115 

ISJ 19: 115-125, 2022                                              ISSN 1824-307X 

 
 

RESEARCH REPORT 

 
Molecular characterization and expression ananlysis of a QM protein gene from 
Chinese shrimp Fenneropenaeus chinensis 
 
L Zhang1, Y Wang1,3, J-J Hu1,2,3, J-B Li1, Y-J Xu1, Q-Q Zhou1, M-Q Wang1,2,3 * 
 

1MOE Key Laboratory of Marine Genetics and Breeding (Qingdao 266003), and Key Laboratory of Tropical 
Aquatic Germplasm of Hainan Province of Sanya Oceanographic Institute (Sanya 572024), Ocean University of 
China, China 
2Laboratory for Marine Fisheries Science and Food Production Processes, and Center for Marine Molecular 
Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China 
3Hainan Yazhou Bay Seed Laboratory, Sanya 572024, China 
 
 
This is an open access article published under the CC BY license                                     Accepted June 15, 2022 

 
Abstract 

Based on lots of results, the QM protein was proposed to be a tumor suppressor, and facilitate in 
the innate immune responses, especially the prophenoloxidase (proPO) activation system. In the 
present study, a cDNA of 761 bp for the QM of Chinese shrimp, Fenneropenaeus chinensis 
(designated as FcQM) was cloned via rapid amplification of cDNA ends (RACE) technique. The 
complete cDNA sequence of FcQM contained an open reading frame (ORF) of 663 bp, 5' untranslated 
regions (UTR) of 42 bp and 3' UTR of 56 bp, which encoded a polypeptide of 155 amino acid residues. 
The analysis of the peptide sequence of FcQM revealed that FcQM sequence contained a 
Ribosomal_L16 domain, an SH3-binding motif, an N-acylation site, two putative antibiotic binding 
sites, two putative protein kinase C phosphorylation sites and two acylamidation sites, which shared 
over 80 % similarity with previously identified QM protein genes. Quantitative real-time PCR 
(qRT-PCR) results showed that the transcript of FcQM was extensively distributed in all the tested 
tissues and most highly expressed in hemocytes and hepatopancreas. After challenged with Vibrio 
anguillarum or white spot syndrome virus (WSSV), the FcQM transcripts were significantly increased 
(p < 0.05) both in hepatopancreas and hemocytes. Hence, the analysis of sequence and transcription 
suggested that FcQM might play crucial roles responses to bacterial and viral invasion in innate 
immunity of arthropods. This study is the first report of the QM protein gene from F. chinensis, which 
would enrich the understanding of the innate immune defense mechanism in shrimp. 
 
Key Words: Fenneropenaeus chinensis; innate immunity; QM protein gene 
 

 
Introduction 

 
Chinese shrimp, Fenneropenaeus chinensis, is 

one of the most important mariculture species in 
China. It is mainly distributed along the coast of 
Yellow Sea and Bohai Sea and the west coast of 
Korean Peninsula (Meng et al., 2021). In recent 
years, outbreaks of diseases caused by bacteria, 
such as Vibrio parahaemolyticus, and viruses, such 
as white spot syndrome virus (WSSV) have 
resulted in mass shrimp mortality, seriously 
inhibiting the production and economic income of 
________________________________________ 

 

Corresponding author: 
Meng-Qiang Wang 
MOE Key Laboratory of Marine Genetics and Breeding 
(Qingdao), and Key Laboratory of Tropical Aquatic 
Germplasm of Hainan Province of Sanya Oceanographic 
Institute (Sanya) 
Ocean University of China 
E-mail: wangmengqiang@ouc.edu.cn 

 
 
the shrimp industry nationwide (Liu et al., 2005; 
Wang et al., 2013). The invasion of pathogens 
drives the fluctuations of physiological and 
behavioral status of shrimp, which could be harmful 
to the survival of shrimps (Alfaro et al., 2021; He et 
al., 2022). Due to the lack of adaptive immune 
system, shrimps only rely on innate immune 
system to protect the organism from pathogens 
(Destoumieux-Garzon et al., 2001). Therefore, it is 
particularly important to better understand the 
innate immune defenses mechanism to promote 
the development of disease treatment, and then to 
find more effective ways to solve the problems. 

The QM protein gene was originally identified 
from human in the non-tumorigenic Wlims’ cell line 
G401 using subtractive hybridization method 
(Dowdy et al., 1991). Initially, it was found that the 
QM protein gene was expressed at a higher level in 
non-tumorigenic Wlims’ cells than in the 



 

116 

tumorigenic parental cells, speculating that the QM 
protein gene might be a tumor suppressor gene 
(Chen et al., 2012). In addition, The QM protein 
gene encodes the ribosomal protein L10, which is 
required for the formation of the 80S ribosome 
(Loftus et al., 1997). Because of its presumed 
functions, the QM protein gene has been the 
subject of intensive study. Homologues of QM have 
been identified in various species, include 
vertebrates and invertebrates and have been 
shown to play important immune roles in cell 
growth, tissue differentiation and apoptosis (Green 
et al., 2000). The mouse QM protein gene is 
differentially expressed throughout the embryo, and 
the expression pattern of QM suggests that QM 
might be involved in the posttranslational protein 
processing, playing an important role in the 
differentiation of specific tissues during 
embryogenesis (Mills et al., 1999). The homolog of 
QM in chicken (JIF-1), a negative transcription 
regulator of c-Jun, could bind to the protooncogene 
c-Jun and suppressed AP-1 function, suggesting 
that QM protein gene may be involved in 
transcriptional regulation (Imafuku et al., 1999). 
And in Bombyx mori, QM protein gene interacted 
with Jun protein and negatively regulated the 
expression of AP-1, which could affect some 
immune genes expression (Zhou et al., 2019). 
Accumulating evidence has demonstrated that QM 
protein are involved in regulating the immune 
response of organisms. In grass carp, QM protein 
was significantly up-regulated by Aeromonas 
hydrophila and grass carp hemorrhagic virus 
(GCHV) infection, suggesting that QM protein gene 
is associated with anti-pathogens inflammatory 
response (Wen et al., 2005). Following bacterial 
stimulation, QM protein gene transcription was 
significantly increased in the hepatopancreas of 

