12

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

DOI 10.11603/ijmmr.2413-6077.2021.1.12468

VITAMIN D AND UROLITHIASIS IN CHILDREN

*Sh.A. Yusupov1, A.M. Shamsiev2,  
J.A. Shamsiev3, P.A. Pulotov4

1, 2, 3, 4 – SAMARKAND STATE MEDICAL INSTITUTE, SAMARKAND, REPUBLIC OF UZBEKISTAN

Background. Urolithiasis is currently one of the topical issues of contemporary urology and medicine in 
general. This is primarily due to the high prevalence of urolithiasis; according to several population studies it 
ranges from 3.5 to 9.6%. At the same time, there is a steady increase in its incidence. Therefore, the matter of 
urolithiasis is one of the most urgent in present-day medicine. 

Objectives. The aim of the research was to study the content of a polymorphic genetic marker of the vitamin 
D receptor gene related to development and relapse of urolithiasis in children.

Methods. The content of a polymorphic genetic marker of the vitamin D receptor gene related to development 
and relapse of urolithiasis in 100 children was investigated. 

Results. The results of the study prove that the vitamin D receptor gene assists in revealing disorders that 
promote urolithiasis development.

Conclusion. Comparative analysis of the frequency of distribution of Fok1 genotypes of the vitamin D receptor 
gene polymorphism showed that statistical significance of the association (p=0.02) of f allele according to the 
dominant inheritance model (total Ff+ff genotypes) was established in the group of patients with urolithiasis 
compare to the corresponding indicator of the control group (63%).

KEYWORDS: vitamin D, urolithiasis, VDR gene, gene polymorphism, dysuria.

International Journal of Medicine and Medical Research 
2021, Volume 7, Issue 1, p. 12-19
copyright © 2021, TNMU, All Rights Reserved

Sh.A. Yusupov et al.

*Corresponding author: Yusupov Shukhrat, PhD, DSc, Head of 
the Department of Paediatric Surgery, Samarkand State 
Medical Institute, Samarkand, Republic of Uzbekistan. E-mail: 
shuchrat_66@mail.ru 

Introduction
It is established that urolithiasis is polyetio-

logical. The final step of stone formation is salts 
crystallization in a urine supersaturated solu-
tion. However, a variety of mechanisms take 
part in pathogenesis before this, i.e. disorders 
of renal circulation, disturbance of urinary tract 
urodynamics, and inflammation in them [2, 3].

Urolithiasis is defined as a metabolic di-
sease that is caused by several endogenous 
and/or exogenous factors and is characterized 
by occurrence of stones in the urinary system 
[3]. It is clear that stones in the urinary tract are 
a clinical manifestation of the disease; removal 
of the stone does not stop its progression, and 
it develops further if the causes are not eli-
minated [19].

Calcium stones are the most common, that 
is more than 80% of cases. Correspondingly, 
most of the calcium stones (about 85-90%) are 
calcium oxalates, 1-10% – calcium phosphates 
[7]. Recently, a tendency to decrease in the 
incidence of phosphate stones in the world 
structure was noticed. Probably, this is caused 

by a decrease in the occurrence of infected 
stones because of advances of minimally in-
vasive surgery for urolithiasis and use of the 
latest antibacterial therapy [1,14]. 

Thus, metabolic disorders are significant in 
the pathogenesis of urolithiasis. Ever more, 
there are uric acid stones (up to 10% of all 
urinary stones); they include uric acid and its 
salts, along with mixed stones (up to 5% of all 
calcium stones) that contain calcium salts 
together with uric acid and/or its salts [18].

Violation of calcium metabolism is one of 
the risk factors for occurrence and relapse of 
urolithiasis; its regulation in the human body 
is a complex process. Three major hormones: 
parathyroid hormone (PTH), calcitonin, and 
metabolite of vitamin D, 1,25-dihydroxy-
cholecalciferol-1,25 – the most important, are 
involved in calcium homeostasis maintenance 
[12].

Vitamin (hormone) D is a controlling ana-
bolic hormone having antioxidant properties 
and an exclusive systemic metabolic effect [12]. 
Then again, seasonal fluctuations in vitamin D 
rate (high levels in summer and autumn and 
low – in winter and spring, similarly to annual 
testosterone cycles) take place [19]. On the 
other hand, regulation of the expression of 



13

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

hormone D metabolism genes variates accor-
ding to the androgens level. Hence, androgen 
deficiency intensifies adverse health effects 
caused by vitamin D deficiency [10].

