316 ISJ 15: 316-326, 2018 ISSN 1824-307X RESEARCH REPORT Molecular characterization of the dual oxidase (LvDuox) gene from the pacific white shrimp Litopenaeus vannamei Y Chen1,2,3, BJ Wang1,2, MQ Wang1,2, M Liu1,2, KY Jiang1,2, L Wang1,2* 1CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China 2Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China 3University of Chinese Academy of Sciences, Beijing 100049, China Accepted August 22, 2018 Abstract The reactive oxygen species（ROS） generated by dual oxidases (Duox) play a role in innate immunity in many organisms. In this study, a 4,735 bp full-length cDNA of the Pacific white shrimp dual oxidase (LvDuox) gene was cloned; the sequence included an open reading frame of 4,497 bp, encoding a protein of 1,498 aa with a calculated mass of 173 kDa. Structural analysis revealed that LvDuox contains several domains. Homology analysis revealed that LvDuox exhibits 96.1%, 67.3% and 67.3% sequence identity with Marsupenaeus japonicas, Drosophila melanogaster and Acyrthosiphon pisum Duox, respectively. The mRNA transcripts of LvDuox were detected in all tested tissues. The mRNA expression of LvDuox was significantly induced in the midgut after Vibrio parahaemolyticus E1 (VPE1) stimulation. After the level of H2O2 in the midgut increased, expression of the superoxide dismutase and catalase genes in the midgut increased significantly. These results suggested that the LvDuox gene was upregulated in the midgut after the challenge by VPE1, and antioxidant genes were involved in the regulation of ROS in the shrimp midgut. LvDuox may therefore be a new target for intestinal disease research in the Pacific white shrimp. Key Words: Litopenaeus vannamei; Duox; antioxidant gene; innate immunity Introduction In recent years, owing to water pollution and overuse of antibiotics, the intestines of aquatic animals have been exposed to substantial threats and challenges. In the Pacific white shrimp Litopenaeus vannamei, the gut is surrounded by various types of bacteria because of its open anatomical structure. Some pathogens and viruses induce inflammation in the mucosa (Qi et al., 2017), thus resulting in damage to the guts of shrimps. Vibrio Harveyi, Vibrio alginolyticus and Vibrio parahaemolyticus E1 (VPE1) are common pathogenic bacteria affecting the production of farmed prawns (Martin et al., 2004; Qi et al., 2017), and they pose a great threat to shrimp health. After the balance of intestinal flora is altered, the immune and digestive systems of shrimp may be affected ___________________________________________________________________________ Corresponding author: Lei W ang Key Laboratory of Experimental Marine Biology Institute of Oceanology Chinese Academy of Sciences Qingdao 266071, China E-mail: wanglei@qdio.ac.cn (Artis, 2008; Miyake et al., 2014; You et al., 2014). Therefore, it is crucial to maintain gut-microbiota homeostasis (van Baarlen et al., 2013; Meng et al., 2018) and determine the mechanism of defense against invading pathogens. The reactive oxygen species (ROS), which are produced by dual oxidase (Duox), have been suggested to be involved in inhibiting pathogenic bacterial infection in the gut (Ha et al., 2005; Yang et al., 2016). ROS include oxygen radicals and some oxidizing agents formed by the partial reduction of oxygen, such as superoxide (O2 -), hydroxyl (OH-), ozone (O3) and superoxide-derived hydrogen peroxide (H2O2) (Juven et al., 1996; Skulachev, 1998). They can damage the structure of DNA and the membrane system in eukaryotic cells, and induce lipid peroxidation (Wang et al., 2009). Therefore, ROS are considered to be a major cause of damage in organisms. Five homologs of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Nox1, Nox2, Nox3, Nox4 