IHJPAS. 36 (3) 2023 42 This work is licensed under a Creative Commons Attribution 4.0 International License *Corresponding Author: rana_alshwaikh@yahoo.com Abstract From 50 stool samples collected from children with diarrhea of both sexes who visited various hospitals in Baghdad, 26 isolates of E.coli were found to belong to the phylogenetic group E. The findings revealed that the percentage of E.coli for thephylogenetic group E is (52%) , making it the dominant group among the other phylogenetic groups. The findings demonstrated that 100% of the E.coli isolates from phylogenetic group E are resistant to penicillin, and only 15% are resistant to imipenem. Multi-drug resistance (MDR) was found to be 15%, while XDR reached 85%. The results of thephylogenetic group for the remaining species of isolates in this study were group A (2/50 and by 4%), group B2 (1/50 and by 2% ),group C (12/50 and by 24%), group D (6/50 and by 12%), group F (3/50 and by 6%), group B1 by 0%, and group Clade 1 by (0%). Keywords: Diarrhea, phylogenetic group E, E.coli. 1. Introduction Esherichia coli is one of the important bacteria belonging to the Enrerobacteriaceae family; it is part of the normal fora in the colon of humans and other animals. The characteristics of E.coli is negative, facultative anaerobic, widespread in nature, positive indole and methyl red, negative oxidase test, positive catalase test, negative Vogas-Proskauer, H2S, and gelatin [1]. E.coli is described as containing a large number of virulent factors, which are cytotoxic necrotizing factor, cilia that help attach to the surface of the host, flagella, capsula, lipopolysaccharides (LPS), haemolysin, toxins, siderophores, and also flagellar antigen H, somatic antigen O and capsular antigen K capsules, enzymes and TypeIII secretion systems, and alkaline protease. E.coli cause infection and disease in humans; the most important of these are intestinal diseases represented by watery and bloody diarrhea, which is called diarrheagenic E. coli (DEC), urinary tract infections (UTIs) which are called uropathogenic E. coli (UPEC), sepsis, and meningitis [3]. doi.org/10.30526/36.3.3107 Article history: Received 16 November 2022, Accepted 27 December 2022, Published in July 2023. Ibn Al-Haitham Journal for Pure and Applied Sciences Journal homepage: jih.uobaghdad.edu.iq Detection of Antibiotic Resistance of the Phylogenetic Group E among E. coli Isolated from Diarrheal Cases in Children Under Five Years Shahla Najim Abed Al-Azzawi Department of Biology, College of Education for Pure Science Ibn Al-Haitham, University of Baghdad, Baghdad, Iraq. shahla.najim1102a@ihcoedu.uobaghdsd.edu.iq Rana Mujahid Abdullah* Department of Biology, College of Education for Pure Science Ibn Al-Haitham, University of Baghdad, Baghdad, Iraq. rana_alshwaikh@yahoo.com https://creativecommons.org/licenses/by/4.0/ mailto:rana_alshwaikh@yahoo.com mailto:shahla.najim1102a@ihcoedu.uobaghdsd.edu.iq mailto:shahla.najim1102a@ihcoedu.uobaghdsd.edu.iq http://en.uobaghdad.edu.iq/?page_id=15060 http://en.uobaghdad.edu.iq/?page_id=15060 mailto:shahla.najim1102a@ihcoedu.uobaghdsd.edu.iq http://en.uobaghdad.edu.iq/?page_id=15060 http://en.uobaghdad.edu.iq/?page_id=15060 mailto:rana_alshwaikh@yahoo.com mailto:rana_alshwaikh@yahoo.com IHJPAS. 36 (3) 2023 43 Diarrhea is a general health problem and a common disease that affects all age groups; it is the largest and most influential percentage, especially in children under five years. Determine which groups of E. coli include Shiga-toxin. E. coli (STEC) or Enterohemorrhagic E. coli were classified into two main groups: O157, which causes hemorrhagic colitis (HC), and hemolytic uremic syndrome (HUC). The second group that includes the most common serotypes of EHEC/STEC related to human infection is O24, O26, O45, O103, O111, O121, O55, and O145, which are the most dangerous and cause diseases