Iraqi J Pharm Sci, Vol.32( 1 ) 2023 L-carvone and acute lung injury
DOI: https://doi.org/10.31351/vol32iss1pp125-132
125
Anti-Inflammatory Effect of L-carvone on Lipopolysaccharide-Induced
Acute Lung Injury
Samah Mahde*,1 and Sarmad Haishm Kathem*
Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad, Baghdad, Iraq.
Abstract
Acute lung injury is among the most serious conditions that affect the lung which is characterized by
an exacerbation of inflammatory response that can result from a severe lung infection. The enantiomers of carvone
(L and D) are found in various plants species each with special pharmacological effects; where, the levo (L)-
carvone is chiral monoterpenoid ketone present in the essential oils of dill, caraway, and spearmint and possess
many pharmacological properties like antioxidant, anti-inflammatory, antimicrobial, antidiabetic, and
anticonvulsant effects. In a previous study, L-carvone inhibited mucositis induced by irinotecan. This study is the
first to evaluate the lung anti-inflammatory protective effects, and potential mechanism of action of L-carvone in
acute lung injury induced by lipopolysaccharide by measuring the gene expression level of inflammatory
mediators (tumor necrosis factor-alpha, cyclooxygenase-2 and nuclear factor-kappa of activated B cells) by
conducting real-time quantitative polymerase chain reaction test.
Fifty adult mice were allocated into 5 Groups as follows: - control group (mice received normal saline,
Group I). Mice in the -induction group received (lipopolysaccharide 10mg/kg/day intraperitoneally, Group II) and
were euthanized 2 hours later. Group III (Vehicle group, Mice received corn oil 0.1 ml + lipopolysaccharide 10
mg/kg). Mice in the -treatment groups received either [(50mg/kg/day), Group IV] or [(100mg/kg/day), Group V]
of oral L-carvone for 5 consecutive days before lipopolysaccharide injection.
Pretreatment with L-carvone (50mg/kg/day) (Group IV) markedly attenuated pro-inflammatory
cytokines as observed by significant (P<0.05) reduction in mRNA expressions of tumor necrosis factor-alpha
(7.56 ±1.195 vs 29.20±4.9) and cyclooxygenase 2 (5.72±0.329 vs.10.58 ±0.777) in mice’s lung tissue compared
to those in the induction group, non-treated mice (lipopolysaccharide model group) (Group II). Increasing the
dose of L-carvone to 100mg/kg/day (Group V) also resulted in a significant reduction in mRNA expressions of
tumor necrosis factor-alpha (7.84±1.4 vs 29.20±4.9) and cyclooxygenase2 (4.589± 0.946 vs 10.58±1.641)
compared to that expression in the induction group, non-treated mice (lipopolysaccharide model group) (Group
II); however, the attenuating effect is dose-independent. Furthermore, the results revealed that nuclear factor-
kappa of activated B cells mRNA gene expression was significantly lowered by L-carvone 50mg/kg /day (Group
IV) (5.01±0.826 vs 11.88±1.227) and 100mg/kg /day (Group V) (6.81±1.362 vs 11.88±1.227) compared to
induction group, non-treated mice (lipopolysaccharide model, Group II).
Conclusion This study clearly revealed that L-carvone exerted anti-inflammatory and lung-protective effects on
lipopolysaccharide-induced acute lung injury. The observed effects were dose-independent and resulted from
hampering of the NF-κB signaling pathway.
Keywords: Acute lung injury, Lipopolysaccharide, TNF-α, COX2, L-carvone.
