id	sid	tid	token	lemma	pos
iajs-3652	1	1	105	105	NUM
iajs-3652	1	2	©	©	ADP
iajs-3652	1	3	2025	2025	NUM
iajs-3652	1	4	the	the	DET
iajs-3652	1	5	author(s	author(s	NOUN
iajs-3652	1	6	)	)	PUNCT
iajs-3652	1	7	.	.	PUNCT
iajs-3652	2	1	published	publish	VERB
iajs-3652	2	2	by	by	ADP
iajs-3652	2	3	college	college	NOUN
iajs-3652	2	4	of	of	ADP
iajs-3652	2	5	education	education	NOUN
iajs-3652	2	6	for	for	ADP
iajs-3652	2	7	pure	pure	ADJ
iajs-3652	2	8	science	science	NOUN
iajs-3652	2	9	(	(	PUNCT
iajs-3652	2	10	ibn	ibn	PROPN
iajs-3652	2	11	al	al	PROPN
iajs-3652	2	12	-	-	PUNCT
iajs-3652	2	13	haitham	haitham	PROPN
iajs-3652	2	14	)	)	PUNCT
iajs-3652	2	15	,	,	PUNCT
iajs-3652	2	16	university	university	NOUN
iajs-3652	2	17	of	of	ADP
iajs-3652	2	18	baghdad	baghdad	PROPN
iajs-3652	2	19	.	.	PUNCT
iajs-3652	3	1	this	this	PRON
iajs-3652	3	2	is	be	AUX
iajs-3652	3	3	an	an	DET
iajs-3652	3	4	open	open	ADJ
iajs-3652	3	5	-	-	PUNCT
iajs-3652	3	6	access	access	NOUN
iajs-3652	3	7	article	article	NOUN
iajs-3652	3	8	distributed	distribute	VERB
iajs-3652	3	9	under	under	ADP
iajs-3652	3	10	the	the	DET
iajs-3652	3	11	terms	term	NOUN
iajs-3652	3	12	of	of	ADP
iajs-3652	3	13	the	the	DET
iajs-3652	3	14	creative	creative	ADJ
iajs-3652	3	15	commons	common	NOUN
iajs-3652	3	16	attribution	attribution	NOUN
iajs-3652	3	17	4.0	4.0	NUM
iajs-3652	3	18	international	international	ADJ
iajs-3652	3	19	license	license	NOUN
iajs-3652	3	20	molecular	molecular	ADJ
iajs-3652	3	21	characterization	characterization	NOUN
iajs-3652	3	22	of	of	ADP
iajs-3652	3	23	algd	algd	NOUN
iajs-3652	3	24	and	and	CCONJ
iajs-3652	3	25	tspe4.c2	tspe4.c2	NOUN
iajs-3652	3	26	genes	gene	NOUN
iajs-3652	3	27	in	in	ADP
iajs-3652	3	28	escherichia	escherichia	NOUN
iajs-3652	3	29	coli	coli	NOUN
iajs-3652	3	30	isolated	isolate	VERB
iajs-3652	3	31	from	from	ADP
iajs-3652	3	32	urinary	urinary	ADJ
iajs-3652	3	33	tract	tract	NOUN
iajs-3652	3	34	infection	infection	NOUN
iajs-3652	3	35	patients	patient	NOUN
iajs-3652	3	36	zahraa	zahraa	VERB
iajs-3652	3	37	jamaal	jamaal	PROPN
iajs-3652	3	38	al	al	PROPN
iajs-3652	3	39	-	-	PUNCT
iajs-3652	3	40	din	din	PROPN
iajs-3652	3	41	m.	m.	PROPN
iajs-3652	3	42	shafiq	shafiq	PROPN
iajs-3652	3	43	1	1	NUM
iajs-3652	3	44	*	*	PUNCT
iajs-3652	3	45	and	and	CCONJ
iajs-3652	3	46	souad	souad	PROPN
iajs-3652	3	47	khalil	khalil	PROPN
iajs-3652	3	48	ibrahim	ibrahim	PROPN
iajs-3652	3	49	2	2	NUM
iajs-3652	3	50	1,2	1,2	NUM
iajs-3652	3	51	department	department	NOUN
iajs-3652	3	52	of	of	ADP
iajs-3652	3	53	biology	biology	NOUN
iajs-3652	3	54	,	,	PUNCT
iajs-3652	3	55	college	college	NOUN
iajs-3652	3	56	of	of	ADP
iajs-3652	3	57	education	education	NOUN
iajs-3652	3	58	for	for	ADP
iajs-3652	3	59	pure	pure	ADJ
iajs-3652	3	60	science	science	NOUN
iajs-3652	3	61	(	(	PUNCT
iajs-3652	3	62	ibn	ibn	PROPN
iajs-3652	3	63	alhaitham	alhaitham	NOUN
iajs-3652	3	64	)	)	PUNCT
iajs-3652	3	65	,	,	PUNCT
iajs-3652	3	66	university	university	NOUN
iajs-3652	3	67	of	of	ADP
iajs-3652	3	68	baghdad	baghdad	PROPN
iajs-3652	3	69	,	,	PUNCT
iajs-3652	3	70	baghdad	baghdad	PROPN
iajs-3652	3	71	,	,	PUNCT
iajs-3652	3	72	iraq	iraq	PROPN
iajs-3652	3	73	.	.	PUNCT
iajs-3652	4	1	*	*	PUNCT
iajs-3652	4	2	corresponding	correspond	VERB
iajs-3652	4	3	author	author	NOUN
iajs-3652	4	4	.	.	PUNCT
iajs-3652	5	1	received	receive	VERB
iajs-3652	5	2	:	:	PUNCT
iajs-3652	5	3	5	5	NUM
iajs-3652	5	4	july	july	PROPN
iajs-3652	5	5	2023	2023	NUM
iajs-3652	5	6	accepted	accept	VERB
iajs-3652	5	7	:	:	PUNCT
iajs-3652	5	8	10	10	NUM
iajs-3652	5	9	september	september	PROPN
iajs-3652	5	10	2023	2023	NUM
iajs-3652	5	11	published	publish	VERB
iajs-3652	5	12	:	:	PUNCT
iajs-3652	5	13	20	20	NUM
iajs-3652	5	14	july	july	NOUN
iajs-3652	5	15	2025	2025	NUM
iajs-3652	5	16	doi.org/10.30526/38.3.3652	doi.org/10.30526/38.3.3652	AUX
iajs-3652	5	17	abstract	abstract	VERB
iajs-3652	5	18	the	the	DET
iajs-3652	5	19	current	current	ADJ
iajs-3652	5	20	study	study	NOUN
iajs-3652	5	21	collected	collect	VERB
iajs-3652	5	22	157	157	NUM
iajs-3652	5	23	clinical	clinical	ADJ
iajs-3652	5	24	samples	sample	NOUN
iajs-3652	5	25	from	from	ADP
iajs-3652	5	26	iraqi	iraqi	ADJ
iajs-3652	5	27	patients	patient	NOUN
iajs-3652	5	28	suffering	suffer	VERB
iajs-3652	5	29	from	from	ADP
iajs-3652	5	30	urinary	urinary	ADJ
iajs-3652	5	31	tract	tract	NOUN
iajs-3652	5	32	infections	infection	NOUN
iajs-3652	5	33	at	at	ADP
iajs-3652	5	34	various	various	ADJ
iajs-3652	5	35	baghdad	baghdad	PROPN
iajs-3652	5	36	hospitals	hospital	NOUN
iajs-3652	5	37	,	,	PUNCT
iajs-3652	5	38	including	include	VERB
iajs-3652	5	39	medical	medical	ADJ
iajs-3652	5	40	city	city	NOUN
iajs-3652	5	41	/	/	SYM
iajs-3652	5	42	educational	educational	ADJ
iajs-3652	5	43	laboratories	laboratory	NOUN
iajs-3652	5	44	,	,	PUNCT
iajs-3652	5	45	baghdad	baghdad	PROPN
iajs-3652	5	46	teaching	teaching	NOUN
iajs-3652	5	47	hospital	hospital	NOUN
iajs-3652	5	48	,	,	PUNCT
iajs-3652	5	49	imamin	imamin	PROPN
iajs-3652	5	50	al	al	PROPN
iajs-3652	5	51	-	-	PUNCT
iajs-3652	5	52	kadhimiya	kadhimiya	NOUN
iajs-3652	5	53	hospital	hospital	NOUN
iajs-3652	5	54	,	,	PUNCT
iajs-3652	5	55	and	and	CCONJ
iajs-3652	5	56	the	the	DET
iajs-3652	5	57	central	central	ADJ
iajs-3652	5	58	children	child	NOUN
iajs-3652	5	59	's	's	PART
iajs-3652	5	60	hospital	hospital	NOUN
iajs-3652	5	61	in	in	ADP
iajs-3652	5	62	baghdad	baghdad	PROPN
iajs-3652	5	63	,	,	PUNCT
iajs-3652	5	64	from	from	ADP
iajs-3652	5	65	27	27	NUM
iajs-3652	5	66	november	november	PROPN
iajs-3652	5	67	2022	2022	NUM
iajs-3652	5	68	to	to	ADP
iajs-3652	5	69	11	11	NUM
iajs-3652	5	70	january	january	PROPN
iajs-3652	5	71	2023	2023	NUM
iajs-3652	5	72	.	.	PUNCT
iajs-3652	6	1	we	we	PRON
iajs-3652	6	2	identified	identify	VERB
iajs-3652	6	3	and	and	CCONJ
iajs-3652	6	4	tested	test	VERB
iajs-3652	6	5	the	the	DET
iajs-3652	6	6	formation	formation	NOUN
iajs-3652	6	7	of	of	ADP
iajs-3652	6	8	biofilms	biofilm	NOUN
iajs-3652	6	9	,	,	PUNCT
iajs-3652	6	10	which	which	PRON
iajs-3652	6	11	led	lead	VERB
iajs-3652	6	12	to	to	ADP
iajs-3652	6	13	the	the	DET
iajs-3652	6	14	detection	detection	NOUN
iajs-3652	6	15	of	of	ADP
iajs-3652	6	16	two	two	NUM
iajs-3652	6	17	genes	gene	NOUN
iajs-3652	6	18	,	,	PUNCT
iajs-3652	6	19	algd	algd	NOUN
iajs-3652	6	20	and	and	CCONJ
iajs-3652	6	21	tspe4.c2	tspe4.c2	PROPN
iajs-3652	6	22	.	.	PUNCT
iajs-3652	7	1	vitek	vitek	PROPN
iajs-3652	7	2	2	2	PROPN
iajs-3652	7	3	confirmed	confirm	VERB
iajs-3652	7	4	the	the	DET
iajs-3652	7	5	final	final	ADJ
iajs-3652	7	6	diagnosis	diagnosis	NOUN
iajs-3652	7	7	after	after	ADP
iajs-3652	7	8	a	a	DET
iajs-3652	7	9	biochemical	biochemical	ADJ
iajs-3652	7	10	and	and	CCONJ
iajs-3652	7	11	microscopic	microscopic	ADJ
iajs-3652	7	12	examination	examination	NOUN
iajs-3652	7	13	of	of	ADP
iajs-3652	7	14	11	11	NUM
iajs-3652	7	15	selected	select	VERB
iajs-3652	7	16	e.	e.	PROPN
iajs-3652	7	17	coli	coli	NOUN
iajs-3652	7	18	isolates	isolate	NOUN
iajs-3652	7	19	.	.	PUNCT
iajs-3652	8	1	the	the	DET
iajs-3652	8	2	congo	congo	PROPN
iajs-3652	8	3	red	red	ADJ
iajs-3652	8	4	method	method	NOUN
iajs-3652	8	5	has	have	AUX
iajs-3652	8	6	detected	detect	VERB
iajs-3652	8	7	the	the	DET
iajs-3652	8	8	bacterial	bacterial	ADJ
iajs-3652	8	9	vulnerability	vulnerability	NOUN
iajs-3652	8	10	to	to	PART
iajs-3652	8	11	form	form	VERB
iajs-3652	8	12	biofilms	biofilm	NOUN
iajs-3652	8	13	.	.	PUNCT
iajs-3652	9	1	he	he	PRON
iajs-3652	9	2	findings	finding	VERB
iajs-3652	9	3	of	of	ADP
iajs-3652	9	4	this	this	DET
iajs-3652	9	5	study	study	NOUN
iajs-3652	9	6	showed	show	VERB
iajs-3652	9	7	that	that	SCONJ
iajs-3652	9	8	all	all	PRON
iajs-3652	9	9	selected	select	VERB
iajs-3652	9	10	bacterial	bacterial	ADJ
iajs-3652	9	11	isolates	isolate	NOUN
iajs-3652	9	12	formed	form	VERB
iajs-3652	9	13	the	the	DET
iajs-3652	9	14	biofilm	biofilm	NOUN
iajs-3652	9	15	with	with	ADP
iajs-3652	9	16	a	a	DET
iajs-3652	9	17	moderate	moderate	ADJ
iajs-3652	9	18	degree	degree	NOUN
iajs-3652	9	19	(	(	PUNCT
iajs-3652	9	20	11	11	NUM
iajs-3652	9	21	(	(	PUNCT
iajs-3652	9	22	100	100	NUM
iajs-3652	9	23	%	%	NOUN
iajs-3652	9	24	)	)	PUNCT
iajs-3652	9	25	)	)	PUNCT
iajs-3652	9	26	.	.	PUNCT
iajs-3652	10	1	the	the	DET
iajs-3652	10	2	polymerase	polymerase	NOUN
iajs-3652	10	3	chain	chain	NOUN
iajs-3652	10	4	reaction	reaction	NOUN
iajs-3652	10	5	(	(	PUNCT
iajs-3652	10	6	pcr	pcr	PROPN
iajs-3652	10	7	)	)	PUNCT
iajs-3652	10	8	identified	identify	VERB
iajs-3652	10	9	the	the	DET
iajs-3652	10	10	algd	algd	NOUN
iajs-3652	10	11	and	and	CCONJ
iajs-3652	10	12	tspe4.c2	tspe4.c2	NOUN
iajs-3652	10	13	genes	gene	NOUN
iajs-3652	10	14	,	,	PUNCT
iajs-3652	10	15	demonstrating	demonstrate	VERB
iajs-3652	10	16	their	their	PRON
iajs-3652	10	17	significant	significant	ADJ
iajs-3652	10	18	role	role	NOUN
iajs-3652	10	19	in	in	ADP
iajs-3652	10	20	biofilm	biofilm	NOUN
iajs-3652	10	21	production	production	NOUN
iajs-3652	10	22	.	.	PUNCT
iajs-3652	11	1	the	the	DET
iajs-3652	11	2	polymerase	polymerase	NOUN
iajs-3652	11	3	chain	chain	NOUN
iajs-3652	11	4	reaction	reaction	NOUN
iajs-3652	11	5	results	result	NOUN
iajs-3652	11	6	revealed	reveal	VERB
iajs-3652	11	7	the	the	DET
iajs-3652	11	8	presence	presence	NOUN
iajs-3652	11	9	of	of	ADP
iajs-3652	11	10	the	the	DET
iajs-3652	11	11	algd	algd	NOUN
iajs-3652	11	12	gene	gene	NOUN
iajs-3652	11	13	in	in	ADP
iajs-3652	11	14	9	9	NUM
iajs-3652	11	15	(	(	PUNCT
iajs-3652	11	16	81.8	81.8	NUM
iajs-3652	11	17	%	%	NOUN
iajs-3652	11	18	)	)	PUNCT
iajs-3652	11	19	out	out	ADP
iajs-3652	11	20	of	of	ADP
iajs-3652	11	21	11	11	NUM
iajs-3652	11	22	isolates	isolate	NOUN
iajs-3652	11	23	,	,	PUNCT
iajs-3652	11	24	while	while	SCONJ
iajs-3652	11	25	the	the	DET
iajs-3652	11	26	tspe4.c2	tspe4.c2	NOUN
iajs-3652	11	27	gene	gene	NOUN
iajs-3652	11	28	was	be	AUX
iajs-3652	11	29	present	present	ADJ
iajs-3652	11	30	in	in	ADP
iajs-3652	11	31	10	10	NUM
iajs-3652	11	32	(	(	PUNCT
iajs-3652	11	33	90.9	90.9	NUM
iajs-3652	11	34	%	%	NOUN
iajs-3652	11	35	)	)	PUNCT
iajs-3652	11	36	isolates	isolate	NOUN
iajs-3652	11	37	.	.	PUNCT
iajs-3652	12	1	keywords	keyword	NOUN
iajs-3652	12	2	:	:	PUNCT
iajs-3652	12	3	escherichia	escherichia	NOUN
iajs-3652	12	4	coli	coli	NOUN
iajs-3652	12	5	,	,	PUNCT
iajs-3652	12	6	algd	algd	NOUN
iajs-3652	12	7	gene	gene	NOUN
iajs-3652	12	8	,	,	PUNCT
iajs-3652	12	9	tspe4.c2	tspe4.c2	NOUN
iajs-3652	12	10	gene	gene	NOUN
iajs-3652	12	11	,	,	PUNCT
iajs-3652	12	12	virulence	virulence	NOUN
iajs-3652	12	13	.	.	PUNCT
iajs-3652	13	1	1	1	X
iajs-3652	13	2	.	.	X
iajs-3652	13	3	introduction	introduction	NOUN
iajs-3652	13	4	the	the	DET
iajs-3652	13	5	genus	genus	NOUN
iajs-3652	13	6	escherichia	escherichia	NOUN
iajs-3652	13	7	takes	take	VERB
iajs-3652	13	8	its	its	PRON
iajs-3652	13	9	name	name	NOUN
iajs-3652	13	10	from	from	ADP
iajs-3652	13	11	theodor	theodor	PROPN
iajs-3652	13	12	escherich	escherich	ADV
iajs-3652	13	13	.	.	PUNCT
iajs-3652	14	1	escherichia	escherichia	NOUN
iajs-3652	14	2	coli	coli	NOUN
iajs-3652	14	3	is	be	AUX
iajs-3652	14	4	extensively	extensively	ADV
iajs-3652	14	5	dispersed	disperse	VERB
iajs-3652	14	6	,	,	PUNCT
iajs-3652	14	7	and	and	CCONJ
iajs-3652	14	8	it	it	PRON
iajs-3652	14	9	is	be	AUX
iajs-3652	14	10	the	the	DET
iajs-3652	14	11	predominant	predominant	ADJ
iajs-3652	14	12	facultative	facultative	ADJ
iajs-3652	14	13	anaerobic	anaerobic	NOUN
iajs-3652	14	14	that	that	PRON
iajs-3652	14	15	lives	live	VERB
iajs-3652	14	16	in	in	ADP
iajs-3652	14	17	the	the	DET
iajs-3652	14	18	human	human	ADJ
iajs-3652	14	19	large	large	ADJ
iajs-3652	14	20	intestine	intestine	NOUN
iajs-3652	14	21	.	.	PUNCT
iajs-3652	15	1	numerous	numerous	ADJ
iajs-3652	15	2	pathogenic	pathogenic	ADJ
iajs-3652	15	3	strains	strain	NOUN
iajs-3652	15	4	of	of	ADP
iajs-3652	15	5	escherichia	escherichia	NOUN
iajs-3652	15	6	coli	coli	NOUN
iajs-3652	15	7	(	(	PUNCT
iajs-3652	15	8	e.	e.	NOUN
iajs-3652	15	9	coli	coli	PROPN
iajs-3652	15	10	)	)	PUNCT
iajs-3652	15	11	can	can	AUX
iajs-3652	15	12	cause	cause	VERB
iajs-3652	15	13	intestinal	intestinal	ADJ
iajs-3652	15	14	and	and	CCONJ
iajs-3652	15	15	extraintestinal	extraintestinal	ADJ
iajs-3652	15	16	disorders	disorder	NOUN
iajs-3652	15	17	,	,	PUNCT
iajs-3652	15	18	despite	despite	SCONJ
iajs-3652	15	19	the	the	DET
iajs-3652	15	20	fact	fact	NOUN
iajs-3652	15	21	that	that	SCONJ
iajs-3652	15	22	the	the	DET
iajs-3652	15	23	majority	majority	NOUN
iajs-3652	15	24	of	of	ADP
iajs-3652	15	25	e.	e.	PROPN
iajs-3652	15	26	coli	coli	PROPN
iajs-3652	15	27	strains	strain	NOUN
iajs-3652	15	28	reside	reside	VERB
iajs-3652	15	29	harmlessly	harmlessly	ADV
iajs-3652	15	30	in	in	ADP
iajs-3652	15	31	the	the	DET
iajs-3652	15	32	colon	colon	NOUN
iajs-3652	15	33	(	(	PUNCT
iajs-3652	15	34	1	1	NUM
iajs-3652	15	35	,	,	PUNCT
iajs-3652	15	36	2	2	NUM
iajs-3652	15	37	)	)	PUNCT
iajs-3652	15	38	.	.	PUNCT
iajs-3652	16	1	the	the	DET
iajs-3652	16	2	strains	strain	NOUN
iajs-3652	16	3	of	of	ADP
iajs-3652	16	4	extra	extra	ADJ
iajs-3652	16	5	-	-	ADJ
iajs-3652	16	6	intestinal	intestinal	ADJ
iajs-3652	16	7	pathogenic	pathogenic	ADJ
iajs-3652	16	8	e.	e.	PROPN
iajs-3652	16	9	coli	coli	PROPN
iajs-3652	16	10	(	(	PUNCT
iajs-3652	16	11	expec	expec	PROPN
iajs-3652	16	12	)	)	PUNCT
iajs-3652	16	13	,	,	PUNCT
iajs-3652	16	14	which	which	PRON
iajs-3652	16	15	infect	infect	VERB
iajs-3652	16	16	humans	human	NOUN
iajs-3652	16	17	,	,	PUNCT
iajs-3652	16	18	are	be	AUX
iajs-3652	16	19	fairly	fairly	ADV
iajs-3652	16	20	closely	closely	ADV
iajs-3652	16	21	linked	link	VERB
iajs-3652	16	22	phylogenetically	phylogenetically	ADV
iajs-3652	16	23	and	and	CCONJ
iajs-3652	16	24	share	share	VERB
iajs-3652	16	25	several	several	ADJ
iajs-3652	16	26	virulence	virulence	NOUN
iajs-3652	16	27	genes	gene	NOUN
iajs-3652	16	28	(	(	PUNCT
iajs-3652	16	29	3	3	NUM
iajs-3652	16	30	,	,	PUNCT
iajs-3652	16	31	4	4	NUM
iajs-3652	16	32	,	,	PUNCT
iajs-3652	16	33	5).urinary	5).urinary	NUM
iajs-3652	16	34	tract	tract	NOUN
iajs-3652	16	35	infections	infection	NOUN
iajs-3652	16	36	utis	utis	NOUN
iajs-3652	16	37	are	be	AUX
iajs-3652	16	38	amongst	amongst	ADP
iajs-3652	16	39	the	the	DET
iajs-3652	16	40	typical	typical	ADJ
iajs-3652	16	41	infections	infection	NOUN
iajs-3652	16	42	that	that	PRON
iajs-3652	16	43	affect	affect	VERB
iajs-3652	16	44	people	people	NOUN
iajs-3652	16	45	.	.	PUNCT
iajs-3652	17	1	numerous	numerous	ADJ
iajs-3652	17	2	microorganisms	microorganism	NOUN
iajs-3652	17	3	,	,	PUNCT
iajs-3652	17	4	including	include	VERB
iajs-3652	17	5	bacteria	bacteria	NOUN
iajs-3652	17	6	,	,	PUNCT
iajs-3652	17	7	are	be	AUX
iajs-3652	17	8	responsible	responsible	ADJ
iajs-3652	17	9	for	for	ADP
iajs-3652	17	10	over	over	ADP
iajs-3652	17	11	90	90	NUM
iajs-3652	17	12	-	-	SYM
iajs-3652	17	13	95	95	NUM
iajs-3652	17	14	%	%	NOUN
iajs-3652	17	15	of	of	ADP
iajs-3652	17	16	uti	uti	PROPN
iajs-3652	17	17	infections	infection	NOUN
iajs-3652	17	18	.	.	PUNCT
iajs-3652	18	1	both	both	PRON
iajs-3652	18	2	negative	negative	ADJ
iajs-3652	18	3	and	and	CCONJ
iajs-3652	18	4	positive	positive	ADJ
iajs-3652	18	5	gram	gram	NOUN
iajs-3652	18	6	bacteria	bacteria	NOUN
iajs-3652	18	7	that	that	PRON
iajs-3652	18	8	cause	cause	VERB
iajs-3652	18	9	utis	utis	NOUN
iajs-3652	18	10	are	be	AUX
iajs-3652	18	11	the	the	DET
iajs-3652	18	12	foremost	foremost	ADJ
iajs-3652	18	13	communal	communal	ADJ
iajs-3652	18	14	causative	causative	ADJ
iajs-3652	18	15	agents	agent	NOUN
iajs-3652	18	16	.	.	PUNCT
iajs-3652	19	1	e.	e.	PROPN
iajs-3652	19	2	coli	coli	PROPN
iajs-3652	19	3	accounts	account	VERB
iajs-3652	19	4	for	for	ADP
iajs-3652	19	5	50–80	50–80	NUM
iajs-3652	19	6	%	%	NOUN
iajs-3652	19	7	of	of	ADP
iajs-3652	19	8	the	the	DET
iajs-3652	19	9	most	most	ADV
iajs-3652	19	10	prevalent	prevalent	ADJ
iajs-3652	19	11	gram	gram	ADJ
iajs-3652	19	12	-	-	PUNCT
iajs-3652	19	13	negative	negative	ADJ
iajs-3652	19	14	bacteria	bacteria	NOUN
iajs-3652	19	15	that	that	PRON
iajs-3652	19	16	cause	cause	VERB
iajs-3652	19	17	these	these	DET
iajs-3652	19	18	infections	infection	NOUN
iajs-3652	19	19	.	.	PUNCT
iajs-3652	20	1	(	(	PUNCT
iajs-3652	20	2	6	6	NUM
iajs-3652	20	3	,	,	PUNCT
iajs-3652	20	4	7	7	NUM
iajs-3652	20	5	)	)	PUNCT
iajs-3652	20	6	.	.	PUNCT
iajs-3652	21	1	the	the	DET
iajs-3652	21	2	most	most	ADV
iajs-3652	21	3	frequent	frequent	ADJ
iajs-3652	21	4	cause	cause	NOUN
iajs-3652	21	5	of	of	ADP
iajs-3652	21	6	urinary	urinary	ADJ
iajs-3652	21	7	tract	tract	NOUN
iajs-3652	21	8	infections	infection	NOUN
iajs-3652	21	9	(	(	PUNCT
iajs-3652	21	10	utis	utis	NOUN
iajs-3652	21	11	)	)	PUNCT
iajs-3652	21	12	in	in	ADP
iajs-3652	21	13	both	both	DET
iajs-3652	21	14	community	community	NOUN
iajs-3652	21	15	-	-	PUNCT
iajs-3652	21	16	acquired	acquire	VERB
iajs-3652	21	17	and	and	CCONJ
iajs-3652	21	18	nosocomial	nosocomial	ADJ
iajs-3652	21	19	settings	setting	NOUN
iajs-3652	21	20	,	,	PUNCT
iajs-3652	21	21	as	as	ADV
iajs-3652	21	22	well	well	ADV
iajs-3652	21	23	as	as	ADP
iajs-3652	21	24	associated	associate	VERB
iajs-3652	21	25	diseases	disease	NOUN
iajs-3652	21	26	such	such	ADJ
iajs-3652	21	27	as	as	ADP
iajs-3652	21	28	diarrhea	diarrhea	NOUN
iajs-3652	21	29	and	and	CCONJ
iajs-3652	21	30	bacteremia	bacteremia	NOUN
iajs-3652	21	31	,	,	PUNCT
iajs-3652	21	32	is	be	AUX
iajs-3652	21	33	e.	e.	PROPN
iajs-3652	21	34	coli	coli	PROPN
iajs-3652	21	35	.	.	PUNCT
iajs-3652	22	1	due	due	ADP
iajs-3652	22	2	to	to	ADP
iajs-3652	22	3	its	its	PRON
iajs-3652	22	4	numerous	numerous	ADJ
iajs-3652	22	5	virulence	virulence	NOUN
iajs-3652	22	6	factors	factor	NOUN
iajs-3652	22	7	,	,	PUNCT
iajs-3652	22	8	including	include	VERB
iajs-3652	22	9	https://orcid.org/0009-0001-5412-1137	https://orcid.org/0009-0001-5412-1137	PROPN
iajs-3652	22	10	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	NOUN
iajs-3652	22	11	https://orcid.org/0009-0000-1526-1682	https://orcid.org/0009-0000-1526-1682	PROPN
iajs-3652	22	12	mailto	mailto	NOUN
iajs-3652	22	13	:	:	PUNCT
iajs-3652	22	14	suad.kh@ihcoedu	suad.kh@ihcoedu	NOUN
iajs-3652	22	15	,	,	PUNCT
iajs-3652	22	16	uobaghdad.edu.iq	uobaghdad.edu.iq	ADP
iajs-3652	22	17	https://orcid.org/0009-0001-5412-1137	https://orcid.org/0009-0001-5412-1137	PROPN
iajs-3652	22	18	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	NOUN
iajs-3652	22	19	https://orcid.org/0009-0000-1526-1682	https://orcid.org/0009-0000-1526-1682	PROPN
iajs-3652	22	20	mailto	mailto	NOUN
iajs-3652	22	21	:	:	PUNCT
iajs-3652	22	22	suad.kh@ihcoedu	suad.kh@ihcoedu	NOUN
iajs-3652	22	23	,	,	PUNCT
iajs-3652	22	24	uobaghdad.edu.iq	uobaghdad.edu.iq	ADP
iajs-3652	22	25	https://orcid.org/0009-0001-5412-1137	https://orcid.org/0009-0001-5412-1137	PROPN
iajs-3652	22	26	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	NOUN
iajs-3652	22	27	https://orcid.org/0009-0000-1526-1682	https://orcid.org/0009-0000-1526-1682	PROPN
iajs-3652	22	28	mailto	mailto	NOUN
iajs-3652	22	29	:	:	PUNCT
iajs-3652	22	30	suad.kh@ihcoedu	suad.kh@ihcoedu	NOUN
iajs-3652	22	31	,	,	PUNCT
iajs-3652	22	32	uobaghdad.edu.iq	uobaghdad.edu.iq	ADP
iajs-3652	22	33	https://orcid.org/0009-0001-5412-1137	https://orcid.org/0009-0001-5412-1137	PROPN
iajs-3652	22	34	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	NOUN
iajs-3652	22	35	https://orcid.org/0009-0000-1526-1682	https://orcid.org/0009-0000-1526-1682	PROPN
iajs-3652	22	36	mailto	mailto	NOUN
iajs-3652	22	37	:	:	PUNCT
iajs-3652	22	38	suad.kh@ihcoedu	suad.kh@ihcoedu	NOUN
iajs-3652	22	39	,	,	PUNCT
iajs-3652	22	40	uobaghdad.edu.iq	uobaghdad.edu.iq	ADP
iajs-3652	22	41	https://orcid.org/0009-0001-5412-1137	https://orcid.org/0009-0001-5412-1137	PROPN
iajs-3652	22	42	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	NOUN
iajs-3652	22	43	https://orcid.org/0009-0000-1526-1682	https://orcid.org/0009-0000-1526-1682	PROPN
iajs-3652	22	44	mailto	mailto	NOUN
iajs-3652	22	45	:	:	PUNCT
iajs-3652	22	46	suad.kh@ihcoedu	suad.kh@ihcoedu	NOUN
iajs-3652	22	47	,	,	PUNCT
iajs-3652	22	48	uobaghdad.edu.iq	uobaghdad.edu.iq	ADP
iajs-3652	22	49	https://orcid.org/0009-0001-5412-1137	https://orcid.org/0009-0001-5412-1137	PROPN
iajs-3652	22	50	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	mailto:zahraa.jamal2102m@ihcoedu.uobaghdad.edu.iq	NOUN
iajs-3652	22	51	https://orcid.org/0009-0000-1526-1682	https://orcid.org/0009-0000-1526-1682	PROPN
iajs-3652	22	52	mailto	mailto	NOUN
iajs-3652	22	53	:	:	PUNCT
iajs-3652	22	54	suad.kh@ihcoedu	suad.kh@ihcoedu	NOUN
iajs-3652	22	55	,	,	PUNCT
iajs-3652	22	56	uobaghdad.edu.iq	uobaghdad.edu.iq	NOUN
iajs-3652	22	57	ihjpas	ihjpa	NOUN
iajs-3652	22	58	.	.	PUNCT
iajs-3652	23	1	2025	2025	NUM
iajs-3652	23	2	,	,	PUNCT
iajs-3652	23	3	38(3	38(3	NUM
iajs-3652	23	4	)	)	PUNCT
iajs-3652	23	5	106	106	NUM
iajs-3652	23	6	adhesion	adhesion	NOUN
iajs-3652	23	7	,	,	PUNCT
