item: #1 of 579 id: bijps-1000 author: Ghanim, Waleed K.; N. Al-Shawi, nada title: Evaluating the Effects of Different Doses of Vitamin B2 and Single Dose of Vitamin B12 Against Myelosuppression Induced by Cyclophosphamide in Experimental Rats date: 2020-06-25 words: 5269 flesch: 52 summary: Group VII/ Vitamin B2 (dose 40 mg/kg/day) and a single IP injection of CPA 2.29±0.099e 0.31±0.017d 1.01±0.023e 2.92±0.029e Group VIII/Vitamin B12 (dose 0.1mg/kg/day) and a single IP injection of CPA 2.68±0.122d 0.39±0.01d 1.25±0.022d 3.16±0.034d Group IX/A combination of vitamin B2 (10 mg/kg/day) and vitamin B12 (0.1 mg/kg/day) and a single IP injection of CPA 3.32±0.091c 0.48±0.013c 1.45±0.017c 3.40±0.021c Group X combination of vitamin B2 (40 mg/kg/day) and vitamin B12 (0.1 mg/kg/day) and a single IP injection of CPA. Iraqi J Pharm Sci, Vol.29(1) 2020 B2 ,B12 against myelosuppression induced by cyclophosphamide DOI: https://doi.org/10.31351/vol29iss1pp134-142 134 Evaluating the Effects of Different Doses of Vitamin B2 and Single Dose of Vitamin B12 Against Myelosuppression Induced by Cyclophosphamide in Experimental Rats Waleed K. Ghanim*,1 and Nada N. Al-Shawi** * Department of Pharmacology and Toxicology, College of Pharmacy, University of Basra, Basra, Iraq. keywords: b12; cpa; cyclophosphamide; day; dose; group; injection; myelosuppression; number; rats; vitamin; vitamin b2; week cache: bijps-1000.pdf plain text: bijps-1000.txt item: #2 of 579 id: bijps-1004 author: sadoon, Noor A.; M. Ghareeb, Mowafaq title: Formulation and Characterization of Isradipine as Oral Nanoemulsion date: 2020-06-25 words: 5427 flesch: 59 summary: With nanoemulsion formulation, it was noticed as the concentration of transcutol increase, the release is high reach 100% at the end of dissolution test , the reason behind this is due to the effect of co-surfactant which are good solubilizing and facilitating dissolution process of the pure drug (46, 47). With regard to the Smix part, high drug solubility in transcutol(75.1mg/ml) and tween20(20.101mg/ml) in table 2 (38). keywords: characterization; delivery; dissolution; drug; formulation; isradipine; journal; nanoemulsion; oil; pass; pass pass; pharm; pharmaceutical; phase; release; sci; size; solubility; study; surfactant; water cache: bijps-1004.pdf plain text: bijps-1004.txt item: #3 of 579 id: bijps-1008 author: Salim, Fahad F.; A. Rajab, Nawal title: Formulation and Characterization of Piroxicam as Self-Nano Emulsifying Drug Delivery System date: 2020-06-25 words: 5229 flesch: 58 summary: FTIR spectrum of selected PIR SNEDDS F4 formula It had been reported that PIR has two interconvertible crystalline forms, the needle and cubic forms. The prepared PIR SNEDDS formulas showed more than 92 % drug release at end of sixty minutes, yet F4 have higher release 97 %. keywords: delivery; drug; formulations; liquid; nano; oil; pharm; phase; piroxicam; sci; self; size; snedds; solubility; surfactant; system cache: bijps-1008.pdf plain text: bijps-1008.txt item: #4 of 579 id: bijps-1013 author: Sulaiman, Ahmed T.; W. Sarsam, Susan title: Synthesis, Characterization and Antibacterial Activity Evaluation of New Indole-Based Derivatives date: 2020-06-25 words: 4982 flesch: 63 summary: OH R2 H H H H H H OCH3 Scheme 1. Indole based N-acyl hydrazones with antibacterial activity 208 These types of bacteria produce IPA through deamination of tryptophan by bacterial enzyme tryptophan deaminase (7). keywords: acid; activity; acyl; antibacterial; ch2; compounds; hydrazones; indole; journal; str cache: bijps-1013.pdf plain text: bijps-1013.txt item: #5 of 579 id: bijps-1022 author: Sahib, Halah A.; H. Mohammed, Mohammed title: Synthesis and Preliminary Biological Activity Evaluation of New N- Substituted Phthalimide Derivatives date: 2020-06-25 words: 3564 flesch: 58 summary: Antimicrobial activity The Antimicrobial activity was screened using well diffusion methods. Bosquesi PL, Regina T, Melo F, et al. Anti- Inflammatory Drug Design Using a Molecular Hybridization Approach. keywords: acid; activity; base; candida; compounds; derivatives; methyl; phthalimide; schiff; str; synthesis cache: bijps-1022.pdf plain text: bijps-1022.txt item: #6 of 579 id: bijps-1028 author: Khaleefa, Ahmed S.; N. Hamad, Maha title: Isolation, Structural Characterization and Identification of Major Constituents in Ephedra foliata Naturally Growing in Iraq by TLC, GC-MS and UPLC-ESI-MS/MS date: 2020-12-27 words: 4448 flesch: 57 summary: That is done by maceration the aerial part of Ephedra foliata with 80% ethanol for 9 days and fractionated by n-hexane, chloroform, ethyl acetate, and n-butanol. These active constituents of Ephedra foliata have been identified play a crucial role in our life due to its pharmacological actions. keywords: acid; as2; butanol; chloroform; compound; constituents; ephedra; figure; foliata; fraction; identification; iraqi; mass; peak; pharm; plant; sci; tlc cache: bijps-1028.pdf plain text: bijps-1028.txt item: #7 of 579 id: bijps-1029 author: Jasim, Ali L.; S. Saleh, Eman; N. Abd Ali, Mustafa title: Evaluating the Clinical Outcomes of Three Medication Regimens for Treating a Sample of Iraqi Persistent Asthmatic patients date: 2020-06-25 words: 6497 flesch: 55 summary: Comparison of salmeterol/fluticasone propionate (FP) combination with FP+sustained release theophylline in moderate asthma patients. This study concluded that all groups caused significant improvement in study parameters compared to baseline values and also concluded that the third group which consisted of budesonide and tiotropium inhalers was associated with the highest extent of improvement followed by first group, while the second group was the least. keywords: ami; asthma; baseline; bud; budesonide; difference; follow; formoterol; group; ics; iraqi; medication; patients; regimens; second; study; tiotropium; values; visit; weeks cache: bijps-1029.pdf plain text: bijps-1029.txt item: #8 of 579 id: bijps-1033 author: Abd, Alaa M.; J. Kadhim, Enas title: Phytochemical Investigation of Aerial Parts of Iraqi Cardaria draba date: 2020-12-27 words: 3917 flesch: 58 summary: Flavonoids and phenolic acid compounds were isolated from hydrolyzed n-butanol fraction by preparative TLC to be then identified by HPLC, TLC, FTIR and melting point. The chromatographic and spectroscopic results showed the presence of luteolin, chlorogenic acid, caffeic acid, and resorcinol in aerial parts of C. draba. keywords: acid; analysis; butanol; caffeic; cardaria; chlorogenic; compounds; draba; flavonoids; fraction; hplc; luteolin; phenolic; phytochemical; resorcinol cache: bijps-1033.pdf plain text: bijps-1033.txt item: #9 of 579 id: bijps-1035 author: M. Ali, Zahra; H. Ali, Shatha; Y. Mohsen, Forat title: Assessment of Some Hematological parameters in Iraqi Women with Different Breast Cancer Stages date: 2020-12-27 words: 5240 flesch: 62 summary: Elevated biomarkers of inflammation are associated with reduced survival among breast cancer patients .J Koh Y W, Lee H J, Ahn J H, Lee J W, & Gong G. Prognostic significance of the ratio of absolute neutrophil to lymphocyte counts for breast cancer patients with ER/PR-positivity and HER2-negativity in neoadjuvant setting. keywords: blood; breast; breast cancer; cancer; control; control group; count; disease; ferroportin; fpn; group; hepcidin; iii; iron; levels; patients; serum; stage; study; value cache: bijps-1035.pdf plain text: bijps-1035.txt item: #10 of 579 id: bijps-1038 author: Sabri, Lubna A.; A. Hussein, Ahmed title: Comparison Between Conventional and Supersaturable Self-nanoemulsion Loaded with Nebivolol: Preparation and In-vitro/Ex-vivo Evaluation date: 2020-06-25 words: 5594 flesch: 49 summary: It can be seen from the apparent NBH concentration-time curves that the formula (SA) showed decrease concentration of NBH to about 66.5 % at 2 hours compared to conventional SNE formula (A), which maintained NBH concentration above 90% along the experimental period. Consequently, drug precipitation may occur and ultimately leading to a decrease in drug absorption. keywords: concentration; delivery; drug; formula; formulations; journal; nanoemulsion; nbh; nebivolol; permeation; precipitation; sas1; self; size; sne; soluplus; study; time cache: bijps-1038.pdf plain text: bijps-1038.txt item: #11 of 579 id: bijps-1040 author: M.Raoof, Zana; F. Dizaye, Kawa title: Diuretic Effect of Prosopis farcta in Comparison with Spironolactone and Hydrochlorothiazide in Hypertensive Rats date: 2020-06-25 words: 5283 flesch: 55 summary: Effects of different doses of P. farcta fruit extract, spironolactone (5mg/kg) and hydrochlorothiazide(20mg/kg) on serum electrolytes, serum urea and creatinine concentration in hypertensive rats( n=36) Parameters Hypertensiv e rats (B1) 25 mg/Kg P.f.f.e. Diuretic efficacy of Prosopis farcta in hypertensive rats 234 Conclusion In this animal study we demonstrated that P. farcta fruit extract has mild diuretic activity in normal rats and without significant blood pressure reduction that resemble the potassium sparing diuretics. keywords: blood; decoction; extract; farcta; farcta fruit; fruit; hypertensive; p. farcta; pressure; rate; rats; serum; sodium; spironolactone cache: bijps-1040.pdf plain text: bijps-1040.txt item: #12 of 579 id: bijps-1045 author: Basher, Taha A.; J. Al-Akkam, Entidhar title: Formulation and In-vitro Evaluation of Itraconazole Floating Microparticles date: 2020-06-25 words: 5368 flesch: 59 summary: Table 1.Composition of ITZ floating microparticles (pH-Dependent) Ingredient Formula no. Itraconazole floating microparticles 237 نتج عنه نسبه اطالق ألنهصيغه كأفضل( 7) الصيغةأوالً ، تم إعداد الجسيمات الدقيقة العائمة المعتمدة على الرقم الهيدروجيني ،وتم اختيار المستقلة العائمة االتروكانازول جسيماتحضير ، ت (%86ساعه مقبول ) keywords: drug; f16; figure; formula; itraconazole; itz; method; microparticles; oil; pharm; pure; release; size; solubility; solvent cache: bijps-1045.pdf plain text: bijps-1045.txt item: #13 of 579 id: bijps-1050 author: Alwan, Mustafa H.; N. Hamad, Maha title: Phytochemical Investigation of the Aerial Part of Iraqi Convolvulus arvensis date: 2020-12-27 words: 3070 flesch: 52 summary: Mass spectrum of rutin in ethyl acetate fraction (23) Conclusion The phytochemical investigation of the Iraqi plant revealed the presence of stigma-sterol in hexane fraction and rutin in the ethyl acetate fraction of Convolvulus arvensis aerial part of the plant. Table 3: Phytochemical analysis of the aerial parts of Convolvulus arvensis extract. keywords: acetate; acid; arvensis; convolvulus; ethyl; figure; fraction; hexane; iraqi; mobile; phase; rutin cache: bijps-1050.pdf plain text: bijps-1050.txt item: #14 of 579 id: bijps-1051 author: Alsaad, Shahad A.; Kathem, Sarmed H. title: Evaluation of the Possible Immuno-Protective Effect of Nigella Sativa Seed Oil on Cyclophosphamide- Induced Myelosuppression in Mice date: 2020-06-25 words: 4438 flesch: 53 summary: Nigella sativa seed oil, a well-known plant extract that widely used for various health conditions. This study aims to evaluate the myeloprotective activity of Nigella sativa seed oil in cyclophosphamide-induced myelosuppression mice model. keywords: bone; cells; count; cyclophosphamide; day; dose; effect; group; marrow; mice; nigella; nigella sativa; oil; sativa; seed; study; total cache: bijps-1051.pdf plain text: bijps-1051.txt item: #15 of 579 id: bijps-1055 author: Hasan, Angham A.; Abd alrazak, Munaf H.; M. Abbas Al-Temimi, Hassan title: Evaluation the Risk Factors that are Associated with Osteoporosis in Post Kidney Transplantation in a Sample of Iraqi Patients date: 2020-12-27 words: 4411 flesch: 61 summary: In conclusion , Osteoporosis in post-renal transplant patients is high when compared to general population, only corticosteroids significantly increase risk of osteoporosis, biochemical marker serum level in post kidney transplant patients are significantly different when compared with the general population but did not increase risk of osteoporosis and Body mass index is a risk factor for both lumbar and hip bones osteoporosis ,while gender and serum calcium are risk factors for osteoporosis in lumbar and hip ;respectively. The follow up of kidney transplant patients was made by specialist's surgeon. keywords: bone; control; hip; kidney; lumbar; mean; osteoporosis; patients; post; renal; risk; study; transplant; transplantation cache: bijps-1055.pdf plain text: bijps-1055.txt item: #16 of 579 id: bijps-1056 author: Abbood, Zainab A.; Ali, Shatha H.; Sheaheed, Nawfal M. title: CYP2D6 Genotype in Relation to Liver Toxicity Due to Tetrabenazine in Iraqi Patients with Hyperkinetic Movement Disorders date: 2020-12-27 words: 3725 flesch: 57 summary: Forward 5’ TGTCCAGAGGAGCCCATTT 3’ Reverse 5’GTCGAAGCAGTATGGTGTGTTCT 3’ Measure plasma level of tetrabenazine by HPLC About (20 µ1) of patient plasma was injected into the liquid chromatographic system consisting of a Cl8 µ Bondapak column and fluorescence detector. In this study, highly significant elevations of liver enzymes in the patients compared to pretreatment, indicating hepatotoxicity.. A positive non-significant correlation between tetrabenazine plasma concentrations and ALP in both chorea and dystonia were observed , while it was significantly correlated with ALT and AST in both chorea and dystonia. keywords: 2d6; alpha; alt; ast; chorea; concentration; cyp; dystonia; liver; patients; plasma; polymorphism; serum; tetrabenazine cache: bijps-1056.pdf plain text: bijps-1056.txt item: #17 of 579 id: bijps-1060 author: Thomas, Lena M.; Khasraghi, Abeer H. title: Nanotechnology-Based Topical Drug Delivery Systems for Management of Dandruff and Seborrheic Dermatitis: An overview date: 2020-06-21 words: 10870 flesch: 51 summary: World J Pharm Pharm Sci. 2007;1(1):238–49. World J Pharm Pharm Sci. 2015;4:1246–58. keywords: activity; agents; antifungal; cream; dandruff; delivery; dermatitis; development; drug; drug delivery; evaluation; formulation; gel; int j; j drug; j pharm; ketoconazole; lipid; liposomes; loaded; miconazole; microemulsion; nanoparticles; nanotechnology; pharm sci; potential; release; res; sci; seborrheic; shampoo; skin; system; tacrolimus; terbinafine; topical; treatment cache: bijps-1060.pdf plain text: bijps-1060.txt item: #18 of 579 id: bijps-1063 author: Abdul-Wahab, Farah K.; Al-Shawi, Nada N title: Effects of Vitamin D3 on Methotrexate- Induced Jejunum Damage in Rats date: 2020-06-25 words: 5080 flesch: 47 summary: control 1,control 2 (I.P normal saline) daily for 14 and 21 days respectively ; (Group III and Group IV) :vitamin D3 groups (500 IU/rat/day) orally for 14 and 21 days, respectively;(Gro up V): a single dose of methotrexate 20mg/kg, I.P injected for 4 days;(Group VI):vitamin D3 (500 IU/rat/day) single for 14 days and methotrexate (20 mg/kg I.P) injected only at day 10;.(Group VII) vitamin D3 (500 IU/rat/day) orally for 21 days and methotrexate (20 mg/kg I.P) injected only at day 17; then the jejunum was removed and used for measuring malondialdehyde (MDA) content, total antioxidant capacity (TAOC) level; in addition histopathological study of jejunum tissue. Iraqi J Pharm Sci, Vol.29(1) 2020 Vitamin D3 on methotrexate induced jejunum damage DOI: https://doi.org/10.31351/vol29iss1pp260-267 260 Effects of Vitamin D3 on Methotrexate- Induced Jejunum Damage in Rats Farah K. Abdul-Wahab *, 1 and Nada N. Al-Shawi * *Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract Both methotrexate and vitamin D3 are used in combination for the treatment of various diseases. keywords: cells; control; damage; days; depletion; figure; goblet; group; jejunum; methotrexate; mtx; rats; study; tissue; villi; vitamin; vitamin d3 cache: bijps-1063.pdf plain text: bijps-1063.txt item: #19 of 579 id: bijps-1065 author: Hameed, Ahmed M.; J. Kadhim, Dheyaa; M. Younus, Manal title: Analysis of Docetaxel Adverse Drug Reactions: A Retrospective Study Based on Iraqi Pharmacovigilance Center Database date: 2020-12-27 words: 4570 flesch: 53 summary: Analysis of docetaxel adverse drug reactions 18 As defined by WHO, the ADR is “any noxious or unintended response to a drug, which occurs at doses normally used in man for prophylaxis, diagnosis or therapy of disease, or for modification of physiological function”(4). Iraqi J Pharm Sci, Vol.29(2) 2020 Analysis of docetaxel adverse drug reactions 19 Table 1. keywords: adrs; analysis; causality; disorders; docetaxel; drug; iraqi; level; pharmacovigilance; reactions; severity; study; table cache: bijps-1065.pdf plain text: bijps-1065.txt item: #20 of 579 id: bijps-1066 author: Noor, Amjed H; M. Ghareeb, Mowafaq title: Formulation and Evaluation of Ondansetron HCl Nanoparticles for Transdermal Delivery date: 2020-12-27 words: 4927 flesch: 59 summary: The controlled drug release aimed for transdermal drug delivery could be obtained by using eudragit RS100 and eudragit RL100 polymers which can reduce dosing frequency, decrease side effects and improve patient compliance. Development in physical permeation- enhancement technologies has led to renewed interest in transdermal drug delivery. keywords: delivery; drug; eudragit; figure; formulation; iraqi; journal; nanoparticles; ond; ondansetron; pharm; polymer; release; sci; size; skin; study; transdermal cache: bijps-1066.pdf plain text: bijps-1066.txt item: #21 of 579 id: bijps-1076 author: Ajeel, Zaineb H.; N. Hamad, Maha title: Detection and isolation of flavonoid and aromatic acid from Cynara scolymus different parts cultivated in iraq date: 2020-12-30 words: 3745 flesch: 52 summary: Flow rate 3ml/min. Isolation of flavonoids and aromatic acid from ethyl acetate fraction from the capsule of plant -Isolation of flavonoids were done by preparative layer chromatography (PLC), from the ethyl acetate fraction of Cynara scolymus capsule the conditions of isolation show in table 2 Table 2. Iraqi J Pharm Sci, Vol.29(2) 2020 Flavonoids and aromatic acid from head(capsule) of Cynara scolymus 206 Analysis of ethyl acetate fraction by high- performance liquid chromatography (HPLC) keywords: acetate; acid; capsule; chromatography; compounds; cynara; ethyl; flavonoids; fraction; hplc; iraqi; luteolin; scolymus cache: bijps-1076.pdf plain text: bijps-1076.txt item: #22 of 579 id: bijps-1077 author: Salman, Ali S.; S.Saleh, Eman; S.Abass, Mohammed title: Estimation of Beta Two Microglobulins, Fetuin-A, Resistin Serum Level in Iraqi Multiple Myeloma Patients date: 2020-12-27 words: 4952 flesch: 57 summary: Fetuin-A, resistin serum level in Iraqi multiple myeloma patients 81 Beta2 microglobulin is a polypeptide presented in the serum its origin is the cell membrane of all nucleated cell in which found in tight junction with major histocompatibility complex 1(MHC1) Fetuin-A, resistin serum level in Iraqi multiple myeloma patients 82 substrate solution is added to the wells and color develops in proportion to the amount of Fetuin Abound in the initial step. keywords: bone; control; correlation; disease; et.al; fetuin; iraqi; journal; level; microglobulin; myeloma; patients; resistin; serum; study cache: bijps-1077.pdf plain text: bijps-1077.txt item: #23 of 579 id: bijps-1086 author: Jasim, Ihsan K.; N. Abd Alhammid, Shaimaa; A. Abdulrasool, Alaa title: Synthesis and evaluation of B-cyclodextrin Based Nanosponges of 5- Fluorouracil by Using Ultrasound Assisted Method date: 2020-12-27 words: 5158 flesch: 60 summary: The overall results suggest that cyclodextrin nanosponges could be a promising 5-FU delivery system utilizing the suitable formula. Shringirishi M, Mahor A, Gupta R, Prajapati SK, Bansal K, Kesharwani P. Fabrication and characterization of nifedipine loaded β- cyclodextrin nanosponges: keywords: complex; cyclodextrin; dpc; drug; efficiency; iraqi; journal; molar; nanosponges; pharm; phase; prepared; release; size; solubility; βcd cache: bijps-1086.pdf plain text: bijps-1086.txt item: #24 of 579 id: bijps-1092 author: Qasim, Zahraa S. title: The Effect of Ginkgo biloba Extracts on Candida albicans Isolated from Healthy Persons date: 2020-12-29 words: 4545 flesch: 58 summary: The mean results of susceptibility test zone diameter indicated that Ginkgo biloba ethanol extract showed a higher zone of inhibition than aqueous as showed in (Table 4 and Figure 2 A, 2B). The susceptibility test of Ginkgo biloba extracts against C. albicans. keywords: activity; albicans; aqueous; biloba; biofilm; candida; ethanol; extracts; formation; ginkgo; ginkgo biloba; isolates; test cache: bijps-1092.pdf plain text: bijps-1092.txt item: #25 of 579 id: bijps-1098 author: Tawfeeq, Mostafa F.; Qassir, Ahlam J title: Synthesis, Characterization, and Antibacterial Evaluation of New Vanillic Acid Derivatives date: 2020-12-29 words: 5152 flesch: 53 summary: Conclusion: New oxadiazole derivatives (hydrazide and its Schiff bases), derived from vanillic acid were successfully synthesized by conventional methods. New vanillic acid derivatives as antibacterials 130 Material and Methods Chemicals supplied by hyper-chem (China) were used. keywords: acid; activities; activity; amide; band; chemistry; cm-1; compound; derivatives; ftir; journal; new; protons; stretching; synthesis; vibration; vibration band cache: bijps-1098.pdf plain text: bijps-1098.txt item: #26 of 579 id: bijps-1107 author: Kareem, Ashwaq T; N. Hamad, Maha title: Separation and Identification of Phenolic Acid from Borago officinalis (F:Boraginaceae) Cultivated in Iraq date: 2020-12-29 words: 3381 flesch: 58 summary: ، كروماتوغرافيا السائل عالية االداء،حامض السنابيك,حامض الكافييك، حامض الروزماريك الكلمات المفتاحية: Introduction Borage (Borago officinalis L.) is an annual plant belonging to the family. Pieretti PG, Palmegiano GB, Salamano G. Quality and fatty acid content of borage (Borago officinalis L.) during the growth cycle. keywords: acetate; acid; borago; caffeic; compound; compound number; figure; number; officinalis; plant; sci; standard; tlc cache: bijps-1107.pdf plain text: bijps-1107.txt item: #27 of 579 id: bijps-1113 author: Ismail, Adnan M.; Saleh, Eman S title: Estimation of Serum CD200 and CD200R1 Levels in a Sample of Iraqi Women with Breast Cancer: Their Role as Diagnostic and Prognostic Markers date: 2020-12-30 words: 3886 flesch: 59 summary: *Highly significant (P<0.01) Superscripts (a,b) refer to statically significant differences The correlation between breast cancer stages and serum CD200 concentration is positive medium (r = 0.545), as breast cancer stage progresses, the level of CD200 increases and this correlation becomes significant (P=0.00002) Table (2). Six groups were enrolled, four groups were confirmed with breast cancer stage (I, II, III and IV), fifth group (benign) and sixth group was control (healthy individual). keywords: breast; cancer; cd200; cd200r1; cell; concentration; control; expression; level; marker; patients; serum; stage; table; tumor cache: bijps-1113.pdf plain text: bijps-1113.txt item: #28 of 579 id: bijps-1114 author: M. Mohammed, Thamer; H. Mutlag, Shihab; A.Shihab, Bahaa title: Evaluation of the Effect of Topical Artemisia dracunculus Administration on Serum Levels of Selected Interleukins and Spleen Index in Imiquimod-Induced Psoriasis in Male Mice Compared to Clobetasol Propionate (Dermovate (R)) Ointment date: 2020-12-30 words: 5098 flesch: 62 summary: All the results showed that A. dracunculus ameliorates psoriasis induced by imiquimod in male mice Keywords: Psoriasis, Artemisia dracunculus, Imiquimod 5%, IL-23, IL-17. Previous data showed that psoriasis incidence varied depending on age and geographic location, being more prevalent in countries more distant from the equator.(30) The statistical calculation of PASI score indicated that the prepared ointment of A. dracunculus significantly (P<0.05) ameliorates the psoriasis-like skin inflammation in Group IV mice received topical A. dracunculus ointment 1hr before 5% IMQ in comparison with the (vehicle ointment + 5% IMQ) (Group III) as shown in table 1 and Figure 1. Previous studies concerning A. Dracunculus indicate pharmacological properties of this plant, including anti-inflammatory, antibacterial, antidiabetic and antioxidant properties. keywords: artemisia; comparison; control group; dracunculus; dracunculus ointment; group; group iii; imiquimod; imq; mice; ointment; psoriasis; skin; vehicle; vehicle ointment cache: bijps-1114.pdf plain text: bijps-1114.txt item: #29 of 579 id: bijps-1117 author: Abdulhamza, Hayder M.; S. Farhan, Muthanna title: Synthesis, Characterization and Preliminary Anti-inflammatory Evaluation of New Fenoprofen Hydrazone Derivatives date: 2020-12-30 words: 3219 flesch: 61 summary: Chemical structure of Fenoprofen 1Corresponding author E-mail: hyder_muhy@yahoo.com Received: 20/ 2/2020 Accepted: 9/8 /2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol29iss2pp239-244 Iraqi J Pharm Sci, Vol.29(2) 2020 Synthesis of Fenoprofen hydrazones with anti-inflammatory effect 240 Iraqi J Pharm Sci, Vol.29(2) 2020 Synthesis of Fenoprofen hydrazones with anti-inflammatory effect 241 (H2) N'-(4-Nitrobenzylidene)-2-(3 phenoxy phenyl) keywords: activity; compounds; effect; fenoprofen; hydrazones; nsaids; str; synthesis cache: bijps-1117.pdf plain text: bijps-1117.txt item: #30 of 579 id: bijps-1122 author: Hussein, Asmaa M.; Kadum, Enas J. title: Identification and Isolation of Caffeic, Chlorogenic and Ferulic Acids in Aerial Parts of Capparis spinosa wildly grown in Iraq date: 2020-12-30 words: 3471 flesch: 58 summary: plates for standards and sample phenolic acids in E2, E3 and E5 at 254nm (above) and 366nm (below). Retention times of the standard phenolic acids and the concentration of sample phenolic acids at standard retention time. keywords: acids; analysis; caffeic; capparis; chlorogenic; ethyl; ferulic; iraqi; presence; sample; spinosa; standard cache: bijps-1122.pdf plain text: bijps-1122.txt item: #31 of 579 id: bijps-1125 author: H. Abdulridha, Sarah; J. Kadhim, Dheyaa; A. Abdul Razzak, Sarmad title: Assessment of Quality of Life in a Sample of Iraqi Patients with Psoriasis. date: 2020-12-30 words: 4895 flesch: 66 summary: This study is a cross-sectional study that involved 300 already diagnosed psoriasis patients who attended to the center of Dermatology and Venereology, Medical City/Baghdad. Additionally, psoriasis disease prevented about one-quarter of the patients from going to work or studying (23%) and caused work/study problems for another third (34.7%) of the participants. keywords: association; dermatology; disease; dlqi; index; iraqi; life; patients; psoriasis; qol; quality; score; skin; study; table; total cache: bijps-1125.pdf plain text: bijps-1125.txt item: #32 of 579 id: bijps-1127 author: R. Abdulbaqi, Mustafa; A.Rajab, Nawal title: Preparation, Characterization and Ex vivo Permeability Study of Transdermal Apixaban O/W Nanoemulsion Based Gel date: 2020-12-30 words: 5159 flesch: 56 summary: Franz cell - Ex vivo permeation study through human skin The use of abdominal skin of adult human female was reviewed and approved by ethical committee of Baghdad University / College of Pharmacy for its application in the ex vivo permeation study experiment for pure APX gel and ultrafine APX-NE based gel. Then, samples of 5 g APX-NE gel and pure APX gel placed above the skin in the donor part of Franz cell for permeation evaluation(20). keywords: apixaban; apx; corneum; delivery; drug; formulation; gel; journal; nanoemulsion; permeation; size; skin; stratum; transdermal; ultrafine; vivo cache: bijps-1127.pdf plain text: bijps-1127.txt item: #33 of 579 id: bijps-1134 author: Kareem, Akram H; J. Kadhim, Dheyaa title: Health-Related Quality of Life in a Sample of Chronic Obstructive Pulmonary Disease Patients in AL-Diwanyia Province /Iraq. date: 2020-12-30 words: 4597 flesch: 67 summary: Iraqi J Pharm Sci, Vol.29(2) 2020 Quality of life in chronic obstructive pulmonary disease patients 172 Results of HRQOL parameters of COPD patients enrolled in the current study are shown in Table 3. Patients The current cross-sectional study involved 150 already diagnosed COPD patients who attended to the Center of Respiratory Diseases/AL- Diwaniyah Teaching Hospital during September 2019 to January 2020. keywords: care; chronic; copd; disease; fev1; health; hospital; hrqol; life; mean; patients; pulmonary; quality; score; study cache: bijps-1134.pdf plain text: bijps-1134.txt item: #34 of 579 id: bijps-1139 author: Amin Huseen, Narmin H. title: Docking Study of Naringin Binding with COVID-19 Main Protease Enzyme date: 2020-12-30 words: 4015 flesch: 63 summary: Results showed that naringin interacted with COVID-19 main protease, and it has the highest binding affinity than other flavonoids include quercetin, hesperetin, and naringenin. Keywords: COVID-19 main protease, Flavonoids, Naringin, Molecular docking, Protease inhibitor. keywords: bond; coronavirus; covid-19; docking; drugs; figure; flavonoids; group; hydrogen; mol; naringin; protease; protein; sars; structure cache: bijps-1139.pdf plain text: bijps-1139.txt item: #35 of 579 id: bijps-1141 author: Al-Shimmran, Ban A.; M. Anwer, Zinah; H. Al-Jarrah, Bassam title: Levothyroxine Therapy Adequacy, Dose Estimation and Vitamin D Effect Assessment in a Sample of Iraqi Female Patients with Different Causes of Hypothyroidism date: 2020-12-30 words: 5134 flesch: 61 summary: LT4 dose was adjusted by physicians empirically. While controlling for LT4 dose, the resulted TSH difference was significant without affecting thyroid hormones (Table 6). keywords: bmi; day; dose; euthyroid; hypothyroidism; levothyroxine; lt4; mcg; patients; post; primary; study; thyroid; treatment; tsh cache: bijps-1141.pdf plain text: bijps-1141.txt item: #36 of 579 id: bijps-1151 author: Saihood, Ahmed H.; Hasan, Ali F. title: Assessment of the Clinical Pharmacists' Role by Physicians at Baghdad Hospitals date: 2020-12-30 words: 4473 flesch: 49 summary: Keywords: Physician, Clinical pharmacist, Baghdad, Assessment, Services. Calculating doses and monitoring medication blood levels are also among the services provided by clinical pharmacists. keywords: assessment; baghdad; clinical; hospital; participants; pharmacist; pharmacy; physicians; questionnaire; role; score; study cache: bijps-1151.pdf plain text: bijps-1151.txt item: #37 of 579 id: bijps-1155 author: Talib, Aya F.; M.Anwer, Zinah title: The Role of Clinical Pharmacist in Reducing Drug Related Problems in Hemodialysis Patients date: 2020-12-30 words: 4078 flesch: 51 summary: Prospective, interventional, clinical study for 180 hemodialysis patients, and was designed as two phases, an observational phase to identify drug related problems and classifying them according to the latest Pharmaceutical Care Network Europe classification, and an interventional phase to increase the awareness of patients and the nephrologists about those problems and proposing a proper solution for each one. There were significant numbers of drug related problems among Iraqi patients on hemodialysis, the use of erythropoietin, calcium carbonate and sevelamer was responsible for most of inappropriate combinations. keywords: 0(0; disease; dose; drps; drug; effect; hemodialysis; indication; iraqi; patients; pharmacist; problems; study; treatment cache: bijps-1155.pdf plain text: bijps-1155.txt item: #38 of 579 id: bijps-1158 author: Al-Tamimi, Duaa J.; Hussein, Ahmed A. title: Formulation and Characterization of Self-Microemulsifying Drug Delivery System of Tacrolimus date: 2021-06-15 words: 4792 flesch: 51 summary: Sapra K, Sapra A, Singh SK, Kakkar S. Self emulsifying drug delivery system: A tool in solubility enhancement of poorly soluble drugs. Wu W, Wang Y, Que L. Enhanced bioavailability of silymarin by self- microemulsifying drug delivery system. keywords: delivery; dissolution; drug; formulation; journal; liquid; oil; pass; pass pass; phase; release; self; size; smedds; system; tacrolimus cache: bijps-1158.pdf plain text: bijps-1158.txt item: #39 of 579 id: bijps-1164 author: Abbas, Ashwaq N.; K. Hasan, Mwafak; A. Ahmed, Muhammad title: Frequency inborn error of mitochondrial function in Mosul and Kurdistan region: the Frequency inborn error of mitochondrial function in Mosul and Kurdistan region date: 2020-12-30 words: 2364 flesch: 55 summary: This work aimed to estimate the frequency of mitochondrial inborn errors of metabolism (MIEMs) in patients presenting with family history and IEM-picture who referred for advance IEM assay in Mosul province and Kurdistan region. In conclusion, the incidence of mitochondrial inborn errors of metabolism (MIEMs) between patients presenting with IEM was higher in Mosul and Kurdistan region than international values Keywords: Mitochondria, An inborn error of metabolism, Carnitine, Mosul. keywords: blood; cases; coa; deficiency; disorders; error; iem; metabolism; mosul; patients cache: bijps-1164.pdf plain text: bijps-1164.txt item: #40 of 579 id: bijps-1166 author: Al-Obaidi, Imad A.; N. Al-Shawi, Nada title: Assessment the Genotoxic Potential of Fluoxetine and Amitriptyline at Maximum Therapeutic Doses for Four-Week Treatment in Experimental Male Rats date: 2021-06-15 words: 6364 flesch: 53 summary: Sister chromatid exchanges and sperm abnormalities produced by antidepressant drug fluoxetine in mouse treated in vivo. Abstract At any moment, the continuous usage of medications can be accompanied by DNA damage and the accumulation of such damages can cause serious consequences. keywords: amitriptyline; animals; assay; bone; cells; comet; control; damage; dna; drug; fluoxetine; genotoxic; group; liver; micronucleus; potential; rats; research; study; tail; testis; tissues cache: bijps-1166.pdf plain text: bijps-1166.txt item: #41 of 579 id: bijps-1169 author: Jabbar, Thair L.; A. Kasim, Ali title: Association of Retinol Binding Protein- 4 (RBP4) with Glycemia, Dyslipidemia, Hypertension, and Obesity in Type 2 Diabetic Iraqi Patients date: 2020-12-30 words: 5142 flesch: 62 summary: While, there was no significant correlation between serum RBP4 levels and age, gender, DBP, or TG, VLDL-c, and TC levels (P>0.05). Pearson’s correlations of serum RBP4 levels with the studied variables Variable r-value P-value Age 0.14 0.13 Gender -0.1 0.15 Disease duration 0.5 0.000* BMI 0.31 0.001* SBP 0.2 0.02* DBP 012 0.17 FBG 0.6 0.000* HBA1c 0.4 0.000* TC 0.17 0.06 TG 0.12 0.17 VLDL-C 0.12 0.17 LDL-C 0.25 0.008* HDL-C -0.45 0.000* Discussion In the present study, serum RBP4 has significant positive correlation with markers of glycemic control, FBG and HbA1c (table 4). keywords: association; blood; diabetes; dm patients; hypertension; journal; levels; obesity; patients; protein; rbp4; retinol; risk; serum; t2 dm; type cache: bijps-1169.pdf plain text: bijps-1169.txt item: #42 of 579 id: bijps-1181 author: H. Mhaibes, Sarah; K. Fakree, Najwan; I. Naser, Sonia title: Regulation of Appetite and Satiety by Gastrointestinal Peptides date: 2021-06-15 words: 5265 flesch: 59 summary: Table 1 explains the role of GIP in food intake control . GIP activities in food intake control (6) GIP Receptor Site of action Effects on food intake Ghrelin ghrelin receptor Vagal nerve Brain stem Hypothalamus orexigenic ↑ appetite ↑ gastric motility Nesfatin-1 Melanocortin receptor Vagal nerve Brain stem Hypothalamus Anorexigenic ↓ appetite CCK CCK1 Vagal nerve Brain stem Hypothalamus Anorexigenic ↓appetite ↑ gallbladder emptying ↓ gastric emptying Peptide YY Y2R keywords: appetite; brain; cck; control; energy; food; gastric; ghrelin; glp-1; glucagon; gut; hormones; intake; obesity; peptides; pyy; receptor; regulation; role; treatment; weight cache: bijps-1181.pdf plain text: bijps-1181.txt item: #43 of 579 id: bijps-1182 author: N. Kamal, Ayia; Hassan, Ali F. title: Comparative Study of Liver Function and Rh Blood Group between both Physiological and Pathological Neonatal Jaundice date: 2021-06-15 words: 5763 flesch: 52 summary: The study was conducted for one hundred neonates with jaundice divided into two groups, group one includes fifty newborns with physiological jaundice, Group two includes fifty newborns with pathological jaundice. Serum bilirubin (total and direct), serum albumin concentration and the liver enzymes were significantly higher when compare between newborns and pathological jaundice with newborns of physiological jaundice (p<0.05). keywords: absorbance; albumin; bilirubin; blood; concentration; enzymes; group; hyperbilirubinemia; jaundice; liver; neonatal; newborns; pediatr; reagent; serum; study; value cache: bijps-1182.pdf plain text: bijps-1182.txt item: #44 of 579 id: bijps-1183 author: Alhagiesa, Areej Wahhab; M. Ghareeb, Mowafaq title: The Formulation and Characterization of Nimodipine Nanoparticles for the Enhancement of solubility and dissolution rate date: 2021-12-11 words: 4541 flesch: 60 summary: This amphipathic nature makes it an excellent surface-active and wetting agent that reduces the interfacial tension between the hydrophobic surface of NMD particles and the aqueous antisolvent. This research aimed to prepare Nimodipine nanoparticles (NMD NPs) for the enhancement of solubility and dissolution rate. keywords: dissolution; drug; j pharm; nanoparticles; nanosuspension; nimodipine; nps; particle; particle size; pdi; pharm; sci; size; solubility; soluplus cache: bijps-1183.pdf plain text: bijps-1183.txt item: #45 of 579 id: bijps-1185 author: Alwan, Rusul M.; A. Rajab, Nawal title: Nanosuspensions of Selexipag: Formulation, Characterization, and in vitro Evaluation date: 2021-06-15 words: 4988 flesch: 59 summary: These polymers can effectively adsorb onto drug particle surfaces that lead to steric stabilization of the system by providing a stable thermodynamic barrier surrounded the particle surface, which retarded particle growth(23,24). Their adsorption onto drug particle surface depends on physisorption; if hydrophobic- hydrophilic forces are not strong enough for surface adsorption, they cannot overcome the attractive force between two-particles that become dominant due to depletion of stabilizer between the gap of particles(25,26). keywords: dissolution; drug; formulas; formulation; nanosuspension; p.s; pharm; sci; selexipag; slp; slpns; solubility; soluplus; stabilizer; surface cache: bijps-1185.pdf plain text: bijps-1185.txt item: #46 of 579 id: bijps-1187 author: Ismail, Parween A.; Ali, Lana M. title: Alteration of Serum Immunoglobulin Levels in Woman with Ovarian Cancer date: 2021-06-19 words: 2704 flesch: 50 summary: Results and Discussion Figures (1,2,3) shows the results of Serum Immunoglobulins (IgG, IgA, and IgM) levels in samples of control and ovarian cancer patients. This research was conducted to evaluate serum immunoglobulin levels in women with ovarian cancer and to assess their role in disease process. keywords: cancer; carcinoma; cell; human; immunoglobulin; levels; patients; serum; study cache: bijps-1187.pdf plain text: bijps-1187.txt item: #47 of 579 id: bijps-1188 author: Khalid, Marwah W.; Abd, Leaqaa; N. Abood, Ahmed title: Synthesis of Mutual Prodrugs of Secnidazole and Ciprofloxacin and study Their Physicochemical Properties date: 2021-06-15 words: 5959 flesch: 51 summary: Iraqi J Pharm Sci, Vol.30(1) 2021 Secnidazole and ciprofloxacin mutual prodrugs DOI : https://doi.org/10.31351/vol30iss1pp133-143 133 Synthesis of Mutual Prodrugs of Secnidazole and Ciprofloxacin and study Their Physicochemical Properties Marwah W. Khalid*,1, Leaqaa A. Alrubaie *, Ahmed N. Abood ** * Department of Pharmaceutical Chemistry, College of Pharmacy, University of Basrah, ,Basrah, Iraq ** Department of Pharmaceutics, College of Pharmacy, University of Basrah, Basrah ,Iraq Abstract In present work, secnidazole and ciprofloxacin were linked as mutual prodrugs to get antibiotics with broader spectrum of activity by acting on aerobic and anaerobic bacteria, improved physicochemical properties and given by single dose to enhance patient’s compliance. عمر قيم لذلك اشارت كما األمعاء من امتصاصها ليتم كافيًا ثباتًا وتنتج المعدة عبر تحلل بدون تمر قد .للميكروبات المضادة , الفعاليةالكيميائية و الخصائص الفيزيائيةمقدمات دوائية مشتركة ,, سيكنيدازول, ينسسيبروفلوكسا المفتاحية: الكلمات 1Corresponding author E-mail: marwa.wkhalid@gmail.com Received:28 / 7 /2020 Accepted: 18/ 10/2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30iss1pp133-143 Iraqi J Pharm Sci, Vol.30(1) 2021 Secnidazole and ciprofloxacin mutual prodrugs 134 Introduction In a clinical practice the treatment for anaerobic infections aims to treat a complex ecosystem of multiple bacterial species with an antibiotics regimen that provide effective activity against both anaerobic and facultative bacteria (1). keywords: activity; chemical; ciprofloxacin; compound; ester; hydrolysis; iraqi; journal; mutual; pharmaceutical; phase; prodrugs; secnidazole; solubility; stretching; synthesis cache: bijps-1188.pdf plain text: bijps-1188.txt item: #48 of 579 id: bijps-1190 author: NAJI, Nabigh A; Ali, Shatha H; Farhan, Fatin S. title: Correlation between serum carnitine level and Soluble Receptors for Advance Glycation End Products(sRAGE) in Clomiphene Citrate Resistant- PCOS Women date: 2021-06-15 words: 7063 flesch: 57 summary: In addition to a significant correlation between serum total carnitine and serum sRAGE levels (r=0.45, P-value=0.03). Furthermore, there is a significant (P-value <0.05) positive correlation between serum carnitine values and serum sRAGE levels (r=0.45, P- value=0.03) in patient group (Figure-3).However, no significant correlation was detected for either one with the studied sex hormones (Table -3). keywords: ages; carnitine; clinical; clomiphene; control; correlation; end; endocrinology; glycation; group; insulin; iraqi; journal; levels; ovarian; ovary; patients; pcos; products; receptor; resistance; serum; serum carnitine; srage; study; syndrome; total; women cache: bijps-1190.pdf plain text: bijps-1190.txt item: #49 of 579 id: bijps-1191 author: Weli, Sardar M. title: Effects of Exclusive Breast Feeding for First Six Months of life on Children Weight, Height and Head Circumference in Sulaimani City, Kurdistan-Iraq and Compare with Other Types of Feeding date: 2021-06-15 words: 3612 flesch: 70 summary: The current study found that head circumferences of exclusively breast fed infants were higher compared to exclusively bottle fed infants at age six and fifteen months. Additionally, a study on Turkish infants during 6 months of life showed that head circumferences were higher in breast fed infants compared to formula fed and mixed fed infants (24). keywords: age; breast; differences; ebf; exclusive; fed; feeding; formula; head; infants; months; study; weight cache: bijps-1191.pdf plain text: bijps-1191.txt item: #50 of 579 id: bijps-1195 author: Hussein, Lina S.; Al-Khedairy, Eman B. H. title: Solubility and Dissolution Enhancement of Ebastine by Surface Solid Dispersion Technique date: 2021-06-15 words: 5218 flesch: 61 summary: Most of the prepared SSD formulas showed improvement of drug solubility. Table 3 showed that, no improvement in the solubility of EBS was obtained by using 1:1 drug: carrier w:w ratio, but significant enhancement in drug solubility (p<0.05) at 1:2 ratio in the following sequence: CCS (SSD7) < keywords: avicel; carrier; ccs; dispersion; dissolution; drug; ebastine; ebs; enhancement; ph101; pharm; ratio; sci; solubility; ssd; surface cache: bijps-1195.pdf plain text: bijps-1195.txt item: #51 of 579 id: bijps-1197 author: Jasim, Basma S.; Y. Jamal, Mohammed title: Evaluating Patient Safety Culture in Iraqi Community Pharmacies date: 2021-06-15 words: 4960 flesch: 62 summary: This study was carried out on 435 pharmacists who are working in community pharmacies in various Iraqi provinces. Keywords: Iraqi pharmacist, Patient Safety Culture, Community pharmacy. keywords: community; culture; health; iraqi; journal; patient; pharmacies; pharmacy; safety; safety culture; staff; study; total; work; working; years cache: bijps-1197.pdf plain text: bijps-1197.txt item: #52 of 579 id: bijps-1204 author: Fakhree, Najwan K.; H. Mhaibes, Sarah; H. Khalil, Heba title: Review article - Impact of Vitamin K on Human Health date: 2021-06-15 words: 8067 flesch: 55 summary: Regulation of cell growth Periostin Bone metabolism, cell migration, angiogenesis Gla rich protein (GRP) Periostin like factor Four transmembrane Gla protein Function unknown Functions of Vitamin K Effect of vitamin K on coagulation Vitamin K, which is a coenzyme used to generate coagulation factors, is long considered to be important for controlling blood clotting. Effect of vitamin K on bone health Vitamin K and vitamin D are important for the healthy metabolism of the bone. keywords: blood; bone; calcification; calcium; cell; coagulation; deficiency; effect; factors; function; gla; health; human; mcg; osteocalcin; phylloquinone; protein; vitamin; vitamin k; years cache: bijps-1204.pdf plain text: bijps-1204.txt item: #53 of 579 id: bijps-1208 author: R. Al-Hassani, Hiba; B. H. Al-Khedairy, Eman title: Formulation and In-Vitro Evaluation of Meloxicam Solid Dispersion using Natural Polymers. date: 2021-06-19 words: 5056 flesch: 57 summary: All the prepared formulas showed improvement of drug solubility except that prepared with HA. The enhanced dissolution of the drug from SDs can be attributed to reduced particle size of the drug within SDs, also it is assumed that the higher the wettability and dispersibility of a drug in a hydrophilic polymer, the better the chances of achieving an increase in drug dissolution profile (6,38). keywords: collagen; dispersion; dissolution; drug; formula; iraqi; meloxicam; mlx; pharm; polymer; rate; sci; sd1; solubility; water cache: bijps-1208.pdf plain text: bijps-1208.txt item: #54 of 579 id: bijps-1210 author: Hussien, Rawaa M.; M. Ghareeb, Mowafaq title: Formulation and Characterization of Isradipine Nanoparticle for Dissolution Enhancement date: 2021-06-19 words: 3678 flesch: 52 summary: FTIR spectrum of pure Isradipine Figure 6.FTIR of Isradipine nanoparticle (F9) Iraqi J Pharm Sci, Vol.30(1) 2021 Isradipine nanoparticle 224 Conclusions Based on the results obtained , the study concluded that nanoparticles is a promising approach to improve the solubility, dissolution rate and release of isradipine and solvent-antisolvent precipitation is an efficient method for preparation of isradipine nanoparticles. The aim of this study was to formulate and optimize a stable nanoparticles of this highly hydrophobic drug by solvent- antisolvent precipitation method to enhance in vitro dissolution rate and improve drug bioavailability Ten formulas of isradipine nanoparticles were prepared by antisolvent precipitation method utilizing one of these polymers Poloxamer 188, PVA, and Soluplus at different drugs: polymer ratios. keywords: dissolution; drug; figure; formula; isradipine; journal; nanoparticles; pharm; rate; results; sci; size; solubility; soluplus cache: bijps-1210.pdf plain text: bijps-1210.txt item: #55 of 579 id: bijps-1213 author: Ghalib, Suroor A.; J. Kadhim, Enass title: The Investigation of Some Phytochemical Compounds Found in Anchusa strigosa L. Grown Naturally in Iraq date: 2021-06-19 words: 3886 flesch: 51 summary: Anchusa strigosa contain many secondary metabolites including pyrolizidine alkaloids with high concentration in the leaves followed by the flowers and finally by the roots such as retrorsine, trachelanthamidine, supinidine , platynecine and Heliotridine (9,18) ,flavonoids and phenolic acid content of this plant including Catechins, Quercitin,rosmarinic acid caffeic acid and others (19,20) ,this plant also contains steroids and terpenoids as tormentic acid. Received: 29/ 8/2020 Accepted: 21/ 11/2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30iss1pp179-188 Iraqi J Pharm Sci, Vol.30(1) 2021 Anchusa strigosa 180 Different species of Anchusa extract have many pharmacological activities ; methanolic extract of Anchusa officinalis L .has great antioxidant activity as free radical scavenging due to phenolic and flavonoids content,(10)While this activity is great for aqueous extract of Anchusa strigosa (11) anti- hyperglycemic activity of A. strigosa in diabetic rats showed a significant decrease in the fasting blood glucose and an increase in the serum insulin levels after administration that possibly was either by increasing the pancreatic secretion of insulin from existing β-cells or by release from the bound form (12) The uses of Anchusa strigosa extract has neuroprotective activity against amyloid toxicity ; reducing levels of amyloid secretion from cells and reduced γ-secretase activity (13). keywords: acid; anchusa; chromatography; compound; extract; fraction; hplc; iraqi; isolated; layer; methanol; plant; preparative; strigosa cache: bijps-1213.pdf plain text: bijps-1213.txt item: #56 of 579 id: bijps-1214 author: Jaafar, Noor S.; Jaafar, Iman S. title: Natural Products as A Promising Therapy for SARS COV-2; An Overview date: 2021-06-15 words: 7750 flesch: 54 summary: In the late stage of SARS CoV-2 infection, the cytokine storm produces acute lung injury, escin might reduce the secretion of inflammatory mediators in addition to attenuate the acute lung injury. A way from therapeutic options that were tried in SARS CoV-2, an increased attention is directed to predict natural products and mainly phytochemicals as collaborative measures for this crisis. keywords: ace2; antiviral; cells; coronavirus; cov-2; covid-19; effect; et al; figure; hesperidin; human; infection; novel; patients; pharm; products; protease; quercetin; sars; sci; studies; treatment; wang cache: bijps-1214.pdf plain text: bijps-1214.txt item: #57 of 579 id: bijps-1221 author: Khudhair, Alaa R.; Al-Shawi, Nada N title: Possible Protective Effects of Lutein against Ciprofloxacin Induced Bone Marrow Toxicity in Rats date: 2021-06-19 words: 4198 flesch: 58 summary: الحمراء وإجمالي عدد كرات الدم البيضاءلوتين ، سيبروفلوكساسين ، إجمالي عدد كرات الدم الكلمات المفتاحية : Introduction The carboxylic acid derivation of fluoroquinolones is Ciprofloxacin, which is a second generation of fluoroquinolone and one of the most effective and widely used drugs within fluoroquinolone (1). Rats that orally received lutein (Groups ӀӀӀ and ӀV), each produced non- significant differences (P>0.05) in total -RBCs and -WBCs and also produced non-significant differences (P>0.05) in Bax levels in BM tissues homogenates with respect to corresponding levels in Group Ι rats. keywords: apoptosis; bax; bone; ciprofloxacin; days; dose; effects; gavage; group; iraqi; lutein; marrow; rats; total cache: bijps-1221.pdf plain text: bijps-1221.txt item: #58 of 579 id: bijps-1224 author: Ibrahim, Ruaa M. title: A review on Active Constituents and Pharmacological Effects of Eriobotrya Japonica Lindl. (Loquat) date: 2021-06-15 words: 8289 flesch: 49 summary: Sun G, Liu Y, Zhu J, Iguchi M, Yoshioka S, Miyamura M, Kyotani S. Immunomodulatory effect of Eriobotrya japonica seed extract on allergic dermatitis rats. Eriobotrya japonica leaves were utilized in the therapy of stomach and lung illness, diabetes mellitus, skin diseases and inflammatory problem (9) and also efficient in dysmenorrhea, phlegm, asthma, headache, chronic bronchitis, and lower back pain (10). keywords: acid; activity; antioxidant; cell; chemical; compounds; effect; eriobotrya; eriobotrya japonica; ethanol; extract; figure; flavonoids; fruit; iraqi; japonica; journal; leaf; leaves; levels; lindl; loquat; pharm; phenolic; quercetin; rats; sci; tea cache: bijps-1224.pdf plain text: bijps-1224.txt item: #59 of 579 id: bijps-1227 author: Ahmad, Halla A.; H. Kathem, Sarmed title: Thymoquinone Attenuates Immune Mediated Liver Injury Induced by Concanavalin A in Mice date: 2021-12-09 words: 5266 flesch: 55 summary: The importance of immune mediated liver damage is to simulate human autoimmune and viral hepatitis, which considered an upgrowing health issue globally (26). This result is the first to demonstrate a hepatoprotective effect of thymoquinone in immune mediated liver damage, that means an immune modulatory activity has been proposed in the present study. keywords: concanavalin; control; control group; damage; dose; effect; group; immune; level; liver; model; study; thymoquinone; tnf cache: bijps-1227.pdf plain text: bijps-1227.txt item: #60 of 579 id: bijps-1229 author: Ali, Aseel J.; Abdulla, Hajer I.; Al-Nimer, Marwan S. title: The Pharmacological Effects of Kappa Carrageenan on Different Human Cell Lines and Genomic DNA: An in vitro study date: 2021-06-19 words: 4605 flesch: 59 summary: 1Corresponding author E-mail: dentist_aseel@yahoo.com Received: 11/ 9 /2020 Accepted:21 / 11 /2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30iss1pp189-195 Iraqi J Pharm Sci, Vol.30(1) 2021 Effects of kappa carrageenan on human cell lines and genomic DNA 190 Iraqi J Pharm Sci, Vol.30(1) 2021 Effects of kappa carrageenan on human cell lines and genomic DNA 191 Solution of methyl-thiazolyl tetrazolium /MTT. keywords: absorbance; cancer; carrageenan; cell; dna; effect; genomic; growth; human; lines; media; solution; study; water cache: bijps-1229.pdf plain text: bijps-1229.txt item: #61 of 579 id: bijps-1230 author: Abbas, Ban Walid; H. Kathem, Sarmed title: Carvone Attenuates Irinotecan-Induced Intestinal Mucositis and Diarrhea in Mice date: 2021-12-09 words: 3481 flesch: 57 summary: Iraqi J Pharm Sci, Vol.30(2) 2021 62 Table 4. Effect of carvone treatment on diarrhea score in irinotecan-induced intestinal mucositis. Effect of carvone treatment on mice body weight variation in irinotecan-induced intestinal mucositis and diarrhea. keywords: carvone; day; diarrhea; dose; effect; group; irinotecan; mice; model; mucositis; p<0.05; treatment; weight cache: bijps-1230.pdf plain text: bijps-1230.txt item: #62 of 579 id: bijps-1231 author: T. Abduljabbar, Tariq; K. Hadi, Mohammed title: Synthesis, Characterization and Antibacterial Evaluation of Some Coumarin Derivatives date: 2021-06-19 words: 4263 flesch: 58 summary: The various biological activities coumarin derivatives such as anticoagulants and antithrombotics are well known, so that; they are active for the inhibition and treatment of venous and arterial thrombosis (6), a number of coumarin derivatives are also described as antifungal and antibacterial agents (7), antiviral and antitumor agents (8), lipid-lowering agents(9), anti-HIV agents (10), antioxidants and lipoxygenase inhibitor (11). New coumarin derivatives (hydrazones and an amide) were synthesized through multisteps reactions. keywords: acid; activity; antibacterial; chemistry; compounds; coumarin; derivatives; group; journal; reaction; schiff; str; synthesis cache: bijps-1231.pdf plain text: bijps-1231.txt item: #63 of 579 id: bijps-1232 author: A. Mahdi, Farah; Zalzala, Munaf H. title: Protective Effects of Safranal Against Selenite-Induced Cataract in Rats date: 2021-06-19 words: 4973 flesch: 57 summary: Effects of safranal on lens GSH and MDA in lenses of rat pups treated with sodium selenite.. (A) GSH (B) MDA. Effects of safranal on lens NRF2 in lenses of rat pups treated with sodium selenite. keywords: antioxidant; cataract; control; day; group; gsh; lenses; level; nrf2; protein; pups; rat; rat pups; safranal; selenite; sodium cache: bijps-1232.pdf plain text: bijps-1232.txt item: #64 of 579 id: bijps-1233 author: B, NIJA; Rasheed, Arun; Kottaimuthu, A title: Development, Characterization and Pharmacological Investigation of Umbelliferone Conjugates of NSAIDs date: 2021-06-19 words: 4685 flesch: 48 summary: The prodrugs based approaches such as carries linked and bioprecursor approaches have significant role in the drug research and development (7).The drug molecules after the development process may be failed in the required therapeutic activity because of the pharmacokinetic profile, transport profile and solubility etc and prodrug approach successfully overcome the above limitations (8).In the worldwide pharmaceutical market, about ten percentages of the drugs are considered as prodrugs that can effectively overcome the limitations of the NSAIDs. Synthesis of NSAIDs -Antioxidant prodrug: This research work developed the ester prodrug of NSAIDs, MA and FBN by conjugating with the antioxidant, 4-methyl umbelliferone thus mefenamic acid-umbellierone prodrug[MU] and Flurbiprofen - umbelliferone prodrug[FU]. keywords: activity; benzene; brain; ester; figure; group; nsaids; prodrugs; study; test; umbelliferone cache: bijps-1233.pdf plain text: bijps-1233.txt item: #65 of 579 id: bijps-1234 author: Kasim, Ali A.; Ataimish, Ahmed H. title: The Pathological Mechanisms of Obesity-Related Glomerulopathy: A review article date: 2021-06-15 words: 4784 flesch: 50 summary: Chagnac A, Herman M, Zingerman B, Erman A, Rozen-Zvi B, Hirsh J, et al. Fan S, Zhang P, Wang AY, Wang X, Wang L, Li G, et al. keywords: adiponectin; adipose; cells; cytokines; endothelial; glomerulopathy; individuals; inflammation; insulin; journal; kidney; leptin; macrophages; obesity; org; pathogenesis; renal; resistance; tissue cache: bijps-1234.pdf plain text: bijps-1234.txt item: #66 of 579 id: bijps-1235 author: Imani, Asad; Saeedi abo-s-haghi, Mohsen; Alidadi, Mohammad; Shafiei, Elham title: Comparing the Effects of Lavender Oil and Olive Oil Massage on Pain due to Muscular Cramp during Hemodialysis date: 2021-06-15 words: 3208 flesch: 60 summary: Although there are some previous studies about the effect of massage with olive oil or lavender oil on outcomes of patients in different diseases (8-10), but there is no earlier study on comparing the effects of lavender oil and olive oil massage on pain due to muscular cramp in hemodialysis patients. The intervention included flora massage on the lower leg muscles so that the first group received lavender oil massage (10 drops) and the second group received olive oil massage (10 drops) for four weeks. keywords: group; hemodialysis; lavender; lavender oil; massage; oil; olive; olive oil; pain; patients; study cache: bijps-1235.pdf plain text: bijps-1235.txt item: #67 of 579 id: bijps-1239 author: J. Mohammed, Ashwaq; Kadhim, Dheyaa J. title: Knowledge and Perception of Iraqi Pharmacists Towards Biosimilar Medicines date: 2021-06-19 words: 4058 flesch: 56 summary: Regarding pharmacists’ knowledge of biosimilar medicines, the results showed that two questions received the highest percentages of adequate answers: biosimilar medicine requires preclinical and clinical studies (58.0%) and biosimilar medicines require more comprehensive data compared to generic drugs (56.1%). When the respondents were asked about the basic information regarding biosimilar medicines, the results showed that two questions received the highest percentages of adequate answers: The requirement of biosimilar medicine for preclinical and clinical studies (58.0%) and the requirement for more comprehensive data compared to generic drugs (56.1%)ˮ . keywords: biosimilars; c e; e n; e s; knowledge; medicines; pharmacists; r e; reference; study cache: bijps-1239.pdf plain text: bijps-1239.txt item: #68 of 579 id: bijps-1241 author: Ahmed, Zainab H.; H Zalzala, Munaf title: Study The Anti-Asthmatic Activity of Guggulsterone In Ovalbumin-Induced Asthma In Rat date: 2021-12-09 words: 4843 flesch: 55 summary: But guggulsterone treated groups are significant reduce IgE levels through the ability of guggulsterone for suppression of gene expresion of proiflammatory cytokines specifically IL-4 and reducing the release of IgE from inflammatory cells in the lung.(8) & (22) Conclusion Guggulsterone has anti-inflammatory activity on OVA-induced asthma in rats as evident by significant reducing in WBC count in BALF, proinflammatory cytokines (IL-4, IL-5, IL-33 & TNFα) and immune marker IgE antibody in serum. Keywords: Anti-inflammatory activity, Asthma, Guggulsterone, Ovalbumin. keywords: asthma; control group; group; group ii; group v; guggulsterone; ige; iii; levels; rats; sensitization; serum; wbc cache: bijps-1241.pdf plain text: bijps-1241.txt item: #69 of 579 id: bijps-1245 author: Al-Kinani, Zainab A.; H. Ali, Shatha title: Serum Chitotriosidase level as a Novel Biomarker for Therapeutic Monitoring of Nephropathic Cystinosis among the Iraqi children date: 2021-06-19 words: 4426 flesch: 58 summary: Sample collection and preparation From each participant ( patient and control subjects), venous blood sample were collected, but for cystinosis patients the blood venous blood samples were collected after at least 6 hours from taking treatment (Cysteamine). The elevation in serum chitotriosidase activity noticed in cystinosis patients may reflect a particular case of phagocyte activation concerned with cystine accumulation in the lysosome that causes excessive producing and/or releasing of the chitotriosidase. keywords: age; calcium; children; chitotriosidase; control; correlation; creatinine; cystine; cystinosis; disease; gfr; group; level; months; patients; serum cache: bijps-1245.pdf plain text: bijps-1245.txt item: #70 of 579 id: bijps-1249 author: Atiyah, Khansaa Hussein; J Kadhum, Enas title: Isolation and Identification of Phenolic Compounds from Dianthus orientalis Wildly Grown in Iraq. date: 2021-12-11 words: 3391 flesch: 54 summary: This project provides the first comprehensive research done in Iraq and the world to study the phytochemicals and the methods of extraction and isolation of active constituents from Dianthus orientalis wildly grown in Iraq. The compounds were isolated from chloroform fraction were symbolized as C1, C2, C3, C4. https://doi.org/10.31351/vol30iss2pp122-134 Iraqi J Pharm Sci, Vol.30(2) 2021 Dianthus orientalis L. 124 Identification of the isolated phenolic derivatives from ethyl acetate and chloroform fraction of Dianthus orientalis The Compound that symbolized as E1, C1, C2, C3, C4 was identified by several methods including chemical, chromatographic, and spectral methods as: Spraying with 5% ethanolic KOH on TLC plate HPLC analysis HPLC technique (Knuaer, Germany) was applied for the detection of different constituents found in the ethyl acetate, chloroform fractions as flavonoids and phenolic acids, and for identification of the isolated compounds from Dianthus orientalis. keywords: acid; cpd; dianthus; figure; hplc; iraqi; orientalis; spectrum; standard; stretching; vol.30(2 cache: bijps-1249.pdf plain text: bijps-1249.txt item: #71 of 579 id: bijps-1253 author: Aziz, Tavga Ahmed; Hama Amin, Renas Raouf; Ahmed, Zheen Aorahman; Jalal Sleman, Hazhan; Hassan Aziz, Bahez title: Occupational Toxicity and Health Hazards of the Healthcare Providers at Healthcare Facilities in Sulaimani City, Iraq date: 2021-12-09 words: 4826 flesch: 60 summary: نسبةب اللفظية لإلساءات عرضة واالكثر %10.69 نسبةب وحالجر و %13.84 بنسبة لحادةا بالمواد لالصابة عرضة هم االطباء ان الدراسة وبينت كما .