	166	1	although	although	SCONJ
bioscience-222	166	2	several	several	ADJ
bioscience-222	166	3	mapping	mapping	NOUN
bioscience-222	166	4	populations	population	NOUN
bioscience-222	166	5	have	have	AUX
bioscience-222	166	6	been	be	AUX
bioscience-222	166	7	developed	develop	VERB
bioscience-222	166	8	,	,	PUNCT
bioscience-222	166	9	few	few	ADJ
bioscience-222	166	10	maps	map	NOUN
bioscience-222	166	11	have	have	AUX
bioscience-222	166	12	been	be	AUX
bioscience-222	166	13	constructed	construct	VERB
bioscience-222	166	14	using	use	VERB
bioscience-222	166	15	single	single	ADJ
bioscience-222	166	16	nucleotide	nucleotide	ADJ
bioscience-222	166	17	polymorphism	polymorphism	NOUN
bioscience-222	166	18	(	(	PUNCT
bioscience-222	166	19	snp	snp	ADJ
bioscience-222	166	20	)	)	PUNCT
bioscience-222	166	21	markers	marker	NOUN
bioscience-222	166	22	in	in	ADP
bioscience-222	166	23	chickpea	chickpea	NOUN
bioscience-222	166	24	.	.	PUNCT
bioscience-222	167	1	in	in	ADP
bioscience-222	167	2	this	this	DET
bioscience-222	167	3	study	study	NOUN
bioscience-222	167	4	,	,	PUNCT
bioscience-222	167	5	1244	1244	NUM
bioscience-222	167	6	markers	marker	NOUN
bioscience-222	167	7	spanning	span	VERB
bioscience-222	167	8	2503	2503	NUM
bioscience-222	167	9	cm	cm	NOUN
bioscience-222	167	10	were	be	AUX
bioscience-222	167	11	mapped	map	VERB
bioscience-222	167	12	;	;	PUNCT
bioscience-222	167	13	this	this	PRON
bioscience-222	167	14	is	be	AUX
bioscience-222	167	15	much	much	ADV
bioscience-222	167	16	higher	high	ADJ
bioscience-222	167	17	than	than	ADP
bioscience-222	167	18	the	the	DET
bioscience-222	167	19	number	number	NOUN
bioscience-222	167	20	of	of	ADP
bioscience-222	167	21	markers	marker	NOUN
bioscience-222	167	22	used	use	VERB
bioscience-222	167	23	by	by	ADP
bioscience-222	167	24	[	[	X
bioscience-222	167	25	36	36	NUM
bioscience-222	167	26	]	]	X
bioscience-222	167	27	,	,	PUNCT
bioscience-222	167	28	who	who	PRON
bioscience-222	167	29	developed	develop	VERB
bioscience-222	167	30	a	a	DET
bioscience-222	167	31	high	high	ADJ
bioscience-222	167	32	-	-	PUNCT
bioscience-222	167	33	density	density	NOUN
bioscience-222	167	34	map	map	NOUN
bioscience-222	167	35	using	use	VERB
bioscience-222	167	36	150	150	NUM
bioscience-222	167	37	ril	ril	NOUN
bioscience-222	167	38	lines	line	NOUN
bioscience-222	167	39	(	(	PUNCT
bioscience-222	167	40	lasseter	lasseter	PROPN
bioscience-222	167	41	×	×	PROPN
bioscience-222	167	42	icc3996	icc3996	NOUN
bioscience-222	167	43	)	)	PUNCT
bioscience-222	167	44	and	and	CCONJ
bioscience-222	167	45	504	504	NUM
bioscience-222	167	46	polymorphic	polymorphic	ADJ
bioscience-222	167	47	ssrs	ssr	NOUN
bioscience-222	167	48	and	and	CCONJ
bioscience-222	167	49	snps	snps	PROPN
bioscience-222	167	50	.	.	PUNCT
bioscience-222	168	1	we	we	PRON
bioscience-222	168	2	identified	identify	VERB
bioscience-222	168	3	three	three	NUM
bioscience-222	168	4	major	major	ADJ
bioscience-222	168	5	qtl	qtl	PROPN
bioscience-222	168	6	regions	region	NOUN
bioscience-222	168	7	in	in	ADP
bioscience-222	168	8	this	this	DET
bioscience-222	168	9	study	study	NOUN
bioscience-222	168	10	.	.	PUNCT
bioscience-222	169	1	one	one	NUM
bioscience-222	169	2	of	of	ADP
bioscience-222	169	3	these	these	PRON
bioscience-222	169	4	,	,	PUNCT
bioscience-222	169	5	the	the	DET
bioscience-222	169	6	qtl	qtl	PROPN
bioscience-222	169	7	on	on	ADP
bioscience-222	169	8	lg4	lg4	PROPN
bioscience-222	169	9	,	,	PUNCT
bioscience-222	169	10	was	be	AUX
bioscience-222	169	11	consistent	consistent	ADJ
bioscience-222	169	12	across	across	ADP
bioscience-222	169	13	the	the	DET
bioscience-222	169	14	six	six	NUM
bioscience-222	169	15	environments	environment	NOUN
bioscience-222	169	16	used	use	VERB
bioscience-222	169	17	in	in	ADP
bioscience-222	169	18	this	this	DET
bioscience-222	169	19	study	study	NOUN
bioscience-222	169	20	and	and	CCONJ
bioscience-222	169	21	considered	consider	VERB
bioscience-222	169	22	a	a	DET
bioscience-222	169	23	major	major	ADJ
bioscience-222	169	24	qtl	qtl	PROPN
bioscience-222	169	25	/	/	SYM
bioscience-222	169	26	gene(s	gene(s	PROPN
bioscience-222	169	27	)	)	PUNCT
bioscience-222	169	28	that	that	PRON
bioscience-222	169	29	explained	explain	VERB
bioscience-222	169	30	a	a	DET
bioscience-222	169	31	maximum	maximum	NOUN
bioscience-222	169	32	of	of	ADP
bioscience-222	169	33	25	25	NUM
bioscience-222	169	34	%	%	NOUN
bioscience-222	169	35	of	of	ADP
bioscience-222	169	36	the	the	DET
bioscience-222	169	37	total	total	ADJ
bioscience-222	169	38	variation	variation	NOUN
bioscience-222	169	39	at	at	ADP
bioscience-222	169	40	marker	marker	NOUN
bioscience-222	169	41	drt100004682	drt100004682	NOUN
bioscience-222	169	42	.	.	PUNCT
bioscience-222	170	1	a	a	DET
bioscience-222	170	2	qtl	qtl	PROPN
bioscience-222	170	3	on	on	ADP
bioscience-222	170	4	lg4	lg4	PROPN
bioscience-222	170	5	that	that	SCONJ
bioscience-222	170	6	confers	confer	NOUN
bioscience-222	170	7	ab	ab	PROPN
bioscience-222	170	8	resistance	resistance	NOUN
bioscience-222	170	9	has	have	AUX
bioscience-222	170	10	been	be	AUX
bioscience-222	170	11	reported	report	VERB
bioscience-222	170	12	by	by	ADP
bioscience-222	170	13	several	several	ADJ
bioscience-222	170	14	previous	previous	ADJ
bioscience-222	170	15	studies	study	NOUN
bioscience-222	170	16	,	,	PUNCT
bioscience-222	170	17	all	all	PRON
bioscience-222	170	18	of	of	ADP
bioscience-222	170	19	which	which	PRON
bioscience-222	170	20	used	use	VERB
bioscience-222	170	21	relatively	relatively	ADV
bioscience-222	170	22	low	low	ADJ
bioscience-222	170	23	-	-	PUNCT
bioscience-222	170	24	density	density	NOUN
bioscience-222	170	25	maps	map	NOUN
bioscience-222	170	26	with	with	ADP
bioscience-222	170	27	ssr	ssr	ADJ
bioscience-222	170	28	or	or	CCONJ
bioscience-222	170	29	snp	snp	ADJ
bioscience-222	170	30	markers	marker	NOUN
bioscience-222	171	1	[	[	X
bioscience-222	171	2	12	12	NUM
bioscience-222	171	3	;	;	PUNCT
bioscience-222	171	4	13	13	NUM
bioscience-222	171	5	;	;	PUNCT
bioscience-222	171	6	37	37	NUM
bioscience-222	171	7	;	;	PUNCT
bioscience-222	171	8	36	36	NUM
bioscience-222	171	9	]	]	PUNCT
bioscience-222	171	10	.	.	PUNCT
bioscience-222	172	1	for	for	ADP
bioscience-222	172	2	example	example	NOUN
bioscience-222	172	3	,	,	PUNCT
bioscience-222	172	4	[	[	X
bioscience-222	172	5	36	36	NUM
bioscience-222	172	6	]	]	PUNCT
bioscience-222	172	7	used	use	VERB
bioscience-222	172	8	snp	snp	ADJ
bioscience-222	172	9	markers	marker	NOUN
bioscience-222	172	10	to	to	PART
bioscience-222	172	11	identify	identify	VERB
bioscience-222	172	12	a	a	DET
bioscience-222	172	13	qtl	qtl	PROPN
bioscience-222	172	14	conferring	confer	VERB
bioscience-222	172	15	ab	ab	PROPN
bioscience-222	172	16	resistance	resistance	NOUN
bioscience-222	172	17	;	;	PUNCT
bioscience-222	172	18	this	this	DET
bioscience-222	172	19	qtl	qtl	PROPN
bioscience-222	172	20	explained	explain	VERB
bioscience-222	172	21	14	14	NUM
bioscience-222	172	22	-	-	SYM
bioscience-222	172	23	45	45	NUM
bioscience-222	172	24	%	%	NOUN
bioscience-222	172	25	of	of	ADP
bioscience-222	172	26	phenotypic	phenotypic	ADJ
bioscience-222	172	27	variation	variation	NOUN
bioscience-222	172	28	and	and	CCONJ
bioscience-222	172	29	spanned	span	VERB
bioscience-222	172	30	around	around	ADV
bioscience-222	172	31	13	13	NUM
bioscience-222	172	32	mb	mb	NOUN
bioscience-222	172	33	between	between	ADP
bioscience-222	172	34	markers	marker	NOUN
bioscience-222	172	35	ssr	ssr	ADJ
bioscience-222	172	36	ta146	ta146	NOUN
bioscience-222	172	37	and	and	CCONJ
bioscience-222	172	38	snp_40000185	snp_40000185	NUM
bioscience-222	172	39	on	on	ADP
bioscience-222	172	40	lg4	lg4	PROPN
bioscience-222	172	41	.	.	PUNCT
bioscience-222	173	1	we	we	PRON
bioscience-222	173	2	identified	identify	VERB
bioscience-222	173	3	two	two	NUM
bioscience-222	173	4	qtl	qtl	PROPN
bioscience-222	173	5	regions	region	NOUN
bioscience-222	173	6	located	locate	VERB
bioscience-222	173	7	on	on	ADP
bioscience-222	173	8	lg2	lg2	X
bioscience-222	173	9	(	(	PUNCT
bioscience-222	173	10	lg2	lg2	X
bioscience-222	173	11	-	-	PUNCT
bioscience-222	173	12	a	a	NOUN
bioscience-222	173	13	and	and	CCONJ
bioscience-222	173	14	lg2	lg2	NOUN
bioscience-222	173	15	-	-	PUNCT
bioscience-222	173	16	b	b	NOUN
bioscience-222	173	17	)	)	PUNCT
bioscience-222	173	18	,	,	PUNCT
bioscience-222	173	19	but	but	CCONJ
bioscience-222	173	20	they	they	PRON
bioscience-222	173	21	were	be	AUX
bioscience-222	173	22	consistent	consistent	ADJ
bioscience-222	173	23	only	only	ADV
bioscience-222	173	24	among	among	ADP
bioscience-222	173	25	the	the	DET
bioscience-222	173	26	th	th	NUM
bioscience-222	173	27	environments	environment	NOUN
bioscience-222	173	28	across	across	ADP
bioscience-222	173	29	three	three	NUM
bioscience-222	173	30	years	year	NOUN
bioscience-222	173	31	(	(	PUNCT
bioscience-222	173	32	th08	th08	PROPN
bioscience-222	173	33	,	,	PUNCT
bioscience-222	173	34	th09	th09	PROPN
bioscience-222	173	35	,	,	PUNCT
bioscience-222	173	36	and	and	CCONJ
bioscience-222	173	37	th10	th10	PROPN
bioscience-222	173	38	)	)	PUNCT
bioscience-222	173	39	.	.	PUNCT
bioscience-222	174	1	this	this	PRON
bioscience-222	174	2	may	may	AUX
bioscience-222	174	3	indicate	indicate	VERB
bioscience-222	174	4	that	that	SCONJ
bioscience-222	174	5	they	they	PRON
bioscience-222	174	6	contain	contain	VERB
bioscience-222	174	7	genes	gene	NOUN
bioscience-222	174	8	whose	whose	DET
bioscience-222	174	9	impact	impact	NOUN
bioscience-222	174	10	is	be	AUX
bioscience-222	174	11	dependent	dependent	ADJ
bioscience-222	174	12	on	on	ADP
bioscience-222	174	13	environment	environment	NOUN
bioscience-222	174	14	(	(	PUNCT
bioscience-222	174	15	temperature	temperature	NOUN
bioscience-222	174	16	/	/	SYM
bioscience-222	174	17	humidity	humidity	NOUN
bioscience-222	174	18	)	)	PUNCT
bioscience-222	174	19	,	,	PUNCT
bioscience-222	174	20	pathotype	pathotype	NOUN
bioscience-222	174	21	differences	difference	NOUN
bioscience-222	174	22	,	,	PUNCT
bioscience-222	174	23	or	or	CCONJ
bioscience-222	174	24	both	both	PRON
bioscience-222	174	25	,	,	PUNCT
bioscience-222	174	26	as	as	SCONJ
bioscience-222	174	27	the	the	DET
bioscience-222	174	28	plants	plant	NOUN
bioscience-222	174	29	in	in	ADP
bioscience-222	174	30	our	our	PRON
bioscience-222	174	31	greenhouse	greenhouse	NOUN
bioscience-222	174	32	experiments	experiment	NOUN
bioscience-222	174	33	were	be	AUX
bioscience-222	174	34	inoculated	inoculate	VERB
bioscience-222	174	35	with	with	ADP
bioscience-222	174	36	ascochyta	ascochyta	NOUN
bioscience-222	174	37	rabiei	rabiei	PROPN
bioscience-222	174	38	pathotype	pathotype	PROPN
bioscience-222	174	39	ii	ii	PROPN
bioscience-222	174	40	.	.	PUNCT
bioscience-222	175	1	however	however	ADV
bioscience-222	175	2	,	,	PUNCT
bioscience-222	175	3	this	this	PRON
bioscience-222	175	4	may	may	AUX
bioscience-222	175	5	also	also	ADV
bioscience-222	175	6	explain	explain	VERB
bioscience-222	175	7	why	why	SCONJ
bioscience-222	175	8	many	many	ADJ
bioscience-222	175	9	research	research	NOUN
bioscience-222	175	10	teams	team	NOUN
bioscience-222	175	11	have	have	AUX
bioscience-222	175	12	failed	fail	VERB
bioscience-222	175	13	to	to	PART
bioscience-222	175	14	report	report	VERB
bioscience-222	175	15	the	the	DET
bioscience-222	175	16	qtls	qtls	NOUN
bioscience-222	175	17	we	we	PRON
bioscience-222	175	18	found	find	VERB
bioscience-222	175	19	on	on	ADP
bioscience-222	175	20	lg2	lg2	X
bioscience-222	175	21	.	.	PUNCT
bioscience-222	176	1	in	in	ADP
bioscience-222	176	2	this	this	DET
bioscience-222	176	3	study	study	NOUN
bioscience-222	176	4	,	,	PUNCT
bioscience-222	176	5	lg2	lg2	X
bioscience-222	176	6	-	-	PUNCT
bioscience-222	176	7	a	a	NOUN
bioscience-222	176	8	and	and	CCONJ
bioscience-222	176	9	lg2	lg2	NOUN
bioscience-222	176	10	-	-	PUNCT
bioscience-222	176	11	b	b	NOUN
bioscience-222	176	12	contained	contain	VERB
bioscience-222	176	13	33	33	NUM
bioscience-222	176	14	and	and	CCONJ
bioscience-222	176	15	23	23	NUM
bioscience-222	176	16	markers	marker	NOUN
bioscience-222	176	17	spanning	span	VERB
bioscience-222	176	18	28	28	NUM
bioscience-222	176	19	cm	cm	NOUN
bioscience-222	176	20	and	and	CCONJ
bioscience-222	176	21	63.6	63.6	NUM
bioscience-222	176	22	cm	cm	NOUN
bioscience-222	176	23	,	,	PUNCT
bioscience-222	176	24	respectively	respectively	ADV
bioscience-222	176	25	.	.	PUNCT
bioscience-222	177	1	based	base	VERB
bioscience-222	177	2	on	on	ADP
bioscience-222	177	3	ga13	ga13	PROPN
bioscience-222	177	4	as	as	ADP
bioscience-222	177	5	an	an	DET
bioscience-222	177	6	anchor	anchor	NOUN
bioscience-222	177	7	ssr	ssr	ADJ
bioscience-222	177	8	marker	marker	NOUN
bioscience-222	177	9	,	,	PUNCT
bioscience-222	177	10	lg2	lg2	X
bioscience-222	177	11	-	-	PUNCT
bioscience-222	177	12	b	b	NOUN
bioscience-222	177	13	corresponds	correspond	NOUN
bioscience-222	177	14	with	with	ADP
bioscience-222	177	15	the	the	DET
bioscience-222	177	16	qtl	qtl	PROPN
bioscience-222	177	17	that	that	PRON
bioscience-222	177	18	was	be	AUX
bioscience-222	177	19	previously	previously	ADV
bioscience-222	177	20	reported	report	VERB
bioscience-222	177	21	by	by	ADP
bioscience-222	177	22	[	[	PUNCT
bioscience-222	177	23	38	38	NUM
bioscience-222	177	24	]	]	PUNCT
bioscience-222	177	25	,	,	PUNCT
bioscience-222	177	26	[	[	X
bioscience-222	177	27	10	10	NUM
bioscience-222	177	28	]	]	PUNCT
bioscience-222	177	29	,	,	PUNCT
bioscience-222	177	30	and	and	CCONJ
bioscience-222	177	31	[	[	X
bioscience-222	177	32	9	9	NUM
bioscience-222	177	33	]	]	PUNCT
bioscience-222	177	34	.	.	PUNCT
bioscience-222	178	1	this	this	DET
bioscience-222	178	2	qtl	qtl	PROPN
bioscience-222	178	3	in	in	ADP
bioscience-222	178	4	this	this	DET
bioscience-222	178	5	study	study	NOUN
bioscience-222	178	6	could	could	AUX
bioscience-222	178	7	explain	explain	VERB
bioscience-222	178	8	a	a	DET
bioscience-222	178	9	relatively	relatively	ADV
bioscience-222	178	10	large	large	ADJ
bioscience-222	178	11	percentage	percentage	NOUN
bioscience-222	178	12	(	(	PUNCT
bioscience-222	178	13	18.5	18.5	NUM
bioscience-222	178	14	%	%	NOUN
bioscience-222	178	15	)	)	PUNCT
bioscience-222	178	16	of	of	ADP
bioscience-222	178	17	the	the	DET
bioscience-222	178	18	total	total	ADJ
bioscience-222	178	19	estimated	estimate	VERB
bioscience-222	178	20	phenotypic	phenotypic	ADJ
bioscience-222	178	21	variation	variation	NOUN
bioscience-222	178	22	in	in	ADP
bioscience-222	178	23	susceptibility	susceptibility	NOUN
bioscience-222	178	24	to	to	ADP
bioscience-222	178	25	ab	ab	PROPN
bioscience-222	178	26	.	.	PUNCT
bioscience-222	179	1	many	many	ADJ
bioscience-222	179	2	other	other	ADJ
bioscience-222	179	3	qtls	qtls	NOUN
bioscience-222	179	4	associated	associate	VERB
bioscience-222	179	5	with	with	ADP
bioscience-222	179	6	ab	ab	PROPN
bioscience-222	179	7	resistance	resistance	NOUN
bioscience-222	179	8	have	have	AUX
bioscience-222	179	9	been	be	AUX
bioscience-222	179	10	reported	report	VERB
bioscience-222	179	11	on	on	ADP
bioscience-222	179	12	linkage	linkage	NOUN
bioscience-222	179	13	groups	group	NOUN
bioscience-222	179	14	lg3	lg3	VERB
bioscience-222	180	1	[	[	X
bioscience-222	180	2	13	13	NUM
bioscience-222	180	3	]	]	PUNCT
bioscience-222	180	4	,	,	PUNCT
bioscience-222	180	5	lg5	lg5	NOUN
bioscience-222	181	1	[	[	X
bioscience-222	181	2	37	37	NUM
bioscience-222	181	3	]	]	PUNCT
bioscience-222	181	4	,	,	PUNCT
bioscience-222	181	5	lg6	lg6	PROPN
bioscience-222	181	6	[	[	PUNCT
bioscience-222	181	7	13	13	NUM
bioscience-222	181	8	;	;	PUNCT
bioscience-222	181	9	37	37	NUM
bioscience-222	181	10	]	]	PUNCT
bioscience-222	181	11	,	,	PUNCT
bioscience-222	181	12	and	and	CCONJ
bioscience-222	181	13	lg8	lg8	VERB
bioscience-222	182	1	[	[	X
bioscience-222	182	2	12	12	NUM
bioscience-222	182	3	]	]	PUNCT
bioscience-222	182	4	but	but	CCONJ
bioscience-222	182	5	were	be	AUX
bioscience-222	182	6	not	not	PART
bioscience-222	182	7	identified	identify	VERB
bioscience-222	182	8	in	in	ADP
bioscience-222	182	9	our	our	PRON
bioscience-222	182	10	study	study	NOUN
bioscience-222	182	11	.	.	PUNCT
bioscience-222	183	1	a	a	DET
bioscience-222	183	2	total	total	NOUN
bioscience-222	183	3	of	of	ADP
bioscience-222	183	4	eighteen	eighteen	NUM
bioscience-222	183	5	predicted	predict	VERB
bioscience-222	183	6	genes	gene	NOUN
bioscience-222	183	7	were	be	AUX
bioscience-222	183	8	located	locate	VERB
bioscience-222	183	9	in	in	ADP
bioscience-222	183	10	lg4	lg4	PROPN
bioscience-222	183	11	,	,	PUNCT
bioscience-222	183	12	and	and	CCONJ
bioscience-222	183	13	9	9	NUM
bioscience-222	183	14	and	and	CCONJ
bioscience-222	183	15	10	10	NUM
bioscience-222	183	16	predicted	predict	VERB
bioscience-222	183	17	genes	gene	NOUN
bioscience-222	183	18	,	,	PUNCT
bioscience-222	183	19	respectively	respectively	ADV
bioscience-222	183	20	,	,	PUNCT
bioscience-222	183	21	were	be	AUX
bioscience-222	183	22	located	locate	VERB
bioscience-222	183	23	in	in	ADP
bioscience-222	183	24	lg2	lg2	NOUN
bioscience-222	183	25	-	-	PUNCT
bioscience-222	183	26	a	a	NOUN
bioscience-222	183	27	and	and	CCONJ
bioscience-222	183	28	lg2	lg2	NOUN
bioscience-222	183	29	-	-	PUNCT
bioscience-222	183	30	b.	b.	NOUN
bioscience-222	183	31	a	a	DET
bioscience-222	183	32	co	co	ADJ
bioscience-222	183	33	-	-	ADJ
bioscience-222	183	34	dominant	dominant	ADJ
bioscience-222	183	35	scar	scar	NOUN
bioscience-222	183	36	marker	marker	NOUN
bioscience-222	183	37	scy17590	scy17590	NOUN
bioscience-222	183	38	tightly	tightly	ADV
bioscience-222	183	39	linked	link	VERB
bioscience-222	183	40	to	to	ADP
bioscience-222	183	41	qtlar2	qtlar2	PROPN
bioscience-222	183	42	on	on	ADP
bioscience-222	183	43	lg4	lg4	PROPN
bioscience-222	183	44	was	be	AUX
bioscience-222	183	45	reported	report	VERB
bioscience-222	183	46	by	by	ADP
bioscience-222	183	47	[	[	X
bioscience-222	183	48	11	11	NUM
bioscience-222	183	49	]	]	PUNCT
bioscience-222	183	50	and	and	CCONJ
bioscience-222	183	51	was	be	AUX
bioscience-222	183	52	successfully	successfully	ADV
bioscience-222	183	53	used	use	VERB
bioscience-222	183	54	to	to	PART
bioscience-222	183	55	characterize	characterize	VERB
bioscience-222	183	56	ab	ab	PROPN
bioscience-222	183	57	source	source	NOUN
bioscience-222	183	58	[	[	X
bioscience-222	183	59	17	17	NUM
bioscience-222	183	60	]	]	PUNCT
bioscience-222	183	61	.	.	PUNCT
bioscience-222	184	1	however	however	ADV
bioscience-222	184	2	,	,	PUNCT
bioscience-222	184	3	no	no	DET
bioscience-222	184	4	genes	gene	NOUN
bioscience-222	184	5	have	have	VERB
bioscience-222	184	6	highlights	highlight	NOUN
bioscience-222	184	7	in	in	ADP
bioscience-222	184	8	bioscience	bioscience	NOUN
bioscience-222	184	9	page	page	NOUN
bioscience-222	184	10	5	5	NUM
bioscience-222	184	11	of	of	ADP
bioscience-222	184	12	11	11	NUM
bioscience-222	184	13	december	december	PROPN
bioscience-222	184	14	2024|volume	2024|volume	NUM
bioscience-222	184	15	7	7	NUM
bioscience-222	185	1	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	185	2	hamwieh	hamwieh	NOUN
bioscience-222	185	3	et	et	PROPN
bioscience-222	185	4	al	al	PROPN
bioscience-222	185	5	.	.	PROPN
bioscience-222	185	6	,	,	PUNCT
bioscience-222	185	7	2024	2024	NUM
bioscience-222	185	8	exploring	explore	VERB
bioscience-222	185	9	qtl	qtl	PROPN
bioscience-222	185	10	genes	gene	NOUN
bioscience-222	185	11	contribute	contribute	VERB
bioscience-222	185	12	to	to	ADP
bioscience-222	185	13	chickpea	chickpea	PROPN
bioscience-222	185	14	ascochyta	ascochyta	NOUN
bioscience-222	185	15	blight	blight	NOUN
bioscience-222	185	16	resistance	resistance	NOUN
bioscience-222	185	17	figure	figure	NOUN
bioscience-222	185	18	2	2	NUM
bioscience-222	185	19	.	.	PUNCT
bioscience-222	185	20	linkage	linkage	NOUN
bioscience-222	185	21	map	map	NOUN
bioscience-222	185	22	of	of	ADP
bioscience-222	185	23	lg2	lg2	PROPN
bioscience-222	185	24	and	and	CCONJ
bioscience-222	185	25	lg4	lg4	ADJ
bioscience-222	185	26	depicting	depict	VERB
bioscience-222	185	27	qtls	qtls	NOUN
bioscience-222	185	28	for	for	ADP
bioscience-222	185	29	ab	ab	PROPN
bioscience-222	185	30	resistance	resistance	NOUN
bioscience-222	185	31	detected	detect	VERB
bioscience-222	185	32	in	in	ADP
bioscience-222	185	33	a	a	DET
bioscience-222	185	34	ril	ril	PROPN
bioscience-222	185	35	(	(	PUNCT
bioscience-222	185	36	flip98	flip98	PROPN
bioscience-222	185	37	-	-	PUNCT
bioscience-222	185	38	1065	1065	NUM
bioscience-222	185	39	œ	œ	PROPN
bioscience-222	185	40	ilc1929	ilc1929	NOUN
bioscience-222	185	41	)	)	PUNCT
bioscience-222	185	42	mapping	map	VERB
