98 © 2022 The Author(s). Published by College of Education for Pure Science (Ibn Al-Haitham), University of Baghdad. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International License IHJPAS. 37 ( 3 ) 2024 Ibn Al-Haitham Journal for Pure and Applied Sciences Journal homepage: jih.uobaghdad.edu.iq PISSN: 1609-4042, EISSN: 2521-3407 Molecular Detection of Virulence Factors Genes for Staphylococcus aureus in Diabetic Foot Ulcers in Iraq Sarah Zghair Hussein1* and Ghada Mohammed Saleh2 1,2 University of Baghdad, College of Science, Baghdad, Iraq. *Corresponding Author. Received:6 May 2024 Accepted:19 June 2024 Published:20 July 2024 doi.org/10.30526/37.3.3431 Abstract One of the main complications in patients with Diabetes Mellitus is diabetic foot ulcers (DFUs), a significant and common disease. The wound of a diabetic foot reduces vascular supply and decrease host immune response, facilitating bacterial infection. The pathogen that is most commonly isolated in DFUs is Staphylococcus aureus. The purpose of this work was to identify S. aureus by conventional, biochemical, and molecular detection of the virulence factor genes in DFUs. This case cohort study was directed at Al-Hussein Teaching Hospital (AIsamawa, Iraq) and Medical City/Baghdad Hospital (Baghdad, Iraq) from January to July 2022, and it involved 140 patients with diabetic foot ulcers. Extraction of bacterial DNA from the swab samples was done by ordinary microbiology techniques and was used to achieve polymerase chain reaction (PCR) using specific gene primers (16S ribosomal RNA, mecA, pvl, and α-hly). S. aureus was identified in 34 (24.28%) of the samples. 73 (52.14%) positive cultures of bacterial growth versus 67 (47.85%) show negative results for culturing. The concentration of DNA extracted from 140 swab samples ranged from 10 to 153 ng/µl. 16S rRNA showed that all 34 isolates gave positive results. PCR results were included. 31 (29.8%) of the Staphylococcus aureus were hiding the mecA gene. The α- hly gene was found in 30 (28.8%) of the S. aureus positive samples. The pvl gene was only present in 10 (9.6%) of S. aureus isolates found in DFU’s samples. In DFUs, S. aureus predominated among the microorganisms. All S. aureus isolates included in this investigation had a high prevalence of the 16S rRNA gene. It serves as a genetic marker that can be utilized to confirm isolates of S. aureus. MecA, pvl, and α-hly genes can be found via PCR analysis. Keywords: Diabetic foot ulcer, Staphylococcus aureus, Polymerase chain reaction, 16S rRNA, mecA, pvl and α-hly. 1. Introduction Hyperglycemia is a metabolic disease defined by hyperglycemia caused by insulin action, secretion, or both. In approximately 15% of diabetics, a diabetic foot ulcer appears as an open sore. They're usually seen around the bottom of the foot. Diabetic foot ulcers are a consequence of poorly managed diabetes. Muscle weakness, foot deformities, peripheral neuropathy, and neuropathic ruptures are all possible causes [1–3]. https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://jih.uobaghdad.edu.iq/index.php/j/index#1609-4042 https://jih.uobaghdad.edu.iq/index.php/j/index#2521-3407 https://orcid.org/ mailto:butt.dream93@gmail.com https://orcid.org/ mailto:b Email: ghada90m@gmail.com IHJPAS. 