149 ISJ 14: 149-156, 2017 ISSN 1824-307X RESEARCH REPORT Hemoglobin from the blood clam Tegillarca granosa (Tg-HbIIA, Tg-HbIIB): expression and antibacterial activity of recombinant proteins D Song1, 2, Z Lin2, W Fu3, S Wang2, C Li1, P Li1,2, Y Bao1,2 1School of Marine Sciences, Ningbo University, Ningbo, Zhejiang, 315211, PR China 2College of Biological & Environmental Sciences, Zhejiang Wanli University, Ningbo, Zhejiang, 315100, PR China 3Zhejiang Marine Development Research Institute, Zhoushan, 316021, PR China Accepted April 18, 2017 Abstract The hemoglobins produced by Tegillarca granosa have antibacterial activity toward some Gram-positive and Gram-negative bacteria. In this study, the genes encoding the recombinant proteins Tg-HbIIA and Tg-HbIIB were cloned from T. granosa hemocytes by RT-PCR, and the proteins were expressed in Escherichia coli Transetta (DE3). The proteins were purified using a HisTrap FF affinity chromatography column under denaturing conditions and refolded at 4 °C by urea gradient dialysis, and the antibacterial activity of the recombinant proteins was determined. The Tg-HbIIA protein had antibacterial activity toward Vibrio harveyi and Pseudomonas putida, with the minimum inhibition concentration (MIC) values of 65.8 ug/ml and 4.11 ug/ml, respectively. The Tg-HbIIB protein had antibacterial activity toward V. harveyi, P. putida and Acinetobacter baumanii, with MIC values of 158 ug/ml, 39.5 ug/ml and 79 ug/ml, respectively. They had no antibacterial activity against Staphylococcus aureus, E. coli, B. firmus, B. subtilis, S. epidermidis, or V. parahaemolyticus. This study provides a basis for further research on the antibacterial function and mechanism of hemoglobin. Key Words: Tegillarca granosa; hemoglobin; recombinant protein; antibacterial activity Introduction Hemoglobin (Hb) is a respiratory protein containing iron that has multiple biological functions and is one of the most researched proteins in the protein family (Riggs, 1991; Terwilliger, 1998; Jiang et al., 2007; Katsu et al., 2010). Hb is rare in molluscs, with most harboring copper-containing hemocyanin instead (Lieb et al., 2006). However, Tegillarca granosa, which belongs to the family Arcidae, contains abundant Hb in circulating erythrocytes (Suzuki et al., 1992). In our previous studies, full-length cDNAs and genomic DNA of Tg-HbIIA and Tg-HbIIB were cloned from T. granosa. Sequence and structural analyses revealed that Tg-HbIIA and Tg-HbIIB form A2B2 heterotetramers (Wang, 2012). The expression of Tg-Hbs mRNA in T. granosa hemocytes was markedly upregulated after Vibrio parahaemolyticus, LPS or PGN challenge (Bao et al., 2011). The purified heterotetramers of Tg-HbII exhibited antibacterial activity against ___________________________________________________________________________ Corresponding author: Yongbo Bao College of Biological & Environmental Sciences Zhejiang W anli University 8 South Qianhu Road, Ningbo Zhejiang 315100, P.R. China E-mail: bobbao2001@gmail.com Pseudomonas putida but no antibacterial activity against Staphylococcus aureus, based on an agarose diffusion test and the minimal inhibitory concentration (MIC) (Bao et al., 2013). And the polypeptides from Tg-HbII also exhibited antibacterial activity against V. alginolyticus, V. harveyi and V. parahaemolyticus (Wang et al., 2015). These results indicated that Tg-Hbs might be involved in the immune responses against bacterial infection. Many animals are known to that their Hb can limit the growth of or kill bacteria as a defense mechanism. Parish et al. (2001) found that intact Hb tetramers, alpha and beta subunits, from human, exhibited considerable activity against Gram-positive and Gram-negative bacteria, and fungi (Parish et al., 2001). Many previous studies demonstrated that bovine Hb is a rich source of antimicrobial peptides (Daoud et al., 2005; Nedjararroume et al., 2008; Przybylski, 