63 © 2025 The Author(s). Published by College of Education for Pure Science (Ibn Al-Haitham), University of Baghdad. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International License Genotyping and Beta–Lactamase Production of Escherichia coli Isolated from Different Sources Saja Mohammed Mahmood1* and Suaad Khalil Ibrahim2 1,2Department of Biology, College of Education for Pure Science (Ibn Al-Haitham) , University of Baghdad, Baghdad, Iraq. *Corresponding Author. Received: 20 September 2023 Accepted: 2 January 2024 Published: 20 April 2025 doi.org/10.30526/38.2.3744 Abstract It was collected 145 samples from a variety of clinical sources, including urinary tract infections, wounds, blood, respiratory tract infections, stool, sputum, and high vaginal swabs, from various hospitals in Baghdad. Following the collection, we conducted microscopic examinations, biochemical examinations, and diagnosis. The Vitek-2 Compact System conducted the final analysis. It was gotten 50 isolates of Escherichia coli, and 34% of those were from urinary tract infections, wounds, respiratory system infections, sputum, and vaginal swabs. 72% of the isolates were from urinary tract infections, 14% were from wounds, and 2% were from respiratory system infections. Next, we conducted genotyping and tested for beta-lactamase resistance. It was genotyped bacterial isolates using the ERICPCR technique to understand their genetic relationships. The results showed three different patterns. We obtained (E19, E42, E50, E75) from each type, which consists of a group of isolates genetically related to each other on the genetic tree. We found genetic relatedness in isolates (E13, E140, E54, E30, E120, E60) that showed no genetic relatedness (E36, E38). Phenotypical detection revealed the presence of Extended-Spectrum B-Lactamase (ESBLS) beta-lactamase. The Double Disk Synergy Test (DDST) results revealed that E36, E13, E38, E120, and E60, with a percentage of 41.7%, possessed the ability to produce beta-lactamase, while E42, E50, E19, E30, E75, E140, and E54, with a percentage of 58.3%, lacked this ability. Keywords: Escherichia coli, Beta-lactamase, Genotyping, Double disk synergy test. 1. Introduction Esherichia coli is a facultative anaerobic, Gram-negative bacterium of naturally occurring intestinal bacteria that colonizes the mucous layer (1, 2). Theodore Escherichie initially named it "Bacterium coli commune" and isolated it from infant feces in 1885 (3). It does not contain spores in the form of rods (4), and it is a common cause of health concern (5). Hospitals regard it https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0009-0009-7013-4040 mailto:saja.mohmoud2102m@ihcoedu.uobaghdad.edu.iq https://orcid.org/0009-0000-1526-1682 mailto:suad.kh@ihcoedu.uobaghdad.edu.iq IHJPAS. 2025, 38(2) 64 as a contaminant (6). Humans and animals have digestive systems, and certain species, like Escherichia coli O157:H7, are known to be pathogenic. Therefore, E.coli bacteria cause many serious clinical symptoms, such as fever, bloody diarrhea, and hemolytic uremic syndrome, which can lead to death in both children and the elderly (7, 8). It thrives in temperatures ranging from 7 to 50°C, with an optimum temperature of 37°C. It possesses a single circular chromosome, some of which contain circular plasmids. E. coli bacteria include other species within the genus E.hermanni, E.albertii, E.vulneris, E.blattae and E.fergusonii (9). The E. coli bait has virulence factors that break down hemolysin and stick to surfaces (10), as well as biofilm (11, 12), colicin, aerobactin, cytotoxic necrosis factor, cell surface hydrophobicity, and some specific serotypes of the O and K antigens that are more resistant to phagocytosis and kill bacteria than normal serum (13). E.coli is the main pathogen that causes urinary tract infections (UTI), meningitis in children, middle ear infections, and wounds (14, 15). It has six