CONTACT : NGANGNANG GHISLAIN ROMÉO ngaghirom1@yahoo.fr

Abstract
Rickettsial bacteria are important tick-transmitted microorganisms
causing disease and death in cattle, sheep, goats and dogs in the area where tick
vectors are found, becoming a major problem for improvement of animal
production in the endemic areas. The study carried out in the Western Highlands
of Cameroon was aimed at highlighting Anaplasma and Ehrlichia species in
apparently healthy cattle. A total number of 162 blood samples were collected
from cattle and screened via nested-PCR based Reverse Line Blot hybridization
(RLB) assay for detection of rickettsial bacteria. Four species of these
microorganisms were identified with an overall prevalence of 44.44%,
Anaplasma marginale (41.35%) being the most prevalent species followed by
Anaplasma sp. ‘Omatjenne’ (15.43%), Anaplasma centrale (8.64%) and Ehrlichia
ruminantium (3.08%). Single infection (24.69%) was more frequent among the
four types of mix infection observed with a significant difference. Parasite
association was most found between A. marginale + Anaplasma sp. ‘Omatjenne’
(11.11%). Female cattle (44.79%) were more infected than males3.93%) but
without significant difference while, yearling cattle (50%) were statistically more
infected than adults (44.07%). The high prevalence and diversity of rickettsial
organisms identified is evidence that disease and their vectors, the Amblyomma
and Rhipicephalus (formerly Boophilus) ticks might be widespread in the
Western Highlands of Cameroon. However, these findings with veterinary
significance suggest the dire need for further research on the presence of other
vectors apart from Amblyomma sp. and Rhipicephalus sp. in Cameroon.

ISSN : 2580-2410
eISSN : 2580-2119

Molecular characterization of Anaplasma and Ehrlichia
microorganisms in bovine populations of the Western Highland
Agro-Ecological Zone of Cameroon

Ngangnang Ghislain Roméo 1*, Aktas Münir 2, Ulucesme Mehmet Can 2, Keptcheu
Tchankwe Désiré 1 , Fonteh Anyangwe Florence3, Vincent Khan Payne1

1 Department of Animal Biology, Faculty of Science, University of Dschang, Dschang,
Cameroon.

2 Department of Parasitology, Faculty of Veterinary Medicine, University of Firät, Elazig,
Turkey.

3 Department of Animal Production, Faculty of Agronomy and Agricultural Sciences,
University of Dschang, Dschang, Cameroon.

OPEN ACCESS International Journal of Applied Biology

Keyword

Anaplasma; Ehrlichia;
rickettsial bacteria;
Molecular
characterization; RLB;
Western Highlands of
Cameroon

Article History
Received 11 November 2021
Accepted 30 December 2021

International Journal of Applied Biology is licensed under a
Creative Commons Attribution 4.0 International License, which
permits unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.

International Journal of Applied Biology, 5(2), 2021

Introduction
Rickettsial diseases of economic importance are ehrlichiosis and anaplasmosis, a tick-

borne disease caused by obligate intracellular bacteria in the genera Ehrlichia and
Anaplasma respectively. They are emerging tick-borne pathogens in humans and other wild
or domesticated animals worldwide. Infections caused by these pathogens are deadly if left
untreated (Iweriebor et al., 2017). These organisms are widespread in nature and are usually
maintained in cycles between ticks and reservoir hosts, which can sometimes remain
infected for long periods. For many years, Ehrlichia and Anaplasma species have been known
to cause illness in pets and livestock where the consequences of exposure vary from
asymptomatic infections to severe, potentially fatal illness.