iajs-3652	23	8	iron	iron	NOUN
iajs-3652	23	9	absorption	absorption	NOUN
iajs-3652	23	10	,	,	PUNCT
iajs-3652	23	11	toxins	toxin	NOUN
iajs-3652	23	12	,	,	PUNCT
iajs-3652	23	13	capsular	capsular	VERB
iajs-3652	23	14	polysaccharides	polysaccharide	NOUN
iajs-3652	23	15	,	,	PUNCT
iajs-3652	23	16	and	and	CCONJ
iajs-3652	23	17	proteins	protein	NOUN
iajs-3652	23	18	,	,	PUNCT
iajs-3652	23	19	e.	e.	PROPN
iajs-3652	23	20	coli	coli	PROPN
iajs-3652	23	21	can	can	AUX
iajs-3652	23	22	cause	cause	VERB
iajs-3652	23	23	various	various	ADJ
iajs-3652	23	24	infections	infection	NOUN
iajs-3652	23	25	.	.	PUNCT
iajs-3652	24	1	other	other	ADJ
iajs-3652	24	2	bacteria	bacteria	NOUN
iajs-3652	24	3	,	,	PUNCT
iajs-3652	24	4	including	include	VERB
iajs-3652	24	5	klebsiella	klebsiella	PROPN
iajs-3652	24	6	,	,	PUNCT
iajs-3652	24	7	proteus	proteus	NOUN
iajs-3652	24	8	,	,	PUNCT
iajs-3652	24	9	pseudomonas	pseudomona	NOUN
iajs-3652	24	10	,	,	PUNCT
iajs-3652	24	11	and	and	CCONJ
iajs-3652	24	12	enterobacter	enterobacter	NOUN
iajs-3652	24	13	,	,	PUNCT
iajs-3652	24	14	can	can	AUX
iajs-3652	24	15	cause	cause	VERB
iajs-3652	24	16	utis	utis	NOUN
iajs-3652	24	17	(	(	PUNCT
iajs-3652	24	18	8)	8)	NUM
iajs-3652	24	19	.	.	PUNCT
iajs-3652	24	20	finding	find	VERB
iajs-3652	24	21	the	the	DET
iajs-3652	24	22	most	most	ADV
iajs-3652	24	23	sensitive	sensitive	ADJ
iajs-3652	24	24	drugs	drug	NOUN
iajs-3652	24	25	is	be	AUX
iajs-3652	24	26	essential	essential	ADJ
iajs-3652	24	27	for	for	ADP
iajs-3652	24	28	proper	proper	ADJ
iajs-3652	24	29	treatment	treatment	NOUN
iajs-3652	24	30	since	since	SCONJ
iajs-3652	24	31	rising	rise	VERB
iajs-3652	24	32	bacterial	bacterial	ADJ
iajs-3652	24	33	resistance	resistance	NOUN
iajs-3652	24	34	to	to	ADP
iajs-3652	24	35	antibiotics	antibiotic	NOUN
iajs-3652	24	36	has	have	AUX
iajs-3652	24	37	become	become	VERB
iajs-3652	24	38	the	the	DET
iajs-3652	24	39	main	main	ADJ
iajs-3652	24	40	worry	worry	NOUN
iajs-3652	24	41	as	as	ADP
iajs-3652	24	42	a	a	DET
iajs-3652	24	43	result	result	NOUN
iajs-3652	24	44	of	of	ADP
iajs-3652	24	45	antibiotic	antibiotic	ADJ
iajs-3652	24	46	abuse	abuse	NOUN
iajs-3652	24	47	.	.	PUNCT
iajs-3652	25	1	sensitivity	sensitivity	NOUN
iajs-3652	25	2	patterns	pattern	NOUN
iajs-3652	25	3	should	should	AUX
iajs-3652	25	4	be	be	AUX
iajs-3652	25	5	developed	develop	VERB
iajs-3652	25	6	in	in	ADP
iajs-3652	25	7	utis	utis	NOUN
iajs-3652	25	8	(	(	PUNCT
iajs-3652	25	9	9	9	NUM
iajs-3652	25	10	)	)	PUNCT
iajs-3652	25	11	.	.	PUNCT
iajs-3652	26	1	one	one	NUM
iajs-3652	26	2	of	of	ADP
iajs-3652	26	3	the	the	DET
iajs-3652	26	4	main	main	ADJ
iajs-3652	26	5	issues	issue	NOUN
iajs-3652	26	6	with	with	ADP
iajs-3652	26	7	treating	treat	VERB
iajs-3652	26	8	utis	utis	NOUN
iajs-3652	26	9	is	be	AUX
iajs-3652	26	10	the	the	DET
iajs-3652	26	11	widespread	widespread	ADJ
iajs-3652	26	12	occurrence	occurrence	NOUN
iajs-3652	26	13	of	of	ADP
iajs-3652	26	14	e.	e.	PROPN
iajs-3652	26	15	coli	coli	PROPN
iajs-3652	26	16	strains	strain	NOUN
iajs-3652	26	17	that	that	PRON
iajs-3652	26	18	are	be	AUX
iajs-3652	26	19	resistant	resistant	ADJ
iajs-3652	26	20	to	to	ADP
iajs-3652	26	21	a	a	DET
iajs-3652	26	22	number	number	NOUN
iajs-3652	26	23	of	of	ADP
iajs-3652	26	24	antibiotics	antibiotic	NOUN
iajs-3652	26	25	(	(	PUNCT
iajs-3652	26	26	coded	code	VERB
iajs-3652	26	27	by	by	ADP
iajs-3652	26	28	chromosomal	chromosomal	ADJ
iajs-3652	26	29	or	or	CCONJ
iajs-3652	26	30	plasmid	plasmid	ADJ
iajs-3652	26	31	genes	gene	NOUN
iajs-3652	26	32	)	)	PUNCT
iajs-3652	26	33	(	(	PUNCT
iajs-3652	26	34	10	10	NUM
iajs-3652	26	35	)	)	PUNCT
iajs-3652	26	36	.	.	PUNCT
iajs-3652	27	1	type	type	NOUN
iajs-3652	27	2	fimbriae	fimbriae	NOUN
iajs-3652	27	3	adhesions	adhesion	NOUN
iajs-3652	27	4	are	be	AUX
iajs-3652	27	5	important	important	ADJ
iajs-3652	27	6	for	for	ADP
iajs-3652	27	7	uropathogenic	uropathogenic	ADJ
iajs-3652	27	8	e.	e.	PROPN
iajs-3652	27	9	coli	coli	PROPN
iajs-3652	27	10	's	's	PART
iajs-3652	27	11	(	(	PUNCT
iajs-3652	27	12	upec	upec	NOUN
iajs-3652	27	13	)	)	PUNCT
iajs-3652	27	14	pathogenicity	pathogenicity	NOUN
iajs-3652	27	15	because	because	SCONJ
iajs-3652	27	16	they	they	PRON
iajs-3652	27	17	allow	allow	VERB
iajs-3652	27	18	the	the	DET
iajs-3652	27	19	bacteria	bacteria	NOUN
iajs-3652	27	20	to	to	PART
iajs-3652	27	21	stick	stick	VERB
iajs-3652	27	22	to	to	ADP
iajs-3652	27	23	the	the	DET
iajs-3652	27	24	uroepithelium	uroepithelium	NOUN
iajs-3652	27	25	.	.	PUNCT
iajs-3652	28	1	researchers	researcher	NOUN
iajs-3652	28	2	have	have	AUX
iajs-3652	28	3	tried	try	VERB
iajs-3652	28	4	to	to	PART
iajs-3652	28	5	find	find	VERB
iajs-3652	28	6	the	the	DET
iajs-3652	28	7	genes	gene	NOUN
iajs-3652	28	8	that	that	PRON
iajs-3652	28	9	make	make	VERB
iajs-3652	28	10	virulence	virulence	NOUN
iajs-3652	28	11	factors	factor	NOUN
iajs-3652	28	12	like	like	ADP
iajs-3652	28	13	alginate	alginate	NOUN
iajs-3652	28	14	(	(	PUNCT
iajs-3652	28	15	algd	algd	PROPN
iajs-3652	28	16	)	)	PUNCT
iajs-3652	28	17	,	,	PUNCT
iajs-3652	28	18	which	which	PRON
iajs-3652	28	19	help	help	VERB
iajs-3652	28	20	bacteria	bacteria	NOUN
iajs-3652	28	21	attach	attach	VERB
iajs-3652	28	22	to	to	PART
iajs-3652	28	23	and	and	CCONJ
iajs-3652	28	24	colonize	colonize	VERB
iajs-3652	28	25	host	host	NOUN
iajs-3652	28	26	cells	cell	NOUN
iajs-3652	28	27	(	(	PUNCT
iajs-3652	28	28	8	8	NUM
iajs-3652	28	29	,	,	PUNCT
iajs-3652	28	30	9	9	NUM
iajs-3652	28	31	,	,	PUNCT
iajs-3652	28	32	11	11	NUM
iajs-3652	28	33	)	)	PUNCT
iajs-3652	28	34	.	.	PUNCT
iajs-3652	29	1	escherichia	escherichia	NOUN
iajs-3652	29	2	coli	coli	NOUN
iajs-3652	29	3	inserts	insert	VERB
iajs-3652	29	4	itself	itself	PRON
iajs-3652	29	5	in	in	ADP
iajs-3652	29	6	a	a	DET
iajs-3652	29	7	matrix	matrix	NOUN
iajs-3652	29	8	of	of	ADP
iajs-3652	29	9	extracellular	extracellular	ADJ
iajs-3652	29	10	polymeric	polymeric	ADJ
iajs-3652	29	11	substances	substance	NOUN
iajs-3652	29	12	(	(	PUNCT
iajs-3652	29	13	eps	eps	NOUN
iajs-3652	29	14	)	)	PUNCT
iajs-3652	29	15	,	,	PUNCT
iajs-3652	29	16	which	which	PRON
iajs-3652	29	17	not	not	PART
iajs-3652	29	18	only	only	ADV
iajs-3652	29	19	protects	protect	VERB
iajs-3652	29	20	the	the	DET
iajs-3652	29	21	bacterium	bacterium	NOUN
iajs-3652	29	22	from	from	ADP
iajs-3652	29	23	harmful	harmful	ADJ
iajs-3652	29	24	ecological	ecological	ADJ
iajs-3652	29	25	factors	factor	NOUN
iajs-3652	29	26	but	but	CCONJ
iajs-3652	29	27	also	also	ADV
iajs-3652	29	28	triggers	trigger	VERB
iajs-3652	29	29	infection	infection	NOUN
iajs-3652	29	30	.	.	PUNCT
iajs-3652	30	1	moreover	moreover	ADV
iajs-3652	30	2	,	,	PUNCT
iajs-3652	30	3	it	it	PRON
iajs-3652	30	4	is	be	AUX
iajs-3652	30	5	the	the	DET
iajs-3652	30	6	primary	primary	ADJ
iajs-3652	30	7	cause	cause	NOUN
iajs-3652	30	8	of	of	ADP
iajs-3652	30	9	recurrent	recurrent	ADJ
iajs-3652	30	10	urinary	urinary	ADJ
iajs-3652	30	11	tract	tract	NOUN
iajs-3652	30	12	infections	infection	NOUN
iajs-3652	30	13	(	(	PUNCT
iajs-3652	30	14	12	12	NUM
iajs-3652	30	15	)	)	PUNCT
iajs-3652	30	16	.	.	PUNCT
iajs-3652	31	1	quorum	quorum	NOUN
iajs-3652	31	2	sensing	sense	VERB
iajs-3652	31	3	is	be	AUX
iajs-3652	31	4	a	a	DET
iajs-3652	31	5	mechanism	mechanism	NOUN
iajs-3652	31	6	by	by	ADP
iajs-3652	31	7	which	which	PRON
iajs-3652	31	8	cells	cell	NOUN
iajs-3652	31	9	communicate	communicate	VERB
iajs-3652	31	10	with	with	ADP
iajs-3652	31	11	each	each	DET
iajs-3652	31	12	other	other	ADJ
iajs-3652	31	13	,	,	PUNCT
iajs-3652	31	14	leading	lead	VERB
iajs-3652	31	15	to	to	ADP
iajs-3652	31	16	the	the	DET
iajs-3652	31	17	accumulation	accumulation	NOUN
iajs-3652	31	18	of	of	ADP
iajs-3652	31	19	signaling	signal	VERB
iajs-3652	31	20	molecules	molecule	NOUN
iajs-3652	31	21	outside	outside	ADP
iajs-3652	31	22	the	the	DET
iajs-3652	31	23	cells	cell	NOUN
iajs-3652	31	24	and	and	CCONJ
iajs-3652	31	25	regulating	regulate	VERB
iajs-3652	31	26	the	the	DET
iajs-3652	31	27	expression	expression	NOUN
iajs-3652	31	28	of	of	ADP
iajs-3652	31	29	specific	specific	ADJ
iajs-3652	31	30	genes	gene	NOUN
iajs-3652	31	31	.	.	PUNCT
iajs-3652	32	1	it	it	PRON
iajs-3652	32	2	is	be	AUX
iajs-3652	32	3	involved	involve	VERB
iajs-3652	32	4	in	in	ADP
iajs-3652	32	5	the	the	DET
iajs-3652	32	6	formation	formation	NOUN
iajs-3652	32	7	of	of	ADP
iajs-3652	32	8	biofilms	biofilm	NOUN
iajs-3652	32	9	(	(	PUNCT
iajs-3652	32	10	13	13	NUM
iajs-3652	32	11	)	)	PUNCT
iajs-3652	32	12	.	.	PUNCT
iajs-3652	33	1	another	another	DET
iajs-3652	33	2	thing	thing	NOUN
iajs-3652	33	3	is	be	AUX
iajs-3652	33	4	that	that	SCONJ
iajs-3652	33	5	e.	e.	PROPN
iajs-3652	33	6	coli	coli	PROPN
iajs-3652	33	7	are	be	AUX
iajs-3652	33	8	a	a	DET
iajs-3652	33	9	genetically	genetically	ADV
iajs-3652	33	10	diverse	diverse	ADJ
iajs-3652	33	11	group	group	NOUN
iajs-3652	33	12	of	of	ADP
iajs-3652	33	13	bacteria	bacteria	NOUN
iajs-3652	33	14	.	.	PUNCT
iajs-3652	34	1	some	some	DET
iajs-3652	34	2	subgroups	subgroup	NOUN
iajs-3652	34	3	of	of	ADP
iajs-3652	34	4	these	these	DET
iajs-3652	34	5	bacterial	bacterial	ADJ
iajs-3652	34	6	species	specie	NOUN
iajs-3652	34	7	have	have	AUX
iajs-3652	34	8	acquired	acquire	VERB
iajs-3652	34	9	genes	gene	NOUN
iajs-3652	34	10	that	that	PRON
iajs-3652	34	11	allow	allow	VERB
iajs-3652	34	12	them	they	PRON
iajs-3652	34	13	to	to	PART
iajs-3652	34	14	cause	cause	VERB
iajs-3652	34	15	disease	disease	NOUN
iajs-3652	34	16	outside	outside	ADP
iajs-3652	34	17	of	of	ADP
iajs-3652	34	18	or	or	CCONJ
iajs-3652	34	19	inside	inside	ADP
iajs-3652	34	20	the	the	DET
iajs-3652	34	21	intestines	intestine	NOUN
iajs-3652	34	22	,	,	PUNCT
iajs-3652	34	23	such	such	ADJ
iajs-3652	34	24	as	as	ADP
iajs-3652	34	25	the	the	DET
iajs-3652	34	26	dna	dna	PROPN
iajs-3652	34	27	fragment	fragment	NOUN
iajs-3652	34	28	tspe4.c2	tspe4.c2	NOUN
iajs-3652	34	29	gene	gene	NOUN
iajs-3652	34	30	.	.	PUNCT
iajs-3652	35	1	however	however	ADV
iajs-3652	35	2	,	,	PUNCT
iajs-3652	35	3	we	we	PRON
iajs-3652	35	4	mainly	mainly	ADV
iajs-3652	35	5	divided	divide	VERB
iajs-3652	35	6	e.	e.	PROPN
iajs-3652	35	7	coli	coli	PROPN
iajs-3652	35	8	strains	strain	VERB
iajs-3652	35	9	into	into	ADP
iajs-3652	35	10	groups	group	NOUN
iajs-3652	35	11	(	(	PUNCT
iajs-3652	35	12	a0	a0	NOUN
iajs-3652	35	13	,	,	PUNCT
iajs-3652	35	14	a1	a1	NOUN
iajs-3652	35	15	,	,	PUNCT
iajs-3652	35	16	b1	b1	NOUN
iajs-3652	35	17	,	,	PUNCT
iajs-3652	35	18	and	and	CCONJ
iajs-3652	35	19	b2	b2	NOUN
iajs-3652	35	20	)	)	PUNCT
iajs-3652	35	21	based	base	VERB
iajs-3652	35	22	on	on	ADP
iajs-3652	35	23	the	the	DET
iajs-3652	35	24	presence	presence	NOUN
iajs-3652	35	25	of	of	ADP
iajs-3652	35	26	genetic	genetic	ADJ
iajs-3652	35	27	markers	marker	NOUN
iajs-3652	35	28	like	like	ADP
iajs-3652	35	29	this	this	DET
iajs-3652	35	30	gene	gene	NOUN
iajs-3652	35	31	and	and	CCONJ
iajs-3652	35	32	other	other	ADJ
iajs-3652	35	33	genes	gene	NOUN
iajs-3652	35	34	,	,	PUNCT
iajs-3652	35	35	chua	chua	PROPN
iajs-3652	35	36	and	and	CCONJ
iajs-3652	35	37	yjaa	yjaa	NOUN
iajs-3652	35	38	(	(	PUNCT
iajs-3652	35	39	14	14	NUM
iajs-3652	35	40	)	)	PUNCT
iajs-3652	35	41	.	.	PUNCT
iajs-3652	36	1	the	the	DET
iajs-3652	36	2	study	study	NOUN
iajs-3652	36	3	's	's	PART
iajs-3652	36	4	goal	goal	NOUN
iajs-3652	36	5	is	be	AUX
iajs-3652	36	6	to	to	PART
iajs-3652	36	7	find	find	VERB
iajs-3652	36	8	two	two	NUM
iajs-3652	36	9	genes	gene	NOUN
iajs-3652	36	10	(	(	PUNCT
iajs-3652	36	11	algd	algd	NOUN
iajs-3652	36	12	and	and	CCONJ
iajs-3652	36	13	tspe4.c2	tspe4.c2	NOUN
iajs-3652	36	14	)	)	PUNCT
iajs-3652	36	15	that	that	PRON
iajs-3652	36	16	control	control	VERB
iajs-3652	36	17	how	how	SCONJ
iajs-3652	36	18	dangerous	dangerous	ADJ
iajs-3652	36	19	escherichia	escherichia	NOUN
iajs-3652	36	20	coli	coli	NOUN
iajs-3652	36	21	is	be	AUX
iajs-3652	36	22	when	when	SCONJ
iajs-3652	36	23	it	it	PRON
iajs-3652	36	24	is	be	AUX
iajs-3652	36	25	taken	take	VERB
iajs-3652	36	26	from	from	ADP
iajs-3652	36	27	people	people	NOUN
iajs-3652	36	28	in	in	ADP
iajs-3652	36	29	baghdad	baghdad	PROPN
iajs-3652	36	30	who	who	PRON
iajs-3652	36	31	have	have	VERB
iajs-3652	36	32	urinary	urinary	ADJ
iajs-3652	36	33	tract	tract	NOUN
iajs-3652	36	34	infections	infection	NOUN
iajs-3652	36	35	.	.	PUNCT
iajs-3652	37	1	2	2	X
iajs-3652	37	2	.	.	X
iajs-3652	37	3	materials	material	NOUN
iajs-3652	37	4	and	and	CCONJ
iajs-3652	37	5	methods	method	NOUN
iajs-3652	37	6	2.1	2.1	NUM
iajs-3652	37	7	.	.	PUNCT
iajs-3652	38	1	sample	sample	NOUN
iajs-3652	38	2	collection	collection	NOUN
iajs-3652	38	3	we	we	PRON
iajs-3652	38	4	collected	collect	VERB
iajs-3652	38	5	urine	urine	NOUN
iajs-3652	38	6	samples	sample	NOUN
iajs-3652	38	7	from	from	ADP
iajs-3652	38	8	patients	patient	NOUN
iajs-3652	38	9	with	with	ADP
iajs-3652	38	10	utis	utis	ADJ
iajs-3652	38	11	midstream	midstream	NOUN
iajs-3652	38	12	in	in	ADP
iajs-3652	38	13	the	the	DET
iajs-3652	38	14	morning	morning	NOUN
iajs-3652	38	15	using	use	VERB
iajs-3652	38	16	a	a	DET
iajs-3652	38	17	sterile	sterile	ADJ
iajs-3652	38	18	container	container	NOUN
iajs-3652	38	19	with	with	ADP
iajs-3652	38	20	a	a	DET
iajs-3652	38	21	screw	screw	NOUN
iajs-3652	38	22	cap	cap	NOUN
iajs-3652	38	23	.	.	PUNCT
iajs-3652	39	1	from	from	ADP
iajs-3652	39	2	27	27	NUM
iajs-3652	39	3	november	november	PROPN
iajs-3652	39	4	2022	2022	NUM
iajs-3652	39	5	to	to	ADP
iajs-3652	39	6	11	11	NUM
iajs-3652	39	7	january	january	PROPN
iajs-3652	39	8	2023	2023	NUM
iajs-3652	39	9	,	,	PUNCT
iajs-3652	39	10	we	we	PRON
iajs-3652	39	11	collected	collect	VERB
iajs-3652	39	12	157	157	NUM
iajs-3652	39	13	samples	sample	NOUN
iajs-3652	39	14	from	from	ADP
iajs-3652	39	15	the	the	DET
iajs-3652	39	16	medical	medical	ADJ
iajs-3652	39	17	city	city	NOUN
iajs-3652	39	18	/	/	SYM
iajs-3652	39	19	educational	educational	ADJ
iajs-3652	39	20	laboratories	laboratory	NOUN
iajs-3652	39	21	,	,	PUNCT
iajs-3652	39	22	baghdad	baghdad	PROPN
iajs-3652	39	23	teaching	teaching	NOUN
iajs-3652	39	24	hospital	hospital	NOUN
iajs-3652	39	25	,	,	PUNCT
iajs-3652	39	26	imamin	imamin	PROPN
iajs-3652	39	27	al	al	PROPN
iajs-3652	39	28	-	-	PUNCT
iajs-3652	39	29	kadhimiya	kadhimiya	NOUN
iajs-3652	39	30	hospital	hospital	NOUN
iajs-3652	39	31	,	,	PUNCT
iajs-3652	39	32	and	and	CCONJ
iajs-3652	39	33	the	the	DET
iajs-3652	39	34	central	central	ADJ
iajs-3652	39	35	children	child	NOUN
iajs-3652	39	36	's	's	PART
iajs-3652	39	37	hospital	hospital	NOUN
iajs-3652	39	38	in	in	ADP
iajs-3652	39	39	baghdad	baghdad	PROPN
iajs-3652	39	40	.	.	PUNCT
iajs-3652	40	1	we	we	PRON
iajs-3652	40	2	then	then	ADV
iajs-3652	40	3	inoculated	inoculate	VERB
iajs-3652	40	4	the	the	DET
iajs-3652	40	5	culture	culture	NOUN
iajs-3652	40	6	medium	medium	NOUN
iajs-3652	40	7	(	(	PUNCT
iajs-3652	40	8	macconkey	macconkey	NOUN
iajs-3652	40	9	,	,	PUNCT
iajs-3652	40	10	blood	blood	NOUN
iajs-3652	40	11	,	,	PUNCT
iajs-3652	40	12	and	and	CCONJ
iajs-3652	40	13	emb	emb	VERB
iajs-3652	40	14	agar	agar	NOUN
iajs-3652	40	15	)	)	PUNCT
iajs-3652	40	16	with	with	ADP
iajs-3652	40	17	a	a	DET
iajs-3652	40	18	calibration	calibration	NOUN
iajs-3652	40	19	loop	loop	NOUN
iajs-3652	40	20	of	of	ADP
iajs-3652	40	21	urine	urine	NOUN
iajs-3652	40	22	samples	sample	NOUN
iajs-3652	40	23	and	and	CCONJ
iajs-3652	40	24	cultured	culture	VERB
iajs-3652	40	25	it	it	PRON
iajs-3652	40	26	aerobically	aerobically	ADV
iajs-3652	40	27	at	at	ADP
iajs-3652	40	28	37	37	NUM
iajs-3652	40	29	°	°	ADP
iajs-3652	40	30	c	c	NOUN
iajs-3652	40	31	for	for	ADP
iajs-3652	40	32	18	18	NUM
iajs-3652	40	33	hours	hour	NOUN
iajs-3652	40	34	.	.	PUNCT
iajs-3652	41	1	we	we	PRON
iajs-3652	41	2	also	also	ADV
iajs-3652	41	3	used	use	VERB
iajs-3652	41	4	the	the	DET
iajs-3652	41	5	vitek	vitek	PROPN
iajs-3652	41	6	ii	ii	PROPN
iajs-3652	41	7	compact	compact	ADJ
iajs-3652	41	8	system	system	NOUN
iajs-3652	41	9	to	to	PART
iajs-3652	41	10	identify	identify	VERB
iajs-3652	41	11	escherichia	escherichia	NOUN
iajs-3652	41	12	coli	coli	NOUN
iajs-3652	41	13	.	.	PUNCT
iajs-3652	42	1	after	after	ADP
iajs-3652	42	2	clinically	clinically	ADV
iajs-3652	42	3	isolating	isolate	VERB
iajs-3652	42	4	the	the	DET
iajs-3652	42	5	bacteria	bacteria	NOUN
iajs-3652	42	6	from	from	ADP
iajs-3652	42	7	patients	patient	NOUN
iajs-3652	42	8	in	in	ADP
iajs-3652	42	9	iraq	iraq	PROPN
iajs-3652	42	10	,	,	PUNCT
iajs-3652	42	11	we	we	PRON
iajs-3652	42	12	isolated	isolate	VERB
iajs-3652	42	13	75	75	NUM
iajs-3652	42	14	isolates	isolate	NOUN
iajs-3652	42	15	of	of	ADP
iajs-3652	42	16	escherichia	escherichia	NOUN
iajs-3652	42	17	coli	coli	NOUN
iajs-3652	42	18	,	,	PUNCT
iajs-3652	42	19	and	and	CCONJ
iajs-3652	42	20	selected	select	VERB
iajs-3652	42	21	11	11	NUM
iajs-3652	42	22	isolates	isolate	NOUN
iajs-3652	42	23	for	for	ADP
iajs-3652	42	24	molecular	molecular	ADJ
iajs-3652	42	25	tests	test	NOUN
iajs-3652	42	26	to	to	PART
iajs-3652	42	27	identify	identify	VERB
iajs-3652	42	28	the	the	DET
iajs-3652	42	29	virulence	virulence	NOUN
iajs-3652	42	30	factor	factor	NOUN
iajs-3652	42	31	genes	gene	NOUN
iajs-3652	42	32	.	.	PUNCT
iajs-3652	43	1	2.2	2.2	NUM
iajs-3652	43	2	.	.	PUNCT
iajs-3652	44	1	the	the	DET
iajs-3652	44	2	congo	congo	NOUN
iajs-3652	44	3	red	red	ADJ
iajs-3652	44	4	agar	agar	NOUN
iajs-3652	44	5	(	(	PUNCT
iajs-3652	44	6	cra	cra	PROPN
iajs-3652	44	7	)	)	PUNCT
iajs-3652	44	8	method	method	NOUN
iajs-3652	44	9	to	to	PART
iajs-3652	44	10	find	find	VERB
iajs-3652	44	11	the	the	DET
iajs-3652	44	12	production	production	NOUN
iajs-3652	44	13	of	of	ADP
iajs-3652	44	14	biofilm	biofilm	NOUN
iajs-3652	44	15	this	this	DET
iajs-3652	44	16	approach	approach	NOUN
iajs-3652	44	17	describes	describe	VERB
iajs-3652	44	18	a	a	DET
iajs-3652	44	19	simple	simple	ADJ
iajs-3652	44	20	way	way	NOUN
iajs-3652	44	21	to	to	PART
iajs-3652	44	22	identify	identify	VERB
iajs-3652	44	23	biofilm	biofilm	NOUN
iajs-3652	44	24	formation	formation	NOUN
iajs-3652	44	25	using	use	VERB
iajs-3652	44	26	the	the	DET
iajs-3652	44	27	congo	congo	NOUN
iajs-3652	44	28	red	red	ADJ
iajs-3652	44	29	agar	agar	NOUN
iajs-3652	44	30	(	(	PUNCT
iajs-3652	44	31	cra	cra	PROPN
iajs-3652	44	32	)	)	PUNCT
iajs-3652	44	33	medium	medium	NOUN
iajs-3652	44	34	.	.	PUNCT
iajs-3652	45	1	black	black	ADJ
iajs-3652	45	2	colonies	colony	NOUN
iajs-3652	45	3	with	with	ADP
iajs-3652	45	4	a	a	DET
iajs-3652	45	5	dry	dry	ADJ
iajs-3652	45	6	crystalline	crystalline	NOUN
iajs-3652	45	7	structure	structure	NOUN
iajs-3652	45	8	were	be	AUX
iajs-3652	45	9	suggestive	suggestive	ADJ
iajs-3652	45	10	of	of	ADP
iajs-3652	45	11	the	the	DET
iajs-3652	45	12	formation	formation	NOUN
iajs-3652	45	13	of	of	ADP
iajs-3652	45	14	biofilms	biofilm	NOUN
iajs-3652	45	15	,	,	PUNCT
iajs-3652	45	16	while	while	SCONJ
iajs-3652	45	17	pink	pink	ADJ
iajs-3652	45	18	colonies	colony	NOUN
iajs-3652	45	19	show	show	VERB
iajs-3652	45	20	that	that	SCONJ
iajs-3652	45	21	no	no	DET
iajs-3652	45	22	bacterial	bacterial	ADJ
iajs-3652	45	23	biofilms	biofilm	NOUN
iajs-3652	45	24	had	have	AUX
iajs-3652	45	25	formed	form	VERB
iajs-3652	45	26	(	(	PUNCT
iajs-3652	45	27	15	15	NUM
iajs-3652	45	28	)	)	PUNCT
iajs-3652	45	29	.	.	PUNCT
iajs-3652	46	1	2.3	2.3	NUM
iajs-3652	46	2	.	.	PUNCT
iajs-3652	46	3	vitek	vitek	NOUN
iajs-3652	46	4	2	2	NUM
iajs-3652	46	5	compact	compact	NOUN
iajs-3652	46	6	to	to	PART
iajs-3652	46	7	test	test	VERB
iajs-3652	46	8	antibiotic	antibiotic	ADJ
iajs-3652	46	9	susceptibility	susceptibility	NOUN
iajs-3652	46	10	a	a	DET
iajs-3652	46	11	sufficient	sufficient	ADJ
iajs-3652	46	12	number	number	NOUN
iajs-3652	46	13	of	of	ADP
iajs-3652	46	14	pure	pure	ADJ
iajs-3652	46	15	colonies	colony	NOUN
iajs-3652	46	16	suspended	suspend	VERB
iajs-3652	46	17	in	in	ADP
iajs-3652	46	18	3	3	NUM
iajs-3652	46	19	ml	ml	NOUN
iajs-3652	46	20	of	of	ADP
iajs-3652	46	21	physiological	physiological	ADJ
iajs-3652	46	22	saline	saline	NOUN
iajs-3652	46	23	solution	solution	NOUN
iajs-3652	46	24	are	be	AUX
iajs-3652	46	25	placed	place	VERB
iajs-3652	46	26	in	in	ADP
iajs-3652	46	27	two	two	NUM
iajs-3652	46	28	transparent	transparent	ADJ
iajs-3652	46	29	plastic	plastic	NOUN
iajs-3652	46	30	test	test	NOUN
iajs-3652	46	31	tubes	tube	NOUN
iajs-3652	46	32	,	,	PUNCT
iajs-3652	46	33	and	and	CCONJ
iajs-3652	46	34	the	the	DET
iajs-3652	46	35	device	device	NOUN
iajs-3652	46	36	's	's	PART
iajs-3652	46	37	model	model	NOUN
iajs-3652	46	38	number	number	NOUN
iajs-3652	46	39	is	be	AUX
iajs-3652	46	40	input	input	NOUN
iajs-3652	46	41	into	into	ADP
iajs-3652	46	42	the	the	DET
iajs-3652	46	43	vitek	vitek	PROPN
iajs-3652	46	44	2	2	NUM
iajs-3652	46	45	compact	compact	ADJ
iajs-3652	46	46	system	system	NOUN
iajs-3652	46	47	's	's	PART
iajs-3652	46	48	database	database	NOUN
iajs-3652	46	49	.	.	PUNCT
iajs-3652	47	1	the	the	DET
iajs-3652	47	2	isolated	isolate	VERB
