39 This work is licensed under a Creative Commons Attribution 4.0 International License IHJPAS. 37 (2) 2024 Ibn Al-Haitham Journal for Pure and Applied Sciences Journal homepage: jih.uobaghdad.edu.iq PISSN: 1609-4042, EISSN: 2521-3407 Antimicrobial Susceptibility of Enterococcus faecium Isolated from Bee-gut on PhzM Gene of Pseudomonas aeruginosa Isolates from Infected Wounds Amna Waheed Anwer 1* , Ghada Mohamed Saleh 2 and Mais Emad Ahmed 3 1,2,3 Department of Biology, College of Science , University of Baghdad, Baghdad, Iraq *Corresponding Author. Received: 3 April 2023 Accepted: 7 May 2023 Published: 20 April 2024 doi.org/10.30526/37.2.3379 Abstract The aim of this study was to isolate and characterize Fructophilic lactic acid bacteria (FLAB) species from the honeybee gut. Based on the results of this study, it was found that the FLAB species obtained from honey were Gram-positive and catalase-negative, and this identification was confirmed through 16S rRNA gene sequencing. It was performed a primary screening to evaluate the effect of the cell-free supernatant (CFS) obtained from Enterococcus faecium (E5), and it was observed that the CFS showed a high inhibition zone of 23 mm against multidrug- resistant Pseudomonas aeruginosa, as determined by the agar well diffusion assay. This study also conducted further investigation to determine the optimal conditions for the production of cell-free supernatant (CFS). The results indicated that yeast extract was the most effective nitrogen source, while glucose was the preferred carbon source for CFS production. The optimal pH for CFS production was 5, and the incubation period of 72 hours was determined to be the most suitable for obtaining a high yield of CFS. Another aspect of the study aimed to identify multidrug-resistant Pseudomonas aeruginosa isolates from burn wound infections. The isolates were identified using the VITEK 2 system, and the presence of the phzM gene was detected in all nine strains. Furthermore, the study evaluated the effect of the cell-free supernatant (CFS) of the selected strain (E5) on the expression of the phzM gene. According to the study, the cell-free supernatant (CFS) significantly decreased the expression of the phzM gene in isolates of multidrug-resistant Pseudomonas aeruginosa. Enterococcus faecium could be a useful antimicrobial agent for treating P. aeruginosa infections that are resistant to multiple drugs. Keywords: Pseudomonas aeruginosa, phzM gene, bee-gut, multi-drug resistance. 1. Introduction Enterococcus faecium is found in the gut flora of both humans and animals and is also known as an opportunistic pathogen. They are mainly associated with hospital-acquired infections in humans as well as many in animals, such as mastitis in cattle, diarrhea in swine and cattle, and septicemic diseases in poultry [1]. Certain virulence factors can be produced by E. faecium that potentially increase their pathogenicity, thereby contributing to the development of diseases [2]. The present study aimed to analyze the antagonistic activity of lactic acid bacteria (LAB), which are present in the honeybee environment, against both known honeybee pathogens and opportunistic pathogens. The LAB strains used in the experiments were previously isolated and characterized from the honeybee environment [3]. This study examined the postbiotic properties https://jih.uobaghdad.edu.iq/index.php/j/index#1609-4042 https://jih.uobaghdad.edu.iq/index.php/j/index#2521-3407 https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq https://orcid.org/0009-0003-5119-1898 mailto:amnawaheedanwer@gmail.com https://orcid.org/ mailto:Ghada90m@gmail.com https://orcid.org/0000-0003-4961-4532 mailto:mais.emad@sc.uobaghdad.edu.iq IHJPAS. 