Transcriptome analysis of hemocytes and hepatopancreas in red swamp crayfish, Procambarus clarkii, challenged with White Spot Syndrome Virus 119 ISJ 7: 119-131, 2010 ISSN 1824-307X RESEARCH REPORT Transcriptome analysis of hemocytes and hepatopancreas in red swamp crayfish, Procambarus clarkii, challenged with white spot syndrome virus X-Z Shi, X-C Li, S Wang, X-F Zhao, J-X Wang School of Life Sciences, Shandong University, Jinan, Shandong 250100, China Accepted March 22, 2010 Abstract Red swamp crayfish Procambarus clarkii is used for the innate immune defense of crustaceans due to its convenience for laboratory culture and study. To know more about the transcriptome of the crayfish, we constructed and sequenced a cDNA library from a mixture of hemocytes and hepatopancreas from white spot syndrome virus (WSSV)-infected crayfish. By random sequencing, we obtained 9115 high-quality expressed sequence tags with a mean length of 370 bp, representing 3033 unigenes. Most of the unigenes are first reports for the red swamp crayfish. Besides the metabolic genes, many genes that may be involved in the innate immune system of the crayfish are also obtained from the library, such as antimicrobial peptides, pattern recognition receptors, proteases and protease inhibitors, signal transduction proteins, apoptosis-, antioxidant-, and RNA interference-related proteins. We chose ten immune-related genes to analyze their expression pattern by quantitative real time polymerase chain reaction (qRT-PCR) from the hemocytes of normal and WSSV-challenged crayfish. Seven of them, including anti-lipopolysaccharide factor, astacidin, crustin 1, H3 histone family 3A, serine/threonine protein kinase, TGF beta-inducible nuclear protein, and tar RNA binding protein, were upregulated after WSSV injection, but the mRNA expression levels of crustin 2, a lectin, and a digestive cysteine protease decreased after WSSV infection. Our results showed that the transcriptome analysis provides a useful resource for identification of immune related genes and understanding the immune responses of the crayfish. Key Words: hemocytes; hepatopancreas; expression sequence tags; white spot syndrome virus; red swamp crayfish; Procambarus clarkii Introduction The crustacean farming industry has been suffering serious problems and enormous economic losses from an outbreak of white spot syndrome virus (WSSV) since 1993 (Yan et al., 2007). WSSV is a serious pathogen and can infect numerous crustaceans including shrimp, crab, and lobster (Shi et al., 2005; Zeng et al., 2009). The cultivation of red swamp crayfish (Procambarus clarkii) has become an important economic activity in China as crayfish is a delicious food. P. clarkii can be infected by white spot syndrome virus (WSSV) and is easy to be used as a laboratory model for immunity analysis. The investigation of the immune defense mechanisms of red swamp crayfish could be helpful in the control of the WSSV disease of cultivated crustaceans by ___________________________________________________________________________ Corresponding author: Jin-Xing Wang School of Life Sciences Shandong University Jinan, Shandong 250100, China E-mail: jxwang@sdu.edu.cn enhancing the defense activity. Crustaceans lack an adaptive immune system and rely totally on the innate defense system to resist pathogen invasion. The innate immune reaction comprises cellular reactions such as phagocytosis, nodule formation and encapsulation performed by hemocytes, and humoral reactions mediated by antimicrobial peptides. Crayfish hemocytes play important roles in the initiation of several immune responses and production of antimicrobial peptides (Jiravanichpaisal et al., 2007). The hemocytes and hepatopancreas are crucial for the immune system in crustaceans as it is the main production site for immune recognition molecules, initiates the humoral reaction, and takes part in the cellular reaction by some specialized cells and phagocytes (Gross et al., 2001). Many immune-related genes have been found in hemocytes of WSSV-challenged crayfish (Jiravanichpaisal et al., 2007; Zeng et al., 2009). Expressed sequence tag analysis is widely used to identify novel and differentially expressed genes 120 (Leu et al., 2007; Jiang et al., 2008). Liu (Liu et al., 2006) firstly used suppression subtractive technique on crayfish to study transcripts after WSSV infection. By suppression subtractive hybridization analysis, Zeng and Lu (Zeng et al., 2009) found thirty-three differently expressed genes in WSSV-infected hemocytes of crayfish. The transcriptome information for the hepatopancreas is still limited, so we constructed and sequenced a cDNA library from WSSV-challenged hemocytes and hepatopancreas in red swamp crayfish. The aim of this study is to identify and annotate more immune-related genes in the two immune organs and also provide some information to uncover the mechanisms of WSSV pathogenesis in crustaceans. In this study, we obtained 3033 unigenes; most of them are novel for red swamp crayfish. Many genes in the library were found to be related to the innate immune system in other species, such as pattern recognition receptors, antimicrobial peptides, proteases and protease inhibitors, signal transduction proteins, apoptosis-related proteins, antioxidant proteins, RNA silencing-related proteins, molecular chaperones, cuticle proteins, and calcium-binding proteins. Materials and Methods WSSV challenge of crayfish and collection of hepatopancreas and hemocytes Red swamp crayfish (Procambarus clarkii) (about 10-20 g each) were obtained from a seafood market in Jinan, Shandong Province, China. They were cultured in 500 L tanks in fresh water at room temperature (~20 C) in the laboratory. WSSV was extracted from the gills of infected crayfish, and diluted in PBS (Phosphate Buffered Saline, containing 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4). Using a 100 l syringe, 3.2×10 7 virus particles were injected into the abdominal