clams, demonstrating that QM transcriptional 
expression can be induced by pathogens challenge 
and play an active role in immune responses (Cui 
et al., 2019). As one of the major invertebrate 
immune responses, prophenoloxidase activation 
system (proPO-AS) plays an important role in 
innate immunity (Soderhall et al., 1994). Through 
pathogens-associated molecular patterns (PAMPs) 
such as lipopolysaccharide (LPS), peptidoglycan 
(PG) or β-1,3-glucan (BG), bind to specific shrimp 
humoral pattern recognition proteins (PRPs) and 
activate the proPO system (Sritunyalucksana et al., 
1999; Sritunyalucksana et al., 2000; Cerenius et al., 
2004). The QM protein in large yellow croaker 
could regulate the activity of phenol oxidase (PO) 
(Han et al., 2015). The QM protein in Penaeus 
japonicus can interact with hemocyanin and myosin, 
thereby regulating the activity of PO in the innate 
immunogen activation system of arthropods (Xu et 
al., 2008). In shrimps, QM protein can significantly 
improve bacterial clearance and positively regulate 
PO activity (Liu et al., 2014). More interestingly, 
researchers reported for the first time that the QM 
protein was present in crustaceans as a potential 
peptidoglycan recognition protein (PGRP) in 
Penaeus monodon and activated the proPO 
response (Udompetcharaporn et al., 2014). 
Therefore, QM protein may play an important role 
in the innate immune response of shrimp. 

In this study, we cloned the full-length cDNA of 
the FcQM gene and analyzed the sequence 
features and molecular characteristics of the FcQM 
protein. Subsequently, the prawns were challenged 
with V. anguillarum and white spot syndrome virus 
(WSSV) to explore the tissue-specific expression of 
the FcQM gene. Finally, we analyze the immune 
response of QM protein gene to pathogens 
challenges. 

 
 
 
 
Table 1 Oligonucleotide primers used in the present study 
 

Primer Sequence (5’-3’) Tm (°C) Brief information 

adaptor primer GGCCACGCGTCGACTAGTAC 60 Anchor primer for 3’ and 5’ RACE 

adaptor primer-oligo (dT) GGCCACGCGTCGACTAGTACT17VN - Oligo (dT) for cDNA synthetize 

adaptor primer-oligo (dG) GGCCACGCGTCGACTAGTACG10HN - Oligo (dT) for cDNA synthetize 

Fc-18S-qRT-F TATACGCTAGTGGAGCTGGAA 58 Internal control for real-time PCR 

Fc-18S-qRT-R GGGGAGGTAGTGACGAAAAAT 57 Internal control for real-time PCR 

FcQM-CDS-F ATGGGGCGCCGTCCGGCCCGATGC 77 Gene specific primer for CDS 

FcQM-CDS-R TTAAGCAAGACCAGCAAGTTCCAACTG 64 Gene specific primer for CDS 

FcQM-qRT-F GGCTTCACCAAGTTCGACC 58 Gene specific primer for real-time PCR 

FcQM-qRT-R TTAAGCAAGACCAGCAAGTTCC 59 Gene specific primer for real-time PCR 

FcQM-RACE-F1 TCATTGAGGCTCTCCGACGTGCCA 68 Gene specific primer for 3’ RACE 

FcQM-RACE-F2 TGGTCGCCTTAGGCCTGATGGTGT 67 Gene specific primer for 3’ RACE 

FcQM-RACE-R1 CCTAAGTCATAGATACGAATCTTG 54 Gene specific primer for 5’ RACE 

FcQM-RACE-R2 TTACAGTAACGGTAGCATCGGGCCGGA 69 Gene specific primer for 5’ RACE 

M13-47 CGCCAGGGTTTTCCCAGTCACGAC 56 Vector primer for sequencing 

RV-M GAGCGGATAACAATTTCACACAGG 56 Vector primer for sequencing 

 



 

117 

Materials and methods 
 
Experimental shrimps, immune challenge and 
sample collection 

In the present study, the shrimps weighing 8 - 
12 g were obtained from a local shrimp farm in 
Qingdao, China, and cultured in the laboratory for 
two weeks before processing. In this phase, 
Shrimps were cultured in 640 L cylindrical tanks 
with 500 L air-pumped circulating seawater at 20 ± 
1 °C. To study the tissues-specific expression of 
FcQM, the hemolymph and tissues, including 
eyestalk, gill, gonad, heart, hepatopancreas, 
intestine (mid gut), muscle, nerve and stomach 
were collected from at least fifteen untreated 
shrimps. To determine the immune response of 
FcQM, approximately 360 shrimps were employed 
for microbe stimulation assay. To determine the 
immune response of FcQM, approximately 360 
shrimps were employed for microbe stimulation 
assay. The shrimps were randomly divided into 
three groups. The shrimps of control groups were 
received challenges at the abdominal segment with 
100 μl phosphate buffered saline (PBS, pH 7.4, 
10010023, Thermo Fisher Scientific, USA). The 
shrimps of two treatment groups V. anguillarum 
suspension (1 × 104 CFUs μl-1, in PBS) and WSSV 
stock (1 × 104 copies μl-1, in PBS), respectively. 
The V. anguillarum suspension and WSSV stock 
were prepared according to previous reports (Yi et 
al., 2014; Xia et al., 2015; Sha et al., 2016). 
Hepatopancreas and hemolymph samples were 
removed from shrimps of the bacteria-injected, 
WSSV-injected and the control groups at 0, 3, 6, 12, 
24, 36 and 48 hpi. The shrimp hemolymph was 
collected from the ventral sinus into a sterilized 
syringe with an equal volume of modified 
anticoagulant Alsever solution (trisodium citrate 30 
mM, NaCl 510 mM, citric acid 200 mM, glucose 115 
mM, and EDTA 10 mM, pH 7.4), and centrifuged at 
800 × g for 10 min at 4 °C. All of the tissue samples 
were kept in RNAlater (AM7020, Thermo Fisher 
Scientific, USA), which snap-frozen in liquid 
nitrogen and used for RNA isolation. 
 
