ijfs#1090_bozza ital. j. food sci., vol. 30, 2018 792 paper angiotensin i converting enzyme inhibitory peptides from sword bean y. zhang, p. chen, l. liu, k. li, h. wang and l. wang* school of life science, beijing university of chinese medicine, fangshan district, beijing 102488, china *e-mail address: wanglz@bucm.edu.cn abstract sword bean is a healthy food and herbal medicine in china. in this study, the main components of sword bean were determined. albumin, globulin, prolamin and glutelin were hydrolyzed by pepsin and then the angiotensin i converting enzyme (ace) inhibitory activity was evaluated. our results showed that glutelin peptides manifested the highest ace inhibitory activity with inhibitory ratio of 22.10±1.57% followed by prolamin peptides and albumin peptides of 16.77±0.76% and 16.40±0.42%, respectively, at the final concentration of 0.01 mg/ml. our results strongly suggest that sword bean at some extant have potential to lower blood pressure. keywords: sword bean, main component, angiotensin i converting enzyme, peptides ital. j. food sci., vol. 30, 2018 793 1. introduction hypertension, a major risk factor for cardiovascular and renal diseases, has become the most common serious chronic health problem. the rennin-angiotensin system (ras) is critically involved in the physiological regulation of blood pressure and pathogenesis of hypertension (cat and touyz, 2011). ace, as an essential member of ras, can catalyzes the conversion of angiotensin (ang) i to ang ii by removing a carboxyterminal dipeptide (wysocki et al., 2006). meanwhile, ace metabolizes bradykinin (bk), a vasodilator, to inactive bk-(1-7). therefore, ace inhibitors are effective first-line treatment against essential hypertension (thomas et al., 2004), such as captopril, enalapril and lisinopril. however, these synthetic drugs may also cause obvious side effects including cough, loss to taste, renal impairment, and angioneurotic oedema (antonios et al., 1995). thus, peptides with potent ace inhibitory activity derived from natural food provide an effectively alternative treatment (yu et al., 2006). in recent years, ace inhibitory peptides from natural protein have been successfully isolated, such as corn (yang et al., 2007), soybean (mallikarjun et al., 2006) and coix seed (yuan et al., 2014). recently, the antihypertensive peptides from traditional chinese medicine proteins has drawn considerable attention. sword bean, the seed of the leguminous plant canavalia gladiate, also has been treated as traditional medicine for containing canavanine, hemagglutinin, and concanavalin a (ekanayake et al., 2006). it has been reported that sword bean may exhibit antioxidant activity of eliminating free radicals and against oxidative stress. in addition, it also has strong anti-inflammatory and anticarcinogenic effects. it is reported that soybean paste containing sword bean exhibits higher ace inhibitory effects than other soybean pastes (han et al., 2015). in this study, this medicinal food was chose to prepare the ace inhibitory peptides because of its ace inhibitory activity and rich protein. the aims of this study are: (1) to determine the main components and protein content of sword bean. (2) to obtain peptides with low molecular weight (≤ 3 kd) by hydrolyzing protein with pepsin, and estimate their ace inhibitory activity. (3) to provide some reference for the clinical drug use of sword bean in traditional chinese medicine. 2. materials and methods 2.1. material sword bean was purchased from tongrentang (beijing, china). the voucher specimen (no. 131121003) was deposited at -20°c. pepsin, ace and hippuryl-l-histidyl-l-leucine (hhl) were purchased from sigma-aldrich (st. louis, mo, usa). trifluoroacetic acid (tfa, ms grade) and acetonitrile (hplc grade) were purchased from merck kgaa (darmstadt, germany) and fisher scientific (pittsburgh, pa, usa) respectively. all other chemicals and reagents were analytical grade. 2.2. determination of the proximal compositions protein, fat, moisture and ash content of sword bean were determined according to the chinese pharmacopoeia (commission, 2015). the content of starch was determined by ji (ji et al., 2016). ital. j. food sci., vol. 30, 2018 794 2.3. sequential extraction of seed protein the seeds were ground into powder by a universal high-speed smashing machine, and then defatted with cooled petroleum ether and dried at 40°c overnight. albumin, globulin, prolamin and glutelin were then sequentially extracted with deionized water, 0.5 m nacl, 70% ethanol (containing 0.5% naac, 5% β-mercaptoethanol) and 0.0125 m sodium borate buffer (containing 1% sds, 2% β-mercaptoethanol), respectively. all of the protein solutions were dialysised against deionized water at 4°c for 24 h and then freezedried. the samples were stored at -80°c for further analysis. 2.4. determination of protein molecular weight distribution sds-page was conducted according to the method of krizkova (krizkova et al., 2015) with some modifications to determine the molecular weight distribution of all the protein fractions. all the samples were run for approximately 100 min in 3% stacking gel with a electric current of 10 ma and then for another 100 min in 15% separating gel with 30 ma. after that, the gel was dyed with coomassie brilliant blue overnight and then decolored with bleaching liquid until the strips were seen clearly. 2.5. determination of the amino acid content for determination of amino acid composition, 100 mg samples were subjected to acid hydrolysis with 20 ml of 6 m hcl at 110°c for 24 h. then the lyophilized hydrosate was dissolved in 0.02 m hcl and analyzed by a amino acid analyzer (l-8900; hitachi, tokyo, japan) (wang et al., 2008). 2.6. preparation of enzymatic hydrolysates to produce bioactive peptides, enzymatic hydrolysis method was applied. the protein (2%, w/v) was dissolved in 0.01 m hcl, and pepsin was added with enzyme/substrate ratio of 1/10 (w/w). the mixture was incubated at the temperature of 37°c for 48 h. to terminate the reaction, the mixture was heated 95°c for 5 min. the hydrolysates supernatant was collected after the centrifugation (at 10,000 rpm, 10 min, 4°c). 2.7. ultrafiltration (uf) of protein hydrolysates to produce low molecular weight peptides, the hydrolysates were passed through ultrafiltration membrane(mwco, 3 kd). the peptide concentration of each collected fractions was estimated by the lowry method (sapan, and lundblad, 2015). 2.8. the assay of ace inhibitory activity the ace inhibitory activity was determined according to the method reported by yuan (yuan et al., 2014). briefly, the reaction system contained 10 μl sample, 20 μl ace (2 mu) and 20 μl hhl (2 mm). sample and ace were incubated at 37°c for 10 min prior to adding substrate hhl, and then for an additional incubation for 80 min at the same temperature. to terminate the reaction, 100 μl acetonitrile was added. captopril and borate buffer solution was used as positive and blank control, respectively. ace inhibitory activity was confirmed by monitoring the formation of ha which was generated by hhl under enzymatic hydrolysis. ha was detected by rp-hplc on a c18 column (250 × 4.6 mm, 5 μm, tianhe). the column was eluted by a mobile phase of acetonitrile/water (0.05% ital. j. food sci., vol. 30, 2018 795 tfa) at a volume ratio of 25 : 75 with the flow rate of 1 ml/min. the elution was monitored at 228 nm. the ace inhibitory ratio of each sample was calculated as follows: inhibitory activity (%) = [ (a-b) ⁄ a] × 100% where a was the ha peak area of blank control; b was the ha peak area in the presence of the sample. 2.9. statistical analysis all data were conducted in triplicate and expressed as the mean±sd. the sas 9.3 program was used for multiple comparison, and p < 0.05 were considered to be significant. 3. results 3.1. proximal compositions of sword bean the proximal compositions of sword bean were presented in table 1. the starch content of sword bean ranked first (36.59±2.93%). as the member of leguminosae, the protein content of sword bean accounted for 31.95±0.24%. the moisture and ash contents of this medicinal food all conformed to the requirements of the chinese pharmacopoeia. table 1. proximal compositions (%) of sword bean. protein crude fat moisture ash starch sword bean 31.95 (±0.24) 0.71 (±0.04) 8.33 (±0.01) 3.16 (±0.04) 36.59 (±2.93) results were expressed as the mean±sd (n = 3). 3.2. protein fractions distribution of sword bean protein patterns of sword bean were shown in table 2. considerable variability among albumin, globulin, prolamin and glutelin was observed. albumin had the highest percentage of 70.93±0.25% followed by globulin of 16.75±0.51%. the prolamin and glutelin contents of this leguminous seeds were rather low. insoluble protein in the residue only accounted for 5.83±0.04% indicating effective extraction of protein. table 2. protein pattern of sword bean (% of total protein). albumin globulin prolamin glutelin residual sword bean 70.93a (±0.25) 16.75b (±0.51) 1.48e (±0.02) 7.02c (±0.26) 5.83d (±0.04) results were expressed as the mean±sd (n = 3). different letters of indicated having significantly different (p < 0.05). ital. j. food sci., vol. 30, 2018 796 3.3. sds-page pattern of protein fractions of sword bean the molecular weight (mw) distributions of different protein fractions for sword bean were detected by sds-page, which was shown in fig. 1. albumin and globulin resolved into similar subunits ranging from 97 kd to 19 kd, with the major subunit of 50 kd. the bands of prolamin and glutelin were heterogeneous ranging from 57 to 14.4 kd and 97 to 19 kd, respectively. figure 1. the molecular weight distribution of proteins extracted from sword bean. lane 1, marker; lane 2, albumin; lane 3, globulin; lane 4, prolamin; lane 5, glutelin. 3.4. amino acid composition of seeds flour for sword bean, a total of 13 kinds of amino acid were detected. including almost all the essential amino acids and semi-essential amino acids for human beings. from table 3, it could be seen that phe had the highest percentage of 4.55±0.11 mg/100 mg, while his recorded the lowest (0.50±0.01 mg/100 mg) in sword bean. 3.5. ace inhibitory activity assay the rp-hplc method was utilized to estimate ace inhibitory activity of peptide mixtures (≤ 3 kd). the blank control displayed a strong peak area of ha (fig. 2a), while the positive control (captopril, final concentration of 2×10-9 mol/l) manifested a strong ace inhibition ratio of 91.64±0.07% (fig. 2b). the glutelin peptides (≤ 3 kd) revealed the highest ace inhibitory activity at the final concentration of 0.01 mg/ml with 22.10±1.57 (fig. 2c). all results were showed in table 4. ital. j. food sci., vol. 30, 2018 797 table 3. the amino acid content of sword bean (mg/100 mg). amino acid sword bean (mg/100 mg) asp 2.84±0.03 thra 1.32±0.03 ser 1.49±0.02 glu 3.26±0.07 gly 0.88±0.02 ala 0.68±0.01 cys vala 2.74±0.06 meta ilea 1.07±0.02 leua 1.69±0.05 tyr phea 4.55±0.11 lysa 1.47±0.02 hisa 0.50±0.01 trpa arga 1.56±0.02 pro a(semi-) essential amino acid for human, not detected. the data was expressed as the mean±sd (n = 3). elution time (min) elution time (min) ha hhl b ha hhl a ital. j. food sci., vol. 30, 2018 798 elution time (min) figure 2. rp-hplc chromatograms of (a) blank control, (b) positive control (captopril, final concentration of 2×10-9 mol/l), (c) glutelin peptides (≤ 3 kd) of 0.01 mg/ml. the mobile phase consisted of 25% acetonitrile (containing 0.05% tfa), eluting at a flow rate of 1.0 ml/min and the absorbance of eluent was detected at 228 nm. table 4. ace inhibition rate (%) of peptides (≤ 3 kd) from different protein fractions. peptide ace inhibition rate (%) albumin peptides 16.40±0.42b globulin peptides 12.72±0.29c prolamin peptides 16.77±0.76b glutelin peptides 22.10±1.57a results were expressed as the mean±sd (n = 3). the samples were measured at the final concentration of 0.01 mg/ml. different letters of indicated having significantly different (p < 0.05). 4. discussion food-derived ace inhibitory peptides can provide an effectively alternative treatment for hypertension. there are different methods to produce ace inhitory peptides from precursor proteins, such as enzymatic hydrolysis (chen et al., 2007), microbial fermentation (yamamoto et al., 1994) and chemical synthesis. among these methods, enzymatic hydrolysis is the most commonly used method (yuan et al., 2014). there are a great number of studies have proved that food-derived protein hydrolysates and peptides possess ace inhibitory activity (balti et al., 2010; lassissi et al., 2014; lee et al., 2010). soybean paste containing sword beans exhibits higher ace inhibitory effects (han et al., 2015). research has shown that the presence of hydrophobic amino acids can increase ace inhibitory activity (li et al., 2004). our study showed that sword bean included all the essential amino acids (except met) and semi-essential amino acids for human beings. moreover, sword bean protein may become effective sources for preparation of ace inhibitory peptides because of its high proportion of hydrophobic amino acid and proline, with 44.58% of total amino acid. albumin, globulin, prolamin and glutelin were sequentially extracted, which is of benefit to study different proteins activity. the high levels of protein and starch make sword bean good sources of these nutrients. 5. conclusion our study mainly focused on the ace inhibitory activity of protein hydrolysates. the result showed that glutelin peptides manifested the highest ace inhibitory activity with ha hhl c ital. j. food sci., vol. 30, 2018 799 inhibitory ratio of 22.10±1.57% followed by prolamin peptides and albumin peptides of 16.77±0.76% and 16.40±0.42%, respectively, at the final concentration of 0.01 mg/ml. after further separation, purification and structural identification of hydrolysates (≤ 3 kd), bioactive peptides with better antihypertensive activity might be obtained. our data might contribute to further research into food derived antihypertensive compounds, meanwhile it also provides some reference for the clinical drug use of sword bean in traditional chinese medicine. acknowledgements this study has received financial support from the natural science foundation of china (no. 81872972) and basic scientific research funding project of beijing university of chinese medicine (no. 2015-jyb-jsm s026). thanks to all the people who joined and helped in this study. references antonios t.f. and macgregor g.a. 1995. angiotensin converting enzyme inhibitors in hypertension: potential problems. journal of hypertension 13:s11-s16. doi: doi.org/10.1097/00004872-199509003-199500003. balti r., nedjar-arroume n., bougatef a., guillochon d. and nasri m. 2010. three novel angiotensin i-converting enzyme (ace) inhibitory peptides from cuttlefish (sepia officinalis) using digestive proteases. food research international 43(4):1136-1143. doi: doi.org/1110.1016/j.foodres.2010.1102.1013. cat a.n.d. and touyz r.m. 2011. a new look at the renin-angiotensin system-focusing on the vascular system. peptides 32(10):2141-2150. doi: doi.org/2110.1016/j.peptides.2011.2109.2010. chen q., xuan g.-d., fu m.-l., he g.-q., wang w., zhang h.-b. and ruan h. 2007. effect of angiotensin і-converting enzyme inhibitory peptide from rice dregs protein on antihypertensive activity in spontaneously hypertensive rats. asia pacific journal of clinical nutrition 16(s1):281-285. commission c.p. 2015. pharmacopeia of people's republic of china (vol. 3). china medical science press (in chinese). isbn:978-977-5067-7337-5066. ekanayake s., nair b.m., asp n.g. and jansz e.r. 2006. effect of processing of sword beans (canavalia gladiata) on physicochemical properties of starch. starch‐stärke 58(5):215-222. doi: doi.org/210.1002/star.200500449. han s. s., hur s.j. and lee s.k. 2015. a comparison of antioxidative and anti-inflammatory activities of sword beans and soybeans fermented with bacillus subtilis. food & function 6(8):2736-2748. doi: doi.org/2710.1039/c2735fo00290g. ji h.f., liu l., k.l., zhang y.y. and wang l.z. 2016. protein composition analysis and cytotoxicity of gulbulin hydrolysates of brucea javanica seeds. china journal of chinese materiamedica 41:4210-4215 (in chinese). doi:4210.4268/cjcmm20162221. krizkova s., dostalova s., michalek p., nejdl l., kominkova m., milosavljevic v., moulick a., vaculovicova m., kopel p. and adam v. 2015. sds-page as a tool for hydrodynamic diameter-dependent separation of quantum dots. chromatographia 78(11-12):785-793. doi: doi.org/710.1007/s10337-10015-12893-z. lassissi t.a., hettiarachchy n.s., rayaprolu s.j., kannan a. and davis m. 2014. functional properties and angiotensin-i converting enzyme inhibitory activity of soy–whey proteins and fractions. food research international 64:598-602. doi:510.1016/j.foodres.2014.1007.1015. lee s.-h., qian z.-j. and kim s.-k. 2010. a novel angiotensin i converting enzyme inhibitory peptide from tuna frame protein hydrolysate and its antihypertensive effect in spontaneously hypertensive rats. food chemistry 118(1):96-102. doi: doi.org/110.1016/j.foodchem.2009.1004.1086. li g.-h., le g.-w., shi y.-h. and shrestha s. 2004. angiotensin i–converting enzyme inhibitory peptides derived from food proteins and their physiological and pharmacological effects. nutrition research 24(7):469-486. doi: doi.org/410.1016/j.nutres.2003.1010.1014. ital. j. food sci., vol. 30, 2018 800 mallikarjun gouda k., gowda l.r., rao a.a. and prakash v. 2006. angiotensin i-converting enzyme inhibitory peptide derived from glycinin, the 11s globulin of soybean (glycine max). journal of agricultural and food chemistry 54(13):4568-4573. doi: doi.org/4510.1021/jf060264q. sapan c.v. and lundblad r.l. 2015. review of methods for determination of total protein and peptide concentration in biological samples. proteomics-clinical applications 9(3-4):268-276. doi: doi.org/210.1002/prca.201400088. thomas d.a., grant p.j., turner a.j. and hooper n.m. 2004. evaluation of angiotensin-converting enzyme (ace), its homologue ace2 and neprilysin in angiotensin peptide metabolism. biochemical journal 383(1):45-51. doi: doi.org/10.1042/bj20040634. wang l., xu c., qu m. and zhang j. 2008. kernel amino acid composition and protein content of introgression lines from zea mays ssp. mexicana into cultivated maize. journal of cereal science 48(2):387-393. doi: doi.org/310.1016/j.jcs.2007.1009.1014. wysocki j., ye m., soler m.j., gurley s.b., xiao h.d., bernstein k.e., coffman t.m., chen s. and batlle d. 2006. ace and ace2 activity in diabetic mice. diabetes 55(7):2132-2139. doi: doi.org/2110.2337/db2106-0033. yamamoto n., akino a. and takano t. 1994. antihypertensive effects of different kinds of fermented milk in spontaneously hypertensive rats. bioscience, biotechnology, and biochemistry 58(4):776-778. doi: doi.org/710.1271/bbb.1258.1776. yang y., tao g., liu p. and liu j. 2007. peptide with angiotensin i-converting enzyme inhibitory activity from hydrolyzed corn gluten meal. journal of agricultural and food chemistry 55(19):7891-7895. doi: doi.org/7810.1021/jf0705670. yu y., hu j., miyaguchi y., bai x., du y. and lin b. 2006. isolation and characterization of angiotensin i-converting enzyme inhibitory peptides derived from porcine hemoglobin. peptides 27(11):2950-2956. doi: doi.org/2910.1061/j.peptides.2006.2905.2025. yuan j., liang y., cui s., zhang x., wang l. and qiao y. 2014. angiotensin i converting enzyme inhibitory and antioxidant activity of adlay (coix lacryma-jobi l. var. ma-yuen stapf) glutelin hydrolysate. italian journal of food science 26(3):282-288. paper received november 8, 2018 accepted june 25, 2018 ijfs#1504_bozza ital. j. food sci., vol. 32, 2020 125 paper experimental contamination of chamelea gallina with murine norovirus and effectiveness of depuration m. berti1, l. teodori1, o. portanti1, a. leone1, i. carmine1, n. ferri1, p. visciano*2, m. schirone*2 and g. savini1 1istituto zooprofilattico sperimentale dell’abruzzo e del molise “g. caporale”, via campo boario, 64100 teramo, italy 2faculty of bioscience and technology for food, agriculture and environment, university of teramo, via r. balzarini 1, 64100 teramo, italy *corresponding author: tel. +39 0861266911 email: pvisciano@unite.it; mschirone@unite.it abstract human norovirus has been reported as the major non-bacterial cause of human gastroenteritis due to the consumption of contaminated bivalve mollusks. the european legislation established microbiological criteria only for bacteria (salmonella spp. and escherichia coli), while no viruses have still been considered. in this study, samples of chamelea gallina were harvested along the central adriatic coasts (italy) and artificially contaminated with murine norovirus-1 (mnv-1) up to a final concentration of 103 tcid50/ml in water. they were subject to a depuration process in a closed-circuit system using both ozone and ultraviolet light. four experimental trials (100 specimens/trial) were performed and, at the end of depuration, the digestive glands of mollusks were examined by means of two methods – namely, rt-pcr and tissue culture. the results of rt-pcr ranged from 103.17 to 104.60 tcid50/ml, and the constant presence of mnv-1 was confirmed by the tissue culture as well. in conclusion, no significant viral reduction was obtained, but the contaminated bivalve mollusks remained infectious until the end of the depuration treatment. the proper cooking of live bivalve mollusks could be considered the most important preventive measure against this sanitary risk. keywords: norovirus, clams, depuration, tissue culture, rt-pcr ital. j. food sci., vol. 32, 2020 126 1. introduction norovirus is a non-enveloped, single-stranded positive rna virus, a member of the family caliciviridae, and divided into six genogroups (gi-gvi). however, only the genogroups gi, gii and giv were identified in humans (ilic et al., 2017). moreover, over 40 genotypes based on the capsid were identified (leroux-roels et al., 2017). a novel gii.17 variant emerged in asia (china, japan, korea and taiwan) in 2014 (cheng et al., 2017; suffredini et al., 2017) and was also reported in other countries such as canada, the united states (u.s.), new zealand as well as some european states – i.e. germany, italy, hungary and slovenia (chan et al., 2017). according to the european union rapid alert system for food and feed (eu rasff), the majority of alert notifications involving norovirus in food were reported by denmark, france, italy, the netherlands and norway as notifying countries, and france and serbia as countries of origin, respectively. with regards to border rejection notifications, the main countries of origin were france and serbia, whereas italy and spain submitted to the eu rasff the majority of them (papapanagiotou, 2017). human norovirus (hunov) is reported as the main non-bacterial cause of foodborne outbreaks due to the consumption of live bivalve mollusks. the main clinical symptoms of such an illness, with an incubation period of 10-51 hours, are nausea, sudden onset of vomiting and/or watery non-bloody diarrhea, abdominal or general muscle pain, headache and mild fever (hassard et al., 2017; jeon et al., 2017). in addition, it can lead to more severe conditions, such as dehydratation, hospitalization and potentially death in vulnerable individuals including children and elderly population (trivedi et al., 2013; fusco et al., 2017). bivalve mollusks are filter-feeding organisms that can retain and concentrate in their own body not only nutrients but also suspended viruses or bacteria. however, the european union (eu) legislation (ec, 2004a) established that sanitary controls of live bivalve mollusks must be based only on the detection of escherichia coli used as an indicator of faecal contamination for the classification of production areas, from which they can be collected. moreover, regulation ec no 2073/2005 (ec, 2005) and its amendments reported the absence of salmonella spp. in 25 g of live bivalve mollusks and a range of 230 to 700 mpn/100 g of flesh and intravalvular liquid for e. coli. in the u.s. as well, the standards used for shellfish hygiene controls in both growing areas during primary production and for end-products are represented by faecal or total coliforms (campos et al., 2017). on the contrary, viruses are not investigated as vehicles for foodborne disease transmission according to the above mentioned legislations. generally, viruses show a higher environmental resistance than bacteria, and depuration is poorly effective on decontamination of live bivalve mollusks (varela et al., 2016). the most common depuration systems are based on the use of chlorine, ultraviolet light (uv) and ozone. while chlorine can have organoleptic effects in mollusks and cause the formation of chlorinated by-products, uv and ozone have gained popularity in recent years but both of them can be limited because the first is effective in high flow rates (polo et al., 2014a) and ozone is influenced by some parameters such as temperature, salinity, ph and dissolved oxygen (ilic et al., 2017). the aim of this study is the evaluation of a depuration process in a closed-circuit system using both ozone and uv in clams (chamelea gallina), experimentally contaminated with murine norovirus-1 (mnv-1), because it has genetic and pathological features similar to hunov and therefore it can be used as surrogate (predmore et al., 2015; kim et al., 2017). ital. j. food sci., vol. 32, 2020 127 2. materials and methods 2.1. samples’ collection and depuration process samples of c. gallina (25-32 mm) were harvested along the central adriatic coast of molise region, italy, in 4 different periods (named a to d) of the year 2015 (from january to october) and put into aquariums containing seawater for acclimation and evaluation of their viability. then, they were transferred into tanks filled with artificial marine water (ocean fish, prodac international, padova, italy) and artificially contaminated for 72 hours with the mnv-1 provided by the istituto zooprofilattico sperimentale delle venezie (italy), up to a final concentration of 103 tcid50/ml in water. the depuration process was carried out for 72 hours in a closed-circuit system (tecno impianti international s.r.l., riccione, italy) equipped with uv and ozone. it consisted of 197x72x45 cm tanks with a perlon wool prefilter and hyperactive carbon filter, an active biological filter using lithothamnium calcareum algae and an uv sterilization plant. with regards to the sterilization unit and ozonator, power was 230v and power consumption was 16w and 0.5 a, respectively. aliquots of 100 specimens were analyzed at time 0 as negative control, before being placed in the depuration tanks, and further 3 aliquots were examined at intervals of 24, 48 and 72 hours. the clams were washed, opened and their digestive glands were pooled together and homogenized. then they were analyzed by both tissue culture and rt-pcr according to baert et al. (2008). 2.2. preparation of viral stocks mnv-1 was propagated in monolayers of raw 264.7 (mouse macrophage) purchased from american type culture collection (atcc-lgc standards, milano, italy) and cultured in 75 cm2 tissue culture flasks. the cells were maintaned in dulbecco’s modified eagle medium, dmem (gibco, new york, usa) supplemented with sterile phosphate buffered saline (pbs, ph 7.4), 1% antibiotics (penicillin, nystatin, gentamicin, streptomycin) and 10% fetal bovine serum (merck, darmstadt, germany). they were incubated at 37°c in a humidified atmosphere of 5% co2. for the preparation of viral stocks, the growth medium was removed, the cells were infected with mnv-1 with a virus titer of 103 tcid50/ml and incubated for 48 hours. when significant cytopathic effects were observed, the supernatant was centrifuged at 500 g at 4°c for 30 min. mnv-1 titer was assessed by both rt-pcr assay and traditional virus end point titration according to reed and müench (1938). 2.3. tissue culture assay an aliquot of pooled hepatopancreas (1±0.2 g) was homogenized with sterile quartz sand and diluted 1:10 (w/v) in antibiotics antimycotic solution (100x). the sample was stored at 4°c for 1 hour and centrifuged at 5000 g for 10 min. twenty-four well microplate monolayers of raw 264.7 were infected with 200 !l of the diluted sample (1:10 and 1:100) in dmem and incubated at 37°c in a humidified atmosphere of 5% co2 for 4-6 days. the presence of mnv-1 was evaluated by means of rt-pcr. ital. j. food sci., vol. 32, 2020 128 2.4. rt-pcr assay the glands were pooled and 2±0.2 g were homogenized with 2±0.2 ml of 0.1 mg/ml proteinase k solution (qiagen, hilden, germany), incubated at 37°c with shaking (320 rpm/1 hour) and centrifuged at 3000 g for 5 min. nucleic acids (100 !l of supernatant) were extracted using the biosprint 96 authomatic system (qiagen) with the biosprint 96 one for all vet kit (qiagen) according to the manufacturers’ instructions. ten !l of armored rna west nile virus (hny1999) (asuragen, santa clara, ca, usa) diluted 1:100 were added to each sample as an internal control to check for any rt-pcr inhibition phenomena. monolayers of raw 264.7 infected with10-fold serial dilutions of mnv-1 were used for the devolopment of the rt-pcr assay and the ct value was < 40. the master mix was prepared by using rna ultrasense one-step qrt-pcr system (invitrogen, carlsbad, ca, usa) as reported in table 1. table 1. composition of master mix. reagent c1 a c2 b vol (μl) h2o 5x 1.100 5x ultrasense reaction mix 50x 1x 4.000 rox reference dye (50x) 4.0 μm 1x 0.500 mnv-f 4.0 μm 200 nm 1.000 mnv-r 4.0 μm 200 nm 1.000 mnv-p 20 μm 200 nm 1.000 ns5-2 50 μm 80 nm 0.188 ns5-2f 50 μm 150 nm 0.100 ns5-2r 150 nm 0.100 rna ultrasense enzyme mix 1.000 total 10.0 a c1: initial concentration b c2: final concentration a primer and probe set was selected according to baert et al. (2008). the sequence of primer pairs and probes was as follows: for mnv-1, the probe was 5’fam-cgc ttt gga aca atg-3’mgb (mnv-p), the primer fw was 5’-cac gcc acc gat ctg ttc tg-3’ (mnv-f) and the primer rev was 5’-gcg ctg cgc cat cac tc-3’ (mnv-r); for hny1999, the probe was 5’vic-cca acg cca ttt gct ccg ctg-3’tam (ns5-2), the primer fw was 5’-gaa gag acc tgc ggc tca tg-3’ (ns5-2f) and the primer rev was 5’-cgg tag gga ccc aat tca ca-3’ (ns5-2r). all the primers and probes were purchased from eurofins mwg operon (louisville, usa). ten !l of master mix and 10 !l of viral rna were used for rt-pcr. the assay was performed on a 7900ht fast real-time pcr system (applied biosystems, foster city, ca, usa) at the following thermal conditions: 50°c for 15 min – 95°c for 2 min – 40 cycles (95°c for 15 sec – 60°c for 1 min). the analytical sensitivity of rt-pcr was tested analyzing the serial log10 dilutions of the mnv-1 tissue culture 105.9 tcid50/ml. ital. j. food sci., vol. 32, 2020 129 2.5. statistical analysis the pearson correlation coefficient with confidence intervals of 95% was used to measure the association between time and viral titer. 3. results and discussion the presence of mnv-1 in the artificially contaminated clams was observed by tissue culture assay just after 24 hours of exposure, even if the rt-pcr results showed that an interval of 72 hours was the optimum for the viral contamination because the values increased from 103.60 (24 hours) to 106.60 tcid50/ml (72 hours). the analytical sensitivity of rt-pcr resulted 100.9 tcid50/ml corresponding to 38 ct value (data not shown). the results of the different experiments of the depuration process carried out by the tissue culture assay showed values of 3.98x104 tcid50/ml for trial a and 1.48x104 tcid50/ml for the remaining trials. the viral titer did not vary among the 4 trials, because mnv-1 resulted always vital. the results of rt-pcr ranged from 103.17 to 104.60 tcid50/ml (data not shown). the pearson correlation coefficient was -0.15 (lower limit = -0.55 and upper limit = 0.29) and therefore not significant. a similar study was carried out by polo et al. (2014b) in samples of clams (venerupis philippinarum) and mussels (mytilus galloprovincialis) contaminated with mnv-1 and then depurated for 7 days by means of ozone and uv-c radiation for water sterilization. the average reductions compared with the initial levels of mnv-1 were 60.5% for clams and 91.6% for mussels, but they remained still infectious at the end of the process. polo et al. (2014a) as well found the presence of norovirus in clams and mussels after a depuration process based on water treatment by chlorination. the efficacy of depuration using traditional or closed-circuit system with disinfection by uv was evaluated by savini et al. (2009), which reported no statistically significant differences between depurated and non-depurated samples (i.e. m. galloprovincialis, tapes decussatus and crassostrea gigas) and indicated that the process was not able to remove norovirus. other studies (leal diego et al., 2013; imamura et al., 2016) showed the failure of depuration process applied on oyster samples using a system based on uv. these results demonstrated that the water exchange could be low and the initial contamination was too high (le mennec et al., 2017). therefore, some measures such as the increasing of depuration time and water circulation as well as the continuous exposure to uv treatment could be able to improve the effectiveness of the process. souza et al. (2013) detected mnv-1 in oysters until 96 hours of depuration in a closed system using different uv doses. the presence of mnv-1 after the depuration process described in the present study demonstrated that these viruses can survive and accumulate in live bivalve mollusks, and therefore they represent a source of foodborne disease for consumers. recent studies showed that norovirus strains can selectively accumulate in mollusks due to viral carbohydrate ligands of histo-blood group such as antigens in various tissues of clams, mussels and oysters (polo et al., 2014a; mcleod et al., 2017). therefore, the elimination of norovirus can be difficult using traditional decontamination treatments, because the virus is internalized within the cells of the digestive organs and other tissues of mollusks (kim et al., 2017). ital. j. food sci., vol. 32, 2020 130 according to the report of efsa and ecdc (2017), during 2010-2016 the number of reported foodborne outbreaks linked to calicivirus (including norovirus) was quite stable, with some differences among the eu member states. in particular, a statistically significant increasing trend was described in belgium, france, portugal and the netherlands, while austria, denmark, estonia and hungary reported a decrease. a national information system, called sinzoo was developed in italy aiming at the collection of data regarding food contamination and related zoonoses occurrence (colangeli et al., 2013). such a system highlighted 12 positive out of 176 mollusk samples, even if no outbreak linked to norovirus was described in the year 2017. the monitoring of viral contamination of mollusks represents an important tool for public health, especially because no legislative standards have been established for viruses. however, according to regulation ec no 853/2004 (ec, 2004b), each eu member state may adopt national measures in order to amend non essential elements such as additional health standards for live bivalve mollusks in cooperation with the relevant community reference laboratory, including virus testing procedures and virological standards. the multi-annual regional control plan for both abruzzo and molise regions (ppric 20152018) established sampling of mollusks every 2 months for e. coli and salmonella spp., and every 6 months for viruses. 4. conclusions the consumption of live bivalve mollusks collected from seawater contaminated with sewage pollution, due to malfunctioning of sewerage system, represents an important risk for human health. in this study, no significant viral reduction was observed, the closedcircuit depuration system was not able to reduce the level of mnv-1 and clams remained still infectious until the end of the experimental design. therefore, the ingestion of raw or undercooked mollusks should be avoided expecially by some population categories, such as immunocompromised individuals. acknowledgements the authors thank prof. francesca rosati (sworn translator) for her support in checking the manuscript for english form. this work was carried out with the financial support of the ministry of health; “ricerca corrente” year 2010; research project code: izsam 04/10 rc. references baert l., wobus c. e., van coillie e., thackray l. b., debevere j. and uyttrndaele m. 2008. detection of murine norovirus 1 by using plaque assay, transfection assay, and real-time reverse transcription-pcr before and after heat exposure. appl. environ. microbiol. 74(2):543-546. campos c.j.a., goblick g., lee r., wittamore k. and lees d.n. 2017. determining the zone of impact of norovirus contamination in shellfish production areas through microbiological monitoring and hydrographic analysis. water res. 124:556-565. chan m.c.w., hu y., chen h., podkolzin a.t., zaytseva e.v., komano j. et al. 2017. global spread of norovirus gii.17 kawasaki 308, 2014-2016. emerg. infect. dis. 23(8), 1350-1354. cheng h.y., hung m.n., chen w.c., lo y.c., su y.s., wei h.y. et al. 2017. ice-associated norovirus outbreak predominantly caused by gii.17 in taiwan, 2015. bmc public health 17(870):1-8. ital. j. food sci., vol. 32, 2020 131 colangeli p., iannetti s., ruocco l., forlizzi l., cioci d. and calistri p. 2013. the italian information system on zoonoses data collection. zoonoses public health. 60(2):182-188. ec 2004a. commission regulation (ec) no 854/2004 of the european parliament and of the council of 29 april 2004 laying down specific hygiene rules for food of animal origin. off. j. eur. union l226:83-127. ec 2004b. commission regulation (ec) no 853/2004 of the european parliament and of the council of 29 april 2004 laying down specific hygiene rules for on the hygiene of foodstuffs. off. j. eur. union l226:22-82. ec 2005. commission regulation (ec) no 2073/2005 of 15 november 2005 on microbiological criteria for foodstuffs. off. j. eur. union l338:1-26. efsa (european food safety authority) and ecdc (european centre for disease, prevention and control) 2017. the european union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2016. efsa j., 15(12), 5077:1-228. fusco g., di bartolo i., cioffi b., ianiro g., palermo p., monini m. and amoroso m.g. 2017. prevalence of foodborne viruses in mussels in southern italy. food environ. virol. 9(2):187-194. hassard f., sharp j. h., taft h., levay l., harris j.p., mcdonald j.e. et al. 2017. critical review on the public health impact of norovirus contamination in shellfish and the environment: a uk perspective. food environ. virol. 9:123-141. ilic n., velebit b., teodorovic v., djordjevic v., karabasil n., vasilev d., djuric s., adzic b. and dimitrijevic m. 2017. influence of environmental conditions on norovirus presence in mussels harvested in montenegro. food environ. virol. 9(4):406-414. imamura s., haruna m., goshima t., kanezashi h., okada t. and akimoto k. 2016. application of next-generation sequencing to evaluate the profile of noroviruses in preand post-depurated oysters. foodborne pathog. dis. 13(10):559565. jeon s.b., seo d.j., oh h., kingsley d.h. and choi c. 2017. development of one-step reverse transcription loop-mediated isothermal amplification for norovirus detection in oysters. food control 73:1002-1009. kim s.h., shahbaz h.m., park d., chun s., lee w., oh j.w., lee d.u. and park j. 2017. a combined treatment of uvassisted tio2 photocatalysis and high hydrostatic pressure to inactivate internalized murine norovirus. innov. food sci. emerg. 39:188-196. le mennec c., pamaudeaus s., rumebe m., le saux j.c., piquet j.c. and le guyader s.f. 2017. follow-up of norovirus contamination in an oyster production area linked to repeated outbreaks. food environ. virol. 9(1):54-61. leal diego a.g., dores ramos a.p., marques souza d.s., durigan m., greinert-goulart j.a., moresco v. et al. 2013. sanitary quality of edible bivalve mollusks in southeastern brazil using an uv based depuration system. ocean coast. manage. 72:93-100. leroux-roels g., cramer j.p., mendelman p.m., sherwood j., clemens r., aerssens a. et al. 2018. safety and immunogenicity of different formulations of norovirus vaccine candidate in healthy adults: a randomized, controlled, double-blind clinical trial. j. infect. dis. 217(4):597-607. mcleod c., polo d., le saux j.c. and le guyader f.s. 2017. depuration and relaying: a review on potential removal of norovirus from oysters. compr. rev. food sci. f. 16:692-706. papapanagiotou e.p. 2017. foodborne norovirus state of affairs in the eu rapid alert system for food and feed. vet. sci. 4:61. ppric 2015-2018. piano pluriennale regionale integrato dei controlli della sanità pubblica veterinaria e sicurezza alimentare della regione abruzzo 2015–2018. 3rd edn. 1-892. polo d., álvarez c., díez j., darriba s., longa á. and romalde j.l. 2014a. viral elimination during commercial depuration of shellfish. food control 43:206-212. polo d., feal x., varela m.f., monteagudo a. and romalde j.l. 2014b. depuration kinetics of murine norovirus in shellfish. food res. int. 64:182-187. predmore a., sanglay g., li j. and lee k. 2015. control of human norovirus surrogates in fresh foods by gaseous ozone and a proposed mechanism of inactivation. food microbiol. 50:118-125. ital. j. food sci., vol. 32, 2020 132 reed l.j. and müench h. 1938. a simple method of estimating fifty per cent endpoints. am. j. epidemiol. 27:493-497. savini g., casaccia c., barile n.b., paoletti m. and pinoni c. 2009. norovirus in bivalve molluscs: a study of the efficacy of the depuration system. veterinaria italiana 45(4):535-539. souza d.s.m., piazza r.s., pilotto m.r., nascimento m.a., moresco v., taniguchi s. et al. 2013. virus, protozoa and organic compounds decay in depurated oysters. int. j. food microbiol. 167(3):337-345. suffredini e., iaconelli m., equestre m., valdazo-gonzález b., ciccaglione a.r., marcantonio c., della libera s., bignami f. and la rosa g. 2018. genetic diversity among genogroup ii noroviruses and progressive emergence of gii.17 in wastewaters in italy (2011-2016) revealed by next-generation and sanger sequencing. food environ. virol. 10(2):141-150. trivedi t.k., desai r., hall a.j., patel m., parashar u.d. and lopman b.a. 2013. clinical characteristics of norovirusassociated deaths: a systematic literature review. am. j. infect. control 41:654-657. varela m.f., polo d. and romalde j.l. 2016. prevalence and genetic diversity of human sapoviruses in shellfish from commercial production areas in galicia, spain. appl. environ. microbiol. 82(4):1167-1172. paper received january 18, 2019 accepted september 19, 2019 ijfs#1187_bozza ital. j. food sci., vol. 30, 2018 707 paper comparison of the fatty acid profile in the meat of pigs and wild boars k. stasiak*a, a. roślewskaa, m. staneka, h. jankowiakb, d. cygan-szczegielniaka and m. bocianb adivision of biochemistry and toxicology, faculty of animal breeding and biology, utp university of science and technology, mazowiecka 28, 85-084 bydgoszcz, poland bdepartment of pig breeding and horses, department of animal breeding and biology, utp university of science and technology, mazowiecka 28, 85-084 bydgoszcz, poland *correspomding author: tel.: +48 523749729, fax: +48 523228158 e-mail address: stasiak@utp.edu.pl abstract the aim of the study was to compare the fatty acid profile of the longissimus lumborum muscle from organically raised pigs: 20 samples from złotnicka spotted pigs, 20 samples from f1 crossbred pigs (polish large white x polish landrace) and 16 samples from wild boar. the content of saturated fatty acids in the meat of animals from all the groups was similar. statistically significant differences were calculated for monounsaturated fatty acids and polyunsaturated fatty acids. the meat of wild boar had the highest content of arachidonic acid but the lowest content of palmitoleic acid, oleic acid and α-linolenic acid. keywords: fatty acid profile, meat, pigs, wild boar ital. j. food sci., vol. 30, 2018 708 1. introduction due to its content of many nutrients, meat plays an important role in the human diet. meat provides our bodies with high value protein, essential amino acids, as well as trace elements, b-group and antioxidant vitamins and fatty acids (fa). the composition of fatty acids, especially the ratio of polyunsaturated fatty acids (pufa) to saturated fatty acids (sfa), is significant for human health (strazdina et al., 2013). according to serrano et al. (2007), saturated fatty acids are regarded as the cause of cardiovascular diseases, as they increase blood pressure and the concentration of the ldl fraction of cholesterol, while monounsaturated fatty acids (mufa) and polyunsaturated fatty acids (pufa) decrease the concentration of bad cholesterol (ldl) and increase the concentration of the good cholesterol (hdl), which results in reducing the risk of heart diseases and atherosclerosis (garcia rebollo et al., 1998; gerhard et al. ,2004). compared to beef, pork is characterised by a favourable fatty acid profile, i.e. lower sfa content and higher pufa content. in comparison with poultry meat, pork (despite a lower total pufa content) shows a much more beneficial n-6 to n-3 fatty acids ratio (blicharski et al., 2013; ivanović et al., 2013). recently, more and more consumers have been paying attention not only to the quality and safety of food, but also to the environmental aspects of its production. the main regulations regarding organic food production are included in the following legal acts: council regulation (ec) no. 834/2007 and regulation (ec) no. 889/2008. according to these regulations, livestock should be fed with plant feeds and feed produced in accordance with the principles of organic farming. at the same time, the laws take into account the possibility of using additives containing some trace elements, vitamins and minerals (sundrum et al., 2000). in organic farms, plant protection products or veterinary medicines should not be used. organically raised animals are fed diets without synthetic additives and gmo preparations. these requirements undoubtedly affect the quality of the product obtained. the meat quality of domestic animals, which were bred in natural conditions means greater food safety for the consumer (skobrák et al., 2011). according to grela and kowalczuk (2009), organic meat products derived from fattening pigs are characterised by a higher content of nutrients. pork obtained from pigs reared in the organic system contains higher amounts of intramuscular fat and more unsaturated fatty acids (angood et al., 2008; sundrum et al., 2000; hansen et al., 2006). in turn, the main source of feed for wild boar living in their natural habitats is plants (grasses, leaves, roots, shrubs, seeds, forest fruits) and, less frequently, avian eggs, snails, insects, earthworms, larvae and beetles (skobrák et al., 2011; rozmaite et al., 2012). due to the natural environment in which wild animals live, venison is often defined as an organic food. the aim of the study was to compare the fatty acid profile of the longissimus lumborum muscle from organically raised złotnicka spotted and f1 crossbred pigs (polish large white × polish landrace) and from wild boar. 2. materials and methods 2.1. animals the study used 20 złotnicka spotted pigs, 20 f1 crossbred pigs (polish large white × polish landrace) and 16 wild boar (hogs and gilts in equal amounts). in each group, the gender ratio of the tested animals was close to 1:1. the pigs originated from an organic ital. j. food sci., vol. 30, 2018 709 farm in the kujawsko-pomorskie province, where they were fed a diet containing 12.6 mj metabolisable energy and 156 g total protein. the feed was comprised of 25% triticale, 20% rye, 10% barley, 10% wheat, 10% oats, 10% lupin, 5% pea, 5% rapeseed and 5% vitaminmineral mixture. the piggery met all the conditions of welfare defined by polish law (regulation of the minister of agriculture and rural development, 2010). at the end of fattening, when złotnicka spotted pigs reached 106.2±3.66 kg of body weight (aged 5.5-6 month) and f1 crosses reached 114.25±2.59 kg (aged 6.5-7 month), the animals were slaughtered under uniform standard production conditions in accordance with polish law and standards in place. from the right halves of the carcasses, samples of the longissimus lumborum muscle were collected (between the 1st and the 4th lumbar vertebra). in turn, two-year-old wild boar (weighing 38-60 kg on average) were shot in the podkarpackie province during the hunting season by different hunters, in accordance with regulation no. 45 and no. 48 of the minister of the environment. the samples were removed from the longissimus lumborum approximately at the level of the 1-2 lumbar vertebra of the carcasses. local hunters provided all samples within 24 hours after shooting. 2.2. samples and fatty acid analysis for further analyses, samples were placed in sterile, tightly sealed bags, chilled to 4°c and transported to a laboratory. after freeze-drying (lyovac gt2, finn-aqua), the samples were analysed for fatty acids through extraction with a chloroform and methanol solution in accordance with the method described by folch et al. (1956). the fatty acid profile of methyl esters was determined by gas chromatography (varian 3800 gc, usa) with a flame ionisation detector, using a supelcowax 10 column (30 m × 0.32 mm × 0.25 μm). the temperature of the injector was 230°c, and that of the detector was 250°c. the volume of the injected sample was 1µl (split 1:50). the carrier gas was helium at a flow rate of 1.5 cm3min-1. the analyses were performed at a temperature range of 90 to 225°c (11°c min-1), 225°c for 6 min, and then an increase from 225 to 240°c (6°c min-1) and 240°c for 19 min. the fatty acid methyl esters were identified with supelco pufa-2 animal source and supelco 37 component fame mix standards (supelco, usa). the composition of fatty acids was expressed as a percentage of total fatty acids. in addition, the indices of fatty acid metabolism were specified. the elongase index was calculated as the ratio of c18:0 to c16:0. the thioesterase index was calculated as the ratio of c16:0 to myristic acid (c14:0). the 9-desaturase index was calculated as 100 times the ratio of the palmitoleic acid (c16:1) percentage to the sum of acids: c16:1 and c16:0. the 9desaturase index was calculated as 100 times the ratio of oleic acid (c18:1) to the sum of acids: c18:1 and c18:0 (zhang et al., 2007). 2.3. statistical analysis the results were statistically analysed with statistica 8.0, and the means and standard deviations are provided in the table. one-way analysis of variance (anova) and the posthoc scheffe test were used to compare the proportion of different fatty acids in the longissimus lumborum muscle of the animals. the normality of data distribution and the homogeneity of variance were tested with the shapiro-wilk and levene tests, respectively. the correlations between the analysed fatty acids were determined based on the coefficients of pearson’s correlation. differences were considered significant at p < 0.05. ital. j. food sci., vol. 30, 2018 710 3. results and discussion the percentage of different fatty acids in the longissimus lumborum muscle of the animals, depending on genetic type and species, is presented in table 1. table 1. fatty acid profile (% of total fa) of fat from the m. longissimus lumborum of the studied animals. zs plw x pl wild boar n=20 n=20 n=16 c14:0 1.02±0.21a 1.26±0.27a 1.80±0.39b c16:0 26.88±1.48a,b 28.22±0.91a 25.14±4.21b c18:0 14.91±2.82a 13.29±1.60a 15.36±0.85a c16:1 n7 3.05±0.45a 3.64±0.74c 1.30±0.68b c18:1 n9 41.65±2.58a 40.76±3.38a 31.59±6.17b c18:3 n3 2.09±0.66a 2.03±0.59a 0.79±0.16b c20:4 n6 10.40±1.87a 10.80±2.99a 24.01±3.15b sfa 42.81±3.50a 42.78±0.95a 42.31±3.93a mufa 44.70±2.81a 44.40±3.90a 32.90±5.77b pufa 12.48±2.34a 12.83±3.36a 24.80±3.10b n3/n6 0.20±0.05a 0.19±0.05a 0.03±0.01b n6/n3 5.34±1.46a 5.62±1.87a 32.03±9.89b thioesterase index1 27.07±4.35a 23.23±4.63a 14.88±5.24b elongase index2 0.55±0.10a,b 0.47±0.07a 0.63±0.12a ʌ9 desaturase (c16) index3 10.10±1.35a 11.35±1.88a 4.74±1.95b ʌ9 desaturase (c18) index4 73.69±4.48a 75.32±3.52a 66.79±4.27b results were expressed as means±sd. values marked in the same row with different letters (a,b) are statistical significantly different at p < 0.05. sfa, mufa, pufa, n6, n3 = sum of all saturated (sfa), monounsaturated (mufa), polyunsaturated (pufa), n6 and n3 fatty acids, zs złotnicka spotted pigs, plw x pl crossbred pigs (polish large white × polish landrace), 1calculated as 16:0/14:0, 2calculated as 18:0/16:0, 3calculated as 100 × [16:1n-9/(16:1n-9 + 16:0)], 4calculated as 100 × [18:1n-9/(18:1n-9 + 18:0)] among saturated fatty acids (sfa), the presence of myristic (c14:0), palmitic (c16:0) and stearic acids (c18:0) was found. compared to pig muscle, the wild boar muscle had a significantly highest content of c14:0 (approx. 1.8%). in turn, the muscle of plw x pl crossbreeds contained statistically more c16:0 acid than wild boar muscle (approx. 3.08%). unlike jankowiak et al. (2010), the present statistical analysis showed no significant differences in the content of palmitic acid between the meat of złotnicka spotted pigs and f1 crossbreeds (plw × pl). despite the differences in the content of individual fatty acids, the total sfa in the meat of the animals in each group did not exceed 43%. the obtained result was confirmed in the studies of other authors (petrović et al., 2014; grela and kowalczuk, 2009). while sfa content remained at the same level in all the groups, considerable differences occurred in the group of monounsaturated fatty acids (mufa). the lowest concentration of mufa was observed in wild boar muscle, in which the content of palmitoleic (c16:1 n7) and oleic acids (c18:1 n9) differed significantly from that determined for the pig muscle from both study groups. compared to other authors, the content of acids (c16:1 n7 and ital. j. food sci., vol. 30, 2018 711 c18:1 n9) determined in the present study was very similar, although the content of mufa was lower by 4.81% for organically raised pigs (grela and kowalczuk, 2009) and by 3.9% for wild boar (ivanović et al., 2013). this difference is caused by the presence of additional acids (c18:1 n7). the highest total pufa (24.8% of all fatty acids) was determined in wild boar muscle. this value was confirmed in the research of other authors (sales and kotrba, 2008). the high level of these acids translates into an appropriate pufa/sfa ratio, which, according to wood et al. (2003), should exceed 0.4. for wild boar muscle, this ratio is 0.5861. the present level was slightly lower than published by dannenberger et al. (2013) for wild boar living in the northern part of germany (0.65÷1.05). in our study, the content of pufa in wild boar meat was twice as high as the values obtained for the muscles of the pigs from both study groups. their pufa level was similar to the values published by cebulska et al. (2018), for złotnicka spotted pigs, and by grześkowiak et al. (2010), who determined the fatty acid profile of the muscle of polish landrace × polish large white pigs. in the present study, arachidonic acid (c20:4 n6) showed the highest percentage among pufa. likely, the high content of c20:4 n6 is due to the absence of c18: 2 n6. this was significantly higher in wild boar muscle compared to pig muscle. statistical analysis did not reveal significant differences in the content of this acid between the meat from złotnicka spotted and plw × pl pigs. the second determined pufa acid was αlinolenic acid (c18:3 n3; ala). the muscles of pigs from both study groups contained similar amounts of this acid, which formed approx. 2% of total fatty acids. in contrast, the wild boar meat was less abundant in this acid (only 0.79%). in comparison with other authors, the ala acid content determined in our own research was higher. according to pedrazzoli et al. (2017), meat of wild boars up to 2 years should contain on average 1.47% of this acid (0.62% more than in the muscle of pigs), while the meat of older wild boars only 0.99% (0.2% more than in the present study). the ala (α-linolenic acid, c18: 3 n3) and la (linoleic; c18: 2 n6) acids supplied with food may undergo enzymatic transformation. elongase enzymes lengthen carbon chains, and desaturases produce additional double bonds, resulting in the formation of polyunsaturated fatty acids with lengths of at least 20 c atoms (achremowicz and szary-sworst, 2005). in fatty acid synthesis, thioesterase is responsible for terminating the reaction and releasing the newly synthesised fatty acid. the thioesterase index (c16:0/c14:0), which indicates a catalysis of palmitic acid synthesis from miristic, was higher (p < 0.05) in pig muscle than in wild boar, while the elongase index, as an indicator of c18:0 synthesis from c16:0 (c18:0/c16:0), remained at the same level (0.47-0.63) in all the groups. ʌ9-desaturase catalyses the conversion of c16:0 and c18:0 to c16:1 and c18:1, the 2 major mufa of pork lipids. greater index values mean greater desaturase activity. the highest ʌ9 -desaturase (c16) and (c18) indexes were found in pig muscle. these results agree with those obtained by daza et.al. (2017) and zhang et al. (2007). between the analysed fatty acids, 11 correlations were found for the meat of zs pigs and 16 correlations for the meat of plw × pl pigs. statistically significant relationships recurred between myristic acid and palmitic, palmitoleic and arachidonic acids, between palmitoleic acid and stearic and oleic acids, and between stearic acid and oleic and arachidonic acids (tables 2-3). ital. j. food sci., vol. 30, 2018 712 table 2. coefficients of correlation (rxy) between fatty acids determined in the m. longissimus lumborum of zs pigs. c16:0 0.81* c16:1 0.56* 0.18 c18:0 –0.22 0.21 –0.57* c18:1 –0.10 –0.45* 0.43* –0.68* c18:3 0.05 –0.16 –0.02 –0.40* –0.19 c20:4 –0.44* –0.56* –0.19 –0.43* –0.02 0.64* c14:0 c16:0 c16:1 c18:0 c18:1 c18:3 * significant at p < 0.05 table 3. coefficients of correlation (rxy) between fatty acids determined in the m. longissimus lumborum of f1 crossbred pigs (plw × pl). c16:0 0.77* c16:1 0.82* 0.66* c18:0 –0.81* –0.77* –0.95* c18:1 0.63* 0.38 0.65* –0.67* c18:3 –0.87* –0.50 –0.58* 0.57 –0.61* c20:4 –0.63* –0.45 –0.63* 0.64* –0.98* 0.56 c14:0 c16:0 c16:1 c18:0 c18:1 c18:3 * significant at p < 0.05 contrary to pig meat, only 5 correlations were found for wild boar meat (table 4). the only correlation shared by the analysed fatty acids for all study groups was a negative correlation between palmitoleic acid and stearic acid (r= -0.57 for zs; r= -0.95 for plw × pl; r= -0.76 for wild boar; p < 0.05). table 4. coefficients of correlation (rxy) between fatty acids determined in the m. longissimus lumborum of wild boar. c16:0 –0.15 c16:1 0.10 0.73* c18:0 –0.27 –0.34 –0.76* c18:1 0.23 –0.90* –0.63* 0.29 c18:3 0.05 0.02 –0.01 0.25 0.10 c20:4 –0.33 0.38 0.24 –0.20 –0.74* –0.35 c14:0 c16:0 c16:1 c18:0 c18:1 c18:3 * significant at p < 0.05 to ensure normal function of the human body, it is particularly important to maintain the proper pufa n6 to pufa n3 ratio, which should range between 1:1 and 4:1 (simopoulos, 2002). in both pig groups under study, this ratio was slightly higher (5.3:1 ital. j. food sci., vol. 30, 2018 713 and 5.6:1), while in the case of wild boar muscle, it was by the highest (32.03:1). according to marciniak-łukasik (2011), excess n6 fatty acids in the diet inhibits the metabolism of n3 fatty acids, which disrupts the physiological balance of the biologically active compounds obtained from them. 4. conclusions wild boar meat does not differ significantly in sfa content from the meat of organically raised pigs of the zs breed and f1 crossbreds (plw × pl). statistically significant differences were noted in the mufa and pufa content. wild boar muscle proved the richest in polyunsaturated fatty acids. the appropriate amounts of individual fatty acids determined in the pig muscles translate into a more health-promoting ratio of n6 to n3 acids. the n6 to n3 fatty acids ratio determined in wild boar muscle was the highest, but the least desirable. references achremowicz k. and szary-sworst k. 2005. polyunsaturated fatty acids as human health improvers. żywność. nauka. technologia. jakość. 3:23-35. angood k.m., wood j.d., nute g.r., whittington f.m., hughes s.i. and sheard p.r. 2008. a comparison of organic and conventionally-produced lamb purchased from three major uk supermarkets: price, eating quality and fatty acid composition. meat sci. 78: 176-184 blicharski t. książek p., pospiech e., migdał w., jóźwik a., poławska e. and lisiak e. 2013 the current dietary value of pork, its importance in diet and its impact on consumers health (in polish) polsus warsaw cebulska a., václavková e., bocian m., dybała j., wiśniewska j. and kapelański w. 2018. quality and dietary value of pork meat of the puławska and złotnicka spotted breeds, and commercial fattening pigs*. ann.anim. sci., 18 (1): 281-291 dannenberger d., nuernberg g., nuernberg k. and hagemann e. 2013. the effects of gender, age and region on macro and micronutrient contents and fatty acid profiles in the muscles of roe deer and wild boar in mecklenburg-western pomerania (germany). meat science. 94:39-46, doi: doi.org/10.1016/j.meatsci.2012.12.010 daza a., olivares a., latorre m.a., rey a.i. callejo a. and lópez bote c.j. 2017. fatty acid composition of different adipose tissues in heavy pigs. ital. j. food sci. 29: 657-666. folch j., lees m. and stanley g.h.s. 1956 a simple method for the isolation and purification of total lipids from animal tissues. j. biol. chem., 226:497-509. garcia rebollo a.j., macia botejara e., ortiz cansado a., morales blanco p.j., martin bellido m., fallola sánchez a., mena arias p. and campillo alvarez j.e. 1998. effects of consumption of meat product rich in monounsaturated fatty acids (the ham from the iberian pig) on plasma lipids. nunition research, 18(4): 743-750 gerhard g.t., ahmann a. and meeuws k. 2004. effect of a low-fat diet compared with those of a high-monounsaturated fat diet on body weight, plasma lipids and lipoproteins, and glycemic control in type 2 diabetes, am. j. clin nutr, 80(3): 668-673 grela e. and kowalczuk e. 2009. content of nutrients and fatty acid composition in meat composition in meat and porkbutcher’s meat from organic pig production, żywność. nauka. technologia. jakość. 4:34-40 grześkowiak e., borzuta k., lisiak d., strzelecki j. and janiszewski p. 2010. physical-chemical and sensory properties, as well as composition of fatty acids in longissimus dorsi muscle of pl x plw and pl x (d x p) pig cross breeds. żywność. nauka. technologia. jakość. 6:189 – 198. hansen l.l., claudi-magnussen c., jensen s.k. and andersen h.j. 2006. effect of organic pig production systems on performance and meat quality. meat sci. 74: 605-615, doi: doi.org/10.1016/j.meatsci.2006.02.014 ivanović s.d., stojanović z.m., popov-raljic j.v., baltić m.ž., pisinov b.p. and nešić k.d. 2013. meat quality characteristics of duroc x yorkshire, duroc x yorkshire x wild boar and wild boar, hem. ind., 67:999-1006. ital. j. food sci., vol. 30, 2018 714 jankowiak h., bocian m., kapelański w. and roślewska a. 2010. the relationship between carcass fatness and intramusculat fat content, and fatty acids profile in pig meat. żywność. nauka. technologia. jakość. 6:199 – 208 marciniak-łukasiak k. 2011. the role and significance of omega 3 fatty acids. żywność. nauka. technologia. jakość. 6:24-35 pedrazzoli m., dal bosco a., castellini c., ranucci d., mattioli s., pauselli m. and roscini v. 2017. effect of age and feeding area in meat quality of wild boars. ital. j. anim. sci. 16 (3): 353-362, doi: doi.org/10.1080/1828051x.2017.1292114 petrović m., wähner m., radović č., radojković d., parunović n., savić r. and brkić n. 2014. fatty acid profile of m.longissimus dorsi of mangalitsa and moravka pig breeds. archiv tierzucht, 57:1-12, doi: doi.org/10.7482/0003-943857-017 piotrowska a., świąder k., waszkiewicz-robak b. and świderski f. 2012. possibilities to produce pork meat and pork meat products with increased content of n-3 polyunsaturated fatty acids. żywność. nauka. technologia. jakość. 5:5-19. doi: doi.org/10.15193/zntj/2012/84/005-019 razmaite v., švirmickas g.j. and šiukščius a. 2012. effect of weight, sex and hunting period on fatty acid composition of intramuscular and subcutaneous fat from wild boar. ital. j. anim. sci., 11:174-179, doi: doi.org/10.4081/ijas.2012.e32 rozporządzenie ministra środowiska z dnia 11 marca 2005 r. w sprawie ustalenia listy gatunków zwierząt łownych (dz.u. 2005 nr 45 poz. 433). available at: www.prawo.sejm.gov.pl/isap.nsf/docdetails.xsp?id=wdu20050450433 rozporządzenie ministra środowiska z dnia 16 marca 2005 r. w sprawie określenia okresów polowań na zwierzęta łowne (dz.u. 2005 nr 48 poz. 459). available at: www.prawo.sejm.gov.pl/isap.nsf/docdetails.xsp?id=wdu20050480459 rozporządzenie komisji (we) nr 889/2008 z dnia 5 września 2008 r. ustanawiające szczegółowe zasady wdrażania rozporządzenia rady (we) nr 834/2007 w sprawie produkcji ekologicznej i znakowania produktów ekologicznych w odniesieniu do produkcji ekologicznej, znakowania i kontroli. 2008. dz. urz. ue l 250: 1-118. available at: www.eurlex.europa.eu/lexuriserv/lexuriserv.do?uri=oj:l:2008:250:0001:0084:en:pdf rozporządzenie rady (we) nr 834/2007 z dnia 28 czerwca 2007 r. w sprawie produkcji ekologicznej i znakowania produktów ekologicznych i uchylające rozporządzenie (ewg) nr 2092/91. 2007. dz. urz. ue l 189: 1-23. available at: www.eur-lex.europa.eu/lexuriserv/lexuriserv.do?uri=oj:l:2007:189:0001:0023:en:pdf sales j. and kotrba r. 2013. meat from wild boar (sus scrofa l.): a review. meat science, 94(2):187-201, doi: doi.org/10.1016/j.meatsci.2013.01.012 serrano, a., librelotto, j., cofrades, s., sanchez-muniz, f. j. and jimenez-colmenero, f. 2007. composition and physicochemical characteristics of restructured beef steaks containing walnuts as affected by cooking method, meat science, 77(3), 304-313, doi: doi.org/10.1016/j.meatsci.2007.03.017 simopoulos a.p. 2002 . the importance of the ratio of omega-6/omega-3 essential fatty acids. biomed. pharmacother. 56: 365–379, doi: doi.org/10.1016/s0753-3322(02)00253-6 skobrák e.b., bodnár k., jónás e.m., gundel j. and jávor a. 2011. the comparison analysis of the main chemical composition parameters of wild boar meat and pork. animal science and biotechnologies, 44:105-112 strazdinav., jemeljanovs a., sterna v. and ikauniece d. 2013. nutrition value of deer, wild boar and beaver meat hunter in latvia. 2nd international conference on nutrition and food sciences ipcbee vol. 53, singapore. doi: 10.7763/ipcbee. 2013. v53. 14 sundrum a., bütfering l., henning m. and hoppenbrock k.h. 2000. effects of on-farm diets for organic pig production on performance and carcass quality. j. anim. sci. 78: 1199-1205. wood j.d., richardson r.i., nute g.r., fisher a.v., campo m.m., kasapidou e., sheard p.r. and enser m. 2003. effects of fatty acids on meat quality: a review. meat science. 66:21-32. doi: doi.org/10.1016/s0309-1740(03)00022-6. zhang, s., knight t.j., stalder k.j., goodwin r.n., lonergan s.m. and beitz d.c. 2007. effects of breed, sex, and halothane genotype on fatty acid composition of pork longissimus muscle. j. anim. sci. 85:583-591 doi: doi.org/10.2527/jas.2006-239 paper received march 6, 2018 accepted june 5, 2018 ijfs#1826_bozza ital. j. food sci., vol. 32, 2020 712 short communication occurrence of deoxynivalenol in beers commercialised in italy m. grumi, a. kunova, m. isotti, a. barbiroli and m. pasquali* defens, dipartimento di scienze per gli alimenti, la nutrizione e l’ambiente, università degli studi di milano, via celoria 2, 20133 milano, italy *corresponding author: matias.pasquali@unimi.it abstract deoxynivalenol (don) is the most frequently detected mycotoxin in beer. this study represents a comprehensive assessment of don occurrence in beers from the italian market. seventy-two craft and industrial beer samples were tested using the ridascreen don® elisa method. don was found in all samples. the average don contamination was 34.3 μg/l (range: 6.1 111.2 μg/l). the highest contamination level was found in a wheat-based sample. our study determined that wheat-based beers have a higher don contamination than barley-based beers. further studies are needed to verify the role of single ingredients on the risk of don accumulation in beers. keywords: consumption level, elisa, fermented beverage, food safety, mycotoxins, wheat ital. j. food sci., vol. 32, 2020 713 1. introduction deoxynivalenol (don) is one of the most frequently detected mycotoxins in cereals and cereal-based products (pedroso pereira et al., 2019). don belongs to type-b trichothecenes mycotoxins and it is mainly produced by fusarium graminearum and fusarium culmorum (pasquali et al., 2016). type-b trichothecenes involve don, its acetylated derivatives (3-acetyl-don and 15-acetyl-don) nivalenol, and deoxynivalenol-3-glucoside (d3g). d3g might be the result of plant metabolism of don or of some food processing operations (berthiller et al., 2013). although don and its derivatives are not classified as being carcinogenic to humans, an exposure to this type of mycotoxins may be associated with a wide range of adverse health complications (efsa contam panel, 2017). the main effect of deoxynivalenol is the inhibition of protein synthesis. this leads to acute gastro-intestinal symptoms (e.g. emesis and diarrhoea) as well as, in case of long-term exposure, to immune system diseases or disorders (pedroso pereira et al., 2019). considering its potential to cause serious health issues, the european commission established a range of maximum limits for don in cereals and cereal-based foods (ferrigo et al., 2016). in 2006, the european commission proposed the maximum level for don in cereals intended for direct human consumption of 750 μg/kg (efsa contam panel, 2017). the joint fao/who expert committee on food additives (jecfa) has also established a provisional maximum tolerable daily intake (pmtdi) of 1 μg/kg body weight for the sum of don and its derivatives (pedroso pereira et al., 2019). since don is largely detected in cereals and malt, which represent the key ingredients of beer, a don contamination of this type of alcoholic beverages seems unavoidable (rodríguez-carrasco et al., 2015). it is worth specifying that maximum levels for don in beer have not been set so far. monitoring don in beer is important considering that this widely popular fermented beverage may significantly contribute to the intake of mycotoxins and even exceed the safety levels when following a regular diet (papadopoulou-bouraoui et al., 2004; rodríguez-carrasco et al., 2015). therefore, exposure of consumers to don and its derivatives through beer consumption should not be underestimated, especially in case of “heavy drinkers” (pascari et al., 2018). the occurrence of deoxynivalenol in beer has been studied in various surveys all around the world: in belgium (papadopoulou-bouraoui et al., 2004), in poland (kuzdraliński et al., 2013), in austria, hungary, croatia and serbia (varga et al., 2013), in spain (rodríguez-carrasco et al., 2015), in brazil (piacentini et al., 2015), in germany (bauer et al., 2016), in paraguay (arrúa et al., 2019) and in mexico (wallmartínez et al., 2019 b). occurrence of don in beers from the italian market was assessed in two surveys with limited number of samples: by pietri et al. (2003) and by peters et al., (2017). the surveys showed that the small number of italian samples analysed, compared with samples produced in other countries, had the lowest don contamination levels (below than 10 μg/l). in 2018 the italian beer consumption increased by 3.2%. therefore, per capita consumption reached its historical peak of 33.6 l a year (assobirra, 2018). considering both the limited number of surveys focusing on the occurrence of don in beers purchased from the italian market and the significant raise of italian craft breweries the aims of this work were: 1. to assess the level of deoxynivalenol in beer samples sold on the italian market from may 2018 to december 2018 in order to update and enrich the available data; ital. j. food sci., vol. 32, 2020 714 2. to compare the contamination of industrial beers to craft beers, taking into account the findings of peters et al., 2017 who identified higher don incidence in craft beers collected all over europe; 3. to define whether wheat-based beers had higher don contamination compared to barley based beers. 2. materials and methods seventy-two beer samples were purchased from may to december 2018 in pubs, supermarkets and beer shops located in the north of italy. some of them were home brewed from semi-processed products. most samples (53) were produced by italian companies whereas nineteen samples came from different european countries. the foreign beers were produced in germany (8), belgium (5), austria (1), czech republic (1), france (1), netherlands (1), sweden (1) and united kingdom (1). none of the beers exceeded their expiration date. 1.5 ml of each sample were placed in separate test tubes and stored at -80°c for at least 24 hours, in order to reach a complete degassed condition. 50 μl of co2-free samples were subjected to the analysis. the commercial competitive elisa ridascreen don® (r-biopharm ag, germany) was used. the declared detection limit of ridascreen don® is 3.7 ppb for beer samples, with a cross-reactivity to don (100%), 3-acetyldeoxynivalenol (>100%), 15-acetyldeoxynivalenol (approximatively 19%), nivalenol (approximatively 4%), fusarenon-x (<1%) and t-2 toxin (<1%). all reagents required for the analysis – including standards – were contained in the kit. the pbs-tween washing buffer was prepared by dissolving the provided salt in milli-q® ultra-pure water. the test procedure issued by the producer was strictly followed. results were obtained by reading sample or standard absorbances at 450 nm using a synergy (h1) microplate reader (biotek®, us) spectrophotometer. the absorbance was inversely proportional to the don concentration in the samples. absorbance was expressed as a percentage value with respect to the zero standard (100 × (absorbance sample or standard)/(absorbance zero standard)). the values calculated for the standards were entered in a system of coordinates on a semilogarithmic graph against the don concentrations (expressed in μg/l) using the online editor line of best fit generator “plot.ly” (plotly technologies, 2015). this allowed obtaining a calibration curve from which the don concentration, actually contained in all the samples, was defined. all samples were measured at least twice in each analysis. samples resulted off the chart were diluted using ultra-pure water, in ratio 1:2 and 1:5 and then reanalysed. the ph of each sample was also measured using an xs instruments® benchtop phmeter supplied with an automatic temperature compensation and a microelectrode that was fit for the low-volume samples. the statistical analysis was carried out using the statistical software jasp version 0.11.1 (jasp team, 2019). a linear regression was performed to assess relationship among don, ph and alcohol content values. furthermore, analysis of variance (anova) followed by bonferroni post hoc test was performed in order to determine the significance of fixed factors “wheat”, “type of brewing process” and “type of fermentation” on the don concentration. all tests were executed at a significance level of p<0.05. ital. j. food sci., vol. 32, 2020 715 3. results with reference to the whole collection of beer samples, 46 samples were classified as “craft beer” whereas 26 samples were classified as “industrial produced beer”. wheat was one of the ingredients in 21 samples. three of the selected samples were “gluten free” beers. the results of the analysis are summarised in table 1. table 1. samples description and results of the analysis. sample country of origin 1%abv type of fermentation type of brewing process wheat special features ph 2don (𝝁𝒈/𝑳) b1 germany 7.5 bottom industrial 4.66 46.9±7.2 b2 germany 5.3 top industrial 4.36 71.5±15.7 b3 germany 5.4 top industrial 4.40 35.6±3.3 b4 germany 5 bottom industrial 4.48 25.7±8.4 b5 germany 4.9 bottom industrial 4.49 43.3±9.6 b6 germany 5 top industrial yes 4.47 32.1±7.7 b7 germany 5 bottom industrial 4.50 57.2±19.5 b8 italy 4.7 top industrial 4.58 17.2±0.5 b9 italy 6.5 top craft yes 4.51 45.0±2.9 b10 italy 5.5 top craft 4.57 55.9±14.6 b11 italy 4.5 top craft yes 4.31 54.3±13.5 b12 italy 5 top craft yes 3.82 61.4±5.4 b13 italy 6.9 top craft yes 4.50 49.3±12.9 b14 italy 5.2 top craft yes 4.64 25.8±0.8 b15 italy 7.8 top craft 4.96 54.8±7.1 b16 italy 5.6 top craft 4.58 50.5±15.6 b17 italy 3.9 top craft 4.17 18.1±2.7 b18 italy 5 bottom industrial 4.93 18.6±10.2 b19 italy 4.5 bottom craft 4.43 19.9±7.3 b20 italy 5 bottom craft yes 4.64 44.5±17.8 b21 italy 6 top craft 4.64 18.4±2.1 b22 italy 4.5 top craft gluten free 4.50 17.8±8.8 b23 italy 5.6 top craft yes 4.46 20.7±0.6 b24 italy 5.6 top craft 4.36 13.1±2.1 b25 italy 4.7 bottom industrial 4.39 10.8±2.0 b26 italy 4.7 bottom industrial gluten free 4.66 6.1±0.1 b27 italy 5.5 bottom industrial 4.60 20.0±0.8 b28 italy 4.5 bottom industrial 4.59 16.1±1.2 b29 italy 4.7 bottom industrial 4.44 15.7±1.4 b30 italy 5 bottom industrial 4.72 22.7±0.7 b31 italy 5.5 top craft gluten free 4.53 13.1±1.7 b32 italy 7 top craft 4.31 95.8±5.7 b33 italy 5 top craft 4.41 31.9±1.0 b34 italy 0.49 n.d. industrial alcohol-free 4.83 9.5±0.4 ital. j. food sci., vol. 32, 2020 716 b35 italy 5 top craft yes 4.05 65.9±12.2 b36 belgium 4.9 top industrial yes 4.46 60.8±6.8 b37 italy 5 top industrial yes 4.19 76.3±9.6 b38 italy 5.1 bottom industrial 4.22 12.0±0.8 b39 belgium 8 top craft yes 4.40 27.8±4.0 b40 italy 5.2 bottom craft 4.80 10.7±0.5 b41 italy 4.6 bottom craft 4.55 22.3±3.2 b42 belgium 7.5 top industrial yes 4.77 50.7±7.1 b43 germany 12 top industrial yes 4.73 56.3±9.6 b44 italy 8 top industrial 4.62 36.4±7.9 b45 italy 8 bottom craft 4.70 80.3±2.1 b46 italy 7.5 bottom industrial 4.92 19.1±0.8 b47 nether-lands 6.5 top craft yes 4.35 37.6±15.3 b48 united kingdom 4.6 bottom craft 4.55 9.3±0.6 b49 italy 5.4 bottom craft 4.56 54.5±9.8 b50 italy 5 bottom craft 4.73 18.9±1.8 b51 belgium 9.5 top craft 4.36 24.3±8.4 b52 italy 8 top craft 4.80 24.1±14.1 b53 france 5.5 bottom industrial 4.43 12.7±3.1 b54 italy 9 top craft 4.67 10.1±0.2 b55 czech republic 4.4 bottom industrial 4.69 15.0±0.7 b56 belgium 6.5 spontaneous craft yes 3.45 111.2±14.1 b57 italy 6 top craft 4.66 10.3±1.3 b58 sweden 5 bottom craft yes 4.55 23.3±3.2 b59 italy 9 top craft 4.53 45.0±6.2 b60 italy 4.9 top craft 4.56 50.5±15.7 b61 italy 4.9 bottom craft 4.79 48.5±8.2 b62 italy 9.7 top craft 4.80 82.6±13.8 b63 italy 8.7 top craft 4.60 35.2±5.1 b64 italy 4.7 top craft 4.78 7.5±1.2 b65 italy 5.2 top craft yes 4.38 17.2±1.0 b66 italy 4.5 bottom craft 4.57 37.8±1.0 b67 italy 8.5 top craft 4.49 46.4±4.8 b68 italy 4.6 top craft yes 4.31 25.5±2.2 b69 italy 4.6 top craft 4.39 28.9±2.8 b70 italy 6.5 top craft 3.98 35.0±6.9 b71 italy 6.5 top craft 4.77 19.1±4.9 b72 italy 5.5 bottom craft 4.51 20.5±5.6 1percentage alcohol by volume; 2 mean value±standard deviation. ital. j. food sci., vol. 32, 2020 717 don contamination levels obtained by ridascreen® don elisa don was found in all samples with a contamination incidence of 100%. the contamination ranged from 6.1 μg/l to 111.2 μg/l. the average contamination level was 34.3 μg/l, with a median of 25.8 μg/l. only in 43.06% of samples (31) the don contamination was greater than the average contamination level (34.3 μg/l). the highest contamination level (111.2 μg/l) was found in a sample that included wheat among the ingredients (table 1). ph values ranged from 3.45 to 4.96 with an average value of 4.51 and a median of 4.53. the percentage alcohol by volume (%abv) ranged from a minimum value below 0.5% (non-alcoholic beer sample) to a maximum of 12%. the average alcohol content was 5.8% with a median of 5.2%. in order to assess the influence of the two variables ph and %abv on don contamination levels, a linear regression model was computed. both %abv and ph were partially correlated with samples don content (p>0.001) but r2 were negligible (r2 = 0.109, r2 = 0.123). analysis of variance (anova) was performed in order to determine the potential impact of both wheat (as ingredient) and the type of brewing process (industrial or craft beer) on don content. the anova revealed a positive effect of wheat as ingredient on don contamination of the samples (p value = 0.001), with an average don contamination of wheat-based beers of 46.6 μg/l (±23.1) and an average don contamination of beers without wheat of 29.9 μg/l (±20.8). on the contrary, there was no difference between the types of brewing process on the final don content (p value = 0.966). 4. conclusions this study represents the first comprehensive assessment of the don level in beers sold on the italian market. moreover, it identifies wheat-based beers as potentially contributing to higher level of don accumulation in consumers. the screening results showed a weak correlation between the alcohol content (%abv) and the don contamination levels. higher alcohol levels were related to significantly higher don levels in beers by other researchers such as papadopoulou-bouraoui et al., 2004; kostelanska et al., 2009; peters et al., 2017; ksieniewicz-woźniak et al., 2019; wall-martínez et al., 2019 b. the requirement of a higher input of fermentable sugars in malt wort, in order to reach higher alcohol levels, seems to be a possible explanation. indeed, the further supplement of grains may be associated with a higher risk of mycotoxins contamination (kostelanska et al., 2009; peters et al., 2017; pascari et al., 2018; wall-martínez et al., 2019 b). a previous study (wall-martínez et al., 2019 a) did not find any correlation between ph and don contamination values. however, in our study we observed a slightly negative correlation that suggests that higher beer ph is correlated to lower don content. further studies are needed to decipher this phenomenon. given the minor ph diversity it is not possible to postulate that alkaline ph are the cause of decreased don stability as it was found for baking products (young et al., 1984). as it is known that the brewing process can include a ph correction before selling, our observations may not be associated to any specific processing of the beer. according to our surveillance, wheat-based beers represent higher risk for consumers. as stated by a recent report of the u.s. department of agriculture economic research ital. j. food sci., vol. 32, 2020 718 service, wheat may represent 5-10% of the whole malts used by u.s. breweries. the increased use of wheat may be related to the significant growth of craft beer production along with the increased popularity of several wheat beers produced by leading international brewers (jin et al., 2018). the scientific report of the european food safety authority (efsa, 2013) states that wheat has an average don contamination about three times higher (434.4 μg/kg) than barley (176.1 μg/kg). that might explain the greater don contamination values of wheat-based beers when compared to other beer types. similar results were reported by ksieniewicz-woźniak et al. (2019), who found a very high percentage of wheat-based beer samples positive to don. previously published studies (peters et al., 2017; wall-martínez et al., 2019 b) found a higher risk of mycotoxin contamination in craft beers. diversely, our analysis did not reveal any significant differences between industrial and craft beers for what concerns don contamination, which is in accordance with the study conducted by arrúa et al., 2019. efsa estimates that the contribution of don deriving from beer, in adult population, is approximatively 0.5-5.3% (efsa, 2013). the average contamination value obtained in this study (34.3 μg/l) is three times higher than the average value (13.5 μg/l) taken into consideration by efsa, 2013. based on the average don value found in our study, the consumption of a heavy drinker of 70 kg of body weight, consuming 0.5 l of beer per day, will determine a don daily intake of 24.5 %. considering the 2018 beer per capita consumption of 33.6 l (0.092 l of beer per day) of the italian consumers 4.5% of the tdi will be reached. these numbers are substantially higher than those found by pietri et al. (2003). annual climate and weather variability may contribute to modify levels of mycotoxins in field crops (beyer et al., 2014), which will eventually lead to modified levels of don in beer. for this reason, annual monitoring of grains for don contamination would be essential to investigate the variability of malts contamination. for the year 2018, our data suggests that through the consumption of beer, the italian population received a higher percentage of don from beer consumption compared to the average estimation from efsa. hence, our study suggests that the intake of don through beer consumption should be updated for each nation, possibly on a yearly based manner. to verify if this can be simply attributed to a “year effect” or to the changes in the ingredients used for beer production further monitoring is needed. future studies should also focus on the impact of other grains on final don levels in beer. specifically, since maize is used in beer production and it has an average don contamination (1041.9 μg/kg) significantly higher than barley (176.1 μg/kg) (efsa, 2013), an investigation of maize impact on don contamination would be of interest. moreover experimental studies focused on the effects of different technological processes on don accumulation will contribute to have a complete assessment of the factors that determine don accumulation in beers. the article processing charge was partially covered by the university of milan. references arrúa a.a., mendes j.m., arrúa p., ferreira f.p., caballero g., cazal c., kohli m.m., peralta i., ulke g. and fernández ríos d. 2019. occurrence of deoxynivalenol and ochratoxin a in beers and wines commercialized in paraguay. toxins. 11(6):308. doi: doi.org/10.3390/toxins11060308 ital. j. food sci., vol. 32, 2020 719 assobirra. 2018. assobirra annual report. 24-27. www.assobirra.it/wp-content/uploads/2019/05/annualreport_2018_ paginesingole.pdf bauer j.i., gross m., gottschalk c. and usleber e. 2016. investigations on the occurrence of mycotoxins in beer. food control. 63:135-139. doi: doi.org/10.1016/j.foodcont.2015.11.040 berthiller f., crews c., dall’asta c., saeger s. de, haesaert g., karlovsky p., oswald i.p., seefelder w., speijers g. and stroka j. 2013. masked mycotoxins: a review. mol. nutr. food res. 57:165-186. doi: doi.org/10.1002/mnfr.201100764 beyer m., pogoda f., pallez m., lazic j., hoffmann l. and pasquali m. 2014. evidence for a reversible drought induced shift in the species composition of mycotoxin producing fusarium head blight pathogens isolated from symptomatic wheat heads. int. j. food microbiol. 182-183:51-56. doi: doi.org/10.1016/j.ijfoodmicro.2014.05.002 efsa. 2013. deoxynivalenol in food and feed: occurrence and exposure. efsa j. 11(10). doi: doi.org/10.2903/j.efsa.2013.3379 efsa contam panel. 2017. risks to human and animal health related to the presence of deoxynivalenol and its acetylated and modified forms in food and feed. efsa j. 15(9). doi: doi.org/10.2903/j.efsa.2017.4718 ferrigo d., raiola a. and causin r. 2016. fusarium toxins in cereals: occurrence, legislation, factors promoting the appearance and their management. molecules. 21(5):627. doi: doi.org/10.3390/molecules21050627 jasp team. 2019. jasp (version 0.11.1)[computer software]. https://jasp-stats.org/ jin z., zhou b., gillespie j., gross t., barr j., simsek s., brueggeman r. and schwarz p. 2018. production of deoxynivalenol (don) and don-3-glucoside during the malting of fusarium infected hard red spring wheat. food control. 85:6. doi: doi.org/10.1016/j.foodcont.2017.09.002 kostelanska m., hajslova j., zachariasova m., malachova a., kalachova k., poustka j., fiala j., scott p.m., berthiller f. and krska r. 2009. occurrence of deoxynivalenol and its major conjugate, deoxynivalenol-3-glucoside, in beer and some brewing intermediates. j. agric. food chem. 57(8):3187-3194. doi: doi.org/10.1021/jf803749u ksieniewicz-woźniak e., bryła m., waskiewicz a., yoshinari t. and szymczyk k. 2019. selected trichothecenes in barley malt and beer from poland and an assessment of dietary risks associated with their consumption. toxins. 11(715):1-15. doi: doi.org/10.3390/toxins11120715 kuzdraliński a., solarska e. and muszyńska m. 2013. deoxynivalenol and zearalenone occurence in beers analysed by an enzyme-linked immunosorbent assay method. food control. 29(1):22-24. doi: doi.org/10.1016/j.foodcont.2012.06. 003 papadopoulou-bouraoui a., vrabcheva t., valzacchi s., stroka j. and anklam e. 2004. screening survey of deoxynivalenol in beer from the european market by an enzyme-linked immunosorbent assay. food addit. contam. 21(6):607-617. doi: doi.org/10.1080/02652030410001677745 pascari x., ortiz-solá j., marín s., ramos a.j. and sanchis v. 2018. survey of mycotoxins in beer and exposure assessment through the consumption of commercially available beer in lleida, spain. lwt. 9:87-91. doi: doi.org/10. 1016/j.lwt.2018.02.021 pasquali m., beyer m., logrieco a., audenaert k., balmas v., basler r., boutigny a.l., chrpová j., czembor e., gagkaeva t., gonzález-jaén m.t., hofgaard i.s., köycü n.d., hoffmann l., levic j., marin p., miedaner t., migheli q., moretti a., müller m.e.h., munaut f., parikka p., pallez-barthel m., piec j., scauflaire j., scherm b., stankovic s., thrane u., uhlig s., vanheule a., yli-mattila t. and vogelgsang s. 2016. a european database of fusarium graminearum and f. culmorum trichothecene genotypes. front. microbiol. 7:406. doi: doi.org/10.3389/fmicb.2016.00406 pedroso pereira l.t., putnik p., tadashi iwase c.h. and oliveira rocha l. de. 2019. deoxynivalenol: insights on genetics, analytical methods and occurrence. curr. opin. food sci. 24:1-8. doi: doi.org/10.1016/j.cofs.2019.01.003 peters j., dam r. van, doorn r. van, katerere d., berthiller f., haasnoot w. and nielen m.w.f. 2017. mycotoxin profiling of 1000 beer samples with a special focus on craft beer. plos one. 12(10):1-27. doi: doi.org/10.1371/journal. pone.0185887 piacentini k.c., savi g.d., olivo g. and scussel v.m. 2015. quality and occurrence of deoxynivalenol and fumonisins in craft beer. food control. 50:925-929. doi: doi.org/10.1016/j.foodcont.2014.10.038 pietri a., bertuzzi t., barbieri g. and fortunati p. 2003. analisi di micotossine in birre nazionali ed estere mediante hplc e gc-ms. conference paper: v congresso di chimica degli alimenti, parma (italy) (in italian). ital. j. food sci., vol. 32, 2020 720 plotly technologies inc. 2015. collaborative data science. https://help.plot.ly/make-a-line-of-best-fit/ rodríguez-carrasco y., fattore m., albrizio s., berrada h. and mañes j. 2015. occurrence of fusarium mycotoxins and their dietary intake through beer consumption by the european population. food chem. 178:149-155. doi: doi.org/10. 1016/j.foodchem.2015.01.092 varga e., malachova a., schwartz h., krska r. and berthiller f. 2013. survey of deoxynivalenol and its conjugates deoxynivalenol-3-glucoside and 3-acetyl-deoxynivalenol in 374 beer samples. food addit. contam. part a. 30(1):137146. doi: doi.org/10.1080/19440049.2012.726745 wall-martínez h.a., pascari x., bigordà a., ramos a.j., marín s. and sanchis v. 2019 a. the fate of fusarium mycotoxins (deoxynivalenol and zearalenone) through wort fermenting by saccharomyces yeasts (s. cerevisiae and s. pastorianus). food res. int. 126:108587. doi: doi.org/10.1016/j.foodres.2019.108587 wall-martínez h.a., pascari x., ramos a.j., marín s. and sanchis v. 2019 b. frequency and levels of mycotoxins in beer from the mexican market and exposure estimate for deoxynivalenol mycotoxins. mycotoxin res. 35(2):207-216. doi: doi.org/10.1007/s12550-019-00347-x young j.c., fulcher r.g., hayhoe j.h., scott p.m. and dexter j.e. 1984. effect of milling and baking on deoxynivalenol (vomitoxin) content of eastern canadian wheats. j. agric. food chem. 32(3):659-664. doi: doi.org/10.1021/jf00123a058 paper received january 14, 2020 accepted april 28, 2020 ijfs#1107_bozza ital. j. food sci., vol. 31, 2019 195 paper presence of destruxin a and beauvericin in cereals e. dreassi*1,, c. zamperini1, a. cito2, v. francardi2 and m. botta1 1department of biotechnology, chemistry and pharmacy, siena university, via a. moro 53100, siena, italy 2consiglio per la ricerca in agricoltura e analisi dell’economia agraria, research center for plant protection and certification, via di lanciola 12/a, 50125 florence, italy *corresponding author: tel.: +39 0577234321; e-mail address: elena.dreassi@unisi.it abstract a lc-ms/ms method for the detection of destruxin a (dtx a) and beauvericin (bea) in cereals was developed, validated and applied to commercial products collected in italian markets in the years 2015-2016. results showed that bea contaminated 59 % of the samples even if only 15 of them (34%) showed quantifiable residues (comprised between 0.11 and 7.51 ng/g). the sample of red rice contaminated with the highest bea level was also contaminated with dtx a (0.28 ng/g). finally, no significant differences were detected between contaminated samples based on the production year and the agronomic technology used (organic or conventional farming). keywords: lc-ms/ms, mycotoxins, organic, conventional ital. j. food sci., vol. 31, 2019 196 1. introduction cereals supply and demand have been steadily increasing in recent years (usda, 2017), however these products are exposed to pre-/post-harvest fungal infections potentially dangerous for humans and animals and responsible for economic losses (who-iarc, 2002; peraica et al., 1999; zain, 2011). fungal toxicity is mainly due to the production of mycotoxins. these secondary metabolites, produced by molds as natural protection, are generally thermostable and resistant to food transformation processes (karlowsky et al., 2016). for these reasons, mycotoxins are considered the main chronic dietary risk factors and therefore a correct evaluation of the real contamination and co-occurrence of these products is required. among all mycotoxins, european union has set a maximum level in food only for aflatoxins, ochratoxin a, patulin, deoxynivalenol, zearalenone, fumonisins, t-2 toxin and ht-2 toxin (commission regulation 1881/2006; commission recommendation 2013/165/eu). recently, a particular attention was paid in ec to enniatins and beauvericin (bea). efsa’s panel on contaminants has reported the occurrence of enniatins and bea in european foods and feeds in 2014 in the food chain (efsa, 2014). even if no concerns for human health have been related to the acute exposure to these mycotoxins, given the lack of relevant in vivo toxicity data, no reliable conclusions can be drawn on chronic exposure to these compounds (contam, 2014). many fungi, such as beauveria bassiana and fusarium spp., produce bea and, in the last period, b. bassiana is widely used as entomopathogenic mycoinsecticide alone or in combination with metarhizium anisopliae (wang and xu, 2012). the metarhizium spp. and other ubiquitous soil fungi, produce a family of cyclic peptide toxins termed destruxins (dtxs). to date, a number of dtxs have been identified and placed in five major subgroups (a-e) with dtx a, b and e as the most predominant one (hsiao and ko, 2001; wang et al., 2009; ibraim and asker, 2012). they are known to possess cytotoxic and cytostatic effects on mammalian and insect cells with dtx a and e being the most toxic (skrobeck and butt, 2015). for some authors, mycotoxins from mycoinsecticides have limited ways to enter in environment and the risks of contaminating foods are negligible (hu and zhang, 2016). differently from bea, no analytical data are currently available on the occurrence of dtxs in food chain and the present work aimed to investigate of the real occurrence of dtx a, along with bea, in cereals purchased from the italian market in 2015-2016 period. based on our previous experience with these two analytes and on the extraction solvents reviewed in literature (hsiao and ko, 2001; wang et al., 2009; cito et al., 2014 and 2016; butt et al., 2009; taibon et al., 2015; blesa et al., 2012; sørensen et al., 2008), a validated lc-ms/ms method was optimized in order to determine simultaneously both analytes in commercial organic or conventional farming cereals samples. 2. materials and methods 2.1. chemicals the standards of dtx a and bea were obtained from sigma-aldrich s.r.l (milano, italia). all reagents were obtained by sigma unless stated otherwise. acetonitrile, dichloromethane and ethyl acetate, used for the mycotoxins extractions, were of analytical grade while acetonitrile used for chromatographic analysis was of hplc grade. milli-q quality water (millipore, milford, ma, usa) was used. ital. j. food sci., vol. 31, 2019 197 2.2. standard solutions standard solutions were prepared by dissolving each compound with methanol in a volumetric flask and then diluted with methanol to make the working solutions. 