bioscience-222	185	43	population	population	NOUN
bioscience-222	185	44	in	in	ADP
bioscience-222	185	45	chickpea	chickpea	NOUN
bioscience-222	185	46	.	.	PUNCT
bioscience-222	186	1	th	th	NOUN
bioscience-222	186	2	:	:	PUNCT
bioscience-222	186	3	tel	tel	PROPN
bioscience-222	186	4	hadya	hadya	NOUN
bioscience-222	186	5	.	.	PUNCT
bioscience-222	187	1	highlights	highlight	NOUN
bioscience-222	187	2	in	in	ADP
bioscience-222	187	3	bioscience	bioscience	NOUN
bioscience-222	187	4	page	page	NOUN
bioscience-222	187	5	6	6	NUM
bioscience-222	187	6	of	of	ADP
bioscience-222	187	7	11	11	NUM
bioscience-222	187	8	december	december	PROPN
bioscience-222	187	9	2024|volume	2024|volume	NUM
bioscience-222	187	10	7	7	NUM
bioscience-222	187	11	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	187	12	hamwieh	hamwieh	NOUN
bioscience-222	187	13	et	et	PROPN
bioscience-222	187	14	al	al	PROPN
bioscience-222	187	15	.	.	PROPN
bioscience-222	187	16	,	,	PUNCT
bioscience-222	187	17	2024	2024	NUM
bioscience-222	187	18	exploring	explore	VERB
bioscience-222	187	19	qtl	qtl	PROPN
bioscience-222	187	20	genes	gene	NOUN
bioscience-222	187	21	contribute	contribute	VERB
bioscience-222	187	22	to	to	ADP
bioscience-222	187	23	chickpea	chickpea	PROPN
bioscience-222	187	24	ascochyta	ascochyta	NOUN
bioscience-222	187	25	blight	blight	NOUN
bioscience-222	187	26	resistance	resistance	NOUN
bioscience-222	187	27	figure	figure	NOUN
bioscience-222	187	28	3	3	NUM
bioscience-222	187	29	.	.	PUNCT
bioscience-222	188	1	(	(	PUNCT
bioscience-222	188	2	a	a	X
bioscience-222	188	3	)	)	PUNCT
bioscience-222	188	4	genetic	genetic	ADJ
bioscience-222	188	5	and	and	CCONJ
bioscience-222	188	6	physical	physical	ADJ
bioscience-222	188	7	maps	map	NOUN
bioscience-222	188	8	of	of	ADP
bioscience-222	188	9	markers	marker	NOUN
bioscience-222	188	10	on	on	ADP
bioscience-222	188	11	lg4	lg4	PROPN
bioscience-222	188	12	.	.	PUNCT
bioscience-222	189	1	the	the	DET
bioscience-222	189	2	estimated	estimate	VERB
bioscience-222	189	3	genetic	genetic	ADJ
bioscience-222	189	4	distances	distance	NOUN
bioscience-222	189	5	are	be	AUX
bioscience-222	189	6	in	in	ADP
bioscience-222	189	7	centimorgans	centimorgan	NOUN
bioscience-222	189	8	(	(	PUNCT
bioscience-222	189	9	cm	cm	NOUN
bioscience-222	189	10	)	)	PUNCT
bioscience-222	189	11	(	(	PUNCT
bioscience-222	189	12	left	leave	VERB
bioscience-222	189	13	)	)	PUNCT
bioscience-222	189	14	.	.	PUNCT
bioscience-222	190	1	the	the	DET
bioscience-222	190	2	physical	physical	ADJ
bioscience-222	190	3	locations	location	NOUN
bioscience-222	190	4	of	of	ADP
bioscience-222	190	5	mapped	map	VERB
bioscience-222	190	6	markers	marker	NOUN
bioscience-222	190	7	on	on	ADP
bioscience-222	190	8	chromosome	chromosome	NOUN
bioscience-222	190	9	4	4	NUM
bioscience-222	190	10	are	be	AUX
bioscience-222	190	11	shown	show	VERB
bioscience-222	190	12	in	in	ADP
bioscience-222	190	13	base	base	NOUN
bioscience-222	190	14	pairs	pair	NOUN
bioscience-222	190	15	(	(	PUNCT
bioscience-222	190	16	bp	bp	PROPN
bioscience-222	190	17	)	)	PUNCT
bioscience-222	190	18	(	(	PUNCT
bioscience-222	190	19	right	right	NOUN
bioscience-222	190	20	)	)	PUNCT
bioscience-222	190	21	.	.	PUNCT
bioscience-222	191	1	(	(	PUNCT
bioscience-222	191	2	b	b	X
bioscience-222	191	3	)	)	PUNCT
bioscience-222	191	4	genetic	genetic	ADJ
bioscience-222	191	5	and	and	CCONJ
bioscience-222	191	6	physical	physical	ADJ
bioscience-222	191	7	maps	map	NOUN
bioscience-222	191	8	of	of	ADP
bioscience-222	191	9	markers	marker	NOUN
bioscience-222	191	10	on	on	ADP
bioscience-222	191	11	lg2	lg2	NOUN
bioscience-222	191	12	-	-	PUNCT
bioscience-222	191	13	a	a	NOUN
bioscience-222	191	14	,	,	PUNCT
bioscience-222	191	15	one	one	NUM
bioscience-222	191	16	of	of	ADP
bioscience-222	191	17	the	the	DET
bioscience-222	191	18	two	two	NUM
bioscience-222	191	19	major	major	ADJ
bioscience-222	191	20	qtl	qtl	PROPN
bioscience-222	191	21	regions	region	NOUN
bioscience-222	191	22	conferring	confer	VERB
bioscience-222	191	23	ab	ab	PROPN
bioscience-222	191	24	resistance	resistance	NOUN
bioscience-222	191	25	in	in	ADP
bioscience-222	191	26	chickpea	chickpea	NOUN
bioscience-222	191	27	.	.	PUNCT
bioscience-222	192	1	(	(	PUNCT
bioscience-222	192	2	c	c	X
bioscience-222	192	3	)	)	PUNCT
bioscience-222	192	4	genetic	genetic	ADJ
bioscience-222	192	5	and	and	CCONJ
bioscience-222	192	6	physical	physical	ADJ
bioscience-222	192	7	maps	map	NOUN
bioscience-222	192	8	of	of	ADP
bioscience-222	192	9	markers	marker	NOUN
bioscience-222	192	10	on	on	ADP
bioscience-222	192	11	lg2	lg2	X
bioscience-222	192	12	-	-	PUNCT
bioscience-222	192	13	b	b	NOUN
bioscience-222	192	14	,	,	PUNCT
bioscience-222	192	15	the	the	DET
bioscience-222	192	16	second	second	ADJ
bioscience-222	192	17	major	major	ADJ
bioscience-222	192	18	qtl	qtl	PROPN
bioscience-222	192	19	region	region	NOUN
bioscience-222	192	20	conferring	confer	VERB
bioscience-222	192	21	ab	ab	PROPN
bioscience-222	192	22	resistance	resistance	NOUN
bioscience-222	192	23	in	in	ADP
bioscience-222	192	24	chickpea	chickpea	NOUN
bioscience-222	192	25	.	.	PUNCT
bioscience-222	193	1	highlights	highlight	NOUN
bioscience-222	193	2	in	in	ADP
bioscience-222	193	3	bioscience	bioscience	NOUN
bioscience-222	193	4	page	page	NOUN
bioscience-222	193	5	7	7	NUM
bioscience-222	193	6	of	of	ADP
bioscience-222	193	7	11	11	NUM
bioscience-222	193	8	december	december	PROPN
bioscience-222	193	9	2024|volume	2024|volume	NUM
bioscience-222	193	10	7	7	NUM
bioscience-222	193	11	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	193	12	hamwieh	hamwieh	NOUN
bioscience-222	193	13	et	et	PROPN
bioscience-222	193	14	al	al	PROPN
bioscience-222	193	15	.	.	PROPN
bioscience-222	193	16	,	,	PUNCT
bioscience-222	193	17	2024	2024	NUM
bioscience-222	193	18	exploring	explore	VERB
bioscience-222	193	19	qtl	qtl	PROPN
bioscience-222	193	20	genes	gene	NOUN
bioscience-222	193	21	contribute	contribute	VERB
bioscience-222	193	22	to	to	ADP
bioscience-222	193	23	chickpea	chickpea	PROPN
bioscience-222	193	24	ascochyta	ascochyta	NOUN
bioscience-222	193	25	blight	blight	NOUN
bioscience-222	193	26	resistance	resistance	NOUN
bioscience-222	193	27	table	table	NOUN
bioscience-222	193	28	4	4	NUM
bioscience-222	193	29	.	.	PUNCT
bioscience-222	194	1	markers	marker	NOUN
bioscience-222	194	2	on	on	ADP
bioscience-222	194	3	lg4	lg4	PROPN
bioscience-222	194	4	significantly	significantly	ADV
bioscience-222	194	5	associated	associate	VERB
bioscience-222	194	6	with	with	ADP
bioscience-222	194	7	ab	ab	PROPN
bioscience-222	194	8	resistance	resistance	NOUN
bioscience-222	194	9	across	across	ADP
bioscience-222	194	10	six	six	NUM
bioscience-222	194	11	environments	environment	NOUN
bioscience-222	194	12	.	.	PUNCT
bioscience-222	195	1	marker	marker	NOUN
bioscience-222	195	2	/	/	SYM
bioscience-222	195	3	sequence	sequence	NOUN
bioscience-222	195	4	position	position	NOUN
bioscience-222	195	5	env	env	PROPN
bioscience-222	195	6	.	.	PUNCT
bioscience-222	196	1	code	code	PROPN
bioscience-222	196	2	lod	lod	PROPN
bioscience-222	196	3	variance	variance	NOUN
bioscience-222	196	4	%	%	NOUN
bioscience-222	196	5	expl	expl	NOUN
bioscience-222	196	6	.	.	PUNCT
bioscience-222	197	1	additive	additive	ADJ
bioscience-222	197	2	marker	marker	NOUN
bioscience-222	197	3	gene	gene	NOUN
bioscience-222	197	4	linkage	linkage	NOUN
bioscience-222	197	5	sn-100024987	sn-100024987	NOUN
bioscience-222	197	6	lat-09	lat-09	ADP
bioscience-222	197	7	7.3	7.3	NUM
bioscience-222	197	8	2.37	2.37	NUM
bioscience-222	197	9	18.4	18.4	NUM
bioscience-222	197	10	-0.73	-0.73	ADP
bioscience-222	197	11	serine	serine	NOUN
bioscience-222	197	12	/	/	SYM
bioscience-222	197	13	threonine	threonine	ADJ
bioscience-222	197	14	protein	protein	NOUN
bioscience-222	197	15	kinase	kinase	PROPN
bioscience-222	197	16	blus1	blus1	PROPN
bioscience-222	197	17	pii-2009	pii-2009	NOUN
bioscience-222	197	18	5.97	5.97	NUM
bioscience-222	197	19	0.86	0.86	NUM
bioscience-222	197	20	15.3	15.3	NUM
bioscience-222	197	21	-0.40	-0.40	NOUN
bioscience-222	197	22	(	(	PUNCT
bioscience-222	197	23	snp	snp	ADJ
bioscience-222	197	24	is	be	AUX
bioscience-222	197	25	located	locate	VERB
bioscience-222	197	26	within	within	ADP
bioscience-222	197	27	the	the	DET
bioscience-222	197	28	gene	gene	NOUN
bioscience-222	197	29	)	)	PUNCT
bioscience-222	197	30	pii-2010	pii-2010	NOUN
bioscience-222	197	31	4.16	4.16	NUM
bioscience-222	197	32	2.04	2.04	NUM
bioscience-222	197	33	11.0	11.0	NUM
bioscience-222	197	34	-0.50	-0.50	NUM
bioscience-222	197	35	th-08	th-08	NUM
bioscience-222	197	36	3.08	3.08	NUM
bioscience-222	197	37	0.77	0.77	NUM
bioscience-222	197	38	8.2	8.2	NUM
bioscience-222	197	39	-0.26	-0.26	NOUN
bioscience-222	197	40	th-09	th-09	VERB
bioscience-222	197	41	7.03	7.03	NUM
bioscience-222	197	42	1.49	1.49	NUM
bioscience-222	197	43	17.8	17.8	NUM
bioscience-222	197	44	-0.57	-0.57	NOUN
bioscience-222	197	45	th-10	th-10	NOUN
bioscience-222	197	46	2.14	2.14	NUM
bioscience-222	197	47	2.98	2.98	NUM
bioscience-222	197	48	5.8	5.8	NUM
bioscience-222	197	49	-0.43	-0.43	NUM
bioscience-222	197	50	sn-5825578	sn-5825578	PROPN
bioscience-222	197	51	lat-09	lat-09	ADP
bioscience-222	197	52	7.28	7.28	NUM
bioscience-222	197	53	2.37	2.37	NUM
bioscience-222	197	54	18.4	18.4	NUM
bioscience-222	197	55	-0.73	-0.73	ADP
bioscience-222	197	56	coiled	coil	VERB
bioscience-222	197	57	-	-	PUNCT
bioscience-222	197	58	coil	coil	NOUN
bioscience-222	197	59	domain	domain	NOUN
bioscience-222	197	60	-	-	PUNCT
bioscience-222	197	61	containing	contain	VERB
bioscience-222	197	62	protein	protein	NOUN
bioscience-222	197	63	pii-2009	pii-2009	NOUN
bioscience-222	197	64	5.91	5.91	NUM
bioscience-222	197	65	0.87	0.87	NUM
bioscience-222	197	66	15.2	15.2	NUM
bioscience-222	197	67	-0.39	-0.39	NOUN
bioscience-222	197	68	(	(	PUNCT
bioscience-222	197	69	snp	snp	ADJ
bioscience-222	197	70	is	be	AUX
bioscience-222	197	71	located	locate	VERB
bioscience-222	197	72	within	within	ADP
bioscience-222	197	73	the	the	DET
bioscience-222	197	74	gene	gene	NOUN
bioscience-222	197	75	)	)	PUNCT
bioscience-222	197	76	pii-2010	pii-2010	NOUN
bioscience-222	197	77	4.14	4.14	NUM
bioscience-222	197	78	2.04	2.04	NUM
bioscience-222	197	79	10.9	10.9	NUM
bioscience-222	197	80	-0.50	-0.50	NUM
bioscience-222	197	81	th-08	th-08	NUM
bioscience-222	197	82	3.08	3.08	NUM
bioscience-222	197	83	0.77	0.77	NUM
bioscience-222	197	84	8.2	8.2	NUM
bioscience-222	197	85	-0.26	-0.26	NOUN
bioscience-222	197	86	th-09	th-09	ADJ
bioscience-222	197	87	7.02	7.02	NUM
bioscience-222	197	88	1.49	1.49	NUM
bioscience-222	197	89	17.8	17.8	NUM
bioscience-222	197	90	-0.57	-0.57	NOUN
bioscience-222	197	91	th-10	th-10	NOUN
bioscience-222	197	92	2.15	2.15	NUM
bioscience-222	197	93	2.97	2.97	NUM
bioscience-222	197	94	5.8	5.8	NUM
bioscience-222	197	95	-0.43	-0.43	NUM
bioscience-222	197	96	sn-5825139	sn-5825139	NOUN
bioscience-222	197	97	lat-09	lat-09	ADP
bioscience-222	197	98	7.12	7.12	NUM
bioscience-222	197	99	2.38	2.38	NUM
bioscience-222	197	100	18.0	18.0	NUM
bioscience-222	197	101	-0.72	-0.72	NOUN
bioscience-222	197	102	transcription	transcription	NOUN
bioscience-222	197	103	factor	factor	NOUN
bioscience-222	197	104	bhlh157	bhlh157	PROPN
bioscience-222	197	105	pii-2009	pii-2009	NOUN
bioscience-222	197	106	5.12	5.12	NUM
bioscience-222	197	107	0.89	0.89	NUM
bioscience-222	197	108	13.3	13.3	NUM
bioscience-222	197	109	-0.37	-0.37	NUM
bioscience-222	197	110	(	(	PUNCT
bioscience-222	197	111	snp	snp	ADJ
bioscience-222	197	112	is	be	AUX
bioscience-222	197	113	located	locate	VERB
bioscience-222	197	114	within	within	ADP
bioscience-222	197	115	the	the	DET
bioscience-222	197	116	gene	gene	NOUN
bioscience-222	197	117	)	)	PUNCT
bioscience-222	197	118	pii-2010	pii-2010	NOUN
bioscience-222	197	119	4.02	4.02	NUM
bioscience-222	197	120	2.05	2.05	NUM
bioscience-222	197	121	10.6	10.6	NUM
bioscience-222	197	122	-0.49	-0.49	NOUN
bioscience-222	197	123	th-08	th-08	NOUN
bioscience-222	197	124	3.29	3.29	NUM
bioscience-222	197	125	0.76	0.76	NUM
bioscience-222	197	126	8.8	8.8	NUM
bioscience-222	197	127	-0.27	-0.27	NOUN
bioscience-222	197	128	th-09	th-09	X
bioscience-222	197	129	6.94	6.94	NUM
bioscience-222	197	130	1.50	1.50	NUM
bioscience-222	197	131	17.6	17.6	NUM
bioscience-222	197	132	-0.57	-0.57	NOUN
bioscience-222	197	133	th-10	th-10	NUM
bioscience-222	197	134	2.36	2.36	NUM
bioscience-222	197	135	2.96	2.96	NUM
bioscience-222	197	136	6.4	6.4	NUM
bioscience-222	197	137	-0.45	-0.45	NUM
bioscience-222	197	138	drt-100004682	drt-100004682	NOUN
bioscience-222	197	139	lat-09	lat-09	ADP
bioscience-222	197	140	10.52	10.52	NUM
bioscience-222	197	141	2.17	2.17	NUM
bioscience-222	197	142	25.5	25.5	NUM
bioscience-222	197	143	0.87	0.87	NUM
bioscience-222	197	144	na	na	ADP
bioscience-222	197	145	pii-2009	pii-2009	NOUN
bioscience-222	197	146	7.20	7.20	NUM
bioscience-222	197	147	0.84	0.84	NUM
bioscience-222	197	148	18.2	18.2	NUM
bioscience-222	197	149	0.43	0.43	NUM
bioscience-222	197	150	pii-2010	pii-2010	NOUN
bioscience-222	197	151	4.66	4.66	NUM
bioscience-222	197	152	2.02	2.02	NUM
bioscience-222	197	153	12.2	12.2	NUM
bioscience-222	197	154	0.53	0.53	NUM
bioscience-222	197	155	th-08	th-08	NUM
bioscience-222	197	156	3.92	3.92	NUM
bioscience-222	197	157	0.75	0.75	NUM
bioscience-222	197	158	10.4	10.4	NUM
bioscience-222	197	159	0.30	0.30	NUM
bioscience-222	197	160	th-09	th-09	NUM
bioscience-222	197	161	7.55	7.55	NUM
bioscience-222	197	162	1.47	1.47	NUM
bioscience-222	197	163	19.0	19.0	NUM
bioscience-222	197	164	0.59	0.59	NUM
bioscience-222	197	165	th-10	th-10	NUM
bioscience-222	197	166	2.38	2.38	NUM
bioscience-222	197	167	2.96	2.96	NUM
bioscience-222	197	168	6.4	6.4	NUM
bioscience-222	197	169	0.45	0.45	NUM
bioscience-222	197	170	sn-5826150	sn-5826150	NOUN
bioscience-222	197	171	lat-09	lat-09	ADP
bioscience-222	197	172	6.95	6.95	NUM
bioscience-222	197	173	2.39	2.39	NUM
bioscience-222	197	174	17.6	17.6	NUM
bioscience-222	197	175	-0.72	-0.72	NOUN
bioscience-222	197	176	na	na	NOUN
bioscience-222	197	177	pii-2009	pii-2009	NOUN
bioscience-222	197	178	5.25	5.25	NUM
bioscience-222	197	179	0.88	0.88	NUM
bioscience-222	197	180	13.6	13.6	NUM
bioscience-222	197	181	-0.37	-0.37	NUM
bioscience-222	197	182	pii-2010	pii-2010	NOUN
bioscience-222	197	183	4.10	4.10	NUM
bioscience-222	197	184	2.05	2.05	NUM
bioscience-222	197	185	10.8	10.8	NUM
bioscience-222	197	186	-0.50	-0.50	NUM
bioscience-222	197	187	th-08	th-08	NOUN
bioscience-222	197	188	3.44	3.44	NUM
bioscience-222	197	189	0.76	0.76	NUM
bioscience-222	197	190	9.1	9.1	NUM
bioscience-222	197	191	-0.28	-0.28	NOUN
bioscience-222	197	192	th-09	th-09	ADP
bioscience-222	197	193	6.90	6.90	NUM
bioscience-222	197	194	1.50	1.50	NUM
bioscience-222	197	195	17.5	17.5	NUM
bioscience-222	197	196	-0.56	-0.56	NUM
bioscience-222	197	197	th-10	th-10	NUM
bioscience-222	197	198	2.17	2.17	NUM
bioscience-222	197	199	2.97	2.97	NUM
bioscience-222	197	200	5.9	5.9	NUM
bioscience-222	197	201	-0.43	-0.43	NOUN
bioscience-222	197	202	na	na	NOUN
bioscience-222	197	203	:	:	PUNCT
bioscience-222	197	204	gene	gene	NOUN
bioscience-222	197	205	/	/	SYM
bioscience-222	197	206	position	position	NOUN
bioscience-222	197	207	is	be	AUX
bioscience-222	197	208	not	not	PART
bioscience-222	197	209	available	available	ADJ
bioscience-222	197	210	table	table	NOUN
bioscience-222	197	211	5	5	NUM
bioscience-222	197	212	.	.	PUNCT
bioscience-222	197	213	sequence	sequence	NOUN
bioscience-222	197	214	and	and	CCONJ
bioscience-222	197	215	position	position	NOUN
bioscience-222	197	216	on	on	ADP
bioscience-222	197	217	lg4	lg4	PROPN
bioscience-222	197	218	of	of	ADP
bioscience-222	197	219	snp	snp	ADJ
bioscience-222	197	220	markers	marker	NOUN
bioscience-222	197	221	significantly	significantly	ADV
bioscience-222	197	222	associated	associate	VERB
bioscience-222	197	223	with	with	ADP
bioscience-222	197	224	ab	ab	PROPN
bioscience-222	197	225	resistance	resistance	NOUN
bioscience-222	197	226	.	.	PUNCT
bioscience-222	198	1	marker	marker	NOUN
bioscience-222	198	2	snp	snp	PROPN
bioscience-222	198	3	position	position	NOUN
bioscience-222	198	4	sequence	sequence	NOUN
bioscience-222	198	5	sn-100024987	sn-100024987	NOUN
bioscience-222	198	6	50	50	NUM
bioscience-222	198	7	:	:	PUNCT
bioscience-222	198	8	t	t	PROPN
bioscience-222	198	9	>	>	X
bioscience-222	198	10	g	g	PROPN
bioscience-222	198	11	4113008	4113008	NUM
bioscience-222	198	12	tgcagaacaagaagcaatatctcaggtataacttatattcaatttttatc(t/	tgcagaacaagaagcaatatctcaggtataacttatattcaatttttatc(t/	NOUN
bioscience-222	198	13	g)gtcataaaatgtgctata	g)gtcataaaatgtgctata	PUNCT
bioscience-222	198	14	sn-5825578	sn-5825578	PROPN
bioscience-222	198	15	24	24	NUM
bioscience-222	198	16	:	:	SYM
bioscience-222	198	17	t	t	PROPN
bioscience-222	198	18	>	>	X
bioscience-222	198	19	c	c	PROPN
bioscience-222	198	20	3997422	3997422	NUM
bioscience-222	198	21	tgcagtgcttcctaaattcgaaga(c/	tgcagtgcttcctaaattcgaaga(c/	NUM
bioscience-222	198	22	t)cctgtttctgttcctgagcctgaacctgaaactcaacctaagga	t)cctgtttctgttcctgagcctgaacctgaaactcaacctaagga	PROPN
bioscience-222	198	23	sn-5825139	sn-5825139	NOUN
bioscience-222	198	24	55	55	NUM
bioscience-222	198	25	:	:	PUNCT
bioscience-222	198	26	g	g	NOUN
bioscience-222	198	27	>	>	X
bioscience-222	198	28	a	a	DET
bioscience-222	198	29	4048029	4048029	NUM
bioscience-222	198	30	tgcagaaagaaaggaaattctcaagtaataagtgaactaaaaacaagag(a/	tgcagaaagaaaggaaattctcaagtaataagtgaactaaaaacaagag(a/	PROPN
bioscience-222	198	31	g)aattgaaatataaaattag	g)aattgaaatataaaattag	PROPN
bioscience-222	198	32	sn-5826150	sn-5826150	PROPN
bioscience-222	198	33	6	6	NUM
bioscience-222	198	34	:	:	SYM
bioscience-222	198	35	c	c	X
bioscience-222	198	36	>	>	X
bioscience-222	198	37	g	g	NOUN
bioscience-222	198	38	4113005	4113005	NUM
bioscience-222	198	39	tgcaga(g/	tgcaga(g/	NOUN
bioscience-222	198	40	c)ggcattctcttcagtgctagttgtgcagcatctttacagatcggaagagcggtttcagcagga	c)ggcattctcttcagtgctagttgtgcagcatctttacagatcggaagagcggtttcagcagga	PROPN
bioscience-222	198	41	sn-100053539	sn-100053539	PROPN
bioscience-222	198	42	5	5	NUM
bioscience-222	198	43	:	:	SYM
bioscience-222	198	44	t	t	PROPN
bioscience-222	198	45	>	>	X
bioscience-222	198	46	c	c	PROPN
bioscience-222	198	47	4168916	4168916	NUM
bioscience-222	198	48	tgcag(c/	tgcag(c/	NOUN
bioscience-222	198	49	t)gggtgacgcagttatagtttacaacgttatggtgttagtgaatggttgaaattattttacaga	t)gggtgacgcagttatagtttacaacgttatggtgttagtgaatggttgaaattattttacaga	NOUN
bioscience-222	198	50	sn-5825294	sn-5825294	NOUN
bioscience-222	198	51	11	11	NUM
bioscience-222	198	52	:	:	PUNCT
bioscience-222	198	53	c	c	X
bioscience-222	198	54	>	>	X
bioscience-222	198	55	g	g	NOUN
bioscience-222	198	56	4167416	4167416	NUM
bioscience-222	198	57	tgcagcaaact(g/	tgcagcaaact(g/	NOUN
bioscience-222	198	58	c)tgaaaaaataaagtaagagaagttctaaggttctatgaaaaaataataatgtatatt	c)tgaaaaaataaagtaagagaagttctaaggttctatgaaaaaataataatgtatatt	PROPN
bioscience-222	198	59	been	be	AUX
bioscience-222	198	60	reported	report	VERB
bioscience-222	198	61	as	as	ADP
bioscience-222	198	62	genes	gene	NOUN
bioscience-222	198	63	associated	associate	VERB
bioscience-222	198	64	with	with	ADP
bioscience-222	198	65	ab	ab	PROPN
bioscience-222	198	66	resistance	resistance	NOUN
bioscience-222	198	67	on	on	ADP
bioscience-222	198	68	lg4	lg4	PROPN
bioscience-222	198	69	.	.	PUNCT
bioscience-222	199	1	in	in	ADP
bioscience-222	199	2	this	this	DET
bioscience-222	199	3	study	study	NOUN
bioscience-222	199	4	,	,	PUNCT
bioscience-222	199	5	we	we	PRON
bioscience-222	199	6	found	find	VERB
bioscience-222	199	7	the	the	DET
bioscience-222	199	8	genes	gene	NOUN
bioscience-222	199	9	annotated	annotate	VERB
bioscience-222	199	10	as	as	ADP
bioscience-222	199	11	leucine	leucine	NOUN
bioscience-222	199	12	-	-	PUNCT
bioscience-222	199	13	rich	rich	ADJ
bioscience-222	199	14	repeat	repeat	NOUN
bioscience-222	199	15	receptor	receptor	NOUN
bioscience-222	199	16	-	-	PUNCT
bioscience-222	199	17	like	like	ADJ
bioscience-222	199	18	tyrosine	tyrosine	NOUN
bioscience-222	199	19	-	-	PUNCT
bioscience-222	199	20	protein	protein	NOUN
bioscience-222	199	21	kinase	kinase	NOUN
bioscience-222	199	22	pxc3	pxc3	PROPN
bioscience-222	199	23	,	,	PUNCT
bioscience-222	199	24	tmv	tmv	ADJ
bioscience-222	199	25	resistance	resistance	NOUN
bioscience-222	199	26	protein	protein	NOUN
bioscience-222	199	27	n	n	CCONJ
bioscience-222	199	28	-	-	PUNCT
bioscience-222	199	29	like	like	ADJ
