18 

© 2025 The Author(s). Published by College of Education for Pure Science (Ibn Al-Haitham), 

University of Baghdad. This is an open-access article distributed under the terms of the Creative Commons 

Attribution 4.0 International License 

Distribution of Macrolides Resistant Genes among Local Clinical Isolates 

of Enterococcus spp. from Root Canal and Urine Samples 

 

Nabaa Kamil Molan
1*

, Alyaa Razooqi Hussein
2

  
1,2

Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq. 

Corresponding author * 

 

Received: 5 July 2023                    Accepted: 10 September 2023              Published: 20 October 2025  

doi.org/10.30526/38.4.3649 

 
 Abstract    

Gram-positive enterococci are opportunistic and resistant to many antibiotics. This search 

investigated the prevalence of macrolide antibiotic resistance genes in local enterococcal isolates and 

its correlation with biofilm formation. We collected 112 clinical samples from the Medical City 

Hospital, dentists' clinics, and labs in Baghdad from October 2022 to March 2023, which included 

root canal samples from 50 patients and urine samples from 62 patients with urinary tract infections. 

The samples were cultured on Pfizer-specific Enterococcus media. Twenty-one isolates were 

identified as Enterococcus spp. by biochemical tests and confirmed using the VITEK 2 system. After 

that, the crystal violet staining method was used to assess enterococci isolates' ability to form biofilms 

in a polystyrene microtiter, and then molecular detection was done to detect the ermB gene. The 

results revealed that the percentage of enterococcal isolates positive for the ermB gene was 87.5% in 

root canal samples. In urine samples, the percentage of enterococcal isolates with the same gene was 

84.6%. All isolates succeeded in forming biofilm; for urine isolates, 77% and 23% of isolates formed 

moderate and strong biofilm, respectively. While for root canal isolates, 12.5%, 75%, and 12.5% of 

isolates formed weak, moderate, and strong biofilm, respectively. We conclude in this study that the 

ermB gene was detected in enterococcal isolates from the tooth root canal and urine samples, with a 

higher prevalence percentage in urine sample isolates than tooth root canal isolates. Finally, the 

findings demonstrated that there is no connection between this gene's existence and the tested isolates' 

ability to create biofilms. 

Keywords: Enterococcus spp., ermB gene, macrolide antibiotics, urine samples, root canal 

samples. 

 

1.Introduction 

     Enterococci are gram-positive, facultative anaerobic bacteria that can be opportunistic 

when naturally occurring in the female genital tract and the human intestinal tract. The 

environment, including water and soil, abundantly harbors enterococci )1(. The most 

common enterococcal species are E. faecium and E. faecalis, which are responsible for most 

of the nosocomial infections causing serious conditions such as endocarditis and septicemia 

)2(. Bacterial infections have a severe problem due to the significant effects they have in 

medical settings and public. The gastrointestinal system, urinary tract, respiratory tract, soft 

tissue, and skin are the locations of most infections )3(. Enterococci are major nosocomial 

microorganisms that are resistant to a variety of antimicrobial treatments through acquired 

and intrinsic mechanisms. Inherent resistance is another name for intrinsic resistance. 

https://orcid.org/0009-0003-7173-0676
mailto:nabaa.Kamel1602a@sc.uobaghdad.edu.iq
https://orcid.org/0000-0003-2514-082X
mailto:alyaa.razooqi@sc.uobaghdad.edu.iq
https://orcid.org/0009-0003-7173-0676
mailto:nabaa.Kamel1602a@sc.uobaghdad.edu.iq
https://orcid.org/0000-0003-2514-082X
mailto:alyaa.razooqi@sc.uobaghdad.edu.iq
https://orcid.org/0009-0003-7173-0676
mailto:nabaa.Kamel1602a@sc.uobaghdad.edu.iq
https://orcid.org/0000-0003-2514-082X
mailto:alyaa.razooqi@sc.uobaghdad.edu.iq
https://orcid.org/0009-0003-7173-0676
mailto:nabaa.Kamel1602a@sc.uobaghdad.edu.iq
https://orcid.org/0000-0003-2514-082X
mailto:alyaa.razooqi@sc.uobaghdad.edu.iq
https://orcid.org/0009-0003-7173-0676
mailto:nabaa.Kamel1602a@sc.uobaghdad.edu.iq
https://orcid.org/0000-0003-2514-082X
mailto:alyaa.razooqi@sc.uobaghdad.edu.iq