2.3. sample extraction the cereals samples (maize, barley, oat, rice, red rice, amaranth, millet, wheat and spelt) were purchased in local supermarkets. in the first step, a representative portion of the cereal samples (100 g) was mixed well with a food chopper. an accurately weighed portion of all the samples (10 g) was placed in a centrifuge tube and 25 ml of acetonitrile or dichloromethane: ethyl acetate (1:1, v/v) was added. the extractions were carried out using an ika labortecnhik homogenizer model t25 basic (ika werke gmbh & co., staufen, germany) for 5 min at 13500 rpm. the supernatant was transferred after centrifugation, and another aliquot of extraction solvent was added to the residue and homogenized. the organic fractions were pooled and evaporated to dryness under vacuum by rotary evaporation (temperature of the bath, 20°c), and the residue redissolved in 500 µl of acetonitrile. the sample was filtered with 0.45 µm minisart srp 4 (sartorius: goettingen, germany) and used for the lc/ms-ms analysis. 2.4. quantification and recovery the quantitative analysis of bea and dtx a was based on calibration curves obtained analysing spiked samples (10 g of equimolar mixture of barley, oat, maize, rice, wheat and spelt) at different concentrations ranged between 0.1 and 100 ng/g. for the equations, six points with different concentrations were used. extraction recoveries were determined by spiking untreated powdered equimolar mixture of cereals with standard solutions to obtain tree different final concentrations (0.1, 10 and 100 ng/g for each investigated compound). after the solvent evaporated, the samples were extracted, as reported above. recovery values were calculated as the ratio of the peak area obtained from the extraction of the fortified samples to the corresponding peak area determined by a single-point calibration standard. 2.5. lc–esi-tandem ms analysis chromatography-mass spectrometry system consisted of a varian apparatus (varian inc.) including a vacuum solvent degassing 20 unit, two pumps (212-lc), a triple quadrupole msd (mod. 320-lc) mass spectrometer with esi interface and varian ms workstation system control ver. 6.9 software. the chromatographic separation was performed by using a kinetex 2.6µm c18 100å column (phenomenex) (100 mm×4.6 mm). the sample was injected (5 µl) after filtration. chromatographic analysis was carried out by using acetonitrile and aqueous solution of formic acid (0.05%) (3:97 v/v). the flow rate was 0.1 ml/min. the instrument operated in positive mode and esi parameters were: detector voltage 1250 v, drying gas pressure 18.0 psi, desolvation temperature 300.0°c, nebulizer gas 42.0 psi, needle voltage 6000 v and shield voltage 250 v. nitrogen was used as nebulizer and drying gas. collision induced dissociation was performed using argon as the collision gas at a pressure of 1.8 mtorr in the collision cell. the selected reaction monitoring (srm) transitions as well as the capillary voltage and the collision energy are summarized in table 1. quantitative analysis was performed in srm to maximize sensitivity. for each investigated compound the [m+h]+ species were selected as precursor ions. two srm ital. j. food sci., vol. 31, 2019 198 transitions (table 1), the first one for quantification and the second one for confirmation purpose, were acquired by using the experimental conditions described above. table 1. chromatographic and selected reaction monitoring (srm) parameters used in the analysis (retention time (tr), quantification and confirmation transitions, collision energy and capillary voltage). compound tr (min) quantification transition (m/z) collision energy (ev) confirmatory transition (m/z) collision energy (ev) capillary voltage (v) dtx a 3.52±0.08 578.1→465.1 -28.5 578.1→436.8 -22.5 86.29 bea 4.32±0.06 784.2→244.0 -25.0 784.2→262.0 -24.5 140.00 2.6. validation procedure and evaluation of the matrix effect the specificity of the method was assessed by analysing blank samples (one sample for each analysed cereals) and blank samples spiked with the investigated compounds, according to the procedure reported above. assay selectivity was defined by evidence of non-interference at retention times and ion channels identical to those of bea and dtx a in the blank samples. in order to determine the linearity of the method, calibration curves (obtained from five replicate experiments) were constructed by analysing spiked cereal samples (10 g of equimolar mixture of barley, oat, maize, rice, wheat and spelt fortified before extraction) ranged between 0.1 and 100 ng/g. the linearity was evaluated by linear least-squares regression analysis. the detection limit (lod) was defined as the concentration for which a signal-to-noise ratio equal to 3 was obtained. the quantification limit (loq) was defined as the lowest concentration for which an accuracy between 80% and 120% and a precision with a coefficient of variation of±20% or less was obtained over six measurements, with a signalto-noise ratio superior or equal to 10. assay precision was determined by repeatability (intra-day) and intermediate precision (inter-day). intra-day precision was evaluated by assaying added blank cereal samples, six replicates set at the same concentration (0.1, 10 and 100 ng/g), during the same day. the between-day precision was studied by assaying added blank cereals samples, six replicates set at the same concentration (0.1, 10 and 100 ng/g), on different days (5 days). the accuracy of the method was also evaluated at the same concentration levels and expressed as relative error % (re). the recovery data were determined by spiking blank cereal samples with standard solutions (three concentrations analysed in triplicate). after spiking, the samples were extracted as previously described. recovery values were calculated by comparing the analytical results of the samples through overall extraction procedure with those obtained from blank samples fortified after extraction. in order to study the matrix effect (me), blank samples were processed and spiked later to obtain three final concentration levels (set b: six samples with final concentrations of 0.1, 10 and 100 ng/g). the response (peak area) was compared with directly injected standard solutions (set a: six samples prepared in methanol at the same concentration levels). the matrix effect (me) was evaluated by comparing the mean peak area of the spiked samples (post-extraction addition) with corresponding standard solutions at equivalent concentrations prepared in methanol. the me values were then calculated as follows: me (%) = a/b×100 (matuszewski et al., 2003). ital. j. food sci., vol. 31, 2019 199 3. results and discussion 3.1. lc–esi-tandem-ms optimization the selected reaction monitoring (srm) was performed to enhance sensitivity and specificity of the analysis. the ms/ms dissociation study was optimized, for each single standard compound, by varying the cone voltage and collision energy, using the flow injection analysis (fia) of working standard solutions at a flow rate of 0.01 ml/min directly through the electrospray probe. [m+h]+ ions were found to be the most abundant ones and selected as precursor ions for the target compounds. the ms–ms breakdown for dtx a showed a fragmentation pattern similar to that reported by other authors (wang et al., 2009; butt et al., 2009). as expected the dtx a ion [m+h]+ at 578.1 m/z represented the most abundant ion without any adduct. the collision-induced dissociation (cid) experiments showed common losses of amino acids following ring opening. as previously described by other authors, bea tends to be readily ionized via esi to form [m+h]+ ion. as determined in this work, [m+h]+ ion was found to be the most abundant one and selected for bea analysis. the ms/ms tuning experiments displayed product ions scan spectra of bea in accordance with those reported in literature (sørensen et al., 2008; song et al., 2009). most intense fragments were selected for dtx a and bea quantification and confirmatory purposes (table 1). 3.2. method optimization and validation procedure the method was validated for accuracy, precision, specificity, linearity and sensitivity. in order to control for variability in recovery from biological samples and factors that can affect the instrumental response, various cereals samples were assayed. cereals used for calibration and for recovery studies were analysed to verify the absence of each investigated compound before performing the analysis. the analysis of blank samples showed the absence of interfering endogenous compound peaks at the same ion channel or retention time of dtx a or bea. two extraction methods were tested in order to identify a unique system to quantify contemporarily both mycotoxins. satisfactory mean recoveries for bea (89 and 72 % respectively) and only with binary mixture for dtx a (56 %) were obtained by using both selected extraction solvents (acetonitrile and dichloromethane: ethyl acetate 1:1 v/v) (table 2). table 2. mean extraction recoveries obtained with the two extraction procedures (experiments conducted on equimolar mixture of barley, maize, oat, rice, spelt and wheat) (n=3). spiked concentration (ng/g) extraction with acetonitrile ch2cl2:ethyl acetate (1:1 v/v) recovery (mean±sd) rsd% a recovery (mean±sd) rsd% a dtx a 0.1 10 100 38.6±7.8 43.1±6.4 39.2±5.8 20.3 14.8 14.9 66.7±6.66 68.2±5.52 79.9±3.46 10.4 8.10 4.3 bea 0.1 10 100 88.4±5.0 88.7±3.1 89.4±2.9 5.9 3.4 3.2 55.8±6.7 54.9±6.2 57.5±4.7 12.0 11.2 8.1 arelative standard deviation. ital. j. food sci., vol. 31, 2019 200 the matrix-induced effects, such as signal enhancement or suppression, were also evaluated according to matuszewski et al. (2003), and the results obtained in presence of an extract of equimolar mixture of barley, maize, oat, rice, spelt and wheat are summarized in table 3. an enhancement of the absolute response was observed for both analytes with both the extraction systems. very close results were obtained for all matrices when tested separately (results not shown), therefore, calibration curves were generated from blank constituted of an equimolar-mixed cereals sample (barley, oat, maize, rice, wheat and spelt) spiked before extraction to avoid and minimize any uncertainty related to the matrix-induced effects. table 3. matrix effects obtained with the two extraction procedures (experiments conducted on equimolar mixture of barley, maize, oat, rice, spelt and wheat) (n=3). spiked concentration (ng/g) matrix effect (mean±sd) acetonitrile ch2cl2:ethyl acetate (1:1 v/v) dtx a 0.1 10 100 146.1±11.3 137.8±9.9 136.9±7.9 120.6±10.6 130.6±9.6 124.8±9.0 bea 0.1 10 100 147.9±8.5 148.7±4.7 143.1±8.5 156.6±10.7 137.2±8.7 140.8±8.5 based on the results obtained in these preliminary stages, the binary extraction mixture was selected for the continuation of the work, ensuring satisfactory recovery values for both analytes. calibration curves (five replicate experiments) were constructed and the method was found to be linear within the range 0.1–100 ng/g with correlation coefficient above 0.9994. the equations of the curves, obtained by a least squares fit, are reported in table 4. table 4. regression plot parameters for dtx a and bea quantification in mixed cereals (experiments conducted on equimolar mixture of barley, maize, oat, rice, spelt and wheat). range (ng/g) regression plots parameters r2 loq a (ng/g) lodb (ng/g) dtx a 0.1-100 y = 24423x+6127 0.9994 0.1 0.03 bea 0.1-100 y = 46020x+7695 0.9997 0.1 0.03 aquantification limit. bdetection limit. the selected method was validated in term of precision and accuracy (results are reported in table 5). intra-day and inter-day precision, expressed as the relative standard deviation (rsd %) values, were always less than 15 % (n = 6) for both the analytes. the relative errors (re %) ranged from −12.00 % for bea to +14.00 % for dtx a obtained at loq levels. the reported results indicated that the developed method is precise, accurate, reproducible and utilizable for determination of the two compounds in cereal-based foods. compared to the loq present in literature our values are comparable for both analytes (taibon et al., 2015; blesa et al., 2012; sørensen et al., 2008; tolosa et al., 2017; malachová et al., 2014). ital. j. food sci., vol. 31, 2019 201 table 5. the intra-day and inter-day precision and accuracy of the method (n=6). compound analysis type spiked concentration (ng/g) measured concentration (media±sd) rsd%a accuracy (relative error %) b dtx a intra-day 0.1 10 100 0.11±0.01 10.52±1.12 101.03±3.40 9.09 10.65 3.40 +8.20 +5.20 +1.00 inter-day 0.1 10 100 0.12±0.01 10.54±0.84 103.06±2.35 11.67 7.97 2.28 +14.00 +5.40 +3.06 bea intra-day 0.1 10 100 0.09±0.01 9.90±1.24 101.20±4.23 14.44 12.53 4.18 -12.00 -1.00 +1.20 inter-day 0.1 10 100 0.09±0.01 9.95±0.90 109.20±3.68 13.33 9.35 3.37 -9.40 -0.50 +9.20 arelative standard deviation. baccuracy = relative error % = (measured-spiked)/spiked x 100. 3.3. analysis of dtx a and bea content in cereals the validated method (extraction accomplished with dichloromethane: ethyl acetate, 1:1 v/v) was successfully applied to quantify dtx a and bea levels in 44 commercial products collected in the years 2015-2016 (table 6). results showed that bea contaminated 59 % of the sample even if in only 15 samples (34%) quantities were higher than loq (included in the range 0.11 and 7.51 ng/g). contamination data are in accord with bea occurrence reported by various authors and collected in the efsa contam panel report (2014). the high number of positive samples is due to the good lod values obtained with our method (0.03 ng/g for both compounds). either no significant differences were detected between percentages of contaminated samples based on the year of production or the agronomic technology used (organic or conventional farming). only one sample (red rice presenting the highest bea levels) resulted contaminated by dtx a (0.28 ng/g). although the number of analyzed samples is limited, the low levels of bea and the substantial absence of dtx a confirm that acute exposure to these toxins could do not indicate concern for human health. however, careful monitoring in foods is essential in order to provide a correct estimate of chronic exposure to these toxins. ital. j. food sci., vol. 31, 2019 202 table 6. occurrence and content of dtx a and bea in commercial products (44 cereals samples) collected in the years 2015-2016 (each sample was analysed in triplicate). year bea content (ng/g±sd) amaranth barley oat oat flakes maize millet red rice rice spelt wheat 2015 ---a ---a 0.18±0.01 0.17±0.02a 0.19±0.02a 0.58±0.05a 7.51±1.16b 1.28±0.16 0.53±0.07a 3.92±0.13 0.27±0.03a ---a ---2.48±0.48 --- 0.98±0.11a ------ >lod --- >lod --- 2016 ---a >lod >lod ---a 0.21±0.03 >lod a --->lod a >lod a >lod --->lod 1.54±0.18 >lod ---a ------ --- 0.11±0.01 5.12±0.59 >lod --- aorganic product. bred rice sample containing also dtx a (0.28±0.04 ng/g). ital. j. food sci., vol. 31, 2019 203 acknowledgments we thank iuni margaret laura trist for helping with the manuscript writing. references blesa j., marín r., lino c.m. and mañes j. 2012. evaluation of enniatins a, a1, b, b1 and beauvericin in portuguese cereal-based foods. food additives and contaminants a 29:1727-1735. butt t.m., ben el hadj n., skrobek a., ravensberg w.j., wang c., lange c.m., vey a., shah u.k. and dudley e. 2009. mass spectrometry as a tool for the selective profiling of destruxins, their first identification in lecanicillium longisporum. rapid communication in mass spectrometry 23:1426-1434. cito a., mazza g., strangi a., benvenuti c., barzanti g.p., dreassi e., turchetti t., francardi v. and roversi p. 2014. metarhizium from red palm weevil rhynchophorus ferrugineus: characterization and comparison of isolates from the native area and an area of recent introduction. fems microbiology letters 355:108-115. cito a., barzanti g.p., strangi a., francardi v., zanfini a. and dreassi e. 2016. cuticle-degrading protease and toxins as virulence markers of beauveria bassiana (balsamo) vuillemin. journal of basic microbiology 56:1-8. commission recommendation 2013/165/eu of 27 march 2013 on the presence of t-2 and ht-2 toxin in cereals and cereal products. oj l 91, 3.4.2013, p. 12-15. commission regulation (ec) no 1881/2006 of 19 december 2006 setting maximum levels for certain contaminants in foodstuffs. oj l 364, 20.12.2006, p.5-24. available at www.data.europa.eu/eli/reg/2006/1881/oj efsa panel on contaminants in the food chain (contam), 2014. scientific opinion on the risks to human and animal health related to the presence of beauvericin and enniatins in food and feed. efsa journal, 12:3802, 174pp. hu q., li f. and zhang y. 2016. risks of mycotoxins from mycoinsecticides to humans. biomed res. int. 2016:3194321, 22 pp. hsiao y.m. and ko j.l. 2001. determination of destruxins, cyclic peptide toxins, produced by different strains of metharizium anisopliae and their mutants induced by ethyl methane sulfonate and ultraviolet using hplc method. toxicon 39:837-841. ibrahim a.a. and asker m.s. 2012. production and characterization of destruxins from local metharizium anisopliae var. anisopliae. australian journal of basic and applied sciences 6:284-288. karlovsky p., suman m., berthiller f., de meester j., eisenbrand g., perrin i., oswald i.p., speijers g., chiodini a., recker t. and dussort p. 2016. impact of food processing and detossification treatments on mycotoxin contamination. mycotoxin research 32:179-205. malachová a., sulyok m., beltrán e., berthiller f. and krska r. 2014. optimization and validation of a quantitative liquid chromatography-tandem mass spectrometric method covering 295 bacterial and fungal metabolites including all regulated mycotoxins in four model food matrices. journal of chromatography a 1362:145-156. matuszewski b.k., constanzer m.l. and chavez-eng c.m. 2003. strategies for the assessment of matrix effect in quantitative bioanalytical methods based on hplc–ms/ms, analytical chemistry 75:3019-3030. peraica m., radic b., lucic a. and pavlovic m. 1999. toxic effects of mycotoxins in humans. bulletin of the world health organization 77:754-766. skrobek a. and butt t.m. 2005. toxicity testing of destruxins and crude extracts from the insect-pathogenic fungus metarhizium anisopliae. fems microbiology letters 251:23-28. song h.h., lee h.s., lee g.p., ha s.d. and lee c. 2009. structural analysis of enniatin h, i, and mk1688 and beauvericin by liquid chromatography-tandem mass spectrometry (lc-ms/ms) and their production by fusarium oxysporum kfcc 11363p. food additives and contaminants a 26:518-526. sørensen j. l., nielsen k.f., rasmussen p.h. and thrane u. 2008. development of a lc-ms/ms method for the analysis of enniatins and beauvericin in whole fresh and ensiled maize. journal of agriculture and food chemistry 56: 1043910443. ital. j. food sci., vol. 31, 2019 204 taibon j., sturm s., seger c., strasser h. and stuppner h. 2015. quantitative assessment of destruxins from strawberry and maize in the lower parts per billion range: combination of a quechersbased extraction protocol with a fast and selective uhplc-qtof-ms. journal of agriculture and food chemistry 63:5707-5713. tolosa j., graziani g., gaspari a., chianese d., ferrer e., mañes j. and ritieni a. 2017. multi-mycotoxin analysis in durum wheat pasta by liquid chromatography coupled to quadrupole orbitrap mass spectrometry. toxins 9:59, 12 pp. usda, 2017. grain : world markets and trade. united states department of agriculture, foreign agricultural service. available at www.apps.fas.usda.gov/psdonline/circulars/grain.pdf wang h., hutwimmer s., strasser h. and burgstaller w. 2009. destruxin production of metarhizium anisopliae under carbon and nitrogen exhaustion. journal of basic microbiology 49:404-411. who-iarc, evaluation of carcinogenic risks to humans, iarc monographs vol. 82, iarc press, lyon, france, 2002. zain m.e. 2011. impact of mycotoxins on human and animals. journal of saudi chemical society 15:129-144. paper received december 17, 2017 accepted august 30, 2018 ijfs#1645_bozza ital. j. food sci., vol. 32, 2020 310 paper grapevine canes waste from veneto region as a new source of stilbenoids content g.s. de bona1,2, f. bonora2 and s. vincenzi*1,2 1university of padova, department of land, environment, agriculture and forestry (tesaf), viale dell’università 16, 35020 legnaro, pd, italy 2university of padova, department of agronomy, food, natural resources, animals and environment (dafnae), viale dell’università 16, 35020 legnaro, pd, italy *corresponding author: simone.vincenzi@unipd.it abstract in the present paper we analyzed the stilbene accumulation in grape canes of seven autochthonous grape varieties from veneto region, italy, in comparison to two international cvs. in addition, we investigated the effect of pruning time on the stilbenes accumulation rate during the storage. taking into account the effect of both pruning time (october, november and december) and storage time (from zero to twelve weeks at room temperature), cultivar verdiso and incrocio manzoni 13.0.25 showed the highest accumulation of trans-resveratrol, trans-piceatannol, and trans-ɛ-viniferin, in particular when the canes were harvested in october, highlighting the importance of the cultivar but also the effect of the pruning time on the accumulation of stilbenes in grape canes. keywords: autochthonous varieties, grape canes, piceatannol, resveratrol, viniferin ital. j. food sci., vol. 32, 2020 311 1. introduction the winemaking industry is responsible for large part of grape waste as pomace, grape canes, seeds and stems. some waste as pomace and seeds are valued from food industry being popular as source of antioxidant polyphenols or for grape seed oil production. at the same time, there is still a need for alternative sources of resveratrol, as can be seen by the recent permission of resveratrol as a novel food ingredient in the european union (commission implementing decision (eu) 2016/1190). stilbenoids are a small family of plant secondary metabolites derived from the phenylpropanoid pathway. they act as plant phytoalexins displaying different bioactivities and thus making them compounds of high current interest (fernandez-mar et al., 2012). in the vitaceae, stilbenoids accumulate in response to various biotic and abiotic stresses such as the attack of pathogen erysiphe necator, plasmopara viticola, botrytis cinerea and uv-c irradiation (schnee et al., 2008; schnee et al., 2013; pezet et al., 2004; alonso-villaverde et al., 2011; adrian and jeandet, 2012; gruau et al., 2015; yin et al., 2016). they can also be induced in response to plant hormones, such as ethylene and jasmonate (d’onofrio et al. 2009; jiang et al., 2015). in grapevine, the stilbene trans-resveratrol has attracted particular attention, not only because of its antimicrobial activity, but also due to its health benefits to humans, as antioxidant, anticarcinogenic, anti-inflammatory, cardioprotective and neuroprotective, among others (flamini et al., 2013; bavaresco et al., 2012; shen et al., 2009). stilbenoids accumulate in different parts of grapevine, however, wang et al. (2010) found the highest concentration of trans-resveratrol in grape canes. grape canes waste is generated during winter annual pruning and represents a large source of waste derived from the viticulture industry, with an estimated volume of 1 to 3 t/ha year depending upon plantation density, climate, and vigor of the grape variety (devesa-rey et al., 2011; ewald et al., 2017). currently, emission protection regulations mostly prohibit the burning of grape canes, which was the traditional way of disposal of these woody residues (ewald et al., 2017). grape canes can be considered as an unexploited source of stilbenoids, as proposed by several authors (vergara et al., 2012; lambert et al., 2013; gorena et al., 2014; houillé et al., 2015; guerrero et al., 2016; ewald et al., 2017). different content of stilbenoids have been found in grape canes of vitis vinifera stored at 40 to 45°c or at room temperature (20±3°c). vergara et al. (2012) compared the stilbenoid content in canes of several grape varieties cultivated in different regions and in two different years in chile, finding trans-resveratrol in the range 446 to 6533 mg/kg dw, with the highest content found in gewurztraminer variety. lower values of trans-resveratrol were reported by lambert et al. (2013) comparing grape canes harvested from 16 different varieties in france. these authors found the lowest content of trans-resveratrol in chardonnay (190 mg/kg dw) and the highest content in pinot noir cultivar (1526 mg/kg dw) while the trans-piceatannol and trans-ɛ-viniferin content were significantly higher in all cultivars when compared with vergara et al. (2012). guerrero et al. (2016) described that most abundant stilbenoid was trans-viniferin in all cultivars, which reached the highest concentration in gewürztraminer cultivar. while ewald et al. (2017) found the higher levels of trans-resveratrol and trans-viniferin in pinot blanc and sauvignon blanc harvested in germany (3199-3329 mg/kg dw, respectively). zhang et al. (2011) studied the content of trans-resveratrol in grape canes of many different grape varieties, including local varieties cultivated in the seven major chinese grape producing regions finding high variability. ital. j. food sci., vol. 32, 2020 312 beside the genetic determinants, several other factors could explain these different results, such as the climate, the solvent used for the extraction of stilbenoids (rayne et al., 2008), the temperature and time of grape canes storage (houillé et al., 2015). in addition, other factors, such as the pruning time, could affect the stilbene accumulation rate in canes. this factor has never taken in account before, in fact in many articles this data is not reported at all, and, when present, show to be highly variable, with pruning times varying from 1 to 4 months after the grape harvest. up to date there are no data available concerning stilbenoid content in grape cane waste of italian grape varieties. in the present paper the stilbene accumulation in grape canes of seven autochthonous grape varieties from veneto region, one of the most important wine producing regions in italy, has been studied. in addition, the effect of pruning time on the stilbenes accumulation rate during the storage was taken in account. 2. materials and methods 2.1. plant materials grape canes of vitis vinifera l. from veneto region white varieties, such as bianchetta, glera vcr sel. lungo, incrocio manzoni 6.0.1.3, verdiso; and red varieties incrocio manzoni 13.0.25, marzemino biotipo 13, raboso, were collected randomly from plants from a conventional vineyard at oenological school of conegliano, province of treviso, italy (i.s.i.s.s – istituto statale di istruzione secondaria superiore “g.b. cerletti”) (latitude 45° 87’ 69” n and longitude 12° 28’ 53” e). as reference, international varieties sauvignon blanc inra 316 and pinot noir, grown in the same vineyard, were chosen because according to lambert et al. (2013) these were the cultivars with the highest content of stilbenes. the canes were collected monthly in october (11th), november (15th) and december (13th) (autumn-winter 2016-2017) from 30 selected plants for each variety. about 1.5 kg for each sampling and for each variety were obtained. the canes were cut into 10-20 cm long pieces and stored for three, six, nine and twelve weeks in well-aerated conditions in the dark, at room temperature. for control, a sample was immediately extracted after each pruning sampling point. 2.2. stilbenoid extraction the stilbenoid extraction was performed according to the procedure described by rayne et al. (2008) with some modifications. briefly, the grape canes were ground with a coffee grinder (imetec, azzano san paolo, bg, italy). three-stage extraction (in the dark to avoid stilbene isomerization) was performed by continuous stirring at room temperature using an 8:1 (v/w) 80% ethanol:sample ratio over a 60-min period for each extraction. during the first extraction, 250 µl of t-oh-stilbene 200 µg/ml in ethanol were added as internal standard. the extracts were vacuum filtered at 1.6 μm on glass microfibre filter (gf/a, whatman) and combined and the solvent removed by rotary evaporation (büchi model r-114, flawil, switzerland), then stored at -20°c. all the extractions were performed in triplicate. before quantification, the extracts were defrosted at room temperature and homogenized. an aliquot of the extract (500 µl) was transferred to eppendorf tubes and 500 µl of methanol were added. after centrifugation at 4000 × g for 1 min, part of the supernatant (500 µl) was transferred to hplc vials. ital. j. food sci., vol. 32, 2020 313 2.3. hplc analysis the analysis of stilbenoids was performed according to the procedure described by vincenzi et al. (2013) with some modifications. stilbenes were separated on a c18 lichrospher column (4 mm x 250 mm, 5 μm, agilent technologies, milano, italy) at 40°c, using an hplc system (waters corporation, milford, ma, usa) equipped with a dual band uv detector waters 2487 (waters corporation, milford, ma, usa). the mobile phase gradient was 0.5% v/v formic acid in deionized water (solvent a) and 2% v/v formic acid in methanol (solvent b). the gradient program was 0 to 10% (solvent b) in 3 min, followed by 10 to 30% (solvent b) in 5 min, 30 to 44% (solvent b) in 35 min, 44 to 55% (solvent b) in 2 min, 55 to 75% (solvent b) in 15 min and 75 to 100% (solvent b) in 1 min. after washing for 2 min with solvent b, the column was re-equilibrated with solvent a. the flow rate was 1.0 ml/min and injection volume 20 μl. detection was performed at 306 nm for trans-isomers for transresveratrol, trans-piceatannol and trans-ɛ-viniferin and at 285 nm for the corresponding cisisomers. all the stilbene standards were obtained in trans form from extrasynthese (genay cedex, france). the cis-isomers were obtained by uv-exposition of the corresponding trans-isomers, and were loaded in hplc for the identification of the retention times. the concentration of individual stilbenes (both transand cis-forms) was calculated on the basis of peak areas using calibration curves of commercially available standards of transresveratrol, trans-piceatannol and trans-ɛ-viniferin, and correcting the value for the internal standard recovery. data were analysed by the waters breezetm chromatography software (version 3.30). the limits of detection (lod) and quantification (loq) were performed according to the procedure described by (shrivastava and gupta, 2011). 2.4. statistical analysis within each factor the results were evaluated by one-way analysis of variance (anova), and values were analyzed by tukey’s test using the software statistica 12.0 (statsoft inc, tolson, usa). results were expressed as mean values ± standard deviation (sd) and the value of p < 0.05 was considered statistically significant. for the global analysis of all data in order to take in account the interactions among different variables, a manova test was applied and values were analyzed by wilks’s test using the software xlstat (addinsoft). 3. results and discussion considering that stilbenoid accumulation in cut canes depends on activation of related genes followed by active synthesis of resveratrol and its derivatives, as already reported by houillé et al. (2015) and billet et al. (2018), it is expected that different grape varieties respond in different way after the injury for both total amount of stilbenoid produced and rate of their accumulation. also, the climate and other environmental factors can affect the way the canes respond during the storage period, for this reason the canes of the seven varieties taken in consideration in this study were collected in the same year from plants grown in the same vineyard. the evolutions of stilbenoids during the storage time for samples of different varieties harvested at different times is reported in figs. 1, 2 and 3. ital. j. food sci., vol. 32, 2020 314 figure 1. content of trans-resveratrol (a), trans-piceatannol (b) and trans-ɛ-viniferin (c) on grape canes harvested in october (autumn−winter 2016−2017) from white varieties, bianchetta, glera, incrocio manzoni 6.0.1.3, sauvignon blanc, verdiso, and red varieties incrocio manzoni 13.0.25, marzemino, pinot noir, raboso, and stored at room temperature for three, six, nine, and twelve weeks. results represent the mean ± sd of triplicate assays. ital. j. food sci., vol. 32, 2020 315 figure 2. content of trans-resveratrol (a), trans-piceatannol (b) and trans-ɛ-viniferin (c) on grape canes harvested at pruning time in november (autumn−winter 2016−2017) from white varieties, bianchetta, glera, incrocio manzoni 6.0.1.3, sauvignon blanc, verdiso, and red varieties incrocio manzoni 13.0.25, marzemino, pinot noir, raboso, and stored at room temperature for three, six, nine, and twelve weeks. results represent the mean ± sd of triplicate assays. ital. j. food sci., vol. 32, 2020 316 figure 3. content of trans-resveratrol (a), trans-piceatannol (b) and trans-ɛ-viniferin (c) on grape canes harvested at pruning time in december (autumn−winter 2016−2017) from white varieties, bianchetta, glera, incrocio manzoni 6.0.1.3, sauvignon blanc, verdiso, and red varieties incrocio manzoni 13.0.25, marzemino, pinot noir, raboso, and stored at room temperature for three, six, nine, and twelve weeks. results represent the mean ± sd of triplicate assays. ital. j. food sci., vol. 32, 2020 317 a manova test was also applied to study the effect of different variables on the stilbenoids accumulation (table 1). table 1. results of manova analysis on the total dataset. storage harvest variety storage* harvest storage* variety harvest* variety storage* harvest* variety f-value 49,240 5,227 4,579 6,615 4,387 2,624 2,313 gdl1 12 6 24 21 96 48 150 gdl2 421 318 462 457 477 474 478 p-value < 0,0001 < 0,0001 < 0,0001 < 0,0001 < 0,0001 < 0,0001 < 0,0001 as a first observation, the basal level of trans-piceatannol and trans-resveratrol in fresh canes of pinot noir was quite low (less than 40 mg/kg dw) and below the detection level in the other varieties, whereas the dimer trans-ɛ-viniferin was already present at concentrations 10 to 30 times higher in all the samples (supplementary table 1). these results confirm the literature data (gorena et al., 2014; houillé et al., 2015; billet et al., 2018), only vergara and colleagues (2012) found very high content of transresveratrol (between 2500 and 3500 mg/kg) already at time zero. during the storage a large increase of stilbenoids was observed in all samples, confirming that the main variable driving their accumulation in grape canes is the storage time (highest f value in table 1). however, a significant effect of the harvest time was also found (table 1). collectively, the canes pruned in october showed a gradual increase of stilbenes during all the storage period, whereas the canes collected in november showed a notable peak of accumulation of stilbene content after 6 weeks of storage for almost all the varieties (figs. 1 and 2). houillé et al. (2015) found the same results, i.e. a peak of accumulation of trans-resveratrol and trans-piceatannol after 6 weeks of storage, on eight cultivars (collected in december) and stored for two, four, six, eight and ten weeks. on the other hand, the pruning carried out in december demonstrated a different behavior in the accumulation of stilbenes (fig. 3). for many varieties, in particular for verdiso and incrocio manzoni 13.0.25 (im 13.0.25) the peak of stilbene accumulation was retarded to 9 weeks of storage. this behavior of canes harvested at different times seems to show a slower stilbenoid response in canes harvested in october, probably due to the high quantity of stilbene synthase enzymes still present in the woody tissue, which under regulate the induction of the related genes after the injury. the synthesis of stilbenoids is instead more rapid with the evolution of canes toward winter dormancy until november, then the accumulation rate slowdown in canes harvested in december. this could explain the significant effect of the interaction storage*harvest time (table 1). the different cultivars showed different behaviors, and different responses to harvest time and storage conditions, as confirmed by the significant effect of variety, storage*variety and harvest*variety in the manova test (table 1). among the samples harvested in october, cultivar verdiso, im 13.0.25 and marzemino showed the highest increase of trans-resveratrol, trans-piceatannol, and trans-ɛ-viniferin after twelve weeks at rt (fig. 1). among the white varieties, verdiso is one of the last to be harvested. similarly, im 13.0.25 and marzemino are, among red varieties, those with the later harvest. it is not clear if this common behavior could be related to the similar accumulation rate of stilbenes in pruned canes. regarding resveratrol, even though after 9 ital. j. food sci., vol. 32, 2020 318 weeks pinot noir was the cultivar with the highest content, confirming the high stilbene metabolism of this variety, after 12 weeks the content in im 13.0.25 canes increased again reaching the highest value among all the varieties taken in consideration. even for piceatannol, im 13.0.25 presented concentration usually higher than pinot noir. the canes harvested in november demonstrated an increase for all stilbene compounds when maintained for twelve weeks at rt. again, the cultivar im 13.0.25 presented a constant increase of trans-resveratrol content reaching, after 12 weeks of storage, a value up to 2016±365 mg/kg dw, comparable with those found in october. in this group, a high increase of the content of trans-piceatannol (633±64 mg/kg dw) and trans-ɛ-viniferin (2193±213 mg/kg dw) was detected even on the cultivar bianchetta (fig. 2). compared to pinot noir, which reached after 6 weeks the maximum content of piceatannol and resveratrol among all varieties, bianchetta and im 13.0.25 were able to reach the same or higher quantities for both compounds after a storage of 12 weeks. in grape canes harvested in december pinot noir showed a very small accumulation of resveratrol and piceatannol, while again verdiso and im 13.0.25 were able to reach a high content of both compounds (fig. 3) (supplementary tables 2-5). our findings confirm the results previously found by guerrero et al. (2016), which highlight the importance of the cultivar in the accumulation of stilbenes in grape canes after pruning. in addition, for the first time, we demonstrated how the pruning time affects both the quantity and the accumulation rate of stilbenes in pruned canes. the information on the maximum stilbene content recoverable from canes of different grapevine cultivars could be interesting for grape producers in order to obtain cane extracts with high stilbenes concentration from their own grape canes waste. these extracts can be the base for the purification of stilbenes to be used in the food or cosmetic industries, with a big economic income considering the value of food-grade resveratrol is about 2000-3000 us$/kg (zhang et al., 2011). however, the crude cane extract could be also reused by grape growers in the same vineyard in an idea of circular economy. in fact, stilbenes have shown antifungal activity against different fungi. until now, the antifungal activity in vitro of the crude cane extracts from pinot noir, gamaret and divico cultivars against plasmopara viticola, erysiphe necator and botrytis cinerea was reported by schnee et al. (2013). recently, the direct antifungal activity of crude cane extract from pinot noir against b. cinerea was studied by monitoring the mycelium growth on nutrient agar medium, and also in grapevine plants in vitro and in vivo by de bona et al. (2019). 4. conclusion the information on the maximum stilbene content recoverable from canes of different grapevine cultivars could be interesting for grape producers, but many factors have to be taken in to account to obtain the highest yield of these compounds. first, the storage time is the main factor driving the increase of stilbenoids in grape canes, confirming the literature data, but we demonstrated for the first time that the total amount of stilbenoids and their rate of accumulation depends significantly on the pruning time. in addition the data reported in the present study confirm the importance of the cultivar in the accumulation of stilbenes in grape canes after pruning. finally, this study showed that the cultivars verdiso and incrocio manzoni 13.0.25 possess a high potential of stilbene accumulation, mainly when the canes were harvested in october. ital. j. food sci., vol. 32, 2020 319 acknowledgements financial support was provided by national scientific and technological development council (conselho nacional de desenvolvimento científico e tecnológico) (cnpq/brazil) (grant number: 206331/2014-2) and the university of padova. references adrian m. and jeandet p. 2012. effects of resveratrol on the ultrastructure of botrytis cinerea conidia and biological significance in plant/pathogen interactions. fitoterapia 83:1345-1350. alonso-villaverde v., voinesco f., viret o., spring j.l. and gindro k. 2011. the effectiveness of stilbenes in resistant vitaceae: ultrastructural and biochemical events during plasmopara viticola infection process. plant physiol biochem. 49:265-274. bavaresco l., mattivi f., de rosso m. and flamini r. 2012. effects of elicitors, viticultural factors, and enological practices on resveratrol and stilbenes in grapevine and wine. mini-rev med chem. 12:1366-1381. billet k., houillé b., besseau s., mélin c., oudin a., papon n., courdavault v., clastre m., giglioli-guivarc'h n. and lanoue a. 2018. mechanical stress rapidly induces e-resveratrol and e-piceatannol biosynthesis in grape canes stored as a freshly-pruned byproduct. food chem. 240:1022-1027. de bona g.s., adrian m., negrel j., chiltz a., klinguer a., poinssot b., héloir m.c., angelini e., vincenzi s. and bertazzon n. 2019. dual mode of action of grape cane extracts against botrytis cinerea. j agric food chem. 67:55125520. devesa-rey r., vecino x., varela-alende j.l., barral m.t., cruz j.m. and moldes a.b. 2011. valorization of winery waste vs. the costs of not recycling. waste manage. 31:2327-2335. d’onofrio c., cox a., davies c. and boss p.k. 2009. induction of secondary metabolism in grape cell cultures by jasmonates. funct plant biol. 36:323-338. ewald p., delker u. and winterhalter p. 2017. quantification of stilbenoids in grapevine canes and grape cluster stems with a focus on long-term storage effects on stilbenoid concentration in grapevine canes. food res int. 100:326-331. flamini r., de rosso m., de marchi, f., dalla vedova a., panighel a., gardiman m., maoz i. and bavaresco l. 2013. an innovative approach to grape metabolomics: stilbene profiling by suspect screening analysis. metabolomics 9:1243-1253. fernández-mar m.i., mateos r., garcía-parrilla m.c., puertas b. and cantos-villar e. 2012. bioactive compounds in wine: resveratrol, hydroxytyrosol and melatonin: a review. food chem. 130:797-813. gorena t., saez v., mardones c., vergara c., winterhalter p. and von baer d. 2014. influence of post-pruning storage on stilbenoid levels in vitis vinifera l. canes. food chem. 155:256-263. gruau c., trotel-aziz p., villaume s., rabenoelina f., clément c., baillieul f. and aziz a. 2015. pseudomonas fluorescens pta-ct2 triggres local and systemic immune response against botrytis cinerea in grapevine. mol plant microbe interact. 28:1117-1129. guerrero r.f., biais b., richard t., puertas b., waffo-teguo p., merillon j.-m. and cantos-villar e. 2016. grapevine cane's waste is a source of bioactive stilbenes. ind crops prod. 94:884-892. houillé b., besseau s., courdavault v., oudin a., glévarec g., delanoue g., guérin l., simkin a. j., papon n., clastre m., giglioli-guivarc’h n. and lanoue a. 2015. biosynthetic origin of e-resveratrol accumulation in grape canes during postharvest storage. j agric food chem. 63:1631-1638. jiang l., jin p., wang l., yu x., wang h. and zheng y. 2015. methyl jasmonate primes defense responses against botrytis cinerea and reduces disease development in harvested table grapes. sci hortic. 192:218-223. lambert c., richard t., renouf e., bisson j., waffo-teguo p., bordenave l., ollat n., merillon j.-m. and cluzet, s. 2013. comparative analyses of stilbenoids in canes of major vitis vinifera l. cultivars. j agric food chem. 61:11392-11399. pezet r., gindro k., viret o. and richter h. 2004. effects of resveratrol, viniferins and pterostilbene on plasmopara viticola zoospore mobility and disease development. vitis 2:145-148. ital. j. food sci., vol. 32, 2020 320 rayne s., karacabey e. and mazza g. 2008. grape cane waste as a source of trans-resveratrol and trans-viniferin: highvalue phytochemicals with medicinal and anti-phytopathogenic applications. ind crops prod. 27:335-340. schnee s., viret o. and gindro k. 2008. role of stilbenes in the resistance of grapevine to powdery mildew. physiol mol plant pathol. 72:128-133. schnee s., queiroz e.f., voinesco f., marcourt l., dubuis p.h., wolfender j.l. and gindro, k. 2013. vitis vinifera canes, a new source of antifungal compounds against plasmopara viticola, erysiphe necator, and botrytis cinerea. j agric food chem. 61:5459-5467. shen t., wang x.-n. and lou h.-x. 2009. natural stilbenes: an overview. 2009. nat prod rep. 26:916-935. shrivastava a. and gupta v.b. 2011. methods for the determination of limit of detection and limit of quantitation of the analytical methods. chron young sci. 2:21-25. vergara c., von baer d., mardones c., wilkens a., wernekinck k., damm a., macke s., gorena t. and winterhalter p. 2012. stilbene levels in grape cane of different cultivars in southern chile: determination by hplc-dad-ms/ms method. j agric food chem. 60:929-933. vincenzi s., tomasi d., gaiotti f., lovat l., giacosa s., torchio f., río segade s. and rolle l. 2013. comparative study of the resveratrol content of twenty-one italian red grape varieties. s afr j enol vitic. 34:30-35. wang w., tang k., yang h.-r., wen p.-f., zhang p., wang h.-l. and huang w.-d. 2010. distribution of resveratrol and stilbene synthase in young grape plants (vitis vinifera l. cv. cabernet sauvignon) and the effect of uv-c on its accumulation. plant physiol biochem. 48:142-152. yin x., singer s.d., qiao h., liu y., jiao c., wang h., wang x., li z., fei z., wang y., fan c. and wang x. 2016. insights into the mechanisms underlying ultraviolet-c induced resveratrol metabolism in grapevine (v. amurensis rupr.) cv. “tonghua-3”. front plant sci. 7:1-16. zhang a., fang y., li x., meng j., wang h., li h., zhang z. and guo z. 2011. occurrence and estimation of transresveratrol in one-year-old canes from seven major chinese grape producing regions. molecules 16:2846-2861. paper received july 17, 2019 accepted november 26, 2019 ijfs#1336_bozza ok ital. j. food sci., vol. 31, 2019 459 paper factors affecting the spectrophotometric quantification of flavonoids in wine o. corona*1, m. squadrito1 and a. tirelli2 3dipartimento scienze agrarie, alimentari e forestali, università di palermo, viale delle scienze 4, 90128 palermo, italy 3dipartimento di scienze per gli alimenti, la nutrizione e l’ambiente, università di milano, via celoria 2, 20133 milano, italy *corresponding author: tel.: +3909123897058; fax: +39091484035 e-mail address: onofrio.corona@unipa.it abstract the quantification of flavonoids in wine and grape skin extract by spectrophotometric evaluation at 280 nm wavelength provides essential information to oenologist concerning wine composition and evolution, and it is commonly applied in wine labs. the measurement of the absorption peak height at 280 nm reported by di stefano and guidoni (1989) allows to selectively quantify flavonoids with minor interferences. however, it has proved to be susceptible to so2 at low ph or acetone in unpurified grape skin extracts. moreover, the effect of ph on flavonoids quantification in wine, either containing so2 or not, has not been assessed. the effect of so2, purification, ph and dilution solvent on spectrophotometric quantification of flavonoids in red wine samples has been evaluated in this work. so2 can overrate the flavonoids content in red wine when ethanol and clions are contained in acid dilution solvents. a wine sample dilution with a strong acid solvent is mandatory to attain a reliable quantification of flavonoids due to the low anthocyanins absorption at 280 nm in water solution. a minor effect arises from the ethanol content. eventually, flavonoids can be quantified in so2-containing wine diluted with a strong acid solution but a 7% overrating should be expected. keywords: polyphenol index, flavonoids, anthocyanins, so2; hyperchromic effect, bathochromic effect ital. j. food sci., vol. 31, 2019 460 1. introduction the amount of polyphenols, especially flavan-3-ols and anthocyanins, affects astringency, bitter taste and green/woody properties of red wine (gibbins and carpenter, 2013; soares et al., 2015). their fast quantification in wine-making and wine ageing is crucial in winery since it makes it possible to carefully address the oenological choices involving the duration and conditions of maceration and ageing. flavonoids are quantitatively the main phenol fraction in red wine by far; therefore, many analytical methods are based on the quantification of total polyphenols (aleixandre-tudo et al., 2017). however, many of them are poorly selective or accurate (folin and denis, 1912; singleton and rossi, 1965) and require quite complex analytical approaches (garcía-guzmán et al., 2015) or even expensive analytical instrumentation fo r quality control laboratories (kennedy and jones, 2001). the spectrophotometric methods are still among the fastest, easy to apply and cheapest for the oenologist; therefore, they are usually applied in the winery laboratories (aleixandre-tudo et al., 2017). the spectrophotometric analytical approach reported by di stefano and guidoni (1989) is widespread and routinely applied in the wineries to achieve a fast and reliable evaluation of flavonoids in grape extract and wine. it is based on the absorption spectrum obtained in the wavelength range 230–700 nm of a diluted sample. the peak height measured at 280 nm (e280) subtracted from the absorbance measured at its valley-to-valley baseline returns the absorbance value mainly due to the flavonoids (e’280). such an approach allows to avoid the interference due to compounds without an absorption peak at 280 nm like aromatic amino acids, nucleosides and nucleotides (somers and ziemelis, 1985). wine dilution with strong acid solutions allows to quantify the total anthocyanin content based on the height of the absorbance peak at about 520 nm of the spectra. an easier wine dilution with distilled water is commonly applied to assess the total flavonoids based on the e’280. however, there is a lack of information about the analytical factors affecting the accuracy of this approach, in spite of its widespread use at wine control laboratories. corona et al. (2015) pointed out the interference exerted by so2 (as an undissociated molecular form) in quantifying flavonoids extracted from the grape berry and dissolved in a strong acid solvent like ethanol-hydrochloric acid mixture (etoh-hcl). a further interference can arise from residual amounts of acetone used as extraction solvent of phenols. both so2 and acetone can be easily removed by solid phase extraction (spe) packed with a c18 resin (corona at al., 2015). it is well-known that sulfites can negatively affect the spectrophotometric quantification of anthocyanins at wine ph and acetaldehyde is needed to effectively remove the so2 bound to anthocyanins (usseglio-tomasset et al., 1982; mazza et al., 1999). recently, so2 proved capable of forming sulfonated adducts of flavan-3-ols over wine aging (arapitsas et al., 2014). the binding involves the c4 position of the flavan ring and only monomeric flavan-3-ols and the terminal flavanol unit of proanthocyanindins are expected to undergo sulfonation in time. sulfonation of elongation flavanol units has not been reported, possibly owing to steric hindrance issues. the spectrophotometric properties of flavanol-sulfite adducts are unknown, as well as their role in flavonoid quantification. however, their low relative abundance has to be considered, especially in young wine (arapitsas et al., 2018). poor information is available about the role exerted by so2 in wine concerning the quantification of flavonoids based on the e’280 value, especially when strongly acidic solutions (ph < 1) are used as a dilution solvent to attain the quantification of anthocyanins in the meantime. moreover, there is a lack of information about how the composition and acidity of the dilution solvent affect the quantification of total flavonoids assessed using the e’280 value. ital. j. food sci., vol. 31, 2019 461 in this work the effects of so2, ethanol concentration, acid and ph on the absorbance values e280 and e’280 assessed in diluted red wine samples were assessed to monitor their role on the quantification of wine flavonoids. 2. materials and methods 2.1. chemicals methanol, ethanol, sulphuric acid, hydrochloric acid, tartaric acid, ethanol, sodium hydroxide, citric acid monohydrate, potassium phosphate monobasic, sodium phosphate dibasic, hydrogen peroxide solution (30% w/w in water), ethyl acetate, polyvinylpolypyrrolidone (pvpp) and bromocresol green methyl red indicator were purchased from sigma-aldrich (st. louis, mo, usa). sodium metabisulphite and phosphoric acid were purchased from j.t. baker (deventer, holland). seeds and white and red grape tannins were provided by bono and ditta s.p.a. italian grape juice from campobello di mazara (trapani, italy). 2.2. wine samples sixty different commercial red wine samples produced in the years 2013–2015 were collected at the market and submitted for the evaluation of total anthocyanin and total flavonoid contents. moreover, the spectrophotometric response obtained following different dilution conditions of eight samples of red wine obtained from nero d’avola grape (vintages 2013–2015), nerello mascarese grape (vintage 2015), cabernet sauvignon grape (vintage 2014 and 2015) and merlot (vintage 2014) was assessed. all measurements were performed in triplicate. 2.3. purification of flavonoids half millilitre of wine sample was diluted with 5 ml h2so4 5 mm and loaded into a 400 mg c18 spe cartridge (sep-pak, waters, milan, italy) previously conditioned with 2 ml methanol and then 3 ml h2so4 5 mm. the polar compounds were eluted with 3 ml h2so4 5 mm to drying and discarded, then the phenols were collected into a 25 ml volumetric flask by eluting with 3 ml methanol and brought to volume with one of the following solvents: h2o, 0.5 m h2so4, ethanol:h2o:12 m hcl 70:30:1 (v/v/v) (etoh-hcl). the same solutions were also used for diluting 0.5 ml of the wine samples to 25 ml in volumetric flasks. triplicate preparations were carried out. 2.4. determination of total flavonoids flavonoids were purified by treatment with spe procedure. the uv-visible absorption spectra in the range 230–700 nm wavelength of either unpurified or purified flavonoids were recorded, and the absorption values at 280 nm (e280) were measured. triplicate preparations were carried out. the e’280 value was also measured according to di stefano and guidoni (1989) and modified by corona et al. (2015). the total flavonoid content was calculated according to di stefano and guidoni (1989) and corona et al. (2010) as follows: total flavonoids (as mg/l (+)-catechin equivalent): 82.4 × e’280 × 50. ital. j. food sci., vol. 31, 2019 462 2.5. absorbance parameters of white grape skin extract buffered solutions at ph 1.1, 3.0, 5.0 and 7.0 were prepared according to küster et al. (1979) and used for dissolving 30 mg/l grape skin extract. their uv-visible absorption spectra in the range 230-400 nm wavelength were recorded and the values of λmax, e280 and e’280 were measured. triplicate preparations were carried out. 2.6. purification of anthocyanins from red grape skin extract phenols from red grape skin extract were obtained from the skin of 50 berries by using a tartaric buffer (5 g tartaric acid, 22 ml naoh 1 n, 2 g na2s2o5, 125 ml ethanol 95–96%, brought to 1 l with h2o). anthocyanins were obtained from the extract as follows. three millilitres of h2so4 0.5 m and 6 g of pvpp were added to 60 ml of skin extract. the mixture was stirred for 2 min, then centrifuged at 2000 g × 10 min and the pvpp was recovered and then rinsed with 20 ml of h2so4. the mixture was centrifuged as above and the pvpp was recovered. the anthocyanins absorbed on the pvpp were dissolved by dispersing the pvpp into 15 ml etoh-hcl solution and centrifuging at 2000 g × 10 min. the addition of etoh-hcl solution and the centrifugation were carried out four times again, and all the five supernatants were collected and blended in a 100 ml evaporation flask. the ethanol contained in the anthocyanins solution was removed by vacuum-drying and the water solution was transferred in a 100 ml extraction funnel. the residual flavan3-ols were removed by a triplicate extraction with 10 ml ethyl acetate each. the purified anthocyanin extract was transferred in a 100 ml evaporation flask and the residual ethyl acetate was removed by vacuum drying. finally, the dried anthocyanins were dissolved with 50 mm h2so4 10 ml and recovered. 2.7. absorbance parameters of anthocyanins one millilitre of either red skin extract or purified anthocyanins solution was diluted to 25 ml with buffer solutions at ph 1.1, 3.0, 5.0 and 7.0 prepared according to küster et al. (1979) or with 0.1 m hcl solutions containing 10, 20, 40 or 80% ethanol. their uv-visible absorption spectra in the range 230–700 nm wavelength was recorded, and the values of maximum absorption wavelengths in the range 275-282 nm (λmaxuv) and in the range 510-550 nm (λmaxvis) were measured, as well as their absorption values (e280, e’280, e520). 2.8. determination of so2 in wine samples the so2 content in wine was carried out according to the functional eec in 2376 (1990) standard procedures. triplicate determinations were carried out. 2.9 statistical analysis analysis of variance (anova) and tukey’s honestly significant difference (hsd) test to calculate significant differences between treatments were carried out. all tests were performed at a significance level of p < 0.05 using the statistical program spss (ver. 13, ibm, armonk, ny, usa). ital. j. food sci., vol. 31, 2019 463 3. results and discussion a fast quantification of total flavonoids and anthocyanins in wine can be achieved by measuring the spectrophotometric values e’280 and e520 of the sample diluted with an acid solution. however, such an approach can overrate the flavonoid content owing to the presence of gallic acid. so2 has an absorption peak close to 280 nm (276 nm) and diluting wine in strong acid solutions might increase the e’280 value, thus inducing a major overrating of the flavanol concentration (corona et al., 2015). wine dilution with ethanol-hcl can further increase the absorbance of so2 owing to the bathochromic and hyperchromic effects induced by ethanol and cl-, respectively. so2 can be removed from the wine sample by spe packed with a c18 resin (corona et al., 2015). to assess the effect of sample purification on the spectrophotometric quantification of flavonoids, the analytical responses of 61 spe-treated and untreated red wine samples, both of them diluted in an ethanol-hcl solution, were compared (fig. 1). figure 1. comparison of e’280 values obtained for wine samples and their corresponding spe-treated wine (n=3). all the samples were diluted with etoh-hcl solution. a good correlation (r2 = 0.979) was obtained; however, the slope of the regression line shows the e’280 values of wine were 6-7% higher than the corresponding spe-treated wine. such an overrating was expected as spe purification removes the polar phenols unretained on the spe resin, namely gallic acid, tyrosine and tyrosol (di stefano and guidoni, 1989). however, the role of so2 is hard to assess in unknown samples, even though it was proved in the previous work of corona et al. (2015). therefore, a known addition of so2 in real wine samples is expected to increase the e’280 value, but such an interference is hard to quantify owing to the occurrence of different ph values as well as quality and content of so2-binding compounds (ethanal, anthocyanins, pyruvate or other carbonyl compounds). to better focus the interference of so2 on the quantification of flavonoids, the absorption spectra obtained from red wine samples containing different concentrations of so2 either submitted or not to spe purification of flavonoids and diluted with acid solutions with different ph values were compared (table 1). following the purification step, the e280 values of the acid-diluted samples decreased by up to -20% in accordance with the work of somers and zimelis (1985) (table 1). ital. j. food sci., vol. 31, 2019 464 table 1. value of λmax, e280 (as au) e’280 (as au), flavonoids (as mg/l (+)-catechin equivalent) and so2 (mg/l) in wine and spe-treated wine samples diluted with different solutions. wine and vintage year wine spe-treated wine so2 level in wine h2o 5 × 10 -1 m h2so4 ethanol-hcl h2o 5 × 10-1 m h2so4 ethanol-hcl total free nero d'avola 13 λmax 276.0±0.00 a 277.5±0.71b 278.5±0.71b 278.0±0.00a 279.0±0.00a 280.0±0.00a 59.5±1.2 17.3±0.3 e280 0.428±0.01 a 0.466±0.02b 0.484±0.00b 0.378±0.00a 0.400±0.00b 0.390±0.00ab e'280 0.129±0.00 a 0.168±0.00b 0.175±0.00b 0.126±0.00a 0.162±0.00b 0.163±0.00b total flavonoids 1068±11a 1384±87b 1445±9b 1037±12a 1337±22b 1345±11b nero d'avola 13 λmax 277.0±0.00 a 277.0±0.00a 279.0±0.00a 278.5±0.71a 279.0±0.00a 280.0±0.00a 61.1±1.1 17.9±0.1 e280 0.450±0.00 a 0.504±0.01b 0.543±0.00c 0.384±0.07a 0.446±0.01b 0.435±0.00b e'280 0.148±0.00 a 0.186±0.01b 0.201±0.01b 0.125±0.00a 0.184±0.01b 0.187±0.00b total flavonoids 1219±29a 1533±33b 1660±10c 1034±19a 1514±11b 1542±10b nero d'avola 14 λmax 276.0±0.00 a 276.5±0.71b 278.0±0.00b 278.0±0.00a 278.0±0.00a 280.0±0.00a 1.3±0.0 0.6±0.0 e280 0.384±0.01 a 0.403±0.00ab 0.419±0.01b 0.342±0.00a 0.358±0.00b 0.345±0.00a e'280 0.114±0.00 a 0.131±0.00ab 0.140±0.00b 0.106±0.00a 0.136±0.00b 0.130±0.00b total flavonoids 938±22a 1076±43b 1154±43b 873±4a 1122±22c 1071±11b nero d'avola14 λmax 276.0±0.00 a 276.5±0.71ab 278.0±0.00b 278.0±0.00a 278.5±0.71a 280.0±0.00a 1.3±0.0 0.6±0.0 e280 0.415±0.00 a 0.431±0.00ab 0.456±0.02b 0.368±0.00a 0.395±0.01a 0.397±0.00a e'280 0.122±0.00 a 0.139±0.01ab 0.160±0.01b 0.120±0.00a 0.146±0.01b 0.154±0.01b total flavonoids 1007±33a 1145±20ab 1314±120b 992±11a 1203±20b 1273±9c nero d'avola 15 λmax 276.0±0.00 a 277.0±0.00a 279.0±0.00b 278.0±0.00a 279.0±0.00a 280.0±0.00a 24.3±1.2 8.7±0.5 e280 0.415±0.00 a 0.432±0.01a 0.447±0.01a 0.379±0.00a 0.385±0.00b 0.389±0.02b e'280 0.122±0.01 a 0.146±0.01ab 0.157±0.01b 0.124±0.00a 0.151±0.00b 0.155±0.01b total flavonoids 1005±11a 1204±20b 1291±43b 1018±4a 1245±21b 1276±22b nero d'avola 15 λmax 278.0±0.00 a 278.5±0.71a 279.0±0.00a 279.0±0.00a 279.0±0.00a 280.0±0.00a 34.3±4.2 11.3±2.4 e280 0.357±0.00 a 0.379±0.00a 0.381±0.01a 0.323±0.00a 0.319±0.00a 0.319±0.00a e'280 0.110±0.00 a 0.112±0.00a 0.113±0.01a 0.105±0.00a 0.107±0.00a 0.108±0.00a total flavonoids 910±4a 923±15a 930±11a 869±11a 884±11a 892±20a ital. j. food sci., vol. 31, 2019 465 nerello mascalese 15 λmax 276.0±0.00 a 277.0±0.00a 278.0±0.00a 278.0±0.00a 278.0±0.00a 279.5±0.71a 35.7±4.2 13.0±2.9 e280 0.344±0.01 a 0.346±0.00a 0.360±0.01a 0.285±0.01a 0.292±0.00a 0.286±0.00a e'280 0.125±0.00 a 0.130±0.00a 0.144±0.00b 0.119±0.01a 0.118±0.00a 0.126±0.00a total flavonoids 1030±22a 1069±10a 1184±22b 982±20a 970±21a 1038±11b cabernet sauvignon 15 λmax 276.0±0.00 a 277.0±0.00a 279.0±0.00b 278.0±0.00a 277.0±0.00a 279.0±0.00a 86.8±7.2 27.9±4.1 e280 0.565±0.00 a 0.591±0.01b 0.626±0.00c 0.514±0.01a 0.585±0.00c 0.542±0.01b e'280 0.185±0.00 a 0.217±0.01b 0.236±0.01c 0.176±0.01a 0.212±0.00b 0.215±0.01b total flavonoids 1524±28a 1786±30b 1948±15c 1453±15a 1736±48b 1772±6b λmax 276.0±0.00 a 277.5±0.71b 278.5±0.71b n.d. n.d. n.d. 62.1±1.3 22.5±0.75 e280 0.416±0.00 a 0.473±0.01b 0.491±0.01b nero d'avola 14 e'280 0.127±0.00 a 0.171±0.01b 0.174±0.01b total flavonoids 1045±15b 1407±23b 1430±17b λmax 276.0±0.00 a 276.5±0.71ab 278.0±0.00b n.d. n.d. n.d. 27.2±1.5 10.8±0.05 e280 0.398±0.00 a 0.432±0.00b 0.479±0.00b nero d'avola 15 e'280 0.107±0.00 a 0.137±0.00b 0.141±0.01b total flavonoids 884±8a 1130±18b 1161±12b λmax 276.0±0.00 a 277.0±0.00a 278.0±0.00a n.d. n.d. n.d. 33.4±1.7 15.3±0.61 e280 0.369±0.00 a 0.402±0.00b 0.429±0.00b cabernet sauvignon 14 e'280 0.124±0.00 a 0.152±0.00b 0.160±0.00b total flavonoids 1022±10a 1253±12b 1322±31b λmax 276.0±0.00 a 277.0±0.00a 279.0±0.00b n.d. n.d. n.d. 89.7±9.1 30.4±0.60 e280 0.413±0.01 a 0.454±0.01b 0.492±0.01b merlot 14 e'280 0.132±0.01 a 0.166±0.01b 0.172±0.01b total flavonoids 1084±38a 1368±19b 1414±10b n = 3 samples; mean value ± standard deviation. n.d.: not determined. different letters in the same row indicate significant differences between wine samples or spe-treated wine samples (tukey’s hsd test, p < 0.05). ital. j. food sci., vol. 31, 2019 466 it is mainly due to the loss of purines, pyrimidines, nucleosides, amino acids and aromatic alcohols occurred following the purification procedure. therefore, the e280 value confirms to be an unsuitable index of the phenol content in wine. the quantification of flavonoids based on the e’280 value shows the major role of the dilution solvent on the measured values. the e’280 values obtained by water dilution of the wine samples were always significantly lower than the sample diluted with acid solutions. the e’280 value increases as the ph decreases, thus suggesting that the so2 plays a role. moreover, the hyperchromic effect detectable only in the wine samples diluted with ethanol-hcl solution further supports such a conclusion. however, a comparable or even higher increase of the e’280 value can be detected after the removal of so2 by spe, even in the samples containing negligible so2 level (nero d’avola 14). neither the bathochromic nor the hyperchromic effects detected in the wine samples, nero d’avola 14, ought to be observed when ethanolhcl instead of a h2so4 solution is used as dilution solvents. moreover, no increase of the e’280 value should be detected in the spe-treated samples following dilution with h2so4 if so2 had a major role. nonetheless, the calculated flavonoids content strongly increases as the ph of the dilution solvent decreases, even in the spe-treated wine samples (table 1). all these data highlight the minor contribution of so2 to the e’280 value and quantification of flavonoids in wine, while ph and solvent composition strongly affect the analytical response. since the variation of e’280 values also occurs with the spe-treated samples where the hydrophobic compounds eluted with methanol from the c18 resin are contained, phenols are likely involved in this behaviour. however, flavan-3-ols, either monomer or polymer, are not expected to be affected by ph values lower than 7, as their pka exceeds 9. therefore, ph variations in the range 0-7 should attain negligible dissociation effects whatever the alcohol content of the adopted diluting solvent (danilewicz, 2003; friedman and jürgens, 2000). as expected trials carried out at ph values spanning from 1 to 7 with different ethanol content did not show any significative effect on the e’280 values recorded for grape phenols extracted from white skin (table 2) and comparable results were obtained when phenols extracted from grape seeds were evaluated (data not shown). therefore, flavan-3-ols and proanthocyanidins, as well as other colourless skin or seed phenols (phenolic acids, flavonols, hydroxystilbenes), can hardly be responsible for the e’280 variations induced by ph and solvent differences. consequently, the role of anthocyanins was investigated. the absorption spectra of anthocyanins are affected by the ph. moreover, the e280 value of their flavilium ion is higher than its neutral form occurring in wine at ph values lower than 6 (março et al., 2011). the e’280 value obtained assessing anthocyanins from red grape skin extract treated by spe packed with pvpp significantly decreases as the ph increases. the e’280 values increase more than 15% by wine acidification (ph 3–4) down to ph 1 (table 1). such a change is lower than it occurs when the absorption peak at 520–540 nm is considered (see elmaxvis in table 3); nonetheless, it can strongly affect the spectrophotometric evaluation of flavonoid by the e’280, especially when wines containing a high amount of anthocyanins are considered (table 3). as the role of ethanol on the absorbance of anthocyanins in diluted wine is well-known (lee et al., 2005), the increase in e520 values following the increased ethanol concentration was expected. ethanol does not affect the e’280 value and only an ethanol level as high as 80% (v/v) shows a minor role. same results were obtained when hcl was replaced with h2so4 (data not shown). if grape skin extract is concerned, increasing e’280 values are clearly visible when the ethanol content increases due to the hyperchromic effect arising from the presence of so2 in the skin extract (table 3). ital. j. food sci., vol. 31, 2019 467 table 2. effect of ph and dilution solvent on the analytical response parameters of phenols extracted from white grape skin. λmax e280 e'280 ph 1.1 283±0.6a 1.193±0.00a 0.279±0.00a 3.0 284±0.6a 1.197±0.01a 0.280±0.00a 5.0 283±0.6a 1.195±0.00a 0.284±0.00a 7.0 283±0.6a 1.195±0.00a 0.284±0.00a ethanol %, 0.1 m hcl 0% 283±0.6a 1.145±0.00a 0.277±0.00ab 10% 283±0.6a 1.146±0.00a 0.279±0.00b 20% 282±0.0a 1.143±0.01a 0.275±0.00ab 40% 282±0.6a 1.143±0.00a 0.274±0.00ab 80% 282±0.0a 1.149±0.00a 0.270±0.00a n = 3 samples; mean value ± standard deviation. different letters in the same column indicate significant difference between dilution solvents (tukey’s hsd test, p < 0.05). table 3. effect of ph, dilution solvent and purification on some spectrophotometric parameters of grape skin anthocyanins. n = 3 samples; mean value ± standard deviation. different letters in the same column indicate significant difference between treatments (tukey’s hsd test, p < 0.05). 4. conclusions our data highlight that the dilution of wine with water to assess the total flavonoid content by the e’280 value prevents from the spectrophotometric interference of so2 in the analytical response unless it occurs at concentration values exceeding the permitted λmaxuv e280 e'280 λmaxvis eλmaxvis ph purified anthocyanin 1.1 277.0±0.0b 0.466±0.01c 0.221±0.02c 519±0.0a 0.618±0.01d 3.0 277.0±0.0b 0.414±0.00b 0.186±0.00bc 519±0.0a 0.464±0.00c 5.0 276.5±0.7b 0.371±0.00a 0.155±0.00b 519±0.0a 0.192±0.00b 7.0 275.0±0.0a 0.351±0.01a 0.099±0.00a 551±0.0b 0.088±0.00a ethanol %, 0.1 m hcl purified anthocyanin 0% 277.0±0.0a 0.436±0.00a 0.241±0.00b 519±0.0a 0.609±0.00a 20% 278.0±0.0a 0.437±0.00a 0.243±0.00b 528±0.0b 0.650±0.00b 40% 279.0±0.0a 0.435±0.00a 0.246±0.00b 536±0.0c 0.684±0.00c 80% 280.0±0.0a 0.431±0.00a 0.229±0.00a 544±0.0d 0.730±0.00d ethanol %, 0.1 m hcl red grape skin extract 0% 278.0±0.0a 0.854±0.04a 0.315±0.00a 520±0.0a 0.305±0.01a 20% 278.0±0.0a 0.882±0.01a 0.331±0.01a 527±0.0b 0.336±0.00ab 40% 279.0±0.0a 0.892±0.02a 0.334±0.01a 535±0.0c 0.358±0.01bc 80% 280.0±0.0a 0.916±0.03a 0.341±0.01a 542±0.0d 0.381±0.01c ital. j. food sci., vol. 31, 2019 468 amounts in wine. however, under such conditions the interference exerted by the polar non-flavonoid phenols and acid equilibrium of anthocyanins induces a biased quantification. on the other hand, wine dilution with etoh-hcl can induce an overrated quantification due to both the interference of so2 in low ph solutions and the hyperchromic effect exerted by cl-. such interferences can be avoided by carrying out the spe purification of wine and then diluting the sample with an acid solution (ph < 1). acknowledgments the authors thank prof. rocco di stefano for his valuable technical suggestions and dr fabio ditta of the “bono and ditta s.p.a. italian grape juice” campobello di mazara (sicily) for providing grape seed tannins. references aleixandre-tudo j.l., buica a., nieuwoudt h., aleixandre j.l. and du toit w. 2017. spectrophotometric analysis of phenolic compounds in grapes and wines. j. agric. food chem. 65:4009-4026. arapitsas p., speri g., angeli a., perenzoni d. and mattivi f. 2014. the influence of storage on the “chemical age” of red wines. metabolomics 10:816-832. arapitsas p., guella g. and mattivi f. 2018. the impact of so2 on wine flavanols and indoles in relation to wine style and age. sci. rep-uk 8:858. corona o., squadrito m., borsa d. and di stefano r. 2010. behaviour of some compounds with λmax at 280 nm in the determination of total flavonoids of grape skin extracts made from a hydroalcoholic so2-rich solvent. ital. j. food sci. 22:347-351. corona o., squadrito m., vento g., tirelli a. and di stefano r., 2015. over-evaluation of total flavonoids in grape skin extracts containing sulphur dioxide. food chem. 172:537-542. danilewicz j.c. 2003. review of reactions mechanism of oxygen and proposed intermediate reduction products in wine: central role of iron and copper. am. j. enol. vitic. 54:73-85. di stefano, r. and guidoni s. (1989). la determinazione dei polifenoli totali nei mosti e nei vini. vignevini 16:47-52. eec, 1990. european communities. commission regulation no. 2676/90 on “community analysis methods to use in wine sector”. official journal european communities l272/3.10.90. folin, o., and denis, w., 1912. on phosphotungstic-phosphomolybdic compounds as color reagents. j. biol. chem. 12:239-243. friedman m. and jürgens h.s., 2000. effect of ph on the stability of plant phenolic compounds. j. agric. food chem. 48:2101-10. garcía-guzmán j.j., hernández-artiga m.p., palacios-ponce de león l. and bellido-milla d. 2015. selective methods for polyphenols and sulphur dioxide determination in wines. food chem. 182:47-54. gibbins h.l. and carpenter g.h. 2013. alternative mechanisms of astringency – what is the role of saliva?. j. text. stud. 44:364-375. kennedy j.a. and jones g.p. 2001. analysis of proanthocyanidin cleavage products following acid-catalysis in the presence of excess phloroglucinol. j. agric. food chem. 49:1740-1746. küster f.w., thiel a. and fischbeck k. 1979. tabelle logaritmiche per chimici, farmacisti, medici e fisici. 11a ediz., milano, hoepli. lee j., durst r. w. and wrolstad r.e. 2005. determination of total monomeric anthocyanin pigment contentof fruit juices, beverages, natural colorants, and wines by the ph differential method: collaborative study. j. aoac int. 88:12691278. março p.h., poppi r.j., scarminio i.s. and tauler r. 2011. investigation of the ph effect and uv radiation on kinetic degradation of anthocyanin mixtures extracted from hibiscus acetosella. food chem. 125:1020-1027. ital. j. food sci., vol. 31, 2019 469 mazza g., fukumoto l., delaquis p., girard b. and ewert. b. 1999. anthocyanins, phenolics, and color of cabernet franc, merlot, and pinot noir wines from british columbia. j. agric. food chem. 47:4009-4017. usseglio-tomasset l., ciolfi g. and di stefano r. 1982. the influence of the presence of anthocyanins on the aseptic activity of sulfur dioxide towards yeasts. vini d’italia 24:86-94. singleton v.l. and rossi j.a. 1965. colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. am. j. enol. vitic. 16:144-158. soares s., kohl s., thalmann s., mateus n., meyerhof w. and de freitas v. 2015. different phenolic compounds activate distinct human bitter taste receptors. j. agric. food chem. 61:1525-1533. somers t.c. and ziemelis g. 1985. spectral evaluation of total phenolics components in vitis vinifera: grapes and wines. j. sci. food agric. 36:1275-1284. paper received july 21, 2018 accepted december 18, 2018 ijfs#1351_bozza ital. j. food sci., vol. 31, 2019 184 paper determination of sunset yellow in different brands of orange jellies of bangladesh by hplc a. islam1,2, m. sarker1, s. haque khan3, md. i. hossain4, md. z. abedin1, md. a. zubair1 and l. bari*1 1department of food technology and nutritional science, mawlana bhashani science and technology university, santosh, tangail 1902, bangladesh 2food and human nutritional sciences, university of manitoba, winnipeg, manitoba, canada 3bangladesh university of health science, mirpur, dhaka, bangladesh 4department of biotechnology and genetic engineering, mawlana bhashani science and technology university, santosh, tangail 1902, bangladesh *corresponding author: tel.: +880 1703162053 e-mail address: mslbari@hotmail.com abstract synthetic colorants may have adverse health effects, therefore, it is necessary to ensure controlled use of these colorants in various alimentary products. in this study, 54 samples of six brands of orange jellies were analyzed for the determination of ‘sunset yellow’ color by high performance liquid chromatography. the results showed that the value of sunset yellow in one brand of orange jelly exceeded the bangladesh standard and testing institute (bsti) value, the values in four other brands were within the range of the bsti value, and it was absent in the last one. one brand yielded more than twice the maximum bsti value and four times the maximum value from the european union. these results indicated that there is a need to monitor the amounts of synthetic colorants used in food products to protect the public health from serious adverse effects related to such chemicals and to create awareness to the consumers as well as policy makers. keywords: hplc, orange jellies, sunset yellow-fcf, synthetic food color, bsti ital. j. food sci., vol. 31, 2019 185 1. introduction sunset yellow (sy) is a common synthetic food color, appearing reddish-orange upon application, that is added to food to improve the color, texture, and overall appearance (kucharska and grabka, 2010; abbey et al., 2014). dairy products, cereals, candies, jellies, ice-cream, soft drinks, yogurts, fillings, liqueurs, and powdered juices are the most common food items in which this dye is added (meinicke and jorge, 2008; yuan et al., 2016). overuse of synthetic colorants is a major source of food intoxication (koutsogeorgopoulou et al., 1998). there are various adverse health effects associated with ingesting excess amounts of synthetic colorants, such as cancer, genetic diseases, etc. (tsuda et al., 2001; das and mukherjee, 2004), asthma, abortions, weakened immune systems, and allergic reactions (geoffrey and felix, 1991; hinton, 2000; bhattacharjee, 2014). additionally, synthetic colorants have been associated with behavioral effects in children, such as hyperactivity, decreased iq scores, and boosted aggression (geoffrey and felix, 1991; hinton, 2000; bhattacharjee, 2014). synthetic sy specifically has been linked with anaphylactic reactions and cardiovascular complications (angioedema, vasculitis, and thromboxane synthesis inhibition) in individuals who present a sensitivity to the compound (sardi et al., 2010). studies have shown that most synthetic colorants bind directly to dna and cause structural and numerical incongruities (hamdy et al., 2000; mpountoukas et al., 2010). in addition, it has been found that semi-toxic doses of sunset yellow leads to changes in total lipid storage of the body when exposed to animal models. as lipids have structural functions in biological membranes of the body, this might stimulate their metabolism and may cause potential liver injuries such as necrosis (mathur et al., 2005). similar to most other developing countries, it is a common scenario in bangladesh that industrial and non-industrial sectors are involved in food production and processing activities. food industry uses various synthetic colorants, which are the most interesting groups of food additives as the colorful food products attract consumers (kucharska and grabka, 2010). however, their range of use and amounts are restricted across the world (sun et al., 2013). the non-industrial sector produces twoto three-times the amount of food items compared to the industrial sector. unfortunately, quality control systems are lacking in the non-industrial sectors, leading to high production of substandard food products potentially compromising the health of consumers and thus, indirectly leading to a financial burden for the nation. based on the results of the international research and recommendation of codex committee on food additives and contaminants (ccfac), the acceptable daily intake (adi) value of food colorants is set across the world (bessonov et al., 2011; ganesan et al., 2011). the adi of permitted food colorants varies from 0.1 mg/kg body weight (erythrosine red) to 25mg/kg body weight (fast green fcf) (swaroop et al., 2011). however, there is warranted concern over the amount of synthetic colorants in food products as certain companies exceed the upper limit recommended by the adi. therefore, it is necessary to monitor the total daily intake of all food colorants to ensure the adi is not exceeded (joint, on food additives, organization and others, 1965, 1991). due to the wide industrial use of food dyes to color foods it is important to determine the amounts of synthetic colorants commonly added to foods in bangladesh. current analytical detection methods are costly and require substantial resources that are not available in bangladesh. therefore, the present study was conducted to determine the color range of sy in different brands of orange jellies collected from different shops of tangail city, bangladesh, using a simple and cost effective high-performance liquid chromatography (hplc) method. the analytical determination of this particular color ital. j. food sci., vol. 31, 2019 186 may aid in establishing a method for detecting synthetic colorants and contribute to overall quality assurance and consumer safety. 2. material and methods 2.1. chemicals and reagents sodium acetate 97%, hplc-grade chloroform, n-hexane, and acetonitrile were obtained from merck (darmstadt, germany). glacial acetic acid was procured from sigma chemical co. (darmstadt, germany). diethyl acetate from rci lifescan ltd. was used. deionised water (18.2 mω) used for chromatography processing was procured from a barnstead nanopure water purification system (barnstead, usa). sunset yellow fcf (e110) was purchased from rayner, co. ltd. (london, england). 2.2. samples a total of 54 samples from six brands of orange jellies (research raw material) were purchased from three stores in tangail city, tangail, bangladesh after getting verbal consent from the shopkeepers. all samples were considered valid based on their expiry dates. the weights of the samples were 200 gm to 500 gm. the collected samples were preserved in refrigerator at 4 °c in the laboratory of the department of food technology and nutritional science, mawlana bhashani science and technology university (mbstu). ethical approval was taken from the research cell of mbstu. 2.3. mobile phase the mobile phase was prepared using the modified method of pylypiw and grether (2000). it consisted of a mixture of 3.0 mm acetate buffer (ph ~4.00) and hplc-grade acetonitrile with a ratio of 17:3. acetate buffer was prepared by mixing of 1.0 ml of glacial acetic acid and 1.0 g of sodium acetate trihydrate in 1.0 l de-ionized water and mixed well. the mixture was filtered with a filter membrane (pore size 0.2 µm). 2.4. preparation of standard solution approximately100 mg of anhydrous sunset yellow was taken in a 25 ml volumetric flask. ten ml 85% aqueous acetonitrile was added to the volumetric flask and was shaken well. finally, 85% aqueous acetonitrile was added up to mark. the solution was filtered with syringe filter. the standard stock solution-1 was labeled as 4 mg/ml. approximately 5 ml of stock solution-1 was taken in 50 ml volumetric flask and mobile phase was added up to the mark. the standard solution-2 was labeled as 0.4 mg/ml standard solution. from the stock solutions, working standard solutions 0.0, 1.0, 5.0, 10.0, 20.0, 40.0 µg/ml were prepared by dilution of aliquots. the solution was filtered through sample filters (pore size 0.2 µm) prior to inject into the column. 2.5. preparation of sample solution approximately 1.0 gm of orange jelly was weighted accurately and placed in a conical flask and it was made to 10 ml by adding aqueous 85% acetonitrile solution and mixed well by vigorous shaking for 10 minutes. about 2.0 ml of the solution was filtered through sample filter (pore size 0.2 µm) and the filtrate was then diluted 5 times and placed in an ital. j. food sci., vol. 31, 2019 187 eppendorf tube. finally, 20 µl was injected into the hplc column. the concentration of injected sample solution was 20 µg/ml. calculation of sample concentration: ! !"×!"" !" !" !"×!""" !" = 0.02 mg/ml=20µg/ml 2.6. sample solution preparation for spiked/recovery assay approximately 2.0 gm of orange jelly and 1.0 mg of sy was weighted accurately and placed in a conical flask and 85% aqueous acetonitrile solution was added to it to make 20 ml solution and mixed well by vigorous shaking for 10 minutes. about 2.0 ml of the solution was filtered through sample filter (pore size 0.2 µm) and the filtrate was then diluted 5 times and placed in an eppendorf tube. finally, 20 µl was injected into the hplc column. the concentration of injected sample solution was 20 µg/ml. 2.7. chromatographic analysis the chromatographic system consisted of a shimadzu isocratic pump, a degasser, column, oven, a uv-vis detector, and a lc workstation class-vp for data acquisition and analysis. each of orange jelly samples of 1.0 g was diluted 1:10 with mobile phase and then the sample was again diluted 1:5 with mobile phase. after that the solution was transferred into dry eppendorf tube. the clear aqueous solution was filtered through a ptfe syringe filter. then the solution was transferred to the dry hplc vials. 20 µl of the sample was injected into the injector. for the chromatographic analysis, a luna 5µ c18 (2) 100a column (250 × 4.6 mm) was used and the column temperature was set at 33 °c. the sunset yellow analysis was performed with isocratic solvent system using sodium acetate and acetic acid buffer (ph ~4.0)/acetonitrile17:3 with a flow rate of 1.0 ml/min. 2.8. sy identification and quantification optimum absorption wavelength for sy color was evaluated before and using standard solutions with uv-spectrophotometer. the determined wavelength for the analysis of sy was 480 nm. several runs were made to determine the retention time for the analysis. the retention time for this color was used for the identification of the color present in different brands of orange jellies. quantification of the studied colors was done by external standard calibration. five level analytical curves (0.00, 1.0, 5.0, 10.0, 20.0, 40.0 µg/ml) were used and the mean of 3 injections of each standard was used to represent each calibration point. by plotting analytes (y) against the concentration (µg/ml) of the color the peak areas were measured. to determine the slope, y-intercept and the correlation coefficients of the standards plots, least square linear regression analysis was used. limit of detection (dl) and limit of quantification (ql) were determined by considering 3 and 10 times the signal to noise ratios respectively estimated by the regression lines as mentioned in the previous report (macdougall et al. 1980). for hplc method validation the performance parameters, i.e., precision, linearity, limit of detection, limit of quantification, the expanded uncertainty were calculated. by spiking known amounts of the studied colors to the unprocessed sample and comparing the output with the same sample without spiking, recovery evaluations were carried out. ital. j. food sci., vol. 31, 2019 188 recoveries were calculated by differences of concentrations and were expressed as percentages. 2.9. statistical analysis each test was performed in triplicate. the descriptive analyses (means, median, standard errors coefficient of variation) were summarized. data were expressed as mean±standard error (se). one-way analysis of variance (anova) was carried out using spss software version 20 at a significance level of 5%. the least significant difference (lsd) test was used to detect differences in means. 3. results and discussion 3.1. analysis of chromatogram numerous analytical methods have been developed for analyzing synthetic colorants in response to the concern regarding their adverse effects. the most preferred technique for quantitative determination of the colorants is using hplc, as it is relatively simple, cost effective, and has less environmental impact due to fewer hazardous chemicals used. in this study, an efficient and accurate hplc analytical method was used for the determination of sunset yellow in different brands of orange jellies collected from local markets of tangail city, bangladesh. this method was simple to use, had good operational stability, and gave reliable and reproducible results. the developed hplc method was applied to analyze the sy color range in orange jellies. the retention time of the sunset yellow standard was 5.62±0.2 minutes and approximate time was set at 10 minutes. (figs. 1 and 2). the calibration curve (fig. 3) for sy was obtained by plotting the peak areas of different concentrations of the working standard solutions (0.0, 1, 5, 10, 20 and 40 µg/ml). the recovery range was 96-131%. table 1 describes the analytical characteristics of the hplc method. there was a strong linear relationship (r2 = 0.999) obtained between the concentration of sy and the peak area within the hplc chromatogram at 480 nm (fig. 3). the detection and quantification limits were calculated as 1.14 mg/100 ml and 3.46 mg/100 ml, respectively. figure 1. hplc chromatogram of 10 µg/ml sunset yellow standard solution with a retention time of 5.625 min. minutes 0 1 2 3 4 5 6 7 8 9 10 vo lts -0.002 0.000 0.002 0.004 vo lts -0.002 0.000 0.002 0.004 1. 21 7 3. 00 0 3. 22 5 5. 62 5 6. 02 5 6. 09 2 6. 35 0 6. 65 8 9. 91 7 detector a (480nm) sunset yellow std 10ugper ml 090715 sunset yellow std 10ugper ml retention time ital. j. food sci., vol. 31, 2019 189 figure 2. hplc chromatogram of sunset yellow present in orange jelly brand-1 (obtained from shop 1) with a retention time of 5.433 min. figure 3. calibration curve for the sunset yellow standard. table 1. analytical characteristics of hplc method. parameter value accuracy 107±14.3 slope 4020 intercept 0 linearity range 1.32 µg/ml to 40 µg/ml correlation coefficient 0.999 steyx 1390 lod 1.14 mg/100 ml loq 3.46 mg/100 ml minutes 0 1 2 3 4 5 6 7 8 9 10 vo lts -0.005 0.000 0.005 vo lts -0.005 0.000 0.005 0. 15 8 0. 32 5 0. 51 7 0. 71 7 4. 65 0 4. 80 0 5. 01 7 5 .4 33 6. 15 0 6. 53 3 7. 20 0 7. 70 0 7. 88 3 8. 07 5 8. 64 2 8. 85 0 detector a (480nm) sunset yellow p3 080715 sunset yellow p3 01 retention time y = 4,0206x r² = 0,99949 0 20 40 60 80 100 120 140 160 180 0 5 10 15 20 25 30 35 40 45 pe ak a re a × 1 03 concentration of std solution in µg/ml ital. j. food sci., vol. 31, 2019 190 3.2. calculation of % recovery of sy in spiked samples approximate 500 µg of sy was added to the 1.0 g of unspiked sample containing sy 4049.41 µg/g. the observed value of sy of the spiked sample was calculated 4560.60 µg/g. so the recovered added sy was 511.19 µg. finally, the % recovery was 102.23%. 3.3. determination of sy in samples the results in tables 2 and 3 show the levels of the sy from the six brands of orange jellies collected from three different shops with different batches. after hplc analysis, majority of the orange jellies contained the same synthetic color as was mentioned on their respective product labels. chromatogram’s peak from five out of the six orange jelly brands, were identified as sy matched with the sy standard. no peak in the chromatogram of the samples of brand 6 was matched to the peak of sy standard. table 2. level of sy (mg/100 g) in different brands of orange jellies. orange jelly concentration of sunset yellow (mg/100 g) mean±sd (n = 3) p-value shop sample 1 sample 2 sample 3 brand 1 1 25.10 27.40 28.70 27.07±1.49 0.118 2 17.30 15.20 25.80 19.43±4.58 3 25.70 28.20 17.90 23.93±4.39 brand 2 1 42.50 40.40 42.00 41.63±0.90 0.351 2 37.33 44.30 39.20 40.28±2.95 3 39.20 40.50 37.90 39.20±1.06 brand 3 1 10.10 8.70 8.89 9.23±0.62 0.833 2 8.89 10.79 7.49 9.06±1.35 3 9.02 9.25 8.07 8.78±0.51 brand 4 1 19.40 18.50 17.40 18.43±0.82 0.109 2 13.8 17.00 18.70 16.50±2.03 3 18.00 20.3 19.70 19.33±0.97 brand 5 1 12.90 13.60 13.30 13.27±0.29 0.003 2 13.10 11.30 12.10 12.17±0.74 3 9.95 11.20 10.10 10.42±0.59 brand 6 1 nd nd nd nd 2 nd nd nd nd 3 nd nd nd nd *nd = not detected. the concentrations of sy in the studied orange jellies varied between 8.78 to 41.63 mg/100 g, depending on the brand in table 2. among the collected samples of brand 1, sy concentration (mean ± sd) of two samples were higher than the bsti value as a whole, but the difference was not statistically significant (p = 0.118). sy values in all samples of brand 1 exceeded the recommended value of eu. when compared to the sy concentration of brand 2, all values exceeded the bsti and eu recommended values. no samples of brand 3 exceeded the eu and bsti values. on the other hand, all samples of brand 4 exceeded ital. j. food sci., vol. 31, 2019 191 the eu recommended value, but did not exceed the bsti value. the sy values in brand 5 sample were within the bsti value, but only one was within the eu value. however, brand 6 showed no trace of sy. a discrepant finding compared to the product label from brand 6 was observed. added synthetic color can be reduced during manufacturing process due to formation of inorganic salts as byproducts e.g. nacl (kirschbaum et al., 2003). orange jellies from brand 2 contained the highest amount (41.63 mg/100 g) of sy in table 3, which was 2 times more than the maximum value of bsti and 4 times from the eu value (fig. 4). again, when comparing among different brands, sy showed significant difference among the brands (p = 0.003) in table 3. among the statistical parameters, the mean value, standard errors, and coefficient of variance were 19.5 mg/100 g, 13.0 and 76% respectively. table 3. summary of concentration of sy (mg/100 g) in selected brands of orange jellies. sample concentration of sunset yellow (mg/100 g) mean ± sd (mg/100 g) (n = 9) p-value shop 1 shop 2 shop 3 brand 1 27.07 19.43 23.93 23.48±3.14 pb = 0.079, pe < 0.001 brand 2 41.63 40.28 39.20 40.37±0.99 pb <0.001, pe <0.001 brand 3 9.23 9.06 8.78 9.02±0.19 pb < 0.001, pe = 0.018 brand 4 18.43 16.50 19.33 18.09±1.18 pb = 0.018, pe <0.001 brand 5 13.27 12.17 10.42 11.95±1.17 pb < 0.001, pe = 0.003 brand 6 nd nd nd nd *nd= not detected; pb – value compared with bsti; pe – value compared with eu. figure 4. comparison of sy concentration in different brands of orange jelly with bsti and eu standard range. alves et al. (2008) showed that the concentration of sy in one brand of mango juice powder was significantly higher compared to the maximum regulated value of 10 mg/100 g. the intakes of colors such as tartrazine, erythrocine and sy were higher in children due to the ingestion of foods containing high concentrations of colors (9.45 and 4.0 mg) (rao and sudershan, 2008). another study showed that the consumption of chewing gum 20 10 23,48 40,37 9,02 18,09 11,95 0 0 10 20 30 40 50 bsti eu brand 1 brand 2 brand 3 brand 4 brand 5 brand 6 c on c. o f s un se t y el lo w (m g/ 10 0g ) brands ital. j. food sci., vol. 31, 2019 192 contains the greatest amount of tartrazine (e102), and jellies contain quinoline yellow (e104), ponceau 4r (e124) and allura red (e129) (malczyk et al., 2015). on the other hand, the consumption of colored beverages significantly increases the adoption of sy (e110) and azorubine (e122) (malczyk et al., 2015). the amount of tartrazine that is not secreted through urine, widely metabolized by intestinal microflora in which some metabolites are absorbed through the intestine ( khera et al., 1979; watabe et al., 1980; elhkim et al., 2007). bento et al. (2015) found the highest concentration containing 75.30±3.85 mgl-1 of ins102 colorant in one sample of milk drink among 15 samples of yogurt and milk drink. they also mentioned that ins122 was the most commonly used dye which was 33% of yogurt and milk drink samples ranging from 1.43 to 11.75 mgl-1. 