363 

ISJ 14: 363-374, 2017                                             ISSN 1824-307X 

 
 

RESEARCH REPORT 

 
Molecular cloning and functional characterization of a calreticulin gene from the sea 
cucumber Apostichopus japonicus 
 
S Cheng

*
, Y Chang

*
, Y Wang, G Li, Y Chen, J Ning, K Li 

 
Key Laboratory of Mariculture & Stock Enhancement in North China’s Sea, Ministry of Agriculture, Dalian Ocean 
University, Dalian 116023, P.R China 
*These authors contributed equally to this work. 

 
 

   Accepted September 18, 2017 

 
Abstract 

Calreticulin (CRT) plays crucial roles in the regulation of Ca
2+

 homeostasis, immune responses and 
molecular chaperon. In this study, a new member of the CRT gene (denoted as AjCRT) was cloned and 
characterized from the sea cucumber Apostichopus japonicus. The full-length of the gene was of 3316 
bp, which consisted of 204 bp 5’ untranslated region (UTR), 1870 bp of 3’-UTR and a putative 1242-bp 
open reading frame encoding a 48-kDa polypeptide (AjCRT) with a theoretical pI of 4.19. AjCRT had 
59 % - 65 % sequence identity with CRTs from other species. It contained two CRT domains (residues 
94 - 109 and 126 - 134) with a RING finger domain. AjCRT was ubiquitously expressed in all tissues 
examined, but was highly expressed in the coelomocytes. Temporal transcriptional levels in the 
coelomocytes revealed significant upregulation of AjCRT after the animal was challenged with Vibrio 
splendidus, reaching 4.97-fold the level of control at 4 h, but then decreased to 2.56-fold the level of 
control at 72 h. AjCRT knockdown decreased the expression level of the binding of Ca

2+
 to protein 

gene about 50 %. At the same time, intracellular concentration of Ca
2+

 also increased by 1.86-fold and 
1.94-fold compared to that of the control. Taken together, the results suggested that AjCRT may be 
associated with the immune response against bacterial infection, probably through participating in the 
regulation of intracellular Ca

2+
 homeostasis in sea cucumber. 

 
Key Words: calreticulin; Apostichopus japonicus; spatial expression; time-course expression; AjCRT knockdown; 

Ca
2+

 concentration 
 

 
Introduction 

 
Apostichopus japonicus is a sea cucumber that 

belongs to the phylum Echinodermata. It is widely 
distributed in China, Japan, Korea and Russia, and 
is one of the most important aquaculture animals in 
North China (Chang et al., 2004). However, 

increasing demand for sea cucumber and 
over-farming have resulted in the frequent 
occurrence of epidemic diseases in both juvenile 
and adult sea cucumber during the last decade, 
especially skin ulceration syndrome (SUS), which 
has caused massive mortality for cultured sea 
cucumbers (Deng et al., 2009; Wang et al., 2009; Ma 
et al., 2013), resulting in serious economic losses and 

limiting the sustainable development of this industry. 
To control epidemic diseases in sea cucumber, 
___________________________________________________________________________ 

 
Corresponding author: 
Yaqing Chang 
Key Laboratory of Mariculture & Stock Enhancement in 
North China’s Sea 
Dalian Ocean University 
Dalian, 52 Heishijiao Rd., Liaoning 116023, P. R. China 
E-mail: yaqingchang@hotmail.com 

 
 

antibiotics and chemicals are frequently used in 
aquaculture. However, indiscriminate use of these 

drugs has resulted in drug residues in the animals 
and environment, which is considered as a form of 
water pollution (Bonnie and Stuart, 2011; Yang et al., 

2015), further limiting the healthy and sustainable 
development of sea cucumber industry. 

As a marine invertebrate which lacks adaptive 
immune system, A. japonicus completely relies on 

innate immunity to combat pathogen infection 
(Iwanaga and Lee, 2005). In recent years, several 
immune-related genes such have been found to play 
crucial roles in the defense against bacterial, fungal 
and viral pathogens. Some of these genes (Wang et 
al., 2011, 2015a, b; Lu et al., 2013; Sun et al., 2013; Ji 
et al., 2014; Jiang et al., 2014; Zhang et al., 2015; 
Shao et al., 2015a, b, 2016; Yang et al., 2015, 2016; 
Lv et al., 2016) are listed in this study. Therefore, 
identifying and characterizing more immune-related 
genes in A. japonicus will enable us to better 
understand the immune responses of sea cucumber 
and find a new way to ensure the development of a 
more robust and healthier aquaculture industry. 



364 

Table 1 Primer sequences used in the cloning of the AjCRT gene 

 

 
 
 
 
 

Calreticulin (CRT) was first isolated from the 
sarcoplasmic reticulum (SR) of rabbit by Ostwald 
and MacLennan in 1974. It is a unique endoplasmic 
reticulum (ER) luminal resident protein, and it plays 
a crucial role in the regulation of Ca

2+
 homeostasis, 

immune responses and molecular chaperoning 
(Thomas and David, 1974; Michalak et al., 1999). 
Structurally, CRT contains three functionally distinct 
domains: N-domain, P-domain and C-domain. The 
N-domain forms a stable core which is resistant to 
proteolysis in the presence of calcium. The 
P-domain contains a high-affinity calcium-binding 
site and participates in either substrate binding or 
protein-protein interactions. The C-domain has a 
large number of negatively charged residues 
(Ellgaard et al., 2001; Corbett et al., 2009; Michalak 
et al., 2009) CRT is also a long-existing and highly 
conserved protein that has a variety of functions and 
is found in a wide range of species (Wang et al., 
2012). Initially known as a high capacity 
calcium-binding protein in ER that participates in the 
folding of newly synthesized SR proteins, CRT is 
now known to associate with many intracellular and 
extracellular processes, including lectin-like 
chaperone activity, Ca

2+
 storage and signaling, 

wound healing, inhibition of tumor growth and 
C1q-dependent complement activation, as well as in 
the regulation of gene expression, cell adhesion, 
cancer and autoimmunity (Johnson et al., 2001; 
Gelebart et al., 2005; Michalak et al., 2009; Ayoola 
and Miodrag, 2010). 

