Bibliography

This is an automatically generated bibliography describing the content of this study carrel.

1. bijps-1000
   • author: Ghanim, Waleed K.; N. Al-Shawi, nada
   • title: Evaluating the Effects of Different Doses of Vitamin B2 and Single Dose of Vitamin B12 Against Myelosuppression Induced by Cyclophosphamide in Experimental Rats
   • date: 2020-06-25
   • words: 5269
   • flesch: 52
   • summary: Group VII/ Vitamin B2 (dose 40 mg/kg/day) and a single IP injection of CPA 2.29±0.099e 0.31±0.017d 1.01±0.023e 2.92±0.029e Group VIII/Vitamin B12 (dose 0.1mg/kg/day) and a single IP injection of CPA 2.68±0.122d 0.39±0.01d 1.25±0.022d 3.16±0.034d Group IX/A combination of vitamin B2 (10 mg/kg/day) and vitamin B12 (0.1 mg/kg/day) and a single IP injection of CPA 3.32±0.091c 0.48±0.013c 1.45±0.017c 3.40±0.021c Group X combination of vitamin B2 (40 mg/kg/day) and vitamin B12 (0.1 mg/kg/day) and a single IP injection of CPA. Iraqi J Pharm Sci, Vol.29(1) 2020 B2 ,B12 against myelosuppression induced by cyclophosphamide DOI: https://doi.org/10.31351/vol29iss1pp134-142 134 Evaluating the Effects of Different Doses of Vitamin B2 and Single Dose of Vitamin B12 Against Myelosuppression Induced by Cyclophosphamide in Experimental Rats Waleed K. Ghanim*,1 and Nada N. Al-Shawi** * Department of Pharmacology and Toxicology, College of Pharmacy, University of Basra, Basra, Iraq.
   • keywords: acid; area; b12; baghdad; blood; bone; cells; college; combination; control; corresponding; cpa; cyclophosphamide; day; days; different; dose; effect; elevation; examination; fatty; figure; group; group ii; histopathological; https://www.sciencedirect.com/science/article/abs/pii/s0009279712000117?via%3dihub; injection; ip injection; iraqi; lymphocytes; marrow; mean±sem; myelosuppression; neutrophils; number; p<0.05; pharm; pharmacy; rats; rats ip; rbcs; reduction; riboflavin; role; sci; section; significant; single; single ip; study; table; tissue; total; viii; vitamin; vitamin b2; vol.29(1; wbcs; week; العظم; الفم; المجموعة; سايكلوفوسفامايد; طريق; فيتامين; كغم; لمدة
   • versions: original; plain text
2. bijps-1004
   • author: sadoon, Noor A.; M. Ghareeb, Mowafaq
   • title: Formulation and Characterization of Isradipine as Oral Nanoemulsion
   • date: 2020-06-25
   • words: 5427
   • flesch: 59
   • summary: With nanoemulsion formulation, it was noticed as the concentration of transcutol increase, the release is high reach 100% at the end of dissolution test , the reason behind this is due to the effect of co-surfactant which are good solubilizing and facilitating dissolution process of the pure drug (46, 47). With regard to the Smix part, high drug solubility in transcutol(75.1mg/ml) and tween20(20.101mg/ml) in table 2 (38).
   • keywords: analysis; aqueous; area; baghdad; bioavailability; characterization; chemical; compatibility; concentration; content; cosurfuctant; cycle; deionized; delivery; development; diagrams; different; dissolution; dosage; droplet; drug; drug delivery; dye; emulsifying; emulsions; figure; film; formulation; ftir; good; heating; high; higher; international; iraqi; isradipine; j pharm; journal; kim; lee; light; loaded; low; mean; measurement; method; mix; nanoemulsion; ne9; oil; oral; particle; pass; pass pass; percent; permeability; pharm; pharm sci; pharmaceutical; phase; polydispersity; potential; preparation; prepared; pseudo; pure; range; rate; ratio; release; research; results; sample; sci; sciences; self; size; smix; solubility; soluble; stability; stretching; studies; study; surfactant; system; table; ternary; test; thermodynamic; transcutol; transmittance; transparent; triacetin; use; value; viscosity; vol.29(1; water; zeta; ±0.01
   • versions: original; plain text
3. bijps-1008
   • author: Salim, Fahad F.; A. Rajab, Nawal
   • title: Formulation and Characterization of Piroxicam as Self-Nano Emulsifying Drug Delivery System
   • date: 2020-06-25
   • words: 5229
   • flesch: 58
   • summary: FTIR spectrum of selected PIR SNEDDS F4 formula It had been reported that PIR has two interconvertible crystalline forms, the needle and cubic forms. The prepared PIR SNEDDS formulas showed more than 92 % drug release at end of sixty minutes, yet F4 have higher release 97 %.
   • keywords: absorption; anti; area; bioavailability; characterization; cm-1; content; cremophore; cycle; delivery; diagram; dilution; dispersibility; dissolution; droplet; drug; drug delivery; emulsification; emulsifying; emulsion; evaluation; fesem; figure; formulas; formulations; ftir; hcl; high; hours; index; inflammatory; iraqi; j pharm; journal; liquid; liquid self; liquid snedds; mean; minutes; mixture; nano; nanoemulsifying; nanoemulsion; oil; oral; pdi; pharm; pharm sci; pharmaceutical; phase; piroxicam; piroxicam liquid; powder; precipitation; preparation; prepared; pseudo; rate; release; results; sci; self; size; small; smix; snedds; solid; solubility; stability; stretching; studies; study; surfactant; system; table; ternary; tests; time; transcutol; triacetin; type; use; value; vol.29(1; water
   • versions: original; plain text
4. bijps-1013
   • author: Sulaiman, Ahmed T.; W. Sarsam, Susan
   • title: Synthesis, Characterization and Antibacterial Activity Evaluation of New Indole-Based Derivatives
   • date: 2020-06-25
   • words: 4982
   • flesch: 63
   • summary: OH R2 H H H H H H OCH3 Scheme 1. Indole based N-acyl hydrazones with antibacterial activity 208 These types of bacteria produce IPA through deamination of tryptophan by bacterial enzyme tryptophan deaminase (7).
   • keywords: 3-(1h; acid; active; activities; activity; acyl; amide; aminolysis; amoxicillin; antibacterial; antibacterial activity; asym; baghdad; benzaldehyde; carbonyl; ch-; ch2; chemistry; cm-1; college; compounds; crystals; derivatives; drugs; ester; ethanol; gram; group; gut; hydrazide; hydrazones; indol-3; indole; indole n; inhibition; ipa; iraqi; journal; m.p; mechanism; moderate; new; nh-; pathway; pharm; pharmaceutical; ppm; propanehydrazide; propionic; reaction; scheme; sci; sciences; solution; str; sym; synthesis; synthesized; types; university; vol.29(1; water; white; yield; المركبات; فعالية
   • versions: original; plain text
5. bijps-1022
   • author: Sahib, Halah A.; H. Mohammed, Mohammed
   • title: Synthesis and Preliminary Biological Activity Evaluation of New N- Substituted Phthalimide Derivatives
   • date: 2020-06-25
   • words: 3564
   • flesch: 58
   • summary: Antimicrobial activity The Antimicrobial activity was screened using well diffusion methods. Bosquesi PL, Regina T, Melo F, et al. Anti- Inflammatory Drug Design Using a Molecular Hybridization Approach.
   • keywords: acetic; acid; active; activity; albicans; aldehyde; amino; antibacterial; antifungal; antimicrobial; asym; aureus; bacteria; baghdad; base; biological; candida; ch2; chem; chemistry; cm-1; coli; college; compounds; concentrations; derivatives; dmso; escherichia; ester; formation; fungi; gram; group; imine; iraqi; isoniazid; med; methyl; mmol; negative; new; novel; peak; pharm; phenylalanine; phthalimide; plane; positive; ppm; reaction; research; schiff; sci; solution; spectra; str; stretching; subtilis; synthesis; synthesized; tropicalis; tyrosine; university; vol.29(1; yellow; zone; µg\ml
   • versions: original; plain text
6. bijps-1028
   • author: Khaleefa, Ahmed S.; N. Hamad, Maha
   • title: Isolation, Structural Characterization and Identification of Major Constituents in Ephedra foliata Naturally Growing in Iraq by TLC, GC-MS and UPLC-ESI-MS/MS
   • date: 2020-12-27
   • words: 4448
   • flesch: 57
   • summary: That is done by maceration the aerial part of Ephedra foliata with 80% ethanol for 9 days and fractionated by n-hexane, chloroform, ethyl acetate, and n-butanol. These active constituents of Ephedra foliata have been identified play a crucial role in our life due to its pharmacological actions.
   • keywords: acetate; acid; actions; active; aerial; alkaloids; analysis; antioxidant; as1; as2; as2 compound; available; baghdad; base; basify; butanol; butanol fraction; characterization; chloroform; chloroform fraction; chromatography; compound; constituents; different; electrospray; ephedra; ephedra foliata; ephedrine; esi; ethanol; ethyl; extract; figure; flavonoids; foliata; fraction; fragmentation; gas; herb; hexane; hydrolysis; hydroxykynurenic; identification; ionization; iraqi; iraqi j; isolated; isolated as2; isolation; j pharm; layer; liquid; major; major constituents; mass; medicinal; min; mobile; molecular; peak; performance; pharm; pharm sci; pharmacological; phase; phenolic; phytochemical; plant; preparative; presence; reagent; results; retention; sci; species; spectrometry; structural; table; test; time; tlc; type; ultra; uplc; vol.29(2; water; كروماتوغرافيا; نبات
   • versions: original; plain text
7. bijps-1029
   • author: Jasim, Ali L.; S. Saleh, Eman; N. Abd Ali, Mustafa
   • title: Evaluating the Clinical Outcomes of Three Medication Regimens for Treating a Sample of Iraqi Persistent Asthmatic patients
   • date: 2020-06-25
   • words: 6497
   • flesch: 55
   • summary: Comparison of salmeterol/fluticasone propionate (FP) combination with FP+sustained release theophylline in moderate asthma patients. This study concluded that all groups caused significant improvement in study parameters compared to baseline values and also concluded that the third group which consisted of budesonide and tiotropium inhalers was associated with the highest extent of improvement followed by first group, while the second group was the least.
   • keywords: 0.001b; acting; allergy; ami; aminophylline; aminophylline bud; anova; asthma; asthmatic; baghdad; baseline; bud; budesonide; change; clinical; college; comparison; control; corticosteroids; days; difference; doses; effect; extent; figure; follow; formoterol; formoterol bud; fvc; group; higher; ics; improvement; increment; inhaled; iraqi; journal; laba; life; long; mean; measure; medication; medicine; miniaqlq; moderate; number; oral; outcomes; p<0.001; parameters; patients; pefr; percentage; persistent; pft; pharm; pretreatment; pulmonary; quality; questionnaire; randomized; regimens; respiratory; salmeterol; sci; scores; second; second follow; second group; severe; sfds; significant; significant difference; status; study; symptoms; table; test; theophylline; tiotropium; treatment; values; visit; vol.29(1; way; weeks; years; االولى; الثانية; الدراسة; الربو; المتابعة; المجموعة; بغداد; زيارة
   • versions: original; plain text
8. bijps-1033
   • author: Abd, Alaa M.; J. Kadhim, Enas
   • title: Phytochemical Investigation of Aerial Parts of Iraqi Cardaria draba
   • date: 2020-12-27
   • words: 3917
   • flesch: 58
   • summary: Flavonoids and phenolic acid compounds were isolated from hydrolyzed n-butanol fraction by preparative TLC to be then identified by HPLC, TLC, FTIR and melting point. The chromatographic and spectroscopic results showed the presence of luteolin, chlorogenic acid, caffeic acid, and resorcinol in aerial parts of C. draba.
   • keywords: acid; activity; aerial; alkaloids; analysis; antioxidant; baghdad; brassicaceae; butanol; caffeic; caffeic acid; cardaria; cardaria draba; chlorogenic; chlorogenic acid; chromatogram; cm−1; compounds; detection; draba; drops; effect; extract; extraction; family; figure; flavonoids; fraction; ftir; group; hoary; hplc; hydrolysis; hydrolyzed; investigation; iraqi; isolated; journal; luteolin; melting; methanol; min; mobile; molecules; natural; parts; peak; pharm; phase; phenolic; phenols; phytochemical; plant; point; preparative; presence; research; resorcinol; results; saponins; sci; solvent; species; spectral; spectrum; standard; study; system; test; tlc; university; vol.29(2; القانبري; الهوائية
   • versions: original; plain text
9. bijps-1035
   • author: M. Ali, Zahra; H. Ali, Shatha; Y. Mohsen, Forat
   • title: Assessment of Some Hematological parameters in Iraqi Women with Different Breast Cancer Stages
   • date: 2020-12-27
   • words: 5240
   • flesch: 62
   • summary: Elevated biomarkers of inflammation are associated with reduced survival among breast cancer patients .J Koh Y W, Lee H J, Ahn J H, Lee J W, & Gong G. Prognostic significance of the ratio of absolute neutrophil to lymphocyte counts for breast cancer patients with ER/PR-positivity and HER2-negativity in neoadjuvant setting.
   • keywords: anemia; baghdad; bc patients; biomarkers; blood; bmi; body; breast; breast cancer; cancer; cancer patients; carcinoma; cases; cell; clinical; control; control group; correlation; count; cytokines; data; diagnosis; different; disease; ductal; elevation; expression; factors; ferroportin; fpn; group; growth; healthy; hematological; hemoglobin; hepcidin; hepcidin levels; higher; human; idc; iii; ilc; incidence; increase; inflammation; inflammatory; invasive; iraqi; iron; levels; lower; lung; markers; mean; n=22; negative; number; p value; parameters; patients; patients group; pharm; platelets; production; prognosis; progression; range; receptor; res; results; role; sci; serum; serum hepcidin; serum levels; significant; situ; stage; stage ii; study; thrombocytosis; total; tumor; types; value; vol.29(2; wbc; weight; white; women; years; االولى; الثدي; الدموية; المرض; الى; سرطان; شملت; لدى; معدالت
   • versions: original; plain text
10. bijps-1038
    • author: Sabri, Lubna A.; A. Hussein, Ahmed
    • title: Comparison Between Conventional and Supersaturable Self-nanoemulsion Loaded with Nebivolol: Preparation and In-vitro/Ex-vivo Evaluation
    • date: 2020-06-25
    • words: 5594
    • flesch: 49
    • summary: It can be seen from the apparent NBH concentration-time curves that the formula (SA) showed decrease concentration of NBH to about 66.5 % at 2 hours compared to conventional SNE formula (A), which maintained NBH concentration above 90% along the experimental period. Consequently, drug precipitation may occur and ultimately leading to a decrease in drug absorption.
    • keywords: 0.1n; absorption; analysis; apparent; aqueous; baghdad; bioavailability; clear; cm-1; components; concentration; conventional; cremophor; crystal; cumulative; delivery; development; different; dispersion; dissolution; droplet; drug; emulsifying; enhancement; evaluation; figure; flux; formula; formulations; germany; glycol; hcl; high; hpmc; improved; international; intestinal; iraqi; journal; k100; liquid; loaded; low; medium; min; mixture; nanoemulsion; nbh; nebivolol; non; oral; peaks; permeability; permeation; pharm; pharmaceutical; pharmacy; polymers; powder; precipitation; preparation; prepared; profile; propylene; pure; pvp; results; sac; samples; sas1; sci; science; selected; self; selfnanoemulsion; significant; size; sne; snedds; soluplus; state; stretching; study; supersaturable; supersaturable self; supersaturated; surface; surfactant; suspension; system; table; time; vehicle; vivo; vol.29(1; التكون; النيبيفولول; على
    • versions: original; plain text
11. bijps-1040
    • author: M.Raoof, Zana; F. Dizaye, Kawa
    • title: Diuretic Effect of Prosopis farcta in Comparison with Spironolactone and Hydrochlorothiazide in Hypertensive Rats
    • date: 2020-06-25
    • words: 5283
    • flesch: 55
    • summary: Effects of different doses of P. farcta fruit extract, spironolactone (5mg/kg) and hydrochlorothiazide(20mg/kg) on serum electrolytes, serum urea and creatinine concentration in hypertensive rats( n=36) Parameters Hypertensiv e rats (B1) 25 mg/Kg P.f.f.e. Diuretic efficacy of Prosopis farcta in hypertensive rats 234 Conclusion In this animal study we demonstrated that P. farcta fruit extract has mild diuretic activity in normal rats and without significant blood pressure reduction that resemble the potassium sparing diuretics.
    • keywords: 50mg; 5mg; activity; animal; blood; cardiovascular; chronic; comparison; concentration; control; creatinine; decoction; diastolic; different; distal; diuretic; doses; effects; efficacy; egfr; electrolytes; excretion; experiment; extract; farcta; farcta fruit; flow; fructose; fruit; fruit decoction; fruit extract; glomerular; group; hct; heart; hours; hydrochlorothiazide; hypertensive; hypertensive rats; increase; iraqi; journal; mean; mechanisms; mmhg; normal; normotensive; oral; p. farcta; p.f.f.e; parameters; pharm; potassium; pressure; prosopis; prosopis farcta; rate; rats; reduction; renal; result; sci; sem; serum; significant; sodium; spironolactone; spl; study; systolic; table; urea; urine; values; vol.29(1; weeks; الدم; الينبوت
    • versions: original; plain text
12. bijps-1045
    • author: Basher, Taha A.; J. Al-Akkam, Entidhar
    • title: Formulation and In-vitro Evaluation of Itraconazole Floating Microparticles
    • date: 2020-06-25
    • words: 5368
    • flesch: 59
    • summary: Table 1.Composition of ITZ floating microparticles (pH-Dependent) Ingredient Formula no. Itraconazole floating microparticles 237 نتج عنه نسبه اطالق ألنهصيغه كأفضل( 7) الصيغةأوالً ، تم إعداد الجسيمات الدقيقة العائمة المعتمدة على الرقم الهيدروجيني ،وتم اختيار المستقلة العائمة االتروكانازول جسيماتحضير ، ت (%86ساعه مقبول )
    • keywords: .05; 0.1n; 15cps; acid; amorphous; bioavailability; bouncy; buffer; cent; coat; coating; concentration; content; crystalline; dcm; dependent; determination; different; dissolution; drug; dsc; dual; efficiency; entrapment; ethanol; evaluation; evaporation; f16; figure; formula; formulation; ftir; hcl; higher; hour; hpmc; hpmc15; hpmc15cps; increase; iraqi; itraconazole; itz; journal; loading; ltd; method; microparticles; nanosuspension; oil; oils; oral; percent; pharm; pharmaceutical; phosphate; physical; polymer; preparation; prepared; profile; pure; range; rate; release; results; safflower; scanning; sci; selected; sfo; size; solubility; solvent; spectrum; studies; temperature; test; time; vegetable; vol.29(1; water; weight; xrd; yield; الجسيمات; الدقيقة; العائمة; خالل; على
    • versions: original; plain text
13. bijps-1050
    • author: Alwan, Mustafa H.; N. Hamad, Maha
    • title: Phytochemical Investigation of the Aerial Part of Iraqi Convolvulus arvensis
    • date: 2020-12-27
    • words: 3070
    • flesch: 52
    • summary: Mass spectrum of rutin in ethyl acetate fraction (23) Conclusion The phytochemical investigation of the Iraqi plant revealed the presence of stigma-sterol in hexane fraction and rutin in the ethyl acetate fraction of Convolvulus arvensis aerial part of the plant. Table 3: Phytochemical analysis of the aerial parts of Convolvulus arvensis extract.
    • keywords: acetate; acetate fraction; acid; aerial; analysis; anti; arvensis; baghdad; chloroform; chromatography; convolvulus; convolvulus arvensis; effects; ethyl; ethyl acetate; extract; figure; flavonoids; formic; fraction; hexane; hexane fraction; hptlc; investigation; iraqi; isolated; isolation; journal; layer; liquid; mass; methanol; mobile; mobile phase; parts; pharm; pharmaceutical; phase; phenols; phytochemical; plant; preparative; presence; reagent; rutin; sci; sitosterol; species; standard; steroids; sterol; stigma; stigmasterol; test; thin; tlc; vol.29(2; water; جزء
    • versions: original; plain text
14. bijps-1051
    • author: Alsaad, Shahad A.; Kathem, Sarmed H.
    • title: Evaluation of the Possible Immuno-Protective Effect of Nigella Sativa Seed Oil on Cyclophosphamide- Induced Myelosuppression in Mice
    • date: 2020-06-25
    • words: 4438
    • flesch: 53
    • summary: Nigella sativa seed oil, a well-known plant extract that widely used for various health conditions. This study aims to evaluate the myeloprotective activity of Nigella sativa seed oil in cyclophosphamide-induced myelosuppression mice model.
    • keywords: 1ml; 2ml; animals; baghdad; blood; body; bone; bone marrow; cancer; cells; chemotherapy; control; count; cyclophosphamide; cyclophosphamideinduced; data; day; days; different; dose; drugs; effect; experimental; figure; function; group; health; hematopoietic; iii; immuno; immunomodulatory; improvement; increase; induced; intraperitoneal; iraqi; leukocyte; marrow; marrow cells; med; mice; model; myeloprotective; myelosuppression; negative; nigella; nigella sativa; normal; oil; p<0.05; pharm; protective; reduction; results; sativa; sativa seed; sci; seed; seed oil; significant; single; stem; study; table; test; therapy; thymoquinone; total; treatment; viability; viable; vol.29(1; weight; white; البركة; الدم; العظم; الى; بذور; تثبيط; حبة; خاليا; زيت; على; كغم; نخاع
    • versions: original; plain text
15. bijps-1055
    • author: Hasan, Angham A.; Abd alrazak, Munaf H.; M. Abbas Al-Temimi, Hassan
    • title: Evaluation the Risk Factors that are Associated with Osteoporosis in Post Kidney Transplantation in a Sample of Iraqi Patients
    • date: 2020-12-27
    • words: 4411
    • flesch: 61
    • summary: In conclusion , Osteoporosis in post-renal transplant patients is high when compared to general population, only corticosteroids significantly increase risk of osteoporosis, biochemical marker serum level in post kidney transplant patients are significantly different when compared with the general population but did not increase risk of osteoporosis and Body mass index is a risk factor for both lumbar and hip bones osteoporosis ,while gender and serum calcium are risk factors for osteoporosis in lumbar and hip ;respectively. The follow up of kidney transplant patients was made by specialist's surgeon.
    • keywords: age; analysis; assessment; baghdad; bmi; bone; calcium; changes; clinical; control; current; cyclosporine; density; difference; et al; factors; gender; general; group; hip; hip bone; increase; iraqi; journal; kidney; kidney transplant; kidney transplantation; logistic; loss; lower; lumbar; mass; mean; mmf; nephrology; normal; osteopenia; osteoporosis; patients; pharm; population; post; post kidney; present; prevalence; recipients; regression; relationship; renal; risk; sci; score; serum; significant; sirolimus; study; subjects; table; tacrolimus; therapy; transplant; transplant patients; transplantation; treatment; value; variables; vol.29(2; years; االشخاص; الجسم; العظام; الفقرات; القطنية; الكلى; الورك; عملية; كتلة; مرضى; هشاشة
    • versions: original; plain text
16. bijps-1056
    • author: Abbood, Zainab A.; Ali, Shatha H.; Sheaheed, Nawfal M.
    • title: CYP2D6 Genotype in Relation to Liver Toxicity Due to Tetrabenazine in Iraqi Patients with Hyperkinetic Movement Disorders
    • date: 2020-12-27
    • words: 3725
    • flesch: 57
    • summary: Forward 5’ TGTCCAGAGGAGCCCATTT 3’ Reverse 5’GTCGAAGCAGTATGGTGTGTTCT 3’ Measure plasma level of tetrabenazine by HPLC About (20 µ1) of patient plasma was injected into the liquid chromatographic system consisting of a Cl8 µ Bondapak column and fluorescence detector. In this study, highly significant elevations of liver enzymes in the patients compared to pretreatment, indicating hepatotoxicity.. A positive non-significant correlation between tetrabenazine plasma concentrations and ALP in both chorea and dystonia were observed , while it was significantly correlated with ALT and AST in both chorea and dystonia.
    • keywords: 2d6; activity; allele; alpha; alt; ast; baghdad; beta; chorea; clinical; college; concentration; correlation; cyp; cyp2d6; data; difference; dihydrotetrabenazine; disease; disorders; distribution; drug; dtbz; dystonia; effects; enzyme; figure; function; gene; genotyping; group; huntington; hyperkinetic; increase; iraqi; jankovic; journal; liver; metabolizers; method; months; movement; non; patients; pcr; pharm; pharmacy; plasma; plasma concentration; polymorphism; pretreatment; related; results; sci; serum; significant; study; subgroup; system; table; tetrabenazine; transaminase; treatment; tsb; value; vol.29(2; الكبد; بغداد
    • versions: original; plain text
17. bijps-1060
    • author: Thomas, Lena M.; Khasraghi, Abeer H.
    • title: Nanotechnology-Based Topical Drug Delivery Systems for Management of Dandruff and Seborrheic Dermatitis: An overview
    • date: 2020-06-21
    • words: 10870
    • flesch: 51
    • summary: World J Pharm Pharm Sci. 2007;1(1):238–49. World J Pharm Pharm Sci. 2015;4:1246–58.
    • keywords: acid; activity; adv; advantages; agents; antidandruff; antifungal; application; approach; aqueous; assessment; benefits; benzoyl; betamethasone; better; bioavailability; butenafine; capacity; carriers; characterization; chem; ciclopirox; clinical; clobetasol; clotrimazole; colloidal; commercial; common; comparative; control; conventional; corticosteroids; cream; curr; cutaneous; dandruff; delivery; delivery system; dermatitis; dermatol; design; development; different; diseases; dispersion; dosage; drug; drug delivery; drug release; effective; effects; efficacy; efficiency; enhanced; ethosomes; eur; eur j; evaluation; factors; fluconazole; formulation; furfur; gel; gels; gupta; hcl; higher; hydrochloride; hydrocortisone; hydrogel; hydrophilic; improved; incorporation; increase; infection; inflammatory; int j; iraqi; iraqi j; j drug; j pharm; keratolytic; ketoconazole; limited; lipid; lipid nanoparticles; lipophilic; liposomal; liposomes; loaded; loading; long; malassezia; metallic; micelles; miconazole; microemulsion; naftifine; nanocarriers; nanoemulsions; nanomedicine; nanoparticles; nanostructured; nanotechnology; nanotechnology role; niosomal; niosomes; nitrate; nlc; nlcs; novel; oil; ointment; olamine; patel; penetration; permeation; peroxide; pharm pharm; pharm res; pharm sci; pharmaceutical; polymeric; poorly; potential; preparation; prepared; production; properties; propionate; recent; references; release; res; res j; review; role; salicylic; scalp; sci; seborrheic; selenium; sertaconazole; shampoo; silver; singh; site; size; skin; skin delivery; sln; slns; solid; solubility; soluble; solution; stability; studies; study; suitable; sulfur; summary; surfactant; sustained; synthesis; system; table; tacrolimus; targeted; targeting; terbinafine; therapeutic; therapy; times; topical; topical delivery; topical drug; transdermal; transdermal delivery; transferosomes; treatment; use; variety; vesicles; vesicular; vivo; vol.29(1; water; yadav; zinc
    • versions: original; plain text
18. bijps-1063
    • author: Abdul-Wahab, Farah K.; Al-Shawi, Nada N
    • title: Effects of Vitamin D3 on Methotrexate- Induced Jejunum Damage in Rats
    • date: 2020-06-25
    • words: 5080
    • flesch: 47
    • summary: control 1,control 2 (I.P normal saline) daily for 14 and 21 days respectively ; (Group III and Group IV) :vitamin D3 groups (500 IU/rat/day) orally for 14 and 21 days, respectively;(Gro up V): a single dose of methotrexate 20mg/kg, I.P injected for 4 days;(Group VI):vitamin D3 (500 IU/rat/day) single for 14 days and methotrexate (20 mg/kg I.P) injected only at day 10;.(Group VII) vitamin D3 (500 IU/rat/day) orally for 21 days and methotrexate (20 mg/kg I.P) injected only at day 17; then the jejunum was removed and used for measuring malondialdehyde (MDA) content, total antioxidant capacity (TAOC) level; in addition histopathological study of jejunum tissue. Iraqi J Pharm Sci, Vol.29(1) 2020 Vitamin D3 on methotrexate induced jejunum damage DOI: https://doi.org/10.31351/vol29iss1pp260-267 260 Effects of Vitamin D3 on Methotrexate- Induced Jejunum Damage in Rats Farah K. Abdul-Wahab *, 1 and Nada N. Al-Shawi * *Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract Both methotrexate and vitamin D3 are used in combination for the treatment of various diseases.
    • keywords: abscess; antioxidant; atrophy; baghdad; cancer; capacity; cells; college; content; control; crypt; damage; days; degree; depletion; different; dose; effects; epithelial; exp; experimental; figure; fusion; goblet; goblet cells; group; group iii; group v; heavy; histopathological; homogenate; i.p; iii; induced; inflammation; inflammatory; inflammatory cells; injury; intestinal; iraqi; jejunum; jejunum damage; jejunum tissue; lamina; level; mda; med; metabolism; methotrexate; methotrexateinduced; mild; mixed; moderate; mtx; normal; oxidative; p<0.05; pharm; propria; protective; ratio; rats; role; sci; severe; significant; single; small; stress; studies; study; taoc; tissue; total; toxicity; treatment; university; vii; villi; villous; vitamin; vitamin d3; vol.29(1; widening
    • versions: original; plain text
19. bijps-1065
    • author: Hameed, Ahmed M.; J. Kadhim, Dheyaa; M. Younus, Manal
    • title: Analysis of Docetaxel Adverse Drug Reactions: A Retrospective Study Based on Iraqi Pharmacovigilance Center Database
    • date: 2020-12-27
    • words: 4570
    • flesch: 53
    • summary: Analysis of docetaxel adverse drug reactions 18 As defined by WHO, the ADR is “any noxious or unintended response to a drug, which occurs at doses normally used in man for prophylaxis, diagnosis or therapy of disease, or for modification of physiological function”(4). Iraqi J Pharm Sci, Vol.29(2) 2020 Analysis of docetaxel adverse drug reactions 19 Table 1.
    • keywords: abnormality; administration; adrs; adverse; adverse drug; age; analysis; assessment; available; baghdad; cancer; care; case; category; causality; center; certain; characteristics; classification; combination; criteria; data; disease; disorders; distribution; docetaxel; drug; drug reactions; effects; expectedness; gastrointestinal; group; health; icsr; individual; iraqi; laboratory; level; missing; non; number; outcome; pain; patient; pharmacovigilance; pharmacy; possible; preferred; preventability; preventable; process; reactions; reported; reports; respiratory; safety; sci; seriousness; severity; site; skin; smpc; study; system; table; term; test; time; tissue; treatment; vol.29(2; التفاعالت; الدوائية; الضارة
    • versions: original; plain text
20. bijps-1066
    • author: Noor, Amjed H; M. Ghareeb, Mowafaq
    • title: Formulation and Evaluation of Ondansetron HCl Nanoparticles for Transdermal Delivery
    • date: 2020-12-27
    • words: 4927
    • flesch: 59
    • summary: The controlled drug release aimed for transdermal drug delivery could be obtained by using eudragit RS100 and eudragit RL100 polymers which can reduce dosing frequency, decrease side effects and improve patient compliance. Development in physical permeation- enhancement technologies has led to renewed interest in transdermal drug delivery.
    • keywords: analysis; aqueous; baghdad; characterization; cm-1; delivery; development; drug; drug delivery; drug release; dsc; effect; efficiency; entrapment; eudragit; evaluation; figure; flux; formulas; formulation; ftir; germany; hcl; international; iraqi; journal; loaded; mean; measurements; method; mixture; nanoparticles; nanoprecipitation; ond; ond nanoparticles; ondansetron; organic; patient; peaks; penetration; permeability; permeation; pharm; pharmaceutical; pharmacy; physical; polymer; potential; preparation; prepared; profile; pure; pva; receptor; release; research; results; rs100; samples; sci; sciences; selected; sem; size; skin; solution; spectra; stretching; study; surface; system; table; time; transdermal; transdermal drug; triplicate; values; vivo; vol.29(2; water; zeta; الغاني; تتتة; تتتد; تتتر; متتتتت
    • versions: original; plain text
21. bijps-1076
    • author: Ajeel, Zaineb H.; N. Hamad, Maha
    • title: Detection and isolation of flavonoid and aromatic acid from Cynara scolymus different parts cultivated in iraq
    • date: 2020-12-30
    • words: 3745
    • flesch: 52
    • summary: Flow rate 3ml/min. Isolation of flavonoids and aromatic acid from ethyl acetate fraction from the capsule of plant -Isolation of flavonoids were done by preparative layer chromatography (PLC), from the ethyl acetate fraction of Cynara scolymus capsule the conditions of isolation show in table 2 Table 2. Iraqi J Pharm Sci, Vol.29(2) 2020 Flavonoids and aromatic acid from head(capsule) of Cynara scolymus 206 Analysis of ethyl acetate fraction by high- performance liquid chromatography (HPLC)
    • keywords: a4(1; a6(3; acetate; acetate fraction; acid; analysis; apigenin; aromatic; aromatic acid; artichoke; baghdad; capsule; chloroform; chromatography; cinnamic; cinnamic acid; color; compounds; conditions; cynara; cynara scolymus; detection; ethyl; ethyl acetate; figure; flavonoids; fraction; globe; head(capsule; health; high; hplc; iraqi; isolated; isolation; journal; layer; liquid; luteolin; medicinal; medicine; methanol; min; molecular; performance; pharm; pharmaceutical; phase; phytochemical; plant; preparative; presence; research; results; sample; sci; sciences; scolymus; screening; solvent; standard; study; table; test; thin; traditional; vol.29(2; weight
    • versions: original; plain text
22. bijps-1077
    • author: Salman, Ali S.; S.Saleh, Eman; S.Abass, Mohammed
    • title: Estimation of Beta Two Microglobulins, Fetuin-A, Resistin Serum Level in Iraqi Multiple Myeloma Patients
    • date: 2020-12-27
    • words: 4952
    • flesch: 57
    • summary: Fetuin-A, resistin serum level in Iraqi multiple myeloma patients 81 Beta2 microglobulin is a polypeptide presented in the serum its origin is the cell membrane of all nucleated cell in which found in tight junction with major histocompatibility complex 1(MHC1) Fetuin-A, resistin serum level in Iraqi multiple myeloma patients 82 substrate solution is added to the wells and color develops in proportion to the amount of Fetuin Abound in the initial step.
    • keywords: action; age; antibody; artery; baghdad; biomolecules; blood; bone; calcification; cancer; cell; clinical; color; common; control; coronary; correlation; cytokine; determined; development; diabetes; difference; disease; et.al; factor; fetuin; formation; group; high; human; il-6; important; increase; inflammatory; insulin; international; iraqi; journal; kit; level; mean; microglobulin; multiple; multiple myeloma; myeloma; myeloma patients; obesity; osteoporosis; pain; patients; pc=; pharm; present; process; protein; research; resistance; resistin; resistin serum; result; role; sci; science; secretion; serum; serum level; significance; specific; study; table; tissue; tumor; turn; type; unbound; use; value; vol.29(2; wells
    • versions: original; plain text
23. bijps-1086
    • author: Jasim, Ihsan K.; N. Abd Alhammid, Shaimaa; A. Abdulrasool, Alaa
    • title: Synthesis and evaluation of B-cyclodextrin Based Nanosponges of 5- Fluorouracil by Using Ultrasound Assisted Method
    • date: 2020-12-27
    • words: 5158
    • flesch: 60
    • summary: The overall results suggest that cyclodextrin nanosponges could be a promising 5-FU delivery system utilizing the suitable formula. Shringirishi M, Mahor A, Gupta R, Prajapati SK, Bansal K, Kesharwani P. Fabrication and characterization of nifedipine loaded β- cyclodextrin nanosponges:
    • keywords: afm; analysis; assisted; baghdad; cancer; carbonate; cavalli; cells; characterization; cm-1; complex; complexation; concentration; cross; cyclodextrin; delivery; diagram; different; dissolution; distilled; dpc; drug; effect; efficiency; encapsulation; entrapment; evaluation; figure; fluorouracil; formula; ftir; funs; germany; hcl; higher; inclusion; index; iraqi; journal; kst; linked; linking; lower; mean; min; molar; molecules; nanoparticles; nanosized; nanosponges; parent; particle; pharm; pharmaceutical; pharmacy; phase; physicochemical; polydispersity; potential; preparation; prepared; production; rate; ratio; region; release; results; review; sci; sem; size; slope; solubility; stability; studies; study; supernatant; surface; table; trotta; ultrasound; values; vol.29(2; water; yield; zeta; βcd; اإلسفنجية; الجسيمات; الدواء
    • versions: original; plain text
24. bijps-1092
    • author: Qasim, Zahraa S.
    • title: The Effect of Ginkgo biloba Extracts on Candida albicans Isolated from Healthy Persons
    • date: 2020-12-29
    • words: 4545
    • flesch: 58
    • summary: The mean results of susceptibility test zone diameter indicated that Ginkgo biloba ethanol extract showed a higher zone of inhibition than aqueous as showed in (Table 4 and Figure 2 A, 2B). The susceptibility test of Ginkgo biloba extracts against C. albicans.
    • keywords: acid; activity; agar; age; albicans; alkaloids; antifungal; antioxidant; aqueous; aqueous extract; ascorbic; biloba; biloba extracts; biofilm; candida; cavity; college; color; compounds; concentration; control; different; distilled; effect; ethanol; extracts; flavonoids; formation; ginkgo; ginkgo biloba; glycosides; gram; healthy; higher; identification; inhibition; iraqi; isolates; leaves; medicinal; method; mosul; number; oral; percentage; persons; pharm; phytochemical; positive; prepared; presence; results; scavenging; sci; screening; small; solution; species; steroids; study; susceptibility; table; tannins; terpenoids; test; tube; university; vol.29(2; water; zone; البيضاء; المبيضات; فحص
    • versions: original; plain text
25. bijps-1098
    • author: Tawfeeq, Mostafa F.; Qassir, Ahlam J
    • title: Synthesis, Characterization, and Antibacterial Evaluation of New Vanillic Acid Derivatives
    • date: 2020-12-29
    • words: 5152
    • flesch: 53
    • summary: Conclusion: New oxadiazole derivatives (hydrazide and its Schiff bases), derived from vanillic acid were successfully synthesized by conventional methods. New vanillic acid derivatives as antibacterials 130 Material and Methods Chemicals supplied by hyper-chem (China) were used.
    • keywords: absolute; acid; active; activities; activity; agents; amide; amoxicillin; anti; antibacterial; antimicrobial; aureus; baghdad; band; base; biological; carbonyl; cefixime; chapter; characteristic; characterization; chemistry; cm-1; coli; college; compound; derivatives; dmso; ester; ethanol; evaluation; figure; ftir; heterocyclic; hours; https://www.researchgate.net/publication/287644704_thesis_-_synthesis%20_characterization%20_and%20_anti-inflammatory%20_evaluation%20_of%20_new%20_potentially%20_active%20_naproxen%20_hydrazones%20/link%20/%205832c41e08ae138f1c086a4b%20/download; hydrazide; hydrazones; iraqi; isoniazid; journal; m.p; medicinal; mixture; moderate; new; nh2; nitrofurantoin; novel; organic; overlapped; oxadiazole; pharm; pharmaceutical; pharmacy; phenolic; pneumoniae; powder; ppm; precipitate; presence; protons; reaction; ring; schiff; sci; spectrum; steps; stretching; stretching vibration; synthesis; university; vanillic; vibration; vibration band; vol.29(2; white; فعالية; كانت
    • versions: original; plain text
26. bijps-1107
    • author: Kareem, Ashwaq T; N. Hamad, Maha
    • title: Separation and Identification of Phenolic Acid from Borago officinalis (F:Boraginaceae) Cultivated in Iraq
    • date: 2020-12-29
    • words: 3381
    • flesch: 58
    • summary: ، كروماتوغرافيا السائل عالية االداء،حامض السنابيك,حامض الكافييك، حامض الروزماريك الكلمات المفتاحية: Introduction Borage (Borago officinalis L.) is an annual plant belonging to the family. Pieretti PG, Palmegiano GB, Salamano G. Quality and fatty acid content of borage (Borago officinalis L.) during the growth cycle.
    • keywords: acetate; acid; acid standard; active; adsorbant; analysis; baghdad; borago; borago officinalis; caffeic; chromatogram; chromatography; compound; compound number; ethyl; ethyl acetate; extract; figure; fraction; gel; gf254; gram; hplc; identification; iraqi; isolated; isolated compound; isolation; j pharm; layer; mass; match; methanol; min; mobile; molecular; number; officinalis; pharm; pharm sci; phase; phenolic; phenols; plant; preparative; results; retention; rosmarinic; sci; silica; sinapic; solvent; spectrum; standard; system; table; test; thin; time; tlc; vol.29(2; weight; كروماتوغرافيا
    • versions: original; plain text
27. bijps-1113
    • author: Ismail, Adnan M.; Saleh, Eman S
    • title: Estimation of Serum CD200 and CD200R1 Levels in a Sample of Iraqi Women with Breast Cancer: Their Role as Diagnostic and Prognostic Markers
    • date: 2020-12-30
    • words: 3886
    • flesch: 59
    • summary: *Highly significant (P<0.01) Superscripts (a,b) refer to statically significant differences The correlation between breast cancer stages and serum CD200 concentration is positive medium (r = 0.545), as breast cancer stage progresses, the level of CD200 increases and this correlation becomes significant (P=0.00002) Table (2). Six groups were enrolled, four groups were confirmed with breast cancer stage (I, II, III and IV), fifth group (benign) and sixth group was control (healthy individual).
    • keywords: analysis; antibody; assay; baghdad; benign; breast; breast cancer; buffer; cancer; cd200; cd200r1; cell; classification; clin; concentration; control; correlation; curve; diagnostic; different; dilution; disease; elisa; enzyme; expression; factor; glycoprotein; group; healthy; high; invasive; iraqi; level; ligand; lung; marker; metastasis; molecular; myeloid; neuroendocrine; new; non; number; patients; pharm; prognostic; progression; receptor; results; role; samples; sci; sensitivity; serum; serum cd200; serum level; significant; solution; specificity; stage; standard; study; surface; table; tube; tumor; value; vol.29(2; women; الثدي; الـ; المجموعة; مستويات; هذه
    • versions: original; plain text
28. bijps-1114
    • author: M. Mohammed, Thamer; H. Mutlag, Shihab; A.Shihab, Bahaa
    • title: Evaluation of the Effect of Topical Artemisia dracunculus Administration on Serum Levels of Selected Interleukins and Spleen Index in Imiquimod-Induced Psoriasis in Male Mice Compared to Clobetasol Propionate (Dermovate (R)) Ointment
    • date: 2020-12-30
    • words: 5098
    • flesch: 62
    • summary: All the results showed that A. dracunculus ameliorates psoriasis induced by imiquimod in male mice Keywords: Psoriasis, Artemisia dracunculus, Imiquimod 5%, IL-23, IL-17. Previous data showed that psoriasis incidence varied depending on age and geographic location, being more prevalent in countries more distant from the equator.(30) The statistical calculation of PASI score indicated that the prepared ointment of A. dracunculus significantly (P<0.05) ameliorates the psoriasis-like skin inflammation in Group IV mice received topical A. dracunculus ointment 1hr before 5% IMQ in comparison with the (vehicle ointment + 5% IMQ) (Group III) as shown in table 1 and Figure 1. Previous studies concerning A. Dracunculus indicate pharmacological properties of this plant, including anti-inflammatory, antibacterial, antidiabetic and antioxidant properties.
    • keywords: application; area; artemisia; artemisia dracunculus; baghdad; cells; clobetasol; comparison; consecutive; control group; cytokines; daily; days; dendritic; dermovate; deviation; different; dorsal; dose; dracunculus; dracunculus ointment; ear; effect; experimental; extract; figure; group; group iii; group iv; il-17; il-23; imiquimod; immune; imq; index; inflammation; inflammatory; iraqi; levels; like; male; mean; measured; mice; ointment; pasi; pharm; plant; propionate; psoriasis; psoriatic; p≤0.05; reduction; respect; results; right; sci; score; serum; severity; significant; skin; spleen; standard; study; table; tarragon; thickness; topical; value; vehicle; vehicle ointment; vol.29(2; الصدفية; الطرخوني; على; مرهم
    • versions: original; plain text
29. bijps-1117
    • author: Abdulhamza, Hayder M.; S. Farhan, Muthanna
    • title: Synthesis, Characterization and Preliminary Anti-inflammatory Evaluation of New Fenoprofen Hydrazone Derivatives
    • date: 2020-12-30
    • words: 3219
    • flesch: 61
    • summary: Chemical structure of Fenoprofen 1Corresponding author E-mail: hyder_muhy@yahoo.com Received: 20/ 2/2020 Accepted: 9/8 /2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol29iss2pp239-244 Iraqi J Pharm Sci, Vol.29(2) 2020 Synthesis of Fenoprofen hydrazones with anti-inflammatory effect 240 Iraqi J Pharm Sci, Vol.29(2) 2020 Synthesis of Fenoprofen hydrazones with anti-inflammatory effect 241 (H2) N'-(4-Nitrobenzylidene)-2-(3 phenoxy phenyl)
    • keywords: acid; activity; analgesic; anti; baghdad; ch3; characterization; chemistry; cm-1; college; compounds; control; derivatives; different; drug; edema; effect; egg; ethanol; evaluation; fenoprofen; gastrointestinal; group; hydrazones; inflammatory; iraqi; journal; new; nmr; non; nsaids; paw; pharmaceutical; pharmacy; propanehydrazide; rats; reaction; sci; sciences; solution; solvent; spectroscopy; standard; steroidal; str; sym; synthesis; synthesized; target; time; university; vol.29(2; white; yield
    • versions: original; plain text
30. bijps-1122
    • author: Hussein, Asmaa M.; Kadum, Enas J.
    • title: Identification and Isolation of Caffeic, Chlorogenic and Ferulic Acids in Aerial Parts of Capparis spinosa wildly grown in Iraq
    • date: 2020-12-30
    • words: 3471
    • flesch: 58
    • summary: plates for standards and sample phenolic acids in E2, E3 and E5 at 254nm (above) and 366nm (below). Retention times of the standard phenolic acids and the concentration of sample phenolic acids at standard retention time.
    • keywords: absolute; acetate; acetone; acids; aerial; analysis; antioxidant; baghdad; berries; buds; caffeic; caffeic acid; caper; capparis; chloroform; chlorogenic; chlorogenic acid; chromatographic; cpl; ethyl; extract; ferulic; ferulic acid; figure; food; formic; fraction; hptlc; identification; iraqi; isolated; journal; layer; medicinal; methanol; mobile; parts; pharm; phase; phenolic; phenolic acids; plant; plates; polyphemolic; presence; present; reported; results; retention; sample; sci; spinosa; spots; standard; standard phenolic; table; techniques; time; tlc; uses; values; vol.29(2; water; وجود
    • versions: original; plain text
31. bijps-1125
    • author: H. Abdulridha, Sarah; J. Kadhim, Dheyaa; A. Abdul Razzak, Sarmad
    • title: Assessment of Quality of Life in a Sample of Iraqi Patients with Psoriasis.
    • date: 2020-12-30
    • words: 4895
    • flesch: 66
    • summary: This study is a cross-sectional study that involved 300 already diagnosed psoriasis patients who attended to the center of Dermatology and Venereology, Medical City/Baghdad. Additionally, psoriasis disease prevented about one-quarter of the patients from going to work or studying (23%) and caused work/study problems for another third (34.7%) of the participants.
    • keywords: acad; activities; activity; age; area; arthritis; association; baghdad; biologics; body; bsa; center; characteristics; chronic; city; clinical; cross; current; daily; dermatology; dermatology life; development; disease; dlqi; dlqi score; effect; et al; feelings; figure; health; higher; impact; income; index; int; iraqi; life; life quality; mean; med; medical; monthly; negative; non; participants; pasi; patients; personal; pharm; plaque; psoriasis; psoriatic; qol; quality; questions; related; relationships; results; sample; school; sci; score; sectional; severe; severity; significant; skin; social; sociodemographic; study; symptoms; systemic; table; topical; total; treatment; type; value; van; variables; venereology; vol.29(2; vulgaris; work; years; الجلدية; الحياة; الصدفية; المرضى; جودة; على
    • versions: original; plain text
32. bijps-1127
    • author: R. Abdulbaqi, Mustafa; A.Rajab, Nawal
    • title: Preparation, Characterization and Ex vivo Permeability Study of Transdermal Apixaban O/W Nanoemulsion Based Gel
    • date: 2020-12-30
    • words: 5159
    • flesch: 56
    • summary: Franz cell - Ex vivo permeation study through human skin The use of abdominal skin of adult human female was reviewed and approved by ethical committee of Baghdad University / College of Pharmacy for its application in the ex vivo permeation study experiment for pure APX gel and ultrafine APX-NE based gel. Then, samples of 5 g APX-NE gel and pure APX gel placed above the skin in the donor part of Franz cell for permeation evaluation(20).
    • keywords: abdominal; analysis; apixaban; application; apx; apx gel; baghdad; carbitol; carbopol; characterization; chemical; conductivity; content; corneum; delivery; development; droplet; drug; electrical; epidermis; evaluation; f-12; female; figure; formulation; ftir; gel; high; higher; human; iraqi; journal; layer; light; low; microemulsion; nanoemulsion; ne gel; oil; pdi; penetration; permeability; permeation; pharm; pharmaceutical; pharmacy; phase; physical; preparation; prepared; properties; pure; pure apx; research; results; samples; scattering; sci; sciences; significant; size; skin; smix; solution; stability; stratum; structure; studies; study; surfactant; system; table; thermodynamic; time; topical; transdermal; transmittance; triacetin; triton; ultrafine; usa; use; values; vivo; vol.29(2; water; x-100; xrd; االبكسابان; النفاذية
    • versions: original; plain text
33. bijps-1134
    • author: Kareem, Akram H; J. Kadhim, Dheyaa
    • title: Health-Related Quality of Life in a Sample of Chronic Obstructive Pulmonary Disease Patients in AL-Diwanyia Province /Iraq.
    • date: 2020-12-30
    • words: 4597
    • flesch: 67
    • summary: Iraqi J Pharm Sci, Vol.29(2) 2020 Quality of life in chronic obstructive pulmonary disease patients 172 Results of HRQOL parameters of COPD patients enrolled in the current study are shown in Table 3. Patients The current cross-sectional study involved 150 already diagnosed COPD patients who attended to the Center of Respiratory Diseases/AL- Diwaniyah Teaching Hospital during September 2019 to January 2020.
    • keywords: activity; admission; age; analysis; baghdad; bmi; care; characteristics; chronic; chronic obstructive; copd; copd patients; current; current study; disease; disease patients; duration; factors; ferrer; fev1; function; fvc; gender; general; george; gold; health; hospital; hrqol; impact; int; iraqi; level; life; lower; lung; male; mean; med; min.-max; number; obstructive; obstructive pulmonary; patients; pharm; protocol; pulmonary; pulmonary disease; quality; questionnaire; range; respiratory; results; sci; score; severity; sgrq; significant; smoking; social; specific; status; studies; study; symptoms; table; total; treatment; university; variables; vol.29(2; years; ±sd; االنسداد; الحياة; الرئوي; الصحية; المزمن; جودة
    • versions: original; plain text
34. bijps-1139
    • author: Amin Huseen, Narmin H.
    • title: Docking Study of Naringin Binding with COVID-19 Main Protease Enzyme
    • date: 2020-12-30
    • words: 4015
    • flesch: 63
    • summary: Results showed that naringin interacted with COVID-19 main protease, and it has the highest binding affinity than other flavonoids include quercetin, hesperetin, and naringenin. Keywords: COVID-19 main protease, Flavonoids, Naringin, Molecular docking, Protease inhibitor.
    • keywords: acceptor; acids; affinity; amino; antiviral; autodock; binding; bond; calculated; clogp; compounds; coronavirus; covid-19; covid-19 main; data; discovery; docking; doi; drugs; energy; enzyme; figure; flavonoids; group; hesperetin; https; human; hydrogen; hydroxyl; indinavir; inhibitors; interaction; iraqi; journal; kcal; length; ligand; like; lipinski; lopinavir; low; main; main protease; molecular; mpro; naringin; nature; novel; number; pdb; pharm; pocket; potential; protease; protein; quercetin; receptor; respiratory; rule; sars; sci; score; severe; structure; studies; study; syndrome; table; vina; vol.29(2; yang; yes
    • versions: original; plain text
35. bijps-1141
    • author: Al-Shimmran, Ban A.; M. Anwer, Zinah; H. Al-Jarrah, Bassam
    • title: Levothyroxine Therapy Adequacy, Dose Estimation and Vitamin D Effect Assessment in a Sample of Iraqi Female Patients with Different Causes of Hypothyroidism
    • date: 2020-12-30
    • words: 5134
    • flesch: 61
    • summary: LT4 dose was adjusted by physicians empirically. While controlling for LT4 dose, the resulted TSH difference was significant without affecting thyroid hormones (Table 6).
    • keywords: age; anova; available; baghdad; bmi; body; calcium; causes; clinical; correlation; data; day; disease; dose; duration; effect; endocrinol; euthyroid; factors; female; figure; follow; function; group; health; higher; hormone; hypothyroidism; index; information; internet; iodine; iraqi; level; levothyroxine; lt4; lt4 dose; mass; mcg; mean; med; model; months; multifactorial; nmol; optimizaion; patients; pharm; post; presence; primary; radioactive; rai; range; replacement; results; sample; sci; serum; significant; status; study; supplementation; supplements; surgery; table; tests; thyroid; thyroidectomy; time; total; treatment; tsh; tt3; tt4; value; vitamin; vol.29(2; weight; µiu; الدرقية; الغدة; بغداد; فيتامين; مكمالت
    • versions: original; plain text
36. bijps-1151
    • author: Saihood, Ahmed H.; Hasan, Ali F.
    • title: Assessment of the Clinical Pharmacists' Role by Physicians at Baghdad Hospitals
    • date: 2020-12-30
    • words: 4473
    • flesch: 49
    • summary: Keywords: Physician, Clinical pharmacist, Baghdad, Assessment, Services. Calculating doses and monitoring medication blood levels are also among the services provided by clinical pharmacists.
    • keywords: appreciative; assessment; average; average score; baghdad; care; city; classification; clinical; clinical pharmacist; consistency; consultation; correlation; data; demographic; drug; findings; governmental; health; hospital; information; internal; interpretation; iraqi; junior; medical; medications; necessary; participants; patient; pharmacist; pharmacy; physicians; point; positive; practice; professional; program; questionnaire; recommendations; reliability; responses; results; role; sample; sci; score; senior; services; similar; statement; study; table; teaching; test; university; view; vol.29(2; wards; years; األطبّاء; بغداد
    • versions: original; plain text
37. bijps-1155
    • author: Talib, Aya F.; M.Anwer, Zinah
    • title: The Role of Clinical Pharmacist in Reducing Drug Related Problems in Hemodialysis Patients
    • date: 2020-12-30
    • words: 4078
    • flesch: 51
    • summary: Prospective, interventional, clinical study for 180 hemodialysis patients, and was designed as two phases, an observational phase to identify drug related problems and classifying them according to the latest Pharmaceutical Care Network Europe classification, and an interventional phase to increase the awareness of patients and the nephrologists about those problems and proposing a proper solution for each one. There were significant numbers of drug related problems among Iraqi patients on hemodialysis, the use of erythropoietin, calcium carbonate and sevelamer was responsible for most of inappropriate combinations.
    • keywords: 0(0; acceptance; adverse; baghdad; calcium; carbonate; care; causes; chronic; ckd; classification; clinical; clinical pharmacist; combination; data; disease; dose; drps; drug; effect; end; erythropoietin; ferrous; health; hemodialysis; high; implementation; inappropriate; incomplete; indication; information; interactions; interventions; iraqi; kidney; level; low; main; medical; number; outcomes; patients; pcne; pharmaceutical; pharmacist; pharmacy; phase; physicians; prescribed; problems; proper; related; renal; results; sample; sci; sciences; sevelamer; stage; study; sulfate; symptoms; table; total; treatment; university; unknown; vol.29(2; المتعلقة; المشاكل; باالدوية
    • versions: original; plain text
38. bijps-1158
    • author: Al-Tamimi, Duaa J.; Hussein, Ahmed A.
    • title: Formulation and Characterization of Self-Microemulsifying Drug Delivery System of Tacrolimus
    • date: 2021-06-15
    • words: 4792
    • flesch: 51
    • summary: Sapra K, Sapra A, Singh SK, Kakkar S. Self emulsifying drug delivery system: A tool in solubility enhancement of poorly soluble drugs. Wu W, Wang Y, Que L. Enhanced bioavailability of silymarin by self- microemulsifying drug delivery system.
    • keywords: alf; analysis; appearance; bioavailability; calibration; centrifugation; characterization; components; concentration; content; cycles; deionized; delivery; delivery system; development; diagrams; dilution; dispersibility; dissolution; droplet; drug; drug delivery; dsc; effect; emulsification; emulsifying; evaluation; figure; formulas; formulation; hcl; index; international; iraqi; journal; labrasol; lipid; liquid; loaded; maisine; microemulsion; min; oil; oral; pass; pass pass; pdi; pharm; pharmaceutics; phase; polydispersity; prepared; profiles; pseudoternary; pure; rate; ratios; release; results; sci; self; size; smedds; smix; solubility; soluble; stability; studies; study; surfactant; system; table; tacrolimus; test; thermodynamic; time; transcutol; vol.30(1; water
    • versions: original; plain text
39. bijps-1164
    • author: Abbas, Ashwaq N.; K. Hasan, Mwafak; A. Ahmed, Muhammad
    • title: Frequency inborn error of mitochondrial function in Mosul and Kurdistan region: the Frequency inborn error of mitochondrial function in Mosul and Kurdistan region
    • date: 2020-12-30
    • words: 2364
    • flesch: 55
    • summary: This work aimed to estimate the frequency of mitochondrial inborn errors of metabolism (MIEMs) in patients presenting with family history and IEM-picture who referred for advance IEM assay in Mosul province and Kurdistan region. In conclusion, the incidence of mitochondrial inborn errors of metabolism (MIEMs) between patients presenting with IEM was higher in Mosul and Kurdistan region than international values Keywords: Mitochondria, An inborn error of metabolism, Carnitine, Mosul.
    • keywords: acyl; addition; assay; blood; c5oh; carboxylase; carnitine; cases; chain; coa; college; deficiency; dehydrogenase; disorders; dysfunction; error; frequency; function; history; iem; inborn; inborn error; incidence; iraqi; january; july; kurdistan; laboratory; lactate; med; metabolism; methylcrotonyl; mitochondrial; mosul; newborn; patients; pharm; private; pyruvate; region; sci; screening; serum; short; study; university; vol.29(2; work; الدم; الطاقة; الغذائي; الموصل; بيوت; تمثيل
    • versions: original; plain text
40. bijps-1166
    • author: Al-Obaidi, Imad A.; N. Al-Shawi, Nada
    • title: Assessment the Genotoxic Potential of Fluoxetine and Amitriptyline at Maximum Therapeutic Doses for Four-Week Treatment in Experimental Male Rats
    • date: 2021-06-15
    • words: 6364
    • flesch: 53
    • summary: Sister chromatid exchanges and sperm abnormalities produced by antidepressant drug fluoxetine in mouse treated in vivo. Abstract At any moment, the continuous usage of medications can be accompanied by DNA damage and the accumulation of such damages can cause serious consequences.
    • keywords: abnormalities; adult; amitriptyline; analysis; animals; antidepressants; anxiety; apoptosis; assay; authors; baghdad; bone; cells; chromosomal; class; clinical; comet; comet assay; control; cytogenetic; damage; data; day; depression; different; disorder; dna; dna damage; doses; drug; effects; environmental; erythrocytes; et al; evaluation; exchanges; experimental; extent; figure; findings; fluoxetine; formation; frequencies; gavage; genetic; genotoxic; genotoxicity; germ; group; health; high; human; hydrochloride; increase; induced; iraqi; journal; letters; liver; long; low; major; male; marrow; maximum; mean; medical; metabolism; mice; micronucleus; molecular; mutagenesis; mutation; negative; norfluoxetine; oxidative; p<0.05; percentage; pharm; pharmaceutical; pharmacology; polychromatic; potential; present; rats; research; results; sci; score; serotonin; significant; small; solution; sperm; stereoselective; stress; studies; study; table; tail; testicular; testis; therapeutic; tissues; total; toxicology; treatment; tube; university; values; vivo; vol.30(1; water; weeks; التي; الجرذان; السمية; النووي
    • versions: original; plain text
41. bijps-1169
    • author: Jabbar, Thair L.; A. Kasim, Ali
    • title: Association of Retinol Binding Protein- 4 (RBP4) with Glycemia, Dyslipidemia, Hypertension, and Obesity in Type 2 Diabetic Iraqi Patients
    • date: 2020-12-30
    • words: 5142
    • flesch: 62
    • summary: While, there was no significant correlation between serum RBP4 levels and age, gender, DBP, or TG, VLDL-c, and TC levels (P>0.05). Pearson’s correlations of serum RBP4 levels with the studied variables Variable r-value P-value Age 0.14 0.13 Gender -0.1 0.15 Disease duration 0.5 0.000* BMI 0.31 0.001* SBP 0.2 0.02* DBP 012 0.17 FBG 0.6 0.000* HBA1c 0.4 0.000* TC 0.17 0.06 TG 0.12 0.17 VLDL-C 0.12 0.17 LDL-C 0.25 0.008* HDL-C -0.45 0.000* Discussion In the present study, serum RBP4 has significant positive correlation with markers of glycemic control, FBG and HbA1c (table 4).
    • keywords: adipose; age; american; analysis; arterial; association; blood; bmi; body; cardiovascular; care; chinese; cholesterol; clinical; correlation; cvds; dbp; density; diabetes; diabetic; different; disease; dm patients; duration; dyslipidemia; elevated; endocrinology; et al; expression; factors; fbg; gender; glucose; hba1c; hdl; high; higher; human; hyperglycemia; hypertension; insulin; iraqi; journal; ldl; levels; lipoprotein; low; medical; mellitus; metabolism; mmhg; normolipidemic; normotensive; normoweight; obese; obesity; p<0.001; p<0.05; patients; pharm; plasma; positive; pressure; protein; rbp4; rbp4 levels; reduction; resistance; retinol; risk; sbp; sci; serum; serum rbp4; significant; stiffness; study; subjects; systolic; t2 dm; tissue; type; vldl; vol.29(2; weight; years; ارتفاع; الدم; السكري; النوع; ضغط; مرضى
    • versions: original; plain text
42. bijps-1181
    • author: H. Mhaibes, Sarah; K. Fakree, Najwan; I. Naser, Sonia
    • title: Regulation of Appetite and Satiety by Gastrointestinal Peptides
    • date: 2021-06-15
    • words: 5265
    • flesch: 59
    • summary: Table 1 explains the role of GIP in food intake control . GIP activities in food intake control (6) GIP Receptor Site of action Effects on food intake Ghrelin ghrelin receptor Vagal nerve Brain stem Hypothalamus orexigenic ↑ appetite ↑ gastric motility Nesfatin-1 Melanocortin receptor Vagal nerve Brain stem Hypothalamus Anorexigenic ↓ appetite CCK CCK1 Vagal nerve Brain stem Hypothalamus Anorexigenic ↓appetite ↑ gallbladder emptying ↓ gastric emptying Peptide YY Y2R
    • keywords: acid; action; administration; agonists; anorexigenic; appetite; arc; associated; baghdad; bloom; body; brain; bypass; cck; ccka; cells; central; cholecystokinin; clin; cns; consumption; control; decrease; diabetes; effect; emptying; endocrinol; endocrinology; energy; expenditure; food; food intake; gastric; gastrointestinal; ghrelin; gip; git; glp-1; glucagon; glucose; gut; health; homeostasis; hormones; humans; hunger; hypothalamus; inhibition; insulin; intake; iraqi; journal; leptin; levels; like; loss; major; metab; metabolism; motility; nerve; nesfatin-1; neurons; neuropeptide; nf-1; npy; nucb2; nucleus; obese; obesity; oxm; oxyntomodulin; pancreas; peptide-1; peptides; peripheral; pharm; potential; protein; pyy; pyy3; receptor; reduction; regulation; release; research; reward; role; roux; satiation; satiety; sci; secretion; signals; stimulating; surgery; system; tissue; treatment; type; tyrosine; vagal; vol.30(1; weight
    • versions: original; plain text
43. bijps-1182
    • author: N. Kamal, Ayia; Hassan, Ali F.
    • title: Comparative Study of Liver Function and Rh Blood Group between both Physiological and Pathological Neonatal Jaundice
    • date: 2021-06-15
    • words: 5763
    • flesch: 52
    • summary: The study was conducted for one hundred neonates with jaundice divided into two groups, group one includes fifty newborns with physiological jaundice, Group two includes fifty newborns with pathological jaundice. Serum bilirubin (total and direct), serum albumin concentration and the liver enzymes were significantly higher when compare between newborns and pathological jaundice with newborns of physiological jaundice (p<0.05).
    • keywords: absorbance; air; alanine; albumin; alkaline; alp; alt; aminotransferase; analysis; aspartate; ast; baghdad; bilirubin; birth; blood; cells; clinical; concentration; cord; cuvette; device; difference; direct; effect; enzymes; factors; finding; gestational; group; hemolysis; higher; hospital; hours; hyperbilirubinemia; incidence; incompatibility; infants; initial; iraqi; jaundice; level; liver; measurement; med; minute; mix; negative; neonatal; neonatal jaundice; neonates; newborns; normal; onset; pathological; pathological jaundice; patients; pediatr; pediatrics; pharm; phosphatase; physiological; pollution; positive; previous; procedure; reagent; red; reflex; relationship; risk; sample; sci; serum; serum bilirubin; significant; stage; status; study; table; test; total; type; value; vol.30(1; weeks; البيليروبين; المرضي; الوالدة; اليرقان; حديثي
    • versions: original; plain text
44. bijps-1183
    • author: Alhagiesa, Areej Wahhab; M. Ghareeb, Mowafaq
    • title: The Formulation and Characterization of Nimodipine Nanoparticles for the Enhancement of solubility and dissolution rate
    • date: 2021-12-11
    • words: 4541
    • flesch: 60
    • summary: This amphipathic nature makes it an excellent surface-active and wetting agent that reduces the interfacial tension between the hydrophobic surface of NMD particles and the aqueous antisolvent. This research aimed to prepare Nimodipine nanoparticles (NMD NPs) for the enhancement of solubility and dissolution rate.
    • keywords: antisolvent; bath; characterization; cm-1; content; different; dissolution; drug; drying; effect; enhancement; ethanol; evaluation; figure; formulas; formulation; ftir; high; hpmc; int; int j; iraqi; j pharm; k90; lyophilization; lyophilized; magnetic; mannitol; media; method; minutes; nanoparticles; nanosuspension; nimodipine; nimodipine nanoparticles; nps; particle; particle size; pdi; pharm; pharm sci; polydispersity; powder; preparation; prepared; process; pure; pvp; range; rate; res; rpm; samples; saturation; sci; size; smallest; solid; solubility; soluplus; solvent; sonicator; spectrum; ssf; stabilizer; stirrer; stretching; study; table; temperature; tpgs; vol.30(2; wang; water; الجسيمات; النانوية
    • versions: original; plain text
45. bijps-1185
    • author: Alwan, Rusul M.; A. Rajab, Nawal
    • title: Nanosuspensions of Selexipag: Formulation, Characterization, and in vitro Evaluation
    • date: 2021-06-15
    • words: 4988
    • flesch: 59
    • summary: These polymers can effectively adsorb onto drug particle surfaces that lead to steric stabilization of the system by providing a stable thermodynamic barrier surrounded the particle surface, which retarded particle growth(23,24). Their adsorption onto drug particle surface depends on physisorption; if hydrophobic- hydrophilic forces are not strong enough for surface adsorption, they cannot overcome the attractive force between two-particles that become dominant due to depletion of stabilizer between the gap of particles(25,26).
    • keywords: addition; antisolvent; baghdad; bioavailability; buffer; characterization; cm-1; combination; concentration; content; different; dissolution; drug; e15; effect; enhancement; evaluation; f15; figure; formulas; formulation; fourier; ftir; group; high; hpmc; infrared; int; iraqi; j pharm; lyophilized; method; nanoparticles; nanosuspension; oral; p.s; parameters; particle; pdi; pharm; pharm sci; pharmacy; phosphate; polymer; powder; precipitation; prepared; process; pure; pva; px-407; rate; result; rpm; saturation; sci; selexipag; similarity; size; slp; slpns; solubility; soluplus; solvent; spectroscopy; speed; stabilizer; stirrer; stirring; stretching; study; surface; system; table; type; vol.30(1; wang; water
    • versions: original; plain text
46. bijps-1187
    • author: Ismail, Parween A.; Ali, Lana M.
    • title: Alteration of Serum Immunoglobulin Levels in Woman with Ovarian Cancer
    • date: 2021-06-19
    • words: 2704
    • flesch: 50
    • summary: Results and Discussion Figures (1,2,3) shows the results of Serum Immunoglobulins (IgG, IgA, and IgM) levels in samples of control and ovarian cancer patients. This research was conducted to evaluate serum immunoglobulin levels in women with ovarian cancer and to assess their role in disease process.
    • keywords: analysis; antibody; breast; cancer; carcinoma; cell; chains; clinical; complexes; concentrations; control; detection; disease; elevate; epithelial; expression; grade; head; heavy; human; iga; igg; igm; immune; immunoglobulin; immunoglobulin levels; iraqi; levels; line; mean; neck; oral; ovarian; ovarian cancer; ovarian carcinoma; patients; pharm; present; previous; results; samples; sci; serum; serum immunoglobulin; study; system; tumor; university; vol.30(1; woman
    • versions: original; plain text
47. bijps-1188
    • author: Khalid, Marwah W.; Abd, Leaqaa; N. Abood, Ahmed
    • title: Synthesis of Mutual Prodrugs of Secnidazole and Ciprofloxacin and study Their Physicochemical Properties
    • date: 2021-06-15
    • words: 5959
    • flesch: 51
    • summary: Iraqi J Pharm Sci, Vol.30(1) 2021 Secnidazole and ciprofloxacin mutual prodrugs DOI : https://doi.org/10.31351/vol30iss1pp133-143 133 Synthesis of Mutual Prodrugs of Secnidazole and Ciprofloxacin and study Their Physicochemical Properties Marwah W. Khalid*,1, Leaqaa A. Alrubaie *, Ahmed N. Abood ** * Department of Pharmaceutical Chemistry, College of Pharmacy, University of Basrah, ,Basrah, Iraq ** Department of Pharmaceutics, College of Pharmacy, University of Basrah, Basrah ,Iraq Abstract In present work, secnidazole and ciprofloxacin were linked as mutual prodrugs to get antibiotics with broader spectrum of activity by acting on aerobic and anaerobic bacteria, improved physicochemical properties and given by single dose to enhance patient’s compliance. عمر قيم لذلك اشارت كما األمعاء من امتصاصها ليتم كافيًا ثباتًا وتنتج المعدة عبر تحلل بدون تمر قد .للميكروبات المضادة , الفعاليةالكيميائية و الخصائص الفيزيائيةمقدمات دوائية مشتركة ,, سيكنيدازول, ينسسيبروفلوكسا المفتاحية: الكلمات 1Corresponding author E-mail: marwa.wkhalid@gmail.com Received:28 / 7 /2020 Accepted: 18/ 10/2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30iss1pp133-143 Iraqi J Pharm Sci, Vol.30(1) 2021 Secnidazole and ciprofloxacin mutual prodrugs 134 Introduction In a clinical practice the treatment for anaerobic infections aims to treat a complex ecosystem of multiple bacterial species with an antibiotics regimen that provide effective activity against both anaerobic and facultative bacteria (1).
    • keywords: acid; activity; aeruginosa; agents; amine; anaerobic; anhydrous; antibacterial; antibiotics; antimicrobial; aqueous; aromatic; aureus; bacteria; basrah; buffer; chemical; chemistry; chemotherapy; chloride; chloroform; ciprofloxacin; class; cm-1; coefficient; coli; college; compound; concentration; design; different; dry; escherichia; ester; evaluation; fluoroquinolone; gastrointestinal; gram; group; hcl; higher; hydrolysis; increase; infections; intermediate; iraqi; journal; klebsiella; lipophilicity; log; mass; method; methylene; mixture; mmol; molecules; mutual; mutual prodrugs; new; novel; parent; partition; pharmaceutical; pharmacy; phase; phosphate; physical; prodrugs; product; properties; pseudomonas; reaction; resistance; scheme; sci; secnidazole; secondary; single; solubility; solution; solvent; stability; staphylococcus; stirring; stretching; structures; study; synthesis; synthesized; system; table; taste; thionyl; times; treatment; values; vol.30(1; water
    • versions: original; plain text
48. bijps-1190
    • author: NAJI, Nabigh A; Ali, Shatha H; Farhan, Fatin S.
    • title: Correlation between serum carnitine level and Soluble Receptors for Advance Glycation End Products(sRAGE) in Clomiphene Citrate Resistant- PCOS Women
    • date: 2021-06-15
    • words: 7063
    • flesch: 57
    • summary: In addition to a significant correlation between serum total carnitine and serum sRAGE levels (r=0.45, P-value=0.03). Furthermore, there is a significant (P-value <0.05) positive correlation between serum carnitine values and serum sRAGE levels (r=0.45, P- value=0.03) in patient group (Figure-3).However, no significant correlation was detected for either one with the studied sex hormones (Table -3).
    • keywords: activation; addition; advanced; advanced glycation; ages; antioxidant; baghdad; blood; bmi; body; carnitine; carnitine levels; cellular; citrate; clinical; clomiphene; clomiphene citrate; coefficient; control; control group; correlation; decrease; development; diabetes; diamanti; effects; elevated; end; end products; endocrinology; estrogen; fertility; free; fsh; function; glucose; glycation; glycation end; glycemic; group; healthy; homa; hormonal; hormone; human; hyperandrogenism; hyperglycemia; hyperinsulinemia; index; inflammation; inflammatory; insulin; insulin resistance; iraqi; jan; journal; kandarakis; levels; markers; mass; mean; mechanisms; metabolism; non; obese; obesity; ovarian; ovary; ovary syndrome; ovulation; oxidative; patients; pcos; pcos patients; pcos women; pharm; piperi; polycystic; polycystic ovary; positive; present; production; products; prolactin; reactive; receptor; reproductive; research; resistance; resistant pcos; results; role; sci; science; serum; serum carnitine; serum levels; serum srage; serum total; significant; soluble; soluble receptor; srage; srage levels; status; stress; studies; study; syndrome; testosterone; total; total carnitine; treatment; value; vol.30(1; weight; women; إلى; األنسولين; االكياس; الدم; السكريه; القابلة; الكارنيتين; المبايض; المتعدد; المتقدمه; النهائيه; بين; تكيس; للذوبان; لمنتجات; متالزمة; مستوى; مصل; مقارنة
    • versions: original; plain text
49. bijps-1191
    • author: Weli, Sardar M.
    • title: Effects of Exclusive Breast Feeding for First Six Months of life on Children Weight, Height and Head Circumference in Sulaimani City, Kurdistan-Iraq and Compare with Other Types of Feeding
    • date: 2021-06-15
    • words: 3612
    • flesch: 70
    • summary: The current study found that head circumferences of exclusively breast fed infants were higher compared to exclusively bottle fed infants at age six and fifteen months. Additionally, a study on Turkish infants during 6 months of life showed that head circumferences were higher in breast fed infants compared to formula fed and mixed fed infants (24).
    • keywords: age; baghdad; bottle; breast; breastfed; breastfeeding; children; circumferences; city; development; differences; different; diseases; ebf; eff; effects; exclusive; exclusive breast; factors; fed; feeding; formula; growth; head; health; higher; infants; iraqi; journal; length; life; milk; mixed; mixed feeding; months; mothers; percentage; pharm; rate; results; risk; sci; significant; study; sulaimani; table; types; vol.30(1; weight; الدراسة; الذين; الرضاعة; الرضع; السليمانية; الطبيعية; بين; تغذية; على
    • versions: original; plain text
50. bijps-1195
    • author: Hussein, Lina S.; Al-Khedairy, Eman B. H.
    • title: Solubility and Dissolution Enhancement of Ebastine by Surface Solid Dispersion Technique
    • date: 2021-06-15
    • words: 5218
    • flesch: 61
    • summary: Most of the prepared SSD formulas showed improvement of drug solubility. Table 3 showed that, no improvement in the solubility of EBS was obtained by using 1:1 drug: carrier w:w ratio, but significant enhancement in drug solubility (p<0.05) at 1:2 ratio in the following sequence: CCS (SSD7) <
    • keywords: 1:10; 1:5ebs; avicel; capacity; carrier; ccs; cm-1; content; determination; different; diffraction; dispersion; dissolution; dissolution rate; drug; ebastine; ebs; effect; enhancement; evaporation; figure; following; formula; formulation; ftir; high; hydration; hydrophilic; improvement; increase; insoluble; int; interaction; iraqi; j pharm; min; mixture; particles; peaks; percentage; ph101; pharm; pharm sci; pharmaceutical; pharmacy; physical; powder; prepared; pure; pxrd; rate; ratio; ray; results; samples; sci; sodium; solid; solid dispersion; solubility; soluble; solvent; spectrum; ssd; ssd16; ssds; ssg; study; surface; surface solid; table; technique; test; vol.30(1; water; yield; الدواء; الذوبان; باستخدام; تقنية; 𝐖𝐞𝐢𝐠𝐡𝐭
    • versions: original; plain text
51. bijps-1197
    • author: Jasim, Basma S.; Y. Jamal, Mohammed
    • title: Evaluating Patient Safety Culture in Iraqi Community Pharmacies
    • date: 2021-06-15
    • words: 4960
    • flesch: 62
    • summary: This study was carried out on 435 pharmacists who are working in community pharmacies in various Iraqi provinces. Keywords: Iraqi pharmacist, Patient Safety Culture, Community pharmacy.
    • keywords: aboneh; agreement; assessment; baghdad; care; communication; community; community pharmacies; continuous; counseling; culture; difference; errors; essential; experience; figure; good; health; healthcare; important; improvement; information; international; interruptions; iraqi; iraqi community; issue; item; journal; mean; medical; medication; mistakes; negative; neutral; new; nursing; organizational; overall; pace; participants; patient; patient safety; pharmaceutical; pharmacies; pharmacy; positive; practice; prescriptions; pressure; preventable; provinces; quality; research; response; result; safety; safety culture; sci; services; shifts; staff; study; survey; table; team; teamwork; total; training; united; use; vol.30(1; work; workflow; working; workload; years; المجتمع; المرضى; سالمة
    • versions: original; plain text
52. bijps-1204
    • author: Fakhree, Najwan K.; H. Mhaibes, Sarah; H. Khalil, Heba
    • title: Review article - Impact of Vitamin K on Human Health
    • date: 2021-06-15
    • words: 8067
    • flesch: 55
    • summary: Regulation of cell growth Periostin Bone metabolism, cell migration, angiogenesis Gla rich protein (GRP) Periostin like factor Four transmembrane Gla protein Function unknown Functions of Vitamin K Effect of vitamin K on coagulation Vitamin K, which is a coenzyme used to generate coagulation factors, is long considered to be important for controlling blood clotting. Effect of vitamin K on bone health Vitamin K and vitamin D are important for the healthy metabolism of the bone.
    • keywords: absorption; acid; action; activation; addition; age; bacteria; bile; binding; bleeding; blood; body; bone; brain; calcification; calcium; cancer; carboxyglutamate; carboxylation; cardiovascular; cell; chain; children; chronic; clinical; clotting; coagulation; cycle; cytokines; deficiency; dependent; dietary; different; disease; dose; effect; enzyme; essential; et al; expression; factors; fat; figure; food; form; function; gamma; gla; gla protein; group; growth; healing; health; high; human; important; inflammatory; inhibit; insulin; intestine; iraqi; kidney; levels; like; liver; loss; low; matrix; mcg; mechanism; med; menaquinones; metabolism; mgp; mk-4; mk-7; nervous; newborn; numerous; nutr; nutrition; osteocalcin; patients; people; pharm; phylloquinone; postmenopausal; process; production; progression; protein; reduced; regulation; research; residues; resistance; review; risk; role; sci; skin; soluble; status; studies; study; supplementation; system; table; testis; tissue; toxicity; treatment; type; van; vascular; vermeer; vessels; vitamin; vitamin k; vkdb; vol.30(1; warfarin; women; wound; years; فيتامين
    • versions: original; plain text
53. bijps-1208
    • author: R. Al-Hassani, Hiba; B. H. Al-Khedairy, Eman
    • title: Formulation and In-Vitro Evaluation of Meloxicam Solid Dispersion using Natural Polymers.
    • date: 2021-06-19
    • words: 5056
    • flesch: 57
    • summary: All the prepared formulas showed improvement of drug solubility except that prepared with HA. The enhanced dissolution of the drug from SDs can be attributed to reduced particle size of the drug within SDs, also it is assumed that the higher the wettability and dispersibility of a drug in a hydrophilic polymer, the better the chances of achieving an increase in drug dissolution profile (6,38).
    • keywords: absorption; acid; alginate; applications; baghdad; characteristic; collagen; concentration; content; determination; development; different; diffraction; dispersion; dissolution; dissolution rate; drug; effect; enhancement; evaluation; figure; formula; formulation; ftir; high; hyaluronic; hydrophilic; improvement; increase; int; iraqi; j pharm; journal; mass; meloxicam; meloxicam solid; method; mlx; natural; particles; peaks; percentage; pharm; pharm sci; pharmaceutical; polymer; powder; preparation; prepared; profile; properties; pure; pure mlx; pxrd; rate; ray; results; samples; saturation; sci; sd1; sd2; sd3; sds; selected; sodium; solid; solid dispersion; solubility; soluble; solvent; spectroscopy; spectrum; studies; study; technique; time; viscosity; vol.30(1; water; xyloglucan; yield; الذوبان; الصلب; قابلية
    • versions: original; plain text
54. bijps-1210
    • author: Hussien, Rawaa M.; M. Ghareeb, Mowafaq
    • title: Formulation and Characterization of Isradipine Nanoparticle for Dissolution Enhancement
    • date: 2021-06-19
    • words: 3678
    • flesch: 52
    • summary: FTIR spectrum of pure Isradipine Figure 6.FTIR of Isradipine nanoparticle (F9) Iraqi J Pharm Sci, Vol.30(1) 2021 Isradipine nanoparticle 224 Conclusions Based on the results obtained , the study concluded that nanoparticles is a promising approach to improve the solubility, dissolution rate and release of isradipine and solvent-antisolvent precipitation is an efficient method for preparation of isradipine nanoparticles. The aim of this study was to formulate and optimize a stable nanoparticles of this highly hydrophobic drug by solvent- antisolvent precipitation method to enhance in vitro dissolution rate and improve drug bioavailability Ten formulas of isradipine nanoparticles were prepared by antisolvent precipitation method utilizing one of these polymers Poloxamer 188, PVA, and Soluplus at different drugs: polymer ratios.
    • keywords: analysis; antisolvent; aqueous; baghdad; bioavailability; characterization; class; cm-1; compatibility; content; delivery; determination; differential; dissolution; drug; dsc; enhancement; evaluation; figure; formula; formulation; ftir; hcl; increase; index; international; iraqi; isradipine; isradipine nanoparticles; journal; low; lyophilized; materials; method; nanoparticles; nanosuspension; particle size; pdi; pharm; pharmaceutical; pharmacy; polydispersity; polymer; powder; precipitation; preparation; prepared; pure; pva; pxm; rate; release; research; results; sample; scanning; sci; selected; size; solubility; soluplus; solvent; stretching; study; system; table; vol.30(1; water; إلى; الدواء; الذوبان
    • versions: original; plain text
55. bijps-1213
    • author: Ghalib, Suroor A.; J. Kadhim, Enass
    • title: The Investigation of Some Phytochemical Compounds Found in Anchusa strigosa L. Grown Naturally in Iraq
    • date: 2021-06-19
    • words: 3886
    • flesch: 51
    • summary: Anchusa strigosa contain many secondary metabolites including pyrolizidine alkaloids with high concentration in the leaves followed by the flowers and finally by the roots such as retrorsine, trachelanthamidine, supinidine , platynecine and Heliotridine (9,18) ,flavonoids and phenolic acid content of this plant including Catechins, Quercitin,rosmarinic acid caffeic acid and others (19,20) ,this plant also contains steroids and terpenoids as tormentic acid. Received: 29/ 8/2020 Accepted: 21/ 11/2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30iss1pp179-188 Iraqi J Pharm Sci, Vol.30(1) 2021 Anchusa strigosa 180 Different species of Anchusa extract have many pharmacological activities ; methanolic extract of Anchusa officinalis L .has great antioxidant activity as free radical scavenging due to phenolic and flavonoids content,(10)While this activity is great for aqueous extract of Anchusa strigosa (11) anti- hyperglycemic activity of A. strigosa in diabetic rats showed a significant decrease in the fasting blood glucose and an increase in the serum insulin levels after administration that possibly was either by increasing the pancreatic secretion of insulin from existing β-cells or by release from the bound form (12) The uses of Anchusa strigosa extract has neuroprotective activity against amyloid toxicity ; reducing levels of amyloid secretion from cells and reduced γ-secretase activity (13).
    • keywords: absolute; acetate; acid; activity; alkaloid; analysis; anchusa; anchusa strigosa; baghdad; boraginaceae; butanol; caffeic; chloroform; chromatogram; chromatography; college; compound; crude; detection; ethyl; extract; extraction; factor; family; figure; filter; flavonoids; formic; formic acid; fraction; ftir; genistein; hplc; iraqi; isolated; isolation; journal; layer; leaves; melting; methanol; min; mobile; paper; pharmaceutical; phenolic; phytochemical; plant; plate; point; preparative; presence; reagent; retardation; rosmarinic; sample; sci; silybin; solvent; standard; std; strigosa; study; system; test; thin; tlc; university; vol.30(1; water
    • versions: original; plain text
56. bijps-1214
    • author: Jaafar, Noor S.; Jaafar, Iman S.
    • title: Natural Products as A Promising Therapy for SARS COV-2; An Overview
    • date: 2021-06-15
    • words: 7750
    • flesch: 54
    • summary: In the late stage of SARS CoV-2 infection, the cytokine storm produces acute lung injury, escin might reduce the secretion of inflammatory mediators in addition to attenuate the acute lung injury. A way from therapeutic options that were tried in SARS CoV-2, an increased attention is directed to predict natural products and mainly phytochemicals as collaborative measures for this crisis.
    • keywords: 3cl; ace2; acid; action; activities; activity; acute; addition; agent; anticancer; antioxidant; antiviral; antiviral effect; baghdad; baicalin; biacalin; binding; biological; candidate; catalytic; celastrol; cells; cellular; cepharanthine; characteristics; chemical; chen; china; clinical; college; combination; compound; coronavirus; cov-2; covid-19; curcumin; cycle; cytokines; diagnostic; disease; docking; drug; effect; effective; entrance; entry; enzyme; escin; et al; expression; figure; glycoside; glycyrrhizin; guo; hesperidin; host; huang; human; identification; immune; infected; infection; inflammatory; influenza; inhibition; inhibitors; injury; int; iraqi; iraqi j; j pharm; life; like; liu; lung; luteolin; lycorine; main; med; mediators; mers; molecular; natural; natural products; novel; pandemic; patients; perspective; pharm; pharmacological; pharmacy; pneumonia; pocket; polymerase; potential; powerful; previous; products; promising; properties; protease; protein; proved; quercetin; receptor; related; remdesivir; replication; respiratory; response; result; resveratrol; review; rna; role; sars; sarscov-2; sci; severe; signaling; site; spike; storm; structure; studies; study; symptoms; syndrome; targets; theaflavin; therapeutic; therapy; time; tract; transmission; treatment; type; university; virol; viruses; vitamin; vol.30(1; wang; wuhan; yang; zhang; zhao; هذه
    • versions: original; plain text
57. bijps-1221
    • author: Khudhair, Alaa R.; Al-Shawi, Nada N
    • title: Possible Protective Effects of Lutein against Ciprofloxacin Induced Bone Marrow Toxicity in Rats
    • date: 2021-06-19
    • words: 4198
    • flesch: 58
    • summary: الحمراء وإجمالي عدد كرات الدم البيضاءلوتين ، سيبروفلوكساسين ، إجمالي عدد كرات الدم الكلمات المفتاحية : Introduction The carboxylic acid derivation of fluoroquinolones is Ciprofloxacin, which is a second generation of fluoroquinolone and one of the most effective and widely used drugs within fluoroquinolone (1). Rats that orally received lutein (Groups ӀӀӀ and ӀV), each produced non- significant differences (P>0.05) in total -RBCs and -WBCs and also produced non-significant differences (P>0.05) in Bax levels in BM tissues homogenates with respect to corresponding levels in Group Ι rats.
    • keywords: -wbcs; 24mg; 6mg; adverse; animals; antioxidant; apoptosis; baghdad; bax; bone; bone marrow; carotenoids; cells; ciprofloxacin; college; consecutive; contents; control; counts; current; daily; data; days; differences; different; disease; dna; dose; effects; elevation; elisa; figure; fluoroquinolone; gavage; group; homogenates; identical; induced; iraqi; journal; kit; levels; liquid; liver; lutein; marrow; mechanisms; mitochondrial; non; oral; p<0.05; paraffin; pharm; protective; protein; rats; rbcs; reduction; results; role; sci; significant; studies; study; suppression; tissues; topoisomerase; total; toxicity; university; values; vol.30(1; الدم; اللوتين; تلقت; سيبروفلوكساسين; طريق; كجم; كرات; نخاع
    • versions: original; plain text
58. bijps-1224
    • author: Ibrahim, Ruaa M.
    • title: A review on Active Constituents and Pharmacological Effects of Eriobotrya Japonica Lindl. (Loquat)
    • date: 2021-06-15
    • words: 8289
    • flesch: 49
    • summary: Sun G, Liu Y, Zhu J, Iguchi M, Yoshioka S, Miyamura M, Kyotani S. Immunomodulatory effect of Eriobotrya japonica seed extract on allergic dermatitis rats. Eriobotrya japonica leaves were utilized in the therapy of stomach and lung illness, diabetes mellitus, skin diseases and inflammatory problem (9) and also efficient in dysmenorrhea, phlegm, asthma, headache, chronic bronchitis, and lower back pain (10).
    • keywords: 48h; ability; acetate; acid; active; activities; activity; addition; airway; anticancer; antimicrobial; antioxidant; antioxidant effect; aqueous; assay; bioactive; bronchitis; caffeic; cancer; cell; chemical; chen; china; chinese; chlorogenic; chronic; compounds; constituents; content; corosolic; derivatives; diabetes; diabetic; diet; different; dpph; effect; enzymes; eriobotrya; eriobotrya japonica; et al; ethanol; ethanol loquat; ethyl; expectorant; expression; extract; fat; fermented; fig.2; figure; flavonoids; flowers; food; fraction; free; fruit; glucose; glycosides; good; green; hepatoprotective; higher; huang; human; hyperglycemia; iia; important; inflammation; inflammatory; inhibited; inhibition; inhibitory; insulin; international; iraqi; irritation; isolated; japan; japonica; japonica lindl; journal; juice; kaempferol; kim; leaf; leaf extract; leaves; levels; like; lindl; lines; liver; loquat; loquat leaf; maceration; macrophages; maslinic; med; medicinal; mellitus; method; mice; model; new; oleanolic; pharm; pharmaceutical; pharmacological; phenolic; phospholipase; plant; present; production; properties; protein; quercetin; radical; rats; reflux; related; research; review; role; scavenging; sci; seed; seong; serum; shafi; skin; structure; study; suspension; tanaka; tea; test; thunb; tormentic; total; treatment; triterpenes; tumor; ursolic; vol.30(1; water
    • versions: original; plain text
59. bijps-1227
    • author: Ahmad, Halla A.; H. Kathem, Sarmed
    • title: Thymoquinone Attenuates Immune Mediated Liver Injury Induced by Concanavalin A in Mice
    • date: 2021-12-09
    • words: 5266
    • flesch: 55
    • summary: The importance of immune mediated liver damage is to simulate human autoimmune and viral hepatitis, which considered an upgrowing health issue globally (26). This result is the first to demonstrate a hepatoprotective effect of thymoquinone in immune mediated liver damage, that means an immune modulatory activity has been proposed in the present study.
    • keywords: 15mg; 30mg; activation; activity; acute; administration; alt; animals; ast; attenuation; autoimmune; baghdad; blood; cells; comparison; concanavalin; control; control group; cytokines; damage; data; day; days; dependent; difference; dose; effect; elevation; experimental; expression; factor; figure; fold; gene; group; hepatic; hepatitis; hepatoprotective; hours; ifn; immune; immunity; immunomodulatory; increase; induced; inf; inflammation; inflammatory; injury; innate; iraqi; level; liver; liver damage; liver injury; mean; mechanisms; mice; model; model control; model group; negative; negative control; normal; p<0.05; pharm; present; pretreatment; protective; rats; response; results; role; saline; sci; serum; significant; single; study; table; thymoquinone; tissue; tnf; tnf α; vol.30(2; الكبد; المناعي
    • versions: original; plain text
60. bijps-1229
    • author: Ali, Aseel J.; Abdulla, Hajer I.; Al-Nimer, Marwan S.
    • title: The Pharmacological Effects of Kappa Carrageenan on Different Human Cell Lines and Genomic DNA: An in vitro study
    • date: 2021-06-19
    • words: 4605
    • flesch: 59
    • summary: 1Corresponding author E-mail: dentist_aseel@yahoo.com Received: 11/ 9 /2020 Accepted:21 / 11 /2020 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30iss1pp189-195 Iraqi J Pharm Sci, Vol.30(1) 2021 Effects of kappa carrageenan on human cell lines and genomic DNA 190 Iraqi J Pharm Sci, Vol.30(1) 2021 Effects of kappa carrageenan on human cell lines and genomic DNA 191 Solution of methyl-thiazolyl tetrazolium /MTT.
    • keywords: 2001; absorbance; activity; anti; antitumor; baghdad; bhattacharyya; buffer; cancer; carcinoma; carrageenan; cell; cell growth; cell lines; chemical; colonic; culture; damage; distilled; dna; effect; epithelial; evidence; experimental; fcs; fibroblast; figure; filter; following; food; genomic; genomic dna; growth; hela; human; human cell; inhibits; iraqi; kappa; layer; lines; mammary; mean; media; microbial; model; monolayer; oligosaccharides; oral; pbs; pharm; pharmaceutical; plate; powder; results; rhabdomyosarcoma; rpmi/1640; sci; serum; solution; study; tobacman; university; use; value; vial; vivo; vol.30(1; volume; water; wells; xue; yao; الخاليا; السرطانية
    • versions: original; plain text
61. bijps-1230
    • author: Abbas, Ban Walid; H. Kathem, Sarmed
    • title: Carvone Attenuates Irinotecan-Induced Intestinal Mucositis and Diarrhea in Mice
    • date: 2021-12-09
    • words: 3481
    • flesch: 57
    • summary: Iraqi J Pharm Sci, Vol.30(2) 2021 62 Table 4. Effect of carvone treatment on diarrhea score in irinotecan-induced intestinal mucositis. Effect of carvone treatment on mice body weight variation in irinotecan-induced intestinal mucositis and diarrhea.
    • keywords: 100mg; 50mg; 75mg; animals; anti; attenuation; baghdad; body; cancer; carvone; chemotherapy; control; daily; day; days; decrease; diarrhea; dna; dose; effect; experimental; figure; group; inflammation; inflammatory; intestinal; intestinal mucositis; iraqi; irinotecan; level; loss; mentha; mice; model; mucositis; normal; oil; oncol; onset; oral; p<0.05; percent; pharm; protective; reduction; results; sci; score; serum; severe; significant; sn-38; solution; spicata; standard; stress; study; successive; table; tnfα; treatment; use; variation; vol.30(2; weight; إلى; التهاب; الغشاء; المخاطي; المعوي
    • versions: original; plain text
62. bijps-1231
    • author: T. Abduljabbar, Tariq; K. Hadi, Mohammed
    • title: Synthesis, Characterization and Antibacterial Evaluation of Some Coumarin Derivatives
    • date: 2021-06-19
    • words: 4263
    • flesch: 58
    • summary: The various biological activities coumarin derivatives such as anticoagulants and antithrombotics are well known, so that; they are active for the inhibition and treatment of venous and arterial thrombosis (6), a number of coumarin derivatives are also described as antifungal and antibacterial agents (7), antiviral and antitumor agents (8), lipid-lowering agents(9), anti-HIV agents (10), antioxidants and lipoxygenase inhibitor (11). New coumarin derivatives (hydrazones and an amide) were synthesized through multisteps reactions.
    • keywords: acid; active; activities; activity; addition; aeruginosa; agents; aldehydes; amide; analgesic; analysis; antibacterial; aromatic; baghdad; bases; biological; c =; carboxylic; ch3; characterization; chemical; chemistry; cm-1; college; compounds; coumarin; derivatives; different; diffusion; edci; electron; ethanol; evaluation; gram; group; heterocyclic; hobt; hydrazide; inhibition; iraqi; journal; m.p; medicinal; method; mixture; moiety; natural; new; new coumarin; nmr; novel; organic; pharm; pharmaceutical; pharmacological; powder; pseudomonas; reaction; ring; scheme; schiff; sci; solution; stirred; str; structure; synthesis; synthesized; synthetic; temperature; university; vol.30(1; yield
    • versions: original; plain text
63. bijps-1232
    • author: A. Mahdi, Farah; Zalzala, Munaf H.
    • title: Protective Effects of Safranal Against Selenite-Induced Cataract in Rats
    • date: 2021-06-19
    • words: 4973
    • flesch: 57
    • summary: Effects of safranal on lens GSH and MDA in lenses of rat pups treated with sodium selenite.. (A) GSH (B) MDA. Effects of safranal on lens NRF2 in lenses of rat pups treated with sodium selenite.
    • keywords: active; administration; aged; analysis; animals; antioxidant; baghdad; cataract; cataractogenesis; content; control; control group; crocus; damage; data; day; days; dependent; development; dose; effects; experimental; eye; factor; figure; formation; glutathione; grade; group; gsh; iii; injection; intra; iraqi; lenses; level; lipid; lower; mda; mean; model; normal; nrf2; nuclear; number; opacification; opacity; ophthalmol; oxidative; oxygen; panel; peritoneal; peroxidation; pharm; postpartum; previous; protection; protein; pups; rat; rat pups; rats; redox; related; results; saffron; safranal; sativus; sci; selenite; significant; single; sodium; sodium selenite; soluble; standard; stress; studies; study; treatment; vol.30(1; إلى; الساد; السفرنال; العين; اليوم; عدسة; على
    • versions: original; plain text
64. bijps-1233
    • author: B, NIJA; Rasheed, Arun; Kottaimuthu, A
    • title: Development, Characterization and Pharmacological Investigation of Umbelliferone Conjugates of NSAIDs
    • date: 2021-06-19
    • words: 4685
    • flesch: 48
    • summary: The prodrugs based approaches such as carries linked and bioprecursor approaches have significant role in the drug research and development (7).The drug molecules after the development process may be failed in the required therapeutic activity because of the pharmacokinetic profile, transport profile and solubility etc and prodrug approach successfully overcome the above limitations (8).In the worldwide pharmaceutical market, about ten percentages of the drugs are considered as prodrugs that can effectively overcome the limitations of the NSAIDs. Synthesis of NSAIDs -Antioxidant prodrug: This research work developed the ester prodrug of NSAIDs, MA and FBN by conjugating with the antioxidant, 4-methyl umbelliferone thus mefenamic acid-umbellierone prodrug[MU] and Flurbiprofen - umbelliferone prodrug[FU].
    • keywords: acid; activities; activity; analysis; anti; antioxidant; behavioral; benzene; brain; carboxylic; characterization; chemical; college; compounds; conjugates; control; cortex; data; development; different; effect; enhanced; ester; evaluation; fbn; figure; formation; free; gastric; group; histopathology; hydrolysis; inflammatory; iraqi; kerala; marbles; mefenamic; melting; methyl; natural; nmr; normal; nsaids; number; order; percentage; pharm; pharmacological; pharmacy; physical; prodrugs; profile; protective; rasheed; results; sci; shifa; sif; spectra; spectrometer; structure; studies; study; synthesis; synthesized; test; therapeutic; ulcer; umbelliferone; vol.30(1
    • versions: original; plain text
65. bijps-1234
    • author: Kasim, Ali A.; Ataimish, Ahmed H.
    • title: The Pathological Mechanisms of Obesity-Related Glomerulopathy: A review article
    • date: 2021-06-15
    • words: 4784
    • flesch: 50
    • summary: Chagnac A, Herman M, Zingerman B, Erman A, Rozen-Zvi B, Hirsh J, et al. Fan S, Zhang P, Wang AY, Wang X, Wang L, Li G, et al.
    • keywords: acid; activation; adipocytes; adipokines; adiponectin; adipose; aldosterone; american; angiotensin; association; baghdad; blood; cells; chen; chronic; clinical; cytokines; deposition; development; diabetes; dialysis; disease; dysfunction; effect; endothelial; et al; european; expression; factor; fatty; fibrosis; function; gfr; glomerular; glomerulopathy; growth; hall; human; hypertension; hypertrophy; il-6; important; increase; individuals; inflammation; inflammatory; insulin; international; iraqi; journal; kidney; kim; leptin; lipid; lipoprotein; macrophages; mechanisms; medicine; mesangial; metabolic; nephrology; obese; obesity; org; oxidative; pathogenesis; patients; pharm; physiology; podocytes; pressure; prevalence; production; proteinuria; proximal; reabsorption; reactive; receptor; related; renal; renin; research; resistance; response; role; sci; signaling; sodium; syndrome; synthesis; system; tissue; tnf; tubular; uric; vascular; visceral; vol.30(1; wang; zhang; البولية; الكبيبات
    • versions: original; plain text
66. bijps-1235
    • author: Imani, Asad; Saeedi abo-s-haghi, Mohsen; Alidadi, Mohammad; Shafiei, Elham
    • title: Comparing the Effects of Lavender Oil and Olive Oil Massage on Pain due to Muscular Cramp during Hemodialysis
    • date: 2021-06-15
    • words: 3208
    • flesch: 60
    • summary: Although there are some previous studies about the effect of massage with olive oil or lavender oil on outcomes of patients in different diseases (8-10), but there is no earlier study on comparing the effects of lavender oil and olive oil massage on pain due to muscular cramp in hemodialysis patients. The intervention included flora massage on the lower leg muscles so that the first group received lavender oil massage (10 drops) and the second group received olive oil massage (10 drops) for four weeks.
    • keywords: aromatherapy; chronic; clinical; cramp; data; doi; drops; duration; effects; female; group; hemodialysis; ilam; intervention; iran; iraqi; lavender; lavender oil; leg; lower; majority; massage; mean; measure; medical; muscular; oil; oil massage; olive; olive oil; pain; participants; patients; pharm; pharmacological; results; review; scale; sciences; score; shahrekord; studies; study; test; treatment; trial; university; variable; vas; vol.30(1; weeks; year
    • versions: original; plain text
67. bijps-1239
    • author: J. Mohammed, Ashwaq; Kadhim, Dheyaa J.
    • title: Knowledge and Perception of Iraqi Pharmacists Towards Biosimilar Medicines
    • date: 2021-06-19
    • words: 4058
    • flesch: 56
    • summary: Regarding pharmacists’ knowledge of biosimilar medicines, the results showed that two questions received the highest percentages of adequate answers: biosimilar medicine requires preclinical and clinical studies (58.0%) and biosimilar medicines require more comprehensive data compared to generic drugs (56.1%). When the respondents were asked about the basic information regarding biosimilar medicines, the results showed that two questions received the highest percentages of adequate answers: The requirement of biosimilar medicine for preclinical and clinical studies (58.0%) and the requirement for more comprehensive data compared to generic drugs (56.1%)ˮ .
    • keywords: adequate; answers; baghdad; biologic; biosimilar; biosimilar medicines; c e; clinical; comprehensive; correct; correlation; costs; current; data; differences; e n; e s; efficacy; experience; french; gender; generic; highest; https://www.amgenbiosimilars.com/media/themes/amgen/amgenbiosimilars-com/amgenbiosimilars-com/pdf/2019-trends-in-biosimilars-report-electronic-version---usa-bio-80182.pdf; iraqi; knowledge; m e; male; marketing; mean; meaningful; medicinal; medicines; n c; participants; patients; percentage; perception; pharmacists; pharmacy; product; questions; r e; reference; results; s r; safety; sci; score; significant; study; substitution; survey; table; terms; total; vol.30(1; years; الحيوية; الصيادلة; على
    • versions: original; plain text
68. bijps-1241
    • author: Ahmed, Zainab H.; H Zalzala, Munaf
    • title: Study The Anti-Asthmatic Activity of Guggulsterone In Ovalbumin-Induced Asthma In Rat
    • date: 2021-12-09
    • words: 4843
    • flesch: 55
    • summary: But guggulsterone treated groups are significant reduce IgE levels through the ability of guggulsterone for suppression of gene expresion of proiflammatory cytokines specifically IL-4 and reducing the release of IgE from inflammatory cells in the lung.(8) & (22) Conclusion Guggulsterone has anti-inflammatory activity on OVA-induced asthma in rats as evident by significant reducing in WBC count in BALF, proinflammatory cytokines (IL-4, IL-5, IL-33 & TNFα) and immune marker IgE antibody in serum. Keywords: Anti-inflammatory activity, Asthma, Guggulsterone, Ovalbumin.
    • keywords: activity; airway; allergic; anti; asthma; asthmatic; baghdad; balf; cell; control group; count; cytokines; days; different; disease; effect; error; expression; figure; group; group group; group ii; group v; guggulsterone; hand; ige; iii; il-33; il-4; il-5; il33; il4; inflammation; inflammatory; inhibit; iraqi; journal; lead; letters; levels; mast; means; n=8; nonidentical; ova; p<0.001; p<0.05; pharm; positive; prednisolone; rats; reduction; sci; sensitization; sensitized; sensitized group; series; serum; serum levels; significant; std; student; studies; symbol; synthesis; test; tnf; tnfα; unpaired; values; vol.30(2; wbc; اعطيت
    • versions: original; plain text
69. bijps-1245
    • author: Al-Kinani, Zainab A.; H. Ali, Shatha
    • title: Serum Chitotriosidase level as a Novel Biomarker for Therapeutic Monitoring of Nephropathic Cystinosis among the Iraqi children
    • date: 2021-06-19
    • words: 4426
    • flesch: 58
    • summary: Sample collection and preparation From each participant ( patient and control subjects), venous blood sample were collected, but for cystinosis patients the blood venous blood samples were collected after at least 6 hours from taking treatment (Cysteamine). The elevation in serum chitotriosidase activity noticed in cystinosis patients may reflect a particular case of phagocyte activation concerned with cystine accumulation in the lysosome that causes excessive producing and/or releasing of the chitotriosidase.
