sek-1 is important in tissue-specific regulation of innate immunity during the Xoo infection in the model host Caenorhabditis elegans ISJ 11: 228-239, 2014 ISSN 1824-307X RESEARCH REPORT sek-1 is important in tissue-specific regulation of innate immunity during the Xoo infection in the model host Caenorhabditis elegans Y Bai1, D Zhi2, C Li1, D Liu1, H Ren2, C Gao2, X Wang2, Y Li2, Z Wu2, H Li1,2 1Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000, PR China 2School of Pharmacy, Lanzhou University, Lanzhou 730000, PR China Accepted August 23, 2014 Abstract Xanthomonas oryzae pv. Oryzae (Xoo) are plant pathogenic bacteria that can cause serious blight of rice. We have demonstrated that Xoo can infect the model organism C. elegans and p38 MAPK pathway plays specific roles in defense against the pathogen in our previous paper. Based on that p38 MAPK pathway can be activated in a range of tissues, it is intriguing to compare the tissue-specific activities of this pathway in host innate immunity. Here, transgenic worms that sek-1 expressed specifically in neurons system, ciliated sensory neurons, and intestine respectively are used to determine the nematode survival and transcriptional levels of immune-related genes. We report that SEK-1 and TOL-1 are not involved in C. elegans avoidance behavior, and ingestion of nematodes is related to the aversion and also the characteristics of bacteria. In addition, tol-1 and sek-1 participate the immune response to the infection by Xoo; sek-1 also exhibits tissue-specific activities in host innate immunity. Our findings suggest that overlapping immune effect may exist between the tol-1 and sek-1. Key Words: C. elegans; tol-1; sek-1; tissue-specific activity; innate immunity Introduction Caenorhabditis elegans is a bacterivore species so that microbes represent both nutrient sources and also potential infection sources (Garsin et al., 2001). Diverse infection modes by pathogens have been reported in C. elegans (Pujol et al., 2008; Irazoqui et al., 2010). When infection happens, C. elegans appears to initiate behavioral defenses such as avoidance and reducing digestion rates (Hasshoff et al., 2007; Schulenburg and Ewbank, 2007). In addition, C. elegans are known to regulate physiological processes including innate immunity through activating conserved neuroendocrine signal and neuropeptides (Styer et al., 2008). A complex innate immune response is involved in the ___________________________________________________________________________ Corresponding author: Hongyu Li Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution School of Life Sciences School of Pharmacy Lanzhou University Tianshui South Road No. 222 Lanzhou 730000, PR China E-mail address: lihy@lzu.edu.cn infection, evolutionary conserved signaling pathways, such as Toll-like receptor (TLR) signaling pathway and p38 MAPK pathway are employed to defense the pathogens invasion (Akira et al., 2006). tol-1, a component of Toll signaling pathway, encodes a TLR, functions in pathogen recognition and thus enables C. elegans to avoid a potential pathogen (Pujol et al., 2001). Aversion behavior indicates the favor of worm to the bacteria; it may also influence the ingestion of nematode. As the only TLR gene in C. elegans, however, tol-1 appears to play no roles in innate immunity (Kanzok et al., 2004). Nevertheless, TOL-1 is required for proper innate immunity in the presence of certain Gram-negative bacteria but it does not have a universal immune protection against pathogens (Tenor and Aballay, 2007). C. elegans has no specialized immune cells like vertebrate for resisting pathogens, the antimicrobial genes are expressed in tissues where the site is exposed to the pathogen infection environment (Alper et al., 2007), including the tissues that are in contact with the exterior or ingested microbes. Digestive tract (pharynx and intestine) is the primary route of infection (Alegado et al., 2003; Tenor and Aballay, 2007), and is considered as the typical infection model to investigate the immune response. 228 mailto:lihy@lzu.edu.cn a) b) c) Fig. 1 tol-1 and sek-1 were not involved in aversion behavior. a) Wild type N2 worms avoided JXOIII and E. faecalis markedly. b) sek-1 mutants exhibited similar tendency while E. faecalis induced stronger avoidance. c) tol-1 mutation had no influence on the avoidance to the bacteria we examined. Chemosensory system with the sensory cilia enables the worm to detect the various cues of food and danger, and then elicit chemotaxis or avoidance behavior (Bargmann, 2006). Nervous system regulates the innate immune responses to maintain the delicate balance between infection and health (Kawli et al., 2010). It is obvious that multiple immune pathways are activated upon encountering a single pathogen in C. elegans and the host