2024, 37( 3 ) 99 Staphylococcus aureus is a Gram positive, spherical, facultatively anaerobic, and devious pathogen that inhabits the skin and mucosal surface of the human host [4,5]. Staphylococcus aureus is the most common bacterial isolate described in Diabetic foot infection (DFI) from western countries, causing delayed wound healing. Virulence factors such as proteases, lipases, nucleases, and hemolysins, which make host tissues promising for bacterial growth and tissue attack, enhance wound adherence, persistence, and infection. Because the extent of S. aureus in soft tissues and bones can lead to amputation of the lower ends, early identification and good wound treatment are crucial. The virulence potential of each bacterial species varies in the wound environment, so it's critical to assess the essential virulence elements of isolated types to describe and discriminate between pathogens that cause infection [6, 7].The staphylococcus cassette chromosome methicillin-sensitive S. aureus (SCCmec) MecA gene is in the variety of a specific chromosome, and methicillin resistance is conferred by the mecA gene, which codes for penicillin-binding protein 2a (PBP2a). This initiates the reduction of binding and attraction for B-lactam antibiotics, including penicillinase-resistant penicillin. PBP is a family of enzymes found in the cell membrane of S. aureus that catalyzes the trans-peptization required for the synthesis of peptidoglycan chains [8].The staphylococcus cassette chromosome methicillin-sensitive S. aureus (SCCmec) MecA gene is in the variety of a specific chromosome, and methicillin resistance is conferred by the mecA gene, which codes for penicillin-binding protein 2a (PBP2a). This initiates the reduction of binding and attraction for B-lactam antibiotics, including penicillinase-resistant penicillin. PBP is a family of enzymes found in the cell membrane of S. aureus that catalyzes the trans-peptidation required for the synthesis of peptidoglycan chains [8].The alpha (α) gene is found on the bacterial chromosome, and it codes for one of the most well-known pore-forming toxins. Exotoxin is a secreted protein with hemolytic, cytotoxic, dermonecrotic, and deadly characteristics. Practically all clinical isolates of S. aureus produce this 33 kDa pore-forming toxin as a monomer. Despite the fact that α-toxin is potent against an extensive variety of mammalian cells, it has species and cell type specificity [9, 10]. Panton-Valentine leukocidin (pvl) is a very toxic cytotoxin. This toxin belongs to a group of proteins that produce membrane holes. It is made up of two discrete protein constituents, LukS-PV and LukF-PV [11]. Dermonecrosis, chronic skin and soft tissue infection (SSTI), chronic mucocutaneous infections, and necrotizing pneumonia are all linked to the active toxin, which causes neutrophil lysis by developing a hole in their membrane [12, 13]. 2. Materials and Methods 2.1.Isolation and identification of S. aureus The samples involved 140 swabs from diabetic foot ulcers collected over seven months between January and July 2022, at Al-Hussein Teaching Hospital (Alsamawa, Iraq) and Medical City, Baghdad Hospital in Baghdad, Iraq. Swab samples were collected by transport media swabs, which were taken from an infected area of the diabetic foot. All these samples were cultivated on plates of Mannitol Salt Agar (MSA) and Blood Agar (BA). Then incubated at 37°C for 24 hr.; after growth was observed, a Gram stain was carried out, and biochemical experiments were performed needed for identification of S. aureus from other species. 2.2. Detection of 16SrRNA, α-hly, mecA and pvl genes 2.2.1. Extraction of Bacterial DNA Using the PrestoTM Mini gDNA Bacteria (Geneaid/Taiwan) Kit, S. aureus entire genomic DNA was extracted and purified following the instructions provided by the kit's company. By using the Nanodrop (Thermo Scientific NanoDrop Lite UV Visible Spectrophotometer, USA), which IHJPAS. 