    • keywords: .0001; accumulation; activity; age; available; baghdad; biomarker; blood; bmi; calcium; cells; center; children; chitotriosidase; cht1; clinical; coefficient; content; control; control group; correlation; creatinine; ctns; cysteamine; cystine; cystine level; cystinosis; diagnosis; different; disease; fanconi; gahl; gfr; group; healthy; high; internet; iraqi; leukocyte; level; lysosomal; mean; measurement; measures; months; nephrol; nephropathic; nmol; normal; novel; patients; pediatr; pharm; plasma; present; protein; proximal; rank; rare; renal; results; sample; sci; serum; significant; study; syndrome; table; therapeutic; treatment; tubular; urine; value; value=0.000; vol.30(1; wbc; weight; years; إلى; الدم; السيستين; داء; نانومول
    • versions: original; plain text
70. bijps-1249
    • author: Atiyah, Khansaa Hussein; J Kadhum, Enas
    • title: Isolation and Identification of Phenolic Compounds from Dianthus orientalis Wildly Grown in Iraq.
    • date: 2021-12-11
    • words: 3391
    • flesch: 54
    • summary: This project provides the first comprehensive research done in Iraq and the world to study the phytochemicals and the methods of extraction and isolation of active constituents from Dianthus orientalis wildly grown in Iraq. The compounds were isolated from chloroform fraction were symbolized as C1, C2, C3, C4. https://doi.org/10.31351/vol30iss2pp122-134 Iraqi J Pharm Sci, Vol.30(2) 2021 Dianthus orientalis L. 124 Identification of the isolated phenolic derivatives from ethyl acetate and chloroform fraction of Dianthus orientalis The Compound that symbolized as E1, C1, C2, C3, C4 was identified by several methods including chemical, chromatographic, and spectral methods as: Spraying with 5% ethanolic KOH on TLC plate HPLC analysis HPLC technique (Knuaer, Germany) was applied for the detection of different constituents found in the ethyl acetate, chloroform fractions as flavonoids and phenolic acids, and for identification of the isolated compounds from Dianthus orientalis.
    • keywords: acetate; acid; applied; aromatic; baghdad; bands; bending; carnation; caryophyllaceae; caryophyllus; chemical; chloroform; chromatogram; cinammic; colored; composition; compounds; coumaric; cpd; data; dianthus; dianthus orientalis; ethyl; family; figure; fraction; ftir; genistein; germany; hplc; identification; interpretation; iraqi; isolated; koh; mass; methanol; oleuropien; orientalis; pharm; phenolic; plant; plate; sci; solvent; spectrum; spot; standard; stretching; table; test; tlc; university; vanillic; vol.30(2; yellow; السائل
    • versions: original; plain text
71. bijps-1253
    • author: Aziz, Tavga Ahmed; Hama Amin, Renas Raouf; Ahmed, Zheen Aorahman; Jalal Sleman, Hazhan; Hassan Aziz, Bahez
    • title: Occupational Toxicity and Health Hazards of the Healthcare Providers at Healthcare Facilities in Sulaimani City, Iraq
    • date: 2021-12-09
    • words: 4826
    • flesch: 60
    • summary: نسبةب اللفظية لإلساءات عرضة واالكثر %10.69 نسبةب وحالجر و %13.84 بنسبة لحادةا بالمواد لالصابة عرضة هم االطباء ان الدراسة وبينت كما .%13.84 بنسبة الدم طريق نع المنقولة %5.11 الجسدية للمحن عرضات االكثر مه لمختبراتا
    • keywords: airborne; assistants; biological; biological hazards; blood; chemical; city; contact; contaminated; control; correlation; course; current; daily; data; diseases; exposure; facilities; follow; group; hazards; health; healthcare; healthcare providers; hospital; hours; infectious; injuries; injury; instructors; international; iraqi; job; lab; laboratory; measures; medical; noise; non; nurses; occupational; occupational hazards; patient; pharmacists; physical; physicians; place; present; private; prone; protection; providers; psychological; public; related; risk; safety; sample; sci; sharp; specimens; spills; staffing; stress; studies; study; sulaimani; table; training; types; unsafe; vol.30(2; work; workers; working; workplace; wounds; years; االطباء; بنسبة
    • versions: original; plain text
72. bijps-1256
    • author: Sadeq, Zainab A.
    • title: Microneedle Array Patches: Characterization and in -vitro Evaluation
    • date: 2021-06-15
    • words: 5933
    • flesch: 54
    • summary: Figure 1 shows the type of microneedles drug delivery (31). Materials used in microneedles fabrication Metallic materials Due to its advantages of toughness and mechanical strength, they are widely used in transdermal drug delivery.
    • keywords: acid; action; active; addition; administration; advanced; advantages; anti; application; approach; array; biological; biomedical; blood; cancer; cell; certain; characterization; chronic; coated; coefficient; corenum; creation; current; delivery; delivery system; development; different; diffusion; dissolving; drug; drug delivery; effect; electrode; enhancement; epidermis; evaluation; fabrication; fluid; following; force; formulation; free; hallow; health; high; hypodermic; improvement; increase; injection; international; interstitial; iraqi; j pharm; journal; kumar; large; layer; lithography; master; materials; method; microneedle; microneedle array; microneedle patch; moisture; mold; molecules; monitoring; oligonucleotides; pain; partition; patch; patches; penetration; permeability; permeation; pharm; pharmaceutical; pharmacy; poke; polymer; potential; prausnitz; receptor; release; research; sci; sciences; site; skin; solid; solution; stratum; study; substances; system; systemic; techniques; temperature; test; therapeutic; therapy; thickness; tips; transdermal; transdermal delivery; transdermal drug; transdermal patch; transport; treatment; use; vaccine; vol.30(1; volume; water; weight; الجلد; المجهرية
    • versions: original; plain text
73. bijps-1259
    • author: Al-Mayyahi, Rawaa S.; Al-Tumah, Wa'il A. Godaymi
    • title: Genetic Structure, Transmission, Clinical Characteristics, Diagnosis, Treatment and Prevention of Coronavirus Disease 2019 (COVID-19): A Review
    • date: 2021-06-15
    • words: 6621
    • flesch: 62
    • summary: Wang J, Zhao S, Liu M, Zhao Z, Xu Y, Wang P, et al. Cao B, Wang Y, Wen D, Liu W, Wang J, Fan G, et al.
    • keywords: ace2; acute; age; analysis; antiviral; assoc; available; benefit; cases; cause; cells; characteristics; children; china; clinical; cohort; confirmed; convalescent; coronavirus; coronavirus disease; corticosteroids; cov-2; covid-19; covid-19 pandemic; covid19; current; days; death; detection; diagnosis; different; disease; distress; drugs; effects; efficacy; engl; entry; et al; figure; guo; health; high; higher; hospital; humans; hydroxychloroquine; ill; immune; infected; infection; internet; iraqi; iraqi j; j med; jama; lancet; liu; management; med; median; mers; mortality; ncov; new; novel; novel coronavirus; number; observational; organization; outbreak; pandemic; patients; persons; pharm; plasma; pneumonia; possible; potential; pregnancy; prevention; previous; protocol; public; randomized; rapid; rate; remdesivir; respiratory; responses; results; review; ribavirin; rna; sars; sarscov-2; sci; sequencing; severe; source; states; structure; studies; study; surfaces; symptoms; syndrome; tang; testing; therapy; time; transmission; treatment; trial; united; updates; vaccines; viral; viruses; vitamin; vitro; vol.30(1; wang; world; wuhan; yang; years; zhang; zhao
    • versions: original; plain text
74. bijps-1262
    • author: Ahmed, Kawther K.; Salman, Salema S.; A. Abbas, Wafaa; Alkaisy, Shahad W.; Kathem, Sarmed H.
    • title: Sudden Transition of Pharmacy Education from Traditional to Distance Learning in the Era of COVID-19: Action Steps of a Leading Pharmacy School in Iraq
    • date: 2020-12-31
    • words: 4715
    • flesch: 51
    • summary: Students had joined the class using class code that is initially conveyed to students through contacting class student representatives on their personal phone number. Students enrollment in the virtual classrooms remained at 100% throughout the second semester where students had sensed the real willingness of all faculty and college administration to help them pass these challenging times.
    • keywords: academic; action; administration; baghdad; classes; classrooms; clinical; college; copharm; covid-19; delivery; distance; education; electronic; emails; exams; experience; face; faculty; figure; final; google; graduate; ibn; ibn sina; implementation; instructors; internet; iraq; learning; lecture; levels; mock; new; official; online; pandemic; pharmacy; position; powerpoint; program; report; sci; second; semester; sina; sina unit; steps; students; support; technical; technology; training; undergraduate; unit; university; uob; video; virtual; vol.29(2; work; year; الصيدلة; بغداد; جامعة
    • versions: original; plain text
75. bijps-1271
    • author: Aziz, Tavga A.
    • title: The Role of Ginkgo biloba Extract as Monotherapy in Improving the Outcomes of Patients with Metabolic Syndrome: A Pilot Comparative Study with Metformin
    • date: 2021-06-19
    • words: 7468
    • flesch: 63
    • summary: Iraqi J Pharm Sci, Vol.30(1) 2021 Ginkgo biloba extract and metformin DOI: https://doi.org/10.31351/vol30iss1pp258-269 258 The Role of Ginkgo biloba Extract as Monotherapy in Improving the Outcomes of Patients with Metabolic Syndrome: A Pilot Comparative Study with Metformin Tavga A. Aziz*,1 *Department of Pharmacology and Toxicology, College of Pharmacy, University of Sulaimani, Kurdistan, Iraq Abstract The present study evaluates the effects of Ginkgo biloba extract as monotherapy on the glycemic status, insulin resistance (IR), body mass index (BMI), and visceral adiposity index (VAI), in addition to the inflammatory markers, oxidative status and leptin level in patients with metabolic syndrome in comparison with metformin. Concerning the level of HbA1c, GKB treated Iraqi J Pharm Sci, Vol.30(1) 2021 Ginkgo biloba extract and metformin 261 group produced a non-significant decrease (7%±0.8% vs 7.2%±1%) compared to the baseline value (P=0.6) with no significant change produced by metformin (Figure 2 C).
    • keywords: adiposity; analysis; antioxidant; association; baseline; baseline values; biloba; biloba extract; blood; bmi; body; change; clin; clinical; college; colorimetric; days; decrease; determination; diabetes; different; disease; e t; effect; effective; extract; fat; figure; food; function; g k; gingko; ginkgo; ginkgo biloba; gkb; glucose; good; group; hba1c; hdl; hematological; high; human; increase; index; inflammation; inflammatory; insulin; int; iraqi; k b; leptin; level; m e; m t; management; markers; mass; mean; med; mellitus; metabolic; metabolic syndrome; metformin; methods; mets; monotherapy; non; obesity; oxidative; p<0.05; parameters; patients; period; pharm; plant; pre; resistance; roche; role; ru m; s e; sci; serum; signaling; significant; status; studies; study; syndrome; table; test; time; tissue; tnfα; total; treatment; type; university; use; vai; values; visceral; vol.30(1; weight; المتالزمة; على; مستخلص; مستوى; ومؤشر
    • versions: original; plain text
76. bijps-1274
    • author: Al-Hilli, Faris Ali
    • title: Study of Microbial Contamination of Some Commercial Contact Lens Solutions
    • date: 2021-12-11
    • words: 3414
    • flesch: 55
    • summary: Our study was aimed at identifying microbial contamination of contact lens solutions from students at the College of Pharmacy/ University of Baghdad. Keywords: Contact lens solution, Microbial contamination, Eye infections, Pseudomonas aeruginosa, Staphylococcus epidermidis سات الالصقة التجاريةدراسة التلوث المايكروبي لبعض محاليل العد 1*،فارس علي محمد الحلي العراق .
    • keywords: aeruginosa; agar; antimicrobial; aureus; bacteria; baghdad; care; clao; clinical; coli; college; commercial; common; contact; contact lens; contaminated; contamination; corneal; diseases; drops; epidermidis; et.al; eye; fluorescence; gram; growth; infections; iraqi; isolated; lens; lens solutions; lenses; likely; microbial; microbial contamination; microorganisms; mirabilis; multipurpose; negative; new; ocular; pharm; positive; proteus; pseudomonas; resistant; samples; sci; serratia; soft; solutions; staphylococcus; storage; students; study; system; university; unused; use; users; vol.30(2; water; wear; إلى; الالصقة; التلوث; الصيدلة; العدسات; المحاليل; بغداد; جامعة; كلية; للعين
    • versions: original; plain text
77. bijps-1280
    • author: Labhade, Sonali Dnyaneshwar; Sharma, Swapnil; Paliwal, Sarvesh; Desai, Shivani
    • title: An Overview of Some Plant Based Products With Hepatoprotective Activity
    • date: 2021-12-09
    • words: 6146
    • flesch: 41
    • summary: Aim: The phytoconstituents studied for their protective effect in liver diseases are reviewed. According to WHO reports, liver diseases lead to approximately 2.4 million deaths per year.
    • keywords: acetate; acid; activities; activity; acute; agents; alanine; albino; alcohol; alkaline; alkaloids; alp; alt; amino; antioxidant; aqueous; article; asian; ast; bark; bilirubin; biochemical; blood; carbon; carbon tetrachloride; cat; causes; ccl4; cells; chemical; chemistry; cirrhosis; clinical; compounds; consumption; content; damage; diseases; disorders; drugs; effect; enzymes; ethanol; ethanolic; ether; ethnopharmacology; ethyl; experimental; extract; factor; family; flavonoids; folk; food; free; glutathione; growth; health; hepatic; hepatitis; hepatocytes; hepatoprotective; hepatoprotective activity; hepatoprotective drugs; hepatoprotective effect; hepatotoxicity; herbal; hgf; increase; indian; injury; international; iraqi; iraqi j; j pharm; journal; kumar; lead; leaf; leaves; levels; like; linn; lipid; liver; liver diseases; mechanism; medicinal; medicines; oxidative; pacific; paracetamol; parameters; peroxidation; pharm; pharmaceutical; pharmacy; phenolic; phosphatase; phytoconstituents; plant; potential; radicals; rao; rats; research; review; ros; saponins; sci; sciences; screening; serum; sgot; sgpt; sharma; singh; sod; source; stem; steroids; stress; studies; study; table; tannins; tetrachloride; therapeutic; thioacetamide; total; toxicology; transaminase; transferase; treatment; tropical; vivo; vol.30(2; water
    • versions: original; plain text
78. bijps-1281
    • author: Katsayal, B. S. ; A. Lema, A.; Jibrin, K.; Nuraddeen, W.; M. Alexander, E.; Mohammed, N.H
    • title: Ameliorative Role of Nutraceutical Quercetin and its Derivatives Against Cognitive Impairment Process Induced by Lead Exposure in Drosophila melanogaster(Fruit Fly)
    • date: 2021-12-11
    • words: 4314
    • flesch: 50
    • summary: Up regulation of acetylcholinesterase activity was observed following treatment with quercetin. This study aimed to determine the effect of short-term exposure to acetylcholinesterase activity in relation to oxidative damage associated with Alzheimer's disease pathogenesis and the role of functional foods in improving these oxidative processes.
    • keywords: acetate; acetylcholinesterase; activity; administration; alzheimer; antioxidant; binding; buffer; catalase; clinical; cognitive; compounds; content; damage; data; database; department; determination; disease; disorders; docking; doi; donepezil; drosophila; effects; enzyme; exposure; figure; flies; function; glutathione; group; high; impairment; inhibition; inhibitors; interactions; iraqi; journal; lead; low; melanogaster; metal; min; model; moderate; molecular; molecules; neurodegenerative; non; normal; nutraceuticals; oxidative; pharm; pharmacokinetic; phosphate; process; properties; protein; quercetin; reaction; related; role; sci; significant; silico; solubility; state; structure; studies; therapeutic; thiol; total; toxicity; transferase; treatment; university; vol.30(2
    • versions: original; plain text
79. bijps-1284
    • author: Jihad, Haider Mohammed; J. Al- Akkam, Entidhar
    • title: Formulation and in-vitro Evaluation of Carvedilol Gastroretentive Capsule as (Superporous Hydrogel)
    • date: 2021-12-11
    • words: 6297
    • flesch: 57
    • summary: Stability of carvedilol SPH hybrid capsule The shelf life of carvedilol (F8) capsule was calculated by constructing the Arrhenius plot as shown in figure (7). Dissolution of carvedilol SPH as capsule Dissolution test was done for the selected formula (F8) after encapsulation and compared with that of reference tablet (Carvedilol 6.25 mg tablet/Roche).
    • keywords: 0.1n; agent; analysis; angle; apparatus; baghdad; best; capsule; carr; carvedilol; carvedilol capsule; chitosan; college; concentration; content; correlation; cross; decrease; delivery; density; development; dissolution; drug; drug release; effect; equation; ethanol; evaluation; figure; flow; foaming; following; formulation; ftir; gastroretentive; hcl; hybrid; hydrogel; increase; index; international; iraqi; journal; lag; linker; mathematical; min; model; nahco3; pharmaceutical; pharmacy; polymerization; polymers; porosity; powder; prepared; properties; pva; range; reference; release; repose; research; resulted; results; roche; sample; sci; science; significant; solubility; sph; study; superporous; superporous hydrogel; swelling; system; table; test; time; type; university; values; vol.30(2; volume; water; weight; المسامية; فائق
    • versions: original; plain text
80. bijps-1286
    • author: Naser, Noor Hatef; Abdul Aziz Alibeg, Ammar
    • title: Exacerbation of COVID 19 in Hypertensive Patients ( A review)
    • date: 2021-12-09
    • words: 4941
    • flesch: 58
    • summary: Although the number of fatal COVID-19 positive patients treated with ACE-Is was more than twice the number of those treated with ARBs, it cannot absolutely conclude the risks or benefits of using such medications, due to Iraqi J Pharm Sci, Vol.30(2) 2021 COVID 19 and hypertension 26 the association of other factors as age, environment, and impact of unidentified comorbidities on outcome with the COVID-19 patients (66,67). Reyfman, P. A., Walter, J. M., Joshi, N., Anekalla, K. R., McQuattie-Pimentel, A. C., Chiu, S. & Verma, R. Single-cell transcriptomic analysis of human lung provides insights into the pathobiology of pulmonary fibrosis.
    • keywords: 2020; ace2; acute; adverse; aldosterone; alveolar; american; analysis; angiotensin; arbs; associated; association; binding; blockers; blood; cardiovascular; cells; chen; china; clinical; converting; coronavirus; cov-2; covid-19; covid19; diabetes; disease; effect; entry; enzyme; et al; expression; factors; health; heart; high; human; hypertension; immune; important; infected; infection; inhibitors; injury; innate; international; iraqi; journal; liu; lung; mechanisms; med; molecular; mortality; outcome; pandemic; pathogenesis; patients; pharm; pressure; raas; receptor; regulation; renin; research; respiratory; response; review; risk; role; sars; sci; severe; severity; spike; stage; studies; study; syndrome; system; type; viral; virus; vol.30(2; wang; zhang; zhou
    • versions: original; plain text
81. bijps-1287
    • author: Alkawak, Rasha Saadi Younus; A. Rajab, Nawal
    • title: Lornoxicam-Loaded Cubosomes: - Preparation and In vitro Characterization.
    • date: 2022-06-17
    • words: 5771
    • flesch: 59
    • summary: Aqueous Phase Hydrotrope Stabilizer Oil (O il: sta b iliz e r ) m ix tu r e Drug F o r m u la c o d e P h o sp h a te B u ffe r S o lu tio n p H 7 .4 (g m ) P r o p y le n e g ly c o l (g m ) E th a n o l (g m ) T W E E N 8 0 (g m ) (g m ) P lu r o n ic ® F 1 2 7 (g m ) G M O (g m ) L o r n o x ic a m (g m ) 20 86.4 … 2.5 … 1.82 7.28 4:1 2 F1 20 83.9 … 5 … 1.82 7.28 2 F2 20 80.9 … 8 … 1.82 7.28 2 F3 20 80.9 8 … … 1.82 7.28 2 F4 20 80.9 … 8 1.82 … 7.28 2 F5 10 80.9 … 8 … 1.82 7.28 2 F6 20 86.4 … 2.5 … 3.03 6.07 2:1 2 F7 20 83.9 … 5 … 3.03 6.07 2 F8 20 80.9 … 8 … 3.03 6.07 2 F9 20 80.9 8 … 3.03 6.07 2 F10 20 80.9 … 8 3.03 … 6.07 2 F11 10 80.9 … 8 … 3.03 6.07 2 F12 Iraqi J Pharm Sci, Vol.31(1) 2022 Lornoxicam-loaded cubosomes 146 Variables affecting formulation Different variables were studied to investigate their effects on the prepared LXM- loaded cubosomal dispersion properties. This result may be because 20min agitation had provided enough time for greater penetration of the oil phase and hydrophobic region of the Pluronic® F127 and, for ethanol to coat the cubosomal particles and confers some degree of electric stabilization that may finally lead to a size reduction of the cubosomes, by reducing particle aggregation risk and enhance the retention of drug in cubosomal particles thus increase the cubosomal EE%.
    • keywords: agitation; aqueous; buffer; concentration; content; crystalline; cubic; cubosomal; cubosomal dispersions; cubosomes; data; delivery; different; dispersions; dissolution; drug; effect; efficiency; entrapment; entrapped; ethanol; evaluation; f10; f11; f127; figure; formulas; formulations; glycol; high; hydrotrope; increase; international; iraqi; journal; lipid; liquid; loaded; lornoxicam; low; lxm; mean; medium; min; mixture; nanoparticles; oil; optimum; particle; particle size; pdi; pharmaceutics; phase; phosphate; pluronic; potential; preparation; prepared; properties; propylene; range; release; results; sci; size; skin; solution; stability; stabilizer; structure; study; surface; sustained; systems; table; time; tween; types; value; value<0.05; vol.31(1; water; zeta
    • versions: original; plain text
82. bijps-1288
    • author: Mohamed Koya, M V; Koya, Saiful; Rahman Hazirah, Abd; Nurul Syahida, Radzuan
    • title: The Difference in Contributing Factors and Costs Associated with Outpatient Refusal to Accept Cardiovascular Medications or Analgesics During Dispensing Process.
    • date: 2021-12-11
    • words: 4646
    • flesch: 50
    • summary: Difference in factors and cost between refused CVD medications and analgesics CVD medicine Analgesic X2 df P-value Age (years) 60.0 (19.0) 63.5 (14.0) 0.136 Gender (n,%) * Male 69 (67.0) 29 (40.3) 12.272 1 <0.05 Female 34 (33.0) 43 (59.7) However, higher cost of refused medication was observed for CVD medicines.
    • keywords: activities; adherence; analgesics; blockers; cardiovascular; cost; current; cvd; cvd drugs; cvd medicines; daily; data; df=; dispensing; dose; dosing; drugs; effects; factors; health; higher; home; hospital; iqr; iraqi; median; medication; medicines; number; outpatient; p<0.05; participants; patients; percentage; pharmacists; pharmacy; pill; polypharmacy; prescribed; prescription; prn; process; reasons; refusal; research; researchers; sci; study; tdm; tdpb; total; treatment; unused; usd; use; vol.30(2; wastage; waste; years
    • versions: original; plain text
83. bijps-1291
    • author: Gh. Jawad, Hani; S. Saleh, Eman; M. Younus, Manal
    • title: Medication Safety in Patients under 18 Years Old; a Retrospective Study based on Iraqi Pharmacovigilance Center Database
    • date: 2020-12-29
    • words: 4578
    • flesch: 58
    • summary: Adverse drug reaction is defined as any harm resulted from the drug itself during medical process journey, while medication errors are any harm resulted from the treatment process rather than the drug or it is the result of the failure in a step of the treatment process and by that it came clear that adverse drug reaction in non-preventable event while medication error is preventable one. %59.43(. مرحلة كتابة الوصفة كانت األكثر غالبيةً بنسبة )49.53%)
    • keywords: ade; administration; adr; adverse; adverse drug; age; available; baghdad; care; case; center; children; classification; clinical; count; counter; criteria; data; database; disorders; dispensing; drug; errors; event; failure; grand; group; health; hospital; inappropriate; incorrect; infants; internet; iraqi; medical; medication; medication errors; medicines; method; monitoring; non; number; patients; pediatric; pharm; pharmacovigilance; phase; prescribing; prescription; prevalence; preventable; process; reaction; reports; result; safety; sci; skin; study; subcutaneous; system; table; tissue; total; treatment; type; use; vol.29(2; world; years; الدوائية; العالجية; المركز; دراسة
    • versions: original; plain text
84. bijps-1294
    • author: Thamer, Aseel Kadhem; Abood, Ahmed Najem
    • title: Preparation and In vitro Characterization of Aceclofenac Nanosuspension (ACNS) for Enhancement of Percutaneous Absorption using Hydrogel Dosage Form
    • date: 2021-12-09
    • words: 6758
    • flesch: 58
    • summary: The PXRD patterns of AC pure drug showed a sharp diffraction peaks indicating the crystalline nature of the drug as a consequence of different arrangement of the molecules in the crystal lattice. Compositions of AC NS.s formulas using different stabilizers at different drug: stabilizer ratios with constant volume of injected organic solution (2 ml).
    • keywords: ac powder; aceclofenac; agglomeration; analysis; anti; area; average; best; blank; buffer; carbopol; characterization; code; concentration; crystalline; delivery; design; determination; determined; development; different; diffusion; dispersion; dissolution; drug; dsc; effect; efficiency; enhancement; ethanol; evaluation; f11; f15; figure; formulas; formulation; ftir; good; hpmc; hydrogel; improved; increase; int; iraqi; iraqi j; j pharm; journal; k25; measurement; media; melting; methods; nanoparticles; nanosuspension; non; ns.s; order; particle; particle size; pdi; pharm; pharm sci; pharmaceutical; phosphate; physical; point; poloxamer; polymer; polymeric; powder; precipitation; preparation; prepared; prepared ac; prepared formulas; properties; pure; pvp; pxrd; range; rate; release; results; room; rpm; samples; sci; selected; sem; shear; significant; size; smaller; solid; solubility; soluble; solvent; stability; stabilization; stabilizer; stretching; study; surface; table; technol; temperature; time; topical; values; viscosity; vol.30(2; water; باستخدام
    • versions: original; plain text
85. bijps-1295
    • author: Merdaw, Maysoon Abdul zahra; Kasim, Ali Abdulhussain; Salih, Mahmood Kahtan
    • title: Seroprevalence of Toxoplasma Gondii in Parkinson’s Disease Iraqi Patients
    • date: 2021-12-09
    • words: 4032
    • flesch: 56
    • summary: Fallahi S, Rostami A, Birjandi M, Zebardast N, Kheirandish F, Spotin A. Parkinson’s disease and Toxoplasma gondii infection: Sero- molecular assess the possible link among patients. Wilking H, Thamm M, Stark K, Aebischer T, Seeber F. Prevalence, incidence estimations, and risk factors of Toxoplasma gondii infection in Germany: a representative, cross-sectional, serological study.
    • keywords: age; analysis; anti; antibody; antitoxoplasma; associated; association; baghdad; brain; chronic; clinical; college; correlation; difference; disease; disease patients; dopaminergic; duration; factors; family; female; frequency; gender; gondii; gondii infection; higher; history; idiopathic; igg; igm; infection; iraqi; journal; latent; logistic; neurodegeneration; parkinson; patients; pd duration; pd patients; pharm; positive; potential; prevalence; research; residence; results; risk; sci; seronegative; seropositive; seropositivity; seroprevalence; serum; smoking; studies; study; table; toxoplasma; toxoplasma gondii; toxoplasma igg; toxoplasma infection; toxoplasmosis; variables; vol.30(2; yes; zone; التوكسوبالزما; العراق; المضادة; باركنسون; داء; مرضى
    • versions: original; plain text
86. bijps-1302
    • author: Mahdi Mutlak, Qassim; Abdulridha, Manal Khalid; M Abbas Al-Huseini, Laith
    • title: Study the Distribution of Rotavirus Genotypes in Vaccinated and non Vaccinated Children in Babylon Province
    • date: 2021-12-11
    • words: 5724
    • flesch: 52
    • summary: In the developing countries, rotavirus vaccines continued to be frequently assessed due to easy approach to reach target populations with much more strain diversity and immunogenicity of vaccines thatcould decrease immunization program performance (19). It may also explain why children are still susceptible to infection although they were fully vaccinated and why the prevalence of rotavirus gastroenteritis remains high after five years of introducing rotavirus vaccine in the Iraqi national immunization program.
    • keywords: 0.5μl; acute; agarose; association; babylon; buffer; cases; characterization; children; circulating; countries; data; device; diarrhea; difference; disease; distribution; dsrna; duration; effectiveness; efficacy; electrophoresis; findings; following; free; g2p[4; gastroenteritis; gel; genomic; genotypes; genotyping; health; higher; hospital; human; immunization; infection; introduction; iraqi; journal; lane; min; mixed; mixture; months; national; non; nucleases; number; pcr; pediatr; percentage; pharm; positive; primary; primer; product; protection; protocol; reaction; room; rotarex; rotavirus; rotavirus genotypes; rotavirus infection; rotavirus vaccine; round; sample; sci; severe; significant; size; solution; status; strains; study; table; temperature; time; total; tube; university; vaccinated; vaccination; vaccine; value; vol.30(2; vp7; water; world; years; األطفال; الجيني; الروتا
    • versions: original; plain text
87. bijps-1309
    • author: Rashad, Sayed; El-Chaghaby, Ghadir
    • title: Algae Bioactive Constituents and Possible Role During COVID-19 Pandemic (A review)
    • date: 2021-12-09
    • words: 4893
    • flesch: 52
    • summary: et al., Antiviral activity of an aqueous extract from the red alga Laurencia obtusa against influenza A and B viruses. Ding L, Chan Gutierrez E and Cheng J, et al. Assessment of continuous fermentative hydrogen and methane co-production using macro- and micro-algae with increasing organic loading rate.
    • keywords: acid; activities; activity; agents; algae; algae algae; algae bioactive; antibacterial; antioxidant; antioxidant activity; antiviral; antiviral activity; appl; applications; bioactive; bioactive compounds; biol; biological; biomass; biotechnological; brown; cell; chaghaby; chemical; chlorella; compounds; content; covid-19; current; cyanobacteria; development; different; diseases; diverse; drugs; effects; egypt; elsevier; environmental; et al; extract; factors; fish; food; freshwater; green; green algae; group; growth; health; herpes; high; hsv; human; industry; infection; inhibitory; int; iraqi; isolated; j pharm; large; laurencia; lectins; like; marine; marine algae; metabolites; microalgae; microorganisms; morais; natural; nutrients; oxidative; pandemic; pharm sci; pharmaceutical; photosynthetic; phytochemical; plant; platensis; polysaccharides; polysiphonia; possible; potential; present; production; products; properties; rashad; red; review; role; sci; seaweed; sharma; simplex; source; species; spirulina; studies; sustainable; therapeutic; therapy; type; use; value; virus; viruses; vitamins; vol.30(2; water; wide; الطحالب; بيولوًيطا
    • versions: original; plain text
88. bijps-1310
    • author: Abbas, Maha Diekan; Egbe, Solomon Sahoon
    • title: The Seroprevalence of CMV in Women with Bad Obstetric History in Babil/Iraq
    • date: 2021-12-11
    • words: 3910
    • flesch: 60
    • summary: Iraqi J Pharm Sci, Vol.30(2) 2021 Seroprevalence of CMV in women with bad obstetric history in Babil/Iraq DOI: https://doi.org/10.31351/vol30iss2pp106-112 106 Seroprevalence of CMV in Women with Bad Obstetric History in Babil/Iraq Maha Diekan Abbas*,1 and Solomon Egbe** * Department of Biotechnology, College of Biotechnology, Al-Qasim Green University, Al-Qasim, Iraq. Amongst Arab countries, seroprevalence in pregnant women varies from 77.8% (Iraq) to 88% (Jordan) (8, 9).
    • keywords: aborted; abortion; age; analysis; association; average; babies; babil; babylon; bad; bad obstetric; boh; children; cmv; cmv_igg; congenital; control; cytomegalovirus; data; district; effective; good; group; hamza; hcmv; higher; highest; history; igg; igm; infection; iraq; levels; local; med; missing; obstetric; obstetric history; old; old women; overcrowded; pharm; population; positive; pregnancy; pregnant; rate; region; sample; sci; screening; seropositivity; seroprevalence; status; study; subjects; table; total; value; viral; vol.30(2; women; yr age; yr old; العراق; المضخم; بين; للخاليا
    • versions: original; plain text
89. bijps-1311
    • author: Mohammed, Samer Imad; Sabry, Aya Thaer; Sabry, Dania Thaer
    • title: Assessment of Health Beliefs Among Iraqi Breast Cancer Patients in Baghdad using either Tamoxifen or Trastuzumab
    • date: 2021-12-11
    • words: 5501
    • flesch: 61
    • summary: This study investigates the beliefs concerning Tamoxifen and Trastuzumab, which are two effective and widely used adjuvant therapies prescribed for breast cancer patients. The findings of the current study have shown that the participants are primarily between 40-60 years of age and that, in line with previous studies(21,28) conducted in Iraq, which showed the peak age frequency for breast cancer patients is between 40- 60.
    • keywords: abstract; adherence; adjuvant; age; articles; association; available; baghdad; beliefs; bmq; breast; breast cancer; cancer; cancer patients; chemotherapy; clinical; concern; correlation; data; demographic; difference; duration; early; effects; endocrine; findings; group; health; her2; higher; horne; https://; internet; iraqi; iraqi breast; iraqi j; jan; level; life; long; mean; medication; medicines; metastatic; months; necessity; need; negative; non; oncology; participants; patients; percentage; pharm; pharmacy; positive; prescribed; quality; questionnaire; questions; receptor; research; results; scale; sci; score; significant; specific; study; table; tamoxifen; term; therapies; therapy; trastuzumab; treatment; university; use; users; value; vol.30(2; women; years; الثدي; الضرورة; القلق; تاموكسيفين; تراستوزوماب; عقار
    • versions: original; plain text
90. bijps-1318
    • author: Jasim, Walaa H.; N. Hamad, Maha
    • title: Extraction and Identification of Phenolic Compounds from the Iraqi Heliotropium europaeum L. plant
    • date: 2021-12-11
    • words: 3313
    • flesch: 54
    • summary: Identification of phenolic compounds in Heliotropium europaeum plant extract Identification of phenolic compounds in Heliotropium europaeum plant extract 1.
    • keywords: 1ml; acetate; acetate fraction; acid; addition; alkaloids; analysis; baghdad; boraginaceae; butanol; chromatogram; chromatography; compounds; concentration; constituents; detection; different; ethyl; ethyl acetate; europaeum; extract; extraction; figure; food; fraction; genistein; heliotropium; heliotropium europaeum; hplc; hydrolysis; identification; iraqi; journal; kaempferol; layer; liquid; methanol; min; mobile; parts; pharm; phenolic; phytochemical; plant; pyrrolizidine; quantitative; sample; sci; separation; silybin; solution; solvent; spectrum; standards; study; syringic; system; table; technique; test; thin; vol.30(2
    • versions: original; plain text
91. bijps-1321
    • author: Raheema, Dheyaa A; Kassab, Hanan Jalal
    • title: Preparation and in-vitro Evaluation of Secnidazole as Periodontal In-situ Gel for Treatment of Periodontal Disease
    • date: 2022-12-23
    • words: 7167
    • flesch: 60
    • summary: Formulation and evaluation of in situ gels containing clotrimazole for oral candidiasis. Secnidazole vaginal in situ gel formulations were prepared by Karthick et al., using 0.45% of Carbopol 940 with 0.35% HPMC K4M and the 0.35% of Carbopol 940 with 0.35% hydroxy propyl cellulose HPC these formulations also released less than 50% of drug in simulated vaginal fluid at the end of 8 hours (19).
    • keywords: activity; anaerobic; appearance; appropriate; capacity; carbopol; cause; chain; clear; clear liquid; cmc; cold; concentration; content; delivery; dental; determination; different; disease; dissolution; drug; drug release; effect; evaluation; f29; f30; figure; force; formulas; formulation; gel; gel formulas; gel strength; gelation; gelation temperature; gelling; gels; good; high; higher; hours; hpmc; hydrogen; hydrophobic; hydroxypropyl; increase; int; iraqi; iraqi j; j pharm; layers; liquid; local; lower; method; methylcellulose; minutes; modeling; molecular; mucoadhesive; mucosa; ophthalmic; oral; p188; p407; periodontal; periodontitis; pharm; pharm sci; pocket; poloxamer; polymer; preparation; prepared; range; release; required; res; results; rpm; sc periodontal; sci; secnidazole; secnidazole dental; situ; situ gel; solution; spreadability; ssf; strength; studies; study; system; table; temperature; test; thermosensitive; thick; time; transition; treatment; type; value; vial; viscosity; vol.31(2; water; weight; ° c; الهالم; الى; درجة
    • versions: original; plain text
92. bijps-1331
    • author: Emad, Hayder; Nazar Abd-Alhammid , Shaimaa
    • title: Improvement of the Solubility and Dissolution Characteristics of Risperidone via Nanosuspension Formulations
    • date: 2022-06-09
    • words: 6548
    • flesch: 56
    • summary: The dispersed formula was tested for the particle size and polydispersity index and the results showed that the particle size was 60.5 nm which is higher than the particle size of the same formula when it was nanosuspension and the PDI of the lyophilized powder was 0.115 which is also higher which was 0.101 The Zeta potential of the lyophilized F13 formula showed -18.96 mv which is similar to the value obtained before lyophilization which indicates the robust formulation by the action of the selected polymer with risperidone drug particles and last durable after freeze-drying. It can be seen that lyophilized F13 formula nanosuspension showed a very characteristic enhancement in drug release when compared to the pure drug with faster and complete drug release within 30 min when compared to the pure drug.
    • keywords: 0.1n; acetone; analysis; antisolvent; aqueous; best; buffer; change; characterization; class; decrease; determination; different; dissolution; distribution; dopamine; drug; drying; effect; enhancement; evaluation; f13; factor; figure; formula; formulation; freeze; hcl; higher; increase; index; iraqi; j pharm; journal; k-30; k30; lyophilization; lyophilized; media; medium; methanol; method; min; nanoparticles; nanosuspension; paddle; particle; particle size; pdi; pharm; pharmaceutical; phosphate; poloxamer; poloxamer188; poloxamer407; polydispersity; polymer; potential; powder; precipitation; preparation; prepared; profile; pure; pvp; range; rate; ratio; release; results; risperidone; risperidone nanosuspension; rpm; sample; saturation; scanning; sci; sem; significant; similarity; size; solubility; soluble; soluplus; solvent; speed; stability; stabilization; stabilizers; stirring; study; system; table; time; type; value; vol.31(1; volume; water; zeta; الريسبيريدون
    • versions: original; plain text
93. bijps-1333
    • author: Moustafa, Mayada M.; kasim, Ali Abdulhussain; Al-Janabi, Rawaa Dawood
    • title: Association of Age, Parity and Body mass Index with Hemoglobin and Serum Ferritin Levels in Pregnant Women in Baghdad City
    • date: 2021-12-11
    • words: 3376
    • flesch: 65
    • summary: (19) On the other hand, the present study showed that 13.3% (4 of 30) of the non- pregnant participants have mean Hb concentration less than 11 gm/dL. Using the cut-off point of Hb for diagnosis of anemia in non-pregnant women is 11.9 will escalate the percent of anemic non-pregnant participants to 23.3% (7 of 30). The negative correlation of parity with blood Hb concentration was reported in participants in the third trimester of pregnancy (r= -0.270, P=0.048); and between parity and plasma ferritin levels in the second (r= -0.088, P= 0.046) and third (r= -0.398, P=0.029)
    • keywords: age; anemia; association; baghdad; blood; blood hb; bmi; body; concentrations; control; correlation; data; deficiency; factors; ferritin; ferritin levels; groups; gynecology; health; index; iraqi; iron; journal; levels; low; markers; mass; maternal; mean; negative; non; obstetrics; parity; participants; plasma; pregnancy; pregnant; pregnant participants; pregnant women; present; risk; second; serum; serum ferritin; significant; study; table; trimester; value; vs.; women; الدم; الهيموغلوبين; بغداد; عدد; مرات
    • versions: original; plain text
94. bijps-1335
    • author: Zalzala, Munaf Hashim; S. Kareem, Victoria
    • title: The Safranal Effect against Cyclophosphamide-Induced Liver Injury
    • date: 2021-12-11
    • words: 3852
    • flesch: 51
    • summary: # compared with model CP group significant different, (p<0.05). # compared with model CP group significant different, (p<0.05).
    • keywords: 100mg; 50mg; acute; alt; antioxidant; apoptosis; ast; cell; control; control group; cyclophosphamide; damage; day; days; dependent; different; dose; effect; enzymes; expression; factor; fifth; genes; glutathione; group; gsh; hepatic; hepatotoxicity; i.p; increase; inflammation; inflammatory; injury; iraqi; level; lipid; liver; manner; mda; mean; mitochondrial; model; normal; nrf2; nuclear; oxidative; oxygen; p<0.05; peroxidation; pharm; protein; radical; rats; relative; saffron; safranal; sci; serum; significant; stress; study; table; tissue; toxicol; values; vol; vol.30(2; ±sd
    • versions: original; plain text
95. bijps-1343
    • author: Abdel-GAbbar, Mohammed; Alkot, Mohammed ; Abdel-Moneim, Adel
    • title: Effectiveness of Ombitasvir with Paritaprevir/Ritonavir plus Ribavirin on the Treatment of Naïve Patients with Chronic Hepatitis C Virus Genotype 4
    • date: 2022-06-12
    • words: 4560
    • flesch: 57
    • summary: Going ahead, the standard of care for chronic HCV patients is a combination of two to four DAAs (9). Discussion Recently, oral DAAs combination regimens are currently achieving viral outcome more than 90% of HCV patients after treatment of 12 weeks (9).
    • keywords: abdel; adverse; aes; agate; analysis; beni; c virus; chronic; chronic hepatitis; cirrhosis; clinical; combination; daas; data; dose; efficacy; egyptian; et al; events; experienced; failure; fatigue; genotype; gt4; hcv; headache; hepatitis; hepatol; infected; infection; iraqi; laboratory; liver; moneim; naive; non; obv; ombitasvir; outcome; overall; paritaprevir; patients; pharm; protocol; ptv; rates; rbv; real; regimen; response; results; ribavirin; ritonavir; rna; safety; sci; serum; study; suef; svr12; table; therapy; tolerability; treatment; trial; viral; virologic; virus; vol.31(1; weeks; العالج
    • versions: original; plain text
96. bijps-1351
    • author: Ibrahim, Manal Abdulkhaliq; Khudhair, Alaa Radhi; AL-shawi, Nada Najia
    • title: Possible Protective Effects of Omega 3, Diazepam and their Combination Against Yohimbine-Induced Clonic Seizure in Mice: Comparative Study
    • date: 2021-12-12
    • words: 5240
    • flesch: 66
    • summary: Table 1 and figure 3. Iraqi J Pharm Sci, Vol.30(2) 202 Omega-3 diazepam as antiepileptic drug against yohimbine induced clonic seizure in mice 244 Observation the number of clonic seizures at 90-120min in the studied groups Table 1 and figure 4 showed that there were significant different (P<0.05) in the number of clonic seizure at 90-120min in Group I (yohimbine- treated) mice (6.5±0.341) compared to that in Group II (Diazepam +yohimbine HCl) (0±0) and Group IV (omega 3 fatty acids +Diazepam + yohimbine HCl) mice (0±0); but there were non- significant (P>0.05) in the number of clonic seizure at 90-120min in Group I (6.5±0.341) compared to that in Group III mice (5.66±0.494). In addition, table 1 and figure 4 showed that there were significant difference (P<0.05) in the number of clonic seizure at 90-120min in Group III (Omega 3 fatty acids +yohimbine HCl) (5.66±0.494) compared to that in Group IV mice (omega 3 fatty acids +Diazepam +yohimbine HCl) (0±0).
    • keywords: 0±0; 2mg; 45mg; 90min; acids; administered; animals; antiepileptic; attack; baghdad; body; brain; changes; clin; clonic; clonic seizures; college; combination; diazepam; difference; dmso; dose; drug; effect; epilepsia; epilepsy; fatty; fatty acids; figure; frequency; group; group iii; group iv; hcl; iii; iraqi; mean; mice; min; n-3; non; number; omega; omega-3; onset; p<0.05; patients; percent; pharm; pharmacology; pharmacy; rats; role; s.e.m; sci; seizures; significant; study; symbol; table; time; treatment; university; vol.30(2; yohimbine; yohimbine hcl; أوميغا; كجم; مجم; يتم
    • versions: original; plain text
97. bijps-1361
    • author: Mikhael, Ehab Mudher
    • title: Community Pharmacists' Attitudes and Practice in the Management of Minor Ailments
    • date: 2021-12-11
    • words: 3761
    • flesch: 65
    • summary: Keywords: Minor ailments, Community pharmacists, Attitudes and practice. Despite all these benefits for management of minor ailments by community pharmacists, this job may be dangerous if inappropriately performed.
    • keywords: ailments; assessment; attitudes; baghdad; cases; common; community; community pharmacists; counseling; current; data; demographic; dosing; effect; experience; factors; gender; information; iraqi; main; management; medication; minor; minor ailments; participants; participated; patient; pharmacists; pharmacy; physician; possible; practice; questionnaire; questions; regard; regimen; role; sci; self; services; studies; study; symptoms; table; technique; treatment; use; vol.30(2; working; wwham; years; البسيطة; الصيادلة
    • versions: original; plain text
98. bijps-1371
    • author: Sahib, Hayder B; Muhammad Hamid, Zeena
    • title: The Acute Toxicity of Rutin in Mice
    • date: 2021-12-12
    • words: 4943
    • flesch: 58
    • summary: 6±0.28 4.95±0.35 6.45±0.77 6.3±0.28 5.95±0.07 5.2±0.28 5.05±0.35 HGB g/dl 14.25±0.77 13.7±0.84 13.9±0.14 14±1.41 13.35±0.49 13.4±0.56 13.5±0.70 The results of Histopathological examination of vital organs after staining with Hematoxylin and eosin (H and E) stain revealed there are no significant histopathological changes in tissue (p˃0.05) of rutin treated mice at dose 1.25, 0.625 and 0.312 g/kg for male and female mice when compare with the tissue of control group as shown in the following figures: Figure 5. Table 1.Sign observed after rutin administration to male mice dose gm/kg T/M The period at sign observed sign of toxicity No.of mice dead at this period 5 5/5 5 mint_15 mint Clonic convulsion, loss of gait, miosis, muscular fasciculation , tachycardia, dyspnea, lacrimation, death(+++) 2 15mint_4hrs hypoactivity, asthenia, abdominal contract, diarrhea, atypical locomotion, back limbs failling, bardycardia, dyspnea, death(++) 2 4hrs_6hrs bradycardia, atypical locomation, piloerection, asthenia ,dyspnea and death(+) 1 2.5 5/5 5 mint_15 mint clonic convulsion, loss of gait, miosis, muscular fasculation, tachycardia, dyspnea ,lacrimation, death(+++) 2 15mint_4hrs hypoactivity, asthenia ,abdominal contract, diarrhea, atypical locomotion ,back limbs failling , bardycardia, dyspnea, death(++) 1 4hrs_6hrs bradycardia,atypical locomation,piloerection,asthenia,dyspnea and death(+) 1 24-48 hrs.
    • keywords: abdominal; acetylcholinesterase; acute; administration; analysis; animals; asthenia; atypical; available; biochemical; blood; body; bradycardia; cell; changes; clonic; contract; control; control dose; control group; convulsion; day; days; death(++; diarrhea; difference; dose; drugs; dyspnea; effects; eosin; evaluation; fasculation; female; female mice; figure; food; gait; group; heart; hematological; histopathological; hrs; hypoactivity; increase; inflammatory; internet; iraqi; kg rutin; kidney; lacrimation; ld50; level; limbs; liver; locomotion; loss; mean±; mice; mint; miosis; mortality; muscular; non; normal; oral; percentage; period; pharm; pharmacol; piloerection; quercetin; rats; results; rutin; sci; section; sex; significant; single; stain; structure; studies; study; substance; table; tachycardia; tissue; toxicity; toxicological; vol.30(2; weight; كجم
    • versions: original; plain text
99. bijps-1376
    • author: Al-Janabi, Ismail Ibrahim
    • title: G Protein-Coupled Receptors: Undervalued Targets for Cancer Therapy
    • date: 2022-06-09
    • words: 12164
    • flesch: 54
    • summary: Cancer cells hijack these communication networks to their proliferative advantage. Cancer cells are capable of deregulating these chemical signals and divide out of the strict overall control (51).
    • keywords: acid; action; activation; active; activity; adenylyl; adhesion; adra2a; adrenergic; alternative; amino; angiogenesis; apoptosis; associated; axis; balance; basal; bcc; biased; binding; biological; blood; breast; cancer; cancer cells; cancer therapy; cancer types; canonical; capable; carcinogenesis; cascade; catenin; ccr5; cells; cellular; certain; cervical; chemokine; chemokine receptors; class; cognate; common; complex; conformational; control; coupling; cross; current; cxcl12; cxcr4; cyclase; damage; death; dependent; development; different; discovery; disease; division; dna; downstream; drugs; effective; effects; egfr; evidence; example; expression; extracellular; factor; families; family; figure; form; frizzled; function; future; fzd; fzds; g protein; gdp; genes; genome; glutamate; gpcrs; growth; gtp; guanosine; gαi; gβɣ; hallmarks; hedgehog; heterotrimeric; hormone; hormone receptor; human; immune; important; increase; inflammation; initiation; inside; involvement; iraqi; journal; kinase; large; largest; ligand; liu; lpa; lpar1; lysophosphatidic; main; matrix; mc1r; mechanisms; melanocortin; melanoma; members; metabolism; metastasis; migration; molecular; molecules; multiple; mutations; nature; new; normal; number; oncogene; oncogenic; orphan; overall; pathways; patients; pharm; plerixafor; potential; presence; primary; process; progression; proliferation; protein; range; receptors; research; residues; resistance; reviews; rhodopsin; robert; role; s1pr1; sci; second; signalling; signals; site; skin; small; smo; smoothened; specific; state; strategy; stromal; structure; studies; subfamily; survival; system; table; targeting; targets; therapeutic; therapy; thyroid; tissue; transduction; transmembrane; treatment; trends; tshr; tumorigenesis; tumour; types; variety; vismodegib; vol.31(1; wang; wide; wnt; yang; المستقبالت; هذه
    • versions: original; plain text
100. bijps-1384
     • author: Tamri, Pari; Pourmoslemi, Shabnam; Moradkhani, Shirin; Foroughinia, Sahar
     • title: Evaluation of Synergistic Antibacterial Effect of Combined Scrophularia striata Extract and Antibiotics Against Pseudomonas aeruginosa and Methicillin -Resistant Staphylococcus aureus
     • date: 2021-12-11
     • words: 3689
     • flesch: 46
     • summary: This test determines the impact on antibacterial activity of the combination of Iraqi J Pharm Sci, Vol.30(2) 2021 The augmentation of antibacterial activity of Vancomycin by SSE could be a result of SSE antibacterial activity or modifying the mechanism of acquired resistance.
     • keywords: activity; additive; aeruginosa; agents; antibacterial; antibacterial activity; antibiotics; antimicrob; aureus; cell; combination; combined; concentration; determination; determined; effects; extract; fic; figure; gentamicin; growth; hamadan; index; infections; interaction; iran; iraqi; mbc; membrane; methicillin; mic; mrsa; pharm; pharmacy; pip; plants; plates; pseudomonas; research; resistance; results; s. striata; sci; sciences; scrophularia; solution; sse; standard; staphylococcus; striata; studies; study; synergistic; test; university; vancomycin; vol.30(2; wells
     • versions: original; plain text
101. bijps-1394
     • author: Husni, Muhammad Ali; Nugroho, Akhmad Kharis; Sulaiman, Teuku Nanda Saifullah; Fakhrudin, Nanang
     • title: Microencapsulation of Green Coffee Beans (Coffea canephora) Extract using Whey Protein Concentrate
     • date: 2022-06-09
     • words: 6291
     • flesch: 53
     • summary: The use of maltodextrin as a wall material in GCB extract microencapsulation increased the antioxidant capacity from 414.8 to 425.9 μmol Trolox/g(31); whereas the use of glucomannan as a wall material in the microencapsulation of roasted coffee extract increased DPPH scavenging activity from 619.21 to 813.3 µM Trolox/g(35). In addition, the difference in the type of coffee extract also contributed to the variability of caffein content.
     • keywords: abrahão; abs; absorbance; acetate; acid; activity; al(21; analysis; antioxidant; aroma; bean; bioactive; caffeine; caffeine content; cga; characteristics; chlorogenic; coffee; coffee extract; compounds; concentrate; concentration; content; data; decrease; desai; diameter; dpph; drying; effect; ethanol; ethyl; extract; extraction; feed; figure; food; gae/100; gcb; green; green coffee; health; https://doi.org/10.31351/vol31iss1pp20-31; indonesia; inlet; iraqi; lower; maltodextrin; mass; material; mean; microcapsule; microencapsulation; min; mode; morphology; particle; pharm; phenolic; physical; plant; procedure; process; protein; radical; retention; sample; scavenging; sci; size; smaller; solution; span; spectrometry; spray; standard; study; table; technol; temperature; time; total; tpc; type; unpleasant; use; value; vol.31(1; wall; water; whey; wpc; yield
     • versions: original; plain text
102. bijps-1411
     • author: Alsaedi, Areej Atheer; Kadhim, Dheyaa j.; Younus, Manal M.
     • title: Gender Differences in Adverse Drug Reactions Among Adult Patients Reported to the Iraqi Pharmacovigilance Center
     • date: 2021-12-12
     • words: 6970
     • flesch: 62
     • summary: من األعراض الجانبية فيما إذا ما قورنت النسبة بالفئة العمرية المماثلة م % في 22.6% Abstract For many years it was argued that there may be a gender differences in adverse drug reactions (ADRs).
     • keywords: addition; adrs; adverse; adverse drug; agents; analysis; assessment; atc; available; cardiovascular; case; causality; center; chi; classification; clinical; combinations; criteria; data; database; differences; different; disorders; distribution; drug; drug reactions; expectedness; females; finding; freq; frequency; gender; gender differences; group; health; higher; highest; icsr; important; individual; information; internet; iraqi; laboratory; level; male gender; medical; medications; number; outcome; p value; patient; percentage; pharmacovigilance; pharmacy; place; possible; preventability; preventable; reactions; related; reported; reporting; reports; safety; sci; seriousness; severity; sex; significant; significant differences; soc; specific; spontaneous; square; studies; study; suspect; system; systemic; table; test; time; total; treatment; use; value; vol.30(2; years; yes; الجانبية; الجنسين; الدوائية; بين; هذه
     • versions: original; plain text
103. bijps-1412
     • author: Hassan, Elaaf Fadhil; Kadhim, Dheyaa j; Younus, Manal m
     • title: Safety Profile of Biological Drugs in Clinical Practice: A Retrospective Pharmacovigilance Study
     • date: 2022-06-09
     • words: 6703
     • flesch: 53
     • summary: Rituximab was found to be the drug with the highest number of adverse drug reactions with 241 adverse drug reactions (26.81% out of total adverse drug reactions). Regarding severity of adverse drug reactions, the majority of adverse drug reactions were observed in moderate levels [Level 4 (26%), and Level 3 (18%)].
     • keywords: administration; adrs; adults; adverse; adverse drug; age; agents; alfa; analysis; antibodies; arthritis; assessment; available; baghdad; biological; biological drugs; care; case; center; classification; clinical; conditions; count; criteria; current; data; database; diseases; disorders; distribution; drug; drug reactions; effects; elderly; european; events; expectedness; females; gender; general; group; health; higher; highest; icsrs; increase; individual; infections; information; interferon; iraqi; level; life; majority; medical; medication; medicinal; mild; ministry; moderate; monitoring; monoclonal; non; number; outcome; patients; percentage; pharmacovigilance; pharmacy; plos; practice; preventability; preventable; product; profile; reactions; relation; reported; reporting; reports; research; result; rheumatoid; risk; rituximab; safety; safety profile; sci; section; seriousness; severe; severity; significant; site; studies; study; system; table; therapy; total; treatment; unknown; use; value; vigiflow; vol.31(1; years; التفاعالت; الدوائية; الضارة
     • versions: original; plain text
104. bijps-1415
     • author: Jaafar, Noor Sabah; Jaafar, Iman S; Noori, Zainab S
     • title: Cressa cretica Pharmacognosy, and Pharmacology (A review )
     • date: 2021-12-09
     • words: 6196
     • flesch: 58
     • summary: The evaluation of ethyl acetate fraction of Cressa cretica effect on mitotic index and micronucleous Frequency in Mice. Abstract Cressa cretica (Shuwwayl) is a halophytic that belongs to Convolvulaceae, naturally grown in the Middle East including Iraq.
     • keywords: 100mg; acetate; acetate extract; acid; activity; aerial; affected; animals; antidepressant; antidiabetic; antifungal; antimicrobial; antioxidant; antitussive; antiviral; apigenin; aqueous; aspergillus; baghdad; bone; bot; c. cretica; candida; cells; chaudhary; chemical; chlorogenic; clinical; coli; college; compounds; concentration; control; convolvulaceae; cov-2; cressa; cressa cretica; cressa extract; cretica; cytotoxic; days; diabetes; dicaffeoylquinic; different; docking; dose; effect; et al; ethyl; ethyl acetate; extract; fatty; fever; figure; flavonoids; fractions; genotoxic; group; halophyte; hepatoprotective; hplc; important; inhibitory; int; iraqi; j pharm; jaafar; jha; khare; leaves; level; lignin; like; linn; liver; main; major; management; marrow; medicinal; memory; methanolic; mice; molecular; mutlag; noticeable; oil; parts; period; pharm; pharm sci; pharmacological; pharmacy; phenolic; phytochemical; plant; positive; potential; presence; quercetin; rani; rats; reduction; review; sars; sci; scopoletin; seeds; sitosterol; soil; south; spleen; stems; structure; studies; study; sunita; syringaresinol; test; time; treatment; university; ursolic; uses; vol.30(2
     • versions: original; plain text
105. bijps-1418
     • author: Al-Assaf, Issa; Khazem, Mays
     • title: Phytochemical screening and Free radicals scavenging activity of leaves of Echinops polyceras Boiss. grown in Syria
     • date: 2022-06-23
     • words: 4805
     • flesch: 55
     • summary: Scanning of extract solution (13): 1g of the aqueous extract was also dissolved with distilled water in a volumetric flask (100 ml), then 1 ml of the solution was transferred into another 100 ml volumetric flask with 10 ml of 0.1 N of hydrochloric acid, then distilled water was used to complete the rest volume to 100 ml. To 5 ml of ethanolic extract, 0.5 g of magnesium metal and 1 ml of concentrated HCl were added.
     • keywords: absorbance; acetate; acid; activity; antioxidant; aqueous; ascorbic; boiss; calibration; chemistry; chloride; chloroform; color; compounds; concentrations; content; coumarins; curve; detection; determination; dpph•; drops; echinops; effective; equation; ethanolic; etoh; extract; extraction; figure; flavonoids; food; formation; free; gae; gallic; identification; iraqi; leaves; methanol; microplate; min; pharm; phenolic; phytochemical; plant; polyceras; polyphenols; presence; qe/; quercetin; radicals; results; scavenging; sci; solution; standard; sugars; syria; table; test; tfc; tlc; total; tpc; vol.31(1; water; yield; الُحّرة
     • versions: original; plain text
106. bijps-1421
     • author: Abdul-Jabbar, Maha Amer; J. Kadhim, Dheyaa
     • title: Adherence to Different Treatment Modalities among Patients on Maintenance Hemodialysis
     • date: 2022-06-12
     • words: 4676
     • flesch: 55
     • summary: Conclusions The current study showed that the overall adherence of HD patients to different treatment modalities was less than optimum with fluid and diet adherence representing the most challenging aspects in the health care of hemodialysis patients. The recorded prevalence of non-adherence among HD patients varies widely, ranging from 22%-74% (9, 10).
     • keywords: adherence; age; answers; attendance; average; baghdad; chronic; ckd; clinical; counseling; current; dietary; different; disease; duration; esrd; fluid; good; health; hemodialysis; high; higher; hospital; important; iraqi; items; journal; kidney; level; low; lowest; maintenance; management; mean; medical; medications; medicines; modalities; moderate; negative; nephrology; non; nonadherence; number; nursing; patients; perception; pharm; poor; prescribed; prevalence; questionnaire; recommendations; renal; restriction; sci; score; shortening; significant; stage; status; study; table; total; treatment; treatment modalities; vol.31(1; االلتزام; الكلى; غسكي; كان
     • versions: original; plain text
107. bijps-1425
     • author: Yempada, Praveena; Marrisetti, Arya Lakshmi; Battu, Ganga Rao
     • title: In silico, In vitro studies of Anti-Oxidant and Anthelminthic Abilities of Phytoconstituents from Rhynchosia cana (Wild.) DC.
     • date: 2022-06-23
     • words: 7065
     • flesch: 60
     • summary: Results Phytochemical screening Preliminary phytochemical screening of various extracts of R. cana extracts revealed the presence of several phytoconstituents listed in Table 1. The molecular docking analysis was then carried out to establish compounds with good efficiency for anti-oxidant activity against the catalase, superoxide dismutase, glutathione-S-transferase, glutathione reductase, glutathione peroxidase and tubulin- colchicine enzyme for anthelmintic activity.
     • keywords: -5.8; -6.2; -7.1; a:58; acetate; acid; activities; activity; admet; affinity; amino; analysis; anthelmintic; anti; arg; ascorbic; asn; asp; behaviour; biological; c1c2; cana; catalase; cc(=o)c3; compounds; cyp450; cys; death; different; diseases; distance; docking; dpph; drug; earc; earthworms; effects; electrostatic; ether; extracts; figure; free; gallocatechin; genistein; glutathione; human; hydrogen; hydrophobic; ile; indian; inhibitor; interactions; iraqi; isoorientin; isovitexin; j pharm; kcal; ligands; mebendazole; medicinal; merc; methanol; methods; molecular; natural; new; orientin; oxidant; paralysis; pdb; perc; pharm; pharm sci; pharmacological; pheretima; phytochemical; phytoconstituents; plant; posthuma; potential; properties; r. cana; radical; reactive; receptor; representation; research; residues; results; rhynchosia; rhynchosia cana; scavenging; sci; ser; significant; silico; sites; species; standard; studies; table; test; thr; time; toxicity; use; val; vicenin-2; vol.31(1; water
     • versions: original; plain text
108. bijps-1426
     • author: Mohammed, Zahraa Sami; Hossain, Ahmed Obaid
     • title: Study the Effects of Anadrol Overdose on Liver Function in Male Rats
     • date: 2022-06-12
     • words: 3844
     • flesch: 53
     • summary: Photomicrograph of rat liver section of anadrol 10mg/kg group shows mild centrilobular inflammation (blue arrow) surrounded by normal hepatocyte (yellow arow), H&E stain 40 X. Anadrol 20 mg group Anadrol 20 mg group hepatic tissue Focal and multifocal Central to midzonal lobular region. Photomicrograph of rat liver section of anadrol 20mg / kg group shows moderate centrilobular inflammation (blue arrow) with increased cytoplasmic eosinophilia (yellow arrow) of surrounding hepatocyte, H&E stain 40 X. Anadrol 30 mg group Anadrol 30 mg group hepatic tissue Moderate to severe multifocal (centrilobular- midzonal-portal region) are necrotic.
     • keywords: affected; alt; aminotransferase; anabolic; anadrol; anadrol overdose; analysis; androgenic; arrow; ast; cell; centrilobular; changes; control; control group; cytoplasmic; daily; damage; drug; effects; elevated; enzymes; experimental; figure; findings; function; gavage; group; hepatic; hepatocyte; higher; histopathological; injury; iraqi; journal; level; liver; liver function; lobules; male; mean; mg group; mice; mild; moderate; multifocal; necrosis; necrotic; normal; oral; overdose; oxymetholone; pharm; rats; region; result; sci; score; section; serum; severe; significant; steroid; studies; study; system; tissue; toxicology; treatment; vol.31(1; weeks; االنادرول; الجرذان; الجرعة; الكبد; طريق
     • versions: original; plain text
109. bijps-1435
     • author: Alhakeem, Zainab; Kaisar Fakree , Najwan ; AbdulSamad Muhsen, Ahmed ; Majeed Hashim, Nuha
     • title: Some Pro and Anti-Inflammatory Cytokines in Children with Tonsillitis and their Correlations with Vitamin D Deficiency
     • date: 2022-06-18
     • words: 4435
     • flesch: 53
     • summary: Results Serum levels of different parameters were measured using ELISA technique in all studied groups and the results revealed a significant decrease (P<0.05) in Vitamin D level in both acute and chronic group (16.38 and 14.13 ng/ml respectively) as compared to the control group (30.91 ng/ml) (Table 1) (Figure 1). This study investigates the correlation between vitamin D level and inflammatory cytokines in children with tonsillitis.
     • keywords: acute; acute tonsillitis; age; anti; antiinflammatory; association; bacterial; baghdad; cat; cells; children; chronic; chronic tonsillitis; clinical; control; correlation; cytokines; deficiency; different; diseases; episodes; figure; groups; healthy; il-10; il-2; il-4; il2; il4; immune; immunity; immunol; increase; infection; inflammation; inflammatory; inflammatory cytokines; interleukin; iraqi; journal; levels; markers; modulation; non; number; p<0.05; patients; pharm; positive; pro; production; recurrent; response; results; sci; secretion; serum; significant; studies; study; system; table; th1; th2; tnfα; tonsillitis; tonsils; vitamin; vitamin d; vol.31(1; year; التهاب; اللوزتين; على; غرا; فيتامين; لاللتهاب; مليلتر; منانو
     • versions: original; plain text
110. bijps-1441
     • author: Al-Jumaili, Ali Azeez; Fahmi, Hiba Leith
     • title: Understanding the Experience of Hospital Pharmacists with the Effectiveness, Safety, Adverse Drug Reaction Reporting and Interchangeability of Biopharmaceutical Medicines
     • date: 2022-06-12
     • words: 8020
     • flesch: 39
     • summary: Keywords: Biological medicines, Biosimilar medicines, Biopharmaceutical medicines, Hospital pharmacists, effectiveness, safety, Interchangeability, Perceptions, Qualitative study. Iraq Abstract The study objectives were to 1) explore the real-world experience of hospital pharmacists with the differences in effectiveness safety, and interchangeability between biosimilar medicines and their reference biological counterparts, 2) reveal pharmacist recommendations to enhance the safety of biopharmaceutical medicines in public hospitals.
     • keywords: adequate; adrs; adverse; approval; arthritis; availability; available; baghdad; barriers; bevacizumab; biological; biological medications; biopharmaceutical; biopharmaceutical adrs; biopharmaceutical medicines; biosimilar; biosimilar medicines; bs pharm; center; city; clinical; comments; common; company; component; data; different; diseases; disorders; documentation; drug; effectiveness; effects; electronic; events; experience; face; fda; female; follow; future; general; health; healthcare; hospital; hospital pharmacists; infliximab; information; interchangeability; interviews; iqphvc; iraqi; j pharm; journal; jumaili; kidney; majority; means; medical; medications; medicines; moh; number; oncology; participants; patients; perceptions; pharmacist experience; pharmacists; pharmacovigilance; pharmacy; physicians; prescribing; products; public; qualitative; reactions; recommendations; records; reference; reference biological; regulations; relies; reported; reporting; reports; research; rituximab; role; safety; sci; short; study; switching; system; table; teaching; themes; therapy; trainee; transplant; trastuzumab; treatment; use; vol.31(1; years; األدوية; الحيوية
     • versions: original; plain text
111. bijps-1443
     • author: Drais, Hayder Kadhim; Abbas Hussein, Ahmed
     • title: Investigation of Lipid Polymer Hybrid Nanocarriers for Oral Felodipine Delivery: Formulation, Method, In-vitro and Ex-vivo Evaluation
     • date: 2022-06-12
     • words: 6235
     • flesch: 55
     • summary: The comparability profile of felodipine release for formulas have similar concentration with a different preparation method was explained as following: HF1> HF4, HF2> HF5 and HF3> HF6 while the comparability profile of the felodipine release from felodipine LPHNs formulations (HF1-HF6) and the pure drug suspension explains in the following descending order: HF2 > HF 3 > HF 1 > HF 6 > HF 5 > HF 4 > pure drug suspension. The microwave-based method is a very successful technique in preparing felodipine LPHNs formulations (HF1-HF3) and prepotent to the SESET.
     • keywords: agent; analysis; bioavailability; buffer; characterization; coefficient; colloidal; concentration; delivery; determination; different; dispersion; dissolution; drug; drug suspension; evaluation; felodipine; felodipine lphns; felodipine release; figure; following; formulas; formulations; hcl; hf1; hf2; hf3; hf4; hf5; hf6; higher; hybrid; intestinal; iraqi; journal; kinetic; lipid; lower; lphns; lphns formulations; mean; medium; method; microwave; model; n=3; nanocarriers; nanoparticles; non; oil; oral; order; pdi; permeability; permeation; pharm; pharmaceutical; phosphate; polymer; polysorbate; potential; preparation; prepared; process; profile; pure; pure drug; rate; release; research; results; sci; seset; significant; single; size; solutions; solvent; stability; study; surface; suspension; system; table; technique; therapeutic; values; vivo; vol.31(1; water; ±sd
     • versions: original; plain text
112. bijps-1445
     • author: Abd, Maryam Rasheed; Faris Hassan, Ali
     • title: The Ameliorative Effect of Fimasartan against Methotrexate-Induced Nephrotoxicity in Rats
     • date: 2022-06-12
     • words: 5385
     • flesch: 58
     • summary: Rats received sterile water for injection in a volume of (6 ml/kg) intraperitoneally (21) for 8 days starting from day 1. Group Ⅱ (MTX group): Rats received a single dose of MTX (20 mg/kg) intraperitoneally on day 1, followed by daily intraperitoneal (IP) administration of sterile water for injection (6 ml/kg) for 7 days starting from day 2 (22). Likewise, when we compare among MTX group, α-Toc group, and MTX plus α-Toc group, statistically significant differences between them can be noticed (P<0.05), as shown in (Table 3) and (Figure 5).
     • keywords: acute; administration; aki; ameliorative; analysis; angiotensin; antioxidant; baghdad; bun; college; control group; creatinine; daily; data; day; days; decrease; differences; dose; drug; effects; elisa; figure; fimasartan; fms group; function; group; group ii; group v; high; iii; increase; index; induced; inflammation; injection; injury; iraqi; kidney; kim; kit; letter; levels; mda; med; methotrexate; model; mtx; mtx group; negative; nephrol; nephrotoxicity; oxidative; p<0.05; pharm; pharmacy; previous; protective; rats; receptor; renal; renoprotective; results; role; sci; serum; significant; significant differences; sod-1; stress; study; successive; superscript; table; tissue; toc group; tocopherol; university; vitamin; vol.31(1; water; weight; تال; لمدة; ملغف
     • versions: original; plain text
113. bijps-1450
     • author: Hantoosh, Saad Muslim
     • title: Nasal Carriage of Vancomycin- and Methicillin-Resistant Staphylococcus aureus among Intermediate Students of Urban and Rural Schools of Muthanna Province in Iraq
     • date: 2022-06-12
     • words: 4667
     • flesch: 57
     • summary: MRSA/VRSA nasal carriage of school students 103 For an extended period, methicillin-resistant S. aureus has been recognized as a pathogen associated with healthcare settings, but in the 1990s, community-associated infections of MRSA had emerged. MRSA/VRSA nasal carriage of school students 104 Table 1.Sociodemographic characteristics of 300 elementary school participants in Al-Muthanna province
     • keywords: aid; animals; antibiotics; antimicrobial; aureus; bacterial; carriage; carriers; chronic; clindamycin; clinical; community; consultation; different; diseases; drug; erythromycin; evaluation; factors; female; figure; gender; habits; health; high; higher; hygiene; incidence; increase; infections; information; international; iraqi; isolates; journal; lack; level; males; medical; medication; methicillin; microbiology; mrsa; muthanna; nasal; nose; pharm; poor; prevalence; primary; questionnaire; rate; reasons; resistance; results; risk; rural; samples; schools; sci; self; significant; skin; sports; staphylococcus; students; study; susceptibility; table; teams; test; times; treatment; urban; vancomycin; vol.31(1; vrsa; water; wounds; العنقودية; المدارس; المقاومة; بين
     • versions: original; plain text
114. bijps-1453
     • author: B. Hamed, Sumaya; N. Abd Alhammid, Shaimaa
     • title: Formulation and Characterization of Felodipine as an Oral Nanoemulsions
     • date: 2021-06-15
     • words: 4395
     • flesch: 61
     • summary: Results of characterization showed that felodipine nanoemulsion (F3) with (oleic acid 10%) ,(Smix 60% of tween80 :ethanol in a ratio of 3:1), (DDW 30%) was selected as the best formula, since it has a particle size of (17.01)nm, low PDI (0.392), zeta potential (-22.34mV), good dilution without drug precipitation , higher percent of drug content (99.098%) with acceptable viscosity , and complete release of the drug after (45 min.) with significantly higher (P<0.05) dissolution rate in comparison with the pure drug powder. Preparation of felodipine nanoemulsion Different o/w nano emulsion formulations (Table 2) were prepared using the Smix and oil ratios according to pseudo-ternary phase diagrams.
     • keywords: acid; aqueous; baghdad; bioavailability; characterization; class; clear; content; delivery; diagrams; different; diluted; dilution; dissolution; dosage; droplet; drug; ethanol; evaluation; felodipine; figure; formula; formulation; ftir; hcl; higher; increase; index; int; iraqi; j pharm; journal; light; low; mean; measurement; medium; method; nanoemulsion; oil; oleic; oral; particle; pdi; percentage; pharm; pharm sci; pharmaceutical; phase; polydispersity; potential; preparation; prepared; pseudo; pure; rate; ratios; release; results; sci; size; smix; solubility; stability; studies; study; surfactant; system; table; ternary; test; transmittance; tween; tween80; value; viscosity; vol.30(1; water; zeta; النانوي
     • versions: original; plain text
115. bijps-1458
     • author: Hameed, Susan Tofiq; Mudhafar Anwer, Zinah
     • title: Using Phone Calls to Promote Community Pharmacist Counselling during COVID-19 Pandemic in Baghdad, Iraq
     • date: 2022-06-12
     • words: 5073
     • flesch: 68
     • summary: Characteristics N % Number of medications <4 194 78.9 ≥4 52 21.1 Chronic disease Diabetes 185 75.2 Hypertension 24 9.8 Diabetes and hypertension 37 15.0 Duration of disease <One year 38 15.4 One-five years 124 50.4 >Five years 84 34.1 Iraqi J Pharm Sci, Vol.31(1) 2022 Using phone calls for pharmaceutical counseling for chronic diseases 112 Table 3.The domains of the participant questions Questions N % 1. Sociodemographic characteristics of participants Characteristics N % Gender Female 154 62.6 Male 92 37.4 Age group <15* 13 5.3 15*-24 29 11.8 25-34 38 15.4 35-44 59 24.0 45-54 50 20.3 55-64 45 18.3 ≥65 12 4.9 Education Primary school or less 43 17.4 Intermediate school 70 28.4 Secondary school 68 27.6 College or higher 65 26.4 Occupation Employed (Government employee, self-employee) 100 40.7 unemployed (housewife, out of a job, retired) 146 59.3 Resident Urban 193 78.5 Rural 53 21.5
     • keywords: 2020; adherence; age; available; baghdad; calls; characteristics; chi; chronic; clinical; college; community; complications; consultations; counseling; count; covid-19; diabetes; diabetic; disease; domain; drug; education; exact; female; figure; fisher; food; group; health; higher; hypertension; information; internet; iraqi; jul; knowledge; level; medications; number; participants; patients; pearson; pharmaceutical; pharmacist; pharmacy; phone; physicians; questions; recommendations; researcher; response; school; sci; services; significant; square; study; table; telephone; test; total; type; use; value; vol.31(1; years; yes
     • versions: original; plain text
116. bijps-1460
     • author: Abushammala, Issam Mohammed
     • title: Effect of Oral Administration of Valerian Extract at Different Doses on Pharmacokinetic Parameters of Carbamazepine in Rabbits
     • date: 2022-06-18
     • words: 3332
     • flesch: 66
     • summary: Carbamazepine has a narrow range of therapy and might show drug interaction with several drugs either by induction or inhibition of CYP3A4. Subjects and Methods Animals Eighteen New Zealand strains of adult male rabbits weighted (3.1-3.4 kg) and aged (7-9) months were divided into three groups (six subjects in each) and were used as animal model for the current drug – herb PK interaction study.
     • keywords: -time; analysis; antiepileptic; auc0; blood; carbamazepine; cbz; clinical; cmax; coadministered; concentration; control; cyp3a4; day; differences; different; doses; drug; effect; food; group; herbal; herbs; interaction; iraqi; journal; lack; level; medicines; metabolism; model; oral; parameters; pharmacokinetic; pharmacy; pk parameters; plasma; rabbits; rats; research; results; san; sci; second; significant; statistical; study; substances; supplements; suspension; t1/2; table; test; tmax; val; valerian; value; vol.31(1; حركية; حشيشة; على; عوامل; مختلفة; مستخلص
     • versions: original; plain text
117. bijps-1463
     • author: Hassan, Zahra; Hassan, Tuka; Abu-Rghif, Ahmed
     • title: Evaluation the Effectiveness of Phenolic Compound of Salvia Frigida on Induced Atopic Dermatitis in Experimental Mice
     • date: 2022-06-17
     • words: 6261
     • flesch: 57
     • summary: Comparison between non treated atopic dermatitis induced group with each of Salvia frigida and Tacrolimus treated groups (by one way ANOVA test) regarding WBC, Eosinophil, serum IgE, and skin tissue homogenate of IL-4 and IL-13. Comparison between non treated atopic dermatitis induced group with each of Salvia frigida and Tacrolimus treated groups (by one way ANOVA test) regarding WBC, Eosinophil, serum IgE, and skin tissue homogenate of IL-4 and IL-13.
     • keywords: 0.001; activity; ad group; animal; antibodies; application; atopic; atopic dermatitis; cell; changes; college; comparison; compound; controls; correlation; cream; days; dermatitis; edema; effect; eosinophil; epidermal; erosion; evaluation; extracellular; figure; frigida; frigida effect; group; hematoxylin; histopathological; homogenate; hyperkeratosis; ige; il-13; il-4; il13; il4; induced; induced atopic; inflammatory; iraqi; journal; kim; levels; mean; mean±sd; medicine; mice; model; non; observational; observational severity; ointment; parakeratosis; parameters; pharm; phenolic; phenolic compound; plant; reduction; results; salvia; salvia frigida; sample; sci; score; serum; serum ige; severity; severity score; significant; skin; skin tissue; species; studied; study; table; tacrolimus; test; thickness; tissue; tissue homogenate; topical; treated; treatment; university; variables; vol.31(1; wbc; x103; التأتبي; الجلد; مستويات
     • versions: original; plain text
118. bijps-1465
     • author: Habeeb, Duaa Mohammed; Zinah M. Anwer
     • title: Descriptive, Prospective Observational Study- Studying Possible Prediction Factors for Disease Severity and Progression among a Sample of COVD 19 Patients in Iraq
     • date: 2022-12-23
     • words: 5727
     • flesch: 59
     • summary: The association between the individual chronic medication and the severity of COVID-19 disease. And with AshaqAli1 (2021) studied Myoglobin and C reactive protein are efficient and reliable early predictors of COVID 19 associated mortality and reported that CRP was specific risk factors related to mortality and highly correlated to organ failure in COVID-19 disease (28).
     • keywords: acute; admission; age; arbs; associated; association; baghdad; care; cases; cells; characteristics; china; chronic; clinical; coronavirus; count; cov-2; covid-19; covid19; critical; crp; data; death; descriptive; diabetes; differences; disease; disease severity; effect; factors; frontiers; gender; health; high; higher; hospital; hospitalization; icu; immune; increase; individuals; infection; insulin; intensive; iraqi; journal; kidney; levels; liver; mean; medical; medicine; metformin; mild; moderate; mortality; need; older; oxygen; patients; pharm; prediction; predictors; progression; protein; reactive; related; respiratory; risk; sample; sars; sci; severe; severity; significant; smoking; study; symptoms; system; table; test; total; unit; use; value; viral; vol.31(2
     • versions: original; plain text
119. bijps-1467
     • author: Bhattacharya, Sankha
     • title: Development of 5-FU Loaded poly lactic-co-glycolic acid Nanoparticles for Treatment of Lung Cancer
     • date: 2022-06-17
     • words: 8122
     • flesch: 61
     • summary: Nanoparticles with an 18-minute sonication time was found to be more cytotoxic than those with PLGA nanoparticles containing 12% polyvinyl alcohol. As per, the recent study conducted by Aditya Nath Pandey et al.,(2020) (51) 5-FU can be encapsulated in PLGA nanoparticles, which could have potential anti-cancer effects against HT-29 and COLO-205 colorectal cancer cell lines.
     • keywords: 5fu; a549; acid; addition; anticancer; area; blood; cancer; carriage; cell; concentration; control; cytotoxicity; days; decreases; degradation; delivery; development; different; dlg; drug; effects; efficacy; efficiency; encapsulation; expansorb; experiment; figure; fluorouracil; formulations; fu loaded; glycolic; glycolide; greater; group; half; higher; hplc; human; ic50; increases; iraqi; isogenic; kda; lactic; lactide; life; line; loaded; loaded nanoparticles; loaded plga; loading; lower; lung; lung cancer; min; minutes; molecular; molecular weight; mrsa; nanoparticles; nasal; non; nsclc; pharm; plga; plga nanoparticles; polymeric; potential; preparation; prepared; process; pva; pva loading; pva molecular; rate; release; research; school; sci; serum; significant; size; small; solution; sonication; sonication time; students; studies; study; surface; system; time; treatment; value; vol.31(1; vrsa; water; weight; zeta
     • versions: original; plain text
120. bijps-1474
     • author: Sameer Yonus, Samara ; Ahmed AlKataan, Muhammad Abdulgafoor
     • title: Mitochondrial Copies Number and Some Renal Function Biomarkers in Type 2 Diabetes Mellitus on Metformin
     • date: 2022-12-23
     • words: 3441
     • flesch: 64
     • summary: T2DM patients have high blood sugar and insulin resistance and both condition associated with elevated ROS formation that intern significantly affect mt-DNA copies number.(19 ) According to this study, the number of mitochondrial copies significantly decreased in T2DM patients by 32.8 times compared to the control group (p 0.01).
     • keywords: acid; age; association; bar; blood; blue; bmi; body; color; control; copies; correlation; creatinine; diabetes; diabetes mellitus; diabetic; disease; dna; figure; function; gene; group; hba1c; healthy; higher; hyperglycemia; index; individuals; insulin; int; iraqi; kidney; levels; mass; mean; med; mellitus; metabolic; metformin; mitochondrial; monotherapy; mosul; negative; number; patients; pharm; positive; red; renal; res; research; results; risk; sci; sequence; serum; serum uric; significant; study; subjects; t2 dm; table; treatment; type; urea; uric; uric acid; vol.31(2; years; السكري; بمجموعة; عدد; مرضى
     • versions: original; plain text
121. bijps-1481
     • author: Mohammed, Ali Haider; Hassan, Bassam Abdul Rasool; Suhaimi, Azyyati Mohd; Blebil, Ali; Dujaili, Juman; Wayyes, Abdulrasool M.
     • title: Factors Impacting Hypertension Awareness among Hypertensive Population: A Quantitative Study in a Tertiary Care Hospital in Malaysia
     • date: 2022-06-18
     • words: 5590
     • flesch: 57
     • summary: Abdulrasool M. Wayyes** *School of Pharmacy, Monash University Malaysia, Jalan Lagoon Selatan, 47500 Bandar Sunway, Selangor, Malaysia **Department of Pharmacy, Al Rafidain University College, Baghdad, Iraq **Department of Pharmacy Practice, Faculty of Pharmacy, Universiti Teknologi MARA, Puncak Alam Campus, 42300 Bandar Puncak Alam, Selangor, Malaysia Abstract There are obstacles to high levels of hypertension awareness that are embedded in gender, income and lifestyle habits which need to be addressed. Received: 15/7/ 2021 Accepted: 17/7 /2021 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol31iss1pp233-240 Iraqi J Pharm Sci, Vol.31(1) 2022 Factors affecting hypertension awareness 234 Introduction Hypertension is one of the major risk factors to cardiovascular failure and mortality (1).
     • keywords: access; adults; age; analysis; areas; associated; awareness; blood; cardiology; cardiovascular; care; control; countries; current; data; diastolic; differences; disease; doctor; education; facilities; factors; female; gender; habits; health; health care; healthcare; high; hospital; hypertension; hypertension awareness; independent; information; international; iraqi; issues; journal; knowledge; level; lifestyle; limited; location; lower; major; majority; malaysia; marital; media; number; participants; patients; people; pharm; population; pressure; prevalence; public; questionnaire; race; reading; respondents; response; risk; risk factors; role; rural; sci; score; significant; social; status; study; survey; systolic; table; tertiary; treatment; university; urban; value; variables; vol.31(1; women; years; young; إلى; الدم; الوعي; بارتفاع; ضغط; على; ماليزيا
     • versions: original; plain text
122. bijps-1487
     • author: AM. Jawad , Rehab ; Sahib, Hayder B
     • title: Estimation the Safety of Parenteral Resveratrol in Mice
     • date: 2022-06-17
     • words: 4737
     • flesch: 65
     • summary: where MMD0, CMMD0, FMD0, CFMD0, MMD7, CMMD7, FMD7, CFMD7, MMD14, CMMD14, FMD14, and CFMD14 represent, male mice day zero, its control, female mice day zero, its control, male mice day seven, its control, female mice day seven, its control, male mice day fourteen, its control, female mice day fourteen and Its control, respectively. where MMD0, CMMD0, FMD0, CFMD0, MMD7, CMMD7, FMD7, CFMD7, MMD14, CMMD14, FMD14, and CFMD14 represent, male mice day zero, its control, female mice day zero, its control, male mice day seven, its control, female mice day seven, its control, male mice day fourteen, its control, female mice day fourteen and Its control, respectively.
     • keywords: + +; 0.312g; acute; acute toxicity; administration; adverse; animals; anti; assay; ast; atypical; biochemical; blood; body; cell; changes; control; control group; convulsion; data; day; days; dead; death; dependent; diarrhea; dmso; dose; dyspnea; effect; fasciculation; female; female mice; figure; gait; group; h-14; h-6h; heart; hematological; histopathological; hypoactivity; iii; inflammatory; interstitial; iraqi; kg resveratrol; lacrimation; ld50; limbs; liver; locomotion; loss; male; mice; mice day; muscular; number; observation; organs; period; pharm; piloerection; resveratrol; resveratrol adverse; sci; shows; sign; significant; single; studies; study; table; tissue; toxicity; vol.31(1; weight; الصفاق; داخل; ريسفيراترول; على; عند; كجم
     • versions: original; plain text
123. bijps-1490
     • author: Mohammed, Ali Haider; Muthanna, Fares Mohammed Saeed; Hassan, Bassam Abdul Rasool; Karuppannan, Mahmathi; Wayyes, Abdulrasool M.
     • title: Impact and Association of Anaemia Severity and Its Treatment With Quality of Life of Breast Cancer Patients in Malaysia
     • date: 2022-12-23
     • words: 5874
     • flesch: 59
     • summary: Regarding QOL and breast cancer patient, a study has been conducted in China in 2016 to detect the effects of social support, financial situation and clinical factors on breast cancer patients, to evaluate QOL. Hence, the current study aimed to detect and evaluate treatment given to breast cancer patient suffering from anaemia and to determine its impact on cancer patients QOL.
     • keywords: agents; anaemia; anaemia severity; anaemia treatment; analysis; anti; antianaemic; assessment; association; blood; breast; breast cancer; cancer; cancer patients; care; chemotherapy; clinical; current; data; effects; esas; fact; follow; functional; guideline; haemoglobin; health; impact; incidence; iraqi; iron; journal; level; life; malaysia; management; mean; medical; need; oncology; outcomes; participants; patients; pharm; qol; quality; research; response; results; sci; scores; severity; significant; solid; stage; stimulating; studies; study; survival; table; therapy; total; transfusion; treatment; type; ups; use; vol.31(2; women; الثدي; الدم; بين; فقر; ماليزيا; مرضى
     • versions: original; plain text
124. bijps-1499
     • author: Hassoon, Sara Saad; Saleh Abbas , Ibrahim ; Abdul Razzaq Mshimesh, Bahir
     • title: Isolation of beta-sitosterol and evaluation of antioxidant Activity of Iraqi Campsis grandiflora flowers.
     • date: 2022-06-18
     • words: 4476
     • flesch: 56
     • summary: The total flavonoids content of Iraqi C.grandiflora was estimated by using the aluminium chloride colourimetric method(20) in which 1ml of plant EAE extract (100 mcg/ml) or standard quercetin solution (5,10,20,40,60,80 and 100 mcg/ml ) was mixed with 4ml of distilled water and then adding 0.3 ml of sodium nitrite solution (5%) to all test tubes. 22/9 /2021 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol31iss1pp176-183 Iraqi J Pharm Sci, Vol.31(1) 2022
     • keywords: absorbance; abts; acetate; acetate extract; acid; activity; analysis; antioxidant; ascorbic; assay; baghdad; beta; blood; c.grandiflora; campsis; carriage; coefficient; compound; content; correlation; detection; different; dpph; eae; effect; electron; ethyl; extract; ferric; figure; findings; flavonoids; flowers; food; frap; hexane; hexane extract; high; hplc; iraqi; iraqi c.grandiflora; iraqi j; isolated; isolation; layer; mcg; methanol; methods; mixed; mobile; mrsa; mustansiriyah; nasal; pearson; pharm; plant; radical; reported; results; scavenging; school; sci; set; single; sitosterol; solution; standard; students; table; tfc; tlc; total; transfer; university; value; vol.31(1; vrsa; البوق; الزاحف; نبات
     • versions: original; plain text
125. bijps-1500
     • author: Yadav, Meena; Sharma, Poonam
     • title: Plant-derived Molecules for the Treatment of Tuberculosis: A Review
     • date: 2022-12-23
     • words: 7840
     • flesch: 48
     • summary: They are either antimycobacterial or act synergistically with anti-TB drugs and reduce their adverse effects. The patients may experience one or more side effects depending on the dosage of anti-TB drugs (12).
     • keywords: acid; action; activities; activity; adverse; alkaloids; alp; alternative; anti; antimycobacterial; antioxidant; antitubercular; article; associated; available; biol; cause; cells; clinical; combination; common; compounds; curcumin; damage; development; diallyl; different; disease; doi; drugs; duration; effective; effects; efficacy; emb; enzymes; ethambutol; expression; extracts; figure; food; functions; gastrointestinal; glabra; glutathione; glycyrrhiza; growth; h37rv; health; hepatic; hepatoprotective; hepatotoxicity; ho-1; immune; immunity; indian; inflammatory; inh; inhibit; int; iraqi; iraqi j; isoniazid; j pharm; kanamycin; kim; kumar; leaves; levels; like; line; liu; liver; loss; m.tb; macrophages; mdr; med; medicinal; medicine; metabolites; molecules; months; mtb; multidrug; mycobacterium; mycobacterium tuberculosis; natural; nrf2; number; oxidative; pathway; patients; pgc-1α; pharm; phytochemicals; piperine; plant; plant molecules; potential; products; properties; pyrazinamide; pza; reactions; regimen; resistant; response; rifampicin; role; ros; sci; sensitive; serum; sharma; silymarin; singh; sirt1; species; strain; strategies; strategy; stress; studies; symptoms; synthetic; synthetic anti; system; table; tb drugs; tb treatment; therapeutic; therapy; toxicol; transaminase; treatment; triterpenes; tuberculosis; ursolic; vaccine; vitro; vivo; viz; vol.31(2; wang; xdr; yang; zhang
     • versions: original; plain text
126. bijps-1501
     • author: Ahmed Azad Kareem ; Aziz, Tavga Ahmed; Zheen Aorahman Ahmed; Hemn Hassan Othman ; Saad Abdulrahman Hussain
     • title: Anti-Inflammatory Activity of Gingko Biloba Extract in Cotton Pellet-Induced Granuloma in Rats: A comparative Study with Prednisolone and Dexamethasone
     • date: 2022-06-18
     • words: 5215
     • flesch: 57
     • summary: Therefore, we need to seek new medications that possess anti-inflammatory activity with minimum unwanted reactions. 3. GKB group: Treated with GKB (200mg/kg/day) orally for the study of anti-inflammatory activity of GKB in rat model cotton pellet-induced granuloma.
     • keywords: 1mg; 200mg; 5mg; activity; ahmed; animals; anova; anti; antiinflammatory; area; biloba; biloba extract; body; cells; chronic; college; connective; control; cotton; crp; current; dexamethasone; different; diseases; doi:10; effective; effects; expression; extract; exudate; figure; free; gingko; ginkgo; ginkgo biloba; gkb; granuloma; granulomatous; group; induction; inflammation; inflammatory; inflammatory activity; inhibition; iraqi; lesion; level; markers; mean; mechanisms; mediators; model; negative; nutraceuticals; oxidative; patients; pellets; percent; percentage; pharm; pharmacol; positive; positive control; prednisolone; rats; reduction; role; sci; sections; significant; steroids; stress; study; test; tissue; tnf; treatment; university; use; values; vcam-1; vol.31(1; weight; الحبيبي
     • versions: original; plain text
127. bijps-1506
     • author: F.Mohammed, Farqid; Subhi Abed, Sadeem Subhi Abed
     • title: Flow Injection Spectrophotometric Technique for Determining of Genistein in Pure and Supplements Formulations Through Diazotization Coupling Reaction
     • date: 2022-06-23
     • words: 3157
     • flesch: 53
     • summary: Iraqi J Pharm Sci, Vol.31(1) 2022 Determination of genistein by coupling reaction 280 After chemical and physical variables have been optimized the calibration graph was performed to test the linearity of GEN concentration (triplicate injections). Calibration curve was constructed over different GEN concentrations with a linearity range of 10-100 µg/mL and a detection limit of 1.51 μg/mL. For the FIA technique, all analytical factors were analyzed and optimized.
     • keywords: absorbance; accuracy; analysis; analytical; biomed; calibration; chemical; chromatography; coil; concentration; coupling; detection; determination; diazotization; distilled; effect; fia; figure; flask; flow; formulations; gen; genistein; injection; iraqi; isoflavones; linearity; liquid; mass; medium; method; ml-1; naoh; parameters; pharm; pharmaceutical; plasma; precision; procaine; pure; range; rate; reaction; reagent; rsd%; sample; sci; solutions; spectrometry; standard; suggested; supplements; table; values; vol.31(1; volume; volumetric; water
     • versions: original; plain text
128. bijps-1507
     • author: Shri Chengama Raju , Nisha ; Wing Kei, Wong
     • title: Anti-Angiogenic Screening of Moringa Oleifera Leaves Extract Using Chorioallantonic Membrane Assay
     • date: 2022-06-18
     • words: 3884
     • flesch: 57
     • summary: Preparation of treatment solutions The study was conducted among six treatment groups which included positive control (sunitinib), negative control (phosphate buffer saline), aqueous Moringa oleifera extract (50% and 100%) and methanolic Moringa oleifera extract (50% and 100%). Analgesic activity of seeds of Moringa oleifera Lam.
     • keywords: activity; air; angiogenesis; angiogenic; anti; antiangiogenic; anticancer; aqueous; assay; bath; blood; blood vessels; cam; cancer; cell; chick; chorioallantoic; concentrated; control; decrease; different; effect; eggs; extract; factor; figure; flavonoids; formation; group; growth; hours; inhibition; iraqi; kaempferol; leaves; mediators; membrane; methanol; mixture; moringa; moringa oleifera; new; number; oleifera; pbs; percentage; pharm; phytochemical; plant; post-48; presence; present; quercetin; receptor; reduction; sample; sci; screening; solution; study; sunitinib; test; treatment; tumor; vegf; vessels; vol.31(1; water
     • versions: original; plain text
129. bijps-1509
     • author: Al-Dulaimi, Amal Fakhrulddin; Al-Kotaji, Myasar Mohammed; Abachi, Faris Thanoon
     • title: Development of novel paracetamol/naproxen co-crystals with an improvement in naproxen solubility.
     • date: 2022-06-18
     • words: 6497
     • flesch: 62
     • summary: However, further diagnostic techniques are needed to confirm co-crystals formation. In addition, a solubility study was conducted to compare the water solubility of pure paracetamol and naproxen with co-crystals solubility.
     • keywords: acid; addition; analysis; band; bioavailability; bonding; changes; characterization; cm-1; cocrystal; comparison; crystals; design; different; diffraction; drug; dsc; electron; emission; energy; enhancement; evaporation; fesem; field; figure; formation; forms; ftir; higher; hydrogen; improvement; increase; iraqi; iraqi j; j pharm; like; low; mass; materials; mechanical; method; mixture; molar; multi; naproxen; naproxen co; naproxen solubility; new; non; paracetamol; parent; pattern; peak; pharm; pharm sci; pharmaceutical; physical; physical mixture; powder; preparation; prepared; production; properties; pure; pure paracetamol; pxrd; rate; ratios; ray; results; sample; scanning; sci; shifting; single; solid; solubility; solution; solvent; spectrum; stretching; study; technique; temperature; tga; theta; value; vol.31(1; water; work; ° c; الباراسيتامول; الذوبان; بلورات; نابروكسين
     • versions: original; plain text
130. bijps-1511
     • author: Ahmed AlKataan, Muhammad Abdulgafoor; Abdullah Shakir Mahmood; Aseel S. Al Mallakhdeer
     • title: Evaluation of the Detrimental Effects of some Antiepileptic Drugs on the Height and Weight of Children with Epilepsy
     • date: 2022-06-18
     • words: 2807
     • flesch: 65
     • summary: The proliferation of epiphyseal growth plate results from complex interactions between hormones and growth factors, which may directly or indirectly affect the serum levels of calcium and the condition of those cells, leading to final stature (4). This study aimed to evaluate the effect of some antiepileptic drugs on growth (height and weight) in children with epilepsy.
     • keywords: absence; acid; age; antiepileptic; bmi; bone; carbamazepine; centile; change; chart; children; combined; condition; detrimental; dose; drugs; eeg; effect; epilepsy; factors; generalized; group; growth; health; height; iraqi; july; mean; monotherapy; months; normal; patients; pharm; results; sci; seizures; significant; study; therapy; treatment; use; valproic; valproic acid; vol.31(1; work; years; إلى; الجسم; العالج; الفالبرويك; النمو; على
     • versions: original; plain text
131. bijps-1514
     • author: Abushammala, Issam Mohammed; Mohammed Mqat, Belal ; Mohammed Hamdan, Abdallah
     • title: Effect of Curcumin at Various Doses on the Pharmacokinetic Profile of Tacrolimus in Healthy Rabbits
     • date: 2022-06-23
     • words: 3338
     • flesch: 65
     • summary: Control group 1.50 ± 0.50 0.405¥ 0.690§ First test group 1.90 ± 0.54 Second test group 1.65 ± 0.65 cke (hr-1) Control group 0.102 ± 0.04 0.736¥ 0.570§ First test group 0.124 ± 0.10 Second test group 0.091 ± 0.03 dAUC0-6 (ng*hr/mL) Control group 97.37 ± 18.06 0.524¥ 0.052§ First test group 112.42 ± 49.14 Second test group 130.02 ± 20.54 eAUC0-∞ (ng*hr/mL) Control group 204.49 ± 75.82 0.564¥ 0.679§ First test group 167.05 ± 71.42 Second test group 189.60 ± 25.80 (¥): P-value of the differences between the control and first test group; (§): P-value of the differences between the control and the second test group. In the second and third groups (test groups), rabbits received TAC (1mg/kg) at identical conditions as in the control group with volumes equivalent to (30 and 90 mg/kg/day) of prepared CUR suspension in normal saline for seven continuous days.
     • keywords: administration; analysis; auc0; blood; clinical; cmax; concentration; control; control group; cur; curcumin; current; cyp; cyp450; day; differences; doses; drug; effect; enzymes; et al; following; gaza; group; healthy; herbal; insignificant; interactions; iraqi; journal; male; metabolism; mohammed; natural; palestine; parameters; patient; pharmacokinetics; pharmacology; pharmacy; profile; rabbits; results; samples; sci; second; statistical; study; tac; tacrolimus; test; test group; therapeutic; time; tmax; transplantation; university; vivo; vol.31(1; األرانب; الدوائية; الضابطة; المجموعة; على
     • versions: original; plain text
132. bijps-1521
     • author: Abdulsahib, Waleed K.
     • title: The Effect of Anabasis articulata Stems Extract on Lowering Intraocular Pressure in the Glaucoma Rat Model(Conference Paper )#
     • date: 2022-01-11
     • words: 4982
     • flesch: 62
     • summary: Effect of Anabasis articulata extracts on the body weight in the betamethasone-induced chronic glaucoma model. Effects of Anabasis articulata extract on serum levels of some oxidative stress parameters.
     • keywords: abdulsahib; acetazolamide; activity; anabasis; anabasis articulata; animals; antioxidant; articulata; baghdad; betamethasone; body; cat; cell; chronic; college; control; control group; day; days; difference; doses; effect; extract; eye; factor; figure; glaucoma; group; high; increase; induced; induction; intraocular; intraocular pressure; iop; iraqi; ldh; levels; loss; mda; mean; med; mmhg; model; nerve; normal; normal group; optic; oral; oxidative; p ˂; pharm; pharmacy; plant; pressure; p˂0.05; rabbits; rats; research; results; risk; sci; serum; significant; significant difference; sod; stems; steroid; stress; study; table; timolol; topical; treatment; university; vol.30(suppl; weeks; weight; العين; المجموعة; ضغط
     • versions: original; plain text
133. bijps-1528
     • author: Drais, Hayder Kadhim; Hussein, Ahmed Abbas
     • title: Rheological Investigation of Lipid Polymer Hybrid Nanocarriers for Oral Delivery of Felodipine (Conference Paper )#
     • date: 2022-01-11
     • words: 4477
     • flesch: 56
     • summary: The pseudoplastic flow behavior of felodipine LPHNs formulations (H1-H9) suggests that the described nanosystems in this study are physically stable Keywords: Rheology, Felodipine, Lipid-polymer hybrid nanocarriers, Microwave-based method. The quantitative components of felodipine LPHNs formulations (H1-H9) for characterization and optimization Formulation code Felodipine % (w/w) Cardamon oil % (w/w) Lauric acid % (w/w) Chitosan % (w/w) PEG-(400) laurate :Polysorbate 80: Propylene glycol % (w/w) Distilled water % (w/w) up to H1 1 4 1 0.1 15:7.5:7.5 100 H2 1 4 1 0.1 17.5:8.75:8.75 100 H3 1 8 2 0.2 17.5:8.75:8.75 100 H4 1 4 1 0.2 20:10:10 100 H5 1 8 2 0.25 20:10:10 100 H6 1 12 3 0.35 20:10:10 100 H7 1 4 1 0.2 22.5:11.25:11.25 100 H8 1 8 2 0.35 22.5:11.25:11.25
     • keywords: 10%(w; active; agents; analysis; blend; colloidal; concentration; constant; content; dispersion; distilled; distilled water; drug; felodipine; felodipine lphns; flow; formulations; glycol; hybrid; investigation; iraqi; journal; laurate; lipid; lipid content; lphns; lphns formulations; method; microwave; nanocarriers; nanoparticles; order; particle; pdi; peg; pharmaceutical; polymer; polysorbate; prepared; propylene; propylene glycol; pseudoplastic; rheological; sci; shear; significant; size; stability; surface; surfactant; system; table; upto; values; viscosity; water
     • versions: original; plain text
134. bijps-1530
     • author: Saad, Anwar Habeeb; rabeea, Ihsan; Salih, Haider
     • title: Adherence and Beliefs to Adjuvant Hormonal Therapy in Patients with Breast Cancer: A Cross-Sectional Study (Conference Paper) #
     • date: 2022-01-12
     • words: 5256
     • flesch: 61
     • summary: Patients' beliefs about their medications were observed to correlate with medication adherence. Guidelines recommended the use of tamoxifen for 5 years in premenopausal women while AI is the recommended type in postmenopausal women as 1Corresponding author E-mail: anwar.habeebsaad@gmail.com Received: 24/8/2021 Accepted:15 / 11/2021 Published Online First: 2022-1-12 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol30issSuppl.pp31-39 Iraqi J Pharm Sci, Vol.30(Suppl.) 2021 Adherence &beliefs of breast cancer patients 32 primary or extended after using tamoxifen for 5 years and sometimes it is recommended to use AI as sequential (a combination with tamoxifen for 3 years followed by 2 years of AI) (3).
     • keywords: adherence; adherent; adjuvant; age; agree; aht; analysis; aromatase; association; beliefs; bmq; breast; breast cancer; cancer; cancer patients; care; center; chronic; clinical; concerns; data; disease; doctors; effects; endocrine; euphrates; face; factors; general; good; health; high; hormone; income; iqd; iraqi; items; level; mean; medication; medication adherence; medicines; medium; method; middle; mmas; morisky; necessity; non; number; oncol; oral; participants; patients; pharm; poor; positive; previous; questionnaires; receptor; res; scale; sci; score; self; significant; sociodemographic; specific; studies; study; table; taking; tamoxifen; test; therapy; total; treatment; type; variables; vol.30(suppl; women; years; االلتزام; الثدي; النساء
     • versions: original; plain text
135. bijps-1533
     • author: Al-Assaf, Issa; Khazem, Mays
     • title: Antioxidant Activity of Total phenols and Flavonoids extracted from Echinops polyceras roots grown in Syria
     • date: 2021-12-12
     • words: 4635
     • flesch: 55
     • summary: Aqueous extract showed the highest yield (10.5%) followed by hydroethanolic 50%, methanol, methanol: ethyl acetate (1:1), and chloroform extracts with yields of 7, 4, 2.75, and 1%, respectively. TPC of the extracts: Total phenolic content was calculated as gallic acid equivalents (GAE) in 1 g of dried extract (DE) using the regression equation between Gallic acid standard concentrations and absorption at 765 nm.
