68 © 2025 The Author(s). Published by College of Education for Pure Science (Ibn Al-Haitham), University of Baghdad. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International License Morphological and Molecular Studies of Acanthobrama marmid Heckel, 1843 (Piscies, Cypriniformes, Leuciscidae) from the Middle of Iraq Hind Dyia Hadi1* , Abed Hassan Baraaj2 , and Atheer Hussain Ali3 1Iraq Natural History Research Centre and Museum, University of Baghdad, Baghdad, Iraq 2 Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq 3Department of Fisheries and Marine Resources, College of Agriculture, University of Basrah, Basrah, Iraq *Corresponding Author. Received: 31 May 2023 Accepted: 12 July 2023 Published: 20 January 2025 doi.org/10.30526/38.1.3555 Abstract Leuciscidae species are the abundant and widely distributed fish species in Iraq's inland waters. They are complex species, and morphology makes them difficult to identify. Molecular analysis achieved and confirmed the morphological characters. Twenty specimens of Acanthobrama marmid were collected from two localities at Tigris River, in the middle of Iraq; 15 specimens from the Al-Zubaydia sub-district and five specimens from Al-Tharthar Lake. We used the mitochondrial DNA cytochrome b (cytb) gene to sequence the DNA of A. marmid. The following analysis are compared the sequences with those of other fish genera and species found in the Gene Bank. The barcoding result (DNA sequencing) in fishes found in the same family (Leuciscidae) showed that it fit with A. marmid. We conclude, the results of the current study, by using the cytochrome b (cytb) gene, are a successful tool and confirmed the morphological characters for accurate identification of A. marmid. Keywords: Cytochrome b, Fishes, Leuciscidae, Morphometric and Meristic characters, Tigris River. 1. Introduction Acanthobrama marmid Heckel (1843) is a freshwater fish belonging to the family Leuciscidae, and this species is common and widely distributed in the Tigris and Euphrates River systems. It is one of the eight species in the genus Acanthobrama, which is endemic to Southwest Asia (1). Heckel (2) described Aleppo's A. marmid for the first time. Later, researchers recorded it from the Tigris River in Iraq (3, 4). Only Al-Nasirii and Shamsul (5) recorded fish belonging to the genus Acanthobrama Heckel, 1843, from the Shatt Al-Arab River, but they did not identify to species level. Al-Hassan and Al-Badri (6) recorded A. marmid for the first time from the Shatt https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0002-0779-0194 mailto:hinddhiaa86@gmail.com https://orcid.org/0000-0001-8842-8519 mailto:abed.baraaj@sc.uobaghdad.edu.iq https://orcid.org/0000-0002-2541-968x mailto:atheeralibu@gmail.com IHJPAS. 2025, 38 (1) 69 Al-Arab river near Ashar, Basrah, southern Iraq, and then recorded in the Little and Great Zab rivers, as well as in Northern Iraq (1, 7). There are many studies dealing with the taxonomic and distribution of this species in Syria, Iraq, and Turkey (3). On the other hand, there are some works that have dealt with some biological characteristics, such as reproduction and nutrition (8). A. marmid inhabits numerous clusters of shallow waters, and it can withstand water bodies such as lakes and rivers with medium pollution levels. Its length can reach up to 30 cm (9). There are numerous taxonomic methods available for recognizing fish species, such as the conventional morphological study. This method is helpful and fast, and it includes numerous morphometric and meristic characters for species identification (10, 11). The morphological similarities, particularly between species belonging to the same genus, have been one of the most common causes of confusion in recognizing the Iraqi fish fauna (12). In the past, it is primarily identified fish species by examining their external morphological characteristics. However, current taxonomic studies of the fishes have revealed numerous challenges in distinguishing between them, whether at the species or genus level. Consequently, we urgently need to base taxonomic work on diverse research directions, including molecular techniques that leverage information from the cell's molecular components to resolve these differences. Mitochondria cytochrome b (mt-cyb) gene is one of 11 components of a group of proteins called complex III. We generally use Cyt b as a mitochondrial DNA locus to identify evolutionary connections between different groups, and its sequence diversity makes it valuable both within and outside families (13). The aim of the current study is to confirm this classification of A. marmid by combining the morphological and molecular analysis. 