37 (2) 2024 40 of lactic acid bacteria (LAB) metabolites in inhibiting the growth of honeybee pathogens at both physiological and neutral pH levels. The authors believe that the topic of LAB's antagonistic activity against honeybee pathogens has not been extensively studied, noting that no research has been conducted to assess the postbiotic impact, like cell-free supernatants, on the growth inhibition of pathogenic microorganisms [3]. Pseudomonas aeruginosa is most frequently found in patients with compromised immune systems who had an extensive medical operation or those with diseases such as diabetes. It is a non-fermenting, Gram-negative pathogen and is considered one of the most hospital-associated infections [4]. P.aeruginosa Infections usually develop in connection with medical devices such as central lines, ventilators, and urine catheters, and more recently, coinfection in patients hospitalized with COVID-19 has been discovered to be prevalent with P.aeruginosa [5]. Without the existence of new therapeutic agents, the problem of drug resistance may worsen. Recently, targeting virulence factors has appeared to be a new line of action against MDR P.aeruginosa strains. [6]. P.aeruginosa has the ability to synthesize several compounds, including pyocyanin. It stimulates the production of reactive oxygen species (ROS) by host cells and inhibits the expression of catalase, which is an enzyme that neutralizes ROS by oxidizing NADPH [7]. In addition, a decrease in lung function and a contribution to the dominance of P.aeruginosa in the CF lung are related to pyocyanin [8]. The aim of this research is to detect the effect of FLAB suspension on upregulation or downregulation of the pyocyanin gene. 2. Materials and Methods 2.1. Sample collection Ten female worker bees were collected during the summer foraging season and transported to the laboratory for analysis. To avoid contamination by external microbes, the bees were treated with 70% ethanol for 60 seconds. In a laminar flow hood, the researchers dissected the bees and isolated the stomach and midgut from the rest of the alimentary canal for further analysis [9]. 2.2. Isolation and identification of E. faecium from honeybee gut The procedure of isolation was done according to [3]. To isolate bacterial cultures from the nectar stomach of each bee, the process involved dissecting under sterile conditions within a laminar flow hood, using sterile forceps. The nectar stomach was separated from the remaining gut contents and placed in sterile tubes containing MRS broth supplemented with 2% fructose and 0.1% cysteine at a volume of 10 ml. Incubation of the tubes occurred for 24-48 hours at a temperature range of 28-30°C anaerobically to promote lactic acid production [10]. The pure cultures obtained were regrown in MRS broth, and after incubation, 200 µl of glycerol was added to 800 µl of MRS broth culture in a 2 ml microtube. 2.3. 16S rRNA gene sequencing The characterization of unidentified bacteria using 16S rRNA gene sequencing was carried out according to previous work [11], with some modifications that are described here briefly. Colonies of each unidentified bacteria were re-cultured for 24–48 hours, depending on their growth conditions. The genomic DNA of bacteria was extracted using the ABIOpureTM Total DNA Kit (USA) before PCR amplification of 16S rRNA genes. Amplification of isolates was performed using universal primers (5’-AGAGTTTGATCCTGGCTCAG-3' and 5'- TACGTTACCTTGTTACGACTT-3’) [12]. PCR products were sent for Sanger sequencing using ABI3730XL, automated DNA sequences, by Macrogen Corporation, Korea. The results were received by email and then analyzed using Geneious software. IHJPAS. 