%13.84 بنسبة الدم طريق نع المنقولة %5.11 الجسدية للمحن عرضات االكثر مه لمختبراتا keywords: diseases; exposure; hazards; health; healthcare; instructors; nurses; pharmacists; physicians; providers; safety; study; work; workers cache: bijps-1253.pdf plain text: bijps-1253.txt item: #72 of 579 id: bijps-1256 author: Sadeq, Zainab A. title: Microneedle Array Patches: Characterization and in -vitro Evaluation date: 2021-06-15 words: 5933 flesch: 54 summary: Figure 1 shows the type of microneedles drug delivery (31). Materials used in microneedles fabrication Metallic materials Due to its advantages of toughness and mechanical strength, they are widely used in transdermal drug delivery. keywords: approach; array; cancer; characterization; delivery; dissolving; drug; drug delivery; iraqi; journal; materials; microneedle; microneedle patch; pain; patch; patches; penetration; pharm; sci; skin; system; therapy; transdermal cache: bijps-1256.pdf plain text: bijps-1256.txt item: #73 of 579 id: bijps-1259 author: Al-Mayyahi, Rawaa S.; Al-Tumah, Wa'il A. Godaymi title: Genetic Structure, Transmission, Clinical Characteristics, Diagnosis, Treatment and Prevention of Coronavirus Disease 2019 (COVID-19): A Review date: 2021-06-15 words: 6621 flesch: 62 summary: Wang J, Zhao S, Liu M, Zhao Z, Xu Y, Wang P, et al. Cao B, Wang Y, Wen D, Liu W, Wang J, Fan G, et al. keywords: china; clinical; coronavirus; cov-2; covid-19; disease; et al; infection; med; novel; pandemic; patients; review; sars; sci; studies; study; syndrome; transmission; treatment; wang cache: bijps-1259.pdf plain text: bijps-1259.txt item: #74 of 579 id: bijps-1262 author: Ahmed, Kawther K.; Salman, Salema S.; A. Abbas, Wafaa; Alkaisy, Shahad W.; Kathem, Sarmed H. title: Sudden Transition of Pharmacy Education from Traditional to Distance Learning in the Era of COVID-19: Action Steps of a Leading Pharmacy School in Iraq date: 2020-12-31 words: 4715 flesch: 51 summary: Students had joined the class using class code that is initially conveyed to students through contacting class student representatives on their personal phone number. Students enrollment in the virtual classrooms remained at 100% throughout the second semester where students had sensed the real willingness of all faculty and college administration to help them pass these challenging times. keywords: baghdad; college; education; exams; faculty; learning; pharmacy; semester; sina; students; unit; university; uob cache: bijps-1262.pdf plain text: bijps-1262.txt item: #75 of 579 id: bijps-1271 author: Aziz, Tavga A. title: The Role of Ginkgo biloba Extract as Monotherapy in Improving the Outcomes of Patients with Metabolic Syndrome: A Pilot Comparative Study with Metformin date: 2021-06-19 words: 7468 flesch: 63 summary: Iraqi J Pharm Sci, Vol.30(1) 2021 Ginkgo biloba extract and metformin DOI: https://doi.org/10.31351/vol30iss1pp258-269 258 The Role of Ginkgo biloba Extract as Monotherapy in Improving the Outcomes of Patients with Metabolic Syndrome: A Pilot Comparative Study with Metformin Tavga A. Aziz*,1 *Department of Pharmacology and Toxicology, College of Pharmacy, University of Sulaimani, Kurdistan, Iraq Abstract The present study evaluates the effects of Ginkgo biloba extract as monotherapy on the glycemic status, insulin resistance (IR), body mass index (BMI), and visceral adiposity index (VAI), in addition to the inflammatory markers, oxidative status and leptin level in patients with metabolic syndrome in comparison with metformin. Concerning the level of HbA1c, GKB treated Iraqi J Pharm Sci, Vol.30(1) 2021 Ginkgo biloba extract and metformin 261 group produced a non-significant decrease (7%±0.8% vs 7.2%±1%) compared to the baseline value (P=0.6) with no significant change produced by metformin (Figure 2 C). keywords: baseline; biloba; days; e t; extract; g k; ginkgo; gkb; insulin; k b; m e; metabolic; metformin; patients; study; syndrome; treatment; values cache: bijps-1271.pdf plain text: bijps-1271.txt item: #76 of 579 id: bijps-1274 author: Al-Hilli, Faris Ali title: Study of Microbial Contamination of Some Commercial Contact Lens Solutions date: 2021-12-11 words: 3414 flesch: 55 summary: Our study was aimed at identifying microbial contamination of contact lens solutions from students at the College of Pharmacy/ University of Baghdad. Keywords: Contact lens solution, Microbial contamination, Eye infections, Pseudomonas aeruginosa, Staphylococcus epidermidis سات الالصقة التجاريةدراسة التلوث المايكروبي لبعض محاليل العد 1*،فارس علي محمد الحلي العراق . keywords: aeruginosa; bacteria; care; contact; contamination; eye; growth; lens; lenses; microbial; pseudomonas; samples; solutions; staphylococcus; study cache: bijps-1274.pdf plain text: bijps-1274.txt item: #77 of 579 id: bijps-1280 author: Labhade, Sonali Dnyaneshwar; Sharma, Swapnil; Paliwal, Sarvesh; Desai, Shivani title: An Overview of Some Plant Based Products With Hepatoprotective Activity date: 2021-12-09 words: 6146 flesch: 41 summary: Aim: The phytoconstituents studied for their protective effect in liver diseases are reviewed. According to WHO reports, liver diseases lead to approximately 2.4 million deaths per year. keywords: activity; aqueous; carbon; ccl4; damage; diseases; drugs; effect; ethanol; extract; flavonoids; hepatic; hepatoprotective; hepatotoxicity; iraqi; journal; leaves; lipid; liver; paracetamol; pharm; plant; rats; sci; screening; tetrachloride; vol.30(2 cache: bijps-1280.pdf plain text: bijps-1280.txt item: #78 of 579 id: bijps-1281 author: Katsayal, B. S. ; A. Lema, A.; Jibrin, K.; Nuraddeen, W.; M. Alexander, E.; Mohammed, N.H title: Ameliorative Role of Nutraceutical Quercetin and its Derivatives Against Cognitive Impairment Process Induced by Lead Exposure in Drosophila melanogaster(Fruit Fly) date: 2021-12-11 words: 4314 flesch: 50 summary: Up regulation of acetylcholinesterase activity was observed following treatment with quercetin. This study aimed to determine the effect of short-term exposure to acetylcholinesterase activity in relation to oxidative damage associated with Alzheimer's disease pathogenesis and the role of functional foods in improving these oxidative processes. keywords: acetylcholinesterase; activity; alzheimer; binding; disease; drosophila; lead; oxidative; process; quercetin; role; sci; studies cache: bijps-1281.pdf plain text: bijps-1281.txt item: #79 of 579 id: bijps-1284 author: Jihad, Haider Mohammed; J. Al- Akkam, Entidhar title: Formulation and in-vitro Evaluation of Carvedilol Gastroretentive Capsule as (Superporous Hydrogel) date: 2021-12-11 words: 6297 flesch: 57 summary: Stability of carvedilol SPH hybrid capsule The shelf life of carvedilol (F8) capsule was calculated by constructing the Arrhenius plot as shown in figure (7). Dissolution of carvedilol SPH as capsule Dissolution test was done for the selected formula (F8) after encapsulation and compared with that of reference tablet (Carvedilol 6.25 mg tablet/Roche). keywords: agent; capsule; carvedilol; drug; effect; evaluation; formulation; hybrid; hydrogel; journal; pharmaceutical; properties; release; sph; swelling; table; time cache: bijps-1284.pdf plain text: bijps-1284.txt item: #80 of 579 id: bijps-1286 author: Naser, Noor Hatef; Abdul Aziz Alibeg, Ammar title: Exacerbation of COVID 19 in Hypertensive Patients ( A review) date: 2021-12-09 words: 4941 flesch: 58 summary: Although the number of fatal COVID-19 positive patients treated with ACE-Is was more than twice the number of those treated with ARBs, it cannot absolutely conclude the risks or benefits of using such medications, due to Iraqi J Pharm Sci, Vol.30(2) 2021 COVID 19 and hypertension 26 the association of other factors as age, environment, and impact of unidentified comorbidities on outcome with the COVID-19 patients (66,67). Reyfman, P. A., Walter, J. M., Joshi, N., Anekalla, K. R., McQuattie-Pimentel, A. C., Chiu, S. & Verma, R. Single-cell transcriptomic analysis of human lung provides insights into the pathobiology of pulmonary fibrosis. keywords: 2020; ace2; angiotensin; cells; converting; coronavirus; covid-19; disease; enzyme; hypertension; journal; patients; receptor; renin; sars; system; virus cache: bijps-1286.pdf plain text: bijps-1286.txt item: #81 of 579 id: bijps-1287 author: Alkawak, Rasha Saadi Younus; A. Rajab, Nawal title: Lornoxicam-Loaded Cubosomes: - Preparation and In vitro Characterization. date: 2022-06-17 words: 5771 flesch: 59 summary: Aqueous Phase Hydrotrope Stabilizer Oil (O il: sta b iliz e r ) m ix tu r e Drug F o r m u la c o d e P h o sp h a te B u ffe r S o lu tio n p H 7 .4 (g m ) P r o p y le n e g ly c o l (g m ) E th a n o l (g m ) T W E E N 8 0 (g m ) (g m ) P lu r o n ic ® F 1 2 7 (g m ) G M O (g m ) L o r n o x ic a m (g m ) 20 86.4 … 2.5 … 1.82 7.28 4:1 2 F1 20 83.9 … 5 … 1.82 7.28 2 F2 20 80.9 … 8 … 1.82 7.28 2 F3 20 80.9 8 … … 1.82 7.28 2 F4 20 80.9 … 8 1.82 … 7.28 2 F5 10 80.9 … 8 … 1.82 7.28 2 F6 20 86.4 … 2.5 … 3.03 6.07 2:1 2 F7 20 83.9 … 5 … 3.03 6.07 2 F8 20 80.9 … 8 … 3.03 6.07 2 F9 20 80.9 8 … 3.03 6.07 2 F10 20 80.9 … 8 3.03 … 6.07 2 F11 10 80.9 … 8 … 3.03 6.07 2 F12 Iraqi J Pharm Sci, Vol.31(1) 2022 Lornoxicam-loaded cubosomes 146 Variables affecting formulation Different variables were studied to investigate their effects on the prepared LXM- loaded cubosomal dispersion properties. This result may be because 20min agitation had provided enough time for greater penetration of the oil phase and hydrophobic region of the Pluronic® F127 and, for ethanol to coat the cubosomal particles and confers some degree of electric stabilization that may finally lead to a size reduction of the cubosomes, by reducing particle aggregation risk and enhance the retention of drug in cubosomal particles thus increase the cubosomal EE%. keywords: concentration; cubosomal; cubosomes; delivery; dispersions; drug; effect; ethanol; journal; lornoxicam; lxm; nanoparticles; particle; release; results; size; stabilizer cache: bijps-1287.pdf plain text: bijps-1287.txt item: #82 of 579 id: bijps-1288 author: Mohamed Koya, M V; Koya, Saiful; Rahman Hazirah, Abd; Nurul Syahida, Radzuan title: The Difference in Contributing Factors and Costs Associated with Outpatient Refusal to Accept Cardiovascular Medications or Analgesics During Dispensing Process. date: 2021-12-11 words: 4646 flesch: 50 summary: Difference in factors and cost between refused CVD medications and analgesics CVD medicine Analgesic X2 df P-value Age (years) 60.0 (19.0) 63.5 (14.0) 0.136 Gender (n,%) * Male 69 (67.0) 29 (40.3) 12.272 1 <0.05 Female 34 (33.0) 43 (59.7) However, higher cost of refused medication was observed for CVD medicines. keywords: analgesics; cost; cvd; dispensing; drugs; iqr; medication; medicines; patients; prescription; process; refusal cache: bijps-1288.pdf plain text: bijps-1288.txt item: #83 of 579 id: bijps-1291 author: Gh. Jawad, Hani; S. Saleh, Eman; M. Younus, Manal title: Medication Safety in Patients under 18 Years Old; a Retrospective Study based on Iraqi Pharmacovigilance Center Database date: 2020-12-29 words: 4578 flesch: 58 summary: Adverse drug reaction is defined as any harm resulted from the drug itself during medical process journey, while medication errors are any harm resulted from the treatment process rather than the drug or it is the result of the failure in a step of the treatment process and by that it came clear that adverse drug reaction in non-preventable event while medication error is preventable one. %59.43(. مرحلة كتابة الوصفة كانت األكثر غالبيةً بنسبة )49.53%) keywords: disorders; drug; errors; health; iraqi; medication; patients; pharm; pharmacovigilance; reports; safety; study; system; table cache: bijps-1291.pdf plain text: bijps-1291.txt item: #84 of 579 id: bijps-1294 author: Thamer, Aseel Kadhem; Abood, Ahmed Najem title: Preparation and In vitro Characterization of Aceclofenac Nanosuspension (ACNS) for Enhancement of Percutaneous Absorption using Hydrogel Dosage Form date: 2021-12-09 words: 6758 flesch: 58 summary: The PXRD patterns of AC pure drug showed a sharp diffraction peaks indicating the crystalline nature of the drug as a consequence of different arrangement of the molecules in the crystal lattice. Compositions of AC NS.s formulas using different stabilizers at different drug: stabilizer ratios with constant volume of injected organic solution (2 ml). keywords: aceclofenac; characterization; drug; f11; f15; formulas; hydrogel; j pharm; nanosuspension; particle; pharm; polymer; powder; preparation; rate; release; sci; size; solubility; table; values cache: bijps-1294.pdf plain text: bijps-1294.txt item: #85 of 579 id: bijps-1295 author: Merdaw, Maysoon Abdul zahra; Kasim, Ali Abdulhussain; Salih, Mahmood Kahtan title: Seroprevalence of Toxoplasma Gondii in Parkinson’s Disease Iraqi Patients date: 2021-12-09 words: 4032 flesch: 56 summary: Fallahi S, Rostami A, Birjandi M, Zebardast N, Kheirandish F, Spotin A. Parkinson’s disease and Toxoplasma gondii infection: Sero- molecular assess the possible link among patients. Wilking H, Thamm M, Stark K, Aebischer T, Seeber F. Prevalence, incidence estimations, and risk factors of Toxoplasma gondii infection in Germany: a representative, cross-sectional, serological study. keywords: anti; disease; gondii; igg; infection; iraqi; parkinson; patients; pd patients; prevalence; risk; study; table; toxoplasma cache: bijps-1295.pdf plain text: bijps-1295.txt item: #86 of 579 id: bijps-1302 author: Mahdi Mutlak, Qassim; Abdulridha, Manal Khalid; M Abbas Al-Huseini, Laith title: Study the Distribution of Rotavirus Genotypes in Vaccinated and non Vaccinated Children in Babylon Province date: 2021-12-11 words: 5724 flesch: 52 summary: In the developing countries, rotavirus vaccines continued to be frequently assessed due to easy approach to reach target populations with much more strain diversity and immunogenicity of vaccines thatcould decrease immunization program performance (19). It may also explain why children are still susceptible to infection although they were fully vaccinated and why the prevalence of rotavirus gastroenteritis remains high after five years of introducing rotavirus vaccine in the Iraqi national immunization program. keywords: children; diarrhea; gastroenteritis; gel; genotypes; health; infection; min; pcr; primer; rotavirus; strains; study; table; vaccinated; vaccine cache: bijps-1302.pdf plain text: bijps-1302.txt item: #87 of 579 id: bijps-1309 author: Rashad, Sayed; El-Chaghaby, Ghadir title: Algae Bioactive Constituents and Possible Role During COVID-19 Pandemic (A review) date: 2021-12-09 words: 4893 flesch: 52 summary: et al., Antiviral activity of an aqueous extract from the red alga Laurencia obtusa against influenza A and B viruses. Ding L, Chan Gutierrez E and Cheng J, et al. Assessment of continuous fermentative hydrogen and methane co-production using macro- and micro-algae with increasing organic loading rate. keywords: activity; algae; antioxidant; bioactive; cell; compounds; covid-19; et al; food; green; health; marine; microalgae; pharmaceutical; products; red; review; role; sci; species; virus cache: bijps-1309.pdf plain text: bijps-1309.txt item: #88 of 579 id: bijps-1310 author: Abbas, Maha Diekan; Egbe, Solomon Sahoon title: The Seroprevalence of CMV in Women with Bad Obstetric History in Babil/Iraq date: 2021-12-11 words: 3910 flesch: 60 summary: Iraqi J Pharm Sci, Vol.30(2) 2021 Seroprevalence of CMV in women with bad obstetric history in Babil/Iraq DOI: https://doi.org/10.31351/vol30iss2pp106-112 106 Seroprevalence of CMV in Women with Bad Obstetric History in Babil/Iraq Maha Diekan Abbas*,1 and Solomon Egbe** * Department of Biotechnology, College of Biotechnology, Al-Qasim Green University, Al-Qasim, Iraq. Amongst Arab countries, seroprevalence in pregnant women varies from 77.8% (Iraq) to 88% (Jordan) (8, 9). keywords: age; cmv; cytomegalovirus; group; hcmv; history; igg; igm; infection; iraq; seroprevalence; study; women cache: bijps-1310.pdf plain text: bijps-1310.txt item: #89 of 579 id: bijps-1311 author: Mohammed, Samer Imad; Sabry, Aya Thaer; Sabry, Dania Thaer title: Assessment of Health Beliefs Among Iraqi Breast Cancer Patients in Baghdad using either Tamoxifen or Trastuzumab date: 2021-12-11 words: 5501 flesch: 61 summary: This study investigates the beliefs concerning Tamoxifen and Trastuzumab, which are two effective and widely used adjuvant therapies prescribed for breast cancer patients. The findings of the current study have shown that the participants are primarily between 40-60 years of age and that, in line with previous studies(21,28) conducted in Iraq, which showed the peak age frequency for breast cancer patients is between 40- 60. keywords: adjuvant; beliefs; breast; breast cancer; cancer; concern; health; internet; iraqi; jan; medicines; necessity; patients; scale; study; tamoxifen; therapy; trastuzumab; treatment cache: bijps-1311.pdf plain text: bijps-1311.txt item: #90 of 579 id: bijps-1318 author: Jasim, Walaa H.; N. Hamad, Maha title: Extraction and Identification of Phenolic Compounds from the Iraqi Heliotropium europaeum L. plant date: 2021-12-11 words: 3313 flesch: 54 summary: Identification of phenolic compounds in Heliotropium europaeum plant extract Identification of phenolic compounds in Heliotropium europaeum plant extract 1. keywords: acetate; acid; alkaloids; compounds; ethyl; europaeum; figure; fraction; heliotropium; hplc; iraqi; plant; spectrum cache: bijps-1318.pdf plain text: bijps-1318.txt item: #91 of 579 id: bijps-1321 author: Raheema, Dheyaa A; Kassab, Hanan Jalal title: Preparation and in-vitro Evaluation of Secnidazole as Periodontal In-situ Gel for Treatment of Periodontal Disease date: 2022-12-23 words: 7167 flesch: 60 summary: Formulation and evaluation of in situ gels containing clotrimazole for oral candidiasis. Secnidazole vaginal in situ gel formulations were prepared by Karthick et al., using 0.45% of Carbopol 940 with 0.35% HPMC K4M and the 0.35% of Carbopol 940 with 0.35% hydroxy propyl cellulose HPC these formulations also released less than 50% of drug in simulated vaginal fluid at the end of 8 hours (19). keywords: concentration; drug; f30; formulas; formulation; gel; gelation; hpmc; liquid; mucoadhesive; oral; periodontal; pharm; poloxamer; polymer; release; sci; secnidazole; situ; temperature; time cache: bijps-1321.pdf plain text: bijps-1321.txt item: #92 of 579 id: bijps-1331 author: Emad, Hayder; Nazar Abd-Alhammid , Shaimaa title: Improvement of the Solubility and Dissolution Characteristics of Risperidone via Nanosuspension Formulations date: 2022-06-09 words: 6548 flesch: 56 summary: The dispersed formula was tested for the particle size and polydispersity index and the results showed that the particle size was 60.5 nm which is higher than the particle size of the same formula when it was nanosuspension and the PDI of the lyophilized powder was 0.115 which is also higher which was 0.101 The Zeta potential of the lyophilized F13 formula showed -18.96 mv which is similar to the value obtained before lyophilization which indicates the robust formulation by the action of the selected polymer with risperidone drug particles and last durable after freeze-drying. It can be seen that lyophilized F13 formula nanosuspension showed a very characteristic enhancement in drug release when compared to the pure drug with faster and complete drug release within 30 min when compared to the pure drug. keywords: dissolution; drug; f13; figure; formula; journal; lyophilized; methanol; nanosuspension; particle; pharm; powder; release; results; risperidone; size; solubility; solvent; water cache: bijps-1331.pdf plain text: bijps-1331.txt item: #93 of 579 id: bijps-1333 author: Moustafa, Mayada M.; kasim, Ali Abdulhussain; Al-Janabi, Rawaa Dawood title: Association of Age, Parity and Body mass Index with Hemoglobin and Serum Ferritin Levels in Pregnant Women in Baghdad City date: 2021-12-11 words: 3376 flesch: 65 summary: (19) On the other hand, the present study showed that 13.3% (4 of 30) of the non- pregnant participants have mean Hb concentration less than 11 gm/dL. Using the cut-off point of Hb for diagnosis of anemia in non-pregnant women is 11.9 will escalate the percent of anemic non-pregnant participants to 23.3% (7 of 30). The negative correlation of parity with blood Hb concentration was reported in participants in the third trimester of pregnancy (r= -0.270, P=0.048); and between parity and plasma ferritin levels in the second (r= -0.088, P= 0.046) and third (r= -0.398, P=0.029) keywords: blood; correlation; ferritin; levels; parity; participants; pregnancy; serum; study; trimester; women cache: bijps-1333.pdf plain text: bijps-1333.txt item: #94 of 579 id: bijps-1335 author: Zalzala, Munaf Hashim; S. Kareem, Victoria title: The Safranal Effect against Cyclophosphamide-Induced Liver Injury date: 2021-12-11 words: 3852 flesch: 51 summary: # compared with model CP group significant different, (p<0.05). # compared with model CP group significant different, (p<0.05). keywords: control; cyclophosphamide; effect; glutathione; group; level; liver; nrf2; oxidative; rats; safranal; vol cache: bijps-1335.pdf plain text: bijps-1335.txt item: #95 of 579 id: bijps-1343 author: Abdel-GAbbar, Mohammed; Alkot, Mohammed ; Abdel-Moneim, Adel title: Effectiveness of Ombitasvir with Paritaprevir/Ritonavir plus Ribavirin on the Treatment of Naïve Patients with Chronic Hepatitis C Virus Genotype 4 date: 2022-06-12 words: 4560 flesch: 57 summary: Going ahead, the standard of care for chronic HCV patients is a combination of two to four DAAs (9). Discussion Recently, oral DAAs combination regimens are currently achieving viral outcome more than 90% of HCV patients after treatment of 12 weeks (9). keywords: chronic; genotype; gt4; hcv; hepatitis; obv; patients; ptv; rbv; ribavirin; study; treatment; virus; weeks cache: bijps-1343.pdf plain text: bijps-1343.txt item: #96 of 579 id: bijps-1351 author: Ibrahim, Manal Abdulkhaliq; Khudhair, Alaa Radhi; AL-shawi, Nada Najia title: Possible Protective Effects of Omega 3, Diazepam and their Combination Against Yohimbine-Induced Clonic Seizure in Mice: Comparative Study date: 2021-12-12 words: 5240 flesch: 66 summary: Table 1 and figure 3. Iraqi J Pharm Sci, Vol.30(2) 202 Omega-3 diazepam as antiepileptic drug against yohimbine induced clonic seizure in mice 244 Observation the number of clonic seizures at 90-120min in the studied groups Table 1 and figure 4 showed that there were significant different (P<0.05) in the number of clonic seizure at 90-120min in Group I (yohimbine- treated) mice (6.5±0.341) compared to that in Group II (Diazepam +yohimbine HCl) (0±0) and Group IV (omega 3 fatty acids +Diazepam + yohimbine HCl) mice (0±0); but there were non- significant (P>0.05) in the number of clonic seizure at 90-120min in Group I (6.5±0.341) compared to that in Group III mice (5.66±0.494). In addition, table 1 and figure 4 showed that there were significant difference (P<0.05) in the number of clonic seizure at 90-120min in Group III (Omega 3 fatty acids +yohimbine HCl) (5.66±0.494) compared to that in Group IV mice (omega 3 fatty acids +Diazepam +yohimbine HCl) (0±0). keywords: acids; clonic; diazepam; difference; epilepsy; fatty; group; group iii; hcl; iii; mice; number; omega; seizures; yohimbine; yohimbine hcl cache: bijps-1351.pdf plain text: bijps-1351.txt item: #97 of 579 id: bijps-1361 author: Mikhael, Ehab Mudher title: Community Pharmacists' Attitudes and Practice in the Management of Minor Ailments date: 2021-12-11 words: 3761 flesch: 65 summary: Keywords: Minor ailments, Community pharmacists, Attitudes and practice. Despite all these benefits for management of minor ailments by community pharmacists, this job may be dangerous if inappropriately performed. keywords: ailments; cases; community; iraqi; management; medication; patient; pharmacists; pharmacy; study; years cache: bijps-1361.pdf plain text: bijps-1361.txt item: #98 of 579 id: bijps-1371 author: Sahib, Hayder B; Muhammad Hamid, Zeena title: The Acute Toxicity of Rutin in Mice date: 2021-12-12 words: 4943 flesch: 58 summary: 6±0.28 4.95±0.35 6.45±0.77 6.3±0.28 5.95±0.07 5.2±0.28 5.05±0.35 HGB g/dl 14.25±0.77 13.7±0.84 13.9±0.14 14±1.41 13.35±0.49 13.4±0.56 13.5±0.70 The results of Histopathological examination of vital organs after staining with Hematoxylin and eosin (H and E) stain revealed there are no significant histopathological changes in tissue (p˃0.05) of rutin treated mice at dose 1.25, 0.625 and 0.312 g/kg for male and female mice when compare with the tissue of control group as shown in the following figures: Figure 5. Table 1.Sign observed after rutin administration to male mice dose gm/kg T/M The period at sign observed sign of toxicity No.of mice dead at this period 5 5/5 5 mint_15 mint Clonic convulsion, loss of gait, miosis, muscular fasciculation , tachycardia, dyspnea, lacrimation, death(+++) 2 15mint_4hrs hypoactivity, asthenia, abdominal contract, diarrhea, atypical locomotion, back limbs failling, bardycardia, dyspnea, death(++) 2 4hrs_6hrs bradycardia, atypical locomation, piloerection, asthenia ,dyspnea and death(+) 1 2.5 5/5 5 mint_15 mint clonic convulsion, loss of gait, miosis, muscular fasculation, tachycardia, dyspnea ,lacrimation, death(+++) 2 15mint_4hrs hypoactivity, asthenia ,abdominal contract, diarrhea, atypical locomotion ,back limbs failling , bardycardia, dyspnea, death(++) 1 4hrs_6hrs bradycardia,atypical locomation,piloerection,asthenia,dyspnea and death(+) 1 24-48 hrs. keywords: acute; asthenia; control; control group; dose; dyspnea; female; group; hypoactivity; iraqi; mice; pharm; rutin; sci; sign; study; toxicity cache: bijps-1371.pdf plain text: bijps-1371.txt item: #99 of 579 id: bijps-1376 author: Al-Janabi, Ismail Ibrahim title: G Protein-Coupled Receptors: Undervalued Targets for Cancer Therapy date: 2022-06-09 words: 12164 flesch: 54 summary: Cancer cells hijack these communication networks to their proliferative advantage. Cancer cells are capable of deregulating these chemical signals and divide out of the strict overall control (51). keywords: acid; activation; adhesion; cancer; cancer cells; cells; chemokine; class; complex; cxcr4; drugs; family; frizzled; g protein; gpcrs; growth; hormone; iraqi; ligand; mutations; nature; number; pathways; pharm; progression; proliferation; protein; receptors; role; sci; signalling; smo; targeting; targets; thyroid; treatment; tumour; types; vol.31(1 cache: bijps-1376.pdf plain text: bijps-1376.txt item: #100 of 579 id: bijps-1384 author: Tamri, Pari; Pourmoslemi, Shabnam; Moradkhani, Shirin; Foroughinia, Sahar title: Evaluation of Synergistic Antibacterial Effect of Combined Scrophularia striata Extract and Antibiotics Against Pseudomonas aeruginosa and Methicillin -Resistant Staphylococcus aureus date: 2021-12-11 words: 3689 flesch: 46 summary: This test determines the impact on antibacterial activity of the combination of Iraqi J Pharm Sci, Vol.30(2) 2021 The augmentation of antibacterial activity of Vancomycin by SSE could be a result of SSE antibacterial activity or modifying the mechanism of acquired resistance. keywords: activity; aeruginosa; antibacterial; antibiotics; extract; mrsa; sse; striata cache: bijps-1384.pdf plain text: bijps-1384.txt item: #101 of 579 id: bijps-1394 author: Husni, Muhammad Ali; Nugroho, Akhmad Kharis; Sulaiman, Teuku Nanda Saifullah; Fakhrudin, Nanang title: Microencapsulation of Green Coffee Beans (Coffea canephora) Extract using Whey Protein Concentrate date: 2022-06-09 words: 6291 flesch: 53 summary: The use of maltodextrin as a wall material in GCB extract microencapsulation increased the antioxidant capacity from 414.8 to 425.9 μmol Trolox/g(31); whereas the use of glucomannan as a wall material in the microencapsulation of roasted coffee extract increased DPPH scavenging activity from 619.21 to 813.3 µM Trolox/g(35). In addition, the difference in the type of coffee extract also contributed to the variability of caffein content. keywords: activity; caffeine; cga; coffee; compounds; content; drying; extract; gcb; green; https://doi.org/10.31351/vol31iss1pp20-31; microcapsule; microencapsulation; particle; process; spray; wpc cache: bijps-1394.pdf plain text: bijps-1394.txt item: #102 of 579 id: bijps-1411 author: Alsaedi, Areej Atheer; Kadhim, Dheyaa j.; Younus, Manal M. title: Gender Differences in Adverse Drug Reactions Among Adult Patients Reported to the Iraqi Pharmacovigilance Center date: 2021-12-12 words: 6970 flesch: 62 summary: من األعراض الجانبية فيما إذا ما قورنت النسبة بالفئة العمرية المماثلة م % في 22.6% Abstract For many years it was argued that there may be a gender differences in adverse drug reactions (ADRs). keywords: adrs; differences; disorders; drug; females; gender; group; iraqi; level; percentage; reactions; reports; study; system; table; total; value cache: bijps-1411.pdf plain text: bijps-1411.txt item: #103 of 579 id: bijps-1412 author: Hassan, Elaaf Fadhil; Kadhim, Dheyaa j; Younus, Manal m title: Safety Profile of Biological Drugs in Clinical Practice: A Retrospective Pharmacovigilance Study date: 2022-06-09 words: 6703 flesch: 53 summary: Rituximab was found to be the drug with the highest number of adverse drug reactions with 241 adverse drug reactions (26.81% out of total adverse drug reactions). Regarding severity of adverse drug reactions, the majority of adverse drug reactions were observed in moderate levels [Level 4 (26%), and Level 3 (18%)]. keywords: adrs; age; biological; disorders; drug; gender; iraqi; level; number; patients; pharmacovigilance; profile; reactions; reports; safety; seriousness; severity; study; table; total cache: bijps-1412.pdf plain text: bijps-1412.txt item: #104 of 579 id: bijps-1415 author: Jaafar, Noor Sabah; Jaafar, Iman S; Noori, Zainab S title: Cressa cretica Pharmacognosy, and Pharmacology (A review ) date: 2021-12-09 words: 6196 flesch: 58 summary: The evaluation of ethyl acetate fraction of Cressa cretica effect on mitotic index and micronucleous Frequency in Mice. Abstract Cressa cretica (Shuwwayl) is a halophytic that belongs to Convolvulaceae, naturally grown in the Middle East including Iraq. keywords: acetate; acid; antioxidant; c. cretica; control; cressa; cressa cretica; cretica; dose; effect; ethyl; extract; figure; fractions; group; iraqi; methanolic; parts; pharm; plant; review; sci cache: bijps-1415.pdf plain text: bijps-1415.txt item: #105 of 579 id: bijps-1418 author: Al-Assaf, Issa; Khazem, Mays title: Phytochemical screening and Free radicals scavenging activity of leaves of Echinops polyceras Boiss. grown in Syria date: 2022-06-23 words: 4805 flesch: 55 summary: Scanning of extract solution (13): 1g of the aqueous extract was also dissolved with distilled water in a volumetric flask (100 ml), then 1 ml of the solution was transferred into another 100 ml volumetric flask with 10 ml of 0.1 N of hydrochloric acid, then distilled water was used to complete the rest volume to 100 ml. To 5 ml of ethanolic extract, 0.5 g of magnesium metal and 1 ml of concentrated HCl were added. keywords: acid; activity; content; echinops; extract; flavonoids; free; leaves; polyceras; quercetin; radicals; solution; test cache: bijps-1418.pdf plain text: bijps-1418.txt item: #106 of 579 id: bijps-1421 author: Abdul-Jabbar, Maha Amer; J. Kadhim, Dheyaa title: Adherence to Different Treatment Modalities among Patients on Maintenance Hemodialysis date: 2022-06-12 words: 4676 flesch: 55 summary: Conclusions The current study showed that the overall adherence of HD patients to different treatment modalities was less than optimum with fluid and diet adherence representing the most challenging aspects in the health care of hemodialysis patients. The recorded prevalence of non-adherence among HD patients varies widely, ranging from 22%-74% (9, 10). keywords: adherence; disease; esrd; fluid; hemodialysis; medications; modalities; patients; restriction; score; study; table; total; treatment; الكلى cache: bijps-1421.pdf plain text: bijps-1421.txt item: #107 of 579 id: bijps-1425 author: Yempada, Praveena; Marrisetti, Arya Lakshmi; Battu, Ganga Rao title: In silico, In vitro studies of Anti-Oxidant and Anthelminthic Abilities of Phytoconstituents from Rhynchosia cana (Wild.) DC. date: 2022-06-23 words: 7065 flesch: 60 summary: Results Phytochemical screening Preliminary phytochemical screening of various extracts of R. cana extracts revealed the presence of several phytoconstituents listed in Table 1. The molecular docking analysis was then carried out to establish compounds with good efficiency for anti-oxidant activity against the catalase, superoxide dismutase, glutathione-S-transferase, glutathione reductase, glutathione peroxidase and tubulin- colchicine enzyme for anthelmintic activity. keywords: acid; activity; anthelmintic; anti; cana; compounds; docking; extracts; interactions; kcal; ligands; mol; pharm; rhynchosia; rhynchosia cana; sci; silico; studies; table cache: bijps-1425.pdf plain text: bijps-1425.txt item: #108 of 579 id: bijps-1426 author: Mohammed, Zahraa Sami; Hossain, Ahmed Obaid title: Study the Effects of Anadrol Overdose on Liver Function in Male Rats date: 2022-06-12 words: 3844 flesch: 53 summary: Photomicrograph of rat liver section of anadrol 10mg/kg group shows mild centrilobular inflammation (blue arrow) surrounded by normal hepatocyte (yellow arow), H&E stain 40 X. Anadrol 20 mg group Anadrol 20 mg group hepatic tissue Focal and multifocal Central to midzonal lobular region. Photomicrograph of rat liver section of anadrol 20mg / kg group shows moderate centrilobular inflammation (blue arrow) with increased cytoplasmic eosinophilia (yellow arrow) of surrounding hepatocyte, H&E stain 40 X. Anadrol 30 mg group Anadrol 30 mg group hepatic tissue Moderate to severe multifocal (centrilobular- midzonal-portal region) are necrotic. keywords: alt; anadrol; ast; changes; control; function; group; injury; liver; male; mg group; rats; study; tissue cache: bijps-1426.pdf plain text: bijps-1426.txt item: #109 of 579 id: bijps-1435 author: Alhakeem, Zainab; Kaisar Fakree , Najwan ; AbdulSamad Muhsen, Ahmed ; Majeed Hashim, Nuha title: Some Pro and Anti-Inflammatory Cytokines in Children with Tonsillitis and their Correlations with Vitamin D Deficiency date: 2022-06-18 words: 4435 flesch: 53 summary: Results Serum levels of different parameters were measured using ELISA technique in all studied groups and the results revealed a significant decrease (P<0.05) in Vitamin D level in both acute and chronic group (16.38 and 14.13 ng/ml respectively) as compared to the control group (30.91 ng/ml) (Table 1) (Figure 1). This study investigates the correlation between vitamin D level and inflammatory cytokines in children with tonsillitis. keywords: acute; children; chronic; control; correlation; cytokines; groups; il-10; il-4; levels; tnfα; tonsillitis; vitamin; vitamin d cache: bijps-1435.pdf plain text: bijps-1435.txt item: #110 of 579 id: bijps-1441 author: Al-Jumaili, Ali Azeez; Fahmi, Hiba Leith title: Understanding the Experience of Hospital Pharmacists with the Effectiveness, Safety, Adverse Drug Reaction Reporting and Interchangeability of Biopharmaceutical Medicines date: 2022-06-12 words: 8020 flesch: 39 summary: Keywords: Biological medicines, Biosimilar medicines, Biopharmaceutical medicines, Hospital pharmacists, effectiveness, safety, Interchangeability, Perceptions, Qualitative study. Iraq Abstract The study objectives were to 1) explore the real-world experience of hospital pharmacists with the differences in effectiveness safety, and interchangeability between biosimilar medicines and their reference biological counterparts, 2) reveal pharmacist recommendations to enhance the safety of biopharmaceutical medicines in public hospitals. keywords: adrs; biopharmaceutical; biosimilar; data; effectiveness; experience; hospital; interviews; iqphvc; iraqi; medications; medicines; patients; pharmacists; reference; reporting; reports; safety; years cache: bijps-1441.pdf plain text: bijps-1441.txt item: #111 of 579 id: bijps-1443 author: Drais, Hayder Kadhim; Abbas Hussein, Ahmed title: Investigation of Lipid Polymer Hybrid Nanocarriers for Oral Felodipine Delivery: Formulation, Method, In-vitro and Ex-vivo Evaluation date: 2022-06-12 words: 6235 flesch: 55 summary: The comparability profile of felodipine release for formulas have similar concentration with a different preparation method was explained as following: HF1> HF4, HF2> HF5 and HF3> HF6 while the comparability profile of the felodipine release from felodipine LPHNs formulations (HF1-HF6) and the pure drug suspension explains in the following descending order: HF2 > HF 3 > HF 1 > HF 6 > HF 5 > HF 4 > pure drug suspension. The microwave-based method is a very successful technique in preparing felodipine LPHNs formulations (HF1-HF3) and prepotent to the SESET. keywords: buffer; drug; felodipine; felodipine lphns; formulations; hf1; hf3; hf4; hf6; lipid; lphns; lphns formulations; method; microwave; polysorbate; release; suspension cache: bijps-1443.pdf plain text: bijps-1443.txt item: #112 of 579 id: bijps-1445 author: Abd, Maryam Rasheed; Faris Hassan, Ali title: The Ameliorative Effect of Fimasartan against Methotrexate-Induced Nephrotoxicity in Rats date: 2022-06-12 words: 5385 flesch: 58 summary: Rats received sterile water for injection in a volume of (6 ml/kg) intraperitoneally (21) for 8 days starting from day 1. Group Ⅱ (MTX group): Rats received a single dose of MTX (20 mg/kg) intraperitoneally on day 1, followed by daily intraperitoneal (IP) administration of sterile water for injection (6 ml/kg) for 7 days starting from day 2 (22). Likewise, when we compare among MTX group, α-Toc group, and MTX plus α-Toc group, statistically significant differences between them can be noticed (P<0.05), as shown in (Table 3) and (Figure 5). keywords: day; differences; fimasartan; fms group; group; injury; kidney; levels; methotrexate; mtx; mtx group; p<0.05; rats; renal; toc group cache: bijps-1445.pdf plain text: bijps-1445.txt item: #113 of 579 id: bijps-1450 author: Hantoosh, Saad Muslim title: Nasal Carriage of Vancomycin- and Methicillin-Resistant Staphylococcus aureus among Intermediate Students of Urban and Rural Schools of Muthanna Province in Iraq date: 2022-06-12 words: 4667 flesch: 57 summary: MRSA/VRSA nasal carriage of school students 103 For an extended period, methicillin-resistant S. aureus has been recognized as a pathogen associated with healthcare settings, but in the 1990s, community-associated infections of MRSA had emerged. MRSA/VRSA nasal carriage of school students 104 Table 1.Sociodemographic characteristics of 300 elementary school participants in Al-Muthanna province keywords: aureus; carriage; health; infections; iraqi; isolates; journal; males; medical; medication; mrsa; nasal; resistance; rural; schools; staphylococcus; students; study cache: bijps-1450.pdf plain text: bijps-1450.txt item: #114 of 579 id: bijps-1453 author: B. Hamed, Sumaya; N. Abd Alhammid, Shaimaa title: Formulation and Characterization of Felodipine as an Oral Nanoemulsions date: 2021-06-15 words: 4395 flesch: 61 summary: Results of characterization showed that felodipine nanoemulsion (F3) with (oleic acid 10%) ,(Smix 60% of tween80 :ethanol in a ratio of 3:1), (DDW 30%) was selected as the best formula, since it has a particle size of (17.01)nm, low PDI (0.392), zeta potential (-22.34mV), good dilution without drug precipitation , higher percent of drug content (99.098%) with acceptable viscosity , and complete release of the drug after (45 min.) with significantly higher (P<0.05) dissolution rate in comparison with the pure drug powder. Preparation of felodipine nanoemulsion Different o/w nano emulsion formulations (Table 2) were prepared using the Smix and oil ratios according to pseudo-ternary phase diagrams. keywords: acid; dissolution; drug; ethanol; felodipine; formula; nanoemulsion; oil; oleic; pharm; phase; sci; size; smix; solubility; surfactant; tween cache: bijps-1453.pdf plain text: bijps-1453.txt item: #115 of 579 id: bijps-1458 author: Hameed, Susan Tofiq; Mudhafar Anwer, Zinah title: Using Phone Calls to Promote Community Pharmacist Counselling during COVID-19 Pandemic in Baghdad, Iraq date: 2022-06-12 words: 5073 flesch: 68 summary: Characteristics N % Number of medications <4 194 78.9 ≥4 52 21.1 Chronic disease Diabetes 185 75.2 Hypertension 24 9.8 Diabetes and hypertension 37 15.0 Duration of disease Five years 84 34.1 Iraqi J Pharm Sci, Vol.31(1) 2022 Using phone calls for pharmaceutical counseling for chronic diseases 112 Table 3.The domains of the participant questions Questions N % 1. Sociodemographic characteristics of participants Characteristics N % Gender Female 154 62.6 Male 92 37.4 Age group <15* 13 5.3 15*-24 29 11.8 25-34 38 15.4 35-44 59 24.0 45-54 50 20.3 55-64 45 18.3 ≥65 12 4.9 Education Primary school or less 43 17.4 Intermediate school 70 28.4 Secondary school 68 27.6 College or higher 65 26.4 Occupation Employed (Government employee, self-employee) 100 40.7 unemployed (housewife, out of a job, retired) 146 59.3 Resident Urban 193 78.5 Rural 53 21.5 keywords: calls; chronic; counseling; diabetes; disease; domain; drug; patients; pharmaceutical; phone; questions; study; table; yes cache: bijps-1458.pdf plain text: bijps-1458.txt item: #116 of 579 id: bijps-1460 author: Abushammala, Issam Mohammed title: Effect of Oral Administration of Valerian Extract at Different Doses on Pharmacokinetic Parameters of Carbamazepine in Rabbits date: 2022-06-18 words: 3332 flesch: 66 summary: Carbamazepine has a narrow range of therapy and might show drug interaction with several drugs either by induction or inhibition of CYP3A4. Subjects and Methods Animals Eighteen New Zealand strains of adult male rabbits weighted (3.1-3.4 kg) and aged (7-9) months were divided into three groups (six subjects in each) and were used as animal model for the current drug – herb PK interaction study. keywords: carbamazepine; cbz; differences; drug; group; interaction; parameters; rabbits; second; study; val; valerian cache: bijps-1460.pdf plain text: bijps-1460.txt item: #117 of 579 id: bijps-1463 author: Hassan, Zahra; Hassan, Tuka; Abu-Rghif, Ahmed title: Evaluation the Effectiveness of Phenolic Compound of Salvia Frigida on Induced Atopic Dermatitis in Experimental Mice date: 2022-06-17 words: 6261 flesch: 57 summary: Comparison between non treated atopic dermatitis induced group with each of Salvia frigida and Tacrolimus treated groups (by one way ANOVA test) regarding WBC, Eosinophil, serum IgE, and skin tissue homogenate of IL-4 and IL-13. Comparison between non treated atopic dermatitis induced group with each of Salvia frigida and Tacrolimus treated groups (by one way ANOVA test) regarding WBC, Eosinophil, serum IgE, and skin tissue homogenate of IL-4 and IL-13. keywords: 0.001; atopic; atopic dermatitis; compound; dermatitis; frigida; group; ige; il-13; mice; non; salvia; salvia frigida; score; severity; skin; tacrolimus; treated; wbc cache: bijps-1463.pdf plain text: bijps-1463.txt item: #118 of 579 id: bijps-1465 author: Habeeb, Duaa Mohammed; Zinah M. Anwer title: Descriptive, Prospective Observational Study- Studying Possible Prediction Factors for Disease Severity and Progression among a Sample of COVD 19 Patients in Iraq date: 2022-12-23 words: 5727 flesch: 59 summary: The association between the individual chronic medication and the severity of COVID-19 disease. And with AshaqAli1 (2021) studied Myoglobin and C reactive protein are efficient and reliable early predictors of COVID 19 associated mortality and reported that CRP was specific risk factors related to mortality and highly correlated to organ failure in COVID-19 disease (28). keywords: age; coronavirus; count; covid-19; disease; factors; iraqi; mortality; need; patients; progression; protein; risk; severity; study; use; value cache: bijps-1465.pdf plain text: bijps-1465.txt item: #119 of 579 id: bijps-1467 author: Bhattacharya, Sankha title: Development of 5-FU Loaded poly lactic-co-glycolic acid Nanoparticles for Treatment of Lung Cancer date: 2022-06-17 words: 8122 flesch: 61 summary: Nanoparticles with an 18-minute sonication time was found to be more cytotoxic than those with PLGA nanoparticles containing 12% polyvinyl alcohol. As per, the recent study conducted by Aditya Nath Pandey et al.,(2020) (51) 5-FU can be encapsulated in PLGA nanoparticles, which could have potential anti-cancer effects against HT-29 and COLO-205 colorectal cancer cell lines. keywords: cancer; cell; delivery; dlg; drug; kda; loaded; lung; min; nanoparticles; plga; pva; release; size; sonication; time; weight cache: bijps-1467.pdf plain text: bijps-1467.txt item: #120 of 579 id: bijps-1474 author: Sameer Yonus, Samara ; Ahmed AlKataan, Muhammad Abdulgafoor title: Mitochondrial Copies Number and Some Renal Function Biomarkers in Type 2 Diabetes Mellitus on Metformin date: 2022-12-23 words: 3441 flesch: 64 summary: T2DM patients have high blood sugar and insulin resistance and both condition associated with elevated ROS formation that intern significantly affect mt-DNA copies number.(19 ) According to this study, the number of mitochondrial copies significantly decreased in T2DM patients by 32.8 times compared to the control group (p 0.01). keywords: acid; control; creatinine; diabetes; diabetic; hba1c; mellitus; metformin; number; patients; serum; type; uric cache: bijps-1474.pdf plain text: bijps-1474.txt item: #121 of 579 id: bijps-1481 author: Mohammed, Ali Haider; Hassan, Bassam Abdul Rasool; Suhaimi, Azyyati Mohd; Blebil, Ali; Dujaili, Juman; Wayyes, Abdulrasool M. title: Factors Impacting Hypertension Awareness among Hypertensive Population: A Quantitative Study in a Tertiary Care Hospital in Malaysia date: 2022-06-18 words: 5590 flesch: 57 summary: Abdulrasool M. Wayyes** *School of Pharmacy, Monash University Malaysia, Jalan Lagoon Selatan, 47500 Bandar Sunway, Selangor, Malaysia **Department of Pharmacy, Al Rafidain University College, Baghdad, Iraq **Department of Pharmacy Practice, Faculty of Pharmacy, Universiti Teknologi MARA, Puncak Alam Campus, 42300 Bandar Puncak Alam, Selangor, Malaysia Abstract There are obstacles to high levels of hypertension awareness that are embedded in gender, income and lifestyle habits which need to be addressed. Received: 15/7/ 2021 Accepted: 17/7 /2021 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol31iss1pp233-240 Iraqi J Pharm Sci, Vol.31(1) 2022 Factors affecting hypertension awareness 234 Introduction Hypertension is one of the major risk factors to cardiovascular failure and mortality (1). keywords: awareness; care; factors; health; hypertension; hypertension awareness; information; journal; level; malaysia; participants; patients; population; public; respondents; risk; study cache: bijps-1481.pdf plain text: bijps-1481.txt item: #122 of 579 id: bijps-1487 author: AM. Jawad , Rehab ; Sahib, Hayder B title: Estimation the Safety of Parenteral Resveratrol in Mice date: 2022-06-17 words: 4737 flesch: 65 summary: where MMD0, CMMD0, FMD0, CFMD0, MMD7, CMMD7, FMD7, CFMD7, MMD14, CMMD14, FMD14, and CFMD14 represent, male mice day zero, its control, female mice day zero, its control, male mice day seven, its control, female mice day seven, its control, male mice day fourteen, its control, female mice day fourteen and Its control, respectively. where MMD0, CMMD0, FMD0, CFMD0, MMD7, CMMD7, FMD7, CFMD7, MMD14, CMMD14, FMD14, and CFMD14 represent, male mice day zero, its control, female mice day zero, its control, male mice day seven, its control, female mice day seven, its control, male mice day fourteen, its control, female mice day fourteen and Its control, respectively. keywords: + +; acute; changes; control; day; death; dose; effect; female; group; hypoactivity; male; mice; mice day; resveratrol; toxicity cache: bijps-1487.pdf plain text: bijps-1487.txt item: #123 of 579 id: bijps-1490 author: Mohammed, Ali Haider; Muthanna, Fares Mohammed Saeed; Hassan, Bassam Abdul Rasool; Karuppannan, Mahmathi; Wayyes, Abdulrasool M. title: Impact and Association of Anaemia Severity and Its Treatment With Quality of Life of Breast Cancer Patients in Malaysia date: 2022-12-23 words: 5874 flesch: 59 summary: Regarding QOL and breast cancer patient, a study has been conducted in China in 2016 to detect the effects of social support, financial situation and clinical factors on breast cancer patients, to evaluate QOL. Hence, the current study aimed to detect and evaluate treatment given to breast cancer patient suffering from anaemia and to determine its impact on cancer patients QOL. keywords: anaemia; breast; breast cancer; cancer; cancer patients; follow; iron; journal; life; patients; qol; quality; study; treatment cache: bijps-1490.pdf plain text: bijps-1490.txt item: #124 of 579 id: bijps-1499 author: Hassoon, Sara Saad; Saleh Abbas , Ibrahim ; Abdul Razzaq Mshimesh, Bahir title: Isolation of beta-sitosterol and evaluation of antioxidant Activity of Iraqi Campsis grandiflora flowers. date: 2022-06-18 words: 4476 flesch: 56 summary: The total flavonoids content of Iraqi C.grandiflora was estimated by using the aluminium chloride colourimetric method(20) in which 1ml of plant EAE extract (100 mcg/ml) or standard quercetin solution (5,10,20,40,60,80 and 100 mcg/ml ) was mixed with 4ml of distilled water and then adding 0.3 ml of sodium nitrite solution (5%) to all test tubes. 22/9 /2021 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol31iss1pp176-183 Iraqi J Pharm Sci, Vol.31(1) 2022 keywords: abts; acetate; acid; activity; antioxidant; assay; c.grandiflora; dpph; eae; extract; flowers; hexane; iraqi; mcg; sci; sitosterol cache: bijps-1499.pdf plain text: bijps-1499.txt item: #125 of 579 id: bijps-1500 author: Yadav, Meena; Sharma, Poonam title: Plant-derived Molecules for the Treatment of Tuberculosis: A Review date: 2022-12-23 words: 7840 flesch: 48 summary: They are either antimycobacterial or act synergistically with anti-TB drugs and reduce their adverse effects. The patients may experience one or more side effects depending on the dosage of anti-TB drugs (12). keywords: acid; activity; antimycobacterial; cells; damage; drugs; effects; h37rv; hepatotoxicity; immune; iraqi; isoniazid; liver; m.tb; mdr; med; molecules; mtb; mycobacterium; pharm; phytochemicals; plant; potential; sci; strain; stress; treatment; tuberculosis cache: bijps-1500.pdf plain text: bijps-1500.txt item: #126 of 579 id: bijps-1501 author: Ahmed Azad Kareem ; Aziz, Tavga Ahmed; Zheen Aorahman Ahmed; Hemn Hassan Othman ; Saad Abdulrahman Hussain title: Anti-Inflammatory Activity of Gingko Biloba Extract in Cotton Pellet-Induced Granuloma in Rats: A comparative Study with Prednisolone and Dexamethasone date: 2022-06-18 words: 5215 flesch: 57 summary: Therefore, we need to seek new medications that possess anti-inflammatory activity with minimum unwanted reactions. 3. GKB group: Treated with GKB (200mg/kg/day) orally for the study of anti-inflammatory activity of GKB in rat model cotton pellet-induced granuloma. keywords: activity; biloba; control; cotton; dexamethasone; extract; exudate; ginkgo; gkb; granuloma; group; inflammation; inflammatory; prednisolone; tissue cache: bijps-1501.pdf plain text: bijps-1501.txt item: #127 of 579 id: bijps-1506 author: F.Mohammed, Farqid; Subhi Abed, Sadeem Subhi Abed title: Flow Injection Spectrophotometric Technique for Determining of Genistein in Pure and Supplements Formulations Through Diazotization Coupling Reaction date: 2022-06-23 words: 3157 flesch: 53 summary: Iraqi J Pharm Sci, Vol.31(1) 2022 Determination of genistein by coupling reaction 280 After chemical and physical variables have been optimized the calibration graph was performed to test the linearity of GEN concentration (triplicate injections). Calibration curve was constructed over different GEN concentrations with a linearity range of 10-100 µg/mL and a detection limit of 1.51 μg/mL. For the FIA technique, all analytical factors were analyzed and optimized. keywords: analysis; coupling; determination; figure; flow; gen; genistein; injection; method; reaction; sci cache: bijps-1506.pdf plain text: bijps-1506.txt item: #128 of 579 id: bijps-1507 author: Shri Chengama Raju , Nisha ; Wing Kei, Wong title: Anti-Angiogenic Screening of Moringa Oleifera Leaves Extract Using Chorioallantonic Membrane Assay date: 2022-06-18 words: 3884 flesch: 57 summary: Preparation of treatment solutions The study was conducted among six treatment groups which included positive control (sunitinib), negative control (phosphate buffer saline), aqueous Moringa oleifera extract (50% and 100%) and methanolic Moringa oleifera extract (50% and 100%). Analgesic activity of seeds of Moringa oleifera Lam. keywords: angiogenesis; anti; blood; cam; extract; hours; leaves; moringa; moringa oleifera; oleifera; test; treatment; vessels cache: bijps-1507.pdf plain text: bijps-1507.txt item: #129 of 579 id: bijps-1509 author: Al-Dulaimi, Amal Fakhrulddin; Al-Kotaji, Myasar Mohammed; Abachi, Faris Thanoon title: Development of novel paracetamol/naproxen co-crystals with an improvement in naproxen solubility. date: 2022-06-18 words: 6497 flesch: 62 summary: However, further diagnostic techniques are needed to confirm co-crystals formation. In addition, a solubility study was conducted to compare the water solubility of pure paracetamol and naproxen with co-crystals solubility. keywords: cm-1; crystals; drug; figure; formation; iraqi; mixture; naproxen; naproxen co; paracetamol; pharm; sci; solubility; tga; vol.31(1 cache: bijps-1509.pdf plain text: bijps-1509.txt item: #130 of 579 id: bijps-1511 author: Ahmed AlKataan, Muhammad Abdulgafoor; Abdullah Shakir Mahmood; Aseel S. Al Mallakhdeer title: Evaluation of the Detrimental Effects of some Antiepileptic Drugs on the Height and Weight of Children with Epilepsy date: 2022-06-18 words: 2807 flesch: 65 summary: The proliferation of epiphyseal growth plate results from complex interactions between hormones and growth factors, which may directly or indirectly affect the serum levels of calcium and the condition of those cells, leading to final stature (4). This study aimed to evaluate the effect of some antiepileptic drugs on growth (height and weight) in children with epilepsy. keywords: acid; antiepileptic; bmi; carbamazepine; children; drugs; epilepsy; growth; months; patients; seizures; therapy; valproic cache: bijps-1511.pdf plain text: bijps-1511.txt item: #131 of 579 id: bijps-1514 author: Abushammala, Issam Mohammed; Mohammed Mqat, Belal ; Mohammed Hamdan, Abdallah title: Effect of Curcumin at Various Doses on the Pharmacokinetic Profile of Tacrolimus in Healthy Rabbits date: 2022-06-23 words: 3338 flesch: 65 summary: Control group 1.50 ± 0.50 0.405¥ 0.690§ First test group 1.90 ± 0.54 Second test group 1.65 ± 0.65 cke (hr-1) Control group 0.102 ± 0.04 0.736¥ 0.570§ First test group 0.124 ± 0.10 Second test group 0.091 ± 0.03 dAUC0-6 (ng*hr/mL) Control group 97.37 ± 18.06 0.524¥ 0.052§ First test group 112.42 ± 49.14 Second test group 130.02 ± 20.54 eAUC0-∞ (ng*hr/mL) Control group 204.49 ± 75.82 0.564¥ 0.679§ First test group 167.05 ± 71.42 Second test group 189.60 ± 25.80 (¥): P-value of the differences between the control and first test group; (§): P-value of the differences between the control and the second test group. In the second and third groups (test groups), rabbits received TAC (1mg/kg) at identical conditions as in the control group with volumes equivalent to (30 and 90 mg/kg/day) of prepared CUR suspension in normal saline for seven continuous days. keywords: blood; control; cur; curcumin; drug; group; pharmacokinetics; rabbits; tac; tacrolimus; test cache: bijps-1514.pdf plain text: bijps-1514.txt item: #132 of 579 id: bijps-1521 author: Abdulsahib, Waleed K. title: The Effect of Anabasis articulata Stems Extract on Lowering Intraocular Pressure in the Glaucoma Rat Model(Conference Paper )# date: 2022-01-11 words: 4982 flesch: 62 summary: Effect of Anabasis articulata extracts on the body weight in the betamethasone-induced chronic glaucoma model. Effects of Anabasis articulata extract on serum levels of some oxidative stress parameters. keywords: anabasis; articulata; control; difference; effect; extract; glaucoma; group; intraocular; iop; model; pressure; sci; treatment cache: bijps-1521.pdf plain text: bijps-1521.txt item: #133 of 579 id: bijps-1528 author: Drais, Hayder Kadhim; Hussein, Ahmed Abbas title: Rheological Investigation of Lipid Polymer Hybrid Nanocarriers for Oral Delivery of Felodipine (Conference Paper )# date: 2022-01-11 words: 4477 flesch: 56 summary: The pseudoplastic flow behavior of felodipine LPHNs formulations (H1-H9) suggests that the described nanosystems in this study are physically stable Keywords: Rheology, Felodipine, Lipid-polymer hybrid nanocarriers, Microwave-based method. The quantitative components of felodipine LPHNs formulations (H1-H9) for characterization and optimization Formulation code Felodipine % (w/w) Cardamon oil % (w/w) Lauric acid % (w/w) Chitosan % (w/w) PEG-(400) laurate :Polysorbate 80: Propylene glycol % (w/w) Distilled water % (w/w) up to H1 1 4 1 0.1 15:7.5:7.5 100 H2 1 4 1 0.1 17.5:8.75:8.75 100 H3 1 8 2 0.2 17.5:8.75:8.75 100 H4 1 4 1 0.2 20:10:10 100 H5 1 8 2 0.25 20:10:10 100 H6 1 12 3 0.35 20:10:10 100 H7 1 4 1 0.2 22.5:11.25:11.25 100 H8 1 8 2 0.35 22.5:11.25:11.25 keywords: concentration; content; felodipine; formulations; glycol; lipid; lphns; polysorbate; propylene; viscosity; water cache: bijps-1528.pdf plain text: bijps-1528.txt item: #134 of 579 id: bijps-1530 author: Saad, Anwar Habeeb; rabeea, Ihsan; Salih, Haider title: Adherence and Beliefs to Adjuvant Hormonal Therapy in Patients with Breast Cancer: A Cross-Sectional Study (Conference Paper) # date: 2022-01-12 words: 5256 flesch: 61 summary: Patients' beliefs about their medications were observed to correlate with medication adherence. Guidelines recommended the use of tamoxifen for 5 years in premenopausal women while AI is the recommended type in postmenopausal women as 1Corresponding author E-mail: anwar.habeebsaad@gmail.com Received: 24/8/2021 Accepted:15 / 11/2021 Published Online First: 2022-1-12 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30issSuppl.pp31-39 Iraqi J Pharm Sci, Vol.30(Suppl.) 2021 Adherence &beliefs of breast cancer patients 32 primary or extended after using tamoxifen for 5 years and sometimes it is recommended to use AI as sequential (a combination with tamoxifen for 3 years followed by 2 years of AI) (3). keywords: adherence; aht; beliefs; bmq; breast; breast cancer; cancer; effects; endocrine; medication; non; patients; study; therapy; treatment; women cache: bijps-1530.pdf plain text: bijps-1530.txt item: #135 of 579 id: bijps-1533 author: Al-Assaf, Issa; Khazem, Mays title: Antioxidant Activity of Total phenols and Flavonoids extracted from Echinops polyceras roots grown in Syria date: 2021-12-12 words: 4635 flesch: 55 summary: Aqueous extract showed the highest yield (10.5%) followed by hydroethanolic 50%, methanol, methanol: ethyl acetate (1:1), and chloroform extracts with yields of 7, 4, 2.75, and 1%, respectively. TPC of the extracts: Total phenolic content was calculated as gallic acid equivalents (GAE) in 1 g of dried extract (DE) using the regression equation between Gallic acid standard concentrations and absorption at 765 nm. keywords: acid; activity; content; echinops; extract; flavonoids; phenolic; polyceras; radicals; scavenging; test cache: bijps-1533.pdf plain text: bijps-1533.txt item: #136 of 579 id: bijps-1535 author: Albassam, Noor Yousif; Mohammed, Amenah; Murtada, Suhair title: Evaluation of Community Pharmacists Knowledge, Attitude and Practice towards Modified Release Dosage Forms date: 2022-01-12 words: 4695 flesch: 56 summary: 125(71*) 11 (6 ) 39 (22) Data presented as number and percentage, n = 175 *Correct answer Attitudes towards modified release dosage forms To investigate the attitudes of pharmacists towards controlled release dosage forms, four questions were designed. 2021 Community pharmacists and modified release 41 Modified-release release dosage forms can provide several benefits. keywords: attitude; community; dosage; forms; knowledge; participants; pharmacists; pharmacy; practice; questionnaire; release; section; study; years cache: bijps-1535.pdf plain text: bijps-1535.txt item: #137 of 579 id: bijps-1538 author: Alqubbanchi, Fatimah Baqer; Yaqoob Al-Hamadani, Fadya title: A Pharmacoeconomics Study for Anticoagulants used for Hospitalized COVID-19 Patients in Al-Najaf Al-Ashraf city –Iraq(Conference Paper )# date: 2022-01-12 words: 7170 flesch: 49 summary: There are many reasons which might contribute to this rise in D- dimer values in COVID-19 patients such as: I) infection which can cause the release of pro- inflammatory cytokines, thus causing an inflammatory storm(26). In contrast, other studies reported that Enoxaparin is associated with a non-significant reduction in total hospital costs compared with the appropriate use of UFH prophylaxis(44).Overall, the results of the present study motivate further studies to investigate reasons for differences in the outcomes and future trials that could enable the development of a more efficacious standard of practice in regards to the administration of anticoagulants in COVID-19 patients. keywords: analysis; anticoagulants; average; cost; covid-19; day; dimer; effectiveness; enoxaparin; heparin; hospitalization; infection; levels; patients; rate; study; survival; treatment; unfractionated; value cache: bijps-1538.pdf plain text: bijps-1538.txt item: #138 of 579 id: bijps-1542 author: Al-Musawi, Mohammed; M. Anwer, Zinah title: Evaluating the Impact of Pharmacist Counselling for Asthmatic Children at Karbala Teaching Hospital for Children: An Interventional Prospective Study (Conference Paper )# date: 2022-01-12 words: 5126 flesch: 61 summary: Evaluating the impact of pharmacist asthma counselling 27 Figure 4. The majority of study participants (90%) was low to medium income families whose children Iraqi J Pharm Sci, Vol.30(2) 2021 Evaluating the impact of pharmacist asthma counselling 28 had asthma which appears to be similar to that found by Davies et al. that stated the prevalence of asthma is greater in low-income families who may have a lower chance of having a good education and optimal academic career (27). keywords: act; act\c; asthma; asthma control; children; control; counseling; face; medication; participants; patients; pharmacist; score; study; الربو cache: bijps-1542.pdf plain text: bijps-1542.txt item: #139 of 579 id: bijps-1543 author: Ali Ashoor , Jamal ; M. Mohsin, Jinan; Mohsin, Hussein Mohammed; W. Mahde, Basam ; M. Gareeb, Mowafaq title: Permeability Enhancement of Methotrexate Transdermal Gel using Eucalyptus oil, Peppermint Oil and Olive Oil(Conference Paper )# date: 2022-01-11 words: 3140 flesch: 60 summary: The donor compartment was supplied by 1gm of MTX gel and the receptor compartment with 100ml of phosphate buffer PH 7.4. The media was stirred at 100 rpm and the temperature kept at 37 C. 5ml sample of MTX gel was withdrawn from the receptor which was replaced by the same volume of buffer to maintain the sink condition. keywords: drug; enhancer; gel; methotrexate; mtx; oil; permeability; pharm; release; skin; transdermal cache: bijps-1543.pdf plain text: bijps-1543.txt item: #140 of 579 id: bijps-1547 author: Fairooz, Amal jawad; Jamal, Mohammed yawuz; Alkhalidi, Nawal mehdi title: Therapeutic Effects of Vitamin E in Non-alcoholic Fatty Liver Disease: An Open-Labeled Clinical Trial date: 2022-12-24 words: 5756 flesch: 63 summary: Epidemiology and natural history of non-alcoholic fatty liver disease. Non-alcoholic fatty liver disease: A clinical update. keywords: 12wks; baseline; bmi; difference; disease; levels; lifestyle; liver; liver disease; nafld; normal; participants; patients; score; steatosis; study; test; vitamin; weeks; weight; الكبد cache: bijps-1547.pdf plain text: bijps-1547.txt item: #141 of 579 id: bijps-1553 author: Hami, Abdulazim Mohammed title: A Study of the inhibitory effect of Terpinen-4-ol on Amastigote Forms of Leishmania tropica within Macrophages of Mouse in vitro date: 2022-12-24 words: 2262 flesch: 62 summary: 7. Haddad, N., et al., Cutaneous leishmaniasis in the central provinces of Hama and Edlib in Syria: Vector identification and parasite typing. 2015; 8(1): 1-8. 