Calreticulin is also a major 
calcium-binding/storage chaperone residing in the 
ER lumen, where it plays important roles in 
molecular chaperoning function and in the response 
to viral infection (Michalak et al., 2002). Intracellular 
Ca

2+
 is associated with various biological processes, 

such as apoptosis and phagocytosis (May et al., 
2001). In addition, CRT and the binding of Ca

2+
 

protein gene are likely to be critical for 
host-pathogen interaction (Zhang et al., 2014). In 
human, CRT plays vital roles in T-cell development 
and in the initiation of immune cell response (Zhang 
et al., 1998; Bryce et al., 2007). In marine organisms, 
CRT has been identified in Dicentrachus labrax 
(Rute et al., 2007), Exopalaemon carinicauda (Duan 
et al., 2014), Fenneropenaeus chinensis (Luana et 
al., 2007) and Trypanosoma carassii (Zhao et al., 
2011), where it can be induced by bacterial or viral 
challenge. However, no study on the CRT gene in A. 
japonicus has been reported. Furthermore, the 

connection between CRT and the binding of Ca
2+

 to 
protein is still poorly understood (according to our 
knowledge). Therefore, by studying the CRT gene of 
A. japonicas, we could gain more insight into the role 

of this gene in sea cucumber and at the same time, 
obtain further information on its regulation of 
intracellular Ca

2+
 homeostasis. 

 

Materials and Methods 
 

Animals preparation and samples collection 
Healthy sea cucumber (body weight 68 ± 4.59) 

were collected from Dalian Heshengfeng Marine 
Product Farm and maintained at 16 - 17 °C in our 
laboratory for one week. The intestine, respiratory 
tree, tube feet, coelomic fluid, body wall and 
longitudinal muscle were then carefully removed 
from three healthy animals. To harvest the 
coelomocytes, the collected coelomic fluid was 
immediately centrifuged at 1,000g/4 °C for 5 min. All 
of the other tissues were immediately snap-frozen in 
liquid nitrogen and stored at -80 °C. 
 
Bacterial challenge experiment 

Vibrio splendidus D450 was cultured and 
harvested as previously described by Yang et al. 
(2015), and the cell pellet was resuspended in 
 

Primers Sequences (5’-3’) Application 
Melting 

temperatures 

AjCRT-5’-out CTTCTGCTCGTGCTTGACTGTA 5’-RACE 56 °C 

AjCRT-5’-in GGTGGTAACACGCACTCCCTGG 5’-RACE 56 °C 

AjCRT-3’-out TAGCAGGTCCACAGTACATGCCCA 3’-RACE 56 °C 

AjCRT-3’-in ATCGCTTTGTTTACATAAGGAATA 3’-RACE 56 °C 

UMP-1 TAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE 56 °C 

UMP-2 CTAATACGACTCACTATAGGGC RACE 56 °C 

AjCRT-F TCCTCCACTCTGACAACACCTACG qPCR 60 °C 

AjCRT-R AGTCCTCTGGTTTCTTGGCTTCGG qPCR 60 °C 

Cytb-F TGAGCCGCAACAGTAATC Reference gene 60 °C 

Cytb-R AAGGGAAAAGGAAGTGAAAG Reference gene 60 °C 

AjCRT siRNA 
GCAAGUGGGUUCAUCCUAUTT 
AUAGGAUGAACCCACUUGCTT 

AjCRT silence  

Negative 
control (NC) 
siRNA 

UUCUCCGAACGUGUCACGUTT 
ACGUGACACGUUCGGAGAATT 

NC for AjCRT 
siRNA 

interference 
 



365 

Table 2 Primer sequences used for the analysis of the binding of Ca
2+

 to protein gene 

 

 
 
 
 
 
phosphate buffered saline (PBS, 0.1 mM, PH 7.4) to 
a final concentration of 10

7
 CFU/mL. Sea cucumbers 

were divided into two groups: control group and a 
bacterial-challenged group. The control group (a 
total of 25 individuals) was immersed in a tank 
containing PBS only whereas the 
bacterial-challenged group (also 25 individuals) was 
immersed in a tank containing PBS plus V. 
splendidus D4501 at a concentration of 10

7 
CFU/mL. 

The celomic fluids were collected from the sea 
cucumbers at 0, 4, 8, 12, 24, 48 and 72 h 
post-immersion, and three individuals were 
randomly selected at each time point. 
 

Total RNA extraction and cDNA synthesis 
Total RNA was isolated from each of the six 

different tissues using Trizol (Ambion) according to 
the manufacturer’s instructions. Then, the quantity 
and quality of extracted RNA were assessed by UV 
spectrophotometry (Nanophotometer, Munich, 
Germany) and agarose gel electrophoresis. The 
cDNA was synthesized using a PrimerScript

TM
 RT 

reagent Kit (TaKaRa, Japan) for real-time PCR 
(RT-PCR), diluted to 1:10 and stored at -20 °C until 
used. 
 

Cloning and sequencing of AjCRT 
A partial cDNA sequence of AjCRT was 

obtained from our transcriptome assembly data 
(unpublished data). Based on the partial sequence, 
5’ and 3’-rapid amplification of cDNA ends (RACE) 
was conducted using the SMARTer

®
RACE 5’/3’ Kit 

(TaKaRa, Japan). All primers used are listed in 
Table 1. PCR product from RACE was detected in 
1.2 % agarose gel and purified using EasyPure 
Quick Gel Extraction Kit (Transgen Biotech, China). 
The purified product was then ligated to the 
PEASY

®
-1 Cloning Vector (Transgen Biotech, 

China). Trans1-T1 Phage Resistant Chemically 
Competent Cells (Transgen Biotech, China) were 
immediately transformed with the resulting construct. 