and Nox5) and two homologs of dual oxidase (Duox1 and Duox2) can produce ROS (Morand et al., 2009). Duox, a transmembrane protein in host cells, is the 317 main enzyme that generates ROS in epithelial cells of many organs (Flores et al., 2010; Kim et al., 2014). The structural organization of Duox is highly conserved in all studied organisms (Kim et al., 2014). Duox comprises a transmembrane domain, a calcium-modulated EF hand domain, a NADPH oxidase domain producing H2O2 and an extracellular peroxidase homology domain that converts H2O2 into HOCl (Sumimoto, 2008). H2O2 and chloride are important components of host gut immunity. In a study of Duox knockdown in flies, Duox has been found to be responsible for host resistance to gut infection in the gut epithelia (Biteau et al., 2008; Buchon et al., 2009; Kim et al., 2014). In Drosophila, H2O2 participates in the regulation of intestinal epithelial cell renewal by activating intestinal stem cell proliferation (Abid et al., 2000). In Anopheles gambiae, Duox-dependent H2O2 is involved in gut permeability by forming a dityrosine network at the peritrophic membrane (Kumar et al., 2010). In zebrafish, Duox-produced H2O2 facilitates wound healing and has an antimicrobial function (Niethammer et al., 2009; Flores et al., 2010). In addition, in Pacific white shrimp, H2O2 is produced and has a role in anti-microbial activity after pathogens enter the hemolymph (Munoz et al., 2000; Gomez-Anduro et al., 2006). Because the Pacific white shrimp is a crustacean that relies on its innate immune system, cloning the Duox gene has important implications for studies investigating resistance to pathogen invasion. However, the existence of Duox gene in the Pacific white shrimp had not been verified, and the mechanism of Duox gene expression in the Pacific white shrimp was unclear. In the present study, we cloned the full-length cDNA encoding the Duox gene from L. vannamei, which we designated LvDuox. Additionally, we investigated the expression of the Duox gene and two antioxidant enzymes (superoxide dismutase and catalase) genes in the gut of L. vannamei after infection by VPE1. Moreover, we detected H2O2 levels at different times after VPE1 challenge to determine the role of LvDuox in the natural immune defense mechanisms in the gut of L. vannamei. The results may provide a new therapeutic target for intestinal diseases of L. vannamei. Materials and methods Animals and Vibrio parahaemolyticus E1 challenge Adult Litopenaeus vannamei (average weight 11±0.12 g) was obtained from Ruizi Seafood Development Co. Ltd. (Qingdao, China). Before the experiment, the shrimp were randomly allocated to six tanks (each containing 50 L seawater), including three control tanks (C1, C2 and C3) for the gene cloning, and three treatment tanks (V1, V2 and V3) for VPE1 challenge, with forty prawns in each tank, and the shrimps were acclimatized at 28±1 °C in aerated and filtered seawater (salinity 30‰) for a week and fed commercial pellets (supplied by Da Le Co. Ltd, Yantai, China). During challenge, VPE1 was added into each treatment tank at a final concentration of 5×106 cfu/mL. The VPE1 strain was donated by Dr. Zhaolan Mo from Yellow Sea Fisheries Research Institute Chinese Academy of Fishery Sciences. RNA extraction and cDNA preparation Total RNA was extracted using a MiniBEST Universal RNA Extraction kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. RNA degradation and contamination were monitored on 1% agarose gels. The RNA purity and concentration of each sample were checked using a NanoPhotometer® spectrophotometer (Implen, Munich, Germany). The cDNA synthesis was carried out by TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China) in accordance