2024, 37( 3 ) 100 measures DNA concentration (ng/L) and examines DNA quality at absorbance (260/280 nm), the extracted total DNA was examined. 2.2.2. Polymerase chain reaction (PCR) technique protocol A polymerase chain reaction (PCR) system was carried out to augment fragments of 16SrRNA (474bp), α-hly (209bp), the mecA gene (147 bp), and the pvl gene (433bp) genes, as shown in Table 1. The manufacturer (Macrogen/Korea) provided the primers, as shown in Table 1, as lyophilized powder in Eppendorf tubes (1.5ml). Before opening, the tubes were centrifuged at 8000 rpm for 5 seconds to settle the lyophilized primers. Next, 1X TE buffer (pH 8.0) was added to all tubes at the manufacturer's recommended volume in order to prepare a stock solution concentration of 100 ml/µl. The working solution of the primers was made by adding 10µl of primer stock solution (which was saved at -20°C) to 90 µl of nuclease free water solution to get a working primer solution (10ml/µl). The PCR mixture was achieved in a total size of 25 μL and controlled the DNA template (25 μL), primers (4 μL) specific for the 16SrRNA, α-hly, mecA, and pvl genes, nuclease-free water (3.5µL), and 12.5µL of premix (2X) with the thermocycling conditions set at one cycle of 95°C for 5 min, followed by 35 cycles of 95°C/30 s, 58°C/30 s, and 72°C/1 min, and one cycle of 72°C/5 min, then 4°C of stop step. PCR products were visualized using 5% agarose and TBE buffer (0.5x) at 100 volts and 80 amps at 70 volts for 1 hour (Promega, USA). All primers for PCR for the 16S ribosomal RNA gene S. aureus were chosen in this study using the National Center Bank Institute NCBI Genbank database. MecA, PVL, and α-hly genes were identified in S. aureus based on sequences published by [14–16], respectively. These primers were provided by Scientific Researcher. Co. Ltd. in Iraq. The sequences of all primers were checked out depending on the National Center Bank Institute (NCBI) Database. Table 1. Sequence of the primers was used with the name and size of the product. Genes Primer Nucleotide sequences 5' 3' Product size(bp) mecA mecA-F GTGAAGATATACCAAGTGATT 147 mecA-R ATGCGCTATAGATTGAAAGGAT Pvl Luk-PV-1 ATCATTAGGTAAAATGTCTGGACATGA TCCA 433 Luk-PV-2 GCATCAAGTGTATTGGATAGCAAAAGC α-hly Fw CTGATTACTATCCAAGAAATTCGATTG 209 Rv CTTTCCAGCCTACTTTTTTATCAGT 16S rRNA F TCAACCGTGGAGGGTCATTG 474 R CCCAACATCTCACGACACGA 3. Results 3.1. Isolation and identification of S. aureus Clinical specimens were collected from 140 DFU patients at Alsamawa and Baghdad Teaching Hospitals and streaked on Mannitol salt agar. 34 isolates looked like round yellow colonies and were positive for the catalase test; consequently, they are predominantly recognized as S. aureus. 3.2. DNA extraction and preparation Following DNA extraction using the Presto™ Mini gDNA Bacteria Kit, the DNA concentration was 10–153 ng/µl. Gel electrophoresis was prepared to check the purity of the extracted DNA. Polymerase chain reaction detection of 16SrRNA, mecA, α-hly, and pvl genes. All 34 strands of DNA of S. aureus were submitted for molecular identification using the 16S rRNA gene as specified in Table 1 with the PCR technique. IHJPAS. 