Throughout the tropics, an estimated 600 million cattle are exposed to anaplasmosis
and babesiosis. In the 1970s, McCallon, (1973) estimated that the disease caused annual
losses of over 300 million US dollars to the American cattle industry. In 1989, over a million
cattle in eleven countries of Eastern, Central and Southern Africa were estimated to have
died of tick-borne diseases. The economic cost in livestock losses and funding for control and
research programs was estimated at US$168 million that year (ILRAD, 1991). Furthermore,
Mukhebi et al., (1999) estimated that the national annual loss due to cowdriosis in
Zimbabwe could attain 5.6 million USD and more recently, Tanzania was estimated to lose
47.3 million USD solely due to the direct costs of bovine anaplasmosis (Kivaria, 2006;
Kenneil, 2015). The distribution of these diseases follows the presence of the vector
Amblyomma among them Amblyomma variegatum is the most important species which is
widely distributed in the sub-Saharan Africa including Cameroon. The control of disease
involves controlling the tick vector, establishing endemic stability, performing immunization
by infection and treatment, and preventing the disease by regular administration of
prophylactic antibiotics. Most of these methods are subject to failure for various
epidemiological reasons, and serious disease outbreaks could occur (Dinkisa, 2018). A
relative little information is available about these rickettsial bacteria in Cameroon and need
to be updated. In the current study, a reverse line blot assay (RLB) was performed in order to
identify Anaplasma and Ehrlichia species circulating amongst cattle in the third agro-
ecological zone of Cameroon.

Materials and Methods
Study Area

The Region considered as the Western Highlands is the third Agro-Ecological Zone
(AEZ) of Cameroon (IRAD, 2008). It comprises the two Administrative Regions of West and
North West, due to their common biotic and abiotic characteristics. It lies between Latitudes
5° and 7° North and Longitude 9° and 11° East of the Equator. With a size of 31,180 km2,
they cover 1/16 of the total land area of the country. Altitudes range from around 300 to 3
000 m above sea level. The climate of this region is the tropical humid type with two
seasons, the dry and rainy seasons. Rainfall varies between 1300-3000 mm with peaks
occurring between mid-July and mid-September. The rainy season extends from mid-March
to mid-November while the dry season runs from end of mid-November to mid-March. The
maximum temperatures vary between 20 and 32°C. The dominant vegetation is residual
savannah and the region is designated grassland because a greater proportion of the area is
covered by grassland than forest. This Region is characterized by a rapid population growth
(128.5 inhabitants per km2), most of whom live in rural areas (67.8%) and depend on crop

International Journal of Applied Biology, 5(2), 2021

and livestock activities. It is the third major cattle producing area, with 500,000 Zebu cattle,
and one of the most important agricultural production zones of the country (IRAD, 2008;
Nchinda and Mendi, 2008; Jiotsa et al., 2016).

Collection of the samples

Between March 2019 and January 2021, one hundred and sixty-two (162) zebu cattle
(Bos indicus), mainly the local breed (Aku, Gudali and M’bororo) commonly found in the
Western Highlands of Cameroon were sampled according to their age and sex for blood
sampling. This target population was in extensive management with no or adequate tick
control program implemented. Five ml of blood samples were collected from jugular or
coccygeal vein of cattle into EDTA tubes, preferably potassium–ethylenediamine tetra-acetic
acid (EDTA/K3) with a concentration of 1.27mg EDTA/K3 per ml of blood and into Dried
Blood Spot (DBS) specimen collection cards prepared for the purpose. Simultaneous
detection of rickettsial bacteria in the blood samples was done using nested-PCR based RLB
hybridization assay in the Laboratory of Molecular Parasitology, Department of Parasitology,
Faculty of Veterinary Medicine, University of Firät, Elazig, Turkey.