species that cause diarrhea (Diarrheagenic E.coli (DEC)) according to (16): Enterotoxic E.coli (ETEC), Entero Aggregative E.coli (EAEC), Enteropathogenic E.coli (EPEC), EnteroHemorragic E.coli (EHEC), EnteroInvasive E.coli (EIEC) and Diffusely Adherent E. coli (DAEC). E.coli is the primary cause of biofilm-associated diseases; the biofilm enables bacteria to resist antibiotics up to 1000 times and suppresses the host's immune system, making biofilm-associated infections challenging to treat (17). Antibiotics play an important role in the treatment of bacterial infections, but the wrong use of antibiotics leads to the emergence of high multidrug resistance in different species of bacteria, especially negative bacteria, because they produce broad- spectrum β-lactamase enzyme (ESBLS) extended-spectrum beta-lactamase (18, 19). In genomics, not only is there amazing diversity among bacteria, but there is also great diversity even among E. coli strains, of which E.coli was first observed through phenotypic characterization (20, 21, 22). 2. Materials and Methods 2.1. Bacterial sample collection One hundred forty five samples were collected from different clinical sources, of different ages and both sexes, from several hospitals in the city of Baghdad, including (Baghdad Teaching Hospital, Educational Laboratories, Shaheed Ghazi Al-Hariri Hospital for Specialized Surgeries in the Medical City, Al-Imamin Al-Kazemin (PBUH) Teaching Hospital, Central Children’s Teaching Hospital, and Al-Yarmouk Hospital). The study was conducted for the period from (6/11/2022) to (22/12/2022) at different clinical sources. 2.2. Isolation and identification of bacteria The collected samples were cultured on blood agars, MacConkey agars, and Eosin agars. 2.3. Biochemical tests The biochemical testes were also conducted (citrate Utilization, indole Prodution) to identify E.coli from other Enterbacteriacae bacteria (23), as well as Methyl red-Vogues Prosquer, Catalase, Glucose, Fermentation, Hemolysin, and oxidase test. The final diagnosis of the isolates was made by the Vitek-2 system compact (24) and (25). After that, it was obtained (50) isolates of E.coli from different clinical sources. IHJPAS. 2025, 38(2) 65 2.4. DNA extraction Genomic DNA was extracted from the preserved bacterial isolates (E36, E13, E38, E120, E60, E42, E50, E19, E30, E75, E140, and E54) for E.coli according to the company's protocol and using a DNA kit (ZYMO RESEARCH). 2.5. The primers used in the interaction The primers were lyophilized, dissolved in the free ddH2O to give a final concentration of 100 pmol/µl as stock solution, and kept at -20 to prepare a 10 pmol/µl concentration as work primer suspended. 10 µl of the stock solution in 90 µl of the free ddH2O water to reach a final volume of 100 µl was investigated by IDT (Integrated DNA Technologies Company, Canada). 2.6. The primers used in the interaction By using the specific primer ERIC (45), as shown in Table 1, Table 1. The specific primer ERIC. Primer Sequence Tm (ᵒC) GC (%) Forward 5′- ATGTAAGCTCCTGGGGATTAAC -3′ 54.4 45.5 % Reverse 5′- AAGTAAGTGACTGGGGTGAGCG -3′ 59.0 54.4 % The contents of the PCR tubes were mixed well using the Vortex, then placed in a PCR thermal cycler, as shown in Table 2. Table 2. The optimum condition of detection gene. No. Phase Tm (ᵒC) Time No. of cycle 1- Initial Denaturation 94ᵒC 5 min. 1 cycle 2- Denaturation -2 94ᵒC 30 sec 40 cycle 3- Annealing 36ᵒC 45 sec 4- Extension-1 72ᵒC 45 sec 5- Extension -2 72ᵒC 7 min. 1 cycle 2.7. Agarose gel electrophoresis It was prepared according to the method (26) as follows: dissolve (1.5%) grams of agarose gel in 100 ml of TBE Buffer solution at a concentration of 1x and microwave at a temperature of 60 °C for a period of 15 minutes, then let the gel cool to a temperature of 45 °C, and then add 5 microliters of red dye and mix well with the gel. Pour the agarose gel into the tray after fixing the combs, then leave to solidify at room temperature for 30 minutes. After that, the combs were carefully removed from the gel to obtain the holes. 