with the manufacturer’s instructions, then stored at -20 °C and used as the temple for cloning and PCR analysis. Cloning and sequencing The template of cloning was the cDNA of gut from the healthy shrimp. The partial sequence of LvDuox cDNA was obtained from the transcriptome database of our laboratory. The primers were designed based on this partial sequence by Primer Premier5.0 (Table 1). Two pairs of gene-specific primers, D501/502R and D301/302F, were used to clone the 5’ end and 3’ end of cDNA of LvDuox by the rapid amplification of cDNA ends (RACE) technique according to the standard procedures. The other primers for cloning were designed based on the results of 5’ end and 3’ end, and were used by cloning the full-length cDNA of the LvDuox by PCR with the PrimeSTAR® GXL Premix (Takara Bio, Inc., Japan). The PCR products were cloned into the pEASY®-T1 Simple Cloning Vector (TransGen Biotech, China) and transformed into the Trans5α Chemically Competent Cell (TransGen Biotech, China), the positive recombinants were identified via anti-ampicillin selection. A sequence analysis was performed using a CEQ 8000 Automated Sequencer (Beckman Coulter, Inc., USA). The sequence similarity of cDNA was analyzed using FASTA and the basic local alignment search tool (BLAST) at the National Center for Biotechnology Information (NCBI). The theoretical isoelectric point and molecular mass were calculated using the ExPASy Proteomics Server (http://web.expasy.org/compute_pi). The structural domains of the white shrimp LvDuox were predicted using the simple Modular Architecture Research Tool (SMART; Version 7.0) (http://smart.emblheidelberg.de/). Using the MEGA 7.0 software package, a Neighbor-Joining (NJ) phylogenic tree was constructed using the full-length amino acid sequences of some published Duox proteins downloaded from NCBI, and multiple sequence alignments of some Duox proteins from NCBI using the BioEdit software package. Detecting the level of H2O2 To detect the level of H2O2 in the midgut of shrimp at different hours after the VPE1 challenge, three midguts were obtained from shrimps at 0 h, 3 h, 6 h, 12 h, 24 h and 36 h during the VPE1 stimulation. Then, the samples were measured with a Hydrogen Peroxide assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. http://web.expasy.org/compute_pi http://smart.emblheidelberg.de/ 318 Table 1 Primers used for the Pacific white shrimp LvDuox analysis in the paper Primers Sequence(5’-3’) Primers for 5’RACE D501R GTTGTTGTACCAGCCATCGT D502R GCCGAGCACAATCCATCTG Primers for 3’RACE D301F CATCTTCATCTTCGCGCACC D302F ATCTGGTCTTCGGAACGTCG Universal primers for RACE NUP AAGCAGTGGTATCAACGCAGAGT UPML CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT UPMS CTAATACGACTCACTATAGGGC 3’CDS AAGCAGTGGTATCAACGCAGAGTAC(T)30V N 5-AP-DG AAGCAGTGGTATCAACGCAGAGTGGGGGGGGGGHN Primers of cloning vector M13F TGTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC Primers for cloning the rest of sequence D503F TCAGATGGATTGTGCTCGGC D504F CAGATGGATTGTGCTCGG D505F TTATTTCCAGGGCTCTGAAGTGACG D506F AGAACTTCCGCAGGAGGCATTT D303R CACTTCAGAGCCCTGGAAATAATCA D304R AAGAGCCAGTAGCCCACGGT D305R AGATTTCCTGCGTCAGACACCT Primers for qRT-PCR analysis LvD1F ATCAGATGGATTGTGCTCGGC LvD1R GACTCAACGGAGCCCCAAGA SOD1F TGACGAGAGCTTTGGATCATTCC SOD1R TGATTTGCAAGGGATCCTGGTT CAT1F GGCTATGGTTCTCGTACTTCCAAGC CAT1R GCATTGTATAGGTCCCTTGTTGCA β-actin1F GCCCATCTACGAGGGATA β-actin1R GGTGGTCGTGAAGGTGTAA Gene expression by qRT-PCR To analyze the expression of LvDuox in various tissues of the white shrimp, including heart, hepatopancreas, intestine, eyestalk, gills and proventriculaus, these tissues were obtained from three healthy white shrimps. To analyze the expression of LvDuox, SOD and CAT of the midgut after it