IHJPAS. 2025, 38(4) 
 

19 

Chromosome characteristics, naturally encoded in all or some strains of the Enterococcus 

species, trigger this resistance. Specific Enterococcus species or groups frequently link 

intrinsic resistance mechanisms to various antimicrobials, unlike acquired resistance, which is 

substantially more varied )4(. Several popular antibacterial medications are inherently 

resistant to enterococci. All enterococci exhibit decreased sensitivity to penicillin and 

ampicillin as well as considerable levels of resistance to the majority of cephalosporins and 

all semi-synthetic penicillins as a result of the development of low-affinity penicillin-binding 

proteins. The prevalence of ampicillin resistance in many bacteria does not exclude the 

therapeutic use of this drug. In reality, ampicillin is still the go-to medication for enterococcal 

infections that don't exhibit other forms of high-level resistance )5(. DNA mutations and the 

creation of new genetic material are two factors that contribute to enterococci's acquired 

resistance. Examples of medicines with this resistance include ampicillin, tetracycline, 

macrolides, aminoglycosides (high levels), chloramphenicol, quinolones, glycopeptides, 

streptogramins, and even some more contemporary medications like linezolid and 

daptomycin )6(. Without a doubt, the development of resistant bacteria is a result of the 

widespread usage of these antibiotics [7]. One of the most common resistance mechanisms is 

23S rRNA methylation expressed by erm genes, which prevent macrolide from binding to 

ribosomes )8(. Efflux pump genes (msrA, msrC, mefA, and mefE) are engaged in additional 

mechanisms that remove macrolide-resistant antibiotic compounds from within the 

bacterium )9(. A family of medications known as macrolides is used to control and treat 

different bacterial infections. Commonly recommended antibiotics for infections, including 

tonsillitis, sinusitis, and pneumonia, include azithromycin, clarithromycin, and erythromycin 

)10(. Erm genes are the more common macrolide resistance determinants. This code is for a 

single methyltransferase that reacts with certain 23S rRNA subunit residues. This enzyme 

inhibits erythromycin binding by N6-dimethylating an adenine residue in the 23S rRNA 

subunit. )11(. The presence of erythromycin resistance methylase (erm) genes, such as ermA, 

ermB, and ermC, is linked to erythromycin resistance in enterococci. The ermB gene, which 

encodes the ribosomal methylase, is the most common erm gene among isolates of 

enterococci that are resistant to erythromycin (12).  

Biofilms play a crucial role in the survival of enterococci by their adaptability to a variety of 

environments and their ease in acquiring mobile genetic elements, such as plasmids, from 

other bacteria, because of this genetic material exchange (13). The process of biofilm 

formation involves the aggregation of microbial cells into collectives that adhere to both 

biological and non-biological surfaces. These collectives are embedded in a self-produced 

extracellular matrix made of microbial biopolymers like proteins, exopolysaccharides, and 

extracellular DNA, which creates a unique microenvironment (14). According to (15), 

biofilm development shields the microbial population from environmental stress. 

Additionally, the development of biofilms makes it easier for community members to engage 

and capture resources. As a result, bacteria that form biofilms are physiologically different 

from bacteria that are free to move about. 

The current study aimed to investigate the prevalence of macrolide antibiotic resistance genes 

in local enterococcal isolates and its correlation with biofilm formation. 

 

2. Materials and Methods 

2.1. Bacterial isolation and identification 

To learn more about the distribution of macrolide-resistant genes in local isolates of 

Enterococcus spp., urine and root canal samples were gathered from the Medical City 



IHJPAS. 2025, 38(4) 
 

20 

Hospital, dentists' clinics, and labs in Baghdad between October 2022 and March 2023. For 

root canal samples, sterile paper points and files with infected root canals of 50 patients were 

collected, while urine samples from 62 individuals with urinary tract infections were 

centrifuged, supernatant removed, and Pfizer-specific Enterococcus media was used for 

inoculation, and samples were incubated at 37°C for 24 hours. (16). All isolate identifications 

were done by biochemical tests, including the catalase test, growth in medium containing 

6.5% NaCl, and growth at pH 9.6, and confirmed by the Vitek 2 system (17, 18). 

2.2.Molecular detection of macrolides resistance gene (ermB). 

Following the manufacturer's instructions, a DNA genome microextraction kit from Norgen 

(Canada) was used to extract DNA from purified colonies of bacteria. The amount of the 

collected DNA was then calculated with Qubit 4 to evaluate the sample quality for more 

usage. Using the PCR approach, genotyping the ermB gene is accurately followed the 

following: 

2.2.1.Selection of primers 

The primer listed in Table 1 was employed for this investigation. 

