Ions score is -10*Log(P), where P is the probability that the observed match is a random event


388 

ISJ 14: 388-403, 2017                                             ISSN 1824-307X 

 
 

RESEARCH REPORT 

 
Comparative proteomic analysis reveals that juvenile hormone binding protein and 
adenylate kinase may be involved in the molting process of silkworm, Bombyx mori 
 
Y Yang, L Chen, Q Tang, Y Zhang, H Tang, P Lü, Q Yao, K Chen 
 
Institute of Life Sciences, Jiangsu University, Zhenjiang 212013, China 

 
 

   Accepted October 13, 2017 

 
Abstract 

The molting is an essential part of the silkworm metamorphosis development. Although previous 
studies have demonstrated that molting in silkworm is associated with prothoracicotropic hormone 
(PTTH), molting hormone (MH), and juvenile hormone (JH), the changes of proteins and genes during 
silkworm molting, as well as the molecular mechanism about its generating and maintaining remains 
unclear. In this paper, the proteomic approaches were employed to investigate this issue. Totally, 35 
different proteins were successfully identified through mass spectrometry and database searches, 
among which 42 % proteins were involved in cell structure and 16 % proteins belonged to the 
metabolism group. Meanwhile, vacuolar ATP synthase, juvenile hormone binding protein precursor and 
adenylate kinase isoenzyme were found to be down-regulated at early, mid-molt stages, which were 
further confirmed by quantitative real-time polymerase chain reaction (qRT-PCR). Taken together, our 
data suggests that juvenile hormone binding protein (JHBP) and adenylate kinase (AK) play a critical 
role in the process of silkworm molting, which may participate in the regulation of silkworm molting. 

 
Key Words: Bombyx mori; molting; proteomics; juvenile hormone binding protein; adenylate kinase 

 

 
Introduction 

 
Insects are the most abundant organisms in the 

world and encompass nearly 80 % species of our 
planet, which provide a large amount of desirable 
material for us to investigate the molecular basis of 
physiological mechanisms (Dahanukar et al., 2005; 
Li et al., 2010). The silkworm (Bombyx mori) has 
been fed as an important economic insect in 
sericulture industry. With the implementation and 
completion of whole genome sequencing program, 
silkworm has become a model insect of Lepidoptera 
molecular biological research (Xia et al., 2004, 2009). 
___________________________________________________________________________ 

 
Corresponding author: 

Keping Chen 

Institute of Life Sciences Jiangsu University 
301 Xuefu Road, Zhenjiang 
Jiangsu Province 212013, PR China  

E-mail: kpchen@ujs.edu.cn 

 
 
List of abbreviations: 
ACN, acetonitrile; CBB, Coomassie Brilliant Blue; 
IEF, isoelectric focusing; MALDI-TOF MS, 
matrix-assisted laser desorption/ionization time of 
flight mass spectrometry; PMSF, 
phenylmethanesulfonyl fluoride; SDS-PAGE, sodium 
dodecyl sulphate polyacrylamide gel electrophoresis; 
TFA, trifluoroacetic acid; 2-DE, two-dimensional 
electrophoresis 

 
 

Molting is a common phenomenon in the 
developmental process of many organisms and is 
essential for the molecular, physiological and 
morphological rebuilding of living animals. In insect, 
molting is the regular shedding of the exoskeleton at 
specific points in its life cycle to let it grow. The 
previous studies have demonstrated that molting in 
silkworm is associated with their growth and other 
physiological processes and is a cascade process of 
gene expression and interaction (Kinjoh et al., 2007; 
Muramatsu et al., 2008; Wang et al., 2013), which is 
endogenously controlled, involving in 
prothoracicotropic hormone (PTTH), molting 
hormone (MH), and juvenile hormone (JH). These 
hormones are secreted by the endocrine system, 
including brain neurosecretory cells, corpora allata 
and prothoracic glands, among which brain 
neurosecretory cells are dominant and play a central 
role. Although molting has been reasonably defined, 
the molecular regulation mechanism involved in 
generating and maintaining remains unclear. 
Meanwhile, the changes of genes or proteins during 
silkworm molting have not yet been resolved and it is 
also uncertain about which genes and proteins are 
indeed involved in the regulation of silkworm molting. 
These issues are very important for understanding 
the molecular mechanism of silkworm molting. 
Therefore, systematic studies are required to 
investigate these issues. 

mailto:kpchen@ujs.edu.cn


389 

In recent years, the proteomic approaches, 
including two-dimensional electrophoresis and mass 
spectrometry, have been applied successfully to 
identify the specific proteins from different tissues 
and organs of silkworm, such as haemolymph (Li et 
al., 2006; Hou et al., 2010; Liu et al., 2010), fat body 
(Moghaddam et al., 2008), midgut (Qin et al., 2012; 
Feng et al., 2014; Kannan et al., 2016), silk gland 
(Zhang et al., 2006; Jia et al., 2007; Yi et al., 2013), 
endocrine organs, larval head (Li et al., 2010; Li et 
al., 2016; Arunprasanna et al., 2017), and so on. 
These results from proteome provided important 
evidences and clues for understanding the growth 
and development of silkworm. The silkworm is 
metamorphic molts involving in complex hormonal 
regulation and replacement of cuticle types and can 
be considered a model organism for understanding 
molting and metamorphosis in holometabolous 
insects. The insect head is composed of important 
sensory systems, including the olfactory, visual, 
gustatory organs, and some important endocrine 
organs, which can receive environmental stimuli and 
regulate insect growth and development. Therefore, 
insect head plays a crucial role in insect growth, 
reproduction, diapause, and metamorphosis 
processes (Li et al., 2009; Li et al., 2010; Li et al., 
2016; Wang et al., 2016). In current study, the 
proteomic approach was employed to detect and 
identify differentially expressed proteins from 
silkworm larval heads, which allowed us to 
determine the proteins and genes associated with 
molting and decipher the molecular mechanism of 
silkworm molting. 
 
Materials and Methods 
 
Experimental insects and developmental stage 

The hybrid strain Jingsong×Haoyue of the 
silkworm B. mori were used for this experiment, 
which was provided by Sericultural Research of 
Institute, Chinese Academy of Agricultural Sciences, 
Zhenjiang, China. All larvae were reared with the 
fresh mulberry leaves at 25 ± 1 °C and 75 ± 2 % 
relative humidity (photoperiod 16 h light: 8 h dark). 
The larvae of 1st - 3rd instar were fed with the 
chopped tender leaves and 4th - 5th instar larvae 
were fed with the matured leaves. The silkworm 
larval heads were used for proteomic analysis, which 
were collected at specific time points during the molt 
from the penultimate (4th) to the last (5th) larval instar. 
Based on the time of head capsule slippage (HCS) 
occurring at the fourth molt period, the molting stage 
was determined, that is, HCS occurring (denoted by 
mq), 12 h and 24 h after HCS (denoted by m1 and 
m2), and newly molted fifth instar larvae (denoted by 
qc). The larval heads were collected on ice, 
immediately frozen in liquid nitrogen and stored at 
-70 °C for later use (at least 100 heads of each 
sample). The experiments were repeated three 
times. 
 