iajs-3652	47	3	bacteria	bacteria	NOUN
iajs-3652	47	4	suspension	suspension	NOUN
iajs-3652	47	5	is	be	AUX
iajs-3652	47	6	measured	measure	VERB
iajs-3652	47	7	using	use	VERB
iajs-3652	47	8	the	the	DET
iajs-3652	47	9	vetik2	vetik2	NOUN
iajs-3652	47	10	(	(	PUNCT
iajs-3652	47	11	densichek	densichek	PROPN
iajs-3652	47	12	)	)	PUNCT
iajs-3652	47	13	turbidity	turbidity	NOUN
iajs-3652	47	14	device	device	NOUN
iajs-3652	47	15	;	;	PUNCT
iajs-3652	47	16	the	the	DET
iajs-3652	47	17	turbidity	turbidity	NOUN
iajs-3652	47	18	must	must	AUX
iajs-3652	47	19	equal	equal	VERB
iajs-3652	47	20	(	(	PUNCT
iajs-3652	47	21	0.50	0.50	NUM
iajs-3652	47	22	-	-	SYM
iajs-3652	47	23	0.63	0.63	NUM
iajs-3652	47	24	)	)	PUNCT
iajs-3652	47	25	,	,	PUNCT
iajs-3652	47	26	or	or	CCONJ
iajs-3652	47	27	around	around	ADP
iajs-3652	47	28	1.5	1.5	NUM
iajs-3652	47	29	x	x	SYM
iajs-3652	47	30	10	10	NUM
iajs-3652	47	31	8	8	NUM
iajs-3652	47	32	cfu	cfu	NOUN
iajs-3652	47	33	/	/	SYM
iajs-3652	47	34	m.	m.	NOUN
iajs-3652	47	35	transfer	transfer	NOUN
iajs-3652	47	36	145	145	NUM
iajs-3652	47	37	µl	µl	ADV
iajs-3652	47	38	from	from	ADP
iajs-3652	47	39	the	the	DET
iajs-3652	47	40	first	first	ADJ
iajs-3652	47	41	tube	tube	NOUN
iajs-3652	47	42	to	to	ADP
iajs-3652	47	43	the	the	DET
iajs-3652	47	44	second	second	NOUN
iajs-3652	47	45	for	for	ADP
iajs-3652	47	46	the	the	DET
iajs-3652	47	47	antibiotic	antibiotic	ADJ
iajs-3652	47	48	susceptibility	susceptibility	NOUN
iajs-3652	47	49	test	test	NOUN
iajs-3652	47	50	.	.	PUNCT
iajs-3652	48	1	a	a	DET
iajs-3652	48	2	two	two	NUM
iajs-3652	48	3	-	-	PUNCT
iajs-3652	48	4	test	test	NOUN
iajs-3652	48	5	tube	tube	NOUN
iajs-3652	48	6	cassette	cassette	NOUN
iajs-3652	48	7	containing	contain	VERB
iajs-3652	48	8	a	a	DET
iajs-3652	48	9	bacterial	bacterial	ADJ
iajs-3652	48	10	suspension	suspension	NOUN
iajs-3652	48	11	was	be	AUX
iajs-3652	48	12	placed	place	VERB
iajs-3652	48	13	in	in	ADP
iajs-3652	48	14	it	it	PRON
iajs-3652	48	15	in	in	ADP
iajs-3652	48	16	accordance	accordance	NOUN
iajs-3652	48	17	with	with	ADP
iajs-3652	48	18	company	company	NOUN
iajs-3652	48	19	instructions	instruction	NOUN
iajs-3652	48	20	(	(	PUNCT
iajs-3652	48	21	biomerieux	biomerieux	NOUN
iajs-3652	48	22	)	)	PUNCT
iajs-3652	48	23	.	.	PUNCT
iajs-3652	49	1	the	the	DET
iajs-3652	49	2	transport	transport	NOUN
iajs-3652	49	3	tube	tube	NOUN
iajs-3652	49	4	was	be	AUX
iajs-3652	49	5	severed	sever	VERB
iajs-3652	49	6	by	by	ADP
iajs-3652	49	7	the	the	DET
iajs-3652	49	8	device	device	NOUN
iajs-3652	49	9	,	,	PUNCT
iajs-3652	49	10	and	and	CCONJ
iajs-3652	49	11	it	it	PRON
iajs-3652	49	12	ihjpas	ihjpa	VERB
iajs-3652	49	13	.	.	PUNCT
iajs-3652	50	1	2025	2025	NUM
iajs-3652	50	2	,	,	PUNCT
iajs-3652	50	3	38(3	38(3	NUM
iajs-3652	50	4	)	)	PUNCT
iajs-3652	50	5	107	107	NUM
iajs-3652	50	6	was	be	AUX
iajs-3652	50	7	placed	place	VERB
iajs-3652	50	8	on	on	ADP
iajs-3652	50	9	the	the	DET
iajs-3652	50	10	incubator	incubator	NOUN
iajs-3652	50	11	card	card	NOUN
iajs-3652	50	12	and	and	CCONJ
iajs-3652	50	13	incubated	incubate	VERB
iajs-3652	50	14	at	at	ADP
iajs-3652	50	15	37	37	NUM
iajs-3652	50	16	°	°	NOUN
iajs-3652	50	17	c	c	NOUN
iajs-3652	50	18	.	.	PUNCT
iajs-3652	51	1	for	for	ADP
iajs-3652	51	2	each	each	DET
iajs-3652	51	3	card	card	NOUN
iajs-3652	51	4	that	that	PRON
iajs-3652	51	5	was	be	AUX
iajs-3652	51	6	in	in	ADP
iajs-3652	51	7	the	the	DET
iajs-3652	51	8	reader	reader	NOUN
iajs-3652	51	9	,	,	PUNCT
iajs-3652	51	10	the	the	DET
iajs-3652	51	11	outcome	outcome	NOUN
iajs-3652	51	12	was	be	AUX
iajs-3652	51	13	read	read	VERB
iajs-3652	51	14	,	,	PUNCT
iajs-3652	51	15	and	and	CCONJ
iajs-3652	51	16	a	a	DET
iajs-3652	51	17	diagnostic	diagnostic	ADJ
iajs-3652	51	18	report	report	NOUN
iajs-3652	51	19	with	with	ADP
iajs-3652	51	20	an	an	DET
iajs-3652	51	21	antibiotic	antibiotic	ADJ
iajs-3652	51	22	susceptibility	susceptibility	NOUN
iajs-3652	51	23	test	test	NOUN
iajs-3652	51	24	was	be	AUX
iajs-3652	51	25	printed	print	VERB
iajs-3652	51	26	(	(	PUNCT
iajs-3652	51	27	16	16	NUM
iajs-3652	51	28	)	)	PUNCT
iajs-3652	51	29	.	.	PUNCT
iajs-3652	52	1	2.4	2.4	NUM
iajs-3652	52	2	.	.	PUNCT
iajs-3652	52	3	extraction	extraction	NOUN
iajs-3652	52	4	of	of	ADP
iajs-3652	52	5	genomic	genomic	ADJ
iajs-3652	52	6	dna	dna	NOUN
iajs-3652	52	7	using	use	VERB
iajs-3652	52	8	fungal	fungal	ADJ
iajs-3652	52	9	/	/	SYM
iajs-3652	52	10	bacterial	bacterial	ADJ
iajs-3652	52	11	/	/	SYM
iajs-3652	52	12	yeast	yeast	NOUN
iajs-3652	52	13	dna	dna	NOUN
iajs-3652	52	14	miniprep	miniprep	NOUN
iajs-3652	52	15	tm	tm	NOUN
iajs-3652	52	16	,	,	PUNCT
iajs-3652	52	17	catalog	catalog	NOUN
iajs-3652	52	18	no	no	NOUN
iajs-3652	52	19	.	.	PUNCT
iajs-3652	53	1	d6005	d6005	PROPN
iajs-3652	53	2	,	,	PUNCT
iajs-3652	53	3	the	the	DET
iajs-3652	53	4	dna	dna	NOUN
iajs-3652	53	5	was	be	AUX
iajs-3652	53	6	isolated	isolate	VERB
iajs-3652	53	7	from	from	ADP
iajs-3652	53	8	the	the	DET
iajs-3652	53	9	samples	sample	NOUN
iajs-3652	53	10	of	of	ADP
iajs-3652	53	11	uti	uti	PROPN
iajs-3652	53	12	patients	patient	NOUN
iajs-3652	53	13	.	.	PUNCT
iajs-3652	54	1	2.5	2.5	NUM
iajs-3652	54	2	.	.	PUNCT
iajs-3652	55	1	agarose	agarose	NOUN
iajs-3652	55	2	gel	gel	NOUN
iajs-3652	55	3	electrophoresis	electrophoresis	NOUN
iajs-3652	55	4	of	of	ADP
iajs-3652	55	5	dna	dna	NOUN
iajs-3652	55	6	in	in	ADP
iajs-3652	55	7	order	order	NOUN
iajs-3652	55	8	to	to	PART
iajs-3652	55	9	identify	identify	VERB
iajs-3652	55	10	the	the	DET
iajs-3652	55	11	size	size	NOUN
iajs-3652	55	12	of	of	ADP
iajs-3652	55	13	bands	band	NOUN
iajs-3652	55	14	on	on	ADP
iajs-3652	55	15	the	the	DET
iajs-3652	55	16	consequence	consequence	NOUN
iajs-3652	55	17	of	of	ADP
iajs-3652	55	18	the	the	DET
iajs-3652	55	19	pcr	pcr	ADJ
iajs-3652	55	20	interface	interface	NOUN
iajs-3652	55	21	on	on	ADP
iajs-3652	55	22	the	the	DET
iajs-3652	55	23	agarose	agarose	NOUN
iajs-3652	55	24	gel	gel	NOUN
iajs-3652	55	25	(	(	PUNCT
iajs-3652	55	26	0.8	0.8	NUM
iajs-3652	55	27	%	%	NOUN
iajs-3652	55	28	)	)	PUNCT
iajs-3652	55	29	,	,	PUNCT
iajs-3652	55	30	electrophoresis	electrophoresis	NOUN
iajs-3652	55	31	was	be	AUX
iajs-3652	55	32	used	use	VERB
iajs-3652	55	33	to	to	PART
iajs-3652	55	34	define	define	VERB
iajs-3652	55	35	dna	dna	PROPN
iajs-3652	55	36	fragments	fragment	NOUN
iajs-3652	55	37	later	later	ADV
iajs-3652	55	38	in	in	ADP
iajs-3652	55	39	the	the	DET
iajs-3652	55	40	extraction	extraction	NOUN
iajs-3652	55	41	procedure	procedure	NOUN
iajs-3652	55	42	or	or	CCONJ
iajs-3652	55	43	to	to	PART
iajs-3652	55	44	distinguish	distinguish	VERB
iajs-3652	55	45	the	the	DET
iajs-3652	55	46	consequence	consequence	NOUN
iajs-3652	55	47	of	of	ADP
iajs-3652	55	48	the	the	DET
iajs-3652	55	49	interaction	interaction	NOUN
iajs-3652	55	50	of	of	ADP
iajs-3652	55	51	pcr	pcr	PROPN
iajs-3652	55	52	when	when	SCONJ
iajs-3652	55	53	standard	standard	ADJ
iajs-3652	55	54	dna	dna	PROPN
iajs-3652	55	55	is	be	AUX
iajs-3652	55	56	present	present	ADJ
iajs-3652	55	57	.	.	PUNCT
iajs-3652	56	1	2.6	2.6	NUM
iajs-3652	56	2	.	.	PUNCT
iajs-3652	56	3	measurement	measurement	NOUN
iajs-3652	56	4	of	of	ADP
iajs-3652	56	5	dna	dna	PROPN
iajs-3652	56	6	purity	purity	NOUN
iajs-3652	56	7	and	and	CCONJ
iajs-3652	56	8	concentration	concentration	NOUN
iajs-3652	56	9	detection	detection	NOUN
iajs-3652	56	10	of	of	ADP
iajs-3652	56	11	dna	dna	PROPN
iajs-3652	56	12	concentration	concentration	NOUN
iajs-3652	56	13	and	and	CCONJ
iajs-3652	56	14	purity	purity	NOUN
iajs-3652	56	15	place	place	NOUN
iajs-3652	56	16	1	1	NUM
iajs-3652	56	17	-	-	SYM
iajs-3652	56	18	2	2	NUM
iajs-3652	56	19	µl	µl	NOUN
iajs-3652	56	20	of	of	ADP
iajs-3652	56	21	mini	mini	ADJ
iajs-3652	56	22	-	-	VERB
iajs-3652	56	23	prepped	prepped	ADJ
iajs-3652	56	24	dna	dna	NOUN
iajs-3652	56	25	onto	onto	ADP
iajs-3652	56	26	the	the	DET
iajs-3652	56	27	pedestal	pedestal	NOUN
iajs-3652	56	28	and	and	CCONJ
iajs-3652	56	29	use	use	VERB
iajs-3652	56	30	a	a	DET
iajs-3652	56	31	nano	nano	NOUN
iajs-3652	56	32	-	-	PUNCT
iajs-3652	56	33	drop	drop	NOUN
iajs-3652	56	34	to	to	PART
iajs-3652	56	35	quantify	quantify	VERB
iajs-3652	56	36	your	your	PRON
iajs-3652	56	37	samples	sample	NOUN
iajs-3652	56	38	.	.	PUNCT
iajs-3652	57	1	the	the	DET
iajs-3652	57	2	purity	purity	NOUN
iajs-3652	57	3	is	be	AUX
iajs-3652	57	4	measured	measure	VERB
iajs-3652	57	5	(	(	PUNCT
iajs-3652	57	6	a	a	DET
iajs-3652	57	7	good	good	ADJ
iajs-3652	57	8	purity	purity	NOUN
iajs-3652	57	9	ranges	range	VERB
iajs-3652	57	10	from	from	ADP
iajs-3652	57	11	1.80	1.80	NUM
iajs-3652	57	12	to	to	ADP
iajs-3652	57	13	2.00	2.00	NUM
iajs-3652	57	14	)	)	PUNCT
iajs-3652	57	15	.	.	PUNCT
iajs-3652	58	1	rehash	rehash	VERB
iajs-3652	58	2	each	each	DET
iajs-3652	58	3	example	example	NOUN
iajs-3652	58	4	.	.	PUNCT
iajs-3652	59	1	2.7	2.7	NUM
iajs-3652	59	2	.	.	PUNCT
iajs-3652	59	3	gene	gene	NOUN
iajs-3652	59	4	amplification	amplification	NOUN
iajs-3652	59	5	2.7.1	2.7.1	NUM
iajs-3652	59	6	.	.	PUNCT
iajs-3652	60	1	the	the	DET
iajs-3652	60	2	specific	specific	ADJ
iajs-3652	60	3	primer	primer	NOUN
iajs-3652	60	4	algd	algd	NOUN
iajs-3652	60	5	of	of	ADP
iajs-3652	60	6	gene	gene	NOUN
iajs-3652	60	7	the	the	DET
iajs-3652	60	8	sequence	sequence	NOUN
iajs-3652	60	9	5′atgcgaatcagcatctttggt	5′atgcgaatcagcatctttggt	NOUN
iajs-3652	60	10	-3′	-3′	PUNCT
iajs-3652	60	11	was	be	AUX
iajs-3652	60	12	used	use	VERB
iajs-3652	60	13	as	as	ADP
iajs-3652	60	14	a	a	DET
iajs-3652	60	15	forward	forward	ADJ
iajs-3652	60	16	primer	primer	NOUN
iajs-3652	60	17	with	with	ADP
iajs-3652	60	18	the	the	DET
iajs-3652	60	19	percentage	percentage	NOUN
iajs-3652	60	20	of	of	ADP
iajs-3652	60	21	gc	gc	PROPN
iajs-3652	60	22	(	(	PUNCT
iajs-3652	60	23	66.93	66.93	NUM
iajs-3652	60	24	%	%	NOUN
iajs-3652	60	25	)	)	PUNCT
iajs-3652	60	26	at	at	ADP
iajs-3652	60	27	60	60	NUM
iajs-3652	60	28	°	°	NOUN
iajs-3652	60	29	c	c	NOUN
iajs-3652	60	30	,	,	PUNCT
iajs-3652	60	31	while	while	SCONJ
iajs-3652	60	32	the	the	DET
iajs-3652	60	33	sequence	sequence	NOUN
iajs-3652	60	34	5′ctaccagcagatgccctcggc-3′	5′ctaccagcagatgccctcggc-3′	PROPN
iajs-3652	60	35	was	be	AUX
iajs-3652	60	36	used	use	VERB
iajs-3652	60	37	as	as	ADP
iajs-3652	60	38	a	a	DET
iajs-3652	60	39	reverse	reverse	ADJ
iajs-3652	60	40	primer	primer	NOUN
iajs-3652	60	41	with	with	ADP
iajs-3652	60	42	the	the	DET
iajs-3652	60	43	percentage	percentage	NOUN
iajs-3652	60	44	of	of	ADP
iajs-3652	60	45	gc	gc	PROPN
iajs-3652	60	46	(	(	PUNCT
iajs-3652	60	47	76.69	76.69	NUM
iajs-3652	60	48	%	%	NOUN
iajs-3652	60	49	)	)	PUNCT
iajs-3652	60	50	at	at	ADP
iajs-3652	60	51	70	70	NUM
iajs-3652	60	52	°	°	NOUN
iajs-3652	60	53	c	c	NOUN
iajs-3652	60	54	,	,	PUNCT
iajs-3652	60	55	and	and	CCONJ
iajs-3652	60	56	both	both	DET
iajs-3652	60	57	sizes	size	NOUN
iajs-3652	60	58	of	of	ADP
iajs-3652	60	59	product	product	NOUN
iajs-3652	60	60	are	be	AUX
iajs-3652	60	61	1310	1310	NUM
iajs-3652	60	62	base	base	NOUN
iajs-3652	60	63	pairs	pair	NOUN
iajs-3652	60	64	.	.	PUNCT
iajs-3652	61	1	2.7.2	2.7.2	NUM
iajs-3652	61	2	.	.	PUNCT
iajs-3652	62	1	the	the	DET
iajs-3652	62	2	specific	specific	ADJ
iajs-3652	62	3	primer	primer	NOUN
iajs-3652	62	4	tspe4.c2	tspe4.c2	NOUN
iajs-3652	62	5	.	.	PUNCT
iajs-3652	63	1	of	of	ADP
iajs-3652	63	2	gene	gene	NOUN
iajs-3652	63	3	the	the	DET
iajs-3652	63	4	sequence	sequence	NOUN
iajs-3652	63	5	5′-gagtaatgtcggggcattca-3′	5′-gagtaatgtcggggcattca-3′	NUM
iajs-3652	63	6	was	be	AUX
iajs-3652	63	7	used	use	VERB
iajs-3652	63	8	as	as	ADP
iajs-3652	63	9	a	a	DET
iajs-3652	63	10	forward	forward	ADJ
iajs-3652	63	11	primer	primer	NOUN
iajs-3652	63	12	with	with	ADP
iajs-3652	63	13	the	the	DET
iajs-3652	63	14	percentage	percentage	NOUN
iajs-3652	63	15	of	of	ADP
iajs-3652	63	16	gc	gc	PROPN
iajs-3652	63	17	(	(	PUNCT
iajs-3652	63	18	68.25	68.25	NUM
iajs-3652	63	19	%	%	NOUN
iajs-3652	63	20	)	)	PUNCT
iajs-3652	63	21	at	at	ADP
iajs-3652	63	22	60	60	NUM
iajs-3652	63	23	°	°	NOUN
iajs-3652	63	24	c	c	NOUN
iajs-3652	63	25	,	,	PUNCT
iajs-3652	63	26	while	while	SCONJ
iajs-3652	63	27	the	the	DET
iajs-3652	63	28	sequence	sequence	NOUN
iajs-3652	63	29	5′-cgcgccaacaaagtattacg	5′-cgcgccaacaaagtattacg	PROPN
iajs-3652	63	30	-3′	-3′	PUNCT
iajs-3652	63	31	was	be	AUX
iajs-3652	63	32	used	use	VERB
iajs-3652	63	33	as	as	ADP
iajs-3652	63	34	a	a	DET
iajs-3652	63	35	reverse	reverse	ADJ
iajs-3652	63	36	primer	primer	NOUN
iajs-3652	63	37	with	with	ADP
iajs-3652	63	38	the	the	DET
iajs-3652	63	39	percentage	percentage	NOUN
iajs-3652	63	40	of	of	ADP
iajs-3652	63	41	gc	gc	PROPN
iajs-3652	63	42	(	(	PUNCT
iajs-3652	63	43	68.25	68.25	NUM
iajs-3652	63	44	%	%	NOUN
iajs-3652	63	45	)	)	PUNCT
iajs-3652	63	46	at	at	ADP
iajs-3652	63	47	60	60	NUM
iajs-3652	63	48	°	°	NOUN
iajs-3652	63	49	c	c	NOUN
iajs-3652	63	50	,	,	PUNCT
iajs-3652	63	51	and	and	CCONJ
iajs-3652	63	52	both	both	DET
iajs-3652	63	53	sizes	size	NOUN
iajs-3652	63	54	of	of	ADP
iajs-3652	63	55	product	product	NOUN
iajs-3652	63	56	are	be	AUX
iajs-3652	63	57	152	152	NUM
iajs-3652	63	58	base	base	NOUN
iajs-3652	63	59	pairs	pair	NOUN
iajs-3652	63	60	.	.	PUNCT
iajs-3652	64	1	in	in	ADP
iajs-3652	64	2	both	both	DET
iajs-3652	64	3	genes	gene	NOUN
iajs-3652	64	4	,	,	PUNCT
iajs-3652	64	5	the	the	DET
iajs-3652	64	6	perfect	perfect	ADJ
iajs-3652	64	7	state	state	NOUN
iajs-3652	64	8	has	have	AUX
iajs-3652	64	9	been	be	AUX
iajs-3652	64	10	recognized	recognize	VERB
iajs-3652	64	11	for	for	ADP
iajs-3652	64	12	(	(	PUNCT
iajs-3652	64	13	initial	initial	ADJ
iajs-3652	64	14	denaturation	denaturation	NOUN
iajs-3652	64	15	and	and	CCONJ
iajs-3652	64	16	annealing	annealing	NOUN
iajs-3652	64	17	)	)	PUNCT
iajs-3652	64	18	;	;	PUNCT
iajs-3652	64	19	later	later	ADV
iajs-3652	64	20	,	,	PUNCT
iajs-3652	64	21	a	a	DET
iajs-3652	64	22	work	work	NOUN
iajs-3652	64	23	of	of	ADP
iajs-3652	64	24	a	a	DET
iajs-3652	64	25	few	few	ADJ
iajs-3652	64	26	examinations	examination	NOUN
iajs-3652	64	27	to	to	PART
iajs-3652	64	28	acquire	acquire	VERB
iajs-3652	64	29	this	this	DET
iajs-3652	64	30	state	state	NOUN
iajs-3652	64	31	,	,	PUNCT
iajs-3652	64	32	the	the	DET
iajs-3652	64	33	temperature	temperature	NOUN
iajs-3652	64	34	has	have	AUX
iajs-3652	64	35	altered	alter	VERB
iajs-3652	64	36	over	over	ADP
iajs-3652	64	37	the	the	DET
iajs-3652	64	38	crafted	craft	VERB
iajs-3652	64	39	by	by	ADP
iajs-3652	64	40	(	(	PUNCT
iajs-3652	64	41	gradient	gradient	ADJ
iajs-3652	64	42	pcr	pcr	NOUN
iajs-3652	64	43	)	)	PUNCT
iajs-3652	64	44	at	at	ADP
iajs-3652	64	45	entirely	entirely	ADV
iajs-3652	64	46	examples	example	NOUN
iajs-3652	64	47	to	to	PART
iajs-3652	64	48	choose	choose	VERB
iajs-3652	64	49	the	the	DET
iajs-3652	64	50	ideal	ideal	ADJ
iajs-3652	64	51	state	state	NOUN
iajs-3652	64	52	and	and	CCONJ
iajs-3652	64	53	furthermore	furthermore	ADV
iajs-3652	64	54	altered	alter	VERB
iajs-3652	64	55	the	the	DET
iajs-3652	64	56	amount	amount	NOUN
iajs-3652	64	57	of	of	ADP
iajs-3652	64	58	dna	dna	NOUN
iajs-3652	64	59	template	template	NOUN
iajs-3652	64	60	amongst	amongst	ADP
iajs-3652	64	61	(	(	PUNCT
iajs-3652	64	62	1.5	1.5	NUM
iajs-3652	64	63	-	-	SYM
iajs-3652	64	64	2	2	NUM
iajs-3652	64	65	µl	µl	NOUN
iajs-3652	64	66	)	)	PUNCT
iajs-3652	64	67	,	,	PUNCT
iajs-3652	64	68	wherever	wherever	SCONJ
iajs-3652	64	69	it	it	PRON
iajs-3652	64	70	is	be	AUX
iajs-3652	64	71	viewed	view	VERB
iajs-3652	64	72	as	as	ADP
iajs-3652	64	73	these	these	DET
iajs-3652	64	74	two	two	NUM
iajs-3652	64	75	elements	element	NOUN
iajs-3652	64	76	from	from	ADP
iajs-3652	64	77	significant	significant	ADJ
iajs-3652	64	78	variables	variable	NOUN
iajs-3652	64	79	in	in	ADP
iajs-3652	64	80	primer	primer	NOUN
iajs-3652	64	81	annealing	annealing	NOUN
iajs-3652	64	82	and	and	CCONJ
iajs-3652	64	83	complement	complement	NOUN
iajs-3652	64	84	.	.	PUNCT
iajs-3652	65	1	2.8	2.8	NUM
iajs-3652	65	2	.	.	PUNCT
iajs-3652	65	3	maxime	maxime	NOUN
iajs-3652	65	4	pcr	pcr	PROPN
iajs-3652	65	5	premix	premix	NOUN
iajs-3652	65	6	kit	kit	NOUN
iajs-3652	65	7	(	(	PUNCT
iajs-3652	65	8	i	i	NOUN
iajs-3652	65	9	-	-	PUNCT
iajs-3652	65	10	taq	taq	NOUN
iajs-3652	65	11	)	)	PUNCT
iajs-3652	65	12	20μlrxn	20μlrxn	NUM
iajs-3652	65	13	(	(	PUNCT
iajs-3652	65	14	cat	cat	NOUN
iajs-3652	65	15	.	.	PUNCT
iajs-3652	66	1	no	no	INTJ
iajs-3652	66	2	.	.	NOUN
iajs-3652	66	3	25025	25025	NUM
iajs-3652	66	4	)	)	PUNCT
iajs-3652	66	5	and	and	CCONJ
iajs-3652	66	6	diagnosis	diagnosis	NOUN
iajs-3652	66	7	of	of	ADP
iajs-3652	66	8	gene	gene	NOUN
iajs-3652	66	9	:	:	PUNCT
iajs-3652	66	10	intron	intron	PROPN
iajs-3652	66	11	's	's	PART
iajs-3652	66	12	maximepcr	maximepcr	ADJ
iajs-3652	66	13	premix	premix	NOUN
iajs-3652	66	14	kit	kit	NOUN
iajs-3652	66	15	has	have	VERB
iajs-3652	66	16	not	not	PART
iajs-3652	66	17	merely	merely	ADV
iajs-3652	66	18	different	different	ADJ
iajs-3652	66	19	types	type	NOUN
iajs-3652	66	20	of	of	ADP
iajs-3652	66	21	premix	premix	NOUN
iajs-3652	66	22	kit	kit	NOUN
iajs-3652	66	23	conferring	confer	VERB
iajs-3652	66	24	to	to	PART
iajs-3652	66	25	practice	practice	VERB
iajs-3652	66	26	tenacity	tenacity	NOUN
iajs-3652	66	27	;	;	PUNCT
iajs-3652	66	28	nevertheless	nevertheless	ADV
iajs-3652	66	29	,	,	PUNCT
iajs-3652	66	30	it	it	PRON
iajs-3652	66	31	is	be	AUX
iajs-3652	66	32	a	a	DET
iajs-3652	66	33	2x	2x	NUM
iajs-3652	66	34	master	master	NOUN
iajs-3652	66	35	combination	combination	NOUN
iajs-3652	66	36	solution	solution	NOUN
iajs-3652	66	37	.	.	PUNCT
iajs-3652	67	1	maxime	maxime	PROPN
iajs-3652	67	2	pcr	pcr	PROPN
iajs-3652	67	3	pre	pre	NOUN
iajs-3652	67	4	mix	mix	NOUN
iajs-3652	67	5	kit	kit	NOUN
iajs-3652	67	6	(	(	PUNCT
iajs-3652	67	7	i	i	NOUN
iajs-3652	67	8	-	-	PUNCT
iajs-3652	67	9	taq	taq	NOUN
iajs-3652	67	10	)	)	PUNCT
iajs-3652	67	11	is	be	AUX
iajs-3652	67	12	the	the	DET
iajs-3652	67	13	product	product	NOUN
iajs-3652	67	14	that	that	PRON
iajs-3652	67	15	is	be	AUX
iajs-3652	67	16	mixing	mix	VERB
iajs-3652	67	17	all	all	DET
iajs-3652	67	18	constituents	constituent	NOUN
iajs-3652	67	19	:	:	PUNCT
iajs-3652	67	20	i	i	PROPN
iajs-3652	67	21	-	-	PUNCT
iajs-3652	67	22	taq	taq	PROPN
iajs-3652	67	23	dna	dna	PROPN
iajs-3652	67	24	polymerase	polymerase	NOUN
iajs-3652	67	25	,	,	PUNCT
iajs-3652	67	26	dntp	dntp	NOUN
iajs-3652	67	27	mixture	mixture	NOUN
iajs-3652	67	28	,	,	PUNCT
iajs-3652	67	29	reaction	reaction	NOUN
iajs-3652	67	30	buffer	buffer	NOUN
iajs-3652	67	31	,	,	PUNCT
iajs-3652	67	32	and	and	CCONJ
iajs-3652	67	33	so	so	ADV
iajs-3652	67	34	on	on	ADV
iajs-3652	67	35	—	—	PUNCT
iajs-3652	67	36	in	in	ADP
iajs-3652	67	37	one	one	NUM
iajs-3652	67	38	tube	tube	NOUN
iajs-3652	67	39	for	for	ADP
iajs-3652	67	40	1	1	NUM
iajs-3652	67	41	rxn	rxn	NOUN
iajs-3652	67	42	pcr	pcr	NOUN
iajs-3652	67	43	.	.	PUNCT
iajs-3652	68	1	this	this	PRON
iajs-3652	68	2	is	be	AUX
iajs-3652	68	3	a	a	DET
iajs-3652	68	4	product	product	NOUN
iajs-3652	68	5	that	that	PRON
iajs-3652	68	6	can	can	AUX
iajs-3652	68	7	give	give	VERB
iajs-3652	68	8	the	the	DET
iajs-3652	68	9	finest	fine	ADJ
iajs-3652	68	10	finding	finding	NOUN
iajs-3652	68	11	through	through	ADP
iajs-3652	68	12	the	the	DET
iajs-3652	68	13	maximum	maximum	ADJ
iajs-3652	68	14	suitability	suitability	NOUN
iajs-3652	68	15	system	system	NOUN
iajs-3652	68	16	.	.	PUNCT
iajs-3652	69	1	the	the	DET
iajs-3652	69	2	main	main	ADJ
iajs-3652	69	3	purpose	purpose	NOUN
iajs-3652	69	4	is	be	AUX
iajs-3652	69	5	that	that	SCONJ
iajs-3652	69	6	it	it	PRON
iajs-3652	69	7	has	have	VERB
iajs-3652	69	8	each	each	DET
iajs-3652	69	9	product	product	NOUN
iajs-3652	69	10	for	for	ADP
iajs-3652	69	11	pcr	pcr	NOUN
iajs-3652	69	12	,	,	PUNCT
iajs-3652	69	13	so	so	SCONJ
iajs-3652	69	14	it	it	PRON
iajs-3652	69	15	can	can	AUX
iajs-3652	69	16	make	make	VERB
iajs-3652	69	17	pcr	pcr	NOUN
iajs-3652	69	18	just	just	ADV
iajs-3652	69	19	supplement	supplement	NOUN
iajs-3652	69	20	:	:	PUNCT
iajs-3652	69	21	a	a	DET
iajs-3652	69	22	template	template	NOUN
iajs-3652	69	23	dna	dna	NOUN
iajs-3652	69	24	,	,	PUNCT
iajs-3652	69	25	primer	primer	NOUN
iajs-3652	69	26	set	set	NOUN
iajs-3652	69	27	,	,	PUNCT
iajs-3652	69	28	and	and	CCONJ
iajs-3652	69	29	distilled	distilled	ADJ
iajs-3652	69	30	water	water	NOUN
iajs-3652	69	31	.	.	PUNCT
iajs-3652	70	1	another	another	DET
iajs-3652	70	2	purpose	purpose	NOUN
iajs-3652	70	3	is	be	AUX
iajs-3652	70	4	to	to	PART
iajs-3652	70	5	include	include	VERB
iajs-3652	70	6	a	a	DET
iajs-3652	70	7	gel	gel	NOUN
iajs-3652	70	8	loading	loading	NOUN
iajs-3652	70	9	buffer	buffer	NOUN
iajs-3652	70	10	for	for	ADP
iajs-3652	70	11	electrophoresis	electrophoresis	NOUN
iajs-3652	70	12	,	,	PUNCT
iajs-3652	70	13	which	which	PRON
iajs-3652	70	14	allows	allow	VERB
iajs-3652	70	15	for	for	ADP
iajs-3652	70	16	gel	gel	NOUN
iajs-3652	70	17	loading	loading	NOUN
iajs-3652	70	18	without	without	ADP
iajs-3652	70	19	the	the	DET
iajs-3652	70	20	need	need	NOUN