Table 1. The primer and its sequence used in conventional PCR 

Gene Sequence 

5ʹ→3ʹ 

Size 

bp 

by Reference 

ermB F: GAAATTGGAACAGGTAAAGGG 

R: CGTTTACTTTGGCGTGTTT 

562 Newly  designed by Nabu 

Scientific Foundation 

 

2.2.2. PCR Amplification 

At 4°C, the primers, the PCR premix, and extracted DNA were defrosted. In order to ensure 

that the contents reached the bottom of their tubes, they were also momentarily vortexed. A 

25 µl PCR mixture was created by combining 5 µl of PCR premix, 1 µl of each primer 

(forward and reverse), 3 µl of DNA template, and 15 µl of clean deionized distilled water 

(19). After quickly mixing the PCR reaction tubes, the DNA was amplified using the 

thermocycler PCR instrument in line with the PCR protocol (Table 2). 

Table 2. Program PCR amplification of ermB gene 

Stage Temperature °C Time  

Initial denaturation 94 4 min  

Denaturation 94 40 sec  

Annealing 48 40 sec 30 Cycle 

Extension 72 40 sec  

Final Extension 72 5 min  

 

2.2.3. Agarose Gel Electrophoresis 

DNA was identified by electrophoresing a 2% agarose gel for 50 minutes at 75 volts and 

staining it with RedSafe dye. Additionally, an ultraviolet transilluminator was used to image 

the agarose gel (20). 

2.3. Biofilm formation 

The crystal violet staining method was used to assess enterococci isolates' ability to form 

biofilms in a polystyrene microtiter plate. We assessed the optical density (OD) using a 

wavelength of 630 nm. After incubation, 200 µl of each bacterial isolate suspension was 

added to a 96-well plate. We fixed the biofilm by heating it to 60°C and then added a 0.1% 

w/v crystal violet solution. The biomass of the biofilm exhibited an inverse correlation with 

the absorbance at 630 nm. Table 3 provided the calculations for the outcomes (21). 

 

 



IHJPAS. 2025, 38(4) 
 

21 

Table 3. Calculation of biofilm formation by Enterococcal isolates   

OD value Biofilm formation 

<OD Non 

  ODc < ODt < 2ODc Weak 

2ODc < ODt < 4ODc Moderate 

4ODc < ODt High 

 

3.  Results  

3.1. Isolation and Identification of Enterococcus spp. 

Samples were collected with the goal of employing the Gram stain technique to isolate and 

identify Enterococcus spp. We arranged gram-positive cocci on Pfizer Enterococcus 

Selective medium into 2 mm in diameter, grey, spherical colonies with black borders and tips 

(Figure 1). It was obtained twenty-one (21) isolates, selected for further investigation such as 

molecular technique and biofilm production ability, that have the ability to resist one or more 

of the macrolide group of antibiotics (unpublished data).  

 
Figure 1. Enterococcus spp. on Pfizer Selective medium 

 

3.2. Biofilm formation  

Biofilm formation capacity was assessed in Enterococcus isolates using 96-well microtiter 

plates, showing varying capabilities. 

3.2.1. Root canal Enterococcus spp. biofilm production 

Eight isolates from root canal samples that showed high antibiotic resistance were chosen for 

the detection of biofilm formation. About 12.5% of the tested isolates were weak producers 

of biofilm, while 75% were moderate, and 12.5% were strong biofilm producers, as shown in 

Figure 2 and Table 4.  

 
Figure 2. Distribution of Enterococcus spp. among weak, moderate and strong groups of biofilm production 

from root canal isolates 



IHJPAS. 2025, 38(4) 
 

22 

Table 4. Biofilm Capacity for Root canal isolates 

Biofilm Capacity for root canal isolates MTP method n=8 (%) 

Producer 8 (100%) 

Strong 1(12.5%) 

Moderate 6 (75.0%) 

Weak 1 (12.5%) 

Non-producer 0 (0%) 

Chi-Square (χ
2
) 12.294 ** 

P-value 0.0098 

** (P≤0.01). 

 

3.2.2. Urine Enterococcus spp. biofilm production 

Thirteen isolates from urine samples that showed high antibiotic resistance were chosen for 

the detection of biofilm formation. About 23% of the tested isolates were strong biofilm 

producers, while 77% were moderately biofilm producers, as shown in figure (3) and table 

(5). 