4. conclusions all but two of the samples tested in this experiment contained sunset yellow in accordance with the standard range accepted by the bsti. sunset yellow was absent in one brand, while the other brand substantially exceeded the amount of sunset yellow compared to the standard range accepted by the bsti and eu. the differences in sunset yellow concentrations across the six brands of orange jellies highlight the need for improved product labeling. by providing this information to consumers and manufacturers would not only be aiding the health of consumers but they would also be assuaging the food adulteration reputation that currently taints the food product system. according to the bangladesh pure food ordinance (2005), there is prohibition of use of intoxicated food color in food. this is considered as a frightening issue which might be hazardous for public health. therefore, further research is required to evaluate different category food products with this method to see the reproducibility of the results described here. acknowledgements authors thank the ministry of science and technology, bangladesh for financial support through grant number 39.009.006.01.00.049.2013-2014/bs-154/154/1-4. s.h.k. designed the study, and a.i. and m.s. collected data from the experiments. a. i. and l. b. contributed to data analysis and manuscript preparation. additional editing was performed by m.i.h. and m.z.a. references were obtained by m.a.z. all authors carefully read and approved the manuscript. references abbey j., fields b., o’mullane m. and tomaska l. d. 2014. food additives: colorants. encycl food saf. 2:459. alves s.p., brum, d.m., branco de andrade, é.c. and pereira netto, a.d. 2008. determination of synthetic dyes in selected foodstuffs by high performance liquid chromatography with uv-dad detection. food chem. 107(1):489. bento w.a.s., lima b.p. and paim a.p.s. 2015. simultaneous determination of synthetic colorants in yogurt by hplc. food chem. 183:154. bessonov v.v, malinkin a.d., perederiaev o.i., bogachuk m.n., volkovich s.v. and medvedev i. 2011. development of methods for determining acrylamide in food products by gas-liquid chromatography. vopr pitan. 80(4):79. bhattacharjee m. 2014. evaluation of mitodepressive effect of sunset yellow using allium sativum assay. int. j. sci. environ. technol. 3(3):1120. das a. and mukherjee a. 2004. genotoxicity testing of the food colours amaranth and tartrazine. int. j. hum. genet. 4(4):277. ital. j. food sci., vol. 31, 2019 193 elhkim m.o., héraud f., bemrah n., gauchard f., lorino, t., lambré c. and poul j.m. 2007. new considerations regarding the risk assessment on tartrazine: an update toxicological assessment, intolerance reactions and maximum theoretical daily intake in france. regul toxicol. and pharmacol. 47(3):308. ganesan l., margolles-clark e., song y. and buchwald p. 2011. the food colorant erythrosine is a promiscuous proteinprotein interaction inhibitor. biochem. pharmacol. 81(6):810. geoffrey b. a. and felix m. b. 1991. canthaxanthin and the eye: a critical ocular toxicologic assessment. j. toxicol. cutan ocul. toxicol. 10(1-2):115. hamdy a., mekkawy a.a., massoud a. and el-zawahry m. 2000. mutagenic effects of the food colour erythrosine in rats. probl. forensic sci. 43:184. hinton, d.m. 2000. us fda“redbook ii” immunotoxicity testing guidelines and research in immunotoxicity evaluations of food chemicals and new food proteins. toxicol pathol. 28(3):467. joint f.a.o., on food additives w.h.o.e.c., organization w.h. and others 1965. specifications for the identity and purity of food additives and their toxicological evaluation: food colours and some antimicrobials and antioxidants, eighth report of the joint fa. joint f.a.o., on food additives w.h.o.e.c., organization w.h. and others 1991. evaluation of certain food additives and contaminants: thirty-seventh report of the joint fa. khera k. s., munro i.c. and radomski j.l. 1979. a review of the specifications and toxicity of synthetic food colors permitted in canada. crc crit. rev. toxicol. 6(2):81. kirschbaum j., krause c., pfalzgraf s. and brückner h. 2003. development and evaluation of an hplc-dad method for determination of synthetic food colorants. chromatographia 57:s115. koutsogeorgopoulou l., maravelias c., methenitou g. and koutselinis a. 1998. immunological aspects of the common food colorants, amaranth and tartrazine. vet. hum. toxicol. 40(1):1. kucharska m. and grabka j. 2010. a review of chromatographic methods for determination of synthetic food dyes. talanta 80:1045. macdougall d., crummett w. b. and others 1980. guidelines for data acquisition and data quality evaluation in environmental chemistry. anal chem. 52(14):2242. malczyk e., wyka j., całyniuk b., zołoteńka-synowiec m., misiarz, m. and gawłowski m. 2015. an assessment of the intake of synthetic food colors by 10-15-year-old children. nurs. publ. health 5(4):323. mathur n., chaudhary v., mehta m. and gupta s. 2005. sunset yellow induced changes in the lipid profile in male albino rat. biochem. cell. arch. 5:197. meinicke r.m. and jorge l.n. 2008. estudo da produção de pigmentos por monascus ruber cct 3802 utilizando glicerol como substrato em cultivo submerso. universidade federal de santa catarina. www.repositorio.ufsc.br/xmlui/handle/123456789/90907 mpountoukas p., pantazaki a., kostareli e., christodoulou p., kareli d., poliliou s. and lialiaris t. 2010. cytogenetic evaluation and dna interaction studies of the food colorants amaranth, erythrosine and tartrazine. food chem. toxicol. 48(10):2934. pylypiw h.m. and grether m.t. 2000. rapid high-performance liquid chromatography method for the analysis of sodium benzoate and potassium sorbate in foods. j. chromatogr. a 883(1):299. rao p. and sudershan r.v. 2008. risk assessment of synthetic food colours: a case study in hyderabad, india. int. j. food saf. nutr. publ. health 1(1):68. sardi m., haldemann y., nordmann h., bottex b., safford b., smith b. and jasti p.r. 2010. use of retailer fidelity card schemes in the assessment of food additive intake: sunset yellow a case study. food addit. contam. 27(11):1507. sun h., sun n., li h., zhang j. and yang y. 2013. development of multiresidue analysis for 21 synthetic colorants in meat by microwave-assisted extraction solid-phase extraction reversed-phase ultrahigh performance liquid chromatography. food anal. method. 6:1291. swaroop v.r., roy d.d. and vijayakumar t. 2011. genotoxicity of synthetic food colorants. j food sc eng. 1(2):128. ital. j. food sci., vol. 31, 2019 194 tsuda s., murakami m., matsusaka n., kano k., taniguchi k. and sasaki y.f. 2001. dna damage induced by red food dyes orally administered to pregnant and male mice. toxicol. sci. 61(1):92. watabe t., ozawa n., kobayashi f. and kurata h. 1980. reduction of sulphonated water-soluble azo dyes by microorganisms from human faeces. food cosmet toxicol. 18(4):349. yuan y., zhao x., qiao m., zhu j., liu s., yang j. and hu x. 2016. determination of sunset yellow in soft drinks based on fluorescence quenching of carbon dots. spectrochim acta a mol biomol. spectrosc 167:106. paper received august 8, 2018 accepted september 9, 2018 ijfs#1071_bozza ital. j. food sci., vol. 31, 2019 264 paper comparison of bioactive compounds and sensory evaluation on edible flowers tea infusion n. hussain*a,b, i. ishakb, n. mohd haritha and g. leong pau kuana adepartment of food technology, faculty of food science and technology, universiti putra malaysia, selangor, malaysia bhalal products research institute, universiti putra malaysia, selangor, malaysia *corresponding author: fax: +60389423552 e-mail address: aryatihussain@upm.edu.my abstract france rose buds, jasmine flower, and osmanthus flower are three edible flowers commonly available in malaysia market. composition of these 3 edible flowers is not widely studied. hence, the caffeine, total phenolic content (tpc), volatile compounds, and overall acceptability of tea infusion from france rose buds, jasmine flower, and osmanthus flower were compared. tea infusion from the edible flowers was prepared by boiling it with distilled water. none solvent extraction was carried out to determine the bioactive compounds. tea infusion of osmanthus flower contains the highest caffeine (4.96±1.94 µg/ml), total phenolic content (4.33±0.03 mg gae/g) and overall acceptability (6.16±2.05) compared to france rose buds and jasmine flower. the jasmine flower was found to have the highest number of volatile compounds (13) compared to france rose buds and osmanthus flower. this study indicates that the edible flowers have the potential for application as food ingredient. keywords: france rose buds, jasmine flower, osmanthus flower, caffeine, volatile compounds, sensory evaluation ital. j. food sci., vol. 31, 2019 265 1. introduction edible flowers commonly seen include cauliflower, broccoli, and artichokes (carter et al., 2007). the edible part of cauliflower and broccoli is made of fleshy flower stalks and clusters of flower buds (carter et al., 2007). edible flower petals and flower buds can be eaten raw in salads. refreshing tea infusion can also be made from the flower petals (lim, 2014). in terms of nutritional value of edible flowers; petal of the flowers is a source of vitamins, minerals, and antioxidants thus contribute to an increase interests for consumption (mlcek and rop, 2011). other than as a decoration and culinary purposes, the nutritive and chemoprotective properties of certain edible flowers are welldocumented or under study. edible flowers can also be classified as nutraceutical food (mlcek and rop, 2011). besides the well-recognized wholesome effects of green and black teas prepared from young leaves of camellia sinensis, hot water infusions (teas) of many other plants also may have health benefits. flavonoids and phenolic acids have been used as antioxidants to prevent oxidative damage and control of diseases caused by oxidative stress (na et al., 2014). flower, seeds, and root of osmanthus flower (osmanthus fragrans) is also used as a acesodyne and as a folk medicine for the treatment of liver, stomachache and for other therapeutic purposes such as aerodontalgia, halistosis, rheumatism and physical pain (peng and ji, 2004). the main bioactive components in the extracts of osmanthus fragrans flowers are flavonoids and phenolic acids (xiong et al., 2014), carotenoids, carotenoid-derivatives and volatile constituents (leffingwell, 2002). jasmine flower (trachelospermum jasminoides) is used in the perfume industry, and the scent has been included in at least 55 commercially sold perfumes (basenotes fragrance search, 2014). the inner bark yields a strong fiber that is utilized for making rope, sacks and paper and the stem is used for treating rheumatism and injury in traditional chinese medicine (ill chan noh, 2011; sheu et al., 2009). most publications on jasmine flower are rather concerned about the content of the plant (jing et al., 2012) than about the flowers (joulain, 1987). france rose buds (rosa sp. var. rosa de castillo) are known as edible flowers and have been used for centuries as food components, either in the fresh form or in processed products, such as confectionary and beverages (girard-lagorce et al., 2001). the combination of health benefits with recognized applicability in cuisine raises the possibility of using rose flowers in functional food products. although the health benefits of some well-known edible flowers are commonly studied, the caffeine content, total phenolic content and volatiles compounds in tea infusion from france rose buds, jasmine flower, and osmanthus flower (osmanthus fragrans) still remain unknown. research on sensory evaluation had been conducted by chen et al. (2010) on the attributes of taste, flavor, and overall acceptance on tea infusion from pu-erh teas. zhu et al. (2016) also conducted evaluation of volatile compounds in infusion of oolong tea (fully fermented camellia sinensis l.). instead of using hedonic scale to rate upon answering the questionnaire, 5 aroma terms were used to define the aroma by well-trained panel of ten members: 2-methylpyrazine for ‘‘roast” note, maltol for ‘‘sweet” note, hexanal for ‘‘green and grassy” note, dipropyl disulfide for ‘‘sulphur” note, phenylethyl alcohol for ‘‘floral” note. for the sensory analysis by benvenuti et al. (2016), 5 different organoleptic characteristics of which spiciness, sweetness, softness, scent, and bitterness were included in the evaluation scheme and were expressed in a scale of 1 to 100. in addition, sensory profile of tea infusion of france rose buds, jasmine flower, and osmanthus flower corresponding to the volatile compositions is still insufficient. therefore, this study was presented to compare the caffeine, total phenolic, volatile compounds, and overall ital. j. food sci., vol. 31, 2019 266 acceptability of the 3 types of edible flowers by untrained panelists. the flowers may be further exploit as a source of natural antioxidant for food and nutraceutical applications. 2. material and methods 2.1. sample preparation france rose buds, jasmine flower, and osmanthus flower were purchased from yin onn shd. bhd. (mid valley city) at lower ground floor 035 & 036, mid valley city megamall, mid valley city, lingkaran syed putra,kuala lumpur, malaysia. extraction was prepared using boiled distilled water by 1: 8.82 ratio (ratio of dry mass sample to boil distilled water). the ratio used was modified from bispo et al. (2002). 2.2. chemicals methanols and acetic acid from fisher scientific, uk and caffeine standard from sigmaaldrich, china were used for high performance liquid chromatography (hplc) analysis. folin-ciocalteu and gallic acid from merck, germany and sodium carbonate from fisher scientific, uk were also used for total phenolic content analysis. 2.3. determination of caffeine content using hplc hplc (shimadzu corporation, japan) was carried out to determine and compare the caffeine content of france rose buds, jasmine flower, and osmanthus flower. the experimental procedure was adopted from bispo et al. (2002) with some modifications. the modifications were on the amount of france rose buds, jasmine flower, and osmanthus flower applied in this study. about 17 g of dried edible flowers were used, instead of 4 g as referred to the method bispo et al. (2002). the extraction time was also changed from 3 min to 10 min. aqueous extract was obtained using 150 ml boiled distilled water with 17 g of dried edible flower for 10 min with continuous stirring. the extracts were filtered using syringe filter (chemolab supplies, malaysia) of 0.45 μm twice (double filter) prior injected into hplc. about 20 μl of each sample was injected into hplc. 2.4. total phenolic content (tpc) analysis tpc of france rose buds, jasmine flower, and osmanthus flower were determined and compared using folin-ciocalteu method. the assay was conducted as described by bhebhe et al. (2015). total phenolic content was expressed as gallic acid equivalents (gae). the results were obtained from representative samples prepared from each concentration. calibration and linear curves were determined. 2.5. analysis of volatile compounds using automated gas chromatography-mass spectrometry (gc-ms) the volatile flavor constituents of each sample were analyzed using trace gc ultra gas chromatography system coupled with tsq quantum xls mass spectrometer system (serial no: tqu03227) from thermo fisher scientific (usa) and capillary column of 30 m × 0.25 mm, 0.25 µm film thickness model tg-5ms (thermo scientific, usa). the detail of experimental procedure was adopted from li et al. (2013). ital. j. food sci., vol. 31, 2019 267 2.6. sensory evaluation sensory analysis of france rose buds, jasmine flower, and osmanthus flower were conducted at room temperature (25±2°c) by 50 untrained panelists who need to complete the questionnaire containing 9-point hedonic scales. the evaluation covered the attributes of taste, color, aroma, and overall acceptability where scale 9 represented like extremely and 1 dislike extremely (hajmohammadi et al., 2016; lim, 2011; zheng et al., 2014). 2.7. statistical analysis the experimental design was completely randomized. statistical analysis and comparisons among means were carried out using the statistical package minitab 17. the data collected was analyzed by one-way analysis of variance. the tukey’s post hoc test was applied for comparison of means, and differences are considered significant at the level of p<0.05. linear regression for correlation analysis was performed using microsoft office excel (2007). 3. results and discussion 3.1. caffeine content caffeine content of france rose buds, jasmine flower, and osmanthus flower were determined as shown in table 1 with 17 g of each samples were brewed using boiled distilled water. from the data collected, it shows that osmanthus flower contain significantly (p<0.05) the highest amount of caffeine (4.96±1.94 µg/ml) than france rose buds and jasmine flower, at 0.17±0.00 µg/ml and 0.67±0.03 µg/ml respectively. el-shahawi et al. (2012) reported that caffeine in tea infusion from tea (camellia sinensis l.) is well-known as natural powerful antioxidant and help in the prevention of cardiovascular diseases and cancers. el-shahawi et al. (2012) also revealed that every consumption of 100 ml of brewed tea infusion (camellia sinensis l.), about 1.04 to 212 mg of total catechins and 0.194 to 5.04 mg of caffeine were found in the tea infusion from 29 commercial green tea samples (camellia sinensis l.) in saudi arabia. coffee, tea, and fruits were the most important food sources of total polyphenols. a total of 437 different individual polyphenols were consumed, including 94 of them consumed at a level 1 mg/day (zamora-ros et al., 2015). to date, no specific dietary intake of caffeine in any food product including edible flowers tea infusion related to antioxidant activity has been reported. el-shahawi et al. (2012) reported that twenty-nine green tea samples (camellia sinensis l.) of different origins (china, japan, indonesia, sri lanka and taiwan) from saudi arabian local market have caffeine content ranged from 0.09 to 2.23 mg/g. d’archivio et al. (2016) also reported that average of 2.5±0.2 mg/g of caffeine was detected in tea infusion of oolong tea (semi-fermented camellia sinensis l.). caffeine content in tea infusion of france rose buds, jasmine flower, and osmanthus flower were relatively much lower than both of the green tea and oolong tea infusion as discussed above. ital. j. food sci., vol. 31, 2019 268 table 1. caffeine content of france rose buds, jasmine flower, and osmanthus flower using hplc. type of flower caffeine (µg/ml) france rose buds 0.17±0.00b jasmine flower 0.67±0.03ab osmanthus flower 4.96±1.94a values expressed as mean±standard deviation (n=2). means with different letters within the same column are significantly different at the level of p<0.05. 3.2. total phenolic content (tpc) the total phenolic content (tpc) was determined by folin-ciocalteu assay and the result was shown in table 2.the result was expressed as gallic acid equivalent (gae). table 2 shows that osmanthus flower had significantly the highest tpc value (4.33±0.03 mg gae/g) among the three edible flowers in this study (p<0.05). in addition, the highest caffeine content was also detected in osmanthus flower at 4.96±1.94 µg/ml (table 1) and this could also be related to the highest total phenolic content of osmanthus flower. similarly, na et al. (2014) reported that the total phenolic contents of osmanthus fragrans was higher 16.00±0.57mg gae/g than the other 50 edible types in a range of 0.63±0.03 to 35.84±1.67 mg gae/g wet weight. the tpc value of tea infusion of osmanthus flower in this study was lower than na et al. (2014). the different results obtained may be due to the different parts of plant used, where leaves had higher content of tpc than fruit, stem, or brunches. species type, age, maturity and or environmental stress may also contribute to differences in phenolic content of a plant (watson, 2014). generally, amount of polyphenols in plants is affected by genetics and environment. external environment also triggers the presence and content of polyphenols for the protection of the plant (watson, 2014). the most efficient solvent for polyphenols extraction was 50% dmf for black tea (fully fermented camellia sinensis l.) and 50% acetone for mate tea. higher phenolic content often linked with higher antioxidant activity where it is health benefiting in terms of medicinal properties such as antibiotic, anti-inflammation, anti-cancer and anti-allergic (bhebhe et al., 2015). table 2. total phenolic content of france rose buds, jasmine flower, and osmanthus flower. type of flower total phenolic content (mg gae/g) france rose buds 3.75±0.03b jasmine flower 4.27±0.02a osmanthus flower 4.33±0.03a results expressed in gallic acid equivalent. values are expressed as mean±standard deviation (n=5). means with different letters within the same column are significantly different at the level of p<0.05 3.3. volatile compounds volatile compounds of france rose buds, jasmine flower, and osmanthus flower were determined by automated headspace gcms with the total retention time of 18.30 min. the ital. j. food sci., vol. 31, 2019 269 chromatography of volatile compounds detected in tea infusion of edible flowers and their relative content were summarized in table 3. about 5 volatile compounds were detected in france rose buds by automated headspace gcms. phenylethyl alcohol was the major volatile compound identified from tea infusion of france rose buds at 57.12%, and this agrees with dudareva and pichersky (2006) that phenylethyl alcohol can be detected in france rose buds. phenylethyl alcohol, also known as benzyl carbinol, 2-phenylethanol, and β-phenylethyl alcohol, is a colorless and viscous liquid, rose-like odor, initially a slightly bitter taste then sweet and reminiscent of peach (fenaroli et al., 2000). phenylethyl alcohol has been used as an antimicrobial, antiseptic, disinfectant, fragrance in perfumes and preservatives (burdock, 1997). compound 1-iodo-2-methylundecane (15.75%), tridecane (3.22%), cis-2-methyl-7octadecene (3.18%), and 1-iodo-2-methylnonane (2.67%), classified as hydrocarbon group were detected in tea infusion of france rose buds. antonelli et al. (1997) showed similar findings where the main component in 24 different rose varieties was phenylethanol, but some roses showed unusually high levels of benzyl alcohol. antonelli et al. (1997) also detected 4-vinylphenol, also known as 4-ethenylphenol, p-vinylphenol, phydroxystyrene, and 4-vp, in two samples of rosa gallica out of 24 different rose varieties, but those volatile compounds was not found as analyzed in this study. tridecane detected in this study was similar to lin et al. (2013) where tridecane was extracted by hsspme in a total of 75 oolong tea (fully fermented camellia sinensis l.) at the ranged of 0.30 to 2.50%. benzyl benzoate (6.81%) and 1,6-octadien-3-ol,3,7-dimethyl(3.81%), also known as linalool, were detected in both tea infusion of jasmine flower and osmanthus flower, similarly as lim (2014). the (r)(-)-linalool was found to be the key odorants of jasmine tea flavor. linalool was identified in a high proportion using different solid-phase micro extraction fibres. a total of 13 constituents were identified in the headspace of jasmine flower, with compound linalool (25.01%) was the highest in proportion, followed by benzyl acetate (23.71%) and 3-hexenyl acetate (13.80%) (lim, 2014). pregna-5, 14-diene-3, 20-diol-18-carboxylic acid, 3-acetate-, lactone were the major volatile compound detected in tea infusion of jasmine flower at 31.98%. however, this volatile compound has never been reported in the similar research as reported by lim (2014). this might be due to the different part of the plants used in the experiments as different part consists of different volatile compounds. volatile compositions vary according to genetics, soil, climate, and agricultural practices (toci and farah, 2008). jasmine flower can be further extracted and incorporated as new food ingredient due to its high volatile compounds. 3.4. sensory evaluation sample preparation for sensory evaluation was conducted under the same preparation method for all the above analysis where the tea infusion was prepared by brewing it with boiling water without addition of sugar or honey. the prepared sample was kept at room temperature 25±2°c. about 50 untrained panelists were required to complete the questionnaire to score the attribute of taste, aroma, color, and overall acceptability. the result was recorded in table 4. although jasmine flower and osmanthus flower are originated from the same order and family, france rose buds and osmanthus flowers show significant different (p> 0.05) in sensory attributes, in terms of taste, aroma, color, and overall acceptability. ital. j. food sci., vol. 31, 2019 270 table 3. volatile compounds and their relative contents detected in france rose buds, jasmine flower, and osmanthus flower using hs gcms. no retention time (min) compound name molecular weight (g/mol) france rose buds (%) jasmine flower (%) osmanthus flower (%) • 4.48 cyclohexene,methyl-5-(1-methylethenyl)-, (r) 5.90 2.79 • 4.93 ethyl2-(5-methyl-5vinyltetrahydrofuran-2yl)propan-2-ylcarbonate 13.38 • 5.21 1,6-octadien-3-ol,3,7-dimethyl(linalool) 154.25 3.81 13.04 • 5.49 phenylethyl alcohol 122.16 57.12 • 6.07 2h-pyran-3-ol,6ethenyltetrahydro-2,2,6trimethyl 5.42 • 6.18 heptanediamide,n,n’-di-benzoyloxy 2.07 • 6.79 1,6-octadien-3-ol,3,7dimethyl-,2aminobenzoate 1.68 8.55 • 7.88 megastigma-4,6(e),8(z)-triene 8.05 • 8.44 1h-3a,7methanoazulene,2,3,4,7, 8,8a-hexahydro-3,6,8,8tetramethyl-, 1.97 • 8.95 3-buten-2-one,4-(2,6,6trimethyl-1-cyclohexen1-yl) 3.53 • 9.04 1,3,6,10dodecatetraene,3,7,11trimethyl-, (z,e) 2.21 • 9.68 3-hexen-1-ol benzoate 1.92 • 10.62 tridecane 184.37 3.22 • 11.19 1-[2-o-benzoyl-3,5-odibenzyl-alpha-dribosyl]-5,6dimethylbenzimide 1.07 • 11.44 benzyl benzoate 212.25 6.81 4.74 • 11.77 phenylmalonic acid monobenzyl ester 9.60 6.21 • 12.06 cis-2-methyl-7-octadecene 3.18 • 12.23 1-iodo-2-methylundecane 15.75 • 12.31 ethanone,2,2-dimethoxy-1,2-diphenyl 6.52 3.55 • 13.51 1-iodo-2-methylnonane 2.67 • 13.56 2-[4-methyl-6-(2,6,6trimethylcyclohex-1enyl)hexa-1,3,5trienyl]cyclohex-1-en-1 carboxaldehyde 3.96 • 13.85 cholest-1-eno[2,1a]naphthalene, 3',4'dihydro 2.38 • 14.23 pregna-5,14-diene-3,20diol-18-carboxylic acid,3acetate-, lactone 31.98 –, not found. four constituents selected for analysis are indicated in bold type. ital. j. food sci., vol. 31, 2019 271 table 4. sensory evaluation on attributes including taste, aroma, color, overall acceptability of france rose buds, jasmine flower, and osmanthus flower. type of flower taste aroma color overall acceptability france rose buds 5.48±2.06a 6.24±1.84a 6.56±1.47a 5.90±1.62a jasmine flower 4.34±2.05b 5.24±1.80b 5.60±1.63b 4.96±1.65b osmanthus flower 5.76±2.36a 6.42±2.07a 6.42±1.66a 6.16±2.05a mean±standard deviation (n = 50). values that are followed by different letters within each column are significantly different (p< 0.05). 1 = dislike extremely, 5 = neither like nor dislike, 9 = like extremely. research on sensory evaluation had been conducted by chen et al. (2010) on the attributes of taste, flavor, and overall acceptance on tea infusion from pu-erh teas. zhu et al. (2016) also conducted evaluation of volatile compounds in infusion of oolong tea (fully fermented camellia sinensis l.). instead of using hedonic scale to rate upon answering the questionnaire, 5 aroma terms were used to define the aroma by well-trained panel of ten members: 2-methylpyrazine for ‘‘roast” note, maltol for ‘‘sweet” note, hexanal for ‘‘green and grassy” note, dipropyl disulfide for ‘‘sulphur” note, phenylethyl alcohol for ‘‘floral” note. for the sensory analysis by benvenuti et al. (2016), 5 different organoleptic characteristics of which spiciness, sweetness, softness, scent, and bitterness were included in the evaluation scheme and were expressed in a scale of 1 to 100. table 4 displays a trend where france rose buds and osmanthus flower were scored significantly (p<0.05) higher than jasmine flower in terms of taste, aroma, color, and overall acceptability. osmanthus flower had the most acceptable sensory attributes with the highest score in terms of taste, aroma, and overall acceptability. despite jasmine flower being scored as the lowest in all sensory attributes, it contains the highest number of volatile compounds among the 3 edible flowers. it is believed that the edible flowers serve more than just as decoration and ornamental plants. 4. conclusions this study compared the bioactive components contained in tea infusion of france rose buds, jasmine flower, and osmanthus flower. it was found that tea infusion of osmanthus flower has the highest caffeine (4.96±1.94 µg/ml), total phenolic content (4.33±0.03 mg gae/g) and overall acceptability (6.16±2.05) compared to tea infusion of france rose buds and jasmine flower. meanwhile, jasmine flower contains the highest number of volatile compounds among the 3 edible flowers. in addition, edible flowers contain the natural bioactive components and may be used in food preparation to reduce or replace the use of synthetic bioactive components. thus, osmanthus flower can be further explored and developed into functional foods, nutraceutical, and pharmaceuticals to prevent and treat diseases caused by oxidative stress. acknowledgements the authors would like to express their gratitude to universiti putra malaysia for their technical support. ital. j. food sci., vol. 31, 2019 272 references antonelli a., fabbri c., giorgioni m.e. and bazzocchi r. 1997. characterization of 24 old garden roses from their volatile compositions. journal of agricultural and food chemistry 45(11):4435-4439. atoui a.k., mansouri a., boskou g. and kefalas p. 2005. tea and herbal infusions: their antioxidant activity and phenolic profile. food chemistry 89(1):27-36. basenotes fragrance search [www document], 2014. www.basenotes.net/fragrancedirectory/?name=&house=&launch=1&launch1=&gender=&avail=any&perfumer=&bottl e=:es=star+jasmin%0d%0a (accessed 9.3.14) www.basenotes.net/fragrancedirectory/. benvenuti s., bortolotti e. and maggini r. 2016. antioxidant power, anthocyanin content and organoleptic performance of edible flowers. scientia horticulturae 199:170-177. bhebhe m., chipurura b. and muchuweti m. 2015. determination and comparison of phenolic compound content and antioxidant activity of selected local zimbabwean herbal teas with exotic aspalathus linearis. south african journal of botany 100:213-218. bispo, m.s., veloso, m.c.c., pinheiro, h.l.c., de oliveira, r.f.s., reis, j.o.n. and de andrade, j.b. 2002. simultaneous determination of caffeine, theobromine, and theophylline by high-performance liquid chromatography. journal of chromatographic science 40(1):45-48. burdock g.a. 1997. encyclopedia of food and color additives, volume 3: crc press, inc. isbn: 9780849394164. carter j., wiecha j.l., peterson k.e., nobrega s. and gortmaker s.l. 2007. planet health: an interdisciplinary curriculum for teaching middle school nutrition and physical activity (second ed.). united states of america human kinetic. isbn-13: 978-0736069182 chen y.-s., liu b.-l. and chang y.-n. 2010. bioactivities and sensory evaluation of pu-erh teas made from three tea leaves in an improved pile fermentation process. journal of bioscience and bioengineering 109(6):557-563. cochran w.g. and cox g.m. 1957. experimental design (second ed.). new york: john wiley & sons. isbn: 978-0-47154567-5 cuevas-juárez e., yuriar-arredondo k.y., pío-león j.f., montes-avila j., lópez-angulo g., díaz-camacho s.p. and delgado-vargas f. 2014. antioxidant and α-glucosidase inhibitory properties of soluble melanins from the fruits of vitex mollis kunth, randia echinocarpa sessé et mociño and crescentia alata kunth. journal of functional foods, 9:78-88. d’archivio a.a., maggi m.a. and ruggieri f. 2016. investigation by response surface methodology of extraction of caffeine, gallic acid and selected catechins from tea using water-ethanol mixtures. food analytical methods, 9(10), 17. donaldson b. 2014. the everything healthy tea book: discover the healing benefits of tea. united states of america adams media. isbn-10: 1440574596 dudareva n. and pichersky e. 2006. biology of floral scent: crc press taylor & francis group. isbn: 9780849322839 el-shahawi m., hamza a., bahaffi s., al-sibaai a. and abduljabbar t. 2012. analysis of some selected catechins and caffeine in green tea by high performance liquid chromatography. food chemistry 134(4):2268-2275. girard-lagorce s., sarramon c. and renault n. 2001. the book of roses. paris: flammarion – pere castor. 160 p. hajmohammadi a., pirouzifard m., shahedi m. and alizadeh m. 2016. enrichment of a fruit-based beverage in dietary fiber using basil seed: effect of carboxymethyl cellulose and gum tragacanth on stability. lwt food science and technology 74:84-91. ill chan noh. 2011. anti-inflammatory and immunosuppressive activity of mixture of trachelospermum asiaticum and paeonia suffruticosa extracts (novel herbal formula si 000902). j. med. plants res. 6. doi: doi.org/10.5897/jmpr12.509. jeszka-skowron m., krawczyk m. and zgoła-grześkowiak a. 2015. determination of antioxidant activity, rutin, quercetin, phenolic acids and trace elements in tea infusions: influence of citric acid addition on extraction of metals. journal of food composition and analysis 40: 70-77. jing l., yu n., zhao y. and li y. 2012. trace chemical constituents contained in trachelospermum jasminoides and structure identification. china j. chin. mater. med. ital. j. food sci., vol. 31, 2019 273 joulain d. 1987. the composition of the headspace from fragrant flowers: further results. flavour fragrance j. 2:149-155. doi: doi.org/10.1002/ffj.2730020403. lee b.-l. and ong c.-n. 2000. comparative analysis of tea catechins and theaflavins by high-performance liquid chromatography and capillary electrophoresis. journal of chromatography a 881(1):439-447. leffingwell j. c. 2002. osmathus (vol. 2(2), 1-9): leffingwell reports. li c., xu f., cao c., shang m.y., zhang c.y., yu j., liu g.x., wang x. and cai s.q. 2013. comparative analysis of two species of asari radix et rhizoma by electronic nose, headspace gc–ms and chemometrics. journal of pharmaceutical and biomedical analysis 85:231-238. lim j. 2011. hedonic scaling: a review of methods and theory. food quality and preference 22(8):733-747. lim t.k. 2014. edible medicinal and non medicinal plants: volume 8, flower: springer. isbn: 978-94-024-0326-8. macadam j.w. 2009. structure and function of plants (first ed.): wiley-blackwell. isbn: 978-0-8138-2718-6. mlcek j. and rop o. 2011. fresh edible flowers of ornamental plants – a new source of nutraceutical foods. trends in food science & technology 22(10):561-569. na l.a., li,s., li h., xu d., xu x. and chen f. 2014. total phenolic contents and antioxidant capacities of 51 edible and wild flowers. journal of functional foods 6:319-330. peng g.q. and ji m.c. 2004. the general condition on the studies of osmanthus in china and its development and utilization. jiangxi science 22:221-226. sheu m.-j., chou p.-y., cheng h.-c., wu c.-h., huang g.-j., wang b.-s., chen j.-s., chien y.-c. and huang m.-h. 2009. analgesic and anti-inflammatory activities of a water extract of trachelospermum jasminoides (apocynaceae). j. ethnopharmacol. 126:332-338. toci a. and farah a. 2008. volatile compounds as potential defective coffee beans’ markers. food chemistry 108(3):11331141. turkmen n., sari f. and velioglu y.s. 2006. effect of extraction solvents on concentration and antioxidant activity of black and black mate polyphenols determined by ferrous tartrate and folin-ciocalteu methods. food chemistry 99:838841. watson r.r. 2014. polyphenols in plants: isolation, purification and extract preparation. united states of america elsevier inc. isbn: 978-0-12-397934-6 xiong l., yang j., jiang y., lu b., hu y., zho, f., mao s. and shen c. 2014. phenolic compounds and antioxidant capacities of 10 common edible flowers from china. journal of food science 79(4):517-525. xu y.-q., zou c., gao y., chen j.-x., wang f., chen g.-s. and yin and j.-f. 2017. effect of the type of brewing water on the chemical composition, sensory quality and antioxidant capacity of chinese teas. food chemistry 236:142-151. yasukawa k., akihisa t., kasahara y., ukiya m., kumaki k., tamura t., yamanouchi s. and takido m. (1998. inhibitory effect of heliantriol c; a component of edible chrysanthemum, on tumor promotion by 12-o-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in mouse skin. phytomedicine 5(3):215-218. zamaros-ros r., knaze v., rothwell j.a., hémon b., moskal a., overvad k., tjønneland a. et al. 2015. dietary polyphenol intake in europe: the european prospective investigation into cancer and nutrition (epic) study. european journal of nutrition 55(4):1359-1375. zheng x., yu y., xiao g., xu y., wu j., tang d. and zhang y. 2014. comparing product stability of probiotic beverages using litchi juice treated by high hydrostatic pressure and heat as substrates. innovative food science & emerging technologies 23:61-67. zhu j., chen f., wang l., niu y. and xiao z. 2016. evaluation of the synergism among volatile compounds in oolong tea infusion by odour threshold with sensory analysis and e-nose. food chemistry 221:1484-1490. paper received november 3, 2017 accepted october 30, 2018 ijfs#1141_bozza ital. j. food sci., vol. 31, 2019 87 paper the effect of intramuscular fat content on the meat quality of plw x pl pigs h. jankowiak*, m. bocian and j. barczak department of animal breeding, faculty of animal breeding and biology, utp university of science and technology in bydgoszcz, 85-084 bydgoszcz, poland *e-mail jankowiak@utp.edu.pl abstract this study aimed to determine the effect of intramuscular fat content (imf) on the quality of meat from plw x pl pigs. meat was evaluated in terms of intramuscular fat content (n=80), technological properties, visual and tactile aspects, and colour measurements. it was demonstrated that meat containing more imf was characterised by higher tenderness and marbling, but lower water content and a lower proportion of the yellow b* colour. furthermore, it had a lower c* saturation, a lower h° hue, and lower muscle pigment content. keywords: pigs, intramuscular fat, meat quality ital. j. food sci., vol. 31, 2019 88 1. introduction there are numerous works indicating a significant role of intramuscular fat content (imf) in determining the traits of pork (fernandez et al., 1999a, b; fortin et al., 2005). its content in meat depends on numerous factors such as species, breed and sex (hocquette et al., 2010; wood et al., 2004; bocian et al., 2009; 2012; jankowiak et al., 2010; tyra and żak, 2012; feeding (wood et al., 2004; alonso et al., 2010), method of maintenance and age of slaughtered animals (andrés et al., 2001), body weight at slaughter (latorre et al., 2004), carcass muscling and subcutaneous fat thickness (pietruszka et al., 2015). irrespective of the above factors, intramuscular fat content is intimately related to some quality traits of meat. intramuscular fat (imf) in pork is one of the main factors that influence the sensory quality parameters of meat, especially suitability for processing and cooking (fernandez et al., 1999a; daszkiewicz et al., 2005; czarniecka-skubina et al., 2010). the number and size of intramuscular adipocytes is related to variability in imf content (hocquette et al., 2010). the muscle fibre microstructure and fibre types -affect the accretion rate of intramuscular fat (fiedler et al., 2003; wojtysiak, 2014). according to de vries et al. (2000), consumers mostly prefer pork with an imf content of 2.5-3%. czarniecka-skubina et al. (2007) stated that pork with a higher (>2.51%) imf content, despite having better processing value, tenderness, juiciness, palatability, and marbling, is less accepted by consumers. a minimum imf content of 1.5% was considered necessary to ensure appropriate juiciness, tenderness, and palatability (fortin et al., 2005). reducing imf content may have a negative impact on sensory and processing features of meat (czarniecka-skubina et al., 2007; bocian et al., 2009). according to ellis (2006) an imf content ranging from 1.8% to 2.6% is an indicator of good quality pork. the most popular and common pig breeds in poland are the polish large white (plw), the polish landrace (pl), and their crossbreds (blicharski and snopkiewicz, 2017). the study aimed to determine the effect of imf on some meat quality traits of polish large white x polish landrace (plw x pl) pigs. 2. materials and methods 2.1. animals and sampling the tested meat was obtained from 80 fattening pigs, f1 crossbreds (polish large white x polish landrace), 50% gilts and 50% hogs. the crossbred plw x pl fattening pigs came from and were kept on the same farm under the same environmental conditions, in accordance with welfare requirements. the animals were fed ad libitum with the same complete mixtures, according to standard requirements (grela and skomiał, 2014). the composition and nutritional value of the complete mix are given in table 1. when fattening was complete, the animals were individually weighed and transported to a slaughterhouse about 100 km away. the slaughter was carried out in accordance with the applicable procedures after a 2-hour rest. the average live weight of slaughtered pigs was 106±9.57 kg. ital. j. food sci., vol. 31, 2019 89 table 1. the nutritional value of feed mixtures. fattening period composition of feed mixture 30 to 70 kg 70 to 110 kg ground wheat (%) 20 15 ground barley (%) 25 10 ground triticale (%) 40 60 protein concentratea (%) 15 15 metabolizable energy (mj/kg) 13.20 13.34 crude protein (g/kg) 156 158 acomposition: metabolizable energy, 13.30 mj/kg; crude protein, 37.60%; crude fibre, 2.50%; crude ash, 17,80%; crude fat, 1.20%; ca, 4.40%; p, 1.20%; na, 1.0%; lysine, 4.50%; methionine, 0.56%; tryptophan, 0.50%; threonine, 1.60%; methionine + cystine, 1.40%. vitamin-micromineral per kilogram of complete diet: vitamin a (e 672), 60000 iu; vitamin d3 (e 671), 16600 iu; vitamin e alfa tocopheryl acetate, 716 iu; vitamin k3 as sodium sulfate, menadione 16 mg; thiamine, 12 mg; riboflavin, 24 mg; pyridoxine, 20 mg; cobalamin, 200 mcg; biotin, 400 mcg; niacin, 113 mg; ca-d-pantothenate, 70 mg; betaine, 1080 mg; cu, 160 mg as copper sulfate; fe, 640 mg as iron sulfate monohydrate; mn, 320 mg as manganese oxide; zn, 640 mg as zinc oxi; se, 3.0 mg as sodium selenate; i, 16 mg as anhydrous calcium iodate. on the day following the slaughter, the carcass fat and meat content were determined according to różycki and tyra (2010). the thickness of backfat was determined on the cold right half-carcass at points over the shoulder (at the thickest point), on the back (behind the last thoracic vertebra and the first lumbar vertebra), and at three locations over the loin (cross-section of the gluteal muscle): over the rostral edge of the gluteal muscle, in the middle of the gluteal muscle, and over the caudal edge of the gluteal muscle. the arithmetic mean was calculated from the five measurements of backfat thickness. on a cross-section of the longissimus lumborum muscle taken from the last thoracic vertebra and the first lumbar vertebra, the surface contour was measured (loin eye), and then the determined cross-sectional area was measured using the lucia system (image for image processing and analysis, version 4.82.2004). the research did not require the consent of the local ethical committee. 2.2. meat analysis the acidification of muscle tissue at 45 minutes post slaughter (ph45) and at 48 hours post slaughter (ph48h) was determined using an elmetron cp-401 ph-meter with a blade electrode. the equipment was calibrated using elmetron ph 7.0 and ph 4.0 buffers. the meat quality was evaluated at 48 h post slaughter based on the longissimus lumborum muscle, which were stored at a temperature of 4-6°c. water-holding capacity (whc) was determined using the method developed by grau and hamm (1952) and modified by pohja and niinivaara (1957). a 300 mg sample of minced meat was placed on a whatman 1 filter paper and put between two glass plates; then an even load of 2 kg was applied to it for 5 minutes. the area of juice infiltration was used to calculate the percentage of free water content in the meat, assuming that 1 cm2 of infiltration corresponds to 10 mg of water. the surface of meat juice infiltration was measured using a lucia computer analysis system (system for image processing and analysis, version 4.82.2004). thermal drip was determined at 48 h post slaughter using the method developed by walczak (1959). a 20 g sample of minced meat (20 g) was placed in a hygroscopic gauze and heated in a water bath at a temperature of 85°c for 10 min. after taking the ital. j. food sci., vol. 31, 2019 90 sample out of the water bath, the gauze was removed, then the sample was cooled to a temperature of 4°c and weighed. based on the difference in weight before and after the heat treatment, the percentage weight loss was calculated. shear force was measured using the instron 3342 strength testing equipment with a warner-bratzler attachment (wbsf), in accordance with the methodology provided by szalata et al. (1999). a 120 g meat sample was heated in a water bath until the sample reached a temperature of 70°c on the inside. the heat treatment was performed in a 0.85% nacl solution. then, 10 mm × 10 mm bars were cut along muscle fibres, which were subsequently cut perpendicularly to the muscle fibres. the results were read as maximum shear force expressed in n. the chemical composition of the meat, i.e. water, dry mass, total protein, and intramuscular fat content, was determined in accordance with polish standard pna-82109:2010 with near-infrared transmission spectroscopy (nit) using calibration on artificial neural networks (ann) with the foss foodscan equipment. visual and tactile evaluation was determined 48 h after slaughter on a slice of raw meat weighing 120 g. visual and tactile assessment of the meat was carried out by a trained 10person team. all evaluators had 4 years of experience in assessing pork meat. visual properties of the raw meat were assessed: visual colour intensity according to a 6-grade scale (polish standard pn-iso 4121:1998) on which 1=very light, 6=dark purple; marbling based on canadian and american models on a 10-grade scale (cheng et al., 2015; nppc, 1999) where 1=no intramuscular fat content, 10=very high marbling. tactile evaluation of firmness was on a 7-grade scale (pn-iso 4121:1998) where 1=very firm, 7=very soft. meat colour was also measured on a slice of raw meat at 48 h post slaughter using a minolta cr 310 photocolorimeter (konica minolta, japan) with a measuring port diameter of 50 mm. the equipment was standardized using a cr310 white calibration plate with the following coordinates: y=92.80, x=0.3175 i y=0.3333. colour parameters were determined in the cie system, l*a*b* (l* lightness, a* participation of red, b* participation of yellow) (cie, 1986) using illuminant d 65 and a standard 2° observer. chroma (c*) and hue angle (ho) were calculated according to the formula provided by beattie et al. (1999) and brewer et at. (2001): 𝐶∗ = (𝑎∗)! + (𝑏∗)! , ho=(tan-1 b* / a*) muscle pigment was determined by colorimetry according to the method developed by hornsey (1956). a 40 ml mixture of acetone, water, and concentrated hcl in proportions 40:2:1 was poured over minced meat samples (10 g), which were then extracted for 1 hour. after filtering, the absorbency of the tested solutions was measured using a marcel media spectrophotometer at a wavelength of 640 nm. the optical density value (e) was multiplied by a factor of 680 in order to obtain the proper concentration of hematin expressed as micrograms of hematin per 1 g of meat. 2.3. statistical analysis the results were statistically analysed; the arithmetic mean and the standard deviation for carcass traits, and the standard error (sem) for meat quality traits were calculated. data were verified for homogeneity of variance with the leven’e test; in the absence of homogeneity of variance, statistical significance between groups was calculated using the nonparametric kruskal-wallis test. a probability of p <0.05 was considered statistically significant. ital. j. food sci., vol. 31, 2019 91 the obtained test results were compiled and analysed in three groups that were defined in terms of the intramuscular fat content (imf) of the meat of the plw x pl pigs according to the normal distribution of features (gaussian curve): group i, <1% of imf content; group ii, 1-2.5% of imf content; group iii, >2.5% of imf content. the meats were divided into imf groups to verify the impact on meat quality of increased imf in the meat of plw x pl pigs. pearson’s simple correlation coefficients between the imf content and the meat slaughter traits and quality traits were calculated to numerically summarize the degree of association between any two variables. all calculations were conducted using statistica pl.8.0 data analysis software (statsoft inc. statistica, 2008). 3. results and discussion the data regarding the quantity and weight measurement of warm carcasses, average backfat thickness, and loin eye area are shown in table 2. the obtained values of average backfat thickness indicate a higher fat content of pig carcass than reported in other studies (czarniecka-skubina et al., 2007; tyra and żak, 2012). table 2. mean and standard deviation of carcass characteristics. mean and standard deviation number (n) 80 hot carcass weight (kg) 86.83±8.61 average backfat thickness (mm) 23.23±5.27 loin eye area (cm2) 53.87±7.41 the characteristics of the technological properties of the tested pork are presented in table 3 and analysed according to the intramuscular fat content. the 16 meat samples fell within the first group (lowest fat content), 48 meat samples within the ii group and 16 meat samples within iii group (highest fat content). in numerous tests, the highest percentage of meat samples had up to 2% of imf (daszkiewicz et al., 2005; tyra and żak, 2012). the imf content in the meat studied ranged from 0.79% to 3.20% and significantly differed between all the groups (p<0.01). the acidity of muscle tissue is one of the parameters that determines meat quality and is used to determine the processing and cooking suitability of meat (kajak et al., 2007). meat acidity is measured 45 minutes after slaughter and is a widely recognised criterion that reflects the intensity of post-slaughter changes that lead to meat quality defects such as pse (hofmann, 1994). the ultimate ph is an indicator of meat quality and is associated with water-holding capacity, colour, and tenderness (kajak et al., 2007). in this study, higher ph45 values were observed in group i than in group iii (p<0.05); this can be explained by the fact that the group with the lowest imf content contained carcasses with values from 6.21 to 6.84 ph, which had an impact on higher ph48 values. the meat ph value measured 48 h post slaughter was the highest in the meat with the lowest imf content and differed significantly between group i and group ii and iii (p<0.01). the results of ph45 and ph48 presented in the paper are compatible with the results obtained by jaworska et al. (2007), who showed that with an increase from 1.72% to 2.63% of imf content in meat, the values of ph45 (6.40 to 6.36) and ph48 (5.52 to 5.50) decreased. czarniecka-skubina et al. (2007) demonstrated that pork with the ital. j. food sci., vol. 31, 2019 92 highest imf content (>2.51%) was characterized by a significantly higher final ph (5.63), compared to meat with the lowest (<1.5%) and average (1.51-2.5%) imf content (5.51 and 5.54) (p<0.05); moreover, it was characterized by a darker colour and lower protein content. daszkiewicz et al. (2005) demonstrated that meat with lower imf content (<1.0%) had lower ph45 (6.17) and similar values to obtained in this study at ph48 (5.44). in turn, klont (2005) indicated that a lower final ph causes the meat to have less water retention capacity and to be lighter in colour, while a higher final ph gives it a darker colour, less juice leakage during storage, and positively effects meat quality traits, i.e. succulence, tenderness and taste. the values obtained and presented in this study of ph45 as well as the final ph were typical for meat of good quality in accordance with the assumptions of hofmann (1994) and klont (2005). table 3. characteristics of the technological properties of meat quality (mean value and standard error) in relation to imf content. group imf i ii iii sem p <1% 1-2.5% >2.5% number (n) 16 48 16 number (%) 20.00 60.00 20.00 imf (%) 0.79a 1.59b 3.20c 0.10 0.001 ph45 6.50 a 6.37 6.32b 0.02 0.027 ph48h 5.54 a 5.46b 5.44b 0.01 0.005 whc (% of free water) 19.38a 19.99 21.67b 0.31 0.033 thermal drip (%) 21.20 21.05 21.75 0.24 0.378 wbsf (n) 55.94a 48.38a 37.46b 1.48 0.001 chemical composition of meat water content (%) 73.30a 74.09b 72.73c 0.12 0.001 total protein content (%) 23.09 23.40 23.11 0.07 0.343 (a-c) row means with different superscripts differ significantly at p<0.01. (a-b) row means with different superscripts differ significantly at p<0.05. imf intramuscular fat content; whc water holding capacity; wbsf warner bratzler shear force (n newton); ph45 ph at 45 minutes post slaughter; ph48h ph at 48 hours post slaughter. the meat with the lowest wbsf (shear force) contained the highest amount of imf (group iii) and was more tender than groups i and ii (p<0.01). van laack et al. (2001) evaluated the impact of ultimate muscle tissue acidity (phu) and imf content on tenderness and tenderization of pork. similarly, ramsey et al. (1990) showed that increasing meat imf content decreases its shear force. the studies demonstrated that, along with increasing imf content of the tested meat, the water content decreased and the dry mass content increased (p<0.01). daszkiewicz et al. (2005) observed a similar relationship between the level of imf and the chemical composition of pork. they showed that as the content of imf and marbling increased, the content of dry matter increased and the content of total protein and ash decreased. table 4 contains the results of a visual and tactile evaluation, and an evaluation of colour and muscle pigment of meat. with the increase in imf, marbling in meat increased (p <0.01). ital. j. food sci., vol. 31, 2019 93 higher marbling of pork is associated with a higher imf content (fernandez et al., 1999a; van der wal et al., 1992; van laack et al., 2001). czarniecka-skubina et al. (2007) showed that meat with the highest imf content (≥2.51%) was characterized by a higher marbling (6.06 points) in relation to meat with the lowest (≤1.5%) imf content (3.92 points). also, przybylski et al. (2010) showed more marbling (4.28 points) in meat with 2.27% imf content compared to 1.67 imf meat (2.70 points) (p <0.05). table 4. the results of visual and tactile evaluation of meat colour and muscle pigment content (mean value and standard error) in relation to imf content. group imf i ii iii sem p <1% 1-2.5% >2.5% visual and tactile evaluation visual colour intensity (1-6 scale) 3.7 3.5 3.1 0.08 0.127 marbling (1-10 scale) 1.0a 2.3b 3.9c 0.13 0.001 firmness (1-7 scale) 3.8a 4.2 4.6b 0.08 0.011 colour measurements l*48 53.73 54.78 55.23 0.32 0.560 a*48 16.19 15.78 15.11 0.13 0.037 b*48 6.80 a 4.90ba 3.32bb 0.22 0.001 c*48 17.60 a 16.61a 15.52b 0.16 0.001 ho48 22.63 a 17.02ba 12.36bb 0.70 0.001 muscle pigment (micrograms of hematin per 1 g of meat) 34.27 aa 29.83b 26.99b 0.64 0.002 (a-c) row means with different superscripts differ significantly at p<0.01. l* value represents lightness; a* proportion of red; b* proportion of yellow; c* saturation; ho hue angle. as evaluated tactilely, the highest hardness of meat was observed in samples in group i with a minimum content of imf, compared to group iii which was less hard (p <0.05). meat colour constitutes an important quality indicator (połom and baryłkopikielna, 2004). although lightness l* was highest for meat with the highest fat content, there were no statistically significant differences in terms of imf content. the obtained results were typical of normal meat quality (warris et al., 2006). there were no significant differences in the proportion of red a*, but there was a significant difference in the proportion of yellow b*, which was highest in the group with the lowest imf (p <0.01). quality features of meat colour include colour saturation, colorimetric purity, and dominating light wavelength, referred to as hue. the highest colour saturation c* and h° hue were observed in meat with the lowest (<1%) imf content (p<0.01). similar values of meat colour parameters l*, a*, b*, and saturation c*, and higher values of h° hue than the ones obtained in this study were shown in previous studies (bocian et al., 2015). muscle pigment content is one of the main factors that affect the evaluated meat colour. this study demonstrated significant differences in muscle pigment content. the highest content of muscle pigment was in meat from group i, which also had the lowest imf content compared to group iii, which had higher imf content (p<0.01). these values are similar to the ones obtained previously by bocian et al. (2015) for plw x pl meat. for more detailed interrelations between intramuscular fat content and the characteristics of the tested meat, the simple linear correlations between them were computed. the ital. j. food sci., vol. 31, 2019 94 coefficients of simple correlation between imf and processing properties of meat, subjective visual and tactile evaluation, and its colour are shown in table 5. the correlations between imf and carcass weight, backfat thickness and loin eye area were also computed. the study confirmed a significant negative relationship between imf and meat acidity ph45 (p<0.05) and ph48h, wbsf, water content (p <0.01), visual colour intensity (p <0.05), proportion of red a* and yellow b* colour, its saturation c*, and h° hue, as well as muscle pigment content (p<0.01). table 5. correlation coefficients between intramuscular fat content and other variables in meat. imf ph45 -0.242* ph48h -0.292** whc 0.140 thermal drip 0.032 wbsf -0.493** water content -0.779** total protein content -0.106 visual colour intensity -0.259* marbling 0.908** firmness 0.305** l*48 value represents lightness 0.147 a*48 proportion of red -0.302** b*48 proportion of yellow -0.584** c*48 saturation -0.473** ho48 hue angle -0.560** muscle pigment -0.422** hot carcass weight 0.353** av. backfat thickness 0.195 loin eye area -0.006 (*) statistical significance at p<0.05, (**) statistical significance at p<0.01. intramuscular fat content was not related to carcass fat and meat content; only carcass weight was positively correlated with imf (p<0.01), which may be explained by the impact of age on the higher animal body weight at slaughter. pietruszka et al. (2015) reported a significant positive correlation between imf content and average backfat thickness (r=0.31, p<0.05), and a negative correlation with the loin eye area (r=-0.64, p<0.01); however, in contrast to this study, no significant relationship between imf and ph45 was demonstrated. the high positive correlation between the imf content and marbling (r=0.908) and the negative relationship with the shear force (r=-0.493) (p<0.01) obtained in this study are in line with the findings of li et al. (2013), which also showed lower shear force of meat containing higher imf content. ital. j. food sci., vol. 31, 2019 95 4. conclusions the meat obtained from the most popular polish crossbred pigs contained more intramuscular fat and was characterized by greater shear force, lower ph45 and ph48h, more marbling with lower water content, and a smaller proportion of yellow colour b*. in addition, it was characterized by a lower saturation of colour c*, its tone h°, and lower content of muscle pigment. acknowledgments this study was realized from statutory research funds bs-6/2014 assigned by the polish ministry of science and higher education. references alonso v., del mar campo m., provincial l., roncalés p. and beltrán j.a. 2010. effect of protein level in commercial diets on pork meat quality. meat sci. 85:7-14. andrés i.a., cava r., mayoral a.i., tejeda j.f., morcuende d. and ruiz j. 2001. oxidative stability and fatty acid composition of pig muscles as affected by rearing system, crossbreeding and metabolic type of muscle fibre. meat sci. 59:39-47. beattie v.e., weatherup r.n., moss b.w. and walker n. 1999. the effect of increasing carcass weight of finishing boars and gilts on joint composition and meat quality. meat sci. 52:205-211. blicharski t. and snopkiewicz m. (ed.). 2017. performance results 2016. pigs. polish pig breeders and producers association „polsus”, warszawa 2017. bocian m., hammermeister a., grajewska s., kapelańska j. and jelińska a. 2009. intramuscular fat content in meat and backfat thickness of purebred and crossbred pigs. rocz. inst. przem. mięsn. tłuszcz. 67(1):21-26 (in polish, english abstract). bocian m., jankowiak h. and kapelański w. 2015. changes of meat colour during storage. nauka przyr. technol. 9, 4, #57. doi: doi.org/10.17306/j.npt.2015.4.57 (in polish, english abstract). bocian m., wojtysiak d., jankowiak h., cebulska a., kapelański w. and migdał w. 2012. carcass, meat quality and histochemical traits of m. longissimus lumborum from złotnicka spotted pigs and commercial pigs. folia biol. kraków 60(3-4):181-187. brewer m.s., zhu l.g., bidner b., meisinger d.j. and mckeith f.k. 2001. measuring pork color: effects of bloom time, muscle, ph and relationship to instrumental parameters. meat sci. 57(2):169-176. cheng w., cheng j-h., sun s-w. and pu h. 2015. marbling analysis for evaluating meat quality: methods and techniques. comprehensive review in food sci. and food safety 14(5):523-535. cie. 1986. colorimetry. publication cie 15.2. vienna: central bureau of cie. czarniecka-skubina e., przybylski w., jaworska d., wachowicz i., urbańska i. and niemyjski s. 2007. quality profile of pork meat with varying contents of intramuscular fat. żywn. nauka. technol. jakość 55(6):285-294 (in polish, english abstract). czarniecka-skubina e., przybylski w., jaworska d., kajak-siemaszko k. and wachowicz i. 2010. effect of ph24 and intramuscular fat content on technological and sensory quality of pork. pol. j. food nutr. sci. 60(1):43-49. daszkiewicz t., bąk t. and denaburski j. 2005. quality of pork with a different intramuscular fat (imf) content. pol. j. food nutr. sci. 14/55(1):31-36. de vries a.g., faucitano l., sosnicki a. and plastow g.s. 2000. the use of gene technology for optimal development of pork meat quality. food chem. 69:397-405. ellis m. 2006. high quality pork production system. meat sci. suppl. 1, 99-100. ital. j. food sci., vol. 31, 2019 96 fernandez x., monin g., talmant a., mourot j. and lebret b. 1999a. influence of intramuscular fat content on the quality of pig meat 1. composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. meat sci. 53:5965. fernandez x., monin g., talmant a., mourot j. and lebret b. 1999b. influence of intramuscular fat content on the quality of pig meat 2. consumer acceptability of m. longissimus lumborum. meat sci. 53:67-72. fiedler i., nurnberg k., harde t., nurnberg g., ender k. 2003. phenopypic variations of muscle fibre and intramuscular fat traits in longissimus muscle of f2 population duroc x berlin miniature pig and relationships to meat quality. meat sci. 63:131-139. fortin a., robertson w.m. and tong a.k.w. 2005. the eating quality of canadian pork and its relationship with intramuscular fat. meat sci. 69:297-305. grela e.r. and skomiał j. (ed.). 2014. polish pig feeding standards. pigs feeding standards. feeding recommendations and nutritional value of feed for pigs. jabłonna: wyd. ifiżz pan. grau r. and hamm r. 1952. eine einfache methode zur bestimmung der wasserbindung in fleisch. fleischwirtschaft 4:295-297 (in german, english abstract). hocquette j.f., gondret f., baéza e., médale f., jurie c. and pethick d.w. 2010. intramuscular fat content in meatproducing animals: development, genetic and nutritional control, and identification of putative markers. animal 4(2):303-319. hofmann k. 1994. what is quality? definition, measurement and evaluation of meat quality. meat focus int. 3 (2):73-82. hornsey h.c. 1956. the colour of cooked cured pork. i. estimation of the nitric oxide-haem pigments. j. sci. food agric. 7:534-540. jankowiak h., bocian m., kapelański w. and roślewska a., 2010. the relationship between carcass fatness and intramuscular fat content, and fatty acids profile in pig meat. żywn. nauka. technol. jakość 6 (73):199-208 (in polish, english abstract). jaworska d., przybylski w., czarniecka-skubina e. and wachowicz i. 2007. sensory quality of pork meat from fatteners of various meatiness. rocz. istyt. przem. mięsn. tłuszcz. 45(1):51-60. kajak, k, przybylski, w., jaworska, d. & rosiak, e., 2007. characteristics of technological quality, sensorial and shelf-life of pork with different ph. żywn. nauka. technol. jakość 1(50):26-34 (in polish, english abstract). klont r. 2005. influence of ultimate ph on meat quality and consumer purchasing decisions. www.thepigsite.com/articles/1506/influence-of-ultimate-ph-on-meat-quality-and-consumer-purchasing-decisions/ latorre m.a., lázaro, r., valencia, d.g., medel, p. and mateos, g.g., 2004. the effects of gender and slaughter weight on the growth performance, carcass traits, and meat quality characteristics of heavy pigs. j. anim. sci. 82:526-533. li y.x., cabling m.m., kang h.s., kim t.s., yeom s.c., sohn y.g., kim s.h., nam k.c. and seo k.s. 2013. comparison and correlation analysis of different swine breed meat quality. asian australas. j. anim. sci. 26(7):905-910. nppc (national pork producers council). 1999. nppc marbling standars. usa: des moines. pietruszka a., jacyno e., kawęcka m. and biel w. 2015. the relation between intramuscular fat level in the longissimus muscle and the quality of pig carcasses and meat. ann. anim. sci. 15(4):1031-1041. pn-a-82109:2010. 2010. polish standard. meat and meat products. determination of fat, protein and water content. near infrared transmission spectrometry (nit) with artifical neural network calibration (in polish). pn-iso 4121:1998. 1998. polish standard. sensory analysis. evaluation of food products using scaling methods (in polish). pohja m.s. and niinivaara f.p. 1957. die bestimmung der wasserbindung des fleisches mittels der konstantdruckmethode. fleischwirtschaft 9:193-195 (in german, english abstract). połom a. and baryłko-pikielna n. 2004. the analysis of factors determining preferences of polish pork consumers. żywn. nauka. technol. jakość 3(40):7-23 (in polish, english abstract). przybylski w., jaworska d., olczak e., namysław i., kajak-siemaszko k., santé-lhoutellier v. and niemyjski s. 2010. characteristic of slaughter value and meat quality of three synthetic pig lines. s. afr. j. anim. sci. 40(3):198-203. ital. j. food sci., vol. 31, 2019 97 ramsey c.b., tribble l.f., wu c. and lind k.d. 1990. effects of grains, marbling and sex on pork tenderness and coposition. j. anim. sci. 68(1):148-154. różycki m. and tyra m. 2010. methodology for tested fattening and slaughter value at pig testing station (in polish). iz pib kraków 28:93-117 (in polish). statsoft incstatistica (data analysis software system), version 8.0, 2008. (www.statsoft.com). szalata m., pospiech e., łyczyński a., urbaniak m., frankiewicz a., mikołajczak b., medyński a., rzosińska e., bartkowiak z. and danyluk b. 1999. tenderness of meat from pigs of various quality. rocz. inst. przem. mięsn. tłuszcz. 36:61-76 (in polish, english abstract). tyra m. and żak g. 2012. analysis of relationships between fattening and slaughter performance of pigs and the level of intramuscular fat (imf) in longissimus dorsi muscle. ann. anim. sci. 12(2):169-178. van der wal p.g., olsman w.j. garrson g.j. and engel b. 1992. marbling, intramuscular fat, and meat color of dutch pork. meat sci. 32(3):351-355. van laack r.l.j.m., stevens s.g. and stalder k.j. 2001. the influence of ultimate ph and intramuscular fat content on pork tenderness and tenderization. j. anim. sci. 79:392-397. walczak z. 1959. a laboratory method for the determination of jelly content in canned meat. rocz. nauk rol. b. 74 (4):619-621 (in polish, english abstract). warriss p.d., brown s.n. and paściak p. 2006. the colour of the adductor muscle as a predictor of pork quality in the loin. meat sci. 73 (4), 565-569. wojtysiak d. 2014. effect of breed on microstructure and tenderness of porcine semimembranosus muscle. ann. anim. sci. 14(3):697-705. wood j.d., nute g.r., richardson r.i., whittington f.m., southwood o., plastow g., mansbridge r., da costa n. and chang k.c. 2004. effect of breed, diet and muscle on fat deposition and eating quality in pigs. meat sci. 67:651-667. paper received january 28, 2018 accepted july 25, 2018 ijfs#1163_bozza ital. j. food sci., vol. 30, 2018 673 paper pasta-making properties of the new durum wheat variety biensur suitable for the northern mediterranean environment g. visioli*1, t. vamerali2, c. dal cortivo2, s. trevisan2, b. simonato3 and g. pasini2 1department of chemistry, life sciences and environmental sustainability, university of parma, parco area delle scienze 11/a, 43124 parma, italy 2department of agronomy, food, natural resources, animals and the environment, university of padua, viale dell'università 16, 35020 legnaro-padua, italy 3department of biotechnology, university of verona, strada le grazie 15, 37134 verona, italy *e-mail address: giovanna.visioli@unipr.it abstract industrial pasta is commonly made from mixtures of semolina from different durum wheat varieties, and there is a very low market presence of mono-varietal pasta from local, short supply chains. in this work, dough rheological properties and pasta quality traits of the new durum wheat cv. biensur, which has a high hmw/lmw-gs ratio, were evaluated with a view to developing short-chain, mono-varietal pasta production in ne italy. chemical and sensory analyses on short-cut pasta, viz. tubetti, made with semolina from cv. biensur at two drying temperatures revealed that it has good technological characteristics and stability, excellent cooking and sensory properties, and is comparable to the high-quality commercial reference cv. aureo. we conclude that biensur provides farmers and traders with new market opportunities and offers improvements to the environmental and economic sustainability of the durum wheat chain. keywords: mono-varietal pasta, short-chain production, pasta texture, hmw and lmw gs, gliadins, technological characteristics ital. j. food sci., vol. 30, 2018 674 1. introduction durum wheat (triticum durum desf.) is one of the most important crops worldwide with an average annual production of 32.6 million tons (mmt), and is the most widely grown crop in the mediterranean area with an annual production of about 18 mmt (international grain council, 2015). italy is a major producer of durum wheat in the mediterranean, with an average production of about 4.0 mmt/year, about 67% of which is grown in the south of italy and used mainly for pasta production (d’egidio, 2007). pasta is made from the kneaded dough of semolina flour and water, which is shaped by a press and stabilised by drying. the pasta-making industry generally uses mixtures of different durum wheat varieties as blending yields semolina with high technological properties. as a consequence, there is very little mono-varietal pasta currently on the market, therefore it would be worthwhile studying the effects of individual cultivars on pasta quality (padalino et al., 2014). protein content and gluten characteristics are the main factors influencing pasta quality (sissons et al., 2005; cubadda et al., 2007), but their relative importance depends on many factors, including genotype, and environmental and processing conditions, such as drying temperature (d’egidio et al., 1990; novaro et al., 1993). the performance of durum wheat in pasta making is related, in particular, to the storage proteins of grains, i.e., glutenins and gliadins, which influence dough strength, extensibility and stability (sissons, 2008). glutenins are large aggregates of sub-units of either low molecular weight (lmw; 31–51 kda) or high molecular weight (hmw; 80-140 kda) joined by disulphide bonds (varzakas et al., 2014). gliadins are alcohol-soluble proteins, which fall into four groups, ω, γ and α/β, based on their electrophoretic mobility and molecular weight (45-25 kda). glutenins are mainly polymeric proteins responsible for dough elasticity, whereas gliadins are monomeric and determine characteristics related to extensibility. aside from the amounts of proteins and types of gluten proteins, the glutenin to gliadin and the hmw-gs to lmw-gs ratios are also directly related to the balance between dough strength and extensibility (samaan et al., 2006; sissons, 2008). drying temperature, one of the most important factors in the pasta production process, gives rise to highly aggregated proteins that are cross-linked via covalent bonds and disulphide bonds. a higher drying temperature intensifies polymerisation of the proteins into a protein network, which entraps the starch granules thereby preventing starch leaching during cooking and increasing the pasta’s sensory properties and cooking quality (zweifel et al., 2003; padalino et al., 2016). in recent years, the environmental impact of the entire pasta production cycle, from the cropping system in the field to semolina production techniques and packaging, has been reviewed (bevilacqua et al., 2007). moreover, under a recent italian decree (legislative decree, 2017), it is now obligatory to declare the origin of the durum wheat grains used in pasta production. in light of this, an advantageous strategy would be to promote local, short food supply chains in order to improve environmental and economic sustainability. in this regard, a recent study assessed the new cv. biensur and found it offered a suitable combination of high grain yield [7.31 t/ha, 132% higher than the italian mean (3.15 t/ha) and 37% higher than the veneto regional mean (5.32 t/ha) (source: istat, averages of the 12-year period 2006-2017)] and high quality semolina when grown under sustainable agronomic management on the edge of the cultivation area of this species in the mediterranean (visioli et al., 2018). the aims of this research, therefore, were: a) to evaluate the dough rheological properties and the quality of the pasta obtained from triticum durum cv. biensur cultivated in ital. j. food sci., vol. 30, 2018 675 northern italy with a view to its possible use in the production of mono-varietal pasta; b) to evaluate the effects on pasta quality of two different drying temperatures during industrial processing. comparative analyses were made against a high-quality standard represented by cv. aureo. 2. materials and methods 2.1. field experiment and grain production a field experiment was carried out in a sandy loam soil at the miana serraglia farm (mira, venice, italy), located close to the venetian lagoon, during the 2012-2013 growing season. the durum wheat cv. biensur (apsovsementi, voghera, italy) was grown in a 13.6 ha field. in accordance with local recommendations, 215 kg/ha of nitrogen fertilizer was applied: 200 kg n/ha to the soil as ammonium nitrate and 15 kg n/ha (uan, urea-ammoniumnitrate) by foliar spraying at the flowering stage. the wheat was sown late in october and harvested early in july. grain samples of 100 kg were collected to carry out dough tests and manufacture the pasta. 2.2. gluten protein quantification and chemical composition grains of the cv. biensur (triticum durum desf.) were ground in an experimental laboratory mill (buhler mlu202 roller mill; braunschweig, germany) at the scientific technology park of the molise region (campobasso, italy) in order to obtain fine semolina with a particle size similar to that of the reference control (200 to 350 µm). the reference control was a high-quality commercial semolina (cv. aureo) used in industrial, mono-varietal pasta production. protein, starch, fat, total fibre and ash contents were quantified in the semolina samples. total protein content was quantified by the kjeldahl 2001.11 method (aoac, 2000). in addition, relative quantification of the gliadin and the high-molecular-weight (hmw) and low-molecular-weight (lmw) glutenin (gs) fractions in the semolina of both biensur and aureo was carried out using the protein sequential extraction procedure (visioli et al., 2016) followed by quantification by bradford assay (bradford, 1976). three technical replicates were performed for each variety. sds-page was performed on a miniprotean tetra cell (bio-rad) on 8%, 12% and 15% acrylamide gel for the hmw-gs, lmw-gs and gliadin fractions, respectively, as previously described (visioli et al., 2016). following gel staining and image acquisition, protein molecular weights (mw) were identified and relative quantification of the gliadin, lmw-gs and hmw-gs in each gel was carried out using the image lab 4.5.1 (bio-rad) software. the total starch content in the semolina samples was determined according to the 996.11 method (aoac, 2000), while the fat content was estimated according to the 2003.05 method (aoac, 2000). total fibre content was measured according to the official 991.43 method (aoac, 2000), and ash content according to the 942.05 method (aoac, 2000). chemical analyses were performed in triplicate and the results expressed on a dry matter basis. short-cut pasta (tubetti) made from both the biensur and reference (aureo) semolina samples (fig. 1) was processed using a pilot system at the pavan-map impianti factory (galliera veneta, padua, italy). briefly, pasta samples were prepared in accordance with italian legislation (presidential decree n°187, 2001) by mixing water and semolina to form a dough with a 30% moisture content. the dough was driven through a vacuum system then extruded to mould the pasta. samples of biensur and aureo pasta were dried ital. j. food sci., vol. 30, 2018 676 at two different temperatures, low (maximum temperature 60°c, for 9 h) or high (maximum temperature 85°c, for 5 h), to obtain a final moisture content of 11% dw. the pasta samples from the two wheat varieties dried at the low and high temperatures are henceforth referred to as biensur lt, biensur ht, aureo lt and aureo ht. figure 1. appearance of the “tubetti” pasta made from mono-varietal semolina of cv. biensur compared with the reference cv. aureo at two drying temperatures, 60°c for 9 h (lt) or 85°c for 5 h (ht). 2.3. farinographic evaluation the properties of the semolina samples were measured with a farinograph (t6, promylograph, max egger, austria) according to the approved 54-21 method (aacc, 2000). farinograph tests allowed us to determine: (i) the water absorption (g water per 100 g of semolina) required to reach a dough consistency of 500 pu (promylograph units); (ii) dough stability, defined as the length of time the dough maintains its maximum consistency; (iii) dough weakening, defined as the reduction in dough consistency (as pu) after 20 minutes of mixing. the analyses were performed in triplicate. 2.4. cooking properties 2.4.1 determination of optimal cooking time pasta samples (50 g) were cooked in deionised boiling water (500 ml). optimal cooking time (oct), defined as “al dente”, was determined by pressing the pasta between two glass slides at different times during cooking and observing the time it took the starchy white core of the pasta to disappear (abécassis et al., 1994). ital. j. food sci., vol. 30, 2018 677 2.4.2 cooking loss and water absorption the pasta samples were drained immediately at the oct to halt the cooking process. cooking loss was defined as the amount of solids lost in the cooking water (d’egidio et al., 1990). in brief, the cooking water was collected in a beaker, placed in an air oven at 110°c and evaporated until dry. cooking loss was the weight of the residue expressed as a percentage of the initial weight of the pasta (g solids per 100 g of dry pasta). water absorption was measured as the increase in the weight of the pasta after cooking and expressed as a percentage of the weight of the uncooked pasta. cooking losses and water absorption were determined with 3 individual measurements (replicates). 2.4.3 texture analyses and colour determination pasta firmness, viz. the resistance to a bite with the incisors through the cooked pasta, and stickiness, i.e., the material adhering to the surface of the cooked pasta, were determined using a ta.xt plus texture analyser (stable micro systems, uk) equipped with a 5 kg load cell. the firmness test was performed according to the aacc 16-50 method. a single tubetto (12 mm thick) was oriented perpendicularly to a knife probe, cut, then compressed at a speed of 0.5 mm/s. firmness was measured as the maximum peak force curve (n) required to compress the pasta sample. for the stickiness test, the pasta was oriented perpendicularly, as described above, to a rectangular probe. excess water was removed before testing. the probe applied a compression force to the pasta sample (1 kg), was held in contact for 2 seconds then withdrawn at the same speed as above (0.5 mm/s). stickiness was measured as the maximum peak force curve (g/s) required to withdraw the probe from the surface of the sample. the average value of five replicates was reported for each test. the colour of cooked pasta was determined using a reflectance colorimeter (minolta®, cr300, japan) following the cie-l*a*b* colour system, where the l* value (brightness) ranges from black (0) to white (100), the chroma a* value ranges from green (-60) to red (+60), and the chroma b* value ranges from blue (-60) to yellow (+60) (minolta, 1993). each colour data represents the mean of three measurements on different pasta samples. 2.4.4 sensory evaluation of pasta to assess acceptability of the pasta made from cv. biensur, a sensory evaluation was carried out by 15 panel members (9 women, 6 men; ages ranging from 22 to 40 years) with experience in general food evaluation. the four pasta samples (biensur ht and lt, and aureo ht and lt) were cooked “al dente” without the addition of salt, drained and kept warm until serving in randomised order on plastic plates labelled with random 2-digit codes. panellists were asked to evaluate colour, flavour and texture properties (firmness, stickiness) on a five-point scale from 1, low intensity, to 5, high intensity. they were also asked to score the overall quality of the product based on these same attributes using the same five-point scale. the attribute scores for each sample and panel member were subjected to a one-way analysis of variance (anova) to obtain mean sensory scores for each of the 15 panel members. 2.5. statistical analysis statistical analysis of the data was performed with the statgraphics centurion xiv software (statpoint technologies, inc., warrenton, va, usa) and the results compared by ital. j. food sci., vol. 30, 2018 678 one-way anova. significant differences between treatments were determined by tukey’s test. 3. results and discussion 3.1. chemical composition of the semolina and rheological properties of the dough table 1 shows a comparison of the compositions of the refined semolina from cv. biensur and the commercial high-quality semolina from cv. aureo, which is already used in italy to produce the mono-varietal pasta voiello® (naples, italy). although biensur had a lower protein content (138.8 vs. 146.8 mg/g dw), the levels were high in both compared with the minimum levels (105 mg/g dw) required by italian legislation (presidential decree n° 187, 2001) and were commercially acceptable. in pasta making, the quantity and quality of wheat storage proteins is important in determining essential dough properties, such as stability and firmness (samaan et al., 2006; sissons, 2008). table 1. chemical and gluten protein composition of semolina samples (mg/g of dw) of cv. biensur compared with the commercial reference cv. aureo. total protein1 gli 2 hmw-gs2 lmw-gs2 gs/gli hmw/lmw-gs moisture total fibre starch ash lipids biensur 138.8b 64 a 12 a 24 b 0.56 b 0.51 a 14.11a 3.17a 74.9a 0.79a 1.73a aureo 146.8a 58 b 12 a 30 a 0.72 a 0.42 b 13.65a 3.10a 73.2b 0.80a 1.80a within each parameter, different letters indicate significant differences (tukey test, p ≤ 0.05; n = 5). 1kjeldahl method. 2percentage of total gluten proteins, which were: biensur 22.3±0.33, aureo 24.2±0.06 mg/g semolina. biensur has been recently recognised as a high-yielding variety, with higher gs/gliadin and hmw/lmw-gs ratios than other italian cultivars, and an optimal allelic gs configuration (bx7 and by8) (fig. 2), suggesting that high productivity can be combined with good quality through suitable breeding programmes (visioli et al., 2018). the hmw-gs configuration is indicated as bx7 and by8 for cv. biensur and as bx6 and by8 for cv. aureo. the lmw-gs pattern in the two varieties is indicated as the lmw-2 protein group, which, in the modern cultivars, replaced the low quality lmw-1 protein configuration (d’ovidio and masci, 2004). the gliadin fractions ω, γ, α/β were indicated according to the molecular weight range in relation to molecular weight markers. besides protein content, the types of gluten proteins, and the ratios between glutenins and gliadins, and between hmw-gs and lmw-gs are known to be directly related to the balance between dough strength and extensibility (samaan et al., 2006; sissons, 2008). biensur semolina had a lower total gluten protein content than aureo (22.3±0.33 vs. 24.2±0.06 mg/g flour; p ≤ 0.05), a lower percentage of the lmw-gs fraction and a higher gliadin fraction with respect to total gluten proteins (table 1). however, our results confirm biensur as having a higher hmw/lmw-gs ratio than aureo (0.51 vs. 0.42) and an acceptable gs/gli ratio (0.56), which are important parameters for gluten technological quality (table 1). we also found differences between the varieties in the abundances of the hmw-gs x-type and y-type sub-units and the most common lmw-gs (42 and 37 kda), as ital. j. food sci., vol. 30, 2018 679 previously reported (visioli et al., 2018). biensur had higher proportions of x-type hmw sub-units and 37 kda lmw-gs than aureo (fig. 2). regarding the gliadin fractions, biensur had a greater amount of α/β gliadins (rich in cys residues) and a lower fraction of ωgliadins (poor in cys residues) than aureo, although they had similar amounts of γgliadins, which are very rich in cys residues. gluten composition and the relative amounts of sub-units are known to contribute to the technological quality of semolina. biensur also had more starch than aureo (749 vs. 732 mg/g dw). figure 2. sds-page of hmw-gs, lmw-gs and gliadin sub-units extracted from cv. aureo and biensur semolina (a), and their relative abundances (%) obtained by densitometric analysis (b). we compared samples of biensur and aureo for dough stability and weakening using a farinograph (table 2) and found the two varieties to have very similar levels of dough stability, while cv. aureo had better indices of dough weakening and water absorption. although there were no significant differences between the two varieties in dough stability, after 20 minutes of mixing the biensur dough was found to have a higher dough weakening index, meaning a lower tolerance to mechanical mixing. ital. j. food sci., vol. 30, 2018 680 table 2. farinographic indices (means; n = 3) of dough samples of cv. biensur compared with the commercial reference cv. aureo. water absorption (%) dough stability (min) dough weakening (pu) biensur 52.4b 11.5a 35a aureo 55.7a 12.0a 25b within each parameter, different letters indicate significant differences (tukey test, p ≤ 0.05). 3.2. physical and sensory characteristics of pasta we looked at the most important quality indicators to properly compare the pasta obtained from the two varieties. good quality pasta should meet the criteria of high water absorption, low cooking losses and good texture (cubadda et al., 2007; bruneel et al., 2010). after cooking, it should be firm enough to resist surface disintegration and have no excessive stickiness. the data regarding water absorption, cooking loss, firmness and stickiness of all pasta samples at the optimal cooking time are similar for the two durum wheat varieties (table 3). table 3. cooking properties [optimal cooking time (oct), water absorption and cooking loss (n = 3)], firmness and stickiness measured by texture analyzer (n = 3), and colour indices of pasta samples of cv. biensur compared with the commercial reference cv. aureo dried at different temperatures (lt = 60°c for 9 h; ht = 85°c for 5 h). cooking quality colour oct (min.sec) water absorption cooking loss firmness stickiness l* a* b* (%) (%) (n) (g/s) biensur ht 9.0 111.90a 2.96a 5.70a 81.6a 57.10a -1.15a 17.6a biensur lt 8.3 111.58a 3.00a 5.65a 82.3a 58.67a -2.4b 18.0a aureo ht 9.0 111.90a 2.96a 5.80a 80.1a 60.57a -1.9ab 18.4a aureo lt 8.3 111.70 a 2.97a 5.71a 81.1a 59.40a -2.41b 17.7a within the same parameter, values with the same letter are not significantly different from each other (tukey test, p ≤ 0.05). analyses of variance for these parameters did not reveal any significant differences between biensur and aureo pasta dried at the same temperature. this provides confirmation that biensur, despite having a lower protein content than aureo, has good gluten quality and is therefore suitable for high quality pasta production. there were also no significant differences between biensur and aureo pasta dried at different temperatures: in all cases the gluten network seems to provide similar shear resistance and equally restricts starch swelling and leaching. this was probably because the gluten quality of cv. biensur has a better hmw-gs configuration (bx7-by8) and a higher hmw/lmw-gs ratio than aureo, as well as an acceptable gs/gli ratio, as previously described (table 1), which plays an important role in the formation of a strong protein network. moreover, we consider that the difference between the lt and ht drying temperatures is not so great as to affect the pasta structure. indeed, only large increases in drying temperature would modify the pasta structure, with positive effects on the sensory ital. j. food sci., vol. 30, 2018 681 properties and cooking quality (pasini et al., 2015; padalino et al., 2016), especially when total protein content is low (cubadda et al., 2007). high drying temperatures, particularly >70 °c, are also known to lower protein digestibility (petitot et al., 2009; stuknyte et al., 2014). in this trial, we detected slight improvements to pasta firmness and lower cooking losses in both varieties dried at the high temperature compared with the lower (85 °c vs. 60 °c), but they were not statistically significant. however, biensur was slightly stickier than aureo, probably due to its higher starch content, and the higher drying temperature seems to be effective in slightly reducing this effect. the sensory properties of the cooked pasta, such as colour, flavour and texture (firmness and stickiness), play an essential role in determining consumer acceptability of the product, especially in traditional pasta-consuming countries (d’egidio and nardi, 1998). sensory evaluation of pasta made from the cv. biensur and from the reference cv. aureo showed there to be no significant differences between them for any of the parameters tested (table 4), which is consistent with the texture analysis (table 3) and hence shows good overall acceptability. texture and flavour appear to play a major role in sensory evaluation, but the initial impact is also highly influenced by colour. similar brightness (l*) and b* values were observed for all cooked pasta samples. differences between the ht and lt pasta samples were found, as indicated by a significant increase in the a* value (redness) under the higher drying temperature (table 3), which is known to be correlated with non-enzymatic browning (anese et al., 1999). although it is difficult to compare results from different studies because of the different drying cycles and raw materials used, our results are in accordance with those of other authors who investigated the effects of drying temperatures and the role of gluten content in pasta quality (cubadda et al., 2007; padalino et al., 2016). table 4. summary of the sensory properties (n = 15) of pasta samples of cv. biensur compared with the commercial reference cv. aureo dried at different temperatures (lt = 60°c for 9 h; ht = 85°c for 5 h). colour flavour firmness stickiness overall acceptability biensur ht 2.7a 3.5a 4.4a 1.7a 3.0a biensur lt 2.5 a 3.5 a 4.1a 1.9 a 2.8 a aureo ht 3.0a 3.8a 4.8a 1.5a 3.5a aureo lt 2.6a 3.7a 4.5a 1.4a 3.4a each attribute was assessed on a 5-point scale from 1, low intensity, to 5, high intensity 4. conclusions to cultivate durum wheat in the northern latitudes of the mediterranean region, greater attention needs to be paid to varietal choice and crop management, particularly nitrogen nutrition and pathogen control, as the climatic conditions are extreme for this species (lower temperatures, higher humidity). currently, high quality semolina is mainly associated with high-protein cultivars, such as aureo, the reference in our trial, although this variety commonly fails to reach high grain yield targets and may not be economically sustainable for farmers in the potentially high-yield, fertile soils of ne italy. one of many wheat cultivars, biensur grown at the extreme northern edge of the mediterranean region has been recently found to have high yield, appreciable protein ital. j. food sci., vol. 30, 2018 682 contents and a good gluten sub-unit configuration for pasta making (visioli et al., 2018). we therefore felt there was a need to assess whether the characteristics of this cultivar meet the requirements for producing high-quality pasta from large field cultivations, and whether the drying temperature may mitigate possible weaknesses during processing. this study suggests that cv. biensur is a good candidate to increase italy’s production of mono-varietal pasta by extending cultivation of it to the more fertile soils of the po plain, given that the dough has high technological characteristics and the pasta very good sensory properties, comparable to well-established commercial mono-varietal semolinas. the effect of drying temperature (high or low) was minimal, suggesting that the intrinsic characteristics of individual varieties are of central importance, as reported by padalino et al. (2014), and that the most energy/economically sustainable technological processes can be selected without compromising pasta quality. there is currently rising market demand for mono-varietal brands, a situation that could stimulate local cultivation of specific durum wheat cultivars to supply short-chain pasta production, thereby offering new market opportunities for farmers and traders, especially in light of the recent italian decree (legislative decree, 2017) requiring the origin of the wheat to be indicated on the label. as all the steps in this project (cultivation, milling, pasta-making) were carried out on a large scale, we are confident that the results will be useful for future development of the chain in ne italy. furthermore, having demonstrated that essential sensory (mechanical) properties, such as firmness and stickiness, can be faithfully measured by a texture analyser and panellists’ judgements, we are sure that consumers will find the quality of pasta made from cv. biensur acceptable. acknowledgements the work was carried out with financial support awarded to prof. giuliano mosca, university of padua, and prof. nelson marmiroli, university of parma, by the ager project grant 2010-0278 “environmental and economic sustainability for yield and quality production of durum wheat supply chain”. the authors thank pavan s.p.a. (galliera veneta, padua, italy) for manufacturing the pasta, and dr. claudio pollini for technical assistance. the authors wish to thank tessa say for revising the english text. references abécassis j., abbou r., chaurand m., morel m.h. and vernoux p. 1994. influence of extrusion conditions on extrusion speed, temperature, and pressure in the extruder and on pasta quality. cereal chem. 71:247. aacc. 2000. “approved methods”10th ed. american association of cereal chemists, s. paul, mn, usa. anese m., nicoli m.c., massini r. and lerici, c.r. 1999. effects of drying processing on the maillard reaction in pasta. food res. int. 32:193. aoac. 2000. “official methods of analysis” 17th ed. association of official analytical chemists, washington, dc, usa. bevilacqua m., braglia m., carmignani g. and zammori f.a. 2007. life cycle assessment of pasta production in italy. j. food qual. 30:932. bradford m.m. 1976. a rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. anal. biochem. 