iajs-3652	70	21	for	for	ADP
iajs-3652	70	22	any	any	DET
iajs-3652	70	23	treatment	treatment	NOUN
iajs-3652	70	24	.	.	PUNCT
iajs-3652	71	1	this	this	DET
iajs-3652	71	2	method	method	NOUN
iajs-3652	71	3	is	be	AUX
iajs-3652	71	4	suitable	suitable	ADJ
iajs-3652	71	5	for	for	ADP
iajs-3652	71	6	processing	process	VERB
iajs-3652	71	7	numerous	numerous	ADJ
iajs-3652	71	8	samples	sample	NOUN
iajs-3652	71	9	quickly	quickly	ADV
iajs-3652	71	10	and	and	CCONJ
iajs-3652	71	11	affordably	affordably	ADV
iajs-3652	71	12	.	.	PUNCT
iajs-3652	72	1	in	in	ADP
iajs-3652	72	2	the	the	DET
iajs-3652	72	3	maxime	maxime	NOUN
iajs-3652	72	4	pcr	pcr	PROPN
iajs-3652	72	5	pre	pre	X
iajs-3652	72	6	blend	blend	PROPN
iajs-3652	72	7	unit	unit	NOUN
iajs-3652	72	8	(	(	PUNCT
iajs-3652	72	9	i	i	NOUN
iajs-3652	72	10	-	-	PUNCT
iajs-3652	72	11	taq	taq	PROPN
iajs-3652	72	12	)	)	PUNCT
iajs-3652	72	13	,	,	PUNCT
iajs-3652	72	14	i	i	PROPN
iajs-3652	72	15	-	-	PUNCT
iajs-3652	72	16	taq	taq	PROPN
iajs-3652	72	17	dna	dna	PROPN
iajs-3652	72	18	polymerase	polymerase	NOUN
iajs-3652	72	19	,	,	PUNCT
iajs-3652	72	20	dntp	dntp	NOUN
iajs-3652	72	21	mixture	mixture	NOUN
iajs-3652	72	22	,	,	PUNCT
iajs-3652	72	23	and	and	CCONJ
iajs-3652	72	24	reaction	reaction	NOUN
iajs-3652	72	25	buffer	buffer	NOUN
iajs-3652	72	26	are	be	AUX
iajs-3652	72	27	all	all	PRON
iajs-3652	72	28	mixed	mixed	ADJ
iajs-3652	72	29	together	together	ADV
iajs-3652	72	30	in	in	ADP
iajs-3652	72	31	one	one	NUM
iajs-3652	72	32	tube	tube	NOUN
iajs-3652	72	33	for	for	ADP
iajs-3652	72	34	rxnpcr	rxnpcr	ADJ
iajs-3652	72	35	.	.	PUNCT
iajs-3652	73	1	you	you	PRON
iajs-3652	73	2	can	can	AUX
iajs-3652	73	3	combine	combine	VERB
iajs-3652	73	4	this	this	DET
iajs-3652	73	5	product	product	NOUN
iajs-3652	73	6	with	with	ADP
iajs-3652	73	7	the	the	DET
iajs-3652	73	8	finest	fine	ADJ
iajs-3652	73	9	and	and	CCONJ
iajs-3652	73	10	most	most	ADV
iajs-3652	73	11	accommodating	accommodate	VERB
iajs-3652	73	12	system	system	NOUN
iajs-3652	73	13	available	available	ADJ
iajs-3652	73	14	.	.	PUNCT
iajs-3652	74	1	the	the	DET
iajs-3652	74	2	subsequent	subsequent	ADJ
iajs-3652	74	3	explanation	explanation	NOUN
iajs-3652	74	4	is	be	AUX
iajs-3652	74	5	that	that	SCONJ
iajs-3652	74	6	it	it	PRON
iajs-3652	74	7	contains	contain	VERB
iajs-3652	74	8	a	a	DET
iajs-3652	74	9	gel	gel	NOUN
iajs-3652	74	10	loading	loading	NOUN
iajs-3652	74	11	buffer	buffer	NOUN
iajs-3652	74	12	for	for	ADP
iajs-3652	74	13	electrophoresis	electrophoresis	NOUN
iajs-3652	74	14	,	,	PUNCT
iajs-3652	74	15	which	which	PRON
iajs-3652	74	16	allows	allow	VERB
iajs-3652	74	17	for	for	ADP
iajs-3652	74	18	gel	gel	NOUN
iajs-3652	74	19	loading	loading	NOUN
iajs-3652	74	20	with	with	ADP
iajs-3652	74	21	minimal	minimal	ADJ
iajs-3652	74	22	treatment	treatment	NOUN
iajs-3652	74	23	.	.	PUNCT
iajs-3652	75	1	the	the	DET
iajs-3652	75	2	constituents	constituent	NOUN
iajs-3652	75	3	of	of	ADP
iajs-3652	75	4	the	the	DET
iajs-3652	75	5	maxime	maxime	ADJ
iajs-3652	75	6	pcr	pcr	NOUN
iajs-3652	75	7	premix	premix	NOUN
iajs-3652	75	8	(	(	PUNCT
iajs-3652	75	9	i	i	NOUN
iajs-3652	75	10	-	-	PUNCT
iajs-3652	75	11	taq	taq	NOUN
iajs-3652	75	12	)	)	PUNCT
iajs-3652	75	13	kit	kit	NOUN
iajs-3652	75	14	are	be	AUX
iajs-3652	75	15	as	as	SCONJ
iajs-3652	75	16	follows	follow	VERB
iajs-3652	75	17	:	:	PUNCT
iajs-3652	75	18	i	i	PROPN
iajs-3652	75	19	-	-	PUNCT
iajs-3652	75	20	taq	taq	PROPN
iajs-3652	75	21	dna	dna	PROPN
iajs-3652	75	22	polymerase	polymerase	NOUN
iajs-3652	75	23	was	be	AUX
iajs-3652	75	24	in	in	ADP
iajs-3652	75	25	an	an	DET
iajs-3652	75	26	amount	amount	NOUN
iajs-3652	75	27	of	of	ADP
iajs-3652	75	28	5	5	NUM
iajs-3652	75	29	u.µl-1	u.µl-1	ADJ
iajs-3652	75	30	,	,	PUNCT
iajs-3652	75	31	dntps	dntps	ADJ
iajs-3652	75	32	were	be	AUX
iajs-3652	75	33	in	in	ADP
iajs-3652	75	34	an	an	DET
iajs-3652	75	35	amount	amount	NOUN
iajs-3652	75	36	of	of	ADP
iajs-3652	75	37	2.5	2.5	NUM
iajs-3652	75	38	mm	mm	NOUN
iajs-3652	75	39	,	,	PUNCT
iajs-3652	75	40	the	the	DET
iajs-3652	75	41	ihjpas	ihjpa	NOUN
iajs-3652	75	42	.	.	PUNCT
iajs-3652	76	1	2025	2025	NUM
iajs-3652	76	2	,	,	PUNCT
iajs-3652	76	3	38(3	38(3	NUM
iajs-3652	76	4	)	)	PUNCT
iajs-3652	76	5	108	108	NUM
iajs-3652	76	6	reaction	reaction	NOUN
iajs-3652	76	7	buffer	buffer	NOUN
iajs-3652	76	8	was	be	AUX
iajs-3652	76	9	in	in	ADP
iajs-3652	76	10	an	an	DET
iajs-3652	76	11	amount	amount	NOUN
iajs-3652	76	12	of	of	ADP
iajs-3652	76	13	10x	10x	NOUN
iajs-3652	76	14	(	(	PUNCT
iajs-3652	76	15	1x	1x	NUM
iajs-3652	76	16	)	)	PUNCT
iajs-3652	76	17	,	,	PUNCT
iajs-3652	76	18	and	and	CCONJ
iajs-3652	76	19	the	the	DET
iajs-3652	76	20	gel	gel	NOUN
iajs-3652	76	21	loading	loading	NOUN
iajs-3652	76	22	buffer	buffer	NOUN
iajs-3652	76	23	was	be	AUX
iajs-3652	76	24	in	in	ADP
iajs-3652	76	25	an	an	DET
iajs-3652	76	26	amount	amount	NOUN
iajs-3652	76	27	of	of	ADP
iajs-3652	76	28	1x	1x	NUM
iajs-3652	76	29	.	.	PUNCT
iajs-3652	77	1	while	while	SCONJ
iajs-3652	77	2	the	the	DET
iajs-3652	77	3	combination	combination	NOUN
iajs-3652	77	4	of	of	ADP
iajs-3652	77	5	the	the	DET
iajs-3652	77	6	specific	specific	ADJ
iajs-3652	77	7	contact	contact	NOUN
iajs-3652	77	8	for	for	ADP
iajs-3652	77	9	the	the	DET
iajs-3652	77	10	identification	identification	NOUN
iajs-3652	77	11	gene	gene	NOUN
iajs-3652	77	12	was	be	AUX
iajs-3652	77	13	as	as	SCONJ
iajs-3652	77	14	follows	follow	VERB
iajs-3652	77	15	:	:	PUNCT
iajs-3652	77	16	taq	taq	PROPN
iajs-3652	77	17	pcr	pcr	PROPN
iajs-3652	77	18	premix	premix	NOUN
iajs-3652	77	19	was	be	AUX
iajs-3652	77	20	an	an	DET
iajs-3652	77	21	amount	amount	NOUN
iajs-3652	77	22	of	of	ADP
iajs-3652	77	23	5	5	NUM
iajs-3652	77	24	µl	µl	NOUN
iajs-3652	77	25	,	,	PUNCT
iajs-3652	77	26	the	the	DET
iajs-3652	77	27	forward	forward	ADJ
iajs-3652	77	28	primer	primer	NOUN
iajs-3652	77	29	was	be	AUX
iajs-3652	77	30	an	an	DET
iajs-3652	77	31	amount	amount	NOUN
iajs-3652	77	32	of	of	ADP
iajs-3652	77	33	10	10	NUM
iajs-3652	77	34	picomoles/µl	picomoles/µl	X
iajs-3652	77	35	(	(	PUNCT
iajs-3652	77	36	1	1	NUM
iajs-3652	77	37	µl	µl	NOUN
iajs-3652	77	38	)	)	PUNCT
iajs-3652	77	39	,	,	PUNCT
iajs-3652	77	40	the	the	DET
iajs-3652	77	41	reverse	reverse	ADJ
iajs-3652	77	42	primer	primer	NOUN
iajs-3652	77	43	was	be	AUX
iajs-3652	77	44	an	an	DET
iajs-3652	77	45	amount	amount	NOUN
iajs-3652	77	46	of	of	ADP
iajs-3652	77	47	10	10	NUM
iajs-3652	77	48	picomoles/µl	picomoles/µl	X
iajs-3652	77	49	(	(	PUNCT
iajs-3652	77	50	1	1	NUM
iajs-3652	77	51	µl	µl	NOUN
iajs-3652	77	52	)	)	PUNCT
iajs-3652	77	53	,	,	PUNCT
iajs-3652	77	54	dna	dna	PROPN
iajs-3652	77	55	was	be	AUX
iajs-3652	77	56	an	an	DET
iajs-3652	77	57	amount	amount	NOUN
iajs-3652	77	58	of	of	ADP
iajs-3652	77	59	1.5	1.5	NUM
iajs-3652	77	60	µl	µl	NOUN
iajs-3652	77	61	,	,	PUNCT
iajs-3652	77	62	and	and	CCONJ
iajs-3652	77	63	distilled	distil	VERB
iajs-3652	77	64	water	water	NOUN
iajs-3652	77	65	was	be	AUX
iajs-3652	77	66	an	an	DET
iajs-3652	77	67	amount	amount	NOUN
iajs-3652	77	68	of	of	ADP
iajs-3652	77	69	16.5	16.5	NUM
iajs-3652	77	70	µl	µl	NOUN
iajs-3652	77	71	;	;	PUNCT
iajs-3652	77	72	therefore	therefore	ADV
iajs-3652	77	73	,	,	PUNCT
iajs-3652	77	74	the	the	DET
iajs-3652	77	75	final	final	ADJ
iajs-3652	77	76	size	size	NOUN
iajs-3652	77	77	equals	equal	VERB
iajs-3652	77	78	25	25	NUM
iajs-3652	77	79	µl	µl	NOUN
iajs-3652	77	80	.	.	PUNCT
iajs-3652	78	1	the	the	DET
iajs-3652	78	2	optimal	optimal	ADJ
iajs-3652	78	3	state	state	NOUN
iajs-3652	78	4	of	of	ADP
iajs-3652	78	5	detection	detection	NOUN
iajs-3652	78	6	was	be	AUX
iajs-3652	78	7	carried	carry	VERB
iajs-3652	78	8	out	out	ADP
iajs-3652	78	9	as	as	SCONJ
iajs-3652	78	10	follows	follow	VERB
iajs-3652	78	11	:	:	PUNCT
iajs-3652	78	12	the	the	DET
iajs-3652	78	13	initial	initial	ADJ
iajs-3652	78	14	denaturation	denaturation	NOUN
iajs-3652	78	15	phase	phase	NOUN
iajs-3652	78	16	took	take	VERB
iajs-3652	78	17	place	place	NOUN
iajs-3652	78	18	in	in	ADP
iajs-3652	78	19	5	5	NUM
iajs-3652	78	20	minutes	minute	NOUN
iajs-3652	78	21	at	at	ADP
iajs-3652	78	22	94	94	NUM
iajs-3652	78	23	degrees	degree	NOUN
iajs-3652	78	24	celsius	celsius	NOUN
iajs-3652	78	25	,	,	PUNCT
iajs-3652	78	26	involving	involve	VERB
iajs-3652	78	27	one	one	NUM
iajs-3652	78	28	cycle	cycle	NOUN
iajs-3652	78	29	.	.	PUNCT
iajs-3652	79	1	denaturation	denaturation	NOUN
iajs-3652	79	2	(	(	PUNCT
iajs-3652	79	3	2	2	NUM
iajs-3652	79	4	)	)	PUNCT
iajs-3652	79	5	,	,	PUNCT
iajs-3652	79	6	annealing	anneal	VERB
iajs-3652	79	7	,	,	PUNCT
iajs-3652	79	8	and	and	CCONJ
iajs-3652	79	9	extension	extension	NOUN
iajs-3652	79	10	(	(	PUNCT
iajs-3652	79	11	1	1	X
iajs-3652	79	12	)	)	PUNCT
iajs-3652	79	13	are	be	AUX
iajs-3652	79	14	each	each	PRON
iajs-3652	79	15	45	45	NUM
iajs-3652	79	16	seconds	second	NOUN
iajs-3652	79	17	at	at	ADP
iajs-3652	79	18	94ᵒc	94ᵒc	NOUN
iajs-3652	79	19	,	,	PUNCT
iajs-3652	79	20	55ᵒc	55ᵒc	ADJ
iajs-3652	79	21	,	,	PUNCT
iajs-3652	79	22	and	and	CCONJ
iajs-3652	79	23	72ᵒc	72ᵒc	NOUN
iajs-3652	79	24	,	,	PUNCT
iajs-3652	79	25	respectively	respectively	ADV
iajs-3652	79	26	,	,	PUNCT
iajs-3652	79	27	with	with	ADP
iajs-3652	79	28	35	35	NUM
iajs-3652	79	29	cycles	cycle	NOUN
iajs-3652	79	30	.	.	PUNCT
iajs-3652	80	1	while	while	SCONJ
iajs-3652	80	2	extension	extension	NOUN
iajs-3652	80	3	:	:	PUNCT
iajs-3652	80	4	-2	-2	PUNCT
iajs-3652	80	5	phase	phase	NOUN
iajs-3652	80	6	in	in	ADP
iajs-3652	80	7	7	7	NUM
iajs-3652	80	8	min	min	NOUN
iajs-3652	80	9	at	at	ADP
iajs-3652	80	10	72ᵒc	72ᵒc	NOUN
iajs-3652	80	11	with	with	ADP
iajs-3652	80	12	one	one	NUM
iajs-3652	80	13	cycle	cycle	NOUN
iajs-3652	80	14	.	.	PUNCT
iajs-3652	81	1	3	3	X
iajs-3652	81	2	.	.	NOUN
iajs-3652	81	3	results	result	VERB
iajs-3652	81	4	3.1	3.1	NUM
iajs-3652	81	5	.	.	PUNCT
iajs-3652	82	1	antibiotic	antibiotic	ADJ
iajs-3652	82	2	resistance	resistance	NOUN
iajs-3652	82	3	detection	detection	NOUN
iajs-3652	82	4	an	an	DET
iajs-3652	82	5	examination	examination	NOUN
iajs-3652	82	6	of	of	ADP
iajs-3652	82	7	the	the	DET
iajs-3652	82	8	resistance	resistance	NOUN
iajs-3652	82	9	of	of	ADP
iajs-3652	82	10	escherichia	escherichia	NOUN
iajs-3652	82	11	coli	coli	NOUN
iajs-3652	82	12	bacteria	bacteria	NOUN
iajs-3652	82	13	to	to	ADP
iajs-3652	82	14	the	the	DET
iajs-3652	82	15	following	follow	VERB
iajs-3652	82	16	antibiotics	antibiotic	NOUN
iajs-3652	82	17	was	be	AUX
iajs-3652	82	18	conducted	conduct	VERB
iajs-3652	82	19	:	:	PUNCT
iajs-3652	82	20	ciprofloxacin	ciprofloxacin	PROPN
iajs-3652	82	21	,	,	PUNCT
iajs-3652	82	22	amoxicillin	amoxicillin	PROPN
iajs-3652	82	23	,	,	PUNCT
iajs-3652	82	24	nitrofurantoin	nitrofurantoin	NOUN
iajs-3652	82	25	,	,	PUNCT
iajs-3652	82	26	cefotaxime	cefotaxime	NOUN
iajs-3652	82	27	,	,	PUNCT
iajs-3652	82	28	gentamycin	gentamycin	PROPN
iajs-3652	82	29	,	,	PUNCT
iajs-3652	82	30	amikacin	amikacin	PROPN
iajs-3652	82	31	,	,	PUNCT
iajs-3652	82	32	imipenem	imipenem	PROPN
iajs-3652	82	33	and	and	CCONJ
iajs-3652	82	34	meropenem	meropenem	PROPN
iajs-3652	82	35	figure	figure	NOUN
iajs-3652	82	36	(	(	PUNCT
iajs-3652	82	37	1	1	X
iajs-3652	82	38	)	)	PUNCT
iajs-3652	82	39	showed	show	VERB
iajs-3652	82	40	that	that	SCONJ
iajs-3652	82	41	the	the	DET
iajs-3652	82	42	above	above	ADJ
iajs-3652	82	43	clinically	clinically	ADV
iajs-3652	82	44	isolated	isolate	VERB
iajs-3652	82	45	bacteria	bacteria	NOUN
iajs-3652	82	46	from	from	ADP
iajs-3652	82	47	iraqi	iraqi	ADJ
iajs-3652	82	48	patients	patient	NOUN
iajs-3652	82	49	in	in	ADP
iajs-3652	82	50	baghdad	baghdad	PROPN
iajs-3652	82	51	were	be	AUX
iajs-3652	82	52	resistant	resistant	ADJ
iajs-3652	82	53	to	to	ADP
iajs-3652	82	54	multiple	multiple	ADJ
iajs-3652	82	55	antibiotics	antibiotic	NOUN
iajs-3652	82	56	as	as	SCONJ
iajs-3652	82	57	follows	follow	VERB
iajs-3652	82	58	:	:	PUNCT
iajs-3652	82	59	ciprofloxacin	ciprofloxacin	PROPN
iajs-3652	82	60	resistance	resistance	NOUN
iajs-3652	82	61	5(45.45	5(45.45	ADJ
iajs-3652	82	62	%	%	NOUN
iajs-3652	82	63	)	)	PUNCT
iajs-3652	82	64	,	,	PUNCT
iajs-3652	82	65	amoxicillin	amoxicillin	NOUN
iajs-3652	82	66	1(9.09	1(9.09	NUM
iajs-3652	82	67	%	%	NOUN
iajs-3652	82	68	)	)	PUNCT
iajs-3652	82	69	,	,	PUNCT
iajs-3652	82	70	nitrofurantoin	nitrofurantoin	NOUN
iajs-3652	82	71	4	4	NUM
iajs-3652	82	72	(	(	PUNCT
iajs-3652	82	73	36.36	36.36	NUM
iajs-3652	82	74	%	%	NOUN
iajs-3652	82	75	)	)	PUNCT
iajs-3652	82	76	,	,	PUNCT
iajs-3652	82	77	cefotaxime	cefotaxime	NOUN
iajs-3652	82	78	11(100	11(100	PROPN
iajs-3652	82	79	%	%	NOUN
iajs-3652	82	80	)	)	PUNCT
iajs-3652	82	81	,	,	PUNCT
iajs-3652	82	82	gentamycin	gentamycin	VERB
iajs-3652	82	83	3(27.27	3(27.27	NUM
iajs-3652	82	84	%	%	NOUN
iajs-3652	82	85	)	)	PUNCT
iajs-3652	82	86	,	,	PUNCT
iajs-3652	82	87	amikacin	amikacin	PROPN
iajs-3652	82	88	9	9	NUM
iajs-3652	82	89	(	(	PUNCT
iajs-3652	82	90	81.82	81.82	NUM
iajs-3652	82	91	%	%	NOUN
iajs-3652	82	92	)	)	PUNCT
iajs-3652	82	93	,	,	PUNCT
iajs-3652	82	94	imipenem	imipenem	PROPN
iajs-3652	82	95	1(9.09	1(9.09	NUM
iajs-3652	82	96	%	%	NOUN
iajs-3652	82	97	)	)	PUNCT
iajs-3652	82	98	and	and	CCONJ
iajs-3652	82	99	meropnem	meropnem	PROPN
iajs-3652	82	100	2(18.185	2(18.185	NOUN
iajs-3652	82	101	)	)	PUNCT
iajs-3652	82	102	.	.	PUNCT
iajs-3652	83	1	in	in	ADP
iajs-3652	83	2	this	this	DET
iajs-3652	83	3	study	study	NOUN
iajs-3652	83	4	,	,	PUNCT
iajs-3652	83	5	results	result	NOUN
iajs-3652	83	6	showed	show	VERB
iajs-3652	83	7	that	that	SCONJ
iajs-3652	83	8	all	all	DET
iajs-3652	83	9	e.coli	e.coli	NOUN
iajs-3652	83	10	isolated	isolate	VERB
iajs-3652	83	11	were	be	AUX
iajs-3652	83	12	cefotaxime	cefotaxime	NOUN
iajs-3652	83	13	resistance	resistance	NOUN
iajs-3652	83	14	and	and	CCONJ
iajs-3652	83	15	many	many	ADJ
iajs-3652	83	16	of	of	ADP
iajs-3652	83	17	the	the	DET
iajs-3652	83	18	isolated	isolate	VERB
iajs-3652	83	19	bacteria	bacteria	NOUN
iajs-3652	83	20	were	be	AUX
iajs-3652	83	21	ciprofloxacinand	ciprofloxacinand	NOUN
iajs-3652	83	22	amikacin	amikacin	NOUN
iajs-3652	83	23	-	-	PUNCT
iajs-3652	83	24	resistant	resistant	ADJ
iajs-3652	83	25	.	.	PUNCT
iajs-3652	84	1	the	the	DET
iajs-3652	84	2	results	result	NOUN
iajs-3652	84	3	of	of	ADP
iajs-3652	84	4	the	the	DET
iajs-3652	84	5	escherichia	escherichia	NOUN
iajs-3652	84	6	coli	coli	NOUN
iajs-3652	84	7	isolates	isolate	NOUN
iajs-3652	84	8	were	be	AUX
iajs-3652	84	9	varied	varied	ADJ
iajs-3652	84	10	,	,	PUNCT
iajs-3652	84	11	as	as	SCONJ
iajs-3652	84	12	some	some	PRON
iajs-3652	84	13	of	of	ADP
iajs-3652	84	14	them	they	PRON
iajs-3652	84	15	were	be	AUX
iajs-3652	84	16	sensitive	sensitive	ADJ
iajs-3652	84	17	and	and	CCONJ
iajs-3652	84	18	others	other	NOUN
iajs-3652	84	19	were	be	AUX
iajs-3652	84	20	resistant	resistant	ADJ
iajs-3652	84	21	.	.	PUNCT
iajs-3652	85	1	figure	figure	NOUN
iajs-3652	85	2	1	1	NUM
iajs-3652	85	3	.	.	PUNCT
iajs-3652	86	1	antibiotics	antibiotic	NOUN
iajs-3652	86	2	resistance	resistance	NOUN
iajs-3652	86	3	of	of	ADP
iajs-3652	86	4	escherichia	escherichia	NOUN
iajs-3652	86	5	coli	coli	NOUN
iajs-3652	86	6	in	in	ADP
iajs-3652	86	7	current	current	ADJ
iajs-3652	86	8	study	study	NOUN
iajs-3652	86	9	.	.	PUNCT
iajs-3652	87	1	bacterial	bacterial	ADJ
iajs-3652	87	2	resistance	resistance	NOUN
iajs-3652	87	3	to	to	ADP
iajs-3652	87	4	antibiotics	antibiotic	NOUN
iajs-3652	87	5	is	be	AUX
iajs-3652	87	6	the	the	DET
iajs-3652	87	7	result	result	NOUN
iajs-3652	87	8	of	of	ADP
iajs-3652	87	9	numerous	numerous	ADJ
iajs-3652	87	10	factors	factor	NOUN
iajs-3652	87	11	working	work	VERB
iajs-3652	87	12	together	together	ADV
iajs-3652	87	13	.	.	PUNCT
iajs-3652	88	1	escherichia	escherichia	NOUN
iajs-3652	88	2	coli	coli	NOUN
iajs-3652	88	3	acquires	acquire	VERB
iajs-3652	88	4	antibiotic	antibiotic	ADJ
iajs-3652	88	5	resistance	resistance	NOUN
iajs-3652	88	6	features	feature	VERB
iajs-3652	88	7	through	through	ADP
iajs-3652	88	8	genetic	genetic	ADJ
iajs-3652	88	9	processes	process	NOUN
iajs-3652	88	10	such	such	ADJ
iajs-3652	88	11	as	as	ADP
iajs-3652	88	12	horizontal	horizontal	ADJ
iajs-3652	88	13	gene	gene	NOUN
iajs-3652	88	14	transfer	transfer	NOUN
iajs-3652	88	15	and	and	CCONJ
iajs-3652	88	16	clonal	clonal	ADJ
iajs-3652	88	17	development	development	NOUN
iajs-3652	88	18	of	of	ADP
iajs-3652	88	19	resistance	resistance	NOUN
iajs-3652	88	20	isolates	isolate	NOUN
iajs-3652	88	21	(	(	PUNCT
iajs-3652	88	22	17	17	NUM
iajs-3652	88	23	-	-	SYM
iajs-3652	88	24	20	20	NUM
iajs-3652	88	25	)	)	PUNCT
iajs-3652	88	26	.	.	PUNCT
iajs-3652	89	1	3.2	3.2	NUM
iajs-3652	89	2	.	.	PUNCT
iajs-3652	90	1	the	the	DET
iajs-3652	90	2	capability	capability	NOUN
iajs-3652	90	3	to	to	PART
iajs-3652	90	4	biofilm	biofilm	VERB
iajs-3652	90	5	formation	formation	NOUN
iajs-3652	90	6	the	the	DET
iajs-3652	90	7	findings	finding	NOUN
iajs-3652	90	8	of	of	ADP
iajs-3652	90	9	the	the	DET
iajs-3652	90	10	current	current	ADJ
iajs-3652	90	11	study	study	NOUN
iajs-3652	90	12	displayed	display	VERB
iajs-3652	90	13	moderate	moderate	ADJ
iajs-3652	90	14	ability	ability	NOUN
iajs-3652	90	15	to	to	PART
iajs-3652	90	16	form	form	VERB
iajs-3652	90	17	a	a	DET
iajs-3652	90	18	biofilm	biofilm	NOUN
iajs-3652	90	19	.	.	PUNCT
iajs-3652	91	1	this	this	DET
iajs-3652	91	2	result	result	NOUN
iajs-3652	91	3	was	be	AUX
iajs-3652	91	4	detected	detect	VERB
iajs-3652	91	5	by	by	ADP
iajs-3652	91	6	using	use	VERB
iajs-3652	91	7	the	the	DET
iajs-3652	91	8	congo	congo	NOUN
iajs-3652	91	9	red	red	ADJ
iajs-3652	91	10	method	method	NOUN
iajs-3652	91	11	to	to	PART
iajs-3652	91	12	detect	detect	VERB
iajs-3652	91	13	biofilm	biofilm	NOUN
iajs-3652	91	14	formation	formation	NOUN
iajs-3652	91	15	by	by	ADP
iajs-3652	91	16	e.	e.	PROPN
iajs-3652	91	17	coli	coli	PROPN
iajs-3652	91	18	bacteria	bacteria	NOUN
iajs-3652	91	19	clinically	clinically	ADV
iajs-3652	91	20	isolated	isolate	VERB
iajs-3652	91	21	,	,	PUNCT
iajs-3652	91	22	which	which	PRON
iajs-3652	91	23	showed	show	VERB
iajs-3652	91	24	moderate	moderate	ADJ
iajs-3652	91	25	ability	ability	NOUN
iajs-3652	91	26	to	to	PART
iajs-3652	91	27	form	form	VERB
iajs-3652	91	28	biofilm	biofilm	NOUN
iajs-3652	91	29	in	in	ADP
iajs-3652	91	30	all	all	DET
iajs-3652	91	31	11	11	NUM
iajs-3652	91	32	(	(	PUNCT
iajs-3652	91	33	100	100	NUM
iajs-3652	91	34	%	%	NOUN
iajs-3652	91	35	)	)	PUNCT
iajs-3652	91	36	selected	select	VERB
iajs-3652	91	37	isolates	isolate	NOUN
iajs-3652	91	38	.	.	PUNCT
iajs-3652	92	1	this	this	DET
iajs-3652	92	2	result	result	NOUN
iajs-3652	92	3	is	be	AUX
iajs-3652	92	4	shown	show	VERB
iajs-3652	92	5	in	in	ADP
iajs-3652	92	6	table	table	NOUN
iajs-3652	92	7	1	1	NUM
iajs-3652	92	8	.	.	NOUN
iajs-3652	92	9	0	0	NUM
iajs-3652	92	10	2	2	NUM
iajs-3652	92	11	4	4	NUM
iajs-3652	92	12	6	6	NUM
iajs-3652	92	13	8	8	NUM
iajs-3652	92	14	10	10	NUM
iajs-3652	92	15	12	12	NUM
iajs-3652	92	16	sensitive	sensitive	ADJ
iajs-3652	92	17	intermediate	intermediate	ADJ
iajs-3652	92	18	resistance	resistance	NOUN
iajs-3652	92	19	ihjpas	ihjpa	NOUN
iajs-3652	92	20	.	.	PUNCT
iajs-3652	93	1	2025	2025	NUM
iajs-3652	93	2	,	,	PUNCT
iajs-3652	93	3	38(3	38(3	NUM
iajs-3652	93	4	)	)	PUNCT
iajs-3652	93	5	109	109	NUM
iajs-3652	93	6	table	table	NOUN
iajs-3652	93	7	1	1	NUM
iajs-3652	93	8	.	.	PUNCT
iajs-3652	94	1	the	the	DET
iajs-3652	94	2	ability	ability	NOUN
iajs-3652	94	3	of	of	ADP
iajs-3652	94	4	e.coli	e.coli	NOUN
iajs-3652	94	5	to	to	ADP
iajs-3652	94	6	biofilm	biofilm	NOUN
iajs-3652	94	7	formation	formation	NOUN
iajs-3652	94	8	.	.	PUNCT
iajs-3652	95	1	no	no	INTJ
iajs-3652	95	2	.	.	PUNCT
iajs-3652	96	1	ability	ability	NOUN
iajs-3652	96	2	of	of	ADP
iajs-3652	96	3	biofilm	biofilm	NOUN
iajs-3652	96	4	formation	formation	NOUN
iajs-3652	96	5	7	7	NUM
iajs-3652	96	6	moderately	moderately	ADV
iajs-3652	96	7	32	32	NUM
iajs-3652	96	8	moderately	moderately	ADV
iajs-3652	96	9	67	67	NUM
iajs-3652	96	10	moderately	moderately	ADV
iajs-3652	96	11	13	13	NUM
iajs-3652	96	12	moderately	moderately	ADV
iajs-3652	96	13	80	80	NUM
iajs-3652	96	14	moderately	moderately	ADV
iajs-3652	96	15	43	43	NUM
iajs-3652	96	16	moderately	moderately	ADV
iajs-3652	96	17	14	14	NUM
iajs-3652	96	18	moderately	moderately	ADV
iajs-3652	96	19	88	88	NUM
iajs-3652	96	20	moderately	moderately	ADV
iajs-3652	96	21	65	65	NUM
iajs-3652	96	22	moderately	moderately	ADV
iajs-3652	96	23	40	40	NUM
iajs-3652	96	24	moderately	moderately	ADV
iajs-3652	96	25	51	51	NUM
iajs-3652	96	26	moderately	moderately	ADV
iajs-3652	96	27	a	a	DET
iajs-3652	96	28	variety	variety	NOUN
iajs-3652	96	29	of	of	ADP
iajs-3652	96	30	virulence	virulence	NOUN
iajs-3652	96	31	factors	factor	NOUN
iajs-3652	96	32	present	present	ADJ
iajs-3652	96	33	in	in	ADP
iajs-3652	96	34	e.	e.	PROPN
iajs-3652	96	35	coli	coli	PROPN
iajs-3652	96	36	,	,	PUNCT
iajs-3652	96	37	like	like	ADP
iajs-3652	96	38	adhesions	adhesion	NOUN