     • keywords: absorbance; acetate; acid; activity; antioxidant; aqueous; ascorbic; boiss; calibration; chloride; chloroform; ciocalteu; compounds; concentrations; content; coumarins; curve; determination; distilled; dpph•; drops; echinops; effective; equation; extract; extraction; figure; flavonoids; folin; formation; free; gae; gallic; glycosides; identification; iraqi; meoh; methanol; microplate; min; pharm; phenolic; phytochemical; plant; polyceras; polyphenols; presence; qe/; quercetin; radicals; reagent; results; roots; scavenging; sci; solution; species; standard; study; sugars; syria; table; tannins; test; tfc; total; tube; vol.30(2; water; الُحّرة
     • versions: original; plain text
136. bijps-1535
     • author: Albassam, Noor Yousif; Mohammed, Amenah; Murtada, Suhair
     • title: Evaluation of Community Pharmacists Knowledge, Attitude and Practice towards Modified Release Dosage Forms
     • date: 2022-01-12
     • words: 4695
     • flesch: 56
     • summary: 125(71*) 11 (6 ) 39 (22) Data presented as number and percentage, n = 175 *Correct answer Attitudes towards modified release dosage forms To investigate the attitudes of pharmacists towards controlled release dosage forms, four questions were designed. 2021 Community pharmacists and modified release 41 Modified-release release dosage forms can provide several benefits.
     • keywords: agreement; attitude; basra; city; coefficient; college; community; community pharmacists; correct; correlation; data; delivery; demographic; different; dispensing; domains; dosage; dosage forms; drug; females; forms; formulations; frequency; health; immediate; iraqi; journal; kap; knowledge; lack; location; majority; medical; medication; modified; modified release; number; oral; outcomes; participants; patient; percentage; pharmaceutical; pharmacists; pharmacy; positive; practice; products; questionnaire; questions; release; release dosage; reliability; research; responses; results; sci; score; section; significant; study; sustained; table; test; therapeutic; university; value; vol.30(suppl; years; المعرفة
     • versions: original; plain text
137. bijps-1538
     • author: Alqubbanchi, Fatimah Baqer; Yaqoob Al-Hamadani, Fadya
     • title: A Pharmacoeconomics Study for Anticoagulants used for Hospitalized COVID-19 Patients in Al-Najaf Al-Ashraf city –Iraq(Conference Paper )#
     • date: 2022-01-12
     • words: 7170
     • flesch: 49
     • summary: There are many reasons which might contribute to this rise in D- dimer values in COVID-19 patients such as: I) infection which can cause the release of pro- inflammatory cytokines, thus causing an inflammatory storm(26). In contrast, other studies reported that Enoxaparin is associated with a non-significant reduction in total hospital costs compared with the appropriate use of UFH prophylaxis(44).Overall, the results of the present study motivate further studies to investigate reasons for differences in the outcomes and future trials that could enable the development of a more efficacious standard of practice in regards to the administration of anticoagulants in COVID-19 patients.
     • keywords: 1st; 2nd; amal; analysis; anticoagulants; available; average; average cost; baseline; clinical; college; comorbidities; coronavirus; cost; covid-19; critical; data; day; days; difference; dimer; dimer levels; disease; distribution; duration; effectiveness; effects; enoxaparin; figure; gender; group; health; heparin; higher; hospitalization; hospitalized; incremental; independent; indicator; infected; infection; injectable; internet; iraqi; journal; kaplan; length; levels; low; lower; male; medical; meier; method; molecular; mortality; non; number; original; outcome; patients; pharmacoeconomic; rate; ratio; records; results; risk; sample; sci; severe; significant; statistical; stay; student; studies; study; suppl; survival; survival rate; t.test; table; test; therapies; therapy; thromboembolism; thrombosis; time; total; treatment; unfractionated; value; venous; vol.30; weight; years; zhang; االینوكزابارین; كان
     • versions: original; plain text
138. bijps-1542
     • author: Al-Musawi, Mohammed; M. Anwer, Zinah
     • title: Evaluating the Impact of Pharmacist Counselling for Asthmatic Children at Karbala Teaching Hospital for Children: An Interventional Prospective Study (Conference Paper )#
     • date: 2022-01-12
     • words: 5126
     • flesch: 61
     • summary: Evaluating the impact of pharmacist asthma counselling 27 Figure 4. The majority of study participants (90%) was low to medium income families whose children Iraqi J Pharm Sci, Vol.30(2) 2021 Evaluating the impact of pharmacist asthma counselling 28 had asthma which appears to be similar to that found by Davies et al. that stated the prevalence of asthma is greater in low-income families who may have a lower chance of having a good education and optimal academic career (27).
     • keywords: act; act\c; allergy; asthma; asthma control; asthma counseling; asthmatic; atopic; available; baghdad; better; care; childhood; children; chronic; clin; control; counseling; criteria; data; development; diseases; educational; face; figure; follow; health; higher; hospital; immunol; impact; increment; inhaler; internet; interventional; iraqi; j pharm; karbala; knowledge; life; management; medication; old; parents; participants; patients; pediatric; pharmacist; pharmacist asthma; pharmacist counseling; pharmacy; phone; poor; prevalence; proper; quality; respir; respiratory; review; risk; sample; sci; score; significant; size; study; symptoms; table; technique; test; types; uncontrolled; use; visits; vol.30(2; weekly; years; اختبار; الربو; السيطرة; على
     • versions: original; plain text
139. bijps-1543
     • author: Ali Ashoor , Jamal ; M. Mohsin, Jinan; Mohsin, Hussein Mohammed; W. Mahde, Basam ; M. Gareeb, Mowafaq
     • title: Permeability Enhancement of Methotrexate Transdermal Gel using Eucalyptus oil, Peppermint Oil and Olive Oil(Conference Paper )#
     • date: 2022-01-11
     • words: 3140
     • flesch: 60
     • summary: The donor compartment was supplied by 1gm of MTX gel and the receptor compartment with 100ml of phosphate buffer PH 7.4. The media was stirred at 100 rpm and the temperature kept at 37 C. 5ml sample of MTX gel was withdrawn from the receptor which was replaced by the same volume of buffer to maintain the sink condition.
     • keywords: 25ml; baghdad; carbopol; caseii; college; concentration; content; days; delivery; diffusion; drug; effect; enhancer; eucalyptus; figure; formulas; formulation; gel; good; iraqi; irritation; journal; kinetic; mechanism; membrane; methotrexate; mixture; mtx; oil; oils; olive; penetration; peppermint; permeability; permeation; pharm; pharmaceutical; pharmacy; prepared; properties; rats; release; results; sci; skin; super; synthetic; table; test; topical; transdermal; university; viscosity; vol.30(suppl; yellow; الجلد; الزيتون; الميثوتريكسات; النعناع; عبر; نفاذية; وزيت
     • versions: original; plain text
140. bijps-1547
     • author: Fairooz, Amal jawad; Jamal, Mohammed yawuz; Alkhalidi, Nawal mehdi
     • title: Therapeutic Effects of Vitamin E in Non-alcoholic Fatty Liver Disease: An Open-Labeled Clinical Trial
     • date: 2022-12-24
     • words: 5756
     • flesch: 63
     • summary: Epidemiology and natural history of non-alcoholic fatty liver disease. Non-alcoholic fatty liver disease: A clinical update.
     • keywords: 12wks; activity; age; alt; analysis; ast; available; baseline; bmi; cholesterol; chronic; clinical; data; degree; diabetes; diagnosis; difference; disease; effects; enzymes; fatty; fatty liver; fibrosis; gastroenterol; glucose; hdl; hepatic; hepatol; higher; highest; hypertension; internet; iraqi; ldl; levels; lifestyle; lipid; liver; liver disease; liver enzymes; loss; low; management; mean; measures; med; meta; modifications; nafld; nash; nonalcoholic; nonalcoholic fatty; normal; p=0.0001; participants; patients; percentage; period; pharm; physical; prevalence; profile; range; recent; reduction; review; risk; sci; score; serum; severe; significant; significant difference; steatohepatitis; steatosis; study; systematic; table; test; total; treatment; triglyceride; type; use; value; vitamin; vitamin e; vldl; vol.31; weeks; weight; women; years; الدراسة; الدهني; الكبد; الكحولي; بين; درجة; غير; فيتامين; ١٢أسابيع
     • versions: original; plain text
141. bijps-1553
     • author: Hami, Abdulazim Mohammed
     • title: A Study of the inhibitory effect of Terpinen-4-ol on Amastigote Forms of Leishmania tropica within Macrophages of Mouse in vitro
     • date: 2022-12-24
     • words: 2262
     • flesch: 62
     • summary: 7. Haddad, N., et al., Cutaneous leishmaniasis in the central provinces of Hama and Edlib in Syria: Vector identification and parasite typing. 2015; 8(1): 1-8. 8. Torres-Guerrero, E., et al., Leishmaniasis: a review.
     • keywords: activity; amastigote; amastigote forms; cases; concentrations; control; culture; cutaneous; effect; forms; hours; human; inhibitory; iraqi; leishmania; leishmaniasis; macrophages; main; mouse; number; oil; parasites; pharm; present; promastigote; results; sci; solution; study; tea; terpinen-4; tree; tropica; tto; viability; vitro; wells; الليشمانيه
     • versions: original; plain text
142. bijps-1555
     • author: Rosnah, Rosnah; Taslim, Nurpudji A.; Aman, Andi Makbul; Idris, Irfan; As’ad, Suryani; Buchari, Agussalim; Bahar, Burhananuddin; Aminuddin, Aminuddin; Wahyudin, Elly; Nugraha, Gaga Irawan
     • title: The Formulation and Evaluation of High-Fat Pellet on Lipid Profiles and Body Mass Index of Male Wistar Rats
     • date: 2022-06-23
     • words: 5858
     • flesch: 62
     • summary: Therefore, HFD FII pellets were selected as obesity induction feed for male Wistar rats to obtain animal models of obesity and dyslipidemia Physical characteristics of HFD Pellet Yield of HFD FI = 800.49 1000 x 100% = 80.05% Yield of HFD FII = 810.08 1000 x 100% = 81.01% Table 3 shows the initial weight of each HFD FI, and the HFD FII formula was 1000 g. After drying, HFD FI and HFD II pellets had a weight reduction of 190.51 g and 189.20 g, respectively. The feed consumption in the rat fed with HFD FII pellets was also higher than the standard group (P0), indicating that rats preferred the HFD FII pellets.
     • keywords: acids; analysis; animal; atherogenic; blood; bmi; body; butter; cardiovascular; characteristics; chemical; cholesterol; clinical; coconut; consumption; content; cream; diet; disease; egg; eggs; experimental; faculty; fat; fat diet; fatty; fed; feed; fellet; fii; fii pellets; formula; formulation; group; hdl; hfd; hfd fii; hfd pellets; high; higher; increase; index; indonesia; induction; intake; iraqi; journal; laboratory; ldl; length; levels; lipid; lower; male; mass; mean; medicine; metabolic; method; milk; mortality; nutrition; obesity; oil; pellets; pharmacy; physical; physicochemical; profile; protein; rats; research; results; risk; sci; serum; source; standard; standard feed; study; table; technology; test; total; triglycerides; use; vol.31(1; water; weeks; weight; wistar; wistar rats; yield
     • versions: original; plain text
143. bijps-1557
     • author: AL-Nema, Zinah Mudhafar; Natiq Yahya, Ruaa ; Mubdir Khalf, Noor
     • title: Highlighting the Treatment Regimens used in COVID-19 epidemic in Iraq with Special Regards to Vitamin D
     • date: 2022-12-24
     • words: 6026
     • flesch: 54
     • summary: There were many different pharmacological treatment regimens and different doses and durations of vitamin D. In conclusion, non-specific treatment protocols were used without compliance to the national guidelines for the treatment of COVID-19 patients in Iraq, and a wide range of pharmaceutical agents was administered without monitoring their safety and efficacy. They were used as an emergency treatment for COVID-19 patients in USA, Japan and other countries(9).
     • keywords: activity; addition; administration; agents; analysis; antibiotics; anticoagulant; antimalarial; antiviral; bacterial; care; cases; clinical; complications; concentration; coronavirus; covid-19; covid-19 patients; covid19; critical; current; cytokines; daily; data; day; deficiency; different; disease; dose; drug; duration; early; effective; effects; efficacy; et al; evidence; exposure; failure; favipiravir; half; health; higher; hydroxychloroquine; immune; immunomodulatory; impact; inappropriate; infection; inflammatory; information; initiation; iraq; ivermectin; j pharm; levels; like; long; lower; management; march; med; medications; meta; mild; minutes; moderate; mortality; pandemic; patients; percentage; pharm; pharmacological; plasma; potential; primary; protocols; range; recovery; regimens; remdesivir; respiratory; results; review; role; safety; sample; sars; sci; serum; severe; severity; studies; study; sun; supplementation; supportive; symptoms; systematic; systematic review; therapeutic; therapy; treatment; treatment regimens; use; virol; vitamin; vitamin d; vol.31(2; wide; years; العالجات; العراق; على; كوفيد
     • versions: original; plain text
144. bijps-1558
     • author: Ahmed AlKataan, Muhammad Abdulgafoor; Junaid Salim, Moamin
     • title: Correlation between Seminal Fructosamine and Glycosylation Gap and Some Sex Hormones in the Young Infertile Male in Mosul City
     • date: 2022-06-23
     • words: 3105
     • flesch: 65
     • summary: Testosterone and estradiol play vital role in spermatogenesis(10, 18, 19 )and this work study both serum and seminal plasma changes of these two hormones. Keywords: Seminal plasma, Fructosamine, Glycosylation وبعض الهرمونات الجنسية لدى الشاب المصاب المنوي و فجوة الجليكوزيل السائل االرتباط بين فركتوزامين بالعقم في
     • keywords: changes; city; compare; comparison; control; control group; correlation; different; elevated; elevation; estradiol; estradiol ratio; ethical; fluid; fructosamine; fructose; gap; glycosylation; group; hba1c; healthy; hormones; infertile; infertile group; infertile male; infertility; kratz; l e; levels; male; men; mosul; p<0.0001; p<0.05; parameter; plasma; profile; ratio; reduction; reprod; results; role; sci; semen; seminal; seminal plasma; serum; significant; sperm; study; subjects; table; testosterone; work; young; استراديول; العقم; بين
     • versions: original; plain text
145. bijps-1565
     • author: Ibrahim, Manal Abdulkhaliq; Abbas, Wameed Hashim; Ghalib, Muhsin Sagheer; Al-Shawi, Nada N. Najia
     • title: Neuroprotective Effect of Vinpocetine against Lead Acetate-Instigated Neurotoxicity in Rats by Evaluation Tumor Necrosis Factor-Alpha, Interleukin-1Beta and Interleukin-10
     • date: 2022-12-24
     • words: 3479
     • flesch: 58
     • summary: The major findings of previous studies that approved raising cytokine creation and axonal destruction with astrocytic activation by Pb effect in immature rat brain (23). Iraqi J Pharm Sci, Vol.31( 2 ) 2022 Neuroprotective effect of vinpocetine DOI: https://doi.org/10.31351/vol31iss2pp129-134 129 Neuroprotective Effect of Vinpocetine against Lead Acetate-Instigated Neurotoxicity in Rats by Evaluation Tumor Necrosis Factor-Alpha, Interleukin-1Beta and Interleukin-10 Manal Abdulkhaliq Ibrahim*,1, Wameed Hashim Abbas**, Muhsin Sagheer Ghalib*, Nada N. Al-Shawi
     • keywords: 3mg; acetate; action; activity; adult; alpha; basrah; blood; brain; brain tissue; calcium; cause; cells; college; control; cytokines; days; different; disease; effect; element; exposure; factor; figure; glial; group; homogenate; il-1β; inflammatory; injection; int; iraqi; lead; lead acetate; level; markers; necrosis; neuroprotective; neurotoxicity; normal; p<0.05; pb acetate; pharm; preparation; rats; reddy; reduction; res; saline; sci; significant; study; system; table; tissue; tissue homogenate; tnf; treatment; tumor; university; vinpocetine; vol.31(2; اال; الجرذان; الر; رلوكيي
     • versions: original; plain text
146. bijps-1567
     • author: Blebil, Ali; Dujaili, Juman Abdulelah; Mohammed, Ali Haider; Awaisu, Ahmed; Ahmad Hassali, Mohamed Azmi; Hassan, Bassam Abdul Rasool; Wayyes, Abdulrasool M.
     • title: Exploring the Capability of the Hospital Pharmacists in Conducting Pharmacy Practice Research: A Study from Malaysia
     • date: 2022-12-23
     • words: 6235
     • flesch: 52
     • summary: To support this paradigm shift, practicing pharmacists should be equipped with essential skills to conduct pharmacy practice research (4-6), thus improving the overall healthcare outcomes (2, 7- 9). In addition, the pharmacists expressed facing barriers to performing pharmacy practice research which dates back to their undergraduate studies.
     • keywords: ability; activities; appropriate; attitudes; barriers; career; clinical; collection; competence; conducting; confidence; data; degree; designing; drug; education; experience; findings; frequency; half; health; healthcare; hospital; hospital pharmacists; human; inadequate; information; interested; international; investigator; involvement; iraqi; items; journal; lack; level; limited; literature; low; majority; malaysia; medical; methods; need; number; old; participants; participation; perception; pharmaceutical; pharmacists; pharmacology; pharmacy; pharmacy practice; postgraduate; practice; practice research; previous; professional; public; related; research; research activities; research training; respondents; response; results; sample; school; sci; self; services; skills; social; statistical; students; studies; study; survey; table; training; undergraduate; university; vol.31(2; years; جامعة; كلية; ماليزيا
     • versions: original; plain text
147. bijps-1571
     • author: Hadi, Hind; A. Al-Uzri, Wasan
     • title: Sensitive Cloud Point Extraction Method for the Determination of Isoxsuprine Hydrochloride in Pharmaceutical forms using Spectrophotometry
     • date: 2022-12-23
     • words: 3726
     • flesch: 53
     • summary: Under the selected optimum conditions, the linearity ranges of calibration curves were 1-9 and 0.5-8 µg/ml with detection limits of 0.26 and 0.09 µg/ml of ISX for batch and CPE methods respectively. CPE method has several characteristics feature over other extraction methods, such as high efficiency, sensitivity and enrichment factor, in addition of use safe aqueous medium rather than toxic organic solvents (10).
     • keywords: accuracy; acid; analytical; assay; azo; batch; cloud; concentration; conditions; coupling; cpe; determination; diazotization; different; distilled; drug; dsd; dye; effect; extraction; figure; forms; hydrochloride; incubation; influence; iraqi; isoxsuprine; isx; medium; methods; min; optimum; pharmaceutical; point; process; product; reaction; reagent; sci; sodium; solution; standard; suggested; sulfadimidine; surfactant; tablets; temperature; time; triton; values; vol.31(2; volume; water; x-114
     • versions: original; plain text
148. bijps-1572
     • author: Annisa, Viviane; Sulaiman, Teuku Nanda Saifullah; Nugroho, Akhmad Kharis; Nugroho, Agung Endro; Roman Kutsyk
     • title: Characterization of Alginate with Natural Polymers Combination for Drug Encapsulation
     • date: 2022-12-24
     • words: 5639
     • flesch: 52
     • summary: The objective of this study was the characterization of alginate combination with pectin, gum acacia, or carrageenan with and without the addition of Calcium Chloride (CaCl2) solution. In mixture solution, the sharp peaks at 1420 cm-1 along with increasing alginate ratio.
     • keywords: 0:100; 50:50; absorption; acacia; addition; alginate; arabic; bands; biological; ca2; cacl2; cacl2 solution; carrageenan; characterization; cm-1; combination; design; deviation; distilled; drug; effect; equation; experimental; fig; figure; food; form; ftir; gel; groups; gum; gum acacia; hydrocolloids; increase; index; interaction; international; iraqi; journal; macromolecules; mechanical; mixed; mixture; natural; peak; pectin; percentage; pharm; polymers; presence; properties; ratio; release; result; sci; significant; sodium; solution; specific; spectra; strength; synergism; synergistic; synergy; table; value; viscosity; viscous; vol.31(2; water; 𝑋_1 𝑋_2
     • versions: original; plain text
149. bijps-1577
     • author: Marouf, Bushra Hassan
     • title: Health Hazards, Hematological and Biochemical Alterations in Dry-Cleaning Workers using Perchloroethylene.
     • date: 2022-12-24
     • words: 3924
     • flesch: 54
     • summary: The study aimed to investigate the harmful effect associated with PERC exposure among dry-cleaning workers. The hematological indices of both PERC-non-Exposed and PERC-Exposed group (n=58) Values are presented as mean±S.D. n: number of participants; unpaired t-test was utilized to predict significance at P<0.05; Hb: Hemoglobin; Hct: Hematocrit; WBC: White blood cell. Effects of exposure to PERC vapor on the kidney and liver function markers of the dry- cleaning workers as shown in table 4.
     • keywords: alteration; available; awareness; blood; cleaners; cleaning; clinical; college; dry; dry cleaning; effect; environ; equipment; exposed; exposure; finding; function; group; hazard; health; hematological; human; indices; inhalation; iraqi; irritation; kidney; laundry; level; liver; markers; n=32; non; occupational; parameters; participants; perc; perchloroethylene; personal; pharm; ppe; present; protection; renal; respiratory; results; safety; sci; serum; shops; significant; solvent; study; subjects; sulaimani; system; table; target; toxicity; tract; university; urine; use; values; vol.31(2; waste; workers; workplace; الجاف; الكبد; المجموعة; المعرضة
     • versions: original; plain text
150. bijps-1587
     • author: almajidi, Yasir Q.; T. Khalaf , Yaseen ; M. Shalan, Naeem ; H. Alani, Israa ; A. Abu Dayyih, Wael
     • title: Preparation and Evaluation of Oroslippery Tablets Contain Irbesartan and Hydrochlorothiazide Combination for Dysphagia Patients
     • date: 2022-12-23
     • words: 5617
     • flesch: 58
     • summary: Material Control formula (CF)(%) Coating formula 1 (CF1)(%) Coating formula 2 (CF2)(%) Coating formula 3 (CF3)(%) Opadry 12 12 12 12 Xanthan gum (Slippering agent) 0 2 3 4 Peppermint flavor 0.5 0.5 0.5 0.5 Aspartame (sweetener) 0.1 0.1 0.1 0.1 Total solid concentration 12.6 14.6 15.6 16.6 Evaluation of the coated tablets Weight gain by coat Weight uniformity test was repeated on coated tablets and the average weight gain by coating process was calculated.(27) Thickness of coated tablets Thickness of coated tablets was measured to check the increase in tablet thickness due to coating process.
     • keywords: agent; analysis; apis; available; average; cf1; cf2; cf3; coated; coated tablets; coating; colorcone; combination; compression; concentration; conditions; control; different; disintegration; disintegration time; dissolution; dosage; drug; dysphagia; evaluation; figure; film; food; forms; formula; friability; gain; guideline; gum; hardness; hct; hplc; hydrochlorothiazide; hypertension; immediate; increase; iraqi; irbesartan; jordan; materials; method; min; mobile; opadry; oral; oroslippery; oroslippery tablets; p<0.05; patients; percent; pharm; pharmaceutical; phase; powder; prepared; process; profile; rate; release; results; risk; rpm; rsd; sci; sec; size; slipperiness; sodium; solid; study; swallowing; tablets; tablets irbesartan; test; thickness; time; total; uncoated; uniformity; usp; variation; vol.31(2; water; weight; xanthan; xanthan gum; ±sd; األقراص
     • versions: original; plain text
151. bijps-1589
     • author: ALJuboury, Rasha Abdullatif; Al-Shawi, Nada N
     • title: Anti-obesity effect of simvastatin and omega-3 and its combination on obese model male Wistar rats: Effect of simvastatin, omega-3 and their combination on UCP1
     • date: 2022-12-23
     • words: 5820
     • flesch: 63
     • summary: 222.66±16.43* 261.26±11.01* 396.23±45.48* week_5 54.966±3.653 154.86±8.46* 326.3±12.77* 296.83±24.98* 512.11±48.79* week_6 42.92±6.33 131.056±10.194* 302.5±22.33* 626.71±27.63* 977.03±41.4* week_7 58.45±5.1 183.466±6.78* 585.86±30.99* 901.17±22.72* However, treating with omega-3 (1ml/day) (Group IV) results from increase UCP1 gene expression from third week of therapy, also in case of mixed dose of simvastatin and omega-3 (Group V) rats where UCP1 gene expression level from increased from third week of therapy (4).
     • keywords: 1ml; 9mg; acids; activation; adipocytes; adipose; adipose tissue; anti; baghdad; bat; biol; body; brite; brown; brown adipose; cell; combination; control; day; detection; diet; different; disease; dose; effect; energy; expenditure; experiment; expression; factors; fat; fatty; fifth; figure; gene; group; group ii; group v; health; hfd; high; ibat; iii; immunohistochemistry; increase; iraqi; iwat; level; loss; male; mean; metabolic; obese; obesity; obvious; omega-3; omega3; oral; order; p<0.05; pcr; pgc-1α; pharm; post; pparγ; prdm16; previous; protein; rats; reduction; results; sci; significant; simvastatin; simvastatin 9mg; standard; studies; study; table; test; therapy; thermogenesis; thermogenic; time; tissue; transcriptional; treatment; ucp1; ucp1 protein; values; vol.31; wat; week; weekly; weight; white; wistar; إلى; الدهون; السمنة; السيمفاستاتين; على; واألوميغا
     • versions: original; plain text
152. bijps-1590
     • author: Mohammed, Samer Imad; Munaf Hashim Zalzala; Gorial, Faiq Isho
     • title: The Effect of TNF-Alpha Gene Polymorphisms At -376 G/A, -806 C/T, and -1031 T/C on The Likelihood of Becoming a Non-Responder to Etanercept in A Sample of Iraqi Rheumatoid Arthritis Patients
     • date: 2022-12-24
     • words: 8909
     • flesch: 58
     • summary: Association of the change in DAS28 over six months between different genotypes in -1031 T/C, - 806 C/T and -376 G/A TNF-α genotypes polymorphism. Also, the result was parallel to an Iranian study which examined -376 G/A TNF-α gene polymorphisms in Iranian celiac patients to healthy controls(47).
     • keywords: -1031; -1031 t; -308; -376; -376 g; -806; activity; allele; alpha; alpha gene; amplification; analysis; annealing; antagonists; anti; arthritis; arthritis patients; associated; association; available; baghdad; blood; carriers; change; characteristics; clinical; college; concentration; correlation; criteria; current; das28; data; demographic; difference; disease; dna; effect; et al; etanercept; etn; eular; factor; figure; findings; frequencies; gene; gene polymorphisms; genetic; genotypes; group; high; https://; human; indicative; influence; internet; iraqi; iraqi j; j pharm; joints; jul; kang; level; likelihood; mar; means; med; months; necrosis; necrosis factor; non; nucleotide; patients; pcr; pharm; polymorphic; polymorphisms; population; presence; primer; promoter; ra patients; region; research; responders; response; responsiveness; results; rheumatoid; rheumatoid arthritis; rheumatology; role; rs1799964; rs1800750; rs4248158; sample; sanger; sci; score; serum; significant; single; sites; size; snps; statistical; studies; study; susceptibility; table; temperature; tendency; test; therapy; tnf; treatment; tumor; value; variant; vol.31(2; α gene; التهاب; الجيني; الرثوي; المفاصل; بغداد; على; نخر
     • versions: original; plain text
153. bijps-1592
     • author: Mohammed, Mohammed Mahmood; AbdulKareem Hadi , Rusul ; Noori Salman , Isam
     • title: Potential Positive Effects using Coenzyme Q10 Supplement as Adjuvant Therapy to Gabapentin for Managing Diabetic Neuropathy
     • date: 2022-12-24
     • words: 4304
     • flesch: 60
     • summary: Finally, addition of Coenzyme Q10 to gabapentin for diabetic neuropathy patients result in improving the glycemic control & symptoms of the diabetic neuropathy, as well as decreasing effects of the inflammation in addition to oxidative stress after three months of treatment. Many clinical trials depend on supplement in an attempt to improve neuropathy symptoms such as (pain & tingling) and patient quality of life, one of them is Coenzyme Q10 which is reported to have an anti- inflammatory and antioxidant effects, and was totally nontoxic and non-reported side effects.
     • keywords: addition; age; antioxidant; baghdad; blood; center; clinical; coenzyme; coenzyme q10; complications; control; coq10; daily; data; diabetes; diabetic; diabetic neuropathy; differences; duration; effects; factor; fbg; figure; gabapentin; glucose; glycated; group; hba1c; hemoglobin; hyperglycemia; il-6; independent; inflammation; inflammatory; instrument; insulin; iraqi; journal; levels; mean; mellitus; michigan; mnsi; months; national; neuropathy; oxidative; p<0.05; pain; patients; peripheral; pharm; post; protein; q10; reported; research; results; risk; sci; screening; serum; significant; significant differences; sod; statistical; stress; study; supplement; symptoms; table; test; therapy; tnf; treatment; trial; type; university; value; vol.31(2; years; إلى; األعصاب; االعتالل; اعتالل; السكري; العصبي
     • versions: original; plain text
154. bijps-1597
     • author: Jardaq, Hind Salim; Y. Jamal, Mohammed
     • title: The correlation between CYP2C19 Polymorphisms and recurrent risk in Patients with Ischemic Stroke treated with Clopidogrel in Kurdistan region-Iraq
     • date: 2022-12-25
     • words: 5669
     • flesch: 57
     • summary: These results were consistent with the findings of another prospective study in China 2019, done on 289 patients with ischemic stroke treated with clopidogrel for prevention where the Iraqi J Pharm Sci, Vol.31(2) 2022 CYP2C19 polymorphisms in ischemic stroke patients 257 correlation of drug therapy during follow-up (ACEI/ARB) was significant with risk of stroke recurrence (P=0.006) and contrast with hypertension which was an independent risk factor of recurrence risk (P=0.04)(32), this can be due to that most of the hypertensive patients in the current study were of age below 60 years old, they had either hypertension alone or with one other risk factor, mostly hyperlipidemia without other comorbidities or they had controlled blood pressure. The correlation between recurrent risk and CYP2C19 gene polymorphisms in patients with ischemic stroke Iraqi J Pharm Sci, Vol.31(2) 2022 CYP2C19 polymorphisms in ischemic stroke patients 259 treated with clopidogrel for prevention.
     • keywords: active; activity; acute; adverse; allele; american; analysis; angiotensin; antiplatelet; arbs; aspirin; association; attack; available; blood; brand; cardiovascular; carriers; case; chain; clinical; clopidogrel; coronary; correlation; cyp2c19; cyp2c19 polymorphisms; data; diabetes; difference; distribution; dose; drug; efficacy; ems; enzyme; events; exact; factors; findings; fisher; frequencies; frequency; function; genetic; genotype; group; heart; higher; homozygotes; hypertension; impact; ims; intermediate; internet; intervention; iraqi; ischemic; ischemic stroke; kurdistan; level; lof; loss; medical; metabolite; metabolizers; mutant; non; outcomes; patients; people; pharm; pharmacogenetics; phenotype; pms; polymerase; polymorphisms; poor; population; present; prevention; reaction; recurrent; reduction; result; retrospective; risk; sample; sci; sequencing; significant; stroke; stroke patients; stroke recurrence; study; table; test; therapy; transient; variant; vol.31(2; years; إلى; االصابة; الدماغية
     • versions: original; plain text
155. bijps-1599
     • author: Hamdan, Azni Izwati; Nordin, Norsyafikah Asyilla; Sukmana, Dike Dandari
     • title: Aspirin Derivatives Exploration: A Review on Comparison Study with Parent Drug
     • date: 2022-12-23
     • words: 9758
     • flesch: 52
     • summary: Aspirin derivatives can be synthesized in various pathways and have been reported to give better biological activities compared to the parent drug. Keywords: Aspirin, Aspirin derivatives, Biological activities, Chemical modification, NSAIDs Introduction Drug modification is vital in drug discovery and development process as it is usually done by altering the molecular structure of the formerly characterized lead compound to improve drug potential for treatment of diseases.
     • keywords: acid; activities; activity; agents; albicans; alkylated; amide; ampicillin; analysis; annexin; antibacterial; antibacterial activity; anticancer; antifungal; antimicrobial; antioxidant; antiplatelet; apoptosis; arrest; aspirin; aspirin derivatives; assay; aureus; available; azo; bearing; better; biochem; biological; bleeding; body; breast; cancer; cancer cells; cell; chalcone; chalcone derivatives; chattopadhyay; clin; coli; colon; compounds; contribute; cox; cycle; damage; death; decrease; derivatives; development; dk143; drug; effect; et al; evaluation; fig; flow; formation; free; gastric; gastrointestinal; good; group; growth; h2s; halogen; high; highest; hindrance; https://; human; hybrid; hydrogen; inflammation; inflammatory; inhibition; iraqi; iraqi j; j pharm; jun; kashfi; kodela; lee; lett; low; lung; med; membrane; modification; moiety; molecular; molecules; mtt; mucus; new; ngaini; nitric; non; nosh; novel; ortho; oxidative; oxide; oxygen; parent; pathway; pc3; penetration; pharm; pharmacological; phase; phenolic; phenylcinnamamide; poor; potential; ppm; presence; proliferation; properties; prostaglandin; prostate; radical; rate; reaction; reactive; releasing; result; review; risk; role; ros; salicylic; scheme; sci; screening; significant; site; small; species; steric; stomach; stress; structure; studies; study; substituent; superior; synthesis; therapeutic; thiourea; toxicity; treatment; tumor; use; value; viability; vitro; vol.31(2; wall; wang; zhang
     • versions: original; plain text
156. bijps-1604
     • author: Salih, Twana Mohsin
     • title: A Comparative Study for the Accuracy of Three Molecular Docking Programs Using HIV-1 Protease Inhibitors as a Model
     • date: 2022-12-24
     • words: 5106
     • flesch: 61
     • summary: Molecular docking programs accuracy 161 Introduction One of the most crucial steps in the drug discovery process is lead identification; various approaches are available to identify a lead compound, such as reliable computational approaches (1). Various metric approaches can be implemented to define the accuracy of molecular docking programs and assist users to select the most appropriate program (15, 16).
     • keywords: accuracy; acid; active; affinity; aids; amide; analysis; applied; approaches; atoms; autodock; autodock vina; binding; bond; carbonyl; carboxylic; chain; chem; chimera; click; click docking; complexes; conformation; correlation; crystal; current; data; design; discovery; dock6; docking; docking programs; doi; drug; energy; enzyme; experimental; fig; figure; free; group; highest; hiv-1; hydrogen; hydroxyl; inhibitors; interactions; iraqi; journal; kcal; ligand; lopinavir; method; molecular; molecular docking; molecules; new; non; novel; pharm; pharmaceutical; pocket; poses; prediction; programs; protease; protease enzyme; protein; ray; receptor; research; results; sampling; saquinavir; sci; scoring; site; software; structure; study; table; target; ucsf; vina; vol.31(2; δgbinding; االلتحام; الجزيئي; الذاتي; على; فينا
     • versions: original; plain text
157. bijps-1605
     • author: Dallal Bashi, Ahmed Yahya; Fathi, Fatimah Haitham
     • title: Evaluation of Hepatic Enzymes in major β-thalassemic Patients using Deferasirox
     • date: 2022-12-25
     • words: 4414
     • flesch: 53
     • summary: Administration of deferasirox for β- thalassemia major patients causes elevation of serum ALP activity and ferritin level. The mean of serum ALP activity showed no significant increase in group A in comparison with group C, while in group B, there was a significant increase in the mean of serum ALP activity (Tables 1 and 2 respectively).
     • keywords: activities; activity; age; alkaline; alp; alp activity; alt; aminotransferase; analysis; anova; ast; blood; bone; causes; cell; clinical; comparison; controls; deferasirox; dependent; difference; doi; effect; elevation; enzymes; ferritin; group; group c; hematol; hemoglobin; hepatic; https://www.sciencedirect.com/science/article/pii/s016748891930148x; important; increase; iraqi; iron; level; liver; major; mean; months; mosul; normal; overload; parameters; patients; pharm; phosphatase; present; production; p≤0.05; results; sci; serum; serum alt; serum ferritin; significant; significant increase; study; tables; test; thalassemia; thalassemia major; therapy; transfusion; value; variance; vol.31(2; work; βtm; أمين; الدم; الدنري; زيادة; للار; للدم; مصيل; ووع; ييتا
     • versions: original; plain text
158. bijps-1606
     • author: Masar Basim Mohsin Mohamed ; Zainab Saad Qaddoori; Ghaidaa Sulaiman Hameed
     • title: Study the Effect of 12-Hydroxyoctadecanoic Acid Concentration on Preparation and Characterization of Floating Organogels using Cinnarizin as Modeling Drug
     • date: 2022-12-24
     • words: 4237
     • flesch: 58
     • summary: In-vivo floating study This study was executed to support the floating in-vitro outcomes of HOA organogels. The organogel’s in vitro floating properties were found positively proven our work’s aim and were buoyant for 24 hours as F5 HOA organogels remained for 12 hours in the rat’s stomach.
     • keywords: acid; amplitude; applied; capsule; concentration; delivery; depot; drug; figure; flow; formulations; frequency; ftir; gastroretentive; hoa; hoa organogels; hours; hydroxyoctadecanoic; international; iraqi; journal; liquid; lver; minutes; modulus; oil; optical; oral; organogels; oscillatory; pharm; pharmaceutics; phase; point; preparation; properties; property; release; result; rheology; scaffold; sci; sesame; solid; status; stomach; studies; study; sweep; system; temperature; test; transition; values; vials; vol.31(2; water; work; أوكتاديكانويك; العضوية; دراسة; كانت
     • versions: original; plain text
159. bijps-1610
     • author: S Jaafar , Noor ; A. Alshammaa, Dhuha ; Abdul-lalil, Thukaa zuhair; M. Ibrahem, Nabaa
     • title: Quantitative Determination and Cytotoxic Effect of Oleanolic Acid from Olea europaea Leaves Extract Cultivated in Iraq
     • date: 2022-12-25
     • words: 3536
     • flesch: 57
     • summary: The chromatogram for ethyl acetate and extracted oleanolic acid fractions (Figure 2, B and 2, C) demonstrated the presence of distinct peaks at 9.70 and 9. 79 min which reflects the presence of oleanolic acid respectively in both examined fractions Figure 1. oleanolic acid and its cytotoxic effect DOI: https://doi.org/10.31351/vol31iss2pp244-250 244 Quantitative Determination and Cytotoxic Effect of Oleanolic Acid from Olea europaea Leaves Extract Cultivated in Iraq Noor S
     • keywords: acetate; acetate fraction; acid; acidic; activity; amj13; antioxidant; assay; baghdad; basic; breast; cancer; cell; chemistry; chromatogram; college; concentration; content; cytotoxic; cytotoxicity; dependent; derivatives; determination; different; effect; ethyl; ethyl acetate; europaea; evaluation; extract; extraction; figure; fraction; hplc; human; hydrolysis; ic50; identification; iraqi; isolation; journal; leaves; line; medicinal; methanol; method; molecules; mtt; new; olea europaea; oleanolic; oleanolic acid; olive; pharm; pharmaceutical; plant; potential; presence; quantification; quantitative; sci; sciences; solution; standard; table; test; tlc; treatment; tumor; university; ursolic; vol.31(2; water; أوراق; الثدي; الزيتون; مستخلص
     • versions: original; plain text
160. bijps-1611
     • author: Ruaa Mohammed Ibrahim; Dhuha Abdul Saheb Alshammaa
     • title: Pharmacological aspects of Borago officinalis (Borage): A review article
     • date: 2023-06-16
     • words: 8233
     • flesch: 46
     • summary: Hamed ANE, Wahid A. Hepatoprotective activity of Borago officinalis extract against CCl4- induced hepatotoxicity in rats. Borago extract also improved gastro-esophageal reflex-associated symptom.
     • keywords: acid; activities; activity; acute; administration; amyloid; analgesic; analysis; antibacterial; antimicrobial; antioxidant; antioxidant activity; anxiolytic; aqueous; aspects; beta; borage; borage extract; borage flowers; borage oil; borago officinalis; bso; capacity; ccl4; cells; changes; chemical; clinical; components; composition; compounds; constituents; content; crude; cultivated; cyclical; cytotoxic; damage; different; disease; dpph; effect; elevated; enzymes; essential; ethanolic; ethanolic extract; exposure; extract; factor; fatty; fatty acids; figure; flavonoids; flowers; food; frap; free; gamma; gene; gla; gsh; health; hepatic; hepatoprotective; hepatotoxicity; herbal; high; higher; hippocampus; hplc; hydroalcoholic; il-1; impairment; important; improvement; induced; inflammation; inflammatory; inhibition; injury; int; international; iraqi; irradiation; j pharm; journal; leaf; leaves; levels; like; linoleic; lipid; liver; ltp; main; male; mastalgia; mda; medicinal; medicine; memory; metabolism; metabolites; method; mice; model; natural; officinalis; oil; oils; oral; oxidative; pain; parts; patients; peroxidation; pharm; pharm sci; pharmaceutical; pharmacological; phenolic; phytochemical; plant; polyphenolic; potential; production; properties; protective; protein; quercetin; radical; rats; reducing; related; reported; res; respiratory; result; review; scavenging; sci; seed; serum; shahidi; significant; source; spathulenol; species; stress; structure; studies; study; symptoms; syndrome; synthesis; test; tissues; treatment; unsaturated; use; vol.32(1; water; wild; wound; الثور; لسان
     • versions: original; plain text
161. bijps-1627
     • author: Al-Atassi, Abdullah Zuhair; AL-KHATIB, Racha Aboualkher; OTHMAN, Mohammad Abdulraouf
     • title: Comparison of Phenolic Contents and Antioxidant Activities for Black and White Desert Truffles Spread in Syria
     • date: 2022-12-24
     • words: 4972
     • flesch: 62
     • summary: To extensively characterize the antioxidant potential of truffle extracts, two antioxidant assays were applied. Yields of extraction, phenolic and flavonoid contents, and antioxidant activities of Terfezia claveryi and Tirmania pinoyi extracts.
     • keywords: aae; absorbance; acid; activities; activity; analysis; antioxidant; aqueous; assay; benzoic; black; chemical; chloride; cinnamic; comparison; composition; compounds; content; control; damascus; desert; detection; determination; dpph; dry; dry extract; edible; ethanolic; extract; extraction; ferric; figure; flavonoid; food; frap; gae; hydroxy; ic50; iraqi; methods; min; mixture; nutritional; pharm; phenolic; phytochemical; polyphenols; power; profile; radical; reported; results; scavenging; sci; species; standard; studied; study; syria; t.claveryi; t.pinoyi; table; temperature; terfezia; tfc; tirmania; total; tpc; trans; truffle; university; use; values; vol.31(2; white; wild; µmol; الكمأة
     • versions: original; plain text
162. bijps-1632
     • author: Alduboni, Noor Mohammed; N Al-Shawi, Nada
     • title: Possible protective effects of two different doses of cyanocobalamin against methotrexate nephrotoxicity in rats
     • date: 2022-12-24
     • words: 4873
     • flesch: 48
     • summary: Renoprotective effects of umbelliferone on methotrexate- induced renal injury through regulation of Nrf- 2/Keap-1, P38MAPK/NF-κB, and apoptosis signaling pathways. Co-administration of cyanocobalamin at doses cyanocobalamin 0.5mg/kg and 2mg/kg with methotrexate showed significant-reduction- (P<0.05) in malondialdehyde, significant elevation (P<0.05)-in the glutathione level, significant upregulation in renal Nrf2 expression and significant down regulation in renal keap1 expression each compared to corresponding levels in methotrexate-only treated group.
     • keywords: 2019; 2mg; actin; activation; acute; administration; antioxidant; b12; baghdad; coa; combination; consecutive; control; cyanocobalamin; damage; day; days; different; doi; dose; drug; effects; epub; error; experimental; expression; factor; figure; glutathione; group; gsh; hassanein; high; ho-1; https://www.sciencedirect.com/science/article/pii/s0753332221009641; hussein; induced; inflammation; injury; iraqi; keap1; kg mtx; kidney; level; mahmoud; mda; mean±sem; methotrexate; methotrexateinduced; mrna; mtx; mtx group; nephrotoxicity; normal; nrf2; oxidative; p<0.05; pathways; pharm; pmid; protective; rats; regulation; renal; researchers; response; role; ros; saline; sci; signaling; significant; single; stress; study; tissue; vitamin; vol.31(2; week; الجرذان; الصفاق; الميثوتريكسيت; داخل; كغم; واحدة
     • versions: original; plain text
163. bijps-1635
     • author: G Jameel , Murooj; Alhakeem, Zainab M; Al-Osami, Mohammad H
     • title: Prevalence of AGER gene polymorphism in post menopause Iraqi sample with Osteoporosis and osteopenia in type 2DM
     • date: 2022-12-24
     • words: 4596
     • flesch: 61
     • summary: The gene and allele frequencies for rs11812261 variant were GG 79%, GA 21%, (G89%, A11%) for group A, GG85%, GA 15% (G 92.5%, A7.5%) for control group, while The gene and allele frequencies for rs143118560 variant was AA51%, AT26%, TT23%(A64%, T36%)for group A, AA75%, AT15%, TT10% (A82.5%, five milliliters of blood sample were divided into three tubes; one tube (1ml) contain gel for obtain serum to measure glucose level, the others tubes containing ethylene-diamine-tetra-acetic acid (EDTA), in second tube 2ml stored in deep freeze at (–40 Co) until genomic analysis of DNA for the performance of PCR genotyping of gene polymorphisms of RAGE, in third tube 2ml used to perform Glycated Hemoglobin % (HbA1c) assays.
     • keywords: advanced; ager; ages; allele; amplification; baghdad; biochemical; blood; bone; college; comparison; control; control group; diabetes; diabetic; disease; disorders; dna; electrophoresis; end; frequencies; frequency; gel; gene; genetic; genotype; glucose; glycation; group; hba1c; healthy; heterozygous; high; higher; homozygous; iraqi; levels; mean; mellitus; menopause; metabolism; non; osteopenia; osteoporosis; parameter; patients; pcr; pharm; polymorphism; post; postmenopausal; prevalence; products; rage; region; results; risk; role; rs118122061; rs143118560; rs1800624; sample; sci; serum; significant; snp; studies; study; table; value; variant; vol.31(2; women; ±sd; الزيجوت; العظام; على
     • versions: original; plain text
164. bijps-1637
     • author: Ahmed Mansur Kadhim; Mohammed, Mohammed Mahmood; Hussein Muhammad Hassan Abdul-Hussein ; sultan, Yasir Sabeeh Abdulridha
     • title: Treatment of Helicobacter Pylori Infections Using Moxifloxacin-Triple Therapy Compared to Standard Triple and Quadruple Therapies
     • date: 2023-06-16
     • words: 5426
     • flesch: 58
     • summary: Jung SM, Cheung DY, Kim JI, Kim I, Seong H. Comparing the efficacy of concomitant therapy with sequential therapy as the first-line therapy of Helicobacter pylori eradication. Helicobacter pylori eradication with a capsule containing bismuth subcitrate potassium, metronidazole, and tetracycline given with omeprazole versus clarithromycin-based triple therapy: a randomised, open-label, non- inferiority, phase 3 trial.
     • keywords: abo; adverse; analysis; antigen; b.i.d; bismuth; blood; blood group; clarithromycin; clinical; data; days; differences; different; disease; drug; duration; effects; efficacy; eradication; eradication rate; esomeprazole; gastric; gastroenterology; gastrointestinal; group; h. pylori; health; helicobacter; helicobacter pylori; high; higher; incidence; infection; iraqi; journal; kim; line; malfertheiner; metronidazole; moxifloxacin; negative; oral; overall; patients; peptic; pharm; phenotype; positive; prevalence; pylera; pylori; pylori eradication; pylori infection; quadruple; quadruple therapy; rapid; rate; regimen; reported; resistance; respectively; sci; significant; standard; stool; studies; study; tab; table; test; therapies; therapy; treatment; triple; triple moxifloxacin; triple regimen; triple therapy; ulcer; use; value; vol.32; wang; البوابية; الثالثي; الدراسة; العالج; على; هذه
     • versions: original; plain text
165. bijps-1639
     • author: Oleiwi, Mohammed Abdulameer; Zalzala, Munaf H.
     • title: Synthesis, Molecular Docking Study and Cytotoxicity Evaluation of some Quinazolinone Derivatives as Nonclassical Antifolates and Potential Cytotoxic Agents
     • date: 2022-12-25
     • words: 6870
     • flesch: 62
     • summary: Molecular docking study showed that both compounds S1 and S2 displayed partially a similar binding mode with the active site of DHFR in comparison with the co-crystallized ligand (MTX), whereas compound S1 showed a different binding mode with the active site of TS when compared with the co-crystallized ligand (raltitrexed). Docking study on TS enzyme revealed that compound S1 formed only Iraqi J Pharm Sci, Vol.31(2) 2022 Synthesis, molecular docking study of some quinazolinone derivatives 292 one hydrogen-bonding interaction with the active site residue LEU221 with a distance of 2.909 Å through the NH group of the anilide moiety (Figure 7 (B)), while compound S2 formed a hydrogen- bonding interaction between the carbonyl oxygen of the anilide and ASN112 residue at 3.067 Å distance (Figure 7 (C)).
     • keywords: 13cnmr; = o; a549; acceptor; acetate; acid; active; activity; agents; amide; amino; anilide; anticancer; antifolates; antitumor; arg31; baghdad; bond; breast; c =; cancer; cell; ch2; ch3; chem; compounds; cytotoxic; cytotoxicity; d,2h; derivatives; dhfr; dihydrofolate; dmso‐d6; docking; docking study; donor; drug; dry; enzymes; ethyl; evaluation; figure; ftir; glutamate; group; hexane; human; hydrogen; ic50; inhibition; interactions; iraqi; ligands; line; lung; m.p; methanol; methotrexate; mmol; moiety; molecular; new; nhf; pdb; peak; pharm; potent; potential; powder; ppm; presence; protein; quinazolinone; raltitrexed; reductase; residue; s,3h; sci; sec; singlet; site; str; stretching; study; synthase; synthesis; synthesized; target; tea; thiol; thymidylate; vibration; vol.31(2; الصايا
     • versions: original; plain text
166. bijps-1641
     • author: Kadhim, Haitham; Gatea, Fouad; Abu Raghif, Ahmed; Ali, Kholod
     • title: Role of Topical Ritodrine Hydrochloride in Experimentally Induced Hypertrophic Scar in Rabbits
     • date: 2022-12-25
     • words: 6918
     • flesch: 54
     • summary: Thirty-two healthy male albino rabbits that divided in to 4 groups were included in the study (healthy; induced untreated hypertrophic scars; induced hypertrophic scars treated with 0.1% Triamcinolone acetonide (TAC) as a standard drug; and induced hypertrophic scars treated with 0.5% Ritodrine HCL gel twice daily for 21 days. Therapy of induced hypertrophic scar with topical Ritodrine was successfully effective in rabbits.
     • keywords: acetonide; activation; addition; adrenergic; angiogenesis; animals; anti; beta; camp; collagen; comparison; consistent; control; current; data; days; decrease; deviation; difference; differentiation; drug; ear; effects; elevation; expression; factor; fibroblast; figure; findings; formation; function; gel; group; growth; hdf; healing; healthy; height; histopathological; hydrochloride; hyperpigmentation; hypertrophic; hypertrophic scar; iii; immunohistochemistry; immunoreactivity; index; induced; induced hypertrophic; inflammation; inflammatory; int; iraqi; journal; keloids; kruskal; level; mean; mechanism; medicine; model; normal; number; paraffin; percent; pharm; porcine; potential; preparation; previous; proliferation; protein; p≤0.05; rabbits; receptor; reduced; reduction; results; ritodrine; ritodrine hydrochloride; role; salbutamol; scar; scar group; scar size; scarring; sci; score; sections; sei; signaling; significant; size; skin; slides; solution; standard; steroid; study; surface; surg; table; tgf; therapy; tissue; topical; treatment; triamcinolone; untreated; value; vitro; vivo; vol.31(2; wallis; wound; zebrafish; β2arag; إلى; األدرينالية; الضخامية; المستحثة; الندبة; النمو; بشكل; بيتا
     • versions: original; plain text
167. bijps-1643
     • author: S. Hassan, Jabbar; Al-Tamimi, Bushra J.; Ghazi Hassan, Fuad
     • title: Occurrence of Quinolone-Resistance Genes in Ciprofloxacin-Resistant Salmonella Enterica Serotype Typhi Isolated form Blood Sample of Patients with Typhoid Fever
     • date: 2022-12-24
     • words: 2716
     • flesch: 55
     • summary: Fluoroquinolone un-responsiveness are primarily caused by two mechanisms: chromosomally mediated mutations in topoisomerase's quinolone resistance determining regions (QRDR) and quinolone resistance determining region mutations; resistance genes belong to qnr groups plasmids mediated play a role in Fluoroquinolone resistant (3). It's worth noting that the transfer of resistance genes among Enterobacteriaceae bacteria, such as quinolones genes, is a complicated process involving a variety of mechanisms, such as plasmid- mediated resistance gene transfer and chromosomal alterations.
     • keywords: agents; antibiotics; antimicrobial; bacterial; blood; chromosomal; ciprofloxacin; current; dna; enterica; enterica serotype; enterobacteriaceae; fever; fluoroquinolone; food; genes; iraqi; isolates; journal; medicine; microbiology; multiplex; mutations; occurrence; patients; pcr; pharm; plasmid; positive; prevalence; qnra; qnrb; qnrs; quinolone; quinolone resistance; rate; resistance; resistance genes; salmonella; salmonella enterica; samples; sci; serotype; species; study; table; typhi; typhoid; university; vol.31(2; world; الدراسة; السالمونيال; المقاومة; للسيبروفلوكساسين; هذه
     • versions: original; plain text
168. bijps-1654
     • author: Ibrahem, Nabaa Mohammed; Khadum, Enas Jawad; Mutlag, Shihab Hattab
     • title: Isolation of Catchin and Epigallocatchin From Iraqi Rhus coriaria By Preparative High-Performance Liquid Chromatography (PHPLC)
     • date: 2022-12-25
     • words: 4434
     • flesch: 54
     • summary: The quantitative PHPLC analysis of the isolated compounds revealed that the catechin has higher concentration than epigallocatechin in fruit extract of Rhus coriaria plant as shown in Table (4). Iraqi J Pharm Sci, Vol.31( 2 ) Isolation of catchin and epigallocatchin from Iraqi R.coriaria DOI: https://doi.org/10.31351/vol31iss2pp271-282 271 Isolation of Catchin and Epigallocatchin From Iraqi Rhus coriaria By Preparative High-Performance Liquid Chromatography (PHPLC) Nabaa M. Ibrahem *,1, Enas J. Kadhim*, Shihab Hattab Mutlag ** * Department of Pharmacognosy and Medicinal Plants, College of Pharmacy, University of Baghdad, Baghdad, Iraq ** Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad, Baghdad, Iraq.
     • keywords: acetate; acid; analysis; baghdad; band; catechin; ch2; chemical; chromatography; cm-1; column; components; compound; concentration; constituents; coriaria; detector; different; epigallocatchin; ethyl; extract; figure; flow; fraction; fruit; ftir; germany; group; high; hplc; identification; important; interpretation; iraqi; iraqi j; isolated; isolation; j pharm; journal; liquid; mass; medical; medicinal; medicine; min; molecular; north; peak; performance; pharm; pharm sci; phenolic; phytochemical; plant; preparative; quantitative; r.coriari; rhus; rhus coriaria; sample; sci; sciex; solvent; spectra; spectroscopy; spectrum; spice; standard; str; sumac; system; table; techniques; time; treatment; university; use; vibration; vol.31(2; wild; بغداد
     • versions: original; plain text
169. bijps-1658
     • author: Aziz, Zahraa Yhaya; Mohsin, Masar Basim; Jasim, Marwa Hazim
     • title: Formulation and Assessment of Delayed/Slow-Release Diclofenac Sodium Edible Organogel Utilizing Low Molecular Weight Organogelators
     • date: 2023-06-16
     • words: 5587
     • flesch: 65
     • summary: Organogels of 12HSA in AO and CO as in A and B, organogels of span 60 in AO and CO as in C and D while in E and F are span 40 in AO and CO organogel. Iraqi J Pharm Sci, Vol.32( 1 ) 2023 Slow release organogel 33 Oscillatory rheology study The rheology was carried out utilizing Anton par mcr 302 rheometer using plate-plate configuration (PP 25/ SN 61895).
     • keywords: 12hsa; acid; acidic; aggregates; amplitude; bath; capacity; capsule; concentration; curves; delayed; delivery; diclofenac; different; drug; dsc; fibers; figure; flow; formulation; frequencies; frequency; gelation; gelators; higher; hours; hpmc; images; iraqi; liquid; loaded; lver; media; minutes; modulus; molecular; morphology; obc; oil; oils; optical; organogel; oscillatory; pharm; phase; point; prepared; previous; properties; release; release organogel; results; rheology; scaffold; sci; similar; slow; slow release; sodium; sol; solubility; solution; span; strain; structure; study; sweep; table; tabletop; temperature; test; thermal; transition; value; vials; vol.32; water; work; wt%; اسد; العضوية
     • versions: original; plain text
170. bijps-1671
     • author: Ayad Lafta, Amenah; N. Hamad, Maha
     • title: Isolation of Alkaloids from Papaver rhoeas (Papaveraceae) Wildly Grown in Iraq
     • date: 2021-12-09
     • words: 2617
     • flesch: 61
     • summary: Papaver rhoeas L 80 Identification, isolation and purification of alkaloids from Papaver rhoeas plant 1. The plant was extracted by hot extraction method using Methanol then fractionation was done to separate alkaloids from chloroform Fraction by TLC and PTLC .The alkaloids were isolated and purified by PTLC then subjected to various analytical techniques for alkaloids identification such as UV, LC mass and IR .The result was indicated of three alkaloids (dihydrocodien, chelidonine and papaverrubine C) in Papaver rhoeas plant.
     • keywords: .the; alkaloids; analysis; aromatic; baghdad; bending; chelidonine; chemical; chloroform; chromatography; compound; data; dihydrocodeine; epiporphyroxine; extract; extraction; figure; ftir; identification; iraqi; isolated; isolation; layer; liquid; mass; max; molecular; papaver; papaver rhoeas; papaverrubine; peak; pharm; phenol; plant; rhoeas; sci; spectrum; starching; stretching; structure; table; vol.30(2; ʎmax; الخشخاش; العراق; نبات
     • versions: original; plain text
171. bijps-1673
     • author: Mohammed, HS; Ahmida, MHS; Madi, MF; Abdel-Gayoum, A A
     • title: Ameliorative Effects of the Aqueous Extract of Allium porrum (Wild Leek) against Cisplatin-Induced Nephrotoxicity in Rabbits
     • date: 2021-12-11
     • words: 5075
     • flesch: 55
     • summary: Antioxidant changes Cisplatin treated group exhibited significant reductions in the renal cortical GSH content and activities of CAT and SOD by 32.20%, 73.86% and 41.82%, respectively and a significant (P˂0.01) increase in the cortical lipid peroxidation by 89.64% compared to control. However, in LCP group animals, the serum TC was still higher than that in control (C) by 48.8%, the TG by 21.1%, and LDL by 50.4%, whereas, the HDL-c and VLDL-c were not significantly different (P>0.05) compared to that of control group (C) rabbits.
     • keywords: acid; activities; activity; administration; allium; animals; antioxidant; aqueous; body; cat; cellular; cholesterol; cisplatin; cisplatininduced; concentration; control; cortical; creatinine; day; days; decrease; density; different; dismutase; dose; drug; effects; experimental; extract; fold; glucose; grade; group; gsh; hdl; high; injury; iraqi; kidney; lcp; ldl; leek; leek extract; levels; lipid; lipoprotein; low; means; necrosis; negative; nephrotoxicity; oxidative; peroxidation; pharm; porrum; positive; protein; rabbits; reduction; renal; sci; serum; significant; sod; stress; study; superoxide; table; total; tubular; urea; vol.30(2; water; weight; wild; البري; الدم; السيسبالتين; المائي; بعقار; طريق
     • versions: original; plain text
172. bijps-1677
     • author: Ahmed, Kawther Khalid; Al-Jumaili, Ali Azeez; Salman, Salema Sultan; Kathem, Sarmed Hashem
     • title: The Students Experience of Hybrid- Education Model at The University of Baghdad College of Pharmacy
     • date: 2021-12-23
     • words: 4762
     • flesch: 45
     • summary: Challenges in distance education implantation and future directions The overall rating of the college success in distance education showed a median score of neutral (3) (Table 1). However, no further investments at infrastructures essential for distance education took place.
     • keywords: academic; academic year; baghdad; better; campus; class; classroom; college; course; covid-19; delivery; different; distance; distance education; education; education experience; education model; end; evaluation; exams; experience; face; faculty; figure; general; google; hybrid; hybrid education; iraq; lab; learning; lectures; management; median; model; online; pandemic; perceptions; pharmacy; program; report; responses; satisfaction; scientific; semester; students; study; support; survey; synchronous; table; technical; university; virtual; vol.30(2; year; التعليم
     • versions: original; plain text
173. bijps-1699
     • author: Al-Uzri, Wasan Abdulamir; Mariam Jamal; Hind Hadi
     • title: Colorimetric Determination of Salbutamol Sulfate using Spectrophotometry-Continuous Flow Injection Technique in Pure and Pharmaceutical Forms
     • date: 2023-06-16
     • words: 3886
     • flesch: 55
     • summary: By analyzing three different concentrations of SLB solutions using both approaches, the accuracy and reproducibility of the suggested procedures were assessed as relative error and relative standard deviation (% RSD), respectively (Table 3). To the 2 µg/mL of SLB solution, fiftyfold of each interference (starch, lactose, polyvinylpyrolidone, and magnesium stearate) was added and evaluated separately utilizing batch and FIA techniques.
     • keywords: absorbance; absorption; accuracy; alkaline; analysis; azo; batch; chemical; coil; colorimetric; compound; concentration; conditions; coupling; determination; diazotization; different; distilled; dosage; drug; dsdm; dye; fia; figure; flow; forms; high; influence; injection; iraqi; journal; length; manifold; methods; nh4oh; pharmaceutical; physical; present; product; range; rate; reaction; reagent; results; rsd; salbutamol; sample; sci; sensitivity; slb; solution; spectrophotometric; standard; sulfadimidine; sulfate; table; tablets; valve; vol.32(1; volume; water; الجرياني
     • versions: original; plain text
174. bijps-1712
     • author: Hazhar M. Balaky; Akam Jasim Mustafa; Parween Abdulsamad Ismail
     • title: Clinical significance of Osteoprotegerin, Vitamin D, Obestatin and some biochemical variables in Kidney failure Patients
     • date: 2023-06-16
     • words: 5169
     • flesch: 45
     • summary: However, the role of native vitamin D supplementation (ergocalciferol, cholecalciferol or calcifediol) remains unclear in chronic kidney disease (CKD), particularly in the pre-dialytic phase (4). The role of uric acid in chronic kidney disease (CKD) has been a controversial topic for decades.
     • keywords: acid; albumin; american; analysis; beta; blood; body; calcium; cause; cells; chronic; chronic kidney; circulating; ckd; clinical; concentration; controls; creatinine; current; damage; decline; decrease; deficiency; development; diabetes; dialysis; dihydroxyvitamin; disease; elevated; esrd; expression; factor; failure; figure; filtration; findings; function; ghrelin; glomerular; group; growth; health; higher; inflammation; inflammatory; insufficiency; international; iraqi; journal; kidney; kidney disease; kidney failure; kidney function; levels; lower; markers; metabolic; mortality; nephrology; nephropathy; nitrogen; nourishment; obestatin; opg; osteoprotegerin; patients; persistent; pharm; phosphorus; progression; protein; rate; renal; renal disease; research; results; review; risk; role; samples; sci; serum; significant; stage; studies; study; table; total; urea; uric; vascular; vitamin; vol.32
     • versions: original; plain text
175. bijps-1716
     • author: Al-Hamdany, Muna; Al-Hubaity , Abduljabar
     • title: The Protective Effects of N-acetylcysteine against 5-Fluorouracil Induced Intestinal Toxicity in Albino Rats
     • date: 2023-06-16
     • words: 3241
     • flesch: 47
     • summary: Results showed an increase in the depth of the colonic crypts in group B rats as compared to the control group, mucinous degeneration of the intestinal mucosal cells along with necrosis, and inflammatory cells infiltration in the lamina propria. Micrograph of the colon of group A (control groups) showing surface epithelium (black arrows), intestinal glands in the lamina propria (white arrows) (H&E X 100).
     • keywords: acetylcysteine; albino; animals; antioxidant; arrows; body; cancer; cells; college; colon; colonic; columnar; consecutive; control; crypts; damage; days; degeneration; dose; drug; effects; epithelium; experiment; figure; fluorouracil; goblet; group; h&e; infiltration; inflammatory; injection; intestinal; intraperitoneal; iraqi; javascript; lamina; lining; mean; medicine; micrograph; mosul; mucinous; mucosa; mucositis; nac; necrosis; normal; oxidative; pharm; pharmacol; propria; protective; rats; recipient; sci; significant; surface; tissue; toxicity; treatment; weight; المجموعة; خمسة; عقار
     • versions: original; plain text
176. bijps-1734
     • author: jassim, Huda
     • title: The Isolation and Identification of Salmosamonella typhi from clinical samples with molecular detection of O-antigen encoded genes
     • date: 2023-06-16
     • words: 2045
     • flesch: 59
     • summary: 9. Liu B, Knirel YA, Feng L, Perepelov AV, Senchenkova SN, Reeves PR, Wang LStructural diversity in Salmonella O antigens andits genetic basis. Presence of Wzy and Wzx gene in different isolates of Salmonella typhi.
     • keywords: antibiotics; antigen; bacterial; detection; diagnosis; diversity; dna; fever; figure; flippase; genes; genetic; high; identification; iraqi; isolates; journal; method; molecular; multi; patients; pcr; pharm; polymerase; present; proteins; resistance; results; salmonella; salmonella typhi; samples; sci; strains; study; susceptibility; test; treatment; typhi; typhoid; vol.32; widal; wzx; wzy; التيفوئيد; الحيوية
     • versions: original; plain text
177. bijps-1735
     • author: Kadhum, Ahmad; Mohammed D. Al-Rekabi; Furqan Hashim
     • title: Pharmaceutical sales and marketing as a future career for pharmacy students in Iraq: perception and barriers
     • date: 2023-06-20
     • words: 4573
     • flesch: 58
     • summary: Abstract The exposure of pharmacy students to fieldwork experience throughout the early stages of their education would assist in preparing them for their future careers. Keywords: Pharmaceutical promotion, Pharmacy students, Pharmacy career, Student perception, pharmaceutical sales.
     • keywords: addition; arabia; area; aspects; barriers; career; colleges; community; drug; education; ethical; experience; face; factors; family; field; fifth; future; future career; gender; health; income; industry; iraq; items; job; journal; knowledge; majority; marketing; medical; najaf; number; opportunities; perceptions; pharmaceutical; pharmaceutical promotion; pharmacists; pharmacy; pharmacy students; private; promotion; public; questionnaire; respondents; sales; saudi; sci; second; sector; significant; skills; social; students; study; survey; table; training; university; vol.32; work; working; year; الصيدلة
     • versions: original; plain text
178. bijps-1741
     • author: Pozdnyakov, Dmitry; Adzhiakhmetova , Similla; Chervonnaya, Nadezhda; Oganesyan, Stanislav
     • title: Lipid -Lowering Effect of Polysaccharide (Pectin) of Viscum album L. Plant in Rats
     • date: 2023-06-16
     • words: 5832
     • flesch: 61
     • summary: NC - negative control; PSpc — a group of rats that received pectin from pear; PSmd - a group of rats that received pectin from a apple tree; PSva/pc - a group of rats that received pectin substances from mistletoe collected from pear; PSva/md - a group of rats that received pectin substances from mistletoe collected from apple tree; WSPpc - a group of rats that received soluble pear polysaccharides; WSPmd - a group of rats that received water soluble polysaccharides from apple tree; WSPva/pc - a group of rats that received water-soluble polysaccharides of mistletoe collected from common pear; WSPva / md - a group of rats that received water-soluble polysaccharides of mistletoe collected from apple tree. NC - negative control; PSpc — a group of rats that received pectin from pear; PSmd - a group of rats that received pectin from a apple tree; PSva/pc - a group of rats that received pectin substances from mistletoe collected from pear; PSva/md - a group of rats that received pectin substances from mistletoe collected from apple tree; WSPpc - a group of rats that received soluble pear polysaccharides; WSPmd - a group of rats that received water soluble polysaccharides from apple tree; WSPva/pc - a group of rats that received water-soluble polysaccharides of mistletoe collected from common pear; WSPva / md - a group of rats that received water-soluble polysaccharides of mistletoe collected from apple tree.
     • keywords: acid; activity; administration; album; animals; apple; apple tree; blood; carboxyl; cept; change; chdl; cholesterol; cldl; communis; composition; compounds; concentration; conditions; content; decrease; determination; effect; experimental; fractions; free; functional; group; high; host; hypolididemic; increase; iraqi; leaves; level; lipid; low; metabolism; method; mistletoe; mistletoe leaves; nc group; npcl1; pear; pectin; pectin substances; pharm; pharmacological; plant; polysaccharides; properties; protein; psmd; pspc; psva; quantitative; rats; relative; research; russian; sci; significant; soluble; soluble polysaccharides; solution; study; substances; test; time; total; transfer; tree; triglycerides; use; viscum; vol.32(1; water; white; white mistletoe; work; wspva
     • versions: original; plain text
179. bijps-1744
     • author: Hassan, Zahra; hassan, Tuka; Abu- Raghif, Ahmed
     • title: Evaluation the Effect of Phytosterol Fraction of Chenopodium Murale in Comparison with Tacrolimus on Mice Induced Atopic Dermatitis
     • date: 2023-06-16
     • words: 4990
     • flesch: 52
     • summary: The comparison between the effect of topical application of tacrolimus and Phytosterol Fraction on the studied variables shows that the level of WBC and thickness of epidermis and inflammatory cells were significantly lower after tacrolimus treatment, while high significant reduction was founded in parakeratosis and score of observational severity among Chenopodium murale treated group in comparison with Tacrolimus treated group. The levels of parakeratosis and observational Severity Score after phytosterol fraction of Chenopodium murale treatment were lower than after Tacrolimus treatment.
     • keywords: activities; activity; animal; anti; antibodies; application; asthma; atopic; atopic dermatitis; cells; changes; chenopodium; chenopodium murale; chloroform; college; comparison; compound; control; cream; days; decrease; department; dermatitis; disease; effect; effective; eosinophil; extract; figure; fraction; group; healthy; high; histopathological; histopathology; homogenate; hplc; ige; il-13; il-4; il13; il4; immunol; induced; inflammatory; iraqi; journal; layer; levels; mice; murale; murale effect; negative; non; observational; ointment; parakeratosis; patients; pharm; phytosterol; phytosterol fraction; plant; positive; reduction; results; retention; sample; sci; score; serum; severity; significant; sitosterol; skin; study; table; tacrolimus; test; thickness; tissue; topical; treatment; university; vol.32(1; wbc; التأتبي; التهاب; الجلد; الدم; الفايتوستيرول; على; ميوريل
     • versions: original; plain text
180. bijps-1747
     • author: Radhi, Alaa; Al-Shawi, Nada; Hassan, Ali
     • title: Impact of omega 3 alone or in combination with irinotecan on bone marrow and spleen of rats: in vivo study
     • date: 2023-06-16
     • words: 3949
     • flesch: 60
     • summary: Results Irinotecan (Group II rats), caused a significant-reduction (P<0.05) in the mitotic index in bone marrow cells (Figure 1), and in the spleen cells (Figure 2) as compared to corresponding levels in the control (Group I) rats. Administration of omega-3 fish oil (600mg/kg/day) in association with irinotecan (Groups IV) rats, there was a significant-elevation (P<0.05) of the mitotic index in bone marrow cells (Figure 1), and in the spleen cells (Figure 2) compared to corresponding index in rats’ tissues of Group ΙΙ.
     • keywords: 600mg; acids; administration; animals; apoptosis; bone; bone marrow; cancer; cells; colchicine; colorectal; control; daily; days; dietary; different; distilled; dose; drug; effects; fatty; figure; fish; fish oil; gavage; genotoxicity; group; impact; index; induced; iraqi; irinotecan; journal; marrow; marrow cells; mitotic; mitotic index; oil; omega-3; oral; p<0.05; pharm; polyunsaturated; protective; rats; reduction; sci; significant; single; slides; solution; spleen; spleen cells; study; successive; test; total; treatment; tubes; vol.32; water; أوميغا; الجرذان; السمك; الطحال; العظم; المجموعة; طريق; نخاع
     • versions: original; plain text
181. bijps-1767
     • author: AL-Saffar, Haidar; Munaf H. Zalzala
     • title: The Possible Protective Effect of Cinnamic Acid on Ovalbumin-Induced Asthma in Mice
     • date: 2023-06-16
     • words: 3774
     • flesch: 62
     • summary: Group II: asthma model group. Group III: cinnamic acid control group; mice received cinnamic acid 50 mg/kg in liquid paraffin orally by gavage.
     • keywords: acid; administration; aid; airway; allergen; allergic; animals; asthma; baghdad; balf; blood; cells; chronic; cinnamic; cinnamic acid; control; control group; count; cytokines; different; dose; e n; effect; figure; fluid; g e; gavage; group; homogenate; ige; il-33; inflammation; inflammatory; iraqi; levels; liquid; lung; m g; mice; model; n g; ova; ovalbumin; p<0.05; paraffin; pbs; pharm; pretreatment; protective; remodeling; sci; serum; significant; study; tissue; tnf; tnfα; total; vol.32(1; wbc; التحسسي; الربو; السيناميك; حمض; كجم
     • versions: original; plain text
182. bijps-1776
     • author: ibrahim, Ruaa mohammed; Zahraa Suhail Nassir
     • title: Detection of Epicatechin in Camellia sinensis Leaves by Thin Layer Chromatography and High Performance Liquid Chromatography Techniques
     • date: 2022-12-25
     • words: 3189
     • flesch: 55
     • summary: (4) 1Corresponding author E-mail: Received: / / Accepted: / / Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol31iss2pp304-312 Iraqi J Pharm Sci, Vol.31(2) 2022 Detection of epicatechin in tea leaves by TLC and HPLC 305 There are three types of tea taken from Camellia sinensis which are either not fermented like white and green tea, or partially fermented like oolong and red tea, and completely fermented like black tea, those compositions of those types are influenced by the process of fermentation(5). According to our work, the highest percentage of yield was obtained from maceration method of green tea (GT) which was (1.796) while for the decoction method of GT gave the highest yield which was (1.683), when we used 50% aqueous ethanol as solvent in two extraction method.
     • keywords: acetate; acetate fractions; acid; analyzed; aqueous; black; black tea; camellia; catechins; chemical; chloroform; chromatogram; chromatography; concentration; dbta; dbte; decoction; detection; determination; dgtae; different; epicatechin; ethanol; ethyl; ethyl acetate; extraction; figure; fractions; green; green tea; hplc; identification; iraqi; leaves; maceration; mbta; mbte; method; mgta; mgte; mobile; pharm; plant; quantitative; samples; sci; sinensis; solvent; standard; table; tea; tlc; vol.31(2; water; الشاي
     • versions: original; plain text
183. bijps-1781
     • author: alidee, Tahani; Habbal, Hoda; Karabet , Francois
     • title: Chitosan- (Prunus avium) Gum Nanocapsules Loaded with Orange Peel Extract: Nanocapsules Loaded with Orange Peel Extract
     • date: 2023-06-20
     • words: 5230
     • flesch: 57
     • summary: Hussein, A. M., Kamil, M. M., Lotfy, S. N., Mahmoud, K. F., Mehaya, F. M., & Mohammad, A. A. Influence of nano-encapsulation on chemical composition, antioxidant activity and thermal stability of rosemary essential oil. Avadi, M. R., Sadeghi, A. M. M., Mohammadpour, N., Abedin, S., Atyabi, F., Dinarvand, R., & Rafiee-Tehrani, M. Preparation and characterization of insulin nanoparticles using chitosan and Arabic gum with ionic gelation method.
     • keywords: acidic; activity; afm; analysis; antioxidant; arabic; avium; bioactive; biological; characterization; chitosan; compounds; department; different; ee%; efficiency; electron; encapsulation; essential; extract; exudates; figure; food; ftir; functional; gelation; gum; high; hours; images; international; ionic; iraqi; journal; materials; matrix; media; method; minutes; nanocapsules; nanoparticles; neutral; oil; orange; peel; pharm; phenolic; physicochemical; polymers; preparation; properties; prunus; ratio; release; results; science; sem; significant; size; solution; stability; structure; study; syria; table; vol.32(1; wall; البرتقال; الكيتوزان
     • versions: original; plain text
184. bijps-1789
     • author: Wrood Salim; sameh Arif, Inam ; Talib Al-sudani, Basma
     • title: Role of Fasting Mimicking Diet in Farnesoid x Receptor for Suppressing Epithelial-to-Mesenchymal Transition, Cell Cycle Progression, and Viability of Prostate Cancer Cells
     • date: 2023-06-16
     • words: 6984
     • flesch: 59
     • summary: Results FXR activation and FMD inhibits PC-3 viability and induce apoptotic morphological changes The effect of FXR and FMD on the growth and proliferation of prostate cancer cells was measured. (B) Representative photomicrograph shows morphological changes of prostate cancer cells and imaged by inverted phase-contrast microscope (total magnification 400x).
     • keywords: 747; acid; activation; agarose; agonist; analysis; androgen; anti; apoptosis; apoptotic; area; arrest; assay; cancer; cancer cells; capacity; cell cycle; cell migration; cells; cellular; changes; closure; combination; control; culture; cycle; cytometry; death; diet; different; effects; elabscience; emt; epithelial; expression; farnesoid; fasting; figure; flow; fmd; formation; fxr; gapdh; gene; group; growth; healing; high; hours; human; imagej; important; inhibition; inhibits; int; invasion; invasiveness; inverted; iraqi; journal; levels; line; manufacturer; mcrpc; media; medium; mesenchymal; metastasis; migration; morphological; mtt; normal; pc-3; pc-3 cells; pcr; pharm; phase; potential; present; primary; progression; proliferation; prostate; prostate cancer; protein; quantitative; receptor; reduced; research; resistance; results; role; sci; significant; software; spheroid; studies; study; survival; synthesis; therapy; total; transition; treatment; tumor; untreated; usa; viability; vimentin; vitro; vol.32; wang; western; wound; إكس; إلى; االوبتي; البروستات; المحاكي; خاليا; سرطان; على; فارنيسويد; للصيام; 𝐖𝐨𝐮𝐧𝐝
     • versions: original; plain text
185. bijps-1790
     • author: Oktavia, Listiana; Evana, Evana; Fahardita, Reza ; Agusta, Andria
     • title: Optimization of Bis-anthraquinones Production from Endophytic Fungi Diaporthe sp. GNBP-10
     • date: 2023-06-16
     • words: 3946
     • flesch: 55
     • summary: Dextrose displayed a better nutrient than glucose for epi production in Diaporthe sp. GNBP-10, as shown by higher epi production in media 3 (0.484 mg) than in media 2 (0.3705 mg). A series of culture media with various nutrient compositions was investigated in epi and bis production.
     • keywords: activity; agusta; analysis; anthraquinones; applied; area; bactotm; bis; bisanthraquniones; calibration; components; composition; compounds; content; culture; culture media; curve; dextrose; diaporthe; diaporthe sp; endophytic; endophytic fungi; epi; extract; figure; fungal; fungi; gambier; glucose; gnbp-10; growth; host; iraqi; malt; mass; media; merck; metabolites; microbiol; milipore; nutrient; optimization; pdb; peptone; pharm; plant; potato; production; research; sample; scanner; sci; secondary; starch; study; table; tlc; ud ud; vol.32(1; yeast
     • versions: original; plain text
186. bijps-1794
     • author: Nugroho, Akhmad Kharis; Kusumorini, Nindya; Pramono, Suwijiyo; Martien, Ronny
     • title: An update on Nanoparticle Formulation Design of Piperine to Improve its Oral bioavailability: A Review
     • date: 2023-06-16
     • words: 10333
     • flesch: 48
     • summary: They function to increase drug solubility, absorption rate, and bioavailability and reduce inter- and intra-individual variability in drug pharmacokinetics (55,56). The lipids in the GIT (gastrointestinal tract) stimulate the excretion process of bile salts and endogenous bile lipids which also supports lipid emulsification to form micelles and improves drug solubility in the GIT (65).Surfactants can cause fluidization of intestinal membranes and opening of tight junctions which result in increased membrane permeability (68,69).
     • keywords: aaps; absorption; acid; activity; administration; albumin; alkaloid; alzheimer; amorphous; analysis; anti; anticancer; antioxidant; applications; aqueous; arthritis; barrier; bioavailability; biodegradable; black; blood; body; brain; breast; cancer; cell; changes; characterization; chemical; chemistry; chitosan; cis; coated; complexation; complexes; compounds; concentration; core; cyclic; cyclodextrin; degradation; delivery; design; development; disease; dissolution; drug; drug delivery; drug solubility; effect; efficacy; efficiency; encapsulation; enhanced; et al; ethanol; evaluation; evaporation; food; forms; formulation; formulation design; function; gastrointestinal; globular; glycol; good; higher; hours; hpmc; human; hydrophobic; imam; inclusion; increase; inorganic; interactions; international; intestinal; iraqi; iraqi j; isomer; j pharm; journal; kim; level; ligands; like; lipid; lipophilic; liposomes; liquid; liu; loaded; longum; low; lymphatic; main; membrane; metabolism; method; microemulsion; mixture; molecular; molecules; nanocarriers; nanomedicine; nanoparticle; nanoparticle formulation; natural; nigrum; nlcs; non; oil; oral; oral bioavailability; pepper; permeability; pharm; pharm sci; pharmaceutical; pharmacy; phospholipids; physicochemical; piperine; piperine compounds; plga; polymeric; polymers; poorly; potential; processes; products; properties; pure; qds; rate; release; results; review; rheumatoid; ring; scale; sci; science; self; serum; singh; sites; size; sln; slns; snedds; solid; solubility; soluble; solvent; specific; spherical; stability; starch; storage; structure; studies; study; surface; surfactants; sustained; system; table; targeted; therapeutic; therapy; times; tissue; tract; trans; use; vivo; vol.32; wang; water; zhang
     • versions: original; plain text
187. bijps-1798
     • author: ghanim, waleed khalid; Muhsin S. G. Al-Moziel; Hussein M. Abood
     • title: Study The Lung-Protective Effects of Riboflavin and Cyanocobalamin Against Lung Toxicity-Induced by Cyclophosphamide in Rats
     • date: 2023-06-16
     • words: 3994
     • flesch: 52
     • summary: Group three and four respectively; and pre-treatment with (0.1mg/kg) of vitamin B12 Group five and pre- treatment with the mixture of both vitamins Group six and seven respectively; before CP injection produce a significant increase in TAC levels this could be explained by their ability to maintain antioxidant enzyme levels including superoxide dismutase, glutathione level in which vitamin B2 plays an important role (24); furthermore the role of vitamin B12 as a scavenger for free radicals (21, 25) and its role in modulating the level of the inflammatory cytokines (25). Group two shows inflammatory cells that found with nuclear fragmentation and pyknosis with a thickness of the alveolar wall which confirms the effects of CP when compared with Group one, however rats pre-treated with different doses of vitamin B2 Groups three and four and a fixed dose of vitamin B12 Group five prior to CP shows fewer histopathological changes such as inflammatory cell, karyorrhexis and destruction of alveolar-like emphysema when compared with Group two furthermore; rats pre-treated with combinations of different doses of vitamin B2 and fixed-dose of vitamin B12 Groups six and seven prior to CP injection shows improvement in lung tissue compared with other treated groups that have noted normal architecture alveolar wall this attributed to the effects of both vitamin B2 and vitamin B12 as the antioxidant activity and their ability to increase the level of glutathione which consist with the finding of Bashandy SA et al and Moshiri M et al which founds that vitamin B2 and vitamin B12 have an important role in the maintenance glutathione level and conversion of glutathione from oxidized form to reduced form (26, 27).
     • keywords: 0.1mg; 150mg; 40mg; alveolar; antioxidant; architecture; arrow; b12; basra; black; cells; changes; combination; consecutive; control; cyanocobalamin; cyclophosphamide; day; days; different; dose; effects; glutathione; group; health; immunohistochemical; important; inflammatory; injection; intraperitoneal; iraqi; journal; level; lung; mean; mixture; normal; oxidative; pharm; pre; protective; rats; red; reduction; riboflavin; role; sci; sciences; serum; significant; single; study; tissue; toxicity; treatment; vitamin; vitamin b12; vol.32(1; wall; الريبوفالفين; المجموعة; بجرعة; سيكلوفوسفاميد; طريق; كجم; يوم
     • versions: original; plain text
188. bijps-1800
     • author: Khaleel, Raghad Abdulsalam; Zalzala, Munaf Hashim
     • title: The Ameliorating Effect of Oral Paquinimod Administration against Imiquimod Induced Psoriasis-like Inflammation in Mice
     • date: 2023-06-16
     • words: 4685
     • flesch: 51
     • summary: These results are consistent with the previous researches that reported the Potent disease-inhibitory effects in experimental models of autoimmune diseases(16).A study by Martin Stenström(2016) revealed that Paquinimod reduces skin fibrosis in tight skin 1 mice, an experimental model of systemic sclerosis they found that Paquinimod reduces skin fibrosis in an experimental model of SSc, and this effect correlates with local and systemic effects on the immune system(4).Another study by Nina Franse´n Pettersson(2018) showed that The immunomodulatory quinoline-3- carboxamide paquinimod reverses established fibrosis in a novel mouse model for liver fibrosis(18).The anti- inflammatory effect for paquinimod revealed a significant reduction in the expression of paquinimod treated group in comparison to the model group, indicating the strong anti- inflammatory effect of paquinimod against psoriasis induced by imiquimod and this can be proved by histopathological examination of mice skin section which has been revealed that paquinimod reduced skin inflammation, scaling, thickness, parakeratosis and epidermal infiltration that have been induced by imiquimod. Paquinimod successfully reduced the gene expression for IL-17 in comparison to model mice.
     • keywords: administration; animal; application; area; baghdad; cells; comparison; consecutive; control; control group; daily; days; dexamethasone; different; dose; ear; effect; experimental; expression; fibrosis; figure; gene; group; hour; human; il-17; il-23; imiquimod; imq; index; induced; inflammation; inflammatory; iraqi; level; like; mean; mice; model; model group; mouse; normal; oral; oral administration; oral paquinimod; p<0.05; paquinimod; paquinimod administration; pasi; pharm; psoriasis; reduction; reverse; right; sci; score; section; serum; significant; skin; spleen; standard; study; susp; suspension; thickness; tissue; tnf; value; vehicle; vol.32(1; الجلد; بشكل; على
     • versions: original; plain text
189. bijps-1801
     • author: Abd allatif, Karima; Jameela Ali Hasian
     • title: Preparation and in Vitro Evaluation for Different Types of Ondansetron Hydrochloride Transdermal Patches
     • date: 2023-06-16
     • words: 4415
     • flesch: 64
     • summary: These results are in agreement with mutalic et al where the formulation with EC:PVP (3:2) exhibited the greatest percentage of drug release value (71.25 %±8.55) compared to the lowest value observed with the formulation containing EC:PVP (4.5:0.5) (47.65%±9.55)(23). . Furthermore, the presence of PVP in patches with chloroform as casting solvent reduce the crystalline state of the drug, which leads to an increase in drug release.
     • keywords: 10ml; analysis; buffer; cellulose; chloroform; content; delivery; deviation; diffusion; drug; dsc; endset; enthalpy; ethyl; evaluation; figure; film; formulation; glycol; higuchi; hydrochloride; hydrochloride transdermal; increase; int; iraqi; j pharm; layer; matrix; model; moisture; ondansetron; ondansetron hydrochloride; onset; order; osh; paddle; patches; peak; pharm; pharm sci; phosphate; physical; polyvinyl; prepared; propylene; pvp; pyrrolidone; release; results; sci; skin; solubility; solution; standard; study; systems; table; temperture; test; transdermal; transdermal patches; uptake; value; vol.32; weight
     • versions: original; plain text
190. bijps-1808
     • author: Mahde, Samah; Sarmad Haishm
     • title: Carvone exerts lung anti-inflammatory effect through hampering NF-KB pathway in lipopolysaccharide-induced acute lung injury in mice
     • date: 2023-06-16
     • words: 5275
     • flesch: 62
     • summary: Analysis and calculation of gene expression levels of TNF- α, NF –κB, COX 2, and glyceraldehyde-3- phosphate dehydrogenase (GAPDH), depend on mRNA concentration after converting it to complementary DNA. The ALI is caused by neutrophil leakage, production of a huge amount of pro-inflammatory cytokines, injury to airway epithelium and alveolar endothelium which lead to pulmonary fluid accumulation, and the impairment in gases exchange.
     • keywords: 100mg; 50mg; activation; acute; acute lung; addition; administration; ali; alpha; analysis; anti; antiinflammatory; baghdad; care; carvone; cell; college; control; corn; cox2; crit; cytokines; data; day; days; difference; dose; effect; expression; expression level; factor; figure; gene; group; group ii; group v; hrs; iii; independent; inflammation; inflammatory; injury; iraqi; level; like; lipopolysaccharide; lps; lps model; lung; lung injury; mean; med; mice; model; model group; mrna; necrosis; negative; non; normal; oil; p<0.05; pathway; pharm; pharmacy; physiol; present; production; protective; qpcr; results; sci; signaling; significant; study; syndrome; table; tissue; tnf; treatment; tumor; university; vol.32(1; الدهني; الرئة; السكاريد; المجموعة; عديد; كارفون; ملغم
     • versions: original; plain text
191. bijps-1825
     • author: AL-SHOHANI, Athmar Dhahir Habeeb; Zahraa Yahya Sabri
     • title: The Effect of Molecular Imprinting on the Loading and Release of Poorly Water Soluble Drug in Hydrogel Gontact Lenses
     • date: 2023-06-16
     • words: 5524
     • flesch: 62
     • summary: Furthermore, using the Korsmeyer-Peppas model to experimental data and explaining the release exponent values (n) provides to a better understanding of the mechanism of contact lenses release. Cumulative release in mcg of ITZ from conventional and MICLs represents the release for 24 h. Analysis of drug release kinetics Various mathematical models, such as zero order, first order, and Higuchi, were used to fit in- vitro release data.
     • keywords: acetonitrile; buffer; characterization; cls; contact; contact lenses; content; conventional; corneal; day; delivery; different; drops; drug; endurance; ewc; eye; f3mi; folding; formulations; fungal; hema; higher; hydrogel; imprinting; increase; iraqi; itraconazole; itz; journal; keratitis; lenses; loaded; loading; low; maa; materials; methanol; method; micls; molecular; monomers; ocular; order; oxygen; pbs; percent; permeability; pharm; pharmaceutics; polymer; prepared; properties; release; results; sci; sciences; silicone; soaking; solubility; solution; solvent; sr%; strength; study; surface; swelling; table; tensile; time; treatment; values; vol.32(1; water; work; الالصقة; البصمة; العدسات; تحميل
     • versions: original; plain text
192. bijps-1827
     • author: Hafidh, Rand R.; Ali, Zahraa Q. ; Abdulamir, Ahmed S.
     • title: Autophagy or Apoptosis: Anticancer Molecular Mechanism of Epigallocatechin Gallate with Natural Polyphenol Effect on HepG2 Cells Viability
     • date: 2023-06-16
     • words: 6328
     • flesch: 59
     • summary: In cancer cells, apoptosis and autophagy play a critical role in the biological process of cancer (8). Natural products-prompted autophagy is mostly causing death of tumor cells when apoptosis is totally defective in cancer cells (11).
     • keywords: 48h; activity; analysis; annexin; anticancer; apoptosis; apoptotic; arrest; assay; autophagy; baghdad; birc5; bnip3; cancer; cancer cells; capns1; carcinoma; caspase-3; cells; cflar; chen; concentration; current; cycle; cytometry; cytotoxic; cytotoxicity; ddit3; death; dna; dual; effect; egcg; eif4; endoplasmic; epigallocatechin; events; expression; figure; flow; folds; following; fos; fos-2; gallate; genes; green; hepg2; hepg2 cells; high; human; ic50; induction; iraqi; itgb1; kit; like; line; mapk9; materials; mechanism; medium; molecular; morphological; natural; nbr1; negative; pathways; pcr; pharm; phase; phosphatidylserine; protein; rb1; real; receptor; regulation; results; reticulum; retinoblastoma; rna; role; rpmi-1640; sci; significant; stress; studies; study; substrate; table; target; time; treatment; tumor; untreated; usa; vol.32; wang; االلتهام; الجينات; الخاليا; الذاتي; المبرمج; بغداد; موت
     • versions: original; plain text
193. bijps-1842
     • author: Marouf, Bushra Hassan; Ghafour Hama Saeed, Ahmed ; Othman, Zhinya ; Karim, Sima ; Gharib , Sava ; Ahmed, Roya
     • title: Awareness and Frequency of using Lifestyle Medications among University Students in Kurdistan Region-Iraq
     • date: 2023-06-20
     • words: 5648
     • flesch: 58
     • summary: Iraqi J Pharm Sci, Vol.32( 1 ) 2023 University students and life style medications 187 Inclusion and exclusion criteria The sampling scheme included undergraduate university students of both gender, age of 18 and above years, residing at the university campuses in the three cities; Sulaimani, Hawler, and Duhok Cities-Kurdistan Region-Iraq. Iraqi J Pharm Sci, Vol.32( 1 ) 2023 University students and life style medications DOI: https://doi.org/10.31351/vol32iss1pp185-193 185 Awareness and Frequency of using Lifestyle Medications among University Students in Kurdistan Region-Iraq ,*Othman Kawa Zhinya ,** Saeed Hama Ghafour Ahmed ,1,* Marouf Hassan Bushra ***Ahmed Jaza Mohammed Roya and *Gharib M Othman Sava ,*Karim Arkan Sima Iraq Sulaimani ,Sulaimani of University Pharmacy, of College ,Toxicology and Pharmacology of Department * Iraq Sulaimani ,Sulaimani of University Pharmacy, of College , Pharmacy Clinical of Department ** Iraq , Sulaimani, Sulaimani of University ,Medicine of College *** Abstract Life style medications (LSMs) are used for the improvement of lifestyle of an individual.
     • keywords: academic; adverse; advertisement; appetite; awareness; body; caffeinated; caffeine; changes; characteristics; cities; college; consumption; cosmetics; countries; dietary; different; drugs; duhok; effects; factors; female; figure; frequency; hair; hawler; health; high; impact; individual; information; intake; interaction; iraqi; knowledge; life; lifestyle; loss; lsms; majority; medical; medical university; medications; motives; non; number; participants; people; perception; performance; pharm; pharmaceutical; pharmacy; phenomenon; physical; present; prevalence; prevention; products; purpose; quality; questionnaire; responses; sci; skin; social; strategies; stress; students; studies; study; style medications; sulaimani; supplement; survey; table; united; universities; university; university students; usage; use; vol.32; weight; year; االدوية; الجامعات; الحياة; السليمانية; جامعة; طلبة; على; نمط; هذه
     • versions: original; plain text
194. bijps-1846
     • author: Ausama Ayob Jaccob; Fatima F. Dari; Muhsin S.G. AL-Moziel
     • title: The Impact of Citrus Bergamot Extract on Hemato- Biochemical, Inflammatory and Oxidative stress Parameters Induced by Acute Amikacin Toxicity in male Albino Rats
     • date: 2023-06-27
     • words: 4801
     • flesch: 57
     • summary: البرغموت ، االلتهاب ، التأكسدي اإلجهاد ، الكلوية السمية أميكاسين، : Changes in rat body weights with respect to days of the experiments.
     • keywords: activity; acute; administration; albino; amikacin; amikacin administration; amikacin toxicity; aminoglycosides; analysis; animals; anti; antioxidant; available; basrah; bergamia; bergamot; bergamot extract; biochemical; biomarkers; blood; body; cbe; cell; changes; cholesterol; citrus; citrus bergamot; college; control; creatinine; days; difference; diseases; dose; effect; et al; experimental; extract; figure; food; gentamicin; groups; health; hemato; hemoglobin; high; i.p; il-6; increase; induced; inflammatory; influence; intraperitoneal; intraperitoneal amikacin; iraqi; juice; kidney; levels; lipid; male; mda; nephrotoxicity; nutr; oil; oxidative; p<0.05; parameters; pharm; pharmacy; profile; protective; protective effect; rats; relative; renal; research; samples; sci; serum; significant; stress; study; test; tissue; university; urea; vldl; vol.31(2; weight; اإلجهاد; االميكاسين; البصرة; السمية; عشرة; على; لمدة
     • versions: original; plain text
195. bijps-1855
     • author: Al-Hasani, Lina; Ghaith A. Jasim; Ihsan S. Rabeea
     • title: Evaluation of Renoprotective Effect of Lipoic Acid and Bosentan Against Diclofenac-Induced Acute Renal Failure
     • date: 2023-07-15
     • words: 5882
     • flesch: 55
     • summary: Lipoic acid group, rats received lipoic acid 200mg/kg by preparing a stock solution of 600mg of α-lipoic acid in 10ml distilled water (each 1ml contains 60mg of α-lipoic acid as suspension) delivered orally by oral gavage for 11 days, on the 5th day they received an intraperitoneal injection of diclofenac sodium (100mg/kg). Lipoic acid group showed non- significant reduction in both serum urea and creatinine levels when compared to induction group.
     • keywords: 100mg; 5th; acid; acid group; acute; addition; aki; ala; alpha; analysis; animals; antagonist; anti; auc; biomarkers; bosentan; bosentan group; cells; coefficient; collagen; combination; combination group; control; control group; correlation; creatinine; curve; data; day; days; decrease; diagnosis; diclofenac; difference; distilled; drugs; effect; elevated; endothelial; endothelin-1; expression; factor; failure; fibronectin; figure; group; hand; induced; induction group; inflammatory; injection; injury; intraperitoneal; iraqi; journal; kidney; kidney injury; levels; linear; lipoic; lipoic acid; malondialdehyde; mda; mean; mean serum; non; oxidative; p>0.05; pearson; pharm; positive; present; rate; rats; receptor; relationship; renal; renoprotective; results; roc; ros; sci; sem; serum; serum creatinine; serum levels; serum urea; significant; sod1; sodium; stress; study; superoxide; table; tgfβ1; treatment; type; university; urea; vol.32(1; water; الكلوي; الكلى
     • versions: original; plain text
196. bijps-1856
     • author: Essa, Narmin; Aladul, Mohammed
     • title: Physicians’ Perception and Practice of Prescribing Vitamin B Combination versus Antiepileptic Drugs for Diabetic Neuropathy: Content Validity, Reliability and Pilot Study
     • date: 2023-06-20
     • words: 9622
     • flesch: 57
     • summary: Agree, neutral, disagree Item 5 Knowledge about vitamin B complex/B12 Vitamin B complex/ B12 supplementation can prevent the development of DN Agree, neutral, disagree Vitamin B complex/ B12 supplementation can treat DN Agree, neutral, disagree Vitamin B complex/ B12 supplements are safe for long term use in treatment of DN Agree, neutral, disagree Item 6 The knowledge and perception domain aimed to closely examine the basic knowledge and the general perception of the physicians about DN (including the commonality of DN, its effect on patient’s Iraqi J Pharm Sci, Vol.32(1) 2023 Vitamin B combination and diabetic neuropathy 205 quality of life, mortality rate and the difficulty of treatment in addition to the perception about dietary supplements and vitamin B).
     • keywords: adjuvant; agents; agree; alpha; american; analysis; anticonvulsants; articles; association; b12; blood; care; change; chronic; clarity; clinical; coefficient; combination; common; complex; consistency; content; control; cost; cronbach; current; cvi; development; diabetes; diabetic; diabetic neuropathy; dietary; dietary supplements; different; disease; dn medication; domain; draft; drug; effects; exercise; experts; factor; family; general; glucose; good; guidelines; half; health; important; indices; information; internal; international; iraqi; item; journal; knowledge; level; life; literature; local; long; management; medical; medication; medicine; mellitus; mortality; mosul; neuropathy; neutral; number; pain; participants; patients; perception; peripheral; pharm; pharmacological; phase; physicians; pilot; plan; practice; prescribing; primary; process; quality; questionnaire; questions; relevance; relevant; reliability; research; respondents; results; review; safety; sample; sci; snri; ssri+; strict; study; style; sugar; supplements; sure; survey; system; table; tca; term; total; treatment; university; use; validity; value; vitamin; vitamin b; vol.32(1; years; السكري
     • versions: original; plain text
197. bijps-1865
     • author: Bedoor A. Salim; Muhsin S.G. AL-Moziel; Jaccob, Ausama Ayob
     • title: Subchronic effect of different doses ofDiclofenac Sodium on female reproductive system in rats.
     • date: 2023-06-27
     • words: 6360
     • flesch: 55
     • summary: Gohel, M. C., et al. Alabi QK, Akomolafe RO, Olukiran OS, Adeyemi WJ, Nafiu AO, Adefisayo MA, et al.
     • keywords: acid; administration; analgesic; analysis; animals; anti; arrow; available; biochemical; blood; body; cell; changes; chronic; chronic effect; combination; comparison; complete; concentration; contrast; control; control group; count; days; decrease; diclofenac; diclofenac sodium; differences; different; doses; drugs; effect; enzymes; estradiol; estrogen; et al; female; figure; findings; follicles; frs; fsh; glutathione; graafian; groups; healthy; hematological; hemoglobin; high; histopathological; hormonal; hormone; impact; increase; inflammatory; inhibition; internet; investigation; iraqi; levels; low; mean±; mefenamic; meloxicam; n=24; non; normal; nsaids; oral; ovulation; oxidative; p<0.05; parameters; pge2; pharm; pharmacological; platelet; previous; primary; progesterone; prolactin; prostaglandins; rats; rbc; reduced; reduction; renal; reproductive; results; sci; sem; serum; significant; sodium; steroidal; stress; studies; study; sub; system; thick; toxicity; toxicol; treatment; use; values; vol.31(2; wbc; weight; white; women; work; ديكلوفيناك; على
     • versions: original; plain text
198. bijps-1866
     • author: Mariam.R. Alghara; Jaccob, Ausama Ayob; Azza.Sajid. Jabbar
     • title: Assessment of Certain Hematological Indices and Interlukin-6 in Workers and Individuals Who Live Near to Crude Oil Wells in Middle Petroleum
     • date: 2023-06-27
     • words: 4667
     • flesch: 59
     • summary: The aim of the study is to reveal the impact of crude oil exposure on several hematological parameters and IL-6 of oil workers and to detect which parameters are more affected by the exposure to be considered as prognosticators and to find the correlation between these parameters. The aim of the study is to reveal the impact of oil exposure on several hematological parameters and Interleukin-6 of oil workers and to detect which parameters are more affected as prognosticators for clinical disorders.
     • keywords: affected; air; anemia; assessment; benzene; blood; body; cell; certain; chemicals; coffee; concentration; control; corpuscular; count; crude; differences; disorders; effect; exposure; figure; fuel; glucose; group; group ii; health; hematological; hemoglobin; history; iii; il-6; increase; indices; individuals; inflammatory; interleukin; iraqi; levels; mchc; mcv; mean; metabolites; non; oil; p>0.05; parameters; participants; pdw; percentage; petroleum; pharm; plts; pollution; pressure; processes; production; products; pulse; random; rate; rbc; refinery; results; rise; risk; sci; serum; significant; study; system; table; test; values; variety; vol.32(1)2023; wbc; wells; workers; الدم; النفط
     • versions: original; plain text
199. bijps-1873
     • author: Kawa Dizaye; Adeeb Alchalabi , , Dereen ; Marouf, Bushra Hassan
     • title: Effects of flaxseed (Linum usitatissimum) on climacteric symptoms and clinical parameters in post-menopausal women: Flaxseed effects on menopause associated symptoms and biochemical parameters
     • date: 2023-06-27
     • words: 5594
     • flesch: 51
     • summary: Iraqi J Pharm Sci, Vol.32( 1 ) 2023 Flaxseed effects on menopause associated symptoms and biochemical parameters DOI: https://doi.org/10.31351/vol32iss1pp257-265 257 Effects of Flaxseed (Linum usitatissimum) on Postmenopausal Symptoms and its Clinical Parameters Kawa Dizaye*, Dereen Adeeb Alchalabi*and 1Corresponding author E-mail: bushra.marouf@univsul.edu.iq Received: 21/ 4/2022 Accepted: 30/7 /2022 Iraqi Journal of Pharmaceutical Science https://doi.org/10.31351/vol32iss1pp257-265 Iraqi J Pharm Sci, Vol.32( 1 ) 2023 Flaxseed effects on menopause associated symptoms and biochemical parameters 258
     • keywords: acid; administration; analysis; biochemical; blood; blood pressure; bmi; body; bone; cancer; cardiovascular; clinical; concentrations; consumption; daily; day; diastolic; dietary; disease; doi:10.1016; dryness; duration; effect; estrogen; fiber; figure; flaxseed; flaxseed effects; flushes; food; health; heart; hormone; hot; index; intake; intervention; iraqi; leptin; levels; lignans; linolenic; linum; linum usitatissimum; lipid; malondialdehyde; mass; mean±se; med; menopausal symptoms; menopausal women; menopause; n=23; night; non; nutr; oxidative; pain; parameters; participants; patients; pharm; post; postmenopausal; powder; pressure; progesterone; protein; reduction; satiety; sci; serum; significant; stress; studies; study; sweating; symptoms; systolic; therapy; total; treatment; usitatissimum; vaginal; value; vol.31(2; weeks; weight; women; الدم; الليبتن; اليأس; على; نسبة
     • versions: original; plain text
200. bijps-1879
     • author: Anjana G V
     • title: Synthesis and Atimicrobial Evaluation of Deuterated Analogues of Metronidazole
     • date: 2022-12-25
     • words: 4179
     • flesch: 46
     • summary: In an attempt to check whether the deuterated metronidazole possessed similar pharmacological activity as that of metronidazole, deuterated metronidazole was synthesised using deuterium oxide in the presence of benzoic acid under nitrogen atmosphere. Also, when compared with the non-deuterated compound, deuterated metronidazole exhibited better anaerobic antibacterial and anti-tubercular activity.
     • keywords: absorption; acid; activities; activity; anaerobic; analogues; antibacterial; antibacterial activity; antifungal; antimicrobial; antitubercular; better; bioactivity; biological; bond; characteristics; chemistry; chen; clinical; compound; d2o; design; deuterated; deuterated metronidazole; deuteration; deuterium; development; drug; evaluation; figure; fusobacterium; gingivalis; gram; group; hydrogen; increase; infections; inhibitor; intermedia; iraqi; isotope; journal; ligand; mass; medicinal; metabolism; metronidazole; mic; molecular; molecule; molinspiration; negative; non; nucleatum; organic; pharm; pharmaceutical; pharmacokinetics; physicochemical; porphyromonas; positive; prevotella; properties; pseudomonas; receptor; research; results; sci; score; stability; studies; substitution; synthesis; table; tuberculosis; values; vol.31(2
     • versions: original; plain text
201. bijps-1887
     • author: Mikhael, Ehab Mudher; Fadya Yaqoob Al-Hamadani; Ali Mohammed Hadi
     • title: Evaluating the Benefits of Using Mobile Application (diarrhea management step by step) in the Management of Diarrhea by Community Pharmacists
     • date: 2023-06-27
     • words: 6999
     • flesch: 63
     • summary: 2. Ibrahim IR, Al-Tukmagi HF, Wayyes A. Attitudes of Iraqi society towards the role of community pharmacists. Attitude of consumers towards community pharmacists and their interest in expanding community pharmacist services in Basra, Iraq: A pilot study.