Total RNA isolation and cDNA synthesis 

The total RNA was extracted from hemolymph 
and tissues, including eyestalk, gill, gonad, heart, 
hepatopancreas, intestine (mid gut), muscle, nerve 
and stomach, using the TRIzol Reagent (Takara, 
Dalian, China) following the manufacturer’s 
protocol. The RNA concentration was determined 
by measured UV absorbance at 260 nm with a 
Nanodrop Lite. Its completeness was examined by 
electrophoresis on a 1.5 % agarose gel. According 
to the manufacturer’s instructions, the synthesis of 
first-strand cDNA was carried out with Promega 
M-MLV (M1701, Promega, USA). Briefly, a mixture 
containing 1 µg of total RNA, 2 µL of adaptor 
primer-oligo (dT) or random primers and 5 µL of 
RNase Free ddH2O was incubated at 70 °C for 5 
min. Then, 4 µL of 5 × M-MLV buffer, 2 µL of DTT 
(100mM), 1 µL of dNTP (10mM), 1 µL of 
ribonuclease inhibitor, 1 µL of M-MLV and RNase 
Free ddH2O were added (total 20 µL). The mixture 
was incubated at 42 °C for 1 h and terminated at 

95 °C for 5 min before cooling on ice. Then, the 
synthesized cDNA was stored at 80 °C for further 
use. 
 
Molecular cloning of FcQM cDNA sequence 

The partial length sequence of FcQM cDNA 
was obtained from the shrimp transcriptome 
sequencing database (Genbank accession number: 
BM302396) (Zhang et al., 2010). Two pairs of 
sequence-specific primers, FcQM-RACE-F1/F2 
and FcQM-RACE-R1/R2 (Table 1), were designed 
using Primer Premier 5.0. The sequence-specific 
primers and adaptor primers were used to clone 
the full-length cDNA of FcQM by 5’ and 3’ RACE 
techniques. Specific primers FcQM-RACE-F1, 
FcQM-RACE-F2 and adaptor primer-oligo(dT) 
were employed to obtain 3’ ends sequence of 
FcQM using a semi-nested PCR. Then, specific 
primers FcQM-RACE-R1, FcQM-RACE-R2 and 
adaptor primer-oligo(dG) were employed to obtain 
5’ ends sequence of FcQM using a semi-nested 
PCR. And the coding sequence (CDS) of FcQM 
was amplified and confirmed using another two 
gene-specific primers, FcQM-CDS-F/R (Table 1). 
Amplification was performed in 25 µL reaction 
volume, containing 2.5 µL of 10 × PCR buffer, 1.5 
µL of MgCl2 (25 mM), 2.0 µL of dNTP (2.5 mM), 1.0 
µL of each primer (10 mM), 1.0 µL of template, 0.2 
µL of Ex Taq (TaKaRa, Japan) and 15.8 µL of 
RNase Free ddH2O. The protocol of PCR was one 
initial denaturation cycle 94 °C for 5 min, followed 
by 35 cycles of 94 °C for 10 s, 55 °C for 30 s and 
72 °C for 30 s, 5 min at 72 °C for the final extension. 
All PCR amplification were performed in a VeritiPro 
Thermal Cycler (ThermoFisher, USA). The PCR 
products were gel-purified and then cloned into the 
pMD-18T Simple (Takara, Japan). After being 
transformed into the competent cells Escherichia 
coli strain DH5α (Tiangen, China). The positive 
recombinants were identified through anti-ampicillin 
selection and verified by PCR screening using 
vector primers, M13-47 and RV-M (Table 1). The 
positive recombinants ware carried out using an 
ABI 3730 sequencer (ThermoFisher, USA). 
 
Bioinformatics analysis of FcQM cDNA and protein 
sequences 

The FcQM nucleotide sequence was 
translated into the amino acid sequence using the 
DANMAN 8.08 software package. The FcQM 
amino acid sequence was used for protein 
functional domains prediction and analysis using 
the Simple Modular Architecture Research Tool 
(SMART, smart.embl-heidelberg.de). And the 
calculated molecular mass and theoretical 
isoelectric point (pI) were predicted using the 
ExPASy Molecular Biology Server 
(web.expasy.org/compute_pi). Similar QM 
sequences of other species were searched in NCBI 
gene database using the BLAST program. And 
multiple alignments were performed using 
ClustalW2. Finally, an unrooted phylogenetic tree 
was constructed using amino acid 
neighbor-joining (NJ) method with MEGA 10.0 
software and tested for reliability with 1000 
bootstrap replications. 