bioscience-222	199	30	,	,	PUNCT
bioscience-222	199	31	chitin	chitin	NOUN
bioscience-222	199	32	elicitor	elicitor	NOUN
bioscience-222	199	33	receptor	receptor	NOUN
bioscience-222	199	34	kinase	kinase	PROPN
bioscience-222	200	1	1	1	NUM
bioscience-222	200	2	-	-	PUNCT
bioscience-222	200	3	like	like	ADJ
bioscience-222	200	4	,	,	PUNCT
bioscience-222	200	5	histidine	histidine	ADJ
bioscience-222	200	6	kinase	kinase	NOUN
bioscience-222	200	7	2	2	NUM
bioscience-222	200	8	,	,	PUNCT
bioscience-222	200	9	probable	probable	ADJ
bioscience-222	200	10	l	l	ADJ
bioscience-222	200	11	-	-	PUNCT
bioscience-222	200	12	type	type	NOUN
bioscience-222	200	13	lectin	lectin	NOUN
bioscience-222	200	14	-	-	PUNCT
bioscience-222	200	15	domain	domain	NOUN
bioscience-222	200	16	containing	contain	VERB
bioscience-222	200	17	receptor	receptor	NOUN
bioscience-222	200	18	kinase	kinase	PROPN
bioscience-222	200	19	s.7	s.7	PROPN
bioscience-222	200	20	,	,	PUNCT
bioscience-222	200	21	uridine	uridine	NOUN
bioscience-222	200	22	kinase	kinase	NOUN
bioscience-222	200	23	-	-	PUNCT
bioscience-222	200	24	like	like	ADJ
bioscience-222	200	25	protein	protein	NOUN
bioscience-222	200	26	4	4	NUM
bioscience-222	200	27	,	,	PUNCT
bioscience-222	200	28	and	and	CCONJ
bioscience-222	200	29	serine	serine	NOUN
bioscience-222	200	30	/	/	SYM
bioscience-222	200	31	threonine	threonine	ADJ
bioscience-222	200	32	protein	protein	NOUN
bioscience-222	200	33	kinase	kinase	NOUN
bioscience-222	200	34	blus1	blus1	PROPN
bioscience-222	200	35	.	.	PUNCT
bioscience-222	201	1	very	very	ADV
bioscience-222	201	2	recent	recent	ADJ
bioscience-222	201	3	research	research	NOUN
bioscience-222	201	4	by	by	ADP
bioscience-222	201	5	[	[	X
bioscience-222	201	6	20	20	NUM
bioscience-222	201	7	]	]	PUNCT
bioscience-222	201	8	validated	validate	VERB
bioscience-222	201	9	a	a	DET
bioscience-222	201	10	qtl	qtl	PROPN
bioscience-222	201	11	similar	similar	ADJ
bioscience-222	201	12	to	to	ADP
bioscience-222	201	13	the	the	DET
bioscience-222	201	14	one	one	NOUN
bioscience-222	201	15	we	we	PRON
bioscience-222	201	16	observed	observe	VERB
bioscience-222	201	17	on	on	ADP
bioscience-222	201	18	chromosome	chromosome	NOUN
bioscience-222	201	19	4	4	NUM
bioscience-222	201	20	using	use	VERB
bioscience-222	201	21	gwas	gwas	NOUN
bioscience-222	201	22	with	with	ADP
bioscience-222	201	23	a	a	DET
bioscience-222	201	24	collection	collection	NOUN
bioscience-222	201	25	of	of	ADP
bioscience-222	201	26	132	132	NUM
bioscience-222	201	27	advanced	advanced	ADJ
bioscience-222	201	28	breeding	breeding	NOUN
bioscience-222	201	29	lines	line	NOUN
bioscience-222	201	30	from	from	ADP
bioscience-222	201	31	the	the	DET
bioscience-222	201	32	australian	australian	ADJ
bioscience-222	201	33	chickpea	chickpea	NOUN
bioscience-222	201	34	breeding	breeding	NOUN
bioscience-222	201	35	program	program	NOUN
bioscience-222	201	36	and	and	CCONJ
bioscience-222	201	37	144,000	144,000	NUM
bioscience-222	201	38	snp	snp	ADJ
bioscience-222	201	39	markers	marker	NOUN
bioscience-222	201	40	.	.	PUNCT
bioscience-222	202	1	the	the	DET
bioscience-222	202	2	study	study	NOUN
bioscience-222	202	3	predicted	predict	VERB
bioscience-222	202	4	12	12	NUM
bioscience-222	202	5	genes	gene	NOUN
bioscience-222	202	6	located	locate	VERB
bioscience-222	202	7	on	on	ADP
bioscience-222	202	8	a	a	DET
bioscience-222	202	9	qtl	qtl	PROPN
bioscience-222	202	10	region	region	NOUN
bioscience-222	202	11	in	in	ADP
bioscience-222	202	12	lg4	lg4	PROPN
bioscience-222	202	13	,	,	PUNCT
bioscience-222	202	14	including	include	VERB
bioscience-222	202	15	those	those	PRON
bioscience-222	202	16	annotated	annotate	VERB
bioscience-222	202	17	as	as	ADP
bioscience-222	202	18	an	an	DET
bioscience-222	202	19	nbs	nbs	NOUN
bioscience-222	202	20	-	-	PUNCT
bioscience-222	202	21	lrr	lrr	ADJ
bioscience-222	202	22	receptor	receptor	NOUN
bioscience-222	202	23	-	-	PUNCT
bioscience-222	202	24	like	like	ADJ
bioscience-222	202	25	kinase	kinase	NOUN
bioscience-222	202	26	,	,	PUNCT
bioscience-222	202	27	a	a	DET
bioscience-222	202	28	wall	wall	NOUN
bioscience-222	202	29	-	-	PUNCT
bioscience-222	202	30	associated	associate	VERB
bioscience-222	202	31	kinase	kinase	NOUN
bioscience-222	202	32	,	,	PUNCT
bioscience-222	202	33	a	a	DET
bioscience-222	202	34	zinc	zinc	NOUN
bioscience-222	202	35	finger	finger	NOUN
bioscience-222	202	36	protein	protein	NOUN
bioscience-222	202	37	,	,	PUNCT
bioscience-222	202	38	and	and	CCONJ
bioscience-222	202	39	serine	serine	NOUN
bioscience-222	202	40	/	/	SYM
bioscience-222	202	41	threonine	threonine	ADJ
bioscience-222	202	42	protein	protein	NOUN
bioscience-222	202	43	kinases	kinase	NOUN
bioscience-222	202	44	.	.	PUNCT
bioscience-222	203	1	however	however	ADV
bioscience-222	203	2	,	,	PUNCT
bioscience-222	203	3	only	only	ADV
bioscience-222	203	4	one	one	NUM
bioscience-222	203	5	significant	significant	ADJ
bioscience-222	203	6	snp	snp	NOUN
bioscience-222	203	7	from	from	ADP
bioscience-222	203	8	that	that	DET
bioscience-222	203	9	study	study	NOUN
bioscience-222	203	10	,	,	PUNCT
bioscience-222	203	11	located	locate	VERB
bioscience-222	203	12	in	in	ADP
bioscience-222	203	13	the	the	DET
bioscience-222	203	14	conserved	conserved	ADJ
bioscience-222	203	15	catalytic	catalytic	ADJ
bioscience-222	203	16	domain	domain	NOUN
bioscience-222	203	17	of	of	ADP
bioscience-222	203	18	an	an	DET
bioscience-222	203	19	nbs	nbs	NOUN
bioscience-222	203	20	-	-	PUNCT
bioscience-222	203	21	lrr	lrr	ADJ
bioscience-222	203	22	receptor	receptor	NOUN
bioscience-222	203	23	-	-	PUNCT
bioscience-222	203	24	like	like	ADJ
bioscience-222	203	25	kinase	kinase	NOUN
bioscience-222	203	26	,	,	PUNCT
bioscience-222	203	27	led	lead	VERB
bioscience-222	203	28	to	to	ADP
bioscience-222	203	29	an	an	DET
bioscience-222	203	30	amino	amino	NOUN
bioscience-222	203	31	acid	acid	NOUN
bioscience-222	203	32	substitution	substitution	NOUN
bioscience-222	203	33	.	.	PUNCT
bioscience-222	204	1	in	in	ADP
bioscience-222	204	2	our	our	PRON
bioscience-222	204	3	study	study	NOUN
bioscience-222	204	4	,	,	PUNCT
bioscience-222	204	5	12	12	NUM
bioscience-222	204	6	markers	marker	NOUN
bioscience-222	204	7	on	on	ADP
bioscience-222	204	8	the	the	DET
bioscience-222	204	9	qtl	qtl	PROPN
bioscience-222	204	10	region	region	PROPN
bioscience-222	204	11	on	on	ADP
bioscience-222	204	12	lg4	lg4	PROPN
bioscience-222	204	13	were	be	AUX
bioscience-222	204	14	consistent	consistent	ADJ
bioscience-222	204	15	across	across	ADP
bioscience-222	204	16	environments	environment	NOUN
bioscience-222	204	17	and	and	CCONJ
bioscience-222	204	18	could	could	AUX
bioscience-222	204	19	be	be	AUX
bioscience-222	204	20	used	use	VERB
bioscience-222	204	21	for	for	ADP
bioscience-222	204	22	mas	mas	PROPN
bioscience-222	204	23	in	in	ADP
bioscience-222	204	24	cicer	cicer	VERB
bioscience-222	204	25	arietinum	arietinum	PRON
bioscience-222	204	26	.	.	PUNCT
bioscience-222	205	1	these	these	PRON
bioscience-222	205	2	include	include	VERB
bioscience-222	205	3	the	the	DET
bioscience-222	205	4	markers	marker	NOUN
bioscience-222	205	5	sn-100024987	sn-100024987	NOUN
bioscience-222	205	6	,	,	PUNCT
bioscience-222	205	7	sn-5825578	sn-5825578	PROPN
bioscience-222	205	8	,	,	PUNCT
bioscience-222	205	9	sn-5825139	sn-5825139	NOUN
bioscience-222	205	10	,	,	PUNCT
bioscience-222	205	11	and	and	CCONJ
bioscience-222	205	12	drt-5824787	drt-5824787	NOUN
bioscience-222	205	13	,	,	PUNCT
bioscience-222	205	14	which	which	PRON
bioscience-222	205	15	are	be	AUX
bioscience-222	205	16	located	locate	VERB
bioscience-222	205	17	,	,	PUNCT
bioscience-222	205	18	respectively	respectively	ADV
bioscience-222	205	19	,	,	PUNCT
bioscience-222	205	20	within	within	ADP
bioscience-222	205	21	four	four	NUM
bioscience-222	205	22	genes	gene	NOUN
bioscience-222	205	23	(	(	PUNCT
bioscience-222	205	24	serine	serine	NOUN
bioscience-222	205	25	/	/	SYM
bioscience-222	205	26	threonine	threonine	ADJ
bioscience-222	205	27	protein	protein	NOUN
bioscience-222	205	28	kinase	kinase	PROPN
bioscience-222	205	29	blus1	blus1	PROPN
bioscience-222	205	30	,	,	PUNCT
bioscience-222	205	31	coiledcoil	coiledcoil	NOUN
bioscience-222	205	32	domain	domain	NOUN
bioscience-222	205	33	-	-	PUNCT
bioscience-222	205	34	containing	contain	VERB
bioscience-222	205	35	protein	protein	NOUN
bioscience-222	205	36	,	,	PUNCT
bioscience-222	205	37	transcription	transcription	NOUN
bioscience-222	205	38	factor	factor	NOUN
bioscience-222	205	39	bhlh157	bhlh157	PROPN
bioscience-222	205	40	,	,	PUNCT
bioscience-222	205	41	highlights	highlight	NOUN
bioscience-222	205	42	in	in	ADP
bioscience-222	205	43	bioscience	bioscience	NOUN
bioscience-222	205	44	page	page	NOUN
bioscience-222	205	45	8	8	NUM
bioscience-222	205	46	of	of	ADP
bioscience-222	205	47	11	11	NUM
bioscience-222	205	48	december	december	PROPN
bioscience-222	205	49	2024|volume	2024|volume	NUM
bioscience-222	205	50	7	7	NUM
bioscience-222	205	51	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	205	52	hamwieh	hamwieh	NOUN
bioscience-222	205	53	et	et	PROPN
bioscience-222	205	54	al	al	PROPN
bioscience-222	205	55	.	.	PROPN
bioscience-222	205	56	,	,	PUNCT
bioscience-222	205	57	2024	2024	NUM
bioscience-222	205	58	exploring	explore	VERB
bioscience-222	205	59	qtl	qtl	PROPN
bioscience-222	205	60	genes	gene	NOUN
bioscience-222	205	61	contribute	contribute	VERB
bioscience-222	205	62	to	to	ADP
bioscience-222	205	63	chickpea	chickpea	PROPN
bioscience-222	205	64	ascochyta	ascochyta	NOUN
bioscience-222	205	65	blight	blight	NOUN
bioscience-222	205	66	resistance	resistance	NOUN
bioscience-222	205	67	and	and	CCONJ
bioscience-222	205	68	metal	metal	NOUN
bioscience-222	205	69	-	-	PUNCT
bioscience-222	205	70	nicotianamine	nicotianamine	NOUN
bioscience-222	205	71	transporter	transporter	NOUN
bioscience-222	205	72	ysl1	ysl1	PROPN
bioscience-222	205	73	)	)	PUNCT
bioscience-222	205	74	(	(	PUNCT
bioscience-222	205	75	table	table	NOUN
bioscience-222	205	76	5	5	NUM
bioscience-222	205	77	)	)	PUNCT
bioscience-222	205	78	.	.	PUNCT
bioscience-222	206	1	unfortunately	unfortunately	ADV
bioscience-222	206	2	,	,	PUNCT
bioscience-222	206	3	little	little	ADJ
bioscience-222	206	4	research	research	NOUN
bioscience-222	206	5	has	have	AUX
bioscience-222	206	6	been	be	AUX
bioscience-222	206	7	conducted	conduct	VERB
bioscience-222	206	8	on	on	ADP
bioscience-222	206	9	these	these	DET
bioscience-222	206	10	genes	gene	NOUN
bioscience-222	206	11	in	in	ADP
bioscience-222	206	12	cicer	cicer	NOUN
bioscience-222	206	13	arietinum	arietinum	PRON
bioscience-222	206	14	.	.	PUNCT
bioscience-222	207	1	however	however	ADV
bioscience-222	207	2	,	,	PUNCT
bioscience-222	207	3	[	[	X
bioscience-222	207	4	20	20	NUM
bioscience-222	207	5	]	]	PUNCT
bioscience-222	207	6	reported	report	VERB
bioscience-222	207	7	that	that	SCONJ
bioscience-222	207	8	nbslrr	nbslrr	NOUN
bioscience-222	207	9	receptor	receptor	NOUN
bioscience-222	207	10	-	-	PUNCT
bioscience-222	207	11	like	like	ADJ
bioscience-222	207	12	kinase	kinase	NOUN
bioscience-222	207	13	and	and	CCONJ
bioscience-222	207	14	several	several	ADJ
bioscience-222	207	15	serine	serine	NOUN
bioscience-222	207	16	/	/	SYM
bioscience-222	207	17	threonine	threonine	ADJ
bioscience-222	207	18	protein	protein	NOUN
bioscience-222	207	19	kinases	kinase	NOUN
bioscience-222	207	20	on	on	ADP
bioscience-222	207	21	chromosome	chromosome	NOUN
bioscience-222	207	22	4	4	NUM
bioscience-222	207	23	were	be	AUX
bioscience-222	207	24	predicted	predict	VERB
bioscience-222	207	25	genes	gene	NOUN
bioscience-222	207	26	associated	associate	VERB
bioscience-222	207	27	with	with	ADP
bioscience-222	207	28	ab	ab	PROPN
bioscience-222	207	29	resistance	resistance	NOUN
bioscience-222	207	30	.	.	PUNCT
bioscience-222	208	1	these	these	DET
bioscience-222	208	2	genes	gene	NOUN
bioscience-222	208	3	are	be	AUX
bioscience-222	208	4	already	already	ADV
bioscience-222	208	5	known	know	VERB
bioscience-222	208	6	to	to	PART
bioscience-222	208	7	have	have	VERB
bioscience-222	208	8	a	a	DET
bioscience-222	208	9	role	role	NOUN
bioscience-222	208	10	in	in	ADP
bioscience-222	208	11	plant	plant	NOUN
bioscience-222	208	12	disease	disease	NOUN
bioscience-222	208	13	resistance	resistance	NOUN
bioscience-222	208	14	.	.	PUNCT
bioscience-222	209	1	for	for	ADP
bioscience-222	209	2	example	example	NOUN
bioscience-222	209	3	,	,	PUNCT
bioscience-222	209	4	the	the	DET
bioscience-222	209	5	network	network	NOUN
bioscience-222	209	6	of	of	ADP
bioscience-222	209	7	protein	protein	NOUN
bioscience-222	209	8	serine	serine	NOUN
bioscience-222	209	9	/	/	SYM
bioscience-222	209	10	threonine	threonine	ADJ
bioscience-222	209	11	kinases	kinase	NOUN
bioscience-222	209	12	in	in	ADP
bioscience-222	209	13	plant	plant	NOUN
bioscience-222	209	14	cells	cell	NOUN
bioscience-222	209	15	appears	appear	VERB
bioscience-222	209	16	to	to	PART
bioscience-222	209	17	act	act	VERB
bioscience-222	209	18	as	as	ADP
bioscience-222	209	19	a	a	DET
bioscience-222	209	20	central	central	ADJ
bioscience-222	209	21	processor	processor	NOUN
bioscience-222	209	22	unit	unit	NOUN
bioscience-222	209	23	that	that	PRON
bioscience-222	209	24	plays	play	VERB
bioscience-222	209	25	a	a	DET
bioscience-222	209	26	role	role	NOUN
bioscience-222	209	27	in	in	ADP
bioscience-222	209	28	the	the	DET
bioscience-222	209	29	resistance	resistance	NOUN
bioscience-222	209	30	of	of	ADP
bioscience-222	209	31	tomato	tomato	NOUN
bioscience-222	209	32	to	to	ADP
bioscience-222	209	33	disease	disease	NOUN
bioscience-222	209	34	caused	cause	VERB
bioscience-222	209	35	by	by	ADP
bioscience-222	209	36	pseudomonas	pseudomona	NOUN
bioscience-222	209	37	syringae	syringae	NOUN
bioscience-222	209	38	pv	pv	NOUN
bioscience-222	209	39	.	.	PUNCT
bioscience-222	210	1	tomato	tomato	NOUN
bioscience-222	211	1	[	[	X
bioscience-222	211	2	39	39	NUM
bioscience-222	211	3	]	]	PUNCT
bioscience-222	211	4	.	.	PUNCT
bioscience-222	211	5	yellow	yellow	ADJ
bioscience-222	211	6	-	-	PUNCT
bioscience-222	211	7	leaf	leaf	NOUN
bioscience-222	211	8	-	-	PUNCT
bioscience-222	211	9	specific	specific	ADJ
bioscience-222	211	10	9	9	NUM
bioscience-222	211	11	(	(	PUNCT
bioscience-222	211	12	ysl9	ysl9	NOUN
bioscience-222	211	13	/	/	SYM
bioscience-222	211	14	nhl10	nhl10	VERB
bioscience-222	211	15	)	)	PUNCT
bioscience-222	211	16	is	be	AUX
bioscience-222	211	17	a	a	DET
bioscience-222	211	18	transmembrane	transmembrane	ADJ
bioscience-222	211	19	gene	gene	NOUN
bioscience-222	211	20	related	relate	VERB
bioscience-222	211	21	to	to	PART
bioscience-222	211	22	plant	plant	VERB
bioscience-222	211	23	defense	defense	NOUN
bioscience-222	211	24	response	response	NOUN
bioscience-222	211	25	to	to	ADP
bioscience-222	211	26	virus	virus	NOUN
bioscience-222	211	27	.	.	PUNCT
bioscience-222	212	1	the	the	DET
bioscience-222	212	2	gene	gene	NOUN
bioscience-222	212	3	product	product	NOUN
bioscience-222	212	4	is	be	AUX
bioscience-222	212	5	localized	localize	VERB
bioscience-222	212	6	to	to	ADP
bioscience-222	212	7	the	the	DET
bioscience-222	212	8	chloroplast	chloroplast	NOUN
bioscience-222	212	9	and	and	CCONJ
bioscience-222	212	10	the	the	DET
bioscience-222	212	11	mrna	mrna	NOUN
bioscience-222	212	12	is	be	AUX
bioscience-222	212	13	cell	cell	NOUN
bioscience-222	212	14	-	-	PUNCT
bioscience-222	212	15	to	to	ADP
bioscience-222	212	16	-	-	PUNCT
bioscience-222	212	17	cell	cell	NOUN
bioscience-222	212	18	mobile	mobile	NOUN
bioscience-222	212	19	.	.	PUNCT
bioscience-222	213	1	in	in	ADP
bioscience-222	213	2	arabidopsis	arabidopsis	NOUN
bioscience-222	213	3	,	,	PUNCT
bioscience-222	213	4	the	the	DET
bioscience-222	213	5	expression	expression	NOUN
bioscience-222	213	6	of	of	ADP
bioscience-222	213	7	this	this	DET
bioscience-222	213	8	gene	gene	NOUN
bioscience-222	213	9	is	be	AUX
bioscience-222	213	10	induced	induce	VERB
bioscience-222	213	11	by	by	ADP
bioscience-222	213	12	virus	virus	NOUN
bioscience-222	213	13	infection	infection	NOUN
bioscience-222	213	14	and	and	CCONJ
bioscience-222	213	15	in	in	ADP
bioscience-222	213	16	senescing	senesce	VERB
bioscience-222	213	17	leaves	leave	NOUN
bioscience-222	213	18	[	[	X
bioscience-222	213	19	40	40	NUM
bioscience-222	213	20	;	;	PUNCT
bioscience-222	213	21	41	41	NUM
bioscience-222	213	22	]	]	PUNCT
bioscience-222	213	23	.	.	PUNCT
bioscience-222	214	1	on	on	ADP
bioscience-222	214	2	the	the	DET
bioscience-222	214	3	other	other	ADJ
bioscience-222	214	4	hand	hand	NOUN
bioscience-222	214	5	,	,	PUNCT
bioscience-222	214	6	blus1	blus1	NOUN
bioscience-222	214	7	(	(	PUNCT
bioscience-222	214	8	blue	blue	ADJ
bioscience-222	214	9	light	light	NOUN
bioscience-222	214	10	signaling1	signaling1	NOUN
bioscience-222	214	11	or	or	CCONJ
bioscience-222	214	12	ser	ser	PROPN
bioscience-222	214	13	/	/	SYM
bioscience-222	214	14	thr	thr	PROPN
bioscience-222	214	15	protein	protein	NOUN
bioscience-222	214	16	kinase	kinase	PROPN
bioscience-222	214	17	)	)	PUNCT
bioscience-222	214	18	mediates	mediate	VERB
bioscience-222	214	19	a	a	DET
bioscience-222	214	20	primary	primary	ADJ
bioscience-222	214	21	step	step	NOUN
bioscience-222	214	22	for	for	ADP
bioscience-222	214	23	phototropin	phototropin	NOUN
bioscience-222	214	24	signaling	signal	VERB
bioscience-222	214	25	in	in	ADP
bioscience-222	214	26	guard	guard	NOUN
bioscience-222	214	27	cells	cell	NOUN
bioscience-222	214	28	and	and	CCONJ
bioscience-222	214	29	is	be	AUX
bioscience-222	214	30	essential	essential	ADJ
bioscience-222	214	31	for	for	ADP
bioscience-222	214	32	stomatal	stomatal	ADJ
bioscience-222	214	33	opening	opening	NOUN
bioscience-222	214	34	,	,	PUNCT
bioscience-222	214	35	and	and	CCONJ
bioscience-222	214	36	it	it	PRON
bioscience-222	214	37	also	also	ADV
bioscience-222	214	38	has	have	VERB
bioscience-222	214	39	a	a	DET
bioscience-222	214	40	role	role	NOUN
bioscience-222	214	41	in	in	ADP
bioscience-222	214	42	the	the	DET
bioscience-222	214	43	stress	stress	NOUN
bioscience-222	214	44	-	-	PUNCT
bioscience-222	214	45	activated	activate	VERB
bioscience-222	214	46	protein	protein	NOUN
bioscience-222	214	47	kinase	kinase	NOUN
bioscience-222	214	48	signaling	signal	VERB
bioscience-222	214	49	cascade	cascade	NOUN
bioscience-222	214	50	[	[	X
bioscience-222	214	51	42	42	NUM
bioscience-222	214	52	]	]	PUNCT
bioscience-222	214	53	.	.	PUNCT
bioscience-222	215	1	the	the	DET
bioscience-222	215	2	coiled	coil	VERB
bioscience-222	215	3	-	-	PUNCT
bioscience-222	215	4	coil	coil	NOUN
bioscience-222	215	5	(	(	PUNCT
bioscience-222	215	6	cc	cc	NOUN
bioscience-222	215	7	)	)	PUNCT
bioscience-222	215	8	domain	domain	NOUN
bioscience-222	215	9	is	be	AUX
bioscience-222	215	10	implicated	implicate	VERB
bioscience-222	215	11	in	in	ADP
bioscience-222	215	12	specific	specific	ADJ
bioscience-222	215	13	interactions	interaction	NOUN
bioscience-222	215	14	with	with	ADP
bioscience-222	215	15	other	other	ADJ
bioscience-222	215	16	proteins	protein	NOUN
bioscience-222	215	17	that	that	PRON
bioscience-222	215	18	enhance	enhance	VERB
bioscience-222	215	19	plant	plant	NOUN
bioscience-222	215	20	disease	disease	NOUN
bioscience-222	215	21	resistance	resistance	NOUN
bioscience-222	215	22	.	.	PUNCT
bioscience-222	216	1	for	for	ADP
bioscience-222	216	2	example	example	NOUN
bioscience-222	216	3	,	,	PUNCT
bioscience-222	216	4	coiled	coil	VERB
bioscience-222	216	5	-	-	PUNCT
bioscience-222	216	6	coil	coil	NOUN
bioscience-222	216	7	nucleotide	nucleotide	NOUN
bioscience-222	216	8	binding	bind	VERB
bioscience-222	216	9	site	site	NOUN
bioscience-222	216	10	-	-	PUNCT
bioscience-222	216	11	leucine	leucine	NOUN
bioscience-222	216	12	rich	rich	ADJ
bioscience-222	216	13	repeat	repeat	NOUN
bioscience-222	216	14	(	(	PUNCT
bioscience-222	216	15	cc	cc	NOUN
bioscience-222	216	16	-	-	ADJ
bioscience-222	216	17	nblrr	nblrr	ADJ
bioscience-222	216	18	)	)	PUNCT
bioscience-222	216	19	protein	protein	NOUN
bioscience-222	216	20	rx	rx	VERB
bioscience-222	216	21	in	in	ADP
bioscience-222	216	22	potato	potato	NOUN
bioscience-222	216	23	has	have	AUX
bioscience-222	216	24	been	be	AUX
bioscience-222	216	25	found	find	VERB
bioscience-222	216	26	to	to	PART
bioscience-222	216	27	interact	interact	VERB
bioscience-222	216	28	with	with	ADP
bioscience-222	216	29	the	the	DET
bioscience-222	216	30	potato	potato	NOUN
bioscience-222	216	31	virus	virus	NOUN
bioscience-222	216	32	x	x	INTJ
bioscience-222	216	33	(	(	PUNCT
bioscience-222	216	34	pvx	pvx	ADJ