Protein sample preparation 

The larval heads of silkworm were grounded 
into fine powder in liquid nitrogen and homogenized 
on ice for 5 min in pre-cooled extraction buffer (20 
mM Tris-HCl pH 7.5, 250 mM sucrose, 10 mM EGTA, 
1 mM PMSF, 1 mM DTT, and 1 % Triton (v/v) X-100) 

as described by Cilia et al. (Cilia et al., 2009). The 
homogenate was transferred into the 2.0 mL 
centrifuge tube and centrifuged (12,000g, 4 °C, 30 
min). The supernatant was collected and 
equal-volume tris-saturated phenol was added and 
mixed. The phenol layer containing proteins was 
collected and incubated 10 ~ 12 h at -20 °C with 
methanol solution containing 100 mM ammonium 
acetate. After centrifugation (12,000g, 30 min, 4 °C), 
the supernate was discarded. The precipitate was 
washed again with methanol solution containing 100 
mM ammonium acetate and then washed 4 ~ 5 
times using ice-cold acetone containing 13 mM DTT, 
centrifuged (12,000g, 4 °C, 20 min/each time), and 
vacuum-dried. The dried powder was dissolved in 
lysis buffer (7 M urea, 2 M thiourea, 4 % w/v CHAPS, 
2 % v/v Bio-lyte, pH 3 - 10, 1 % w/v DTT), overnight 
at 4 °C. Finally, the mixtures were centrifuged 
(12,000g, 20 min, 4 °C). The supernatant was 
collected and used for two-dimensional 
electrophoresis. The protein concentration was 
measured by Bradford method (Bradford, 1976). 
 
Two-dimensional electrophoresis (2-DE) 

IEF was carried out through Bio-Rad PROTEAN 
electrophoresis system and 17 cm immobilized IPG 
dry gel strips with pH 4 - 7 liner range (Bio-Rad, 
USA) was used. About 1.5 mg protein samples 
were loaded by passive rehydration (room 
temperature, 11 ~ 12 h). Then IEF was performed 
at 300, 500, and 1,000 V, linear for 1 h, respectively, 
next 10,000 V, linear for 5 h, and then remained 
10,000 V until a total voltage of 54,000 Vh. 
Subsequently, the gel strips were equilibrated for 
15 min in equilibration buffer (0.05 M Tris-HCl pH 
6.8, 2.5 % w/v SDS, 30 % v/v glycerol and 1 % w/v 
DTT) and then equilibrated for 15 min again (0.05 M 
Tris-HCl pH 6.8, 2.5 % w/v SDS, 30 % v/v glycerol 
and 2.5 % w/v iodoacetamide). The second 
dimension SDS-PAGE was carried out with a 
Laemmli buffer system (15,% resolving gels) 
(Laemmli, 1970). Finally, the gels were dyed with 
0.116 % CBB R-250 (0.116 % w/v CBB, 25 % v/v 
ethanol, and 8 % v/v acetic acid). 
 
Image and data analysis 

The 2-DE gels were scanned using the 
imagescanner III (GE Healthcare Life Sciences). 
The images were analyzed using ImageMaster 7.0 
software (GE Healthcare Life Sciences). The 
optimized parameters were as follows: saliency = 3, 
smooth = 6, and minimum area = 60. The value of 
each protein spot was normalized (a percentage of 
the total volume in the whole set of gel spots). The 
protein spots with ratios ≥ 1.5 or ratios ≤ 0.67 and 
passing the Student’s t-test (p < 0.05) were 
considered to be differentially expressed proteins. 
 
In-gel digestion and protein identification 

The differentially expressed proteins were 
manually cut down from the gels and washed using 
ultrapure water. The gel pieces were destained 2 ~ 3 
times by ultrasonic with 50 μL destaining buffer 
(50 % ACN, 25 mM NH4HCO3) until the gel pieces 
became colorless. Next, the gel pieces were rinsed 
using 25 mM NH4HCO3, 50 % ACN, and 100 % CAN 
(50 μL/each), respectively, and vacuum-dried. The 



390 

 
 
Fig. 1 The 2-DE profiles from head extracted proteins between mq and m1. 
Note: (Reference gel: mq). The differentially expressed protein spots are indicated by circles and labeled with 
Arabic numerals. The upward and downward arrows respectively indicate up-regulated and down-regulated 
proteins. The protein spots with circles and plus symbol indicate that the protein spot is expressed only in this 2-DE 
gel. The numbers shown on the left indicate the protein markers in kDa. (Figs 2 and 3 are same as Fig. 1) 
 
 
 
 
dried gel pieces were soaked in 25 mM NH4HCO3 
with 10 μg/mL of trypsin (Promega, USA) at 4 °C for 
30 min. Subsequently, 10 ~ 15 μL 25 mM NH4HCO3 
was added to the gel pieces and the gel pieces were 
digested at 37 °C overnight (about 12 h). Peptides 
were collected and dried by vacuum (-50 °C) and 
then stored at -70 °C until mass spectrometry. 
MALDI TOF/TOF samples were prepared by 
spotting 2 μL digested protein solution (dissolved 
with 5 μL 0.1 %TFA) and 1 μL matrix 

(-cyano-4-hydroxycinnamic acid, Sigma, 10 mg/mL, 
dissolved in 50 % ACN containing 0.1 % TFA) on the 
600 μm AnchorChip MALDI probe (Bruker Daltonik, 
Germany). After dryness at room temperature, the 
samples were analyzed through MALDI TOF/TOF 
Mass Spectrometer (Bruker Daltonik, Germany). All 
the acquired peptide mass finger prints of 
MALDI-TOF MS/MS data were analyzed through the 
BioTools 3.0 program to search the protein database 
(NCBInr) using in-house Mascot software (Matrix 
Science, UK). Metazoa (Animals) was selected as 
the taxonomic category. To ensure the confidence of 
identified results, the search parameters were set as 
follows: trypsin was selected as enzyme, one missed 
cleavage was allowed, carbamidomethyl was 
selected as fixed modification, Gln->pyro-Glu 
(N-term Q) was chosen as variable modification, and 
peptide tolerance was set at ±100 ppm with a MH+ 
mass values. The proteins whose Mascot scores 
were more than 55 were considered to be reliably 
identified. 