affected the VPE1, the midguts of shrimp (six shrimp per group) were extracted at 0 h, 3 h, 6 h, 12 h, 24 h and 36 h after the VPE1 challenge. The genetic expression of all the temples from these tissues was determined by quantitative real-time PCR (qRT-PCR). All the temples were carried out in triplicate with a total volume of 20 μL containing 10 μL 2×TransStart® Top Green qPCR SuperMix, 2 μL of cDNA, 0.4 μL each of the forward and reverse primers (final concentration 0.2 μM) and 7.2 μL of ddH2O. The qRT-PCR using SYBR green I dye (TransGen Biotech, China) was performed using the following cycling conditions: denaturation for 30 s at 94 °C, followed by 40 cycles of 5 s at 94 °C, and 30 s at 60 °C. The gene expression analysis primers of LvDuox, CAT and SOD are listed in Table 1. 319 Fig. 1 The nucleotide and deduced amino acid sequences of the L.vannamei dual oxidase (LvDuox) cDNA. The sequence has been deposited in the GenBank (accession number MG734366). The cDNA (4735 bp) contains a complete ORF encoding a protein of 1,498 amino acid residues (residue number indicated on the left). The start codon ATG and the stop codon TAA are indicated by the rectangle. The Primer sequences for the qRT-PCR analysis are indicated by the solid lines 320 Fig. 2 Comparison of the predicted domain structures of dual oxidases from different organisms. The names of the different domains are marked. The full name, abbreviation and accession number of different Duoxs are listed in the Table 3 Statistical analysis The expression of β-actin gene was used as the reference gene of all the samples, and the comparative CT method (2-ΔΔCt) was used to analyze the expression level of LvDuox and the other genes. The results are expressed as means ± standard deviation (SD). To compare the differences between the data of different groups in different hours, the statistical analysis of these data was performed by one-way analysis of variance (one-way ANOVA) using SPSS Statistics 24.0 software. The P < 0.05 was considered statistically significant. Results Sequence and domain structures of LvDuox A 4,735 bp nucleotide sequence of LvDuox was assembled and included an open reading frame (ORF) of 4,497 bp, encoding a protein of 1,498 aa with a calculated molecular mass of approximately 173 kDa and a theoretical isoelectric point of 6.98 (Fig. 1). The cDNA sequence of LvDuox has been deposited in GenBank under accession number MG734366. To determine the similarity of the complete domain structure of LvDuox to those of other Duoxs, we predicted the structural domains of the Duoxs from different animals by using the Simple Modular Architecture Research Tool (Fig. 2). The deduced amino acid sequence of LvDuox contains a signal peptide (1–21 aa), a peroxidase-like domain (33-557 aa), two transmembrane regions (593–615 aa and 988–1,010 aa), a coiled coil (726–766 aa), three EF-hand motifs (calcium binding region: 818–846 aa, 854–882 aa and 899–927 aa), a ferric reduction region (1,031–1,178 aa), a FAD binding domain (1,214–1,317 aa) and a NADPH binding domain (1,323–1,479 aa). The structural domains of LvDuox were nearly the same as those of MjDuox, and the peroxidase-like domain, transmembrane segment, ferric-reductase domain, FAD binding domain and NADPH binding domain were conserved among LvDuox and the other Duox proteins. A coiled coil was found only in LvDuox and MjDuox. Moreover, the signal peptide was not present in DmDuox and DrDuox1. As for the calcium binding region, three arthropod Duoxs (LvDuox, MjDuox and DmDuox) were predicted to have three EF-hand motifs, and the others were predicted to have two EF-hand motifs. 