segment of each crayfish. The preparation and quantification of viral inocula followed a previously described method (Wang et al., 2009b). Ninety-six hours after injection, the hemolymph was collected from the ventral sinus of ten crayfish and mixed with 1⁄10 volume of anticoagulant buffer (10 % sodium citrate, pH 7) containing 200 mM phenylthiourea as a melanization inhibitor. The hemolymph was then centrifuged at 800 g for 5 min (4 C) to collect the hemocytes. The hepatopancreas was also collected from the crayfish for RNA extraction 96 h after WSSV injection. RNA extraction and cDNA library construction The total RNA was extracted from hemocytes and hepatopancreas of 96 h infected crayfish using Unizol reagent following the manufacturer’s instructions (Biostar, Shanghai, China). Messenger RNA (mRNA) was extracted with the PolyATract mRNA isolation system (Promega, USA). The mRNAs from hemocytes and hepatopancreas were mixed together and used to construct a cDNA library. The Creator SMART cDNA Library Construction Kit (Clontech, USA) was used for the cDNA library construction following the manufacturer’s instructions. The double strand cDNA was digested and ligated with the pDNR-LIB vector, and then transformed into competent DH5 cells. Individual colonies were randomly selected, and plasmids were extracted for sequencing from the 5'-ends. Analysis and classification of the expression sequence tags (ESTs) High quality ESTs (more than 100 bp after removal of the vector sequence) were assembled by CAP3 (http://seq.cs.iastate.edu./) in order to obtain contig sequences. Unigenes (including contigs and singlets) were analyzed by BLASTx against the National Center for Biotechnology Information (NCBI) protein database, BLASTn against the NCBI nucleotide database, and BLASTx against the SWISSPROT protein database. The E-value of significant matches by the BLASTx and BLASTn is less than 0.001, and the alignment score is more than 30. The concrete functional information and metabolic profiles of Unigenes were obtained using the Kyoto Encyclopedia for Genes and Genomes (KEGG) (Kanehisa et al., 2004). Unigenes were assembled into different functional classes with Clusters of Orthologous Groups of proteins (COGs) (http://www.ncbi.nlm.nih.gov/COG/). Quantitative real time PCR (qRT-PCR) Total RNAs were extracted from hemocytes of ten normal and 96 h WSSV-challenged crayfish using Unizol reagent separately. Then RNAs were reverse transcribed to the first strand cDNAs. The cDNAs were diluted 100 fold and used as the template for qRT-PCR. Ten genes including anti-lipopolysaccharide factor, astacidin, crustin 1, crustin 2, H3 histone family 3A, serine/threonine protein kinase (SRK), TGF beta-inducible nuclear protein, tar RNA binding protein (TRBP), lectin and digestive cysteine protease from this cDNA library were chosen for qRT-PCR analysis. These genes were chosen because they belonged to different groups and were firstly found in crayfish. We wanted to know whether they participate the antivirus innate immune reaction of crayfish. 18S rRNA was used as the control. Primer sequences used in this study are listed in Table 1. qRT-PCR was performed following the manufacturer’s instruction with SYBR Premix Ex Taq (Takara, Japan) using a real-time thermal cycler (Bio-Rad, USA). The qRT-PCR was performed in 10 μl reactions containing 5 μl of 2×Premix ExTaq, 1 μl of the 1:100 diluted cDNA, 2 μl each of the forward and reverse primer (1 M). The amplification conditions were initial denaturation at 95 C for 5 min, 40 cycles of 95 C for 30 s, 60 C for 50 s, followed by a melting curve from 60 to 95 C. PCR products were detected by agarose gel analysis after each PCR reaction to confirm the specific gene amplification. Data were analyzed using a comparative method (2 -∆∆Ct ). qRT-PCR analysis was repeated three times for each sample. Results and Discussion General of the cDNA library To get more information on the virus immunity-related proteins from crayfish, total RNA was extracted from important immune tissues including hemocytes and hepatopancreas at 96 h http://www.ncbi.nlm.nih.gov/COG/ 121 Table 1 Primers used in the study after WSSV challenge, and then a cDNA library was constructed and randomly sequenced. As shown in Table 2, a total of 10145 clones were sequenced, and among these, 9115 ESTs were equal to or longer than a cutoff length (100 bp) after removal of vector sequences. They are high quality ESTs with an average length of 370 bp. In total, 3033 unigenes were acquired including 859 contigs which have more than one EST and 2174 singlets which have only one EST; the singlet rate is 71.68 . The unigene hemocyanin has 213 ESTs, which is the largest unigene size (Table 3). The novelty of the library is 33.27 . Among the unigenes, only a small fraction is previously reported genes and most of them are novel genes in red swamp crayfish. We discovered many new genes from this library, and it also provides some information about the transcriptome of crayfish hemocytes and hepatopancreas. All the unigenes were aligned to the NCBI nr database using BLASTx, and to the NCBI nt database using BLASTn as a complementary analysis. Moreover, the unigenes were repeatedly aligned against the BLASTx SWISSPROT database. From the annotation of the alignments, we found that most of the ESTs shared high similarities with nucleotide sequences mainly from Table 2 Summary statistical analysis of the cDNA library from hemocytes and hepatopancreas Total ESTs: Low and high quality ESTs; Low Quality ESTs: After remove Empty ESTs and Vector ESTs, the length of EST less than a cutoff length (100bp); High Quality ESTs: After remove Empty ESTs and Vector ESTs, the length of EST more than a cutoff length (100bp); Unigenes: Contigs and Singlets; Contigs: the number of ESTs is equal to or bigger than 2; Singlets: the number of ESTs is 1; Novelty: Unigenes/Assembled ESTs; Redundancy: 1-Novelty Gene Primer Sequence(5 -3 ) Astacidin Astacidin-F