DNA extraction and PCR

DNA was extracted by a commercial DNA isolation kit (Invitrogen Corporation,
Carlsbad, CA, USA) following the manufacturer’s instructions. Then, for the amplification of
Anaplasma/Ehrlichia spp., a nested PCR was performed using two universal primer pairs. The
primers EC9/EC12A were used for the first round PCR amplification of 1462 bp fragments of
the 16S rRNA gene of Anaplasma/Ehrlichia spp. The nested amplification, using the primers
16S8FE/BGA1B, produced a 492–498 bp fragment in the hypervariable V1 region of the 16S
rRNA gene of the Anaplasma/Ehrlichia species. For the second amplification, one μl of first
round PCR products was used as a DNA template. To reduce non-specific amplification, a
touchdown program was performed. Touchdown PCR involves the use of an annealing
temperature that is higher than the target optimum in early PCR cycles.

RLB hybridization

Probes of catchall, genus and species-specific for Anaplasma/Ehrlichia were used
with a range of 200–800 pmol/150μl concentration and contain N-terminal N-
(trifluoracetamidohexyl-cyanoethyl,N,N-diisopropyl phosphoramidite [TFA])-C6 amino linker
in the study. The oligonucleotide probes were synthesised by The Midland Certified Reagent
(Midland, Texas, USA). Preparation, hybridisation and stripping of the RLB membrane were
performed as previously described with minor modifications (Georges et al., 2001).
Table 1. Oligonucleotide primers and probes used in this study

Primer Sequence (5’-3’) Reference
EC9 TACCTTGTTACGACTT Kawahara

et al., 2006
EC12A TGATCCTGGCTCAGAACGAACG Kawahara

et al., 2006
16S8FE GGAATTCAGAGTTGGATCM*TGGYTCAG Schouls et

al., 1999
B-GA1B biotin-

CGGGATCCCGAGTTTGCCGGGACTTCTTCT
Schouls et

al., 1999
Probe Modification (5’-3’) Reference

International Journal of Applied Biology, 5(2), 2021

Anaplasma/Ehrlichia
catch-all

C6 amino-GGG GGA AAG ATT TAT CGC
TA

Bekker et
al., 2002

A. marginale C6 amino-GAC CGT ATA CGC AGC TTG Bekker et
al., 2002

A. centrale C6 amino TCG AAC GGA CCA TAC GC Bekker et
al., 2002

A. bovis C6 amino-GTA GCT TGC TAT GRG AAC A Bekker et
al., 2002

E. ruminantium C6 amino-AGT ATC TGT TAG TGG CAG Bekker et
al., 2002

Ehrlichia sp.
‘Omatjenne’

C6 amino-CGG GTT TTT ATC ATA GCT
TGC

Bekker et
al., 2002

A. phagocytophilum
group

C6 aminoTTG CTA TRR AGA ATA RTT AGT
GG

Bekker et
al., 2002

A. phagocytophilum
1

C6 amino-
TTGCTATAAAGAATAATTAGTGG

Schouls et
al., 1999

A. phagocytophilum
3

C6 amino-
TTGCTATGAAGAATAATTAGTGG

Schouls et
al., 1999

A. phagocytophilum
5

C6 amino-
TTGCTATAAAGAATAGTTAGTGG

Schouls et
al., 1999

A. phagocytophilum
7

C6 amino-
TTGCTATAGAGAATAGTTAGTGG

Schouls et
al., 1999

A. phagocytophilum
A-HE

C6 amino-GCTATAAAGAATAGTTAGTGG Schouls et
al., 1999

A. phagocytophilum
A-D- HE

C6 amino-GCTATGAAGAATAGTTAGTG Schouls et
al., 1999

Statistical analysis

Statistical calculations were performed using SPSS V. 23 software and Chi-square
tests was used to statistically compare different prevalence of infection.

Result
A total number of 162 cattle blood samples were screened for detection of rickettsial

organisms. Seventy-two (72) were found positive for the presence of 16S rRNA gene of
Anaplasma and Ehrlichia species. We then identified after examination these blood samples
of two genera of rickettsial bacteria such as Anaplasma sp. and Ehrlichia sp. (Figure 1).