37 (2) 2024 41 2.4. Antimicrobial spectrum analyses The antimicrobial activity of Fructophilic lactic acid bacteria suspension was obtained by growing FLAB in tubes with MRS broth, which contains 0.1% cysteine and 2% fructose, anaerobically in an anaerobic jar at 28–30 °C for 24-48 hours, then centrifuged at 6000 rpm for fifteen minutes, after which it was transferred to fresh tubes, filtered with sterile syringe filters with a pore size of 0.22 µm, and kept at 4°C in sterilized test tubes [13]. 2.5. Screening for CFS production After obtaining CFS, the antimicrobial activity of the cell-free supernatant was determined using the agar-well diffusion assay. 50µl of the supernatant was placed in 6mm-diameter wells cut with a cork borer into cooled Mueller Hinton agar plates inoculated with 1.5*10 8 (cell/ml) that confronted McFarland tube (0.5 turbidity) of the MDR P. aeruginosa. The supernatant was allowed to diffuse by leaving the plates at room temperature for 1h before incubation at 37 ºC for 24h and examined for the presence of an inhibition zone [14]. 2.6. Synthesis of bacteriocins is optimized numerous factors were examined to determine the ideal settings for high-level bacteriocin synthesis, and these are [15] 2.6.1. Determination of optimum pH The production and growth of cell-free supernatants from various isolates were examined to determine the impact of pH. To achieve different pH values of 5, 6, 7, and 8, MRS broth was prepared in 10 ml tubes and adjusted with 0.5 N HCl or 0.5 N NaOH after autoclaving. The tubes were then inoculated with selected strains and incubated at 37°C under anaerobic conditions for 24 hours. 2.6.2. Determination of optimum incubation To investigate the impact of the incubation period, 10 ml of a selected strain (1.5 x 10 9 CFU/ml) was incubated in a MRS broth medium for different durations (18, 24, 48, and 72 hours) at 37ºC under anaerobic conditions. 2.6.3. Effect of Nitrogen Source & carbon source (sugars) Included (Tryptone, yeast extract, sucrose, and glucose) with concentrations were used, with 1% of each one of them added to MRS broth. 2.7. P. aeruginosa isolation Ten samples were collected from patients suffering from wound infections in an indoor setting after obtaining ethical approval from the Ethical Committee in the Department of Biology, College of Science, University of Baghdad. Before sample collection, signed consent was obtained from the patients. The samples were cultured under sterile conditions on nutrient agar, followed by culturing on cetrimide agar and MacConkey agar [16]. The VITEK 2 system was then used to confirm the identification of the bacterial isolates [17]. 2.8. Detection of phzM gene The tested gene was amplified by conventional PCR using primers obtained from [18]. PCR amplifications were carried out in 20 µl volumes containing 10 µl of GoTaq Green Master Mix (2X), 1µl of primer (10 pmol), 6 µl of nuclease-free water, and 2 µl of template DNA. The PCR cycling was performed using a PCR Express (Thermal Cycler, Thermo Fisher Scientific, USA), following this temperature program: initial denaturation at 94°C for 4 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55, 58, 60, 63, or 65°C for 30 seconds, and extension at 72°C for 30 seconds. The final extension step was carried out at 72°C for 7 minutes, followed by a 10-minute incubation at 4°C to stop the reactions. The primer sequence for phzM used in this study is mentioned in Table 1. IHJPAS. 