     • keywords: ability; advice; agent; ailments; analysis; antimotility; applicability; application; application users; appropriate; assessment; average; baghdad; baseline; benefits; case; clinical; college; community; continuous; counseling; current; data; developed; diagnosis; diarrhea; difference; disagree; dispensed; drug; ease; educational; effects; end; errors; group; hand; improvement; information; iraqi; j pharm; knowledge; main; management; measure; medication; minor; mobile; mobile application; non; number; participants; participated; patient; pharmacists; pharmacological; pharmacy; points; practice; questioning; questions; role; sample; scenario; sci; scientific; score; second; significant; simulated; step; study; table; test; time; training; treatment; usage; users; value; variables; visit; vol.31(2; years; اإلسهال; ذلك
     • versions: original; plain text
202. bijps-1896
     • author: Salman, Omar; Maysoon Abdul Zahra Merdaw; Ahmed A. Almaliky
     • title: A Novel Single Nucleotide Polymorphism of Interleukin-10 Gene is Linked to Type 2 Diabetes Mellitus in Iraqi Patients with Toxoplasmosis(Conference Paper )#
     • date: 2023-02-16
     • words: 5153
     • flesch: 63
     • summary: Fifty-five and fifty-eight venous blood specimens were obtained from T2DM patients and age-matched non-diabetic persons, respectively. A higher percentage of T. gondii infection was found in T2DM patients (52.1%) compared to 31.5% of non-diabetic persons.
     • keywords: ---(1; -1082; -1091; ag+gg; age; allele; american; analysis; anti; association; baghdad; blood; carriers; college; complications; controls; current; cytokine; dec; development; diabetes; diabetes mellitus; diabetic; difference; disease; dm patients; dna; frequency; g allele; gene; genetic; genotype; genotyping; gondii; group; high; higher; il-10; il-6; il10; individuals; infection; inflammation; inflammatory; interaction; interleukin-10; iraqi; journal; levels; mellitus; mutant; non; novel; nucleotide; odd; patients; pcr; percent; persons; pharm; polymorphisms; position; present; primers; promoter; p≤0.01; ratio; region; research; results; risk; rs1800896; samples; sci; significant; single; snp; snps; software; specific; study; subjects; susceptibility; t2 dm; table; toxoplasma; toxoplasmosis; type; university; vol.31(suppl; الثاني; السكري; المصابين; النوع; بغداد; على; مرضى
     • versions: original; plain text
203. bijps-1899
     • author: Shah, Sherine Majeed; Thukaa Z. Abdul-Jalil
     • title: Qualitative and Quantitative Estimation or Chemical Constituents from Leaves and Roots of Iraqi Agave Attenuata by GC-MS and RP-HPLC(Conference Paper) #
     • date: 2023-02-16
     • words: 4480
     • flesch: 53
     • summary: Figure 1: Photo of Iraqi Agave attenuate This study was aimed to develop a suitable extraction and identification procedures which aids in getting the information about the main bioactive constituents in Iraqi Agave attenuata leaves and roots and qualitative estimation of these constituents in n-hexane fraction by GC/MS while qualitative and quantitative estimation of constituents in ethyl acetate, methanol, and steroidal saponins fractions were done by using RP-HPLC. 2022 GC/MS and RP-HPLC estimation of Iraqi agave attenuate 81 Reverse Phase-High-Performance Liquid Chromatography (RP-HPLC) examinations of different fractions RP-HPLC analysis of different extracts for Iraqi Agave attenuata leaves and roots were applied after extraction for further analysis to identify and quantify the major proposed active constituents.
     • keywords: acetate; acid; agave; agave attenuata; analysis; attenuata; attenuata leaves; bioactive; caffeic; chromatogram; compounds; concentration; coumaric; curve; different; ester; estimation; ethyl; ethyl acetate; extraction; extracts; fatty; figure; fraction; genus; hecogenin; hexane; higher; hplc; iraqi; iraqi agave; leaves; liquid; methanol; method; min; pharm; phase; phenolic; phytochemical; phytoconstituents; plant; ppm; qualitative; quercetin; results; roots; saponin; sarsasapogenin; sci; screening; solvent; species; standards; steroidal; steroidal saponin; study; table; tigogenin; time; vol.31(suppl; water; على
     • versions: original; plain text
204. bijps-1908
     • author: Humadi, Suhad; Hassan, Saif M. ; Ahjel , Salam W.
     • title: A Cross-Sectional Survey of Iraqi Herbalist Practicing in the Middle Euphrates Area with a Recognition of their Knowledge, Practice and Attitude(Conference Paper )#
     • date: 2023-02-18
     • words: 5795
     • flesch: 55
     • summary: % secondary aim is to provide the baseline data for researchers for further investigations regarding herbalist practice, thus generating a proper model for herbalist practice.
     • keywords: adverse; aim; alternative; area; bloom; categories; clients; complementary; complete; conditions; countries; cross; data; different; education; effects; experience; face; final; follow; health; herbalists; herbalists knowledge; herbs; high; identification; information; ingredients; international; iraqi; iraqi herbalists; journal; karbala; knowledge; level; medical; medicinal; medicine; method; middle; organization; p<0.05; package; patients; percentage; pharm; plants; points; policy; poor; population; practice; practitioners; products; proportion; provinces; public; pvalue; questionnaire; questions; reactions; remedies; results; safety; sci; sciences; scores; sectional; shops; significant; source; statistical; storage; studies; study; survey; system; table; total; traditional; translation; treatment; university; use; vol.31(suppl; world; years; الخبرة; الدراسة; العشابين; بالمئة; على; هذه; يقومون
     • versions: original; plain text
205. bijps-1911
     • author: Al-Tukmagi, Haydar; Al-Qazaz, Harith; Shanshal, Sadeel; Al-Kaisey, Muhanad
     • title: Self-Medication Towards Antibiotic Use Among Non- Medical University Staff (Conference Paper )#
     • date: 2023-02-16
     • words: 5029
     • flesch: 56
     • summary: Haque M, Rahman NAA, McKimm J, Kibria GM, Majumder MAA, Haque SZ, et al. Self- medication of antibiotics: investigating practice among university students at the Malaysian National Defence University. Ateshim Y, Bereket B, Major F, Emun Y, Woldai B, Pasha I, et al. Prevalence of self- medication with antibiotics and associated factors in the community of Asmara, Eritrea: a descriptive cross sectional survey.
     • keywords: adverse; antibiotic self; antibiotics; antimicrobial; bacterial; baghdad; college; community; condition; countries; course; cross; current; data; demographic; development; dose; drugs; effects; et al; experience; factors; figure; findings; health; important; infect; int; iraqi; j pharm; laws; leaflets; main; major; majority; medical; medication; mosul; non; participants; percentage; pharm; pharmacist; pharmacy; population; practice; prescription; prevalence; public; questions; reasons; reported; resistance; respondents; sci; sectional; self; selfmedication; simple; source; staff; students; studies; study; survey; symptoms; treatment; universities; university; usage; use; vol.31(suppl; world; التطبيب; الحيوية; الذاتي; المضادات; على
     • versions: original; plain text
206. bijps-1916
     • author: Satar_Al_Baaj, Azal; Abdul-Jalil1, Thukaa Z.
     • title: Phytochemical Screening of Petroleum Ether Fractions by GC/MS and Isolation of Lupeol from Two Different Parts of Iraqi Leucaena leucocephala. (Conference Paper )#
     • date: 2023-02-16
     • words: 4671
     • flesch: 33
     • summary: 2022 Phytochemical screening of two different parts of Iraqi Leucaena leucocephala 67 Table 4. GC-MS analysis of petroleum ether leaves extract of Leucaena leucocephala by hot extraction method. 2022 Phytochemical screening of two different parts of Iraqi Leucaena leucocephala 68 Table 5. GC-MS analysis of petroleum ether leaves extract of Leucaena leucocephala by cold extraction method.
     • keywords: acid; acid methyl; analysis; anti; baghdad; bioactive; chromatogram; chromatography; cold; cold extraction; compounds; concentration; conditions; different; different parts; ester; ethanolic; ether; ether fractions; extraction; extraction method; extracts; fatty; fatty acid; figure; fractionation; fractions; gas; hexadecanoic; high; hot; hot extraction; hptlc; https://pubchem.ncbi.nlm.nih.gov/#query=c17h34o2; https://pubchem.ncbi.nlm.nih.gov/#query=c17h34o2 https://pubchem.ncbi.nlm.nih.gov/#query=c17h34o2; https://www.ncbi.nlm.nih.gov/pcsubstance/?term=%22hexanedioic%20acid%2c%20bis(2-ethylhexyl)%20ester%22%5bcompletesynonym%5d%20and%207641%5bstandardizedcid%5d; identification; iraqi; iraqi j; iraqi leucaena; isolation; j pharm; layer; leaves; leucaena; leucaena leucocephala; leucocephala; liquid; lupeol; maceration; mass; medicinal; method; methyl; methyl ester; min; molecular; ms analysis; p.e; parts; performance; petroleum; petroleum ether; pharm; pharm sci; pharmacological; phplc; phytochemical; phytochemical screening; plant; references; result; sci; screening; spectrometry; standard; stems; table; temperature; time; vol.31(suppl; االستخالص; اللوبيول; طريقة
     • versions: original; plain text
207. bijps-1917
     • author: Jewely, Hind Mohammed; Thukaa Zuhair
     • title: Evaluation of Antileishmanial Activity of Osteospermum ecklonis Extract of Aerial Parts against Leishmania donovani: in vitro(Conference Paper) #
     • date: 2023-02-16
     • words: 4024
     • flesch: 54
     • summary: In vitro antileishmanial efficacy DOI: https://doi.org/10.31351/vol31issSuppl.pp45-53 45 Evaluation of Antileishmanial Activity of Osteospermum ecklonis Extract of Aerial Parts against Leishmania donovani: in vitro(Conference Paper) # Hind M. Jewelee*,1 and Thukaa Z.Abdul-Jalil * # 10th scientific conference sponsored by College of Pharmacy, University of Baghdad 2-3 June 2022 *Department of Pharmacognosy and Medicinal Plants, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract Lack of safe available non -resistant treatment for visceral leishmaniasis (Kala-azar) keeps limiting the complete cure of this disease, drugs that have toxic side effects or lack of effectiveness have led to disease relapse, all these factors have lightened the way to the search for alternative drugs from natural resources that have been shown to have antileishmanial activity through literature survey In the present study, the comparative in vitro anti-leishmania activity of various fractions of Osteospermum ecklonis aerial parts fractions have been evaluated. Extracts were prepared through maceration and Soxhlet apparatus using 85% methanol and fractionation was done by separating the active constituents according to the differences in their polarities using four solvents in different polarities )petroleum ether, chloroform, ethyl acetate, and finally n-butanol( ،Two of the resultant fractions( petroleum ether as well as n- butanol fractions ) were chosen to test the effective inhibition of Leishmania donovani, Results prove with no doubt that the petroleum ether fraction of the maceration aerial parts in a concentration of 2.5 mg/ml had better antileishmanial activity than other concentrations of tested samples and the result coincided with the anti- leishmaniasis activity of official treatment (pentostam®) ,This finding can be attributed to the terpene nature of the materials used to be existed in such fraction.
     • keywords: -ve; acetate; acid; activity; aerial; aerial parts; agents; analysis; anova; antileishmanial; antiparasitic; apparatus; baghdad; butanol; chloroform; concentrations; control; diagram; differences; different; dilutions; donovani; drugs; ecklonis; efficacy; ether; ether fraction; ethyl; evaluation; extraction; figure; fraction; hot; inhibition; iraqi; layer; leishmaniasis; maceration; materials; mean; med; methods; natural; non; osteospermum; osteospermum ecklonis; parts; pentostam; percentage; petroleum; pharm; plant; positive; products; qualitative; rate; results; review; sample; sci; significant; similar; sodium; solvent; soxhlet; stibogluconate; study; table; test; tested; tlc; treatment; visceral; vol.31(suppl; wells; yield; على; لليشمانيا
     • versions: original; plain text
208. bijps-1925
     • author: Abdulkhaleq, Nuha Mohammed; Ghareeb, Mowafaq M.
     • title: Combination of FDM 3D Printing and Compressed Tablet for Preparation of Baclofen as Gastro-Floating Drug Delivery System (Conference Paper )#
     • date: 2023-02-16
     • words: 4194
     • flesch: 57
     • summary: Anjali Devi N, Hadi MA, Rajitha P, Sharma JVC, Srinivasa Rao A. Formulation and evaluation of floating controlled release tablets of Imatinib mesylate using hydrophilic matrix system. Development of sustained release tablets containing solid dispersions of baclofen.
     • keywords: 3d printing; absorption; acid; baclofen; bioavailability; capsular; content; delivery; design; development; device; dissolution; dosage; drug; dsc; ethylcellulose; eudragit; evaluation; extrudate; extrusion; fdm; figure; filament; forms; formula; formulation; friability; gastro; gastrointestinal; hardness; hme; hot; iraqi; journal; k30; layer; matrix; melt; method; oral; peak; peg; peo; pharmaceutical; polymers; prepared; printing; profile; pvp; release; rs-100; sci; sciences; solid; stomach; study; sustained; system; tablets; technology; temperature; time; total; tract; vol.31(suppl; weight; window; الباكلوفين; الدواء; ثالثية; على
     • versions: original; plain text
209. bijps-1927
     • author: Al-Tamimi, Duaa; Al-Kinani, Khalid; Taher, Salam; Hussein, Ahmed
     • title: Effect of Food on the Pharmacokinetics of Fluoxetine in Healthy Male Adult Volunteers(Conference Paper )#
     • date: 2023-02-18
     • words: 6289
     • flesch: 55
     • summary: In the fed study, FX capsules were administered to the same volunteers who received the drug in the fasting study after a washout period of 90 days after ending the fasting study by applying the same clinical procedures mentioned above, except FX capsules, were administered to the volunteers directly after serving a fatty breakfast. Thus, food intake with FX capsules may influence the onset rather than the intensity of the effect of FX.
     • keywords: absorption; administration; adult; arabic; area; auc0; baghdad; bioequivalence; blood; capsules; clinical; cmax; college; concentration; conditions; current; curve; data; days; department; differences; dosage; dose; dosing; drug; effect; elimination; evaluation; fasting; fed; fed study; figure; fluoxetine; food; guidance; healthy; high; hours; hr-1; hrs; human; ibraheem; intake; interindividual; interval; investigator; iraqi; jaafar; jaber; kel; mahroos; male; mean; method; monitoring; mrt; ng.hr/ml; oral; parameters; patients; pharmacokinetics; plasma; profiles; protocol; rate; research; samples; sci; standard; studies; study; subjects; t0.5; t1/2; tablet; tamimi; terminal; tests; therapeutic; time; tmax; total; values; vol.31(suppl; volume; volunteer; الدواء; الدوائية; الصيام; بعد; بغداد; دراسة; ساعة; على
     • versions: original; plain text
210. bijps-1932
     • author: Atia, Ahmed; Nouran Gzllal; Malak Gharibe
     • title: Evaluation of Drug Prescription Pattern Using WHO Prescribing Indicators in Libya: A Cross-Sectional Study
     • date: 2023-06-27
     • words: 4744
     • flesch: 57
     • summary: Nonetheless, the prescription model is used in all three districts of Libya, and the pattern of drug prescription is likely to be consistent throughout the country. Atia A. Physician trends of drug prescription in Libya: A pharmacoepidemiological study.
     • keywords: antibiotics; antimicrobial; average; broad; care; current; districts; doi; drug; drug prescription; east; essential; evaluation; facilities; form; generic; health; healthcare; higher; hospital; index; indicators; injectable; injections; iraqi; irdp; level; libya; list; lower; medical; medicines; narrow; number; optimal; organization; overall; patients; pattern; percentage; pharm; physicians; prescribed; prescribing; prescription; primary; rate; rational; reported; result; saudi; sci; similar; south; studies; study; system; table; total; use; utilization; value; vol.32(1; west; world
     • versions: original; plain text
211. bijps-1991
     • author: Alabdali, Hala; Algaem, Manal
     • title: Study anti-inflammatory effect of Tamsulosin in rat by evaluation IL-4, IL-6 and TNF-α: airway model.
     • date: 2023-06-27
     • words: 4634
     • flesch: 51
     • summary: There was a significant reduction (P-value<0.05) of IL- 4 and TNF-α in serum for tamsulosin treated group (D) and group (E) when compared with the positive control group (B) but only group (D) (35mcg/kg/d) tamsulosin showed significant reduction (P-value<0.05) in IL-6 level when compared with the positive control group (B). Group B: negative control group, rats were exposed to airway sensitization only.
     • keywords: airway; airway sensitization; anti; asthma; cells; comparison; control; control group; corticosteroids; current; cytokines; days; difference; disease; distilled; dose; drug; effect; et al; figure; frontiers; group; group d; il-4; il-6; il4; immunology; induced; inflammation; inflammatory; injury; iraqi; journal; level; mcg; model; negative; negative control; normal; normal control; ovalbumin; pharm; positive; prednisolone; previous; rats; reduction; research; respiratory; result; role; sci; sensitization; serum; significant; study; table; tamsulosin; tnf; treatment; value<0.05; vol.32(1; water; ااترلوكيع; الهواا; للى; مجرى
     • versions: original; plain text
212. bijps-1999
     • author: Murtadha Saleh Hussien; Ayad A. Al-Hamashi
     • title: Phytosterol Profile in Iraqi Lactuca serriola after Purification and Isolation by Combiflash and HPLC (Conference Paper )#
     • date: 2023-02-16
     • words: 3368
     • flesch: 58
     • summary: 1- Liebermann-Burchard test: A small amount of plant hexane extract was dissolved in 5 ml of chloroform, and the chloroform layer was then dried over anhydrous sodium sulfate. Early civilizations in China, India, and the Near East used medicinal plants as a source of sickness relief (2,3).
     • keywords: acetate; aerial; analysis; area; asteraceae; baghdad; calibration; chemical; chloroform; chromatography; college; column; combiflash; components; compounds; concentration; curve; effects; ethyl; extract; family; figure; fraction; health; hexane; high; hplc; human; iraqi; isolated; isolation; journal; lactuca; layer; lettuce; liquid; materials; medicinal; method; peak; pharm; phase; phytochemical; phytosterol; plant; reaction; research; sample; sci; serriola; silica; sitosterol; solvent; standard; sterols; stigmasterol; system; table; tlc; u.v; value; vol.31(suppl; world; األداء; السائلة; بغداد; عالية
     • versions: original; plain text
213. bijps-2000
     • author: Alabdly, Ammar; J. Kassab, Hanan
     • title: Formulation Variables Effect on Gelation Temperature of Nefopam Hydrochloride intranasal in Situ Gel (Conference Paper) #
     • date: 2023-02-16
     • words: 6362
     • flesch: 62
     • summary: 2022 Nefopam HCl intranasal in situ gel 34 Preparation of NF HCl intranasal in situ gel The cold approach was applied to formulate different compositions of mucoadhesive thermosensitive in situ gel as detailed in Table 1. pH of NF HCl intranasal in situ gel
     • keywords: absorption; appearance; available; brain; calibration; capacity; car934; cellulose; cloudy; cm-1; compatibility; concentration; curves; delivery; different; drug; dsc; evaluation; excipients; figure; fluid; force; formula; formulation; ftir; gel; gelation; gelation temperature; gelling; glass; group; h.a; hcl; hcl intranasal; hpmc; https://; hydrochloride; intranasal; iraqi; j pharm; m.c; mean±sd; method; mixture; mucoadhesive; mucosa; n.f; nefopam; nefopam hcl; nf hcl; non; nose; osmolarity; p.a; p.i; peaks; pharm; pharm sci; pharmaceutical; polox; poloxamer; polymers; ppt; range; reference; results; sci; situ; situ gel; solubility; solution; spectrabase; spectrum; standard; strength; stretching; studies; study; system; table; temperature; thermosensitive; time; triplicate; tube; vol.31(suppl; water; weight
     • versions: original; plain text
214. bijps-2004
     • author: Radeef, Mohanad Yasir; Khalid Saud Saleh
     • title: Drug Information Resources in Iraqi Community Pharmacies (Conference Paper) #
     • date: 2023-02-16
     • words: 4200
     • flesch: 60
     • summary: Chauhan N, Moin S, Pandey A, Mittal A, Bajaj U. Indian aspects of drug information resources and impact of drug information center on community. Qadus S, Naser AY, Al-Rousan R, Daghash A. Utilization of drug information resources among community pharmacists in Jordan: A cross-sectional study.
     • keywords: access; addition; adverse; appropriate; area; available; bachelor; baghdad; bnf; care; clinical; college; common; community; current; data; different; drug; drug information; figure; google; health; information; information resources; internet; iraqi; lactation; literature; medications; medicines; medscape; online; participants; patients; percentage; pharmaceutical; pharmacists; pharmacy; pregnancy; primary; quality; questions; research; resources; results; review; safety; sci; search; specific; study; survey; tertiary; textbooks; tikrit; time; type; university; use; utilization; vol.31(suppl; websites; work; years; الصيادلة; العراق; المعلومات; تكريت; على; قبل; هذه
     • versions: original; plain text
215. bijps-2009
     • author: Tawfeeq, Amani Amer; Shatha H Ali
     • title: Isolation and Structural Characterization of Quercetin 3-O-Rhamnoside and Essential oil Estimation from Leaves of Iraqi Cupressus sempervirens L (Conference Paper )#
     • date: 2023-02-16
     • words: 5256
     • flesch: 55
     • summary: In this work, the extraction yield of the EO from the leaves of Iraqi Cupressus sempervirens L. was 0.9%. Cupressus sempervirens have been ethnobotanicals as an antiseptic, relief of cough, astringent, antispasmodic, wound healing, and anti-inflammatory.
     • keywords: activities; activity; addition; analysis; analytical; antimicrobial; antioxidant; baghdad; butanol; characterization; chemical; chromatography; college; color; components; composition; compound; concentration; conditions; cones; conifers; cupressaceae; cupressus; cupressus sempervirens; cypress; data; department; detection; different; effect; essential; essential oil; evergreen; extraction; figure; flavonoids; fraction; gas; hplc; identification; important; ionization; iraqi; isolated; isolated compound; isolation; leaves; liquid; mass; medicinal; methanol; method; min; mode; oil; peak; pharm; pharmacy; phenolic; phytochemical; pinene; plants; potential; purity; quercetin-3; quercitrin; range; rate; reagent; relief; results; review; rhamnoside; sci; science; screening; sempervirens; separation; sharma; source; species; spectra; standard; structural; sugar; system; target; test; tlc; unit; university; vol.31(2; vol.31(suppl; work; yield; الزيت; السرو; العطري; بغداد; نبات
     • versions: original; plain text
216. bijps-2017
     • author: Ong, Siew Chin; Mikhael, Ehab Mudher
     • title: Knowledge, Attitudes, Practices, and Online Distance Learning Experience of Malaysian University Students towards COVID-19: A Cross Sectional Study(Conference Paper )#
     • date: 2023-02-16
     • words: 5566
     • flesch: 65
     • summary: The higher knowledge about COVID-19 among Indian students than students from other ethnic groups (20) may be the main reason for such better adherence to COVID-19 preventive practices (21). In conclusion, the knowledge and practice toward COVID-19 was good in less than half of Malaysian university students.
     • keywords: attitudes; challenges; control; covid-19; covid19; cross; crowded; current; data; demographic; distance; education; effect; ethnicity; face; field; general; good; half; hand; health; higher; infected; infection; information; iraqi; knowledge; learning; level; limited; main; malaysian; masks; mco; mean; measures; media; movement; n(%; need; neutral; new; online; online learning; order; outbreak; overall; pandemic; participants; people; period; pharm; pharmacy; places; poor; positive; practice; present; problems; public; questionnaire; result; sample; sci; score; sectional; size; social; spread; students; study; studying; suppl; table; technical; university; university students; virus; vol.31; اإلنترنت; التعلم; الطالب; تجاه; عبر; على; كوفيد
     • versions: original; plain text
217. bijps-2018
     • author: Al-Metwali, Basma Zuheir; Hatem Nsaif, Farah
     • title: Knowledge, Perception, and Reporting Practices of Healthcare Providers about Adverse Events Following the COVID-19 Vaccination in Iraq(Conference Paper )#
     • date: 2023-02-18
     • words: 5852
     • flesch: 59
     • summary: Questions Frequency(N) Percentage AEFIs causes: (Multiple answers possible): Vaccine-product related reaction 86 74 Vaccine-quality defect-related reaction 26 22 Immunization error-related reaction 29 25 Immunization anxiety-related reaction 22 19 Coincidental reaction 26 22 Methods of COVID-19 vaccine AEFI reporting: Filling of AEFI form 85 73 Reporting via social media group 15 13 Email/online 10 9 Talking to colleague 7 6 AEFI can be caused by reconstituted vaccines stored longer than normal, vaccine reaction, inappropriate route of administration, vaccines stored beyond the expiry date, or contaminated vaccines. Reporting practice of AEFI of COVID-19 vaccine by study participants Association of Socio-Demographic Characteristics and AEFI Knowledge, Perception and Practice Respondents’ profession was found to significantly affect knowledge on AEFI (Table 5).
     • keywords: addition; adverse; adverse events; aefis; age; association; baghdad; centers; characteristics; covid-19; covid-19 vaccination; covid-19 vaccine; data; date; demographic; events; fair; figure; form; good; group; hcps; health; healthcare; higher; hospital; immunization; inadequate; investigation; iraqi; knowledge; level; low; majority; new; online; paper; participants; percentage; perception; pharmacists; pharmacovigilance; physicians; poor; positive; practice; primary; profession; providers; questionnaire; questions; reaction; reporting; reporting practice; respondents; responses; safety; sci; score; study; surveillance; table; vaccination; vaccine; value; variables; vol.31(suppl; work; years; yes; التطعيم; الجانبية; الرعاية; الصحية; بعد; كان; معرفة
     • versions: original; plain text
218. bijps-2023
     • author: Al-Metwali, Basma Zuheir; Majid Shaukat, Juan
     • title: Knowledge, Attitude, and Practices of Iraqi Community Pharmacists Toward Emergency Contraceptives (Conference Paper )#
     • date: 2023-02-16
     • words: 6280
     • flesch: 62
     • summary: % 61.8( سنة, 29-24في الفئة العمرية ) % 67.9صيدلي مجتمع, 212 منهم لديهم مواقف جيدة جدا.
     • keywords: abortion; action; addition; adolescents; age; association; attitude; baghdad; characteristics; community; community pharmacists; contraception; contraceptives; counseling; current; degree; dispensing; ecs; effects; emergency; ethiopia; experience; figure; good; half; health; hospital; information; intercourse; iraqi; iud; knowledge; level; levonorgestrel; location; majority; mechanism; med; method; nepal; participants; pharmacists; pharmacy; pills; poor; positive; practice; pregnancy; primary; questionnaire; questions; relationship; responses; results; sci; score; sexual; significant; sociodemographic; study; table; time; ulipristal; unintended; unprotected; use; variables; vol.31(suppl; women; years; الحمل; منع; وسائل
     • versions: original; plain text
219. bijps-2030
     • author: Shniakat, Wafa Naji; Ekbal H. Al-Khateeb, Ekbal H. ; Numan, Nawfal A.M.; Manal M. Abbas; Shakya, Ashok
     • title: Cytotoxic Evaluation of Doxorubicin Combination with Baicalein and Resveratrol Against Hct116 and Hepg2 Cancer Cell Lines (Conference Paper) #
     • date: 2023-02-16
     • words: 4362
     • flesch: 54
     • summary: HCT116 (colorectal cancer cells) and HepG2 (hepatocellular cancer cells). 2022 Doxorubicin combination with baicalein and resveratrol 97 Discussion Natural products baicalein (BA) and resveratrol (RSV) combinations along with doxorubicin (DOX) at constant ratio (1:1:1) produced significant increase in DOX toxicity compared to treatment with DOX alone in both types of cancer cell line.
     • keywords: 1:1:1; activity; agents; amman; analysis; anticancer; antioxidant; apoptosis; baicalein; best; cancer; cardiotoxicity; cells; chemistry; chemotherapeutic; combination; compounds; concentration; constant; cytotoxic; cytotoxicity; decrease; different; dose; dox; doxorubicin; doxorubicin combination; drugs; effect; enhancement; fixed; h9c2; hct116; hepg2; ic50; index; iraqi; levels; lines; lower; mechanisms; medicine; medium; molecular; mtt; natural; non; pharm; pharmacy; polyphenolic; profile; protection; range; ratio; research; response; results; resveratrol; rsv; sci; sciences; significant; studies; study; table; therapy; toxicity; treatment; types; university; use; vol.31(suppl; wang; الخاليا; باستخدام; بين; على
     • versions: original; plain text
220. bijps-2031
     • author: Adnan, Manar; RoaaA.Nief; Shaimaa Nazar Abd-Al Hameed; Haneen Abdulhadi Kharaba
     • title: Preparation and In-Vitro Evaluation of Floating Oral In- Situ Gel of Montelukast Sodium (Conference Paper) #
     • date: 2023-02-18
     • words: 4016
     • flesch: 62
     • summary: Preparation of in situ gel In situ gel formulations were made using the ingredients listed in Table (1). Table 1.Floating in situ gel formulations of montelukast sodium Formulation code Montelukast sodium (mg) Gellan gum (%w/v) Sodium alginate (%w/v) Pectin (%w/v) CaCO3(%w/v) Sodium citrate (%w/v) F1 4.2 0.25 0.75 0.17 F2 4.2 0.5 0.75 0.17 F3 4.2 1.0 0.75 0.17 F4 4.2 0.25 0.75 0.17 F5 4.2 0.5 0.75 0.17 F6 4.2 1.0 0.75 0.17 F7 4.2 0.25 0.75 0.17 F8 4.2 0.5 0.75 0.17 F9 4.2 1.0 0.75 0.17 F10 4.2 1.0 1.5 0.17 *
     • keywords: + +; 0.1n; 2020; administration; alginate; bioavailability; caco3; calcium; carbonate; concentration; delivery; development; dissolution; dose; drug; duration; evaluation; figure; formulation; gastric; gel; gelation; gellan; gelling; gels; gum; hcl; int; iraqi; lag; liquid; measurement; medication; montelukast; natural; oral; pectin; pharm; phase; polymer; polymeric; release; res; review; sci; sensitive; situ; situ gel; sodium; solution; stomach; study; surface; sustained; system; table; test; time; viscosity; vitro; vol.31(suppl; water
     • versions: original; plain text
221. bijps-2032
     • author: Al-Jumaili, Ali Azeez; Sameer, Hayder Naji
     • title: The Insights of Experienced Pharmacists Regarding the Iraqi health Insurance Program: A Qualitative Study(Conference Paper )#
     • date: 2023-02-16
     • words: 6521
     • flesch: 52
     • summary: Health insurance is defined as an insurance system which covers medical expenses by a third party (7). Health insurance is a good thing because when the patient visits hospitals or the private sector, the fees paid are low because the services are subsidized(Ph-14).
     • keywords: authority; available; baghdad; bills; bsc; challenges; clinical; coverage; department; dhi; diseases; doctor; electronic; electronic health; electronic system; expected; face; family; financial; hcps; health; health department; health insurance; healthcare; help; hospital; impact; implementation; important; income; increase; insights; insurance; insurance program; insured; international; interviews; iraqi; iraqi health; iraqi j; law; level; low; male; management; master; medical; medicines; monthly; national; national health; necessary; new; number; participants; patients; payment; people; pharmacists; pharmacy; population; potential; practitioner; private; private sector; problems; program; providers; public; qar; qualitative; quality; sci; sector; services; settings; statistics; study; system; team; tested; themes; time; vol.31(suppl; workload; الصحي; على
     • versions: original; plain text
222. bijps-2033
     • author: Fadhil, Hasan Raid ; Al-Jumaili, Ali Azeez; Al-Ani, Nizar Abdulateef
     • title: Cost-effectiveness Analysis of Reference Infliximab (Remicade) Compared to its Biosimilar (Remsima) in Iraqi Patients with Rheumatoid Arthritis (Conference Paper )#
     • date: 2023-02-16
     • words: 6818
     • flesch: 59
     • summary: Jørgensen TS, Turesson C, Kapetanovic M, Englund M, Turkiewicz A, Christensen R, et al. EQ-5D utility, response and drug survival in rheumatoid arthritis patients on biologic monotherapy: A prospective observational study of patients registered in the south Swedish SSATG registry. Thus, the inclusion criteria were RA patients who received infliximab for at least 14 weeks and had a medical record with infliximab follow-up data.
     • keywords: activities; activity; adverse; analysis; anxiety; arthritis; available; baghdad; baseline; biological; biosimilar; bmi; care; cdai; clinical; college; comparable; cost; data; depression; difference; dimensions; discomfort; disease; drugs; effectiveness; eq-5d-5l; fatigue; groups; headache; health; higher; hospital; icer; improvement; incidence; incremental; index; infection; inflammatory; infliximab; internet; iraqi; kimadia; level; life; limitation; majority; mean; measures; medical; medicines; methotrexate; mobility; moderate; nausea; pain; patients; pharm; post; price; qaly; qol; quality; reactions; reference; regimen; remicade; remsima; rheumatoid; rheumatoid arthritis; rheumatology; sample; sci; score; self; severe; significant; std; study; suppl; table; test; therapy; time; total; tract; treatment; type; use; usual; utility; value; vol.31; weeks; willingness; years; االنفلكسيماب; التهاب; الحيوي; المفاصل; بغداد; كان
     • versions: original; plain text
223. bijps-2034
     • author: Alfetlawi, Bashar; Jasim, Ali
     • title: Determining the Prevalence of Upper and Lower Urinary Tract Infections’ Pathogens and Their Antibiotic Susceptibility Profile for Adult Patients in Al-Diwaniya, Iraq (Conference Paper) #
     • date: 2023-02-16
     • words: 3998
     • flesch: 58
     • summary: Multiple drugs resistance among urinary tract infection patients in Duhok City – Kurdistan Region –Iraq. الممرض البولي، الحساسية للمضادات Introduction One of the most prevalent bacterial infections is urinary tract infection (UTI) (1).
     • keywords: adult; age; amikacin; ampicillin; antibiotic; antimicrobial; bacteria; baghdad; cefepime; ceftazidime; ceftriaxone; city; coli; common; community; data; different; dis; diwaniya; duhok; e. coli; effective; escherichia; gram; health; high; hospital; imipenem; infections; iraq; isolates; klebsiella; lower; med; meropenem; multidrug; negative; nitrofurantoin; number; patients; pattern; pharm; pharmacy; positive; predominant; prevalence; profile; rate; records; resistance; results; sci; sensitive; sensitivity; spp; staphylococcus; studies; study; susceptibility; susceptible; table; teaching; tract; tract infections; upper; urinary; urinary tract; uropathogens; uti; utis; vancomycin; vol.31(suppl; women; years; البكتيرية; البولية; العراق; المجاري; عدوى; على; كانت; لمضاد; هذه
     • versions: original; plain text
224. bijps-343
     • author: N. Hamad, Maha
     • title: Detection and isolation of flavonoids from Calendula officinalis (F.Asteraceae) cultivated in Iraq
     • date: 2017-03-26
     • words: 2317
     • flesch: 54
     • summary: Iraqi J Pharm Sci, Vol.25(2) 2016 Flavonoids of Calendula officinalis 1 Detection and isolation of flavonoids from Calendula officinalis (F.Asteraceae) cultivated in Iraq Maha N. Hamad *,1 * Department of Pharmacognosy and Medicinal Plants , College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract Calendula officinalis L. (Asteraceae) known as marigold is known to have several pharmacological activities and used for the treatment of several diseases as measles, jaundice, constipation and several inflammations. Iraqi J Pharm Sci, Vol.25(2) 2016 Flavonoids of Calendula officinalis 3 Table (I):- Rf values of standard quercetin and kaempferol compared with isolated aglycons I&II in different mobile phases.
     • keywords: acetate; acid; activity; aglycones; baghdad; butanol; butanol fraction; calendula; calendula officinalis; column; constituents; essential; ethyl; figure; flavonoids; flowers; fraction; gel; glycosides; hplc; hydrolyzed; iraqi; isolated; kaempferol; marigold; methanol; mobile; officinalis; oil; pharm; phases; preparative; presence; quercetin; rutin; sci; silica; standard; tlc; value; vol.25(2; water; انفالفٌَٕٕذاث
     • versions: original; plain text
225. bijps-344
     • author: Hadi, Hind; Mouayed, Marwa
     • title: Spectrophotometric Determination of Nitrofurantoin Drug in its Pharmaceutical Formulations Using MBTH as a Coupling Reagent
     • date: 2017-03-26
     • words: 4075
     • flesch: 48
     • summary: Figure (10):-Absorbance versus time graphs Figure (11):- Log (rate) versus log [NIT] graphs The rate of reaction was also found to be dependent on NIT concentrations. Hence k' = 3122.4 min -1 = 52 sec -1 and the reaction is first order (n = 1.2944)with respect to NIT concentration.
     • keywords: absorbance; accuracy; acs; ammonium; analysis; analytical; blank; calculated; calibration; ceric; concentration; constant; coupling; curve; determination; deviation; different; distilled; dosage; drug; effect; equation; figure; forms; high; iraqi; log; maximum; mbth; method; mole; nit; nitrofurantoin; order; oxidant; pharmaceutical; precision; preparations; prepared; presence; product; range; rate; reaction; reagent; regression; relative; results; rsd; sci; sensitivity; solution; spectrophotometric; standard; table; temperature; time; vol.25(2; volume; water
     • versions: original; plain text
226. bijps-345
     • author: A. Hayder, Asma; S. Altaei, Tagreed
     • title: Impact of Different Doses of Nicorandil-Induced Ulceration (Oral , Gastrointestinal Tract, and Anal) in Rats: Roles of Leptin and Prostaglandin E2
     • date: 2017-03-26
     • words: 7493
     • flesch: 64
     • summary: The administration of different doses of nicorandil produced a highly significant reduction in plasma leptin concentration; in G2 from 110.81±31.58 to 62.91±46.88, in G3 from 153.86±33.27 to 48.09±16.17, and in G4 from 149.41±58.46 to 56.09±44.43, while in G1 there was a decreased level of plasma leptin from 118.13± 31.58 to 62.91±46.88, but a non-significant difference (P= 0.07). There was a weak, non-significant positive correlation between weights and plasma leptin concentrations after treatment; r = 0.272, P=0.08.
     • keywords: 400x; acid; administration; adverse; albino; albino rats; anal; analysis; animals; aspirin; associated; baseline; blood; body; cause; cell; clin; college; concentration; control; correlation; damage; day; day nicorandil; days; dermatol; different; dose; effects; erosion; factors; females; figure; formation; gastric; gastrointestinal; gender; granulation; groups; h&e; hawler; healing; heavy; higher; histopathological; increase; induced; infiltration; inflammatory; intestine; iraqi; lamina; leptin; levels; local; mean; medical; microscopic; minutes; mononuclear; mucosa; mucous; negative; nicorandil; nicorandil effects; non; nonsignificant; normal; oral; pg e2; pge2; pharm; plasma; plasma leptin; positive; proporia; prostaglandin; rats; receptors; reduction; repair; role; saline; samples; sci; section; serum; sexes; significant; sloughing; small; solution; standard; study; surface; table; tested; tissues; treatment; ulceration; ulcers; university; value; vascular; vol.25(2; weak; weight; wound; استحداث; القرحة; اللبتين; عقار; على; نيكورانديل
     • versions: original; plain text
227. bijps-350
     • author: A. Ahmed, Zheen
     • title: Relationship between Renal Function Tests and the Levels of MDA, Zinc, and Cadmium among Painters in Sulaimani
     • date: 2017-03-26
     • words: 2622
     • flesch: 57
     • summary: Environmental cadmium exposure occurs mostly in subjects living in proximity to potential industrial pollution (19) and also in heavy smokers (19) , since tobacco smoke has a high cadmium contents (21) . The effects of environmental cadmium exposure on kidney function: the possible influence of age.
     • keywords: age; cadmium; changes; city; control; creatinine; difference; environmental; estimation; exposure; factors; figure; function; group; heavy; iraqi; kidney; levels; low; mda; med; metals; non; number; occupational; oxidative; painters; pharm; potential; present; relationship; renal; renal function; reported; results; sci; serum; significant; stress; study; subjects; sulaimani; sulaimani city; tests; trace; urea; vol.25(2; workers; years; zinc; الؼاهليي
     • versions: original; plain text
228. bijps-352
     • author: T. Numan, Intesar; N. Hamad, Maha; A. Fadhil, Ammar; M. Najim, Safa
     • title: The Possible Cardio-Protective Effects of Ethanolic Artichoke Extract against 5- Fluorouracil Induced Cardiac Toxicity in Rats
     • date: 2017-03-26
     • words: 3599
     • flesch: 56
     • summary: Cardiac toxicity includes a wide range of cardiac effects from small changes in blood pressure and arrhythmias to cardiomyopathy. Moreover, the influence of the cytotoxic agents on certain phospholipids, especially cardiolipin, may also explain the development of cardiac toxicity (2) .
     • keywords: /day; albino; alt; aminotransferase; animals; antioxidant; artichoke; artichoke extract; assay; association; ast; baghdad; cancer; cardiac; cardiac toxicity; cardio; cell; college; control; creatine; cynara; cytotoxic; daily; days; dimethyl; dmso; dose; drugs; effects; et al; ethanolic; ethanolic artichoke; extract; fluorouracil; group; iraqi; kinase; levels; mean; medicinal; oral; oxidative; p<0.05; pharm; plant; protective; rats; respect; sci; scolymus; serum; significant; standard; stress; study; successive; sulfoxide; therapy; toxicity; treatment; university; vol.25(1; االسض; االٌثإَل; انشٕكً; انًدًٕعت; فهٕسٌٕٔساسٍم; نًذة; يخخانٍت; يسخخهص
     • versions: original; plain text
229. bijps-353
     • author: F. Mustafa, Yasser; A. Al-Omari, Nohad
     • title: Design, Synthesis and Kinetic Study of Coumarin-Based Mutual Prodrug of 5-Fluorouracil and Dichloroacetic acid
     • date: 2017-03-26
     • words: 4810
     • flesch: 66
     • summary: Anticancer drugs that target metabolism: Iraqi J Pharm Sci, Vol.25(1) 2016 Coumarin- based mutual prodrug of 5-fluorouracil 16 Is dichloroacetate a new paradigm? To tackle these problems, many approaches have been developed and evaluated; the most important one is the use of prodrug strategy to yield 5-FU prodrugs that can avoid certain routes of degradation
     • keywords: acid; addition; agent; bath; buffer; cancer; cells; chemical; chloride; compound; concentration; coumarin; crystals; dca; dichloroacetate; dmso; dry; effect; ether; ethyl; figure; fluorouracil; hcl; human; hydrolysis; iraqi; kinetic; layer; lialh4; metabolism; min; mixture; mmol; molecular; mutual; mutual prodrug; na2so4; nmr; oral; pharm; phosphate; ppm; prodrug; product; reaction; release; residue; sci; serum; solution; spectra; spectrophotometer; spectrum; stability; structure; study; system; table; thf; time; vol.25(1; wang; water; white; λmax
     • versions: original; plain text
230. bijps-355
     • author: R. Mahmood, Abdulrahman
     • title: Estimation of Oxidative Stress and Some Trace Elements in Iraqi Men Patients with Type 2 Diabetes Mellitus
     • date: 2017-03-26
     • words: 3639
     • flesch: 62
     • summary: Previous experimental and clinical studies report that oxidative stress plays a major role in the pathogenesis and development of (T2DM). However, the exact mechanism of oxidative stress could contribute to and accelerate the development of (T2DM).
     • keywords: antioxidant; baghdad; blood; capacity; clinical; concentration; control; determination; diabetes; diabetes mellitus; diabetic; diagnosis; elements; free; glucose; glycated; group; hba1c; healthy; increase; insulin; int; iraqi; iron; levels; lipid; mda; mean; mellitus; metabolism; non; oxidative; oxidative stress; oxygen; p<0.001; patients; peroxidation; pharm; present; radicals; reactive; results; role; ros; sci; serum; significant; species; stress; study; subjects; table; tac; total; trace; type; urine; vol.25(1; zinc; اٌثأٟ; اٌذَ; إٌٛع; ِسرٜٛ; ِشع; ِظً
     • versions: original; plain text
231. bijps-356
     • author: S. Nassir, Eman
     • title: Detection of Serum Ferritin in Women with Breast Cancer
     • date: 2017-03-26
     • words: 3330
     • flesch: 64
     • summary: In the current study as we observed in table (2) the levels of ferritin were found to be significantly raised in breast cancer patients (in both groups B and C) as compared to control (group A). Iraqi J Pharm Sci, Vol.25(1) 2016 Serum ferritin in women with breast cancer 23 Detection of Serum Ferritin in Women with Breast Cancer Eman S. Nassir *, 1 * Department of Clinical Laboratory Science, College of Pharmacy, University of Baghdad ,Baghdad, Iraq.
     • keywords: addition; advanced; blood; body; breast; breast cancer; cancer; cause; cells; clinical; control; difference; disease; early; eastern; family; females; ferritin; group; group b; healthy; hepatic; history; incidence; iraqi; iron; levels; liver; markers; mass; mean; mediterranean; organization; overweight; p<0.05; patients; pharm; positive; protein; rates; region; res; sample; sci; serum; serum ferritin; significant; stage; storage; study; subjects; synthesis; table; tumor; vol.25(1; women; world; انثذ٘; انذو; انًشاحم; انُساء; يسخٕٖ; يشاحم; ْزِ
     • versions: original; plain text
232. bijps-357
     • author: A.Omer, Noor; A.Taher, Muhammad; Dh Skheel Aljebory, Henan
     • title: Effect of Metformin Treatment on some Blood Biomarkers in Women with Endometriosis.
     • date: 2017-03-26
     • words: 4600
     • flesch: 47
     • summary: Thus, metformin may be effective in treatment endometriosis through suppression both ovarian and local production of estrogen (36) . Moravek et al (2009) ,provided a preliminary data about the effectiveness of rosiglitazone, an insulin sensitizer, in treating endometriosis -related pain in six patients and concluded that it was effective and promising for usage in endometriosis patients desiring the chance to conceive (31) .
     • keywords: activation; adhesions; alpha; american; baghdad; blood; care; cells; clinical; common; contraceptive; control; cytokines; daily; danazol; data; drugs; dysmenorrhea; effect; endometrial; endometriosis; estradiol; expression; factor; female; goserelin; groups; growth; health; human; il-8; implantation; infertility; inflammatory; iraqi; laparoscopy; laparotomy; lesions; levels; m.d; management; medicine; menorrhagia; menstrual; metformin; metformin treatment; months; necrosis; oral; ovarian; pain; pathogenesis; patients; pelvic; peritoneal; pharm; primary; proliferation; protein; reduction; relief; reproductive; result; sci; serum; significant; stage; stromal; study; symptoms; table; theories; therapy; tissue; tnf; treatment; tumor; usage; uterus; visit; vol.25(1; women; انشحى; تطاَح
     • versions: original; plain text
233. bijps-358
     • author: A.Abdul Sattar, Sura; H.Abdulla, Amer; Sh. Nsaif, Aufaira
     • title: Gestational Diabetes Mellitus and Hormonal Alteration
     • date: 2017-03-26
     • words: 3141
     • flesch: 34
     • summary: In previous studies of progesterone conflict data was reported where one of them has found association of progesterone with the development of gestational diabetes due to the enhancement of insulin resistance (23,24) , while another group did not find a correlation between progesterone level and an increasing risk of gestational diabetes mellitus (25) . https://en.wikipedia.org/wiki/Pregnancy https://en.wikipedia.org/wiki/Human_chorionic_gonadotropin https://en.wikipedia.org/wiki/Human_chorionic_gonadotropin http://care.diabetesjournals.org/content/36/7/1974.long#ref-1 http://care.diabetesjournals.org/content/36/7/1974.long#ref-2 http://care.diabetesjournals.org/content/36/7/1974.long#ref-3 http://care.diabetesjournals.org/content/36/7/1974.long#ref-4 http://care.diabetesjournals.org/content/36/7/1974.long#ref-5 http://care.diabetesjournals.org/content/36/7/1974.long#ref-3 http://care.diabetesjournals.org/content/36/7/1974.long#ref-6 http://care.diabetesjournals.org/content/36/7/1974.long#ref-7 Iraqi J Pharm Sci, Vol.25(1) 2016 Gestational diabetes mellitus and hormonal alteration 39 Table (1): Baseline characterization of gestational diabetes mellitus.
     • keywords: action; age; aged; alteration; baghdad; bmi; cell; changes; comparison; control; correlation; diabetes; diabetes mellitus; endocrinol; fsg; fsh; function; gdm; gestational; gestational diabetes; glucose; group; hormonal; hormone; human; increase; insulin; intolerance; iraqi; level; mellitus; metabolic; non; patients; pharm; pituitary; pregnancies; pregnancy; pregnant; present; previous; progesterone; prolactin; resistance; result; risk; sci; secretion; sera; serum; significant; study; table; trimester; vol.25(1; women; year; انبزٔصسخزٌٔ; انحًهٙ; انذو; انسكز٘; انًحذ; انٓزيٌٕ; بٍٛ
     • versions: original; plain text
234. bijps-359
     • author: R. Fadhel, Sahar; I. Abdulla, Najwa; D. Sulaiman, Intidhar
     • title: The Spectrophotometric Determination of Olanzapine via Coupling with Diazotized p-Nitroaniline
     • date: 2017-03-26
     • words: 3359
     • flesch: 55
     • summary: Olanzapine tablets solution [1000 µg.ml -1 ] Spectrophotometric determination of olanzapine 44 Figure (1): Absorption spectra of: (a) the complex of 10 µg.mL -1 (OLN.) with diazotized p-nitroaniline against reagent blank, (b) blank solution against distilled water under the primary test conditions.
     • keywords: absorbance; absorption; analytical; antipsychotic; assay; azo; blank; colored; concentration; conditions; coupling; determination; development; different; distilled; dosage; drug; dye; effect; figure; flask; hydroxide; iraqi; journal; mark; maximum; method; nitroaniline; olanzapine; oln; optimum; pharmaceutical; product; pure; range; reaction; reagent; results; sci; sodium; solution; spectrophotometric; table; time; vol.25(1; volumetric; water; zyprexa; µg.ml
     • versions: original; plain text
235. bijps-360
     • author: M. Al-Nema, Zeena
     • title: Trend of Antibiotics Usage in the Intensive Care Unit in the Medical City in Baghdad
     • date: 2017-03-26
     • words: 4739
     • flesch: 44
     • summary: Levin PD (2007) determined risk factors associated with ciprofloxacin resistance in clinical bacterial isolates from ICU patients which includes prior use of fluoroquinolones and duration of hospitalization prior to ICU admission (15) . Metronidazole is widely used antibiotic in our clinical practice and unfortunately the culture and sensitivity tests for anaerobic bacteria are unavailable in most of our centers including our settings in the present study, so we can’t evaluate its efficacy against bacteria, but in the recent years, metronidazole has appeared to lose some of its effectiveness in Clostridium difficile infection (CDI) management and vancomycin is now recognized as the first-line treatment of severe cases (16) , although, many studies proved that the rate of CDI in ICU patients is low, but the infection affects severely ill patients, and is associated with high mortality (17,18,19) .
     • keywords: acinetobacter; admission; amikacin; ampiclox; antibiotic; antimicrobial; aztreonam; bacteria; blood; care; causative; cefotaxime; cefotetan; cefoxitin; ceftazidime; ceftriaxone; chloramphenicol; ciprofloxacin; clinical; cprs; culture; days; drugs; duration; effective; empirical; gentamicin; high; hospital; http://reference.medscape.com/viewpublication/21438; icu; inadequate; infection; intensive; intensive care; iraqi; klebsiella; levofloxacin; low; mean; medical; meropenem; metronidazole; mortality; negative; number; patients; period; pharm; piperacillin; present; pseudomonas; range; resistance; results; samples; sci; sensitive; sensitivity; sensitivity tests; shunt; significant; species; spp; study; swab; table; tests; tetracycline; therapy; tobramycin; treatment; trend; trimoxazole; unit; use; vancomycin; vol.25(1; years; الة; الؼ
     • versions: original; plain text
236. bijps-361
     • author: T.Ismail, Sara; M. Al-Kotaji, Myasar; A. Khayrallah, Ahlam
     • title: Formulation and Evaluation of Nystatin Microparticles as a Sustained Release System
     • date: 2017-03-26
     • words: 5287
     • flesch: 57
     • summary: Drug release kinetics The in- vitro release data were plotted according to different models, and these curves were used to draw some conclusions regarding the mode of drug release from the microparticles. To determine the mode of drug release, the initial 60% drug release values were fitted to the Korsmeyer–Peppas model: Mt/M∞ = Kt n , where Mt/M∞ is the fraction( ≤ 60%) of drug released at time t, K is the drug release rate constant, and n is the release exponent.
     • keywords: amino; analysis; anomalous; blank; characteristic; characterization; chemical; chitosan; chitosan microparticles; concentration; cross; cumulative; data; delivery; determination; different; diffusion; drug; drug release; dsc; effect; efficiency; entrapment; evaluation; figure; file:///d:/new%20journal%2012; formulas; formulation; ftir; glutaraldehyde; group; higuchi; hours; increase; initial; invitro; iraqi; kumar; linking; loaded; loading; loss; mechanism; microparticles; microspheres; mixture; model; n1c1; n1c2; n1c3; n1c5; nystatin; nystatin microparticles; nystatin release; patel; peak; percentage; pharm; phase; physical; polymer; preparation; prepared; pure; release; research; results; sara; sci; size; slow; solution; spectroscopy; studies; study; sustained; system; table; temp; time; value; vol.24(2; yield; أظٓشد; اندضٚئبد; انًبٚكشٔٚخ; دساسخ
     • versions: original; plain text
237. bijps-362
     • author: A.Ali, Yasser; N. Abd-Alhammid, Shaimaa
     • title: Formulation and Evaluation of Ezetimibe Nanoparticles
     • date: 2017-03-26
     • words: 5028
     • flesch: 51
     • summary: Bailey N, Booth J and Clark B. Characterisation of drug nanoparticles by atomic force microscopy. As seen in Figures (9), and (10) the sharp melting peak of ezetimibe (165.30 °C) is completely disappeared in these figures that’s mean the stabilizer PVP K-30 completely converted ezetimibe particles into amorphous state (29) .
     • keywords: area; atomic; buffer; characterization; concentration; design; different; dissolution; distribution; drug; dsc; effect; efficiency; enhancement; entrapment; evaluation; ezetimibe; f11; f12; f13; f14; f21; f22; f23; f24; figure; force; formulas; formulation; ftir; hcl; hpmc; increase; international; iraqi; journal; k-30; lyophilized; methanol; microscopy; nanoparticles; nanosuspension; particle; particle size; pharmaceutical; pharmacy; phosphate; poloxamer188; polymer; powder; preparation; prepared; profile; pva; pvp; r.p.m; range; rate; ratio; research; samples; sci; sciences; size; solubility; solvent; stabilizer; study; surface; temperature; type; value; vinyl; vol.24(2; water
     • versions: original; plain text
238. bijps-363
     • author: H.Maedie, Faris; Alhaddad, Hasan; A. Hussain, Saad
     • title: Evaluation of Poisoning Cases in the Poisoning Consultation Center and Forensic Medicine Institute within Baghdad area
     • date: 2017-03-26
     • words: 4455
     • flesch: 60
     • summary: Poisoning cases in the poisoning consultation center 26 cases (7.8% each), while chlorpheniramine, alprazolam, and tramadol predispose to equal percent of poisoning cases (6.5 each). Poisoning cases in the poisoning consultation center 28 Conclusions The present study evaluates the charac- teristics of poisoning cases reported in Baghdad PCC and FMI.
     • keywords: acute; age; agents; analysis; baghdad; baghdad pcc; cases; causative; cause; center; characteristics; common; consultation; countries; data; departments; distribution; drugs; emergency; equal; females; figure; fmi; forensic; geographical; health; india; institute; iraqi; korean; lee; major; med; medical; medicine; metals; number; patients; pcc; percent; pesticides; pharm; poisoning; poisoning cases; predispose; present; reports; results; sci; soc; study; substances; suicide; table; time; total; toxic; toxic poisoning; toxicol; treatment; type; vol.24(2; years; انزغًى; انزً; ثغذاد; حبالد
     • versions: original; plain text
239. bijps-364
     • author: I. Abdulla, Najwa; M.Yaseen, Hamsa
     • title: Potentiometric Transducers for the Selective Recognition of Risperidone Based on Molecularly Imprinted Polymer
     • date: 2017-03-26
     • words: 5270
     • flesch: 58
     • summary: (a) (b) Figure (2): FTIR of (a): Ris -MIP(AAm) after the removal of (Ris.), (b) : Ris -NIP(AAm). According to the equilibrium dissociation constants (Kd) of the two acidic and basic Ris -MIPs, it was noticed that basic Ris-MIP has homogenous binding site distributions which lead to better results in its application than acidic Ris-MIP which exhibited high (Kd) value as well as heterogeneous binding sites distributions.
     • keywords: -ch; aam; acid; acidic; addition; basic; chemistry; cm -1; concentration; control; dbp; determination; direct; dop; drug; electrode; equilibrium; figure; formulations; free; ftir; functional; gce; graphite; iii; imprinted; iraqi; journal; linear; measurements; membrane; method; mip; mips; molecular; molecule; monomer; nip; non; performance; pharm; pharmaceutical; plasticizer; plot; polymer; potential; potentiometric; pure; pvc; range; recognition; response; results; ris; risperidone; sci; selective; selectivity; sensors; sites; solution; spectra; standard; str; structure; synthesis; table; template; time; transducers; values; vol.24(2; water
     • versions: original; plain text
240. bijps-365
     • author: M. Abrahem, Ruaa; J. Awad, Zainab
     • title: Phytochemical Study of Steroidal Sapogenin “Tigogenin” Present in the Leaves of Agave americana Cultivated in Iraq
     • date: 2017-03-26
     • words: 2645
     • flesch: 55
     • summary: This search include extraction, isolation, purification and dentification of Tigogenin from the leaves of Agave americana. This study confirms the presence of Tigogenin in the leaves of Agave americana cultivated in Iraq.
     • keywords: activity; agave; agave americana; americana; analysis; baghdad; chromatography; compound; crude; ethylacetate; extraction; extracts; figure; gel; hplc; identification; iraq; isolated; layer; leaves; liquid; methanol; method; no.1; no.2; pharm; plant; powdered; presence; reagent; sapogenin; sci; silica; solvent; standard; steroidal; study; system; thin; tigogenin; tlc; university; vol.24(2; انذراست; يادة
     • versions: original; plain text
241. bijps-366
     • author: M. Shiblawi, Wessam; H.Ismael, Sajida
     • title: The Effect of L-Carnitine as an Adjuvant Supplement on Lipid Profile in Iraqi Diabetic Patients
     • date: 2017-03-26
     • words: 2679
     • flesch: 52
     • summary: Role of L- Carnitine in the T2DM Patients with type 2 diabetes seem to be at elevated risk for carnitine deficiency (9) . Blood samples were taken from all individuals included in this study, at base line time and every 30 days of the study period, blood was collected by venipuncture technique in order to measure serum lipid profile.
     • keywords: administration; baseline; carnitine; changes; cholesterol; classification; clin; coa; comparison; control; criteria; density; diabetes; diabetic; diagnostic; disease; effect; fatty; group; hdl; health; increase; insulin; iraqi; ldl; level; lipid; lipoprotein; mellitus; metabolic; months; non; nutr; oxidation; patients; people; period; pharm; placebo; profile; sci; serum; significant; study; subjects; supplementation; total; treatment; triglyceride; type; vascular; vol.24(2
     • versions: original; plain text
242. bijps-367
     • author: J. Ibraheem Al-Tamimi, Jaafar
     • title: Bioequivalence and Pharmacokinetics Comparison of Two Formulations of Extended-Release Pentoxifylline Tablets in Healthy Subjects after Fasting and Fed Conditions
     • date: 2017-03-26
     • words: 5363
     • flesch: 52
     • summary: In case of fasting study; the volunteers were confined at the clinical site 14 hours before dose administration and until 24 hours after dose administration (end of each study period). It is obvious from Tables 1 and 2 that the descriptive statistics of the demographic data of the volunteers selected for fasting study was almost similar to the fed study in order to exclude the potential difference in the pharmacokinetics of drug due to age, weight and/or height.
     • keywords: administration; analysis; anova; auc0-; bioavailability; bioequivalence; blood; clinical; cmax; concentrations; condition; data; dose; dosing; drug; emea; evaluation; extended; fasting; fda; fed; food; formula; formulation; guidance; healthy; hours; hr -1; human; interval; iraqi; limit; mean; ng.hr/ml; parameters; pentoxifylline; period; pharmacokinetic; plasma; products; reference; release; reported; samples; sci; single; studies; study; subjects; t0.5; tablet; test; time; tmax; trental; values; vol.24(2; volunteers
     • versions: original; plain text
243. bijps-368
     • author: I.Khalil, Yehia
     • title: Preparation and Characterization of Montelukast Sodium ( SMLT ) as a Dual Sustained Release Buccal Strips
     • date: 2017-03-26
     • words: 5071
     • flesch: 57
     • summary: Sumedha Bansal ., Formulation ,and evaluation of fast dissolving film of an antihypertensive drug; Int. Alka Tomar, Formulation ,and evaluation ,of fast dissolving film of Dicyclomine as potential route of buccal delivery: International Journal of Drug Development 2012; 4(2): 408-417. 11.
     • keywords: acid; area; buccal; buffer; carrageenan; concentration; content; development; different; dish; disintegration; dissolution; dissolving; drug; dual; effect; endurance; evaluation; fast; figure; film; folding; formulas; formulation; fsr6; ftir; guar; gum; hours; international; iraqi; journal; k17; lactic; layer; mean; mechanical; method; minutes; montelukast; n=3; oral; pharm; pharmaceutical; phosphate; physical; polymer; prepared; profile; properties; pvp; release; release layer; research; results; sci; seconds; selected; singulair; smlt; sodium; strips; surface; sustained; table; thickness; time; vol.24(2; water; xanthan
     • versions: original; plain text
244. bijps-369
     • author: K. Fakree, Najwan
     • title: Measurement of Serum Trace Elements (Zinc, Copper, Magnesium and Iron) Concentrations in Pediatric Patients with Otitis Media with Effusion in Iraq
     • date: 2017-03-26
     • words: 3006
     • flesch: 58
     • summary: Group 1 (patient group) consist of 30 children suffering from OME and group 2 (control group) included 25 apparently healthy children. (Serum levels of zinc in group 1 and group 2 were 8.7303 ±1.5503 and 16.8039± 2.4528(umol/l) respectively) Also patients group had significantly lower serum copper values as comparing with control group (P <0.05) (Serum copper levels were 14.2097± 4.3439 in group 1 and 18.1874± 3.01628 (umol/l) in group 2).
     • keywords: activity; acute; antioxidant; children; control; copper; deficiency; development; dietary; differences; disease; ear; effect; effusion; elements; factors; function; group; healthy; immune; infections; iraqi; iron; levels; lower; magnesium; media; middle; ome; otitis; otitis media; pathogenesis; patients; pediatric; pharm; production; radicals; results; role; sci; serum; sod; status; study; table; trace; umol; values; vol.24(2; zinc; االطفال; انذو; انىسطً; يسرىياخ; يصم
     • versions: original; plain text
245. bijps-375
     • author: Hadi, Hind
     • title: Spectrophotometric Determination of Clonazepam in Pure and Dosage forms using Charge Transfer Reaction
     • date: 2017-03-27
     • words: 4193
     • flesch: 44
     • summary: The literature contained very little researches of spectrophotometric method for CLO determination. The proposed method was compared with classical method of CLO determination in British pharmacopeia and by using two statistical methods (t- and F tests and paired t-test) and both methods proved accuracy and precision of the method, and in addition the proposed method can be used routinely in quality control studies.
     • keywords: absorbance; addition; analysis; association; benesi; blank; charge; charge transfer; clo; clonazepam; complex; concentration; constant; determination; different; distilled; donor; dosage; drug; effect; equation; figure; flask; forms; hildebrand; http://www.sciencedirect.com/science/article/pii/s0731708510000300; iraqi; job; metaperiodate; method; metol; molar; order; oxidant; pharm; pharmaceutical; pharmacopoeia; precision; present; procedure; product; pure; reaction; reagent; reduction; results; sci; sodium; solution; spectrophotometric; standard; table; tablets; temperature; time; transfer; vol.24(1; volume; volumetric; water; work
     • versions: original; plain text
246. bijps-376
     • author: J. Mehsin, Raheem; A.Raheem, Leaqaa; H. Ghazi, Abdulhussein; A.Khathem, Saba
     • title: Preparation, Characterization and Prophylactic Study of New Microsphere Containing Doxycycline against Diseases of Shrimp
     • date: 2017-03-27
     • words: 3533
     • flesch: 61
     • summary: The microsphere is incorporation of drugs into polymeric materials to control drug release and increase duration of action, the biodegradable polymers were used in drug delivery systems, control the release of therapeutic agents (1) . Polymer blends, that is, physical mixture of structurally different polymers which interact with secondary forces such as hydrogen bonding with no covalent bonding.
     • keywords: acid; basrah; biodegradable; blend; chitin; chitosan; control; cost; degradation; delivery; dichloromethane; different; diseases; doxycycline; doxycycline microsphere; drop; drug; erosion; evaluation; evaporation; figure; fish; ftir; gelatin; high; hours; increase; iraqi; lactic; loading; materials; matrix; method; microsphere; mixture; mol; molecular; natural; new; oven; pathogens; peg; percentage; pharm; pla; polymers; preparation; products; prophylactic; pva; release; results; sci; shrimp; solution; study; survival; systems; table; tannin; temperature; time; vol.24(1; water; weight; بىني
     • versions: original; plain text
247. bijps-377
     • author: H. Abdul Wahab, Usama; J. Awad, Zainab
     • title: Isolation and Characterization of Iridoid Glycoside (Gardenoside) Present in the Leaves of Gardenia jasminoides J.Ellis Cultivated in Iraq
     • date: 2017-03-27
     • words: 3796
     • flesch: 54
     • summary: Iraqi J Pharm Sci, Vol.24(1) 2015 Gardenoside in the leaves of Gardenia jasminoides 40 Isolation and Characterization of Iridoid Glycoside (Gardenoside) Present in the Leaves of Gardenia jasminoides J.Ellis Cultivated in Iraq Usama H. Abdul Wahab *,1 and Zainab J. Awad * * Department of Pharmacognosy and Medicinal Plants, College of Pharmacy, University of Baghdad, Baghdad,Iraq. Keywords: Gardenia jasminoides , Gardenoside,Geniposide,Genipin.
     • keywords: acid; analysis; butanol; centimeters; chemical; chromatography; column; compounds; crude; dryness; ethanol; extract; extraction; figure; flowers; gardenia; gardenia jasminoides; gardenoside; gel; genipin; glass; glycosides; high; hplc; http://en.wikipedia.org/wiki/gardenia_jasminoides; http://pubs.acs.org/doi/abs/10.1021/jf991263j; identification; iraqi; iridoid; isolated; isolation; jasminoides; leaves; liquid; long; major; method; no.1; no.2; pancreatitis; performance; pharm; plants; plates; reference; residue; sci; silica; small; solution; solvent; spots; standard; study; systems; table; tlc; vol.24(1; water; yellow
     • versions: original; plain text
248. bijps-378
     • author: S. Farhan, Mohammed; Y. Saour, Kawkab
     • title: Synthesis of some Novel Nitrogenous Heterocyclic Compounds with Expected Biological Activity as Antimicrobial and Cytotoxic Agents
     • date: 2017-03-27
     • words: 4427
     • flesch: 57
     • summary: Iraqi J Pharm Sci, Vol.24(1) 2015 Novel nitrogenous heterocyclic compounds with biological activity 49 Synthesis of some Novel Nitrogenous Heterocyclic Compounds with Expected Biological Activity as Antimicrobial and Cytotoxic Agents. 28/4/2015 mailto:mohmadsinjar@Gmail.com Iraqi J Pharm Sci, Vol.24(1) 2015 Novel nitrogenous heterocyclic compounds with biological activity 50 Introduction Heterocyclic compounds are acquiring more importance in recent years which display biological activities.
     • keywords: 200µg; absolute; acetic; acid; activities; activity; agar; agents; alkylated; amino; analogues; antibacterial; antifungal; antimicrobial; assay; bend; biological; biological activity; bond; cancer; cell; chem; chemistry; chloride; chloroform; compounds; concentration; coupling; crystals; cytotoxic; derivatives; dmf; dryness; ester; esterification; ethyl; figure; group; hcl; heterocyclic; heterocyclic compounds; hobt; hydroxyquinoline; inhibition; iraqi; med; methanol; method; mixture; mmol; natural; new; nitrogenous; novel; o str; organic; peptide; pharm; pharmacological; product; properties; quinolone; reaction; research; room; sci; sodium; solution; str; sym; synthesis; synthesized; table; tested; university; vol.24(1; water; yellow; zone; انًشكببث; عهى; غيش; يشكببث
     • versions: original; plain text
249. bijps-379
     • author: A. Al-jubouri, Ahlam; J. Qasir, Ahlam
     • title: Synthesis and Antibacterial Activity of bis Heterocyclic Derivatives of 1,3,4-thiadiazole
     • date: 2017-03-27
     • words: 4561
     • flesch: 59
     • summary: Antibacterial evolution of bis heterocyclic derivatives 62 Table (1): Physical appearance, percentage of yield, melting points, Rf values of intermediates and final compounds. --------- 0.71 D 4C Brown crystal 85.3% 201-203 -------- 0.88 A A) Toluene: Methanol (9:1), B) Chloroform: Ethylacetate: Methanol (2:2:1) C) n-Hexane: Isopropanol: Methanol (9: 0.9:0.1), D) Chloroform: Ethanol (8:2) Table (2): Elemental microanalysis of the final compounds Table (3): Characteristic IR absorption bands of intermediates and final compounds
     • keywords: -ve; acetic; acid; activities; activity; addition; amide; antibacterial; antimicrobial; appearance; aromatic; bands; bath; bending; biological; bis; chem; color; compounds; data; deep; derivatives; dimer; elemental; ethanol; evolution; final; gram; heterocyclic; ice; iraqi; melting; microanalysis; mmole; naphthol; new; percentage; pharm; physical; plane; point; primary; reaction; results; ring; sci; solution; staphylococcus; stretching; synthesis; synthesized; table; temperature; thiadiazole; values; vol.24(1; water; yield; μg/
     • versions: original; plain text
250. bijps-380
     • author: M. Ibrahim, Nabaa; J. Kadhim, Enas
     • title: Phytochemical Investigation and Antioxidant Activity of Iraqi Tribulus terrestris
     • date: 2017-03-27
     • words: 3025
     • flesch: 50
     • summary: Preparation of extract Shade-dried coarsely powdered aerial parts of Tribulus plant was defatted with hexane for 24 hours then allowed to dry at room temperature. Abstract The aim of the present study was to characterize the Iraqi Tribulus terrestris for the presence of biologically active phyto-chemicals using methanolic extracts of the plant (aerial parts) by Gas Chromatography –Mass spectrometry (GC/MS), while the mass spectra of the compounds found in the extract was matched with the National Institute of Standards and Technology (NIST) library , in addition to study the antioxidant activity of plant extract , results confirmed the presence of therapeutically potent compounds in the Iraqi Tribulus terrestris extract predominantly alkaloids, flavonoids, saponins, tannins and terpenoids.
     • keywords: 3ml; acid; activity; aerial; alcoholic; alkaloids; analysis; antioxidant; ascorbic; baghdad; blood; body; compounds; constituents; different; dismutase; ester; extract; flavonoids; glutathione; group; iraqi; iraqi tribulus; mass; medicinal; metabolites; methanolic; methanolic extract; methyl; parts; pharm; phytochemical; plant; presence; rats; results; saponins; sci; secondary; serum; steroids; study; superoxide; tannins; temperature; terpenoids; terrestris; test; traditional; tribulus; vol.24(1; water; المضادة; الىخائج
     • versions: original; plain text
251. bijps-381
     • author: A. Nadhum, Shams; H. Mohammed, Mohammed
     • title: Design, Synthesis, Characterization and Preliminary Anticancer Study for Methotrexate Silibinin Conjugates
     • date: 2017-03-27
     • words: 4856
     • flesch: 55
     • summary: Folate is a basic component of cell metabolism and DNA synthesis and repair, and rapidly dividing cancer cells have an increased requirement for folate to maintain DNA synthesis, an observation supported by the wide spread use of antifolates in cancer chemotherapy (4) . However, the potencies of all folate-receptor targeted therapies depend on the rate of folate-linked drug conjugate binding to the cancer cell surface, the dose of folate conjugate that will saturate tumor cell surface FR in vivo, the rate of FR internalization, un loading,and recycling back to the tumor cell surface for another round of conjugate uptake, and the residence time of the folate conjugate before its metabolism or release from the cell (6) .Linkage of a drug to folic acid can generate a molecular “Trojan Horse” that can enable tumor-specific delivery of both imaging and therapeutic agents into cancer cells.
     • keywords: 5,6; acid; activity; agents; amide; amino; analysis; anticancer; assay; benzen; cancer; cell; characterized; chem; compound; concentration; conjugates; culture; cytotoxic; derivative; different; drop; drug; effective; elemental; evaluation; exposure; folate; hcl; high; human; inhibition; iraqi; low; mechanisms; membrane; methotrexate; methotrexate silibinin; methyl; mixture; mtx; n h; n n; n o; new; nh3cl; nmr; oho; p.s; pharm; powder; prodrug; proliferation; promising; rate; receptor; resistance; results; sci; silibinin; socl2; solvent; spectroscopy; stirred; stretching; surface; synthesis; table; target; tissue; treatment; triethylamine; tumor; vibration; vol.24(1; wise; yellow; اٌسشطأُح
     • versions: original; plain text
252. bijps-382
     • author: M. Alwan, Shakir; S. Jabbar, Sarrah
     • title: Design, Synthesis and Preliminary Antimicrobial Evaluation of New Derivatives of Cephalexin
     • date: 2017-03-27
     • words: 3347
     • flesch: 59
     • summary: Compound 1 (125 and 250μg) showed significant activity against P. aeruginosa and reduction in antibacterial activities against S. aureus and E. coli as compared with cephalexin. Most of the synthesized compounds were found to possess significant antibacterial activities.
     • keywords: 10ml; 250μg; activities; activity; aeruginosa; amide; amino; antibacterial; antimicrobial; appearance; aureus; bacillus; boc; carboxylate; cephalexin; cereus; chemical; coli; compound; derivatives; evaluation; follows; group; iraqi; mixture; mmol; new; percent; pharm; physical; resistant; scheme; sci; significant; stretching; structure; synthesis; synthesized; table; tea; value; vol.24(1; yield
     • versions: original; plain text
253. bijps-383
     • author: A. Hussein, Ahmed; Sh. Mahmood, Hasanain
     • title: Preparation and Evaluation of Cefixime Nanocrystals
     • date: 2017-03-27
     • words: 4794
     • flesch: 59
     • summary: Drug nanocrystals are one of the most important strategies to enhance the oral bioavailability of hydrophobic drugs. Nanocrystal drug particles: Resolving pharmaceutical formulation issues associated with poorly water- soluble compounds.
     • keywords: afm; amorphous; analyzer; area; bioavailability; capsules; cefixime; cefixime nanocrystals; cephalosporins; certain; chemical; crystalline; curve; delivery; diffraction; dissolution; distribution; drug; dsc; efficiency; entrapment; evaluation; excipients; figure; formula; formulation; ftir; generation; high; hpmc; increase; international; iraqi; journal; methanol; method; nanocrystals; nanoparticles; oral; particle; particle size; peak; pharm; pharmaceutical; poor; powder; precipitation; preparation; prepared; pure; pvp; range; rate; raw; release; results; samples; sci; sciences; sem; size; solubility; soluble; solvent; spectrum; stabilizer; state; studies; study; surface; system; temp; trihydrate; vol.23(2; water; yield; انُبٌَٕت; ػهى
     • versions: original; plain text
254. bijps-384
     • author: M. Mohammed, Mohammed; J. Al-Shamma, Kassim; A. Jassim, Nizar
     • title: Evaluation of the Clinical use of Metformin or Pioglitazone in Combination with Meloxicam in Patients with Knee Osteoarthritis; using Knee Injury and Osteoarthritis outcome Score
     • date: 2017-03-27
     • words: 6172
     • flesch: 64
     • summary: Results Effect on pain score Before enrolment in the study (zero time), OA patients demonstrated poor pain control with their previous therapy, manifested by low pain score which indicate severe or extreme symptoms of pain in most of patients (table 1). Furthermore; unrelieved pain leads to serious negative consequences, like those observed with poor pain score belong to OA patients before treatment (table 1), with many other physiological effects associated with increased catabolic demands (22) .
     • keywords: 15mg; activation; activity; adl; agonist; anti; baghdad; chondrocytes; clinical; combination; corresponding; cox-2; data; day; different; drugs; duration; effects; end; expression; group; higher; improvement; inflammation; inflammatory; iraqi; knee; knee osteoarthritis; koos; levels; life; maximum; mean; meloxicam; metformin; non; nsaids; osteoarthritis; oxidative; p>0.05; pain; patient=20; patients; pelletier; peroxisome; pharm; pioglitazone; ppar; pre; qol; quality; receptor; recreation; results; sci; score; sem; significant; sport; stress; study; symptoms; table; time; treatment; value; vol.23(2; weeks; اىَٞي٘مسٞناً; اىٚ; ػقاس
     • versions: original; plain text
255. bijps-386
     • author: M. Alwan, Shakir; H. Kadhim, Ameer
     • title: Synthesis of New Cephalosporins of Expected Improved Activity and Resistance Against -Lactamases
     • date: 2017-03-27
     • words: 5757
     • flesch: 64
     • summary: The IR spectra (ʋ, cm -1 ); recorded the following bands; 3200-2900 (O-H stretching of carboxyl, N-H stretching of sulfonamide, C- H stretching of aromatic ring), broad band at 1680-1610 (represents C=O stretching of carboxyl, C=N stretching of imine and C=C aromatic), 1510 (N-H bending of sulfonamide), 1276, 1161 (S=O stretching of sulfonamide). Iraqi J Pharm Sci, Vol.23(2) 2014 Synthesis of new cephalosporins of improved activity 24 Synthesis of New Cephalosporins of Expected Improved Activity and Resistance Against -Lactamases Shakir M. Alwan *,1 and Ameer H. Kadhim * * Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq.
     • keywords: = n; acid; activities; activity; adjacent; aeruginosa; antimicrobial; aromatic; aureus; band; bases; broad; carboxyl; cephalexin; cephalosporins; characteristic; chemical; chlorophenyl; coli; compound; cysteine; derivatives; elemental; ethanol; h c; improved; iraqi; m.p; methylene; mixture; moiety; mrsa; new; nh2; nmr; pharm; ppm; product; protons; reaction; resistant; scheme; schiff; sci; series; solution; spectra; spectrum; staph; stretching; sulfonamide; synthesis; synthesized; thiadiazole; values; vol.23(2; water
     • versions: original; plain text
256. bijps-387
     • author: A. Hussien, Suhaib; J. Awad, Zainab
     • title: Isolation and Characterization of Triterpenoid Saponin Hederacoside C. Present in the Leaves of Hedera helix L. Cultivated in Iraq
     • date: 2017-03-27
     • words: 3088
     • flesch: 57
     • summary: The pharmacological activities of Hedera helix L. are: spasmolytic, secretolytic, anti-inflammatory, antimicrobial, antiviral, antifungal, protozoidal, hepatoprotective, antioxidant, hypoglycaemic, cytotoxic, antimutagenic, and anti- hyaluronidase activity (3) . H. helix L. naturally grows in the Western, Central, and Southern Europe but has also been introduced to North America and Asia (4) .
     • keywords: acid; arabinopyranosyl; baghdad; burchard; chloroform; chromatography; column; crude; detection; different; dry; ether; extraction; figure; fractions; general; glacial; glycosides; group; hederacoside; hederasaponin; helix; helix l.; hplc; identification; iraqi; isolated; isolation; layer; leaves; liebermann; major; methanol; method; no.1; pharm; plant; precipitate; reagent; reference; residue; saponin; sci; solvent; standard; stretching; systems; table; thin; tlc; triterpenoid; vol.23(2; water
     • versions: original; plain text
257. bijps-388
     • author: H. Zain Al-Abdeen, Salah; J. Qasir, Ahlam
     • title: Synthesis of New B-adrenoceptor Blocking Agent Including 1,3,4 Thiadiazole with Expected Adrenoceptor Blocking Activity
     • date: 2017-03-27
     • words: 4408
     • flesch: 55
     • summary: New β-adrenoceptor blockers 46 Table (2): Synthesis of series B compounds (9-12) Synthesis of final products (Compounds (13- 20)) in methanol containing potassium hydroxide (0.01mol.), a solution of one of series B compounds (9-12) (0.012 mol.)
     • keywords: acid; activity; addition; adrenergic; adrenoceptor; alkyl; amino; appearances; aromatic; aromatic ch; aromatic ring; asymmetrical; baghdad; base; bending; blockers; c =; ch stretching; ch2; chain; chem; compound; concentrated; derivatives; elemental; ethanol; ether; final; group; heterocyclic; iraqi; med; melting; mixture; mole; new; nitrogen; oxypropanolamine; percentage; pharm; physical; plane; point; powder; procedure; product; reaction; receptor; ring; schiff; sci; series; stretching; synthesis; table; temperature; thiadiazole; thiol; university; value; vibration; vol.23(2; water; yellow; yield
     • versions: original; plain text
258. bijps-389
     • author: N.Al-Atrakchey, Rajaa; A.Taher, Mohammed; N.Saeed, Ibtehal
     • title: Lipid Profile and Fasting Blood Sugar Analysis in Patients with Cholelithiasis
     • date: 2017-03-27
     • words: 3464
     • flesch: 60
     • summary: Zak A, Zeman M, Hrubant K, et al: Effect of hypolipidemic treatment on the composition of bile and the risk or cholesterol gallstone disease. The role of serum lipid in the etiology of cholelithiasis is very important and particularly in cholesterol gallstones in which serum lipid profile are altered which is suggestive of metabolic syndrome.
     • keywords: age; analysis; bile; biochemical; blood; cholecystectomy; cholelithiasis; cholesterol; clinical; controls; correlation; decrease; density; disease; et al; factors; fasting; formation; fsg; gallbladder; gallstone; gallstone disease; gallstone patients; gastroenterol; glucose; hdl; healthy; high; higher; iraqi; ldl; levels; lipid; lipoprotein; low; mean; med; metabolic; p<0.05; patients; pharm; positive; present; profile; risk; samples; sci; serum; significant; study; sugar; symptomatic; syndrome; total; triglyceride; vldl; vol.23(2; world; اىبشٗحٍِ; اىذً; اىشحًَ; اىنثبفت; اىَشظى; حبىت; حصى
     • versions: original; plain text
259. bijps-390
     • author: S.Sadiem, Omer; A. Taher, Mohamed; S. Amin, Seenaa
     • title: Association of Oxidative Stress Markers with Cholelithiasis
     • date: 2017-03-27
     • words: 3279
     • flesch: 49
     • summary: Hye-Lin Ha, Hye-Jun Shin, Mark A Feitelson, et al: Oxidative stress and antioxidants in hepatic pathogenesis. Galli F, Piroddi M, Annetti C, et al: Oxidative stress and reactive oxygen species.
     • keywords: age; antibody; antioxidant; bile; bilirubin; blood; cancer; cells; cholelithiasis; color; composition; controls; decrease; department; diagnostic; difference; diseases; dismutase; enzyme; females; formation; free; gallbladder; gallstones; gastrointestinal; gene; health; history; human; increase; individuals; iraqi; laboratory; levels; markers; mean; mpo; myeloperoxidase; oxidative; oxidative stress; oxygen; parameters; patients; pharm; pigment; prevalence; radical; reactive; results; role; samples; sci; serum; significant; sod; sod1; species; stress; study; superoxide; table; tikrit; university; vol.23(2; world; years; االجهاد; حصىة
     • versions: original; plain text
260. bijps-392
     • author: S. Hmood, Kasim; N. Elias, Amer
     • title: Synthesis, Characterization, and Antimicrobial Evaluation of New Ceftriaxone Derivatives
     • date: 2017-03-28
     • words: 7153
     • flesch: 51
     • summary: N ew ceftriaxone derivatives 78 Scheme (1): The synthetic scheme of the intermediate compound (A) 2. N ew ceftriaxone derivatives 79 Table( 1): The percent yield, physical appearance, uncorrected Melting points, and Rf values of the synthesized intermediate (A) and target compounds (B1-B7) Compound Chemical Name Chemical Formula Physical appearance % Yield Melting point O C Rf A (6R,7R)-7-((Z)-2-(2-(2- chloroacetamido)thiazol-4-yl)-2- (methoxyimino)-acetamido)-3-(((2- methyl-5,6-dioxo-1,2,5,6-tetrahydro- 1,2,4-triazin-3-yl)thio)methyl)-8-oxo- 5-thia-1-azabicyclo[4.2.0]oct-2-ene-2- carboxylic acid C20H19ClN8O8S3 White powder 65 172-174 0.26 B1 (6R,7R)-7-((Z)-2-(methoxyimino)-2- (2-(2-morpholinoacetamido)-thiazol- 4-yl)acetamido)-3-(((2-methyl-5,6- dioxo-1,2,5,6-tetrahydro-1,2,4-triazin- 3-yl)thio)methyl)-8-oxo-5-thia-1- azabicyclo[4.2.0]oct-2-ene-2- carboxylic acid C24H27N9O9S3 yellow powder 88 245 0.5 B2 (6R,7R)-7-((Z)-2-(methoxyimino)-2- (2-(2-(pyrrolidin-1-yl)- acetamido)thiazol-4-yl)acetamido)-3- (((2-methyl-5,6-dioxo-1,2,5,6- tetrahydro-1,2,4-triazin-3- yl)thio)methyl)-8-oxo-5-thia-1- azabicyclo[4.2.0]oct-2-ene-2- carboxylic acid C24H27N9O8S3 brown powder 93 230 0.55
     • keywords: -och3; = n; acid; activities; activity; aliphatic; amide; amines; amino; aminothiazole; antibacterial; antifungal; antimicrobial; appearance; asymmetric stretching; baghdad; bending; biological; calculated; carbon; ceftriaxone; ceftriaxone derivatives; cephalexin; ch2; chem; chemical; chemistry; chloride; chloroacetyl; college; compounds; cooh; cooh group; data; derivatives; design; drug; elemental; ene-2carboxylic; evaluation; final; ftir; gram; group; heteroaromatic; http://www.sciencedirect.com/science/article/pii/s0040403909007898; intermediate; iraqi; lactam; melting; microanalysis; mixture; mmol; mode; n ew; new; o c; organic; oxime; oxime c; parent; pharm; pharmaceutical; piperazine; plane; powder; present; product; properties; reaction; res; ring; scheme; sci; secondary; shoulder; sodium; solution; spectrum; stretching; stretching vibration; symmetric stretching; synthesis; synthesized; synthetic; table; target; thia-1azabicyclo[4.2.0]oct-2; thiazole; university; vol.23(2; water; yield
     • versions: original; plain text
261. bijps-393
     • author: Eggadi, Venkateshwarlu; Chandra Korupozu, Sharath; kumar Korupoju, Bharath; Bandaru Sheshagiri, Sharavanabhava; Kumar R, Shiva; Rao Jupally, Venkateshwar
     • title: Evaluation of Protective Effect of Different Doses of Terminalia arjuna Bark Ethanolic Extract on Cisplatin Induced Oxidative Nephrotoxicity in Rats
     • date: 2017-03-28
     • words: 4898
     • flesch: 56
     • summary: The effect of ethanolic extract of Terminalia arjuna bark on kidney antioxidant levels A-The effect of ethanolic extract of Terminalia arjuna bark on kidney GSH levels Very high significant (P<0.001) reduction in kidney GSH levels were seen in rats intoxicated with cisplatin compared to normal control (Figure 6). Figure ( 6): Effect of different doses of ethanolic extracts of Terminalia arjuna bark (EETAB I and II) on kidney GSH levels.
     • keywords: + +; acute; administration; antioxidant; arjuna; arjuna bark; ati n; bark; body; bun; cat; ci spl; cisplatin; cisplatin control; control; control ci; creatinine; different; doses; eetab; effect; estimation; ethanolic; extract; figure; groups; gsh; high; india; induced; iraqi; kidney; levels; lipid; mda; n=6; nephrotoxicity; normal; normal control; oxidative; p<0.001; peroxidation; pharm; protective; protein; rats; reduction; renal; sci; serum; significant; sod; spl ati; terminalia; terminalia arjuna; total; treatment; urea; vol.23(2; weight
     • versions: original; plain text
262. bijps-394
     • author: F. Al - Tukmagi, Haydar; A. Moussa, Miamin
     • title: Quality of Life of Patients with Type II Diabetes Mellitus in Al- Hilla City-Iraq
     • date: 2017-03-28
     • words: 3192
     • flesch: 64
     • summary: Abstract Diabetes mellitus is a global problem nowadays due to increase the disease cases all over the world, in both the developed and developing countries which may affect the quality of life (QOL ) of diabetic patients. 100 patients enrolled in this cross sectional study which conducted to determine the quality of life of diabetic patients and to find the association between that quality and certain variables including (age, sex, occupation, residence, educational level, marital status, family history of diabetes and duration of diabetes).
     • keywords: affected; assessment; association; baghdad; care; diabetes; diabetic; disease; domain; duration; environmental; factors; fair; family; good; health; high; iraq; life; marital; measures; mellitus; merjan; mosul; outcomes; overall; patients; pharm; physical; poor; psychological; qol; quality; relation; results; sci; score; sex; significant; social; status; studies; study; table; teaching; type; variables; vol.23(2; world; انحٍبح; انسكشي; َٕػٍخ
     • versions: original; plain text
263. bijps-395
     • author: A. Ali Beg, Ammar; J. Qasir, Ahlam
     • title: Synthesis and Antimicrobial Study of Possible Mutual Prodrugs of Amoxicillin and Metronidazole by Direct and Indirect Coupling through Spacer
     • date: 2017-03-28
     • words: 3137
     • flesch: 61
     • summary: Microorganism in mixed infections may respond to antimicrobial agents differently than do those in monomicrobial infections, and it may not be necessary to eradicate every bacterial species in mixed infection to achieve cure (5) . ethyl ester ( compound 1c ) (9) :
     • keywords: acetate; activity; amoxicillin; anaerobic; anhydrous; antimicrobial; appearance; chloride; cm -1; compound; ester; ethyl; iii; infections; iraqi; kbr; melting; metronidazole; mixed; mixture; mmol; nitro; o c; organic; percent; pharm; phase; physical; point; prodrugs; residue; sci; sodium; solution; str; sulfate; synthesis; table; value; vol.23(1; water; yield
     • versions: original; plain text
264. bijps-396
     • author: M. Mikhael, Ehab; A. Majeed, Ibrahim; I. Gorial, Faiq; H. Al-Ossamy, Mohammad; H. Falih, Ali; Abdulhameed, Dhikra
     • title: Evaluation of Rosuvastatin Effect as Adjuvant Therapy to Methotrexate on Lipid Profile and the Possibility of its Cardioprotective Effect in Iraqi Patients with Active Rheumatoid Arthritis
     • date: 2017-03-28
     • words: 3880
     • flesch: 46
     • summary: The aim of this study was to evaluate the effect of rosuvastatin as adjuvant therapy to methotrexate (MTX) on lipid profile and its possible cardioprotective effect in RA patients. At the start of the study total cholesterol (TC), low density lipoprotein cholesterol (LDLc) and high density lipoprotein cholesterol (HDLc) values were not significantly different between RA patients and control group.
     • keywords: active; adjuvant; ann; arthritis; baghdad; baseline; cardioprotective; cardiovascular; cholesterol; clin; continuous; control; density; difference; disease; early; effect; esr; et al; group; hdlc; high; higher; inflammation; inflammatory; iraqi; laboratory; ldlc; level; lipid; lipoprotein; low; methotrexate; mtx; normal; patients; pbo; pharm; placebo; profile; ra patients; randomized; range; reductase; results; rheumatoid; rheumatoid arthritis; risk; rosuvastatin; sci; significant; study; subjects; table; test; therapy; total; treatment; values; variables; vol.23(1; weeks; انشثٕ٘; انًفاصم; ػُذ
     • versions: original; plain text
265. bijps-397
     • author: A.Hassan, Hiba
     • title: Measurement of some Biochemical Values in Hemodialysis Patients in Baghdad
     • date: 2017-03-28
     • words: 2722
     • flesch: 45
     • summary: The distribution of dialysis patients according to mean age is listed in table (1)shows the mean age have no significant difference( P>0.05) . Serum cholesterol is often low in dialysis patients, probably because of malnutrition and chronic inflammation (23,24) .
     • keywords: acid; acute; age; baghdad; biochemical; blood; calcium; cholesterol; chronic; concentration; control; creatinine; determination; diabetes; diabetic; dialyzer; disease; distribution; failure; file://search; function; gender; groups; healthy; hemodialysis; http://www.sciencedirect.com.tiger.sempertool.dk/science/article/pii/s0167494311000513; iraqi; kidney; kit; mean; membrane; mmol; p>0.05; patients; pharm; rbs; renal; results; serum; significant; std; study; table; test; urea; uric; uric acid; values; vol.23(1; week; اىبىه; ٍتىسط
     • versions: original; plain text
266. bijps-399
     • author: I. Abdul, Basma; A. Rajab, Nawal
     • title: Preparation and in-Vitro Evaluation of Mucoadhesive Clotrimazole Vaginal Hydrogel
     • date: 2017-03-28
     • words: 3878
     • flesch: 61
     • summary: Table (1) Composition of clotrimazole vaginal hydrogels formulas (%w/w). The lowest concentration showed faster release within the first half an hour of 99± 2% of drug release , while CMC-Na at 3.5% (F2) demonstrated the least release of 40 % after three hours.
     • keywords: buffer; carbopol; characteristics; clotrimazole; cmc; concentration; content; delivery; diameter; different; dissolution; drug; effect; evaluation; figure; following; formulas; formulation; gel; gels; hours; hydrogel; iraqi; journal; method; minutes; mucoadhesive; mucosa; order; pharm; pharmaceutical; phosphate; poloxamer; polymer; preparation; prepared; profile; properties; release; result; sci; spreadability; strength; study; swelling; system; table; time; types; vaginal; vol.23(1; water; weight
     • versions: original; plain text
267. bijps-400
     • author: J. Khadim, Enas; A. Abdulrasool, Alaa; J. Awad, Zainab
     • title: Phytochemical Investigation of Alkaloids in the Iraqi Echinops heterophyllus (Compositae)
     • date: 2017-03-28
     • words: 3603
     • flesch: 50
     • summary: 1 Corresponding author E-mail:enassara@yahoo.com Received: 23/1/2013 Accepted: 5/2/2014 http://en.wikipedia.org/wiki/Chemical_compound http://en.wikipedia.org/wiki/Base_(chemistry) http://en.wikipedia.org/wiki/Nitrogen http://en.wikipedia.org/wiki/Bacteria http://en.wikipedia.org/wiki/Fungus http://en.wikipedia.org/wiki/Animal http://en.wikipedia.org/wiki/Pharmacology Iraqi J Pharm Sci, Vol.23(1) 2014 Alkaloids of Iraqi Echinops 27 And many literatures survey revealed different pharmacological activities of Echinops plant like, antibacterial activity (7) , Antifungal (8) , Antioxidant activity (9) , Protective effects on testosterone-induced prostatic hyperplasia (10) , Hepatoprotective (11) and antiulcerogenic activity (12) . This study was emphasized on the isolation and identification of alkaloids found in the Iraqi species of Echinops plant by two methods : Preparative high Performance Liquid Chromatography chromatography (PHPLC) and preparative thin layer chromatography(PTLC) and compare between quantity of these active constituents obtained by both methods.
     • keywords: absence; activity; aerial; alkaloids; analysis; baghdad; cardiac; chromatography; compositae; compounds; different; echinops; ethylacetate; f-1; family; figure; flavonoids; form; fraction; genus; group; heterophyllus; highest; hplc; identification; iraqi; iraqi echinops; iraqi j; isolated; isolation; layer; like; medicinal; methods; nmr; parts; pharm; phytochemical; plant; plates; preliminary; preparative; presence; pure; purification; quantity; quinoline; results; roots; sci; screening; seeds; shakroka; solvent; species; steroids; study; tannins; terpenoids; test; thin; time; tlc; vol.23(1; weight
     • versions: original; plain text
268. bijps-401
     • author: A. Muften, Rouaa; Y.Saour, Kawkab; A.Razzak Mahmood, Ammar
     • title: Synthesis and Antimicrobial Evaluation of New 6 and7 Substituted Derivatives of Coumarin
     • date: 2017-03-28
     • words: 2830
     • flesch: 60
     • summary: The reaction of coumarin derivatives (coumarin I and II) with p-nitrophenyl hydrazine yield Schiff bases (compound1a and IIa).These Schiff bases were refluxed with benzoyl chloride to give benzohydrazide derivatives of coumarin substituted at its 6 or 7 nucleus position (Ia1 and IIa1).The reaction and the purity of the products were checked by thin layer chromatography (TLC). 7 3 µg/ml Ia1 9 25 µg/ml 16 60 µg/ml 6 3 µg/ml IIa1 4 25 µg/ml 12 60 µg/ml 11 3 Ketoconazole 27 25 30 60 Results and Discussion The present investigation involves the synthesis of new series of compounds involving the coumarin moiety as shown in scheme 1 and scheme 2; the pathway of synthesis of coumarin derivatives that have a characteristic aldehyde group substituted at the 6 or 7 positions of the coumarin nucleus as shown in compound (I) and (II).
     • keywords: absorption; activity; antibacterial; antifungal; antimicrobial; appearance; baghdad; bands; bases; benzohydrazide; characteristic; chem; compd; compound; coumarin; derivatives; elemental; ethanol; evaluation; group; hrs; hydrazine; ia1; ice; iia1; iraqi; m.p; methyl; mixture; new; percent; pharm; physical; product; reaction; schiff; sci; spp; stretching; synthesis; synthesized; table; values; vol.23(1; yield
     • versions: original; plain text
269. bijps-402
     • author: H. Samein, Laith
     • title: Preparation, Characterization, and in - vivo Evaluation of Daptomycin Poly(D,L-lactide-co-glycolide) Microspheres
     • date: 2017-03-28
     • words: 5926
     • flesch: 51
     • summary: 0.99 1.1 1.0 1.36 Mean particle size (μm) 20.0 19.8 25.3 23.6 Dose of Daptomycin 15 mg/kg 15 mg/kg 30 mg/kg 30 mg/kg F1 F2 F3 F4 Figure 1: Scanning electron micrographs of Daptomycin PLGA microspheres of different formulations According to the published literatures, the particle size was found to have an important effect on the drug release in the field of drug delivery. The exact kinetics of drug release could be determined and fine-tuned by careful design of the microsphere composition including the type of Polymer used, the polymer molecular weight, the copolymer composition, the nature of any excipients added to the microsphere formulation and the microsphere size, all of these factors have a strong impact on the delivery rates (5) .
     • keywords: acid; action; administration; area; auc; bulk; bulk density; burst; characterization; clinical; concentration; content; copolymer; cumulative; daptomycin; day; day dosing; days; delivery; density; dose; dosing; drug; duration; effect; figure; formulas; formulations; glycolide; higher; initial; intermediate; iraqi; journal; kda; lactide; levels; low; lower; matrix; method; microparticles; microspheres; molecular; morphology; multiple; particle; patient; peak; pharm; phase; plga; poly(d; polymer; polymeric; porous; preparation; properties; regimen; release; results; sci; serum; similar; simulation; size; soluble; state; steady; structure; studies; study; suitable; surface; table; time; treatment; trough; type; values; vivo; vol.23(1; volume; weekly; weight
     • versions: original; plain text
270. bijps-403
     • author: N. Abd-Alhammid, Shaimaa; H.Saleeh, Haider
     • title: Formulation and Evaluation of Flurbiprofen Oral Film
     • date: 2017-03-28
     • words: 3631
     • flesch: 61
     • summary: Iraqi J Pharm Sci, Vol.23(1) 2014 Flurbiprofen oral film 53 Formulation and Evaluation of Flurbiprofen Oral Film Shaimaa N. Abd-Alhammid * , 1 and Haider H.Saleeh ** * Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq. Received: 14/12/2013 Accepted:12 /4/2014 Iraqi J Pharm Sci, Vol.23(1) 2014 Flurbiprofen oral film 54 Fast dissolving films (FDF) is a type of oral drug delivery system for the oral delivery was developed based on the technology of the monolithic transdermal patches.
     • keywords: absorbance; average; buffer; calibration; cavity; characterization; cmc; concentration; data; delivery; determinations; disintegration; dissolution; dosage; drug; effect; endurance; evaluation; fast; figure; film; flurbiprofen; flurbiprofen oral; formula; formulation; glycerin; hpmc; iraqi; mean; mechanical; melting; method; oral; oral film; peg; pharm; phosphate; plasticizer; point; polymer; powder; prepared; properties; release; replicate; results; sci; study; surface; table; thickness; thin; time; type; variation; vivo; vol.23(1; water; weight
     • versions: original; plain text
271. bijps-404
     • author: J. Ibraheem Al-Tamimi, Jaafar
     • title: Bioequivalence and Pharmacokinetics of Two Formulations of Amlodipine Tablets in Healthy Subjects
     • date: 2017-03-28
     • words: 4388
     • flesch: 57
     • summary: Iraqi J Pharm Sci, Vol.23(1) 2014 Bioequivalence and pharmacokinetics of amlodipine tablets 60 Bioequivalence and Pharmacokinetics of Two Formulations of Amlodipine Tablets in Healthy Subjects Jaafar J. Ibraheem Al-Tamimi *,1 * Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq. Received: 4 / 2 / 2014 Accepted: 15 / 4 /2014 Iraqi J Pharm Sci, Vol.23(1) 2014 Bioequivalence and pharmacokinetics of amlodipine tablets 61 Introduction Amlodipine is a long-acting calcium channel blocker.
     • keywords: administration; adult; amlodipine; analysis; anova; applied; area; auc0-; bioavailability; bioequivalence; calculated; clin; clinical; cmax; concentration; criteria; crossover; curve; dose; dosing; drug; elimination; evaluation; fda; formula; guidance; healthy; hours; hplc; human; interval; iraqi; limit; lower; male; mean; method; mrt; ng.hr/ml; norvasc; parameters; period; pfizer; pharmacokinetic; pharmacol; plasma; product; randomized; reference; samples; schuirmann; sci; sequence; sided; single; studies; study; subjects; t0.5; tablet; test; time; tmax; upper; usa; values; vol.23(1; volunteers; اندواء
     • versions: original; plain text
272. bijps-406
     • author: R. Kadhim, Shurooq; H. Alaiwi, Ishraq; R., Rasha
     • title: Detection of Helicobacter Pylori IgG and IgA , Serum Biomarkers CA19-9 and CEA in Patients with Gastrointestinal Diseases
     • date: 2017-03-28
     • words: 2710
     • flesch: 66
     • summary: Recommendations: test the specimens of patients with chronic infections with H.pylori. for CA19-9 and CEA diagnosis because several studies reported a strong association between H. pylori infection and gastric cancer and colorectal cancer; as such, H. pylori is now recognized as a Group 1 carcinogen for humans . In most children, the presence of H. pylori infection does not lead to clinically apparent disease, even when the organism colonizing the gastric mucosa causes chronic active gastritis (18) .
     • keywords: age; anti; ca19; cancer; cea; chronic; clinical; colorectal; detection; diseases; distribution; elevated; females; gastric; gastritis; gastrointestinal; gender; h.pylori; helicobacter; iga; igg; infection; iraqi; males; markers; numbers; pancreatic; patients; pharm; positive; pylori; results; samples; sci; serum; serum samples; study; table; test; total; tumor; vol.23(1; years; عٍُخ
     • versions: original; plain text
273. bijps-407
     • author: Dave, Vivek; Yadav, Sachdev; Sharma, Swapnil; Panwar, Nitesh
     • title: Guggulusome - A Novel Vesicular Carriers for Enhanced Transdermal Delivery
     • date: 2017-03-28
     • words: 5547
     • flesch: 50
     • summary: The temperature was maintained at 37 ± 0.5ºC. (5,6) In-vivo efficacy study The anti-inflammatory activity of Aceclofenac guggulusomes gels formulations was evaluated by the carrageenan-induced rat hind paw edema method (18,19) . The result advocates the potential of guggulusomes gel formulation to treat rheumatic disease where facilitated penetration of the drug into muscle and synovial fluid is desirable.
     • keywords: 934k; aceclofenac; aceclofenac guggulusomes; animals; anti; carbopol; carriers; concentration; days; delivery; determination; different; diffusion; drug; edema; effect; efficiency; entrapment; erythema; ethanol; figure; formulation; function; gel; gels; glass; glycol; group; guggul lipid; guggulusomes; increase; inflammatory; inhibition; iraqi; irritation; lipid; mixture; novel; paw; percentage; permeation; pharm; potential; prepared; propylene; q.s; rats; receptor; release; results; sci; size; skin; solution; spreadability; stability; studies; study; suspension; system; table; temperature; time; topical; transdermal; vesicles; vesicular; viscosity; vol.23(1; water
     • versions: original; plain text
274. bijps-408
     • author: N. Saeed, Ebtihal; I.Omer Al-Deen, Hanan; A. Merdaw, Maysoon
     • title: Determine Nasal Carriage of Methicillin Resistant Staphylococcus aureus MRSA in Young Adult College Student
     • date: 2017-03-28
     • words: 3324
     • flesch: 56
     • summary: In table (4) the sensitivity pattern of MRSA isolates 67 (90.5%) to antibiotics show rate of resistance toward some antibiotics, Keflex(30%), Erythromycin(22.5%), Tetracycline (13.5%), Gentamycin (9%), Ciprofloxacin (6%) and Vancomycin (4.5%). Culture, colonial morphology, Gram stain, mannitol fermentation, coagulase ,gelatinasetest, DNAase, MR/VP and antimicrobial susceptibility test was performed on tryptic soy agar by modified Kirby-Bauer muller hinton disc diffusion method and the result show that out of 74 nasal swabs,67(90.5%) were MRSA positive isolates, 21(31.4%) of them were mannitol ferment and 46(68.6%) non mannitol fermenter, among these isolates 33(44.6%)male and 41(55.4%) female, there was no significant sex difference in the prevalence of Staph.