2.8. Detection of Extended Spectrum β–Lactamases (ESβLs) Twelve cuts of 50 isolates were taken from E.coli bacteria to perform the investigation of βeta- lactamase. The ability of E.coli isolates to produce beta-lactamase was revealed by double-disk synergy, where the bacterial suspension of E.coli bacteria was present at the age of 18-24 hours, where its density was compared with the solution of the standard constant turbidity McFarland, whose cell number is approximately equal to 1.5×108. Mueller-Hinton medium was inoculated by using a sterile cotton swab in the method of brushes (mat method) and left to dry for 10 minutes. After that, antibiotic tablets were installed, and the anti-tablets (Amoxicillin, Clavulanic acid) were placed in the medium of the dish and offset by the antibiotic (Cefotaxime) on one side and the other side, in which the antibiotic (Ceftazidime) provided that the distance between each antibiotic is not less than 20-25 mm. IHJPAS. 2025, 38(2) 66 Then, after the end of the incubation period (18-24hours) and a temperature of (37 °C), where the result is positive and the isolate produces enzymes (β–Lactamases) broad-spectrum if the inhibition zone of Cefotaxime, Ceftazidime is towards the antibiotic tablet (Amoxicillin, Clavulanic acid) (27). 3. Results 3.1. Isolation identification Fifty (34%) isolates of E.coli were obtained from different clinical cases (urinary tract infections (72%), wounds (14%), respiratory tract infections (2%), sputum (10%), and vaginal swabs (2%)), and then E36, E13, E38, E120, E60, E42, E50, E19, E30, E75, E140, and E54 were taken for genotyping and β-lactamase antibodies (Table 3). Table 3. Number of E.coli isolates for each source. Percentage Number of isolate Isolate source 72% 36 Urinary tract infections 14% 7 Wounds 10% 5 Sputum 2% 1 Respiratory tract swab 2% 1 Vagina swab 50 Total 3.2. Microscopic and Biochemical examination It was used on all 50 isolates after staining them with a gram stain, so the result was negative rods. Other tests were also conducted on E.coli to confirm them on the isolates (E36, E13, E38, E120, E60, E42, E50, E19, E30, E75, E140, E54), so the results of the biochemical tests were negative on the (E36, E13, E38, E120, E60, E42, E50, E19, E30, E75, E140, E54) isolate in the test oxidase, urea, Vogues-proskauer, citrate, and gram stain. The biochemical tests were positive tests on E36, E13, E38, E120, E60, E42, E50, E19, E30, E75, E140, and E54. The isolate tests are catalase, indole, and methyl red. The positive and negative results are consistent with the results of (28). 3.3. The ability of E.coli to produce β-lactamase The results showed that (E36, E13, E38, E120, E60) can make beta-lactamase (41.7%), but (E42, E50, E19, E30, E75, E140, E54) can't (58.3%). Figures 1 and 2. When the effects of the inhibition zone (Cefotaxime and Ceftazidime) extend towards the central disk (Amoxicilin and Clavulanic acid), the isolate is considered a producer of beta-lactamase, and this is considered an indicator of the presence of beta-lactamase. The results of the current study are similar to those of (29), with 56% of bacteria producing beta-lactamase and 64% not producing beta-lactamase. The results of (30) contradict the findings of the current study, indicating a higher production of beta-lactamases compared to those that were not produced. As well as the results of (31), it was found that 70% is a producer of beta-lactamases, which does not correspond to the results of the current study. The percentage of 26.8% in the previous study (32) closely aligns with the findings of the current study. Whereas the results of the current study are not consistent with the results of the (33) study, which showed that E. coli is producing beta-lactamase enzymes by 53.8% and non-producing beta-lactamase by 38.8%. The results of the current study are consistent with the results of the (34) study, which recorded E. coli producing beta-lactamase (45.7%) and non-producing (54.2%). Beta-lactamases have been widely used to treat several different types of infections that affect humans; the cause of IHJPAS. 