Microsoft Word - 13-22 Biology | 13 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 The Synergistic Effect of Zinc, Coumestrol, Genestein and Daidzein on Proinflammatory Cytokines Production and Receptor Activator of NFκB Ligand Expression that Implicates in Bone Resorption Sahar S. Karieb Dept. of Biology/College of Education for pure science(Ibn Al-Haitham) /University of Baghdad Received in :12 January 2016,Accepted in :5March2016 Abstract Several observations have showed the synergistic effect of nutrients elements and phytoestrogens on bone resorption elimination. Zn is one of the trace elements found to increase the stimulatory effect of phytoestrogens including genestein, coumestrol and daidzein on bone formation; however the synergistic modulation of Zn, genestein, coumestrol and daidzein on proinflammatory-producing T-cells and receptor activator of NFκB ligand (RANKL) expression that implicated in osteoclast formation is still open area to debate. This study found that Zn enhanced the inhibitory effect of genistein, daidzein and coumestrol on TNF-α expression; however the same effect was shown with daidzein on IL-1β expression while there is no further effect found with other compounds. Zn is only in combination with genistein decreaseIL-6 expression; moreover Zn had additional effect on the inhibitory effect of all test phytoestrogens on RANKL expression in dose-dependent manner. In conclusion, Zn alone or in combination with phytoestrogens has an inhibitory effect on the expression of pro-inflammatory cytokines and RANKL that play an important role in the promotion of bone resorption. Keywords: Zinc, Phytoestrogens, T cells, Pro-inflammatory cytokines Biology | 14 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 Introduction Recently it has become clear that the interactions between the immune system and bone have a key role in osteoporosis after aging. Estrogen plays an important role in the balance of bone remodeling and its deficiency causes bone loss and fractures after aging especially in women [1]. Moreover, estrogen deficiency increases T-lymphocytes population and TNF production by activated T-cells that act a key factor promote osteoclastogenesis [2,3]. Receptor activator of nuclear factor kappa-B (NFκ-B) ligand (RANKL) (also called osteoprotegerin ligand (OPGL)) is a member of the tumor necrosis factor superfamily and plays an important role in bone remodeling and osteoclast formation.TNF acts a major key in bone resorption and can induce osteoclast formation through several mechanisms involving RANKL-inducing mechanism which in turn directly promote osteoclastogenesis [4]. In addition, estrogen deficiency can modulate the production of several cytokines by T-cells such as TGF-β and IFN-γ [5]. Recent studies found that ovarictomy mice with T- lymphocytes-deficient nude did not induce bone resorption, while the wild type of overctomy mice with T-cells induce bone loos [6,7]. Osteoclast formation is controlled by appropriate changes in osteoblast derived RANKL and osteoprotegerin (OPG) expression [8]. Resorptive stimuli increase RANKL expression and decrease levels of the RANKL antagonist OPG [9]. This enables the initiation of osteoclast formation. Changes in immune status can disrupt this balance and excessive osteoclastic bone loss which causes several disorders such rheumatoid arthritis and osteomyelitis [10]. Genestein, daidzein and coumestrol are phytoestrogens (PEs) which are a diverse group of plant derived compounds with a structure and function similar to oestradiol, have been examined as an alternative therapeutic agent. Diets with high phytoestrogen content are associated with a more robust skeleton [11,12]. Phytoestrogens directly inhibit the response of osteoclast precursors to RANKL and TNF-α [13, 14, 15, 16], and genistein also reduce osteoblast RANKL expression and elevate OPG [17]. Interestingly, phytoestrogens also reduce lymphocytes number and activity for instance genistein and daidzein reduce T cells number and thymus weight in ovariectomised mice [18, 19]. Cytokines such as TNF-α, IL-1 and IL-6 and RANKLS