Positive transformants were verified by colony PCR 
using M13 primers (Tran, China), and three 
independent clones were subjected to DNA 
sequencing to confirm the sequence of the insert. 
 

Bioinformatics analysis of AjCRT 
The full-length of the AjCRT gene was analyzed 

using Basic Local Alignment Search Tool (BLAST) 
(http://www.ncbi.nlm.nih.gov/blast) program. Open 
reading frame (ORF) was identified by ORF Finder 
(http://www.ncbi.nlm.nih.gov/projects/gorf/orfig.cgi). 
The deduced amino acid sequence was analyzed 
online using the Expert Protein Analysis System 

(http://www.expasy.org/), and the molecular weight 
of the predicted polypeptide was calculated using 
the Expasy compute PI/MW tool 
(http://www.expasy.org/). SignaIP 4.1 Server 
(http://www.cbs.dtu.dk/services/SignalP/) was used 
to predict the signal peptide sequence of AjCRT 
whereas Simple Modular Architecture Research 
Tool (SMART) program 
(http://smart.embl-heidelberg.de/) was used to 
analyze its domain structure. Phylogenetic tree was 
conducted by the Neighbor-joining (NJ) method 
using MEGA 5.2 program. Multiple sequence 
alignment was performed by the DNAman. 

 
Quantification analysis of AjCRT expression 

Spatial and temporal expression levels of 
AjCRT were analyzed by qRT-PCR using the 

Applied Biosystem 7500 Real-time system (Applied 
Biosystem, USA). The sample contained 2 μL of 
1:10 diluted original cDNA, 10 μL of 2 × SYBR 
Green Master mix (SYBR PrimeScript

TM 
RT-PCR kit 

Ⅱ, TaKaRa, Japan), 0.4 μL of ROX Reference Dye 

Ⅱ, 0.8 μL (10μM) of each primer and 6 μL ddH2O in 

a total volume of 20L. The condition of the 
amplification consisted of the followings: a holding 
step at 95 ℃ for 30 s, followed by 40 cycles of 95 ℃ 
for 5s, and 60 ℃ for 32 s. The specific amplification 
of AjCRT was confirmed by melting curve. The gene 
for cytochrome b was selected as the reference 
gene (Yang et al., 2010). The sequences of all the 
primers used are shown in Table 1. The relative 
mRNA levels of AjCRT were quantified using the 
2

-△△Ct method and the results were given as relative 

expression patterns (means ± S.D., n = 3), and the 
differences were obtained by one-way Analysis of 
Variance (ANOVA). 

 
Primary coelomocytes culture and AjCRT silencing 
in vitro 

Primary celomocytes were cultured as 
described by Yang et al. (2016) and Lu et al. (2015). 

In brief, the washed cells were re-suspended in 
Leibovitz's L-15 cell culture medium (Invitrogen, 
USA) containing penicillin (100 U/mL), streptomycin 
sulfate (100 µg/mL) and Gentamycin sulfate (100 
µg/mL). The final concentration of the cells was 10

6
 

cells/mL. The osmotic pressure of the cell 
suspension was adjusted with 0.39 M NaCl, and 500 

L aliquots were then dispensed into a 24-well plate 
and incubated at 17 ℃ for 12 h before the AjCRT 
knockdown experiment. The AjCRT targeting small 
interfering RNA (AjCRT siRNA) and a negative 

control siRNA (NC siRNA) were designed and 

Primers Sequences (5’-3’) Application 
Melting 

temperatures 

Ca
2+

-F TCCTCCACTCTGACAACACCTACG qPCR 60 °C 

Ca
2+

-R AGTCCTCTGGTTTCTTGGCTTCGG qPCR 60 °C 

http://blast.ncbi.nlm.nih.gov/Blast
http://www.ncbi.nlm.nih.gov/projects/gorf/orfig.cgi
http://www.expasy.org/
http://www.cbs.dtu.dk/services/SignalP/
http://smart.embl-heidelberg.de/


366 

synthesized by GenePharma (shanghai, China). The 
sequences of these siRNAs are shown in Table 1. 
For AjCRT knockdown, 3 μL of AjCRT siRNA (20 µM) 

or NC siRNA was mixed with an equal volume of 
Lipotap Liposomal Transfection Reagent (Beyotime 
Biotechnology, China) and 500 μL of the cultured 
coelomcytes prepared earlier was transfected with 
this siRNA sample. Twenty-four hours after the 
transfection, the cells were harvested and used in 
subsequent experiments. 
 
Analysis of the binding Ca

2+
 to protein gene after 

AjCRT knockdown 
Total RNA harvested from the celomocytes 

following the AjCRT knockdown was used to 
synthesize the cDNA. Then, the expression levels of 
AjCRT and the binding Ca

2+
 to protein gene were 

conducted as described above. The primers of the 
binding Ca

2+
 to protein are listed in Table 2.  

 
Measurement of intracellular Ca

2+
 level 

Intracellular Ca
2+ 

concentration ([Ca
2+

]i) was 
measured according to Ding et al. (2008) and Girard 
et al. (2002) with little modification. Briefly, 500 μL 

coelomocytes at the final concentration of 10
6
 

cells/mL was mixed with 1.3 μL of 2 μM Fura-2/AM 
and 0.8 μL 0.05 % (w/v) of pluronic-F127, and then 
incubated in 37 ℃ for 30 min. Following incubation, 
the coelomocytes were collected by centrifugation at 
1000g and 4 °C for 5 min, and then washed thrice 
with Hanks’ Balanced Salt Solution (HBSS) without 
calcium chloride (Sangon, China). The washed cells 
were re-suspended in 250 μL HBSS. [Ca

2+
]i was 

automatically recorded with a Hitachi F-4500 
fluorimeter at excitation wavelengths of 340 and 380 
nm and an emission wavelength of 510 nm. 
 