International Journal of Applied Biology, 5(2), 2021

Figure 1. Gel electrophoresis of PCR product of Anaplasma and Ehrlichia species

The detection of 16S rRNA gene of Anaplasma and Ehrlichia species is done by nested

PCR using genus-specific primers 16S8FE/B-GA1B. M: 500 bp ladder; N1-N2: standard
negative controls (N1, DNA isolated from uninfected cow blood; N2, Sterile deionized water);
P1-P2: positive controls (P1, Anaplasma marginale; P2, Anaplasma phagocytophilum). Lanes
1-8: positive field samples signalling Anaplasma/Ehrlichia catchall probe in the RLB.

After confirmation of the presence of 18S rRNA gene of Anaplasma and Ehrlichia
species in the blood samples, RLB was performed to identify these parasites at the level of
species and so, the following four of them were incriminated: Anaplasma marginale,
Anaplasma centrale, Anaplasma sp. ‘Omatjenne’ and Ehrlichia ruminantium (Figure 2).

Figure 2. Detection of Anaplasma and Ehrlichia species by RLB

Oligonucleotide probes were applied in columns and PCR products in rows. Lanes 1-
4: Positive controls (1, A. marginale; 2, A. centrale; 3, Anaplasma sp. ‘Omatjenne’; 4, A.

International Journal of Applied Biology, 5(2), 2021

phagocytophilum. Lanes 5-6: negative controls (5, DNA isolated from uninfected cow blood;
6, sterile deionized water). Lanes 7-16: field samples (single and mixed infection) (7, A.
marginale; 8, A. centrale; 9, Anaplasma sp. ‘Omatjenne’; 10, E. ruminantium; 11, A.
marginale + A. centrale; 12, A. marginale + Anaplasma sp. ‘Omatjenne’; 13, A. marginale + A.
centrale + Anaplasma sp. ‘Omatjenne’; 14, A. marginale + Anaplasma sp. ‘Omatjenne’ + E.
ruminantium; 15, A. marginale + A. centrale + Anaplasma sp. ‘Omatjenne’ + E. ruminantium;
16, A. centrale + E. ruminantium.

The overall prevalence of infection in cattle by these rickettsial bacteria was
important and assessed to 44.44%. We also noticed that, female cattle (44.79%) were more
infected than males (43.93%) with no significant difference while according to age,
prevalence of infection was significantly different between yearling (50%) and adult cattle
(44.07%) (Table 2).
Table 2. Overall prevalence of infection of rickettsial bacteria in the study area

Number of cattle blood

Examined Infected
Prevalence

(%)

Age χ2 = 51.681; df = 1; P < 0.0001
Yearling 10 5 50

Adult 152 67 44.07

Sex χ2 = 2.347; df = 1; P = 0.1255
Male 66 29 43.93

Female 96 43 44.79

Total 162 72 44.44

We noted that four species of rickettsial bacteria: Anaplasma marginale, Anaplasma

centrale, Anaplasma sp. ‘Omatjenne’ and Ehrlichia ruminantium were identified. The most
prevalent parasite was A. marginale (41.35%), followed by Anaplasma sp. ‘Omatjenne’
(15.43%), A. centrale (8.64%) and E. ruminantium (3.08%). There was a significant difference
between the prevalence of infection between the species identified (Table 3).
Table 3. Prevalence of each rickettsial bacteria identified in cattle blood

Number of cattle blood

Examin
ed Infected

Prevalence
(%)

Rickettsial bacteria χ2 = 81.252; df = 3; P < 0.0001

Anaplasma marginale

162

67 41.35

Anaplasma sp. ‘Omatjenne’ 25 15.43

Anaplasma centrale 14 8.64

Ehrlichia ruminantium 5 3.08

Several types of co-infections were observed following blood examination. We noted

four different types of multiple infection and classified as single, double, triple and