as well [20]. Thus, the anti-steoclastic action of phytoestrogens involved in an inhibitory effect on T cells number and cytokine production. Furthermore, Phytoestrogens that is found could further protect against post-menopausal bone loss through the modulation of pro-inflammatory cytokines expression produced by T-cells. However the effect of Zinc on T cell derived cytokines is not well established. Zn deficiency was found to affect on the immune system function including increases in proinflammatory cytokines in the patients. The previous study observed under Zn deficiency, TNF-α and IL-1β expression in HL-60 cells via redox-mediated mechanism and also recommended to use Zn supplemented as a treatment in several inflammatory diseases [21] and TNF-α and IL-6 as well [22]; Zn that is found can modulate pro-inflammatory cytokines expression via a mechanism involving effect on NF-κB, a transcriptional gene is important for the biosysnthesis of proinflammatory cytokines [22]. Moreover, a low level of Zn was found after aging which can cause a disruption in in inflammatory response result in several diseases including atherosclerosis [23]. Previously, zinc has been found induced osteoblast differentiation, mineralization and bone matrix formation and reduced RANKL/OPG ratio expressed by mature osteoblast [24] with the no effect on osteoclast formation. Pro-inflammatory cytokines produced by T cells such as TNF-α and IL-1β play an important role in osteoclast differentiation. However, zinc has no direct effect on osteoclast formation but it may modulate T-produced pro-inflammatory cytokines involved in osteoclast formation. Thus, the effect of zinc alone or in combination with PEs on cytokine expression produced by T cells was not studied yet. Therefore this study investigated the effect of the zinc alone or in combination with PEs on T cell-producing pro-inflammatory cytokines and RANKL expression that promote bone resorption. Biology | 15 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 Material and Methods Media and reagents Jurkat E6.1 T cells a human leukemic T cell line (ECACC ,UK) cultured in phenol red free RPMI medium supplemented with 10% foetal calf serum (Autogen Bioclear, UK) 2 mmol/l glutamine, 100 IU/ml benzylpenicillin and 100 mg/ml streptomycin. Culture incubated at 37oC in 5% CO2 in a humidified incubator till using in experiments [25]. Real time quantitative PCR analysis of inflammatory cytokine expression T cells were cultured for four days with genistein (10-6-10-9 M), daidzein (10-6-10-9 M) or coumestrol (10-6-10-9 M) in the presence of Con A (10 μg/ml). Total RNA was extracted and reversed transcribed with M-MLV reverse transcriptase, and real time-PCR performed on a Step One PCR system (Applied Biosystems, UK) using the DNA-binding dye SYBR green as a fluorophore. A total of 2 μl of external plasmid standard or cDNA was added to a final reaction volume of 25 μl containing 0.05 U/μl Taq, SYBR green and specific primers (0.2 μM). Primers used are shown in (Table 1). The concentration of DNA plasmid stock was determined by OD at 260 nm. The progress of the PCR amplification was monitored by real- time fluorescence emitted from SYBR green during the extension time. Reaction conditions were 94oC for two minutes, followed by 35 cycles of 94oC for 30 seconds, 60oC for 30 seconds and 72oC for 30 seconds. At the end of each PCR run a melt curve analysis was performed to show the absence of non-specific bands. For each sample mRNA level was expressed in comparison to control group normalized against β-actin. by the instrument’s software. Samples were analysed in triplicate. The data were analyzed based on the differences between the reference (control group) and the treatment groups using a comparative Ct analysis according to the following formula: ΔCt sample = Ct sample − Ct reference gene ΔΔCt = ΔCt sample − ΔCt reference control Amount of target (RQ) = 2 −(ΔΔCt) Where Ct is a threshold cycle. Results This study found that TNF-α expression augmented in the presence of ConA while it is decreased in the presence of Zn (Figure 1). Phytoestrogens