caused by food and are transmitted through food- producing animals such as cows and chickens, which are the main reservoirs of many foodborne pathogens that are represented by strains of E. coli producing Shiga-toxins that cause millions of sporadic disease conditions such as diarrhea and chronic complications. Studies have shown that 1.5 billion cases of diarrhea annually in children under 5 years of age are caused by intestinal pathogenic bacteria, which lead to more than 3 million deaths annually [1, 2]. Epidemiological studies have shown a rise in the rate of STEC infection in humans, leading to a broad challenge to public health services in many countries with high incidence and mortality rates worldwide [3]. The resistance of E.coli to antibiotics is one of the biggest health problems in the world, which prompted many researchers to generate new antibiotics to defeat the resistant strains. E.coli has several mechanisms of resistance to antibiotics, such as Amoxicillin, Ampicillin, Cefepime, Ceftriaxone, Cefotaxime, Imipenem, Gentamicin, Amikacin, Ciprofloxacin , Norfloxacin, Chloramphenicol, Amoxycillin, /Clavulanic acid,Aztreonam, Piperacillin, and Tazobactam. especially beta-lactams through their effect on the inhibition of transpeptidase and carboxypeptide enzymes, which affect the side connections in the cell wall that surrounds the bacteria, leading to its weakness and thus cell decomposition. Additional mechanisms that E.coli possess for resistance to beta-lactams include the production of beta-lactamase enzymes, a change in cell membrane permeability, an efflux pump, and target site modification [4]. The study aimed to determine the relationship between antibiotic resistance patterns and phylogenetic group E in E.coli that cause diarrhea in children under five years of age. 2. Materials and Methods 2.1. Collection of samples from patients In three hospitals in Baghdad (the Children's Protection Teaching Hospital/City of Medicine, the Central Children's Teaching Hospital, and Al-Alwiya Teaching Hospital),from January 2022 to the end of April 2022, 120 fecal samples were collected from children with diarrhea who were under five years old, both males and females. 2.2. Isolation and diagnosis of E.coli Oxidase, catalase, and IMViC, which included Indole methyl red, voges proskauar,and citrate utilization, ,were used to identify E.coli samples in addition to cultural media, MacConkey agar, Blood agar, ,and Eosin methylene blue agar [5]. with the vitek-2 compact system,identify the final diagnosis of isolates (France,Biomerieux). 2.3. Resistance of E. coli isolates to antibiotics The sensitivity test to bacterial isolates under study was carried out using the Kirby-Bauer method according to CLSI 2021 [6] for 15 antibiotics, which include:Amoxycillin (30μg), Ampicillin (10 μg), Cefepime (30 μg), Cefotaxime (30 μg), Ceftriaxone (30 μg) ,Imipenem (10 μg), Gentamicin IHJPAS. 36 (3) 2023 44 (10 μg), Amikacin (30 μg), Ciprofloxacin (5 μg), NORfloxacin (10 μg) Chloramphenicol (30 μg), Amoxycillin/ Clavulanic acid (30μg), Aztreonam (30 μg) Piperacilli/Tazobactam (100/10 μg ) , Trimethprim-Sulfamethozal (1.25/23.75 μg). 2.4. DNA isolation using a special kit to extract genomic DNA(HiPurA®Bacterial Genomic DNA Purification Kit ®): the isolation of bacteria is carried out in accordance with the manufacturer's recommendations. 2.5. Measuring the purity of the DNA output in the Nano drop device The purity of DNA was measured using Nano-drop, by applying 1μl of the extracted DNA to the sampling port of the device. - Detection of phylogenetic groups of genes in E.coli using a multiplex PCR device as shown in Table 1, including the sequence of specific primers. Table 1. Sequence of Primers used in this study. 