International Journal of Applied Biology, 5(2), 2021

quadruple infections with a prevalence statistically different. We found that, the most
prevalent was single infection (24.69%) followed by double infection (16.67%) while triple
(1.85%) and quadruple infections (1.23%) were less prevalent. Summarily, difference was not
significant between the prevalence of single (24.69%) and whole mixed infection (19.75%)
(Table 4).
Table 4. Prevalence of co-infection in the study area

Single
infection

Double
infection

Triple
infection

Quadruple
infection Total

No (%) No (%) No (%) No (%) No (%)

Age
Yearling 3 30 2 20 5 50
Adults 37 24.34 25 16.44 3 1.97 2 1.32 67 44.07

Sex
Male 18 27.27 9 13.63 2 3.03 29 43.93
Female 22 22.91 18 18.75 3 3.12 43 44.79

χ2 = 58.111; df = 3; P < 0.0001

Total 40 24.69 27 16.67 3 1.85 2 1.23 72 44.44

Co-infection

Single infection Mixed infection
Frequency 40 32

Prevalence (%) 24.69 19.75

χ2 = 0.681; df = 1; P = 0.409

Considering the single infection (Table 5) of these rickettsial infections of cattle

blood, we found that the most prevalent parasite was Anaplasma marginale (22.22%), while
the most prevalent mixed infection was the double infection (16.66%) with the association
between A. marginale + A. sp. ‘Omatjenne’ (11.11%).

International Journal of Applied Biology, 5(2), 2021

Table 5. Prevalence of rickettsial bacteria association in infected cattle

Age Sex Total

Yearling Adults Male Female Study area

No (%) No (%) No (%) No (%) No (%)

Rickettsial bacteria

Anaplasma marginale 3 30
33 21.71 16 24.24 20 20.83 36 22.22

Anaplasma centrale 2 1.31 1 1.52 1 1.04
2 1.23

Anaplasma sp. ‘Omatjenne’ 1 0.66 1 1.04 1 0.62

Ehrlichia ruminantium 1 0.66 1 1.52 1 0.62

A. marginale + A. centrale 8 5.27 3 4.54 5 5.21 8 4.94

A. marginale + A. sp. ‘Omatjenne’ 2 20 16 10.52 6 9.09 12 12.5 18 11.11

A. centrale + A. sp. ‘Omatjenne’ 1 0.66 1 1.04 1 0.62

A. marginale + A. centrale + A. sp. ‘Omatjenne’ 1 0.66 1 1.04 1 0.62

A. marginale + A. sp. ‘Omatjenne’ + E. ruminantium 2 1.31 2 2.09 2 1.23

A. marginale+ A. centrale + A. sp. ‘Omatjenne’ + E. ruminantium 2 1.31 2 3.03 2 1.23

Total 5 50 67 44.07 29 43.94 43 44.79 72 44.44

Discussion
The reverse line blot hybridization was performed to specifically identify

simultaneously several species of rickettsial bacteria (Anaplasma and Ehrlichia species). Of
the 162 blood samples screened, 77 were found positive for at least one rickettsial bacteria.
The overall prevalence of infection was 44.44%. This result was similar to 40.76% and 41%
reported by Hailemariam et al., (2017) in Ethiopia and Nguyen et al., (2020) in Thailand
respectively. However, it was highest compared to 9%, 5.3% and 7.1% reported respectively
by Aktas et al., (2010) in Turkey, Parvizi et al., (2019) in Egypt and Zaid et al., (2019) in
Palestine. Furthermore, this prevalence was lower than the 76.1% found in Northern
Cameroon by Abanda et al., (2019). The important prevalence of infection of rickettsial
bacteria observed might be associated to the presence of its main vectors, the Amblyomma
and Rhipicephalus ticks (Ngangnang et al., 2021). However, Hyalomma and Haemaphysalis
tick species are also considered as potential vectors (Latif and Walker, 2004; Lankester et
al., 2007) and were identified in the study area (Ngangnang et al., 2021). According to this
finding, we could conclude that pathogens and vector might be widespread and well
established in the Western Highlands of Cameroon and need a great attention for medical
and veterinary concern. It had also been noticed that, female cattle (44.79%) were most
infected than male (43.93%) but the difference was not statistically significant as found by
Nguyen et al., (2020) while, the infection was associated to sex as reported Nyabongo et al.,
(2021) in Uganda. According to Nyabongo et al., (2021), this risk of infection could be
explained by the higher number of female cattle sampled compared to male in the study
population. Moreover, male cattle are provided with better health care due to their higher
value, as they are used by farmers for reproduction and sold for meat, whereas females are
kept for dairy. The prevalence of infection was high and significantly different between
yearling (50%) and adult cattle (44.07%). Similarly, Nyabongo et al., (2021) report indicated
the same observation while it was different from the finding of Lorusso et al., (2016) in
Nigeria. This study showed that yearling cattle had a higher chance of being infected
compared to adults. Adult cattle that were infected as calves are resistant to re-infection,
which could explain the high risk of infection for calves or yearling compared to adult
animals.