2. Materials and Methods 2.1. Study area Two localities at Tigris River were chosen to collect studied fish species as follows: 2.1.1. Al-Tharthar Lake The largest natural lake in Iraq is located in Salahaddin Governorate; approximately 120 km northwest of Baghdad, situated between the Tigris and Euphrates rivers, within coordinates of 33°58′N 43°11′E. The Tigris River feeds the lake, which has an area between 1875 and 2710 km2 and a maximum depth of 68.4 m, and discharges its water into the Euphrates River (14, 15). 2.1.2. Al-Zubaydia sub-district It is one of the sub-districts of the Al-Suwaira district in Wasit Governorate. Al-Zubaydia is located 50 km to the south of Al-Suwaira city and 85 km to the north of Kut city, the capital of Wasit Governorate, in south-eastern Baghdad, within coordinates 32°45'46.6"N 45°10'48.7"E. The sampling localities are illustrated in the map Figure 1. IHJPAS. 2025, 38 (1) 70 Figure 1. Sampling areas. 2.2. Samples collection Fishermen used gill nets to collect a total of 20 fish specimens, 15 for morphology study and five for molecular study, from June 2022 to December 2022. The Iraq Natural History Research Centre and Museum, University of Baghdad, received the fish in a cool box filled with crushed ice. 2.3. Morphological study Each specimen is measured using a 1-meter measuring board graduated in millimetres (mm) and a digital caliper, and the weight of each fish individual was done immediately by digital balance. The morphometric features are measured from the left side of each fish. The morphometric and meristic characters based on the guidelines provided by Hubbs and Lagler (16), as illustrated in Table 1 and Figures 2 and 3. Table 1. Morphometric and meristic characters and their abbreviations No. Characteristic name Abbreviated name 1 Total Length TL 2 Fork Length FL 3 Standard Length SL 4 Head Length HL 5 Head Height HH 6 Snout Length SnL 7 Eye Diameter ED 8 Interorbital Distance IOD 9 Postorbital Length POL 10 Maximum Body Height MAXH 11 Minimum Body Height MINH IHJPAS. 2025, 38 (1) 71 No. Characteristic name Abbreviated name 12 Caudal Peduncle Length CPL 13 Dorsal Fin Length DFL 14 Dorsal Fin Height DFH 15 Pectoral Fin Length PFL 16 Pelvic Fin Length PVL 17 Pectoral-Pelvic Distance PPD 18 Pelvic-Anal Distance PAD 19 Anal Fin Length AFL 20 Anal Fin Height AFH 21 Pre Dorsal Length PDL 22 Post Back Distance PBD 23 Upper Caudal Fin Length UCFL 24 Lower Caudal Fin Length LCFL 25 Centre of Caudal Fin Length CCFL 26 Caudal Peduncle Height CPH 27 Mouth Width MW 28 Prepectoral Length PPL 29 Prepelvic Length PVL 30 Preanal Length PAL 31 Preanus Length PASL Meristic characteristics 32 Scales of Lateral Line SLL 33 Up Scales of Lateral Line USLL 34 Down Scales of Lateral Line DSLL 35 Dorsal Fin Spines DFS 36 Dorsal Fin Rays DFR 37 Anal Fin Spines AFS 38 Anal Fin Rays AFR 39 Pectoral Fin Rays PFR 40 Pelvic Fin Rays PVFR 41 Caudal Fin Rays CFR 42 Number of scales around the least circumference of the caudal peduncle SCP 43 Gill Rakers GR IHJPAS. 2025, 38 (1) 72 Figure 1. The morphometric measurements carried out of Acanthobrama marmid Heckel, 1843(17 with personal modification) Figure 2. The meristic measurement carried out on Acanthobrama marmid Heckel, 1843(From Coad (1) with personal modification) 2.4. DNA Extraction Using the Genomic DNA Extraction Kit (addbio/Korea, Cat. no. 10023), the total DNA is extracted from the muscle dorsal side of each fish individual and preserved the samples in absolute ethanol (100%). Genomic DNA was taken out according to Sambrook et al. (18), and it was tested by electrophoresis on a 1% agarose gel that had been stained with ethidium bromide. 2.5. Amplification and polymerase chain reaction PCR This step carried out by amplified approximately 508 bp from the 5’ region of the Cytb gene using universal fish primers. The forward primer is Fish F1 5’ (CAAGCCTACGAAAAACMCAC) 3, and the reverse primer is 5’ Fish R1 (TCTACTGAGAAKCCRCCTCA) 3’. Polymerase Chain IHJPAS. 2025, 38 (1) 73 Reaction (PCR) reactions are 50 μl in size and have 25 μl of 2xTaq DNA Polymerase Master Mix, 2 μl of each primer (Fish F1 and Fish R1), 17 μl of free water, and 4 μl of DNA template. They are run on an Optimus 96G thermal cycler. The PCR thermal cycling conditions were: 94ºC for five min; 35 cycles of 94ºC for 30s; 52ºC for 30s; 72ºC for 30s; final extension of 72ºC for 5 min; and hold at 4ºC. We then electrophoresed the PCR products on a 2% agarose gel, stained with ethidium bromide dye. For this test, we used Promega's 100-bp ladder. We tested the profiles on a UV light transilluminator and documented them using a Canon camera and a gel documentation tool.The PCR product for sequencing sent to Macrogen/Korea using a forward primer. The results are evaluated using Bioedit software, version 7; 