72:248. bruneel c., pareyt b., brijs k. and delcour j.a. 2010. the impact of the protein network on the pasting and cooking properties of dry pasta products. food chem. 120:371. cubadda r.e., carcea m., marconi e. and trivisonno m.c. 2007. influence of gluten proteins and drying temperature on the cooking quality of durum wheat pasta. cereal chem. 84:48. d’egidio m. g., mariani b.m., nardi s., novaro p. and cubadda r. 1990. chemical and technological variables and their relationships: a predictive equation for pasta cooking quality. cereal chem. 67:275. ital. j. food sci., vol. 30, 2018 683 d’egidio m.g. and nardi s. 1998. textural measurement of cooked spaghetti. in “pasta noodle technology” j.e. kruger, r.b. matsuo and j. w. dick (eds.) p. 133 american association of cereal chemistry, st. paul mn, usa. d’egidio m.g. 2007. overview on pasta in the world. tecnica molitoria int. 58:92. d’ovidio r and masci s. 2004. the low-molecular-weight glutenin subunits of wheat gluten. j. cereal sci. 39:321. eu regulation n° 1169/2011 of the european parliament and of the council of 22 november 2011. official journal of the european union l 304/33 international grain council 2015. www.igc.int istat, italian national institute of statistics, section agriculture and livestock, www.agri.istat.it/sag_is_pdwout/jsp/newdownload.jsp?id=15a|18a|25a legislative decree 2017. indicazione dell’origine, in etichetta, del grano duro per paste di semola di grano duro (17a05704). gazzetta ufficiale n. 191 del 17 agosto 2017, p. 16. minolta. 1993. precise color communication: color control form feeling to instrumentation. dsaka: minolta camera. novaro p., d’egidio m.g., mariani b.m. and nardi s. 1993. combined effect of protein-content and high-temperature drying systems on pasta cooking quality. cereal chem. 70:716. padalino l., caliandro r., chita g., conte a. and del nobile m.a. 2016. study of drying process on starch structural properties and their effect on semolina pasta sensory quality, carbohyd. polym. 153:229. padalino l., mastromatteo m., lecce l., spinelli s., contò f. and del nobile m.a. 2014. effect of durum wheat cultivars on physico-chemical and sensory properties of spaghetti. j. sci. food agric. 11:2196. pasini g., greco f., cremonini m., brandolini a., consonni r. and gussoni m. 2015. structural and nutritional properties of pasta from triticum monococcum and triticum durum species. a combined 1h nmr, mri and digestibility study. j. agric. food chem. 63:5072. petitot m., brossard c., barron c., larré c., morel m-h. and micard v. 2009. modification of pasta structure induced by high drying temperatures. effects on the in vitro digestibility of protein and starch fractions and the potential allergenicity of protein hydrolysates. food chem. 116:401. presidential decree n°187. 2001. regulation for the revision of laws concerning the production and sale of milling products and pasta, pursuant to article 50 of law n° 146, dated 22 february 1994. official journal n. 117. samaan j., el-khayat g.h., manthey f.a., fuller m.p. and brennan c.s. 2006. durum wheat quality: ii. the relationship of kernel physicochemical composition to semolina quality and end product utilization. int. j. food sci. tech. 41:47. sissons m. 2008. role of durum wheat composition on the quality of pasta and bread. food 2:75. sissons m.j., egan n.e. and gianibelli m.c. 2005. new insights into the role of gluten on durum pasta quality using reconstitution method. cereal chem. 82:601. stuknyte m., cattaneo s., pagani m.a., marti a., micard v., hogenboom j. and de noni i. 2014. spaghetti from durum wheat: effect of drying conditions on heat damage, ultrastructure and in vitro digestibility. food chem. 149:40. varzakas t., kozub n. and xynias i.n. 2014. quality determination of wheat: genetic determination, biochemical markers, seed storage proteins – bread and durum wheat germplasm. j. sci. food agric. 94:2819. visioli g., bonas u., dal cortivo c., pasini g., marmiroli n., mosca g. and vamerali t. 2018. variations in yield and gluten proteins in durum wheat varieties under late-season foliar vs. soil application of nitrogen fertilizer in a northern mediterranean environment. j. sci. food agric. 98:2360. visioli g., comastri a., imperiale d., paredi g., faccini a. and marmiroli n. 2016. gel-based and gel-free analytical methods for the detection of hmw-gs and lmw-gs in wheat flour. food anal. method. 9:469. zweifel c., handschin s., escher f. and conde-petit b. 2003. thermal modifications of starch during high-temperature drying of pasta. cereal chem. 80:159. paper received february 16, 2018 accepted may 25, 2018 ijfs#1559_bozza ital. j. food sci., vol. 32, 2020 167 paper multilegume bar prepared from extruded legumes flour to address protein energy malnutrition s. saadat1, s. akhtar3, t. ismail3, m.k. sharif2, u. shabbir1, n. ahmad*1 and a. ali1 1institute of home and food sciences, government college university faisalabad, 38000, pakistan 2national institute of food science and technology, university of agriculture faisalabad, 38000, pakistan 3institute of food science and nutrition, bahauddin zakariya university, multan, 60000, pakistan 4institute of diet and nutrition, university of lahore, 75500, pakistan *corresponding author: drnazirahmad@gcuf.edu.pk abstract this study was planned to develop and characterize extruded multilegume savory bars as a protein supplementary nutrition. legumes were extruded to prepare composite flour. proportions of extruded flour were mixed with whey protein concentrate, honey and palm oil for preparation of protein bar. the product was evaluated for physico-chemical, minerals, calorific value, color, hardness, protein digestibility and sensorial characteristics. in vitro protein digestibility was found from 62.04 to74.98% and in vivo from 65.30 to 84.01%. extrusion process and addition of whey protein concentrates significantly affected the nutritional and sensorial parameters of bars. keywords: legume protein, extrusion, bar, protein digestibility ital. j. food sci., vol. 32, 2020 168 1. introduction malnutrition is an abnormal physiological condition triggered by imbalanced, inadequate or excessive consumption of nutrients (rizwana et al., 2015) while, proteins energy malnutrition (pem) is a change of pathological conditions arises due to deficiency of protein calories (ernest et al., 2013). developing economies are adversely affected by the malnutrition. globally, there are more than 150 million children under the age of five years who are malnourished. the majority of these children are residing in just three countries of the south asia i.e. india, bangladesh and pakistan where almost 54% of child deaths are linked to this menace (unicef, 2016). unhealthy diet, ecological conditions and general living standard have a strong relation with diseases. according to global hunger index (ghi), pakistan is at 11th position from 118 countries with respect to malnourished population (22%), stunted growth (45%), wasting (10.5%) and mortality (8.1%) in children under 5 years of age (ifpri, 2016). likewise, according to national nutrition survey (2011), 58% of the population is facing the food security situation. due to malnutrition, women and children are facing macroand micro-nutrient deficiencies. about 31.5% of the children are underweight, 43.7% are stunted and 15.1% are suffering from wasting. children (39-61%), pregnant women (38-69%) and non-pregnant women (26%-68%) are facing iron, zinc, vitamin a and d deficiencies (gop-pakistan, 2011). pem is one of the important public health issues in developing countries (van der pols-vijlibrief et al., 2014). marasmus, kwashiorkor and marasmic-kwashiorkor are the primary reasons of pem (ernest et al., 2013) that is associated with co-morbidities such as anaemia, tuberculosis diarrhea and malaria (le roux et al., 2010) and these causes may lead to death. several policies have been implemented to overcome the issue of pem that involves different food based strategies such as dietary modifications, food enrichment and supplementation. school health programs are also initiated in various countries to mitigate this situation (onis, 2012). protein as a nutrient is considered a dietary component that evokes the widest array of complex scientific, economic and environmental issues, viewed as the most expensive but essential ingredient forming part of a healthy balanced diet (schönfeldt and hall, 2012). edible legumes belong to the family leguminosae entitled as fabacae. these are termed used for grain legumes which are generally grown up for their edible seeds. legumes also called “a poor man’s meat”. legumes are abundantly cultivated in subtropics and tropics areas of the world. they are the good alternative to animal protein for those people who have limited resources (adebowale and lawal, 2004). they possess amounts of amino acids such as leucine, lysine, aspartic acid, arginine and glutamic acid. they are vital sources for food proteins and also give rational essential amino acids when used with grains or other foods (sarwar et al., 2013). it can be used with other food items to enhance the nutrition. they are also an excellent source of micronutrients as contain riboflavin, thiamin, niacin, selenium, folate, and pyridoxine (usda, agricultural research service 2012). they have good amounts of vitamin a, e and c (raatz; the bean institute 2010). application of extrusion process on legumes modifies the physico-chemical parameters for improving functional properties in target applications (osen et al., 2015). thermal extrusion has advantages as it helps to hinder anti-nutritional factors such as haemagglutinins, trypsin inhibitors, tannins, phytates which inhibit protein functionality and digestibility (alonso et al., 2000). since, legumes have good sources of protein and micronutrients and can be modified into an extruded product. they can be used to prepare protein rich bars, that can diversified the diet with natural approach to enhance the nutritional requirements and reduce the ital. j. food sci., vol. 32, 2020 169 malnutrition of poor regions by using as a cultural food. the present project was planned to prepare extruded multilegume savory bar in order to mitigate pem. according to institute of medicine the recommended daily allowance of protein for adults older than 18 years is 0.8 g/kg/d and the youngsters (under 18 years of age) required 13-52 g of protein per day (nap, 2005). the primary objective of this multilegume product was to provide the enough nutrients that fulfill the daily requirement of protein but will not cross the threshold level for children and adults in the absence of meat products to address pem. 2. materials and methods 2.1. procurement of materials chickpea (cicer arietinum l), mung (vigna radiata), mash (vigna mungo l), soybean (glycine max), whey protein concentrates (wpc 80), palm oil and honey were purchased from the markets of faisalabad, pakistan. 2.2. preparation of extruded multilegume savory bars thermal extrusion has advantages to destroy the anti-nutritional factors such as haemagglutinins, trypsin inhibitors, tannins, phytates, and helps in production of bioactive peptides and improve protein functionality and digestibility. all legumes were soaked for 15 hrs and dried for thermal extrusion. legumes were fed into a twin-screw extruder (dndl 44, bühler ag, uzwil, switzerland) using the method described by tremaine and schoenfuss (2014). optimized extrusion conditions of feed flow rate (60 kg/hr), screw speed (250 rpm), feed moisture content (10%) and barrel exit temperature (160°c) were used for the preparation of extruded powder. extrudates were pelletized and dried in vacuum oven. drying continued at 40°c in oven for 26 hrs. chickpea flour and other legumes (mash, mung and soybean as composite flour) were mixed in proportions and prepared different treatments as described in table 1. whey protein concentrates (3%); honey (3%) and palm oil (3%) were added in each sample for better mixing, sensorial and nutritional properties. purpose of combining proteins from vegan and vegetarian diets is to provide sufficient amounts of some essential amino acids to make complete protein intake. palm oil has good spreading properties, technically useful and economically beneficial as compared to animal fat as well. after mixing, sheeting was done, and cut into bars of 3.5 centimeter (cm) width, 2 cm height, and 9 cm in length. each bar of approximately 50 g was packed individually in aluminum foil. using aacc 2000 methods, moisture content (method no; 44-15.02), crude protein (method no; 990.03), crude fat (method no; 30-10.01), crude fiber (method no; 962.09), ash (method no; 942.05) and nfe content were determined. water activity of prepared bars was determined using a previously described aoac method (aoac, 2012; method no. 978.18). the color values for each treatment were determined through color meter (color test ii, neοhuаus neοtec, germany) by following the method described by hunter (1987). calorific values of bars were determined through oxygen bomb calorimeter (ikаwerke, c2000 basic, gmbh and cο. germany) as described by miller (1959). hardness of bars was measured according to the method of piga et al. (2005). results were obtained on the basis of compression force (kg) used to press the bars. ital. j. food sci., vol. 32, 2020 170 table 1. treatment plan. treatment formulation t0 chickpea flour/composite% as 100/0 t1 chickpea flour/composite% as 70/30 t2 chickpea flour/composite% as 55/45 t3 chickpea flour/composite% as 40/60 t4 chickpea flour/composite% as 25/75 t5 chickpea flour/composite% as 0/100 composite flour contains mung, mash and soybean flours. 2.3. in vitro study for protein digestibility using the method of akeson and stahmann (1964) (with some modifications), in vitro protein digestibility was determined. aliquots of 250 mg of each sample were suspended in 15 ml of 0.1 mol equi/l hcl containing 1.5 mg/ml pepsin (sigma®, st. louis, mo, usa) and incubated for 3 hrs at 37°c in a water bath. hydrolysis from pepsin was stopped after neutralization by adding 7.5 ml of 0.5 mol equi/l of naoh, then pancreatic digestion started by the addition of 10 ml of 0.2 mol/l phosphate buffer (ph 8.0) containing 10 mg of pancreatin (sigma®, st. louis, mo, usa) with 1 ml of 0.005 mol/l sodium azide to hinder microbes growth and incubated at 37°c for 24 hrs. after hydrolysis with pancreatin, 1 ml of 10 g/100 ml of trichloroacetic acid was added and centrifuged at 550×g for 20 min. the supernatant was collected and the total protein content was calculated using kjeldahl (on the basis of nitrogen content) using aoac (2012) method. % digestibility= (ns–nb)/ns×100 ns = nitrogen content in the sample, nb = nitrogen content in the blank. 2.4. in vivo study for true protein digestibility (tpd) male sprague-dawley rats (350±12 g) of 9 weeks old were procured from animal house, national institute of health, islamabad, pakistan and maintained under standard laboratory conditions at 28±2°c with constant light-dark cycle. rats were fed on standardized chow for an acclimation period of 2 days and then 36 rats were divided into groups of 6 rats. rats were fed for 10 days in which 2 days were for acclimation period. rats were weighed on daily basis during study. after 4 days period, spilled food and feces were carefully collected and separated from each rat. the spilled food was dried for 72 hrs in air while collected feces were dried in oven overnight at 100°c, weighed, grinded and analyzed for nitrogen content. weight of spilled food and uneaten food were minus from the total food supplied to rat to determine the nitrogen intake. tpd was calculated as: i– (f–fk) tdp = × 100 i ital. j. food sci., vol. 32, 2020 171 i= intake nitrogen, f= fecal nitrogen, and fk=metabolic or endogenous fecal nitrogen. 2.5. sensory evaluation attributes like color, texture, folding ability, chewаbility, taste and οverаll аcceptаbility of extruded multilegume savory bars were analyzed by а penal of judges using 9point hedonic scale system as described by meilgааrd et аl. (2007). all experiments were conducted in triplicates and average values were considered as mean values. the significance of values was calculated statistically through mean using analysis of variance (anova) at probability of 0.05. 3. resukts 3.1. proximate composition of extruded flour extruded multilegume composite flours for each treatment were prepared by blending various amounts of mung, mash and soybean with chickpea and then analyzed for moisture, crude protein, crude fat, crude fiber, ash, nfe and mineral content. the mean values regarding proximate composition of composite flour is presented in table 2. table 2. proximate composition and mineral profile of flour of chickpea/mung, mash and soybean for savory bar development. chickpea flour/composite flour (%) moisture crude protein2 crude fat crude fiber3 ash nfe t0 3.98±0.18 1 29.26±1.32 3.20±0.05 1.02±0.10 3.03±0.06 57.09±2.04 t1 4.12±0.11 29.89±0.99 3.34±0.03⋆ 1.35±0.13 3.09±0.09 54.17±1.98⋆ t2 4.19±0.24 30.28±2.47 3.78±0.05⋆ 1.98±0.10⋆ 3.43±0.05 53.84±2.61⋆ t3 4.06±0.11 30.49±3.97 3.86±0.03⋆ 2.87±0.13⋆ 3.51±0.09 50.20±1.39⋆ t4 4.29±0.24⋆ 30.58±2.64 4.94±0.05⋆ 3.01±0.10⋆ 4.28±0.05 49.84±2.09⋆ t5 4.48±0.35⋆ 31.43±3.29⋆ 5.53±0.09** 3.30±0.08⋆⋆ 4.34±0.10⋆ 47.50±1.87⋆ mineral profile (mg/100g) na k ca fe zn t0 11.51±0.25 477.00±12.45 81.39±19.10 04.70±0.63 02.54±0.09 t1 13.65±0.29⋆ 614.50±05.23⋆⋆ 113.85±2.62⋆⋆ 06.62±0.25⋆ 03.01±0.09⋆ t2 14.72±0.21⋆ 682.80±09.19⋆⋆ 129.70±5.69⋆⋆ 07.36±0.14⋆ 03.30±0.03⋆ t3 15.86±0.36⋆ 751.87±07.71⋆⋆ 146.55±2.70⋆⋆ 07.75±0.29⋆ 03.45±0.09⋆ t4 16.87±0.49⋆ 820.93±11.40⋆⋆ 155.40±2.22⋆⋆ 07.92±0.23⋆ 03.75±0.08⋆ t5 18.65±0.39⋆ 925.27±11.35⋆⋆ 188.25±4.50⋆⋆⋆ 08.20±0.20⋆ 03.94±0.09⋆ 1mean values (on dry basis) ± standard deviation. different superscripts (⋆) on values in columns show significance difference (p˂ 0.05) within treatment. 2calculated using n x 6.25 for proteins 3calculated by difference of 100 (ash + proteins + fat +starch). ital. j. food sci., vol. 32, 2020 172 the moisture content was ranged from 3.98±0.18 to 4.48±0.35%, crude protein 29.26±1.32 to 31.43±3.29%, crude fat 3.20±0.05 to 5.53±0.09%, crude fiber 1.02±0.10 to 3.30±0.08%, ash 3.03±0.06 to 4.34±0.10% and nfe 47.50±1.87 to 57.09±2.04%. significant (p˂ 0.05) difference in nutritional composition was observed with the increase of multilegume composite flours in formulations. maximum na content was observed in t5 (18.65±0.39 mg/100g) and minimum (11.51±0.25 mg/100g) in t0. k content of formulations was ranged from 477.00±12.45 to 925.27±11.35 mg/100g in which maximum content was observed in t5 and minimum in t0. ca content of formulations was ranged from 81.39±19.10 to 188.25±4.50 mg/100g. the highest ca content was observed in t5 and the lowest ca was noted in t0. maximum values for fe were found in t5 (08.20±0.20 mg/100g) and minimum values in t0 (04.70±0.63 mg/100g). zn content was found lowest in t0 (02.54±0.09 mg/100g) and highest in t5 (03.94±0.09 mg/100g). significant (p˂0.05) difference was found within treatments from control in mineral analysis. 3.2. proximate composition of multilegume savory bars the mean values regarding proximate composition of multіlegume savory bars are shown in table 3. table 3. proximate composition of multіlegume savory bars. savory bar legumes ratio mοіsture crude protein2 crude fat crude fіber3 ash nfe energy4 (calories/100 g) t0 3.99±0.21 1 31.98±0.87 5.03±0.12 0.99±0.26 3.24±0.13 58.03±1.08 418.03±13.04 t1 4.24±0.09 32.76±0.16 5.63±0.24 1.29±0.31 3.45±0.19 56.23±1.98 436.74±12.09⋆ t2 4.35±0.19 33.01±0.34 5.98±0.76 1.92±0.41 3.69±0.23 53.12±2.42⋆ 458.67±10.26⋆ t3 4.40±0.20 33.56±0.23 6.73±0.53⋆ 2.76±0.27⋆ 3.93±0.17 51.89±2.32⋆ 526.18±09.87⋆ t4 4.43±0.29⋆ 33.93±0.49⋆ 7.09±0.49⋆ 2.86±0.65⋆ 4.56±0.32⋆ 50.63±1.59⋆ 530.17±15.76⋆ t5 4.61±0.25⋆ 34.23±0.95⋆ 7.99±1.02* 3.19±0.51⋆ 4.89±0.09⋆ 48.53±0.99⋆⋆ 546.49±19.87⋆⋆ mineral profile (mg/100g) na k ca fe zn t0 11.65±0.12 479.12±4.32 81.29±9.34 04.65±0.43 02.51±0.04 t1 13.71±0.18⋆ 618.32±5.76⋆⋆ 114.31±1.93⋆ 06.68±0.18⋆ 02.97±0.12⋆ t2 14.78±0.31⋆ 685.47±6.20⋆⋆ 130.82±4.32⋆ 07.71±0.07⋆ 03.23±0.31⋆ t3 15.92±0.28⋆ 763.38±8.24⋆⋆ 147.25±3.21⋆ 07.82±0.15⋆ 03.49±0.54⋆ t4 16.93±0.17⋆ 824.52±5.91⋆⋆ 156.32±1.99⋆ 07.89±0.09⋆ 03.87±0.42⋆ t5 18.69±0.16⋆⋆ 927.36±6.32⋆⋆ 189.17±3.35⋆⋆ 08.40±0.87⋆⋆ 04.02±0.41⋆ 1mean values (on dry basis) ± standard deviation. different superscripts (⋆) on values in columns show significance difference (p˂ 0.05) within treatment. 2calculated using n x 6.25 for proteins. 3calculated by difference of 100 (ash + proteins + fat+ starch). 4 caloric values were determined bomb calorimeter. ital. j. food sci., vol. 32, 2020 173 in all treatments, the moisture content ranged from 3.99±0.21 to 4.61±0.25%, crude protein 31.98±0.87 to 34.23±0.95%, crude fat 5.03±0.12 to 7.99±1.02%, crude fiber 0.99±0.26 to 3.19±0.51%, ash 3.24±0.13 to 4.89±0.09% and nfe 48.53±0.99 to 58.03±1.08%. significant (p˂ 0.05) difference was found in all treatments in comparison with control for moisture content, crude protein, crude fat, crude fiber, ash and nfe in bars prepared from multilegumes composite flour. maximum na content was observed in t5 (18.69±0.16 mg/100g) and minimum in t0 (11.65±0.12 mg/100g). k content was ranged from 479.12±4.32 to 927.36±6.32 mg/100g in which maximum content was observed in t5 and minimum in t0. ca content was ranged from 81.29±9.34 to 189.17±3.35 mg/100g. maximum value for fe was found in t5 (08.40±0.87 mg/100g) and minimum in t0 (04.65±0.43 mg/100g). zn content was found highest in t5 (04.02±0.41 mg/100g) and lowest in t0 (02.51±0.04 mg/100g). significant (p<0.05) difference was found for mineral content in bars within treatments in each column. maximum calorific value was noticed in t5 (546.49±19.87 calories/100g) while lowest in t0 (418.03±13.04 calories/100g). 3.3. water activity non-significant (p > 0.05) difference was found for water activities in bar as all values were recorded around 0.50. 3.4. color of extruded multilegume savory bars color reveals the first impression of a food product before consumed. it’s the first score of a like and dislike for food commodity. the mean values for color score of extruded multilegume savory bar are shown in table 4. highest value (58.67±0.14) of l was found in t2 while the lowest value (50.50±0.13) was noticed in t0. maximum color value of a⋆ was 7.85 in t2 while the minimum was 5.30 in t5 that shows coloring trend towards redness. maximum color value for b⋆ was 19.4±0.09 in t5 and lowest was 15.69±0.04 in t3 that shows coloring trend toward yellowness. t1, t2, t4 and t5 were significantly (p<0.05) different from each other while t0 and t3 were non-significantly (p>0.05) different in color value of l*. t0, t2, t3, t4 and t5 were significantly (p<0.05) different from each other while t1 was nonsignificantly (p>0.05) different in color value of a*. t3 and t5 show significant (p<0.05) difference than other treatment in color value of b*. 3.5. hardness of extruded multilegume savory bars hardness is one of the quality attributes, which describe quality of food bars before testing. the mean values of hardness for bars have been listed in table 4. maximum force (kg) was noticed on t5 (8.61±0.76) while minimum on t0 (5.33±0.34). highly significant values were observed for t5, t4 and t3 as compared to others. 3.6. in vitro and in vivo studies for protein digestibility protein digestibility values were calculated for each treatment and results regarding digestibility are shown in figure 1 for both in vitro and in vivo studies. in vitro digestibility was observed between 62.04 to 74.98% while tpd in vivo values ranged from 65.30 to 84.01%. maximum value for tdp was observed in t5 (84.01±3.91) and lowest value in t0 (65.30±3.43). all the treatments were significantly different (p<0.05) from control sample in both studies. ital. j. food sci., vol. 32, 2020 174 table 4. mean values of color and hardness (kg) of multilegume savory bar. color treatments l⋆ a⋆ b⋆ t0 150.50±0.13 6.63⋆ 17.8±0.07 t1 54.81±0.09⋆ 6.33 18.02±0.03 t2 58.67±0.14⋆ 7.85⋆ 16.03±0.02 t3 52.33±0.09 6.08⋆ 15.69±0.04⋆ t4 55.51±0.09⋆ 5.40⋆ 18.80±0.08 t5 57.84±0.12⋆ 5.30⋆ 19.4±0.09⋆ 1mean values of triplicate representations + standard deviation, superscripts (⋆) show the significant difference (p˂0.05) in same column. l⋆ represents the lightness ranging from darkness (0) to lightness (100). a⋆ represents redness varying from greenness (-a⋆) to redness (+a⋆). b⋆ represents the yellowness varying from blue (-b⋆) to yellow (+b⋆). figure 1. the in vivo and in vitro protein digestibility values (%) of different treatments. in vivo protein digestibility was evaluated using rats model and in vitro through pepsin and pancreatin. 3.7. sensory evaluation of extruded multilegume savory bars 0 10 20 30 40 50 60 70 80 90 100 t0 t1 t2 t3 t4 t5 in vivo in vitro treatments % p ro te in d ig es ti bi lit y in vivo and in vitro protein digestibility treatments hardness (kg) t0 15.33±0.34 t1 5.89±0.22 * t2 6.17±0.43 * t3 7.01±0.52 ** t4 7.99±0.56 ** t5 8.61±0.76 *** ital. j. food sci., vol. 32, 2020 175 values regarding aroma, texture and flavor analysis are shown figure 2. 0 1 2 3 4 5 6 7 sweet butter beany spicy herbs a: aroma t1 t2 t3 t4 t5 t0 0 1 2 3 4 5 6 7 8 soft hard crunchy crumbly dense/compact dry b: texture t1 t3 t4 t5 t0 t2 ital. j. food sci., vol. 32, 2020 176 figure 2. mean values were obtained through 3 repetitions by 19 panelists each. (a= aroma, b= texture, c= flavor) score range from 1 = dislike extremely to 9 = like extremely evaluated after 60 days of storage interval. texture observation of bar in t3, t4 and t5 showed significant sweet, butter and bean aroma. texture observation of extruded multilegume savory bars showed that all the treatments had rough texture; t2 showed significant dryness in its texture, t3, t4 and t5 showed crunchy and crumble texture. bars made from t4 showed compact and dense texture whereas bars from t5 were observed significantly soft in texture. flavor analysis showed that t3 has significant flavor of chewy, nutty and grainy, whereas flavor of bitter, burnt and saltish was found in t5. similarly, t4 showed significant saltish flavor. 4. discussion legumes are good source of proteins and transformation of these into bars helps to mitigate the threatening situation of pem. addition of whey protein concentrate, honey and palm oil into bar was also added to improve nutritional and sensorial characteristics. production of protein rich bars lower down pem but also provide various minerals and vitamins to consumer in sufficient quantity to address various body functions. as legumes proportions were increased in treatments, values of protein, ash and energy increased. so, it is clear from results that addition of legumes in composite proportions helps to increase the nutritional status of bars. nutritional value of proteins depends on the availability, digestibility and quantity of essential amino acids present in it. extrusion helps in the inactivation of anti-nutritional factors and improves nutritional values. so, preparation of 0 1 2 3 4 5 6 7 8 bitter burnt chewy nutty grainy saltiness herb/spacy c: flavor t4 t5 t0 t1 t3 t2 ital. j. food sci., vol. 32, 2020 177 bar through extrusion treatment is one of the best method to conserve protein constituents for mitigation of pem. abdel-gawad et al. (2016) prepared composite flours using legumes and wheat and observed protein content between 11.76 to 19.05%, fat content between 1.36 to 3.25%, crude fiber between 0.59 to 1.55% and ash content between 0.63 to 2.40%. all values are slightly different from current study that is due to use of whey protein concentrate and different legume species, as composition varies within species. jahreis et al. (2015) prepared legume flour and found ca content (47-221 mg/100g), k content (1030 to 1760 mg/100g), fe content (4.3 to 7.7 mg/100g) and zn content (2.5 to 4.1 mg/100g); these observations are slightly different from present study. this might be due to addition of different legume species. nadeem et al. (2012) prepared date bars and showed moisture content (15.56 to 18.70%), protein content (7.41 to 14.96%), crude fat (5.55 to 8.37%), crude fibre (3.58 to 3.88%) and ash content (2.30 to 2.91%). as multilegume increases in the bar protein, crude fibre and ash content also increases and improves minerals profile such as na, ca, k, fe, zn and essential amino acids without disturbing the sensorial parameters (bower and whitten 2000). added proteins are functioned to keep the ingredients of food bars intact, maximize the strength, set the structure and contribute to water holding capacity. whey protein possesses viscosity, water holding properties and gel strength that contribute to bar firmness (ortiz et al., 2008). fat content not only provide caloric values but also increases the palatability of bars. additionally, fat possess to act as a binder with sweeteners in agglutination of the ingredient present in bar that helps to impart compactness and firmness to texture of food bars (escobar et al., 1996). color is the first impression of a food product. it’s the first score of a like and dislike food commodity. srebernich et al. (2016) prepared cereal bar with different formulations and found l* value (52.78 to 62.70), a* values (8.39 to 11.93) and b* values (23.53 to 27.90), slight difference was found in our findings in accordance to current findings; this might be due to different composition of bars. rajabi (2017) prepared high protein extruded bars and found hardness values between 6.08 to 9.33 kg; these values are comparable to current findings. increase in harness was observed with the change in composite flour (%) that is might be due to the cumulative effect of different flours. almeida et al. (2015) prepared whey protein supplements and found their protein digestibility between 88.4 to 91.7% in vitro and these values are not comparable to current findings because in this study vegetable protein sources were used that have more antinutritional factors and can form more complex protein structure and may hinder protein digestibility (butts et al., 2012). in vivo true protein digestibility increased as the extruded multilegumes proportions increased in bars. erbersdobler et al. (2017) stated that digestibility of protein is high around 89-96% in weaning foods based on beans and rice and these values have contradictions to current findings and this might be due to use of different legumes and processing conditions. nosworthy et al. (2018) stated that extrusion of beans/legumes ameliorate the protein digestion as compared to other processing conditions. changes in extrusion variables also affect the protein digestibility. with the increase in extrusion temperature, the protein digestibility values are increased as inactivation of protease enzymes occur rapidly as temperature increases. increase in the shear forces increases the protein digestibility, this might be due to denaturation of protein increase with increasing screw speed (bhattacharya and hanna, 1985). in this study screw speed was 250 rpm and barrel exit temperature was 160°c, these conditions might be the reason of increase in protein digestibility of protein bars. ital. j. food sci., vol. 32, 2020 178 extruded multilegume savory bar first time prepared, which has sensorial and nutritional qualities. both nutritional and sensorial qualities of puffed cornmeal were enhanced when blended with milk protein isolates (onwulata, 2010), same is happened in current study. banach et al. (2016) prepared protein bar by using extruded milk protein concentrates that were more cohesive, softer and less textural changes were observed than bars prepared with the spray drying method. hence, extrusion process modifies the physico-chemical parameters of ingredients not only the structural-function relationships of proteins and same findings are observed in the current work. 5. conclusions compositional and sensorial characteristics of multilegume savory bars were assessed to consider the supplementation of protein from plant source (legumes) as alternate of meat protein. proximate analyses showed that proportion of different legumes have significantly increased the nutritional values of savory bar. significant increase in protein and minerals content were observed in bars and they have better protein digestibility in vivo and vitro studies conducted on rats. protein from plant source can be an economical approach to produce these bars to mitigate pem. so, these bars can be considered as well balanced fast food from nutritional point of view to handle the problems associated with pem. references aacc. 2000. “approved methods of the american association of cereal chemists”. 10th ed. american association of cereal chemists.st. paul, mn, u.s.a. abdel-gawad a.s. rashwan m.r.a. el-naggar e.a. and hassan m.a. 2016. composite flours from wheat-legumes flour. 1. chemical composition, functional properties and antioxidant assiut j. agric. sci. 47(6-2):430-442. adebowale k.o. and lawal o.s. 2004. comparative study of the functional properties of bambarra groundnut (voandzeia subterranean), jack bean (canavalia ensiformis) and mucuna bean (mucuna pruriens) flours. food res. int. 37(4):355-365. akeson w.r. and stahmann m.a. 1964. a pepsin pancreatin digest index of protein quality evaluation. j. nutr. 83:257261. almeida c.c. monteiro m.l.g. da costa-lima b.r.c. alvares t.s. and conte-junior c.a. 2015. in vitro digestibility of commercial whey protein supplements. lwt-food sci. technol. 61(1):7-11. alonso r. orue e. zabalza m.j. grant g. and marzo f. 2000. effect of extrusion cooking on structure and functional properties of pea and kidney bean proteins. j. sci. food agric. 80(3):397-403. aoac. 2012. “official method of analysis”. 19th ed. association of official analytical chemists, washington, dc, usa. banach j.c. clark s. and lamsal b.p. 2016. instrumental and sensory texture attributes of high-protein nutrition bars formulated with extruded milk protein concentrate. j. food sci. 81(5):1254-1262. bhattacharya m. and hanna m.a. 1985. extrusion processing of wet corn gluten meal. j. food sci. 50(5):1508-1509. bower j.a. and whitten r. 2000. sensory characteristics and consumer liking for cereal bar snack foods. j. sens. stud. 15(3):327-345. butts c.a. monro j.a. and moughan p.j. 2012. in vitro determination of dietary protein and amino acid digestibility for humans. br. j. nutri. 108:282-287. ital. j. food sci., vol. 32, 2020 179 erbersdobler h.f. barth c.a. and jah-reis g. 2017. legumes in human nutrition. nutrient content and protein quality of pulses. ernahrungs umschau. 64(9):134-139. ernest n. akpan p. and uko e. 2013. reduced levels of some iron parameters of protein energy malnourished children in calabar, nigeria. j. biol. agric. healthcare. 3(13):114-120. escobar b. estevez a.m. vasquez m. castillo e. and yanez e. 1994. cereal bars with peanut and puffed amaranthus:chemical and stability in accelerated storage. arch. latinoam nutr. 44:10-36. government of pakistan (gop). 2011. economic survey of pakistan. available at: www.finance.gov.pk/survey_1415.html (accessed on 28 august 2018.) hunter r.s. and harold r.w. 1987. the measurement of appearance, 2nd ed., john wiley and sons, inc. new york, ny usa. international food policy research institute (ifpri) 2016. global food policy report. available at: www.ifpri.org/publication/2016-global-food-policy-report (accessed 03 july 2018). jahreis g. brese m. leiterer m. schaefer u. and boehm v. 2016. legume flours: nutritionally important sources of protein and dietary fiber. ernahrungs umschau. 63(02):36-42. le roux i.m. le roux k. comulada w.s, greco e.m. desmond k.a. mbewu n. and rotheram-borus m.j. 2010. home visits by neighborhood mentor mothers provide timely recovery from childhood malnutrition in south africa: results from a randomized controlled trial. nutri. j. 9(1):56. meilgaard m. civile g.v. and carr b.t. 2007. sensory evaluation techniques. 4th ed. crc press. boca raton, fl, usa. pp. 1-464. miller d.s. and payne p.r. 1959. a ballistic bomb calorimeter. br. j. nutri. 13(4):501-508. nadeem m. anjum f.m. murtaza m.a. and mueen-ud-din g. 2012. development, characterization, and optimization of protein level in date bars using response surface methodology. sci. world j. nosworthy m. medina g. franczyk a. neufeld j. appah p. utioh a. frohlich p. and house j. 2018. effect of processing on the in vitro and in vivo protein quality of beans (phaseolus vulgaris and vicia faba). nutrients. 10(6):671. onis m.d. blössner m. and borghi e. 2012. prevalence and trends of stunting among pre-school children, 19902020. public health nutr. 15(1):142-148. onwulata c.i. 2010. use of extrusion-texturized whey protein isolates in puffed corn meal. j. food process. preserv. 34:571-586. ortiz m.e.r. martínez e.s.m. and padilla l.p.m. 2008. rheological and thermal properties of extruded mixtures of rice starch and isolated soy protein. starch‐stärke. 60(10):577-587. osen r. toelstede s. eisner p. and schweiggert-weisz u. 2015. effect of high moisture extrusion cooking on proteinprotein interactions of pea (pisum sativum l.) protein isolates. j. food sci. technol. 50(6):1390-1396. piga a.p. catzeddu s. farris t. roggio a. sanguinetti e. scano. 2005. texture evolution of “amaretti” cookies during storage. eur. food res. technol. 221:387391. raatz s. the bean institute (2010). nutritional values of dry beans. available at http://beaninstitute.com/healthbenefits/nutritional-value-of-dry-beans/ (accessed 1 june 2013). rajabi f. 2017. high protein bars based on whey proteins. master's thesis, norwegian university of life sciences, ås. rizwana b. butt m.s. sultan t.m. farhan s. and rabia n. 2015. protein-energy malnutrition: a risk factor for various ailments. crit. rev. food sci. nutr. 55(2):242-253. sarwar m.h. sarwar m.f. sarwar m. qadri n.a. and mughal s. 2013. the importance of cereals (poaceae: gramineae) nutrition in human health:a review. j. cereals oilseeds. 4(3):32-35. schönfeldt h.c. and hall n.g. 2012. dietary protein quality and malnutrition in africa. br. j. nutri. 108:69-76. ital. j. food sci., vol. 32, 2020 180 srebernich s.m. gonçalves g.m.s. ormenese r.d.c.s.c. and ruffi c.r.g. 2016. physico-chemical, sensory and nutritional characteristics of cereal bars with addition of acacia gum, inulin and sorbitol. food sci technol. 36(3):555-562. the united nations international children's emergency fund (unicef) (2016). unicef the state of the world's children. availabe at: www.unicef.org/publications/index_96412.html (accessed 10 september 2018). tremaine a. and schoenfuss t.c. 2014. twin‐screw extrusion puffing of nonfat dry milk and starch-the effects of acid addition, fluid addition rate and nonfat dry milk concentration on extruded products. j. food process. preserv. 38(1):232-246. usda, agricultural research service (2012). usda national nutrient. database for standard reference. available at: www.ars.usda.gov/ba/bhnrc/ndl (accessed 2 september 2018). van der pols-vijlibrief r. wijnhoven h.a.h. schaap l.a. terwee c.b. and visser m. 2014. determinants of proteinenergy malnutrition in community-dwelling older adults: a systematic review of observational studies. ageing res. rev. 18:112-131. paper received march 18, 2019 accepted october 1, 2019 ijfs#1572_bozza ital. j. food sci., vol. 32, 2020 181 paper effect of different illumination sources on colour and oxidative stability of seasoned coppa di parma pgi g. minelli*a,b, d.p. lo fiegoa,b, p. macchionic and p. favaa,b adepartment of life sciences, university of modena e reggio emilia, via amendola 2, 42122 reggio emilia, italy binterdepartmental research centre for agri-food biological resources improvement and valorisation (biogest-siteia), university of modena and reggio emilia, via amendola 2, 42122 reggio emilia, italy cdepartment of agricultural and food sciences (distal), university of bologna, viale fanin 44, 40127 bologna, italy *corresponding author: tel.: +39(0)522522085; fax: +39(0)522522027 email: giovanna.minelli@unimore.it abstract the influence of different lighting durations, lamps and modified atmosphere packaging (map) on the colour and oxidative stability of lipids was studied in coppa di parma pgi. the samples were stored (4°c) in darkness or lighted by uv-free lamps. in trials 1 and 2, the samples were lighted 24 and 12 h/day, respectively, and were packaged in air. in trial 3, samples were packaged in ma (70% n2/30% co2) and lighted 12 h/day. in air, illumination reduced oxidative stability, redness, colour saturation and increased the hue angle. in map, the lighting conditions did not affect colour and oxidative stability. during storage the lipid oxidation increased. overall, light negatively affected the studied parameters. keywords: colour, cured salami, lighting conditions, lipid stability, modified atmosphere packaging ital. j. food sci., vol. 32, 2020 182 1. introduction the colour of meat plays a pivotal role in determining the decision of the consumer to buy a particular product. indeed, it is perceived as relating to the freshness, integrity and quality of the food. thus, maintaining an attractive colour during storage is a key of success in the selling of meat. discolouration in retail-fresh meats during display is ascribable to muscle pigment oxidation (oxymyoglobin to metmyoglobin). this is influenced by oxygen concentration, ph and secondary products of lipids peroxidation (papuc et al., 2017). in case of nitrites addition, as in the processing of coppa di parma pgi (protected geographical indication), nitrosylmyoglobin formation occurs; this is an unstable pigment that, in presence of oxygen in cured meat, is oxidized to brownish nitrosylmetmyoglobin nommb (fox, 1966): this evidence was confirmed in scientific literature, in which the discolouration of nitrosylmyoglobin has been linked to the combination of the presence of both oxygen in the headspace surrounding the product and light exposure during the display life (møller and skibsted, 2002; zanardi et al., 2002). indeed, lipid oxidation, which takes place in intramuscular fat and/or membrane phospholipids, besides causing an unpleasant odour and flavour, brings about the loss of desirable colour, thereby reducing display life (buckley et al., 1995; papuc et al., 2017; ruiz et al., 1999) and has deleterious effects on the organoleptic properties of meat and meat products as well as the digestibility of main nutrients (garcía-lomillo et al., 2017; patrakova and gurinovich, 2015). therefore, preventing or delaying both pigment and lipid oxidation enables the duration in which the meat maintains its bright-red colour to be extended. the oxidation of both lipids and pigments in meats are strictly related to similar processes (faustman et al., 1989; papuc et al., 2017) and, in this regard, light may play a critical role. in fact, oxidative reactions can be initiated also by physical factors such as radiation and light (amaral et al., 2018). the effect of light on lipid oxidation has been shown in various foods, such as oils, butter, milk and meat (aurand et al., 1977; chahine and deman, 1971; kiritsakis and dugan, 1985; luby et al., 1986; whang and peng, 1988); uv-light is more effective than visible light in inducing oxidation of lipids and pigments (andersen and skibsted, 1991; bertelsen and boegh-soerensen, 1986; zhu and brewer, 1998). although the amount of radiation below 400 nm is small in fluorescent lamps used in display cabinets, it must be taken into account due to its deleterious effects on the display-life of meat (djenane et al., 2001). meat products on retail shelves are provided in transparent packaging and with residual oxygen inside the packages; in association with the cabinet display light, these can cause discolouration of the packaged meat products (gibis and rieblinger, 2011; mcmillin, 2008). to overcome this problem, in the last few decades the use of modified atmosphere packaging (map) for meat and sliced meat products is increasingly widespread as a tool to extend their shelf-life. however, the effect of lighting on the shelf-life of cured seasoned pork products has not been widely investigated. in particular, the coppa di parma pgi has never been studied under this profile. coppa di parma pgi is obtained from subjects of at least nine months of age weighing approximately 160 kg. after hand-salting, the muscular portion of the neck adhering to the cervical and the first two thoracic vertebrae is placed in a closed-ended beef gut casing and hand-tied with string. after two/three months of curing, coppa is marketable. the product, cylindrical in shape, is 25-40 cm long and weighs at least 1.3 kg. the aim of this work was to study the effects of display under different lighting times and lamps on the colour parameters and oxidative stability of coppa di parma pgi packaged in air as well as in a modified atmosphere. ital. j. food sci., vol. 32, 2020 183 2. materials and methods for the purposes of the study, a total of 18 coppa di parma pgi, obtained from a local retailer, were used. three distinct trials were carried out. for each trial, three replications were performed. in each replication, 2 different coppa were sampled and sliced. in the first two trials, the slices of coppa were air-packaged in trays made of a pet/evoh/pe structure (oxygen permeability < 0.5 cm3 m-2 24h-1 bar-1), lidded with a pet/pe film (oxygen permeability 80 cm3 m-2 24h-1 bar-1). in the third trial, sliced coppa was packaged with the same material (bottom and top) in a modified atmosphere (nominally 70/30 n2/co2), using caveco equipment and working with the technique of vacuum compensation. the initial and final atmosphere composition was determined by a handheld gas analyzer checkpoint (dansensor, denmark). in each replication, 26 trays were filled with 10 slices each of coppa. twenty-four trays were put in refrigerators at 4±1°c. six trays were maintained in the dark, the other 18 were put into another refrigerator, divided into 3 sections separated by horizontal black screens. each section (estimated area of 0.33 m2) was illuminated with a specific lamp, whose characteristics are summarized in table 1. table 1. characteristics of the different lamps used. lamp identifier (code) colour temperature °k colour rendering wattage (w) luminous flux (lm) illuminance* (lx) 640 basic cool white (cw) 4000 62 18 1200 3640 827 lumilux interna warm white (ww) 2700 80 18 1350 4090 76 natura neutral white (nw) 3500 75 18 750 2270 *the illuminance (lx) values have been calculated simply dividing the nominal luminous flux (lm) of each lamp by the exposed area (0.33 m2) of the fridge shelves. the distance between the lamp and the samples was about 40 cm. the samples contained in the remaining 2 trays were immediately assigned to the analyses (described below). the samples were exposed either to continuous lighting (24/24 hours) (trial 1), or to a 12 hours on/12 hours off light cycle (trials 2 and 3). eight trays (two for each lighting condition) were removed from the refrigerators after 24, 48, and 120 hours and then submitted to the analytical determinations. on each coppa, the lipid content was determined according to a.o.a.c. (1995) and the average lipid content was 29.3±5.5. lipid oxidation was measured by the 2-thiobarbituric acid reactive substances (tbars) method (siu and draeper, 1978). each sample was minced, and an aliquot of 2.5 g was homogenised in 12.5ml of distilled water at 9500 rpm for 2 min, using an ultra turrax tissue homogenizer and then vortexed for 1 min at high speed. samples were centrifuged for 20 min at 2000 rpm at 4°c with 12.5 ml of 10% trichloroacetic acid (tca) and the supernatant decanted through a paper filter (whatman 541). four ml of clear filtrate were transferred into 15 ml pyrex screw cap test tubes and 1 ml of 0.06m 2-thiobarbituric acid (tba) was added. a distilled water-tca-tba reagent ital. j. food sci., vol. 32, 2020 184 blank was prepared and treated in the same way as the samples. the samples were heated in a water bath at 80°c for 90 min and then cooled. absorbance was measured at 532 nm in spectrophotometer (jasco model v550, uv/vis, tokyo, japan). results were expressed as mg of malondialdehyde (mda)/kg. the surface colour of coppa slices was determined using a cm-600d spectrophotometer (konica minolta holdings, inc., osaka, japan) with a window diameter of 8 mm and d65 as the source of illumination. before colour measuring, carried out on both lean and fat tissue, the spectrophotometer was calibrated against a white plate supplied by the manufacturer. colour measurements complied with the cie colour convention (cie, 1986), where the three fundamental outputs are l*“lightness”, a*“redness”, b* “yellowness” values. chroma (c*), also referred to as saturation index and colour intensity, was calculated as: [(a*2+b*2)] 0.5 and hue angle (h*) calculated as follows: tan-1 (b*/a*). overall colour change (∆e) was calculated as [(∆l*2 + ∆a*2 + ∆b*2) 0.5] where ∆l*, ∆a* and ∆b* are the difference between time 0 and the values l*, a* and b*, respectively, at 24 (∆e1), 48 (∆e2) and 120 (∆e3) hours. the average values for both fat and lean were the mean of 25 determinations in each fraction. the data were submitted for analysis of variance, with the lamps and exposure times as independent variables (sas, 1996). in addition, interaction effect between exposure time and lamp was evaluated; this was statistically significant for none of the examined parameters (p>0.05) and was thus removed from the model. 3. results and discussion 3.1. trial 1 in this trial, the samples were packaged in air and illuminated 24h/d (table 2). l* values did not vary with lighting conditions, either in the lean fraction or in the fat. however, the values of most of the other colour parameters differed between the samples kept in the dark and those exposed to the lamps. in fact, in the lean component, light exposure led to a significant reduction of both a* (p<0.01) and c* (p<0.05) values and an increase in the h* value (p<0.01), whereas the b* value was unaffected. very similar trends were reported for fresh pork studied by zhu and brewer (1998). cierach and niedźwiedź (2014) reported a decrease of 4-7 units of a* values in semitendinosus muscle of beef after few days of light exposure using a lamp of 3000 k and 3 lightning intensity (500, 1000 and 1500 lux), demonstrating that intensity of 500 lx has less influence on the beef colour changes. in the scientific literature on this topic, light intensity has been chosen as a parameter to be standardized, by adjusting the lamp to product distance (böhner et al., 2014; böhner and rieblinger, 2016; haile et al., 2013; sørheim et al., 2017). in our work a fixed lamp to product distance has been chosen, in order to simulate the actual lighting condition of packaged coppa in the retail display. it is evident that, despite the lighting intensity values, the simultaneous presence of oxygen (20.9%) and the continuous lighting over 120 hours deeply affect the colour of the product, without no appreciable difference among the three lamps used. display time, too, had no effect on the l* value, as reported by other authors (cierach and niedźwiedź, 2014); however, all the other colour characteristics in the lean fraction changed significantly during the 120 hours display period (table 2). the a* value decreased over time (p<0.01), while the b* value increased, significantly (p<0.05) only at 48 hours of storage. ital. j. food sci., vol. 32, 2020 185 table 2. effect of lighting and display time on colour parameters and tbars values (mg mda/kg) in air packaged coppa di parma pgi with 24 hours lighting/day. trial 1 lighting /lamp time of display (h) r-mse (df 66) darkness cw ww nw 24 48 120 lean: l* 44.40 45.90 44.78 45.36 43.65 45.87 45.80 5.02 a* 16.58a 12.06b 12.81b 12.41b 14.69a 13.99a 11.72b 1.69 b* 16.62 17.76 17.05 17.26 16.16b 18.32a 17.03ab 3.24 c* 23.76a 21.65b 21.64b 21.51b 22.15ab 23.38a 20.90b 2.86 h* 44.50b 55.31a 52.04a 53.62a 47.37bb 51.80aba 54.93aab 6.16 fat: l* 63.90 65.17 63.26 62.32 63.58 63.71 63.69 4.41 a* 8.17a 4.52b 5.76b 5.47b 6.23 6.27 5.44 2.06 b* 12.96b 13.94ab 14.30a 14.03ab 13.21b 14.31a 13.89ab 1.87 c* 15.53 14.87 15.63 15.28 14.93 15.85 15.20 2.38 h* 59.32b 73.63aa 69.56ab 70.48aab 66.68b 67.75ab 70.31a 5.74 tbars 0.288bb 1.414aa 0.741abb 0.717abb 0.323b 0.413b 1.635a 0.91 a,b: p<0.05; a, b: p< 0.01. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. the opposite trends of a* and b* values brought about a significant increase of the h* value during storage (p<0.01). the value of c* decreased significantly (p<0.01) between 48 and 120 hours. changes in a*, b*, c* and h* values, and hue angle (h*) indicated that the lean fraction of the samples tended to be less red and more grey as storage time increased, probably due to a progressive loss of nitrosylmyoglobin and the consequent increase of nommb, according with the findings of other authors (böhner et al., 2014; haile et al., 2013). as shown in fig. 1, 24 hours under the basic cool white (cw) led to an a* value lower (p<0.05) than under the other lamps, whereas at 48 and 120 hours a* values were similar regardless the lamps. also with regard to the fat fraction (table 2), the light lowered the a* value (p<0.01), which did not differ among lamps; instead, it increased the values of b* (p<0.05) and h* (p<0.01) without affecting the c* value. indeed, storage time led to an increase of b* and h* values (p<0.05), as observed in the lean fraction. overall, the lipid fraction of the sliced coppa tended to yellow, as a consequence of both light exposure, oxygen in contact with the product and storage time, which promote the fat fraction oxidation. samples under the cw lamp showed tbars values significantly higher than those kept in the dark (p<0.01) or illuminated by the other two lamps (p<0.05). at 24 and 48 hours, tbars values were similar, while they increased significantly at 120 hours (p<0.01). the evolution of tbars values during display, depending on the different lighting conditions, is shown in fig. 2. ital. j. food sci., vol. 32, 2020 186 figure 1. values of cie a* (redness) in coppa di parma pgi packaged in air, displayed under continuous lighting. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. figure 2. tbars values (mg mda/kg) in coppa di parma pgi packaged in air, displayed under continuous lighting. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. ital. j. food sci., vol. 32, 2020 187 lipid oxidation did not develop in the dark. during storage, tbars values increased in all the lighted samples. at 120 hours, the samples under the cw lamp gave values higher (p<0.01) than those under the other two lamps. these results may be explained considering the different emission spectra of the three lamps tested in this work (data from technical data sheet by osram). cool white (cw) has a strong emission in the short wavelengths (blue and green zone of the spectrum – from 430 to 560 nm); instead, warm white (ww) and natura neutral white (nw) lamps are characterized by an emission in the blue zone significantly lower respect to cw; nw also shows a good emission in the red zone (630-700 nm). some authors underlined the importance of the lamps’ emission spectra and the correlated energy. böhner and rieblinger (2016) demonstrated that shorter wavelengths and higher irradiance provoke increased oxygen absorption with concomitant colour changes of bologna sausages. the continuous lighting promotes also lipid oxidation, but low energy emitting lamps will affect to a lesser extent this product degradation, as demonstrated in figure 2, where the tbars values in coppa stored under nw and ww lamps are lower than those determined on the samples stored under cw lamp. 3.2. trial 2 in this trial, the slices of the coppa were also packaged in air, but using a 12 hours on/12 hours off light cycle. as observed in trial 1, the l* value (table 3) did not vary in any tissue, either with the type of illumination or with the storage time. for the other colour parameters studied, the trends observed did not differ markedly from the first trial, though only a* and h* values varied significantly. table 3. effect of lighting and display time on colour parameters and tbars values (mg mda/kg) in air packaged coppa di parma pgi with 12 hours lighting/day. trial 2 lighting /lamp time of display (h) r-mse (df 66) darkness cw ww nw 24 48 120 lean: l* 40.63 42.46 41.61 42.00 40.74 41.35 42.93 3.86 a* 18.23a 14.72b 15.73b 15.04b 17.67aa 15.83abb 14.29b 2.81 b* 14.95 15.86 15.55 15.38 14.99 15.05 16.27 3.80 c* 23.77 21.93 22.38 21.75 23.38 22.10 21.89 4.19 h* 38.56bb 46.60a 43.67aba 44.58a 39.55b 42.23b 48.28a 5.88 fat: l* 61.70 62.34 60.16 59.74 59.77 61.86 61.32 6.73 a* 9.39aa 6.32b 7.45abb 7.98ab 8.97a 7.78ab 6.60b 2.50 b* 12.85 14.07 13.89 14.33 13.20 14.56 13.59 0.83 c* 16.23 15.80 16.13 16.72 16.34 16.88 15.44 2.82 h* 54.13b 66.78a 63.52a 62.31a 57.29bb 62.66aba 65.12a 7.95 tbars 0.340a 1.044b 0.790ab 0.658ab 0.340b 0.519b 1.258a 0.73 a,b: p<0.05; a, b: p< 0.01. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. ital. j. food sci., vol. 32, 2020 188 the statistical data processing demonstrates that illuminated samples showed a lower a* value (p<0.01) and a higher h* value (p<0.05) in the lean fraction; whereas, only h* changed in the fat fraction (p<0.01), and no significant differences were found among the lamps. at increased storage time, a* values decreased, significantly at 120 hours (p<0.01), both in lean and fat components, with a corresponding increase (p<0.01) of the h* values in both tissues. in fig. 3, the a* value evolution on the surface of coppa slices exposed to different light sources or stored in the dark is reported. the colour of samples stored in the dark changes, even if slightly, probably because of high partial pressure of oxygen in the headspace of the packages. if the samples stored under light are considered, it is possible to observe a different influence of the lamps used. samples stored under cw lamp shows a more pronounced decrease of the a* value between 48 and 120 hours of discontinuous lighting in comparison with the results obtained with ww and nw lamps. discontinuous lighting also affects the colour of coppa slices, but highlights the influence of different emitting lamps on the product colour fading. figure 3. values of cie a* (redness) in coppa di parma pgi packaged in air, displayed under 12 h/d lighting. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. tbars values showed the same path observed in trial 1. thus, the samples kept in the dark provided the lowest values, but only the cw lamp caused significantly higher values (p<0.01). moreover, as in trial 1, tbars increased with time, significantly at 120 hours (p <0.01). tbars evolution during storage under different lighting conditions is shown in fig. 4: darkness preserved samples from oxidation, which developed more markedly in the ital. j. food sci., vol. 32, 2020 189 illuminated samples, showing the highest value under the cw lamp. these data are consistent with those obtained for the colour changes. figure 4. tbars values (mg mda/kg) in coppa di parma pgi packaged in air, displayed under 12h/d lighting. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. 3.3. trial 3 in table 4 are shown the data concerning the samples packaged in modified atmosphere (map) exposed to continuous lighting 12h/d. as regards the effect of the type of lighting, the results showed no statistically significant variation (p>0.05) of the values of the parameters taken into account, neither in the lean nor the fat fraction. as concerns the a* value, our results agree with the findings of martínez et al. (2007) on fresh pork sausages and of djenane et al. (2001; 2003) on fresh beef steaks, and partially with the results of haile et al. (2013) on colour stability of cooked ham. the effect of residual oxygen and light exposure on the quality of cured boiled sausages (böhner et al., 2014) and of norwegian salami (sørheim et al., 2017) has been studied. in our work the residual oxygen inside the ma packages was not measured, so we can only hypothesize a complete oxygen depletion during the packaging process, which makes irrelevant the lighting of the product concerning the colour fading. another consideration is that the cured products examined in the cited works differ from coppa, and it is well known that the type of meat and the production process may influence the specific sensitivity against oxygen and light. if storage times are considered, the few significant differences observed in the lean fraction showed an erratic path, difficult to explain. these same considerations also apply to the evolution of a* value in the samples displayed under different lightings; as fig. 5 clearly shows, map maintained the red colour, regardless of light exposure and source; though it must be noted that the a* values at 0 hours were lower in this trial. ital. j. food sci., vol. 32, 2020 190 table 4. effect of lighting and display time on colour parameters and tbars values (mg mda/kg) in coppa di parma pgi packaged in a modified atmosphere with 12 hours lighting/day. trial 3 lighting /lamp time of display (h) r mse (df 66) darkness cw ww nw 24 48 120 lean: l* 41.24 40.92 43.00 41.48 41.48 41.99 41.51 3.36 a* 13.45 13.84 13.03 13.94 13.64ab 14.05a 13.00b 1.60 b* 12.30 12.05 12.50 12.44 12.12 12.48 12.38 1.37 c* 18.43 18.52 18.18 18.81 18.37 ab 18.92a 18.17 b 1.13 h* 42.63 41.46 44.29 42.07 41.87 42.04 43.93 5.66 fat: l* 56.35 57.37 57.09 56.22 56.04 57.19 57.04 5.61 a* 6.63 5.95 6.17 6.93 6.97a 6.78ab 5.51b 2.32 b* 10.39 10.99 11.06 11.01 10.82 10.85 10.92 1.13 c* 12.68 12.87 13.07 13.40 13.23 13.15 12.64 1.92 h* 59.83 64.02 63.64 60.66 59.83b 60.90ab 65.38a 7.82 tbars 0.312 0.306 0.283 0.277 0.254b 0.271b 0.358a 0.07 a,b: p<0.05; a, b: p< 0.01. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. figure 5. values of cie a* (redness) in coppa di parma pgi packaged in a modified atmosphere, displayed under 12 h/d lighting (1c). cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. ital. j. food sci., vol. 32, 2020 191 at increasing storage time, a significant decrease at 120 hours (p<0.05) of the a* value and a corresponding significant increase (p<0.05) of the h* value took place in the adipose fraction. the tbars values did not differ between the samples maintained in the dark and those exposed to light. also in this case, as well as the colour evolution, eliminating oxygen in contact with coppa means protect the product against lipid oxidation, even in presence of a luminous source emitting high energy wavelengths, such as cw lamp (refer to fig. 6). our findings are consistent with the results of martínez et al. (2007) on fresh pork sausages, with djenane et al. (2001; 2003) on fresh beef steaks and with gimenez et al. (2004; 2005) on gilt-head sea bream and salmon fillets. as in the two previous trials, after 120 h of storage, tbars values increased significantly (p<0.01), though changes were rather slight. our results conflict with those of møller et al. (2000) who could not detect any difference among tbars values in samples lighted or kept in the dark. the authors stated that this could be due to the low fat content of their hams, much lower than the one found in our samples of coppa, which was well above 29%. figure 6. tbars values (mg mda/kg) in coppa di parma pgi packaged in a modified atmosphere, displayed under 12h/d lighting. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. table 5 shows changes in the value ∆e that expresses, in the cie l*, a*, b*, the quantification of the colour difference. as regards the type of lighting, it can be observed that at 24 hours (∆e1) the cw lamp brought about a colour variation greater than the other lighting conditions, which was significant only when compared with the dark (p<0.01). regarding the ∆e2 values, they were greater than ∆e1, as expected, and were significantly lower in the samples kept in the dark (p<0.05). at 120 hours (∆e3) the colour difference was still greater and although ital. j. food sci., vol. 32, 2020 192 the samples kept into the dark gave the lowest value, no statistically significant variation among lighting conditions was found (p>0.05). table 5. effect of lighting and display time on colour change (∆e) in the lean of coppa di parma pgi. lighting /lamp treatment r-mse (df 66) darkness cw ww nw trial 1 trial 2 trial 3 δe1 5.28b 7.63a 6.21ab 6.38ab 7.73a 6.37ab 5.02b 2.60 δe2 5.68b 8.80a 8.76a 8.15a 9.64a 8.76a 5.14b 3.58 δe3 7.73 9.54 9.10 9.08 11.59a 9.98a 5.01b 3.69 a,b: p<0.05; a, b: p< 0.01. cw: 640 basic cool white lamp; ww: 827 lumilux interna warm white lamp; nw: 76 natura neutral white lamp. ∆e1, ∆e2 and ∆e3 are calculated colour differences between time 0 and 24, 48, 120 hours, respectively with regard to the colour difference among the trials, data showed that the presence of oxygen caused a significant increase of ∆e2 and ∆e3 values (p<0.01), while at 24 hours (∆e1) only permanent lighting gave colour changes higher (p<0.01) than in map stored samples. no visual evaluations have been performed, in order to establish if the colour changes can be detected by consumers, but it was demonstrated that if ∆e>2 a small difference is observed, and when ∆e>5 the changes are well distinguished (fleishman et al., 1998; lindström, 2008). 4. conclusions from our results it may be concluded that the lighting with uv-free lamps negatively affects colour characteristics of coppa di parma pgi sliced and then packaged in air. further, illumination causes a significant increase of lipid oxidation and the basic cool white lamp appears to be somewhat more detrimental. when the product is packaged in a modified atmosphere, colour and lipid stability are not affected by light exposure or source. one hundred and twenty hours of storage led mainly to a loss of redness and to a significant increase of lipid oxidation. acknowledgements the research was carried out with private funds. the authors wish to thank dr. v. cornini and dr. s. codelupi members of technical staff of coopbox group spa (bibbiano, reggio emilia, italy) for their skillful technical assistance. references amaral a.b., da silva m.v. and lannes s.c. da silva. 2018. lipid oxidation in meat: mechanisms and protective factors a review. food sci. technol, campinas, 38(suppl. 1):1-15. a.o.a.c. 1995. official methods of analysis of the association of official analytical chemists. 16th ed., washington, dc, usa. ital. j. food sci., vol. 32, 2020 193 andersen h.j. and skibsted l.h. 1991. oxidative stability of frozen pork patties. effect of light and added salt. j. food sci. 56(5):1182-1184. aurand l.w., boone n.h. and giddings g.g. 1977. superoxide and singlet oxygen in milk lipid peroxidation. j. dairy sci. 60:363-369. bertelnsen g. and boegh-soerensen l. 1986. the effect of lighting on colour of beef. in: proceedings of. ii rmeeting. bristol, uk, 433-438. böhner n., hösl f., rieblinger k. and danzl w. 2014. effect of display illumination and headspace oxygen concentration on cured boiled sausages. food packaging and shelf life i:131-139 böhner n. and rieblinger k. 2016. impact of different light spectra on oxygen adsorption and surface discoloration of bologna sausage. meat sci 121:207-209 buckley d. j., morrissey p. a. and gray j. i. 1995. influence of dietary vitamin e on the oxidative stability and quality of pig meat. j.anim. sci. 73(10):3122-3130chahine m.h. and deman j.m. 1971. autoxidation of corn oil under the influence of fluorescent light. can. inst. food sci. techn. j. 4(1):24-28. cie 1986. colorimetry (2nd ed.). commission international de l'éclairage, publication cie 15.2. vienna: cie. cierach m. and niedźwiedź j. 2014. effects of three lighting intensities during display on discolouration of beef semitendinosus muscle. eur. food. res. technol. 239:377-383 djenane d., sánchez-escalante a., beltrán, j.a. and roncalés p. 2001. extension of the retail display life of fresh beef packaged in modified atmosphere by varying lighting conditions. j. food sci. 66(1):181-186. djenane d., sánchez-escalante a., beltrán j.a. and roncalés, p. 2003. extension of the shelf life of beef steaks packaged in modified atmosphere by treatment with rosemary and displayed under uv-free lighting. meat sci. 64:417-426. faustman c., cassens r., schaefer. d.m., buege d.r., williams s.n. and scheller k.k. 1989. improvement of pigment and lipid stability in holstein steer beef by dietary supplementation with vitamin e. j. food sci. 54:858-862. fleishman l.j., mcclintock w.j., d’eath r.b., brainard d.h., endler j.a. 1998. colour perception and the use of video playback experiments in animal behaviour. anim behav. 56:1035-1040. fox j.b. 1966. the chemistry of meat pigments. j. agric. food chem. 14(3):207-210. garcía-lomillo j., gonzalez-sanjose m. l., del pino-garcía r., ortega-heras m. and muñiz-rodríguez, p. 2017. antioxidant effect of seasonings derived from wine pomace on lipid oxidation in refrigerated and frozen beef patties. lwt food sci. technol. 77:85-91. gibis d. and rieblinger k. 2011. oxygen scavenging films for food application. proc. food sci. 1: 229-234. giménez b., roncalés p., and beltrán j.a. 2004. the effects of natural antioxidants and lighting conditions on the quality characteristics of gilt-head sea bream fillets (sparus aurata) packaged in modified atmosphere. j. sci. food agric. 84:10531060. giménez b., roncalés p., and beltrán j.a. 2005. the effects of natural antioxidants and lighting conditions on the quality of salmon (salmo salar) fillets packaged in modified atmosphere. j. sci. food agric. 85:1033-1040. haile d.m., de smet s., clayes e. and vossen e. 2013. effect of light, packaging condition and dark storage duration on colour and lipid oxidative stability of cooked ham. j. food sci. technol. 50(2):239-247 kiritsakis a., and dugan l.r. 1985. studies in photooxidation of olive oil. j. am. oil chem. soc. 62:892-896. lindström p. 2008. delta e blues: the science of color perception. seybold report: analyzing publishing technologies 8(3):13. luby j.m., gray j.i., harte b.r. and ryan t.c. 1986. photooxidation of cholesterol in butter. j. food sci. 51:904-907. martínez l., cilla i., beltrán j.a. and roncalés p. 2007. effect of illumination of the display life of fresh pork sausages packaged in modified atmosphere. influence of the addition of rosemary, ascorbic acid and black pepper. meat sci. 75:443-450. ital. j. food sci., vol. 32, 2020 194 mcmillin k.w. 2008. where is map going? a review and future potential of modified atmosphere packaging for meat. proc 54th interntl. cong. meat sci. techn. 43-65. cape town. møller j.k.s., jensen j.s., olsen m.b., skibsted l.h. and bertelsen g. 2000. effect of residual oxygen on colour stability during chill storage of sliced, pasteurized ham packaged in modified atmosphere. meat sci. 54:399-405. møller j.k.s. and skibsted l.h. 2002. nitric oxide and myoglobins. chem. rev. 102:1167-1178. papuc c., goran g.v., predescu c. n. and nicorescu v. 2017. mechanisms of oxidative processes in meat and toxicity induced by postprandial degradation products: a review. comp. revi. food sci. food saf. 16:96-123. patrakova i. s. and gurinovich, g. v. 2015. the study of factors affecting the activity of meat antioxidant system. foods and raw materials, 3, 33-40. ruiz j.a., pérez-vendrell a.m. and esteve-garcıá e. 1999. effect of b-carotene and vitamin e on oxidative stability in leg meat of broilers fed different supplemental fats. j. agric. food chem. 47:448-454. sas institute. 1996. sas/stat user’s guide. cary, nc: sas institute inc. siu g.m. and draper h.h. 1978. a survey of the malonaldehyde content of retail meats and fish. j. food sci. 43:11471149. sørheim o., måge i. and larsen h. 2017. determination of critical levels of residual oxygen to minimize discoloration of sliced packaged norwegian salami under light display. meat sci. 129:88-92. whang k. and peng i.c. 1988. photosensitized lipid peroxidation in ground pork and turkey. j. food sci. 53:1596-1598. zanardi e., dorigoni v., badiani a. and chizzolini r. 2002. lipid and colour stability of milano-type sausages: effect of packaging conditions. meat sci. 61:7-14. zhu l.g. and brewer m.s. 1998. discoloration of fresh pork as related to muscle and display conditions. j. food sci. 63: 763-767. paper received april 11, 2019 accepted october 13, 2019 ijfs#1004_bozza ital. j. food sci., vol. 30, 2018 456 paper effects of temperature on biofilm formation and quorum sensing of aeromonas hydrophila m.f.r. mizana, i.k. jahida, b, s.y. parkc, j.l. silvad, t.j. kime, j. myoung*f and s.-d. ha*a a department of food science and technology, advanced food safety research group, brain korea 21 plus, chung-ang university, 72–1 nae-ri, daedeok-myun, anseong, gyunggi-do 456-756, south korea b department of microbiology, jessore science and technology university, jessore-7408, bangladesh c department of seafood and aquaculture science, institute of marine industry, gyeongsang national university, togyeong 53024, south korea d department of food science, nutrition and health promotion, mississippi state university, mississippi state, mississippi 39762, usa e food and nutrition department, college of education, health and human sciences, wisconsin’s polytechnic university, 712 broadway st s, menomonie, wi 54751, united states f korea zoonosis research institute, chonbuk national university, deokjin-dong 1ga, deokjin-gu, jeonju-si, jeollabuk-do, south korea *e-mail addresses: jinjong.myoung@jbnu.ac.kr; sangdoha@cau.ac.kr abstract aeromonas hydrophila is an emerging foodborne pathogen that causes infections more frequently in summer than in winter. this study evaluated the effects of temperature (437°c) on the biofilm formation and quorum sensing abilities of a. hydrophila on microtiter plates, stainless steel (ss), and crab surfaces. the incubation of the bacterium in luriabertani broth at temperatures of 20-25°c significantly (p < 0.05) enhanced the biofilm formation and intra-species quorum sensing ability (via c4-ahl and c6-ahl). fieldemission electron microscopy revealed that the bacterium colonized the surface of crab and formed biofilms at 25°c. thus, the present study demonstrates that temperature control in food processing environments may reduce a. hydrophila biofilm formation. therefore, the study has significant applications in food processing plants. keywords: aeromonas hydrophila, temperature, biofilm, quorum sensing, crab surface ital. j. food sci., vol. 30, 2018 457 1. introduction aeromonas hydrophila has recently received much attention as an emerging opportunistic and foodborne pathogen and a causative agent of various human infections such as gastrointestinal tract infections, wound and soft tissue infections, and blood-borne dyscrasias (daskalov, 2006). the incidence of these infections is higher during summer, owing to elevated temperatures (janda and abbott, 2010). the importance of a. hydrophila in food safety (daskalov, 2006), fish diseases, and human infections (janda and abbott, 2010) as well as its role in quorum sensing and biofilm formation (chopra et al., 2009) have been studied. the bacterium has been isolated from various fresh and estuarine water samples and animals living in these waters, including fish, crab, shrimp, and other mollusks (ottaviani et al., 2011; deng et al., 2014). microbial biofilms are sessile microbial communities that are attached to either biotic or abiotic surfaces. biofilm formation is a common phenomenon in nature; for instance, biofilms are formed on foods and food-contact surfaces as well as in waste treatment plants. the effect of temperature on the production of biofilms and virulence factors has been studied using various microorganisms, including enterococcus spp., salmonella spp., and listeria monocytogenes (di bonaventura et al., 2008; jahan and holley, 2014). although salmonella is commonly associated with human and animals, it can also be found in the environment (chronicle, 1997; giaouris et al., 2005). as these are environmental microorganisms, such as a. hydrophila, temperature is expected to modulate their survival and ability to form biofilms. quorum sensing is a density-dependent process by which microorganisms coordinate and control intraspecies and interspecies communication (fuqua et al., 1994). several authors have reviewed the importance of quorum sensing in relation to food microbiology (skandamis and nychas, 2012; mizan et al., 2015). a. hydrophila carries quorumsensing genes, including ahyi (encoding n-3-butanoyl-dl-homoserine lactone [c4-ahl]) and ahyr (encoding n-3-hexanoyl homoserine lactone synthase [c6-ahl]) (swift et al., 1997). in addition, the bacterium produces autoinducer 2 (ai-2) for inter-species communication (kozlova et al., 2008). intra-species quorum sensing in a. hydrophila (via c4-ahl and c6-ahl) has been reported to control biofilm formation, motility, and virulence factors (khajanchi et al., 2009). temperature is known to play an important role in governing the rate of microbial activity as well as for the propagation of biofilms and settlement of organisms in aquatic systems (rao, 2010). biofilm formation is influenced by several factors, available nutrients, and organic matter. melo and bott (1997) reported that the development and maturation of biofilm is dependent on temperature, nutrient availability, and water flow rate. as a. hydrophila is common in aquatic environments, it may face adverse environmental conditions such as fluctuations in temperature, humidity, and ph (daskalov, 2006). survey studies have shown that aeromonads are found in high numbers in late summer/early autumn (temperatures are around 20–25°c) but are rarely detected during the cold months (gavriel et al., 1998). the present study focused on the effects of temperatures on biofilm formation and quorum sensing by a. hydrophila on the surface of microtiter plates, stainless steel (ss), and crab shells. in the food industry, biofilm formation is a major concern as an important source of food contamination. therefore, the results of this study will provide potential approaches to avoid contamination, as they reveal the temperatures favorable for a. hydrophila biofilm formation and quorum sensing. ital. j. food sci., vol. 30, 2018 458 2. materials and methods 2.1. bacterial strains, culture media, and growth conditions in the present study, the following strains were used: a. hydrophila kctc 11533 (isolated from surface water) and kccm 32586 (a clinical isolate), vibrio harveyi strain bb120 and bb170, and chromobacterium violaceum cv026. the bioreporter strain cv026 was provided by the animal, plant, and fisheries quarantine and inspection agency, korea. luriabertani (lb) broth (difco laboratories, detroit, mi, usa) was used for the bacterial cultivation and violacein production assay. prior to each experiment, frozen culture aliquots (100 µl) were thawed and inoculated into 5 ml of lb broth. the cultures were incubated at 30°c and 220 rpm for 24 h. these starter cultures were subsequently inoculated into fresh lb broth and cultured to a final optical density of 1.0 at 600 nm (od600), followed by their dilution (1:50) for biofilm formation experiments and quorum sensing assay. 2.2. quantitative biofilm formation assay in microtiter plates the quantitative biofilm assay was performed as previously described (o’toole, 2011; mizan et al., 2016). a. hydrophila was cultured in lb broth for 24 h without shaking, followed by its dilution at 1:50 in lb broth. a total of 100 µl aliquots were placed in the wells of 96-well polystyrene microtiter plates (becton, dickinson and company, franklin lakes, nj, usa) and the microtiter plates were incubated at 4, 10, 15, 20, 25, 30, 35, and 37°c for 72 h without shaking. biofilm formation was normalized to planktonic growth and determined using the following equation (1), according to teh et al. (2010): (1) where bfi is the biofilm formation index, ab is od595 of the crystal violet (cv)-stained attached microorganisms, cw is od595 of the stained blank wells containing sterile (microorganism-free) medium only, gb is od600 of the cells in suspended culture, and gw is od600 of the blank well. biofilm production was classified into three categories according to martinez-medina et al. (2009): weak (0.1 > bfi ≤ 0.5), moderate (0.5 > bfi ≤ 1), and strong (bfi > 1). 2.3. determination of biofilm formation on ss surfaces austenitic ss coupons (type 302, 2 × 2 × 0.1 cm; chung-ang scientific inc., seoul, korea) were processed as described by shen et al. (2012). thereafter, a. hydrophila cell suspensions were diluted at 1:50 and inoculated into 7 ml of fresh lb in 50 ml falcon tubes containing a completely submerged ss coupon. the tubes were incubated without shaking at 4, 10, 15, 20, 25, 30, 35, and 37°c for 24 h to allow biofilm formation on ss coupons. following incubation, each ss coupon was transferred into a small petri dish (55 × 12 mm) containing 1 ml of 0.1% peptone water (pw; oxoid, hampshire, uk) and agitated by rotation in clockwise and anticlockwise direction using sterile forceps. agitation was always performed by the same person; thus, it was assumed that the same amount of pressure was applied to all coupons (jahid and ha, 2014). the cells were separated, vortexed, and diluted in pw for enumeration. cell number was quantified using bacto r2a agar (difco, usa) following incubation for 24 h. ital. j. food sci., vol. 30, 2018 459 2.4. preparation of inocula for crab surfaces cultures grown in lb broth were centrifuged (10,000 ×g for 10 min at 4°c) and the pellets were washed twice with dulbecco’s phosphate-buffered saline (dpbs). the pellets were re-suspended in a suitable amount of dpbs to obtain an absorbance of 1.0 at 600 nm wavelengths. to determine the cell density, serial dilutions were performed and plated on aeromonas selective medium (oxoid, hampshire, uk). these inocula were used to inoculate the crab surfaces. 2.5. biofilm formation on crab surfaces and detachment of cell population crabs (corystes cassivelaunus) used in this study were purchased from a local grocery store in anseong, korea. a delimited area (cm2) of crab shell was dissected and processed immediately, as described by jahid et al. (2015). the shells were incubated at different temperatures (4, 10, 15, 20, 25, 30, 35, and 37°c) without shaking. the detachment of microbial populations from shell surfaces was performed as described by jahid et al. (2014), with minor modifications. briefly, the crab surfaces were washed twice with pbs to free planktonic cells and placed in 10 ml of pw in a sterile stomacher bag (nasco whirlpak, usa). these were processed using a stomacher (bagmixer, interscience, saint nom, france) at maximum speed for 2 min to free the biofilm-forming microbes from the crab shells. a. hydrophila was enumerated after serial dilution and spread plating on aeromonas selective medium containing ampicillin. the plates were incubated at 30°c for 48 h. colonies were counted and the results for biofilm production were expressed as colonyforming unit (cfu)/cm2 for biofilm populations. for each of three independent experiments, two plates per dilution were assessed to obtain the final data. 2.6. quantification of violacein production to quantify violacein production, the procedures described by kim et al. (2013) and jahid et al. (2015) were followed. a. hydrophila was cultivated in lb broth at different temperatures for 24 h and the supernatant was collected by centrifugation at 15,000 ×g for 15 min, followed by its filter sterilization using 0.22 µm filters (millipore corporation, billerica, ma, usa). lb agar was prepared, cooled, and poured using the open side of a 1 ml pipette tip to make a well. a loop full of c. violaceum cv026 overnight culture was spread on the wall of the well and treated with 100 µl of supernatant from each condition at 28°c for 24 h in an upside up of petri dish. next, whole cv026 cells grown on the plate were collected and solubilized with 250 µl of dimethyl sulfoxide (dmso; sigma aldrich). the mixture was vortexed to ensure the release of violacein pigment. after centrifugation at 15,000 ×g for 15 min, the absorbance of 200 µl of colored dmso from cv026 cells was measured at 585 nm wavelength using a microplate reader (spectra max 190; molecular devices). 2.7. autoinducer-2 (ai-2) bioassay the secretion of ai-2 by a. hydrophila during its incubation with crab surfaces at different temperatures (4-37°c) was assessed with minor modifications in previously described procedures (soni et al., 2008). a. hydrophila was inoculated on crab surfaces in cyanobacteria bg-11 freshwater solution (sigma aldrich, inc., st. louis, mo, usa) and incubated at different temperatures without shaking. the cultures were centrifuged at 15,000 ×g for 10 min. the supernatant from the cell-free culture was passed through 0.2 µm tuffryn syringe filters and stored at -20°c. the cell-free supernatants were tested for ital. j. food sci., vol. 30, 2018 460 the presence of ais that induce luminescence of v. harveyi reporter strain bb170. this strain carries sensor 2, but not sensor 1, and is capable of sensing ai-2 but not ai-1. v. harveyi strain bb170 was grown overnight at 30°c with aeration in the autoinducer bioassay (ab) broth and diluted to 1:1,000 in ab medium (bassler et al., 1993). next, 4.5 ml of diluted v. harveyi strain bb170 and 500 µl of the cell-free supernatant from each sample (a. hydrophila supernatant incubated with crab at different temperatures) was added to 50 ml falcon tubes and shaken for 16 h at 220 rpm to allow the reporter strain to produce luminescence. a total of 100 µl samples were transferred to white microtiter plates and the luminescence was measured using a computer-controlled microplate luminometer (glomax® 96 microplate luminometer for luminescence, promega, madison, wi, usa). v. harveyi strain bb120 that produces ai-1 and ai-2 was used as a positive control. control v. harveyi strains were grown overnight at 30°c with shaking at 220 rpm in lb broth and 1 ml of cell-free supernatant from each culture was prepared as described above. 2.8. field-emission scanning electron microscopy a. hydrophila biofilm formation was observed on crab surfaces at 4, 25, and 37°c by fieldemission scanning electron microscopy (fesem). the inoculation and incubation procedures were the same as those described above. fesem samples were processed according to the previously described procedures (mizan et al., 2016). the dehydrated samples were sputter-coated with platinum and visualized with an fesem microscope (sigma, carl zeiss, germany) at an accelerated voltage of 5 kv and a working distance of 5 mm. digitized images of biofilms were collected for further analysis. 2.9. statistical analysis biofilm formation and quorum sensing of a. hydrophila at different temperatures (4–37°c) were analyzed by analysis of variance (anova) using sas software (version 9.2; sas institute inc., cary, nc, usa) for a completely randomized design to determine the significance of differences due to temperature variation. the mean separation was evaluated with duncan’s multiple-range test when the effect was significant (p < 0.05). 3. results and discussion 3.1. impact of temperature on biofilm formation temperature is one of the major factors that affect bacterial growth. most of the clinically important pathogens are mesophiles that grow well at optimum temperatures between 25°c and 40°c (murray et al., 2003). the optimum growth temperature is 20°c for some aeromonas species and 37°c for others (ewing et al., 1961). maalej et al. (2004) reported a decline in a. hydrophila population to a level below the detection level at 23°c and 5°c. the optimum temperature for a. hydrophila infection in goldfish (carassius auratus) is 17– 25°c (rahman et al., 2001). the results from the examination of the biofilm formation on microtiter plates at different temperatures are shown in table 1. a significant increase in the biofilm production was observed at 20–25°c for a. hydrophila strains 11533 and 32586. biofilm formation declined at temperatures over 25°c (i.e., 30-37°c) or below 20°c. rachid et al. (2000) reported the formation of dense biofilms with an increase in temperature. ital. j. food sci., vol. 30, 2018 461 studies have shown that a. hydrophila may attach and produce biofilm on to ss surfaces (lynch et al., 2002), glass (whiteley et al., 1997), and vegetables (jahid et al., 2014) in laboratory settings. lynch et al. (2002) reported that a. hydrophila produces a thin biofilm that may cover 40-50% of ss surface. biofilm formation by a. hydrophila strains 11533 and 32586 on ss coupons is presented in table 1. the trend observed was similar to that reported with microtiter plates. a significant increase (p < 0.05) in biofilm formation was observed at 20-25°c, indicative of the optimum temperature range for biofilm formation. similar trend was observed for both a. hydrophila strains, although they had different origins (i.e., clinical versus environmental). biofilms on fish surfaces and bacteria from marine water source may contaminate seafoodprocessing facilities. vibrio, aeromonas, listeria, and salmonella isolated from seafood are known to cause foodborne illness and form biofilms (takahashi et al., 2009; aberoum and jooyandeh, 2010; norhana et al., 2010; jahid et al., 2015; mizan et al., 2017). the ability of a. hydrophila to produce biofilms on crab surfaces at 4, 10, 15, 20, 25, 30, 35, and 37°c is shown in table 1. biofilm formation was significantly lower (p < 0.05) at 4, 10, and 15°c than at 20-37°c. a significant increase in the biofilm formation was observed for both strains at 20-30°c, while the biofilm growth gradually reduced at 37°c. no significant difference (p > 0.05) was observed in the biofilm formation between the two a. hydrophila strains. table 1. viable counts of biofilm cells of aeromonas hydrophila in luria-bertani (lb) medium with different temperature from 4°c to 37°c. support microtiter plates stainless steel surfaces crab surfaces temperatur e (°c) 11533 (bfi±sem**) 32586 (bfi±sem) 11533 (log cfu/cm2 ±sem) 32586 (log cfu/cm2 ±sem) 11533 (log cfu/cm2 ±sem) 32586 (log cfu/cm2 ±sem) 4 0.29±0.02de 0.22±0.03d 4.56±0.26c 3.62±0.28d 2.05±0.10h 1.66±0.17f 10 0.38±0.03cd 0.47±0.01bc 4.89±0.15bc 5.14±0.22bc 2.76±0.09g 2.81±0.07e 15 0.79±0.02ab 0.63±0.04ab 5.26±0.11b 5.50±0.32b 4.74±0.26f 4.45±0.15d 20 0.91±0.08a 0.72±0.03a 6.23±0.07a 6.22±0.24a 5.98±0.03ab 4.77±0.14d 25 1.06±0.04a 0.70±0.07a 6.35±0.18a 6.72±0.24a 6.08±0.11a 5.55±0.09ab 30 0.34±0.05de 0.45±0.06bc 5.46±0.25b 5.29±0.12b 5.88±0.07abc 5.67±0.17a 35 0.24±0.04e 0.36±0.02cd 5.16±0.08bc 5.34±0.08b 5.43±0.24cd 4.87±0.09c 37 0.16±0.02e 0.38±0.06cd 2.65±0.26e 3.26±0.27de 4.96±0.30de 4.73±0.23d **the values are mean ± sem (standard error mean) of 3 independent experiments. the values with same letters within a column were not significant (p < 0.05) according to duncan’s multiple-range test. 3.2. violacein production the modulation in the quorum sensing ability of a. hydrophila at different temperatures has been previously investigated (medina-martinez et al., 2006). the biosensor c. violaceum strain cv026 (a cvil transposon mutant) with quorum sensing regulation defect fails to produce violet color in the absence of ahl, which controls violacein production. however, cv026 produces color if ahl is externally supplied. the mutant cv026 produces color when grown in the presence of a. hydrophila, as violacein is produced in response to ahl secreted by a. hydrophila. the intensity of the color is proportional to ahl concentration. violacein production was significantly lower (p < 0.05) at 4-15°c than at 20-25°c. ahl produced by strain 11533 was significantly higher (p < 0.05) than that ital. j. food sci., vol. 30, 2018 462 produced by strain 32586 (fig. 1). jahid et al. (2015) stated that the production of ahl by a. hydrophila is strain-dependent. ponce-rossi et al. (2016) reported a. hydrophila atcc7966 to be negative for ahl production, while a. hydrophila embrapa 029 was shown to produce ahl. both a. hydrophila strains produced the highest ahl levels at 25°c (fig. 1). medinamartinez et al. (2006) noted that the optimum temperature for ahl production was 22°c, and no ahl production was observed at 37°c. at 12°c, however, c4-hsl production was detected after 70 h of incubation. figure 1. violacein production in a. hydrophila at different temperatures. values shown are the mean ± sem of three independent experiments. within each treatment, the values marked with the same letter are not significantly different according to duncan’s multiple-range test (p < 0.05). 3.3. ai-2 production although ai-2 production and biofilm formation may be associated with each other (mizan et al., 2016), no strong relationship was observed between ai-2 levels and biofilm formation, as the procedure for ai-2 measurement was too sensitive and variable to compare independent experiments (fig. 2). temperature modulates cell density, and quorum sensing is dependent on cell density. ai-2 production by a. hydrophila was analyzed in crab fresh water samples incubated at different temperatures. as shown in fig. 2, ai-2 production by a. hydrophila strains was origin-dependent; more strains are necessary to justify the results. the environmental strain (kctc 11533) produced lower levels of ai-2 than the clinical strain (kccm 32586). a significant (p < 0.05) increase in ai2 production was observed in both a. hydrophila strains at 20–30°c (fig. 2). further studies on the role of food composition and environment in the production of ai-2 and c4-hsl may increase our understanding of the synthesis and accumulation of these signal molecules in food products. ital. j. food sci., vol. 30, 2018 463 figure 2. ai-2 production in a. hydrophila at different temperatures. values shown are the mean ± sem of three independent experiments. within each treatment, the values marked with the same letter are not significantly different according to duncan’s multiple-range test (p < 0.05). 3.4. analysis of crab samples with fesem aberoum and jooyandeh (2010) reported that processing facilities of seafood products may act as a source of contamination and that a. hydrophila is commonly isolated from unprocessed and processed seafood products. tsai and chen (1996) observed that a. hydrophila contaminated 50% of oysters purchased from native marts of taiwan. biofilm formation may differ, owing to differences in the growth surface and temperature (noori et al., 2016). jahan and holley (2014) observed dense biofilm formation (enterococcus spp.) at temperatures lower than the optimum growth temperature. noori et al. (2016) reported that higher temperatures induced extensive biofilm formation, whereas lower temperatures resulted in the attachment of the bacterial cells (v. parahaemolyticus) as monolayers on crab surface. mizan et al. (2015) observed a. hydrophila cell attachment on crab shell. biofilm formation on crab samples incubated at 4, 25, and 37°c (according to biofilm formation strength) is presented in fig. 3. a. hydrophila failed to form biofilms on crab surfaces at 4°c; the bacterium attached on the crab surface (fig. 3a). in contrast, a. hydrophila formed a strong three-dimensional structure at 25°c, (fig. 3b). at 37°c, the bacterium formed biofilms on the crab surface (fig. 3c). poncerossi et al. (2016) evaluated biofilm formation in two strains of a. hydrophila at the same temperature but different incubation times. these authors found that the biofilm formation was maximum at 48 h and decreased at 72 h. almeida et al. (2017) studied salmonella and observed that maximum biofilm formation may occur after 36 h incubation in contrast to other times evaluated. ital. j. food sci., vol. 30, 2018 464 figure 3. fesem images of a. hydrophila biofilm formation on crab surfaces at different temperatures. the image shown is a representative result for strain kctc 11533. (a) 4°c, (b) 25°c and (c) 37°c. 4. conclusions the two a. hydrophila strains, one originally isolated from surface water (strain kctc 11532) and the other from clinical sample (strain kccm 32586), showed significant variations in the tested phenotypes (i.e., biofilm formation and quorum sensing), indicating strain-specific regulation. strain kctc 11533 was found to produce high concentrations of ahl and lower concentrations of ai-2. strain kccm 32586, on the other hand, showed high ai-2 production and lower ahl activity. therefore, the phenotypic properties differed between the two strains. such studies will elucidate the effect of quorum sensing on the regulation of virulence factors produced by opportunistic pathogens such as a. hydrophila on microtiter plates, ss, and crab surfaces. however, the experimental scope of the study is limited to only one strain of environmental and clinical origin. further studies are warranted to extend the application of this study in food quality and safety regulations. acknowledgements this research was supported by mid-career research program of the national research foundation of korea (nrf) funded by the ministry of education, science, and technology (2016r1a2b4007960). references aberoum a. and jooyandeh h., 2010. a review on occurrence and characterization of the aeromonas species from marine fishes. world j. fish mar. sci. 2:2078e4589. almeida f.a., pimentel‑filho n.j., pinto u.m., mantovani h.c., oliveira l.l. and vanetti m.c. 2017. acyl homoserine lactone‑based quorum sensing stimulates biofilm formation by salmonella enteritidis in anaerobic conditions. arch. microbiol. 199(3):475-486. bassler b.l., wright m., showalter r.e. and silverman m.r. 1993. intercellular signaling in vibrio harveyi: sequence and function of genes regulating expression of luminescence. mol. microbiol. 