2024, 37( 3 ) 101 Table 2: Frequency of virulence genes of S. aureus isolates in DFUs. mecA α-hly pvl N Percent N Percent N Percent Positive 31 29.8 30 28.8 10 9.6 Negative 3 2.9 4 3.8 24 23.1 P value <0.0001* <0.0001* <0.016* The 16S rRNA gene was employ as a genetic marker to confirm identification of S. aureus isolates and it has become more common in the clinical environment [17]. Our results of amplifying 16S rRNA was given positive results in all isolates 34(34%) of S. aureus, Table 2 and single band in 474bp amplicon size, Figure 1A. Figure 1: Gel electrophoresis of the PCR product. (A) 16SrRNA gene in S. aureus with an amplicon size of 474 bp Line M: DNA marker (100-1500bp); Lines 1–10: Positive isolates of S. aureus. (B) α-hly gene in S. aureus with an amplicon size of 209 bp. Line M: DNA marker (100-1500bp); Lines 1–10: Positive isolates of S. aureus. (C) pvl gene in S. aureus with an amplicon size of 433 bp. Line M: DNA marker (100-1500bp); Lines (1, 2, 3, and 4): positive isolates of S. aureus. (D) mecA gene in S. aureus with an amplicon size of 147 bp. Line M: DNA marker (100-1500bp); Lines 1–11: Positive isolates of S. aureus. Lines N in A,B,C and D: Negative isolates of S. aureus migrated in 5% agarose, TBE buffer (0.5x), and current 200A at 70 volts for 90 minutes. The results of α-hly revealed that the α-hly gene was identified in 30 isolates (28.8%) Table 2, which revealed bands of 209 bp as shown in Figure 1B. Α-toxin is a major virulence component of S. aureus that has been significantly related to skin and soft tissue infections in humans. Most S. aureus strains release this pore-forming toxin, which is predominantly composed of beta sheets and targets red blood cells [6]. Current results revealed that the pvl gene (433 bp) in Figure 1C was identified only in 10 (9.6%) isolates out of 34 isolates in Table 2.A single band of the mecA gene was observed at the given molecular weight (147 bp), as shown in Figure 1D. The results revealed that the mecA gene was identified in 31 (29.8%) out of 34 isolates Table 2. A D C B IHJPAS. 2024, 37( 3 ) 102 4. Discussion Our results of amplifying 16S rRNA all isolates 34(34%) of S. aureus agreeing with [18] that found the outcome of amplifying 16S rRNA was revealed the all 18 isolates presented positive results. However, [15] discovered that 60 of 67 S. aureus isolates possessed 16SrRNA. Despite the fact that seven isolates were recognized as S. aureus using conventional techniques, they lost this gene. Current results found that almost all isolated strains contain the α-hly gene 30 (28.8%). This is compatible with the French’s study, which reported that nearly all of the strains had the α‐ toxin‐encoding gene hla freely of the grade [19]. Alpha-toxin production was also evaluated among the 25 DFU isolates [20]. Additionally, [21] the α-toxin gene was found in 85 percent of the S. aureus-positive specimens. The outcomes of the existing study agreed with those of another study done by [15] in Baghdad, which showed the detection of the exotoxin pvl gene in only 6 (10%) isolates out of 60 isolates offered a positive consequence. Also, [22] revealed that 19 (79%) out of 24 isolates had a positive outcome for the pvl toxin gene. While a study showed that amplifying the pvl gene was indicated in all 18 isolates and gave a positive outcome [18], Pvl is an extracellular protein that serves as a dermonecrotic and Leukocidin agent [23, 24, 25, 26]. The mecA gene produces penicillin-binding protein (PBP2a), which is responsible for methicillin resistance in MRSA and is capable of decreasing affinity for β-lactam antibiotics [27, 28, 29]. While the mecA gene results by [15] showed that the mecA gene was located in 48 isolates (80%) of all S. aureus isolates, [30] reported that mecA frequency was 96% among S. aureus isolates, which was consistent with our result. 