The receptor of vitamin D is encoded by the 
vitamin D receptor gene characterized by ge-
netic polymorphism, i.e. different allelic varia-
tions of this gene in humans [4]. Bsm I, Fok I, 
Taq I are the most important polymorphisms 
of the vitamin D receptor gene involved in 
progress of diseases [18, 19]. Several studies 
associate VDR gene polymorphism with uro-
lithiasis. Some publications prove the signi-
ficance of occurrence of the ApalAA genotype 
that determines sensitivity to vitamin D in the 
formation of calcium stones in the urinary 
organs [7, 14]. It is also established that in 
patients with urolithiasis the HLA B13, B22 and 
B35 genes are more common than in healthy 
individuals [2].

The huge range of biological effects of 
vitamin D, its involvement in carbohydrate, fat, 
purine metabolism, as well as its anabolic, 
antiproliferative, immunomodulatory effects, 
the investigation of cases of its deficiency is 
essential. 

Methods
To perform the tasks set, a clinical exa-

mination of 100 children with urolithiasis and 
100 practically healthy children was conducted, 
as well as the collection and analysis of sta tis-
tical data on urolithiasis in children of different 
age groups to identify the gender, age-related 
and family frequency of urolithiasis, nutrition 
and lifestyle features, as well as the seasonality 
of this pathological process. Ultrasound and 
X-ray examinations of the urinary organs of 
patients were performed. 

The selection of patients was carried out on 
the basis of the diagnosis established in the 
clinic with the written consents of the probands. 
Blood samples were collected from the patients 
with urolithiasis (100 samples) and a control 
group of practically healthy children (100 
samples). Venous blood (1 ml) was kept in 
0.5 ml of sodium citrate solution at -20 °C.

The material for the research was provided 
by the Republican Specialized Scientific and 
Practical Medical Center of Pediatric Surgery of 
Samarkand.

Table 1 presents data on distribution of the 
patients according to age in the groups under 
consideration.

Table 1 shows that among the patients, 
school-age children prevailed – 69 (69%). The 
reason is the fact that it is the age when meta-
bolic disorders are the most often manifested; 
it is associated with the transition of children 
to a general diet, violation of drinking regime, 
etc., and in the younger group – the diet is quite 
rational and metabolic changes are less pro-
nounced. 

The distribution of patients in both groups 
depending on gender is presented in Table 2.

The data presented in Table 2 shows that 
according to the gender distribution of patients, 
incidence of urolithiasis is higher among boys – 
68 (68%) children than girls – 32 (32%). 

The most common complaints of patients 
with urolithiasis were pain in the lumbar region, 
fever, hematuria, turbidity of urine, increased 
or decreased urination. Acute urinary retention 
and spontaneous discharge of concretions 
were noted in some cases. In dislocation of 
concretions in the ureter n/w the pain was 
present in the iliac region on the same side. The 
patients with renal insufficiency had charac-

Table 1. Age-related division of patients with urolithiasis and healthy children 

Age of patients
(years)

Control group 
(n=100)

Main group 
(n=100)

Total
(n=200)

n % n % n %
0-3 17 17 31 31 48 24
4-11 43 43 43 43 86 43
12-17 46 46 26 26 72 36

Table 2. Division of patients depending on gender

Gender
Control group 

(n=100)
Main group 

(n=100)
Total

(n=200)
n % n % n %

Girls 35 35 32 32 35  17.5
Boys 65 65 68 68 165 82.5

Sh.A. Yusupov et al.



14

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

teristic symptoms, i.e. headache, drowsiness, 
poor appetite.

At admission pain syndrome was evidenced 
in 89 (89%) patients. Also, a severe pain syndro-
me of renal colic was present in 15 (15%) pa-
tients. The nature and localization of the pain 
syndrome depended on the child’s age, pre-
sence of concomitant concretions in the urinary 
tract. In the patients of a younger age group, 
abdominal pain was typical. Older patients 
complained for lumbar pain more often, 
sometimes complained of irradiation of pain 
along the ureter. 

In 3 (3%) children suffering from concretion 
in the lower third of the right ureter, pain 
syndrome led to unjustified appendectomy 
performed at the place of residence. In these 
patients ureterolithotomy was associated with 
some technical difficulties due to an adhesive 
process.