ATGCGTCTTCTCCATCTCC Astacidin-R TTACTTGCCTGGACGGTA Anti lipopolysaccharide factor ALF-F CCGCCTCCTTCACCCCACA ALF-R TCCACCTCACCGTTCCGCC Crustin1 Crustin1-F TATTCCTCGCTGCACAAACA Crustin1-R CACATAGCACCTCCCTCTCA Crustin2 Crustin2-F GGGAAGAAAAGCACAATGGT Crustin2-R GGTATGGAGGTCGAGACAGG Digestivecysteine protease Dcysp-F AAGTATGTTGACGCAGAGGAGG Dcysp-R AAATTGGTTCATTGCCAGGTTG H3 histone family 3A H3-F GTCACCATCATGCCCAAGGATA H3-R GCCAGCACTGCGAAGTCAATTC Lectin Lectin-F GTTATTGACGACTCCACCTT Lectin-R GTCTTCCCATTGACCCACTT Serine/threonine protein kinase SPK-F TGCTATGTGAAGCTCGGCTCT SPK-R: GCGATCTGATGCTCCTCCTCT TGF beta-inducible nuclear protein TGFINP-F GCCTGGGTGCTGGTATCTTGG TGFINP-R GTTCGTTCTGTGGCATTGTGT Tar RNA binding protein TRBP-F AAAATGTATCGTCAACCACCAC TRBP-R CACCCTCTATCTGCAACAAGTC 18SRNA 18SRNA-F ACCGATTGAATGATTTAGTGAG 18SRNA-R TACGGAAACCTTGTTACGAC Description Number Total ESTs 10145 Low Quality ESTs 1030 High Quality ESTs 9115 Unigenes 3033 Contigs 859 Singlets 2174 Novelty (%) 33.27 Redundancy (%) 66.73 122 Fig. 1 The number of annotated unigenes with different E-values. crayfish (Pacifastacus leniusculus), narrow-fingered crayfish (Pontastacus leptodactylus), broad-fingered crayfish (Astacus fluviatilis), and California spiny lobster (Panulirus interruptus). About 68 of the unigenes have best hits and annotations against available databases, and the other 961 unigenes that have no hits may be undiscovered or unknown function genes in the database. A number of genes had identity scores of a given E value (1.00E 10). From the E-value distribution profile of all the annotated unigenes shown in Fig. 1, we could see that about 90 of the annotated unigenes had an E-value 1.00E 10, so the annotation results of the blast searches in three databases are believable. The most highly expressed gene is hemocyanin 2, and its contig contains 213 ESTs. In arthropods, hemocyanin is a multifunctional protein which can transport oxygen in the hemolymph, shows phenoloxidase activity in its proteolytically cleaved N-terminal, and the C-terminal part sequence serves as antimicrobial peptides (Lee et al., 2004). The hemocyanin of horseshoe crab could be directly activated by microbial protease and was enhanced by pathogen associated molecular patterns. The activated hemocyanin can generated highly reactive oxygen intermediates that kills microbes (Jiang et al., 2007). Therefore, hemocyanin plays important roles in the immune system of arthropods. Here we obtained 213 ESTs of hemocyanin in our cDNA library, and nine kinds of hemocyanin can be divided by alignment and phylogenetic analysis. This suggested that the hemocyanin might have function in antiviral immune response. Megalin is also a highly expressed gene which contains 152 ESTs. Megalin is a low-density lipoprotein receptor-related protein that is a cell surface endocytic receptor and could bind extracellular ligands for degradation (Li et al., 2001). Several proteases such as cathepsin L, trypsin, and zinc protease are all highly abundant expressed genes and have more than 100 ESTs. Table 3 Analysis of unigenes including contigs and singlets Max Unigene Size：213 *Unigene Size: The Number of ESTs in a Unigene Unigene Size Number of Unigenes Percent of Unigenes(%) 1 2174 71.68 2 358 11.8 3 157 5.18 4–5 116 3.82 6–10 103 3.4 11–20 60 1.98 21–50 40 1.32 51–100 17 0.56 >100 8 0.26 123 Genes potentially involved in the defense reactions Hemocytes and hepatopancreas are important immune-related cells and organs in arthropods, and 33 differentially expressed genes have been discovered in hemocytes of WSSV-challenged crayfish by suppression subtractive hybridization (SSH) and cDNA microarrays (Zeng et al., 2009). Many upregulated genes in the SSH library such as serine protease inhibitor, tubulin, zinc finger protein, synaptosome-associated protein, fatty acid binding protein, superoxide dismutase precursor, arginine kinase, and heat shock protein were also found in our cDNA library from hemocytes and hepatopancreas of WSSV-challenged red swamp crayfish. Among the newly discovered genes of our cDNA library, there are many genes potentially involved in the defense reaction of crayfish (Table 4). They could be assembled into seven groups such as antimicrobial peptides, pattern recognition receptors, proteases and protease inhibitors, signal transduction proteins, apoptosis-related proteins, antioxidant proteins, and others which could not be classified into groups. Antimicrobial peptides In this cDNA library, five kinds of antimicrobial peptides have been found, including anti-lipopolysaccharide factor (ALF), astacidin, lysozymes, single WAP domain-containing protein, and crustins. ALFs are potential antimicrobial peptides which could bind to the lipopolysaccharide (LPS) from the cell wall of Gram-negative bacteria and inhibit the LPS-mediated coagulation cascade in arthropod (Rosa et al., 2008). ALF could interfere with WSSV replication in crayfish Pacifastacus leniusculus and protect shrimp from WSSV infection (Liu et al., 2006). ALF was upregulated in hemocytes 96 h after WSSV challenge in qRT-PCR analysis (Fig. 2A), and it may be related to the anti-WSSV reaction in crayfish P. clarkii. Astacidin 2 is a small proline/arginine-rich antibacterial peptide that shows strong antimicrobial activity against Gram-positive and Gram-negative bacteria, and has been purified from the hemolymph of freshwater crayfish P. leniusculus (Jiravanichpaisal et al., 2007). It was upregulated in hemocytes 96 h after WSSV challenge (Fig. 2B). Lysozymes are well known antimicrobial proteins that show lytic activity to a range of Gram-positive and Gram-negative bacteria (de-la-Re-Vega et al., 2006). Both the single WAP domain-containing protein (SWD) and two crustins belong to the WAP-containing proteins were also found in the crayfish. SWD was upregulated in the WSSV-challenged shrimp (Amparyup et al., 2008; Du et al., 2010). Crustins are a large antimicrobial peptide family. They can be divided into