5. Conclusion In DFUs, S. aureus predominated among the microorganisms. All 34 S. aureus isolates involved in this investigation had a high prevalence of the 16S rRNA gene. MecA, pvl, and α-hly genes can be found via PCR analysis. The MecA gene was higher than other genes. Acknowledgment We are very grateful to the staff of the Al-Hussein Teaching Hospital (Alsamawa, Iraq) and Medical City, Baghdad Hospital in Baghdad, Iraq, for facilitating the work of this article. Conflict of Interest The authors declare that they have no conflicts of interest.” Funding There is no financial support in preparation for the publication. Ethical Clearance This study involving human participants was reviewed, and the patients and participants provided their written consent to contribute to this paper. References 1. American Diabetes Association. Standards of medical care in diabetes—2016 abridged for primary care providers. Clinical diabetes: a publication of the American Diabetes Association. 2016, 34(1), 3. doi: https://doi.org/10.2337/diaclin.34.1.3 https://doi.org/10.2337%2Fdiaclin.34.1.3 IHJPAS. 2024, 37( 3 ) 103 2. Mohammed, S. I.; Mikhael, E. M.; Ahmed, F. T.; Al-Tukmagi, H. F.; Jasim, A. L.. Risk factors for occurrence and recurrence of diabetic foot ulcers among Iraqi diabetic patients. Diabetic foot & ankle 2016, 7(1), 29605. https://doi.org/10.3402/dfa.v7.29605. 3. Ogba, O.M.; Nsan, E.; Eyam, E.S. Aerobic bacteria associated with diabetic foot ulcers and their susceptibility pattern. Biomedical Dermatology. 2019, 3(1), 1-6. 1 https://doi.org/10.1186/s41702-019- 0039-x . 4. Hamad, S.L.; Melconian, A.K.A.. Staphylococcus aureus Nasal Carriage and Obesity among Patients with Type Two Diabetes Mellitus. Iraqi Journal of Science. 2016, 2840-2848. https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/6258. 5. Gholizadeh, P.; Mahallei, M.; Pormohammad, A.; Varshochi, M.; Ganbarov, K.; Zeinalzadeh, E.; Mahmood, S.S.; Kafil, H. S. Microbial balance in the intestinal microbiota and its association with diabetes, obesity and allergic disease. Microbial Pathogenesis. 2019, 127, 48-55. https://doi.org/10.1016/j.micpath.2018.11.031. 6. hettigar, K.; Murali, T. S. Virulence factors and clonal diversity of Staphylococcus aureus in colonization and wound infection with emphasis on diabetic foot infection. European Journal of Clinical Microbiology & Infectious Diseases. 2020, 39(12), 2235-2246. https://doi.org/10.1007/s10096-020-03984-8. 7. Kadhim, B. A.; Essa, M. A.; Sabbah, M. R. Prevalence of enterotoxin type a in Staphylococcus aureus isolated from different sources. Iraqi Journal of Agricultural Sciences. 2022, 53(6), 1325-1330. https://doi.org/10.36103/ijas.v53i6.1648. 8. AlSaadi, B.Q.H.; Mohaisen, S.; Kazaal, Z.; Abdulla, Z. N. Study the prevalence of mecA gene in methicillin resistance Staphylococcus aureus (MRSA) isolated from different clinical specimens and their antibiotic resistance profile. Annals of Tropical Medicine and Public Health. 2020, 23, 231-223. http://doi.org/10.36295/ASRO.2020.231223. 9. Ismail, M.C.. Relationship between Alpha-toxin production and biofilm for1nation by Staphylococcus aureus isolated from Eye's infections. Ibn AL-Haitham Journal For Pure and Applied Science. 2017 20(1), 13-18. https://jih.uobaghdad.edu.iq/index.php/j/article/view/1307. 10. Divyakolu, S.; Chikkala, R.; Ratnakar, K. S.; Sritharan, V. Hemolysins of Staphylococcus aureus—An Update on Their Biology, Role in Pathogenesis and as Targets for Anti-Virulence Therapy. Advances in Infectious Diseases. 2019, 9(2), 80-104. DOI: https://doi.org/10.4236/aid.2019.92007. 