2025, 38(2) 67 Figure E 38 Urine E60 Wound E120 Respiratory tract swab E13 Wound E36 Sputum them is E.coli. E.coli, which breaks down the beta-lactamase ring, is one of the important causes of resistance to beta-lactamase (35; 36; 37). The study's results indicate that doctors should consult before using antibiotics to prevent severe resistance in E. coli bacteria and to prevent the development of drug resistance in bacteria. Figure 1. Production of extended-spectrum beta-lactamase (ESBLs) in E.coli isolates. Figure 2. The percentage of ESBLS production by E. coli bacteria. The number of isolates (E36, E13, E38, E120, E60, E42, E50, E19, E30, E75, E140, E54) was chosen due to their high resistance. Three types of antibiotics were used (Cefotaxime), (Ceftazidime), and (Amoxicillin- Clavulanic Acid) according to the method used for the source (27). 3.4. Genotyping of E.coli using the ERIC method Genotyping is used to find a relationship between bacterial strains in terms of their genetic content. It is also important in finding genetic relations between strains and is also considered less expensive and faster than other techniques related to genetic similarity, as well as important 0% 10% 20% 30% 40% 50% 60% 70% EsβLs production Non- production EsβLs P er ce n ta g e Figure E 38 Urine E60 Wound E120 Respiratory tract swab E13 Wound E36 Sputum Figure E 38 Urine E60 Wound E120 Respiratory tract swab E13 Wound E36 Sputum Figure E 38 Urine E60 Wound E120 Respiratory tract swab E13 Wound E36 Sputum Figure E 38 Urine E60 Wound E120 Respiratory tract swab E13 Wound E36 Sputum IHJPAS. 2025, 38(2) 68 in the field of epidemiological studies and also in the classification of bacteria, methods of infection, and the distinction of bacterial strains that have high virulence in order to prevent their spread and eliminate them (38, 39). Genetic relation was identified and found by profiling E.coli under study by using the Enterobacterial Repetitive Intergenic Consensus (ERIC) method, which was found to be sequenced in multiple regions of the bacterial genome. The results of the current study showed the existence of genetic relations between bacterial isolates that were isolated from different bacterial sources, as well as the presence of (3) genotypes ranging in molecular weights for their bands between 2000 and 300 base pairs, as shown in Figure 3 and Table 4. These results are consistent with the third group of the (39) study, which showed five patterns and one clone with genetic relation and are close to the results of the current study by using the ERIC method, while the results of the current study do not correspond to the results of the (40) study, where it showed 27 genotypes and 4 clones that have genetic relation. The reason for the difference in the source of isolation .The results showed in Figure 4 the presence of one clone while (E19, E42, E50, E75, E13, E140, E54, E30, E120, E60) isolates contained different genotypes. The clone contained two isolates (E38, E36), while isolate No. (E36) was from a 36- year-old male isolated from sputum from Al Imamain Al-Kadhimain Medical City. As for isolate No. (E38), it was a 38-year-old female and was isolated from urine and also from Al Imamain Al-Kadhimain Medical City. The reason for the genetic relatedness is the location (Al Imamain Al-Kadhimain Medical City) and age (close), and the E38 and E36 also possessed genes (CsgA, YajA). Also, the results of the current study do not correspond to the results of the (41) study, which consists of 27 genotypes and 14 clones genetic relation, while the results of the current study do not correspond