 

118 

 
 
Fig. 1 Nucleotide and deduced amino acid sequences of FcQM (GenBank Accession KU361824). The start 
codon (ATG), the stop codon (TAA), and the polyadenylation signal sequence (ATTAAA) are in bold and 
underlined. The predicted SH3-binding motif (RPARCY) are in bold italics, two acylamidation sites (MGRR) and 
(LGRK) are underlined with dotted lines, two putative antibiotic binding sites (GRI) and (NK) are shaded with a 
line, an N-acylation site (GMRGAF) are double-underlined and two protein kinase C phosphorylation sites (SVR) 
and (SRK) are boxed. In addition, a ribosomal protein L10 signature is in shaded 
 
 
 
 
Quantitative Real-time PCR analysis of FcQM 
mRNA expression 

The transcripts of FcQM in various tissues 
from healthy F. chinensis and its temporal 
expression in hemocytes and hepatopancreas after 
V. anguillarum or WSSV challenges were detected 
by qRT-PCR. Two FcQM gene-specific primers, 
FcQM-qRT-F and FcQM-qRT-R (Table 1), were 
designed using Primer Premier 5.0 to detect the 
temporal expression of the FcQM gene. 18S rDNA 
was chosen as reference gene for internal 
standardization. Two primers, Fc-18S-qRT-F and 
Fc-18S-qRT-R (Table 1) were used to amplify the 
fragments of 18S rDNA. qRT-PCR was carried out 
in a 20 µL reaction volume containing 10 µL of 2 × 
ChamQ SYBR qPCR Master Mix (Q311-02, 
Vazyme, China), 0.4 µL of each primer (10 mM), 2 
µL of the 1:10 diluted cDNA and 7.2 µL of RNase 
Free ddH2O. The protocol of qRT-PCR was one 
initial denaturation cycle 95 °C for 30 s, followed by 
39 cycles of 95 °C for 10 s and 60 °C for 30 s. After 
each run, a dissociation step (95 °C for 15 s, 60 °C 
for 60 s, 95 °C for 15 s) was performed to generate 
a melting curve thermal profile to verify a single 

product. All qRT-PCR amplification were performed 
in an ABI 7300 (ThermoFisher, USA). The mRNA 
relative expression level of FcQM and 18s rDNA 
were analyzed by comparative CT method (2-ΔΔCt 

method) (Schmittgen et al., 2008; Wang et al., 
2011). All data were given in terms of the mRNA 
relative expression of FcQM as the mean ± 
standard deviation and subjected to one-way 
ANOVA followed by Duncan's multiple range test 
by using IBM SPSS Statistics 23.0.0.0. The P 
values less than 0.05 were considered statistically 
significant. 
 
Results 
 
Cloning and characterization of FcQM cDNA 

To further characterize the functions of QM 
protein gene in shrimp immune response against 
pathogens infections, QM protein gene was cloned 
from F. chinensis. The full-length cDNA (Genbank 
accession number: KU361824) of FcQM was 
obtained by 5' and 3’ RACE techniques. As is 
shown in Fig. 1, it comprised 761bp, containing an 
open reading frame (ORF) of 663 bp, 5' 



 

119 

untranslated regions (UTR) of 42 bp and 3' UTR of 
56 bp. The ORF encoded a 155 amino acid 
polypeptide with a calculated molecular mass of 
approximately 25.53 kDa and a theoretical 
isoelectric point (pI) of 10.08. SMART indicated that 
FcQM contains a Ribosomal_L16 domain (from 
C12 to F166), an SH3-binding motif (RPAFCY), an 
N-acylation site (GMRGAF), two putative antibiotic 
binding sites (GRI; NK), two putative protein kinase 
C phosphorylation sites (SVR; SRK), two 
acylamidation sites (MGRR; LGRK). In addition, it 
contains a ribosomal L10 signature motif. A 
polyadenylation signal (AATAAA) was found 
upstream of PolyA. 
 
Homology and phylogenetic analysis of FcQM 

Homology and similarity analysis of the 
deduced amino acid of FcQM was performed by 
GeneDoc and DNAMAN software to determine the 
evolutionary conservation of characteristic motifs 
and active sites of QM proteins. The amino acid 
sequence homology of the QM protein of F. 
chinensis and P. vannamei was the highest, and 
the amino acid sequence homology of the QM 
protein of Homo sapiens was the lowest. In addition, 
the amino acid sequence of FcQM was similar to 
that of Homo sapiens (75 %), Penaeus japonicus 

(92 %), Eriocheir sinensis (92 %), Danio rerio 
(77 %), Pinctada fucata (78 %), Drosophila 
melanogaster (79 %), Bombix mori (80 %), and 
Pediculus humanus corporis (81 %) had higher 
homology in Fig. 2. The alignment results show that 
the N-terminal and internal region of the peptides are 
conserved. In addition, the study also found that 
SH3-binding motif (RPARCY), ribosomal protein L10 
signature (ADRLQTGMRGAWGKQGTVARV) and 
protein kinase C phosphorylation site (RPARCY) 
were highly conserved during the evolution of QM 
protein. 

In order to study the molecular evolution of 
FcQM genes, a neighbor-joining (NJ) phylogenetic 
tree based on the amino acid sequences of 16 
different species was constructed to analyze the 
phylogenetic relationship of FcQM. As is shown in 
Fig. 3, it was clearly to find that the QM group can 
be divided into mammalians (O. aries, B. taurus, H. 
sapiens, M. musculus), amphibians (X. tropicalis), 
fish (D. rerio, L.crocea, O. niloticus) , mollusks (H. 
diversicolor supertexta, H. discus discus, P. fucata, 
A. farreri, M. meretrix), arthropods (P. vannamei, F. 
chinensis, P. japonicus, P. clarkii, D. melanogaster, 
P. monodon, B. mandarina) four groups. Further 
analysis showed that FcQM is the closest relative 
to LvQM and is located in the crustacean subclade. 