321 Fig. 3 Comparison of the amino acid sequence of dual oxidases from the Pacific white shrimp and the others organisms using the ClustalW program of BioEdit software. The full name, abbreviation and accession number are listed in the Table 3 322 Table 2 Amino acid identity of the Pacific white shrimp LvDuox gene compared to the others known Duoxes sequences Sequence homology and phylogenetic analysis Sequence alignment was performed to determine the sequence identity of LvDuox compared with the other Duox proteins (Fig. 3). LvDuox shares 96.1% sequence similarity with MjDuox, 67.3% with the insect Duox (DmDuox and ApDuox-like), 35% with the chordate Duox (CiDuox-B) and 36.2–39.2% with the other Duoxs (Table 2). To elucidate the evolutionary relationships between LvDuox and other Duoxs, a neighbor-joining phylogenic tree was constructed by using sequence alignments in MEGA software (Fig. 4). In this phylogenic tree, LvDuox formed a cluster with arthropod Duoxs, including MjDuox, DmDuox, TcDuox and CfDuox. The XtDuox2, BtDuox2 and the other Duoxs formed another cluster. Fig. 4 The Neighbor-Joining (NJ) phylogenic tree constructed using MEGA 7.0 software package based on the amino acid sequences of Duoxs from different organisms. The numbers at the forks indicated the bootstrap value. The scale bar represents the proportion of amino acid differences between sequences based on nucleotide substitutions per site. The species and protein sequences ID are listed in Table 3 Entire Duox 1 2 3 4 5 6 7 8 9 10 11 12 1.LvDuox 2.MjDuox 96.1% 3.DmDuox 67.3% 67.0% 4.ApDuox-like 67.3% 66.9% 68.8% 5.SpDuox1 37.2% 37.3% 36.6% 35.6% 6.CiDuox-B 35.0% 35.1% 33.4% 34.5% 37.2% 7.XtDuox1 37.0% 36.6% 36.9% 35.5% 38.3% 43.5% 8.XtDuox2 36.2% 35.8% 35.1% 35.7% 35.6% 40.6% 56.6% 9.CjDuox2 38.1% 37.9% 37.5% 36.3% 39.4% 43.6% 61.5% 57.9% 10.HsDuox1 39.2% 39.3% 37.3% 36.0% 39.0% 42.2% 60.5% 56.2% 64.7% 11.HsDuox2 37.9% 37.8% 36.1% 35.0% 39.2% 41.8% 59.7% 56.4% 65.8% 77.2% 12.PcDuox2 37.6% 37.8% 36.4% 34.3% 38.7% 42.5% 60.0% 56.0% 65.9% 74.8% 87.4% 323 Table 3 Amino acid sequence numbers, symbols, GenBank accession numbers and nomenclatures used in the paper Symbol Accession number Nomenclature 1.LvDuox MG734366 Litopenaeus vannamei 2.MjDuox AB744213 Marsupenaeus japonicus 3.DmDuox NP_608715 Drosophila melanogaster 4.SpDuox1 NP_001118237 Strongylocentrotus purpuratus 5.DrDuox1 BAF33370 Danio rerio 6.CjDuox2 XP_015727798 Coturnix japonica 7.HsDuox1 AAI14939 Homo sapiens 8.HsDuox2 EAW77288 Homo sapiens 9.BtDuox2 DAA25263 Bos taurus 10.RnDuox1 AAN33120 Rattus norvegicus 11.RnDuox2 NP_077055 Rattus norvegicus 12.GgDuox2 XP_425053 Gallus gallus 13.XtDuox1 XP_002937936 Xenopus (Silurana) tropicalis 14.XtDuox2 XP_002937935 Xenopus (Silurana) tropicalis 15.CfDuox EFN70161 Camponotus floridanus 16.TcDuox XP_970848 Tribolium castaneum 17.ApDuox-like XP_001951113 Acyrthosiphon pisum 18.CiDuox-B FAA00329 Ciona intestinalis 19.BmDuox JQ768349 Bombyx mori 20.PcDuox2 XP_007121449 Physeter catodon Fig. 5 Pacific white shrimp LvDuox expression in various tissues of healthy shrimps (n=3). Tissue distribution of cDNA of LvDuox was detected using quantitative real-time PCR. β-actin gene was used as the reference gene, and vertical bars represented mean ± SD 324 Fig. 6 The levels of the H2O2 in the midgut of the Pacific white shrimp following affected the V. parahaemolyticus E1 (VPE1). The level of the H2O2 was detected at different hours (0-36 h) using a hydrogen peroxide assay kit according to the manufacturer’s instructions Analysis of LvDuox expression in various tissues The qRT-PCR was used to detect the tissue distribution of LvDuox gene expression, by using the β-actin gene as a reference. The expression levels of the LvDuox gene were observed in different tissues, such as the heart, hepatopancreas, intestine, eyestalk, gills and