9(4):773-786. ital. j. food sci., vol. 30, 2018 465 chronicle c. 1997. salmonellosis (public health concerns for the farm family and staff). (accessed, 17.12.12). http://news.cornell.edu/stories/1997/12/salmonella-fact-sheet chopra a.k., graf j., horneman a.j., johnson j.a. 2009. virulence factor-activity relationships (vfar) with specific emphasis on aeromonas species (spp.). j. water health. 7:29-54. daskalov h. 2006. the importance of aeromonas hydrophila in food safety. food control. 17(6): 474-483. deng y.t., wu y.l., tan a.p., huang y.p., jiang l., xue h.j., luo w.l. and zhao f. 2014. analysis of antimicrobial resistance genes in aeromonas spp. isolated from cultured freshwater animals in china. microb. drug resist. 20(4):350356. di bonaventura g., piccolomini r., paludi d., d'orio v., vergara a., conter m. and ianieri a. 2008. influence of temperature on biofilm formation by listeria monocytogenes on various food‐contact surfaces: relationship with motility and cell surface hydrophobicity.j. appl. microbiol. 104:1552-1561. ewing w.h., hugh r. and johnson. j.g. 1961. studies on the aeromonas group. ncdc monogr., national communicable disease center, atlanta. fuqua c., winans s.c. and greenberg e.p. (1994). quorum sensing in bacteria: the luxr/luxi family of cell densityresponsive transcriptional regulators. j. bacteriol. 176(2):269-275. gavriel a.a., landre j.p. and lamb j.p. 1998. incidence of mesophilic aeromonas within a public drinking water supply in north-east scotland. j. appl. microbiol. 84:383-392. giaouris e., chorianopoulos n. and nychas g.-j.e. 2005. effect of temperature, ph, and water activity on biofilm formation by salmonella enterica enteritidis pt4 on stainless steel surfaces as indicated by the bead vortexing method and conductance measurements.j. food prot. 68(10):2149-2154. jahan m. and holley r.a. 2014. incidence of virulence factors in enterococci from raw and fermented meat and biofilm forming capacity at 25°c and 37°c. int. j. food microbiol. 170:65-69. jahid i.k. and ha s.d. 2014. inactivation kinetics of various chemical disinfectants on aeromonas hydrophila planktonic cells and biofilms. foodborne pathog. dis. 11(5):346-353. jahid i.k., han n., srey s. and ha s.d. 2014. competitive interactions inside mixed species biofilms of salmonella typhimurium and cultivable indigenous microorganisms on lettuce enhance microbial resistance of their sessile cells to ultraviolet c (uv-c) irradiation. food res. int. 55:445-454. jahid i.k., mizan m.f.r, ha a.j. and ha s.d. 2015. effect of salinity and incubation time of planktonic cells on biofilm formation, motility, exoprotease production, and quorum sensing of aeromonas hydrophila. food microbiol. 49:142-151. janda j.m. and abbott s.l. 2010. the genus aeromonas: taxonomy, pathogenicity, and infection. clin. microbiol. rev. 23(1):35-73. khajanchi b.k., sha j., kozlova e.v., erova t.e., suarez g., sierra j.c., popov v.l., horneman a.j. and chopra a.k. 2009. n-acylhomoserine lactones involved in quorum sensing control the type vi secretion system, biofilm formation, protease production, and in vivo virulence in a clinical isolate of aeromonas hydrophila. microbiol. 155:3518-3531. kim, s.r., oh, h.s., jo, s.j., yeon, k.m., lee, c.h., lim, d.j., lee, c.h., lee, j.k. 2013. biofouling control with beadentrapped quorum quenching bacteria in membrane bioreactors: physical and biological effects. environ. sci. technol. 47:836−842. kozlova e.v., popov v.l., sha j., foltz s.m., erova t.e., agar s.l., horneman a.j., chopra a.k. 2008. mutation in the sribosylhomocysteinase (luxs) gene involved in quorum sensing affects biofilm formation and virulence in a clinical isolate of aeromonas hydrophila. microb. pathog. 45(5-6):343–354. maalej s., denis m., dukan, s. 2004. temperature and growth-phase effects on aeromonas hydrophila survival in natural seawater microcosms: role of protein synthesis and nucleic acid content on viable but temporarily nonculturable response. microbiol. 150:181-187. martinez-medina m., naves p., blanco j., aldeguer x., blanco j., blanco m., ponte c., soriano f., darfeuille-michaud a. and garcia-gil l.j. 2009. biofilm formation as a novel phenotypic feature of adherent-invasive escherichia coli (aiec). bmc microbiol. 9: 202. medina-martínez m.s., uyttendaele m., demolder v. and debevere j. 2006. effect of temperature and glucose concentration on the n-butanoyl-l-homoserine lactone production by aeromonas hydrophila. food microbiol. 23(6):534540. ital. j. food sci., vol. 30, 2018 466 melo l.f. and bott t.r. 1997. biofouling in water systems. exp. therm. fluid sci. 14:375–381. mizan m.f.r, jahid i.k. and ha s.d. 2015. microbial biofilms in seafood: a food-hygiene challenge. food microbiol. 49:41-55. mizan m.f.r., jahid i.k., kim m.h., lee, k.h., kim t.j. and ha s.d. 2016. variability of biofilm formation correlates with hydrophobicity and quorum sensing among vibrio parahaemolyticus isolates from food contact surfaces and distribution of genes involved in biofilm formation. biofouling. 32(4):497-509. mizan m.f.r., ashrafodoulla m., sadekuzzaman m., kang i. and ha s.d. 2017. effects of nacl, glucose, and their combinations on biofilm formation on black tiger shrimp (penaeus monodon) surfaces by vibrio parahaemolyticus. food control 89:203-209. murray p.r., baron, e.j., jorgensen, j.h., pfaller, m.a. and yolken r.h. (ed.). 2003. manual of clinical microbiology, 8th ed. asm press, washington, dc. noori h., mizan m.f.r., jahid i.k. and ha s.d. 2016. biofilm formation by vibrio parahaemolyticus on food and food contact surfaces increases with rise in temperature. food control. 70:161-166. norhana m.n.w., poole s.e., deeth h.c. and dykes g.a. 2010. the effects of temperature, chlorine and acids on the survival of listeria and salmonella strains associated with uncooked shrimp carapace and cooked shrimp flesh. food microbiol. 27:250-256. o’toole g.a. 2011. microtiter dish biofilm formation assay. j.vis. exp. 30, pii: 2437. ottaviani d., parlani c., citterio b., masini l., leoni f., canonico c., sabatini l., bruscolini f. and pianetti a. 2011. putative virulence properties of aeromonas strains isolated from food, environmental and clinical sources in italy: a comparative study. international journal of food microbiol. 144(3):538-545. ponce-rossi, a.d.r., pinto, u.m., ribon, a.d.o.b., bazzolli, d.m.s., and vanetti and m.c.d. 2016. quorum sensing regulated phenotypes in aeromonas hydrophila atcc7966 deficient in ahl production. ann. microbiol. 66:1117-1126. rachid s., ohlsen k., witte w., hacker j. and ziebuhr w. 2000. effect of subinhibitory antibiotic concentrations on polysaccharide intercellular adhesin expression in biofilm-forming staphylococcus epidermidis. antimicrob. agents chemother. 44(12):3357-3363. rahman m.h., suzuki s. and kawai k. 2001. the effect of temperature on aeromonas hydrophila infection in goldfish, carassius auratus. j. appl. ichthyol. 17:282-285. rao t.s. 2010. comparative effect of temperature on biofilm formation in natural and modified marine environment. aquat. ecol. 44(2):463-478. shen c., luo y., nou x., bauchan g., zhou b., wang q., and millner p. 2012. enhanced inactivation of salmonella and pseudomonas biofilms on stainless steel by use of t-128, a fresh-produce washing aid, in chlorinated wash solutions. appl. environ. microbiol. 78(19):6789-6798. skandamis p.n. and nychas g.j. 2012. quorum sensing in the context of food microbiology. appl. environ. microbiol. 78:5473–5482. soni k.a., jesudhasan p.r., cepeda m., williams b., hume m., russell w.k., jayaraman a. and pillai s.d. 2008. autoinducer ai-2 is involved in regulating a variety of cellular processes in salmonella typhimurium. foodborne pathog. dis. 5:147-153. swift s., karlyshev a.v., fish l., durant e.l., winson m.k., chhabra s.r., williams p., macintyre s. and stewart g.s. 1997. quorum sensing in aeromonas hydrophila and aeromonas salmonicida: identification of the luxri homologs ahyri and asari and their cognate nacylhomoserine lactone signal molecules. j. bacteriol. 179(17):5271-5281. takahashi h., miya s., igarashi k., suda t., kuramoto s. and kimura, b. 2009. biofilm formation ability of listeria monocytogenes isolates from raw ready-to-eat seafood. j. food prot. 72:1476-1480. teh k.h., flint s. and french n. 2010. biofilm formation by campylobacter jejuni in controlled mixed-microbial populations. int. j. food microbiol. 143(3):118-124. paper received october 27, 2017 accepted april 4, 2018 ijfs#1231_bozza ital. j. food sci., vol. 30, 2018 828 survey determination of microbial contamination, ph and temperature changes in sheep and cattle carcasses during the slaughter and pre-cooling processes in konya, turkey ü. gürbüz1,2, a.e. telli*1, h.a. kahraman3, d. balpetekkülcü4 and s. yalçın1 1selçuk university, faculty of veterinary medicine, department of food hygiene and technology, konya, turkey 2kyrgyz -turkish manas university, faculty ofveterinary medicine, department of food hygiene and technology, bishkek, kyrgyzstan 3mehmet akif ersoyuniversity, faculty of veterinary medicine, food hygiene and technology department, burdur, turkey 4giresun university, engineering faculty, foodengineering department, giresun, turkey *corresponding author: tel.: +90 5334698994; fax: 03322410063 e-mail address: ezgiyilmaz@selcuk.edu.tr abstract this study was conducted to determine microbial contamination, ph and internal temperature changes in sheep and cattle carcasses during slaughter and chilling stages. samples were analysed for the presence of salmonella spp. and enterobacteriaceae and aerobic colony counts (acc) were performed. air sampling was also performed in slaughtering areas and chilling rooms. mean values of accs were between 2.57±0.61 and 4.71±0.24 log cfu/cm2 and between 3.51±0.48 and 5.19±0.28 log cfu/cm2, whereas enterobacteriaceae counts were between 0.89±0.46 and 2.61±0.10 log cfu/cm2 and between 0.55±0.37 and 3.63±0.39 log cfu/cm2 in cattle and sheep carcasses, respectively. enterobacteriaceae contamination in the shoulder region of cattle carcasses after washing, enterobacteriaceae contamination in all regions in sheep carcasses after chilling and acc in the shoulder region of sheep carcasses after chilling all exceeded the limits of ec regulation (ec no 2073/2005). keywords: air sampling, enterobacteriaceae, salmonella spp., slaughtering stages, acc ital. j. food sci., vol. 30, 2018 829 1. introduction it is desirable to keep the initial microorganism load in meat as low as possible and to observe hygiene rules during slaughtering. therefore, it is very crucial that slaughtered animals are cut according to hygiene rules in slaughterhouses. carcasses naturally have a low level of microbial flora and can be regarded to be sterile immediately after slaughtering. microbial contamination can occur in slaughtered animals in most of the stages throughout the slaughtering process. the slaughtering steps are basically followed by bleeding, dressing, evisceration, washing and finally storage. the hygienic bleeding and dressing system described by fao is to allow the animal to move up from the back leg to an upright position to allow the bleeding to continue until the blood flow reaches negligible level. besides, inadequate hygiene conditions along the dressing cause the bacteria to spread from the carcass to the knives and to the hands of the operators. contamination of carcasses may also occur through direct contact with equipment or hands of the personnel or may also occur indirectly through microorganisms in the air of the slaughterhouse following slaughter (unterman et al., 1997, gill and baker, 1998, burfoot et al., 2006). the european union legislation has declared that the enterobacteriaceae content and aerobic colony count (acc) should be used as hygiene criteria throughout the slaughtering process and that measures should be taken if the values increase above the criteria for slaughtered animals during the slaughtering process (barco et al., 2015). the legislation required monitoring of the above bacterial groups as process hygiene criteria for cattle, sheep and other slaughtered animals and were declared to be hazard analysis and critical control point (haccp) indicators for an acceptable food processing system (ec no 2073/2005; barco et al., 2015). according to the legislation, the acc and enterobacteriaceae limits for carcasses of cattle and sheep were declared as minimum (m) and maximum (m) values were 3.5 log cfu/cm2 5.0 log cfu/cm2 and 1.5 log cfu/cm2 2.5 log cfu/cm2, respectively. the european food safety authority (efsa) panel on biological hazards (biohaz) has also introduced the current requirement that the interior temperature of the carcass should not higher than 7 °c immediately after the post-mortem examination, before transporting. a panel of researchers has stated that temperature-time profiles can be applied to obtain similar or reduced levels of carcass contamination and that contamination levels at this temperature range are typically related to the initial level of contamination. in most studies on carcass surface microbiology, non-invasive methods are used, such as the swab method (mcevoya, 2004). the swab method is the preferred method for carcass sampling according to haccp requirements for european union slaughterhouses (pepperell et al., 2005). there are a number of published studies in which swab sampling methods have been utilised (anderson et al., 2005; blagojevic, 2012; barco et al., 2015; petruzzelli et al., 2016; alonso-calleja et al., 2017). carcass samples used in this study were slaughtered using procedures based on ‘good hygiene practices’ and ‘haccp’ principles, related to european union regulation 852/2004. the main purpose of the present study was to determine whether the turkish food codex hygiene criteria and commission regulation (ec) no 2073/2005, are met in cattle and sheep slaughterhouses in the konya province, which is the biggest producer of red meat in turkey. in addition, we aimed to detect the airborne contamination in slaughtering area and cold storage rooms, to identify the sources of contamination during slaughtering and to detect the incidence (presence or absence) of salmonella spp. contamination in sheep and cattle carcasses. ital. j. food sci., vol. 30, 2018 830 2. materials and methods 2.1. sample collection in this study, changes in microbial flora, ph and temperature in cattle and sheep carcasses during different slaughter stages were investigated in three different large-scale slaughterhouses (with a daily cutting capacity of at least 40 cattle, according to the classification of turkish slaughterhouses) between december 2013 and april 2016 in konya, turkey. swab samples moistened with sterile buffered peptone water (bpw) were collected using the swab technique consisting of 5 vertical and horizontal passes described by usda with slight modification. we swabbed an area of 10 × 10 cm2 from five randomly chosen regions of the carcasses, including two shoulders, two rumps and briskets, after three different cutting stages (dressing, evisceration and washing) and after storage of the same carcass in chilling rooms for 24 h. a total of 480 samples from sheep (n = 240) and cattle (n = 240) were collected from the carcasses. samples were cold chain transported to the laboratory, and microbiological analyses were performed within 3 h of sampling. samples were cold chain transported to the laboratory 2.2. microbiological analysis acc were performed as follows: 1 ml from a 1:10 diluted swab sample was poured onto plate count agar (pca, merck 105463) plates. incubation was performed under aerobic conditions at 37°c for 24 h. the total number of enterobacteriaceae was determined according to the international organization for standardization (iso) 21528–2:2004. the procedure was as follows: 1 ml of serial dilutions in buffered peptone water (bpw, merck, germany), were poured onto violet red bile glucose agar (vrbg, merck, germany) and incubated at 37°c for 24 h. typical colonies grown on plates were quantified after incubation. isolation and identification of salmonella spp. was performed using the method recommended by iso 6579:2002 + a1:2007 with slight modifications. accordingly, swab samples in bpw were incubated overnight at 37°c for pre-enrichment. for selective enrichment, 0.1 ml of the pre-enriched culture was added to 10 ml of modified rappaportvassiliadis broth (mrvb, merck, germany) and incubated at 41.5°c for 24-48 h. subsequently, 0.1 ml from the enriched culture was streaked onto xylose lactose tergitol 4 (xlt4, merck, germany) agar supplemented with xlt4 selective supplement (merck, germany). these plates were incubated at 37°c for 24 h. dna isolation was performed from five selected black or black-centred colonies on each plate which were considered to be ‘presumptive salmonella colonies’ grown on xlt4 agar. 2.3. conventional m-pcr for detecting salmonella spp. dna isolation from suspicious salmonella colonies was performed using the boiling method. following optimisation of pcr conditions, conventional multiplex-pcr (m-pcr) was performed. gene primers used for salmonella spp. are shown on table 1. the m-pcr master mix comprised 1 u taq polymerase and taq buffer (5 mm kcl and 0 mm tris-hcl), 1.5 mm mgcl2, 0.025 mm of each primer, 0.9 µm inv-a primers and 0.4 µm ie1 and flic-c primers in a 20-µl reaction volume. the m-pcr protocol comprised an initial denaturation step for 5 min at 95°c followed by 30 cycles of 1 min at 95°c, 1 min at 58°c and 30 s at 72°c, with a final extension step of 7 min at 72°c (paiao et al., 2013). ital. j. food sci., vol. 30, 2018 831 table 1. the primer pairs used in this study. primers product length reference salmonella spp. (inv-a) f:gtgaaattatcgccacgttcgggcaa r:tcatcgcaccgtcaaaggaacc 284 bp rahn et al., 1992 s. enteritidis (ie-1) f:agtgccatactt ttaatgac r:actatgtcgatacggtggg 316 bp wang and yeh, 2002 s. typhimurium (flic-c) f:cccgcttacaggtggactac r:agcgggttttcggtggttgt 432 bp paiao et al., 2013 2.4. air sampling air sampling was employed to determine the number of acc and fungal counts in slaughter operation and cold storage rooms during processing. pca (merck, germmany) was used for acc and potato dextrose agar (merck, germany) supplemented with 10% tartaric acid solution was used for fungal counts in the air sampler (air ideal 3p, biomerieux, france). the air sampler device was placed 1-1,5 m above the floor along the slaughter line and chilling rooms. in the sampling areas, 190 l of air was vacuumed by placing the petri dishes on the vacuum surface of the device. the plates were incubated before determining microbial counts. the samples were taken six independent times on different sampling days. 2.5. determination of ph and temperature ph and temperature values of the carcass were measured during different sampling stages using a portable ph and temperature probe (testo 205, germany). changes in ph and temperature of sheep and cattle carcasses were also determined during the following slaughtering steps: dressing, evisceration, washing and chilling. 2.6. statistical analysis data obtained from the study was analysed using spss software package 21.00. data was subjected to variance analysis (one-way anova) and two sample t-tests in accordance with the experimental design. significant differences (p < 0.05) were identified using multicomparisons of the means, with duncan’s test, within the variance analysis. means and standard errors of the means were reported. 3. results and discussion in our study, acc in cattle carcasses were observed between 2.57±0.61 and 4.71±0.24 log cfu/cm2 and enterobacteriaceae counts were observed between 0.89±0.46 and 2.61±0.10 log cfu/cm2. further, contamination with enterobacteriaceae in the shoulder region after washing was found to exceed the limits of ec regulation for cattle carcasses. our highest acc in cattle carcass were observed in shoulders and rumps after dressing and in briskets after washing (fig. 1). contamination levels were not found to be statistically different (p > 0.05) for acc in shoulders, rumps and brisket regions at different stages of cattle slaughtering. ital. j. food sci., vol. 30, 2018 832 figure 1. acc at different slaughtering stages of cattle and sheep carcasses (log10cfu/cm2) data are presented as mean±standart error. data with different superscript (x,y; a,b; α,β) indicate significant difference (p<0.05). although there were no statistically significant differences in the total number of enterobacteriaceae in cattle carcasses (p > 0.05) in shoulders, rumps and brisket regions at all stages of slaughtering (p > 0.05; fig. 2), we observed that enterobacteriaceae contamination was the highest after the washing stage. this can be explained by partial contamination originating from faeces or internal organs that are spread to other regions during washing. in sheep carcass samples, the highest level of enterobacteriaceae contamination was observed at the chilling stage, and this was statistically significant (p < 0.05; fig 2). in sheep carcasses, mean values of acc were between 3.51±0.48 and 5.19±0.28 log cfu/cm2, whereas enterobacteriaceae counts were between 0.55±0.37 and 3.63±0.39 log cfu/cm2. further, acc in the shoulder region and enterobacteriaceae contamination in all regions after the chilling stage exceeded the limits of ec regulation. the highest acc were found in all sampled parts after the chilling stage (fig 1) and this was statistically significant (p < 0.05). in a similar study, zweifel et al. (2014) obtained similar results in cattle carcasses and they determined that chilling was the most important stage for preventing contamination. cattle and sheep carcasses were compared in terms of slaughtering steps and contamination levels in different sampling regions. statistical graphs and a comparison table of acc and enterobacteriaceae count from both sheep and cattle carcasses at different slaughtering stages are given below (p < 0.05, table 2). acc were higher in the shoulder region of cattle carcasses than in that of sheep carcasses (p < 0.05, table 2). similar differences were observed in acc in rump area after washing and that in brisket after the dressing process in the two carcasses (p < 0.05). further, acc in the rump area of sheep carcasses had higher contamination than that in the rump area of cattle carcasses during the dressing stage. after evisceration, contamination in the brisket of sheep carcasses was higher than that in the brisket of cattle carcasses (p < 0.05, fig. 3.). ital. j. food sci., vol. 30, 2018 833 figure 2. enterobacteriaceae counts at different slaughtering stages of cattle and sheep carcasses (log10cfu/cm2). data are presented as mean±standart error. data with different superscript (x,y; a,b; α,β ) above each bar indicate significant difference (p<0.05). table 2. comparison the acc and enterobacteriaceae contamination levels of cattle and sheep carcasses. shoulder rump brisket processing steps x± sx x± sx x± sx p acc (log cfu/cm2) after dressing cattle 4,71±0,24a 2,99±0,69b 4,01±0,21ab * sheep 4,55±0,17 4,70±0,28 3,51±0,48 after evisceration cattle 4,46±0,23 4,08±0,47 2,93±0,68b sheep 4,66±0,18 4,45±0,26 4,48±0,21 after washing cattle 4,46±0,26a 4,22±0,20a 2,57±0,61b ** sheep 4,22±0,21 4,19±0,19 3,79±0,48 after chilling cattle 4,44±0,24 3,54±0,26 2,92±0,68 sheep 5,19±0,28 5,44±0,24 4,60±0,59 enterobacteriaceae (log cfu/cm2) after dressing cattle 2,14±0,16a 2,06±0,22a 1,14±0,40b * sheep 0,83±0,42b 2,30±0,45a 0,55±0,37b * after evisceration cattle 2,45±0,33 2,13±0,50 1,77±0,52 sheep 1,09±0,47 1,31±0,54 1,82±0,51 after washing cattle 2,61±0,10a 2,28±0,30a 1,77±0,48b * sheep 1,12±0,38 1,16±0,39 1,55±0,44 after chilling cattle 1,69±0,50 1,41±0,50 0,89±0,46 sheep 3,63±0,39 3,52±0,49 3,15±0,59 x,y: values within a row with different letters are significantly different (p<0.05), x: mean, sx: standard error of mean *: p<0.05;**: p<0.01. ital. j. food sci., vol. 30, 2018 834 figure 3. comparison the acc levels of cattle and sheep carcasses. data are presented as mean±standart error. data with different superscript (x,y; a,b; α,β) above each bar indicate significant difference (p<0.05). the shoulder region of cattle carcasses after dressing and in the shoulder and rump regions after washing had higher enterobacteriaceae contamination values than those of sheep carcasses (p < 0.05, fig 4.), this implied that the washing process in cattle was inadequate. figure 4. comparison enterobacteriaceae spp. contamination levels of cattle and sheep carcasses.data are presented as mean±standart error. data with different superscript (x,y; a,b; α,β) above each bar indicate significant difference (p<0.05). other previous studies (barboza de martinez et al., 2002; mies et al., 2004) have supported these findings and stated that the washing process during slaughtering may be ineffective in decreasing the rate of bacterial contamination. therefore, many investigators suggest that washing should be done with effective disinfectants and that more strict preventive measures should be taken. a similar study (barboza de martinez et al., 2002) investigated the effect of nisin and lactic acid against bacterial loads, including acc, total coliforms and e. coli in cattle carcasses. researchers stated that washing alone did not reduce the bacterial load and that spraying with a mixture of lactic acid and nisin provided the highest reduction in all bacterial groups tested. in another study (mies et al., 2004), researchers assessed the effect of washing cattle carcasses with or without ital. j. food sci., vol. 30, 2018 835 disinfectant solutions prior to slaughtering on aerobic plate, coliform, e. coli and salmonella counts. the greatest reductions were observed in mean logs of bacterial counts in groups sprayed with 4%-6% ethanol and lactic acid. our microbial counts are comparable with those obtained in other surveys at the national and international level using similar techniques (swabbing or sponging) (gill and baker, 1998; duffy et al., 2001; yalçın et al., 2004; pearce et al., 2005; salmela et al., 2013; petruzelli et al., 2016). gill and baker (1998) examined aerobic counts and coliform and e. coli contamination rates on randomly selected sheep carcass surfaces using the swab method in canada. the highest e. coli load was detected on shoulder and rump regions after the dressing stage and that the acc load was the highest after the evisceration stage. duffy et al. in 2001 investigated lamb carcasses in the united states using sponge sampling to detect the presence of salmonella spp and e. coli and determine acc and total coliform loads after the chilling process. salmonella spp. was detected in 1.5% samples, whereas acc, total coliform and e. coli counts were observed at 4.42, 1.18 and 0.70 log cfu/ cm2, respectively. a similar study in turkey by yalçın et al. (2004) stated that acc in sheep carcasses were 2.96, 3.10, 2.81 and 1.69 log cfu/ cm2 after dressing, evisceration, washing and chilling steps, respectively. moreover, in ireland pearce et al. (2005) reported that acc in sheep carcasses, as tested by the excision method, in the thorax, shoulder-neck, chest-brisket, and flank areas were 3.4, 3.6, 3.5 and 2.4 log cfu/cm2, respectively, whereas measurements using the polyurethane sponge method indicated 2.9, 2.8, 3.3 and 2.5 log cfu/cm2 and that using the cellulose acetate sponge method indicated 2.7, 2.5, 2.7 and 2.3 log cfu/cm2 in the same stages, respectively. salmela et al. (2013) also assayed acc of carcasses sampled by excision and swab methods in finland; results were 3.77 and 3.16 log cfu/cm2, respectively. researchers reported that acc and enterobacteriaceae and e. coli counts were higher in the excision method than the swab method. the authors reported that enterobacteriaceae was detected using the excision and swab methods in 72% and 76% carcasses, respectively, whereas e. coli was detected in 48% and 61% carcasses, respectively. similar to our findings, petruzzelli et al. (2016) investigated acc and enterobacteriaceae contaminations in ovine, bovine and swine carcasses in italy using the sponge method following ec regulations. they found that contamination levels in bovine, ovine and swine carcasses, when measuring acc were 1.96, 2.27 and 2.27 log cfu/cm2, respectively, whereas enterobacteriaceae counts were 0.01, 0.27 and 0.20, respectively. they also stated that cattle carcasses had significantly lower levels of acc and enterobacteriaceae counts than swine and ovine carcasses. alonso-calleja et al. (2017) also studied lamb carcasses in two slaughterhouses in spain. they stated that total viable counts (tvc, 2.74 log cfu/cm2) were higher than enterobacteriaceae (2.21 log cfu/cm2) counts and that there was a high correlation between them. they also stated that 0% and 30.8% of the samples in abattoir a and 10% and 40% of the samples in abattoir b exceeded ec regulations for tvc and enterobacteriaceae counts, respectively. an overall evaluation demonstrated that as the samples progressed through the steps of the slaughtering process, an increase in the total number of microorganisms in the shoulders, rump and brisket regions was observed after dressing in both cattle and sheep carcasses. in this context, gill et al. (2003) argued that despite the use of decontamination methods, such as pasteurisation, hot-water washing or lactic acid spraying, after the evisceration step, the increase in bacterial counts after chilling of carcasses was related to the proliferation of initial microorganisms rather than subsequent contaminations. however, it has been determined that accs, as one of the determinative criteria of slaughtering hygiene, are also in conformity with the turkish food codex regulations on microbiological criteria of meat and meat products and commission, except in the shoulder region of sheep carcasses after the chilling stage. in addition, enterobacteriaceae ital. j. food sci., vol. 30, 2018 836 limits were exceeded in shoulder, brisket and rump regions of sheep carcasses after the chilling process and in the shoulder region of cattle carcasses after washing. thus, it is very important to take necessary precautions to prevent contamination, particularly during the process of washing and evisceration during slaughtering. likewise, it is thought that the chilling process should be performed at maximum performance and speed and that carcass decontamination methods should be applied, if necessary, to minimise the growth of pathogenic and spoilage microorganisms. the present study aimed to determine the presence of salmonella spp. in sheep and cattle slaughtering process. however, no salmonella spp. were detected in the 480 samples analysed, which is highly satisfactory in terms of slaughtering hygiene and public health. salmela et al. (2013) did not detect any salmonella spp. by swab and excision methods in carcasses in any of the samples, similar to that observed our present study. nevertheless, madden et al. (2001) found that three of the 200 samples from cattle carcasses were contaminated with salmonella spp. chavez et al. (2015) used the sponge sampling technique to collect samples (n = 142) after the washing step and before the chilling step and determined that 18% cattle carcasses were contaminated with salmonella spp. at the three inspected abattoirs. similarly, hald et al. (2003), collected pig carcass samples from 12 slaughterhouses in five countries of europe. the researchers stated no salmonella was found in one country while 5.3 % of 3485 samples found to be positive in the other four countries. in a recent study in ethiopia, muluneh and kibret (2015) found 7.6 % of the beef carcasses collected from an abattoir positive for salmonella spp. we observed that as the sheep and cattle slaughtering process progressed, the temperature progressively decreased in all carcass regions and that this was statistically significant (p < 0.05; table 3). the temperature observed after storage did not reach the desired low temperature (4°c-6°c), indicating that cooling is insufficient. this demonstrates the necessity for systematically controlling the size of carcasses, internal temperature, air flow and humidity of the chilling rooms. it was observed that inner temperatures of sheep carcasses after chilling storage were lower than cattle. nevertheless, it has been observed that this decrease in temperature does not provide any advantage in reducing the microbial load. as a matter of fact, according to the efsa panel on biohaz (2014a,b), it has been declared that it is important to go to the transport stage while the chilling process is performed on the carcasses so that the number of spoilage bacteria cannot reach an unsatisfactory level. table 3. ph and temperature (°c) values of the shoulder and rump regions at different slaughtering stages. sheep cattle shoulder rump shoulder rump processing steps x±sx x±sx x±sx x±sx ph after dressing 6.40±0.09a 6.35±0.05a 6,40a±0,09 6,35a±0,05 after evisceration 6.48±0.12a 6.14±0.05ab 6,48a±0,12 6,14ab±0,05 after washing 6.33±0.23a 6.15±0.01ab 6,33a±0,23 6,15ab±0,01 after chilling 5.61±0.28b 5.28±0.04c 5,61b±0,28 5,28c±0,04 p* *** *** *** *** °c after dressing 38.66±0.22a 38.48±0.38a 32,77ab±1,54 34,47b±1,93 after evisceration 38.12±0.26a 37.46±0.47a 33,85a±2,82 37,50a±0,35 after washing 36.27±0.68b 37.22±0.92a 28,23b±3,95 37,05ab±0,85 after chilling 7.72±0.77c 8.13±0.85b 11,43c±1,18 13,36c±1,24 p* *** *** *** *** ital. j. food sci., vol. 30, 2018 837 air sampling results for acc and fungal counts were found to be lower in the chilling rooms than in the slaughtering area (table 4; p < 0.05). these values indicated that the hygiene in chilling rooms is satisfactory. this can explain why microbial counts were reduced in the chilling rooms compared with those in the slaughtering area and increasing general hygienic conditions is critical for reduction of carcass microbial growth. in a similar study, prendergast et al. (2004) also investigated the relation between airborne bacterial counts and carcass contamination in two abattoirs in ireland. the acc were found to be between 1.79-3.49 log10cfu/m3 at different stages of slaughtering. they also stated the clean areas of slaughtering process had a lower microbial load than the dirty areas. researchers found the correlations between carcass contamination and aerial load was low. similarly, burfoot et al. (2006) noted that airborne contamination of cattle and sheep carcasses during the evisceration phase is less of a concern than other contamination sources. table 4. ac, yeast and molds counts in the slaughtering room and cold storage room (log10 cfu/m3). areas acc (x±sx) yeast and molds (x±sx) slaughtering room 2.54±0.01a 1.23±0.12 cold storage room 1.98±0.03b 1.04±0.01 p *** a, b, c: the differences between different letter values in the same column are significant (p <0.05). n: number of samples. x: mean value. sx: standard error of mean, *: p<0,05;**: p<0,01;***: p<0,001. 4. conclusion in the present study, enterobacteriaceae limits were exceeded in shoulder, brisket and rump regions of sheep carcasses after the chilling process and in the shoulder region of cattle carcasses after washing. further, acc in the shoulder region and enterobacteriaceae contamination in all regions after the chilling stage exceeded the limits of ec regulation. the highest acc were found in all sampled parts after the chilling stage. this is thought to be due to the provision of a suitable environment as a result of poorly cooled chilled rooms to gradually increase microbial load, which is relatively low in cutting stages. furthermore, it is satisfactory that salmonella spp. is not detected in the present study, but it should be considered that this result may be due to possible insufficiency of the swabbing method compared with the excision. in conclusion, the microbial quality of meat for consumption is closely related to public health. thus, it is critical to understand specific microbial risks of each work step, from slaughtering to chilling of carcasses. microbiological analyzes which are carried out only at the end of the process, may not provide realistic information on the main causes of the microbial contamination. therefore, the microbiological criteria which are ‘process-based’ related to measurements including different methods at various stages of the process should be preferred and more detailed risk assessments should be undertaken to assess and develop preventive measures that can reduce sources of contamination during the most critical stages of slaughtering. ital. j. food sci., vol. 30, 2018 838 references alonso-calleja c, guerrero-ramos e. and capita r. 2017. hygienic status assessment of two lamb slaughterhouses in spain. journal of food protection 9;80(7):1152-8. doi: doi.org/10.4315/0362-028x.jfp-16-330 anderson r., carr m., miller r., king d., carstens g., genovese k., callaway t., edrington t., jung y., mcreynolds j. and nisbet d.j. 2005. effects of experimental chlorate preparations as feed and water supplements on escherichia coli colonization and contamination of beef cattle and carcasses. food microbiol 22:439-447. doi: doi.org/10.1016/ j.fm.2004.09.002. ec commission regulation no 2073/2005 of 15 november 2005 on microbiological criteria for food stuffs. official journal of the european union, l338, 1e26. as amended by commission regulation (ec) no 1441/2007 of 5 december 2007 of 5 december 2007 amending regulation (ec) no 2073/2005 on microbiological criteria for food stuffs. barboza de martinez y., ferrer k. and salas e.m. 2002. combined effects of lactic acid and nisin solution in reducing levels of microbiological contamination in red meat carcasses. j. food prot. 65,:780-1783. barco l., belluco s., roccato a. and ricci a. 2015. a systematic review of studies on escherichia coli and enterobacteriaceae on beef carcasses at the slaughterhouse. int j food microbiol. 207:30-39. doi: doi.org/10.1016/j.ijfoodmicro.2015.04.027 blagojevic b., antic d., ducic m. and buncic s. 2012. visual cleanliness scores of cattle at slaughter and microbial loads on the hides and the carcases. vet. rec. 170:563-570. doi: doi.org/10.1136/vr.100477. burfoot d., whyte r., tinker d., howell m., hall k., holah j., smith d., white r., baker d. and mcintosh j. 2006. importance of airborne contamination during dressing of beef and lamb carcasses. j. food protect. 69:2828-2836. chavez l.m., diaz e.c., montano j.a.p., garay-martínez l.e., varela-hernandez j.j., castillo a., lucia l., avila-novoa m.g., cardona-lopez m.a., gutierrez-gonzalez p. and martinez-gonzales n.e. 2015. quantitative distribution of salmonella spp. and escherichia coli on beef carcasses and raw beef at retail establishments. int j food microbiol. 210(1):149-155. doi: doi.org/10.1016/j.ijfoodmicro.2015.06.016. duffy e.a., belk k.e., sofos j.n., levalley s.b., kain m.l., tatum j.d., smith g.c. and kimberling c.v. 2001. microbial contamination occurring on lamb carcasses processed in de united states. journal of food protection 64:503-508. efsa and transport of meat. efsa journal 2016; 6):4523, 38 pp. doi: doi.org/10.2903/j.efsa.2016.4523. efsa biohaz panel. 2016. growth of spoilage bacteria during storage and transport of meat. efsa journal 14(6):4523. doi: doi.org/10.2903/j.efsa.2016.4523. fao (food and agriculture organization of the united nations) 1991. techniques and hygiene practices in slaughtering and meat handling. in “guidelines for slaughtering, meat cutting and further processing.” www.fao.org/docrep/004/t0279e/t0279e04.htm. gill c.o. and baker l.p. 1998. assessment of the hygienic performance of a sheep carcass dressing process. j food protect. 61:329-333. hald t., wingstrand a., swanenburg m., von altrock a. and thorberg b. m. 2003. the occurrence and epidemiology of salmonella in european pig slaughterhouses. epidemiology & infection 131(3):1187-1203. doi: doi.org/10.1017/ s0950268803001171 iglesias m.a., kroning i.s., decol l.t., de melo franco b.d. g. and da silva w.p. 2017. occurrence and phenotypic and molecular characterization of listeria monocytogenes and salmonella spp. in slaughterhouses in southern brazil. food research international 100:96-101. doi: doi.org/10.1016/j.foodres.2017.06.023. iso 21528-2: 2004. microbiology of food and animal feeding stuffs – horizontal methods for the detection and enumeration of enterobacteriaceae part 2: colony count method. www.iso.org/standard/34566.html. iso 6579:2002. microbiology of food and animal feding stuffs. horizontal method for the detection of salmonella spp. madden h., espiea w.e., morana l., mcbridea j. and scates p. 2001. occurrence of escherichia coli o157:h7, listeria monocytogenes, salmonella and campylobacter spp. on beef carcasses in northern ireland. meat science 58(4):343-346. doi: doi.org/10.1016/s0309-1740(00)00153-4. martínez b., celda m.f., anastasio b., garcía i. and lópez-mendoza m.c. 2010. microbiological sampling of carcasses by excision or swabbing with three types of sponge or gauze. j. food prot. 73:81-87. ital. j. food sci., vol. 30, 2018 839 mcevoya j.m., sheridana j.j., blairb i.s. and mcdowell d.a. 2004. microbial contamination on beef in relation to hygiene assessment based on criteria used in eu decision 2001/471/ec. int. j. food microbiol. 92:217-225. doi: doi.org/10.1016/j.ijfoodmicro.2003.09.010. mies p.d., covington b.r., harris k.b., lucia l.m., acuff g.r. and savell j.w. 2004. decontamination of cattle hides prior to slaughter using washes with and without antimicrobial agents. j. food prot. 67: 579-582. muluneh g. and kibret m. 2015. salmonella spp. and risk factors for the contamination of slaughtered cattle carcass from a slaughterhouse of bahir dar town, ethiopia. asian pacific journal of tropical disease 5.2:130-135. doi: doi.org/10.1016/s2222-1808(14)60640-x. turkish food codex communique on microbiological criteria. annex-2 production hygiene criteria / meat and meat products. official newspaper number 28157, dated december 29. paiao f.g., arisitides l.g.a., murate l.s., vilas-bôas g.t., vilas-boas l.a. and shimokomaki m. 2013. detection of salmonella spp, salmonella enteritidis and typhimuriumin naturally infected broiler chickens by a multiplex pcr-based assay. brazilian journal of microbiology 44(1):37-41. doi: doi.org/10.1590/s1517-83822013005000002. pearce r.a. and bolton d.j. 2005. excision vs sponge swabbing – a comparison of methods for the microbiological sampling of beef, pork and lamb carcasses. journal of applied microbiology 98:896-900. doi: doi.org/10.1111/j.13652672.2004.02525.x. pepperell r., reid c., solano s.n., hutchison m.l., walters l.d., johnston a.m. and buncic s. 2005. experimental comparison of excision and swabbing microbiological sampling methods for carcasses. j. food protect. 68(10):2163-2168. petruzzelli a., osimani a., pasquini m., clementi f., vetranoa v., paolini f., foglini m., micci e., paoloni a. and tonucci f. 2016. trends in the microbial contamination of bovine, ovine and swine carcasses in three small-scale abattoirs in central italy: a four-year monitoring. meat science 11:53-59. doi: doi.org/10.1016/j.meatsci.2015.08.016. prendergast d.m., daly d.j., sheridan j.j., mcdowell d.a. and blair i.s. 2004. the effect of abattoir design on aerial contamination levels and the relationship between aerial and carcass contamination levels in two irish beef abattoirs. food microbial. 21(5):589-596. doi: doi.org/10.1016/j.fm.2003.11.002. rahn k., de grandis s.a., clarke r.c., mcewen s.a., galin j.e., ginocchio c., curtiss r. and gyles c.l. 1992. amplification of an inva gene sequence of salmonella typhimurium by polymerase chain reaction as a specific method of detection of salmonella. molecular and cellular probes. 6:271-279. salmela s.p., fredriksson-ahomaa m., hatakka m. and nevas m. 2013. microbiological contamination of sheep carcases in finland by excision and swabbing sampling. food control 31:372-378. doi: doi.org/10.1016/j.foodcont.2012.10.017. untermann f., stephan r., dura u., hofer m. and heimann p. 1997. reliability and practicability of bacteriological monitoring of beef carcass contamination and the irrating within a hygiene quality control programme of abattoirs. int. j. food microbiol. 34:67-77. doi: doi.org/10.1016/s0168-1605(96)01173-7. wang s.j. and yeh d.b. 2002. designing of polymerase chain reaction primers for the detection of salmonella enteritidis in foodsand faecal samples. lett. app. microbiol. 32:422-427.3. yalçın s., nizamlıoğlu m. and gurbuz u. 2004 microbiological conditions of sheep carcasses during the slaughtering process. journal of food safety 24(2):87-93. doi: doi.org/10.1111/j.1745-4565.2004.tb00377.x. zweifel c., capek m. and stephan r. 2014. microbiological contamination of cattle carcasses at different stages of slaughter in two abattoirs. meat science 98:198-202. doi: doi.org/10.1016/j.meatsci.2014.05.029. paper received april 12, 2018 accepted june 14, 2018 paper ital. j. food sci., vol. 27 2015 495 keywords: buckwheat; biscuit; dough; storage; texture impact of buckwheat flour granulation and supplementation level on the quality of composite wheat/buckwheat ginger-nut-type biscuits b. filipčev*, o. šimurina and m. bodroža-solarov institute of food technology, university of novi sad, bul. cara lazara 1, 21000 novi sad, serbia *corresponding author: tel. +381 21 485 3778, email: bojana.filipcev@fins.uns.ac.rs abstract effects of gradual wheat flour substitution with buckwheat flour in ginger-nut biscuit formulation were investigated regarding dough characteristics, physical and textural characteristics of final product assessed after baking and 30 days of storage. buckwheat flour was added at 30, 40, 50% levels and two granulations (fine and coarse). addition of buckwheat flour significantly increased dough hardness and decreased adhesiveness. spread significantly increased in biscuits with 40% and 50% of coarse buckwheat flour. biscuits containing coarse flour were harder and more fracturable than the control, whereas those with fine flour tended to be softer and less fracturable. textural properties were significantly correlated to protein stability to heat and retrogradation tendency of starch in biscuit dough as well as moisture content. mailto:bojana.filipcev@fins.uns.ac.rs 496 ital. j. food sci., vol. 27 2015 introduction ginger-nut biscuit (gnb) is a sweet biscuit containing honey and aromatic spices (cinnamon, ginger, cloves), which is very popular globally. by this term, variety of sweet biscuit types are described. they may range from thin (less than 3 mm thick), crisp varieties with smooth surfaces to thicker (over 3 mm thick), smaller in diameter and softer varieties with prominent cracks on top surface. the large variation in ingredients and their proportions contributed to a wide range of biscuit types. for example, the finest quality nürnberg lebkuchen does not even contain flour but nuts and candid fruits deposited on thin wafer base whereas the polish pierniki toruńskie is made from the highest quality flour. the similar feature in all of them is that they all contain honey and spices. in serbia, ginger-nut biscuits are traditionally produced by artisans, although their production has been industrialized (gavrilović, 2003). in appearance, they mostly resemble the gingersnaps from the united states: usually circularly shaped, over 6 mm thick with cracks on the top surface and soft crumb. formulations of gnb typically include 3550% honey, 28-32% sugar, 0-5% fat on a flour weight basis (gavrilović, 2003), whereas the levels of major ingredients in common sweet biscuits are 30-75% sugar, 15-50% fat and 7-20% water (manley, 2000). according to pyler (1998), basic ratios of flour, fat and sugar in cookies vary from 100:30:30; 100:50:50 to 100:50:variable depending on processing type but may considerably deviate. gnb flour can be specified as a wheat flour with good bread-making performance (quality group b, peak amylogram value 300 b.u.), preferably of higher extractions (ash contents 0.8-1.15% d.b.) due to higher protein, hydrocolloid and enzyme content as opposed to the quality requirements in common biscuit production. the flour in common biscuits is usually soft wheat flour with lower protein content and moisture absorption and ash contents 0.34-0.38% d.b. (pyler, 1998) and weak gluten (pareyt and delcour, 2008). in contrast to common biscuits whose final moisture content is low and ranges between 1-5% (chevallier et al., 2000, 2002), the lowest recommended moisture content in gnb is 7% (gavrilović, 2003). below this value, the quality deteriorates due to increased hardness, fracturability and crumbling. the crumb of gnb is porous with denser or looser pore structure, soft and elastic. its upper surface is cracked which is a common pattern with formulations high in sugar and low in fat and is attributed to sugar recrystallization on the surface area (pareyt et al., 2009). gnb is traditionally perceived as healthier in relation to other types of sweet biscuits probably because they contain honey and low amount of fat. as such, they can be seen as a convenient medium for providing further improvement in nutritional value and functionality by replacing a part of wheat flour with other nutritionally more valuable cereal or noncereal flour. one such ingredient having an excellent reputation for its nutritious quality and abundance in bioactive compounds is common buckwheat. buckwheat is most commonly used for producing flour and groats. while groats are mainly used for porridge and in various ethnic dishes, buckwheat flour is used as an ingredient in a variety of baked, cooked and extruded products: breads made from wheat-buckwheat flour blends at different ingredient proportions, flat bread, pasta (pizzoccheri in italy), noodles (soba in japan, extruded noodles in china and korea), pancakes, breakfast cereals (based on extrudates made from buckwheat, rice, and/or corn blends), and biscuits (buckwheat added at 2030% wheat flour basis). results from previous studies (filipčev et al., 2012) revealed that buckwheat flour has a potential as an ingredient in gnb formulation but a main disadvantage was related to the coarse granulation of commercially available buckwheat flour which reflected gritty texture of the final product. therefore, this study was conducted to investigate the effect of substitution level and granulation of wholegrain buckwheat flour on dough characteristics and gnb physical and textural characteristics. the effects of three substitution levels (30%, 40%, 50%) and two flour granulation sizes (fine (fbf) and coarse (cbf)) were studied. materials and methods materials commercially available wheat flour (wf) type 850 (ash content 0.81% dry basis, moisture content 12.53%), and wholegrain buckwheat flour (ash 2.20% d. b., moisture content 12.31%) were used in the experiment. other ingredients honey, vegetable fat (from sunflower), sugar, nahco 3 , lecithin and spice (cinnamon) were obtained from a local food store (novi sad, serbia). the purchased buckwheat flour was coarsely granulated. to obtain finer granulation, it was remilled on a falling number 3100 mill (perten instruments). the granulation of used flours is given in table 1. water absorption capacity of flours flour sample (5 g) was mixed with an excess of distilled water (25 ml), kept at ambient temperature for 30 min and then centrifuged at ital. j. food sci., vol. 27 2015 497 2000 x g for 15 min. water absorption capacity was expressed as g of water bound by 100 g of dry matter. syneresis degree of wheat and buckwheat flours the method described by singh et al. (2003) was used. flour suspensions (6 % w/v) were heated in a water bath to 90°c and held 20 min at this temperature. cooled flour paste (30 mg) was poured into a centrifuge tube. the tubes were stored for 1 and 10 days at 4°c. syneresis was measured as % of water expelled after centrifugation of sample. biscuit making gnb was prepared by substituting wheat flour with buckwheat (0, 30, 40, 50 %). formulae are found in table 2. firstly, a basic dough was formed by warming a mixture of honey, sugar and water to 80°c and adding part of the flour (75% of total) to a hot mixture. the mixture was mixed to obtain a thick, homogenous mass. after cooling to 40°c, basic dough was sprinkled over with flour, covered with a plastic foil, and left to rest at ambient temperature for two days. other ingredients (remaining flour amount, spices, raising agents dissolved in water, fat and lecithin) were added and mixed using a kitchen mixer with a spiral hook for 10 min. the amount of added water was adjusted table 1 particle size distribution of used flours. particle size wheat flour coarse buckwheat fine buckwheat (weight %) (wf) flour (cbf) flour (fbf) >350 mm 0.00 55.30 5.74 >250 mm 0.02 9.40 11.32 >180 mm 0.40 4.76 11.11 >150 mm 1.32 3.80 8.90 >105 mm 22.54 10.14 18.86 >85 mm 26.85 9.80 30.76 bottom 48.87 6.80 13.31 table 2 ginger nut biscuits formulations. ingredients, g control biscuit supplemented biscuit supplemented with cbfa with fbfa wheat flour 100 70 60 50 70 60 50 buckwheat flour 0 30 40 50 30 40 50 honey 50 50 50 sugar 10 10 10 vegetable fat 5 5 5 nahco 3 2.1 2.1 2.1 spice blend 2 2 2 lecithin 1 1 1 water 20 18 17 16 20 21 22 a cbf-coarse buckwheat flour; fbf-fine buckwheat flour to obtain a maximally soft dough with acceptable handling characteristics. the consistency of dough was evaluated subjectively by an experienced baker. dough moisture content ranged between 17.8-21.7%. after mixing, the dough was sheeted on a pastry break to 10-mm thickness (sfogliatrice mignon, maestrino, pd, italy). the dough was cut to a diameter of 60 mm and baked for 15 min in a deck oven at 170°c. after 1 hour of cooling at room temperature, the biscuits were packed in polyethylene bags and stored at room temperature. texture profile analysis of biscuit dough dough characteristics were evaluated using a texture analyzer (ta.xtplus stable micro systems ltd., surrey, uk) equipped with a 30kg load cell. texture profile analysis (tpa) was employed to measure dough properties as described by (gallagher et al., 2005). doughs were prepared as for the baking test and cut into round pieces (60 mm). a 36-mm cylindrical aluminium probe was used in two compression cycles at test speed 1.0 mm/s. pre and posttest speeds were 2.0 mm/s. the force was measured at 45% compression. the recovery period between the strokes was 5 s. the following 4 parameters were recorded: hardness, adhesiveness, cohesiveness and springiness. seven measurements per each biscuit type were made. measurements were performed on dough after the resting period. 498 ital. j. food sci., vol. 27 2015 analysis of thermo-mechanical properties of biscuit dough by mixolab mixing and pasting properties of the ginger nut biscuit doughs were studied on mixolab (chopin, tripette and renaud, paris, france). this device measures in real time the torque produced by dough during mixing at conditions of controlled temperature regime which include dough heating to 90°c, maintenance at constant temperature and dough cooling to 50°c. in this way, the behaviour of both proteins and starch under dual mechanical shear stress and temperature constraint can be measured (rosell et al., 2006). usually, individual flours or flour blend slurries are analysed in this way. in our study, previously prepared gnb dough was subjected to analysis using a modified mixolab protocol. for the assays, 80 g of dough was inserted to mixolab bowl, followed by the next regime: mixing speed 80 rpm, tank temperature: 30°c, 1st plateau temperature 30°c, duration of first plateau 5 min, heating rate 4.0°c/min, 2nd plateau temperature 90°c, duration of 2nd plateau 7 min, cooling rate 4.0°c/min, 3 rd plateau temperature 50 °c, duration of 3rd plateau 5 min. main derived parameters from the mixolab curves are: development (c1) or maximum torque reached during mixing at 30°c, protein weakening (c2) or the minimum torque produced as a consequence of heating and mechanical stress, maximal torque (c3) produced during the heating stage as a consequence of starch gelatinization, minimal torque at the stage of cooling (c4) and the torque after cooling at 50°c (c5). measurements were replicated twice for each biscuit dough type after the resting period. textural analysis of ginger nut biscuits hardness and fracture of gnb were measured 24 h post-bake by penetration test on ta.xtplus texture analyzer (stable micro systems, england, uk). the test mode was force in compression. a 5 kg load cell was used. the sample was placed on the platform with a holed plate and centrally punctured with a 2 mm cylinder probe through the sample at test-speed 0.5 mm/s. hardness of the sample was calculated from the area under the curve whereas fracturability was calculated from the linear distance. four biscuits from each treatment were punctured five times in an ‘x’ pattern avoiding the outer 1 cm to prevent from edge effects. biscuit dimensions and density diameter (width) and height (thickness) of biscuits were measured using a vernier calliper. diameter was calculated as an average of long and short diameter. spread was calculated from the ratio of width and height. for the measurements, twelve randomly chosen biscuits were taken. density was calculated as a ratio of biscuit mass and volume. since biscuits had a regular shape, their volume was approximated to the volume of cylinder according to formula v=p*(r/2)2*h where h is biscuit height and r is average biscuit diameter. moisture content moisture was calculated according to aoac method 926.5 (2000). two composite samples of each biscuit type were analyzed in duplicates. the composite samples were prepared by homogenization of six individual biscuit samples. statistical analysis an analysis of variance (anova) of data was performed by using a statistica 7.1 statistical software package (statsoft inc., tulsa, oklahoma). tukey’s post-hoc test was used to compare the means at 95% confidence interval. correlation analysis was conducted using spearman’s rank correlation coefficient applied to mean values for each biscuit. results and discussion water absorption capacity (wac) and syneresis degree of used flours buckwheat flour showed higher wac in comparison to wf (table 3). this might be due to various reasons: higher hydration capacity of buckwheat starch in comparison to wheat starch (qian et al., 1998); presence of other hydrophilic constituents in the wholegrain bucktable 3 water absorption capacity (wac) and syneresis (%) of wheat and buckwheat flour. flour wac (g/100 g dry matter) syneresis (%) 1 day 10 days wheat flour 63.96a 9.27a 14.57a buckwheat flour, coarse 101.10b 39.27b 46.86c buckwheat flour, fine 104.14b 40.20b 42.67b a,b,c figures followed by the same letters in a column are not significantly different (p>0.05). wheat flour (fibers). in contrast, baljeet et al. (2010) reported that buckwheat flour had lower wac, higher oil absorption capacity, higher foaming capacity and higher least gelation concentration than wheat. wac of fbf increased but not significantly in comparison to cbf which might be explained by the fact that milling does not tend to increase the amount of damaged starch in buckwheat. it has been shown by qian and co-workers (1998) that ital. j. food sci., vol. 27 2015 499 buckwheat flour has lower amounts of damaged starch than wheat. the syneresis value (%) of cooked pastes from wheat and buckwheat flour significantly differed. wf showed much less syneresis than buckwheat. during storage, syneresis of the pastes increased. the highest syneresis was observed in the paste made from cbf (46.9%), followed by fbf (42.7%). the retrogradation properties of the flours are generally attributed to composition, ratio and interactions of flour constituents: proteins, starch, lipids, fibers. gnb dough characteristics the addition of buckwheat significantly increased dough hardness in comparison to the control (p<0.05) (fig.1). the dough hardness increased remarkably in the case of finely ground buckwheat flour. tpa adhesiveness showed a declining trend which was significant in comparison to the control. dough springiness and cohesiveness also tended to decline with increased proportion of buckwheat, but there were no significant differences between the samples. fbf increased dough cohesiveness in comparison to cbf. fig. 1 dough hardness, adhesiveness, cohesiveness and springiness for different formulations of gnb. a,b,c ,… a, b,… values followed by same letters of the same case are not significantly different (p>0.05). these effects can be related to the particularities of buckwheat flour and flour particle size. buckwheat is characterized by resistant starch, which may contribute to low viscoelastic properties of dough and increased hardening (qian et al., 1998; de francischi et al., 1994; li et al., 1997; qian and kuhn, 1999; yoshimoto et al., 2004; hatcher et al., 2008). the observed variations in dough hardness and adhesiveness were mainly due to the effect of buckwheat flour granularity. even though wac between fbf and cbf did not significantly differ, it seems that finer flour particles were able to absorb more water during mixing, thereby forming more cohesive and harder dough. lowering of dough adhesiveness and cohesiveness as a consequence of increasing amounts of coarse wheat flour was reported earlier (singh gurjal et al. 2003). this coincides with our findings. furthermore, dough made with wholegrain buckwheat flour was reported to have lower adhesiveness in comparison to the majority of other buckwheat flour fractions (ikeda and kishida, 1992). parameters related to thermo-mechanical behaviour of gnb dough made with coarse and fine buckwheat flour is given in table 4. bucktable 4 dough mixolab parameters for different formulations of gnb (cbf-coarse buckwheat flour; fbf-fine buckwheat flour). sample c1 c2 c3 c4 c5 c1-c2 c5-c4 (nm) (nm) (nm) (nm) (nm) (nm) (nm) control 3.45a 2.73e 3.04f 1.65e 1.66b 0.72a 0.005a cbf 30% 3.99b,c 1.20d 1.40c 1.39c 2.71e 2.79c 1.32d 40% 4.31c 0.86c 1.53c 1.54d 2.24d 3.45e 0.70b 50% 3.68a,b 0.68a 1.81d 1.62e 2.69e 3.00d 1.06c fbf 30% 4.22c 1.30d 1.30b 0.97b 1.85c 2.92d 0.88c 40% 4.19c 0.75b 2.00e 0.91b 1.52b 3.44e 0.61b 50% 5.32d 0.85c 1.10a 0.63a 0.95a 4.47e 0.32b a,b,c ,… figures followed by the same letters in a column are not significantly different (p>0.05). 500 ital. j. food sci., vol. 27 2015 wheat supplemented dough was characterized with higher maximal torque during mixing (c1) and lower resistance to thermal and mechanical stresses (low c2 and high c1-c2) than the control dough. these effects seem to be more pronounced in the case of dough supplemented with coarse buckwheat flour. both buckwheat flours affected these parameters in a similar way. this behaviour is probably due to dilution of gluten by addition of non-glutenous buckwheat flour which contributed to the formation of weaker protein network. the control dough showed higher maximal peak during heating (c3) than the buckwheat supplemented doughs. the decrease in peak viscosity of the buckwheat supplemented doughs may be attributed to lower swelling of starch granules and poorer gelatinization which is probably due to native characteristics of buckwheat starch and limited water amount in gnb doughs. similar results were reported by hadnađev and co-workers (2008), even in systems with higher moisture content, resembling bread dough. the buckwheat doughs exhibited lower breakdown torque (c4) which indicates lower stability of warm gel. final torque (c5) and total setback values (c5-c4) are parameters used to characterize starch retrogradation that occurs during cooling to 50°c. final torque (c5) was lower in the control dough and dough made with fine buckwheat flour. the total setback was the lowest in the control dough followed by fbf dough. hence, regarding the ability to resist retrogradation, the tested gnb doughs follow the order: wheat dough > fine buckwheat flour dough > coarse buckwheat flour dough. biscuit dimension, density and spread data related to the biscuit dimension and density is displayed in fig. 2. majority of the variables showed significant differences as compared to the control especially at higher replacement levels (40% and 50%). the height and diameter decreased with increasing levels of both fbf and cbf. despite general shrinkage, the interrelation between both dimensions was such that spread increased significantly at 40% and 50% of cbf addition whereas in other cases, spread did not significantly vary from the control. there was a strong inverse correlation between spread and height (r=-0.84, p<0.01) showing that reduction in height dominantly affected spread whereas spread and diameter were not significantly correlated (r=-0.17, p>0.01). the spread of the biscuit during baking is caused by expansion of dough by leavening and gravitational flow (hoseney and rogers, 1994). it depends on factors that control dough viscosity: the amount of water free to act as solvent and the strength of dough (ram and singh, 2004). it also depends on partitioning of available water between the ingredients. the lesser the amount of water held by ingredients, the more the amount of water is available to dissolve sugar, decrease dough viscosity and increase spread (pareyt and delcour, 2008). coarse flour has been reported to contribute to greater spread (singh gurjal et al., 2003; manley, 1991). substitution of wheat flour with a finely ground light and dark buckwheat flour (granulation size 100-150 mm) in sugarsnap cookie formulations lowered the cookie spread (maeda et al., 2004). it was also found that buckwheat flour of similar granulation dosed at 10-40% level (flour basis) decreased the spread in sugar snap cookies (baljeet et al., 2010). results obtained in this study confirmed the relation between spread and flour granularity: in relation to the control, the addition of cbf increased the spread. higher biscuit spread is considered advantageous in biscuit making (pareyt and delcour, 2008). but, in contrast to majority of biscuits, the main quality requirement for gnb is well developed and soft crumb (gavrilović, 2003). therefore, high spread may not be necessarily considered as preferable in gnb making since the increased thickness (height) is needed to develop a porous and soft crumb. regarding biscuit density, a general trend was fig. 2 effect of gnb formulation on biscuit dimensions (height, diameter, spread) and density. a,b,c ,… a, b,… values followed by same letters of the same case are not significantly different (p>0.05). ital. j. food sci., vol. 27 2015 501 fig. 4 effect of gnb formulation on biscuit hardness and fracturability measured after 24 h and 30 days. a,b,c ,… a, b,… values followed by same letters of the same case are not significantly different (p>0.05). that density increased in the combined formulations. there was a strong inverse correlation between the biscuit dimensions and density r=0.97 (p<0.01) and -0.76 (p>0.05) for height and diameter, respectively, confirming that higher density reduces biscuit development. biscuit moisture content minimal moisture content required for the retention of freshness in gnb is 7%. moisture contents below this value render biscuits unacceptable owing to their increased tendency to dry out during storage. the moisture content of biscuits was significantly affected by the level of flour substitution with buckwheat flour as well as its granulation: increased buckwheat doses and coarse flour tended to decrease it whereas fbf increased the moisture content (fig. 3). as a result, the composite biscuits with 40% and 50% of cbf were significantly lower in moisture (8.00-8.50%, p<0.05, respectively). other formulations had higher moisture contents with the highest registered in gnb made with fbf and the control (≥ 10.0% moisture content). the water content in gnb formula was significantly correlated to biscuit hardness (r=-0.84, p<0.01), dough cohesiveness (r=0.84, p<0.01) and c5 (r=0.92, p<0.01). these results indicate that higher moisture content is advantageous in this category of biscuits as it contributes to softer texture, more cohesive and stable dough. over time, a decrease in moisture contents was observed in all samples. the most marked moisture content decrease (by 8%-10.7%, p<0.05) were in the biscuits substituted with fbf and much less in other samples (by 2.6%-3.8%), in spite of the lower syneresis degree of fbf. although subjected to the high moisture loss, these biscuits remained higher in moisture content than the control due to higher initial moisture. during storage, moisture migration and evaporation occurs because gluten and starch undergoes such transformations which result in water release (willhoft, 1971; senti and dimler, 1960). biscuit texture characteristics granulation of buckwheat flour affected hardness and fracturability of gnb. in general, two trends were observed: as the level of cbf increased, hardness also increased, whereas the addition of fbf decreased hardness (fig. 4). however, the produced results were similar to the control except in the case of gnb made with 50% cbf, which produced significantly higher hardness. fracturability showed a similar trend (fig. 4). baljeet and others (2010) said that the addition of finely ground buckwheat flour decreased the hardness of composite biscuits. increased hardness has been usually related to increased association of wheat proteins as correlated by gaines (1990) in sugar snap cookies and hatcher et al. (2008) in the buckwheat supplemented soba noodles. in contrast to common biscuits, good quality wheat flour is required in the production of ginger nut biscuits. consequently, its texture is related to the quality of flour proteins with the ability to provide unique viscoelastic and network-forming properties. the results of this study showed a significant correlation (r=0.74, p<0.05) between the biscuit hardness and a mixolab parameter fig. 3 effect of gnb formulation and storage time on biscuit moisture content. a,b,c ,… a, b,… values followed by same letters of the same case are not significantly different (p>0.05). 502 ital. j. food sci., vol. 27 2015 related to the quality of proteins, c1-c2. as already noted, c1-c2 indicates protein weakening during heating: higher difference means increased protein weakening i.e. lower stability to heat. gavrilović (2003) suggested that gnb hardness is also affected by starch pasting properties. in this study, significant correlation (r=0.84 and 0.81, p<0.01) was found only between hardness and mixolab parameters which indicates starch gel retrogradation (c5 and c5-c4 (total setback), respectively) i.e. higher biscuit hardness can be related to higher setback and c5 values which are indicators of higher susceptibility to staling. the ability of the buckwheat starch to increase hardness of gnb can be counteracted by using ingredients able to retain more water (such as an observed decreasing trend for hardness in the biscuits made with fbf (fig. 4)). actually, it was found that the moisture content significantly affected biscuit hardness; there was a significant inverse correlation between hardness and formula water content i.e. biscuit moisture content (r=-0.84 (p<0.01) and -0.74 (p<0.05), respectively). according to gavrilović (2003), fracturability of gnb can be related to the presence of partially dehydrated gluten in the dough matrix. charles and co-workers (2004) proposed that the presence of discontinuous phase in gluten network was related to an increase in fracturability in flaky snack. here in the study, significant correlation was found between the biscuit fracturability and two mixolab parameters related to the behaviour of protein during heating (c2 and c1c2): c2 denotes the minimum torque produced during heating as a consequence of the beginning of protein weakening (r=-0.84, p<0.01) and c1-c2 can be associated with protein stability (r=0.95, p<0.01). lower value of c2 and higher value for c1-c2 indicate lower protein stability. in other words, increasing fracturability of gnb can be related to all such factors that may lower the protein stability or discontinue the gluten network such as the addition non-gluten ingredient like buckwheat, especially in the form of coarse flour. there was also a significant correlation between biscuit fracturability and setback value (c5-c4) (r=0.78, p<0.05 ). over the 30-day trial period, a significant increase in hardness and fracturability occurred for gnb made with fbf whereas all others showed insignificant increases as related to the initial values (fig. 4). but, there were no significant differences in hardness and fracturability within all biscuits measured after 30 days of storage. on the basis of the above mentioned high correlation between the texture and mixolab parameters that indicate starch susceptibility toward retrogradation, it could be thought that the lower the susceptibility of starch in biscuit dough to retrograde, the lower the biscuit hardness, fracturability and presumably its tendency towards staling. but, the results obtained after storage showed that gnb made with fbf, which initially gave the softest biscuit and which paste had lower syneresis degree, significantly increased in hardness (in relation to the initial values). this could be due to higher moisture evaporation and more compact structure in comparison to the granular structure of gnb made with cbf. it is also worth noting that gnb dough represents a low-moisture system containing up to 25% moisture and, in addition, interfering ingredients like sugar and fat which might have caused different behaviour and tendencies regarding starch pasting. interestingly, dough hardness was strongly positively correlated with biscuit hardness and fracturability after storage (r=0.84 and r=0.81, p<0.01). in the literature, there is little data on the functional properties of buckwheat flour; more data exist on buckwheat starch. furthermore, data on the ability of buckwheat starch to retrograde are rather contrasting. in the study of qian and colleagues (1998), besides increased hardness and stability, buckwheat starch gels exhibited lowered retrogradation as compared to cereal starches, even after storage. lower susceptibility to retrogradation was also suggested in reports on thermomechanical properties of buckwheat flour slurries or wheat/buckwheat blends slurries (chopin’s mixolab user’s manual 2005, banu et al., 2010). in another study, however, a stronger retrogradation peak was observed in buckwheat thermogram than that in wheat (liu et al., 2006). zheng and associates (1998) reported that buckwheat starch had a higher peak viscosity and setback value than maize and wheat starches which may suggest higher retrogradation tendencies in buckwheat starch since setback viscosity indicates the degree of starch retrogradation, mainly its amylase fraction. starch pasting properties depend on the hydration level (zhou et al., 2009). it was concluded that buckwheat starch gelatinization temperatures and enthalpies increased along with the decrease of water content, which can be associated with an increased retrogradation tendency. moreover, there is little data to relate starch pasting behaviour with the final properties in a biscuit-like products. it was reported that the addition of corn flour produced harder cookies than did the addition of potato flour, although corn flour had been shown to give lower syneresis (retrogradation) than potato flour (singh et al., 2003). some authors did not find any correlation between pasting properties of batters and characteristics of layer cakes (gómez et al., 2010). others suggested that dehulled buckwheat flour, although showing a tendency to retrograde, can be used in buckwheat enriched products (mariotti et al., 2008). inital. j. food sci., vol. 27 2015 503 glett and his team (2009) proposed that only specialty buckwheat flour with low paste viscosity is suitable for mixing with wheat flour to produce bread and cookies. much earlier, lorenz and dilsaver (1982) mentioned that inclusion of native buckwheat starches in cake formulations did not produce cakes of acceptable quality. conclusions the results indicated that the addition of buckwheat significantly increased dough hardness and decreased dough adhesiveness. springiness and cohesiveness of buckwheat doughs were reduced but no significant difference within the samples was observed. the dimensions of gnb decreased, but since the biscuit height was more affected by the rising doses of buckwheat, the spread increased in the composite biscuits (significant difference was noted with cbf at 40% and 50% replacement level). hardness and fracturability of gnb increased with increasing doses of cbf whereas fbf decreased hardness and fracturability. however, a significant change was noted only with the addition of 50% cbf. hardness and fracturability of gnb significantly correlated to the quality of proteins; lower stability of proteins to heat was associated to increased hardness and fracturability in gnb. tendency of starch gel in biscuit dough to retrograde was found to be in significant positive correlation with biscuit hardness and fracturability, however, after 30 days of storage, hardness and fracturability increased most markedly in the biscuits made with fbf which were initially softer than the others. biscuit hardness was in significant inverse relation with the formula water content which might additionally support the importance of protein quality and starch pasting behaviour to the quality of gnb. comparing gnb and common biscuits made from short and semi-sweet dough from literature, it seems that gnb exhibits different behaviour. better quality characteristics are obtained when more water is added to the dough and increased spread cannot be regarded as positive since well-developed crumb is more advantageous for better textural properties. the addition of fbf to gnb formulation is appropriate at the investigated doses. however, since they have been inclined to excessive drying out, the use of humectants or suitable edible coatings would be appropriate. acknowledgements the authors acknowledge the financial support of the ministry of education, science and technological development of the republic of serbia (project iii 46005). references aoac 2000. „ official methods of analysis of aoac international“. aoac, maryland, usa. baljeet, s.y., ritika, b. y. and roshan, l.y. 2010. studies on functional properties and incorporation of buckwheat flour for biscuit making. int. food res. j. 17: 1067-1076. banu, i., vasilean, i. and aprodu, i. 2010. evaluation of rheological behaviour of whole rye and buckwheat blends with whole wheat flour using mixolab. it. j. food sci. 22(1): 83-89. charles, a.l., fu, h-y. and huang, t-c. 2004. role of intact starch granule and gluten on texture of taiwanese flaky snack. j. text. study 35: 311-323. chevallier, s., colonna, p., buléon, a. and della valle, g. 2000. physicochemical behaviours of sugars, lipids and gluten in short dough and biscuit. j. agric. food chem. 48: 1322-1326. chevallier, s., della valle, g., colonna, p., broyart, b. and trystram, g. (2002). structural and chemical modifications of short dough during baking. j. cereal sci. 35: 1-10. chopin’s mixolab user’s manual 2005. villeneuve la garenne: france tripette and renaud chopin. de francischi, m.l.p., salgado, j.m. and leitão, r.f.f. 1994. chemical, nutritional and technological characteristics of buckwheat and non-prolamine buckwheat flours in comparison of wheat flour. plant food hum. nutr. 46: 323-329. filipčev, b., šimurina, o. and bodroža-solarov, m. 2012. enrichment of ginger nut biscuits with wholegrain buckwheat and rye flour. eu. j. plant sci. biotechnol. 6 (special issue 2): 57-62. gaines, c.s. 1990. influence of chemical and physical modification of soft wheat protein on sugar snap cookie dough consistency, cookie size, and hardness. cereal chem. 67 (1): 73-77. gallagher, e., kenny, s. and arendt, e.k. 2005. impact of dairy protein powders on biscuit quality. eu. food res. technol. 221: 237-243. gavrilović, m. 2003. tehnologija konditorskih proizvoda (technology of confectionery products). university of novi sad, novi sad. (in serbian). gómez, m., manchón, l., oliete, b., ruiz, e. and caballero, p.a. 2010. adequacy of wholegrain non-wheat flours for layer cake elaboration. lwt-food sci. technol. 43: 507-513. hadnađev, m., torbica, a., dokić, p. and sakač, m. 2008. influence of partial wheat flour substitution by buckwheat flour on dough rheological characteristics measured using mixolab. food process. quality safety 35: 129-134. hatcher, d.w., you, s., dexter, j.e., campbell, c. and izydorczyk, m.s. 2008. evaluation of the performance of flours from cross and self-pollinating canadian common buckwheat (fagopyrum esculentum moench) cultivars in soba noodles. food chem. 107: 722-731. hoseney, r.c. and rogers, d.e. 1994. mechanism of sugar functionality in cookies. in: “the science of cookies and cracker production”. h. faridi (ed.), p. 203-225. avi, new york, usa. ikeda, k. and kishida, m. 1992. analysis of texture of doughs from buckwheat flours. fagopyrum 12: 17-20. inglett, g.e., xu, j., stevenson, d.g. and chen, d. 2009. rheological and pasting properties of buckwheat (fagopyrum esculentum möench) flours with and without jetcooking. cereal chem. 86(1): 1-6. li, w., lin, r. and corke, h. 1997. physicochemical properties of common and tartary buckwheat starch. cereal chem. 74 (1): 79-82. liu, q., donner, e., yin, y., huang, r.l. and fan, m.z. 2006. the physicochemical properties and in vitro digestibility of selected cereals, tubers and legumes grown in china. food chem. 99: 470-477. lorenz, k. and dilsaver, w. 1982. buckwheat (fagopyrum esculentum) starch-physicochemical properties and functional characteristics. starch (stärke) 34(7): 217-220. 504 ital. j. food sci., vol. 27 2015 maeda, t., miyake, k., tahara, m. and morita, n. 2004. substitution of buckwheat flour on processing pasta and cookie. fagopyrum 21: 99-103. manley, d. 2000. “technology of biscuits, crackers and cookies”. woodhead publishing limited, uk, crc press, boca raton, usa. mariotti, m., lucisano, m., pagani, m.a. and iametti, s. 2008. macromolecular interactions and rheological properties of buckwheat-based dough obtained from differently processed grains. j. agric. food chem. 56: 4258-4267. pareyt, b. and delcour, j.a. 2008. the role of wheat flour constituents, sugar, and fat in low moisture cereal based products: a review on sugar-snap cookies. crit. rev. food sci. nutr. 48: 824-839. pareyt, b., talhaoui, f., kerckhofs, g., brijs, k., goesaert, h. and wevers, m. 2009. the role of sugar and fat in sugar-snap cookies-structural and textural properties. j. food eng. 90: 400-408. pyler, j.m. 1988. “baking science and technology”. sosland publishing co., meriam, ks. qian, j., rayas-duarte, p. and grant, l. 1998. partial charcterization of buckwheat (fagopyrum esculentum) starch. cereal chem. 75(3): 365-373. qian, j.y. and kuhn, m. 1999. evaluation on gelatinization of buckwheat starch: a comparative study of brabender viscoamylography, rapid visco-analysis, and differential scanning calorimetry. eu. food res. technol. 209: 277-280. ram, s. and singh, r.p. 2004. solvent retention capacities paper received december 12, 2014 accepted april 7, 2015 of indian wheats and their relationship with cookie-making quality. cereal chem. 81: 128-133. rosell, c.m., collar, c. and haros, m. 2006. assessment of hydrocolloid effects on the thermo-mechanical properties of wheat using the mixolab. food hydrocolloid 21: 452-462. senti, f.r. and dimler, r.j. 1960. changes in starch and gluten during aging of bread. baker’s digest 33 (1): 28-31. singh, j., singh, n., sharma, t.r. and saxena, s.k. 2003. physicochemical, rheological and cookie making properties of corn and potato flours. food chem. 83: 387-393. singh gurjal, h., mehta, s., singh samra, i. and goyal, p. 2003. effect of wheat bran, coarse wheat flour and rice flour on the instrumental texture of cookies. int. j. food prop. 6 (2): 329-340. willhoft, e.m.a. 1971. bread staling. i. experimental study. ii. theoretical study. j. sci. food agric. 22: 176. yoshimoto, y., egashira, t., hanashiro, i., ohinata, h., takase, y. and takeda, y. 2004. molecular structure and some phycisochemical properties of buckwheat starches. cereal chem. 81 (4): 515-520. zheng, g.h., sosulski, f.w. and tyler, r.t. 1998. wet milling, composition and functional properties of starch and protein isolated from buckwheat groats. food res. int. 30: 493-502. zhou, y-g., li, d., wang, l-y., li, y., yang, b-n., bhandari, b., chen, x. d. and mao, z-h. 2009. effect of water on thermal behaviors of common buckwheat flour and starch. j. food eng. 93, 242-248. ijfs#1263_bozza ital. j. food sci., vol. 31, 2019 110 paper effect of the addition of smoked trout fillet powder to the quality properties of pasta e. ozgoren* and a. yapar pamukkale university, faculty of engineering, department of food engineering, denizli, turkey *corresponding author: tel.: +90 2582963129; fax: +90 2582963262 e-mail address: ezgio@pau.edu.tr abstract in this study, quality properties of six pasta samples, prepared by substituting semolina with smoked trout fillet powder (stfp), were investigated. the addition of stfp to the pasta formulation resulted in an increase in protein, fat and ash content, energy value, antioxidant activity, phenolic content, optimum cooking time, cooking loss, and a* and b* values, but a decrease in carbohydrate content, water absorption capacity, swelling index and l* value. furthermore, sem images revealed that addition of stfp leads to an increase in protein matrix around the starch molecules, and its addition in quantities up to 15% showed acceptable sensory scores. keywords: pasta enrichment, pasta quality, smoked trout fillet powder ital. j. food sci., vol. 31, 2019 111 1. introduction pasta is the most commonly consumed food product after bread among cereal products, and is traditionally produced from wheat semolina and water. the popularity of pasta is a result of its low cost, long shelf life, sensory characteristics and nutritional properties (fradique et al., 2013; kaur et al., 2013; goes et al., 2016). the food and drug administration and the world health organization both recognize pasta as a good vehicle for enrichment with nutrients (beleggia et al., 2011), and it is also known to be a rich source of complex carbohydrates and b vitamins, but as a poor source of protein and essential amino acids. this has led to many studies being carried out to enrich pasta with protein-rich ingredients such as meat, seafood (such as fishes and shrimp), legumes (such as chickpea, split pea, lentil, cowpea, mung bean and faba bean flour) (gallegosinfante et al., 2010; kadam and prabhasankar, 2012; lakshmi devi et al., 2013; liu et al., 2016; petitot et al., 2010; savita et al., 2013; wojtowicz and moscicki, 2014; wood, 2009; zhao et al., 2005). such enrichments can have an effect on certain qualities of pasta, such as color, sensory characteristics, texture and cooking parameters (mercier et al., 2011). fish provide several nutritional benefits, such as high quality proteins that contain essential amino acids, and are a good source of lipids, complex b vitamins and such minerals as phosphorus, magnesium, zinc and iron (goes et al., 2016). fish is usually consumed in its fresh form, but can also be consumed after being dried, salted or smoked. smoking techniques have been used as a preservation method for centuries. besides affecting the characteristic color and flavor of food, smoking processes also has antimicrobial and antioxidative effects that are known to extend the shelf life of foods (lingbeck et al., 2014). before marketing, smoked fish fillet is packed in standard weights. the edges of smoked fillets must be cut to meet a standard weight for packaging. these pieces that showed the same nutritional characteristics as the fish fillets, are discarded as production waste or are processed into low value-added products. such waste can be used in the manufacture of enriched, high value-added food products. the objective of this study is to investigate the chance of utilization of such fillet pieces and to examine the possibility of pasta nutritional value enhancement. it was also aimed to determine the changes in the cooking characteristics, antioxidant activity, microstructural properties, sensory properties and color attributes of pasta samples with the addition of smoked trout (oncorhynchus mykiss) fillet powder (stfp). 2. material and methods 2.1. raw materials smoked trout fillet pieces were dried in a cabinet dryer (yucebas machine analytical equipment industry, izmir, turkey) at 50°c until ˂10% moisture content was achieved. the airflow rate in the cabinet dryer was 0.2 m/s and the relative humidity of the air was in a range of 19–21 %. after drying, the samples were ground into powder of a ˂1000 µm particle size, and the stfp was then stored at -18 °c until use. wheat semolina (particle size ˂450 µm), deionized water and common salt were used in the preparation of each pasta sample. ital. j. food sci., vol. 31, 2019 112 2.2. pasta production the stfp was added to the pasta formulation in quantities of 5, 10, 15, 20 and 25. the formulations of the pasta samples are shown in table 1. the salt content of the stfp was found to be 6.3 %, and so the salt content was adjusted to 1.5 % in the pasta formulations. the ingredients were mixed in the kneading vessel of the laboratory pasta machine (dolly pasta machine, la monferrina, italy) at room temperature for 10 min to make the pasta dough, and the dough was then extruded using the pasta machine. a no. 28 die (6 mm wide, 0.85 mm thick, ptfe) was used to shape the dough, which was then cut into 10 cm lengths. the pasta samples were dried at room temperature until a ˂10% moisture content was reached (~20 h). table 1. formulations of pasta samples. ingredients stfp inclusion level 0% 5% 10% 15% 20% 25% wheat semolina (g) 100 95 90 85 80 75 stfp (g) 0 5 10 15 20 25 deionized water (ml) 34 34 36 39 39 41 salt (g) 1.5 1.2 0.9 0.5 0.2 0 the control sample (unenriched) and the enriched pasta samples were packaged in a moisture-proof material (pet+coex pa) and stored at room temperature for further analyses. 2.3. proximate composition analysis the crude protein content of the samples was determined using the dumas method (shea and watts, 1939) with a dumatherm analyzer (gerhardt gmbh & co. kg, königswinter, germany), while fat content, moisture content and ash content were measured using aoac (1990) methods. carbohydrate content was estimated by subtracting the moisture, protein, fat and ash content from 100% energy values were calculated using the following equation (souci et al., 2000); 𝐸𝑛𝑒𝑟𝑔𝑦 𝑣𝑎𝑙𝑢𝑒(𝑘𝑐𝑎𝑙/𝑔) = 𝐶𝑎𝑟𝑏𝑜ℎ𝑦𝑑𝑟𝑎𝑡𝑒𝑠×4 + 𝑃𝑟𝑜𝑡𝑒𝑖𝑛𝑠×4 + (𝐿𝑖𝑝𝑖𝑑𝑠×9 ) 2.4. total phenolic content and total antioxidant activity of pasta for the extraction of phenolics, 10 ml of aqueous methanol (70:30 v/v) was added to 1 g of the samples. after 10 min of sonication in an ultrasonic bath (e 60 h model, elma co., germany), the mixture was shaken in a mechanical shaker (wiseshake sho-1d, wertheim, germany) for 15 min at room temperature. at the end of the centrifugation (nf 1200 r, nuve, turkey) of mixture at 8500 g at 4°c for 20 min, supernatants were collected. the total phenolic content and antioxidant activity of the extracts were analyzed in duplicate. total phenolic content (tpc) analyses were carried out by the method of singleton et al. (1998), in which 1 ml of extract is poured into a test tube, after which, 5 ml of 10-fold ital. j. food sci., vol. 31, 2019 113 diluted folin-ciocalteu and 4 ml of na2co3 (7.5%) solutions were added. after 2 h incubation in the dark, the absorbance of the mixtures was measured at 760 nm against a reagent blank and standards using a spectrophotometer (pg-80 uv-vis spectrometer, pg instruments, united kingdom). the results were expressed as milligrams gallic acid equivalent (gae)/100 g wet basis. total antioxidant activity (taa) was measured using the 2.2-diphenyl-1-picrylhydrazyl (dpph) method according to thaipong, et al. (2006). twenty four mg of dpph was dissolved in 100 ml of methanol for prepared as a stock solution and then stored at -20 °c until use. the working dpph solution was prepared by mixing the stock solution with methanol to obtain an absorbance value of 1.1±0.02 at 515 nm. the extracts (150µl) were allowed to react with the working solution (2850 µl) for 24 h in the dark, after which the absorbance of the samples was measured at 515nm. the standard calibration curve was linear between 25 and 800 µm trolox, and the results were expressed in µmol trolox equivalent (te)/100 g wet basis. 2.5. pasta cooking tests 2.5.1 optimum cooking time the optimum cooking time (oct) of the samples was determined according to aacc (2000). briefly, 25 g of pasta was broken into 5 cm constant lengths and added into 300 ml of boiling distilled water. every 30 seconds, a piece of pasta was taken out and squeezed between two glass plates. the oct was defined as the time taken until the white center of the sample disappeared. 2.5.2 cooking loss for the determination of cooking loss, 10 g of pasta was cooked for the oct, after which the sample was rinsed with distilled water in a buhner funnel. cooking loss was measured by evaporating the cooking water and rinsing with water in a hot air oven at 105 °c. the residue was weighed and reported as a percentage of the uncooked pasta sample (tudorica et al., 2002). 2.5.3 water absorption capacity after cooking the 10 g pasta samples at oct, the water absorption capacity (wac) was calculated using the following equation (marti et al., 2013): 𝑊𝐴𝐶(%) = 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑐𝑜𝑜𝑘𝑒𝑑 𝑝𝑎𝑠𝑡𝑎 − 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑢𝑛𝑐𝑜𝑜𝑘𝑒𝑑 𝑝𝑎𝑠𝑡𝑎 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑢𝑛𝑐𝑜𝑜𝑘𝑒𝑑 𝑝𝑎𝑠𝑡𝑎 ×100 2.5.4 swelling index the swelling index (si) of the samples was determined according to the cleary and brennan (2006). twenty-five g of pasta was cooked in 250 ml of boiling distilled water for oct, and then dried at 105°c. the si was expressed as: ital. j. food sci., vol. 31, 2019 114 𝑆𝐼 = 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑐𝑜𝑜𝑘𝑒𝑑 𝑝𝑎𝑠𝑡𝑎 − 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑑𝑟𝑖𝑒𝑑 𝑝𝑎𝑠𝑡𝑎 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑑𝑟𝑖𝑒𝑑 𝑝𝑎𝑠𝑡𝑎 2.6. microstructure of raw pasta the pasta samples were freeze-dried (thermo savant modulyod-230, usa) for 8 h, and the freeze-dried samples were coated with gold. the microstructure of the surface of the raw pasta samples was visualized with scanning electron microscopy (sem) (fei quanta 250 feg, usa). 2.7. color measurement the surface color values of the cooked pasta were measured using a hunter lab miniscan xe colorimeter (hunter associates laboratory, reston, va). l*, a* and b* parameters were recorded, and the changes in color resulting from the addition stfp to the pasta formulation were determined according to a color differential index (∆e) that calculated the following equation; ∆𝐸 = ∆𝐿 ! + ∆𝑎 ! + ∆𝑏 ! where: ∆l* was calculated as l* sample-l*control; ∆a was calculated as a* sample-a* control; ∆b was calculated as b*sample-b*control according to the handbook of colour science (yamauchi, 1989), ∆e values describe visual color differences as follows: (0–0.5, trace difference); (0.5–1.5, slightly discernible; hard to detect with the human eye); (1.5–3.0, noticeable; detectable by trained people); (3.06.0, appreciable; detectable by ordinary people); (6.0–12.0, large; large difference in the same color group); (larger than 12; extreme; another color group). 2.8. sensory evaluation the pasta samples were cooked (100 g of pasta in 1 l of boiling water with 10 g salt) for oct and drained. pasta samples were presented individually on plastic trays to each panelist. the sensory evaluation was made by 44 panelists from pamukkale university, department of food engineering (29 females, 15 males; age range 20–50). the panelists scored each sample for color, odor, taste, texture and overall acceptability on a hedonic scale ranging from 1 (dislike extremely) to 7 (like extremely). the samples were labeled with randomly selected three-digit numerical codes. bread and water were given to the panelists for rinse their palates between samples. the final scores were calculated from the average of the 44 scores (aydin and gocmen, 2011; cardenas-hernandez et al., 2016). 