bioscience-222	216	35	)	)	PUNCT
bioscience-222	216	36	coat	coat	NOUN
bioscience-222	216	37	protein	protein	NOUN
bioscience-222	216	38	,	,	PUNCT
bioscience-222	216	39	conferring	confer	VERB
bioscience-222	216	40	pvx	pvx	ADJ
bioscience-222	216	41	resistance	resistance	NOUN
bioscience-222	217	1	[	[	X
bioscience-222	217	2	43	43	NUM
bioscience-222	217	3	]	]	PUNCT
bioscience-222	217	4	.	.	PUNCT
bioscience-222	218	1	transcription	transcription	NOUN
bioscience-222	218	2	factor	factor	NOUN
bioscience-222	218	3	bhlh157	bhlh157	PROPN
bioscience-222	218	4	(	(	PUNCT
bioscience-222	218	5	basic	basic	ADJ
bioscience-222	218	6	/	/	SYM
bioscience-222	218	7	helix	helix	NOUN
bioscience-222	218	8	-	-	PUNCT
bioscience-222	218	9	loop	loop	NOUN
bioscience-222	218	10	-	-	PUNCT
bioscience-222	218	11	helix	helix	NOUN
bioscience-222	218	12	)	)	PUNCT
bioscience-222	218	13	is	be	AUX
bioscience-222	218	14	a	a	DET
bioscience-222	218	15	master	master	NOUN
bioscience-222	218	16	-	-	PUNCT
bioscience-222	218	17	switch	switch	NOUN
bioscience-222	218	18	gene	gene	NOUN
bioscience-222	218	19	in	in	ADP
bioscience-222	218	20	plants	plant	NOUN
bioscience-222	218	21	[	[	X
bioscience-222	218	22	44	44	NUM
bioscience-222	218	23	]	]	PUNCT
bioscience-222	218	24	and	and	CCONJ
bioscience-222	218	25	plays	play	VERB
bioscience-222	218	26	an	an	DET
bioscience-222	218	27	important	important	ADJ
bioscience-222	218	28	role	role	NOUN
bioscience-222	218	29	in	in	ADP
bioscience-222	218	30	disease	disease	NOUN
bioscience-222	218	31	resistance	resistance	NOUN
bioscience-222	218	32	,	,	PUNCT
bioscience-222	218	33	high	high	ADJ
bioscience-222	218	34	temperature	temperature	NOUN
bioscience-222	218	35	-	-	PUNCT
bioscience-222	218	36	mediated	mediate	VERB
bioscience-222	218	37	adaptations	adaptation	NOUN
bioscience-222	218	38	,	,	PUNCT
bioscience-222	218	39	and	and	CCONJ
bioscience-222	218	40	phytochrome	phytochrome	NOUN
bioscience-222	218	41	signaling	signal	VERB
bioscience-222	218	42	[	[	X
bioscience-222	218	43	45	45	NUM
bioscience-222	218	44	;	;	PUNCT
bioscience-222	218	45	46	46	NUM
bioscience-222	218	46	;	;	PUNCT
bioscience-222	218	47	47	47	NUM
bioscience-222	218	48	]	]	PUNCT
bioscience-222	218	49	.	.	PUNCT
bioscience-222	219	1	the	the	DET
bioscience-222	219	2	dreb	dreb	PROPN
bioscience-222	219	3	/	/	SYM
bioscience-222	219	4	cbf	cbf	PROPN
bioscience-222	219	5	were	be	AUX
bioscience-222	219	6	also	also	ADV
bioscience-222	219	7	regulated	regulate	VERB
bioscience-222	219	8	by	by	ADP
bioscience-222	219	9	bhlh	bhlh	NOUN
bioscience-222	219	10	-	-	PUNCT
bioscience-222	219	11	type	type	NOUN
bioscience-222	219	12	transcription	transcription	NOUN
bioscience-222	219	13	factor	factor	NOUN
bioscience-222	219	14	,	,	PUNCT
bioscience-222	219	15	ice1	ice1	PROPN
bioscience-222	220	1	[	[	X
bioscience-222	220	2	48	48	NUM
bioscience-222	220	3	]	]	PUNCT
bioscience-222	220	4	,	,	PUNCT
bioscience-222	220	5	and	and	CCONJ
bioscience-222	220	6	recent	recent	ADJ
bioscience-222	220	7	studies	study	NOUN
bioscience-222	220	8	demonstrate	demonstrate	VERB
bioscience-222	220	9	that	that	SCONJ
bioscience-222	220	10	the	the	DET
bioscience-222	220	11	basic	basic	ADJ
bioscience-222	220	12	helix	helix	ADJ
bioscience-222	220	13	-	-	PUNCT
bioscience-222	220	14	loop	loop	NOUN
bioscience-222	220	15	-	-	PUNCT
bioscience-222	220	16	helix	helix	NOUN
bioscience-222	220	17	(	(	PUNCT
bioscience-222	220	18	bhlh	bhlh	NOUN
bioscience-222	220	19	)	)	PUNCT
bioscience-222	220	20	transcription	transcription	NOUN
bioscience-222	220	21	factor	factor	NOUN
bioscience-222	220	22	atmyc2	atmyc2	NOUN
bioscience-222	220	23	plays	play	VERB
bioscience-222	220	24	a	a	DET
bioscience-222	220	25	role	role	NOUN
bioscience-222	220	26	in	in	ADP
bioscience-222	220	27	multiple	multiple	ADJ
bioscience-222	220	28	hormone	hormone	NOUN
bioscience-222	220	29	signaling	signal	VERB
bioscience-222	220	30	pathways	pathway	NOUN
bioscience-222	221	1	[	[	X
bioscience-222	221	2	49	49	NUM
bioscience-222	221	3	]	]	PUNCT
bioscience-222	221	4	.	.	PUNCT
bioscience-222	222	1	the	the	DET
bioscience-222	222	2	regulation	regulation	NOUN
bioscience-222	222	3	of	of	ADP
bioscience-222	222	4	flavonoid	flavonoid	NOUN
bioscience-222	222	5	biosynthetic	biosynthetic	ADJ
bioscience-222	222	6	gene	gene	NOUN
bioscience-222	222	7	expression	expression	NOUN
bioscience-222	222	8	by	by	ADP
bioscience-222	222	9	the	the	DET
bioscience-222	222	10	cooperation	cooperation	NOUN
bioscience-222	222	11	of	of	ADP
bioscience-222	222	12	r2r3	r2r3	PROPN
bioscience-222	222	13	myb	myb	NOUN
bioscience-222	222	14	and	and	CCONJ
bioscience-222	222	15	basic	basic	ADJ
bioscience-222	222	16	bhlh	bhlh	NOUN
bioscience-222	222	17	transcription	transcription	NOUN
bioscience-222	222	18	factors	factor	NOUN
bioscience-222	222	19	provides	provide	VERB
bioscience-222	222	20	one	one	NUM
bioscience-222	222	21	of	of	ADP
bioscience-222	222	22	the	the	DET
bioscience-222	222	23	best	well	ADV
bioscience-222	222	24	described	describe	VERB
bioscience-222	222	25	examples	example	NOUN
bioscience-222	222	26	of	of	ADP
bioscience-222	222	27	combinatorial	combinatorial	ADJ
bioscience-222	222	28	gene	gene	NOUN
bioscience-222	222	29	regulation	regulation	NOUN
bioscience-222	222	30	in	in	ADP
bioscience-222	222	31	plants	plant	NOUN
bioscience-222	222	32	[	[	X
bioscience-222	222	33	50	50	NUM
bioscience-222	222	34	]	]	PUNCT
bioscience-222	222	35	.	.	PUNCT
bioscience-222	223	1	the	the	DET
bioscience-222	223	2	transcription	transcription	NOUN
bioscience-222	223	3	activator	activator	NOUN
bioscience-222	223	4	-	-	PUNCT
bioscience-222	223	5	like	like	ADJ
bioscience-222	223	6	effector	effector	NOUN
bioscience-222	223	7	(	(	PUNCT
bioscience-222	223	8	tale	tale	NOUN
bioscience-222	223	9	)	)	PUNCT
bioscience-222	223	10	protein	protein	NOUN
bioscience-222	223	11	was	be	AUX
bioscience-222	223	12	shown	show	VERB
bioscience-222	223	13	to	to	PART
bioscience-222	223	14	induce	induce	VERB
bioscience-222	223	15	bhlh	bhlh	NOUN
bioscience-222	223	16	transcription	transcription	NOUN
bioscience-222	223	17	factors	factor	NOUN
bioscience-222	223	18	that	that	PRON
bioscience-222	223	19	activate	activate	VERB
bioscience-222	223	20	a	a	DET
bioscience-222	223	21	pectate	pectate	ADJ
bioscience-222	223	22	lyase	lyase	NOUN
bioscience-222	223	23	and	and	CCONJ
bioscience-222	223	24	contribute	contribute	VERB
bioscience-222	223	25	to	to	ADP
bioscience-222	223	26	water	water	NOUN
bioscience-222	223	27	soaking	soak	VERB
bioscience-222	223	28	in	in	ADP
bioscience-222	223	29	bacterial	bacterial	ADJ
bioscience-222	223	30	spot	spot	NOUN
bioscience-222	223	31	of	of	ADP
bioscience-222	223	32	tomato	tomato	NOUN
bioscience-222	223	33	[	[	X
bioscience-222	223	34	51	51	NUM
bioscience-222	223	35	]	]	PUNCT
bioscience-222	223	36	.	.	PUNCT
bioscience-222	224	1	cicer	cicer	VERB
bioscience-222	224	2	arietinum	arietinum	DET
bioscience-222	224	3	genome	genome	NOUN
bioscience-222	224	4	annotation	annotation	NOUN
bioscience-222	224	5	[	[	X
bioscience-222	224	6	52	52	NUM
bioscience-222	224	7	]	]	PUNCT
bioscience-222	224	8	has	have	AUX
bioscience-222	224	9	been	be	AUX
bioscience-222	224	10	used	use	VERB
bioscience-222	224	11	as	as	ADP
bioscience-222	224	12	an	an	DET
bioscience-222	224	13	annotation	annotation	NOUN
bioscience-222	224	14	database	database	NOUN
bioscience-222	224	15	for	for	ADP
bioscience-222	224	16	the	the	DET
bioscience-222	224	17	snpeff	snpeff	NOUN
bioscience-222	224	18	tool	tool	NOUN
bioscience-222	224	19	in	in	ADP
bioscience-222	224	20	order	order	NOUN
bioscience-222	224	21	to	to	PART
bioscience-222	224	22	detect	detect	VERB
bioscience-222	224	23	the	the	DET
bioscience-222	224	24	possible	possible	ADJ
bioscience-222	224	25	effect	effect	NOUN
bioscience-222	224	26	of	of	ADP
bioscience-222	224	27	sn-5825578	sn-5825578	PROPN
bioscience-222	224	28	,	,	PUNCT
bioscience-222	224	29	sn-100024987	sn-100024987	NOUN
bioscience-222	224	30	,	,	PUNCT
bioscience-222	224	31	sn-5826150	sn-5826150	PROPN
bioscience-222	224	32	,	,	PUNCT
bioscience-222	224	33	sn-100053539	sn-100053539	PROPN
bioscience-222	224	34	,	,	PUNCT
bioscience-222	224	35	sn-5825294	sn-5825294	NOUN
bioscience-222	224	36	,	,	PUNCT
bioscience-222	224	37	and	and	CCONJ
bioscience-222	224	38	sn-5825139	sn-5825139	ADJ
bioscience-222	224	39	.	.	PUNCT
bioscience-222	225	1	these	these	DET
bioscience-222	225	2	snps	snps	PROPN
bioscience-222	225	3	have	have	AUX
bioscience-222	225	4	shown	show	VERB
bioscience-222	225	5	a	a	DET
bioscience-222	225	6	modifier	modifier	NOUN
bioscience-222	225	7	effect	effect	NOUN
bioscience-222	225	8	on	on	ADP
bioscience-222	225	9	yls9	yls9	PROPN
bioscience-222	225	10	,	,	PUNCT
bioscience-222	225	11	coiled	coil	VERB
bioscience-222	225	12	-	-	PUNCT
bioscience-222	225	13	coil	coil	NOUN
bioscience-222	225	14	domain	domain	NOUN
bioscience-222	225	15	-	-	PUNCT
bioscience-222	225	16	containing	contain	VERB
bioscience-222	225	17	protein	protein	NOUN
bioscience-222	225	18	12	12	NUM
bioscience-222	225	19	,	,	PUNCT
bioscience-222	225	20	blus1	blus1	NOUN
bioscience-222	225	21	,	,	PUNCT
bioscience-222	225	22	and	and	CCONJ
bioscience-222	225	23	transcription	transcription	NOUN
bioscience-222	225	24	factor	factor	NOUN
bioscience-222	225	25	bhlh157	bhlh157	PROPN
bioscience-222	225	26	.	.	PUNCT
bioscience-222	226	1	some	some	DET
bioscience-222	226	2	genes	gene	NOUN
bioscience-222	226	3	,	,	PUNCT
bioscience-222	226	4	such	such	ADJ
bioscience-222	226	5	as	as	ADP
bioscience-222	226	6	blus1	blus1	NOUN
bioscience-222	226	7	and	and	CCONJ
bioscience-222	226	8	methionine	methionine	NOUN
bioscience-222	226	9	gamma	gamma	NOUN
bioscience-222	226	10	-	-	PUNCT
bioscience-222	226	11	lyase	lyase	NOUN
bioscience-222	226	12	-	-	PUNCT
bioscience-222	226	13	like	like	NOUN
bioscience-222	226	14	,	,	PUNCT
bioscience-222	226	15	are	be	AUX
bioscience-222	226	16	affected	affect	VERB
bioscience-222	226	17	by	by	ADP
bioscience-222	226	18	two	two	NUM
bioscience-222	226	19	snps	snps	NOUN
bioscience-222	226	20	,	,	PUNCT
bioscience-222	226	21	while	while	SCONJ
bioscience-222	226	22	others	other	NOUN
bioscience-222	226	23	are	be	AUX
bioscience-222	226	24	affected	affect	VERB
bioscience-222	226	25	by	by	ADP
bioscience-222	226	26	only	only	ADV
bioscience-222	226	27	one	one	NUM
bioscience-222	226	28	snp	snp	ADJ
bioscience-222	226	29	.	.	PUNCT
bioscience-222	227	1	in	in	ADP
bioscience-222	227	2	summary	summary	NOUN
bioscience-222	227	3	,	,	PUNCT
bioscience-222	227	4	it	it	PRON
bioscience-222	227	5	is	be	AUX
bioscience-222	227	6	not	not	PART
bioscience-222	227	7	yet	yet	ADV
bioscience-222	227	8	clear	clear	ADJ
bioscience-222	227	9	how	how	SCONJ
bioscience-222	227	10	the	the	DET
bioscience-222	227	11	predicted	predict	VERB
bioscience-222	227	12	genes	gene	NOUN
bioscience-222	227	13	located	locate	VERB
bioscience-222	227	14	in	in	ADP
bioscience-222	227	15	the	the	DET
bioscience-222	227	16	qtl	qtl	PROPN
bioscience-222	227	17	regions	region	NOUN
bioscience-222	227	18	we	we	PRON
bioscience-222	227	19	identified	identify	VERB
bioscience-222	227	20	play	play	VERB
bioscience-222	227	21	a	a	DET
bioscience-222	227	22	role	role	NOUN
bioscience-222	227	23	in	in	ADP
bioscience-222	227	24	ab	ab	PROPN
bioscience-222	227	25	resistance	resistance	NOUN
bioscience-222	227	26	in	in	ADP
bioscience-222	227	27	cicer	cicer	NOUN
bioscience-222	227	28	arietinum	arietinum	PRON
bioscience-222	227	29	.	.	PUNCT
bioscience-222	228	1	therefore	therefore	ADV
bioscience-222	228	2	,	,	PUNCT
bioscience-222	228	3	further	further	ADJ
bioscience-222	228	4	research	research	NOUN
bioscience-222	228	5	into	into	ADP
bioscience-222	228	6	the	the	DET
bioscience-222	228	7	potential	potential	ADJ
bioscience-222	228	8	roles	role	NOUN
bioscience-222	228	9	of	of	ADP
bioscience-222	228	10	these	these	DET
bioscience-222	228	11	genes	gene	NOUN
bioscience-222	228	12	is	be	AUX
bioscience-222	228	13	recommended	recommend	VERB
bioscience-222	228	14	.	.	PUNCT
bioscience-222	229	1	however	however	ADV
bioscience-222	229	2	,	,	PUNCT
bioscience-222	229	3	this	this	DET
bioscience-222	229	4	study	study	NOUN
bioscience-222	229	5	presents	present	VERB
bioscience-222	229	6	the	the	DET
bioscience-222	229	7	first	first	ADJ
bioscience-222	229	8	set	set	NOUN
bioscience-222	229	9	of	of	ADP
bioscience-222	229	10	functional	functional	ADJ
bioscience-222	229	11	snp	snp	ADJ
bioscience-222	229	12	markers	marker	NOUN
bioscience-222	229	13	in	in	ADP
bioscience-222	229	14	chickpea	chickpea	PROPN
bioscience-222	229	15	(	(	PUNCT
bioscience-222	229	16	table	table	NOUN
bioscience-222	229	17	5	5	NUM
bioscience-222	229	18	)	)	PUNCT
bioscience-222	229	19	,	,	PUNCT
bioscience-222	229	20	which	which	PRON
bioscience-222	229	21	could	could	AUX
bioscience-222	229	22	be	be	AUX
bioscience-222	229	23	converted	convert	VERB
bioscience-222	229	24	to	to	ADP
bioscience-222	229	25	kompetitive	kompetitive	ADJ
bioscience-222	229	26	allele	allele	PROPN
bioscience-222	229	27	specific	specific	ADJ
bioscience-222	229	28	pcr	pcr	PROPN
bioscience-222	229	29	(	(	PUNCT
bioscience-222	229	30	kasp	kasp	NOUN
bioscience-222	229	31	)	)	PUNCT
bioscience-222	229	32	markers	marker	NOUN
bioscience-222	229	33	and	and	CCONJ
bioscience-222	229	34	applied	apply	VERB
bioscience-222	229	35	in	in	ADP
bioscience-222	229	36	mas	mas	PROPN
bioscience-222	229	37	breeding	breeding	NOUN
bioscience-222	229	38	programs	program	NOUN
bioscience-222	229	39	for	for	ADP
bioscience-222	229	40	ab	ab	PROPN
bioscience-222	229	41	resistance	resistance	NOUN
bioscience-222	229	42	in	in	ADP
bioscience-222	229	43	chickpea	chickpea	NOUN
bioscience-222	229	44	.	.	PUNCT
bioscience-222	230	1	reference	reference	NOUN
bioscience-222	230	2	1	1	NUM
bioscience-222	230	3	.	.	PUNCT
bioscience-222	231	1	udupa	udupa	PROPN
bioscience-222	231	2	sm	sm	PROPN
bioscience-222	231	3	,	,	PUNCT
bioscience-222	231	4	weigand	weigand	PROPN
bioscience-222	231	5	f	f	PROPN
bioscience-222	231	6	,	,	PUNCT
bioscience-222	231	7	saxena	saxena	PROPN
bioscience-222	231	8	mc	mc	PROPN
bioscience-222	231	9	,	,	PUNCT
bioscience-222	231	10	kahl	kahl	PROPN
bioscience-222	231	11	g.	g.	PROPN
bioscience-222	231	12	genotyping	genotype	VERB
bioscience-222	231	13	with	with	ADP
bioscience-222	231	14	rapd	rapd	NOUN
bioscience-222	231	15	and	and	CCONJ
bioscience-222	231	16	microsatellite	microsatellite	ADJ
bioscience-222	231	17	markers	marker	NOUN
bioscience-222	231	18	resolve	resolve	VERB
bioscience-222	231	19	pathotype	pathotype	NOUN
bioscience-222	231	20	diversity	diversity	NOUN
bioscience-222	231	21	in	in	ADP
bioscience-222	231	22	the	the	DET
bioscience-222	231	23	ascochyta	ascochyta	NOUN
bioscience-222	231	24	blight	blight	NOUN
bioscience-222	231	25	pathogen	pathogen	NOUN
bioscience-222	231	26	of	of	ADP
bioscience-222	231	27	chickpea	chickpea	NOUN
bioscience-222	231	28	.	.	PUNCT
bioscience-222	232	1	theoretical	theoretical	ADJ
bioscience-222	232	2	and	and	CCONJ
bioscience-222	232	3	applied	apply	VERB
bioscience-222	232	4	genetics	genetic	NOUN
bioscience-222	232	5	.	.	PUNCT
bioscience-222	233	1	1998;97:299	1998;97:299	NUM
bioscience-222	233	2	-	-	SYM
bioscience-222	233	3	307	307	NUM
bioscience-222	233	4	.	.	PUNCT
bioscience-222	234	1	2	2	NUM
bioscience-222	234	2	.	.	X
bioscience-222	234	3	imtiaz	imtiaz	PROPN
bioscience-222	234	4	m	m	PROPN
bioscience-222	234	5	,	,	PUNCT
bioscience-222	234	6	abang	abang	PROPN
bioscience-222	234	7	mm	mm	PROPN
bioscience-222	234	8	,	,	PUNCT
bioscience-222	234	9	malhotra	malhotra	PROPN
bioscience-222	234	10	rs	rs	PROPN
bioscience-222	234	11	,	,	PUNCT
bioscience-222	234	12	ahmed	ahmed	PROPN
bioscience-222	234	13	s	s	PROPN
bioscience-222	234	14	,	,	PUNCT
bioscience-222	234	15	bayaa	bayaa	PROPN
bioscience-222	234	16	b	b	PROPN
bioscience-222	234	17	,	,	PUNCT
bioscience-222	234	18	udupa	udupa	ADJ
bioscience-222	234	19	sm	sm	PROPN
bioscience-222	234	20	,	,	PUNCT
bioscience-222	234	21	et	et	PROPN
bioscience-222	234	22	al	al	PROPN
bioscience-222	234	23	.	.	PROPN
bioscience-222	234	24	pathotype	pathotype	PROPN
bioscience-222	234	25	iv	iv	PROPN
bioscience-222	234	26	,	,	PUNCT
bioscience-222	234	27	a	a	DET
bioscience-222	234	28	new	new	ADJ
bioscience-222	234	29	and	and	CCONJ
bioscience-222	234	30	highly	highly	ADV
bioscience-222	234	31	virulent	virulent	ADJ
bioscience-222	234	32	pathotype	pathotype	NOUN
bioscience-222	234	33	of	of	ADP
bioscience-222	234	34	didymellarabiei	didymellarabiei	PROPN
bioscience-222	234	35	,	,	PUNCT
bioscience-222	234	36	causing	cause	VERB
bioscience-222	234	37	ascochyta	ascochyta	NOUN
bioscience-222	234	38	blight	blight	NOUN
bioscience-222	234	39	in	in	ADP
bioscience-222	234	40	chickpea	chickpea	NOUN
bioscience-222	234	41	in	in	ADP
bioscience-222	234	42	syria	syria	PROPN
bioscience-222	234	43	.	.	PUNCT
bioscience-222	235	1	plant	plant	NOUN
bioscience-222	235	2	disease	disease	NOUN
bioscience-222	235	3	.	.	PUNCT
bioscience-222	236	1	2011;95(9):1192	2011;95(9):1192	NUM
bioscience-222	236	2	-	-	SYM
bioscience-222	236	3	2	2	NUM
bioscience-222	236	4	.	.	NOUN
bioscience-222	236	5	3	3	NUM
bioscience-222	236	6	.	.	PUNCT
bioscience-222	237	1	atik	atik	PROPN
bioscience-222	237	2	o	o	PROPN
bioscience-222	237	3	,	,	PUNCT
bioscience-222	237	4	ahmed	ahmed	PROPN
bioscience-222	237	5	s	s	PROPN
bioscience-222	237	6	,	,	PUNCT
bioscience-222	237	7	abang	abang	PROPN
bioscience-222	237	8	mm	mm	PROPN
bioscience-222	237	9	,	,	PUNCT
bioscience-222	237	10	imtiaz	imtiaz	PROPN
bioscience-222	237	11	m	m	PROPN
bioscience-222	237	12	,	,	PUNCT
bioscience-222	237	13	hamwieh	hamwieh	VERB
bioscience-222	237	14	a	a	PRON
bioscience-222	237	15	,	,	PUNCT
bioscience-222	237	16	baum	baum	PROPN
bioscience-222	237	17	m	m	PROPN
bioscience-222	237	18	,	,	PUNCT
bioscience-222	237	19	et	et	PROPN
bioscience-222	237	20	al	al	PROPN
bioscience-222	237	21	.	.	PROPN
bioscience-222	237	22	pathogenic	pathogenic	ADJ
bioscience-222	237	23	and	and	CCONJ
bioscience-222	237	24	genetic	genetic	ADJ
bioscience-222	237	25	diversity	diversity	NOUN
bioscience-222	237	26	of	of	ADP
bioscience-222	237	27	didymella	didymella	PROPN
bioscience-222	237	28	rabiei	rabiei	PROPN
bioscience-222	237	29	affecting	affect	VERB
bioscience-222	237	30	chickpea	chickpea	NOUN
bioscience-222	237	31	in	in	ADP
bioscience-222	237	32	syria	syria	PROPN
bioscience-222	237	33	.	.	PUNCT
bioscience-222	238	1	crop	crop	NOUN
bioscience-222	238	2	protection	protection	NOUN
bioscience-222	238	3	.	.	PUNCT
bioscience-222	239	1	2013;46:70	2013;46:70	NUM
bioscience-222	239	2	-	-	SYM
bioscience-222	239	3	9	9	NUM
bioscience-222	239	4	.	.	NOUN
bioscience-222	239	5	4	4	NUM
bioscience-222	239	6	.	.	X
bioscience-222	239	7	pande	pande	PROPN
bioscience-222	239	8	s	s	PROPN
bioscience-222	239	9	,	,	PUNCT
bioscience-222	239	10	siddique	siddique	PROPN
bioscience-222	239	11	kh	kh	PROPN
bioscience-222	239	12	,	,	PUNCT
bioscience-222	239	13	kishore	kishore	PROPN
bioscience-222	239	14	g	g	PROPN
bioscience-222	239	15	,	,	PUNCT
bioscience-222	239	16	bayaa	bayaa	PROPN
bioscience-222	239	17	b	b	PROPN
bioscience-222	239	18	,	,	PUNCT
bioscience-222	239	19	gaur	gaur	NOUN
bioscience-222	239	20	p	p	NOUN
bioscience-222	239	21	,	,	PUNCT
bioscience-222	239	22	gowda	gowda	PROPN
bioscience-222	239	23	c	c	PROPN
bioscience-222	239	24	,	,	PUNCT
bioscience-222	239	25	et	et	PROPN
bioscience-222	239	26	al	al	PROPN
bioscience-222	239	27	.	.	PROPN
bioscience-222	239	28	ascochyta	ascochyta	PROPN
bioscience-222	239	29	blight	blight	NOUN
bioscience-222	239	30	of	of	ADP
bioscience-222	239	31	chickpea	chickpea	NOUN
bioscience-222	239	32	(	(	PUNCT
bioscience-222	239	33	cicer	cicer	VERB
bioscience-222	239	34	arietinum	arietinum	DET
bioscience-222	239	35	l.	l.	NOUN
bioscience-222	239	36	):	):	PUNCT
bioscience-222	239	37	a	a	DET
bioscience-222	239	38	review	review	NOUN
bioscience-222	239	39	of	of	ADP
bioscience-222	239	40	biology	biology	NOUN
bioscience-222	239	41	,	,	PUNCT
bioscience-222	239	42	pathogenicity	pathogenicity	NOUN
bioscience-222	239	43	,	,	PUNCT
bioscience-222	239	44	and	and	CCONJ
bioscience-222	239	45	disease	disease	NOUN
bioscience-222	239	46	management	management	NOUN
bioscience-222	239	47	.	.	PUNCT
bioscience-222	240	1	australian	australian	ADJ
bioscience-222	240	2	journal	journal	NOUN
bioscience-222	240	3	of	of	ADP
bioscience-222	240	4	agricultural	agricultural	ADJ