المضاد لأللتهاب لليفو كارفون في تلف الرئة الحاد المستحث بواسطة عديد السكاريد الدهنيالتأثير
*سرمد هاشم كاظم و 1*،سماح مهدي
. العراق، بغداد، بغداد جامعة، الصيدلةكلية ، والسموم*فرع االدوية
الخالصة
تعد أصابة الرئة الحادة من أخطر الحاالت التي تصيب الرئة حيث تتصف بتفاقم االستجابة األلتهابية التي يمكن ان تنتج من التهاب
هو كيتون دوائية خاصة . ليفو كارفون تأثيرات منها لكل مختلفة نباتية أنواع في (L and Dله نوعان مصاوغ مرآتي ) كارفونال.رئوي حاد
.لديه العديد من الخصائص الدوائية مثل مضاد األكسدة والنعناع والكراوية الكمون تفي الشب األساسية أحادي التربينيدات موجود في الزيوت
الليفو كارفون ثبط التهاب الغشاء المخاطي واأللتهاب ومضاد للميكروبات وتأثير مضاد لمرض السكر ومضاد لألختالج. في دراسة سابقة، فان
الليفو كارفون ضد المستحث بواسطة عقار االيرينوتيكان. هذه الدراسة هي األولى لتقييم االثار الوقائية المضادة اللتهاب الرئة واآللية المحتملة لعمل
α لتعبير الجيني للسيتوكينات المؤيدة لأللتهاب عامل نخر الورمتلف الرئة الحاد المستحث بواسطة عديد السكاريد الدهني. عن طريق قياس مستوى ا
) (TNFوالعامل النووي 2وانزيم سايكلوأوكسي جينيزκ للخاليا البائيةB في الكمي المتسلسل البلمرة تفاعل اختبار المنشطة عن طريق اجراء
(.األولى المجموعة ، طبيعيًا محلواًل الفئران تلقت) التحكم مجموعة -: التالي النحو على مجموعات 5 إلى بالغًا فأًرا خمسين تقسيم تم .الفعلي الوقت
1Corresponding author E-mail: samahmahde@gmail.com
Received: 16/2 /2022
Accepted: 24/4 /2022
Iraqi Journal of Pharmaceutical Science
https://doi.org/10.31351/vol32iss1pp125-132
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
126
. ساعتين بعد القتل الرحيم وتم( الثانية المجموعة ، الصفاق داخل يوم/ كغم/ ملغم 10 الدهني السكاريد عديد ) الحث مجموعة في الفئران تلقت
العالج مجموعات في الفئران تلقت(. كغم/ ملغم 10 الدهني السكاريد عديد+ مل 0.1 الذرة زيت الفئران تلقت ، المذيب مجموعة) الثالثة المجموعة
قبل متتالية أيام 5 لمدة الفموي الكارفون من[ الخامسة المجموعة ، ( يوم/ كغم/ ملغم 100]) أو[ الرابعة المجموعة ، ( يوم/ كغم/ ملغم 50]) إما
الدهني. السكاريد عديد حقن
األلتهابية كما مالحظ من انخفاض بشكل كبير في التعبير الجيني ملغم/كغم /يوم )المجموعة الرابعة ( قلل بشكل كبيراألحداث 50لعالج بالليفو كارفون ا
( 0.777± 10.58مقابل 0.329±5.72)2( وأنزيم سايكلوأوكسي جنيز 4.9± 29.20مقابل 1.195±7.561في أنسجة الرئة لعامل نخر الورم )
المعالجة غير بالمجموعة المجموعمقارنة , الدهني السكاريد عديد )مجموعة الحث (,مجموعة الثانية الى الجرعة زيادة وعند ة كارفون لليفو
( و أنزيم سايكلو 4.9±29.20مقابل 1.4±7.84ملغم/كغم/يوم )الجموعة الخامسة ( أيضا قلل بشكل كبير التعبير الجيني لعامل نخر الورم )100
الحث )مجموعة عديد السكاريد الدهني , ( مقارنة بالمجموعة الغير معالجة ,مجموعة 10.58± 0.777مقابل 0.946±4.589) 2أوكسي جنيز
امل النوويالمجموعة الثانية(. مع ذلك فان تأثير الليفو كارفون لم يعتمد على الجرعة .وأيضا اظهرت النتائج أنخفاض كبير في التعبير الجيني للع
κ للخاليا البائيةB ( وجرعة 1.227±11.88مقابل 1.362 ±6.81عة ( )ملجم/كغم/يوم)المجموعة الراب 50المنشطة عند جرعة الليفو كارفون
( مقارنة بمجموعة الحث , المجموعة الغير معالجة )مجموعة 1.227±11.88مقابل 0.826± 5.01ملغمم/كغم/يوم ) المجموعة الخامسة ( )100
عديد السكاريد الدهني , المجموعة الثانية (
كارفون له تأثير مضاد لأللتهاب ووقائي في أصابة الرئة الحادة المستحثة -الليفواألستنتاج :كشفت هذه الدراسة بوضوح أن
Bللخاليا البائية κبعديد السكاريد الدهني، حيث ان التأثيرات كانت غير معتمدة على الجرعة ونتجت عن أعاقة مسار أشارات العامل النووي
المنشطة .
. كارفون، ليفو 2الفا ، سايكلو اوكسي جنيز -،عامل نخر الورمديد السكاريد الدهني ع،الكلمات المفتاحية :التهاب الرئة الحاد
Introduction
Acute lung injury (ALI) and its more
severe form, acute respiratory distress syndrome
(ARDS), is a serious inflammatory condition
affecting the lung with a high percentage of
morbidity and mortality (1). The ALI is caused by
neutrophil leakage, production of a huge amount of
pro-inflammatory cytokines, injury to airway
epithelium and alveolar endothelium which lead to
pulmonary fluid accumulation, and the impairment
in gases exchange.
Lipopolysaccharide (LPS) is a
component of the gram-negative bacterial cell wall,
which is a glycolipid that consists of many
disaccharide units and polar lipid head group and
can be employed to create an ALI model in the mice
lung which mimicked its characteristic and
pathological features in the human (2,3). Previous
studies have demonstrated that LPS could cause ALI
by activating the toll-like receptor 4/nuclear factor-
kappa B (TLR4/NF-κB) signaling pathway, which
controls the transcription of pro-inflammatory
cytokines, such as interleukin 1β (IL-1β),
interleukin-6(IL-6), and tumor necrosis factor-alpha
(TNF-α). These cytokines are responsible for the
activation of the innate immune system which
results in injury in the lung tissue (4–6).