 
 
 
 
 

 
 

Fig. 2 Multiple alignments of FcQM with previous known QM. The sequences and their accession numbers are 
as follows: Homo sapiens, AAB27665.1; Fenneropenaeus chinensis, KU361824; Penaeus vannamei, 
AGA16579.1; Penaeus japonicus, ABS45569.1; Eriocheir sinensis, ATO74510.1; Danio rerio, AAV34163.1; 
Pinctada fucata, AAN85578.1; Drosophila melanogaster, AAC16108.1; Bombyx mori, AAK73358.1 
 
 



 

120 

 
 
Fig. 3 Consensus neighbor-joining phylogenetic based on the protein sequences of FcQM from different 
organisms. The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus 
tree inferred from 1,000 replicates was taken to represent the evolutionary history of the taxa analyzed. All 
positions containing gaps and missing data were eliminated. The numbers at the forks indicated the bootstrap 
value. The sequences and their accession numbers are as follows: Penaeus vannamei, AGA16579.1; 
Fenneropenaeus chinensis, KU361824; Penaeus japonicus, ABS45569.1; Procambarus clarkii, AEB54638.1; 
Drosophila melanogaster, AAC16108.1; Haliotis diversicolor supertexta, ACJ71721.1; Haliotis discus discus, 
ABO26700.1; Pinctada fucata, AAN85578.1; Azumapecten farreri, AKM12718.1; Danio rerio, AAV34163.1; 
Larimichthys crocea, ACS93602.1; Xenopus tropicalis, NP_001004965.1; Ovis aries, ABV64839.1; Bos taurus, 
NP_777185.1; Homo sapiens, AAB27665.1; Mus musculus, CAA53061.1; Meretrix meretrix, ANG56314.1; 
Oreochromis niloticus, XP_003454286.1; Bombyx mandarina, AAC98301.1; Penaeus monodon, ACV72062.1 
 
 
 
 
Tissue-specific expression of FcQM 

The relative expression level of FcQM in 
various tissues including eyestalk, gill, gonad, heart, 
hemocytes, hepatopancreas, intestine, muscle, 
nerve and stomach was detected by qRT-PCR with 
18S rDNA as the internal control in fifteen 
untreated shrimps. As shown in Fig. 4, FcQM 
genes were all expressed in the tested tissues, with 
the highest expression in hepatopancreas, higher 
expression in hemocytes, and less expressed gills, 
eye stalk, gonad, heart, intestine, muscle, nerve, 
stomach expression. 

The mRNA expression profiles of FcQM post 
bacterial stimulation 

In order to understand the changes in the 
transcriptional response of FcQM gene after 
stimulation by V. anguillarum, qRT-PCR was used 
to detect the mRNA relative expressions of FcQM 
in hemocytes and hepatopancreas at various time 
points (0, 3, 6, 12, 24, 36, 48 hpi). As shown in Fig. 
5, the relative expression level of FcQM in both 
tissues was up-regulated under the V. anguillarum 
stimulation, while the expression level of FcQM in 
the control group had no significant change. Fig. 5A 



 

121 

 
 
Fig. 4 Tissue distribution of FcQM mRNA transcripts detected by qRT-PCR technique. The 18s rDNA gene was 
used as an internal control to calibrate the cDNA template for each sample. Vertical bars represent mean ± SD 
(n = 3), and bars with different characters were significantly different (p < 0.05), while bars with same characters 
were not significantly different 
 
 
 
 
 
shows that the relative expression of FcQM gene in 
hemocytes after V. anguillarum stimulation was 
significantly increased at 3 hpi and 6 hpi (p < 0.05) 
with the peak value of 6.41-fold higher than that in 
the control group at 3 hpi. The expression level of 
FcQM gene in the treatment group were not 
significantly different from that in the control group 
from 12 hpi to 48 hpi. Fig. 5 B shows that the 
relative expression of FcQM gene in the 
hepatopancreas after immune stimulation. The 
expression level of FcQM were significantly 
increased at 12 hpi and 24 hpi after V. anguillarum 
challenges (p < 0.05) and reached a peak value at 
24 hpi with the peak value of 7.87-fold higher than 
that in the control group, and recovered to 36 hpi at 
36 hpi. normal level. The expression level of FcQM 
gene did not exhibit any significant changes in 
control group. 
 
The mRNA expression profiles of and FcQM post 
WSSV stimulation 

Under WSSV stimulation, the expression of 
FcQM in hemocytes and hepatopancreas was 
up-regulated. As shown in Fig. 6 A, the relative 
expression of FcQM in hemocytes after WSSV 

challenges was significantly up-regulated at 3 hpi 
and 6 hpi (p < 0.05) with the peak value of 6.58-fold 
higher than that in the control group at 6 hpi. After 6 
hpi, the expression level of FcQM was the same as 
that of the control group. There was no significant 
difference, and gradually returned to normal level. 
Fig. 6 B shows that under WSSV stimulation, 
FcQM also showed a higher expression level. The 
highest expression level (2.9-fold) of FcQM 
transcripts was detected at 12 hpi after the 
challenge with WSSV (p < 0.05). In addition, the 
expression level of FcQM gene was fluctuated at 
48 hpi, representing 2.49-fold higher level than that 
in the control group. 