three groups according to structural characters (Smith et al., 2008). From an antimicrobial experiment in vitro, we could see that crustins mainly showed strong bactericidal activity against Gram-positive bacteria and Gram-negative bacteria so far (Amparyup et al., 2008; Smith et al., 2008). Also in vivo experiment showed that after crustin was depleted, the mortality increased significantly after shrimp were infected by V. penaeicida (Shockey et al., 2009). Crustin 2 is a kind of carcinin like protein. Crustin 1 and Crustin 2 belong to different groups. Crustin 1 was upregulated and crustin 2 was downregulated in hemocytes 96 h after challenge of WSSV (Figs 2C, D). Pattern recognition receptors (PRRs) In invertebrates, pattern recognition receptors can recognize and bind molecules present on the surface of pathogens such as -1,3-glucans, lipopolysaccharides, lipoteichoic acid, and peptidoglycans, which are called pathogen-associated molecular patterns (Janeway, 1989). We discovered several kinds of pattern recognition receptors including C-type lectins, -1,3-glucan binding protein, lipopolysaccharide and -1,3-glucan binding protein, and LysM and putative peptidoglycan binding domain-containing protein. C-type lectins have been reported to participate in the innate defense reaction of nonself recognition by recognizing and binding to the molecules on the surfaces of cell walls and then inducing pathogen phagocytosis and agglutination (Sun et al., 2007; Ma et al., 2008). Reports on Chinese shrimp showed that C-type lectin served not only as a pattern recognition receptor but also an effector (Sun et al., 2008). C-type lectin from the shrimp Litopenaeus vannamei also has activity against WSSV (Zhao et al., 2009). A C-type lectin was downregulated 96 h after WSSV injection, which was the same pattern as a C-type lectin, PmAV, from Penaeus monodon (Leu et al., 2007) (Fig. 2E). In crustaceans, -1,3-glucan binding protein (BGBP) and lipopolysaccharide and -1,3-glucan binding protein (LGBP) serve as pattern recognition receptors to recognize cell wall components of bacteria and fungi, such as -1,3-glucans and lipopolysaccharide. BGBP binding to -1,3-glucan induces hemocyte degranulation and subsequently activates the prophenoloxidase (proPO) system (Lin et al., 2008). LGBP from the crayfish P. leniusculus have been reported to participate in the activation of the proPO system (Lee et al., 2000). Proteases and protease inhibitors The hepatopancreas was reportedly the site of synthesis of digestive enzymes in crustaceans. Several protease and protease inhibitors were found in the crayfish. The proteases include astacin, zinc protease, zinc metalloproteinase, cathepsin, cysteine protease, carboxypeptidase, and trypsin. The protease inhibitors include three kinds of serine protease inhibitors such as hemocyte-specific Kazal-type protease inhibitor, hepatopancreas Kazal-type protease inhibitor, and the putative serine protease inhibitor serpin. Astacin is a small zinc protease that can digest fibrillar collagen and other proteins (Reyda et al., 1999). It was significantly upregulated by bacterial or LPS challenge in oyster (Roberts et al., 2009). Zinc metalloproteinase is a protease family involved in growth factor activation, polypeptide degradation and extracellular protein processing (Bond et al., 1995). Trypsin is one of the most important proteases and contributes about 6 % of soluble protein in the 124 Table 4 Genes potentially included in innate immune response systems Gene name Species most similar to E-value No. of ESTs Antibacterial peptide Pl-crustin 1 Pacifastacus leniusculus 2E-37 3 Pl-crustin 2 Pacifastacus leniusculus 3E-13 2 anti-lipopolysaccharide factor Pacifastacus leniusculus 1E-19 3 astacidin 2 Pacifastacus leniusculus 4E-20 1 Lysozyme precursor Crassostrea gigas 2E-06 2 single WAP domain-containing protein Marsupenaeus japonicus 1E-09 1 Pattern recognition receptor C-type lectins Fenneropenaeus chinensis 2E-06 72 -1,3-glucan binding protein Penaeus monodon 1E-11 5 Lipopolysaccharide and -1,3-glucan binding protein Pacifastacus leniusculus 7E-56 1 Proteases/protease inhibitors Astacin Astacus fluviatilis 5E-96 1 zinc proteases Astacus astacus 4E-25 123 Trypsin Pacifastacus leniusculus 1E-12 124 cysteine protease Homarus americanus 4E-11 60 cathepsin C Marsupenaeus japonicus 7E-44 1 cathepsin D Apriona germari 8E-34 1 cathepsin L Nephrops norvegicus 2E-16 141 carboxypeptidase A1 Scophthalmus maximus 4E-06 1 carboxypeptidase B Astacus fluviatilis 7E-20 7 carboxypeptidase A5 precursor Mus musculus 1E-06 8 Serine carboxypeptidase precursor Mus musculus 3E-10 3 semigranular hemocyte specific Kazal-type protease inhibitor Pacifastacus leniusculus 3E-13 1 hepatopancreas Kazal-type protease inhibitor Penaeus monodon 1E-07 17 zinc metalloproteinase Caenorhabditis elegans 2E-07 1 putative serine protease inhibitor serpin Pacifastacus leniusculus 4E-21 1 Signal transduction proteins Ras-related protein Rab-1A Lymnaea stagnalis 2E-40 3 Ras-related protein Rab-18 Gallus gallus 2E-63 1 Ras-related protein Rab-5B Pongo pygmaeus 2E-49 1 Ras-related protein Rab-7a Rattus norvegicus 3E-34 1 Ras-related GTP-binding protein C Mus musculus 1E-10 1 Ras-like GTP-binding protein Rho1 isoform 1 Apis mellifera 2E-25 2 125 Rho family small GTP binding protein cdc42 Nasonia vitripennis 6E-69 1 vacuolar ATPase G subunit-like protein Maconellicoccus hirsutu 2E-19 1 Nucleolar GTP-binding protein 1 Homo sapiens 2E-56 1 GTP-binding nuclear protein Ran (GTPase Ran) Xenopus tropicalis 2E-45 3 Ran-binding protein 16 Mus musculus 7E-51 1 protein kinase N2 Tribolium castaneum 2E-38 1 receptor for activated protein kinase C-like protein Lepeophtheirus salmonis 9E-73 1 Toll-like receptor Anopheles gambiae 1E-06 2 Relish Litopenaeus vannamei 2E-25 1 Insulin like growth factor binding protein Mus musculus 2E-10 1 Casein kinase I isoform alpha Xenopus laevis 2E-06 1 mitogen-activated protein-binding protein-interacting protein