Of the 162 cattle blood samples tested using nested PCR-based RLB hybridization
assay for detection of rickettsial bacteria, A. marginale, Anaplasma sp. ‘Omatjenne’, A.
centrale and E. ruminantium were identified. The most prevalent rickettsial bacteria
identified in this study was A. marginale (41.35%) followed by Anaplasma sp. ‘Omatjenne’
(15.43%), A. centrale (8.64%) and E. ruminantium (3.08%). This finding was in agreement
with the report of Lorusso et al., (2016) in Nigeria although they found the prevalence in
different proportion and might be due to the sample size or the epizootiological situation of
disease in each study site. However, the result contrast the previous report of Eygelaar et
al., (2015) in Botswana and Teshale et al., (2018) in Ethiopia who reported respectively
Anaplasma centrale and Anaplasma sp. ‘Omatjenne’ as the most prevalent species. This
contrast might be difference among the target population (Buffalo and Cattle) during each
study site and even the epizootiology of vectors.

Several categories of co-infection were observed and the most prevalent was the
single infection (24.69%) followed by double (16.67%), triple (1.85%) and quadruple
infection (1.23%). The single infection (24.69%) was most prevalent than the total mixed
infection (19.75%) with no significant difference. These results were different from those of

International Journal of Applied Biology, 5(2), 2021

Hailemariam et al., (2017) and Nyabongo et al., (2021) and could indicate the severity of
rickettsial infection in cattle in the given study area.

Conclusion

There was a high level of prevalence and species composition of rickettsial bacteria
in the study area. This prevalence could be associated to the previous identification of
Amblyomma and Rhipicephalus ticks in the study area. Likewise, the current description of
biological transmission of A. marginale by Rhipicephalus microplus ticks such as biological
intrastadial and transstadial transmission could affect the persistence of rickettsial bacteria.
Better prevention and control methods of these microorganisms could be development of
new vector control strategies.

Authorization

This study including cattle was authorized by the Regional Delegate for Livestock,
Fisheries and Animal Industries of the West Region of Cameroon (Authorization No
02/19/L/DREPIA-O/SRAG).

Author’s contribution

Ngangnang Ghislain Roméo conceived the idea of the study, wrote the research
proposal, gathered the data, analysed and interpreted the data, prepared the manuscript,
searched the literature and finalized the study.

Vincent Khan Payne and Fonteh Anyangwe Florence proposed the study, analysed
and interpreted the data, revised and approved the final version of the manuscript.

Aktas Munir and Ulucesme Mehmet Can designed the methodology, extracted the
DNA and performed PCR and RLB assay and revised the final version of the manuscript on
molecular biology.

Keptcheu Tchankwe Désiré Léonard gathered and analysed the data.

Conflict of interest

The authors declare that they have no competing interest on this study.