 
Gene ontology (GO) analysis 

To evaluate the major biological functions of the 
differentially expressed proteins among mq-m1, 
mq-m2, and mq-qc, Gene Ontology (GO) analysis 
(http://www.geneontology.org/) was employed. The 
GO IDs of all identified proteins were obtained by 
InterProscan searching 

(http://www.ebi.ac.uk/interpro/scan.html) using the 
amino acid sequences. Following the Ye’s method 
(Ye et al., 2006), the annotation information of 
identified proteins was gathered and then uploaded 
as Web Gene Ontology Annotation Plot (WEGO) 
Native Format into WEGO 
(http://wego.genomics.org.cn/cgi-bin/wego/index.pl). 
Finally, the GO plot was obtained and downloaded 
as jepg format. According to WEGO, all identified 
proteins was classified as molecular function, 
cellular component and biological process (Ye et al., 
2006). 
 
RNA extraction and quantitative real-time PCR 
(qRT-PCR) 

Using Trizol reagent (Invitrogen, USA), total 
RNA was extracted and 1 μg RNA was used for the 
first strand synthesis. The specific primers were 
shown in Table S1. The qRT-PCR was performed in 
a total volume of 20 μL containing 2 μL of cDNA (200 
ng), 10 μL of SYBR Green Master Mix (Vazyme 
Biotech Co., Ltd, China), 0.4 μL of 50×ROX 
Reference Dye I, 0.4 μL of primers (10 μM) and 7.2 
μL of H2O. Amplification was carried out using an 
ABI7300 PCR thermocycler (Applied Biosystems, 

USA) as follows: 5 min at 95 C, followed by 40 

cycles of 10 s at 95 C, 31 s at 60 C and one cycle 

of 15 s at 95 C, 60 s at 60 C, 15 s at 95 C. The 
α-tubulin gene (NCBI accession No. 
NM_001043419.1) of silkworm was amplified as a 
reference and the experiments were repeated three 
times. 
 

Results 
 

Differentially expressed proteins between mq-m1, 
mq-m2, and mq-qc 

To investigate the molecular mechanism of 
silkworm molting, we applied proteomic approach to 

http://wego.genomics.org.cn/cgi-bin/wego/index.pl


391 

comprehensively identify and then characterize the 
differentially expressed proteins during the fourth 
molt of silkworm. As shown in Figures 1, 2 and 3, 
most protein spots were mainly distributed in the 
range of pH 4 - 7 and mass weight 20 - 100 kDa, 
indicating that protein samples were correctly 
extracted and most proteins from the larval heads of 
silkworm were obtained. Totally, 842 ± 15, 825 ± 13, 
827 ± 10, 857 ± 16 protein spots were detected in 

mq, m1, m2, and qc, respectively, in CBB R-250 
stained gels. Using ImageMaster 7.0 software, 24, 
20, and 18 different protein spots were ultimately 
determined between mq-m1, mq-m2, and mq-qc, 
respectively (Supplementary file, Table S2). Through 
further analysis, these 62 differentially expressed 
proteins can be classified into 35 different proteins, 
which were numbered uniformly (Table 1) and 
labeled in Figures 1, 2 and 3. 

 
 
 
 

 
 
Fig. 2 The 2-DE profiles from head extracted proteins between mq and m2. 
 
 

 
 
Fig. 3 The 2-DE profiles from head extracted proteins between mq and qc. 
 
 
 
MALDI-TOF MS/MS identification of differentially 
expressed proteins and functional classification 

Among 35 differentially expressed proteins, 34 
proteins were successfully identified through 
MALDI-TOF MS/MS and database searches 
(Mascot score > 55), and one protein was identified 
through MALDI-TOF MS and database searches 
(Mascot score > 84) (Table 1). According to Bevan 

et al. (1998), these 35 proteins can be divided into 
the following nine categories: cell structure proteins, 
metabolism-related proteins, 
disease/defense-related proteins, transporter, 
transcription, molecular chaperone, secondary 
metabolism, protein synthesis, and unknown 
function proteins (Fig. 4). As shown in Figure 4, 
42 % of the identified proteins were classified into the 



392 

Table 1 Identification of differentially expressed proteins by MALDI-TOF MS/MS 
 

Spot 
No. 

Protein name Accession No. Mr(kDa)/pI a 
Mascot 
scores 

SC b 
(%) 

Amino 
acid 

Function 

1 heat shock protein 70-3 AEI58998 72.82/5.12 138 25% 655 
Molecular 
chaperone 

2 tubulin alpha-3 chain, partial KFQ41598 43.57/5.79 197 55% 389 Cell structure 

3 beta-1 tubulin TBB1_MANSE 50.65/4.75 262 64% 447 Cell structure 

4 uncharacterized protein LOC101738727 XP_012552185 49.91/5.29 129 31% 449 
Unknown 
function 

5 vacuolar ATP synthase subunit b NP_001091828 54.67/5.25 187 55% 490 Metabolism 

6 antichymotrypsin-2 ACH2_BOMMO 41.43/5.26 109 39% 375 Metabolism 

7 antitrypsin isoform 1 ACT36276 43.46/5.41 145 41% 392 Metabolism 

8 uncharacterized LOC101739385 XP_004922152 37.46/6.07 91 32% 328 
Unknown 
function 

9 annexin BAB16697 36.11/4.89 138 43% 323 
Disease and 
defense 

10 alpha-tocopherol transfer protein-like XP_004928929 35.28/5.56 146 47% 306 Transporter 

11 alpha-tocopherol transfer protein-like XP_004928929 35.28/5.56 183 50% 306 Transporter 

12 juvenile hormone binding protein brP-2095 precursor NP_001036987 28.05/5.42 140 55% 249 
Secondary 
metabolism 

13 cuticular protein RR-1 motif 34 precursor NP_001166717 23.18/4.78 107 56% 207 Cell structure 

14 adenylate kinase isoenzyme 1 XP_004929167 25.29/5.70 108 57% 226 Metabolism 

15 tumor protein D54 isoform X3 XP_004930117 22.32/5.41 91 28% 206 Cell structure 

16 putative cuticle protein FAA00454 21.66/5.39 91 45% 215 Cell structure 

17 H+ transporting ATP synthase subunit d NP_001093279 20.19/5.56 57 52% 179 Metabolism 

18 transcription factor BTF3 homolog 4 XP_012551703 19.04/9.12 201 48% 174 Transcription 

19 triosephosphate isomerase NP_001119730 26.93/5.67 168 64% 248 Metabolism 

20 odorant binding protein fmxg18C17 precursor NP_001157372 26.48/6.23 121 28% 236 Cell structure 

21 glutathione S-transferase sigma 1 NP_001037077 23.60/5.98 131 54% 206 
Disease and 

defense 

22 cuticular protein RR-1 motif 42 precursor NP_001166712 17.17/5.16 151 86% 159 Cell structure 

23 actin-depolymerizing factor 1 NP_001093278 17.23/6.17 175 64% 148 Cell structure 