8. Torres-Guerrero, E., et al., Leishmaniasis: a review. keywords: amastigote; forms; leishmania; leishmaniasis; macrophages; terpinen-4 cache: bijps-1553.pdf plain text: bijps-1553.txt item: #142 of 579 id: bijps-1555 author: Rosnah, Rosnah; Taslim, Nurpudji A.; Aman, Andi Makbul; Idris, Irfan; As’ad, Suryani; Buchari, Agussalim; Bahar, Burhananuddin; Aminuddin, Aminuddin; Wahyudin, Elly; Nugraha, Gaga Irawan title: The Formulation and Evaluation of High-Fat Pellet on Lipid Profiles and Body Mass Index of Male Wistar Rats date: 2022-06-23 words: 5858 flesch: 62 summary: Therefore, HFD FII pellets were selected as obesity induction feed for male Wistar rats to obtain animal models of obesity and dyslipidemia Physical characteristics of HFD Pellet Yield of HFD FI = 800.49 1000 x 100% = 80.05% Yield of HFD FII = 810.08 1000 x 100% = 81.01% Table 3 shows the initial weight of each HFD FI, and the HFD FII formula was 1000 g. After drying, HFD FI and HFD II pellets had a weight reduction of 190.51 g and 189.20 g, respectively. The feed consumption in the rat fed with HFD FII pellets was also higher than the standard group (P0), indicating that rats preferred the HFD FII pellets. keywords: body; characteristics; cholesterol; diet; fat; feed; fii; group; hfd; hfd fii; journal; lipid; obesity; pellets; rats; weight; wistar cache: bijps-1555.pdf plain text: bijps-1555.txt item: #143 of 579 id: bijps-1557 author: AL-Nema, Zinah Mudhafar; Natiq Yahya, Ruaa ; Mubdir Khalf, Noor title: Highlighting the Treatment Regimens used in COVID-19 epidemic in Iraq with Special Regards to Vitamin D date: 2022-12-24 words: 6026 flesch: 54 summary: There were many different pharmacological treatment regimens and different doses and durations of vitamin D. In conclusion, non-specific treatment protocols were used without compliance to the national guidelines for the treatment of COVID-19 patients in Iraq, and a wide range of pharmaceutical agents was administered without monitoring their safety and efficacy. They were used as an emergency treatment for COVID-19 patients in USA, Japan and other countries(9). keywords: analysis; antiviral; cases; complications; covid-19; disease; infection; iraq; meta; patients; regimens; review; sci; severity; study; symptoms; therapy; treatment; vitamin; vitamin d cache: bijps-1557.pdf plain text: bijps-1557.txt item: #144 of 579 id: bijps-1558 author: Ahmed AlKataan, Muhammad Abdulgafoor; Junaid Salim, Moamin title: Correlation between Seminal Fructosamine and Glycosylation Gap and Some Sex Hormones in the Young Infertile Male in Mosul City date: 2022-06-23 words: 3105 flesch: 65 summary: Testosterone and estradiol play vital role in spermatogenesis(10, 18, 19 )and this work study both serum and seminal plasma changes of these two hormones. Keywords: Seminal plasma, Fructosamine, Glycosylation وبعض الهرمونات الجنسية لدى الشاب المصاب المنوي و فجوة الجليكوزيل السائل االرتباط بين فركتوزامين بالعقم في keywords: control; estradiol; fructosamine; glycosylation; group; infertile; infertility; male; plasma; ratio; serum cache: bijps-1558.pdf plain text: bijps-1558.txt item: #145 of 579 id: bijps-1565 author: Ibrahim, Manal Abdulkhaliq; Abbas, Wameed Hashim; Ghalib, Muhsin Sagheer; Al-Shawi, Nada N. Najia title: Neuroprotective Effect of Vinpocetine against Lead Acetate-Instigated Neurotoxicity in Rats by Evaluation Tumor Necrosis Factor-Alpha, Interleukin-1Beta and Interleukin-10 date: 2022-12-24 words: 3479 flesch: 58 summary: The major findings of previous studies that approved raising cytokine creation and axonal destruction with astrocytic activation by Pb effect in immature rat brain (23). Iraqi J Pharm Sci, Vol.31( 2 ) 2022 Neuroprotective effect of vinpocetine DOI: https://doi.org/10.31351/vol31iss2pp129-134 129 Neuroprotective Effect of Vinpocetine against Lead Acetate-Instigated Neurotoxicity in Rats by Evaluation Tumor Necrosis Factor-Alpha, Interleukin-1Beta and Interleukin-10 Manal Abdulkhaliq Ibrahim*,1, Wameed Hashim Abbas**, Muhsin Sagheer Ghalib*, Nada N. Al-Shawi keywords: acetate; brain; days; effect; group; homogenate; lead; level; rats; tissue; tnf; vinpocetine cache: bijps-1565.pdf plain text: bijps-1565.txt item: #146 of 579 id: bijps-1567 author: Blebil, Ali; Dujaili, Juman Abdulelah; Mohammed, Ali Haider; Awaisu, Ahmed; Ahmad Hassali, Mohamed Azmi; Hassan, Bassam Abdul Rasool; Wayyes, Abdulrasool M. title: Exploring the Capability of the Hospital Pharmacists in Conducting Pharmacy Practice Research: A Study from Malaysia date: 2022-12-23 words: 6235 flesch: 52 summary: To support this paradigm shift, practicing pharmacists should be equipped with essential skills to conduct pharmacy practice research (4-6), thus improving the overall healthcare outcomes (2, 7- 9). In addition, the pharmacists expressed facing barriers to performing pharmacy practice research which dates back to their undergraduate studies. keywords: activities; competence; conducting; confidence; data; hospital; hospital pharmacists; journal; malaysia; pharmaceutical; pharmacists; pharmacy; practice; research; study; training; undergraduate; years cache: bijps-1567.pdf plain text: bijps-1567.txt item: #147 of 579 id: bijps-1571 author: Hadi, Hind; A. Al-Uzri, Wasan title: Sensitive Cloud Point Extraction Method for the Determination of Isoxsuprine Hydrochloride in Pharmaceutical forms using Spectrophotometry date: 2022-12-23 words: 3726 flesch: 53 summary: Under the selected optimum conditions, the linearity ranges of calibration curves were 1-9 and 0.5-8 µg/ml with detection limits of 0.26 and 0.09 µg/ml of ISX for batch and CPE methods respectively. CPE method has several characteristics feature over other extraction methods, such as high efficiency, sensitivity and enrichment factor, in addition of use safe aqueous medium rather than toxic organic solvents (10). keywords: batch; cpe; extraction; incubation; isx; methods; pharmaceutical; reaction; solution; sulfadimidine cache: bijps-1571.pdf plain text: bijps-1571.txt item: #148 of 579 id: bijps-1572 author: Annisa, Viviane; Sulaiman, Teuku Nanda Saifullah; Nugroho, Akhmad Kharis; Nugroho, Agung Endro; Roman Kutsyk title: Characterization of Alginate with Natural Polymers Combination for Drug Encapsulation date: 2022-12-24 words: 5639 flesch: 52 summary: The objective of this study was the characterization of alginate combination with pectin, gum acacia, or carrageenan with and without the addition of Calcium Chloride (CaCl2) solution. In mixture solution, the sharp peaks at 1420 cm-1 along with increasing alginate ratio. keywords: acacia; alginate; cacl2; carrageenan; combination; effect; gel; gum; mixture; pectin; polymers; ratio; solution; viscosity cache: bijps-1572.pdf plain text: bijps-1572.txt item: #149 of 579 id: bijps-1577 author: Marouf, Bushra Hassan title: Health Hazards, Hematological and Biochemical Alterations in Dry-Cleaning Workers using Perchloroethylene. date: 2022-12-24 words: 3924 flesch: 54 summary: The study aimed to investigate the harmful effect associated with PERC exposure among dry-cleaning workers. The hematological indices of both PERC-non-Exposed and PERC-Exposed group (n=58) Values are presented as mean±S.D. n: number of participants; unpaired t-test was utilized to predict significance at P<0.05; Hb: Hemoglobin; Hct: Hematocrit; WBC: White blood cell. Effects of exposure to PERC vapor on the kidney and liver function markers of the dry- cleaning workers as shown in table 4. keywords: cleaning; dry; effect; exposure; group; health; kidney; liver; non; perc; perchloroethylene; study; workers cache: bijps-1577.pdf plain text: bijps-1577.txt item: #150 of 579 id: bijps-1587 author: almajidi, Yasir Q.; T. Khalaf , Yaseen ; M. Shalan, Naeem ; H. Alani, Israa ; A. Abu Dayyih, Wael title: Preparation and Evaluation of Oroslippery Tablets Contain Irbesartan and Hydrochlorothiazide Combination for Dysphagia Patients date: 2022-12-23 words: 5617 flesch: 58 summary: Material Control formula (CF)(%) Coating formula 1 (CF1)(%) Coating formula 2 (CF2)(%) Coating formula 3 (CF3)(%) Opadry 12 12 12 12 Xanthan gum (Slippering agent) 0 2 3 4 Peppermint flavor 0.5 0.5 0.5 0.5 Aspartame (sweetener) 0.1 0.1 0.1 0.1 Total solid concentration 12.6 14.6 15.6 16.6 Evaluation of the coated tablets Weight gain by coat Weight uniformity test was repeated on coated tablets and the average weight gain by coating process was calculated.(27) Thickness of coated tablets Thickness of coated tablets was measured to check the increase in tablet thickness due to coating process. keywords: agent; coating; disintegration; formula; gum; hct; hydrochlorothiazide; irbesartan; min; oroslippery; release; swallowing; tablets; test; time; weight; xanthan cache: bijps-1587.pdf plain text: bijps-1587.txt item: #151 of 579 id: bijps-1589 author: ALJuboury, Rasha Abdullatif; Al-Shawi, Nada N title: Anti-obesity effect of simvastatin and omega-3 and its combination on obese model male Wistar rats: Effect of simvastatin, omega-3 and their combination on UCP1 date: 2022-12-23 words: 5820 flesch: 63 summary: 222.66±16.43* 261.26±11.01* 396.23±45.48* week_5 54.966±3.653 154.86±8.46* 326.3±12.77* 296.83±24.98* 512.11±48.79* week_6 42.92±6.33 131.056±10.194* 302.5±22.33* 626.71±27.63* 977.03±41.4* week_7 58.45±5.1 183.466±6.78* 585.86±30.99* 901.17±22.72* However, treating with omega-3 (1ml/day) (Group IV) results from increase UCP1 gene expression from third week of therapy, also in case of mixed dose of simvastatin and omega-3 (Group V) rats where UCP1 gene expression level from increased from third week of therapy (4). keywords: adipose; body; brown; combination; day; effect; expression; fat; group; obese; obesity; omega-3; protein; rats; simvastatin; tissue; treatment; ucp1; week cache: bijps-1589.pdf plain text: bijps-1589.txt item: #152 of 579 id: bijps-1590 author: Mohammed, Samer Imad; Munaf Hashim Zalzala; Gorial, Faiq Isho title: The Effect of TNF-Alpha Gene Polymorphisms At -376 G/A, -806 C/T, and -1031 T/C on The Likelihood of Becoming a Non-Responder to Etanercept in A Sample of Iraqi Rheumatoid Arthritis Patients date: 2022-12-24 words: 8909 flesch: 58 summary: Association of the change in DAS28 over six months between different genotypes in -1031 T/C, - 806 C/T and -376 G/A TNF-α genotypes polymorphism. Also, the result was parallel to an Iranian study which examined -376 G/A TNF-α gene polymorphisms in Iranian celiac patients to healthy controls(47). keywords: -376; -806; allele; alpha; analysis; arthritis; das28; disease; etn; factor; gene; genotypes; internet; iraqi; jul; necrosis; non; patients; polymorphisms; response; rheumatoid; study; tnf; tumor; α gene cache: bijps-1590.pdf plain text: bijps-1590.txt item: #153 of 579 id: bijps-1592 author: Mohammed, Mohammed Mahmood; AbdulKareem Hadi , Rusul ; Noori Salman , Isam title: Potential Positive Effects using Coenzyme Q10 Supplement as Adjuvant Therapy to Gabapentin for Managing Diabetic Neuropathy date: 2022-12-24 words: 4304 flesch: 60 summary: Finally, addition of Coenzyme Q10 to gabapentin for diabetic neuropathy patients result in improving the glycemic control & symptoms of the diabetic neuropathy, as well as decreasing effects of the inflammation in addition to oxidative stress after three months of treatment. Many clinical trials depend on supplement in an attempt to improve neuropathy symptoms such as (pain & tingling) and patient quality of life, one of them is Coenzyme Q10 which is reported to have an anti- inflammatory and antioxidant effects, and was totally nontoxic and non-reported side effects. keywords: coenzyme; coq10; diabetes; differences; effects; gabapentin; group; levels; neuropathy; patients; q10; sod; study; supplement; test; treatment cache: bijps-1592.pdf plain text: bijps-1592.txt item: #154 of 579 id: bijps-1597 author: Jardaq, Hind Salim; Y. Jamal, Mohammed title: The correlation between CYP2C19 Polymorphisms and recurrent risk in Patients with Ischemic Stroke treated with Clopidogrel in Kurdistan region-Iraq date: 2022-12-25 words: 5669 flesch: 57 summary: These results were consistent with the findings of another prospective study in China 2019, done on 289 patients with ischemic stroke treated with clopidogrel for prevention where the Iraqi J Pharm Sci, Vol.31(2) 2022 CYP2C19 polymorphisms in ischemic stroke patients 257 correlation of drug therapy during follow-up (ACEI/ARB) was significant with risk of stroke recurrence (P=0.006) and contrast with hypertension which was an independent risk factor of recurrence risk (P=0.04)(32), this can be due to that most of the hypertensive patients in the current study were of age below 60 years old, they had either hypertension alone or with one other risk factor, mostly hyperlipidemia without other comorbidities or they had controlled blood pressure. The correlation between recurrent risk and CYP2C19 gene polymorphisms in patients with ischemic stroke Iraqi J Pharm Sci, Vol.31(2) 2022 CYP2C19 polymorphisms in ischemic stroke patients 259 treated with clopidogrel for prevention. keywords: allele; antiplatelet; association; clopidogrel; cyp2c19; drug; enzyme; genotype; iraqi; ischemic; metabolizers; patients; pharm; polymorphisms; prevention; recurrent; risk; sci; stroke; study cache: bijps-1597.pdf plain text: bijps-1597.txt item: #155 of 579 id: bijps-1599 author: Hamdan, Azni Izwati; Nordin, Norsyafikah Asyilla; Sukmana, Dike Dandari title: Aspirin Derivatives Exploration: A Review on Comparison Study with Parent Drug date: 2022-12-23 words: 9758 flesch: 52 summary: Aspirin derivatives can be synthesized in various pathways and have been reported to give better biological activities compared to the parent drug. Keywords: Aspirin, Aspirin derivatives, Biological activities, Chemical modification, NSAIDs Introduction Drug modification is vital in drug discovery and development process as it is usually done by altering the molecular structure of the formerly characterized lead compound to improve drug potential for treatment of diseases. keywords: acid; activity; agents; antibacterial; anticancer; apoptosis; aspirin; aspirin derivatives; assay; aureus; azo; cancer; cell; chalcone; coli; compounds; derivatives; drug; inhibition; iraqi; nosh; pharm; potential; ros; scheme; sci; synthesis; thiourea; vol.31(2 cache: bijps-1599.pdf plain text: bijps-1599.txt item: #156 of 579 id: bijps-1604 author: Salih, Twana Mohsin title: A Comparative Study for the Accuracy of Three Molecular Docking Programs Using HIV-1 Protease Inhibitors as a Model date: 2022-12-24 words: 5106 flesch: 61 summary: Molecular docking programs accuracy 161 Introduction One of the most crucial steps in the drug discovery process is lead identification; various approaches are available to identify a lead compound, such as reliable computational approaches (1). Various metric approaches can be implemented to define the accuracy of molecular docking programs and assist users to select the most appropriate program (15, 16). keywords: accuracy; autodock; binding; crystal; docking; doi; drug; group; ligand; molecular; programs; protease; results; saquinavir; structure; ucsf; vina cache: bijps-1604.pdf plain text: bijps-1604.txt item: #157 of 579 id: bijps-1605 author: Dallal Bashi, Ahmed Yahya; Fathi, Fatimah Haitham title: Evaluation of Hepatic Enzymes in major β-thalassemic Patients using Deferasirox date: 2022-12-25 words: 4414 flesch: 53 summary: Administration of deferasirox for β- thalassemia major patients causes elevation of serum ALP activity and ferritin level. The mean of serum ALP activity showed no significant increase in group A in comparison with group C, while in group B, there was a significant increase in the mean of serum ALP activity (Tables 1 and 2 respectively). keywords: activity; alp; alt; ast; blood; deferasirox; ferritin; group; iron; major; mean; patients; serum; thalassemia; transfusion; value cache: bijps-1605.pdf plain text: bijps-1605.txt item: #158 of 579 id: bijps-1606 author: Masar Basim Mohsin Mohamed ; Zainab Saad Qaddoori; Ghaidaa Sulaiman Hameed title: Study the Effect of 12-Hydroxyoctadecanoic Acid Concentration on Preparation and Characterization of Floating Organogels using Cinnarizin as Modeling Drug date: 2022-12-24 words: 4237 flesch: 58 summary: In-vivo floating study This study was executed to support the floating in-vitro outcomes of HOA organogels. The organogel’s in vitro floating properties were found positively proven our work’s aim and were buoyant for 24 hours as F5 HOA organogels remained for 12 hours in the rat’s stomach. keywords: acid; figure; hoa; hours; organogels; release; stomach; study; sweep cache: bijps-1606.pdf plain text: bijps-1606.txt item: #159 of 579 id: bijps-1610 author: S Jaafar , Noor ; A. Alshammaa, Dhuha ; Abdul-lalil, Thukaa zuhair; M. Ibrahem, Nabaa title: Quantitative Determination and Cytotoxic Effect of Oleanolic Acid from Olea europaea Leaves Extract Cultivated in Iraq date: 2022-12-25 words: 3536 flesch: 57 summary: The chromatogram for ethyl acetate and extracted oleanolic acid fractions (Figure 2, B and 2, C) demonstrated the presence of distinct peaks at 9.70 and 9. 79 min which reflects the presence of oleanolic acid respectively in both examined fractions Figure 1. oleanolic acid and its cytotoxic effect DOI: https://doi.org/10.31351/vol31iss2pp244-250 244 Quantitative Determination and Cytotoxic Effect of Oleanolic Acid from Olea europaea Leaves Extract Cultivated in Iraq Noor S keywords: acetate; acid; amj13; cancer; cell; cytotoxic; determination; effect; ethyl; europaea; extract; fraction; journal; leaves; method; oleanolic cache: bijps-1610.pdf plain text: bijps-1610.txt item: #160 of 579 id: bijps-1611 author: Ruaa Mohammed Ibrahim; Dhuha Abdul Saheb Alshammaa title: Pharmacological aspects of Borago officinalis (Borage): A review article date: 2023-06-16 words: 8233 flesch: 46 summary: Hamed ANE, Wahid A. Hepatoprotective activity of Borago officinalis extract against CCl4- induced hepatotoxicity in rats. Borago extract also improved gastro-esophageal reflex-associated symptom. keywords: acid; activity; administration; antioxidant; aspects; borage; borago officinalis; bso; content; effect; ethanolic; extract; fatty; figure; flavonoids; flowers; food; gamma; gla; iraqi; journal; leaves; levels; liver; officinalis; oil; pharm; plant; rats; sci; seed; treatment cache: bijps-1611.pdf plain text: bijps-1611.txt item: #161 of 579 id: bijps-1627 author: Al-Atassi, Abdullah Zuhair; AL-KHATIB, Racha Aboualkher; OTHMAN, Mohammad Abdulraouf title: Comparison of Phenolic Contents and Antioxidant Activities for Black and White Desert Truffles Spread in Syria date: 2022-12-24 words: 4972 flesch: 62 summary: To extensively characterize the antioxidant potential of truffle extracts, two antioxidant assays were applied. Yields of extraction, phenolic and flavonoid contents, and antioxidant activities of Terfezia claveryi and Tirmania pinoyi extracts. keywords: acid; activity; antioxidant; compounds; desert; dry; extract; species; terfezia; tirmania; truffle; values cache: bijps-1627.pdf plain text: bijps-1627.txt item: #162 of 579 id: bijps-1632 author: Alduboni, Noor Mohammed; N Al-Shawi, Nada title: Possible protective effects of two different doses of cyanocobalamin against methotrexate nephrotoxicity in rats date: 2022-12-24 words: 4873 flesch: 48 summary: Renoprotective effects of umbelliferone on methotrexate- induced renal injury through regulation of Nrf- 2/Keap-1, P38MAPK/NF-κB, and apoptosis signaling pathways. Co-administration of cyanocobalamin at doses cyanocobalamin 0.5mg/kg and 2mg/kg with methotrexate showed significant-reduction- (P<0.05) in malondialdehyde, significant elevation (P<0.05)-in the glutathione level, significant upregulation in renal Nrf2 expression and significant down regulation in renal keap1 expression each compared to corresponding levels in methotrexate-only treated group. keywords: 2mg; antioxidant; cyanocobalamin; dose; effects; expression; group; keap1; kg mtx; kidney; level; methotrexate; mtx; nephrotoxicity; nrf2; p<0.05; rats; renal cache: bijps-1632.pdf plain text: bijps-1632.txt item: #163 of 579 id: bijps-1635 author: G Jameel , Murooj; Alhakeem, Zainab M; Al-Osami, Mohammad H title: Prevalence of AGER gene polymorphism in post menopause Iraqi sample with Osteoporosis and osteopenia in type 2DM date: 2022-12-24 words: 4596 flesch: 61 summary: The gene and allele frequencies for rs11812261 variant were GG 79%, GA 21%, (G89%, A11%) for group A, GG85%, GA 15% (G 92.5%, A7.5%) for control group, while The gene and allele frequencies for rs143118560 variant was AA51%, AT26%, TT23%(A64%, T36%)for group A, AA75%, AT15%, TT10% (A82.5%, five milliliters of blood sample were divided into three tubes; one tube (1ml) contain gel for obtain serum to measure glucose level, the others tubes containing ethylene-diamine-tetra-acetic acid (EDTA), in second tube 2ml stored in deep freeze at (–40 Co) until genomic analysis of DNA for the performance of PCR genotyping of gene polymorphisms of RAGE, in third tube 2ml used to perform Glycated Hemoglobin % (HbA1c) assays. keywords: ager; control; diabetes; gene; genotype; glucose; group; hba1c; levels; osteoporosis; polymorphism; prevalence; rage; study; value; women cache: bijps-1635.pdf plain text: bijps-1635.txt item: #164 of 579 id: bijps-1637 author: Ahmed Mansur Kadhim; Mohammed, Mohammed Mahmood; Hussein Muhammad Hassan Abdul-Hussein ; sultan, Yasir Sabeeh Abdulridha title: Treatment of Helicobacter Pylori Infections Using Moxifloxacin-Triple Therapy Compared to Standard Triple and Quadruple Therapies date: 2023-06-16 words: 5426 flesch: 58 summary: Jung SM, Cheung DY, Kim JI, Kim I, Seong H. Comparing the efficacy of concomitant therapy with sequential therapy as the first-line therapy of Helicobacter pylori eradication. Helicobacter pylori eradication with a capsule containing bismuth subcitrate potassium, metronidazole, and tetracycline given with omeprazole versus clarithromycin-based triple therapy: a randomised, open-label, non- inferiority, phase 3 trial. keywords: blood; clarithromycin; eradication; group; h. pylori; helicobacter; helicobacter pylori; infection; moxifloxacin; patients; pylori; quadruple; regimen; study; therapy; treatment; triple cache: bijps-1637.pdf plain text: bijps-1637.txt item: #165 of 579 id: bijps-1639 author: Oleiwi, Mohammed Abdulameer; Zalzala, Munaf H. title: Synthesis, Molecular Docking Study and Cytotoxicity Evaluation of some Quinazolinone Derivatives as Nonclassical Antifolates and Potential Cytotoxic Agents date: 2022-12-25 words: 6870 flesch: 62 summary: Molecular docking study showed that both compounds S1 and S2 displayed partially a similar binding mode with the active site of DHFR in comparison with the co-crystallized ligand (MTX), whereas compound S1 showed a different binding mode with the active site of TS when compared with the co-crystallized ligand (raltitrexed). Docking study on TS enzyme revealed that compound S1 formed only Iraqi J Pharm Sci, Vol.31(2) 2022 Synthesis, molecular docking study of some quinazolinone derivatives 292 one hydrogen-bonding interaction with the active site residue LEU221 with a distance of 2.909 Å through the NH group of the anilide moiety (Figure 7 (B)), while compound S2 formed a hydrogen- bonding interaction between the carbonyl oxygen of the anilide and ASN112 residue at 3.067 Å distance (Figure 7 (C)). keywords: activity; amide; bond; cancer; cell; compounds; derivatives; docking; iraqi; pharm; ppm; quinazolinone; sci; sec; str; study; synthesis cache: bijps-1639.pdf plain text: bijps-1639.txt item: #166 of 579 id: bijps-1641 author: Kadhim, Haitham; Gatea, Fouad; Abu Raghif, Ahmed; Ali, Kholod title: Role of Topical Ritodrine Hydrochloride in Experimentally Induced Hypertrophic Scar in Rabbits date: 2022-12-25 words: 6918 flesch: 54 summary: Thirty-two healthy male albino rabbits that divided in to 4 groups were included in the study (healthy; induced untreated hypertrophic scars; induced hypertrophic scars treated with 0.1% Triamcinolone acetonide (TAC) as a standard drug; and induced hypertrophic scars treated with 0.5% Ritodrine HCL gel twice daily for 21 days. Therapy of induced hypertrophic scar with topical Ritodrine was successfully effective in rabbits. keywords: acetonide; angiogenesis; collagen; days; group; hydrochloride; hypertrophic; iii; inflammation; model; rabbits; reduction; ritodrine; scar; scarring; sci; skin; study; tgf; treatment; triamcinolone; wound; β2arag cache: bijps-1641.pdf plain text: bijps-1641.txt item: #167 of 579 id: bijps-1643 author: S. Hassan, Jabbar; Al-Tamimi, Bushra J.; Ghazi Hassan, Fuad title: Occurrence of Quinolone-Resistance Genes in Ciprofloxacin-Resistant Salmonella Enterica Serotype Typhi Isolated form Blood Sample of Patients with Typhoid Fever date: 2022-12-24 words: 2716 flesch: 55 summary: Fluoroquinolone un-responsiveness are primarily caused by two mechanisms: chromosomally mediated mutations in topoisomerase's quinolone resistance determining regions (QRDR) and quinolone resistance determining region mutations; resistance genes belong to qnr groups plasmids mediated play a role in Fluoroquinolone resistant (3). It's worth noting that the transfer of resistance genes among Enterobacteriaceae bacteria, such as quinolones genes, is a complicated process involving a variety of mechanisms, such as plasmid- mediated resistance gene transfer and chromosomal alterations. keywords: enterica; genes; isolates; plasmid; qnra; qnrb; qnrs; quinolone; resistance; salmonella; serotype; study; typhi cache: bijps-1643.pdf plain text: bijps-1643.txt item: #168 of 579 id: bijps-1654 author: Ibrahem, Nabaa Mohammed; Khadum, Enas Jawad; Mutlag, Shihab Hattab title: Isolation of Catchin and Epigallocatchin From Iraqi Rhus coriaria By Preparative High-Performance Liquid Chromatography (PHPLC) date: 2022-12-25 words: 4434 flesch: 54 summary: The quantitative PHPLC analysis of the isolated compounds revealed that the catechin has higher concentration than epigallocatechin in fruit extract of Rhus coriaria plant as shown in Table (4). Iraqi J Pharm Sci, Vol.31( 2 ) Isolation of catchin and epigallocatchin from Iraqi R.coriaria DOI: https://doi.org/10.31351/vol31iss2pp271-282 271 Isolation of Catchin and Epigallocatchin From Iraqi Rhus coriaria By Preparative High-Performance Liquid Chromatography (PHPLC) Nabaa M. Ibrahem *,1, Enas J. Kadhim*, Shihab Hattab Mutlag ** * Department of Pharmacognosy and Medicinal Plants, College of Pharmacy, University of Baghdad, Baghdad, Iraq ** Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad, Baghdad, Iraq. keywords: catechin; compound; coriaria; epigallocatchin; figure; hplc; iraqi; isolation; mass; pharm; plant; rhus; sci; sumac cache: bijps-1654.pdf plain text: bijps-1654.txt item: #169 of 579 id: bijps-1658 author: Aziz, Zahraa Yhaya; Mohsin, Masar Basim; Jasim, Marwa Hazim title: Formulation and Assessment of Delayed/Slow-Release Diclofenac Sodium Edible Organogel Utilizing Low Molecular Weight Organogelators date: 2023-06-16 words: 5587 flesch: 65 summary: Organogels of 12HSA in AO and CO as in A and B, organogels of span 60 in AO and CO as in C and D while in E and F are span 40 in AO and CO organogel. Iraqi J Pharm Sci, Vol.32( 1 ) 2023 Slow release organogel 33 Oscillatory rheology study The rheology was carried out utilizing Anton par mcr 302 rheometer using plate-plate configuration (PP 25/ SN 61895). keywords: 12hsa; frequency; gelators; oil; oils; organogel; release; sci; span; study; sweep; temperature; wt% cache: bijps-1658.pdf plain text: bijps-1658.txt item: #170 of 579 id: bijps-1671 author: Ayad Lafta, Amenah; N. Hamad, Maha title: Isolation of Alkaloids from Papaver rhoeas (Papaveraceae) Wildly Grown in Iraq date: 2021-12-09 words: 2617 flesch: 61 summary: Papaver rhoeas L 80 Identification, isolation and purification of alkaloids from Papaver rhoeas plant 1. The plant was extracted by hot extraction method using Methanol then fractionation was done to separate alkaloids from chloroform Fraction by TLC and PTLC .The alkaloids were isolated and purified by PTLC then subjected to various analytical techniques for alkaloids identification such as UV, LC mass and IR .The result was indicated of three alkaloids (dihydrocodien, chelidonine and papaverrubine C) in Papaver rhoeas plant. keywords: alkaloids; compound; figure; iraqi; mass; papaver; plant; rhoeas; spectrum cache: bijps-1671.pdf plain text: bijps-1671.txt item: #171 of 579 id: bijps-1673 author: Mohammed, HS; Ahmida, MHS; Madi, MF; Abdel-Gayoum, A A title: Ameliorative Effects of the Aqueous Extract of Allium porrum (Wild Leek) against Cisplatin-Induced Nephrotoxicity in Rabbits date: 2021-12-11 words: 5075 flesch: 55 summary: Antioxidant changes Cisplatin treated group exhibited significant reductions in the renal cortical GSH content and activities of CAT and SOD by 32.20%, 73.86% and 41.82%, respectively and a significant (P˂0.01) increase in the cortical lipid peroxidation by 89.64% compared to control. However, in LCP group animals, the serum TC was still higher than that in control (C) by 48.8%, the TG by 21.1%, and LDL by 50.4%, whereas, the HDL-c and VLDL-c were not significantly different (P>0.05) compared to that of control group (C) rabbits. keywords: animals; cholesterol; cisplatin; control; day; extract; group; kidney; lcp; leek; nephrotoxicity; rabbits; renal; serum; weight cache: bijps-1673.pdf plain text: bijps-1673.txt item: #172 of 579 id: bijps-1677 author: Ahmed, Kawther Khalid; Al-Jumaili, Ali Azeez; Salman, Salema Sultan; Kathem, Sarmed Hashem title: The Students Experience of Hybrid- Education Model at The University of Baghdad College of Pharmacy date: 2021-12-23 words: 4762 flesch: 45 summary: Challenges in distance education implantation and future directions The overall rating of the college success in distance education showed a median score of neutral (3) (Table 1). However, no further investments at infrastructures essential for distance education took place. keywords: college; distance; distance education; education; exams; experience; face; hybrid; model; students; year cache: bijps-1677.pdf plain text: bijps-1677.txt item: #173 of 579 id: bijps-1699 author: Al-Uzri, Wasan Abdulamir; Mariam Jamal; Hind Hadi title: Colorimetric Determination of Salbutamol Sulfate using Spectrophotometry-Continuous Flow Injection Technique in Pure and Pharmaceutical Forms date: 2023-06-16 words: 3886 flesch: 55 summary: By analyzing three different concentrations of SLB solutions using both approaches, the accuracy and reproducibility of the suggested procedures were assessed as relative error and relative standard deviation (% RSD), respectively (Table 3). To the 2 µg/mL of SLB solution, fiftyfold of each interference (starch, lactose, polyvinylpyrolidone, and magnesium stearate) was added and evaluated separately utilizing batch and FIA techniques. keywords: batch; determination; drug; dsdm; fia; flow; methods; pharmaceutical; reaction; salbutamol; slb; sulfate cache: bijps-1699.pdf plain text: bijps-1699.txt item: #174 of 579 id: bijps-1712 author: Hazhar M. Balaky; Akam Jasim Mustafa; Parween Abdulsamad Ismail title: Clinical significance of Osteoprotegerin, Vitamin D, Obestatin and some biochemical variables in Kidney failure Patients date: 2023-06-16 words: 5169 flesch: 45 summary: However, the role of native vitamin D supplementation (ergocalciferol, cholecalciferol or calcifediol) remains unclear in chronic kidney disease (CKD), particularly in the pre-dialytic phase (4). The role of uric acid in chronic kidney disease (CKD) has been a controversial topic for decades. keywords: ckd; disease; failure; function; kidney; kidney disease; levels; obestatin; osteoprotegerin; patients; protein; renal; serum; study; uric cache: bijps-1712.pdf plain text: bijps-1712.txt item: #175 of 579 id: bijps-1716 author: Al-Hamdany, Muna; Al-Hubaity , Abduljabar title: The Protective Effects of N-acetylcysteine against 5-Fluorouracil Induced Intestinal Toxicity in Albino Rats date: 2023-06-16 words: 3241 flesch: 47 summary: Results showed an increase in the depth of the colonic crypts in group B rats as compared to the control group, mucinous degeneration of the intestinal mucosal cells along with necrosis, and inflammatory cells infiltration in the lamina propria. Micrograph of the colon of group A (control groups) showing surface epithelium (black arrows), intestinal glands in the lamina propria (white arrows) (H&E X 100). keywords: acetylcysteine; cells; colon; colonic; control; crypts; effects; fluorouracil; group; nac; rats cache: bijps-1716.pdf plain text: bijps-1716.txt item: #176 of 579 id: bijps-1734 author: jassim, Huda title: The Isolation and Identification of Salmosamonella typhi from clinical samples with molecular detection of O-antigen encoded genes date: 2023-06-16 words: 2045 flesch: 59 summary: 9. Liu B, Knirel YA, Feng L, Perepelov AV, Senchenkova SN, Reeves PR, Wang LStructural diversity in Salmonella O antigens andits genetic basis. Presence of Wzy and Wzx gene in different isolates of Salmonella typhi. keywords: antigen; detection; genes; isolates; molecular; salmonella; study; typhi; typhoid; wzx; wzy cache: bijps-1734.pdf plain text: bijps-1734.txt item: #177 of 579 id: bijps-1735 author: Kadhum, Ahmad; Mohammed D. Al-Rekabi; Furqan Hashim title: Pharmaceutical sales and marketing as a future career for pharmacy students in Iraq: perception and barriers date: 2023-06-20 words: 4573 flesch: 58 summary: Abstract The exposure of pharmacy students to fieldwork experience throughout the early stages of their education would assist in preparing them for their future careers. Keywords: Pharmaceutical promotion, Pharmacy students, Pharmacy career, Student perception, pharmaceutical sales. keywords: career; community; field; future; iraq; job; pharmaceutical; pharmacy; promotion; students; study; work; working cache: bijps-1735.pdf plain text: bijps-1735.txt item: #178 of 579 id: bijps-1741 author: Pozdnyakov, Dmitry; Adzhiakhmetova , Similla; Chervonnaya, Nadezhda; Oganesyan, Stanislav title: Lipid -Lowering Effect of Polysaccharide (Pectin) of Viscum album L. Plant in Rats date: 2023-06-16 words: 5832 flesch: 61 summary: NC - negative control; PSpc — a group of rats that received pectin from pear; PSmd - a group of rats that received pectin from a apple tree; PSva/pc - a group of rats that received pectin substances from mistletoe collected from pear; PSva/md - a group of rats that received pectin substances from mistletoe collected from apple tree; WSPpc - a group of rats that received soluble pear polysaccharides; WSPmd - a group of rats that received water soluble polysaccharides from apple tree; WSPva/pc - a group of rats that received water-soluble polysaccharides of mistletoe collected from common pear; WSPva / md - a group of rats that received water-soluble polysaccharides of mistletoe collected from apple tree. NC - negative control; PSpc — a group of rats that received pectin from pear; PSmd - a group of rats that received pectin from a apple tree; PSva/pc - a group of rats that received pectin substances from mistletoe collected from pear; PSva/md - a group of rats that received pectin substances from mistletoe collected from apple tree; WSPpc - a group of rats that received soluble pear polysaccharides; WSPmd - a group of rats that received water soluble polysaccharides from apple tree; WSPva/pc - a group of rats that received water-soluble polysaccharides of mistletoe collected from common pear; WSPva / md - a group of rats that received water-soluble polysaccharides of mistletoe collected from apple tree. keywords: activity; apple; cholesterol; concentration; content; group; leaves; mistletoe; pear; pectin; pectin substances; plant; polysaccharides; rats; substances; tree; water cache: bijps-1741.pdf plain text: bijps-1741.txt item: #179 of 579 id: bijps-1744 author: Hassan, Zahra; hassan, Tuka; Abu- Raghif, Ahmed title: Evaluation the Effect of Phytosterol Fraction of Chenopodium Murale in Comparison with Tacrolimus on Mice Induced Atopic Dermatitis date: 2023-06-16 words: 4990 flesch: 52 summary: The comparison between the effect of topical application of tacrolimus and Phytosterol Fraction on the studied variables shows that the level of WBC and thickness of epidermis and inflammatory cells were significantly lower after tacrolimus treatment, while high significant reduction was founded in parakeratosis and score of observational severity among Chenopodium murale treated group in comparison with Tacrolimus treated group. The levels of parakeratosis and observational Severity Score after phytosterol fraction of Chenopodium murale treatment were lower than after Tacrolimus treatment. keywords: atopic; atopic dermatitis; chenopodium; chenopodium murale; control; dermatitis; effect; fraction; group; ige; inflammatory; mice; murale; phytosterol; skin; study; tacrolimus; test; treatment cache: bijps-1744.pdf plain text: bijps-1744.txt item: #180 of 579 id: bijps-1747 author: Radhi, Alaa; Al-Shawi, Nada; Hassan, Ali title: Impact of omega 3 alone or in combination with irinotecan on bone marrow and spleen of rats: in vivo study date: 2023-06-16 words: 3949 flesch: 60 summary: Results Irinotecan (Group II rats), caused a significant-reduction (P<0.05) in the mitotic index in bone marrow cells (Figure 1), and in the spleen cells (Figure 2) as compared to corresponding levels in the control (Group I) rats. Administration of omega-3 fish oil (600mg/kg/day) in association with irinotecan (Groups IV) rats, there was a significant-elevation (P<0.05) of the mitotic index in bone marrow cells (Figure 1), and in the spleen cells (Figure 2) compared to corresponding index in rats’ tissues of Group ΙΙ. keywords: acids; bone; cancer; cells; days; fatty; fish; group; index; irinotecan; marrow; oil; omega-3; rats; spleen cache: bijps-1747.pdf plain text: bijps-1747.txt item: #181 of 579 id: bijps-1767 author: AL-Saffar, Haidar; Munaf H. Zalzala title: The Possible Protective Effect of Cinnamic Acid on Ovalbumin-Induced Asthma in Mice date: 2023-06-16 words: 3774 flesch: 62 summary: Group II: asthma model group. Group III: cinnamic acid control group; mice received cinnamic acid 50 mg/kg in liquid paraffin orally by gavage. keywords: acid; asthma; cinnamic; effect; group; mice; model; ova; tissue cache: bijps-1767.pdf plain text: bijps-1767.txt item: #182 of 579 id: bijps-1776 author: ibrahim, Ruaa mohammed; Zahraa Suhail Nassir title: Detection of Epicatechin in Camellia sinensis Leaves by Thin Layer Chromatography and High Performance Liquid Chromatography Techniques date: 2022-12-25 words: 3189 flesch: 55 summary: (4) 1Corresponding author E-mail: Received: / / Accepted: / / Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol31iss2pp304-312 Iraqi J Pharm Sci, Vol.31(2) 2022 Detection of epicatechin in tea leaves by TLC and HPLC 305 There are three types of tea taken from Camellia sinensis which are either not fermented like white and green tea, or partially fermented like oolong and red tea, and completely fermented like black tea, those compositions of those types are influenced by the process of fermentation(5). According to our work, the highest percentage of yield was obtained from maceration method of green tea (GT) which was (1.796) while for the decoction method of GT gave the highest yield which was (1.683), when we used 50% aqueous ethanol as solvent in two extraction method. keywords: acetate; epicatechin; ethanol; ethyl; figure; fractions; green; hplc; leaves; sinensis; tea; tlc cache: bijps-1776.pdf plain text: bijps-1776.txt item: #183 of 579 id: bijps-1781 author: alidee, Tahani; Habbal, Hoda; Karabet , Francois title: Chitosan- (Prunus avium) Gum Nanocapsules Loaded with Orange Peel Extract: Nanocapsules Loaded with Orange Peel Extract date: 2023-06-20 words: 5230 flesch: 57 summary: Hussein, A. M., Kamil, M. M., Lotfy, S. N., Mahmoud, K. F., Mehaya, F. M., & Mohammad, A. A. Influence of nano-encapsulation on chemical composition, antioxidant activity and thermal stability of rosemary essential oil. Avadi, M. R., Sadeghi, A. M. M., Mohammadpour, N., Abedin, S., Atyabi, F., Dinarvand, R., & Rafiee-Tehrani, M. Preparation and characterization of insulin nanoparticles using chitosan and Arabic gum with ionic gelation method. keywords: chitosan; encapsulation; extract; food; gum; journal; nanocapsules; orange; prunus; ratio; release; size cache: bijps-1781.pdf plain text: bijps-1781.txt item: #184 of 579 id: bijps-1789 author: Wrood Salim; sameh Arif, Inam ; Talib Al-sudani, Basma title: Role of Fasting Mimicking Diet in Farnesoid x Receptor for Suppressing Epithelial-to-Mesenchymal Transition, Cell Cycle Progression, and Viability of Prostate Cancer Cells date: 2023-06-16 words: 6984 flesch: 59 summary: Results FXR activation and FMD inhibits PC-3 viability and induce apoptotic morphological changes The effect of FXR and FMD on the growth and proliferation of prostate cancer cells was measured. (B) Representative photomicrograph shows morphological changes of prostate cancer cells and imaged by inverted phase-contrast microscope (total magnification 400x). keywords: 747; activation; assay; cancer; cancer cells; cells; control; cycle; effects; figure; fmd; fxr; int; invasion; mesenchymal; migration; pc-3; phase; prostate; prostate cancer; study; treatment cache: bijps-1789.pdf plain text: bijps-1789.txt item: #185 of 579 id: bijps-1790 author: Oktavia, Listiana; Evana, Evana; Fahardita, Reza ; Agusta, Andria title: Optimization of Bis-anthraquinones Production from Endophytic Fungi Diaporthe sp. GNBP-10 date: 2023-06-16 words: 3946 flesch: 55 summary: Dextrose displayed a better nutrient than glucose for epi production in Diaporthe sp. GNBP-10, as shown by higher epi production in media 3 (0.484 mg) than in media 2 (0.3705 mg). A series of culture media with various nutrient compositions was investigated in epi and bis production. keywords: anthraquinones; bis; content; culture; diaporthe; epi; extract; fungi; gnbp-10; media; production cache: bijps-1790.pdf plain text: bijps-1790.txt item: #186 of 579 id: bijps-1794 author: Nugroho, Akhmad Kharis; Kusumorini, Nindya; Pramono, Suwijiyo; Martien, Ronny title: An update on Nanoparticle Formulation Design of Piperine to Improve its Oral bioavailability: A Review date: 2023-06-16 words: 10333 flesch: 48 summary: They function to increase drug solubility, absorption rate, and bioavailability and reduce inter- and intra-individual variability in drug pharmacokinetics (55,56). The lipids in the GIT (gastrointestinal tract) stimulate the excretion process of bile salts and endogenous bile lipids which also supports lipid emulsification to form micelles and improves drug solubility in the GIT (65).Surfactants can cause fluidization of intestinal membranes and opening of tight junctions which result in increased membrane permeability (68,69). keywords: absorption; bioavailability; cancer; complexes; compounds; cyclodextrin; delivery; design; drug; drug delivery; formulation; inclusion; increase; iraqi; j pharm; journal; lipid; method; nanoparticle; permeability; pharm; piperine; polymeric; release; sci; self; snedds; solubility; spherical; stability; system; vol.32; water cache: bijps-1794.pdf plain text: bijps-1794.txt item: #187 of 579 id: bijps-1798 author: ghanim, waleed khalid; Muhsin S. G. Al-Moziel; Hussein M. Abood title: Study The Lung-Protective Effects of Riboflavin and Cyanocobalamin Against Lung Toxicity-Induced by Cyclophosphamide in Rats date: 2023-06-16 words: 3994 flesch: 52 summary: Group three and four respectively; and pre-treatment with (0.1mg/kg) of vitamin B12 Group five and pre- treatment with the mixture of both vitamins Group six and seven respectively; before CP injection produce a significant increase in TAC levels this could be explained by their ability to maintain antioxidant enzyme levels including superoxide dismutase, glutathione level in which vitamin B2 plays an important role (24); furthermore the role of vitamin B12 as a scavenger for free radicals (21, 25) and its role in modulating the level of the inflammatory cytokines (25). Group two shows inflammatory cells that found with nuclear fragmentation and pyknosis with a thickness of the alveolar wall which confirms the effects of CP when compared with Group one, however rats pre-treated with different doses of vitamin B2 Groups three and four and a fixed dose of vitamin B12 Group five prior to CP shows fewer histopathological changes such as inflammatory cell, karyorrhexis and destruction of alveolar-like emphysema when compared with Group two furthermore; rats pre-treated with combinations of different doses of vitamin B2 and fixed-dose of vitamin B12 Groups six and seven prior to CP injection shows improvement in lung tissue compared with other treated groups that have noted normal architecture alveolar wall this attributed to the effects of both vitamin B2 and vitamin B12 as the antioxidant activity and their ability to increase the level of glutathione which consist with the finding of Bashandy SA et al and Moshiri M et al which founds that vitamin B2 and vitamin B12 have an important role in the maintenance glutathione level and conversion of glutathione from oxidized form to reduced form (26, 27). keywords: b12; cyclophosphamide; day; dose; effects; group; lung; rats; riboflavin; study; vitamin cache: bijps-1798.pdf plain text: bijps-1798.txt item: #188 of 579 id: bijps-1800 author: Khaleel, Raghad Abdulsalam; Zalzala, Munaf Hashim title: The Ameliorating Effect of Oral Paquinimod Administration against Imiquimod Induced Psoriasis-like Inflammation in Mice date: 2023-06-16 words: 4685 flesch: 51 summary: These results are consistent with the previous researches that reported the Potent disease-inhibitory effects in experimental models of autoimmune diseases(16).A study by Martin Stenström(2016) revealed that Paquinimod reduces skin fibrosis in tight skin 1 mice, an experimental model of systemic sclerosis they found that Paquinimod reduces skin fibrosis in an experimental model of SSc, and this effect correlates with local and systemic effects on the immune system(4).Another study by Nina Franse´n Pettersson(2018) showed that The immunomodulatory quinoline-3- carboxamide paquinimod reverses established fibrosis in a novel mouse model for liver fibrosis(18).The anti- inflammatory effect for paquinimod revealed a significant reduction in the expression of paquinimod treated group in comparison to the model group, indicating the strong anti- inflammatory effect of paquinimod against psoriasis induced by imiquimod and this can be proved by histopathological examination of mice skin section which has been revealed that paquinimod reduced skin inflammation, scaling, thickness, parakeratosis and epidermal infiltration that have been induced by imiquimod. Paquinimod successfully reduced the gene expression for IL-17 in comparison to model mice. keywords: administration; control; effect; figure; group; il-17; imiquimod; imq; mice; model; paquinimod; psoriasis; significant; skin; tnf; vehicle cache: bijps-1800.pdf plain text: bijps-1800.txt item: #189 of 579 id: bijps-1801 author: Abd allatif, Karima; Jameela Ali Hasian title: Preparation and in Vitro Evaluation for Different Types of Ondansetron Hydrochloride Transdermal Patches date: 2023-06-16 words: 4415 flesch: 64 summary: These results are in agreement with mutalic et al where the formulation with EC:PVP (3:2) exhibited the greatest percentage of drug release value (71.25 %±8.55) compared to the lowest value observed with the formulation containing EC:PVP (4.5:0.5) (47.65%±9.55)(23). . Furthermore, the presence of PVP in patches with chloroform as casting solvent reduce the crystalline state of the drug, which leads to an increase in drug release. keywords: buffer; drug; figure; formulation; hydrochloride; ondansetron; patches; pharm; pvp; release; sci; solution; transdermal cache: bijps-1801.pdf plain text: bijps-1801.txt item: #190 of 579 id: bijps-1808 author: Mahde, Samah; Sarmad Haishm title: Carvone exerts lung anti-inflammatory effect through hampering NF-KB pathway in lipopolysaccharide-induced acute lung injury in mice date: 2023-06-16 words: 5275 flesch: 62 summary: Analysis and calculation of gene expression levels of TNF- α, NF –κB, COX 2, and glyceraldehyde-3- phosphate dehydrogenase (GAPDH), depend on mRNA concentration after converting it to complementary DNA. The ALI is caused by neutrophil leakage, production of a huge amount of pro-inflammatory cytokines, injury to airway epithelium and alveolar endothelium which lead to pulmonary fluid accumulation, and the impairment in gases exchange. keywords: acute; carvone; day; effect; expression; gene; group; inflammatory; injury; level; lipopolysaccharide; lps; lung; mice; model; mrna; tnf cache: bijps-1808.pdf plain text: bijps-1808.txt item: #191 of 579 id: bijps-1825 author: AL-SHOHANI, Athmar Dhahir Habeeb; Zahraa Yahya Sabri title: The Effect of Molecular Imprinting on the Loading and Release of Poorly Water Soluble Drug in Hydrogel Gontact Lenses date: 2023-06-16 words: 5524 flesch: 62 summary: Furthermore, using the Korsmeyer-Peppas model to experimental data and explaining the release exponent values (n) provides to a better understanding of the mechanism of contact lenses release. Cumulative release in mcg of ITZ from conventional and MICLs represents the release for 24 h. Analysis of drug release kinetics Various mathematical models, such as zero order, first order, and Higuchi, were used to fit in- vitro release data. keywords: cls; contact; drug; hydrogel; imprinting; itz; journal; lenses; loading; maa; methanol; micls; prepared; release; solubility; solvent; water cache: bijps-1825.pdf plain text: bijps-1825.txt item: #192 of 579 id: bijps-1827 author: Hafidh, Rand R.; Ali, Zahraa Q. ; Abdulamir, Ahmed S. title: Autophagy or Apoptosis: Anticancer Molecular Mechanism of Epigallocatechin Gallate with Natural Polyphenol Effect on HepG2 Cells Viability date: 2023-06-16 words: 6328 flesch: 59 summary: In cancer cells, apoptosis and autophagy play a critical role in the biological process of cancer (8). Natural products-prompted autophagy is mostly causing death of tumor cells when apoptosis is totally defective in cancer cells (11). keywords: anticancer; apoptosis; autophagy; cancer; cells; effect; egcg; epigallocatechin; expression; gallate; genes; hepg2; hepg2 cells; human; mechanism; protein; role; sci; study; treatment cache: bijps-1827.pdf plain text: bijps-1827.txt item: #193 of 579 id: bijps-1842 author: Marouf, Bushra Hassan; Ghafour Hama Saeed, Ahmed ; Othman, Zhinya ; Karim, Sima ; Gharib , Sava ; Ahmed, Roya title: Awareness and Frequency of using Lifestyle Medications among University Students in Kurdistan Region-Iraq date: 2023-06-20 words: 5648 flesch: 58 summary: Iraqi J Pharm Sci, Vol.32( 1 ) 2023 University students and life style medications 187 Inclusion and exclusion criteria The sampling scheme included undergraduate university students of both gender, age of 18 and above years, residing at the university campuses in the three cities; Sulaimani, Hawler, and Duhok Cities-Kurdistan Region-Iraq. Iraqi J Pharm Sci, Vol.32( 1 ) 2023 University students and life style medications DOI: https://doi.org/10.31351/vol32iss1pp185-193 185 Awareness and Frequency of using Lifestyle Medications among University Students in Kurdistan Region-Iraq ,*Othman Kawa Zhinya ,** Saeed Hama Ghafour Ahmed ,1,* Marouf Hassan Bushra ***Ahmed Jaza Mohammed Roya and *Gharib M Othman Sava ,*Karim Arkan Sima Iraq Sulaimani ,Sulaimani of University Pharmacy, of College ,Toxicology and Pharmacology of Department * Iraq Sulaimani ,Sulaimani of University Pharmacy, of College , Pharmacy Clinical of Department ** Iraq , Sulaimani, Sulaimani of University ,Medicine of College *** Abstract Life style medications (LSMs) are used for the improvement of lifestyle of an individual. keywords: caffeine; consumption; drugs; effects; life; lifestyle; lsms; medical; medications; number; prevention; students; study; sulaimani; table; university; university students; use cache: bijps-1842.pdf plain text: bijps-1842.txt item: #194 of 579 id: bijps-1846 author: Ausama Ayob Jaccob; Fatima F. Dari; Muhsin S.G. AL-Moziel title: The Impact of Citrus Bergamot Extract on Hemato- Biochemical, Inflammatory and Oxidative stress Parameters Induced by Acute Amikacin Toxicity in male Albino Rats date: 2023-06-27 words: 4801 flesch: 57 summary: البرغموت ، االلتهاب ، التأكسدي اإلجهاد ، الكلوية السمية أميكاسين، : Changes in rat body weights with respect to days of the experiments. keywords: administration; amikacin; bergamot; bergamot extract; cbe; citrus; citrus bergamot; control; days; dose; effect; extract; groups; levels; lipid; nephrotoxicity; rats; serum cache: bijps-1846.pdf plain text: bijps-1846.txt item: #195 of 579 id: bijps-1855 author: Al-Hasani, Lina; Ghaith A. Jasim; Ihsan S. Rabeea title: Evaluation of Renoprotective Effect of Lipoic Acid and Bosentan Against Diclofenac-Induced Acute Renal Failure date: 2023-07-15 words: 5882 flesch: 55 summary: Lipoic acid group, rats received lipoic acid 200mg/kg by preparing a stock solution of 600mg of α-lipoic acid in 10ml distilled water (each 1ml contains 60mg of α-lipoic acid as suspension) delivered orally by oral gavage for 11 days, on the 5th day they received an intraperitoneal injection of diclofenac sodium (100mg/kg). Lipoic acid group showed non- significant reduction in both serum urea and creatinine levels when compared to induction group. keywords: acid; acute; aki; biomarkers; bosentan; combination; creatinine; diclofenac; effect; fibronectin; group; induction group; injury; kidney; levels; lipoic; rats; renal; serum; serum levels; significant; study; urea cache: bijps-1855.pdf plain text: bijps-1855.txt item: #196 of 579 id: bijps-1856 author: Essa, Narmin; Aladul, Mohammed title: Physicians’ Perception and Practice of Prescribing Vitamin B Combination versus Antiepileptic Drugs for Diabetic Neuropathy: Content Validity, Reliability and Pilot Study date: 2023-06-20 words: 9622 flesch: 57 summary: Agree, neutral, disagree Item 5 Knowledge about vitamin B complex/B12 Vitamin B complex/ B12 supplementation can prevent the development of DN Agree, neutral, disagree Vitamin B complex/ B12 supplementation can treat DN Agree, neutral, disagree Vitamin B complex/ B12 supplements are safe for long term use in treatment of DN Agree, neutral, disagree Item 6 The knowledge and perception domain aimed to closely examine the basic knowledge and the general perception of the physicians about DN (including the commonality of DN, its effect on patient’s Iraqi J Pharm Sci, Vol.32(1) 2023 Vitamin B combination and diabetic neuropathy 205 quality of life, mortality rate and the difficulty of treatment in addition to the perception about dietary supplements and vitamin B). keywords: b12; care; combination; content; cvi; diabetes; domain; item; knowledge; management; neuropathy; perception; physicians; practice; questionnaire; respondents; study; supplements; treatment; validity; vitamin; vitamin b cache: bijps-1856.pdf plain text: bijps-1856.txt item: #197 of 579 id: bijps-1865 author: Bedoor A. Salim; Muhsin S.G. AL-Moziel; Jaccob, Ausama Ayob title: Subchronic effect of different doses ofDiclofenac Sodium on female reproductive system in rats. date: 2023-06-27 words: 6360 flesch: 55 summary: Gohel, M. C., et al. Alabi QK, Akomolafe RO, Olukiran OS, Adeyemi WJ, Nafiu AO, Adefisayo MA, et al. keywords: acid; blood; combination; control; diclofenac; doses; effect; female; figure; follicles; groups; levels; nsaids; progesterone; rats; sci; serum; sodium; use cache: bijps-1865.pdf plain text: bijps-1865.txt item: #198 of 579 id: bijps-1866 author: Mariam.R. Alghara; Jaccob, Ausama Ayob; Azza.Sajid. Jabbar title: Assessment of Certain Hematological Indices and Interlukin-6 in Workers and Individuals Who Live Near to Crude Oil Wells in Middle Petroleum date: 2023-06-27 words: 4667 flesch: 59 summary: The aim of the study is to reveal the impact of crude oil exposure on several hematological parameters and IL-6 of oil workers and to detect which parameters are more affected by the exposure to be considered as prognosticators and to find the correlation between these parameters. The aim of the study is to reveal the impact of oil exposure on several hematological parameters and Interleukin-6 of oil workers and to detect which parameters are more affected as prognosticators for clinical disorders. keywords: air; benzene; blood; differences; exposure; group; iii; il-6; indices; oil; p>0.05; parameters; study; wells; workers cache: bijps-1866.pdf plain text: bijps-1866.txt item: #199 of 579 id: bijps-1873 author: Kawa Dizaye; Adeeb Alchalabi , , Dereen ; Marouf, Bushra Hassan title: Effects of flaxseed (Linum usitatissimum) on climacteric symptoms and clinical parameters in post-menopausal women: Flaxseed effects on menopause associated symptoms and biochemical parameters date: 2023-06-27 words: 5594 flesch: 51 summary: Iraqi J Pharm Sci, Vol.32( 1 ) 2023 Flaxseed effects on menopause associated symptoms and biochemical parameters DOI: https://doi.org/10.31351/vol32iss1pp257-265 257 Effects of Flaxseed (Linum usitatissimum) on Postmenopausal Symptoms and its Clinical Parameters Kawa Dizaye*, Dereen Adeeb Alchalabi*and 1Corresponding author E-mail: bushra.marouf@univsul.edu.iq Received: 21/ 4/2022 Accepted: 30/7 /2022 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol32iss1pp257-265 Iraqi J Pharm Sci, Vol.32( 1 ) 2023 Flaxseed effects on menopause associated symptoms and biochemical parameters 258 keywords: blood; body; effect; estrogen; flaxseed; leptin; linum; menopause; post; postmenopausal; pressure; serum; study; symptoms; usitatissimum; weeks; women cache: bijps-1873.pdf plain text: bijps-1873.txt item: #200 of 579 id: bijps-1879 author: Anjana G V title: Synthesis and Atimicrobial Evaluation of Deuterated Analogues of Metronidazole date: 2022-12-25 words: 4179 flesch: 46 summary: In an attempt to check whether the deuterated metronidazole possessed similar pharmacological activity as that of metronidazole, deuterated metronidazole was synthesised using deuterium oxide in the presence of benzoic acid under nitrogen atmosphere. Also, when compared with the non-deuterated compound, deuterated metronidazole exhibited better anaerobic antibacterial and anti-tubercular activity. keywords: activity; anaerobic; analogues; antibacterial; chemistry; deuterium; drug; evaluation; gram; hydrogen; journal; metronidazole; mic; synthesis cache: bijps-1879.pdf plain text: bijps-1879.txt item: #201 of 579 id: bijps-1887 author: Mikhael, Ehab Mudher; Fadya Yaqoob Al-Hamadani; Ali Mohammed Hadi title: Evaluating the Benefits of Using Mobile Application (diarrhea management step by step) in the Management of Diarrhea by Community Pharmacists date: 2023-06-27 words: 6999 flesch: 63 summary: 2. Ibrahim IR, Al-Tukmagi HF, Wayyes A. Attitudes of Iraqi society towards the role of community pharmacists. Attitude of consumers towards community pharmacists and their interest in expanding community pharmacist services in Basra, Iraq: A pilot study. keywords: application; assessment; case; community; diarrhea; iraqi; management; medication; non; patient; pharmacists; pharmacy; role; study; users; visit cache: bijps-1887.pdf plain text: bijps-1887.txt item: #202 of 579 id: bijps-1896 author: Salman, Omar; Maysoon Abdul Zahra Merdaw; Ahmed A. Almaliky title: A Novel Single Nucleotide Polymorphism of Interleukin-10 Gene is Linked to Type 2 Diabetes Mellitus in Iraqi Patients with Toxoplasmosis(Conference Paper )# date: 2023-02-16 words: 5153 flesch: 63 summary: Fifty-five and fifty-eight venous blood specimens were obtained from T2DM patients and age-matched non-diabetic persons, respectively. A higher percentage of T. gondii infection was found in T2DM patients (52.1%) compared to 31.5% of non-diabetic persons. keywords: -1082; allele; association; diabetes; gene; gondii; group; il-10; iraqi; mellitus; patients; polymorphisms; risk; snp; study; t2 dm; toxoplasmosis; type cache: bijps-1896.pdf plain text: bijps-1896.txt item: #203 of 579 id: bijps-1899 author: Shah, Sherine Majeed; Thukaa Z. Abdul-Jalil title: Qualitative and Quantitative Estimation or Chemical Constituents from Leaves and Roots of Iraqi Agave Attenuata by GC-MS and RP-HPLC(Conference Paper) # date: 2023-02-16 words: 4480 flesch: 53 summary: Figure 1: Photo of Iraqi Agave attenuate This study was aimed to develop a suitable extraction and identification procedures which aids in getting the information about the main bioactive constituents in Iraqi Agave attenuata leaves and roots and qualitative estimation of these constituents in n-hexane fraction by GC/MS while qualitative and quantitative estimation of constituents in ethyl acetate, methanol, and steroidal saponins fractions were done by using RP-HPLC. 2022 GC/MS and RP-HPLC estimation of Iraqi agave attenuate 81 Reverse Phase-High-Performance Liquid Chromatography (RP-HPLC) examinations of different fractions RP-HPLC analysis of different extracts for Iraqi Agave attenuata leaves and roots were applied after extraction for further analysis to identify and quantify the major proposed active constituents. keywords: acetate; acid; agave; attenuata; ethyl; fraction; hplc; iraqi; leaves; roots; steroidal cache: bijps-1899.pdf plain text: bijps-1899.txt item: #204 of 579 id: bijps-1908 author: Humadi, Suhad; Hassan, Saif M. ; Ahjel , Salam W. title: A Cross-Sectional Survey of Iraqi Herbalist Practicing in the Middle Euphrates Area with a Recognition of their Knowledge, Practice and Attitude(Conference Paper )# date: 2023-02-18 words: 5795 flesch: 55 summary: % secondary aim is to provide the baseline data for researchers for further investigations regarding herbalist practice, thus generating a proper model for herbalist practice. keywords: data; experience; health; herbalists; information; iraqi; journal; knowledge; medicine; patients; practice; products; remedies; safety; source; study; survey; total; use; years cache: bijps-1908.pdf plain text: bijps-1908.txt item: #205 of 579 id: bijps-1911 author: Al-Tukmagi, Haydar; Al-Qazaz, Harith; Shanshal, Sadeel; Al-Kaisey, Muhanad title: Self-Medication Towards Antibiotic Use Among Non- Medical University Staff (Conference Paper )# date: 2023-02-16 words: 5029 flesch: 56 summary: Haque M, Rahman NAA, McKimm J, Kibria GM, Majumder MAA, Haque SZ, et al. Self- medication of antibiotics: investigating practice among university students at the Malaysian National Defence University. Ateshim Y, Bereket B, Major F, Emun Y, Woldai B, Pasha I, et al. Prevalence of self- medication with antibiotics and associated factors in the community of Asmara, Eritrea: a descriptive cross sectional survey. keywords: antibiotics; figure; health; medication; participants; pharm; practice; resistance; sci; self; selfmedication; study; university; use cache: bijps-1911.pdf plain text: bijps-1911.txt item: #206 of 579 id: bijps-1916 author: Satar_Al_Baaj, Azal; Abdul-Jalil1, Thukaa Z. title: Phytochemical Screening of Petroleum Ether Fractions by GC/MS and Isolation of Lupeol from Two Different Parts of Iraqi Leucaena leucocephala. (Conference Paper )# date: 2023-02-16 words: 4671 flesch: 33 summary: 2022 Phytochemical screening of two different parts of Iraqi Leucaena leucocephala 67 Table 4. GC-MS analysis of petroleum ether leaves extract of Leucaena leucocephala by hot extraction method. 