The reason for the difference in geographical location is its source to the (42) study that results were recorded for 8 genotypes and 10 clones. Also, the results of the current study do not correspond to the reason for the geographical location (India, Vietnam, China, Saudi Arabia) as well as the difference in source to the (43) results, which show 7 patterns and 12 clones. It also does not correspond to the results of the (44) study that showed 14 genotypes and 7 clones. Thus, genetic relationships are detected through profiling methods in the classification of bacteria, the identification of the most deadly strains, as well as the identification and elimination of sources of infection (38), as shown in Table 4. Figure 3. Electrophoresis of the polymerase chain reaction (PCR) product of E.coli bacteria isolates, using a primer to perform genotyping using the ERIC method (100-2000) base pairs on agarose gel at a concentration of (2%) and a voltage difference of 5 volts and 1:30 hours. Path (M) represents the size guide (100) base pairs. Paths (E 19, E 38, E 4 2, E 50, E 30, E120 (E140, E13, E75, E36, E 54, E 60) for positive isolates. The bands that appeared start from 300 to 2000. 2000 1750 1500 1400 1300 1200 1000 900 800 700 650 600 500 425 300 200 M 19 4 2 50 36 75 13 140 54 38 120 30 60 IHJPAS. 2025, 38(2) 69 Table 4. Molecular weights and percentages of bands produced by the ERIC method. Bands Molecular weight (bp) Isolates number Percentage % ERIC1 300 12 100% ERIC2 450 12 100% ERIC3 500 3 25% ERIC4 600 5 41% ERIC5 650 7 58.3% ERIC6 700 7 58.3% ERIC7 800 12 100% ERIC8 900 9 75% ERIC9 1000 5 41% ERIC10 1200 7 58.3% ERIC11 1300 11 91.6% ERIC12 1400 5 41% ERIC13 1500 6 50% ERIC14 1750 9 75% ERIC15 2000 7 58.3% Table 4 and Figure 3, show the bands with molecular weights starting from (300 to 2000) showing how many isolates appeared in it, as band (ERIC1) appeared in its 12 isolates with a molecular weight of 300 and its percentage is 100%, and band (ERIC2) also appeared. It contains 12 isolates with a molecular weight of 450, and their percentage is also 100%. As for band (ERIC3), there appeared 3 with a molecular weight of 500, and their percentage is 25%, etc. for the rest of the bands. This is the commonality between Table 4 and Figure 3. Figure 4. Cluster Analysis Diagram of E.coli isolates using ready-made program NTSYS-pc (Numerical Taxonomy System) to obtain the relation of the genetic tree. Figure 19 42 50 13 60 36 38 75 140 54 120 30 Genetic relatedness Urinary Tract Infection Urinary Tract Infection Urinary Tract Infection Wound Wound Sputum High Vaginal Swab Wound Respiratory Tract Infection Sputum IHJPAS. 2025, 38(2) 70 4. Conclusion The genotyping results revealed that (E38, E36) share a genetic relationship with (E38, E36, E19, E42, E50, E75, E13, E140, E54, E30, E120, E60) isolates, while (E19, E42, E50, E75, E13, E140, E54, E30, E120, E60) isolates do not share a genetic relationship. In terms of beta- lactamase production, it was observed that (E36, E13, E38, E120, E60) produced beta-lactamase at a rate of 41.7%, while (E42, E50, E19, E30, E75, E140, E54) did not produce beta-lactamase at a rate of 58.3%. Acknowledgment Many thanks to the staff of hospitals; (Baghdad Teaching Hospital, Educational Laboratories, Shaheed Ghazi Al-Hariri Hospital for Specialized Surgeries in the Medical City, Al-Imamin Al- Kazemin (PBUH) Teaching Hospital, Central Children’s Teaching Hospital, and Al-Yarmouk Hospital). Conflict of Interest The authors declare that they have no conflicts of interest. Funding No funding. Ethical Clearance The samples were gained according to Local Research Ethics Committee approval in Iraqi Ministry of Health No. 5824 in 2/12/2022. References 1. Khudhir ZS. The synergistic effects of Lactobacillus acidophilus ROO52 and Lactobacillus bulgaricus LB-12 bacteriocins against E. coli O157:H7 in milk. Iraqi J Vet Med. 2014;38(2):35-40. https://doi.org/10.30539/iraqijvm.v38i2.220. 