 
Figure 3. Distribution of Enterococcus spp. among weak, moderate and strong groups of biofilm production 

from urine isolates 

 

Table 5. Biofilm Capacity for Urine isolates 

Biofilm Capacity for urine isolates MTP method n=13(%) 

Producer 13 (100%) 

Strong 3 (23%) 

Moderate 10 (77.0%) 

Weak 0 (0%) 

Non-producer 0 (0%) 

Chi-Square (χ
2
) 23.271 ** 

P-value 0.0001 

** (P≤0.01). 

 

3.3. Molecular detection  

The results of PCR showed that 18 (85.7%) out of 21 isolates from urine and root canal 

samples had the ermB gene. The positive result of the ermB gene was confirmed by 2% 

agarose gel electrophoresis stained with RedSafe, electrophoresed at 75 volts for 50 minutes. 

And photographed under an ultraviolet (UV) transilluminator (Figure 4). 

 



IHJPAS. 2025, 38(4) 
 

23 

 
Figure 4. RedSafe-stained PCR amplified products for the ermB gene were electrophoresed on an agarose gel at 

2% (75 volt/cm) for 50 minutes. Lane M: l500bp Ladder marker. Lane L: isolate NO. with positive bands of 

562bp of ermB gene as follow:1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19, 21. 

 

3.3.1 Urine samples  

The results of PCR showed that 11 (84.6%) isolates had the ermB gene from 13       

enterococcal isolates from urine samples (Table 6). 

Table 6. Percentage distribution of ermB gene among enterococcal isolates from urine samples 

Gene Positive No. (%) Negative  No. (%) Total (%) 

ermB 11 (84.6) 2 (15.3) 13 (100) 

Chi-Square -χ
2
 

(P-value) 

4.865 * 

(0.0437) 

--- 

* (P≤0.05). 

 

3.3.2. Root canal samples 

The results of PCR showed that seven (87.5%) isolates had the ermB gene from eight 

enterococcal isolates of root canal samples (Table 7). 

Table 7. Percentage distribution of ermB gene among enterococcal isolates from root canal samples 

Gene Positive No. (%) Negative  No. (%) Total (%) 

ermB 7 (87.5) 1 (12.5) 8 (100) 

Chi-Square - χ
2
 

(P-value) 

4.138 * 

(0.0497) 
---- 

* (P≤0.05). 

 

3.4. Correlation between antibiotics resistance and biofilm formation in m        

Enterococcal clinical isolates 

The correlation between ermB gene with the category of biofilm formation was investigated; 

the findings demonstrated that there is no connection between this gene's existence and the 

tested isolates' ability to create biofilms as shown in Tables 8, 9 and 10. The results presented 

in Figure 5. 

Table 8. Gene type Biofilm formation Cross-tabulation 

 Biofilm formation Total 

Weak Moderate Strong 

ErmB 

gene 

Positive Count 1 13 4 18 

% of Total 4.8% 61.9% 19.0% 85.7% 

Negative Count 0 3 0 3 

% of Total 0.0% 14.3% 0.0% 14.3% 

Total Count 1 16 4 21 

% of Total 4.8% 76.2% 19.0% 100.0% 

 



IHJPAS. 2025, 38(4) 
 

24 

Table 9. Chi-Square Tests 

 Value df Asymptotic Significance (2-sided) 

Pearson Chi-Square 1.094
a
 2 .579 

Likelihood Ratio 1.782 2 .410 

Linear-by-Linear Association .313 1 .576 

N of Valid Cases 21   

a. 5 cells (83.3%) have expected count less than 5. The minimum expected count is .14. 

 

  Table 10. Correlations between gene type and biofilm formation 

Correlations ErmB gene Biofilm formation 

   

Spearman’s 

rho 

ErmB gene Correlation Coefficient 1.000 -.136 

Sig. (2-tailed) . .556 

N 21 21 

Biofilm formation Correlation Coefficient -.136 1.000 

Sig. (2-tailed) .556 . 

N 21 21 

 

 
Figure 5. Correlations between ermB gene and biofilm formation 

 

4.Discussion  

The obtained isolates and results correspond with previous local findings by (22), who 

also reported macrolide resistance in a significant proportion of Enterococcus isolates. 