Statistic analysis 

Data were represented as mean ± standard 
error (SE). Difference in relative expression of 
AjCRT and the binding of Ca

2+
 protein was analyzed 

by one way ANOVA or independent-T-test on SPSS 
13.0. The asterisk (*) and double asterisks (**) 
above the bars represent difference at p < 0.05 and 
significant difference at p < 0.01, respectively. 
 
Results 
 
Sequence analysis of AjCRT 

The full-length cDNA of AjCRT (GenBank 

accession No. MF960913) was obtained by 5’and 
3’-RACE according to an EST obtained from an A. 
japonicus cDNA library. The gene was 3316 bp long, 
containing 1242-bp of open reading frame, 204-bp of 
5’-untranslated region (UTR) of and 1870-bp of 
3’-UTR, which included a putative polyadenylation 
consensus signal (AATAAA) and a poly A tail (Fig. 1) 
The open reading frame was found to encode a 
polypeptide of 480 amino acids with a predicted 
molecular mass and a theoretical pI of 48 kDa and 
4.19, respectively. Domains and motifs analysis 
revealed two conserved domains reminiscent of the 
CRT family proteins: Lys

94
-Phe

109
 and Lle

126
-Gly

134
 

NG finger domain (residues 119 - 160). Three CRT 
family repeat motifs (DWD), one putative ER 
targeting motif HDEL as well as a coiled coil 
(residues 346 - 383) were also found in AjCRT. CRT 

was also found to contain a putative signal peptide of 
16 amino acids (MKFLVALAILCYTASA). Blastp 
analysis revealed 69 - 75 % sequence identity 
between AjCRT and CRTs from other species, 
including Strongylocentrotus purpuratus (XP 
006824896), Haliotis discus discus (ALY 11013), 
Danio rerio (NP 956007) and Sus scrofa (NP 

001167604). 
 
Multiple alignment and phylogenetic analysis 

The deduced amino acid sequence of AjCRT 

and the corresponding CRT sequences of 
invertebrates and vertebrates were aligned using the 
DNAman program (Fig. 2). AjCRT was found to have 
significant percentages of sequence identity (> 50 %) 
with the CRT sequences from other species, e.g., 
59 % with Homo sapiens CRT and 65 % with S. 
purpuratus CRT (Fig. 3). Moreover, phylogenetic 
analysis showed that AjCRT was clustered into the 
invertebrate subgroup with closer evolution 
relationship with S. purpuratus. Figure 3 depicts the 
phylogenetic analysis of CRTs, which was 
constructed by the Neighbor-joining method. The 
relationships among the 10 CRTs shown by the 
phylogenetic tree were consistent with traditional 
taxonomy. 
 
Tissue distribution and mRNA expression pattern of 
AjCRT in coelomocytes after V. splendidus 
challenge 

AjCRT transcript was detected in all the different 
tissues examined, suggesting that it was 
ubiquitously expressed in A. japonicus (Fig. 4), but 
the expression varied, depending on the tissue. For 
comparison purpose, the transcript level of AjCRT in 
the intestine was taken as 1 and the transcript levels 
in the other tissues were compared against that of 
the intestine. Such comparison yielded the highest 
AjCRT transcript level in the cleomocytes (3.2 fold 
the level found in the intestine), followed by tube feet 
(1.24-fold), respiratory tree (1.05-fold), body wall 
(0.92-fold), and lastly, the longitudinal muscle 
(0.3-fold). The different levels of AjCRT expression 
in the different tissues suggested that AjCRT may be 

involved in important physiological functions. 
A significant (p < 0.01) increase in the 

expression level of AjCRT was found in the 
coelomocytes of A. japonicas following V. 
splendidus challenge. The expression of AjCRT was 

4.97-fold and 2.56-fold the expression of 
non-infected A. japonicas 4 h and 72 h, respectively, 
after the bacterial challenge (Fig. 5). 
 
AjCRT knockdown affects the expression of the 
binding of Ca

2+
 to protein gene [Ca

2+
]i 

Knockdown of AjCRT by siRNA in the primary 
celomocytes was found to affect the expression of 
the binding to Ca

2+
 protein gene in the cells. The 

level of AjCRT transcript in the cells transfected with 
the AjCRT-specific siRNA was 0.46 fold and 0.44 
fold the levels AjCRT in the cells transfected with a 

negative control siRNA or in the non-transfected 
cells (Fig. 6A). At the same time, the transcript level 
of a binding of Ca

2+
 to protein gene in the 

AjCRT-knocked down celomocytes was also 

reduced to about 0.52-fold the level found in the 
negative control cells (Fig. 6B). 



367 

 
 
Fig. 1 Nucleotide and deduced amino acid sequences of the CRT gene cloned from A. japonicus. The start codon 

(ATG) and the putative polyadenylation consensus signal (AATAAA) are boxed. The asterisk represents the stop 
codon. The signal peptide is underlined. The two CRT family signature motifs (KHEQKIDCGGGYVKVF and 
IMFGPDICG) are shaded. The three CRT family repeat motifs (DWD) and the putative ER targeting motif HDEL 
are underlined and shaded. 



368 

 
 

 
 

 
 

 
 

 
 
 
Fig. 2 Multiple alignment of the deduced amino acid sequence of AjCRT with CRTs from other organisms. H. 
discus (ALY11013), L. gigantea (XP_009056939), S. purpuratus (NP_999643),  D. rerio (AJG06014), C. 
semilaevis (XP_008336669), X. tropicalis (NP_001001253), M. musculus (NP_031617) and H. sapiens 

(NP_004334). The two CRT family signature motifs are indicated by two boxes. The three CRT family repeat motifs 
(DWD/E) are underlined. 