iajs-3652	96	39	,	,	PUNCT
iajs-3652	96	40	p	p	NOUN
iajs-3652	96	41	-	-	PUNCT
iajs-3652	96	42	fimbriae	fimbriae	NOUN
iajs-3652	96	43	,	,	PUNCT
iajs-3652	96	44	and	and	CCONJ
iajs-3652	96	45	additional	additional	ADJ
iajs-3652	96	46	mannose	mannose	NOUN
iajs-3652	96	47	-	-	PUNCT
iajs-3652	96	48	resistant	resistant	ADJ
iajs-3652	96	49	adhesions	adhesion	NOUN
iajs-3652	96	50	,	,	PUNCT
iajs-3652	96	51	offer	offer	VERB
iajs-3652	96	52	an	an	DET
iajs-3652	96	53	enhanced	enhanced	ADJ
iajs-3652	96	54	capacity	capacity	NOUN
iajs-3652	96	55	for	for	ADP
iajs-3652	96	56	adaptation	adaptation	NOUN
iajs-3652	96	57	to	to	PART
iajs-3652	96	58	novel	novel	VERB
iajs-3652	96	59	environments	environment	NOUN
iajs-3652	96	60	and	and	CCONJ
iajs-3652	96	61	enable	enable	VERB
iajs-3652	96	62	e.	e.	PROPN
iajs-3652	96	63	coli	coli	PROPN
iajs-3652	96	64	strains	strain	VERB
iajs-3652	96	65	to	to	PART
iajs-3652	96	66	cause	cause	VERB
iajs-3652	96	67	a	a	DET
iajs-3652	96	68	wide	wide	ADJ
iajs-3652	96	69	range	range	NOUN
iajs-3652	96	70	of	of	ADP
iajs-3652	96	71	diseases	disease	NOUN
iajs-3652	96	72	(	(	PUNCT
iajs-3652	96	73	21	21	NUM
iajs-3652	96	74	,	,	PUNCT
iajs-3652	96	75	22	22	NUM
iajs-3652	96	76	)	)	PUNCT
iajs-3652	96	77	.	.	PUNCT
iajs-3652	97	1	these	these	DET
iajs-3652	97	2	virulence	virulence	NOUN
iajs-3652	97	3	traits	trait	NOUN
iajs-3652	97	4	are	be	AUX
iajs-3652	97	5	typically	typically	ADV
iajs-3652	97	6	encoded	encode	VERB
iajs-3652	97	7	on	on	ADP
iajs-3652	97	8	genetic	genetic	ADJ
iajs-3652	97	9	components	component	NOUN
iajs-3652	97	10	,	,	PUNCT
iajs-3652	97	11	and	and	CCONJ
iajs-3652	97	12	they	they	PRON
iajs-3652	97	13	can	can	AUX
iajs-3652	97	14	be	be	AUX
iajs-3652	97	15	deployed	deploy	VERB
iajs-3652	97	16	in	in	ADP
iajs-3652	97	17	various	various	ADJ
iajs-3652	97	18	bacterial	bacterial	ADJ
iajs-3652	97	19	strains	strain	NOUN
iajs-3652	97	20	to	to	PART
iajs-3652	97	21	produce	produce	VERB
iajs-3652	97	22	original	original	ADJ
iajs-3652	97	23	virulence	virulence	NOUN
iajs-3652	97	24	factor	factor	NOUN
iajs-3652	97	25	permutations	permutation	NOUN
iajs-3652	97	26	.	.	PUNCT
iajs-3652	98	1	meanwhile	meanwhile	ADV
iajs-3652	98	2	,	,	PUNCT
iajs-3652	98	3	the	the	DET
iajs-3652	98	4	bacterial	bacterial	ADJ
iajs-3652	98	5	extracellular	extracellular	ADJ
iajs-3652	98	6	matrix	matrix	NOUN
iajs-3652	98	7	protects	protect	VERB
iajs-3652	98	8	against	against	ADP
iajs-3652	98	9	antimicrobial	antimicrobial	ADJ
iajs-3652	98	10	drugs	drug	NOUN
iajs-3652	98	11	that	that	PRON
iajs-3652	98	12	might	might	AUX
iajs-3652	98	13	cause	cause	VERB
iajs-3652	98	14	persistent	persistent	ADJ
iajs-3652	98	15	infections	infection	NOUN
iajs-3652	98	16	and	and	CCONJ
iajs-3652	98	17	treatment	treatment	NOUN
iajs-3652	98	18	issues	issue	NOUN
iajs-3652	98	19	,	,	PUNCT
iajs-3652	98	20	biofilm	biofilm	NOUN
iajs-3652	98	21	formation	formation	NOUN
iajs-3652	98	22	in	in	ADP
iajs-3652	98	23	e.	e.	PROPN
iajs-3652	98	24	coli	coli	PROPN
iajs-3652	98	25	is	be	AUX
iajs-3652	98	26	a	a	DET
iajs-3652	98	27	significant	significant	ADJ
iajs-3652	98	28	factor	factor	NOUN
iajs-3652	98	29	in	in	ADP
iajs-3652	98	30	60	60	NUM
iajs-3652	98	31	%	%	NOUN
iajs-3652	98	32	of	of	ADP
iajs-3652	98	33	the	the	DET
iajs-3652	98	34	severity	severity	NOUN
iajs-3652	98	35	of	of	ADP
iajs-3652	98	36	infection	infection	NOUN
iajs-3652	98	37	in	in	ADP
iajs-3652	98	38	people	people	NOUN
iajs-3652	98	39	and	and	CCONJ
iajs-3652	98	40	antibiotic	antibiotic	ADJ
iajs-3652	98	41	resistance	resistance	NOUN
iajs-3652	98	42	(	(	PUNCT
iajs-3652	98	43	23	23	NUM
iajs-3652	98	44	,	,	PUNCT
iajs-3652	98	45	24	24	NUM
iajs-3652	98	46	)	)	PUNCT
iajs-3652	98	47	.	.	PUNCT
iajs-3652	99	1	3.3	3.3	NUM
iajs-3652	99	2	.	.	PUNCT
iajs-3652	100	1	algd	algd	NOUN
iajs-3652	100	2	gene	gene	NOUN
iajs-3652	100	3	detection	detection	NOUN
iajs-3652	100	4	the	the	DET
iajs-3652	100	5	consequences	consequence	NOUN
iajs-3652	100	6	of	of	ADP
iajs-3652	100	7	the	the	DET
iajs-3652	100	8	molecular	molecular	ADJ
iajs-3652	100	9	identification	identification	NOUN
iajs-3652	100	10	of	of	ADP
iajs-3652	100	11	the	the	DET
iajs-3652	100	12	algd	algd	NOUN
iajs-3652	100	13	gene	gene	NOUN
iajs-3652	100	14	that	that	PRON
iajs-3652	100	15	add	add	VERB
iajs-3652	100	16	to	to	ADP
iajs-3652	100	17	the	the	DET
iajs-3652	100	18	development	development	NOUN
iajs-3652	100	19	of	of	ADP
iajs-3652	100	20	the	the	DET
iajs-3652	100	21	alginate	alginate	NOUN
iajs-3652	100	22	layer	layer	NOUN
iajs-3652	100	23	in	in	ADP
iajs-3652	100	24	e.coli	e.coli	NOUN
iajs-3652	100	25	were	be	AUX
iajs-3652	100	26	that	that	SCONJ
iajs-3652	100	27	nine	nine	NUM
iajs-3652	100	28	isolates	isolate	NOUN
iajs-3652	100	29	possessed	possess	VERB
iajs-3652	100	30	algd	algd	NOUN
iajs-3652	100	31	gene	gene	NOUN
iajs-3652	100	32	and	and	CCONJ
iajs-3652	100	33	only	only	ADV
iajs-3652	100	34	two	two	NUM
iajs-3652	100	35	isolates	isolate	NOUN
iajs-3652	100	36	did	do	AUX
iajs-3652	100	37	not	not	PART
iajs-3652	100	38	possess	possess	VERB
iajs-3652	100	39	the	the	DET
iajs-3652	100	40	algd	algd	NOUN
iajs-3652	100	41	gene	gene	NOUN
iajs-3652	100	42	.	.	PUNCT
iajs-3652	101	1	these	these	DET
iajs-3652	101	2	results	result	NOUN
iajs-3652	101	3	are	be	AUX
iajs-3652	101	4	shown	show	VERB
iajs-3652	101	5	in	in	ADP
iajs-3652	101	6	table	table	NOUN
iajs-3652	101	7	(	(	PUNCT
iajs-3652	101	8	2	2	NUM
iajs-3652	101	9	)	)	PUNCT
iajs-3652	101	10	and	and	CCONJ
iajs-3652	101	11	figure	figure	NOUN
iajs-3652	101	12	(	(	PUNCT
iajs-3652	101	13	2	2	NUM
iajs-3652	101	14	.	.	PUNCT
iajs-3652	101	15	)	)	PUNCT
iajs-3652	102	1	3.4	3.4	NUM
iajs-3652	102	2	.	.	PUNCT
iajs-3652	103	1	detection	detection	NOUN
iajs-3652	103	2	of	of	ADP
iajs-3652	103	3	tspe4.c2	tspe4.c2	NOUN
iajs-3652	103	4	gene	gene	NOUN
iajs-3652	103	5	phylogenetic	phylogenetic	ADJ
iajs-3652	103	6	analysis	analysis	NOUN
iajs-3652	103	7	was	be	AUX
iajs-3652	103	8	finished	finish	VERB
iajs-3652	103	9	by	by	ADP
iajs-3652	103	10	pcr	pcr	ADJ
iajs-3652	103	11	technique	technique	NOUN
iajs-3652	103	12	in	in	ADP
iajs-3652	103	13	light	light	NOUN
iajs-3652	103	14	of	of	ADP
iajs-3652	103	15	the	the	DET
iajs-3652	103	16	preserved	preserve	VERB
iajs-3652	103	17	gene	gene	NOUN
iajs-3652	103	18	tspe4.c2	tspe4.c2	PROPN
iajs-3652	103	19	dna	dna	PROPN
iajs-3652	103	20	fragment	fragment	NOUN
iajs-3652	103	21	.	.	PUNCT
iajs-3652	104	1	the	the	DET
iajs-3652	104	2	consequences	consequence	NOUN
iajs-3652	104	3	of	of	ADP
iajs-3652	104	4	the	the	DET
iajs-3652	104	5	recent	recent	ADJ
iajs-3652	104	6	study	study	NOUN
iajs-3652	104	7	displayed	display	VERB
iajs-3652	104	8	the	the	DET
iajs-3652	104	9	incidence	incidence	NOUN
iajs-3652	104	10	of	of	ADP
iajs-3652	104	11	this	this	DET
iajs-3652	104	12	gene	gene	NOUN
iajs-3652	104	13	in	in	ADP
iajs-3652	104	14	10	10	NUM
iajs-3652	104	15	of	of	ADP
iajs-3652	104	16	the	the	DET
iajs-3652	104	17	11	11	NUM
iajs-3652	104	18	clinically	clinically	ADV
iajs-3652	104	19	isolated	isolate	VERB
iajs-3652	104	20	escherichia	escherichia	NOUN
iajs-3652	104	21	coli	coli	NOUN
iajs-3652	104	22	isolates	isolate	NOUN
iajs-3652	104	23	from	from	ADP
iajs-3652	104	24	iraqi	iraqi	ADJ
iajs-3652	104	25	patients	patient	NOUN
iajs-3652	104	26	with	with	ADP
iajs-3652	104	27	urinary	urinary	ADJ
iajs-3652	104	28	tract	tract	NOUN
iajs-3652	104	29	infection	infection	NOUN
iajs-3652	104	30	,	,	PUNCT
iajs-3652	104	31	as	as	SCONJ
iajs-3652	104	32	shown	show	VERB
iajs-3652	104	33	in	in	ADP
iajs-3652	104	34	table	table	NOUN
iajs-3652	104	35	(	(	PUNCT
iajs-3652	104	36	2	2	NUM
iajs-3652	104	37	)	)	PUNCT
iajs-3652	104	38	and	and	CCONJ
iajs-3652	104	39	figure	figure	NOUN
iajs-3652	104	40	(	(	PUNCT
iajs-3652	104	41	3	3	NUM
iajs-3652	104	42	)	)	PUNCT
iajs-3652	104	43	.	.	PUNCT
iajs-3652	105	1	table	table	NOUN
iajs-3652	105	2	2	2	NUM
iajs-3652	105	3	.	.	PUNCT
iajs-3652	105	4	pcr	pcr	ADJ
iajs-3652	105	5	product	product	NOUN
iajs-3652	105	6	the	the	DET
iajs-3652	105	7	size	size	NOUN
iajs-3652	105	8	of	of	ADP
iajs-3652	105	9	band	band	NOUN
iajs-3652	105	10	1310	1310	NUM
iajs-3652	105	11	bp	bp	PROPN
iajs-3652	105	12	algd	algd	NOUN
iajs-3652	105	13	and	and	CCONJ
iajs-3652	105	14	band	band	VERB
iajs-3652	105	15	152	152	NUM
iajs-3652	105	16	bp	bp	PROPN
iajs-3652	105	17	tspe4.c2	tspe4.c2	NOUN
iajs-3652	105	18	by	by	ADP
iajs-3652	105	19	electrophoresis	electrophoresis	NOUN
iajs-3652	105	20	on	on	ADP
iajs-3652	105	21	condition	condition	NOUN
iajs-3652	105	22	2	2	NUM
iajs-3652	105	23	%	%	NOUN
iajs-3652	105	24	agarose	agarose	NOUN
iajs-3652	105	25	at	at	ADP
iajs-3652	105	26	5	5	NUM
iajs-3652	105	27	volt	volt	NOUN
iajs-3652	105	28	/	/	SYM
iajs-3652	105	29	cm	cm	NOUN
iajs-3652	105	30	2	2	NUM
iajs-3652	105	31	.	.	PUNCT
iajs-3652	106	1	no	no	INTJ
iajs-3652	106	2	.	.	PUNCT
iajs-3652	107	1	of	of	ADP
iajs-3652	107	2	sample	sample	NOUN
iajs-3652	107	3	i	i	PROPN
iajs-3652	107	4	d	d	PROPN
iajs-3652	107	5	dna	dna	PROPN
iajs-3652	107	6	result	result	VERB
iajs-3652	107	7	algd	algd	NOUN
iajs-3652	107	8	/	/	SYM
iajs-3652	107	9	1310bp	1310bp	ADJ
iajs-3652	107	10	tspe4.c2	tspe4.c2	NOUN
iajs-3652	107	11	/152bp	/152bp	NOUN
iajs-3652	107	12	7	7	NUM
iajs-3652	107	13	32	32	NUM
iajs-3652	107	14	(	(	PUNCT
iajs-3652	107	15	1	1	NUM
iajs-3652	107	16	)	)	PUNCT
iajs-3652	107	17	+	+	PUNCT
iajs-3652	108	1	+	+	PUNCT
iajs-3652	108	2	+	+	NUM
iajs-3652	108	3	32	32	NUM
iajs-3652	108	4	43	43	NUM
iajs-3652	109	1	+	+	CCONJ
iajs-3652	109	2	+	+	PUNCT
iajs-3652	109	3	+	+	NUM
iajs-3652	109	4	67	67	NUM
iajs-3652	109	5	88	88	NUM
iajs-3652	109	6	+	+	CCONJ
iajs-3652	109	7	+	+	PUNCT
iajs-3652	109	8	+	+	NUM
iajs-3652	109	9	13	13	NUM
iajs-3652	109	10	14	14	NUM
iajs-3652	110	1	+	+	CCONJ
iajs-3652	110	2	+	+	PUNCT
iajs-3652	110	3	+	+	NUM
iajs-3652	110	4	80	80	NUM
iajs-3652	110	5	65	65	NUM
iajs-3652	111	1	+	+	CCONJ
iajs-3652	111	2	+	+	PUNCT
iajs-3652	111	3	+	+	NUM
iajs-3652	111	4	43	43	NUM
iajs-3652	111	5	10	10	NUM
iajs-3652	112	1	+	+	CCONJ
iajs-3652	113	1	+	+	PUNCT
iajs-3652	113	2	+	+	NUM
iajs-3652	113	3	14	14	NUM
iajs-3652	113	4	32	32	NUM
iajs-3652	113	5	(	(	PUNCT
iajs-3652	113	6	2	2	NUM
iajs-3652	113	7	)	)	PUNCT
iajs-3652	114	1	+	+	PUNCT
iajs-3652	115	1	+	+	CCONJ
iajs-3652	115	2	88	88	NUM
iajs-3652	115	3	40	40	NUM
iajs-3652	115	4	+	+	CCONJ
iajs-3652	115	5	+	+	CCONJ
iajs-3652	115	6	65	65	NUM
iajs-3652	115	7	51	51	NUM
iajs-3652	115	8	+	+	CCONJ
iajs-3652	115	9	+	+	CCONJ
iajs-3652	115	10	+	+	NUM
iajs-3652	115	11	40	40	NUM
iajs-3652	115	12	67	67	NUM
iajs-3652	116	1	+	+	CCONJ
iajs-3652	116	2	+	+	PUNCT
iajs-3652	116	3	+	+	NUM
iajs-3652	116	4	51	51	NUM
iajs-3652	116	5	12	12	NUM
iajs-3652	116	6	+	+	CCONJ
iajs-3652	116	7	+	+	CCONJ
iajs-3652	116	8	algd	algd	NOUN
iajs-3652	116	9	gene	gene	NOUN
iajs-3652	116	10	was	be	AUX
iajs-3652	116	11	found	find	VERB
iajs-3652	116	12	in	in	ADP
iajs-3652	116	13	9	9	NUM
iajs-3652	116	14	(	(	PUNCT
iajs-3652	116	15	81.8	81.8	NUM
iajs-3652	116	16	%	%	NOUN
iajs-3652	116	17	)	)	PUNCT
iajs-3652	116	18	isolates	isolate	VERB
iajs-3652	116	19	tspe4.c2	tspe4.c2	NOUN
iajs-3652	116	20	gene	gene	NOUN
iajs-3652	116	21	was	be	AUX
iajs-3652	116	22	presence	presence	NOUN
iajs-3652	116	23	in	in	ADP
iajs-3652	116	24	10	10	NUM
iajs-3652	116	25	(	(	PUNCT
iajs-3652	116	26	90.9	90.9	NUM
iajs-3652	116	27	%	%	NOUN
iajs-3652	116	28	)	)	PUNCT
iajs-3652	116	29	isolates	isolate	NOUN
iajs-3652	116	30	ihjpas	ihjpa	NOUN
iajs-3652	116	31	.	.	PUNCT
iajs-3652	117	1	2025	2025	NUM
iajs-3652	117	2	,	,	PUNCT
iajs-3652	117	3	38(3	38(3	NUM
iajs-3652	117	4	)	)	PUNCT
iajs-3652	117	5	110	110	NUM
iajs-3652	117	6	figure	figure	NOUN
iajs-3652	117	7	2	2	NUM
iajs-3652	117	8	.	.	PUNCT
iajs-3652	117	9	pcr	pcr	ADJ
iajs-3652	117	10	product	product	NOUN
iajs-3652	117	11	the	the	DET
iajs-3652	117	12	size	size	NOUN
iajs-3652	117	13	of	of	ADP
iajs-3652	117	14	band	band	NOUN
iajs-3652	117	15	1310	1310	NUM
iajs-3652	117	16	bp	bp	PROPN
iajs-3652	117	17	(	(	PUNCT
iajs-3652	117	18	algd	algd	PROPN
iajs-3652	117	19	)	)	PUNCT
iajs-3652	117	20	.	.	PUNCT
iajs-3652	118	1	the	the	DET
iajs-3652	118	2	product	product	NOUN
iajs-3652	118	3	was	be	AUX
iajs-3652	118	4	electrophoresis	electrophoresis	NOUN
iajs-3652	118	5	on	on	ADP
iajs-3652	118	6	condition	condition	NOUN
iajs-3652	118	7	2	2	NUM
iajs-3652	118	8	%	%	NOUN
iajs-3652	118	9	agarose	agarose	NOUN
iajs-3652	118	10	at	at	ADP
iajs-3652	118	11	5	5	NUM
iajs-3652	118	12	volt	volt	NOUN
iajs-3652	118	13	/	/	SYM
iajs-3652	118	14	cm	cm	NOUN
iajs-3652	118	15	2	2	NUM
iajs-3652	118	16	.1x	.1x	PUNCT
iajs-3652	118	17	tbe	tbe	VERB
iajs-3652	118	18	buffer	buffer	NOUN
iajs-3652	118	19	for	for	ADP
iajs-3652	118	20	1hr	1hr	NOUN
iajs-3652	118	21	.	.	PUNCT
iajs-3652	119	1	n	n	CCONJ
iajs-3652	119	2	:	:	PUNCT
iajs-3652	119	3	dna	dna	NOUN
iajs-3652	119	4	ladder	ladder	NOUN
iajs-3652	119	5	(	(	PUNCT
iajs-3652	119	6	100	100	NUM
iajs-3652	119	7	base	base	NOUN
iajs-3652	119	8	pair	pair	NOUN
iajs-3652	119	9	)	)	PUNCT
iajs-3652	119	10	.	.	PUNCT
iajs-3652	120	1	figure	figure	NOUN
iajs-3652	120	2	2	2	NUM
iajs-3652	120	3	.	.	PUNCT
iajs-3652	120	4	pcr	pcr	ADJ
iajs-3652	120	5	product	product	NOUN
iajs-3652	120	6	the	the	DET
iajs-3652	120	7	size	size	NOUN
iajs-3652	120	8	of	of	ADP
iajs-3652	120	9	band	band	NOUN
iajs-3652	120	10	152	152	NUM
iajs-3652	120	11	bp	bp	PROPN
iajs-3652	120	12	(	(	PUNCT
iajs-3652	120	13	tspe4.c2	tspe4.c2	PROPN
iajs-3652	120	14	)	)	PUNCT
iajs-3652	120	15	.	.	PUNCT
iajs-3652	121	1	the	the	DET
iajs-3652	121	2	product	product	NOUN
iajs-3652	121	3	was	be	AUX
iajs-3652	121	4	electrophoresis	electrophoresis	NOUN
iajs-3652	121	5	on	on	ADP
iajs-3652	121	6	condition	condition	NOUN
iajs-3652	121	7	2	2	NUM
iajs-3652	121	8	%	%	NOUN
iajs-3652	121	9	agarose	agarose	NOUN
iajs-3652	121	10	at	at	ADP
iajs-3652	121	11	5	5	NUM
iajs-3652	121	12	volt	volt	NOUN
iajs-3652	121	13	/	/	SYM
iajs-3652	121	14	cm	cm	NOUN
iajs-3652	121	15	2	2	NUM
iajs-3652	121	16	.	.	PUNCT
iajs-3652	122	1	1x	1x	PROPN
iajs-3652	122	2	tbe	tbe	VERB
iajs-3652	122	3	buffer	buffer	NOUN
iajs-3652	122	4	for	for	ADP
iajs-3652	122	5	1hr	1hr	NOUN
iajs-3652	122	6	.	.	PUNCT
iajs-3652	123	1	was	be	AUX
iajs-3652	123	2	done	do	VERB
iajs-3652	123	3	for	for	ADP
iajs-3652	123	4	m	m	PROPN
iajs-3652	123	5	:	:	PUNCT
iajs-3652	123	6	dna	dna	NOUN
iajs-3652	123	7	ladder	ladder	NOUN
iajs-3652	123	8	(	(	PUNCT
iajs-3652	123	9	100	100	NUM
iajs-3652	123	10	base	base	NOUN
iajs-3652	123	11	pair	pair	NOUN
iajs-3652	123	12	)	)	PUNCT
iajs-3652	123	13	.	.	PUNCT
iajs-3652	124	1	4.discussion	4.discussion	NUM
iajs-3652	124	2	alginates	alginate	NOUN
iajs-3652	124	3	are	be	AUX
iajs-3652	124	4	polysaccharides	polysaccharide	NOUN
iajs-3652	124	5	that	that	PRON
iajs-3652	124	6	are	be	AUX
iajs-3652	124	7	viscous	viscous	ADJ
iajs-3652	124	8	.	.	PUNCT
iajs-3652	125	1	two	two	NUM
iajs-3652	125	2	bacterial	bacterial	ADJ
iajs-3652	125	3	taxa	taxa	NOUN
iajs-3652	125	4	,	,	PUNCT
iajs-3652	125	5	pseudomonas	pseudomona	NOUN
iajs-3652	125	6	and	and	CCONJ
iajs-3652	125	7	azotobacter	azotobacter	NOUN
iajs-3652	125	8	,	,	PUNCT
iajs-3652	125	9	can	can	AUX
iajs-3652	125	10	produce	produce	VERB
iajs-3652	125	11	alginate	alginate	NOUN
iajs-3652	125	12	as	as	ADP
iajs-3652	125	13	an	an	DET
iajs-3652	125	14	exopolysaccharide	exopolysaccharide	NOUN
iajs-3652	125	15	during	during	ADP
iajs-3652	125	16	biofilm	biofilm	NOUN
iajs-3652	125	17	formation	formation	NOUN
iajs-3652	125	18	.	.	PUNCT
iajs-3652	126	1	it	it	PRON
iajs-3652	126	2	stops	stop	VERB
iajs-3652	126	3	both	both	CCONJ
iajs-3652	126	4	opsonic	opsonic	ADJ
iajs-3652	126	5	and	and	CCONJ
iajs-3652	126	6	non	non	ADJ
iajs-3652	126	7	-	-	ADJ
iajs-3652	126	8	opsonic	opsonic	ADJ
iajs-3652	126	9	phagocytosis	phagocytosis	NOUN
iajs-3652	126	10	,	,	PUNCT
iajs-3652	126	11	defending	defend	VERB
iajs-3652	126	12	the	the	DET
iajs-3652	126	13	bacterial	bacterial	ADJ
iajs-3652	126	14	cell	cell	NOUN
iajs-3652	126	15	from	from	ADP
iajs-3652	126	16	the	the	DET
iajs-3652	126	17	host	host	NOUN
iajs-3652	126	18	's	's	PART
iajs-3652	126	19	inflammatory	inflammatory	ADJ
iajs-3652	126	20	reaction	reaction	NOUN
iajs-3652	126	21	.	.	PUNCT
iajs-3652	127	1	a	a	DET
iajs-3652	127	2	big	big	ADJ
iajs-3652	127	3	group	group	NOUN
iajs-3652	127	4	of	of	ADP
iajs-3652	127	5	genes	gene	NOUN
iajs-3652	127	6	at	at	ADP
iajs-3652	127	7	position	position	NOUN
iajs-3652	127	8	34	34	NUM
iajs-3652	127	9	min	min	NOUN
iajs-3652	127	10	on	on	ADP
iajs-3652	127	11	the	the	DET
iajs-3652	127	12	p.	p.	NOUN
iajs-3652	127	13	aeruginosa	aeruginosa	PROPN
iajs-3652	127	14	chromosomal	chromosomal	ADJ
iajs-3652	127	15	map	map	NOUN
iajs-3652	127	16	make	make	VERB
iajs-3652	127	17	up	up	ADP
iajs-3652	127	18	most	most	ADJ
iajs-3652	127	19	of	of	ADP
iajs-3652	127	20	the	the	DET
iajs-3652	127	21	enzymes	enzyme	NOUN
iajs-3652	127	22	that	that	PRON
iajs-3652	127	23	are	be	AUX
iajs-3652	127	24	used	use	VERB
iajs-3652	127	25	to	to	PART
iajs-3652	127	26	make	make	VERB
iajs-3652	127	27	alginate	alginate	NOUN
iajs-3652	127	28	polymers	polymer	NOUN
iajs-3652	127	29	and	and	CCONJ
iajs-3652	127	30	change	change	VERB
iajs-3652	127	31	them	they	PRON
iajs-3652	127	32	.	.	PUNCT
iajs-3652	128	1	numerous	numerous	ADJ
iajs-3652	128	2	genes	gene	NOUN
iajs-3652	128	3	,	,	PUNCT
iajs-3652	128	4	whose	whose	DET
iajs-3652	128	5	products	product	NOUN
iajs-3652	128	6	are	be	AUX
iajs-3652	128	7	located	locate	VERB
iajs-3652	128	8	in	in	ADP
iajs-3652	128	9	the	the	DET
iajs-3652	128	10	9	9	NUM
iajs-3652	128	11	to	to	PART
iajs-3652	128	12	13	13	NUM
iajs-3652	128	13	min	min	NOUN
iajs-3652	128	14	region	region	NOUN
iajs-3652	128	15	of	of	ADP
iajs-3652	128	16	the	the	DET
iajs-3652	128	17	chromosome	chromosome	NOUN
iajs-3652	128	18	,	,	PUNCT
iajs-3652	128	19	transcriptionally	transcriptionally	ADV
iajs-3652	128	20	control	control	VERB
iajs-3652	128	21	this	this	DET
iajs-3652	128	22	process	process	NOUN
iajs-3652	128	23	.	.	PUNCT
iajs-3652	129	1	algr	algr	NOUN
iajs-3652	129	2	and	and	CCONJ
iajs-3652	129	3	algb	algb	PROPN
iajs-3652	129	4	,	,	PUNCT
iajs-3652	129	5	two	two	NUM
iajs-3652	129	6	homologous	homologous	ADJ
iajs-3652	129	7	genes	gene	NOUN
iajs-3652	129	8	,	,	PUNCT
iajs-3652	129	9	algp	algp	PROPN
iajs-3652	129	10	,	,	PUNCT
iajs-3652	129	11	a	a	DET
iajs-3652	129	12	histone	histone	NOUN
iajs-3652	129	13	-	-	PUNCT
iajs-3652	129	14	like	like	ADJ
iajs-3652	129	15	protein	protein	NOUN
iajs-3652	129	16	,	,	PUNCT
iajs-3652	129	17	algq	algq	NOUN
iajs-3652	129	18	,	,	PUNCT
iajs-3652	129	19	and	and	CCONJ
iajs-3652	129	20	algu	algu	PROPN
iajs-3652	129	21	are	be	AUX
iajs-3652	129	22	all	all	PRON
iajs-3652	129	23	included	include	VERB
iajs-3652	129	24	.	.	PUNCT
iajs-3652	130	1	the	the	DET
iajs-3652	130	2	crucial	crucial	ADJ
iajs-3652	130	3	algd	algd	NOUN
iajs-3652	130	4	gene	gene	NOUN
iajs-3652	130	5	encodes	encodes	PRON
iajs-3652	130	6	gdp	gdp	NOUN
iajs-3652	130	7	-	-	PUNCT
iajs-3652	130	8	mannose	mannose	NOUN
iajs-3652	130	9	dehydrogenase	dehydrogenase	NOUN
iajs-3652	130	10	,	,	PUNCT
iajs-3652	130	11	and	and	CCONJ
iajs-3652	130	12	these	these	DET
iajs-3652	130	13	genes	gene	NOUN
iajs-3652	130	14	influence	influence	VERB
iajs-3652	130	15	its	its	PRON
iajs-3652	130	16	expression	expression	NOUN
iajs-3652	130	17	.	.	PUNCT
iajs-3652	131	1	alginate	alginate	NOUN
iajs-3652	131	2	is	be	AUX
iajs-3652	131	3	also	also	ADV
iajs-3652	131	4	known	know	VERB
iajs-3652	131	5	as	as	ADP
iajs-3652	131	6	mep	mep	PROPN
iajs-3652	131	7	(	(	PUNCT
iajs-3652	131	8	mucoid	mucoid	ADJ
iajs-3652	131	9	exopolysaccharide	exopolysaccharide	PROPN
iajs-3652	131	10	)	)	PUNCT
iajs-3652	131	11	.	.	PUNCT
iajs-3652	132	1	when	when	SCONJ
iajs-3652	132	2	cultivated	cultivate	VERB
iajs-3652	132	3	on	on	ADP
iajs-3652	132	4	solid	solid	ADJ
iajs-3652	132	5	media	medium	NOUN
iajs-3652	132	6	in	in	ADP
iajs-3652	132	7	the	the	DET
iajs-3652	132	8	lab	lab	NOUN
iajs-3652	132	9	,	,	PUNCT
iajs-3652	132	10	p.	p.	NOUN
iajs-3652	132	11	aeruginosa	aeruginosa	NOUN
iajs-3652	132	12	that	that	PRON
iajs-3652	132	13	has	have	VERB
iajs-3652	132	14	this	this	DET
iajs-3652	132	15	polysaccharide	polysaccharide	NOUN
iajs-3652	132	16	overexpressed	overexpresse	VERB
iajs-3652	132	17	has	have	VERB
iajs-3652	132	18	a	a	DET
iajs-3652	132	19	mucoid	mucoid	ADJ
iajs-3652	132	20	look	look	NOUN
iajs-3652	132	21	(	(	PUNCT
iajs-3652	132	22	25	25	NUM
iajs-3652	132	23	)	)	PUNCT
iajs-3652	132	24	.	.	PUNCT
iajs-3652	133	1	previous	previous	ADJ
iajs-3652	133	2	studies	study	NOUN
iajs-3652	133	3	demonstrated	demonstrate	VERB
iajs-3652	133	4	that	that	SCONJ
iajs-3652	133	5	pseudomonas	pseudomona	NOUN
iajs-3652	133	6	aeruginosa	aeruginosa	NOUN
iajs-3652	133	7	produced	produce	VERB