     • keywords: agar; analysis; antibiotics; aureus; care; carriage; carriers; children; coagulase; college; colonization; community; different; erythromycin; etal; factors; female; fermenter; gelatinase; group; healthy; high; hospital; infection; iraqi; isolates; mannitol; media; methicillin; methods; microbiology; mrsa; nasal; nasal carriage; need; negative; non; nosocomial; number; pharm; population; positive; prevalence; rate; resistant; result; sample; sci; sensitivity; sex; significant; spread; staph; staphylococcus; staphylococcus aureus; strain; student; studies; study; susceptibility; swabs; table; test; total; tube; vancomycin; vol.23(1; years; ب٘ي
     • versions: original; plain text
275. bijps-409
     • author: A. Hussein, Ahmed
     • title: Preparation and Evaluation of Liquid and Solid Self-Microemulsifying Drug Delivery System of Mebendazole
     • date: 2017-03-28
     • words: 6480
     • flesch: 56
     • summary: In conclusion ,self micro emulsifying drug delivery system has become promising tool to overcome shortcomings associated with conventional delivery. A novel approach to enhanced drug delivery system.
     • keywords: acid; aerosil; aqueous; batch; bioavailability; carrier; clear; concentration; constant; delivery; delivery system; diagram; dilution; dissolution; droplet; drug; drug delivery; drug release; effect; emulsification; energy; enhanced; evaluation; figure; formulas; formulation; free; glycol; improved; index; interfacial; international; iraqi; journal; liquid; measurement; mebendazole; microemulsion; min; mixture; model; oil; oleic; oral; order; particles; pharm; pharmaceutics; phase; plasma; polydispersity; potential; preparation; prepared; range; rate; release; sample; sci; self; sem; size; smedds; solid; solid smedds; stability; stable; stirring; studies; study; surface; surfactant; suspension; system; time; vivo; vol.23(1; water; zeta; انًسزسهت
     • versions: original; plain text
276. bijps-410
     • author: M.Ibrahem, Nabaa; J. Awad, Zainab
     • title: Phytochemical Study of Steroidal Sapogenin “Tigogenin” Present in the Leaves of Yucca aloifolia Cultivated in Iraq
     • date: 2017-03-28
     • words: 3181
     • flesch: 60
     • summary: Tigogenin standard E1: extraction method No.1 E2: extraction method No. 2 T E1 E2 Figure (5) : TLC for Yucca aloifolia leaves extract obtained by extraction methods No.1 and No.2 using silica gel GF 254as adsorbent and (S2) as solvent system . Rf values of Tigogenin from Yucca aloifolia leaves extract obtained by extraction methods No.1 and No.2 and its standard in different developing solvent systems in TLC Solvent system S1 S2 S3 Rf value of standard Tigogenin 0.55 0.74 0.80 Rf value of Tigogenin in crud extract of method No1 0.54 0.75 0.80 Rf value of Tigogenin in crud extract of method No2 0.56 0.78 0.81 S1: Chloroform:Methanol (95:5) S2: Chloroform:Petroleum ether: Methanol (85:10:5) S3: Chloroform:Acetone (80:20) T E1 E2 Figure(4): TLC for Yucca aloifolia leaves extract obtained by extraction methods No.1 and No.2 using silica gel GF 254 as adsorbent and (S1) as solvent system .
     • keywords: aloifolia; analysis; chloroform; chromatography; column; compound; ether; extraction; figure; fraction; gel; hours; hplc; identification; iraqi; isolated; isolation; layer; leaves; major; material; melting; methanol; method; no.1; no.2; petroleum; pharm; plant; point; purified; reagent; residue; sapogenin; sci; silica; solvent; spots; standard; steroidal; study; system; table; thin; tigogenin; tlc; vol.22(2; yucca; yucca aloifolia; ْذِ
     • versions: original; plain text
277. bijps-411
     • author: M. Mikhael, Ehab; N.Ibrahim, Turath
     • title: Neutrophil / Lymphocyte Ratio is not Correlated with Disease Activity in Rheumatoid Arthritis Patients
     • date: 2017-03-28
     • words: 3217
     • flesch: 33
     • summary: This finding is acceptable since Hb in RA patients is inversely correlated with inflammation and RA disease activity (21) . This finding was strengthened by absence of statistical difference in NLR between patients with moderately and those with highly active RA, and only CRP and ESR showed a significant difference between the 2 groups of patients similar to that of DAS28; Consequently ESR and CRP is better than NLR to detect RA disease activity.
     • keywords: active; activity; arthritis; assessment; baghdad; blood; cardiovascular; clinical; correlation; count; crp; das28; disability; disease; disease activity; ega; esr; finding; haqdi; health; heart; hematological; index; inflammation; iraqi; joints; liter; lymphocyte; measure; mtx; nano; neutrophil; nlr; parameters; patients; pharm; protein; ratio; rbc; reactive; rheumatoid; rheumatoid arthritis; risk; sci; score; sdai; significant; sjc; study; systemic; table; vas; vol.22(2; wbc; انثٛط; انذو; انًفاصم; كشٚاخ; َسثح
     • versions: original; plain text
278. bijps-412
     • author: A. Shukur, Asmaa; K.Ismail, Dawser; M. Ibrahim, Kawther
     • title: Relationship between Blood Lead Levels and Hematological Parameters in Children from Al-Fallujah City in Iraq
     • date: 2017-03-28
     • words: 4238
     • flesch: 63
     • summary: This study was designed to assess lead exposure in Al-Fallujah city by analyzing blood lead levels in children and adults and to explain the relationship between blood lead levels, hematological parameters and ferritin levels in the children. The study was performed on-(90) subjects, (65children and 25 adults).Venous blood samples were taken for estimation of hematological parameters, serum ferritin levels and blood lead levels.
     • keywords: 10µg; absorption; adults; american; anemia; association; blood; blood lead; bone; children; city; clinical; control; control group; decrease; deficiency; disease; effects; elevated; environmental; estimation; exposure; fallujah; ferritin; ferritin levels; findings; group; group(c; health; hematological; heme; high; increase; infection; inflammation; intestinal; iraqi; iron; journal; lead; lead levels; levels; low; mcv; mean; normal; p<0.001; parameters; pcv; pharm; poisoning; regulator; results; risk; sci; serum; significant; studies; study; subjects; table; toxicity; tube; values; vol.22(2; zinc; األؽفبه; اىذراسخ; اىذً; اىزطبص; ٍجَىعخ; ٍسزىيبد
     • versions: original; plain text
279. bijps-413
     • author: L. Abdulhadi, Shayma; J. Qasir, Ahlam; A. Abdul Razzak, Nadeem
     • title: Synthesis of new Conjugates of some NSAIDs with Sulfonamide as Possible Mutual Prodrugs using Tyrosine Spacer for Colon Targeted Drug Delivery
     • date: 2017-03-28
     • words: 3833
     • flesch: 47
     • summary: Colon targeted drug delivery The colon has some unique features, which make this organ attractive for site- specific drug delivery. 19. Deepika Nagpal, R Singh, Neha Gairola , SL Bodhankar, Suneela S Dhaneshwar, Mutual azo prodrug of 5-aminosalicylic acid for colon targeted drug delivery: Synthesis, kinetic studies and pharmacological evaluation, Indian Pharmaceutical Publication, 2006;68(2): 171-178. 20.
     • keywords: 25ml; acid; activity; addition; aromatic c; asymmetric; azo; baghdad; band; bath; bending; ch2; ch3; chemistry; chloride; chloroform; colon; compound; conjugates; delivery; diazonium; drug; ester; figure; group; h bending; hcl; ibuprofen; ice; iii; inflammation; inflammatory; iraqi; journal; max; melting; mixture; mmole; mutual; n =; n n; n o; non; nsaids; o o; pharm; pharmaceutical; plane; powder; prodrugs; residue; sci; site; solution; specific; stirring; stretching; sulfonamide; synthesis; table; targeted; temperature; thionyl; vol.22; yellow; انى
     • versions: original; plain text
280. bijps-414
     • author: M.K. Al-Ani, Widad; M. Aziz, Fitua
     • title: Antimicrobial Activity of Hydroxymatairesinol (HMR) Lignan
     • date: 2017-03-28
     • words: 2162
     • flesch: 29
     • summary: The antibacterial activity of HMR lignan was determined using the disc diffusion method and the MIC of the isolated compound was tested by the broth micro-dilution method. HMR lignan showed activity against Staphylococcus epidermidis(17 mm), Candida albicans (13mm), Proteussp(12mm) and Klebsiella sp (12mm).
     • keywords: activities; activity; agar; albicans; antibacterial; antibiotics; antimicrobial; antimicrobial activity; bacteria; candida; compounds; concentrations; derivatives; effects; efflux; epidermidis; figure; free; hmr; hmr lignan; hydroxymatairesinol; inhibition; iraqi; klebsiella; lignan; mechanisms; method; natural; pharm; phenylpropane; plant; potassium; products; resistance; sci; secoisolariciresinol; sensitive; staphylococcus; study; vol.22(2; zone; اىبنتشَا; راث; ٍشمباث
     • versions: original; plain text
281. bijps-415
     • author: M. Alwan, Shakir; H. Abdul-Wahab, Abdul-Hafeedh
     • title: Synthesis of new derivatives of Ceftazidime as possible Prodrugs
     • date: 2017-03-28
     • words: 5366
     • flesch: 62
     • summary: New ceftazidime derivatives were successfully prepared characterized and identified using spectral and elemental microanalysis (CHNS) analyses and the results comply with the calculated measurements. The synthesis of compound (2) was achieved by reaction of compound 2a (lysine Schiff base) and ceftazidime by the mixed anhydride method (25) , and as stated below.
     • keywords: + +; 3.41mmol; absorption; acetone; acid; activities; activity; aeruginosa; amide; amino; antibacterial; antimicrobial; appearance; bands; base; bicarbonate; buffer; carbonyl; carboxylate; ceftazidime; characteristic; chem; chemical; coli; compound; derivatives; distilled; elemental; good; group; h o; h2n; hcl; imine; iraqi; lysine; microanalysis; mixture; n h; n n; n o; na+; new; o o; oral; percent; pharm; physical; precipitate; s n; salt; schiff; sci; sodium; solution; spectra; spp; stability; stretching; synthesis; synthesized; table; tea; values; vol.22(2; water; yield; لٕاػذ; يزكب
     • versions: original; plain text
282. bijps-416
     • author: A. AlOmari, Nohad
     • title: Design, Synthesis, Characterization and Comparative Cytotoxic Evaluation of bis-(2- mercaptoacetate) gold (III) chloride
     • date: 2017-03-28
     • words: 5245
     • flesch: 61
     • summary: Indeed, gold complexes appear to be more cytotoxic than other analogous, isoelectronic metalcomplexes (9) . In this article and by the aim to replace, one of (L') ligand by anion chloride ligand (which supposedly more relevant for the biodistribution of the compound than for its pharmacodynamic effects), new complex (Au(L')2 Cl) was synthesized : (H (AuCl4)
     • keywords: absorption; action; activity; agents; analysis; anticancer; assay; au(iii; band; biological; bis-(2mercaptoacetate; cases; cell; center; ch2; chem; chemistry; chloride; cisplatin; comparative; complexes; compounds; concentration; coordination; cytotoxic; cytotoxicevaluation; cytotoxicity; design; different; dmso; drugs; effects; electronic; figure; geometry; gold; gold(iii; human; ic50; iii; inorganic; interest; iraqi; ligand; line; mechanism; medicinal; messori; metal; mol; mtt; new; pbs; pharm; planar; plate; platinum; potential; prepared; profile; properties; results; sci; sodium; solution; spectra; structure; studies; study; table; tested; time; transition; university; vol.22(2
     • versions: original; plain text
283. bijps-417
     • author: S.Ahmed, Ghassan; J. Al-Shamma, Kassim; M.Asghar, Majeed
     • title: Comparison between Rowatinex and Tamsulosin as a Medical Expulsion Therapy for Ureteral Stone
     • date: 2017-03-28
     • words: 2468
     • flesch: 59
     • summary: Iraqi J Pharm Sci, Vol.22(1) 2013 Rowatinex and tamsulosin for ureteral stone 1 Comparison between Rowatinex and Tamsulosin as a Medical Expulsion Therapy for Ureteral Stone Ghassan S.Ahmed * , Kassim J. Al-Shamma **,1 and Majeed M.Asghar *** * Department of Pharmaceutics and Clinical Pharmacy, College of Pharmacy, Basra University, Basra, Iraq. Received: 19/5/2012 Accepted: 1/12/2012 Iraqi J Pharm Sci, Vol.22(1) 2013 Rowatinex and tamsulosin for ureteral stone 2 The increased risk of dehydration in hot climates, coupled with a diet that is 50% lower in calcium and 250% higher in oxalates compared to Western diets, accounts for the higher net risk in the Middle East .(2)
     • keywords: abdominal; adrenergic; adrenoceptors; basra; clinical; colic; data; dellabella; different; effects; efficacy; expulsion; fibers; group; higher; human; iraqi; mean; medical; milanese; muscle; number; p<0.05; pain; patients; pharmacy; randomized; rate; results; rowatinex; sci; smooth; stone; study; subjects; table; tamsulosin; test; therapy; time; total; treatment; ureteral; ureteric; urol; vol.22(1; انًزضى
     • versions: original; plain text
284. bijps-418
     • author: M. Sulaiman, Dlveen; J.Al-Shamma, Kassim; N.Al-Hassani, Ansam
     • title: Efficacy, safety and Cardiovascular Disease Risk Lowering Ability of ACE Inhibitors, B-Blockers and Combination Antihypertensive Drug Regimes in Iraq
     • date: 2017-03-28
     • words: 7305
     • flesch: 57
     • summary: Most predominant adverse effects that appear, in ACE inhibitors treated group were dry cough and taste disturbances, in β-blockers treated group were bradycardia and sleep disturbances while in combination therapy treated group were according to the combination used. Level of HDL was also significantly lower than HDL in ACE inhibitors group.
     • keywords: ability; ace; ace inhibitors; age; antihypertensive; antihypertensive drug; blockers; blood; cardiovascular; chd; clinical; coa; combination; combination therapy; control; control healthy; cvd; dbp; decrease; diabetes; diabetic; diastolic; different; different antihypertensive; disease; diuretics; drug; drug regimens; effect; error; glucose; group; hdl; healthy; healthy individuals; higher; hypertension; hypertensive patients; individuals; individuals group; inhibitors; insulin; iraqi; level; lipid; lower; mean; mmhg; non; normal; patients; pharm; pressure; profiles; pulse; rate; reductase; reduction; regimens; results; risk; sbp; sci; serum; significant; standard; stroke; studies; study; systolic; table; target; therapy; thiazide; treatment; value; vldl; vol.22(1; years; اٌذَ; ظغػ; ػًٍ; فشغ
     • versions: original; plain text
285. bijps-419
     • author: A.Al-Shammaa, Dhuha; Y. Saour, Kawkab; M. Abdul-Khalik, Zaid
     • title: Phytochemical Investigation for the Main Active Constituents in Arctium lappa L. Cultivated in Iraq
     • date: 2017-03-28
     • words: 2141
     • flesch: 45
     • summary: This study confirms the presence of Chlorogenic acid, Caffeic acid, Arctiin and Arctigenin in Actium lappa plant cultivated in Iraq. Standards used to identify the main active constituents (Arctiin, Arctigenin, Caffeic acid and Chlorogenic acid) were obtained from China (Cheng du Biopurify phytochemicals Ltd.).UV was done in methanol.
     • keywords: acid; active; active constituents; analysis; arctigenin; arctiin; arctium; arctium lappa; baghdad; burdock; caffeic; chlorogenic; chlorogenic acid; chromatography; compounds; conditions; constituents; extract; extraction; figure; hplc; identification; iraqi; isolated; lappa; leaf; leaves; main; methanolic; pharm; phytochemical; plant; presence; results; root; sample; sci; solvent; standards; std; table; tlc; vol.22(1; بغذاد
     • versions: original; plain text
286. bijps-420
     • author: N. Sabir, Mohammed; K. Rachid, Shwan
     • title: Comparative Analysis of the Fatty Acid Pattern of Silybum marianum with Nigella sativa by Gas Chromatography-Mass Spectrometry
     • date: 2017-03-28
     • words: 3857
     • flesch: 58
     • summary: Normally, fatty acids are acids produced in cell after catabolism break down of fat. The common constituents of the lipids in plants are branched fatty acids, and they are rarely found in the integral lipid.
     • keywords: acid; acid pattern; activities; analysis; biological; branched; chain; chemistry; chromatography; content; data; detector; differences; diseases; drugs; et al; ether; extract; extraction; fatty; fatty acid; fixed; free; gas; germany; health; hexane; important; iraqi; marianum; mass; med; metabolites; min; natural; new; nigella; nigella sativa; nist; oils; omega; organic; pattern; petroleum; pharm; plant; products; ratio; sample; sativa; sativa seeds; sci; seeds; selective; silybum; silybum marianum; silymarin; solvents; spectrometry; standards; table; temperature; total; treatment; unsaturated; unsaturated fatty; vol.22(1; weight; عهً
     • versions: original; plain text
287. bijps-421
     • author: A. Fatohy, Heba; A. Abdul-Rasool, Alaa
     • title: Effect of Different Diluent and Binder Types on the Preparation of Bisoprolol Fumarate as Tablet Dosage Form
     • date: 2017-03-28
     • words: 4064
     • flesch: 51
     • summary: Stability study within one month The effect of different temperatures on the degradation of Bisoprolol tablet was studied by storing samples of Bisoprolol tablet F1 under 40, 50 and 60 o C for one month; samples were taken at certain time intervals to determine percent drug remaining versus time. Bisoprolol tablets were prepared by two methods (direct and wet) using different proportion and types of diluents, different binder types and forms, then evaluated for, weight variation, hardness, friability, disintegration time and dissolution rate.
     • keywords: acacia; angle; avicel; binder; bisoprolol; bisoprolol tablet; compression; different; diluent; direct; disintegration; disintegration time; dissolution; dosage; drug; effect; faster; figure; formulas; friability; fumarate; good; granulation; hardness; iraqi; liquid; mannitol; method; min; pharm; pharmacy; powder; preparation; prepared; presence; properties; proportion; reference; results; sci; starch; study; tablet; test; time; type; university; usp; vol.22(1; water; weight; wet
     • versions: original; plain text
288. bijps-422
     • author: M.Toma, Nawar; I.Khalil, Yehia
     • title: Formulation and Evaluation of Bilayer Tablets Containing Immediate Release Aspirin Layer and Floating Clopidogrel Layer
     • date: 2017-03-28
     • words: 4429
     • flesch: 41
     • summary: Key words: Aspirin, Clopidogrel, Bilayer tablet, Floating tablet. To administer fixed dose combinations of different active pharmaceutical ingredients, prolong the drug product life cycle, fabricate novel drug delivery systems such as chewing device, buccal/mucoadhesive delivery systems, and floating tablets for gastro-retentive drug delivery (2).
     • keywords: active; addition; aspirin; bicarbonate; bilayer; bilayer tablets; carbapol; clopidogrel; combination; compressed; concentration; content; decrease; degradation; delivery; different; diluents; disintegration; dissolution; drug; duration; effect; ethylcellulose; evaluation; figure; formulas; formulation; friability; hardness; hcl; hpmc; immediate; ingredients; iraqi; journal; lactose; lag; life; matrix; method; pharmaceutical; platelets; plot; polymer; preparation; prepared; profile; properties; rapid; rate; release; release layer; research; results; sci; sodium; soluble; study; sustained; system; tablets; test; time; total; uniformity; vol.22(1
     • versions: original; plain text
289. bijps-424
     • author: S. Jabbar, Zainab; J. Al-Shamma, Kassim; A. Taher, Mohammad
     • title: Some Hormonal Changes in Women with Primary Hypothyroidism under the Effect of Thyroid Hormone Replacement Therapy
     • date: 2017-03-28
     • words: 4321
     • flesch: 60
     • summary: A significant increase in free testosterone and FBG and significant decrease in TT3 and E2 levels in normal cyclic patients women when compared with normal cycle control group. The present work demonstrated that estradiol level is decreased in both groups of patients women (normal cyclic and postmenopausal) when compared with their control groups.
     • keywords: a×c; baghdad; blood; b×d; changes; clinical; control; control group; cycle; cycle)group; cyclic; cyclic patients; c×d; diabetes; disease; effect; elevation; estradiol; fasting; free; glucose; group; high; homa; hormonal; hormone; hypothyroidism; increase; insulin; iraqi; l.b; levels; mean; normal; normal cyclic; old; patients; patients women; pharm; postmenopausal; primary; prolactin; replacement; resistance; results; sci; significant; study; testosterone; therapy; thyroxine; tsh; tt4; u.b; vol.22; women; years; انذسقٛت; انذٔسة; انسش; انطبٛؼٛت; انًشٚعاث; انُساء; انٛأط; بانًقاسَت; بؼذ; رٔاث
     • versions: original; plain text
290. bijps-425
     • author: A. Yas, Ali; I. Khalil, Yehia; S. Mohamed, Mohamed
     • title: Response Surface Methodology for Development and Optimization of Theophylline Pulmonary Delivery System
     • date: 2017-03-28
     • words: 8092
     • flesch: 55
     • summary: Where % r – cumulative % TP released at time t, K – rate constant of the model and n – release exponent Checkpoint analysis The checkpoint analysis was performed to confirm the reliability of the equations and plots in responses prediction. After being cooled to room temperature, the extract is filtered through 0.45 µm syringe filter and the content was determined spectrophotometrically at 274 nm against filtered extract from TP free solid lipid microparticles as a blank using spectrophotometer (Hitachi / Japan).
     • keywords: aerodynamic; analysis; asthma; behenate; behnken; biopharmaceutics; box; characterization; cm -1; concentration; daer; de420; delivery; density; design; diameter; diffusion; dissolution; drug; dry; dsc; effect; efficiency; electron; entrapment; equation; european; experimental; factors; figure; fine; following; formulation; fpf; fraction; high; independent; inhalation; international; iraqi; journal; layer; level; lipid; lipid microparticles; loaded; loading; mass; median; melting; microparticles; minutes; mixture; mmad; model; nanoparticles; negative; non; nps; optimization; order; peak; percentage; pharm; pharmaceutical; phase; physical; plot; point; positive; potential; powder; preparation; prepared; pulmonary; pulmonary delivery; pure; quadratic; release; response; sample; scanning; sci; sciences; significant; size; solid; solid lipid; spectroscopy; spectrum; surface; system; table; theophylline; time; usa; values; vol.22(1; water; weight; zeta
     • versions: original; plain text
291. bijps-426
     • author: J. Mohammed, Huda
     • title: Physicochemical Factors Affected the Partial Purified Lipase Activity of Acinetobacter baumannii "local isolates"
     • date: 2017-03-28
     • words: 4160
     • flesch: 50
     • summary: (6) wherease Park et al., recorded that the Zn ++ has inhibitory action on A. baumannii lipase (34) but other study reported that lipase activity is slightly inhibited by Zn ++(1) . Characterization of lipase lipase assay The hydrolytic activity was tested by trimetric method, 20 mM phosphate buffer / Arabic gum (1%w/v) and the substrate (olive oil) 1/1 (v/v) were made up to a total volume of 10 ml.
     • keywords: 10(100; 2012; ability; acid; acinetobacter; acinetobacter baumannii; activity; agar; amikacin; ammonium; amoxicillin; antibiotics; antimicrobial; bacterial; baumannii; biochemical; blood; ceftazidim; characterization; ciprofloxacin; clinical; colistin; conditions; different; effect; enzyme; etal; extracellular; fatty; figure; food; gentamicin; high; hydrolysis; imipenem; infections; ions; iraqi; isolates; lipase; lipase activity; lipase production; mcg; media; meropenem; microbiol; n=20; negative; number; oil; optimum; partial; penicillin; pharm; piperacillin; positive; production; purification; purified; range; resistance; results; rhodamine; sci; skin; spp; strains; study; sulphate; system; table; temperature; transesterification; vol.22(1; wherease
     • versions: original; plain text
292. bijps-427
     • author: J.Kadhim, Dheyaa; J.Al-Shamma, Kassim; G. Hussein, Adeeb
     • title: Association of Admission Serum Resistin Level with Acute ST-Segment Elevation Myocardial Infarction in Iraqi Patients
     • date: 2017-03-28
     • words: 3912
     • flesch: 58
     • summary: Spearman correlation was performed to evaluate the relationship between resistin level and the values of other selected clinical variables among patients with STEMI. No significant correlation was found between age, BMI, S. uric acid, S. Creatinine, S. urea, Total cholesterol, HDL-c, serum leptin, and serum cTnI and resistin level (Table 4).
     • keywords: 2011; acute; acute stemi; adiponectin; admission; age; association; atherosclerosis; biochem; biophys; bmi; cardiovascular; cells; cholesterol; clinical; commun; control; coronary; correlation; demographic; development; diabetes; disease; elevation; elisa; endothelial; et al; factor; groups; hdl; heart; human; hypertension; infarction; inflammatory; insulin; iraqi; laboratory; leptin; level; lipoprotein; macrophages; mean; myocardial; obesity; patients; pharm; plasma; relationship; resistin; resistin level; risk; sci; segment; serum; serum resistin; significant; stemi; studies; study; syndrome; table; test; tissue; variables; vol.22(1; اىقية
     • versions: original; plain text
293. bijps-428
     • author: K. Abdulridha, Manal
     • title: The Relationship between ABO Blood Group Distribution and the incidence of Upper Gastric and Duodenal Ulcer in Iraqi Patients
     • date: 2017-03-28
     • words: 3927
     • flesch: 64
     • summary: Abstract The relationship between blood group antigens and peptic ulcer disease has been widely evaluated in the past, but only one study relating H pylori seroprevalence to ABO blood groups among Iraqi patients with peptic ulcer disease is available. These studies encouraged many researchers to investigate the relation between ABO blood groups and their secretor status with peptic ulcer (9, 11) .
     • keywords: abo; abo blood; addition; age; association; bleeding; blood; blood group; cancer; clinical; controls; disease; distribution; duodenal; endoscopic; factor; findings; frequency; gastric; gastroenterol; gastrointestinal; gender; group; group o; helicobacter; higher; http://en.wikipedia.org/wiki/blood_type#cite_note-0; incidence; individuals; infection; inflammatory; iraqi; jaff; med; patients; peptic; peptic ulcer; pharm; phenotype; positivity; pud; pylori; relationship; rhesus; risk; sci; secretor; significant; statistical; status; stomach; studies; study; subjects; table; ulcer; ulcer disease; upper; vol.22(1; years; الذساست; الذم; الوشػً; الوعذة; حمشدبث; عششٌ; علً; عٌذ; فظُلت; واالثٌٍ; ًسبت
     • versions: original; plain text
294. bijps-429
     • author: A. Shakir, Aous; J. Awad, Zainab
     • title: Phytochemical Study of Flavonoid "Casticin" Present in the Fruits of Vitex agnus-castus L. Cultivated in Iraq
     • date: 2017-03-28
     • words: 2796
     • flesch: 61
     • summary: Key words : Vitex agnus – castus , Flavanoid , Casticin انمسروع في انموجود في ثمار نباث شجرة ابراهيم( انكاستيسين)دراست كيموأحيائيت نهفالفينويذ انعراق أوش عبذانحسين شاكر * و زينب جهيم عواد ** * . IR For further characterization of the Casticin isolated from the dried fruit of Vitex agnus- castus, FT-IR spectroscopy analysis was performed using Casticin standard as a reference.
     • keywords: acetone; acid; agnus; agnuscastus; analysis; casticin; castus; castus l.; chloroform; chromatography; compound; concentrated; dmf; dry; ethyl; extract; extraction; figure; flavonoid; formic; fruits; gel; hplc; identification; iraq; isolated; layer; melting; method; pharm; phase; plant; plates; point; room; sci; silica; solvent; standard; step; study; temperature; thin; tlc; vitex; vol.22(1; ْذِ
     • versions: original; plain text
295. bijps-430
     • author: M. Saleh Al-Quraishi, Ghadah
     • title: Serum Levels of Total IgE, IL-12, IL-13 and IL-18 in Children Patients with Asthma
     • date: 2017-03-28
     • words: 3077
     • flesch: 63
     • summary: However, it was thought that IL-18 might act as a coinducer of both Th1 and Th2 cytokines, it was suggested that elevated IL-18 levels in asthma patients did not affect IFN-γ production and might enhance T-lymphocyte-mediated inflammation (15). Abstract T-cell activation and alteration of cytokine levels are involved in the pathogenesis of asthma.
     • keywords: airway; allergic; asthma; asthmatic; blood; bronchial; cells; children; concentrations; control; cytokine; disease; elevated; higher; ifn; ige; il-13; il-4; inflammation; interleutines; iraqi; levels; lymphocyte; mast; new; p<0.05; pathogenesis; patients; pharm; population; production; proinflammatory; responses; role; sci; serum; serum levels; study; subjects; th1; th2; total; vol.22(1
     • versions: original; plain text
296. bijps-431
     • author: I. Rashid, Khaleel; M. Aljibouri, Abedaljasim; J. Zayer, AbdulAmeer; B. Khalid, Luma; Abdul-Munaem, Ahmed
     • title: Study the Effect of Arabidopsis thaliana Extract on Reducing Blood Glucose Level in Diabetic White Albino Mice
     • date: 2017-03-28
     • words: 3263
     • flesch: 60
     • summary: It was concluded that it was plant insulin, The presence of insulin-like molecule was recently demonstrated in the seed extract of Arabidopsis thaliana , this protein may be responsible for the lowering of blood glucose concentrations when it was injected in diabetic mice. The aims of this research are to determine the active compounds in Arabidopsis plant seeds, for anti-diabetic treatments of patients with high glucose level in their blood, and to achieve commercial and economic source of insulin.
     • keywords: active; activity; agents; albino; alkaloids; alloxan; animals; aqueous; arabidopsis; arabidopsis thaliana; blood; chemical; compounds; control; days; detection; diabetes; diabetic; distilled; effect; extract; flavonoids; glucose; group; herbal; human; hypoglycemic; insulin; iraqi; level; like; mice; normal; pharm; plant; presence; protein; research; results; saponins; sci; seeds; solution; steroids; study; tannins; thaliana; treatment; type; vol.22(1; water; white
     • versions: original; plain text
297. bijps-432
     • author: N – A . Omar, Tagreed
     • title: Synthesis and Preliminary Pharmacological Evaluation of Esters and Amides Derivatives of Naproxen as Potential Anti-Inflammatory Agents
     • date: 2017-03-28
     • words: 3634
     • flesch: 63
     • summary: 2- ( 6 – methoxynaphthalen – 2 - yl ) – N - ( 4 - nitrophenyl)propanamide (compound IV) White crystal m.p. 175-176 °C; 4-chlorophenyl2- ( 6- methoxynaphthalen-2-yl ) propanoate (compound II): White powder (55% yield); m.p. 185-186 °C; Rf = 0.73; IR (cm− 1 ): 2,941, 2,852 (C-H), 1,753 (C=O) of ester, 1,602 and 1,523 (C=C of aromatic), 1,146(C-O); CHNO calculated (C20H17ClO3): C, 70.49; H, 5.03; O, 14.08 found: C, 71.82; H, 5.15; O, 14.75.
     • keywords: acid; activity; agents; amidation; amide; anhydride; aniline; anti; aromatic; clinical; comparable; compounds; control; cox-2; derivatives; drugs; edema; effect; egg; esters; figure; final; glycol; group; higher; iii; induced; inflammation; inflammatory; inhibitors; iraqi; m.p; mixture; mmol; naproxen; new; non; nsaids; paw; pharm; pharmacological; preliminary; propylene; rats; results; sci; selective; steroidal; synthesis; tested; time; vol.22(1; white
     • versions: original; plain text
298. bijps-433
     • author: I. Rasheed, Jawad; M. Abbas, Hassan
     • title: Implementation of a Clinical Pharmacy Training Program in Iraqi Teaching Hospitals : Review Article
     • date: 2017-03-28
     • words: 3109
     • flesch: 53
     • summary: As a conclusion, the practice of clinical pharmacy, as well as clinical pharmacy education, varies significantly throughout the world. In our opinion we lack for most of these programs, even the program of clinical pharmacy in ministry of health is not residency program and it is short and not subspecialized apart from being not recognized by academic institutes and references.
     • keywords: accp; american; article; available; board; care; certification; clinical; clinical pharmacy; college; council; countries; cpe; critical; degree; department; development; drug; education; graduates; health; higher; home; hospitals; http://www.acpe-accredit.org/pdf/acpe_revised_pharmd_standards_adopted_jan152006.pdf.%20accessed%20may%2020,2011; iraqi; journal; medical; medicine; ministry; new; page; patient; pharmaceutical; pharmacists; pharmacotherapy; pharmacy; practice; practitioners; profession; program; quality; residency; sci; services; skills; specialists; specialties; system; teaching; training; vol.21(1; year; إًٌ; اٌشػاَت; اٌصُذالُٔت; اٌصُذٌت
     • versions: original; plain text
299. bijps-434
     • author: Mutalib A.G Nasser, Abdul
     • title: Phytochemical Study of Cynara scolymus L. (Artichoke) (Asteraceae) Cultivated in Iraq, Detection and Identification of Phenolic Acid Compounds Cynarin and Chlorogenic Acid
     • date: 2017-03-28
     • words: 3391
     • flesch: 58
     • summary: Thus this work deals with phenolic acids cholrogenic acid and cynarin. Phenolic acids which include a combinations of caffeic acid and quinic acid.
     • keywords: acetate; acid; activity; analysis; antioxidant; artichoke; baghdad; butanol; chlorogenic; choleretic; chromatography; college; column; compounds; content; cynara; cynara scolymus; cynarin; endothelial; ethyl; extract; figure; food; fraction; globe; hplc; important; investigation; iraq; layer; leaf; leaves; methanol; minutes; pharm; pharmacy; phenolic; phytochemical; plant; portion; quinic; results; retention; sci; scolymus; separation; standard; study; table; time; university; unknown; vol.21(1; water
     • versions: original; plain text
300. bijps-435
     • author: J. Aram, Jehan; J. Al-Shamma, Kassim; N. Al-Hassani, Ansam
     • title: Effect of L-carnitine, Multivitamins and their Combination in the Treatment of Idiopathic Male Infertility
     • date: 2017-03-28
     • words: 4060
     • flesch: 57
     • summary: Different letters represent significant difference between controls and the patients before treatment Table 5: Effects of multivitamins treatment on the mean ± SE of seminal fluid volume, sperm concentration, and sperm count in idiopathic infertile patients(n=29) compared to controls (n=30). The aim of the present study is to investigate and compare the efficacy of L-carnitine, multivitamins and their combination therapies on semen characteristics (seminal fluid volume, sperm concentration, sperm count, sperm morphology, sperm motility, progressive motile sperm count and round cells count) in idiopathic male infertility.
     • keywords: acid; active; analysis; carnitine; cell; combination; concentration; controls; count; daily; difference; effects; fluid; group; human; idiopathic; improvement; infertile; infertility; iraqi; letters; male; mean; medical; month; motile; motile sperm; motility; multivitamins; n=30; p<0.05; parameters; patients; percentage; period; pharm; progressive; results; role; sci; semen; seminal; significant; sperm; sperm concentration; sperm count; study; table; therapy; treatment; values; vol.21(1; volume; انحٛايٍ; انسائم; انؼالج; انًُٕ٘; كاسَرٍٛ
     • versions: original; plain text
301. bijps-436
     • author: M. Murtadha, Riyadh
     • title: Therapeutic Response of Serum Lipids to Atorvastatin in Type II Diabetic Patients
     • date: 2017-03-28
     • words: 2908
     • flesch: 60
     • summary: It was found that the reduction in S. Total Cholesterol and S. LDL-C were less in diabetic patients than that in non-diabetic patients when they are using the same doses of Atorvastatin, while the changes in S. HDL-C and S. Triglyceride were nearly similar in both. So,higher doses of Atorvastatin (double doses) are needed to improve serum lipid levels in diabetic patients as compared to non-diabetic patients.
     • keywords: atorvastatin; cad; cardiovascular; changes; cholesterol; concentrations; coronary; diabetes; diabetic; diabetic patients; disease; doses; hdl; heart; hyperlipidemic; iraqi; ldl; levels; lipid; mellitus; months; non; patients; percentage; pharm; pts; reduction; response; risk; sci; serum; similar; statins; study; table; treatment; type; vol.21(1; انذهىٌ; انذو; انًشظً; انًصابٍُ
     • versions: original; plain text
302. bijps-437
     • author: M. Attyah, Ahmed; H. Ismail, Sajida
     • title: Protective Effect of Ginger Extract Against Cisplatin-Induced Hepatotoxicity and Cardiotoxicity in Rats.
     • date: 2017-03-28
     • words: 4147
     • flesch: 54
     • summary: Abstract Iraqi J Pharm Sci, Vol.21(1) 2012 Protective effect of ginger extract 27 Protective Effect of Ginger Extract Against Cisplatin-Induced Hepatotoxicity and Cardiotoxicity in Rats. Abstract The protective effect of ginger extract against cisplatin-induced hepatotoxicity and cardiotoxicity was evaluated in 30 albino white rats(weighing 200-300 gm ) classified into 5groups (6 rats per each group).
     • keywords: 10mg; alt; animals; antioxidant; arraw; ast; cardiac; cardiotoxicity; carnitine; cells; changes; chem; cisplatin; comparison; control; damage; days; degeneration; difference; dose; effect; enzymes; eosin; extract; fiber; figure; food; ginger; ginger extract; group; haematoxylline; heart; hepatic; hepatotoxicity; histological; inflammatory; inhibition; iraqi; ldh; levels; liver; magnification; muscle; necrosis; normal; oxidative; p<0.05; pharm; protective; protective effect; rats; respect; sci; section; serum; serum levels; significant; stress; study; tissue; toxicol; toxicology; treatment; tsb; vol.21(1; انزَجبٛم; خالٚا
     • versions: original; plain text
303. bijps-438
     • author: M. Al-Nema, Zeena; I. Mohammed, Samer; T. Ahmed, Fadia
     • title: Effect of Administration of Crystalloid IV Fluids Preoperatively on Postoperative Pain
     • date: 2017-03-28
     • words: 3068
     • flesch: 53
     • summary: Table 2: Postoperative pain within 5 hours in group A and B Pain scale of the Mayo Clinic (10) Number of patients group A % of patients group A Number of patients group B % of patients group B Less or equal 5 10 15.3 16 29.09 More than 5 55 84.6 39 70.9 Total 65 100 55 100 Table 3 : Use of analgesics in group A and B Use of analgesics Number of patients group A % of patients group A Number of patients group B %of patients group B Without analgesic 6 10.1 10 18.18 Tramadol 46 77.9 32 58.18 Diclofenac sodium 13 22.0 13 23.64 Total 65 100 55 100 Type of surgery In fact, a close examination of other studies of preoperative fluid regimens does reveal evidence for reduced postoperative pain with 2ml/kg/hr preoperative IV fluid therapy, although this has received little attention.
     • keywords: 2ml; abdominal; administration; ambulatory; analgesic; associated; baghdad; crystalloid; disease; effect; fluids; group; group b; high; hospital; hours; incidence; iraqi; iv fluids; large; nausea; need; number; opioid; pain; patients; pharm; postoperative; potential; preoperative; reduced; risk; scale; sci; severity; study; surgery; table; teaching; type; use; vol.21(1; volume; vomiting; بعذ; ِمْه
     • versions: original; plain text
304. bijps-439
     • author: J. Mohamed, Suad; E. Mecheser, Abdullah
     • title: Assessment of Patients’ Knowledge Toward Total Hip Replacement Home – Care
     • date: 2017-03-28
     • words: 3299
     • flesch: 55
     • summary: 2. Provide the discharge patient with a pan phlet6 of all need instruction with figures illustrating to them all information they may need at home relating to activity and sleeping or medication Iraqi J Pharm Sci, Vol.21(1) 2012 Total hip replacement home – care 45 References 1. significant relation between the sample age group and patients knowledge toward mobility limitation at home (table 5) ,while significant relation between level of education and patients knowledge toward managing complication at home, which revealed that hip replacement educated patients can managing the complication at home (table7).
     • keywords: assistive; care; complication; data; devices; education; hip; hip replacement; home; hospital; infection; information; instruction; iraqi; item; joint; knowledge; level; limitation; main; management; medical; mobility; nursing; pain; patients; pharm; potential; questionnaire; rehabilitation; related; replacement; result; sample; school; sci; score; section; significant; study; surgery; surgical; table; technique; time; total; total hip; use; vol.21(1; wound; اسخبذاي; اٌىرن; ِفصً
     • versions: original; plain text
305. bijps-441
     • author: S. Mohammed, Ebtehal; F. Al-Taie, Wafa; T. Numan, Intesar; A. Hussain, Saad
     • title: Changes in Serum Levels of Tumor Necrosis Factor-Alpha and Antioxidant status in Different Stages of Malignant Prostate Cancer Patients in Iraq
     • date: 2017-03-28
     • words: 2762
     • flesch: 51
     • summary: Results Table 1 indicated that TNF-α levels in all stages of malignant prostate patients were significantly higher compared to control (485.88%, 1152.04%, 2469.73%, and 3640.16%, respectively, P<0.05), and (126.67%, 384.39%, 894.19% and 1347% respectively, P<0.05) compared to BPH patients; significant differences were observed between the four stages of PCa patients; however, highly significant difference was shown in stage IV of malignant PCa patients compared to control and BPH patients (P<0.05) (Figure 1). Table 2 clearly demonstrated that MDA levels in all stages of PCa patients were significantly higher compared to control (329.92%, 457.79%, 616.8%, and 745.9% respectively), and 68.92%, 119.16%, 181.64%, and 232.37%, respectively compared to BPH patients, and significant differences were observed between the four stages of PCa; however, highly significant difference was observed in stage IV of malignant PCa patients compared to control and BPH patients (P<0.05) (Figure 2).
     • keywords: alpha; antioxidant; baghdad; bph; bph patients; cancer; cells; control; damage; development; differences; different; disease; dna; figure; groups; healthy; hospital; inflammation; iraqi; levels; malignant; mda; oxidative; p<0.05; patients; pca; pca patients; pharm; proliferation; prostate; prostatic; role; sci; serum; significant; stages; status; stress; study; subjects; table; tas; teaching; tissue; tnf; total; tumor; values; vol.21(1
     • versions: original; plain text
306. bijps-442
     • author: H. Jaber, Saba; T.Salih, Zainab; M. Salmo, Hiba
     • title: Formulation of Azithromycin Suspension as an Oral Dosage Form
     • date: 2017-03-28
     • words: 4247
     • flesch: 50
     • summary: Method of preparation Formulation of azithromycin suspension Several formulas of Azithromycin aqueous suspension were prepared, either as dry physical mixture powder for reconstitution or as granules for reconstitution. Table (1) shows different formulas of azithromycin suspension each was prepared as: Ablend of 4.0 %( w/v) azithromycin was mixed with different excipients stated in the above table, in a dry amber bottle (11) .
     • keywords: agent; azithromycin; azithromycin suspension; baghdad; college; colloidal; concentration; date; degradation; different; dioxide; dissolution; dosage; drug; dry; effect; expiration; figure; flavor; formula; formulation; gram; granular; granules; gum; hcl; hpmc; iii; infections; iraqi; medium; methyl; mixture; oral; paraben; ph=1.2; pharm; pharmacy; physical; powder; preparation; prepared; profile; propyl; rate; reconstitution; reference; release; resuspendable; sci; sedimentation; silicon; stability; study; suspension; table; thesis; university; viscosity; vol.21(1; volume; xanthan; xanthan gum; zithromax
     • versions: original; plain text
307. bijps-443
     • author: A. Al-Haideri, Abdul-Muhsin; I. Abdulla, Najwa; K. Malih, Ibtihaj
     • title: Polymeric Membrane Sensors for the Selective Determination of Metoclopramide Hydrochloride and their Applications to Pharmaceutical Analysis
     • date: 2017-03-28
     • words: 4676
     • flesch: 55
     • summary: The response time of TBP electrode using 10 -5 M metoclopramide hydrochloride pH-effect The influence of the pH on the response of MCP membrane sensors was checked using 10 -2 M and 10 -3 M MCP hydrochloride solutions and recording the e.m.f. A typical calibration graph of MCP sensors is shown in Figure1.
     • keywords: -2 m; acid; addition; amino; analysis; analytical; behp; butyl; coefficient; complex; concentration; days; dbph; decade; detection; determination; different; dioctyl; dopp; drug; electrode; figure; formulations; high; hydrochloride; ion; iraqi; limit; linear; mcp; measurements; membrane; membrane sensors; method; metoclopramide; pair; pharmaceutical; phosphate; phosphotungstic; phthalate; plasticizers; plot; polymeric; potential; potentiometric; pure; pvc; range; response; results; rsd; sci; selective; selectivity; sensors; solution; standard; table; tbp; time; titration; values; vol.21(1
     • versions: original; plain text
308. bijps-444
     • author: M. Mikhael, Ehab; Y. Mohammed, Mahdi
     • title: Serratiopeptidase a Hope in a Rapid and Better Improvement of Inflammatory Acne Vulgaris
     • date: 2017-03-28
     • words: 2245
     • flesch: 51
     • summary: The results of this study showed that the effect of serratiopeptidase as adjuvant therapy for acne treatment result in a significant rapid improvement, this might be explained by serratiopeptidase ability in enhancing antibiotic efficacy and also increase the possibility of excellent improvement in acne appearance which may be due of it’s anti-inflammatory, anti-edemic. (13) After 12 months ( at end of clinical trial ) there is no significant difference between the 2 groups , this simply can be explained by the short period ( only one month ) usage of serratiopeptidase , however additional studies on large scale and for longer period of time are needed to confirm the benefit of addition of serratiopeptidase to acne treatment.
     • keywords: acne; anti; bad; baghdad; cases; chronic; common; control; danzen; difference; edemic; excellent; group; improvement; inflammation; inflammatory; iraqi; mild; moderate; number; patients; period; pharm; pilosebaceous; presentation; rapid; sci; serratiopeptidase; significant; study; table; therapy; treatment; vol.21(1; vulgaris; weeks; إَضٌى; انسٍشاذٕتثراٌذٌض; انشثاب
     • versions: original; plain text
309. bijps-445
     • author: H. Mutlag, Shihab
     • title: Dose Dependent Anti-inflammatory Effect of Ammi majus Alcoholic Extract in Rat: Chronic Study
     • date: 2017-03-28
     • words: 3012
     • flesch: 51
     • summary: Ammi majus alcoholic extract (2mg , 4 mg and 8mg/rat) showed no effect on paw thickness compared to other test groups .The anti- inflammatory effect of Ammi majus alcoholic extract may be explained by the many active constituents of the extract : 1(quercetin), which is the most common flavoniod that scavenger both reactive oxygen species (ROS) and reactive nitrogen species (RNS). In conclusion, Ammi majus alcoholic extract possess anti-inflammatory activity in animals model of chronic inflammation and the effect increased with increasing the dose.
     • keywords: 32mg; activity; alcoholic; alcoholic extract; ammi; ammi majus; angelica; animals; anti; antiinflammatory; cells; chronic; chronic inflammation; control; coumarins; cytokine; days; dose; edema; effect; extract; factor; formalin; groups; immunol; imperatorin; increase; induction; inflammation; inflammatory; inhibition; iraqi; kinase; majus; majus alcoholic; mean; mediators; model; n=6; normal; p<0.05; paw; pharm; pharmacol; piroxicam; process; production; rat; rats; reactive; release; response; sci; significant; species; standard; study; test; thickness; tissue; treatment; vol.21(1; االنرٓاب; االنرٓاتاخ; انشٛطاَّٛ; انعالض; ذؤشٛش
     • versions: original; plain text
310. bijps-446
     • author: M. Mohammed, Shaimaa; A. Amin, Inaam; Z. Sabri, Zeina
     • title: Nitric Oxide, Peroxynitrite and Malondialdehyde Levels as Markers for Nitrosative/Oxidative Stress in Iraqi Patients with Systemic Lupus Erythematosus
     • date: 2017-03-28
     • words: 3817
     • flesch: 58
     • summary: Serum nitric oxide levels were significantly elevated in SLE patients (mean + SE 263.58 + 35.42 mol/L) as compared with healthy control (162.48 +10.42 mol/L). The study findings support an association between nitrosative/oxidative stress and SLE through elevated level of NO, peroxynitrite and MDA in the serum of SLE patients.
     • keywords: acid; activity; ali; autoimmune; autoimmunity; cell; college; controls; damage; disease; dna; elevated; erythematosus; formation; free; function; group; hand; healthy; iraqi; level; lipid; lupus; lupus erythematosus; malondialdehyde; markers; mda; mean; method; min; nitric; nitric oxide; nitrogen; nitrosative; nmol; onoo; oxidative; oxidative stress; oxide; oxygen; pathogenesis; patients; peroxidation; peroxynitrite; pharm; potential; production; proteins; radical; reactive; response; rheumatology; role; sci; serum; sle; sle patients; species; stress; study; synthase; systemic; systemic lupus; table; van; vol.21(1; األصحاء; اٌذ٘ا٠ذ; اٌزئب; حشو١ض; داء; ٔا٠خشا٠ج; mol
     • versions: original; plain text
311. bijps-447
     • author: Y. Muttalib, Lana; M. Naqishbandi, Alaadin
     • title: Antibacterial and Phytochemical Study of Iraqi Salvia officinalis Leave Extracts
     • date: 2017-03-28
     • words: 2968
     • flesch: 52
     • summary: Tannin test: A few drops of ferric chloride reagent 1% were added to 1ml of sage extract. Saponin test: A volume of 2ml of hydroalcoholic sage extract were shaken with 1ml of water.
     • keywords: 100mg; 1ml; acetate; acid; active; activity; agar; antibacterial; aureus; chloroform; color; condensed; constituents; drops; essential; ethanol; ethyl; extract; flavonoid; formic; groups; herbal; hydroalcoholic; identification; iraqi; layer; leaves; main; method; mobile; natural; officinalis; pharm; phase; phytochemical; plant; plate; presence; product; proteus; sage; salvia; saponin; sci; screening; separation; solution; spp; staphylococcus; strains; study; test; thujone; tlc; toluen; value; vol.21(1
     • versions: original; plain text
312. bijps-448
     • author: A. Ameen, Husam; J. Qasir, Ahlam
     • title: Synthesis and Preliminary Antimicrobial Study of 2-Amino-5-Mercapto-1,3,4-Thiadiazole Derivatives
     • date: 2017-03-28
     • words: 3587
     • flesch: 58
     • summary: Synthesis, characterization and biological activity of schiff base analogue of indole-3- Iraqi J Pharm Sci, Vol.21(1) 2012 Synthesis of thiadiazole derivatives 104 carboxaldehyde. Iraqi J Pharm Sci, Vol.21(1) 2012 Synthesis of thiadiazole derivatives 98 Synthesis and Preliminary Antimicrobial Study of 2-Amino-5- Mercapto-1,3,4-Thiadiazole Derivatives Husam A. Ameen* and Ahlam J. Qasir *,1 *Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq ** Ibn-Zuhr Hospital ,Ministry of Health ,Baghdad, Iraq.
     • keywords: 1,3,4; acetate; activities; activity; agents; analysis; antibacterial; antifungal; antimicrobial; appearance; aromatic; bacteria; baghdad; base; bending; biological; ch3; chem; compound; data; derivatives; disc; elemental; ethanol; ethyl; fungi; iii; iraqi; journal; med; melting; mixture; mmole; moiety; new; percentage; pharm; physical; point; primary; reaction; results; ring; schiff; sci; solution; stirring; stretching; stretching vibration; synthesis; synthesized; table; thiadiazole; thiadiazole derivatives; thiol; university; values; vibration; vol.21(1; water; yield
     • versions: original; plain text
313. bijps-449
     • author: K. Mohammed Salih, Raya; M. Al-Gharawi, Ali; I. Al-Lehibi, Khalid
     • title: The Correlation Between Hyperglycemia and Rheumatoid Factor in Type 2 Diabetic Patients in Al- Risafa Area, Baghdad
     • date: 2017-03-28
     • words: 5394
     • flesch: 69
     • summary: While the number and percentage of RF positive subjects out of healthy control are only 3 (4.3%), 1(33.33%) male and 2(66.66%) females, respectively. يٙه يٕل نكم نرش 5.2≤ تذٌٔ سٛطشج ى انؼًم انشث %( أكثش 3563 ،
     • keywords: age; agglutination; arthritis; baghdad; bmi; care; chronic; class; clin; comparison; control; diabetes; diabetic; diabetic patients; diseases; distribution; dm patients; factor; female; fpg; glucose; groups; healthy; highest; hyperglycemia; important; index; inflammatory; insulin; iraqi; iu/; level; mass; mellitus; mmol; negative; niddm; non; normal; number; obese; overweight; patients; percent; percentage; pharm; plasma; positive; prevalence; pro; resistance; results; rf positive; rf titer; rheumatoid; rheumatoid arthritis; rheumatoid factor; risk; role; sci; serum; significant; smokers; smoking; study; subjects; t2 dm; table; test; titer; total; type; value; vol.21(1; years; أظٓش; انسكش٘; انشث; انؼايم; اًن; دسجح; ٕاَٙ
     • versions: original; plain text
314. bijps-450
     • author: F. Al-Tukmagi, Haydar; Rasool M.Wayyes, Abdul
     • title: Prescribing Pattern and Rational use of Drugs in Maysan Governorate, Iraq
     • date: 2017-03-28
     • words: 2767
     • flesch: 58
     • summary: Total Average Percentage %of total Drugs %of AB in Rxs % of CS in Rxs % of anxiolytics in Rxs Results The prescribing indicators were calculated from each pharmacy and summarized in the table 2 in addition to the WHO standard value for each indicator (14) . In the present study, the percentage of drugs prescribed in generic names is 12% only, which is very low percentage compared with the WHO standard value that may reach 100%; this could be due to low training prescribers, no health education about the importance of restriction in drug use.
     • keywords: anxiolytics; average; baghdad; care; characteristics; clin; data; drugs; facilities; generic; governorate; guidelines; health; high; indicators; iraq; maysan; mean; misuse; number; organization; patient; pattern; percentage; pharmacies; pharmacol; pharmacy; physicians; prescribed; prescribing; prescription; problems; rational; rxs; sci; standard; study; table; use; value; vol.21(1; world; انًىصىفخ; انُسجخ
     • versions: original; plain text
315. bijps-451
     • author: B. H. Al-Khedairy, Eman
     • title: Effect of Additives on the Solubility and Dissolution of Piroxicam From Prepared Hard Gelatin Capsule
     • date: 2017-03-28
     • words: 3619
     • flesch: 61
     • summary: However, drugs with low solubility and high permeability fall into Biopharmaceutics Classification System (BCS) class II (1) for which the dissolution is usually the rate- limiting step for gastrointestinal absorption. The aim of this study was to determine the impact of simple physical mixing of piroxicam with different amount of starch, lactose, superdisintegrants including crospovidone, cross carmellose sodium, and sodium starch glycolate each alone on the solubility of drug in 0.1N HCl .In
     • keywords: addition; additives; capsules; ccs; combination; diluents; dispersion; dissolution; drug; effect; feldene; figure; gelatin; hcl; improvement; iraqi; lactose; medium; method; minutes; mixture; pfizer; pharm; physical; piroxicam; prepared; presence; profiles; rate; results; sci; similar; simple; sodium; solid; solubility; soluble; ssg; starch; study; superdisintegrants; table; time; type; vol.21(1; water
     • versions: original; plain text
316. bijps-452
     • author: A. Al-Dawaf, Rana; Y. Saour, Kawkab
     • title: Synthesis of Coumarin Derivatives Coupled to Amino Acid Esters and Studying their Biological Activity as Antimicrobial Agents
     • date: 2017-03-29
     • words: 3151
     • flesch: 64
     • summary: Key words: coumarin, amino acid, coumarin antimicrobialal activity. Iraqi J Pharm Sci, Vol.21(2) 2012 Coumarin derivatives coupled to amino acid esters 1 Synthesis of Coumarin Derivatives Coupled to Amino Acid Esters and Studying their Biological Activity as Antimicrobial Agents Rana A. Al-Dawaf *,1 and Kawkab Y. Saour** * Department of Pharmaceutical Chemistry,College of Pharmacy, Al-Mustansiriya University, Baghdad, Iraq **Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract A series of coumarin derivatives linked to amino acid ester side chains were synthesized and evaluated of their antibacterial and antifungal activity.
     • keywords: absorption; acid; activities; activity; amide; amino; antibacterial; antifungal; appearance; aromatic; bands; bend; ch2; ch3; characteristics; chloroform; compound; coumarin; coupling; derivatives; ester; formation; hcl; hobt; hymecromone; iraqi; m.p; methanol; method; methyl; percent; pharm; physical; sci; solution; spp; standard; str; synthesis; table; values; vol.21(2; white; yield
     • versions: original; plain text
317. bijps-453
     • author: K. Abdul-Wahab, Farah; Z. Abdul Jalil, Thukaa
     • title: Study of Iraqi Spinach Leaves (Phytochemical and Protective Effects Against methotrexate-Induced hepatotoxicity in rats)
     • date: 2017-03-29
     • words: 4555
     • flesch: 57
     • summary: This study was concerned with extraction of compounds in Iraqi spinach leaves, preliminary phytochemical evaluation, identification of two biological important flavonols, quercetin and kaempferol in spinach leaves and evaluation of the protective effect of aqueous spinach extract on methotrexate (MTX) induced hepatotoxicity in rats. The rats were divided into three groups as control, MTX group following a single dose of MTX (20 mg/kg, i.p) saline was administered for 5 days and the MTX+aqueous spinach extract group were rats received 200mg/kg orally of aqueous spinach extract 7days before and 5 days after MTX treatment.
     • keywords: 1ml; acid; alp; analysis; antioxidant; aqueous; aqueous spinach; baghdad; cell; chloroform; color; compounds; control; damage; days; effects; evaluation; extract; extraction; figure; fixed; flavonoids; glycosides; group; gsh; hepatotoxicity; hours; hplc; identification; injury; iraqi; iraqi spinach; kaempferol; leaves; level; liver; mda; methotrexate; mtx; oleracea; orange; oxidative; percentage; peroxidation; pharm; phenolic; phytochemical; plant; preliminary; presence; protective; quercetin; rats; results; saponins; sci; significant; solution; spinach; spinach extract; spinach leaves; spinacia; standard; studies; study; table; tannins; temperature; test; tissue; tlc; vol.21(2; water; انسببَغ; انًبئٙ
     • versions: original; plain text
318. bijps-454
     • author: T. Flayyih, May; Q. Majeed, Raghad
     • title: The Effects of Aloe vera Gel, Sesame Oil and Camphor Oil on Pseudomonas aeruginosa Isolated from Burnt Patients
     • date: 2017-03-29
     • words: 3503
     • flesch: 57
     • summary: Iraqi J Pharm Sci, Vol.21(2) 2012 Aloe vera gel,sesame oil &camphor oil &Pseudomonas aeruginosa 18 The Effects of Aloe vera Gel, Sesame Oil and Camphor Oil on Pseudomonas aeruginosa Isolated from Burnt Patients May T. Flayyih* ,1 and Raghad Q. Majeed* *Department of Biology, College of Science, University of Baghdad ,Baghdad, Iraq Abstract Three isolates of P. aeruginosa were isolated from burnt patients. Ciprofloxacin and Amikacin were found effective against P. aeruginosa isolates with MIC values of 3.8 μg/ ml for Ciprofloxacin and 0.244 μg/ ml for Amikacin The antibacterial effect of Different concentrations of Aloe vera gel, Sesame Oil and Camphor Oil against P. aeruginosa were determined, Camphor was highly effective with Concentration inhibit bacteria value of 10% followed by Sesame Oil (20%) and Aloe vera gel (>75%).
     • keywords: 2ml; activity; adherence; aeruginosa; agar; agents; aloe; aloe vera; amikacin; antibacterial; antibiotics; antimicrobial; broth; burn; camphor; camphor oil; ciprofloxacin; combination; concentrations; contents; different; effect; effective; essential; formation; gel; gram; growth; inhibit; iraqi; isolates; mic; mics; oil; oils; p.aeroginosa; patients; pharm; presence; pseudomonas; result; sci; sensitivity; sesame oil; skin; slime; standard; sterile; sub; surface; table; test; tube; vera; vera gel; vol.21(2; μg/; انعشالث
     • versions: original; plain text
319. bijps-455
     • author: A. Sadon, Ahmed; J. Qasir, Ahlam
     • title: Design and Synthesis of Some Nitrate Derivatives of Mefenamic Acid with Expected Nitric Oxide Release
     • date: 2017-03-29
     • words: 3657
     • flesch: 54
     • summary: Nitrate derivatives of mefenamic acid 29 Compound 4 3308 3059 2931 2856 1747, 1705 1639 1583 1516 1276 1224 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound 5 3275 3055 2929 2856 1745, 1710 1631 1581 1514 1265 1224 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound I 3286 3061 2931 2856 1747, 1710 1635 1581 1516 1278 1226 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester Overlapped C=O stretching of 2º amide (amide I) and N=O asymmetrical stretching of nitrate N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound II 3277 3059 2929 2854 1745, 1714 1637 1579 1512 1278 1226 N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester Overlapped C=O stretching of 2º amide (amide I) and N=O asymmetrical stretching of nitrate N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester References 1. Compound Band (cm -1 ) Interpretation Compound 1 2500-3300 1751 1585, 1504 1261 Asymmetrical and symmetrical NH3 + stretching C=O stretching of ester Asymmetrical and symmetrical bending of NH3 + Asymmetrical C-O stretching of ester Compound 2 3377 3311 3063, 3037 2931 2856 1749 1629 1581 1510 1276 1228 N-H stretching of 2º aromatic amine N-H stretching of 2º amide Aromatic C-H stretching Asymmetrical C-H stretching of CH3 and CH2 Symmetrical C-H stretching of CH3 and CH2 C=O stretching of ester C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of ester Compound 3 3423 3367 2750-3200 3034 2937 1741, 1707 1626 1579 1512 1278 1211 N-H stretching of 2º aromatic amine N-H stretching of 2º amide OH stretching of carboxyl group Aromatic C-H stretching Asymmetrical C-H stretching of CH2 C=O stretching of acid C=O stretching of 2º amide (amide I) N-H bending of 2º amide (amide II) N-H bending of 2º aromatic amine C-N stretching of 2º aromatic amine Asymmetrical C-O stretching of acid Iraqi J Pharm Sci, Vol.21(2) 2012
     • keywords: 2º amide; 2º aromatic; acetate; acid; amide; amino; appearance; aromatic; asymmetrical; bands; bending; ch2; ch3; characteristic; compound; dcc; derivatives; drugs; ester; gastrointestinal; glycine; h bending; h n; iraqi; mefenamic; melting; mixture; mmol; nitrate; nitric; o o; oxide; percent; pharm; physical; point; sci; solution; stirred; stretching; synthesis; table; vacuum; value; vol.21(2; water; yield
     • versions: original; plain text
320. bijps-456
     • author: K. Saleh, Shafaq
     • title: Misuse of appetite- stimulant drugs in Babylon#
     • date: 2017-03-29
     • words: 1961
     • flesch: 59
     • summary: Misuse of appetite-stimulant drugs in Babylon 31 Misuse of appetite- stimulant drugs in Babylon # Shafaq K. Saleh* ,1 *Babylon University , College of Pharmacy, Babel, Iraq Abstract Drug misuse is defined as using of drugs for a non-therapeutic or non-medical purpose. Appetite- stimulant drugs are example of drugs that are widely used without a prescription.
     • keywords: age; appetite; appetitestimulant; babylon; body; cyproheptadine; daily; day; different; drugs; effects; females; figure; forms; health; iraq; medical; misuse; old; physician; prescription; reason; results; sci; steroids; stimulant; study; subjects; type; vol.21(2; weight; years; األدويخ; اسزؼَبه; ثبثو; هزٓ
     • versions: original; plain text
321. bijps-457
     • author: S. Khamis, Ammar; H. Ali, Shatha; I. Al-Lehibi, Khalid
     • title: The Correlation between Serum Total Adiponectin and Hemoglobin in Type 2 Diabetic Patients without Microalbuminuria
     • date: 2017-03-29
     • words: 3978
     • flesch: 57
     • summary: In conclusion, anemia could be associated with a marked elevation in serum total adiponectin levels of diabetic patients without a detectable nephropathy (-ve microalbuminuria). In all 42 patients with type 2 diabetes, serum total adiponectin levels were correlated positively with serum creatinine and age, whereas, negative correlations were found with Hb.
     • keywords: adiponectin; adipose; analysis; anemic; anemic type; association; blood; cardiovascular; clinical; concentrations; control; correlation; creatinine; data; diabetes; diabetic; diabetic patients; difference; disease; expression; ferritin; group; hemoglobin; high; hmw; hypoxia; increase; insulin; iraqi; iron; levels; lipid; liver; lower; male; mean; metabolic; microalbuminuria; molecular; nephropathy; non; non anemic; patients; pharm; plasma; production; protein; resistance; risk; sci; serum; serum total; significant; study; subjects; table; tissue; total; total adiponectin; type; urea; values; vol.21(2; women; انذو; انسكشٌ; انًسحىي; انًصهٍ; نألدَبىَكحٍُ
     • versions: original; plain text
322. bijps-458
     • author: Y. Saour, Kawkab; I. Al-Bayati, Ridha; K. Hadi, Mohammed
     • title: Synthesis of New Coumarin and 2-quinolone Derivatives with Expected Biological Activities
     • date: 2017-03-29
     • words: 4009
     • flesch: 55
     • summary: Novel coumarin derivatives with expected biological activity. 50 µg/ml compound 10 showed significant activity against Staphylococcus aureus.
     • keywords: 120µg; 2µg; 50µg; absorption; acid; activity; agents; antimicrobial; appearance; aureus; bands; car; characteristics; charo; chemistry; chloride; chloroform; compounds; coumarin; derivatives; different; elemental; ethanol; final; heterocyclic; inhibition; iraqi; journal; melting; methyl-2; mixture; new; novel; o str; oxoquinolin-1(2h)-yl; percentage; pharm; physical; point; quinolone; reaction; sci; solution; str; sulfonamide; synthesis; synthesized; table; university; values; vol.21(2; water; yellow; yield
     • versions: original; plain text
323. bijps-459
     • author: MA. Naji, Zahraa; M.Mohammed, Shaimaa; F. Muhammad, Mays
     • title: Uric Acid as a Natural Scavenger of Peroxynitrite in a Sample of Iraqi Patients with Rheumatoid Arthritis
     • date: 2017-03-29
     • words: 3511
     • flesch: 55
     • summary: NO levels in patients group 163.7±23.6 (mean±SE) µmol/l as compared with control subjects 164.3±9.22 (mean ±SE) µmol/L,( P>0.05) ,while there was significant increase in serum levels of peroxynitrite in patients group as compared with control subjects 8.71±1.16 (mean±SE) µmol/l,(0.53±0.04) (mean±SE) µmol/l respectively ,(P <0.05) .There was non- significant increase in serum levels of MDA in RA patients group 4.76 ±0.31 (mean±SE) nmol/ml as compared with control subjects 4.01 ±0.47 (mean±SE) nmol/ml, (P >0.05) Altered uric acid levels and disease states .
     • keywords: acid; activity; age; antioxidant; arthritis; baghdad; blood; chronic; control; damage; decrease; disease; et al; free; group; healthy; human; increase; inflammation; inflammatory; iraqi; levels; lipid; malondialdehyde; mda; mean; mean±se; natural; nitration; nitric; oxidative; oxide; oxygen; patients; peroxidation; peroxynitrite; pharm; plasma; production; radicals; range; rate; reactive; rheumatoid; rheumatoid arthritis; role; scavenger; sci; sedimentation; serum; significant; species; status; stress; study; subjects; superoxide; uric; uric acid; van; vol.21(2; years; اىذساست; اىَشظٚ; اىٞ٘سٝل; ىذٙ; ٍعذالث
     • versions: original; plain text
324. bijps-460
     • author: R. Abdullah, Ijlal; J. Al-Shamma, Kassim; N. Al-Hassany, Ansam
     • title: Investigation and Comparative Study Among Various Methods of Contraception Used in Erbil City
     • date: 2017-03-29
     • words: 4297
     • flesch: 62
     • summary: %(، اِا اٌطش٠مح االدٔٝ لثٛال فمذ وأد اٌذمٓ د٠ث١ِٛذسٚوس14.4ٟ%( . اِا تإٌسثح ٌٍٕضف اٌشذ٠ذ ٚإٌضف اٌّرمطغ ٚاٌؼذٜٚ ا ..11% ( ٚ ) 30.1د٠ثِٛذسٚوسٟ تشٚجسرشْٚ ) % ( ػٍٝ اٌرٛاٌٟ .
     • keywords: acetate; adherence; adverse; available; azadi; baghdad; city; clinical; cocs; combined; compatible; compliance; condom; contraceptive; copper; data; different; dmpa; duration; effects; efficacy; failure; family; group; hawler; health; higher; highest; hormonal; infection; intrauterine; iraqi; iucd; lowest; male; menstrual; methods; months; number; occp; oral; percentage; pharm; pill; planning; rate; results; sci; spermicides; studies; study; subjects; table; users; vaginal; vol.21(2; weight; women; years; است١ً; اٌذًّ; اٌطش٠مح; إٌرائج; اِشأج; ت١ٓ; فمذ; ِٕغ
     • versions: original; plain text
325. bijps-462
     • author: J.Nasser, Saddam; H. Sameen, Laith; M.Ghareeb, Mowafaq
     • title: Preparation and Evaluation of Oral Disintegrating Tablets of Ketoprofen by Dirct Compression
     • date: 2017-03-29
     • words: 2993
     • flesch: 52
     • summary: Good F4 31.71±0.62 29.87±0.76 Good F5 29.83±0.28 31.60±1.27 Passable F6 27.83±0.28 32.86±1.24 Passable F7 33.20±0.14 30.73±1.51 Passable F8 33.21±0.18 32.45±0.72 Passable F9 33.61±0.34 29.42±0.76 Good F10 35.70±0.81 32.00±1.92 Passable F11 35.12±0.82 26.45±0.40 Good F12 37.43±0.98 28.00±3.43 Good Iraqi J Pharm Sci, Vol.21(2) 2012 Ketoprofen oral disintegrating tablets 67 Table 3.:Post compression parameters of prepared ketoprofen orodispersible tablets Formula Code Hardness (Kg/cm²) The result in vitro disintegration time indicated that formula (F1) has shortest disintegration time this decrease in the disintegration time may be attributed to the increasing porosity of the tablet so that the porous hydrophilic matrix will easily pick up the disintegration medium and thus facilitating the wicking action of the superdisintegrant and bringing about rapid tablet disintegration and shorter wetting time (17) .
     • keywords: absorption; angle; british; ccs; compliance; compression; content; conventional; different; direct; disintegration; dissolution; dissolving; dosage; drug; evaluation; f11; fast; forms; formula; formulation; friability; good; hardness; international; iraqi; journal; ketoprofen; medium; method; mouth; oral; orodispersible; parameters; passable; patel; pharm; pharmacopoeia; powder; prepared; properties; rapid; repose; sci; sodium; subliming; superdisintegrants; tablets; technique; time; vol.21(2; water; weight; wetting
     • versions: original; plain text
326. bijps-463
     • author: M. Al-Temimi, Hassan; j.Al-Shamma, Kassim; M.Alrubaie, Salim
     • title: Evaluation of Metformin + Sitagliptin versus Metformin + Glibenclamide on Glycemic Control in Iraqis Type 2 Diabetic Patients
     • date: 2017-03-29
     • words: 4954
     • flesch: 63
     • summary: In conclusion , the combination of metformin + sitagliptin improved fasting plasma glucose , postprandial plasma glucose & HbA1c % in comparison with metformin + glibenclamide combination. The aim of this study is to evaluate effects of combination of metformin + sitagliptin versus the effects of combination of metformin + glibenclamide on fasting plasma glucose, postprandial plasma glucose and HbA1c percentage in Iraqis type 2 diabetic patients.
     • keywords: baghdad; blood; care; cell; clinical; combination; comparison; control; daily; diabetes; diabetic; difference; dipeptidyl; disease; drugs; effect; engl; fasting; fpg; glibenclamide; glucagon; glucose; glycemic; group; hba1c; healthy; increase; individuals; inhibitor; insulin; iraqi; levels; like; lower; mean; med; mellitus; metab; metformin; months; normal; oral; patients; peptide; pharm; plasma; plasma glucose; postprandial; ppg; reading; results; sci; secretion; significant; sitagliptin; study; sulfonylurea; sus; therapy; times; times daily; treatment; type; use; values; vol.21(2; إنى; انًعًىعح; تانذو; تانُسثح; تغذاد; َسثح
     • versions: original; plain text
327. bijps-464
     • author: M. Ali, Huda; A. Al-Zubaidi, Mohammed
     • title: Evaluation of Trace Elements in Iraqi Patients with Rheumatoid Arthritis by using Atomic Absorption Spectrophotometer (AAS)
     • date: 2017-03-29
     • words: 4925
     • flesch: 50
     • summary: Figure1: Mean serum trace elements level (ng/ml) among the studied groups Figure 2: Mean serum trace elements level (ng/ml) among the studied groups Se Cr Mn Ni V Co Ge Table 1: Serum trace elements concentration in patients with rheumatoid arthritis and healthy control group in serum (ng/ml) *.
     • keywords: absorption; anemia; antioxidant; arthritis; atomic; blood; body; bone; cell; chromium; clinical; cobalt; concentration; control; copper; damage; data; decrease; deficiency; development; difference; disease; effect; elements; enzyme; essential; factor; female; figure; formation; free; function; germanium; group; growth; health; high; histogram; human; immune; important; inflammatory; iraqi; iron; levels; magnesium; manganese; mean; metabolism; necessary; nickel; oxidative; p<0.001; patients; people; pharm; production; results; rheumatoid; rheumatoid arthritis; role; sci; selenium; sera; serum; significant; spectrophotometer; studies; study; system; table; trace; trace elements; values; vanadium; vitamin; vol.21(2; zinc; اىعْاصش
     • versions: original; plain text
328. bijps-465
     • author: R. Abd Ali, Abeer; H. Ismail, Sajida
     • title: The Protective Effect of Honey Against Amikacin- induced Nephrotoxicity in Rats
     • date: 2017-03-29
     • words: 4512
     • flesch: 53
     • summary: The elevation of GSH levels in the serum of group 3, and decrease of MDA levels in comparison with group 2, attributed to the free-radical scavenging properties of the honey where it help in maintaining the levels of reduce glutathione and MDA. This study showed that amikacin causes nephrotoxicity represented by elevation of serum level of creatinine and urea, MDA and a decrease in the serum glutathione level.
     • keywords: acid; activity; amikacin; aminoglycoside; animals; antibiotics; antioxidant; arrow; baghdad; cell; combination; control; corresponding; creatinine; damage; day; decrease; dose; effect; elevation; figure; free; gentamicin; glutathione; group; gsh; honey; i.p; increase; induced; injury; iraqi; journal; kg/; kidney; levels; lipid; mda; necrosis; nephrotoxicity; normal; oxidative; oxygen; p<0.05; peroxidation; pharm; protective; protective effect; proximal; radical; rats; reactive; renal; results; samples; sci; serum; serum creatinine; serum levels; significant; species; stress; structure; study; table; tubules; urea; vol.21(2; x±sd; العسل; الكلْٕ
     • versions: original; plain text
329. bijps-466
     • author: J.Al-faris, Omar; N. Al-Shawi, Nada; D. Kako, Maha
     • title: Possible Cardiac Adverse Effects Induced by Therapeutic Doses of Ciprofloxacin in Juvenile Rats
     • date: 2017-03-29
     • words: 2403
     • flesch: 53
     • summary: A 425.66±234.16* C 4030.33±228 *C Iraqi J Pharm Sci, Vol.21(2) 2012 Possible cardiac Adverse effects of ciprofloxacin 97 compared to control juvenile rats. Evaluation of ciprofloxacin-induced adverse cardiac effect in juvenile rats Iraqi J Pharm Sci, Vol.21(2) 2012 Possible cardiac Adverse effects of ciprofloxacin 94 Possible Cardiac Adverse Effects Induced by Therapeutic Doses of Ciprofloxacin in Juvenile Rats # Omar J.Al-faris * , Nada N. Al-Shawi **,1 and Maha D. Kako *** * Department of Clinical Pharmacology, College of Pharmacy, University of Mosul, Mosul,Iraq.
     • keywords: 25mg; 50mg; activity; adverse; alt; aminotransferase; animals; ast; baghdad; cardiac; ciprofloxacin; clinical; college; control; damage; doses; effects; elevation; enzymes; fqs; group; heart; histological; i.p; iii; juvenile; juvenile rats; ldh; mosul; p<0.05; pharmacology; pharmacy; possible; rats; results; sci; serum; significant; study; table; therapeutic; toxicity; university; vol.21(2; week
     • versions: original; plain text
330. bijps-467
     • author: K. Ali Allah, Ali; N. Abd-Al Hammid, Shaimaa
     • title: Preparation and Evaluation of Chloramphenicol as Thermosensitive Ocular in- situ Gel
     • date: 2017-03-29
     • words: 4167
     • flesch: 57
     • summary: Chloramphenicol ocular in situ gel 98 Preparation and Evaluation of Chloramphenicol as Thermosensitive Ocular in- situ Gel Ali K. Ali Allah*, Shaimaa N. Abd-Al Hammid** ,1 * Ministry of health, Al-Hashimmia Hospital, Babel, Iraq **Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract The purpose of this study was to develop poloxamer-based in-situ gel of chloramphenicol aiming to increase bioavailability and prolong corneal contact time, controlling drug release, and enhancing ocular bioavailability. Then, carbopol would be in an extended configuration and form strong three- dimensional networks, therefore, F3 possess stronger gel structure and this will cause more retardation for drug release (28) .
     • keywords: 100ml; aqueous; bioavailability; carbopol; case; chloramphenicol; chloride; concentration; corneal; delivery; different; diffusion; dissolution; drug; evaluation; eye; f127; figure; fluid; formulas; formulations; gel; gelation; gels; hpmc; increase; int; iraqi; isotonicity; kinetic; lower; medium; membrane; micelles; ocular; ophthalmic; order; period; pharm; phosphate; pluronic; poloxamer; polymers; prepared; properties; q.s; rate; release; rheological; rpm; sci; situ; situ gel; sol; solutions; studies; study; systems; table; tear; temperature; test; time; transition; values; viscosity; vol.21(2; volume; انى; انًبدة; دسجت
     • versions: original; plain text
331. bijps-468
     • author: N. Abed, Haithem; A. Abdulrasool, Alaa; M. Ghareeb, Mowafaq
     • title: Controlled Release Floating Matrix Tablet of Captopril
     • date: 2017-03-29
     • words: 4590
     • flesch: 59
     • summary: Streubel A., Siepmann J., Bodmeier R., Floating matrix tablets based on low density foam powder: effects of formulation and processing parameters on drug release, Eur. .Various attempts have been made to develop floating systems to control drug release; among them is the so called hydrodynamically balanced system (13, 14) .Such
     • keywords: 0.1n; 37ºc; agent; angle; best; captopril; compressibility; compression; content; control; conventional; delivery; density; different; direct; dissolution; dosage; drug; drug release; effect; effervescent; evaluation; f11; f12; f13; figure; final; formation; formula; friability; gastric; granulation; hardness; hcl; hpmc; index; iraqi; kinetic; korsmeyer; log; matrix; mechanism; method; model; oral; order; parameters; pectin; peppas; pharm; polymer; powder; prepared; profile; rate; ratio; release; repose; results; sci; scmc; study; system; tablet; technique; time; time(min; uniformity; value; vol.20(2; volume; wet
     • versions: original; plain text
332. bijps-469
     • author: A.H. Dakhel, Zainab
     • title: Synthesis of 5-Fluorouracil Derivatives as Possible Mutual Prodrugs with Meloxicam and Ibuprofen for Targeting Cancer Tissues
     • date: 2017-03-29
     • words: 3963
     • flesch: 62
     • summary: Synthesis of compound V: (11, 12) To a stirred solution of compound Vd (0.28 gm, 0.498 mmol) in dry chloroform (20 ml) at −20 o C, a suspension of compound Vb (0.190 gm, 0.498 mmol) in dry chloroform (20 ml) was added drop wise, then a solution of triethylamine (0.0504 gm, 0.498 mmol) in dry chloroform(20 ml) was added drop wise into the reaction mixture with continuous stirring at the same temperature, then the same procedure of compound II was carried out to give brown crystals of compound V. Percent yield (40.42%), melting point 124-126 o C. The structure of the final compounds and their intermediates were confirmed by their melting points, infrared spectroscopy and elemental microanalysis, the hydrolysis of compound III was studied using HPLC technique.
     • keywords: acetonitrile; amide; analysis; buffer; cancer; chemistry; chloroform; chn; compound; data; drop; dry; dry chloroform; group; hplc; hydrolysis; iii; iraqi; material; melting; mixture; mmol; mutual; night; nsaids; oily; organic; percent; pharm; point; prodrug; reaction; room; sci; sodium; solution; stirred; stock; stretching; suspension; synthesis; temperature; vacuum; vibration; vol.20(2; v∕v; wise; yield; −20
     • versions: original; plain text
333. bijps-470
     • author: I. Khalil, Yehia; H. Khasraghi, Abeer; J. Mohammed, Entidhar
     • title: Preparation and Evaluation of Physical and, Rheological Properties of Clotrimazole Emulgel
     • date: 2017-03-29
     • words: 5375
     • flesch: 62
     • summary: Table 1 : Compositions of different formulas of clotrimazole emulgel ( % w/w) . Figure 5 : The effect of paraffin concentration on the release of clotrimazole 1`% w/w from carbopol 934 emulgel at pH 5.5 and 37 °C ( Mean ± SD , n=3) Figure 6 : The effect of paraffin concentration on the release of clotrimazole 1`% w/w from methyl cellulose emulgel at pH 5.5 and 37 °C.
     • keywords: 1`%; agents; antifungal; aqueous; available; base; behaviour; canestin; carbopol; cellulose; clotrimazole; clotrimazole emulgel; company; concentration; consistency; cream; different; diffusion; drug; edition; effect; emulgel; emulsion; evaluation; f10; figure; formulas; formulations; germany; high; higuchi; increase; iraqi; liquid; low; m.c; mean; methyl; methyl cellulose; miconazole; n=3; nitrate; oil; paraffin; pharm; pharmaceutical; pharmacy; phase; physical; preparations; prepared; properties; rate; release; results; rheological; rpm; sci; shear; significant; skin; span; structure; table; topical; treatment; tween; type; viscosity; vol.20(2; water; مسذوم
     • versions: original; plain text
334. bijps-471
     • author: M.T. Al-Bashir, Nada
     • title: Poly Acrylamide Gel Electrophoresis of Serum Protein, Application to Kala-azar Patients
     • date: 2017-03-29
     • words: 3561
     • flesch: 58
     • summary: Serum of control group showed the specific protein pattern with five protein bands, while serum protein profile in visceral leishmaniasis patients revealed three groups of electrophoretic banding patterns. , 50% showed twelve bands, 36.66% of the patients showed nine bands and 13.33% showed ten bands. Abstract Sera samples were collected from 60 children aged 4-60 months, all were clinically and serologically proven cases of visceral leishmaniasis, as well as from 10 healthy children, all were seronegative with no history of parasitic infection who serve as a control during the study.
     • keywords: 2002; abnormal; activation; albumin; antibody; azar; baghdad; bands; calibration; cases; children; clinical; complement; control; conventional; current; dalton; diagnosis; different; disease; donovani; electrophoresis; elisa; figure; gel; group; high; human; hyg; igg; igm; immunol; infection; iraqi; kala; leishmaniasis; levels; med; methods; molecular; normal; number; parasite; patients; patterns; pharm; presentation; profile; protein; relative; response; samples; sci; serum; serum protein; similarity; specific; studies; study; table; test; total; treatment; values; visceral; visceral leishmaniasis; vol.20(2; weights; ×10; ْذِ
     • versions: original; plain text
335. bijps-472
     • author: A. Kasim, Ali
     • title: Calcium, Magnesium and Phosphorous Levels in Serum of Iraqi Women with Fibromyalgia
     • date: 2017-03-29
     • words: 2176
     • flesch: 54
     • summary: 8/10/2011 Iraqi J Pharm Sci, Vol.20(2) 2011 Fibromyalgia in Iraqi women 35 Higher concentrations of phosphodiesterase (PDE) products and inorganic phosphate (Pi) have been observed in FM patients in comparison to controls (19) , together with a decrease in phosphocreatine, ATP and phosphocreatine/inositol phosphate (IP) ratio in the quadriceps (20) .Within Also there is a significant increase in serum calcium level (P <0.05) in the FM group in respect to NHI group.
     • keywords: activity; arthritis; atp; baghdad; bennett; calcium; changes; chronic; clinical; compare; criteria; elements; energy; etiopathogenesis; fatigue; fibromyalgia; groups; healthy; inorganic; iraqi; level; magnesium; metabolism; muscle; nhi; normal; pain; patients; pharm; phosphorus; points; results; rheumatol; rheumatology; role; sci; serum; significant; study; symptoms; syndrome; system; tender; vol.20(2; women; اىفيبروٍيالخيا
     • versions: original; plain text
336. bijps-473
     • author: H. Altaie, Anmar
     • title: Association between Gallstones and Diabetics Type 2 Iraqi Patients
     • date: 2017-03-29
     • words: 3128
     • flesch: 66
     • summary: Certain exclusion criteria were followed to avoid interference of any other factors like drugs or pathological conditions with this research, which include: patients with history of gallstones and received previous therapy or undergoing treatment, patients with history of clinical disorders like hyperlipidemia, hepatic disorders and those taking medications other than prescribed for DM type 2. The mean ages of female patients having gallstones and DM type 2 was (56.2±9.24) years, is slightly higher (p<0.05) than the female controls having gallstones without diabetes (49.5±10.62) years while the mean ages of male patients having gallstones and DM type 2 was (58±10.5) years is significantly indifferent (p<0.05) from the male controls having gallstones without diabetes (58.2±10.88) years .
     • keywords: age; bile; bmi; cholesterol; controls; diabetes; diabetic; difference; disease; factors; female; figure; gallbladder; gallstones; gender; higher; incidence; iraqi; kg/; male; male patients; mean; mellitus; non; number; obesity; p<0.05; patients; pharm; results; risk; sci; significant; size; study; subjects; table; type; vol.20(2; years; الزٗي; السنشٕ; الوشاسة; الوصاب٘ي; ب٘ي; دصٔ; معٌ٘ت
     • versions: original; plain text
337. bijps-474
     • author: OM Saleh, Basil; N. H. Anbar, Zainab; Y. Majid, Ali
     • title: Serum Trace Elements (Zinc, Copper and Magnesium) Status in Iraqi Patients with Acne Vulgaris :( Case- Controlled Study)
     • date: 2017-03-29
     • words: 3385
     • flesch: 69
     • summary: Recently, Nasiri et al. in 2009 indicated that serum zinc levels in 30 Iranian acne patients were lower than that of 35 healthy controls; however, this difference was not significant (P= 0.32) (10) . Serum trace elements and acne vulgaris 46 Table 1: Clinical and biochemical data for healthy male controls, - mild, - moderate, and - severe types of acne vulgaris patients.
     • keywords: acne; baghdad; clinical; controls; copper; correlation; e ru; e s; elements; figure; group; healthy; iraqi; l e; levels; lower; m l; magnesium; male; mild; moderate; n=15; patients; pharm; results; sci; serum; serum levels; severe; severity; significant; skin; study; trace; type; vol.20(2; vulgaris; zinc; اىذساصخ; اىشجبة; اىْ٘ع; فئخ; ٍضز٘ٙ
     • versions: original; plain text
338. bijps-475
     • author: S. Saleh, Eman
     • title: The Correlation between Rheumatoid Factor, Chloroquine Phosphate in Osteoarthritis
     • date: 2017-03-29
     • words: 2582
     • flesch: 65
     • summary: Figure (1) show the level of RFs check only between control, all patients before treatment and after 2 months figure (2) show the level at RFs AGM for control, (69.23%) of total patients before and after using the drug. Figure (1) show the level of RFs check only between control(C) and all patients before treatment (P0) and after 2 months (P2) while figure (2) show the level at RFs AGM for control, (69.23%) of total patients before and after using the drug.
     • keywords: agent; agm; anti; antibodies; bone; cartilage; check; chloroquine; chronic; clinical; college; common; control; correlation; cqp; disease; dmoads; drugs; eds; effects; factor; figure; groups; igg; immune; inflammatory; iraqi; joints; knee; laboratory; level; medicine; months; non; osteoarthritis; patients; pharm; phosphate; rfs; rheumatoid; role; sci; serum; significant; study; synovial; total; treatment; vol.20(2; µ/ml; اىَزظٚ; ػيٚ; ْٕاك
     • versions: original; plain text
339. bijps-477
     • author: A. Merdaw, Maysoon
     • title: Postoperative Wound Infections and the Antimicrobial Susceptibility in Baghdad Hospitals
     • date: 2017-03-29
     • words: 3305
     • flesch: 47
     • summary: Our results appear to be maintained with strategies for preventing nosocomial infection,permanent education, strong application of protocols and urging the implementation of strict infection control policy. Key words: nosocomial infection, surgical wound, antimicrobial susceptibility.
     • keywords: 0.0; abdominal; acinetobacter; aeruginosa; agar; antimicrobial; aureus; baghdad; baumannii; care; coli; control; countries; days; enterococcus; escherichia; factors; hospital; hospitalization; imipenem; incidence; infections; iraqi; isolates; klebsiella; medical; microorganisms; mirabilis; mrsa; nosocomial; organisms; patients; pharm; pneumoniae; positive; postoperative; procedures; proteus; pseudomonas; resistance; results; risk; samples; sci; site; spp; staphylococcus; study; surgical; surveillance; susceptibility; swabs; table; testing; total; vancomycin; visa; vol.20(2; vrsa; wards; wound; نثكرسيا
     • versions: original; plain text
340. bijps-478
     • author: A. abdul khaleq, Maysaa; H. Abd, Abdulkareem; A. dhahi, Maysaa
     • title: Efficacy of Combination of Meropenem with Gentamicin, and Amikacin against Resistant E. coli Isolated from Patients with UTIs: in vitro Study
     • date: 2017-03-29
     • words: 4145
     • flesch: 59
     • summary: Figure 2: Percentage of resistant E. coli isolates to antimicrobial ToB: Tobramycin; CN: Gentamicin; Sxt: Triomethoprime and sulfamethoxazole; Cip: Ciprofloxacin; The percentage of resistant isolates to each antimicrobial is shown in Figure (2).Standard disc diffusion assay was used to detect the sensitivity of pathogenic bacteria and results obtained were compared with those of Clinical and laboratory standard institute (9) .The results of the current study (Figure 2) revealed that most of E. coli isolates resist the β- lactam antimicrobials (like ampicillin and amoxicillin) (10) .noted the high resistance rates of gram positive and gram negative species to penicillins and some of cephalosporins.
     • keywords: a37; a57; activity; agents; agreement; amikacin; aminoglycoside; amoxicillin; antimicrobials; bacteria; baghdad; clinical; coli; college; combination; concentration; current; dna; e. coli; effect; escherichia; fic; figure; gentamicin; gram; infection; inhibitory; iraqi; isolates; laboratory; lsd; meropenem; mic; microbiology; molecular; negative; percentage; pharm; plasmid; resistance; resistant e.; result; sci; spectrum; strains; study; susceptibility; syn; synergistic; table; tract; urinary; vol.20(2; weight; عضىت
     • versions: original; plain text
341. bijps-479
     • author: A. A. Al-Thanoon, Zeina; H. Mahmood, Isam
     • title: Effects of Losartan versus Enalapril on Serum Uric Acid Levels in Hypertensive Patients with Metabolic Syndrome
     • date: 2017-03-29
     • words: 3907
     • flesch: 51
     • summary: Comparison of uric acid levels between losartan group and enalapril group showed a significant reduction in the losartan group (P<0.001) as compared with the enalapril group (Table .5). It was reported that the risk of death due to ischemic heart disease increased by 77% (men), and by 30% (women) when serum uric acid levels where in the highest quartile (>416 µmol/l) compared with the lowest quartile (<321 µmol/l) (27) .
     • keywords: 0.001; acid; acid levels; blood; bmi; cardiovascular; cholesterol; comparison; concentration; control; disease; effects; elevated; enalapril; group; hdl; hypertensive; hyperuricemia; iii; insulin; iraqi; ldl; levels; losartan; markers; mean; metabolic; mmol; mosul; n=60; national; p<0.001; patients; pharm; pressure; renal; results; risk; sci; serum; serum uric; significant; study; sua; syndrome; table; test; therapy; total; treatment; tubular; uric; uric acid; vol.20(2; waist; انحايِط; انذو; يسخىي
     • versions: original; plain text
342. bijps-480
     • author: F. AL- Marjani, Mohammed; S. Khazaal, Saba; M. Zayer, Thana; A. Atahia, Yasir; A. Kadhim, Kadhim
     • title: The Prevalence of Microorganisms in H1N1 Patients Compared to Seasonal Influenza in a Sample of Iraqi Patients
     • date: 2017-03-29
     • words: 1887
     • flesch: 50
     • summary: Iraqi J Pharm Sci, Vol.20(2) 2011 Prevalence of microorganisms in H1N1 patients 81 The Prevalence of Microorganisms in H1N1 Patients Compared to Seasonal Influenza in a Sample of Iraqi Patients # Mohammed F. AL- Marjani * ,1 , Saba S. Khazaal * , Thana M. Zayer * , Yasir A. Atahia ** and Kadhim A. Kadhim *** *Department of Biology , College of Science , AL- Mustansiriya University,Baghdad , Iraq. Abstract This study provides valuable information on secondary microbial infections in H1N1 patients compared to Seasonal Influenza in Iraqi Patients.
     • keywords: aureus; bacterial; baghdad; cases; centers; community; control; disease; h1n1; healthy; infected; infection; influenza; iraq; microorganisms; novel; pandemic; patients; pneumonia; prevalence; prevention; seasonal; secondary; south; staphylococcus; streptococcus; subjects; swabs; swine; table; virus
     • versions: original; plain text
343. bijps-481
     • author: A.Mshiemish, Bahir
     • title: Role of the Clinical Pharmacist in Reducing Preventable Adverse Drug Events
     • date: 2017-03-29
     • words: 3976
     • flesch: 54
     • summary: Specialist physicians accepted (60) of (77) recommendations (i.e. do modifications in drug therapy depending on clinical pharmacist interventions). Role of clinical pharmacists interventions in detection and prevention of medication errors in a medical ward.
     • keywords: addition; ades; adverse; care; cause; clinical; clinical pharmacist; common; control; cost; drug; errors; events; frequency; group; health; hospital; identification; information; internal; interventions; iraqi; jama; leape; medical; medication; medicine; number; ordering; outcome; p>0.05; patient; pharmacist; pharmacy; physicians; prescribing; presence; preventable; problems; process; rate; recommendations; reduction; role; rounding; sci; significant; staff; stay; study; team; therapy; time; total; unit; use; vol.20(2; ward
     • versions: original; plain text
344. bijps-482
     • author: A. Razooki, Raghad; N. Saeed, Ebtihal; I. Omar Al-Deem, Hanan
     • title: Microbial Contamination of Eye Drops in out Patient in Iraq
     • date: 2017-03-29
     • words: 2857
     • flesch: 55
     • summary: This study aimed to determine the magnitude and pattern of microbial contamination of eye drops in out patient at the department of ophthalmology, at Baghdad national hospital, Iraq. Our data show acontamination rate of 15%, which is in the medium range of data puplished on the contamination of eye drops elsewhere (0.07% to 35.8%).
     • keywords: agar; antimicrobial; aureus; bacterial; baghdad; benzalkonium; blood; bottle; candida; chloride; clinical; colonies; containers; contaminated; contamination; dropper; drops; eye; eye drops; flora; gram; growth; infection; iraqi; media; medications; microbial; micrococcus; negative; neisseria; ocular; ophthalmic; organisms; patients; pharm; plates; potential; preservatives; rate; residual; results; risk; sci; solution; spp; staph; study; table; tip; tips; total; use; vials; vol.20(2
     • versions: original; plain text
345. bijps-483
     • author: A. Hasan, Hiba
     • title: Evaluation of the Relation between Asthma, Obesity and Leptin Level in Iraqi Asthmatic Patients and the Main Risk Factors that are Associated with Leptin Level
     • date: 2017-03-29
     • words: 3656
     • flesch: 61
     • summary: The lack of difference in leptin levels between asthmatic and healthy males could be a result either of a true modifying effect of sex on leptin or a small sample size to detect a difference (14) .The results also show that leptin level in female is higher than in male. Also it will work to indicate the main risk factors which play role in the elevation of leptin level within asthmatic patients.
     • keywords: age; association; asthmatic; asthmatic patients; bmi; body; clin; control; correlation; difference; elevation; endocrinol; factors; female; gender; healthy; higher; hip; index; iraqi; iraqi asthmatic; leptin; leptin level; level; linear; main; mass; menopausal; metab; method; obese; obesity; old; overweight; patients; pharm; postmenopausal; receptor; results; risk; role; sampling; sci; serum; significant; steroid; student; study; test; tissue; utilization; vol.20(2; waist; weight; women; years; اللبخ٘ي
     • versions: original; plain text
346. bijps-484
     • author: Y. Alhamdani, Fadya
     • title: Acquired Error in using Antibiotic for Surgery Patients in Iraqi Hospitals
     • date: 2017-03-29
     • words: 3075
     • flesch: 49
     • summary: The study shows that there are medication errors related to different causes: firstly, medical team error which include the nurse (70.9%) and the physician which include 1) delay in patient follow up after operation(5.9%) , 2) changing the AB without doing culture and sensitivity test (48.8%), and incomplete prescription order(13.1%). The aim of the present study was designed to evaluate the prevalence of medication errors of using AB after surgery, and to estimate the causes behind these error.
     • keywords: administration; adverse; american; antibiotic; antimicrobial; availability; care; city; clinical; common; contaminated; cost; delay; dispensing; drug; errors; events; factors; healing; health; hospitals; http://www.ncbi.nlm.nih.gov/pubmed?term=%22williams%20c%22%5bauthor%5d; incomplete; infection; information; iraqi; jama; journal; lack; medical; medication; medication errors; multiple; national; nurse; order; ordering; original; patients; percentage; pharmacists; pharmacy; physician; practice; prescribing; prescription; prophylaxis; results; right; sap; sci; source; study; surgery; surgical; system; team; type; use; vol.20(2; wound; انحٕٛٚح; انًضاداخ
     • versions: original; plain text
347. bijps-485
     • author: A. Abbass, Shaima; H. Ali, Shatha
     • title: The Beneficial Role of Some Bone Markers in Evaluating Women with Osteoporosis under Different Therapeutic Regimens
     • date: 2017-03-29
     • words: 4238
     • flesch: 57
     • summary: Bone markers in osteoporosis 5 than a sole line of treatment by itself (36,37) , although (Palacios et al, 2005) had reported a significant reduction in serum bone markers after treatment with calcium and vitamin D (38) . In recent years, a panel of new simple to use kits to determine bone markers had became available for the diagnosis, monitoring, of osteoporosis, and other metabolic diseases of bone tissue (9) .
     • keywords: activity; age; agreement; alendronate; alp; assessment; baseline; biochemical; bisphosphonates; bone; bone markers; calcium; changes; clinical; comparison; control; day; decrease; diagnosis; effect; estrogen; et al; formation; fracture; group; hormone; hrt; inorganic; iraqi; levels; loss; markers; med; n=12; new; non; osteocalcin; osteoporosis; patients; pharm; phosphate; postmenopausal; postmenopausal osteoporosis; postmenopausal women; pre; pth; reduction; remodeling; replacement; resorption; results; role; sci; serum; significant; study; table; therapeutic; therapies; therapy; total; treatment; turnover; values; vit; vitamin; vitamin d; vol.20(1; weeks; women; انؼظاو; ػشز
     • versions: original; plain text
348. bijps-486
     • author: A.Abdulrasool, Alaa; A.Naseer, Abdulmuttalib; A.Rahi, Firas
     • title: Application of Seed Mucilage Extracted from Lallemantia royleana as a Suspending Agent
     • date: 2017-03-29
     • words: 3254
     • flesch: 58
     • summary: Characterization of mucoadhesive property of the mucilage The mucoadhesive property of L.royleana mucilage as well as for chitosan was determined according to Park and Robinson method. Dissolution of (2.5% w/v) furosemide suspension using L.royleana mucilage as a suspending agent The United States pharmacopoea (USP) rotating – paddle dissolution apparatus (Copley) was used to study drug release from the furosemide suspension.
     • keywords: agent; baghdad; balango; carbopol; chitosan; college; comparable; dissolution; drug; figure; furosemide; gum; higher; hpmc; int; iraq; journal; l.royleana; l.royleana mucilage; lallemantia; mean; minutes; mucilage; mucoadhesive; natural; nutlets; patel; pharm; pharmaceutical; pharmacy; plant; properties; property; release; results; sci; seeds; shear; solution; studies; study; suspension; time; viscosity; vol.20(1; water; xanthan; انٓالو
     • versions: original; plain text
349. bijps-487
     • author: A. Kurji, Hayder; M. Ghareeb, Mowafaq; H. Zalzala, Munaf
     • title: Serum Level Profile and Pharmacokinetic Parameters of Single Oral Dose of Metronidazole in Type II Diabetic Patients
     • date: 2017-03-29
     • words: 2997
     • flesch: 52
     • summary: Metronidazole pharmacokinetic in diabetic 15 There is a wealth of information regarding the pharmacokinetic parameters of metronidazole in healthy subjects; however, limited information is available about this issue in diabetic patients. The metabolism of caffeine is decreased in diabetic patient while the clearance of paracetamol is decreased in diabetic patients type II (17) .
     • keywords: absorption; administration; auclast; auctotal; baghdad; changes; cmax; concentrations; data; diabetes; diabetes mellitus; diabetic; diabetic patients; disease; dose; drug; extent; gastroparesis; healthy; healthy subjects; hepatic; influence; iraqi; kelim; lee; mellitus; metabolism; metronidazole; oral; p<0.05; parameters; patients; pharmacokinetic; pharmacy; plasma; prepared; present; sci; serum; single; study; subjects; table; tmax; type; values; vol.20(1; volunteers
     • versions: original; plain text
350. bijps-488
     • author: A.Taher, Mohammed; M. Moustafa, Mayada; S. Mahmood, Aqeel
     • title: Measurements of HbA1c for Patients with Diabetes Mellitus and Foot Ulceration
     • date: 2017-03-29
     • words: 3711
     • flesch: 66
     • summary: The biggest sites of foot ulcer were on the bottom of the big toe and less at the ball of the foot, table (3).Table (4), shows significant difference between FBS & HbA1c for diabetic foot ulcer patients and control group. Table 6 : Percentage of healing after treatment for diabetic foot ulcer patients.
     • keywords: acid; age; association; baghdad; blood; care; combination; committee; complications; control; data; day; diabetes; diabetic; diabetic foot; diagnosis; disease; expert; fasting; fbs; foot; foot ulcer; glibenclamide; glucose; glycosylated; hba1c; healing; hemoglobin; high; higher; http://en.wikipedia.org/wiki/hba1c#cite_note-1; iraqi; level; mean; medical; mellitus; metformin; nov; occupation; old; patients; people; percentage; pharm; relationship; risk; sci; serum; significant; study; subjects; sugar; table; test; therapy; treatment; type; ulcer; ulceration; uric; value; vol.20(1; years; ١ّ٘ٛغٍٛب١ٓ
     • versions: original; plain text
351. bijps-489
     • author: H. Naser, Noor; F. Mahdi, Monther; N-A Omar, Tagreed; A. Fadhil, Amar
     • title: Synthesis and Preliminary Pharmacological Evaluation of New Analogues of Diclofenac as Potential Anti-inflammatory Agents
     • date: 2017-03-29
     • words: 3952
     • flesch: 64
     • summary: Anti-inflammatory activity The anti-inflammatory activity of the tested compounds was studied using egg-white induced edema model (25) . [(Vc-Vt)/Vc], Where Vc and Vt represents mean paw thickness in control and tested groups (at time t-time zero) respectively (26) , the results were represented in table 3. Results and Discussion The most widely used primary test to screen new anti-inflammatory agents measure the ability of a compound to reduce local edema induced in the rat paw by injection of an irritant agent (27) .
     • keywords: 2.57mmol; acid; activity; agents; analogues; anti; antiinflammatory; baghdad; clinical; cold; college; compound; continuous; control; data; derivatives; dichlorophenylamino; diclofenac; drop; drug; edema; effect; egg; ethanol; flask; glycol; group; hours; hydroxide; induced; inflammatory; inhibition; inhibitors; injection; iraqi; methyl; minimum; minutes; mixture; n=6; new; nsaids; paw; percent; period; pharm; pharmacology; physical; powder; propylene; rats; reaction; round; sci; sodium; solution; stirring; synthesis; table; thickness; time; university; values; vol.20(1; volume; white; yield
     • versions: original; plain text
352. bijps-490
     • author: I. Al- shemmary, Inssaf
     • title: In vitro MIC of Itraconazole Against Different Isolates of Candida albicans
     • date: 2017-03-29
     • words: 2732
     • flesch: 71
     • summary: MIC of nail isolates were 0.05 –6.4 μg /ml, skin isolates were 0.05 – 6.4 μg /ml, oral cavity isolates were 0.05 – 0.4 μg /ml, vagina isolates were 0.1 – 6.4 μg /ml and wound isolates were 0.1 – 1.6 μg /ml (table 2). Resistance mechanisms in clinical isolates of candida albicans.
     • keywords: 1ml; activity; agent; albicans; antifungal; antimicrobial; broth; candida; cavity; clinical; concentration; different; dilution; drug; females; fungicidal; fungistatic; inoculum; isolates; itraconazole; laboratory; media; method; mic; mic50; nails; oral; rpmi; size; skin; study; susceptibility; test; testing; tubes; vagina; vol.20(1; wounds; years; yeast
     • versions: original; plain text
353. bijps-491
     • author: J. Muhammed, Huda
     • title: Bacterial and Fungal Contamination in Three Brands of Cosmetic Marketed in Iraq
     • date: 2017-03-29
     • words: 2826
     • flesch: 48
     • summary: The raw materials used in cosmetics products may be grouped in to categories (Table1). Microorganisms can grow on almost every substances existing in nature and often able to attack or even decompose them , cosmetic ingredients are rich in nutrients that provide organic substrates in the form of sugar , starch , protein , amino acids , organic acids , alcohols , lipids and etc. for microbial growth (21) , addition to that ,water is a fundamental requirements for any microorganisms likely to contaminate the cosmetics products , thus untreated or non sterile water can support microbial growth leading to contamination of cosmetics products (11) , generally microorganisms of interest in raw materials or cosmetic products grow best around neutral pH 7.0 and many yeast and molds are able to tolerate acid
     • keywords: aeruginosa; agar; ahearn; albicans; aspergillus; aureus; bacteria; brands; broth; c.f.u./ml; candida; coli; contaminated; contamination; control; cosmetic; epidermidis; escherichia; eye; fumigatus; fungi; growth; iraqi; klebsiella; lip; mascara; materials; microbial; microbiological; microbiology; microorganisms; number; pencil; penicillium; pharm; pigments; pneumonia; preservatives; products; pseudomonas; raw; results; sci; spp; staphylococcus; sterile; study; table; test; use; vol.20(1; water; ° c
     • versions: original; plain text
354. bijps-492
     • author: GH. AbdulKarim, Nadia; A. Taher, Mohamed; N. Almarayati, Amal
     • title: The Role of Some Inflammatory Markers (IL-6 and CRP) in the Pathogenesis of Acute Coronary Syndrome in Iraqi CCU for Heart Diseases
     • date: 2017-03-29
     • words: 4055
     • flesch: 36
     • summary: Lindmark et al agreed with Manginas that IL-6 is a strong independent marker of increased mortality in UA patients, as IL-6 with both pro- and anti-inflammatory mediators affecting both B-cell immunoglobulin production and T- cell cytotoxic activity, and this indicates a possible role for IL-6 in progression of coronary artery disease (CAD) Accordingly, elevated CRP levels could be linked to increased long-term mortality [29] .