37 (2) 2024 42 Table 1. Primer used in PCR and real-time PCR. Primer Name Sequence 5`-3` Annealing Temp.(°C) Product size (bp) Reference phzM-F ACGGCTGTGGCGGTTTA 60 ~180 phzM-R CCGTGACCGTCGCATT [18] fbp-F fbp-R CCTACCTGTTGGTCTTCGACCCG GCTGATGTTGTCGTGGGTGAGG 53 53 [19] 2.9 RT-qPCR protocol Real-time quantification of cDNA was carried out on the GoTaq® 1-Step RT-qPCR System (Promega, USA) using the SYBR green PCR master mix. Real-time PCR was used to investigate the expression levels of the phzM and fbp genes. In order to assess the gene expression of the phzM gene, the results were normalized using the fbp gene, which is considered a housekeeping gene. Primers of these genes Table 1. were provided in a lyophilized form and dissolved in sterile nuclease-free water to give a final concentration of 100 pmol/μl. Afterwards, they were stored in a deep freezer until used in qPCR. The reaction mixture was summarized in Table 2. Table 2. The components of master mix in qRT-PCR. Master mix components Unit Volume / 1 Sample µl qPCR Master Mix X 5 RT mix x 0.25 MgCl2 0.25 Forward primer µM 0.5 Reverse primer µM 0.5 Nuclease Free Water 2.5 RNA ng/µl 1 Total volume 10 3. Results and Discussion 3.1. Identification of Bacterial Isolates The isolation FLAB species (E1 –E10) characterization such as Gram-positive, catalase- negative, and appearing as large, white colonies were isolated on MRS. The result agrees with Elzeini et al. [20]. LAB was isolated from the gastrointestinal tract of the bee. After sequencing the 16S rRNA gene, the isolate was identified, and the resulting sequence was submitted to the NCBI database. The accession number showed a high level of similarity to E. faecium. This finding is consistent with the identification of enterococci isolates from both dairy and honeybee samples using 16S rRNA gene sequencing, as depicted in Figure 1 [21]. Samples were collected from patients with burn and wound infections, and several isolates of P. aeruginosa were identified. The colony shapes of these isolates were determined using selective media. On MacConkey agar, the isolates that were able to grow were observed as pale colonies, while on Cetrimide agar, P. aeruginosa isolates appear as mucoid, smooth colonies with flat edges and elevated centers and exhibit the ability to produce a blue-green pigment after 72 hours of incubation. The confirmation of all isolates was done and diagnosed using the VITEK 2. From the 10 clinical isolates named (Z1, Z2, Z3, Z5, Z4, Z9, 72, 77, and 79), the current results agree with [17]. The results of the Vitek 2 automated system show a probability of about 95%–99% belonging to the genus Pseudomonas aeruginosa. IHJPAS. 37 (2) 2024 43 Figure 1. Results of amplification of 16SrRNA gene of bacterial samples were fractionated on 1,5% agarose gel electrophoresis stained with E th..Br. M: 100 bp ladder marker. Lanes 5 resemble 1500 bp PCR. 3.2. Screening of antimicrobial activity of LAB isolated from honey-bee E. faecium strain screening the best CFS crude antimicrobial activities’ spectrum as each of them had activity against multidrug-resistant P. aeruginosa shown in Figure 2. The cell-free culture supernatant (CFS) antibacterial activities were assessed by an agar-well diffusion assay [22]. The 23-mm inhibition zone diameter at the pH of the CFS was modified to 5. Other results agree that FLAB strains have been isolated from bees and selected for their broad antimicrobial activity against pathogenic bacteria [23, 24]. Figure 2. Effect of