Carvones are chiral monoterpenoid ketones
(5-Isopropenyl-2-methyl-2-cyclohexenone) that are
abundant in many plants including caraway,
angelica, and spearmint. In recent years it attracts
attention as alternative medicine. It is present in
nature in two enantiomers (+, D) mainly present in
caraway Carum carvi and (-, L) carvone mainly
present in Mentha spicata. Many studies evaluate
pharmacological effects like anti-inflammatory,
antioxidant effects, antibacterial, antidiabetic,
anticonvulsant, and antinociceptive effects.
According to the previously mentioned effects of l-
carvone, the anti-inflammatory and possible lung
protective effect in ALI induced by LPS was
investigated in an animal model in this study (7–10).
The anti-inflammatory effect of L-carvone
was previously reported through the inhibition of
myeloperoxidase activity (MPO), reduction of
prostaglandin E2 (PGE2), interleukin-1β (IL-1β),
tumor necrosis factor (TNF-α), nitric oxide (NO˚),
inducible nitric oxide synthase (iNOS) expression,
cyclooxygenase E2 (COX2), an increase in
glutathione levels (GSH) (10).
Moreover, L-carvone was able to produce
a protective effect on irinotecan-induced intestinal
mucositis in mice by reducing pro-inflammatory
cytokines TNF-α production and diarrheal score (11).
Materials and Methods
Chemicals and kit
Levo-carvone (l-carvone) was obtained
from Sigma Aldrich/USA, LPS O55:B5was
purchased from sigma Aldrich/ Germany, NF–кB,
GAPDH, COX 2, and TNF α Primers were
purchased from Macrogen / South Korea, RNA
extraction kit was purchased from Dong Sheng
Biotech /China, Trans Start® Green qPCR Supermix
was purchased from Transgen Biotech/ China, Easy
Script® One-Step gDNA removal and cDNA
synthesis.
Animal selection
Fifty (50) Albino male mice weighing (20-30)
grams were divided into five groups were brought
from and maintained in the Animal Facility of the
College of Pharmacy, University of Baghdad, under
conditions of the controlled temperature, humidity,
and light periodicity (12-hour light/dark cycle).
Mice had free access to a standard diet and water
during the experimental period.
Experimental protocol
This study was approved by the Scientific and
Ethical Committees of the College of the
Pharmacy/University of Baghdad. Mice employed
in this study were randomly-divided into five groups
of ten mice each, as follows:
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
127
GroupⅠ. Mice received 0.1ml intraperitoneal
injection of normal saline for five constitutive days
and were considered as the normal group (negative
control group).
Group Ⅱ (lipopolysaccharide model group). Mice
received a single dose of intraperitoneal LPS in dose
(10mg/kg) and were euthanized after two hours.
This group served as the acute lung injury model
group(induction group) (12).
Group Ⅲ (Corn oil+LPS). Mice received corn oil
(0.1ml) orally for five consecutive days. On day 5,
mice received lipopolysaccharide (10mg/kg) and
were euthanized after 2 hrs. the purpose of using
corn oil+LPS was to verify if the corn oil has an anti-
inflammatory effect or not (as corn oil is used to
dissolve L-carvone).
Group Ⅳ(L-carvone treatment). Mice received L-
carvone solution in dose (50mg/kg/day) orally for
five consecutive days (13). On day 5, mice received
lipopolysaccharide (10mg/kg) and were euthanized
after 2 hrs.
Group Ⅴ(L-carvone treatment). Mice received L-
carvone solution (100mg/kg/day) orally for five
consecutive days (13). On day 5, mice received
lipopolysaccharide (10mg/kg) and were euthanized
after 2 hrs. Administration of L-carvone is done by
oral gavage at 8:00 AM daily from day 1 through
day 5. Euthanization is done by diethyl ether
followed by cervical dislocation
Determination of lung tissue gene expression of
TNF-α, NF–кB, and COX2
The right lung was isolated and 50-100
mg of it was placed in a tube containing 1 ml of
TRIzol (RL solution) and frozen for later use.