iajs-3652	133	8	the	the	DET
iajs-3652	133	9	algd	algd	NOUN
iajs-3652	133	10	gene	gene	NOUN
iajs-3652	133	11	(	(	PUNCT
iajs-3652	133	12	26	26	NUM
iajs-3652	133	13	)	)	PUNCT
iajs-3652	133	14	.	.	PUNCT
iajs-3652	134	1	in	in	ADP
iajs-3652	134	2	the	the	DET
iajs-3652	134	3	current	current	ADJ
iajs-3652	134	4	study	study	NOUN
iajs-3652	134	5	,	,	PUNCT
iajs-3652	134	6	e.	e.	PROPN
iajs-3652	134	7	coli	coli	PROPN
iajs-3652	134	8	production	production	NOUN
iajs-3652	134	9	of	of	ADP
iajs-3652	134	10	algd	algd	NOUN
iajs-3652	134	11	was	be	AUX
iajs-3652	134	12	determined	determine	VERB
iajs-3652	134	13	in	in	ADP
iajs-3652	134	14	most	most	ADJ
iajs-3652	134	15	isolates	isolate	NOUN
iajs-3652	134	16	taken	take	VERB
iajs-3652	134	17	clinically	clinically	ADV
iajs-3652	134	18	from	from	ADP
iajs-3652	134	19	iraqi	iraqi	ADJ
iajs-3652	134	20	patients	patient	NOUN
iajs-3652	134	21	,	,	PUNCT
iajs-3652	134	22	which	which	PRON
iajs-3652	134	23	reinforces	reinforce	VERB
iajs-3652	134	24	the	the	DET
iajs-3652	134	25	idea	idea	NOUN
iajs-3652	134	26	of	of	ADP
iajs-3652	134	27	virulence	virulence	NOUN
iajs-3652	134	28	factors	factor	NOUN
iajs-3652	134	29	for	for	ADP
iajs-3652	134	30	this	this	DET
iajs-3652	134	31	bacteria	bacteria	NOUN
iajs-3652	134	32	acquired	acquire	VERB
iajs-3652	134	33	from	from	ADP
iajs-3652	134	34	other	other	ADJ
iajs-3652	134	35	bacterial	bacterial	ADJ
iajs-3652	134	36	strains	strain	NOUN
iajs-3652	134	37	and	and	CCONJ
iajs-3652	134	38	types	type	NOUN
iajs-3652	134	39	.	.	PUNCT
iajs-3652	135	1	these	these	DET
iajs-3652	135	2	findings	finding	NOUN
iajs-3652	135	3	were	be	AUX
iajs-3652	135	4	consistent	consistent	ADJ
iajs-3652	135	5	with	with	ADP
iajs-3652	135	6	a	a	DET
iajs-3652	135	7	recent	recent	ADJ
iajs-3652	135	8	study	study	NOUN
iajs-3652	135	9	that	that	PRON
iajs-3652	135	10	suggested	suggest	VERB
iajs-3652	135	11	that	that	SCONJ
iajs-3652	135	12	the	the	DET
iajs-3652	135	13	ability	ability	NOUN
iajs-3652	135	14	of	of	ADP
iajs-3652	135	15	e.coli	e.coli	NOUN
iajs-3652	135	16	to	to	PART
iajs-3652	135	17	form	form	VERB
iajs-3652	135	18	biofilm	biofilm	NOUN
iajs-3652	135	19	,	,	PUNCT
iajs-3652	135	20	which	which	PRON
iajs-3652	135	21	is	be	AUX
iajs-3652	135	22	the	the	DET
iajs-3652	135	23	first	first	ADJ
iajs-3652	135	24	step	step	NOUN
iajs-3652	135	25	in	in	ADP
iajs-3652	135	26	the	the	DET
iajs-3652	135	27	emergence	emergence	NOUN
iajs-3652	135	28	of	of	ADP
iajs-3652	135	29	antibiotic	antibiotic	ADJ
iajs-3652	135	30	resistance	resistance	NOUN
iajs-3652	135	31	and	and	CCONJ
iajs-3652	135	32	is	be	AUX
iajs-3652	135	33	ihjpas	ihjpa	NOUN
iajs-3652	135	34	.	.	PUNCT
iajs-3652	136	1	2025	2025	NUM
iajs-3652	136	2	,	,	PUNCT
iajs-3652	136	3	38(3	38(3	NUM
iajs-3652	136	4	)	)	PUNCT
iajs-3652	136	5	111	111	NUM
iajs-3652	136	6	accomplished	accomplish	VERB
iajs-3652	136	7	through	through	ADP
iajs-3652	136	8	the	the	DET
iajs-3652	136	9	mechanisms	mechanism	NOUN
iajs-3652	136	10	of	of	ADP
iajs-3652	136	11	transport	transport	NOUN
iajs-3652	136	12	of	of	ADP
iajs-3652	136	13	antibiotics	antibiotic	NOUN
iajs-3652	136	14	resistance	resistance	NOUN
iajs-3652	136	15	genes	gene	NOUN
iajs-3652	136	16	and	and	CCONJ
iajs-3652	136	17	communication	communication	NOUN
iajs-3652	136	18	between	between	ADP
iajs-3652	136	19	cells	cell	NOUN
iajs-3652	136	20	as	as	ADV
iajs-3652	136	21	well	well	ADV
iajs-3652	136	22	as	as	ADP
iajs-3652	136	23	the	the	DET
iajs-3652	136	24	mechanisms	mechanism	NOUN
iajs-3652	136	25	of	of	ADP
iajs-3652	136	26	the	the	DET
iajs-3652	136	27	sensor	sensor	NOUN
iajs-3652	136	28	(	(	PUNCT
iajs-3652	136	29	qs	qs	NOUN
iajs-3652	136	30	)	)	PUNCT
iajs-3652	136	31	,	,	PUNCT
iajs-3652	136	32	is	be	AUX
iajs-3652	136	33	a	a	DET
iajs-3652	136	34	major	major	ADJ
iajs-3652	136	35	factor	factor	NOUN
iajs-3652	136	36	in	in	ADP
iajs-3652	136	37	the	the	DET
iajs-3652	136	38	development	development	NOUN
iajs-3652	136	39	of	of	ADP
iajs-3652	136	40	antibiotic	antibiotic	ADJ
iajs-3652	136	41	resistance	resistance	NOUN
iajs-3652	136	42	(	(	PUNCT
iajs-3652	136	43	27	27	NUM
iajs-3652	136	44	)	)	PUNCT
iajs-3652	136	45	.	.	PUNCT
iajs-3652	137	1	the	the	DET
iajs-3652	137	2	new	new	ADJ
iajs-3652	137	3	work	work	NOUN
iajs-3652	137	4	uses	use	VERB
iajs-3652	137	5	pcr	pcr	PROPN
iajs-3652	137	6	in	in	ADP
iajs-3652	137	7	the	the	DET
iajs-3652	137	8	same	same	ADJ
iajs-3652	137	9	manner	manner	NOUN
iajs-3652	137	10	as	as	SCONJ
iajs-3652	137	11	earlier	early	ADJ
iajs-3652	137	12	studies	study	NOUN
iajs-3652	137	13	to	to	PART
iajs-3652	137	14	identify	identify	VERB
iajs-3652	137	15	phylogenetic	phylogenetic	ADJ
iajs-3652	137	16	groups	group	NOUN
iajs-3652	137	17	of	of	ADP
iajs-3652	137	18	escherichia	escherichia	NOUN
iajs-3652	137	19	coli	coli	NOUN
iajs-3652	137	20	.	.	PUNCT
iajs-3652	138	1	as	as	ADP
iajs-3652	138	2	a	a	DET
iajs-3652	138	3	single	single	ADJ
iajs-3652	138	4	gene	gene	NOUN
iajs-3652	138	5	responsible	responsible	ADJ
iajs-3652	138	6	for	for	ADP
iajs-3652	138	7	the	the	DET
iajs-3652	138	8	phylogenetic	phylogenetic	ADJ
iajs-3652	138	9	grouping	grouping	NOUN
iajs-3652	138	10	of	of	ADP
iajs-3652	138	11	e.	e.	PROPN
iajs-3652	138	12	coli	coli	NOUN
iajs-3652	138	13	bacteria	bacteria	NOUN
iajs-3652	138	14	(	(	PUNCT
iajs-3652	138	15	a	a	DET
iajs-3652	138	16	,	,	PUNCT
iajs-3652	138	17	b1	b1	NOUN
iajs-3652	138	18	,	,	PUNCT
iajs-3652	138	19	b2	b2	NOUN
iajs-3652	138	20	and	and	CCONJ
iajs-3652	138	21	d	d	NOUN
iajs-3652	138	22	)	)	PUNCT
iajs-3652	138	23	,	,	PUNCT
iajs-3652	138	24	the	the	DET
iajs-3652	138	25	genomic	genomic	ADJ
iajs-3652	138	26	dna	dna	NOUN
iajs-3652	138	27	of	of	ADP
iajs-3652	138	28	isolated	isolate	VERB
iajs-3652	138	29	strains	strain	NOUN
iajs-3652	138	30	was	be	AUX
iajs-3652	138	31	amplified	amplify	VERB
iajs-3652	138	32	through	through	ADP
iajs-3652	138	33	triplicate	triplicate	NOUN
iajs-3652	138	34	pcr	pcr	ADJ
iajs-3652	138	35	utilizing	utilizing	NOUN
iajs-3652	138	36	targeted	target	VERB
iajs-3652	138	37	primers	primer	NOUN
iajs-3652	138	38	marker	marker	NOUN
iajs-3652	138	39	,	,	PUNCT
iajs-3652	138	40	tspe4.c2	tspe4.c2	NOUN
iajs-3652	138	41	(	(	PUNCT
iajs-3652	138	42	21	21	NUM
iajs-3652	138	43	,	,	PUNCT
iajs-3652	138	44	24	24	NUM
iajs-3652	138	45	,	,	PUNCT
iajs-3652	138	46	28	28	NUM
iajs-3652	138	47	)	)	PUNCT
iajs-3652	138	48	.	.	PUNCT
iajs-3652	139	1	it	it	PRON
iajs-3652	139	2	is	be	AUX
iajs-3652	139	3	well	well	ADV
iajs-3652	139	4	known	know	VERB
iajs-3652	139	5	that	that	SCONJ
iajs-3652	139	6	there	there	PRON
iajs-3652	139	7	are	be	VERB
iajs-3652	139	8	several	several	ADJ
iajs-3652	139	9	different	different	ADJ
iajs-3652	139	10	phylo	phylo	NOUN
iajs-3652	139	11	-	-	PUNCT
iajs-3652	139	12	groups	group	NOUN
iajs-3652	139	13	of	of	ADP
iajs-3652	139	14	escherichia	escherichia	NOUN
iajs-3652	139	15	coli	coli	NOUN
iajs-3652	139	16	,	,	PUNCT
iajs-3652	139	17	and	and	CCONJ
iajs-3652	139	18	that	that	SCONJ
iajs-3652	139	19	the	the	DET
iajs-3652	139	20	strains	strain	NOUN
iajs-3652	139	21	within	within	ADP
iajs-3652	139	22	each	each	DET
iajs-3652	139	23	phylo	phylo	NOUN
iajs-3652	139	24	-	-	PUNCT
iajs-3652	139	25	group	group	NOUN
iajs-3652	139	26	differ	differ	VERB
iajs-3652	139	27	in	in	ADP
iajs-3652	139	28	terms	term	NOUN
iajs-3652	139	29	of	of	ADP
iajs-3652	139	30	their	their	PRON
iajs-3652	139	31	ecological	ecological	ADJ
iajs-3652	139	32	niches	niche	NOUN
iajs-3652	139	33	,	,	PUNCT
iajs-3652	139	34	life	life	NOUN
iajs-3652	139	35	-	-	PUNCT
iajs-3652	139	36	history	history	NOUN
iajs-3652	139	37	traits	trait	NOUN
iajs-3652	139	38	,	,	PUNCT
iajs-3652	139	39	and	and	CCONJ
iajs-3652	139	40	propensity	propensity	NOUN
iajs-3652	139	41	to	to	PART
iajs-3652	139	42	cause	cause	VERB
iajs-3652	139	43	disease	disease	NOUN
iajs-3652	139	44	.	.	PUNCT
iajs-3652	140	1	as	as	ADP
iajs-3652	140	2	a	a	DET
iajs-3652	140	3	result	result	NOUN
iajs-3652	140	4	,	,	PUNCT
iajs-3652	140	5	classifying	classify	VERB
iajs-3652	140	6	an	an	DET
iajs-3652	140	7	e.	e.	PROPN
iajs-3652	140	8	coli	coli	NOUN
iajs-3652	140	9	strain	strain	NOUN
iajs-3652	140	10	according	accord	VERB
iajs-3652	140	11	to	to	ADP
iajs-3652	140	12	one	one	NUM
iajs-3652	140	13	of	of	ADP
iajs-3652	140	14	the	the	DET
iajs-3652	140	15	known	know	VERB
iajs-3652	140	16	phylogroups	phylogroup	NOUN
iajs-3652	140	17	might	might	AUX
iajs-3652	140	18	reveal	reveal	VERB
iajs-3652	140	19	a	a	DET
iajs-3652	140	20	lot	lot	NOUN
iajs-3652	140	21	about	about	ADP
iajs-3652	140	22	it	it	PRON
iajs-3652	140	23	.	.	PUNCT
iajs-3652	141	1	e.	e.	PROPN
iajs-3652	141	2	coli	coli	PROPN
iajs-3652	141	3	strains	strain	NOUN
iajs-3652	141	4	can	can	AUX
iajs-3652	141	5	be	be	AUX
iajs-3652	141	6	classified	classify	VERB
iajs-3652	141	7	into	into	ADP
iajs-3652	141	8	phylo	phylo	NOUN
iajs-3652	141	9	-	-	PUNCT
iajs-3652	141	10	groups	group	NOUN
iajs-3652	141	11	using	use	VERB
iajs-3652	141	12	a	a	DET
iajs-3652	141	13	pcr	pcr	NOUN
iajs-3652	141	14	-	-	PUNCT
iajs-3652	141	15	based	base	VERB
iajs-3652	141	16	technique	technique	NOUN
iajs-3652	141	17	that	that	PRON
iajs-3652	141	18	is	be	AUX
iajs-3652	141	19	based	base	VERB
iajs-3652	141	20	on	on	ADP
iajs-3652	141	21	the	the	DET
iajs-3652	141	22	presence	presence	NOUN
iajs-3652	141	23	or	or	CCONJ
iajs-3652	141	24	lack	lack	NOUN
iajs-3652	141	25	of	of	ADP
iajs-3652	141	26	two	two	NUM
iajs-3652	141	27	genes	gene	NOUN
iajs-3652	141	28	(	(	PUNCT
iajs-3652	141	29	chua	chua	PROPN
iajs-3652	141	30	and	and	CCONJ
iajs-3652	141	31	yjaa	yjaa	NOUN
iajs-3652	141	32	)	)	PUNCT
iajs-3652	141	33	and	and	CCONJ
iajs-3652	141	34	an	an	DET
iajs-3652	141	35	unidentified	unidentified	ADJ
iajs-3652	141	36	dna	dna	NOUN
iajs-3652	141	37	fragment	fragment	NOUN
iajs-3652	141	38	tspe4.c2	tspe4.c2	NOUN
iajs-3652	141	39	(	(	PUNCT
iajs-3652	141	40	29	29	NUM
iajs-3652	141	41	)	)	PUNCT
iajs-3652	141	42	.	.	PUNCT
iajs-3652	142	1	it	it	PRON
iajs-3652	142	2	is	be	AUX
iajs-3652	142	3	worth	worth	ADJ
iajs-3652	142	4	noting	note	VERB
iajs-3652	142	5	that	that	SCONJ
iajs-3652	142	6	the	the	DET
iajs-3652	142	7	results	result	NOUN
iajs-3652	142	8	of	of	ADP
iajs-3652	142	9	our	our	PRON
iajs-3652	142	10	current	current	ADJ
iajs-3652	142	11	study	study	NOUN
iajs-3652	142	12	agree	agree	VERB
iajs-3652	142	13	to	to	ADP
iajs-3652	142	14	some	some	DET
iajs-3652	142	15	extent	extent	NOUN
iajs-3652	142	16	with	with	ADP
iajs-3652	142	17	the	the	DET
iajs-3652	142	18	results	result	NOUN
iajs-3652	142	19	of	of	ADP
iajs-3652	142	20	a	a	DET
iajs-3652	142	21	previous	previous	ADJ
iajs-3652	142	22	study	study	NOUN
iajs-3652	142	23	that	that	PRON
iajs-3652	142	24	confirmed	confirm	VERB
iajs-3652	142	25	that	that	SCONJ
iajs-3652	142	26	the	the	DET
iajs-3652	142	27	tspe4.c2	tspe4.c2	NOUN
iajs-3652	142	28	gene	gene	NOUN
iajs-3652	142	29	is	be	AUX
iajs-3652	142	30	responsible	responsible	ADJ
iajs-3652	142	31	for	for	ADP
iajs-3652	142	32	the	the	DET
iajs-3652	142	33	classification	classification	NOUN
iajs-3652	142	34	of	of	ADP
iajs-3652	142	35	escherichia	escherichia	NOUN
iajs-3652	142	36	isolated	isolate	VERB
iajs-3652	142	37	from	from	ADP
iajs-3652	142	38	urine	urine	NOUN
iajs-3652	142	39	and	and	CCONJ
iajs-3652	142	40	other	other	ADJ
iajs-3652	142	41	samples	sample	NOUN
iajs-3652	142	42	.	.	PUNCT
iajs-3652	143	1	the	the	DET
iajs-3652	143	2	previous	previous	ADJ
iajs-3652	143	3	study	study	NOUN
iajs-3652	143	4	confirmed	confirm	VERB
iajs-3652	143	5	that	that	SCONJ
iajs-3652	143	6	the	the	DET
iajs-3652	143	7	presence	presence	NOUN
iajs-3652	143	8	of	of	ADP
iajs-3652	143	9	the	the	DET
iajs-3652	143	10	tspe4.c2	tspe4.c2	NOUN
iajs-3652	143	11	gene	gene	NOUN
iajs-3652	143	12	is	be	AUX
iajs-3652	143	13	a	a	DET
iajs-3652	143	14	major	major	ADJ
iajs-3652	143	15	cause	cause	NOUN
iajs-3652	143	16	of	of	ADP
iajs-3652	143	17	the	the	DET
iajs-3652	143	18	pathogenicity	pathogenicity	NOUN
iajs-3652	143	19	and	and	CCONJ
iajs-3652	143	20	virulence	virulence	NOUN
iajs-3652	143	21	of	of	ADP
iajs-3652	143	22	escherichia	escherichia	NOUN
iajs-3652	143	23	coli	coli	NOUN
iajs-3652	143	24	type	type	NOUN
iajs-3652	143	25	a	a	PRON
iajs-3652	143	26	in	in	ADP
iajs-3652	143	27	the	the	DET
iajs-3652	143	28	urinary	urinary	ADJ
iajs-3652	143	29	system	system	NOUN
iajs-3652	143	30	and	and	CCONJ
iajs-3652	143	31	the	the	DET
iajs-3652	143	32	occurrence	occurrence	NOUN
iajs-3652	143	33	of	of	ADP
iajs-3652	143	34	urinary	urinary	ADJ
iajs-3652	143	35	tract	tract	NOUN
iajs-3652	143	36	infection	infection	NOUN
iajs-3652	143	37	(	(	PUNCT
iajs-3652	143	38	30	30	NUM
iajs-3652	143	39	)	)	PUNCT
iajs-3652	143	40	.	.	PUNCT
iajs-3652	144	1	5	5	X
iajs-3652	144	2	.	.	X
iajs-3652	144	3	conclusions	conclusion	NOUN
iajs-3652	144	4	we	we	PRON
iajs-3652	144	5	discovered	discover	VERB
iajs-3652	144	6	that	that	SCONJ
iajs-3652	144	7	all	all	DET
iajs-3652	144	8	e.	e.	PROPN
iajs-3652	144	9	coli	coli	PROPN
iajs-3652	144	10	isolates	isolate	NOUN
iajs-3652	144	11	produced	produce	VERB
iajs-3652	144	12	biofilms	biofilm	NOUN
iajs-3652	144	13	,	,	PUNCT
iajs-3652	144	14	with	with	ADP
iajs-3652	144	15	the	the	DET
iajs-3652	144	16	majority	majority	NOUN
iajs-3652	144	17	of	of	ADP
iajs-3652	144	18	these	these	DET
iajs-3652	144	19	isolates	isolate	NOUN
iajs-3652	144	20	using	use	VERB
iajs-3652	144	21	the	the	DET
iajs-3652	144	22	microtiter	microtiter	ADJ
iajs-3652	144	23	plate	plate	NOUN
iajs-3652	144	24	method	method	NOUN
iajs-3652	144	25	.	.	PUNCT
iajs-3652	145	1	additionally	additionally	ADV
iajs-3652	145	2	,	,	PUNCT
iajs-3652	145	3	we	we	PRON
iajs-3652	145	4	employed	employ	VERB
iajs-3652	145	5	pcr	pcr	ADJ
iajs-3652	145	6	amplification	amplification	NOUN
iajs-3652	145	7	to	to	PART
iajs-3652	145	8	find	find	VERB
iajs-3652	145	9	two	two	NUM
iajs-3652	145	10	genes	gene	NOUN
iajs-3652	145	11	(	(	PUNCT
iajs-3652	145	12	algd	algd	NOUN
iajs-3652	145	13	and	and	CCONJ
iajs-3652	145	14	tspe4.c2	tspe4.c2	NOUN
iajs-3652	145	15	)	)	PUNCT
iajs-3652	145	16	responsible	responsible	ADJ
iajs-3652	145	17	for	for	ADP
iajs-3652	145	18	several	several	ADJ
iajs-3652	145	19	virulence	virulence	NOUN
iajs-3652	145	20	factors	factor	NOUN
iajs-3652	145	21	in	in	ADP
iajs-3652	145	22	escherichia	escherichia	NOUN
iajs-3652	145	23	coli	coli	NOUN
iajs-3652	145	24	clinical	clinical	ADJ
iajs-3652	145	25	isolates	isolate	NOUN
iajs-3652	145	26	from	from	ADP
iajs-3652	145	27	iraqi	iraqi	ADJ
iajs-3652	145	28	patients	patient	NOUN
iajs-3652	145	29	in	in	ADP
iajs-3652	145	30	baghdad	baghdad	PROPN
iajs-3652	145	31	.	.	PUNCT
iajs-3652	146	1	acknowledgment	acknowledgment	NOUN
iajs-3652	146	2	the	the	DET
iajs-3652	146	3	authors	author	NOUN
iajs-3652	146	4	would	would	AUX
iajs-3652	146	5	like	like	VERB
iajs-3652	146	6	to	to	PART
iajs-3652	146	7	thank	thank	VERB
iajs-3652	146	8	college	college	NOUN
iajs-3652	146	9	of	of	ADP
iajs-3652	146	10	education	education	NOUN
iajs-3652	146	11	for	for	ADP
iajs-3652	146	12	pure	pure	ADJ
iajs-3652	146	13	science	science	NOUN
iajs-3652	146	14	(	(	PUNCT
iajs-3652	146	15	ibn	ibn	PROPN
iajs-3652	146	16	al	al	PROPN
iajs-3652	146	17	-	-	PUNCT
iajs-3652	146	18	haitham	haitham	PROPN
iajs-3652	146	19	)	)	PUNCT
iajs-3652	146	20	,	,	PUNCT
iajs-3652	146	21	university	university	NOUN
iajs-3652	146	22	of	of	ADP
iajs-3652	146	23	baghdad	baghdad	PROPN
iajs-3652	146	24	.	.	PUNCT
iajs-3652	147	1	conflict	conflict	NOUN
iajs-3652	147	2	of	of	ADP
iajs-3652	147	3	interest	interest	NOUN
iajs-3652	147	4	the	the	DET
iajs-3652	147	5	authors	author	NOUN
iajs-3652	147	6	declare	declare	VERB
iajs-3652	147	7	that	that	SCONJ
iajs-3652	147	8	they	they	PRON
iajs-3652	147	9	have	have	VERB
iajs-3652	147	10	no	no	DET
iajs-3652	147	11	conflicts	conflict	NOUN
iajs-3652	147	12	of	of	ADP
iajs-3652	147	13	interest	interest	NOUN
iajs-3652	147	14	.	.	PUNCT
iajs-3652	148	1	funding	fund	VERB
iajs-3652	148	2	no	no	DET
iajs-3652	148	3	funding	funding	NOUN
iajs-3652	148	4	.	.	PUNCT
iajs-3652	149	1	ethical	ethical	ADJ
iajs-3652	149	2	approval	approval	NOUN
iajs-3652	149	3	the	the	DET
iajs-3652	149	4	study	study	NOUN
iajs-3652	149	5	was	be	AUX
iajs-3652	149	6	conducted	conduct	VERB
iajs-3652	149	7	in	in	ADP
iajs-3652	149	8	accordance	accordance	NOUN
iajs-3652	149	9	with	with	ADP
iajs-3652	149	10	the	the	DET
iajs-3652	149	11	ethical	ethical	ADJ
iajs-3652	149	12	principles	principle	NOUN
iajs-3652	149	13	.	.	PUNCT
iajs-3652	150	1	it	it	PRON
iajs-3652	150	2	was	be	AUX
iajs-3652	150	3	carried	carry	VERB
iajs-3652	150	4	out	out	ADP
iajs-3652	150	5	with	with	ADP
iajs-3652	150	6	patients	patient	NOUN
iajs-3652	150	7	verbal	verbal	ADJ
iajs-3652	150	8	and	and	CCONJ
iajs-3652	150	9	analytical	analytical	ADJ
iajs-3652	150	10	approval	approval	NOUN
iajs-3652	150	11	before	before	SCONJ
iajs-3652	150	12	the	the	DET
iajs-3652	150	13	sample	sample	NOUN
iajs-3652	150	14	was	be	AUX
iajs-3652	150	15	taken	take	VERB
iajs-3652	150	16	.	.	PUNCT
iajs-3652	151	1	the	the	DET
iajs-3652	151	2	university	university	PROPN
iajs-3652	151	3	of	of	ADP
iajs-3652	151	4	baghdad	baghdad	PROPN
iajs-3652	151	5	,	,	PUNCT
iajs-3652	151	6	college	college	NOUN
iajs-3652	151	7	of	of	ADP
iajs-3652	151	8	education	education	NOUN
iajs-3652	151	9	for	for	ADP
iajs-3652	151	10	pure	pure	ADJ
iajs-3652	151	11	science	science	NOUN
iajs-3652	151	12	(	(	PUNCT
iajs-3652	151	13	ibn	ibn	PROPN
iajs-3652	151	14	al	al	PROPN
iajs-3652	151	15	-	-	PUNCT
iajs-3652	151	16	haitham	haitham	PROPN
iajs-3652	151	17	)	)	PUNCT
iajs-3652	151	18	,	,	PUNCT
iajs-3652	151	19	a	a	DET
iajs-3652	151	20	local	local	ADJ
iajs-3652	151	21	ethics	ethic	NOUN
iajs-3652	151	22	committee	committee	NOUN
iajs-3652	151	23	,	,	PUNCT
iajs-3652	151	24	reviewed	review	VERB
iajs-3652	151	25	and	and	CCONJ
iajs-3652	151	26	approved	approve	VERB
iajs-3652	151	27	the	the	DET
iajs-3652	151	28	study	study	NOUN
iajs-3652	151	29	protocol	protocol	NOUN
iajs-3652	151	30	,	,	PUNCT
iajs-3652	151	31	subject	subject	ADJ
iajs-3652	151	32	information	information	NOUN
iajs-3652	151	33	,	,	PUNCT
iajs-3652	151	34	and	and	CCONJ
iajs-3652	151	35	consent	consent	VERB
iajs-3652	151	36	form	form	NOUN
iajs-3652	151	37	on	on	ADP
iajs-3652	151	38	26	26	NUM
iajs-3652	151	39	september	september	PROPN
iajs-3652	151	40	2022	2022	NUM
iajs-3652	151	41	,	,	PUNCT
iajs-3652	151	42	using	use	VERB
iajs-3652	151	43	the	the	DET
iajs-3652	151	44	document	document	NOUN
iajs-3652	151	45	number	number	NOUN
iajs-3652	151	46	csec/0922/0089	csec/0922/0089	NOUN
iajs-3652	151	47	.	.	PUNCT
iajs-3652	152	1	references	reference	NOUN
iajs-3652	152	2	1	1	NUM
iajs-3652	152	3	.	.	PUNCT
iajs-3652	153	1	gomes	gomes	PROPN
iajs-3652	153	2	ta	ta	PROPN
iajs-3652	153	3	,	,	PUNCT
iajs-3652	153	4	elias	elias	PROPN
iajs-3652	153	5	wp	wp	PROPN
iajs-3652	153	6	,	,	PUNCT
iajs-3652	153	7	scaletsky	scaletsky	PROPN
iajs-3652	153	8	ic	ic	PROPN
iajs-3652	153	9	,	,	PUNCT
iajs-3652	153	10	guth	guth	PROPN
iajs-3652	153	11	be	be	AUX
iajs-3652	153	12	,	,	PUNCT
iajs-3652	153	13	rodrigues	rodrigues	PROPN
iajs-3652	153	14	jf	jf	PROPN
iajs-3652	153	15	,	,	PUNCT
iajs-3652	153	16	piazza	piazza	PROPN
iajs-3652	153	17	rm	rm	PROPN
iajs-3652	153	18	,	,	PUNCT
iajs-3652	153	19	martinez	martinez	PROPN
iajs-3652	153	20	mb	mb	PROPN
iajs-3652	153	21	.	.	PROPN
iajs-3652	153	22	diarrheagenic	diarrheagenic	ADJ
iajs-3652	153	23	escherichia	escherichia	NOUN
iajs-3652	153	24	coli	coli	NOUN
iajs-3652	153	25	.	.	PUNCT
iajs-3652	154	1	braz	braz	PROPN
iajs-3652	154	2	j	j	PROPN
iajs-3652	154	3	microbiol	microbiol	PROPN
iajs-3652	154	4	.	.	PUNCT
iajs-3652	155	1	2016;47:3–30	2016;47:3–30	NUM
iajs-3652	155	2	.	.	PUNCT
iajs-3652	156	1	https://doi.org/10.1016/j.bjm.2016.10.003	https://doi.org/10.1016/j.bjm.2016.10.003	NOUN
iajs-3652	156	2	.	.	PROPN
iajs-3652	156	3	2	2	NUM
iajs-3652	156	4	.	.	X
iajs-3652	156	5	abdulsalam	abdulsalam	PROPN
iajs-3652	156	6	aa	aa	PROPN
iajs-3652	156	7	,	,	PUNCT
iajs-3652	156	8	saleh	saleh	PROPN
iajs-3652	156	9	mk	mk	PROPN
iajs-3652	156	10	.	.	PUNCT
iajs-3652	157	1	effect	effect	NOUN
iajs-3652	157	2	of	of	ADP
iajs-3652	157	3	colicin	colicin	PROPN
iajs-3652	157	4	from	from	ADP
iajs-3652	157	5	e.	e.	PROPN
iajs-3652	157	6	coli	coli	NOUN
iajs-3652	157	7	product	product	NOUN
iajs-3652	157	8	on	on	ADP
iajs-3652	157	9	some	some	DET
iajs-3652	157	10	species	specie	NOUN
iajs-3652	157	11	of	of	ADP
iajs-3652	157	12	gramnegative	gramnegative	ADJ
iajs-3652	157	13	bacteria	bacteria	NOUN
iajs-3652	157	14	isolated	isolate	VERB
iajs-3652	157	15	from	from	ADP
iajs-3652	157	16	urinary	urinary	ADJ
iajs-3652	157	17	tract	tract	NOUN
iajs-3652	157	18	infections	infection	NOUN
iajs-3652	157	19	.	.	PUNCT
iajs-3652	158	1	j	j	PROPN