proventriculus. The results showed that the expression of LvDuox was higher in the gills than in the other tissues (Fig. 5). H2O2 levels in the midgut after VPE1 challenge Before VPE1 challenge, H2O2 was present at a low level in the shrimp midgut (0.45 mmol/g prot). After VPE1 stimulation, it increased at 3 h and peaked at 6 h (0.88 mmol/g prot), then declined gradually afterward (Fig. 6); the results were consistent with the expression of the LvDuox gene (Fig. 7). Analysis of expression of LvDuox and antioxidant genes after VPE1 challenge During VPE1 challenge, the midguts of Pacific white shrimps were obtained at 0 h, 3 h, 6 h, 12 h, 24 h and 36 h. The expression levels of the LvDuox gene, superoxide dismutase (SOD) gene and catalase (CAT) gene in the shrimp midgut were determined using quantitative real-time PCR (Fig. 7). The relative gene expression level of LvDuox in the midgut increased significantly at 3 h (5.03+0.41) and 6 h (5.33+0.4) (P<0.05), then decreased gradually at 12–36 h. The expression of the SOD gene decreased 3–6 h after the VPE1 challenge, then began to increase at 12 h (2.16+0.21), peaked at 24 h (3.53+0.22) (P<0.05) and then decreased significantly at 36 h. The expression level of the CAT gene at 6–12 h was lower than that at 0–3 h, but significantly increased at 24 h (2.32+0.28) (P<0.05), then decreased to normal levels. Discussion Duox has been studied extensively in many model species, but there have been few reports in commercial aquatic animals. The role of Duox in the innate immunity of the Pacific white shrimp remains unknown. In this study, the full-length sequence of the Duox gene of the Pacific white shrimp was cloned and named LvDuox, and was deposited in GenBank under accession number MG734366 (not released). The ORF was 4,497 bp and encoded a 1,498 amino acid protein with a theoretical mass of 173 kDa, results similar to those for Marsupenaeus japonicus (~173 kDa), Bombyx mori (~172 kDa), Danio rerio (~172 kDa) and Drosophila melanogaster (~178 kDa). The amino acid sequence of LvDuox has a higher identity to Duox from arthropods than from other species. Both structural domain comparison and sequence alignment indicated that LvDuox was more similar to crustacean MjDuox than to other Duoxs (Inada et al., 2013). Thus, the Duox gene appears to be highly conserved in different kinds of shrimp. The analysis of structural domains of LvDuox revealed that a peroxidase domain, the transmembrane segment, the calcium binding region, a ferric reduction region, a FAD binding domain and a NADPH binding domain were conserved, and the signal peptide also was present in many Duoxs expected for BmDuox and DrDuox1. There was a coiled coil in LvDuox and MjDuox. The coiled coil is a structural motif in proteins, in which 2-7 alpha-helices coil together like the strands of a rope, 325 Fig. 7 The expression of the genes (LvDuox,SOD and CAT) in the midgut of the Pacific white shrimp following affected the V. parahaemolyticus E1 (VPE1). The expression levels of the genes were detected at different hours (0-36 h) using quantitative real-time PCR, and β-actin gene was used as the reference gene, and differences were considered significant at *P<0.05 and dimers are common. The coiled coil plays a major role in cell recognition and signal transduction. Therefore, the coiled coil may be a special domain distinguishing the Duoxs of shrimps from those of other organisms. The NADPH oxidase domain can produce H2O2, whereas the peroxidase domain can convert H2O2 into HOCl. H2O2 and HOCl aid in resistance to the intrusion of pathogens and provide an important immune defense mechanism in organisms that is necessary for the adaptive immune response. The calcium binding region formed by three EF-hand