369 

 Homo sapiens BAD96780

 Oryctolagus cuniculus NP 001075704

 Sus scrofa NP 001167604

 Mus musculus NP 031617

 Xenopus tropicalis NP 001001253

 Cynoglossus semilaevis XP 008336669

 Danio rerio AJG06014

 ▲Apostichopus japonicus

 Strongylocentrotus purpuratus NP 999643

 Lottia gigantea XP 009056939

59

25

26

19

8

6

4

2  
 
Fig. 3 Consensus neighbor-joining tree constructed from the amino acid sequences of CRTs from other species. 

The phylogenetic tree was constructed according to the Neighbor-joining method using MEGA 5.2 software. The 
numbers at the forks indicate the bootstrap. 
 
 
 
 

Intracellular Ca
2+

 concentration ([Ca
2+

]i) in the 
primary celomocytes increased following the 
knockdown of AjCRT. A [Ca

2+
 ]i of 61.83 ± 2.79 nM 

was obtained for cells transfected with the control 
siRNA, 59.51 ± 2.65 nM for non-transfected cells, 
and 115.2 ± 2.25 nM for cells transfected with 
AjCRT-specific siRNA. Thus knockdown of AjCRT in 

primary coelomocytes increased the level of 
intracellular Ca

2+
 by almost 2 fold compared to cells 

without AjCRT knockdown (Fig. 6C).  
 

Discussion 

 
Sea cucumbers lack an adaptive immune 

system and therefore they rely completely on an 
innate system for protection against potential 
pathogens. The vital roles involved in immune 
responses from the calcium-related proteins were 
identified in A. japonicus, such as calumenin, 
annexin, calreticulin and phospholipase C-gamma 
(Andrew et al., 2007; Zhang et al., 2014). Ca

2+
 acts 

 
 
 

 
 
Fig. 4 Relative expression of AjCRT in different tissues. Each vertical bar represents the mean ± SD (n = 3). 



370 

 
 
Fig. 5 Temporal expression of AjCRT in the coelomocytes after infection of the A. japonicus by V. splendidus. 

Each vertical bar represents the mean ± SD (n = 3). Significant difference between the challenge group and the 
control group are indicated by asterisk (* represented p < 0.05, ** represented p < 0.01). 
 
 
 
 
 
as a diffusible second messenger and plays a crucial 
role in the metabolism and physiology of eukaryotes. 
In addition, the maintenance of intracellular Ca

2+
 

homeostasis is essential in the metabolic processes 
of and physiology of eukaryote. Intracellular Ca

2+
 

concentration can be affected by various external 
signals, such as drugs, stress, light and pathogens 
(Carafoli et al., 1999; Chamilani et al., 2010). 
Therefore, the modulation of calcium-related 
proteins is critical for intracellular Ca

2+
 homeostasis. 

Calreticulin (CRT) is a highly conserved protein that 
modulates calcium binding to proteins and storage 

(Wang et al., 2012; Zhang et al., 2014). In order to 
better understand the role of CRT in the processes 
of immune responses and the maintenance of 
intracellular Ca

2+
 homeostasis, we identified and 

characterized a CRT gene from A. japonicus. As a 
result, a total of 3316 bp nucleotide sequences 
represented the complete cDNA sequence of AjCRT. 
Typical domains of CRT proteins were found in the 
deduced AjCRT protein sequence, suggesting that 
AjCRT might perform similar functions as other 
CRTs from other animals, including invertebrates 
and vertebrates. Similar results of CRT domains 
have also been reported in plenty of species, such 
as Trypanosoma carassii, Pieris rapae, 
Exopalaemon carinicauda, et al., which further 
supporting the notion that AjCRT being an ancient 
and highly conserved protein (Johnson et al., 2001; 
Gelebart et al., 2005; Ayoola and Miodrag, 2010; 

Wang et al., 2012). 
In the white prawn E. carinicauda, CRT could be 

detected in all the tissues examined, including 
hemocytes, gill, hepatopancreas, muscle, ovary, 
intestine, stomach and eyestalk, with the highest 
expression level in hepatopancreas, whereas the 
lowest was found in eyestalk (Duan et al., 2014). In 
this study, AjCRT was distributed in all the tested 
tissues, including celomocytes, tube feet, respiratory 
trees, intestine, body wall and longitudinal muscle. 
The highest expression level of AjCRT mRNA was 
detected in the celomocytes, cells that are regarded 
as the main cellular component of the immune 
system and the metabolic center for reactive oxygen 
species (ROS) production in sea cucumber. Similar 
to the hemocytes of vertebrates, celomocytes are 
freely circulating cells and they play an irreplaceable 
role in the immune responses of sea cucumber 
(Wang et al., 2007; Wang et al., 2009; Cheng et al., 
2016). Thus AjCRT may act as an immune-related 
gene and its function may be to defend the animal 
against bacterial, fungal and viral pathogens (Duan 
et al., 2014; Zhang et al., 2014). In addition, the 
ubiquitous distributing pattern of AjCRT suggested 
that it may have a multifunction in many cellular 
processes, both intracellular and extracellular 
processes, such as calcium-binding in ER and 
folding of newly synthesized protein (Thomas and 
David, 1974; Michalak et al., 1999). Infection by 
pathogen can induce the generation of excessive 



371 

 
 
Fig. 6 AjCRT knockdown in A. japonicas coelomocytes and its effect on intracellar Ca

2+
 and Ca

2+
-binding protein 

expression. (A) AjCRT knockdown. Effect of AjCRT knockdown on intracellular Ca
2+

 concentration (B) and 

Ca
2+

-binding protein expression (C). Data are the means  SDs (n = 3). Significant difference between the AjCRT 
siRNA group and the negative control group is indicated by asterisk (*represented p < 0.05, **represented p < 
0.01). 
 