can distinguish different pathogens and elicit specific responses (Bogaerts et al., 2010). The NSY-1-SEK-1-PMK-1 p38 MAPK pathway mediates resistance to bacterial pathogens and sek-1 mutants have enhanced susceptibility to pathogens (Kim et al., 2004). p38 MAPK pathway is not involved in aversion behavior, but SEK-1 229 contributes to this physiological process in response to certain functional classes of gene inactivation by RNAi (Melo and Ruvkun, 2012). SEK-1 activities in different tissues exhibit specific patterns in modulating immune responses to infection. In sensory nervous system, SEK-1 is required for a protective avoidance behavior to PA14, However, SEK-1 shows a cell-autonomous regulation in intestinal immunity (Shivers et al., 2009). Downstream effectors of p38 MAPK pathway like C17H12.8, F08G5.6, F56D6.2 and T24B8.5 act as immune-related genes, they are classified into CUB-like genes, C-type lectin genes and ShK toxin genes, respectively (Troemel et al., 2006). Based on the higher transcriptional levels (Troemel et al., 2006), we choose these genes to investigate the immune responses to pathogenic bacteria infection. Xanthomonas oryzae pv. Oryzae (Xoo) is a plant pathogen, Gram-negative, causes serious bacterial blight of rice (Hopkins et al., 1992). In our previous research, it is shown that Xoo can infect C. elegans and trigger innate immune responses to defense against the adverse effects on the host organism through up-regulating the downstream effectors. Given that immune-related components express in multiple tissues, different transgenic worms (Shivers et al., 2009) are used in our research. Here, we further report that aversion behavior is benefit for nematode survival and sek-1 is important in tissue-specific innate immunity in response to Xoo infection. Materials and Methods Bacteria and C. elegans strains The nematode strains of wild type N2, IG10 (tol-1(nr2033) I), ZD193 (sek-1(km4) X; qdEx4)， ZD202 (sek-1(km4) X; qdEx8), and ZD260 (sek-1(km4) X; qdEx11) were provided by the Caenorhabditis Genetics Center (CGC). KU4 (sek-1(km4) X) were kindly gifted from Ausubel Lab of Department of Molecular Biology, Massachusetts General Hospital. Xoo strains Philippine race PXO99 and Japonic race JXOIII, were kindly supplied by Prof. JS Wang, Key Laboratory of Monitoring and Management of Plant Diseases and Pests, Ministry of Agriculture, Department of Plant Protection, Nanjing Agricultural University (Li et al., 2007). E. coli OP50 and Enterococcus faecalis (ATCC29212) were used as positive and negative control, respectively. Xoo were maintained in nutrient agar (NA) liquid medium, E. faecalis was in Brain Heart Infusion (BHI) medium, and OP50 was in LB broth. Microbial avoidance assays Avoidance assays were generally performed as previously described (Melo and Ruvkun, 2012). Briefly, bacterial overnight cultures were concentrated 20×, and 50 ul aliquots were dropped in the centre of 3cm diameter NGM plates about 1 h before use. At least 50 synchronized L4 stage worms were dropped directly onto lawns and plates were scored for aversion (A = N off lawn/N total) at the time points of 1, 2, 4, 8, 16, 24 h. Three replica plates were prepared for each treatment and at least two independent trails were repeated. Nematode ingestion behavior Xoo strains were cultured at 28 °C and E. faecalis and E. coli OP50 were cultured at 37 °C until the logarithmic phase. L4 stage wild type N2 and sek-1 mutant worms were added to 96-wells plates contained the same known concentration bacterial cultures. Each well contained 70 - 80 worms and each treatment was performed in triplicate. For 24 h and 96 h, supernatants were collected to measure the OD600 and worms were obtained through centrifuging to test the total protein concentration by Lowry method. Bacterial consumption was determined by ΔOD600/protein (mg). Body length measurement sek-1 mutants were treated as ingestion assay described above. For 24 h and 96 h, worms were collected by centrifugation and washed twice in M9 buffer. The tube was heated to about 40 - 50 °C for several seconds to make the worms straight and easy to measure body length. Then worms were pipetted on a glass slide and covered with a coverglass. At least 30 worms were measured each group under a Motic microscope equipped with Motic Image software Advanced 3.2. Killing assays Killing assays were performed as described (Tan et al., 1999), modified with spotting a small lawn in the centre of the plates (Shivers et al., 2009). Then the plates were incubated overnight and equilibrated to the room temperature. L4 stage worms were picked to the assay plates and transferred to fresh bacterial plates every 48 h to eliminate newborn larvae. Assays for survival of ZD193, ZD202 and ZD260 were performed with big-lawn to exclude the interference