antimicrobial activity of FLAB on P. aeruginosa on MHA anaerobic condition at 37C. 3.3. Optimum conditions for bacteriocin production 3.3.1. Optimal pH The results indicate that the diameter of the inhibition zone reached 22.5 mm, and pH 5 was the best value for production. The lower inhibition zone 15.12 mm at pH 8 is shown in Figure 3. According to the results that correlate with [25], the antimicrobial activity of both CFS and crude enterocin was stable at pH levels varying from 4 to 8. Figure 1. Results of the amplification of 16SrRNA gene of bacterial samples were fractionated on 1.5% agarose gel electrophoresis stained with Eth.Br. M: 100bp ladder marker. Lanes 5 resemble 1500bp PCR IHJPAS. 37 (2) 2024 44 Figure 3. Effect of pH on CFS production. 3.3.2. Optimum incubation time The production of CFS (cell-free supernatant) was observed at various incubation times, and it was noted that the highest production occurred after 72 hours of incubation, resulting in the largest inhibition zone measuring 24 mm. However, the activity of CFS decreased after 48 and 18 hours, with the lowest inhibition zone measuring 10 mm (as illustrated in Figure 4). These findings agree with [26] and [27]. The observations found the highest activity from E. faecalis was observed after a three-day incubation period. Figure 4. Effect of incubation time on CFS production. 3.3.3. Nitrogen &carbon source The optimum nitrogen Sources such as yeast extract reached 24 mm zone and was the best nitrogen source than tryptone; scours best carbon source than glucose reached 22 and 21 mm, respectively, as in Figure 5. The results demonstrated that under specific production conditions, there was an increase in the antimicrobial activity produced [28]. IHJPAS. 37 (2) 2024 45 Figure 5. A. Effect of Nitrogen source, B. Effect of carbon source (sugars) on CFS production. 3.4. Polymerase Chain Reaction (PCR)Technique The PCR results identified nine isolates of P. aeruginosa with the phzM gene, selected based on their multidrug resistance (MDR). The positive gene result was subsequently confirmed through electrophoresis on a 1.5% agarose gel stained with ethidium bromide, electrophoresed at 75 volts for 50 minutes, and visualized under an ultraviolet (UV) transilluminator. The present study revealed the presence of a sharp, singular, and non-dispersed 180 bp phzM gene band, which was clearly distinguished from the DNA ladder, as demonstrated in Figure 6. Notably, there was no evidence of DNA degradation, as indicated by the absence of any smearing of the gene band. Figure 6. Results of the amplification of phzM gene of Pseudomonas aeruginosa bacterial samples were fractionated on 1.5% agarose gel electrophoresis stained with Eth.Br. M: 100bp ladder marker. Lanes Z1-79 resemble 180bp PCR products. To estimate the effect of CFS on E. faecium at concentrations of 8 μg/ml, two P. aeruginosa isolates were studied using the RT-qPCR technique. RT-PCR reveals a major downregulation in phzM expression after exposure to the CFS suspension of E. faecium compared to normal gene expression in bacteria. A fold change in gene expression reveals that phzM was downregulated in response to CFS in all isolates of P. aeruginosa, as entailed in Table 3. The result agrees with [29]. Mechanical exploration of different antimicrobial substances was performed with the loss of functional genes involved in pyocyanin biosynthesis strain-derived phzM 73 and z1. The other IHJPAS. 