 
 
 
 
ROS, which could cause mass mortality in marine 
organisms (Siripong et al., 2014). Vibrio splendidus 

was regarded as the major pathogen of sea 
cucumbers (Zhao et al., 2011). To better understand 
the role of AjCRT in the immune response, the 
animals were challenged with V. splendidus D450 to 

simulate a state of infection. Pathogens infection can 
elicit variation in the concentration of intracellular 
Ca

2+
 in eukaryotes. Maintenance of intracellular Ca

2+
 

homeostasis is essential to the processes of 
metabolism and physiological function (Chamilani et 
al., 2010). As the result, AjCRT expression was 
significantly up-regulated at 4 h after V. splendidus 
challenge, which indicated that AjCRT expression 

was quickly induced upon bacterial infection. At the 
same time, our data also showed that the 
concentration of intracellular Ca

2+
 increased when 

AjCRT was knocked down, further suggesting that 
AjCRT was involved in the homeostasis of 
intracellular Ca

2+
 directly. However, the second peak 

of AjCRT expression was observed at 72 h post 

bacterial challenge, and a possible explanation for 
the emergence of this peak could be due to the 
momentarily disruption of the innate immune system 
of A. japonicus, caused by the growing number of 
bacteria inside the animal. Similar results have been 
observed in Exopalaemon carinicauda after WSSV 

challenge and in the hepatopancreas 
Fenneropenaeus chinensis following WSSV 
infection (Duan et al., 2014; Luana et al., 2014). This 
further demonstrated that a role for AjCRT in the 

immune response against bacterial infection. 
CRT is initially thought to be responsible for the 

high calcium-binding capacity in ER and the folding 
of newly synthesized proteins (Michalak et al., 1999). 

A growing number of studies have focused on 
unravelling the function of CRT since its discovery in 
mammals (Ostwald and MacLennan, 1974). It is now 
known that CRT has many functions, including 
lectin-like chaperone activity, Ca

2+
 storage and 

signaling, and regulation of gene expression, cell 
adhesion, wound healing, cancer and autoimmunity 



372 

(Corbett et al., 2000; Ellgaard et al., 2001; Johnson 
et al., 2001; Wang et al., 2012). The role of CRT in 
immune reaction has been reported in different 
invertebrates (Luana et al., 2007; Duan et al., 2014). 
In this study, the connection between CRT and the 
binding of Ca

2+
 to protein gene was investigated by 

looking at the effect of AjCRT knockdown on the 

level of intracellular Ca
2+

 and the expression of a 
binding of Ca

2+
 to protein gene. The binding of Ca

2+
 

to protein gene known as EF hand domain-containing 
calcium regulation protein plays important roles in 
signal transduction and calcium binding to proteins 
(Ikura et al., 1996). The modulation of the binding of 
Ca

2+
 to protein gene is considered to be vital during 

thermal stress (Zhang et al., 2013). The level of the 
binding of Ca

2+
 to protein gene in the celomocytes of 

A. japonicus decreased when AjCRT in these cells 
was knocked down. This basically consistent 
decreasing of AjCRT and the binding of Ca

2+
 to 

protein gene after AjCRT knockdown maybe 
suggested that AjCRT and the binding of Ca

2+
 to 

protein gene are involved in the general 
physiological processes of A. japonicus. Intracellular 
Ca

2+
 was regarded as critical for various biological 

events. Particularly, increase in intracellular Ca
2+

 is 
associated with many defense responses elicited by 
the host cell during an infection (Michalak et al., 
2002; Zhang et al., 2013). Significant increase in 

intracellular Ca
2+

 concentration resulting from the 
knockdown of AjCRT in A. japonicus celomocytes 
indicated that AjCRT was directly affected 
intracellular Ca

2+
 homeostasis. A possible 

perspective of AjCRT involved in different biological 
events like intracellular Ca

2+
 homeostasis. 

In conclusion, we have cloned and 
characterized a full-length CRT gene from A. 
japonicus and analysis of its spatial and temporal 
expression pattern suggested that this gene might 
be involved in the immune response, perhaps by 
mediating the regulation of intracellular Ca

2+
 

homeostasis in sea cucumber. 
 

Acknowledgments 

This work was supported by grant from the 
National Natural Science Foundation of China (No. 
31572608). 

 
References 

Andrew F, Adam P. Invertebrate immune 
systems-specific, quasi-specific,or nonspecific? 
J. Immunol. 179: 7209-7214, 2007. 

Ayoola O, Miodrag B. Trypanosoma carassii 
calreticulin binds host complement component 
C1q and inhibits classical complement 
pathway-mediated lysis. Dev. Comp. Immunol. 
34: 396-405, 2010. 

Bonnie M, Stuart B. Food animals and antimicrobials: 
impacts on human health. Clin. Microbiol. Rev. 
24: 718-733, 2011. 

Bryce W, Doo Y, Dora M. Presenilin/γ-secretase and 
α-secretase-like peptidases cleave human MHC 
class I proteins. Biochem. J. 401: 121-7, 2007. 

Carafoli E, Klee C. Calcium as a cellular regulator. 
New York: Oxford University Press, 1999. 

Chamilani N, Mahanama D, Ilson W, Se-Jae K, et al. 

Characterization and expression analysis of EF 
hand domain-containing calcium-regulatory 

gene from disk abalone: Calcium homeostasis 
and its role in immunity. Fish Shellfish Immunol. 
29: 334-342, 2010. 

Chang Y, Ding J, Song J, Yang W. Biology and 
aquaculture of sea cucumbers and sea urchins. 
Beijing, China: China Ocean Press, 2004 (in 
Chinese). 

Cheng S, Li C, Wang Y, Yang L, Chang Y. 
Characterization and expression analysis of a 
thioredoxin-like protein gene in the sea 
cucumber Apostichopus japonicas. Fish 

Shellfish Immunol. 58: 165-173, 2016. 
Corbett EF, Michalak KM, Oikawa K, Johnson S, 

Campbell ID, Eggleton P, et al. The 
conformation of calreticulin is influenced by the 
endoplasmic reticulum lumenal environment. J. 
Biol. Chem. 275: 27177-27185, 2000. 