of aversion. A total of 60-75 L4 larvae for each genotype were assayed in two independent trials. Worms were scored as dead and live every 24 h along the time course. Quantitative RT-PCR Synchronized eggs were seeded on E. coli OP50 plates until L4 larvae, RNA were extracted from L4 worms exposed to PXO99, JXOIII, E. faecalis and OP50 for 24 h using Triol (TaKaRa). cDNA was generated using the primescript RT reagent kit with gDNA Eraser (TaKaRa) as indicated by the manufacturer. The qRT-PCR was performed on a BIO-RAD S1000 Thermal Cycler using SYBR Premix Ex TaqTMⅡ(TaKaRa). Cycle threshold (Ct) values were normalized to act-3. Samples treated by pathogenic bacteria were compared to parallel samples feeding on E. coli OP50. Primers used were listed in Table 3. Statistics SPSS Ver. 17.0 was used for data processing; Kaplan-Meier method and log-rank test were adopted for statistical analysis. RT-PCR statistical tests were calculated from OP50-normalized cycle threshold values prior to conversion to relative fold change. The normalized values for induction expression for the 3 replicates were compared using a 1-sample t-test. 230 Results tol-1 and sek-1 are not involved in aversion behavior Previous work has shown that tol-1 is required for the worm avoidance behavior of pathogenic Serratia marcescens (Pujol et al., 2001), SEK-1 activity in the chemosensory neuron is necessary for protective avoidance response to Pseudomonas aeruginosa strain PA14 (Shivers et al., 2009). In our study, the regular food source OP50 exerted an attractive effect on wild type N2, as well as the Xoo strain PXO99, that was, nearly no aversion. However, E. faecalis and another Xoo strain JXOIII had a strong tendency to repel N2 worms (Fig. 1a). Avoidance worms for 16 h was shown in Figure 2, it also indicated that part of N2 worms were out of the JXOIII and E. faecalis bacterial lawns (Figs 2B, C) while almost all the worms still maintained in the PXO99 and OP50 lawns (Figs 2A, D). sek-1 and tol-1 mutation had no effect on the avoidance tendency against JXOIII and PXO99 (Figs 1b, c), suggesting that tol-1 and sek-1 were not involved in aversion behavior. Ingestion behavior is related to the body length and associate with the survival of worms Aversion behavior is a common response to products released by pathogen (Pradel et al., 2007), these substances may have an effect on ingestive efficiency of C. elegans (Schmeisser et al., 2013). Pathogenic bacterium itself also serves as cues to be detected and ingested. In our previous work, Xoo PXO99 and JXOIII can infect the C. elegans like E. faecalis (Bai et al., 2014). To determine whether nematode ingestion is related to the favor of pathogenic bacteria, we tested bacterial consumption for different time periods. Consistent with the tendency of avoidance, ingestion of JXOIII and E. faecalis by both N2 and sek-1 mutants were reduced remarkably for 24 h in contrast to their normal food source OP50 (Figs 3a, b). Bacteria that smelt or tasted unpleasantly might be avoided and not be taken up effectively (Kaletta and Hengartner, 2006). It indicated that nearly no aversion was occurred after the exposure to PXO99 like OP50 (Figs 1a, b), however, the consumption of PXO99 was significantly reduced for 24 h compared Fig. 2 Avoidance behavior of wild type N2 at the time point 16 h. Several worms were out of the bacterial lawns of JXOIII and E. faecalis while almost all the worms were within the PXO99 and OP50 lawns. (A): PXO99 (B): JXOIII (C): E. faecalis (D): OP50 to the control (Figs 3a, b). Thus, PXO99 could escape detection by C. elegans but pathogenic virulence of PXO99 induced the worm reducing uptaking. It is intriguing that PXO99 and JXOIII ingestion increased as time went on and JXOIII had no significant differences compared with control group in sek-1 mutants for 96 h (Fig. 3b). Habituation to the environment because of long-time exposure or repeated stimulation is defined as a reason for decreasing in responding (Rose and Rankin, 2001). It was hypothesized that adaption to the environment conferred the worm greater chances to survive and sek-1 mutation might induce recognition defect of the worms when the exposure time is longer than 24 h. Factors affect ingestion were not only related to the characteristics of pathogen itself but also the interaction between the Table 1 Body length of KU4 (sek-1) mutants treated with Xoo and E. faecalis 24 h 96 h Treatment Body length (mm) (means ± SD) n P-value Body length(mm) (means ± SD) n P-value PXO99 0.91±0.09 45 < 0.01 1.17±0.07 33 < 0.01 JXOⅢ 0.85±0.05 30 < 0.001 1.26±0.05 50 > 0.05 E. faecalis 0.73±0.07 37 < 0.001 0.92±0.11 42 < 0.001 OP50 1.04±0.12 40 1.32±0.06 37 231 a) Δ O D 60 0 / p ro te in [m g] Fig. 3 Worm ingestion behaviors after exposed to pathogens and the standard food