 
Discussion 

 
Since the first QM protein gene was identified 

from humans, the QM protein gene has been 
identified in a large range of organisms. Recent 
research achievements indicated QM protein may 
play an important role in the innate immune 
defenses mechanism of shrimp (Wen et al., 2005). 
In the present study, we first reported the 
identification and molecular characterization of 



 

122 

 
 
Fig. 5 Temporal mRNA expression profiles of FcQM detected via qRT-PCR technique in shrimp hemocytes and 
hepatopancreas at 0, 3, 6, 12, 24, 36 and 48 hpi stimulation. A: Temporal mRNA expression profiles of FcQM 
post V. anguillarum stimulation in shrimp hemocytes; B: Temporal mRNA expression profiles of FcQM post V. 
anguillarum stimulation in shrimp hepatopancreas; The 18s rDNA gene was used as an internal control to 
calibrate the cDNA template for each sample. Vertical bars represent mean ± SD (n = 3), and bars with different 
characters were significantly different (p < 0.05), while bars with same characters were not significantly different 
 
 
 
 
 
FcQM cDNA sequence from the Chinese shrimp, F. 
chinensis. The full-length cDNA of FcQM was 
761bp, including a 663 bp ORF encoding a 155 
amino acids polypeptide with a calculated 
molecular mass of approximately 25.53 kDa and a 
pI of 10.08. The protein sequence of FcQM shared 
over 80 % similarities with other identified QMs. 
The deduced amino acid sequence of FcQM was 
conformity to the conserved domains of those 
identified QMs of marine invertebrates, which 
included an SH3-binding motif, an N-acylation site, 
antibiotic binding sites, protein kinase C 
phosphorylation sites, acylamidation sites and a 
ribosomal L10 signature motif, indicating that 
FcQM was an orthologue of QM family (Liu et al., 
2014; Han et al., 2015; Cui et al., 2019). The highly 
conserved signature sequences might suggest the 
important role of QM in the basic functions. 
Phylogenetic analysis showed that no signal 
peptide identified from the deduced amino acid 
sequence of FcQM, pointed out that FcQM may not 
be a secretory protein. A study confirmed that QM 
localized to the cytoplasmic face of the rough ER 
on mammalian cells and yeast (Loftus et al., 1997). 
In the NJ phylogenetic tree, FcQM is the closest 
relative to LvQM and is located in the crustacean 
subclade, which could have similar functions to 
those from other invertebrates. The sequence 
characteristics and the phylogenetic relationship of 
FcQM indicate that the FcQM gene could have 
similar functions to those from other invertebrates. 

Previous research showed that QM was 
ubiquitously expressed in various tissues. 
Interestingly, it was also reported that the QM 
protein gene participated in the innate immune 
response. In order to better understand the 
potential biological role of QM in shrimp, the tissue 
distribution of FcQM mRNA transcripts was 

detected by qRT-PCR technique. The FcQM 
mRNA transcripts were observed to be ubiquitously 
expressed in all the examined tissues, including 
eyestalk, gill, gonad, heart, hemocytes, 
hepatopancreas, intestine, muscle, nerve and 
stomach, which were consisted with the previously 
observation in other invertebrates (Xu et al., 2008; 
Li et al., 2016; Cui et al., 2019). The ubiquity of 
FcQM mRNA transcripts indicated that it could be 
involved in many physiological responses of 
shrimps. The highest expression level of FcQM 
mRNA was found in hepatopancreas and 
hemocytes, followed by gill. Similarly, in M. meretrix, 
MmQM was highest expressed in hepatopancreas 
and hemocytes, followed by gill (Cui et al., 2019). 
The hepatopancreas was considered as the main 
immunity and detoxification organ (Song et al., 
2015). Hemocytes as the major immune cells 
respond to pathogens mainly through phagocytosis 
(Jiravanichpaisal et al., 2006). Gill is part of the 
mucosal system, functioning as the first defense 
line against pathogens in lower animals (Wang et 
al., 2019). Therefore, the high expression level of 
FcQM in these tissues further confirmed that FcQM 
could participate in the innate immune system of 
shrimp.  

Accumulating evidence has shown that QM 
protein genes have important immune functions in 
organisms. Previous research have shown that 
LvQM mRNA transcripts in hemocytes and 
hepatopancreas increased significantly in the early 
stage of the experiment after V. anguillarum 
stimulation, and RNAi and bacterial clearance 
experiments showed that QM protein regulated the 
activity of PO (Liu et al., 2014). To further 
investigate the role of FcQM in immune responses, 
the present research detected the temporal 
expression profiles of QM in response to a bacterial 



 

123 

 
 
Fig. 6 Temporal mRNA expression profiles of FcQM detected via qRT-PCR technique in shrimp hemocytes and 
hepatopancreas at 0, 3, 6, 12, 24, 36 and 48 hpi stimulation. A: Temporal mRNA expression profiles of FcQM 
post WSSV stimulation in shrimp hemocytes; B: Temporal mRNA expression profiles of FcQM post WSSV 
stimulation in shrimp hepatopancreas; The 18s rDNA gene was used as an internal control to calibrate the cDNA 
template for each sample. Vertical bars represent mean ± SD (n = 3), and bars with different characters were 
significantly different (p < 0.05), while bars with same characters were not significantly different 
 
 
 
 
 
 
and WSSV challenge. The expression level of 
FcQM gene after V. anguillarum and WSSV 
stimulation was significantly increased at 3 hpi and 
6 hpi in hemocytes and increased at 12 hpi and 24 
hpi in hepatopancreas, which suggest the 
important immune regulation effect of FcQM in F. 
chinensis. The expression of FcQM in hemocytes is 
earlier than that in hepatopancreas. Gill is the first 
defense line against pathogens in shrimps. 
However, once this barrier is passed, a series of 
complex innate humoral and cellular immune 
reactions is induced in both haemocoel and tissues, 
resulting in a fast elimination of pathogens 
(Cerenius et al., 2010). This also reasonably 
explains that the differential expression level of 
FcQM in hemocytes is earlier than that in 
hepatopancreas in this study. In hemocytes, the 
induction expression level of FcQM mRNA 
transcripts reached a peak value at 3 hpi with 
6.41-fold after V. anguillarum stimulation and at 6 
hpi with 6.58-fold after WSSV stimulation. In 
hepatopancreas, the induction expression level of 
FcQM mRNA transcripts reached a peak value at 
24 hpi with 6.41-fold and 6.58-fold after V. 
anguillarum or WSSV stimulation. Researchers 
have reported that the results of qRT-PCR and 
Western blot indicated that the PjQM gene was 
significantly upregulated in WSSV-resistant 
Penaeus Japonicus (Xu et al., 2008). In the 
Chlamys farreri, the relative expression of CfQM 
sharply increased at 6 hpi and normalized at 48 hpi 
under V. anguillarum and acute viral necrobiotic 
virus stimulation, which suggested that CfQM can 
protect organisms against pathogens challenges 
(Chen et al., 2015). Bacterial challenge tests 
indicated that HdiQM gene expression was induced 