2015). Antibacterial activities of Hb from non-mammalian vertebrates such as Crocodylus siamensis and Japanese eel (Anguilla japonica) also have been confirmed. Hb, α-chain, β-chain and fragmented Hb of C. siamensis can inhibit growth of Gram-positive bacteria B. subtilis, B. amyloliquefaciens, and B. pumilus (Srihongthong et al., 2012). Zhang et al. (2013) isolated an antibacterial 150 Table 1 Primers used in the present study Gene Genbank number Primer sequence Product size Tg-HbIIA HQ729976 F: GGATCCGTTGATGCAGCAGTTGCAAAT R: AAGCTTCCATTGATGGTTGGTCCAGAT 492bp Tg-HbIIB HQ149306.1 F: GGATCCGGTGTCAACGAAGCAATCAAAG R: AAGCTTAATAGTCGTTTTTTCTCATGC 483bp peptide from Hb alpha in the liver of Japanese eel. And they found that its synthetic peptide also had strong antibacterial activities against Gram-positive and Gram-negative bacterias. There are several Hb of invertebrate have been reported. It reported that Scapharca Kagoshimensis Hb had antibacterial activity against S. aureus, B. subtilis, Micrococcus tetragenus (Xu et al., 2015). In a word, nature Hb has broad-spectrum antibacterial activity and different sources of Hb with different antimicrobial activity. However, few study reported that recombinant Hb have antibacterial activity. In the present study, we constructed Tg-HbIIA and Tg-HbIIB expression vectors, expressed these vectors by IPTG induction, and purified the proteins by affinity chromatography. In addition, through the analysis of the recombinant Hb antibacterial activity by in vitro bacteriostatic experiments, this work provides the basis for the further study of the antibacterial immunity function of Hb and its mechanism. Materials and Methods Experimental clams, collection of hemocytes and experimental bacteria T. granosa (average shell length approximately 30 mm) were purchased from an aquaculture farm (Ningbo, China). After the T. granosa were vivisected and the blood was quickly drawn, the hemolymphs were centrifuged at 1000 rpm for 10 min to harvest the hemocytes. The cells were flash-frozen in liquid nitrogen and then stored at -80 °C for RNA extraction. E. coli (ATCC 35218), P. putida (CGMCC 1.0593), S. aureus (ATCC 29213), V. harveyi, V. parahaemolyticus, and V. alginolyticus, B. subtilis, S. epidermidis, B. firmus, and A. baumanii are provided by Zhejiang Wanli College Microbiology and Environmental Engineering Key Laboratory. Cloning and expression vector construction Total RNA was isolated from the T. granosa hemocytes using Trizol (Invitrogen, USA) and was reverse transcribed using a Reverse Transcription System Kit (Promega, USA). The primers were designed to amplify the ORF of the full-length Tg-HbIIA and Tg-HbIIB cDNAs. All primers were synthesized by Sangon Biotechnology (China) and are shown in Table 1. The amplified products with a size of approximately 500 bp were cloned into the pMD-18T vector (TaKaRa, Japan), and the recombinant plasmids were named pMD-18T/Tg-HbIIA and pMD-18T/Tg-HbIIB. The recombinant plasmids were digested with BamHI and HindIII (New England biolabs, UK), which were then inserted into the corresponding sites of the expression vector pET30a (TaKaRa) to generate pET30a/Tg-HbIIA and pET30a/Tg-HbIIB. Three positive clones for each product were sequenced at Sangon Biotechnology (China). Expression and purification of Tg-HbIIA and Tg-HbIIB The pET30a/Tg-HbIIA and pET30a/Tg-HbIIB plasmids were separately transformed into E. coli Transetta (DE3) (TransGen, China). For the expression of Tg-HbIIA and Tg-HbIIB recombinant proteins, the positive Transetta (DE3) cells were grown at 37 °C in 1 L LB liquid medium with 50 mg/ml of kanamycin. When the OD600 reached between 0.5 and 0.8, the culture was induced with 1 mM IPTG (Aladdin USA). To determine the optimal conditions for the expression, the expression of the target proteins at 37 °C, 30 °C, 28 °C, 25 °C, and 20 °C after 2 h, 3 h, 4 h, 5 h and 6 h of