Funding

Not applicable

Acknowledgement

The authors acknowledge farmers for agreeing to participate and consent to collect
ectoparasites and blood samples on cattle. We are also grateful to the Department of
Parasitology, Faculty of Veterinary Medicine, University of Firät, Elazig, Turkey for providing
laboratory space and reagents necessary for accomplishment of this work.

International Journal of Applied Biology, 5(2), 2021

Reference
Abanda Babette, Archile Paguem, Mamoudou Abdoulmoumini, Tanyi Kingsley, Alfons Renz

and Albert Eisenbarth 2019. Molecular identifcation and prevalence of tick-borne
pathogens in zebu and taurine cattle in North Cameroon. Parasites Vectors 12:448.

Aktas Munir, Kursat Altay, Nazir Dumanli, 2010. Molecular detection and identification of
Anaplasma and Ehrlichia species in cattle from Turkey. Ticks and Tick-borne
Diseases, 2 62–65.

Bekker C P, de Vos S, Taoufik A, Sparagano O A and Jongejan F, 2002. “Simultaneous
detection of Anaplasma and Ehrlichia species in ruminants and detection of
Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot
hybridization”. Veterinary Microbiology, 89, 223-238.

Dinkisa Gutema, 2018. Review on Control of Cowdriosis in Ruminants. Int J Vet Sci Technol,
3(1): 013-01.

Eygelaar Dewald, Ferran Jori, Mokganedi Mokopasetso, Kgomotso P Sibeko, Nicola E Collins,
Ilse Vorster, Milana Troskie and Marinda C Oosthuizen, 2015. Tick-borne
haemoparasites in African buffalo (Syncerus caffer) from two wildlife areas in
Northern Botswana. Parasites & Vectors, 8:26.

Georges K, Loria G R, Greco A, Caracappa S, Jongejan F and Sparagano O, 2001. Detection of
haemoparasites in cattle by reverse line blot hybridisation with a note on the
distribution of ticks in Sicily. Vet Parasitol, 99, 273-286.

Hailemariam Zerihun, Jurgen Krucken, Maximilian Baumann, Jabbar S Ahmed, Peter-
Henning Clausen and Ard M Nijhof, 2017. Molecular detection of tick-borne
pathogens in cattle from Southwestern Ethiopia. PLoS ONE 12 (11).

ILRAD, 1991. Tick-Borne Diseases of Livestock. International Laboratory for Research on
Animal Diseases, Vol 9 No 3.

IRAD, 2008. Rapport national sur l'état des ressources phytogénétiques pour l'alimentation
et l'agriculture. 83p.

Iweriebor Benson C, Elia J Mmbaga, Abiodun Adegborioye, Aboi Igwaran, Larry C Obi and
Anthony I Okoh, 2017. Genetic profiling for Anaplasma and Ehrlichia species in ticks
collected in the Eastern Cape Province of South Africa. BMC Microbiology, 17:45.

Jiotsa Albert, Timothy Musima Okia and Henri Yambene 2016. Cooperative Movements in
the Western Highlands of Cameroon. Journal of Alpine Research, 103-1.

Kawahara M, Rikihisa Y, Lin Q, Isogai E, Tahara K, Itagaki A, Hiramitsu Y and Tajima T, 2006.
Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis,
Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major
islands in Japan. Appl. Environ. Microbiol, 72, 1102–1109.

International Journal of Applied Biology, 5(2), 2021

Kenneil Rachel, 2015. The immune response to live vaccines against bovine anaplasmosis.
Thèse présentée à la faculté des Sciences, Institut de Biologie, Université de
Neuchâtel Pour l’obtention du grade de docteur ès Sciences (Ph.D.), 139p.

Kivaria F M, 2006. Estimated direct economic costs associated with tick-borne diseases on
cattle in Tanzania. Trop. Anim. Health Prod., 38, 291-299.