iajs-3652	158	2	educ	educ	VERB
iajs-3652	158	3	sci	sci	PROPN
iajs-3652	158	4	stud	stud	NOUN
iajs-3652	158	5	.	.	PUNCT
iajs-3652	159	1	2021;3:17	2021;3:17	NOUN
iajs-3652	159	2	.	.	PUNCT
iajs-3652	160	1	https://doi.org/10.1016/j.bjm.2016.10.003	https://doi.org/10.1016/j.bjm.2016.10.003	PROPN
iajs-3652	160	2	ihjpas	ihjpas	PROPN
iajs-3652	160	3	.	.	PUNCT
iajs-3652	161	1	2025	2025	NUM
iajs-3652	161	2	,	,	PUNCT
iajs-3652	161	3	38(3	38(3	NUM
iajs-3652	161	4	)	)	PUNCT
iajs-3652	161	5	112	112	NUM
iajs-3652	161	6	3	3	NUM
iajs-3652	161	7	.	.	PUNCT
iajs-3652	162	1	al	al	PROPN
iajs-3652	162	2	-	-	PUNCT
iajs-3652	162	3	nasrawi	nasrawi	PROPN
iajs-3652	162	4	mm	mm	PROPN
iajs-3652	162	5	,	,	PUNCT
iajs-3652	162	6	al	al	PROPN
iajs-3652	162	7	-	-	PUNCT
iajs-3652	162	8	hashimy	hashimy	PROPN
iajs-3652	162	9	ab	ab	PROPN
iajs-3652	162	10	.	.	PUNCT
iajs-3652	162	11	molecular	molecular	ADJ
iajs-3652	162	12	study	study	NOUN
iajs-3652	162	13	of	of	ADP
iajs-3652	162	14	some	some	DET
iajs-3652	162	15	virulence	virulence	NOUN
iajs-3652	162	16	genes	gene	NOUN
iajs-3652	162	17	of	of	ADP
iajs-3652	162	18	escherichia	escherichia	NOUN
iajs-3652	162	19	coli	coli	NOUN
iajs-3652	162	20	isolated	isolate	VERB
iajs-3652	162	21	from	from	ADP
iajs-3652	162	22	women	woman	NOUN
iajs-3652	162	23	with	with	ADP
iajs-3652	162	24	urinary	urinary	ADJ
iajs-3652	162	25	tract	tract	NOUN
iajs-3652	162	26	infection	infection	NOUN
iajs-3652	162	27	in	in	ADP
iajs-3652	162	28	al	al	PROPN
iajs-3652	162	29	-	-	PUNCT
iajs-3652	162	30	najaf	najaf	PROPN
iajs-3652	162	31	city	city	NOUN
iajs-3652	162	32	.	.	PUNCT
iajs-3652	163	1	iraqi	iraqi	ADJ
iajs-3652	163	2	j	j	PROPN
iajs-3652	163	3	biotechnol	biotechnol	PROPN
iajs-3652	163	4	.	.	PUNCT
iajs-3652	164	1	2020;3:19	2020;3:19	PROPN
iajs-3652	164	2	.	.	PUNCT
iajs-3652	165	1	4	4	X
iajs-3652	165	2	.	.	X
iajs-3652	165	3	sarowska	sarowska	PROPN
iajs-3652	165	4	j	j	PROPN
iajs-3652	165	5	,	,	PUNCT
iajs-3652	165	6	futoma	futoma	NOUN
iajs-3652	165	7	-	-	PUNCT
iajs-3652	165	8	koloch	koloch	PROPN
iajs-3652	165	9	b	b	PROPN
iajs-3652	165	10	,	,	PUNCT
iajs-3652	165	11	jama	jama	NOUN
iajs-3652	165	12	-	-	PUNCT
iajs-3652	165	13	kmiecik	kmiecik	PROPN
iajs-3652	165	14	a	a	X
iajs-3652	165	15	,	,	PUNCT
iajs-3652	165	16	frej	frej	NOUN
iajs-3652	165	17	-	-	PUNCT
iajs-3652	165	18	madrzak	madrzak	NOUN
iajs-3652	165	19	m	m	PROPN
iajs-3652	165	20	,	,	PUNCT
iajs-3652	165	21	ksiazczyk	ksiazczyk	PROPN
iajs-3652	165	22	m	m	PROPN
iajs-3652	165	23	,	,	PUNCT
iajs-3652	165	24	buglaploskonska	buglaploskonska	ADV
iajs-3652	165	25	g	g	NOUN
iajs-3652	165	26	,	,	PUNCT
iajs-3652	165	27	choroszy	choroszy	ADJ
iajs-3652	165	28	-	-	PUNCT
iajs-3652	165	29	krol	krol	PROPN
iajs-3652	165	30	i.	i.	PROPN
iajs-3652	165	31	virulence	virulence	NOUN
iajs-3652	165	32	factors	factor	NOUN
iajs-3652	165	33	,	,	PUNCT
iajs-3652	165	34	prevalence	prevalence	NOUN
iajs-3652	165	35	and	and	CCONJ
iajs-3652	165	36	potential	potential	ADJ
iajs-3652	165	37	transmission	transmission	NOUN
iajs-3652	165	38	of	of	ADP
iajs-3652	165	39	extraintestinal	extraintestinal	ADJ
iajs-3652	165	40	pathogenic	pathogenic	ADJ
iajs-3652	165	41	escherichia	escherichia	NOUN
iajs-3652	165	42	coli	coli	NOUN
iajs-3652	165	43	isolated	isolate	VERB
iajs-3652	165	44	from	from	ADP
iajs-3652	165	45	different	different	ADJ
iajs-3652	165	46	sources	source	NOUN
iajs-3652	165	47	:	:	PUNCT
iajs-3652	165	48	recent	recent	ADJ
iajs-3652	165	49	reports	report	NOUN
iajs-3652	165	50	.	.	PUNCT
iajs-3652	166	1	gut	gut	NOUN
iajs-3652	166	2	pathog	pathog	NOUN
iajs-3652	166	3	.	.	PUNCT
iajs-3652	167	1	2019;11:1–16	2019;11:1–16	NOUN
iajs-3652	167	2	.	.	PUNCT
iajs-3652	168	1	https://doi.org/10.1186/s13099-019-0290-0	https://doi.org/10.1186/s13099-019-0290-0	NUM
iajs-3652	168	2	.	.	PUNCT
iajs-3652	169	1	5	5	X
iajs-3652	169	2	.	.	X
iajs-3652	169	3	mohammed	mohammed	PROPN
iajs-3652	169	4	rk	rk	PROPN
iajs-3652	169	5	,	,	PUNCT
iajs-3652	169	6	ibrahim	ibrahim	PROPN
iajs-3652	169	7	aa	aa	PROPN
iajs-3652	169	8	.	.	PUNCT
iajs-3652	170	1	distribution	distribution	NOUN
iajs-3652	170	2	of	of	ADP
iajs-3652	170	3	dfra1	dfra1	PROPN
iajs-3652	170	4	and	and	CCONJ
iajs-3652	170	5	cat1	cat1	PROPN
iajs-3652	170	6	antibiotic	antibiotic	ADJ
iajs-3652	170	7	resistance	resistance	NOUN
iajs-3652	170	8	genes	gene	NOUN
iajs-3652	170	9	in	in	ADP
iajs-3652	170	10	uropathogenic	uropathogenic	ADJ
iajs-3652	170	11	escherichia	escherichia	NOUN
iajs-3652	170	12	coli	coli	NOUN
iajs-3652	170	13	isolated	isolate	VERB
iajs-3652	170	14	from	from	ADP
iajs-3652	170	15	teen	teen	ADJ
iajs-3652	170	16	pregnant	pregnant	ADJ
iajs-3652	170	17	women	woman	NOUN
iajs-3652	170	18	in	in	ADP
iajs-3652	170	19	iraq	iraq	PROPN
iajs-3652	170	20	.	.	PUNCT
iajs-3652	171	1	iraqi	iraqi	PROPN
iajs-3652	171	2	j	j	PROPN
iajs-3652	171	3	sci	sci	PROPN
iajs-3652	171	4	.	.	PUNCT
iajs-3652	171	5	2022;63:3340–3353	2022;63:3340–3353	NUM
iajs-3652	171	6	.	.	PUNCT
iajs-3652	172	1	https://doi.org/10.24996/ijs.2022.63.12.5	https://doi.org/10.24996/ijs.2022.63.12.5	PUNCT
iajs-3652	172	2	.	.	X
iajs-3652	173	1	6	6	X
iajs-3652	173	2	.	.	X
iajs-3652	173	3	hammadi	hammadi	PROPN
iajs-3652	173	4	ah	ah	INTJ
iajs-3652	173	5	,	,	PUNCT
iajs-3652	173	6	yaseen	yaseen	PROPN
iajs-3652	173	7	nn	nn	PROPN
iajs-3652	173	8	,	,	PUNCT
iajs-3652	173	9	al	al	PROPN
iajs-3652	173	10	-	-	PUNCT
iajs-3652	173	11	mathkhury	mathkhury	PROPN
iajs-3652	173	12	hj	hj	PROPN
iajs-3652	173	13	.	.	PROPN
iajs-3652	173	14	molecular	molecular	ADJ
iajs-3652	173	15	detection	detection	NOUN
iajs-3652	173	16	of	of	ADP
iajs-3652	173	17	some	some	DET
iajs-3652	173	18	β	β	NOUN
iajs-3652	173	19	-	-	ADJ
iajs-3652	173	20	lactamases	lactamases	ADJ
iajs-3652	173	21	genes	gene	NOUN
iajs-3652	173	22	in	in	ADP
iajs-3652	173	23	uropathogenic	uropathogenic	ADJ
iajs-3652	173	24	escherichia	escherichia	NOUN
iajs-3652	173	25	coli	coli	NOUN
iajs-3652	173	26	.	.	PUNCT
iajs-3652	174	1	iraqi	iraqi	PROPN
iajs-3652	174	2	j	j	PROPN
iajs-3652	174	3	sci	sci	PROPN
iajs-3652	174	4	.	.	PUNCT
iajs-3652	175	1	2015;56(3a):1925–1931	2015;56(3a):1925–1931	NUM
iajs-3652	175	2	.	.	X
iajs-3652	176	1	7	7	X
iajs-3652	176	2	.	.	X
iajs-3652	176	3	pirko	pirko	PROPN
iajs-3652	176	4	ey	ey	PROPN
iajs-3652	176	5	,	,	PUNCT
iajs-3652	176	6	ali	ali	PROPN
iajs-3652	176	7	mr	mr	PROPN
iajs-3652	176	8	,	,	PUNCT
iajs-3652	176	9	mr	mr	PROPN
iajs-3652	176	10	n.	n.	PROPN
iajs-3652	176	11	the	the	DET
iajs-3652	176	12	relationship	relationship	NOUN
iajs-3652	176	13	between	between	ADP
iajs-3652	176	14	phylogenic	phylogenic	ADJ
iajs-3652	176	15	typing	typing	NOUN
iajs-3652	176	16	and	and	CCONJ
iajs-3652	176	17	antimicrobial	antimicrobial	ADJ
iajs-3652	176	18	susceptibility	susceptibility	NOUN
iajs-3652	176	19	patterns	pattern	NOUN
iajs-3652	176	20	for	for	ADP
iajs-3652	176	21	escherichia	escherichia	NOUN
iajs-3652	176	22	coli	coli	NOUN
iajs-3652	176	23	isolated	isolate	VERB
iajs-3652	176	24	from	from	ADP
iajs-3652	176	25	utis	utis	NOUN
iajs-3652	176	26	at	at	ADP
iajs-3652	176	27	many	many	ADJ
iajs-3652	176	28	hospitals	hospital	NOUN
iajs-3652	176	29	in	in	ADP
iajs-3652	176	30	baghdad	baghdad	PROPN
iajs-3652	176	31	city	city	PROPN
iajs-3652	176	32	.	.	PUNCT
iajs-3652	177	1	nurs	nur	VERB
iajs-3652	177	2	natl	natl	PROPN
iajs-3652	177	3	iraqi	iraqi	PROPN
iajs-3652	177	4	spec	spec	PROPN
iajs-3652	177	5	.	.	PUNCT
iajs-3652	178	1	2017;30(2):1–2	2017;30(2):1–2	X
iajs-3652	178	2	.	.	PUNCT
iajs-3652	179	1	https://injns.uobaghdad.edu.iq/index.php/injns/article/view/275	https://injns.uobaghdad.edu.iq/index.php/injns/article/view/275	PROPN
iajs-3652	179	2	.	.	NOUN
iajs-3652	179	3	8	8	NUM
iajs-3652	179	4	.	.	X
iajs-3652	179	5	altaee	altaee	PROPN
iajs-3652	179	6	aj	aj	PROPN
iajs-3652	179	7	,	,	PUNCT
iajs-3652	179	8	aldabbagh	aldabbagh	VERB
iajs-3652	179	9	sy	sy	INTJ
iajs-3652	179	10	.	.	NOUN
iajs-3652	179	11	molecular	molecular	ADJ
iajs-3652	179	12	identification	identification	NOUN
iajs-3652	179	13	of	of	ADP
iajs-3652	179	14	virulence	virulence	NOUN
iajs-3652	179	15	genes	gene	NOUN
iajs-3652	179	16	of	of	ADP
iajs-3652	179	17	pseudomonas	pseudomona	NOUN
iajs-3652	179	18	aeruginosa	aeruginosa	NOUN
iajs-3652	179	19	isolated	isolate	VERB
iajs-3652	179	20	from	from	ADP
iajs-3652	179	21	fish	fish	NOUN
iajs-3652	179	22	(	(	PUNCT
iajs-3652	179	23	cyprinus	cyprinus	NOUN
iajs-3652	179	24	carpio	carpio	NOUN
iajs-3652	179	25	)	)	PUNCT
iajs-3652	179	26	in	in	ADP
iajs-3652	179	27	mosul	mosul	PROPN
iajs-3652	179	28	city	city	PROPN
iajs-3652	179	29	.	.	PUNCT
iajs-3652	180	1	iraqi	iraqi	PROPN
iajs-3652	180	2	j	j	PROPN
iajs-3652	180	3	vet	vet	PROPN
iajs-3652	180	4	sci	sci	PROPN
iajs-3652	180	5	.	.	PUNCT
iajs-3652	181	1	2022;36(4):953	2022;36(4):953	NUM
iajs-3652	181	2	–	–	PUNCT
iajs-3652	181	3	958	958	NUM
iajs-3652	181	4	.	.	PUNCT
iajs-3652	182	1	https://doi.org/10.33899/ijvs.2022.132967.2207	https://doi.org/10.33899/ijvs.2022.132967.2207	NOUN
iajs-3652	182	2	.	.	PUNCT
iajs-3652	183	1	9	9	NUM
iajs-3652	183	2	.	.	X
iajs-3652	184	1	mohamad	mohamad	PROPN
iajs-3652	184	2	ls	ls	PROPN
iajs-3652	184	3	.	.	PUNCT
iajs-3652	185	1	the	the	DET
iajs-3652	185	2	effect	effect	NOUN
iajs-3652	185	3	of	of	ADP
iajs-3652	185	4	alcoholic	alcoholic	ADJ
iajs-3652	185	5	extracts	extract	NOUN
iajs-3652	185	6	of	of	ADP
iajs-3652	185	7	zingiber	zingiber	PROPN
iajs-3652	185	8	officinale	officinale	ADJ
iajs-3652	185	9	anti	anti	ADJ
iajs-3652	185	10	-	-	ADJ
iajs-3652	185	11	e.	e.	ADJ
iajs-3652	185	12	coli	coli	NOUN
iajs-3652	185	13	isolates	isolate	NOUN
iajs-3652	185	14	isolated	isolate	VERB
iajs-3652	185	15	from	from	ADP
iajs-3652	185	16	urinary	urinary	ADJ
iajs-3652	185	17	tract	tract	NOUN
iajs-3652	185	18	infection	infection	NOUN
iajs-3652	185	19	.	.	PUNCT
iajs-3652	186	1	iraqi	iraqi	PROPN
iajs-3652	186	2	j	j	PROPN
iajs-3652	186	3	sci	sci	PROPN
iajs-3652	186	4	.	.	PUNCT
iajs-3652	187	1	2019;60(10):2136–2140	2019;60(10):2136–2140	NUM
iajs-3652	187	2	.	.	PUNCT
iajs-3652	188	1	https://doi.org/10.24996/ijs.2019.60.10.18	https://doi.org/10.24996/ijs.2019.60.10.18	PROPN
iajs-3652	188	2	.	.	PUNCT
iajs-3652	189	1	10	10	NUM
iajs-3652	189	2	.	.	PUNCT
iajs-3652	189	3	faisal	faisal	PROPN
iajs-3652	189	4	zg	zg	PROPN
iajs-3652	189	5	,	,	PUNCT
iajs-3652	189	6	al	al	PROPN
iajs-3652	189	7	-	-	PUNCT
iajs-3652	189	8	bakiri	bakiri	PROPN
iajs-3652	189	9	gh	gh	PROPN
iajs-3652	189	10	,	,	PUNCT
iajs-3652	189	11	attawi	attawi	PROPN
iajs-3652	189	12	fa	fa	PROPN
iajs-3652	189	13	.	.	PROPN
iajs-3652	189	14	role	role	NOUN
iajs-3652	189	15	of	of	ADP
iajs-3652	189	16	plasmids	plasmid	NOUN
iajs-3652	189	17	in	in	ADP
iajs-3652	189	18	antibiotic	antibiotic	ADJ
iajs-3652	189	19	resistance	resistance	NOUN
iajs-3652	189	20	for	for	ADP
iajs-3652	189	21	e.	e.	PROPN
iajs-3652	189	22	coli	coli	PROPN
iajs-3652	189	23	strains	strain	NOUN
iajs-3652	189	24	isolated	isolate	VERB
iajs-3652	189	25	from	from	ADP
iajs-3652	189	26	patients	patient	NOUN
iajs-3652	189	27	with	with	ADP
iajs-3652	189	28	urinary	urinary	ADJ
iajs-3652	189	29	tract	tract	NOUN
iajs-3652	189	30	infection	infection	NOUN
iajs-3652	189	31	.	.	PUNCT
iajs-3652	190	1	j	j	PROPN
iajs-3652	190	2	educ	educ	VERB
iajs-3652	190	3	sci	sci	PROPN
iajs-3652	190	4	stud	stud	NOUN
iajs-3652	190	5	.	.	PUNCT
iajs-3652	191	1	2013;1(1	2013;1(1	NUM
iajs-3652	191	2	)	)	PUNCT
iajs-3652	191	3	.	.	PUNCT
iajs-3652	192	1	11	11	NUM
iajs-3652	192	2	.	.	PUNCT
iajs-3652	193	1	al	al	PROPN
iajs-3652	193	2	-	-	PUNCT
iajs-3652	193	3	ganimi	ganimi	PROPN
iajs-3652	193	4	a	a	PROPN
iajs-3652	193	5	,	,	PUNCT
iajs-3652	193	6	al	al	PROPN
iajs-3652	193	7	-	-	PUNCT
iajs-3652	193	8	khafaji	khafaji	PROPN
iajs-3652	193	9	j.	j.	PROPN
iajs-3652	194	1	some	some	DET
iajs-3652	194	2	virulence	virulence	NOUN
iajs-3652	194	3	factors	factor	NOUN
iajs-3652	194	4	genes	gene	NOUN
iajs-3652	194	5	and	and	CCONJ
iajs-3652	194	6	phylogenic	phylogenic	ADJ
iajs-3652	194	7	groups	group	NOUN
iajs-3652	194	8	of	of	ADP
iajs-3652	194	9	uropathogenic	uropathogenic	ADJ
iajs-3652	194	10	escherichia	escherichia	NOUN
iajs-3652	194	11	coli	coli	NOUN
iajs-3652	194	12	(	(	PUNCT
iajs-3652	194	13	upec	upec	NOUN
iajs-3652	194	14	)	)	PUNCT
iajs-3652	194	15	isolated	isolate	VERB
iajs-3652	194	16	from	from	ADP
iajs-3652	194	17	karbala	karbala	PROPN
iajs-3652	194	18	patients	patient	NOUN
iajs-3652	194	19	.	.	PUNCT
iajs-3652	195	1	kerbala	kerbala	PROPN
iajs-3652	195	2	j	j	PROPN
iajs-3652	195	3	med	med	PROPN
iajs-3652	195	4	.	.	PUNCT
iajs-3652	196	1	2016;9(1):2376–2385	2016;9(1):2376–2385	NUM
iajs-3652	196	2	.	.	PUNCT
iajs-3652	197	1	12	12	NUM
iajs-3652	197	2	.	.	PUNCT
iajs-3652	198	1	sharma	sharma	PROPN
iajs-3652	198	2	g	g	PROPN
iajs-3652	198	3	,	,	PUNCT
iajs-3652	198	4	sharma	sharma	PROPN
iajs-3652	198	5	s	s	PROPN
iajs-3652	198	6	,	,	PUNCT
iajs-3652	198	7	sharma	sharma	PROPN
iajs-3652	198	8	p	p	X
iajs-3652	198	9	,	,	PUNCT
iajs-3652	198	10	chandola	chandola	PROPN
iajs-3652	198	11	d	d	NOUN
iajs-3652	198	12	,	,	PUNCT
iajs-3652	198	13	dang	dang	PROPN
iajs-3652	198	14	s	s	PROPN
iajs-3652	198	15	,	,	PUNCT
iajs-3652	198	16	gupta	gupta	PROPN
iajs-3652	198	17	s	s	PROPN
iajs-3652	198	18	,	,	PUNCT
iajs-3652	198	19	gabrani	gabrani	PROPN
iajs-3652	198	20	r.	r.	PROPN
iajs-3652	198	21	escherichia	escherichia	NOUN
iajs-3652	198	22	coli	coli	NOUN
iajs-3652	198	23	biofilm	biofilm	NOUN
iajs-3652	198	24	:	:	PUNCT
iajs-3652	198	25	development	development	NOUN
iajs-3652	198	26	and	and	CCONJ
iajs-3652	198	27	therapeutic	therapeutic	ADJ
iajs-3652	198	28	strategies	strategy	NOUN
iajs-3652	198	29	.	.	PUNCT
iajs-3652	199	1	j	j	PROPN
iajs-3652	199	2	appl	appl	PROPN
iajs-3652	199	3	microbiol	microbiol	PROPN
iajs-3652	199	4	.	.	PUNCT
iajs-3652	200	1	2016;121(2):309–319	2016;121(2):309–319	X
iajs-3652	200	2	.	.	PUNCT
iajs-3652	201	1	https://doi.org/10.1111/jam.13174	https://doi.org/10.1111/jam.13174	PROPN
iajs-3652	201	2	.	.	PUNCT
iajs-3652	202	1	13	13	NUM
iajs-3652	202	2	.	.	PUNCT
iajs-3652	203	1	hamady	hamady	PROPN
iajs-3652	203	2	dr	dr	PROPN
iajs-3652	203	3	,	,	PUNCT
iajs-3652	203	4	ibrahim	ibrahim	PROPN
iajs-3652	203	5	sk	sk	VERB
iajs-3652	203	6	.	.	PUNCT
iajs-3652	204	1	the	the	DET
iajs-3652	204	2	study	study	NOUN
iajs-3652	204	3	on	on	ADP
iajs-3652	204	4	ability	ability	NOUN
iajs-3652	204	5	of	of	ADP
iajs-3652	204	6	escherichia	escherichia	NOUN
iajs-3652	204	7	coli	coli	NOUN
iajs-3652	204	8	isolated	isolate	VERB
iajs-3652	204	9	from	from	ADP
iajs-3652	204	10	different	different	ADJ
iajs-3652	204	11	clinical	clinical	ADJ
iajs-3652	204	12	cases	case	NOUN
iajs-3652	204	13	to	to	PART
iajs-3652	204	14	biofilm	biofilm	NOUN
iajs-3652	204	15	formation	formation	NOUN
iajs-3652	204	16	and	and	CCONJ
iajs-3652	204	17	detection	detection	NOUN
iajs-3652	204	18	of	of	ADP
iajs-3652	204	19	csgd	csgd	NOUN
iajs-3652	204	20	gene	gene	NOUN
iajs-3652	204	21	responsible	responsible	ADJ
iajs-3652	204	22	for	for	ADP
iajs-3652	204	23	produce	produce	NOUN
iajs-3652	204	24	curli	curli	NOUN
iajs-3652	204	25	(	(	PUNCT
iajs-3652	204	26	fimbriae	fimbriae	NOUN
iajs-3652	204	27	)	)	PUNCT
iajs-3652	204	28	.	.	PUNCT
iajs-3652	205	1	biochem	biochem	PROPN
iajs-3652	205	2	cell	cell	PROPN
iajs-3652	205	3	arch	arch	NOUN
iajs-3652	205	4	.	.	PUNCT
iajs-3652	206	1	2020;20(2	2020;20(2	NUM
iajs-3652	206	2	):	):	PUNCT
iajs-3652	206	3	5553	5553	NUM
iajs-3652	206	4	-	-	SYM
iajs-3652	206	5	5557	5557	NUM
iajs-3652	206	6	.	.	PUNCT
iajs-3652	207	1	14	14	NUM
iajs-3652	207	2	.	.	PUNCT
iajs-3652	208	1	hussain	hussain	PROPN
iajs-3652	208	2	a	a	X
iajs-3652	208	3	,	,	PUNCT
iajs-3652	208	4	saleh	saleh	NOUN
iajs-3652	208	5	m.	m.	NOUN
iajs-3652	208	6	determination	determination	NOUN
iajs-3652	208	7	of	of	ADP
iajs-3652	208	8	phylogenetic	phylogenetic	ADJ
iajs-3652	208	9	groups	group	NOUN
iajs-3652	208	10	and	and	CCONJ
iajs-3652	208	11	antimicrobial	antimicrobial	ADJ
iajs-3652	208	12	susceptibility	susceptibility	NOUN
iajs-3652	208	13	patterns	pattern	NOUN
iajs-3652	208	14	for	for	ADP
iajs-3652	208	15	escherichia	escherichia	NOUN
iajs-3652	208	16	coli	coli	NOUN
iajs-3652	208	17	isolated	isolate	VERB
iajs-3652	208	18	from	from	ADP
iajs-3652	208	19	patients	patient	NOUN
iajs-3652	208	20	with	with	ADP
iajs-3652	208	21	urinary	urinary	ADJ
iajs-3652	208	22	tract	tract	NOUN
iajs-3652	208	23	infection	infection	NOUN
iajs-3652	208	24	.	.	PUNCT
iajs-3652	209	1	j	j	PROPN
iajs-3652	209	2	coll	coll	PROPN
iajs-3652	209	3	educ	educ	VERB
iajs-3652	209	4	pure	pure	ADJ
iajs-3652	209	5	sci	sci	PROPN
iajs-3652	209	6	.	.	PUNCT
iajs-3652	210	1	2019;9(1):71–81	2019;9(1):71–81	NUM
iajs-3652	210	2	.	.	PUNCT
iajs-3652	211	1	http://doi.org/10.32792/utq.jceps.09.01.08	http://doi.org/10.32792/utq.jceps.09.01.08	PROPN
iajs-3652	211	2	.	.	NOUN
iajs-3652	211	3	15	15	NUM
iajs-3652	211	4	.	.	X
iajs-3652	212	1	sultan	sultan	PROPN
iajs-3652	212	2	am	be	AUX
iajs-3652	212	3	,	,	PUNCT
iajs-3652	212	4	nabiel	nabiel	VERB
iajs-3652	212	5	y.	y.	PROPN
iajs-3652	212	6	tube	tube	PROPN
iajs-3652	212	7	method	method	NOUN
iajs-3652	212	8	and	and	CCONJ
iajs-3652	212	9	congo	congo	NOUN
iajs-3652	212	10	red	red	ADJ
iajs-3652	212	11	agar	agar	NOUN
iajs-3652	212	12	versus	versus	ADP
iajs-3652	212	13	tissue	tissue	NOUN
iajs-3652	212	14	culture	culture	NOUN
iajs-3652	212	15	plate	plate	NOUN
iajs-3652	212	16	method	method	NOUN
iajs-3652	212	17	for	for	ADP
iajs-3652	212	18	detection	detection	NOUN
iajs-3652	212	19	of	of	ADP
iajs-3652	212	20	biofilm	biofilm	NOUN
iajs-3652	212	21	production	production	NOUN
iajs-3652	212	22	by	by	ADP
iajs-3652	212	23	uropathogens	uropathogen	NOUN
iajs-3652	212	24	isolated	isolate	VERB
iajs-3652	212	25	from	from	ADP
iajs-3652	212	26	midstream	midstream	NOUN
iajs-3652	212	27	urine	urine	NOUN
iajs-3652	212	28	:	:	PUNCT
iajs-3652	212	29	which	which	DET
iajs-3652	212	30	one	one	PRON
iajs-3652	212	31	could	could	AUX
iajs-3652	212	32	be	be	AUX
iajs-3652	212	33	better	well	ADJ
iajs-3652	212	34	?	?	PUNCT
iajs-3652	212	35	.	.	PUNCT
iajs-3652	213	1	afr	afr	PROPN
iajs-3652	213	2	j	j	PROPN
iajs-3652	213	3	clin	clin	PROPN
iajs-3652	213	4	exp	exp	PROPN
iajs-3652	213	5	microbiol	microbiol	PROPN
iajs-3652	213	6	.	.	PUNCT
iajs-3652	214	1	2019;20(1):60–66	2019;20(1):60–66	X
iajs-3652	214	2	.	.	PUNCT
iajs-3652	214	3	https://doi.org/10.4314/ajcem.v20i1.10	https://doi.org/10.4314/ajcem.v20i1.10	NOUN
iajs-3652	214	4	.	.	PUNCT
iajs-3652	215	1	16	16	NUM
iajs-3652	215	2	.	.	PUNCT
iajs-3652	216	1	karagoz	karagoz	PROPN
iajs-3652	216	2	a	a	DET
iajs-3652	216	3	,	,	PUNCT
iajs-3652	216	4	artun	artun	NOUN
iajs-3652	216	5	ft	ft	PROPN
iajs-3652	216	6	,	,	PUNCT
iajs-3652	216	7	özcan	özcan	PROPN
iajs-3652	216	8	g	g	PROPN
iajs-3652	216	9	,	,	PUNCT
iajs-3652	216	10	melikoğlu	melikoğlu	NOUN
iajs-3652	216	11	g	g	PROPN
iajs-3652	216	12	,	,	PUNCT
iajs-3652	216	13	anıl	anıl	PROPN
iajs-3652	216	14	s	s	PART
iajs-3652	216	15	,	,	PUNCT
iajs-3652	216	16	kültür	kültür	VERB
iajs-3652	216	17	ş	ş	X
iajs-3652	216	18	,	,	PUNCT
iajs-3652	216	19	sütlüpınar	sütlüpınar	NOUN
iajs-3652	216	20	n.	n.	PROPN
iajs-3652	216	21	in	in	ADP
iajs-3652	216	22	vitro	vitro	X
iajs-3652	216	23	evaluation	evaluation	NOUN
iajs-3652	216	24	of	of	ADP
iajs-3652	216	25	antioxidant	antioxidant	ADJ
iajs-3652	216	26	activity	activity	NOUN
iajs-3652	216	27	of	of	ADP
iajs-3652	216	28	some	some	DET
iajs-3652	216	29	plant	plant	NOUN
iajs-3652	216	30	methanol	methanol	NOUN
iajs-3652	216	31	extracts	extract	NOUN
iajs-3652	216	32	.	.	PUNCT
iajs-3652	217	1	biotechnol	biotechnol	ADJ
iajs-3652	217	2	biotechnol	biotechnol	NOUN
iajs-3652	217	3	equip	equip	NOUN
iajs-3652	217	4	.	.	PUNCT
iajs-3652	218	1	2015;29(6):1184–1189	2015;29(6):1184–1189	PROPN
iajs-3652	218	2	.	.	PUNCT
iajs-3652	219	1	https://doi.org/10.1080/13102818.2015.1053143	https://doi.org/10.1080/13102818.2015.1053143	PROPN
iajs-3652	219	2	.	.	PROPN
iajs-3652	220	1	17	17	NUM
iajs-3652	220	2	.	.	PUNCT
iajs-3652	221	1	aljeboury	aljeboury	PROPN
iajs-3652	221	2	gh	gh	PROPN
iajs-3652	221	3	.	.	PUNCT
iajs-3652	222	1	a	a	DET
iajs-3652	222	2	comparative	comparative	ADJ
iajs-3652	222	3	study	study	NOUN
iajs-3652	222	4	of	of	ADP
iajs-3652	222	5	amoxicillin	amoxicillin	PROPN
iajs-3652	222	6	sensitivity	sensitivity	NOUN
iajs-3652	222	7	against	against	ADP
iajs-3652	222	8	escherichia	escherichia	NOUN
iajs-3652	222	9	coli	coli	NOUN
iajs-3652	222	10	isolates	isolate	NOUN
iajs-3652	222	11	isolated	isolate	VERB
iajs-3652	222	12	from	from	ADP
iajs-3652	222	13	urinary	urinary	ADJ
iajs-3652	222	14	tract	tract	NOUN
iajs-3652	222	15	infections	infection	NOUN
iajs-3652	222	16	.	.	PUNCT
iajs-3652	223	1	iraqi	iraqi	PROPN
iajs-3652	223	2	j	j	PROPN
iajs-3652	223	3	sci	sci	PROPN