Dysuric manifestations were evidenced in 
28 (28%) patients and mostly characterized by 
frequent and painful urination. Acute urinary 
retention was present in 5 (5%) patients. 
Dysuric manifestations were nearly 2 times 
more common in younger patients than other. 
Acute urinary retention in all patients was 
managed by inserting an Ad’mer catheter; in 3 
(3%) patients, after the catheter was removed, 
spontaneous discharge of the concretion was 
evidenced.

According to the localization of the con-
cretions, the following were identified: renal 
calculi in 43 patients (left-13, right – 21, on both 
sides – 9); ureter stones in 12 patients (c/3 
ureter – 1, b/3 ureter – 1, n/3 ureter – 10); 
bladder stones in 9 patients (recurrent bladder 
stone in 1 of them); stones of the proximal 
urethra in 4 patients; multiple urolithiasis in 10 
patients. Combined urolithiasis with urinary 
disorders were revealed in 22 children.

Genomic DNA was separated from the 
whole blood of patients diagnosed for uroli-
thiasis and almost healthy individuals of the 
control group. It was performed by means of 
reagents kit Diatom DNA Prep 200 (IsoGen 
Laboratory LLC) according to a standard pro-
tocol. This kit comprised a lysing agent with 
guanidine thiocyanate, which was designed to 

destroy cells, solubilize cell debris and denature 
cell nucleases. With a lysing reagent the DNA 
was absorbed on the NucleoS™ sorbent, then 
washed from salts and proteins with an alcohol 
solution. The DNA, which was eluted from the 
Extra-Genome sorbent, was used for further 
analysis.

PCR was performed by means of special 
oligonucleotide primers and a reagents kit for 
PCR amplification of DNA GenePak™ PCR Core 
(IsoGen Laboratory LLC). We used Master Mix 
tubes ready for amplification, which comprised 
a lyophilized state Taq DNA polymerase, 
deoxynucleose triphosphates, and magnesium 
chloride with final concentrations of 1 u, 200 
microns, and 2.5 mM, respectively, and an 
optimized buffer system intended for PCR 
amplification. 5 µl of a primers mixture, a final 
concentration of 0.5 µm, 10 µl of diluent PCR, 
and 5 µl of the test DNA were added to the 
Master Mix tubes. For PCR, the GeneAmp ® PCR 
system 9700 with a 96-cell block (Applied Bio-
systems) was used. The amplification program 
for the VDR gene involved 5 minutes of pre-
denaturation at 95 °C, 34 cycles: 94 °C – 30 sec, 
66 °C – 30 sec, 72 °C – 30 sec, and a final elon-
gation for 7 minutes at 72 °C. The temperature-
time mode of amplification for the Urokinase 
gene was: 5 minutes of preliminary denaturation 
at 95 °C, 40 cycles: 95 °C – 30 sec, 56 °C – 30 sec, 
72 °C – 30 sec; as well as final elongation at 72 °C 
for 7 minutes.

Results
Bioinformatic search for the nucleotide 

sequences of these genes was carried out in 
the Ensemble Genome Browser genomic 
database. After PCR amplification of the VDR 
gene fragment, the PCR-derived products were 
subjected to PCR analysis using Fok I endo-
nuclease (manufactured by NPO Sibenzyme) 
(Fig. 1, Table 3).

The genotypes of the VDR gene polymor-
phisms were interpreted on the basis of dif-
ferent band patterns on the electrophoregram 
(Fig. 2).

After photodocumentation, the subsequent 
restriction fragments were genotyped according 
to the presence of corresponding fragments. 

Table 3. Chromosomal structure and localization of the studied gene

Gene,  
polymorphism Primers Nucleotide sequence Restrictases

Vitamin D receptor
Fok-I polymorphism

Pr_VDR_F AGCTGGCCCTGGCACTGACTCTGCTCT Fok-I
Pr_VDR_R ATGGAAACACCTTGCTTCTTCTCCCTC

Sh.A. Yusupov et al.



15

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

Genotyping analysis of VDR gene PDRF 
products (restriction products) was performed. 

One fragment weighing 278 bp indicated 
that this sample was a carrier of the homozygous 
genotype WT (Wild Type), and three fragments 
weighing 278 bp, 198 bp and 80 bp – a carrier 
of the heterozygous genotype WT/MUT, the 
presence of two fragments weighing 198 bp 

and 80 bp – a carrier of the homozygous 
genotype MUT (Mutant) (Fig.3).