37 (2) 2024 46 gene was P. aeruginosa. At the molecular level, amrZ (a global regulator of multiple genes) and rhl (responsible for rhamnolipid production) [30]. Table 3. gene expression changes before and after treatment with CFS. Sample Fbp phzM dct ddct Folding 73(before) 18.52 15.28 -3.25 0.00 1.00 73(after) 19.00 16.08 -2.92 0.33 0.79 Z4(before) 21.76 17.58 -4.17 0.00 1.00 Z4(after) 19.76 16.17 -3.59 0.59 0.67 The results indicated a major down-regulation in phzM expression after exposure to CFS. The fold change in gene expression showed that phzM was down-regulated in response to CFS in all isolates of P. aeruginosa. These findings suggest that the CFS of E. faecium can have an inhibitory effect on phzM gene expression, which may lead to the loss of functional genes involved in pyocyanin biosynthesis. 5. Conclusion The use of FLAB as an alternative to antibiotics can reduce the use of antibiotics and is important in the context of the global problem of antibiotic resistance. E. faecium bacteria isolated from the gut of honeybees have antimicrobial properties that make them a promising alternative to antibiotics and have been shown to be effective in inhibiting the expression of important virulence factors in P. aeruginosa phzM gene expression for pyocyanin. This inhibitory effect on pyocyanin gene expression may represent a potential strategy for controlling P. aeruginosa infections. Acknowledgment We are very grateful to the staff of Department of Biology at the College of Education for Pure Sciences, Ibn-AL Haitham University of Baghdad, for facilitating the work of this article Conflict of Interest There are no conflicts of interest. Funding There is no funding for the article. Ethical Clearance This research was subjected to ethical considerations, and the research was approved by the Committee of Ethical Standards in the college Science, University of Baghdad, in line with the form issued for this purpose by the Iraqi Ministry of Health. References 1. Nowakiewicz, A., Zi´olkowska, G.; Tro´scia´nczyk, A.; Zieba, P.; Gnat, S. Determination of resistance and virulence genes in Enterococcus faecalis and E. faecium strains isolated from poultry and their genotypic characterization by ADSRRS-fingerprinting. Poultry Science 2016, 96, 986–996. DOI: https://doi.org/10.3382/ps/pew365. https://doi.org/10.3382/ps/pew365 IHJPAS. 37 (2) 2024 47 2. Yılmaz, E.S.; Aslanta, O.; Onen, S.P.; Turkyılmaz, S.; Kurekci, C. Prevalence, antimicrobial resistance and virulence traits in enterococci from food of animal origin in Turkey. LWT - Food Science and Technology 2016, 66, 20–26. DOI: https://doi.org/10.1016/j.lwt.2015.10.009. 3. Leska, A.; Nowak, A.; Motyl, I. Isolation and Some Basic Characteristics of Lactic Acid Bacteria from Honeybee (Apis mellifera L.) Environment A Preliminary Study. Agriculture 2022, 12, 1562. DOI: https://doi.org/10.3390/agriculture12101562. 4. Yaseen, N.N.; Ahmed, D.A. Detection of mexB Multidrug Efflux Gene in Some Local Isolates of Pseudomonas aeruginosa. Iraqi Journal of Science 2023, 64, 111-118. DOI: https://doi.org/10.24996/ijs.2023.64.1.11. 5. Qu, J.; Cai, Z.; Liu, Y.; Duan, X.; Han, S.; Liu, J.; Zhu, Y.; Jiang, Z.; Zhang, Y.; Zhuo, C.; Liu, Y.; Liu, Y.; Liu, L.; Yang, L. Persistent bacterial coinfection of a COVID-19 patient caused by a genetically adapted Pseudomonas aeruginosa chronic colonizer. Frontiers in Cellular and Infection Microbiology 2021, 11, 641920. DOI: 10.3389/fcimb.2021.641920. 6. Shao, X.; Xie, Y.; Zhang, Y.; Liu, J.; Ding, Y.; Wu, M. Novel therapeutic strategies for treating Pseudomonas aeruginosa infection. Expert Opinion on Drug Discovery 2020, 15, 1403–1423. DOI: https://doi.org/10.1080/17460441.2020.1803274. 