source E. coli OP50 for different time period. a) Wild type N2 ingestion changed for 24 h and 96 h. b) Bacteria uptaking of sek-1 mutants for 24 h and 96 h. host and invaders. To our knowledge, E. faecalis is a classic animal pathogen, colonizes and proliferates in the gut of worm (Garsin et al., 2001). We also reported that PXO99 and JXOIII infected C. elegans in a similar manner with E. faecalis. It is obvious that E. faecalis has stronger pathogenicity than Xoo in the worm host and animal pathogen has essential differences with phytopathogen. This might be one explanation for the more consumption of PXO99 and JXOIII in contrast to E. faecalis. When compared the data in Figure 3A (24 h) to the pictures in Figure 2 (16 h), it seemed like there was a correlation between ingestion of bacteria and worm body size. Therefore, it was interesting to know if the same size difference could be seen with sek-1 mutants. It indicated that after 96 h, all the worms we tested had longer body size than 24 h and the tendency of body length was identical to the differences of ingestion behavior (Fig. 3b, Table 1). We found that ingestion of JXOIII was fewer than PXO99 at 24 h while after 96 h the consumption of JXOIII was more than PXO99 and had no statistical significant difference with the control group. These phenomena were also verified in the body size (Table 1). It could be explained with that the PXO99 is more virulent than JXOIII (Bai et al., 2014). Behavioral avoidance promotes nematode survival to Xoo and E. faecalis exposure Pathogenic bacteria represent an environmental challenge that can influence the worm survival, and C. elegans has the ability to detect and avoid pathogens (Pradel et al., 2007). Avoidance behavior in small-lawn of PA14 is a natural choice response, and confers survival benefit to the nematode (Reddy et al., 2009). In our experiment, wild type N2 and sek-1 mutant worms were not susceptible to both E. faecalis and JXOIII in small-lawn killing assay (Figs 4a, c). Compared with this, survival in the big-lawn assay in which pathogenic bacteria JXOIII were covered the entire plate performed in our previous work and other research work on identification of traditional Chinese medicine for promoting immunity of C. elegans against E. faecalis in our lab (personal communication) exhibited distinguished differences. The survival differences between small-lawn and big-lawn assays could be attributed to avoidance of the bacterial lawn (Figs 1a, b). Consistent with the Δ O D 60 0 / p ro te in [m g] b) 232 a) b) to l-1 s ur vi vi ng fr ac tio n N 2 su rv iv in g fr ac tio n c) se k- 1 su rv iv in g fr ac tio n Fig. 4 Kaplan-Meier survival plots of C. elegans mutant strains and wild type N2 treated with Xanthomonas strain PXO99 and JXOIII and standard food source E. coli OP50. Assays were performed on small-lawn plates. PXO99 group (dark gray solid line), JXOIII group (black dotted line), E. faecalis group (dark gray dotted line), OP50 (black solid line). results that tol-1 mutants are not more susceptible to E. faecalis than wild-type worms (Tenor and Aballay, 2007), the tol-1 mutants in our experimental condition also revealed similar survival patterns to N2 treated by E. faecalis (Fig. 4b). However, although tol-1 mutants avoided JXOIII strongly, it seemed no benefit for survival compared to the control (p < 0.0001) (Fig. 4b, Table 2). This might be ascribed to the importance of TOL-1 in the innate immune response to Gram-negative bacteria (Tenor and Aballay, 2007). In contrast to E. faecalis and JXOIII, PXO99 decreased the survival of wild-type N2, tol-1 mutants, and sek-1 mutants remarkably (Figs 4a - c, Table 2). It has been proved that PXO99 is more virulent than JXOIII in our previous data (Bai et al., 2014), together with the no avoidance results (Fig. 1), it indicated that PXO99 could successfully avoid the detection of immune system and shorten the lifespan of C. elegans. Tissue-specific sek-1 activities regulate immune responses to Xoo and E. faecalis sek-1 is a key component of p38 MAPK signal pathway and plays an important role in immune responses to pathogen resistance (Liberati et al., 2004). Despite sek-1 was not involved in nematode 233 Table 2 The effect of Xoo and E. faecalis on lifespan of C. elegans LT50 (in days) First and last death Strains and genotype p-value a Treatment Mean SD Min Max N2, wild type PXO99 12.0 0.4 7 20 p < 0.0001 JXOⅢ 14.5 0.2 10 18 p = 0.38 14.2 0.4 8 20 p = 0.72 E. faecalis OP50 14.6 0.3 9 21 IG10, tol-1(nr2033) PXO99 7.1 0.3 2 14 p < 0.0001 JXOⅢ 9.4 0.4 5 14 p < 0.0001 10.6 0.4 5 16 p = 0.12 E. faecalis OP50 11.5 0.5 4 17 KU4, sek-1(km4) PXO99 6.7 0.4 1 15 p < 0.001 JXOⅢ 10.6 0.4 2 17 p = 0.73 12.2 0.5 5 16 p = 0.11 E. faecalis OP50 8.9 0.6 1 19 KU4, sek-1(km4) PXO99 6.7 0.4 1 15 p < 0.0001 ZD193 (intestine) PXO99 11.4 0.4 3 20 p = 0.73 ZD202 (neurons) PXO99 9.2 0.7 5 16 p < 0.0001 ZD260 (ciliated sensory neurons) PXO99 8.0 0.6 5 14 p < 0.0001 N2, wild type PXO99 12.0 0.4 7 20 a p-value (log rank test) compared with control group of OP50. avoidance behavior to Xoo and E. faecalis, we proposed that tissue-specific sek-1 expressions participate in innate immunity of C. elegans. Based on that no aversion was occurred when wild type N2 and sek-1 mutants exposed to PXO99, and both small-lawn and big-lawn could supply enough bacterial sources, we chose N2 and sek-1 mutants survival curves from experiments on ‘small lawn’ and ZD260, ZD202 and ZD193 survival curves from ‘big-lawn’ assay for comparison. sek-1 mutation caused increased susceptibility to PXO99 (p < 0.0001) while transgenosis compromise the damage in different degrees (Fig. 5). Consistent with previous study that intestine is the main position where infection and immune response occur (Garsin et al., 2001), intestinal activity of sek-1 (ZD193 strain) was sufficient for nematode innate immune responses to PXO99 (Fig. 5, Table 2), survival curve had no significant difference from N2. ZD260 and ZD202 strains, sek-1 expressed in ciliated sensory neurons and all neurons respectively, both were susceptible to PXO99 like sek-1 mutants (Fig. 5, Table 2). However, compared with sek-1 mutants, ZD202 (sek-1 in neuron cells) could alleviate the damage of pathogen PXO99 (p < 0.01, Fig. 5), ZD260 (sek-1 in ciliated neurons) had no difference on survival (p = 0.23, Fig. 5). It suggested that sek-1 expressed in neuron cells conferred the host capability to resist pathogen infection. Consistent with the survival assay, transcriptional levels of the CUB-like genes C17H12.8 and F08G5.6 were higher in ZD202 than in ZD260 (Figs 6a, b). 234 P X O 99 -t re at ed w or m s su rv iv in g fr ac tio n Fig. 5 Survival plots of worms treated with Xanthomonas strain PXO99. Small-lawn assay results of wild type N2 and sek-1 mutants treated by PXO99 were chosen for control groups, which owing to that N2 and sek-1 mutants showed no avoidance towards PXO99 and enough bacterial resources could be supplied on small-lawn plates like big-lawn. Big-lawn method was employed for transgenic nematodes ZD193, ZD202 and ZD260, which sek-1 expressed specifically in intestine, neurons system, and ciliated sensory neurons. PXO99-treated wild type N2 (black solid line), sek-1 mutant (dark gray solid line), ZD260 (dark gray dotted line), ZD202 (black dotted line), ZD193 (light gray dotted line). Downstream genes C17H12.8, F08G5.6, T24B8.5, and F56D6.2, act as immune effectors and expression levels are enhanced significantly to defend infection attack (Troemel et al., 2006). CUB-like genes C17H12.8 and F08G5.6 were significantly upregulated in wild type N2 (Figs 6a, b), together with the upregulated C-type lectin gene F56D6.2 (Fig. 6c), it showed that PXO99, JXOIII and E. faecalis could activate p38 MAPK pathway to defend against infection. sek-1 mutation led to no response that all these effector genes nearly had no transcript (Figs 6a - d). However, tissue-specific expression of sek-1 could rescue the defense response. ZD193, sek-1 specifically expressed in the intestine, effector genes C17H12.8, F08G5.6, F56D6.2 and T24B8.5 were remarkably upregulated after treated by PXO99 and JXOIII (Figs 6a - d). Among these results, JXOIII could induce higher gene transcriptional levels (Figs 6a, b and d), it further verified that JXOIII was less virulent than PXO99. ZD202 (sek-1 in neuron cells) and ZD260 (sek-1 in ciliated neurons) could trigger lower gene expressions compared to ZD193 (sek-1 in intestine) (Figs 6a - d). tol-1 did not participate the avoidance response (Figs 1a, c) but it may be involved in immune response to Gram-negative bacteria like Xoo (Fig. 4b). During the infection process, C17H12.8 expression level in tol-1 mutants increased significantly after treated by PXO99 and JXOIII than control OP50, but obviously reduced compared to the wild type N2 (Fig. 6a). Other effector genes we investigated did not have fold changes (Figs 6b - d). Discussion As a bacterivore species, C. elegans encounters various bacteria including food source and dangerous pathogens in its habitat. Avoidance behavior and conserved innate immune response are usually employed to defense against pathogenic bacteria (Reddy et al., 2009). E. faecalis and JXOIII are animal and plant pathogens respectively, it indicated that worms could avoid the two strains effectively in the small-lawn assay (Fig. 1). Avoidance may related to the characteristics of the molecules produced by bacteria, such as the cyclic lipodepsipentapeptide serrawettin W2 produced by Serratia (Pradel et al., 2007), and molecules including toxic shock syndrome toxin 1 (TSST-1) and staphylococcal