The frequency distribution of the VDR gene 
polymorphism Fok1 genotypes in the control 
group corresponded to the Hardy-Weinberg 
distributions.

A comparative analysis of the frequency 
distribution of the VDR gene polymorphism 

Fig. 1. VDR gene Fok-I polymorphism.

Fig. 2. FDRF analysis of the Fok1 polymorphism of the VDR gene.

Sh.A. Yusupov et al.



16

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

Fok1 genotypes showed a statistically significant 
association (p=0.02) of the f allele regarding the 
dominant inheritance model (Ff +ff genotypes) 
in the group of urolithiasis patients compare to 
the corresponding indicators in the control 
group (Fig. 4).

As shown on the diagram, the genotype of 
heterozygotes F/F of the Fok1 polymorphism 
of the VDR gene was the most often recorded 
in the control group (53%), and in the group of 

urolithiasis children, a decrease tendency was 
established, no confidence between the 
indicators (47%) (p>0.05) was evidenced. The 
F/f+f/f polymorphism Fok1 of the VDR gene was 
the most informative genotype in urolithiasis, 
which occured almost 2 times more often 
compare to the control group (p<0.01).

The frequency distribution of the hete-
rozygotes F / F genotype was 44.4%; in the 
control group – 15%, respectively (χ2=0.47; 
p=0.24; OR=1.35; 95% CI 0.57-3.17; df=1). f allele 
detection increased the risk of urolithiasis in 
children in 2.4 times compare to the F allele 
(95% CI=0.68-2.93, df=1).

Аllele determines the vitamin D receptor 
synthesis (427 amino acids); it is defined as *f, 
and the shorter form (424 amino acids) of the 
receptor is VDR*F. The study of the patient 
samples proved that the ff-normal genotype 
was revealed in 83 patients; a homozygous 
variant of the mutant Ff genotype – in one case, 
a heterozygous FF genotype – in 127 cases by 
the VDR gene polymorphic marker FokI 
(3663T>C). 

The allelic form of VDR*F*f was associated 
with a frequency of 74% and urolithiasis 
manifestations in the studied group of patients; 
the *f allele occurrence was 93 compare to the 
*F allele – 89. 

Fig. 3. PDRF analysis of the Fok1 polymorphism of the VDR gene.

Fig. 4. Frequency distribution of Fok1 polymorphism genotypes 
of the VDR gene in the control group and in patients with 
urolithiasis.

0

10

20

30

40

50

60

70

FF Ff+ff

53% 

37% 

47% 

63% % 

Control group Main group

Sh.A. Yusupov et al.



17

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

It is established that calcium urolithiasis is 
associated with the VDR*F*F genotype; in the 
individuals with this genotype the manifestations 
of urolithiasis at an early age are significantly 
more frequent; in the carriers of the VDR*f*f 
genotype the association with the development 
of urolithiasis is significantly lower; and in the 
individuals homozygous for the VDR*F*f ge-
notype – intermediate.

The analysis of the VDR gene genotype 
frequencies proved that the analysed genotypes 
distribution in our population corresponded to 
the Hardy-Weinberg distribution (RHB) (χ2=5.14; 
p=0.03) (Table 4).

Thus, the attained results prove that the 
VDR gene is significant in revealing the dis-
orders that contribute to urolithiasis deve-
lopment.

Table 4. Statistical analysis of the genetic association of the VDR gene genotypes  
with urolithiasis according to the dominant inheritance model (test χ2, df=2)

Genotypes
Cases Control

χ2 р
OR

n=100 n=94 Case 95% CI
Genotype F/F 0.370 0.532 5.14 0.02 0.52 0.29-0.92
Genotype F/f+f/f 0.630 0.468 1.93 1.09-3.43

Discussion
Many scientists have proved that a violation 

of the metabolism of vitamin D leads to an 
imbalance in the phosphorus-calcium meta-
bolism, which is a direct risk factor for the 
development of urolithiasis. A decrease in the 
level of vitamin D leads to a deterioration of 
health due to a range of physiological processes. 
However, many guidelines on urolithiasis pro-
vide recommendations on the limited admi-
nistration of vitamin D due to the fear of deve-
lopment of increased lithogenesis. Some re-
searchers proved that 1.25 (OH)2D3 has a direct 
effect on calcium excretion [8]. Currently, the 
relationship between the level of vitamin D and 
nephrolithiasis is debatable; the data obtained 
are contradictory, especially in paediatrics.