Analysis and calculation of gene expression levels
of TNF- α, NF –κB, COX 2, and glyceraldehyde-3-
phosphate dehydrogenase (GAPDH), depend on
mRNA concentration after converting it to
complementary DNA. The process includes total
RNA extraction and purification using (Dong Sheng
Biotech /China), complementary DNA (cDNA)
synthesis using random primers (Transgen Biotech /
China), The SYBR green PCR Master Mix
(TaqDNA polymerase, SYBER Green1, dNTPs,
PCR enhancer and stabilizer) was used for real-time
PCR analysis. The cycle time values of the
interested genes were first normalized with
GAPDH(Housekeeping gene which is a reference
gene used to achieve accurate normalization for the
RT-qPCR of the same sample, The changes in the
mRNA expression in all the groups were calculated
by the comparative method of 2-∆∆ct. The primer
pairs of the expected products were as follows
(forward and reverse, respectively): NF-κB
(5`AAGACAAGGAGCAGGACATG-3`and5`
AGCAACATCTTCACATCCC-3), TNF–
α(5`TAGCCCACGTCGTAGCAAAC 3` and 5`
ACAAGGTACAACC CATCGGC-3`), COX2(5`
GCTCAGCCAGGCAGCAAATC-3` and 5` CACC
ATAGAATCCAGTCCGGG-3`) and GAPDH(5`
CGGGTTCCTATAAATACG GACTG-3`and5`-
CCAATACGGCCAAATCCGTTC-3`) primers were
purchased from Macrogen /South Korea, real-time
PCR was performed using Corbett research RT-
qPCR device according to the manufacturer
instructions (14,15).
Statistical analysis
Data presented as mean± standard error of
the mean (SEM). Statistical Package for the Social
Sciences (SPSS, version 25) was used for data
analysis and student T-test was used. One-way
ANOVA and Tukey used for comparison among
groups were (P˂0.05) considered significant.
Results
Effect of l-carvone on TNF-α mRNA level
Analysis of the data in the Table (1)
revealed that, the level of TNF-α mRNA is
significantly elevated (P<0.05) in the LPS model
(Group II) compared to corresponding level in the
normal control (Group I) (29.20±4.9 vs.
1.141±0.31). Furthermore, administration of L-
carvone in dose 50mg/kg/day (Group Ⅳ, L-carvone
treatment group) significantly (P<0.05) attenuated
the TNF-α mRNA level in lung tissue (29.20 ±4.9
vs. 7.56±1.195) compared to those levels in the non-
treated mice (Group Ⅱ, LPS model group)
(Figure1). Similarly, increasing the dose of L-
carvone to 100mg/kg/day (Group Ⅴ, L-carvone
treatment group) also resulted in significant
(P<0.05) attenuation of the TNF-α mRNA level
(29.20 ±4.9 vs. 7.84±1.40) compared to non-treated
mice (Group Ⅱ, LPS model group). In addition, data
of Table 1 and Figure 1 pointed out that there is a
non-significant (P>0.05) difference between the
(Group Ⅲ, corn oil + LPS) and that in (Group Ⅱ,
LPS model group) in terms of TNF-α mRNA level
which revealed that corn oil used as a vehicle in the
study has no effect on the TNF-α mRNA gene
expression level (which prove corn oil had no anti-
inflammatory effect). Further, data analysis reveals
that there is a non-significant (P>0.05) difference in
the TNF-α mRNA expression level between (Group
IV) mice treated with 50mg/kg/day and (Group V)
mice treated with 100mg/kg/day L-carvone. Table
(1) and Figure (1).
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
128
Table 1. Effect of L-carvone on TNF-α, COX2, and NF-κB mRNA gene expression levels.
Groups
TNF-α gene
expression level
(Mean ± SEM)
COX2 gene
expression level
(Mean ± SEM)
NF-κB gene
expression level
(Mean ± SEM)
G I: Negative Control (Normal
saline treated group)
1.141818± 0.318204 1.111382 ± 0.294431 1.15711 ± 0.369087
G II: LPS group (ALI model
group)
29.2048± 4.767602# 10.58144 ± 0.777646#
11.88348 ± 1.575529#
G III: (Corn oil + LPS group) 28.81076± 4.501522a 10.78121±2.751145a 11.31629 ± 0.684981a
G IV: L-carvone treatment group
50mg/kg/day
7.838699± 0.399415*b 5.721759 ± 0.329006*b
6.810089 ± 1.719718*b
G V: L-carvone treatment group
100mg/kg/day
7.560717± 1.155811*b 4.589894 ± 0.946045*b
5.005296 ± 0.800742*b
#: Significant (P<0.05) differences compared to the normal (negative) control Group I mice.
a: Non-significant (P>0.05) differences compared to the LPS model Group II mice.
*: Significant (P<0.05) compared to the LPS model Group II mice.
b: Non-significant (P>0.05) differences between Groups IV and V mice.
Figure 1. Bar Chart Showing the Effects of L-
carvone on TNF-α expression in LPS-induced
Acute Lung Injury (ALI).
RT-qPCR analysis of TNF-α mRNA expression
level in lung tissue of mice treated with L-carvone
50mg/kg/day and 100 mg/Kg/day for 5 days and
euthanized 2 hrs. after lipopoly-saccharide (LPS)
administration (n=10 mice in each group). Data
represent mean ±SEM.