bioscience-222	240	5	research	research	NOUN
bioscience-222	240	6	.	.	PUNCT
bioscience-222	241	1	2005;56(4):31732	2005;56(4):31732	NUM
bioscience-222	241	2	.	.	X
bioscience-222	242	1	5	5	NUM
bioscience-222	242	2	.	.	X
bioscience-222	242	3	li	li	PROPN
bioscience-222	242	4	h	h	PROPN
bioscience-222	242	5	,	,	PUNCT
bioscience-222	242	6	rodda	rodda	PROPN
bioscience-222	242	7	m	m	PROPN
bioscience-222	242	8	,	,	PUNCT
bioscience-222	242	9	gnanasambandam	gnanasambandam	PROPN
bioscience-222	242	10	a	a	PRON
bioscience-222	242	11	,	,	PUNCT
bioscience-222	242	12	aftab	aftab	PROPN
bioscience-222	242	13	m	m	PROPN
bioscience-222	242	14	,	,	PUNCT
bioscience-222	242	15	redden	redden	VERB
bioscience-222	242	16	r	r	NOUN
bioscience-222	242	17	,	,	PUNCT
bioscience-222	242	18	hobson	hobson	PROPN
bioscience-222	242	19	k	k	PROPN
bioscience-222	242	20	,	,	PUNCT
bioscience-222	242	21	et	et	PROPN
bioscience-222	242	22	al	al	PROPN
bioscience-222	242	23	.	.	PUNCT
bioscience-222	243	1	breeding	breed	VERB
bioscience-222	243	2	for	for	ADP
bioscience-222	243	3	biotic	biotic	ADJ
bioscience-222	243	4	stress	stress	NOUN
bioscience-222	243	5	resistance	resistance	NOUN
bioscience-222	243	6	in	in	ADP
bioscience-222	243	7	chickpea	chickpea	NOUN
bioscience-222	243	8	:	:	PUNCT
bioscience-222	243	9	progress	progress	NOUN
bioscience-222	243	10	and	and	CCONJ
bioscience-222	243	11	prospects	prospect	NOUN
bioscience-222	243	12	.	.	PUNCT
bioscience-222	244	1	euphytica	euphytica	PROPN
bioscience-222	244	2	.	.	PUNCT
bioscience-222	245	1	2015;204:25788	2015;204:25788	NUM
bioscience-222	245	2	.	.	PUNCT
bioscience-222	246	1	6	6	NUM
bioscience-222	246	2	.	.	X
bioscience-222	246	3	tekeoglu	tekeoglu	PROPN
bioscience-222	246	4	m	m	PROPN
bioscience-222	246	5	,	,	PUNCT
bioscience-222	246	6	rajesh	rajesh	PROPN
bioscience-222	246	7	p	p	PROPN
bioscience-222	246	8	,	,	PUNCT
bioscience-222	246	9	muehlbauer	muehlbauer	NOUN
bioscience-222	246	10	f.	f.	PROPN
bioscience-222	246	11	integration	integration	NOUN
bioscience-222	246	12	of	of	ADP
bioscience-222	246	13	sequence	sequence	NOUN
bioscience-222	246	14	tagged	tag	VERB
bioscience-222	246	15	microsatellite	microsatellite	ADJ
bioscience-222	246	16	sites	site	NOUN
bioscience-222	246	17	to	to	ADP
bioscience-222	246	18	the	the	DET
bioscience-222	246	19	chickpea	chickpea	ADJ
bioscience-222	246	20	genetic	genetic	ADJ
bioscience-222	246	21	map	map	NOUN
bioscience-222	246	22	.	.	PUNCT
bioscience-222	247	1	theoretical	theoretical	ADJ
bioscience-222	247	2	and	and	CCONJ
bioscience-222	247	3	applied	apply	VERB
bioscience-222	247	4	genetics	genetic	NOUN
bioscience-222	247	5	.	.	PUNCT
bioscience-222	248	1	2002;105(6	2002;105(6	NUM
bioscience-222	248	2	-	-	PUNCT
bioscience-222	248	3	7):84754	7):84754	NUM
bioscience-222	248	4	.	.	PUNCT
bioscience-222	249	1	7	7	X
bioscience-222	249	2	.	.	X
bioscience-222	249	3	flandez	flandez	PROPN
bioscience-222	249	4	-	-	PUNCT
bioscience-222	249	5	galvez	galvez	PROPN
bioscience-222	249	6	h	h	PROPN
bioscience-222	249	7	,	,	PUNCT
bioscience-222	249	8	ades	ades	PROPN
bioscience-222	249	9	pk	pk	PROPN
bioscience-222	249	10	,	,	PUNCT
bioscience-222	249	11	ford	ford	PROPN
bioscience-222	249	12	r	r	PROPN
bioscience-222	249	13	,	,	PUNCT
bioscience-222	249	14	pang	pang	PROPN
bioscience-222	249	15	eck	eck	PROPN
bioscience-222	249	16	,	,	PUNCT
bioscience-222	249	17	taylor	taylor	PROPN
bioscience-222	249	18	pwj	pwj	PROPN
bioscience-222	249	19	.	.	PUNCT
bioscience-222	250	1	qtl	qtl	PROPN
bioscience-222	250	2	analysis	analysis	NOUN
bioscience-222	250	3	for	for	ADP
bioscience-222	250	4	ascochyta	ascochyta	NOUN
bioscience-222	250	5	blight	blight	NOUN
bioscience-222	250	6	resistance	resistance	NOUN
bioscience-222	250	7	in	in	ADP
bioscience-222	250	8	an	an	DET
bioscience-222	250	9	intraspecific	intraspecific	NOUN
bioscience-222	250	10	population	population	NOUN
bioscience-222	250	11	of	of	ADP
bioscience-222	250	12	chickpea	chickpea	PROPN
bioscience-222	250	13	(	(	PUNCT
bioscience-222	250	14	cicer	cicer	VERB
bioscience-222	250	15	arietinum	arietinum	DET
bioscience-222	250	16	l.	l.	PROPN
bioscience-222	250	17	)	)	PUNCT
bioscience-222	250	18	.	.	PUNCT
bioscience-222	251	1	theoretical	theoretical	ADJ
bioscience-222	251	2	and	and	CCONJ
bioscience-222	251	3	applied	apply	VERB
bioscience-222	251	4	genetics	genetic	NOUN
bioscience-222	251	5	.	.	PUNCT
bioscience-222	252	1	2003;107(7):1257	2003;107(7):1257	NUM
bioscience-222	252	2	-	-	SYM
bioscience-222	252	3	65	65	NUM
bioscience-222	252	4	.	.	NOUN
bioscience-222	252	5	8	8	NUM
bioscience-222	252	6	.	.	X
bioscience-222	253	1	flandez	flandez	PROPN
bioscience-222	253	2	-	-	PUNCT
bioscience-222	253	3	galvez	galvez	PROPN
bioscience-222	253	4	h	h	PROPN
bioscience-222	253	5	,	,	PUNCT
bioscience-222	253	6	ford	ford	PROPN
bioscience-222	253	7	r	r	PROPN
bioscience-222	253	8	,	,	PUNCT
bioscience-222	253	9	pang	pang	PROPN
bioscience-222	253	10	eck	eck	PROPN
bioscience-222	253	11	,	,	PUNCT
bioscience-222	253	12	taylor	taylor	PROPN
bioscience-222	253	13	pwj	pwj	PROPN
bioscience-222	253	14	.	.	PUNCT
bioscience-222	254	1	an	an	DET
bioscience-222	254	2	intraspecific	intraspecific	NOUN
bioscience-222	254	3	linkage	linkage	NOUN
bioscience-222	254	4	map	map	NOUN
bioscience-222	254	5	of	of	ADP
bioscience-222	254	6	the	the	DET
bioscience-222	254	7	chickpea	chickpea	NOUN
bioscience-222	254	8	(	(	PUNCT
bioscience-222	254	9	cicer	cicer	VERB
bioscience-222	254	10	arietinum	arietinum	DET
bioscience-222	254	11	l.	l.	PROPN
bioscience-222	254	12	)	)	PUNCT
bioscience-222	254	13	genome	genome	NOUN
bioscience-222	254	14	based	base	VERB
bioscience-222	254	15	on	on	ADP
bioscience-222	254	16	sequence	sequence	NOUN
bioscience-222	254	17	tagged	tag	VERB
bioscience-222	254	18	microsatellite	microsatellite	NOUN
bioscience-222	254	19	site	site	NOUN
bioscience-222	254	20	and	and	CCONJ
bioscience-222	254	21	resistance	resistance	NOUN
bioscience-222	254	22	gene	gene	NOUN
bioscience-222	254	23	analog	analog	NOUN
bioscience-222	254	24	markers	marker	NOUN
bioscience-222	254	25	.	.	PUNCT
bioscience-222	255	1	theoretical	theoretical	ADJ
bioscience-222	255	2	and	and	CCONJ
bioscience-222	255	3	applied	apply	VERB
bioscience-222	255	4	genetics	genetic	NOUN
bioscience-222	255	5	.	.	PUNCT
bioscience-222	256	1	2003;106(8):1447	2003;106(8):1447	NUM
bioscience-222	256	2	-	-	SYM
bioscience-222	256	3	56	56	NUM
bioscience-222	256	4	.	.	NOUN
bioscience-222	256	5	9	9	NUM
bioscience-222	256	6	.	.	X
bioscience-222	256	7	udupa	udupa	PROPN
bioscience-222	256	8	sm	sm	PROPN
bioscience-222	256	9	,	,	PUNCT
bioscience-222	256	10	baum	baum	PROPN
bioscience-222	256	11	m.	m.	PROPN
bioscience-222	256	12	genetic	genetic	ADJ
bioscience-222	256	13	dissection	dissection	NOUN
bioscience-222	256	14	of	of	ADP
bioscience-222	256	15	pathotypespecific	pathotypespecific	ADJ
bioscience-222	256	16	resistance	resistance	NOUN
bioscience-222	256	17	to	to	ADP
bioscience-222	256	18	ascochyta	ascochyta	NOUN
bioscience-222	256	19	blight	blight	NOUN
bioscience-222	256	20	disease	disease	NOUN
bioscience-222	256	21	in	in	ADP
bioscience-222	256	22	chickpea	chickpea	NOUN
bioscience-222	256	23	(	(	PUNCT
bioscience-222	256	24	cicer	cicer	VERB
bioscience-222	256	25	arietinum	arietinum	DET
bioscience-222	256	26	l.	l.	PROPN
bioscience-222	256	27	)	)	PUNCT
bioscience-222	256	28	using	use	VERB
bioscience-222	256	29	microsatellite	microsatellite	ADJ
bioscience-222	256	30	markers	marker	NOUN
bioscience-222	256	31	.	.	PUNCT
bioscience-222	257	1	theoretical	theoretical	ADJ
bioscience-222	257	2	and	and	CCONJ
bioscience-222	257	3	applied	apply	VERB
bioscience-222	257	4	genetics	genetic	NOUN
bioscience-222	257	5	.	.	PUNCT
bioscience-222	258	1	2003;106(7):1196	2003;106(7):1196	NUM
bioscience-222	258	2	-	-	SYM
bioscience-222	258	3	202	202	NUM
bioscience-222	258	4	.	.	PUNCT
bioscience-222	259	1	10	10	NUM
bioscience-222	259	2	.	.	PUNCT
bioscience-222	260	1	cho	cho	PROPN
bioscience-222	260	2	s	s	PROPN
bioscience-222	260	3	,	,	PUNCT
bioscience-222	260	4	chen	chen	PROPN
bioscience-222	260	5	w	w	PROPN
bioscience-222	260	6	,	,	PUNCT
bioscience-222	260	7	muehlbauer	muehlbauer	PROPN
bioscience-222	260	8	fj	fj	PROPN
bioscience-222	260	9	.	.	PUNCT
bioscience-222	260	10	pathotype	pathotype	NOUN
bioscience-222	260	11	-	-	PUNCT
bioscience-222	260	12	specific	specific	ADJ
bioscience-222	260	13	genetic	genetic	ADJ
bioscience-222	260	14	factors	factor	NOUN
bioscience-222	260	15	in	in	ADP
bioscience-222	260	16	chickpea	chickpea	NOUN
bioscience-222	260	17	(	(	PUNCT
bioscience-222	260	18	cicer	cicer	VERB
bioscience-222	260	19	arietinum	arietinum	DET
bioscience-222	260	20	l.	l.	PROPN
bioscience-222	260	21	)	)	PUNCT
bioscience-222	260	22	for	for	ADP
bioscience-222	260	23	quantitative	quantitative	ADJ
bioscience-222	260	24	resistance	resistance	NOUN
bioscience-222	260	25	to	to	ADP
bioscience-222	260	26	ascochyta	ascochyta	NOUN
bioscience-222	260	27	blight	blight	NOUN
bioscience-222	260	28	.	.	PUNCT
bioscience-222	261	1	theoretical	theoretical	ADJ
bioscience-222	261	2	and	and	CCONJ
bioscience-222	261	3	applied	apply	VERB
bioscience-222	261	4	genetics	genetic	NOUN
bioscience-222	261	5	.	.	PUNCT
bioscience-222	262	1	2004;109(4):733	2004;109(4):733	NUM
bioscience-222	262	2	-	-	SYM
bioscience-222	262	3	9	9	NUM
bioscience-222	262	4	.	.	NOUN
bioscience-222	262	5	11	11	NUM
bioscience-222	262	6	.	.	X
bioscience-222	263	1	iruela	iruela	PROPN
bioscience-222	263	2	m	m	PROPN
bioscience-222	263	3	,	,	PUNCT
bioscience-222	263	4	rubio	rubio	PROPN
bioscience-222	263	5	j	j	PROPN
bioscience-222	263	6	,	,	PUNCT
bioscience-222	263	7	barro	barro	PROPN
bioscience-222	263	8	f	f	PROPN
bioscience-222	263	9	,	,	PUNCT
bioscience-222	263	10	cubero	cubero	PROPN
bioscience-222	263	11	ji	ji	PROPN
bioscience-222	263	12	,	,	PUNCT
bioscience-222	263	13	millán	millán	NOUN
bioscience-222	263	14	t	t	PROPN
bioscience-222	263	15	,	,	PUNCT
bioscience-222	263	16	gil	gil	PROPN
bioscience-222	263	17	j.	j.	PROPN
bioscience-222	263	18	detection	detection	PROPN
bioscience-222	263	19	of	of	ADP
bioscience-222	263	20	two	two	NUM
bioscience-222	263	21	quantitative	quantitative	ADJ
bioscience-222	263	22	trait	trait	NOUN
bioscience-222	263	23	loci	loci	NOUN
bioscience-222	263	24	for	for	ADP
bioscience-222	263	25	resistance	resistance	NOUN
bioscience-222	263	26	to	to	ADP
bioscience-222	263	27	ascochyta	ascochyta	NOUN
bioscience-222	263	28	blight	blight	NOUN
bioscience-222	263	29	in	in	ADP
bioscience-222	263	30	an	an	DET
bioscience-222	263	31	intra	intra	ADJ
bioscience-222	263	32	-	-	ADJ
bioscience-222	263	33	specific	specific	ADJ
bioscience-222	263	34	cross	cross	NOUN
bioscience-222	263	35	of	of	ADP
bioscience-222	263	36	chickpea	chickpea	NOUN
bioscience-222	263	37	(	(	PUNCT
bioscience-222	263	38	cicer	cicer	VERB
bioscience-222	263	39	arietinum	arietinum	DET
bioscience-222	263	40	highlights	highlight	NOUN
bioscience-222	263	41	in	in	ADP
bioscience-222	263	42	bioscience	bioscience	NOUN
bioscience-222	263	43	page	page	NOUN
bioscience-222	263	44	9	9	NUM
bioscience-222	263	45	of	of	ADP
bioscience-222	263	46	11	11	NUM
bioscience-222	263	47	december	december	PROPN
bioscience-222	263	48	2024|volume	2024|volume	NUM
bioscience-222	263	49	7	7	NUM
bioscience-222	264	1	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	264	2	hamwieh	hamwieh	NOUN
bioscience-222	264	3	et	et	PROPN
bioscience-222	264	4	al	al	PROPN
bioscience-222	264	5	.	.	PROPN
bioscience-222	264	6	,	,	PUNCT
bioscience-222	264	7	2024	2024	NUM
bioscience-222	264	8	exploring	explore	VERB
bioscience-222	264	9	qtl	qtl	PROPN
bioscience-222	264	10	genes	gene	NOUN
bioscience-222	264	11	contribute	contribute	VERB
bioscience-222	264	12	to	to	ADP
bioscience-222	264	13	chickpea	chickpea	PROPN
bioscience-222	264	14	ascochyta	ascochyta	NOUN
bioscience-222	264	15	blight	blight	NOUN
bioscience-222	264	16	resistance	resistance	NOUN
bioscience-222	264	17	l.	l.	PROPN
bioscience-222	264	18	):	):	PUNCT
bioscience-222	264	19	development	development	NOUN
bioscience-222	264	20	of	of	ADP
bioscience-222	264	21	scar	scar	ADJ
bioscience-222	264	22	markers	marker	NOUN
bioscience-222	264	23	associated	associate	VERB
bioscience-222	264	24	with	with	ADP
bioscience-222	264	25	resistance	resistance	NOUN
bioscience-222	264	26	.	.	PUNCT
bioscience-222	265	1	theoretical	theoretical	ADJ
bioscience-222	265	2	and	and	CCONJ
bioscience-222	265	3	applied	apply	VERB
bioscience-222	265	4	genetics	genetic	NOUN
bioscience-222	265	5	.	.	PUNCT
bioscience-222	266	1	2006;112(2):27887	2006;112(2):27887	NUM
bioscience-222	266	2	.	.	NOUN
bioscience-222	266	3	12	12	NUM
bioscience-222	266	4	.	.	PUNCT
bioscience-222	267	1	lichtenzveig	lichtenzveig	PROPN
bioscience-222	267	2	j	j	PROPN
bioscience-222	267	3	,	,	PUNCT
bioscience-222	267	4	bonfil	bonfil	PROPN
bioscience-222	267	5	dj	dj	PROPN
bioscience-222	267	6	,	,	PUNCT
bioscience-222	267	7	zhang	zhang	PROPN
bioscience-222	267	8	hb	hb	PROPN
bioscience-222	267	9	,	,	PUNCT
bioscience-222	267	10	shtienberg	shtienberg	PROPN
bioscience-222	267	11	d	d	PROPN
bioscience-222	267	12	,	,	PUNCT
bioscience-222	267	13	abbo	abbo	PROPN
bioscience-222	267	14	s.	s.	PROPN
bioscience-222	267	15	mapping	map	VERB
bioscience-222	267	16	quantitative	quantitative	ADJ
bioscience-222	267	17	trait	trait	NOUN
bioscience-222	267	18	loci	locus	NOUN
bioscience-222	267	19	in	in	ADP
bioscience-222	267	20	chickpea	chickpea	NOUN
bioscience-222	267	21	associated	associate	VERB
bioscience-222	267	22	with	with	ADP
bioscience-222	267	23	time	time	NOUN
bioscience-222	267	24	to	to	ADP
bioscience-222	267	25	flowering	flowering	NOUN
bioscience-222	267	26	and	and	CCONJ
bioscience-222	267	27	resistance	resistance	NOUN
bioscience-222	267	28	to	to	ADP
bioscience-222	267	29	didymella	didymella	PROPN
bioscience-222	267	30	rabiei	rabiei	PROPN
bioscience-222	267	31	the	the	DET
bioscience-222	267	32	causal	causal	ADJ
bioscience-222	267	33	agent	agent	NOUN
bioscience-222	267	34	of	of	ADP
bioscience-222	267	35	ascochyta	ascochyta	NOUN
bioscience-222	267	36	blight	blight	NOUN
bioscience-222	267	37	.	.	PUNCT
bioscience-222	268	1	theoretical	theoretical	ADJ
bioscience-222	268	2	and	and	CCONJ
bioscience-222	268	3	applied	apply	VERB
bioscience-222	268	4	genetics	genetic	NOUN
bioscience-222	268	5	.	.	PUNCT
bioscience-222	269	1	2006;113:1357	2006;113:1357	NUM
bioscience-222	269	2	-	-	SYM
bioscience-222	269	3	69	69	NUM
bioscience-222	269	4	.	.	PUNCT
bioscience-222	270	1	13	13	NUM
bioscience-222	270	2	.	.	PUNCT
bioscience-222	271	1	taran	taran	PROPN
bioscience-222	271	2	b	b	PROPN
bioscience-222	271	3	,	,	PUNCT
bioscience-222	271	4	warkentin	warkentin	PROPN
bioscience-222	271	5	t	t	PROPN
bioscience-222	271	6	,	,	PUNCT
bioscience-222	271	7	tullu	tullu	NOUN
bioscience-222	271	8	a	a	PRON
bioscience-222	271	9	,	,	PUNCT
bioscience-222	271	10	vandenberg	vandenberg	PROPN
bioscience-222	271	11	a.	a.	NOUN
bioscience-222	271	12	genetic	genetic	ADJ
bioscience-222	271	13	relationships	relationship	NOUN
bioscience-222	271	14	among	among	ADP
bioscience-222	271	15	chickpea	chickpea	NOUN
bioscience-222	271	16	(	(	PUNCT
bioscience-222	271	17	cicer	cicer	VERB
bioscience-222	271	18	arietinum	arietinum	DET
bioscience-222	271	19	l.	l.	PROPN
bioscience-222	271	20	)	)	PUNCT
bioscience-222	271	21	genotypes	genotype	NOUN
bioscience-222	271	22	based	base	VERB
bioscience-222	271	23	on	on	ADP
bioscience-222	271	24	the	the	DET
bioscience-222	271	25	ssrs	ssr	NOUN
bioscience-222	271	26	at	at	ADP
bioscience-222	271	27	the	the	DET
bioscience-222	271	28	quantitative	quantitative	ADJ
bioscience-222	271	29	trait	trait	NOUN
bioscience-222	271	30	loci	loci	NOUN
bioscience-222	271	31	for	for	ADP
bioscience-222	271	32	resistance	resistance	NOUN
bioscience-222	271	33	to	to	ADP
bioscience-222	271	34	ascochyta	ascochyta	NOUN
bioscience-222	271	35	blight	blight	NOUN
bioscience-222	271	36	.	.	PUNCT
bioscience-222	272	1	european	european	PROPN
bioscience-222	272	2	journal	journal	PROPN
bioscience-222	272	3	of	of	ADP
bioscience-222	272	4	plant	plant	NOUN
bioscience-222	272	5	pathology	pathology	NOUN
bioscience-222	272	6	.	.	PUNCT
bioscience-222	273	1	2007;119(1):39	2007;119(1):39	NUM
bioscience-222	273	2	-	-	SYM
bioscience-222	273	3	51	51	NUM
bioscience-222	273	4	.	.	PUNCT
bioscience-222	273	5	14	14	NUM
bioscience-222	273	6	.	.	PUNCT
bioscience-222	274	1	anbessa	anbessa	PROPN
bioscience-222	274	2	y	y	PROPN
bioscience-222	274	3	,	,	PUNCT
bioscience-222	274	4	taran	taran	PROPN
bioscience-222	274	5	b	b	PROPN
bioscience-222	274	6	,	,	PUNCT
bioscience-222	274	7	warkentin	warkentin	ADJ
bioscience-222	274	8	td	td	NOUN
bioscience-222	274	9	,	,	PUNCT
bioscience-222	274	10	tullu	tullu	NOUN
bioscience-222	274	11	a	a	PRON
bioscience-222	274	12	,	,	PUNCT
bioscience-222	274	13	vandenberg	vandenberg	PROPN
bioscience-222	274	14	a.	a.	PROPN
bioscience-222	274	15	genetic	genetic	PROPN
bioscience-222	274	16	analyses	analysis	NOUN
bioscience-222	274	17	and	and	CCONJ
bioscience-222	274	18	conservation	conservation	NOUN
bioscience-222	274	19	of	of	ADP
bioscience-222	274	20	qtl	qtl	PROPN
bioscience-222	274	21	for	for	ADP
bioscience-222	274	22	ascochyta	ascochyta	NOUN
bioscience-222	274	23	blight	blight	NOUN
bioscience-222	274	24	resistance	resistance	NOUN
bioscience-222	274	25	in	in	ADP
bioscience-222	274	26	chickpea	chickpea	NOUN
bioscience-222	274	27	(	(	PUNCT
bioscience-222	274	28	cicer	cicer	VERB
bioscience-222	274	29	arietinum	arietinum	DET
bioscience-222	274	30	l.	l.	PROPN
bioscience-222	274	31	)	)	PUNCT
bioscience-222	274	32	.	.	PUNCT
bioscience-222	275	1	theoretical	theoretical	ADJ
bioscience-222	275	2	and	and	CCONJ
bioscience-222	275	3	applied	apply	VERB
bioscience-222	275	4	genetics	genetic	NOUN
bioscience-222	275	5	.	.	PUNCT
bioscience-222	276	1	2009;119(4):757	2009;119(4):757	NUM
bioscience-222	276	2	-	-	SYM
bioscience-222	276	3	65	65	NUM
bioscience-222	276	4	.	.	NOUN
bioscience-222	277	1	15	15	NUM
bioscience-222	277	2	.	.	PUNCT
bioscience-222	278	1	kottapalli	kottapalli	PROPN
bioscience-222	278	2	p	p	X
bioscience-222	278	3	,	,	PUNCT
bioscience-222	278	4	gaur	gaur	NOUN
bioscience-222	278	5	pm	pm	NOUN
bioscience-222	278	6	,	,	PUNCT
bioscience-222	278	7	katiyar	katiyar	PROPN
bioscience-222	278	8	sk	sk	PROPN
bioscience-222	278	9	,	,	PUNCT
bioscience-222	278	10	crouch	crouch	PROPN
bioscience-222	278	11	jh	jh	PROPN
bioscience-222	278	12	,	,	PUNCT
bioscience-222	278	13	buhariwalla	buhariwalla	PROPN
bioscience-222	278	14	hk	hk	PROPN
bioscience-222	278	15	,	,	PUNCT
bioscience-222	278	16	pande	pande	PROPN
bioscience-222	278	17	s	s	PROPN
bioscience-222	278	18	,	,	PUNCT
bioscience-222	278	19	et	et	PROPN
bioscience-222	278	20	al	al	PROPN
bioscience-222	278	21	.	.	PUNCT
bioscience-222	279	1	mapping	mapping	NOUN
bioscience-222	279	2	and	and	CCONJ
bioscience-222	279	3	validation	validation	NOUN
bioscience-222	279	4	of	of	ADP
bioscience-222	279	5	qtls	qtls	PROPN
bioscience-222	279	6	for	for	ADP
bioscience-222	279	7	resistance	resistance	NOUN
bioscience-222	279	8	to	to	ADP
bioscience-222	279	9	an	an	DET
bioscience-222	279	10	indian	indian	ADJ
bioscience-222	279	11	isolate	isolate	NOUN
bioscience-222	279	12	of	of	ADP
bioscience-222	279	13	ascochyta	ascochyta	NOUN
bioscience-222	279	14	blight	blight	NOUN
bioscience-222	279	15	pathogen	pathogen	NOUN
bioscience-222	279	16	in	in	ADP
bioscience-222	279	17	chickpea	chickpea	NOUN
bioscience-222	279	18	.	.	PUNCT
bioscience-222	280	1	euphytica	euphytica	PROPN
bioscience-222	280	2	.	.	PUNCT
bioscience-222	281	1	2009;165(1):79	2009;165(1):79	NUM
bioscience-222	281	2	-	-	SYM
bioscience-222	281	3	88	88	NUM
bioscience-222	281	4	.	.	PUNCT
bioscience-222	282	1	16	16	NUM
bioscience-222	282	2	.	.	PUNCT
bioscience-222	283	1	winter	winter	NOUN
bioscience-222	283	2	p	p	NOUN
bioscience-222	283	3	,	,	PUNCT
bioscience-222	283	4	benko	benko	PROPN
bioscience-222	283	5	-	-	PUNCT
bioscience-222	283	6	iseppon	iseppon	NOUN
bioscience-222	283	7	am	am	NOUN
bioscience-222	283	8	,	,	PUNCT
bioscience-222	283	9	hüttel	hüttel	NOUN
bioscience-222	283	10	b	b	NOUN
bioscience-222	283	11	,	,	PUNCT
bioscience-222	283	12	ratnaparkhe	ratnaparkhe	ADJ
bioscience-222	283	13	m	m	PROPN
bioscience-222	283	14	,	,	PUNCT
bioscience-222	283	15	tullu	tullu	VERB
bioscience-222	283	16	a	a	PRON
bioscience-222	283	17	,	,	PUNCT