24 muscular protein 20 NP_001040476 20.29/8.70 79 20% 184 Cell structure 

25 cuticular protein 66D NP_729400 30.80/5.97 74 20% 270 Cell structure 

26 cuticular protein RR-2 motif 67 precursor NP_001166691 18.72/6.16 223 43% 178 Cell structure 

27 uncharacterized protein LOC101741978 XP_004930780 16.55/4.93 117 46% 144 
Unknown 

function 

28 ribosomal protein P2 NP_001037213 11.53/4.68 121 16% 112 
Protein 
synthesis 

29 beta tubulin NP_001036887 50.72/4.83 267 70% 447 Cell structure 

30 centromere protein F isoform X2 XP_004926842 33.22/4.84 157 30% 297 Cell structure 

31 T-complex protein 1 subunit epsilon-like XP_004933262 59.19/5.63 127 31% 542 
Molecular 

chaperone 

32 cuticular protein RR-1 motif 3 precursor NP_001166744 14.68/4.66 93 28% 137 Cell structure 

33 cuticular protein RR-1 motif 3 precursor NP_001166744 14.68/4.66 64 26% 137 Cell structure 

34 thiol peroxiredoxin NP_001037083 22.07/6.09 252 18% 195 
Disease and 
defense 

35 ubiquitin-like protein SMT3 NP_001037410 10.36/5.29 105 23% 91 Transcription 

 
a MW: Molecular weight; pI: Isoelectric point 
b SC: Sequence coverage 
c The identified protein by MALDI-TOF MS 



392 

 
 
Fig. 4 Functional classifications of the identified proteins. 
 
 
 
 
 
cell structure group, 16 % proteins belonged to the 
metabolism group, which accounted for 58 % of the 
identified proteins and were the most abundant 
proteins in the heads of silkworm larvae. Compared 
with HCS occurring stage, up-regulated proteins in 
early, mid-molt of the fourth molt period, and newly 
molted fifth instar larvae mainly involved in cell 
structure, but down-regulated proteins mainly 
involved in metabolism (Supplementary file, Table 
S1). In particular, four metabolism/secondary 
metabolism-related proteins were found to express 
regularly (Fig. 5, spot nos. 5, 12, 14, 17). Among 
these four proteins, spot no. 5, 12 and 14 highly 
expressed at HCS occurring stage, and then 
gradually declined at early, mid-molt stages, 
especially spot no. 5 and 12. At newly molted fifth 
instar larvae stage, the expression levels of these 
proteins increased again (Fig. 5). As shown in Table 
1, these proteins were vacuolar ATPase subunit b, 
juvenile hormone binding protein brP-2095 precursor, 
adenylate kinase isoenzyme 1, H+ transporting ATP 
synthase subunit d, respectively. Meanwhile, we 
also identified some stress and/or defense-related 
proteins, including annexin (Table 1, Fig. 1, spot no. 
9), glutathione S-transferase sigma 1 (Table 1, Fig. 1, 
spot no. 21), thiol peroxiredoxin (Table 1, Fig. 3, spot 
no. 34). As shown in Table 1 and Figure 1, annexin 
was down-regulated at 12 h after HCS (m1), 
whereas glutathione S-transferase was up-regulated 
at 12 h after HCS (m1). The expression level of thiol 
peroxiredoxin had no obvious change among HCS 

(mq), 12 h after HCS (m1), and 24 h after HCS (m2), 
but its expression level was significantly 
down-regulated at newly molted fifth instar larvae (qc) 
stage (Table 1, Fig. 3, spot no. 34). 
 
GO analysis 

All GO annotations of differentially expressed 
proteins were summarized and used for GO analysis. 
As shown in Figure 6, these proteins mainly involved 
in cell, cell part, organelle, organelle part, binding, 
catalytic, structural molecule, cellular process, and 
metabolic process, which were consistent with its 
specific developmental stages. The GO analysis can 
provide useful clues for subsequent studies of 
physiological roles and characteristics of these 
identified proteins. 
 
Quantitative real-time PCR 

In current study, four proteins (spot no. 5, 
vacuolar ATP synthase subunit b; spot no. 12, 
juvenile hormone binding protein brP-2095 precursor; 
spot no. 14, adenylate kinase isoenzyme 1; spot no. 
17, H+ transporting ATP synthase subunit d) were 
selected to investigate their expression patterns at 
transcript level. As shown in Figure 7, vacuolar ATP 
synthase subunit b (spot no. 5) and H+ transporting 
ATP synthase subunit d (spot no. 17) displayed 
good correlation between transcript and protein 
levels at each time point. Compared with 12 h and 
24 h after HCS (m1 and m2), juvenile hormone 
binding protein brP-2095 precursor (spot no. 12) and 

393 



394 

 
 
Fig. 5 Enlarged view of distribution of regularly changed proteins. Changed proteins were indicated by black 
arrows, spot numbers were shown on the first column, and the quantitative changes of proteins were shown in the 
last column (Vol %: spot relative volume). Values are average of three replicates. 
 
 
 
 
 
adenylate kinase isoenzyme (spot no. 14) were both 
up-regulated at transcript and protein levels at mq 
and qc stages (Fig. 7). The quantitative real-time 
PCR results demonstrated that the expression 
patterns of these proteins at transcript level were 
basically consistent with the proteomic results. 
 
Discussion 

 
In this study, we applied proteomic approach to 

globally identify different proteins during the fourth 
molting of silkworm and evaluate proteomic dynamic 
changes and their roles in this specific period. Taken 
together, 35 differentially expressed proteins were 
successfully identified through mass spectrometry 
and database searches. Among these identified 
proteins, 42 % proteins were classified as the cell 
structure group, which were the most abundant 
proteins in silkworm larval heads of the fourth 
molting stage, indicating that cell components of the 
heads at this stage changed dramatically. Moreover, 

down-regulated proteins at early, mid-molt, and 
newly molted fifth instar larvae mainly consisted of 
metabolism-related proteins, indicating the 
metabolic levels at these stages were very low, 
which were consistent with its specific 
developmental period. Interestingly, the expression 
levels of three metabolism/secondary 
metabolism-related proteins were down-regulated 
significantly at early, mid-molt stages (Fig. 5, spot 
nos. 5, 12, 14), which were further confirmed by 
quantitative real-time PCR. Meanwhile, these three 
proteins had the Mascot scores with 187, 140, and 
108, and their sequence coverages were 55 %, 52 %, 
and 57 %, which strongly supported for their positive 
identification (Table 1, Supplementary files, Figs S1, 
S2, S3). The vacuolar ATPase (V-ATPase) is a 
heteromultimeric protein complexes that consists of 
the peripheral V1 domain and the integral V0 
domain, which is ATP-driven proton pumps and can 
transport protons across the plasma membrane 
(Beyenbach and Wieczorek, 2006; Forgac, 2007; 



395 

 
 
Fig. 6 The Gene Ontology (GO) analysis (Web Gene Ontology Annotation Plot) for differentially expressed 
proteins. The left coordinate axis represents the proportion of proteins for every GO annotation, and the right one 
indicates the number of proteins for each GO annotation. 
 