#: Significant (P<0.05) differences compared to the
normal (negative) control Group I mice.
a: non-significant difference (P>0.05) (Group III,
Corn oil+LPS) compared to the LPS model Group
II mice.
*: Significant difference (P<0.05) of L-carvone
Groups (IV and V) each compared to the
lipopolysaccharide (LPS) model Group (II) mice.
b: Non-significant (P>0.05) difference between
Groups IV and V mice.
Effect of L-carvone on COX2 mRNA level
Results of Table (1) showed that the COX2 mRNA
gene expression level was significantly-elevated
(P<0.05) in LPS model group (Group II) compared
to the corresponding gene expression level in normal
control group (10.58±0.777 vs. 1.1± 0.29); and the
administration of L-carvone in a dose of
50mg/kg/day (Group IV) significantly (P<0.05)
attenuated the COX2 mRNA gene expression level
in lung tissue (10.58±0.777 vs.5.72±0.329)
compared to non-treated animals (Group II, LPS
model group) (Figure 2). Moreover, doubling the
dose of L-carvone to 100mg/Kg/day (Group V, L-
carvone treatment) also resulted in significant
(P<0.05) attenuation of COX2 mRNA level
(10.58±0.777 vs. 4.589± 0.946) compared to such
level in non-treated mice (LPS model group In
addition, data of Table (1) and Figure (2) pointed out
that there was a non-significant (P>0.05) difference
in the COX2 mRNA expression level between the
(Group Ⅲ, corn oil + LPS) and non-treated animals
(Group II, LPS model group), which can indicate
that the utilization of corn oil as a vehicle in the
study has no effect on the COX2 mRNA gene
expression level (in other word, corn oil had no anti-
inflammatory effect).
In addition, data analysis reveals that there is a non-
significant (P>0.05) difference in the COX2 mRNA
expression level between (Group IV) mice treated
with 50mg/kg/day and (Group V) mice treated with
100mg/kg/day L-carvone. Table (1) and Figure (2).
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
129
Figure 2. Bar Chart showing the effect of L-
carvone on COX2 expression in LPS-induced
acute lung injury (ALI).
RT-qPCR analysis of COX2 mRNA expression
level in lung tissue of mice treated with L-carvone
50 mg/kg or 100 mg/Kg/day for 5 days and
euthanized 2 hrs after LPS administration (n=10
mice in each group). Data represent mean ±SEM.
#: Significant (P<0.05) differences compared to the
normal (negative) control Group I mice.
a: non-significant difference (P>0.05) (Group III,
Corn oil+ LPS) compared to the LPS model Group
II mice.
*: Significant difference (P<0.05) of L-carvone
Groups (IV and V) each compared to the
lipopolysaccharide (LPS) model Group (II) mice.
b: Non-significant (P>0.05) difference between
Groups IV and V mice.
Effect of l-carvone on NF-кB mRNA level:
Results shown in Table (1) revealed that
levels of NF-κB mRNA gene expression were
significantly-elevated (P<0.05) in the LPS model
group compared to the corresponding gene
expression level in the normal control group
(11.88±1.227 vs. 1.15 ± 0.369), while in the mice’s
group received L-carvone 50mg/kg/day (Group IV)
showed that there was significant (P<0.05) down-
regulation of NF-κB mRNA gene level
(11.88±1.227 vs. 6.81±1.362) compared to non-
treated mice (LPS model group) (Figure 3).
Furthermore, administration of L-carvone
100mg/kg/day (Group V) to mice also resulted in a
significant (P<0.05) reduction in NF-κB mRNA
gene expression level (11.88±1.227 vs. 5.01±0.826)
compared to such level in non-treated mice (LPS
model, Group II). In addition, data pointed out in
Table (1) and Figure (3) there were non-significant
(P>0.05) differences in NF-κB mRNA gene
expression level between the corn oil group (corn oil
+ LPS Group III) and LPS model group which can
indicate that corn oil used as a vehicle in the study
has no effect on the NF-κB mRNA gene expression
level.
Also, results of Table (1) and Figure (3) revealed
that there was a non-significant difference (P>0.05)
in the NF-κB mRNA gene expression level between
the treatment groups with L-carvone 50mg/kg/day
(Group IV) and 100mg/kg/day (Group V).
Figure 3. Bar Chart Showing the Effect of L-
carvone on NF-κB Expression in LPS-induced
Acute lung Injury (ALI).
RT-qPCR analysis of NF-kB mRNA expression
level in lung tissue of mice treated with L-carvone
50mg/kg/day or 100 mg/Kg/day for 5 days and
euthanized 2 hrs. after LPS administration (n=10
mice in each group). Data represents mean ±SEM.
#: Significant (P<0.05) differences compared to the
normal (negative) control Group I mice.
a: non-significant difference (P>0.05) (Group III,
Corn oil+ LPS) compared to the LPS model Group
II mice.
*: Significant difference (P<0.05) of L-carvone
Groups (IV and V) each compared to the
lipopolysaccharide (LPS) model Group (II) mice.
b: Non-significant (P>0.05) difference between
Groups (IV and V) mice .