Nasonia vitripennis 5E-29 1 Serine/threonine-protein phosphatase PP2A Drosophila melanogaster 1E-25 1 Arginine kinase Homarus gammarus 3E-46 6 Serine/threonine-protein kinase N2 Homo sapiens 2E-38 1 Apoptosis senescence-associated protein Pisum sativum 1E-19 2 zinc finger protein Xenopus laevis 2E-11 3 Antioxidation thioredoxin-like protein Maconellicoccus hirsutus 4E-33 1 thioredoxin domain containing 11 isoform 1 Apis mellifera 1E-31 1 thioredoxin reductase 1 Rattus norvegicus 9E-08 1 superoxide dismutase Pontastacus leptodactylus 6E-18 1 glutathione peroxidase 5 Mus musculus 1E-09 23 glutathione peroxidase 1 Canis familiaris 4E-21 14 ferritin Pacifastacus leniusculus 1E-09 11 glutathione S-transferase Mu 2 Mus musculus 1E-32 6 glutathione-S-transferase-like protein Galleria mellonella 4E-40 1 glutathione S-transferase 1-1 (GST class-theta) Tribolium castaneum 1E-36 1 glutamine synthetase Panulirus argus 1E-42 1 Microsomal glutathione S-transferase 3 Mus musculus 1E-24 1 Putative thiosulfate sulfurtransferase FMP31 Saccharomyces cerevisiae 2E-13 1 omega class glutathione S-transferase Crassostrea gigas 1E-27 1 farnesoic acid O-methyltransferase Marsupenaeus japonicus 4E-08 6 O-methyltransferase Fenneropenaeus chinensis 5E-25 1 Acyl-Coenzyme A oxidase 3 Strongylocentrotus purpuratus 9E-07 1E-12 2 126 digestive gland. Trypsins as important digestive proteases mainly take part in food digestion, hydrolysis, and activation of zymogens (Muhlia-Almazan et al., 2008). Three kinds of cathepsins have been discovered in the crayfish, including cathepsin C, cathepsin D, and cathepsin L. Cathepsin C is a multifunctional protease and is essential for the activation of other enzymes (Turk et al., 2001). Cathepsin D is an aspartic protease involved in several physiological functions such as protein degradation, apoptosis and autophagy (Zaidi et al., 2008). Cathepsin L could digest food in the gastrointestinal juice of crustaceans (Hu et al., 2007). A digestive cysteine protease was downregulated 96 h after WSSV injection (Fig. 2F). Carboxypeptidases are hydrolases that cleave in the C-terminus of proteins. Carboxypeptidases A and B are digestive carboxypeptidases and serve in the degradation of proteins in the digestive tract. Serine protease inhibitors of arthropods include the Kazal, Kunitz, -macroglobulin, and serpin families. They play important roles in prophenoloxidase and cytokine activation, blood coagulation, and pathogen digestion. Three kinds of serine protease inhibitors including hemocyte-specific Kazal-type protease inhibitor, hepatopancreas Kazal-type protease inhibitor, and the putative serine protease inhibitor serpin have been isolated from this library. Kazal-type protease inhibitors have been found in the hemocytes of shrimp, and were suggested to be involved in the host defense against WSSV challenge (Jarasrassamee et al., 2005). Serpin from hemocytes cDNA library of Chinese shrimp has been shown to fluctuate after WSSV and bacteria challenges (Liu et al., 2009). Proteins in signal transduction pathway Ras-related protein Rab, Ran-binding protein, and Ras-like GTP-binding protein Rho were found in the cDNA library; they all belong to the Ras-related protein superfamily. The Ras family of small GTPases plays roles in a series of cellular processes such as phagocytosis, vesicle transportation, and development. Rab GTPase from Japanese shrimp participates in the defense response to virus and might function as an intracellular virus recognition protein in virus-infected shrimp (Wu et al., 2008). Moreover Ran from Japanese shrimp is involved in antiviral defense immunity and could regulate hemocytic phagocytosis by interacting with myosin (Liu et al., 2009). The studies of Rho GTPase have mainly focused on phagocytosis and actin dynamics control (Pan et al., 2005). Toll is a receptor of the Toll signal pathway responsible for antifungal and anti-Gram-positive bacterial response in Drosophila. Toll like receptor from invertebrates could not bind pathogens directly, but it was activated by binding to Spaetzle (Hoffmann, 2003). It was also found in the crayfish cDNA library. Relish is a downstream NF- B transcription factor in the Imd signal pathway. The translocation of cleaved Relish to the nucleus could activate the signal pathway (Hoffmann, 2003). This means that the Toll and Imd pathways might existed in the crayfish, and the pathways might have functions in antiviral responses. Insulin-like growth factor binding protein (IGFBP) was also found in the crayfish. It is a member of the Others LysM and putative peptidoglycan binding domain containing protein Xenopus tropicalis 4E-09 1 megalin Danio rerio 1E-16 152 hemocyanin 2 Pacifastacus leniusculus 2E-15 213 ATP-dependent RNA helicase Mus musculus 1E-23 6 PAZ and PIWI domain protein/ Piwi-like protein Paramecium tetraurelia 5E-19 1 Cuticle protein 6 Blaberus craniifer 2E-11 1 Crustacean calcium-binding protein 23 Orconectes limosus 2E-46 1 heat shock 70 kDa protein Blastocladiella emersonii 4E-37 3 heat shock protein 27 Drosophila melanogaster 2E-06 1 TGF beta-inducible nuclear protein Brugia malayi 8E-07 1 H3 histone family 3A Salmo salar 3E-29 1 tar RNA binding protein Fenneropenaeus chinensis 1E-09 1 chitinase Fenneropenaeus chinensis 9E-14 43 127 insulin-like growth factor pathway. The insulin-like growth factor pathway takes part in growth and development, metabolic homeostasis, fecundity and stress resistance, and also lifespan in multicellular organisms (Broughton et al., 2009). Serine/threonine-protein kinases and phosphatases play roles in signal transduction of anoxia in the crayfish Orconectes virilis (Cowan et al., 2001). Serine/threonine-protein kinase N2 and serine/threonine-protein phosphatase PP2A were isolated from our cDNA library. Casein kinase1 is a member of the serine/threonine protein kinase family, and it has seven isoforms in mammals and vertebrates. Casein kinase1 could enhance receptor interacting protein-mediated NF- B