2013; https://bioedit.software.informer.com/7.2/ . Then aligned and compared the sequences generated from the sequencing findings with data from the same organism genes found in the gene bank at the National Center for Biotechnology (NCBI), which had previously undergone investigations in various nations worldwide using the Basic Local Alignment Search Tool (BLAST). The results of sequencing showed 99–100% agreement with reference sequences. The phylogenetic tree is drawn of the species from the sequence data of the studied samples and compared them with the previously studied species using MEGA X: Molecular Evolutionary Genetics Analysis (19). The nucleotide location value of variance is calculated using the maximum likelihood (ML) and generated a molecular phylogenetic tree. The bootstrapping method with 500 repeats is used to assess the accuracy of the estimated phylogenies. 3. Results A total of 20 specimens of A. marmid are collected from Al-Zubaydia sub-district (15 specimens) and Tharthar Lake (five specimens), both at the Tigris River in the middle of Iraq. 3.1. Morphological study The morphological and meristic characters of A. marmid are indicated in Tables (2 and 3), and Figures (3A and 3B) to show the general morphology of A. marmid. Table 2. Morphological characters proportional measurements as expressed as percentage of standard length or of head length for Acanthobrama marmid. Character min-max (Mean ±SD) Proportional measurements as expressed as percentage of Standard Length or of Head length* Weight 22.4- 38.1 (30.84± 9.35) - Total Length TL 114-157 (141.4±14.1) - Fork Length FL 102-145 (129±13.5) - Standard Length SL 93-131 (117.2±12.2) - Maximum Body Height MAXH 27-43 (37.2 ± 5.2) 27.83-35.92 (31.65 ± 2.29) Minimum Body Height MINH 10-14 (11.6 ± 1.0) 8.39-11.65 (9.94 ± 0.86) Caudal Peduncle Length CPL 11-21 (17.2 ± 2.8) 11.53-17.47 (14.67 ± 2.00) Dorsal Fin Length DFL 12-20(15.6± 2.0) 11.53- 16.50 (13.32 ±1.30) Dorsal Fin Height DFH 22-31 (26.1 ± 2.4) 19.08-26.27 (22.26±3.27a) 19.23-25.77 (22.52±1.81b) https://bioedit.software.informer.com/7.2/ IHJPAS. 2025, 38 (1) 74 Character min-max (Mean ±SD) Proportional measurements as expressed as percentage of Standard Length or of Head length* Pectoral Fin Length PFL 16-23 (20.9 ± 2.2) 15.70-20.38(18.44 ± 1.84a) 16.92-17.96 (17.60±0.39b) Pelvic Fin Length VFL 13-21 (17.8 ± 2.3) 12.09-16.49 (15.24 ±1.20) Pectoral-pelvic Distance PV 18-33(26.2 ± 3.9) 19.35-26.21 (22.34 ± 1.85) Predorsal distance 46-72 (61.6 ± 7.6) 49.46- 55.38 (52.52±1.71) Prepelvic Distance PVD 41-59 (52.6 ± 5.2) 43.63-49.51 (44.92±1.55) Prepectoral Distance PPD 22-35 (28.4 ± 3.5) 21.53-27.34 (24.30±1.81) Preanal Distance PAD 58-88 (75.0 ± 8.2) 61.15-67.69 (64.03±1.96) Pelvic-Anal Distance VA 18-32 (24.8 ± 3.6) 19.60-27.11 (21.20±2.12) Anal Fin Length AFL 19-29 (23.5±2.9) 17.94-22.88 (20.12±1.89) Anal Fin Height AFH 11-18 (14.2±2.2) 9.16-16.21 (12.17 ±1.91) Preanus Distance 54-84 (61.6±8.1) 53.71-64.61 (59.38±3.00) Post Back Distance POB 31- 47 (39.6±5.3) 30-38.01(33.76±2.48) Upper Caudal Fin Length UCFL 21- 32 (27.6±3.0) 22.72-26.27 (24.2(24.22±1.52a) 20.76-25.77 (23.26±1.60b) lower Caudal Fin Length DCFL 20-33 (27.4±3.7) 20.51-25.78 (23.35±1.61) Center Caudal Fin Length CCFL 10-17 (12.5±2.3) 7.69-10.31 (11.69±1.03) Caudal Peduncle Height 10-18 (14.0±2.0) 10.74-13.84 (11.98±1.08) Head Length 21-30 (25.8±2.6) (HL/SL) ×100 20.72-24.27(22.10±1.14) Head Height 14-19(16.1±1.5) 56.00-73.91 (62.68±6.05) Snout Length 4.4-7.2(6.0±0.8) 17.6-28.57 (23.30±3.01) Orbit diameter 5-7 (6.0±0.6) 19.25-26.92 (23.51±2.30) Eye Diameter 3-4 (3.3±0.3) 11.11-15.38 (13.10±1.40) Post Orbit Distance 10-14 (12.0±1.1) 41.37-56.00 (46.81±3.91) Between Eye Distance 6-9.6 (8.0±1.0) 26.92-34.8 (31.65±2.67) Mouth width 5-8.5 (6.8±1.1) 22.22-30.4 (26.31±2.49) a, b mean significant differences in characters between two populations of A. marmid from two localities (a Tharthar Lake, and b Al-Zubaydia sub-district) * mean Proportional measurements as expressed as percentage of Head length Table 3. Meristic characters for Acanthobrama marmid. Character min-max (Mean ±SD) Lateral Line Scales (LLS) 53-55 (54 ±0.67) Above Scales of Lateral Line (ASLL) 12-13 (12.5 ± 0.51) Below Scales of Lateral Line (BSLL) 5-6 (5.2± 0.45) Unbranched Dorsal Fin rays (UDFR) 3-3 (3±0) Branched Dorsal Fin Rays (BDFR) 8 (8± 0) Pectoral Fin Rays (PFR) 12-14 (13± 0.63) Unbranched Anal Fin Ray (UAFR) 3-3 (3±0) Branched Anal Fin Rays (BAFR) 13-15 (14± 0.89) Caudal Fin Rays (CFR) 16-18 (17±0.70) Pelvic Fin Spine (VFS) 1-1 (1±0) Pelvic Fin Rays (VFR) 8-8 (8±0) IHJPAS. 2025, 38 (1) 75 Character min-max (Mean ±SD) Scales around the least circumference of the caudal peduncle (SCP) 10-12 (11±0.97) Gill Rakers (GR) 12-14 (13± 0.59) Figure 3 A. Acanthobrama marmid (Whole body) from Al-Zubaydia sub-district, Wasit Governorate. Figure 3 B. Acanthobrama marmid (Whole body) from Al-Tharthar Lake, Salahaddin Governorate. 