compounds; genistein (10-5-10-7 M) (Figure 1A), coumestrol 10-5 M (Figure 1C) and daidzein (10-5, 10-7 M) (Figure 1B) decreased TNF-α expression, however zinc significantly enhanced down-regulation of TNF-α mRNA expression of PEs in dose-dependent manner; however, coumestrol at 10-6 and 10-7 M in the presence of Zn increased this expression. The expression of IL-1β was significantly increased by stimulated T-cells and this expression is not affected in the presence of zinc alone or in combination with phytoestrogens (Figure 2 A, B, C). However, zinc suppressed the stimulatory effect of daidzein (10-5 M) on IL-1β expression (Figure 2B) and this concentration is similar to that decreased osteoclast formation as found previously [15]. The effect of zinc on IL-6 expression was opposite to its effect on TNF-α and IL-1β expression. IL-6 expression is significantly enhanced by stimulating T-cells while this expression is not affected by zinc treatment alone (Figure 3). while the combination of zinc and genistein (10-5-10-7M) decreased IL-6 production versus stimulated T-cells but still higher than control group (Figure 3A), while the treatment of zinc and daidzein (10-5 M) decreased the stimulatory effect of daidzein on IL-6 expression (Figure 3B) referring to the suppression effect of zinc and no further effect on other concentrations but still lower in comparison to control group. Similar effect had been shown with zinc in combination with coumestrol (10- Biology | 16 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 5M) while the presence of zinc increased IL-6 expression with coumestrol (10-6 M) (Figure 3C). Genistein (10-5-10-7 M) also decreased receptor activator of NFκB ligand (RANKL) expression but this expression is more suppressed in the presence of zinc at all concentration that is used in this study (Figure 4A). Moreover, coumetrol (10-5-10-7 M) decreased RANKL expression with higher levels in the presence of zinc than coumestrol alone (Figure 4C) refers to the additional inhibitory effect of zinc on this expression which can modulate osteoclast formation. In addition, daidzein at anti-osteoclastic dose (10-5M) suppressed RANKL expression in the presence of zinc due to the inhibitory effect of this element in combination with PEs on RANKL expression (Figure 4B). Discussion T cells are evaluated to produce a wide range of pro and anti-inflammatory cytokines that play a critical role in the initiation of inflammatory diseases such as rheumatoid arthritis and post-menopausal bone resorption. TNF-α is a key cytokine that trigger osteoclast differentiation. Several studies found that osteoclastogenic cytokines -producing T cell plays an important role in the progression of osteoporosis [26] such as TNF-α, IL-1β, IL-6 and RANKL and the latest expressed on T-cell surface and all of these factors can induce osteoclast formation. Accumulated observations determined the implication of T-cells in inducing bone loss after menopause due to the absence of estrogen [27,19,28]. Furthermore, it was found that after aging the function of lymphocytes was increased which associated with high levels of proinflammatory cytokines [23]. In addition, it was found that T-cells are implicated in bone resorption and disorders due to its ability to produce RANKL on its surface that plays an important role in osteoclast formation. Previous study found that PEs alone reduced TNF-α, IL-1β, IL-6 and RANKL expression by T-cells, while in opposite way increased osteoblast differentiation [20, 24]. Moreover, zinc has been shown to induce osteoblast differentiation and bone matrix formation alone or in combination with PEs [24]. Thus, this study aimed to determine if any further effect of zinc on T-cells; the current study revealed that zinc can reduce bone resorption through effect on pro-inflammatory cytokines and RANKL expression in T cells that promote osteoclastogenesis. This study found a direct effect of zinc alone on the cytokines expression especially on TNF-α and RANKL; moreover PEs compounds that are used in this study reduced the expression of theses cytokines while the addition