 
 
 
 
Collaco et al., 2013; Lv et al., 2014). V-ATPases are 
essential for pH regulation of the intracellular 
compartments, the extracellular space, and the 
cytoplasm and play a vital role in acidification of 
organelles within the lysosomal, endocytic, and 
secretory pathways (Breton and Brown, 2007; 
Collaco et al., 2013). The juvenile hormone binding 
proteins (JHBPs) are specific carriers of juvenile 
hormone (JH) and also the first member in the series 
of proteins participating in JH signal transmission 
(Sok et al., 2005). As the key proteins in JH signaling, 
JHBPs can not only transport JH to its target tissues 
where JH exerts a physiological effect (Goodman, 
1990), but also inhibit enzymatic degradation of JH 
through general hemolymph esterases (Ritdachyeng 
et al., 2012). Previous studies have pointed out that 
more than 99.8 % JH in hemolymph emerges in a 
complex with JHBPs and the interaction between JH 
and its carrier partner protein is specific (Ozyhar and 
Kochman, 1987; Touhara et al., 1993; Ritdachyeng 
et al., 2012). It is well known that JH plays pivotal 
roles in regulating insect growth and development, 
especially in maintaining the larval state, which 
ensures growth of the larva and prevents 
metamorphosis (Riddiford, 1994; Vermunt et al., 
2001). Therefore, as JH signal transmitters and 

specific carrier proteins, information concerning 
JHBPs not only provides an alternative approach to 
understand how JH regulates metamorphosis, but 
also affords important clues for us to investigate the 
molecular mechanism of silkworm molting. Previous 
studies have shown that JH regulates 
metamorphosis by way of specific gene 
up-regulation and down-regulation (Riddiford, 1994; 
Truman and Riddiford, 1999; Gilbert et al., 2000). In 
current study, although JH was not detected, the 
precursor of its carrier protein decreased 
significantly during silkworm molting. These 
observations suggest that JH regulates 
metamorphosis by way of JHBP down-regulation, 
that is, JHBP indirectly participates in the regulation 
of silkworm molting and plays a crucial role during 
silkworm molting (Fig. 8, A pathway). Adenylate 
kinase (AK) is ubiquitous in a variety of organisms 
and can catalyze a reversible high energy 
phosphoryl transfer reaction between ATP and AMP 
to generate ADP (Noda, 1973; Miura et al., 2001), 
which facilitates to regulate AMP levels. The 
previous study has demonstrated that the blood 
AMP levels are potential metabolic signals related to 
vital functions, including body energy sensing, sleep, 
hibernation and food intake (Dzeja and Terzic, 2009). 



396 

 
 
Fig. 7 Relative expression levels of spot nos. 5, 12, 14 and 17. X-axis represents different samples, Y-axis 
represents the relative expression level of each protein. 
 
 
 
 
 
The energy from adenylate kinase-catalyzed 
phosphotransfer can regulate multiple extracellular 
and intracellular energy-dependent and nucleotide 
signaling processes, including cell and ciliary motility, 
excitation-contraction coupling, energetics of cell 
cycle, DNA synthesis and repair, hormone secretion, 
nuclear transport, and developmental programming 
(Dzeja and Terzic, 2009). In current study, the 
expression levels of AK isoenzyme at HCS and 
newly molted fifth instar larvae stages were higher 
than that at early, mid-molt stages. As mentioned 
above, AMP levels were associated with some 
crucial functions, such as body energy sensing, 
sleep and hibernation. Therefore, we postulated that 
AK may function as a mediator that control 
developmental events such as diapause, molting 
and eclosion, which was firstly found that AK might 
be correlated with silkworm molting (Fig. 8, B 
pathway). These findings described here not only 
improve our understanding of the molecular 
mechanism of silkworm molting, but also 

demonstrate that comparative proteomic approach 
can be conducive to identifying different proteins and 
investigating their roles in silkworm studies. 
 
Conclusions 

 
In current study, proteomic method was 

employed to investigate and analyze the changes of 
different proteins during silkworm molting, which 
enabled us to better understand the molecular 
mechanism of molting. Eventually, 35 different 
proteins were successfully identified, including 
juvenile hormone binding protein precursor and 
adenylate kinase isoenzyme. The identification of 
these two proteins suggests that JHBPs and AK may 
take part in the regulation of silkworm molting. As a 
consequence, our results not only provide novel 
insights and references for the explanation of 
molecular mechanism of silkworm molting, but also 
provide candidate proteins and genes for the following 
investigations of their roles in silkworm molting. 



397 

 
 
Fig. 8 The speculative molecular mechanism of silkworm molting. 
 
 
 
 
 
Acknowledgments 

This work was supported by National Natural 
Science Foundation of China (31572467), the 
Priority Academic Program Development of Jiangsu 
Higher Education Institutions, the Scientific 
Research Promotion Fund for the Talents of Jiangsu 
University (11JDG049). We are thankful to the 
anonymous reviewers for reviewing our manuscript 
and providing helpful comments and suggestions. 
 
References 
Arunprasanna V, Kannan M, Anbalagan S, Krishnan 

M. Comparative proteomic analysis of larva and 
adult heads of silkworm, Bombyx mori 
(Lepidoptera: Bombycidae). J. Entomol. 1-12, 
2017. 

Bevan M, Bancroft I, Bent E, Love K, Goodman H, 
Dean C, et al. Analysis of 1.9 Mb of contiguous 
sequence from chromosome 4 of Arabidopsis 
thaliana. Nature 391: 485-488, 1998. 

Beyenbach KW, Wieczorek H. The V-type H+ 
ATPase: molecular structure and function, 
physiological roles and regulation. J. Exp. Biol. 
209: 577-589, 2006. 

Bradford MM. A rapid and sensitive method for the 
quantitation of microgram quantities of protein 
utilizing the principle of protein-dye binding. 
Anal. Biochem. 72: 248-254, 1976. 

Breton S, Brown D. New insights into the regulation 
of V-ATPase-dependent proton secretion. Am. J. 
Physiol.-Renal. 292: 10, 2007. 

Cilia M, Fish T, Yang X, McLaughlin M, 
Thannhauser TW, Gray S. A comparison of 
protein extraction methods suitable for 
gel-based proteomic studies of aphid proteins. J. 
Biomol. Tech. 20: 201-215, 2009. 