Schlingmann and co-authors stated that in 
children with urolithiasis, significant nephro-
calcinosis and hypercalcemia had conditions of 
suppressed serum PTH and a significant in-
crease in the level of 1.25-dihydroxyvitamin D3 
due to CYP24A1 mutations [13].

Consequently, VDRs are encoded by the 
VDR gene with genetic polymorphism, i.e. the 
presence of various allelic variants of this gene 
in the population [5]. Bsm I, Folc I, Taq I were 
the most significant polymorphisms of the VDR 
gene involved in disease development. The 
prevalence of VDR gene polymorphism has 
racial and ethnic differences. In one population, 
one genotype of a polymorphic marker prevails, 
in another population – another genotype of a 
polymorphic marker [11, 15, 17]. In this regard, 
it is relevant to study the distribution of ge-
notypes of the polymorphic marker Fok I of the 
VDR gene in the Uzbek population in children 
with urolithiasis.

The Fok I locus is characterized by a T / C 
transition in the start codon (ATG) of the second 
exon of the VDR gene, in which the length of 
the protein molecule of the receptor decreases 
due to the displacement of the start codon by 
three triplets. In the case of thymine (T) or the 
“f” allele, the M1 form of a molecule of 427 
amino acids is synthesized; in the case of 
cytosine (C) or the “F” allele, a shorter and, 
accordingly, more active M4 form of the 
receptor with a length of 424 amino acids is 
synthesized [9]. According to the US researchers, 
in children with the FF genotype, bone mineral 
density was on average by 8.2% higher than in 
those with the recessive homozygous genotype 
(ff) and by 4.8% higher than in children with the 
Ff genotype [16].

A group of scientists guided by S. Azab 
conducted a study of the association of BsmI 
polymorphism of the VDR gene with the risk of 
development of nephropathy in patients with 
systemic lupus erythematosus; it showed that 
the BB (AA) genotype is a risk factor for this 
complication. However, there was no significant 
association of VDR gene variants with other 
clinical manifestations, laboratory profiles of 
systemic lupus erythematosus, the disease 
activity index or the level of 25-hydroxyvitamin 
D in the blood serum of patients [6].

According to the results of out study, it was 
established that in the Uzbek population the 
genetic markers of predisposition to urolithiasis 
are: genotypes Ff+ff of the VDR gene. A com-
parative analysis of the frequency distribution 
of the VDR gene polymorphism Fok1 genotypes 
proved a statistically significant association 
(p=0.02) of the f allele regarding the dominant 
inheritance model (Ff+ff genotypes) in the 

Sh.A. Yusupov et al.



18

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

group of urolithiasis patients compare to the 
corresponding indicators in the control group. 
The genotype distribution frequencies of F/F 
heterozygotes were 44.4%, and 15% – in the 
control group, respectively (χ2 =0.47; p=0.24; 
OR=1.35; 95% CI 0.57-3.17; df=1). Revealing of 
the f allele increased the urolithiasis risk in 
children in 2.4 times, compare to the F allele 
(95%) (CI = 0.68-2.93, df=1).

The heterozygosity of F/F mutations may 
predispose to formation of stones; therefore, 
screening should be carried out to determine 
the level of 25(OH)D in serum (which will be 
high) and levels of 24, 25(OH) vitamin D (which 
will be low), before prescribing vitamin D 
supplements to the patients with kidney stones 
to prevent exacerbation of calciuria. Those to 
be screened and genetically tested are the 
patients with high or above average serum 
calcium levels and reduced PTH levels.

The molecular genetic method of prediction 
of urolithiasis occurrence allows identifying a 
disease predisposition at any age: just about 
from the birth of a person, since the genotype 
of an individual does not change throughout 
life. Moreover, disease predisposition can be 
established by means of this method if no 
clinical or biochemical manifestations are 
present, specifically at the earliest preclinical 
stage of the pathology development. So, the 

earlier the genetic marker is detected, the more 
reliable and timely measures can be taken to 
prevent the disease.

Conclusions
A comparative analysis of the frequency 

distribution of VDR gene polymorphism Fok-1 
genotypes showed a statistically significant 
association (p=0.02) of the f allele regarding the 
dominant inheritance model (Ff +ff genotypes 
in total) in the group of urolithiasis patients 
compare to this indicator in the control group 
that was 63%. In the Uzbek population, the 
genetic markers of predisposition to urolithiasis 
are: genotypes Ff+ff of the VDR gene. It is 
appro priate to test this genotype as a comp-
rehensive program of urolithiasis prevention in 
Uzbekistan.