induction was examined. Then, a large number of recombinant proteins were expressed in the best condition. Finally, the cells were harvested by centrifugation at 6,000 rpm for 20 min at 4 °C and stored for next step of the experiment. All of the wet cells were resuspended in lysis buffer (50 mM NaH2PO4·2H2O, 2 mM EDTA, 100 mM NaCl, 0.5 % Triton X-100) and disrupted by sonication on ice. The cell lysate was centrifuged at 12,000 rpm for 30 min at 4 °C. Because the Tg-HbIIA and Tg-HbIIB were found in inclusion body, the insoluble fraction (i.e., inclusion body) from the lysate was resuspended in solubilization buffer (50 mM NaH2PO4·2H2O, 10 mM Tris-HCl, 8 M urea, pH 7.2) at 5 ml per gram of wet inclusion body and centrifuged at 12,000 rpm for 30 min to pelletize the cellular debris. To purify the proteins, a 5 ml HisTrap FF affinity chromatography column (GE Healthcare) was used in the AKTA pure protein chromatography system (GE Healthcare). As a first step, the HisTrap FF column was equilibrated with 2~3 column volumes of distilled water and equilibrating buffer (50 mM NaH2PO4·2H2O, 300 mM NaCl, 8 M urea, 10 mM imidazole, pH 7.2) at a flow rate of 0.5 ml/min. Then, protein samples were loaded into the column by using equilibrating buffer. Subsequently, the desired protein was eluted using elution buffer (50 mM NaH2PO4·2H2O, 300 mM NaCl, 8 M urea, 200 mM imidazole, pH 7.2), automatically 151 collected in a fraction collector and stored at 4 °C. The collected proteins were analyzed by SDS-PAGE to verify the purity of the proteins. The components of the proteins were identified by mass spectrometry, and the concentrations were estimated using a Bradford protein assay. The purified protein was denatured, so we needed to make the proteins form complexes. We added 1 mg of the purified recombinant Tg-HbIIA or Tg-HbIIB into a dialysis bag and added a slight excess of heme, ~1 mg. The samples were then dialyzed for 12 h at 4 °C using renaturation buffer (50 mM NaH2PO4·2H2O, 50 mM NaCl, 1 mM EDTA, 2 M reduced glutathione, 0.02 M oxidized glutathione, 10 % glycerol, 10 % glycine, pH 7.2), which contained 6 M, 4 M, 2 M or 0 M urea. Antibacterial activity of the recombinant protein An agar diffusion method was used for the preliminary detection of the antibacterial activity of the recombinant proteins (Tg-HbIIA, Tg-HbIIB) against the Gram-negative bacteria E. coli, A. baumanii, P. putida, V. harveyi, V. parahaemolyticus, and V. alginolyticus and the Gram-positive bacteria S. aureus, B. subtilis, S. epidermidis, and B. firmus. S. aureus, E. coli, P. putida, A. baumanii, B. firmus, B. subtilis and S. epidermidis were spread on LB solid medium and grown at 37 °C for 12 h. Then, colonies were picked into 50 ml of LB in a liquid culture flask and cultured at 37 °C for 5 h with shaking. V. alginolyticus, V. harveyi and V. parahaemolyticus were spread on seawater solid medium in a liquid culture flask and grown at 28 °C for 12 h. Then, colonies were picked into 50 ml of seawater medium and cultured at 28 °C for 5 h with shaking. All of the bacteria were counted using a hemocytometer, diluted into 105 CFU/ml bacterial suspensions, and 200 µl of each test microorganism suspension was spread onto LB or seawater solid medium. Bacterial plates were cultured for 10min, and three oxford cups were then put into the medium. The recombinant proteins (Tg-HbIIA, Tg-HbIIB) and the phosphate buffer negative control (50 mM NaH2PO4·2H2O, 50 mM NaCl, 1 mM EDTA, 2 M reduced glutathione, 0.02 M oxidized glutathione, 10 % glycerol, 10 % glycine, pH 7.2) were added to the oxford cup. S. aureus, E. coli, P. putida, A. baumanii, B. firmus, B. subtilis, and S. epidermidis were cultured at 37 °C for 12 h, and V. alginolyticus, V. harveyi and V. parahaemolyticus were cultured at 28 °C for 12 h. Then, the oxford cups were unplugged, and the zone of inhibition was observed. To ensure the accuracy of the bacteriostatic experiment, we performed three replicates for each kind of bacterium. The MIC of recombinant proteins (Tg-HbIIA, Tg-HbIIB) was determined using the broth dilution method. The bacterial suspensions and serially diluted recombinant proteins were added to 96-well plates at a ratio of 4:1 in a final volume of 100 µl for 10 wells. The 11th well without added recombinant protein served as a growth control. The 12th well contained 0.1 mg/ml trypsin as a positive control. The microplates of S. aureus, E. coli, P. putida, A. baumanii, B. firmus, B. subtilis, and S. epidermidis were incubated at 37 °C with continuous shaking. The microplates of V. alginolyticus, V. harveyi and V. parahaemolyticus were incubated at 28 °C with continuous shaking. After 16 ~ 20 h, the OD value of each well was measured with an automatic microplate reader (SpectraMax 190, Molecular Devices, USA) set at 600 nm. The experiment was repeated 3 times. Finally the clear bacterial growth was observed both in the growth control and in the 96-well plates, and the concentrations of the wells with no bacterial growth were designated as the value of the MIC. Results and Discussion Cloning and expression vector construction We cloned the Tg-HbIIA and Tg-HbIIB genes from T. granosa hemocytes by RT-PCR and the PCR products were inserted into pMD-18T vectors. The coding region of the mature Tg-HbIIA was amplified from the plasmid pMD-18T/Tg-HbIIA and cloned into the expression vector pET30a (+) to generate the pET30a/Tg-HbIIA. The plasmid was confirmed by a double restriction enzyme digestion of pET30a/Tg-HbIIA with BamHI and HindIII, and using PCR, we showed that the coding region of the mature Tg-HbIIA gene was 492 bp, as expected. In the same way, the coding region of the mature Tg-HbIIB gene was confirmed and was shown to be 483 bp, as expected. The result was also confirmed by sequencing (data not shown). Then, the pET30a/Tg-HbIIA and pET30a/Tg-HbIIB were introduced into E. coli Transetta (DE3). To confirm the positive Transetta (DE3), Tg-HbIIA and Tg-HbIIB were amplified using PCR with T7 primers and were then detected by 1% agarose gel electrophoresis. We observed a single band of approximately 750 bp (Fig. 1). It was confirmed that the recombinant expression vector was successfully constructed. Fig. 1 Agarose gel electrophoresis analysis of recombinant expression vector. Lane 1, pET-30a/Tg-HbIIA; Lane 2, pET-30a/Tg-HbIIB; Lane M, DNA Marker. 152 Expression and purification of Tg-HbIIA and Tg-HbIIB The approach used to produce the recombinant Tg-HbIIA and Tg-HbIIB proteins at high levels was to determine the optimal expression conditions by evaluating the induction time and temperature. After induction with IPTG, the Tg-HbIIA gene was successfully expressed, and the highest expression was induced by 1 mmol/L IPTG at 37 °C for 5 h (Suppl. Fig. 1). In the same way, the highest expression of Tg-HbIIB was induced by 1 mmol/L IPTG at 28 °C for 4 h (Suppl. Fig. 2). The largest amounts of Tg-HbIIA and Tg-HbIIB were found in the precipitate when analyzed by SDS-PAGE analysis, after the samples were ultrasonicated. This result showed that they were mostly in insoluble inclusion bodies. To isolate the Tg-HbIIA and Tg-HbIIB, bacterial cells were collected and disrupted using ultrasonication. The inclusion bodies were obtained by centrifugation and dissolved in the solubilization buffer. The cell debris was removed by centrifugation, and the solubilized protein was purified by the HisTrap FF column in the denaturing condition. After purification and SDS-PAGE, single bands of the Tg-HbIIA and Tg-HbIIB at approximately 24 kDa and 25 kDa, respectively, were observed (Fig. 2). To further determine the components of the proteins, mass spectrometry was performed. The results see Figure 3 and in Supplementary Figure 3. The concentrations of Tg-HbIIA and Tg-HbIIB were 3.26 mg/ml and 3.71 mg/ml, respectively, as determined by the Bradford protein assay. Exogenous gene expression in E. coli is affected by many factors, such as induction temperature, IPTG concentration, inducing time and genetic structure (Lilie et al., 1998). Experiments found that the expression of the vectors pET30a/Tg-HbIIA and pET30a/Tg-HbIIB was mainly Fig. 2 SDS-PAGE analysis of purified recombinationt hemoglobins. Lane 1, Purified recombinationt Tg-HbIIB; Lane 2, Purified recombinationt Tg-HbIIA; lane M, Broad range protein molecular weight markers affected by inducing time. Although the expression of exogenous genes in E. coli is one of the most economic and convenient expression systems, the greatest obstacle is the inability to correctly fold recombinant proteins and form active proteins. Gradient dialysis, via the ultrafiltration centrifugal method, can induce recombinant protein folding in vitro but this method is unable to restore the original Fig. 3 The mass spectrogram of recombinationt HbIIA from Tegillarca granosa. 153 Table 2 Antibacterial activity of recombinant hemoglobin from Tegillarca granosa Bacteria Gram The minimum inhibition concentration (MIC) (g/ml） Tg-HbIIA Tg-HbIIB V. harveyi - 65.8 158 P. putida - 4.11 39.5 A. baumanii - --- 79 E. coli - --- --- V. parahaemolyticus - --- --- V. alginolyticus - --- --- S. aureus - --- --- B. subtilis + --- --- S. epidermidis + --- --- B. firmus + --- --- level (Mayer and Buchner, 2004). If the recombinant proteins were solubilized as inclusion bodies and refolded in the right process, then they would have biological activity (Sings and Panda, 2005). The recombinant proteins (Tg-HbIIA, Tg-HbIIB) in dialysis renaturation required the addition of a slight excess of heme in proportion. Heme is an important component of Hb, but it is also the active center of Hb. Without adding the heme, the protein could not be folded into its normal active protein form (Perutz, 1979). Each Hb subunit needs one auxiliary heme. The Fe2+ of the heme is oxidized easily in the renaturation process, but it may reduce the activity of the recombinant protein. Additionally, heme was dissolved in ethanol. Therefore, the excess heme and the residual urea also likely affected the protein activity. It was found that when 1 mg of recombinant protein was added to 1 mg heme, the result of renaturation was good. Protein renaturation is a complex process that is affected by many factors.The protein spatial structure needs to be formed slowly, so the urea should be diluted gradually (Vallejo and Rinas, 2004; Yu and Tao, 2007). To prevent protein denaturation, the entire process should be performed at 4 °C. Antibacterial activity of the recombinant protein The results of the bacteriostatic experiment are shown in Table 2. We found that recombinant Tg-Hb exhibits great differences in its effects on various bacteria. The recombinant proteins have no antibacterial activity against S. aureus, E. coli, B. firmus, B. subtilis, S. epidermidis, V. parahaemolyticus or V. alginolyticus. The antibacterial activity of the recombinant proteins to V. harveyi, P. putida and A. baumanii is shown in Figure 4. In the previous study, the Tg-HbllA and Tg-HbllB had different amino acids, but they had similar tertiary structure, like 8 alpha helix. We also found that the recombinant proteins without heme have no antimicrobial activities in the pre experiment. And the potential heme binding sites of Tg-HbllA, Tg-HbllB and S. inaequivalvis HbII were highly conserved, indicating that the function of Hb play mainly related to its tertiary structure and function domain(Jr et al., 1994; Jr et al., 1995; Wang, 2012). Compared with the previous study, we found that the effects of the recombinant proteins on antibacterial activity on P. putida, V. parahaemolyticus and S. aureus are similar to those of natural Tg-HbII (Wang et al., 2014). This result indicated that recombinant Fig. 4 The inhibition zone of purified recombinationt hemoglobin from Tegillarca granosa. A, V. harveyi; B, P. putida; C, A. Baumanii. 154 proteins are inducible and have high antibacterial activity against Gram-negative bacteria, similar to natural protein. There are also some differences. The nature Tg-HbII heterotetramers obtained by gel exclusion chromatography was exhibited antibacterial activity against E. coli, B. subtilis, B. firmus, and had no antibacterial activity against V. harveyi, A. baumanii (Bao et al., 2013; Bao et al., 2016). The Tg-HbII was an A2B2 heterotetramers formed by Tg-HbIIA and Tg-HbIIB. The interaction between Tg-HbIIA subunit and Tg-HbIIB subunit may lead to different antibacterial results. In the previous study, the expression of Tg-HbIIA and Tg-HbIIB mRNA was markedly upregulated after V. parahaemolyticus, but the recombination Hb had no antibacterial activity against V. parahaemolyticus. We speculate that polypeptides from Tg-HbllA and Tg-HbllB by enzymatic hydrolysis can resist V. parahaemolyticus (Wang et al., 2015). In addition, that the hemolytic effects of the hemolysins produced during V. Parahaemolyticus infection are responsible for enhanced hematopoeisis (Honda and Iida, 1993). Our results also confirmed that protein with antibacterial activity can be expressed and assembled in E. coli (De-La-Re-Vega et al., 2006; Zhao et al., 2007; Mai et al., 2009). So far, most have focused on the natural Hb and its peptides antibacterial research, while the recombinant Hb and its peptides is less. Niu and Chen (2016) reported that recombinant Hb from Urechis unicinctus has antibacterial activity against S. aureus, M. luteus, E. coli, and V. parahaemolyticus. And their results are different from ours, which indicated that the antibacterial mechanism of different sources of Hb may be different. At present, the antibacterial mechanism of Hb is unclear. Though Hb has been found capable of producing ROS and of exerting pseudoperoxidase and deoxygenase activities, which are involved in host defense (Adachi et al., 2003; Cheng et al., 2011; Goodarzi et al., 2014). Jiang et al. (2007) showed that human Hb is oxidized to ferric iron when stimulated by virulence factors, resulting in a superoxide anion that can produce toxic derivatives such as hydroxyl radicals and hypochlorous acid and has a bactericidal effect. Wang et al. found that purified Tg-Hbs catalyzed the oxidation of several phenol compounds in the presence of H2O2, with high affinity to guaiacol. And the predicted structure at their heme pocket was highly similar to that of horseradish peroxidase (HRP) and myeloperoxidase (MPO). It indicated that Tg-Hbs may function as peroxidase in the clam’s hemocytes. The authors considered that the antibacterial effect may be generated by the peroxidase activity (Wang et al., 2014; Wang et al., 2017). The heme moiety of Hb can either act as an iron chelator or an oxidant, leading to bacterial and fungal cell wall damage (Katsu et al., 2010). The diversity of antimicrobial activity of Tg-Hbs might be due to their antibacterial mechanism. The research of antibacterial mechanism of nature and recombinant Tg-Hb is under way. Acknowledgments This research was supported by the National Science Foundation of China (31672678), Natural Science Foundation of Ningbo (2015A610258), Zhejiang Province Public Technology Applied Research Projects (2016C33090), Zhejiang Major Program of Science and Technology (2016C02055-9), and Zhejiang Natural Science Foundation (LQ15C190001). References Adachi K, Hirata T, Nishioka T, Sakaguchi M. Hemocyte components in crustaceans convert hemocyanin into a phenoloxidase-like enzyme. Comp. Biochem. Physiol. 134B: 135-141, 2003. Bao Y, Wang J, Li C, Li P, Wang S, Lin Z. A preliminary study on the antibacterial mechanism of Tegillarca granosa hemoglobin by derived peptides and peroxidase activity. Fish Shellfish Immun. 51: 9-16, 2016 Bao Y, Wang Q, Lin Z. Hemoglobin of the bloody clam Tegillarca granosa, (Tg-HbI) is involved in the immune response against bacterial infection. Fish Shellfish Immun. 31: 517-523, 2011. Bao Y, Yang T, Wang S, Wang C, You Z, Jiao H, et al. Hemoglobin and its derived peptides from blood clam (Tegillarca granosa) exhibiting an antimicrobial activity. Fish Shellfish Immun. 34: 1696, 2013. Cheng TM, Mao SJ, Lai ST, Chang CC, Yang MC, Chen NC, et al. Haemoglobin-induced oxidative stress is associated with both endogenous peroxidase activity and H2O2 generation from polyunsaturated fatty acids. Free Radic Res. 45: 303-316, 2011. Daoud R, Dubois V, Borsdodita L, Nedjar-Arroume N, Krier F, Chihib NE, et al. New antibacterial peptide derived from bovine hemoglobin. Peptides 26:713-719, 2005. De-la-Re-Vega E, García-Galaz A, Díaz-Cinco ME, Sotelo-Mundo RR. White shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae. Fish Shellfish Immun. 20: 405-408, 2006. Goodarzi M, Moosavi-Movahedi AA, Habibi-Rezaei M, Shourian M, Ghourchian H, Ahmad F, et al. Hemoglobin fructation promotes heme degradation through the generation of endogenous reactive oxygen species. Spectrochim. Acta A Mol. Biomol. Spectrosc. 130: 561-567, 2014. Honda T, Iida T. The pathogenicity of Vibrio parahaemolyticus and the role of the thermostable direct haemolysin and related haemolysins. Rev. Med. Microbiol. 4: 106-113, 1993. Jiang N, Tan NS, Ho B, Ding J. Respiratory protein-generated reactive oxygen species as an antimicrobial strategy. Nat. Immunol. 8: 1114-1122, 2007. https://www.ncbi.nlm.nih.gov/pubmed/?term=Nedjar-Arroume%20N%5BAuthor%5D&cauthor=true&cauthor_uid=15808900 https://www.ncbi.nlm.nih.gov/pubmed/?term=Krier%20F%5BAuthor%5D&cauthor=true&cauthor_uid=15808900 https://www.ncbi.nlm.nih.gov/pubmed/?term=Chihib%20NE%5BAuthor%5D&cauthor=true&cauthor_uid=15808900 https://www.ncbi.nlm.nih.gov/pubmed/?term=de-la-Re-Vega%20E%5BAuthor%5D&cauthor=true&cauthor_uid=16098764 https://www.ncbi.nlm.nih.gov/pubmed/?term=Garc%C3%ADa-Galaz%20A%5BAuthor%5D&cauthor=true&cauthor_uid=16098764 https://www.ncbi.nlm.nih.gov/pubmed/?term=D%C3%ADaz-Cinco%20ME%5BAuthor%5D&cauthor=true&cauthor_uid=16098764 https://www.ncbi.nlm.nih.gov/pubmed/?term=Sotelo-Mundo%20RR%5BAuthor%5D&cauthor=true&cauthor_uid=16098764 155 Jr REW. High-resolution crystallographic analysis of a co-operative dimeric Hemoglobin. J. Mol. Biol. 235:657, 1994. Jr REW, Heard KS, Harrington DJ, Chiancone E. The 2.0 A crystal structure of Scapharca tetrameric hemoglobin: cooperative dimers within an allosteric tetramer. J. Mol. Biol. 253:168-186, 1995 Katsu M, Niizuma K, Yoshioka H, Okami N, Sakata H, Chan PH. Hemoglobin-induced oxidative stress contributes to matrix metalloproteinase activation and blood-brain barrier dysfunction in vivo. J. Cereb. Blood Flow Metab. 30: 1939-1950, 2010. Kawano T, Pinontoan R, Hosoya H, Muto S. Monoamine-dependent production of reactive oxygen species catalyzed by pseudoperoxidase activity of human hemoglobin. Biosci. Biotechnol. Biochem. 66: 1224-1232, 2002 Lieb B, Dimitrova K, Kang HS, Braun S, Gebauer W, Martin A, et al. Red blood with blue-blood ancestry: intriguing structure of a snail hemoglobin. Proc. Natl. Acad. Sci. USA 103: 12011-12016, 2006. Lilie H, Schwarz E, Rudolph R. Advances in refolding of proteins produced in E. Coli. Curr. Opin. Biotechnol. 9: 497-501, 1998. Mai WJ, Hu CQ, Wang WN. In vitro activation of the antibacterial activity by virus-resistant shrimp (Marsupenaeus japonicu) recombinant interferon-like protein. Aquaculture 288: 140-142, 2009. Mayer M, Buchner J. Refolding of inclusion body proteins. Methods Mol. Med. 94: 239-254, 2004. Nedjararroume N, Duboisdelval V, Adje EY, Jonathan T, François K, Patrice M et al. Bovine hemoglobin: an attractive source of antibacterial peptides. Peptides 29: 969, 2008. Niu R, Chen X. Full-Length cDNA, Prokaryotic Expression, and Antimicrobial Activity of UuHb-F-I fromUrechis unicinctus, Biomed. Res. Int. 2: 1-8, 2016. Parish CA, Jiang H, Tokiwa Y, Berova N, Nakanishi K, McCabe D et al. Broad-spectrum antimicrobial activity of hemoglobin. Bioorgan Med. Chem. 9: 377-382, 2001. Perutz MF. Regulation of oxygen affinity of hemoglobin: influence of structure of the globin on the heme iron. Annu. Rev. Biochem. 48: 327-386, 1979. Przybylski R. Selective separation of an antimicrobial peptide from bovine hemoglobin hydrolysates by electrodialysis with ultrafiltration membranes. Eur. Congr. Appl. Biotechnol., 2015. Riggs AF. Aspects of the origin and evolution of non-vertebrate hemoglobins. Am. Zool. 31: 535-545, 1991. Singh S, Panda A. Solubilization and refolding of bacterial inclusion body proteins. J. Biosci. Bioeng. 99: 303-310, 2005. Srihongthong S, Pakdeesuwan A, Daduang S, Araki T, Dhiravisit A, Thammasirirak S. Complete amino acid sequence of globin chains and biological activity of fragmented crocodile hemoglobin (Crocodylus siamensis). Protein J. 31: 466-476, 2012. Suzuki T, Nakamura A, Satoh Y, Inai C, Furukohri T, Arita T, et al. Primary structure of chain I of the heterodimeric hemoglobin from the blood clam Barbatia virescens. J. Protein Chem. 11: 629-633, 1992. Terwilliger N. Functional adaptations of oxygen-transport proteins. J. Exp. Biol. 201: 441-443, 1998. Vallejo F, Rinas U. Strategies for the recovery of active proteins through refolding of bacterial inclusion body proteins. Microb. Cell Fact. 3: 85-100, 2004. Wang J, Bao Y, Wang S, Lin Z, Antibacterial activity and mechanisms of heterotetramer hemoglobin derived polypetide from Tegillarca granosa, Haiyang Xuebao 37: 106-115, 2015. Wang Q. Molecular cloning, expression and immune-related research on the hemolobin from blood clam Tegillarca granosa. Dissertation in Shanghai Ocean University, 2012. Wang S, Bao Y, Shi M, Zhen D, Yang T, Lin Z. Purification and antibacterial activity of hemoglobin from Tegillarca granosa. Acta Oceanol. Sin. 36: 67-73, 2014. Wang S, Yu X, Lin Z, Zhang S, Xue L, Xue Q, et al. Hemoglobins Likely Function as Peroxidase in Blood ClamTegillarca granosa Hemocytes. J Immunol. 8: 1-10, 2017. Xu B, Zhao J, Jing Z, Zhang Y, Shi Y, Fang T. Role of hemoglobin from blood clam Scapharca kagoshimensis beyond oxygen transport. Fish Shellfish Immun. 44: 248-256, 2015. Yun EY, Lee JK, Kwon OY, Hwang JS, Kim I, Kang SW, et al. Bombyx mori transferrin: genomic structure, expression and antimicrobial activity of recombinant protein. Dev. Comp. Immun. 33:1064, 2009. Zhang D, Guan R, Huang W, Xiong J. Isolation and characterization of a novel antibacterial peptide derived from hemoglobin alpha in the liver of Japanese eel, Anguilla japonica. Fish Shellfish Immun. 35: 625-631, 2013. Zhao J, Song L, Li C, Ni D, Wu L, Zhu L, et al. Molecular cloning, expression of a big defensin gene from bay scallop Argopecten irradians and the antimicrobial activity of its recombinant protein. Molecular Immunol. 44: 360-368. 2007. https://www.ncbi.nlm.nih.gov/pubmed/?term=Dhiravisit%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22648692 https://www.ncbi.nlm.nih.gov/pubmed/?term=Thammasirirak%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22648692 156 Suppl. Fig. 1 SDS-PAGE analysis of recombinant Tg-HbIIA. Lane 1, non-induced; Lane 2, after induction by 37 °C, 2h; Lane 3, after induction by 37 °C, 3 h; Lane 4, after induction by 37 °C, 4 h; Lane 5, after induction by 37 °C, 5 h; lane M, Broad range protein molecular weight markers. Suppl. Fig. 2 SDS-PAGE analysis of recombinant Tg-HbIIB. Lane 1, non-induced; Lane 2, after induction by 28 °C, 3 h; Lane 3, after induction by 28 °C, 4 h; Lane 4, after induction by 28 °C, 5 h; Lane 5, after induction by 28 °C, 6 h; lane M, Broad range protein molecular weight markers. Suppl. Fig. 3 The mass spectrogram of recombinationt HbIIB from Tegillarca granosa.