Collaco AM, Geibel P, Lee BS, Geibel JP, Ameen 
NA. Functional vacuolar ATPase (V-ATPase) 
proton pumps traffic to the enterocyte brush 
border membrane and require CFTR. Am. J. 
Physiol - Cell Physiol. 305: C981-C996, 2013. 

Dahanukar A, Hallem EA, Carlson JR. Insect 
chemoreception. Curr. Opin. Neurobiol. 15: 
423-430, 2005. 

Dzeja P, Terzic A. Adenylate kinase and AMP 
signaling networks: metabolic monitoring, signal 
communication and body energy sensing. Int. J. 
Mol. Sci. 10: 1729-1772, 2009. 

Feng F, Chen L, Lian C, Xia H, Zhou Y, Yao Q, et al. 
Comparative proteomic analysis reveals the 
suppressive effects of dietary high glucose on 
the midgut growth of silkworm. J. Proteomics 
108: 124-132, 2014. 

Forgac M. Vacuolar ATPases: rotary proton pumps 
in physiology and pathophysiology. Nat. Rev. 
Mol. Cell Biol. 8: 917-929, 2007. 

Gilbert LI, Granger NA, Roe RM. The juvenile 
hormones: historical facts and speculations on 
future research directions. Insect Biochem. Mol. 
30: 617-644, 2000. 

Goodman WG. Biosynthesis, titer regulation and 
transport of juvenile hormones, in: Gupta, AP 
(ed.), Morphogenetic Hormones of Arthropods. 
Discoveries, Syntheses, Metabolism, Evolution, 
Mode of Action and Techniques. Rutgers 
University Press, New Brunswick, pp 83-124, 
1990. 

Hou Y, Zou Y, Wang F, Gong J, Zhong X, Xia Q, et 
al. Comparative analysis of proteome maps of 
silkworm hemolymph during different 
developmental stages. Proteome Sci. 8: 
2010. 



398 

Jia SH, Li MW, Zhou B, Liu WB, Zhang Y, Miao XX, 
et al. Proteomic analysis of silk gland 
programmed cell death during metamorphosis 
of the silkworm Bombyx mori. J. Proteome Res. 
6: 3003-3010, 2007. 

Kannan M, Suryaaathmanathan V, Saravanakumar 
M, Jaleel A, Romanelli D, Tettamanti G, et al. 
Proteomic analysis of the silkworm midgut 
during larval-pupal transition. Inv. Surv. J. 13: 
191-204, 2016. 

Kinjoh T, Kaneko Y, Itoyama K, Mita K, Hiruma K, 
Shinoda T. Control of juvenile hormone 
biosynthesis in Bombyx mori: Cloning of the 
enzymes in the mevalonate pathway and 
assessment of their developmental expression 
in the corpora allata. Insect Biochem. Mol. 37: 
808-818, 2007. 

Laemmli UK. Cleavage of structural proteins during 
the assembly of the head of bacteriophage T4. 
Nature 227: 680-685, 1970. 

Li JY, Chen X, Fan W, Moghaddam SHH, Chen M, 
Zhou ZH, et al. Shotgun strategy-based 
proteome profiling analysis on the head of 
silkworm Bombyx mori. Amino Acids 39: 
751-761, 2009. 

Li JY, Chen X, Fan W, Moghaddam SH, Chen M, 
Zhou ZH, et al. Proteomic and bioinformatic 
analysis on endocrine organs of domesticated 
silkworm, Bombyx mori L. for a comprehensive 
understanding of their roles and relations. J. 
Proteome Res. 2620-2632, 2009. 

Li XH, Wu XF, Yue WF, Liu JM, Li GL, Miao YG. 
Proteomic analysis of the silkworm (Bombyx 
mori L.) hemolymph during developmental 
stage. J. Proteome Res. 5: 2809-2814, 2006. 

Li Y, Wang X, Chen Q, Hou Y, Xia Q, Zhao P. 
Metabolomics analysis of the larval head of the 
silkworm, Bombyx mori. Int. J. Mol. Sci. 17: 
1460, 2016. 

Liu X, Yao Q, Wang Y, Chen K. Proteomic analysis 
of nucleopolyhedrovirus infection resistance in 
the silkworm, Bombyx mori Lepidoptera: 
Bombycidae. J. Invertebr. Pathol. 105: 84-90, 
2010. 

Lv X, Huang L, Chen W, Wang X, Huang Y, Deng C, 
et al. Molecular characterization and serological 
reactivity of a vacuolar ATP synthase subunit 
ε-like protein from Clonorchis sinensis. Parasitol. 
Res. 113: 1545-1554, 2014. 

Miura K, Inouye S, Sakai K, Takaoka H, Kishi F, 
Tabuchi M, et al. Cloning and characterization 
of adenylate kinase from Chlamydia 
pneumoniae. J. Biol. Chem. 276: 13490-13498, 
2001. 

Moghaddam SHH, Du X, Li J, Cao J, Zhong B, Chen 
Y. Proteome analysis on differentially expressed 
proteins of the fat body of two silkworm breeds, 
Bombyx mori, exposed to heat shock exposure. 
Biotechnol. Bioproc. E. 13: 624-631, 2008. 

Muramatsu D, Kinjoh T, Shinoda T, Hiruma K. The 
role of 20-hydroxyecdysone and juvenile 
hormone in pupal commitment of the epidermis 
of the silkworm, Bombyx mori. Mech. Dev. 125: 
411-420, 2008. 

Noda L. The Enzymes. Boyer PD (ed.), Academic 
Press, New York 8, pp 279-305, 1973. 

Ozyhar A, Kochman M. Juvenile-hormone-binding 
protein from the hemolymph of Galleria 
mellonella L. Isolation and characterization. Eur. 
J. Biochem. 162: 675-682, 1987. 

Qin L, Xia H, Shi H, Zhou Y, Chen L, Yao Q, et al. 
Comparative proteomic analysis reveals that 
caspase-1 and serine protease may be involved 
in silkworm resistance to Bombyx mori nuclear 
polyhedrosis virus. J. Proteomics 75: 3630-3638, 
2012. 

Riddiford LM. Cellular and Molecular Actions of 
Juvenile Hormone I. General Considerations 
and Premetamorphic Actions, in: Evans PD 
(ed.), In Advances in Insect Physiology. 
Academic Press pp 213-274, 1994. 

Ritdachyeng E, Manaboon M, Tobe SS, Singtripop T. 
Molecular characterization and gene expression 
of juvenile hormone binding protein in the 
bamboo borer, Omphisa fuscidentalis. J. Insect 
Physiol. 58: 1493-1501, 2012. 

Sok AJ, Kamila C, Andrzej O, Marian K. The 
structure of the juvenile hormone binding protein 
gene from Galleria mellonella. Biol. Chem. 386: 
2259-2210, 2005. 