of zinc enhanced the inhibitory effect of PEs on the mRNA expression of the examined cytokines. Zinc significantly showed an augmentative effect on the suppressive effect of genistein, daidzein and coumestrol on the mRNA expression of proinflammatory cytokines-producing T cells including TNF-α, IL-1β and IL-6 which are trigger osteoclast differentiation in dose- dependent manner and this is consistent with previous study that found T cells enhanced the production of pro-inflammatory cytokines that induces bone loss after inducing osteoclast formation [29]. In addition, the results of this study showed that ConA did not induce RANKL expression significantly versus control group, although the results revealed that zinc alone suppressed RANKL expression induced by stimulated T-cells with ConA and in comparison to control group. The inhibitory effect of genistein, daidzein and coumestrol on TNF-α and RANKL mRNA expression was significantly enhanced in the presence of zinc, while there is no further effect has been shown on IL-1β and IL-6 expression, and all of the results conducted that the main mechanism that mediated the synergistic effect of zinc with Pes including increases the anti-osteoclastic action of PEs through decrease TNF-α and RANKL expression; main keys that switch on osteoclast differentiation. However, the high levels of IL-6 induced by daidzein were reduced in the presence of zinc and this included a new effect Biology | 17 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 of daidzein on IL-6 expression that also could trigger osteoclast formation, and no effect of zinc was seen on IL-1β at all. This study observed the synergistic effect of zinc with PEs that reduced the level expression of osteoclastogenic cytokines-producing T cells which in turn decrease osteoclast formation; moreover, zinc alone reduced the expression of TNF and RANKL and thus it is could participate partially to reduce osteoclast formation and bone resorption. References 1- Pacifici, R. (2008). Estrogen deficiency, T cells and bone loss. Cellular Immunology, 252, 68-80. 2- Pacifici, R. (2012). Role of T cells in ovariectomy induced bone loss-revisited, J. Bone Miner. Res. 27 231–239. 3- Komine, M.; Kukita, A.; Kukita, T.; Ogata, Y.; Hotokebuchi, T. and Kohashi, O. (2001). Tumor necrosis factor-[alpha] cooperates with receptor activator of nuclear factor [kappa]B ligand in generation of osteoclasts in stromal cell-depleted rat bone marrow cell culture. Bone, 28, 474-483. 4- Zhang, Y.-H.; Heulsmann, A.; Tondravi, M. M.; Mukherjee, A. and Abu-Amer, Y. (2001). Tumor Necrosis Factor-alpha (TNF) Stimulates RANKL-induced Osteoclastogenesis via Coupling of TNF Type 1 Receptor and RANK Signaling Pathways. The Journal of Biological Chemistry, 276, 563-568. 5- D'amelio, P.; Grimaldi, A.; Di Bella, S.; Brianza, S. Z. M.; Cristofaro, M. A.; Tamone, C.; Giribaldi, G.; Ulliers, D.; Pescarmona, G. P. and Isaia, G. (2008). Estrogen deficiency increases osteoclastogenesis up-regulating T cells activity: A key mechanism in osteoporosis. Bone, 43, 92-100. 6- Cenci, S.; Toraldo, G.; Weitzmann, M.N.; Roggia, C.; Gao, Y.; Qian, W.P.; Sierra, O. and Pacifici R. (2003). Estrogen deficiency induces bone loss by increasing T cell proliferation and lifespan through IFN-γ-induced class II transactivator. Proceedings of the National Academy of Sciences of the United States of America; 100:10405-10. 7- Cenci, S.; Weitzmann, M.N.; Roggia, C.; Namba, N.; Novack, D.; Woodring, J. and Pacifici R. (2000). Estrogen deficiency induces bone loss by enhancing T-cell production of TNF-α. J Clin Invest; 106:1229-7. 8- Yasuda, H.; Shima, N.; Nakagawa, N. et al. (1998). Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE / RANKL. Proc Natl Acad Sci USA; 95:3597-2. 9- Ma, Y.L.; Cain, R.L.; Halladay, D.L. et al. (2001). Catabolic effects of continuous human PTH (1--38) in vivo is associated with sustained stimulation of RANKL and inhibition of osteoprotegerin and gene-associated bone formation. Endocrinology; 142:4047-4. 10- Redlich, K. and Smolen J.S. (2012). Inflammatory bone loss: pathogenesis and therapeutic intervention. Nature reviews Drug discovery; 11:234-50. 