11. Alwash, S. J.; Aburesha, R. A. Detection of toxin-associated genes in seven spa-types of Staphylococcus aureus in Iraq. Indian Journal of Forensic Medicine & Toxicology. 2021, 15(3), 4156- 4164. DOI: https://doi.org/10.37506/ijfmt.v15i3.15945. 12. Jauneikaite, E.; Ferguson, T.; Mosavie, M.; Fallowfield, J. L.; Davey, T.; Thorpe, N.; Lamb, L. E. Staphylococcus aureus colonization and acquisition of skin and soft tissue infection among Royal Marines recruits: a prospective cohort study. Clinical microbiology and infection. 2020, 26(3), 381-e1. https://doi.org/10.1016/j.cmi.2019.07.014. 13. Jafar Alwash, S.; Abed Aburesha, R. The Differences in Antibiotic-resistance among Several Staphylococcus aureus strains in Iraq. Medico-legal Update. 2021, 21(3). DOI: https://doi.org/10.37506/mlu.v21i3.3034. 14. Abd Zaid, A. M.; Kandala, N. J. Identification of Methicillin Resistant Staphylococcus aureus using touchdown pcr and phenotypic methods from patients and hospitals environments in different Iraqi cities. Iraqi Journal of Agricultural Sciences. 2021, 52(6), 1356-1364. https://doi.org/10.36103/ijas.v52i6.1475. 15. Ibraheem, H. T.; Al-Mathkhury, H. J. F. pvl-carried methicillin resistant Staphylococcus aureus isolated from hospitalized patients in Baghdad, Iraq: none. Iraqi Journal of Science. 2018, 1967-1972. https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/468. https://doi.org/10.3402/dfa.v7.29605 https://doi.org/10.1186/s41702-019-0039-x https://doi.org/10.1186/s41702-019-0039-x https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/6258 https://doi.org/10.1016/j.micpath.2018.11.031 https://doi.org/10.1007/s10096-020-03984-8 https://doi.org/10.36103/ijas.v53i6.1648 http://doi.org/10.36295/ASRO.2020.231223 https://jih.uobaghdad.edu.iq/index.php/j/article/view/1307 https://doi.org/10.4236/aid.2019.92007 https://doi.org/10.1016/j.cmi.2019.07.014 https://doi.org/10.36103/ijas.v52i6.1475 https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/468 IHJPAS. 2024, 37( 3 ) 104 16. Delgado, S.; García, P.; Fernández, L.; Jiménez, E.; Rodríguez-Baños, M.; del Campo, R.; Rodríguez, J. M. Characterization of Staphylococcus aureus strains involved in human and bovine mastitis. FEMS Immunology and Medical Microbiology. 2011, 62(2), 225-235. https://doi.org/10.1111/j.1574- 695X.2011.00806.x. 17. Gumaa, M. A.; Idris, A. B.; Bilal, N. E.; Hassan, M. A. First insights into molecular basis identification of 16s ribosomal RNA gene of Staphylococcus aureus isolated from Sudan. BMC Research Notes. 2021, 14(1), 1-5. https://doi.org/10.1186/s13104-021-05569-w. 18. Gadban, T. H.; Al-Amara, S. S.; Jasim, H. A. Screening the frequency of panton-valentine leukocidin (pvl) gene between methicillin resistant Staphylococcus aureus isolated from diabetic foot patients in Al-Basrah governorate, south of Iraq. Systematic Reviews in Pharmacy. 2020, 11(11), 285-290. http://faculty.uobasrah.edu.iq/uploads/publications/1614500670.pdf. 19. Sotto, A.; Richard, J.L.; Messad, N.; Molinari, N.; Jourdan, N.; Schuldiner, S.; French Study Group on the Diabetic Foot. Distinguishing colonization from infection with Staphylococcus aureus in diabetic foot ulcers with miniaturized oligonucleotide arrays: a French multicenter study. Diabetes Care, 2012, 35(3), 617-623. https://doi.org/10.2337/dc11-1352. 20. Vu, B. G.; Stach, C. S.; Salgado-Pabón, W.; Diekema, D. J.; Gardner, S. E.; Schlievert, P. M. Superantigens of Staphylococcus aureus from patients with diabetic foot ulcers. The Journal of Infectious Diseases. 2014, 210(12), 1920-1927. https://doi.org/10.1093/infdis/jiu350. 