Touhara K, Lerro KA, Bonning BC, Hammock BD, 
Prestwich GD. Ligand binding by a recombinant 
insect juvenile hormone binding protein. 
Biochemistry 32: 2068-2075, 1993. 

Truman JW, Riddiford LM. The origins of insect 
metamorphosis. Nature 401: 447-452, 1999. 

Vermunt AMW, Kamimura M, Hirai M, Kiuchi M, 
Shiotsuki T. The juvenile hormone binding 
protein of silkworm haemolymph: gene and 
functional analysis. Insect Mol. Biol. 10: 147-154, 
2001. 

Wang GB, Zheng Q, Shen YW, Wu XF. Shotgun 
proteomic analysis of Bombyx mori brain: 
emphasis on regulation of behavior and 
development of the nervous system. Insect Sci. 
23: 15-27, 2016. 

Wang MX, Lu Y, Cai ZZ, Liang S, Niu YS, Miao 
YG. Phenol oxidase is a necessary enzyme 
for the silkworm molting which is regulated by 
molting hormone. Mol. Biol. Rep. 40: 
3549-3555, 2013. 

Xia Q, Guo Y, Zhang Z, Li D, Xuan Z, Li Z, et al. 
Complete resequencing of 40 genomes reveals 
domestication events and genes in silkworm 
Bombyx. Science 326: 433-436, 2009. 

Xia Q, Zhou Z, Lu C, Cheng D, Dai F, Li B, et al. A 
draft sequence for the genome of the 
domesticated silkworm Bombyx mori. Science 
306: 1937-1940, 2004. 

Ye J, Fang L, Zheng H, Zhang Y, Chen J, Zhang Z, 
et al. WEGO: a web tool for plotting GO 
annotations. Nucleic Acids Res. 34: W293-297, 
2006. 

Yi Q, Zhao P, Wang X, Zou Y, Zhong X, Wang C, et 
al. Shotgun proteomic analysis of the Bombyx 
mori anterior silk gland: An insight into the 
biosynthetic fiber spinning process. Proteomics 
13: 2657-2663, 2013. 

Zhang P, Aso Y, Yamamoto K, Banno Y, Wang Y, 
Tsuchida K, et al. Proteome analysis of silk 
gland proteins from the silkworm, Bombyx mori. 
Proteomics 6: 2586-2599, 2006. 

 



399 

Supplementary material 
 
Table S1 Primer sequences used for quantitative real-time PCR 
 

Spot 
No.a 

Protein name Forward primer (5’-3’) Reverse primer (5’-3’) 

5 
vacuolar ATP synthase 
subunit B 

GCCTAGGCTCACTTACAAGACT GACCAGAACGAAGGGTTCCA 

12 
juvenile hormone binding 
protein brP-2095 precursor 

TGTTCAACACAAACGCCGAC ACCCTTCGTAAACTCAGGCAG 

14 adenylate kinase isoenzyme 1 CCCGGATCAGGAAAGGGAAC CTCTCCGAGCCGCTTTTGAC 

17 
H+ transporting ATP synthase 
subunit D 

CTACTGCCGTATGACCAGAT GACATAGTCGAGCTGCTCTT 

 α-tubulin CTCCCTCCTCCATACCCT ATCAACTACCAGCCACCC 

a The spot number of identified proteins (see Table 1). 
 
 
 
Table S2 The differentially expressed proteins and their identification through MALDI-TOF MS/MS 
 

Material 
Expression 
level b 

Spot 
No. 

Protein name Accession No. Mr(kDa)/pI c 
Mascot 
scores 

SCd 
(%) 

Amino 
acid 

Function 
Fold 
change 

mq-m1 a 
Up-regulated 
proteins 

1 
heat shock protein 
70-3 

AEI58998 72.82/5.12 138 25% 655 
Molecular 
chaperone 

1.7 

  4 

uncharacterized 

protein 
LOC101738727 

XP_012552185 49.91/5.29 129 31% 449 
Unknown 
function 

2.4 

  7 antitrypsin isoform 1 ACT36276 43.46/5.41 145 41% 392 Metabolism 1.8 

  10 
alpha-tocopherol 
transfer protein-like 

XP_004928929 35.28/5.56 146 47% 306 Transporter 2.9 

  11 
alpha-tocopherol 

transfer protein-like 
XP_004928929 35.28/5.56 183 50% 306 Transporter 2.5 

  13 e 
cuticular protein 
RR-1 motif 34 

precursor 

NP_001166717 23.18/4.78 107 56% 207 
Cell 

structure 
3.9 

  15 
tumor protein D54 
isoform X3 

XP_004930117 22.32/5.41 91 28% 206 
Cell 
structure 

1.9 

  16 
putative cuticle 
protein 

FAA00454 21.66/5.39 91 45% 215 
Cell 
structure 

2.2 

  20 

odorant binding 

protein fmxg18C17 
precursor 

NP_001157372 26.48/6.23 121 28% 236 
Cell 

structure 
3.1 

  21 

glutathione 

S-transferase sigma 
1 

NP_001037077 23.60/5.98 131 54% 206 
Disease and 

defense 
2.9 

  23 
actin-depolymerizing 

factor 1 
NP_001093278 17.23/6.17 175 64% 148 

Cell 

structure 
2.3 

 
Down-regulated 
proteins 

2 
tubulin alpha-3 
chain, partial 

KFQ41598 43.57/5.79 197 55% 389 
Cell 
structure 

2.2 

  3 beta-1 tubulin TBB1_MANSE 50.65/4.75 262 64% 447 
Cell 
structure 

2.0 

  5 
vacuolar ATP 

synthase subunit b 
NP_001091828 54.67/5.25 187 55% 490 Metabolism 2.0 

  6 antichymotrypsin-2 ACH2_BOMMO 41.43/5.26 109 39% 375 Metabolism 1.8 

  9 annexin BAB16697 36.11/4.89 138 43% 323 
Disease and 
defense 

2.0 

  12 
juvenile hormone 
binding protein 
brP-2095 precursor 

NP_001036987 28.05/5.42 140 55% 249 
Secondary 
metabolism 

3.1 

  14 
adenylate kinase 
isoenzyme 1 

XP_004929167 25.29/5.70 108 57% 226 Metabolism 1.9 

  17 
H+ transporting ATP 

synthase subunit d 
NP_001093279 20.19/5.56 57 52% 179 Metabolism 1.7 

  19 
triosephosphate 
isomerase 

NP_001119730 26.93/5.67 168 64% 248 Metabolism 1.7 

  22 
cuticular protein 
RR-1 motif 42 
precursor 

NP_001166712 17.17/5.16 151 86% 159 
Cell 
structure 

3.0 



399 

 Unique proteins 8 
uncharacterized 

LOC101739385 
XP_004922152 37.46/6.07 91 32% 328 

Unknown 

function 
 

  18 
transcription factor 
BTF3 homolog 4 

XP_012551703 19.04/9.12 201 48% 174 
Transcriptio
n 

 