Deng H, He C, Zhou Z, Liu C, Tan K, Wang N, et al. 
Isolation and pathogenicity of pathogens from 
skin ulceration disease and viscera ejection 
syndrome of the sea cucumber Apostichopus 
japonicas. Aquaculture 287: 18-27, 2009. 

Ding L, Wang R, Jiang W, Lai l, Jiang l, Fan j. 
Isolation and cytosolic calcium assay of 
ventricular myocytes of Spraque-Dawley rat. 
Chin. J. Cardiovascular. Rev. 6: 61-63, 2008 (in 
Chinese). 

Duan Y, Liu P, Li J, Wang Y, Li J, Chen P. Molecular 
responses of calreticulin gene to Vibrio 
anguillarum and WSSV challenge in the ridgetail 
white prawn Exopalaemon carinicauda. Fish 
Shellfish Immunol. 36: 164-171, 2014. 

Ellgaard L, Riek R, Herrmann T, Güntert P, Braun, D, 
Helenius A, et al.   NMR structure of the 
calreticulin P-domain. Proc. Natl. Acad. Sci. 
USA 98: 3133-3138, 2001. 

Gelebart P, Opas M, Michalak M. Calreticulin, a 
Ca2+-binding chaperone of the endoplasmic 
reticulum. Int. J. Biochem. Cell. Biol. 37: 
260-266, 2005. 

Girard T, Treves S, Censier K, Mueller C, Zorzato F, 
Urwyler A. Phenotyping malignant hyperthermia 
susceptibility by measuring halothane-induced 
changes in myoplasmic calcium concentration 
in cultured human skeletal muscle cells. Brit. J. 
Anaesth. 89: 571-579, 2002. 

Ikura M. Calcium binding and conformational 
response in EF-hand proteins. Comp. Biochem. 
Physiol. 111B: 337-345, 1996. 

Iwanaga S, Lee B. Recent advances in the innate 
immunity of invertebrate animals. BMB Rep. 38: 
128-150, 2005. 

Ji N, Chang Y, Zhao C, Pang Z, He Z. Cloning and 
gene expression of allograft inflammatory 
factor-1 (AIF-1) provide new insights into injury 
and bacteria response of the sea cucumber 
Apostichopus japonicus (Selenka, 1867). Fish 

Shellfish Immunol. 38: 400-405, 2014. 
Jiang J, Zhou Z, Dong Y, Sun H, Chen Z, Yang A, et 

al. Phenoloxidase from the sea cucumber 
Apostichopus japonicus: cDNA cloning, 

expression and substrate specificity analysis. 
Fish Shellfish Immunol. 36: 344-351, 2014. 

Johnson S, Michalak M, Opas M, Eggleton P. The 
ins and outs of calreticulin: from the ER lumen 
to the extracellular space. Trends Cell Biol. 11: 
122-129, 2001. 



372 

Lu M, Zhang P, Li C, Zhang W, Jin C, Han Q. 
MiR-31 modulates coelomocytes ROS 
production via targeting p105 in Vibrio 
splendidus challenged sea cucumber 
Apostichopus japonicus in vitro and in vivo. Fish 
Shellfish Immunol. 45: 293-299, 2015. 

Lu Y, Li C, Zhang P, Wang D, Su X, Jin C, et al. 

Characterization of two negative regulators of 
the Toll-like receptor pathway in Apostichopus 
japonicus: Inhibitor of NF-κB and Toll-interacting 
protein. Fish Shellfish Immunol. 35: 1663-1669, 
2013. 

Luana W, Li F, Wang B, Zhang X, Liu Y, Xiang J. 
Molecular characteristics and expression 
analysis of calreticulin in Chinese shrimp 
Fenneropenaeus chinensis. Comp. Biochem. 

Physiol. 147B: 482-491, 2007. 
Lv Z, Li C, Zhang W, Jin C, Shao Y, Duan X, et al. 

Nemo like kinase negatively regulates NF-κB 
activation and coelomocytes apoptosis in 
Apostichopus japonicas. Dev. Comp. Immunol. 
54: 109-115, 2016. 

Ma Y, Liu Z, Yang Z, Li M, Liu J, Song J. Effects of 
dietary live yeast Hanseniaspora opuntiae C21 

on the immune and disease resistance against 
Vibrio splendidus infection in juvenile sea 
cucumber Apostichopus japonicas. Fish 
Shellfish Immunol. 34: 66-73, 2013. 

May R, Machesky L. Phagocytosis and the actin 
cytoskeleton. J. Cell. Sci. 114: 1061-1078, 
2001. 

Michalak M, Corbett EF, Mesaeli N, Nakamura K, 
Opas M. Calreticulin: one protein, one gene, 
many functions. Biochem. J. 344: 281-292, 
1999. 

Michalak M, Groenendyk J, Szabo E, Gold LI, Opas 
M. Calreticulin, a multi-process 
calcium-buffering chaperone of the endoplasmic 
reticulum. Biochem. J. 417: 651-666, 2009. 

Michalak M, Lynch J, Groenendyk J, Guo L, Robert 
P, Opas M. Calreticulin in cardiac development 
and pathology. BBA-Proteins Proteomics 1600: 
32-37, 2002. 

Ostwald T, MacLennan D. Isolation of a high affinity 
calcium binding protein from sarcoplasmic 
reticulum. J. Biol. Chem. 249: 974-979, 1974. 