2.9. statistical analysis all experiments were performed in duplicate. statistical analyses were made using spss 22.0 (ibm spss inc., chicago, il, usa) software. a duncan’s multiple range test was used and the levels were considered significantly different at p˂0.05. ital. j. food sci., vol. 31, 2019 115 3. results and discussion 3.1. raw materials the moisture, protein, fat, ash and carbohydrate content, and the energy value, taa, tpc and color values of wheat semolina and stfp are shown in table 2. table 2. nutritional and chemical properties of wheat semolina and stfp. wheat semolina stfp moisture (%) 13.41±0.07 7.61±0.45 protein (%) 10.91±0.02 72.49±0.82 fat (%) 1.79±0.37 14.29±0.74 ash (%) 0.90±0.03 5.03±0.22 carbohydrate (%) 73.00±0.40 0.59±0.31 energy value (kcal/100g) 351.69±1.71 420.92±4.57 total antioxidant activity (µmol te/100g) 2.20±0.10 10.06±0.39 total phenolic content (mg gae/100g) 33.30±0.46 51.22±0.91 hunter color values l* 85.61±0.08 53.33±1.06 a* 0.04±0.03 6.27±0.18 b* 18.45±0.08 27.40±0.52 stfp: smoked trout fillet powder. the moisture value of semolina was determined under the maximum limit (14.5%) of the turkish food codex (2002). in addition, the protein content of semolina was detected above the minimum protein content (10.5%) defined in the turkish food codex (2002). the results reveal that while stfp is a remarkable source of protein and fat, semolina is a good source of carbohydrate. it was determined that the use of fish powder in pasta production enhances the nutritional quality of enriched pasta. additionally, the energy values of semolina and stfp were determined as 351.69 kcal/100g and 420.92 kcal/100g, respectively. stfp has a higher energy value than semolina due to its high protein and fat content. furthermore, stfp demonstrates higher total antioxidant activity and total phenolic content than wheat semolina. the high level of antioxidant activity in the stfp can be attributed to the applied smoking process, in that smoke contains various phenolic compounds (goulas and kontominas, 2005; kjallstrand and petersson, 2001). the color measurement indicated that stfp has higher a* and b* values and lower l* values than wheat semolina. 3.2. proximate composition of samples the proximate composition of the control sample and the enriched samples are presented in table 3. moisture content was increased after the addition of stfp, although all results were found to be under the critical moisture value of 13% identified in turkish standard 1620 (2017). the stfp may have increased the moisture content of the samples due to the water holding capacity of stfp proteins during dough preparation (chin et al., 2012; zayas, 1997). ital. j. food sci., vol. 31, 2019 116 table 3. proximate composition of samples. stfp: smoked trout fillet powder. different superscript letters in columns indicate statistical differences (p˂0.05). the protein, fat and ash content of the samples increased with the addition of stfp. in particular, the protein content of the sample with the addition of 25% stfp was detected to be 1.9 times higher than the control sample due to the high protein content (72.49%) of stfp. the fat content of the control sample and 25% stfp-added sample were detected as 1.70% and 7.88% respectively. the control sample was significantly lower than the 10, 15, 20 and, 25 % stfp-added samples (p˂0.05). the ash content analysis revealed 1.33% ash content for the control sample and 2.29% for the 25% stfp-added sample. the ash content of the 25% and 20% stfp added samples were significantly higher than the rest of the groups (p˂0.05). the statistical analysis revealed that the control and stfp 5% samples were similar in this respect (p˃0.05). the carbohydrate ratio decreased significantly with the addition of stfp, while the energy value increased (p˂0.05). although the energy value was higher, it was not regarded as a negative outcome due to the higher fat and protein contents of the enriched samples. the results of the present study concur with those of liu et al. (2016) and chin et al. (2012). 3.3. total phenolic content and antioxidant activity traditionally, meat, fish and some other foods are subjected to smoking not only to give them a special taste, color and odor, but also to improve shelf life, based on the antioxidant and antibacterial properties of smoke (semanova et al., 2016; soares et al., 2016). the taa and tpc of the samples are shown in table 4. table 4. total antioxidant activity and phenolic content of samples sample total antioxidant activity (µm te/100g) total phenolic content (mg gae/100g) control 1.79±0.29b 35.93±1.75c stfp 5% 4.75±0.88a 36.36±1.90bc stfp 10% 4.76±0.92a 38.77±2.24abc stfp 15% 4.99±0.76a 38.83±0.99abc stfp 20% 5.10±1.11a 40.92±2.43ab stfp 25% 5.12±0.41a 42.21±0.30a stfp: smoked trout fillet powder. different superscript letters in columns indicate statistical differences (p˂0.05). sample moisture (%) protein (%) fat (%) ash (%) carbohydrate (%) energy value (kcal/100g) control 9.44±0.15b 13.87±0.28d 1.70±0.19d 1.33±0.03b 73.66±0.59a 365.39±0.47c stfp 5% 10.12±0.06ab 14.29±0.21d 3.61±0.73cd 1.39±0.17b 70.59±0.41a 371.96±4.08bc stfp 10% 10.32±0.26a 17.97±0.18cd 5.52±0.71bc 1.45±0.20b 64.74±0.96b 380.51±3.27ab stfp 15% 10.06±0.55ab 19.72±2.40bc 5.79±1.54ab 1.56±0.08b 62.87±4.41bc 382.48±5.84ab stfp 20% 10.15±0.18ab 23.27±2.93ab 7.22±0.42ab 2.20±0.04a 57.16±2.73cd 386.69±3.00a stfp 25% 10.44±0.45a 25.76±2.51a 7.88±0.88a 2.29±0.11a 53.63±2.19d 388.40±6.66a ital. j. food sci., vol. 31, 2019 117 taa and tpc were both detected in higher values in the stfp than in the semolina (table 2). so enriched samples had higher taa and tpc values than the control samples. the taa values of the samples ranged between 1.79 µm te/100g and 5.12 µm te/100g. the taa of the control sample was significantly lower than stfp-added samples (p˂0.05). the tpc of the samples increased significantly with the addition of stfp to the pasta formulation (p˂0.05), and it was determined that the tpc of the 25% stfp-added sample was 1.2 times higher than the control sample. previous studies have investigated the effects of smoking processes on certain foods, and similar results have been found. shaiban et al. (2006) investigated the effect of different types of woods used for smoking cheese, and found that smoked cheese showed higher total phenolic content and total antioxidant activity than non-smoked cheese. serot et al. (2004) investigated 10 major phenolic compounds in herring fillets smoked using different methods, and found that the sum of the content of 10 phenolic compounds in smoked fillets was strongly affected by the method used. 3.4. pasta cooking tests cooking characteristics are a strong indicator of pasta quality. the cooking characteristics of the pasta samples are shown in table 5. oct ranged from 9.50 to 11.00 minutes, and compared to the control sample, the oct showed an increasing trend with the addition of stfp. higher optimum cooking times have also been reported in meat-based pasta. kadam and prabhasankar (2012) reported that cooking time increased from 8.5 min (control sample) to 14.0 min with the addition of 30% shrimp meat. cooking time is related to the starch gelatinization and water penetration rate. water enter into the starch granule may be restricted by more complex protein networks, which may cause a delay in the start of the gelatinization process (liu et al., 2016). the swelling index of pasta is an indicator of the water absorbed by the proteins during cooking (gopalakrishnan et al., 2011). increasing the stfp ratio in the formulation caused the water absorption capacity and swelling index to decrease significantly (p˂0.05), which could be related to the lower water absorption capacity of the protein network in stfp than in the gluten network. previous studies into bran-enriched and fish powderenriched pasta have reported similar decreases in water absorption capacity and swelling index (aravind et al., 2012; desai et al., 2018; gatta et al., 2017). petitot et al. (2010) determined that pasta samples made with split pea flour and faba bean flour had lower water absorption capacities than the control samples. in contrast, baskaran et al. (2011) reported that pasta enriched with skimmed milk powder and whey protein concentrate had higher swelling index values than the control sample. table 5. cooking characteristics of the control and stfp-enriched pastas. sample optimum cooking time (min) water absorption capacity (%) cooking loss (%) swelling index control 9.50±0.01d 208.32±1.62a 5.87±0.04b 2.74±0.03a stfp 5% 9.75±0.35cd 204.76±3.21ab 7.50±0.01a 2.72±0.05a stfp 10% 10.00±0.01bcd 197.48±5.08bc 7.57±0.23a 2.62±0.07ab stfp 15% 10.50±0.71abc 197.80±2.84bc 7.82±0.69a 2.63±0.01ab stfp 20% 10.75±0.35ab 190.20±1.65cd 8.15±0.50a 2.55±0.04b stfp 25% 11.00±0.01a 182.85±2.53d 8.42±0.15a 2.51±0.08b stfp: smoked trout fillet powder. different superscript letters in columns indicate statistical differences (p˂0.05). ital. j. food sci., vol. 31, 2019 118 cooking loss is defined as the amount of solids lost into the cooking water of a sample cooked for oct (sozer et al., 2007). an analysis identified statistically similar levels of cooking loss in the enriched samples (p˃0.05), while the control sample was significantly different (p˂0.05). increasing the stfp ratio in the pasta formulation increases the level of cooking loss of the samples. the cooking loss values of the samples ranged between 5.87% and 8.42% all of which fall under the acceptable limit of 9% (aacc, 2000). an increase in the proportion of stfp in the formulation results in a decrease in the amount of semolinabased components, such as gluten, in pasta, which leads to a weakening of the gluten network. similarly, some studies on the enrichment of pasta with various ingredients have also shown an increase in the level of cooking loss (aravind et al., 2012; gallegosinfante et al., 2010; islas-rubio et al., 2014; sant’anna et al., 2014). the supplementation of different non-gluten flours in pasta formulation has been reported to dilute the gluten strength and weaken the pasta structure, which may increase the level of dry matter lost into the cooking water (gallegos-infante et al., 2010). in addition, it was stated that pasta had low cooking loss when dried at high temperature. pasqualone et al. (2016) reported that when a high-temperature drying program was adopted, cooking losses were ranged from 3.2 to 4.8 % in control pasta and in pasta samples enriched of lyophilized tomato matrix or with durum wheat bran extracts produced by supercritical carbon dioxide or ultrasound. 3.5. microstructure of raw samples sem images demonstrate the arrangement of the gluten network and starch in pasta (rajeswari et al., 2013). the surface microstructure of raw pasta samples is illustrated in fig 1. images of the control pasta sample show numerous starch granules that appear to vary in both size and shape (fig. 1a). the outer surface of the pasta appears to be coated with a thin protein film (fig. 1a), which has also been reported in previous studies (pasqualone et al., 2016; alireza sadeghi and bhagya, 2008; cunin et al., 1995). as dried pasta has a very limited water system, the starch and protein compete strongly for water during cooking. the less protein surrounding the starch granules, causes the faster starch swelling and gelatinization. (de noni and pagani, 2010).with the addition of stfp to the pasta formulation, the protein matrix around the starch molecules enhances, and the starch molecules are coated with a thicker protein network by the increase of stfp addition ratio (fig. 1b, 1c, 1d, 1e, 1f)., as also observed by alireza sadeghi and bhagya, (2008) and liu et al., (2016).this phenomenon also explained the extension of cooking time by the increasing addition ratio of stfp. 3.6. color measurement the color of pasta is very important quality parameter in terms of consumer preferences (carini et al., 2009). the color parameters of the enriched and control samples are shown in table 6. it can be noted that the l* value (lightness) decreases with the increasing supplementation levels of stfp. the l* values of the control and the 5% stfp-added sample were statically similar (p˃0.05), and significantly higher than the other enriched samples (p˂0.05). pasta samples enriched with stfp had a significantly higher a*(redness) and b*(yellowness) values than the control sample (p˂0.05). overall, the color values indicate that enriched samples have more redness (a*) and more yellowness (b*), but less lightness (l*) values than the control sample. the changes in color were found to be related to the original color of the stfp and the semolina (table 2). ital. j. food sci., vol. 31, 2019 119 a b c d e f figure 1. surface sem images of (a) control pasta, (b) 5% stfp pasta, (c) 10% stfp pasta, (d) 15% stfp pasta, (e) 20% stfp pasta, (f) 25 % stfp pasta. s: starch granules, p: protein network. magnification 2500x. these results were in close agreement with kadam and prabhasankar (2012), aydin and gocmen (2011), alireza sadeghi and bhagya (2008), who reported that samples supplemented with oat flour, shrimp meat and mustard protein isolate had lower l values and higher a and b values than the control sample due to the darker color of the enrichment materials than semolina. p s p s s s p p s p s p s p s p s s p p , p s s p p ital. j. food sci., vol. 31, 2019 120 the color differential index (∆e) was indicated the color changes between the control sample and the enriched samples. the ∆e values of the samples was increased with the addition of stfp to the pasta formulation. according to the handbook of colour science, 10%, 15% and, 20% stfp-added samples can be classified as “large difference in the same color group”, while the classification of the 5% stfp-added sample and the 25% stfpadded sample were “appreciable; detectable by ordinary people” and “extreme, another color” respectively. desai et al., (2018) reported that the incorporation of fish powder into pasta increased ∆e values, while khan et al. (2014) investigated the color changes in sorghum flour-enriched pasta, stating that all the ∆e values of the cooked enriched samples were greater than 12, being classified as “extreme, another color” by yamauchi (1989) in the handbook of colour science. table 6. color parameters of cooked pasta samples. sample l* a* b* ∆e control 68.01±0.45a -3.06±0.02f 14.81±1.10e stfp 5% 67.00±0,34a -2.30±0.10e 18.63±0.01d 4.04±1.05d stfp 10% 65.79±0.47b -1.55±0.10d 20.62±0.33c 6.40±0.66c stfp 15% 64.49±0.52c -0.42±0.27c 22.76±0.64b 9.09±0.30b stfp 20% 62.84±0.59d 0.45±0.13b 24.26±0.95ab 11.32±0.01a stfp 25% 61.87±0.35d 1.24±0.11a 25.25±0.66a 12.85±0.45a stfp: smoked trout fillet powder. different superscript letters in columns indicate statistical differences (p˂0.05). 3.7. sensory evaluation the sensory properties of the samples were evaluated based on color, odor, taste, texture and overall acceptability, and the results are shown in table 7. the control sample and the 5% stfp-enriched samples were found to be statistically similar in all parameters (p˃0.05). table 7. sensory properties of control and smoked trout fillet powder enriched pastas. sample color odor taste texture overall acceptability control 4.84±0.21a 4.86±0.22a 4.78±0.34a 5.01±0.31a 4.90±0.25a stfp 5% 4.98±0.03a 4.88±0.23a 4.77±0.27a 5.00±0.11a 4.86±0.26a stfp 10% 4.75±0.11a 4.50±0.06b 4.36±0.21ab 4.34±0.23ab 4.38±0.23ab stfp 15% 4.84±0.18a 4.17±0.01c 3.94±0.33bc 4.25±0.41ab 4.00±0.30bc stfp 20% 4.77±0.08a 4.19±0.03c 3.46±0.18c 3.84±0.23b 3.63±0.12c stfp 25% 4.48±0.44a 3.90±0.03d 3.48±0.08c 3.73±0.57b 3.56±0.33c stfp: smoked trout fillet powder. different superscript letters in columns indicate statistical differences (p˂0.05). no difference was identified between the color values of all samples (p˃0.05), while odor and taste values decreased significantly with the addition of stfp (p˂0.05). some of the panelists reported an excessive fish odor and taste in the 20% and 25% stfp-added ital. j. food sci., vol. 31, 2019 121 samples, and a decrease in texture values was detected with stfp supplementation. during cooking, it was observed that especially the 20% and 25% stfp-added pastas had a tendency to rupture, and the panelists also pointed out that these pastas were very easily ruptured. the addition of stfp, which causes gluten reduction and a weakening of the gluten network, might reduce the resistance of the pasta. it was determined that the overall acceptability values of all the samples scored above 3.5, which the midpoint in a 7point hedonic scale. this study follows on from the research by chin et al. (2012), who reported that the color, taste and overall acceptability scores of noodles decreased with the addition of surimi powder. on the other hand kadam and prabhasankar (2012), when supplementing pasta with shrimp meat, found from a sensory analyses that the addition of 20% shrimp meat had the best result in the overall score. liu et al. (2016) enriched pasta with beef emulsion, and the overall preference scores showed that a 30% beef emulsion-added sample was statically similar to a commercial pasta sample. 4. conclusions the consumption of fish is known to have many benefits to human health. it can be added to various foods as a good source of enrichment, due mainly to its high protein content. fish meat is considered to be a good source of enrichment for pasta. in the present study, it was determined that the addition of stfp increased the nutritional value of pasta, and also increased the antioxidant activity and phenolic content. the cooking analysis showed that the addition of stfp increased oct and cooking loss, and decreased wac and swelling index. as can be observed from the sem images, the addition of stfp to the pasta formulation leads to an increased protein matrix around the starch molecules. an increased l* value, and decreased a* and b* values have been found in the enriched-stfp samples due to the darker color of stfp than semolina. the sensory analysis revealed overall acceptability scores of all samples above 3.5, although the 20% and 25% stfpadded samples were reported by the panelists to have an excessive taste and odor of fish. the 20% and 25% stfp-added samples were also noted to rupture during cooking. it was determined that the addition of 15% stfp enhanced the nutritional value of pasta, and also had acceptable cooking quality and sensory characteristics. therefore, it can be concluded that fish pieces (production waste material) can be thought as pasta enrichment ingredients in case they are used in the mentioned concentration. acknowledgements this work was funded by pamukkale university, unit of scientific research projects, turkey (project no: 2014fbe052). references aacc. 2000. "approved methods of the american association of cereal chemists", inc. st. paul. minnesota. alireza sadeghi m. and bhagya s. 2008. quality characterization of pasta enriched with mustard protein isolate. j. food sci. 73(5):229-237. aoac. 1990. "official methods of analysis" 15th ed. association of official analytical. chemists, washington, dc. aravind n., sissons m.j., fellows c.m., blazek j. and gilbert e.p. 2012. effect of inulin soluble dietary fibre addition on technological, sensory, and structural properties of durum wheat spaghetti. food chem. 132(2):993-1002. ital. j. food sci., vol. 31, 2019 122 aydin e. and gocmen d. 2011. cooking quality and sensorial properties of noodle supplemented with oat flour. food sci. biotechnol. 20(2):507-511. baskaran d., muthupandian k., gnanalakshmi k.s., pugazenthi t.r. and jothylingam s. 2011. physical properties of noodles enriched with whey protein concentrate (wpc) and skim milk powder (smp). j. stored prod. postharvest res. 2(6):127-130. beleggia r., platani c., papa r., di chio a., barros e., mashaba c., wirth j., fammartino a., sautter c., conner s., rauscher j., stewart j. and cattivelli l. 2011. metabolomics and food processing: from semolina to pasta. j. agric. food chem. 59(17):9366-9377. carini e., vittadini e., curti e. and antoniazzi f. 2009. effects of different shaping modes on physico-chemical properties and water status of fresh pasta. j. food eng. 93(4):400–406. chin c.k., huda n. and yang t.a. 2012. incorporation of surimi powder in wet yellow noodles and its effects on the physicochemical and sensory properties. int. food res. j. 19(2):701–707. cleary l. and brennan c. 2006. the influence of a (1 � 3)(1 � 4)-β-d-glucan rich fraction from barley on the physicochemical properties and in vitro reducing sugars release of durum wheat pasta. int. j. food sci. technol. 41(8):910-918. cunin c., handschin s., walther p. and escher f. 1995. structural changes of starch during cooking of durum wheat pasta. lwt food sci. technol. 28(3):323-328. desai a., brennan m.a. and brennan c.s. 2018. the effect of semolina replacement with protein powder from fish (pseudophycis bachus) on the physicochemical characteristics of pasta. lwt food sci. technol. 89:52-57. doi: doi.org/10.1016/j.lwt.2017.10.023 de noni i. and pagani m.a. 2010. cooking properties and heat damage of dries pasta as influenced by raw material characterictics and processing conditions. crit. rev. food sci. nutr.50(5):465-472. fradique m., batista a.p., nunes m.c., gouveia l., bandarra n.m. and raymundo a. 2013. isochrysis galbana and diacronema vlkianum biomass incorporation in pasta products as pufa’s source. lwtfood sci. technol. 50:312-319. gallegos-infante j.a., rocha-guzman n.e., gonzalez-laredo r.f., ochoa-martinez l.a., corzo n., bello-perez l.a. and peralta-alvarez l.e. 2010. quality of spaghetti pasta containing mexican common bean flour (phaseolus vulgaris l.). food chem. 119(4):1544-1549. doi: doi.org/10.1016/j.foodchem.2009.09.040 gatta b., rutigliano m., padalino l., conte a., alessandro m., nobile d. and luccia a. di. 2017. the role of hydration on the cooking quality of bran-enriched pasta. lwt food sci. technol. 84:489-496. goes e.s. dos r., souza m.l.r. de, michka j.m.g., kimura k.s., lara j.a.f. de, delbem a.c.b. and gasparino e. 2016. fresh pasta enrichment with protein concentrate of tilapia: nutritional and sensory characteristics. food sci. technol. 36(1):76-82. gopalakrishnan j., menon r., padmaja g., sajeev m.s. and moorthy s.n. 2011. nutritional and functional characteristics of protein-fortified pasta from sweet potato. food nutr. sci. 2(9):944–955. goulas a.e. and kontominas m.g. 2005. effect of salting and smoking-method on the keeping quality of chub mackerel (scomber japonicus): biochemical and sensory attributes. food chem. 93:511-520. islas-rubio a.r., calderón de la barca a.m., cabrera-chávez f., cota-gastélum a.g. and beta t. 2014. effect of semolina replacement with a raw: popped amaranth flour blend on cooking quality and texture of pasta. lwt food sci. technol. 57(1):217–222. doi: doi.org/10.1016/j.lwt.2014.01.014 kadam s.u. and prabhasankar p. 2012. evaluation of cooking, microstructure, texture and sensory quality characteristics of shrimp meat-based pasta. j. texture stud. 43(4):268-274. doi: doi.org/10.1111/j.1745-4603.2011.00336.x kaur g., sharma s., nagi h.p.s. and ranote p.s. 2013. enrichment of pasta with different plant proteins. j. food sci. technol. 50(5):1000-1005. khan i., yousif a.m., johnson s.k. and gamlath s. 2014. effect of sorghum flour addition on in vitro starch digestibility, cooking quality, and consumer acceptability of durum wheat pasta. j. food sci. 79(8):1560-1567. kjallstrand j. and petersson g. 2001. phenolic antioxidants in alder smoke during industrial meat curing. food chem. 74:85-89. ital. j. food sci., vol. 31, 2019 123 lakshmi devi n., aparna k. and kalpana k. 2013. utilization of fish mince in formulation and development of pasta products. int. food res. j. 20(1):219-224. lingbeck j.m., cordero p., bryan c.a.o., johnson m.g., ricke s.c. and crandall p.g. 2014. functionality of liquid smoke as an all-natural antimicrobial in food preservation. meat sci. 97(2):197-206. liu t., hamid n., kantono k., pereira l., farouk m.m. and knowles s.o. 2016. effects of meat addition on pasta structure, nutrition and in vitro digestibility. food chem. 213:108-114. marti a., caramanico r., bottega g. and pagani m.a. 2013. cooking behavior of rice pasta: effect of thermal treatments and extrusion conditions. lwt food sci. technol. 54(1):229-235. mercier s., villeneuve s., mondor m. and des marchais l.p. 2011. evolution of porosity, shrinkage and density of pasta fortified with pea protein concentrate during drying. lwt food sci. technol. 44(4):883-890. pasqualone a., gambacorta g., summo c., caponio f., di miceli g., flagella z., marrese p.p., piro g., perrotta c., de bellis l. and lenucci m.s. 2016. functional, textural and sensory properties of dry pasta supplemented with lyophilized tomato matrix or with durum wheat bran extracts produced by supercritical carbon dioxide or ultrasound. food chem. 213:545-553. petitot m., boyer l., minier c. and micard v. 2010. fortification of pasta with split pea and faba bean flours: pasta processing and quality evaluation. food res. int. 43(2):634-641. rajeswari g., susanna s., prabhasankar p. and venkateswara rao g. 2013. influence of onion powder and its hydrocolloid blends on pasta dough, pasting, microstructure, cooking and sensory characteristics. food biosci. 4:13-20. sant’anna v., christiano f.d.p., marczak l.d.f., tessaro i.c. and thys r.c.s. 2014. the effect of the incorporation of grape marc powder in fettuccini pasta properties. lwt food sci. technol. 58(2):497-501. savita s., arshwinder k., gurkirat k. and vikas n. 2013. influence of different protein sources on cooking and sensory quality of pasta. int. j. eng. res. appl. 3(2):1757-1763. semanová j., skláršová b., šimon p. and šimko p. 2016. elimination of polycyclic aromatic hydrocarbons from smoked sausages by migration into polyethylene packaging. food chem. 201:1-6. sérot t., baron r., knockaert c. and vallet j.l. 2004. effect of smoking processes on the contents of 10 major phenolic compounds in smoked fillets of herring (cuplea harengus). food chem. 85(1):111-120. shaiban m., al.mamary m. and al-habori m. 2006. total antioxidant activity and total phenolic contents in yemeni smoked cheese. malays. j. nutr. 12(1):87-92. shea f. and watts c.e. 1939. dumas method for organic nitrogen. ind. eng. chem. anal. ed. 11(6):333-334. singleton v.l., orthofer r. and lamuela-raventós r.m. 1998. analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. methods enzymol. 299:152-178. soares j.m., da silva p.f., puton b.m.s., brustolin a.p., cansian r.l., dallago r.m. and valduga e. 2016. antimicrobial and antioxidant activity of liquid smoke and its potential application to bacon. innov. food sci. emerg. technol. 38:189197. souci s., fachmann w. and kraut h. 2000. "food composition and nutrition tables"6th ed. medpharm scientific publication, crc press, stutgart. sozer n., dalgic a.c. and kaya a. 2007. thermal, textural and cooking properties of spaghetti enriched with resistant starch. j. food eng. 81(2):476-484. thaipong k., boonprakob u., crosby k., cisneros-zevallos l. and hawkins byrne d. 2006. comparison of abts, dpph, frap, and orac assays for estimating antioxidant activity from guava fruit extracts. j. food compos. anal. 19(67):669–675. tudoricǎ c.m., kuri v. and brennan, c.s. 2002. nutritional and physicochemical characteristics of dietary fiber enriched pasta. j. agric. food chem. 50(2):347-356. turkish food codex, 2002. legislation of semolina (no.2002/21), the ministry of agriculture and rural affairs, official gazettee, no:24686, ankara, turkey. turkish standard, 2017. macaroni, ts 1620, turkish standards institution, ankara. ital. j. food sci., vol. 31, 2019 124 wojtowicz a. and moscicki l. 2014. influence of legume type and addition level on quality characteristics, texture and microstructure of enriched precooked pasta. lwt food sci. technol. 59(2p1):1175-1185. wood j.a. 2009. texture, processing and organoleptic properties of chickpea-fortified spaghetti with insights to the underlying mechanisms of traditional durum pasta quality. j. cereal sci. 49(1):128-133. yamauchi, j. 1989. "handbook of colour science". japanese academy of colour science. tokyo, japan. zayas j.f. 1997. "functionality of proteins in food", springer, berlin, heidelberg. zhao y.h., manthey f.a., chang s.k.c., hou h.j. and yuan s.h. 2005. quality characteristics of spaghetti as affected by green and yellow pea , lentil , and chickpea flours. sens. nutr. qual. food 70(6):371-376. doi: doi.org/10.1111/j.1365-2621.2005.tb11458.x. paper received may 11, 2018 accepted august 29, 2018 ijfs#1313_bozza ital. j. food sci., vol. 31, 2019 401 paper imaging, sensory properties and fatty acid composition of parma ham and “nero di parma ham” g. pastorelli*1, s. panseri1, g. curone1, a. zanon3 and m. di giancamillo1 1department of veterinary medicine, università di milano, italy 2department of veterinary sciences and technologies for food safety, università di milano, italy 3dvm freelancer *corresponding author: grazia.pastorelli@unimi.it abstract this paper provides preliminary results on “nero di parma” ham analysing fatty acid composition from fat and muscle tissues in three locations. computerized tomography (ct) and sensory characteristics were also performed. the same measurements were investigated in parma ham too. significant differences in terms of saturated and monounsaturated fatty acids composition were observed between hams resulting lower and higher in “nero di parma” ham than parma ham respectively. results detected by ct showed an inverse ratio of fat and muscle between the hams. “nero di parma” ham highlighted some descriptors such as oiliness, brightness, redness significantly different from parma useful to define the sensory profile of a typical product, which had never been tested. keywords: fatty acids, “nero di parma ham”, parma ham, sensory profile ital. j. food sci., vol. 31, 2019 402 1. introduction dry curing is a common way to preserve pork in some mediterranean countries. in italy, parma ham is the main consortium for the production of dry cured ham labeled with protected designation of origin (pdo), processing over 8 million thighs (data referred to 2017). parma ham represents a product of great economic value covering about half of the trading value of carcasses from italian heavy pigs. in addition, new interest is now addressed to the health promoting characteristics of parma ham and therefore, the fatty acid composition of its lipids is important to relate the profile to medical guidelines. alongside the intensive pig farming conducted according to criteria of industrialization, an attractive production related to tradition is emerging. it concerns native breeds that are characterised by peculiar traits low input rearing conditions and suitable high quality food products. in the present work “nero di parma” breed has been considered. it is a modern recreation of the ancient nera parmigiana breed, which significantly declined almost to the point of extinction. however, selection programs are being designed to reintroduce the “nero di parma” pig breeding tradition; with the dm 11781 of 20 may 2016 the “nero di parma” pig obtained the recognition of the breed. animals are fed fresh grass, corn, barley and wheat, as well as broad beans, berries, roots and acorns. the characteristics of the meat of “nero di parma” are linked to the presence of intramuscular fat due to the ability to accumulate subcutaneous fat between the muscle fibers compared to the white breeds such as the large white and landrace and their crossings. fat plays an important role in the development of the chemical and sensorial characteristics of cured meat products (ventanas et al., 2007; jimenez-colmenero et al., 2010). moreover, much attention is being paid to fatty acid profile in animal products because of its effects on consumers’ health (wood and enser, 1997). scientific evidence (who, 2003) and nutritional guidelines recommend a reduction in total fat intake, particularly of saturated fatty acids (sfa), which are associated with an increased risk of obesity, hypercholesterolaemia and some cancers (wood et al., 2004), while a high intake of monounsaturated and n-3 polyunsaturated fatty acids has been shown to have an inverse effect (ganji et al., 2003). however, there are few data on “nero di parma” pigs in terms of meat quality and those related to seasoned ham to the best of our knowledge are missing. the aim of paper is to provide preliminary results on some qualitative parameters of the “nero di parma” ham by evaluating fatty acid composition in fat and muscle in three locations (initial part, central and the final part of the ham), the structure of the ham through the computerized tomography (ct), sensory characteristics and measuring the same parameters in parma ham. 2. material and methods 2.1. sampling a total of 6 raw cured hams, 3 “nero di parma” hams and 3 parma (pdo) were provided by a local producer, within the same factory in order to ensure the same production technology. the two types of hams had different ripening maturation times: 30 and 24 months respectively. the choice depended on the high fat (either fat coverage either as intermuscular fat) of “nero di parma” that requires longer times of ripening. therefore “nero di parma” ham is marketed at 30 months, and parma ham at 24 months. before starting chemical analysis, on the whole ham the spiral multi slice ct was carried out; subsequently the hams were sliced and used for sensory analysis. during the sensory ital. j. food sci., vol. 31, 2019 403 analysis whole slices (including muscle and external fat) at three different locations (initial, central and final part) were sampled according to fig. 1. samples were vacuum-packaged and stored at -20ºc for 2 weeks until subsequent chemical analysis. figure 1. sampling location. section 1 corresponds to initial part; section 2 corresponds to central part; section 3: corresponds to final part 2.2. fatty acid analysis lipid extraction was conducted using chloroform: methanol (2:1) according to the method of folch et al. (1957). lipids were extracted from each sample of the muscle, and from each sample of trimmed adipose tissue. the extracts were dried under vacuum on a rotary evaporator (laborota 4000, heidolph instruments, milan, italy). fatty acid composition was measured after methylation of the samples. fatty acid methyl esters were prepared with boron trifluoride methanol according to procedures developed by morrison and smith (1964). the methyl esters were separated on a carlo erba instruments chromatograph (gc 6000 vega series 2) equipped with fused silica gel capillary column (0.25 mm i.d.25 m) having a 0.2-mm internal coating of cyanopropyl siloxane (cp-sil 88, chrompack). the furnace temperature was 180°c, and injector and detector temperatures were 240°c. for all samples, retention times and peak areas were determined by chromatography (nelson analytical, manchester, nh). the identities of the peaks were verified by comparison with the retention times of standard fatty acid methyl esters. the results were expressed as the percentage of the total fatty acid composition. all the analyses were carried out in duplicate. atherogenicity (ai) and thrombogenicity (ti) indices (ulbricht and southgate 1991), which characterize the potential proneness to atherosclerosis and thrombosis in humans were used to assess dietetic values of ham. in detail ia indicates the relationship between the sum of the main saturated fatty acids and that of the main classes of unsaturated; the former being considered pro-atherogenic (favoring the adhesion of lipids to cells of the immunological and circulatory system), and the latter anti atherogenic (inhibiting the aggregation of plaque and diminishing the levels ital. j. food sci., vol. 31, 2019 404 of esterified fatty acid, cholesterol, and phospholipids, by preventing the appearance of micro and macro coronary diseases). index of thrombogenicity is defined as the relationship between the pro-thrombogenetic (saturated) and the anti-thrombogenetic fatty acids (mufas, pufas – n6 and pufas – n3). 2.3. sensory analysis eleven trained assessors belonging to onas (national organization salumi taster) undertook the sensory analysis on 2-mm slices of ham. the choice of descriptors was decided by open discussion in two preliminary sessions. twenty sensory descriptors covering appearance (redness, whiteness, marbling, oiliness, brightness), odor (aged, fresh pork meat, rancid, mold), taste (sweetness, saltiness, bitter), flavor (aged, fresh pork meat, rancid, butter, fresh fat), texture (fibrousness, dryness, firmness) were chosen. a 9-point scale was used, where 0 meant absence and 9 meant maximum intensity of the descriptor. the sensory evaluation was repeated in three sessions carried out on three different days (en iso 13299, 2010). each member of the panel assessed two types of hams in each session. slices of ham samples were coded with three random numbers and were presented to the members according to macfie et al. (1989). 2.4. computed axial tomography hams were submitted to 16-slices ct scanner (brightspeed® ge medical systems italia s.p.a., milan, italy) applying the following protocol: tube voltage 110 kvp, x-ray tube current 200 ma, revolution time 1, slice thickness 1.25 mm, spiral pitch factors 0.9375, convolution kernel standard, rows and columns 512x512. all images were transferred to the picture archiving and communication system (mypacs – md saronno italy), processed with a certified medical software (osirixpro® 64 bit, aycan medical systems) and reconstructed using smoothing and edge enhancement algorithms in all the three spatial transverse planes. the program can differentiate the fat from the lean as a consequence of the significant difference in hounsfield units (hu) existing between the two tissues (negative values for fat and positive for lean). hounsfield units (also named ct numbers) express the x-ray attenuation of the tissues, which is a measure of its density in a given region of interest (roi). in each slice, a roi based on the density of the tissues examined (fat or lean) was selected in order to obtain the hu surface area values. therefore, the “compute volume” function of the software was used to calculate the volume. 2.5. statistical analysis the ham was the experimental unit for statistical analysis. data were analyzed by means of variance analysis including typology (parma and “nero di parma”), tissue (muscle and fat) and location (initial, central and distal part), as main effect. newman-keuls test was used to assess differences between means. the sensory data for each attribute were submitted to three-way anova with typology, judges, replicates and their interaction as effects. the significance of these effects was tested with the f-test and the comparison between mean values was tested with t student. differences with probability levels of p<0.05 were considered significant. effects were deemed significant at p<0.05, and a trend was noted when p<0.10. statistical analyses of the data were performed using spss software (spss inc., chicago, il) ital. j. food sci., vol. 31, 2019 405 3. results and discussion pig farming plays a key role within animal production, particularly in north italy where about 70% of the italian pig production is located. the main strength factor of the italian pig industry is represented by the top quality of its production labeled with the pdo (protected designation of origin) or pgi (protected geographical indication) marks. they represent an important market value and must continuously be monitored from a qualitative point of view. fat and fatty acids, whether in adipose tissue or muscle, contribute importantly to various aspects of meat quality and are central to meat nutritional value (wood et al., 2008). it is generally assumed that intramuscular fat (imf) content positively influences sensory quality traits, including flavor, juiciness and tenderness of meat, whereas a low amount of fat results in a less tasty meat (tous et al., 2013). it is well known that traditional breeds are fattier than industrial ones. generally, they have more adipose tissue thickness and more intramuscular fat (gandemer, 2009). drycured ham from conventionally reared modern breeds of pigs compared to dry-cured ham from iberian pigs had lower levels of saturated fatty acids (sfa) and polyunsaturated fatty acids (pufa) (jiménez-colmenero et al., 2010). the fa composition of dry-cured hams is due to many factors, such as genetic features and differences in the rearing and feeding systems. results of fernández et al. (2015) for fatty acid composition of analyzed samples of spanish dry cured ham showed approximate mean percentages of sfa and monounsaturated fatty acid (mufa) of about 43% of the total fa, and 13.87% of pufa. in a study conducted by bermúdez et al. (2012) on the effect of the inclusion of chestnut in the finishing diet (from three different diets: concentrate, mixed and chestnut) on fatty acid profile of dry-cured celta the percentage of sfa (35 %) pufa (13%) and mufa (51%) in mixed diet were similar to those found herein. in the present study the most abundant fatty acids in both types were monounsaturated fatty acids (mufa) (mainly c18:1 c-n9) followed by sfa and finally polyunsaturated fatty acids. the different typology caused some changes in the fatty acid composition of dry-cured ham (table 1). in particular, “nero di parma” ham showed a significant lower sfa content and higher mufa than parma ham as a direct consequence of the high oleic acid content of acorns as reported in iberian pigs (ruiz et al., 1998; ruiz-carrascal et al., 2000). numerically, the values of oleic acid in “nero di parma” agree with those found in spanish ham (perez-palacios, 2010). moreover, campo and sierra (2011) monitored different varieties of spanish dry cured ham produced from the same company in two years (19952007). the oleic acid (c18: 1n9) levels found overlap those found in “nero di parma” ham in the present work. the levels found in this study are lower but not too far from those of fernández et al. (2007) who found approximately 49% of c18:1 n-9, considered a healthy product in a diet. moreover, the oleic acid content of “nero di parma” ham agrees with values coming from pigs of parma dop circuit fed with 6% sunflower oil in which a significant increase of oleic acid in the treated group was found (bosi et al., 2000). “nero di parma” ham compared to parma showed a significantly lower content of both stearic acid (c18: 0) and myristic acid (c14: 0). moreover, the content of total n-3 pufa and particularly α-linolenic acid (ala, c18:3n-3) was greater (p<0.05) in “nero di parma” than parma dry cured ham. this is likely due to the different rearing system, which characterize the two typologies. according to muriel et al. (2002), free-range rearing and feeding pigs on pasture increase the levels of long chain n 3 fatty acids in porcine muscles which is in agreement with the present results. ital. j. food sci., vol. 31, 2019 406 table 1. effects of typology (parma ham and “nero di parma ham”) on fatty acid composition of muscle and adipose tissue of dry-cured ham. muscle tissue fat tissue p value1 parma “nero di parma parma “nero di parma” t2 typ3 tex x typ c14:0 1.07±0.17 0.87±0.2 1.17±0.36 0.92±0.3 ns * ns c16:0 24.00±0.87 23.40±0.86 24.01±0.85 24.03±2.4 ns ns ns c16:1n7 2.42±0.81 2.37±0.77 2.00±0.81 2.24±0.59 ns ns ns c17:0 0.16±0.53 0.15±0.48 0.15±0.44 0.17±0.39 ns ns ns c17:1 0.12±0.04 0.15±0.03 0.13±0.04 0.15±0.02 ns ns ns c18:0 11.00±0.95 9.15±1.26 11.23±1.40 9.53±1.37 ns *** ns c18:1n9 44.40±2.01 47.40±2.87 44.96±2.43 46.5±4.02 ns *** ns c18:2n6 10.38±0.83 9.90±2.27 11.11±1.12 10.74±1.40 ns ns ns c20:0 0.08±0.01 0. 08±0.03 0.07±0.04 0.10±0.02 ns ns ns c18:3n3 0.32±0.10 0.42±0.10 0.38±0.08 0.48±0.06 ** *** ns c20:1n9 0.64±0.10 0.71±0.15 0.60±0.12 0.68±0.20 ns ns ns c20:2n6 0.37±0.06 0.34±0.06 0.39±0.10 0.35±0.10 ns ns ns c20:3n3 0.02±0.02 0.03±0.01 0.03±0.03 0.04±0.03 ns ns ns c20:3n6 0.07±0.06 0.06±0.03 0.05±0.08 0.03±0.02 ns ns ns c20:4n6 0.48±0.25 0.58±0.44 0.10±0.17 0.11±0.07 *** ns ns c23:0 0.23±0.21 0.15±0.14 0.04±0.05 0.13±0.30 ns ns ns sfa 36.58±1.34 33.82±1.78 36.74±1.52 34.89±3.74 ns *** ns mufa 51.77±1.56 54.85±2.94 51.18±2.03 53.83±3.75 ** *** ns pufa 11.65±0.95 11.32±2.77 12.07±1.39 11.77±1.55 ns ns ns n-6 pufa 10.94±0.93 10.53±2.65 11.27±1.30 10.89±1.47 ns ns ns n-3 pufa 0.35±0.11 0.44±0.11 0.41±0.10 0.52±0.07 † *** ns 2t= tissue; 3 typ: tipology; probability (*) statistical significance at p<0.05, (**) statistical significance at p<0.01, (***) statistical significance at p<0.001, (†) = p<0.10 previous studies conducted in heavy pigs (pastorelli et al., 2003) (160±10 kg of bw) and in light pigs (santos et al., 2008) showed that the fatty acid composition of dry cured ham depends on the dietary fatty acid composition. both studies observed an increase in ala content in dry-cured ham obtained from pigs fed diets enriched in n-3 pufa. the increase of linolenic acid and monounsaturated fatty acids content, in “nero di parma ham” is certainly positive considering the indications provided by human diet for the important role of monounsaturated fatty acids and fatty acids of the omega 3 series. a trend was noted for n-3 pufa in the two tissues analysed (table 1). as far as linolenic acid is concerned, the content is higher in adipose tissue than in muscle (0.43 vs 0.37), according to musella et al. (2009) and as expected. in contrast, eicosapentaenoic acid (epa) and docosapentaenoic acid (dpa) are preferentially stored in the organs or muscle rather than in the adipose tissue. in the present work, these fatty acids have not been quantified. no significant effect has been found for tissue x typology. typology did not affect (p>0.05) linoleic acid (c18:2n6) in any of analysed tissue. regarding the curing process of meat and in order to obtain adequate fat quality, adipose tissue should contain no more than 12% of c18:2n-6 and exceed 12% of c18:0 (mourot and hermier, 2001). adipose tissues studied in the present research were within those ranges. ital. j. food sci., vol. 31, 2019 407 the nature and proportion of individual fatty acids, especially sfa to pufa, is important in assessing the quality and nutritional value of fats. the proportions of these fatty acid groups have been used to calculate the very important risk factors for atherogenic index (ai) and thrombogenic index (ti). a lower ai value indicates a lower proportion of saturated to unsaturated acids, which reduces ability of endothelium of blood vessels to attach lipids and plaque formation. the ti at its lower index indicates a lower risk of occurrence of disturbance of the blood coagulation process and blood clotting. both these indices in the present study were at an appropriate low level in both typologies of ham, close to that observed in wild boar meat (razmaite et al., 2012). both ai (0.42 vs 0.45) and ti (1.00 vs 1.20) indices were significantly lower in “nero di parma” ham than parma ham. our results are consistent with those obtained by cebulska et al. (2018), who reported an average value of 0.40 and 1.07 for ai and ti respectively in pork meat originating from pigs of polish native pure breeds. a significant reduction of the nutritional indexes has been reported in cow’s milk (caroprese et al., 2010), ewe’s milk (cieslak et al., 2010; caroprese et al., 2011), and rabbit meat (peiretti and meineri, 2010) after linseed feeding. cieslak et al. (2010) showed reduction of the atherogenic index from 1.4 to 0.5 and thrombogenic index from 0.8 to 0.4. okrouhlá et al. (2013) reported a thrombogenic index (1.33 and 1.28 vs. 0.80 and 0.85) in meat of barrows and gilts. according to previous studies (lorenzo et al., 2012, franco et al., 2006) that found the effect of carcass location on the fatty acid profile, we investigated the effect of location in three different locations of the ham. fatty acid composition differences in relation to location were found. in particular, they were identified for the following fatty acids: c18:0, c18: 1n9, c20: 0, c20: 3n3, c20: 4n6 with consequent effect on sfa (p = 0.007), mufa (p<0.001) and n-6 pufa that showed just a trend (p = 0.075). in particular, it is noted that sfa exhibit a higher concentration in the initial part (36.73), the mufas in the final part (54.99) and the pufa in the central part (12.49) of the sampled hams (fig. 2). figure 2. effect of sampling location on saturated fatty acids (sfa), polyunsaturated fatty acids (pufa) and monounsaturated fatty acids (mufa) content. ital. j. food sci., vol. 31, 2019 408 the highest content of mufa in the final part agrees with results of cava et al. (2000) who found higher percentages of oleic acid and mufa in a deeper muscle than in superficial one. sfa are mainly located in the initial part corresponding to a location with higher adipose accumulation. the nutritional value of adipose tissues is related to high values of pufa/sfa, mufa/ sfa ratios and low values for n-6/n-3 ratio. in the present study all cited ratios were significantly improved in “nero di parma” ham. 3.1. sensorial analysis there are various kinds of dry-cured hams in mediterranean countries, distinguished by the origin and the quality of raw material. dry-cured hams can be categorized into two types: (1) originating from traditional breeds, usually accompanied by extensive outdoor rearing systems and (2) originating from modern lean breeds, raised under intensive systems (čandek-potokar and škrlep, 2012). consumer demand regarding the sensory quality of dry cured ham varies according to the region and local habits. many highly regarded traditional products are based on the exploitation of natural resources like acorn pastures in the current case or in the case of the iberian pig. taste is the key factor affecting consumer satisfaction with dry-cured ham (resano et al., 2011). however, familiarity with a product affects quality expectations and perceptions of consumers, which explains why different dry-cured ham characteristics are appreciated in different countries. the least square means of the different attributes for the samples of dry cured ham are reported in the spider plot (fig. 3). the panelist effect was significant (p<0.01) for all descriptors; this statement is very common in sensory evaluation because of a different use of scores and disagreement within the assessment of sample (lea et al., 1997). no effect for replicates and no interaction between panelists × replicates and samples × replicates were found except brightness (p=0.018) and sweetness taste (p = 0.024). these results underline the excellent reproducibility of scores given by the panelists and excellent homogeneity of samples during repetitions. typology x replication interaction was not significant; this result would therefore seem to indicate that the mean scores for each sample given by the panelists for each descriptor are satisfactory estimates of the sensory profile of parma and “nero di parma” ham. anova of the sensory data showed a significant effect in the following descriptors: redness, marbling, oily, brightness, aged odor, rancid both in odor and flavor, sweetness, bitter and dryness. numerical values of the considered descriptors of parma ham are comparable with literature (laureati et al., 2014). redness descriptor was higher in “nero di parma” (7.4 vs 5.88) than parma ham. this result is consistent with those previously reported by (estévez et al., 2003, 2006) who described a higher a* value, chroma and iron content in muscles from rustic pig breeds than in those from selected ones. in addition to the breed effect, the characteristics of the iberian pigs’ livestock farming could have influenced since the pigments and iron concentrations and the red colour of the muscles increase with the animal age and the physical exercise (lawrie, 1998). this descriptor is linked to the sensory perception of meat color: consumers consider bright red meat as fresh and are adverse to brown meat. in addition, the highest oiliness appearance of “nero di parma” agrees with values of montanera ham (jurado et al., 2007) due to a high fat content of “ham as underlined by ct. the highest value of oiliness produced the highest brightness value in “nero di parma” (5.27 vs 4,22). ital. j. food sci., vol. 31, 2019 409 figure 3. sensory analysis results: mean values for each sensory descriptor by parma and “nero di parma” ham. for each descriptor the relevant significance is reported. (***significant at p< 0.001, **significant at p<0.01, *significant at p<0.05). in addition, the fat unsaturation affects dryness of ham meat resulting higher in parma ham according to results of ruiz et al. (2002) obtained in meat. however, an high fat content is associated with the phenomena of oxidation; the panel, both aroma and odor evaluation, found a greater value of rancid in the “nero di parma” ham (p <0.001 and p <0.003) than parma ham. this attribute is often present in longmatured products, such as ham, and it is also reported in the iberian typology (garciagonzalez et al., 2006; ruiz et al., 2002). rancidity is considered as a defective note of the product if present in high density. however, in contrast to the negative effect of lipid oxidation in pork, the formation of volatile lipid oxidation components during ripening/fermentation is important for the oxidative flavour note of parma ham. it is well known that the typical ham aroma is related to intramuscular lipid composition and to the extent of lipolysis and oxidation of lipids during processing (berdaguè, et al., 1993; buscailhon et al., 1994). in fact, muscle and adipose tissue lipids are subject to intense lipolysis by the action of lipases, generating free fatty acids that, at a second stage, are transformed to volatiles as a result of oxidation. sensory profiles of dry cured ham are strongly affected by these enzymatic reactions (toldra et al., 1997). “nero di parma” also showed the most intense aged odor according to the prolonged seasoning period (30 vs 24 months). as for marbling, a significant difference was obtained between the two types, higher in parma than in “nero di parma” ham (5.13 vs 4.53). it must be emphasized that marbling score is not only affected by the total fat area of fat ital. j. food sci., vol. 31, 2019 410 flecks, but also by the distribution of fat (cheng et al., 2015). the total lipid content of muscle was equal to an average value of 7.1% (s.e. 0.88) and 10.2% (s.e. 1.26) (p = 0.65) in parma ham and “nero di parma ham” respectively. this result agrees with ct analysis as described below. taste descriptor related to sweetness, a typical characteristic of parma ham, highlighted in parma ham higher values (3.93 vs 3.43) than “nero di parma ham”. in contrast, “nero di parma”, characterized by a lower sweetness, resulted more bitter (3.18 vs 2.28); this attribute could be caused by a greater presence of myoglobin. higher myoglobin levels in bull meat have been indicated as leading to greater sensations of metallic, liver, and bitter flavors. as recently reported, native pig breeds are characterized by the highest redness and the higher content of heme pigments (cebulska et al., 2018). in order to satisfy the requirements of the modern meat industry, it is important to develop some non-destructive, accurate, and rapid techniques for assessing meat quality and safety as recently reviewed (xiong et al., 2017). computerized tomography has been used mostly in medicine for diagnostic purposes. nevertheless, it has also been proven to be useful in other fields and its application has been extended to palaeontology, geology and also to food technology and the meat science field. application of computed tomography (ct) in meat science is based on the different x-ray attenuations that different tissues produce. it has been demonstrated to be useful in the estimation of body composition in animals and to measuring lean percentage in pig carcasses (picouet et al., 2010). in the present paper hounsfield units (hu), transformed by the software as cm3, were then expressed as a percentage; the different distribution of lean and fat can be appreciated from the images reported in fig. 4. figure 4. distribution of fat and lean tissue in parma ham and “nero di parma ham”. ital. j. food sci., vol. 31, 2019 411 as graphically presented in fig. 5 the opposite content of lean and fat component in the two types of analyzed hams (“nero di parma” 39% and 55%, parma: 59% and 34%) could be noted respectively. surprisingly, connective content is similar between the two types. monziols et al. (2006) evaluating by magnetic resonance imaging the proportion of different carcass cuts reported a value of 62% (st. dev. 7.3) and 20.2% (st. dev. 6.3) in muscle and fat of ham respectively. the percentage of muscle overlaps the values found in parma ham. the highest fat content of “nero di parma ham” is due to an adaptive mechanism to the environment, which is known as thrifty genotype and which was firstly described in humans (neel, 1962) and also in iberian pigs (garcia-contreras et al., 2018). the thrifty genotype facilitates accommodation to seasonal cycles of feasting and famine because the ability to store fat in excess during food abundance enables survival during periods of scarcity. an higher fat content implicates a longer ripening process from which depends all chemical and physical changes affecting volatile compounds during processing. figure 5. the lean, fat, and connective tissue surface ratio in “nero di parma” ham and parma ham. the connective tissue content of meat varies with species, chronological age, state of nutrition of the animal and muscle fiber characteristics (klont et al., 1998). meat texture is directly related to the size of muscle fiber and the amount of connective tissue (joo et al., 2013). moreover, connective tissue also undergoes morphological changes during meat-aging (bailey and light 1989; nishimura 2015). the results of ct are consistent with the evaluation of the sensory analysis carried out on the ham; in this study no difference was found in texture also in accordance with the study of nishimura (2010). 4. conclusions in conclusion, the results of the quality tests conducted on raw cured ham from the “nero di parma” pig emphasize high processing value and nutritional value of the meat of these animals. the profile of fatty acids and the proportions of individual fatty acids expressed in the form of disease risk indices (ai, ti) allow us to characterize the “nero di parma” ital. j. food sci., vol. 31, 2019 412 ham as a product with health value. “nero di parma” ham with the high monounsaturated and omega-3 fatty acids content, could play an important role for human health; moreover, the omega6/omega3 ratio was improved in “nero di parma” ham more than in parma ham. the present study provides additional data on parma pdo ham with regard to the fatty acid composition, and sensory analysis, confirming literature and the positive evaluation of this product. the sensorial profile of a typical product is the starting point for a strategy to enhance the typicality. the results of this preliminary study indicated that “nero di parma” ham, for which sensory investigations are not known, highlighted some descriptors such as oiliness, brightness, redness significantly different from parma ham, and useful to define the sensorial profile of a typical product. this study is only a first approach from which further investigations can emerge. the numbers will have to be expanded in order to reach a definitive sensorial profile and to characterize the “nero di parma” ham for the entire nutritional label. acknowledgements the authors wish to thank the producer "rosa dell'angelo" (traversetolo, pr, italy) and onas, organizzazione nazionale assaggiatori salumi (national salami tasters organization) for their help in making this research possible. references bailey a. j. and light n. d. 1989. connective tissue in meat and meat products. london, uk:elsevier applied science. bermúdez r., franco i., franco d., carballo j. and lorenzo j.m. 2012. influence of inclusion of chestnut in the finishing diet on fatty acid profile of dry-cured ham from celta pig breed. meat sci. 92:394. berdaguè j. l., bonnaud n., rousset s. and touraille c.1993. influence of pig crossbreed on the composition, volatile compound content and flavour of dry cured ham. meat sci. 34:129. bosi p., cacciavillani j.a., casini l., lo fiego d.p., marchetti m. and mattuzzi s. 2000. effects of dietary high-oleic acid sunflower oil, copper and vitamin e levels on the fatty acid composition and the quality of dry cured parma ham. meat sci. 54:119. buscailhon s., berdaguè j. l., bousset j., cornet m.g., gandemer g., touraille c. and campo m.m. and sierra i. 2011. fatty acid composition of selected varieties of spanish dry-cured ham. surveys from 1995 and 2007. span. j. agric. res. 9:66. čandek-potokar m. and škrlep m. 2012. factors in pig production that impact the quality of dry-cured ham: a review. animal, 6:327. caroprese m., marzano a., marino r., gliatta g., muscio a. and sevi a. 2010. flaxseed supplementation improves fatty acid profile of cow milk. j. dairy sci. 93:2580. caroprese m., albenzio m., bruno a., fedele v., santillo a. and sevi a. 2011. effect of solar radiation and flaxseed supplementation on milk production and fatty acid profile of lactating ewes under high ambient temperature. j. dairy sci. 94:3856. cava r., ventanas j., ruiz j., andrès a.i. and antequera t. 2000. sensory characteristics of iberian ham:influence of rearing system and muscle location. food sci. tech. int. 6:235. cebulska a., václavková e., bocian m., dybała j., wiśniewska j. and kapelański w. 2018. quality and dietary value of pork meat of the puławska and złotnicka spotted breeds, and commercial fattening pigs. ann. anim. sci. 18:281. cheng w., cheng j.h., sun d.w. and pu h. 2015. marbling analysis for evaluating meat quality: methods and techniques. compr. rev. food sci. food saf. 14:523. ital. j. food sci., vol. 31, 2019 413 cieslak a., kowalczyk j., czauderna m., potkanski a.and szumacher-strabel m. 2010. enhancing unsaturated fatty acids in ewe’s milk by feeding rapeseed or linseed oil. czech j. anim. sci. 55:496. estévez m., morcuende d. and cava r. 2003. oxidative and colour changes in meat from free-range reared iberian pigs slaughtered at 90 kg live-weight and commercial pig under refrigerated storage. meat sci. 65:1139. estévez m., morcuende d. and cava r. 2006. extensively reared iberian pigs versus intensively reared white pigs for the manufacture of frankfurters. meat sci. 72:356. en iso 13299. 2010 sensory analysis – methodology – general guidance for establishing a sensory profile. fernández d, menéndez r. a., sanz j.j and garcía-fernández m del c. 2015. fatty acid profile of two cured meat products: dry-cured ham and cecina. nutr. hosp. 32 :367. fernández m., ordonez j.a., cambero i., santos c., pin c. and de la hoz l. 2007. fatty acid compositions of selected varieties of spanish dry ham related to their nutritional implications. food chem. 101:107. folch j., lees m. and sloane stanley g.h. 1957. a simple method for the isolation and purification of total lipids from animal tissues. j. biol. chem. 226:497. franco i., escamilla m.c., garcía j., fontán m.c.g. and carballo j. 2006. fatty acid profile of the fat from celta pig breed fattened using a traditional feed: effect of the location in the carcass. j. food compos. anal. 19:792 gandemer g. 2009. dry cured ham quality as related to lipid quality of raw material and lipid changes during processing: a review. grasas aceites, 60:297. ganji v., hampl j.s. and betts n.m. 2003. race, gender and age-specific differences in dietary micronutrient intakes of us children. int. j. food sci. nutr. 54:485. garcia-contreras c., vazquez-gomez m., torres-rovira l., gonzalez j., porrini e., gonzalez-colaço m., isabel b., astiz s. and gonzalez-bulnes a. 2018. characterization of ageingand diet-related swine models of sarcopenia and sarcopenic obesity. intern. j. mol. sci. 19:823. garcıa-gonzalez d.l., roncales p., cilla i., del rio s., poma j.p. and aparicio r. 2006. interlaboratory evaluation of drycured hams (from france and spain) by assessors from two different nationalities. meat sci. 73:521. hounsfield g.n. 1980. computed medical imaging. j. comput. assist. tomogr. 4:665. jimenez-colmenero f., ventanas j. and toldrá f. 2010. nutritional composition of dry cured ham and its role in a healthy diet. meat sci. 84:585 joo s.t., hwanga y.h. and ryub y.c. 2013. control of fresh meat quality through manipulation of muscle fiber characteristics. meat sci. 95:825. jurado a., garcía c., timón m.l. and carrapiso a.i. 2007. effect of ripening time and rearing systems on amino acidrelated flavour compounds of iberian ham. meat sci. 75:585. klont r.e., brocks l. and eikelenboom g. 1998. muscle fibre type and meat quality. meat sci.49:219. laureati m., buratti s., giovanelli g., m. corazzin, lo fego d.p. and pagliarini e. 2014. characterization and differentiation of italian parma, san daniele and toscano dry cured hams: a multidisciplinary approach. meat sci. 96:288. lawrie r.a. 1998. the eating quality of meat. in meat science (sixth ed.). cambridge: woodhead publishing. lea p., tormod n. and morit r. 1997. analysis of variance for sensory data, john wiley and sons ltd., england, 1997 lorenzo j.m., montes r., purrinos l., cobas n. and franco d. 2012. fatty acid composition of celta pig breed as influenced by sex and location of fat in the carcass. j. sci. food agric. 92:1311. macfie h.j., bratchell n., greenhoff k. and vallis l.v. 1989. designs to balance the effect of order of presentation and first-order carry-over effects in hall tests. j. sens. stud. 4:129. monin g. 1994. relations between compositional traits and sensory qualities of french dry-cured ham. meat sci. 37:229. morrison w.r. and smith l.m. 1964. preparation of fatty acid methyl esters and dimethyl acetals from lipids with boron fluoride-methanol. j. lipid res. 5:600. ital. j. food sci., vol. 31, 2019 414 mourot j. and hermiern d. 2001. lipid in monogastric animal meat. repr. nutr. devel. 41:109. muriel e., ruiz j., ventanas j. and antequera t. 2002. free-range rearing increases (n 3) polyunsaturated fatty acids of neutral and polar lipids in swine muscles. food chem. 78:219. musella m., cannata s., rossi r., mourot j., baldini p. and corino c. 2009. omega-3 polyunsaturated fatty acid from extruded linseed influences the fatty acid composition and sensory characteristics of dry-cured ham from heavy pigs. j. anim. sci. 87:3578. neel, j.v. 1962. diabetes mellitus: a “thrifty” genotype rendered detrimental by “progress”? am. j. hum. genet. 14:353. nishimura t. 2010. the role of intramuscular connective tissue in meat texture. anim. sci. j. 81:21. nishimura t. 2015. role of extracellular matrix in development of skeletal muscle and postmortem aging of meat. meat sci. 109:48. okrouhlá m., stupka r., čítek j., šprysl m., and brzobohatý l. 2013. effect of dietary linseed supplementation on the performance, meat quality, and fatty acid profile of pigs. czech j. anim. sci. 58:279. pastorelli g., magni s., rossi r., pagliarini e., baldini p., dirinck p., van opstaele f and corino c. 2003. influence of dietary fat, on fatty acid composition and sensory properties of dry-cured parma ham. meat sci. 65:571. peiretti p.g. and meineri g. 2010. effects of diets with increasing levels of golden flaxseed on carcass characteristics, meat quality and lipid traits of growing rabbits. it. j. anim. sci. 9:372-377. pérez-palacios t., antequera t., durán m.l., caro a., rodríguez p.g. and ruiz j. 2010. mri-based analysis, lipid composition and sensory traits for studying iberian dry-cured hams from pigs fed with different diets. food res. intern. 43:248. picouet p., teran f., gispert m. and font i furnols m. 2010. lean content prediction in pig carcasses, loin and ham by computerized tomography (ct) using a density model. meat sci. 86:616. razmaite v., švirmickas g.j. and šiukščius a. 2012. effect of weight, sex and hunting period on fatty acid composition of intramuscular and subcutaneous fat from wild boar. ital. j. anim. sci. 11:174. resano h., perez-cueto f.j.a., sanjuàn a.i., de barcellos m.d., grunert k.g. and verbeke w. 2011. consumer satisfaction with dry-cured ham in five european countries. meat sci. 87:336. ruiz j., garcıa c., muriel e., andres a.i. and ventanas j. 2002. influence of sensory characteristics on the acceptability of dry-cured ham. meat sci. 61:347. ruiz j., cava r., antequera t., martın l., ventanas j. and lopez-bote c.j. 1998. prediction of the feeding background of iberian pigs using the fatty acid profile of subcutaneous muscle and hepatic fat. meat sci. 49:155. ruiz-carrascal j., ventanas j., cava r., andrés a. and garcía c. 2000. texture and appearance of dry cured ham as affected by fat content and fatty acid composition. food res. intern. 33:91. santos c., hoz l., cambero m.i., cabeza m.c. and ordóñez j.a. 2008. enrichment of dry-cured ham with α-linolenic acid and α-tocopherol by the use of linseed oil and α-tocopheryl acetate in pig diets. meat sci. 80:668. toldra f., flores f. and sanz m. 1997. dry-cured ham flavour: enzymatic generation and process influence. food chem. 59:523. tous n., lizardo r., vilà b., marina gispert m., furnols m.f. and garcia e.e. 2013. effect of a high dose of cla in finishing pig diets on fat deposition and fatty acid composition in intramuscular fat and other fat depots. meat sci. 93:517. ulbricht t.l. and southgate d.a.t. 1991. coronary heart disease: seven dietary factors. the lancet 338:985. ventanas s., ventanas j, tovar j., garcía c. and estevez m. 2007. extensive feeding versus oleic and tocopherol enriched mixed diets for the production of iberian dry-cured hams: effect on chemical composition, oxidative status and sensory traits. meat sci. 77:246. who technical report series 916. who, geneva (2003). wood j.d. and enser m. 1997. factors influencing fatty acids in meat and the role of antioxidants in improving meat quality. br. j. nutr. 78:s49-s60. ital. j. food sci., vol. 31, 2019 415 wood j.d., enser m., fisher a.v., nute g.r., sheard p.r. and richardson r.i. 2008. fat deposition, fatty acid composition and meat quality: a review. meat sci. 78:343. wood j.d, nute g.r., richardson r.i., whittington f.m, southwood o. and plastow g. 2004. effects of breed diet and muscle on fat deposition and eating quality in pig. meat sci. 67:651. xiong z., sun d.w., pu h., gao w. and dai q. 2017. applications of emerging imaging techniques for meat quality and safety detection and evaluation: a review. crit. rev. food sci. nutr. 57:755. paper received june 21, 2018 accepted october 15, 2018 ijfs#1020_bozza ital. j. food sci., vol. 30, 2018 184 paper enological eligibility of grape clones based on the simca method: the case of the sangiovese cultivar from tuscany v. canuti*1, s. puccioni2, p. storchi2, b. zanoni1, m. picchi1, and m. bertuccioli1 1gesaaf, department of agriculture, food and forestry systems, university of florence, via donizetti 6, 50144, florence, italy 2crea, council for research in agriculture and agricultural economy analysis, viale santa margherita 80, 52100, arezzo, italy *corresponding author. tel.: +39 0552755517, fax +39 0552755500 e-mail address: valentina.canuti@unifi.it abstract sangiovese is the most widespread italian red grape cultivar and it constitutes the basis of internationally known wines. it has a large diversity of clones whose performances vary with environmental conditions due to interaction with the weather and soil. in this study, the performance of grapes from seven sangiovese clones was evaluated by analyzing grapes from four vineyards in the chianti classico region in tuscany over the ripening period. in order to assess the enological eligibility of grape clones, a grape reference model was developed using chemical parameters from commercially available sangiovese wines, by performing a soft independent modeling of class analogy (simca). keywords: anthocyanin profile, clone plasticity, ripening, sangiovese, simca, wine quality ital. j. food sci., vol. 30, 2018 185 1. introduction sangiovese is the most widespread italian red cultivar and, according to the last agricultural census of the ministry of agricultural, food, and forestry policies (http://catalogoviti.politicheagricole.it), the total area planted with sangiovese was 69787 ha, equivalent to 10.3% of the total area of vineyards in italy. 47% of these vineyards are in tuscany, producing 92.5% of the sangiovese world output. sangiovese constitutes the basis of internationally known wines such as chianti, brunello di montalcino, nobile di montepulciano, and, furthermore, its use is allowed in the production of 11 docg (denominazione di origine controllata e garantita), 103 doc (denominazione di origine controllata) and 99 igt (indicazione geografica tipica) wines all over italy. the selective pressure carried out by mankind over the centuries in different growing conditions has induced the diversification of sangiovese into many clones (campostrini et al., 1995). nowadays, 116 clones of sangiovese are listed in the italian national registry of grapevine varieties. clone performances vary with environmental conditions according to the interaction between the grapevine, weather and soil (barbeau et al., 1999) and they can influence wine quality and typicality. some authors (tonietto and carbonneau, 2004) consider that climate is the most dominant factor in determining grape quality and that is responsible for the terroir effect. a few studies have been conducted on the physiological and productive response of sangiovese clones to environmental and pedoclimatic factors. on the other hand, while some authors have focused on the relationship between the sangiovese grape composition and different grapevine growth conditions, they only monitored standard parameters such as ph, titratable acidity, and sugar content (di collalto et al., 2000). however, some studies on other cultivars, such as tempranillo, pinot noir, merlot, and cabernet sauvignon, have shown that, within the same grape variety, different clones can be distinguished by comparing their field performances including yield components (number and weight of clusters and berries, pruning weight) and the chemical compositions of grapes including anthocyanin content (revilla et al., 2009, fidelibus et al., 2006, fidelibus et al., 2007, castagnoli et al., 2006, arozarena et al., 2002, ranković-vasić et al., 2015) and anthocyanin profiles (guidoni et al. 2002, ryan and revilla, 2003, downey et al., 2006, gonzález-neves et al., 2004, ortegaregules et al., 2006). these studies demonstrated that climate and soil are crucial factors in determining the final composition of grapes. however, it is not easy to predict how these changes could affect the final characteristics of wines. integrated approaches can identify the relationship between grape chemical features, wine chemical composition, and wine sensory attributes, in order to predict wine flavor from grape composition and provide a practical tool for guiding the winemaking process (zanoni et al., 2010, forde et al., 2011). many studies (cadot et al., 2012, kontoudakis et al., 2011, koundouras et al., 2006, ristic et al., 2010) have proposed different methodological approaches to measure the qualitative characteristics of grapes and the related wines, but a complete methodological approach to assess the eligibility of grapes in order to obtain a wine with well-defined characteristics has not been taken into account by these authors. a recent study proposed a multivariate statistical approach to relate grape features, and enological and agronomical practices with the composition of wines, in order to provide a practical tool to manage the vineyard and the winemaking process and preserve or enhance wine typicality (canuti et al., 2017). the aim of this study was to create a tool capable of discriminating grapes, depending on their chemical composition, according to a given enological objective. for this purpose, a ital. j. food sci., vol. 30, 2018 186 grape eligibility model (gem) was developed by computing the chemical parameters of commercially available sangiovese wines, grapes, and the relevant wines from previous experiments by performing a soft independent modeling of class analogy (simca). the model was then applied to assess the enological eligibility of seven sangiovese clones grown in four vineyards in different growing areas of the chianti classico region in tuscany. 2. materials and methods 2.1. grape samples the present study was carried out using seven vitis vinifera cv. sangiovese clones listed in the italian national registry of grapevine varieties as reported in table 1. table 1. sangiovese clones studied for performance evaluation. registered clones code area of origin ss-f9-a5-48 f9 lamole (florence tuscany, italy) rauscedo 24 r24 predappio (forlì cesena emilia romagna, italy) montalcino 42 m42 montalcino (siena tuscany, italy) ap-sg-1 ap1 cossignano (ascoli piceno marche, italy) peccioli 1 pec peccioli (pisa tuscany, italy) rauscedo 10 r10 lamole (florence tuscany, italy) sg-12t 12t predappio (forlì cesena emilia romagna, italy) the vineyards were located in four different estates in the chianti classico docg area in tuscany. these were situated in the provinces of florence (panzano and greve in chianti) and siena (castellina in chianti and castelnuovo in berardenga) and coded with the letters a, b, c, and d respectively. each vineyard was planted in 1990 and has an average surface area of 1.7 hectares. the vines were spaced 2.8 m (between rows) × 1.0 m (between vines in the row), resulting in a density of 3571 vines/ha, in a randomized block design with a minimum of three replicates. each clone was grafted on to 420 a (vitis berlandieri x vitis riparia) rootstock. the vines, with a permanent unilateral cordon, were spur-pruned and trained to a vertical shoot-position. the same soil management techniques were applied in all the vineyards, in which the rows were alternately covered with a spontaneous permanent grass and tilled. no irrigation system was installed. the meteorological indices, based on the data recorded by the nearest climate stations to the experimental vineyards and the characteristics of the soils, are available at the reader's request. grapes were harvested for sampling at three different ripening stages during the 2005 vintage (september 10th, 20th and 30th). in 2005, rain events were quite intense at the beginning of september, as indicated by the data collected at the local meteorological stations. on each sampling date, 2 kg-samples of grapes were collected from portions of different clusters picked randomly from all the randomized blocks and analyzed. ital. j. food sci., vol. 30, 2018 187 2.2. chemicals the acetonitrile and o-phosphoric acid (hplc grade) were purchased from panreac (barcelona, spain). the malvidin-3-monoglucoside (m3mg) (hplc grade) was purchased from extrasynthèse (genay, france). all of the other chemicals were of the highest purity available and were purchased from sigma-aldrich (milan, italy). 2.3. instrumentation the hplc analyses were carried out on a perkin-elmer 200 lc series equipped with an autosampler and a diode-array detector (perkin elmer, shelton, ct, usa). the ultravioletvisible (uv/vis) absorbance of the samples was measured on a perkin elmer lambda 35 uv/vis spectrophotometer (perkin elmer, shelton, ct, usa). 2.4. grape analysis the technological ripeness of the grapes was measured following official oiv methods (compendium of international methods of analysis – oiv – oeno 21/2004). two hundred berries were pressed to extract their juice. the juice sugar contents (brix), titratable acidity (g/l), and ph were measured after centrifugation of the juice at 3000 rpm for 10 min. the berry weight was determined as the ratio between the total weight and the number of berries. phenolic maturity was measured as described by saint-criq et al. (1998). the anthocyanin profiles (expressed as relative abundance of the different anthocyanins) of the same grape extracts at ph 3.2 were determined by hplc, according to a previously published method (peng et al., 2002) used to determine the phenolic maturity by acquiring a chromatogram at 520 nm. at the same time, the tannin contents (expressed as peak height) were determined by acquiring a chromatogram at 280 nm, as described in canuti et al. (2012). chromatograms were acquired, recorded, and processed using total chrome navigator software (perkin elmer). 2.5. analysis of commercial and experimental wines standard parameters were measured in the wines following official eu methods (official methods of wine analysis, reg. 440/2003). color intensity (ci) and hue (hue) were measured according to glories (1984) and the total phenols index (tpi) was measured as described by ribereau-gayon (1970). monomer anthocyanin contents, expressed as mg/l of malvidin-3-monoglucoside (m3mg), colored polymeric pigments (cpp) expressed as mg/l of m3mg, and tannins (expressed as peak height) were determined by hplc (peng et al., 2002). chromatograms were acquired at 520 and 280 nm respectively, using the same hplc parameters reported in the grape analysis section. 2.6. statistical analysis the analysis of variance (anova) was performed using statgraphics centurion (ver. xv, statpoint technologies, warrenton, va), considering clones, growing area, and sampling date as factors. principal component analysis (pca) and the soft independent modelling of class analogy (simca) were performed using unscrambler (v10.3, camo process as, oslo, norway). the simca analysis enables the assessment of which factors are decisive in determining the classification. indeed, in this classification method, each class is described by an ital. j. food sci., vol. 30, 2018 188 independent principal component analysis model. new samples are classified on the basis of their fit with the different pca models. the optimal number of pcs for each model is chosen independently since the classes may exhibit different shapes and structures. for new samples the residuals and scores are calculated for each pca model. the residuals provide information on the ability of each model to describe the new data, like a sort of object-to-model distance, while the scores can be combined to measure the distance between the object and the model center. 2.7. grape quality model and evaluation of clone performance a model evaluating the grape quality, and the consequent performance of the clones, was built in order to provide an objective tool to assess the grapes’ eligibility for winemaking. the classification method (simca) consisted of describing each class of samples (wines and grapes), identified by their chemical composition, in independent principal component analysis (pca) models. grape and wine samples were classified on the basis of their membership limit within the different pca models (wold and sjostrom, 1977). in particular, the methodology to build the model and evaluate the clone performances consisted of three phases as follows: phase 1 – sangiovese wine eligibility model (wem) in phase 1, a sangiovese wine eligibility model was built which described the chianti classico region wines. the aim of this phase was to establish a definition of sangiovese wines from the region. for this purpose, 37 commercial chianti classico docg wines (coded with numbers from 101 to 137) were analyzed to determine their alcohol contents, titratable acidity, ph, total phenol index, total anthocyanins, tannins, color intensity, and hue. later, a global pca was run considering all the parameters for the 37 commercial wines. all the wines used to build the wem were produced with 100% sangiovese grapes without oak contact and analyzed one year after the harvest. phase 2 – sangiovese grape eligibility model (gem) the aim of phase 2 was to create a grape eligibility model (gem) starting from the wem built in phase 1. for this purpose, 30 sangiovese grape samples from the chianti classico region were analyzed to determine their sugar content, ph, titratable acidity, total and extractable anthocyanins, cellular maturity index, phenolic richness, and tannins. the grapes were then vinified, on an industrial scale, to obtain 30 experimental sangiovese wines (coded with numbers from 1 to 30) that were analyzed, after aging for one year, to determine their alcohol contents, titratable acidity, ph, total phenol index, total anthocyanins, tannins, color intensity, and hue. finally, the chemical composition parameters of 30 sangiovese grape samples and the related experimental wines were statistically analyzed in order to correlate the grapes to wine composition. a global pca of the experimental wines was performed and the resulting model was compared with a simca analysis to assess which wines fitted the wem. the grape samples whose wines fitted the wem obtained in phase 1 were used to create the grape eligibility model (gem) by running a global pca which considered all of the grape parameters. ital. j. food sci., vol. 30, 2018 189 phase 3 – evaluation of clone performance in order to evaluate the clones’ performances, the grape samples were classified according to their composition using a simca analysis to assess which grapes fitted the gem. outliers were detected during the exploratory analysis by calculating the hotelling’s t2 distance diagnostic tool for each class of samples. 3. results 3.1. grape clone characteristics the data collected from grape sample analyses at three different ripening stages were statistically analyzed and the results are reported in table 2. table 2. f-values and interactions for chemical parameters analyzed in the grape samples. variable sd c ga c x ga ga x sd c x sd sugar 13.97*** 2.86* 70.43*** 4.46*** 4.25*** 3.79*** ph 15.45*** 5.65*** 21.08*** 1.23 ns 1.48 ns 1.53 ns titratable acidity 65.61*** 14.35*** 112.52*** 6.43*** 4.11*** 9.24*** berry weight 4.02* 13.78*** 93.69*** 11.52*** 5.76*** 5.01*** total potential in anthocyanins 14.37*** 23.41*** 54.05*** 13.06*** 13.57*** 5.00*** extractable anthocyanins 10.46*** 20.47*** 70.42*** 10.50*** 9.89*** 5.21*** cellular maturity index 22.66*** 6.09*** 18.27*** 7.10*** 6.65*** 6.26*** phenolic richness 6.48** 5.15*** 7.67*** 2.87*** 2.58* 2.08* di/tri substituted anthocyanins ratio 21.82*** 15.93*** 92.03*** 27.48*** 7.90*** 2.07* tannins 5.05* 46.30*** 186.47*** 46.18*** 4.48*** 5.39*** *p ≤ 0.05; **p ≤ 0.005; ***p ≤ 0.001; ns, not significant; c, clone; ga, growing area; sd, sampling date. all the variables measured have been significantly affected by the factors clone (c), growing area (ga), sampling date (sd) factors and their interactions, with the exception of ph (table 2). furthermore, the anova results indicate that ga was the most influential factor; in fact, the f-values of ga were the highest for all the considered grape parameters. the c factor was found to be a determining factor for the concentrations of phenolic compounds (tannins, potential and total anthocyanins). as expected, the sd factor did not only influence the cellular maturity index but also the quality of the anthocyanins, modifying the di-substituted and tri-substituted pigment ratios. with regard to the interactions between the various factors, the results suggest that the interaction between clone and growing area (c x ga) was the most significant, in relation to tannin contents (f = 46.18) and the di/tri index (f = 27.48). the mean plots for the standard and phenolic parameters of the grape samples are shown in figs. 1 and 2, respectively. the berry weight (bw) provides a qualitative and quantitative indication about the berry size and the skin to pulp ratio. the most important factor that influenced bw (table 2) was ga, which showed the highest f value (93.69). according to fig. 1, bw remained fairly constant during the ripening stage, indicating that the sd factor had less influence on bw (f – value = 4.02) if compared to the ga and c factors which had a higher statistically ital. j. food sci., vol. 30, 2018 190 significant influence (table 2). in particular, clone f09 showed a higher bw in comparison to clone 12t, which produced smaller berries. growing areas a and d seemed to stimulate the growth of the berry more than growing area b. clone r24 had the highest berry weight variability, producing the lightest berries (1.24 g) in area b and the heaviest (2.37 g) in d. the clone pec stood out in area c with an average weight of 2.35 g. clones f09, ap1, and r10 produced grapes with a more constant berry weight in all the growing areas. figure 1. mean plots of standard parameters of grape samples (sugar, ph, titratable acidity, berry weight, and cellular maturity index); significance at 95% confidence level according to fisher’s least significant difference (lsd) procedure. bars represent lsd; total number of grape samples for each plot = 252. all of the factors had a statistically significant influence in relation to the grapes’ sugar content, and ga was the one with the greatest effect (f-value = 70.43). there were also significant effects when considering the interactions between factors. for example, fig. 1 ital. j. food sci., vol. 30, 2018 191 shows that the sugar content increased, as expected, during ripening, with clone r24 having the highest sugar content, and growing area b promoting the accumulation of sugars. the sugar content of the grapes produced by clones 12t and ap1 showed the most unstable and extreme values, which varied between 25.0 brix in b and 20.5 in the other zones. r10 showed constant concentrations (21.3 brix) in all the growing areas. figure 2. mean plots of phenolic parameters of grape samples (total potential in anthocyanins, extractable anthocyanins, phenolic richness, di/tri substituted anthocyanins ratio, and tannins); significance at 95% confidence level according to fisher’s least significant difference (lsd) procedure. bars represent lsd; total number of grape samples for each plot = 252. concerning the titratable acidity and ph (table 2), the most determining factor was again ga (f value = 112.52 and 21.58 respectively). moreover, the titratable acidity decreased as the ph increased at the three different sampling dates (f = 65.61). clone ap1 showed the highest ph and clones 12t and r10 the highest titratable acidity (fig. 1). ital. j. food sci., vol. 30, 2018 192 growing area b produced grapes with the highest ph and the lowest titratable acidity in comparison to the other gas. the grapes grown in area a showed the highest titratable acidity and the lowest ph. the titratable acidity was similar for all the clones in growing area b, while the results showed a high variability in the other zones. f09 reached the lowest value of titratable acidity (6.65 g/l) in area d. clone r10 displayed the highest values in zones a (8.59 g/l) and c (8.08 g/l). moreover, in growing area a, clones 12t (8.72 g/l) and r24 (8.57 g/l) stood out for their high titratable acidity. the cellular maturity index (ea%) measures the berries’ ability to release anthocyanins: the lower the ea index value, the higher the extractable potential of the anthocyanins (saint criq et al., 1998). the evolution of this factor at the different sds (fig. 1) highlighted a progressive cellular maturity that should result in a better release of the phenolic compounds during winemaking. statistical analysis (table 2) pointed out that ea% mostly depended on the sd (f = 22.66) and ga factors (f = 18.27) and that growing areas a and b promoted the ripening of the grape skin cells the most. moreover, clone 12t showed the highest ea% (fig. 1). the cellular maturity index was stable for clone pec (49) while it was inconstant for f09 (38 in b and 51 in c) and m42 (40 in a and 56 in c). the ea% was the highest for all the clones in growing area d. during the ripening of the grapes, there was a constant and significant increase in phenolic richness and total potential in anthocyanins from the first to the second sd and a significant decrease at the third sd (fig. 2). instead, the extractable anthocyanins increased over time, reaching the maximum at the second sampling date and remaining constant between the second and third sds. the tannin contents remained constant throughout the ripening stages; this result could indicate that the increase in the total amount of phenolic compounds was due to the accumulation of monomeric phenols (fig. 2). however, clones pec and r24 showed the highest tannin content, and there were significant differences induced by the ga factor, with growing areas a and d having the lowest values and areas b and c showing the highest value for tannin contents. the largest differences in phenolic composition between the grapes emerged when considering ga as the main factor. in fact, the content of total potential (f = 54.05), extractable anthocyanins (f = 70.42) and tannins (f = 186.47) was higher in zone b and lower in all the other growing areas. moreover, the differences in the levels of phenolic richness were less remarkable but still significant for growing areas b, c, and d, which showed higher values than area a. upon examining the chemical profile of the different sangiovese clones, it is clear that there were differences among them due to the content of total anthocyanins but not at the level of phenolic richness. clone r24 showed a different behavior when compared to all the other clones, resulting in significantly higher contents of total potential and extractable anthocyanins and tannins. regarding the clone x growing area interactions, clone f09 always showed similar levels of phenolic richness (54), while r24, with values that ranged between 47 in a and 56 in d, was the clone most influenced by the ga factor. the tannin content was similar for all the clones in areas a and b; a higher variability was observed in the other zones where clones pec, r24 (in b), and f09 (in c) stood out with higher values. the anthocyanin content, both potential and extractable, showed the highest variability in zone b where clones 12t (1879 and 946 mg/kg) and r24 (2011 and 983 mg/kg) stood out with the highest values. in area b, the values were higher for all the clones with the exception of f09 (1043 and 642 mg/kg) which, on the contrary, was the richest in anthocyanins in growing area c (1609 and 744 mg/kg). different considerations should be made regarding the ratio between the diand trisubstituted anthocyanins (di/tri) and the anthocyanin profiles of the different clones. ital. j. food sci., vol. 30, 2018 193 clone r24 showed the highest di/tri value and growing areas a and b showed larger levels of di/tri in comparison to areas c and d (fig. 2). regarding the relative abundance of anthocyanins, it was seen that the pigments were mainly represented by delphinidin-3-o-glucoside (del), cyanidin-3-o-glucoside (cya), peonidin-3-o-glucoside (peo), petunidin-3-o-glucoside (pet), and malvidin-3-oglucoside (mal). in agreement with results reported elsewhere (mattivi et al., 2006, arapitsas et al., 2012), the acylated anthocyanins were found in very low amounts (sum of total relative area below 2% of the total anthocyanin content, data not shown). due to the low amounts of acylated pigments in the sangiovese cultivar, only glucoside anthocyanins were taken into consideration for the statistical analysis (del, cya, peo, pet and mal). the variability in di/tri levels, according to the multifactor anova, was affected by all the factors taken into consideration (table 2). all the clones had similar di/tri values with the exception of clone r24 (f = 15.93), which showed a higher value (fig. 2). small variations occurred during the ripening period (f = 21.82). in this case too, the growing area was the most influential factor on this parameter (f = 92.03), with areas a and b showing the highest values of the index. the di/tri ratio was similar for all the clones in growing areas a and c while in area b the values varied between 1.37 for clone r24 and 0.49 for r10. upon analyzing the anthocyanin profile (table 3), mal resulted the major component of the anthocyanin pool present in the sangiovese grapes from all the different clones; while del was the smallest component. table 3. grape clone anthocyanin percentages and significance1. anthocyanins factors del cya pet peo mal σ tri-sub clone 12t 9.5c 20.5a 13.3cd 16.9b 39.7bc 62.5ab ap1 9.1b 19.5a 12.8b 19.8d 38.7b 60.6ab f09 6.8a 19.9a 10.4a 18.6c 44.1d 61.3ab m42 9.7c 19.5a 13.4d 16.5b 41.0c 64.1b pec 9.4c 23.7b 13.7d 14.8a 38.1b 61.2ab r10 10.2d 19.9a 14.1c 14.3a 41.2c 65.5b r24 10.3d 24.5a 12.9bc 17.4b 34.6a 57.8a growing area a 9.9c 24.2c 13.7b 16.2b 35.8a 59.4a b 8.9b 24.7c 12.3a 18.7d 35.2a 56.4a c 9.9c 16.6a 13.8b 15.2a 44.4b 68.1c d 8.5a 18.9b 12.0a 17.5c 43.0b 63.5b sampling date 9/10 9.4a 19.6a 13.0a 16.5a 41.3c 63.7b 9/20 9.3a 22.8a 12.8a 17.3b 37.6a 59.7a 9/30 9.3a 20.8a 12.9a 16.9ab 39.9b 62.1ab 1different letters within the same row mean significant differences (significance at 95% confidence level according to fisher’s least significant difference (lsd) procedure). del: delphinidin-3-o-glucoside; cya: cyanidin-3-o-glucoside; peo: peonidin-3-o-glucoside; pet: petunidin-3-o-glucoside; mal: malvidin-3-oglucoside; σ tri-sub: sum of tri-substituted anthocyanins. ital. j. food sci., vol. 30, 2018 194 cya was the second most abundant anthocyanin in sangiovese grapes. the sum of the trisubstituted anthocyanins (del, pet and mal) ranged between 57.8-65.5%. the results showed that the average anthocyanin profile of sangiovese corresponded to the one described in the literature (mattivi et al., 2006, arapitsas et al., 2012). however, significant differences in the anthocyanin composition of the grapes were related to c, ga, and sd (table 3). 