motifs was predicted in three arthropod Duoxs (LvDuox, MjDuox and BmDuox), whereas the others contained two EF-hand motifs (Fig. 2). Intracellular concentrations of Ca2+ modulate BmDuox enzymatic activity via the EF-hand motifs (Hu et al., 2013). Thus, we believe that the EF-hand motifs of LvDuox may be involved in the response to Ca2+ in a manner similar to the mechanism in the fruit fly. The mRNA transcripts of LvDuox gene were observed in all the detected tissues. LvDuox had high expression in the gills, a respiratory organ that, like the intestine, directly contacts water and bacteria. In the midgut of shrimp infected by VPE1, the expression of LvDuox increased significantly at 3 h after infection (P<0.05), peaked at 6 h (P<0.05), then began to decline and returned to its original level at 36 h. The trends in H2O2 levels in the midgut were consistent with the expression level of the LvDuox gene. VPE1 stimulated the expression of LvDuox, and H2O2 from LvDuox participated in resisting the invasion of VPE1. As the SOD and CAT gene expression increased significantly between 12 and 24 h (P<0.05), the level of H2O2 declined gradually. We concluded that the high concentration of ROS in the midgut induced the response of the antioxidant system to protect the organism from oxidative damage. Initial research has revealed that the production of O2 - in the hemocytes of Pacific white shrimps is dependent on the concentration of bacteria (Escherichia coli) (Munoz et al., 2000). In addition, the expression of kuruma shrimp MjDuox increases after white spot syndrome virus injection (Inada et al., 2013). Thus, our results suggested that foreign pathogens stimulate the expression of LvDuox to participate in innate immunity, and the antioxidant genes regulate H2O2 levels, thus protecting the shrimp against oxidative damage induced by ROS. In conclusion, we cloned the full-length cDNA encoding LvDuox. On the basis of sequence alignment and phylogenetic analysis, the LvDuox was found to be highly conserved and to be more similar to arthropod Duoxs than to vertebrate and echinoderm Duoxs. The LvDuox gene was expressed in all the main organs of the white shrimp and responds to invading pathogenic bacteria in the midgut. Two antioxidant genes were involved in the regulation of H2O2 levels generated by LvDuox. Therefore, LvDuox may be a new target for intestinal disease research. More studies are needed to clarify the regulatory mechanism of LvDuox in the innate immunity system and to determine how to accurately control the expression of Duox in shrimp to protect cells from ROS damage. 326 Acknowledgement This work was supported by the Science and Technology Development Fund Project of Shinan District of Qingdao City (2018-4-001-ZH), and the Chinese Academy of Sciences STS Regional Center Project (Fujian Province). We are grateful to all the laboratory members for their technical advice and helpful discussion. Competing financial interests The authors declare no competing financial interests. References Abid MR, Kachra Z, Spokes KC, Aird WC. NADPH oxidase activity is required for endothelial cell proliferation and migration. Febs Lett. 486: 252-256, 2000. Artis D. Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat. Rev. Immunol. 8: 411-420, 2008. Biteau B, Hochmuth CE, Jasper H. JNK Activity in Somatic Stem Cells Causes Loss of Tissue Homeostasis in the Aging Drosophila Gut. Cell Stem Cell 3: 442-455, 2008. Buchon N, Broderick NA, Chakrabarti S, Lemaitre B. Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila. Gene. Dev. 23: 2333-2344, 2009. Flores MV, Crawford KC, Pullin LM, Hall CJ, Crosier KE, Crosier PS. Dual oxidase in the intestinal epithelium of zebrafish larvae has anti-bacterial properties. Biochem. Bioph. Res. Co. 400: 164-168, 2010. Gomez-Anduro GA, Barillas-Mury CV, Peregrino-Uriarte AB, Gupta L, Gollas-Galvan T, Hernandez-Lopez J, et al. The cytosolic manganese superoxide dismutase from the shrimp Litopenaeus vannamei: Molecular cloning and expression. Dev. Comp. Immunol. 30: 893-900, 2006. Ha EM, Oh CT, Ryu JH, Bae YS, Kang SW, Jang IH, et al. An antioxidant system required for host protection against gut infection in Drosophila. Dev. Cell 8: 125-132, 2005. Hu X, Yang R, Zhang X, Chen L, Xiang X, Gong C, et al. Molecular Cloning and Functional Characterization of the Dual Oxidase (BmDuox) Gene from the Silkworm Bombyx mori. Plos One 8: e70118, 2013. Inada M, Kihara K, Kono T, Sudhakaran R, Mekata T, Sakai M, et al. Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization. Fish Shellfish Immunol. 34: 471-485, 2013. Juven BJ, Pierson MD. Antibacterial effects of hydrogen peroxide and methods for its detection and quantitation. J. Food Protect. 59: 1233-1241, 1996. Kim SH, Lee WJ. Role of DUOX in gut inflammation: lessons from Drosophila model of gut-microbiota interactions. Front. Cell. Infect. Mi. 3: 116, 2014. Kumar S, Molina-Cruz A, Gupta L, Rodrigues J, Barillas-Mury C. A Peroxidase/Dual Oxidase System Modulates Midgut Epithelial Immunity in Anopheles gambiae. Science 327: 1644-1648, 2010. Martin GG, Rubin N, Swanson E. Vibrio parahaemolyticus and V.harveyi cause detachment of the epithelium from the midgut trunk of the penaeid shrimp Sicyonia ingentis. Dis. Aquat. Organ. 60: 21-29, 2004. Meng XL, Li S, Qin CB, Zhu ZX, Hu WP, Yang LP, et al. Intestinal microbiota and lipid metabolism responses in the common carp (Cyprinus carpio L.) following copper exposure. Ecotox. Environ. Safe. 160: 257-264, 2018. Miyake K, Kaisho T. Homeostatic inflammation in innate immunity. Curr. Opin. Immunol. 30: 85-90, 2014. Morand S, Ueyama T, Tsujibe S, Saito N, Korzeniowska A, Leto TL. Duox maturation factors form cell surface complexes with Duox affecting the specificity of reactive oxygen species generation. Faseb J. 23: 1205-1218, 2009. Munoz M, Cedeno R, Rodriguez J, van der Knaap WPW, Mialhe E, Bachere E. Measurement of reactive oxygen intermediate production in haemocytes of the penaeid shrimp, Penaeus vannamei. Aquaculture 191: 89-107, 2000. Niethammer P, Grabher C, Look AT, Mitchison TJ. A tissue-scale gradient of hydrogen peroxide mediates rapid wound detection in zebrafish. Nature 459: 996-999, 2009. Qi C, Wang L, Liu M, Jiang K, Wang M, Zhao W, et al. Transcriptomic and morphological analyses of Litopenaeus vannamei intestinal barrier in response to Vibrio paraheamolyticus infection reveals immune response signatures and structural disruption. Fish Shellfish Immunol. 70: 437-450, 2017. Skulachev VP. Possible role of reactive oxygen species in antiviral defense. Biochemistry-Moscow. 63: 1438-1440, 1998. Sumimoto H. Structure, regulation and evolution of Nox-family NADPH oxidases that produce reactive oxygen species. Febs J. 275: 3249-3277, 2008. van Baarlen P, Wells JM, Kleerebezem M. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli. Trends Immunol. 34: 208-215, 2013. Wang WN, Zhou J, Wang P, Tian TT, Zheng Y, Liu Y, et al. Oxidative stress, DNA damage and antioxidant enzyme gene expression in the Pacific white shrimp, Litopenaeus vannamei when exposed to acute pH stress. Comp. Biochem. Phys. C. 150: 428-435, 2009. Yang HT, Yang MC, Sun JJ, Shi XZ, Zhao XF, Wang JX. Dual oxidases participate in the regulation of intestinal microbiotic homeostasis in the kuruma shrimp Marsupenaeus japonicus. Dev. Comp. Immunol. 59: 153-163, 2016. You H, Lee WJ, Lee WJ. Homeostasis between gut-associated microorganisms and the immune system in Drosophila. Curr. Opin. Immunol. 30: 48-53, 2014.