     • keywords: acs; activity; acute; acute coronary; addition; age; angina; artery; assay; baghdad; cannon; cardiac; cardiovascular; ccu; centre; circulation; clinical; control; coronary; correlation; crp; cytokines; disease; ecg; elevated; elevation; endothelial; events; factors; findings; healthy; heart; http://www.netce.com/coursecontent.php?courseid=551&works=true#ref70; il-6; infarction; inflammation; inflammatory; inflammatory markers; iraqi; ischemia; levels; management; markers; mean; med; myocardial; non; nstemi; p<0.01; patients; pharm; phase; plaque; protein; quantitative; reactive; response; results; risk; role; sci; serum; significant; smoking; strong; study; symptoms; syndromes; unstable; value; vol.20(1; year; اإلكهُهُت; انحشَك; انذساست; انفعال; بشوحٍُ; يشػً
     • versions: original; plain text
355. bijps-493
     • author: A. Al-Rikaby, Maitham; J. Al – Shamma, Kasim; A. Majeed, Ibrahim; SH.Hamondi, Saad
     • title: Possible Augmentive Effect of Antioxidant Vitamin C in Patients with Essential Hypertension Treated with Amlodipin or Enalapril
     • date: 2017-03-29
     • words: 4466
     • flesch: 62
     • summary: The addition of vitamin C to amlodipine or enalapril treated patients had resulted in a significant (p<0.05) lowering effect on mean blood pressure after two, three and four weeks. On the other hand, the addition of vitamin C to amlodipine or enalapril treated patients had resulted in a significant lowering of serum MDA after two and four weeks of treatment.
     • keywords: activity; addition; amlodipine; angiotensin; antioxidant; blood; cholesterol; control; control group; daily; density; dose; ecg; effect; enalapril; enzyme; essential; essential hypertension; group; hdl; heart; human; hypertension; iraqi; ldl; levels; lipid; lipoprotein; lowering; mda; mean; mmol; nitric; oxidative; oxide; p<0.05; parameters; patients; pharm; pressure; profile; role; sci; serum; significant; stress; study; table; time; treatment; values; vitamin; vitamin c; vldl; vol.20(1; weeks; انذو; انًعًٕعح; ػغؾ
     • versions: original; plain text
356. bijps-494
     • author: W. Ameen, Dina
     • title: Development and in vitro Evaluation of Bioadhesive Vaginal Tablet using Econazole Nitrate as a Model Drug
     • date: 2017-03-29
     • words: 5375
     • flesch: 57
     • summary: (8) The aim of this study is to investigate the use bioadhesive polymers: Carbopol 941 P and sodim carboxymethyl- cellulose or methylcellulose in different ratios to develop EN vaginal tablet .The developed tablets were evaluated for their physical and bioadhesive characteristics, and in vitro release of EN. Materials and Methods Materials Econazole nitrate (EN) supplied by Samarra Drug industries, carbopol 941(CP), (Goodrich,USA),Sodium carboxymethyl- cellulose (NaCMC), Methylcellulose (MC), Sodium lauryl sulfate (SLS), and Magnisium stearate (BDH Chemicals, LTD),Liverpool, England) ,Agar no.1( Oxoid Limited , England), all other reagents are of analytical grade. Table 2: Results of the physical evaluations conducted on EN bioadhesive vaginal tablets prepared Formula # Weight variation (mg) ± SD a Friability (%) a Hardness (kp) b Drug Content (%) ±SD b Tablet thickness (mm) b Surface pH b F1 748.4± 11 0.1±0.005 >13 98.5±0.2 4.4±0.02
     • keywords: bioadhesive; bioadhesive vaginal; buffer; carbopol; carboxymethylcellulose; combination; content; delivery; development; different; dissolution; distilled; dosage; drug; drug release; econazole; evaluation; figure; formulae; formulation; friability; greater; groups; hardness; higuchi; index; iraqi; journal; kinetics; mechanism; methylcellulose; mucoadhesive; nacmc; nitrate; order; pan; patel; pharm; polymers; prepared; profiles; release; results; sci; similarity; sls; sodium; solubility; strength; study; surface; swelling; systems; tablet; test; time; tissue; vaginal; vaginal tablet; values; vol.20(1; water; weight; انكاستٕتٕل
     • versions: original; plain text
357. bijps-495
     • author: A. Aziz, Tavga
     • title: Concentration-Dependant Antioxidant Activity of Pentoxifylline in Nitrite-induced Hemoglobin Oxidation Model
     • date: 2017-03-29
     • words: 2188
     • flesch: 50
     • summary: PTX is known to become metabolized to its corresponding 8- oxo derivatives in the mammalian system (6) ; these metabolites (methyluric acids) are known to inhibit lipid peroxidation in human erythrocyte membranes in vitro and function as free radical scavengers (7,8) suggesting their antioxidant effects in vivo. Ciuffetti, G, Mercuri M, Ott C, Lombardini R, Lupattelli G, Santambrogio L, Mannarino E. Use of pentoxifylline as an inhibitor of free radical generation in peripheral vascular disease.
     • keywords: activity; addition; antioxidant; blood; clin; concentration; course; damage; different; effect; erythrocyte; formation; free; hemoglobin; hemolysate; high; induced; inhibition; membrane; methb; methemoglobin; min; nitrite; oxidation; pentoxifylline; peripheral; pharm; present; ptx; radical; reported; scavenger; scavenging; sodium; study; table; time; vitro; vivo
     • versions: original; plain text
358. bijps-496
     • author: M. Thomas, Lena; I.Khalil, Yehia
     • title: Preparation and Evaluation of Atenolol Floating Beads as a Controlled Delivery System
     • date: 2017-03-29
     • words: 5573
     • flesch: 53
     • summary: This work aims to formulate a promised controlled-release atenolol beads that are capable of floating on gastric juice to prolong gastric residence time, thereby extend the time of drug release and then enhance its oral bioavailability, using aqueous colloid polymer dispersion method. Analysis of Drug Release Mechanism To establish the release kinetics and mechanism of drug release from the floating beads in different media, data obtained in the first 120 minutes of the in vitro release studies in 0.1 N HCl (pH 1.2) and acetate buffer (pH 4.6) were fitted to into zero-order, first-order, Higuchi, and Baker-Lonsdale models.
     • keywords: acetate; acidic; acpd; agent; alginate; aqueous; areas; atenolol; beads; behavior; bold; buffer; buoyancy; cacl2; calcium; coefficient; concentration; correlation; data; delivery; dev; different; diffusion; dispersion; dissolution; drug; drug release; effect; efficiency; encapsulation; ethylcellulose; evaluation; exponent; figure; formulas; hcl; higher; ind; iraqi; kinetic; korsmeyer; lower; matrix; mechanism; media; method; microencapsul; microspheres; minutes; mixture; oral; peppas; pharm; phosphate; polymer; polymer mixture; preparation; prepared; profile; ratio; release; results; sci; similar; sodium; structure; studies; study; systems; table; time; value; vol.20(1; yield; االص
     • versions: original; plain text
359. bijps-497
     • author: A. Al-Emami, Sura; H. Faraj, Aliaa; M.R. Al-Abadi, Dahlia
     • title: Relation of ?-Amylase Activity with Glucose and Anti-Gliadin IgA and IgG in Sera of Patients with Celiac Disease
     • date: 2017-03-29
     • words: 3143
     • flesch: 65
     • summary: α -Amylase activity and celiac disease 81 Relation of α-Amylase Activity with Glucose and Anti-Gliadin IgA and IgG in Sera of Patients with Celiac Disease Sura A. Al-Emami * ,1 , Aliaa H. Faraj* and Dahlia M.R. Al-Abadi* * Department of Chemistry , College of Science, Al-Mustansiryia Univirsity ,Baghdad,Iraq. Since the measurement of α-amylase activity is the most widely used biochemical test for the diagnosis of pancreatic and non pancreatic disease , therefore serum α-amylase were studied in the present study in an attempt to evaluate the usefulness of this enzyme in the diagnosis of celiac disease and its relationship with anti gliadin IgA and IgG and serum glucose .
     • keywords: activity; amylase; amylase activity; anti; antibodies; antigliadin; celiac; celiac disease; concentration; control; correlation; determination; deviation; diagnosis; disease; elevated; enzyme; gliadin; glucose; gluten; group; iga; igg; increase; iraqi; levels; mean; measured; non; p<0.001; pancreatic; patients; pharm; present; protein; range; result; sci; sera; serum; significant; specific; standard; study; table; values; vol.20(1; االحخشاء
     • versions: original; plain text
360. bijps-498
     • author: Sagban, Sura; N. Al-Shawi, Nada; Mohammad, Alia; Talib, Ashwak; Hasson, Utoor
     • title: The Effect of Orally -Administered Calcium Carbonate to Pregnant Women with Mild Pre-eclampsia
     • date: 2017-03-29
     • words: 4334
     • flesch: 55
     • summary: This study showed that serum calcium level in mild pre-eclampsia are lower than in normotensive pregnant women ,this finding support the hypothesis that hypocalcemia is a possible etiology in pre-eclampsia ; additionally this study showed the possible beneficial effect of calcium supplementation in controlling pre-eclampsia and reducing blood pressure by increasing serum calcium level . Figure 5: The effect of treatment with calcium carbonate 500 mg tablet in mild pre-eclamptic women on serum calcium level.
     • keywords: age; angiotensin; arterial; arterial blood; blood; blood pressure; calcium; calcium carbonate; carbonate; cells; clinical; concentration; control; diastolic; eclampsia; eclamptic; eclamptic women; effect; figure; function; group; hypertension; increase; intracellular; iraqi; levels; maternal; mean; med; membrane; mild; mild pre; mmhg; muscle; n=15; normal; normotensive; p<0.05; patients; pharm; plasma; pre; preeclampsia; pregnancy; pregnant; pressure; role; sci; serum; serum calcium; significant; smooth; study; supplementation; systolic; tablet; treatment; vascular; vol.20(1; weeks; women; انثغٛػ; انحًم; انذساعح; انذو; انكانغٕٛو; انُغاء; تغًذيٛح; ظغػ; عًذيٛح; يصم; يغرٕٖ
     • versions: original; plain text
361. bijps-499
     • author: A. Al-Shikli, Raghad; A.Abdulrasool, Alaa; M. Al-Hiti, Mustafa
     • title: Effect of Some Storage Conditions upon the Survival of Some Fungal Spores
     • date: 2017-03-29
     • words: 5426
     • flesch: 50
     • summary: The result also indicate that there is a significant different (p<0.05) between the three humidites as well as there are significant different between multivitamin and folic acid tablets and a significant difference between the weeks of storage. Multivitamin tablets showed more survival than folic acid tablets and this is due to the presence of more nutrients.
     • keywords: acid; acid tablets; aflatoxin; agar; aspergillus; assay; avicel; broth; compression; conditions; containers; contamination; control; decrease; different; effect; figure; flavus; folic; folic acid; fungal; fungi; growth; humidities; humidity; increase; iraqi; l.s.d0.05; level; materials; microbial; microbiological; microorganisms; multivitamin; multivitamin tablets; number; nutrients; optimum; origin; parker; penicillia; pharm; preparation; prepared; presence; production; pyridoxine; r.h; raw; relative; relative humidity; results; sci; solution; spore; spp; starch; storage; survival; tablets; talc; temperature; thiamin; time; total; type; viability; viable; visible; vol.19(2; water; weeks; ° c
     • versions: original; plain text
362. bijps-500
     • author: A.Taher, Mohammed; A.Atia, Yaser; K.Amin, Manal
     • title: Improving an Ovulation Rate in Women with Polycystic Ovary Syndrome by Using Silymarin
     • date: 2017-03-29
     • words: 4991
     • flesch: 58
     • summary: Table-1 shows that the clinical presentations of patients in present study like those reported in other studies of polycystic ovary syndrome in that it is a heterogeneous disorder Investigations included : serum fasting glucose levels, fasting insulin levels, serum testosterone, serum progesterone and serum leutinizing hormone (LH).All patients participi- tated in this study were diagnosed having PCOS and were non-diabetic, not hypertensive, not pregnant , and not taking any medications that affect the reproductive or metabolic func- tions with 90 days of study. (34.35) Silymarin may produce its effect on glucose and insulin levels by another mechanism through blockage of TNF-α where that serum TNF-α concentration have been high in normal- weight PCOS women and even higher levels in obese women with PCOS.
     • keywords: .the; /or; acne; androgens; baghdad; baseline; bmi; clinical; combination; common; concentration; control; criteria; cycle; day; determination; disorder; doses; drug; effect; elevated; endocrinol; fasting; glucose; group; hirsutism; homa; hyperandrogenemia; hyperandrogenism; hyperinsulinemia; improvement; increment; induced; infertility; insulin; iraqi; levels; luteal; mean; mechanism; metformin; month; nmol; non; number; obese; obesity; ovarian; ovary; ovary syndrome; ovulation; p<0.05; patients; pcos; percentage; pharm; polycystic; polycystic ovary; present; progesterone; progesterone levels; rate; reduction; regular; resistance; results; sci; serum; significant; silymarin; studies; study; syndrome; table; testosterone; treatment; vol.19(2; women; years
     • versions: original; plain text
363. bijps-501
     • author: M. Malik, Ali; M. Malik, Emad; MJ Al-Shammaa, Nawal; M. Al-Rubaei, Zeinab
     • title: A Comparative Biochemical Study of Proteins Profile in Iraqi Children and Adolescent with ?-Thalassemia
     • date: 2017-03-29
     • words: 2767
     • flesch: 64
     • summary: As a Conclusion the alteration in some protein parts occurred which is more obvious in major thalassemia patients compared to the normal and pathological control groups. Total protein level depend on the balance between their synthesis and their catabolism or loss from body .
     • keywords: albumin; baghdad; blood; children; clinical; control; decrease; difference; electrophoresis; groups; iga; igg; igm; immune; immunoglobulin; increase; iraqi; levels; major; minor; no.=50; normal; pathological; patients; pharm; protein; results; sci; sera; serum; significant; study; thalassemia; total; values; vol.19(2; الم
     • versions: original; plain text
364. bijps-502
     • author: S. Al-Sabbagh, May
     • title: Comparative Effects of Fentanyl, Medazolam, Lignocaine and Propranolol on Controlling the Hemodynamic Pressor Response during Laryngoscopy and Intubation
     • date: 2017-03-29
     • words: 4544
     • flesch: 53
     • summary: The present study was designed to evaluate the effect of medazolom, lignocaine and propranolol as a valuable adjuvant to fentanyl in attenuating hemodynamic responses to endotracheal intubation in normotensive patients. Can calcium and sodium channel blockers attenuate hemodynamic response to endotracheal intubation?
     • keywords: administration; anaesth; analg; anesthesia; base; blood; cardiovascular; changes; combination; data; dbp; difference; dose; effective; effects; endotracheal; endotracheal intubation; fentanyl; general; groups; heart; hemodynamic; hemodynamic response; hypertension; i.v; increase; induction; intravenous; intubation; iraqi; laryngoscopy; lignocaine; line; map; mean; medazolam; medications; minutes; non; number; p<0.05; patients; pharm; postintubation; preanesthetic; present; pressor; pressure; product; propranolol; rate; respect; response; results; rpp; sbp; sci; significant; study; surgery; table; thiopental; time; values; vol.19(2
     • versions: original; plain text
365. bijps-503
     • author: M. Jasim, Azhar
     • title: Validity of Generalized Standard Addition Method for a Mixture of Amino Acid Analysis
     • date: 2017-03-29
     • words: 3651
     • flesch: 46
     • summary: At pH higher than (2.7) low result for acetyl salicylic acid were obtained due to incomplete liberation acetyl salicylic acid from its salt with arginine. Determination of acetyl salicylic acid in this complex (1gm) of arginine acetylsalicylate– glycine complex was weighed and dissolved in (25 ml) of distilled water.
     • keywords: a11; a12; aacciidd; aammiinnoo; aannaallyyssiiss; aanndd; aarrggiinniinnee; absorptivity; acetic; acetyl; acetylsalicylate; acid; anal; aqueous; arginine; bbyy; buffer; chem; colored; complex; curve; ddeetteerrmmiinnaattiioonn; determination; determined; different; end; equation; ffoorr; figure; ggllyycciinnee; ggssaamm; glacial; glycine; hydrochloric; iraqi; measured; method; mixture; mmeetthhoodd; mmooddiiffiiccaattiioonn; molar; ninhydrin; non; ooff; percentage; perchloric; pharm; point; prepared; procedure; quantitative; reagent; result; salicylic; sample; sci; second; sodium; solution; spectrophotometric; standard; system; table; titration; titrimetric; tthhee; ttoo; uusseedd; values; vol.19(2; water; wwaass; wwiitthh
     • versions: original; plain text
366. bijps-504
     • author: G. Sabar, Ahmed
     • title: Lithotripsy of Different Urinary Tract Stones by Using Seeds of Carum copticum
     • date: 2017-03-29
     • words: 2425
     • flesch: 60
     • summary: Iraqi J Pharm Sci, Vol.19(2) 2010 Lithotripsy of urinary stone by Carum copticum seeds 38 Lithotripsy of Different Urinary Tract Stones by Using Seeds of Carum copticum Ahmed G. Sabar* ,1 * This research aimed to the use of these seeds as a lithotripsian against different types of urinary stones and determine the efficiency of these preparation against which types of stone.
     • keywords: acid; ammi; analysis; ayurvedic; carum; carum copticum; chemical; copticum; days; different; dose; effect; essential; extract; h.s; india; iraqi; kidney; liquid; lithotripsy; mixed; oil; oxalate; patients; pharm; plant; preparation; present; pure; renal; research; response; results; sci; seeds; stone; study; table; thymol; trachyspermum; tract; treatment; types; urinary; use; vol.19(2; اٌٝ; ٘ذا
     • versions: original; plain text
367. bijps-505
     • author: S. Shaokat, Siham; A. Hameed, Hamoudi
     • title: Evaluation of Stability of Cefamandol and Ceftazidime with Clavulanic Acid Against Extended Spectrum ?- Lactamase
     • date: 2017-03-29
     • words: 3644
     • flesch: 54
     • summary: NO of isolates Diameters of zone of inhibition / MM Amo Amc Tic Tim Cxt Cfm Cfz Cxm Ctr Amk Cip Rif Nal 1 0 4 0 5.5 16 2 3 10 11 10 12 19 0 2 0 4.5 0 7 16 3 3 12 10 11 10 0 18 3 0 3.5 0 8 18 2 5 8 5 14 12 19 0 4 0 4 0 8.5 17 0 4 4 13 12 11 10 0 5 0 5 0 9 17 6 14 15 12 12 11 19 0 6 0 5.5 0 9 19 10 14 15 13 12 18 0 0 7 0 6 0 7 20 11 11 15 12 18 20 0 18 8 0 6 0 6.5 20 5 10 13 10 18 24 0 19 9 0 6 0 9.5 20 5 11 12 10 15 22 19 19 10 0 7.5 0 9 17 7.5 13 10 10 12 10 19 18 E.coli (ESBL) 0 0 0 5 17 7 13 12 10 12 18 11 17 E.coli ATCC 25922 21 21 13 13 22 22 21 21 21 32 40 32 33 Iraqi J Pharm Sci, Vol.19(2) 2010 Stability of Cfm and Cfz with CA against β- lactamase 46 Ceftriaxone Azthreonam Ceftazidime Cefixime Imipenem Cefaloridin Azlocillin Carbenicillin Figure 1: Activity of ß– lactamase against ß- lactams antibiotics Figure 2: Antibiotic –enzyme Interaction ,by the highly sensitive double disks technique (24) demonstrated A : hydrolysis of ceftazidime and Cefalmandol by β-Iactamases producing E.coli B: Inhibition by Clavulanic acid (CA) . Although other clavams produced in nature may possess antibacterial and antifungal properties, clavulanic acid is the only one known clavam with potent ß– lactamase inhibitory activity owing in part to its 3R ,5R stereochemistry , it is a potent inhibitor of ß– lactamase enzymes produced by many strains of Staphylococcus aureus , E.coli , Klebsiella , Proteus , Sheglla , Pseudomonas , and Haemophilus influenzae (20,21,) .
     • keywords: acid; activity; agar; amc; amo; amoxicillin; antibiotics; antimicrobial; bacteria; beta; cefamandol; ceftazidime; cfm; cfp; cfz; clavulanate; clavulanic; clinical; combination; cxm; e.coli; enzymes; esbl; extended; imipenem; infections; inhibition; inhibitory; iraqi; isolates; k12; klebsiella; lactamases; method; mics; nal; pharm; presence; prevalence; resistant; rif; sci; sensitive; spectrum; stability; standard; strains; study; test; tim; tract; urinary; vol.19(2; zone; βlactam
     • versions: original; plain text
368. bijps-506
     • author: N. Hamad, Maha; A. Abdul-Hussain, Dhuha
     • title: Gravimetric Estimation of Caffeine in Different Commercial Kinds of Tea Found in the Iraqi Market
     • date: 2017-03-29
     • words: 2464
     • flesch: 64
     • summary: Caffeine was also identified by TLC using silica gel GF254 plates developed in three different mobile phases and comparing the Rf values of isolated caffeine with standard using single and mixed spots , and detection was done under UV254nm. 1- Murexide test : Isolated caffeine gave a purple color.
     • keywords: acid; bags; beverages; black; caffeine; coffee; color; commercial; dichloromethane; different; drinks; estimation; figure; gravimetric; gray; green; heat; hplc; iraqi; isolated; kinds; leaves; method; mobile; n n; percentages; pharm; pharmacognosy; phase; processing; sci; soluble; spectrum; standard; table; tea; teas; tlc; vol.19(2; water
     • versions: original; plain text
369. bijps-507
     • author: A. Rasheed, Faris; N. Sulaiman, Jwan; Abdul-Raheem, Yousif
     • title: Goserelin versus Norethisterone in the Management of Menorrhagia with Uterine Fibroid
     • date: 2017-03-29
     • words: 3127
     • flesch: 58
     • summary: (16) Adding goserelin after uterine artery embolization was found not to increase in the reduction of the size of leiomyoma, (17) in the same study the reduction of size of fibroid in Goserelin group was 45%. Abstract Menorrhagia is common in patients with uterine fibroids, if operation needs to be delayed for a particular reason, goserelin can be used safely to reduce bleeding and the size of the tumor.
     • keywords: acetate; agonist; bleeding; blood; difference; dimensions; effects; fibroid; gm/100ml; gnrh; goserelin; goserelin group; group; gynecol; hemoglobin; hormone; hysterectomy; increase; iraqi; management; mean; medical; menorrhagia; months; myomectomy; need; norethisterone; number; obstet; operation; pads; patients; pharm; reduction; sci; significant; size; statistical; study; surgery; treatment; use; uterine; versus; vol.19(2
     • versions: original; plain text
370. bijps-508
     • author: M. Jasim, Thamer; G.Alabbassi, Mustafa; F. Hatem Almuqdadi, Suhad; K. Kamel, Jinan
     • title: Anti-bacterial Properties of Melatonin against Mycobacterium Tuberculosis in Vitro
     • date: 2017-03-29
     • words: 3238
     • flesch: 55
     • summary: Susceptibility patterns of many dilutions M.tuberculosis and M.bovis to many concentration of Melatonin Dilution of Bacteria Melatonin concentration mg/ml (0.4) (0.2) (0.1) (0.05) Control 3×10 7 CFU/ml (10 -1 ) S S S S R 3×10 5 CFU/ml (10 -3 ) S S S S R 3×10 3 CFU/ml (10 -5 ) S S S S R Sex of Patients Examined samples Number of positive M. tuberculosis isolates Number of positive M. bovis isolates No. Isolates Code of isolates Melatonin concentration (mg/ml) (0.4) (0.2) (0.1) (0.05) Control S S S S R L2 S S S S R L3 S S S S R L4 S S S S R L5 * S S S S R L6 * S S S S R L =isolate, S =Sensitive, R=Resist, *= M. bovis Table 5 :
     • keywords: antibacterial; antibiotics; antimicrobial; bacterial; bovis; cancer; cell; concentration; control; cultured; dilution; drug; effects; ethambutol; fluid; free; growth; infection; iraqi; iron; isolates; laboratory; lipid; m.bovis; media; melatonin; mycobacterium; mycobacterium tuberculosis; national; number; percentage; pharm; pineal; positive; present; properties; reference; resistant; rifampicin; s r; s s; samples; sci; streptomycin; studies; study; susceptibility; table; test; total; tuberculosis; vol.19(2; year; عهى
     • versions: original; plain text
371. bijps-509
     • author: T.Salih, Zainab
     • title: In vitro Evaluation of Tinidazole Bioadhesive Vaginal Gels
     • date: 2017-03-29
     • words: 3526
     • flesch: 61
     • summary: Acomparision of vaginal gel vs. oral therapy .J.Reprod. Abstract Many trials were made to prepare Tinidazole 2% as bioadhesive vaginal gels using different gel bases including hydroxypropyl methyl cellulose (3 and 4% w/w), methylcellulose (3 and 4%w/w) and carboxymethylcellulose (2 and 3% w/w) .Swelling index of the polymers,pH , viscosity , bioadhesive force , and in-vitro drug release to the simulating vaginal fluid (S.V.F.) were investigated for all the prepared bioadhesive gels .
     • keywords: bases; bioadhesive; bioadhesive vaginal; cmc; concentration; contact; delivery; drug; dry; effect; evaluation; fickian; figure; fluid; force; gel; gel bases; gels; highest; hours; hpmc; index; initial; iraqi; mechanism; metronidazole; mucoadhesive; mucosa; pharm; polymer; prepared; properties; rate; release; releasing; s.v.f; sci; study; surface; swelling; system; table; time; tinidazole; tnd; type; vaginal; vial; viscosity; vol.19(2; volume
     • versions: original; plain text
372. bijps-510
     • author: MK Al-Mulla Hummadi, Yassir
     • title: Urine Protein SDS-PAGE Reveals Different Profiles in Iraqi Children with Kala-azar
     • date: 2017-03-29
     • words: 3142
     • flesch: 38
     • summary: Urine protein profile in Kala-azar patients revealed three groups of banding patterns: group- 1(33.4)% of the patients show the pattern of 5 bands with a MW. Control group (1) group (2) group (3) Figure 2 : Urine protein profiles in normal and kala-azar children.
     • keywords: active; azar; banding; bands; children; clinical; control; conventional; dalton; detection; different; donovani; electrophoresis; gel; group; human; hyg; infection; involvement; iraqi; javascript; journal; kala; leishmaniasis; lima; med; molecular; number; page; patients; pattern; pharm; presence; profiles; protein; renal; samples; sci; serum; studies; study; table; urine; verde; visceral; vol.19(2
     • versions: original; plain text
373. bijps-511
     • author: Y. Al-hurr, Marwan
     • title: Development of Modified Release Nicotine Tablet Formulation for Treatment of Ulcerative Colitis
     • date: 2017-03-29
     • words: 4161
     • flesch: 59
     • summary: Table (1) summarizes 8 formulas to prepare modified release nicotine tablets by wet granulation method with alcohol. Development of modified release nicotine tablet formulation for treatment of ulcerative colitis Iraqi J Pharm Sci, Vol.19(2) 2010 Modified release nicotine tablet 75 Development of Modified Release Nicotine Tablet Formulation for Treatment of Ulcerative Colitis Marwan Y. Al-hurr *,1 * Department of Pharmaceutics, College of Pharmacy, University of Baghdad,Baghdad,Iraq.
     • keywords: absorption; area; avicel; baghdad; bowel; clinical; coated; coating; colitis; college; colon; compression; concentration; degradation; delivery; different; disease; dissolution; drug; drug release; effect; enteric; eudragit; fig; figure; force; formula; formulation; germany; grade; inflammatory; intestine; iraqi; lacquer; large; mannitol; matrix; medium; method; modified; nicotine; oral; patients; percent; pharm; pharmacy; phosphate; polymers; prepared; release; release nicotine; retardant; samples; sci; sodium; starch; stearate; study; surface; system; tablets; temperature; therapy; time; treatment; type; ulcerative; university; vol.19(2
     • versions: original; plain text
374. bijps-512
     • author: A.Al-Shikli, Raghad; A.Abdul-Rasool, Alaa; M. Al-Hiti, Mustafa
     • title: The Survival of Different Fungal Spores During Tabletting
     • date: 2017-03-29
     • words: 3000
     • flesch: 49
     • summary: One day after preparation Less than 10 * CFU/gm After storage for 8 week at 35 C 75 % RH Less than 10 * CFU/gm After storage for 8 week at 35 C 85 % RH Less than 10 *CFU/gm After storage for 8 week at 35 C 95 % RH Less than 10 * CFU/gm Interrelation of compression pressure and survival of A. flavus, penicillia and Cladosporia spores in multivitamin and folic acid tablets Multivitamin formulation were contaminated with A.flavus spores or cladosporium spores or penicillia spores using 102 and 104 spore/gm. Tablets were prepared at a variety of compression pressure (137.9, 144.8, and 148.3) MN/m2 and the number of survival was determined immediately upon ejection of tablets from the die.
     • keywords: a.flavus; acid; agar; avicel; baghdad; cell; cladosporia; compaction; compression; contaminated; contamination; diameter; different; effect; folic; forces; formulations; fungal; gram; heat; iraqi; level; microbial; microorganisms; multivitamin; number; penicillia; percent; pharm; physical; potassium; prepared; pressure; properties; reduction; results; sci; shearing; size; spores; spp; starch; sterile; storage; survival; tablets; university; vol.19(1
     • versions: original; plain text
375. bijps-513
     • author: A. Abdul Razzak, Nadeem; F.Hussan, Samera; J. Qaseer, Ahlam
     • title: Design and Synthesis of New Non-Steroidal Anti-inflammatory Agents with Expected Selectivity toward Cyclooxygenase-2 Inhibition
     • date: 2017-03-29
     • words: 3854
     • flesch: 60
     • summary: Abstract This study includes design and synthesis of new non-steroidal anti-inflammatory agents (NSAIDs) with expected cyclooxygenase-2 (COX-2) selective inhibition to achieve better activity and low gastric side effects. 2. Harvey, R.A. and Champe, P.C. (EDs.): Anti-inflammatory drugs and autocoids.
     • keywords: acetate; acetic; acid; agents; amide; analysis; anhydride; anti; aromatic; aspirin; baghdad; carboxylic; chn; compound; cox-2; design; different; diflunisal; disk; drugs; edema; effect; egg; figure; glycol; h3c; hcl; induced; inflammation; inflammatory; inhibitors; injection; iraqi; kbr; melting; minutes; mixture; new; non; nsaid; o n; paw; pharm; phenol; point; product; propylene; rats; reaction; reflux; salicylic; sci; secondary; stretching; stretching vibration; synthesis; synthesized; time; vibration; vol.19(1; water; white
     • versions: original; plain text
376. bijps-514
     • author: K. Jabbar Alhamd, Alaa
     • title: Bioequivalence of Two Formulations of Amoxicillin in Human Healthy Volunteers on (HPLC) Technique
     • date: 2017-03-29
     • words: 3833
     • flesch: 52
     • summary: Figure 2: Typical chromatogram of HPLC analysis of Amoxicillin on ODS-DB column Figure 3: Typical chromatogram of HPLC analysis of plasma Amoxicillin on ODS-DB column Pharmacokinetics and statistical analysis The observation of maximum plasma concentration levels (C(max)) and time consuming to reach it (T(max)) were obtained from drug concentration versus time curves. Table 1: the linearity, precision and accuracy of blood plasma Amoxicillin samples.
     • keywords: acid; administration; amoxicillin; analysis; antimicrobial; assay; auc; available; bioavailability; bioequivalence; blood; c(max; chromatography; clinical; column; concentration; curve; detection; determination; drug; equal; extraction; formulation; healthy; high; hours; hplc; human; indian; iraqi; isocratic; levels; liquid; low; methanol; methods; model; new; ods; oral; performance; pharmacokinetic; phase; plasma; preparation; retention; reversed; samples; sci; simple; solid; solution; standard; studies; study; system; t(max; technique; ther; time; treatment; visible; vol.19(1; volunteers; عهً
     • versions: original; plain text
377. bijps-515
     • author: S. Jabbar, Mohammed; I. Khalil, Yehia
     • title: Formulation of Metoprolol Bilayer Tablets as an Oral Modified Release Dosage Form
     • date: 2017-03-30
     • words: 5846
     • flesch: 58
     • summary: 9. Lauretta M., Evelyn O. and Maria L., Formulation of biphasic release tablets containing slightly soluble drugs. Each layer may contain a different medicinal agent, separated for reasons of chemical or physical incompatibility, staged drug release, or simply for unique appearance of the layered tablet (3) .
     • keywords: bilayer; binder; cellulose; compression; concentration; cumulative; delivery; different; diluent; disintegration; dissolution; dosage; drug; effect; erosion; evaluation; f11; f15; figure; formulas; formulation; gel; granules; hec; hpmc; hydrophilic; hydroxypropyl; immediate; increase; iraqi; lactose; matrix; metoprolol; microcrystalline; pharm; pharmaceutical; physical; polymer; preparation; prepared; profile; properties; pvp; ratio; reference; release; result; sci; size; sodium; starch; strength; study; sustained; swelling; system; tablets; tartrate; test; time; type; vol.19; water; weight; انطجقخ
     • versions: original; plain text
378. bijps-516
     • author: J.Awad, Zainab
     • title: In Vitro Effect of Cholesterol and Different Sugars on Digitonin Production in Multiplied Shoots of Digitalis purpurea L. Plant
     • date: 2017-03-30
     • words: 3497
     • flesch: 61
     • summary: The production of cardiac glycosides from the plant of zahrat al kishtiban ( Digitalis purpurea L .) by using tissue culture technique .Ph. Effect of Adding Cholesterol and Different Sugars to the Nutrient Medium on Production the Steroidal Saponin Digitonin From Digitalis Purpurea L Iraqi J Pharm Sci, Vol.19(1) 2010 In Vitro Digitonin production in Digitalis plant 31 In Vitro Effect of Cholesterol and Different Sugars on Digitonin Production in Multiplied Shoots of Digitalis purpurea L. Plant Zainab J.Awad *,1 * Department of Pharmacognosy ,College of Pharmacy, University of Baghdad ,Baghdad, Iraq.
     • keywords: analysis; chlorophyll; cholesterol; compounds; concentration; content; culture; different; digitalis; digitonin; dry; effect; experiment; fructose; glucose; growth; iraqi; l tdz; maltose; medium; multiplication; multiplied; multiplied shoots; pharm; plant; presence; production; purpurea; saponin; sci; shoots; soluble; starch; steroidal; sucrose; sugars; table; tdz; tissue; total; treatment; university; weight; اىمخضاعفت; ىخس
     • versions: original; plain text
379. bijps-517
     • author: T. Numan, Ahmed; R. Aziz, Manhel; M. Shaker, Sinaa
     • title: Synthesis, Characterization and Antibacterial Activities of Ligand Type N2O4 Schiff base and its Novel Complexes with Co(II), Ni(II), Cu(II) and Zn(II) ions.
     • date: 2017-03-30
     • words: 4760
     • flesch: 69
     • summary: Sal1 Sal 2 Sal 3 Sal 4 Sal 5 Sal 6 Sal 7 Sal 8 Sal 9 Sal10 H2L Nil 11 Nil Nil Nil Nil Nil Nil Nil Nil [Cu(L)](3) Nil Nil Nil Nil Nil Nil 12 9 Nil Nil
     • keywords: absorption; acid; acinetobacter; activity; agar; aminobenzoic; antibacterial; aureus; bacteria; bands; base; baumannii; biological; c.t; chemistry; chohan; cm -1; complexes; compound; coordination; cu(ii; data; dec; electronic; ester; field; figure; group; h2l; h4l; high; hours; infrared; inhibition; intense; ions; iraqi; koh; ligand; metal; methanol; molar; new; ni(ii; nil nil; octahedral; peak; pharm; phenolic; precursor; results; sal; salmonella; schiff; sci; solid; solution; spectra; spectrum; staphylococcus; strains; synthesis; table; technique; transition; typhi; vol.19(1; york; zn(ii; zn(l)](4; εmax
     • versions: original; plain text
380. bijps-518
     • author: Z. Abdul-Jalil, Thukaa; Saour, Kawkab; Nasser, Abdul- MutalibA.
     • title: Phytochemical Study of some Flavonoids Present in the Fruits of Two Ammi L. Species Wildly Grown in Iraq
     • date: 2017-03-30
     • words: 3248
     • flesch: 59
     • summary: Traces 0.035 Iraqi J Pharm Sci, Vol.19(1) 2010 Detection of flavonoids in Ammi L. species 52 Identification of Flavonoids by TLC TLC of the extracts (F1,F2,F3) obtained from dried ripe fruits of Ammi majus and Ammi visnaga , confirms the presence of quercetin and kaempferol in all extraction portions in comparison with standards. Ammi visnaga, Q: quercetin standard ) Iraqi J Pharm Sci, Vol.19(1) 2010 Detection of flavonoids in Ammi L. species 53 Isolation and Quantitative determination of quercetin and Kaempferol by preparative TLC From the investigation of the fruits extracts (fractions) of Ammi majus and Ammi visnaga on TLC plates, it was found that quercetin present in both fruits extracts but higher in Ammi visnaga while kaempferol also present in both fruits extracts but higher in Ammi majus.
     • keywords: ammi; ammi majus; ammi visnaga; analysis; baghdad; chromatography; detection; different; dryness; ethanolic; extract; extraction; figure; filtrate; flavonoids; fruits; higher; hours; hplc; identification; iraqi; isolated; kaempferol; layer; majus; marc; mee; melting; methanol; method; percentage; pharm; plant; point; portion; present; purification; quercetin; sci; species; standard; study; table; thin; tlc; value; visnaga; vol.19(1; الخلة
     • versions: original; plain text
381. bijps-519
     • author: A. Ali, Ali
     • title: The Effect of Long Term use of Glibenclamide on Serum and Urinary Sodium and Potassium Level in Type 2 DM Patients
     • date: 2017-03-30
     • words: 2280
     • flesch: 47
     • summary: The effect of long term use of Glibenclamide on serum and urinary sodium and potassium level in type 2 DM patients Iraqi J Pharm Sci, Vol.19(1) 2010 Effect of glibenclamide on sodium and potassium level 58 The Effect of Long Term use of Glibenclamide on Serum and Urinary Sodium and Potassium Level in Type 2 DM Patients Ali A. Ali* ,1 *Department of Clinical Pharmacy, College of Pharmacy, University of Baghdad, Baghdad, Iraq. Parameter Control subjects (n=15) DM patients treated with glibenclamide (n=98) Serum sodium (meq/L) 139.95 ± 3.859 142.29 ± 6.67* Serum potassium (meq/L) 4.13 ± 0.56 4.71 ± 0.663* Urine sodium (meq/L)
     • keywords: baghdad; blood; clinical; control; diabetes; different; dose; effect; elevation; endocrinology; evaluation; excretion; flame; glibenclamide; henle; iraqi; levels; long; loop; meq; number; patients; pharm; potassium; present; sci; serum; sodium; study; subjects; table; term; type; urinary; urine; use; values; vol.19(1; water; اىصىدٌىً; حزمٍش; عيى; وقذ
     • versions: original; plain text
382. bijps-520
     • author: H. Alubaidi, Gheid; A. Ali, Zeyan; R. Mahmood, Abdulrahman
     • title: Detection of Carbohydrate Antigen CA19-9 Levels in Sera and Tissues' Homogenate of Breast and Thyroid Benign Cases
     • date: 2017-03-30
     • words: 2024
     • flesch: 56
     • summary: The results of CA19-9 levels in sera were (15 ±1.58 and 10.67 ±2.08)U/ml respectively compared with serum CA19-9 levels of control group which was 7.74 ±4.92 U/ml, the results were found to be highly significantly in breast tumor patients and non significantly in thyroid tumor patients than control group. The results were found to be highly significant in tissues' homogenate of breast tumor patients and non significant in thyroid tumor patients of higher compare with the it's serum levels of the same patients groups.
     • keywords: antigen; benign; breast; ca19; cancer; carbohydrate; cases; conditions; control; detection; diagnostic; elevated; elisa; group; homogenate; levels; malignant; markers; mean; patients; pharm; results; sci; sera; serum; significant; study; thyroid; tissues; tumor; value; الثدي; الحمٍدة; الدرقٍت; اورام; معنىٌت
     • versions: original; plain text
383. bijps-521
     • author: K. Ali, Layla
     • title: The Effect of Chronic Renal Failure on Thyroid Hormones
     • date: 2017-03-30
     • words: 2180
     • flesch: 56
     • summary: Introduction: Iraqi J Pharm Sci, Vol.19(1) 2010 Chronic renal failure on thyroid hormones 65 The Effect of Chronic Renal Failure on Thyroid Hormones Layla K. Ali *,1 *Nursing Department , Koya Technical Institute Abstract Chronic renal failure (CRF) affects thyroid function in multiple ways, including low circulating thyroid hormone concentration, altered peripheral hormone metabolism, disturbed binding to carrier proteins, possible reduction in tissue thyroid hormone content, and increased iodine store in thyroid glands. Alteration in thyroid function test findings may reflect changes in production of thyroid hormone by effects on the thyroid itself, on the hypothalamic - pituitary thyroid – axis, on peripheral tissue metabolism of the hormones, or a combination of these effects
     • keywords: acid; addition; blood; changes; chronic; chronic renal; concentration; control; creatinine; crf; disease; elevation; failure; female; function; gland; group; hormone; hypothalamic; illness; iodine; iraqi; kidney; levels; low; metabolism; normal; patients; pharm; pituitary; reduction; renal; renal failure; sci; secretion; serum; significant; study; test; thyroid; thyroid function; tissue; tsh; urea; uric; vol.19(1; فةً; مةه
     • versions: original; plain text
384. bijps-522
     • author: H. Cheyad, Samir; K. Khudier, Kalisa; A. AL-Mzain, Khtan
     • title: Effect of Chronic Exposure of Cadmium Chloride in Drinking Water on Structural and Functional Aspects of Thyroid Gland in Mature Male Rabbits
     • date: 2017-03-30
     • words: 2658
     • flesch: 55
     • summary: H&E, 40x Figure 2: Section in thyroid gland from cadmium treated rabbit (group II), note follicular- H &E. 40x Figure 3 :Section in thyroid gland from cadmium treated rabbit (group III), showing large area of microfollicels of varying size with hypertrophic thyrocyte (arrow), and hardly little secretion in the lumen.
     • keywords: activity; cadmium; cadmium chloride; cdcl2; cells; chloride; chronic; colloid; concentration; control; decrease; different; drinking; effect; exposure; figure; follicular; function; gland; group; hepatic; histological; hypertrophic; iii; iraqi; letters; levels; little; male; mature; metals; pharm; ppb; rabbits; sci; secretion; selenium; serum; significant; size; study; thyrocyte; thyroid; thyroxin; toxic; toxicity; values; vol.19; water; weeks; الذسقٍح; هاء
     • versions: original; plain text
385. bijps-523
     • author: N. Saeed, Ibtihal; I. Ibrahim, Aseel
     • title: Study the Prevalence of Helicobacter pylori Infection by Different Diagnostic Methods
     • date: 2017-03-30
     • words: 4669
     • flesch: 57
     • summary: The aim of this study is to compare the different diagnostic techniques of Helicobacter pylori infection by using invasive methods (histological examination of gastric & duodenal biopsies stained by Giemsa &Haematoxilin & Eosin methods , & rapid urease test which is considered the gold standard methods & non-invasive serological methods such as ICM rapid test , all these tests provide information about the incidence and prevalence of H. pylori in population , diagnostic value for each test also the eradication of person. McNulty and Wise (15) were the first ones to use this test to detect H. pylori infection .
     • keywords: .the; age; antibodies; antibody; bacteria; biopsies; biopsy; campylobacter; cancer; clinical; comparison; culture; detection; diagnosis; different; disease; duodenal; endoscopy; false; gastric; gastritis; gastroenterol; giemsa; gold; h. pylori; helicobacter; helicobacter pylori; histological; histopathological; icm; igg; increase; infection; invasive; iraqi; kits; methods; negative; non; number; patients; percentage; pharm; population; positive; prevalence; pylori; pylori infection; rapid; result; sci; sensitivity; serodiagnosis; serological; serology; specificity; specimen; stain; standard; study; table; techniques; test; true; ulcer; urease; urease test; value; vol.19(1; years
     • versions: original; plain text
386. bijps-524
     • author: j.Hasson, Kahtan
     • title: Enhancement of Atorvastatin Tablet Dissolution Using Acid Medium
     • date: 2017-03-30
     • words: 1871
     • flesch: 37
     • summary: In this study some generic commercial products of Atorvastatin tablets were evaluated by dissolution test in acid medium by comparing with that of parent drug Lipitor of Pfizer Company. Some of solubilizing agents were studied in formulation of Atorvastatin tablet including; surface active agent and PEG 6000 .The
     • keywords: acid; addition; analysis; atorvastatin; calcium; commercial; concentrations; different; dissolution; effect; experimental; figure; formulation; hplc; iraqi; lauryl; lipitor; low; medium; method; minutes; peak; peg; pharm; pharmaceutical; phase; product; profile; sci; sls; sodium; tablet; vol.19(1; work; انثحث; هرا
     • versions: original; plain text
387. bijps-525
     • author: Q. Abdul-Kadir, Maadh; E. AL-Ani, Nadhum; M. Alwan, Shakir
     • title: Synthesis of New Cyclic Amines-Linked Metronidazole Derivatives as Possible Prodrugs
     • date: 2017-03-30
     • words: 3257
     • flesch: 60
     • summary: The intensity of compound III(having molar absorbitivity  =2.72 X 10 4 mole -1 .L.cm -1 ) is nearly twice that of metronidazole and compound II(=1.61 X 10 4 mole -1 .L.cm -1 ), since compound III has double concentration of chromophore of metronidazole and compound II as shown in figure (1); whereas in figure (2), the intensities of absorption of metronidazole, compound II and IV(=1.03 X 10 4 mole -1 .L.cm -1 ) are nearly equal, since they have the same concentration of chromophore. With respect to compound III, it was prepared as a new mutual ester prodrug (and also of the twin ester type) that may liberate, upon hydrolysis, piperazine derivative as anthelmentic in addition to the anti-infective activity of metronidazole.
     • keywords: absorption; acid; activities; activity; amines; analysis; baghdad; band; ch3; chemistry; chloride; chloroform; coefficients; compound; cyclic; derivatives; drugs; effect; effective; equal; ester; iii; inter; iraqi; melting; methanol; methods; metronidazole; moiety; mole; n n; new; o2n; partition; pharm; physicochemical; piperazine; points; prodrug; properties; sci; solubilities; solvent; spectra; stretching; strong; synthesis; table; treatment; values; vol.18(2; water
     • versions: original; plain text
388. bijps-526
     • author: N. Aziz, Bassm; A. Al-Kataan, Mohammad; K. Ali, Wasan
     • title: Lipid Peroxidation and Antioxidant Status in β-Thalassemic Patients: Effect of Iron Overload
     • date: 2017-03-30
     • words: 4124
     • flesch: 55
     • summary: The effects of iron overload in thalassemic patients, represented with increased serum iron (157.75±7.57), before blood transfusion, on lipid peroxidation and antioxidant status are presented in table (3). The first group included twenty patients without signs of iron overload as revealed from the mean value of serum iron (90,97±12.92), referred as control, while the second group included twenty patients with clinical and biochemical signs of iron overload (157.75±7.57).
     • keywords: acid; activity; albumin; antioxidant; beta; biochem; blood; blood transfusion; ceruloplasmin; chem; clinical; continuous; control; damage; different; effects; erythrocytes; free; glutathione; group; h2o2; hematol; increased; iraqi; iron; iron overload; level; lipid; major; mda; methods; mosul; normal; overload; oxidative; oxygen; p<0.05; patients; peroxidation; peroxynitrite; pharm; present; radicals; reaction; sci; serum; significant; sod; status; stress; study; subjects; superoxide; table; thalassemia; transfusion; uric; values; vitamin; vitamin e; vol.18(2; انذو; فزغ
     • versions: original; plain text
389. bijps-527
     • author: A. Alnakshabandi, Abdulkadir; A. Muhammad, Huda
     • title: Prevalence of B-Thalassemia Carriers Among a Cohort of University Students in Hawler Province of Iraqi Kurdistan
     • date: 2017-03-30
     • words: 3120
     • flesch: 67
     • summary: 2. Thalassemia carriers can be detected through clinical examination and complete blood count. The cardinal feature of thalassemia carrier state is elevated HbA2 level .
     • keywords: age; basis; blood; carriers; cbc; cell; count; difference; disorders; distribution; elevated; erbil; estimation; figure; group; h.ch.anemia; hawler; hba2; hbf; health; hematology; hemoglobin; hemoglobinopathies; indices; iraqi; kurdistan; level; low; male; mch; mcv; mean; medical; minor; normal; pcg; pharm; prevalence; red; region; results; sample; sci; screening; students; studied; study; subjects; thalassemia; total; university; values; vol.18(2; years; انذو
     • versions: original; plain text
390. bijps-528
     • author: A. Razooki, Raghad; N. Saeed, Ebtihal; Hamza, Heyam
     • title: A Study on Cosmetic Products Marketed in Iraq: Microbiological Aspect
     • date: 2017-03-30
     • words: 3562
     • flesch: 52
     • summary: Contaminated water is a likely source of organisms found in cosmetic products. The raw materials used in cosmetic products may be grouped into categories (Table 1).
     • keywords: aerobic; aeruginosa; agar; bacilli; bacteria; baghdad; baird; body; broth; c.f.u; colonies; contaminants; contaminated; contamination; control; cosmetic; cosmetic products; counts; cream; dental; enterobacter; eye; facial; gram; growth; hand; infection; ingredients; iraq; klebsiella; level; london; lotion; materials; microbial; microbiological; microorganisms; negative; number; nutrients; organisms; pharm; plates; powder; preparations; preservatives; products; pseudomonas; raw; sample; sci; shampoos; soaps; source; spp; staphylococcus; sterile; study; susceptible; table; tests; types; use; vol.18(2; water
     • versions: original; plain text
391. bijps-529
     • author: A.Sabri, Lubna; T. Sulayman, Hala; I. Khalil, Yehia
     • title: An Investigation Release and Rheological Properties of Miconazole Nitrate from Emulgel
     • date: 2017-03-30
     • words: 3851
     • flesch: 56
     • summary: On other hand, increase the emulsifying concentration with 7.5% w/w liquid paraffin as in formulas 7 and 8 showed significant (P<0.05) increase in release of miconazole nitrate as shown in figure 4.The treatment of obtained data with Higuchi principle revealed that best fit mechanism of miconazole nitrate 2% w/w release from emulgel with linear relationship when the amount of drug released plotted with square root of time (22) as shown in figure 5.The later result of formula 4 was found to be pharmaceutically bioequivalent with the reference one Mecozalen cream ® as shown in table 3. Figure 3: The effect of paraffin concentration on the release of miconazole nitrate 2% w/w from carbomer 941 emulgel at pH 5.5 and 37 ° C. Figure 4: The effect of paraffin concentration on the release of miconazole nitrate 2% w/w from SCMC emulgel at pH 5.5 and 37 ° C. Figure 5: The effect of emulsifying agent concentration on release of miconazle nitrate 2% w/w from emulgel. The influence of type of gelling agent and concentration of both oil phase and emulsifying agent on drug release was studied and compared with commercially available miconazole nitrate cream (Mecozalen ® ).
     • keywords: agent; aqueous; base; carbomer; concentration; consistency; cream; delivery; different; drug; effect; emulgel; figure; formula; formulation; germany; increase; investigation; iraqi; liquid; miconazole; miconazole nitrate; min; months; nitrate; nitrate emulgel; oil; paraffin; pharm; phase; physical; preparation; prepared; properties; release; result; rheological; rpm; sci; scmc; shear; sodium; softy; span; storage; structure; table; time; topical; tween; type; vehicle; viscosity; viscous; vol.18(2; water; white
     • versions: original; plain text
392. bijps-530
     • author: Kader, Sardar; J.Al-Shamma, Kassim; A. Majeed, Ibrahim; T. Al-Ani, Abdulla
     • title: Comparative Study between Oral Hypoglycemic Drugs Repaglinide, Glibenclamide and Rosiglitazone on Some Biochemical Parameters in Type 2 Diabetic Patients
     • date: 2017-03-30
     • words: 4273
     • flesch: 55
     • summary: However, repaglinide acts on a different binding site than that of sulfonylureas (17) .The present work showed that fasting blood glucose and postprandial blood glucose in diabetic patients treated with rosiglitazone were significantly decreased after 4 and 8 weeks of treatment. The results showed that the the correlation (R2 values) between fasting and postprandial blood glucose in diabetic patients treated with repaglinide was 0.743 in comparing with R2 values in diabetic patients treated with glibenclamide 0.624 and rosiglitazone 0.499.
     • keywords: 2hr; alt; atherogenic; blood; blood glucose; cholesterol; comparative; control; creatinine; daily; determination; diabetes; diabetic; diabetic patients; drugs; effect; etal; fasting; glibenclamide; glucose; group; hdl; hyperglycemia; hypoglycemic; index; insulin; iraqi; ldl; levels; lipid; mellitus; mmol; non; oral; parameters; patients; pharm; postprandial; postprandial blood; reduction; repaglinide; results; rosiglitazone; sci; serum; significant; study; subjects; table; treatment; type; values; vol.18(2; weeks; weight; انذو; بعذ
     • versions: original; plain text
393. bijps-531
     • author: S. Salem, Bader; F. Mahdi, Monther; H. Mohammed, Mohammed
     • title: Synthesis and Preliminary Pharmacological Study of Sulfonamide Conjugates with Ibuprofen and Indomethacin as New Anti-Inflammatory Agents
     • date: 2017-03-30
     • words: 3160
     • flesch: 61
     • summary: Animals were brought to the laboratory, and were divided into four groups (each group consist of six rats) as follow: Group A: Six rats served as control; and treated with the vehicle (propylene glycol 50% v/v); Group B: treated with diclofenac (reference agent) in a dose of 3mg/kg suspended in propylene glycol 50% v/v (11) ; Group C: treated with tested compound 10 in a dose equivalent to 10 mg/kg of ibuprofen as suspension in 50% v/v propylene glycol (12) ; Group D: treated with tested compound 11 in a dose equivalent to 2 mg/kg of indomethacin as suspension in 50% v/v propylene glycol (13) . Table 1 showed the effect of tested compounds (10&11) in respect to control group.
     • keywords: acid; activity; agents; anti; cold; college; compound; conjugates; control; cox-2; diclofenac; different; drugs; edema; effect; egg; flask; group; hours; ibuprofen; indomethacin; induced; inflammatory; inhibitors; iraqi; minutes; mixture; n=6; paw; pharm; propylene; rats; reaction; sci; stretching; sulfonamide; suspension; synthesis; tested; university; vacuum; vol.18(2; water; white; yield
     • versions: original; plain text
394. bijps-532
     • author: Y. Saour, Kawkab
     • title: Synthesis and Biological Evaluation of Two New Analogues of Gonadotropin Releasing Hormone (GnRH)D-alanine8 and D-alanine
     • date: 2017-03-30
     • words: 5189
     • flesch: 64
     • summary: Analogue II showed significant ascorbic acid depletion as compared to the native hormone while the percentage in ascorbic acid depletion after administration of analogue I were not significant as compared to the native hormone. Table 3and 4 show the percent of depletion of ascorbic acid in the ovaries of the treated group.
     • keywords: acid; activity; ala; alanine; amide; amide(s; amino; analogue; analysis; arg; ascorbic; ascorbic acid; band; biological; carbonyl; ch2; chemical; chn; concentration; dala; decapeptide; depletion; dmf; ester; evaluation; gly; glycine; gnrh; gonadotropin; group; hormone; iraqi; leu; methine; methyl; mice; new; nh2; och3; optical; ovaries; ovary; peptide; percent; pglu; pharm; physico; prepared; pro; sci; secondary; ser; stretching; structure; synthesis; synthetic; table; trp; tyr; vibration; vol.18(2; weight
     • versions: original; plain text
395. bijps-533
     • author: S. Manhal, Falah; M. Abbas, Husam
     • title: Frequency of Antineutrophil Cytoplasmic Antibodies (ANCA) in Some Autoimmune Diseases
     • date: 2017-03-30
     • words: 3902
     • flesch: 61
     • summary: The low percentage of positive results detected by ANCA testing could be attributable to the limitations of our study, that's including: some of study patients were referred while they in remission stage rather than active phase of the diseases, the ELISA test was not coupled with indirect immunofluorescence technique (IIFT) due to the hospital policy, ANCA levels were not measured serially by quantitative image analysis, and the clinical relevance of the studied cases might be doubtful. The 'International Consensus Statement on Testing and Reporting ANCA' has been developed to optimize the clinical relevance of ANCA testing by the Studied groups LSD 4 (f-test) P-value Significance Control RA 1 0.672 Non Sig.
     • keywords: activity; age; anca; anti; antibodies; antibody; antineutrophil; arthritis; autoantibodies; autoimmune; clinical; colitis; control; cytoplasmic; diagnostic; differences; diseases; disorders; elisa; erythematosus; frequency; group; healthy; immunofluorescence; iraqi; levels; lupus; mean; mpo; non; normal; patients; pharm; positive; pr3; results; rheumatoid; role; sci; sera; serum; sig; significance; sle; studies; study; suppl; systemic; table; testing; ulcerative; value; vasculitis; vol.18(2; ااا; ااة; ااةن; اام; فام; يطم
     • versions: original; plain text
396. bijps-534
     • author: A.A. Ibrahim, Zaman; S.Muhsin, Salwa; A. Risan, Farhan
     • title: Genetic Variations of Echinococcus granulosus Isolated from Sheep and Cows by Using Fingerprint DNA Method in Iraq
     • date: 2017-03-30
     • words: 3418
     • flesch: 65
     • summary: This primer showed (5) unique patterns for DNA hydatid cysts samples of cows (Figure 3A, Table 3A), and (4) Unique patterns for sheep DNA hydatid Cysts samples (Figure 3B, Table3B). 4- Two µL from each DNA sample of both sheep and cows after performing several dilutions for the concentrated samples by D.W to reach the final required concentration starting the RAPD reaction Of DNA chain which ranged between 10-50ngm / each 1 µL of DNA sample and the final volume became 25µL (13) .
     • keywords: baghdad; bands; colors; cows; cysts; different; dna; duplication; echinococcus; figure; fingerprinting; gel; genetic; granulosus; hours; human; hydatid; iraqi; isolated; medical; method; minutes; molecular; numbers; opf; patterns; pharm; primer; rapd; results; samples; sci; sequences; sheep; solution; study; table; tube; unique; unique patterns; variations; vol.18(2; weights; األغٌبم; األكيبط; العذسيَ; على
     • versions: original; plain text
397. bijps-535
     • author: A. Al-Hussein Hassan, Hiba
     • title: The Relationship between Uric Acid Concentration and Some of Plasma Lipids in Patients with C. V. Disease in General Hospital of Al-Nasseriya
     • date: 2017-03-30
     • words: 2977
     • flesch: 49
     • summary: Uric acid (or urate) is non-protein nitrogen compound with the formula C5H4N4O3. The data showed a highly significant increased in the serum concentration of uric acid , cholesterol and triglyceride in cardiovascular disorders patients compared with healthy control (P<0.01) .In
     • keywords: acid; atherosclerosis; blood; cardiovascular; cells; cholesterol; circulation; concentration; control; coronary; density; difference; disease; disorders; distribution; effects; endothelial; enzymatic; fatty; groups; hdl; hdlcholesterol; healthy; heart; high; higher; hospital; human; iraqi; lipids; lipoproteins; low; mean; mechanisms; med; method; muscle; non; oxidative; p<0.01; patients; pharm; plasma; potential; results; risk; sci; serum; significant; smooth; statistical; study; table; test; total; triglyceride; uric; uric acid; value; vol.18(2; xanthine; µmol; ااِلظطشاباث; انقهبُت; انكىنُسخُشول; انىعائُت; انُىسَك
     • versions: original; plain text
398. bijps-536
     • author: H. Jwied, Ahmed
     • title: Hepatoprotective Effect of the Aqueous Extract of Camellia sinensis Against Methotrexate-induced Liver Damage in Rats
     • date: 2017-03-30
     • words: 3841
     • flesch: 54
     • summary: A model of liver injury in rats was induced by intraperitoneal injection of 20mg/kg MTX as a single dose followed by saline and 1.25% and 2.5% aqueous extract of green tea (GTE) were orally administered 7 days prior and 5 days after MTX- intoxication as a sole source of drinking water. tea leaves are rich in flavanol monomers known as catechins such as epicatechins (13) , which are 13.6 g/100 g in green tea and 4.2 g/100 gm dry weight in black tea (14) .In
     • keywords: -values; activities; activity; alp; alt; animals; antioxidant; approaches; aqueous; ast; biochem; changes; control; damage; days; decrease; different; effect; extract; fatty; figure; flavonoids; free; glutathione; green; green tea; group; gsh; gte; hepatic; hepatocytes; hepatoprotective; hepatotoxicity; histological; homogenate; hydroxyl; identical; induced; injury; iraqi; levels; lipid; liver; mda; mean; methotrexate; mild; moderate; mtx; non; oxidative; p<0.05; parameter; peroxidation; pharm; pharmacol; phosphatase; prepared; radicals; rats; respect; sci; section; serum; significant; stress; structure; study; superscripts; tea; tissue; toxicol; treatment; vol.18(2; water; االخعش; انكبذ
     • versions: original; plain text
399. bijps-537
     • author: A. Sulaiman, Amaal; A. Hussain, Saad; M. Jum'ma, Kasim; H. Sigar, Assad
     • title: Evaluation of the Anti-Inflammatory Effect of Pioglitazone in Experimental Models of Inflammation in Rats
     • date: 2017-03-30
     • words: 3351
     • flesch: 55
     • summary: Anti-inflammatory effects of pioglitazone and/or Simvastatin in high cardiovascular risk patients with elevated high sensitivity C-reactive protein. Duffy JC, Dearden JC, Rostron C. Design , synthesis and biological testing of novel series of anti-inflammatory drugs.
     • keywords: 5mg; activity; acute; acute inflammation; albumin; animals; anti; caliper; chronic; control; data; dexamethazone; diabetic; different; drugs; edema; effect; egg; evaluation; figure; formalin; group; hind; increase; induction; inflammation; inflammatory; inhibition; iraqi; mean; models; non; p<0.05; paw; paw thickness; pharm; pioglitazone; piroxicam; ppar; present; rats; reduction; response; sci; significant; study; sub; suppl; table; test; thickness; time; tissue; treatment; vernier; vol.18; فااٍ
     • versions: original; plain text
400. bijps-538
     • author: K. Fakree, Najwan; H. Ali, Shatha
     • title: Effect of COX-2 Inhibitors Selectivity on Lipid Profile in Hyperlipidemic and Normolipidemic Type 2 Diabetics
     • date: 2017-03-30
     • words: 3849
     • flesch: 47
     • summary: Table (2) shows that in hyperlipidemic diabetic patients diclofenac caused a significant increase in serum TG/HDL-c ratio % change +73.87 (figure 6) without significant difference in serum LDL- c/HDL-c ratio. Analysis of results indicated that diclofenac increased serum triglycerides (TG) whereas; celecoxib group exerted a significant reduction in total cholesterol (TC), triglycerides (TG) levels in hyperlipidemic patients.
     • keywords: arthritis; baseline; cardiovascular; celecoxib; changes; cholesterol; components; concentration; control; day; decline; density; diabetes; diabetic; diclofenac; drugs; effect; figure; group; hdl; hyperlipidemic; increase; inhibition; inhibitors; iraqi; joints; journal; ldl; level; lipids; lipoprotein; mellitus; non; normolipidemic; patients; pharm; profile; qualitative; ratio; results; sci; selective; selectivity; serum; significant; study; suppl; therapy; total; treatment; triglycerides; type; value; vol.18; weeks; اىدهىُ; اىدً; اىغيسُسَد; اىنثبفت; اىً; عْد; ىيدهىُ
     • versions: original; plain text
401. bijps-539
     • author: M. Juma'a, Kasim; A. Hussain, Saad; T. Numan, Intesar; H. Siqar, Assad
     • title: Dose-dependent Anti-inflammatory Effect of Silymarin in Experimental Animal Model of Acute Inflammation
     • date: 2017-03-30
     • words: 3234
     • flesch: 51
     • summary: The cell membrane stabilizing effect of silymarin on Iraqi J Pharm Sci , Vol.18 (Suppl.), 2009 Silymarin in acute inflammation 17 mast cell (20) may explain its effect on the initial phase of acute inflammation model mediated by histamine and 5-HT. It is now clear that silymarin suppresses early, intermediate and late phase of acute inflammatory model through interference with the initiation and propagation phases of acute inflammation.
     • keywords: acetyl; acid; activity; acute; acute inflammation; albumin; animal; anti; antiinflammatory; cell; control; dexamethazone; different; dose; drugs; edema; effect; egg; experimental; expression; extract; figure; groups; important; increase; induction; inflammation; inflammatory; inhibition; iraqi; liver; mediators; meloxicam; milk; model; p<0.05; paw; pharm; pharmacol; phase; propagation; rats; resolution; response; results; salicylic; sci; significant; silymarin; standard; suppl; synthesis; treatment; vol.18
     • versions: original; plain text
402. bijps-540
     • author: Y. Mohammed, Zainab; F. Al-Jumaily, Essam; Y. Yaseen, Nahi
     • title: In Vitro Cytotoxic Study for Purified Resveratrol Extracted from Grape Skin Fruit Vitis vinifera
     • date: 2017-03-30
     • words: 4768
     • flesch: 63
     • summary: In vitro Study The in vitro method was used to investigate the effect of pure resveratrol on two types of tumor cell lines (human laryngeal carcinoma Hep-2 and murine mammary adenocarcinoma AMN-3 tumor cell lines) and to compare the results with resveratrol effect on normal cell line Ref-2 cell line at different concentrations and different exposure times. The cytotoxic effect of the pure resveratrol was studied in comparison with trans- resveratrol standard in concentrations of (12.5, 25, 50 and 100) µg/ml for both purified resveratrol and the standard, also the comparism included methotrexate drug in concentrations (0.05 , 0.1 , 0.2 and 0.4) µg/ml toward the growth effects of the three types of cell lines and at three exposure times (24, 48 and 72) hours.
     • keywords: acid; assay; baghdad; cancer; cell; cell line; chromatography; collected; column; concentration; control; cool; culture; cytotoxic; cytotoxic effect; dark; differences; different; drug; effect; exposure; extract; gel; grape; growth; highest; hours; human; inhibition; inhibitory; iraqi; level; light; line; lsd; medium; methanol; methotrexate; mobile; new; p<0.01; partial; pharm; phase; plate; pure; pure resveratrol; purified; rate; ref; results; resveratrol; sci; serum; significant; skin; solution; solvent; standard; study; suppl; test; times; trans; transresveratrol; treatments; tumor; types; university; vitis; vol.18; ػيٚ
     • versions: original; plain text
403. bijps-541
     • author: H. Ali, Amal
     • title: The Effect of Brucellosis on Lipid Profile and Oxidant-Antioxidants Status
     • date: 2017-03-30
     • words: 3485
     • flesch: 52
     • summary: Significant differences were noted between the serum lipids of Brucellosis patients and control group. Table l , Figure 1.While circulating concentration of glutathione (GSH), soluble antioxidants were higher in Brucellosis patients than in control groups (mean  SE 2.49  0.4).
     • keywords: acid; antioxidant; bowel; brucella; brucellosis; brucellosis patients; cardiovascular; cells; cholesterol; clinical; concentrations; control; control groups; density; disease; effect; fever; figure; free; glutathione; groups; gsh; h2o2; hdl; higher; important; increase; inflammatory; intracellular; iraqi; ldl; levels; lipid; lipid profile; lipoprotein; low; malondialdehyde; mean; microbial; oxidant; patients; peroxidation; pharm; plasma; professional; profile; radicals; sci; serum; significant; species; status; study; suppl; table; total; total cholesterol; triglyceride; vol.18; االشؤخا; الحمؤ; الزا; ةؤت;  se
     • versions: original; plain text
404. bijps-542
     • author: A.AlOmari, Nohad; O. Omar, Adnan; M. Taher, Iklas
     • title: Preliminary Cytotoxic Study of Some Novel Furo-2-quinolone Compounds
     • date: 2017-03-30
     • words: 2486
     • flesch: 67
     • summary: The preliminary results indicate that HEP-2 cell differs in its sensitivity towards these compounds. Morphological changes of HEP-2 cell upon exposure to selected compounds [Fig. 3] accompanied with reduction in size i.e. loss of contact with neighboring cells as the apoptotic cells shrank and become detached from the adjacent cells.
     • keywords: angular; c2a; c3a; cancer; cell; ch3; cisplatin; compounds; concentration; control; coumarin; cytotoxic; cytotoxicity; difference; dimethyl; fig; furo[2; iraqi; lead; mosul; o ch3; pharm; ppm; preliminary; psoralen; quinoline-2; quinolone; sci; screening; significant; spectrum; study; suppl; survival; u.v; vol.18
     • versions: original; plain text
405. bijps-543
     • author: I. Abd Al-Zahra, Jameel; K. Ismael, Dawser; N. Al-Shawi, Nada
     • title: Preventive Effects of Different Doses of Pentoxyfilline Against CCl4-Induced Liver Toxicity in Rats
     • date: 2017-03-30
     • words: 4576
     • flesch: 57
     • summary: Additionally, increasing doses of PTX produce a dose-dependent improvement in liver tissue damage induced by CCl4, as evident histologically by the stained liver sections. Results The data presented in (table 1) showed that, CCl4 produces a highly significant increase in MDA contents of liver tissue homogenate compared to control group.
     • keywords: .day; activity; addition; anesthetic; animals; blood; carbon; ccl3; ccl4; cell; clin; contents; control; damage; data; days; different; doses; effect; eosin; ether; figure; free; glutathione; group; gsh; haematoxylline; hepatic; hepatocytes; homogenate; inflammatory; injection; injury; iraqi; kupffer; levels; lipid; liver; magnification; mda; necrosis; nitric; normal; oxidative; oxide; pentoxifylline; peroxidation; pharmacol; phosphodiesterase; pre; preventive; prior; production; properties; ptx; radical; rats; results; sci; significant; single; study; suppl; table; tetrachloride; tissue; toxicity; treatment; vol.18; work
     • versions: original; plain text
406. bijps-544
     • author: A. Aziz, Tavga; A. Ahmed, Zheen; M. Juma'a, Kasim; H. Abdulrazzaq, Munaf; A. Hussain, Saad; A. Hussain, Saad
     • title: Study of the Protective Effects of Benfotiamine Against CCl4-Induced Hepatotoxicity in Rats
     • date: 2017-03-30
     • words: 4787
     • flesch: 54
     • summary: In conclusion, benfotiamine is capable to protect liver tissue against CCl4-induced toxicity in rats more than thiamine. Table 2 showed that animals intoxicated with CCl4 presented with a highly significant increase in MDA (95.6%) and decrease in GSH (72.2%) contents of liver tissue homogenate compared to control (saline treated) group (P>0.05, table 2).
     • keywords: acetylcysteine; activities; activity; albumin; alp; alt; animals; ast; benfotiamine; bilirubin; ccl4; clin; college; control; daily; damage; data; days; decline; decrease; department; diabetes; diabetic; different; dose; effect; end; figure; group; gsh; hepatic; hepatotoxicity; homogenate; increase; induction; injury; intoxication; intracellular; iraqi; levels; lipid; liver; liver tissue; marked; mda; membrane; nac; oral; oxidative; p>0.05; pharm; pharmacy; pre; present; protection; protein; rats; results; role; saline; sci; serum; significant; single; study; suppl; table; thiamine; tissue; total; toxicity; treatment; triglycerides; university; values; vol.18; xenobiotics; انكبد
     • versions: original; plain text
407. bijps-545
     • author: M. Muhammad, Hazhar; Y. Saour, Kawkab; M. Naqishbandi, Alaadin
     • title: Quantitative and Qualitative Analysis of Plumbagin in the Leaf and Root of Plumbago europaea Growing Naturally in Kurdistan by HPLC
     • date: 2017-03-30
     • words: 2016
     • flesch: 56
     • summary: Iraqi J Pharm Sci , Vol.18 (Suppl.), 2009 HPLC analysis of plumbagin in plumbago europaea 45 Quantitative and Qualitative Analysis of Plumbagin in the Leaf and Root of Plumbago europaea Growing Naturally in Kurdistan by HPLC Hazhar M. Muhammad * , Kawkab Y. Saour ** , and Alaadin M. Naqishbandi *, 1 * Department of pharmacognosy, College of Pharmacy, Hawler Medical University, Iraq. The main active constituents from dried powdered leaves and roots of Plumbago europaea were extracted by Soxhlet apparatus using ethyl acetate, the main active constituent was characterized by spectroscopic analysis (IR, 1 H NMR, and 13 C NMR) as plumbagin.
     • keywords: active; analysis; calibration; concentration; constituent; curve; europaea; extracts; figure; genus; hplc; iraqi; isolated; leaf; leaves; main; major; nmr; pharm; plant; plates; plumbagin; plumbago; plumbago europaea; quantitative; roots; sci; species; spectrum; standard; suppl; tlc; vol.18
     • versions: original; plain text
408. bijps-547
     • author: H.Al-Malki, Falah; H. Ali, Shatha; A.Abdulbari, Gamal
     • title: Role of Ezetimibe in Combination with Statins(Simvastatin and Atorvastatin) in Controlling Dyslipidemia
     • date: 2017-03-30
     • words: 6324
     • flesch: 48
     • summary: (35) Iraqi J Pharm Sci , Vol.18 (1), 2009 Role of ezetimibe in combination with statins 4 180.50 179.82 179.36188.09 172.27 160.82 188.82 176.18 163.59 0 50 100 150 200 250 Before Ezetimibe addition 4weeks after Ezetimibe addition 6weeks after Ezetimibe Addition Time S er u m C h o le st er o l (m g /d l) Normal gp Simvistatin gp Atrovastatin gp Results Both simvastatin and atorvastatin treated groups (figure-1), showed no significant change in serum total cholesterol after 4 weeks of ezetimibe therapy ,but after 6 weeks of the addition of ezetimibe to simvastatin, there was a significant lowering in serum total cholesterol level as compared with both baseline . (57) A recent study showed that despite the comparable modest reduction of serum cholesterol levels by ezetimibe, an intestinal inhibitor of cholesterol absorption, and statin, only the statin improved endothelial function (58)
     • keywords: absorption; activity; addition; age; alt; atorvastatin; baseline; baseline values; bilirubin; bleeding; cardiovascular; changes; chd; cholesterol; clinical; coa; column; combination; control; creatinine; day; density; disease; dose; drug; dyslipidemia; effect; efficacy; elevation; ezetimibe; ezetimibe addition; female; figure; function; group; hdl; heart; high; histogram; hmg; hypercholesterolemia; inhibitors; intestinal; iraqi; kidney; ldl; level; lipid; lipoprotein; liver; lowering; mda; mean; n=22; non; normal; normal values; number; p<0.05; patients; people; pharm; plasma; platelets; primary; profile; ratio; reductase; reduction; renal; results; risk; role; safety; sci; serum; significant; simvastatin; statins; studies; study; subjects; table; therapeutics; therapy; time; total; treatment; triglyceride; values; vol.18; weeks
     • versions: original; plain text
409. bijps-548
     • author: S.Yousif, Hala; I. Khalil, Yehia
     • title: In Situ Gelling Formulation of Naproxen for Oral Sustained Delivery System
     • date: 2017-03-30
     • words: 5209
     • flesch: 60
     • summary: From the point of view of patient acceptability, a liquid dosage form that can sustain drug release and remains in contact for extended period of time, improving the bioavailability, reducing the dose concentration and frequency may be achieved by in situ gelling formulations (8) .Gelation of the orally administered liquid formulations (Ion activated system) was ensured by the inclusion of calcium ions in the formulation as a soluble complex designed to break down to release free calcium ions on encountering the acidic environment of the stomach (9) . The viscosity of the sols and drug release were measured, and was found to be dependent on the type and concentration of the gelling agent.
     • keywords: + +; addition; administration; alginate; article; calcium; cell; chloride; citrate; concentration; date; delivery; different; diffusion; donor; drug; effect; expiration; figure; fluid; formulations; gastric; gelation; gellan; gelling; gels; gum; influence; initial; int; iraqi; kubo; liquid; miyazaki; naproxen; oral; order; pectin; period; pharm; polymer; prepared; properties; range; receptor; release; results; sci; simulated; situ; sodium; sols; solution; sorbitol; study; sustained; system; temperature; time; viscosity; vol.18; water; علٔ
     • versions: original; plain text
410. bijps-549
     • author: A. Baker, Amanj; A. Majeed, Ibrahim; K. Ismail, Dawser
     • title: The Safety Profile of Single Daily Dose of Aminoglycosides in Comparison with Multiple Daily Dose
     • date: 2017-03-30
     • words: 4564
     • flesch: 61
     • summary: The results of statistical analysis indicated that there was no significant difference (P>0.01) in the mean length of therapy between the SDD and MDD group.24% of the patients in SDD group received therapy for ≥ 8 days compared to only 8% in group indicating the safety of SDD regimen since no toxicity was observed in spite of higher percent of patients who received longer duration of therapy due to the safety profile of SDD regimen (24) figure (2) . Ototoxicity, in the form of vestibular manifestation, was not observed in any of the patients in SDD group as in Benjman M. Limson et al study which also revealed no ototoxicity with SDD regimen (31) while other study revealed only 0.14% ototoxicity (6) .
     • keywords: .the; administration; age; agents; amikacin; aminoglycoside; antimicrob; baghdad; body; calculated; chemother; clcr; clinical; concentration; creatinine; daily; daily dose; days; difference; dis; dose; dosing; drug; duration; edition; figure; function; gentamicin; group; high; hours; ibw; incidence; interval; iraqi; length; mdd; mdd group; mdd regimen; mean; monitoring; multiple; nephrotoxicity; new; normal; ototoxicity; patients; percent; pharm; pharmacokinetics; pharmacy; post; range; regimen; renal; respect; results; s.cr; safety; sci; sdd; sdd regimen; serum; significant; single; study; therapy; treatment; use; vol.18; weight; years; الجراات; الواحادة; ىماان
     • versions: original; plain text
411. bijps-550
     • author: M.H. Zeiny, Sarmad
     • title: Isolation of Some Microorganisms from Bar Soaps and Liquid Soaps in Hospital Environments
     • date: 2017-03-30
     • words: 2487
     • flesch: 61
     • summary: Liquid hand washing soaps are more appropriate in hospital environments. Keywords: Bar soap, liquid soap, pseudomonas aeruginosa, nosocomial infections.
     • keywords: aeruginosa; agents; bacteria; baghdad; bar; bar soaps; bars; care; clin; colonization; colonized; contaminated; control; epidemiol; figure; growth; hand; handwashing; health; hospital; hygiene; important; infect; infection; iraqi; larson; liquid; liquid soaps; microorganisms; nosocomial; pharm; pseudomonas; sci; settings; skin; soaps; study; surfaces; swabs; transient; use; vol.18; wards; washing
     • versions: original; plain text
412. bijps-551
     • author: M.K. Al-Shafi, Sabah; J.Al-Azzaw, Mohamed; A. Ali, Methal
     • title: The Inhibitory Effect of Gallic Acid on Human Serum Cholinesterase
     • date: 2017-03-30
     • words: 2979
     • flesch: 45
     • summary: Therefore, we can not recommended gallic acid and its related compounds , as preservative substances in food industry or in pharmacological preparations since they might have some side effect on certain biological systems.. Key words: Gallic acid , gallotannin , Human Serum Cholinesterase . The inhibitory effects of different concentrations of gallic acid on the enzyme activity were summarized in Table 3 .It was found that increasing gallic acid concentrations will accordingly affect enzyme activity.
     • keywords: acid; activity; analysis; antimicrobial; baghdad; biological; brown; characteristic; chem; cholinesterase; color; column; compounds; concentrations; different; effect; enzyme; esters; ethanol; family; food; gallic; gallic acid; gallotannin; galloyl; glucose; http://www.ncbi.nlm.nih.gov/pubmed/10782489?ordinalpos=59&itool=entrezsystem2.pentrez.pubmed.pubmed_resultspanel.pubmed_rvdocsum; human; hydrolyzable; inhibition; inhibitory; iraqi; lh-20; light; mechanism; methods; mixture; paper; pharm; pharmacy; phenolic; phenols; plant; polyphenols; potassium; properties; reaction; reagent; related; sci; sephadex; serum; serum cholinesterase; shafi; solvent; substances; tannins; vitro; vol.18; عهى
     • versions: original; plain text
413. bijps-552
     • author: H. Tizkam, Hussam; A. Abdul Rassol, Alaa; A. Hussain, Ahmed
     • title: Preparation of a New Dosage Form of Metoclopramide Hydrochloride as Orodispersible Tablet
     • date: 2017-03-30
     • words: 5433
     • flesch: 55
     • summary: Among the different diluents utilized, it was found that a combination of microcrystalline cellulose PH101 (MCC 101), mannitol, dicalcium phosphate dihydrate (DPD) and Glycine was the best in preparing MTB orodispersible tablet with fastest disintegration time in the mouth. The physical parameters of the prepared MTB orodispersible tablet were satisfactory as hardness (4 Kg), friability (0.5%) and mouth disintegration (23 sec).The overall results suggest that the prepared formula of MTB as orodispersible tablet could be utilized as a new dosage form for the oral administration.
     • keywords: best; c c; concentrations; control; control orodispersible; conventional; d.w; different; disintegrant; disintegration; disintegration time; dissolution; dosage; drug; effect; figure; formula; formulation; friability; glycine; hardness; hcl; iraqi; mannitol; mcc; meclodin; min; mouth; mouth disintegration; mtb; mtb orodispersible; orodispersible; orodispersible tablet; pharm; phosphate; prepared; prepared orodispersible; primperan; release; results; sci; sec; study; super; tablet; test; time; types; vol.18; vomiting; water
     • versions: original; plain text
414. bijps-553
     • author: A. Mohammad, Amera
     • title: Determination of Cefalexin by Direct (UV- Vis) Spectrophotometer and Indirect(Flame Atomic Absorption) Technique
     • date: 2017-03-30
     • words: 3258
     • flesch: 60
     • summary: concentration in Germany capsules is less than the real concentration which is 500 mg while Ajanta and SD Iis O.K. Table(3):The concentration of Cefalexin capsule in 500mg cefalexin of different trade marks Determination of drug CEX – FeIII by using Flame Atomic Absorption Spectrophotometer: To be sure about the result obtained by U.V , we used another technical method, Flame Atomic Absorption Spectrophotometer (FAAS) , by indirect measurement the absorbance of Fe III in the complex to detect the cefalexin conc. by using UV spectrum Effect of Fe III concentration: The best concentration for Fe III ion is 80 µg /ml, it gave the maximum Absorbance figure (7) show that effect of concentration PPM on absorbance . Figure(7):
     • keywords: absorbance; absorption; cefalexin; cex; complex; complexes; concentration; determination; different; drug; effect; extraction; faas; feiii; fig; figure; formation; iii; iraqi; length; metal; optimum; pharm; ppm; prepared; reaction; sci; solution; spectra; spectrum; stock; temperature; time; uv spectrum; vol.18; water; wave
     • versions: original; plain text
415. bijps-554
     • author: S. Saleh, Eman; M.Turki, Kismet; H.Al-Osami, Mohammed
     • title: The Role of Chloroquine Phosphate on Acute Phase Reactant Proteins in Patients with Knee Osteoarthritis
     • date: 2017-03-30
     • words: 2317
     • flesch: 65
     • summary: Key words: Chloroquine , knee osteoarthritis , acute phase proteins , complement , C-reactive protein. Acute phase protein in rheumatic disease.
     • keywords: acute; baghdad; baseline; blood; cells; chloroquine; clinical; college; complement; control; cqp; crp; decrease; disease; drug; eds; effect; female; figure; inflammation; iraqi; knee; koa; level; male; month; osteoarthritis; p<0.05; patients; pharm; phase; phosphate; post; postgraduate; pre; protein; reactive; results; rheumatology; sci; serum; significant; study; table; treatment; university; value; vol.18
     • versions: original; plain text
416. bijps-555
     • author: A. Amin, Inaam
     • title: The Effect of Atenolol on CK-MB Levels in Hypertensive Patients
     • date: 2017-03-30
     • words: 2222
     • flesch: 65
     • summary: من امزاض الوهخس ال، ٍ الى خئٍ. وإلث خه اللوقأل To prove the relationship between atenolol and cardiovascular disease, measurement of creatinekinase-MB as a diagnostic indicator in early and long term usage of this drug by hypertensive patients is recommended.
     • keywords: antihypertensive; atenolol; biological; blood; cardiac; cardiovascular; clinical; correlation; cpk; creatine; diseases; drug; duration; effect; enzyme; group; heart; hours; hypertensive; injury; iraqi; kinase; levels; long; markers; mean; muscle; myocardial; patients; pharm; sci; serum; significant; study; treatment; usage; use; vol.18; years; ارع; التُندىرمُن; الى
     • versions: original; plain text
417. bijps-556
     • author: M.J. Al-Mudhafar, May
     • title: Spectroscopic Study for Determination of Amoxicillin Using Cobalt(II) as Complexing Metal
     • date: 2017-03-30
     • words: 3024
     • flesch: 60
     • summary: Complex Spectrum: transfer (2-5 ml) from the standard of Amoxicillin stock solution to 5 ml volumetric flask then 1 ml of Cobalt stock solution is added. in a new study, prepared different complexes of amoxicillin with Zn (II), Ni (II), Co (II) and Cu (II), these complexes were studied using elemental analysis, IR and mass spectra.
     • keywords: absorbance; alcohol; amoxicillin; benzyl; co(ii; cobalt; complex; complexation; complexes; determination; different; drug; effect; extraction; figure; formation; iraqi; metal; molar; pharm; phase; ppm; prepared; ratio; reaction; sci; solution; spectrum; stock; table; temperature; time; vol.18; water; λmax
     • versions: original; plain text
418. bijps-557
     • author: Q. Abdulkadir, Maadh
     • title: Proceeding Bromometric Phenol Assay without Starch Indicator
     • date: 2017-03-30
     • words: 2926
     • flesch: 55
     • summary: Therefore, we see a small difference ranging from 0.03-0.04% (as shown on table 5) between the resultant weights of phenol assay with and without starch procedure possibly due to simple error in technique (may occur in measuring phenol samples since capacity of bulb pipette is 25±0.03 ml). Phenol,as oily injection,is used to inject haemorrhoids particularly when unprolapsed (12) .Simply heating a mixture of phenol and formaldehyde with aqueous acid leads Bakelite which was the first commercially available cross-linked three dimensional network polymer molecule that is very resistant to solvents, heat and electricity and widely used in household products (13) .
     • keywords: acid; addition; aromatic; assay; blank; bromine; bromometric; chemical; chemistry; chloroform; colorless; deep; edition; end; excess; experiment; flask; indicator; iodine; iraqi; method; na2s2o3; organic; pharm; phenol; point; potassium; prepared; procedure; react; reaction; results; sample; sci; sodium; solution; standardization; starch; table; thiosulfate; vol.18; volumes; water; weight; محهىل
     • versions: original; plain text
419. bijps-558
     • author: A.Hussain, Saad; M. Mohammed, Shaima; T. Numan, Intesar; I. Abdulwahhab, Ihab
     • title: Effects of Different Concentrations of Melatonin on the Time-course of Nitrite–induced Oxidation of Hemoglobin: In vitro Study
     • date: 2017-03-30
     • words: 2472
     • flesch: 48
     • summary: Figure1 describes the effect of different melatonin concentrations on the time- course of nitrite oxidation of hemoglobin; without melatonin, the time- course of oxidation shows a characteristic pattern of slow initial transformation followed by a rapid autocatalytic process; in presence of melatonin there is slow increase in absorbance related to reduced levels of methemoglobin formation in all test samples. 9- Tomoda A, Tsuiji A, Yoneysnia Y. Biochemical concequences of Hb oxidation.
     • keywords: activity; antioxidant; autocatalytic; baghdad; blood; compounds; concentrations; control; course; different; effect; electron; erythrocyte; formation; free; hemoglobin; hemolysate; melatonin; meth; methemoglobin; min; moiety; nitrite; oxidation; oxidative; oxoferryl; perferryl; presence; radicals; rapid; reaction; samples; sci; sodium; species; stage; study; time; vitro; هوي
     • versions: original; plain text
420. bijps-559
     • author: J. Jawad, Fatima
     • title: A Study on the Stability of Different Frusemide Liquid Dosage Formulas: Oral Solution, Syrup, Elixir, Suspension and Emulsion
     • date: 2017-03-30
     • words: 4699
     • flesch: 58
     • summary: (12) 303.2 k t Iraqi J Pharm Sci , Vol.17 (2) ,2008 Frusemide oral liquid dosage forms 5 1.984 1.986 1.988 1.99 1.992 1.994 1.996 1.998 2 2.002 0 1 2 3 4 5 Time (months) lo g % r em ai ni ng 40 C 50 C 60 C Figure (1): Degradation curve of frusemide oral solution (formula I) at 40, 50, 60 0C 1.984 1.986 1.988 1.99 1.992 1.994 1.996 1.998 2 2.002 0 1 2 3 4 5 Time (months) lo g % r em ai ni ng 40 C 50 C 60 C Figure (2): Degradation curve of frusemide syrup (formula II) at 40, 50, 60 0C 1.955 1.96 1.965 1.97 1.975 1.98 1.985 1.99 1.995 2 2.005 0 1 2 3 4 5 Time (month) Lo g% r em in in g 40 50 60 Figure (3): Degradation curve of frusemide elixir (formula III) at 40, 50, 60 0C Table (3) summarized the degradation rate constant of formulas I, II and III. (5)Comparison studies of formulas A, B, C, D and E The following parameters were used to compare the prepared formulas A, B, C, D and E. Table (2): Different formulas of frusemide prepared as suspension (A, B, C, D and E).
     • keywords: acid; alcohol; buffer; cellulose; concentration; constant; date; degradation; different; dissolution; dosage; elixir; emulsion; expiration; figure; following; forms; formula; frusemide; glycerol; gum; iii; iraqi; liquid; methyl; oral; order; pharm; phosphate; potassium; prepared; purified; rate; sci; sedimentation; sodium; solution; sorbitol; suspension; syrup; table; time; viscosity; vol.17; volume; water; xanthan; ةساردلا; ةلئاسلا; دياميسورفلل; رضح; ريضحت; فلتخمب; لاكشالا; لالخ; لوبقم; هعينصت; يومف
     • versions: original; plain text
421. bijps-560
     • author: M. Taher, Al-Muhannad; S. Al-Sabbagh, May; K. Al-Khashali, Dawser
     • title: Effects of Abuse of Anabolic Androgenic Steroids on Iraqi Athletes
     • date: 2017-03-30
     • words: 5407
     • flesch: 60
     • summary: Anabolic androgenic steroids -using athletes had significantly higher (p< 0.05) serum levels of triglycerides (TG) (45.6%), low density lipoprotein- cholesterol (LDL-C) (26.0%) and very low density lipoprotein-cholesterol(VLDL-C) (45.6%) together with significantly lower serum concentrations of high density lipoprotein-cholesterol (HDL-C) (31.3%) than sedentary controls. Introduction Self-administration of large doses of anabolic androgenic steroids ( AAS ) by athletes to obtain a well-shaped body and to increase muscular strength has been increasingly noticeable since the 1950s.1,2 Anabolic androgenic steroids are widely used by professional and recreational athletes as well as nonathletes.3 Abuse of AAS is not limited to male adults but also reported in female adults as well as adolescents of both sexes.1
     • keywords: aas; abuse; abusers; administration; adverse; alkaline; anabolic; anabolic androgenic; anabolic steroids; androgenic; androgenic steroids; athletes; baghdad; bilirubin; bodybuilders; changes; chem; cholesterol; clin; concentrations; controls; creatinine; decanoate; density; difference; direct; doses; effects; fsh; function; glucose; groups; hdl; higher; hormone; iraqi; ldl; levels; lipid; lipoprotein; liver; low; lower; male; mean; med; men; methandrostenolone; n=15; nandrolone; non; pharm; phosphatase; present; profile; prolactin; renal; reported; results; sci; secretion; sedentary; sedentary controls; serum; significant; steroids; study; subjects; table; testosterone; total; urea; users; vldl; vol.17; ادذلق; ادلل; تةت; تدريخلات; تصث; ربد
     • versions: original; plain text
422. bijps-561
     • author: S.Yousif, Hala; I. Khalil, Yehia
     • title: Some Variables Affecting the Formulation of Oral Loratadine Suspension
     • date: 2017-03-30
     • words: 4847
     • flesch: 57
     • summary: Preparation of suspension: Loratadine suspension was prepared by levigating 0.1 gm loratadine in a mortar with the prepared dispersion of suspending agent. Formulation of loratadine suspension: Five different formulas were prepared using different suspending agents as shown in table (1) Chemical formula
     • keywords: acid; agent; alginate; baghdad; college; concentration; constant; date; degree; different; dispersion; dissolution; dosage; drug; effect; expiration; figure; formula; formulation; gum; hcl; insoluble; iraqi; like; loratadine; loratadine suspension; m.sc; methyl; min; nacmc; order; paraben; particles; percent; period; pharm; pharmaceutical; pharmacy; polymers; polysorbate; prepared; propyl; rate; release; results; resuspendability; sci; sedimentation; sodium; solid; stability; study; suspending; suspension; syrup; table; thesis; time; types; university; veegum; viscosity; vol.17; volume; xanthan; xanthan gum; ×10
     • versions: original; plain text
423. bijps-562
     • author: A. Bakir, Wasan; M. Hussein, Shalal; A. Mahmood, Noah
     • title: Determination of Enzymatic Antioxidant in Iraqi Patients with Chronic Gastritis
     • date: 2017-03-30
     • words: 3378
     • flesch: 50
     • summary: That H.pylori induces the production of intracellular ROS; this increase in ROS in gastric cells was enhanced by increasing the concentration of H.pylori and inhibited by use of antioxidant(22).There are more ROS in the gastric mucosa of patients infected with H.pylori CagA positive strains, is significantly difference from patients with H.pylori CagA negative strains. Medicine; 2006; 55: 386-390. 3. Weiss, J.; Tsang, T.; Meng, X.; Zhang, H.; Kilner, E.; Wang, E. and Watkin, W.: Detection of Helicobacter pylori gastritis by PCR: correlation with inflammation scores and immunohistochemical and CLOtest findings.
     • keywords: activity; caga; cancer; catalase; cells; chronic; control; detection; dismutase; dna; enzyme; epithelial; factors; gastric; gastritis; gene; h.pylori; helicobacter; helicobacter pylori; higher; host; hp+; hybridization; increase; infected; infection; level; mucosa; negative; oxygen; pathogen; patients; peptic; positive; probe; production; reactive; response; ros; serum; significant; sod; species; strains; study; subjects; superoxide; ulcer; virulence; إاا; يهو
     • versions: original; plain text
424. bijps-563
     • author: H. Mohammad, Mohammad; J.Al-Karagully, Haider
     • title: Cephalothin as a Carrier of 6-Mercaptopurine for Targeting Cancer Tissues
     • date: 2017-03-30
     • words: 3428
     • flesch: 65
     • summary: Compound II has acceptable rate of hydrolysis at slightly acidic medium pH 6 (t1/2 = 56.34 min.) and 80% of compound II had been converted to 6-MP within 30 min in the presence of GSH. The generation of compound II was accomplished following multistep reaction procedures.
     • keywords: acid; avtp; bend; buffer; cancer; carrier; cephalosporin; cephalothin; coefficient; compound; compound ii; concentration; cooh; drug; figure; glutathione; gsh; h n; hydrolysis; iraqi; level; melting; mercaptopurine; min; n s; nn n; organic; partition; pharm; phosphate; plot; presence; prodrug; rate; reaction; scheme; sci; solution; str; synthesis; time; tissues; tumours; vib; vol.17; yield; ملا
     • versions: original; plain text
425. bijps-564
     • author: Y. Alhamdani, Fadia; Y.Alhamdani, Faaiz
     • title: Single Dose Antibiotic Prophylaxis in Outpatient Oral Surgery Comparative Study
     • date: 2017-03-30
     • words: 3122
     • flesch: 52
     • summary: ووي بلت أ ضتأحص أ ستأطض أ ن أ قءضضت
     • keywords: .ةعونتملا; 3rd; administration; age; antibiotic; antimicrobial; apicectomy; bacterial; central; clindamycin; clinical; control; dental; dose; drug; figure; group; hours; i.u; incidence; incisor; infection; local; lower; maxillofac; molar; operation; operative; oral; patients; penicillin; picture; postoperative; procaine; procedures; prophylaxis; removal; single; site; study; surgery; surgical; upper; wound; ببس; ةــيريرسلا; تاطاا; تاطالتخالا; تالاحلا; حيحصلأ; ددــع; عنمي; قءضضت; قـيبطتلا
     • versions: original; plain text
426. bijps-565
     • author: G. Alabbassi, Mustafa; A. Hussain, Saad; H. Ali, Shatha
     • title: Therapeutic Effects of Melatonin in Lead-Induced Toxicity in Rats
     • date: 2017-03-30
     • words: 4817
     • flesch: 58
     • summary: Melatonin reduces lead levels significanty in all studied compartments (blood 28%, brain 46%, liver 40% and kidney 42%) compared with lead acetate and saline treated animals (table 7). Lead acetate, when administered subcutaneously, in a consecutive 100 mg/kg doses for one month and saline for another month produces significant elevation in blood lead levels (513%), and lead levels in brain, liver and kidney of these animals were also significantly elevated (3810%, 4736% and 2849% respectively, p<0.05) compared with 20 mg/kg only melatonin treated animals.
     • keywords: 100mg; acetate; animals; baghdad; blood; body; brain; changes; damage; data; days; different; effects; enzymes; exposure; figure; groups; identical; induced; kg lead; kg melatonin; kidney; lead; lead acetate; levels; liver; mda; mean; melatonin; month; non; normal; number; organs; oxidative; p<0.05; poisoning; rats; reduction; renal; results; saline; sem; serum; significant; study; superscripts; table; therapeutic; tissue; total; toxicity; treatment; use; values; variable; weight
     • versions: original; plain text
427. bijps-566
     • author: H. Salman, Amal; N. Iqbal, Mayada; A. Bakir, Wasan
     • title: The In Situ Expression of IL-6 and IL-1? in breast cancer patients
     • date: 2017-03-30
     • words: 4053
     • flesch: 63
     • summary: Shen, W. H.; Zhou, J. H.; Broussard, S. R.; Freund, G. G.; Dantzer, R.; and Kelley, K. W.. Proinflammatory cytokines block growth of breast cancer cells by impairing signals from a growth factor receptor. The antiproliferative action of IL-1 β on human breast cancer cells is exhibited not by killing the cells but rather by preventing the ability of the late G1 progression factor, insulin-like growth factor (IGF)-I, to promote progression from late G1 into the S phase of the cell cycle (27) .This
     • keywords: benign; benign breast; breast; breast cancer; breast tumor; cancer; cancer patients; cells; correlation; cytokines; detection; expression; factor; groups; growth; human; hybridization; il-1β; il-6; iraqi; ish; ish%il-6; level; malignant; malignant breast; mean; mrna; p<0.01; patients; percentages; pharm; positive; receptor; research; results; role; sci; sig; significant; situ; staining; studied; study; table; technique; tissue; total; tumor; value; vol.17; املل; سطررء; طمين
     • versions: original; plain text
428. bijps-567
     • author: S. Abdel Gany, Zaynab; F. Mahdi, Mayasaa
     • title: Cytotoxic Assay of Nigella sativa Leaf Callus Extract (Thymol) on Hep-2 Cell Line Using ELISA Assay
     • date: 2017-03-30
     • words: 3319
     • flesch: 74
     • summary: Radiation protection activity of N. sativa in mice against induction of chromosomal aberrations by gamma ray was also reported(8) 1Corresponding author : E-mail : zaynabsaad@yahoo.com Received : 14/6/2008 Accepted : 1/12/2008 Iraqi J Pharm Sci , Vol.17 (2) , 2008 Nigella sativa callus cytotoxicity 64 The using of plant tissue culture techniques make the easy of pharmaceutical compounds production instead of depending on the mother plant and become possible to produce these compounds at high amount and at high rate of pure may be over than these isolated from the complete mother plant, and its production may be quickly and independent on the season, also limit the surface area that is used in the medicinal plant culturing (9).The objective of the present study was to assess the cytotoxic properties of this extract from cell culure of N. sativa leaf callus using against Hep-2 cell line using ELISA (enzyme linked immunosorbant assay) assay. Hep-2 cell line, obtained from Iraqi Center For Cancer and Medical Genetics Researches at the passage level 326 were used in this study.
     • keywords: activity; assay; callus; cancer; cell; concentration; control; culture; cytotoxicity; density; differences; different; effect; elisa; exposure; extract; growth; hrs; human; inhibition; iraqi; leaf; line; nigella; optical; period; plant; production; sativa; sci; seed; significant; study; test; thymol; thymoquinone; tissue; ءادوسلا ةبحلا; ةبحلا يبطلا; ةفرعمل ءادوسلا; ةيمسلا هصئاصخ; ربتعي; لومياثلا; هصئاصخ ةفرعمل; وه ربتعي; يعرزلا
     • versions: original; plain text
429. bijps-568
     • author: S. Mahmood, Wissam; A. Kamal, Balkis
     • title: Preparation and In Vitro Permeation of Chlopheniramine Maleate (CPM) from Gel through Rat Skin
     • date: 2017-03-30
     • words: 4300
     • flesch: 60
     • summary: The result after 30 days storage time at different storage exaggerated temperatures of CPM gel , revealed that slight increase in the pH of CPM gel from 4.25 to 4.6 , which may be attributed to the ionization of CPM that releases chlorpheniramine base , which belongs to the basic properties of this types of antihistamines ( 19 ) . The kinetic analysis of CPM 1% w/w release from different polymer concentration at pH 7.14 and 37̊C Effect of CPM concentrations on the diffusion process : Table 3. and figure 4 , illustrate the effect of different CPM concentration 1% w/w and 3% w/w on the amount of CPM diffused through the rat skin , using 2% w/w SA as a gel base , the results showed that the amount of CPM diffused during the period of application ( 5hours ) , increased as a function of increasing drug concentration .
     • keywords: 1%w; 2%w; addition; alginate; base; buffer; chlopheniramine; concentration; constant; cpm; days; different; diffused; diffusion; drug; edition; effect; enhancers; figure; formula; gel; gels; iraqi; irritation; journal; life; maleate; nacmc; permeation; pharmaceutical; phosphate; polymer; process; rat; rat skin; rate; release; results; sci; selected; shelf; skin; sodium; solution; study; table; tea; urea; vol.17; w cpm; w sa; water; ا ا; دالبمت; نزو)%ا; نزو)%ل)%\ل)%; نزو\; نزو\ نزو)%ل)%\ل)%; يجدا
     • versions: original; plain text
430. bijps-569
     • author: w. Ahmed, Dhamraa
     • title: Effects of Interleukin-2 (IL-2) and Interleukin-6 (IL-6) in Recurrent Spontaneous Abortion (RSA)
     • date: 2017-03-30
     • words: 3135
     • flesch: 55
     • summary: Circulating cytokines and CD30 in normal human pregnancy and recurrent spontaneous abortions. Protect the fetus and placenta from being rejected and to aid in the maintenance of normal pregnancy.
     • keywords: aborted; abortion; antibody; cells; concentration; control; correlation; cytokine; delivery; elisa; expression; fetal; fetus; group; helper; human; il-2; il-6; immune; immunol; important; interleukins; iraqi; labour; level; maternal; mean; mechanisms; normal; pharm; placental; pregnancy; production; recurrent; reprod; role; rsa; sci; serum; significant; spontaneous; study; successful; table; th1; th2; tolerance; trophoblast; uterine; value; vol.17; women; باجنإ; براجتلا; ةايح; ةساردلا; ةميلألا; تيرجأ; نيبغارلا; نيجوزلا; هذه; يرحتلل
     • versions: original; plain text
431. bijps-570
     • author: A.Taher, Mohammed; R. Sulaiman, Waleed; Y. Al-Khairi, Hillal
     • title: Rosiglitazone , Metformin or both for Treatment of Polycystic Ovary Syndrome
     • date: 2017-03-30
     • words: 3577
     • flesch: 61
     • summary: These results are in agreement with studies showed a reduction in serum androgen levels after the reduction of insulin levels by insulin sensitizing agents, and these effect were independent in body weight (28,30,29). The luteal progesterone may be enhanced in PCOS by decreasing insulin levels with metformin (33).
     • keywords: age; baseline; clin; combination; control; day; effect; endocrinol; glucose; group; homa; improvement; insulin; iraqi; kit; levels; menstrual; metformin; months; ovarian; ovary; ovary syndrome; ovulation; p<0.05; patients; pcos; pharm; polycystic; polycystic ovary; progesterone; rate; reduction; resistance; rosiglitazone; sci; serum; study; syndrome; table; testosterone; treatment; vol.17; women; years; ةعرجب; ةعومجملا; عفلم; نوزاتيلكيزورلا; ىلوالا
     • versions: original; plain text
432. bijps-571
     • author: H. Hussain, Ahmed; I.Khalil, Yehia
     • title: Some Variables Affecting the Formulation of Pentoxifylline (PTX) as a Solid Sustained Release Dosage Form
     • date: 2017-03-30
     • words: 3694
     • flesch: 63
     • summary: the other hand the cumulative release of PTX from two polymers used (fig.3) revealed that after 10h. of dissolution, the percent of drug release from formula 3 is 88% compared with 60% in formula 7 , while the reference tablet (Trental400) gave 51% drug release after same period of dissolution . ,It was seen that when EC incorporated as a retardant material, a slight less or more in drug release was resulted compared with that of reference one (Trental) , and in an appreciab decrease in drug in drug release compared with the other formulas free from EC , which is attributed to the insolubility of EC in water, besides rigid consolidation of Eudragit RS and EC polymer that retain drug in matrix , this phenomena is in a consistent with results obtained by Aldermann (18) and Sreubel (19) .