activation (Wang et al., 2008). The mRNA expression level of serine/threonine-protein kinase N2 from this cDNA library increased 96 h after WSSV injection (Fig. 2G), and it may be involved in the antiviral innate immune reaction of crayfish. The transforming growth factor (TGF- ) signal pathway plays important roles in diverse biological processes. In Caenorhabditis elegans, the TGF- pathway participates in immune responses (Schulenburg et al., 2004). TGF beta-inducible nuclear protein could be induced by stimulation of TGF- , so it may be involved in the defense reaction. TGF beta-inducible nuclear protein was upregulated in hemocytes of crayfish after WSSV challenge, so it may participate in the anti-virus immune response (Fig. 2H). Apoptosis-related proteins A senescence-associated protein was also found from this cDNA library. The senescence-associated protein takes part in the early embryonic development of silkworm Bombyx mori (Hong et al., 2006). Several zinc finger proteins were also found in the library, just as in the SSH library of hemocytes from WSSV-challenged crayfish. One zinc finger protein could bind to viral mRNA and prevent its accumulation in the cytoplasm (Garcia et al., 2007). Thus the zinc finger proteins of our cDNA library may be involved in the anti-virus immune defense reaction of crayfish. Antioxidant proteins Reactive oxygen species, the products of normal aerobic metabolism, can cause oxidative damage to organisms. Antioxidant proteins are needed to eliminate the reactive oxygen species and regulate the redox homeostasis. To protect against damage and regulate redox homeostasis, molecules in the glutaredoxin and thioredoxin systems are employed. Glutaredoxins and thioredoxins are conserved proteins involved in many cellular processes including repair of oxidatively damaged proteins and protein refolding and regulation (Grant, 2001). The thioredoxin system contains thioredoxin and thioredoxin reductase, and thioredoxin is catalyzed directly by thioredoxin reductase and electrons from nicotinamide adenine dinucleotide (NADH) (Aispuro-Hernandez et al., 2008). By the random sequencing of the cDNA library, thioredoxin-like proteins and thioredoxin reductase were isolated from the WSSV-challenged crayfish. Thioredoxin was characterized in Pacific white shrimp (L. vannamei) and the antioxidant activity of the recombinant protein was tested by reducing insulin disulfides using the Trolox Equivalent Antioxidant Capacity assay. The results showed that thioredoxin is an important antioxidant (Aispuro-Hernandez et al., 2008). Glutathione peroxidase is a component of the glutaredoxin system. Glutathione S-transferases belong to a multigene family that plays important roles in detoxification of xenobiotic compounds (Rosa de Lima et al., 2002). A selenium-dependent glutathione peroxidase and two glutathione S-transferases have been cloned from Chinese shrimp and were involved in detoxification defense reactions (Ren et al., 2009). A glutamine synthetase was also found in this library. Superoxide dismutase is a kind of antioxidant enzyme. It was also found in the SSH library of WSSV-challenged crayfish and upregulated after virus injection (Zeng et al., 2009). Ferritin is an iron storage protein that participates in iron metabolism and detoxification. Ferritins from shrimp have been reported to be involved in the anti-virus defense reaction (Zhang et al., 2006). Others LysM and putative peptidoglycan binding domain-containing protein (PBP) has not been found in crustaceans so far, so this PBP may be the first one. It may also be involved in the innate immune reaction in crayfish. We found PAZ and PIWI domain protein and ATP-dependent RNA helicase, which are involved in RNA-mediated silencing and the defense response against viruses (Cerutti et al., 2006). In humans, the trans-activation response (Tar) RNA-binding protein plays a role in passing small interfering RNA to the RNA-induced silencing complex and functions in RNA interference(Wang et al., 2009a). A tar RNA binding protein was found in the cDNA library; it was upregulated after WSSV challenge in the hemocytes of crayfish (Fig. 2I), so it may take part in the antiviral immune reaction. Chitinases are members of the glycoside hydrolase family. It has been reported that in the mollusc Crassostrea gigas, two chitinases are stimulated in response to LPS challenge, which suggested that they are involved in the immune defense reaction of oyster (Badariotti et al., 2007). Chitinase was upregulated in hepatopancreas of WSSV-resistant shrimp (Pan et al., 2005). Cuticle protein and crustacean calcium-binding protein were also found by an EST approach in the WSSV-infected shrimp P. mondon. Calcium-binding proteins act as cytosolic Ca 2 buffers and were significantly downregulated in WSSV-injected shrimp (Leu et al., 2007). A calcium-binding peptide from the exoskeleton of crayfish functions as a regulator of exoskeleton calcification (Inoue et al., 2004). Cuticle proteins were upregulated as a result of WSSV infection, as the WSSV mainly infects the cuticular epidermis in shrimp (Leu et al., 2007). Heat shock proteins are members of the chaperone family and take part in protein folding. In shrimp, heat shock protein 70 expression was influenced by WSSV infection, and the association 128 Fig. 2 qRT-PCR analysis of ten genes in total RNA extracted from red swamp crayfish hemocytes 96 h after WSSV challenge. The qRT-PCR data of the expression level of these genes in response to bacterial and viral challenge were calculated by 2 -∆∆Ct . Bars stand for the mean±SD. of three independent PCR amplifications and quantifications. The data obtained were subjected to the statistical analysis followed by an unpaired sample t-test. Asterisks indicate significant differences (*P<0.05) when comparing to that in the healthy hemocytes (0 h). Astacidin (GenBank accession no. GQ301199); crustin 1 (GenBank accession no. GQ301201); crustin 2 (GenBank accession no. GQ301202); Anti-lipopolysaccharide factor (ALF) HM005306; Digestive cysteine proteinase HM005305; H3 histone family protein HM005304;Serine/threonine protein kinase(SER) HM005303; TGF beta-inducible nuclear protein HM005302; Tar RNA binding protein (TRBP)HM005301; Lectin HM005300. 