2.6. Investigation of phylo-groups genes in E.coli Prepare a PCR mixture of 12.5 μl of Master Mix equipped by Promega (USA), 1 μl per F-Primer and R-Primer primer, 3 μl of DNA tamplate and 2.5 μl of Deionized Sterile Distilled Water and Equipped by Promega (USA) to obtain the final size of 25 μl then the contents of the PCR tubes were thoroughly mixed using the vortex and then placed in a PCR column. The optimal conditions for detecting the Phylo-group genes included (AceK, ArpAgpE, ChuA, trpBA, trpAgpC, TspE4C2, YjaA) for E. coli using Multiplex PCR are only one cycle for 4 minutes at 94°C for the first denaturation, 30 cycles including 5 seconds at 94 °C for the denaturation of the DNA template, 20 seconds at 57 °C for the primer to bind with the DNA template, 1 minute at 72°C to elongate the associated primer, and then transfer 5 μl of the duplication gene product for electrophoresis on the prepared agarose gel at 2% with a voltage difference of (100) volts and for 60 minutes, and use the volumetric guide (100-1500 base pairs). 3. Results and Discussion After conducting the tests to diagnose the bacteria, 26 isolates were obtained, and 52% belong to E. coli and the phylogenetic group E, which were collected from cases of diarrhea in children Gene name Primer sequence (5-3) Product size (base pair) Reference ChuA F ATGGTACCGGACGAACCAAC 288 [7] R TGCCGCCAGTACCAAAGACA [8] YjaA F CAAACGTGAAGTGTCAGGAG 211 [7] R AATGCGTTCCTCAACCTGTG TspE4C2 F CACTATTCGTAAGGTCATCC 152 [7] R AGTTTATCGCTGCGGGTCGC AceK F AACGCTATTCGCCAGCTTGC 400 [9] R TCTCCCCATACCGTACGCTA ArpAgpE F GATTCCATCTTGTCAAAATATGCC 301 [10] R GAAAAGAAAAAGAATTCCCAAGAG trpAgpC F AGTTTTATGCCCAGTGCGAG 219 [10] R TCTGCGCCCGGTCACGCCC trpBA F CGGCGATAAAGACATCTTCAC 489 [11] R GCAACGCGGCCTGGCGGAAG IHJPAS. 36 (3) 2023 45 under five years of age. Out of the 50 . coli that belong to the phylogenetic group E showed a clear variation in resistance to the antibiotics used in this study, as these isolates showed resistance to Ampicillin and Amoxicillin 100%, resistance to Chloramphenicol and Ceftriaxone 69%, and resistance to Azetreonam 77%, Ciprofloxacin 62%, Sulfamethoxzal-Trimethoprim 59%, Cefotaxime 54%, Amoxicillin-clavulante 53%, Cefepime 46%, Gentamicin 38%, Amikacin 35%, resistance to Piperacillin-tazobactam 31%, Norfloxacin 23%, and resistance to Imipenem 15% [11] (CLSI, 2022) as shown in Figure 1. Antibiotics Figure 1.Percentage of resistance to E. coli isolates from phylogenetic group E of antibiotics; Amoxycillin (AUG), Ampicillin (AMP), Cefepime (CPM), Ceftriaxone (CTR), Cefotaxime (CTX), Imipenem (IMP), Gentamicin (GM), Amikacin (AK), Ciprofloxacin (CIP), NORfloxacin (NX), Chloramphenicol (C), Amoxycillin /Clavulanic acid (AMC), Aztreonam ATM , Piperacillin / TazobactamP/T . The presence of genes (TrpBA, arpA, ArBAgpE, ChuA, TspE4c2, yjaA) was detected, and the results showed that isolates E7-E25 – E39– E40 possess genes (ArpA-TrpBA – ChuA) and they are resistant to three groups of antibiotics by 15%. The isolates E3-E6-E8-E12-E32-E33-E35-E37 that possess genes (ArpAgp.E-arpA-TrpBA-ChuA) were resistant to six groups of antibiotics by 31%, while the isolates E28-E16-E10-E34-E38-E36-E48 that possess genes (arpA-TrpBA-ChuA- TspE4C2) resistant to seven groups of antibiotics by 30%, whereas the isolates E1-E9-E15-E24- E41-E44-E50 that possess genes (ArpAgp.E-arpA-TrpE4C2) were resistant to eight groups of antibiotics by 27%, as shown in Figures (2) and (3), as shown in Figures (2) and (3). Table (1). The results of [13] in a study on 33 isolates of E.coli conducted in Iraq (Baghdad) and the results of [14] conducted in the city of Shiraz in southern Iran on 113 isolates and isolated cases of diarrhea in children determined the percentage of resistance to Ampicillin and Amoxycillin by 100%. The resistance of bacteria to the antibodies of the Cephalosporin group (Cefepime, Ceftriaxone, and 0 10 20 30 40 50 60 70 80 90 100 100 100 77 69 69 62 59 54 53 46 38 35 31 23 15 P er ce n ta g e % AMP AUG ATM C CTR CIP COT CTX AMC CPM GM AK P/T NX IPM IHJPAS. 