Conflict of Interests
Authors declare no conflict of interest.
Author’s Contributions
Yusupov Shukhrat Abdurasulovich, Shamsiev 

Azamat Mukhitdinovich – conceptualization, 
methodology, formal analysis, writing – original 
draft, writing – reviewing and editing; Shamsiev 
Jamshed Azamatovich, Pulotov Parviz Amridino-
vich – data curation, writing – reviewing and 
editing, investigation, formal analysis.

ВІТАМІН Д І СЕЧОКАМ'ЯНА ХВОРОБА В ДИТЯЧОМУ ВІЦІ

Ш.А. Юсупов1, А.М. Шамсиев2,  
Ж.А. Шамсиев3, П.А. Пулотов4 

1, 2, 3, 4 – САМАРКАНДСЬКИЙ ДЕРЖАВНИЙ МЕДИЧНИЙ ІНСТИТУТ, САМАРКАНД, РЕСПУБЛІКА УЗБЕКИСТАН 

Вступ. Сечокам'яна хвороба одна з найбільш актуальних проблем сучасної урології та медицини в 
цілому. Це пов'язано в першу чергу з високою поширеністю сечокам'яної хвороби, яка, за даними декількох 
популяційних досліджень, становить від 3,5 до 9,6%. При цьому відзначається неухильне зростання 
захворюваності.

Мета. Вивчити вміст поліморфного генетичного маркера гена рецептора вітаміну Д асоційованого 
з розвитком і рецидивуванням сечокам'яної хвороби у дітей.

Методи. Методом ПЛР проведено генетичне дослідження поліморфного генетичного маркера гена 
рецептора вітаміну Д асоційованого з розвитком і рецидивуванням сечокам'яної хвороби у 100 дітей.

Результати. результати, отримані в цьому дослідженні, вказують на те, що ген VDR сприяє 
визначенню порушень, що сприяють розвитку сечокам'яної хвороби

Висновки. В результаті проведеного порівняльного аналізу розподілу частот генотипів fok1 
поліморфізму гена VDR встановлена статистично значуща асоціація (p=0.02) алеля f за домінантною 
моделлю спадкування (сумарно генотипи Ff+ff) в групі хворих з уролітіазом порівняно з відповідним 
показником в групі контролю, який склав 63%.

КЛЮЧОВІ СЛОВА: вітамін Д, сечокам’яна хвороба, ген VDR, поліморфізм генів, дизурія

Sh.A. Yusupov et al.



19

P
e

d
ia

t
r

ic
s

issN 2413-6077. iJMMr 2021 Vol. 7 issue 1

Information about the authors 
Yusupov Shukhrat Abdurasulovich, PhD, DcS, Head of the Department of Pediatric Surgery, Samarkand 

State Medical Institute, Samarkand, Republic of Uzbekistan. 
ORCID 0000-0001-7259-028X, E-mail: shuchrat_66@mail.ru
Shamsiev Azamat Mukhitdinovich, PhD, DcS, Professor of the Department of Pediatric Surgery, 

Samarkand State Medical Institute, Samarkand, Republic of Uzbekistan. 
ORCID 0000-0001-8482-7037, E-mail: prof.ashamsiev@mail.ru
Shamsiev Jamshed Azamatovich, PhD, DcS, Professor of the Department of Pediatric Surgery, 

Samarkand State Medical Institute, Samarkand, Republic of Uzbekistan. 
ORCID 0000-0002-4193-7372, E-mail: jamshedshamsiev@mail.ru 
Pulotov Parviz Amridinovich, Assistant Professor of the Department of Pediatric Surgery, Samarkand 

State Medical Institute, Samarkand, Republic of Uzbekistan. 
ORCID 0000-0003-1338-6873, E-mail: parviz8787@icloud.com

References
1. Apolikhin OI, Sivkov AV, Konstantinova OV, 

Slominsky PA, Tupitsyna TV, Kalinichenko DN. 
Association of urolithiasis in patients with various 
family history of urolithiasis with polymorphisms of 
its candidate genes in the Russian population.
Experimental and Clinical Urology 2014; (3): 50-52. 

2. Apolikhin OI, Sivkov AV, Konstantinova OV, 
Slominsky PA, Tupitsyna TV, Kalinichenko DN. The 
connection of unilateral and bilateral urolithiasis with 
genetic factors. Experimental and clinical urology 
2015;(2):68-70.