     • keywords: accepte; addition; cumulative; different; dissolution; dosage; drug; dry; effect; eudragit; figure; formulation; friable; granulation; granules; iraqi; j.pharm.sci; matrix; method; pentoxifylline; pharmaceutical; pharmacy; polymer; prepared; ptx; pvp; release; results; rl100; rspm; sustained; tablets; type; variables; vol.17; water; wdusty; weight; wet; ةرطيسلل مدختسملا; تيجاردويلا مادختسأب; دق نيلفيسكوتنبلا; ررحت ىلع; رضح دق; عون تيجاردويلا; قلا.را عون; لاعف ريغلا; مادختسأب رضح; مدختسملا لاعف; ىلع ةرطيسلل
     • versions: original; plain text
433. bijps-572
     • author: F. Mahdi, Monther
     • title: Synthesis and Preliminary Pharmacological Evaluation of Aminobenzensulfonamides Derivatives of Mefenamic Acid as a Potential Anti-inflammatory Agents
     • date: 2017-03-30
     • words: 3706
     • flesch: 65
     • summary: [4-aminobenzenesulfonamide,4-amino-N¹ methylbenzenesulfonamide, or N¹-(4-aminophenylsulfonyl)acetamide] bound to carboxyl group of mefenamic acid a well known nonsteroidal anti-inflammatory drugs (NSAIDs) were designed and synthesized for evaluation as a potential anti-inflammatory agent. In vivo acute anti-inflammatory activity of the final compounds (9, 10 and 11) was evaluated in rat using egg-white induced edema model of inflammation in a dose equivalent to (7.5mg/Kg) of mefenamic acid.
     • keywords: acetic; acid; activity; amino; anti; antiinflammatory; benzene; ch3; chem; compounds; control; cox-2; data; derivatives; diclofenac; differences; different; drugs; edema; effect; egg; evaluation; group; hcl; induced; inflammatory; inhibitors; iraqi; j.pharm.sci; med; mefenamic; minute; n=6; new; nh2; non; nsaids; o2s; paw; physical; propylene; rats; reaction; secondary; selective; significant; study; sulfonamide; synthesis; table; time; value; vol.17; white; yield
     • versions: original; plain text
434. bijps-573
     • author: H. Abdulrazzaq, Munaf; J. Khadeem, Enas; S. Al- Muhammadi, Suhad
     • title: Hepatoprotective Effect of Echinops tenuisectus (Compositae) on CCl4 Induced Hepatic Damage in Rats
     • date: 2017-03-30
     • words: 3034
     • flesch: 51
     • summary: Solvent system Standard silymarin Standard Quercetin Standard Rutin Seed extract S1 0.43 0.35 0.28 0.4,0.33,0.2 S2 0.2 0.81 0.56 0.21,0.8,0.5 Figure 8: HPLC of plant seed extract of Echinops tenuisectus. Hepatoprotective effect of Echinops flavonoids 16 Hepatoprotective Effect of Echinops tenuisectus (Compositae) on CCl4 Induced Hepatic Damage in Rats Munaf H. Abdulrazzaq* , Enas J. Khadeem** , Suhad S. Al- Muhammadi** *Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad.
     • keywords: activities; activity; alt; animals; ast; baghdad; ccl4; cell; changes; college; compositae; control; damage; different; echinops; echinops flavonoids; echinops tenuisectus; effect; eosin; extract; family; figure; flavonoids; gf254; group; hepatic; hepatoprotective; hplc; iraqi; j.pharm.sci; liver; normal; plant; plant seed; quercetin; rats; reflux; results; rutin; section; seed; seed extract; serum; silymarin; solvent; standard; steatosis; study; table; tenuisectus; tlc; treatment; university; value; vol.17; ةهج; ةيبطلا; ةيمهألل; تاديونيفالفلل; دوجو; سردت
     • versions: original; plain text
435. bijps-574
     • author: O. Ibrahim, Zaid; H. Ali, Shatha
     • title: Antiplatelts Activity of Vitamin E in Relation to Dose and Duration of Therapy
     • date: 2017-03-30
     • words: 3580
     • flesch: 62
     • summary: Sci., Vol.17 (1) ,2008 Antiplatelts Activity of Vitamin E 25 Antiplatelts Activity of Vitamin E in Relation to Dose and Duration of Therapy Zaid O. Ibrahim , Shatha H. Ali *,1 * Department of Clinical Laboratory Sciences, College of Pharmacy , University of Baghdad , Baghdad , Iraq Abstract Vitamin E, having the well known antioxidant activity through scavenging free radicals و it occurs in several isomeric forms , these isomers have relatively different functions . addition to it’s antioxidant effect, which seems to be significantly correlated to it’s antiplatelets effect ( r=0.994 ,p<0.05).Hence , long term administration of high doses of vitamin E could be effective in decreasing the incidence of thrombosis ,which in turn depends on platelets function.
     • keywords: acid; action; activity; aggregation; alpha; antioxidant; antiplatelts; aspirin; bleeding; ch3; ch3 ch3; clin; control; coronary; day; different; disease; dose; duration; effect; figure; free; function; gamma; general; group; iraqi; j.pharm.sci; lipid; med; months; nutr; oxide; period; platelets; radicals; results; serum; significant; spat; structure; studies; study; subjects; tbars; therapy; time; tocopherol; tocotrienols; values; vitamin; vol.17; فبا
     • versions: original; plain text
436. bijps-575
     • author: N. Al-Wiswasi, Noor; B.H. Al-Khedairy, Eman
     • title: Formulation and in vitro Evaluation of In-situ Gelling Liquid Suppositories for Naproxen
     • date: 2017-03-30
     • words: 4526
     • flesch: 54
     • summary: Naproxen liquid suppository 31 Formulation and in vitro Evaluation of In-situ Gelling Liquid Suppositories for Naproxen Noor N. Al-Wiswasi ** , Eman B.H. Al-Khedairy* , 1 * Department of Pharmaceutics, College of Pharmacy, University of Baghdad , Baghdad ,Iraq ** Abi-Ghraib General Hospital, Ministry of Health , Baghdad ,Iraq Abstract In-situ gelation is a process of gel formation at the site of application, in which a drug product formulation that exists as a liquid has been transformed into a gel upon contact with body fluids. Key words: - naproxen, in-situ gelation, liquid suppository, poloxamer188 ةصالخلا رلإض ءئاإمعثافيإمع متمإعء يثاذلإمعتلم مإمعإإا عإومإيف مإمهلثل ايإتثذ اإرضحاسإمع يثاذلإ لوةإلا ةإلمع نإ اثافيإمعإإا عإضاتإت الرإيمإلفم ةإمع يلإإلياإوفم تإا إمعل ءئاإر ماإتياضتإضءإإتالسإمعتلمسإ لوةإىفاةإمحيت .ع
     • keywords: addition; additives; alginate; chains; chloride; concentration; dialysis; different; dissolution; dosage; drug; effect; figure; form; formulation; gel strength; gelation; gelation temperature; gelling; hours; hpmc; int.j.pharm; iraqi; j.pharm.sci; liquid; liquid suppository; mean; membrane; method; naproxen; naproxen liquid; percentage; physicochemical; poloxamer; preparations; properties; pvp; release; results; s.d; seconds; situ; sodium; solid; solutions; strength; study; suppositories; suppository; table; temperature; test; time; tubing; type; vol.17; water
     • versions: original; plain text
437. bijps-577
     • author: S. Al-Ttaee, Muthanna; Y. Saour, Kawkab; J. Qasir, Ahlam
     • title: Synthesis of New Opioid Analgesic Peptide Analogues to Enkephalin (Leucine- and Methionine-Enkephalin)
     • date: 2017-03-30
     • words: 3039
     • flesch: 67
     • summary: Al-omari, N.A.; Abachi, F.T.: Editorial Board of Education and Sciences Magazine, College of Education, University of Mosul: Biological study of phthalyl amino acids and phthalyl amino acid esters as antimicrobial agents 1998; pp. According to the designed structures, the analogues were synthesized following the conventional solution method and they were identified using the following techniques: melting point, optical rotation, thin layer chromatography (TLC), infrared spectroscopy (IR), elemental analysis (CHN) and amino acid analysis.
     • keywords: acetic; acid; activity; amino; analgesic; analogue; analysis; boc; cpd; ester; gly; glycine; group; iraqi; methanol; method; methyl; mixture; new; opioid; optical; peptides; phthalyl; physical; powder; rotation; synthesis; table; tyr; tyrosyl; white; اهزاجنإ; ةديدج; ةنكسملا; ةهباشم; ةيعيبطلا; تابكرم; تاديتببلل; ريضحتو; لاجم; نيلافكنالا
     • versions: original; plain text
438. bijps-579
     • author: A. Sahib, Adel; Wahab A.Al-Shaikely, Abdul
     • title: Evaluation of the Role of Interleukein-2 and Interleukein-4 in the Immunopathogenesis of Steroid Therapy Resistance in Iraqi Asthmatic Patients
     • date: 2017-03-30
     • words: 4984
     • flesch: 62
     • summary: Key words: steroid resistant asthma, steroid sensitive asthma, IL-2, IL-4. ةصالخلا ة فسفي مظا ي لحيسىا ضعريسوىظلض كديزسىوقضدكديدقعي تخليسىت ايزنعيةياايمىاي ييضيىتلالي لحيسىلا ضعيسىوتسم ديدزي ية فسفيدقعي تخليسىت ايزنعيinterleukin-2 and interleukin-4سىولك ديىهوتج .زنعيىااليداي It is clearly shown that smoking may comprise significant predisposing factor for steroid resistance (55.56%) when smoking SRA patients were compared to non-smoking Iraqi J.Pharm.
     • keywords: activation; age; allergy; anova; asthma; asthmatic; atopic; beta; cell; clinical; comparison; complement; control; cytokines; d.y.m; difference; dose; evaluation; factors; family; figure; glucocorticoid; group; habit; high; history; iga; ige; igg; igm; il-4; immune; immunoglobulins; immunol; incidence; induced; interleukins; iraqi; j.pharm.sci; kit; laboratory; leung; level; mean; med; n=27; n=28; non; p<0.05; patients; protein; receptor; residence; resistance; respir; results; role; s.j; samples; sem; sensitive; serum; sex; significant; smoking; sra; ssa; steroid; steroidal; study; szefler; table; therapy; total; values; vol.17; مظا
     • versions: original; plain text
439. bijps-580
     • author: H. Aziz, Samer; A. Abdulrasool, Alaa; A. Hussein, Ahmed
     • title: Factors Affecting the Formulation of Carbamazepine Extended Release Tablet
     • date: 2017-03-30
     • words: 6088
     • flesch: 63
     • summary: Sci., Vol.17 (1) ,2008 Carbamazepine extended release tablet. Sci., Vol.17 (1) ,2008 Carbamazepine extended release tablet.
     • keywords: -5.0; 60ºc; addition; additives; agents; calcium; carbamazepine; carboxymethyl; cbz; cellulose; concentration; content; degradation; delivery; different; diffusion; dissolution; dosage; drug; effect; ethyl; ethyl cellulose; extended; figure; formula; formulation; hardness; higher; hour; hydrophilic; increase; insoluble; int; iraqi; j.pharm.sci; kinetics; lactose; lauryl; materials; matrices; matrix; microcrystalline; minutes; order; pharm; phosphate; polyethylene; polymer; prepared; rate; release; results; sodium; study; sulphate; tablets; tegretol; test; time; value; vol.17; water; جالتخالل داضم; داضم لماع; دقل; زاهجلا ىلع; غييصت; لماع وه; لمعتسيو يزكرملا; لمعي جالتخالل; وهامر; ىلع لمعي; يبصعلا زاهجلا; يزكرملا يبصعلا
     • versions: original; plain text
440. bijps-581
     • author: H. Samein, Laith; A. Hussein, Ahmed; A. Abdulrasool, Alaa; A. Faraj, Jabar
     • title: Preparation and Characterization of Biodegradable Microspheres Containing Sertraline Hydrochloride
     • date: 2017-03-30
     • words: 3792
     • flesch: 58
     • summary: Abstract Four batches of sertraline HCl microspheres were prepared using a poly (D-L-lactide-co- glycolide) (PLGA) polymer ( Mw. 9, 27, 30 and 83 KDa) as a delivery system. In Vitro Drug Release A pathway for sertraline HCl release was provided by microsphere degradation where water-soluble degradation products (i.e. monomers and oligomers ) leave the microspheres matrix for the surrounding aqueous medium.
     • keywords: 502h; 503h; 6535dl; aaps; acetate; acid; administration; analysis; batches; buffer; characterization; clin; complete; content; days; degradation; delivery; depression; disorder; dispersion; drug; dsc; efficiency; encapsulation; evaporation; extraction; figure; glycolic; hcl; high; iraqi; journal; lactic; loaded; loading; method; microspheres; mixture; molecular; morphology; oral; particle; pharmacokinetics; physical; plga; polymer; preparation; prepared; release; sertraline; sertraline hcl; size; solvent; study; surface; table; treatment; weight
     • versions: original; plain text
441. bijps-582
     • author: A. Majeed, Ibrahim
     • title: Comparative Evaluation of Using Intranasal Desmopressin, Parenteral Diclofenac or their Combination in the Management of Acute Renal Colic Pain in Iraqi Patients
     • date: 2017-03-30
     • words: 2581
     • flesch: 57
     • summary: In conclusion, these results indicate that desmopressin may be used to treat renal colic either alone or combined, increasing the analgesic effect of other drugs like diclofenac Key words: renal colic, intranasal desmopressin, diclofenac الخالصة : لشالو اللوا الحوبد حوٍ صوىل ال. The study included 75 patients randomized into three different groups; group A received desmopressin (40 μg, nasal spray), group B diclofenac (75 mg) intramuscularly and group C, both desmopressin and diclofenac.
     • keywords: action; acute; adh; administration; analgesic; antidiuretic; blood; colic; desmopressin; diclofenac; differences; different; diuresis; drug; effect; effective; group; hormone; increase; intranasal; iraqi; j.pharm.sci; mean; min; nsaids; number; pain; patients; pressure; renal; renal colic; response; results; scale; scores; significant; similar; spray; study; therapy; time; treatment; values; vol.16; عىد
     • versions: original; plain text
442. bijps-583
     • author: N. Omar, Tagreed
     • title: Synthesis of Schiff Bases of Benzaldehyde and Salicylaldehyde as Anti-inflammatory Agents
     • date: 2017-03-30
     • words: 2797
     • flesch: 64
     • summary: Sci., Vol.16 (2) ,2007 Synthesis of anti-inflammatory aromatic Schiff bases 5 Synthesis of Schiff Bases of Benzaldehyde and Salicylaldehyde as Anti-inflammatory Agents Tagreed N. Omar* ,1 * Department of Pharmaceutical Chemistry , College of Pharmacy , University of Baghdad ,Baghdad , Iraq Abstract Three Schiff bases from Benzaldehyde and Salicylaldehyde have been synthesized (A, 1and 2) and two of them (1and 2) have been tested for anti-inflammatory activity. Sci., Vol.16 (2) ,2007 Synthesis of anti-inflammatory aromatic Schiff bases 6 C H N C H N C O HO (1) C H N (2) OH S NH 2 O O (A) Experimentals A. Chemistry Materials: Acetanilide (Riedel-Dehaen, Germany), ammonia solution, benzaldehyde, salicylaldehyde, chlorosulfonic acid, absolute ethanol and ether (BDH, England), all solvents and materials used were of analar type and used without further purification.
     • keywords: acid; activity; anti; aromatic; bases; chem; chemistry; cm -1; compound; control; cox-2; disk; dose; drugs; flask; group; indomethacin; induced; inflammatory; iraqi; j.pharm.sci; kbr; melting; minutes; mixture; paw; preparation; salicylaldehyde; schiff; significant; solution; stretching; sulfonamide; suspension; synthesis; tested; time; vibration; vol.16; water
     • versions: original; plain text
443. bijps-584
     • author: S.Shaokat, Siham; A.Hameed, Hamoudi; J.Mohammad, Hassan
     • title: Anti-fungal Activity of Punica Granatum I.peels Powder and Extracts from Pathogenic Samples
     • date: 2017-03-30
     • words: 4361
     • flesch: 56
     • summary: Et al. Studies on anti diarrhoeal activity of Punica granatum seed extract in rat. Antioxidant activity of pomegranate fruit extract and its anthocyanidins: dephinidin,cyaniding and pelargonidin.
     • keywords: 10gm; 20gm; acid; activity; agar; albicans; alcoholic; anti; antioxidant; aspergillus; candida; candida albicans; cells; concentrations; detection; diabetic; diameters; different; distilled; et al; ethyl; extract; flower; following; food; fruit; fumegatus; fungal; fungi; granatum; hours; hyphae; identification; infections; inhibition; inhibitory; iraqi; isolates; isolation; j.pharm.sci; jan; juice; media; medium; minimum; minutes; nigar; patients; peels; plants; pomegranate; positive; powder; present; punica; punica granatum; reaction; red; results; rind; sabouraud; samples; skin; solution; species; standard; strains; study; table; test; treatment; tropicalis; type; vol.16; water; yeast; zone
     • versions: original; plain text
444. bijps-585
     • author: A. Kamal, Balkis
     • title: The Release of Diazepam from Different Conventional and Hollow Type Suppository Bases
     • date: 2017-03-30
     • words: 3052
     • flesch: 59
     • summary: In-Vitro Dissolution Study : The dissolution rates of diazepam release from both conventional and hollow-type suppositories were carried out , a rotating basket dissolution apparatus was used at 50 rpm. Formula 1, 2 and 3 which they are prepared by conventional method revealed that the rate of diazepam release from insoluble theobroma oil is very slow compared with the rate diazepam released from hydrophilic base glycerol- gelatin and glycerol- PEG bases.
     • keywords: base; buffer; buffered; conventional; day; diazepam; different; dissolution; drug; drug release; effect; formula; gelatin; glycerol; hollow; iraqi; j.pharm.sci; journal; method; min; minutes; oil; peg; percent; prepared; rectal; release; results; samples; significant; solution; storage; study; suppositories; suppository; table; theobroma; time; type; value; vol.16; water
     • versions: original; plain text
445. bijps-587
     • author: A. Hussain, Saad; M. Mohammed, Haider; H. Abdulrazzaq, Munaf; T. Numan, Ahmed
     • title: Effect of Silibinin in Lowering the Intraocular Pressure in Normotensive Rabbits: Interaction with Pilocarpine and Cyclopentolate
     • date: 2017-03-30
     • words: 3164
     • flesch: 55
     • summary: Silibinin hemisuccinate, a powerful antioxidant flavonoid (15), inhibits cAMP- Phosphodiestrase enzyme, even more potent than theophylline or papaverine (16), an effect that can be utilized for the interference with AH formation and IOP regulation. % I O P r e d u c ti o n 2% pilocarpine alone Pre-treatment with 0.75% silybinin hemisuccinate post-treatment with 0.75% silybinin hemisuccinate * * * * * * * * * * * * * * -45 -35 -25 -15 -5 5 15 25 35 0.5 1 1.5 2 2.5 3 Tim e (hour) % C h a n g e i n I O P 1% cyclopent olat e alone P ost -t
     • keywords: aqueous; baghdad; baseline; bovine; camp; changes; chloride; ciliary; cyclopentolate; different; drugs; effect; epithelium; eye; eyes; figure; formation; hemisuccinate; humor; inflow; inhibition; instillation; interference; intraocular; invest; iop; iraqi; j.pharm.sci; mechanism; min; normotensive; ophthalmol; p<0.05; physiol; pilocarpine; pre; pressure; rabbits; reduction; regulation; respect; results; sci; silibinin; solution; study; time; transport; treatment; vol.16; الداخلي; السیلیبینین; العین; خفض
     • versions: original; plain text
446. bijps-588
     • author: A. Hussain, Saad; M. Mohammed, Haider; H. Jwaied, Ahmed; H. Abdulrazzaq, Munaf
     • title: Effect of Silibinin in Lowering the Intraocular Pressure in Normotensive Rabbits: Interaction with Betaxolol
     • date: 2017-03-30
     • words: 3592
     • flesch: 54
     • summary: Effects of pre- and post- treatment with 0.75% silibinin hemisuccinate on IOP-lowering effect of 0.5% betaxolol in normotensive rabbits; results are presented as mean of % reduction; number of eyes in each group = 10; *P<0.05 with respect to 0.75% silibinin hemisuccinate alone. All experiments were conducted by trained subject who is completely unaware about the type of treatment followed, and performed during a fixed time of the day (from 10:00 AM to 3:00 PM) to exclude the effect of circadian changes in IOP.For studying the pre-instillation effect of betaxolol, baseline IOP was recorded after the instillation of betaxolol, and then one drop of silibinin solution was instilled after 30 min into both eyes.
     • keywords: action; application; aqueous; baghdad; baseline; betaxolol; camp; ciliary; cyclic; decrease; different; drop; dynamics; effect; epithelium; eye; eyes; figure; formation; forskolin; glaucoma; hemisuccinate; humor; increase; inflow; inhibition; instillation; intraocular; invest; iop; iraqi; j.pharm.sci; lowering; mechanism; min; normotensive; ophthalmol; p<0.05; pde; pharmacy; post; potent; pressure; rabbits; receptors; reduction; results; silibinin; solution; study; time; timolol; topical; treatment; university; vol.16; انبٍخاكسٕنٕل; انذاخهً
     • versions: original; plain text
447. bijps-589
     • author: H. Ali, Shahlaa; A. Hamadi, Salim; N. Al- Jaff, Ashwaq
     • title: Effect of Ergotamine and its Combination with Vitamin E or Melatonin on Total Antioxidant Status in Migraine Patients
     • date: 2017-03-30
     • words: 4471
     • flesch: 58
     • summary: Sci., Vol.16 (2) ,2007 Ergotamine, vitamin E, melatonin and total antioxidants 72 Effect of Ergotamine and its Combination with Vitamin E or Melatonin on Total Antioxidant Status in Migraine Patients Shahlaa H. Ali 1 , Salim A. Hamadi ** , Ashwaq N. Al- Jaff** ** Department of Clinical Pharmacy ,College of Pharmacy , University of Baghdad, Baghdad , Iraq Abstract Free radicals and oxidative damage caused by them have being suggested to be involved in the pathogenesis of migraine. Migraine patients were divided into three treatment groups; first group treated with ergotamine alone, second group with ergotamine /vitamin
     • keywords: activity; acute; addition; age; ann; antioxidant; attacks; blood; cerebral; clinical; combination; control; damage; decrease; disease; effect; elevation; ergotamine; free; group; headache; healthy; iraqi; j.pharm.sci; level; mechanism; melatonin; migraine; migraine headache; migraine patients; nitric; normal; olesen; oxidative; oxide; p<0.05; pain; pathophysiology; patients; radicals; reduction; release; serotonin; status; stress; study; subjects; synthase; system; tas; therapy; total; treatment; vascular; vitamin; vitamin e; vol.16; إٌٝ; األوسذة; اٌحاٌت; اٌذفاػ١ت; اٌشم١مت; اٌى١ٍت; ف١خا١ِٓ; ِشظٝ
     • versions: original; plain text
448. bijps-590
     • author: M.Mohamed Ali, Muqdam; A. Humadi, Salim; N. Al-Jaff, Ashwaq
     • title: Clinical Evaluation of Melatonin Alone and in Combination with Pizotifen in the Prophylaxis of Migraine
     • date: 2017-03-30
     • words: 4329
     • flesch: 61
     • summary: After a month of treatment, the severity, duration and frequency of migraine attacks were recorded using special migraine scoring system. The effect of pizotifen is greatly enhanced by the addition of melatonin in term of the reduction in the severity, duration and frequency of migraine attacks.
     • keywords: 3mg; activity; addition; antimigraine; attack; baseline; clinical; combination; complete; daily; data; different; dimension; drug; duration; effect; effectiveness; evaluation; frequency; grade; group; headache; intensity; iraqi; items; j.pharm.sci; maximum; melatonin; migraine; minimum; month; new; night; nitric; oxide; p<0.05; pain; parameters; partial; patients; pineal; pizotifen; placebo; prophylactic; r.j; reduction; release; response; score; serotonin; severity; study; symptoms; system; table; test; treatment; use; vol.16; انذراست
     • versions: original; plain text
449. bijps-591
     • author: R. Abed Al- Rahman, Issraa; J. Jawad, Fatima; H.Alkateeb, Ekbal; A. Abdulrasool, Alaa
     • title: Preparation of Anise and Thyme Lotion for Topical Use
     • date: 2017-03-31
     • words: 3489
     • flesch: 58
     • summary: Two formulas were prepared using the mentioned natural plants, formula 2 (selected lotion) was the most acceptable one which contained veegum and xanthan gum as suspending agents in addition to other exceipients providing it good properties with high physical stability because of its flocculating, pouring, resuspending easily with sedimentation volume (F) 0.96. 10 The same method mentioned above was used in wich the total amount of stored lotion (50 ml) was diluted, filtered and macerated in ether then TLC technique was done to determine the stability of prepared lotion stored at 40 0 C, 50 0 C and 60 0 C for four months by measuring the RF values of all samples by calculating their quantities in comparison with standard lotion stored at room temperature.
     • keywords: active; anise; chicken; chicken pox; clinical; crude; dispersion; e.g; edition; ether; extracts; figure; formula; gum; ingredients; iraqi; j.pharm.sci; liquid; lotion; male; mary; materials; methyl; oils; paraben; pharmacy; plant; powder; pox; preliminary; preparation; prepared; properties; rate; rheogram; rose; sedimentation; shelf; skin; sodium; stability; study; suspension; table; temperatures; thyme; time; topical; veegum; vol.16; volume; xanthan
     • versions: original; plain text
450. bijps-592
     • author: H. Abdulrazzaq, Munaf
     • title: Protective Effect of Benfotiamine against Doxorubicin-Induced Cardiotoxicity in Rabbits
     • date: 2017-03-31
     • words: 2119
     • flesch: 45
     • summary: Results : Figure (1) indicated that serum level of LDH activity was significantly increased in doxorubicin treated rabbits compared to controls (P<0.05), while pretreatment with benfotiamine significantly reduces serum LDH activity compared to doxorubicin treated group. While benfotiamine pretreated rabbits showed a significant reduction in LDH and CPK activity when compared to doxorubicin treated group.
     • keywords: activity; administration; animals; apoptosis; baghdad; benfotiamine; cardiac; cardiomyocytes; cardiotoxicity; cell; changes; control; cpk; cytotoxicity; doxorubicin; effect; eosin; figure; group; heart; histological; induction; inflammatory; iraqi; j.pharm.sci; kinase; ldh; level; mechanism; myocardial; normal; pretreatment; protective; rabbits; res; section; serum; signaling; significant; study; thiamine; tissue; tnf; treated; treatment; vol.16
     • versions: original; plain text
451. bijps-593
     • author: A. Abdulhameed, Zena; I. Khalil, Yehia
     • title: Formulation of Alpha Tocopherol Acetate as a Powder Dosage Form by Adsorption
     • date: 2017-03-31
     • words: 3230
     • flesch: 40
     • summary: Figure 9: The percent of alpha- tocopherol acetate released from microcrystalline cellulose at pH 1.2 after 3 months of incubation period. In general, magnesium carbonate enhanced the dissolution phase by its rapid solubility and enhanced the adsorption phase, as in formula 4, due to its higher affinity to alpha- tocopherol acetate (10) .
     • keywords: acetate; adsorbate; adsorbent; adsorption; adsorptivity; alpha; alphatocopherol; best; carbonate; cellulose; different; dissolution; dosage; drug; figure; formula; incubation; incubation period; iraqi; j.pharm.sci; kaolin; magnesium; microcrystalline; min; minutes; months; oily; percent; period; phase; powder; release; results; solid; time; tocopherol; tocopherol acetate; vol.16; weight
     • versions: original; plain text
452. bijps-594
     • author: A. Hussein, Ahmed
     • title: Preparation and Characterization of Poly (D,L-Lactide-Co-Glycolide) Microspheres for Controlled Release of KSL Peptide
     • date: 2017-03-31
     • words: 4346
     • flesch: 53
     • summary: KSL peptide microspheres were characterized for drug content, surface morphology, microspheres size determination, polymers stability , in vitro microspheres degradation and in vitro release. The morphological effects and polymers degradation were analyzed to obtain a better understanding of the mechanism of KSL peptide release from microspheres and composite microspheres.
     • keywords: aches; acid; analysis; anti; aromatic; bases; biodegradable; blank; buffer; characterization; composite; composite microspheres; content; controlled; days; degradation; delivery; deluca; drug; efficiency; figure; glycolide; incubation; inflammatory; iraqi; j.pharm.sci; ksl; ksl peptide; lactide; loaded; loading; matrix; microspheres; molecular; morphology; particles; peptide; peptide release; phase; phosphate; plga; polymer; preparation; prepared; properties; release; rg503; rg503 composite; rg503 microspheres; saline; samples; schiff; size; solution; solvent; study; synthesis; system; table; temperature; time; vol.16; water; weight; انًجٓشٚت; عهٗ
     • versions: original; plain text
453. bijps-595
     • author: A. Hussain, Saad; T. Numan, Intesar; H.Khalaf, Ban; A. Abdulla, Talal
     • title: Therapeutic Use of Silymarin in the Management of Suspected Renal and Hepatic Injury Produced by NSAIDs in Osteoarthritis Patients
     • date: 2017-03-31
     • words: 3357
     • flesch: 58
     • summary: Treatment of OA patients with silymarin significantly reduces serum enzymes activity (25%, 15% and 20% respectively) compared to pre-treatment values. In the clinical practice, treatment of 20 patients having chronic active hepatitis with 240mg/day of silybinin-phosphatidyl choline complex for 7days significantly lowers serum liver enzymes (GOT, GPT, ALP) and total bilirubin.
     • keywords: 300mg; activities; activity; alp; baghdad; clinical; combination; creatinine; damage; day; different; disease; drugs; effects; enzymes; function; gpt; group; hepatic; injury; iraqi; j.pharm.sci; levels; liver; long; med; meloxicam; non; nsaids; p<0.05; patients; piroxicam; post; pre; protective; reduction; renal; results; selective; serum; significant; silymarin; study; table; term; treatment; university; urea; use; values; vol.16; weeks; السلُوارَي; علً; غُز; َوكي
     • versions: original; plain text
454. bijps-596
     • author: S. Altaei, Tagreed; T. Numan, Intesar; A.Hussain, Saad; G. Al-Talabani, Nazar
     • title: The Efficacy of Topically Applied Silymarin in the Treatment of Herpes Labialis Ulcers
     • date: 2017-03-31
     • words: 4752
     • flesch: 56
     • summary: When the two methods of treatment compared (silymarin vs placebo), no significant differences reported in C3 levels (P<0.05), while C4 levels showed significantly lower values due to silymarin treatment (43%) compared to placebo treatment. Table 2 demonstrated that treatment of HLU patients with 5% silymarin paste for 4 -5 days resulted in significant reduction in the serum levels of the immunoglobulins IgG, IgM and IgA (4%, 22% and 36% respectively) compared to pre-treatment levels, while placebo treatment did not alter Ig’s levels during the same period of treatment.
     • keywords: activity; antioxidant; baghdad; cells; clinical; complete; cytoprotective; days; differences; different; effects; figure; flavonoids; formula; glutathione; group; gsh; healing; herpes; hlu; hsv; human; iga; igg; igm; il-1α; important; infection; inflammation; inflammatory; inhibition; iraqi; j.pharm.sci; levels; lipid; lower; macrophages; mda; mean; neutrophils; number; oral; oxidative; p<0.05; pain; paste; patients; period; peroxidation; placebo; post; pre; recurrent; reduction; respect; responses; results; score; serum; significant; silybinin; silymarin; silymarin paste; simplex; size; stress; study; table; time; treatment; type; ulcer; use; values; virus; viruses; vitro; vol.16
     • versions: original; plain text
455. bijps-597
     • author: A. Sabri, Lubna; A. Abdul-Rasool, Alaa; A. Shehab, Muayad
     • title: Formulation of Rifampicin Suspension
     • date: 2017-03-31
     • words: 4826
     • flesch: 88
     • summary: It is o ne of the ve ry s lightly s oluble drugs, thus is suitab le fo r s uspension dosa ge form. So me suspe nd ing age nts are ge nerally add ed to the disp ersion me dium in o rd er that their structure s he lp to mainta in unifo rm disp ersibility (2) o r to preve nt c aking o
     • keywords: add; age; agent; aqi; aqueous; ared; arrhe; bag; ble; date; diffe; dis; disp; diss; dium; drug; eac; ellulo; ely; figure; formula; gra; gum; ility; ing; ium; j.pha; lution; lyso; mpe; mples; nts; olutio; ous; owde; pension; pharm; powder; prepa; rate; ready; res; rifa; rifactine; rifampicin; rm.sc; rma; rmulation; scmc; sed; siev; sily; sodium; stud; suspe; tha; time; ting; tion; tive; tures; use; vol.15; volume; water; whic; معلق
     • versions: original; plain text
456. bijps-598
     • author: S. Shaokat, Siham; A. Hameed, Hamoudi
     • title: Synergistic Effect of Potassium Clavulanate in Combination withCefamandol and Ceftazidime on B- Lactamase, Extracted From Resistant E.coli
     • date: 2017-03-31
     • words: 7454
     • flesch: 86
     • summary: te d e nzymes ) and –lac ta mas e from E.cloac ae P 99( ce pha lo spo rina se ) as re ference. o r Rifa mpicin(30 0 g /ml) to inhibit the growth of donor and Amoxic illin ,Tica rc illin,a nd e ftazidime to inhibit the gro wth o f recipient s train (11).
     • keywords: .the; /clavulanate; acid; aga; amc; amo; amoxic; amp; ampicillin; antibiotic; antimicrob; ard; atcc; augmentin; bac; bee; beta; cefamandol; cfm; cfz; clav; clinical; cmr; comb; comp; ctama; cteria; ctio; dec; dia; dis; disc; disk; e.c; e.coli; enzymes; esbls; figure; free; fro; ftaz; ftazidime; growth; hours; i.p; idime; illin; inatio; inc; infec; inhib; inhibition; inoc; itive; ium; j.pha; k12; lac; lacta; lactamase; mas; mase; med; method; mic; mics; mid; nalr; nce; nda; new; nic; nicillins; njuga; ntin; ntra; nts; nzyme; o f; olates; oli; pec; plas; pos; rec; res; resista; rifr; ring; rm.sc; sensitiv; ses; sistant; stra; stud; table; ted; tem; tes; ther; tic; tica; ticr; tics; time; timentin; tion; tivity; trac; trains; tric; type; ults; urs; utis; vol.15; zone; الم; ــــ
     • versions: original; plain text
457. bijps-599
     • author: N.Abood, Ahmad; I. Khalil, Yehia
     • title: Micro encapsulation of Naproxen By Complex Coacervation and Aqueous Colloid Dispersion Part ( 1 )
     • date: 2017-03-31
     • words: 4033
     • flesch: 88
     • summary: o f drug released from mic ro ca psules fro m 1 :2 , 1:1 and 2:1 core wa ll ra tio respec tively . a nti infla mmatory d rugs wid ely use d in rheumatoid arthritis and ankylo sing sp ond ylitis (4) .The ma in s id e effe cts of this drug a re GIT disturba nc es a nd bitte r tas te .
     • keywords: 0.1n; 40c; acetate; acpd; aps; ase; buffer; cap; coa; core; dis; drug; effe; enc; enca; figure; fro; hcl; ing; iraqi; j.pharm.sci; lease; metho; mic; micro; microca; min; nap; naproxe; nca; pare; pharmac; phosphate; pre; psulatio; psule; ratio; res; rma; sulation; tha; thod; time; ting; tion; ulatio; ules; ults; vol.15; wall; xen; المادة
     • versions: original; plain text
458. bijps-600
     • author: A. Taher, Mohammed; A.Hammadi, Salim; A.Ali, Ali
     • title: The Chages in Sex Hormones in Female Working in Battries Manufacturing Plant
     • date: 2017-03-31
     • words: 6029
     • flesch: 91
     • summary: The wo rkers in group I ha d blood lea d le vels s ignifica ntly lo wer tha n that in gro ups II a nd III ( P< 0.05 ),this may b e due to longer e xpo sure time in groups II and III tha n that fo r group group П, inc ludes thirte en (1 3) female that ha ve be en e mploye d for 8-14 yea rs with ra nge age (3 0-5 5) yea rs (37.9± 7 .9 )
     • keywords: .the; age; aqi; ared; ars; atio; batte; bee; blood; changes; comp; ctin; diffe; elev; erum; expos; female; fsh; ges; group; hav; higher; hirs; hormones; hyp; ignifica; iii; inc; increase; indica; j.pha; lead; lev; leve; levels; low; male; mea; menstrual; mic; mis; mong; nce; non; ntly; nts; ontrol; p<0.005; pituita; plant; prolac; relea; res; results; rkers; rm.sc; rria; rum; sed; sex; signific; sterone; stud; sure; table; ted; tes; tha; time; tin; tion; tional; tive; total; toxic; tudy; twe; und; ups; ure; utism; vels; vol.15; wome; worke; workers; yea; العامالت; عند
     • versions: original; plain text
459. bijps-601
     • author: S. Al-Mohammadi, Suhad
     • title: Detection of Cholesterol in Suaeda Baccata (Chenopodiaceae)
     • date: 2017-03-31
     • words: 3801
     • flesch: 93
     • summary: 30 18 1 1 Olive oil 0.5-2 19 ,2 0 1 2 .S esame o il Ca.1 19 ,2 0 Chole sterol and its e sters a re imp orta nt constituents o f plant me mbrane s. The follo wing ta ble re prese nts Sc i., Vol.15 (2 ) ,2006 Detec tion o f choles tero l in su aed a bacca ta 32 Figure (3 ) :conve rsion o f choles te ro l to pro ge ste rone (27) Material a nd Meth ods The p la nt materia l (a eria l pa rt) wa s collec te d during mo nths o f July, Augus t, and S epte mber 200 5.
     • keywords: bacca; bio; ble; ch3; che; choles; cholesterol; chondria; detec; eda; etate; ethe; ethyl; extra; f choles; figure; free; hplc; inc; iraq; ity; j.pha; lipid; london; mic; mily; mito; o f; oil; oils; ome; plant; plate; qua; rep; res; rial; rm.sc; standard; steroids; sterol; sua; suaeda; synthes; table; tha; tion; tion o; tis; tlc; ture; unive; urfa; urs; vol.15; wild; xtract; الك; ستير
     • versions: original; plain text
460. bijps-602
     • author: R. Abed Al- Rahman, Issraa
     • title: Effect of Temperature on the Stability and Release Profile of Ibuprofen Microcapsules
     • date: 2017-03-31
     • words: 5661
     • flesch: 79
     • summary: te d in 5 0ml o f methano l, te d
     • keywords: 40oc; 4oc; aps; aqi; aqueo; aqueous; arrhe; ase; buffe; cap; ccoo; che; cia; coa; conta; core; diffe; different; drug; effe; ffec; figure; fro; gelatin; hange; hav; havior; ibuprofe; iner; ing; j.pha; lease; lution; metho; mic; mic ro; micr; microca; microcapsules; month; mpe; mperature; nius; o f; ope; organic; ous; pare; physica; polymers; pre; prepa; profile; psule; que; ra ture; rate; ratio; ratures; red; releas; rgy; rm.sc; rraa; stability; storage; store; stud; te mpe; tempe; thod; time; tion; tive; ture; ules; uprofen; vol.15; wall; whic; yie; المجهرية; تحرر; ثباتية; درجات; عند; كبسوالت
     • versions: original; plain text
461. bijps-603
     • author: S. AL-Taee, Muthanna; Y. Saour, Kawkab; M. Mohammed, Haider
     • title: Evaluation of Analgesic Activity of Newly Synthesized Phthalyl- tyrosyl-glycin Sodium
     • date: 2017-03-31
     • words: 3600
     • flesch: 89
     • summary: Understa nding the p owe rful mo le cula r, biologic al a nd physio logical te rms o f opioids was used to dev elop a nalges ic c ompo unds with significant advanta ge s o ve r morphine (9). The animal jumps 2 4.8 ± 2.4 time s/25 s eco nd s which rep re se nts the a nalge sia s core.
     • keywords: activity; ana; analgesic; anima; ant; bind; comp; core; diffe; different; drugs; eds; effe; effect; enkep; figure; firs; fro; glycin; group; hcl; hyperalge; ide; ing; jumps; leu; lges; lin; med; mice; morphine; nalge; nce; new; onse; opioid; p<0.05; pha; pharmaco; phthalyl; plate; prese; ptides; rece; receptors; res; rma; rsity; sia; significant; sodium; stud; sults; thes; tion; tyros; tyrosyl; york; الحيوان; الصفيحة; الم; مركب; موعة
     • versions: original; plain text
462. bijps-607
     • author: Abed Al- Rahman, Issraa Rasheed; A. A.Rasool, Alaa; A. Tawfiq, Fatima
     • title: A Modified Organic Method for Preparation of Ibuprofen Microcapsules As a Sustained Release Solid Dosage Form
     • date: 2017-03-31
     • words: 3404
     • flesch: 46
     • summary: PEG4000 had a little decreasing effect on the yield and encapsulation efficiency and little increasing effect on percent of drug release per time. A modification of aqueous colloidal polymer dispersion method was utilized for microencapsulation of ibuprofen, through replacing the water required for ethylcellulose dispersion (30%) with chloroform (20%) as shown in scheme(2), which provided a good percent yield and encapsulation efficiency of ibuprofen microcapsules.
     • keywords: 37ºc; addition; alginate; aqueous; balkaprofen; buffer; calcium; chloride; colloidal; comparison; compressed; compression; core; different; dispersion; dissolution; dosage; drug; effect; efficiency; equivalent; ethylcellulose; fenbid; figure; formula; ibuprofen; iraqi; method; microcapsules; microencapsulation; modified; organic; original; parma; peg4000; percent; phosphate; polymer; preparation; prepared; proportion; ratio; reference; release; room; sci; spansule; sustained; tablet; vol.14; wall; weight; yield; المادة; ملغم; � �
     • versions: original; plain text
463. bijps-608
     • author: .F. AL.Fakhri, Elham
     • title: BIOCHEMICAL FEATURES of IRAQI PATIENTS INFECTED WITH HEPATITIS E VIRUS COMPARED WITH THOSE INFECTED WITH HEPATITIS A VIRUS
     • date: 2017-03-31
     • words: 2164
     • flesch: 63
     • summary: Table I shows that the ages of patients infected with hepatitis E virus were (19.22 ± 1.48) years old while those with hepatitis A were (7.76 ± 1.05) years old. 7.76 1.05 15.52 2.44 Table I Table II shows that all the patients of both groups were icteric but the level of total serum bilirubin of patients with hepatitis E virus were insignificantly higher than those with HAV (t =1.388 .p< 0.05)(Fig.(1))
     • keywords: acute; adults; alanine; alkaline; alp; aspartate; bilirubin; children; damage; disease; gamma; ggt; glutamyl; hav; hepatitis; hev; high; higher; infected; infection; iraqi; level; liver; normal; parma; patients; phosphatase; range; results; sci; serum; study; table; total; transaminase; transferase; transmission; viral; virus; vol.14; years; الكبد
     • versions: original; plain text
464. bijps-609
     • author: HAMZA SAMIN, LAITH
     • title: FORMULATION OF ECONAZOLE NITRATE AS A TOPICAL SOLUTION
     • date: 2017-03-31
     • words: 2552
     • flesch: 64
     • summary: The use of plastic or glass container for Econazole nitrate drug had no effect since the same percent remaining were seen when drug solution was stored the drug at different temperature. The results indicated that the use of propylene glycol and ethanol as a vehicle for EN which is very slightly soluble in water gave amore stable formula as EN topical solution, with a shelf life of about 3.15 years .The data also indicated that the light accelerated the degradation of EN, while the type of container (glass or plastic) had no effect on the rate of drug.
     • keywords: assay; clear; container; content; control; degradation; different; drug; econazole; effect; formula; glass; glycol; hydrolysis; iraqi; light; methanol; method; months; nitrate; parma; percent; product; propylene; quality; results; room; samples; sci; solution; stability; stable; study; temperature; time; topical; type; vol.14
     • versions: original; plain text
465. bijps-610
     • author: N. Najem, Sami,
     • title: MAGNESIUM, ZINC, AND COPPER IN SERUM, ERYTHROCYTE, URINE AND DIALYZATE FLUIDS OF HAEMODIALYSIS PATIENTS
     • date: 2017-03-31
     • words: 2294
     • flesch: 66
     • summary: The lowest value of urinary Zn found in oliguric patients while the highest was in polyuric patients, which reflects the variation in serum and RBC Zn (tables 1, 2). 1.10.02 0.30.01 Solution of oliguric patients 0.60.02 10.02 0.40.03 Solution of Polyuric patients 1.30.2 0.90.25 0.430.1 DISCUSSION:
     • keywords: cases; control; copper; dialysis; dialyzate; elements; elevated; fluids; group; haemodialysis; high; iraqi; levels; magnesium; mean; oliguric; p<0.05; parma; patients; polyuric; ratio; rbc; renal; sci; serum; solution; table; trace; treatment; unuric; urine; value; vol.14; zinc
     • versions: original; plain text
466. bijps-611
     • author: A. ISA, SAADOON; M. JASSIM, SAMEER; K.A. HUSSEIN, HUSSEIN
     • title: INVESTIGATION OF BENTONITE CLAY SURFACE AS A PHYSICAL ANTIDOTE IN ADSORPTION OF AMITRIPTYLINE-HCl, CHLORPROMAZINE-HCl AND CHLORDIAZEPOXIDE-HCl FROM SOLUTION
     • date: 2017-03-31
     • words: 4177
     • flesch: 64
     • summary: Activated charcoal was the most widely used solid surface as an antidote and in drug adsorption (4-12) . The extent of drugs adsorption by bentonite followed the order: chlordiazepoxide HCl> chlorpromazine HCl > amtriptyline HCl.
     • keywords: activated; active; adsorbent; adsorption; affinity; amitriptyline; amitriptyline hcl; bentonite; certain; change; charcoal; chemistry; chlordiazepoxide; chlorpromazine; chlorpromazine hcl; clay; concentration; constant; decrease; different; drug; edition; effect; equation; equilibrium; figure; hcl; hcl adsorption; high; increase; ionic; iraqi; isotherm; kaolin; langmuir; lnxm; log; magnesium; materials; molecules; parma; pharm; physical; poisoning; process; sci; solid; solubility; solution; strength; study; surface; temperature; time; treatment; uptake; value; vitro; vol.14
     • versions: original; plain text
467. bijps-612
     • author: Elldin Al- Jaff, Ashwaq Najjem
     • title: ROLE OF SERUM ZINC AND COPPER AND ZINC/ COPPER RATIO IN ALOPECIA AREATA
     • date: 2017-03-31
     • words: 2311
     • flesch: 62
     • summary: # Significantly different from alopecia areata patients with mild severity (p<0.05). The present study showed a significant decline in serum Zn level in Alopecic patients (Table 1), a fact that agree with that of Tasaki et al (14) who, in addition to alopecia areata, reported comparable decreases in Zn levels in serum of patients with other skin diseases (e.g. bullous pemphigoid and decubitus ulcer).
     • keywords: absorption; alopecia; areata; cell; clinical; concentration; control; copper; deficiency; disease; edition; eds; free; function; group; immune; iraqi; level; mean; mild; oxidation; oxidative; parma; patches; patients; presence; present; progression; ratio; role; sci; serum; severity; significant; study; subjects; system; table; vol.14; zinc; الزنك; الصلع; داء; ھذه
     • versions: original; plain text
468. bijps-613
     • author: A. Abdul R asool, Dr. Alaa; Al – Dujali, Dr. Hikmet
     • title: The Effect of some Variables on the Formulation of Captopril as Tablets Shaymaa Nazar Al – Sammarrai
     • date: 2017-03-31
     • words: 3657
     • flesch: 57
     • summary: Hardness (kg) Friability (%) Disintegration time (min) Dissolution time for 100% release (min) 4 2X 4 0.7 1.3 25 5 3X 1 7 2 25 – 30 6 X 2.5 5 1 20 Table (3): Effect of binder concentration on the physical properties of captopril tablets of suggested formulas 4,5, and 6. Table (4): The effect of diluent on the physical properties of captopril tablet and the release of captopril from suggested formulas 4 and 7. On the other hand, using a combination of avicel and starch formula (14) or avicel alone formula (15) as a disintegrant resulted in a harder and less friable tablet.
     • keywords: 0.1n; 60c; avicel; binder; c.m.c; captopril; comparison; concentration; corn; degradation; different; diluent; disintegrant; disintegration; dissolution; dosage; drug; effect; england; explotab; extra; figure; formula; friability; germany; hardness; hcl; high; hypertension; incorporation; intra; intragranular; iraqi; lactose; method; min; miniten; minutes; oven; p.v.p; parma; physical; plain; prepared; properties; release; results; satisfactory; sci; starch; study; tablets; time; type; vol.14
     • versions: original; plain text
469. bijps-614
     • author: K. Al –Temimy, Bazigha; A. Abdul –Rasool, Alaa
     • title: Formulation, Stability and Bioequivalency Study of Prepared Salbutamol Sulphate Nebules.
     • date: 2017-03-31
     • words: 2101
     • flesch: 62
     • summary: The same method was repeated for salbutamol sulphate nebules. Quantitation of salbutamol sulphate nebules was accomplished by plotting the concentration in mg/ml against peak height, as shown in fig.
     • keywords: absorbance; acid; ampoules; analysis; bioequivalency; concentration; dose; drug; equal; formula; inhaled; iraqi; iraqi j.; j. parma; life; lung; method; nebules; nebulization; parma; patients; potassium; prepared; rate; salbutamol; salbutamol sulphate; sci; shelf; sodium; solution; stability; stable; study; sulphate; time; treatment; unchanged; urine; ventolin; vol.14; رذاذ; � �
     • versions: original; plain text
470. bijps-615
     • author: Karim F. Jumaa, Abdul; A.Abdulrasool, Alaa; A.Al – Dujali, Hikmet
     • title: Formulation and Clinical Evaluation of Orphenadrine citrate as a Plain Tablet
     • date: 2017-03-31
     • words: 7708
     • flesch: 88
     • summary: who state d that inco rpo ra tion of s upe r d is inte grant in the intra gra nula r pha se re sulted in fas ter tablet diss olutio n than did inc orporating it in the extragra nular phase o r bo th p ha ses . .One of thes e theories is that they red uce s ke le ta l mus cle sp as m , p os sibly thro ugh a n a trop ine like central a ctio n o n ce re bra l moto r centers o r on the me dulla
     • keywords: .it; .the; 0.1n; ared; arkins; atie; bility; bind; blets; citrate; cle; cmc; comp; diffe; diluent; dise; disintegra; diss; dition; drug; dys; editio; effe; effect; eptab; extra; fig; formula; fria; friability; fro; goo; grant; hardnes; hcl; inc; indica; ing; integration; ium; j.pharm.sc; lease; linica; lution; mannito; mins; minutes; mor; mparison; mpe; mus; nadrine; nce; nde; nia; nnitol; nts; olutio; orphe; orphenadrine; pha; ponse; pre; prepa; prope; pvp; q.s; reference; res; rine; rma; sho; showe; starch; study; symptoms; tab; table; tablets; ter; tha; time; tion; tme; tre; trea; ture; type; ults; use; utic; ver; vol.15; wee; whic; على
     • versions: original; plain text
471. bijps-616
     • author: H.AL-Khateeb, Ekbal; AL-Shamma, Ali A.; A. Nehar, Bajes
     • title: A Study of the Furocoumarin Derivative of Ruta Chalepensis L. (Rutaceae)
     • date: 2017-03-31
     • words: 2920
     • flesch: 98
     • summary: Moreo ver the C-H o ut p la ne b end ing vibration at 87 0 cm- 1 is due to o ne fre e (H) in benze ne ring. ال ة الم ن النباتات الطبي سذاب م ان نبات ال وري دراسـة .
     • keywords: alen; ba1; cha; che; cm-1; comp; crys; ctrum; eng; fig; hing; j.pharm.sc; metho; mpound; nmr; ounds; pea; plant; ruta; standard; str; tic; tion; vol.15; الم; النبات; ركب; هذا; هذه
     • versions: original; plain text
472. bijps-617
     • author: N. Al- Jaff, Ashwaq; A.Humadi, Salim; A. Wohaieb, Saleh.
     • title: The Ability of Nutrient Antioxidants to Influence Oxidative Stress and Lower the Dose of Prednisolone in Patients with Alopecia Areata
     • date: 2017-03-31
     • words: 4171
     • flesch: 91
     • summary: y ma y b e associated with s ep tic necrosis of the hip or se ve re gas trointes tinal b le ed ing ( 12,13). te d that, despite the difference in o ra l pred niso lo ne dose (1 0 vs. 100 mg) be tween the two groups, addition of nu trie nt a ntio xida nts to pred niso lo ne therap y resulted in compa ra ble and significa nt d ecrease in MDA lev els and correction of GSH co ntent in blood , as well as simila r improve ment in the ra te o f ha ir growth with less side e ffec t (ac ne, weight ga in a nd ga stro intestina l disturba nces) re gardless the do se of p re dnisolone.
     • keywords: age; alopecia; antioxida; area; areata; atmen; ble; contro; cts; diffe; dniso; effe; ffec; group; growth; gsh; hair; iiant; immune; ing; j.pharm.sc; mda; mea; min; months; n=2; n=27; nce; ntrol; nts; numbe; nutrie; nutrient; olone; othe; patie; patients; plasma; pre; prednisolone; res; rma; sha; signif; stress; study; sys; tion; tment; trea; ubje; use; value; vita; vol.15; xidants; إلى; تقليل
     • versions: original; plain text
473. bijps-618
     • author: A. Muhi-Eldeen, Zuhair; F. Hassan, Samira
     • title: Synthesis and Characterization of 2(2-Tetrahydropyranylthio) methyl cyclopropylamine
     • date: 2017-03-31
     • words: 3728
     • flesch: 90
     • summary: من الخ عة تحـت الح ه اش ة تقني واسط هائية ب والن ة طي كبات الوس غناطيسـي (IR)تم تشخيص المر ن الم رني ف اـل -H)وطـي NMR ) عناصر االولية خيص ال e) وتش le me ntal a nalys e s معالجة . The re fo re the se co mpound s may be utilize d se le ctiv ely to treat one o r mo re of the previously me ntio ned d is ea se s. SYNTHETIC MATERIAL Allylmercaptan , p- to luenesulfonic acid , dihyd ropyran e thldiazoce ta te , we re obtained fro m
     • keywords: 2(2; add; ana; arra; ch2; chlo; ctio; ctrum; cycloprop; free; gas; group; hloroform; hyd; infrared; ing; j.pharm.sc; ment; minutes; mixture; multiplet; nge; nmr; ntal; pane; propa; rad; rea; rop; spe; stre; tempe; tion; tra; trahyd; und; vol.15; yclop; yranylthio; zide
     • versions: original; plain text
474. bijps-620
     • author: M.H. Al–Mhbashy, Hasan; A. Hussain, Saad; A.M. Numan, Nawfal; A. Saed, Majeed
     • title: The Effects of Melatonin On The Oxidative Stress , Protein Glycation , Microalbuminuria and Lipid Profile In Type II Diabetes Mellitus
     • date: 2017-03-31
     • words: 6142
     • flesch: 93
     • summary: Ox idativ e Stre s s, Me la to nin,Mic ro albuminuria. Erythrocytes and plas ma glutathione lev els were meas ured ac co rding to the method of God in e t al.
     • keywords: afte; ant; antioxid; atio; ativ; betic; ble; cted; ctiv; cts; dama; days; diabe; effe; els; fter; gsh; hdl; howe; ind; ing; j.pharm.sc; ldl; lev; leve; lipid; lues; mda; melatonin; mic; min; mplic; nce; ntly; nts; o f; obs; ontrols; oxid; plas; plasma; pre; profile; protec; protein; red; res; rma; rror; signific; sma; spe; stre; stud; tab; table; ted; tha; thy; tic; time; tion; tive; tment; total; trea; treatme; type; uce; ults; vels; vol.15; الدم
     • versions: original; plain text
475. bijps-621
     • author: A.Taher, Mohammed
     • title: Effect of Metformin and Antioxidant Agents on Hirsutism in Women with Polycystic Ovary Syndrome
     • date: 2017-03-31
     • words: 3693
     • flesch: 90
     • summary: f t r e a t m They we re tre ated with metformin a lo ne a nd with antioxida nt age nts (vita min E o r C).It was found that all pa tie nts who treated with me tformin or with co mbina tion o f metformin with antioxid ant agents s ho wed s ignifica nt d ec re ase in hirs utis m s co re .
     • keywords: .5±; agents; ant; antioxid; atie; atme; ble; clin; clinical; duc; effec; erum; fter; gro; group; growth; hirs; hirsutism; histurism; hyp; insulin; men; metformin; months; n=1; nts; ova; ove; pcos; res; sis; sterone; t.i.d; tab; ted; tes; tha; tion; tme; tment; trea; use; utis; vita; women
     • versions: original; plain text
476. bijps-622
     • author: A. Wohaieb, Saleh
     • title: Effects of Allopurinol on Ketone Body Metabolism and Tissue Lipid Peroxidation in Alloxan Diabetes in Rats
     • date: 2017-03-31
     • words: 5595
     • flesch: 92
     • summary: f p atie nts with type II diab etes with mild hypertens ion (3) and in v ario us tis sues o f ra ts exp os ed to oxida tive stre ss ind uce Howe ver, the single a llop urinol a dministratio n was a ble not only to lower ketonuria , but a ls o the inc id ence o f e arly ke to sis–a ss oc ia te d mortality in diabe tic rats, a fact sugge stive of a pos sible effe ct o n
     • keywords: 1hr; allo; allopurino; alx; anima; animals; bete; betic; ble; bod; ctio; diabe; diffe; early; effe; els; ent; erime; exp; furthe; hyd; i.p; ility; inc; inductio; ing; ingle; inje; insulin; inv; j.pharm.sc; ketone; lev; leve; line; lipid; llop; mea; mia; minis; ntal; ody; plas; pos; pres; rats; riod; rma; ros; sis; sma; state; sue; table; tba; ted; tes; ther; tic; tion; tiss; tive; tration; tre; trea; urinol; vels; vent; vol.15; إلى; السك; الل; الم; ورين
     • versions: original; plain text
477. bijps-623
     • author: H Al-Sahaf, Fadhil; H Al-Samara’i, Madeha; J Al-Ndawi, Muna
     • title: Effect of Nitrogen and Phosphorus Levels on Yield, Concentration, Physical and Chemical Properties of Dill Seed Oil
     • date: 2017-04-01
     • words: 5424
     • flesch: 89
     • summary: Chub ey B B, Do rrell D G Cha nge s in the che mical compos ition o f dill oil d uring hyd ro d is tillatio n, Can J . tub er d is ea se s (6).Dill se ed may c ontain 4% o f oil (7) with es se ntia l oil (c hiefly co ns is ting of c arvo ne, limo nine and terpens), fa tty oils , pro te ins, ta nnins, re sins a nd mine ra l sa lts (4).
     • keywords: analysis; ane; app; baghdad; carvo; comp; compounds; conce; ctiv; dill; effe; effect; els; entratio; fertilizatio; ffec; gen; grave; growth; ha-1; horus; increa; inde; ing; ity; j.pharm.sc; lev; leve; lity; n2p; nce; nitro; nitrogen; nsity; nstituents; ntra; nts; o f; o il; oil; oils; olens; onc; pho; phosp; plants; properties; qua; refra; res; rtiliza; rus; seed; ses; singh; table; tha; tion; titue; tive; ulture; usa; vol.15; whe; yie; yield; زيت
     • versions: original; plain text
478. bijps-624
     • author: B. H. Al-Khedairy, Eman
     • title: In Vitro Release Study on Capsules and Tablets Containing Enteric - Coated Granules Prepared by Wet Granulation
     • date: 2017-04-01
     • words: 3691
     • flesch: 87
     • summary: Sa mples were taken at certain ti me intervals and assayed fo r diclofena c so dium spec trophtometric ally a t its λ max 27 3 nm fo r the ac id me dium and at λ max 27 6 nm for the buffer medium. te buffer o f p H 6 .8 , then sa mpling were co ntinue d fo r 45 minutes (10).
     • keywords: acid; ared; buffer; butyl; coated; coating; comp; disintegra; dissolution; dium; drug; effec; encapsula; ente; enteric; eur; fig; form; fro; grant; granules; isso; ition; j.pharm.sc; lease; lution; med; medium; minutes; mpressed; nce; pha; phthalate; plas; polyme; pre; release; res; rug; sdi; tab; tablets; ted; tha; time; ting; tudy; ulated; vol.15; غلف
     • versions: original; plain text
479. bijps-625
     • author: I.Mustafa, Besma
     • title: Gender Differences of Serum Leptin Hormone Levels in Iraqi Population
     • date: 2017-04-01
     • words: 3544
     • flesch: 88
     • summary: To e va luate and comp are se rum Leptin ho rmo ne leve l be twe en Iraqi male & female and the re la tion betwee n this ho rmo ne & BMI in the se two groups. Wa uters M, Me rtens I, Cons idine R, e t al. Are le ptin leve ls de pende nt on bod y fat distribution in ob es e men a nd wo men?
     • keywords: blood; bmi; bod; cts; diabe; difference; els; eral; fat; fig; gender; gluc; gro; group; highe; hormone; intake; iraq; j.pharm.sc; lep; leptin; leve; lly; male; men; ntly; obe; ous; plas; ptin; rmo; role; serum; sity; table; tha; timula; ting; tion; tudy; twe; vol.15; weight; women; بين; مستوى
     • versions: original; plain text
480. bijps-626
     • author: A. Al-Ftahi, Yousif; H.Al – Jawad, Fuad; F.Al – Mejwel, Nidhal
     • title: Synthesis of 3 - 3 - gem - di - C -Nitromethyl Nucleoside Analogues of Possible Biological Activity
     • date: 2017-04-01
     • words: 4041
     • flesch: 91
     • summary: invo lve d the c onv ersion of the protec te d sugar (9 ) in to the rea ctive e lectrophilic 1 ,2 – ac etyloxo nium io n fo llowe d b y the s ilyla te d urac il (13 ) attak to affo rd the p rote cted urac il nucleos id e analogue (14) with the regenera tio n of the catalyst . f the huma n immuno de ficiency v irus (HIV)(4,5) , hav e ta rgeted the inves tigatio n for utilizing new nucleos id e analogues .Effo rts ha ve prima rily fo cused o n modific atio n
     • keywords: .the; 1,2; 5,6; ace; analogue; anhyd; atio; ativ; benzoyl; bromide; che; chem; deoxy; dium; ene; eriv; gem; j.pharm.sc; llowe; mixture; mmol; new; nhydrous; nitrome; nitromethyl; nmr; nucleos; oprop; pec; rea; res; ribo; sis; sugar; thyl; tion; tra; urac; vol.15; wa s; ylid; yrup
     • versions: original; plain text
481. bijps-627
     • author: H. Samein, Laith
     • title: Clinical Evaluation of a Formulated Econazol Nitrate as A Topical Solution
     • date: 2017-04-01
     • words: 2867
     • flesch: 92
     • summary: o f e thano l (96%) 1 in 60 It has be en prove n to be e ffe ctiv e in the pres enc e of mixed infection.
     • keywords: ared; aryl; clinical; cure; eco; effe; evaluation; formula; fungus; ide; j.pharm.sc; kin; myco; nazole; nitrate; ntification; nts; patie; patient; pev; rapy; res; results; rma; solution; table; tients; tion; tive; tme; trea; vol.15; wee; yea; zole; االيكانازول; محلول; نترات
     • versions: original; plain text
482. bijps-629
     • author: Al-Ubaidy, Bashier; K. Al-Khashali, Dawsar; A. Numan, Nawfal
     • title: The Role of Oxidative Stress In Lead Poisoning
     • date: 2017-04-02
     • words: 5374
     • flesch: 92
     • summary: Gluta thione leve ls we re determine d in e rythro cyte s and p la sma acc ording to the me thod of Go din e t al (15). Thirty male and females workers e mploye d in the Iraq i storage ba ttery (age range 2 0-40 ye ars) were pa rticipating in this stud y. Additio nally, 11 he althy subjec ts were se rv ed as hea lthy controls , with the sa me age ra nge comp ared to workers group, to a void the effects o f age variatio ns on the studied pa ra meters.
     • keywords: acta; age; albumin; ant; antioxid; ared; atio; bio; ble; bloo; cha; comp; cop; ctiv; cyte; dec; erythroc; ffec; free; glutathione; gsh; hea; ignifica; inc; ind; j.pharm.sc; lea; lead; lev; leve; lipid; lthy; mda; med; metho; mins; nge; ntly; ntrol; nts; o f; oxida; parame; peroxid; plas; plasma; pre; protein; rad; ros; rythro; signific; sma; spe; stress; stud; sure; tab; ted; thod; tion; tive; tme; trea; treatment; tudy; value; vels; vit; vita; vol.15; worke; workers; األ; الت; الم
     • versions: original; plain text
483. bijps-630
     • author: D. Saud, Muthanna
     • title: Conjugation of Steroidal and Non – Steroidal Anti- Inflammatory Drugs as Possible Mutual Prodrug
     • date: 2017-04-02
     • words: 4877
     • flesch: 90
     • summary: r p art o ac id (glycine) as a s
     • keywords: c17; c21; chlo; chloride; chro; cid; cific; comp; compound; ctio; ctiv; dias; diffe; drug; duc; glycine; group; hav; hyd; hydroxyl; ibupr; ing; inv; ite; j.pharm.sc; med; mixture; mpound; nyl; olone; olute; ome; omp; ompo; othe; ound; partition; pre; prednis; rea; rma; rme; rofen; sep; spe; ster; synthesis; t.l.c; thes; thio; thro; tion; tive; ugh; vol.15; المركب; على; مجموعة
     • versions: original; plain text
484. bijps-631
     • author: D. Saud, Muthana; M. Ghani, Suhair
     • title: Phosphodiester Conjugation of Metronidazole and Dexamethasone as Possible Mutual Prodrug
     • date: 2017-04-02
     • words: 4358
     • flesch: 91
     • summary: Mutua l pro – d rugs fo r co rticos te ro id s were also s ynthesized through co njuga tion w ith no n – steroida l anti – inflammatory drugs using a n amino a cid as s pa cer arm(17). Cortico steroids were us ed in the se pro – drugs either a s p ro moiety for ta rge ting the ac tiv e s pe cies as in the cas e of a ntic anc er agents (13,14), or a s the a ctiv e spe cies which we re co njuga ted to promo ie ties to c ha nge *De par tme nt o f Ph arma ce utic al Ch emistry Colle ge o f Pha rmac y, Unive rs ity of Baghdad ,Baghdad- Ir aq.
     • keywords: anhyd; artitio; che; chem; coe; comp; compound; dcc; diffe; drugs; een; figure; gent; hate; hyd; ing; ity; j.pharm.sc; linkage; lipid; metro; mic; mpound; mutua; nce; nde; nidazole; njuga; o f; olute; ound; pha; phosp; pro; purity; pyridine; rea; rma; rtition; size; spe; sphate; ster; synthe; t.l.c; thas; thes; thro; time; tion; tive; tronid; u.v; ueo; ugh; unive; vol.15; water; whic; xame
     • versions: original; plain text
485. bijps-660
     • author: T. Salih, Nagham; J. Kadhim, Dheyaa
     • title: Adherence to American Society of Health-System Pharmacists Surgical Antibiotic Prophylaxis Guideline in Medical City Teaching Hospitals/Baghdad
     • date: 2017-04-10
     • words: 3001
     • flesch: 46
     • summary: The objective of this study was to evaluate the antibiotic administration pattern for surgical antibiotic prophylaxis and the adherence to American Society of Health-System Pharmacists surgical antibiotic prophylaxis guideline in Medical City Teaching Hospitals/Baghdad. Surgical antibiotic prophylaxis refers to the use of preoperative and postoperative antibiotics to decrease the incidence of postoperative wound infections.
     • keywords: adherence; administered; administration; american; antibiotic; antimicrobial; ashp; baghdad; choice; city; clean; correct; current; discharge; doses; duration; general; guideline; health; hospital; infections; iraqi; medical; patients; pharmacists; practice; procedures; prophylaxis; rate; sci; site; society; ssis; study; surgery; surgical; system; teaching; time; use; vol.25(2; wound; اٌذساسح; اٌذيىيح; اٌىلائيح; اٌّضاداخ
     • versions: original; plain text
486. bijps-661
     • author: N. Taher, Mohanad; A.Hussein, Ahmed
     • title: Formulation and Evaluation of Domperidone Nanoemulsions for Oral Rout
     • date: 2017-04-10
     • words: 5735
     • flesch: 53
     • summary: Iraqi J Pharm Sci, Vol.24(2) 2015 Domperidone nanoemulsions 77 Formulation and Evaluation of Domperidone Nanoemulsions for Oral Rout Mohanad N. Taher *,1 and Ahmed A.Hussein ** * Iraqi Ministry of Health, Directorate of Technical Affairs, Baghdad, Iraq. Domperidone nanoemulsions 78 Reducing droplet sizes to the nanoscale leads to some very interesting physical properties, such as optical transparency and unusual elastic behavior (3) .
     • keywords: acid; afm; anise; anise oil; aqueous; average; band; best; concentration; delivery; development; diagram; different; dissolution; distribution; domperidone; domperidone nanoemulsion; double; droplet; drug; effect; ethanol; evaluation; faster; figure; formula; formulation; globule; higher; index; international; iraqi; j pharm; journal; measurement; mix; months; nanoemulsion; oil; oils; oleic; oral; particle; pdi; peppermint; percentage; periodic; pharm; pharmaceutics; phase; potential; prepared; profile; propanol; ratio; release; results; sci; selected; size; smallest; solubility; stability; stretching; studies; study; surface; surfactant; suspension; system; table; temp; transmittance; transparency; tween; type; viscosity; vol.24(2; water; week; zeta
     • versions: original; plain text
487. bijps-666
     • author: Chaplenko, Alexander; Monogarova, Oksana; Oskolok, Kirill
     • title: Colorimetry and Indirect X-ray Fluorescence Determination of Active Ingredients in Tetracycline Hydrochloride Drug and Injection Solution of B12 Vitamin Using of Polyurethane Foam Sorbents
     • date: 2017-12-25
     • words: 2620
     • flesch: 44
     • summary: This fact can be used for adequacy test of colorimetric techniques using indirect X-ray fluorescence determination of mentioned above organic substances on «heavy labels». Figure (1): Selection of optimal pH value of Zn2+and Co2+ sorption (n = 5, P = 0.95) Figure (2): Selection of optimal time of Zn2+ and Co2+ sorption Metrological characteristics of colorimetric and indirect X-ray fluorescence determination of active ingredients in drugs after sorption on PUF sorbent are presented in Table 1. Table (1): The metrological characteristics of colorimetric and indirect X-ray fluorescence determination of tetracycline hydrochloride and cyanocobalamin using PUF sorbents (n = 5, P = 0.95)
     • keywords: active; analytical; available; calibration; chemical; chemistry; colorimetry; complex; cyanocobalamin; determination; device; drugs; fluorescence; foam; hydrochloride; indirect; ingredients; ions; measurement; method; pharmaceutical; polyurethane; puf; ray; sample; separation; signal; solution; sorbent; sorption; standard; substances; table; tetracycline; use; water
     • versions: original; plain text
488. bijps-671
     • author: AlZubaidi, Ruaa Fadhil Abbas; Al-Shawi, Nada Naji
     • title: The Impact of Two Doses of Vitamin K2 (Menaquinone-7) on Doxorubicin-Induced Hepatotoxicity in Rats
     • date: 2017-12-25
     • words: 3647
     • flesch: 56
     • summary: Furthermore, in group V rats, which received MK-7 at a dose of 16 µg/kg body weight/day orally prior to 15 mg/kg of Dox, there were non-significant (P>0.05) differences in the intended enzymes compared to positive control group; however, in group VI rats received MK-7 at a dose of 48 µg/kg body weight/day orally prior to 15 mg/kg of Dox exhibited significant (P<0.05) decrease in serum ALT, ALP enzymes activities, and TB compared to positive control group. - Values with non–identical superscripts capital letters (A and B) are significantly different (P<0.05) compared to positive control group utilizing unpaired Student t-test.
     • keywords: activities; alp; alt; animals; antioxidant; baghdad; bilirubin; blood; body; body weight; cell; central; college; consecutive; control; control group; damage; day; days; degeneration; different; dose; dox; doxorubicin; effects; enzymes; examination; figure; gavage; group; group vi; hepatotoxicity; histological; histopathological; iii; impact; iraqi; kg body; liver; med; menaquinone-7; mk-7; negative; oral; oxidative; p<0.05; pharm; positive; protective; rats; sci; section; serum; significant; single; single dose; study; university; vacuolar; veins; vitamin; vol.26(2; weight; اىنبذ; اىَدَ٘عت; عقبس
     • versions: original; plain text
489. bijps-672
     • author: Abdul Ridha, Doaa Kadhim; Al-Shawi, Nada Naji
     • title: The Impacts of Graded Doses of Pyridoxine on the Biomarkers, Aspartate Aminotransferase, lactate Dehydrogenase and Total Antioxidant Capacity in Doxorubicin-Induced Cardiotoxicity in Female Rats
     • date: 2017-12-25
     • words: 5868
     • flesch: 51
     • summary: Effect of anthracycline antibiotics on oxygen radical formation in rat heart. The aim of the current study was to investigate the possible protective effect of graded doses (5, 10, and 15mg/kg) of pyridoxine hydrochloride intraperitoneally (IP) injected for four consecutive days against single dose of (15mg/kg) doxorubicin-induced cardiotoxicity in female rats IP injected at the fourth day only.
     • keywords: 10mg; 15mg; activities; activity; aminotransferase; animals; antioxidant; aspartate; ast; baghdad; biology; cardiotoxicity; clinical; consecutive; consecutive days; control; control group; days; dehydrogenase; differences; different; dose; doxorubicin; doxorubicin cardiotoxicity; effect; enzymes; female; female rats; figure; free; group; group v; healthy; heart; homogenate; hydrochloride; identical; impact; iraqi; journal; kg doxorubicin; kg pyridoxine; lactate; ldh; letters; levels; mean; medicine; negative; negative control; non; oxidative; p<0.05; pharm; positive; prior; pyridoxine; radical; rats; reduction; research; role; sci; serum; significant; single; single dose; stress; study; superscripts; table; tac; taoc; tissue; treatment; vii; viii; vitamin; vol.26(2; water; أربعة; أيام; البايريدوكسين; الدوكسوروبيسين; المجموعة; الى; اليوم; جرعة; حقنت; غرام; كيلو; لمدة; متتالية; ملغم; هايدروكلوريد; واحدة
     • versions: original; plain text
490. bijps-679
     • author: S. Al-Lami, Mohammed
     • title: Formulation and Evaluation of Sustained and Raft Forming Antacid Tablet
     • date: 2017-07-08
     • words: 3451
     • flesch: 56
     • summary: In the preparation of sustained release floating antacid tablets, two formulas were employed using different percentages of active ingredients and polymer, floatation was accomplished by incorporation of gas generating calcium and magnesium carbonates that generate CO2 and act as active ingredient; sodium CMC was use as anionic polymer that mediate FDDS design on basis of delay gastric emptying time and buoyancy principle. The raft was formed on the top just upon addition of pulverized tablet onto the AGJ medium for both formulas 3 and 4.
     • keywords: addition; agent; agj; antacid; bilayer; british; bulk; buoyancy; calcium; capacity; carbonate; carboxy; carboxymethyl; carmelose; cellulose; characterization; cmc; content; cross; delivery; dosage; drug; effect; evaluation; figure; fluid; formulas; formulation; gastric; higher; highest; intact; iraqi; layer; magnesium; methyl; neutralizing; pharm; pharmaceutical; polymer; prepared; pulverized; raft; release; result; sci; second; significant; sodium; solution; study; sustained; system; tablets; test; time; treatment; ulcer; variation; vol.26(1; water; weight; انحًىضح; انطثمح; انًعذج
     • versions: original; plain text
491. bijps-680
     • author: B. Dikran, Sarmad; H. Zankanah, Faeza
     • title: A Highly Sensitive Kinetic-Spectrophotometric Method for the Assay of Carbamazepine in Pure and Commercial Tablet
     • date: 2017-07-08
     • words: 3363
     • flesch: 58
     • summary: Fixed time method Iraqi J Pharm Sci, Vol.26(1) 2017 Kinetic-spectrophotometric method for the assay of carbamazepine 6 Table (3): Regression equations at fixed time method for the determination of CABZ.
     • keywords: absorbance; absorption; acid; analysis; assay; azo; cabz; carbamazepine; coefficient; concentration; conditions; correlation; coupling; determination; diazonium; different; drug; dye; effect; equation; figure; initial; iraqi; kinetic; limit; method; minutes; order; pharm; pharmaceutical; product; pure; rate; reaction; regression; results; salt; sci; solution; spectrophotometric; sulfanilic; table; time; value; vol.26(1; volume; µg.ml
     • versions: original; plain text
492. bijps-681
     • author: Kadhim Drais, Hayder; A. Hussein, Ahmad
     • title: Formulation Characterization and Evaluation of Meloxicam Nanoemulgel to be Used Topically
     • date: 2017-07-08
     • words: 4291
     • flesch: 57
     • summary: Meloxicam nanoemulgel 15 when present in nanoemulgels provide many advantages in comparison to gel such as nanosize droplets and enhance solubility of meloxicam hydrophobic drug this will enhance enterance of dissolution media to hydrophobic matrix and lower diffusional pathway for meloxicam molecules to reach the dissolution media that make meloxicam nanoemulgels superior and highly prefer in comparison to meloxicam gels (8, 21) . The drug release analysis from meloxicam nanoemulgel formulations (NF1- NF7) showed the effect of oil mixture concentration at constant concentration of Smix and gelling agent,as the concentration oil mixture increase this lead decrease drug release this may be due to the high concentration of oil mixture increase hydrophobicity of formulations and this will provide retarding forces for dissolution media to pass through hydrophobic matrix and liberate the drug also the meloxicam molecules will have greater diffusional pathway to reach the dissolution media therefore it was found NF1 has greater release profile compare to other of meloxicam nanoemulgel formulations due to it had the least concentration of oil mixture that make less retarding effect for dissolution molecules and lower diffusional pathway to drug molecules to reach the dissolution media.
     • keywords: activity; afm; agent; almond; analysis; appearance; aqueous; area; characterization; concentration; content; delivery; diagram; dissolution; distilled; double; droplets; drug; effect; evaluation; excellent; figure; formulas; formulations; greater; higher; hydrophobic; increase; index; iraqi; measurement; media; meloxicam; meloxicam nanoemulgel; mixture; molecules; nanoemulgel; nanoemulsion; nf1; nf7; oil; oil mixture; particle; pdi; peppermint; pharm; pharmaceutical; phase; physical; preparation; prepared; pseudo; release; results; samples; sci; selected; size; skin; smix; stirring; study; surface; table; ternary; transparent; viscosity; vol.26(1; water; yellow
     • versions: original; plain text
493. bijps-682
     • author: R. Moustafa, Shatha; A. Omar, Shawn
     • title: Estimation of Superoxide Dismutase, Matrix-metalloprotinase-9, and Interleukin -18 in Patients with Type Two Diabetes Mellitus
     • date: 2017-07-08
     • words: 4961
     • flesch: 54
     • summary: Patients and Methods This case-control study was designed to examine the associations between the selected parameters with in T2DM patients that was performed at Hawler Medical University, College of Pharmacy on 50 patients of both genders who were randomly selected and newly diagnosed by specialist using clinical examination and confirmed by laboratory tests at diabetic center (Al-Shahida Layla Qassim) and after exclusion of other diseases by clinical history, laboratory investigations and clinical examination. Effect of controlling the disease on the Serum levels of selected parameters Serum levels of HbA1C% and glucose were founded to be significantly higher in T2DM patients (uncontrolled group) as compared with poor control and healthy subjects (p< 0.001)
     • keywords: activity; addition; age; antioxidant; blood; clinical; control; correlation; current; decrease; development; diabetes; diabetes mellitus; diabetic; difference; disease; dismutase; effect; elevated; enzymes; females; gender; glucose; group; hba1c; healthy; high; il-18; important; increase; inflammation; inflammatory; interleukin; iraqi; level; lipid; males; matrix; mean; medical; mellitus; mmp-9; parameters; patients; pharm; poor; positive; previous; process; reduction; result; risk; sci; serum; significant; sod; statistical; status; strong; study; subjects; superoxide; t2 dm; table; total; type; uncontrolled; variable; vol.26(1; women
     • versions: original; plain text
494. bijps-683
     • author: .R.Abdul, Fatima; .A.Taher, Nehad; S.Hassan, Ashraf; H. Batah, Enaam
     • title: The Effect of Coumarin Derivatives(compounds) on the Vibrio cholerae Isolates from Different Clinical Iraqi Sources
     • date: 2017-07-08
     • words: 3917
     • flesch: 56
     • summary: رًاٍَت (.كًا حى قٍاط حغاعٍتEltor)انؼششة كاَج يٍ َٕع رٍشا ٔبُغبت يقأيت انغبشٔفهٕكغاعٍٍ , َٕسفهٕكغاعٍٍ ,االسرشٔياٌغٍٍ, االيبغهٍٍ ٔانغٍفشحٕكغٍٍ ٔااليٍكاعٍٍ كاَج اكزشانًضاداث حا ػهى انخٕانً, بًٍُا كاَج نهكهٕسيفٍُكٕل ٔانكٕاحشايٍكغٕل اقم حارٍشا حٍذ كاَج َغبت %30%,30%,51%,51%,51%,51حغأي ( اػخًادا ػهى َخائش انحغاعٍت نهًضاداث انحٌٍٕت 9,8,6)ًْ V. cholerae % نكهًٍٓا. Three (3,5,6) isolates V. cholerae were selected depending on results of antibiotics sensitivity tests as showed multiple –antibiotics resistance(100%).
     • keywords: acid; acridine; activity; agar; agarose; agent; amikacin; ampicillin; antibiotics; antimicrobial; bacterial; bands; biochemical; cell; choleraee; chromosomal; ciprofloxacin; compound; concentration; coumarin; derivatives; diameter; different; dna; effect; effective; electrophoresis; etal; ethanol; figure; genes; genetic; inhibition; iraqi; isolates; isolation; medium; method; norfloxacin; normal; number; orange; percentage; pharm; plasmid; resistance; results; rrr; rrr rrr; rrr sss; salt; samples; sci; sensitive; sensitivity; solution; sss sss; study; susceptibility; table; tcbs; test; vibrio; vol.26(1; zone; اظٓشث; انؼضالث; انُخائش; ػضالث; ػهى; كاَج
     • versions: original; plain text
495. bijps-684
     • author: A. Hazzaa, Suray; N. Abd-Alhameed, Shaimaa
     • title: Formulation and Evaluation of Optimized Zaltoprofen Lyophilized Tablets by Zydis Technique
     • date: 2017-07-12
     • words: 4946
     • flesch: 50
     • summary: 3 3 F6 3.2 3 1 F7 3.2 3 2 F8 3.2 3 3 F9 3.2 3 3 1 F10 3.2 3 3 1.5 F11 3.2 3 3 2 F12 3.2 3 3 1.5 0.5 F13 3.2 3 3 1.5 1 F14 3.2 3 3 1.5 1.5 Total To make 20ml Preliminary screening for optimizing lyophilized tablets: Zaltoprofen lyophilized tablets 47 Figure (8) : FTIR spectrum of lyophilized tablet (F14 ) Powder X-ray diffraction analysis (PXRD) of pure Zaltoprofen and selected formula (F14)
     • keywords: .the; 0.1n; agent; blister; brittle; buffer; bulking; calibration; characterization; collapse; concentration; design; determination; different; diffraction; disintegration; dissolution; distilled; drug; drying; effect; evaluation; excipients; f14; fast; figure; formulas; formulation; freeze; ftir; gelatin; glycine; good; handling; hcl; high; increase; iraqi; j pharm; journal; lyophilization; lyophilized; mannitol; matrix; max; mechanical; medium; melting; method; oral; parameters; pharm; pharmaceutical; pharmacy; phosphate; physical; point; powder; prepared; properties; protectant; rate; ray; release; results; sci; solubility; sorbitol; study; tablets; technique; temperature; test; time; vivo; vol.26(1; water; weight; zaltoprofen; zydis; اُحبىب; اُذواء
     • versions: original; plain text
496. bijps-685
     • author: A. Abdulqader, Alaa; B. H.Al-Khedairy, Eman
     • title: Formulation and Evaluation of Fast Dissolving Tablets of Taste-Masked Ondansetron Hydrochloride by Solid Dispersion
     • date: 2017-07-26
     • words: 5205
     • flesch: 59
     • summary: In vitro taste evaluation In- vitro taste was evaluated by determining drug release in phosphate buffer (pH 6.8) to predict release of drug in the human saliva. Cumulative percentage of drug release was calculated using an equation obtained from a standard curve (14) .
     • keywords: acceptable; blend; buffer; bulk; complete; compression; concentration; content; density; disintegration; dispersion; dissolution; dissolving; dosage; drug; e100; effect; equation; eudragit; evaluation; evaporation; excellent; fast; fdts; figure; flow; formulas; formulation; friability; ftir; fusion; hardness; hcl; hydrochloride; index; international; iraqi; journal; masking; measured; method; minutes; mixture; ondansetron; onh; percentage; pharm; pharmaceutical; phosphate; polymer; powder; preparation; prepared; product; profile; properties; release; research; sci; sciences; solid; solid dispersion; solvent; study; tablets; taste; test; time; usp; vivo; vol.26(1; volume; weight; wetting
     • versions: original; plain text
497. bijps-687
     • author: abd alhamza al ibrahimy, ali shlash; F.Al-Tukmagi, Haydar
     • title: Assessing Quality of Life Among Patients with Diabetes Mellitus, Hypertension or Both Diseases in Al-Najaf Province /Iraq
     • date: 2017-12-25
     • words: 5199
     • flesch: 62
     • summary: Patients with diabetes mellitus, hypertension or both diseases 36 Table( 5): Comparison of QOL domain scores between DM patients and control group Scale Domain Diabetic group Control group p- The mean age diabetic, hypertensive, DM plus hypertension patients and control group include 51.18 ± 10.220, 51.90 ± 10.928, 56.03 ± 8.878 and 50.05 ± 9.20 years respectively.
     • keywords: affected; age; aspects; assessment; bref; chronic; clinical; community; comparison; complications; control; control group; cross; diabetes; diabetes mellitus; diabetic; diabetic patients; diseases; domains; drugs; duration; effect; environmental; extent; general; greater; group; health; hypertension; hypertensive patients; impact; individuals; instrument; insulin; iraqi; items; level; life; lower; mean; measure; mellitus; non; number; organization; outcome; overall; participants; patients; perception; pharm; pharmacy; physical; presence; prevalence; psychological; public; qol; quality; questionnaire; questions; results; scale; sci; scores; sectional; significant; social; status; study; table; treatment; type; value; vol.26(2; whoqol; world; years; الحياة
     • versions: original; plain text
498. bijps-700
     • author: S. Nassir, Zahra'a; J. Khadem, Enas
     • title: phytochemical investigations of Iraqi Abrus precatorius Linn. plant
     • date: 2018-06-03
     • words: 3462
     • flesch: 58
     • summary: Table 3: Phytochemical screening of alkaloids in the crude ethanolic extract of Abrus precatorius plant. Preliminary qualitative phytochemical screening were performed on the crude ethanolic extract and revealed the presence of alkaloids, flavonoids ,terpenoids and phytosterols in Iraqi Abrus precatorius plant.
     • keywords: abrine; abrus; abrus precatorius; acetate; acid; alkaloid; amine; analysis; aqueous; basic; chloroform; chromatogram; chromatography; compounds; constituents; crude; detection; diethyl; different; ethanolic; ether; ethyl; extract; extraction; f-1; figure; flavonoids; fraction; gel; gf254; hplc; identification; india; iraqi; isolated; journal; layer; medicinal; methanol; method; mobile; petroleum; pharm; phase; phytochemicals; plant; point; precatorius; preparative; presence; press; reagent; results; retention; s5k; sample; sci; seeds; silica; solvent; standard; stretching; table; thin; time; tlc; value; vol.27(1
     • versions: original; plain text
499. bijps-704
     • author: s, Pavani; K, Mounika; K, Naresh
     • title: Formulation and Evaluation of Acyclovir Microspheres
     • date: 2018-06-03
     • words: 2967
     • flesch: 56
     • summary: ACV microspheres were spherical in nature, which was confirmed by SEM. The in vitro performance of ACV microspheres showed sustained release depending on the polymer concentration and concentration of calcium chloride.
     • keywords: acv; acyclovir; alginate; calcium; chitosan; chloride; concentration; drug; efficiency; entrapment; figure; formulation; ftir; gelation; hcl; hours; increase; iraqi; journal; microspheres; order; particle; percentage; pharm; plot; polymer; prepared; release; results; sample; sci; sem; size; sodium; solution; spectra; table; value; vol.27(1; yield
     • versions: original; plain text
500. bijps-705
     • author: abdul-lalil, thukaa zuhair; Hussein, Ahmed Abbas; Saour, Kawkab Y.
     • title: Extraction, Identification and Isolation of B-sitosterol from Iraqi Wild Awsaj plant (Lycium barbarum) Using UAE (Probe and Bath) and two isolation technique (HPTLC and PHPLC): B-sitosterol in Iraqi Awsaj plant
     • date: 2017-12-25
     • words: 3632
     • flesch: 55
     • summary: Iraqi J Pharm Sci, Vol.26(2) 2017 -sitosterol in Iraqi Awsaj plant 78 Table (1): Difference in extract content yield (gram of fraction / 250 gm) in different parts of Awsaj plant using different methods. This goal was achieved by comparing the extraction mass yield, also by a quick and easy approach for identification and quantification of bioactive -sitosterol in four parts of Awsaj using high performance thin layer chromatography (HPTLC) which confirm the presence of -sitosterol in four parts of Iraqi Awsaj plant and the results clarify that the root part of Iraqi Awsaj plant extracted by probe UAE give the highest concentration (0.610 mg/ml) of B-sitosterol followed by fruits (0.465mg/ml), leaves(0.405mg/ml) and the least was stems(0.275mg/ml); according to these; isolation and purification of ß-sitosterol from petroleum ether fraction of Awsaj roots was done by preparative HPLC.
     • keywords: activity; awsaj; awsaj plant; baghdad; barbarum; bath; bioactive; chromatogram; chromatography; college; comparison; compound; concentration; conventional; different; ether; extraction; figure; fraction; fruits; high; hptlc; identification; iraqi; iraqi awsaj; iraqi j; isolated; isolation; journal; layer; leaves; lycium; melting; method; min; mobile; parts; performance; petroleum; pharm; pharmacy; phase; phplc; plant; point; preparative; probe; quantification; results; roots; sci; soxhlet; standard; stems; time; uae; ultrasound; university; vol.26(2; wild; yield; االنجاز; العالي; العوسج; الفصل; اللوني; بغداد; ذات; -sitosterol
     • versions: original; plain text
501. bijps-706
     • author: A. Mohammed, Ihsan; M. Ghareeb, Mowafaq
     • title: Investigation of Solubility Enhancement Approaches of Ticagrelor
     • date: 2018-06-03
     • words: 4939
     • flesch: 55
     • summary: Moreover, the PVPK-30, is a well-known efficient polymeric stabilizer forming adsorption layers on drug nanoparticles, (18) whereas the poloxamer 188 is an anon ionic surfactant (19). Formulation and evaluation of clopidogrel tablet incorporating drug nanoparticles.
     • keywords: 1:10; antisolvent; antisolvent ratio; brij; buffer; characterization; concentration; content; different; dissolution; drug; dsc; effect; efficiency; electron; enhancement; entrapment; evaluation; f12; factor; figure; formulas; formulation; high; hpmc; increase; index; international; iraqi; j pharm; journal; low; mean; methanol; method; nanoparticles; optimum; particle size; pdi; percent; pharm; pharm sci; pharmaceutics; phosphate; polydispersity; polymer; poorly; preparation; prepared; profile; pure; pvp; pxm; range; rate; ratio; results; samples; sci; similarity; size; solid; solubility; solubility enhancement; soluble; solvent; stabilizer; study; surface; table; tablets; technique; ticagrelor; ticagrelor nanoparticles; ticagrelor solubility; type; vol.27(1; water; yield
     • versions: original; plain text
502. bijps-712
     • author: Abbas, Sumayah Saadi; Kubba, Ammar A.Razzak Mahmood
     • title: Synthesis and antimicrobial evaluation with DFT study for new thiazole derivatives
     • date: 2018-06-04
     • words: 4349
     • flesch: 62
     • summary: Synthesis and DFT study of new thiazole derivatives 77 Conclusion In the present work new derivatives were synthesized starting from,[2-amino-4-(4- nitrophenyl) 1,3-thiazole], (4) and [2-amino-4- (4-bromophenyl) 1,3-thiazole],(5) using conventional method, the titled derivatives (6) and (8) were evaluated for their preliminary antimicrobial activity using well diffusion method. Received: 26/10/2017 Accepted: 4/3/2018 Iraqi Journal of Pharmaceutical Sciences http://dx.doi.org/10.31351/vol27iss1pp69-78 http://bijps.com/index.php/bijps/index Iraqi J Pharm Sci, Vol.27(1) 2018 Synthesis and DFT study of new thiazole derivatives 70 Introduction Thiazole is a five membered aromatic heterocyclic ring containing sulfur and nitrogen in its structure.
     • keywords: = c; acetate; active; activities; activity; albicans; amide; amino-4-(4; antibacterial; antifungal; antimicrobial; ar(c; asym; bacillus; baghdad; bend; biological; bromo; calculations; candida; chem; chemical; chemistry; chloride; chns; cm-1; compound; density; derivatives; dft; dmso; dry; elemental; energy; ethyl; evaluation; gap; general; gram; hexane; highest; homo; iraqi; lumo; m.p; med; methanol; method; microanalysis; mixture; moderate; molecular; molecule; new; nh2; nhco; novel; orbital; peak; pharm; plane; positive; powder; ppm; properties; pumilus; quantum; reaction; residue; sci; str; structure; study; subtilis; synthesis; synthesized; table; thiazole; thiazole derivatives; thiourea; tlc; university; vol.27(1; water; zone
     • versions: original; plain text
503. bijps-715
     • author: Ala Allah, Ali kathem; Hussein, Ahmed
     • title: Darifenacin Hydrobromide loaded nanostructured lipid carrier for oral administration
     • date: 2018-06-04
     • words: 6318
     • flesch: 58
     • summary: Darifenacin hydrobromide loaded nanostructured lipid carriers 54 NLCs have been developed to overcome the drawbacks associated with SLNs. Darifenacin hydrobromide loaded nanostructured lipid carriers 56 Characterization and evaluation of nanostruc- tured lipid carriers ( NLCs ) Particle size and polydispersity index measurement The particle size analysis of formulas was performed using ABT- 9000 Nano Laser Particle Size Analyzer.
     • keywords: acid; afm; aggregation; analysis; bioavailability; carriers; characterization; concentration; darifenacin; darifenacin hydrobromide; delivery; development; different; dispersion; drug; drug release; dsc; effect; efficiency; entrapment; equal; european; evaluation; f16; figure; force; formulas; formulation; ftir; glyceryl; gms; higher; hydrobromide; hydrobromide nlcs; increase; index; international; iraqi; j pharm; journal; kinetic; lipid; lipid carriers; lipid nanoparticles; liquid; liquid lipid; loaded; matrix; measurement; melting; method; min; monostearate; nanoparticles; nanostructured; nlcs; oil; oleic; oral; order; particle; pdi; percentage; pharm; pharm sci; pharmaceutics; point; polydispersity; potential; preparation; prepared; q.s; ray; release; sci; selection; size; sln; solid; solid lipid; solubility; spectrum; stability; studies; study; surface; surfactants; system; table; temperature; time; tween80; value; vitamin; vol.27(1; water; zeta; الى; عشر; هايدروبرومايد
     • versions: original; plain text
504. bijps-721
     • author: Al-lami, Mohammed Sabar; H. Oudah, Malath; A. Rahi, Firas
     • title: Preparation and characterization of domperidone nanoparticles for dissolution improvement
     • date: 2018-06-03
     • words: 5044
     • flesch: 53
     • summary: Iraq Abstract This study was carried out to prepare and characterize domperidone nanoparticles to enhance solubility and the release rate. Then domperidone nanoparticles were formulated into a simple capsule dosage form in order to study of the in vitro release of drug from nanoparticles in comparison pure drug and mixture of polymer:drug ratios of 2:1.
     • keywords: 1:10; analysis; antisolvent; area; average; bioavailability; capsule; characterization; chemical; cmc-30; comparison; concentration; crystalline; different; diffraction; dissolution; domperidone; domperidone nanoparticles; drug; dsc; e50; effect; fesem; figure; formula; ftir; hpmc; increase; iraqi; journal; k15; k30; low; method; mixture; n=3; nanoparticles; particle size; pdi; pharm; pharmaceutical; physical; polymer; powder; precipitation; preparation; prepared; pure; pure domperidone; pvp; range; rate; ratio; ray; reduction; release; results; scanning; sci; size; solubility; solvent; specific; spectrum; state; stirring; study; surface; table; time; type; vol.27(1; volume; water; xrpd; الجسيمات; النانوية
     • versions: original; plain text
505. bijps-726
     • author: A. Darweesh, Samar
     • title: Spectrophotometric Determination of Cefixime Following Simple Diazotization and Coupling with ?-Naphthol
     • date: 2017-12-25
     • words: 2352
     • flesch: 55
     • summary: Effect of diazotization reaction time The optimum time for the diazotization of cefixime were established at 0-5 °C and 2 minutes, where longer times led to extremely low absorbance values. Cefixime and α-Naphthol 4 Effect of sulfamic acid concentration
     • keywords: absorbance; absorption; acid; analytical; calibration; cefixime; cfx; colored; concentration; determination; diazotization; distilled; drug; dye; effect; figure; form; formulations; hydrochloric; iraqi; method; naphthol; nitrite; pharm; pharmaceutical; product; pure; reaction; results; sci; sodium; solution; spectrophotometric; standard; sulfamic; table; time; vol.26(2; water
     • versions: original; plain text
506. bijps-727
     • author: K . Abbas, Hayder; M. Hussein Wais, Fatimah; N. Abood, Ahmed
     • title: Preparation and Evaluation of Ketoprofen Nanosuspension Using Solvent Evaporation Technique
     • date: 2017-12-25
     • words: 7088
     • flesch: 54
     • summary: Since dissolution takes place at the surface of drug particle, the high dissolution rate of drug is associated with large surface area of drug particles. In addition, it is mainly attributed to the rule, which states that the reduction of drug particle size can result in larger surface area and consequently enhanced the contact of nanoparticles with the dissolution medium.
     • keywords: 0.1n; absorption; area; average; bioavailability; c0±; characterization; class; combination; concentration; decrease; different; dissolution; drug; drug particle; e15; e50; effect; efficiency; enhancement; entrapment; et.al; f10; f13; f15; f19; figure; formulas; formulation; free; hcl; hpmc; increase; index; international; iraqi; journal; k30; ketoprofen; ketoprofen nanosuspension; large; lead; low; method; mixture; nanoparticles; nanosuspension; particle; particle size; pdi; pharm; pharmaceutical; pharmacy; physical; poloxamer188; polydispersity; polymer; poorly; precipitation; preparation; prepared; profile; pure; pvp; range; rate; ratios; release; research; results; saturation; sci; size; solid; solubility; soluble; stabilizer; surface; system; table; time; tween; type; vol.26(2; water; zhang; الذوبان
     • versions: original; plain text
507. bijps-728
     • author: H. AL-Behadily, Hasan; F.Al-Tukmagi, Haydar
     • title: Knowledge, Attitudes and Barriers Towards Breast Cancer Health Education Among Iraqi Community Pharmacists
     • date: 2017-12-25
     • words: 4873
     • flesch: 60
     • summary: (15.3) 44 (14.7) Patients appreciate efforts of community pharmacists when counselled about breast cancer 120 (40.0) 76 (25.3) 33 (11.0) 35 (11.7) 36 (12.0) Iraqi J Pharm Sci, Vol.26(2) 2017 Knowledge, attitudes and barriers towards breast cancer 63 Figure ( 1 ):Barriers for breast cancer health as stated by community pharmacists. Relationship of demographics and characteristics of practice with knowledge and attitudes towards breast cancer health promotion among community pharmacists Bivariate correlation analysis of continuous variables (represented in table 5) showed that age had no significant association with overall knowledge of breast cancer (r = - 0.021, P = 0.360), knowledge of breast cancer screening (r = - 0.098, P = 0.045) or attitude (r = - 0.010, P = 0.434) among pharmacists.
     • keywords: 2012; activities; age; attitudes; awareness; baghdad; barriers; breast; breast cancer; cancer; cancer health; care; community; community pharmacists; correct; degree; demographics; description; diagnosis; early; education; examination; factors; female; health; incorrect; iraqi; knowledge; lack; level; major; mammography; mean; mortality; overall; participants; patients; pharmaceutical; pharmacists; pharmacy; points; poor; practice; promotion; public; qatar; questionnaire; range; rate; results; risk; sci; score; screening; self; services; significant; signs; study; survey; symptoms; table; time; variables; vol.26(2; women; years; حُش; سشطبُ
     • versions: original; plain text
508. bijps-729
     • author: A. Hussein, Esraa; J. Kadhim, Dheyaa; F. Al-Auqbi, Tawfeeq
     • title: Belief about Medications Among Type 2 Diabetic Patients Attending the National Diabetes Center in Iraq.
     • date: 2017-12-26
     • words: 5181
     • flesch: 57
     • summary: Assuming the margin of error of 5% and the confidence level is 95%, the total number of diabetic patients registered at the above center were 33,408 patients at the beginning of the current study then the sample size will be of minimally 380 patients. β: Correlation coefficient Figure(4):Scatter plot of the relationship between HbA1c and BMQ score in all patients Table-8 demonstrates the comparison of BMQ score and it's subparts with glycemic control where a poor control patients has a higher median score compared to good control patients regarding specific necessity and it was significant ,while no significance was available with other subparts and glycemic control.
     • keywords: adherence; age; agree; analysis; anti; association; beliefs; bmq; center; concern; control; correlation; current; diabetes; diabetic; disease; distribution; factors; general; glycemic; good; greater; harm; hba1c; health; higher; insulin; interquartile; iraqi; journal; level; mean; median; medications; medicines; mellitus; necessity; negative; normal; number; overall; overuse; patients; poor; population; positive; prescribed; questionnaire; range; relationship; sample; scale; sci; score; significant; specific; strong; study; table; test; total; treatment; type; value; variables; vol.26(2; years; السكري; العالج; بغداد; نسبة
     • versions: original; plain text
509. bijps-730
     • author: H. Mhaibes, Sarah; A. Taher, Mohammed; H. Badr, Ala; H. Badr, Ala
     • title: A Comparative Study of Blood Levels of Manganese, Some Macroelements and Heavy Metals in Obese and Non-Obese Polycystic Ovary Syndrome Patients
     • date: 2017-12-26
     • words: 5688
     • flesch: 68
     • summary: There were no significant differences between obese PCOS women and non-obese PCOS women in the levels of the studied hormones, elements and heavy metals. There was a positive correlation between blood lead and serum TSH levels in non- obese PCOS women; and between serum total testosterone and cadmium levels in obese PCOS women.
     • keywords: age; blood; bmi; body; cadmium; calcium; clinical; concentrations; control groups; control non; correlation; difference; elements; endocrinology; figure; fsh; groups; heavy; higher; hormone; human; infertility; insulin; iraqi; journal; lead; levels; lower; magnesium; manganese; mean; measured; mechanisms; metals; non; nonobese; obese; obese control; obese pcos; ovary; oxidative; patients; pcos; pcos groups; pcos non; pcos patients; pcos women; pharm; polycystic; positive; reproductive; research; resistance; results; ros; sci; serum; significant; stress; study; subjects; syndrome; table; testosterone; total; trace; tsh; vol.26(2; women; االكياس; البدينات; الدم; العناصر; المبيض; النساء; بين; متالزمة; متعدد; وغير; ييعان
     • versions: original; plain text
510. bijps-731
     • author: ALi, Hassan; H. Mohammed, Mohammed; H. Ismeal, Sajida
     • title: Synthesis, Characterization and Alpha Glucosidase Inhibition activity of new Phthalimide Derivatives
     • date: 2018-06-05
     • words: 5025
     • flesch: 63
     • summary: However it was found that phthalimide, tetrachlorophthalimide derivatives exhibited potent α -glucosidase inhibition and the structure activity relationship studies show the following: 1.A phthalimide or tetrachlorophthalimide moiety connected to a variously substituted phenyl ring by an alkyl chain shows promising alpha glucosidase inhibitory activity (Scheme 1). Str. of Tetrachlorophthalimide,1717(C=O) Str. of carboxylic acid consolidated with(C=O) Str. of Tetrachlorophthalimide, 1581 and 1431 (C=C) aromatic Str., 1396C-N Str., 1199C-O str.v., 736Out of plane aromatic bendcm-1.
     • keywords: 13cnmr; acid; activity; alpha; american; amide; amino; anhydride; aromatic; aromatic str; association; asym; baghdad; bend; bendcm-1; ch2; ch2nco; chemistry; chloride; cm-1; college; compounds; derivatives; diabetes; dry; enzyme; glucosidase; glycine; h str; hcl; ic50; inhibition; inhibitory; insulin; iraqi; kbr; melting; mhz; mixture; mmol; nh str.v; nh2; nmr; pharm; phthalimide; phthaloyl; plane; plane aromatic; point; reaction; ring; sci; secondary; secondary amide; solid; solid;yield; solution; str; str.v; sym.str; synthesis; synthesized; tetrachloro; type; university; vol.27(1; water; white; yield; yl)acetamide; بغداد
     • versions: original; plain text
511. bijps-754
     • author: Al-anbagi, Mina Shihab; A. Rajab, Nawal; I.Khalil, Yehia
     • title: Preparation and characterization of timed drug delivery system of sumatriptan using natural polymers
     • date: 2018-06-05
     • words: 5309
     • flesch: 56
     • summary: Six formulas of fast dissolving core tablets and three formulas of press-coated tablets were prepared by using direct compression method using different variables to prepare core tablets which include: different types and concentrations of superdisintegrants while different concentrations of natural and synthetic polymers were utilized in preparation of press-coated tablets. The obtained results showed that formula F4 of core tablet, which contained 25 milligrams of sumatriptan, 5% w/w sodium starch glycolate and avicel PH 102 as diluent, was the selected formula that showed the fastest and complete release of sumatriptan.