36 (3) 2023 46 Cefotaxime) is indicated by the results of [15], which were conducted in India and isolated from 200 children, where the resistance rate to Cefotaxime was 67%, as well as [16], which showed that the resistance to Ceftriaxone 88%. Whereas, the results of the [17] study determined the resistance percentage of Cefepime to be 44%.While the findings of [15] determined a resistance rate of 15% to Monobactams, which include Aztreonam and Carbapenem, which include Imipenem, the results of [15] showed the resistance percentage was determined at 15%. One of the most important reasons for resistance to beta-lactam by E.coli is due to the production of beta-lactamase enzymes (Cephalosporinase, Penicillinase), as well as their production of broad-spectrum beta-lactamase enzymes (ESBLs), their possession of efflux pumps, and a change in the permeability of the outer membrane due to the loss of outer membrane openings [18]. The results of the current study showed the resistance of E.coli to the aminoglycoside group, which includes the antibodies Gentamicin and Amikacin. The results of [15] indicate that the percentages of resistance to the Gentamicin and Amikacin were 31% and 28%, respectively. Local isolates have shown resistance to the Aminoglycoside group, and the reason for this resistance is due to the production of the modified enzymes Phosphotransferase and N-acetyl transferase, which have the ability to modify the antibiotic molecule to an ineffective form [19]. E.coli isolates in the current study showed resistance to Quinolone antibiotics that include both Ciprofloxacin and Norfloxacin; the results of [17] determined the resistance percentage of Ciprofloxacin at 49%, and the study of [15] indicated the resistance percentage of Norfloxacin (25%). E.coli resistance to quinolone antibiotics is caused by stopping the action of the DNA gyrase enzyme or by a mutation in the DNA gyrase enzyme [20]. E.coli isolates have shown resistance to Chloramphenicol this agrees with the [14] study on 113 patients conducted in southern Iran, in which they mentioned the resistance percentage of this antibiotic as 36%. While [16] showed a resistance to Chloramphenicol by 87%, the resistance to chloramphenicol is caused by the disruption of the activity of the enzyme chloramphenol acetyl transferase (CAT) by an enzyme that enters new acetylcysteine groups in antibiotics [21]. In the current study, the isolates of E.coli bacteria have shown resistance to Trimethoprim-Sulfamethoxazole, and the results of the [17] study determined the resistance percentage of this antibiotic to be 66%. This indicates that the mechanism of action of this group is evidenced by mixing these two antibiotics to become more powerful than the action of each antibiotic separately and thus work to inhibit the metabolic pathway of making folic acid, which plays an important role in the synthesis of bacterial cells nucleic acid [22]. E.coli isolates have shown resistance to Piperacillin and Tazobactam, as indicated by the results of [15], which indicate that the resistance percentage to this antibiotic is 21%. As for Amoxicillin and Clavulanic Acid, the results of the [17] study that determined the resistance percentage of this antibiotic to 23% indicate that these inhibitors work to form a stable covalent bond between the inhibitor and the active site of enzymes of beta-lactamase, which in turn inhibits these enzymes and at the same time works to protect the antibiotic [23]. IHJPAS. 36 (3) 2023 47 Figure 2.Electrophoresis of the polymerase chain reaction product of trpBA gene (489bp), Acek gene (400bp), ArBAgpE gene (301bp), ChuA gene ( 288bp), TrpAgpc gene (219bp), YjaA gene (211bp) and TSPE4C2 gene (152bp) for the isolates of E.coli on the agarose gel at a concentration of 2% and a voltage d 100 V for 60 minutes. L : ladder marker (100-1500 bp). Figure 3. Electrophoresis of the polymerase chain reaction product of trpBA gene (489bp), Acek gene (400bp), ArBAgpE gene (301bp), ChuA gene ( 288bp), TrpAgpc gene (219bp), YjaA gene (211bp) and TSPE4C2 gene (152bp) for the isolates of E coli on the agarose gel at a concentration of 2% and a voltage 100 V for 60 minutes. L:ladder marker (100-1500 bp). IHJPAS. 