Discussion
Acute lung injury (ALI) is a serious
inflammatory condition with a high mortality rate in
the intensive care unit around the world. It is caused
by many factors which affect the lung either directly
or indirectly (16), (17). One of the causes of ALI is the
lipopolysaccharide (LPS), which is a component of
the gram-negative bacterial cell wall. In the present
study, the expression of pro-inflammatory mediators
TNF-α, COX2, and NF-κB were significantly-
elevated in mice intraperitoneally-injected with
10mg/kg LPS to induce ALI (Group II mice); results
of this study are consistent with those of others (18–
21).
Pretreatment with L-carvone at doses of
50mg/kg/day or 100mg/kg/day for 5 days (Groups
IV and Group V), respectively each decreased the
gene expression levels of TNF-α, COX2, and NF-
κB in lung tissue of treated mice and each compared
to those expression levels in LPS model (ALI,
Group II) but the effects are not significant (P>0.05)
(dose-independent effect). Table 1 and Figures (1, 2,
and 3).
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
130
Levo (L)-carvone can reduce the mRNA
gene expression levels of TNF-α, COX2, and NF-
κB, this may indicate the anti-inflammatory effect of
L-carvone that has been supported by other studies
(22–24) ; furthermore it has recently been reported that,
L-carvone can inhibit the elevated TNF-α level and
diarrhea score in intestinal mucositis induced by
irinotecan (11). Results of many in vitro studies have
shown that the anti-inflammatory effect of L-
carvone is related to the suppression of TNF-α -
induced neutrophil adherence; moreover, studies
showed that L-carvone inhibited TNF-α production
by macrophage cell line RAW264.7 stimulated with
LPS which further proved the anti-inflammatory
effect of L-carvone also in this study; moreover, L-
carvone inhibited nitric oxide (NO˚) and interleukin-
1β (1L-1β), interleukin-1α (IL-1α), and NF-κB
which are critical inflammatory mediators
associated with severe acute and chronic
inflammatory diseases (22–24).
Furthermore, a study of others revealed that the
inflammatory cytokines TNF-α, IL-1β, IL-6, COX2
and NF-κB play critical roles in the development of
ALI; thus, inhibiting these cytokines is of significant
concern in attenuating ALI (25).
Tumor necrosis factor–α (TNF-α) is a crucial
endogenous mediator that is mostly-produced by
monocytes and macrophages; it can activate the
inflammatory response, and plays a major role in the
regulation of the inflammatory process in the lung,
and causes damage to the cells of vascular
endothelium (26).
Furthermore, the COX2 enzyme is involved in
converting arachidonic acid (AA) to inflammatory
prostanoids, which are involved in the development
of early and late phase endotoxemia; moreover such
enzyme is a critical component in the inflammatory
response downstream of the NF-κB signaling
pathway; where, it can be stimulated by several pro-
inflammatory factors such as IL-6 and TNF-α,
oxidative stress (OS), and growth factors (23, 24).
Macrophages, dendritic cells, and neutrophils are
the major component of the innate immune system
involved in inflammation; furthermore, these cells
express pattern recognition receptor (PRRs) that
detect various microbial components, which is
called (pathogen-associated molecular patterns) (29).
Moreover, Vidya MK et al (2018) reported that LPS
activated the PRRs receptor (Toll-like receptor 4),
which is a classical pathway that initiates
intracellular inflammatory signal transduction which
stimulates macrophages to produce pro-
inflammatory cytokines production (30), and it is
essential for inflammatory M1 macrophage
polarization and inflammatory cytokines production
(31). Also, its activation resulted in the activation of
NF-κB through myeloid differentiation 88
dependent (MyD88 dependent) and MyD88
independent pathway (32); furthermore, the NF-κB is
a crucial transcription factor of M1 macrophages
and is required for the induction of a large number
of inflammatory genes, such as TNF-α, IL-1β, IL-6,
and COX-2 (29).
Moreover, OS can contribute to the pathogenesis of
ALI by the activation of transcription factor NF-κB
and the downstream pro-inflammatory cytokines (33).
Levo (L)-carvone showed an antioxidant effect in
a previous study by reducing the superoxide-free
radical (O2·
−); and, the antioxidant treatment in
oxidant-induced lung injury has been widely
observed to suppress NF-κB activation and the
outspread neutrophilic lung inflammation (34). In the
current study, the lung-protective effects of L-
carvone could either be due to its direct inhibition of
NF-κB signaling pathway or indirect effect by
inhibition of OS/ NF-κB pathway which is been
shown in Table (1) and Figure (3).
Furthermore, L-carvone was able to exert a
protective effect in ALI induced by LPS by
hampering NF-κB activation and its downstream
pro-inflammatory cytokines (TNF-α, COX2)
production; the results of the present study are
consistent with the results of other, which revealed
that downregulation of NF-κB resulted in
ameliorating lung injury in mice (35); in addition, L-
carvone induced the production of the anti-
inflammatory factor interleukin-10 (IL-10) which
further prove its anti-inflammatory effect (22).