7. Gonçalves, T.; Vasconcelos, U. Colour me blue: the history and the biotechnological potential of pyocyanin. Molecules 2021; 26, 927. DOI: 10.3390/molecules26040927. 8. Carlsson, M.; Shukla, S.; Petersson, A.C. Pseudomonas aeruginosa in cystic fibrosis: pyocyanin negative strains are associated with BPI-ANCA and progressive lung disease. Journal of cystic fibrosis: Official Journal of the European Cystic Fibrosis Society 2011, 10, 265–271. DOI: 10.1016/j.jcf.2011.03.004. 9. Al-Ghamdi, A.; Ali Khan, K.; Javed Ansari, M.; Almasaudi, S.; Al-Kahtani, S. Effect of gut bacterial isolates from Apis mellifera jemenitica on Paenibacillus larvae infected bee larvae. Saudi Journal of Biological Sciences 2018, 25, 383–387. DOI: https://doi.org/10.1016/j.sjbs.2017.07.005. 10. Butler, É.; Oien, R.F.; Lindholm, C.; Olofsson, T.C.; Nilson, B.; Vásquez, A. A pilot study investigating lactic acid bacterial symbionts from the honeybee in inhibiting human chronic wound pathogens. International wound journal 2016, 13(5), 729-737. DOI: 10.1111/iwj.12360, 11. Olofsson, T.C.; Vásquez, A. Detection and identification of a novel lactic acid bacterial flora within the honey stomach of the honeybee Apis mellifera. Current Microbiology 2008, 57, 356–363. DOI: 10.1007/s00284-008-9202-0. 12. Deng, J.; Fu, L.; Wang, R.; Yu, N.; Ding, X.; Jiang, L.; Fand, Y.; Jiang, C.; Lin, L.; Wang, Y.; Che, X. Comparison of MALDI-TOF MS, gene sequencing and the Vitek 2 for identifcation of seventy- three clinical isolates of enteropathogens. Journal of thoracic disease 2014, 6, 5, 539-544. DOI: 10.3978/j.issn.2072-1439.2014.02.20. 13. Kowalska, J.D.; Nowak, A.; S´liz˙ ewska, K.; Stan´ czyk, M.; Łukasiak, M.; Dastych, J. Anti- Salmonella Potential of New Lactobacillus Strains with the Application in the Poultry Industry. Polish Journal of Microbiology 2020, 69, 5–18. DOI: 10.33073/pjm-2020-001. 14. Hashim, G.M.; Almasaudi, S.B.; Azhar, E.; Al Jaouni, S.K.; Harakeh, S. Biological activity of Cymbopogon schoenanthus essential oil. Saudi Journal of Biological Sciences 2017, 24(7), 1458-64. DOI: 10.1016/j.sjbs.2016.06.001. 15. Bayoub, K.; Mardad, I.; Ammar, E.; Serrano, A.; Soukri, A. Isolation and purification of two bacteriocins 3D produced by Enterococcus faecium with inhibitory activity against Listeria monocytogenes. Current Microbiology 2011, 62(2), 479-85. DOI: 10.1007/s00284-010-9732-0 16. MacFaddin, J.F. Biochemical Tests for Identification of Medical Bacteria, (3 rd ed.): Williams and Wilkins, Baltimore, USA 2000. 17. Ahmed, M.E.; Ahmed, Z.M.; Thamer, A. The Evolutionary Effects Of Bacillin And S-Pyocin Bacteriocin And Their Effects On Propionibacterium acnes and Fungi. Biochem. Cell. Arch 2022, 20(Supplement 2), 3645-3649. https://doi.org/10.1016/j.lwt.2015.10.009 https://doi.org/10.3390/agriculture12101562 https://doi.org/10.24996/ijs.2023.64.1.11 https://doi.org/10.3389/fcimb.2021.641920 https://doi.org/10.1080/17460441.2020.1803274 https://doi.org/10.3390%2Fmolecules26040927 https://doi.org/10.1016/j.jcf.2011.03.004 https://doi.org/10.1016/j.sjbs.2017.07.005 https://doi.org/10.1111/iwj.12360 https://doi.org/10.1007/s00284-008-9202-0 https://doi.org/10.3978/j.issn.2072-1439.2014.02.20 https://doi.org/10.33073/pjm-2020-001 https://doi.org/10.1016%2Fj.sjbs.2016.06.001 https://doi.org/10.1007/s00284-010-9732-0 IHJPAS. 37 (2) 2024 48 18. Tang, H.; Yang, D.; Zhu, L.; Shi, F.; Ye, G.; Guo, H.; Deng, H.; Zhao, L.; Xu, Z.; Li, Y. Paeonol Interferes With Quorum-Sensing in Pseudomonas aeruginosa and Modulates Inflammatory Responses In Vitro and In Vivo. Frontiers in Immunology 2022, 13, 896874. DOI: 10.3389/fimmu.2022.896874. 