3.2. grape quality model and evaluation of clone performance phase 1 – sangiovese wine eligibility model (wem) the model was built by running a pca which considered the chemical parameters of 37 commercial sangiovese wines from the chianti classico region. the scores of the wines relative to the two first pcs and the hotelling t2 ellipse (95% confidence level) are represented in fig. 3. figure 3. principal component analysis (pca) and hotelling t2 ellipse of the commercial wines, numbered 101 to 137. by encircling all the samples, the hotelling statistic evidenced the absence of outliers among the wines. the statistical analysis confirmed, moreover, a homogeneity between the samples, stating that they reasonably belong to the same class. for the construction of the model, the number of pcs was chosen to reach a level of explained variance between 80 and 90%. for the wem, three principal components that accounted for 84.11% of the total variance were considered adequate. phase 2 – sangiovese grape eligibility model (gem) the wem built in phase 1 was used to classify 30 experimental wines according to their analytical profiles. the simca analysis allowed the identification of 23 wines that fitted the model criteria, while rejecting wine samples 6, 13, 20, 22, 23, 27, and 28 (table 4). the grapes used in the experimental wines that resulted eligible by applying the wem were considered suitable for the construction of a grape eligibility model (gem). the ital. j. food sci., vol. 30, 2018 195 analytical parameters of the 23 grape samples were then used to calculate a pca in order to set up the gem. table 4. classification of the experimental wines (simca). numbers 1 to 30 represent the wine samples. (●) wine which fitted the wem, (-) wine which did not fit the wem. experimental wine experimental wine 1 ! 16 ! 2 ! 17 ! 3 ! 18 ! 4 ! 19 ! 5 ! 20 6 21 ! 7 ! 22 8 ! 23 9 ! 24 ! 10 ! 25 ! 11 ! 26 ! 12 ! 27 13 28 14 ! 29 ! 15 ! 30 ! fig. 4 reports the pca performed with the chemical parameters of the eligible grapes previously selected using the simca analysis. in this case too, no outliers were found according to the hotelling t2 test, confirming the homogeneity among the samples and indicating that they reasonably belong to the same class. figure 4. principal component analysis (pca) and hotelling t2 ellipse of the eligible grapes. the numbers inside the ellipse represent the grape samples whose wines fitted the wem. ital. j. food sci., vol. 30, 2018 196 similarly, as was done for the construction of the wem, to build the gem the number of pcs was chosen to reach a level of explained variance between 80 and 90%. for the purpose of this study, four pcs, which accounted for 81.72% of the total variance, were considered adequate. the simca analysis also allowed us to assess which factors are decisive in determining the classification of wines. the modeling power represents the contribution of each factor to building the model expressed as the variance of each variable. any variable having a modeling power higher than 0.3 was considered relevant in the model. in our study all the considered variables were relevant and in particular, hue (0.709), color intensity (0.704), monomer anthocyanins (0.699), and titratable acidity (0.628) were the variables with the greatest modeling power for the wines, followed by total phenol index (0.584), alcohol content (0.554), tannins (0.504), and ph (0.498). phase 3 – evaluation of clone performance lastly, the chemical profile of the grape clones was compared with the gem to classify their performance as a function of the clone, the sampling date, and the different growing areas. the results indicating which grapes had the chemical characteristics to fit the gem are reported in table 5. table 5. classification of the grapes (simca) as a function of the clone (12t, ap1, f09, m42, pec, r10, r24), the sampling date (9/10, 9/20, 9/30) and the different growing area (a, b, c, d); (●) grapes fitting the gem, (-) grapes not fitting the gem. a b c d 9/10 9/20 9/30 9/10 9/20 9/30 9/10 9/20 9/30 9/10 9/20 9/30 12t ! ! ! ap1 ! ! ! ! ! f09 ! ! ! ! ! m42 ! ! ! pec ! ! ! ! r10 ! ! ! ! r24 ! ! ! ! the clones showed a different performance according to the different growing areas and their ripening stage. considering the growing area as a factor, it can be seen that in zone a the ideal ripeness was reached in only four cases. in zone a, furthermore, only three clones were in accord with the parameters defined by the model: 12t, f09, and pec. area c, on the contrary, showed the highest number of clones that produced grapes with the desired characteristics. with regard to the performances of the individual clones, f09 resulted the only clone able to fit the model in all the growing areas on at least one of the sampling dates. the grapes from clones 12t, m42 and r10 fitted the model in two distinct zones: clone 12t in areas a and c; clone m42 in areas b and c; and clone r10 in areas b and d; the other clones (ap1 and r24) reached the maturity required by the model in three growing areas (areas b, c and d for clones ap1 and r24, and areas a, c, and d for clone pec). total potential in anthocyanins (0.797), extractable anthocyanins (0.699), and tannins (0.684) were the variables with the greatest modeling power for the grapes (expressed as ital. j. food sci., vol. 30, 2018 197 the variance of each variable) followed by cellular maturity index ea% (0.674), phenolic richness (0.607), titratable acidity (0.562), ph (0.505), and sugar (0.497). these results show the strong influence of the soil and climate on the ripeness parameters of sangiovese grapes. in growing area b five clones already fitted the model in the first sampling period, producing the fastest ripening. in this case, the grapes tended to exit the eligibility model over time. this highlights how the gem determined the unsuitability of grapes due to over-ripening, and therefore identified precise periods within which the quality of the grapes reaches its peak in relation to a particular enological target (wem). table 5 also shows how the model determined not only thresholds of acceptability but a real eligibility criterion. indeed, when all these variables are taken into account together, throughout the model, it creates a “space of acceptability where grapes transit over time,” with some of the grapes entering the space as they ripen while others, which were initially acceptable, are later expelled from the space of suitability by the model, because of overripening. it should be emphasized that the study was carried out in a single year, in order to propose a methodological approach. on the other hand, an adequate number of replicates over the years, taking into account the seasonal trends, should be analyzed when studying the performance of clones in a given area. 4. conclusions in the present study, grapes from seven sangiovese grape clones cultivated in the chianti classico region in tuscany were chemically characterized and compared, over the ripening period, to understand if non-genetic factors could affect the performances of different clones. in the first part of the study, the results showed that grape characteristics were influenced by all the factors considered: clone, growing area, and sampling date. the largest differences between the grapes, according to the phenolic composition, emerged when considering the growing area as a factor and the total anthocyanin content as a variable. the anthocyanin profiles were also affected by the different growing conditions and clones; the most abundant anthocyanins were malvidin-3-o-glucoside and cyanidin-3-oglucoside while acylated anthocyanins were detected in a very low amount (less than 2%), confirming the results for sangiovese wines reported elsewhere. in the second part of the study, a statistical model was developed to evaluate the impact of sangiovese variability on grape eligibility referring to a given enological target. for this purpose, a chianti classico sangiovese wine reference model (wem) was developed with the chemical characteristics of commercial wines from the same area. by comparing the composition of the experimental wines that fitted the wem with the relevant grapes, a model (gem) was defined that allowed us to discriminate the sangiovese grapes on the basis of their suitability to produce wines with the desired properties. the model could be expanded by inserting additional features such as aroma compounds or by using quick analysis methods such as ft-nir that can easily predict some chemical grape and wine parameters. with an adequate number of replicates, the proposed approach could be useful in zoning studies or in determining the performance of different varieties or clones with the goal of producing a typical sangiovese wine of the chianti classico region. moreover, it could be implemented as a more rational use of available analytical data both to monitor grape maturation trends and to improve the management of winemaking processes by transforming chemical analysis databases into active decision-making tools. ital. j. food sci., vol. 30, 2018 198 acknowledgements thanks to julian herszage for his help with the revision of the manuscript. references arapitsas p., perenzoni d., nicolini g. and mattivi f. 2012. study of sangiovese wines pigment profile by uhplcms/ms. j. agric. food chem. 60:10461-10471. arozarena i., ayestarán b., cantalejo m.j., navarro m., vera m., abril i. and casp a. 2002. anthocyanin composition of tempranillo, garnacha and cabernet sauvignon grapes from highand low-quality vineyards over two years. eur. food res. tech. 214:303-309. barbeau g., cousin m., blin a., panneau j-p., bouvet m-h. and mège a. 1999. méthodologie de sélection clonale chez la vigne (vitis vinifera). priese en compte de la précocité du cycle et de l’interaction clone x terroir. bull. oiv. 72:731-751. cadot y., caillé s., samson a., barbeau g. and cheynier v. 2012: sensory representation of typicality of cabernet franc wines related to phenolic composition: impact of ripening stage and maceration time. anal. chim. acta 732:91-99. campostrini f., de micheli l., bogoni m. and scienza a. 1995. study of genetic variability of sangiovese ecotypes as a tool for new strategies in clonal selection. in: proceedings of the international symposium of clonal selection. j.a. wolpert, m.a. walker, d. roberts (eds), pp. 105-110. portland, oregon. canuti v., puccioni s., giovani g., salmi m., rosi i. and bertuccioli m. 2012. effect of oenotannin addition on the composition of sangiovese wines from grapes with different characteristics. am. j. enol. vitic. 63:220-231. canuti v., picchi m., zanoni b., fia g. and bertuccioli m. 2017. a multivariate methodological approach to relate wine to characteristics of grape composition: the case of typicality. am. j. enol. vitic.68:49-59. castagnoli s.p. and vasconcelos,c. 2006. field performance of 20 ‘pinot noir’ clones in the willamette valley of oregon. hort technology 16:153-161. di collalto g., scalabrelli g. and ferroni g. 2000. primi risultati del comportamento bio-agronomico dei sei cloni di “sangiovese” nella zona di produzione del “morellino di scansano”. in: proceedings of the simposio internazionale “il sangiovese”, palazzo dei congressi, 15-17 febbraio 2000. pp. 265-270. firenze, italy. downey m.o., dokoozlian n.k. and krstic m.p., 2006. cultural practice and environmental impacts on the flavonoid composition of grapes and wine: a review of recent research. am. j. enol. vitic. 57:257-268. fidelibus m.w., christensen p.l., katayama d.g. and verdenal p-t., 2006. yield components and fruit composition of six ‘cabernet sauvignon’ grapevine selections in the central san joaquin valley, california. j. amer. pomological society 60:32-36. fidelibus m.w., christensen p.l., katayama d.g. verdenal p-t. and cathline k. 2007. fruit characteristics of six merlot grapevine selections in the central san joaquin valley, california. am. j. enol. vitic. 58:259-261. forde c.g., cox a. williams e.r. and boss p.k. 2011. associations between the sensory attributes and volatile composition of cabernet sauvignon wines and the volatile composition of the grapes used for their production. j. agric. food chem. 59:2573-2583. glories y. 1984. la couler des vins rouges. ii partie mesure, origine et interpretation. connaiss. la vigne du vin 18:253271. gonzález-neves g., barreiro l., gil g., franco j., ferrer m., moutounet m. and carbonneau a. 2004. anthocyanic composition of tannat grapes from the south region of uruguay. anal. chim. acta, 513:197-202. guidoni s., allara p. and schubert a. 2002. effect of cluster thinning on berry skin anthocyanin composition of vitis vinifera cv. nebbiolo. am. j. enol. vitic. 53:224-226. kontoudakis n., esteruelas m., fort f., canals j.m., de freitas v. and zamora f. 2011. influence of the heterogeneity of grape phenolic maturity on wine composition and quality. food chem. 124:767-774. koundouras s., marinos v., gkoulioti a., kotseridis y. and van leeuwen c. 2006. influence of vineyard location and vine water status on fruit maturation of nonirrigated cv. agiorgitiko (vitis vinifera l.). effects on wine phenolic and aroma components. j. agric. food chem. 54:5077-5086. ital. j. food sci., vol. 30, 2018 199 mattivi f., guzzon r., vrhovsek u., stefanini m. and velasco r. 2006. metabolite profiling of grape: flavonols and anthocyanins. j. agric. food chem. 54:7692-7702. official methods of wine analysis, reg. 440/2003. ortega-regules a., romero-cascales i., lòpez-roca j.m., ros-garcìa j.m. and gòmez-plaza e. 2006. anthocyanin fingerprint of grapes: environmental and genetic variations. j. sci. food agric. 86:1460-1467. peng z., iland p.g., oberholster a., sefton m.a. and waters e.j. 2002. analysis of pigmented polymers in red wine by reverse phase hplc. aust. j. grape wine res. 8:70-75. ranković-vasić z., nikolić d., atanacković z., sivčev b. and ruml m. 2015. characterization and adaptation of some ‘pinot noir’ clones to the environmental conditions of serbian grape growing regions. vitis 54:147-149. revilla e., garcía-beneytez e., cabello, f. 2009. anthocyanin fingerprint of clones of tempranillo grapes and wines made with them. aust. j. grape wine res. 15:70-78. ribereau-gayon p. 1970. le dosage des composés phénoliques totaux dans les vins rouges. chim. anal. 52:627-631. ristic r., bindon k., francis l.i., herderic m.j. and iland p.g. 2010. flavonoids and c13-norisoprenoids in vitis vinifera l. cv. shiraz: relationships between grape and wine composition, wine colour and wine sensory properties. aust. j. grape wine res. 16:369-388. ryan j.m. and revilla e. 2003. anthocyanin composition of cabernet sauvignon and tempranillo grapes at different stages of ripening. j. agric. food chem. 51:3372-3378. saint-criq de gaulejac n., vivas n. and glories y. 1998. maturité phénolique: definition et control. rev. française d’œnologie 173:14-21. tonietto j. and carbonneau a. 2004. a multicriteria climatic classification system for grape-growing regions worldwide. agric. forest meteorol. 124:81-97. wold s. and sjostrom m. 1977. simca: a method for analyzing chemical data in terms of similarity and analogy. chemometr theory appl 52:243-282. zanoni b., siliani s., canuti v., rosi i. and bertuccioli m. 2010. a kinetic study on extraction and transformation phenomena of phenolic compounds during red wine fermentation. int. j. food sci. & tech. 45(10):2080-2088. paper received september 14, 2017 accepted november 17, 2017 ijfs#1290_bozza ital. j. food sci., vol. 31, 2019 644 paper an investigation of the mechanical, microstructural and thermo-mechanical properties of collagen films cross-linked with smoke condensate and glutaraldehyde s. barbut* and m. ioi university of guelph, department of food science, guelph, ontario, canada, n1g 2w1 *corresponding author: tel.: +15198244120 e-mail address: sbarbut@uoguelph.ca abstract collagen films were produced from five commercial collagen dispersions used for in-line sausage co-extrusion production. films were prepared by partially dehydrating in a salt solution (30%) and crossed linked with smoke condensate (15%) or glutaraldehyde (ga; 01%). both treatments increased the tensile strength (0.32 to 0.91 mpa) and reduced % elongation while differences among the dispersions were observed. overall, % elongation generally decreased with a higher degree of cross linking. transmission electron micrographs revealed that collagen fibers were swollen to varying degrees, likely influencing the mechanical behaviours. protein concentration affected the transparency of the films with a difference of 100% in light transmission between the clearest and most opaque film studied. cross-linking with ga appeared to thermally stabilize films up to 80˚c. aldehydes in the smoke condensate were identified by gas chromatography showing highest concentration of benzaldehyde, 4-hydroxy-3,5-dimethoxy. keywords: casings, coating, collagen, cross-linking, glutaraldehyde, smoke condensate ital. j. food sci., vol. 31, 2019 645 1. introduction sausage products rely on casings to contain, form and bind the raw ground/emulsified meat placed inside them. after cooking (heat induced gelation) of the meat proteins, the casings can be removed from the product by the food processor (e.g., frankfurters produced in cellulose casings), by the consumer (salami produced in plastic casings) or consumed with the product (pepperettes produced in natural casings). prior to the early 20th century almost all casings were derived from animal intestines. since then, advancements in casing technology and manufacturing have led to several types of synthetic casings (e.g., cellulose, plastic) that can be tailored to a given process and product. with increasing sophistication, the production of manufactured casings was moved to designated plants, where collagen derived from hides is extracted, formed into tubes and then crosslinked with a strong crosslinking agent such as glutaraldehyde. when co-extrusion was more recently commercialized, on a large industrial scale (savic and savic, 2016), direct casing application was moved to the meat processing facilities. however, the issue of finding an acceptable mild crosslinking agent, that will also enable operating at a high speed production line, is still a challenge today (i.e., glutaraldehyde is not permitted to be used in food production areas, and in the off-premises casing manufacturing plants it is thoroughly washed away prior to shipping) and hence the need for the current investigation. co-extrusion is the process of extruding a cylindrical core of sausage meat, while simultaneously extruding an outer layer of casing material directly on to the meat’s surface. subsequent processes include: brining, smoking, drying and cooking. they are needed to stabilize and harden the casing material by osmotically removing water, and later chemically cross-linking the building blocks of the casing material (e.g., collagen, alginate). stabilizing the casing is essential, as the casings require strength and elasticity to undergo linking, packaging, storage and reheating. since casings are formed directly on the meat’s surface, co-extrusion systems must use a suitable brining (e.g., concentrated salt solution) and cross-linking agents that will set the casings fairly quickly (morgan et al., 1998). smoke condensates are commonly used as chemical cross-linking agents, as their aldehydes form covalent linkages between collagen molecules and fibers. exposure to smoke condensates enhances the mechanical properties of the casing, and also provides the sausage with colour, flavour and some antimicrobial properties. in co-extrusion, smoke condensate is favoured over traditional smoking (burnt wood shavings) because of the ability to work with higher concentrations, product’s uniformity, and the intense colour they can provide during a short exposure time (morgan et al., 1998; bontjer et al., 2011). smoke condensates are produced by combustion of hard woods (e.g., cherry, oak), while the smoke is moved through a shower of water droplets that collect the aldehydes, ketones, furans, phenols, and acids (toledo, 2007). when dry regenerated collagen casings are produced (in special plants), glutaraldehyde (ga) is used as a cross-linking agent, and is later thoroughly washed off the casings before the drying process (avery and bailey, 2008; morgan et al., 1998; savic and savic, 2016). glutaraldehyde is also used as a leather tanning agent, production of medical constructs made from collagen, and tissue fixative (covington, 1997; cheung and nimni, 1982). it is able to form stable bonds among proteins and increase the mechanical properties of collagen fibers. the mechanism of glutaraldehyde’s reactions has been studied quite a lot in order to help improve the modification of collagenous materials (cheung and nimni, 1982; barbut, 2015). overall, it has been shown that ga reacts with amine groups, specifically lysine, to form heterocyclic compounds. subsequent oxidation reactions produce pyridine rings (englert et al., 2007). although ga is a ital. j. food sci., vol. 31, 2019 646 highly functional cross-linking agent, cytotoxic effects have limited its direct food applications, including in semi-liquid casing application as used in co-extrusion. however, as mentioned above in designated casing producing plants it is used as part of the manufacturing of regenerated collagen casings that subsequently go through an extensive washing process to remove all the ga residues. overall, there has been a substantial effort to understand the properties of collagenous materials and the effects of different cross-linking agents (o’sullivan et al., 2006; wolf et al., 2006; tomihata et al., 1994; olde damik et al., 1995). however, little has been published about the effectiveness of cross-linking agents on the performance of commercial co-extrusion collagen products. this study was designed to address this area in two steps. first, the effects of smoke condensate (currently used in meat processing plants for the wet co-extrusion process), and glutaraldehyde (used in special plants to make regenerated dry manufactured collagen casing) concentration and contact time were examined by evaluating the mechanical properties of collagen films. this was done to provide an insight into potential manipulation of the mechanical properties of coextrusion collagen casings. the second study examined the mechanical, microstructural and thermal properties of cross-linked films to compare the similarities and differences in functionality of different commercial collagen dispersions. 2. material and methods 2.1. study i. manipulation of cross-linking conditions 2.1.1 preparation of films five commercial collagen dispersions used for sausage extrusion processes were obtained from major manufacturers. the dispersions were labeled as: collagen 1 through 5 (c1, c2, c3, c4, c5). protein content was determined by the dumas method (leco fp528, st joseph, mi, usa) using a nitrogen factor of 6.25. moisture content was determined by drying triplicate samples (5 g) at 105°c for 24 h. the method of film formation was adapted from the work of harper et al. (2013) with alginate solutions and was performed at 4˚c to reduce adhesion during film formation. briefly, the samples were degassed using a vacuum packager (multivac canada inc., woodbridge, on, can) at 7.3 kpa for 25 s, then again at 7.3 kpa for 50 s and 75 s (settings 4, 6 and 8, respectively) to remove gas bubbles that were incorporated during processing, as they can create weak spots in the films. while still in the vacuum pack bags, the dispersions were mixed by rolling the dispersions 10 times in adjacent directions. later, approximately 3 g portions were rolled on a stainless steel board between two layers of plastic film, with a stainless steel roller. the roller had a recess of 0.50 mm in order to achieve uniform film thickness. the plastic sheet on the roller side of the film was removed and the remaining plastic sheet with the collagen film on it was then placed in a 30 wt.% sodium chloride (prepared in deionized water) for 5 min, in order to dehydrate the film. the nacl treatment mirrors the industrial practice of dehydrating the film (avery and bailey, 2008). after 5 min, the film was strong enough to hold together when removed from the plastic sheet. the plastic sheet was folded onto the formed film to prevent further dehydration of the film before it was moved to the cross-linking solution. the goal of the first study was to determine the best exposure time and cross-linking agent concentration to obtain a good quality film/casing. for this part we used collagen 2, which is one of the most common dispersions currently used by the meat industry. the partially dehydrated films (i.e., by the salt solution) were cross-linked with either liquid ital. j. food sci., vol. 31, 2019 647 smoke condensate (charsol select 24p liquid smoke, red arrow products, manitowoc, wi, usa) or glutaraldhyde (em grade, canemco, canton de gore, qc, can). the application of liquid smoke is a standard treatment used by the meat industry, while glutaraldehyde was used here as a control treatment with a known aldehyde (crosslinker) concentration. the films were immersed in a 15 vol.% smoke condensate in deionized water, i.e., based on industry recommendation/procedure. films were held in the diluted smoke condensate bath for 10, 20, 40 or 80 s. following cross-linking, films were covered with a plastic sheet to avoid drying before testing. as indicated above, glutaraldehyde (ga) was used because its mechanism of cross-linking is better understood, thus its effects could be used as a reference/standard. films were cross-linked in solutions of 0.1, 0.5 and 1.0 vol.% ga in 1m hepes buffer at ph 7.4 (fisher scientific, ottawa, on, can). the partially dehydrated films were immersed in the ga solution for 5, 10 or 20 min intervals (note: longer times were used because of the low ga concentrations), followed by a 5 min rinse in water to remove ga residues. similar to cross-linking with smoke condensate, the films were later covered with plastic to avoid dying before testing. 2.1.2 mechanical properties the standard tensile test (astm, 2010) was used, by employing a texture analyzer (taxt2i, texture technologies corporation, scarsdale, ny, usa) with a gripper distance set at 50 mm, trigger force at 5 g, test speed at 2 mm/s and test distance of 25 mm. six measurements were made to calculate an average thickness, using a digital micrometer (testing machines inc., islandia, ny, usa), of each film in each of the three trials. films were cut into 75 mm × 25 mm strips. the average thickness and width of the films were used for the tensile stress calculations. tensile strength (maximum stress the film endured prior to breaking) and the percent elongation (maximum elongation the film reached prior to breaking) were determined from the generated stress–strain curve. puncture force was also examined using the texture analyzer. in this test, a 5 mm stainless steel ball probe was used to puncture films mounted in an extensibility fixture with 10 mm diameter round openings (ta-108s5, texture technologies, corporation, scarsdale, ny, usa). the test speed was 1 mm/s and the trigger force was 5 g. the distance to puncture and work of puncture were determined from the force–distance curve. a total of eighteen measurements were used for each of the treatments (six measurements per trial). 2.1.3 experimental design and statistical analysis the experiment was designed as a randomized complete block with 3 independent trials. each trial consisted of evaluating six samples per treatment. the statistical analysis was performed using sas version 9.2 (sas inst., cary, nc, usa). a general linear model was used for the analysis of variance (anova). the film type means and interactions were compared by using tukey's multiple comparison analysis with a p-value ≤ 0.05, which was used to detect statistical significance. 2.2. study ii. evaluation of cross-linked collagen dispersions 2.2.1 preparation of films collagen films were prepared from the five dispersions, as described before. in this part they were cross-linked with either 15 vol.% smoke condensate in deionized water, for 40 s, or with 0.5 vol.% ga in 1m hepes buffer at ph 7.4 for 5 min, followed by a 5 min rinse. ital. j. food sci., vol. 31, 2019 648 2.2.2 characterization of smoke condensate the smoke condensate was diluted in methanol and injected directly to a gas chromatograph (gc-ms 1200, varian, palo alto, ca, usa) to determine both volatile and semi-volatile compounds. compounds were tentatively identified based on the nist library provided with the instrument. 2.2.3 transmission electron microscopy (tem) tem was performed on collagen films, raw collagen and cellulose fibers as controls. the films were fixed in 2.0% glutaraldehyde, buffered with hepes (ph 7.4) for 90 min. this was followed by fixing in osmium tetroxide and dehydration through a series of graded ethanol solutions (50%, 70%, 80%, 90%, and 100%), each for 10 min. once the films were dehydrated, they were run through a series of propylene oxide and spurr’s resin solutions (1:0, 3:1, 1:1, 1:3 and 0:1) to ensure that the resin was thoroughly incorporated, prior to embedding. the resin was polymerized for 24 h at 60˚c. samples were then cut into 70 to 90 nm sections on a microtome (reichert ultracut s, leica microsystems inc., concord, on, can), fixed on grids, stained with saturated uranium acetate and lead citrate (hayat, 2000). negative staining was used to prepare raw collagen and cellulose fibers as controls. the collagen control was prepared by hydrating dried bovine hide sample (provided by the meat laboratory at the university of guelph) for 24 h at 23˚c. the ph was then lowered to 2 and blended to aid in dispersion and fiber swelling. the cellulose control was a 0.1 wt.% solution of powdered cellulose (arbocel, jrs, schoolcraft, mi, usa). one drop of the control solution was placed on a formvar-coated grid and the excess solution was removed with a filter paper. a drop of 2% uranium acetate was then applied to stain the sample. after 30 s, the excess uranium acetate was removed with a filter paper and the grids were dried, on the bench top. samples were examined by a tem (philips cm 10, philips scientifics, eindhoven, nb, nl) and photographed (olympus morada camera, olympus soft imaging system, berlin, ger) using item imaging software (item software, whiteley, hph, uk). 2.2.4 optical property the light transmission (380–780 nm) of the films was evaluated using a single beam spectrophotometer (usb 2000, ocean optics inc., dunedin, fl, usa). the following settings were used: integration time: 100 ms: scans to average 2; and boxcar width 4. the light transmission was measured on twelve films per collagen sample. 2.2.5 mechanical properties of thermally treated films cross-linked films from collagen 2 (c2) were mounted in the puncture fixture and placed in a plastic bag. the fixture and bag were lowered into a water bath at 40, 50, 60, 70 or 80˚c and held for 15 min. the puncture test was performed immediately after thermal treatment. the puncture test was performed as previously described. once again, a total of eighteen measurements were used for each of the thermal treatments (six measurements per trial). ital. j. food sci., vol. 31, 2019 649 2.2.6 experimental design and statistical analysis the experiment was designed as a completely randomized block with 3 independent trials. each trial consisted of evaluating six sub-samples per treatment. the statistical analysis was performed as indicated above. 3. results and discussion 3.1. study i. manipulation of cross-linking conditions 3.1.1 mechanical properties the goal of the first study was to determine the best exposure time to obtain a good selfsupporting collagen film, and for this we focused on collagen 2, which is currently the most commonly used preparation. the results of the tensile test (fig. 1) demonstrate that there were no significant differences (p > 0.05) in the tensile strength and % elongation when films were exposed to smoke condensate for 10 to 80 s. the results were obtained by using collagen 2, which is one of the most commonly used collagen dispersions in the industry. the ph of the dispersion was 2.21 and is in line with the values of the other dispersions (c1=2.06; c3=2.01; c4=2.67; c5=2.04). according to manufacturers, the swelling agent for c3 was hcl, for c4 it was hcl/acetic acid; this information was not provided for c1, 2 and 5. overall, the results reveal that after 10 s exposure the film gains a certain degree of cross-linking, and further exposure does not have a significant effect. it should be pointed out that after 10 s the film is removed from the solution but not rinsed so the amount of liquid smoke picked up by the film keeps on working. overall, crosslinking, by intramolecular bonds, are formed between collagen molecules and fibers. the formation of covalent cross-links prevents collagen fibers from sliding past each other, thus reducing the film’s ability to undergo deformation (rault et al., 1996; paul and bailey, 2003). from a practical point of view, the results indicate that the meat processor would not be able to significantly modify the tensile properties of their casings by increasing the contact time, within this range (10 to 80 s). as noted in the method section, the concentration of smoke condensate used here was based on industry practices/recommendations. figure 1. mechanical properties of collagen films produced with increasing exposure times to smoke condensate (15 vol.% in deionized water). samples made from collagen 2. means with the same letter are not significantly different (p > 0.05). ital. j. food sci., vol. 31, 2019 650 this study employed a commonly used liquid smoke condensate, currently used by various meat processors for co-extrusion applications. overall, it is known that the composition of smoke condensates can vary, because of variations in the proportion of compounds such as aldehydes and phenols in the hard wood used to produce the condensates (guillén and manzanos, 1999; montazeri et al., 2013). since aldehyde compounds are linked to the smoke’s cross-linking ability, variations in their concentration could potentially produce different results related to tensile strength. in order to address this point, laboratory grade glutaraldehyde (ga) with a known aldehyde concentration was also used in our study. the mechanical properties of the glutaraldehyde-treated films (table 1) show that the tensile strength and % elongation were basically in the same range as obtained by the smoke condensate. when using ga there were no significant interactions between the ga concentration and exposure time. also, the results indicate that there was no significant difference (p > 0.05) in the percent elongation between 5 and 20 min exposure (fig. 2). thus, exposure time appears to have a greater effect on tensile strength when cross-linking with ga. this difference might be attributed to the concentration of the cross-linking agent in the ga solution. the results also suggest that manipulating the concentration of ga will have significant differences (p < 0.05) on the tensile and puncture properties of the collagen films. the most notable effect of increasing ga concentration (0.1 to 1.0 vol.%) was the significant decrease in percent elongation and distance to break (fig. 2). these observations are consistent with those discussed by avery and bailey (2008). overall, it appears that over cross-linking with ga would make the films less stretchable. table 1. mechanical properties of collagen films produced with increasing exposure time and concentration of glutaraldehyde; samples made from collagen 2. concentration vol.% time min tensile strength mpa percent elongation % distance to break mm work to break n*mm 5 0.564±0.14 22.475±2.11 3.012±0.26 1.537±0.56 0.1 10 0.765±0.09 23.213±1.72 2.911±0.31 1.590±0.28 20 0.833±0.12 20.741±0.96 2.787±0.35 1.566±0.31 5 0.502±0.06 20.137±1.21 2.517±0.24 1.068±0.05 0.5 10 0.664±0.02 20.381±1.43 2.338±0.44 1.058±0.37 20 0.577±0.05 19.661±3.28 1.952±0.48 0.672±0.19 5 0.708±0.08 20.921±2.96 2.071±0.63 1.630±0.90 1.0 10 0.680±0.15 15.877±2.80 1.784±0.72 1.276±0.61 20 0.764±0.16 17.591±3.68 1.634±0.59 1.135±0.69 3.2. study ii. evaluation of cross-linked collagen dispersions 3.2.1 mechanical properties the mechanical properties of casings play a crucial role in sausage production. they affect sausages’ structural integrity, shape, volumetric changes, textural properties, and behavior during processing (savic and savic, 2016). for example, during traditional production, casings must withstand tensile stresses during stuffing, and hanging in the smokehouse. in addition, casings must provide compressive strength during meat protein gelation (heating) and exhibit elasticity during cooling the product (savic and savic, 2016). ital. j. food sci., vol. 31, 2019 651 examining properties such as percent elongation, and tensile strength, can help to predict the success of a casing. figure 2. mechanical properties of collagen films produced with increasing contact times to glutaraldehyde and concentration of glutaraldehyde. samples made from collagen 2. the contact time means were averaged across all concentration (0.1, 0.5, 1.0 vol.%) and the concentration means were averaged across all contact times (5, 10 and 20 min). means in the same graph with same letter are not significantly different (p > 0.05). in the second study, the five different collagen dispersions were compared. overall, they all had a protein content or 4.3±0.8% (c1=5.1; c2=3.6; c3=3.7; c4=4.4; c5=4.8%) and moisture content of 94.5±1.0% (c1=93.5; c2=95.5; c3=93.5; c4=94.0; c5=93.7%). after partially drying the casings, by exposing them to a salt solution (30% salt as is also done by the industry), all the films showed a pretty similar moisture content (76.0±1.5%, where ital. j. food sci., vol. 31, 2019 652 c1=74.5; c2=77.5; c3=74.5; c4=75.0; c5=77.0%). tensile strength and percent elongation results (table 2) showed that there were some significant differences among the various collagen films. the film produced with collagen 4 (c4) had the lowest tensile strength (0.32 mpa) when cross-linked with smoke condensate, and c3 (0.41 mpa) when crosslinked with ga. in any case, both c3 and c4 showed low tensile strength under both cross-linking treatments. savic and savic (2016) indicated that a greater degree of native and intact fibrillar structures produce higher strength and elasticity in collagen casings. the c3 and c4 collagen dispersions may have undergone further degradation during processing, resulting in their lower tensile properties. for instance, excessive mechanical or alkaline modification, during corium separation, can result in greater degradation of the native collagen fibers (savic and savic, 2016). the influence of protein concentration on the mechanical properties was also investigated (table 3). when comparing adjusted mechanical properties (i.e., per % protein), again c3 and c4 were found to result in low tensile strength values when cross-linked with smoke condensate. when cross-linked with ga, c3 showed the lowest value (0.077 mpa/% protein). when looking at % elongation, the samples that showed the lowest values when tested as received (i.e., their original protein content) also showed the lowest values when compared on a % protein basis (sample c5 treated with smoke condensate, and sample c3 treated with ga; tables 2 and 3). these results indicate that the mechanical properties of films may be more dependent on the quality of protein, rather than on protein content. another factor that may have led to differences in mechanical properties was the concentration of cellulose fibers within the partially dried films tested here. mathew et al. (2012) observed that interactions between cellulose nanofibers and collagen significantly increased the strength and break strain of fully dry collagen films. note: see below additional discussion and micrographs concerning cellulose fibers. it is important to note that cross-linking has a dramatic effect on the mechanical properties of partially dehydrated films (i.e., with salt solution). cross-linking with smoke condensate or ga appeared to increase the tensile strength of collagen films by approximately 100% and 200% (respectively) over the values obtained after salt solution partial drying (barbut, unpublished data), which were in the range of 0.2 to 0.3 mpa. in addition, the distance to break was reduced by 30% and 60%, when cross-linked with smoke condensate and ga, respectively. as suggested by others (avery and bailey, 2008; covington, 1997; paul and bailey, 2003) cross-links increase the mechanical strength by forming bonds among the collagen molecules/fibers and preventing them from sliding past each other, creating a stiff but brittle network within the films. overall, there were some differences in the mechanical properties between films crosslinked with smoke condensate and ga. in general, films cross-linked with ga showed greater tensile strength than those cross-linked with liquid smoke (table 2). smoke condensates typically contain over 300 compounds (toledo, 2007) therefore, the differences observed in tensile strength can likely be attributed to the purity of the crosslinking agent. the smoke condensate was analyzed to determine the type and concentration of its aldehyde compounds (table 4). it was observed that the aldehyde compounds were all mono-functional aldehydes. the effect of various monoand dialdehydes (formaldehyde, gluteraldehyde, crotanaldehyde and glyoxal) on the thermal and conformational stability of type i collagen has been investigated by fathima et al. (2004). their work suggested that the aldehydes differ in their ability to improve the thermal stability of collagen. it was observed that the increase in thermal stability followed the order: formaldehyde > gluteraldehyde > glyoxal > crotanaldehyde, thus demonstrating that di-aldehydes are not necessarily more functional than monoaldehydes. ital. j. food sci., vol. 31, 2019 653 table 2. mechanical properties of cross-linked films: c1 (collagen 1), c2 (collagen 2), c3 (collagen 3), c4 (collagen 4) and c5 (collagen 5). collagen cross-linker1 tensile strength 2 mpa percent elongation2 % distance at break3 mm work to break3 nmm thickness mm c1 sc 0.67±0.04a 24.80±1.23ab 3.85±0.22a 2.75±0.48a 0.35±0.01ab c2 sc 0.53±0.02ab 26.32±1.18a 3.39±0.18a 1.52±0.14a 0.30±0.01b c3 sc 0.38±0.05b 22.41±0.78abc 3.21±0.30a 1.24±0.34a 0.34±0.01ab c4 sc 0.32±0.07b 21.37±0.99bc 3.27±0.35a 1.23±0.31a 0.36±0.02a c5 sc 0.39±0.16b 18.81±2.08c 2.59±0.04a 0.85±0.10a 0.38±0.03a c1 ga 0.91±0.17d 26.26±4.65d 2.77±0.52d 1.79±0.57d 0.36±0.03d c2 ga 0.66±0.02e 20.38±1.43d 2.34±0.44d 1.06±0.37d 0.45±0.01d c3 ga 0.41±0.13f 18.95±2.56d 2.66±0.39d 1.35±0.27d 0.38±0.05d c4 ga 0.61±0.20ef 24.18±3.72d 2.74±0.29d 1.52±0.11d 0.38±0.04d c5 ga 0.60±0.18ef 22.04±2.60d 2.87±0.60d 1.91±0.76d 0.39±0.05d 1smoke condensate (sc), glutaraldehyde (ga). 2tensile test. 3puncture test. 4means in columns with same letter are not significantly different p > 0.05: letters a-crefer to smoke condensate treated films; d-eglutaraldehyde treated films. table 3. protein adjusted mechanical properties of cross-linked films: c1 (collagen 1), c2 (collagen 2), c3 (collagen 3), c4 (collagen 4) and c5 (collagen 5). collagen cross-linker1 tensile strength 2 mpa / %protein percent elongation2 % / %protein distance at break3 mm / %protein work to break3 n*mm / %protein c1 sc 0.092±0.01ab 3.36±0.17bc 0.38±0.07a 0.24±0.08a c2 sc 0.101±0.00a 4.98±0.23a 0.45±0.08a 0.20±0.07a c3 sc 0.062±0.01b 3.67±0.13b 0.44±0.06a 0.22±0.04a c4 sc 0.056±0.01b 3.68±0.17b 0.47±0.05a 0.26±0.02a c5 sc 0.058±0.02b 2.77±0.31c 0.42±0.09a 0.28±0.11a c1 ga 0.140±0.03d 4.05±0.72d 0.43±0.08d 0.28±0.09d c2 ga 0.131±0.00d 4.02±0.28d 0.46±0.09d 0.21±0.07d c3 ga 0.077±0.03e 3.59±0.48d 0.50±0.07d 0.26±0.05d c4 ga 0.120±0.04de 4.77±0.73d 0.54±0.06d 0.30±0.02d c5 ga 0.118±0.04de 4.34±0.51d 0.57±0.12d 0.38±0.15d 1smoke condensate (sc), glutaraldehyde (ga). 2tensile test. 3puncture test. 4means in columns with same letter are not significantly different p > 0.05: letters a-crefer to smoke condensate treated films; d-eglutaraldehyde treated films. ital. j. food sci., vol. 31, 2019 654 it was suggested that the number of cross-links formed influence the stability of the crosslinks, therefore the reactivity of the aldehyde is of greater importance. the reactivity of mono and di-aldehydes is thought to stem from sterochemical factors and ph (increase uptake at higher ph) as was indicated by bowes and cater (1968). although according to our calculation the smoke condensate had a higher percentage of different aldehydes (0.95%; table 4), compared to the 0.5% glutaraldehyde used in the experiment, it appears that glutaraldehyde is a more reactive cross-linker that overall provided higher tensile strength values to the films (tables 2 and 3). it should be mentioned that the ph of the cross-linking solution may have also affected the mechanical properties of the films. morgan et al. (1998) suggested that neutralizing the acidic collagen dispersion would result in water loss. similar to dehydrating films with a salt brine, the removal of water will result in shorter distances between the collagen molecules and hence improve the stability of the collagen structure. the smoke condensate was used as is (i.e., not buffered; at ph 3.5) while the ga was buffered (ph 7.4). thus the buffered solution could have increased the neutralization of the collagen gels, and in turn, improving stabilization. table 4. tentative identification of aldehyde compounds found in the commercial smoke condensate, the relative concentration (%) and approximate concentration in the cross-linking bath. tentative id relative % cross-linking bath1 % 2,4-diethoxybenzaldehyde 0.47 0.07 4-methyl 2,5-dimethoxybenzaldehyde 1.24 0.19 benzaldehyde, 4-hydroxy-3,5-dimethoxy 3.22 0.48 2-oxa-6-azatricyclo[3.3.1.1(3,7)]decane-6-carboxaldehyde 0.47 0.07 3,5-dimethoxy-4-hydroxycinnamaldehyde 0.92 0.14 (aldehyde in smoke condensate) (6.32 0.95) 1 the original smoke condensate received was diluted to 15 vol.% using deionized water. 3.2.2 electron microscope imaging the collagen fibers appear to have varying degrees of swelling or hydration (fig. 3). overall in natural tendon tissue, collagen fibrils are long, slender and show cylindrical structures, but can differ in length, diameter, uniformity, and telopeptide size, as a result of collagen type and interactions (wess, 2008; cameron et al., 2002). the alignment of collagen molecules in a staggered array conformation develops areas of overlap and gaps. the overlap and gap regions of the parallel arrays give collagen fibrils their distinctive striated pattern with a periodicity of 640-700 å (wess, 2008). the control collagen sample (obtained by us from beef hide) was imaged to compare the likeness of the banded fibers (fig. 4a). it appeared that, at this magnification, the banded structures were indicative of collagen fibers. in addition, the bulk material, presented in this micrograph, shares similar characteristics to the collagen tissue studies by meyer et al. (2005). although some collagen fibers display a banding pattern or cross-striations (fig. 3), the majority of the fibers presented in the current work appear to be swollen. since commercial collagen dispersions are extracted from hides that have varying degree of natural cross-linking, the degree of cross-links varies depending on animal age, growing conditions, overall muscle activity, etc. overall, there is an increase in natural cross-links, ital. j. food sci., vol. 31, 2019 655 with increasing age and therefore the solubility also decreases (meyer et al., 2005). in addition, the connective tissue extraction process would be expected to result in varying degree of fiber degradation. figure 3. transmission electron micrographs of collagen film: collagen c1 (a), collagen c2 (b), collagen c3 (c), collagen c4 (d), collagen c5 (e). black bar represents 1 !m. the final collagen structure supports the mechanical properties of the film because a more intact fibrillar structure produces higher strength and elasticity in collagen casings (savic and savic, 2016). the c4 appeared to have the most swollen or hydrated fibers, with little visible banded fibrils remaining (fig. 3d). since c4 generally revealed lower tensile strength and percent elongation (table 2), one may presume that greater swelling and hydration during collagen extraction, with hcl, and acetic acid resulted in lower mechanical properties. however, definite conclusions cannot be drawn as the orientation and plane at which the fibrils are viewed is not known with certainty. ital. j. food sci., vol. 31, 2019 656 figure 4. transmission electron micrographs of a collagen control obtained from beef hide (a), a cellulose control (b) and a cellulose fiber embedded in a collagen film network (c). black bar represents 1 !m in micrograph (a) and 5 !m in micrographs (b) and (c). another interesting observation was that there appears to be differences in the linearity of fibers. the fibers in c1 appear to be arranged in a less linear way compared to the other treatments. c1 also appears to have a higher concentration of more condensed fibers, which may have hindered alignment of the fibers during film preparation by rolling. it should be pointed out that during the formation of commercial co-extruded casings, a counter rotating extrusion head applies shear forces, which orientates and elongates the collagen fibers (hoogenkamp et al., 2015). orienting the fibers improves the mechanical properties of casing by reducing splitting (bontjer et al., 2011). overall, it would be interesting to further investigate this topic to further assist the industry. microstructure imaging the films did not suggest significant differences in the concentration of cellulose in the five dispersions. as previously mentioned, cellulose fibers are commonly added to modify the mechanical properties and porosity of collagen casings (savic and savic, 2016; barbut, 2010). to verify that the larger fiber structures were derived from cellulose, a cellulose control (fig. 4b) was imaged, demonstrating the difference in structure and magnitude. an example of a cellulose fiber embedded in the collagen network of one of the dispersions can be seen in fig. 4c. overall, cellulose fibers can be distinguished based on their larger size, lack of striation and electron density. 3.2.3 optical properties of films the degree of light transmission through casings affects consumer’s ability to evaluate the meat product inside (savic and savic, 2016). light transmission measurements were ital. j. food sci., vol. 31, 2019 657 taken to evaluate the transparency of cross-linked collagen films (fig. 5). among the collagen films, c5 was the least transparent and c2 was the most. simple visual inspection also confirmed that c5 was more opaque than the other samples. the micrograph of the c5 films also showed high concentration of individual fibrils and sub-fibrils, which could result in higher light scattering. light transmission is also affected by the composition of each casing (savic and savic, 2016). c2 was on the lower end of protein content (3.6%), which may have contributed to it being the most transparent. figure 5. the light transmission (380 to 780 nm) through cross-linked collagen films; c1 (collagen 1), c2 (collagen 2), c3 (collagen 3), c4 (collagen 4) and c5 (collagen 5). a films cross-linked with liquid smoke; b films cross-linked with glutaraldehyde. films treated with liquid smoke tended to have lower transmission than films treated with glutaraldehyde (fig. 5). this observation is likely a result of some dark smoke components that became deposited on the films. there was no difference in the ranking of transparency between the liquid smoke and glutaraldehyde treated films. this observation is somewhat inconsistent with tanaka et al. (2011), who observed that increased crosslinking results in lower transmission of wet collagen films cross-linked with 1-ethyl-3-(3dimethylaminopropyl) carbodimide and n-hydroxysuccimide. 0 20 40 60 80 100 380 420 460 500 540 580 620 660 700 740 780 li gh t t ra ns m is si on (% ) wavelength (nm) c1 c2 c3 c4 c5 a 0 20 40 60 80 100 380 420 460 500 540 580 620 660 700 740 780 li gh t t ra ns m is si on (% ) wavelength (nm) c1 c2 c3 c4 c5 b ital. j. food sci., vol. 31, 2019 658 3.2.4 mechanical properties of thermally treated films table 5 shows the puncture distance and work to puncture as an effect of heating temperature. in general, as heating increases, puncture distance significantly decreased and work to puncture showed a trend of decreasing. this is in line with the expectation that collagen tissue, in muscle foods, softens as temperature goes above the collagen denaturation temperature of 60˚c (miles et al., 2005). overall, there were no measurements recorded from testing the films cross-linked with smoke condensate because the films became too fragile to be evaluated by the texture analyzer. as previously suggested, the collagen in films cross-linked with smoke condensate may have remained more swollen and had higher water content. the higher water content may have resulted in lower thermal stability of these films. miles et al. (2005) suggested that the increased thermal stability is a result of the water content of the fibers. they observed that crosslinking reduced the axial separation between molecules, thus reducing the amount of entrapped water. avery and bailey (2008) observed that cross-linking agents, having different cross-link length, had no effect on denaturation temperature when hydration was done in the same way. table 5. mechanical properties (puncture distance and work to puncture) of collagen films cross-linked with glutaraldehyde and thermally treated. films produced with collagen 2. thermal treatment puncture distance mm work of puncture mj no treatment 3.781±0.75a 2.576±0.82a 40°c 3.180±0.17ab 2.053±0.16a 50°c 3.151±0.57ab 2.584±0.45a 60°c 2.838±0.25ab 1.844±0.63a 70°c 2.423±0.13b 1.265±0.30a 80°c 2.578±0.23b 1.518±0.40a 1means in columns with a similar letter are not significantly different (p > 0.05). in the present study, collagen may have not undergone full thermal denaturation by 80˚c when films were cross-linked with ga (avery and bailey, 2008). cross-linking with ga has been observed to increase the denaturation temperature of collagen to approximately 100˚c (miles et al., 2005). our results may suggest that the thermal stability of cross-linked casings depend more on moisture content than cross-links. 4. conclusions it was observed that manipulating the smoke condensate contact time (10, 20, 40, 80 s) did not result in significant differences (p > 0.05) in the mechanical properties of collagen films. similarly, the ga contact time (5, 10, 20 min) did not result in significant differences in mechanical properties, when averaged across the ga concentrations employed. although contact time had little effect, increasing the concentration of cross-linking with ga (0.1, 0.5 1.0%) significantly decreased the % elongation (22 to 17%) and distance to break (3.0 to 1.6 mm). this suggests that increasing the ga concentration increases crosslinking and brittleness of the film. ital. j. food sci., vol. 31, 2019 659 there were some significant differences between the mechanical properties of the different cross-linked films. it was suggested that fiber structure, cellulose content and ph of the cross-linking agent could influence the mechanical properties. therefore manufacturers of regenerated collagen casings and producers of co-extruded sausages should consider these differences when selecting a source of collagen for their casings. in addition, meat processors should monitor the concentration and ph of their crosslinking solution as solutions from a continuous liquid smoke drip/spray application are known to become diluted over time. as discussed in the paper, these changes may significantly affect the mechanical properties of the collagen films. overall, proper understanding is required when selecting the raw collagen dispersion and the conditions for the co-extrusion process. furthermore, if products are going to be cooked, the casings may require further heating and dehydration, which will also change their mechanical properties. acknowledgements the authors would like to thank the ontario ministry of agriculture, food and rural affairs for financial support. references astm. 2010. standard test method for tensile properties of this plastic sheeting. method d882-10, philadelphia, pa. avery n. and bailey a. 2008. restraining cross-links responsible for the mechanical properties of collagen fibers: natural and artificial. in “collagen structure and mechanics”, p. fratzl (ed.), p. 81. springer science, new york, ny. barbut, s. 2015. casings. in: “the science of poultry and meat processing”, p.13-54 and 62. isbn-978-088955-625-6. free download: www.poultryandmeatprocessing.com. barbut s. 2010. microstructure of natural, extruded and co-extruded collagen casings before and after heating. ital. j. food sci. 22:126. bontjer m.b.h., kuijpers m.w.j.t. and van den berg k.w. 2011. method for preparing food products by co-extrusion, in particular sausage and food products obtained with this method. european patent wo 2006 135238. bowes j.h. and cater c.w. 1968. the interaction of aldehydes with collagen. biochim. biophys. acta 168: 41. cameron g.j., alberts i.l., laing j.h. and wess t.j. 2002. structure of type i and type iii heterotypic collagen fibrils. an x-ray diffraction study. j. struct. biol. 137:15. cheung d.t. and nimni m.e. 1982. mechanism of crosslinking of proteins by glutaraldehyde ii reaction with monomeric and polymeric collagen. connect. tissue res. 10: 201. covington a.d. 1997. modern tanning chemistry. chem. soc. rev. 26:111. englert c., blunk t., muller r., von glasser s.s., baumer j., fierlbeck j., heid i.m., nerlich m. and hammer j. 2007. bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking. arthritis res. therapy. 9(3):r47. fathima n.n., madhan b., rao j.r., nair b.u. and ramasami t. 2004. interaction of aldehydes with collagen: effect on thermal, enzymatic and conformational stability. international j. biol. macromol. 34:241. guillén m.d. and manzanos m.j. 1999. smoke and light smoke study of an aqueous smoke flavouring from the aromatic plant thymus vulgaris l. j. sci. food agr. 79:1267. harper b.a., barbut s., lim l-t. and marcone m.f. 2013. characterization of ‘wet’ alginate and composite films containing gelatin, whey or soy protein. food res. int. 52:452. ital. j. food sci., vol. 31, 2019 660 hayat m.a. 2000. “principles and techniques of electron microscopy biological applications” 4th ed. p. 120. cambridge university press, cambridge, uk. hoogenkamp h.r., bakker g.j., wolf l., suurs p., dunnewind b., barbut s., friedl p., van kuppevelt t.h. and daamen w.f. 2015. directing collagen fibers using counter-rotating cone extrusion. acta biomater. 12:113. mathew a.p., oksman k., pierron d. and harmad m.f. 2012. crosslinked fibrous composites based on cellulose nanofibers and collagen with in situ ph induced fibrillation. cellulose 19:139. meyer m., muhlbach r. and harzer d. 2005. solubilisation of cattle hide collagen by thermo-mechanical treatment. polym. degrad. stabil. 87:137. miles c.a., avery n.c., rodin v., bailey a.j. 2005. the increase in denaturation temperature following cross-linking is caused by dehydration of the fibres. j. mol. biol. 346:551. montazeri n., oliveira a.c.m., himelbloom b.h., leigh m.b. and crapo c.a. 2013. chemical characterization of commercial liquid smoke products. food sci. nutr. 1:102. morgan t.f., frame g. and kobussen p.j. 1998. process for producing a linked co-extruded edible product. us patent 5,795,605. olde damik l.h.h., dijkstra p.j., van luyn m.j.a., van wachem p.b., nieuwenhuis p. and feijen j. 1995. glutaraldehyde as a crosslinking agent for collagen-based biomaterials. j. material. sci. material med. 6:460. o’sullivan a.o., shaw n.b., murphy s.c., van de vis j.w., van pelt-heerschap h. and kerry j.p. 2006. extraction of collagen from fish skins and its use in the manufacture of biopolymer films. j. aquat. food prod. t. 15:21. paul r.g. and bailey a.j. 2003. chemical stabilization of collagen as a biomimetic. sci. world j. 3:138. rault i., frei v., herbage d., abdul-malak n. and huc a. 1996. evaluation of different chemical methods for cross linking collagen gel films and sponges. j. material. sci. material med. 7:215. savic z. and savic i. 2016. “sausage casings” 2nd ed. p. 75. victus, inc., vienna, aus. tanaka y., kubota a., matsusaki m., duncan t., hatakeyama y., fukuyama k., quantock a.j., yamato m., akashi m. and nishida k. 2011. anisotropic mechanical properties of collagen hydrogels induced by uniaxial-flow for ocular applications. j. biomat. sci. 22:1427. toledo r.t. 2007. wood smoke components and functional properties. in: “international smoke seafood conference proceedings”. d.e. kramer and l. brown. (ed.), p. 55. alaska sea grant college program, anchorage, usa. tomihata k., burczak k., shiraki k. and ikada y. 1994. cross-linking and biodegradation of native and denatured collagen. in “polymers of biological and biomedical significance”. w. shalaby, y. ikada, r. langer and j. williams. (eds.), p. 275. american chemical society, washington, usa. wess t.j. 2008. collagen fibrillar structure and hierarchies. in: “collagen structure and mechanics”. p. fratzl (ed.), p.55. springer science, new york, ny. wolf k.l., sobral, p.j.a. and telis v.r.n. 2006. characterization of collagen fibers for biodegradable films production. iufost 13:801. paper received june 3, 2018 accepted february 13, 2019 ijfs#147_wahyono_bozza   ital. j. food sci., vol 28, 2016 298 paper improving bread quality using co-cultures of saccharomyces cerevisiae, torulaspora delbrueckii jk08, and pichia anomala jk04 agung wahyono1, sae-byuk lee1, woo-won kang2 and heui-dong park*1 1school of food science and biotechnology, kyungpook national university, republic of korea 2department of food & food-service industry, kyungpook national university, republic of korea *corresponding author: hpark@knu.ac.kr   abstract co-cultured saccharomyces cerevisiae, torulaspora delbrueckii jk08, and pichia anomala jk04 were used as a leavening agent. the leavening ability, crumb structure, texture profile, crumb aroma, and sensory properties of bread were evaluated. the leavening ability of the co-cultures tested was lower than for s. cerevisiae alone. leavening containing a cocultures produced bread crust and crumb that were slightly yellow in colour and bright. generally, co-cultured bread produced a larger diversity and higher abundance of volatile organic compounds. superior colour properties, favorable aroma, and decent textural and structural features resulted in higher sensorial ratings for co-cultured bread. we suggest the use of co-culture as leavening agents for improved bread quality. keywords: bread quality, co-culture, pichia anomala, saccharomyces cerevisiae, torulaspora delbrueckii   ital. j. food sci., vol 28, 2016 299 1. introduction bread is a food that not only has a long history, but also a long future. over 12,000 years ago, the first bread was probably developed by deliberate experimentation using wheat flour and water. product development and process innovation in bread making is still an active field. consumer interest in bringing unique and alternative breads to the table is driving the production of a wide variety of breads (cauvain, 2012; mondal and datta, 2008). a multitude of studies conducted over the 20th century focused on improving bread quality and have explored the immense terrain of recipes (gardner et al., 2002; rosell et al., 2009; movahed et al., 2012; nilufer-erdil et al., 2012), process innovations (karaoğlu et al., 2006; bosmans et al., 2013) and the use of novel microorganisms as leavening agents (caballero et al., 1995; plessas et al., 2005; choi and choi, 2009; mo and sung, 2014). although the experience of bread quality is highly personal, it may be described as the sum of the sensory pleasures associated with flavour, taste, texture, and appearance (cauvain, 2012). the technological role of yeast in bread making has been well established. the main role of yeast is to produce gas by degrading the sugars available in the flour or that are added to the recipe. the gas produces air bubbles that are contained by the stretchy gluten proteins in the flour, which causes the dough to rise and produces an aerated structure in the resulting bakery product. during fermentation, the yeast produces abundant alcohols and other volatile compounds that impart unique tastes and flavours to the bread (stear, 1990; gélinas, 2009; ali et al., 2012; pacheco et al., 2012). over the last two decades, there has been great interest in using new strains of baker’s yeast that produce particular aromas, anti-molding properties, or desirable nutritional characteristics to fulfill the needs of the baking industry (gélinas, 2009). furthermore, the use of co-cultures as leavening agents has been reported to confer favorable effects in baking products. examples include the use of lactobacillus plantarum or pediococcus cerevisiae, combined with saccharomyces cerevisiae, as a co-culture for improving bread quality and delaying staling (elhariry et al., 2011); employing lactic acid bacteria and s. cerevisiae as a starter to enhance the nutritional content and shelf life of cassava-wheat bread (ogunbanwo et al., 2008); the use of lactobacillus delbrueckii ssp. bulgaricus or lactobacillus helveticus mixed with the lactose-fermenting yeast kluyveromyces marxianus to improve bread quality and increase shelf-life (plessas et al., 2008); and the use of starter culture combinations of lactobacillus fermentum, s. cerevisiae, and candida krusei to enhance aroma in ghanaian maize dough fermentation (annan et al., 2003). torulaspora delbrueckii and pichia anomala have unique traits that improve the quality of bakery products. as reported by hernandez-lopez et al. (2003), t. delbrueckii strains igc5321 and igc5323 exhibited higher leavening ability and co2 production than s. cerevisiae after exposure to hyperosmotic and freeze-thaw stress. mo and sung (2014) reported that p. anomala skm-t enhanced flavour properties and extended shelf life. the use of t. delbrueckii, p. anomala, and s. cerevisiae as co-cultured leavening agents has not yet been reported. here, we investigated the effects of co-cultured s. cerevisiae, t. delbrueckii jk08, and p. anomala jk04 as a leavening agent on bread quality. leavening ability, structural crumb features, texture profile, crumb aroma, and sensory properties of bread were evaluated.   ital. j. food sci., vol 28, 2016 300 2. materials and methods 2.1. microorganism strains and bread ingredients t. delbrueckii jk08 (td) and p. anomala jk04 (pa) were isolated from korean traditional starter (nuruk), and then identified and collected at the institute of fermentation biotechnology, kyungpook national university, daegu, south korea. the strains were sub-cultured in yeast extract-peptone-dextrose (ypd, difco, le pont de claix, france) agar (oxoid, hampshire, united kingdom) and stored at 2-4°c. s. cerevisiae (sc) was isolated from compressed instant baker’s yeast (saf-instant s.i., lesaffre, marcq, france). commercial wheat flour (beksul, cheiljedang, seoul, south korea) contained 13.93% protein and 0.47% ash, with a ph of 4.35. sugar and salt were purchased from a supermarket in sangju, south korea. 2.2. preparation of cultures preparation of cultures was described previously (wahyono et al., 2015). the strains were sub-cultured in 5% ypd broth and cultivated in a rotary shaker (jssi-300c, js research, gongju, south korea) at 30°c for 48 h, with shaking at 180 rpm. the yeast cells were collected by centrifugation (hanil supra 22k, hanil, incheon, south korea) at 4000 × g for 10 min at 4°c. the supernatant was discarded, and the pellet was re-suspended in distilled water, vortexed thoroughly, and stored at 4 °c. cell density was measured using a hemocytometer (neubauer chamber, celeromics, cambridge, united kingdom). to measure cell density, 10-1 to 10-4 dilutions of culture were prepared; 10 μl of diluted culture was loaded into the hemocytometer chamber. the chamber was observed at 100× magnification using a binocular microscope (cx31rtsf, olympus, tokyo, japan). cells in four different regions of the chamber were counted. cell density was calculated using the following formula: 𝑐 = ! !·!  ×  10  000 (1) where c is the concentration (expressed as number of cells per millilitre), n is the number of cells, n is number of squares counted, and d is the dilution factor. number 10 000 represents a constant converter to millilitre. 2.3. leavening ability the leavening ability of co-cultures was measured as described previously (wahyono et al., 2015). bread dough containing 20 g flour, 20 ml water, and 4 × 108 yeast cells per ml of water was mixed thoroughly in a 100-ml graduated cylinder and then incubated at 30°c for 210 min. this was done in triplicate and each sample was observed every 30 min. the maximum leavening rate (ml/h) was calculated from the highest volume reached in 210 min divided by the time the highest volume was first recorded. 2.4. bread-making procedure baking was carried out in a bread maker (national sd-bt102, panasonic, osaka, japan) using the 4-h standard bread-making setting. the basic recipe consisted of wheat flour, salt, sugar, and drinkable water. a single culture sc and co-cultures of s. cerevisiae + t.   ital. j. food sci., vol 28, 2016 301 delbrueckii jk08 (sctd), s. cerevisiae + p. anomala jk04 (scpa), and s. cerevisiae + t. delbrueckii jk08 + p. anomala jk04 (sctdpa) were used as leavening agents. the working ratio for co-cultures of s. cerevisiae + t. delbrueckii jk08 (sctd) and s. cerevisiae + p. anomala jk04 (scpa) were 50:50, respectively. the co-culture ratio for s. cerevisiae + t. delbrueckii + p. anomala jk04 (sctdpa) was 30:35:35. in the bread dough, the sc cell density was adjusted to approximately 5 × 108 cells per ml of water added to the dough. for td and pa, the cell densities were approximately 109 cells per ml of water added. dough compositions are given in table 1. the bread maker protocol included a first mixing for 20 min, resting for 25 min, and a second mixing for 10 min, followed by a first fermentation at 35°c for 50 min. a third mixing was performed for 3 min, followed by a second fermentation at 35°c for 40 min, and then a fourth mixing for 2 min. proofing was done at 40°c for 50 min and finally, loaves were baked at 210°c for 40 min. baking was performed in triplicate. after baking, the bread loaves were tempered at ambient temperature (28-30°c) before analysis. 2.5. moisture content, specific volume, and bread yield efficiency the moisture content of the bread crumb was determined by the oven-drying method (czuchajowska et al., 1989). specific volume was determined by the seed displacement method (aacc 10-05, 2000). bread yield efficiency was calculated as described by movahed et al. (2012) using the following formula: 𝑃! = !! !! ×  100 (2) where p2 is bread yield efficiency, w3 is bread weight and w2 is flour weight. 2.6. chromaticity of bread crust and crumb the crust and crumb colour were measured using the cr-400 chroma meter (konicaminolta, tokyo, japan); l (lightness), a (redness), and b (yellowness) values (hunter colour) were measured for six regions of bread crust and crumb. the whiteness index (wi) was calculated according to hsu (2003) and lin et al. (2009). 2.7. texture profile analysis texture profile analysis (tpa) was carried out in triplicate for two slices of bread. tpa was performed using a texture analyzer (ct3 4500, brookfield, middleboro, usa). bread samples were sliced to approximately 25-mm thickness. hardness, cohesiveness, springiness, and chewiness of the center of the bread slices were measured (blandino et al., 2013). the settings and conditions were carried out as described previously by ulziijargal et al. (2013), with some modifications: the acrylic cylindrical probe had a 38.1 mm diameter (ta4/1000), the pretest speed was 2 mm/s, the test speed was 2 mm/s, the post-test speed was 2 mm/s, the distance was 10 mm (40% compression), and the trigger load was 50 g. 2.8. bread crumb image analyses the structural features of the bread crumb were analyzed using imagej software (1.47v, national institutes of health, bethesda, md, usa). structural features included bread cell   ital. j. food sci., vol 28, 2016 302 density, mean cell area, and the fraction of cell area to total area. bread crumb images were captured using a scanner (epson perfection v370 photo, epson, japan) at a resolution of 800 × 800 dpi. images were calibrated to reflect actual size using a known scale, were cropped to 60 × 60 mm, filtered using a bandpass filter, and converted into binary images using the convert to mask feature for differentiating between the cell and non-cell area. before analyzing particles (cells), the particle size was set from 0.01 mm2 to infinity and the circularity was set from 0 to 1. this particle size corresponds to a particle diameter of 0.1 mm, which can be resolved by the human eye (pongjaruvat et al., 2014). 2.9. analysis of volatile compounds in bread crumbs volatile compounds were analyzed as described previously by plessas et al. (2008), using gas chromatography and mass spectrometry (7890a gc-ms; agilent, santa clara, ca, usa) with a flame ionization detector (fid). the separation was performed with a dbwax column (60 m × 250 μm × ɸ 0.25 mm) (waters, milford, ma, us). the detector was an agilent 5975c inert xl msd with triple-axis detector. helium was used as a carrier gas with a constant flow of 1 ml/min. using solid-phase microextraction technique (spme), 1 g of each bread sample was put into a 20-ml vial accessible to the spme needle through the vial septum. then, the vial was submerged in a water bath at 60°c and the spme fiber (50/30 μm dvb/car/pdms, supelco, bellefonte, pa, usa) was exposed to the headspace of the vial for 60 min. when the extraction process was finished, the spme fiber was inserted into the injector port (set at 280°c) of the gas chromatograph (gc) for thermal desorption of volatile compounds for 5 min in splitless mode. the gc temperature program was set as follows: 35°c for 5 min, increased by 5°c/min to 50°c (held for 5 min), increased by 5.5°c/min to 230°c (held for 5 min). volatile compound identification was based on comparison of gc retention times and peak areas with spectral data from the wiley9nist 0.8 library (wiley9nist 0.8 library, mass spectral search program, version 5.0, usa). 2.10. sensory evaluation bread samples were prepared from a freshly baked loaf (6-8 h after baking). the bread samples were cut about 50 × 20 × 25 mm and served on a small paper plate. sensory evaluations were conducted by 15 semi-trained consumers who were students and professors at kyungpook national university, south korea. the sensory attributes tested included appearance, colour, flavour, mouthfeel, and overall acceptability. the sensory attribute scale used for assessing the bread was as follows: 1, extremely dislike; 4, neither like nor dislike; and 7, extremely like (ulziijargal et al., 2013). 2.11. statistical analysis to examine statistical significance, the data were analyzed using one-way analysis of variance (anova) followed by duncan’s multiple range test at the p < 0.05 level of significance. the correlation among structural features and textural profiles of bread crumb was analyzed using a 2-tailed pearson correlation at p < 0.05. the analysis was carried out using spss for windows (ver. 19, ibm, new york, new york, usa). the graphs were constructed using microsoft excel (2007v, microsoft, redmond, washington, usa).   ital. j. food sci., vol 28, 2016 303 3. results and discussion 3.1. leavening ability the leavening ability of co-cultures was compared to that of single cultures (sc) in lean dough containing wheat flour and water (fig. 1). the leavening rates were significantly different among the cultures tested (p < 0.05). for sc, the dough was greatly leavened after only 30 min of incubation, but for co-cultures, the dough was greatly leavened after 60 min of incubation. the leavening rates for sc, sctd, scpa, and sctdpa were 55.4, 41.6, 36.5, and 31.6 ml/h, respectively. in a previous study, we found that the leavening rate for single cultures of t. delbrueckii jk08 and p. anomala jk04 were 8.67 and 2.29 ml/h, respectively. the lower performance of t. delbrueckii jk08 and p. anomala jk04 may be due to slower growth relative to s. cerevisiae (wahyono et al., 2015). bely et al. (2008) also reported lower performance for t. delbrueckii 27828 and t. delbrueckii 31703 in terms of fermentation rate in comparison to s. cerevisiae. on the contrary, hernandez-lopez et al. (2003) reported that t. delbrueckii strains igc5321 and igc5323 exhibited higher leavening ability and co2 production than s. cerevisiae after exposure to hyperosmotic and freeze-thaw stress. we demonstrated that incorporating td and pa with sc produced a co-culture with greatly improved leavening ability for a longer leavening period (> 120 min). elhariry et al. (2011) revealed that incorporating s. cerevisiae and l. plantarum in a sourdough system delivered favorable effects such as improving the leavening ability, as well as the sensory and physical properties of the bread. table 1: list of ingredients used in bread making. ingredients quantity yeast addition (total cells)a s. cerevisiae t. delbrueckiijk08 p. anomalajk04 wheat flour (g) 280 sugar (g) 16.8 salt (g) 5.6 water (ml) 200 leavening agent; sc 1 × 1011 sctd 5 × 1010 1 × 1011 scpa 5 × 1010 1 × 1011 sctdpa 3 × 1010 7 × 1010 7 × 1010 acalculated according to the yeast concentration and ratio determined in the bread-making procedures in the materials and methods.   ital. j. food sci., vol 28, 2016 304 figure 1: leavening rates for co-cultures or a single culture in lean dough. results are means±sd of triplicate. 3.2. physical properties the co-cultures did not affect the moisture content or bread yield, but significantly affected the bread-specific volume (p < 0.05, table 2). the specific volumes of breads produced with the cultures tested were in the range of 4.01-4.37 cm3/g. in comparison to breads leavened with co-cultures, the bread leavened with sc produced the greatest specific volume (4.37 cm3/g), which is consistent with the observation that sc exhibited the highest leavening activity (55.4 ml/h). we previously reported that lower leavening abilities for t. delbrueckii jk08 and p. anomala jk04 produced significantly lower specific volumes in comparison to s. cerevisiae (wahyono et al., 2015). these results strongly suggest a connection between the yeast’s leavening ability and the specific volume of the resulting bread. no significant differences were observed in bread-specific volume for the co-cultures tested. even though there were significant differences in leavening rates for the co-cultures tested, the time period for fermentation in the bread-making process was not long enough for optimum leavening activity for sctd, scpa, sctdpa (120, 150, and 180 min, respectively). however, the specific volume of breads produced by co-cultures is well within the range of standard bread, with specific volumes that ranged from 3.5 to 6 cm3/g (ulziijargal et al., 2013). the co-cultures significantly affected the chromaticity of the bread crust (table 3). sctd leavened bread showed the greatest l, b, and wi values. the l value for sctd was significantly greater than that for sc or scpa. the b value for sctd was only significantly greater than that for sc. the wi value for sctd was significantly higher than those for the other cultures tested. sctdpa produced the highest a value, which was significantly greater than that of sc or sctd. in contrast, sc-leavened bread produced the lowest l, a, b, and wi values. these results were consistent with previous work that demonstrated greater l and b values for bread crust when t. delbrueckii jk08 was used as a leavening agent (wahyono et al., 2015). for crumb colour, the co-cultures significantly affected the l and b values, but not the a and wi values (table 3). scpa produced the greatest l value, which was significantly greater than that of sc. it also produced the greatest b value, which was significantly higher than that of sc or sctd. the greatest l and b values of bread crumb arose when p. anomala jk04 was used as a leavening agent, while lower l and 0,0   10,0   20,0   30,0   40,0   50,0   60,0   70,0   80,0   90,0   100,0   0   30   60   90   120   150   180   210   v ol um e    ( m l)   time  (min)   sc   sctd   scpa   sctdpa     ital. j. food sci., vol 28, 2016 305 b values (darker colour) were produced when s. cerevisiae was used (wahyono et al., 2015). in short, td produced greater lightness and unsaturated yellowish colour in the bread crust, and pa produced similarly a coloured bread crumb. on the other hand, sc produced a darker and saturated yellowish colour in bread crust and crumb. hernandez-lopez et al. (2003) reported that commercial baker’s yeast (s. cerevisiae) exhibited greater maltase and invertase activity than t. delbrueckii igc5321. consequently, sc produced more reactive saccharides, which may contribute to darker colour formation. the saccharides and nitrogen-containing substances involved in the browning reaction create the dark-coloured pigment melanoidin, which confers a darker colour to the bread crust and crumb (stear, 1990). table 2: physical properties of bread leavened with co-cultures or a single culturea. yeast crumb moisture content (%) specific volume (cm3/g) bread yield efficiency (%) sc 46.33±0.50a 4.37±0.15a 147.97±0.75a sctd 46.58±0.59a 4.08±0.05b 148.86±1.00a scpa 46.83±0.35a 4.15±0.01b 147.85±0.21a sctdpa 46.61±0.16a 4.01±0.09b 148.13±0.75a ameans with the same superscript letter in a column are not significantly different at the level p < 0.05. table 3: chromaticity of bread crust and crumb leavened with co-cultures or a single culturea. yeast crust colour crumb colour l a b whiteness index (wi) l a b whiteness index (wi) sc 38.22±1.22c 6.26±0.72c 15.85±0.97b 35.90±0.88b 56.85±2.88b -2.52±0.11a 8.53±0.78c 55.93±2.76a sctd 41.63±0.93a 6.92±0.67bc 17.77±0.24a 38.59±1.00a 59.08±0.11ab -2.56±0.05a 9.25±0.38bc 57.97±0.03a scpa 39.39±0.34bc 7.79±0.26ab 17.00±0.28a 36.57±0.35b 60.22±0.75a -2.42±0.02a 10.34±0.13a 58.82±0.71a sctdpa 40.12±0.83ab 8.23±0.22a 17.66±0.46a 37.02±0.64b 58.37±1.55ab -2.43±0.10a 9.58±0.47ab 57.21±1.40a ameans with the same superscript letter in a column are not significantly different at the level p < 0.05. 3.3. structural features of bread crumb the structural parameters of bread crumb are expected to influence its mechanical behavior. by using image analysis, the structural features of bread crumb can be quantified (zghal et al., 2002). hence, we carried out an image analysis of bread crumb and the results are presented in table 4. the digital binary images of bread crumb from which the structural features could be extracted are shown in fig. 2. the use of co-cultures significantly affected the cell density and the mean cell area of bread crumb, but not the fraction of cell area to total area. the cell density of bread crumb leavened with sctd (58.89 1/cm) was the greatest among cultures tested, and was significantly greater than that leavened with sc (50.04 1/cm). inversely, the mean cell area of bread crumb leavened with sc (0.90 mm2) was the largest, significantly larger than that leavened with sctd (0.73 mm2). these results suggest that as mean cell area increases, cell density decreases. the   ital. j. food sci., vol 28, 2016 306 large mean cell area for sc-leavened bread is consistent with its high specific volume. in other words, bread leavened with sc was more porous than bread produced using cocultures, probably because of superior leavening ability and higher co2 production (wahyono et al., 2015). alternatively, pongjaruvat et al. (2014) reported that high specific volume is tightly correlated with cell density and cell area fraction. we performed correlation analysis for structural features and mechanical parameters (tpa) of bread crumb. we found that the cell density, mean cell area, and fraction of cell area to total area were correlated with cohesiveness, but not hardness, springiness, or chewiness (table 5). structural features were not strongly correlated with overall bread quality, which is more strongly affected by attributes such as odor and appearance (lampignano et al., 2013). figure 2: the digital binary images of breads crumb leavened with co-cultures or a single culture. table 4: structural features of bread crumb leavened with co-cultures or a single culture quantified by image processinga. yeast cell density (1/cm2) mean cell area (mm2) fraction of cell area to total area (%) sc 50.04±5.59b 0.90±0.10a 44.87±0.40a sctd 58.89±2.92a 0.73±0.03b 42.83±2.06a scpa 52.55±3.37ab 0.85±0.09ab 44.34±1.87a sctdpa 53.38±3.59ab 0.84±0.04ab 44.57±1.03a ameans with the same superscript letter in a column are not significantly different at the level p < 0.05.   ital. j. food sci., vol 28, 2016 307 table 5: pearson correlation of structural features and textural profiles of bread crumb. hardness springiness cohesiveness chewiness cell density mean cell area springiness 0.360 cohesiveness -0.485 -0.391 chewiness 0.981** 0.353 -0.319 cell density 0.450 0.365 -0.633* 0.380 mean cell area -0.435 -0.432 0.732** -0.340 -0.950** cell fraction -0.175 -0.326 0.658* -0.043 -0.273 0.541 **correlation is significant at the 0.01 level (2-tailed). *correlation is significant at the 0.05 level (2-tailed). 3.4. texture profile analyses tpa was used to evaluate the textural properties of bread crumb (fig. 3). the co-cultures altered hardness, chewiness and cohesiveness, but these changes were insignificant, except for cohesiveness. sctd-leavened bread was of lower cohesiveness than bread leavened with other cultures (fig. 3), consistent with our previous study, demonstrating that t. delbrueckii jk08 produces bread crumb with lower cohesiveness (wahyono et al., 2015). as stated earlier, the cohesiveness of bread crumb was the only parameter that correlated with its structural features. according to scanlon and zghal (2001), the crumb textural properties were largely determined by the bread crumb structural features. fine and uniformly-sized cells produce a softer texture. here we have demonstrated that a greater mean cell size conferred greater cohesiveness and vice versa. however, this result should be further evaluated in light of previous work that established that crumb cohesiveness is controlled by moisture content and the strength of networks surrounding the cell pore (cauvain, 2004). we have shown that the use of co-cultures produced bread of quality and textural properties comparable to bread leavened using a single culture. figure 3: texture profiles of bread leavened with co-cultures or a single culture. (a) hardness and chewiness of bread crumb. (b) springiness and cohesiveness of bread crumb. results are means ± sd of triplicate. 0   200   400   600   800   1000   1200   sc   sctd   scpa   sctdpa   h ar dn es s/ ch ew in es s   (g )   leavening  agent   hardness   chewiness   a 0,00   0,20   0,40   0,60   0,80   1,00   1,20   sc   sctd   scpa   sctdpa   sp ri n gi n es s/ co he si ve n es s   leavening  agent   springiness   cohesiveness   b *   ital. j. food sci., vol 28, 2016 308 (*) significantly different at the level p < 0.05. 3.5. volatile compounds of bread crumb a total of 54 volatile compounds were identified in the bread crumb leavened with sctdpa, whereas 50, 47, and 49 volatile compounds were identified in the bread crumb leavened with sc, sctd, and scpa, respectively (table 6). sctdpa-leavened bread not only produced more unique volatile compounds, but in greater abundance, as indicated by the greater peak area. in most cases, the bread leavened by co-cultures produced more volatile compounds than that of a single culture. the volatile compounds were predominately alcohols, aldehydes and esters. isobutyl alcohol (i-buoh), isoamyl alcohol (i-amoh), and phenethyl alcohol (pea) were the predominant alcohol groups. i-buoh levels were highest in sctdpa bread (20,169) and the lowest in sc bread (1,986). inversely, i-amoh levels were the highest in scpa bread (11,168) and lowest in sctdpa bread (6,265). as reported by kim et al. (2013), p. anomala y197-13 produced high i-amoh levels and conferred a banana flavour that significantly affected the flavour and taste of turbid rice wine. watanabe et al. (1990) reported that bread containing high levels of i-amoh was less favorable than bread containing high levels of i-buoh. the bread leavened with p. anomala skm-t exhibited a higher pea content and was preferred over s. cerevisiae (mo and sung, 2014) due to the favorable honey and flower odor of pea (jensen et al., 2011). the predominant aldehydes in bread crumb were n-hexanal, furfural, and benzaldehyde. the bread leavened with the co-cultures containing pa (scpa and sctdpa) produced the highest amounts of these compounds. n-hexanal was the most abundant aldehyde and conferred a green flavour. the second most abundant was benzaldehyde which produces an almond odor (birch et al., 2013a). fulfural is characterized by a burnt and sweet, caramel-like, odor (prost et al., 2012). the other volatile compounds that contributed to either favorable (n-octanal, n-decanal) or unfavorable (n-heptenal) odors were comparable among all cultures tested. esters typically have pleasant, fruity, or sweet odors (birch et al., 2013b). in most cases, sctdpa leavened bread contained a greater abundance and higher diversity of ester compounds. compounds including isoamyl acetate (fruity), ethyl caproate (fruity, wine, apple, banana, brandy), ethyl octanoate (fatty, fruity), ethyl decanoate, and ethyldodecanoate were enhanced in the bread leavened with co-cultures containing pa (scpa and sctdpa). sc and td enhanced particular compounds such as ethyl acetate and methyl salicylate, respectively. in alcoholic beverages, ethyl acetate can produce unfavorable sensory qualities. mixed cultures of s. cerevisiae and p. anomala (mutant type) produced higher ethyl acetate-hydrolyzing esterase activities. this enzyme is crucial in the formation of acetate ester, which delivers superior flavour (kurita, 2008). the bread leavened by co-cultures was obviously superior to that leavened by a single culture with regard to the volatile compound content. these compounds were produced mainly from the metabolism of yeasts during dough fermentation and flour lipid oxidation (birch et al., 2013b). these processes are influenced by the availability of free, reactive amino acids, sugars, alcohols, enzyme activity, and the degree of polymerization and hydration of substrates due to mixing to baking (stear, 1990). sadoudi et al. (2012) reported that the use of co-cultures altered the production of volatile compounds in wine, because co-culture interactions influenced the entire metabolic pathway.   ital. j. food sci., vol 28, 2016 309 table 6: volatile compounds contained in the bread crumb leavened with co-cultures or a single culture. no group rt compound flavour description peak area* sc sctd scpa sctdpa 1 acids 30.40 acetic acid acid, pungent (a) 1,973 1,838 2,483 4,043 2 33.28 isobutyric acid 339 275 287 408 3 35.61 2-methylbutanoic acid sweaty (e) 680 603 514 939 4 40.00 2-methylpropanoic acid sweat, butter(a) 81 59 83 176 5 alcohols 18.63 isobutyl alcohol 1,986 7,494 13,946 20,169 6 23.30 isoamyl alcohol banana (f) 8,011 8,174 11,168 6,265 7 26.30 2-ethyl-1-decanol nd nd nd 301 8 27.69 2-methyl-3-pentanol 146 180 67 88 9 27.90 1-hexanol flower (a) 465 610 527 674 10 28.14 2-nonanol 153 159 nd 87 11 28.63 3-ethoxy-1-propanol fruity (a) 87 236 nd 116 12 32.76 1-dodecanol 228 163 280 684 13 35.42 2-furanmethanol 309 552 615 1,857 14 40.86 phenethyl alcohol honey, flower (a) 9,506 12,292 8,391 12,643 15 aldehydes 18.01 n-hexanal green (d) 5,369 19,874 37,144 71,305 16 22.38 n-heptanal fatty, rancid (d) 233 262 528 302 17 25.99 n-octanal citrus (d) 207 263 333 495 18 27.11 2-heptenal 600 1,086 1,594 2,335 19 30.88 furfural 1,646 2,068 2,764 7,529 20 31.79 n-decanal citrus (d) 151 230 237 379 21 32.56 benzaldehyde almond (d) 3,507 5,475 6,389 8,374 22 33.64 5-methyl-2-furfural 132 47 131 529 23 38.80 2,4-decadienal fatty, waxy (b) 38 94 103 224 24 alkenes 8.96 2,4-dimethyl-1-heptene 62 nd nd 396 25 29.86 3-ethyl-2-methyl-1,3-hexadiene 36 58 83 120 26 benzenes 15.92 methyl benzene 269 330 551 413 27 24.95 ethenylbenzene 762 134 8,026 6,265 28 29.97 1,3-bis(1,1-dimethylethyl)benzene 381 563 85 1,503 29 esters 9.10 ethyl acetate pineapple (a) 1,688 120 635 5,590 30 14.66 isobutyl acetate ethereal, fermented nd nd nd 134   ital. j. food sci., vol 28, 2016 310 odor (b) 31 19.87 isoamyl acetate fruity (e) 305 666 5,290 7,923 32 24.16 ethyl caproate fruity, wine, apple, banana, brandy (c) 305 51 4,641 3,903 33 25.43 n-hexyl acetate 37 34 124 256 34 30.10 ethyl octanoate fatty, fruity (a) 625 796 4,646 12,307 35 30.75 amyl caproate 7 nd 84 351 36 34.96 ethyl decanoate 204 171 4,066 9,553 37 36.12 ethyl-9-decenoate nd nd 104 1,658 38 38.27 methyl salicylate 220 1,686 316 1,876 39 38.91 2-phenethyl acetate roasty(e) 235 101 209 868 40 39.22 ethyldodecanoate 336 281 1,069 1,407 41 furans 24.06 2-pentylfuran floral, fruity (d) 309 246 887 566 42 31.99 2-acetylfuran 282 339 450 1,243 43 ketones 12.73 2,3-butanedione buttery, caramel (d) 353 592 460 542 44 22.29 2-heptanone nd nd 58 67 45 25.89 3-hydroxy-2-butanone butterscotch (d) 867 744 922 1,149 46 26.37 1-octen-3-one mushroom (g) 48 263 419 765 47 phenols 40.61 butylatedhydroxytoluene 1,585 2,788 4,507 2,683 48 pyrazines 25.33 methylpyrazine 185 179 228 546 49 27.33 2,6-dimethylpyrazine hazelnut (e) 68 73 219 314 50 27.49 ethylpyrazine 58 95 95 223 51 terpenes 37.04 (-)-.beta.-bisabolene 220 nd 341 222 52 others 28.90 dimethyl trisulfite 51 120 217 263 53 37.64 naphthalene 79 143 446 288 54 41.42 1,4-methanobenzocyclodecene 75 139 265 275 *the values of volatile compounds calculated from the peak area divided by 1000. nd, not detected a. jensen et al. (2011); b. mo and sung (2014); c. daigle et al. (1999); d. birch et al. (2013a); e. prost et al. (2012); f. kim et al. (2013); g. birch et al. (2013b) 3.6. sensory properties the average results of the sensory evaluation of appearance, colour, flavour, mouthfeel, and overall acceptability are shown in fig. 4. in most cases, the co-cultures slightly enhanced all the sensory attributes, except for appearance. all attributes produced satisfactory scores in the range of 4.73–5.57 out of a total 7 points. on average, the co   ital. j. food sci., vol 28, 2016 311 cultures produced marked improvement over the single culture, which scored in the range of 4.07-5.71. sctdpa leavened bread was superior in overall acceptability (5.57), which is attributable to higher ratings in flavour (5.27) and mouthfeel (5.30). high flavour ratings are probably due to the high abundance of favorable volatile compounds (table 6). sctd leavened bread had a superior colour rating (5.53). these results demonstrate that incorporating sc, td, and pa as leavening agents conferred beneficial characteristics to bread. sc contributed to improving bread appearance through greater leavening ability, and td and pa contributed to enhanced flavour, colour, and mouthfeel. figure 4. radar plot of the sensory properties of bread leavened with co-cultures or a single culture. result reflects the means of scores from 15 semi-trained panelists. 4. conclusions we have shown that the use of mixed cultures of s. cerevisiae, t. delbrueckii jk08, and p. anomala jk04 enhanced bread quality. the bread leavened by the co-cultures produced textural and structural properties comparable to single cultures of s. cerevisiae. the cocultured bread had a superior aroma and enhanced sensorial qualities. thus, the use of cocultures as leavening agents has great promise in fulfilling the consumer need for unique and high-quality bread. acknowledgements we thank the directorate general of human resources for science, technology and higher education, the republic of indonesia, and the department of food and food service industry at kyungpook national university, republic of korea, for supporting this study. the authors wish to thank dr. d. silveri, dr. v. galli and mr. l. bartoli for the technical assistance and dr. francesca melini for the technical and linguistic assistance in the revision of this paper. references aacc 10-05. 2000. rapeseed displacement method. in: approved methods of the aacc. 10th ed. st. paul :american association of cereal chemists. 