3.2. Statistical analysis The SPSS program version 26 was used to find out the significant differences in characters between two populations of A. marmid from two localities: Al-Zubaydia sub-district and Tharthar Lake. The results of this study show that there were minor differences between the studied populations in some morphological characteristics, including dorsal fin height, pectoral fin length, and upper caudal fin length, but that there were no significant differences in meristic characters. 3.3. Molecular study PCR primers of the cytochrome b gene (cyto b), and specific primers der are successfully amplified, and gel electrophoresis is performed to show PCR amplification of the cyto b, which yielded a 508 bp product. These amplifications are used for diagnosis the species and give comparative data for developmental taxonomy studies and family development research at the IHJPAS. 2025, 38 (1) 76 species level. Sequencing of these genes is performed in order to determine the genotype of A. marmid, which is collected from the Al-Zubaydia sub-district. DNA sequencing is one of the most important methods that contributed to the rapid diagnosis of species (20). The sequence of one gene examined forward and reverse primer is performed, this is part of the sequence process requirements and the use of PCR technology in the context of the method of genetic analysis. The results of nucleotide alignment with the sequences in the gene bank showed that the identities ranged 99%. BLAST results are shown in Table 4. Table 4. The BLAST output of Acanthobrama marmid fish for cytochrome b partial sequence gene. Sample Organism Sequence ID Score Expect Identities No. nucleotide Isolate T 4, T5 and T6 A. marmid AY026411.1 826 0.0 99 % 44 - 499 Partial CDs and cytochrome b (cytb) gene mitochondria are compatible with the same sequence fragment marker, which is available at the Gene Bank in the National Center for Biotechnology Information (NCBI). Figure 4 shows the fish specimens' partial sequence and pair-wise analysis. https://www.ncbi.nlm.nih.gov/nucleotide/AY026411.1?report=genbank&log$=nuclalign&blast_rank=1&RID=1EJN02C1013 IHJPAS. 2025, 38 (1) 77 Figure 4. Pair wise alignment of partial cds, cytochrome b (cyt b) gene of Acanthobrama marmid Query is the study or sample sequence and subject is the Gene Bank sequence TAGTCGACCTTCCAACACCATCTAACATTTCAGTAATATGAAACTTCGGGT AQuery 1 ATGACGCG 60 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| TAGTCGACCTTCCAACACCATCTAACATTTCAGTAATATGAAACTTCGGGT CSbjct 44 ATGACGCG 103 TATTTCTAGCTATACATT CATTATGCTTAATTACCCAAATCCTCACGGGAQuery 61 CCCTCCTAGG 120 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| TATTTCTAGCTATACATT GSbjct 104 CCCTCCTAGGATTATGCTTAATTACCCAAATCCTCACGGGA 163 CCCATATTTGCCGAGACGTTAACT TCCACCGCGTTTTCATCAGTAACQuery 121 ACACCTCTGATAT 180 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| TCCACCGCGTTTTCATCAGTAACCCATATTTGCCGAGACGTTAACT TSbjct 164 ACACCTCTGATAT 223 Query 181 ATGGTTGACTCATTCGAAGTTTACACGCTAACGGAGCATCGTTCTTCTTTATCTGCCTTT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 224 ATGGTTGACTCATTCGAAGTTTACACGCTAACGGAGCATCGTTCTTCTTTATCTGCCTTT 283 Query 241 ATATACACATTGCACGAGGCCTATACTACGGATCATATCTTTACAAAGAGACCTGAAATA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 284 ATATACACATTGCACGAGGCCTATACTACGGATCATATCTTTACAAAGAGACCTGAAATA 343 Query 301 TTGGCGTAGTCCTATTTCTTCTAGTTATAATGACAGCCTTCGTCGGCTATGTACTTCCAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 344 TTGGCGTAGTCCTATTTCTTCTAGTTATAATGACAGCCTTCGTCGGCTATGTACTTCCAT 403 Query 361 GGGGACAGATATCTTTTTGAGGTGCCACCGTAATTACAAACCTCCTCTCAGCAGTCCCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 404 GGGGACAGATATCTTTTTGAGGTGCCACCGTAATTACAAACCTCCTCTCAGCAGTCCCTT 463 Query 421 ACATGGGCGACACCCTCGTACAGTGAATCTGAGGCG 456 |||||||||||||||||||||||||||||||||||| Sbjct 464 ACATGGGCGACACCCTCGTACAGTGAATCTGAGGCG 499 IHJPAS. 2025, 38 (1) 78 The fish tissues are sequenced a total of 508 bp at the 5 ends of the cytb mtDNA region for three samples, and the best likelihood tree from the partitioned maximum likelihood analysis revealed two sub-branches in Fig. 5. One of the branches revealed that A. marmid, found in local samples T5 and T6, formed a sister group with a bootstrap value (BP) of 83%, while another sample, local sample T4, formed a sister group with a bootstrap value (BP) of 63%. There was a similarity between local samples (T4, T5, and T2) and standard sequences of A. marmid of the same gene from France (AY026411.1), with a bootstrap value (BP) of 99%. The other branch demonstrated a close clustering of the genus Acanthobrama with the genera Abramis Cuvier, 1816, Vimba Fitzinger, 1873, Acanthalburnus Berg, 1916, Blicca Heckel, 1843, and Petroleuciscus Bogutskaya, 2002. Figure 5. Phylogenetic tree analysis of Acanthobrama marmid local samples resemble for others in different countries; draw by MEGA X using Maximum like hood (ML) method with bootstrap value 500 repeats. 