2. Abdulridha RN, Ibrahim OMS. Activity of bacterial antibiotics against some pathogenic bacteria isolated from calves diarrhea in Baghdad (Part I). Iraqi J Agric Sci. 2018;49(5):847-854. https://doi.org/10.36103/ijas.v49i5.45. 3. De Sousa CP. Escherichia coli as a specialized bacterial pathogen. Rev Biolcienc Terra. 2006;2(2):341-352. 4. Al-Rekaby SM, Al-Wendawi SA. In vitro evaluation of inhibitory activity of enteric Bifidobacterium isolates against shiga toxin-producing E. coli (STEC) 175:H7. Iraqi J Sci. 2014;55(3A):999-1005. https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/11370. 5. Mustafa TNH, Mohammed ZA. Correlation between the prevalence of E. coli O157:H7 and the physicochemical characteristics of the soil on dairy farms reared under field conditions in Baghdad province. Iraqi J Vet Med. 2014;38(2):55-65. https://doi.org/10.30539/iraqijvm.v38i2.224. 6. Ibrahim SK, Banno IS, Abdella SM. Effect of Citrus aurantifolia seed extracts on some bacteria isolated from burn infections. Baghdad Sci J. 2014;11(2):773-780. https://bsj.uobaghdad.edu.iq/index.php/BSJ/article/view/2691. 7. Al-Rudha AMH, Al-Rubaia EM, Khalil NK. Distribution of E.coli O157:H7 in fecal and urine samples of cattle. Iraqi J Vet Med. 2016;40(1):79-82. https://doi.org/10.30539/iraqijvm.v40i1.142. 8. Khudhir ZS. Evaluation of the antibacterial activity of brine, nisin solution, and ozonated water against E. coli O157:H7 in experimentally produced soft cheese. Iraqi J Vet Med. 2021;4(1):17-21. https://doi.org/10.30539/iraqijvm.v38i2.220 https://doi.org/10.36103/ijas.v49i5.45 https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/11370 https://doi.org/10.30539/iraqijvm.v38i2.224 https://bsj.uobaghdad.edu.iq/index.php/BSJ/article/view/2691 https://doi.org/10.30539/iraqijvm.v40i1.142 IHJPAS. 2025, 38(2) 71 https://doi.org/10.30539/ijvm.v45i1.1035. 9. Olowe BM, Oluyege JO, Famurewa O, Ogunniran AO, Adelegan O. Molecular identification of Escherichia coli and new emerging enteropathogen, Escherichia fergusonii, from drinking water sources in Ado-Ekiti, Ekiti State, Nigeria. J Microbiol Res. 2017;7(3):45-54. http://dx.doi.org/10.5923/j.microbiology.20170703.01. 10. Alice KM, Al-Aubydi MA. Extraction and partial purification of adhesive protein FimH from type-1 pili isolated from uropathogenic E. coli. Baghdad Sci J. 2009;6(4):1-7. https://doi.org/10.21123/bsj.2010.11911. 11. Bien J, Sokolova O, Bozko P. Role of uropathogenic Escherichia coli virulence factors in development of urinary tract infection and kidney damage. Int J Nephrol. 2012;2012:e681473. https://doi.org/10.1155/2012/681473. 12. Al-Karawi NJ, Al-Awade AR. Molecular identification of Escherichia coli virulence gene. Biochem Cell Arch. 2019;19(2):3153-3157. http://dx.doi.org/10.35124/bca.2019.19.2.3153. 13. Ebraheem AA, Alwendawi SA. Screening for in vitro biofilm formation ability of locally isolated uropathogenic Escherichia coli (UPEC). Iraqi J Sci. 2015;56(2B):1310-1314. https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/10081. 14. Kibret M, Abera B. Antimicrobial susceptibility patterns of E. coli from clinical sources in northeast Ethiopia. Afr Health Sci. 2011;11(3):40-45. https://doi.org/10.4314/ahs.v11i3.70069. 15. Roof MAJ, Fayidh MA. Investigation of biofilm formation efficiency in ESβLs of pathogenic Escherichia coli isolates. Int J Drug Deliv Technol. 2022;12(2):696-700. http://dx.doi.org/10.25258/ijddt.12.2.41. 16. Ageorges V, Monteiro R, Leroy S, Buress CM, Pizza M, Durand FC, Desvaux M. Molecular determinants of surface colonization in diarrhoeagenic Escherichia coli (DEC): from bacterial adhesion to biofilm formation. FEMS Microbiol Rev. 2020;44(3):314-350. https://doi.org/10.1093/femsre/fuaa008. 17. Ballen V, Capas V, Ratia C, Gabasa Y, Soto SM. Clinical Escherichia coli: From biofilm formation to new antibiofilm strategies. Microorganisms. 2022;10(6):1103. https://doi.org/10.3390/microorganisms10061103. 