Lankester Murray W, Brad Scandrett W, Elizabeth J Golsteyn-Thomas, Neil C Chilton and
Alvin A Gajadhar, 2007. Experimental transmission of bovine anaplasmosis (caused
by Anaplasma marginale) by means of Dermacentor variabilis and D. andersoni
(Ixodidae) collected in western Canada. The Canadian Journal of Veterinary
Research, 71:271–277.

Latif A A and A R Walker, 2004. An introduction to the biology and control of ticks in Africa.
29p.

Lorusso Vincenzo, Michiel Wijnveld, Ayodele O Majekodunmi, Charles Dongkum, Akinyemi
Fajinmi, Abraham G Dogo, Michael Thrusfeld, Albert Mugenyi, Elise Vaumourin and
Augustine C Igweh, 2016. Tick-borne pathogens of zoonotic and veterinary
importance in Nigerian cattle. Parasites and Vectors, BioMed Central, 9.

McCallon, B R, 1973. Prevalence and economic aspects of anaplasmosis. In: Jones, E.W.
(Ed.), Proc. 6th National Anaplasmosis Conference, Las Vegas, NV, pp. 1–3.

Mukhebi A W, Chamboko T, O'Callaghan C J, Peter T F, Kruska R L, Medley G F, et al, 1999.
An assessment of the economic impact of heartwater (Cowdria ruminantium
infection) and its control in Zimbabwe. Prev Vet Med, 39: 173-189.

Nchinda V P and Mendi S D, 2008. Factors influencing the adoption of yoghurt technology in
the Western Highlands Agro-ecological zone of Cameroon. Livestock Research for
Rural Development, Vol 20, N07, 1-7.

Ngangnang G R, Aktas M, Keptcheu T D, Fonteh A F and Payne V K, 2021. Species
composition, diversity and predilection sites of ticks (Acari: Ixodidae) infesting
cattle in the Western Highlands of Cameroon. Arthropods, 10(3): 82-96.

Nguyen Anh H L, Sonthaya Tiawsirisup and Morakot Kaewthamasorn, 2020. Molecular
detection and genetic characterization of Anaplasma marginale and Anaplasma
platys-like (Rickettsiales: Anaplasmataceae) in water buffalo from eight provinces
of Thailand. BMC Veterinary Research, 16:380, pp 1-12.

Nyabongo Lionel, Esther G Kanduma, Richard P Bishop, Eunice Machuka, Alice Njeri, Alain V
Bimenyimana, Canesius Nkundwanayo, David O Odongo and Roger Pelle, 2021.
Prevalence of tick-transmitted pathogens in cattle reveals that Theileria parva,
Babesia bigemina and Anaplasma marginale are endemic in Burundi. Parasites &
Vectors, 14:6.

International Journal of Applied Biology, 5(2), 2021

Parvizi Omid, Hosny El-Adawy, Falk Melzer, Uwe Roesler, Heinrich Neubauer and Katja
Mertens-Scholz, 2019. Seroprevalence and Molecular Detection of Bovine
Anaplasmosis in Egypt. Pathogens, 9, 64.

Zaid Taher, Suheir Ereqat, Abdelmajeed Nasereddin, Amer Al-Jawabreh, Ahmad Abdelkader
and Ziad Abdeen, 2019. Molecular characterization of Anaplasma and Ehrlichia in
ixodid ticks and reservoir hosts from Palestine: a pilot survey. Veterinary Medicine
and Science, 5, pp. 230–242.

Schouls, L M, Ingrid Van De P, Rijpkema S G T, Schot C S, 1999. ‘’Detection and identification
of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes
ricinus Ticks.’’ Journal Clinical Microbiology, 37, 2215-2222.

Teshale Sori, Dirk Geysen, Gobena Ameni, Pierre Dorny and Dirk Berkvens, 2018. Survey of
Anaplasma phagocytophilum and Anaplasma sp. ‘Omatjenne’ infection in cattle in
Africa with special reference to Ethiopia. Parasites & Vectors 11:162.