11- Kim, M.K.; Chung, B.C.; Yu, V.Y.; Nam, J.H.; Lee, H.C; Huh, K.B. and Lim S.K. (2002). Relationships of urinary phyto-oestrogen excretion to BMD in postmenopausal women. Clin Endocrinol; 56:321-8. 12- Mei, J.; Yeung, S.S.C. and Kung, A.W.C. (2001). High Dietary Phytoestrogen Intake Is Associated with Higher Bone Mineral Density in Postmenopausal but Not Premenopausal Women. J Clin Endocrinol Metab; 86:5217-21. 13- Gao, Y.H. and Yamaguchi M. (2000). Suppressive effect of genistein on rat bone osteoclasts: involvement of protein kinase inhibition and protein tyrosine phosphatase activation. Int J Mol Med; 5:261-7. 14- Garcia Palacios, V.; Robinson, L.J.; Borysenko, C.W.; Lehmann, T.; Kalla, S.E. and Blair, H.C. (2005). Negative Regulation of RANKL-induced Osteoclastic Differentiation in RAW264.7 Cells by Estrogen and Phytoestrogens. J Biol Chem; 280:13720-13727. Biology | 18 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 15- Karieb, S,and Fox, SW. (2011). Phytoestrogens directly inhibit TNF-alpha-induced bone resorption in RAW264.7 cells by suppressing c-fos-induced NFATc1 expression. J Cell Biochem; 112:476-87. 16- Uchiyama, S. and Yamaguchi, M. (2007). Genistein and zinc synergistically stimulate apoptotic cell death and suppress RANKL signaling-related gene expression in osteoclastic cells. J Cell Biochem; 101:529-42. 17- Chen, W.F. and Wong, M.S. (2006). Genistein modulates the effects of parathyroid hormone in human osteoblastic SaOS-2 cells. Br J Nutr; 95:1039-47. 18- Yellayi, S.; Naaz, A.; Szewczykowski, M.A. et al. (2002). The phytoestrogen genistein induces thymic and immune changes: a human health concern? Proc Natl Acad Sci U S A; 99:7616-21. 19- Tyagi, A.M.; Srivastava, K.; Sharan, K.; Yadav, D.; Maurya, R. and Singh, D. (2011). Daidzein prevents the increase in CD4+CD28null T cells and B lymphopoesis in ovariectomized mice: a key mechanism for anti-osteoclastogenic effect. PLoS ONE; 6:e21216. 20- Karieb, S. and Fox, S. W. (2013). Suppression of T cell-induced osteoclast formation. Bioch. Biophysic. Res. Comm., 436: 619–624. 21- Wessels, I.; Haase, H.; Engelhardt, G.; Rink, L. and Uciechowski, P. (2013). Zinc deficiency induces production of the proinflammatory cytokines IL-1β and TNFα in promyeloid cells via epigenetic and redox-dependent mechanisms. J Nutr Biochem., 24(1):289-297. 22- Vasto, S.; Mocchegiani, E.; Malavolta, M.; Cuppari, I.; Listì, F.; Nuzzo, D.; Ditta, V.; Candore, G. and Caruso, C. (2007). Zinc and inflammatory/immune response in aging. Ann N Y Acad Sci., 1100:111-122. 23- Vasto, S.; Mocchegiani, E.; Candore, G.; Listì, F.; Colonna-Romano, G.; Lio, D.; Malavolta, M.; Giacconi, R.; Cipriano, C. and Caruso C. (2006). Inflammation, genes and zinc in ageing and age-related diseases. Biogerontology, 7(5-6):315-327. 24- Karieb, S. and Fox, S. W. (2012). Zinc modifies the effect of phyto-oestrogens on osteoblast and osteoclast differentiation in vitro. British Journal of Nutrition, 108: 1736- 1745. 25- Perussia, B. and Loza M. J. (2005). Purification of peripheral blood natural killer cells. In: human cell culture protocols (Picot, J. ed.). Human press, Totowa, New Jersy. 26- Pacifici, R. (2010). The immune system and bone. Archives of Biochemistry and Biophysics, 503, 41-53. 27- Tyagi, A., K. Srivastava, et al. (2012). Premature T cell senescence in Ovx mice is inhibited by repletion of estrogen and medicarpin: a possible mechanism for alleviating bone loss. Osteoporosis International 23(3): 1151-1161. 28- Gao, Y, ;Qian W-P.;Dark, K, et al. (2004). Estrogen prevents bone loss through transforming growth factor β signaling in T cells. Proc Natl Acad Sci USA; 101:16618-3. 