18. Sah SK, Hemalatha S. Extended spectrum beta-lactamase (ESBL) mechanism of antibiotic resistance and epidemiology. Inter J Pharm Res Int. 2015;7(2):303-309. https://doi.org/xxxxx 19. Roof MAJ, Fayidh MA. Molecular study to detect blaTEM and blaCTX-M genes in ESβL Escherichia coli and their antimicrobial resistance profile. J Phys Conf Ser. 2021;1879:1-9. https://iopscience.iop.org/article/10.1088/1742-6596/1879/2/022051. 20. Welch RA, Burland V, Plunkett G, Redford P, Roesch P, Rasko D, Buckles EL, Liou SR, Boutin A, Hackett J, Stroud D, Mayhew GF, Rose DJ, Zhou S, Schwartz DC, Perna NT, Mobley HLT, Donnenberg MS, Blattner FR. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc Natl Acad Sci USA. 2002;99:17020-17024. https://doi.org/10.1073/pnas.252529799. 21. Denamur E, Clermont O, Bonacorsi S, Gordon D. The population genetics of pathogenic Escherichia coli. Rev Microbiol. 2021;19:37-54. https://doi.org/10.1038/s41579-020-0416-x. 22. Ruiz N, Silhavy TS. How Escherichia coli became the flagship bacterium of molecular biology. J Bacteriol. 2022;204(9):e0023022. https://doi.org/10.1128/jb.00230-22. 23. Mahdi AA. Detection of some antibiotic resistance genes and their gene expression In Acinetobacter baumannii isolated from different clinical cases. MSc. thesis, University of Baghdad, College of Education for Pure Science; 2019. 24. Mohamad LS. The Effect of Alcoholic Extracts of Zingiber officinale Anti-E. coli Isolates Isolated from Urinary Tract Infection. Iraqi J Sci. 2019;60(10):2136-40. https://doi.org/10.24996/ijs.2019.60.10.5. https://doi.org/10.30539/ijvm.v45i1.1035 http://dx.doi.org/10.5923/j.microbiology.20170703.01 https://doi.org/10.21123/bsj.2010.11911 https://doi.org/10.1155/2012/681473 http://dx.doi.org/10.35124/bca.2019.19.2.3153 https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/10081 https://doi.org/10.4314/ahs.v11i3.70069 http://dx.doi.org/10.25258/ijddt.12.2.41 https://doi.org/10.1093/femsre/fuaa008 https://doi.org/10.3390/microorganisms10061103 https://doi.org/xxxxx https://iopscience.iop.org/article/10.1088/1742-6596/1879/2/022051 https://doi.org/10.1073/pnas.252529799 https://doi.org/10.1038/s41579-020-0416-x https://doi.org/10.1128/jb.00230-22 https://doi.org/10.24996/ijs.2019.60.10.5 IHJPAS. 2025, 38(2) 72 25. Hamady DR, Ibrahim SK. The study on ability of Escherichia coli isolated from different clinical cases to biofilm formation and detection of csgD gene responsible for produce curli (fimbriae). Biochem Cell Arch. 2020;20(2):5553-7. https://connectjournals.com/03896.2020.20.5553. 26. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press; 1989. 27. Jure MA, Aulet O, Trejo A, Castillo M. Extended-spectrum β-lactamase-producing Salmonella enterica serovar Oranienburg (CTX-M2 group) in a pediatric hospital in Tucumán, Argentina. Rev Soc Bras Med Trop. 2010;43:121-4. https://doi.org/10.1590/s0037-86822010000200003. 28. Al-Badry DRH. Molecular bacteriological study of the mixed effect of acetic and antibiotic ceftazidime on clinical samples. MSc. thesis, University of Baghdad, College of Education for Pure Sciences/Ibn Al-Haitham; 2020. 29. Sadek MS, El-Sherbiny GM, Halim MM. Detection of blaSHV and blaCTX-M genes among the extended-spectrum β-lactamases (ESβLS) producing Enterobacteriaceae isolated from hospital- acquired infections and community in Egypt. AIMJ. 2021;7-14. https://doi.org/10.21608/aimj.2021.61624.1412. 30. Garba L, Chiroma NM, Justine J, Yusuf I, Inuwa AB, Idris A. Phenotypic detection of extended- spectrum β-lactamase-producing bacteria from selected hospital contact surfaces. JEMAT. 2020;18(1):32-6. 31. Ghonaim MM, Mostafa RM, Alkady A. Phenotypic and molecular characterization of aminoglycoside resistance in clinical Escherichia coli isolates from patients at Menoufia University Hospitals. Egypt J Med Microbiol. 2019;28(3):25-32. https://doi.org/10.21608/ejmm.2019.282956. 