by the bacterial isolates from Haliotis diversicolor, 
which implied that HdiQM might be an inflammatory 
stress-inducible gene associated with pathogen 
infection (Li et al., 2016). The above results further 
verify that QM may play an essential role in the 
response to pathogens. Therefore, QM protein 
gene have important immune functions in shrimps 
and other invertebrates, especially in process of 
innate immune defense. Specially, the 
upregulation of the expression level of FcQM at 48 
h after WSSV stimulation, which is different from 
the other results, suggests that FcQM might be 
involved in multiple innate immune response 
processes in shrimp. 

In summary, we have successfully cloned the 
cDNA sequence of FcQM from the Chinese shrimp, 
F. chinensis. Tissue expression analysis indicated 
that FcQM was detected in all examined tissues, 
and higher expressed in hemocytes, 
hepatopancreas and gills. The FcQM was 
significantly increased both in hemocytes and 
hepatopancreas after V. anguillarum and WSSV 
stimulation. These results of sequence and 
transcription analysis suggested that FcQM may 
play crucial roles in innate immune responses to 
bacterial and viral stimulation. 
 
Acknowledgments 

This research was supported by the Project of 
Sanya Yazhou Bay Science and Technology City 
Management Foundation (SKJC-KJ-2019KY01), 
and the Startup Fund of Young Talents Project of 
Ocean University of China.  We would like to 
thank the expert reviewers for constructive 
suggestions and enlightening comments during the 
revision. 



 

124 

References 
Alfaro A, Nguyen T, Bayot B, Rodriguez Leon J, 

Dominguez-Borbor C, Sonnenholzner S. 
Metabolic responses of whiteleg shrimp to 
white spot syndrome virus (WSSV). J. 
Invertebr. Pathol. 180: 107545, 2021. 

Cerenius L, Jiravanichpaisal P, Liu H, Soderhall I. 
Crustacean immunity. Invertebr. Immun. 708: 
239-259, 2010. 

Cerenius L, Soderhall K. The 
prophenoloxidase-activating system in 
invertebrates. Immunol. Rev. 198: 116-126, 
2004. 

Chen G, Zhang C, Wang Y, Wang Y, Guo C, Wang 
C. Molecular characterization and immune 
response expression of the QM gene from the 
scallop Chlamys farreri. Fish Shellfish Immunol. 
45: 543-550, 2015. 

Chen X, Su Y, Wang J, Liu M, Niu S, Zhong S, et al. 
Isolation and identification of the 
immune-relevant ribosomal protein L10 
(RPL10/QM-like gene) from the large yellow 
croaker Pseudosciaena crocea (Pisces: 
Sciaenidae). Genet. Mol. Res. 11: 3755-3765, 
2012. 

Cui X, Cheng J, Wang Y, Zhou B. Sequence 
feature and expression profile of a tumor 
suppressor QM protein gene from hard clam 
Meretrix meretrix. Invertebr. Surviv. J. 16: 
164-172, 2019. 

Destoumieux-Garzon D, Saulnier D, Garnier J, 
Jouffrey C, Bulet P, Bachere E. Crustacean 
immunity - Antifungal peptides are generated 
from the C terminus of shrimp hemocyanin in 
response to microbial challenge. J. Biol. Chem. 
276: 47070-47077, 2001. 

Dowdy S, Lai K, Weissman B, Matsui Y, Hogan B, 
Stanbridge E. The isolation and 
characterization of a novel cDNA 
demonstrating an altered mRNA level in 
nontumorigenic Wilms' microcell hybrid cells. 
Nucleic Acids Res. 19: 5763-5769, 1991. 

Green H, Canfield AE, Hillarby MC, Grant ME, 
Boot-Handford RP, Freemont AJ, et al. The 
ribosomal protein QM is expressed 
differentially during vertebrate endochondral 
bone development. J. Bone Miner. Res. 15: 
1066-1075, 2000. 

Han F, Xiao S, Zhang Y, Wang Z. Molecular 
cloning and functional characterization of a QM 
protein in large yellow croaker (Larimichthys 
crocea). Fish Shellfish Immunol. 44: 187-194, 
2015. 

He Y, Wang Q, Li J, Li Z. Comparative proteomic 
profiling in Chinese shrimp Fenneropenaeus 
chinensis under low pH stress. Fish Shellfish 
Immunol. 120: 526-535, 2022. 

Imafuku I, Masaki T, Waragai M, Takeuchi S, 
Kawabata M, Hirai SI, et al. Presenilin 1 
suppresses the function of c-jun homodimers 
via interaction with QM/Jif-1. J. Cell Biol. 147: 
121-133, 1999. 

Jiravanichpaisal P, Lee BL, Soderhall K. 
Cell-mediated immunity in arthropods: 
Hematopoiesis, coagulation, melanization and 
opsonization. Immunobiology. 211: 213-236, 
2006. 