4. Discussion 4.1. Morphological study Morphometric and meristic traits are practical tools in fish morphology for new species definition (21) and species identification (22). In addition, fish morphology can influence their swimming performance, reproductive, camouflage, feeding activities, etc. (23). The fish species in the current study previously belonged to the Cyprinidae, but now belong to the Leuciscidae, according to the global research of Stout et al. (24), which provides robust resolution for the relationships among Cypriniformes using anchored enrichment. The descriptions of the current A. marmid specimens are similar to those provided by Coad (1). The number of dorsal fin rays in this study is similar to that in Al-Hassan et al. (6), but the number of lateral line scales and the anal fin ray of present specimens are smaller (53-55 vs. 66 and 16-18 vs. 19), respectively. Krupp et al. (25) found a specimen that exhibited characters intermediate between A. marmid and Alburnus mossulensis (= A. sellal). However, these specimens are similar to the hybrid species described by Krupp et al. (25). For example, both they have 53–55 lateral line scales above and below, as well as the same number of dorsal fin rays, anal fin rays, gill rackers, and lateral line scales. at the current results have a few differences in characteristics of A. marmid compared to the results of Coad (1). These differences were 12–18 for the number of pectoral-fin rays, 16–22 for the number of anal-fin rays, 11–8 for the number of dorsal-fin rays, 12–17 for the number of pelvic-fin rays, and 53–72 for the number of gill rackers. When made comparison in some features of A. marmid in the current study, such as the number of branched dorsal-fin rays, the number of pelvic-fin rays, and the number of anal-fin rays, Acanthobrama marmid (Local sample-T5) Acanthobrama marmid (Local sample-T6) Acanthobrama marmid (Local sample-T4) Acanthobrama marmid AY026411.1 France Acanthalburnus microlepis AY026407.1 France Abramis brama KX588538.1 Czech Republic Blicca bjoerkna AP011210.1 Japan Vimba vimba GQ279764.1 UK Acanthobrama persidis AP011264.1 Japan Petroleuciscus persidis HM560112.1 Iran: Pibarnoo spring100 100 96 83 63 99 37 IHJPAS. 2025, 38 (1) 79 we found that the scales above of the lateral line and the scales below of the lateral line are 8, 8, 16-18, 12-13, and 5-6, respectively, which are in agreement with the results of Agha (26). However, the number of lateral line and gill rakers in this study is lower (53-55 vs 57-69) and 12- 14 vs 14-16, respectively. The lateral line scales and numbers of the anal-fin rays 53-55 and 16- 18, respectively, are inconsistent with the results of Al-Moussawi and Afrasiab (27), which are 66 and 19, respectively. The number of branched dorsal fin rays, pelvic fin rays, and pectoral fin rays in this study is consistent with Kaya et al.'s results (28), but the lateral scale line and number of gill rakers of current specimens are lower than those of Turkish specimens (53-55 vs 61-70 and 12-14 vs. 14-17 respectively). The total length of the specimens ranges from 11.4-15.7, which is in line with the results of Eagderi et al. (29), which show a range of 4.85-15.49. The current study compares several features of A. marmid, including the number of dorsal fin rays, the number of pelvic fin rays, the number of pectoral fin rays, the number of anal-fin rays, the number of lateral line scales, the number of above and below lateral line scales, and the number of lateral line scales. These results align with those of Coad (30), which are 11, 7-9, 12-18, 16-22, 53-77, 10-14, and 4- 7, respectively. The phenotype of an organism constantly interacts with its environment and biological factors, either directly or indirectly influencing its body shape and the selection of preferred features. It increases the likelihood of survival and reproduction in an environment. This can lead to the creation of a new population (31). The results of the current study showed that there were differences between the studied populations in some morphological characteristics, including dorsal fin height, pectoral fin length, and upper caudal fin length. There are many studies that showed these differences in morphometric and meristic characters of some species that belong to the Cypriniformes, such as Keivany et al. (32) Looked at 29 groups of G. rufa from six river basins and systems in Iran. They discovered big differences (p<0.05) in the ratios of the dorsal fin base to standard length and the pectoral fin to standard length. This matches what Zamani- Faradonbe et al. is found. (33). The latter study conducted on G. rufa from three distinct populations, revealing significant differences in 14 morphometric measures and several metrics, including lateral line scales, predorsal scales, and circamucaudal scales. 