Conclusion
Based on the observed effects, L-carvone
(in dose-independent effect) has lung-protective and
anti-inflammatory effects on LPS-induce ALI; and
its anti-inflammatory effect is ensured by hampering
NF-κB gene expression and its downstream pro-
inflammatory cytokines TNF-α and COX2, thus
protecting the lungs from acute inflammatory
damage.
Acknowledgment
The data of this article were abstracted
from the M.Sc. thesis submitted to the Department
of Pharmacology and Toxicology, College of
Pharmacy, University of Baghdad. The authors are
extremely grateful to the College of the
Pharmacy/University of Baghdad for supporting this
work.
References
1. Vázquez-Medina JP, Tao JQ, Patel P, Bannitz-
Fernandes R, Dodia C, Sorokina EM, et al.
Genetic inactivation of the phospholipase A2
activity of peroxiredoxin 6 in mice protects
against LPS-induced acute lung injury. Am J
Physiol - Lung Cell Mol Physiol.
2019;316(4):656–68.
2. Matthay MA, McAuley DF, Ware LB. Clinical
trials in acute respiratory distress syndrome:
challenges and opportunities. Lancet Respir
Med. 2017;5(6):524–34.
3. Schultz C. Lipopolysaccharide, structure and
biological effects. Gen Intern Med Clin Innov.
2018;3(1):1–2.
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
131
4. Ciesielska A, Matyjek M, Kwiatkowska K.
TLR4 and CD14 trafficking and its influence on
LPS-induced pro-inflammatory signaling. Cell
Mol Life Sci. 2021;78(4):1233–61.
5. Jiang K, Guo S, Yang C, Yang J, Chen Y,
Shaukat A, et al. Barbaloin protects against
lipopolysaccharide (LPS)-induced acute lung
injury by inhibiting the ROS-mediated
PI3K/AKT/NF-κB pathway. Int
Immunopharmacol. 2018; 64:140–50.
6. Sadiq AT, Zalzala MH. The Possible Protective
Effect of Safranal on the Lipopolysaccharide-
induced Acute Lung Injury in Mice. IJDDT.
2021;11(3):1–6.
7. Abbas MA, Oriquat GA, Abbas MM, Al-Najjar
BO, Kandil YI. Hypolipidaemic and Insulin
Secretagogue Activities of (R)-(-)-Carvone.
Malays J Med Sci. 2020; 27(6):39–52.
8. Nesterkina M, Barbalat D, Konovalova I,
Shishkina S, Atakay M, Salih B, et al. Novel (‒)-
carvone derivatives as potential anticonvulsant
and analgesic agents. Nat Prod Res.
2021;35(23):4978–87.
9. Abbas MM, Kandil Yİ, Abbas MA. R-(-)-
carvone Attenuated Doxorubicin Induced
Cardiotoxicity In Vivo and Potentiated Its
Anticancer Toxicity In Vitro. Balkan Med J.
2020;37(2):98–103.
10. Pina LTS, Serafini MR, Oliveira MA, Sampaio
LA, Guimarães JO, Guimarães AG. Carvone and
its pharmacological activities: A systematic
review. Phytochemistry. 2022; 196:113080.
11. Abbas BW, Kathem SH. Carvone Attenuates
Irinotecan-Induced Intestinal Mucositis and
Diarrhea in Mice. Iraqi J Pharm Sci.
2021;30(2):58–63.
12. An X, Sun X, Hou Y, Yang X, Chen H, Zhang P,
et al. Protective effect of oxytocin on LPS-
induced acute lung injury in mice. Sci Rep.
2019;9(1):2836.
13. Muruganathan U, Srinivasan S, Indumathi D.
Antihyperglycemic effect of carvone : Effect on
the levels of glycoprotein components in
streptozotocin-induced diabetic rats. J Acute Dis.
2013;2(4):310–5.
14. Wang J, Liu Y, Xiao L, Zhu L, Wang Q, Yan T.
Anti-Inflammatory Effects of Apigenin in
Lipopolysaccharide- Induced Inflammatory in
Acute Lung Injury by Suppressing COX-2 and
NF-kB Pathway. 2014;37(6):0–5.
15. Fragoulis A, Biller K, Fragoulis S, Lex D, Uhlig
S, Reiss LK. Reference Gene Selection for Gene
Expression Analyses in Mouse Models of Acute
Lung Injury. Int. J. Mol. Sci. 2021; 22(15): 7853
16. Reilly JP, Calfee CS, Christie JD. Acute
Respiratory Distress Syndrome Phenotypes.