36 (3) 2023 48 Table 1. The percentages of the phylogenetic group E resistant to different groups of antibiotics. Isoletes Possession of genes Antibiotics Percentage of resistance % E7 – E25 -9 E3-E40 ArpA - TrpBA - ChuA 3 15 E3-E6-E8-E12- E32-E33-E35- E37 YjaA- TrpBA – arpA- TspE4C2- ArpAgp.E 6 31 E10-E16-E28- E34-E36 - E38- E48 arpA - TrpBA - ChuA- TspE4C2 7 30 E1-E9-E15-E24- E41 – E44-E50 - ArpAgp.E - arpATrpBA - TspE4C2 - ChuA 8 27 Resistance to antibiotic groups can be gained through mutations or gene transmission by conjugation, transduction, transformation, or the possession of plasmids, transposons, or integrons that are carriers of antibiotic-resistant genes. Several studies have indicated a lack of association between sensitivity to antibiotics and the phylogenetic group assigned to the isolates of E.coli [24]. The information obtained emphasizes the importance of regular monitoring of the distribution of the phylogenetic group and antibiotic resistance to commensal and pathogenic strains of E. coli in each geographical region, as such studies can be useful in developing appropriate guidelines for the administration of antibiotics among the child population in the region. 4. Conclusions The phylogenetic group was divided into 8 groups, including A, B1, B2, C, D, F, Clade 1, and the E group, which was the common group. The E group had TrpBA, ArpA, ArBAgpE, ChuA, TspE4c2, and yjaAgenes. References 1. Matsukawa, M.; Igarashi, M.; Watanabe, H.; Qin, L.; Ohnishi, M; Terajima, J.; Iyoda, S.; Morita-Ishihara, T.; Tateda, K.; Ishii, Y.; Saga, T.; Aoki, K.; Bonomo, R.A. Epidemiology and genotypic characterization of dissemination patterns of uropathogenic Escherichia coli in a community. Epidemiology and Infection 2019, 147(e148), 1–9. 2. Moxley, R.A.; Bargar, T.W.; Kachman, S.D.; Baker, D.R.; Francis, D.H. Intimate Attachment of Escherichia coli O157:H7 to Urinary Bladder Epithelium in the Gnotobiotic Piglet Model. Microorganisms2020, 8(2), 263. 3. Syahrul, F.; Wahyuni, C.U.; Notobroto, H.B.; Wasito, E.B.; Adi, A.C.; Dwirahmadi, F. (2020). Transmission media of foodborne diseases asan index prediction of diarrheagenic Escherichia coli: Study at elementary school, Surabaya, Indonesia. Int. J. Environ. Res. PublicHealth 2020, 17, 8227. 4. Estaleva, C.E.L.; Zimba, T.F.; Sekyere, J.O.; Govinden, U.; Chenia, H.Y.; Simonsen, G.S.; Haldorsen, B.; Essack, S.Y.; Sundsfjord, A.High prevalence of multidrug resistant ESBL- and plasmid mediated AmpC-producing clinical isolates of Escherichia coli at Maputo Central Hospital, Mozambique. BMC Infect. Dis. 2021,21, 16. 5. Tille, P.M. Baily and Scott’s Diagnostic Microbiology. 41st ed. Elsevier, Inc. China, 2017, 1115. CLSI.(2021).Performance Standards for Antimicrobial Susceptibility Testing. 30th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute. IHJPAS. 36 (3) 2023 49 6. Clermont, O.; Christenson J.K.; Denamur, E.The Clermont Escherichia coli phylotyping method revisited: improvement of specificity and detection of new phylogroups. Environ. Microbiol. Rep.2013, 5, 58–65. 7. Clermont, O., Bonacorsi, S.; Bingen, E. Rapid and simple determination of the Escherichia coli phylogenetic group. Applied and Environmental Microbiology2000, 66(10), 4555-4558. 8. Clermont, O., Bonacorsi, S.; Bingen, E. Characterization of an anonymous molecular marker stronglylinked to Escherichia coli strains causing neonatal meningitis. J. Clin. Microbiol.2004,42, 1770–1772. 