In research by (23), 49% of the isolates were shown to be strong biofilm producers, 42% 

showed moderate biofilm development, and 9% showed weak or no biofilm, which is 

different from the results of the current study, while local research by (24) and (25) showed 

that all isolates were biofilm producers.  The local study by Salih revealed that about 23.5% 

of the tested isolates were weak producers of biofilm, while 47% were moderate and 29.5% 

were strong biofilm producers. The research makes clear the significance of biofilm growth 

in bacterial pathogenicity. With the help of biofilms, bacteria may colonize during an illness 

and develop drug resistance. A well-hydrated matrix consisting of proteins, exopolymeric 

substances, and nucleic acids released by dead, lysed cells shields biofilm-forming bacteria 

from immune clearance and antibiotic treatment (26). Both tissue epithelia and body implant 

devices are susceptible to bacterial biofilm formation. Hospitals may employ more antibiotics 

and implant devices, which may enhance clinical pathogens with characteristics that 

encourage the production of biofilms (27). 

It was conducted an investigation into the ability of Enterococcus spp. from urine samples to 

form biofilm (28). Out of 22 isolates, the study discovered that 0 (0%), 17 (77.3%), 3 



IHJPAS. 2025, 38(4) 
 

25 

(13.6%), and 2 (9.1%) were classified as high, medium, weak, and non-biofilm formers, 

respectively. Therefore, this result stands in contrast to the findings of the current study. 

Another study categorized 24 (32%), 33 (44%), and 18 (24%), respectively, in 75 samples as 

weakly, moderately, and highly producing biofilms (29). The majority of these moderate 

values align with the results of the current investigation. Moreover, a study by (30) revealed 

that 4 strains had no biofilm formation, 17 had weak formation, and 4 had moderate 

formation. 

When compared to the DNA ladder displayed in Figure 4, the results of the current 

investigation revealed that the ermB gene band was found at a 562 bp area. The bands 

appeared distinct, single, and not diffused, with no smear indicative of DNA breakdown. 

A global study done by (31) demonstrated that (80.5%) of Enterococcus spp. isolated from 

urine samples were found to have the ermB gene. Another study done by (32) demonstrated 

that (41%) of isolates were found to be positive for the ermB gene. Another study done by 

(33) reported that the ermB gene was the most common gene in 56 (77.7%) of all 

enterococcal urine isolates. Also, (34) reported that the ermB gene was detected in 55.14% of 

all enterococcal isolates. Another study found that of all enterococcal isolates, ermB (67.7%) 

had the highest frequency of erythromycin ribosome methylation (35). 

A study by (36) revealed that 47.6% of the isolates (10 of 21) carried the ermB gene. Also, 

the most often occurring gene, according to (37), it was the ermB gene. Erythromycin 

resistance was discovered in 7% of the growing bacteria. It was found that two of the isolates 

tested positive for the ermB gene, one of the most prevalent genes in oral isolates and more 

prevalent in strains that are highly resistant to the antibiotic erythromycin (38). Anoother 

study found the ermB gene in 24% of all enterococcal isolates in their latest study. Most 

often, ermB expressed erythromycin resistance (39). 

The results in Table 8 demonstrated that the highest percentage of biofilm formation was 

61.9% of the moderate type in the case of gene presence, and also when the gene did not 

appear, the highest percentage of biofilm formation was 14.3% also of the medium type, and 

this indicates that the appearance of the gene had no role in biofilm formation. According to 

the results of the chi-square comparison between the types of biofilm (Table 9), it was found 

that there were no significant differences between the three types; weak, medium, and strong.  

According to Table 10, there is no correlation between the expression of the gene and the 

formation or type of biofilm. 

 

5.Conclusion 

     We conclude in this study that the ermB gene was detected in enterococcal isolates from 

the tooth root canal and urine samples, with a higher prevalence percentage in urine sample 

isolates than tooth root canal isolates. Finally, the findings demonstrated that there is no 

connection between this gene's existence and the tested isolates' ability to create biofilms. 

  

Conflict of Interest  

     Conflict of Interest the authors declare that they have no conflicts of interest. 

 

Funding 

     There is no funding for the article. 

 

 

 



IHJPAS. 2025, 38(4) 
 

26 

Ethical Clearance  

    The study was conducted following the receipt of participant consent and ethical approval 

from the Ethics Committee of the Biology Department at the University of Baghdad's College 

of Science (CSEC/0922/0097) on September 26, 2022. This procedure is in line with the 

guidelines set forth by the Iraqi Ministry of Health and Environment. 