2022 Phytochemical screening of two different parts of Iraqi Leucaena leucocephala 68 Table 5. GC-MS analysis of petroleum ether leaves extract of Leucaena leucocephala by cold extraction method. keywords: acid; analysis; ester; ether; extraction; fatty; fractions; iraqi; leaves; leucaena; leucocephala; lupeol; method; methyl; petroleum; phytochemical; stems cache: bijps-1916.pdf plain text: bijps-1916.txt item: #207 of 579 id: bijps-1917 author: Jewely, Hind Mohammed; Thukaa Zuhair title: Evaluation of Antileishmanial Activity of Osteospermum ecklonis Extract of Aerial Parts against Leishmania donovani: in vitro(Conference Paper) # date: 2023-02-16 words: 4024 flesch: 54 summary: In vitro antileishmanial efficacy DOI: https://doi.org/10.31351/vol31issSuppl.pp45-53 45 Evaluation of Antileishmanial Activity of Osteospermum ecklonis Extract of Aerial Parts against Leishmania donovani: in vitro(Conference Paper) # Hind M. Jewelee*,1 and Thukaa Z.Abdul-Jalil * # 10th scientific conference sponsored by College of Pharmacy, University of Baghdad 2-3 June 2022 *Department of Pharmacognosy and Medicinal Plants, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract Lack of safe available non -resistant treatment for visceral leishmaniasis (Kala-azar) keeps limiting the complete cure of this disease, drugs that have toxic side effects or lack of effectiveness have led to disease relapse, all these factors have lightened the way to the search for alternative drugs from natural resources that have been shown to have antileishmanial activity through literature survey In the present study, the comparative in vitro anti-leishmania activity of various fractions of Osteospermum ecklonis aerial parts fractions have been evaluated. Extracts were prepared through maceration and Soxhlet apparatus using 85% methanol and fractionation was done by separating the active constituents according to the differences in their polarities using four solvents in different polarities )petroleum ether, chloroform, ethyl acetate, and finally n-butanol( ،Two of the resultant fractions( petroleum ether as well as n- butanol fractions ) were chosen to test the effective inhibition of Leishmania donovani, Results prove with no doubt that the petroleum ether fraction of the maceration aerial parts in a concentration of 2.5 mg/ml had better antileishmanial activity than other concentrations of tested samples and the result coincided with the anti- leishmaniasis activity of official treatment (pentostam®) ,This finding can be attributed to the terpene nature of the materials used to be existed in such fraction. keywords: -ve; activity; control; ecklonis; ether; extraction; figure; fraction; maceration; osteospermum; parts; plant; test cache: bijps-1917.pdf plain text: bijps-1917.txt item: #208 of 579 id: bijps-1925 author: Abdulkhaleq, Nuha Mohammed; Ghareeb, Mowafaq M. title: Combination of FDM 3D Printing and Compressed Tablet for Preparation of Baclofen as Gastro-Floating Drug Delivery System (Conference Paper )# date: 2023-02-16 words: 4194 flesch: 57 summary: Anjali Devi N, Hadi MA, Rajitha P, Sharma JVC, Srinivasa Rao A. Formulation and evaluation of floating controlled release tablets of Imatinib mesylate using hydrophilic matrix system. Development of sustained release tablets containing solid dispersions of baclofen. keywords: baclofen; delivery; device; drug; eudragit; extrusion; gastro; melt; pharmaceutical; printing; release; tablets; time; weight cache: bijps-1925.pdf plain text: bijps-1925.txt item: #209 of 579 id: bijps-1927 author: Al-Tamimi, Duaa; Al-Kinani, Khalid; Taher, Salam; Hussein, Ahmed title: Effect of Food on the Pharmacokinetics of Fluoxetine in Healthy Male Adult Volunteers(Conference Paper )# date: 2023-02-18 words: 6289 flesch: 55 summary: In the fed study, FX capsules were administered to the same volunteers who received the drug in the fasting study after a washout period of 90 days after ending the fasting study by applying the same clinical procedures mentioned above, except FX capsules, were administered to the volunteers directly after serving a fatty breakfast. Thus, food intake with FX capsules may influence the onset rather than the intensity of the effect of FX. keywords: blood; capsules; clinical; drug; fasting; fed; fluoxetine; parameters; pharmacokinetics; plasma; study; time; volunteer cache: bijps-1927.pdf plain text: bijps-1927.txt item: #210 of 579 id: bijps-1932 author: Atia, Ahmed; Nouran Gzllal; Malak Gharibe title: Evaluation of Drug Prescription Pattern Using WHO Prescribing Indicators in Libya: A Cross-Sectional Study date: 2023-06-27 words: 4744 flesch: 57 summary: Nonetheless, the prescription model is used in all three districts of Libya, and the pattern of drug prescription is likely to be consistent throughout the country. Atia A. Physician trends of drug prescription in Libya: A pharmacoepidemiological study. keywords: antibiotics; drug; health; indicators; libya; pattern; percentage; prescribed; prescribing; prescription; study; use cache: bijps-1932.pdf plain text: bijps-1932.txt item: #211 of 579 id: bijps-1991 author: Alabdali, Hala; Algaem, Manal title: Study anti-inflammatory effect of Tamsulosin in rat by evaluation IL-4, IL-6 and TNF-α: airway model. date: 2023-06-27 words: 4634 flesch: 51 summary: There was a significant reduction (P-value<0.05) of IL- 4 and TNF-α in serum for tamsulosin treated group (D) and group (E) when compared with the positive control group (B) but only group (D) (35mcg/kg/d) tamsulosin showed significant reduction (P-value<0.05) in IL-6 level when compared with the positive control group (B). Group B: negative control group, rats were exposed to airway sensitization only. keywords: airway; control; control group; group; group d; mcg; rats; sensitization; tamsulosin; tnf cache: bijps-1991.pdf plain text: bijps-1991.txt item: #212 of 579 id: bijps-1999 author: Murtadha Saleh Hussien; Ayad A. Al-Hamashi title: Phytosterol Profile in Iraqi Lactuca serriola after Purification and Isolation by Combiflash and HPLC (Conference Paper )# date: 2023-02-16 words: 3368 flesch: 58 summary: 1- Liebermann-Burchard test: A small amount of plant hexane extract was dissolved in 5 ml of chloroform, and the chloroform layer was then dried over anhydrous sodium sulfate. Early civilizations in China, India, and the Near East used medicinal plants as a source of sickness relief (2,3). keywords: chromatography; combiflash; figure; fraction; hexane; hplc; iraqi; lactuca; phytosterol; plant; serriola; sitosterol; standard; stigmasterol cache: bijps-1999.pdf plain text: bijps-1999.txt item: #213 of 579 id: bijps-2000 author: Alabdly, Ammar; J. Kassab, Hanan title: Formulation Variables Effect on Gelation Temperature of Nefopam Hydrochloride intranasal in Situ Gel (Conference Paper) # date: 2023-02-16 words: 6362 flesch: 62 summary: 2022 Nefopam HCl intranasal in situ gel 34 Preparation of NF HCl intranasal in situ gel The cold approach was applied to formulate different compositions of mucoadhesive thermosensitive in situ gel as detailed in Table 1. pH of NF HCl intranasal in situ gel keywords: cm-1; drug; ftir; gel; gelation; hcl; intranasal; mucoadhesive; nefopam; p.i; ppt; sci; situ; table; temperature cache: bijps-2000.pdf plain text: bijps-2000.txt item: #214 of 579 id: bijps-2004 author: Radeef, Mohanad Yasir; Khalid Saud Saleh title: Drug Information Resources in Iraqi Community Pharmacies (Conference Paper) # date: 2023-02-16 words: 4200 flesch: 60 summary: Chauhan N, Moin S, Pandey A, Mittal A, Bajaj U. Indian aspects of drug information resources and impact of drug information center on community. Qadus S, Naser AY, Al-Rousan R, Daghash A. Utilization of drug information resources among community pharmacists in Jordan: A cross-sectional study. keywords: community; drug; drug information; information; internet; iraqi; participants; pharmacists; pharmacy; resources; study; use cache: bijps-2004.pdf plain text: bijps-2004.txt item: #215 of 579 id: bijps-2009 author: Tawfeeq, Amani Amer; Shatha H Ali title: Isolation and Structural Characterization of Quercetin 3-O-Rhamnoside and Essential oil Estimation from Leaves of Iraqi Cupressus sempervirens L (Conference Paper )# date: 2023-02-16 words: 5256 flesch: 55 summary: In this work, the extraction yield of the EO from the leaves of Iraqi Cupressus sempervirens L. was 0.9%. Cupressus sempervirens have been ethnobotanicals as an antiseptic, relief of cough, astringent, antispasmodic, wound healing, and anti-inflammatory. keywords: analysis; butanol; compound; cupressus; cupressus sempervirens; extraction; figure; fraction; hplc; identification; iraqi; isolation; leaves; oil; plants; quercitrin; rhamnoside; sempervirens; standard cache: bijps-2009.pdf plain text: bijps-2009.txt item: #216 of 579 id: bijps-2017 author: Ong, Siew Chin; Mikhael, Ehab Mudher title: Knowledge, Attitudes, Practices, and Online Distance Learning Experience of Malaysian University Students towards COVID-19: A Cross Sectional Study(Conference Paper )# date: 2023-02-16 words: 5566 flesch: 65 summary: The higher knowledge about COVID-19 among Indian students than students from other ethnic groups (20) may be the main reason for such better adherence to COVID-19 preventive practices (21). In conclusion, the knowledge and practice toward COVID-19 was good in less than half of Malaysian university students. keywords: attitudes; covid-19; hand; health; knowledge; learning; malaysian; n(%; online; pandemic; participants; practice; students; study; table; university cache: bijps-2017.pdf plain text: bijps-2017.txt item: #217 of 579 id: bijps-2018 author: Al-Metwali, Basma Zuheir; Hatem Nsaif, Farah title: Knowledge, Perception, and Reporting Practices of Healthcare Providers about Adverse Events Following the COVID-19 Vaccination in Iraq(Conference Paper )# date: 2023-02-18 words: 5852 flesch: 59 summary: Questions Frequency(N) Percentage AEFIs causes: (Multiple answers possible): Vaccine-product related reaction 86 74 Vaccine-quality defect-related reaction 26 22 Immunization error-related reaction 29 25 Immunization anxiety-related reaction 22 19 Coincidental reaction 26 22 Methods of COVID-19 vaccine AEFI reporting: Filling of AEFI form 85 73 Reporting via social media group 15 13 Email/online 10 9 Talking to colleague 7 6 AEFI can be caused by reconstituted vaccines stored longer than normal, vaccine reaction, inappropriate route of administration, vaccines stored beyond the expiry date, or contaminated vaccines. Reporting practice of AEFI of COVID-19 vaccine by study participants Association of Socio-Demographic Characteristics and AEFI Knowledge, Perception and Practice Respondents’ profession was found to significantly affect knowledge on AEFI (Table 5). keywords: aefis; covid-19; events; good; hcps; health; immunization; knowledge; perception; pharmacists; practice; reporting; respondents; study; vaccination; vaccine cache: bijps-2018.pdf plain text: bijps-2018.txt item: #218 of 579 id: bijps-2023 author: Al-Metwali, Basma Zuheir; Majid Shaukat, Juan title: Knowledge, Attitude, and Practices of Iraqi Community Pharmacists Toward Emergency Contraceptives (Conference Paper )# date: 2023-02-16 words: 6280 flesch: 62 summary: % 61.8( سنة, 29-24في الفئة العمرية ) % 67.9صيدلي مجتمع, 212 منهم لديهم مواقف جيدة جدا. keywords: attitude; community; contraceptives; dispensing; ecs; effects; emergency; knowledge; level; participants; pharmacists; practice; study; years cache: bijps-2023.pdf plain text: bijps-2023.txt item: #219 of 579 id: bijps-2030 author: Shniakat, Wafa Naji; Ekbal H. Al-Khateeb, Ekbal H. ; Numan, Nawfal A.M.; Manal M. Abbas; Shakya, Ashok title: Cytotoxic Evaluation of Doxorubicin Combination with Baicalein and Resveratrol Against Hct116 and Hepg2 Cancer Cell Lines (Conference Paper) # date: 2023-02-16 words: 4362 flesch: 54 summary: HCT116 (colorectal cancer cells) and HepG2 (hepatocellular cancer cells). 2022 Doxorubicin combination with baicalein and resveratrol 97 Discussion Natural products baicalein (BA) and resveratrol (RSV) combinations along with doxorubicin (DOX) at constant ratio (1:1:1) produced significant increase in DOX toxicity compared to treatment with DOX alone in both types of cancer cell line. keywords: baicalein; cancer; cells; combination; compounds; concentration; dox; doxorubicin; hct116; hepg2; ratio; resveratrol; rsv; toxicity cache: bijps-2030.pdf plain text: bijps-2030.txt item: #220 of 579 id: bijps-2031 author: Adnan, Manar; RoaaA.Nief; Shaimaa Nazar Abd-Al Hameed; Haneen Abdulhadi Kharaba title: Preparation and In-Vitro Evaluation of Floating Oral In- Situ Gel of Montelukast Sodium (Conference Paper) # date: 2023-02-18 words: 4016 flesch: 62 summary: Preparation of in situ gel In situ gel formulations were made using the ingredients listed in Table (1). Table 1.Floating in situ gel formulations of montelukast sodium Formulation code Montelukast sodium (mg) Gellan gum (%w/v) Sodium alginate (%w/v) Pectin (%w/v) CaCO3(%w/v) Sodium citrate (%w/v) F1 4.2 0.25 0.75 0.17 F2 4.2 0.5 0.75 0.17 F3 4.2 1.0 0.75 0.17 F4 4.2 0.25 0.75 0.17 F5 4.2 0.5 0.75 0.17 F6 4.2 1.0 0.75 0.17 F7 4.2 0.25 0.75 0.17 F8 4.2 0.5 0.75 0.17 F9 4.2 1.0 0.75 0.17 F10 4.2 1.0 1.5 0.17 * keywords: delivery; drug; formulation; gel; gelling; montelukast; oral; pharm; release; sci; situ; sodium cache: bijps-2031.pdf plain text: bijps-2031.txt item: #221 of 579 id: bijps-2032 author: Al-Jumaili, Ali Azeez; Sameer, Hayder Naji title: The Insights of Experienced Pharmacists Regarding the Iraqi health Insurance Program: A Qualitative Study(Conference Paper )# date: 2023-02-16 words: 6521 flesch: 52 summary: Health insurance is defined as an insurance system which covers medical expenses by a third party (7). Health insurance is a good thing because when the patient visits hospitals or the private sector, the fees paid are low because the services are subsidized(Ph-14). keywords: health; health insurance; healthcare; implementation; insurance; insurance program; iraqi; national; patients; people; pharmacists; program; providers; public; sector; services; system cache: bijps-2032.pdf plain text: bijps-2032.txt item: #222 of 579 id: bijps-2033 author: Fadhil, Hasan Raid ; Al-Jumaili, Ali Azeez; Al-Ani, Nizar Abdulateef title: Cost-effectiveness Analysis of Reference Infliximab (Remicade) Compared to its Biosimilar (Remsima) in Iraqi Patients with Rheumatoid Arthritis (Conference Paper )# date: 2023-02-16 words: 6818 flesch: 59 summary: Jørgensen TS, Turesson C, Kapetanovic M, Englund M, Turkiewicz A, Christensen R, et al. EQ-5D utility, response and drug survival in rheumatoid arthritis patients on biologic monotherapy: A prospective observational study of patients registered in the south Swedish SSATG registry. Thus, the inclusion criteria were RA patients who received infliximab for at least 14 weeks and had a medical record with infliximab follow-up data. keywords: analysis; arthritis; cdai; cost; disease; effectiveness; infliximab; iraqi; patients; qol; remicade; remsima; rheumatoid; study; table; therapy; treatment; utility; value; weeks cache: bijps-2033.pdf plain text: bijps-2033.txt item: #223 of 579 id: bijps-2034 author: Alfetlawi, Bashar; Jasim, Ali title: Determining the Prevalence of Upper and Lower Urinary Tract Infections’ Pathogens and Their Antibiotic Susceptibility Profile for Adult Patients in Al-Diwaniya, Iraq (Conference Paper) # date: 2023-02-16 words: 3998 flesch: 58 summary: Multiple drugs resistance among urinary tract infection patients in Duhok City – Kurdistan Region –Iraq. الممرض البولي، الحساسية للمضادات Introduction One of the most prevalent bacterial infections is urinary tract infection (UTI) (1). keywords: coli; gram; infections; iraq; patients; profile; resistance; sci; spp; study; susceptibility; tract; urinary; uropathogens; uti cache: bijps-2034.pdf plain text: bijps-2034.txt item: #224 of 579 id: bijps-343 author: N. Hamad, Maha title: Detection and isolation of flavonoids from Calendula officinalis (F.Asteraceae) cultivated in Iraq date: 2017-03-26 words: 2317 flesch: 54 summary: Iraqi J Pharm Sci, Vol.25(2) 2016 Flavonoids of Calendula officinalis 1 Detection and isolation of flavonoids from Calendula officinalis (F.Asteraceae) cultivated in Iraq Maha N. Hamad *,1 * Department of Pharmacognosy and Medicinal Plants , College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract Calendula officinalis L. (Asteraceae) known as marigold is known to have several pharmacological activities and used for the treatment of several diseases as measles, jaundice, constipation and several inflammations. Iraqi J Pharm Sci, Vol.25(2) 2016 Flavonoids of Calendula officinalis 3 Table (I):- Rf values of standard quercetin and kaempferol compared with isolated aglycons I&II in different mobile phases. keywords: butanol; calendula; flavonoids; flowers; fraction; hplc; marigold; officinalis; quercetin; rutin; standard cache: bijps-343.pdf plain text: bijps-343.txt item: #225 of 579 id: bijps-344 author: Hadi, Hind; Mouayed, Marwa title: Spectrophotometric Determination of Nitrofurantoin Drug in its Pharmaceutical Formulations Using MBTH as a Coupling Reagent date: 2017-03-26 words: 4075 flesch: 48 summary: Figure (10):-Absorbance versus time graphs Figure (11):- Log (rate) versus log [NIT] graphs The rate of reaction was also found to be dependent on NIT concentrations. Hence k' = 3122.4 min -1 = 52 sec -1 and the reaction is first order (n = 1.2944)with respect to NIT concentration. keywords: absorbance; determination; figure; mbth; method; nit; nitrofurantoin; pharmaceutical; reaction; reagent; solution cache: bijps-344.pdf plain text: bijps-344.txt item: #226 of 579 id: bijps-345 author: A. Hayder, Asma; S. Altaei, Tagreed title: Impact of Different Doses of Nicorandil-Induced Ulceration (Oral , Gastrointestinal Tract, and Anal) in Rats: Roles of Leptin and Prostaglandin E2 date: 2017-03-26 words: 7493 flesch: 64 summary: The administration of different doses of nicorandil produced a highly significant reduction in plasma leptin concentration; in G2 from 110.81±31.58 to 62.91±46.88, in G3 from 153.86±33.27 to 48.09±16.17, and in G4 from 149.41±58.46 to 56.09±44.43, while in G1 there was a decreased level of plasma leptin from 118.13± 31.58 to 62.91±46.88, but a non-significant difference (P= 0.07). There was a weak, non-significant positive correlation between weights and plasma leptin concentrations after treatment; r = 0.272, P=0.08. keywords: albino; anal; aspirin; body; control; day; day nicorandil; days; effects; groups; leptin; mucosa; nicorandil; plasma; plasma leptin; prostaglandin; rats; study; treatment; ulceration cache: bijps-345.pdf plain text: bijps-345.txt item: #227 of 579 id: bijps-350 author: A. Ahmed, Zheen title: Relationship between Renal Function Tests and the Levels of MDA, Zinc, and Cadmium among Painters in Sulaimani date: 2017-03-26 words: 2622 flesch: 57 summary: Environmental cadmium exposure occurs mostly in subjects living in proximity to potential industrial pollution (19) and also in heavy smokers (19) , since tobacco smoke has a high cadmium contents (21) . The effects of environmental cadmium exposure on kidney function: the possible influence of age. keywords: cadmium; exposure; function; levels; painters; renal; serum; subjects; sulaimani; workers; zinc cache: bijps-350.pdf plain text: bijps-350.txt item: #228 of 579 id: bijps-352 author: T. Numan, Intesar; N. Hamad, Maha; A. Fadhil, Ammar; M. Najim, Safa title: The Possible Cardio-Protective Effects of Ethanolic Artichoke Extract against 5- Fluorouracil Induced Cardiac Toxicity in Rats date: 2017-03-26 words: 3599 flesch: 56 summary: Cardiac toxicity includes a wide range of cardiac effects from small changes in blood pressure and arrhythmias to cardiomyopathy. Moreover, the influence of the cytotoxic agents on certain phospholipids, especially cardiolipin, may also explain the development of cardiac toxicity (2) . keywords: artichoke; ast; dose; effects; extract; fluorouracil; group; rats; toxicity cache: bijps-352.pdf plain text: bijps-352.txt item: #229 of 579 id: bijps-353 author: F. Mustafa, Yasser; A. Al-Omari, Nohad title: Design, Synthesis and Kinetic Study of Coumarin-Based Mutual Prodrug of 5-Fluorouracil and Dichloroacetic acid date: 2017-03-26 words: 4810 flesch: 66 summary: Anticancer drugs that target metabolism: Iraqi J Pharm Sci, Vol.25(1) 2016 Coumarin- based mutual prodrug of 5-fluorouracil 16 Is dichloroacetate a new paradigm? To tackle these problems, many approaches have been developed and evaluated; the most important one is the use of prodrug strategy to yield 5-FU prodrugs that can avoid certain routes of degradation keywords: cancer; coumarin; fluorouracil; mmol; pharm; ppm; prodrug; sci; serum; solution; study cache: bijps-353.pdf plain text: bijps-353.txt item: #230 of 579 id: bijps-355 author: R. Mahmood, Abdulrahman title: Estimation of Oxidative Stress and Some Trace Elements in Iraqi Men Patients with Type 2 Diabetes Mellitus date: 2017-03-26 words: 3639 flesch: 62 summary: Previous experimental and clinical studies report that oxidative stress plays a major role in the pathogenesis and development of (T2DM). However, the exact mechanism of oxidative stress could contribute to and accelerate the development of (T2DM). keywords: antioxidant; diabetes; hba1c; levels; mda; mellitus; oxidative; patients; serum; stress; trace; type; zinc cache: bijps-355.pdf plain text: bijps-355.txt item: #231 of 579 id: bijps-356 author: S. Nassir, Eman title: Detection of Serum Ferritin in Women with Breast Cancer date: 2017-03-26 words: 3330 flesch: 64 summary: In the current study as we observed in table (2) the levels of ferritin were found to be significantly raised in breast cancer patients (in both groups B and C) as compared to control (group A). Iraqi J Pharm Sci, Vol.25(1) 2016 Serum ferritin in women with breast cancer 23 Detection of Serum Ferritin in Women with Breast Cancer Eman S. Nassir *, 1 * Department of Clinical Laboratory Science, College of Pharmacy, University of Baghdad ,Baghdad, Iraq. keywords: breast; breast cancer; cancer; disease; ferritin; group; iraqi; iron; patients; serum; study; women cache: bijps-356.pdf plain text: bijps-356.txt item: #232 of 579 id: bijps-357 author: A.Omer, Noor; A.Taher, Muhammad; Dh Skheel Aljebory, Henan title: Effect of Metformin Treatment on some Blood Biomarkers in Women with Endometriosis. date: 2017-03-26 words: 4600 flesch: 47 summary: Thus, metformin may be effective in treatment endometriosis through suppression both ovarian and local production of estrogen (36) . Moravek et al (2009) ,provided a preliminary data about the effectiveness of rosiglitazone, an insulin sensitizer, in treating endometriosis -related pain in six patients and concluded that it was effective and promising for usage in endometriosis patients desiring the chance to conceive (31) . keywords: cells; control; effect; endometriosis; factor; groups; il-8; metformin; months; pain; patients; study; table; tnf; treatment; women cache: bijps-357.pdf plain text: bijps-357.txt item: #233 of 579 id: bijps-358 author: A.Abdul Sattar, Sura; H.Abdulla, Amer; Sh. Nsaif, Aufaira title: Gestational Diabetes Mellitus and Hormonal Alteration date: 2017-03-26 words: 3141 flesch: 34 summary: In previous studies of progesterone conflict data was reported where one of them has found association of progesterone with the development of gestational diabetes due to the enhancement of insulin resistance (23,24) , while another group did not find a correlation between progesterone level and an increasing risk of gestational diabetes mellitus (25) . https://en.wikipedia.org/wiki/Pregnancy https://en.wikipedia.org/wiki/Human_chorionic_gonadotropin https://en.wikipedia.org/wiki/Human_chorionic_gonadotropin http://care.diabetesjournals.org/content/36/7/1974.long#ref-1 http://care.diabetesjournals.org/content/36/7/1974.long#ref-2 http://care.diabetesjournals.org/content/36/7/1974.long#ref-3 http://care.diabetesjournals.org/content/36/7/1974.long#ref-4 http://care.diabetesjournals.org/content/36/7/1974.long#ref-5 http://care.diabetesjournals.org/content/36/7/1974.long#ref-3 http://care.diabetesjournals.org/content/36/7/1974.long#ref-6 http://care.diabetesjournals.org/content/36/7/1974.long#ref-7 Iraqi J Pharm Sci, Vol.25(1) 2016 Gestational diabetes mellitus and hormonal alteration 39 Table (1): Baseline characterization of gestational diabetes mellitus. keywords: bmi; cell; control; diabetes; diabetes mellitus; fsh; glucose; insulin; mellitus; patients; pregnancy; progesterone; prolactin cache: bijps-358.pdf plain text: bijps-358.txt item: #234 of 579 id: bijps-359 author: R. Fadhel, Sahar; I. Abdulla, Najwa; D. Sulaiman, Intidhar title: The Spectrophotometric Determination of Olanzapine via Coupling with Diazotized p-Nitroaniline date: 2017-03-26 words: 3359 flesch: 55 summary: Olanzapine tablets solution [1000 µg.ml -1 ] Spectrophotometric determination of olanzapine 44 Figure (1): Absorption spectra of: (a) the complex of 10 µg.mL -1 (OLN.) with diazotized p-nitroaniline against reagent blank, (b) blank solution against distilled water under the primary test conditions. keywords: determination; method; nitroaniline; olanzapine; oln; pharmaceutical; reagent; solution; table; µg.ml cache: bijps-359.pdf plain text: bijps-359.txt item: #235 of 579 id: bijps-360 author: M. Al-Nema, Zeena title: Trend of Antibiotics Usage in the Intensive Care Unit in the Medical City in Baghdad date: 2017-03-26 words: 4739 flesch: 44 summary: Levin PD (2007) determined risk factors associated with ciprofloxacin resistance in clinical bacterial isolates from ICU patients which includes prior use of fluoroquinolones and duration of hospitalization prior to ICU admission (15) . Metronidazole is widely used antibiotic in our clinical practice and unfortunately the culture and sensitivity tests for anaerobic bacteria are unavailable in most of our centers including our settings in the present study, so we can’t evaluate its efficacy against bacteria, but in the recent years, metronidazole has appeared to lose some of its effectiveness in Clostridium difficile infection (CDI) management and vancomycin is now recognized as the first-line treatment of severe cases (16) , although, many studies proved that the rate of CDI in ICU patients is low, but the infection affects severely ill patients, and is associated with high mortality (17,18,19) . keywords: antibiotic; bacteria; care; ceftazidime; ceftriaxone; ciprofloxacin; culture; icu; intensive; levofloxacin; patients; resistance; sensitivity; spp; study; tests; use cache: bijps-360.pdf plain text: bijps-360.txt item: #236 of 579 id: bijps-361 author: T.Ismail, Sara; M. Al-Kotaji, Myasar; A. Khayrallah, Ahlam title: Formulation and Evaluation of Nystatin Microparticles as a Sustained Release System date: 2017-03-26 words: 5287 flesch: 57 summary: Drug release kinetics The in- vitro release data were plotted according to different models, and these curves were used to draw some conclusions regarding the mode of drug release from the microparticles. To determine the mode of drug release, the initial 60% drug release values were fitted to the Korsmeyer–Peppas model: Mt/M∞ = Kt n , where Mt/M∞ is the fraction( ≤ 60%) of drug released at time t, K is the drug release rate constant, and n is the release exponent. keywords: chitosan; concentration; drug; efficiency; entrapment; evaluation; formulas; loaded; loading; microparticles; microspheres; n1c1; nystatin; pharm; polymer; release; sara; size cache: bijps-361.pdf plain text: bijps-361.txt item: #237 of 579 id: bijps-362 author: A.Ali, Yasser; N. Abd-Alhammid, Shaimaa title: Formulation and Evaluation of Ezetimibe Nanoparticles date: 2017-03-26 words: 5028 flesch: 51 summary: Bailey N, Booth J and Clark B. Characterisation of drug nanoparticles by atomic force microscopy. As seen in Figures (9), and (10) the sharp melting peak of ezetimibe (165.30 °C) is completely disappeared in these figures that’s mean the stabilizer PVP K-30 completely converted ezetimibe particles into amorphous state (29) . keywords: concentration; dissolution; drug; ezetimibe; f21; figure; formulas; journal; nanoparticles; nanosuspension; particle; poloxamer188; polymer; ratio; size; stabilizer; surface cache: bijps-362.pdf plain text: bijps-362.txt item: #238 of 579 id: bijps-363 author: H.Maedie, Faris; Alhaddad, Hasan; A. Hussain, Saad title: Evaluation of Poisoning Cases in the Poisoning Consultation Center and Forensic Medicine Institute within Baghdad area date: 2017-03-26 words: 4455 flesch: 60 summary: Poisoning cases in the poisoning consultation center 26 cases (7.8% each), while chlorpheniramine, alprazolam, and tramadol predispose to equal percent of poisoning cases (6.5 each). Poisoning cases in the poisoning consultation center 28 Conclusions The present study evaluates the charac- teristics of poisoning cases reported in Baghdad PCC and FMI. keywords: age; baghdad; baghdad pcc; cases; distribution; figure; fmi; patients; pcc; poisoning; poisoning cases; study; years cache: bijps-363.pdf plain text: bijps-363.txt item: #239 of 579 id: bijps-364 author: I. Abdulla, Najwa; M.Yaseen, Hamsa title: Potentiometric Transducers for the Selective Recognition of Risperidone Based on Molecularly Imprinted Polymer date: 2017-03-26 words: 5270 flesch: 58 summary: (a) (b) Figure (2): FTIR of (a): Ris -MIP(AAm) after the removal of (Ris.), (b) : Ris -NIP(AAm). According to the equilibrium dissociation constants (Kd) of the two acidic and basic Ris -MIPs, it was noticed that basic Ris-MIP has homogenous binding site distributions which lead to better results in its application than acidic Ris-MIP which exhibited high (Kd) value as well as heterogeneous binding sites distributions. keywords: aam; electrode; mip; polymer; potentiometric; recognition; ris; risperidone; solution cache: bijps-364.pdf plain text: bijps-364.txt item: #240 of 579 id: bijps-365 author: M. Abrahem, Ruaa; J. Awad, Zainab title: Phytochemical Study of Steroidal Sapogenin “Tigogenin” Present in the Leaves of Agave americana Cultivated in Iraq date: 2017-03-26 words: 2645 flesch: 55 summary: This search include extraction, isolation, purification and dentification of Tigogenin from the leaves of Agave americana. This study confirms the presence of Tigogenin in the leaves of Agave americana cultivated in Iraq. keywords: agave; americana; extraction; leaves; method; no.1; no.2; steroidal; tigogenin; tlc cache: bijps-365.pdf plain text: bijps-365.txt item: #241 of 579 id: bijps-366 author: M. Shiblawi, Wessam; H.Ismael, Sajida title: The Effect of L-Carnitine as an Adjuvant Supplement on Lipid Profile in Iraqi Diabetic Patients date: 2017-03-26 words: 2679 flesch: 52 summary: Role of L- Carnitine in the T2DM Patients with type 2 diabetes seem to be at elevated risk for carnitine deficiency (9) . Blood samples were taken from all individuals included in this study, at base line time and every 30 days of the study period, blood was collected by venipuncture technique in order to measure serum lipid profile. keywords: carnitine; diabetes; effect; group; lipid; mellitus; patients; profile; study cache: bijps-366.pdf plain text: bijps-366.txt item: #242 of 579 id: bijps-367 author: J. Ibraheem Al-Tamimi, Jaafar title: Bioequivalence and Pharmacokinetics Comparison of Two Formulations of Extended-Release Pentoxifylline Tablets in Healthy Subjects after Fasting and Fed Conditions date: 2017-03-26 words: 5363 flesch: 52 summary: In case of fasting study; the volunteers were confined at the clinical site 14 hours before dose administration and until 24 hours after dose administration (end of each study period). It is obvious from Tables 1 and 2 that the descriptive statistics of the demographic data of the volunteers selected for fasting study was almost similar to the fed study in order to exclude the potential difference in the pharmacokinetics of drug due to age, weight and/or height. keywords: bioequivalence; cmax; drug; fasting; mean; ng.hr/ml; pentoxifylline; reference; study; test cache: bijps-367.pdf plain text: bijps-367.txt item: #243 of 579 id: bijps-368 author: I.Khalil, Yehia title: Preparation and Characterization of Montelukast Sodium ( SMLT ) as a Dual Sustained Release Buccal Strips date: 2017-03-26 words: 5071 flesch: 57 summary: Sumedha Bansal ., Formulation ,and evaluation of fast dissolving film of an antihypertensive drug; Int. Alka Tomar, Formulation ,and evaluation ,of fast dissolving film of Dicyclomine as potential route of buccal delivery: International Journal of Drug Development 2012; 4(2): 408-417. 11. keywords: buccal; dissolving; drug; fast; film; layer; oral; polymer; release; smlt; sodium; strips; surface; time cache: bijps-368.pdf plain text: bijps-368.txt item: #244 of 579 id: bijps-369 author: K. Fakree, Najwan title: Measurement of Serum Trace Elements (Zinc, Copper, Magnesium and Iron) Concentrations in Pediatric Patients with Otitis Media with Effusion in Iraq date: 2017-03-26 words: 3006 flesch: 58 summary: Group 1 (patient group) consist of 30 children suffering from OME and group 2 (control group) included 25 apparently healthy children. (Serum levels of zinc in group 1 and group 2 were 8.7303 ±1.5503 and 16.8039± 2.4528(umol/l) respectively) Also patients group had significantly lower serum copper values as comparing with control group (P <0.05) (Serum copper levels were 14.2097± 4.3439 in group 1 and 18.1874± 3.01628 (umol/l) in group 2). keywords: children; copper; group; iron; levels; magnesium; media; ome; otitis; serum; zinc cache: bijps-369.pdf plain text: bijps-369.txt item: #245 of 579 id: bijps-375 author: Hadi, Hind title: Spectrophotometric Determination of Clonazepam in Pure and Dosage forms using Charge Transfer Reaction date: 2017-03-27 words: 4193 flesch: 44 summary: The literature contained very little researches of spectrophotometric method for CLO determination. The proposed method was compared with classical method of CLO determination in British pharmacopeia and by using two statistical methods (t- and F tests and paired t-test) and both methods proved accuracy and precision of the method, and in addition the proposed method can be used routinely in quality control studies. keywords: charge; clo; clonazepam; complex; determination; drug; method; metol; reaction; solution; transfer cache: bijps-375.pdf plain text: bijps-375.txt item: #246 of 579 id: bijps-376 author: J. Mehsin, Raheem; A.Raheem, Leaqaa; H. Ghazi, Abdulhussein; A.Khathem, Saba title: Preparation, Characterization and Prophylactic Study of New Microsphere Containing Doxycycline against Diseases of Shrimp date: 2017-03-27 words: 3533 flesch: 61 summary: The microsphere is incorporation of drugs into polymeric materials to control drug release and increase duration of action, the biodegradable polymers were used in drug delivery systems, control the release of therapeutic agents (1) . Polymer blends, that is, physical mixture of structurally different polymers which interact with secondary forces such as hydrogen bonding with no covalent bonding. keywords: acid; blend; chitosan; diseases; doxycycline; drug; fish; microsphere; pla; polymers; release; shrimp; solution cache: bijps-376.pdf plain text: bijps-376.txt item: #247 of 579 id: bijps-377 author: H. Abdul Wahab, Usama; J. Awad, Zainab title: Isolation and Characterization of Iridoid Glycoside (Gardenoside) Present in the Leaves of Gardenia jasminoides J.Ellis Cultivated in Iraq date: 2017-03-27 words: 3796 flesch: 54 summary: Iraqi J Pharm Sci, Vol.24(1) 2015 Gardenoside in the leaves of Gardenia jasminoides 40 Isolation and Characterization of Iridoid Glycoside (Gardenoside) Present in the Leaves of Gardenia jasminoides J.Ellis Cultivated in Iraq Usama H. Abdul Wahab *,1 and Zainab J. Awad * * Department of Pharmacognosy and Medicinal Plants, College of Pharmacy, University of Baghdad, Baghdad,Iraq. Keywords: Gardenia jasminoides , Gardenoside,Geniposide,Genipin. keywords: chromatography; extract; extraction; figure; gardenia; gardenoside; iridoid; jasminoides; leaves; method; standard cache: bijps-377.pdf plain text: bijps-377.txt item: #248 of 579 id: bijps-378 author: S. Farhan, Mohammed; Y. Saour, Kawkab title: Synthesis of some Novel Nitrogenous Heterocyclic Compounds with Expected Biological Activity as Antimicrobial and Cytotoxic Agents date: 2017-03-27 words: 4427 flesch: 57 summary: Iraqi J Pharm Sci, Vol.24(1) 2015 Novel nitrogenous heterocyclic compounds with biological activity 49 Synthesis of some Novel Nitrogenous Heterocyclic Compounds with Expected Biological Activity as Antimicrobial and Cytotoxic Agents. 28/4/2015 mailto:mohmadsinjar@Gmail.com Iraqi J Pharm Sci, Vol.24(1) 2015 Novel nitrogenous heterocyclic compounds with biological activity 50 Introduction Heterocyclic compounds are acquiring more importance in recent years which display biological activities. keywords: acid; activity; amino; compounds; derivatives; ester; heterocyclic; method; novel; peptide; pharm; solution; str; synthesis; table cache: bijps-378.pdf plain text: bijps-378.txt item: #249 of 579 id: bijps-379 author: A. Al-jubouri, Ahlam; J. Qasir, Ahlam title: Synthesis and Antibacterial Activity of bis Heterocyclic Derivatives of 1,3,4-thiadiazole date: 2017-03-27 words: 4561 flesch: 59 summary: Antibacterial evolution of bis heterocyclic derivatives 62 Table (1): Physical appearance, percentage of yield, melting points, Rf values of intermediates and final compounds. --------- 0.71 D 4C Brown crystal 85.3% 201-203 -------- 0.88 A A) Toluene: Methanol (9:1), B) Chloroform: Ethylacetate: Methanol (2:2:1) C) n-Hexane: Isopropanol: Methanol (9: 0.9:0.1), D) Chloroform: Ethanol (8:2) Table (2): Elemental microanalysis of the final compounds Table (3): Characteristic IR absorption bands of intermediates and final compounds keywords: -ve; activity; bending; compounds; derivatives; heterocyclic; ring; solution; stretching; synthesis; table; μg/ cache: bijps-379.pdf plain text: bijps-379.txt item: #250 of 579 id: bijps-380 author: M. Ibrahim, Nabaa; J. Kadhim, Enas title: Phytochemical Investigation and Antioxidant Activity of Iraqi Tribulus terrestris date: 2017-03-27 words: 3025 flesch: 50 summary: Preparation of extract Shade-dried coarsely powdered aerial parts of Tribulus plant was defatted with hexane for 24 hours then allowed to dry at room temperature. Abstract The aim of the present study was to characterize the Iraqi Tribulus terrestris for the presence of biologically active phyto-chemicals using methanolic extracts of the plant (aerial parts) by Gas Chromatography –Mass spectrometry (GC/MS), while the mass spectra of the compounds found in the extract was matched with the National Institute of Standards and Technology (NIST) library , in addition to study the antioxidant activity of plant extract , results confirmed the presence of therapeutically potent compounds in the Iraqi Tribulus terrestris extract predominantly alkaloids, flavonoids, saponins, tannins and terpenoids. keywords: acid; activity; antioxidant; extract; group; iraqi; methanolic; plant; presence; terrestris; tribulus cache: bijps-380.pdf plain text: bijps-380.txt item: #251 of 579 id: bijps-381 author: A. Nadhum, Shams; H. Mohammed, Mohammed title: Design, Synthesis, Characterization and Preliminary Anticancer Study for Methotrexate Silibinin Conjugates date: 2017-03-27 words: 4856 flesch: 55 summary: Folate is a basic component of cell metabolism and DNA synthesis and repair, and rapidly dividing cancer cells have an increased requirement for folate to maintain DNA synthesis, an observation supported by the wide spread use of antifolates in cancer chemotherapy (4) . However, the potencies of all folate-receptor targeted therapies depend on the rate of folate-linked drug conjugate binding to the cancer cell surface, the dose of folate conjugate that will saturate tumor cell surface FR in vivo, the rate of FR internalization, un loading,and recycling back to the tumor cell surface for another round of conjugate uptake, and the residence time of the folate conjugate before its metabolism or release from the cell (6) .Linkage of a drug to folic acid can generate a molecular “Trojan Horse” that can enable tumor-specific delivery of both imaging and therapeutic agents into cancer cells. keywords: cancer; cell; compound; concentration; drug; folate; methotrexate; n n; receptor; sci; silibinin; stretching; synthesis; vibration cache: bijps-381.pdf plain text: bijps-381.txt item: #252 of 579 id: bijps-382 author: M. Alwan, Shakir; S. Jabbar, Sarrah title: Design, Synthesis and Preliminary Antimicrobial Evaluation of New Derivatives of Cephalexin date: 2017-03-27 words: 3347 flesch: 59 summary: Compound 1 (125 and 250μg) showed significant activity against P. aeruginosa and reduction in antibacterial activities against S. aureus and E. coli as compared with cephalexin. Most of the synthesized compounds were found to possess significant antibacterial activities. keywords: activity; aeruginosa; amino; cephalexin; compound; derivatives; mmol; stretching; synthesis cache: bijps-382.pdf plain text: bijps-382.txt item: #253 of 579 id: bijps-383 author: A. Hussein, Ahmed; Sh. Mahmood, Hasanain title: Preparation and Evaluation of Cefixime Nanocrystals date: 2017-03-27 words: 4794 flesch: 59 summary: Drug nanocrystals are one of the most important strategies to enhance the oral bioavailability of hydrophobic drugs. Nanocrystal drug particles: Resolving pharmaceutical formulation issues associated with poorly water- soluble compounds. keywords: cefixime; dissolution; drug; dsc; figure; formula; journal; nanocrystals; particle; pharm; powder; pvp; rate; results; sci; size cache: bijps-383.pdf plain text: bijps-383.txt item: #254 of 579 id: bijps-384 author: M. Mohammed, Mohammed; J. Al-Shamma, Kassim; A. Jassim, Nizar title: Evaluation of the Clinical use of Metformin or Pioglitazone in Combination with Meloxicam in Patients with Knee Osteoarthritis; using Knee Injury and Osteoarthritis outcome Score date: 2017-03-27 words: 6172 flesch: 64 summary: Results Effect on pain score Before enrolment in the study (zero time), OA patients demonstrated poor pain control with their previous therapy, manifested by low pain score which indicate severe or extreme symptoms of pain in most of patients (table 1). Furthermore; unrelieved pain leads to serious negative consequences, like those observed with poor pain score belong to OA patients before treatment (table 1), with many other physiological effects associated with increased catabolic demands (22) . keywords: combination; day; knee; meloxicam; metformin; osteoarthritis; pain; patients; pioglitazone; score; study; treatment cache: bijps-384.pdf plain text: bijps-384.txt item: #255 of 579 id: bijps-386 author: M. Alwan, Shakir; H. Kadhim, Ameer title: Synthesis of New Cephalosporins of Expected Improved Activity and Resistance Against -Lactamases date: 2017-03-27 words: 5757 flesch: 64 summary: The IR spectra (ʋ, cm -1 ); recorded the following bands; 3200-2900 (O-H stretching of carboxyl, N-H stretching of sulfonamide, C- H stretching of aromatic ring), broad band at 1680-1610 (represents C=O stretching of carboxyl, C=N stretching of imine and C=C aromatic), 1510 (N-H bending of sulfonamide), 1276, 1161 (S=O stretching of sulfonamide). Iraqi J Pharm Sci, Vol.23(2) 2014 Synthesis of new cephalosporins of improved activity 24 Synthesis of New Cephalosporins of Expected Improved Activity and Resistance Against -Lactamases Shakir M. Alwan *,1 and Ameer H. Kadhim * * Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq. keywords: activity; carboxyl; cephalosporins; compound; spectra; stretching; synthesis; thiadiazole cache: bijps-386.pdf plain text: bijps-386.txt item: #256 of 579 id: bijps-387 author: A. Hussien, Suhaib; J. Awad, Zainab title: Isolation and Characterization of Triterpenoid Saponin Hederacoside C. Present in the Leaves of Hedera helix L. Cultivated in Iraq date: 2017-03-27 words: 3088 flesch: 57 summary: The pharmacological activities of Hedera helix L. are: spasmolytic, secretolytic, anti-inflammatory, antimicrobial, antiviral, antifungal, protozoidal, hepatoprotective, antioxidant, hypoglycaemic, cytotoxic, antimutagenic, and anti- hyaluronidase activity (3) . H. helix L. naturally grows in the Western, Central, and Southern Europe but has also been introduced to North America and Asia (4) . keywords: chromatography; column; extraction; hederacoside; helix; method; saponin; standard; tlc; triterpenoid cache: bijps-387.pdf plain text: bijps-387.txt item: #257 of 579 id: bijps-388 author: H. Zain Al-Abdeen, Salah; J. Qasir, Ahlam title: Synthesis of New B-adrenoceptor Blocking Agent Including 1,3,4 Thiadiazole with Expected Adrenoceptor Blocking Activity date: 2017-03-27 words: 4408 flesch: 55 summary: New β-adrenoceptor blockers 46 Table (2): Synthesis of series B compounds (9-12) Synthesis of final products (Compounds (13- 20)) in methanol containing potassium hydroxide (0.01mol.), a solution of one of series B compounds (9-12) (0.012 mol.) keywords: adrenoceptor; bending; ch stretching; chain; compound; plane; ring; schiff; stretching; symmetrical; synthesis; table cache: bijps-388.pdf plain text: bijps-388.txt item: #258 of 579 id: bijps-389 author: N.Al-Atrakchey, Rajaa; A.Taher, Mohammed; N.Saeed, Ibtehal title: Lipid Profile and Fasting Blood Sugar Analysis in Patients with Cholelithiasis date: 2017-03-27 words: 3464 flesch: 60 summary: Zak A, Zeman M, Hrubant K, et al: Effect of hypolipidemic treatment on the composition of bile and the risk or cholesterol gallstone disease. The role of serum lipid in the etiology of cholelithiasis is very important and particularly in cholesterol gallstones in which serum lipid profile are altered which is suggestive of metabolic syndrome. keywords: blood; cholelithiasis; cholesterol; disease; fasting; gallstone; glucose; ldl; lipid; patients; profile; serum; study cache: bijps-389.pdf plain text: bijps-389.txt item: #259 of 579 id: bijps-390 author: S.Sadiem, Omer; A. Taher, Mohamed; S. Amin, Seenaa title: Association of Oxidative Stress Markers with Cholelithiasis date: 2017-03-27 words: 3279 flesch: 49 summary: Hye-Lin Ha, Hye-Jun Shin, Mark A Feitelson, et al: Oxidative stress and antioxidants in hepatic pathogenesis. Galli F, Piroddi M, Annetti C, et al: Oxidative stress and reactive oxygen species. keywords: antioxidant; cholelithiasis; diseases; dismutase; gallbladder; gallstones; mpo; patients; serum; sod; stress; study cache: bijps-390.pdf plain text: bijps-390.txt item: #260 of 579 id: bijps-392 author: S. Hmood, Kasim; N. Elias, Amer title: Synthesis, Characterization, and Antimicrobial Evaluation of New Ceftriaxone Derivatives date: 2017-03-28 words: 7153 flesch: 51 summary: N ew ceftriaxone derivatives 78 Scheme (1): The synthetic scheme of the intermediate compound (A) 2. N ew ceftriaxone derivatives 79 Table( 1): The percent yield, physical appearance, uncorrected Melting points, and Rf values of the synthesized intermediate (A) and target compounds (B1-B7) Compound Chemical Name Chemical Formula Physical appearance % Yield Melting point O C Rf A (6R,7R)-7-((Z)-2-(2-(2- chloroacetamido)thiazol-4-yl)-2- (methoxyimino)-acetamido)-3-(((2- methyl-5,6-dioxo-1,2,5,6-tetrahydro- 1,2,4-triazin-3-yl)thio)methyl)-8-oxo- 5-thia-1-azabicyclo[4.2.0]oct-2-ene-2- carboxylic acid C20H19ClN8O8S3 White powder 65 172-174 0.26 B1 (6R,7R)-7-((Z)-2-(methoxyimino)-2- (2-(2-morpholinoacetamido)-thiazol- 4-yl)acetamido)-3-(((2-methyl-5,6- dioxo-1,2,5,6-tetrahydro-1,2,4-triazin- 3-yl)thio)methyl)-8-oxo-5-thia-1- azabicyclo[4.2.0]oct-2-ene-2- carboxylic acid C24H27N9O9S3 yellow powder 88 245 0.5 B2 (6R,7R)-7-((Z)-2-(methoxyimino)-2- (2-(2-(pyrrolidin-1-yl)- acetamido)thiazol-4-yl)acetamido)-3- (((2-methyl-5,6-dioxo-1,2,5,6- tetrahydro-1,2,4-triazin-3- yl)thio)methyl)-8-oxo-5-thia-1- azabicyclo[4.2.0]oct-2-ene-2- carboxylic acid C24H27N9O8S3 brown powder 93 230 0.55 keywords: activity; amide; antibacterial; bending; ceftriaxone; chem; compounds; derivatives; drug; group; new; pharm; sci; stretching; stretching vibration; synthesis cache: bijps-392.pdf plain text: bijps-392.txt item: #261 of 579 id: bijps-393 author: Eggadi, Venkateshwarlu; Chandra Korupozu, Sharath; kumar Korupoju, Bharath; Bandaru Sheshagiri, Sharavanabhava; Kumar R, Shiva; Rao Jupally, Venkateshwar title: Evaluation of Protective Effect of Different Doses of Terminalia arjuna Bark Ethanolic Extract on Cisplatin Induced Oxidative Nephrotoxicity in Rats date: 2017-03-28 words: 4898 flesch: 56 summary: The effect of ethanolic extract of Terminalia arjuna bark on kidney antioxidant levels A-The effect of ethanolic extract of Terminalia arjuna bark on kidney GSH levels Very high significant (P<0.001) reduction in kidney GSH levels were seen in rats intoxicated with cisplatin compared to normal control (Figure 6). Figure ( 6): Effect of different doses of ethanolic extracts of Terminalia arjuna bark (EETAB I and II) on kidney GSH levels. keywords: arjuna; bark; cisplatin; control; eetab; effect; ethanolic; kidney; levels; rats; terminalia cache: bijps-393.pdf plain text: bijps-393.txt item: #262 of 579 id: bijps-394 author: F. Al - Tukmagi, Haydar; A. Moussa, Miamin title: Quality of Life of Patients with Type II Diabetes Mellitus in Al- Hilla City-Iraq date: 2017-03-28 words: 3192 flesch: 64 summary: Abstract Diabetes mellitus is a global problem nowadays due to increase the disease cases all over the world, in both the developed and developing countries which may affect the quality of life (QOL ) of diabetic patients. 100 patients enrolled in this cross sectional study which conducted to determine the quality of life of diabetic patients and to find the association between that quality and certain variables including (age, sex, occupation, residence, educational level, marital status, family history of diabetes and duration of diabetes). keywords: diabetes; diabetic; domain; health; life; patients; qol; quality; score; study cache: bijps-394.pdf plain text: bijps-394.txt item: #263 of 579 id: bijps-395 author: A. Ali Beg, Ammar; J. Qasir, Ahlam title: Synthesis and Antimicrobial Study of Possible Mutual Prodrugs of Amoxicillin and Metronidazole by Direct and Indirect Coupling through Spacer date: 2017-03-28 words: 3137 flesch: 61 summary: Microorganism in mixed infections may respond to antimicrobial agents differently than do those in monomicrobial infections, and it may not be necessary to eradicate every bacterial species in mixed infection to achieve cure (5) . ethyl ester ( compound 1c ) (9) : keywords: amoxicillin; compound; metronidazole; mmol; synthesis cache: bijps-395.pdf plain text: bijps-395.txt item: #264 of 579 id: bijps-396 author: M. Mikhael, Ehab; A. Majeed, Ibrahim; I. Gorial, Faiq; H. Al-Ossamy, Mohammad; H. Falih, Ali; Abdulhameed, Dhikra title: Evaluation of Rosuvastatin Effect as Adjuvant Therapy to Methotrexate on Lipid Profile and the Possibility of its Cardioprotective Effect in Iraqi Patients with Active Rheumatoid Arthritis date: 2017-03-28 words: 3880 flesch: 46 summary: The aim of this study was to evaluate the effect of rosuvastatin as adjuvant therapy to methotrexate (MTX) on lipid profile and its possible cardioprotective effect in RA patients. At the start of the study total cholesterol (TC), low density lipoprotein cholesterol (LDLc) and high density lipoprotein cholesterol (HDLc) values were not significantly different between RA patients and control group. keywords: arthritis; cholesterol; effect; esr; level; lipid; patients; placebo; rheumatoid; rosuvastatin; study cache: bijps-396.pdf plain text: bijps-396.txt item: #265 of 579 id: bijps-397 author: A.Hassan, Hiba title: Measurement of some Biochemical Values in Hemodialysis Patients in Baghdad date: 2017-03-28 words: 2722 flesch: 45 summary: The distribution of dialysis patients according to mean age is listed in table (1)shows the mean age have no significant difference( P>0.05) . Serum cholesterol is often low in dialysis patients, probably because of malnutrition and chronic inflammation (23,24) . keywords: acid; calcium; control; creatinine; hemodialysis; kidney; mean; patients; serum; urea; uric cache: bijps-397.pdf plain text: bijps-397.txt item: #266 of 579 id: bijps-399 author: I. Abdul, Basma; A. Rajab, Nawal title: Preparation and in-Vitro Evaluation of Mucoadhesive Clotrimazole Vaginal Hydrogel date: 2017-03-28 words: 3878 flesch: 61 summary: Table (1) Composition of clotrimazole vaginal hydrogels formulas (%w/w). The lowest concentration showed faster release within the first half an hour of 99± 2% of drug release , while CMC-Na at 3.5% (F2) demonstrated the least release of 40 % after three hours. keywords: clotrimazole; concentration; delivery; drug; effect; formulas; gel; hydrogel; mucoadhesive; pharm; polymer; release; swelling cache: bijps-399.pdf plain text: bijps-399.txt item: #267 of 579 id: bijps-400 author: J. Khadim, Enas; A. Abdulrasool, Alaa; J. Awad, Zainab title: Phytochemical Investigation of Alkaloids in the Iraqi Echinops heterophyllus (Compositae) date: 2017-03-28 words: 3603 flesch: 50 summary: 1 Corresponding author E-mail:enassara@yahoo.com Received: 23/1/2013 Accepted: 5/2/2014 http://en.wikipedia.org/wiki/Chemical_compound http://en.wikipedia.org/wiki/Base_(chemistry) http://en.wikipedia.org/wiki/Nitrogen http://en.wikipedia.org/wiki/Bacteria http://en.wikipedia.org/wiki/Fungus http://en.wikipedia.org/wiki/Animal http://en.wikipedia.org/wiki/Pharmacology Iraqi J Pharm Sci, Vol.23(1) 2014 Alkaloids of Iraqi Echinops 27 And many literatures survey revealed different pharmacological activities of Echinops plant like, antibacterial activity (7) , Antifungal (8) , Antioxidant activity (9) , Protective effects on testosterone-induced prostatic hyperplasia (10) , Hepatoprotective (11) and antiulcerogenic activity (12) . This study was emphasized on the isolation and identification of alkaloids found in the Iraqi species of Echinops plant by two methods : Preparative high Performance Liquid Chromatography chromatography (PHPLC) and preparative thin layer chromatography(PTLC) and compare between quantity of these active constituents obtained by both methods. keywords: alkaloids; analysis; compounds; echinops; heterophyllus; hplc; iraqi; parts; plant; seeds; species; test; tlc cache: bijps-400.pdf plain text: bijps-400.txt item: #268 of 579 id: bijps-401 author: A. Muften, Rouaa; Y.Saour, Kawkab; A.Razzak Mahmood, Ammar title: Synthesis and Antimicrobial Evaluation of New 6 and7 Substituted Derivatives of Coumarin date: 2017-03-28 words: 2830 flesch: 60 summary: The reaction of coumarin derivatives (coumarin I and II) with p-nitrophenyl hydrazine yield Schiff bases (compound1a and IIa).These Schiff bases were refluxed with benzoyl chloride to give benzohydrazide derivatives of coumarin substituted at its 6 or 7 nucleus position (Ia1 and IIa1).The reaction and the purity of the products were checked by thin layer chromatography (TLC). 7 3 µg/ml Ia1 9 25 µg/ml 16 60 µg/ml 6 3 µg/ml IIa1 4 25 µg/ml 12 60 µg/ml 11 3 Ketoconazole 27 25 30 60 Results and Discussion The present investigation involves the synthesis of new series of compounds involving the coumarin moiety as shown in scheme 1 and scheme 2; the pathway of synthesis of coumarin derivatives that have a characteristic aldehyde group substituted at the 6 or 7 positions of the coumarin nucleus as shown in compound (I) and (II). keywords: activity; compound; coumarin; derivatives; new; synthesis; table cache: bijps-401.pdf plain text: bijps-401.txt item: #269 of 579 id: bijps-402 author: H. Samein, Laith title: Preparation, Characterization, and in - vivo Evaluation of Daptomycin Poly(D,L-lactide-co-glycolide) Microspheres date: 2017-03-28 words: 5926 flesch: 51 summary: 0.99 1.1 1.0 1.36 Mean particle size (μm) 20.0 19.8 25.3 23.6 Dose of Daptomycin 15 mg/kg 15 mg/kg 30 mg/kg 30 mg/kg F1 F2 F3 F4 Figure 1: Scanning electron micrographs of Daptomycin PLGA microspheres of different formulations According to the published literatures, the particle size was found to have an important effect on the drug release in the field of drug delivery. The exact kinetics of drug release could be determined and fine-tuned by careful design of the microsphere composition including the type of Polymer used, the polymer molecular weight, the copolymer composition, the nature of any excipients added to the microsphere formulation and the microsphere size, all of these factors have a strong impact on the delivery rates (5) . keywords: bulk; daptomycin; day; density; dosing; drug; formulations; lactide; levels; microspheres; plga; release; size cache: bijps-402.pdf plain text: bijps-402.txt item: #270 of 579 id: bijps-403 author: N. Abd-Alhammid, Shaimaa; H.Saleeh, Haider title: Formulation and Evaluation of Flurbiprofen Oral Film date: 2017-03-28 words: 3631 flesch: 61 summary: Iraqi J Pharm Sci, Vol.23(1) 2014 Flurbiprofen oral film 53 Formulation and Evaluation of Flurbiprofen Oral Film Shaimaa N. Abd-Alhammid * , 1 and Haider H.Saleeh ** * Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq. Received: 14/12/2013 Accepted:12 /4/2014 Iraqi J Pharm Sci, Vol.23(1) 2014 Flurbiprofen oral film 54 Fast dissolving films (FDF) is a type of oral drug delivery system for the oral delivery was developed based on the technology of the monolithic transdermal patches. keywords: concentration; disintegration; drug; film; flurbiprofen; formula; formulation; hpmc; pharm; phosphate; release; sci cache: bijps-403.pdf plain text: bijps-403.txt item: #271 of 579 id: bijps-404 author: J. Ibraheem Al-Tamimi, Jaafar title: Bioequivalence and Pharmacokinetics of Two Formulations of Amlodipine Tablets in Healthy Subjects date: 2017-03-28 words: 4388 flesch: 57 summary: Iraqi J Pharm Sci, Vol.23(1) 2014 Bioequivalence and pharmacokinetics of amlodipine tablets 60 Bioequivalence and Pharmacokinetics of Two Formulations of Amlodipine Tablets in Healthy Subjects Jaafar J. Ibraheem Al-Tamimi *,1 * Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq. Received: 4 / 2 / 2014 Accepted: 15 / 4 /2014 Iraqi J Pharm Sci, Vol.23(1) 2014 Bioequivalence and pharmacokinetics of amlodipine tablets 61 Introduction Amlodipine is a long-acting calcium channel blocker. keywords: amlodipine; auc0-; bioavailability; bioequivalence; cmax; parameters; pharmacokinetic; plasma; product; reference; study; subjects; test; time cache: bijps-404.pdf plain text: bijps-404.txt item: #272 of 579 id: bijps-406 author: R. Kadhim, Shurooq; H. Alaiwi, Ishraq; R., Rasha title: Detection of Helicobacter Pylori IgG and IgA , Serum Biomarkers CA19-9 and CEA in Patients with Gastrointestinal Diseases date: 2017-03-28 words: 2710 flesch: 66 summary: Recommendations: test the specimens of patients with chronic infections with H.pylori. for CA19-9 and CEA diagnosis because several studies reported a strong association between H. pylori infection and gastric cancer and colorectal cancer; as such, H. pylori is now recognized as a Group 1 carcinogen for humans . In most children, the presence of H. pylori infection does not lead to clinically apparent disease, even when the organism colonizing the gastric mucosa causes chronic active gastritis (18) . keywords: anti; ca19; iga; igg; patients; pylori; samples; serum cache: bijps-406.pdf plain text: bijps-406.txt item: #273 of 579 id: bijps-407 author: Dave, Vivek; Yadav, Sachdev; Sharma, Swapnil; Panwar, Nitesh title: Guggulusome - A Novel Vesicular Carriers for Enhanced Transdermal Delivery date: 2017-03-28 words: 5547 flesch: 50 summary: The temperature was maintained at 37 ± 0.5ºC. (5,6) In-vivo efficacy study The anti-inflammatory activity of Aceclofenac guggulusomes gels formulations was evaluated by the carrageenan-induced rat hind paw edema method (18,19) . The result advocates the potential of guggulusomes gel formulation to treat rheumatic disease where facilitated penetration of the drug into muscle and synovial fluid is desirable. keywords: aceclofenac; concentration; drug; entrapment; formulation; gel; gels; guggulusomes; lipid; paw; skin; vesicles cache: bijps-407.pdf plain text: bijps-407.txt item: #274 of 579 id: bijps-408 author: N. Saeed, Ebtihal; I.Omer Al-Deen, Hanan; A. Merdaw, Maysoon title: Determine Nasal Carriage of Methicillin Resistant Staphylococcus aureus MRSA in Young Adult College Student date: 2017-03-28 words: 3324 flesch: 56 summary: In table (4) the sensitivity pattern of MRSA isolates 67 (90.5%) to antibiotics show rate of resistance toward some antibiotics, Keflex(30%), Erythromycin(22.5%), Tetracycline (13.5%), Gentamycin (9%), Ciprofloxacin (6%) and Vancomycin (4.5%). Culture, colonial morphology, Gram stain, mannitol fermentation, coagulase ,gelatinasetest, DNAase, MR/VP and antimicrobial susceptibility test was performed on tryptic soy agar by modified Kirby-Bauer muller hinton disc diffusion method and the result show that out of 74 nasal swabs,67(90.5%) were MRSA positive isolates, 21(31.4%) of them were mannitol ferment and 46(68.6%) non mannitol fermenter, among these isolates 33(44.6%)male and 41(55.4%) female, there was no significant sex difference in the prevalence of Staph. keywords: aureus; carriage; isolates; mannitol; methicillin; mrsa; nasal; prevalence; staph; staphylococcus; strain; study; test cache: bijps-408.pdf plain text: bijps-408.txt item: #275 of 579 id: bijps-409 author: A. Hussein, Ahmed title: Preparation and Evaluation of Liquid and Solid Self-Microemulsifying Drug Delivery System of Mebendazole date: 2017-03-28 words: 6480 flesch: 56 summary: In conclusion ,self micro emulsifying drug delivery system has become promising tool to overcome shortcomings associated with conventional delivery. A novel approach to enhanced drug delivery system. keywords: delivery; drug; drug delivery; mebendazole; microemulsion; oil; phase; release; self; size; smedds; surfactant; system; water cache: bijps-409.pdf plain text: bijps-409.txt item: #276 of 579 id: bijps-410 author: M.Ibrahem, Nabaa; J. Awad, Zainab title: Phytochemical Study of Steroidal Sapogenin “Tigogenin” Present in the Leaves of Yucca aloifolia Cultivated in Iraq date: 2017-03-28 words: 3181 flesch: 60 summary: Tigogenin standard E1: extraction method No.1 E2: extraction method No. 2 T E1 E2 Figure (5) : TLC for Yucca aloifolia leaves extract obtained by extraction methods No.1 and No.2 using silica gel GF 254as adsorbent and (S2) as solvent system . Rf values of Tigogenin from Yucca aloifolia leaves extract obtained by extraction methods No.1 and No.2 and its standard in different developing solvent systems in TLC Solvent system S1 S2 S3 Rf value of standard Tigogenin 0.55 0.74 0.80 Rf value of Tigogenin in crud extract of method No1 0.54 0.75 0.80 Rf value of Tigogenin in crud extract of method No2 0.56 0.78 0.81 S1: Chloroform:Methanol (95:5) S2: Chloroform:Petroleum ether: Methanol (85:10:5) S3: Chloroform:Acetone (80:20) T E1 E2 Figure(4): TLC for Yucca aloifolia leaves extract obtained by extraction methods No.1 and No.2 using silica gel GF 254 as adsorbent and (S1) as solvent system . keywords: aloifolia; chromatography; extraction; fraction; leaves; method; standard; steroidal; tigogenin; tlc; yucca cache: bijps-410.pdf plain text: bijps-410.txt item: #277 of 579 id: bijps-411 author: M. Mikhael, Ehab; N.Ibrahim, Turath title: Neutrophil / Lymphocyte Ratio is not Correlated with Disease Activity in Rheumatoid Arthritis Patients date: 2017-03-28 words: 3217 flesch: 33 summary: This finding is acceptable since Hb in RA patients is inversely correlated with inflammation and RA disease activity (21) . This finding was strengthened by absence of statistical difference in NLR between patients with moderately and those with highly active RA, and only CRP and ESR showed a significant difference between the 2 groups of patients similar to that of DAS28; Consequently ESR and CRP is better than NLR to detect RA disease activity. keywords: activity; arthritis; disease; inflammation; lymphocyte; nlr; patients; ratio; rheumatoid; study cache: bijps-411.pdf plain text: bijps-411.txt item: #278 of 579 id: bijps-412 author: A. Shukur, Asmaa; K.Ismail, Dawser; M. Ibrahim, Kawther title: Relationship between Blood Lead Levels and Hematological Parameters in Children from Al-Fallujah City in Iraq date: 2017-03-28 words: 4238 flesch: 63 summary: This study was designed to assess lead exposure in Al-Fallujah city by analyzing blood lead levels in children and adults and to explain the relationship between blood lead levels, hematological parameters and ferritin levels in the children. The study was performed on-(90) subjects, (65children and 25 adults).Venous blood samples were taken for estimation of hematological parameters, serum ferritin levels and blood lead levels. keywords: anemia; blood; blood lead; children; control; deficiency; ferritin; group; iron; lead; levels; low; normal; study cache: bijps-412.pdf plain text: bijps-412.txt item: #279 of 579 id: bijps-413 author: L. Abdulhadi, Shayma; J. Qasir, Ahlam; A. Abdul Razzak, Nadeem title: Synthesis of new Conjugates of some NSAIDs with Sulfonamide as Possible Mutual Prodrugs using Tyrosine Spacer for Colon Targeted Drug Delivery date: 2017-03-28 words: 3833 flesch: 47 summary: Colon targeted drug delivery The colon has some unique features, which make this organ attractive for site- specific drug delivery. 19. Deepika Nagpal, R Singh, Neha Gairola , SL Bodhankar, Suneela S Dhaneshwar, Mutual azo prodrug of 5-aminosalicylic acid for colon targeted drug delivery: Synthesis, kinetic studies and pharmacological evaluation, Indian Pharmaceutical Publication, 2006;68(2): 171-178. 20. keywords: aromatic; colon; compound; drug; ester; n o; nsaids; o o; pharm; stretching; sulfonamide; synthesis cache: bijps-413.pdf plain text: bijps-413.txt item: #280 of 579 id: bijps-414 author: M.K. Al-Ani, Widad; M. Aziz, Fitua title: Antimicrobial Activity of Hydroxymatairesinol (HMR) Lignan date: 2017-03-28 words: 2162 flesch: 29 summary: The antibacterial activity of HMR lignan was determined using the disc diffusion method and the MIC of the isolated compound was tested by the broth micro-dilution method. HMR lignan showed activity against Staphylococcus epidermidis(17 mm), Candida albicans (13mm), Proteussp(12mm) and Klebsiella sp (12mm). keywords: activity; bacteria; effects; hmr; inhibition; lignan cache: bijps-414.pdf plain text: bijps-414.txt item: #281 of 579 id: bijps-415 author: M. Alwan, Shakir; H. Abdul-Wahab, Abdul-Hafeedh title: Synthesis of new derivatives of Ceftazidime as possible Prodrugs date: 2017-03-28 words: 5366 flesch: 62 summary: New ceftazidime derivatives were successfully prepared characterized and identified using spectral and elemental microanalysis (CHNS) analyses and the results comply with the calculated measurements. The synthesis of compound (2) was achieved by reaction of compound 2a (lysine Schiff base) and ceftazidime by the mixed anhydride method (25) , and as stated below. keywords: activity; base; ceftazidime; compound; lysine; n n; n o; new; o o; schiff; solution; stretching; synthesis cache: bijps-415.pdf plain text: bijps-415.txt item: #282 of 579 id: bijps-416 author: A. AlOmari, Nohad title: Design, Synthesis, Characterization and Comparative Cytotoxic Evaluation of bis-(2- mercaptoacetate) gold (III) chloride date: 2017-03-28 words: 5245 flesch: 61 summary: Indeed, gold complexes appear to be more cytotoxic than other analogous, isoelectronic metalcomplexes (9) . In this article and by the aim to replace, one of (L') ligand by anion chloride ligand (which supposedly more relevant for the biodistribution of the compound than for its pharmacodynamic effects), new complex (Au(L')2 Cl) was synthesized : (H (AuCl4) keywords: cell; chem; chloride; cisplatin; complexes; compounds; cytotoxic; gold; iii; ligand; metal; properties; solution cache: bijps-416.pdf plain text: bijps-416.txt item: #283 of 579 id: bijps-417 author: S.Ahmed, Ghassan; J. Al-Shamma, Kassim; M.Asghar, Majeed title: Comparison between Rowatinex and Tamsulosin as a Medical Expulsion Therapy for Ureteral Stone date: 2017-03-28 words: 2468 flesch: 59 summary: Iraqi J Pharm Sci, Vol.22(1) 2013 Rowatinex and tamsulosin for ureteral stone 1 Comparison between Rowatinex and Tamsulosin as a Medical Expulsion Therapy for Ureteral Stone Ghassan S.Ahmed * , Kassim J. Al-Shamma **,1 and Majeed M.Asghar *** * Department of Pharmaceutics and Clinical Pharmacy, College of Pharmacy, Basra University, Basra, Iraq. Received: 19/5/2012 Accepted: 1/12/2012 Iraqi J Pharm Sci, Vol.22(1) 2013 Rowatinex and tamsulosin for ureteral stone 2 The increased risk of dehydration in hot climates, coupled with a diet that is 50% lower in calcium and 250% higher in oxalates compared to Western diets, accounts for the higher net risk in the Middle East .