4.2. Molecular study The present study classified and identified conventionally on the basis of external morphological traits. However, the various developmental stages of the fishes are difficult to identify by morphological characteristics alone. Therefore, the traditional identification and classification results were supported by mitochondrial DNA sequencing, and, fortunately, the results matched and there was no confusion in the scientific nomenclature, the cyto b gene as a code for animal species identification (34); especially the fish species, which have been attracting attention lately. This study demonstrated the effectiveness of the cyto b gene in identifying Leuciscidae species. Aziz (35) used the same gene cyto b to identify nine species of Cyprinidae. The DNA sequencing results showed that all species belong to Cyprinidae, and the phylogenetic relationship degree with this family for Cyprinion macrostomum, Luciobarbus esocinus, Capoeta trutta, and L. xanthopterus was a BP of 90%, for C. luteus was a BP of 87%, for B. grypus (=A. grypus) was a BP of 76%, and C. regium, C. carpio, and C. carassius was a BP of 75%. In this study, the results IHJPAS. 2025, 38 (1) 80 are in agreement with Durand et al. (36), who used mitochondrial cytochrome b DNA sequences with strong statistical support to study the phylogenetic of A. marmid in the Middle East region and indicated that the genus Acanthobrama closely clusters with the genera Abramis, Vimba, and Acanthalburnus. Gaffaroglu et al. (37), examined the karyotype of A. marmid, and discovered that it closely resembles the karyotype pattern of several leuciscine genera, such as Alburnus Rafinesque, 1820, Alburnoides Jeitteles, 1861, Abramis, Blicca, Leucaspisus Heckel & Kner, 1857, Leuciscus Cuvier, 1816, Petroleuciscus Bogutskaya, 2002, Pseudaspius Dybowski, 1869, Rutilus Rafinesque, 1820, Scardinius Bonaparte, 1837, and Vimba, among others. This finding is consistent with the current study, which includes DNA sequencing results indicating that there is a genetically close relationship among them, and these species belong to the Leucisidae, which in turn belongs to the order Cypriniformes. Behrens-Chapuis et al. (38) used the mitochondrial COI gene for species identification. Still, it concluded this gene failed to identify closely related species of Leucisidae such as Acanthobrama, Alburnus, Mirogrex, Phoxinus, Scardinius, Chondrostoma, Gobio, and Squalius. Still, the cytochrome b (cytb) gene used in the current study is successful in the identification of Acanthobrama belonging to Leucisidae. 5. Conclusions The current study's results confirm the morphological identification of A. marmid. The DNA sequencing results validated the validity of the fish species and demonstrated the identification of correctly sequenced species using the cytob gene. Acknowledgement We extend our sincere thanks to Prof. Dr. Hula Y. F. Al-Sadi, College of Sciences, University of Baghdad, for her invaluable contribution and advice about molecular work. Conflict of Interest The authors declare that they have no conflicts of interest. Funding There is no funding for the article. Ethical Clearance There is no ethical clearance for the used animals. References 1. Coad BW. Freshwater fishes of Iraq. Pensoft Series Faunistica. 2010; ISBN 978-954-642-530-0. 2. Heckel JJ. Abbildungen und Beschreibungen der Fische Syriens nebst einer neuen Classification und Characteristik sämmtlicher Gattungen der Cyprinen. Stuttgart; 1843. p. 109. 3. Mahdi N. Fishes of Iraq. Ministry of Education, Baghdad; 1962. p. 82. IHJPAS. 2025, 38 (1) 81 4. Al-Thahaibawi BM, Younis KH, Al-Mayaly IKA. Fish assemblage structure in Al-Huwaizah marsh, southern Iraq after inscribed on the World Heritage List. Iraq J Sci. 2019;60(7):1430-1441. https://doi.org/10.24996/ijs.2019.60.7.3 5. Al-Nasiri SK, Hoda SM. Survey of fish fauna of Shatt Al-Arab (from Abu al-Khasib to Karmat Ali). Bull Basrah Nat Hist Mus. 1975;2:36-46. https://bjnhm.uobasrah.edu.iq/index.php/nhm/article/view/54 6. Al-Hassan LA, Al-Badri MEH. First record of some fishes from Khor Al-Zubair, Khor Adullah, and Shatt Al-Arab, Basrah, Iraq. Cybium. 1986;10:297-298. https://doi.org/10.26028/cybium/1986-103- 007 7. Froese R, Pauly D, editors. FishBase. World Wide Web electronic publication. www.fishbase.org, version (02/2023). 