19. Chakravarty, S.; Melton, C.N.; Bailin, A.; Yahr, T. L.; Anderson, G.G. Pseudomonas aeruginosa magnesium Transporter Mgte Inhibits Type III Secretion System Gene Expression By Stimulating Rsmyz Transcription. Journal of Bacteriology 2017, 199(23), E00268-17. DOI: Https://Doi.Org/10.1128/JB.00268-17. 20. Elzeini, H.M.; Ali, A.A.; Nasr, N.F. Isolation and identification of lactic acid bacteria from intestinal tract of honey bee Apis Mellifera L. in Egypt. Journal of Apicultural Research 2020, 59, 1–10. DOI: https://doi.org/10.1080/00218839.2020.1746019. 21. Kim, S-H.; Chon, J.-W.; Jeong, H.-W.; Song, K.-Y.; Kim, D.-H.; Bae, D.; Kim, H.; Seo, K.H. Identification And Phylogenetic Analysis Of Enterococcus Isolates Using Maldi‑Tof Ms And Vitek 2. AMB Express 2023, 13, 21. DOI: 10.1186/s13568-023-01525-y. 22. De Simone, N.; Rocchetti, M.T.; La Gatta, B.; Spano, G.; Drider, D.; Capozzi, V.; Fiocco, D. Antimicrobial Properties, Functional Characterisation and Application of Fructobacillus fructosus and Lactiplantibacillus plantarum Isolated from Artisanal Honey. Probiotics and Antimicrobial Proteins 2020, 1-18. DOI: https://doi.org/10.1007/s12602-022-09988-4. 23. Ahmed, M.E.; AL-Shimmary, S.M.H. Comparative study between Pure Bacterocin and Vancomycin on Biofilms of MRSA isolated from medical implants. Journal of Pharmaceutical Sciences and Research 3018, 10(6), 1476-1480. 24. Saleh, G.M. Isolation And Characterization Of Unique Fructophilic Lactic Acid Bacteria From Different Flower Sources. Iraqi Journal of Agricultural Sciences 2020, 51(2), 508-518. DOI: https://doi.org/10.36103/ijas.v51i2.977. 25. Kasimin, M.E.; Shamsuddin, S.; Molujin, A.M.; Sabullah, MK, Gansau J.A.; Jawan, R. Enterocin: promising biopreservative produced by Enterococcus spp. Microorganisms 2022, 10(4), 684. DOI:10.3390/microorganisms10040684. 26. Phumisantiphong, U.; Siripanichgon, K.; Reamtong, O.; Diraphat P. A novel bacteriocin from Enterococcus faecalis 478 exhibits a potent activity against vancomycin-resistant enterococci. PLOS one 2017, 12(10), e0186415. DOI: 10.1371/journal.pone.0186415. 27. Ahmed, M.E. The study of Bacteriocin of Pseudomonas fluorescens and Citrus limon Effects against Propionibacterium acnes and Staphylococcus epidermidis in acne patients. IOP Conference Series: Journal of Physics: Conf. Series 2018, 1003, 012004. DOI 10.1088/1742-6596/1003/1/012004. 28. Leska, A.; Nowak, A.; Szulc, J.; Motyl, I.; Czarnecka-Chrebelska, K.H. Antagonistic Activity of Potentially Probiotic Lactic Acid Bacteria against Honeybee (Apis mellifera L.) Pathogens. Pathogens 2022, 11, 1367. DOI: https://doi.org/10.3390/pathogens11111367. 29. Zhou, H.; Yang, Y.; Shang, W.; Rao, Y.; Chen, J.; Peng, H.; Huang, J.; Hu, Z.; Zhang, R. Rao, X. Pyocyanin biosynthesis protects Pseudomonas aeruginosa from nonthermal plasma inactivation. Microbial biotechnology 2022,15, 1910–1919. DOI: 10.1111/1751-7915.14032. 30. Fadhil, K.H.; Al-Mathkhury, H.J.F. Gentamicin Variably Affects amrZ and rhl gene Expression in Swarmer Cells of Pseudomonas aeruginosa. Iraqi Journal of Science 2022, 63(7), 2884-2890. DOI: https://doi.org/10.24996/ijs.2022.63.7.12. https://doi.org/10.3389/fimmu.2022.896874 https://doi.org/10.1128/JB.00268-17 https://doi.org/10.1080/00218839.2020.1746019 https://doi.org/10.1186/s13568-023-01525-y https://doi.org/10.1007/s12602-022-09988-4 https://doi.org/10.36103/ijas.v51i2.977 https://doi.org/10.3390%2Fmicroorganisms10040684 https://doi.org/10.1371/journal.pone.0186415 https://doi.org/10.3390/pathogens11111367 https://doi.org/10.1111%2F1751-7915.14032 https://doi.org/10.24996/ijs.2022.63.7.12