(2) keywords: expulsion; group; p<0.05; patients; results; rowatinex; stone; tamsulosin; ureter cache: bijps-417.pdf plain text: bijps-417.txt item: #284 of 579 id: bijps-418 author: M. Sulaiman, Dlveen; J.Al-Shamma, Kassim; N.Al-Hassani, Ansam title: Efficacy, safety and Cardiovascular Disease Risk Lowering Ability of ACE Inhibitors, B-Blockers and Combination Antihypertensive Drug Regimes in Iraq date: 2017-03-28 words: 7305 flesch: 57 summary: Most predominant adverse effects that appear, in ACE inhibitors treated group were dry cough and taste disturbances, in β-blockers treated group were bradycardia and sleep disturbances while in combination therapy treated group were according to the combination used. Level of HDL was also significantly lower than HDL in ACE inhibitors group. keywords: ace; blockers; cardiovascular; combination; control; drug; group; hypertensive; individuals; inhibitors; mean; patients; regimens; risk; therapy; اٌذَ cache: bijps-418.pdf plain text: bijps-418.txt item: #285 of 579 id: bijps-419 author: A.Al-Shammaa, Dhuha; Y. Saour, Kawkab; M. Abdul-Khalik, Zaid title: Phytochemical Investigation for the Main Active Constituents in Arctium lappa L. Cultivated in Iraq date: 2017-03-28 words: 2141 flesch: 45 summary: This study confirms the presence of Chlorogenic acid, Caffeic acid, Arctiin and Arctigenin in Actium lappa plant cultivated in Iraq. Standards used to identify the main active constituents (Arctiin, Arctigenin, Caffeic acid and Chlorogenic acid) were obtained from China (Cheng du Biopurify phytochemicals Ltd.).UV was done in methanol. keywords: acid; arctigenin; arctiin; arctium; constituents; hplc; lappa; plant; root; std cache: bijps-419.pdf plain text: bijps-419.txt item: #286 of 579 id: bijps-420 author: N. Sabir, Mohammed; K. Rachid, Shwan title: Comparative Analysis of the Fatty Acid Pattern of Silybum marianum with Nigella sativa by Gas Chromatography-Mass Spectrometry date: 2017-03-28 words: 3857 flesch: 58 summary: Normally, fatty acids are acids produced in cell after catabolism break down of fat. The common constituents of the lipids in plants are branched fatty acids, and they are rarely found in the integral lipid. keywords: acid; ether; fatty; marianum; mass; nigella; nigella sativa; petroleum; plant; sativa; seeds; silybum; silybum marianum cache: bijps-420.pdf plain text: bijps-420.txt item: #287 of 579 id: bijps-421 author: A. Fatohy, Heba; A. Abdul-Rasool, Alaa title: Effect of Different Diluent and Binder Types on the Preparation of Bisoprolol Fumarate as Tablet Dosage Form date: 2017-03-28 words: 4064 flesch: 51 summary: Stability study within one month The effect of different temperatures on the degradation of Bisoprolol tablet was studied by storing samples of Bisoprolol tablet F1 under 40, 50 and 60 o C for one month; samples were taken at certain time intervals to determine percent drug remaining versus time. Bisoprolol tablets were prepared by two methods (direct and wet) using different proportion and types of diluents, different binder types and forms, then evaluated for, weight variation, hardness, friability, disintegration time and dissolution rate. keywords: binder; bisoprolol; diluent; disintegration; effect; formulas; hardness; method; min; preparation; tablet; time cache: bijps-421.pdf plain text: bijps-421.txt item: #288 of 579 id: bijps-422 author: M.Toma, Nawar; I.Khalil, Yehia title: Formulation and Evaluation of Bilayer Tablets Containing Immediate Release Aspirin Layer and Floating Clopidogrel Layer date: 2017-03-28 words: 4429 flesch: 41 summary: Key words: Aspirin, Clopidogrel, Bilayer tablet, Floating tablet. To administer fixed dose combinations of different active pharmaceutical ingredients, prolong the drug product life cycle, fabricate novel drug delivery systems such as chewing device, buccal/mucoadhesive delivery systems, and floating tablets for gastro-retentive drug delivery (2). keywords: aspirin; bilayer; clopidogrel; dissolution; effect; formulas; matrix; polymer; release; sodium; study; tablets; time cache: bijps-422.pdf plain text: bijps-422.txt item: #289 of 579 id: bijps-424 author: S. Jabbar, Zainab; J. Al-Shamma, Kassim; A. Taher, Mohammad title: Some Hormonal Changes in Women with Primary Hypothyroidism under the Effect of Thyroid Hormone Replacement Therapy date: 2017-03-28 words: 4321 flesch: 60 summary: A significant increase in free testosterone and FBG and significant decrease in TT3 and E2 levels in normal cyclic patients women when compared with normal cycle control group. The present work demonstrated that estradiol level is decreased in both groups of patients women (normal cyclic and postmenopausal) when compared with their control groups. keywords: control; cycle; cyclic; glucose; group; hypothyroidism; insulin; levels; patients; postmenopausal; women; انُساء cache: bijps-424.pdf plain text: bijps-424.txt item: #290 of 579 id: bijps-425 author: A. Yas, Ali; I. Khalil, Yehia; S. Mohamed, Mohamed title: Response Surface Methodology for Development and Optimization of Theophylline Pulmonary Delivery System date: 2017-03-28 words: 8092 flesch: 55 summary: Where % r – cumulative % TP released at time t, K – rate constant of the model and n – release exponent Checkpoint analysis The checkpoint analysis was performed to confirm the reliability of the equations and plots in responses prediction. After being cooled to room temperature, the extract is filtered through 0.45 µm syringe filter and the content was determined spectrophotometrically at 274 nm against filtered extract from TP free solid lipid microparticles as a blank using spectrophotometer (Hitachi / Japan). keywords: delivery; drug; effect; figure; journal; lipid; microparticles; nanoparticles; nps; release; sci; solid; system; table; theophylline; vol.22(1 cache: bijps-425.pdf plain text: bijps-425.txt item: #291 of 579 id: bijps-426 author: J. Mohammed, Huda title: Physicochemical Factors Affected the Partial Purified Lipase Activity of Acinetobacter baumannii "local isolates" date: 2017-03-28 words: 4160 flesch: 50 summary: (6) wherease Park et al., recorded that the Zn ++ has inhibitory action on A. baumannii lipase (34) but other study reported that lipase activity is slightly inhibited by Zn ++(1) . Characterization of lipase lipase assay The hydrolytic activity was tested by trimetric method, 20 mM phosphate buffer / Arabic gum (1%w/v) and the substrate (olive oil) 1/1 (v/v) were made up to a total volume of 10 ml. keywords: acinetobacter; activity; baumannii; characterization; enzyme; etal; lipase; lipase activity; mcg; positive; production; purification; temperature cache: bijps-426.pdf plain text: bijps-426.txt item: #292 of 579 id: bijps-427 author: J.Kadhim, Dheyaa; J.Al-Shamma, Kassim; G. Hussein, Adeeb title: Association of Admission Serum Resistin Level with Acute ST-Segment Elevation Myocardial Infarction in Iraqi Patients date: 2017-03-28 words: 3912 flesch: 58 summary: Spearman correlation was performed to evaluate the relationship between resistin level and the values of other selected clinical variables among patients with STEMI. No significant correlation was found between age, BMI, S. uric acid, S. Creatinine, S. urea, Total cholesterol, HDL-c, serum leptin, and serum cTnI and resistin level (Table 4). keywords: acute; adiponectin; et al; level; patients; resistin; serum; stemi; study; variables cache: bijps-427.pdf plain text: bijps-427.txt item: #293 of 579 id: bijps-428 author: K. Abdulridha, Manal title: The Relationship between ABO Blood Group Distribution and the incidence of Upper Gastric and Duodenal Ulcer in Iraqi Patients date: 2017-03-28 words: 3927 flesch: 64 summary: Abstract The relationship between blood group antigens and peptic ulcer disease has been widely evaluated in the past, but only one study relating H pylori seroprevalence to ABO blood groups among Iraqi patients with peptic ulcer disease is available. These studies encouraged many researchers to investigate the relation between ABO blood groups and their secretor status with peptic ulcer (9, 11) . keywords: abo; age; blood; blood group; disease; gastric; group; helicobacter; infection; patients; pylori; study; ulcer; الذم cache: bijps-428.pdf plain text: bijps-428.txt item: #294 of 579 id: bijps-429 author: A. Shakir, Aous; J. Awad, Zainab title: Phytochemical Study of Flavonoid "Casticin" Present in the Fruits of Vitex agnus-castus L. Cultivated in Iraq date: 2017-03-28 words: 2796 flesch: 61 summary: Key words : Vitex agnus – castus , Flavanoid , Casticin انمسروع في انموجود في ثمار نباث شجرة ابراهيم( انكاستيسين)دراست كيموأحيائيت نهفالفينويذ انعراق أوش عبذانحسين شاكر * و زينب جهيم عواد ** * . IR For further characterization of the Casticin isolated from the dried fruit of Vitex agnus- castus, FT-IR spectroscopy analysis was performed using Casticin standard as a reference. keywords: agnus; casticin; castus; extract; extraction; flavonoid; fruits; identification; tlc; vitex cache: bijps-429.pdf plain text: bijps-429.txt item: #295 of 579 id: bijps-430 author: M. Saleh Al-Quraishi, Ghadah title: Serum Levels of Total IgE, IL-12, IL-13 and IL-18 in Children Patients with Asthma date: 2017-03-28 words: 3077 flesch: 63 summary: However, it was thought that IL-18 might act as a coinducer of both Th1 and Th2 cytokines, it was suggested that elevated IL-18 levels in asthma patients did not affect IFN-γ production and might enhance T-lymphocyte-mediated inflammation (15). Abstract T-cell activation and alteration of cytokine levels are involved in the pathogenesis of asthma. keywords: asthma; ige; il-13; levels; patients; serum cache: bijps-430.pdf plain text: bijps-430.txt item: #296 of 579 id: bijps-431 author: I. Rashid, Khaleel; M. Aljibouri, Abedaljasim; J. Zayer, AbdulAmeer; B. Khalid, Luma; Abdul-Munaem, Ahmed title: Study the Effect of Arabidopsis thaliana Extract on Reducing Blood Glucose Level in Diabetic White Albino Mice date: 2017-03-28 words: 3263 flesch: 60 summary: It was concluded that it was plant insulin, The presence of insulin-like molecule was recently demonstrated in the seed extract of Arabidopsis thaliana , this protein may be responsible for the lowering of blood glucose concentrations when it was injected in diabetic mice. The aims of this research are to determine the active compounds in Arabidopsis plant seeds, for anti-diabetic treatments of patients with high glucose level in their blood, and to achieve commercial and economic source of insulin. keywords: arabidopsis; blood; diabetes; extract; glucose; insulin; mice; plant; thaliana cache: bijps-431.pdf plain text: bijps-431.txt item: #297 of 579 id: bijps-432 author: N – A . Omar, Tagreed title: Synthesis and Preliminary Pharmacological Evaluation of Esters and Amides Derivatives of Naproxen as Potential Anti-Inflammatory Agents date: 2017-03-28 words: 3634 flesch: 63 summary: 2- ( 6 – methoxynaphthalen – 2 - yl ) – N - ( 4 - nitrophenyl)propanamide (compound IV) White crystal m.p. 175-176 °C; 4-chlorophenyl2- ( 6- methoxynaphthalen-2-yl ) propanoate (compound II): White powder (55% yield); m.p. 185-186 °C; Rf = 0.73; IR (cm− 1 ): 2,941, 2,852 (C-H), 1,753 (C=O) of ester, 1,602 and 1,523 (C=C of aromatic), 1,146(C-O); CHNO calculated (C20H17ClO3): C, 70.49; H, 5.03; O, 14.08 found: C, 71.82; H, 5.15; O, 14.75. keywords: compounds; cox-2; derivatives; edema; effect; naproxen; paw; white cache: bijps-432.pdf plain text: bijps-432.txt item: #298 of 579 id: bijps-433 author: I. Rasheed, Jawad; M. Abbas, Hassan title: Implementation of a Clinical Pharmacy Training Program in Iraqi Teaching Hospitals : Review Article date: 2017-03-28 words: 3109 flesch: 53 summary: As a conclusion, the practice of clinical pharmacy, as well as clinical pharmacy education, varies significantly throughout the world. In our opinion we lack for most of these programs, even the program of clinical pharmacy in ministry of health is not residency program and it is short and not subspecialized apart from being not recognized by academic institutes and references. keywords: american; board; care; education; health; patient; pharmaceutical; pharmacists; pharmacy; program; residency; training cache: bijps-433.pdf plain text: bijps-433.txt item: #299 of 579 id: bijps-434 author: Mutalib A.G Nasser, Abdul title: Phytochemical Study of Cynara scolymus L. (Artichoke) (Asteraceae) Cultivated in Iraq, Detection and Identification of Phenolic Acid Compounds Cynarin and Chlorogenic Acid date: 2017-03-28 words: 3391 flesch: 58 summary: Thus this work deals with phenolic acids cholrogenic acid and cynarin. Phenolic acids which include a combinations of caffeic acid and quinic acid. keywords: acid; artichoke; cynara; cynarin; extract; hplc; phenolic; plant; scolymus; standard cache: bijps-434.pdf plain text: bijps-434.txt item: #300 of 579 id: bijps-435 author: J. Aram, Jehan; J. Al-Shamma, Kassim; N. Al-Hassani, Ansam title: Effect of L-carnitine, Multivitamins and their Combination in the Treatment of Idiopathic Male Infertility date: 2017-03-28 words: 4060 flesch: 57 summary: Different letters represent significant difference between controls and the patients before treatment Table 5: Effects of multivitamins treatment on the mean ± SE of seminal fluid volume, sperm concentration, and sperm count in idiopathic infertile patients(n=29) compared to controls (n=30). The aim of the present study is to investigate and compare the efficacy of L-carnitine, multivitamins and their combination therapies on semen characteristics (seminal fluid volume, sperm concentration, sperm count, sperm morphology, sperm motility, progressive motile sperm count and round cells count) in idiopathic male infertility. keywords: carnitine; controls; count; infertility; male; motile; multivitamins; patients; sperm; sperm count; treatment cache: bijps-435.pdf plain text: bijps-435.txt item: #301 of 579 id: bijps-436 author: M. Murtadha, Riyadh title: Therapeutic Response of Serum Lipids to Atorvastatin in Type II Diabetic Patients date: 2017-03-28 words: 2908 flesch: 60 summary: It was found that the reduction in S. Total Cholesterol and S. LDL-C were less in diabetic patients than that in non-diabetic patients when they are using the same doses of Atorvastatin, while the changes in S. HDL-C and S. Triglyceride were nearly similar in both. So,higher doses of Atorvastatin (double doses) are needed to improve serum lipid levels in diabetic patients as compared to non-diabetic patients. keywords: atorvastatin; changes; cholesterol; diabetes; non; patients; serum; treatment cache: bijps-436.pdf plain text: bijps-436.txt item: #302 of 579 id: bijps-437 author: M. Attyah, Ahmed; H. Ismail, Sajida title: Protective Effect of Ginger Extract Against Cisplatin-Induced Hepatotoxicity and Cardiotoxicity in Rats. date: 2017-03-28 words: 4147 flesch: 54 summary: Abstract Iraqi J Pharm Sci, Vol.21(1) 2012 Protective effect of ginger extract 27 Protective Effect of Ginger Extract Against Cisplatin-Induced Hepatotoxicity and Cardiotoxicity in Rats. Abstract The protective effect of ginger extract against cisplatin-induced hepatotoxicity and cardiotoxicity was evaluated in 30 albino white rats(weighing 200-300 gm ) classified into 5groups (6 rats per each group). keywords: animals; cisplatin; effect; extract; ginger; group; hepatotoxicity; ldh; levels; liver; rats; serum cache: bijps-437.pdf plain text: bijps-437.txt item: #303 of 579 id: bijps-438 author: M. Al-Nema, Zeena; I. Mohammed, Samer; T. Ahmed, Fadia title: Effect of Administration of Crystalloid IV Fluids Preoperatively on Postoperative Pain date: 2017-03-28 words: 3068 flesch: 53 summary: Table 2: Postoperative pain within 5 hours in group A and B Pain scale of the Mayo Clinic (10) Number of patients group A % of patients group A Number of patients group B % of patients group B Less or equal 5 10 15.3 16 29.09 More than 5 55 84.6 39 70.9 Total 65 100 55 100 Table 3 : Use of analgesics in group A and B Use of analgesics Number of patients group A % of patients group A Number of patients group B %of patients group B Without analgesic 6 10.1 10 18.18 Tramadol 46 77.9 32 58.18 Diclofenac sodium 13 22.0 13 23.64 Total 65 100 55 100 Type of surgery In fact, a close examination of other studies of preoperative fluid regimens does reveal evidence for reduced postoperative pain with 2ml/kg/hr preoperative IV fluid therapy, although this has received little attention. keywords: fluids; group; pain; patients; preoperative; surgery cache: bijps-438.pdf plain text: bijps-438.txt item: #304 of 579 id: bijps-439 author: J. Mohamed, Suad; E. Mecheser, Abdullah title: Assessment of Patients’ Knowledge Toward Total Hip Replacement Home – Care date: 2017-03-28 words: 3299 flesch: 55 summary: 2. Provide the discharge patient with a pan phlet6 of all need instruction with figures illustrating to them all information they may need at home relating to activity and sleeping or medication Iraqi J Pharm Sci, Vol.21(1) 2012 Total hip replacement home – care 45 References 1. significant relation between the sample age group and patients knowledge toward mobility limitation at home (table 5) ,while significant relation between level of education and patients knowledge toward managing complication at home, which revealed that hip replacement educated patients can managing the complication at home (table7). keywords: care; complication; hip; home; knowledge; pain; patients; replacement; table; total; wound cache: bijps-439.pdf plain text: bijps-439.txt item: #305 of 579 id: bijps-441 author: S. Mohammed, Ebtehal; F. Al-Taie, Wafa; T. Numan, Intesar; A. Hussain, Saad title: Changes in Serum Levels of Tumor Necrosis Factor-Alpha and Antioxidant status in Different Stages of Malignant Prostate Cancer Patients in Iraq date: 2017-03-28 words: 2762 flesch: 51 summary: Results Table 1 indicated that TNF-α levels in all stages of malignant prostate patients were significantly higher compared to control (485.88%, 1152.04%, 2469.73%, and 3640.16%, respectively, P<0.05), and (126.67%, 384.39%, 894.19% and 1347% respectively, P<0.05) compared to BPH patients; significant differences were observed between the four stages of PCa patients; however, highly significant difference was shown in stage IV of malignant PCa patients compared to control and BPH patients (P<0.05) (Figure 1). Table 2 clearly demonstrated that MDA levels in all stages of PCa patients were significantly higher compared to control (329.92%, 457.79%, 616.8%, and 745.9% respectively), and 68.92%, 119.16%, 181.64%, and 232.37%, respectively compared to BPH patients, and significant differences were observed between the four stages of PCa; however, highly significant difference was observed in stage IV of malignant PCa patients compared to control and BPH patients (P<0.05) (Figure 2). keywords: bph; cancer; levels; oxidative; patients; pca; prostate; stages; stress; tnf cache: bijps-441.pdf plain text: bijps-441.txt item: #306 of 579 id: bijps-442 author: H. Jaber, Saba; T.Salih, Zainab; M. Salmo, Hiba title: Formulation of Azithromycin Suspension as an Oral Dosage Form date: 2017-03-28 words: 4247 flesch: 50 summary: Method of preparation Formulation of azithromycin suspension Several formulas of Azithromycin aqueous suspension were prepared, either as dry physical mixture powder for reconstitution or as granules for reconstitution. Table (1) shows different formulas of azithromycin suspension each was prepared as: Ablend of 4.0 %( w/v) azithromycin was mixed with different excipients stated in the above table, in a dry amber bottle (11) . keywords: azithromycin; dissolution; figure; formula; gum; hpmc; iii; suspension; xanthan; zithromax cache: bijps-442.pdf plain text: bijps-442.txt item: #307 of 579 id: bijps-443 author: A. Al-Haideri, Abdul-Muhsin; I. Abdulla, Najwa; K. Malih, Ibtihaj title: Polymeric Membrane Sensors for the Selective Determination of Metoclopramide Hydrochloride and their Applications to Pharmaceutical Analysis date: 2017-03-28 words: 4676 flesch: 55 summary: The response time of TBP electrode using 10 -5 M metoclopramide hydrochloride pH-effect The influence of the pH on the response of MCP membrane sensors was checked using 10 -2 M and 10 -3 M MCP hydrochloride solutions and recording the e.m.f. A typical calibration graph of MCP sensors is shown in Figure1. keywords: determination; electrode; hydrochloride; ion; mcp; membrane; metoclopramide; pharmaceutical; sensors; solution; tbp cache: bijps-443.pdf plain text: bijps-443.txt item: #308 of 579 id: bijps-444 author: M. Mikhael, Ehab; Y. Mohammed, Mahdi title: Serratiopeptidase a Hope in a Rapid and Better Improvement of Inflammatory Acne Vulgaris date: 2017-03-28 words: 2245 flesch: 51 summary: The results of this study showed that the effect of serratiopeptidase as adjuvant therapy for acne treatment result in a significant rapid improvement, this might be explained by serratiopeptidase ability in enhancing antibiotic efficacy and also increase the possibility of excellent improvement in acne appearance which may be due of it’s anti-inflammatory, anti-edemic. (13) After 12 months ( at end of clinical trial ) there is no significant difference between the 2 groups , this simply can be explained by the short period ( only one month ) usage of serratiopeptidase , however additional studies on large scale and for longer period of time are needed to confirm the benefit of addition of serratiopeptidase to acne treatment. keywords: acne; cases; group; improvement; inflammation; patients; serratiopeptidase; therapy; treatment cache: bijps-444.pdf plain text: bijps-444.txt item: #309 of 579 id: bijps-445 author: H. Mutlag, Shihab title: Dose Dependent Anti-inflammatory Effect of Ammi majus Alcoholic Extract in Rat: Chronic Study date: 2017-03-28 words: 3012 flesch: 51 summary: Ammi majus alcoholic extract (2mg , 4 mg and 8mg/rat) showed no effect on paw thickness compared to other test groups .The anti- inflammatory effect of Ammi majus alcoholic extract may be explained by the many active constituents of the extract : 1(quercetin), which is the most common flavoniod that scavenger both reactive oxygen species (ROS) and reactive nitrogen species (RNS). In conclusion, Ammi majus alcoholic extract possess anti-inflammatory activity in animals model of chronic inflammation and the effect increased with increasing the dose. keywords: alcoholic; anti; chronic; control; effect; extract; groups; inflammation; majus; paw; rat cache: bijps-445.pdf plain text: bijps-445.txt item: #310 of 579 id: bijps-446 author: M. Mohammed, Shaimaa; A. Amin, Inaam; Z. Sabri, Zeina title: Nitric Oxide, Peroxynitrite and Malondialdehyde Levels as Markers for Nitrosative/Oxidative Stress in Iraqi Patients with Systemic Lupus Erythematosus date: 2017-03-28 words: 3817 flesch: 58 summary: Serum nitric oxide levels were significantly elevated in SLE patients (mean + SE 263.58 + 35.42 mol/L) as compared with healthy control (162.48 +10.42 mol/L). The study findings support an association between nitrosative/oxidative stress and SLE through elevated level of NO, peroxynitrite and MDA in the serum of SLE patients. keywords: disease; erythematosus; level; lupus; mda; nitric; oxidative; oxide; patients; peroxynitrite; serum; sle; stress cache: bijps-446.pdf plain text: bijps-446.txt item: #311 of 579 id: bijps-447 author: Y. Muttalib, Lana; M. Naqishbandi, Alaadin title: Antibacterial and Phytochemical Study of Iraqi Salvia officinalis Leave Extracts date: 2017-03-28 words: 2968 flesch: 52 summary: Tannin test: A few drops of ferric chloride reagent 1% were added to 1ml of sage extract. Saponin test: A volume of 2ml of hydroalcoholic sage extract were shaken with 1ml of water. keywords: acid; activity; bacteria; chloroform; constituents; extract; officinalis; plant; sage; salvia cache: bijps-447.pdf plain text: bijps-447.txt item: #312 of 579 id: bijps-448 author: A. Ameen, Husam; J. Qasir, Ahlam title: Synthesis and Preliminary Antimicrobial Study of 2-Amino-5-Mercapto-1,3,4-Thiadiazole Derivatives date: 2017-03-28 words: 3587 flesch: 58 summary: Synthesis, characterization and biological activity of schiff base analogue of indole-3- Iraqi J Pharm Sci, Vol.21(1) 2012 Synthesis of thiadiazole derivatives 104 carboxaldehyde. Iraqi J Pharm Sci, Vol.21(1) 2012 Synthesis of thiadiazole derivatives 98 Synthesis and Preliminary Antimicrobial Study of 2-Amino-5- Mercapto-1,3,4-Thiadiazole Derivatives Husam A. Ameen* and Ahlam J. Qasir *,1 *Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq ** Ibn-Zuhr Hospital ,Ministry of Health ,Baghdad, Iraq. keywords: activity; bending; biological; compound; derivatives; ring; stretching; synthesis; table; thiadiazole; vibration cache: bijps-448.pdf plain text: bijps-448.txt item: #313 of 579 id: bijps-449 author: K. Mohammed Salih, Raya; M. Al-Gharawi, Ali; I. Al-Lehibi, Khalid title: The Correlation Between Hyperglycemia and Rheumatoid Factor in Type 2 Diabetic Patients in Al- Risafa Area, Baghdad date: 2017-03-28 words: 5394 flesch: 69 summary: While the number and percentage of RF positive subjects out of healthy control are only 3 (4.3%), 1(33.33%) male and 2(66.66%) females, respectively. يٙه يٕل نكم نرش 5.2≤ تذٌٔ سٛطشج ى انؼًم انشث %( أكثش 3563 ، keywords: arthritis; control; diabetes; diabetic; factor; glucose; mellitus; patients; rheumatoid; table; titer; total; type; انشث; اًن; ٕاَٙ cache: bijps-449.pdf plain text: bijps-449.txt item: #314 of 579 id: bijps-450 author: F. Al-Tukmagi, Haydar; Rasool M.Wayyes, Abdul title: Prescribing Pattern and Rational use of Drugs in Maysan Governorate, Iraq date: 2017-03-28 words: 2767 flesch: 58 summary: Total Average Percentage %of total Drugs %of AB in Rxs % of CS in Rxs % of anxiolytics in Rxs Results The prescribing indicators were calculated from each pharmacy and summarized in the table 2 in addition to the WHO standard value for each indicator (14) . In the present study, the percentage of drugs prescribed in generic names is 12% only, which is very low percentage compared with the WHO standard value that may reach 100%; this could be due to low training prescribers, no health education about the importance of restriction in drug use. keywords: drugs; health; pattern; pharmacies; prescribing; prescription; study; use; value cache: bijps-450.pdf plain text: bijps-450.txt item: #315 of 579 id: bijps-451 author: B. H. Al-Khedairy, Eman title: Effect of Additives on the Solubility and Dissolution of Piroxicam From Prepared Hard Gelatin Capsule date: 2017-03-28 words: 3619 flesch: 61 summary: However, drugs with low solubility and high permeability fall into Biopharmaceutics Classification System (BCS) class II (1) for which the dissolution is usually the rate- limiting step for gastrointestinal absorption. The aim of this study was to determine the impact of simple physical mixing of piroxicam with different amount of starch, lactose, superdisintegrants including crospovidone, cross carmellose sodium, and sodium starch glycolate each alone on the solubility of drug in 0.1N HCl .In keywords: additives; capsules; dissolution; drug; effect; lactose; pharm; piroxicam; solubility; ssg; starch cache: bijps-451.pdf plain text: bijps-451.txt item: #316 of 579 id: bijps-452 author: A. Al-Dawaf, Rana; Y. Saour, Kawkab title: Synthesis of Coumarin Derivatives Coupled to Amino Acid Esters and Studying their Biological Activity as Antimicrobial Agents date: 2017-03-29 words: 3151 flesch: 64 summary: Key words: coumarin, amino acid, coumarin antimicrobialal activity. Iraqi J Pharm Sci, Vol.21(2) 2012 Coumarin derivatives coupled to amino acid esters 1 Synthesis of Coumarin Derivatives Coupled to Amino Acid Esters and Studying their Biological Activity as Antimicrobial Agents Rana A. Al-Dawaf *,1 and Kawkab Y. Saour** * Department of Pharmaceutical Chemistry,College of Pharmacy, Al-Mustansiriya University, Baghdad, Iraq **Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract A series of coumarin derivatives linked to amino acid ester side chains were synthesized and evaluated of their antibacterial and antifungal activity. keywords: acid; activity; amino; coumarin; derivatives; ester; methyl; synthesis; table cache: bijps-452.pdf plain text: bijps-452.txt item: #317 of 579 id: bijps-453 author: K. Abdul-Wahab, Farah; Z. Abdul Jalil, Thukaa title: Study of Iraqi Spinach Leaves (Phytochemical and Protective Effects Against methotrexate-Induced hepatotoxicity in rats) date: 2017-03-29 words: 4555 flesch: 57 summary: This study was concerned with extraction of compounds in Iraqi spinach leaves, preliminary phytochemical evaluation, identification of two biological important flavonols, quercetin and kaempferol in spinach leaves and evaluation of the protective effect of aqueous spinach extract on methotrexate (MTX) induced hepatotoxicity in rats. The rats were divided into three groups as control, MTX group following a single dose of MTX (20 mg/kg, i.p) saline was administered for 5 days and the MTX+aqueous spinach extract group were rats received 200mg/kg orally of aqueous spinach extract 7days before and 5 days after MTX treatment. keywords: extract; figure; flavonoids; group; iraqi; kaempferol; leaves; liver; methotrexate; mtx; quercetin; rats; spinach; study; test cache: bijps-453.pdf plain text: bijps-453.txt item: #318 of 579 id: bijps-454 author: T. Flayyih, May; Q. Majeed, Raghad title: The Effects of Aloe vera Gel, Sesame Oil and Camphor Oil on Pseudomonas aeruginosa Isolated from Burnt Patients date: 2017-03-29 words: 3503 flesch: 57 summary: Iraqi J Pharm Sci, Vol.21(2) 2012 Aloe vera gel,sesame oil &camphor oil &Pseudomonas aeruginosa 18 The Effects of Aloe vera Gel, Sesame Oil and Camphor Oil on Pseudomonas aeruginosa Isolated from Burnt Patients May T. Flayyih* ,1 and Raghad Q. Majeed* *Department of Biology, College of Science, University of Baghdad ,Baghdad, Iraq Abstract Three isolates of P. aeruginosa were isolated from burnt patients. Ciprofloxacin and Amikacin were found effective against P. aeruginosa isolates with MIC values of 3.8 μg/ ml for Ciprofloxacin and 0.244 μg/ ml for Amikacin The antibacterial effect of Different concentrations of Aloe vera gel, Sesame Oil and Camphor Oil against P. aeruginosa were determined, Camphor was highly effective with Concentration inhibit bacteria value of 10% followed by Sesame Oil (20%) and Aloe vera gel (>75%). keywords: aeruginosa; aloe; aloe vera; camphor; camphor oil; gel; growth; oil; sesame oil; sub; vera; vera gel cache: bijps-454.pdf plain text: bijps-454.txt item: #319 of 579 id: bijps-455 author: A. Sadon, Ahmed; J. Qasir, Ahlam title: Design and Synthesis of Some Nitrate Derivatives of Mefenamic Acid with Expected Nitric Oxide Release date: 2017-03-29 words: 3657 flesch: 54 summary: Nitrate derivatives of mefenamic acid 29 Compound 4 3308 3059 2931 2856 1747, 1705 1639 1583 1516 1276 1224 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound 5 3275 3055 2929 2856 1745, 1710 1631 1581 1514 1265 1224 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound I 3286 3061 2931 2856 1747, 1710 1635 1581 1516 1278 1226 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester Overlapped C=O stretching of 2º amide (amide I) and N=O asymmetrical stretching of nitrate N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound II 3277 3059 2929 2854 1745, 1714 1637 1579 1512 1278 1226 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester Overlapped C=O stretching of 2º amide (amide I) and N=O asymmetrical stretching of nitrate N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester References 1. Compound Band (cm -1 ) Interpretation Compound 1 2500-3300 1751 1585, 1504 1261 Asymmetrical and symmetrical NH3 + stretching C=O stretching of ester Asymmetrical and symmetrical bending of NH3 + Asymmetrical C-O stretching of ester Compound 2 3377 3311 3063, 3037 2931 2856 1749 1629 1581 1510 1276 1228 N-H stretching of 2º aromatic amine N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound 3 3423 3367 2750-3200 3034 2937 1741, 1707 1626 1579 1512 1278 1211 N-H stretching of 2º aromatic amine N-H stretching of 2º amide OH stretching of carboxyl group Aromatic C-H stretching Asymmetrical C-H stretching of CH2 C=O stretching of acid C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of acid Iraqi J Pharm Sci, Vol.21(2) 2012 keywords: 2º amide; acid; amide; aromatic; ch3; compound; mmol; stretching; synthesis cache: bijps-455.pdf plain text: bijps-455.txt item: #320 of 579 id: bijps-456 author: K. Saleh, Shafaq title: Misuse of appetite- stimulant drugs in Babylon# date: 2017-03-29 words: 1961 flesch: 59 summary: Misuse of appetite-stimulant drugs in Babylon 31 Misuse of appetite- stimulant drugs in Babylon # Shafaq K. Saleh* ,1 *Babylon University , College of Pharmacy, Babel, Iraq Abstract Drug misuse is defined as using of drugs for a non-therapeutic or non-medical purpose. Appetite- stimulant drugs are example of drugs that are widely used without a prescription. keywords: appetite; drugs; misuse; results; stimulant; study; subjects; weight cache: bijps-456.pdf plain text: bijps-456.txt item: #321 of 579 id: bijps-457 author: S. Khamis, Ammar; H. Ali, Shatha; I. Al-Lehibi, Khalid title: The Correlation between Serum Total Adiponectin and Hemoglobin in Type 2 Diabetic Patients without Microalbuminuria date: 2017-03-29 words: 3978 flesch: 57 summary: In conclusion, anemia could be associated with a marked elevation in serum total adiponectin levels of diabetic patients without a detectable nephropathy (-ve microalbuminuria). In all 42 patients with type 2 diabetes, serum total adiponectin levels were correlated positively with serum creatinine and age, whereas, negative correlations were found with Hb. keywords: adiponectin; control; diabetes; difference; ferritin; hemoglobin; levels; non; patients; serum; study; total; type; urea cache: bijps-457.pdf plain text: bijps-457.txt item: #322 of 579 id: bijps-458 author: Y. Saour, Kawkab; I. Al-Bayati, Ridha; K. Hadi, Mohammed title: Synthesis of New Coumarin and 2-quinolone Derivatives with Expected Biological Activities date: 2017-03-29 words: 4009 flesch: 55 summary: Novel coumarin derivatives with expected biological activity. 50 µg/ml compound 10 showed significant activity against Staphylococcus aureus. keywords: activity; compounds; coumarin; derivatives; new; quinolone; str; synthesis; table cache: bijps-458.pdf plain text: bijps-458.txt item: #323 of 579 id: bijps-459 author: MA. Naji, Zahraa; M.Mohammed, Shaimaa; F. Muhammad, Mays title: Uric Acid as a Natural Scavenger of Peroxynitrite in a Sample of Iraqi Patients with Rheumatoid Arthritis date: 2017-03-29 words: 3511 flesch: 55 summary: NO levels in patients group 163.7±23.6 (mean±SE) µmol/l as compared with control subjects 164.3±9.22 (mean ±SE) µmol/L,( P>0.05) ,while there was significant increase in serum levels of peroxynitrite in patients group as compared with control subjects 8.71±1.16 (mean±SE) µmol/l,(0.53±0.04) (mean±SE) µmol/l respectively ,(P <0.05) .There was non- significant increase in serum levels of MDA in RA patients group 4.76 ±0.31 (mean±SE) nmol/ml as compared with control subjects 4.01 ±0.47 (mean±SE) nmol/ml, (P >0.05) Altered uric acid levels and disease states . keywords: acid; arthritis; levels; oxide; patients; peroxynitrite; rheumatoid; serum; study; subjects; uric cache: bijps-459.pdf plain text: bijps-459.txt item: #324 of 579 id: bijps-460 author: R. Abdullah, Ijlal; J. Al-Shamma, Kassim; N. Al-Hassany, Ansam title: Investigation and Comparative Study Among Various Methods of Contraception Used in Erbil City date: 2017-03-29 words: 4297 flesch: 62 summary: %(، اِا اٌطش٠مح االدٔٝ لثٛال فمذ وأد اٌذمٓ د٠ث١ِٛذسٚوس14.4ٟ%( . اِا تإٌسثح ٌٍٕضف اٌشذ٠ذ ٚإٌضف اٌّرمطغ ٚاٌؼذٜٚ ا ..11% ( ٚ ) 30.1د٠ثِٛذسٚوسٟ تشٚجسرشْٚ ) % ( ػٍٝ اٌرٛاٌٟ . keywords: condom; contraceptive; dmpa; effects; failure; iucd; male; methods; percentage; rate; study; subjects; users; women cache: bijps-460.pdf plain text: bijps-460.txt item: #325 of 579 id: bijps-462 author: J.Nasser, Saddam; H. Sameen, Laith; M.Ghareeb, Mowafaq title: Preparation and Evaluation of Oral Disintegrating Tablets of Ketoprofen by Dirct Compression date: 2017-03-29 words: 2993 flesch: 52 summary: Good F4 31.71±0.62 29.87±0.76 Good F5 29.83±0.28 31.60±1.27 Passable F6 27.83±0.28 32.86±1.24 Passable F7 33.20±0.14 30.73±1.51 Passable F8 33.21±0.18 32.45±0.72 Passable F9 33.61±0.34 29.42±0.76 Good F10 35.70±0.81 32.00±1.92 Passable F11 35.12±0.82 26.45±0.40 Good F12 37.43±0.98 28.00±3.43 Good Iraqi J Pharm Sci, Vol.21(2) 2012 Ketoprofen oral disintegrating tablets 67 Table 3.:Post compression parameters of prepared ketoprofen orodispersible tablets Formula Code Hardness (Kg/cm²) The result in vitro disintegration time indicated that formula (F1) has shortest disintegration time this decrease in the disintegration time may be attributed to the increasing porosity of the tablet so that the porous hydrophilic matrix will easily pick up the disintegration medium and thus facilitating the wicking action of the superdisintegrant and bringing about rapid tablet disintegration and shorter wetting time (17) . keywords: compression; disintegration; dissolution; drug; formula; good; ketoprofen; pharm; tablets; time cache: bijps-462.pdf plain text: bijps-462.txt item: #326 of 579 id: bijps-463 author: M. Al-Temimi, Hassan; j.Al-Shamma, Kassim; M.Alrubaie, Salim title: Evaluation of Metformin + Sitagliptin versus Metformin + Glibenclamide on Glycemic Control in Iraqis Type 2 Diabetic Patients date: 2017-03-29 words: 4954 flesch: 63 summary: In conclusion , the combination of metformin + sitagliptin improved fasting plasma glucose , postprandial plasma glucose & HbA1c % in comparison with metformin + glibenclamide combination. The aim of this study is to evaluate effects of combination of metformin + sitagliptin versus the effects of combination of metformin + glibenclamide on fasting plasma glucose, postprandial plasma glucose and HbA1c percentage in Iraqis type 2 diabetic patients. keywords: control; diabetes; glibenclamide; glucose; group; metformin; months; patients; plasma; sitagliptin; treatment; type cache: bijps-463.pdf plain text: bijps-463.txt item: #327 of 579 id: bijps-464 author: M. Ali, Huda; A. Al-Zubaidi, Mohammed title: Evaluation of Trace Elements in Iraqi Patients with Rheumatoid Arthritis by using Atomic Absorption Spectrophotometer (AAS) date: 2017-03-29 words: 4925 flesch: 50 summary: Figure1: Mean serum trace elements level (ng/ml) among the studied groups Figure 2: Mean serum trace elements level (ng/ml) among the studied groups Se Cr Mn Ni V Co Ge Table 1: Serum trace elements concentration in patients with rheumatoid arthritis and healthy control group in serum (ng/ml) *. keywords: arthritis; bone; control; copper; deficiency; elements; iron; magnesium; manganese; patients; results; rheumatoid; serum; trace; zinc cache: bijps-464.pdf plain text: bijps-464.txt item: #328 of 579 id: bijps-465 author: R. Abd Ali, Abeer; H. Ismail, Sajida title: The Protective Effect of Honey Against Amikacin- induced Nephrotoxicity in Rats date: 2017-03-29 words: 4512 flesch: 53 summary: The elevation of GSH levels in the serum of group 3, and decrease of MDA levels in comparison with group 2, attributed to the free-radical scavenging properties of the honey where it help in maintaining the levels of reduce glutathione and MDA. This study showed that amikacin causes nephrotoxicity represented by elevation of serum level of creatinine and urea, MDA and a decrease in the serum glutathione level. keywords: amikacin; creatinine; day; effect; group; gsh; honey; kidney; levels; mda; nephrotoxicity; rats; serum; study; urea cache: bijps-465.pdf plain text: bijps-465.txt item: #329 of 579 id: bijps-466 author: J.Al-faris, Omar; N. Al-Shawi, Nada; D. Kako, Maha title: Possible Cardiac Adverse Effects Induced by Therapeutic Doses of Ciprofloxacin in Juvenile Rats date: 2017-03-29 words: 2403 flesch: 53 summary: A 425.66±234.16* C 4030.33±228 *C Iraqi J Pharm Sci, Vol.21(2) 2012 Possible cardiac Adverse effects of ciprofloxacin 97 compared to control juvenile rats. Evaluation of ciprofloxacin-induced adverse cardiac effect in juvenile rats Iraqi J Pharm Sci, Vol.21(2) 2012 Possible cardiac Adverse effects of ciprofloxacin 94 Possible Cardiac Adverse Effects Induced by Therapeutic Doses of Ciprofloxacin in Juvenile Rats # Omar J.Al-faris * , Nada N. Al-Shawi **,1 and Maha D. Kako *** * Department of Clinical Pharmacology, College of Pharmacy, University of Mosul, Mosul,Iraq. keywords: cardiac; ciprofloxacin; control; group; iii; rats; serum; study cache: bijps-466.pdf plain text: bijps-466.txt item: #330 of 579 id: bijps-467 author: K. Ali Allah, Ali; N. Abd-Al Hammid, Shaimaa title: Preparation and Evaluation of Chloramphenicol as Thermosensitive Ocular in- situ Gel date: 2017-03-29 words: 4167 flesch: 57 summary: Chloramphenicol ocular in situ gel 98 Preparation and Evaluation of Chloramphenicol as Thermosensitive Ocular in- situ Gel Ali K. Ali Allah*, Shaimaa N. Abd-Al Hammid** ,1 * Ministry of health, Al-Hashimmia Hospital, Babel, Iraq **Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract The purpose of this study was to develop poloxamer-based in-situ gel of chloramphenicol aiming to increase bioavailability and prolong corneal contact time, controlling drug release, and enhancing ocular bioavailability. Then, carbopol would be in an extended configuration and form strong three- dimensional networks, therefore, F3 possess stronger gel structure and this will cause more retardation for drug release (28) . keywords: chloramphenicol; delivery; drug; formulations; gel; medium; ocular; pharm; pluronic; release; studies; temperature cache: bijps-467.pdf plain text: bijps-467.txt item: #331 of 579 id: bijps-468 author: N. Abed, Haithem; A. Abdulrasool, Alaa; M. Ghareeb, Mowafaq title: Controlled Release Floating Matrix Tablet of Captopril date: 2017-03-29 words: 4590 flesch: 59 summary: Streubel A., Siepmann J., Bodmeier R., Floating matrix tablets based on low density foam powder: effects of formulation and processing parameters on drug release, Eur. .Various attempts have been made to develop floating systems to control drug release; among them is the so called hydrodynamically balanced system (13, 14) .Such keywords: captopril; delivery; dissolution; drug; f11; formula; hpmc; matrix; pharm; release; system; tablet; time cache: bijps-468.pdf plain text: bijps-468.txt item: #332 of 579 id: bijps-469 author: A.H. Dakhel, Zainab title: Synthesis of 5-Fluorouracil Derivatives as Possible Mutual Prodrugs with Meloxicam and Ibuprofen for Targeting Cancer Tissues date: 2017-03-29 words: 3963 flesch: 62 summary: Synthesis of compound V: (11, 12) To a stirred solution of compound Vd (0.28 gm, 0.498 mmol) in dry chloroform (20 ml) at −20 o C, a suspension of compound Vb (0.190 gm, 0.498 mmol) in dry chloroform (20 ml) was added drop wise, then a solution of triethylamine (0.0504 gm, 0.498 mmol) in dry chloroform(20 ml) was added drop wise into the reaction mixture with continuous stirring at the same temperature, then the same procedure of compound II was carried out to give brown crystals of compound V. Percent yield (40.42%), melting point 124-126 o C. The structure of the final compounds and their intermediates were confirmed by their melting points, infrared spectroscopy and elemental microanalysis, the hydrolysis of compound III was studied using HPLC technique. keywords: chloroform; compound; mixture; mmol; reaction; sodium; solution; stretching; synthesis; yield cache: bijps-469.pdf plain text: bijps-469.txt item: #333 of 579 id: bijps-470 author: I. Khalil, Yehia; H. Khasraghi, Abeer; J. Mohammed, Entidhar title: Preparation and Evaluation of Physical and, Rheological Properties of Clotrimazole Emulgel date: 2017-03-29 words: 5375 flesch: 62 summary: Table 1 : Compositions of different formulas of clotrimazole emulgel ( % w/w) . Figure 5 : The effect of paraffin concentration on the release of clotrimazole 1`% w/w from carbopol 934 emulgel at pH 5.5 and 37 °C ( Mean ± SD , n=3) Figure 6 : The effect of paraffin concentration on the release of clotrimazole 1`% w/w from methyl cellulose emulgel at pH 5.5 and 37 °C. keywords: agents; carbopol; cellulose; clotrimazole; concentration; drug; effect; emulgel; formulas; formulations; liquid; methyl; oil; paraffin; phase; release; topical; type cache: bijps-470.pdf plain text: bijps-470.txt item: #334 of 579 id: bijps-471 author: M.T. Al-Bashir, Nada title: Poly Acrylamide Gel Electrophoresis of Serum Protein, Application to Kala-azar Patients date: 2017-03-29 words: 3561 flesch: 58 summary: Serum of control group showed the specific protein pattern with five protein bands, while serum protein profile in visceral leishmaniasis patients revealed three groups of electrophoretic banding patterns. , 50% showed twelve bands, 36.66% of the patients showed nine bands and 13.33% showed ten bands. Abstract Sera samples were collected from 60 children aged 4-60 months, all were clinically and serologically proven cases of visceral leishmaniasis, as well as from 10 healthy children, all were seronegative with no history of parasitic infection who serve as a control during the study. keywords: azar; bands; control; donovani; electrophoresis; kala; leishmaniasis; patients; protein; serum; serum protein; table; visceral cache: bijps-471.pdf plain text: bijps-471.txt item: #335 of 579 id: bijps-472 author: A. Kasim, Ali title: Calcium, Magnesium and Phosphorous Levels in Serum of Iraqi Women with Fibromyalgia date: 2017-03-29 words: 2176 flesch: 54 summary: 8/10/2011 Iraqi J Pharm Sci, Vol.20(2) 2011 Fibromyalgia in Iraqi women 35 Higher concentrations of phosphodiesterase (PDE) products and inorganic phosphate (Pi) have been observed in FM patients in comparison to controls (19) , together with a decrease in phosphocreatine, ATP and phosphocreatine/inositol phosphate (IP) ratio in the quadriceps (20) .Within Also there is a significant increase in serum calcium level (P <0.05) in the FM group in respect to NHI group. keywords: calcium; fibromyalgia; iraqi; level; magnesium; patients; serum; women cache: bijps-472.pdf plain text: bijps-472.txt item: #336 of 579 id: bijps-473 author: H. Altaie, Anmar title: Association between Gallstones and Diabetics Type 2 Iraqi Patients date: 2017-03-29 words: 3128 flesch: 66 summary: Certain exclusion criteria were followed to avoid interference of any other factors like drugs or pathological conditions with this research, which include: patients with history of gallstones and received previous therapy or undergoing treatment, patients with history of clinical disorders like hyperlipidemia, hepatic disorders and those taking medications other than prescribed for DM type 2. The mean ages of female patients having gallstones and DM type 2 was (56.2±9.24) years, is slightly higher (p<0.05) than the female controls having gallstones without diabetes (49.5±10.62) years while the mean ages of male patients having gallstones and DM type 2 was (58±10.5) years is significantly indifferent (p<0.05) from the male controls having gallstones without diabetes (58.2±10.88) years . keywords: age; controls; diabetes; gallstones; incidence; male; p<0.05; patients; type cache: bijps-473.pdf plain text: bijps-473.txt item: #337 of 579 id: bijps-474 author: OM Saleh, Basil; N. H. Anbar, Zainab; Y. Majid, Ali title: Serum Trace Elements (Zinc, Copper and Magnesium) Status in Iraqi Patients with Acne Vulgaris :( Case- Controlled Study) date: 2017-03-29 words: 3385 flesch: 69 summary: Recently, Nasiri et al. in 2009 indicated that serum zinc levels in 30 Iranian acne patients were lower than that of 35 healthy controls; however, this difference was not significant (P= 0.32) (10) . Serum trace elements and acne vulgaris 46 Table 1: Clinical and biochemical data for healthy male controls, - mild, - moderate, and - severe types of acne vulgaris patients. keywords: acne; copper; levels; patients; serum; study; vulgaris; zinc cache: bijps-474.pdf plain text: bijps-474.txt item: #338 of 579 id: bijps-475 author: S. Saleh, Eman title: The Correlation between Rheumatoid Factor, Chloroquine Phosphate in Osteoarthritis date: 2017-03-29 words: 2582 flesch: 65 summary: Figure (1) show the level of RFs check only between control, all patients before treatment and after 2 months figure (2) show the level at RFs AGM for control, (69.23%) of total patients before and after using the drug. Figure (1) show the level of RFs check only between control(C) and all patients before treatment (P0) and after 2 months (P2) while figure (2) show the level at RFs AGM for control, (69.23%) of total patients before and after using the drug. keywords: agm; check; chloroquine; control; cqp; disease; months; osteoarthritis; patients; rfs; rheumatoid cache: bijps-475.pdf plain text: bijps-475.txt item: #339 of 579 id: bijps-477 author: A. Merdaw, Maysoon title: Postoperative Wound Infections and the Antimicrobial Susceptibility in Baghdad Hospitals date: 2017-03-29 words: 3305 flesch: 47 summary: Our results appear to be maintained with strategies for preventing nosocomial infection,permanent education, strong application of protocols and urging the implementation of strict infection control policy. Key words: nosocomial infection, surgical wound, antimicrobial susceptibility. keywords: hospital; infections; patients; positive; pseudomonas; resistance; site; surgical; table; vancomycin; wound cache: bijps-477.pdf plain text: bijps-477.txt item: #340 of 579 id: bijps-478 author: A. abdul khaleq, Maysaa; H. Abd, Abdulkareem; A. dhahi, Maysaa title: Efficacy of Combination of Meropenem with Gentamicin, and Amikacin against Resistant E. coli Isolated from Patients with UTIs: in vitro Study date: 2017-03-29 words: 4145 flesch: 59 summary: Figure 2: Percentage of resistant E. coli isolates to antimicrobial ToB: Tobramycin; CN: Gentamicin; Sxt: Triomethoprime and sulfamethoxazole; Cip: Ciprofloxacin; The percentage of resistant isolates to each antimicrobial is shown in Figure (2).Standard disc diffusion assay was used to detect the sensitivity of pathogenic bacteria and results obtained were compared with those of Clinical and laboratory standard institute (9) .The results of the current study (Figure 2) revealed that most of E. coli isolates resist the β- lactam antimicrobials (like ampicillin and amoxicillin) (10) .noted the high resistance rates of gram positive and gram negative species to penicillins and some of cephalosporins. keywords: amikacin; antimicrobials; coli; combination; gentamicin; isolates; meropenem; mic; plasmid; resistance; result; study; syn cache: bijps-478.pdf plain text: bijps-478.txt item: #341 of 579 id: bijps-479 author: A. A. Al-Thanoon, Zeina; H. Mahmood, Isam title: Effects of Losartan versus Enalapril on Serum Uric Acid Levels in Hypertensive Patients with Metabolic Syndrome date: 2017-03-29 words: 3907 flesch: 51 summary: Comparison of uric acid levels between losartan group and enalapril group showed a significant reduction in the losartan group (P<0.001) as compared with the enalapril group (Table .5). It was reported that the risk of death due to ischemic heart disease increased by 77% (men), and by 30% (women) when serum uric acid levels where in the highest quartile (>416 µmol/l) compared with the lowest quartile (<321 µmol/l) (27) . keywords: acid; enalapril; group; levels; losartan; metabolic; mmol; patients; serum; study; syndrome; uric cache: bijps-479.pdf plain text: bijps-479.txt item: #342 of 579 id: bijps-480 author: F. AL- Marjani, Mohammed; S. Khazaal, Saba; M. Zayer, Thana; A. Atahia, Yasir; A. Kadhim, Kadhim title: The Prevalence of Microorganisms in H1N1 Patients Compared to Seasonal Influenza in a Sample of Iraqi Patients date: 2017-03-29 words: 1887 flesch: 50 summary: Iraqi J Pharm Sci, Vol.20(2) 2011 Prevalence of microorganisms in H1N1 patients 81 The Prevalence of Microorganisms in H1N1 Patients Compared to Seasonal Influenza in a Sample of Iraqi Patients # Mohammed F. AL- Marjani * ,1 , Saba S. Khazaal * , Thana M. Zayer * , Yasir A. Atahia ** and Kadhim A. Kadhim *** *Department of Biology , College of Science , AL- Mustansiriya University,Baghdad , Iraq. Abstract This study provides valuable information on secondary microbial infections in H1N1 patients compared to Seasonal Influenza in Iraqi Patients. keywords: baghdad; cases; h1n1; influenza; microorganisms; patients; virus cache: bijps-480.pdf plain text: bijps-480.txt item: #343 of 579 id: bijps-481 author: A.Mshiemish, Bahir title: Role of the Clinical Pharmacist in Reducing Preventable Adverse Drug Events date: 2017-03-29 words: 3976 flesch: 54 summary: Specialist physicians accepted (60) of (77) recommendations (i.e. do modifications in drug therapy depending on clinical pharmacist interventions). Role of clinical pharmacists interventions in detection and prevention of medication errors in a medical ward. keywords: ades; care; drug; errors; events; group; interventions; medication; patient; pharmacist; study cache: bijps-481.pdf plain text: bijps-481.txt item: #344 of 579 id: bijps-482 author: A. Razooki, Raghad; N. Saeed, Ebtihal; I. Omar Al-Deem, Hanan title: Microbial Contamination of Eye Drops in out Patient in Iraq date: 2017-03-29 words: 2857 flesch: 55 summary: This study aimed to determine the magnitude and pattern of microbial contamination of eye drops in out patient at the department of ophthalmology, at Baghdad national hospital, Iraq. Our data show acontamination rate of 15%, which is in the medium range of data puplished on the contamination of eye drops elsewhere (0.07% to 35.8%). keywords: benzalkonium; contamination; drops; eye; medications; microbial; solution; tip; use cache: bijps-482.pdf plain text: bijps-482.txt item: #345 of 579 id: bijps-483 author: A. Hasan, Hiba title: Evaluation of the Relation between Asthma, Obesity and Leptin Level in Iraqi Asthmatic Patients and the Main Risk Factors that are Associated with Leptin Level date: 2017-03-29 words: 3656 flesch: 61 summary: The lack of difference in leptin levels between asthmatic and healthy males could be a result either of a true modifying effect of sex on leptin or a small sample size to detect a difference (14) .The results also show that leptin level in female is higher than in male. Also it will work to indicate the main risk factors which play role in the elevation of leptin level within asthmatic patients. keywords: age; asthmatic; bmi; elevation; factors; iraqi; leptin; level; patients; risk; role; study cache: bijps-483.pdf plain text: bijps-483.txt item: #346 of 579 id: bijps-484 author: Y. Alhamdani, Fadya title: Acquired Error in using Antibiotic for Surgery Patients in Iraqi Hospitals date: 2017-03-29 words: 3075 flesch: 49 summary: The study shows that there are medication errors related to different causes: firstly, medical team error which include the nurse (70.9%) and the physician which include 1) delay in patient follow up after operation(5.9%) , 2) changing the AB without doing culture and sensitivity test (48.8%), and incomplete prescription order(13.1%). The aim of the present study was designed to evaluate the prevalence of medication errors of using AB after surgery, and to estimate the causes behind these error. keywords: antibiotic; care; cost; drug; errors; health; hospitals; medical; medication; patients; surgery; use cache: bijps-484.pdf plain text: bijps-484.txt item: #347 of 579 id: bijps-485 author: A. Abbass, Shaima; H. Ali, Shatha title: The Beneficial Role of Some Bone Markers in Evaluating Women with Osteoporosis under Different Therapeutic Regimens date: 2017-03-29 words: 4238 flesch: 57 summary: Bone markers in osteoporosis 5 than a sole line of treatment by itself (36,37) , although (Palacios et al, 2005) had reported a significant reduction in serum bone markers after treatment with calcium and vitamin D (38) . In recent years, a panel of new simple to use kits to determine bone markers had became available for the diagnosis, monitoring, of osteoporosis, and other metabolic diseases of bone tissue (9) . keywords: alendronate; bone; calcium; effect; hrt; markers; osteoporosis; patients; postmenopausal; serum; treatment; vit; vitamin; women cache: bijps-485.pdf plain text: bijps-485.txt item: #348 of 579 id: bijps-486 author: A.Abdulrasool, Alaa; A.Naseer, Abdulmuttalib; A.Rahi, Firas title: Application of Seed Mucilage Extracted from Lallemantia royleana as a Suspending Agent date: 2017-03-29 words: 3254 flesch: 58 summary: Characterization of mucoadhesive property of the mucilage The mucoadhesive property of L.royleana mucilage as well as for chitosan was determined according to Park and Robinson method. Dissolution of (2.5% w/v) furosemide suspension using L.royleana mucilage as a suspending agent The United States pharmacopoea (USP) rotating – paddle dissolution apparatus (Copley) was used to study drug release from the furosemide suspension. keywords: agent; chitosan; furosemide; gum; l.royleana; lallemantia; mucilage; suspension cache: bijps-486.pdf plain text: bijps-486.txt item: #349 of 579 id: bijps-487 author: A. Kurji, Hayder; M. Ghareeb, Mowafaq; H. Zalzala, Munaf title: Serum Level Profile and Pharmacokinetic Parameters of Single Oral Dose of Metronidazole in Type II Diabetic Patients date: 2017-03-29 words: 2997 flesch: 52 summary: Metronidazole pharmacokinetic in diabetic 15 There is a wealth of information regarding the pharmacokinetic parameters of metronidazole in healthy subjects; however, limited information is available about this issue in diabetic patients. The metabolism of caffeine is decreased in diabetic patient while the clearance of paracetamol is decreased in diabetic patients type II (17) . keywords: diabetes; mellitus; metronidazole; patients; pharmacokinetic; subjects; type cache: bijps-487.pdf plain text: bijps-487.txt item: #350 of 579 id: bijps-488 author: A.Taher, Mohammed; M. Moustafa, Mayada; S. Mahmood, Aqeel title: Measurements of HbA1c for Patients with Diabetes Mellitus and Foot Ulceration date: 2017-03-29 words: 3711 flesch: 66 summary: The biggest sites of foot ulcer were on the bottom of the big toe and less at the ball of the foot, table (3).Table (4), shows significant difference between FBS & HbA1c for diabetic foot ulcer patients and control group. Table 6 : Percentage of healing after treatment for diabetic foot ulcer patients. keywords: age; blood; care; control; diabetes; fbs; foot; glucose; hba1c; hemoglobin; level; patients; table; ulcer cache: bijps-488.pdf plain text: bijps-488.txt item: #351 of 579 id: bijps-489 author: H. Naser, Noor; F. Mahdi, Monther; N-A Omar, Tagreed; A. Fadhil, Amar title: Synthesis and Preliminary Pharmacological Evaluation of New Analogues of Diclofenac as Potential Anti-inflammatory Agents date: 2017-03-29 words: 3952 flesch: 64 summary: Anti-inflammatory activity The anti-inflammatory activity of the tested compounds was studied using egg-white induced edema model (25) . [(Vc-Vt)/Vc], Where Vc and Vt represents mean paw thickness in control and tested groups (at time t-time zero) respectively (26) , the results were represented in table 3. Results and Discussion The most widely used primary test to screen new anti-inflammatory agents measure the ability of a compound to reduce local edema induced in the rat paw by injection of an irritant agent (27) . keywords: compound; data; diclofenac; mixture; new; percent; reaction; synthesis; table; time; values; yield cache: bijps-489.pdf plain text: bijps-489.txt item: #352 of 579 id: bijps-490 author: I. Al- shemmary, Inssaf title: In vitro MIC of Itraconazole Against Different Isolates of Candida albicans date: 2017-03-29 words: 2732 flesch: 71 summary: MIC of nail isolates were 0.05 –6.4 μg /ml, skin isolates were 0.05 – 6.4 μg /ml, oral cavity isolates were 0.05 – 0.4 μg /ml, vagina isolates were 0.1 – 6.4 μg /ml and wound isolates were 0.1 – 1.6 μg /ml (table 2). Resistance mechanisms in clinical isolates of candida albicans. keywords: albicans; antifungal; candida; fungicidal; isolates; itraconazole; mic cache: bijps-490.pdf plain text: bijps-490.txt item: #353 of 579 id: bijps-491 author: J. Muhammed, Huda title: Bacterial and Fungal Contamination in Three Brands of Cosmetic Marketed in Iraq date: 2017-03-29 words: 2826 flesch: 48 summary: The raw materials used in cosmetics products may be grouped in to categories (Table1). Microorganisms can grow on almost every substances existing in nature and often able to attack or even decompose them , cosmetic ingredients are rich in nutrients that provide organic substrates in the form of sugar , starch , protein , amino acids , organic acids , alcohols , lipids and etc. for microbial growth (21) , addition to that ,water is a fundamental requirements for any microorganisms likely to contaminate the cosmetics products , thus untreated or non sterile water can support microbial growth leading to contamination of cosmetics products (11) , generally microorganisms of interest in raw materials or cosmetic products grow best around neutral pH 7.0 and many yeast and molds are able to tolerate acid keywords: aeruginosa; c.f.u./ml; contamination; cosmetic; microorganisms; pencil; products; pseudomonas; staphylococcus cache: bijps-491.pdf plain text: bijps-491.txt item: #354 of 579 id: bijps-492 author: GH. AbdulKarim, Nadia; A. Taher, Mohamed; N. Almarayati, Amal title: The Role of Some Inflammatory Markers (IL-6 and CRP) in the Pathogenesis of Acute Coronary Syndrome in Iraqi CCU for Heart Diseases date: 2017-03-29 words: 4055 flesch: 36 summary: Lindmark et al agreed with Manginas that IL-6 is a strong independent marker of increased mortality in UA patients, as IL-6 with both pro- and anti-inflammatory mediators affecting both B-cell immunoglobulin production and T- cell cytotoxic activity, and this indicates a possible role for IL-6 in progression of coronary artery disease (CAD) Accordingly, elevated CRP levels could be linked to increased long-term mortality [29] . keywords: acs; acute; coronary; crp; disease; elevated; factors; il-6; levels; markers; patients; protein; risk; serum cache: bijps-492.pdf plain text: bijps-492.txt item: #355 of 579 id: bijps-493 author: A. Al-Rikaby, Maitham; J. Al – Shamma, Kasim; A. Majeed, Ibrahim; SH.Hamondi, Saad title: Possible Augmentive Effect of Antioxidant Vitamin C in Patients with Essential Hypertension Treated with Amlodipin or Enalapril date: 2017-03-29 words: 4466 flesch: 62 summary: The addition of vitamin C to amlodipine or enalapril treated patients had resulted in a significant (p<0.05) lowering effect on mean blood pressure after two, three and four weeks. On the other hand, the addition of vitamin C to amlodipine or enalapril treated patients had resulted in a significant lowering of serum MDA after two and four weeks of treatment. keywords: amlodipine; antioxidant; blood; enalapril; group; hypertension; patients; pressure; serum; time; treatment; vitamin cache: bijps-493.pdf plain text: bijps-493.txt item: #356 of 579 id: bijps-494 author: W. Ameen, Dina title: Development and in vitro Evaluation of Bioadhesive Vaginal Tablet using Econazole Nitrate as a Model Drug date: 2017-03-29 words: 5375 flesch: 57 summary: (8) The aim of this study is to investigate the use bioadhesive polymers: Carbopol 941 P and sodim carboxymethyl- cellulose or methylcellulose in different ratios to develop EN vaginal tablet .The developed tablets were evaluated for their physical and bioadhesive characteristics, and in vitro release of EN. Materials and Methods Materials Econazole nitrate (EN) supplied by Samarra Drug industries, carbopol 941(CP), (Goodrich,USA),Sodium carboxymethyl- cellulose (NaCMC), Methylcellulose (MC), Sodium lauryl sulfate (SLS), and Magnisium stearate (BDH Chemicals, LTD),Liverpool, England) ,Agar no.1( Oxoid Limited , England), all other reagents are of analytical grade. Table 2: Results of the physical evaluations conducted on EN bioadhesive vaginal tablets prepared Formula # Weight variation (mg) ± SD a Friability (%) a Hardness (kp) b Drug Content (%) ±SD b Tablet thickness (mm) b Surface pH b F1 748.4± 11 0.1±0.005 >13 98.5±0.2 4.4±0.02 keywords: bioadhesive; buffer; delivery; dissolution; drug; econazole; formulae; nacmc; nitrate; order; release; swelling; tablet; water cache: bijps-494.pdf plain text: bijps-494.txt item: #357 of 579 id: bijps-495 author: A. Aziz, Tavga title: Concentration-Dependant Antioxidant Activity of Pentoxifylline in Nitrite-induced Hemoglobin Oxidation Model date: 2017-03-29 words: 2188 flesch: 50 summary: PTX is known to become metabolized to its corresponding 8- oxo derivatives in the mammalian system (6) ; these metabolites (methyluric acids) are known to inhibit lipid peroxidation in human erythrocyte membranes in vitro and function as free radical scavengers (7,8) suggesting their antioxidant effects in vivo. Ciuffetti, G, Mercuri M, Ott C, Lombardini R, Lupattelli G, Santambrogio L, Mannarino E. Use of pentoxifylline as an inhibitor of free radical generation in peripheral vascular disease. keywords: effect; methb; nitrite; oxidation; pentoxifylline; ptx; time cache: bijps-495.pdf plain text: bijps-495.txt item: #358 of 579 id: bijps-496 author: M. Thomas, Lena; I.Khalil, Yehia title: Preparation and Evaluation of Atenolol Floating Beads as a Controlled Delivery System date: 2017-03-29 words: 5573 flesch: 53 summary: This work aims to formulate a promised controlled-release atenolol beads that are capable of floating on gastric juice to prolong gastric residence time, thereby extend the time of drug release and then enhance its oral bioavailability, using aqueous colloid polymer dispersion method. Analysis of Drug Release Mechanism To establish the release kinetics and mechanism of drug release from the floating beads in different media, data obtained in the first 120 minutes of the in vitro release studies in 0.1 N HCl (pH 1.2) and acetate buffer (pH 4.6) were fitted to into zero-order, first-order, Higuchi, and Baker-Lonsdale models. keywords: alginate; atenolol; beads; buffer; dissolution; drug; effect; ethylcellulose; mixture; pharm; polymer; ratio; release; sodium cache: bijps-496.pdf plain text: bijps-496.txt item: #359 of 579 id: bijps-497 author: A. Al-Emami, Sura; H. Faraj, Aliaa; M.R. Al-Abadi, Dahlia title: Relation of ?