Rute D, Ana R, Pedro J, Nuno M. Molecular cloning 
and characterization of sea bass (Dicentrarchus 
labrax, L.) calreticulin. Fish Shellfish Immunol, 

34: 1611-1618, 2013. 
Shao Y, Li C, Che Z, Zhang P, Zhang W, Duan X, et 

al. Cloning and Characterization of two 
lipopolysaccharide-binding protein/bactericidal 
permeability-increasing protein (LBP/BPI) 
genes from the sea cucumber Apostichopus 
japonicus with diversified function in modulating 
ROS production. Dev. Comp. Immunol. 52: 
88-97, 2015a. 

Shao Y, Li C, Zhang W, Duan X, Li Y, Han Q, et al. 
Three members in JAK/STAT signal pathway 
from the sea cucumber Apostichopus japonicus: 

Molecular cloning, characterization and function 
analysis. Fish Shellfish Immunol. 46: 523-536, 
2015b. 

Shao Y, Li C, Zhang W, Xu W, Duan X, Li Y, et al. 

Cloning and comparative analysis the proximal 
promoter activities of arginase and agmatinase 

genes in Apostichopus japonicas. Dev. Comp. 
Immunol. 65: 299-308, 2016. 

Siripong T, Jiraporn S, Suparat T, Kallaya S. 
Double-dose β-glucan treatment in 
WSSV-challenged shrimp reduces viral 
replication but causes mortality possibly due to 
excessive ROS production. Fish Shellfish 
Immunol. 40: 478-484, 2014. 

Sun H, Zhou Z, Dong Y, Yang A, Jiang B, Gao S, et 
al. Identification andexpression analysis of two 
Toll-like receptor genes from sea cucumber 
(Apostichopus japonicus). Fish Shellfish 
Immunol. 34: 147-158, 2013. 

Thomas J, David H. Isolation of a high affinity 
calcium-binding protein from sarcoplasmic 
reticulum. J. Biol. Chem. 249: 974-979, 1974. 

Wang F, Yang H, Wang X, Xing K, Gao F. 
Antioxidant enzymes in sea cucumber 
Apostichopus japonicus (Selenka) during 
aestivation. J. Mar. Biol. Assoc. UK. 91: 
209-214, 2011. 

Wang H, Shao Y, Li C, Zhang W, Lv Z, Jin C. 
Molecular characterization of two novel 
molecular chaperones in bacterial-challenged 
Apostichopus japonicas. Gene 570: 141-147, 
2015b. 

Wang H, Zhang W, Li C, Lv Z, Jin C. Identification 
and characterization of a novel Foxo 
transcription factors in Apostichopus japonicas. 
Fish Shellfish Immunol. 44: 164-171, 2015a. 

Wang L, Fang Q, Zhu J, Wang F, Zunnu R, Ye G. 
Molecular cloning and functional study of 
calreticulin from a lepidopteran pest, Pieris 
rapae. Dev. Comp. Immunol. 38: 55-65, 2012. 

Wang P, Chang Y, Yu J, Li C, Xu G. Acute peristome 
edema disease in juvenile and adult sea 
cucumbers Apostichopus japonicus (Selenka) 
reared in North China. J. Invertebr. Pathol. 96: 
11-17, 2007. 

Wang T, Sun Y, Jin L, Xu Y, Wang L, Ren T, et al. 

Enhancement of non-specific immune response 
in sea cucumber (Apostichopus japonicus) by 
Astragalus membranaceus and its 
polysaccharides. Fish Shellfish Immunol. 27: 
757-762, 2009. 

Wang Y, Zhang F, Li S, Chen X, Cui Y. Detection of 
Vibrio splendidus causing skin ulcer syndrome 
of sea cucumber (Apostichopus japonicus) with 
DNA probes. J. Fish. China 33: 119-125, 2009a. 

Yang AF, Zhou ZC, Dong Y, Jiang B, Wang XY, 
Chen Z, et al. Stability comparison of cytb and 

-actin gene expression in sea cucumber 
Apostichopus japonicus. J. Agric. Sci. Technol. 
12: 79-84, 2010 (in Chinese). 

Yang L, Chang Y, Wang Y, Wei J, Ge C, Song J. 
Identification and functional characterization of 
TNF receptor associated factor 3 in the sea 
cucumber Apostichopus japonicas. Dev. Comp. 

Immunol. 59: 128-135, 2016. 
Yang L, Li C, Chang Y, Gao Y, Wang Y, Wei J, et al. 

Identification and characterization a novel 
transcription factor activator protein-1 in the sea 
cucumber Apostichopus japonicas. Fish 
Shellfish Immunol. 45: 927-932, 2015. 

Zhang P, Li C, Li Y, Zhang P, Shao Y, Jin C, et al. 
Proteomic identification of differentially 
expressed proteins in sea cucumber 

373 



372 

Apostichopus japonicus coelomocytes after 
Vibrio splendidus infection. Dev. Comp. 
Immunol. 44: 370-377, 2014. 

Zhang P, Lu Y, Li C, Su X, Wang Z, Jin C, et al. 
Identification of differential expressed proteins 
and characterization their mRNA expression in 
thermally stressed Apostichopus japonicas. 

Comp. Biochem. Physiol. 8D: 194-200, 2013. 
Zhang Q, Russell D. Distinct patterns of folding and 

interactions with calnexin and calreticulin in 
human class I MHC proteins with altered 
N-glycosylation. J. Immunol. 160: 831-837, 1998. 

Zhang X, Zhang P, Li C, Li Y, Jin C, Zhang W. 

Characterization of two regulators of the 
TNF-α signaling pathway in Apostichopus 
japonicus: LPS-induced TNF-α factor and 

baculoviral inhibitor of apoptosis 
repeat-containing 2. Dev. Comp. Immunol. 48: 
138-142, 2015. 

Zhao Y, Ma H, Zhang W, Ai Q, Mai K, Xu W, et al. 

Effects of dietary β-glucan on the growth, 
immune responses and resistance of sea 
cucumber, Apostichopus japonicus against 
Vibrio splendidus infection. Aquaculture 315: 

269-274, 2011. 

 

374