enterotoxin C (SEC) secreted by Staphylococcus aureus (Osanai et al., 2012). It is necessary to elaborate the mechanism of aversion by C. elegans, however, based on the fact that the 235 a) b) d) c) Fig. 6 Transcriptional levels of effector molecules downstream of p38 MAPK pathway after exposed to pathogenic bacteria. CUB-like genes C17H12.8 a) and F08G5.6 b), C-type lectin gene F56D6.2 c), and ShK toxin gene T24B8.5 d). We examined the fold changes of these genes to testify the roles of tol-1 and tissue-specific sek-1 in worm innate immunity to defend against the Xoo and E. faecalis. Results were obtained from 2 independent biological replicate and normalized to the control act-3. Error bars represent SD. *t-test, p < 0.05 comparison to OP50 groups. issue we want to discuss is the tol-1 and sek-1 roles in aversion and innate immunity of worms, molecules induced avoidance response are not included in our study. Compared to the JXOIII, another Xoo strain PXO99 did not induce worm avoidance response. We speculate that because PXO99 is more virulent than JXOIII, it may escape the detection and recognition system of the worm and make the worm maintain in the bacterial lawn to induce greater damage. sek-1 locates downstream of nsy-1, which are components of p38 MAPK pathway in C. elegans innate immune system (Kim et al., 2002). sek-1 mutation led to more sensitive to E. faecalis while there was no change in response to Xoo (Fig. 1b). Consistent with the importance of nsy-1 mutation in enhanced avoidance (Mori, 2008), sek-1 mutation may also cause more susceptibility to E. faecalis (Fig. 1b). tol-1 is important for nematode in pathogen recognition, and that tol-1 mutants are defective in their aversion of pathogenic Serratia marcescens (Pujol et al., 2001). However, tol-1 mutation seemed have no forward or reversal effect on the aversion in our study (Fig. 1C); it suggested that tol-1 did not play a universal role in recognizing pathogens and triggering avoidance response. In addition, sek-1 was not involved in aversion to pathogenic Xoo. Aversion is an indicator of unpleasant odorant or taste sensed by C. elegans. In order to study whether avoidance can influence the ingestion behavior, we examined bacterial consumption with wild type N2 and sek-1 mutants for 24 h and 96 h. As regular food source, OP50 consumption was the most (Fig. 3). No aversion was exhibited when exposed to PXO99 (Fig. 1), thus uptaking of this bacterium seemed more than JXOIII and E. faecalis in N2 (Fig. 3A). However, when prolonging the exposure time until 96 h, consumption of bacteria all increased (Fig. 3B). We propose two explanations for this issue, (i) adaption to odorant or chemical repellents may attenuate responses to these stimuli (Colbert and Bargmann, 1995; Hilliard et al., 2005), so that ingestion of bacteria increased. (ii) sek-1 was 236 Table 3 Sequence information for primers used in qRT-PCR Gene sequence name primer sequence 5'TGTCATTTCAATGGAGGATATTGT3' C17H12.8 C17H12.8 5'TGATGGAGTTGGAGGATATTGA3' 5'CACAATGATTTCAATGCGAGA3' F08G5.6 F08G5.6 5' TGCTTTCAGAACACAGTCAGG3' 5' TGATGGTGACAGTTCAAAGC3' F56D6.2 F56D6.2 5' TTCCAAAAATGCCCGAGTAG3' 5' AGACCATCATGCCCTTCACT3' T24B8.5 T24B8.5 5' GTAACGCAGACACCACAGGT3' 5'CCATCATGAAGTGCGACATTG3' act-3 T04C12.4 5'CATGGTTGATGGGGCAAGAG3' not involved in avoidance behavior to Xoo (Figs 1a, b), nevertheless, it plays important roles in C. elelgans innate immunity to resist bacterial pathogens (Kim et al., 2004). Mutation in sek-1 impairs the defense capability of the host, and pathogens can escape the detection system of worms and enter into the digestive tract. In addition, virulence of pathogens is also a key factor to influence the ingestion behavior. In our previous study, E. faecalis is more virulent to nematode than JXOIII (Bai et al., 2014), it may enter the host digestive tract easier than JXOIII as we expected. However, although JXOIII and E. faecalis could be both avoided by sek-1 mutants effectively (Fig. 1b), JXOIII could be ingested more than E. faecalis (Fig. 3b). This may due to differences in virulent factors such as extracellular enzymes or extracellular polysaccharides used by these pathogens (Shen and Ronald, 2002). Lifespan assay is always used to evaluate pathogenic bacterial effect on C. elelgans and defense responses of various mutant hosts to pathogens (Irazoqui et al., 2010). In order to testify the tol-1 and sek-1 roles in host innate immunity, we performed small-lawn killing assay using tol-1 and sek-1 mutants. Based on the aversion of JXOIII and E. faecalis (Fig. 1b), survival of sek-1 mutants treated by the two strains had no differences compared to the control (Fig. 4c, Table 2). However, similar aversion tendency did not induce semblable survival results in tol-1 mutants (Figs 1c, 4b), nematodes treated with