-Amylase Activity with Glucose and Anti-Gliadin IgA and IgG in Sera of Patients with Celiac Disease date: 2017-03-29 words: 3143 flesch: 65 summary: α -Amylase activity and celiac disease 81 Relation of α-Amylase Activity with Glucose and Anti-Gliadin IgA and IgG in Sera of Patients with Celiac Disease Sura A. Al-Emami * ,1 , Aliaa H. Faraj* and Dahlia M.R. Al-Abadi* * Department of Chemistry , College of Science, Al-Mustansiryia Univirsity ,Baghdad,Iraq. Since the measurement of α-amylase activity is the most widely used biochemical test for the diagnosis of pancreatic and non pancreatic disease , therefore serum α-amylase were studied in the present study in an attempt to evaluate the usefulness of this enzyme in the diagnosis of celiac disease and its relationship with anti gliadin IgA and IgG and serum glucose . keywords: activity; amylase; celiac; disease; gliadin; iga; igg; patients; sera cache: bijps-497.pdf plain text: bijps-497.txt item: #360 of 579 id: bijps-498 author: Sagban, Sura; N. Al-Shawi, Nada; Mohammad, Alia; Talib, Ashwak; Hasson, Utoor title: The Effect of Orally -Administered Calcium Carbonate to Pregnant Women with Mild Pre-eclampsia date: 2017-03-29 words: 4334 flesch: 55 summary: This study showed that serum calcium level in mild pre-eclampsia are lower than in normotensive pregnant women ,this finding support the hypothesis that hypocalcemia is a possible etiology in pre-eclampsia ; additionally this study showed the possible beneficial effect of calcium supplementation in controlling pre-eclampsia and reducing blood pressure by increasing serum calcium level . Figure 5: The effect of treatment with calcium carbonate 500 mg tablet in mild pre-eclamptic women on serum calcium level. keywords: blood; calcium; carbonate; control; eclampsia; mean; pre; preeclampsia; pregnancy; pregnant; pressure; serum; women cache: bijps-498.pdf plain text: bijps-498.txt item: #361 of 579 id: bijps-499 author: A. Al-Shikli, Raghad; A.Abdulrasool, Alaa; M. Al-Hiti, Mustafa title: Effect of Some Storage Conditions upon the Survival of Some Fungal Spores date: 2017-03-29 words: 5426 flesch: 50 summary: The result also indicate that there is a significant different (p<0.05) between the three humidites as well as there are significant different between multivitamin and folic acid tablets and a significant difference between the weeks of storage. Multivitamin tablets showed more survival than folic acid tablets and this is due to the presence of more nutrients. keywords: acid; aflatoxin; effect; folic; fungal; growth; humidity; multivitamin; production; spore; storage; survival; tablets; temperature; weeks cache: bijps-499.pdf plain text: bijps-499.txt item: #362 of 579 id: bijps-500 author: A.Taher, Mohammed; A.Atia, Yaser; K.Amin, Manal title: Improving an Ovulation Rate in Women with Polycystic Ovary Syndrome by Using Silymarin date: 2017-03-29 words: 4991 flesch: 58 summary: Table-1 shows that the clinical presentations of patients in present study like those reported in other studies of polycystic ovary syndrome in that it is a heterogeneous disorder Investigations included : serum fasting glucose levels, fasting insulin levels, serum testosterone, serum progesterone and serum leutinizing hormone (LH).All patients participi- tated in this study were diagnosed having PCOS and were non-diabetic, not hypertensive, not pregnant , and not taking any medications that affect the reproductive or metabolic func- tions with 90 days of study. (34.35) Silymarin may produce its effect on glucose and insulin levels by another mechanism through blockage of TNF-α where that serum TNF-α concentration have been high in normal- weight PCOS women and even higher levels in obese women with PCOS. keywords: effect; group; insulin; levels; metformin; ovary; patients; pcos; progesterone; resistance; serum; silymarin; syndrome; treatment; women cache: bijps-500.pdf plain text: bijps-500.txt item: #363 of 579 id: bijps-501 author: M. Malik, Ali; M. Malik, Emad; MJ Al-Shammaa, Nawal; M. Al-Rubaei, Zeinab title: A Comparative Biochemical Study of Proteins Profile in Iraqi Children and Adolescent with ?-Thalassemia date: 2017-03-29 words: 2767 flesch: 64 summary: As a Conclusion the alteration in some protein parts occurred which is more obvious in major thalassemia patients compared to the normal and pathological control groups. Total protein level depend on the balance between their synthesis and their catabolism or loss from body . keywords: albumin; control; major; patients; protein; serum; thalassemia cache: bijps-501.pdf plain text: bijps-501.txt item: #364 of 579 id: bijps-502 author: S. Al-Sabbagh, May title: Comparative Effects of Fentanyl, Medazolam, Lignocaine and Propranolol on Controlling the Hemodynamic Pressor Response during Laryngoscopy and Intubation date: 2017-03-29 words: 4544 flesch: 53 summary: The present study was designed to evaluate the effect of medazolom, lignocaine and propranolol as a valuable adjuvant to fentanyl in attenuating hemodynamic responses to endotracheal intubation in normotensive patients. Can calcium and sodium channel blockers attenuate hemodynamic response to endotracheal intubation? keywords: anesthesia; fentanyl; hemodynamic; induction; intubation; laryngoscopy; lignocaine; medazolam; patients; pressure; response cache: bijps-502.pdf plain text: bijps-502.txt item: #365 of 579 id: bijps-503 author: M. Jasim, Azhar title: Validity of Generalized Standard Addition Method for a Mixture of Amino Acid Analysis date: 2017-03-29 words: 3651 flesch: 46 summary: At pH higher than (2.7) low result for acetyl salicylic acid were obtained due to incomplete liberation acetyl salicylic acid from its salt with arginine. Determination of acetyl salicylic acid in this complex (1gm) of arginine acetylsalicylate– glycine complex was weighed and dissolved in (25 ml) of distilled water. keywords: aacciidd; aanndd; acetyl; acid; arginine; complex; glycine; method; ooff; pharm; procedure; solution; standard; titration; tthhee cache: bijps-503.pdf plain text: bijps-503.txt item: #366 of 579 id: bijps-504 author: G. Sabar, Ahmed title: Lithotripsy of Different Urinary Tract Stones by Using Seeds of Carum copticum date: 2017-03-29 words: 2425 flesch: 60 summary: Iraqi J Pharm Sci, Vol.19(2) 2010 Lithotripsy of urinary stone by Carum copticum seeds 38 Lithotripsy of Different Urinary Tract Stones by Using Seeds of Carum copticum Ahmed G. Sabar* ,1 * This research aimed to the use of these seeds as a lithotripsian against different types of urinary stones and determine the efficiency of these preparation against which types of stone. keywords: carum; copticum; lithotripsy; oxalate; patients; seeds; stone; table; tract; treatment cache: bijps-504.pdf plain text: bijps-504.txt item: #367 of 579 id: bijps-505 author: S. Shaokat, Siham; A. Hameed, Hamoudi title: Evaluation of Stability of Cefamandol and Ceftazidime with Clavulanic Acid Against Extended Spectrum ?- Lactamase date: 2017-03-29 words: 3644 flesch: 54 summary: NO of isolates Diameters of zone of inhibition / MM Amo Amc Tic Tim Cxt Cfm Cfz Cxm Ctr Amk Cip Rif Nal 1 0 4 0 5.5 16 2 3 10 11 10 12 19 0 2 0 4.5 0 7 16 3 3 12 10 11 10 0 18 3 0 3.5 0 8 18 2 5 8 5 14 12 19 0 4 0 4 0 8.5 17 0 4 4 13 12 11 10 0 5 0 5 0 9 17 6 14 15 12 12 11 19 0 6 0 5.5 0 9 19 10 14 15 13 12 18 0 0 7 0 6 0 7 20 11 11 15 12 18 20 0 18 8 0 6 0 6.5 20 5 10 13 10 18 24 0 19 9 0 6 0 9.5 20 5 11 12 10 15 22 19 19 10 0 7.5 0 9 17 7.5 13 10 10 12 10 19 18 E.coli (ESBL) 0 0 0 5 17 7 13 12 10 12 18 11 17 E.coli ATCC 25922 21 21 13 13 22 22 21 21 21 32 40 32 33 Iraqi J Pharm Sci, Vol.19(2) 2010 Stability of Cfm and Cfz with CA against β- lactamase 46 Ceftriaxone Azthreonam Ceftazidime Cefixime Imipenem Cefaloridin Azlocillin Carbenicillin Figure 1: Activity of ß– lactamase against ß- lactams antibiotics Figure 2: Antibiotic –enzyme Interaction ,by the highly sensitive double disks technique (24) demonstrated A : hydrolysis of ceftazidime and Cefalmandol by β-Iactamases producing E.coli B: Inhibition by Clavulanic acid (CA) . Although other clavams produced in nature may possess antibacterial and antifungal properties, clavulanic acid is the only one known clavam with potent ß– lactamase inhibitory activity owing in part to its 3R ,5R stereochemistry , it is a potent inhibitor of ß– lactamase enzymes produced by many strains of Staphylococcus aureus , E.coli , Klebsiella , Proteus , Sheglla , Pseudomonas , and Haemophilus influenzae (20,21,) . keywords: acid; ceftazidime; cfm; cfz; e.coli; esbl; isolates; lactamases; strains cache: bijps-505.pdf plain text: bijps-505.txt item: #368 of 579 id: bijps-506 author: N. Hamad, Maha; A. Abdul-Hussain, Dhuha title: Gravimetric Estimation of Caffeine in Different Commercial Kinds of Tea Found in the Iraqi Market date: 2017-03-29 words: 2464 flesch: 64 summary: Caffeine was also identified by TLC using silica gel GF254 plates developed in three different mobile phases and comparing the Rf values of isolated caffeine with standard using single and mixed spots , and detection was done under UV254nm. 1- Murexide test : Isolated caffeine gave a purple color. keywords: bags; caffeine; iraqi; standard; table; tea; water cache: bijps-506.pdf plain text: bijps-506.txt item: #369 of 579 id: bijps-507 author: A. Rasheed, Faris; N. Sulaiman, Jwan; Abdul-Raheem, Yousif title: Goserelin versus Norethisterone in the Management of Menorrhagia with Uterine Fibroid date: 2017-03-29 words: 3127 flesch: 58 summary: (16) Adding goserelin after uterine artery embolization was found not to increase in the reduction of the size of leiomyoma, (17) in the same study the reduction of size of fibroid in Goserelin group was 45%. Abstract Menorrhagia is common in patients with uterine fibroids, if operation needs to be delayed for a particular reason, goserelin can be used safely to reduce bleeding and the size of the tumor. keywords: fibroid; goserelin; group; hysterectomy; norethisterone; patients; study; treatment; uterine cache: bijps-507.pdf plain text: bijps-507.txt item: #370 of 579 id: bijps-508 author: M. Jasim, Thamer; G.Alabbassi, Mustafa; F. Hatem Almuqdadi, Suhad; K. Kamel, Jinan title: Anti-bacterial Properties of Melatonin against Mycobacterium Tuberculosis in Vitro date: 2017-03-29 words: 3238 flesch: 55 summary: Susceptibility patterns of many dilutions M.tuberculosis and M.bovis to many concentration of Melatonin Dilution of Bacteria Melatonin concentration mg/ml (0.4) (0.2) (0.1) (0.05) Control 3×10 7 CFU/ml (10 -1 ) S S S S R 3×10 5 CFU/ml (10 -3 ) S S S S R 3×10 3 CFU/ml (10 -5 ) S S S S R Sex of Patients Examined samples Number of positive M. tuberculosis isolates Number of positive M. bovis isolates No. Isolates Code of isolates Melatonin concentration (mg/ml) (0.4) (0.2) (0.1) (0.05) Control S S S S R L2 S S S S R L3 S S S S R L4 S S S S R L5 * S S S S R L6 * S S S S R L =isolate, S =Sensitive, R=Resist, *= M. bovis Table 5 : keywords: bacterial; effects; growth; iron; isolates; melatonin; mycobacterium; number; s s; tuberculosis cache: bijps-508.pdf plain text: bijps-508.txt item: #371 of 579 id: bijps-509 author: T.Salih, Zainab title: In vitro Evaluation of Tinidazole Bioadhesive Vaginal Gels date: 2017-03-29 words: 3526 flesch: 61 summary: Acomparision of vaginal gel vs. oral therapy .J.Reprod. Abstract Many trials were made to prepare Tinidazole 2% as bioadhesive vaginal gels using different gel bases including hydroxypropyl methyl cellulose (3 and 4% w/w), methylcellulose (3 and 4%w/w) and carboxymethylcellulose (2 and 3% w/w) .Swelling index of the polymers,pH , viscosity , bioadhesive force , and in-vitro drug release to the simulating vaginal fluid (S.V.F.) were investigated for all the prepared bioadhesive gels . keywords: bases; cmc; drug; gel; polymer; release; swelling; tnd cache: bijps-509.pdf plain text: bijps-509.txt item: #372 of 579 id: bijps-510 author: MK Al-Mulla Hummadi, Yassir title: Urine Protein SDS-PAGE Reveals Different Profiles in Iraqi Children with Kala-azar date: 2017-03-29 words: 3142 flesch: 38 summary: Urine protein profile in Kala-azar patients revealed three groups of banding patterns: group- 1(33.4)% of the patients show the pattern of 5 bands with a MW. Control group (1) group (2) group (3) Figure 2 : Urine protein profiles in normal and kala-azar children. keywords: azar; bands; children; javascript; kala; leishmaniasis; patients; profiles; protein; urine; visceral cache: bijps-510.pdf plain text: bijps-510.txt item: #373 of 579 id: bijps-511 author: Y. Al-hurr, Marwan title: Development of Modified Release Nicotine Tablet Formulation for Treatment of Ulcerative Colitis date: 2017-03-29 words: 4161 flesch: 59 summary: Table (1) summarizes 8 formulas to prepare modified release nicotine tablets by wet granulation method with alcohol. Development of modified release nicotine tablet formulation for treatment of ulcerative colitis Iraqi J Pharm Sci, Vol.19(2) 2010 Modified release nicotine tablet 75 Development of Modified Release Nicotine Tablet Formulation for Treatment of Ulcerative Colitis Marwan Y. Al-hurr *,1 * Department of Pharmaceutics, College of Pharmacy, University of Baghdad,Baghdad,Iraq. keywords: avicel; colitis; colon; delivery; drug; effect; eudragit; formula; nicotine; pharm; release; study; tablets cache: bijps-511.pdf plain text: bijps-511.txt item: #374 of 579 id: bijps-512 author: A.Al-Shikli, Raghad; A.Abdul-Rasool, Alaa; M. Al-Hiti, Mustafa title: The Survival of Different Fungal Spores During Tabletting date: 2017-03-29 words: 3000 flesch: 49 summary: One day after preparation Less than 10 * CFU/gm After storage for 8 week at 35 C 75 % RH Less than 10 * CFU/gm After storage for 8 week at 35 C 85 % RH Less than 10 *CFU/gm After storage for 8 week at 35 C 95 % RH Less than 10 * CFU/gm Interrelation of compression pressure and survival of A. flavus, penicillia and Cladosporia spores in multivitamin and folic acid tablets Multivitamin formulation were contaminated with A.flavus spores or cladosporium spores or penicillia spores using 102 and 104 spore/gm. Tablets were prepared at a variety of compression pressure (137.9, 144.8, and 148.3) MN/m2 and the number of survival was determined immediately upon ejection of tablets from the die. keywords: a.flavus; acid; compression; folic; fungal; penicillia; pressure; spores; survival; tablets cache: bijps-512.pdf plain text: bijps-512.txt item: #375 of 579 id: bijps-513 author: A. Abdul Razzak, Nadeem; F.Hussan, Samera; J. Qaseer, Ahlam title: Design and Synthesis of New Non-Steroidal Anti-inflammatory Agents with Expected Selectivity toward Cyclooxygenase-2 Inhibition date: 2017-03-29 words: 3854 flesch: 60 summary: Abstract This study includes design and synthesis of new non-steroidal anti-inflammatory agents (NSAIDs) with expected cyclooxygenase-2 (COX-2) selective inhibition to achieve better activity and low gastric side effects. 2. Harvey, R.A. and Champe, P.C. (EDs.): Anti-inflammatory drugs and autocoids. keywords: acid; amide; aspirin; compound; cox-2; new; nsaid; stretching; synthesis; vibration cache: bijps-513.pdf plain text: bijps-513.txt item: #376 of 579 id: bijps-514 author: K. Jabbar Alhamd, Alaa title: Bioequivalence of Two Formulations of Amoxicillin in Human Healthy Volunteers on (HPLC) Technique date: 2017-03-29 words: 3833 flesch: 52 summary: Figure 2: Typical chromatogram of HPLC analysis of Amoxicillin on ODS-DB column Figure 3: Typical chromatogram of HPLC analysis of plasma Amoxicillin on ODS-DB column Pharmacokinetics and statistical analysis The observation of maximum plasma concentration levels (C(max)) and time consuming to reach it (T(max)) were obtained from drug concentration versus time curves. Table 1: the linearity, precision and accuracy of blood plasma Amoxicillin samples. keywords: amoxicillin; column; concentration; detection; drug; formulation; hplc; human; iraqi; pharmacokinetic; phase; plasma; time cache: bijps-514.pdf plain text: bijps-514.txt item: #377 of 579 id: bijps-515 author: S. Jabbar, Mohammed; I. Khalil, Yehia title: Formulation of Metoprolol Bilayer Tablets as an Oral Modified Release Dosage Form date: 2017-03-30 words: 5846 flesch: 58 summary: 9. Lauretta M., Evelyn O. and Maria L., Formulation of biphasic release tablets containing slightly soluble drugs. Each layer may contain a different medicinal agent, separated for reasons of chemical or physical incompatibility, staged drug release, or simply for unique appearance of the layered tablet (3) . keywords: bilayer; dissolution; drug; figure; formulas; matrix; metoprolol; pharm; polymer; release; tablets; time cache: bijps-515.pdf plain text: bijps-515.txt item: #378 of 579 id: bijps-516 author: J.Awad, Zainab title: In Vitro Effect of Cholesterol and Different Sugars on Digitonin Production in Multiplied Shoots of Digitalis purpurea L. Plant date: 2017-03-30 words: 3497 flesch: 61 summary: The production of cardiac glycosides from the plant of zahrat al kishtiban ( Digitalis purpurea L .) by using tissue culture technique .Ph. Effect of Adding Cholesterol and Different Sugars to the Nutrient Medium on Production the Steroidal Saponin Digitonin From Digitalis Purpurea L Iraqi J Pharm Sci, Vol.19(1) 2010 In Vitro Digitonin production in Digitalis plant 31 In Vitro Effect of Cholesterol and Different Sugars on Digitonin Production in Multiplied Shoots of Digitalis purpurea L. Plant Zainab J.Awad *,1 * Department of Pharmacognosy ,College of Pharmacy, University of Baghdad ,Baghdad, Iraq. keywords: digitalis; digitonin; experiment; plant; production; shoots; sugars; tdz cache: bijps-516.pdf plain text: bijps-516.txt item: #379 of 579 id: bijps-517 author: T. Numan, Ahmed; R. Aziz, Manhel; M. Shaker, Sinaa title: Synthesis, Characterization and Antibacterial Activities of Ligand Type N2O4 Schiff base and its Novel Complexes with Co(II), Ni(II), Cu(II) and Zn(II) ions. date: 2017-03-30 words: 4760 flesch: 69 summary: Sal1 Sal 2 Sal 3 Sal 4 Sal 5 Sal 6 Sal 7 Sal 8 Sal 9 Sal10 H2L Nil 11 Nil Nil Nil Nil Nil Nil Nil Nil [Cu(L)](3) Nil Nil Nil Nil Nil Nil 12 9 Nil Nil keywords: base; cm -1; complexes; group; h2l; ligand; metal; molar; nil; schiff; spectrum; synthesis; table; εmax cache: bijps-517.pdf plain text: bijps-517.txt item: #380 of 579 id: bijps-518 author: Z. Abdul-Jalil, Thukaa; Saour, Kawkab; Nasser, Abdul- MutalibA. title: Phytochemical Study of some Flavonoids Present in the Fruits of Two Ammi L. Species Wildly Grown in Iraq date: 2017-03-30 words: 3248 flesch: 59 summary: Traces 0.035 Iraqi J Pharm Sci, Vol.19(1) 2010 Detection of flavonoids in Ammi L. species 52 Identification of Flavonoids by TLC TLC of the extracts (F1,F2,F3) obtained from dried ripe fruits of Ammi majus and Ammi visnaga , confirms the presence of quercetin and kaempferol in all extraction portions in comparison with standards. Ammi visnaga, Q: quercetin standard ) Iraqi J Pharm Sci, Vol.19(1) 2010 Detection of flavonoids in Ammi L. species 53 Isolation and Quantitative determination of quercetin and Kaempferol by preparative TLC From the investigation of the fruits extracts (fractions) of Ammi majus and Ammi visnaga on TLC plates, it was found that quercetin present in both fruits extracts but higher in Ammi visnaga while kaempferol also present in both fruits extracts but higher in Ammi majus. keywords: ammi; detection; ethanolic; extract; figure; flavonoids; fruits; kaempferol; majus; quercetin; species; visnaga cache: bijps-518.pdf plain text: bijps-518.txt item: #381 of 579 id: bijps-519 author: A. Ali, Ali title: The Effect of Long Term use of Glibenclamide on Serum and Urinary Sodium and Potassium Level in Type 2 DM Patients date: 2017-03-30 words: 2280 flesch: 47 summary: The effect of long term use of Glibenclamide on serum and urinary sodium and potassium level in type 2 DM patients Iraqi J Pharm Sci, Vol.19(1) 2010 Effect of glibenclamide on sodium and potassium level 58 The Effect of Long Term use of Glibenclamide on Serum and Urinary Sodium and Potassium Level in Type 2 DM Patients Ali A. Ali* ,1 *Department of Clinical Pharmacy, College of Pharmacy, University of Baghdad, Baghdad, Iraq. Parameter Control subjects (n=15) DM patients treated with glibenclamide (n=98) Serum sodium (meq/L) 139.95 ± 3.859 142.29 ± 6.67* Serum potassium (meq/L) 4.13 ± 0.56 4.71 ± 0.663* Urine sodium (meq/L) keywords: effect; glibenclamide; levels; patients; potassium; serum; sodium cache: bijps-519.pdf plain text: bijps-519.txt item: #382 of 579 id: bijps-520 author: H. Alubaidi, Gheid; A. Ali, Zeyan; R. Mahmood, Abdulrahman title: Detection of Carbohydrate Antigen CA19-9 Levels in Sera and Tissues' Homogenate of Breast and Thyroid Benign Cases date: 2017-03-30 words: 2024 flesch: 56 summary: The results of CA19-9 levels in sera were (15 ±1.58 and 10.67 ±2.08)U/ml respectively compared with serum CA19-9 levels of control group which was 7.74 ±4.92 U/ml, the results were found to be highly significantly in breast tumor patients and non significantly in thyroid tumor patients than control group. The results were found to be highly significant in tissues' homogenate of breast tumor patients and non significant in thyroid tumor patients of higher compare with the it's serum levels of the same patients groups. keywords: benign; breast; ca19; levels; patients; serum; thyroid; tumor cache: bijps-520.pdf plain text: bijps-520.txt item: #383 of 579 id: bijps-521 author: K. Ali, Layla title: The Effect of Chronic Renal Failure on Thyroid Hormones date: 2017-03-30 words: 2180 flesch: 56 summary: Introduction: Iraqi J Pharm Sci, Vol.19(1) 2010 Chronic renal failure on thyroid hormones 65 The Effect of Chronic Renal Failure on Thyroid Hormones Layla K. Ali *,1 *Nursing Department , Koya Technical Institute Abstract Chronic renal failure (CRF) affects thyroid function in multiple ways, including low circulating thyroid hormone concentration, altered peripheral hormone metabolism, disturbed binding to carrier proteins, possible reduction in tissue thyroid hormone content, and increased iodine store in thyroid glands. Alteration in thyroid function test findings may reflect changes in production of thyroid hormone by effects on the thyroid itself, on the hypothalamic - pituitary thyroid – axis, on peripheral tissue metabolism of the hormones, or a combination of these effects keywords: chronic; creatinine; failure; function; hormone; patients; thyroid; tsh; urea cache: bijps-521.pdf plain text: bijps-521.txt item: #384 of 579 id: bijps-522 author: H. Cheyad, Samir; K. Khudier, Kalisa; A. AL-Mzain, Khtan title: Effect of Chronic Exposure of Cadmium Chloride in Drinking Water on Structural and Functional Aspects of Thyroid Gland in Mature Male Rabbits date: 2017-03-30 words: 2658 flesch: 55 summary: H&E, 40x Figure 2: Section in thyroid gland from cadmium treated rabbit (group II), note follicular- H &E. 40x Figure 3 :Section in thyroid gland from cadmium treated rabbit (group III), showing large area of microfollicels of varying size with hypertrophic thyrocyte (arrow), and hardly little secretion in the lumen. keywords: cadmium; chloride; drinking; effect; exposure; gland; group; rabbits; thyroid; water cache: bijps-522.pdf plain text: bijps-522.txt item: #385 of 579 id: bijps-523 author: N. Saeed, Ibtihal; I. Ibrahim, Aseel title: Study the Prevalence of Helicobacter pylori Infection by Different Diagnostic Methods date: 2017-03-30 words: 4669 flesch: 57 summary: The aim of this study is to compare the different diagnostic techniques of Helicobacter pylori infection by using invasive methods (histological examination of gastric & duodenal biopsies stained by Giemsa &Haematoxilin & Eosin methods , & rapid urease test which is considered the gold standard methods & non-invasive serological methods such as ICM rapid test , all these tests provide information about the incidence and prevalence of H. pylori in population , diagnostic value for each test also the eradication of person. McNulty and Wise (15) were the first ones to use this test to detect H. pylori infection . keywords: diagnosis; endoscopy; gastric; helicobacter; infection; methods; patients; prevalence; pylori; result; sensitivity; specificity; test; urease cache: bijps-523.pdf plain text: bijps-523.txt item: #386 of 579 id: bijps-524 author: j.Hasson, Kahtan title: Enhancement of Atorvastatin Tablet Dissolution Using Acid Medium date: 2017-03-30 words: 1871 flesch: 37 summary: In this study some generic commercial products of Atorvastatin tablets were evaluated by dissolution test in acid medium by comparing with that of parent drug Lipitor of Pfizer Company. Some of solubilizing agents were studied in formulation of Atorvastatin tablet including; surface active agent and PEG 6000 .The keywords: atorvastatin; calcium; dissolution; figure; lipitor; medium; product; tablet cache: bijps-524.pdf plain text: bijps-524.txt item: #387 of 579 id: bijps-525 author: Q. Abdul-Kadir, Maadh; E. AL-Ani, Nadhum; M. Alwan, Shakir title: Synthesis of New Cyclic Amines-Linked Metronidazole Derivatives as Possible Prodrugs date: 2017-03-30 words: 3257 flesch: 60 summary: The intensity of compound III(having molar absorbitivity  =2.72 X 10 4 mole -1 .L.cm -1 ) is nearly twice that of metronidazole and compound II(=1.61 X 10 4 mole -1 .L.cm -1 ), since compound III has double concentration of chromophore of metronidazole and compound II as shown in figure (1); whereas in figure (2), the intensities of absorption of metronidazole, compound II and IV(=1.03 X 10 4 mole -1 .L.cm -1 ) are nearly equal, since they have the same concentration of chromophore. With respect to compound III, it was prepared as a new mutual ester prodrug (and also of the twin ester type) that may liberate, upon hydrolysis, piperazine derivative as anthelmentic in addition to the anti-infective activity of metronidazole. keywords: amines; compound; cyclic; derivatives; iii; metronidazole; pharm; piperazine cache: bijps-525.pdf plain text: bijps-525.txt item: #388 of 579 id: bijps-526 author: N. Aziz, Bassm; A. Al-Kataan, Mohammad; K. Ali, Wasan title: Lipid Peroxidation and Antioxidant Status in β-Thalassemic Patients: Effect of Iron Overload date: 2017-03-30 words: 4124 flesch: 55 summary: The effects of iron overload in thalassemic patients, represented with increased serum iron (157.75±7.57), before blood transfusion, on lipid peroxidation and antioxidant status are presented in table (3). The first group included twenty patients without signs of iron overload as revealed from the mean value of serum iron (90,97±12.92), referred as control, while the second group included twenty patients with clinical and biochemical signs of iron overload (157.75±7.57). keywords: acid; antioxidant; blood; iron; lipid; overload; oxidative; patients; serum; thalassemia; transfusion; vitamin cache: bijps-526.pdf plain text: bijps-526.txt item: #389 of 579 id: bijps-527 author: A. Alnakshabandi, Abdulkadir; A. Muhammad, Huda title: Prevalence of B-Thalassemia Carriers Among a Cohort of University Students in Hawler Province of Iraqi Kurdistan date: 2017-03-30 words: 3120 flesch: 67 summary: 2. Thalassemia carriers can be detected through clinical examination and complete blood count. The cardinal feature of thalassemia carrier state is elevated HbA2 level . keywords: carriers; cell; hba2; hemoglobin; iraqi; minor; normal; prevalence; students; subjects; thalassemia cache: bijps-527.pdf plain text: bijps-527.txt item: #390 of 579 id: bijps-528 author: A. Razooki, Raghad; N. Saeed, Ebtihal; Hamza, Heyam title: A Study on Cosmetic Products Marketed in Iraq: Microbiological Aspect date: 2017-03-30 words: 3562 flesch: 52 summary: Contaminated water is a likely source of organisms found in cosmetic products. The raw materials used in cosmetic products may be grouped into categories (Table 1). keywords: agar; bacteria; contamination; cosmetic; iraq; microbial; organisms; products; pseudomonas; shampoos; table; water cache: bijps-528.pdf plain text: bijps-528.txt item: #391 of 579 id: bijps-529 author: A.Sabri, Lubna; T. Sulayman, Hala; I. Khalil, Yehia title: An Investigation Release and Rheological Properties of Miconazole Nitrate from Emulgel date: 2017-03-30 words: 3851 flesch: 56 summary: On other hand, increase the emulsifying concentration with 7.5% w/w liquid paraffin as in formulas 7 and 8 showed significant (P<0.05) increase in release of miconazole nitrate as shown in figure 4.The treatment of obtained data with Higuchi principle revealed that best fit mechanism of miconazole nitrate 2% w/w release from emulgel with linear relationship when the amount of drug released plotted with square root of time (22) as shown in figure 5.The later result of formula 4 was found to be pharmaceutically bioequivalent with the reference one Mecozalen cream ® as shown in table 3. Figure 3: The effect of paraffin concentration on the release of miconazole nitrate 2% w/w from carbomer 941 emulgel at pH 5.5 and 37 ° C. Figure 4: The effect of paraffin concentration on the release of miconazole nitrate 2% w/w from SCMC emulgel at pH 5.5 and 37 ° C. Figure 5: The effect of emulsifying agent concentration on release of miconazle nitrate 2% w/w from emulgel. The influence of type of gelling agent and concentration of both oil phase and emulsifying agent on drug release was studied and compared with commercially available miconazole nitrate cream (Mecozalen ® ). keywords: carbomer; drug; effect; emulgel; formula; miconazole; nitrate; paraffin; release; scmc cache: bijps-529.pdf plain text: bijps-529.txt item: #392 of 579 id: bijps-530 author: Kader, Sardar; J.Al-Shamma, Kassim; A. Majeed, Ibrahim; T. Al-Ani, Abdulla title: Comparative Study between Oral Hypoglycemic Drugs Repaglinide, Glibenclamide and Rosiglitazone on Some Biochemical Parameters in Type 2 Diabetic Patients date: 2017-03-30 words: 4273 flesch: 55 summary: However, repaglinide acts on a different binding site than that of sulfonylureas (17) .The present work showed that fasting blood glucose and postprandial blood glucose in diabetic patients treated with rosiglitazone were significantly decreased after 4 and 8 weeks of treatment. The results showed that the the correlation (R2 values) between fasting and postprandial blood glucose in diabetic patients treated with repaglinide was 0.743 in comparing with R2 values in diabetic patients treated with glibenclamide 0.624 and rosiglitazone 0.499. keywords: blood; diabetes; fasting; glibenclamide; glucose; hdl; mmol; patients; repaglinide; rosiglitazone; treatment; type; weeks cache: bijps-530.pdf plain text: bijps-530.txt item: #393 of 579 id: bijps-531 author: S. Salem, Bader; F. Mahdi, Monther; H. Mohammed, Mohammed title: Synthesis and Preliminary Pharmacological Study of Sulfonamide Conjugates with Ibuprofen and Indomethacin as New Anti-Inflammatory Agents date: 2017-03-30 words: 3160 flesch: 61 summary: Animals were brought to the laboratory, and were divided into four groups (each group consist of six rats) as follow: Group A: Six rats served as control; and treated with the vehicle (propylene glycol 50% v/v); Group B: treated with diclofenac (reference agent) in a dose of 3mg/kg suspended in propylene glycol 50% v/v (11) ; Group C: treated with tested compound 10 in a dose equivalent to 10 mg/kg of ibuprofen as suspension in 50% v/v propylene glycol (12) ; Group D: treated with tested compound 11 in a dose equivalent to 2 mg/kg of indomethacin as suspension in 50% v/v propylene glycol (13) . Table 1 showed the effect of tested compounds (10&11) in respect to control group. keywords: compound; effect; group; ibuprofen; indomethacin; mixture; paw; stretching; sulfonamide; synthesis cache: bijps-531.pdf plain text: bijps-531.txt item: #394 of 579 id: bijps-532 author: Y. Saour, Kawkab title: Synthesis and Biological Evaluation of Two New Analogues of Gonadotropin Releasing Hormone (GnRH)D-alanine8 and D-alanine date: 2017-03-30 words: 5189 flesch: 64 summary: Analogue II showed significant ascorbic acid depletion as compared to the native hormone while the percentage in ascorbic acid depletion after administration of analogue I were not significant as compared to the native hormone. Table 3and 4 show the percent of depletion of ascorbic acid in the ovaries of the treated group. keywords: acid; analogue; ch2; gly; gnrh; hormone; leu; pro; stretching; vibration cache: bijps-532.pdf plain text: bijps-532.txt item: #395 of 579 id: bijps-533 author: S. Manhal, Falah; M. Abbas, Husam title: Frequency of Antineutrophil Cytoplasmic Antibodies (ANCA) in Some Autoimmune Diseases date: 2017-03-30 words: 3902 flesch: 61 summary: The low percentage of positive results detected by ANCA testing could be attributable to the limitations of our study, that's including: some of study patients were referred while they in remission stage rather than active phase of the diseases, the ELISA test was not coupled with indirect immunofluorescence technique (IIFT) due to the hospital policy, ANCA levels were not measured serially by quantitative image analysis, and the clinical relevance of the studied cases might be doubtful. The 'International Consensus Statement on Testing and Reporting ANCA' has been developed to optimize the clinical relevance of ANCA testing by the Studied groups LSD 4 (f-test) P-value Significance Control RA 1 0.672 Non Sig. keywords: anca; anti; antibodies; cytoplasmic; diseases; mpo; patients; pr3; sle cache: bijps-533.pdf plain text: bijps-533.txt item: #396 of 579 id: bijps-534 author: A.A. Ibrahim, Zaman; S.Muhsin, Salwa; A. Risan, Farhan title: Genetic Variations of Echinococcus granulosus Isolated from Sheep and Cows by Using Fingerprint DNA Method in Iraq date: 2017-03-30 words: 3418 flesch: 65 summary: This primer showed (5) unique patterns for DNA hydatid cysts samples of cows (Figure 3A, Table 3A), and (4) Unique patterns for sheep DNA hydatid Cysts samples (Figure 3B, Table3B). 4- Two µL from each DNA sample of both sheep and cows after performing several dilutions for the concentrated samples by D.W to reach the final required concentration starting the RAPD reaction Of DNA chain which ranged between 10-50ngm / each 1 µL of DNA sample and the final volume became 25µL (13) . keywords: bands; cows; cysts; dna; echinococcus; hydatid; patterns; primer; samples; sheep; unique cache: bijps-534.pdf plain text: bijps-534.txt item: #397 of 579 id: bijps-535 author: A. Al-Hussein Hassan, Hiba title: The Relationship between Uric Acid Concentration and Some of Plasma Lipids in Patients with C. V. Disease in General Hospital of Al-Nasseriya date: 2017-03-30 words: 2977 flesch: 49 summary: Uric acid (or urate) is non-protein nitrogen compound with the formula C5H4N4O3. The data showed a highly significant increased in the serum concentration of uric acid , cholesterol and triglyceride in cardiovascular disorders patients compared with healthy control (P<0.01) .In keywords: acid; cholesterol; concentration; control; disorders; groups; hdl; heart; patients; serum; triglyceride; uric cache: bijps-535.pdf plain text: bijps-535.txt item: #398 of 579 id: bijps-536 author: H. Jwied, Ahmed title: Hepatoprotective Effect of the Aqueous Extract of Camellia sinensis Against Methotrexate-induced Liver Damage in Rats date: 2017-03-30 words: 3841 flesch: 54 summary: A model of liver injury in rats was induced by intraperitoneal injection of 20mg/kg MTX as a single dose followed by saline and 1.25% and 2.5% aqueous extract of green tea (GTE) were orally administered 7 days prior and 5 days after MTX- intoxication as a sole source of drinking water. tea leaves are rich in flavanol monomers known as catechins such as epicatechins (13) , which are 13.6 g/100 g in green tea and 4.2 g/100 gm dry weight in black tea (14) .In keywords: antioxidant; days; effect; extract; green; gte; levels; lipid; liver; methotrexate; mtx; rats; tea; tissue; treatment cache: bijps-536.pdf plain text: bijps-536.txt item: #399 of 579 id: bijps-537 author: A. Sulaiman, Amaal; A. Hussain, Saad; M. Jum'ma, Kasim; H. Sigar, Assad title: Evaluation of the Anti-Inflammatory Effect of Pioglitazone in Experimental Models of Inflammation in Rats date: 2017-03-30 words: 3351 flesch: 55 summary: Anti-inflammatory effects of pioglitazone and/or Simvastatin in high cardiovascular risk patients with elevated high sensitivity C-reactive protein. Duffy JC, Dearden JC, Rostron C. Design , synthesis and biological testing of novel series of anti-inflammatory drugs. keywords: acute; anti; control; effect; group; inflammation; paw; pioglitazone; rats cache: bijps-537.pdf plain text: bijps-537.txt item: #400 of 579 id: bijps-538 author: K. Fakree, Najwan; H. Ali, Shatha title: Effect of COX-2 Inhibitors Selectivity on Lipid Profile in Hyperlipidemic and Normolipidemic Type 2 Diabetics date: 2017-03-30 words: 3849 flesch: 47 summary: Table (2) shows that in hyperlipidemic diabetic patients diclofenac caused a significant increase in serum TG/HDL-c ratio % change +73.87 (figure 6) without significant difference in serum LDL- c/HDL-c ratio. Analysis of results indicated that diclofenac increased serum triglycerides (TG) whereas; celecoxib group exerted a significant reduction in total cholesterol (TC), triglycerides (TG) levels in hyperlipidemic patients. keywords: celecoxib; cholesterol; diclofenac; effect; hdl; hyperlipidemic; inhibitors; ldl; normolipidemic; patients; serum; type cache: bijps-538.pdf plain text: bijps-538.txt item: #401 of 579 id: bijps-539 author: M. Juma'a, Kasim; A. Hussain, Saad; T. Numan, Intesar; H. Siqar, Assad title: Dose-dependent Anti-inflammatory Effect of Silymarin in Experimental Animal Model of Acute Inflammation date: 2017-03-30 words: 3234 flesch: 51 summary: The cell membrane stabilizing effect of silymarin on Iraqi J Pharm Sci , Vol.18 (Suppl.), 2009 Silymarin in acute inflammation 17 mast cell (20) may explain its effect on the initial phase of acute inflammation model mediated by histamine and 5-HT. It is now clear that silymarin suppresses early, intermediate and late phase of acute inflammatory model through interference with the initiation and propagation phases of acute inflammation. keywords: dose; edema; effect; inflammation; paw; rats; silymarin cache: bijps-539.pdf plain text: bijps-539.txt item: #402 of 579 id: bijps-540 author: Y. Mohammed, Zainab; F. Al-Jumaily, Essam; Y. Yaseen, Nahi title: In Vitro Cytotoxic Study for Purified Resveratrol Extracted from Grape Skin Fruit Vitis vinifera date: 2017-03-30 words: 4768 flesch: 63 summary: In vitro Study The in vitro method was used to investigate the effect of pure resveratrol on two types of tumor cell lines (human laryngeal carcinoma Hep-2 and murine mammary adenocarcinoma AMN-3 tumor cell lines) and to compare the results with resveratrol effect on normal cell line Ref-2 cell line at different concentrations and different exposure times. The cytotoxic effect of the pure resveratrol was studied in comparison with trans- resveratrol standard in concentrations of (12.5, 25, 50 and 100) µg/ml for both purified resveratrol and the standard, also the comparism included methotrexate drug in concentrations (0.05 , 0.1 , 0.2 and 0.4) µg/ml toward the growth effects of the three types of cell lines and at three exposure times (24, 48 and 72) hours. keywords: cancer; cell; concentration; cytotoxic; effect; exposure; hours; line; methotrexate; resveratrol; standard; study cache: bijps-540.pdf plain text: bijps-540.txt item: #403 of 579 id: bijps-541 author: H. Ali, Amal title: The Effect of Brucellosis on Lipid Profile and Oxidant-Antioxidants Status date: 2017-03-30 words: 3485 flesch: 52 summary: Significant differences were noted between the serum lipids of Brucellosis patients and control group. Table l , Figure 1.While circulating concentration of glutathione (GSH), soluble antioxidants were higher in Brucellosis patients than in control groups (mean  SE 2.49  0.4). keywords: brucellosis; cholesterol; control; disease; glutathione; hdl; ldl; lipid; mean; oxidant; patients; profile; serum; total cache: bijps-541.pdf plain text: bijps-541.txt item: #404 of 579 id: bijps-542 author: A.AlOmari, Nohad; O. Omar, Adnan; M. Taher, Iklas title: Preliminary Cytotoxic Study of Some Novel Furo-2-quinolone Compounds date: 2017-03-30 words: 2486 flesch: 67 summary: The preliminary results indicate that HEP-2 cell differs in its sensitivity towards these compounds. Morphological changes of HEP-2 cell upon exposure to selected compounds [Fig. 3] accompanied with reduction in size i.e. loss of contact with neighboring cells as the apoptotic cells shrank and become detached from the adjacent cells. keywords: c3a; cell; ch3; cisplatin; compounds; cytotoxic cache: bijps-542.pdf plain text: bijps-542.txt item: #405 of 579 id: bijps-543 author: I. Abd Al-Zahra, Jameel; K. Ismael, Dawser; N. Al-Shawi, Nada title: Preventive Effects of Different Doses of Pentoxyfilline Against CCl4-Induced Liver Toxicity in Rats date: 2017-03-30 words: 4576 flesch: 57 summary: Additionally, increasing doses of PTX produce a dose-dependent improvement in liver tissue damage induced by CCl4, as evident histologically by the stained liver sections. Results The data presented in (table 1) showed that, CCl4 produces a highly significant increase in MDA contents of liver tissue homogenate compared to control group. keywords: .day; animals; ccl4; days; effect; group; gsh; liver; pentoxifylline; pre; ptx; rats; tissue; treatment cache: bijps-543.pdf plain text: bijps-543.txt item: #406 of 579 id: bijps-544 author: A. Aziz, Tavga; A. Ahmed, Zheen; M. Juma'a, Kasim; H. Abdulrazzaq, Munaf; A. Hussain, Saad; A. Hussain, Saad title: Study of the Protective Effects of Benfotiamine Against CCl4-Induced Hepatotoxicity in Rats date: 2017-03-30 words: 4787 flesch: 54 summary: In conclusion, benfotiamine is capable to protect liver tissue against CCl4-induced toxicity in rats more than thiamine. Table 2 showed that animals intoxicated with CCl4 presented with a highly significant increase in MDA (95.6%) and decrease in GSH (72.2%) contents of liver tissue homogenate compared to control (saline treated) group (P>0.05, table 2). keywords: acetylcysteine; animals; benfotiamine; ccl4; days; group; levels; liver; rats; serum; table; thiamine; tissue; total; treatment cache: bijps-544.pdf plain text: bijps-544.txt item: #407 of 579 id: bijps-545 author: M. Muhammad, Hazhar; Y. Saour, Kawkab; M. Naqishbandi, Alaadin title: Quantitative and Qualitative Analysis of Plumbagin in the Leaf and Root of Plumbago europaea Growing Naturally in Kurdistan by HPLC date: 2017-03-30 words: 2016 flesch: 56 summary: Iraqi J Pharm Sci , Vol.18 (Suppl.), 2009 HPLC analysis of plumbagin in plumbago europaea 45 Quantitative and Qualitative Analysis of Plumbagin in the Leaf and Root of Plumbago europaea Growing Naturally in Kurdistan by HPLC Hazhar M. Muhammad * , Kawkab Y. Saour ** , and Alaadin M. Naqishbandi *, 1 * Department of pharmacognosy, College of Pharmacy, Hawler Medical University, Iraq. The main active constituents from dried powdered leaves and roots of Plumbago europaea were extracted by Soxhlet apparatus using ethyl acetate, the main active constituent was characterized by spectroscopic analysis (IR, 1 H NMR, and 13 C NMR) as plumbagin. keywords: analysis; europaea; extracts; hplc; nmr; plumbagin; plumbago cache: bijps-545.pdf plain text: bijps-545.txt item: #408 of 579 id: bijps-547 author: H.Al-Malki, Falah; H. Ali, Shatha; A.Abdulbari, Gamal title: Role of Ezetimibe in Combination with Statins(Simvastatin and Atorvastatin) in Controlling Dyslipidemia date: 2017-03-30 words: 6324 flesch: 48 summary: (35) Iraqi J Pharm Sci , Vol.18 (1), 2009 Role of ezetimibe in combination with statins 4 180.50 179.82 179.36188.09 172.27 160.82 188.82 176.18 163.59 0 50 100 150 200 250 Before Ezetimibe addition 4weeks after Ezetimibe addition 6weeks after Ezetimibe Addition Time S er u m C h o le st er o l (m g /d l) Normal gp Simvistatin gp Atrovastatin gp Results Both simvastatin and atorvastatin treated groups (figure-1), showed no significant change in serum total cholesterol after 4 weeks of ezetimibe therapy ,but after 6 weeks of the addition of ezetimibe to simvastatin, there was a significant lowering in serum total cholesterol level as compared with both baseline . (57) A recent study showed that despite the comparable modest reduction of serum cholesterol levels by ezetimibe, an intestinal inhibitor of cholesterol absorption, and statin, only the statin improved endothelial function (58) keywords: addition; atorvastatin; baseline; cholesterol; combination; ezetimibe; function; group; ldl; p<0.05; patients; role; serum; simvastatin; statins; therapy; treatment; values; weeks cache: bijps-547.pdf plain text: bijps-547.txt item: #409 of 579 id: bijps-548 author: S.Yousif, Hala; I. Khalil, Yehia title: In Situ Gelling Formulation of Naproxen for Oral Sustained Delivery System date: 2017-03-30 words: 5209 flesch: 60 summary: From the point of view of patient acceptability, a liquid dosage form that can sustain drug release and remains in contact for extended period of time, improving the bioavailability, reducing the dose concentration and frequency may be achieved by in situ gelling formulations (8) .Gelation of the orally administered liquid formulations (Ion activated system) was ensured by the inclusion of calcium ions in the formulation as a soluble complex designed to break down to release free calcium ions on encountering the acidic environment of the stomach (9) . The viscosity of the sols and drug release were measured, and was found to be dependent on the type and concentration of the gelling agent. keywords: concentration; drug; effect; formulations; gelation; gelling; naproxen; pectin; release; situ; sodium cache: bijps-548.pdf plain text: bijps-548.txt item: #410 of 579 id: bijps-549 author: A. Baker, Amanj; A. Majeed, Ibrahim; K. Ismail, Dawser title: The Safety Profile of Single Daily Dose of Aminoglycosides in Comparison with Multiple Daily Dose date: 2017-03-30 words: 4564 flesch: 61 summary: The results of statistical analysis indicated that there was no significant difference (P>0.01) in the mean length of therapy between the SDD and MDD group.24% of the patients in SDD group received therapy for ≥ 8 days compared to only 8% in group indicating the safety of SDD regimen since no toxicity was observed in spite of higher percent of patients who received longer duration of therapy due to the safety profile of SDD regimen (24) figure (2) . Ototoxicity, in the form of vestibular manifestation, was not observed in any of the patients in SDD group as in Benjman M. Limson et al study which also revealed no ototoxicity with SDD regimen (31) while other study revealed only 0.14% ototoxicity (6) . keywords: age; aminoglycoside; daily; days; dose; drug; gentamicin; group; mdd; mean; nephrotoxicity; ototoxicity; patients; regimen; sdd; therapy cache: bijps-549.pdf plain text: bijps-549.txt item: #411 of 579 id: bijps-550 author: M.H. Zeiny, Sarmad title: Isolation of Some Microorganisms from Bar Soaps and Liquid Soaps in Hospital Environments date: 2017-03-30 words: 2487 flesch: 61 summary: Liquid hand washing soaps are more appropriate in hospital environments. Keywords: Bar soap, liquid soap, pseudomonas aeruginosa, nosocomial infections. keywords: bacteria; bar; control; hand; hospital; microorganisms; soaps; washing cache: bijps-550.pdf plain text: bijps-550.txt item: #412 of 579 id: bijps-551 author: M.K. Al-Shafi, Sabah; J.Al-Azzaw, Mohamed; A. Ali, Methal title: The Inhibitory Effect of Gallic Acid on Human Serum Cholinesterase date: 2017-03-30 words: 2979 flesch: 45 summary: Therefore, we can not recommended gallic acid and its related compounds , as preservative substances in food industry or in pharmacological preparations since they might have some side effect on certain biological systems.. Key words: Gallic acid , gallotannin , Human Serum Cholinesterase . The inhibitory effects of different concentrations of gallic acid on the enzyme activity were summarized in Table 3 .It was found that increasing gallic acid concentrations will accordingly affect enzyme activity. keywords: acid; activity; cholinesterase; compounds; effect; enzyme; gallic; gallotannin; inhibition; phenolic; plant; serum; tannins cache: bijps-551.pdf plain text: bijps-551.txt item: #413 of 579 id: bijps-552 author: H. Tizkam, Hussam; A. Abdul Rassol, Alaa; A. Hussain, Ahmed title: Preparation of a New Dosage Form of Metoclopramide Hydrochloride as Orodispersible Tablet date: 2017-03-30 words: 5433 flesch: 55 summary: Among the different diluents utilized, it was found that a combination of microcrystalline cellulose PH101 (MCC 101), mannitol, dicalcium phosphate dihydrate (DPD) and Glycine was the best in preparing MTB orodispersible tablet with fastest disintegration time in the mouth. The physical parameters of the prepared MTB orodispersible tablet were satisfactory as hardness (4 Kg), friability (0.5%) and mouth disintegration (23 sec).The overall results suggest that the prepared formula of MTB as orodispersible tablet could be utilized as a new dosage form for the oral administration. keywords: disintegration; disintegration time; formula; mouth; mtb; orodispersible; tablet; test; time cache: bijps-552.pdf plain text: bijps-552.txt item: #414 of 579 id: bijps-553 author: A. Mohammad, Amera title: Determination of Cefalexin by Direct (UV- Vis) Spectrophotometer and Indirect(Flame Atomic Absorption) Technique date: 2017-03-30 words: 3258 flesch: 60 summary: concentration in Germany capsules is less than the real concentration which is 500 mg while Ajanta and SD Iis O.K. Table(3):The concentration of Cefalexin capsule in 500mg cefalexin of different trade marks Determination of drug CEX – FeIII by using Flame Atomic Absorption Spectrophotometer: To be sure about the result obtained by U.V , we used another technical method, Flame Atomic Absorption Spectrophotometer (FAAS) , by indirect measurement the absorbance of Fe III in the complex to detect the cefalexin conc. by using UV spectrum Effect of Fe III concentration: The best concentration for Fe III ion is 80 µg /ml, it gave the maximum Absorbance figure (7) show that effect of concentration PPM on absorbance . Figure(7): keywords: absorption; cex; complex; feiii; fig; iii; spectrum cache: bijps-553.pdf plain text: bijps-553.txt item: #415 of 579 id: bijps-554 author: S. Saleh, Eman; M.Turki, Kismet; H.Al-Osami, Mohammed title: The Role of Chloroquine Phosphate on Acute Phase Reactant Proteins in Patients with Knee Osteoarthritis date: 2017-03-30 words: 2317 flesch: 65 summary: Key words: Chloroquine , knee osteoarthritis , acute phase proteins , complement , C-reactive protein. Acute phase protein in rheumatic disease. keywords: baghdad; chloroquine; crp; level; osteoarthritis; phosphate; protein; serum; treatment cache: bijps-554.pdf plain text: bijps-554.txt item: #416 of 579 id: bijps-555 author: A. Amin, Inaam title: The Effect of Atenolol on CK-MB Levels in Hypertensive Patients date: 2017-03-30 words: 2222 flesch: 65 summary: من امزاض الوهخس ال، ٍ الى خئٍ. وإلث خه اللوقأل To prove the relationship between atenolol and cardiovascular disease, measurement of creatinekinase-MB as a diagnostic indicator in early and long term usage of this drug by hypertensive patients is recommended. keywords: atenolol; cardiac; drug; duration; heart; patients; years cache: bijps-555.pdf plain text: bijps-555.txt item: #417 of 579 id: bijps-556 author: M.J. Al-Mudhafar, May title: Spectroscopic Study for Determination of Amoxicillin Using Cobalt(II) as Complexing Metal date: 2017-03-30 words: 3024 flesch: 60 summary: Complex Spectrum: transfer (2-5 ml) from the standard of Amoxicillin stock solution to 5 ml volumetric flask then 1 ml of Cobalt stock solution is added. in a new study, prepared different complexes of amoxicillin with Zn (II), Ni (II), Co (II) and Cu (II), these complexes were studied using elemental analysis, IR and mass spectra. keywords: absorbance; amoxicillin; complex; figure; table cache: bijps-556.pdf plain text: bijps-556.txt item: #418 of 579 id: bijps-557 author: Q. Abdulkadir, Maadh title: Proceeding Bromometric Phenol Assay without Starch Indicator date: 2017-03-30 words: 2926 flesch: 55 summary: Therefore, we see a small difference ranging from 0.03-0.04% (as shown on table 5) between the resultant weights of phenol assay with and without starch procedure possibly due to simple error in technique (may occur in measuring phenol samples since capacity of bulb pipette is 25±0.03 ml). Phenol,as oily injection,is used to inject haemorrhoids particularly when unprolapsed (12) .Simply heating a mixture of phenol and formaldehyde with aqueous acid leads Bakelite which was the first commercially available cross-linked three dimensional network polymer molecule that is very resistant to solvents, heat and electricity and widely used in household products (13) . keywords: assay; bromine; experiment; indicator; na2s2o3; phenol; sample; solution; starch cache: bijps-557.pdf plain text: bijps-557.txt item: #419 of 579 id: bijps-558 author: A.Hussain, Saad; M. Mohammed, Shaima; T. Numan, Intesar; I. Abdulwahhab, Ihab title: Effects of Different Concentrations of Melatonin on the Time-course of Nitrite–induced Oxidation of Hemoglobin: In vitro Study date: 2017-03-30 words: 2472 flesch: 48 summary: Figure1 describes the effect of different melatonin concentrations on the time- course of nitrite oxidation of hemoglobin; without melatonin, the time- course of oxidation shows a characteristic pattern of slow initial transformation followed by a rapid autocatalytic process; in presence of melatonin there is slow increase in absorbance related to reduced levels of methemoglobin formation in all test samples. 9- Tomoda A, Tsuiji A, Yoneysnia Y. Biochemical concequences of Hb oxidation. keywords: hemoglobin; melatonin; min; nitrite; oxidation; time cache: bijps-558.pdf plain text: bijps-558.txt item: #420 of 579 id: bijps-559 author: J. Jawad, Fatima title: A Study on the Stability of Different Frusemide Liquid Dosage Formulas: Oral Solution, Syrup, Elixir, Suspension and Emulsion date: 2017-03-30 words: 4699 flesch: 58 summary: (12) 303.2 k t Iraqi J Pharm Sci , Vol.17 (2) ,2008 Frusemide oral liquid dosage forms 5 1.984 1.986 1.988 1.99 1.992 1.994 1.996 1.998 2 2.002 0 1 2 3 4 5 Time (months) lo g % r em ai ni ng 40 C 50 C 60 C Figure (1): Degradation curve of frusemide oral solution (formula I) at 40, 50, 60 0C 1.984 1.986 1.988 1.99 1.992 1.994 1.996 1.998 2 2.002 0 1 2 3 4 5 Time (months) lo g % r em ai ni ng 40 C 50 C 60 C Figure (2): Degradation curve of frusemide syrup (formula II) at 40, 50, 60 0C 1.955 1.96 1.965 1.97 1.975 1.98 1.985 1.99 1.995 2 2.005 0 1 2 3 4 5 Time (month) Lo g% r em in in g 40 50 60 Figure (3): Degradation curve of frusemide elixir (formula III) at 40, 50, 60 0C Table (3) summarized the degradation rate constant of formulas I, II and III. (5)Comparison studies of formulas A, B, C, D and E The following parameters were used to compare the prepared formulas A, B, C, D and E. Table (2): Different formulas of frusemide prepared as suspension (A, B, C, D and E). keywords: dosage; forms; formula; frusemide; liquid; rate; solution; suspension; volume cache: bijps-559.pdf plain text: bijps-559.txt item: #421 of 579 id: bijps-560 author: M. Taher, Al-Muhannad; S. Al-Sabbagh, May; K. Al-Khashali, Dawser title: Effects of Abuse of Anabolic Androgenic Steroids on Iraqi Athletes date: 2017-03-30 words: 5407 flesch: 60 summary: Anabolic androgenic steroids -using athletes had significantly higher (p< 0.05) serum levels of triglycerides (TG) (45.6%), low density lipoprotein- cholesterol (LDL-C) (26.0%) and very low density lipoprotein-cholesterol(VLDL-C) (45.6%) together with significantly lower serum concentrations of high density lipoprotein-cholesterol (HDL-C) (31.3%) than sedentary controls. Introduction Self-administration of large doses of anabolic androgenic steroids ( AAS ) by athletes to obtain a well-shaped body and to increase muscular strength has been increasingly noticeable since the 1950s.1,2 Anabolic androgenic steroids are widely used by professional and recreational athletes as well as nonathletes.3 Abuse of AAS is not limited to male adults but also reported in female adults as well as adolescents of both sexes.1 keywords: aas; abuse; anabolic; androgenic; bodybuilders; controls; effects; levels; serum; steroids; table; testosterone; total cache: bijps-560.pdf plain text: bijps-560.txt item: #422 of 579 id: bijps-561 author: S.Yousif, Hala; I. Khalil, Yehia title: Some Variables Affecting the Formulation of Oral Loratadine Suspension date: 2017-03-30 words: 4847 flesch: 57 summary: Preparation of suspension: Loratadine suspension was prepared by levigating 0.1 gm loratadine in a mortar with the prepared dispersion of suspending agent. Formulation of loratadine suspension: Five different formulas were prepared using different suspending agents as shown in table (1) Chemical formula keywords: agent; concentration; dissolution; drug; formula; gum; loratadine; rate; sedimentation; suspending; suspension; volume; xanthan cache: bijps-561.pdf plain text: bijps-561.txt item: #423 of 579 id: bijps-562 author: A. Bakir, Wasan; M. Hussein, Shalal; A. Mahmood, Noah title: Determination of Enzymatic Antioxidant in Iraqi Patients with Chronic Gastritis date: 2017-03-30 words: 3378 flesch: 50 summary: That H.pylori induces the production of intracellular ROS; this increase in ROS in gastric cells was enhanced by increasing the concentration of H.pylori and inhibited by use of antioxidant(22).There are more ROS in the gastric mucosa of patients infected with H.pylori CagA positive strains, is significantly difference from patients with H.pylori CagA negative strains. Medicine; 2006; 55: 386-390. 