129 between the major envelope protein VP28 of WSSV and heat shock protein 70 is direct and ATP-dependent (Xu et al., 2009). Heat shock protein 70 was upregulated after WSSV infection and involved in the anti-virus response in crayfish (Zeng et al., 2009). Another heat shock protein of this cDNA library showed similarity to heat shock protein 27 from Drosophila melanogaster, and it had anti-apoptotic activity by inhibition of cytochrome C and TNF-mediated cell death (Arya et al., 2007). Histones are basic protein components of chromatin. As early as 1942, some reports showed that histone possessed antibacterial properties (Miller et al., 1942). Recent work demonstrate that the histones and histone-derived fragments have antimicrobial activities in diverse range of organisms from shrimp to human (Kawasaki and Iwamuro, 2008). The H3 family contains two replacement histone genes, H3 histone family 3A and 3B. Here we found a H3 histone family 3A. It was upregulated after WSSV infection (Fig. 2J). It was reported that histone H2B could mediate anti-virus immune defense reactions, so the upregulation of H3 histone 3A may also be involved in the antiviral defense reaction of crayfish (Kobiyama et al., 2010). Acknowledgements The authors thank all other laboratory members for some data analysis and helpful discussions. This work was supported by grants from the National High Technology Research and Development Program of China (863 Program) (No. 2007AA09Z425, 2006CB101806), the National Natural Science Foundation of China (No. 30770282). References Amparyup P, Donpudsa S, Tassanakajon A. Shrimp single WAP domain (SWD)-containing protein exhibits proteinase inhibitory and antimicrobial activities. Dev. Comp. Immunol. 32: 1497-509, 2008. Amparyup P, Kondo H, Hirono I, Aoki T, Tassanakajon A. Molecular cloning, genomic organization and recombinant expression of a crustin-like antimicrobial peptide from black tiger shrimp Penaeus monodon. Mol. Immunol. 45: 1085-1093, 2008. Aispuro-Hernandez E, Garcia-Orozco KD, Muhlia-Almazan A, Del-Toro-Sanchez L, Robles-Sanchez RM, Hernandez J, et al. Shrimp thioredoxin is a potent antioxidant protein. Comp. Biochem. Physiol. 148C: 94-99, 2008. Arya R, Mallik M, Lakhotia SC. Heat shock genes - integrating cell survival and death. J. Biosci. 32: 595-610, 2007. Badariotti F, Lelong C, Dubos MP, Favrel P. Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas. FEBS J. 274: 3646-3654, 2007. Bond JS, Beynon RJ. The astacin family of metalloendopeptidases. Protein Sci. 4: 1247-1261, 1995. Broughton S, Partridge L. Insulin/IGF-like signalling, the central nervous system and aging. Biochem. J. 418: 1-12, 2009. Burge EJ, Madigan DJ, Burnett LE, Burnett KG. Lysozyme gene expression by hemocytes of Pacific white shrimp, Litopenaeus vannamei, after injection with Vibrio. Fish Shellfish Immunol. 22: 327-339, 2007. Cerutti H, Casas-Mollano JA. On the origin and functions of RNA-mediated silencing: from protists to man. Curr. Genet. 50: 81-99, 2006. Cowan KJ, Storey KB. Protein kinase and phosphatase responses to anoxia in crayfish, Orconectes virilis: purification and characterization of cAMP-dependent protein kinase. Comp. Biochem. Physiol. 130B: 565-577, 2001. de-la-Re-Vega E, Garcia-Galaz A, Diaz-Cinco ME, Sotelo-Mundo RR. White shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae. Fish Shellfish Immunol. 20: 405-408, 2006. Du ZQ, Li XC, Wang ZH, Zhao XF, Wang JX. A single WAP domain (SWD)-containing protein with antipathogenic relevance in red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol. 28: 134-142, 2010. Garcia CC, Damonte EB. Zn finger containing proteins as targets for the control of viral infections. Infect. Disord. Drug Targets 7: 204-212, 2007. Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev. Comp. Immunol. 25: 565-577, 2001. Hoffmann JA. The immune response of Drosophila. Nature 426: 33-38, 2003. Hong SM, Nho SK, Kim NS, Lee JS, Kang SW. Gene expression profiling in the silkworm, Bombyx mori, during early embryonic development. Zoolog. Sci. 23: 517-528, 2006. Hu KJ, Leung PC. Food digestion by cathepsin L and digestion-related rapid cell differentiation in shrimp hepatopancreas. Comp. Biochem. Physiol. 146B: 69-80, 2007. Inoue H, Ohira T, Ozaki N, Nagasawa H. A novel calcium-binding peptide from the cuticle of the crayfish, Procambarus clarkii. Biochem. Biophys. Res. Commun. 318: 649-654, 2004. Janeway CA, Jr. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 54 Pt 1: 1-13, 1989. Jarasrassamee B, Supungul P, Panyim S, Klinbunga S, Rimphanichayakit V, Tassanakajon A. Recombinant expression and characterization of five-domain Kazal-type serine proteinase inhibitor of black tiger shrimp (Penaeus monodon). Mar. Biotechnol. (NY) 7: 46-52, 2005. Jiang N, Tian NS, Ho B, Ding JL. Respiratory protein-generated reactive oxygen species as an antimicrobial strategy. Nat. Immunol. 8: 1114-1122, 2007. http://www.ncbi.nlm.nih.gov/pubmed?term=%22Amparyup%20P%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract http://www.ncbi.nlm.nih.gov/pubmed?term=%22Donpudsa%20S%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tassanakajon%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract javascript:AL_get(this,%20'jour',%20'Dev%20Comp%20Immunol.'); 130 Jiravanichpaisal P, Lee SY, Kim YA, Andren T, Soderhall I. Antibacterial peptides in hemocytes and hematopoietic tissue from freshwater crayfish Pacifastacus leniusculus: characterization and expression pattern. Dev. Comp. Immunol. 31: 441-455, 2007. Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 32: D277-280, 2004. Kobiyama K, Takeshita F, Jounai N, Sakaue-Sawano A, Miyawaki A, Ishii KJ, et al. Extrachromosomal histone H2B mediates innate antiviral immune responses induced by intracellular double-stranded DNA. J. Virol. 