29- Kawai, T.; Matsuyama,T. et al. (2006). B and T Lymphocytes Are the Primary Sources of RANKL in the Bone Resorptive Lesion of Periodontal Disease. The American Journal of Pathology 169(3): 987-998. Biology | 19 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 Table(1):Primer sequences Genes 5´-3´ Forward primer 3´-5´ Reverse primer Human β-Actin GCGCGGCTACAGCTT CACCA TGGCCGTCAGGCAGCTCGTA Human TNF-α GCTCCAGTGGCTGAA CCGCC AGCACATGGGTGGAGGGGCA Human IL-6 TCAATGAGGAGACTTGCCTGG TGA TCTGCAGGAACTGGATCAGGACTT Human IL-1β ACGCTCCGGGACTCA CAGCA TGAGGCCCAAGGCCACAGGT Human RANKL ACAGGCCTTTCAAGGAGCTGTGC ACCAGATGGGATGTCGGTGGC R el a tiv e E x p re ss io n T N F -  0 10 20 30 40 50 Control ConA Gen -5M Gen -6M Gen -7M Zinc R e la tiv e E x p re s s io n T N F-  0 1 2 3 4 5 6 PEs PEs+Zn R e la tiv e E x p re s s io n T N F-  0 2 4 6 8 10 12 14 16 18 Control ConA Zinc Control ConA Zinc Dai -5M Dai -6M Dai -7M Cou -5M Cou -6M Cou -7M A B C * * * * * * *   Figure (1): The synergistic effect of zinc with phytoestrogens (PEs) compounds A: genestein, B: daidzein, C: coumestrol on TNF-α gene expression. * Values are significantly different (P<0.05) from phytoestrogens treatment alone. Biology | 20 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 R e la tiv e E xp re s s io n o f IL -1  0.0 0.5 1.0 1.5 2.0 2.5 R e la tiv e E x pr e ss io n o f IL -1  0 2 4 6 8 10 12 14 16 18 20 PEs PEs+Zn R e la tiv e E x pr es s io n o f IL -1  0 2 4 6 8 10 12 Control ConA Gen -5M Gen -6M Gen -7M Zinc Control ConA Zinc Dai -5M Dai -6M Dai -7M Control ConA Zinc Cou -5M Cou -6M Cou -7M A B C * * * Figure (2): The synergistic effect of zinc with phytoestrogens (PEs) compounds A: genestein, B: daidzein, C: coumestrol on IL-1β gene expression. * Values are significantly different (P<0.05) from phytoestrogens treatment alone. R el at iv e Ex pr es si on o f IL -6 0 5 10 15 20 25 PEs PEs+Zn R el at iv e Ex pr es si on o f IL -6 0 2 4 6 8 10 12 14 Control ConA Gen -5M Gen -6M Gen -7M Zinc Control ConA Zinc Dai -5M Dai -6M Dai -7M Control ConA Zinc Cou -5M Cou -6M Cou -7M R el at iv e Ex pr es si on o f IL -6 0 1 2 3 4 A B C * * * *   Figure (3): The synergistic effect of zinc with phytoestrogens (PEs) compounds A: genestein, B: daidzein, C: coumestrol on IL-6 gene expression. * Values are significantly different (P<0.05) from phytoestrogens treatment alone. Biology | 21 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 R el at iv e E xp re ss io n of R A N K L 0.0 0.2 0.4 0.6 0.8 1.0 1.2 R el at iv e E xp re ss io n of R A N K L 0 2 4 6 8 PEs PEs+Zn R el at iv e E xp re ss io n of R A N K L 0 1 2 3 4 5 6 Control ConA Gen -5M Gen -6M Gen -7MZinc Control ConA Zinc Control ConA Zinc Dai -5M Dai -6M Dai -7M Cou -5M Cou -6M Cou -7M A B C * * * * * * * * *   Figure (4): The synergistic effect of zinc with phytoestrogens (PEs) compounds A: genestein, B: daidzein, C: coumestrol on receptor activator oof NFκB ligand (RANKL) gene expression. * Values are significantly different (P<0.05) from phytoestrogens treatment alone. Biology | 22 2016) عام 2(العدد 29المجلد مجلة إبن الهيثم للعلوم الصرفة و التطبيقية Ibn Al-Haitham J. for Pure & Appl. Sci. Vol. 29 (2) 2016 التاثير التازري للزنك مع الجنستين، الكومسترول والدايدزين في انتاج الوسائط الخلوية البادئة لاللتهاب وتعبير المستقبل المنشط لرابط العامل النووي كابا المرتبطين بتنخر العظام سحر سعدي غريب كلية التربية للعلوم الصرفة/ابن الهيثم، جامعة بغداد /قسم علوم الحياة 2016اذار 5، قبل في : 2016كانون الثاني 12استلم في: الخالصة دعناصر الغذائية مع الفايتوستروجينات في تقليل تنخر العظام. يعلبينت الكثير من الدراسات التاثير التازري لكل من ا إن، العظاموجد انه يزيد من القدرة التحفيزية للفايتوستروجينات في زيادة نسبة تكوين ذالزنك واحدا من اهم هذه العناصر إ لوسائط الحركية البادئة ل في التعبير الجينييدزين دالتاثير التازرري لعنصر الزنك مع الجنستين، الكومسترول والدا او مع مركبات الفايتوستروجينات ردهبمفالدراسة ان الزنك ت. بينهو قيد المناقشة لحد االن RANKLلاللتهاب و -ILانتاج في نفسه بينما وجد التاثير TNF-α النتاج للفايتوستروجينات انه زاد من القابلية التثبيطية عملة في البحثالمست 1β فقط مع الدايدزين. ايضا فان الزنك مع الجنستين قلل من التعبير الجيني للوسيطIL-6 بيطيةالقدرة التث زيادة في وايضا ان الزنك نستنتج من الدراسة الحاليةفي وسط معتمد على الجرعة. RANKL على التعبير للجيني للـ لفايتوستروجيناتل دورا ؤدياو مع مركبات الفايتوستروجينات زاد من تثبيط التعبير الجيني للوسائط الحركية البادئة لاللتهاب والتي ت بمفرده خر العظام. نيقلل من ت ان ن تناول هذه العناصر مع بعضها ممكنتنخر العظام وازيادة مهما في الزنك، الفايتوستروجينات، الخاليا التائية، الوسائط الحركية البادئة لاللتهاب.الكلمات المفتاحية: