ISJ 13: 89-93, 2016    


ISJ 13: 89-93, 2016                                 ISSN 1824-307X 
 
 

RESEARCH REPORT 
 

EF-1α silencing by feeding RNAi suppresses resting cyst formation in Colpoda 
cucullus Nag-1 strain 
 
Y Sogame1, M Hori2, T Matsuoka1 
 
1Department of Biological Science, Faculty of Science, Kochi University, Kochi 780-8520, Japan 
2Division of Environmental Science and Engineering, Graduate School of Science and Engineering, Yamaguchi 
University,Yamaguchi 753-8512, Japan 
 
 

   Accepted March 15, 2016 
 

Abstract 
It is reported that the expression level of EF-1α in Colpoda cucullus Nag-1 is markedly enhanced 

within several hours after the onset of encystment induction. In this study, the Colpoda strain (stock 
EQ-1) known to promptly encyst also showed early EF-1α expression while the strain (stock ES-1) 
known to show prolonged encystment also showed delayed EF-1α expression. In cells in which EF-1α 
is silenced by feeding RNAi, the cyst formation was prolonged, but normal cyst walls were formed. 
These results suggest that Colpoda EF-1α is involved in the early morphogenetic events of the resting 
cyst formation by accelerating protein translation or cytosleletal dynamics such as microtubule 
disintegration. 

 
Key Words: EF-1α; Colpoda; encystment; feeding RNAi 

 
 
Introduction 

 
Soil ciliates such as Colpoda quickly transform 

into resting cysts resistant to desiccation, high 
temperature, freezing, and acid (Taylor and 
Strickland, 1936; Maeda et al., 2005; Müller et al., 
2010; Sogame et al., 2011) before the temporary 
puddles in which they dwell dry up. The resting cyst 
formation of Colpoda cucullus Nag-1 is promptly 
induced by suspension in a Ca2+-containing 
food-free medium at a high cell density (encystment 
induction by Ca2+/ overpopulation) (Yamaoka et al., 
2004; Maeda et al., 2005), while excystment is 
induced by components contained in wheat leaves 
or by sodium copper chlorophyllin (chlorophyllin-Cu) 
(Tsutsumi et al., 2004). When the vegetative cells of 
C. cucullus Nag-1 are stimulated to encyst, diffusion 
of external Ca2+ into the cell interior is accelerated by 
cell-to-cell mechanical stimulation (Matsuoka et al., 
2009; Asami et al., 2010; Sogame and Matsuoka, 
2013), followed by cAMP-dependent protein 
phosphorylation (Sogame et al., 2012a, 2014a) and 
alteration of expression levels of proteins (Sogame 
et al., 2014b) such as elongation factor 1α (EF-1α) 
(Sogame et al., 2012b). The fact that the expression 
of Colpoda EF-1α is prominently enhanced in the 
___________________________________________________________________________ 

 
Corresponding author: 
Tatsuomi Matsuoka  
Department of Biological Science  
Faculty of Science  
Kochi University, 780-8520, Japan 
E-mail: tmatsuok@kochi-u.ac.jp 
 

 
 
early phase of encystment (several hours after the 
onset of encystment induction), while its expression 
level is regained (reduced) within 1 h after onset of 
excystment induction (Sogame et al., 2013) implies 
that EF-1α may play an important role in the 
disintegration of the vegetative cell structure of 
Colpoda and its reconstruction into resting cysts. 
The present study showed that EF-1α plays a key 
role in certain processes in the encystment events of 
C. cucullus Nag-1. 

 
Materials and Methods 

 
Cell culture and encystment induction 

Colpoda cucullus Nag-1 strain, which was 
collected as a resting cyst from the soil suface in 
Kochi Prefecture in Japan, was cultured in a 0.05 % 
(w/v) infusion of dried wheat leaves inoculated with a 
non-pathogenic strain of bacteria (Klebsiella 
pneumoniae). Klebsiella pneumoniae were cultured 
on agar plates containing 1.5 % agar, 0.5 % 
polypepton, 1 % meat extract and 0.5 % NaCl. The 
vegetative cells of C. cucullus Nag-1 cultured for 1 - 
2 days were rinsed 2 - 3 times with 1 mM Tris-HCl 
(pH 7.2), and subjected to sedimentation (1,500×g 
for 2 min) and resuspension; the cells were then 
induced to encyst by being suspended in 
encystment-inducing medium (1 mM Tris–HCl [pH 
7.2], 0.1 mM CaCl2) at a high cell density (50,000 
cells/ml) (encystment induction by 
Ca2+/overpopulation). As a control, the vegetative 

89 
 



 
 
Fig. 1 Comparison of the time course of encystment and EF-1α expression between two stock cultures of C. 
cucullus Nag-1. (a) Time course of encystment rate. Closed circles, Stock ES-1, with slowly induced encystment; 
open circles, Stock EQ-1, with quickly induced encystment. In this measurement, rounded cells with an ectocyst 
layer were counted as encysting cells. (b) SDS-PAGE of total proteins contained in the cells of encysting Colpoda, 
showing EF-1α expression level (arrows). The solubilized samples of Stock ES-1 and EQ-1 were obtained at 0 to 6 
h (labeled on the top of each lane) after the onset of encystment induction. 
 
 
 
cells were suspended in 1 mM Tris-HCl (pH 7.2) at a 
low cell density (2,000 cells/ml) so that the resting 
cyst formation could be inhibited as much as 
possible. Excystment induction was carried out by 
replacing the surrounding medium 
(encystment-inducing medium) of 10-day-old resting 
cysts by a fresh 0.05 % (w/v) wheat-leaf infusion. 

 
Sodium dodecyl sulfate-polyacrylamide gel 
electrophoresis (SDS-PAGE) 

SDS-PAGE was carried out according to 
Laemmli’s method (Laemmli, 1970) with a slight 
modification. The vegetative cells and encysting 
cells of C. cucullus Nag-1 were solubilized in 
SDS-PAGE sample buffer containing 1% SDS, 30 
mM Tris-HCl (pH 6.8), 5 % 2-mercaptoethanol and 
10 % glycerol, followed by boiling for 3 min. A 
sample containing 5,000 cells was applied in each 
lane, and electrophoresed on a 10 % gel at 150 V. 
The gels were stained with a solution containing 
0.2 % Coomassie brilliant blue (CBB) R250, 45 % 
(v/v) methanol and 10 % glacial acetic acid, and then 
destained in a 27 % (v/v) methanol, 9 % glacial 
acetic acid solution. 

Determination of partial nucleotide sequence of the 
EF-1α of C. cucullus Nag-1 

PCR amplification of C. cucullus Nag-1 EF-1α 
(using TAKARA Prime STAR HS) was performed 
using genomic DNA, and the nucleotide sequence 
was determined (GenBank accession No. 
AB918921.1). Amplification primers (sense: 
5’-AAGAACATGATTACCGGT; antisense: 
5’-GAACCAGGTAAGGTTGGG) were designed 
based on the sequence of C. inflate (GenBank, 
accession No. AF056098.1). 

 
Gene silencing by feeding RNAi method 

The region (336 bp) of the open reading frame 
of C. cucullus Nag-1 EF-1α (GenBank accession No. 
AB918921.1) was amplified by PCR, followed by 
cloning into the Litmus 28i vector (New England 
BioLabs) between the two T7 promoters. For PCR, a 
set of primers connected with EcoRI-HF (New 
England BioLabs) or HindIII-HF (New England 
BioLabs) recognition sequences (underlined) and 4 
extra nucleotides (5’-CCGC) (sense: 5’- 
CCGCGAATTCAAGAACATGATTACCGGT/antisen
se: 5’- CCGCAAGCTTGAACCAGGTAAGGTTGGG) 

90 
 



 
 
Fig. 2 Suppression of encystment and semi-quantitative RT-PCR in C. cucullus Nag-1 cells whose EF-1α had 
been silenced by RNAi. (a) Time course of encystment rates of EF-1α-silenced cells (closed circles) and 
nonsilenced cells (open circles) of Stock EQ-1. In this measurement, rounded cells with an ectocyst layer were 
counted as encysting cells. (b) Semi-quantitative RT-PCR of EF-1α, showing electrophoresis images of EF-1α and 
α-tubulin expression in nonsilenced cells (Control), left lane, and EF-1α-silenced cells (3 days after induction of 
gene silencing), right lane.  
 
 
 
 
was used. Escherichia coli strain HT115 was 
transformed by the introduction of the obtained 
constructs. In order to confirm that the E. coli strain 
HT115 might be transformed by the introduction of 
an EF-1α-gene-cloned Litmus 28i vector, the vector 
was isolated from the E. coli HT115 strain, and the 
nucleotide sequence was determined. In this case, a 
set of primer sequences (M13 primer M3: 
5’-GTAAAACGACGGCCAGT/M13 primer RV: 
5’-CAGGAAACAGCTATGAC) was used. 

RNAi gene silencing was carried out according 
to the method described previously (Galvani and 
Sperling, 2002; Kutomi et al., 2012) with 
modifications. Resting cysts of Colpoda cucullus 
Nag-1 were stimulated to encyst in 0.05 % wheat 
leaves infusion (culture medium), and cultured for 
about 12 h in this medium. Thus, cultured cells were 
suspended using a thin pipette at a cell density of 10 
cells/ml in culture medium containing 100 μg/mL 
ampicillin, 100 μg/ml tetracycline and 0.4 mM 
isopropyl β-D-thiogalactopyranoside (IPTG). Gene 
silencing was initiated by the addition of E. coli strain 
HT115 into the culture medium at the cell density of 
OD600 of 0.25, which was transformed to produce 
double-stranded RNA of EF-1α. For the control 
(nonsilenced Colpoda), E. coli strain HT115 
transformed by the introduction of a Litmus 28i 
vector from which the EF-1α gene had been 
excluded was added into the culture medium at the 
cell density of OD600 of 0.25. 

Semi-quantitative RT-PCR 
Total RNA was extracted from C. cucullus 

Nag-1 vegetative cells by an acid guanidinium 
thiocyanate-phenol-chloroform technique using 
ISOGEN-II (NIPPON GENE Co., Ltd, Tokyo, Japan) 
according to the attached protocol. The total RNA (4 
μg) was reverse transcribed using GoScript Reverse 
Transcription System (Promega) according to the 
attached protocol. The 100 μl of PCR mixture for 
competitive PCR amplification (30 cycles using Go 
Taq Green Master Mix [Promega]) contained 5 μl 
cDNA solution (containing 1 ng cDNA) as a template. 
PCR amplification of EF-1α gene of C. cucullus 
Nag-1 was performed using EF-1α primers 
5’-TAAGTCCACCTCCACTGG (sense) and 
5’-TGGCGGTTTCGAACTTCC (antisense), which 
had been designed based on the sequence of C. 
inflate (GenBank, accession No. AF056098.1). As 
an internal control for cDNA quantity, the α-tubulin 
gene of C. cucullus Nag-1 was amplified using the 
primers 5’-CTGAAACTGGTGCTGG (sense) and 
5’-CAGTGTGTTCAAGAAGGG (antisense), 
designed based on the sequence of Colpoda sp. 
(GenBank, accession No. X94348.1). 

Amplified PCR products were electrophoresed 
in 2.0% agarose gels, followed by visualization with 
ethidium bromide staining. In order to confirm that 
each band was a PCR product of the EF-1α (194 bp) 
or α-tubulin (456 bp) gene, DNA was extracted from 
each gel band using phenol, and their sequences 

91 
 



were determined (EF-1α: GenBank accession No. 
AB976559.1; α-tubulin; GenBank accession No. 
LC004697.1). 

The rate of encystment and excystment is 
expressed as a percentage of the total number of 
tested cells (142-161 cells). Points (columns) and 
attached bars correspond to the means of six 
identical measurements (140 - 163 cells per 
measurement) and standard errors. 

 
Results and Discussion 

 
We compared the time course of 

Ca2+/overpopulation-induced encystment initiation 
between two stock cultures of C. cucullus Nag-1 
cells, those in which encystment was slowly induced 
(Stock ES-1) and those in which encystment was 
quickly induced (Stock EQ-1) (Fig. 1a). As shown in 
Figure 1a, compared to Stock EQ-1 (open circles), 
encystment initiation of ‘Stock ES-1’ (closed circles) 
was significantly prolonged (p < 0.01 in 3, 4, 5, 6 h 
after the onset of encystment induction, 
Mann-Whitney test). SDS-PAGE of total proteins of 
the cells obtained from these two stocks showed that 
the expression of a protein around 48 - 49 kDa which 
had been identified EF-1α (Sogame et al., 2012b) 
was enhanced 1 hour after onset of encystment 
induction in Stock EQ-1 cells (Fig. 1b-2), but several 
hours after onset of encystment induction in Stock 
ES-1 cells (Fig. 1b-1). 

Encystment occurred spontaneously in the 
culture medium. We silenced EF-1α expression in 
Stock EQ-1 cells by feeding E. coli containing 
knockdown plasmid, and examined the effect of 
EF-1α silencing on the spontaneously induced 
encystment during culturing (Fig. 2a). Compared to 
nonsilenced cells (Fig. 2a, open circles), the 
encystment initiation of EF-1α-silenced cells was 
significantly suppressed (p < 0.01 at 4 days after 
initiation of culturing, Mann-Whitney test). We used 
competitive PCR to examine whether the EF-1α 
mRNA expression in Colpoda fed E. coli containing 
the knockdown plasmid was actually silenced. 
Semi-quantitative RT-PCR showed that the amount 
of EF-1α mRNA contained in the silenced Colpoda 
was decreased (Fig. 2b) while the amount of 
α-tubulin mRNA used as an internal control was 
almost identical between the silenced and 
nonsilenced cells (Fig. 2b). 

Photomicrographs shown in Figure 3a, b are 
motile cells surrounded by endocyst layers (en) just 
emerging from the mechanically ruptured ectocyst 
(ec) of a 10-day-old resting cyst, and they indicate 
that an ectocyst layer and endocyst layers are 
formed in EF-1α-silenced Colpoda cysts (Fig. 3b) 
identical to the case with the nonsilenced Colpoda 
cyst (Fig. 3a). In addition, there was no difference (p 
> 0.05, Mann-Whitney test) in the emergence rate 
(%) between nonsilenced (Fig. 3c, ‘Control’) and 
EF-1α-silenced cells (Fig. 3c, ‘EF-1α silenced’) when 
excystment was induced by replacing the 
surrounding encystment-inducing medium with fresh 
0.05 % (w/v) wheat-leaf infusion. These resuts 
indicate that EF-1α-silenced cells may ultimately 
become mature resting cysts despite the cyst 
formation was prolonged. 

 
 
Fig. 3 Excystment of C. cucullus Nag-1 cells whose 
EF-1α had been silenced by RNAi. (a), (b) 
Photomicrographs of EF-1α-nonsilenced cells (a) 
and silenced cells (b), showing just-emerging cells 
surrounded by endocyst layers (en) through the 
rupture of the hard ectocyst layer (ec). (c) Effect of 
RNAi silencing of EF-1α on the emergence rate (%) 
in the excystment-induced cysts. Left and right 
columns correspond to the EF-1α-nonsilenced 
(Control) and -silenced cells. The photomicrographs 
(a, b) and the emergence rate (c) were obtained at 1 
h after the onset of excystment induction in the 
resting cysts which had been spontaneously formed 
until the 10th day of culture of vegetative cells (Stock 
EQ-1) in normal culture medium or EF-1α-silencing 
medium. 

 
 
 
The results obtained in the present study 

suggest that Colpoda EF-1α may play a role in early 
events in the encystment process. EF-1α is one of 
the subunits of translation elongation factor 1 
composed of four different subunits (Ejiri, 2002), and 
has multiple functions such as a translation in 
ribosomes (Ejiri, 2002), bundling of actin filaments 
(Kurasawa et al., 1996), severing of microtubules 

 

92 
 



(Shiina et al., 1994) and regulation of the 
proteasome-dependent degradation of proteins 
(Gonen et al., 1994). Judging from the multiple 
functions of EF-1α, it is suggested that enhancement 
in the EF-1α expression level may be involved in the 
acceleration of morphogenetic events such as cyst 
wall formation by promoting protein translation in the 
regulation of protein disintegration, or in cytoskeletal 
dynamics such as microtubule disintegration. 
 
Acknowledgements 

This work was financially supported by a 
Sasagawa Scientific Research Grant (#24-407) from 
the Japan Science Society, by a Basic Scientific 
Research Grant (#140890) from Sumitomo 
foundation and by a Research Fellowship from the 
Japan Society for the Promotion of Science for 
Young Scientists (#13J08784). 

 
References 
Asami H, Ohtani Y, Iino R, Sogame Y, Matsuoka T. 

Behavior and Ca2+-induced cell signaling for 
encystment of Colpoda cucullus. J. Protozool. 
Res. 20: 1-6, 2010. 

Ejiri S. Moonlighting functions of polypeptide 
elongation factor 1: From actin bundling to zinc 
finger protein R1-associated nuclear localization. 
Biosci. Biotechnol. Biochem. 66: 1-21, 2002. 

Galvani A, Sperling L. RNA interference by feeding 
in Paramecium. Trends Genet. 18: 11-12, 2002. 

Gonen H, Smith CE, Siegel NR, Kahana C, Merrick 
WC, Chakraburtty K, et al. Protein synthesis 
elongation factor EF-1a is essential for 
ubiquitin-dependent degradation of certain 
N-acetylated proteins and may be substituted 
for by the bacterial elongation factor EF-Tu. 
Proc. Natl. Acad. Sci. USA 91: 7648-7652, 
1994. 

Kurasawa Y, Watanabe Y, Numata O. 
Characterization of F-actin bundling activity of 
Tetrahymena elongation factor 1 a investigated 
with rabbit skeletal muscle actin. Zool. Sci. 13: 
371-375, 1996. 

Kutomi O, Hori M, Ishida M, Tominaga T, Kamachi H, 
Koll F, et al. Outer dynein arm light chain 1 is 
essential for controlling the ciliary response to 
cyclic AMP in Paramecium tetraurelia. Eukaryot 
Cell 11: 645-53, 2012. 

Laemmli UK. Cleavage of structural proteins during 
the assembly of the head of bacteriophage T4. 
Nature 227: 680-685, 1970. 

Maeda H, Akematsu T, Fukui R, Matsuoka T. 
Studies on the resting cyst of ciliated protozoan 
Colpoda cucullus: Resistance to temperature 
and additional inducing factors for en-or 
excystment. J. Protozool. Res. 15: 7-13, 2005. 

Matsuoka T, Kondoh A, Sabashi K, Nagano N, 
Akematsu T, Kida A, et al. Role of Ca2+ and 
cAMP in a cell signaling pathway for resting cyst 

formation of ciliated protozoan Colpoda cucullus. 
Protistology 6: 103-110, 2009. 

Müller H, Achilles-Day UEM, Day JG. Tolerance of 
the resting cysts of Colpoda inflata (Ciliophora, 
Colpodea) and Meseres corlissi (Ciliophora, 
Spirotrichea) to desiccation and freezing. Eur. J. 
Protistol. 46: 133-142, 2010. 

Shiina N, Gotoh Y, Kubomura N, Iwamatsu A, 
Nishida E. Microbutule severing by elongation 
factor 1alpha. Science 266: 282-285, 1994. 

Sogame Y, Kida A, Matsuoka T. Possible 
involvement of endocyst in tolerance of the 
resting cyst of Colpoda cucullus against HCl. Afr. 
J. Microbiol. Res. 5: 4316-4320, 2011. 

Sogame Y, Kojima K Takeshita T, Kinoshita E, 
Funadani R, Matsuoka T. 
Excystment-dependent protein expression in 
terrestrial ciliate Colpoda cucullus. Microbes 
Environ. 28: 388-390, 2013. 

Sogame Y, Kojima K, Takeshita T, Kinoshita E, 
Matsuoka T. Identification of cAMP-dependent 
phosphorytlated proteins involved in the 
formation of environment-resistant resting cysts 
by the terrestrial ciliate Colpoda cucullus. Inv. 
Surv. J. 11: 213-218, 2014a. 

Sogame Y, Kojima K, Takeshita T, Fujiwara S, 
Miyata S, Kinoshita E, et al. Protein 
phosphorylation in encystment-induced 
Colpoda cucullus: Localization and identification 
of phosphoproteins. FEMS Microbiol. Lett. 331: 
128-135, 2012a. 

Sogame Y, Kojima K, Takeshita T, Kinoshita E, 
Matsuoka T. EF-1α and mitochondrial ATP 
synthase β chain: Alteration of their expression 
in encystment-induced Colpoda cucullus. J. Euk. 
Microbiol. 59: 401-406, 2012b. 

Sogame Y, Kojima K, Takeshita T, Kinoshita E, 
Matsuoka T. Identification of differentially 
expressed water-insoluble proteins in the 
encystment process of Colpoda cucullus by 
two-dimensional electrophoresis and 
LC-MS/MS analysis. J. Euk. Microbiol. 61: 
51-60, 2014b. 

Sogame Y, Matsuoka T. Evaluation of intracellular 
Ca2+ concentration by fura 2 ratiometry in 
encystment-induced Colpoda cucullus. Acta 
Protozool. 52: 51-54. 2013. 

Taylor CV, Strickland AGR. Effects of high vacua 
and extreme temperatures on the cysts of 
Colpoda cucullus. Physiol. Zool. 9: 15-26, 1936. 

Tsutsumi S, Watoh T, Kumamoto K, Kotsuki H, 
Matsuoka T. Effects of porphyrins on 
encystment and excystment in ciliated 
protozoan Colpoda sp. Jpn. J. Protozool. 3: 
119-126, 2004. 

Yamaoka M, Watoh T, Matsuoka T. Effects of salt 
concentration and bacteria on encystment 
induction in ciliated protozoan Colpoda sp. Acta. 
Protozool. 43: 93-98, 2004. 

 

93 
 

http://www.ncbi.nlm.nih.gov/pubmed/22427431
http://www.ncbi.nlm.nih.gov/pubmed/22427431