8. Al-Nasiri SK, Salman NA. Length-weight relationship and condition of Acanthobrama marmid Heckel, in the Lesser Zab River. Iraq J Agric Sci. 1977;12:186-194. 9. Freyhof J, Güler Ekmekçi F, Ali A, Khamees NR, Ozuluğ M, Hamidan N, Küçük F, Smith K. Freshwater fishes, p.19-42. In: Smith KG, Barrios V, Darwall WRT, Numa C, editors. The status and distribution of freshwater biodiversity in the Eastern Mediterranean. IUCN programs; 2014. p. 129. 10. Al-Janabi MIG. A description study of two local fish himri Carasobarbus luteus (Heckel, 1843) (Cypriniformes: Cyprinidae) and hishni Liza abu (Heckel, 1843) (Mugiloidei: Mugilidae) by bones staining method. Bull Iraq Nat Hist Mus. 2014;13(1):73-79. https://jnhm.uobaghdad.edu.iq/index.php/BINHM/article/view/95 11. Stein ED, Martinez MC, Stiles S, Miller PE, Zakharov E. Is DNA barcoding actually cheaper and faster than traditional morphological methods: results from a survey of freshwater bioassessment efforts in the United States. PLoS ONE. 2014;9(4):e95525. https://doi.org/10.1371/journal.pone.0095525 12. Faddagh MS, Hussain NA, Al-Badran AI. DNA fingerprinting of eight Cyprinid fish species of Iraqi inland waters using RAPD-PCR technique. Adv Life Sci. 2012;2(2):9-16. https://doi.org/10.5923/j.als.20120202.03 13. Caine L, Lima G, Pontes L, Abrantes D, Pereira M, Pinheiro MF. Species identification by cytochrome b gene: casework samples. Int Congr Ser. 2006;1288:145-147. https://doi.org/10.1016/j.ics.2005.09.152 14. Szczerbowski JA, Barbel R, Epler P. Fishing gear selectivity, fish survival rates, and resources in lakes Tharthar, Habbaniya and Razzazah. Arch Pol Fish. 2001;9(1):225-233. Cited by: Kornijów R, Szczerbowski J, Krzywosz T, Bartel R. The macrozoobenthos of the Iraqi lakes Tharthar, Habbaniya and Razzazah. Arch Pol Fish. 2001;9(1):127-145. https://www.researchgate.net/publication/232815436_The_macrozoobenthos_of_the_Iraqi_lakes_Tha rthar_Habbaniya_and_Razzazah 15. Zdanowski B, Lossow K, Bartel R, Szczerbowski JA. Salinity levels and the trophic state of Iraqi dam reservoirs and lakes. Arch Pol Fish. 2001;9(1):35-52. Cited by: Kornijów R, Szczerbowski J, Krzywosz T, Bartel R. The macrozoobenthos of the Iraqi lakes Tharthar, Habbaniya and Razzazah. Arch Pol Fish. 2001;9(1):127-145. https://www.researchgate.net/publication/232815436_The_macrozoobenthos_of_the_Iraqi_lakes_Tha rthar_Habbaniya_and_Razzazah 16. Hubbs CL, Lagler KF. Fishes of the Great Lakes region. Cranbrook Inst Sci Bull. 1964;26:1-213. Cited by: Tanaka F, Iwatsuki Y. Amamiichthys, a new genus for the sparid fish Cheimerius matsubarai Akazaki 1962, and redescription of the species, with designation of a neotype. Zootaxa. 2015;4007(2):195-206. https://www.biotaxa.org/Zootaxa/article/view/zootaxa.4007.2.3 https://doi.org/10.24996/ijs.2019.60.7.3. https://bjnhm.uobasrah.edu.iq/index.php/nhm/article/view/54. https://doi.org/10.26028/cybium/1986-103-007. https://doi.org/10.26028/cybium/1986-103-007. https://jnhm.uobaghdad.edu.iq/index.php/BINHM/article/view/95. https://doi.org/10.1371/journal.pone.0095525 https://doi.org/10.5923/j.als.20120202.03. https://doi.org/10.1016/j.ics.2005.09.152 https://www.researchgate.net/publication/232815436_The_macrozoobenthos_of_the_Iraqi_lakes_Tharthar_Habbaniya_and_Razzazah. https://www.researchgate.net/publication/232815436_The_macrozoobenthos_of_the_Iraqi_lakes_Tharthar_Habbaniya_and_Razzazah. https://www.researchgate.net/publication/232815436_The_macrozoobenthos_of_the_Iraqi_lakes_Tharthar_Habbaniya_and_Razzazah. https://www.researchgate.net/publication/232815436_The_macrozoobenthos_of_the_Iraqi_lakes_Tharthar_Habbaniya_and_Razzazah. https://www.biotaxa.org/Zootaxa/article/view/zootaxa.4007.2.3. IHJPAS. 2025, 38 (1) 82 17. Kashefi P, Bani A, Ebrahimi E. Morphometric and meristic variations between non-reproductive and reproductive kutum females (Rutilus frisii kutum, Kamensky, 1901) in the southwest Caspian Sea. Ital J Zool. 2015;79(3):337-343. https://doi.org/10.1080/11250003.2011.642414 18. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, New York. 1989. https://www.cabdirect.org/cabdirect/abstract/19901616061 19. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547-1549. https://doi.org/10.1093/molbev/msy096 20. Pons J, Barraclough TG, Gomez-Zurita J, Cardoso A, Duran DP, Hazell S, Vogler AP. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Syst Biol. 2006;55(4):595-609. https://doi.org/10.1080/10635150600852011 21. Strauss RE, Bond CE. Taxonomic methods: morphology. In: Schreck CB, Moyle PB, editors. Methods for fish biology. American Fisheries Society, Maryland. 1990;109-140. https://doi.org/10.47886/9780913235584 22. Nelson JS, Grande TC, Wilson MVH. Fishes of the World. 