JXOIII exhibited marked lifespan differences compared with control OP50 (Fig. 4b, Table 2). It indicated that tol-1 may participate the innate immune response to Gram-negative bacterium Xoo (Tenor and Aballay, 2007). Although tol-1 and sek-1 are both important in host immune response to Xoo, tol-1 is considered to be independent of p38 MAPK pathway (Aballay et al., 2003). However, transcriptional level of CUB-like gene C17H12.8 increased when tol-1 mutants treated by Xoo PXO99 and JXOIII, and other genes we examined nearly had no changes (Fig. 6). We hypothesize that tol-1 and sek-1 may have overlapping roles in defense against the Xoo, and the host integrates multiple cues to respond the environmental stimulus. Interaction between tol-1 and sek-1 needs further investigation. p38 MAPK pathway acts as a pivotal immune signaling module in C. elegans, it can be activated in a range of tissues where specific immune responses are triggered (Bolz et al., 2010). Intestinal epithelium and nervous system are the common focus for investigating immune defense mechanism (Pukkila-Worley and Ausubel, 2012; Takeda and Ichijo, 2002). Therefore, transgenic worms expressed sek-1 in ciliated sensory neurons (ZD260), neurons system (ZD202) and intestine (ZD193) were used to study the roles of tissue-specific sek-1 in innate immune response to Xoo infection. It showed that intestine expression could rescue the survival of worms while neurons system and ciliated sensory neurons expression just attenuated the reduced lifespan compared to sek-1 mutants (Fig. 5, Table 2). Consistent with this, effector molecules downstream of p38 MAPK pathway such as C17H12.8, F08G5.6, F56D6.2, and T24B8.5 had enhanced transcriptional levels in ZD193 (intestine expression) (Fig. 6). Fold changes of C17H12.8 and F08G5.6 were higher in ZD202 (neurons) than ZD260 (ciliated sensory 237 http://legacy.wormbase.org/db/seq/sequence?name=R13H8.1;class=Gene_name http://legacy.wormbase.org/db/seq/sequence?name=T04C12.4;class=Gene_name http://legacy.wormbase.org/db/seq/sequence?name=T04C12.4;class=Gene_name Garsin DA, Sifri CD, Mylonakis E, Qin X, Singh KV, Murray BE, et al. A simple model host for identifying Gram-positive virulence factors. Proc. Natl. Acad. Sci. 98: 10892-10897, 2001. neurons) (Fig. 6), it suggested that sek-1 expressed in neurons could confer the host limited resistance to the Xoo. In conclusion, our findings reveal that SEK-1 and TOL-1 are not involved in C. elegans avoidance behavior and ingestion of nematodes is related to the aversion and also the characteristics of bacteria. In addition, tol-1 and sek-1 participate the immune response to the infection by Xoo, sek-1 also exhibits tissue-specific activities in host innate immunity. Overlapping effect may exist between the tol-1 and sek-1. Hasshoff M, Böhnisch C, Tonn D, Hasert B, Schulenburg H. The role of Caenorhabditis elegans insulin-like signaling in the behavioral avoidance of pathogenic Bacillus thuringiensis. FASEB J. 21: 1801-1812, 2007. Acknowledgements This work was supported by the National Natural Science Foundation of China (31071335); the Special International Cooperation Project of MOST (2012DFA30480); the Key Project of Gansu Province Science and Technology (1002WKDE55); Gansu Province International Science and Technology Cooperation Project (090WCGA900); the Fundamental Research Funds for the Central Universities of China (lzujbky-2013-71, lzujbky-2013-75, lzujbky-2014-147, lzujbky-2014-149, and lzujbky-2014-150). The nematode strains used in our work were provided by Caenorhabditis Genetics Center (CGC). Hilliard MA, Apicella AJ, Kerr R, Suzuki H, Bazzicalupo P, Schafer WR. In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents. EMBO J. 24: 63-72, 2005. Hopkins C, White F, Choi S, Guo A, Leach J. Identification of a family of avirulence genes from Xanthomonas oryzae pv. oryzae. Mol. Plant Microbe In. 5: 451-459, 1992. Irazoqui JE, Troemel ER, Feinbaum RL, Luhachack LG, Cezairliyan BO, Ausubel FM. Distinct pathogenesis and host responses during infection of C. elegans by P. aeruginosa and S. aureus. PLoS Pathog. 6: e1000982, 2010. Kaletta T, Hengartner MO. Finding function in novel targets: C. elegans as a model organism. Nat. Rev. Drug Discov. 5: 387-399, 2006. Kanzok SM, Hoa NT, Bonizzoni M, Luna C, Huang Y, Malacrida AR, et al. Origin of Toll-like receptor-mediated innate immunity. J. Mol. Evol. 58: 442-448, 2004. References Aballay A, Drenkard E, Hilbun LR, Ausubel FM. Caenorhabditis elegans innate immune response triggered by Salmonella enterica requires intact LPS and is mediated by a MAPK signaling pathway. Curr. Biol. 13: 47-52, 2003. Kawli T, He F, Tan MW. It takes nerves to fight infections: insights on neuro-immune interactions from C. elegans. Dis. Mod. Mech. 3: 721-731, 2010. Kim DH, Feinbaum R, Alloing G, Emerson FE, Garsin DA, Inoue H, et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297: 623-626, 2002. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 124: 783-801, 2006. Alegado RA, Campbell MC, Chen WC, Slutz SS, Tan MW. Characterization of mediators of microbial virulence and innate immunity using the Caenorhabditis elegans host-pathogen model. Cell. Microbiol. 5: 435-444, 2003. Kim DH, Liberati NT, Mizuno T, Inoue H, Hisamoto N, Matsumoto K, et al. Integration of Caenorhabditis elegans MAPK pathways mediating immunity and stress resistance by MEK-1 MAPK kinase and VHP-1 MAPK phosphatase. Proc. Natl. Acad. Sci. 101: 10990-10994, 2004. Alper S, McBride SJ, Lackford B, Freedman JH, Schwartz DA. Specificity and complexity of the Caenorhabditis elegans innate immune response. Mol. Cell. Biol. 27: 5544-5553, 2007. Li X, Li H, Pang X, Feng H, Zhi D, Wen J, et al. Localization changes of endogenous hydrogen peroxide during cell division cycle of Xanthomonas. Mol. Cell. Biochem. 300: 207-213, 2007. Bai YL, Zhi DJ, Li ChH, Liu DL, Zhang J, Tian J, et al. Infection and immune response in the nematode Caenorhabditis elelgans elicited by phytopathogen Xanthomonas. J. Microbiol. Biotechn. 2014 [im press]. Liberati NT, Fitzgerald KA, Kim DH, Feinbaum R, Golenbock DT, Ausubel FM. Requirement for a conserved Toll/interleukin-1 resistance domain protein in the Caenorhabditis elegans immune response. Proc. Natl. Acad. Sci. 101: 6593-6598, 2004. Bargmann CI. Chemosensation in C. elegans. WormBook, ed. The C. elegans Research Community, doi/10.1895/ wormbook.1.123.1, http://www.wormbook.org. pp.1-29, 2006. Bogaerts A, Beets I, Schoofs L, Verleyen P. Antimicrobial peptides in Caenorhabditis elegans. Inv. Surv. J. 7: 45-52, 2010. Melo JA, Ruvkun G. Inactivation of conserved C. elegans genes engages pathogen-and xenobiotic-associated defenses. Cell 149: 452-466, 2012. Bolz DD, Tenor JL, Aballay A. A conserved PMK-1/p38 MAPK is required in Caenorhabditis elegans tissue-specific immune response to Yersinia pestis infection. J. Biol. Chem. 285: 10832-10840, 2010. Mori I. A single sensory neuron directs both attractive and repulsive odor preferences. Neuron 59: 839-840, 2008. Colbert HA, Bargmann CI. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14: 803-812, 1995. Osanai A, Hu DL, Nakane A. Caenorhabditis elegans avoids staphylococcal superantigenic toxins via 5-hydroxytryptamine-dependent pathway. Can. J. Microbiol. 58: 1268-1277, 2012. 238 Pradel E, Zhang Y, Pujol N, Matsuyama T, Bargmann CI, Ewbank JJ. Detection and avoidance of a natural product from the pathogenic bacterium Serratia marcescens by Caenorhabditis elegans. Proc. Natl. Acad. Sci. 104: 2295-2300, 2007. Pujol N, Cypowyj S, Ziegler K, Millet A, Astrain A, Goncharov A, et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr. Biol. 18: 481-489, 2008. Pujol N, Link EM, Liu LX, Kurz CL, Alloing G, Tan MW, et al. A reverse genetic analysis of components of the Toll signaling pathway in Caenorhabditis elegans. Curr. Biol. 11: 809-821, 2001. Pukkila-Worley R, Ausubel FM. Immune defense mechanisms in the Caenorhabditis elegans intestinal epithelium. Curr. Opin. Immunol. 24: 3-9, 2012. Reddy KC, Andersen EC, Kruglyak L, Kim DH. A polymorphism in npr-1 is a behavioral determinant of pathogen susceptibility in C. elegans. Science 323: 382-384, 2009. Rose JK, Rankin CH. Analyses of habituation in Caenorhabditis elegans. Learn. Memory 8: 63-69, 2001. Schmeisser S, Schmeisser K, Weimer S, Groth M, Priebe S, Fazius E, et al. Mitochondrial hormesis links low-dose arsenite exposure to lifespan extension. Aging cell 12: 508-517, 2013. Schulenburg H, Ewbank JJ. The genetics of pathogen avoidance in Caenorhabditis elegans. Mol. Microbiol. 66: 563-570, 2007. Shen Y, Ronald P. Molecular determinants of disease and resistance in interactions of Xanthomonas oryzae pv. oryzae and rice. Microbes and infection 4: 1361-1367, 2002. Shivers RP, Kooistra T, Chu SW, Pagano DJ, Kim DH. Tissue-Specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host Microbe 6: 321-330, 2009. Styer KL, Singh V, Macosko E, Steele SE, Bargmann CI, Aballay A. Innate immunity in Caenorhabditis elegans is regulated by neurons expressing NPR-1/GPCR. Science 322: 460-464, 2008. Takeda K, Ichijo H. Neuronal p38 MAPK signalling: an emerging regulator of cell fate and function in the nervous system. Genes Cells 7: 1099-1111, 2002. Tan MW, Mahajan-Miklos S, Ausubel FM. Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proc. Natl. Acad. Sci. 96: 715-720, 1999. Tenor JL, Aballay A. A conserved Toll-like receptor is required for Caenorhabditis elegans innate immunity. EMBO Rep. 9: 103-109, 2007. Troemel ER, Chu SW, Reinke V, Lee SS, Ausubel FM, Kim DH. p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genet. 2: e183, 2006. 239