3. Zhilenko MI, Gusakova DA, Tyuzikov IA. 
Prevalence of vitamin D deficiency/insufficiency in 
routine clinical practice. Questions of dietology. 2017. 
Vol. 7. No. 1. pp. 10-15. 

4. Kaprin AD, Apolikhin OI, Sivkov AV, etc. 
Analysis of uronephrological morbidity and mortality 
in the Russian Federation for 2003-2013. Expe-
rimental and clinical urology. 2015. No. 2. pp. 3-7.

5. Alagol F, Shihadeh Y, Boztepe H, Tanakol R, 
Yarman S, Azizlerli H, Sandakci O. 2000. Sunlight 
exposure and vitamin D deficiency in Turkish wo men. 
J. Endocrinol. Invest. 23, 173-177.

6. Azab SF, Ali YF, Farghaly MA, Hamed ME, 
Allah MA, Emam AA. Vitamin D receptor gene BsmI 
polymorphisms in Egyptian children and adolescents 
with systemic lupus erythematosus: A case-control 
study. Medicine (Baltimore) 2016; 95 (46): e5233. DOI: 
10.1097/MD.0000000000005233

7. Blomberg JM. Vitamin D metabolism, sex 
hormones, and male reproductive function. Repro-
duction. 2012. Vol. 144. № 2. P. 135–152. 

8. Ferraro PM, Taylor EN, Gambaro G, et al. 
Vitamin D intake and the risk of incident kidney 
stones. 2017; 197(2):405-410.

9. Genetics and biology of vitamin D receptor 
polymorphisms / A.G. Uitterlinden [et al.] // Gene. 
2004. 338. 143–156.

10. Girgis CM, Baldock PA, Downes M. Vitamin 
D, muscle and bone: integrating effects in deve-
lopment, aging and injury. Mol. Cell. Endocrinol. 
2015. Vol. 410. P. 10–13. 

11. Holick MF. Vitamin D: Photobiology, Meta-
bolism, etc., In “Primer on the Metabolic bone Disea-
ses and Disorders of Mineral Metabolism. American 
Society for Bone and Mineral Research. 1996, Phila-
delphia. 74-81.

12. Holick MF, Binkley NC, Bischoff-Ferrari HA 
et al. Evaluation, treatment, and prevention of 
vitamin D deficiency: аn Endocrine Society clinical 
practice guideline. J. Clin. Endocrinol. Metab. 2011. 
Vol. 96. № 7. P. 1911–1930. 

13. Schlingmann KP, Kaufmann M, Weber S, et 
al. Mutations in CYP24A1 and idiopathic infantile 
hypercalcemia. N Engl J Med 2011; 365(5):410-21.

14. Skolarikos A, Straub M, Knoll T et al. Meta bolic 
evaluation and recurrence prevention for urinary 
stone patients: EAU guidelines // Eur. Urol. 2015. Vol. 
67. № 4. P. 750–763. 

15. Timms PM, Mannan N, Hitman GA et al: 
Circulating MMP9, vitamin D and variation in the 
TIMP-1 response with VDR genotype: mechanisms 
for inflammatory damage in chronic disorders? QJM. 
2002. 95. 787-796. 

16. Vitamin D receptor gene Fok1 polymorphism 
predicts calcium absorption and bone mineral den-
sity in children / SK Ames [et al.] // Bone Miner Res. 
1999. 14, N. 5. 740–746.

17. Wang TJ, Pencina MJ, Booth SL, Jacques PF 
et al. Vitamin D Deficiency and Risk of Cardiovascular 
Disease. Circulation. – 2008. - №117. – С.503-511.

18. Wehr E, Pilz S, Boehm BO et al. Association 
of vitamin D status with serum androgen levels in 
men. Clin. Endocrinol. (Oxf.). 2010. Vol. 73. № 2. P. 
243–248. 

19. Xu H, Zisman AL, Coe FL, Worcester EM 
Kidney stones: an update on current pharmacological 
management and future directions. Expert Opin. 
Pharmacother. 2013. Vol. 14. № 4. P. 435–447.

Received 25 May 2021; revised 19 Jun 2021; 
accepted 20 Jun 2021.

This is open access article distributed under the Creative Com-
mons Attribution License, which permits unrestricted use, 
distribution, and reproduction in any medium, provided the 
original work is properly cited.

Sh.A. Yusupov et al.