bioscience-222	283	18	sonnante	sonnante	NOUN
bioscience-222	283	19	g	g	NOUN
bioscience-222	283	20	,	,	PUNCT
bioscience-222	283	21	et	et	PROPN
bioscience-222	283	22	al	al	PROPN
bioscience-222	283	23	.	.	PUNCT
bioscience-222	284	1	a	a	DET
bioscience-222	284	2	linkage	linkage	NOUN
bioscience-222	284	3	map	map	NOUN
bioscience-222	284	4	of	of	ADP
bioscience-222	284	5	the	the	DET
bioscience-222	284	6	chickpea	chickpea	NOUN
bioscience-222	284	7	(	(	PUNCT
bioscience-222	284	8	cicer	cicer	VERB
bioscience-222	284	9	arietinum	arietinum	DET
bioscience-222	284	10	l.	l.	PROPN
bioscience-222	284	11	)	)	PUNCT
bioscience-222	284	12	genome	genome	NOUN
bioscience-222	284	13	based	base	VERB
bioscience-222	284	14	on	on	ADP
bioscience-222	284	15	recombinant	recombinant	ADJ
bioscience-222	284	16	inbred	inbred	ADJ
bioscience-222	284	17	lines	line	NOUN
bioscience-222	284	18	from	from	ADP
bioscience-222	284	19	a	a	DET
bioscience-222	284	20	c.	c.	NOUN
bioscience-222	284	21	arietinum	arietinum	DET
bioscience-222	284	22	œ	œ	PROPN
bioscience-222	284	23	c.	c.	PROPN
bioscience-222	284	24	reticulatum	reticulatum	PROPN
bioscience-222	284	25	cross	cross	PROPN
bioscience-222	284	26	:	:	PUNCT
bioscience-222	284	27	localization	localization	NOUN
bioscience-222	284	28	of	of	ADP
bioscience-222	284	29	resistance	resistance	NOUN
bioscience-222	284	30	genes	gene	NOUN
bioscience-222	284	31	for	for	ADP
bioscience-222	284	32	fusarium	fusarium	NOUN
bioscience-222	284	33	wilt	wilt	ADJ
bioscience-222	284	34	races	race	NOUN
bioscience-222	284	35	4	4	NUM
bioscience-222	284	36	and	and	CCONJ
bioscience-222	284	37	5	5	NUM
bioscience-222	284	38	.	.	NOUN
bioscience-222	284	39	theoretical	theoretical	ADJ
bioscience-222	284	40	and	and	CCONJ
bioscience-222	284	41	applied	apply	VERB
bioscience-222	284	42	genetics	genetic	NOUN
bioscience-222	284	43	.	.	PUNCT
bioscience-222	285	1	2000;101(7):1155	2000;101(7):1155	NUM
bioscience-222	285	2	-	-	SYM
bioscience-222	285	3	63	63	NUM
bioscience-222	285	4	.	.	PUNCT
bioscience-222	286	1	17	17	NUM
bioscience-222	286	2	.	.	PUNCT
bioscience-222	287	1	imtiaz	imtiaz	PROPN
bioscience-222	287	2	m	m	PROPN
bioscience-222	287	3	,	,	PUNCT
bioscience-222	287	4	materne	materne	PROPN
bioscience-222	287	5	m	m	PROPN
bioscience-222	287	6	,	,	PUNCT
bioscience-222	287	7	hobson	hobson	PROPN
bioscience-222	287	8	k	k	PROPN
bioscience-222	287	9	,	,	PUNCT
bioscience-222	287	10	van	van	PROPN
bioscience-222	287	11	ginkel	ginkel	NOUN
bioscience-222	287	12	m	m	PROPN
bioscience-222	287	13	,	,	PUNCT
bioscience-222	287	14	malhotra	malhotra	PROPN
bioscience-222	287	15	rs	rs	PROPN
bioscience-222	287	16	.	.	PUNCT
bioscience-222	288	1	molecular	molecular	ADJ
bioscience-222	288	2	genetic	genetic	ADJ
bioscience-222	288	3	diversity	diversity	NOUN
bioscience-222	288	4	and	and	CCONJ
bioscience-222	288	5	linked	link	VERB
bioscience-222	288	6	resistance	resistance	NOUN
bioscience-222	288	7	to	to	ADP
bioscience-222	288	8	ascochyta	ascochyta	NOUN
bioscience-222	288	9	blight	blight	NOUN
bioscience-222	288	10	in	in	ADP
bioscience-222	288	11	australian	australian	ADJ
bioscience-222	288	12	chickpea	chickpea	NOUN
bioscience-222	288	13	breeding	breeding	NOUN
bioscience-222	288	14	materials	material	NOUN
bioscience-222	288	15	and	and	CCONJ
bioscience-222	288	16	their	their	PRON
bioscience-222	288	17	wild	wild	ADJ
bioscience-222	288	18	relatives	relative	NOUN
bioscience-222	288	19	.	.	PUNCT
bioscience-222	289	1	australian	australian	ADJ
bioscience-222	289	2	journal	journal	NOUN
bioscience-222	289	3	of	of	ADP
bioscience-222	289	4	agricultural	agricultural	ADJ
bioscience-222	289	5	research	research	NOUN
bioscience-222	289	6	.	.	PUNCT
bioscience-222	290	1	2008;59(6):554	2008;59(6):554	NUM
bioscience-222	290	2	-	-	PUNCT
bioscience-222	290	3	60	60	NUM
bioscience-222	290	4	.	.	PUNCT
bioscience-222	290	5	18	18	NUM
bioscience-222	290	6	.	.	PUNCT
bioscience-222	291	1	bouhadida	bouhadida	PROPN
bioscience-222	291	2	m	m	PROPN
bioscience-222	291	3	,	,	PUNCT
bioscience-222	291	4	benjannet	benjannet	NOUN
bioscience-222	291	5	r	r	NOUN
bioscience-222	291	6	,	,	PUNCT
bioscience-222	291	7	madrid	madrid	PROPN
bioscience-222	291	8	e	e	PROPN
bioscience-222	291	9	,	,	PUNCT
bioscience-222	291	10	amri	amri	PROPN
bioscience-222	291	11	m	m	PROPN
bioscience-222	291	12	,	,	PUNCT
bioscience-222	291	13	kharrat	kharrat	NOUN
bioscience-222	291	14	m.	m.	NOUN
bioscience-222	291	15	efficiency	efficiency	NOUN
bioscience-222	291	16	of	of	ADP
bioscience-222	291	17	marker	marker	NOUN
bioscience-222	291	18	-	-	PUNCT
bioscience-222	291	19	assisted	assist	VERB
bioscience-222	291	20	selection	selection	NOUN
bioscience-222	291	21	in	in	ADP
bioscience-222	291	22	detection	detection	NOUN
bioscience-222	291	23	of	of	ADP
bioscience-222	291	24	ascochyta	ascochyta	NOUN
bioscience-222	291	25	blight	blight	NOUN
bioscience-222	291	26	resistance	resistance	NOUN
bioscience-222	291	27	in	in	ADP
bioscience-222	291	28	tunisian	tunisian	ADJ
bioscience-222	291	29	chickpea	chickpea	NOUN
bioscience-222	291	30	breeding	breeding	NOUN
bioscience-222	291	31	lines	line	NOUN
bioscience-222	291	32	.	.	PUNCT
bioscience-222	292	1	phytopathologia	phytopathologia	PROPN
bioscience-222	292	2	mediterranea	mediterranea	PROPN
bioscience-222	292	3	.	.	PUNCT
bioscience-222	293	1	2013;52(1):202	2013;52(1):202	NUM
bioscience-222	293	2	-	-	PUNCT
bioscience-222	293	3	11	11	NUM
bioscience-222	293	4	.	.	PUNCT
bioscience-222	293	5	19	19	NUM
bioscience-222	293	6	.	.	PUNCT
bioscience-222	293	7	bouhadida	bouhadida	PROPN
bioscience-222	293	8	m	m	PROPN
bioscience-222	293	9	,	,	PUNCT
bioscience-222	293	10	benjannet	benjannet	NOUN
bioscience-222	293	11	r	r	NOUN
bioscience-222	293	12	,	,	PUNCT
bioscience-222	293	13	madrid	madrid	PROPN
bioscience-222	293	14	e	e	PROPN
bioscience-222	293	15	,	,	PUNCT
bioscience-222	293	16	amri	amri	PROPN
bioscience-222	293	17	m	m	PROPN
bioscience-222	293	18	,	,	PUNCT
bioscience-222	293	19	kharrat	kharrat	NOUN
bioscience-222	293	20	m.	m.	NOUN
bioscience-222	293	21	efficiency	efficiency	NOUN
bioscience-222	293	22	of	of	ADP
bioscience-222	293	23	marker	marker	NOUN
bioscience-222	293	24	-	-	PUNCT
bioscience-222	293	25	assisted	assist	VERB
bioscience-222	293	26	selection	selection	NOUN
bioscience-222	293	27	in	in	ADP
bioscience-222	293	28	detection	detection	NOUN
bioscience-222	293	29	of	of	ADP
bioscience-222	293	30	ascochyta	ascochyta	NOUN
bioscience-222	293	31	blight	blight	NOUN
bioscience-222	293	32	resistance	resistance	NOUN
bioscience-222	293	33	in	in	ADP
bioscience-222	293	34	tunisian	tunisian	ADJ
bioscience-222	293	35	chickpea	chickpea	NOUN
bioscience-222	293	36	breeding	breeding	NOUN
bioscience-222	293	37	lines	line	NOUN
bioscience-222	293	38	.	.	PUNCT
bioscience-222	294	1	phytopathologia	phytopathologia	PROPN
bioscience-222	294	2	mediterranea	mediterranea	PROPN
bioscience-222	294	3	.	.	PUNCT
bioscience-222	295	1	2013;52(1):202	2013;52(1):202	NUM
bioscience-222	295	2	-	-	PUNCT
bioscience-222	295	3	11	11	NUM
bioscience-222	295	4	.	.	PUNCT
bioscience-222	295	5	20	20	NUM
bioscience-222	295	6	.	.	PUNCT
bioscience-222	296	1	li	li	PROPN
bioscience-222	296	2	y	y	PROPN
bioscience-222	296	3	,	,	PUNCT
bioscience-222	296	4	ruperao	ruperao	NOUN
bioscience-222	296	5	p	p	PROPN
bioscience-222	296	6	,	,	PUNCT
bioscience-222	296	7	batley	batley	PROPN
bioscience-222	296	8	j	j	PROPN
bioscience-222	296	9	,	,	PUNCT
bioscience-222	296	10	edwards	edwards	PROPN
bioscience-222	296	11	d	d	PROPN
bioscience-222	296	12	,	,	PUNCT
bioscience-222	296	13	davidson	davidson	PROPN
bioscience-222	296	14	j	j	PROPN
bioscience-222	296	15	,	,	PUNCT
bioscience-222	296	16	hobson	hobson	PROPN
bioscience-222	296	17	k	k	PROPN
bioscience-222	296	18	,	,	PUNCT
bioscience-222	296	19	et	et	PROPN
bioscience-222	296	20	al	al	PROPN
bioscience-222	296	21	.	.	PROPN
bioscience-222	296	22	genome	genome	NOUN
bioscience-222	296	23	analysis	analysis	NOUN
bioscience-222	296	24	identified	identify	VERB
bioscience-222	296	25	novel	novel	ADJ
bioscience-222	296	26	candidate	candidate	NOUN
bioscience-222	296	27	genes	gene	NOUN
bioscience-222	296	28	for	for	ADP
bioscience-222	296	29	ascochyta	ascochyta	NOUN
bioscience-222	296	30	blight	blight	NOUN
bioscience-222	296	31	resistance	resistance	NOUN
bioscience-222	296	32	in	in	ADP
bioscience-222	296	33	chickpea	chickpea	NOUN
bioscience-222	296	34	using	use	VERB
bioscience-222	296	35	whole	whole	ADJ
bioscience-222	296	36	genome	genome	NOUN
bioscience-222	296	37	re	re	VERB
bioscience-222	296	38	-	-	ADJ
bioscience-222	296	39	sequencing	sequence	VERB
bioscience-222	296	40	data	datum	NOUN
bioscience-222	296	41	.	.	PUNCT
bioscience-222	297	1	frontiers	frontier	NOUN
bioscience-222	297	2	in	in	ADP
bioscience-222	297	3	plant	plant	NOUN
bioscience-222	297	4	science	science	NOUN
bioscience-222	297	5	.	.	PUNCT
bioscience-222	298	1	2017;8:359	2017;8:359	X
bioscience-222	298	2	.	.	PUNCT
bioscience-222	299	1	21	21	NUM
bioscience-222	299	2	.	.	PUNCT
bioscience-222	300	1	rogers	rogers	PROPN
bioscience-222	300	2	so	so	ADV
bioscience-222	300	3	,	,	PUNCT
bioscience-222	300	4	bendich	bendich	PROPN
bioscience-222	300	5	aj	aj	PROPN
bioscience-222	300	6	.	.	PROPN
bioscience-222	300	7	extraction	extraction	NOUN
bioscience-222	300	8	of	of	ADP
bioscience-222	300	9	dna	dna	NOUN
bioscience-222	300	10	from	from	ADP
bioscience-222	300	11	milligram	milligram	NOUN
bioscience-222	300	12	amounts	amount	NOUN
bioscience-222	300	13	of	of	ADP
bioscience-222	300	14	fresh	fresh	ADJ
bioscience-222	300	15	,	,	PUNCT
bioscience-222	300	16	herbarium	herbarium	NOUN
bioscience-222	300	17	and	and	CCONJ
bioscience-222	300	18	mummified	mummified	ADJ
bioscience-222	300	19	plant	plant	NOUN
bioscience-222	300	20	tissues	tissue	NOUN
bioscience-222	300	21	.	.	PUNCT
bioscience-222	301	1	plant	plant	VERB
bioscience-222	301	2	molecular	molecular	ADJ
bioscience-222	301	3	biology	biology	NOUN
bioscience-222	301	4	.	.	PUNCT
bioscience-222	302	1	1985;5:69	1985;5:69	PROPN
bioscience-222	302	2	-	-	PUNCT
bioscience-222	302	3	76	76	NUM
bioscience-222	302	4	.	.	PUNCT
bioscience-222	303	1	22	22	NUM
bioscience-222	303	2	.	.	PUNCT
bioscience-222	304	1	hamwieh	hamwieh	PROPN
bioscience-222	304	2	a	a	PRON
bioscience-222	304	3	,	,	PUNCT
bioscience-222	304	4	imtiaz	imtiaz	PROPN
bioscience-222	304	5	m	m	PROPN
bioscience-222	304	6	,	,	PUNCT
bioscience-222	304	7	hobson	hobson	PROPN
bioscience-222	304	8	k	k	PROPN
bioscience-222	304	9	,	,	PUNCT
bioscience-222	304	10	ahmed	ahmed	PROPN
bioscience-222	304	11	s.	s.	PROPN
bioscience-222	304	12	genetic	genetic	ADJ
bioscience-222	304	13	diversity	diversity	NOUN
bioscience-222	304	14	of	of	ADP
bioscience-222	304	15	microsatellite	microsatellite	ADJ
bioscience-222	304	16	alleles	allele	NOUN
bioscience-222	304	17	located	locate	VERB
bioscience-222	304	18	at	at	ADP
bioscience-222	304	19	quantitative	quantitative	ADJ
bioscience-222	304	20	resistance	resistance	NOUN
bioscience-222	304	21	loci	locus	NOUN
bioscience-222	304	22	for	for	ADP
bioscience-222	304	23	ascochyta	ascochyta	NOUN
bioscience-222	304	24	blight	blight	NOUN
bioscience-222	304	25	resistance	resistance	NOUN
bioscience-222	304	26	in	in	ADP
bioscience-222	304	27	a	a	DET
bioscience-222	304	28	global	global	ADJ
bioscience-222	304	29	collection	collection	NOUN
bioscience-222	304	30	of	of	ADP
bioscience-222	304	31	chickpea	chickpea	NOUN
bioscience-222	304	32	germplasm	germplasm	NOUN
bioscience-222	304	33	.	.	PUNCT
bioscience-222	305	1	phytopathologia	phytopathologia	PROPN
bioscience-222	305	2	mediterranea	mediterranea	PROPN
bioscience-222	305	3	.	.	PUNCT
bioscience-222	306	1	2013:183	2013:183	NUM
bioscience-222	306	2	-	-	PUNCT
bioscience-222	306	3	91	91	NUM
bioscience-222	306	4	.	.	PUNCT
bioscience-222	307	1	23	23	NUM
bioscience-222	307	2	.	.	PUNCT
bioscience-222	308	1	lichtenzveig	lichtenzveig	PROPN
bioscience-222	308	2	j	j	PROPN
bioscience-222	308	3	,	,	PUNCT
bioscience-222	308	4	scheuring	scheure	VERB
bioscience-222	308	5	c	c	NOUN
bioscience-222	308	6	,	,	PUNCT
bioscience-222	308	7	dodge	dodge	PROPN
bioscience-222	308	8	j	j	PROPN
bioscience-222	308	9	,	,	PUNCT
bioscience-222	308	10	abbo	abbo	PROPN
bioscience-222	308	11	s	s	PROPN
bioscience-222	308	12	,	,	PUNCT
bioscience-222	308	13	zhang	zhang	PROPN
bioscience-222	308	14	hb	hb	PROPN
bioscience-222	308	15	.	.	PUNCT
bioscience-222	309	1	construction	construction	NOUN
bioscience-222	309	2	of	of	ADP
bioscience-222	309	3	bac	bac	PROPN
bioscience-222	309	4	and	and	CCONJ
bioscience-222	309	5	bibac	bibac	ADJ
bioscience-222	309	6	libraries	library	NOUN
bioscience-222	309	7	and	and	CCONJ
bioscience-222	309	8	their	their	PRON
bioscience-222	309	9	applications	application	NOUN
bioscience-222	309	10	for	for	ADP
bioscience-222	309	11	generation	generation	NOUN
bioscience-222	309	12	of	of	ADP
bioscience-222	309	13	ssr	ssr	ADJ
bioscience-222	309	14	markers	marker	NOUN
bioscience-222	309	15	for	for	ADP
bioscience-222	309	16	genome	genome	NOUN
bioscience-222	309	17	analysis	analysis	NOUN
bioscience-222	309	18	of	of	ADP
bioscience-222	309	19	chickpea	chickpea	NOUN
bioscience-222	309	20	,	,	PUNCT
bioscience-222	309	21	cicer	cicer	VERB
bioscience-222	309	22	arietinum	arietinum	DET
bioscience-222	309	23	l.	l.	PROPN
bioscience-222	309	24	theoretical	theoretical	ADJ
bioscience-222	309	25	and	and	CCONJ
bioscience-222	309	26	applied	apply	VERB
bioscience-222	309	27	genetics	genetic	NOUN
bioscience-222	309	28	.	.	PUNCT
bioscience-222	310	1	2005;110(3):492	2005;110(3):492	NUM
bioscience-222	310	2	-	-	SYM
bioscience-222	310	3	510	510	NUM
bioscience-222	310	4	.	.	PUNCT
bioscience-222	311	1	24	24	NUM
bioscience-222	311	2	.	.	PUNCT
bioscience-222	311	3	gujaria	gujaria	PROPN
bioscience-222	311	4	n	n	PRON
bioscience-222	311	5	,	,	PUNCT
bioscience-222	311	6	kumar	kumar	PROPN
bioscience-222	311	7	a	a	PROPN
bioscience-222	311	8	,	,	PUNCT
bioscience-222	311	9	dauthal	dauthal	NOUN
bioscience-222	311	10	p	p	X
bioscience-222	311	11	,	,	PUNCT
bioscience-222	311	12	dubey	dubey	PROPN
bioscience-222	311	13	a	a	PRON
bioscience-222	311	14	,	,	PUNCT
bioscience-222	311	15	hiremath	hiremath	NOUN
bioscience-222	311	16	p	p	X
bioscience-222	311	17	,	,	PUNCT
bioscience-222	311	18	bhanu	bhanu	PROPN
bioscience-222	311	19	prakash	prakash	PROPN
bioscience-222	311	20	a	a	PROPN
bioscience-222	311	21	,	,	PUNCT
bioscience-222	311	22	et	et	PROPN
bioscience-222	311	23	al	al	PROPN
bioscience-222	311	24	.	.	PUNCT
bioscience-222	311	25	development	development	NOUN
bioscience-222	311	26	and	and	CCONJ
bioscience-222	311	27	use	use	NOUN
bioscience-222	311	28	of	of	ADP
bioscience-222	311	29	genic	genic	ADJ
bioscience-222	311	30	molecular	molecular	ADJ
bioscience-222	311	31	markers	marker	NOUN
bioscience-222	311	32	(	(	PUNCT
bioscience-222	311	33	gmms	gmms	NOUN
bioscience-222	311	34	)	)	PUNCT
bioscience-222	311	35	for	for	ADP
bioscience-222	311	36	construction	construction	NOUN
bioscience-222	311	37	of	of	ADP
bioscience-222	311	38	a	a	DET
bioscience-222	311	39	transcript	transcript	NOUN
bioscience-222	311	40	map	map	NOUN
bioscience-222	311	41	of	of	ADP
bioscience-222	311	42	chickpea	chickpea	NOUN
bioscience-222	311	43	(	(	PUNCT
bioscience-222	311	44	cicer	cicer	VERB
bioscience-222	311	45	arietinum	arietinum	DET
bioscience-222	311	46	l.	l.	PROPN
bioscience-222	311	47	)	)	PUNCT
bioscience-222	311	48	.	.	PUNCT
bioscience-222	312	1	theoretical	theoretical	ADJ
bioscience-222	312	2	and	and	CCONJ
bioscience-222	312	3	applied	apply	VERB
bioscience-222	312	4	genetics	genetic	NOUN
bioscience-222	312	5	.	.	PUNCT
bioscience-222	313	1	2011;122:1577	2011;122:1577	NUM
bioscience-222	313	2	-	-	SYM
bioscience-222	313	3	89	89	NUM
bioscience-222	313	4	.	.	PUNCT
bioscience-222	314	1	25	25	NUM
bioscience-222	314	2	.	.	PUNCT
bioscience-222	315	1	singh	singh	PROPN
bioscience-222	315	2	k	k	PROPN
bioscience-222	315	3	,	,	PUNCT
bioscience-222	315	4	reddy	reddy	PROPN
bioscience-222	315	5	m.	m.	PROPN
bioscience-222	315	6	sources	source	NOUN
bioscience-222	315	7	of	of	ADP
bioscience-222	315	8	resistance	resistance	NOUN
bioscience-222	315	9	to	to	ADP
bioscience-222	315	10	ascochyta	ascochyta	NOUN
bioscience-222	315	11	blight	blight	NOUN
bioscience-222	315	12	in	in	ADP
bioscience-222	315	13	wild	wild	ADJ
bioscience-222	315	14	cicer	cicer	NOUN
bioscience-222	315	15	species	specie	NOUN
bioscience-222	315	16	.	.	PUNCT
bioscience-222	316	1	netherlands	netherlands	PROPN
bioscience-222	316	2	journal	journal	PROPN
bioscience-222	316	3	of	of	ADP
bioscience-222	316	4	plant	plant	NOUN
bioscience-222	316	5	pathology	pathology	NOUN
bioscience-222	316	6	.	.	PUNCT
bioscience-222	317	1	1993;99:163	1993;99:163	NUM
bioscience-222	317	2	-	-	SYM
bioscience-222	317	3	7	7	NUM
bioscience-222	317	4	.	.	NOUN
bioscience-222	317	5	26	26	NUM
bioscience-222	317	6	.	.	PUNCT
bioscience-222	318	1	duarte	duarte	PROPN
bioscience-222	318	2	jb	jb	PROPN
bioscience-222	318	3	,	,	PUNCT
bioscience-222	318	4	vencovsky	vencovsky	PROPN
bioscience-222	318	5	r.	r.	PROPN
bioscience-222	318	6	interacao	interacao	PROPN
bioscience-222	318	7	genotiposœambientes	genotiposœambiente	NOUN
bioscience-222	318	8	:	:	PUNCT
bioscience-222	318	9	uma	uma	PROPN
bioscience-222	318	10	introducao	introducao	PROPN
bioscience-222	318	11	a	a	DET
bioscience-222	318	12	analise	analise	NOUN
bioscience-222	318	13	ammi	ammi	NOUN
bioscience-222	318	14	.	.	PUNCT
bioscience-222	319	1	vol	vol	NOUN
bioscience-222	319	2	.	.	PROPN
bioscience-222	319	3	9	9	NUM
bioscience-222	319	4	of	of	ADP
bioscience-222	319	5	serie	serie	PROPN
bioscience-222	319	6	monografias	monografias	PROPN
bioscience-222	319	7	.	.	PUNCT
bioscience-222	320	1	ribeirao	ribeirao	PROPN
bioscience-222	320	2	preto	preto	NOUN
bioscience-222	320	3	:	:	PUNCT
bioscience-222	320	4	sociedade	sociedade	PROPN
bioscience-222	320	5	brasileira	brasileira	PROPN
bioscience-222	320	6	de	de	PROPN
bioscience-222	320	7	genetica	genetica	PROPN
bioscience-222	320	8	;	;	PUNCT
bioscience-222	320	9	1999	1999	NUM
bioscience-222	320	10	.	.	PUNCT
bioscience-222	321	1	27	27	NUM
bioscience-222	321	2	.	.	X
bioscience-222	322	1	ooijen	ooijen	NOUN
bioscience-222	322	2	v.	v.	ADP
bioscience-222	322	3	joinmap	joinmap	PROPN
bioscience-222	322	4	®	®	PROPN
bioscience-222	322	5	5	5	NUM
bioscience-222	322	6	,	,	PUNCT
bioscience-222	322	7	software	software	NOUN
bioscience-222	322	8	for	for	ADP
bioscience-222	322	9	the	the	DET
bioscience-222	322	10	calculation	calculation	NOUN
bioscience-222	322	11	of	of	ADP
bioscience-222	322	12	genetic	genetic	ADJ
bioscience-222	322	13	linkage	linkage	NOUN
bioscience-222	322	14	maps	map	NOUN
bioscience-222	322	15	in	in	ADP
bioscience-222	322	16	experimental	experimental	ADJ
bioscience-222	322	17	populations	population	NOUN
bioscience-222	322	18	of	of	ADP
bioscience-222	322	19	diploid	diploid	ADJ
bioscience-222	322	20	species	specie	NOUN
bioscience-222	322	21	.	.	PUNCT
bioscience-222	323	1	kyazma	kyazma	PROPN
bioscience-222	323	2	bv	bv	PROPN
bioscience-222	323	3	,	,	PUNCT
bioscience-222	323	4	wageningen	wageningen	PROPN
bioscience-222	323	5	,	,	PUNCT
bioscience-222	323	6	netherlands	netherlands	PROPN
bioscience-222	323	7	.	.	PUNCT
bioscience-222	323	8	2018	2018	NUM
bioscience-222	323	9	.	.	PUNCT
bioscience-222	324	1	28	28	NUM
bioscience-222	324	2	.	.	PUNCT
bioscience-222	325	1	kosambi	kosambi	PROPN
bioscience-222	325	2	dd	dd	PROPN
bioscience-222	325	3	.	.	PUNCT
bioscience-222	326	1	the	the	DET
bioscience-222	326	2	estimation	estimation	NOUN
bioscience-222	326	3	of	of	ADP
bioscience-222	326	4	map	map	NOUN
bioscience-222	326	5	distance	distance	NOUN
bioscience-222	326	6	from	from	ADP
bioscience-222	326	7	recombination	recombination	NOUN
bioscience-222	326	8	values	value	NOUN
bioscience-222	326	9	.	.	PUNCT
bioscience-222	327	1	annals	annal	NOUN
bioscience-222	327	2	of	of	ADP
bioscience-222	327	3	eugenics	eugenic	NOUN
bioscience-222	327	4	.	.	PUNCT
bioscience-222	328	1	1944;12:172	1944;12:172	NUM
bioscience-222	328	2	-	-	SYM
bioscience-222	328	3	5	5	NUM
bioscience-222	328	4	.	.	NOUN
bioscience-222	328	5	29	29	NUM
bioscience-222	328	6	.	.	PUNCT
bioscience-222	329	1	alonso	alonso	NOUN
bioscience-222	329	2	-	-	PUNCT
bioscience-222	329	3	blanco	blanco	PROPN
bioscience-222	329	4	c	c	PROPN
bioscience-222	329	5	,	,	PUNCT
bioscience-222	329	6	koornneef	koornneef	PROPN