32. El-Masry E, Alruwaili FM, Taha AE, Saad AE, Taher IA. Prevalence of extended-spectrum β- lactamase-producing Enterobacteriaceae among clinical isolates in Turaif General Hospital, Northern Borders-Saudi Arabia. J Infect Dev Ctries. 2023;17(4):477-84. https://doi.org/10.3855/jidc.17212. 33. Michael NS, Saadi AT. Extended spectrum of β-lactamase status in Escherichia coli isolated from urinary tract infections in Duhok City, Iraq. J Duhok Univ. 2019;21(2):27-33. 34. Raoof MA. Phenotypic and molecular study of Escherichia coli producing extended-spectrum β- lactamase enzymes. MSc. thesis, University of Baghdad, College of Education for Pure Sciences/Ibn Al-Haitham; 2021. 35. Bajaj P, Singh NS, Virdi JS. Escherichia coli β-lactamases: What really matters. Front Microbiol. 2016;7:417. https://doi.org/10.3389/fmicb.2016.00417. 36. Bush K, Bradford PA. β-Lactams and β-lactamase inhibitors: An overview. Cold Spring Harb Perspect Med. 2016;6(8):a025247. https://doi.org/10.1101/cshperspect.a025247. 37. Sadeghi M, Sedigh H, Saraie E, Mojtahedi A. Prevalence of ESBL and AmpC genes in E. coli isolates from urinary tract infections in the north of Iran. New Microbes New Infect. 2021;45:2-6. https://doi.org/10.1016/j.nmni.2021.100947. 38. Ahmed RZT. Phenotypic and genetic study of some virulence factors of Acinetobacter baumannii isolated from different clinical cases. MSc.thesis, University of Baghdad, College of Education for Pure Sciences (Ibn Al-Haitham); 2017. 39. Mahmoud AT, Ibrahem RA, Salim MT, Gabr A, Halby HM. Prevalence of some virulence factors and genotyping of hospital-acquired uropathogenic Escherichia coli isolates recovered from cancer patients. J Glob Antimicrob Resist. 2020;23:211-6. https://doi.org/10.1016/j.jgar.2020.08.003. 40. Elmonir W, Shalaan S, Tahoun A. Prevalence, antimicrobial resistance, and genotyping of Shiga toxin-producing Escherichia coli in foods of cattle origin, diarrheic cattle, and diarrheic humans in Egypt. Gut Pathog. 2021;13(8). https://doi.org/10.1186/s13099-021-00402-y. 41. Movahedi M, Zarei O, Hazhirkamal M, Karami P, Shokoohizadeh L, Taheri M. Molecular typing of Escherichia coli strains isolated from urinary tract infection by ERIC-PCR. Gene Rep. 2021;23:101058. https://doi.org/10.1016/j.genrep.2021.101058. https://connectjournals.com/03896.2020.20.5553 https://doi.org/10.1590/s0037-86822010000200003 https://doi.org/10.21608/aimj.2021.61624.1412 https://doi.org/10.21608/ejmm.2019.282956 https://doi.org/10.3855/jidc.17212 https://doi.org/10.3389/fmicb.2016.00417 https://doi.org/10.1101/cshperspect.a025247 https://doi.org/10.1016/j.nmni.2021.100947 https://doi.org/10.1016/j.jgar.2020.08.003 https://doi.org/10.1186/s13099-021-00402-y https://doi.org/10.1016/j.genrep.2021.101058 IHJPAS. 2025, 38(2) 73 42. Alsultan A, Elhadi N. Evaluation of ERIC-PCR method for determining genetic diversity among Escherichia coli isolated from human and retail imported frozen shrimp and beef. Food Contam. 2022;9:12. https://doi.org/10.1186/s40550-022-00098-1. 43. Alttai NA, Al-Sanjary RA, Sheet OH. Genetic diversity of Escherichia coli harboring virulence genes Stx1 and Stx2 isolated from common carp fish in Nineveh Governorate using ERIC-PCR. Iraqi J Vet Sci. 2023;37(3):701-5. https://doi.org/10.33899/ijvs.2023.137140.2642. 44. Al-Azzawi SNA, Ahmed RZT, Hadi TF. Genotyping of Escherichia coli isolated from urinary tract infections using ERIC method. BNIHS. 2022;140(1):1343-92. https://doi.org/10.33899/ijvs.2023.137140.2642. 45. Beltrão EMB, de Oliveira ÉM, Scavuzzi AML, Firmo EF, Lopes ACD. Virulence factors of Proteus mirabilis clinical isolates carrying blaKPC-2 and blaNDM-1 and first report blaOXA-10 in Brazil. J Infect Chemother. 2022;28(3):363-72. https://doi.org/10.1016/j.jiac.2021.11.001. https://doi.org/10.1186/s40550-022-00098-1 https://doi.org/10.33899/ijvs.2023.137140.2642 https://doi.org/10.33899/ijvs.2023.137140.2642 https://doi.org/10.1016/j.jiac.2021.11.001