iajs-3652	223	4	.	.	PUNCT
iajs-3652	224	1	2017;58(2b):417–426	2017;58(2b):417–426	NUM
iajs-3652	224	2	.	.	PUNCT
iajs-3652	225	1	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/6115	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/6115	PROPN
iajs-3652	225	2	.	.	PUNCT
iajs-3652	226	1	18	18	NUM
iajs-3652	226	2	.	.	X
iajs-3652	226	3	olowe	olowe	NOUN
iajs-3652	226	4	oa	oa	INTJ
iajs-3652	226	5	,	,	PUNCT
iajs-3652	226	6	adefioye	adefioye	PROPN
iajs-3652	226	7	oj	oj	NOUN
iajs-3652	226	8	,	,	PUNCT
iajs-3652	226	9	ajayeoba	ajayeoba	PROPN
iajs-3652	226	10	ta	ta	PROPN
iajs-3652	226	11	,	,	PUNCT
iajs-3652	226	12	schiebel	schiebel	PROPN
iajs-3652	226	13	j	j	PROPN
iajs-3652	226	14	,	,	PUNCT
iajs-3652	226	15	weinreich	weinreich	PROPN
iajs-3652	226	16	j	j	PROPN
iajs-3652	226	17	,	,	PUNCT
iajs-3652	226	18	ali	ali	PROPN
iajs-3652	226	19	a	a	X
iajs-3652	226	20	,	,	PUNCT
iajs-3652	226	21	schierack	schierack	NOUN
iajs-3652	226	22	p.	p.	NOUN
iajs-3652	226	23	phylogenetic	phylogenetic	ADJ
iajs-3652	226	24	grouping	grouping	NOUN
iajs-3652	226	25	and	and	CCONJ
iajs-3652	226	26	biofilm	biofilm	NOUN
iajs-3652	226	27	formation	formation	NOUN
iajs-3652	226	28	of	of	ADP
iajs-3652	226	29	multidrug	multidrug	NOUN
iajs-3652	226	30	resistant	resistant	ADJ
iajs-3652	226	31	escherichia	escherichia	NOUN
iajs-3652	226	32	coli	coli	NOUN
iajs-3652	226	33	isolates	isolate	NOUN
iajs-3652	226	34	from	from	ADP
iajs-3652	226	35	humans	human	NOUN
iajs-3652	226	36	,	,	PUNCT
iajs-3652	226	37	animals	animal	NOUN
iajs-3652	226	38	and	and	CCONJ
iajs-3652	226	39	food	food	NOUN
iajs-3652	226	40	products	product	NOUN
iajs-3652	226	41	in	in	ADP
iajs-3652	226	42	south	south	NOUN
iajs-3652	226	43	-	-	PUNCT
iajs-3652	226	44	west	west	PROPN
iajs-3652	226	45	nigeria	nigeria	PROPN
iajs-3652	226	46	.	.	PUNCT
iajs-3652	227	1	sci	sci	PROPN
iajs-3652	227	2	afr	afr	PROPN
iajs-3652	227	3	.	.	PUNCT
iajs-3652	228	1	2019;6	2019;6	PROPN
iajs-3652	228	2	:	:	PUNCT
iajs-3652	228	3	e00158	e00158	PROPN
iajs-3652	228	4	.	.	PUNCT
iajs-3652	229	1	https://doi.org/10.1016/j.sciaf.2019.e00158	https://doi.org/10.1016/j.sciaf.2019.e00158	PROPN
iajs-3652	229	2	.	.	PUNCT
iajs-3652	230	1	19	19	NUM
iajs-3652	230	2	.	.	X
iajs-3652	230	3	ali	ali	PROPN
iajs-3652	230	4	sa	sa	PROPN
iajs-3652	230	5	,	,	PUNCT
iajs-3652	230	6	al	al	PROPN
iajs-3652	230	7	-	-	PUNCT
iajs-3652	230	8	dahmoshi	dahmoshi	PROPN
iajs-3652	230	9	ho	ho	PROPN
iajs-3652	230	10	.	.	PROPN
iajs-3652	230	11	detection	detection	NOUN
iajs-3652	230	12	of	of	ADP
iajs-3652	230	13	efflux	efflux	NOUN
iajs-3652	230	14	pumps	pump	NOUN
iajs-3652	230	15	gene	gene	NOUN
iajs-3652	230	16	and	and	CCONJ
iajs-3652	230	17	relation	relation	NOUN
iajs-3652	230	18	with	with	ADP
iajs-3652	230	19	antibiotics	antibiotic	NOUN
iajs-3652	230	20	resistance	resistance	NOUN
iajs-3652	230	21	in	in	ADP
iajs-3652	230	22	uropathogenic	uropathogenic	ADJ
iajs-3652	230	23	escherichia	escherichia	NOUN
iajs-3652	230	24	coli	coli	NOUN
iajs-3652	230	25	(	(	PUNCT
iajs-3652	230	26	upec	upec	NOUN
iajs-3652	230	27	)	)	PUNCT
iajs-3652	230	28	isolated	isolate	VERB
iajs-3652	230	29	from	from	ADP
iajs-3652	230	30	patients	patient	NOUN
iajs-3652	230	31	with	with	ADP
iajs-3652	230	32	cystitis	cystitis	NOUN
iajs-3652	230	33	.	.	PUNCT
iajs-3652	231	1	iraqi	iraqi	PROPN
iajs-3652	231	2	j	j	PROPN
iajs-3652	231	3	sci	sci	PROPN
iajs-3652	231	4	.	.	PUNCT
iajs-3652	231	5	2022;63(5):2388–2397	2022;63(5):2388–2397	PROPN
iajs-3652	231	6	.	.	PUNCT
iajs-3652	232	1	https://doi.org/10.24996/ijs.2022.63.5.26	https://doi.org/10.24996/ijs.2022.63.5.26	PROPN
iajs-3652	232	2	.	.	PUNCT
iajs-3652	232	3	https://doi.org/10.1186/s13099-019-0290-0	https://doi.org/10.1186/s13099-019-0290-0	NUM
iajs-3652	232	4	https://doi.org/10.24996/ijs.2022.63.12.5	https://doi.org/10.24996/ijs.2022.63.12.5	NUM
iajs-3652	232	5	https://injns.uobaghdad.edu.iq/index.php/injns/article/view/275	https://injns.uobaghdad.edu.iq/index.php/injns/article/view/275	PROPN
iajs-3652	232	6	https://doi.org/10.33899/ijvs.2022.132967.2207	https://doi.org/10.33899/ijvs.2022.132967.2207	NOUN
iajs-3652	232	7	https://doi.org/10.24996/ijs.2019.60.10.18	https://doi.org/10.24996/ijs.2019.60.10.18	NOUN
iajs-3652	232	8	https://doi.org/10.1111/jam.13174	https://doi.org/10.1111/jam.13174	PROPN
iajs-3652	232	9	http://doi.org/10.32792/utq.jceps.09.01.08	http://doi.org/10.32792/utq.jceps.09.01.08	PROPN
iajs-3652	232	10	https://doi.org/10.4314/ajcem.v20i1.10	https://doi.org/10.4314/ajcem.v20i1.10	PROPN
iajs-3652	232	11	https://doi.org/10.1080/13102818.2015.1053143	https://doi.org/10.1080/13102818.2015.1053143	NOUN
iajs-3652	232	12	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/6115	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/6115	PROPN
iajs-3652	232	13	https://doi.org/10.1016/j.sciaf.2019.e00158	https://doi.org/10.1016/j.sciaf.2019.e00158	PRON
iajs-3652	232	14	https://doi.org/10.24996/ijs.2022.63.5.26	https://doi.org/10.24996/ijs.2022.63.5.26	PROPN
iajs-3652	232	15	ihjpas	ihjpas	PROPN
iajs-3652	232	16	.	.	PUNCT
iajs-3652	233	1	2025	2025	NUM
iajs-3652	233	2	,	,	PUNCT
iajs-3652	233	3	38(3	38(3	NUM
iajs-3652	233	4	)	)	PUNCT
iajs-3652	233	5	113	113	NUM
iajs-3652	233	6	20	20	NUM
iajs-3652	233	7	.	.	PUNCT
iajs-3652	233	8	raoof	raoof	PROPN
iajs-3652	233	9	maj	maj	PROPN
iajs-3652	233	10	,	,	PUNCT
iajs-3652	233	11	fayidh	fayidh	PROPN
iajs-3652	233	12	ma	ma	PROPN
iajs-3652	233	13	.	.	PROPN
iajs-3652	234	1	molecular	molecular	ADJ
iajs-3652	234	2	study	study	NOUN
iajs-3652	234	3	to	to	PART
iajs-3652	234	4	detect	detect	VERB
iajs-3652	234	5	blatem	blatem	NOUN
iajs-3652	234	6	and	and	CCONJ
iajs-3652	234	7	blactx	blactx	NOUN
iajs-3652	234	8	-	-	PUNCT
iajs-3652	234	9	m	m	PROPN
iajs-3652	234	10	genes	gene	NOUN
iajs-3652	234	11	in	in	ADP
iajs-3652	234	12	esβl	esβl	NOUN
iajs-3652	234	13	escherichia	escherichia	NOUN
iajs-3652	234	14	coli	coli	NOUN
iajs-3652	234	15	and	and	CCONJ
iajs-3652	234	16	their	their	PRON
iajs-3652	234	17	antimicrobial	antimicrobial	ADJ
iajs-3652	234	18	resistance	resistance	NOUN
iajs-3652	234	19	profile	profile	NOUN
iajs-3652	234	20	.	.	PUNCT
iajs-3652	235	1	j	j	PROPN
iajs-3652	235	2	phys	phys	PROPN
iajs-3652	235	3	conf	conf	NOUN
iajs-3652	235	4	ser	ser	NOUN
iajs-3652	235	5	.	.	PUNCT
iajs-3652	236	1	2021;1879(2):022051	2021;1879(2):022051	NUM
iajs-3652	236	2	.	.	PUNCT
iajs-3652	237	1	https://doi.org/10.1088/1742-6596/1879/2/022051	https://doi.org/10.1088/1742-6596/1879/2/022051	PROPN
iajs-3652	237	2	.	.	PROPN
iajs-3652	238	1	21	21	NUM
iajs-3652	238	2	.	.	PUNCT
iajs-3652	239	1	barzan	barzan	PROPN
iajs-3652	239	2	m	m	PROPN
iajs-3652	239	3	,	,	PUNCT
iajs-3652	239	4	rad	rad	PROPN
iajs-3652	239	5	m	m	PROPN
iajs-3652	239	6	,	,	PUNCT
iajs-3652	239	7	tabar	tabar	PROPN
iajs-3652	239	8	gh	gh	PROPN
iajs-3652	239	9	,	,	PUNCT
iajs-3652	239	10	azizzadeh	azizzadeh	PROPN
iajs-3652	239	11	m.	m.	NOUN
iajs-3652	239	12	phylogenetic	phylogenetic	ADJ
iajs-3652	239	13	analysis	analysis	NOUN
iajs-3652	239	14	of	of	ADP
iajs-3652	239	15	escherichia	escherichia	NOUN
iajs-3652	239	16	coli	coli	NOUN
iajs-3652	239	17	isolates	isolate	NOUN
iajs-3652	239	18	from	from	ADP
iajs-3652	239	19	healthy	healthy	ADJ
iajs-3652	239	20	and	and	CCONJ
iajs-3652	239	21	diarrhoeic	diarrhoeic	ADJ
iajs-3652	239	22	calves	calf	NOUN
iajs-3652	239	23	in	in	ADP
iajs-3652	239	24	mashhad	mashhad	PROPN
iajs-3652	239	25	,	,	PUNCT
iajs-3652	239	26	iran	iran	PROPN
iajs-3652	239	27	.	.	PUNCT
iajs-3652	240	1	bulg	bulg	PROPN
iajs-3652	240	2	j	j	PROPN
iajs-3652	240	3	vet	vet	PROPN
iajs-3652	240	4	med	me	VERB
iajs-3652	240	5	.	.	PUNCT
iajs-3652	241	1	2017;20(1):59–67	2017;20(1):59–67	NUM
iajs-3652	241	2	.	.	PUNCT
iajs-3652	241	3	http://dx.doi.org/10.15547/bjvm.952	http://dx.doi.org/10.15547/bjvm.952	NOUN
iajs-3652	241	4	.	.	PUNCT
iajs-3652	242	1	22	22	NUM
iajs-3652	242	2	.	.	X
iajs-3652	242	3	raoof	raoof	PROPN
iajs-3652	242	4	maj	maj	PROPN
iajs-3652	242	5	,	,	PUNCT
iajs-3652	242	6	fayidh	fayidh	PROPN
iajs-3652	242	7	ma	ma	PROPN
iajs-3652	242	8	.	.	PROPN
iajs-3652	242	9	investigation	investigation	NOUN
iajs-3652	242	10	of	of	ADP
iajs-3652	242	11	biofilm	biofilm	NOUN
iajs-3652	242	12	formation	formation	NOUN
iajs-3652	242	13	efficiency	efficiency	NOUN
iajs-3652	242	14	in	in	ADP
iajs-3652	242	15	esβls	esβls	NOUN
iajs-3652	242	16	of	of	ADP
iajs-3652	242	17	pathogenic	pathogenic	ADJ
iajs-3652	242	18	escherichia	escherichia	NOUN
iajs-3652	242	19	coli	coli	NOUN
iajs-3652	242	20	isolates	isolate	NOUN
iajs-3652	242	21	.	.	PUNCT
iajs-3652	243	1	int	int	NOUN
iajs-3652	243	2	j	j	PROPN
iajs-3652	243	3	drug	drug	PROPN
iajs-3652	243	4	deliv	deliv	VERB
iajs-3652	243	5	technol	technol	NOUN
iajs-3652	243	6	.	.	PUNCT
iajs-3652	244	1	2022;12(2):695–700	2022;12(2):695–700	NUM
iajs-3652	244	2	.	.	PUNCT
iajs-3652	245	1	http://dx.doi.org/10.25258/ijddt.12.2.41	http://dx.doi.org/10.25258/ijddt.12.2.41	NOUN
iajs-3652	245	2	.	.	PUNCT
iajs-3652	246	1	23	23	NUM
iajs-3652	246	2	.	.	PUNCT
iajs-3652	247	1	alrekaby	alrekaby	PROPN
iajs-3652	247	2	sm	sm	PROPN
iajs-3652	247	3	,	,	PUNCT
iajs-3652	247	4	alwendawi	alwendawi	PROPN
iajs-3652	247	5	sa	sa	PROPN
iajs-3652	247	6	.	.	PUNCT
iajs-3652	248	1	in	in	ADP
iajs-3652	248	2	vitro	vitro	X
iajs-3652	248	3	evaluation	evaluation	NOUN
iajs-3652	248	4	of	of	ADP
iajs-3652	248	5	inhibitory	inhibitory	ADJ
iajs-3652	248	6	activity	activity	NOUN
iajs-3652	248	7	of	of	ADP
iajs-3652	248	8	enteric	enteric	ADJ
iajs-3652	248	9	bifidobacterium	bifidobacterium	NOUN
iajs-3652	248	10	isolates	isolate	NOUN
iajs-3652	248	11	against	against	ADP
iajs-3652	248	12	shiga	shiga	ADJ
iajs-3652	248	13	toxin	toxin	NOUN
iajs-3652	248	14	producing	produce	VERB
iajs-3652	248	15	e.	e.	PROPN
iajs-3652	248	16	coli	coli	PROPN
iajs-3652	248	17	(	(	PUNCT
iajs-3652	248	18	stec	stec	ADJ
iajs-3652	248	19	)	)	PUNCT
iajs-3652	248	20	o157	o157	PROPN
iajs-3652	248	21	:	:	PUNCT
iajs-3652	248	22	h7	h7	PROPN
iajs-3652	248	23	.	.	PUNCT
iajs-3652	249	1	iraqi	iraqi	PROPN
iajs-3652	249	2	j	j	PROPN
iajs-3652	249	3	sci	sci	PROPN
iajs-3652	249	4	.	.	PUNCT
iajs-3652	250	1	2014;55(3a):999	2014;55(3a):999	NUM
iajs-3652	250	2	–	–	PUNCT
iajs-3652	250	3	1005	1005	NUM
iajs-3652	250	4	.	.	PUNCT
iajs-3652	251	1	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/11370	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/11370	PROPN
iajs-3652	251	2	.	.	PUNCT
iajs-3652	252	1	24	24	NUM
iajs-3652	252	2	.	.	PUNCT
iajs-3652	253	1	javed	javed	PROPN
iajs-3652	253	2	s	s	PROPN
iajs-3652	253	3	,	,	PUNCT
iajs-3652	253	4	mirani	mirani	PROPN
iajs-3652	253	5	za	za	PROPN
iajs-3652	253	6	,	,	PUNCT
iajs-3652	253	7	pirzada	pirzada	PROPN
iajs-3652	253	8	za	za	PROPN
iajs-3652	253	9	.	.	PUNCT
iajs-3652	254	1	phylogenetic	phylogenetic	ADJ
iajs-3652	254	2	group	group	NOUN
iajs-3652	254	3	b2	b2	NOUN
iajs-3652	254	4	expressed	express	VERB
iajs-3652	254	5	significant	significant	ADJ
iajs-3652	254	6	biofilm	biofilm	NOUN
iajs-3652	254	7	formation	formation	NOUN
iajs-3652	254	8	among	among	ADP
iajs-3652	254	9	drug	drug	NOUN
iajs-3652	254	10	-	-	PUNCT
iajs-3652	254	11	resistant	resistant	ADJ
iajs-3652	254	12	uropathogenic	uropathogenic	ADJ
iajs-3652	254	13	escherichia	escherichia	NOUN
iajs-3652	254	14	coli	coli	NOUN
iajs-3652	254	15	.	.	PUNCT
iajs-3652	255	1	libyan	libyan	PROPN
iajs-3652	255	2	j	j	PROPN
iajs-3652	255	3	med	med	PROPN
iajs-3652	255	4	.	.	PUNCT
iajs-3652	256	1	2021;16(1):1927483	2021;16(1):1927483	PROPN
iajs-3652	256	2	.	.	PUNCT
iajs-3652	257	1	https://doi.org/10.1080/19932820.2021.1927483	https://doi.org/10.1080/19932820.2021.1927483	PROPN
iajs-3652	257	2	.	.	PROPN
iajs-3652	258	1	25	25	NUM
iajs-3652	258	2	.	.	PUNCT
iajs-3652	259	1	ra'oof	ra'oof	PROPN
iajs-3652	259	2	wam	wam	PROPN
iajs-3652	259	3	.	.	PUNCT
iajs-3652	260	1	distribution	distribution	NOUN
iajs-3652	260	2	of	of	ADP
iajs-3652	260	3	algd	algd	NOUN
iajs-3652	260	4	,	,	PUNCT
iajs-3652	260	5	lasb	lasb	PROPN
iajs-3652	260	6	,	,	PUNCT
iajs-3652	260	7	pilb	pilb	ADJ
iajs-3652	260	8	and	and	CCONJ
iajs-3652	260	9	nan1	nan1	NOUN
iajs-3652	260	10	genes	gene	NOUN
iajs-3652	260	11	among	among	ADP
iajs-3652	260	12	mdr	mdr	PROPN
iajs-3652	260	13	clinical	clinical	ADJ
iajs-3652	260	14	isolates	isolate	NOUN
iajs-3652	260	15	of	of	ADP
iajs-3652	260	16	pseudomonas	pseudomona	NOUN
iajs-3652	260	17	aeruginosa	aeruginosa	NOUN
iajs-3652	260	18	in	in	ADP
iajs-3652	260	19	respect	respect	NOUN
iajs-3652	260	20	to	to	ADP
iajs-3652	260	21	site	site	NOUN
iajs-3652	260	22	of	of	ADP
iajs-3652	260	23	infection	infection	NOUN
iajs-3652	260	24	.	.	PUNCT
iajs-3652	261	1	tikrit	tikrit	NOUN
iajs-3652	261	2	med	med	PROPN
iajs-3652	261	3	j.	j.	PROPN
iajs-3652	261	4	2011;17(2):1–9	2011;17(2):1–9	PROPN
iajs-3652	261	5	.	.	PROPN
iajs-3652	262	1	26	26	NUM
iajs-3652	262	2	.	.	PUNCT
iajs-3652	263	1	salah	salah	PROPN
iajs-3652	263	2	al	al	PROPN
iajs-3652	263	3	-	-	PROPN
iajs-3652	263	4	deen	deen	PROPN
iajs-3652	263	5	h	h	PROPN
iajs-3652	263	6	,	,	PUNCT
iajs-3652	263	7	ibrahim	ibrahim	PROPN
iajs-3652	263	8	sk	sk	PROPN
iajs-3652	263	9	.	.	PROPN
iajs-3652	263	10	study	study	VERB
iajs-3652	263	11	the	the	DET
iajs-3652	263	12	ability	ability	NOUN
iajs-3652	263	13	of	of	ADP
iajs-3652	263	14	pseudomonas	pseudomona	NOUN
iajs-3652	263	15	aeruginosa	aeruginosa	NOUN
iajs-3652	263	16	isolated	isolate	VERB
iajs-3652	263	17	from	from	ADP
iajs-3652	263	18	different	different	ADJ
iajs-3652	263	19	clinical	clinical	ADJ
iajs-3652	263	20	cases	case	NOUN
iajs-3652	263	21	to	to	PART
iajs-3652	263	22	biofilm	biofilm	NOUN
iajs-3652	263	23	formation	formation	NOUN
iajs-3652	263	24	and	and	CCONJ
iajs-3652	263	25	detection	detection	NOUN
iajs-3652	263	26	of	of	ADP
iajs-3652	263	27	algd	algd	NOUN
iajs-3652	263	28	gene	gene	NOUN
iajs-3652	263	29	.	.	PUNCT
iajs-3652	264	1	indian	indian	PROPN
iajs-3652	264	2	j	j	PROPN
iajs-3652	264	3	forensic	forensic	ADJ
iajs-3652	264	4	med	med	ADJ
iajs-3652	264	5	toxicol	toxicol	NOUN
iajs-3652	264	6	.	.	PUNCT
iajs-3652	265	1	2022;16(1):1368–1374	2022;16(1):1368–1374	PROPN
iajs-3652	265	2	.	.	PUNCT
iajs-3652	266	1	https://doi.org/10.37506/ijfmt.v16i1.17683	https://doi.org/10.37506/ijfmt.v16i1.17683	X
iajs-3652	266	2	.	.	PUNCT
iajs-3652	267	1	27	27	NUM
iajs-3652	267	2	.	.	PUNCT
iajs-3652	268	1	abdul	abdul	PROPN
iajs-3652	268	2	razzaq	razzaq	PROPN
iajs-3652	268	3	ah	ah	INTJ
iajs-3652	268	4	,	,	PUNCT
iajs-3652	268	5	al	al	PROPN
iajs-3652	268	6	-	-	PUNCT
iajs-3652	268	7	kubaisi	kubaisi	PROPN
iajs-3652	268	8	awb	awb	PROPN
iajs-3652	268	9	,	,	PUNCT
iajs-3652	268	10	aziz	aziz	PROPN
iajs-3652	268	11	lm	lm	PROPN
iajs-3652	268	12	,	,	PUNCT
iajs-3652	268	13	hussain	hussain	PROPN
iajs-3652	268	14	as	as	ADP
iajs-3652	268	15	.	.	PUNCT
iajs-3652	268	16	bacteriological	bacteriological	ADJ
iajs-3652	268	17	and	and	CCONJ
iajs-3652	268	18	molecular	molecular	ADJ
iajs-3652	268	19	study	study	NOUN
iajs-3652	268	20	of	of	ADP
iajs-3652	268	21	pseudomonas	pseudomona	NOUN
iajs-3652	268	22	aeruginosa	aeruginosa	NOUN
iajs-3652	268	23	strains	strain	NOUN
iajs-3652	268	24	isolated	isolate	VERB
iajs-3652	268	25	from	from	ADP
iajs-3652	268	26	different	different	ADJ
iajs-3652	268	27	clinical	clinical	ADJ
iajs-3652	268	28	cases	case	NOUN
iajs-3652	268	29	in	in	ADP
iajs-3652	268	30	erbil	erbil	PROPN
iajs-3652	268	31	and	and	CCONJ
iajs-3652	268	32	kurkuk	kurkuk	NOUN
iajs-3652	268	33	.	.	PUNCT
iajs-3652	269	1	iraqi	iraqi	PROPN
iajs-3652	269	2	j	j	PROPN
iajs-3652	269	3	vet	vet	NOUN
iajs-3652	269	4	med	me	VERB
iajs-3652	269	5	.	.	PUNCT
iajs-3652	270	1	2018;41(2):124–130	2018;41(2):124–130	X
iajs-3652	270	2	.	.	PUNCT
iajs-3652	271	1	https://doi.org/10.30539/iraqijvm.v41i2.61	https://doi.org/10.30539/iraqijvm.v41i2.61	NOUN
iajs-3652	271	2	.	.	PUNCT
iajs-3652	272	1	28	28	NUM
iajs-3652	272	2	.	.	PUNCT
iajs-3652	272	3	ebraheem	ebraheem	PROPN
iajs-3652	272	4	aa	aa	PROPN
iajs-3652	272	5	,	,	PUNCT
iajs-3652	272	6	alwendawi	alwendawi	PROPN
iajs-3652	272	7	sa	sa	PROPN
iajs-3652	272	8	.	.	PUNCT
iajs-3652	273	1	screening	screen	VERB
iajs-3652	273	2	for	for	ADP
iajs-3652	273	3	in	in	ADP
iajs-3652	273	4	vitro	vitro	X
iajs-3652	273	5	biofilm	biofilm	NOUN
iajs-3652	273	6	formation	formation	NOUN
iajs-3652	273	7	ability	ability	NOUN
iajs-3652	273	8	of	of	ADP
iajs-3652	273	9	locally	locally	ADV
iajs-3652	273	10	isolated	isolate	VERB
iajs-3652	273	11	uropathogenic	uropathogenic	ADJ
iajs-3652	273	12	escherichia	escherichia	NOUN
iajs-3652	273	13	coli	coli	NOUN
iajs-3652	273	14	(	(	PUNCT
iajs-3652	273	15	upec	upec	NOUN
iajs-3652	273	16	)	)	PUNCT
iajs-3652	273	17	.	.	PUNCT
iajs-3652	274	1	iraqi	iraqi	PROPN
iajs-3652	274	2	j	j	PROPN
iajs-3652	274	3	sci	sci	PROPN
iajs-3652	274	4	.	.	PUNCT
iajs-3652	275	1	2015;56(2b):1310–1314	2015;56(2b):1310–1314	NUM
iajs-3652	275	2	.	.	PUNCT
iajs-3652	276	1	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/10081	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/10081	PROPN
iajs-3652	276	2	.	.	PUNCT
iajs-3652	277	1	29	29	NUM
iajs-3652	277	2	.	.	PUNCT
iajs-3652	278	1	gordon	gordon	PROPN
iajs-3652	278	2	dm	dm	PROPN
iajs-3652	278	3	,	,	PUNCT
iajs-3652	278	4	clermont	clermont	PROPN
iajs-3652	278	5	o	o	PROPN
iajs-3652	278	6	,	,	PUNCT
iajs-3652	278	7	tolley	tolley	PROPN
iajs-3652	278	8	h	h	PROPN
iajs-3652	278	9	,	,	PUNCT
iajs-3652	278	10	denamur	denamur	PROPN
iajs-3652	278	11	e.	e.	PROPN
iajs-3652	278	12	assigning	assign	VERB
iajs-3652	278	13	escherichia	escherichia	NOUN
iajs-3652	278	14	coli	coli	NOUN
iajs-3652	278	15	strains	strain	NOUN
iajs-3652	278	16	to	to	ADP
iajs-3652	278	17	phylogenetic	phylogenetic	ADJ
iajs-3652	278	18	groups	group	NOUN
iajs-3652	278	19	:	:	PUNCT
iajs-3652	278	20	multi‐locus	multi‐locus	NOUN
iajs-3652	278	21	sequence	sequence	NOUN
iajs-3652	278	22	typing	type	VERB
iajs-3652	278	23	versus	versus	ADP
iajs-3652	278	24	the	the	DET
iajs-3652	278	25	pcr	pcr	ADJ
iajs-3652	278	26	triplex	triplex	NOUN
iajs-3652	278	27	method	method	NOUN
iajs-3652	278	28	.	.	PUNCT
iajs-3652	279	1	environ	environ	PROPN
iajs-3652	279	2	microbiol	microbiol	PROPN
iajs-3652	279	3	.	.	PUNCT
iajs-3652	280	1	2008;10(10):2484–2496	2008;10(10):2484–2496	X
iajs-3652	280	2	.	.	PUNCT
iajs-3652	281	1	https://doi.org/10.1111/j.1462-2920.2008.01669.x	https://doi.org/10.1111/j.1462-2920.2008.01669.x	PROPN
iajs-3652	281	2	.	.	PUNCT
iajs-3652	282	1	30	30	NUM
iajs-3652	282	2	.	.	PUNCT
iajs-3652	282	3	abdul	abdul	PROPN
iajs-3652	282	4	-	-	PUNCT
iajs-3652	282	5	razzaq	razzaq	PROPN
iajs-3652	282	6	ms	ms	PROPN
iajs-3652	282	7	,	,	PUNCT
iajs-3652	282	8	abdul	abdul	PROPN
iajs-3652	282	9	-	-	PUNCT
iajs-3652	282	10	lateef	lateef	PROPN
iajs-3652	282	11	la	la	PROPN
iajs-3652	282	12	.	.	PUNCT
iajs-3652	283	1	molecular	molecular	ADJ
iajs-3652	283	2	phylogeny	phylogeny	NOUN
iajs-3652	283	3	of	of	ADP
iajs-3652	283	4	escherichia	escherichia	NOUN
iajs-3652	283	5	coli	coli	NOUN
iajs-3652	283	6	isolated	isolate	VERB
iajs-3652	283	7	from	from	ADP
iajs-3652	283	8	clinical	clinical	ADJ
iajs-3652	283	9	samples	sample	NOUN
iajs-3652	283	10	in	in	ADP
iajs-3652	283	11	hilla	hilla	NOUN
iajs-3652	283	12	,	,	PUNCT
iajs-3652	283	13	iraq	iraq	PROPN
iajs-3652	283	14	.	.	PUNCT
iajs-3652	284	1	afr	afr	PROPN
iajs-3652	284	2	j	j	PROPN
iajs-3652	284	3	biotechnol	biotechnol	PROPN
iajs-3652	284	4	.	.	PUNCT
iajs-3652	285	1	2011;10(70):15783–15787	2011;10(70):15783–15787	NUM
iajs-3652	285	2	.	.	PUNCT
iajs-3652	286	1	https://doi.org/10.5897/ajb11.1019/	https://doi.org/10.5897/ajb11.1019/	PROPN
iajs-3652	286	2	https://doi.org/10.1088/1742-6596/1879/2/022051	https://doi.org/10.1088/1742-6596/1879/2/022051	PROPN
iajs-3652	286	3	http://dx.doi.org/10.15547/bjvm.952	http://dx.doi.org/10.15547/bjvm.952	NOUN
iajs-3652	286	4	http://dx.doi.org/10.25258/ijddt.12.2.41	http://dx.doi.org/10.25258/ijddt.12.2.41	NOUN
iajs-3652	287	1	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/11370	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/11370	PROPN
iajs-3652	287	2	https://doi.org/10.1080/19932820.2021.1927483	https://doi.org/10.1080/19932820.2021.1927483	PROPN
iajs-3652	287	3	https://doi.org/10.37506/ijfmt.v16i1.17683	https://doi.org/10.37506/ijfmt.v16i1.17683	X
iajs-3652	288	1	https://doi.org/10.30539/iraqijvm.v41i2.61	https://doi.org/10.30539/iraqijvm.v41i2.61	ADP
iajs-3652	288	2	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/10081	https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/10081	PROPN
iajs-3652	288	3	https://doi.org/10.1111/j.1462-2920.2008.01669.x	https://doi.org/10.1111/j.1462-2920.2008.01669.x	NOUN
iajs-3652	288	4	https://doi.org/10.5897/ajb11.1019/	https://doi.org/10.5897/ajb11.1019/	X