bioscience-222	329	7	m	m	PROPN
bioscience-222	329	8	,	,	PUNCT
bioscience-222	329	9	van	van	PROPN
bioscience-222	329	10	ooijen	ooijen	PROPN
bioscience-222	329	11	jw	jw	PROPN
bioscience-222	329	12	.	.	PROPN
bioscience-222	330	1	qtl	qtl	PROPN
bioscience-222	330	2	analysis	analysis	NOUN
bioscience-222	330	3	.	.	PUNCT
bioscience-222	331	1	arabidopsis	arabidopsis	NOUN
bioscience-222	331	2	protocols	protocol	NOUN
bioscience-222	331	3	.	.	PUNCT
bioscience-222	332	1	2006:79	2006:79	NUM
bioscience-222	332	2	-	-	SYM
bioscience-222	332	3	99	99	NUM
bioscience-222	332	4	.	.	PUNCT
bioscience-222	332	5	30	30	NUM
bioscience-222	332	6	.	.	PUNCT
bioscience-222	333	1	altschul	altschul	PROPN
bioscience-222	333	2	sf	sf	PROPN
bioscience-222	333	3	,	,	PUNCT
bioscience-222	333	4	madden	madden	PROPN
bioscience-222	333	5	tl	tl	PROPN
bioscience-222	333	6	,	,	PUNCT
bioscience-222	333	7	schäffer	schäffer	VERB
bioscience-222	333	8	aa	aa	PROPN
bioscience-222	333	9	,	,	PUNCT
bioscience-222	333	10	zhang	zhang	PROPN
bioscience-222	333	11	j	j	PROPN
bioscience-222	333	12	,	,	PUNCT
bioscience-222	333	13	zhang	zhang	PROPN
bioscience-222	333	14	z	z	PROPN
bioscience-222	333	15	,	,	PUNCT
bioscience-222	333	16	miller	miller	PROPN
bioscience-222	333	17	w	w	PROPN
bioscience-222	333	18	,	,	PUNCT
bioscience-222	333	19	et	et	PROPN
bioscience-222	333	20	al	al	PROPN
bioscience-222	333	21	.	.	PROPN
bioscience-222	333	22	gapped	gapped	NOUN
bioscience-222	333	23	blast	blast	NOUN
bioscience-222	333	24	and	and	CCONJ
bioscience-222	333	25	psi	psi	NOUN
bioscience-222	333	26	-	-	PUNCT
bioscience-222	333	27	blast	blast	NOUN
bioscience-222	333	28	:	:	PUNCT
bioscience-222	333	29	a	a	DET
bioscience-222	333	30	new	new	ADJ
bioscience-222	333	31	generation	generation	NOUN
bioscience-222	333	32	of	of	ADP
bioscience-222	333	33	protein	protein	NOUN
bioscience-222	333	34	database	database	NOUN
bioscience-222	333	35	search	search	NOUN
bioscience-222	333	36	programs	program	NOUN
bioscience-222	333	37	.	.	PUNCT
bioscience-222	334	1	nucleic	nucleic	ADJ
bioscience-222	334	2	acids	acid	NOUN
bioscience-222	334	3	research	research	NOUN
bioscience-222	334	4	.	.	PUNCT
bioscience-222	335	1	1997;25(17):3389	1997;25(17):3389	NUM
bioscience-222	335	2	-	-	SYM
bioscience-222	335	3	402	402	NUM
bioscience-222	335	4	.	.	PUNCT
bioscience-222	336	1	31	31	NUM
bioscience-222	336	2	.	.	PUNCT
bioscience-222	337	1	kaur	kaur	PROPN
bioscience-222	337	2	m	m	PROPN
bioscience-222	337	3	,	,	PUNCT
bioscience-222	337	4	singh	singh	PROPN
bioscience-222	337	5	n.	n.	NOUN
bioscience-222	337	6	characterization	characterization	NOUN
bioscience-222	337	7	of	of	ADP
bioscience-222	337	8	protein	protein	NOUN
bioscience-222	337	9	isolates	isolate	NOUN
bioscience-222	337	10	from	from	ADP
bioscience-222	337	11	different	different	ADJ
bioscience-222	337	12	indian	indian	ADJ
bioscience-222	337	13	chickpea	chickpea	NOUN
bioscience-222	337	14	(	(	PUNCT
bioscience-222	337	15	cicer	cicer	VERB
bioscience-222	337	16	arietinum	arietinum	DET
bioscience-222	337	17	l.	l.	PROPN
bioscience-222	337	18	)	)	PUNCT
bioscience-222	337	19	cultivars	cultivar	NOUN
bioscience-222	337	20	.	.	PUNCT
bioscience-222	338	1	food	food	NOUN
bioscience-222	338	2	chemistry	chemistry	NOUN
bioscience-222	338	3	.	.	PUNCT
bioscience-222	339	1	2007;102(1):366	2007;102(1):366	NUM
bioscience-222	339	2	-	-	SYM
bioscience-222	339	3	74	74	NUM
bioscience-222	339	4	.	.	PUNCT
bioscience-222	340	1	32	32	NUM
bioscience-222	340	2	.	.	PUNCT
bioscience-222	341	1	lichtenzveig	lichtenzveig	PROPN
bioscience-222	341	2	j	j	PROPN
bioscience-222	341	3	,	,	PUNCT
bioscience-222	341	4	shtienberg	shtienberg	PROPN
bioscience-222	341	5	d	d	PROPN
bioscience-222	341	6	,	,	PUNCT
bioscience-222	341	7	zhang	zhang	PROPN
bioscience-222	341	8	hb	hb	PROPN
bioscience-222	341	9	,	,	PUNCT
bioscience-222	341	10	bonfil	bonfil	NOUN
bioscience-222	341	11	dj	dj	PROPN
bioscience-222	341	12	,	,	PUNCT
bioscience-222	341	13	abbo	abbo	PROPN
bioscience-222	341	14	s.	s.	PROPN
bioscience-222	341	15	biometric	biometric	PROPN
bioscience-222	341	16	analyses	analysis	NOUN
bioscience-222	341	17	of	of	ADP
bioscience-222	341	18	the	the	DET
bioscience-222	341	19	inheritance	inheritance	NOUN
bioscience-222	341	20	of	of	ADP
bioscience-222	341	21	resistance	resistance	NOUN
bioscience-222	341	22	to	to	ADP
bioscience-222	341	23	didymella	didymella	PROPN
bioscience-222	341	24	rabiei	rabiei	PROPN
bioscience-222	341	25	in	in	ADP
bioscience-222	341	26	chickpea	chickpea	PROPN
bioscience-222	341	27	.	.	PUNCT
bioscience-222	342	1	phytopathology	phytopathology	NOUN
bioscience-222	342	2	.	.	PUNCT
bioscience-222	343	1	2002;92(4):417	2002;92(4):417	NUM
bioscience-222	343	2	-	-	SYM
bioscience-222	343	3	23	23	NUM
bioscience-222	343	4	.	.	PUNCT
bioscience-222	344	1	33	33	NUM
bioscience-222	344	2	.	.	PUNCT
bioscience-222	345	1	pande	pande	PROPN
bioscience-222	345	2	s	s	PROPN
bioscience-222	345	3	,	,	PUNCT
bioscience-222	345	4	sharma	sharma	PROPN
bioscience-222	345	5	m	m	PROPN
bioscience-222	345	6	,	,	PUNCT
bioscience-222	345	7	gaur	gaur	NOUN
bioscience-222	345	8	pm	pm	NOUN
bioscience-222	345	9	,	,	PUNCT
bioscience-222	345	10	basandrai	basandrai	PROPN
bioscience-222	345	11	ak	ak	PROPN
bioscience-222	345	12	,	,	PUNCT
bioscience-222	345	13	kaur	kaur	PROPN
bioscience-222	345	14	l	l	PROPN
bioscience-222	345	15	,	,	PUNCT
bioscience-222	345	16	hooda	hooda	PROPN
bioscience-222	345	17	ks	ks	PROPN
bioscience-222	345	18	,	,	PUNCT
bioscience-222	345	19	et	et	PROPN
bioscience-222	345	20	al	al	PROPN
bioscience-222	345	21	.	.	PUNCT
bioscience-222	346	1	biplot	biplot	NOUN
bioscience-222	346	2	analysis	analysis	NOUN
bioscience-222	346	3	of	of	ADP
bioscience-222	346	4	genotype	genotype	NOUN
bioscience-222	346	5	œ	œ	PROPN
bioscience-222	346	6	environment	environment	NOUN
bioscience-222	346	7	interactions	interaction	NOUN
bioscience-222	346	8	and	and	CCONJ
bioscience-222	346	9	identification	identification	NOUN
bioscience-222	346	10	of	of	ADP
bioscience-222	346	11	stable	stable	ADJ
bioscience-222	346	12	sources	source	NOUN
bioscience-222	346	13	of	of	ADP
bioscience-222	346	14	resistance	resistance	NOUN
bioscience-222	346	15	to	to	ADP
bioscience-222	346	16	ascochyta	ascochyta	NOUN
bioscience-222	346	17	blight	blight	NOUN
bioscience-222	346	18	in	in	ADP
bioscience-222	346	19	chickpea	chickpea	NOUN
bioscience-222	346	20	(	(	PUNCT
bioscience-222	346	21	cicer	cicer	VERB
bioscience-222	346	22	arietinum	arietinum	DET
bioscience-222	346	23	l.	l.	PROPN
bioscience-222	346	24	)	)	PUNCT
bioscience-222	346	25	.	.	PUNCT
bioscience-222	347	1	australasian	australasian	ADJ
bioscience-222	347	2	plant	plant	NOUN
bioscience-222	347	3	pathology	pathology	NOUN
bioscience-222	347	4	.	.	PUNCT
bioscience-222	348	1	2013;42:561	2013;42:561	PROPN
bioscience-222	348	2	-	-	SYM
bioscience-222	348	3	71	71	NUM
bioscience-222	348	4	.	.	PUNCT
bioscience-222	349	1	highlights	highlight	NOUN
bioscience-222	349	2	in	in	ADP
bioscience-222	349	3	bioscience	bioscience	NOUN
bioscience-222	349	4	page	page	NOUN
bioscience-222	349	5	10	10	NUM
bioscience-222	349	6	of	of	ADP
bioscience-222	349	7	11	11	NUM
bioscience-222	349	8	december	december	PROPN
bioscience-222	349	9	2024|volume	2024|volume	NUM
bioscience-222	349	10	7	7	NUM
bioscience-222	349	11	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	349	12	hamwieh	hamwieh	NOUN
bioscience-222	349	13	et	et	PROPN
bioscience-222	349	14	al	al	PROPN
bioscience-222	349	15	.	.	PROPN
bioscience-222	349	16	,	,	PUNCT
bioscience-222	349	17	2024	2024	NUM
bioscience-222	349	18	exploring	explore	VERB
bioscience-222	349	19	qtl	qtl	PROPN
bioscience-222	349	20	genes	gene	NOUN
bioscience-222	349	21	contribute	contribute	VERB
bioscience-222	349	22	to	to	ADP
bioscience-222	349	23	chickpea	chickpea	PROPN
bioscience-222	349	24	ascochyta	ascochyta	NOUN
bioscience-222	349	25	blight	blight	NOUN
bioscience-222	349	26	resistance	resistance	NOUN
bioscience-222	349	27	34	34	NUM
bioscience-222	349	28	.	.	PUNCT
bioscience-222	350	1	gauch	gauch	PROPN
bioscience-222	350	2	gh	gh	PROPN
bioscience-222	350	3	,	,	PUNCT
bioscience-222	350	4	zobel	zobel	PROPN
bioscience-222	350	5	rw	rw	PROPN
bioscience-222	350	6	.	.	PUNCT
bioscience-222	351	1	ammi	ammi	PROPN
bioscience-222	351	2	analysis	analysis	NOUN
bioscience-222	351	3	of	of	ADP
bioscience-222	351	4	yield	yield	NOUN
bioscience-222	351	5	trials	trial	NOUN
bioscience-222	351	6	.	.	PUNCT
bioscience-222	352	1	in	in	ADP
bioscience-222	352	2	:	:	PUNCT
bioscience-222	352	3	kang	kang	PROPN
bioscience-222	352	4	ms	ms	PROPN
bioscience-222	352	5	,	,	PUNCT
bioscience-222	352	6	gauch	gauch	NOUN
bioscience-222	352	7	hg	hg	NOUN
bioscience-222	352	8	,	,	PUNCT
bioscience-222	352	9	editors	editor	NOUN
bioscience-222	352	10	.	.	PUNCT
bioscience-222	353	1	genotype	genotype	NOUN
bioscience-222	353	2	by	by	ADP
bioscience-222	353	3	environment	environment	NOUN
bioscience-222	353	4	interaction	interaction	NOUN
bioscience-222	353	5	.	.	PUNCT
bioscience-222	354	1	boca	boca	PROPN
bioscience-222	354	2	raton	raton	PROPN
bioscience-222	354	3	,	,	PUNCT
bioscience-222	354	4	fl	fl	PROPN
bioscience-222	354	5	:	:	PUNCT
bioscience-222	354	6	crc	crc	NOUN
bioscience-222	354	7	press	press	NOUN
bioscience-222	354	8	;	;	PUNCT
bioscience-222	354	9	1996	1996	NUM
bioscience-222	354	10	.	.	PUNCT
bioscience-222	355	1	p.	p.	NOUN
bioscience-222	355	2	85	85	NUM
bioscience-222	355	3	-	-	SYM
bioscience-222	355	4	122	122	NUM
bioscience-222	355	5	.	.	PUNCT
bioscience-222	355	6	35	35	NUM
bioscience-222	355	7	.	.	PUNCT
bioscience-222	356	1	yan	yan	PROPN
bioscience-222	357	1	w	w	PROPN
bioscience-222	357	2	,	,	PUNCT
bioscience-222	357	3	rajcan	rajcan	PROPN
bioscience-222	357	4	i.	i.	PROPN
bioscience-222	357	5	biplots	biplot	VERB
bioscience-222	357	6	analysis	analysis	NOUN
bioscience-222	357	7	of	of	ADP
bioscience-222	357	8	the	the	DET
bioscience-222	357	9	test	test	NOUN
bioscience-222	357	10	sites	site	NOUN
bioscience-222	357	11	and	and	CCONJ
bioscience-222	357	12	trait	trait	NOUN
bioscience-222	357	13	relations	relation	NOUN
bioscience-222	357	14	of	of	ADP
bioscience-222	357	15	soybean	soybean	NOUN
bioscience-222	357	16	in	in	ADP
bioscience-222	357	17	ontario	ontario	PROPN
bioscience-222	357	18	.	.	PUNCT
bioscience-222	358	1	crop	crop	NOUN
bioscience-222	358	2	science	science	NOUN
bioscience-222	358	3	.	.	PUNCT
bioscience-222	359	1	2002;42:1120	2002;42:1120	NUM
bioscience-222	359	2	.	.	NOUN
bioscience-222	360	1	36	36	NUM
bioscience-222	360	2	.	.	PUNCT
bioscience-222	361	1	stephens	stephens	PROPN
bioscience-222	361	2	a	a	PROPN
bioscience-222	361	3	,	,	PUNCT
bioscience-222	361	4	lombardi	lombardi	PROPN
bioscience-222	361	5	m	m	PROPN
bioscience-222	361	6	,	,	PUNCT
bioscience-222	361	7	cogan	cogan	PROPN
bioscience-222	361	8	noi	noi	PROPN
bioscience-222	361	9	,	,	PUNCT
bioscience-222	361	10	forster	forster	PROPN
bioscience-222	361	11	jw	jw	PROPN
bioscience-222	361	12	,	,	PUNCT
bioscience-222	361	13	hobson	hobson	PROPN
bioscience-222	361	14	k	k	PROPN
bioscience-222	361	15	,	,	PUNCT
bioscience-222	361	16	materne	materne	PROPN
bioscience-222	361	17	m	m	PROPN
bioscience-222	361	18	,	,	PUNCT
bioscience-222	361	19	et	et	PROPN
bioscience-222	361	20	al	al	PROPN
bioscience-222	361	21	.	.	PUNCT
bioscience-222	362	1	genetic	genetic	ADJ
bioscience-222	362	2	marker	marker	NOUN
bioscience-222	362	3	discovery	discovery	NOUN
bioscience-222	362	4	,	,	PUNCT
bioscience-222	362	5	intraspecific	intraspecific	NOUN
bioscience-222	362	6	linkage	linkage	NOUN
bioscience-222	362	7	map	map	NOUN
bioscience-222	362	8	construction	construction	NOUN
bioscience-222	362	9	and	and	CCONJ
bioscience-222	362	10	quantitative	quantitative	ADJ
bioscience-222	362	11	trait	trait	NOUN
bioscience-222	362	12	locus	locus	NOUN
bioscience-222	362	13	analysis	analysis	NOUN
bioscience-222	362	14	of	of	ADP
bioscience-222	362	15	ascochyta	ascochyta	NOUN
bioscience-222	362	16	blight	blight	NOUN
bioscience-222	362	17	resistance	resistance	NOUN
bioscience-222	362	18	in	in	ADP
bioscience-222	362	19	chickpea	chickpea	NOUN
bioscience-222	362	20	(	(	PUNCT
bioscience-222	362	21	cicer	cicer	VERB
bioscience-222	362	22	arietinum	arietinum	DET
bioscience-222	362	23	l.	l.	PROPN
bioscience-222	362	24	)	)	PUNCT
bioscience-222	362	25	.	.	PUNCT
bioscience-222	363	1	molecular	molecular	ADJ
bioscience-222	363	2	breeding	breeding	NOUN
bioscience-222	363	3	.	.	PUNCT
bioscience-222	364	1	2014;33:297	2014;33:297	PROPN
bioscience-222	364	2	-	-	PUNCT
bioscience-222	364	3	313	313	NUM
bioscience-222	364	4	.	.	PUNCT
bioscience-222	365	1	37	37	NUM
bioscience-222	365	2	.	.	PUNCT
bioscience-222	366	1	sabbavarapu	sabbavarapu	PROPN
bioscience-222	366	2	mm	mm	PROPN
bioscience-222	366	3	,	,	PUNCT
bioscience-222	366	4	sharma	sharma	PROPN
bioscience-222	366	5	m	m	PROPN
bioscience-222	366	6	,	,	PUNCT
bioscience-222	366	7	chamarthi	chamarthi	NOUN
bioscience-222	366	8	sk	sk	NOUN
bioscience-222	366	9	,	,	PUNCT
bioscience-222	366	10	swapna	swapna	PROPN
bioscience-222	366	11	n	n	CCONJ
bioscience-222	366	12	,	,	PUNCT
bioscience-222	366	13	rathore	rathore	PROPN
bioscience-222	366	14	a	a	PRON
bioscience-222	366	15	,	,	PUNCT
bioscience-222	366	16	thudi	thudi	PROPN
bioscience-222	366	17	m	m	PROPN
bioscience-222	366	18	,	,	PUNCT
bioscience-222	366	19	et	et	PROPN
bioscience-222	366	20	al	al	PROPN
bioscience-222	366	21	.	.	PUNCT
bioscience-222	367	1	molecular	molecular	ADJ
bioscience-222	367	2	mapping	mapping	NOUN
bioscience-222	367	3	of	of	ADP
bioscience-222	367	4	qtls	qtls	PROPN
bioscience-222	367	5	for	for	ADP
bioscience-222	367	6	resistance	resistance	NOUN
bioscience-222	367	7	to	to	ADP
bioscience-222	367	8	fusarium	fusarium	NOUN
bioscience-222	367	9	wilt	wilt	NOUN
bioscience-222	367	10	(	(	PUNCT
bioscience-222	367	11	race	race	NOUN
bioscience-222	367	12	1	1	NUM
bioscience-222	367	13	)	)	PUNCT
bioscience-222	367	14	and	and	CCONJ
bioscience-222	367	15	ascochyta	ascochyta	NOUN
bioscience-222	367	16	blight	blight	NOUN
bioscience-222	367	17	in	in	ADP
bioscience-222	367	18	chickpea	chickpea	NOUN
bioscience-222	367	19	(	(	PUNCT
bioscience-222	367	20	cicer	cicer	VERB
bioscience-222	367	21	arietinum	arietinum	DET
bioscience-222	367	22	l.	l.	PROPN
bioscience-222	367	23	)	)	PUNCT
bioscience-222	367	24	.	.	PUNCT
bioscience-222	368	1	euphytica	euphytica	PROPN
bioscience-222	368	2	.	.	PUNCT
bioscience-222	369	1	2013;193:121	2013;193:121	NUM
bioscience-222	369	2	-	-	SYM
bioscience-222	369	3	33	33	NUM
bioscience-222	369	4	.	.	PUNCT
bioscience-222	370	1	38	38	NUM
bioscience-222	370	2	.	.	PUNCT
bioscience-222	371	1	cobos	cobos	PROPN
bioscience-222	371	2	mj	mj	PROPN
bioscience-222	371	3	,	,	PUNCT
bioscience-222	371	4	rubio	rubio	PROPN
bioscience-222	371	5	j	j	PROPN
bioscience-222	371	6	,	,	PUNCT
bioscience-222	371	7	strange	strange	ADJ
bioscience-222	371	8	rn	rn	PROPN
bioscience-222	371	9	,	,	PUNCT
bioscience-222	371	10	moreno	moreno	PROPN
bioscience-222	371	11	mt	mt	PROPN
bioscience-222	371	12	,	,	PUNCT
bioscience-222	371	13	gil	gil	PROPN
bioscience-222	371	14	j	j	PROPN
bioscience-222	371	15	,	,	PUNCT
bioscience-222	371	16	millan	millan	PROPN
bioscience-222	371	17	t.	t.	PROPN
bioscience-222	371	18	a	a	DET
bioscience-222	371	19	new	new	ADJ
bioscience-222	371	20	qtl	qtl	PROPN
bioscience-222	371	21	for	for	ADP
bioscience-222	371	22	ascochyta	ascochyta	NOUN
bioscience-222	371	23	blight	blight	NOUN
bioscience-222	371	24	resistance	resistance	NOUN
bioscience-222	371	25	in	in	ADP
bioscience-222	371	26	an	an	DET
bioscience-222	371	27	ril	ril	NOUN
bioscience-222	371	28	population	population	NOUN
bioscience-222	371	29	derived	derive	VERB
bioscience-222	371	30	from	from	ADP
bioscience-222	371	31	an	an	DET
bioscience-222	371	32	interspecific	interspecific	NOUN
bioscience-222	371	33	cross	cross	NOUN
bioscience-222	371	34	in	in	ADP
bioscience-222	371	35	chickpea	chickpea	PROPN
bioscience-222	371	36	.	.	PUNCT
bioscience-222	372	1	euphytica	euphytica	PROPN
bioscience-222	372	2	.	.	PUNCT
bioscience-222	373	1	2006;149(1):105	2006;149(1):105	NUM
bioscience-222	373	2	-	-	SYM
bioscience-222	373	3	11	11	NUM
bioscience-222	373	4	.	.	NOUN
bioscience-222	373	5	39	39	NUM
bioscience-222	373	6	.	.	PUNCT
bioscience-222	374	1	martin	martin	PROPN
bioscience-222	374	2	gb	gb	PROPN
bioscience-222	374	3	,	,	PUNCT
bioscience-222	374	4	brommonschenkel	brommonschenkel	PROPN
bioscience-222	374	5	sh	sh	PROPN
bioscience-222	374	6	,	,	PUNCT
bioscience-222	374	7	chunwongse	chunwongse	PROPN
bioscience-222	374	8	j	j	PROPN
bioscience-222	374	9	,	,	PUNCT
bioscience-222	374	10	frary	frary	ADJ
bioscience-222	374	11	a	a	DET
bioscience-222	374	12	,	,	PUNCT
bioscience-222	374	13	ganal	ganal	ADJ
bioscience-222	374	14	mw	mw	NOUN
bioscience-222	374	15	,	,	PUNCT
bioscience-222	374	16	spivey	spivey	PROPN
bioscience-222	374	17	r	r	PROPN
bioscience-222	374	18	,	,	PUNCT
bioscience-222	374	19	et	et	PROPN
bioscience-222	374	20	al	al	PROPN
bioscience-222	374	21	.	.	PROPN
bioscience-222	374	22	map	map	NOUN
bioscience-222	374	23	-	-	PUNCT
bioscience-222	374	24	based	base	VERB
bioscience-222	374	25	cloning	cloning	NOUN
bioscience-222	374	26	of	of	ADP
bioscience-222	374	27	a	a	DET
bioscience-222	374	28	protein	protein	NOUN
bioscience-222	374	29	kinase	kinase	NOUN
bioscience-222	374	30	gene	gene	NOUN
bioscience-222	374	31	conferring	confer	VERB
bioscience-222	374	32	disease	disease	NOUN
bioscience-222	374	33	resistance	resistance	NOUN
bioscience-222	374	34	in	in	ADP
bioscience-222	374	35	tomato	tomato	NOUN
bioscience-222	374	36	.	.	PUNCT
bioscience-222	375	1	science	science	NOUN
bioscience-222	375	2	.	.	PUNCT
bioscience-222	376	1	1993;262:1432	1993;262:1432	NUM
bioscience-222	376	2	-	-	SYM
bioscience-222	376	3	6	6	NUM
bioscience-222	376	4	.	.	NUM
bioscience-222	377	1	40	40	NUM
bioscience-222	377	2	.	.	PUNCT
bioscience-222	378	1	zheng	zheng	PROPN
bioscience-222	378	2	ms	ms	PROPN
bioscience-222	378	3	,	,	PUNCT
bioscience-222	378	4	takahashi	takahashi	PROPN
bioscience-222	378	5	h	h	PROPN
bioscience-222	378	6	,	,	PUNCT
bioscience-222	378	7	miyazaki	miyazaki	PROPN
bioscience-222	378	8	a	a	PROPN
bioscience-222	378	9	,	,	PUNCT
bioscience-222	378	10	hamamoto	hamamoto	PROPN
bioscience-222	378	11	h	h	PROPN
bioscience-222	378	12	,	,	PUNCT
bioscience-222	378	13	shah	shah	PROPN
bioscience-222	378	14	j	j	PROPN
bioscience-222	378	15	,	,	PUNCT
bioscience-222	378	16	yamaguchi	yamaguchi	PROPN
bioscience-222	378	17	i	i	PROPN
bioscience-222	378	18	,	,	PUNCT
bioscience-222	378	19	et	et	PROPN
bioscience-222	378	20	al	al	PROPN
bioscience-222	378	21	.	.	PROPN
bioscience-222	379	1	up	up	ADP
bioscience-222	379	2	-	-	PUNCT
bioscience-222	379	3	regulation	regulation	NOUN
bioscience-222	379	4	of	of	ADP
bioscience-222	379	5	arabidopsis	arabidopsis	NOUN
bioscience-222	379	6	thaliana	thaliana	NOUN
bioscience-222	379	7	nhl10	nhl10	PROPN
bioscience-222	379	8	in	in	ADP
bioscience-222	379	9	the	the	DET
bioscience-222	379	10	hypersensitive	hypersensitive	ADJ
bioscience-222	379	11	response	response	NOUN
bioscience-222	379	12	to	to	ADP
bioscience-222	379	13	cucumber	cucumber	PROPN
bioscience-222	379	14	mosaic	mosaic	PROPN
bioscience-222	379	15	virus	virus	NOUN
bioscience-222	379	16	infection	infection	NOUN
bioscience-222	379	17	and	and	CCONJ
bioscience-222	379	18	in	in	ADP
bioscience-222	379	19	senescing	senesce	VERB
bioscience-222	379	20	leaves	leave	NOUN
bioscience-222	379	21	is	be	AUX
bioscience-222	379	22	controlled	control	VERB
bioscience-222	379	23	by	by	ADP
bioscience-222	379	24	signalling	signal	VERB
bioscience-222	379	25	pathways	pathway	NOUN
bioscience-222	379	26	that	that	PRON
bioscience-222	379	27	differ	differ	VERB
bioscience-222	379	28	in	in	ADP
bioscience-222	379	29	salicylate	salicylate	NOUN
bioscience-222	379	30	involvement	involvement	NOUN
bioscience-222	379	31	.	.	PUNCT
bioscience-222	380	1	planta	planta	NOUN
bioscience-222	380	2	.	.	PUNCT
bioscience-222	381	1	2004;218(5):740	2004;218(5):740	NUM
bioscience-222	381	2	-	-	SYM
bioscience-222	381	3	50	50	NUM
bioscience-222	381	4	.	.	PUNCT
bioscience-222	382	1	41	41	NUM
bioscience-222	382	2	.	.	PUNCT
bioscience-222	383	1	yoshida	yoshida	PROPN
bioscience-222	383	2	s	s	PROPN
bioscience-222	383	3	,	,	PUNCT
bioscience-222	383	4	ito	ito	PROPN
bioscience-222	383	5	m	m	PROPN
bioscience-222	383	6	,	,	PUNCT