21. Sandhu, S.; Rathnayake, I.; Huygens, F. Prevalence of methicillin resistance and virulence determinants of Staphylococcus aureus in diabetic foot ulcers. International Journal of Basic and Clinical Pharmacology, 2014, 3(6), 978-982. https://doi.org/10.5455/2319-2003.ijbcp20141201. 22. Al-Hassnawi, H. H.; Al-Charrakh, A. H.; Al-Khafaji, J. K. Occurrence of mecA, SCCmec IV, pvl, lukED Genes in Community Acquired Methicillin Resistance Staphylococcus aureus (CA-MRSA) from Hilla/Iraq. Medical Journal of Babylon, 2013, 10(1). https://www.uobabylon.edu.iq/publications/medicine_edition15/medicine15_16.doc. 23. Gordon, R. J.; Lowy, F.D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2008, 46 Suppl 5(Suppl 5), S350–S359. https://doi.org/10.1086/533591. 24. Ayepola, O.O.; Olasupo, N.A., Egwari, L.O.; Schaumburg, F. Characterization of Panton-Valentine leukocidin-positive Staphylococcus aureus from skin and soft tissue infections and wounds in Nigeria: a cross-sectional study. F1000Research. 2018, 7, 1155. https://doi.org/10.12688/f1000research.15484.1. 25. He, C.; Xu, S.; Zhao, H.; Hu, F.; Xu, X.; Jin, S.; Liu, Q. Leukotoxin and pyrogenic toxin Superantigen gene backgrounds in bloodstream and wound Staphylococcus aureus isolates from eastern region of China. BMC Infectious Diseases, 2018, 18(1), 1-10. https://doi.org/10.1186/s12879-018-3297-0. 26. Li, Y.; Song, Y.; Huang, Z.; Mei, L.; Jiang, M.; Wang, D.; Wei, Q. Screening of Staphylococcus aureus for Disinfection Evaluation and Transcriptome Analysis of High Tolerance to Chlorine-Containing Disinfectants. Microorganisms. 2023, 11, 475. https://doi.org/10.3390/microorganisms11020475. 27. Kim, C.; Milheiriço, C.; Gardete, S.; Holmes, M.A.; Holden, M.T.; de Lencastre, H.; Tomasz, A. (Properties of a novel PBP2A protein homolog from Staphylococcus aureus strain LGA251 and its contribution to the β-lactam-resistant phenotype. The Journal of Biological Chemistry. 2012, 287(44), 36854–36863. https://doi.org/10.1074/jbc.M112.395962. 28. Peacock, S.J.; Paterson, G.K. Mechanisms of Methicillin Resistance in Staphylococcus aureus. Annual Review of Biochemistry. 2015, 84, 577–601. https://doi.org/10.1146/annurev-biochem-060614-034516. 29. Kumar, S.; Singh, S.; Kumar, V.; Datta, S.; Dhanjal, D. S.; Sharma, P.; Singh, J. Pathogenesis and antibiotic resistance of Staphylococcus aureus. In Model Organisms for Microbial Pathogenesis, Biofilm Formation and Antimicrobial Drug Discovery. 2020, 99-115. https://link.springer.com/chapter/10.1007/978-981-15-1695-5_7. https://doi.org/10.1111/j.1574-695X.2011.00806.x https://doi.org/10.1111/j.1574-695X.2011.00806.x https://doi.org/10.1186/s13104-021-05569-w http://faculty.uobasrah.edu.iq/uploads/publications/1614500670.pdf https://doi.org/10.2337/dc11-1352 https://doi.org/10.1093/infdis/jiu350 https://doi.org/10.5455/2319-2003.ijbcp20141201 https://www.uobabylon.edu.iq/publications/medicine_edition15/medicine15_16.doc https://doi.org/10.1086/533591 https://doi.org/10.12688/f1000research.15484.1 https://doi.org/10.1186/s12879-018-3297-0 https://doi.org/10.3390/microorganisms11020475 https://doi.org/10.1074/jbc.M112.395962 https://doi.org/10.1146/annurev-biochem-060614-034516 https://link.springer.com/chapter/10.1007/978-981-15-1695-5_7 IHJPAS. 2024, 37( 3 ) 105 30. Raheema, R.H.; Melek, H.K.; Jassim, A.T. Characterization of antibiotic resistance of Staphylococcus aureus isolated from patients with diabetic foot ulcers in Wasit Province. International Journal of Science and Research Archive. 2021, 3(2), 201-208. https://doi.org/10.30574/ijsra.2021.3.2.0146. https://doi.org/10.30574/ijsra.2021.3.2.0146