9. Lescat, M.; Clermont, O.; Woerther, P.L.; Glodt, J.; Dion, S.; Skurnik, D. Commensal Escherichia coli strains in Guiana reveal a high genetic diversity with hostdependant population structure. Environ Microbiol Rep.2012, DOI: 10.1111/j.1758-2229.2012.00374.x 10. Clermont, O.; Lescat, M.; O’Brien, C.L.; Gordon, D.M.; Tenaillon, O.; Denamur, E. Evidence for a humanspecific Escherichia coli clone. Environ Microbiol. 2008,10, 1000–10006. 11. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, M100,32nd ed.; Clinicaland Laboratory Standards Institute: Wayne, PA, USA, 2022, ISBN 978-1-68440-033-1. 12. AL-Imam, M.J.K. Evaluation of Lactobacillus spp. supernatant effect on gene expression of some virulence determinants in Enteropathogenic and Enterohaemorrhagic Escherichia coli from diarrheal patients. PhD thesis. College of Science, University of Baghdad, 2020. 13. Javadi, K.; Mohebi, S.;Motamedifar, M.; Hadi, N. Characterization and antibiotic resistance pattern of diffusely adherent Escherichia coli (DAEC), isolated from paediatric diarrhoea in Shiraz, southern Iran. New Microbes and New Infections2020, 38, 100780. 14. Snehaa, K.; Singh, T.; Dar, S.A.; Haque, S.; Ramachandran, V.G.; Saha, R.; Shah, D.; Das, S. Typical and atypical enteropathogenic Escherichia coli in children with acute diarrhoea: changing trend in East Delhi. Biomedical Journal2021, 44(4), 471-478. 15. Webale, M.K.; Guyah, B.; Wanjala, C.; Nyanga, P.L.; Webale, S.K.; Abonyo, C.; Kitungulu, N.; Kiboi, N.; Bowen, N. Phenotypic and genotypic antibiotic resistant diarrheagenic Escherichia coli pathotypes isolated from children with diarrhea in Nairobi City, Kenya. Ethiopian Journal of Health Sciences2020, 30(6). 16. Kurowski, K.M.; Marusinec, R.; Amato, H.K.; Garcia, C.S; Loayza, F.; Salinas, L; Trueba, G., Graham, J.P. Social and Environmental Determinants of Community-Acquired Antimicrob ial- Resistant Escherichia coli in Children Living in Semirural Communities of Quito, Ecuador. The American journal of tropical medicine and hygiene2021, 105(3), 600. 17. AL-Shwaikh, R. M. Antibiotics and their uses. Dar Dijla for Publishing and Distribution, Amman,2016, 112 pages. 18. Ejaz, H.; Younas, S.; Qamar, M.U.; Junaid, K.; Abdalla, A.E.; Abosalif, K.O.A.; Alameen, A.A.M.; Elamir, M.Y.M.; Ahmad, N.;Hamam, S.S.M. Molecular Epidemiology of Extensively Drug-Resistant mcr Encoded Colistin-Resistant Bacterial Strains Co-Expressing Multifarious -Lactamases. Antibiotics, 2021, 10, 467. 19. Faife, S.L.; Zimba, T.; Sekyere, J.O.; Govinden, U.; Chenia, H.Y.; Simonsen, G.S.; Sundsfjord, A.; Essack, S.Y. ß - lactam and fluoroquinolone resistance in Enterobacteriaceae from imported and locally-produced chicken in Mozambique. J. Infect. Dev. Ctries. 2020, 14, 471– 478. 20. Pandit, R.; Awal, B.; Shrestha, S.S.; Joshi, G.; Rijal, B.P., Parajuli, N.P. Extended-Spectrum β -Lactamase (ESBL) Genotypes among Multidrug-Resistant Uropathogenic Escherichia coli IHJPAS. 36 (3) 2023 50 Clinical Isolates from a Teaching Hospital of Nepal. Interdisciplinary Perspectives on Infectious Diseases2020. DOI: 10.1155/2020/6525826 21. Kutilova, I.; Medvecky, M.; Leekitcharoenphon, P.; Munk, P.; asarikova, M.; Davidova- Gerzova, L.; Jamborova, I.; Bortolaia,V.; Pamp, S.J.; Dolejska, M. Extended-Spectrum Beta- Lactamase-Producing Escherichia Coli and Antimicrobial Resistance in Municipal and Hospital Wastewaters in Czech Republic: Culture-Based and Metagenomic Approaches. Environ. Res. 2021,193, 110487. 22. Rodrigues, C.F. Self-medication with antibiotics in Maputo, Mozambique: Practices, rationales and relationships. Palgrave Commun. 2020,6, 1–12. 23. Massot, M.; Daubié, A.S.; Clermont, O.; Jaureguy, F.; Couffignal, C.; Dahbi, G.; Mora, A.; Blanco, J.; Branger, C.; Mentré, F.; Eddi, A. Phylogenetic, virulence and antibiotic resistance characteristics of commensal strain populations of Escherichia coli from community subjects in the Paris area in 2010 and evolution over 30 years. Microbiology,2016, 162(4), 642.