3. Weiss, J.; Tsang, T.; Meng, X.; Zhang, H.; Kilner, E.; Wang, E. and Watkin, W.: Detection of Helicobacter pylori gastritis by PCR: correlation with inflammation scores and immunohistochemical and CLOtest findings. keywords: caga; cells; chronic; gastric; gastritis; h.pylori; helicobacter; oxygen; patients; ros; sod cache: bijps-562.pdf plain text: bijps-562.txt item: #424 of 579 id: bijps-563 author: H. Mohammad, Mohammad; J.Al-Karagully, Haider title: Cephalothin as a Carrier of 6-Mercaptopurine for Targeting Cancer Tissues date: 2017-03-30 words: 3428 flesch: 65 summary: Compound II has acceptable rate of hydrolysis at slightly acidic medium pH 6 (t1/2 = 56.34 min.) and 80% of compound II had been converted to 6-MP within 30 min in the presence of GSH. The generation of compound II was accomplished following multistep reaction procedures. keywords: buffer; cephalothin; compound; hydrolysis; mercaptopurine; vib cache: bijps-563.pdf plain text: bijps-563.txt item: #425 of 579 id: bijps-564 author: Y. Alhamdani, Fadia; Y.Alhamdani, Faaiz title: Single Dose Antibiotic Prophylaxis in Outpatient Oral Surgery Comparative Study date: 2017-03-30 words: 3122 flesch: 52 summary: ووي بلت أ ضتأحص أ ستأطض أ ن أ قءضضت keywords: antibiotic; group; infection; molar; patients; procedures; prophylaxis; surgery cache: bijps-564.pdf plain text: bijps-564.txt item: #426 of 579 id: bijps-565 author: G. Alabbassi, Mustafa; A. Hussain, Saad; H. Ali, Shatha title: Therapeutic Effects of Melatonin in Lead-Induced Toxicity in Rats date: 2017-03-30 words: 4817 flesch: 58 summary: Melatonin reduces lead levels significanty in all studied compartments (blood 28%, brain 46%, liver 40% and kidney 42%) compared with lead acetate and saline treated animals (table 7). Lead acetate, when administered subcutaneously, in a consecutive 100 mg/kg doses for one month and saline for another month produces significant elevation in blood lead levels (513%), and lead levels in brain, liver and kidney of these animals were also significantly elevated (3810%, 4736% and 2849% respectively, p<0.05) compared with 20 mg/kg only melatonin treated animals. keywords: 100mg; acetate; kg melatonin; lead; liver; melatonin; rats; saline; treatment cache: bijps-565.pdf plain text: bijps-565.txt item: #427 of 579 id: bijps-566 author: H. Salman, Amal; N. Iqbal, Mayada; A. Bakir, Wasan title: The In Situ Expression of IL-6 and IL-1? in breast cancer patients date: 2017-03-30 words: 4053 flesch: 63 summary: Shen, W. H.; Zhou, J. H.; Broussard, S. R.; Freund, G. G.; Dantzer, R.; and Kelley, K. W.. Proinflammatory cytokines block growth of breast cancer cells by impairing signals from a growth factor receptor. The antiproliferative action of IL-1 β on human breast cancer cells is exhibited not by killing the cells but rather by preventing the ability of the late G1 progression factor, insulin-like growth factor (IGF)-I, to promote progression from late G1 into the S phase of the cell cycle (27) .This keywords: benign; breast; breast cancer; cancer; cells; expression; growth; il-1β; il-6; malignant; mrna; patients; tumor cache: bijps-566.pdf plain text: bijps-566.txt item: #428 of 579 id: bijps-567 author: S. Abdel Gany, Zaynab; F. Mahdi, Mayasaa title: Cytotoxic Assay of Nigella sativa Leaf Callus Extract (Thymol) on Hep-2 Cell Line Using ELISA Assay date: 2017-03-30 words: 3319 flesch: 74 summary: Radiation protection activity of N. sativa in mice against induction of chromosomal aberrations by gamma ray was also reported(8) 1Corresponding author : E-mail : zaynabsaad@yahoo.com Received : 14/6/2008 Accepted : 1/12/2008 Iraqi J Pharm Sci , Vol.17 (2) , 2008 Nigella sativa callus cytotoxicity 64 The using of plant tissue culture techniques make the easy of pharmaceutical compounds production instead of depending on the mother plant and become possible to produce these compounds at high amount and at high rate of pure may be over than these isolated from the complete mother plant, and its production may be quickly and independent on the season, also limit the surface area that is used in the medicinal plant culturing (9).The objective of the present study was to assess the cytotoxic properties of this extract from cell culure of N. sativa leaf callus using against Hep-2 cell line using ELISA (enzyme linked immunosorbant assay) assay. Hep-2 cell line, obtained from Iraqi Center For Cancer and Medical Genetics Researches at the passage level 326 were used in this study. keywords: cell; ءادوسلا ةبحلا; ةبحلا يبطلا; ةفرعمل ءادوسلا; ربتعي; لومياثلا; هصئاصخ ةفرعمل; وه ربتعي; يعرزلا cache: bijps-567.pdf plain text: bijps-567.txt item: #429 of 579 id: bijps-568 author: S. Mahmood, Wissam; A. Kamal, Balkis title: Preparation and In Vitro Permeation of Chlopheniramine Maleate (CPM) from Gel through Rat Skin date: 2017-03-30 words: 4300 flesch: 60 summary: The result after 30 days storage time at different storage exaggerated temperatures of CPM gel , revealed that slight increase in the pH of CPM gel from 4.25 to 4.6 , which may be attributed to the ionization of CPM that releases chlorpheniramine base , which belongs to the basic properties of this types of antihistamines ( 19 ) . The kinetic analysis of CPM 1% w/w release from different polymer concentration at pH 7.14 and 37̊C Effect of CPM concentrations on the diffusion process : Table 3. and figure 4 , illustrate the effect of different CPM concentration 1% w/w and 3% w/w on the amount of CPM diffused through the rat skin , using 2% w/w SA as a gel base , the results showed that the amount of CPM diffused during the period of application ( 5hours ) , increased as a function of increasing drug concentration . keywords: alginate; cpm; diffusion; drug; effect; gel; rat; skin; sodium; نزو\ cache: bijps-568.pdf plain text: bijps-568.txt item: #430 of 579 id: bijps-569 author: w. Ahmed, Dhamraa title: Effects of Interleukin-2 (IL-2) and Interleukin-6 (IL-6) in Recurrent Spontaneous Abortion (RSA) date: 2017-03-30 words: 3135 flesch: 55 summary: Circulating cytokines and CD30 in normal human pregnancy and recurrent spontaneous abortions. Protect the fetus and placenta from being rejected and to aid in the maintenance of normal pregnancy. keywords: abortion; cells; cytokine; group; il-6; maternal; pregnancy; recurrent; role; th2; women cache: bijps-569.pdf plain text: bijps-569.txt item: #431 of 579 id: bijps-570 author: A.Taher, Mohammed; R. Sulaiman, Waleed; Y. Al-Khairi, Hillal title: Rosiglitazone , Metformin or both for Treatment of Polycystic Ovary Syndrome date: 2017-03-30 words: 3577 flesch: 61 summary: These results are in agreement with studies showed a reduction in serum androgen levels after the reduction of insulin levels by insulin sensitizing agents, and these effect were independent in body weight (28,30,29). The luteal progesterone may be enhanced in PCOS by decreasing insulin levels with metformin (33). keywords: combination; effect; glucose; insulin; levels; metformin; ovary; patients; pcos; rosiglitazone; syndrome; treatment; women cache: bijps-570.pdf plain text: bijps-570.txt item: #432 of 579 id: bijps-571 author: H. Hussain, Ahmed; I.Khalil, Yehia title: Some Variables Affecting the Formulation of Pentoxifylline (PTX) as a Solid Sustained Release Dosage Form date: 2017-03-30 words: 3694 flesch: 63 summary: the other hand the cumulative release of PTX from two polymers used (fig.3) revealed that after 10h. of dissolution, the percent of drug release from formula 3 is 88% compared with 60% in formula 7 , while the reference tablet (Trental400) gave 51% drug release after same period of dissolution . ,It was seen that when EC incorporated as a retardant material, a slight less or more in drug release was resulted compared with that of reference one (Trental) , and in an appreciab decrease in drug in drug release compared with the other formulas free from EC , which is attributed to the insolubility of EC in water, besides rigid consolidation of Eudragit RS and EC polymer that retain drug in matrix , this phenomena is in a consistent with results obtained by Aldermann (18) and Sreubel (19) . keywords: release; ةرطيسلل مدختسملا; تيجاردويلا مادختسأب; دق نيلفيسكوتنبلا; ررحت ىلع; رضح دق; عون تيجاردويلا; لاعف ريغلا; مادختسأب رضح; مدختسملا لاعف; ىلع ةرطيسلل cache: bijps-571.pdf plain text: bijps-571.txt item: #433 of 579 id: bijps-572 author: F. Mahdi, Monther title: Synthesis and Preliminary Pharmacological Evaluation of Aminobenzensulfonamides Derivatives of Mefenamic Acid as a Potential Anti-inflammatory Agents date: 2017-03-30 words: 3706 flesch: 65 summary: [4-aminobenzenesulfonamide,4-amino-N¹ methylbenzenesulfonamide, or N¹-(4-aminophenylsulfonyl)acetamide] bound to carboxyl group of mefenamic acid a well known nonsteroidal anti-inflammatory drugs (NSAIDs) were designed and synthesized for evaluation as a potential anti-inflammatory agent. In vivo acute anti-inflammatory activity of the final compounds (9, 10 and 11) was evaluated in rat using egg-white induced edema model of inflammation in a dose equivalent to (7.5mg/Kg) of mefenamic acid. keywords: acid; ch3; compounds; cox-2; derivatives; drugs; edema; mefenamic; paw; time cache: bijps-572.pdf plain text: bijps-572.txt item: #434 of 579 id: bijps-573 author: H. Abdulrazzaq, Munaf; J. Khadeem, Enas; S. Al- Muhammadi, Suhad title: Hepatoprotective Effect of Echinops tenuisectus (Compositae) on CCl4 Induced Hepatic Damage in Rats date: 2017-03-30 words: 3034 flesch: 51 summary: Solvent system Standard silymarin Standard Quercetin Standard Rutin Seed extract S1 0.43 0.35 0.28 0.4,0.33,0.2 S2 0.2 0.81 0.56 0.21,0.8,0.5 Figure 8: HPLC of plant seed extract of Echinops tenuisectus. Hepatoprotective effect of Echinops flavonoids 16 Hepatoprotective Effect of Echinops tenuisectus (Compositae) on CCl4 Induced Hepatic Damage in Rats Munaf H. Abdulrazzaq* , Enas J. Khadeem** , Suhad S. Al- Muhammadi** *Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad. keywords: ccl4; echinops; effect; extract; figure; flavonoids; hepatoprotective; plant; quercetin; rutin; seed; silymarin; tenuisectus cache: bijps-573.pdf plain text: bijps-573.txt item: #435 of 579 id: bijps-574 author: O. Ibrahim, Zaid; H. Ali, Shatha title: Antiplatelts Activity of Vitamin E in Relation to Dose and Duration of Therapy date: 2017-03-30 words: 3580 flesch: 62 summary: Sci., Vol.17 (1) ,2008 Antiplatelts Activity of Vitamin E 25 Antiplatelts Activity of Vitamin E in Relation to Dose and Duration of Therapy Zaid O. Ibrahim , Shatha H. Ali *,1 * Department of Clinical Laboratory Sciences, College of Pharmacy , University of Baghdad , Baghdad , Iraq Abstract Vitamin E, having the well known antioxidant activity through scavenging free radicals و it occurs in several isomeric forms , these isomers have relatively different functions . addition to it’s antioxidant effect, which seems to be significantly correlated to it’s antiplatelets effect ( r=0.994 ,p<0.05).Hence , long term administration of high doses of vitamin E could be effective in decreasing the incidence of thrombosis ,which in turn depends on platelets function. keywords: activity; ch3; ch3 ch3; day; group; months; platelets; subjects; tocopherol; vitamin cache: bijps-574.pdf plain text: bijps-574.txt item: #436 of 579 id: bijps-575 author: N. Al-Wiswasi, Noor; B.H. Al-Khedairy, Eman title: Formulation and in vitro Evaluation of In-situ Gelling Liquid Suppositories for Naproxen date: 2017-03-30 words: 4526 flesch: 54 summary: Naproxen liquid suppository 31 Formulation and in vitro Evaluation of In-situ Gelling Liquid Suppositories for Naproxen Noor N. Al-Wiswasi ** , Eman B.H. Al-Khedairy* , 1 * Department of Pharmaceutics, College of Pharmacy, University of Baghdad , Baghdad ,Iraq ** Abi-Ghraib General Hospital, Ministry of Health , Baghdad ,Iraq Abstract In-situ gelation is a process of gel formation at the site of application, in which a drug product formulation that exists as a liquid has been transformed into a gel upon contact with body fluids. Key words: - naproxen, in-situ gelation, liquid suppository, poloxamer188 ةصالخلا رلإض ءئاإمعثافيإمع متمإعء يثاذلإمعتلم مإمعإإا عإومإيف مإمهلثل ايإتثذ اإرضحاسإمع يثاذلإ لوةإلا ةإلمع نإ اثافيإمعإإا عإضاتإت الرإيمإلفم ةإمع يلإإلياإوفم تإا إمعل ءئاإر ماإتياضتإضءإإتالسإمعتلمسإ لوةإىفاةإمحيت .ع keywords: effect; gelation; liquid; naproxen; poloxamer; release; sodium; strength; suppositories; suppository; temperature cache: bijps-575.pdf plain text: bijps-575.txt item: #437 of 579 id: bijps-577 author: S. Al-Ttaee, Muthanna; Y. Saour, Kawkab; J. Qasir, Ahlam title: Synthesis of New Opioid Analgesic Peptide Analogues to Enkephalin (Leucine- and Methionine-Enkephalin) date: 2017-03-30 words: 3039 flesch: 67 summary: Al-omari, N.A.; Abachi, F.T.: Editorial Board of Education and Sciences Magazine, College of Education, University of Mosul: Biological study of phthalyl amino acids and phthalyl amino acid esters as antimicrobial agents 1998; pp. According to the designed structures, the analogues were synthesized following the conventional solution method and they were identified using the following techniques: melting point, optical rotation, thin layer chromatography (TLC), infrared spectroscopy (IR), elemental analysis (CHN) and amino acid analysis. keywords: acid; amino; analogue; boc; cpd; ester; gly; phthalyl; synthesis cache: bijps-577.pdf plain text: bijps-577.txt item: #438 of 579 id: bijps-579 author: A. Sahib, Adel; Wahab A.Al-Shaikely, Abdul title: Evaluation of the Role of Interleukein-2 and Interleukein-4 in the Immunopathogenesis of Steroid Therapy Resistance in Iraqi Asthmatic Patients date: 2017-03-30 words: 4984 flesch: 62 summary: Key words: steroid resistant asthma, steroid sensitive asthma, IL-2, IL-4. ةصالخلا ة فسفي مظا ي لحيسىا ضعريسوىظلض كديزسىوقضدكديدقعي تخليسىت ايزنعيةياايمىاي ييضيىتلالي لحيسىلا ضعيسىوتسم ديدزي ية فسفيدقعي تخليسىت ايزنعيinterleukin-2 and interleukin-4سىولك ديىهوتج .زنعيىااليداي It is clearly shown that smoking may comprise significant predisposing factor for steroid resistance (55.56%) when smoking SRA patients were compared to non-smoking Iraqi J.Pharm. keywords: allergy; asthma; control; group; il-4; level; patients; resistance; role; sra; ssa; steroid; study cache: bijps-579.pdf plain text: bijps-579.txt item: #439 of 579 id: bijps-580 author: H. Aziz, Samer; A. Abdulrasool, Alaa; A. Hussein, Ahmed title: Factors Affecting the Formulation of Carbamazepine Extended Release Tablet date: 2017-03-30 words: 6088 flesch: 63 summary: Sci., Vol.17 (1) ,2008 Carbamazepine extended release tablet. Sci., Vol.17 (1) ,2008 Carbamazepine extended release tablet. keywords: cbz; cellulose; drug; formula; release; tablets; جالتخالل داضم; داضم لماع; دقل; زاهجلا ىلع; غييصت; لمعي جالتخالل; ىلع لمعي; يزكرملا cache: bijps-580.pdf plain text: bijps-580.txt item: #440 of 579 id: bijps-581 author: H. Samein, Laith; A. Hussein, Ahmed; A. Abdulrasool, Alaa; A. Faraj, Jabar title: Preparation and Characterization of Biodegradable Microspheres Containing Sertraline Hydrochloride date: 2017-03-30 words: 3792 flesch: 58 summary: Abstract Four batches of sertraline HCl microspheres were prepared using a poly (D-L-lactide-co- glycolide) (PLGA) polymer ( Mw. 9, 27, 30 and 83 KDa) as a delivery system. In Vitro Drug Release A pathway for sertraline HCl release was provided by microsphere degradation where water-soluble degradation products (i.e. monomers and oligomers ) leave the microspheres matrix for the surrounding aqueous medium. keywords: 502h; 503h; drug; figure; hcl; microspheres; plga; polymer; preparation; release; sertraline cache: bijps-581.pdf plain text: bijps-581.txt item: #441 of 579 id: bijps-582 author: A. Majeed, Ibrahim title: Comparative Evaluation of Using Intranasal Desmopressin, Parenteral Diclofenac or their Combination in the Management of Acute Renal Colic Pain in Iraqi Patients date: 2017-03-30 words: 2581 flesch: 57 summary: In conclusion, these results indicate that desmopressin may be used to treat renal colic either alone or combined, increasing the analgesic effect of other drugs like diclofenac Key words: renal colic, intranasal desmopressin, diclofenac الخالصة : لشالو اللوا الحوبد حوٍ صوىل ال. The study included 75 patients randomized into three different groups; group A received desmopressin (40 μg, nasal spray), group B diclofenac (75 mg) intramuscularly and group C, both desmopressin and diclofenac. keywords: colic; desmopressin; diclofenac; group; min; pain; patients; renal cache: bijps-582.pdf plain text: bijps-582.txt item: #442 of 579 id: bijps-583 author: N. Omar, Tagreed title: Synthesis of Schiff Bases of Benzaldehyde and Salicylaldehyde as Anti-inflammatory Agents date: 2017-03-30 words: 2797 flesch: 64 summary: Sci., Vol.16 (2) ,2007 Synthesis of anti-inflammatory aromatic Schiff bases 5 Synthesis of Schiff Bases of Benzaldehyde and Salicylaldehyde as Anti-inflammatory Agents Tagreed N. Omar* ,1 * Department of Pharmaceutical Chemistry , College of Pharmacy , University of Baghdad ,Baghdad , Iraq Abstract Three Schiff bases from Benzaldehyde and Salicylaldehyde have been synthesized (A, 1and 2) and two of them (1and 2) have been tested for anti-inflammatory activity. Sci., Vol.16 (2) ,2007 Synthesis of anti-inflammatory aromatic Schiff bases 6 C H N C H N C O HO (1) C H N (2) OH S NH 2 O O (A) Experimentals A. Chemistry Materials: Acetanilide (Riedel-Dehaen, Germany), ammonia solution, benzaldehyde, salicylaldehyde, chlorosulfonic acid, absolute ethanol and ether (BDH, England), all solvents and materials used were of analar type and used without further purification. keywords: bases; compound; schiff; stretching; sulfonamide; vibration cache: bijps-583.pdf plain text: bijps-583.txt item: #443 of 579 id: bijps-584 author: S.Shaokat, Siham; A.Hameed, Hamoudi; J.Mohammad, Hassan title: Anti-fungal Activity of Punica Granatum I.peels Powder and Extracts from Pathogenic Samples date: 2017-03-30 words: 4361 flesch: 56 summary: Et al. Studies on anti diarrhoeal activity of Punica granatum seed extract in rat. Antioxidant activity of pomegranate fruit extract and its anthocyanidins: dephinidin,cyaniding and pelargonidin. keywords: activity; albicans; anti; aspergillus; candida; concentrations; extract; granatum; peels; pomegranate; punica; water cache: bijps-584.pdf plain text: bijps-584.txt item: #444 of 579 id: bijps-585 author: A. Kamal, Balkis title: The Release of Diazepam from Different Conventional and Hollow Type Suppository Bases date: 2017-03-30 words: 3052 flesch: 59 summary: In-Vitro Dissolution Study : The dissolution rates of diazepam release from both conventional and hollow-type suppositories were carried out , a rotating basket dissolution apparatus was used at 50 rpm. Formula 1, 2 and 3 which they are prepared by conventional method revealed that the rate of diazepam release from insoluble theobroma oil is very slow compared with the rate diazepam released from hydrophilic base glycerol- gelatin and glycerol- PEG bases. keywords: base; day; diazepam; drug; release; suppositories; suppository; time; type cache: bijps-585.pdf plain text: bijps-585.txt item: #445 of 579 id: bijps-587 author: A. Hussain, Saad; M. Mohammed, Haider; H. Abdulrazzaq, Munaf; T. Numan, Ahmed title: Effect of Silibinin in Lowering the Intraocular Pressure in Normotensive Rabbits: Interaction with Pilocarpine and Cyclopentolate date: 2017-03-30 words: 3164 flesch: 55 summary: Silibinin hemisuccinate, a powerful antioxidant flavonoid (15), inhibits cAMP- Phosphodiestrase enzyme, even more potent than theophylline or papaverine (16), an effect that can be utilized for the interference with AH formation and IOP regulation. % I O P r e d u c ti o n 2% pilocarpine alone Pre-treatment with 0.75% silybinin hemisuccinate post-treatment with 0.75% silybinin hemisuccinate * * * * * * * * * * * * * * -45 -35 -25 -15 -5 5 15 25 35 0.5 1 1.5 2 2.5 3 Tim e (hour) % C h a n g e i n I O P 1% cyclopent olat e alone P ost -t keywords: cyclopentolate; effect; hemisuccinate; instillation; iop; min; ophthalmol; pilocarpine; rabbits; silibinin; treatment cache: bijps-587.pdf plain text: bijps-587.txt item: #446 of 579 id: bijps-588 author: A. Hussain, Saad; M. Mohammed, Haider; H. Jwaied, Ahmed; H. Abdulrazzaq, Munaf title: Effect of Silibinin in Lowering the Intraocular Pressure in Normotensive Rabbits: Interaction with Betaxolol date: 2017-03-30 words: 3592 flesch: 54 summary: Effects of pre- and post- treatment with 0.75% silibinin hemisuccinate on IOP-lowering effect of 0.5% betaxolol in normotensive rabbits; results are presented as mean of % reduction; number of eyes in each group = 10; *P<0.05 with respect to 0.75% silibinin hemisuccinate alone. All experiments were conducted by trained subject who is completely unaware about the type of treatment followed, and performed during a fixed time of the day (from 10:00 AM to 3:00 PM) to exclude the effect of circadian changes in IOP.For studying the pre-instillation effect of betaxolol, baseline IOP was recorded after the instillation of betaxolol, and then one drop of silibinin solution was instilled after 30 min into both eyes. keywords: betaxolol; camp; effect; humor; instillation; iop; lowering; rabbits; reduction; silibinin cache: bijps-588.pdf plain text: bijps-588.txt item: #447 of 579 id: bijps-589 author: H. Ali, Shahlaa; A. Hamadi, Salim; N. Al- Jaff, Ashwaq title: Effect of Ergotamine and its Combination with Vitamin E or Melatonin on Total Antioxidant Status in Migraine Patients date: 2017-03-30 words: 4471 flesch: 58 summary: Sci., Vol.16 (2) ,2007 Ergotamine, vitamin E, melatonin and total antioxidants 72 Effect of Ergotamine and its Combination with Vitamin E or Melatonin on Total Antioxidant Status in Migraine Patients Shahlaa H. Ali 1 , Salim A. Hamadi ** , Ashwaq N. Al- Jaff** ** Department of Clinical Pharmacy ,College of Pharmacy , University of Baghdad, Baghdad , Iraq Abstract Free radicals and oxidative damage caused by them have being suggested to be involved in the pathogenesis of migraine. Migraine patients were divided into three treatment groups; first group treated with ergotamine alone, second group with ergotamine /vitamin keywords: antioxidant; ergotamine; headache; melatonin; migraine; nitric; oxide; patients; study; tas; vitamin; vitamin e; األوسذة; اٌشم١مت cache: bijps-589.pdf plain text: bijps-589.txt item: #448 of 579 id: bijps-590 author: M.Mohamed Ali, Muqdam; A. Humadi, Salim; N. Al-Jaff, Ashwaq title: Clinical Evaluation of Melatonin Alone and in Combination with Pizotifen in the Prophylaxis of Migraine date: 2017-03-30 words: 4329 flesch: 61 summary: After a month of treatment, the severity, duration and frequency of migraine attacks were recorded using special migraine scoring system. The effect of pizotifen is greatly enhanced by the addition of melatonin in term of the reduction in the severity, duration and frequency of migraine attacks. keywords: attack; combination; dimension; duration; frequency; group; melatonin; migraine; patients; pizotifen; score; severity; treatment cache: bijps-590.pdf plain text: bijps-590.txt item: #449 of 579 id: bijps-591 author: R. Abed Al- Rahman, Issraa; J. Jawad, Fatima; H.Alkateeb, Ekbal; A. Abdulrasool, Alaa title: Preparation of Anise and Thyme Lotion for Topical Use date: 2017-03-31 words: 3489 flesch: 58 summary: Two formulas were prepared using the mentioned natural plants, formula 2 (selected lotion) was the most acceptable one which contained veegum and xanthan gum as suspending agents in addition to other exceipients providing it good properties with high physical stability because of its flocculating, pouring, resuspending easily with sedimentation volume (F) 0.96. 10 The same method mentioned above was used in wich the total amount of stored lotion (50 ml) was diluted, filtered and macerated in ether then TLC technique was done to determine the stability of prepared lotion stored at 40 0 C, 50 0 C and 60 0 C for four months by measuring the RF values of all samples by calculating their quantities in comparison with standard lotion stored at room temperature. keywords: anise; chicken; crude; formula; lotion; paraben; pox; thyme; volume cache: bijps-591.pdf plain text: bijps-591.txt item: #450 of 579 id: bijps-592 author: H. Abdulrazzaq, Munaf title: Protective Effect of Benfotiamine against Doxorubicin-Induced Cardiotoxicity in Rabbits date: 2017-03-31 words: 2119 flesch: 45 summary: Results : Figure (1) indicated that serum level of LDH activity was significantly increased in doxorubicin treated rabbits compared to controls (P<0.05), while pretreatment with benfotiamine significantly reduces serum LDH activity compared to doxorubicin treated group. While benfotiamine pretreated rabbits showed a significant reduction in LDH and CPK activity when compared to doxorubicin treated group. keywords: activity; benfotiamine; cardiotoxicity; doxorubicin; effect; figure; rabbits; serum; treated cache: bijps-592.pdf plain text: bijps-592.txt item: #451 of 579 id: bijps-593 author: A. Abdulhameed, Zena; I. Khalil, Yehia title: Formulation of Alpha Tocopherol Acetate as a Powder Dosage Form by Adsorption date: 2017-03-31 words: 3230 flesch: 40 summary: Figure 9: The percent of alpha- tocopherol acetate released from microcrystalline cellulose at pH 1.2 after 3 months of incubation period. In general, magnesium carbonate enhanced the dissolution phase by its rapid solubility and enhanced the adsorption phase, as in formula 4, due to its higher affinity to alpha- tocopherol acetate (10) . keywords: acetate; adsorbent; alpha; carbonate; incubation; magnesium; min; tocopherol cache: bijps-593.pdf plain text: bijps-593.txt item: #452 of 579 id: bijps-594 author: A. Hussein, Ahmed title: Preparation and Characterization of Poly (D,L-Lactide-Co-Glycolide) Microspheres for Controlled Release of KSL Peptide date: 2017-03-31 words: 4346 flesch: 53 summary: KSL peptide microspheres were characterized for drug content, surface morphology, microspheres size determination, polymers stability , in vitro microspheres degradation and in vitro release. The morphological effects and polymers degradation were analyzed to obtain a better understanding of the mechanism of KSL peptide release from microspheres and composite microspheres. keywords: aches; degradation; drug; ksl; ksl peptide; loading; microspheres; peptide; plga; polymer; preparation; release; rg503; weight cache: bijps-594.pdf plain text: bijps-594.txt item: #453 of 579 id: bijps-595 author: A. Hussain, Saad; T. Numan, Intesar; H.Khalaf, Ban; A. Abdulla, Talal title: Therapeutic Use of Silymarin in the Management of Suspected Renal and Hepatic Injury Produced by NSAIDs in Osteoarthritis Patients date: 2017-03-31 words: 3357 flesch: 58 summary: Treatment of OA patients with silymarin significantly reduces serum enzymes activity (25%, 15% and 20% respectively) compared to pre-treatment values. In the clinical practice, treatment of 20 patients having chronic active hepatitis with 240mg/day of silybinin-phosphatidyl choline complex for 7days significantly lowers serum liver enzymes (GOT, GPT, ALP) and total bilirubin. keywords: activities; injury; liver; meloxicam; nsaids; patients; piroxicam; serum; silymarin; treatment cache: bijps-595.pdf plain text: bijps-595.txt item: #454 of 579 id: bijps-596 author: S. Altaei, Tagreed; T. Numan, Intesar; A.Hussain, Saad; G. Al-Talabani, Nazar title: The Efficacy of Topically Applied Silymarin in the Treatment of Herpes Labialis Ulcers date: 2017-03-31 words: 4752 flesch: 56 summary: When the two methods of treatment compared (silymarin vs placebo), no significant differences reported in C3 levels (P<0.05), while C4 levels showed significantly lower values due to silymarin treatment (43%) compared to placebo treatment. Table 2 demonstrated that treatment of HLU patients with 5% silymarin paste for 4 -5 days resulted in significant reduction in the serum levels of the immunoglobulins IgG, IgM and IgA (4%, 22% and 36% respectively) compared to pre-treatment levels, while placebo treatment did not alter Ig’s levels during the same period of treatment. keywords: days; effects; group; herpes; hlu; levels; p<0.05; paste; patients; placebo; pre; serum; silymarin; treatment; virus cache: bijps-596.pdf plain text: bijps-596.txt item: #455 of 579 id: bijps-597 author: A. Sabri, Lubna; A. Abdul-Rasool, Alaa; A. Shehab, Muayad title: Formulation of Rifampicin Suspension date: 2017-03-31 words: 4826 flesch: 88 summary: It is o ne of the ve ry s lightly s oluble drugs, thus is suitab le fo r s uspension dosa ge form. So me suspe nd ing age nts are ge nerally add ed to the disp ersion me dium in o rd er that their structure s he lp to mainta in unifo rm disp ersibility (2) o r to preve nt c aking o keywords: formula; rifa; rifampicin; suspe; tion cache: bijps-597.pdf plain text: bijps-597.txt item: #456 of 579 id: bijps-598 author: S. Shaokat, Siham; A. Hameed, Hamoudi title: Synergistic Effect of Potassium Clavulanate in Combination withCefamandol and Ceftazidime on B- Lactamase, Extracted From Resistant E.coli date: 2017-03-31 words: 7454 flesch: 86 summary: te d e nzymes ) and –lac ta mas e from E.cloac ae P 99( ce pha lo spo rina se ) as re ference. o r Rifa mpicin(30 0 g /ml) to inhibit the growth of donor and Amoxic illin ,Tica rc illin,a nd e ftazidime to inhibit the gro wth o f recipient s train (11). keywords: amp; ctama; e.c; e.coli; illin; k12; lac; mas; method; oli; res; tic; tion cache: bijps-598.pdf plain text: bijps-598.txt item: #457 of 579 id: bijps-599 author: N.Abood, Ahmad; I. Khalil, Yehia title: Micro encapsulation of Naproxen By Complex Coacervation and Aqueous Colloid Dispersion Part ( 1 ) date: 2017-03-31 words: 4033 flesch: 88 summary: o f drug released from mic ro ca psules fro m 1 :2 , 1:1 and 2:1 core wa ll ra tio respec tively . a nti infla mmatory d rugs wid ely use d in rheumatoid arthritis and ankylo sing sp ond ylitis (4) .The ma in s id e effe cts of this drug a re GIT disturba nc es a nd bitte r tas te . keywords: core; drug; mic; ratio cache: bijps-599.pdf plain text: bijps-599.txt item: #458 of 579 id: bijps-600 author: A. Taher, Mohammed; A.Hammadi, Salim; A.Ali, Ali title: The Chages in Sex Hormones in Female Working in Battries Manufacturing Plant date: 2017-03-31 words: 6029 flesch: 91 summary: The wo rkers in group I ha d blood lea d le vels s ignifica ntly lo wer tha n that in gro ups II a nd III ( P< 0.05 ),this may b e due to longer e xpo sure time in groups II and III tha n that fo r group group П, inc ludes thirte en (1 3) female that ha ve be en e mploye d for 8-14 yea rs with ra nge age (3 0-5 5) yea rs (37.9± 7 .9 ) keywords: group; iii; lead; lev; male; ontrol; rkers; tha; tion; ure; worke cache: bijps-600.pdf plain text: bijps-600.txt item: #459 of 579 id: bijps-601 author: S. Al-Mohammadi, Suhad title: Detection of Cholesterol in Suaeda Baccata (Chenopodiaceae) date: 2017-03-31 words: 3801 flesch: 93 summary: 30 18 1 1 Olive oil 0.5-2 19 ,2 0 1 2 .S esame o il Ca.1 19 ,2 0 Chole sterol and its e sters a re imp orta nt constituents o f plant me mbrane s. The follo wing ta ble re prese nts Sc i., Vol.15 (2 ) ,2006 Detec tion o f choles tero l in su aed a bacca ta 32 Figure (3 ) :conve rsion o f choles te ro l to pro ge ste rone (27) Material a nd Meth ods The p la nt materia l (a eria l pa rt) wa s collec te d during mo nths o f July, Augus t, and S epte mber 200 5. keywords: bacca; choles; o f; oil; plant; sterol; tion cache: bijps-601.pdf plain text: bijps-601.txt item: #460 of 579 id: bijps-602 author: R. Abed Al- Rahman, Issraa title: Effect of Temperature on the Stability and Release Profile of Ibuprofen Microcapsules date: 2017-03-31 words: 5661 flesch: 79 summary: te d in 5 0ml o f methano l, te d keywords: aps; drug; ing; metho; mic; mpe; pre; psule; stability; tion; ture; ules; uprofen; wall cache: bijps-602.pdf plain text: bijps-602.txt item: #461 of 579 id: bijps-603 author: S. AL-Taee, Muthanna; Y. Saour, Kawkab; M. Mohammed, Haider title: Evaluation of Analgesic Activity of Newly Synthesized Phthalyl- tyrosyl-glycin Sodium date: 2017-03-31 words: 3600 flesch: 89 summary: Understa nding the p owe rful mo le cula r, biologic al a nd physio logical te rms o f opioids was used to dev elop a nalges ic c ompo unds with significant advanta ge s o ve r morphine (9). The animal jumps 2 4.8 ± 2.4 time s/25 s eco nd s which rep re se nts the a nalge sia s core. keywords: glycin; group; ing; morphine; pha; phthalyl; rma cache: bijps-603.pdf plain text: bijps-603.txt item: #462 of 579 id: bijps-607 author: Abed Al- Rahman, Issraa Rasheed; A. A.Rasool, Alaa; A. Tawfiq, Fatima title: A Modified Organic Method for Preparation of Ibuprofen Microcapsules As a Sustained Release Solid Dosage Form date: 2017-03-31 words: 3404 flesch: 46 summary: PEG4000 had a little decreasing effect on the yield and encapsulation efficiency and little increasing effect on percent of drug release per time. A modification of aqueous colloidal polymer dispersion method was utilized for microencapsulation of ibuprofen, through replacing the water required for ethylcellulose dispersion (30%) with chloroform (20%) as shown in scheme(2), which provided a good percent yield and encapsulation efficiency of ibuprofen microcapsules. keywords: core; drug; ibuprofen; method; microcapsules; prepared; ratio; release; tablet; wall cache: bijps-607.pdf plain text: bijps-607.txt item: #463 of 579 id: bijps-608 author: .F. AL.Fakhri, Elham title: BIOCHEMICAL FEATURES of IRAQI PATIENTS INFECTED WITH HEPATITIS E VIRUS COMPARED WITH THOSE INFECTED WITH HEPATITIS A VIRUS date: 2017-03-31 words: 2164 flesch: 63 summary: Table I shows that the ages of patients infected with hepatitis E virus were (19.22 ± 1.48) years old while those with hepatitis A were (7.76 ± 1.05) years old. 7.76 1.05 15.52 2.44 Table I Table II shows that all the patients of both groups were icteric but the level of total serum bilirubin of patients with hepatitis E virus were insignificantly higher than those with HAV (t =1.388 .p< 0.05)(Fig.(1)) keywords: acute; hav; hepatitis; hev; iraqi; patients; sci; serum; virus cache: bijps-608.pdf plain text: bijps-608.txt item: #464 of 579 id: bijps-609 author: HAMZA SAMIN, LAITH title: FORMULATION OF ECONAZOLE NITRATE AS A TOPICAL SOLUTION date: 2017-03-31 words: 2552 flesch: 64 summary: The use of plastic or glass container for Econazole nitrate drug had no effect since the same percent remaining were seen when drug solution was stored the drug at different temperature. The results indicated that the use of propylene glycol and ethanol as a vehicle for EN which is very slightly soluble in water gave amore stable formula as EN topical solution, with a shelf life of about 3.15 years .The data also indicated that the light accelerated the degradation of EN, while the type of container (glass or plastic) had no effect on the rate of drug. keywords: drug; econazole; formula; nitrate; parma; sci; solution cache: bijps-609.pdf plain text: bijps-609.txt item: #465 of 579 id: bijps-610 author: N. Najem, Sami, title: MAGNESIUM, ZINC, AND COPPER IN SERUM, ERYTHROCYTE, URINE AND DIALYZATE FLUIDS OF HAEMODIALYSIS PATIENTS date: 2017-03-31 words: 2294 flesch: 66 summary: The lowest value of urinary Zn found in oliguric patients while the highest was in polyuric patients, which reflects the variation in serum and RBC Zn (tables 1, 2). 1.10.02 0.30.01 Solution of oliguric patients 0.60.02 10.02 0.40.03 Solution of Polyuric patients 1.30.2 0.90.25 0.430.1 DISCUSSION: keywords: dialysis; haemodialysis; patients; serum cache: bijps-610.pdf plain text: bijps-610.txt item: #466 of 579 id: bijps-611 author: A. ISA, SAADOON; M. JASSIM, SAMEER; K.A. HUSSEIN, HUSSEIN title: INVESTIGATION OF BENTONITE CLAY SURFACE AS A PHYSICAL ANTIDOTE IN ADSORPTION OF AMITRIPTYLINE-HCl, CHLORPROMAZINE-HCl AND CHLORDIAZEPOXIDE-HCl FROM SOLUTION date: 2017-03-31 words: 4177 flesch: 64 summary: Activated charcoal was the most widely used solid surface as an antidote and in drug adsorption (4-12) . The extent of drugs adsorption by bentonite followed the order: chlordiazepoxide HCl> chlorpromazine HCl > amtriptyline HCl. keywords: adsorption; amitriptyline; bentonite; chlordiazepoxide; chlorpromazine; clay; drug; hcl; pharm; sci; solution; surface cache: bijps-611.pdf plain text: bijps-611.txt item: #467 of 579 id: bijps-612 author: Elldin Al- Jaff, Ashwaq Najjem title: ROLE OF SERUM ZINC AND COPPER AND ZINC/ COPPER RATIO IN ALOPECIA AREATA date: 2017-03-31 words: 2311 flesch: 62 summary: # Significantly different from alopecia areata patients with mild severity (p<0.05). The present study showed a significant decline in serum Zn level in Alopecic patients (Table 1), a fact that agree with that of Tasaki et al (14) who, in addition to alopecia areata, reported comparable decreases in Zn levels in serum of patients with other skin diseases (e.g. bullous pemphigoid and decubitus ulcer). keywords: alopecia; areata; control; copper; patients; ratio; serum; zinc cache: bijps-612.pdf plain text: bijps-612.txt item: #468 of 579 id: bijps-613 author: A. Abdul R asool, Dr. Alaa; Al – Dujali, Dr. Hikmet title: The Effect of some Variables on the Formulation of Captopril as Tablets Shaymaa Nazar Al – Sammarrai date: 2017-03-31 words: 3657 flesch: 57 summary: Hardness (kg) Friability (%) Disintegration time (min) Dissolution time for 100% release (min) 4 2X 4 0.7 1.3 25 5 3X 1 7 2 25 – 30 6 X 2.5 5 1 20 Table (3): Effect of binder concentration on the physical properties of captopril tablets of suggested formulas 4,5, and 6. Table (4): The effect of diluent on the physical properties of captopril tablet and the release of captopril from suggested formulas 4 and 7. On the other hand, using a combination of avicel and starch formula (14) or avicel alone formula (15) as a disintegrant resulted in a harder and less friable tablet. keywords: binder; captopril; disintegrant; disintegration; dissolution; effect; formula; sci; starch; tablets; time cache: bijps-613.pdf plain text: bijps-613.txt item: #469 of 579 id: bijps-614 author: K. Al –Temimy, Bazigha; A. Abdul –Rasool, Alaa title: Formulation, Stability and Bioequivalency Study of Prepared Salbutamol Sulphate Nebules. date: 2017-03-31 words: 2101 flesch: 62 summary: The same method was repeated for salbutamol sulphate nebules. Quantitation of salbutamol sulphate nebules was accomplished by plotting the concentration in mg/ml against peak height, as shown in fig. keywords: formula; nebules; parma; salbutamol; sci; study; sulphate; vol.14 cache: bijps-614.pdf plain text: bijps-614.txt item: #470 of 579 id: bijps-615 author: Karim F. Jumaa, Abdul; A.Abdulrasool, Alaa; A.Al – Dujali, Hikmet title: Formulation and Clinical Evaluation of Orphenadrine citrate as a Plain Tablet date: 2017-03-31 words: 7708 flesch: 88 summary: who state d that inco rpo ra tion of s upe r d is inte grant in the intra gra nula r pha se re sulted in fas ter tablet diss olutio n than did inc orporating it in the extragra nular phase o r bo th p ha ses . .One of thes e theories is that they red uce s ke le ta l mus cle sp as m , p os sibly thro ugh a n a trop ine like central a ctio n o n ce re bra l moto r centers o r on the me dulla keywords: blets; disintegra; formula; orphe; res; tab; time; tion cache: bijps-615.pdf plain text: bijps-615.txt item: #471 of 579 id: bijps-617 author: N. Al- Jaff, Ashwaq; A.Humadi, Salim; A. Wohaieb, Saleh. title: The Ability of Nutrient Antioxidants to Influence Oxidative Stress and Lower the Dose of Prednisolone in Patients with Alopecia Areata date: 2017-03-31 words: 4171 flesch: 91 summary: y ma y b e associated with s ep tic necrosis of the hip or se ve re gas trointes tinal b le ed ing ( 12,13). te d that, despite the difference in o ra l pred niso lo ne dose (1 0 vs. 100 mg) be tween the two groups, addition of nu trie nt a ntio xida nts to pred niso lo ne therap y resulted in compa ra ble and significa nt d ecrease in MDA lev els and correction of GSH co ntent in blood , as well as simila r improve ment in the ra te o f ha ir growth with less side e ffec t (ac ne, weight ga in a nd ga stro intestina l disturba nces) re gardless the do se of p re dnisolone. keywords: mda; nts; pre; trea cache: bijps-617.pdf plain text: bijps-617.txt item: #472 of 579 id: bijps-618 author: A. Muhi-Eldeen, Zuhair; F. Hassan, Samira title: Synthesis and Characterization of 2(2-Tetrahydropyranylthio) methyl cyclopropylamine date: 2017-03-31 words: 3728 flesch: 90 summary: من الخ عة تحـت الح ه اش ة تقني واسط هائية ب والن ة طي كبات الوس غناطيسـي (IR)تم تشخيص المر ن الم رني ف اـل -H)وطـي NMR ) عناصر االولية خيص ال e) وتش le me ntal a nalys e s معالجة . The re fo re the se co mpound s may be utilize d se le ctiv ely to treat one o r mo re of the previously me ntio ned d is ea se s. SYNTHETIC MATERIAL Allylmercaptan , p- to luenesulfonic acid , dihyd ropyran e thldiazoce ta te , we re obtained fro m keywords: ch2; mixture; multiplet cache: bijps-618.pdf plain text: bijps-618.txt item: #473 of 579 id: bijps-620 author: M.H. Al–Mhbashy, Hasan; A. Hussain, Saad; A.M. Numan, Nawfal; A. Saed, Majeed title: The Effects of Melatonin On The Oxidative Stress , Protein Glycation , Microalbuminuria and Lipid Profile In Type II Diabetes Mellitus date: 2017-03-31 words: 6142 flesch: 93 summary: Ox idativ e Stre s s, Me la to nin,Mic ro albuminuria. Erythrocytes and plas ma glutathione lev els were meas ured ac co rding to the method of God in e t al. keywords: ant; days; melatonin; res; trea cache: bijps-620.pdf plain text: bijps-620.txt item: #474 of 579 id: bijps-621 author: A.Taher, Mohammed title: Effect of Metformin and Antioxidant Agents on Hirsutism in Women with Polycystic Ovary Syndrome date: 2017-03-31 words: 3693 flesch: 90 summary: f t r e a t m They we re tre ated with metformin a lo ne a nd with antioxida nt age nts (vita min E o r C).It was found that all pa tie nts who treated with me tformin or with co mbina tion o f metformin with antioxid ant agents s ho wed s ignifica nt d ec re ase in hirs utis m s co re . keywords: hirs; nts; pcos; trea cache: bijps-621.pdf plain text: bijps-621.txt item: #475 of 579 id: bijps-622 author: A. Wohaieb, Saleh title: Effects of Allopurinol on Ketone Body Metabolism and Tissue Lipid Peroxidation in Alloxan Diabetes in Rats date: 2017-03-31 words: 5595 flesch: 92 summary: f p atie nts with type II diab etes with mild hypertens ion (3) and in v ario us tis sues o f ra ts exp os ed to oxida tive stre ss ind uce Howe ver, the single a llop urinol a dministratio n was a ble not only to lower ketonuria , but a ls o the inc id ence o f e arly ke to sis–a ss oc ia te d mortality in diabe tic rats, a fact sugge stive of a pos sible effe ct o n keywords: allo; alx; diabe; llop; tic; tre; urinol cache: bijps-622.pdf plain text: bijps-622.txt item: #476 of 579 id: bijps-623 author: H Al-Sahaf, Fadhil; H Al-Samara’i, Madeha; J Al-Ndawi, Muna title: Effect of Nitrogen and Phosphorus Levels on Yield, Concentration, Physical and Chemical Properties of Dill Seed Oil date: 2017-04-01 words: 5424 flesch: 89 summary: Chub ey B B, Do rrell D G Cha nge s in the che mical compos ition o f dill oil d uring hyd ro d is tillatio n, Can J . tub er d is ea se s (6).Dill se ed may c ontain 4% o f oil (7) with es se ntia l oil (c hiefly co ns is ting of c arvo ne, limo nine and terpens), fa tty oils , pro te ins, ta nnins, re sins a nd mine ra l sa lts (4). keywords: dill; nitro; oil; tion cache: bijps-623.pdf plain text: bijps-623.txt item: #477 of 579 id: bijps-624 author: B. H. Al-Khedairy, Eman title: In Vitro Release Study on Capsules and Tablets Containing Enteric - Coated Granules Prepared by Wet Granulation date: 2017-04-01 words: 3691 flesch: 87 summary: Sa mples were taken at certain ti me intervals and assayed fo r diclofena c so dium spec trophtometric ally a t its λ max 27 3 nm fo r the ac id me dium and at λ max 27 6 nm for the buffer medium. te buffer o f p H 6 .8 , then sa mpling were co ntinue d fo r 45 minutes (10). keywords: ente; granules; tab cache: bijps-624.pdf plain text: bijps-624.txt item: #478 of 579 id: bijps-625 author: I.Mustafa, Besma title: Gender Differences of Serum Leptin Hormone Levels in Iraqi Population date: 2017-04-01 words: 3544 flesch: 88 summary: To e va luate and comp are se rum Leptin ho rmo ne leve l be twe en Iraqi male & female and the re la tion betwee n this ho rmo ne & BMI in the se two groups. Wa uters M, Me rtens I, Cons idine R, e t al. Are le ptin leve ls de pende nt on bod y fat distribution in ob es e men a nd wo men? keywords: lep; leptin; male; ptin cache: bijps-625.pdf plain text: bijps-625.txt item: #479 of 579 id: bijps-627 author: H. Samein, Laith title: Clinical Evaluation of a Formulated Econazol Nitrate as A Topical Solution date: 2017-04-01 words: 2867 flesch: 92 summary: o f e thano l (96%) 1 in 60 It has be en prove n to be e ffe ctiv e in the pres enc e of mixed infection. keywords: cure; nts cache: bijps-627.pdf plain text: bijps-627.txt item: #480 of 579 id: bijps-629 author: Al-Ubaidy, Bashier; K. Al-Khashali, Dawsar; A. Numan, Nawfal title: The Role of Oxidative Stress In Lead Poisoning date: 2017-04-02 words: 5374 flesch: 92 summary: Gluta thione leve ls we re determine d in e rythro cyte s and p la sma acc ording to the me thod of Go din e t al (15). Thirty male and females workers e mploye d in the Iraq i storage ba ttery (age range 2 0-40 ye ars) were pa rticipating in this stud y. Additio nally, 11 he althy subjec ts were se rv ed as hea lthy controls , with the sa me age ra nge comp ared to workers group, to a void the effects o f age variatio ns on the studied pa ra meters. keywords: lea; mda; tion; tme cache: bijps-629.pdf plain text: bijps-629.txt item: #481 of 579 id: bijps-630 author: D. Saud, Muthanna title: Conjugation of Steroidal and Non – Steroidal Anti- Inflammatory Drugs as Possible Mutual Prodrug date: 2017-04-02 words: 4877 flesch: 90 summary: r p art o ac id (glycine) as a s keywords: ing; ound; tion cache: bijps-630.pdf plain text: bijps-630.txt item: #482 of 579 id: bijps-631 author: D. Saud, Muthana; M. Ghani, Suhair title: Phosphodiester Conjugation of Metronidazole and Dexamethasone as Possible Mutual Prodrug date: 2017-04-02 words: 4358 flesch: 91 summary: Mutua l pro – d rugs fo r co rticos te ro id s were also s ynthesized through co njuga tion w ith no n – steroida l anti – inflammatory drugs using a n amino a cid as s pa cer arm(17). Cortico steroids were us ed in the se pro – drugs either a s p ro moiety for ta rge ting the ac tiv e s pe cies as in the cas e of a ntic anc er agents (13,14), or a s the a ctiv e spe cies which we re co njuga ted to promo ie ties to c ha nge *De par tme nt o f Ph arma ce utic al Ch emistry Colle ge o f Pha rmac y, Unive rs ity of Baghdad ,Baghdad- Ir aq. keywords: tion cache: bijps-631.pdf plain text: bijps-631.txt item: #483 of 579 id: bijps-660 author: T. Salih, Nagham; J. Kadhim, Dheyaa title: Adherence to American Society of Health-System Pharmacists Surgical Antibiotic Prophylaxis Guideline in Medical City Teaching Hospitals/Baghdad date: 2017-04-10 words: 3001 flesch: 46 summary: The objective of this study was to evaluate the antibiotic administration pattern for surgical antibiotic prophylaxis and the adherence to American Society of Health-System Pharmacists surgical antibiotic prophylaxis guideline in Medical City Teaching Hospitals/Baghdad. Surgical antibiotic prophylaxis refers to the use of preoperative and postoperative antibiotics to decrease the incidence of postoperative wound infections. keywords: antibiotic; hospital; infections; patients; procedures; prophylaxis; site; study; surgery; time cache: bijps-660.pdf plain text: bijps-660.txt item: #484 of 579 id: bijps-661 author: N. Taher, Mohanad; A.Hussein, Ahmed title: Formulation and Evaluation of Domperidone Nanoemulsions for Oral Rout date: 2017-04-10 words: 5735 flesch: 53 summary: Iraqi J Pharm Sci, Vol.24(2) 2015 Domperidone nanoemulsions 77 Formulation and Evaluation of Domperidone Nanoemulsions for Oral Rout Mohanad N. Taher *,1 and Ahmed A.Hussein ** * Iraqi Ministry of Health, Directorate of Technical Affairs, Baghdad, Iraq. Domperidone nanoemulsions 78 Reducing droplet sizes to the nanoscale leads to some very interesting physical properties, such as optical transparency and unusual elastic behavior (3) . keywords: domperidone; drug; figure; formula; nanoemulsion; oil; pharm; phase; potential; release; sci; size; tween; water; zeta cache: bijps-661.pdf plain text: bijps-661.txt item: #485 of 579 id: bijps-666 author: Chaplenko, Alexander; Monogarova, Oksana; Oskolok, Kirill title: Colorimetry and Indirect X-ray Fluorescence Determination of Active Ingredients in Tetracycline Hydrochloride Drug and Injection Solution of B12 Vitamin Using of Polyurethane Foam Sorbents date: 2017-12-25 words: 2620 flesch: 44 summary: This fact can be used for adequacy test of colorimetric techniques using indirect X-ray fluorescence determination of mentioned above organic substances on «heavy labels». Figure (1): Selection of optimal pH value of Zn2+and Co2+ sorption (n = 5, P = 0.95) Figure (2): Selection of optimal time of Zn2+ and Co2+ sorption Metrological characteristics of colorimetric and indirect X-ray fluorescence determination of active ingredients in drugs after sorption on PUF sorbent are presented in Table 1. Table (1): The metrological characteristics of colorimetric and indirect X-ray fluorescence determination of tetracycline hydrochloride and cyanocobalamin using PUF sorbents (n = 5, P = 0.95) keywords: determination; puf; solution; sorption; tetracycline cache: bijps-666.pdf plain text: bijps-666.txt item: #486 of 579 id: bijps-671 author: AlZubaidi, Ruaa Fadhil Abbas; Al-Shawi, Nada Naji title: The Impact of Two Doses of Vitamin K2 (Menaquinone-7) on Doxorubicin-Induced Hepatotoxicity in Rats date: 2017-12-25 words: 3647 flesch: 56 summary: Furthermore, in group V rats, which received MK-7 at a dose of 16 µg/kg body weight/day orally prior to 15 mg/kg of Dox, there were non-significant (P>0.05) differences in the intended enzymes compared to positive control group; however, in group VI rats received MK-7 at a dose of 48 µg/kg body weight/day orally prior to 15 mg/kg of Dox exhibited significant (P<0.05) decrease in serum ALT, ALP enzymes activities, and TB compared to positive control group. - Values with non–identical superscripts capital letters (A and B) are significantly different (P<0.05) compared to positive control group utilizing unpaired Student t-test. keywords: control; dose; dox; doxorubicin; group; hepatotoxicity; liver; mk-7; rats; serum; weight cache: bijps-671.pdf plain text: bijps-671.txt item: #487 of 579 id: bijps-672 author: Abdul Ridha, Doaa Kadhim; Al-Shawi, Nada Naji title: The Impacts of Graded Doses of Pyridoxine on the Biomarkers, Aspartate Aminotransferase, lactate Dehydrogenase and Total Antioxidant Capacity in Doxorubicin-Induced Cardiotoxicity in Female Rats date: 2017-12-25 words: 5868 flesch: 51 summary: Effect of anthracycline antibiotics on oxygen radical formation in rat heart. The aim of the current study was to investigate the possible protective effect of graded doses (5, 10, and 15mg/kg) of pyridoxine hydrochloride intraperitoneally (IP) injected for four consecutive days against single dose of (15mg/kg) doxorubicin-induced cardiotoxicity in female rats IP injected at the fourth day only. keywords: 10mg; 15mg; activity; antioxidant; ast; cardiotoxicity; control; days; dose; doxorubicin; group; kg doxorubicin; kg pyridoxine; ldh; pyridoxine; rats; serum; tissue cache: bijps-672.pdf plain text: bijps-672.txt item: #488 of 579 id: bijps-679 author: S. Al-Lami, Mohammed title: Formulation and Evaluation of Sustained and Raft Forming Antacid Tablet date: 2017-07-08 words: 3451 flesch: 56 summary: In the preparation of sustained release floating antacid tablets, two formulas were employed using different percentages of active ingredients and polymer, floatation was accomplished by incorporation of gas generating calcium and magnesium carbonates that generate CO2 and act as active ingredient; sodium CMC was use as anionic polymer that mediate FDDS design on basis of delay gastric emptying time and buoyancy principle. The raft was formed on the top just upon addition of pulverized tablet onto the AGJ medium for both formulas 3 and 4. keywords: antacid; calcium; capacity; carbonate; cellulose; formulas; gastric; layer; magnesium; raft; release; sodium; tablets cache: bijps-679.pdf plain text: bijps-679.txt item: #489 of 579 id: bijps-680 author: B. Dikran, Sarmad; H. Zankanah, Faeza title: A Highly Sensitive Kinetic-Spectrophotometric Method for the Assay of Carbamazepine in Pure and Commercial Tablet date: 2017-07-08 words: 3363 flesch: 58 summary: Fixed time method Iraqi J Pharm Sci, Vol.26(1) 2017 Kinetic-spectrophotometric method for the assay of carbamazepine 6 Table (3): Regression equations at fixed time method for the determination of CABZ. keywords: cabz; carbamazepine; determination; figure; method; rate; reaction; spectrophotometric; time cache: bijps-680.pdf plain text: bijps-680.txt item: #490 of 579 id: bijps-681 author: Kadhim Drais, Hayder; A. Hussein, Ahmad title: Formulation Characterization and Evaluation of Meloxicam Nanoemulgel to be Used Topically date: 2017-07-08 words: 4291 flesch: 57 summary: Meloxicam nanoemulgel 15 when present in nanoemulgels provide many advantages in comparison to gel such as nanosize droplets and enhance solubility of meloxicam hydrophobic drug this will enhance enterance of dissolution media to hydrophobic matrix and lower diffusional pathway for meloxicam molecules to reach the dissolution media that make meloxicam nanoemulgels superior and highly prefer in comparison to meloxicam gels (8, 21) . The drug release analysis from meloxicam nanoemulgel formulations (NF1- NF7) showed the effect of oil mixture concentration at constant concentration of Smix and gelling agent,as the concentration oil mixture increase this lead decrease drug release this may be due to the high concentration of oil mixture increase hydrophobicity of formulations and this will provide retarding forces for dissolution media to pass through hydrophobic matrix and liberate the drug also the meloxicam molecules will have greater diffusional pathway to reach the dissolution media therefore it was found NF1 has greater release profile compare to other of meloxicam nanoemulgel formulations due to it had the least concentration of oil mixture that make less retarding effect for dissolution molecules and lower diffusional pathway to drug molecules to reach the dissolution media. keywords: drug; figure; formulations; index; meloxicam; mixture; nanoemulgel; nanoemulsion; nf1; oil; phase; pseudo; release; water cache: bijps-681.pdf plain text: bijps-681.txt item: #491 of 579 id: bijps-682 author: R. Moustafa, Shatha; A. Omar, Shawn title: Estimation of Superoxide Dismutase, Matrix-metalloprotinase-9, and Interleukin -18 in Patients with Type Two Diabetes Mellitus date: 2017-07-08 words: 4961 flesch: 54 summary: Patients and Methods This case-control study was designed to examine the associations between the selected parameters with in T2DM patients that was performed at Hawler Medical University, College of Pharmacy on 50 patients of both genders who were randomly selected and newly diagnosed by specialist using clinical examination and confirmed by laboratory tests at diabetic center (Al-Shahida Layla Qassim) and after exclusion of other diseases by clinical history, laboratory investigations and clinical examination. Effect of controlling the disease on the Serum levels of selected parameters Serum levels of HbA1C% and glucose were founded to be significantly higher in T2DM patients (uncontrolled group) as compared with poor control and healthy subjects (p< 0.001) keywords: antioxidant; control; diabetes; il-18; level; mellitus; patients; serum; significant; sod; study; table; type cache: bijps-682.pdf plain text: bijps-682.txt item: #492 of 579 id: bijps-683 author: .R.Abdul, Fatima; .A.Taher, Nehad; S.Hassan, Ashraf; H. Batah, Enaam title: The Effect of Coumarin Derivatives(compounds) on the Vibrio cholerae Isolates from Different Clinical Iraqi Sources date: 2017-07-08 words: 3917 flesch: 56 summary: رًاٍَت (.كًا حى قٍاط حغاعٍتEltor)انؼششة كاَج يٍ َٕع رٍشا ٔبُغبت يقأيت انغبشٔفهٕكغاعٍٍ , َٕسفهٕكغاعٍٍ ,االسرشٔياٌغٍٍ, االيبغهٍٍ ٔانغٍفشحٕكغٍٍ ٔااليٍكاعٍٍ كاَج اكزشانًضاداث حا ػهى انخٕانً, بًٍُا كاَج نهكهٕسيفٍُكٕل ٔانكٕاحشايٍكغٕل اقم حارٍشا حٍذ كاَج َغبت %30%,30%,51%,51%,51%,51حغأي ( اػخًادا ػهى َخائش انحغاعٍت نهًضاداث انحٌٍٕت 9,8,6)ًْ V. cholerae % نكهًٍٓا. Three (3,5,6) isolates V. cholerae were selected depending on results of antibiotics sensitivity tests as showed multiple –antibiotics resistance(100%). keywords: acridine; antibiotics; bacterial; choleraee; coumarin; derivatives; effect; isolates; orange; plasmid; resistance; results; rrr; rrr rrr; rrr sss; vibrio cache: bijps-683.pdf plain text: bijps-683.txt item: #493 of 579 id: bijps-684 author: A. Hazzaa, Suray; N. Abd-Alhameed, Shaimaa title: Formulation and Evaluation of Optimized Zaltoprofen Lyophilized Tablets by Zydis Technique date: 2017-07-12 words: 4946 flesch: 50 summary: 3 3 F6 3.2 3 1 F7 3.2 3 2 F8 3.2 3 3 F9 3.2 3 3 1 F10 3.2 3 3 1.5 F11 3.2 3 3 2 F12 3.2 3 3 1.5 0.5 F13 3.2 3 3 1.5 1 F14 3.2 3 3 1.5 1.5 Total To make 20ml Preliminary screening for optimizing lyophilized tablets: Zaltoprofen lyophilized tablets 47 Figure (8) : FTIR spectrum of lyophilized tablet (F14 ) Powder X-ray diffraction analysis (PXRD) of pure Zaltoprofen and selected formula (F14) keywords: agent; concentration; disintegration; dissolution; drug; effect; figure; gelatin; glycine; mannitol; pharm; sci; tablets; water; zaltoprofen cache: bijps-684.pdf plain text: bijps-684.txt item: #494 of 579 id: bijps-685 author: A. Abdulqader, Alaa; B. H.Al-Khedairy, Eman title: Formulation and Evaluation of Fast Dissolving Tablets of Taste-Masked Ondansetron Hydrochloride by Solid Dispersion date: 2017-07-26 words: 5205 flesch: 59 summary: In vitro taste evaluation In- vitro taste was evaluated by determining drug release in phosphate buffer (pH 6.8) to predict release of drug in the human saliva. Cumulative percentage of drug release was calculated using an equation obtained from a standard curve (14) . keywords: disintegration; dispersion; dissolution; drug; evaluation; fdts; method; onh; pharm; polymer; powder; prepared; release; tablets; taste; time cache: bijps-685.pdf plain text: bijps-685.txt item: #495 of 579 id: bijps-687 author: abd alhamza al ibrahimy, ali shlash; F.Al-Tukmagi, Haydar title: Assessing Quality of Life Among Patients with Diabetes Mellitus, Hypertension or Both Diseases in Al-Najaf Province /Iraq date: 2017-12-25 words: 5199 flesch: 62 summary: Patients with diabetes mellitus, hypertension or both diseases 36 Table( 5): Comparison of QOL domain scores between DM patients and control group Scale Domain Diabetic group Control group p- The mean age diabetic, hypertensive, DM plus hypertension patients and control group include 51.18 ± 10.220, 51.90 ± 10.928, 56.03 ± 8.878 and 50.05 ± 9.20 years respectively. keywords: control; diabetes; diseases; domains; group; health; hypertension; life; mean; mellitus; patients; qol; quality; study cache: bijps-687.pdf plain text: bijps-687.txt item: #496 of 579 id: bijps-700 author: S. Nassir, Zahra'a; J. Khadem, Enas title: phytochemical investigations of Iraqi Abrus precatorius Linn. plant date: 2018-06-03 words: 3462 flesch: 58 summary: Table 3: Phytochemical screening of alkaloids in the crude ethanolic extract of Abrus precatorius plant. Preliminary qualitative phytochemical screening were performed on the crude ethanolic extract and revealed the presence of alkaloids, flavonoids ,terpenoids and phytosterols in Iraqi Abrus precatorius plant. keywords: abrine; abrus; alkaloid; extract; f-1; figure; fraction; iraqi; layer; plant; precatorius; sci; standard; tlc cache: bijps-700.pdf plain text: bijps-700.txt item: #497 of 579 id: bijps-704 author: s, Pavani; K, Mounika; K, Naresh title: Formulation and Evaluation of Acyclovir Microspheres date: 2018-06-03 words: 2967 flesch: 56 summary: ACV microspheres were spherical in nature, which was confirmed by SEM. The in vitro performance of ACV microspheres showed sustained release depending on the polymer concentration and concentration of calcium chloride. keywords: acv; acyclovir; chitosan; concentration; drug; formulation; microspheres; polymer; release cache: bijps-704.pdf plain text: bijps-704.txt item: #498 of 579 id: bijps-705 author: abdul-lalil, thukaa zuhair; Hussein, Ahmed Abbas; Saour, Kawkab Y. title: Extraction, Identification and Isolation of B-sitosterol from Iraqi Wild Awsaj plant (Lycium barbarum) Using UAE (Probe and Bath) and two isolation technique (HPTLC and PHPLC): B-sitosterol in Iraqi Awsaj plant date: 2017-12-25 words: 3632 flesch: 55 summary: Iraqi J Pharm Sci, Vol.26(2) 2017 -sitosterol in Iraqi Awsaj plant 78 Table (1): Difference in extract content yield (gram of fraction / 250 gm) in different parts of Awsaj plant using different methods. This goal was achieved by comparing the extraction mass yield, also by a quick and easy approach for identification and quantification of bioactive -sitosterol in four parts of Awsaj using high performance thin layer chromatography (HPTLC) which confirm the presence of -sitosterol in four parts of Iraqi Awsaj plant and the results clarify that the root part of Iraqi Awsaj plant extracted by probe UAE give the highest concentration (0.610 mg/ml) of B-sitosterol followed by fruits (0.465mg/ml), leaves(0.405mg/ml) and the least was stems(0.275mg/ml); according to these; isolation and purification of ß-sitosterol from petroleum ether fraction of Awsaj roots was done by preparative HPLC. keywords: awsaj; ether; extraction; figure; fraction; hptlc; iraqi; parts; petroleum; pharm; plant; uae; -sitosterol cache: bijps-705.pdf plain text: bijps-705.txt item: #499 of 579 id: bijps-706 author: A. Mohammed, Ihsan; M. Ghareeb, Mowafaq title: Investigation of Solubility Enhancement Approaches of Ticagrelor date: 2018-06-03 words: 4939 flesch: 55 summary: Moreover, the PVPK-30, is a well-known efficient polymeric stabilizer forming adsorption layers on drug nanoparticles, (18) whereas the poloxamer 188 is an anon ionic surfactant (19). Formulation and evaluation of clopidogrel tablet incorporating drug nanoparticles. keywords: antisolvent; dissolution; drug; effect; enhancement; figure; formulas; hpmc; nanoparticles; pharm; polymer; ratio; size; solubility; solvent; ticagrelor cache: bijps-706.pdf plain text: bijps-706.txt item: #500 of 579 id: bijps-712 author: Abbas, Sumayah Saadi; Kubba, Ammar A.Razzak Mahmood title: Synthesis and antimicrobial evaluation with DFT study for new thiazole derivatives date: 2018-06-04 words: 4349 flesch: 62 summary: Synthesis and DFT study of new thiazole derivatives 77 Conclusion In the present work new derivatives were synthesized starting from,[2-amino-4-(4- nitrophenyl) 1,3-thiazole], (4) and [2-amino-4- (4-bromophenyl) 1,3-thiazole],(5) using conventional method, the titled derivatives (6) and (8) were evaluated for their preliminary antimicrobial activity using well diffusion method. Received: 26/10/2017 Accepted: 4/3/2018 Iraqi Journal of Pharmaceutical Sciences http://dx.doi.org/10.31351/vol27iss1pp69-78 http://bijps.com/index.php/bijps/index Iraqi J Pharm Sci, Vol.27(1) 2018 Synthesis and DFT study of new thiazole derivatives 70 Introduction Thiazole is a five membered aromatic heterocyclic ring containing sulfur and nitrogen in its structure. keywords: activity; ar(c; bend; chem; cm-1; compound; derivatives; dft; lumo; orbital; pharm; plane; str; study; synthesis; thiazole cache: bijps-712.pdf plain text: bijps-712.txt item: #501 of 579 id: bijps-715 author: Ala Allah, Ali kathem; Hussein, Ahmed title: Darifenacin Hydrobromide loaded nanostructured lipid carrier for oral administration date: 2018-06-04 words: 6318 flesch: 58 summary: Darifenacin hydrobromide loaded nanostructured lipid carriers 54 NLCs have been developed to overcome the drawbacks associated with SLNs. Darifenacin hydrobromide loaded nanostructured lipid carriers 56 Characterization and evaluation of nanostruc- tured lipid carriers ( NLCs ) Particle size and polydispersity index measurement The particle size analysis of formulas was performed using ABT- 9000 Nano Laser Particle Size Analyzer. keywords: acid; carriers; darifenacin; darifenacin hydrobromide; drug; hydrobromide; journal; lipid; lipid carriers; liquid; nanoparticles; nanostructured; nlcs; particle; pharm; q.s; release; sci; size; study cache: bijps-715.pdf plain text: bijps-715.txt item: #502 of 579 id: bijps-721 author: Al-lami, Mohammed Sabar; H. Oudah, Malath; A. Rahi, Firas title: Preparation and characterization of domperidone nanoparticles for dissolution improvement date: 2018-06-03 words: 5044 flesch: 53 summary: Iraq Abstract This study was carried out to prepare and characterize domperidone nanoparticles to enhance solubility and the release rate. Then domperidone nanoparticles were formulated into a simple capsule dosage form in order to study of the in vitro release of drug from nanoparticles in comparison pure drug and mixture of polymer:drug ratios of 2:1. keywords: dissolution; domperidone; domperidone nanoparticles; drug; effect; figure; k15; nanoparticles; pharm; polymer; pvp; ratio; sci; size; solubility; solvent cache: bijps-721.pdf plain text: bijps-721.txt item: #503 of 579 id: bijps-726 author: A. Darweesh, Samar title: Spectrophotometric Determination of Cefixime Following Simple Diazotization and Coupling with ?-Naphthol date: 2017-12-25 words: 2352 flesch: 55 summary: Effect of diazotization reaction time The optimum time for the diazotization of cefixime were established at 0-5 °C and 2 minutes, where longer times led to extremely low absorbance values. Cefixime and α-Naphthol 4 Effect of sulfamic acid concentration keywords: cefixime; concentration; effect; figure; naphthol; pharm cache: bijps-726.pdf plain text: bijps-726.txt item: #504 of 579 id: bijps-727 author: K . Abbas, Hayder; M. Hussein Wais, Fatimah; N. Abood, Ahmed title: Preparation and Evaluation of Ketoprofen Nanosuspension Using Solvent Evaporation Technique date: 2017-12-25 words: 7088 flesch: 54 summary: Since dissolution takes place at the surface of drug particle, the high dissolution rate of drug is associated with large surface area of drug particles. In addition, it is mainly attributed to the rule, which states that the reduction of drug particle size can result in larger surface area and consequently enhanced the contact of nanoparticles with the dissolution medium. keywords: area; concentration; dissolution; drug; effect; formulas; hpmc; journal; ketoprofen; nanoparticles; nanosuspension; particle; particle size; prepared; size; solubility; stabilizer; surface cache: bijps-727.pdf plain text: bijps-727.txt item: #505 of 579 id: bijps-728 author: H. AL-Behadily, Hasan; F.Al-Tukmagi, Haydar title: Knowledge, Attitudes and Barriers Towards Breast Cancer Health Education Among Iraqi Community Pharmacists date: 2017-12-25 words: 4873 flesch: 60 summary: (15.3) 44 (14.7) Patients appreciate efforts of community pharmacists when counselled about breast cancer 120 (40.0) 76 (25.3) 33 (11.0) 35 (11.7) 36 (12.0) Iraqi J Pharm Sci, Vol.26(2) 2017 Knowledge, attitudes and barriers towards breast cancer 63 Figure ( 1 ):Barriers for breast cancer health as stated by community pharmacists. Relationship of demographics and characteristics of practice with knowledge and attitudes towards breast cancer health promotion among community pharmacists Bivariate correlation analysis of continuous variables (represented in table 5) showed that age had no significant association with overall knowledge of breast cancer (r = - 0.021, P = 0.360), knowledge of breast cancer screening (r = - 0.098, P = 0.045) or attitude (r = - 0.010, P = 0.434) among pharmacists. keywords: attitudes; barriers; breast; breast cancer; cancer; community; health; iraqi; knowledge; pharmacists; pharmacy; screening; study cache: bijps-728.pdf plain text: bijps-728.txt item: #506 of 579 id: bijps-729 author: A. Hussein, Esraa; J. Kadhim, Dheyaa; F. Al-Auqbi, Tawfeeq title: Belief about Medications Among Type 2 Diabetic Patients Attending the National Diabetes Center in Iraq. date: 2017-12-26 words: 5181 flesch: 57 summary: Assuming the margin of error of 5% and the confidence level is 95%, the total number of diabetic patients registered at the above center were 33,408 patients at the beginning of the current study then the sample size will be of minimally 380 patients. β: Correlation coefficient Figure(4):Scatter plot of the relationship between HbA1c and BMQ score in all patients Table-8 demonstrates the comparison of BMQ score and it's subparts with glycemic control where a poor control patients has a higher median score compared to good control patients regarding specific necessity and it was significant ,while no significance was available with other subparts and glycemic control. keywords: beliefs; bmq; concern; control; diabetes; diabetic; mean; medications; medicines; necessity; patients; score; specific; study; type cache: bijps-729.pdf plain text: bijps-729.txt item: #507 of 579 id: bijps-730 author: H. Mhaibes, Sarah; A. Taher, Mohammed; H. Badr, Ala; H. Badr, Ala title: A Comparative Study of Blood Levels of Manganese, Some Macroelements and Heavy Metals in Obese and Non-Obese Polycystic Ovary Syndrome Patients date: 2017-12-26 words: 5688 flesch: 68 summary: There were no significant differences between obese PCOS women and non-obese PCOS women in the levels of the studied hormones, elements and heavy metals. There was a positive correlation between blood lead and serum TSH levels in non- obese PCOS women; and between serum total testosterone and cadmium levels in obese PCOS women. keywords: blood; control; elements; groups; levels; non; obese; obese control; obese pcos; patients; pcos; serum; trace; women cache: bijps-730.pdf plain text: bijps-730.txt item: #508 of 579 id: bijps-731 author: ALi, Hassan; H. Mohammed, Mohammed; H. Ismeal, Sajida title: Synthesis, Characterization and Alpha Glucosidase Inhibition activity of new Phthalimide Derivatives date: 2018-06-05 words: 5025 flesch: 63 summary: However it was found that phthalimide, tetrachlorophthalimide derivatives exhibited potent α -glucosidase inhibition and the structure activity relationship studies show the following: 1.A phthalimide or tetrachlorophthalimide moiety connected to a variously substituted phenyl ring by an alkyl chain shows promising alpha glucosidase inhibitory activity (Scheme 1). Str. of Tetrachlorophthalimide,1717(C=O) Str. of carboxylic acid consolidated with(C=O) Str. of Tetrachlorophthalimide, 1581 and 1431 (C=C) aromatic Str., 1396C-N Str., 1199C-O str.v., 736Out of plane aromatic bendcm-1. keywords: amide; aromatic; ch2; cm-1; compounds; diabetes; glucosidase; kbr; phthalimide; str; str.v cache: bijps-731.pdf plain text: bijps-731.txt item: #509 of 579 id: bijps-754 author: Al-anbagi, Mina Shihab; A. Rajab, Nawal; I.Khalil, Yehia title: Preparation and characterization of timed drug delivery system of sumatriptan using natural polymers date: 2018-06-05 words: 5309 flesch: 56 summary: Six formulas of fast dissolving core tablets and three formulas of press-coated tablets were prepared by using direct compression method using different variables to prepare core tablets which include: different types and concentrations of superdisintegrants while different concentrations of natural and synthetic polymers were utilized in preparation of press-coated tablets. The obtained results showed that formula F4 of core tablet, which contained 25 milligrams of sumatriptan, 5% w/w sodium starch glycolate and avicel PH 102 as diluent, was the selected formula that showed the fastest and complete release of sumatriptan. keywords: core; core tablet; drug; formula; glycolate; journal; pharm; pharmaceutical; polymers; powder; press; release; sodium; starch; sumatriptan; tablet; time cache: bijps-754.pdf plain text: bijps-754.txt item: #510 of 579 id: bijps-756 author: A. Taher, Mohammed; A. Abdul- Hussain, Dhuha; F. Hasan, Huda; M. Fahmi, Zena; K. Luaibi, Oday; G. Ali, Mezaal title: Hypolipidemic Effect of Caffeic Acid Isolated From Arctium Lappa Cultivated In Iraq, in Hyperlipidemic Rat Model date: 2018-02-23 words: 3583 flesch: 57 summary: From the area under the peak we calculated the percentage of caffeic acid in crude extract about 0.176mg/ml. Figure (1): HPLC chromatogram of Caffeic acid std.