5th ed. John Wiley and Sons, Hoboken; 2016. ISBN 978-1-118-34233-6. https://doi.org/10.1002/9781119174844 23. Sfakiotakis M, Davies JBC, Lane DM. Review of fish swimming modes for aquatic locomotion. IEEE J Ocean Eng. 1999;24(2):237-252. https://doi.org/10.1109/48.757275 24. Stout CC, Tan M, Lemmon AR, Lemmon EM, Armbruster GW. Resolving Cypriniformes relationships using an anchored enrichment approach. BMC Evol Biol. 2016;16(244):1-13. https://doi.org/10.1186/s12862-016-0819-5 25. Krupp F, Al-Hassun LAJ, Ziegler T. A possible natural hybrid of Acanthobrama marmid and Alburnus mossulensis from Haur al-Hammar, southern Iraq (Pisces: Osteichthyes: Cyprinidae). Senckenb Biol. 1992; 27:219-223. https://fishbase.mnhn.fr/References/RefbyFamily.php?ID=349&Family=Cichlidae&ComName=Cich lids 26. Agha GF. Morphological and molecular identification of some inhabitant fishes in greater Zab River/Aski-Kalak in Kurdistan Region, Iraq. MSc thesis. College of Agriculture, University of Salahaddin; 2017. 27. Al-Moussawi AA, Afrasiab SR. Small collection of cyprinid fishes of fountain and natural streams of Halabja city, north east of Iraq. Adv Bioresearch. 2019;10(2):33-39. https://doi.org/10.15515/abr.0976- 4585.10.2.3339 28. Kaya C, Turan D, Ünlü E. The latest status and distribution of fishes in upper Tigris River and two new records for Turkish Freshwaters. Turk J Fish Aquat Sci. 2016;16:551-568. https://www.trjfas.org/uploads/pdf_900.pdf. 29. Eagderi S, Mouludi-Saleh A, Çiçek E. Length-weight relationship of ten species of Leuciscinae sub- family (Cyprinidae) from Iranian inland waters. Int Aquat Res. 2020;12:133-136. https://doi.org/10.22034/IAR(20).2020.1891648.1004 30. Coad BW. Freshwater fishes of Iran. 2023. http://www.briancoad.com/Species%20Accounts/Contents%20new.htm 31. Spoljaric M, Reimchen TE. 10000 years later: evolution of body shape in Haida Gwaii three-spined stickleback. J Fish Biol. 2007;70(5):1484-1503. https://doi.org/10.1111/j.1095-8649.2007.01425.x. 32. Keivany Y, Nezamoleslami A, Dorafshan S. Morphological diversity of Garra rufa (Heckel, 1843) populations in Iran. Iran J Ichthyol. 2015;2(3):148-154. https://doi.org/10.22034/iji.v2i3.62 https://doi.org/10.1080/11250003.2011.642414 https://www.cabdirect.org/cabdirect/abstract/19901616061. https://doi.org/10.1093/molbev/msy096. https://doi.org/10.1080/10635150600852011 https://doi.org/10.47886/9780913235584 https://doi.org/10.1002/9781119174844. https://doi.org/10.1109/48.757275. https://doi.org/10.1186/s12862-016-0819-5. https://fishbase.mnhn.fr/References/RefbyFamily.php?ID=349&Family=Cichlidae&ComName=Cichlids. https://fishbase.mnhn.fr/References/RefbyFamily.php?ID=349&Family=Cichlidae&ComName=Cichlids. https://doi.org/10.15515/abr.0976-4585.10.2.3339. https://doi.org/10.15515/abr.0976-4585.10.2.3339. https://www.trjfas.org/uploads/pdf_900.pdf. https://doi.org/10.22034/IAR(20).2020.1891648.1004. http://www.briancoad.com/Species%20Accounts/Contents%20new.htm https://doi.org/10.22034/iji.v2i3.62. IHJPAS. 2025, 38 (1) 83 33. Zamani-Faradonbe M, Keivany Y, Dorafshan S, Abbasi-Jeshvaghani M. Body shape variation of Garra rufa (Heckel) (Teleostei: Cyprinidae) using geometric and morphometric techniques. J Anim Divers. 2020;2(1):127-140. https://doi.org/10.29252/JAD.2020.2.1.5 34. Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM, Godfray CJPB. Identification of birds through DNA barcodes. PLoS Biol. 2004;2:e312. https://doi.org/10.1371/journal.pbio.0020312 35. Aziz DM. A comparative hemato-biochemical profiles and phylogenetic study of some cyprinids in Dukan Lake, Kurdistan. MSc thesis. College of Science, University of Salahaddin; 2015. 36. Durand JD, Tsigenopoulos CS, Unlü E, Berrebi P. Phylogeny and biogeography of the family Cyprinidae in the Middle East inferred from Cytochrome B DNA-evolutionary significance of this region. Mol Phylogenet Evol. 2001;22(1):91-100. https://doi.org/10.1006/mpev.2001.1040 37. Gaffaroglu M, Esref Y, Ráb P. Note on the karyotype and NOR phenotype of leuciscine fish Acanthobrama marmid (Osteichthyes, Cyprinidae). Biologia (Bratisl). 2002; 61:207-209. https://doi.org/10.2478/s11756-006-0031-y 38. Behrens-Chapuis S, Herder F, Esmaeili HR, Freyhof J, Hamidan NA, Ozuluğ M, Šanda R, Geiger MF. Adding nuclear rhodopsin data where mitochondrial COI indicates discrepancies – can this marker help to explain conflicts in cyprinids? DNA Barcodes. 2015; 3:187-199. https://www.researchgate.net/publication/286449210 https://doi.org/10.29252/JAD.2020.2.1.5 https://doi.org/10.1371/journal.pbio.0020312 https://doi.org/10.1006/mpev.2001.1040. https://doi.org/10.2478/s11756-006-0031-y. https://www.researchgate.net/publication/286449210. Morphological and Molecular Studies of Acanthobrama marmid Heckel, 1843 (Piscies, Cypriniformes, Leuciscidae) from the Middle of Iraq