Li W, Li X, Shen M, Lu W, Wang R, Huang M, et al. 
Molecular cloning, expression and functional 
analysis of a predicted HdiQM gene in small 
abalone, Haliotis diversicolor. Aquac. Res. 47: 
3169-3179, 2016. 

Liu F, Liu Y, Li F, Dong B, Xiang J. Molecular 
cloning and expression profile of putative 
antilipopolysaccharide factor in Chinese 
shrimp (Fenneropenaeus chinensis). Mar. 
Biotechnol. 7: 600-608, 2005. 

Liu Y, Qian Z, Qu R, Wang X, He S, Hou F, et al. 
Molecular characterization, immune 
responsive expression and functional analysis 
of QM, a putative tumor suppressor gene from 
the Pacific white shrimp, Litopenaeus 
vannamei. Fish Shellfish Immunol. 37: 1-10, 
2014. 

Loftus T, Nguyen Y, Stanbridge E. The QM protein 
associates with ribosomes in the rough 
endoplasmic reticulum. Biochemistry. 36: 
8224-8230, 1997. 

Meng X, Fu Q, Luan S, Luo K, Sui J, Kong J. 
Genome survey and high-resolution genetic 
map provide valuable genetic resources for 
Fenneropenaeus chinensis. Sci. Rep. 11: 1-12, 
2021. 

Mills A, Mills M, Gardiner D, Bryant S, Stanbridge E. 
Analysis of the pattern of QM expression 
during mouse development. Differentiation. 64: 
161-171, 1999. 

Schmittgen T, Livak K. Analyzing real-time PCR 
data by the comparative C-T method. Nat. 
Protoc. 3: 1101-1108, 2008. 

Sha Y, Wang L, Liu M, Jiang K, Xin F, Wang B. 
Effects of lactic acid bacteria and the 
corresponding supernatant on the survival, 
growth performance, immune response and 
disease resistance of Litopenaeus vannamei. 
Aquaculture. 452: 28-36, 2016. 

Soderhall K, Cerenius L, Johansson MW. The 
prophenoloxidase activating system and its 
role in invertebrate defence. Primordial 
Immunity: Foundations for the Vertebrate 
Immune System. 712: 155-161, 1994. 

Song L, Wang L, Zhang H, Wang M. The immune 
system and its modulation mechanism in 
scallop. Fish Shellfish Immunol. 46: 65-78, 
2015. 

Sritunyalucksana K, Cerenius L, Soderhall K. 
Molecular cloning and characterization of 
prophenoloxidase in the black tiger shrimp, 
Penaeus monodon. Dev. Comp. Immunol. 23: 
179-186, 1999. 

Sritunyalucksana K, Soderhall K. The proPO and 
clotting system in crustaceans. Aquaculture. 
191: 53-69, 2000. 

Udompetcharaporn A, Junkunlo K, Senapin S, 
Roytrakul S, Flegel TW, Sritunyalucksana K. 
Identification and characterization of a QM 
protein as a possible peptidoglycan recognition 
protein (PGRP) from the giant tiger shrimp 
Penaeus monodon. Dev. Comp. Immunol. 46: 
146-154, 2014. 

Wang M, Yang J, Wang L, Zhang H, Gao Y, Wang 
X, et al. A primitive Toll-like receptor signaling 
pathway in mollusk Zhikong scallop Chlamys 
farreri. Dev. Comp. Immunol. 35: 511-520, 



 

125 

2011. 
Wang X, Wang J. Diversity and multiple functions 

of lectins in shrimp immunity. Dev. Comp. 
Immunol. 39: 27-38, 2013. 

Wang Y, Wang M, Wang B, Liu M, Jiang K, Hou X, 
et al. A preliminary attempt to explore the 
potential functions of a tetraspanin gene 
(MmTSPAN) in the innate immunity of hard 
clam Meretrix meretrix: Sequence features and 
expression profiles. Fish Shellfish Immunol. 88: 
135-141, 2019. 

Wen Y, Shao J, Pan X, Xiang L. Molecular cloning, 
characterization and expression analysis of 
QM gene from grass carp (Ctenopharyngodon 
idellus) homologous to Wilms' tumor 
suppressor. Comp. Biochem. Physiol. B, 
Biochem. Mol. Biol. 141: 356-365, 2005. 

Xia Q, Wang B, Liu M, Jiang K, Wang L. A new 
method to evaluate the effects of bacterial 
dosage, infection route and Vibrio strain in 
experimental challenges of Litopenaeus 
vannamei, based on the Cox proportional 
hazard model. Fish Shellfish Immunol. 46: 

686-692, 2015. 
Xu J, Wu S, Zhang X. Novel function of QM protein 

of shrimp (Penaeus japonicus) in regulation of 
phenol oxidase activity by interaction with 
hemocyanin. Cell. Physiol. Biochem. 21: 
473-480, 2008. 

Yi Q, Liu R, Sun R, Wang L, Zhou Z, Wang M, et al. 
The protection of CpG ODNs and Yarrowia 
lipolytica harboring VP28 for shrimp 
Litopenaeus vannamei against White spot 
syndrome virus infection. Invertebr. Surviv. J. 
11: 119-131, 2014. 

Zhang J, Li F, Jiang H, Yu Y, Liu C, Li S, et al. 
Proteomic analysis of differentially expressed 
proteins in lymphoid organ of Fenneropenaeus 
chinensis response to Vibrio anguillarum 
stimulation. Fish Shellfish Immunol. 29: 
186-194, 2010. 

Zhou X, Chen C, Li T, Tang J, Zhu B, Wei G, et al. 
A QM protein from Bombyx mori negatively 
regulates prophenoloxidase activation and 
melanization by interacting with Jun protein. 
Insect Mol. Biol. 28: 578-590, 2019.