bioscience-222	383	7	nishida	nishida	PROPN
bioscience-222	384	1	i	i	PRON
bioscience-222	384	2	,	,	PUNCT
bioscience-222	384	3	watanabe	watanabe	PROPN
bioscience-222	384	4	a.	a.	PROPN
bioscience-222	384	5	isolation	isolation	PROPN
bioscience-222	384	6	and	and	CCONJ
bioscience-222	384	7	rna	rna	NOUN
bioscience-222	384	8	gel	gel	NOUN
bioscience-222	384	9	blot	blot	NOUN
bioscience-222	384	10	analysis	analysis	NOUN
bioscience-222	384	11	of	of	ADP
bioscience-222	384	12	genes	gene	NOUN
bioscience-222	384	13	that	that	PRON
bioscience-222	384	14	could	could	AUX
bioscience-222	384	15	serve	serve	VERB
bioscience-222	384	16	as	as	ADP
bioscience-222	384	17	potential	potential	ADJ
bioscience-222	384	18	molecular	molecular	ADJ
bioscience-222	384	19	markers	marker	NOUN
bioscience-222	384	20	for	for	ADP
bioscience-222	384	21	leaf	leaf	NOUN
bioscience-222	384	22	senescence	senescence	NOUN
bioscience-222	384	23	in	in	ADP
bioscience-222	384	24	arabidopsis	arabidopsis	NOUN
bioscience-222	384	25	thaliana	thaliana	NOUN
bioscience-222	384	26	.	.	PUNCT
bioscience-222	385	1	plant	plant	NOUN
bioscience-222	385	2	and	and	CCONJ
bioscience-222	385	3	cell	cell	NOUN
bioscience-222	385	4	physiology	physiology	NOUN
bioscience-222	385	5	.	.	PUNCT
bioscience-222	386	1	2001;42(2):170	2001;42(2):170	NUM
bioscience-222	386	2	-	-	PUNCT
bioscience-222	386	3	8	8	NUM
bioscience-222	386	4	.	.	X
bioscience-222	387	1	42	42	NUM
bioscience-222	387	2	.	.	PUNCT
bioscience-222	388	1	takemiya	takemiya	PROPN
bioscience-222	388	2	a	a	PRON
bioscience-222	388	3	,	,	PUNCT
bioscience-222	388	4	sugiyama	sugiyama	NOUN
bioscience-222	388	5	n	n	CCONJ
bioscience-222	388	6	,	,	PUNCT
bioscience-222	388	7	fujimoto	fujimoto	PROPN
bioscience-222	388	8	h	h	PROPN
bioscience-222	388	9	,	,	PUNCT
bioscience-222	388	10	tsutsumi	tsutsumi	PROPN
bioscience-222	388	11	t	t	PROPN
bioscience-222	388	12	,	,	PUNCT
bioscience-222	388	13	yamauchi	yamauchi	PROPN
bioscience-222	388	14	s	s	PROPN
bioscience-222	388	15	,	,	PUNCT
bioscience-222	388	16	hiyama	hiyama	NOUN
bioscience-222	388	17	a	a	X
bioscience-222	389	1	,	,	PUNCT
bioscience-222	389	2	et	et	PROPN
bioscience-222	389	3	al	al	PROPN
bioscience-222	389	4	.	.	PROPN
bioscience-222	389	5	phosphorylation	phosphorylation	NOUN
bioscience-222	389	6	of	of	ADP
bioscience-222	389	7	blus1	blus1	PROPN
bioscience-222	389	8	kinase	kinase	PROPN
bioscience-222	389	9	by	by	ADP
bioscience-222	389	10	phototropins	phototropin	NOUN
bioscience-222	389	11	is	be	AUX
bioscience-222	389	12	a	a	DET
bioscience-222	389	13	primary	primary	ADJ
bioscience-222	389	14	step	step	NOUN
bioscience-222	389	15	in	in	ADP
bioscience-222	389	16	stomatal	stomatal	ADJ
bioscience-222	389	17	opening	opening	NOUN
bioscience-222	389	18	.	.	PUNCT
bioscience-222	390	1	nature	nature	NOUN
bioscience-222	390	2	communications	communication	NOUN
bioscience-222	390	3	.	.	PUNCT
bioscience-222	391	1	2013;4:2094	2013;4:2094	NOUN
bioscience-222	391	2	.	.	PUNCT
bioscience-222	392	1	43	43	NUM
bioscience-222	392	2	.	.	PUNCT
bioscience-222	393	1	bendahmane	bendahmane	PROPN
bioscience-222	393	2	a	a	PRON
bioscience-222	393	3	,	,	PUNCT
bioscience-222	393	4	kohn	kohn	PROPN
bioscience-222	393	5	ba	ba	PROPN
bioscience-222	393	6	,	,	PUNCT
bioscience-222	393	7	dedi	dedi	VERB
bioscience-222	393	8	c	c	NOUN
bioscience-222	393	9	,	,	PUNCT
bioscience-222	393	10	baulcombe	baulcombe	PROPN
bioscience-222	393	11	dc	dc	PROPN
bioscience-222	393	12	.	.	PUNCT
bioscience-222	394	1	the	the	DET
bioscience-222	394	2	coat	coat	NOUN
bioscience-222	394	3	protein	protein	NOUN
bioscience-222	394	4	of	of	ADP
bioscience-222	394	5	potato	potato	NOUN
bioscience-222	394	6	virus	virus	NOUN
bioscience-222	394	7	x	x	PRON
bioscience-222	394	8	is	be	AUX
bioscience-222	394	9	a	a	DET
bioscience-222	394	10	strain	strain	NOUN
bioscience-222	394	11	-	-	PUNCT
bioscience-222	394	12	specific	specific	ADJ
bioscience-222	394	13	elicitor	elicitor	NOUN
bioscience-222	394	14	of	of	ADP
bioscience-222	394	15	rx1	rx1	PROPN
bioscience-222	394	16	-	-	PUNCT
bioscience-222	394	17	mediated	mediate	VERB
bioscience-222	394	18	virus	virus	NOUN
bioscience-222	394	19	resistance	resistance	NOUN
bioscience-222	394	20	in	in	ADP
bioscience-222	394	21	potato	potato	NOUN
bioscience-222	394	22	.	.	PUNCT
bioscience-222	395	1	plant	plant	NOUN
bioscience-222	395	2	j.	j.	PROPN
bioscience-222	395	3	1995;8:93341	1995;8:93341	PROPN
bioscience-222	395	4	.	.	PROPN
bioscience-222	396	1	44	44	NUM
bioscience-222	396	2	.	.	PUNCT
bioscience-222	397	1	gurr	gurr	PROPN
bioscience-222	397	2	sj	sj	PROPN
bioscience-222	397	3	,	,	PUNCT
bioscience-222	397	4	rushton	rushton	PROPN
bioscience-222	397	5	pj	pj	PROPN
bioscience-222	397	6	.	.	PUNCT
bioscience-222	398	1	engineering	engineering	NOUN
bioscience-222	398	2	plants	plant	NOUN
bioscience-222	398	3	with	with	ADP
bioscience-222	398	4	increased	increase	VERB
bioscience-222	398	5	disease	disease	NOUN
bioscience-222	398	6	resistance	resistance	NOUN
bioscience-222	398	7	:	:	PUNCT
bioscience-222	398	8	how	how	SCONJ
bioscience-222	398	9	are	be	AUX
bioscience-222	398	10	we	we	PRON
bioscience-222	398	11	going	go	VERB
bioscience-222	398	12	to	to	PART
bioscience-222	398	13	express	express	VERB
bioscience-222	398	14	it	it	PRON
bioscience-222	398	15	?	?	PUNCT
bioscience-222	399	1	trends	trend	NOUN
bioscience-222	399	2	in	in	ADP
bioscience-222	399	3	biotechnology	biotechnology	NOUN
bioscience-222	399	4	.	.	PUNCT
bioscience-222	400	1	2005;23(6):283	2005;23(6):283	NUM
bioscience-222	400	2	-	-	SYM
bioscience-222	400	3	90	90	NUM
bioscience-222	400	4	.	.	PUNCT
bioscience-222	401	1	45	45	NUM
bioscience-222	401	2	.	.	PUNCT
bioscience-222	401	3	duek	duek	PROPN
bioscience-222	401	4	pd	pd	PROPN
bioscience-222	401	5	,	,	PUNCT
bioscience-222	401	6	fankhauser	fankhauser	PROPN
bioscience-222	401	7	c.	c.	PROPN
bioscience-222	401	8	bhlh	bhlh	PROPN
bioscience-222	401	9	class	class	NOUN
bioscience-222	401	10	transcription	transcription	NOUN
bioscience-222	401	11	factors	factor	NOUN
bioscience-222	401	12	take	take	VERB
bioscience-222	401	13	centre	centre	NOUN
bioscience-222	401	14	stage	stage	NOUN
bioscience-222	401	15	in	in	ADP
bioscience-222	401	16	phytochrome	phytochrome	NOUN
bioscience-222	401	17	signalling	signal	VERB
bioscience-222	401	18	.	.	PUNCT
bioscience-222	402	1	trends	trend	NOUN
bioscience-222	402	2	in	in	ADP
bioscience-222	402	3	plant	plant	NOUN
bioscience-222	402	4	science	science	NOUN
bioscience-222	402	5	.	.	PUNCT
bioscience-222	403	1	2005;10(2):51	2005;10(2):51	NUM
bioscience-222	403	2	-	-	SYM
bioscience-222	403	3	4	4	NUM
bioscience-222	403	4	.	.	NUM
bioscience-222	403	5	46	46	NUM
bioscience-222	403	6	.	.	PUNCT
bioscience-222	404	1	cheng	cheng	PROPN
bioscience-222	404	2	q	q	PROPN
bioscience-222	404	3	,	,	PUNCT
bioscience-222	404	4	dong	dong	PROPN
bioscience-222	404	5	l	l	PROPN
bioscience-222	404	6	,	,	PUNCT
bioscience-222	404	7	gao	gao	PROPN
bioscience-222	404	8	t	t	PROPN
bioscience-222	404	9	,	,	PUNCT
bioscience-222	404	10	liu	liu	PROPN
bioscience-222	404	11	t	t	PROPN
bioscience-222	404	12	,	,	PUNCT
bioscience-222	404	13	li	li	PROPN
bioscience-222	404	14	n	n	PROPN
bioscience-222	404	15	,	,	PUNCT
bioscience-222	404	16	wang	wang	PROPN
bioscience-222	404	17	l	l	PROPN
bioscience-222	404	18	,	,	PUNCT
bioscience-222	404	19	et	et	PROPN
bioscience-222	404	20	al	al	PROPN
bioscience-222	404	21	.	.	PUNCT
bioscience-222	405	1	the	the	DET
bioscience-222	405	2	bhlh	bhlh	NOUN
bioscience-222	405	3	transcription	transcription	NOUN
bioscience-222	405	4	factor	factor	NOUN
bioscience-222	405	5	gmpib1	gmpib1	NOUN
bioscience-222	405	6	facilitates	facilitate	VERB
bioscience-222	405	7	resistance	resistance	NOUN
bioscience-222	405	8	to	to	ADP
bioscience-222	405	9	phytophthora	phytophthora	NOUN
bioscience-222	405	10	sojae	sojae	NOUN
bioscience-222	405	11	in	in	ADP
bioscience-222	405	12	glycine	glycine	PROPN
bioscience-222	405	13	max	max	PROPN
bioscience-222	405	14	.	.	PROPN
bioscience-222	406	1	journal	journal	PROPN
bioscience-222	406	2	of	of	ADP
bioscience-222	406	3	experimental	experimental	ADJ
bioscience-222	406	4	botany	botany	NOUN
bioscience-222	406	5	.	.	PUNCT
bioscience-222	407	1	2018;69(10):2527	2018;69(10):2527	NUM
bioscience-222	407	2	-	-	SYM
bioscience-222	407	3	41	41	NUM
bioscience-222	407	4	.	.	PUNCT
bioscience-222	408	1	47	47	NUM
bioscience-222	408	2	.	.	PUNCT
bioscience-222	409	1	koini	koini	PROPN
bioscience-222	409	2	ma	ma	PROPN
bioscience-222	409	3	,	,	PUNCT
bioscience-222	409	4	alvey	alvey	NOUN
bioscience-222	409	5	l	l	PROPN
bioscience-222	409	6	,	,	PUNCT
bioscience-222	409	7	allen	allen	PROPN
bioscience-222	409	8	t	t	PROPN
bioscience-222	409	9	,	,	PUNCT
bioscience-222	409	10	tilley	tilley	PROPN
bioscience-222	409	11	ca	ca	PROPN
bioscience-222	409	12	,	,	PUNCT
bioscience-222	409	13	harberd	harberd	VERB
bioscience-222	409	14	np	np	PROPN
bioscience-222	409	15	,	,	PUNCT
bioscience-222	409	16	whitelam	whitelam	PROPN
bioscience-222	409	17	gc	gc	PROPN
bioscience-222	409	18	,	,	PUNCT
bioscience-222	409	19	et	et	PROPN
bioscience-222	409	20	al	al	PROPN
bioscience-222	409	21	.	.	PROPN
bioscience-222	409	22	high	high	ADJ
bioscience-222	409	23	temperature	temperature	NOUN
bioscience-222	409	24	-	-	PUNCT
bioscience-222	409	25	mediated	mediate	VERB
bioscience-222	409	26	adaptations	adaptation	NOUN
bioscience-222	409	27	in	in	ADP
bioscience-222	409	28	plant	plant	NOUN
bioscience-222	409	29	architecture	architecture	NOUN
bioscience-222	409	30	require	require	VERB
bioscience-222	409	31	the	the	DET
bioscience-222	409	32	bhlh	bhlh	NOUN
bioscience-222	409	33	transcription	transcription	NOUN
bioscience-222	409	34	factor	factor	NOUN
bioscience-222	409	35	pif4	pif4	PROPN
bioscience-222	409	36	.	.	PUNCT
bioscience-222	410	1	current	current	ADJ
bioscience-222	410	2	biology	biology	NOUN
bioscience-222	410	3	.	.	PUNCT
bioscience-222	411	1	2009;19(5):408	2009;19(5):408	NUM
bioscience-222	411	2	-	-	SYM
bioscience-222	411	3	13	13	NUM
bioscience-222	411	4	.	.	PUNCT
bioscience-222	412	1	48	48	NUM
bioscience-222	412	2	.	.	PUNCT
bioscience-222	413	1	chinnusamy	chinnusamy	PROPN
bioscience-222	413	2	v	v	PROPN
bioscience-222	413	3	,	,	PUNCT
bioscience-222	413	4	ohta	ohta	PROPN
bioscience-222	413	5	m	m	PROPN
bioscience-222	413	6	,	,	PUNCT
bioscience-222	413	7	kanrar	kanrar	PROPN
bioscience-222	413	8	s	s	PROPN
bioscience-222	413	9	,	,	PUNCT
bioscience-222	413	10	lee	lee	PROPN
bioscience-222	413	11	bh	bh	PROPN
bioscience-222	413	12	,	,	PUNCT
bioscience-222	413	13	hong	hong	PROPN
bioscience-222	413	14	x	x	PROPN
bioscience-222	413	15	,	,	PUNCT
bioscience-222	413	16	agarwal	agarwal	PROPN
bioscience-222	413	17	m	m	PROPN
bioscience-222	413	18	,	,	PUNCT
bioscience-222	413	19	et	et	PROPN
bioscience-222	413	20	al	al	PROPN
bioscience-222	413	21	.	.	PUNCT
bioscience-222	413	22	complex	complex	ADJ
bioscience-222	413	23	regulation	regulation	NOUN
bioscience-222	413	24	of	of	ADP
bioscience-222	413	25	cold	cold	ADJ
bioscience-222	413	26	-	-	PUNCT
bioscience-222	413	27	responsive	responsive	ADJ
bioscience-222	413	28	gene	gene	NOUN
bioscience-222	413	29	expression	expression	NOUN
bioscience-222	413	30	in	in	ADP
bioscience-222	413	31	arabidopsis	arabidopsis	NOUN
bioscience-222	413	32	through	through	ADP
bioscience-222	413	33	genetic	genetic	ADJ
bioscience-222	413	34	and	and	CCONJ
bioscience-222	413	35	epigenetic	epigenetic	ADJ
bioscience-222	413	36	mechanisms	mechanism	NOUN
bioscience-222	413	37	.	.	PUNCT
bioscience-222	414	1	plant	plant	NOUN
bioscience-222	414	2	j.	j.	PROPN
bioscience-222	414	3	2003;33:334	2003;33:334	PROPN
bioscience-222	414	4	-	-	PUNCT
bioscience-222	414	5	42	42	NUM
bioscience-222	414	6	.	.	PUNCT
bioscience-222	415	1	49	49	NUM
bioscience-222	415	2	.	.	PUNCT
bioscience-222	416	1	fujita	fujita	PROPN
bioscience-222	416	2	m	m	PROPN
bioscience-222	416	3	,	,	PUNCT
bioscience-222	416	4	fujita	fujita	PROPN
bioscience-222	416	5	y	y	PROPN
bioscience-222	416	6	,	,	PUNCT
bioscience-222	416	7	noutoshi	noutoshi	PROPN
bioscience-222	416	8	y	y	PROPN
bioscience-222	416	9	,	,	PUNCT
bioscience-222	416	10	takahashi	takahashi	PROPN
bioscience-222	416	11	f	f	PROPN
bioscience-222	416	12	,	,	PUNCT
bioscience-222	416	13	narusaka	narusaka	PROPN
bioscience-222	416	14	y	y	PROPN
bioscience-222	416	15	,	,	PUNCT
bioscience-222	416	16	yamaguchi	yamaguchi	PROPN
bioscience-222	416	17	-	-	PUNCT
bioscience-222	416	18	shinozaki	shinozaki	PROPN
bioscience-222	416	19	k	k	PROPN
bioscience-222	416	20	,	,	PUNCT
bioscience-222	416	21	et	et	PROPN
bioscience-222	416	22	al	al	PROPN
bioscience-222	416	23	.	.	PROPN
bioscience-222	416	24	crosstalk	crosstalk	VERB
bioscience-222	416	25	between	between	ADP
bioscience-222	416	26	abiotic	abiotic	ADJ
bioscience-222	416	27	and	and	CCONJ
bioscience-222	416	28	biotic	biotic	ADJ
bioscience-222	416	29	stress	stress	NOUN
bioscience-222	416	30	responses	response	NOUN
bioscience-222	416	31	:	:	PUNCT
bioscience-222	416	32	a	a	DET
bioscience-222	416	33	current	current	ADJ
bioscience-222	416	34	view	view	NOUN
bioscience-222	416	35	from	from	ADP
bioscience-222	416	36	the	the	DET
bioscience-222	416	37	points	point	NOUN
bioscience-222	416	38	of	of	ADP
bioscience-222	416	39	convergence	convergence	NOUN
bioscience-222	416	40	in	in	ADP
bioscience-222	416	41	the	the	DET
bioscience-222	416	42	stress	stress	NOUN
bioscience-222	416	43	signaling	signal	VERB
bioscience-222	416	44	networks	network	NOUN
bioscience-222	416	45	.	.	PUNCT
bioscience-222	417	1	current	current	ADJ
bioscience-222	417	2	opinion	opinion	NOUN
bioscience-222	417	3	in	in	ADP
bioscience-222	417	4	plant	plant	NOUN
bioscience-222	417	5	biology	biology	NOUN
bioscience-222	417	6	.	.	PUNCT
bioscience-222	418	1	2006;9(4):436	2006;9(4):436	NUM
bioscience-222	418	2	-	-	SYM
bioscience-222	418	3	42	42	NUM
bioscience-222	418	4	.	.	PUNCT
bioscience-222	419	1	50	50	NUM
bioscience-222	419	2	.	.	X
bioscience-222	420	1	feller	feller	VERB
bioscience-222	420	2	a	a	PRON
bioscience-222	420	3	,	,	PUNCT
bioscience-222	420	4	machemer	machemer	ADJ
bioscience-222	420	5	k	k	NOUN
bioscience-222	420	6	,	,	PUNCT
bioscience-222	420	7	braun	braun	PROPN
bioscience-222	420	8	el	el	PROPN
bioscience-222	420	9	,	,	PUNCT
bioscience-222	420	10	grotewold	grotewold	PROPN
bioscience-222	420	11	e.	e.	PROPN
bioscience-222	420	12	evolutionary	evolutionary	PROPN
bioscience-222	420	13	and	and	CCONJ
bioscience-222	420	14	comparative	comparative	ADJ
bioscience-222	420	15	analysis	analysis	NOUN
bioscience-222	420	16	of	of	ADP
bioscience-222	420	17	myb	myb	NOUN
bioscience-222	420	18	and	and	CCONJ
bioscience-222	420	19	bhlh	bhlh	NOUN
bioscience-222	420	20	plant	plant	NOUN
bioscience-222	420	21	transcription	transcription	NOUN
bioscience-222	420	22	factors	factor	NOUN
bioscience-222	420	23	.	.	PUNCT
bioscience-222	421	1	the	the	DET
bioscience-222	421	2	plant	plant	NOUN
bioscience-222	421	3	journal	journal	NOUN
bioscience-222	421	4	.	.	PUNCT
bioscience-222	422	1	2011;66(1):94	2011;66(1):94	NUM
bioscience-222	422	2	-	-	SYM
bioscience-222	422	3	116	116	NUM
bioscience-222	422	4	.	.	PUNCT
bioscience-222	423	1	51	51	NUM
bioscience-222	423	2	.	.	PUNCT
bioscience-222	423	3	schwartz	schwartz	PROPN
bioscience-222	423	4	ar	ar	PROPN
bioscience-222	423	5	,	,	PUNCT
bioscience-222	423	6	morbitzer	morbitzer	PROPN
bioscience-222	423	7	r	r	NOUN
bioscience-222	423	8	,	,	PUNCT
bioscience-222	423	9	lahaye	lahaye	PROPN
bioscience-222	423	10	t	t	PROPN
bioscience-222	423	11	,	,	PUNCT
bioscience-222	423	12	staskawicz	staskawicz	NOUN
bioscience-222	423	13	bj	bj	NOUN
bioscience-222	423	14	.	.	PUNCT
bioscience-222	424	1	taleinduced	taleinduce	VERB
bioscience-222	424	2	bhlh	bhlh	NOUN
bioscience-222	424	3	transcription	transcription	NOUN
bioscience-222	424	4	factors	factor	NOUN
bioscience-222	424	5	that	that	PRON
bioscience-222	424	6	activate	activate	VERB
bioscience-222	424	7	a	a	DET
bioscience-222	424	8	pectate	pectate	ADJ
bioscience-222	424	9	lyase	lyase	NOUN
bioscience-222	424	10	contribute	contribute	NOUN
bioscience-222	424	11	to	to	ADP
bioscience-222	424	12	water	water	NOUN
bioscience-222	424	13	soaking	soak	VERB
bioscience-222	424	14	in	in	ADP
bioscience-222	424	15	bacterial	bacterial	ADJ
bioscience-222	424	16	spot	spot	NOUN
bioscience-222	424	17	of	of	ADP
bioscience-222	424	18	tomato	tomato	NOUN
bioscience-222	424	19	.	.	PUNCT
bioscience-222	425	1	proceedings	proceeding	NOUN
bioscience-222	425	2	of	of	ADP
bioscience-222	425	3	the	the	DET
bioscience-222	425	4	national	national	PROPN
bioscience-222	425	5	academy	academy	PROPN
bioscience-222	425	6	of	of	ADP
bioscience-222	425	7	sciences	sciences	PROPN
bioscience-222	425	8	.	.	PUNCT
bioscience-222	425	9	2017;114(5	2017;114(5	NUM
bioscience-222	425	10	)	)	PUNCT
bioscience-222	425	11	.	.	PUNCT
bioscience-222	426	1	52	52	NUM
bioscience-222	426	2	.	.	X
bioscience-222	426	3	varshney	varshney	NOUN
bioscience-222	426	4	rk	rk	NOUN
bioscience-222	426	5	,	,	PUNCT
bioscience-222	426	6	song	song	NOUN
bioscience-222	426	7	c	c	PROPN
bioscience-222	426	8	,	,	PUNCT
bioscience-222	426	9	saxena	saxena	PROPN
bioscience-222	426	10	rk	rk	PROPN
bioscience-222	426	11	,	,	PUNCT
bioscience-222	426	12	azam	azam	PROPN
bioscience-222	426	13	s	s	PROPN
bioscience-222	426	14	,	,	PUNCT
bioscience-222	426	15	yu	yu	PROPN
bioscience-222	426	16	s	s	PROPN
bioscience-222	426	17	,	,	PUNCT
bioscience-222	426	18	sharpe	sharpe	PROPN
bioscience-222	426	19	ag	ag	PROPN
bioscience-222	426	20	,	,	PUNCT
bioscience-222	426	21	et	et	PROPN
bioscience-222	426	22	al	al	PROPN
bioscience-222	426	23	.	.	PROPN
bioscience-222	426	24	draft	draft	NOUN
bioscience-222	426	25	genome	genome	NOUN
bioscience-222	426	26	sequence	sequence	NOUN
bioscience-222	426	27	of	of	ADP
bioscience-222	426	28	chickpea	chickpea	NOUN
bioscience-222	426	29	(	(	PUNCT
bioscience-222	426	30	cicer	cicer	VERB
bioscience-222	426	31	arietinum	arietinum	PRON
bioscience-222	426	32	)	)	PUNCT
bioscience-222	426	33	provides	provide	VERB
bioscience-222	426	34	a	a	DET
bioscience-222	426	35	resource	resource	NOUN
bioscience-222	426	36	for	for	ADP
bioscience-222	426	37	trait	trait	NOUN
bioscience-222	426	38	improvement	improvement	NOUN
bioscience-222	426	39	.	.	PUNCT
bioscience-222	427	1	nature	nature	NOUN
bioscience-222	427	2	biotechnology	biotechnology	NOUN
bioscience-222	427	3	.	.	PUNCT
bioscience-222	428	1	2013;31(3):240	2013;31(3):240	NUM
bioscience-222	428	2	.	.	PUNCT
bioscience-222	429	1	highlights	highlight	NOUN
bioscience-222	429	2	in	in	ADP
bioscience-222	429	3	bioscience	bioscience	NOUN
bioscience-222	429	4	page	page	NOUN
bioscience-222	429	5	11	11	NUM
bioscience-222	429	6	of	of	ADP
bioscience-222	429	7	11	11	NUM
bioscience-222	429	8	december	december	PROPN
bioscience-222	429	9	2024|volume	2024|volume	NUM
bioscience-222	429	10	7	7	NUM
bioscience-222	429	11	http://bioscience.highlightsin.org/	http://bioscience.highlightsin.org/	NOUN
bioscience-222	429	12	abstract	abstract	ADJ
bioscience-222	429	13	introduction	introduction	NOUN
bioscience-222	429	14	materials	material	NOUN
bioscience-222	429	15	and	and	CCONJ
bioscience-222	429	16	methods	method	NOUN
bioscience-222	429	17	plant	plant	NOUN
bioscience-222	429	18	materials	material	NOUN
bioscience-222	429	19	and	and	CCONJ
bioscience-222	429	20	dna	dna	NOUN
bioscience-222	429	21	isolation	isolation	NOUN
bioscience-222	429	22	dart	dart	NOUN
bioscience-222	429	23	and	and	CCONJ
bioscience-222	429	24	dartseq	dartseq	VERB
bioscience-222	429	25	experimental	experimental	ADJ
bioscience-222	429	26	design	design	NOUN
bioscience-222	429	27	and	and	CCONJ
bioscience-222	429	28	locations	location	NOUN
bioscience-222	429	29	scoring	score	VERB
bioscience-222	429	30	plants	plant	NOUN
bioscience-222	429	31	for	for	ADP
bioscience-222	429	32	ab	ab	PROPN
bioscience-222	429	33	symptom	symptom	PROPN
bioscience-222	429	34	severity	severity	PROPN
bioscience-222	429	35	statistical	statistical	ADJ
bioscience-222	429	36	analysis	analysis	NOUN
bioscience-222	429	37	results	result	VERB
bioscience-222	429	38	phenotypic	phenotypic	ADJ
bioscience-222	429	39	characterization	characterization	NOUN
bioscience-222	429	40	mapping	mapping	NOUN
bioscience-222	429	41	and	and	CCONJ
bioscience-222	429	42	qtl	qtl	PROPN
bioscience-222	429	43	analyses	analyse	VERB
bioscience-222	429	44	discussion	discussion	NOUN