Semin Respir Crit Care Med. 2019;40(1):19-30
17. Chalmers S, Khawaja A, Wieruszewski PM,
Gajic O, Odeyemi Y. Diagnosis and treatment of
acute pulmonary inflammation in critically ill
patients: The role of inflammatory biomarkers.
World J Crit care Med. 2019 ;8(5):59–71.
18. Abdelmageed ME, El-Awady MS, Abdelrahim
M, Suddek GM. LPS-RS attenuation of
lipopolysaccharide-induced acute lung injury
involves NF-κB inhibition. Can J Physiol
Pharmacol. 2016;94(2):140–6.
19. Meng L, Zhao X, Zhang H. HIPK1 Interference
Attenuates Inflammation and Oxidative Stress of
Acute Lung Injury via Autophagy. Med Sci
Monit. 2019;25:827–35.
20. Lee SA, Lee SH, Kim JY, Lee WS. Effects of
glycyrrhizin on lipopolysaccharide-induced
acute lung injury in a mouse model. J Thorac Dis.
2019 ;11(4):1287–302.
21. Chen X, Wu S, Tang L, Ma L, Wang F, Feng H,
et al. Mesenchymal stem cells overexpressing
heme oxygenase-1 ameliorate
lipopolysaccharide-induced acute lung injury in
rats. J Cell Physiol . 2019;234(5):7301–19.
22. Marques FM, Figueira MM, Schmitt EFP,
Kondratyuk TP, Endringer DC, Scherer R, et al.
In vitro anti-inflammatory activity of terpenes
via suppression of superoxide and nitric oxide
generation and the NF-κB signalling pathway.
Inflammopharmacology. 2019;27 (2):281–9.
23. Sousa C, Leitão AJ, Neves BM, Judas F,
Cavaleiro C, Mendes AF. Standardised
comparison of limonene-derived monoterpenes
identifies structural determinants of anti-
inflammatory activity. Sci Rep.
2020;10(1):7199.
24. Abe S, Maruyama N, Hayama K, Ishibashi H,
Inoue S, Oshima H, et al. Suppression of tumor
necrosis factor-alpha-induced neutrophil
adherence responses by essential oils. Mediators
Inflamm. 2003;12(6):323–8.
25. Goodman RB, Pugin J, Lee JS, Matthay MA.
Cytokine-mediated inflammation in acute lung
injury. Cytokine Growth Factor Rev.
2003;14(6):523–35.
26. Jaffer U, Wade RG, Gourlay T. Cytokines in the
systemic inflammatory response syndrome : a
review. HSR Proc Intensive Care Cardiovasc
Anesth. 2010;2(3):161-75
27. Cartin-Ceba R, Hubmayr RD, Qin R, Peters S,
Determann RM, Schultz MJ, et al. Predictive
value of plasma biomarkers for mortality and
organ failure development in patients with acute
respiratory distress syndrome. J Crit Care. J Crit
Care. 2015 ;30 (1):219.e1-7.
28. Al-Harbi NO, Imam F, Al-Harbi MM, Ansari
MA, Zoheir KMA, Korashy HM, et al.
Dexamethasone Attenuates LPS-induced Acute
Lung Injury through Inhibition of NF-κB, COX-
2, and Pro-inflammatory Mediators. Immunol
Invest. 2016 ;45(4):349–69.
29. Liu T, Zhang L, Joo D, Sun S-C. NF-κB
signaling in inflammation. Signal Transduct
Target Ther. 2017;2:17023.
Iraqi J Pharm Sci, Vol.32(1) 2023 L-carvone and acute lung injury
132
30. Vidya MK, Kumar VG, Sejian V, Bagath M,
Krishnan G, Bhatta R. Toll-like receptors:
Significance, ligands, signaling pathways, and
functions in mammals. Int Rev Immunol.
2018;37(1):20–36.
31. Liu Z, Ma Y, Cui Q, Xu J, Tang Z, Wang Y, et
al. Toll-like receptor 4 plays a key role in
advanced glycation end products-induced M1
macrophage polarization. Biochem Biophys Res
Commun. 2020;531(4):602–8.
32. De Nardo D. Toll-like receptors: Activation,
signalling and transcriptional modulation.
Cytokine. 2015;74(2):181–9.
33. Sarma JV, Ward PA. Oxidants and redox
signaling in acute lung injury. Compr Physiol.
2011;1(3):1365–81.
34. Haddad JJ. Science review: Redox and oxygen-
sensitive transcription factors in the regulation of
oxidant-mediated lung injury: Role for nuclear
factor-κB. Crit Care. 2002;6(6):481–90.
35. Huang X, Wei X, Guo L, Zhao L, Chen X, Cui
Y, et al. The therapeutic effects of Jaceosidin on
lipopolysaccharide-induced acute lung injury in
mice. J Pharmacol Sci. 2019;140(3):228–35.
This work is licensed under a Creative Commons Attribution 4.0 International License.
http://creativecommons.org/licenses/by/4.0/
http://creativecommons.org/licenses/by/4.0/