84: 822-832, 2010. Lee SY, Lee BL, Soderhall K. Processing of crayfish hemocyanin subunits into phenoloxidase. Biochem. Biophys. Res. Commun. 322: 490-496, 2004. Lee SY, Wang R, Soderhall K. A lipopolysaccharide- and beta-1,3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization, and cDNA cloning. J. Biol. Chem. 275: 1337-1343, 2000. Leu JH, Chang CC, Wu JL, Hsu CW, Hirono I, Aoki T, et al. Comparative analysis of differentially expressed genes in normal and white spot syndrome virus infected Penaeus monodon. BMC Genomics 8: 120, 2007. Li Y, Cam J, Bu G. Low-density lipoprotein receptor family: endocytosis and signal transduction. Mol. Neurobiol. 23: 53-67, 2001. Lin YC, Vaseeharan B, Chen JC. Identification and phylogenetic analysis on lipopolysaccharide and beta-1,3-glucan binding protein (LGBP) of kuruma shrimp Marsupenaeus japonicus. Dev. Comp. Immunol. 32: 1260-1269, 2008. Liu H, Jiravanichpaisal P, Soderhall I, Cerenius L, Soderhall K. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J. Virol. 80: 10365-10371, 2006. Liu W, Han F, Zhang X. Ran GTPase Regulates Hemocytic Phagocytosis of Shrimp by Interaction with Myosin. J. Proteome Res. 8: 1198-1206, 2009. Liu Y, Li F, Wang B, Dong B, Zhang X, Xiang J. A serpin from Chinese shrimp Fenneropenaeus chinensis is responsive to bacteria and WSSV challenge. Fish Shellfish Immunol. 26: 345-351, 2009. Ma TH, Benzie JA, He JG, Chan SM. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J. Invertebr. Pathol. 99: 332-341, 2008. Miller B, Abrams R, Dorfman A, Klein M. Antibacterial properties of protamines and histone. Science 96: 428-430,1942. Muhlia-Almazan A, Sanchez-Paz A, Garcia-Carreno FL. Invertebrate trypsins: a review. J. Comp. Physiol. [B] 178: 655-672, 2008. Pan D, He N, Yang Z, Liu H, Xu X. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev. Comp. Immunol. 29: 103-112, 2005. Ren Q, Sun RR, Zhao XF, Wang JX. A selenium-dependent glutathione peroxidase (Se-GPx) and two glutathione S-transferases (GSTs) from Chinese shrimp (Fenneropenaeus chinensis). Comp. Biochem. Physiol. 149C: 613-623, 2009. Reyda S, Jacob E, Zwilling R, Stocker W. cDNA cloning, bacterial expression, in vitro renaturation and affinity purification of the zinc endopeptidase astacin. Biochem. J. 344 Pt 3: 851-857, 1999. Roberts S, Goetz G, White S, Goetz F. Analysis of Genes Isolated from Plated Hemocytes of the Pacific Oyster, Crassostreas gigas. Mar. Biotechnol. (NY) 11: 24-44, 2009. Rosa de Lima MF, Sanchez Ferreira CA, Joaquim de Freitas DR, Valenzuela JG, Masuda A. Cloning and partial characterization of a Boophilus microplus (Acari: Ixodidae) glutathione S-transferase. Insect Biochem. Mol. Biol. 32: 747-754, 2002. Rosa RD, Stoco PH, Barracco MA. Cloning and characterisation of cDNA sequences encoding for anti-lipopolysaccharide factors (ALFs) in Brazilian palaemonid and penaeid shrimps. Fish Shellfish Immunol. 25: 693-696, 2008. Schulenburg H, Kurz CL, Ewbank JJ. Evolution of the innate immune system: the worm perspective. Immunol. Rev. 198: 36-58, 2004. Shi Z, Wang H, Zhang J, Xie Y, Li L, Chen X, et al. Response of crayfish, Procambarus clarkii, haemocytes infected by white spot syndrome virus. J. Fish Dis. 28: 151-156, 2005. Shockey JE, O'Leary NA, de la Vega E, Browdy CL, Baatz JE, Gross PS. The role of crustins in Litopenaeus vannamei in response to infection with shrimp pathogens: An in vivo approach. Dev. Comp. Immunol. 33: 668-673, 2009. Smith VJ, Fernandes JM, Kemp GD, Hauton C. Crustins: enigmatic WAP domain-containing antibacterial proteins from crustaceans. Dev. Comp. Immunol. 32: 758-772, 2008. Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterisation of a natural lectin from the serum of the shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 23: 292-299, 2007. Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreas-specific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis exhibits antimicrobial activity. Mol. Immunol. 45: 348-361, 2008. Turk D, Janjic V, Stern I, Podobnik M, Lamba D, Dahl SW, et al. Structure of human dipeptidyl peptidase I (cathepsin C): exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases. EMBO J. 20: 6570-6582, 2001. Wang S, Liu N, Chen AJ, Zhao XF, Wang JX. TRBP homolog interacts with eukaryotic initiation factor 6 (eIF6) in Fenneropenaeus chinensis. J. Immunol. 182: 5250-5258, 2009a. Wang S, Zhao XF, Wang JX. Molecular cloning and characterization of the translationally controlled 131 tumor protein from Fenneropenaeus chinensis. Mol. Biol. Rep. 36: 1683-1693, 2009b. Wang Y, Sun X, Wu J, Xu BE, Gu C, Wang H, et al. Casein kinase 1alpha interacts with RIP1 and regulates NF-kappaB activation. Biochemistry 47: 441-448, 2008. Wu W, Zong R, Xu J, Zhang X. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J. Proteome Res. 7: 424-431, 2008. Xu H, Yan F, Deng X, Zou T, Ma X, Zhang X, et al. The interaction of white spot syndrome virus envelope protein VP28 with shrimp Hsc70 is specific and ATP-dependent. Fish Shellfish Immunol. 26: 414-421, 2009. Yan DC, Dong SL, Huang J, Zhang JS. White spot syndrome virus (WSSV) transmission from rotifer inoculum to crayfish. J. Invertebr. Pathol. 94: 144-148, 2007. Zaidi N, Maurer A, Nieke S, Kalbacher H. Cathepsin D: a cellular roadmap. Biochem. Biophys. Res. Commun. 376: 5-9, 2008. Zeng Y, Lu CP. Identification of differentially expressed genes in haemocytes of the crayfish (Procambarus clarkii) infected with white spot syndrome virus by suppression subtractive hybridization and cDNA microarrays. Fish Shellfish Immunol. 26: 646-650, 2009. Zhang J, Li F, Wang Z, Zhang X, Zhou Q, Xiang J. Cloning, expression and identification of ferritin from Chinese shrimp, Fenneropenaeus chinensis. J. Biotechnol. 125: 173-184, 2006. Zhao ZY, Yin ZX, Xu XP, Weng SP, Rao XY, Dai ZX, et al. A novel C-type lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J. Virol. 83: 347-356, 2009.