  24 muscular protein 20 NP_001040476 20.29/8.70 79 20% 184 
Cell 
structure 

 

mq-m2 a 
Up-regulated 
proteins 

1 
heat shock protein 
70-3 

AEI58998 72.82/5.12 138 25% 655 
Molecular 
chaperone 

2.1 

  10 
alpha-tocopherol 

transfer protein-like 
XP_004928929 35.28/5.56 121 28% 306 Transporter 1.8 

  11 
alpha-tocopherol 
transfer protein-like 

XP_004928929 35.28/5.56 183 50% 306 Transporter 1.9 

  13 
cuticular protein 
RR-1 motif 34 
precursor 

NP_001166717 23.18/4.78 107 56% 207 
Cell 
structure 

3.4 

  15 
tumor protein D54 
isoform X3 

XP_004930117 22.32/5.41 91 28% 206 
Cell 
structure 

1.7 

  17 
H+ transporting ATP 

synthase subunit d 
NP_001093279 20.19/5.56 57 52% 179 Metabolism 2.0 

  23 
actin-depolymerizing 
factor 1 

NP_001093278 17.23/6.17 175 64% 148 
Cell 
structure 

1.7 

  25 cuticular protein 66D NP_729400 30.80/5.97 74 20% 270 
Cell 
structure 

2.5 

  26 

cuticular protein 

RR-2 motif 67 
precursor 

NP_001166691 18.72/6.16 223 43% 178 
Cell 
structure 

8.6 

  28 ribosomal protein P2 NP_001037213 11.53/4.68 121 16% 112 
Protein 

synthesis 
2.4 

 
Down-regulated 

proteins 
5 

vacuolar ATP 

synthase subunit b 
NP_001091828 54.67/5.25 187 55% 490 Metabolism 2.3 

  6 antichymotrypsin-2 ACH2_BOMMO 41.43/5.26 109 39% 375 Metabolism 2.8 

  12 

juvenile hormone 

binding protein 
brP-2095 precursor 

NP_001036987 28.05/5.42 140 55% 249 
Secondary 
metabolism 

11.1 

  14 
adenylate kinase 

isoenzyme 1 
XP_004929167 25.29/5.70 108 57% 226 Metabolism 2.1 

  18 
transcription factor 
BTF3 homolog 4 

XP_012551703 19.04/9.12 201 48% 174 
Transcriptio
n 

4.0 

  19 
triosephosphate 
isomerase 

NP_001119730 26.93/5.67 168 64% 248 Metabolism 1.6 

  20 

odorant binding 

protein fmxg18C17 
precursor 

NP_001157372 26.48/6.23 121 28% 236 
Cell 
structure 

3.7 

  24 muscular protein 20 NP_001040476 20.29/8.70 79 20% 184 
Cell 

structure 
4.8 

 Unique proteins 22 

cuticular protein 

RR-1 motif 42 
precursor 

NP_001166712 17.17/5.16 151 86% 159 
Cell 

structure 
 

  27 

uncharacterized 

protein 
LOC101741978 

XP_004930780 16.55/4.93 117 46% 144 
Unknown 

function 
 

mq-qc a 
Up-regulated 

proteins 
10 

alpha-tocopherol 

transfer protein-like 
XP_004928929 35.28/5.56 146 47% 306 Transporter 2.0 

  13 
cuticular protein 
RR-1 motif 34 

precursor 

NP_001166717 23.18/4.78 107 56% 207 
Cell 
structure 

3.2 

  17 
H+ transporting ATP 
synthase subunit d 

NP_001093279 20.19/5.56 57 52% 179 Metabolism 2.4 

  29 beta tubulin NP_001036887 50.72/4.83 267 70% 447 
Cell 
structure 

1.9 

  30 
centromere protein F 

isoform X2 
XP_004926842 33.22/4.84 157 30% 297 

Cell 

structure 
1.7 

  32 
cuticular protein 
RR-1 motif 3 

precursor 

NP_001166744 14.68/4.66 93 28% 137 
Cell 
structure 

2.4 

  33 
cuticular protein 
RR-1 motif 3 

precursor 

NP_001166744 14.68/4.66 64 26% 137 
Cell 
structure 

2.5 

 
Down-regulated 
proteins 

5 
vacuolar ATP 
synthase subunit b 

NP_001091828 54.67/5.25 187 55% 490 Metabolism 1.8 

  12 
juvenile hormone 
binding protein 
brP-2095 precursor 

NP_001036987 28.05/5.42 140 55% 249 
Secondary 
metabolism 

4.0 

  14 
adenylate kinase 
isoenzyme 1 

XP_004929167 
25.29/5.70 108 57% 226 Metabolism 1.7 

  22 cuticular protein NP_001166712 17.17/5.16 151 86% 159 Cell 4.4 

400 



399 

RR-1 motif 42 

precursor 

structure 

  31 
T-complex protein 1 
subunit epsilon-like 

XP_004933262 59.19/5.63 127 31% 542 
Molecular 
chaperone 

2.1 

  34 thiol peroxiredoxin NP_001037083 22.07/6.09 252 18% 195 
Disease and 
defense 

2.5 

  35 
ubiquitin-like protein 
SMT3 

NP_001037410 10.36/5.29 105 23% 91 
Transcriptio
n 

1.8 

 Unique proteins 7 antitrypsin isoform 1 ACT36276 43.46/5.41 145 41% 392 Metabolism  

  8 
uncharacterized 
LOC101739385 

XP_004922152 37.46/6.07 91 32% 328 
Unknown 
function 

 

  26 
cuticular protein 
RR-2 motif 67 
precursor 

NP_001166691 18.72/6.16 223 43% 178 
Cell 
structure 

 

  27 
uncharacterized 
protein 
LOC101741978 

XP_004930780 16.55/4.93 117 46% 144 
Unknown 
function 

 

 
a mq: silkworm from head capsule slippage (HCS) occurring; m1: silkworm from 12 h after HCS; m2: silkworm from 
24 h after HCS; qc: newly molted fifth instar larvae; bReference gel: mq; c MW: Molecular weight; pI: Isoelectric 
point;  dSC: Sequence coverage; eThe identified protein by MALDI-TOF MS. 
 
 
 

 
 
Fig. S1 The mass spectrogram of vacuolar ATP synthase subunit b and the amino acid assignment of the protein 
from the samples. 

401 



399 

 
 
Fig. S2 The mass spectrogram of juvenile hormone binding protein brP-2095 precursor and the amino acid 
assignment of the protein from the samples. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

402 



399 

 
 
Fig. S3 The mass spectrogram of adenylate kinase isoenzyme 1 and the amino acid assignment of the protein 
from the samples. 
 

403