     • keywords: angle; avicel; blend; bulk; circadian; cm-1; coated; coating; compatibility; compression; concentration; core; core tablet; croscarmellose; delivery; density; different; disintegration; dissolution; dosage; drug; dsc; effect; ethylcellulose; evaluation; excellent; fast; figure; flow; forms; formula; formulation; ftir; funnel; glycolate; hardness; hausner; hpmck15; international; iraqi; journal; lag; mean±; migraine; milliliters; natural; optimum; pectin; pharm; pharmaceutical; pharmacy; physical; polymers; powder; prepared; press; properties; pulsatile; pure; release; repose; research; results; samples; sci; sciences; sodium; starch; str; studies; study; sumatriptan; sumatriptan core; superdisintegrant; system; tablet; test; time; types; usp; vol.27(1; volume; water; weight; التي
     • versions: original; plain text
512. bijps-756
     • author: A. Taher, Mohammed; A. Abdul- Hussain, Dhuha; F. Hasan, Huda; M. Fahmi, Zena; K. Luaibi, Oday; G. Ali, Mezaal
     • title: Hypolipidemic Effect of Caffeic Acid Isolated From Arctium Lappa Cultivated In Iraq, in Hyperlipidemic Rat Model
     • date: 2018-02-23
     • words: 3583
     • flesch: 57
     • summary: From the area under the peak we calculated the percentage of caffeic acid in crude extract about 0.176mg/ml. Figure (1): HPLC chromatogram of Caffeic acid std.(Left one) and plant extract sample with high peak of caffeic acid at (Rt 2.71) identical to the reference standard( Right one). Hypolipidemic effect of caffeic acid 23 The influence of Caffeic acid at the TG- cholesterols and VLDL-cholesterol might be attributed to CA decrease tri-glyceride creation by decrease the countenance of both (three hydroxyl three methy-glutary coenzyme a reductase) and glycerol three phosphate acyl- transferase in the liver by arrangement of adenosine mono phosphate activated kinase (23) .
     • keywords: acid; activity; analysis; animals; aorta; arctium; baghdad; caffeic; caffeic acid; cholesterol; clinical; collections; college; control; day; days; decrease; department; diet; e.x400; effect; figure; great; group; hdl; high; hplc; hypercholesterolemia; hypolipidemic; important; iraq; lappa; ldl; low; media; medicinal; medicine; method; normal; p<0.05; parts; pharm; pharmacy; plant; protein; rats; research; result; rich; sample; sci; section; serum; study; treatment; tunica; university; vol.24(1; weeks; الؼشاق; الكافاَُك; باسحفاع; بغذاد; جاهؼت; حاهض; كغن; كلُت; وصى
     • versions: original; plain text
513. bijps-757
     • author: A. Mousa, Zahraa; N. Al-Shawi, Nada; A. Omar, Ahmed
     • title: Study the Influence of Captopril on Bone Metabolism in Elderly Hypertensive Women
     • date: 2018-02-23
     • words: 3721
     • flesch: 50
     • summary: In conclusion, the present study provides additional knowledge concerning the influence of captopril treatment on some selected parameters of bone metabolism in elderly hypertensive women. Keywords: Captopril, Bone metabolism, Elderly women, Hypertension, Dual energy x-ray absorptiometry.
     • keywords: activity; addition; age; alkaline; angiotensin; baghdad; blood; body; bone; calcium; captopril; clinical; control; data; density; differences; dose; effects; elderly; elderly hypertensive; elderly women; enzyme; estrogen; germany; group; hitachi; hormone; hypertensive; hypertensive women; influence; inorganic; iraqi; levels; magnesium; mass; mean; metabolism; mineral; non; normotensive; osteoporosis; parathyroid; pharm; phosphatase; phosphorus; postmenopausal; present; rats; roche; sci; score; serum; significant; spine; study; table; therapeutic; values; vol.24(1; women; years; ارتفاع; الالتً; الدم; العظم; النساء; ضغط
     • versions: original; plain text
514. bijps-758
     • author: Z. Nagara, Zeina; Y. Saour, Kawkab
     • title: Phytochemical and Pharmacological Study of Valepotriates in Valeriana officinalis L. F.Valerianeceae Cultivated in Iraq
     • date: 2018-02-23
     • words: 4006
     • flesch: 55
     • summary: Isolation and identification of active constituents Separation of the main active constituents of Valeriana officinalis L. root was carried out using Preparative TLC: TLC plates, 20x20cm and 1mm thickness of silica gel GF254 developed in solvent system (hexane : ethyl acetate : acetic acid 65:35:0.5) with standard reference. Due to the large number of active constituents in Valeriana officinalis, it was necessary to make analytical study of its constituents to determine the chemical nature of these constituents and then determine the main classes (terpenes and iridoids) using chemical reagents specific for each class.
     • keywords: acetate; acetic; acid; active; analysis; analytical; animals; baghdad; chemical; chromatography; college; components; compound; constituents; control; department; diazepam; differences; different; dried; effect; ethyl; extract; extraction; figure; gaba; germany; group; herbal; hexane; hplc; i.p; identification; iraqi; isolated; light; main; methanol; method; mice; officinalis; organic; pharm; pharmacological; pharmacy; phytochemical; plant; present; products; reagent; results; root; sci; sleeping; solvent; standard; study; system; table; test; time; tlc; university; valepotriates; valerenic; valeriana; valeriana officinalis; valtrate; vol.24(1; water; انفؼانت; انًشكباث; بغذاد
     • versions: original; plain text
515. bijps-761
     • author: J. Ahmed, Mariam; Abdullah, hind H.
     • title: Spectrophotometric Determination of Chlordiazepoxide in Pharmaceutical Formulations via Oxidative Coupling Reaction with Phenothiazine
     • date: 2018-12-05
     • words: 3575
     • flesch: 49
     • summary: The proposed method was compared with UV method (classical method) of CDE determination and by using the statistical methods (t- and F test) and the suggested method proved accuracy and precision and can be used routinely in quality control studies. Method of validation Linearity Under the optimized experimental conditions for CDE determination, standard calibration curve was constructed (Fig. 6).
     • keywords: absorbance; accuracy; acid; acidic; addition; amino; cde; chlordiazepoxide; conc; coupling; determination; distilled; dosage; drug; effect; experiments; figure; green; https://www.sciencedirect.com/science/article/pii/s0026265x10000494; hydrolyzed; iraqi; libroxide; method; naio4; oxidative; pharm; pharmaceutical; phenothiazine; pht; precision; procedure; product; reaction; reagent; results; sci; simple; solution; spectrophotometric; standard; suggested; table; tablets; temperature; time; values; vol.27(2; volume; volumetric; water
     • versions: original; plain text
516. bijps-762
     • author: Chaplenko, Alexander; Monogarova, Oksana; Oskolok, Kirill
     • title: X-Ray Fluorescence Determination of Trace Elements in Vitamin-Mineral Complexes and Medicinal Herbs Using Chemically Modified Polyurethane Foam Sorbents
     • date: 2018-12-05
     • words: 2971
     • flesch: 53
     • summary: Results of trace element determination in medicinal plants (µg/g, n = 5, P = 0.95) *1 - PUF, modified by resorcinol 2 - PUF, modified by 8-hydroxyquinoline 3 - PUF, modified by 2- nitrozo-1-naphthol Table 3. Results of trace element determination in vitamin-mineral complexes (µg/g, n = 5, P = 0.95) *1 - PUF, modified by resorcinol 2 - PUF, modified by 8-hydroxyquinoline 3 - PUF, modified by 2- nitrozo-1-naphthol Conclusion Developed technique of XRF determination of trace elements in medicinal herbs and vitamin-mineral complexes is simple and effective alternative to traditional used methods of atomic spectroscopy. 4. Brown R. J. C., Milton M. J. T. Analytical techniques for trace element analysis: an overview.
     • keywords: analysis; approach; azo; co(ii; complexes; concentration; conditions; determination; elements; extraction; fluorescence; foam; herbs; high; ions; iraqi; leaves; medicinal; metal; mineral; naphthol; pharm; polyurethane; puf; ray; reaction; resorcinol; sci; solution; sorbent; sorption; tablets; trace; trace elements; vitamin; vol.27(2; xrf; zn(ii
     • versions: original; plain text
517. bijps-768
     • author: S. Abdul Jabbar, Ahmed
     • title: Dissolution Enhancement of Raltegravir by Hot Melt Extrusion Technique
     • date: 2018-06-04
     • words: 3875
     • flesch: 53
     • summary: Thermograms of raltegravir HME (Figure 9) illustrated a little, slightly wide endotherm that specified the reduced crystallinity of raltegravir. FTIR spectra of raltegravir HME best formulation (Trial 6) Figure 7.FTIR spectra of raltegravir and Plasdone S630 Differential scanning calorimetry (DSC)
     • keywords: absorbance; amorphous; angle; bioavailability; buffer; bulk; compressed; compression; concentration; cross; density; dispersion; dissolution; distilled; drug; dsc; enhancement; extrusion; figure; flow; following; formulations; friability; ftir; funnel; hardness; hausner; hme; hot; hot melt; index; international; iraqi; journal; medication; melt; melt extrusion; minutes; mixture; parameters; pass; pharm; pharmaceutical; physical; plasdone; polymer; powder; prepared; properties; raltegravir; range; rate; release; repose; research; s630; saturation; sci; sciences; sodium; solid; solubility; soluble; spectra; study; tablets; technique; trial; vol.27(1; water; weight
     • versions: original; plain text
518. bijps-776
     • author: A Mahmood Kubba, Ammar; A. A. Rahim, Nedaa
     • title: Synthesis, Characterization and Antimicrobial Evaluation with DFT Study of New Two-Amino-4-(4-Chlorophenyl) Thiazole Derivatives
     • date: 2018-06-20
     • words: 3582
     • flesch: 60
     • summary: Completion of reactions and the purity of compounds were ascertained by thin-layer chromatography (TLC) , using Silica gel GF254 (type 60) pre- coated Aluminium sheets, Merck (Germany) exposed to UV-254nm light and the eluent used is n-hexane: ethyl acetate (6.0:4.0) for compound (1) , n-hexane: ethyl acetate (8.0:2.0) for compound (2) and n-hexane: ethyl acetate (4.0:6.0) for compound (3).Melting points were measured by using Stuart SMP3 melting point apparatus in open capillary tubes, and are uncorrected. Therefore, compound 2 is more reactive than compounds 3 and 1, respectively.
     • keywords: absolute; activities; activity; albicans; amino; amino-4-(4; antibacterial; antifungal; antimicrobial; aureus; bacillus; baghdad; biological; bromide; calculations; candida; chem; chemical; chemistry; chlorophenyl; cm-1; compound; conc; density; derivatives; dft; dft study; dinitrophenyl; dmso; electronegativity; electronic; elemental; energy; ethanol; evaluation; gap; glabrata; gram; high; homo; hydrazine; iraqi; lumo; med; method; mixture; mol; molecular; new; nh2; pharm; phenacyl; phenyl; powder; preliminary; properties; quantum; reaction; reactive; results; scheme; sci; study; subtilis; synthesis; synthesized; table; thiazole; thiourea; university; vol.27(1
     • versions: original; plain text
519. bijps-777
     • author: Mekhilef, Safa F.; A. Hussein, Ahmed
     • title: Novel Combination for Self-Nanoemulsifying Drug Delivery System of Candesartan Cilexetil
     • date: 2018-12-07
     • words: 6508
     • flesch: 57
     • summary: Self- emulsifying drug delivery system (SEDDS) showed promising result in overcoming solubility problem of many drug molecules. Yadav PS, Yadav E, Verma A, Amin S. Development, characterization, and pharmacodynamic evaluation of hydrochlorothiazide loaded self- Iraqi J Pharm Sci, Vol.27(2) 2018 Self-nanoemulsifying drug delivery system of candesartan cilexetil 133 nanoemulsifying drug delivery systems.
     • keywords: 2013; 2015; addition; anomalous; aqueous; area; bioavailability; candesartan; candesartan cilexetil; cc sedds; cilexetil; combination; concentration; cremophore; delivery; delivery system; development; diagrams; different; dilution; dissolution; droplets; drug; drug delivery; drug release; emulsification; evaluation; f-10; f-11; f-12; f-13; f-14; f-15; f-2; f-3; f-4; f-5; f-6; f-7; figure; food; formation; formulas; formulations; hcl; index; int; iraqi; j pharm; journal; lee; low; min; mixture; molecules; nanoemulsifying; nanoemulsion; oil; oral; order; particle; pass; pass pass; pharm; pharm sci; pharmaceutical; pharmacy; phase; potential; preparation; process; pseudo; rate; ratios; release; result; review; sci; sedds; self; size; smix; solubility; stability; study; surface; surfactant; system; table; temperature; ternary; test; tetraglycol; thermodynamic; time; triacetin; tween; value; vol.27(2; water; zeta
     • versions: original; plain text
520. bijps-784
     • author: Hareeja, Marwah M.; B.H.Al-Khedairy, Eman
     • title: Formulation and In- Vitro Evaluation of Spherical Crystal Agglomerates of Ebastine by Quasi Emulsion Solvent Diffusion Method
     • date: 2018-12-06
     • words: 6141
     • flesch: 57
     • summary: All other reagents and chemicals used were of analytical grade Method Preparation of EBS spherical crystal agglomerates SCAs prepared by emulsion solvent diffusion method. PEG 4000 show highest increase in rate of dissolution (f2=20.014) in comparison with pure drug dissolution rate that’s because PEG 4000 have important effect on maintaining the spherical shape of agglomerated crystal (36) and also it enhances the physical and chemical stability of drugs and prevents aggregation of the drug particles as a result of the steric hindrance and/or masking of charges provided through formation of a conformational cloud (37) so, higher surface area will be available for dissolution.
     • keywords: agglomerates; agglomeration; analysis; angle; asian; bulk; cm-1; combination; comparison; content; crystal; crystallization; cyclodextrin; dcm; delivery; density; diffraction; diffusion; direct; dissolution; drug; dsc; ebastine; ebs; ebs1; ebs4; ebs6; effect; emulsion; enhancement; evaluation; figure; flowability; formula; formulation; ftir; good; gupta; high; improvement; increase; index; international; iraqi; j pharm; journal; melting; method; micromeritic; microscope; mixture; optical; peak; peg4000; percentage; pharm sci; pharmaceutical; physical; point; polymers; poor; powder; preparation; prepared; presence; process; profile; properties; property; pure; pure drug; quasi; ray; release; repose; research; results; samples; scanning; scas; sci; sciences; shape; solubility; solvent; spherical; spherical crystal; stretching; studies; study; surface; table; vol.27(2; water; yield; 𝑩𝒖𝒍𝒌; 𝑻𝒂𝒑𝒑𝒆𝒅; 𝒅𝒆𝒏𝒔𝒊𝒕𝒚
     • versions: original; plain text
521. bijps-789
     • author: Hussein, Zainab A.; A. Rajab, Nawal
     • title: Formulation and Characterization of Bromocriptine Mesylate as Liquid Self-Nano Emulsifying Drug Delivery System
     • date: 2018-12-06
     • words: 5094
     • flesch: 55
     • summary: Evaluation of the prepared liquid self-nano emulsifying drug delivery system Thermodynamic stability studies All of SNEDDS formulations were passed the thermodynamic stability testing as there was no sign of phase separation or drug precipitation at the end of all cycles. Kumar RS, Syamala US, Revathi P, Devaki S, Raghuveer P, Gowthamarajan K. Self nanoemulsifying drug delivery system of olanzapine for enhanced oral bioavailability:
     • keywords: 0.1n; aqueous; area; bioavailability; bromocriptine; bromocriptine mesylate; buffer; castor; characterization; code; content; delivery; delivery systems; different; dilution; dispersibility; dissolution; droplet; drug; drug delivery; dsc; emulsification; emulsifying; emulsion; ethanol; evaluation; formation; formulations; hcl; index; iraqi; j pharm; journal; liquid; liquid self; medium; mesylate; min; mixed; nano; nanoemulsion; oil; oral; pass; pass pass; pharm; pharm sci; pharmaceutical; phase; phosphate; polydispersity; powder; prepared; pseudo; pure; rate; ratio; release; sci; self; separation; significant; size; snedds; solubility; stability; studies; study; surfactant; system; table; temperature; ternary; test; thermodynamic; time; tween; vol.27(2; water
     • versions: original; plain text
522. bijps-791
     • author: Ismail, Muna Y.; M. Ghareeb, Mowafaq
     • title: Enhancement of the Solubility and Dissolution Rate of Rebamipide by Using Solid Dispersion Technique (Part I)
     • date: 2018-12-06
     • words: 5498
     • flesch: 52
     • summary: Composition of REM and carriers using solid dispersion method. Iraqi J Pharm Sci, Vol.27(2) 2018 Solid dispersion of Rebamipide with TPGS DOI: https://doi.org/10.31351/vol27iss2pp55-65 55 Enhancement of the Solubility and Dissolution Rate of Rebamipide by Using Solid Dispersion Technique (Part I)
     • keywords: analysis; behavior; best; bioavailability; carrier; characterization; cm-1; crystalline; development; different; diffraction; dispersion; dissolution; drug; dsc; effect; enhancement; evaluation; evaporation; evaporation method; evaporation sd; f-127; figure; formula; formulation; ftir; fusion; fusion sd; hcl; hydrophilic; international; iraqi; japan; journal; k30; kneading; mean; medium; method; minutes; n=3; nature; particles; peg; percent; pharmaceutical; pharmacy; pluronic; polymer; powder; preparation; prepared; profile; pure; pvp; pxrd; rate; rebamipide; release; rem; rem solid; research; results; samples; scanning; sci; sciences; sd30; size; solid; solid dispersion; solubility; soluble; solvent; solvent evaporation; spectrum; stretching; study; surface; technique; tpgs; type; vol.27(2; water; yield; الذوبان
     • versions: original; plain text
523. bijps-792
     • author: Noor, Ala'a Dheia; B.H. Al-Khedairy, Eman
     • title: Formulation and Evaluation of Silymarin Microcrystals by In- Situ Micronization Technique
     • date: 2019-06-09
     • words: 5538
     • flesch: 54
     • summary: Table (4) Effect of solvent: anti-solvent ratio on SM microcrystals formulas. Effect of polymer type To select the best polymer for preparation of SM microcrystals, four formulas were prepared; MC1, MC2, MC3 and MC4 using gelatin, PVP-K30, HPMC15 and pullulan respectively as stabilizing agent with 0.1% (w/w) concentration for each as shown in table.1 Effect of polymer concentration To estimate the minimum concentration of stabilizing agent (gelatin or PVP k30) required to get the maximum crystals yield and solubility, three concentrations of each stabilizing agent 0.05% (MC5 and MC7),0.1% (w/v)(MC1 and MC2)
     • keywords: anti; antisolvent; aqueous; best; bioavailability; change; cm-1; concentration; content; crystalline; crystallization; dissolution; drug; dsc; effect; enhancement; factors; figure; formulas; ftir; gelatin; high; hydrophilic; increase; intensity; iraqi; j pharm; journal; k30; low; mc1; mc10; mc9; mc9s; mean; methanol; method; microcrystals; micronization; min; modification; organic; particle; pdi; peaks; percent; pharm; pharmaceutical; phase; polymer; powder; preparation; prepared; process; pvp; pvpk30; rate; ratio; ray; results; samples; sci; selected; sem; significant; silymarin; situ; size; solubility; solvent; sonication; stabilizer; stirring; study; surface; table; technique; time; type; ultrasonic; ultrasound; untreated; vol.28(1; volume; water; yield
     • versions: original; plain text
524. bijps-793
     • author: Fareed, Noor Y.; Kassab, Hanan J.
     • title: Studying the Effect of Variables on Acyclovir Microsponge
     • date: 2018-12-06
     • words: 4521
     • flesch: 59
     • summary: The effect of changing drug polymer ratio on drug release was illustrated in figure (6). The effect of different formulation and process variables such as internal phase volume, polymer type, drug polymer ratio, stirring speed and stirring duration on microsponge production yield, loading efficiency, particle size, and in vitro drug release was evaluated.
     • keywords: acetone; acv; acyclovir; acyclovir microsponge; analysis; characterization; cm-1; delivery; diameter; different; diffusion; dissolution; drug; drug release; dsc; effect; efficiency; emulsion; ers; eudragit; evaluation; external; f10; figure; formulation; ftir; internal; international; iraqi; journal; kinetic; loading; lower; method; microspheres; microsponge; mixture; oil; order; particle; pharmaceutical; pharmacy; phase; phosphate; physical; polymer; prepared; present; production; properties; pure; rate; ratio; release; research; results; rpm; rs100; sci; sem; size; skin; solvent; speed; stearate; stirring; stretching; study; system; table; topical; type; variables; viscosity; vol.27(2; volume; xrd; yield
     • versions: original; plain text
525. bijps-795
     • author: Yahya, Ruaa Natiq; A.Kasim, Ali; A. Al Gawwam, Gheyath
     • title: Comparing the Quality of Life among Patients with Relapsing Remitting Multiple Sclerosis in Iraq Using Different Disease Modifying Therapies
     • date: 2018-12-06
     • words: 7116
     • flesch: 58
     • summary: The expanded disability status scale (EDSS) is negatively associated with QoL of MS patients in all of the three therapies, while other predictors such as occupational status, educational status, smoking habit and MS duration have different impact in different treatments. Relapsing–remitting MS (RRMS):- affects about 85% of MS patients and marked by flare- ups (relapse or exacerbation of symptoms followed by periods of remission, when symptoms improve or disappear)(8,9).
     • keywords: age; aid; analysis; assessment; baghdad; bit; clinical; college; condition; contentment; correlation; criteria; day; different; disability; disability status; disease; duration; edss; educational; emotional; et al; family; fams; fams score; fatigue; fingolimod; functional; gender; general; groups; health; higher; impact; independent; interferonβ-1b; iraqi; journal; life; linear; marital; mean; meters; mobility; ms duration; ms patients; multiple; multiple sclerosis; multivariate; natalizumab; neurology; occupational; p<0.001; patients; pharm; predictors; qol; quality; regions; regression; relationship; scale; sci; sclerosis; sclerosis patients; score; significant; smoking; social; status; status scale; studies; study; subscales; symptoms; system; table; therapies; total; total fams; treatment; treatment duration; trouble; type; univariate; value; variables; vol.27(2; wheelchair; work; years; االعصاب; الحياة; المتعدد; تصلب; جودة
     • versions: original; plain text
526. bijps-797
     • author: Al abood, Raid Mohamed; M. Ghareeb, Mowafaq; A. Abdulrasool, Alaa
     • title: Investigation of cytotoxic activity and dissolution improvement of Teniposide by incorporation into acid treated carbon nanotube and dispersed by hydrophilic polymer
     • date: 2019-06-11
     • words: 5402
     • flesch: 57
     • summary: In this study, carbon nanotubes properties were improved by pre-functionalized of carbon nanotubes via carboxylation with strong acids and then functionalized through attaching to polymer and copolymer. Key words: Acid treated carbon nanotubes, Teniposide, Hydrophilic polymers.
     • keywords: acid; aqueous; area; bands; bath; body; bundle; cancer; carbon; carbon nanotubes; carboxylation; centrifugation; characterization; chemical; china; cm-1; consistency; container; copolymer; cswcnt; cswcnt-(pva; deionized; delivery; dextran; different; dispersibility; dispersion; drug; electron; f19; figure; formulation; ftir; functionalization; glycol; group; homogeneity; homogenous; homogenous pass; hours; images; improvement; impurities; iraqi; like; liu; loading; measurement; microscopy; mixture; molecular; nanocomposites; nanotubes; nil; non; order; oxidation; pass; peg1500; peg400; peo; pharm; phys; polyethylene; polymer; preparation; prepared; properties; purification; pva; ratio; results; rpm; sci; sem; single; solubility; soluble; solution; sonication; spectroscopy; stability; step; stretch; studies; study; swcnts; system; table; temperature; teniposide; type; vol.28(1; walled; walled carbon; wang; water; weight; األنابيب; الكربونية; النانوية
     • versions: original; plain text
527. bijps-799
     • author: Mohammed, Amina M.; Mohammed, Entidhar J.
     • title: Preparation and In-Vitro Evaluation of Clopidogrel Bisulfate Liquisolid Compact
     • date: 2018-12-07
     • words: 6670
     • flesch: 61
     • summary: The purpose of this work was to enhance the dissolution pattern of the clopidogrel through its preparation as liquisolid compact. In addition, Differential Scanning Calorimetry (DSC), Fourier Transforms Infrared Spectroscopy (FTIR), X-Ray Diffraction (XRD) and Scanning Electron Microscopy (SEM) were used for the assessment of the physicochemical properties of the drug and compatibility with excipients in liquisolid compacts.
     • keywords: 0.1n; addition; aerosil; analysis; angle; avicel; avicel ph; bioavailability; bisulfate; bisulfate liquisolid; buffer; carrier; clopidogrel; clopidogrel bisulfate; coating; compact; compressed; concentration; content; dct; density; diffraction; disintegration; dissolution; dissolution rate; drug; dsc; enhancement; evaluation; excipients; figure; formulation; friability; ftir; good; hardness; hausner; hcl; high; index; iraqi; iraqi j; j pharm; liquid; liquisolid; liquisolid compact; low; ls-2; marketed; materials; mean; medication; min; mixture; oral; particles; peak; pharm; pharm pharm; pharm sci; phosphate; plavix; powder; preparation; prepared; profiles; properties; pure; rate; ratio; ray; release; repose; res; results; sci; sls; solubility; soluble; spectrum; study; surface; system; tablets; technique; test; time; tween; uniformity; value; vehicle; vol.27(2; water; weight
     • versions: original; plain text
528. bijps-801
     • author: Nafeer, Sara Ameen; Zalzala, Munaf
     • title: Possible Amelioration of the Severity of Nutritional Steatohepatitis by Guggulsterone in Mice: guggulsterone and steatohepatitis in mice
     • date: 2019-06-09
     • words: 3817
     • flesch: 50
     • summary: This study data showed a reduction in the level of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and Alkaline phosphatase (ALP) in guggulsterone treated groups remarkably with the higher concentration, compared to the HFD-treated group, thus consequently alleviated the damage in the liver caused by HFD. Guggulsterone enhance the transcription of bile salt export pump that lead to reduced hepatic lipid content, also due to guggulsterone own activity as antioxidant, guggulsterone reduce the need for the bilirubin that act as free radical scavenger this results in reduced oxidative stress (18)(19) eventually reduced production of bilirubin, as noted in the presented results that serum TB is significantly lower in guggulsterone treated groups compared with the HFD group that showed a markedly elevated TB level.
     • keywords: activity; ast; bile; cholesterol; comparison; concentration; control; control group; decrease; degeneration; diet; different; disease; effects; expression; fat; fat diet; fatty; figure; fxr; group; guggulsterone; hepatic; hfd; hfd group; high; higher; https://doi.org/10.31351/vol28iss1pp17-23; increase; inflammation; iraqi; ldl; level; lipid; liver; mice; models; nafld; non; nutritional; p<0.05; pharm; ppm; results; sci; serum; significant; standard; steatohepatitis; steatosis; study; tissue; tnf; treatment; vol.28(1; weeks; الدهني; الفئران; الكبد; على
     • versions: original; plain text
529. bijps-806
     • author: Salih, Balqes Hisham; H.Ali, Shatha; I. Allehibi, Khalid
     • title: Serum Aldosterone Levels in Patients With Diabetic Nephropathy in Relation to Vascular Calcification
     • date: 2019-06-11
     • words: 5663
     • flesch: 54
     • summary: In overweight subjects, moreover,a high salt intake is associated with a larger increase in the extra cellular volume (ECV) than in lean subjects, supporting the impact of subtle changes in renal haemodynamics on volume homeostasis(38), as being presented in this study with a positive correlation between body weight and serum aldosterone (figure-7) in group B diabetic patients. A mean values are higher in diabetic patient with microalbuminuria compared to diabetic patients without microalbuminuria and control group and this referred to uncontrolled diabetes ,aldosterone show a correlation with weight and body mass index while fetuin-
     • keywords: aldosterone; angiotensin; baghdad; blood; bmi; body; calcification; cardiovascular; cause; chem; chloride; clin; complications; concentration; control; control group; correlation; creatinine; development; diabetes; diabetic; diabetic nephropathy; diabetic patients; disease; early; effect; electrolyte; endocrinology; et al; evaluation; factors; fetuin; figure; filtration; fsg; function; gault; gfr; glomerular; glucose; group; hba1c; healthy; heart; high; higher; hypertension; hyponatremia; increase; index; insulin; intake; iraqi; kidney; levels; liver; mass; mean; mellitus; metabolic; microalbuminuria; microvascular; negative; nephropathy; obesity; parameters; patients; pharm; plasma; positive; potassium; raas; range; rate; renal; resistance; retention; risk; role; salt; sci; serum; serum aldosterone; serum creatinine; serum fetuin; significant; similar; sodium; study; subjects; syndrome; system; test; type; urea; values; vascular; vol.28(1; weight; years; االدرار; الثاني; الدقيق; الذين; السكري; الكلى; النوع; دقيق; زاللي; لديهم; هذه
     • versions: original; plain text
530. bijps-809
     • author: Alatraqchi, Faten Ibraheem; J. AL Gawhri, Fatima
     • title: Preparation and In-Vitro Evaluation as an Oral Microsponge Tablet of Baclofen
     • date: 2019-06-11
     • words: 7424
     • flesch: 62
     • summary: BFN microsponge tablets prepared using 40 % (w/w) carbopol 934p as a gastroretentive polymer and 17.5 % (w/w) sodium bicarbonate maintained the tablet integrity and achieved tablets with maximum swelling and shorter FLT with controlled drug release. Therefore, BFN floating microsponge tablets formulated with 30 % and 40 % carbopol 934 p polymer showed an acceptable tablet shape with excellent FLT and TFT and good gel strength layer that maintained integrity of the tablets.
     • keywords: 0.1n; acetone; analysis; baclofen; bf14; bfn; bfn microsponge; bicarbonate; calibration; carbopol; concentration; curve; delivery; development; different; diffusion; dissolution; droplets; drug; drug release; dsc; duration; effect; effervescent; emulsion; equal; eudragit; evaluation; external; figure; float; flt; fmt4; fmt7; formula; formulation; friability; gastroretentive; hardness; hcl; higher; increase; int; internal; iraqi; iraqi j; j pharm; journal; kinetic; loaded; low; matrix; mean; method; microsponge; microsponge formula; microsponge tablets; mixture; model; non; novel; oil; oral; oral microsponge; paraffin; particle; percentage; pharm; pharm sci; pharmaceutical; phase; physical; polymer; powder; preparation; prepared; pure; range; rate; ray; release; res; results; rs100; scanning; sci; sec; selected; sem; significant; size; sodium; solvent; spectrum; speed; stirring; study; swelling; system; tablets; test; tft; time; type; value; vol.28(1; volume; water; weight; λmax; الدواء
     • versions: original; plain text
531. bijps-811
     • author: Ameen, Zeyad A.; Ali, Shatha H.
     • title: Effects of Aldosterone, Osteoprotegerin and Fibroblast Growth Factor-23 and Some Biochemical Markers in Chronic Kidney Disease Patients (Stage II-IV) among Patients with or without Cardiovascular Events
     • date: 2018-12-07
     • words: 4617
     • flesch: 53
     • summary: Data analysis showed that fasting serum glucose levels of CKD patients (with and without CV disorder) had significantly higher values as compared to the controls (76.5% and 29% respectively). Mortality of CKD adjusted for comorbidity, race, gender, age and previous hospitality for CKD patients indicate an obvious decline in rates since 1995 may reflect to some extent the increased recognition of CKD as this confirmed by increasing number of patients carrying the diagnosis(2) .
     • keywords: ace; aldosterone; associated; baghdad; bone; calcium; cardiovascular; chronic; chronic kidney; ckd; ckd patients; concentrations; controls; correlation; creatinine; data; different; disease; disorder; elevated; events; failure; fgf-23; fgf23; fibroblast; figure; function; gfr; glucose; groups; growth; heart; increase; iraqi; kidney; kidney disease; levels; mean; mortality; nephrol; normal; opg; osteoprotegerin; p=0.005; patients; pharm; phosphate; plasma; renal; risk; sci; serum; serum aldosterone; serum opg; significant; sodium; stage; study; subjects; table; urea; values; vol.27(2; العجز; الكلوي; مرضى
     • versions: original; plain text
532. bijps-813
     • author: Shawkat, Ali Jalal; H. Jwaid, Ahmed; M. Awad, Ghada
     • title: Evaluating Health-Related Quality of Life (HRQoL) in Iraqi Adult and Pediatric Patients with Beta-Thalassemia Major Using Two Different Iron Chelation Therapies
     • date: 2019-06-11
     • words: 5377
     • flesch: 61
     • summary: It is clear from table (5) that education has a significant direct correlation with all QoL domains, which was found to agree with Ansari et Iraqi J Pharm Sci, Vol.28(1) 2019 Quality of life in thalassemia major 50 al.(19) and Gin et al.(20) in which patients with higher educational levels have better QoL. Thalassemic facies and poor body image in adult thalassemia patients have a negative impact on QoL domains. In adults patients; Health-Related Quality of Life (HRQoL) components were significantly lower in patients receiving Deferoxamine (DFO).
     • keywords: adolescents; adults; age; agreement; analysis; assessment; beta; better; blood; bref; center; chelation; children; college; complications; correlation; deferasirox; deferoxamine; dependent; dfo; dfx; disease; disorders; distribution; domains; education; effects; et al; facies; factors; ferritin; frequency; functioning; group; health; hematology; hrqol; icts; impact; iraqi; iron; journal; level; life; lower; major; negative; normal; number; oncology; overload; patients; pediatrics; pharm; physical; present; psychological; qol; quality; questionnaire; questions; related; relationship; sci; score; significant; social; splenectomy; study; table; thalassemia; thalassemia major; therapy; total; transfusion; treatment; value; variables; vol.28(1; whoqol; years; الحياة; النوعية; جودة; لدى
     • versions: original; plain text
533. bijps-817
     • author: Radhi, Zainab Abdulmohsin Hadi; Ghareeb, Mowafaq Mohammed
     • title: Preparation and Evaluation of Rebamipide Film using Casting Technique for Local Action
     • date: 2019-06-09
     • words: 6577
     • flesch: 54
     • summary: The results of this study showed that rebamipide ocular inserts have good potential for futuristic rebamipide extended release ocular delivery system. Table( 1) Composition of formulas of matrix rebamipide ocular inserts Evaluation of rebamipide ocular inserts: Physical appearance Physical appearance of the insert’s color, transparency and texture was observed and inspected visually (21) .
     • keywords: absorption%; acid; amino; appearance; arginine; available; batch; buffer; calculated; calibration; casting; composition; content; curve; deionized; delivery; determination; diluted; drug; dry; dsc; effect; endurance; evaluation; eye; figure; film; folding; formula; formulation; ftir; glycol; hpmc; hydroxypropyl; inserts; internet; iraqi; j pharm; k15; loss%; management; mean; methanol; methylcellulose; moisture; molecular; mucosta; ocular; ocular inserts; ophthalmic; pharm; phosphate; physical; plasticizer; polymer; preparation; prepared; properties; pure; range; rebamipide; reference; release; results; sci; significant; solubility; solution; solvent; spectrum; stretching; study; surface; suspension; syndrome; system; table; tear; technique; temperature; thermogram; thickness; time; treatment; uniformity; value; vol.28(1; water; weight; مثيل
     • versions: original; plain text
534. bijps-824
     • author: Abass, Maysam M.; A. Rajab, Nawal
     • title: Preparation and Characterization of Etodolac as a Topical Nanosponges Hydrogel
     • date: 2019-06-11
     • words: 5217
     • flesch: 51
     • summary: The viscosity of nanosponges hydrogel Carbopol 934 hydrogel showed approximate viscosity between (32,000 -134,150) CP for ETO loaded NS hydrogel while ETO hydrogel showed viscosity between (45,000 - 140,546) CP; Figure (15). The selected formula was lyophilized then incorporated into hydrogel ; which also evaluated .The results show that the formulation that contain Drug:Polyvinyl alcohol: ethylcellulose in ratio 1:3:2 is the best with smallest particle size 40.2±0.098nm with polydispersibility0.005 and in vitro release 97.6%±0.11, , ETO NS Carbopol hydrogel produced a significant(p<0.05) improvement of the in vitro release than pure ETO hydrogel.
     • keywords: analysis; aqueous; bioavailability; buffer; carbopol; characterization; chemical; concentration; delivery; dialysis; different; diffusion; dispersion; dissolution; drug; effect; emulsion; eto; etodolac; evaluation; figure; formula; formulations; ftir; hydrogel; increase; international; iraqi; journal; loaded; lyophilized; materials; mean; method; molecules; nanoparticles; nanosponges; nanosponges hydrogel; nature; organic; particle; pbs; pharm; pharmaceutical; pharmacy; phase; phosphate; physical; polymer; powder; preparation; prepared; profile; properties; pure; pva; rao; release; research; result; rpm; sci; sciences; selected; sem; size; solubility; solvent; speed; stirring; structure; study; surface; table; time; topical; type; viscosity; vivo; vol.28(1; water; zeta
     • versions: original; plain text
535. bijps-827
     • author: Abdul jabbar, Aliaa Abdul sattar; H. Kathem, Sarmed
     • title: The Protective Effect of Ethanolic Extract of Mentha spicata Against Irinotecan-Induced Mucositis in mice
     • date: 2019-06-11
     • words: 4133
     • flesch: 56
     • summary: Mentha ethanolic extract orally administered to mice for 7 days starting one day before irinotecan dose. As a conclusion, Mentha ethanolic extract has a protective effect on irinotecan-induced mucositis.
     • keywords: 0.1ml; activity; animals; anti; atrophy; bowen; cancer; cell; changes; chemotherapy; chronic; control; damage; day; days; diarrhea; dose; dysplastic; effects; enzyme; ethanolic; ethanolic extract; examination; extract; fecal; figure; gibson; glucuronidase; group; histopathological; il-1β; infiltration; inflammatory; internet; intestinal; iraqi; irinotecan; jejunum; leaves; level; mentha; mentha ethanolic; mice; model; mucositis; normal; pharm; phase; protective; rats; reactive; saline; sci; sections; significant; sn-38; solution; species; spicata; study; successive; table; tissue; toxicity; treatment; villi; vol; vol.28(1; االلتهاب; االيرينوتيكان; المعوي; بواسطه
     • versions: original; plain text
536. bijps-860
     • author: A. Khaleel, Raghad; H. Zalzala, Munaf
     • title: Ameliorating Effect of Oral Guggulsterone Administration in Imiquimod-Induced Psoriasis in Mice
     • date: 2018-12-06
     • words: 4661
     • flesch: 49
     • summary: The results of the current study showed that guggulsterone suspension can significantly reduce psoriasis area and severity index in (guggul suspension + imiquimod group as compared with both control group and (vehicle suspension + imiquimod ) group. Histological examination of mice skin and right ear section.
     • keywords: administration; area; cells; comparison; control group; deviation; different; differentiation; disease; drug; ear; effect; elevation; epidermal; epidermis; examination; factor; figure; group; guggulsterone; guggulsterone administration; histological; il-17; il-23; imiquimod; immune; immunol; index; infiltration; inflammation; inflammatory; iraqi; layer; level; like; mean; measured; mice; negative; normal; oral; oral administration; oral guggulsterone; p<0.05; pasi; pharm; preparation; psoriasis; psoriatic; respect; results; rete; right; sci; score; section; serum; severity; significant; skin; spleen; standard; study; susp+imq; susp+imq group; suspension; thickening; thickness; tissue; tnf; topical; treatment; type; value; vehicle; vehicle susp+imq; vol.27(2
     • versions: original; plain text
537. bijps-861
     • author: A. I. Al-Geam, Manal; N. Al-Shawi, Nada
     • title: Effects of Vitamin E and Q10 Supplementation against Doxorubicin-Induced Neurotoxicity in Rats
     • date: 2018-12-06
     • words: 5188
     • flesch: 54
     • summary: Mean ± SEM of IL-1β levels in brain tissue homogenate were respectively, 54.2±5.8 vs. 49.5±4.2. Mean±SEM of IL-1β level in brain tissue homogenate were respectively, 100.2±4.3 vs. 175.1±15.2, 110.2±7.9 vs. 175.1±15.2, and 108.5±10.8 vs. 175.1±15.2.
     • keywords: 100mg; 50mg; animals; antioxidant; blood; brain; brain tissue; cancer; cells; coenzyme; college; combination; control; control group; coq10; corn; day; differences; dose; dox; doxorubicin; effect; examination; figure; group; group iv; group vii; histopathological; homogenate; iii; il-10; inflammatory; injection; iraqi; kg bw; kg coq10; kg vit; levels; mean; mediators; neuronal; neurotoxicity; non; normal; oil; oxidative; p<0.05; pharm; positive; prior; rats; role; sci; section; sem; significant; study; supplements; table; tissue; tissue homogenate; tnf; university; vii; vit e; vitamin; vitamin e; vol.27(2; weeks; المجموعة; كغم; لمدة; ملغم; يومياً
     • versions: original; plain text
538. bijps-862
     • author: J. Jebur, Nisreen; J. Kadhim, Dheyaa; M. Firhan, Nawal.
     • title: Belief about Medications among Sample of Iraqi Patients with Inflammatory Bowel Disease
     • date: 2018-12-06
     • words: 5132
     • flesch: 60
     • summary: In addition, frequency of patients treated in out-patients setting was higher in CD patients which means that patients with CD may undergo less relapses or any other causes that lead to hospitalization and then CD patients usually treated as outpatients more than UC patients. Future studies should investigate how interventional approaches addressing these predictors may lead to improve beliefs about medicines among inflammatory bowel disease patients and their impact on disease control.
     • keywords: analysis; beliefs; bmq; bowel; bowel disease; chronic; colitis; components; concern; concern score; correlation; crohn; current; disease; doses; drugs; duration; et al; frequency; gastroenterology; gender; general; greater; harm; health; higher; horne; ibd; inflammatory; inflammatory bowel; infliximab; iraqi; journal; male; mean; medications; medicines; necessity; number; overuse; patients; prescribed; questionnaire; regression; result; rural; sci; score; significant; smoking; specific; specific concern; specific necessity; strong; study; surgical; table; test; treatment; ulcerative; value; variables; vol.27(2; years; االمعاء; التهاب; المعتقدات
     • versions: original; plain text
539. bijps-863
     • author: A. Ali, Inas; H. Ali, Shatha
     • title: Impact of Osteocalcin Level on Vascular Calcification in Type 2 Diabetics in Relation to Fibroblast Growth Factor-23(FGF-23)
     • date: 2018-12-06
     • words: 7007
     • flesch: 54
     • summary: As consistent with these studies, the mean of serum ucOC level was significantly reduced in diabetic patients groups (A and B) when compared with control group (p<0.01) as illustrated in figure-1 The reduction of serum ucOC level in patients with T2DM can be explained by the following causes: Iraqi J Pharm Sci, Vol.27(2) 2018 Osteocalcin and vascular calcification in diabetics 49 1. As illustrated in figure-1, the mean of serum ucOC level was significantly lowered in diabetic patients with cardiovascular disease (group A) and diabetic patients without cardiovascular disease (group B) when compared with control group (p<0.01), while there was no significant variation between diabetic patients groups (p>0.05).
     • keywords: alkaline; alp; arterial; artery; association; atherosclerosis; biochem; blood; bmd; bone; calcification; calcium; cardiovascular; cardiovascular disease; carotid; ca×pi; cell; chronic; clin; clinical; concentration; consistent; control; coronary; correlation; creatinine; density; diabetes; diabetic; diabetic patients; different; disease; disease group; dm patients; elevated; endocrinol; energy; et al; factor; fasting; fgf-23; fibroblast; figure; formation; fracture; fsg; function; future; glucose; group; group b; growth; hba1c; healthy; higher; homa; homeostasis; hormone; human; hypertension; increment; insulin; insulin resistance; int; iraqi; kidney; levels; lower; mean; measurement; med; mellitus; metabolism; mineral; mineralization; normal; number; osteoblasts; osteocalcin; p>0.05; patients; pharm; phosphate; present; pressure; pth; range; reduction; relation; relationship; renal; resistance; results; risk; role; sample; sci; serum; serum glucose; significant; specific; studies; study; subjects; t2 dm; type; ucoc; undercarboxylated; value; vascular calcification; vitamin; vol.27(2; الدموية; السكري; المجموعة; النوع; على
     • versions: original; plain text
540. bijps-864
     • author: T. Hasan, Hayder; J. Kadhim, Enas
     • title: Phytochemical Investigation of Corchorus olitorius L. Leaves Cultivated in Iraq and it’s In Vitro Antiviral Activity
     • date: 2018-12-07
     • words: 4386
     • flesch: 57
     • summary: Different statistical result revealed a significant antiviral activity of the aqueous layer of Corchorus olitorius leaves against measles virus. Keywords: Corchorus olitorius, flavonoids, Phenolics, Antiviral, Measles.
     • keywords: acetate; acid; activity; antiviral; aqueous; aqueous layer; assay; baghdad; cardiac; cells; color; compounds; concentrations; control; corchorus; corchorus olitorius; cytotoxicity; dboivinopyranoside; density; different; digitoxigenin; digitoxopyranoside; dry; effect; ethyl; extract; extraction; family; filtrate; flavonoids; food; glycosides; hrs; infection; investigation; iraqi; journal; jute; layer; leaf; leaves; like; materials; mean; measles; measles virus; mtt; multiplicity; natural; number; olitorius; optical; pharm; pharmacological; phenolics; phenols; phytochemical; plant; preliminary; presence; result; sample; sci; seeds; significant; solution; solvent; statistical; strophanthidin; study; table; test; tetrazolium; tiliaceae; vero; viability; virus; vol.27(2; water; world; yellow; أوراق; الملوخية; على
     • versions: original; plain text
541. bijps-868
     • author: Ali, Ahmed H.; N. Abd-Alhammid, Shaimaa
     • title: Enhancement of Solubility and Improvement of Dissolution Rate of Atorvastatin Calcium Prepared as Nanosuspension
     • date: 2019-12-22
     • words: 6577
     • flesch: 45
     • summary: Atorvastatin calcium nanosuspension was evaluated for particle size, poly dispersity index (PDI), zeta potential, crystal form and surface morphology. Atorvastatin calcium nanosuspension 47 Introduction Formulating poorly water soluble drugs to obtain a suitable bioavailability has become a serious defy in scientific, industrial, and medical issue.
     • keywords: 0.1n; 25oc; addition; applied; atorvastatin; atorvastatin calcium; buffer; calcium; calcium nanosuspension; calcium powder; concentrations; different; dissolution; drug; drying; dsc; e15; effect; electrostatic; enhancement; evaluation; f17; f18; factor; figure; formulation; freeze; hcl; hpmc; inclusion; influence; international; ionic; iraqi; journal; k30; measurement; media; morphology; nanosuspension; non; particle; particle size; particulate; pharmaceutical; phosphate; polymer; polymeric; potential; powder; preparation; prepared; primary; profile; pure; pvp; rate; reduction; release; results; rpm; saturation; sci; size; sls; sodium; solubility; soluble; solvent; speed; stability; stabilization; stabilizer; steric; study; surface; surfactant; table; technique; temperature; time; tpgs; tween80; types; vitamin; vol.28(2; water; zeta
     • versions: original; plain text
542. bijps-872
     • author: Khudair, oun D.; A. Fatih, Diar
     • title: Synthesis and Characterizations of Dipeptide Derivative of Gentamicin
     • date: 2019-12-22
     • words: 2942
     • flesch: 57
     • summary: C=O stretching of ester 1768 C=O stretching of amide group 1681 N-H bending of secondary amide 1529 Asymmetric C– H bending of methyl group 1462 Symmetric C–H bending of methylene group 1432 C-O stretching of ester. Chemical synthesis of compound Ib (Synthesis of Boc L-val -L-ala dipeptide)
     • keywords: acid; ala; amide; amino; appearance; asymmetric; baghdad; bending; boc; ch2; ch3; chemical; chloride; chloroform; compound; data; derivative; dipeptide; ecf; elemental; ester; ether; gentamicin; group; iraqi; journal; melting; methyl; methylene; mixture; mol; pharm; pharmaceutical; physical; precipitate; reaction; sci; secondary; solution; stretching; synthesis; synthesized; table; transporters; val; values; vibration; vol.28(2; ثنائي
     • versions: original; plain text
543. bijps-874
     • author: Shihab, Ikram K.; H. Mohammed, Mohammed
     • title: Synthesis, Characterization and Preliminary Anticancer Study of Novel 5-fluorouracil Conjugate with Pyrrolidine Dithiocarbamate as a Mutual Anticancer Prodrug
     • date: 2019-12-21
     • words: 4062
     • flesch: 60
     • summary: ** Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq Abstract 5-Fluorouracil (5-FU)s one of the commonly used chemotherapy drugs in anticancer therapy; unfortunately treatment with 5-FU solely has many drawbacks low lipophilicity, low permeability, low molecular weight, and its relatively poor plasma protein binding; also a brief half-life, therefore frequent administration is required to maintain the optimal therapeutic plasma level which in addition to its poor selectivity, drug resistance and limited penetration to cancer cells; leads to increased incidence of side-effects to healthy cells/tissues and low response rates. .Properties like poor selectivity, drug resistance and limited penetration to cancer cells
     • keywords: acetate; acid; activity; anticancer; antioxidant; assay; b16v; baghdad; broad; cancer; cells; ch2; chemical; college; compound; concentrated; concentrations; conjugate; control; cooled; cytotoxic; cytotoxicity; derivatives; dithiocarbamate; drugs; effect; ethyl; figure; fluorouracil; ftir; hrs; i.r.%; inhibition; iraqi; line; low; mcg; mhz; mole; mutual; negative; nmr; oil; pdtc; pharm; pharmacol; pharmacy; plasma; poor; precipitate; preliminary; prodrug; pvalue; pyrrolidine; rate; reaction; research; resistance; results; room; scheme; sci; significant; solution; stirred; str; stretching; study; synthesis; table; temperature; therapy; tissues; treatment; university; values; vol.28(2; zhang; بغداد
     • versions: original; plain text
544. bijps-876
     • author: Shawkat, Ali Jalal; H. Jwaid, Ahmed
     • title: Clinical Complications of Beta-Thalassemia Major
     • date: 2019-12-21
     • words: 5562
     • flesch: 50
     • summary: The importance of spleen, spleen iron, and splenectomy for determining total body iron load, ferrikinetics, and iron toxicity in thalassemia major patients. 2019 Beta-thalassemia major 4 complications comprising macrovascular complications (cardiovascular, cerebrovascular and peripheral vascular diseases), and microvascular complications (diabetic retinopathy, nephropathy, and neuropathy)(26).The use of HbA1c for assessing glycemic control in thalassemia patients with hemoglobinopathies is less accurate; hence an alternate method for assessment that is not affected by abnormal hemoglobin variants is the use of fructosamine levels measurement which depends on serum protein glycosylation(25).
     • keywords: acid; activity; america; anemia; baghdad; beta; blood; bmd; bone; calcium; cardiac; cause; cells; chain; chelation; chronic; clinical; clinics; complications; concentrations; damage; deficiency; deposition; development; dfo; diabetes; differentiation; disease; disorders; dysfunction; effect; elevated; endocrine; et al; expansion; factor; failure; ferritin; folic; formation; genetic; gland; globin; growth; heart; hematology; hepatitis; high; hormone; hypogonadism; hypoparathyroidism; hypothyroidism; ict; increase; ineffective; international; iraqi; iron; iron overload; journal; leading; levels; liver; major; major patients; management; marrow; medical; medicine; metabolism; multifactorial; normal; north; opg; osteoblasts; osteoporosis; overload; patients; pharm; pituitary; proliferation; pth; puberty; rankl; rate; rbcs; receptor; reduction; resorption; results; role; sci; sciences; serum; severe; splenectomy; susceptible; synthesis; system; thalassemia; thalassemia major; thalassemia patients; therapy; tm patients; transfusion; treatment; type; ventricular; vitamin; vol.28(2; years; zinc; β‐tm; الدم; للحديد
     • versions: original; plain text
545. bijps-877
     • author: al_talkani, ahmed F.; H. Kathem, Sarmed
     • title: The Prevalence of UGT1A1*93 and ABCC5 Polymorphisms in Cancer Patients Receiving Irinotecan-Based Chemotherapy at Al-Najaf Al-Ashraf
     • date: 2019-12-22
     • words: 3439
     • flesch: 55
     • summary: This finding was consistent with Li et al. and Crona et al studies, who postulated that a polymorphism of UGT1A1*93 was a strong predictor of irinotecan induced neutropenia, that is associated with higher SN-38 AUC and lower absolute neutrophils3 counts (ANC) nadirs. Vomiting 4 16.7% a: irinotecan dose reduction (25% -35%)
     • keywords: abcc5; adverse; agent; allele; assay; baghdad; blood; cancer; center; characteristics; clinical; college; colorectal; diarrhea; dna; dose; drug; enzyme; et al; euphrates; features; genes; genotyping; heterozygous; high; homozygous; inner; iraqi; irinotecan; journal; metabolism; metastatic; middle; mutation; national; neutropenia; outer; patients; pcr; pharmacogenetics; pharmacy; polymorphism; prevalence; research; response; results; rs562; rs569189; sci; sec; severe; sn-38; snp; studies; study; table; therapy; toxicity; transporter; treatment; type; ugt1a1; usa; variant; vol.28(2; wild
     • versions: original; plain text
546. bijps-879
     • author: Mohammed, Samer I.; Dawood, Elaf B.; Abaas, Iman S.
     • title: Perceptions and attitudes of community pharmacists towards patient counseling and continuing pharmacy education programs in Iraq
     • date: 2019-12-22
     • words: 3892
     • flesch: 59
     • summary: Almost (47%) of participants indicated that attending continuous pharmacist education programs can help them to improve the counseling practice furthermore, the majority of them have an optimistic attitude toward the importance of these programs for the future of their career. By increasing pharmacists in pharmacy 44(16.73) Attendance of continuous pharmacist education programs 124(47.14) Specify special areas for providing consultation 84(31.93) Other 11(4.18) Only less than (5%) of participants said that continuous pharmacist education programs available for them while more than half of the participants cleared that these programs rarely reach to Iraqi pharmacists as shown in table 7.
     • keywords: attitude; baghdad; bsp; care; college; community; community pharmacists; consultation; continuous; counseling; countries; data; different; dispensing; dose; drug; education; education programs; half; health; higher; information; internet; iraq; j pharm; journal; knowledge; majority; medications; minutes; n=263; nov; number; opinion; participants; patients; percentages; perception; pharmaceutical; pharmacists; pharmacy; pharmacy education; practice; prescription; previous; programs; result; role; sci; study; table; time; university; vol.28(2; years; التعليم; الصيادلة; العراق; المستمر; بغداد; على
     • versions: original; plain text
547. bijps-883
     • author: Abed, haithem N; A. Hussein, Ahmed
     • title: Ex-vivo Ex-Vivo Absorption Study of a Novel Dabigatran Etexilate Loaded Nanostructured Lipid Carrier Using Non-Everted Intestinal Sac Model
     • date: 2019-12-22
     • words: 5402
     • flesch: 51
     • summary: Conclusion In the present study, DE loaded NLCs were successfully prepared utilizing emulsification / ultrasonication method, and the formula N1 was selected due to its preferred particle size distribution, zeta potential, entrapment efficiency and drug release profile and selected to undergo ex-vivo permeability study and the obtained data reveals a four folds increase in drug permeability showing that NLCs is a promising delivery system to increase the DE oral bioavailability. Beloqui A., Solinís M.A., des Rieux A, Préat V. and Rodríguez-Gascón A., Nanostructured Lipid Carriers: promising drug delivery systems for future clinics, Nanomed.:
     • keywords: accuracy; acid; analysis; analytical; aqueous; area; baghdad; bioavailability; calculated; capacity; carriers; characterization; concentration; dabigatran; dabigatran etexilate; data; delivery; determined; deviation; different; dissolution; drug; efficiency; entrapment; etexilate; figure; formula; free; grade; hplc; increase; intestinal; iraqi; journal; lipid; lipid carriers; loaded; loading; matrix; mean; methanol; method; min; mobile; n=3; nanoparticles; nlcs; non; oil; oleic; oral; particle; permeability; permeation; permeation study; pharm; phase; potential; precision; preparation; prepared; pure; rate; regression; release; results; robustness; sac; sample; sci; size; solid; solution; standard; study; suspension; system; table; validation; value; vivo; vol.28(2; volume; water; zeta; zhang; 𝑊𝑡𝑜𝑡𝑎𝑙; 𝑑𝑟𝑢𝑔
     • versions: original; plain text
548. bijps-884
     • author: Kassab, Hanan J.; MERDAW, Maysoon A.; J. Al- Ramahi, Intesar; A. Alasadi, Alaa; Al Mousauy, Sawsan; Ahmed, Rownak; Ismaeel, Israa; Al-Sultani, Dorees
     • title: Use of Human Umbilical Cord Serum to Treat Animal Skin Burns
     • date: 2019-12-23
     • words: 4175
     • flesch: 65
     • summary: But the number of studies using umbilical cord blood for skin injuries remains minor; Liu et al. injected UCB intravenously into burnt mice, while Dai et al. isolated mononuclear cells from mesenchymal stem cells of human umbilical cord blood and transplanted into injured nude mice by tail vein injection (21,22). Human umbilical cord serum HUCS was collected and screened for transmitted diseases such as hepatitis B, hepatitis C and HIV.
     • keywords: agar; animals; area; baghdad; biomed; blood; boiling; burn; burn area; burn treatment; care; cells; cetrimide; chemical; clinical; clot; comparison; control; cord; cord serum; days; dermal; diameter; difference; duration; effects; et al; figure; grade; group; hair; healing; hepatitis; hot; hucs; human; human umbilical; infection; inflammation; injury; int; iraqi; iraqi j; j pharm; mesenchymal; mice; microbial; microorganisms; naoh; pharm; process; rabbits; regrowth; research; results; review; sci; second; serum; significant; skin; source; stem; study; table; test; testing; thermal; treatment; umbilical; umbilical cord; use; vol.28(2; water; wound; التي; الحبل; السري; بغداد; جلد; مصل
     • versions: original; plain text
549. bijps-887
     • author: Saleh, Eman S.
     • title: The Assessment of Some Serum Biomarkers of Fibromyalgia Syndrome in Pre and Postmenopausal Women in Relation to Obesity
     • date: 2019-12-22
     • words: 5434
     • flesch: 55
     • summary: Eastell et al and Khosla et al in different studies described the progress of age lead to increase turnover of bone due to raise the blood level of parathyroid hormone and lower estrogen (34, 35). Quinzii CM, Lopez LC, Naini A et al: Human CoQ10 deficiencies.
     • keywords: age; antioxidant; baghdad; biochemical; biomarkers; blood; bmi; body; bone; calcium; chronic; clin; clinical; co q; coenzyme; college; control; coq; criteria; decreased; different; disease; dysfunction; effect; enzyme; et al; fibromyalgia; fibromyalgia syndrome; figure; fms; groups; health; hormone; hyperparathyroidism; increase; independent; influence; iraqi; journal; level; mass; mean; menopause; mitochondrial; mmol; musculoskeletal; normal; obese; obesity; osteoarthritis; oxidative; p value; pain; patients; pharm; post; postmenopausal; pre; premenopausal; primary; pth; q10; relationship; results; rheumatol; rheumatology; role; sci; serum; serum pth; significant; status; stress; studies; study; subjects; symptoms; syndrome; table; tas; total; ttest; turnover; value; vitamin; vol.28(2; weight; women; years; البدينات; الهرمون; اليأس; مضادات; معنويه
     • versions: original; plain text
550. bijps-888
     • author: G.Al-Rakhat, Iman; N.Al-Shawi, Nada
     • title: Effects of Hydrochlorothiazide on Tenofovir Disoproxil Fumarate-Induced Nephrotoxicity in Rats
     • date: 2019-12-22
     • words: 4556
     • flesch: 58
     • summary: Thus, results of this study concerning the effects of hydrochlorthiazide on kidney are coincide with that of Wadei H.M, et al at 2008 who reported that low kidney function and glomerular and tubular injury can be more commonly manifested in thiazide-treated rats (32). Adikwu, E, Ogbuehi I, Nkereuwen J., et al. Tenofovir Renal Toxicity: Evaluation of Cohorts and Clinical Studies-Part 2. Pharmacology and Pharmacy 2014; 5: 97-111. 8.
     • keywords: acute; antiretroviral; baghdad; blood; cells; control; control group; corresponding; creatinine; cystatin; day; different; disoproxil; disoproxil fumarate; drug; effect; et al; figure; fumarate; function; gavage; group; group ii; human; hydrochlorthiazide; iii; il-10; injury; iraqi; kidney; level; mean±sem; negative; negative control; nephrotoxicity; non; oat3; organic; p<0.05; patients; pharm; pharmacology; pharmacy; proximal; rats; reduction; renal; sci; serum; serum cystatin; serum level; significant; study; table; tdf; tenofovir; tenofovir disoproxil; tfv; transporters; treatment; tube; tubular; tubule; values; virus; vol.28(2; weeks; البروكسيل; التينوفوفير; السمية; الم; ثنائي; على; فيوماريت; معنويا; موعة
     • versions: original; plain text
551. bijps-896
     • author: Jaafar, Noor Sabah
     • title: Clinical effects of Arabic gum (Acacia): A mini review
     • date: 2019-12-21
     • words: 6218
     • flesch: 54
     • summary: Sugars arabinose and ribose were originally discovered and isolated from gum Arabic which represents the original source of these sugars. Although gum Arabic considered as an inert substance, recent information revealed multiple pharmacological and medical effects, such as weight reduction, antihypertensive, antihyperlipidemic, anticoagulant, antibacterial, antidiabetic, anti-inflammatory, nephroprotective and other effects.
     • keywords: abd; ability; absorption; acacia; acacia senegal; acid; action; activity; ahmed; albino; amino; antibacterial; antimicrobial; antioxidant; antiulcer; aqueous; arabic; arthritis; babiker; bile; biological; blood; body; cell; cholesterol; chronic; clinical; coagulation; coating; concentration; consumption; content; day; decrease; diabetes; diabetic; dietary; digestive; disease; dose; effect; enzymes; et al; expression; extract; failure; fat; fedail; female; fiber; food; glucose; gram; gum; gum arabic; hdl; healthy; high; https://www.sciencedirect.com/science/article/pii/s2225411016300268; human; hydrocoll; hyperlipidemia; improvement; induced; inflammation; inflammatory; ingestion; intake; intestine; iraqi; kidney; large; level; lipid; liver; low; main; management; mass; mice; mrna; musa; nasir; new; obesity; oxidative; patients; percentage; pharm; pharmaceutical; pharmacol; pharmacological; plasma; potassium; pressure; protective; protein; quality; rats; reduction; renal; res; review; role; sci; senegal; seyal; significant; solution; species; staphylococcus; stress; studies; study; sudan; sugars; treatment; trees; type; urea; vol.28(2; weeks; weight; الصمغ; العربي; مضاد; يتم
     • versions: original; plain text
552. bijps-916
     • author: Shanshal, Aysha M.; H. Ataimish, Ahmed
     • title: Evaluation of Knowledge, Attitudes and Experience of off-label Drug Prescribing Practice among Physicians in Baghdad City Hospitals
     • date: 2019-12-22
     • words: 5952
     • flesch: 55
     • summary: The authors thank Professor Dr. Saad A. Hussain for the instructions and valuable advice, and specifically for sharing his knowledge concerning off label prescribing with us. Radley D, Finkelstein S and Stafford R. Off- label prescribing among office-based physicians.
     • keywords: administration; age; attitudes; authority; baghdad; chi; city; clinical; clinical trials; common; concerns; consent; current; different; dose; drug; efficacy; ethical; experience; familiar; figure; formulation; frequency; groups; half; healthcare; hospitals; information; iraqi; issues; journal; knowledge; label; label drug; label medicines; label prescribing; label use; majority; medical; medications; medicines; n(%; new; number; offlabel; participants; patients; percentage; pharm; pharmaceutical; pharmacol; pharmacy; physicians; practice; prescribe; prescribing; present; providers; questionnaire; questions; reasons; recruit; research; respondents; safety; sci; significant; sources; square; study; table; targeted; term; test; treatment; trials; use; values; views; vol.28(2; volunteers; years; younger; بغداد
     • versions: original; plain text
553. bijps-919
     • author: Dahash, Rajaa A.; A. Rajab, Nawal
     • title: Formulation and Investigation of Lacidipine as a Nanoemulsions
     • date: 2020-06-21
     • words: 5714
     • flesch: 61
     • summary: Results of thermodynamic stability studies For LCDP nanoemulsions. Particle size measurement for LCDP nanoemulsion.
     • keywords: 2016; afm; analysis; atomic; baghdad; bioavailability; characterization; chromatograms; clear; cm−1; conductivity; content; ddw; delivery; development; diagram; different; diluted; dilution; dispersion; dissolution; droplet; drug; effect; electrical; ethanol; evaluation; excipients; f-1; f-2; f-3; f-5; f-6; f-7; f-8; fcode; figure; force; formula; formulation; ftir; good; higher; hplc; index; int; int j; iraqi; iraqi j; j pharm; journal; lacidipine; lacidipine nanoemulsions; lcdp; light; liquid; loaded; low; measurement; medium; method; min; nanoemulsions; nanoparticles; nes; oil; optimization; optimum; oral; particle; pass; pass pass; pdi; pharm; pharm sci; pharmaceutical; phase; polydispersity; potential; powder; preparation; prepared; pure; rate; ratios; release; results; rpm; samples; sci; self; size; smix; solid; solubility; stability; stretching; studies; study; surfaces; surfactant; system; table; temperature; ternary; test; thermodynamic; triacetin; tween; values; viscosity; vol.29(1; water; zeta
     • versions: original; plain text
554. bijps-922
     • author: Abbas, Ishraq k.; A. Rajab, Nawal; A. Hussein, Ahmed
     • title: Formulation and In-Vitro Evaluation of Darifenacin Hydrobromide as Buccal Films
     • date: 2019-12-22
     • words: 5421
     • flesch: 63
     • summary: Fast dissolving buccal films are the most innovative oral solid dosage form because of their flexibility and comfort. Keywords: Darifenacin hydrobromide, Overactive bladder, Fast dissolving buccal films.
     • keywords: average; baghdad; bladder; buccal; buccal films; ccs; concentrations; content; darifenacin; darifenacin hydrobromide; degradation; delivery; development; different; disintegration; dissolution; dosage; drug; dsc; effect; evaluation; fast; fdbfs; figure; films; formulas; formulation; ftir; hydrobromide; hydrobromide buccal; indion; initial; iraqi; j pharm; journal; mechanical; method; min; mixture; oab; oral; p<0.05; pass; peaks; percent; petri; pharm; pharmaceutical; pharmacy; physical; polymer; prepared; profile; properties; pva; rate; release; results; sci; significant; sodium; spectrum; ssg; stability; stretching; study; superdisintegrant; surface; t80; table; temperature; thickness; time; variation; vol.28(2; water; weight; xrpd
     • versions: original; plain text
555. bijps-925
     • author: Aldahhan, Eman S.; A. Radhi, Ameera
     • title: Co-Amorphous System: A promising Strategy for Delivering Poorly Water - Soluble Drugs
     • date: 2020-06-21
     • words: 7427
     • flesch: 52
     • summary: Laitinena R, Löbmanna K, Strachana CJ, Grohganzb H, Radesa T. Emerging trends in the stabilization of amorphous drugs. This review highlights the different approaches followed in the preparation of co-amorphous drug delivery system, and the proper selection of the co-formers.
     • keywords: acid; active; addition; adv; amino; amorphization; amorphous; amorphous solid; amorphous system; api; approach; arginine; behavior; binary; bioavailability; biopharm; bonding; cam; characterization; cimetidine; citric; co amorphous; components; crystalline; crystallization; deliv; delivery; different; dispersions; dissolution; docetaxel; dosage; drug; drying; dsc; energy; enhanced; enhancement; eur; eur j; evaporation; excipients; fast; figure; formation; forms; formulations; glass; gordon; grohganz; growth; heat; high; hydrogen; increase; indomethacin; int; int j; interactions; iraqi; j pharm; jensen; laitinen; low; löbmann; materials; mechanical; melt; method; milling; mixing; mixture; molecular; molecules; naproxen; oral; pharm; pharm sci; pharmaceutical; phase; physical; physicochemical; polymeric; poorly; potential; powder; preparation; prepared; process; product; properties; rades; rate; res; result; rev; scale; sci; single; small; solid; solubility; soluble; solvent; spectroscopy; spray; stability; stabilization; stable; state; step; strachan; system; tablets; taylor; technique; temperature; transition; values; vol.29(1; water; weight; zhang; zografi
     • versions: original; plain text
556. bijps-926
     • author: alkufi, hussein K.; Kassab, Hanan J.
     • title: Formulation and Evaluation of Sustained Release Sumatriptan Mucoadhesive Intranasal in-Situ Gel
     • date: 2019-12-22
     • words: 5475
     • flesch: 61
     • summary: Initial rapid release may be due to the exposure of fresh surface of drug present in gel to the sheep mucosa and sustained drug release after 1 h may be due to the polymers like poloxamer407 which slightly decrease the rate of drug release due to enhanced micellar structure and gel network(9) and the presence of HA (hydrophilic polymer) which entrap the drug and sustain the release. Faster release of ST solution in comparism to IG 7 was obtained with a significant difference (p<0.05).The percent of drug release from the ST solution is 99.33% in 2h while the percent of drug release from IG7 in 6h was 95.89% as shown in the figure 4, due to the presence of polymers.
     • keywords: acid; administration; chloride; compartment; compatibility; concentration; content; control; delivery; determination; diffusion; drug; drug release; evaluation; figure; force; formulas; formulation; ftir; gel; gel strength; gelation; gelation temperature; gelling; glass; hyaluronic; ig1; ig2; ig7; ig8; intranasal; iraqi; iraqi j; j pharm; low; mean±sd; melting; membrane; migraine; mucoadhesive; mucosa; n=3; nasal; nasal gel; nasal mucosa; oral; order; permeation; pharm; pharm sci; point; poloxamer; poloxamer188; poloxamer407; polymers; preparation; prepared; range; receptor; release; results; sci; sheep; situ; situ gel; snf; solution; spreadability; strength; stretching; studies; study; sumatriptan; surface; sustained; table; temperature; thermosensitive; time; tissue; value; viscosity; vivo; vol.28(2; water; weight; الدواء; سماتربتان
     • versions: original; plain text
557. bijps-928
     • author: Ali, Samer K.; B. H. Al-Khedairy, Eman
     • title: Solubility and Dissolution Enhancement of Atorvastatin Calcium using Solid Dispersion Adsorbate Technique
     • date: 2019-12-22
     • words: 4870
     • flesch: 56
     • summary: The prepared (SDA) showed improvement of drug solubility in all prepared formula. All prepared formula of SDAs improved the solubility of ATR may be due to increased wettability and reduced crystallinity of the drug, which leads to improve drug solubility and dissolution.
     • keywords: 200; adsorbate; adsorbent; adsorption; aerosil; area; atorvastatin; atr; bioavailability; calcium; carrier; characteristic; cm-1; content; crystalline; determination; different; diffraction; dispersion; dispersion adsorbate; dissolution; drug; dsc; effect; enhancement; evaluation; figure; formula; fourier; ftir; high; hydrophilic; improvement; infrared; int; intensity; iraqi; iraqi j; j pharm; magnesium; mas; melting; method; peak; peg; peg4000; percentage; pharm; pharm sci; pharmaceutical; poloxamer; poloxamer188; poloxamer407; poorly; powder; preparation; prepared; pure; rate; ray; results; samples; saturation; sci; sda; sda12; sdas; silicate; solid; solid dispersion; solubility; soluble; stretching; studies; study; surface; table; technique; vol.28(2; water; xrd; yield; الذوبان; الصلب; المنتشر; قابلية
     • versions: original; plain text
558. bijps-929
     • author: Rashid, Asmaa M.; Abdal-Hammid, Shaimaa N.
     • title: Formulation and Characterization of Itraconazole as Nanosuspension Dosage Form for Enhancement of Solubility
     • date: 2019-12-22
     • words: 5058
     • flesch: 56
     • summary: ITZ nanosuspension was produced by a solvent-antisolvent nanoprecipitation method in the presence of different stabilizers (Poloxamer-188 and HPMCE5) at different ratios with the drug alone or combination with surfactants (tween 80 and SLS). Zeta potential The zeta potential for the selected formulation of ITZ nanosuspension was - 21.86 mV, as shown in figure 6.
     • keywords: analysis; bioavailability; characteristic; characterization; concentration; delivery; determined; different; dissolution; drug; dsc; effect; efficiency; entrapment; evaluation; figure; formula; formulation; ftir; hcl; hpmc; index; international; iraqi; itraconazole; itraconazole nanosuspension; itz; itz nanosuspension; journal; lyophilization; lyophilized; mean; method; min; nanoparticles; nanoprecipitation; nanosuspension; oral; p-188; particle; particle size; pdi; peaks; pharm; pharmaceutical; pharmacy; polydispersity; potential; powder; preparation; prepared; presence; pure; pure itz; range; rate; ray; release; research; results; rpm; sample; saturation; sci; sciences; selected; sem; size; sls; solubility; soluble; solvent; spectrophotometer; speed; stability; stabilizer; stirring; studies; surfactant; system; table; temperature; tween; vol.28(2; water; xrd; zeta; ±0.0; نانوي
     • versions: original; plain text
559. bijps-931
     • author: K. Abd, Ahmad; J. Kadhim, Dheyaa; M. Younus, Manal
     • title: Assessment of Causality, Severity and Seriousness of Adverse Event Following Immunization in Iraq: A Retrospective Study Based on Iraqi
     • date: 2019-12-22
     • words: 5489
     • flesch: 54
     • summary: % 22.29جدية بنسبة ) Relation of the outcome , severity and seriousness of adverse event following immunization with gender Parameter male Female Total P. Value Outcomes No. %
     • keywords: administration; adr; adverse; adverse events; aefi; aes; age; assessment; available; bcg; cases; causality; center; classification; clinical; combination; conditions; count; current; data; disorders; distribution; drug; events; fatal; general; group; health; hexavalent; http; immune; immunization; increase; information; injection; iraqi; level; local; majority; measles; mild; ministry; monitoring; new; outcomes; pentavalent; pharmacovigilance; pharmacy; presence; reaction; relation; reported; reporting; reports; results; safety; sci; seriousness; severe; severity; significant; site; study; surveillance; switzerland; system; table; tetanus; total; treatment; unknown; vaccine; vol.28(2; االعراض; التي; الجانبية
     • versions: original; plain text
560. bijps-932
     • author: Faiq, Mirna K.; J. Kadhim, Dheyaa; I. Gorial, Faiq
     • title: The Belief about Medicines among a Sample of Iraqi Patients with Rheumatoid Arthritis
     • date: 2019-12-22
     • words: 4395
     • flesch: 56
     • summary: Future studies should investigate how interventional approaches addressing these predictors may lead to improve beliefs about medicines among rheumatoid arthritis patients and their impression on disease control. Study done by Zwikker HE, shown increasing need belief about prescription in clinical practice may be advantageous in improving medicine adherence in RA patients(22).
     • keywords: activity; adherence; age; analysis; arthritis; articular; association; baghdad; beliefs; bmq; cdai; chronic; clinical; coefficient; college; concern; correlation; current; das28; department; direct; disease; duration; esr; factors; female; gender; general; greater; harm; high; index; iraqi; journal; mean; medication; medicines; necessity; number; overuse; patients; pharmacy; positive; pvalue; questionnaire; regression; relationship; rheumatoid; rheumatoid arthritis; rheumatology; sample; sci; score; significant; specific; strong; study; subject; table; treatment; university; use; variables; vol.28(2; years; االدوية; التهاب; الرثوي; العالج; المعتقدات
     • versions: original; plain text
561. bijps-933
     • author: Al-Amily, Duraid; Mohammed, Mohammed H.
     • title: Design, Synthesis and Cytotoxicity Study of Primary Amides as Histone Deacetylase Inhibitors
     • date: 2019-12-23
     • words: 4036
     • flesch: 68
     • summary: Both of them showed good cytotoxicity against cancer cell lines (HC-04 and HRT-18) and lower cytotoxicity against normal cell line (HBL-100). Synthesis of primary amides as HDACIs DOI: https://doi.org/10.31351/vol28iss2pp151-158 151 Design, Synthesis and Cytotoxicity Study of Primary Amides as Histone Deacetylase Inhibitors Duraid Al-Amily*,1 and Mohammed H. Mohammed* *Department of Pharmaceutical Chemistry, College of Pharmacy, University of Baghdad, Baghdad, Iraq.
     • keywords: acid; adenocarcinoma; adipic; aliphatic; amide; aromatic; asym; binding; breast; cancer; carboxylate; carcinoma; cell; ch2; chem; chloride; class; cm-1; colon; compounds; concentration; cytotoxicity; deacetylase; figure; growth; hc-04; hdacis; hepatic; histone; hrt-18; ice; inhibition; inhibitors; iraqi; line; med; minutes; mixture; monoanilide; nmr; normal; pharm; pimelic; precipitate; primary; relative; sci; site; solution; step; sym; synthesis; tunnel; vol.28(2; white; zinc
     • versions: original; plain text
562. bijps-936
     • author: Hamed, Hiba E.; A. Hussein, Ahmed
     • title: Preparation, in vitro and ex-vivo Evaluation of Mirtazapine Nanosuspension and Nanoparticles Incorporated in Orodispersible Tablets
     • date: 2020-06-21
     • words: 6114
     • flesch: 51
     • summary: Flow properties of prepared blends of mirtazapine incorporating drug nanoparticles. International Journal of Pharmaceutics. 2013; 443: 209- 220. 25. Wu L, Zhang J, Watanabe W. Physical and chemical stability of drug nanoparticles.
     • keywords: 0.1n; 188; afm; anti; best; bioavailability; buffer; chemical; cm-1; combination; concentration; content; decrease; delivery; different; dissolution; distribution; drug; dsc; ee%; effect; efficiency; entrapment; evaluation; f15; f15a; f15b; figure; force; formula; formulation; friability; ftir; good; hardness; hcl; high; hplc; hydrophobic; increase; index; international; iraqi; journal; k90; lyophilized; methanol; method; minutes; mirtazapine; mirtazapine nanoparticles; mirtazapine nanosuspension; nanoparticles; nanosuspension; orodispersible; particle; particle size; pdi; pharmaceutical; pharmacy; phase; poloxamer; polydispersity; powder; preparation; prepared; profile; properties; pure; pva; pvp; range; rate; ratio; release; research; results; samples; sci; science; size; solubility; soluble; solvent; spectroscopy; stabilizer; stabilizer ratio; study; surface; surfactant; system; tablets; temperature; test; time; uniformity; variation; vol.29(1; water; weight; الجسيمات
     • versions: original; plain text
563. bijps-938
     • author: Majeed, Israa A.; N. Al-Shawi, Nada
     • title: Effects of Omega-3 Co-Administered with Therapeutic Dose of lornoxicam on Male Rats' Liver
     • date: 2019-12-23
     • words: 4159
     • flesch: 59
     • summary: Authors illustrated the adverse effects of other drugs and chemicals on rats liver (16) (17); but, no previous studies were reported in order to compare results of this study with others concerning the effect of lornoxicam used at therapeutic dose alone on rats' liver. In conclusion, the current study is the first that highlight the effect of utilizing alone, lornoxicam, or omega 3 on rats' liver; and again, it is the first that investigates the effect of combination of omega 3 co-administered with lornoxicam on rat's liver; thus, we did not have a chance to compare results of this study with others.
     • keywords: 185mg; acid; activity; administration; adverse; alpha; alt; aminotransferase; animals; antibody; assay; ast; baghdad; biotin; control; days; difference; dose; drug; effects; elevation; enzymes; fatty; group; homogenate; iii; il-10; immune; incubation; inflammation; inflammatory; iraqi; levels; liver; liver tissue; lornoxicam; male; male rats; mean±sem; negative; non; nsaids; omega; omega-3; p<0.05; pharm; rats; sci; significant; solution; study; table; therapeutic; therapeutic dose; tissue; tissue homogenate; tnf; vol.28(2; عقار
     • versions: original; plain text
564. bijps-939
     • author: AlKhalidi, Mustapha M.; J. Jawad, Fatima
     • title: Enhancement of Aqueous Solubility and Dissolution Rate of Etoricoxib by Solid Dispersion Technique
     • date: 2020-06-21
     • words: 5270
     • flesch: 54
     • summary: Selection of the optimum formula The selection of the optimum formula was depended on the solubility study and the dissolution profile of EXB solid dispersion. The practical yield percent (PY %) and drug content of EXB solid dispersion using different methods Formula number Preparation method Practical yield percent (PY %) Drug content mean±std (n=3)
     • keywords: analysis; aqueous; best; buffer; carriers; characterization; cm−1; content; determination; different; diffraction; dispersion; dissolution; distilled; drug; dsc; effect; enhancement; etoricoxib; evaluation; evaporation; evaporation method; exb; exb solid; figure; formula; ftir; fusion; hydrophilic; international; iraqi; journal; medium; methanol; method; min; optimum; peaks; peg; percent; pharmaceutical; pharmacopoeia; phosphate; poloxamer; polymer; powder; practical; preparation; prepared; pure; pure exb; pxm; pxrd; rate; ratios; ray; release; research; results; samples; sci; sciences; sd14; sd15; significant; solid; solid dispersion; solubility; soluble; solvent; solvent evaporation; spectrum; study; system; table; technique; type; vol.29(1; water; yield; ±0.01; الدواء
     • versions: original; plain text
565. bijps-941
     • author: Y. Al-Radeef, Mohanad
     • title: Status of CHADS2 and CHA2DS2-VASc Scores in Predicting Risk of Stroke and its Prevention in Iraqi Patients with Atrial Fibrillation
     • date: 2019-06-09
     • words: 3411
     • flesch: 54
     • summary: For the most of AF patients, the backbones of treatment to decrease stroke risk are antithrombotic medicines (antiplatelet and anticoagulants). Conclusion CHADS2 and CHA2DS2-VASc scores were often neglected in assessing Iraqi AF patients in hospitals; in addition to that, aspirin is still widely used as a strategy to minimize stroke risk in patients with AF regardless to these scores.
     • keywords: age; anticoagulant; antithrombotic; aspirin; atrial; bleeding; cardiac; cha2ds2vasc; chads2; chads2 score; discharge; disease; elevated; failure; fibrillation; figure; heart; high; hospital; hypertension; iraqi; ischemic; low; oacs; oral; pad; patients; pharm; prevention; relation; risk; sci; score; status; stroke; study; symptoms; therapy; tikrit; treatment; type; vasc; vasc scores; vol.28(1; warfarin; years; الدراسة; الدماغية; الرجفان; هذه
     • versions: original; plain text
566. bijps-942
     • author: M. Hassan, Omeed; W. Sarsam, Susan
     • title: Synthesis, Characterization and Preliminary Anti-inflammatory Evaluation of New Etodolac Derivatives
     • date: 2019-06-09
     • words: 3687
     • flesch: 66
     • summary: 1Corresponding author: E-mail: sarsam14@yahoo.com Received: 27/11/2018 Accepted: 2/2/2019 Iraqi Journal of Pharmaceutical Sciences https://doi.org/10.31351/vol28iss1pp106-112 Iraqi J Pharm Sci, Vol.28(1) 2019 Etodolac hydrazone derivatives with anti-inflammatory action 107 Hydrazones are an important class for new drug development and an exceptional class of organic compounds in the Schiff base family. Etodolac hydrazone derivatives with anti-inflammatory action 108 (P1) 2-(1,8-diethyl-1,3,4,9-tetrahydropyrano[3,4- b]indol-1-yl) - N' - ( 4 – hydroxyl -3 , 5 - dimethoxy – benzylidene ) acetohydrazide.
     • keywords: -ch2; acid; action; activity; anti; ch3; compounds; control; cox; derivatives; difference; edema; effect; egg; ethanol; ether; etodolac; hydrazone; indole; induced; inflammatory; injection; iraqi; minutes; mixture; n=6; nsaids; paw; pharm; rats; reaction; reduction; sci; significant; solution; str; synthesis; synthesized; target; thickness; time; vol.28(1; white
     • versions: original; plain text
567. bijps-943
     • author: Al-Darraji, Asmaa S.; H.Mohamed, Mohamed
     • title: Synthesis and Preliminary Anticancer Evaluation of 6-Mercaptopurine –Methotrexate Conjugate as Possible Mutual Prodrug
     • date: 2019-06-09
     • words: 4708
     • flesch: 54
     • summary: Iraqi J Pharm Sci, Vol.28(1) 2019 6-mercaptopurine –methotrexate conjugate 120 Table ( 1) Cytotoxic activity of 6-MP, compound VIII and compound VI against MCF-7 cancer cell (*Mean ±SEM is mean and standard error of mean, P value is probability value, NS: non-significant value, **** significant value) Cytotoxic assay of the tested compounds against SKO-3 type of tumor cell % of cytotoxicity, IC50% results of standard and the two synthesized VI, VIII were shown in figure 2, while statistical data of them shown in table 2. <0.0001(****) 100(µg/ml) 87.00±1.155 <0.0001(****) Iraqi J Pharm Sci, Vol.28(1) 2019 6-mercaptopurine –methotrexate conjugate 121 Table (2) Statistical results of cytotoxic activity of 6-MP, compound VIII and compound VI against SKO- 3 cancer cell (Mean ±SEM is mean and standard error of mean, P value is probability value, NS: non- significant value, **** significant value)
     • keywords: 60mhz; 6mp; acid; activity; amide; amino; anhydrous; assay; bending; benzene; bond; c =; cancer; carbamate; cell; ch)of; ch2; ch3; chemical; cmˉ¹(c; cmˉ¹(n; compound; compound vi; concentration; conjugate; cysteine; cytotoxic; cytotoxicity; disc),(ʋ; disease; dmf; dmsod6; drug; ester; final; folate; group; higher; ic50; imidazole; inhibitory; iraqi; j pharm; kbr; leukemia; line; mean; medication; mercaptopurine; methotrexate; methyl; methylene; mixture; mtx; mutual; pharm; phase; plane; precipitate; prodrug; produce; purin-6; reaction; receptor; region; results; ring; room; salt; sci; smdc; solution; standard; stirring; stretching; sym; synthesis; synthesized; tea; temperature; treatment; tumor; use; value; viii; vol.28(1; water; yield
     • versions: original; plain text
568. bijps-948
     • author: A. Tamer, Anwar; J Qassir, Ahlam
     • title: Synthesis of Acetylenic Derivatives of a Substituted 1, 3, 4-Thiadiazole as Antibacterial Agents
     • date: 2019-06-26
     • words: 3986
     • flesch: 55
     • summary: The synthesized compounds were evaluated for their antimicrobial activity in vitro Iraqi J Pharm Sci, Vol.28(1) 2019 Substituted 1, 3, 4-thiadiazole as antibacterial agents 127 against three types of tested microorganisms (Staph. aureus., and Bacillus subtilis as a Gram-positive bacteria) and (klebsiella pneomonae, and E. coli) as a Gram-negative bacteria) were clinically activated and maintained on nutrient agar for examining antibacterial activity. Ampicillin was used as a standard drug for antibacterial activity.
     • keywords: absolute; acetic; acid; active; activities; activity; agents; amide; ampicillin; analgesic; antibacterial; anticancer; anticonvulsant; antifungal; antimicrobial; aromatic; base; bending; biological; ch2; characterization; chemical; chemistry; compound; c≡c; derivatives; ethanol; evaluation; gram; group; heterocyclic; hours; important; international; iraqi; journal; mannich; methanimine; mixture; mole; new; nh2; nitrogen; organic; peak; pharmaceutical; pharmacy; piperidine; powder; ppm; product; reaction; research; ring; schiff; sci; sciences; singlet; solution; stretching; synthesis; synthesized; thiadiazole; vol.28(1; water; yn-1; ثياديازول
     • versions: original; plain text
569. bijps-951
     • author: R. Al-Nakeeb, Mayada; N-A. Omar, Tagreed
     • title: Synthesis, Characterization and Preliminary Study of the Anti-Inflammatory Activity of New Pyrazoline Containing Ibuprofen Derivatives
     • date: 2019-06-26
     • words: 4271
     • flesch: 65
     • summary: All of them showed anti-inflammatory activity compared to the control group (propylene glycol) except compound 5f that showed more anti-inflammatory activity than ibuprofen. All of the synthesized compounds demonstrated anti-inflammatory activity in the control group of rats.
     • keywords: 5a‐f; = o; acetate; acid; activity; agents; amide; analgesic; anti; anti‐inflammatory; aromatic; biological; ch ibuprofen; ch2; ch3; chem; chloride; colour; compound; control; derivatives; different; effect; ester; ethanol; ethyl; evaluation; glycine; group; ibuprofen; inflammatory; iraqi; mean; mhz; mmol; new; nsaids; paw; pharm; powder; ppm; preliminary; propanamide; propylene; pyrazoline; rats; reaction; reduced; ring; sci; stretching; study; symmetric; synthesis; synthesized; table; tested; time; vol.28(1; water; white; yellow; yield
     • versions: original; plain text
570. bijps-952
     • author: H. Ali Alsafi, Mustafa; S. Farhan, Muthanna
     • title: Synthesis, Characterization and Acute Anti-inflammatory Evaluation of New Mefenamic Acid Derivatives Having 4-Thiazolidinone Nucleus
     • date: 2019-06-26
     • words: 4587
     • flesch: 64
     • summary: Abstract Mefenamic acid (MA) is one of the non-steroidal anti-inflammatory drugs, it is widely used probably due to having both anti-inflammatory and analgesic activity, the main side effects of mefenamic acid include gastrointestinal tract (GIT) disturbance mainly diarrhea, peptic ulceration, and gastric bleeding. The study aimed to synthesize derivatives of mefenamic acid with more potency and to decrease the drug's potential side effects, new series of 4-thiazolidinone derivatives of mefenamic acid were synthesized IVa-g.
     • keywords: = n; acetate; acid; activity; acute; amide; analgesic; anti; antiinflammatory; c =; carboxylic; carboxylic acid; ch2; chem; cm-1; compounds; control; data; derivatives; dimethyl; dimethylphenyl; dmsod6; dose; edema; effect; egg; end; evaluation; ftir; group; hydrazine; iii; induced; inflammatory; inhibition; inhibitors; iraqi; mefenamic; mefenamic acid; mhz; min; mixture; mmol; model; new; nsaids; o amide; oil; orange; paw; pharm; physical; position; potent; powder; rats; sci; study; sulfoxide; synthesis; table; tested; thiazolidinone; time; vol.28(1; water; white; yellow; yield; ±0.1; ±0.1*a; ±0.2; الميفيناميك; تصنيع; حمض; لاللتهاب
     • versions: original; plain text
571. bijps-956
     • author: Ezghayer, Mohammed A.; J. Kadhim, Enas
     • title: UPLC-ESI-MS/MS and Various Chromatographic Technique for Identification of Phytochemicals in Populus euphratica Oliv. Leaves Extract
     • date: 2020-06-24
     • words: 6204
     • flesch: 67
     • summary: Li X, Xiao H, Liang X, Shi D, Liu J. LC – MS / MS determination of naringin , hesperidin and Iraqi J Pharm Sci, Vol.29(1) 2020 leaves extract 97 UPLC-ESI-MS/MS for tentative identification of compounds in fractions Twenty phytochemicals have been putatively characterized by UPLC-ESI-MS/MS in Populus euphratica leaves based on comparison of mass fragmentation pattern, LC retention time and molecular weight with previous study and the literature in phytochemicals mass library such as Respect (http:// spectra.psc .riken.
     • keywords: acid; adduct; alkaloid; analysis; aqueous; available; b.b; beta; butanol; cha; chloroform; chromatogram; chromatography; compound; data; derivatives; e n; e s; esi; euphratica; euphratica oliv; extract; feb; figure; formation; formic; fraction; fragmentation; glycoside; gnps; hexane; high; hptlc; http://mona.fiehnlab.ucdavis.edu/spectra/displa; identification; internet; ions; iraqi; iraqi j; isolated; j pharm; layer; leaves; library; lin; liquid; mass; method; mode; molecular; n o; negative; npl; oliv; pattern; peak; performance; pharm; pharm sci; phenolic; phytochemicals; plant; populus; populus euphratica; positive; present; protopine; reagent; results; salicin; salicortin; sci; sid; sid e; sitosterol; spectrometry; spectrum; standard; study; table; time; uplc; vol.29(1; wang; water; weight; الكيميائية; الموجودة
     • versions: original; plain text
572. bijps-957
     • author: Hassan, Ali F.; H. Jasem, Nibras
     • title: Evaluation the Incidence of Genotoxic Effects of Artificial Food Favoring Additives in Bone Marrow Cells and Spleen Cells in Mice
     • date: 2020-06-21
     • words: 3777
     • flesch: 34
     • summary: Iraqi J Pharm Sci, Vol.29(1) 2020 Genotoxic evaluation for artificial food flavoring additive DOI: https://doi.org/10.31351/vol29iss1pp55-61a 55 Evaluation the Incidence of Genotoxic Effects of Artificial Food Favoring Additives in Bone Marrow Cells and Spleen Cells in Mice Nibras H. Jasem* and Ali F. Hassan **,1 * Ministry of Health and Environment ,Technical Affairs Directorate, , Baghdad, Iraq. Received: 3 / 7 / 2019 Accepted:16 / 9 / 2020 Iraqi Journal of Pharmaceutical Sciences https://doi.org/10.31351/vol29iss1pp55-61a mailto:ali_1371982@yahoo.com Iraqi J Pharm Sci, Vol.29(1) 2020 Genotoxic evaluation for artificial food flavoring additive 56 Any DNA mutations inherit if the DNA damage is not repaired by repair system before mitosis (12].
     • keywords: aberration; acentric; additive; animals; artificial; artificial flavoring; artificial food; baghdad; bone; break; cells; chemical; chromatid; chromosomal; chromosomal aberration; compare; concentration; control; days; decrease; dicentric; different; disodium; distilled; division; dna; effects; evaluation; flavoring; flavoring additive; food; food flavoring; gap; genetic; genotoxic; genotoxicity; glutamate; group; increase; individual; iraqi; marrow; mice; monosodium; negative; negative control; non; oxidative; p<0.05; pharm; positive; results; ros; sci; significant; significant increase; solution; spleen; stress; studies; substances; successive; test; total; total chromosomal; values; vol.29(1; water; الصناعية; الطحال; العظم; على; نخاع
     • versions: original; plain text
573. bijps-958
     • author: Hassan, Ali F.; N. Muhsin, Suha
     • title: Evaluate the Protective Effect of Lactobacillus against Collateral Damage Induced by Ciprofloxacin and Levofloxacin in Iraqi Patients
     • date: 2019-12-23
     • words: 3477
     • flesch: 57
     • summary: The results for this study, there are a significant increase in the incidence of diarrhea for all groups when comparison between before and after treatment diarrhea was made; a number of patients with diarrhea in group 1 after finish the treatment was not significantly higher when compared with group 2 (P>0.05); meanwhile, number of patients with diarrhea in group 4 after finish the treatment was significantly lower when compared with group 3 (P<0.05). Antibiotic associated diarrhea is a most important type of collateral damage that associated with the uses of specific type of antibiotics.
     • keywords: absence; active; agents; antibacterial; antibiotic; associated; capsule; ciprofloxacin; clinical; collateral; compare; comparison; current; daily; damage; day; days; diarrhea; differences; different; dose; drugs; effect; figure; fluoroquinolone; grade; gram; group; higher; incidence; infections; iraqi; lactobacillus; levofloxacin; mg capsule; mg tablet; number; p<0.05; patients; pharm; presence; probiotics; protocol; range; results; sci; significant; specific; square; study; tablet; treatment; use; value; vol.28(2; الجانبية; الليفوفلوكساسين
     • versions: original; plain text
574. bijps-960
     • author: M. Al-joda, Ali; Zalzala, Munaf H.
     • title: Inhibition of NF-kB Pathway by Gggulsterone in the Protective Effects of Cyclophosphamide-Induced Renal Toxicity
     • date: 2019-12-23
     • words: 3868
     • flesch: 49
     • summary: Results As presented in table 1, the nephrotoxic effect of cyclophosphamide represent a significant elevation in renal level of NF-κB in comparison to control group. In this study, the albino rats were divided to four groups: control group treated with vehicle, cyclophosphamide group, cyclophosphamide with guggulsterone group and guggulsterone alone group.
     • keywords: action; activation; activity; administration; animals; anti; antioxidant; apoptosis; baghdad; biol; catalase; cells; cellular; chem; consecutive; control; control group; creatinine; cyclophosphamide; cyp; damage; day; days; degenerative; dose; effect; elisa; enzyme; experiment; figure; group; guggulsterone; histological; increase; index; inflammation; inflammatory; injury; intraperitoneal; iraqi; kidney; kit; level; metabolites; mice; normal; oral; oxidant; oxidative; p65; p<0.05; pharm; plant; protective; rats; receptor; reduction; renal; renal toxicity; result; samples; sci; serum; significant; stress; study; table; tissue; tnf; toxicity; toxicol; treatment; tubules; urea; urinary; vol.28(2; weight; ومستقبالت
     • versions: original; plain text
575. bijps-963
     • author: Najaf, Hanan N.; J. Kadhim, Dheyaa
     • title: Health-Related Quality of Life among a Sample of Chronic Hepatitis B Patients in AL-Najaf Province /Iraq.
     • date: 2020-06-21
     • words: 5168
     • flesch: 63
     • summary: The aim of the current study was to measure health-related quality of life among a sample of chronic hepatitis B patients in AL- Najaf city/Iraq. In conclusion, chronic hepatitis B patients showed significantly lower health-related quality of life scores in various domains compared to healthy control subjects in AL-Najaf province /Iraq.
     • keywords: age; albumin; biopsy; characteristics; chb; chb patients; children; chronic; chronic hepatitis; control; current; disease; domain; emotional; energy; ewb; fatigue; form; functioning; functioning score; general; hbv; health; hepatitis; higher; hrqol; infection; iqr; iraqi; life; limitation; liver; lower; male; med.score; median; najaf; pain; patients; pharm; physical; physical functioning; physical health; problems; quality; rlep; rlph; role; sample; sci; score; score iqr; short; significant; social; study; table; test; treatment; viral; virus; vol.29(1; الحياة; الصحية; الفيروسي; الكبد
     • versions: original; plain text
576. bijps-967
     • author: Mohammed, Samer I.; Al- Shadedi, Mohamed I.; Kasim, Ali A.
     • title: Knowledge, Use and Recommendation of Iraqi Pharmacist Toward Complementary and Alternative Medicine
     • date: 2020-06-21
     • words: 3300
     • flesch: 54
     • summary: Keywords: Complementary medicine, Alternative medicine, Herbal medicines, Nutritional supplements, Iraqi pharmacists. N (%) True False Don’t know Alternative medicines are used instead of conventional medicine 85 (37) 65 (28) *
     • keywords: alternative; alternative medicine; answers; baghdad; cam; clinical; college; community; complementary; complementary medicine; conventional; correct; cross; current; data; different; general; global; half; healing; health; herbal; information; iraqi; iraqi pharmacists; journal; knowledge; level; medical; medicine; modalities; national; nutritional; participants; patients; percentage; pharmacists; pharmacy; population; practice; prevalence; products; professionals; questionnaire; questions; recommendation; results; sci; sectional; spiritual; study; supplements; survey; table; therapies; united; university; use; vol.29(1; work; years; إلى; البديل; التكميلي; الصيادلة; الطب; العشبية
     • versions: original; plain text
577. bijps-970
     • author: Maryoosh, Taif M.; N. Al-Shawi, Nada; S. Salih, Eman
     • title: Effects of Two Different Doses of Zinc Sulfate on Serum Troponin I 3 Enzyme Level and Cardiac Malondialdehyde Contents in Mitoxantrone-Induced Cardiotoxicity in Rats
     • date: 2020-06-25
     • words: 5226
     • flesch: 56
     • summary: According to above results it can be concluded that zinc sulfate at a dose of (30 mg/kg/day) (in Group VI rats) diminished the cardiotoxicity induced by mitoxantrone as indicated by the reduction of serum troponin I 3 enzyme level but non-significant difference in lipid peroxidation marker (malondialdehyde) compared to (15 mg/kg/day) (in Group V rats). Conclusion Zinc sulfate at a dose of (30 mg/kg/day) (in Group VI rats) diminished the cardiotoxicity induced by mitoxantrone as indicated by the reduction of serum troponin I 3 enzyme level but non-significant difference in lipid peroxidation marker ( malondialdehyde) compared to (15 mg/kg/day) (in Group V rats).
     • keywords: 15mg; administration; animals; authors; baghdad; cardiac; cardiotoxicity; college; contents; control; corresponding; cumulative; cumulative dose; day; days; difference; distilled; dose; effects; enzyme; figure; group; group iv; group vi; heart; heart tissue; homogenate; iii; iraqi; level; lipid; malondialdehyde; mda; mda contents; mitoxantrone; mtxn; myocardial; negative; non; p<0.05; peroxidation; pharm; pharmacy; protective; rats; reduction; results; sci; serum; significant; study; sulfate; table; tissue; tissue homogenate; total; total cumulative; treatment; troponin; university; vol.29(1; water; zinc; zinc sulfate; الزنك; القلب; المالونداي; المجموعة; بجرعة; داخل; كبريتات; كغم; يوم
     • versions: original; plain text
578. bijps-974
     • author: Alshaeer, Majeed N.; M. Anwer, Zinah
     • title: Comparing the Efficacy of Paracetamol, Diclofenac, and Ketorolac on Post-Appendectomy Outcomes in Children and Adolescents
     • date: 2020-06-25
     • words: 5799
     • flesch: 60
     • summary: After surgery patients favor to have pain rather than (N,V)(19). Patients received ketorolac had a high percentage of the decrease in pain score between 30 and 60 min. after surgery, while paracetamol was the next and diclofenac sodium was the last.
     • keywords: abdominal; acute; addition; analgesia; anesthesia; antiemetic; appendectomy; appendicitis; baghdad; bleeding; cases; changes; children; clinical; college; common; comparative; comparison; data; day; decrease; department; diclofenac; different; dose; drug; effects; efficacy; exact; faces; family; female; figure; finding; fisher; frequency; frequent; gastrointestinal; good; groups; health; higher; highest; history; hospital; inflammatory; intravenous; iraqi; journal; ketorolac; laparoscopic; medications; minutes; moderate; morphine; nausea; no.(%; nsaids; number; original; pain; pain score; paracetamol; patients; pediatric; percent; percentage; pharm; pharmacy; postoperative; postoperative pain; potent; prescribed; present; review; risk; scale; sci; sciences; score; significant; sodium; studies; study; surgery; surgical; table; treatment; university; value; vol.29(1; vomiting; years; استئصال; البراسيتامول; الدراسة; الدودية; الزائدة; الصيدلة; العملية; المرضى; بعد; على; والتقيؤ
     • versions: original; plain text
579. bijps-977
     • author: Mahmood, Mustafa K.; Anwer, Zinah M.
     • title: The Prevalence of Potentially Inappropriate Prescribing in Geriatric Patients with Psychiatric Disorders in Iraq
     • date: 2020-06-25
     • words: 3481
     • flesch: 49
     • summary: PIP psychotropic medications 171 The total prevalence of PIP The prevalence inappropriate psychotropic medications was 74.3%, while the remaining 25.7% received appropriately prescribing medications. The prevalence of potentially inappropriate prescribing according to Beers criteria was found to be 74.3% among study patients, the most prevalent inappropriately used drug class was benzodiazepines, and there was a significant association between the prescribing of a potentially inappropriate medication with gender (p=0.018), with comorbidities (p=0.022), and a very significant association with polypharmacy (p<0.001)
     • keywords: adverse; age; antipsychotics; association; baghdad; beers; benzodiazepines; clin; clinical; comorbidities; condition; criteria; data; dementia; diseases; disorders; drug; duration; elderly; frequent; gender; geriatric; hospital; hospitalization; inappropriate; iraqi; medical; medications; older; patients; pims; pip; pips; polypharmacy; population; prescribed; prescribing; prevalence; psychiatric; psychotropic; records; sci; significant; studies; study; table; tool; use; vol.29(1; years; الدوائي; السن; المحتمل; عدم
     • versions: original; plain text
580. bijps-985
     • author: Alkhiro, Adeeb R.; Ghareeb, Mowafaq M.
     • title: Formulation and Evaluation of Iornoxicam as Dissolving Microneedle Patch
     • date: 2020-06-25
     • words: 5473
     • flesch: 63
     • summary: Methods Preparation of lornoxicam microneedle patches Preparation of LXM MN patches was accomplished by using different ratios of PVP K 30, PVA and 5% W/W polyethylene glycol 400 (PEG 400) by micro molding techniques as shown in table (1). No cell necrosis was detected after application of LXM MN patch and saline buffer pH 7.4 as comparator.
     • keywords: abdominal; axial; baghdad; buffer; calculated; cm2; compatibility; concentration; content; delivery; different; digital; dissolution; drug; effect; endurance; evaluation; f10; fast; figure; folding; force; formula; formulation; fracture; ftir; germany; higher; histopathology; insertion; interspacing; iraqi; j pharm; journal; kinetics; loading; lornoxicam; lxm; mean; measurement; microneedle; microneedle patch; microscopic; mixture; mn patch; mns; mold; needles; order; ordinary; patch; patches; peg; penetration; percent; permeation; pharm; pharmaceutical; pharmacy; phosphate; polymer; preparation; prepared; pva; pvp; rate; release; results; samples; sci; sciences; skin; stability; studies; study; table; temperature; thickness; time; transdermal; tween; value; vivo; vol.29(1; weeks; weight
     • versions: original; plain text
581. bijps-989
     • author: Hammodi, Ihab D.; N. Abd Alhammid, Shaimaa
     • title: Preparation and Characterization of Topical Letrozole Nanoemulsion for Breast Cancer
     • date: 2020-06-25
     • words: 5432
     • flesch: 62
     • summary: Table 4. Zeta potential (ZP) distribution results of LZL nanoemulsion NS ZP NS ZP NS-1 Therefore, 9 formulae of (o/w) LZL NS were formulated, then pseudo-ternary phase diagram was used as a useful tool to evaluate the NS domain at Smix ratios: 1:1, 2:1 and 3:1.
     • keywords: acid; breast; cancer; characterization; concentration; conductivity; content; cycles; deionized; delivery; diagrams; different; dissolution; distribution; droplet; drug; effective; electro; evaluation; figure; formulation; globule; high; https://doi.org/10.31351/vol29iss1pp195-206; iraqi; journal; letrozole; lzl; mean; measurement; medium; method; min; nanoemulsion; ns-1; ns-2; ns-3; ns-4; ns-5; ns-6; ns-8; ns-9; nss; oil; oils; oleic; optimum; particle; pdi; peg; percent; permeation; pharmaceutical; phase; polydispersity; potential; preparation; prepared; range; ratios; release; results; sample; sciences; sem; size; skin; small; smix; solubility; stability; stretching; studies; study; surfactant; system; table; temperature; test; topical; transcutol; transmittance; tween; value; vol.29(1; water; zeta; √ √
     • versions: original; plain text