 

References 

1. Semedo-Lemsaddek T, Barreto-Crespo MT, Tenreiro R. Occurrence of putative pathogenicity 

islands in enterococci from distinct species and of differing origins. Appl Environ Microbiol. 

2009;75:7271-7274. https://doi.org/10.1128/AEM.00687-09. 

2. Sharifi Y, Hasani A, Ghotaslou R, Naghili B, Aghazadeh M, Milani M, Bazmany A. Virulence and 

antimicrobial resistance in enterococci isolated from urinary tract infections. Adv Pharm Bull. 

2013;3:197. https://doi.org/10.5681/apb.2013.032. 

3. Hayati Z, Desfiana UH, Suhartono S. Distribution of multidrug-resistant Enterococcus faecalis and 

Enterococcus faecium isolated from clinical specimens in the Zainoel Abidin General Hospital, 

Banda Aceh, Indonesia. Biodiversitas. 2022;23. https://doi.org/10.13057/biodiv/d231010. 

4. Hadi MS. Detection of esp and asa1 genes in multidrug resistance Enterococcus faecalis and their 

relation with biofilm formation. Master’s thesis. Coll Sci, Baghdad Univ. 2021. 

5. Kristich CJ, Rice LB, Arias CA. Enterococcal infection-treatment and antibiotic resistance. 

Enterococci From Commensals to Leading Causes of Drug Resistant Infection. 2014. 

https://pubmed.ncbi.nlm.nih.gov/24649502. 

6. Holman DB, Klima CL, Gzyl KE, Zaheer R, Service C, Jones TH, McAllister TA. Antimicrobial 

resistance in Enterococcus spp. isolated from a beef processing plant and retail ground beef. 

Microbiol Spectr. 2021;9:e01980-21. https://doi.org/10.1128/Spectrum.01980-21. 

7. Conwell M, Dooley JS, Naughton PJ. Enterococcal biofilm—A nidus for antibiotic resistance 

transfer?. J Appl Microbiol. 2022;13:3444-3460. https://doi.org/10.1111/jam.15441. 

8. Tian Y, Yu H, Wang Z. Distribution of acquired antibiotic resistance genes among Enterococcus 

spp. isolated from a hospital in Baotou, China. BMC Res Notes. 2019;12:1-5. 

https://doi.org/10.1186/s13104-019-4064-z. 

9. Choi J, Rieke EL, Moorman TB, Soupir ML, Allen HK, Smith SD, Howe A. Practical implications 

of erythromycin resistance gene diversity on surveillance and monitoring of resistance. FEMS 

Microbiol Ecol. 2018;94:fiy006. https://doi.org/10.1093/femsec/fiy006. 

10. Parnham MJ, Haber VE, Giamarellos-Bourboulis EJ, Perletti G, Verleden GM, Vos R. 

Azithromycin: mechanisms of action and their relevance for clinical applications. Pharmacol Ther. 

2014;143:225-245. https://doi.org/10.1016/j.pharmthera.2014.03.003. 

11. DiPersio LP, DiPersio JR, Frey KC, Beach JA. Prevalence of the erm(T) gene in clinical isolates 

of erythromycin-resistant group D Streptococcus and Enterococcus. Antimicrob Agents 

Chemother. 2008;52:1567-1569. https://doi.org/10.1128/aac.01325-07. 

12. Pechère JC. Macrolide resistance mechanisms in Gram-positive cocci. Int J Antimicrob Agents. 

2001;18:25-28. https://doi.org/10.1016/S0924-8579(01)00407-1. 

13. Celik S, Cakirlar FK, Torun MM. Presence of vancomycin, aminoglycosides, and erythromycin 

resistance genes in enterococci isolated from clinical samples in Turkey. Clin Lab. 2014;60:1801-

1806. https://doi.org/10.7754/Clin.Lab.2014.140211.  

14. Flemming HC, Wuertz S. Bacteria and archaea on Earth and their abundance in biofilms. Nat Rev 

Microbiol. 2019;17:247-260. https://doi.org/10.1038/s41579-019-0158-9. 

15. Van Wolferen M, Orell A, Albers SV. Archaeal biofilm formation. Nat Rev Microbiol. 

2018;16:699-713. https://doi.org/10.1038/s41579-018-0058-4.  

16. Yaaqoob L. Evaluation of the biological effect of synthesized iron oxide nanoparticles on 

Enterococcus faecalis. Iraqi J Agric Sci. 2022;53:440-452. 

https://doi.org/10.36103/ijas.v53i2.1552. 