(Left one) and plant extract sample with high peak of caffeic acid at (Rt 2.71) identical to the reference standard( Right one). Hypolipidemic effect of caffeic acid 23 The influence of Caffeic acid at the TG- cholesterols and VLDL-cholesterol might be attributed to CA decrease tri-glyceride creation by decrease the countenance of both (three hydroxyl three methy-glutary coenzyme a reductase) and glycerol three phosphate acyl- transferase in the liver by arrangement of adenosine mono phosphate activated kinase (23) . keywords: acid; aorta; arctium; baghdad; caffeic; cholesterol; diet; effect; group; lappa; plant; rats; بغذاد cache: bijps-756.pdf plain text: bijps-756.txt item: #511 of 579 id: bijps-757 author: A. Mousa, Zahraa; N. Al-Shawi, Nada; A. Omar, Ahmed title: Study the Influence of Captopril on Bone Metabolism in Elderly Hypertensive Women date: 2018-02-23 words: 3721 flesch: 50 summary: In conclusion, the present study provides additional knowledge concerning the influence of captopril treatment on some selected parameters of bone metabolism in elderly hypertensive women. Keywords: Captopril, Bone metabolism, Elderly women, Hypertension, Dual energy x-ray absorptiometry. keywords: bone; calcium; captopril; density; group; hypertensive; metabolism; mineral; phosphorus; serum; study; women; years cache: bijps-757.pdf plain text: bijps-757.txt item: #512 of 579 id: bijps-758 author: Z. Nagara, Zeina; Y. Saour, Kawkab title: Phytochemical and Pharmacological Study of Valepotriates in Valeriana officinalis L. F.Valerianeceae Cultivated in Iraq date: 2018-02-23 words: 4006 flesch: 55 summary: Isolation and identification of active constituents Separation of the main active constituents of Valeriana officinalis L. root was carried out using Preparative TLC: TLC plates, 20x20cm and 1mm thickness of silica gel GF254 developed in solvent system (hexane : ethyl acetate : acetic acid 65:35:0.5) with standard reference. Due to the large number of active constituents in Valeriana officinalis, it was necessary to make analytical study of its constituents to determine the chemical nature of these constituents and then determine the main classes (terpenes and iridoids) using chemical reagents specific for each class. keywords: acid; analysis; constituents; extract; figure; hexane; officinalis; plant; root; standard; valepotriates; valeriana; valtrate cache: bijps-758.pdf plain text: bijps-758.txt item: #513 of 579 id: bijps-761 author: J. Ahmed, Mariam; Abdullah, hind H. title: Spectrophotometric Determination of Chlordiazepoxide in Pharmaceutical Formulations via Oxidative Coupling Reaction with Phenothiazine date: 2018-12-05 words: 3575 flesch: 49 summary: The proposed method was compared with UV method (classical method) of CDE determination and by using the statistical methods (t- and F test) and the suggested method proved accuracy and precision and can be used routinely in quality control studies. Method of validation Linearity Under the optimized experimental conditions for CDE determination, standard calibration curve was constructed (Fig. 6). keywords: absorbance; cde; chlordiazepoxide; coupling; determination; method; product; reaction; solution cache: bijps-761.pdf plain text: bijps-761.txt item: #514 of 579 id: bijps-762 author: Chaplenko, Alexander; Monogarova, Oksana; Oskolok, Kirill title: X-Ray Fluorescence Determination of Trace Elements in Vitamin-Mineral Complexes and Medicinal Herbs Using Chemically Modified Polyurethane Foam Sorbents date: 2018-12-05 words: 2971 flesch: 53 summary: Results of trace element determination in medicinal plants (µg/g, n = 5, P = 0.95) *1 - PUF, modified by resorcinol 2 - PUF, modified by 8-hydroxyquinoline 3 - PUF, modified by 2- nitrozo-1-naphthol Table 3. Results of trace element determination in vitamin-mineral complexes (µg/g, n = 5, P = 0.95) *1 - PUF, modified by resorcinol 2 - PUF, modified by 8-hydroxyquinoline 3 - PUF, modified by 2- nitrozo-1-naphthol Conclusion Developed technique of XRF determination of trace elements in medicinal herbs and vitamin-mineral complexes is simple and effective alternative to traditional used methods of atomic spectroscopy. 4. Brown R. J. C., Milton M. J. T. Analytical techniques for trace element analysis: an overview. keywords: complexes; determination; elements; herbs; puf; sorbent; trace; vitamin cache: bijps-762.pdf plain text: bijps-762.txt item: #515 of 579 id: bijps-768 author: S. Abdul Jabbar, Ahmed title: Dissolution Enhancement of Raltegravir by Hot Melt Extrusion Technique date: 2018-06-04 words: 3875 flesch: 53 summary: Thermograms of raltegravir HME (Figure 9) illustrated a little, slightly wide endotherm that specified the reduced crystallinity of raltegravir. FTIR spectra of raltegravir HME best formulation (Trial 6) Figure 7.FTIR spectra of raltegravir and Plasdone S630 Differential scanning calorimetry (DSC) keywords: density; dissolution; drug; extrusion; figure; hme; medication; melt; polymer; raltegravir; solubility; tablets; technique; water cache: bijps-768.pdf plain text: bijps-768.txt item: #516 of 579 id: bijps-776 author: A Mahmood Kubba, Ammar; A. A. Rahim, Nedaa title: Synthesis, Characterization and Antimicrobial Evaluation with DFT Study of New Two-Amino-4-(4-Chlorophenyl) Thiazole Derivatives date: 2018-06-20 words: 3582 flesch: 60 summary: Completion of reactions and the purity of compounds were ascertained by thin-layer chromatography (TLC) , using Silica gel GF254 (type 60) pre- coated Aluminium sheets, Merck (Germany) exposed to UV-254nm light and the eluent used is n-hexane: ethyl acetate (6.0:4.0) for compound (1) , n-hexane: ethyl acetate (8.0:2.0) for compound (2) and n-hexane: ethyl acetate (4.0:6.0) for compound (3).Melting points were measured by using Stuart SMP3 melting point apparatus in open capillary tubes, and are uncorrected. Therefore, compound 2 is more reactive than compounds 3 and 1, respectively. keywords: activity; candida; chem; compound; derivatives; dft; lumo; method; sci; study; synthesis; thiazole cache: bijps-776.pdf plain text: bijps-776.txt item: #517 of 579 id: bijps-777 author: Mekhilef, Safa F.; A. Hussein, Ahmed title: Novel Combination for Self-Nanoemulsifying Drug Delivery System of Candesartan Cilexetil date: 2018-12-07 words: 6508 flesch: 57 summary: Self- emulsifying drug delivery system (SEDDS) showed promising result in overcoming solubility problem of many drug molecules. Yadav PS, Yadav E, Verma A, Amin S. Development, characterization, and pharmacodynamic evaluation of hydrochlorothiazide loaded self- Iraqi J Pharm Sci, Vol.27(2) 2018 Self-nanoemulsifying drug delivery system of candesartan cilexetil 133 nanoemulsifying drug delivery systems. keywords: candesartan; cilexetil; delivery; drug; drug delivery; formulations; oil; particle; pass; pass pass; pharm; release; sci; sedds; self; size; surfactant; system; tween cache: bijps-777.pdf plain text: bijps-777.txt item: #518 of 579 id: bijps-784 author: Hareeja, Marwah M.; B.H.Al-Khedairy, Eman title: Formulation and In- Vitro Evaluation of Spherical Crystal Agglomerates of Ebastine by Quasi Emulsion Solvent Diffusion Method date: 2018-12-06 words: 6141 flesch: 57 summary: All other reagents and chemicals used were of analytical grade Method Preparation of EBS spherical crystal agglomerates SCAs prepared by emulsion solvent diffusion method. PEG 4000 show highest increase in rate of dissolution (f2=20.014) in comparison with pure drug dissolution rate that’s because PEG 4000 have important effect on maintaining the spherical shape of agglomerated crystal (36) and also it enhances the physical and chemical stability of drugs and prevents aggregation of the drug particles as a result of the steric hindrance and/or masking of charges provided through formation of a conformational cloud (37) so, higher surface area will be available for dissolution. keywords: agglomerates; crystal; crystallization; dissolution; drug; ebastine; ebs; iraqi; journal; method; pharmaceutical; polymers; scas; sci; solubility; solvent; spherical; vol.27(2; water cache: bijps-784.pdf plain text: bijps-784.txt item: #519 of 579 id: bijps-789 author: Hussein, Zainab A.; A. Rajab, Nawal title: Formulation and Characterization of Bromocriptine Mesylate as Liquid Self-Nano Emulsifying Drug Delivery System date: 2018-12-06 words: 5094 flesch: 55 summary: Evaluation of the prepared liquid self-nano emulsifying drug delivery system Thermodynamic stability studies All of SNEDDS formulations were passed the thermodynamic stability testing as there was no sign of phase separation or drug precipitation at the end of all cycles. Kumar RS, Syamala US, Revathi P, Devaki S, Raghuveer P, Gowthamarajan K. Self nanoemulsifying drug delivery system of olanzapine for enhanced oral bioavailability: keywords: bromocriptine; delivery; drug; drug delivery; emulsifying; formulations; liquid; mesylate; nano; oil; pass; pass pass; pharm; sci; self; snedds; system cache: bijps-789.pdf plain text: bijps-789.txt item: #520 of 579 id: bijps-791 author: Ismail, Muna Y.; M. Ghareeb, Mowafaq title: Enhancement of the Solubility and Dissolution Rate of Rebamipide by Using Solid Dispersion Technique (Part I) date: 2018-12-06 words: 5498 flesch: 52 summary: Composition of REM and carriers using solid dispersion method. Iraqi J Pharm Sci, Vol.27(2) 2018 Solid dispersion of Rebamipide with TPGS DOI: https://doi.org/10.31351/vol27iss2pp55-65 55 Enhancement of the Solubility and Dissolution Rate of Rebamipide by Using Solid Dispersion Technique (Part I) keywords: dispersion; dissolution; drug; evaporation; figure; fusion; journal; method; polymer; rebamipide; rem; solid; solubility; solvent; tpgs cache: bijps-791.pdf plain text: bijps-791.txt item: #521 of 579 id: bijps-792 author: Noor, Ala'a Dheia; B.H. Al-Khedairy, Eman title: Formulation and Evaluation of Silymarin Microcrystals by In- Situ Micronization Technique date: 2019-06-09 words: 5538 flesch: 54 summary: Table (4) Effect of solvent: anti-solvent ratio on SM microcrystals formulas. Effect of polymer type To select the best polymer for preparation of SM microcrystals, four formulas were prepared; MC1, MC2, MC3 and MC4 using gelatin, PVP-K30, HPMC15 and pullulan respectively as stabilizing agent with 0.1% (w/w) concentration for each as shown in table.1 Effect of polymer concentration To estimate the minimum concentration of stabilizing agent (gelatin or PVP k30) required to get the maximum crystals yield and solubility, three concentrations of each stabilizing agent 0.05% (MC5 and MC7),0.1% (w/v)(MC1 and MC2) keywords: anti; dissolution; drug; gelatin; methanol; method; microcrystals; pharm; polymer; ratio; sci; silymarin; solubility; solvent; stirring; yield cache: bijps-792.pdf plain text: bijps-792.txt item: #522 of 579 id: bijps-793 author: Fareed, Noor Y.; Kassab, Hanan J. title: Studying the Effect of Variables on Acyclovir Microsponge date: 2018-12-06 words: 4521 flesch: 59 summary: The effect of changing drug polymer ratio on drug release was illustrated in figure (6). The effect of different formulation and process variables such as internal phase volume, polymer type, drug polymer ratio, stirring speed and stirring duration on microsponge production yield, loading efficiency, particle size, and in vitro drug release was evaluated. keywords: acv; acyclovir; delivery; drug; efficiency; eudragit; figure; formulation; journal; loading; microsponge; oil; phase; polymer; release; stirring cache: bijps-793.pdf plain text: bijps-793.txt item: #523 of 579 id: bijps-795 author: Yahya, Ruaa Natiq; A.Kasim, Ali; A. Al Gawwam, Gheyath title: Comparing the Quality of Life among Patients with Relapsing Remitting Multiple Sclerosis in Iraq Using Different Disease Modifying Therapies date: 2018-12-06 words: 7116 flesch: 58 summary: The expanded disability status scale (EDSS) is negatively associated with QoL of MS patients in all of the three therapies, while other predictors such as occupational status, educational status, smoking habit and MS duration have different impact in different treatments. Relapsing–remitting MS (RRMS):- affects about 85% of MS patients and marked by flare- ups (relapse or exacerbation of symptoms followed by periods of remission, when symptoms improve or disappear)(8,9). keywords: analysis; disability; duration; edss; fams; fingolimod; interferonβ-1b; life; patients; predictors; qol; quality; sclerosis; score; status; table; treatment cache: bijps-795.pdf plain text: bijps-795.txt item: #524 of 579 id: bijps-797 author: Al abood, Raid Mohamed; M. Ghareeb, Mowafaq; A. Abdulrasool, Alaa title: Investigation of cytotoxic activity and dissolution improvement of Teniposide by incorporation into acid treated carbon nanotube and dispersed by hydrophilic polymer date: 2019-06-11 words: 5402 flesch: 57 summary: In this study, carbon nanotubes properties were improved by pre-functionalized of carbon nanotubes via carboxylation with strong acids and then functionalized through attaching to polymer and copolymer. Key words: Acid treated carbon nanotubes, Teniposide, Hydrophilic polymers. keywords: carbon; carbon nanotubes; cm-1; copolymer; cswcnt; dextran; dispersibility; dispersion; drug; formulation; iraqi; nanotubes; pass; peo; pharm; polymer; properties; pva; sci; solubility; teniposide; water cache: bijps-797.pdf plain text: bijps-797.txt item: #525 of 579 id: bijps-799 author: Mohammed, Amina M.; Mohammed, Entidhar J. title: Preparation and In-Vitro Evaluation of Clopidogrel Bisulfate Liquisolid Compact date: 2018-12-07 words: 6670 flesch: 61 summary: The purpose of this work was to enhance the dissolution pattern of the clopidogrel through its preparation as liquisolid compact. In addition, Differential Scanning Calorimetry (DSC), Fourier Transforms Infrared Spectroscopy (FTIR), X-Ray Diffraction (XRD) and Scanning Electron Microscopy (SEM) were used for the assessment of the physicochemical properties of the drug and compatibility with excipients in liquisolid compacts. keywords: avicel; bisulfate; clopidogrel; clopidogrel bisulfate; compact; dissolution; drug; figure; j pharm; liquid; liquisolid; pharm; pharm sci; powder; rate; ratio; sci; tablets cache: bijps-799.pdf plain text: bijps-799.txt item: #526 of 579 id: bijps-801 author: Nafeer, Sara Ameen; Zalzala, Munaf title: Possible Amelioration of the Severity of Nutritional Steatohepatitis by Guggulsterone in Mice: guggulsterone and steatohepatitis in mice date: 2019-06-09 words: 3817 flesch: 50 summary: This study data showed a reduction in the level of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and Alkaline phosphatase (ALP) in guggulsterone treated groups remarkably with the higher concentration, compared to the HFD-treated group, thus consequently alleviated the damage in the liver caused by HFD. Guggulsterone enhance the transcription of bile salt export pump that lead to reduced hepatic lipid content, also due to guggulsterone own activity as antioxidant, guggulsterone reduce the need for the bilirubin that act as free radical scavenger this results in reduced oxidative stress (18)(19) eventually reduced production of bilirubin, as noted in the presented results that serum TB is significantly lower in guggulsterone treated groups compared with the HFD group that showed a markedly elevated TB level. keywords: control; diet; fat; figure; group; guggulsterone; hfd; hfd group; level; liver; mice; p<0.05; serum cache: bijps-801.pdf plain text: bijps-801.txt item: #527 of 579 id: bijps-806 author: Salih, Balqes Hisham; H.Ali, Shatha; I. Allehibi, Khalid title: Serum Aldosterone Levels in Patients With Diabetic Nephropathy in Relation to Vascular Calcification date: 2019-06-11 words: 5663 flesch: 54 summary: In overweight subjects, moreover,a high salt intake is associated with a larger increase in the extra cellular volume (ECV) than in lean subjects, supporting the impact of subtle changes in renal haemodynamics on volume homeostasis(38), as being presented in this study with a positive correlation between body weight and serum aldosterone (figure-7) in group B diabetic patients. A mean values are higher in diabetic patient with microalbuminuria compared to diabetic patients without microalbuminuria and control group and this referred to uncontrolled diabetes ,aldosterone show a correlation with weight and body mass index while fetuin- keywords: aldosterone; calcification; clin; control; correlation; diabetes; diabetic; fetuin; gfr; group; insulin; levels; mean; microalbuminuria; nephropathy; patients; serum; sodium; study; type; values; vascular cache: bijps-806.pdf plain text: bijps-806.txt item: #528 of 579 id: bijps-809 author: Alatraqchi, Faten Ibraheem; J. AL Gawhri, Fatima title: Preparation and In-Vitro Evaluation as an Oral Microsponge Tablet of Baclofen date: 2019-06-11 words: 7424 flesch: 62 summary: BFN microsponge tablets prepared using 40 % (w/w) carbopol 934p as a gastroretentive polymer and 17.5 % (w/w) sodium bicarbonate maintained the tablet integrity and achieved tablets with maximum swelling and shorter FLT with controlled drug release. Therefore, BFN floating microsponge tablets formulated with 30 % and 40 % carbopol 934 p polymer showed an acceptable tablet shape with excellent FLT and TFT and good gel strength layer that maintained integrity of the tablets. keywords: baclofen; bfn; carbopol; delivery; drug; effect; eudragit; evaluation; figure; formula; hcl; iraqi; j pharm; microsponge; pharm; polymer; release; sci; solvent; stirring; tablets cache: bijps-809.pdf plain text: bijps-809.txt item: #529 of 579 id: bijps-811 author: Ameen, Zeyad A.; Ali, Shatha H. title: Effects of Aldosterone, Osteoprotegerin and Fibroblast Growth Factor-23 and Some Biochemical Markers in Chronic Kidney Disease Patients (Stage II-IV) among Patients with or without Cardiovascular Events date: 2018-12-07 words: 4617 flesch: 53 summary: Data analysis showed that fasting serum glucose levels of CKD patients (with and without CV disorder) had significantly higher values as compared to the controls (76.5% and 29% respectively). Mortality of CKD adjusted for comorbidity, race, gender, age and previous hospitality for CKD patients indicate an obvious decline in rates since 1995 may reflect to some extent the increased recognition of CKD as this confirmed by increasing number of patients carrying the diagnosis(2) . keywords: aldosterone; ckd; disease; events; fgf-23; figure; kidney; levels; opg; osteoprotegerin; patients; serum; stage cache: bijps-811.pdf plain text: bijps-811.txt item: #530 of 579 id: bijps-813 author: Shawkat, Ali Jalal; H. Jwaid, Ahmed; M. Awad, Ghada title: Evaluating Health-Related Quality of Life (HRQoL) in Iraqi Adult and Pediatric Patients with Beta-Thalassemia Major Using Two Different Iron Chelation Therapies date: 2019-06-11 words: 5377 flesch: 61 summary: It is clear from table (5) that education has a significant direct correlation with all QoL domains, which was found to agree with Ansari et Iraqi J Pharm Sci, Vol.28(1) 2019 Quality of life in thalassemia major 50 al.(19) and Gin et al.(20) in which patients with higher educational levels have better QoL. Thalassemic facies and poor body image in adult thalassemia patients have a negative impact on QoL domains. In adults patients; Health-Related Quality of Life (HRQoL) components were significantly lower in patients receiving Deferoxamine (DFO). keywords: adults; dfo; dfx; health; hrqol; iron; journal; life; major; patients; pediatrics; qol; quality; table; thalassemia cache: bijps-813.pdf plain text: bijps-813.txt item: #531 of 579 id: bijps-817 author: Radhi, Zainab Abdulmohsin Hadi; Ghareeb, Mowafaq Mohammed title: Preparation and Evaluation of Rebamipide Film using Casting Technique for Local Action date: 2019-06-09 words: 6577 flesch: 54 summary: The results of this study showed that rebamipide ocular inserts have good potential for futuristic rebamipide extended release ocular delivery system. Table( 1) Composition of formulas of matrix rebamipide ocular inserts Evaluation of rebamipide ocular inserts: Physical appearance Physical appearance of the insert’s color, transparency and texture was observed and inspected visually (21) . keywords: buffer; drug; figure; hpmc; inserts; moisture; ocular; pharm; phosphate; rebamipide; release; sci; solubility; surface; table cache: bijps-817.pdf plain text: bijps-817.txt item: #532 of 579 id: bijps-824 author: Abass, Maysam M.; A. Rajab, Nawal title: Preparation and Characterization of Etodolac as a Topical Nanosponges Hydrogel date: 2019-06-11 words: 5217 flesch: 51 summary: The viscosity of nanosponges hydrogel Carbopol 934 hydrogel showed approximate viscosity between (32,000 -134,150) CP for ETO loaded NS hydrogel while ETO hydrogel showed viscosity between (45,000 - 140,546) CP; Figure (15). The selected formula was lyophilized then incorporated into hydrogel ; which also evaluated .The results show that the formulation that contain Drug:Polyvinyl alcohol: ethylcellulose in ratio 1:3:2 is the best with smallest particle size 40.2±0.098nm with polydispersibility0.005 and in vitro release 97.6%±0.11, , ETO NS Carbopol hydrogel produced a significant(p<0.05) improvement of the in vitro release than pure ETO hydrogel. keywords: dissolution; drug; eto; etodolac; figure; formula; hydrogel; journal; loaded; nanosponges; particle; pharm; powder; release; sci; size; topical cache: bijps-824.pdf plain text: bijps-824.txt item: #533 of 579 id: bijps-827 author: Abdul jabbar, Aliaa Abdul sattar; H. Kathem, Sarmed title: The Protective Effect of Ethanolic Extract of Mentha spicata Against Irinotecan-Induced Mucositis in mice date: 2019-06-11 words: 4133 flesch: 56 summary: Mentha ethanolic extract orally administered to mice for 7 days starting one day before irinotecan dose. As a conclusion, Mentha ethanolic extract has a protective effect on irinotecan-induced mucositis. keywords: activity; cell; day; ethanolic; extract; glucuronidase; group; il-1β; irinotecan; jejunum; mentha; mice; mucositis; sn-38 cache: bijps-827.pdf plain text: bijps-827.txt item: #534 of 579 id: bijps-860 author: A. Khaleel, Raghad; H. Zalzala, Munaf title: Ameliorating Effect of Oral Guggulsterone Administration in Imiquimod-Induced Psoriasis in Mice date: 2018-12-06 words: 4661 flesch: 49 summary: The results of the current study showed that guggulsterone suspension can significantly reduce psoriasis area and severity index in (guggul suspension + imiquimod group as compared with both control group and (vehicle suspension + imiquimod ) group. Histological examination of mice skin and right ear section. keywords: administration; area; control group; ear; figure; group; guggulsterone; imiquimod; level; mice; p<0.05; psoriasis; skin; susp+imq; thickness; vehicle cache: bijps-860.pdf plain text: bijps-860.txt item: #535 of 579 id: bijps-861 author: A. I. Al-Geam, Manal; N. Al-Shawi, Nada title: Effects of Vitamin E and Q10 Supplementation against Doxorubicin-Induced Neurotoxicity in Rats date: 2018-12-06 words: 5188 flesch: 54 summary: Mean ± SEM of IL-1β levels in brain tissue homogenate were respectively, 54.2±5.8 vs. 49.5±4.2. Mean±SEM of IL-1β level in brain tissue homogenate were respectively, 100.2±4.3 vs. 175.1±15.2, 110.2±7.9 vs. 175.1±15.2, and 108.5±10.8 vs. 175.1±15.2. keywords: 100mg; 50mg; brain; coq10; day; dose; dox; doxorubicin; group; homogenate; rats; tissue; vitamin; weeks cache: bijps-861.pdf plain text: bijps-861.txt item: #536 of 579 id: bijps-862 author: J. Jebur, Nisreen; J. Kadhim, Dheyaa; M. Firhan, Nawal. title: Belief about Medications among Sample of Iraqi Patients with Inflammatory Bowel Disease date: 2018-12-06 words: 5132 flesch: 60 summary: In addition, frequency of patients treated in out-patients setting was higher in CD patients which means that patients with CD may undergo less relapses or any other causes that lead to hospitalization and then CD patients usually treated as outpatients more than UC patients. Future studies should investigate how interventional approaches addressing these predictors may lead to improve beliefs about medicines among inflammatory bowel disease patients and their impact on disease control. keywords: beliefs; concern; disease; ibd; medicines; necessity; number; patients; score; specific; study cache: bijps-862.pdf plain text: bijps-862.txt item: #537 of 579 id: bijps-863 author: A. Ali, Inas; H. Ali, Shatha title: Impact of Osteocalcin Level on Vascular Calcification in Type 2 Diabetics in Relation to Fibroblast Growth Factor-23(FGF-23) date: 2018-12-06 words: 7007 flesch: 54 summary: As consistent with these studies, the mean of serum ucOC level was significantly reduced in diabetic patients groups (A and B) when compared with control group (p<0.01) as illustrated in figure-1 The reduction of serum ucOC level in patients with T2DM can be explained by the following causes: Iraqi J Pharm Sci, Vol.27(2) 2018 Osteocalcin and vascular calcification in diabetics 49 1. As illustrated in figure-1, the mean of serum ucOC level was significantly lowered in diabetic patients with cardiovascular disease (group A) and diabetic patients without cardiovascular disease (group B) when compared with control group (p<0.01), while there was no significant variation between diabetic patients groups (p>0.05). keywords: bone; calcification; calcium; control; diabetes; diabetic; disease; fgf-23; glucose; group; insulin; levels; osteocalcin; patients; phosphate; resistance; risk; serum; study; type; ucoc; vascular cache: bijps-863.pdf plain text: bijps-863.txt item: #538 of 579 id: bijps-864 author: T. Hasan, Hayder; J. Kadhim, Enas title: Phytochemical Investigation of Corchorus olitorius L. Leaves Cultivated in Iraq and it’s In Vitro Antiviral Activity date: 2018-12-07 words: 4386 flesch: 57 summary: Different statistical result revealed a significant antiviral activity of the aqueous layer of Corchorus olitorius leaves against measles virus. Keywords: Corchorus olitorius, flavonoids, Phenolics, Antiviral, Measles. keywords: activity; cells; corchorus; corchorus olitorius; effect; flavonoids; layer; leaves; measles; olitorius; phytochemical; plant; sample; sci; virus cache: bijps-864.pdf plain text: bijps-864.txt item: #539 of 579 id: bijps-868 author: Ali, Ahmed H.; N. Abd-Alhammid, Shaimaa title: Enhancement of Solubility and Improvement of Dissolution Rate of Atorvastatin Calcium Prepared as Nanosuspension date: 2019-12-22 words: 6577 flesch: 45 summary: Atorvastatin calcium nanosuspension was evaluated for particle size, poly dispersity index (PDI), zeta potential, crystal form and surface morphology. Atorvastatin calcium nanosuspension 47 Introduction Formulating poorly water soluble drugs to obtain a suitable bioavailability has become a serious defy in scientific, industrial, and medical issue. keywords: atorvastatin; calcium; dissolution; drug; f18; figure; hpmc; nanosuspension; particle; powder; pvp; release; size; stabilizer; steric; tpgs; tween80 cache: bijps-868.pdf plain text: bijps-868.txt item: #540 of 579 id: bijps-872 author: Khudair, oun D.; A. Fatih, Diar title: Synthesis and Characterizations of Dipeptide Derivative of Gentamicin date: 2019-12-22 words: 2942 flesch: 57 summary: C=O stretching of ester 1768 C=O stretching of amide group 1681 N-H bending of secondary amide 1529 Asymmetric C– H bending of methyl group 1462 Symmetric C–H bending of methylene group 1432 C-O stretching of ester. Chemical synthesis of compound Ib (Synthesis of Boc L-val -L-ala dipeptide) keywords: chloride; compound; derivative; dipeptide; gentamicin; group; iraqi; stretching; synthesis cache: bijps-872.pdf plain text: bijps-872.txt item: #541 of 579 id: bijps-874 author: Shihab, Ikram K.; H. Mohammed, Mohammed title: Synthesis, Characterization and Preliminary Anticancer Study of Novel 5-fluorouracil Conjugate with Pyrrolidine Dithiocarbamate as a Mutual Anticancer Prodrug date: 2019-12-21 words: 4062 flesch: 60 summary: ** Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract 5-Fluorouracil (5-FU)s one of the commonly used chemotherapy drugs in anticancer therapy; unfortunately treatment with 5-FU solely has many drawbacks low lipophilicity, low permeability, low molecular weight, and its relatively poor plasma protein binding; also a brief half-life, therefore frequent administration is required to maintain the optimal therapeutic plasma level which in addition to its poor selectivity, drug resistance and limited penetration to cancer cells; leads to increased incidence of side-effects to healthy cells/tissues and low response rates. .Properties like poor selectivity, drug resistance and limited penetration to cancer cells keywords: cancer; cells; compound; dithiocarbamate; fluorouracil; iraqi; prodrug; pyrrolidine; sci; str; synthesis cache: bijps-874.pdf plain text: bijps-874.txt item: #542 of 579 id: bijps-876 author: Shawkat, Ali Jalal; H. Jwaid, Ahmed title: Clinical Complications of Beta-Thalassemia Major date: 2019-12-21 words: 5562 flesch: 50 summary: The importance of spleen, spleen iron, and splenectomy for determining total body iron load, ferrikinetics, and iron toxicity in thalassemia major patients. 2019 Beta-thalassemia major 4 complications comprising macrovascular complications (cardiovascular, cerebrovascular and peripheral vascular diseases), and microvascular complications (diabetic retinopathy, nephropathy, and neuropathy)(26).The use of HbA1c for assessing glycemic control in thalassemia patients with hemoglobinopathies is less accurate; hence an alternate method for assessment that is not affected by abnormal hemoglobin variants is the use of fructosamine levels measurement which depends on serum protein glycosylation(25). keywords: beta; blood; bone; chelation; complications; deficiency; disease; et al; growth; iron; iron overload; journal; levels; liver; major; overload; patients; thalassemia; therapy; transfusion cache: bijps-876.pdf plain text: bijps-876.txt item: #543 of 579 id: bijps-877 author: al_talkani, ahmed F.; H. Kathem, Sarmed title: The Prevalence of UGT1A1*93 and ABCC5 Polymorphisms in Cancer Patients Receiving Irinotecan-Based Chemotherapy at Al-Najaf Al-Ashraf date: 2019-12-22 words: 3439 flesch: 55 summary: This finding was consistent with Li et al. and Crona et al studies, who postulated that a polymorphism of UGT1A1*93 was a strong predictor of irinotecan induced neutropenia, that is associated with higher SN-38 AUC and lower absolute neutrophils3 counts (ANC) nadirs. Vomiting 4 16.7% a: irinotecan dose reduction (25% -35%) keywords: abcc5; allele; cancer; drug; irinotecan; mutation; patients; pharmacogenetics; polymorphism; prevalence; study; toxicity; ugt1a1 cache: bijps-877.pdf plain text: bijps-877.txt item: #544 of 579 id: bijps-879 author: Mohammed, Samer I.; Dawood, Elaf B.; Abaas, Iman S. title: Perceptions and attitudes of community pharmacists towards patient counseling and continuing pharmacy education programs in Iraq date: 2019-12-22 words: 3892 flesch: 59 summary: Almost (47%) of participants indicated that attending continuous pharmacist education programs can help them to improve the counseling practice furthermore, the majority of them have an optimistic attitude toward the importance of these programs for the future of their career. By increasing pharmacists in pharmacy 44(16.73) Attendance of continuous pharmacist education programs 124(47.14) Specify special areas for providing consultation 84(31.93) Other 11(4.18) Only less than (5%) of participants said that continuous pharmacist education programs available for them while more than half of the participants cleared that these programs rarely reach to Iraqi pharmacists as shown in table 7. keywords: care; community; continuous; counseling; education; iraq; participants; patients; pharmacists; pharmacy; programs; study; table cache: bijps-879.pdf plain text: bijps-879.txt item: #545 of 579 id: bijps-883 author: Abed, haithem N; A. Hussein, Ahmed title: Ex-vivo Ex-Vivo Absorption Study of a Novel Dabigatran Etexilate Loaded Nanostructured Lipid Carrier Using Non-Everted Intestinal Sac Model date: 2019-12-22 words: 5402 flesch: 51 summary: Conclusion In the present study, DE loaded NLCs were successfully prepared utilizing emulsification / ultrasonication method, and the formula N1 was selected due to its preferred particle size distribution, zeta potential, entrapment efficiency and drug release profile and selected to undergo ex-vivo permeability study and the obtained data reveals a four folds increase in drug permeability showing that NLCs is a promising delivery system to increase the DE oral bioavailability. Beloqui A., Solinís M.A., des Rieux A, Préat V. and Rodríguez-Gascón A., Nanostructured Lipid Carriers: promising drug delivery systems for future clinics, Nanomed.: keywords: carriers; dabigatran; drug; formula; lipid; method; min; nlcs; particle; permeability; permeation; pharm; release; size; study; vivo cache: bijps-883.pdf plain text: bijps-883.txt item: #546 of 579 id: bijps-884 author: Kassab, Hanan J.; MERDAW, Maysoon A.; J. Al- Ramahi, Intesar; A. Alasadi, Alaa; Al Mousauy, Sawsan; Ahmed, Rownak; Ismaeel, Israa; Al-Sultani, Dorees title: Use of Human Umbilical Cord Serum to Treat Animal Skin Burns date: 2019-12-23 words: 4175 flesch: 65 summary: But the number of studies using umbilical cord blood for skin injuries remains minor; Liu et al. injected UCB intravenously into burnt mice, while Dai et al. isolated mononuclear cells from mesenchymal stem cells of human umbilical cord blood and transplanted into injured nude mice by tail vein injection (21,22). Human umbilical cord serum HUCS was collected and screened for transmitted diseases such as hepatitis B, hepatitis C and HIV. keywords: area; blood; burn; cord; group; healing; hucs; human; mice; sci; serum; treatment; umbilical; water; wound cache: bijps-884.pdf plain text: bijps-884.txt item: #547 of 579 id: bijps-887 author: Saleh, Eman S. title: The Assessment of Some Serum Biomarkers of Fibromyalgia Syndrome in Pre and Postmenopausal Women in Relation to Obesity date: 2019-12-22 words: 5434 flesch: 55 summary: Eastell et al and Khosla et al in different studies described the progress of age lead to increase turnover of bone due to raise the blood level of parathyroid hormone and lower estrogen (34, 35). Quinzii CM, Lopez LC, Naini A et al: Human CoQ10 deficiencies. keywords: age; control; fibromyalgia; fms; level; menopause; obesity; pain; patients; pth; serum; study; syndrome; tas; value; women; years cache: bijps-887.pdf plain text: bijps-887.txt item: #548 of 579 id: bijps-888 author: G.Al-Rakhat, Iman; N.Al-Shawi, Nada title: Effects of Hydrochlorothiazide on Tenofovir Disoproxil Fumarate-Induced Nephrotoxicity in Rats date: 2019-12-22 words: 4556 flesch: 58 summary: Thus, results of this study concerning the effects of hydrochlorthiazide on kidney are coincide with that of Wadei H.M, et al at 2008 who reported that low kidney function and glomerular and tubular injury can be more commonly manifested in thiazide-treated rats (32). Adikwu, E, Ogbuehi I, Nkereuwen J., et al. Tenofovir Renal Toxicity: Evaluation of Cohorts and Clinical Studies-Part 2. Pharmacology and Pharmacy 2014; 5: 97-111. 8. keywords: control; cystatin; disoproxil; fumarate; group; kidney; level; nephrotoxicity; p<0.05; rats; serum; tdf; tenofovir cache: bijps-888.pdf plain text: bijps-888.txt item: #549 of 579 id: bijps-896 author: Jaafar, Noor Sabah title: Clinical effects of Arabic gum (Acacia): A mini review date: 2019-12-21 words: 6218 flesch: 54 summary: Sugars arabinose and ribose were originally discovered and isolated from gum Arabic which represents the original source of these sugars. Although gum Arabic considered as an inert substance, recent information revealed multiple pharmacological and medical effects, such as weight reduction, antihypertensive, antihyperlipidemic, anticoagulant, antibacterial, antidiabetic, anti-inflammatory, nephroprotective and other effects. keywords: acacia; acid; ahmed; antioxidant; arabic; chronic; diabetic; effect; et al; gum; gum arabic; level; mice; patients; pharm; rats; reduction; res; sci; senegal; study cache: bijps-896.pdf plain text: bijps-896.txt item: #550 of 579 id: bijps-916 author: Shanshal, Aysha M.; H. Ataimish, Ahmed title: Evaluation of Knowledge, Attitudes and Experience of off-label Drug Prescribing Practice among Physicians in Baghdad City Hospitals date: 2019-12-22 words: 5952 flesch: 55 summary: The authors thank Professor Dr. Saad A. Hussain for the instructions and valuable advice, and specifically for sharing his knowledge concerning off label prescribing with us. Radley D, Finkelstein S and Stafford R. Off- label prescribing among office-based physicians. keywords: drug; iraqi; label; label drug; patients; pharm; physicians; practice; prescribing; questionnaire; respondents; study; test; trials; use; years cache: bijps-916.pdf plain text: bijps-916.txt item: #551 of 579 id: bijps-919 author: Dahash, Rajaa A.; A. Rajab, Nawal title: Formulation and Investigation of Lacidipine as a Nanoemulsions date: 2020-06-21 words: 5714 flesch: 61 summary: Results of thermodynamic stability studies For LCDP nanoemulsions. Particle size measurement for LCDP nanoemulsion. keywords: delivery; dissolution; drug; ethanol; figure; formula; iraqi; j pharm; lacidipine; lcdp; nanoemulsions; nes; oil; pass; pharm; pharm sci; phase; potential; sci; size; study; surfactant; triacetin; tween cache: bijps-919.pdf plain text: bijps-919.txt item: #552 of 579 id: bijps-922 author: Abbas, Ishraq k.; A. Rajab, Nawal; A. Hussein, Ahmed title: Formulation and In-Vitro Evaluation of Darifenacin Hydrobromide as Buccal Films date: 2019-12-22 words: 5421 flesch: 63 summary: Fast dissolving buccal films are the most innovative oral solid dosage form because of their flexibility and comfort. Keywords: Darifenacin hydrobromide, Overactive bladder, Fast dissolving buccal films. keywords: buccal; darifenacin; disintegration; drug; evaluation; figure; films; formulation; hydrobromide; indion; pharm; pva; sci; time cache: bijps-922.pdf plain text: bijps-922.txt item: #553 of 579 id: bijps-925 author: Aldahhan, Eman S.; A. Radhi, Ameera title: Co-Amorphous System: A promising Strategy for Delivering Poorly Water - Soluble Drugs date: 2020-06-21 words: 7427 flesch: 52 summary: Laitinena R, Löbmanna K, Strachana CJ, Grohganzb H, Radesa T. Emerging trends in the stabilization of amorphous drugs. This review highlights the different approaches followed in the preparation of co-amorphous drug delivery system, and the proper selection of the co-formers. keywords: acid; amorphous; cam; dispersions; dissolution; drug; int; interactions; j pharm; milling; pharm; pharm sci; preparation; rades; sci; solid; solubility; stability; system cache: bijps-925.pdf plain text: bijps-925.txt item: #554 of 579 id: bijps-926 author: alkufi, hussein K.; Kassab, Hanan J. title: Formulation and Evaluation of Sustained Release Sumatriptan Mucoadhesive Intranasal in-Situ Gel date: 2019-12-22 words: 5475 flesch: 61 summary: Initial rapid release may be due to the exposure of fresh surface of drug present in gel to the sheep mucosa and sustained drug release after 1 h may be due to the polymers like poloxamer407 which slightly decrease the rate of drug release due to enhanced micellar structure and gel network(9) and the presence of HA (hydrophilic polymer) which entrap the drug and sustain the release. Faster release of ST solution in comparism to IG 7 was obtained with a significant difference (p<0.05).The percent of drug release from the ST solution is 99.33% in 2h while the percent of drug release from IG7 in 6h was 95.89% as shown in the figure 4, due to the presence of polymers. keywords: drug; formulation; gel; gelation; ig7; mucoadhesive; nasal; pharm; poloxamer; release; sci; situ; temperature cache: bijps-926.pdf plain text: bijps-926.txt item: #555 of 579 id: bijps-928 author: Ali, Samer K.; B. H. Al-Khedairy, Eman title: Solubility and Dissolution Enhancement of Atorvastatin Calcium using Solid Dispersion Adsorbate Technique date: 2019-12-22 words: 4870 flesch: 56 summary: The prepared (SDA) showed improvement of drug solubility in all prepared formula. All prepared formula of SDAs improved the solubility of ATR may be due to increased wettability and reduced crystallinity of the drug, which leads to improve drug solubility and dissolution. keywords: adsorbate; aerosil; atorvastatin; atr; carrier; dispersion; dissolution; drug; formula; iraqi; j pharm; mas; pharm; poloxamer; sci; sda; solubility; water cache: bijps-928.pdf plain text: bijps-928.txt item: #556 of 579 id: bijps-929 author: Rashid, Asmaa M.; Abdal-Hammid, Shaimaa N. title: Formulation and Characterization of Itraconazole as Nanosuspension Dosage Form for Enhancement of Solubility date: 2019-12-22 words: 5058 flesch: 56 summary: ITZ nanosuspension was produced by a solvent-antisolvent nanoprecipitation method in the presence of different stabilizers (Poloxamer-188 and HPMCE5) at different ratios with the drug alone or combination with surfactants (tween 80 and SLS). Zeta potential The zeta potential for the selected formulation of ITZ nanosuspension was - 21.86 mV, as shown in figure 6. keywords: dissolution; drug; figure; formula; formulation; itraconazole; itz; journal; lyophilized; nanoparticles; nanosuspension; p-188; particle; pure; selected; size; solubility; stabilizer cache: bijps-929.pdf plain text: bijps-929.txt item: #557 of 579 id: bijps-931 author: K. Abd, Ahmad; J. Kadhim, Dheyaa; M. Younus, Manal title: Assessment of Causality, Severity and Seriousness of Adverse Event Following Immunization in Iraq: A Retrospective Study Based on Iraqi date: 2019-12-22 words: 5489 flesch: 54 summary: % 22.29جدية بنسبة ) Relation of the outcome , severity and seriousness of adverse event following immunization with gender Parameter male Female Total P. Value Outcomes No. % keywords: aefi; assessment; causality; events; immunization; iraqi; pharmacovigilance; reaction; reports; safety; seriousness; severity; study; table; total; vaccine cache: bijps-931.pdf plain text: bijps-931.txt item: #558 of 579 id: bijps-932 author: Faiq, Mirna K.; J. Kadhim, Dheyaa; I. Gorial, Faiq title: The Belief about Medicines among a Sample of Iraqi Patients with Rheumatoid Arthritis date: 2019-12-22 words: 4395 flesch: 56 summary: Future studies should investigate how interventional approaches addressing these predictors may lead to improve beliefs about medicines among rheumatoid arthritis patients and their impression on disease control. Study done by Zwikker HE, shown increasing need belief about prescription in clinical practice may be advantageous in improving medicine adherence in RA patients(22). keywords: arthritis; beliefs; bmq; concern; disease; medication; medicines; necessity; patients; rheumatoid; score; study; years cache: bijps-932.pdf plain text: bijps-932.txt item: #559 of 579 id: bijps-933 author: Al-Amily, Duraid; Mohammed, Mohammed H. title: Design, Synthesis and Cytotoxicity Study of Primary Amides as Histone Deacetylase Inhibitors date: 2019-12-23 words: 4036 flesch: 68 summary: Both of them showed good cytotoxicity against cancer cell lines (HC-04 and HRT-18) and lower cytotoxicity against normal cell line (HBL-100). Synthesis of primary amides as HDACIs DOI: https://doi.org/10.31351/vol28iss2pp151-158 151 Design, Synthesis and Cytotoxicity Study of Primary Amides as Histone Deacetylase Inhibitors Duraid Al-Amily*,1 and Mohammed H. Mohammed* *Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq. keywords: acid; amide; aromatic; cell; cm-1; compounds; cytotoxicity; histone; line; primary; synthesis cache: bijps-933.pdf plain text: bijps-933.txt item: #560 of 579 id: bijps-936 author: Hamed, Hiba E.; A. Hussein, Ahmed title: Preparation, in vitro and ex-vivo Evaluation of Mirtazapine Nanosuspension and Nanoparticles Incorporated in Orodispersible Tablets date: 2020-06-21 words: 6114 flesch: 51 summary: Flow properties of prepared blends of mirtazapine incorporating drug nanoparticles. International Journal of Pharmaceutics. 2013; 443: 209- 220. 25. Wu L, Zhang J, Watanabe W. Physical and chemical stability of drug nanoparticles. keywords: concentration; dissolution; drug; figure; formula; formulation; journal; mirtazapine; nanoparticles; nanosuspension; particle; particle size; pharmaceutical; poloxamer; powder; ratio; size; stabilizer; tablets cache: bijps-936.pdf plain text: bijps-936.txt item: #561 of 579 id: bijps-938 author: Majeed, Israa A.; N. Al-Shawi, Nada title: Effects of Omega-3 Co-Administered with Therapeutic Dose of lornoxicam on Male Rats' Liver date: 2019-12-23 words: 4159 flesch: 59 summary: Authors illustrated the adverse effects of other drugs and chemicals on rats liver (16) (17); but, no previous studies were reported in order to compare results of this study with others concerning the effect of lornoxicam used at therapeutic dose alone on rats' liver. In conclusion, the current study is the first that highlight the effect of utilizing alone, lornoxicam, or omega 3 on rats' liver; and again, it is the first that investigates the effect of combination of omega 3 co-administered with lornoxicam on rat's liver; thus, we did not have a chance to compare results of this study with others. keywords: ast; dose; group; homogenate; levels; liver; lornoxicam; male; omega; rats; tissue; tnf cache: bijps-938.pdf plain text: bijps-938.txt item: #562 of 579 id: bijps-939 author: AlKhalidi, Mustapha M.; J. Jawad, Fatima title: Enhancement of Aqueous Solubility and Dissolution Rate of Etoricoxib by Solid Dispersion Technique date: 2020-06-21 words: 5270 flesch: 54 summary: Selection of the optimum formula The selection of the optimum formula was depended on the solubility study and the dissolution profile of EXB solid dispersion. The practical yield percent (PY %) and drug content of EXB solid dispersion using different methods Formula number Preparation method Practical yield percent (PY %) Drug content mean±std (n=3) keywords: carriers; dispersion; dissolution; drug; etoricoxib; evaporation; exb; figure; formula; fusion; journal; method; polymer; preparation; pxm; solubility; solvent cache: bijps-939.pdf plain text: bijps-939.txt item: #563 of 579 id: bijps-941 author: Y. Al-Radeef, Mohanad title: Status of CHADS2 and CHA2DS2-VASc Scores in Predicting Risk of Stroke and its Prevention in Iraqi Patients with Atrial Fibrillation date: 2019-06-09 words: 3411 flesch: 54 summary: For the most of AF patients, the backbones of treatment to decrease stroke risk are antithrombotic medicines (antiplatelet and anticoagulants). Conclusion CHADS2 and CHA2DS2-VASc scores were often neglected in assessing Iraqi AF patients in hospitals; in addition to that, aspirin is still widely used as a strategy to minimize stroke risk in patients with AF regardless to these scores. keywords: aspirin; chads2; fibrillation; figure; patients; risk; score; stroke; study; vasc cache: bijps-941.pdf plain text: bijps-941.txt item: #564 of 579 id: bijps-942 author: M. Hassan, Omeed; W. Sarsam, Susan title: Synthesis, Characterization and Preliminary Anti-inflammatory Evaluation of New Etodolac Derivatives date: 2019-06-09 words: 3687 flesch: 66 summary: 1Corresponding author: E-mail: sarsam14@yahoo.com Received: 27/11/2018 Accepted: 2/2/2019 Iraqi Journal of Pharmaceutical Sciences https://doi.org/10.31351/vol28iss1pp106-112 Iraqi J Pharm Sci, Vol.28(1) 2019 Etodolac hydrazone derivatives with anti-inflammatory action 107 Hydrazones are an important class for new drug development and an exceptional class of organic compounds in the Schiff base family. Etodolac hydrazone derivatives with anti-inflammatory action 108 (P1) 2-(1,8-diethyl-1,3,4,9-tetrahydropyrano[3,4- b]indol-1-yl) - N' - ( 4 – hydroxyl -3 , 5 - dimethoxy – benzylidene ) acetohydrazide. keywords: -ch2; ch3; compounds; derivatives; etodolac; hydrazone; paw; str cache: bijps-942.pdf plain text: bijps-942.txt item: #565 of 579 id: bijps-943 author: Al-Darraji, Asmaa S.; H.Mohamed, Mohamed title: Synthesis and Preliminary Anticancer Evaluation of 6-Mercaptopurine –Methotrexate Conjugate as Possible Mutual Prodrug date: 2019-06-09 words: 4708 flesch: 54 summary: Iraqi J Pharm Sci, Vol.28(1) 2019 6-mercaptopurine –methotrexate conjugate 120 Table ( 1) Cytotoxic activity of 6-MP, compound VIII and compound VI against MCF-7 cancer cell (*Mean ±SEM is mean and standard error of mean, P value is probability value, NS: non-significant value, **** significant value) Cytotoxic assay of the tested compounds against SKO-3 type of tumor cell % of cytotoxicity, IC50% results of standard and the two synthesized VI, VIII were shown in figure 2, while statistical data of them shown in table 2. <0.0001(****) 100(µg/ml) 87.00±1.155 <0.0001(****) Iraqi J Pharm Sci, Vol.28(1) 2019 6-mercaptopurine –methotrexate conjugate 121 Table (2) Statistical results of cytotoxic activity of 6-MP, compound VIII and compound VI against SKO- 3 cancer cell (Mean ±SEM is mean and standard error of mean, P value is probability value, NS: non- significant value, **** significant value) keywords: amide; cancer; cell; cmˉ¹(c; compound; conjugate; mercaptopurine; methotrexate; mtx; solution; stretching; synthesis; viii cache: bijps-943.pdf plain text: bijps-943.txt item: #566 of 579 id: bijps-948 author: A. Tamer, Anwar; J Qassir, Ahlam title: Synthesis of Acetylenic Derivatives of a Substituted 1, 3, 4-Thiadiazole as Antibacterial Agents date: 2019-06-26 words: 3986 flesch: 55 summary: The synthesized compounds were evaluated for their antimicrobial activity in vitro Iraqi J Pharm Sci, Vol.28(1) 2019 Substituted 1, 3, 4-thiadiazole as antibacterial agents 127 against three types of tested microorganisms (Staph. aureus., and Bacillus subtilis as a Gram-positive bacteria) and (klebsiella pneomonae, and E. coli) as a Gram-negative bacteria) were clinically activated and maintained on nutrient agar for examining antibacterial activity. Ampicillin was used as a standard drug for antibacterial activity. keywords: activity; antibacterial; bending; compound; journal; mixture; reaction; ring; schiff; stretching; synthesis; thiadiazole cache: bijps-948.pdf plain text: bijps-948.txt item: #567 of 579 id: bijps-951 author: R. Al-Nakeeb, Mayada; N-A. Omar, Tagreed title: Synthesis, Characterization and Preliminary Study of the Anti-Inflammatory Activity of New Pyrazoline Containing Ibuprofen Derivatives date: 2019-06-26 words: 4271 flesch: 65 summary: All of them showed anti-inflammatory activity compared to the control group (propylene glycol) except compound 5f that showed more anti-inflammatory activity than ibuprofen. All of the synthesized compounds demonstrated anti-inflammatory activity in the control group of rats. keywords: amide; aromatic; ch2; compound; derivatives; ibuprofen; pyrazoline; stretching; synthesis cache: bijps-951.pdf plain text: bijps-951.txt item: #568 of 579 id: bijps-952 author: H. Ali Alsafi, Mustafa; S. Farhan, Muthanna title: Synthesis, Characterization and Acute Anti-inflammatory Evaluation of New Mefenamic Acid Derivatives Having 4-Thiazolidinone Nucleus date: 2019-06-26 words: 4587 flesch: 64 summary: Abstract Mefenamic acid (MA) is one of the non-steroidal anti-inflammatory drugs, it is widely used probably due to having both anti-inflammatory and analgesic activity, the main side effects of mefenamic acid include gastrointestinal tract (GIT) disturbance mainly diarrhea, peptic ulceration, and gastric bleeding. The study aimed to synthesize derivatives of mefenamic acid with more potency and to decrease the drug's potential side effects, new series of 4-thiazolidinone derivatives of mefenamic acid were synthesized IVa-g. keywords: acid; amide; carboxylic; ch2; cm-1; compounds; derivatives; ftir; mefenamic; synthesis; thiazolidinone cache: bijps-952.pdf plain text: bijps-952.txt item: #569 of 579 id: bijps-956 author: Ezghayer, Mohammed A.; J. Kadhim, Enas title: UPLC-ESI-MS/MS and Various Chromatographic Technique for Identification of Phytochemicals in Populus euphratica Oliv. Leaves Extract date: 2020-06-24 words: 6204 flesch: 67 summary: Li X, Xiao H, Liang X, Shi D, Liu J. LC – MS / MS determination of naringin , hesperidin and Iraqi J Pharm Sci, Vol.29(1) 2020 leaves extract 97 UPLC-ESI-MS/MS for tentative identification of compounds in fractions Twenty phytochemicals have been putatively characterized by UPLC-ESI-MS/MS in Populus euphratica leaves based on comparison of mass fragmentation pattern, LC retention time and molecular weight with previous study and the literature in phytochemicals mass library such as Respect (http:// spectra.psc .riken. keywords: esi; euphratica; extract; figure; fraction; iraqi; leaves; mass; oliv; pharm; phytochemicals; populus; sci; uplc; vol.29(1 cache: bijps-956.pdf plain text: bijps-956.txt item: #570 of 579 id: bijps-957 author: Hassan, Ali F.; H. Jasem, Nibras title: Evaluation the Incidence of Genotoxic Effects of Artificial Food Favoring Additives in Bone Marrow Cells and Spleen Cells in Mice date: 2020-06-21 words: 3777 flesch: 34 summary: Iraqi J Pharm Sci, Vol.29(1) 2020 Genotoxic evaluation for artificial food flavoring additive DOI: https://doi.org/10.31351/vol29iss1pp55-61a 55 Evaluation the Incidence of Genotoxic Effects of Artificial Food Favoring Additives in Bone Marrow Cells and Spleen Cells in Mice Nibras H. Jasem* and Ali F. Hassan **,1 * Ministry of Health and Environment ,Technical Affairs Directorate, , Baghdad, Iraq. Received: 3 / 7 / 2019 Accepted:16 / 9 / 2020 Iraqi Journal of Pharmaceutical Sciences https://doi.org/10.31351/vol29iss1pp55-61a mailto:ali_1371982@yahoo.com Iraqi J Pharm Sci, Vol.29(1) 2020 Genotoxic evaluation for artificial food flavoring additive 56 Any DNA mutations inherit if the DNA damage is not repaired by repair system before mitosis (12]. keywords: aberration; additive; artificial; cells; chromosomal; concentration; control; evaluation; flavoring; food; food flavoring; genotoxic; increase; p<0.05; total cache: bijps-957.pdf plain text: bijps-957.txt item: #571 of 579 id: bijps-958 author: Hassan, Ali F.; N. Muhsin, Suha title: Evaluate the Protective Effect of Lactobacillus against Collateral Damage Induced by Ciprofloxacin and Levofloxacin in Iraqi Patients date: 2019-12-23 words: 3477 flesch: 57 summary: The results for this study, there are a significant increase in the incidence of diarrhea for all groups when comparison between before and after treatment diarrhea was made; a number of patients with diarrhea in group 1 after finish the treatment was not significantly higher when compared with group 2 (P>0.05); meanwhile, number of patients with diarrhea in group 4 after finish the treatment was significantly lower when compared with group 3 (P<0.05). Antibiotic associated diarrhea is a most important type of collateral damage that associated with the uses of specific type of antibiotics. keywords: associated; ciprofloxacin; day; days; diarrhea; group; lactobacillus; levofloxacin; mg tablet; patients; tablet; treatment cache: bijps-958.pdf plain text: bijps-958.txt item: #572 of 579 id: bijps-960 author: M. Al-joda, Ali; Zalzala, Munaf H. title: Inhibition of NF-kB Pathway by Gggulsterone in the Protective Effects of Cyclophosphamide-Induced Renal Toxicity date: 2019-12-23 words: 3868 flesch: 49 summary: Results As presented in table 1, the nephrotoxic effect of cyclophosphamide represent a significant elevation in renal level of NF-κB in comparison to control group. In this study, the albino rats were divided to four groups: control group treated with vehicle, cyclophosphamide group, cyclophosphamide with guggulsterone group and guggulsterone alone group. keywords: catalase; control; creatinine; cyclophosphamide; cyp; effect; group; guggulsterone; kidney; level; rats; serum; toxicity cache: bijps-960.pdf plain text: bijps-960.txt item: #573 of 579 id: bijps-963 author: Najaf, Hanan N.; J. Kadhim, Dheyaa title: Health-Related Quality of Life among a Sample of Chronic Hepatitis B Patients in AL-Najaf Province /Iraq. date: 2020-06-21 words: 5168 flesch: 63 summary: The aim of the current study was to measure health-related quality of life among a sample of chronic hepatitis B patients in AL- Najaf city/Iraq. In conclusion, chronic hepatitis B patients showed significantly lower health-related quality of life scores in various domains compared to healthy control subjects in AL-Najaf province /Iraq. keywords: chronic; chronic hepatitis; disease; functioning; health; hepatitis; hrqol; iqr; life; med.score; patients; quality; score; study cache: bijps-963.pdf plain text: bijps-963.txt item: #574 of 579 id: bijps-967 author: Mohammed, Samer I.; Al- Shadedi, Mohamed I.; Kasim, Ali A. title: Knowledge, Use and Recommendation of Iraqi Pharmacist Toward Complementary and Alternative Medicine date: 2020-06-21 words: 3300 flesch: 54 summary: Keywords: Complementary medicine, Alternative medicine, Herbal medicines, Nutritional supplements, Iraqi pharmacists. N (%) True False Don’t know Alternative medicines are used instead of conventional medicine 85 (37) 65 (28) * keywords: cam; health; iraqi; knowledge; medicine; modalities; patients; pharmacists; questions; study; therapies; use; الصيادلة cache: bijps-967.pdf plain text: bijps-967.txt item: #575 of 579 id: bijps-970 author: Maryoosh, Taif M.; N. Al-Shawi, Nada; S. Salih, Eman title: Effects of Two Different Doses of Zinc Sulfate on Serum Troponin I 3 Enzyme Level and Cardiac Malondialdehyde Contents in Mitoxantrone-Induced Cardiotoxicity in Rats date: 2020-06-25 words: 5226 flesch: 56 summary: According to above results it can be concluded that zinc sulfate at a dose of (30 mg/kg/day) (in Group VI rats) diminished the cardiotoxicity induced by mitoxantrone as indicated by the reduction of serum troponin I 3 enzyme level but non-significant difference in lipid peroxidation marker (malondialdehyde) compared to (15 mg/kg/day) (in Group V rats). Conclusion Zinc sulfate at a dose of (30 mg/kg/day) (in Group VI rats) diminished the cardiotoxicity induced by mitoxantrone as indicated by the reduction of serum troponin I 3 enzyme level but non-significant difference in lipid peroxidation marker ( malondialdehyde) compared to (15 mg/kg/day) (in Group V rats). keywords: contents; day; dose; group; heart; mda; mitoxantrone; mtxn; rats; serum; sulfate; tissue; troponin; zinc; zinc sulfate cache: bijps-970.pdf plain text: bijps-970.txt item: #576 of 579 id: bijps-974 author: Alshaeer, Majeed N.; M. Anwer, Zinah title: Comparing the Efficacy of Paracetamol, Diclofenac, and Ketorolac on Post-Appendectomy Outcomes in Children and Adolescents date: 2020-06-25 words: 5799 flesch: 60 summary: After surgery patients favor to have pain rather than (N,V)(19). Patients received ketorolac had a high percentage of the decrease in pain score between 30 and 60 min. after surgery, while paracetamol was the next and diclofenac sodium was the last. keywords: acute; analgesia; appendectomy; appendicitis; bleeding; children; diclofenac; groups; journal; ketorolac; nausea; nsaids; number; pain; paracetamol; patients; postoperative; score; study; surgery; vomiting cache: bijps-974.pdf plain text: bijps-974.txt item: #577 of 579 id: bijps-977 author: Mahmood, Mustafa K.; Anwer, Zinah M. title: The Prevalence of Potentially Inappropriate Prescribing in Geriatric Patients with Psychiatric Disorders in Iraq date: 2020-06-25 words: 3481 flesch: 49 summary: PIP psychotropic medications 171 The total prevalence of PIP The prevalence inappropriate psychotropic medications was 74.3%, while the remaining 25.7% received appropriately prescribing medications. The prevalence of potentially inappropriate prescribing according to Beers criteria was found to be 74.3% among study patients, the most prevalent inappropriately used drug class was benzodiazepines, and there was a significant association between the prescribing of a potentially inappropriate medication with gender (p=0.018), with comorbidities (p=0.022), and a very significant association with polypharmacy (p<0.001) keywords: criteria; drug; geriatric; medications; patients; pip; prescribing; prevalence; psychotropic; study cache: bijps-977.pdf plain text: bijps-977.txt item: #578 of 579 id: bijps-985 author: Alkhiro, Adeeb R.; Ghareeb, Mowafaq M. title: Formulation and Evaluation of Iornoxicam as Dissolving Microneedle Patch date: 2020-06-25 words: 5473 flesch: 63 summary: Methods Preparation of lornoxicam microneedle patches Preparation of LXM MN patches was accomplished by using different ratios of PVP K 30, PVA and 5% W/W polyethylene glycol 400 (PEG 400) by micro molding techniques as shown in table (1). No cell necrosis was detected after application of LXM MN patch and saline buffer pH 7.4 as comparator. keywords: drug; f10; force; formula; journal; lornoxicam; lxm; microneedle; patch; patches; permeation; pharm; pva; pvp; release; skin; study cache: bijps-985.pdf plain text: bijps-985.txt item: #579 of 579 id: bijps-989 author: Hammodi, Ihab D.; N. Abd Alhammid, Shaimaa title: Preparation and Characterization of Topical Letrozole Nanoemulsion for Breast Cancer date: 2020-06-25 words: 5432 flesch: 62 summary: Table 4. Zeta potential (ZP) distribution results of LZL nanoemulsion NS ZP NS ZP NS-1 Therefore, 9 formulae of (o/w) LZL NS were formulated, then pseudo-ternary phase diagram was used as a useful tool to evaluate the NS domain at Smix ratios: 1:1, 2:1 and 3:1. keywords: drug; figure; formulation; letrozole; lzl; nanoemulsion; oil; particle; size; smix; surfactant; table; tween; water; √ √ cache: bijps-989.pdf plain text: bijps-989.txt