17. Harley JP, Prescott H. Laboratory exercises in microbiology. 5th ed. McGraw-Hill. 2002. 

https://doi.org/10.1128/AEM.00687-09
https://doi.org/10.5681/apb.2013.032
https://doi.org/10.13057/biodiv/d231010
https://pubmed.ncbi.nlm.nih.gov/24649502
https://doi.org/10.1128/Spectrum.01980-21
https://doi.org/10.1111/jam.15441
https://doi.org/10.1186/s13104-019-4064-z
https://doi.org/10.1093/femsec/fiy006
https://doi.org/10.1016/j.pharmthera.2014.03.003
https://doi.org/10.1128/aac.01325-07
https://doi.org/10.1016/S0924-8579(01)00407-1
https://doi.org/10.7754/Clin.Lab.2014.140211
https://doi.org/10.1038/s41579-019-0158-9
https://doi.org/10.1038/s41579-018-0058-4
https://doi.org/10.36103/ijas.v53i2.1552


IHJPAS. 2025, 38(4) 
 

27 

18. Morello JA, M H. Laboratory manual and workbook in microbiology. 8th ed. New York, 

McGraw-Hill Higher Education. 2006. 

19. Dejoies L, Sassi M, Schutz S, Moreaux J, Zouari A, Potrel S, Cattoir V. Genetic features of the 

poxtA linezolid resistance gene in human enterococci from France. J Antimicrob Chemother. 

2021;76(8):1978-1985. https://doi.org/10.1093/jac/dkab116. 

20. Sambrook J, Rusell DW. Molecular cloning: a laboratory manual. New York, Cold Spring Harbor 

Lab Press. 2001.  

21. Atshan SS, Shamsudin MN, Karunanidhi A, van Belkum A, Lung LTT, Sekawi Z, Nathan JJ, Ling 

KH, Seng JSC, Ali AM. Quantitative PCR analysis of genes expressed during biofilm 

development of methicillin-resistant Staphylococcus aureus (MRSA). Infect Genet Evol. 

2013;18:106-112. https://doi.org/10.1016/j.meegid.2013.05.002. 

22. Shareef HA, Abdullah SN. Antimicrobial susceptibility of Enterococcus spp. isolated from 

different clinical sources in Kirkuk province. Ibn Al-Haitham J Pure Appl Sci. 2018;97-104. 

https://doi.org/10.30526/2017.IHSCICONF.1777.  

23. Akbari T, Pourhajibagher M, Hosseini F, Chiniforush N, Gholibegloo E, Khoobi M, Shahabi S, 

Bahador A. The effect of indocyanine green loaded on a novel nano-graphene oxide for high 

performance of photodynamic therapy against Enterococcus faecalis. Photodiagn Photodyn Ther. 

2017;20:148-153. https://doi.org/10.1016/j.pdpdt.2017.08.017. 

24. Al-Shammary AHA. Run-off patterns of vancomycin resistant enterococci (VRE clones) in cow’s 

raw milk and imported milk powders at Baghdad markets. Iraqi J Vet Med. 2019;43:61-66. 

https://doi.org/10.30539/iraqijvm.v43i2.532. 

25. Salih AM. Effect of fructophilic lactic acid bacteria suspension on biofilm formed by 

Enterococcus faecalis. Master’s thesis. Baghdad Univ. 2022. 

26. Upadhyaya GP, Lingadevaru UB, Lingegowda RK. Comparative study among clinical and 

commensal isolates of Enterococcus faecalis for presence of esp gene and biofilm production. J 

Infect Dev Ctries. 2011;5:365-369. https://doi.org/10.3855/jidc.1385. 

27. Costerton J, Montanaro L, Arciola CR. Biofilm in implant infections: its production and 

regulation. Int J Artif Organs. 2005;28:1062-1068. https://doi.org/10.1177/039139880502801103. 

28. Asfaw T. Biofilm formation by Enterococcus faecalis and Enterococcus faecium. Int J Res Stud 

Biosci. 2019;7. http://dx.doi.org/10.20431/2349-0365.0704002. 

29. Shahi F, Hamidi H, Khoshnood S, Mehdipour G, Dezfouli AA, Sheikh AF. Virulence 

determinants and biofilm formation in clinical isolates of Enterococcus: a cross-sectional study. J 

Acute Dis. 2020;9:27-32. http://doi:10.4103/2221-6189.276079. 

30. Francisco PA, Fagundes PIG, Lemes-Junior JC, Lima AR, Passini MRZ, Gomes BP. Pathogenic 

potential of Enterococcus faecalis strains isolated from root canals after unsuccessful endodontic 

treatment. Clin Oral Investig. 2021;1-9. https://doi.org/10.1007/s00784-021-03823-w. 

31. Jia W, Li G, Wang W. Prevalence and antimicrobial resistance of Enterococcus species: a hospital-

based study in China. Int J Environ Res Public Health. 2014;11:3424-3442. 

https://doi.org/10.3390/ijerph110303424. 

32. Emaneini M, Aligholi M, Aminshahi M. Characterization of glycopeptides, aminoglycosides and 

macrolide resistance among Enterococcus faecalis and Enterococcus faecium isolates from 

hospitals in Tehran. Pol J Microbiol. 2008;57:173-178. 

33. Ahmadpoor N, Ahmadrajabi R, Esfahani S, Hojabri Z, Moshafi MH, Saffari F. High-level 

resistance to erythromycin and tetracycline and dissemination of resistance determinants among 

clinical enterococci in Iran. Med Princ Pract. 2021;30:272-276. 

https://doi.org/10.1159/000516216. 

34. Woźniak-Biel A, Bugla-Płoskońska G, Burdzy J, Korzekwa K, Ploch S, Wieliczko A. 

Antimicrobial resistance and biofilm formation in Enterococcus spp. isolated from humans and 

turkeys in Poland. Microb Drug Resist. 2019;25:277-286. https://doi.org/10.1089/mdr.2018.0221. 

35. Tian Y, Yu H, Wang Z. Distribution of acquired antibiotic resistance genes among Enterococcus 

spp. isolated from a hospital in Baotou, China. BMC Res Notes. 2019;12:27. 

https://doi.org/10.1186/s13104-019-4064-z. 

https://doi.org/10.1093/jac/dkab116
https://doi.org/10.1016/j.meegid.2013.05.002
https://doi.org/10.30526/2017.IHSCICONF.1777
https://doi.org/10.1016/j.pdpdt.2017.08.017
https://doi.org/10.30539/iraqijvm.v43i2.532
https://doi.org/10.3855/jidc.1385
https://doi.org/10.1177/039139880502801103
http://dx.doi.org/10.20431/2349-0365.0704002
http://doi:10.4103/2221-6189.276079
https://doi.org/10.1007/s00784-021-03823-w
https://doi.org/10.3390/ijerph110303424
https://doi.org/10.1159/000516216
https://doi.org/10.1089/mdr.2018.0221
https://doi.org/10.1186/s13104-019-4064-z


IHJPAS. 2025, 38(4) 
 

28 

36. Penas PP, Mayer MP, Gomes BP, Endo M, Pignatari ACP, Bauab KC, Pinheiro ET. Analysis of 

genetic lineages and their correlation with virulence genes in Enterococcus faecalis clinical 

isolates from root canal and systemic infections. J Endod. 2013;39:858-864. 

https://doi.org/10.1016/j.joen.2013.01.009. 

37. Jain H, Mulay S, Mullany P. Persistence of endodontic infection and Enterococcus faecalis: role of 

horizontal gene transfer. Gene Rep. 2016;5:112-116. https://doi.org/10.1016/j.genrep.2016.09.010.  

38. Seguel N, Quezada-Aguiluz M, González-Rocha G, Bello-Toledo H, Sánchez-Sanhueza G. 

Antibiotic resistance of Enterococcus faecalis from persistent endodontic infections. Int J 

Odontostomatol. 2022;14:448-456. https://doi.org/10.53730/ijhs.v6n7.11067. 

39. Vazquez-Ramos VR, Pérez-Serrano RM, García-Solís P, Solis-Sainz JC, Espinosa-Cristóbal LF, 

Castro-Ruíz JE, Domínguez-Pérez RA. Root canal microbiota as an augmented reservoir of 

antimicrobial resistance genes in type 2 diabetes mellitus patients. J Appl Oral Sci. 

2023;30:e20220362. https://doi.org/10.1590/1678-7757-2022-0362. 

 

https://doi.org/10.1016/j.joen.2013.01.009
https://doi.org/10.1016/j.genrep.2016.09.010
https://doi.org/10.53730/ijhs.v6n7.11067
https://doi.org/10.1590/1678-7757-2022-0362