0,00   1,00   2,00   3,00   4,00   5,00   6,00   7,00   appearance   color   flavor  mouthfeel   overal   sc   sctd   scpa   sctdpa     ital. j. food sci., vol 28, 2016 312 ali a., shehzad a., khan m.r., shabbir m.a. and amjid m.r. 2012. yeast, its types and role in fermentation during bread making process-a review. pak. j. food sci. 22: 171-179. <http://psfst.com/__jpd_fstr/63f9e07b9aa310709ce11c70ac9bf266.pdf> annan n.t., poll l., dedeh s.s., plahar w.a. and jakobsen m. 2003. influence of starter culture combinations of lactobacillus fermentum, saccharomyces cerevisiae and candida krusei on aroma in ghanaian maize dough fermentation. eur. food res. technol. 216: 377-384. bely m., stoeckle p., pomarede i.m. and dubourdieu d. 2008. impact of mixed torulaspora delbrueckii-saccharomyces cerevisiae culture on high-sugar fermentation. int. j. food microbiol. 122: 312-320. birch a.n., petersen m.a., arneborg n. and hansen a.s. 2013a. influence of commercial baker’s yeasts on bread aroma profiles. food res. int. 52: 160-166. birch a.n., petersen m.a. and hansen å.s. 2013b. the aroma profile of wheat bread crumb influenced by yeast concentration and fermentation temperature. lwt food sci. technol. 50: 480-488. blandino m., sovrani v., marinaccio f., reyneri a., rolle l., giacosa s., locatelli m., bordiga m., travaglia f., coïsson j. d. and arlorio m. 2013. nutritional and technological quality of bread enriched with an intermediated pearled wheat fraction. food chem. 141: 2549-57. bosmans g.m., lagrain b., fierens e. and delcour j. a. 2013. the impact of baking time and bread storage temperature on bread crumb properties. food chem. 141: 3301-8. caballero r., olguin p. and gallardo f. 1995. evaluation of kluyveromyces marxianus as baker’s yeast. food res. int. 28: 37-41. cauvain s.p. 2004. improving the texture of bread. in “texture in food: solid foods”. vol. 2. 1st edition. d. kilcast (ed.), p, 435-448. woodhead, cambridge, england. cauvain s.p. 2012. introducing to bread making. in “breadmaking: improving quality”. 2nd edition. s. p. cauvain (ed.), p, 1-8. woodhead, cambridge, england. choi i. and choi w.s. 2009. effects of kokja as a fermentation starter on sponge-and-dough bread properties. j. kor. soc. appl. biol. chem. 53: 50-55. czuchajowska z., pomeranz y. and jeffers h. 1989. water activity and moisture content of dough and bread. cereal chem. 66: 128-132. <http://www.aaccnet.org/publications-/cc/backis-sues/1989/documents/66_128.pdf> daigle p., gélinas p., leblanc d. and morin a. 1999. production of aroma compounds by geotrichumcandidum on waste bread crumb. food microbiol. 16: 517-522. elhariry h.m., mahmoud r.m., hassan a.a. and aly m.a. 2011. development of co-culture sourdough systems for improving bread quality and delaying staling. food biotechnol. 25: 252-272. gardner n., champagne c. p. and gelinas p. 2002. effect of yeast extracts containing propionic acid on bread dough fermentation and bread properties. j. food sci. 67: 1855-1858. gélinas p. 2009. inventions on baker’s yeast strains and specialty ingredients. recent pat. food nutr. agric. 1: 104-132. hernandez-lopez m.j., prieto j.a. and randez-gil f. 2003. osmotolerance and leavening ability in sweet and frozen sweet dough. comparative analysis between torulaspora delbrueckii and saccharomyces cerevisiae baker’s yeast strains. antonie van leeuwenhoek. 84: 125-34. hsu c. 2003. chemical composition, physical properties, and antioxidant activities of yam leavaflours as affected by different drying methods. food chem. 83: 85-92. jensen s., oestdal h., skibsted l.h., larsen e. and thybo a.k. 2011. chemical changes in wheat pan bread during storage and how it affects the sensory perception of aroma, flavour, and taste. j. cereal sci. 53: 259-268. karaoğlu m.m. and kotancilar h.g. 2006. effect of partial baking, storage and rebaking process on the quality of white pan bread. int. j. food sci. technol. 41: 108-114. kim h.r., kim j.h., bai d.h. and ahn b.h. 2013. microbiological characteristics of wild yeast strain pichia anomala y19713 for brewing makgeolli. mycobiology. 41: 139-44. kurita o. 2008. increase of acetate ester-hydrolysing esterase activity in mixed cultures of saccharomyces cerevisiae and pichia anomala. j. appl. microbiol. 104: 1051-8.   ital. j. food sci., vol 28, 2016 313 lampignano v., laverse j., mastromatteo m. and del nobile m.a. 2013. microstructure, textural and sensorial properties of durum wheat bread as affected by yeast content. food res. int. 50: 369-376. lin l.y., liu h.m., yu y.w. and lin s.d. and mau j.l. 2009. quality and antioxidant property of buckwheat enhanced wheat bread. food chem. 112: 987-991. mo e.k. and sung c.k. 2014. production of white pan bread leavened by pichia anomala skm-t. food sci. biotechnol. 23: 431-437. mondal a. and datta a.k. 2008. bread baking a review. j. food eng. 86: 465-474. movahed s., rooshenas g. and chenarbon h.a. 2012. evaluation of the effect of yeast-salt method on dough yield, bread yield and organoleptic properties iranian lavash bread. annals biol. res. 3: 595-600. <http://scholarsresearchlibrary.com/abr-vol3-iss1/abr-2012-3-1-595-600.pdf> nilufer-erdil d., serventi l., boyacioglu d. and vodovotz y. 2012. effect of soy milk powder addition on staling of soy bread. food chem. 131: 1132-1139. ogunbanwo s.t., adebayo a.a., ayodele m.a., okanlawon b.m. and edema m.o. 2008. effects of lactic acid bacteria and saccharomyces cerevisae co-cultures used as starters on the nutritional contents and shelf life of cassava-wheat bread. j. appl. biosci. 12: 612-622. pacheco a., santos j., chaves s., almeida j., leão c. and sousa m.j. 2012. the emerging role of the yeast torulaspora delbrueckii in bread and wine production: using genetic manipulation to study molecular basis of physiological responses. in “structure and function of food engineering”. a.a. eissa (ed.), p, 339-370. intech, rijeka, croatia. plessas s., bekatorou a., gallanagh j., nigam p., koutinas a.a. and psarianos c. 2008. evolution of aroma volatiles during storage of sourdough breads made by mixed cultures of kluyveromyces marxianus and lactobacillus delbrueckii ssp. bulgaricus or lactobacillus helveticus. food chem. 107: 883-889. plessas s., pherson l., bekatorou a., nigam p. and koutinas a.a. 2005. bread making using kefir grains as baker’s yeast. food chem. 93: 585-589. pongjaruvat w., methacanon p., seetapan n., fuongfuchat a. and gamonpilas c. 2014. influence of pregelatinised tapioca starch and transglutaminase on dough rheology and quality of gluten-free jasmine rice breads. food hydrocoll. 36: 143-150. prost c., poinot p., rannou c. and arvisenet g. 2012. bread aroma. in “breadmaking: improving quality”. 2nd edition. s. p. cauvain (ed.), p, 523-561. woodhead, cambridge, england. rosell c.m., santos e., penella j.m.s. and haros m. 2009. wholemeal wheat bread: a comparison of different breadmaking processes and fungal phytase addition. j. cereal sci. 50: 272-277. sadoudi m., tourdot-maréchal r., rousseaux s., steyer d., gallardo-chacón j.j., ballester j., vichi s., guérin-schneider r., caixach j. and alexandre h. 2012. yeast-yeast interactions revealed by aromatic profile analysis of sauvignon blanc wine fermented by single or co-culture of non-saccharomyces and saccharomyces yeasts. food microbiol. 32: 243-53. scanlon m.g. and zghal m.c. 2001. bread properties and crumb structure. food res. int. 34: 841-864. stear c.a. 1990. handbook of breadmaking technology. elsevier, london and new york. ulziijargal e., yang j.h., lin l.y., chen c.p. and mau j.l. 2013. quality of bread supplemented with mushroom mycelia. food chem. 138: 70-76. wahyono a., kang w.w. and park h.d. 2015. characterization and application of torulaspora delbrueckii jk08 and pichia anomala jk04 as baker's yeast. j. food nutr. res. 54: 205-217. watanabe m., fukuda k., asano k. and ohta s. 1990. mutants of bakers’ yeasts producing a large amount of isobutyl alcohol or isoamyl alcohol, flavour components of bread. appl. microbiol. biotechnol. 34: 154-159. zghal m.c., scanlon m.g. and sapirstein h.d. 2002. cellular structure of bread crumb and its influence on mechanical properties. j. cereal sci. 36: 167-176. paper received may 6, 2015 accepted august 30,2015 ijfs#1536_bozza ital. j. food sci., vol. 32, 2020 107 paper textural, physical and retrogradation properties of muffin prepared with kamut (triticum turanicum jakubz) p. lee1, h. oh1, s.y. kim1 and y.s. kim*1,2 1department of integrated biomedical and life sciences, korea university, 145 anam-ro, seongbukgu, seoul 02841, republic of korea 2department of food and nutrition, korea university, 145 anam-ro, seongbukgu, seoul 02841, republic of korea *corresponding author: tel.: +82 29402806, fax: +82 29217207 email: kteresa@korea.ac.kr abstract the effects of kamut flour substitution levels (0%, 25%, 50%, 75%, 100%) on muffin properties were investigated. as kamut flour level increased muffins showed lower height and volume and the l value decreased. the crumb hardness increased with increasing kamut level, and the control showed the lowest value in elasticity, chewiness, and brittleness. the increment of kamut flour level resulted the total flavonoid and polyphenol contents, reducing power, and abts and dpph radical scavenging activities. during storage, the avrami exponent decreased between the control to the sample added with 75% kamut. the crumb air cell number decreased, but the area increased with kamut flour level increment. in sensory evaluation, the samples with kamut level 25% and 50% were acceptable. therefore, muffins with an appropriate level of kamut flour improve the nutritional profile, and quality of baking products. keywords: antioxidant, kamut (khorasan wheat), muffin, physical properties ital. j. food sci., vol. 32, 2020 108 1. introduction in human nutrition, wheat is an important component of cereal-based foods, and it is one of the most consumed food sources on a global scale (sofi et al., 2013). as the awareness of healthy life increases, healthy food products are more in demand. following this trend, various wheat varieties such as whole wheat, organic wheat, and ancient wheat, have emerged in the market (angioloni and collar, 2011; fatma et al., 2017; dinu et al., 2018). among the wheat varieties, kamut (khorasan wheat, triticum turanicum jakubz) is one of the noted ancient grains due to the higher content of selenium content and the protein content. kamut contains 400-1000 ppb of selenium depending on harvesting condition and contains relatively large amounts of 12-18/100 g of protein (wijngaard and arendt, 2006; di loreto et al., 2017). in addition, consuming whole grain and the products from its derivative could be providing antioxidant substances and various cofactors such as copper, iron, zinc and selenium (benedetti et al., 2012). in recent studies (bordoni et al., 2017; carnevali et al., 2014; di loreto et al., 2017), the whole grain kamut was found to contain higher phytochemical contents than common wheat, and it has been attracting attention due to its nutraceutical properties such as high antioxidant, prebiotic activities, and reduction of irritable bowel syndrome symptoms. in addition, in human intervention studies, a volunteer group that consumed kamut products for 8 weeks demonstrated a significant decrease in total and ldl cholesterol and glucose levels while the control group showed no significant changes. the popularity of bakery products, especially with health functionalities, is increasing and as the consumption of cereal-based products increase, these products are important for taking essential nutrients in daily life (alpaslan and hayta, 2006). among the bakery products, muffins are easy to make into various products depending on the ingredients to be added, so the studies on functional muffins such as legume blended muffin, coffee ground residue water extracts muffin, flaxseed muffin and buckwheat muffin (kim et al., 2016; bae and jung, 2013; kaur and kaur, 2018; qian et al., 2017) are briskly. also, muffins have high acceptance for the consumer due to sweet taste and soft texture and are characterized by typical pore formation. previous studies on kamut have been on antioxidant effects of kamut in the rat liver, sourdough bread, flake and muesli, tortillas and cookies (benedetti et al., 2012; carini et al., 2010; chandi et al., 2015; choi et al., 2016; sumczynski et al., 2015). the present study, therefore, focused on antioxidant, baking, rheological, microstructural, storage and quality characteristics of muffins with whole grain kamut and with the aim to find the optimal addition level of kamut for increasing utilization of kamut and development of functional bakery products. 2. materials and methods 2.1. muffin materials kamut (kamut® international, ltd., missoula, usa) cultivated in canada in 2016 was purchased. kamut (khorasan wheat) grains were washed three times and freeze-dried (fd8508, ilshinbiobase co., dongducheon, korea) at -80℃ for 5 days. dried kamut grains were ground (rt-04, wongangbio co., taiwan) for 2min, passed through a 40 mesh sieve twice to obtain kamut flour (kf), and stored at -20℃ until use. a soft wheat flour (wf) (q1, samyang co., asan, korea), salt (chungjungwaon, shinan, korea), sugar (beak-seol, ital. j. food sci., vol. 32, 2020 109 incheon, korea), egg (nature egg, yeo-ju, korea), butter (unsalted pure new zealand butter, fonterra, new zealand), milk (seoul milk, chung-ju, korea), and baking powder (baking soda, gimpo, korea) were acquired at a local market. 2.2 preparation of muffin samples the muffin formulations are presented in table 1. muffins were prepared using a modified method as described by qian et al. (2017). five different muffin samples with various ratio of kf and wf [100 wf (con), 75 wf:25 kf (k25), 50 wf:50 kf(k50), 25 wf:75 kf(k75), 100 kf(k100)] were prepared along with a control sample (100 wf). butter, salt and sugar were whipped with a blender (kmm020, kenwood, havant, england) for 3 min at 40 rpm. the egg was added in two portions and mixed for 5 min at 54 rpm. flour mix and baking powder were added and mixed at 40 rpm for 2 min. finally, milk was blended at 40 rpm for 2 min. the muffins were cooled for 1 h at 25℃ after baking and were used for analyses. table 1. formula for a muffin with different levels of kf. samples con k25 k50 k75 k100 wheat flour (g) 200 50 100 150 0 kamut flour (g) 0 150 100 50 200 salt (g) 2 2 2 2 2 sugar (g) 120 120 120 120 120 egg (g) 70 70 70 70 70 butter (g) 80 80 80 80 80 milk (g) 100 100 100 100 100 baking powder (g) 6 6 6 6 6 con: control. without added kf. k25: 75% wf, 25% kf. k50: 50% wf, 50%kf. k75: 25% wf, 75% kf. k100: 100% kf. 2.3. physicochemical measurement 2.3.1 moisture and brix degree the moisture content was measured at 105℃ in 5.0 g of crumb parts of muffins with a moisture analyzer (mb, ohaus, zurich, switzerland). the sugar content was measured with a digital refractometer (pr-201α, tokyo, japan) having a range of 0-60% by stirring 5.0 g of sample and 50 g of distilled water for 5 min (song et al., 2017). 2.3.2 batter measurement the batter specific gravity was measured at 25℃ by standard methods of analysis (aacc, 2000). the baking loss and baking yield were calculated according to the following formulas using the batter weigh. ital. j. food sci., vol. 32, 2020 110 baking loss (%) = 〔(batter weight – muffin weight)/batter weight〕 × 100 baking yield (%) = (muffin weight/batter weight) × 100 2.3.3 physical properties muffin weight was measured with a digital scale (eb-2200hu, dong-il shimadzu corp., seoul, korea). muffin volume was measured by the method of seed displacement (pyler, 1979). specific volume (ml/g) was determined by dividing the muffin volume (ml) by muffin weight (g). muffin height was measured as the vertical distance from the bottom to the top of the muffin center using vernier calipers. 2.3.4 appearance the color values of both crumb and crust were measured by a spectrophotometer (cr-400, konica minolta co., ltd, tokyo, japan). the color values were shown as lightness (l), redness (a), yellowness (b) and total color difference (△e). the △e was calculated by the following equation. the appearance and cross section of muffins were captured by a digital camera (x-t20, fujifilm, tokyo, japan). ∆𝐸 = (𝐿!"#$%& − 𝐿!"#$%#&%)! + (𝑎!"#$%& − 𝑎!"#$%#&%)! + (𝑏!"#$%& − 𝑏!"#$%#&%)! 2.4. textural analysis of muffin crumb texture profile analysis (tpa) was performed on muffins at a 25℃. the samples (20 mm × 20 mm × 20 mm) were measured by a two-bite compression test using rheometer (compac-100ⅱ, sun scientific, tokyo, japan). in this measurement, the cylindrical probe (20 mm diameter) was mounted and operated at 1.0 mm/s. hardness (n), springiness (%), cohesiveness (%), chewiness (g) and brittleness (g) were determined. hardness refers to the maximum force with the maximum peak of the first compression. springiness is the deformation rate between the first compression and the second compression, defined as the ratio of distances (d1: the maximum distance of the first bite; d2: the distance to the deformed sample surface in the second bite). cohesiveness is the strength of internal bonds and defined as the ratio of area. chewiness is calculated by multiplying the hardness value by the cohesiveness value. brittleness, also called fracturability, is a measure of force at the first peak. springiness (%) = d2/d1 × 100 cohesiveness (%) = a2/a1 × 100 2.5. antioxidant activity properties 2.5.1 antioxidant compound extraction the muffins were freeze-dried at -80℃ for 48 h and ground for 1 min (40 mesh). the muffins were defatted with hexane at a ratio of 1:5 w/v (3 min, 3 times), dried at 45℃ for 5 h, and extracted in a water bath (bs-20, jeio tech, seoul, korea) at 185 rpm for 1 h at 40℃ ital. j. food sci., vol. 32, 2020 111 with 70% methanol at a ratio of 1:10 w/v. the sample extracts were filtered using whatman filter (no. 4) and kept at 4℃ for subsequent experiments. 2.5.2 total polyphenols content total polyphenols content was determined by the folin-ciocalteu method. briefly, 50 µl of 0.9 n folin-ciocalteu’s reagent (merk kgaa, darmstadt, germany) and 150 µl of 20% sodium carbonate solution (merck kgaa, darmstadt, germany) were added sequentially to the extracted samples (20 µl) mixed with distilled water (790 µl). after incubating for 2 h incubation at 25℃, the absorbance of the mixed sample was read at 700 nm using an elisa microplate reader (apollo11lb913, berthhold thechnolosies co., ltd., bad wildbad, germany). the total polyphenol content (㎍ gae/g) was converted to gallic acid equivalents. 2.5.3 total flavonoids content total flavonoids content was examined by the method of zhang et al. (2017). briefly, 150 µl of 5% sodium nitrie (junsei chemistry) was added to 1 ml of samples and incubated in the darkroom at 25℃ for 6 min. subsequently, 0of 10% alcl3 was added to the mixed samples and incubated in the darkroom at 25℃ for 5 min. finally, 1 ml of 1 n naoh was mixed, and the absorbance of the sample mixture was read at 520 nm using an elisa microplate reader (apollo11lb913, berthhold thechnolosies co., ltd., bad wildbad, germany). the total flavonoids content (㎍ qe/mg) was converted to quercetin equivalents. 2.5.4 reducing power reducing power of the extracted samples was determined by a modified oyaizu (1986) method. briefly, 250 µl of 0.2 m phosphate buffer, the mixture of sodium phosphate monobasic solution and sodium phosphate dibasic solution (1:2), and 250 µl of 1% potassium ferricyanide solution were added to 250 µl of samples and incubated for 30 min at 50℃. subsequently, 250 µl of 10% trichloroacetic acid solution was mixed. finally, 500 µl of distilled water and 100 µl of 0.1% fecl3 were added to the sample supernatant (500 µl) and the absorbance of the sample mixtures was read at 700 nm using an elisa microplate reader (apollo11lb913, berthhold thechnolosies co., ltd., bad wildbad, germany). 2.5.5 dpph radical scavenging assay dpph assay refers to the method of joung et al. (2017). the 200 μmol dpph reagent was added to the diluted samples extracts (10, 12.5, 20, 25, 50, 100 mg/ml) and reacted in the darkroom at room temperature for 30 min. the absorbance of the sample mixtures was read at 520 nm using an elisa microplate reader (apollo11lb913, berthhold thechnolosies co., ltd., bad wildbad, germany). ital. j. food sci., vol. 32, 2020 112 2.5.6 abts radical scavenging assay the abts assay was measured with reference to the method of zhang et al. (2017). the abts reagent with the absorbance of 1.5 at 405 nm was added to the diluted samples (10, 12.5, 20, 25, 50, 100 mg/ml) and reacted in the darkroom at room temperature for 60 min. the absorbance of the sample mixtures was read at 405 nm using an elisa microplate reader (apollo11lb913, berthhold thechnolosies co., ltd., bad wildbad, germany). 2.6. air cells determination muffins were cut at the height of muffin mold (2 cm), and images of the bottom half were obtained using a digital camera (x-t20, fujifilm, tokyo, japan). by pore size, air cell number and area were calculated using the imagej software (marcet et al., 2015). 2.7. microstructure of batter and muffins 2.7.1 batter microstructure a drop of batter was placed on a microscope glass slide and covered with a cover glass. the cover glass was used to apply constant force (1 kg) to equalize and thinly spread the batter layer. the batter samples were observed using a microscope (ts100, nikon, tokyo, japan). the infinity capture v6.5.6 for windows software was utilized with the infinity lite camera (lumenera, ottawa, canada). 2.7.2 crumb microstructure scanning electron microscopic (sem) studies were examined using the jsm-6701f (jeol ltd., tokyo, japan). sample preparation for sem was according to the modified method of shin et al. (2018). the crumb samples were freeze-dried (fd8508, ilshinbiobase co.), and pieces of samples (size 2 × 4 mm) were placed separately on aluminum specimen mount using nem tape and conductive graphite (ted pella inc., california, usa). mounted samples were coated with au using the jsm 670-1f (jeol ltd., tokyo, japan) at 10 ma for 2 min. each sample was observed at 10 kv and 1.16 × 10-4 torr vacuum. 2.8. retrogradation kinetics of avrami model retrogradation of the muffin was analyzed with reference to berski et al. (2018). muffin samples were stored at 25℃ for 35 days, and hardness was measured on a rheometer (compac-100ⅱ, sun scientific, tokyo, japan) at the date of production and every week after preparation. according to the avrami equation, the retrogradation status of muffins was measured by analyzing the alteration of hardness with the storage period. avrami equation was as follows: 𝜃 = 𝑒!!"! (1) where θ is the amorphous part remaining after a certain time (t), k is the rate constant, n is the avrami exponent, and t is the storage period. ital. j. food sci., vol. 32, 2020 113 the operating conditions for the rheometer were a tpa test using the cylinder probe no.1 (ф 20 mm), 2 × 2 × 2 cm sample size, 120 mm/min table speed, 66.67% distance, and 10 kg max weight. (el-et) / (el-e0) = 𝑒!!" ! (2) where e0 is the hardness of the initial period (t = 0), et is the hardness after a certain time (t) and el is the greatest hardness value to be reached theoretically (the hardness value of a muffin stored at 25℃ for 35 days). the following equation was obtained by taking a common logarithm of equation (2) as: log〔ln (el-et) / (el-e0)〕 = log k + n log t (3) where n is the avrami exponent (1 ~ 4 values, depending on the crystallization status), and k is rate constant. 2.9. sensorial evaluation the muffin samples were baked 3 h before sensory evaluation. the samples were divided into four parts and supplied with water to each panelist at once in a white plastic plate. the sensory evaluation was completed by 51 panelists from korea university (age range 20-60). the panels evaluated the muffins based on their appearance, flavor, texture, taste and overall acceptability using a hedonic scale of 9 points (9 score is “i like very much” and 1 score is “i dislike very much”). 2.10. statistical analysis the statistical analysis of results was completed using the spss (ibm spss statistics 23, international business machines corporation, new york, usa) program. significant differences were assessed by one-way anova (analysis of variance) followed by duncan’s multiple range test at a 95% significance level (p<0.05). 3. results and discussions 3.1. muffin physicochemical characteristics the physicochemical features of muffins are shown in table 2 (fig. 1.) the results suggest that the addition of kf significantly affected the moisture content and brix degree (p<0.05). muffin crumb moisture content was the highest in k100 (28.18%) and the lowest in con (24.78%). similar to the description by gurpree et al. (2015), this is due to the water absorption of kf. with increasing kf replacement level, muffin moisture content tended to increase. as the result of comparing the water binding capacity of kf and wf, the water binding capacity of kf (225.09%) showed a higher value than that of wf (198.13%) (data not shown). as the water binding capacity results showed, the moisture content of muffins was significantly increased with the addition of kf. the sugar content of muffins was expressed in brix degree, which is the basic criterion to evaluate sugar contents. muffin sugar contents diminished significantly (p<0.05) as the kf substitution ital. j. food sci., vol. 32, 2020 114 increased. due to the maillard reaction, which is the reaction between the reducing sugar and the amino acids. the brix degree represents the content of soluble solids, and the reducing sugar involved in the maillard reaction is also included in the soluble solids. as the kf replacement level increased, the muffin lightness value decreased and became significantly darker, suggesting that the number of soluble solids was reduced by increasing the nonenzymatic browning reaction. according to a study by zhang et al. (2016), the brownish or yellowish color of bakery products with high sugar content were caused by the maillard reaction, which is mainly found in the baking process. the baking loss significantly decreased with increasing kf substitutions (p<0.05). the lowest baking loss was found in k100 (10.67%). the baking yield was the lowest in con (83.43%) and the highest in k100 (89.33%), and it significantly increased as the kf substitution ratio increased. the results are similar to the study of kotoki and daka (2010), suggesting that the water binding capacity affects the water content of muffin crumb, which may affect baking yield and baking loss. the specific gravity of the batter was the lowest in con (0.94), and it significantly increases with the increased in kf substitution levels. the muffin height significantly decreased as the kf substitution rate rose in the batter (p<0.05). the con muffin had the highest volume (121.83 ml) and specific volume (2.89 ml/g), and these were significantly decreased as the kf substitution ratio decreased. while the con muffin showed the lowest weight (42.11 g), it significantly increased with the increasing kf substitution percentage. the lightness (l), yellowness (b), redness (a), and color difference (△e) values of both crust and crumb are shown in table 3. crust l, a and b were the lowest in k100, and the l and b values of crust were the highest in con. the crust color was affected by the maillard or caramelization reaction between proteins and sugar. crumb l and b values decreased significantly, while the a value increased significantly as the kf substitution increased (p<0.05). the crumb color value was affected by the color of the raw material, which was not heated sufficiently to drive the maillard or caramelization reaction (marchetti et al., 2018). the crust △e values of con and k25 were lower than other samples. as the kf proportion increased, the crumb △e values increased significantly (p<0.05). figure 1. photograph of muffins and cross section of muffin crumbs with different levels of kf. ital. j. food sci., vol. 32, 2020 115 table 2. some physicochemical properties of muffin with different levels of kf. samples moisture (%) brix degree baking loss (%) batter yield (%) specific gravity height (mm) volume (ml) specific volume (ml/g) weight (g) con 24.78±0.29 1)d 3.03±0.20a 16.57±0.20a 83.43±0.20d 0.94±0.00e 48.56±0.43a 121.83±2.02a 2.89±0.05a 42.11±0.07d k25 25.95±0.17 c 2.63±0.06b 14.22±0.28b 85.78±0.28c 0.95±0.01d 47.24±0.42b 117.5±1.50b 2.72±0.03b 43.16±0.09c k50 26.92±0.43 b 2.50±0.00bc 11.85±0.03c 88.15±0.03b 0.96±0.00c 47.26±0.47b 114.23±0.76c 2.58±0.02c 44.45±0.02b k75 27.30±0.45 b 2.40±0.00c 11.66±0.13c 88.34±0.13b 1.04±0.00b 46.64±0.21b 107.83±1.26d 2.43±0.03d 44.33±0.10b k100 28.18±0.22 a 2.33±0.06c 10.67±0.09d 89.33±0.09a 1.04±0.00a 45.3±0.33c 90.33±1.26e 2.01±0.03e 45.04±0.05a f-value 46.567*** 23.100*** 591.725*** 591.725*** 616.542*** 28.328*** 226.868*** 317.512*** 782.063*** 1) the data are mean±sd in triplicates. a-edifferent superscripts indicate there are significant differences between values in the same row according to duncan's multiple range test at p<0.05. *p<0.05, ***p<0.001. table 3. color measurement of muffin crust and crumb with different levels of kf. samples crust crumb l2) a b △e l a b △e con 48.51±0.441)a 8.99±0.05b 15.21±0.06a 50.90±0.54b 78.51±0.29a -3.74±0.32d 24.26±0.42a 28.68±0.35e k25 47.78±0.10b 8.75±0.16bc 15.57±0.54a 51.74±0.28b 67.68±0.34b -1.02±0.12c 23.05±0.27b 36.42±0.50d k50 42.87±0.59d 9.64±0.07a 14.17±0.57b 56.11±0.56a 61.45±0.40c -0.79±0.09c 22.02±0.82c 41.63±0.31c k75 44.02±0.30c 7.80±0.18d 13.13±0.32c 55.08±0.99a 55.77±0.16d 0.97±0.11b 20.98±0.12d 45.68±0.20b k100 43.67±0.40c 8.53±0.21c 12.85±0.75c 56.03±0.23a 52.04±0.32e 1.57±0.07a 19.89±0.22e 49.45±0.36a f-value 125.283*** 60.174*** 17.172*** 53.359*** 3370.949*** 455.629*** 44.380*** 1557.270*** 1) the data are mean±sd in triplicates. 2) l: lightness, a: redness, b: yellowness, △e: total color difference. a-e different superscripts indicate there are significant differences between values in the same row according to duncan's multiple range test at p<0.05. *p<0.05, ***p<0.001. ital. j. food sci., vol. 32, 2020 116 3.2. textural properties of muffin crumb the texture of food products is a close factor to the body, such as the feeling of the mouth or fingers. the results of the muffin textural analysis prepared from the various ratio of wf and kf are presented in table 4. the results showed that kf significantly affected the muffin crumb texture (p<0.05). hardness was 1.15 n in con and as the kf ratio increased, the hardness increased significantly (p<0.05), reaching k100 at 3.09 n. the increment in hardness is related to fewer and smaller air cells inside the muffin crumb, and it corresponds to the muffin volume, height, and weight. tess et al. (2015) also mentioned that volume and hardness have an inverse relationship. springiness is related to aeration and freshness of products, and especially in bakery products, high springiness has close relevance to high quality (matos et al., 2014). the k100 muffin showed the highest value in springiness, and an appropriate addition of kamut flour seemed to have a good effect on the muffin textural quality. cohesiveness is the parameter that signifies the perception linked to the energy required to bite the piece of food and sensory brittleness (sanz et al., 2009). in comparison to con, the other samples were significantly (p<0.05) decreased in cohesiveness, which suggests that energy was required for the second compression. the chewiness reflects the parameter associated with the energy required for biting activity from a solid form to a swallowable state (tess et al., 2015). con chewiness showed the lowest value at 0.54 n and it increased significantly (p<0.05) with the increasing kf ratio. k100 chewiness was approximately twice as high as that of con. brittleness is related to the muscle motion of biting food, and it has a correlation with hardness (peng et al., 2002). brittleness in con was 56.57 g, and it significantly (p<0.05) increased, reaching 214.27 g in k100 and following a similar trend as hardness and chewiness. the previous study carried out by pasqualone et al. (2011) demonstrated that the crumb firmness of durum wheat bread was slightly lower than kamut bread, but there was no significant difference. table 4. textural profile analysis of muffin crumbs with different levels of kf. samples hardness (n) springiness (%) cohesiveness (%) chewiness (n) brittleness (g) con 1.15±0.121)c 69.65±3.27c 67.03±2.63a 0.54±0.06b 56.57±9.74e k25 1.40±0.15c 70.25±1.75c 61.56±0.24b 0.61±0.05b 84.04±3.08d k50 1.73±0.25c 75.29±2.11b 59.92±0.92b 0.78±0.10b 110.62±2.52c k75 2.39±0.30b 79.86±1.37a 54.46±1.48c 1.04±0.16a 150.87±3.54b k100 3.09±0.60a 82.32±0.96a 49.17±0.55d 1.25±0.24a 214.27±3.24a f-value 16.882*** 21.252*** 68.269*** 13.309** 426.197*** 1) the data are mean±sd in triplicates. a-edifferent superscripts indicate there are significant differences between values in the same row according to duncan's multiple range test at p<0.05. **p<0.01, ***p<0.001. ital. j. food sci., vol. 32, 2020 117 3.3. antioxidant properties of muffin crumb the kamut flour showed significantly higher antioxidant activities than wheat flour. the total polyphenol content was 23.44 ㎍gae/mg in kamut flour and 17.74 ㎍gae/mg in wheat flour. the total flavonoids content was 27.75 ㎍qe/mg in kamut flour and 8.44 ㎍ qe/mg in wheat flour. in the results of reducing power, kamut flour (0.84) was about four times higher than wheat flour (0.21). dpph and abts results also showed that kamut flour (129.91 ㎍/ml and 130.91 ㎍/ml respectively) had lower ic50 values than wheat flour (162.21 ㎍/ml and 325.79 ㎍/ml respectively) so that kamut flour had higher radical scavenging activities. sofi et al. (2013) reported a comparison of antioxidant activities between kamut flour and wheat flour, and kamut was determined as superior in dpph and fe2+ chelation. in addition, polyphenols and flavonoids were higher in kamut. the antioxidant properties of muffins are presented in table 5. the total polyphenol content and total flavonoid content were determined in terms of gallic acid equivalent and quercetin, respectively. k100 (17.33 ㎍gae/mg) was the richest in polyphenols, which was 2.62 times higher than con. the total flavonoids content was also the highest in k100 (18.54 ㎍qe/mg), and it increased significantly as kf level increased (p<0.05). the replacement of wf with kf showed an increment in reducing power. the reducing power of extracts is regarded as an indicator of antioxidant activities (kaur and kaur, 2018). a significant increment in abts and dpph radical scavenging activities of muffin crumbs was observed as the kf level increased (p<0.05). k100 showed a relatively lower ic50 in comparison to con. table 5. antioxidant activities of muffin crumbs with different levels of kf. con k25 k50 k75 k100 f-value polyphenols (㎍gae/mg) 6.61±0.06 1)e 8.07±0.12d 10.45±0.13c 15.30±0.20b 17.33±0.08a 3953.926*** flavonoids (㎍qe/mg) 9.61±0.25 e 11.77±0.00d 12.80±0.11c 16.75±0.33b 18.54±0.14a 987.048*** reducing power 0.23±0.00 d 0.22±0.00c 0.32±0.00b 0.36±0.00a 0.36±0.00a 9770.3*** dpph (ic50, ㎍/ml) 243.09±3.79d 234.95±1.55c 223.95±.6.67c 224.90±0.87b 213.47±3.48a 25.945*** abts (ic50, ㎍/ml) 263.08±2.90d 237.89±3.58c 223.68±1.91c 219.92±6.32b 207.34±0.22a 104.716*** 1) the data are mean±sd in triplicates. a-e different superscripts indicate there are significant differences between values in the same row according to duncan's multiple range test at p<0.05. *p<0.05, ***p<0.001. 3.4. crumb air cells table 6 presents the number and area of air cells categorized by a particular size range. cross section images of muffin crumbs are shown in fig. 2. during the mixing process, pores are generated in the batter and they grow while baking as co2 production results. ital. j. food sci., vol. 32, 2020 118 table 6. air cell number and area in muffin crumbs with different levels of kf. samples air cells number air cells area <1 pixel2 1-10 pixel2 10-100 pixel2 1001000 pixel2 1000 pixel2 < total 1-10 pixel 2 10-100 pixel2 100-1000 pixel2 1000 pixel2 < total con 61 90 87 81 13 332 4.80±2.71 40.80±27.79 331.22±210.10 2336.69±1194.21 2713.51 k25 52 88 123 66 12 341 4.53±2.55 39.36±23.97 265.05±158.10 2230.58±1445.59 2539.52 k50 98 177 187 59 5 526 4.37±2.28 38.63±24.47 222.32±152.39 1723.6±907.82 1988.92 k75 132 214 257 55 2 660 4.29±2.26 33.77±22.74 224.58±113.84 1412.50±433.46 1675.14 k100 129 218 251 53 3 654 4.28±2.32 34.53±22.09 211.47±110.25 1171.33±152.32 1421.61 figure 2. cellular structure of muffin crumb with different levels of kf. top line: scanned images of the cross section of muffin crumb, bottom line: modified images using imagej. ital. j. food sci., vol. 32, 2020 119 as the substitution ratio of wf to kf increases, the number of pores with the size of 100 pixel2 or less increased, whereas the number of pores decreased over a size of 100 pixel2. the air cells area result showed the opposite tendency to the air cells number. as the kf substitution rate increased, average air cell size increased in all pore size classes. therefore, substitution of wf by kf resulted in a tiny air cell and densely structured crumb. the size of air cells is an important factor affecting the texture of final bakery products (giacomozzi et al., 2018). the air cells growing during baking affects the tender quality, which is related to the crumb hardness. con showed a greater number of large air cells than other samples, which had weak crumb hardness. as mentioned earlier, the hardness increased as the pore size decreased and became dense. 3.5. microstructure of batter and muffins batter microstructure is shown in fig. 3. the micrograph of con batter shows a uniformly spread air bubble and the air bubble size is relatively large and not concentrated in a particular area. in the former study by rajiv et al. (2011), the control muffin batter showed an even and constant size of air bubble distribution. micrograph of k25 batter shows relatively small-sized air bubbles appeared. the air bubbles of k25 batter showed closer formation and density compared to those of the con batter. micrograph of k50 batter exhibits both large-sized and small-sized air bubbles, and it does not form the uniform distribution. compare to con and k25 batter, the smaller air bubbles can be observed to stick together slightly in the k50 batter. the k75 batter micrograph shows unevenly distributed air bubbles, and the small-sized air bubbles are gathered around medium-sized air bubbles. micrograph of the k100 batter shows an air bubble distribution similar to that of the k75 batter is observed, and the air bubbles are denser. fig. 4 presents the scanning electron micrographs. in figs. 4a-1 (con), 4b-1 (k25), 4c-1 (k50), 4d-1 (k75) and 4e-1(k100), the muffin crumbs are magnified 100 times, and the change of the pore size, distribution, and matrix surface can be observed. as the kf level increased, the small-sized pores gradually formed and the granular structure on the matrix surface became larger, such that the matrix appeared to be disconnected. fig. 4a-2 shows the micrograph of the con muffin crumb prepared entirely with wf, which shows gelatinized starch granules buried under the denatured protein matrix. the microstructure of starch granules embedded in a protein matrix is also described by gao et al. (2018). lee et al. (2001) reported that starch granules can be divided into two types, spherical and lenticular-shaped, which were also observed in the blended wheat flour dough. fig. 4b-2 displays the micrograph of the k25 muffin crumb, and it shows fewer starch granules and smoother continuous matrix than that of con. in fig. 4c-2, which is the micrograph of the k50 muffin crumb, a rather rough and ruptured protein matrix is observed. rajiv et al. (2011) reported that disruption of the protein matrix became greater when wheat was replaced by 60% of finger millet. in fig. 4d-2, which exhibits the micrograph of the k75 muffin crumb, the gelatinized starch granules are large, and it appears to be coated. fig. 4e-2 is the micrograph of the k100 muffin crumb, which shows greater and thin starch granules that seem to be entangled in a discontinuous protein matrix. therefore, when the kf level is increased, the starch granules become greater, and continuity of the protein matrix is lost. ital. j. food sci., vol. 32, 2020 120 figure 3. batter microstructure (×100). top line: micrograph of muffin batters con, k25, k50, k75, k100, bottom line: modified images of batter con, k25, k50, k75, k100 using imagej. figure 4. scanning electron micrograph of muffin crumbs. top line: sem micrograph of magnification 100×. bottom line: sem micrograph of magnification 250×. 3.6. retrogradation kinetics the avrami equation describes the retrogradation process kinetics and the result is shown in table 4. starch retrogradation is an important quality determinant in the staling of bakery products. avrami exponent (n) indicates the value of nucleation in crystallization, and it depends on the growth rate of crystallites in short storage periods (collar et al., 1999). the lower the avrami exponent, the slower the crystallization rate, which is more effective for delaying retrogradation (kim et al., 2006; s.-s. kim and chung, 2010; zhang et al., 2017). crystallization is an important factor as it is related to the texture and shelf-life of a bakery product. the avrami exponent showed the highest value in k100, but the value tended to decrease from con (1.5540) to k75 (0.7669). the rate constant (k) refers to the retrogradation time. the reduction in the rate constant describes delays in retrogradation in the presence of carbohydrates. the rate constant tended to decrease with kamut replacement from con (1.8095) to k75 (1.2904), but the k100 (2.1541) showed a sharp increase. according to avrami kinetic results, muffins prepared only with kamut had similar values to the con. carini et al. (2010) reported that whole kamut tortillas were very similar to the control group in textural changes during the storage period. ital. j. food sci., vol. 32, 2020 121 table 7. avrami parameters for muffin crumbs with different levels of kf. avrami avrami exponent (n) rate constant (k) r2 con 1.554 1.8095 0.9988 k25 1.3208 1.4036 0.9998 k50 1.1402 1.3113 0.9996 k75 0.7669 1.2904 0.9995 k100 1.5774 2.1541 1.0000 3.7. sensorial evaluation the sensory evaluation scores for appearance, flavor, texture, sweetness, and overall acceptability of muffins are presented in table 8. the data showed that the sensory score for appearance, flavor, texture, sweetness, and overall acceptability decreased as the kamut flour replacement level was over 50%. in the case of appearance and sweetness, except for con, k25 and k50 scored higher than other samples and became not preferred at levels above 75% kf addition. the lowest appearance score of k100 could be explained due to the dark crumb color by the maillard reaction between sugar and amino acids, increased brittleness, and small muffin volume. the decreased score in sweetness could be related to a decrement in brix degree. regarding flavor and overall acceptability, both k25 and k50 were as high as con. according to statistically analyze result, the con and both k25 and k50 showed no significant difference in flavor and overall acceptability (p>0.05). it showed that the kamut replacement had no significant negative effect on product preference at levels below 50%. the texture is one of the important parameters of sensory evaluation of processed foods (alpaslan and hayta, 2006). the texture was not significantly affected by kamut flour substitution (p>0.05), unlike the mechanical texture results. in previous studies, the partial or complete replacement of wheat flour with kf provided equal or better sensory characteristics (bordoni et al., 2017), and cooked kamut grain ranked highly for sweetness among the various wheat varieties (starr et al., 2015). based on the sensory evaluation results, 25-50% of the kamut added to muffins is considered as a desirable substitute addition level. table 8. sensory evaluation of muffins with different levels of kf. con k25 k50 k75 k100 f-value appearance 7.18±1.80a 6.76±1.45ab 6.27±1.54bc 5.72±1.39cd 5.49±1.55d 10.435*** flavor 6.84±1.49a 6.54±1.43a 6.27±1.61ab 5.84±1.54bc 5.53±1.65c 5.948*** texture 6.10±1.71ns 6.25±1.56 6.11±2.00 5.75±1.62 5.37±1.77 2.161 sweetness 6.94±1.22a 6.25±1.44bc 6.55±1.63ab 5.86±1.46c 6.00±1.93bc 3.985** overall acceptability 6.69±1.69 a 6.37±1.57a 6.45±1.80a 5.73±1.42b 5.47±1.74b 5.009** 1) the data are mean±sd in triplicates. a-e different superscripts indicate there are significant differences between values in the same row according to duncan's multiple range test at p<0.05. **p<0.01, ***p<0.001. ital. j. food sci., vol. 32, 2020 122 4. conclusions replacement of wheat flour by kamut flour in muffins affected the air bubble distribution in batter and this affected on the muffin volume, weight and height. the air cell distribution became denser as kf level increased so that caused increased harness. in addition, with increasing kf level, the greater starch granules and the less protein matrix continuity could be descripted through the microscopic observation. textural properties of crumb changed significantly. addition of kf improved antioxidant capacity. study of muffin firming kinetics revealed avrami exponent value of k100 significantly high, but k75 showed the lowest value. all muffins were considered acceptable and the muffin containing less than 50% of kamut flour level showed a preference score in the sensory evaluation references aacc. 2000. approved methods of the american association of cereal chemists 10th ed. pp.10-91.st. paul, mn:american association of cereal chemists, inc. alpaslan m. and hayta m. 2006. the effects of flaxseed, soy and corn flours on the textural and sensory properties of a bakery product. journal of food quality. 29(6):617-627. angioloni a. and collar c. 2011. nutritional and functional added value of oat, kamut®, spelt, rye and buckwheat versus common wheat in breadmaking. journal of the science of food and agriculture. 91(7):1283-1292. benedetti s., primiterra m., tagliamonte m.c., carnevali a., gianotti a., bordoni a. and canestrari f. 2012. counteraction of oxidative damage in the rat liver by an ancient grain (kamut brand khorasan wheat). nutrition. 28(4):436-441. berski w., ziobro r., witczak m., and gambuś h. 2018. the retrogradation kinetics of starches of different botanical origin in the presence of glucose syrup. international journal of biological macromolecules. 114:1288-1294. bordoni a., danesi f., di nunzio m., taccari a. and valli v. 2017. ancient wheat and health: a legend or the reality? a review on kamut khorasan wheat. international journal of food sciences and nutrition. 68(3):278-286. dinu m., whittaker a., pagliai g., benedettelli s. and sofi f. 2018. ancient wheat species and human health: biochemical and clinical implications. the journal of nutritional biochemistry. 52:1-9. fatma b., silvia f., stefano s, elena v. and barbara p. 2017. current trends in ancient grains-based foodstuffs: insights into nutritional aspects and technological applications. compregensive reviews in food science and food safety. 17(1):123-136 kim b.g., park n.y. and lee s.h. 2016. quality characteristics and antioxidative activity of muffins added with coffee ground residue water extract and powder. journal of the korean society of food science and nutrition. 45(1):76-83. carini e., curti e. and vittadini e. 2010. effect of long-term storage on water status and physicochemical properties of nutritionally enhanced tortillas. food biophysics. 5(4):300-308. carnevali a., gianotti a., benedetti s., tagliamonte m. c., primiterra m., laghi l. and capozzi f. 2014. role of kamut® brand khorasan wheat in the counteraction of non-celiac wheat sensitivity and oxidative damage. food research international. 63:218-226. chandi g.k., lok c.w., jie n.y. and seetharaman k. 2015. functionality of kamut and millet flours in macro wire cut cookie systems. journal of food science and technology. 52(1):556-561. choi j.h., kim e. and lee k.s. 2016. quality characteristics of sourdough bread made with kamut sour starter. culinary science and hospitality research. 22(5):117-133. collar c., andreu p., martınez j. and armero e. 1999. optimization of hydrocolloid addition to improve wheat bread dough functionality: a response surface methodology study. food hydrocolloids. 13(6):467-475. ital. j. food sci., vol. 32, 2020 123 song d.h., kim g.j., kim j.h., seo h.r., kim s.g., yoon j.a., chung k.h.and an j.h. 2017. quality characteristics and antioxidant activity of muffins prepared by substituting wheat flour with different rice powders. korean journal of food science and technology. 49(5): 567-573. di loreto a., di silvestro r., dinelli g., bregola v., stenico v., sferrazza r.and bosi s. 2017. nutritional and nutraceutical aspects of kamut® khorasan wheat grown during the last two decades. the journal of agricultural science. 155(6):954965. gao j., han f., guo x., zenh x.a., mason s., brennan m.and brennan c. 2018. image analysis of the sugar-reduced muffin formulated with stevianna® or inulin as a sugar replacer. grain and oil science and technology. 1(2):63-71. giacomozzi a.s., carrín m.e.and palla c.a. 2018. muffins elaborated with optimized monoglycerides oleogels: from solid fat replacer obtention to product quality evaluation. journal of food science. 83(6):1505-1515. gurpreet k.c., chan w.l, ng y.j. and koushik s. 2015. functionality of kamut and millet flours in macro wire cut cookie systems. journal of food science and technology. 52(1):556-561. bae j.h. and jung i.c. 2013. quality characteristics of muffin added with buckwheat powder. journal of the east asian society of dietary life. 23(4):430-436. kaur r. and kaur m. 2018. microstructural, physicochemical, antioxidant, textural and quality characteristics of wheat muffins as influenced by partial replacement with ground flaxseed. lwt – food science and technology. 91: 278-285. kim d.h., whang h.j., moon s. .and kang b.s. 2006. the retrogradation of steamed korean rice cake (jeungpyun) with addition of gums. korean journal of food science and technology. 38(6):838-842. kim s.s. and chung h.y. 2010. retarding retrogradation of korean rice cakes (karedduk) with a mixture of trehalose and modified starch analyzed by avrami kinetics. the korean journal of food and nutrition. 23(1):39-44. kotoki d. and deka s.c. 2010. baking loss of bread with special emphasis on increasing water holding capacity. journal of food science and technology. 47(1):128-131 lee l., ng p.k. w., whallon j.h.and steffe j.f. 2001. relationship between rheological properties and microstructural characteristics of nondeveloped, partially developed, and developed doughs. cereal chemistry. 78(4):447-452. marcet i., paredes b.and díaz m. 2015. egg yolk granules as low-cholesterol replacer of whole egg yolk in the preparation of gluten-free muffins. lwt food science and technology. 62(1, part 2):613-619. marchetti l., califano a.n.and andrés s. c. 2018. partial replacement of wheat flour by pecan nut expeller meal on bakery products. effect on muffins quality. lwt – food science and technology. 95:85-91. matos m.e., sanz t.and rosell c.m. 2014. establishing the function of proteins on the rheological and quality properties of rice based gluten free muffins. food hydrocolloids. 35:150-158. oyaizu m. 1986. antioxidative activities of browning reaction prepared from glucosamine. the japanese journal of nutrition. 44:307-315. pasqualone a., piergiovanni a., caponio f., paradiso v.m., summo c.and simeone r. (2011). evaluation of the technological characteristics and bread-making quality of alternative wheat cereals in comparison with common and durum wheat. food science and technology international. 17(2):135-142. peng y.k., sun x.z., carson l.and setser c. 2002. food hardness and fracturability assessment by an electronic sensing system. journal of texture studies. 33(2):135-148. qian l., lee s.j.and chung h.j. 2017. quality characteristics of muffins made with legume and wheat flour blends. korean journal of food science and technology. 49(6):638-643. rajiv j., soumya c., indrani d.and venkateswara rao g. 2011. effect of replacement of wheat flour with finger millet flour (eleusine corcana) on the batter microscopy, rheology and quality characteristics of muffins. journal of texture studies. 42(6):478-489. sanz t., salvador a., baixauli r.and fiszman s.m. 2009. evaluation of four types of resistant starch in muffins. ii. effects in texture, colour and consumer response. european food research and technology. 229(2):197-204. ital. j. food sci., vol. 32, 2020 124 shin s.y., o h., joung k.y.and kim y.s. 2018. quality and texture characteristics of pumpkin seed tofu made with soybean (glycine max l. merrill) and pumpkin (cucurbita moschata duch.) seed. the korean journal of food and nutrition. 31(1):62-69. sofi f., whittaker a., cesari f., gori a., fiorillo c., becatti m., abbate r. 2013. characterization of khorasan wheat (kamut) and impact of a replacement diet on cardiovascular risk factors: cross-over dietary intervention study. european journal of clinical nutrition. 67(2):190. sumczynski d., bubelova z., sneyd j., erb-weber s.and mlcek, j. 2015. total phenolics, flavonoids, antioxidant activity, crude fibre and digestibility in non-traditional wheat flakes and muesli. food chemistry. 174:319-325. starr g., hansen å.s., petersen m.a.and bredie w. 2015. aroma of wheat porridge and bread-crumb is influenced by the wheat variety. lwt-food science and technology. 63(1):590-598. tess m., bhaduri s., ghatak r.and navder k. p. 2015. physical, textural and sensory characteristics of gluten free muffins prepared with teff flour (eragrostistef (zucc) trotter). journal of food processing and technology. 6(9):490. wijngaard h.h. and arendt e.k. 2006. buckwheat. cereal chemistry. 83(4):391-401. zhang y.y., song k.y., o h., joung k.y., shin s.y.and kim y.s. 2017. effect of pomegranate (punica granatum l.) peel powder on the quality characteristics, retrogradation and antioxidant activities of sponge cake. the korean journal of food and nutrition. 30(3):578-590. zhang l., putranto a., zhou w.b., boom r.m., schutyser m.a. i.and chen x.d. 2016. miniature bread baking as a timesaving research approach and mathematical modeling of browning kinetics. food and bioproducts processing, 100:401–411 paper received february 19, 2019 accepted september 5, 2019 ijfs#1207_bozza ital. j. food sci., vol. 31, 2019 1 opinion paper insoluble tomato-fiber effect on wheat dough rheology and cookies' quality m. chouaibi*, l. rezig, a. boussaid and s. hamdi food preservation laboratory, high institute of food industry, 58 alain savary street, elkhadra city, tunis 1003, tunisia *corresponding author: tel./fax: +21671770399/+21671771192 e-mail address: moncef.chouaibi@yahoo.com.au abstract commercial insoluble tomato fiber (itf) was incorporated in wheat-flour dough to prepare cookies at amounts of 2.50, 5, 7.50, and 10 %. it was demonstrated that all wheat dough samples exhibited non-newtonian-thixotropic behaviors at shear rates from 0.001 to 1000 s-1. besides, the oscillatory rheology analysis confirmed that the storage modulus predominated the loss one in the whole frequency range and increased significantly with the increase in the itf concentration. actually, the latter's incorporation from 0 to 10 % increased farinograph water absorption, pasting temperature and peak consistency, and decreased dough stability, amylograph pasting viscosities and fermentation parameters of all tested wheat flours. furthermore, the itf addition was proven to affect the formed cookies, indicating a significant increase in the samples' breaking strength and decrease in their spread ratio. the total polyphenol contents of the formed cookies ranged from 86.98mggae/ 100 g to 376.02 gae/g cookies. the itf incorporation increased the antioxidant activities as measured by dpph, abts and frap scavenging activities. correlations between the analyzed parameters of the cookies' color and ic50 are statistically significant (p< 0.01), suggesting the possible use of itf as an alternative source of bioactive compounds to improve the cookies' quality. keywords: insoluble tomato fiber, wheat flour, rheological properties, cookies, antioxidant activities, quality characteristics ital. j. food sci., vol. 31, 2019 2 1. introduction every year, millions of tons of tomatoes are processed with a residue waste being considered as a good source for food supplements, such as insoluble dietary fibers (idf), fats, proteins and bioactive compounds, namely lycopene and polyphenols (kaur et al., 2008). idf from by-products, whose chemical constituents are chiefly non-starch polysaccharides, namely cellulose, arabinoxylans and β-glucan, is not commonly incorporated in food products due to its adverse effects on food quality, like sensory effects and functionality (ahmed et al., 2013). nowadays, many research works have revealed that idf is beneficial to human health. indeed, the ingestion of insoluble fiber from fruits and vegetables could significantly reduce the plasmatic concentration of cholesterol, implying a decrease in the risk of cardiovascular disease, colon cancer, diabetes and obesity (slavin, 2013). the european prospective investigation into cancer and nutrition (epic) has shown 40% reduction of colorectal cancer risk when consuming more than 30 g of fiber per day (sumczynski et al., 2015). actually, the food and nutrition board recommends 38 g/day for dietary fiber intake (sumczynski et al., 2015). tomato fiber is a by-product of tomato processing industry with high content of idf (71.82 %), soluble dietary fiber (14.33 %), protein (13.30 %), lipid (6.01 %) and ash (3.01) (navarro-gonzalez et al., 2011). some sugars, as glucose, xylose and galactose are present in tomato residue fiber (garcia-herrera et al., 2010). the latter is reported to comprise mainly cellulose (75%), hemicelluloses (15%) and pectin (10%) (hua et al., 2017). since it is rich in bioactive compounds, namely polyphenols and lycopene, it could be used in the development of functional food formulations (navarro-gonzalez et al., 2011). cookies and biscuits can be supplemented with dietary fibers from various sources, wheat bran, inulin carob fiber and many other biopolymers such as galactomannans, pectins and β-glucan (mildner-szkudlarz et al., 2013). the incorporation of dietary fiber into wheat flour interacts directly with the structural elements of three dimensional gluten networks, disrupts the starch gluten matrix and finally changes the mechanical properties of blended dough during mixing, fermentation and baking (liu et al., 2017; martinez et al., 2014; ahmed et al., 2013). since there is no published data on cookies formulations containing itf, to our knowledge, this study is the first to examine the effect of itf incorporation on both physicochemical and rheological wheat dough, and the quality characteristics of the formulated cookies. the obtained results would contribute to better valorize the itf in the cereal-based foods and support product authenticity. 2. materials and methods 2.1. materials the samples of commercial wheat flour produced by “minoterie soukra de tunis”, tunisia” were studied for proximate composition. itf was supplied by “conservas vegetales de extremadura” (conesa), extremadura, spain, and packaged in vacuum bags until the samples were opened for analysis. the itf proximate composition: water content 6.22 g/100 g, protein 0.93 g/100 g, dietary fiber 91.27 g/100 g, lipid 1.01 g/100 g, ash 0.57 g/100 g), itf 79.82 g/100g and soluble dietary fiber 11.45 g/100g. wheat dough samples were packed in low-density polyethylene bags, and then stored for analysis at different itf concentrations. ital. j. food sci., vol. 31, 2019 3 2.2. proximate composition analyses water, protein, lipid and ash contents were determined according to the approved aoac method (aoac, 1990). dietary soluble and insoluble fiber contents were identified according to the method of prosky et al. (1998). total carbohydrate content was estimated by mean-value difference: 100− (% water +% protein+% ash + % lipid+% total fibres). the assessment of wet and dry gluten contents, and gluten index was performed by glutomatic (perten instruments, hägersten, sweden) according to the aacc method (aacc, 2000). wheat flour was substituted by itf at different concentrations (g/100 g) to make a dough blend. both wheat flour and itf was premixed in dry condition using a mixer with a spiral blade, typically used for dough mixing. the wheat dough samples were prepared by mixing different blends in farinograph at a consistency of 500 ub at 30°c. the wheat flour sample without tif was considered as control. 2.3. rheological properties of wheat dough 2.3.1 rheological measurements the rheological properties of prepared dough samples were determined using a strain/stress controlled rheometer (thermo-haake, rheostress 1, germany) equipped with a temperature-control unit (thermo-haake, karlsruhe k15 germany). the rheometer had a cone-plate configuration with a 35-mm cone radius and a 0.14-mm gap between the cone and plate. measurements were conducted in the shear rate range of 0.001 to 1000 s-1 at constant temperature (20°c). twenty-five data points were recorded at 10 s intervals during the shearing. each measurement was replicated seven times on the same sample with two repetitions. experimental data were fitted to herschel-bulkley and power-law (ostwald) equations (1) and (2), respectively: σ = σ! + 𝐾𝛾! (1) σ = kγ! (2) where σ is the shear stress (pa), k is the consistency coefficient (pa.sn), γ is the shear rate (s-1), σ0 is the yield stress and n is the flow behavior index (dimensionless). the thixotropic hysteresis loop area was computed as the difference between the area under the up-flow and the down-flow curve using rheowin v.2.93 (haake, germany) software. 2.3.2 dough viscoelasticity using a parallel plate system (4 cm dia.) at a 500-mm gap, the dynamic rheological measurements were conducted with a rheometer (ar 1000, ta instruments, new castle, de, usa). dynamic shear data were obtained from frequency sweeps over the range of 0.1-100 rad/s. the strain value was obtained in the linear viscoelastic region at 1.5 % strain, and the frequency-sweep tests were performed at 20°c. to obtain the experimental data and to calculate the elastic (g’) and viscous moduli (g’’), data analysis software (version vi. 1.76) was used. aiming to relax the samples before taking the dynamic shear rheological measurements, all samples were allowed a5-min rest at the initial temperatures. these rheological measurements were performed in triplicate. ital. j. food sci., vol. 31, 2019 4 2.3.3 farinograph, alveograph and visco-amylograph tests the itf effect on dough rheology was determined by farinograph alveograph and viscoamylograph tests according to aacc method (aacc, 2000). 2.4. fermentation parameter determination fermentation parameters were assessed by the rheofermentometer f3 (tripette and renaud, france) according to the supplier’s specifications. the fermentation parameters of dough development were determined as follows: maximum dough fermentation height (hm) and the time at which dough reaches maximum height (t1). the measured gas parameters were the volume of gas produced throughout fermentation (vt), the gas retained in the dough at the end of the assay (vr), and the loss volume of gas (vl) in both milliliters (ml). all assays were performed in triplicate, and the average values were adopted. 2.5. formulation of cookies 2.5.1 cookie preparation cookies were prepared from the wheat flour (wf) and other ingredients such as shortenings, sugar, salt and sodium bicarbonate. composite flours, itf and other dry ingredients (sodium bicarbonate, sugar and salt) were mingled together in a bowl and shortenings were added, then mixed in a hobart mixer for 6 min to obtain creamy dough. the specified amount of water was added gradually during continuous mixing until slightly firm dough was obtained. a hundred of baked cookies each weighing approximately 13.4 g were obtained for each recipe. kneaded dough was manually rolled into sheets of required thickness and cut into round shapes, using a 5-cm diameter and 1cm high biscuit cutter. cookies were baked in batches at 195±2.0°c for 20 min. baked cookies were cooled to room temperature (22±1.0°c) and stored in polyethylene bags until analysis. 2.5.2 color determination the color parameters (l*, a* and b*) of the prepared wheat flours and formulated cookies were assessed using a cr-300 colorimeter (konica minolta sensing, inc., osaka, japan). color intensity was measured and expressed using the cie l* a∗ b* coordinate system, where l* represents color lightness, a∗ characterizes red (positive value) and green (negative value) colors. the parameter b∗ indicates yellow (positive value) and blue (negative value) colors. the above analysis was realized in 20 replicates. 2.5.3 physical parameters the cookies' diameter was measured by laying six cookies edge to edge with the help of a scale, rotating them through 90◦, remeasuring them and then taking the average value. the cookies' thickness was measured by stacking five samples one on top of the other and taking the average value. the spread ratio was estimated as diameter/thickness. ital. j. food sci., vol. 31, 2019 5 2.5.4 texture analysis of cookies the cookies texture was assessed using breaking test and whose parameters are breaking strength and fracturability, was determined using a ta.tx. plus texture analyzer (stable micro systems, godalming, surrey, u.k.). the test speed is of 1 mm/s using a knife probe. the peak force from the resulting curve was measured as the breaking strength or breaking force of the cookies. twenty cookies from each formulation were analyzed. 2.5.5 determination of total polyphenol content and antioxidant activities of cookies total polyphenol content and antioxidant activities by dpph and frap of the formulated cookies were determined using the method described by ismail et al. (2014). the total phenol content is expressed as the gallic acid equivalent (mg gae/100 g) of the sample. the cookies antioxidant activities by abts assay were assessed using the method of passos et al. (2017). the antioxidant activities of the formulated cookies are expressed as inhibitory concentration at 50 % (ic50), which in turn, represents the amount of cookies (mg) necessary for 50 % reduction of abts.+, dpph. and frap. ic50 values were calculated according to the non-linear regression algorithm of the plotted inhibition graph percentage compared with the cookie sample concentration. 2.5.6 sensory evaluation of cookies for sensory evaluation, 50 panelists were chosen from the food technology and science department of nutraceutical institute of foods at laval university (25 males and 25 females). the tests were performed under daylight room conditions. sensory analyses were conducted on itf-enriched cookies samples due to their higher physical properties. the order of samples presentation to the panel was randomized. the color, texture, flavor, crispness and overall acceptability of cookies were rated on a 1-9 scale: 1 dislike extremely; 2 dislike very much; 3 dislike moderately; 4 dislike slightly; 5 neither like nor dislike; 6 like slightly; 7 like moderately; 8 like very much; 9 like extremely. 2.6. statistical analysis except for the sensory evaluation that was evaluated in duplicate, all the others were realized in triplicate. the results were statistically analyzed using spss (spss inc., chicago, usa), version 18. while the analysis of variance (anova) was used to identify the significant difference between the results, duncan's test was used to separate the mean with a significance level of 5%. 3. results and discussion 3.1. proximate composition the physicochemical properties of the wheat flour incorporated with itf were examined (table 1), revealing that the itf incorporation levels into wheat flour decreased the water and protein contents from 14.05 to 12.38 % and from 9.58 to 4.33 %, respectively, (p<0.05). the ash content is also known to be another parameter used for the determination of the wheat flour purity. in this study, the ash and fat contents ranged from 0.42 to 0.94 and 0.26 to 1.41 %, respectively, hence the significant variations (p<0.05) between itf-enriched samples and control flour. additionally, the total fiber increased and the carbohydrate ital. j. food sci., vol. 31, 2019 6 contents decreased substantially with the increase in itf from 0 to 10 % (p<0.05) depending on the itf's concentration. likewise, wet and dry gluten contents decreased from 28.20 to 22.56 % and from 12.48 to 9.98 %, respectively, with itf incorporation (p>0.05), which is the same with the gluten index values (p<0.05). furthermore, the results demonstrated that dry gluten content decreased significantly with the incorporation of 2.5 % itf, due to reduction of protein content in the tested wheat flours. the itf incorporation will compete for water during the dough making process, thus making the dough thicker, which in turn may ‘work’ the gluten network more to enable an enhanced water uptake. further itf incorporation would out-compete gluten for the available water and make the gluten network less able to take up water, hence reducing the water binding capacity beyond the itf incorporation in wheat flour. table 1. chemical composition, gluten analysis and color parameters of wheat flour containing insoluble tomato fibre. itf concentration (g/100 g) control 2.5 5 7.5 10 chemical composition water 14.05±0.03a 13.63±0.03b 13.22±0.02c 12.80±0.02d 12.38±0.02e protein 9.58±0.05a 6.77±0.04b 5.95±0.05c 5.14±0.03d 4.33±0.02e ash 0.42±0.02a 0.55±0.01b 0.68±0.01c 0.71±0.01d 0.74±0.01e lipids 0.26±0.01a 0.55±0.01b 0.84±0.01c 0.92±0.01d 0.94±0.01d insoluble fiber 3.54±0.05a 10.21±0.04b 11.87±0.03c 14.54±0.02d 18.20±0.02e soluble fiber 6.75±0.05a 7.08±0.10ab 7.41±0.14bc 7.73±0.20cd 8.06±0.24d total fibers 10.20±0.01a 17.29±0.05b 19.28±0.11bc 22.27±0.17d 26.26±0.23e total carbohydrates 65.40±1.05a 61.21±0.38ab 60.03±0.80bc 58.16±1.24cd 55.35±1.67d gluten analysis wet gluten 28.20±0.03a 26.79±0.02b 25.38±0.02c 23.97±0.02d 22.56±0.03e gluten index 86.86±0.08a 82.51±0.07b 78.17±0.07c 73.84±0.06d 69.48±0.06e dry gluten 12.48±0.02a 11.86±0.02b 11.23±0.01c 10.61±0.03d 9.98±0.02e color parameters l* 95.34±0.04a 93.69±0.03b 92.04±0.03c 90.40±0.04d 88.75±0.03e a* -0.74±0.02a -0.36±0.02b 1.20±0.01c 4.38±0.02d 6.75±0.01e b* 12.78±0.04a 16.27±0.03b 19.67±0.02c 23.27±0.03d 26.76±0.03e chemical composition and gluten analysis were expressed as %. values given are the means of three replicates ± standard deviation. different letters within the same row indicate significant differences (oneway anova and duncan test, p< 0.05). table 1 lists cielab color parameters (l*, a*, and b*) for different wheat flour samples incorporated with itf, indicating the considerable impact of itf incorporation on these parameters. briefly, the lightness value (l*) of the whole-wheat flour was 95.34, which drastically dropped to 88.75 for the highest itf content (10 %). nevertheless, a* value for the whole wheat flour sample was -0.74, which increased significantly, about 4 to 9 times after itf incorporation with the highest value of 6.75 for the sample with the highest itf amount. the yellowness parameter (+b*) increased significantly as itf amount increased. the increase in color values a* and b* in wheat flour samples could be attributed to the ital. j. food sci., vol. 31, 2019 7 creation of more surface areas that possibly increase color intensity as reported by ahmed and al-attar (2015). 3.2. rheological properties of formulated wheat dough 3.2.1 flow behavior all formulated dough samples enriched with itf exhibited non-newtonian behavior at shear rates from 0.001 to 1000 s-1 at 20°c (fig. 1). a b shear rate (1/s) 0 200 400 600 800 1000 1200 s he ar s tre ss (p a) 0 500 1000 1500 2000 2500 10 % itf 7.5 % itf 5 % itf 2.5 % itf control shear rate (1/s) 0 200 400 600 800 1000 1200 sh ea r s tre ss (p a) 0 500 1000 1500 2000 2500 control 10 % itf ital. j. food sci., vol. 31, 2019 8 c d figure 1. shear stress versus shear rate (a). flow curves with a controlled shear rate measured by increasing (forward measurements) and decreasing shear rate (backward measurements) (b). variation of storage (c) and loss modulus (d) with angular frequency (ω) for insoluble tomato fibre-enriched wheat dough at 20°c. there is a nonlinear relationship between shear stress (σ) and shear rate (γ), which is in good agreement with the findings of guadarama-lezam et al. (2016). the power-law and herschel-bulkley models were used to characterize the flow curves of the formulated dough samples. based on the regression coefficient values (r2), the power-law was found to be a better-fit model for flow curves (r2> 0.99), and only the rheological parameters of this model were determined in this study (table 2). furthermore, flow behavior index values (n), at different itf amounts, were in the range of 0.339-0.264 and significant differences between all wheat dough samples (p<0.05) were noted. indeed, the flow plot of the shear stress against shear rate of the investigated dough showed a flow index (n) less than 1 (thinning fluid), indicating that the flow behavior of the examined samples can be described by following a nonnewtonian profile. consequently, all values are less than 1, which further confirms the pseudoplastic behavior of the whole itf-enriched dough. angular frequency (rad/s) 0,1 1 10 100 1000 e la st ic m od ul us g ' ( p a) 100 1000 10000 10 % itf 7.5 % itf 5 % itf 2.5 % itf control angular frequency (rad/s) 0,1 1 10 100 1000 vi sc ou s m od ulu s g ' ( pa ) 100 1000 10000 10 % tif 7.5 % tif 5 % tif 2.5 % tif control ital. j. food sci., vol. 31, 2019 9 the obtained results also showed that the flow index (n) decreased with the increase in itf concentration. actually, the consistency coefficient (k) indicates the viscous nature of a matter. yet, the consistency values (k) of the whole-wheat flour suspension within the studied concentration domain were in the range of 137.22-350.60 pa·sn. the higher consistency values of the formulated dough resulted from the antiplasticizing effect of sugars against water. another reason for the non-newtonian pseudoplastic flow behavior of samples emanates from the presence of high-molecular-weight macromolecules as fibers, gluten, sugars and starch. martinez et al. (2014) have confirmed that the addition of insoluble fibers increases dough consistency due to the insoluble fibers’ effect on the internal structure of wheat doughs. figure 1b shows the flow curves of control and wheat dough at 10 % of itf. shear stress measurements at increasing and decreasing shear rates from 0.001 to 1000 s-1 gave hysteresis loops. the hysteresis area (a) was determined and illustrated in table 2, confirming that its values decreased with the increase in itf concentration. however, significant variations with itf concentration exist in all tested samples (p<0.05). the hysteresis loops indicate a time dependency of the wheat dough rheological properties. this thixotropic behavior is observed with concentrated suspensions and macromolecular solutions due to structural breakdown happening in the specimen during the rheological test. 3.2.2 viscoelastic behavior the oscillatory spectra of the formulated dough samples displayed viscoelastic properties (figs. c-d). the characteristic slopes of the double-logarithmic plots of the storage and loss modulus (g’ and g”) vs angular frequency were quite similar. in this case, the elastic modulus was significantly high and different from the viscous one throughout the covered frequency range. all examined dough samples exhibited higher storage modulus (g’) values than those of g”, thus confirming the elastic behavior of the dough samples and indicating that both moduli values increased with the increase of the angular frequency and itf concentration. these results are comparable with those found by ahmed et al. (2013), guadarramalezama et al. (2016), who have proven that wheat dough was characterized by a solidlike behavior. indeed, they suggested that the increase of mechanical properties is due to limited plasticization effect and the presence of fiber nanoparticles. the experimental data was fitted with power-law models, described as follows: 𝐺!(𝜔) = 𝐾!.𝜔!! (3) 𝐺"(𝜔) = 𝐾".𝜔!" (4) where g’ is an elastic modulus (pa), g” is a loss modulus (pa), ω is an angular frequency (rad/s), and k’, k”, n’ and n” are the experimental constants. table 2 presents the power-law parameters of the elastic and viscous moduli (k’ and k”) of the tested samples undergoing an increase with the increase of itf concentration. in all cases, the k’ values were higher than those of k”, and increased significantly with the rise in the itf level in the wheat dough, (from 850.82 to 1680.92 and from 291.88 to 720.68 pa, respectively). in the same vein, bengtsson et al. (2011) found that the itf increase led to the increase of g’ and g”. thus, the highest k’ and k’’ values were observed for dough sample with 10 % of itf. the exponents n’ and n” were then found to decrease from 0.22 to 0.12 and from 0.23 to 0.181, respectively. besides, no significant variations in exponent values at high levels of itf (p>0.05) were noticed. ital. j. food sci., vol. 31, 2019 10 3.2.3 farinograph properties the use of elevated itf concentration in the wheat flour increased significantly the farinograph water absorption (wa), dough consistency (dc) and dough development time (ddt) (p<0.05) (table 2). while the increase in wa may be due to the presence of protein, fiber and resistant starch contents, the increase in the ddt showed a delay in the hydration and gluten development in the presence of these macromolecules. obviously, variations in wa depend on the protein content, the chemical structure and porosity of itf, the association between molecules and the particle sizes (thebaudin et al., 1997). recently, wang et al. (2002) have demonstrated that the variations in wa is mainly attributed to the greater number of hydroxyl group existing in the fiber structure, allowing more water interaction through hydrogen bonding. these results are in accordance with those found in the literature (mis et al., 2012; ahmed et al., 2013). dough stability time is an indicator of the flour strength, with higher values, indicating stronger doughs, which shows that the different itf amounts modify the ddt (p<0.05). the use of itf improved significantly the dough stability compared with control flour (p< 0.05), which could be explained by higher interactions among itf, water and gluten. furthermore, mixing dough could release water to the dough matrix, causing a quick reduction in dough consistency, and therefore a reduction in ddt (majzoobi et al., 2011). the mixing tolerance index (mti) of itf-enriched dough decreased considerably, with the increase in concentration from 0 to 10 % of itf. table 3 shows that control and wheat dough enriched with 2.5 % of itf has a better dough mixing tolerance with a lower value than the other samples. the increase in mixing tolerance index upon itf addition is probably due to the dilution of gluten protein with the fibers, which may be explicated by the interaction between fiber and gluten influencing the dough mixing properties (ahmed et al., 2013). however, quality index (qi) insignificantly increased from 53.48 to 60.60 bu by the itf addition as a function of increasing rate substitution (p>0.05). ahmed et al. (2013) suggested that the quality index increase emanates from the interaction between gluten and fiber. 3.2.4 alveographic properties table 3 lists the alveographic parameters of dough with and without itf, proving that its incorporation caused an increase in the tenacity (p) and decrease in the extensibility (l), and consequently in the swelling index (g) of the formulated wheat dough (p<0.05). after the itf addition, the configuration curve ratio (p/l) increased and the alveograph strength decreased. this may be due, at least partly, to the reduction in the gluten content caused by the presence of other components, as proteins, fibers, lipids and non-glutenforming proteins, which interfere with gluten formation. it can be concluded that the protein existing in the itf might have instigated partial disruption of the gluten network, causing change in the equilibrium of elasticity and extensibility properties of the whole wheat flour dough. the obtained results also corroborated significant differences between control and itf-enriched dough in term of the deformation energy (w) (p < 0.05). these results are clearly in conformity with those obtained by boubaker et al. (2016). yet, many studies, as wang et al. (2002), reported that commercial fibers' incorporation greatly improved the development of wheat protein behavior. they also stated that the fibres 'incorporation induced a decrease of the proteolytic degradation, being practically neutralized by inulin. ital. j. food sci., vol. 31, 2019 11 3.2.5 visco-amylograph properties to determine the itf incorporation effect on wheat flour-water interaction in cookies dough, a rapid viscoanaylzer (rva) was used, revealing that itf significantly diminished the pasting viscosities (peak, breakdown, final, and setback viscosities) (p<0.05). similarly, the values of the peak paste viscosity of the formulated dough decreased significantly from 1285.56 to 450.44 cp, which was explained probably by their association with high protein amount. thus, the tomato protein is estimated to form complexes with starch granule surface, preventing the release of exudates and lowering the peak viscosity. however, the pasting temperature increased from 86.20 to 90.75°c in flour blends (p<0.05), which, according to martinez et al. (2014), might be related to delay or restricted starch swelling. actually, the amylose leaching and lower pasting viscosities are indications of reduced starch available for gelatinization. therefore, the itf addition is proven to significantly diminish the degree of breakdown from 0.60 (control) to 0.25 (flour at 10 % of tif), showing increased resistance of the swollen starch granule to rupture after cooking as reported by sozer et al. (2014). 3.3. fermentation parameters the fermentation parameters of the itf-enriched wheat dough were assessed by the rheofermentometer, table 3. the maximum dough height (hm) decreased dramatically from 69.17 to 30.84 mm, with the itf addition, regardless of its concentration (p<0.05). however, no significant difference between samples containing 7.5 and 10 % of itf (p> 0.05) was observed. similar results were obtained by martinez et al. (2014) and liu et al. (2017) who discovered that the addition of insoluble fibers led to the decrease of the maximum dough height. nevertheless, the time required to reach the maximum dough height decreased from 2.95 to 1.30 h with the increase in itf concentration (p<0.05), demonstrating substantial differences in the time of reaching the maximum height between wheat flour samples. besides, the co2 production, retention and loss volumes were also determined. indeed, although the itf incorporation decreased the co2 production and retention volumes, it increased its loss volume (p<0.05). these results accord well with those found by martinez et al. (2014), who added different fibers to the wheat flour, proving that the influence differs with the type of fiber used. they suggested that insoluble fibers with larger particles can create points to split the structure, thus enabling gas to escape, affirming the assumption that itf incorporation to wheat flour decreased gas holding capacity. however, correa et al. (2014) have hypothesized that the addition of hydrocolloids could form hydrophilic complexes with protein or starch, which further changed the viscoelasticity and influenced the fermentation character. 3.4. properties of formulated cookies 3.4.1 physical properties table 4 summarizes the physical parameters of the analyzed cookies by substituting wheat flour with itf from 0 to 10% levels. as the itf concentration increased, the diameter of cookies (d) decreased from 53.94 to 51.83 mm, but no significant variations were found between cookies with 5 and 7.5 % of itf. the thickness of cookies (e) increased, confirming the dilution of gluten as reported by ajila et al. (2008). the differences in diameter and thickness are revealed in the spread ratio (d/e), consistently decreasing from 5.17 to 4.02 with itf levels increase (p<0.05). ital. j. food sci., vol. 31, 2019 12 table 2. power-law parameters of insoluble tomato fibre-enriched wheat dough enriched at 20°c. itf (%) 𝛔 = 𝐊𝛄𝐧 𝑮! = 𝑲!.𝝎𝒏! 𝑮" = 𝑲".𝝎𝒏" n k [pa.sn] a [pa.s-1] r2 n’ k'[pa.sn’] r2 n" k"[pa.sn’] r2 control 0.339±0.003a 137.22±9.98a 4.09±0.03a 0.986 0.220±0.002a 850.82±12.00a 0.989 0.230±0.002a 291.88±15.03a 0.994 2.5 0.321±0.002b 153.40±11.80a 3.83±0.02b 0.991 0.194±0.003ab 940.49±14.80b 0.972 0.218±0.003b 370.21±15.21b 0.992 5 0.302±0.002c 191.26±15.74ab 3.51±0.03c 0.978 0.173±0.02ab 1187.66±19.84c 0.988 0.201±0.001c 482.46±12.30c 0.980 7.5 0.284±0.003d 244.19±17.81b 3.33±0.04d 0.983 0.153±0.003bc 1409.37±24.83d 0.991 0.198±0.002c 591.10±12.95d 0.979 10 0.264±0.002e 350.60±19.40c 3.18±0.03e 0.995 0.120±0.003c 1680.92±30.01e 0.998 0.181±0.003d 720.68±15.88e 0.996 a: area of hysteresis loop; n: flow index; k: consistency coefficient; itf: insoluble tomato fibre; r2: regression coefficient; itf: insoluble tomato fibre. values given are the means of three replicates ± standard deviation. different letters within the same row indicate significant differences (oneway anova and duncan test, p< 0.05). table 3. farinograph, alveograph, viscoamylograph and rheofermentation tests of insoluble tomato fibre-enriched wheat flour. test concentration (%, g/100g) parameters control 2.5 5 7.5 10 w (%) 58.80±0.20a 65.70±0.30b 71.42±0.22c 74.04±0.16d 78.68±0.32e dc (bu) 510±3.00a 525±3.00a 565±5.00b 590±10.00c 620±8.00d farinograph ddt (min) 2.00±0.05a 2.30±0.04b 4.02±0.10c 5.10±0.07d 6.30±0.10e dst (min) 7.40±0.10a 7.30±0.05a 7.30±0.08a 6.45±0.10b 5.67±0.13c dmi (bu) 43.20±0.10a 48.55±0.15b 60.40±0.25c 65.23±0.23d 67.78±0.41e qi (bu) 53.48±1.73a 55.00±2.50a 57.09±1.91a 60.20±2.00a 60.60±2.00a p (mmh2o)×10 -4 89.32±2.50a 123.75±0.50b 160.11±1.30c 163.69±2.30c 174.20±2.20d l (mm) 86.56±1.40a 65.44±1.03b 30.19±0.80c 22.77±0.50d 18.82±0.60e alveograph g (mm) 20.65±0.16a 17.96±0.14b 12.20±0.16c 10.59±0.12d 9.63±0.15e p/l ratio 1.03±0.01a 1.89±0.03b 5.30±0.10c 7.19±0.06d 9.26±0.18e wl (j×104) 225.40±5.20a 200.36±3.30b 180.22±1.20c 140.43±2.55d 120.60±3.40e ital. j. food sci., vol. 31, 2019 13 pv (cp) 1285.56±5.70a 1179.25±4.80a 813.60±4.81b 550.02±2.98c 450.44±5.56d hpv (cp) 771.34±3.66a 553.33±4.67b 341.71±2.80c 154.00±3.02d 112.61±1.80e viscoamylograph fv (cp) 1421.63±7.70a 1149.11±9.89b 842.91±6.09c 605.81±5.90d 514.11±3.89e sv (cp) 650.30±4.04a 595.78±5.22b 500.20±3.29c 451.81±2.90d 401.50±5.69e pt (°c) 86.20±0.02a 87.36±0.06b 87.93±0.04c 88.46±0.06d 90.75±0.05e bd 0.60±0.00a 0.49±0.00b 0.42±0.00c 0.28±0.00d 0.25±0.00e hm (mm) 69.17±2.33a 41.23±1.23b 36.89±0.50c 32.76±1.01d 30.84±1.02d t1 (h) 2.95±0.05a 2.52±0.03b 1.83±0.02c 1.47±0.03d 1.30±0.03e rheoermentator vt (ml) 1720.27±19.73a 1680.60±14.40ab 1651.04±14.96bc 1644.3±11.93bc 1610.30±7.85c vr (ml) 1440.06±25.10a 1372.82±18.00ab 1314.10±24.95b 1234.28±15.89c 1144.45±13.70d vl (ml) 280.21±1.27a 307.78±1.40b 336.94±4.95c 410.09±3.97d 465.70±5.85e itf: insoluble tomato fibre; w: water absorption; dc: dough consistency; ddt: dough development time; dst: dough stability time; ds: degree of softening; qi: quality index; p: tenacity (mmh2o); l: dough extensibility; g: swelling index; p/l: configuration curve ratio; wl: deformation energy; pv: pasting viscosity; hpv: hot pasting viscosity; fv: final viscosity; sv: setback viscosity; pt: pasting temperature; db: degree of breakdown; vt: total volume of dioxide carbon; vr: retention volume of carbon dioxide; vl: loss volume of carbon dioxide. values given are the means of three replicates ± standard deviation. different letters within the same row indicate significant differences (oneway anova and duncan test, p< 0.05). table 4. physical, colour, textural and biochemical parameters of insoluble tomato fibre-enriched cookies. itf concentration (g/100 g) parameters control 2.5 5 7.5 10 physical parameters diameter (mm) 53.94±0.06a 53.17±0.03b 52.20±0.10c 52.06±0.06c 51.83±0.03d thickness (mm) 10.43±0.17a 11.24±0.15b 11.67±0.25c 12.22±0.25c 12.91±0.15d spread ratio 5.17±0.08a 4.73±0.06b 4.47±0.10bc 4.26±0.09cd 4.02±0.04d color parameters l* 75.79±0.09a 70.51±0.06b 66.17±0.03c 63.64±0.05d 62.36±0.04e a* 3.22±0.01a 3.94±0.01b 4.17±0.02c 4.91±0.01d 5.43±0.02e b* 27.72±0.03a 31.45±0.05b 35.58±0.02c 38.76±0.03d 39.68±0.01e ital. j. food sci., vol. 31, 2019 14 textural parameters breaking strength (n) 19.88±0.11a 20.94±0.06b 24.47±0.04c 28.06±0.06d 33.47±0.05e fracturability (mm) 0.32±0.02a 0.45±0.02b 0.56±0.02c 0.59±0.02cd 0.63±0.01d biochemical parameters total polyphenol content (mg gae/100) 86.98±2.58a 189.50±7.50b 239.51±3.50c 305.00±10.03d 376.02±6.02e abts (mg/ml) 2.40±0.03a 1.84±0.04b 1.34±0.01c 1.13±0.02d 0.89±0.03e dpph (mg/ml) 181.00±7.00a 91.03±8.04b 14.47±0.07c 9.10±0.10c 3.32±0.05c frap (mg/ml) 35.89±2.34a 16.62±2.12b 6.62±0.03c 1.95±0.05cd 0.78±0.04d abts, dpph, and frap were expressed as inhibitory concentration at 50 % (ic50). values given are the means of three replicates ± standard deviation. different letters within the same row indicate significant differences (oneway anova and duncan test, p< 0.05). ital. j. food sci., vol. 31, 2019 15 however, the decrease in the spread ratio of itf-fortified cookies is probably attributed both to the fact that the composite flour increased water absorption, and the absence of free water in the cookie dough. sharma et al. (2016) mentioned that the decrease in the spread ratio of germinated flour blend cookies may be due to the enzymatic degradation of the starch and protein into smaller sugars and peptides, resulting in the increase of hydrophilic nature within cookies. table 4 shows that cookies became darker (lower l* values), more reddish (higher a* values) and more yellowish (higher b* values) than control cookies with the increase in itf amount. the lightness (l) also decreased proportionally with the increase of the itf amount, reflecting the darkening of the cookies. this color change was confirmed by cookies photos (fig. 2). the decrease of lightness is probably due to the high protein and free sugar contents may accelerate the maillard reaction and therefore change the color of the products. as suggested by mildnerszkudlarz et al. (2013), cookies color depends mainly on their ingredients because the temperature is not high enough for maillard and caramelization reactions. the itf’s color values may affect the color of cookies’ crust. the 10 % level of itf presented more yellowish crust color than control cookies (fig. 2). figure 2. photos of formulated cookies at different levels of insoluble tomato fibre. the breaking strength values of formulated cookies with different itf concentration are illustrated in table 4, which reveals that the breaking force value increased with the increase in itf concentration ranging from 19.88 to 34.47 n. meanwhile, the results showed that there are significant variations in cookies' hardness among all cookies samples (p<0.05) (table 4). the increase in breaking force may be due to the increase in cookies thickness, which gives physical strength to the cookies structure. yet, higher positive correlation was found between itf concentration and breaking strength (r = 0.965, p<0.05), which is in perfect accordance with the study of nasir et al. (2010) who found a positive correlation between the concentration of vegetable flours and cereal foods. besides, the results showed that the itf incorporation decreased the cookies' fracturabilities (p<0.05), revealing a negative correlation between thickness and fracturability of the formulated cookies (r=-0.96, p<0.05). 3.4.2 total polyphenols and antioxidant activities of cookies the results of the total polyphenol content and antioxidant activities are shown in table 4. the total polyphenol content of cookies, with 2.5 to 10 % itf, increased significantly compared to the control cookies, i.e., it increased in parallel with itf supplementation level. while highly negative correlation was found between lightness (l*) parameter and the total polyphenol content (r =-0.977, p< 0.01), positive correlations between a* and b* ital. j. food sci., vol. 31, 2019 16 parameters and total polyphenol content of cookies (r=0.994, p<0.01and r=0.982, p<0.01, respectively). to characterize the antioxidant potential of the formulated itf-enriched cookies, dpph, frap and abts radical scavenging activities were determined, table 4. actually, all ic50values of antioxidant tests decreased with the itf increase, and significant differences between all cookies samples were found (p<0.05). comparing the activities, the highest one was abts followed by those of frap and dpph, whose relationship with the maillard reaction products (e.g., color parameters) was identified by a multivariate analysis to find the possible correlations among measured variables. high correlations were found between the total polyphenol content and antioxidant activities (ic50) (r =-0.982 (abts); r=-0.919 (dpph); r=-0.940 (frap), p< 0.01). correlations between antioxidant activities (ic50) and lightness (l*) (r =-0.998 (abts); r=-0.977 (dpph); r=-0.985 (frap), p< 0.01) were also detected. this implies that the amount and type of polyphenolic substances in cookies are variable, depending mainly on the itf incorporation level. the baking can further increase the antioxidant activities, and the formation of dark color pigment due to maillard browning during baking process can increase the antioxidant properties of the cookies. these findings were confirmed with the high correlations between the lightness and inhibitory concentrations (ic50), which are similar to those obtained by michalska et al. (2008). the latter indicated that maillard reaction products possess cookies' antioxidant activities at elevated temperature, which are in turn in good agreement with the studies of misan et al. (2011) and agila et al. (2008). at a 10 % itf incorporation, the content of polyphenols were 4 times higher than control cookies. 3.4.3 sensory evaluation the score results of sensory evaluation of the tested cookies are illustrated in fig. 3. figure 3. principal component analysis plot of data from sensory evaluation of insoluble tomato fibreenriched cookies. ● itf concentration; ■ sensory parameters control 2.5 % itf 5 % itf 7.5 % itf 10 % itf color flavour texture overall acceptabili ty crispness -3 -2 -1 0 1 2 3 4 -5 -4 -3 -2 -1 0 1 2 3 4 5 f2 (3 6, 47 % ) f1 (60,75 %) biplot (axes f1 and f2: 97,21 %) ital. j. food sci., vol. 31, 2019 17 the first (pc1) and the second (pc2) principal components were 60.75 and 36.47 %, respectively, accounting for 97.21 % of the total variance. the results also revealed that all sensory parameters were positively correlated with both components. indeed, while color, crispness and flavor were positively and highly correlated with pc1, texture and overall acceptability were positively correlated with pc2. the score plot showed that control cookies and those enriched with 7.5 % of tif had high scores of color and overall acceptability. however, compared to control, the sensory parameters of the formulated cookies were found to be different. according to the panels, there are no a significant difference between control and cookies with 7.5 % of itf in term of overall acceptability (fig. 3). it can be concluded that itf can be incorporated into cookies at 7.5 % level. 4. conclusions in this study, the effect of itf on the physicochemical, rheological and antioxidant properties of wheat flour and the formulated cookies were investigated. the results showed that the itf incorporation improved the nutritional and rheological properties of wheat dough and diminished the rheofermentation parameters and pasting properties: higher water absorption, tenacity, stability and peak consistency and smaller extensibility. moreover, itf significantly increased the hardness and the total polyphenol content and enhanced the antioxidant activities of cookies. the cookies enriched with 7.5 % itf had similar overall acceptability with the control cookies. however, compared to the latter, differences on the formulated cookies color and texture were found. therefore, itf might be used for the novel formulation of cookies as an alternative source of dietary fiber and bioactive compounds. acknowledgements thanks are credited to ms. leila mahfoudhi, major teacher of english in the sfax faculty of science, for proofreading and polishing the language of the manuscript. references aacc. 2000. approved methods of the aacc, 10th ed. st. paul, mn: american association of cereal chemists. ahmed j. and al-attar h. 2015. effect of drying method on rheological, thermal, and structural properties of chestnut flour doughs. food hydrocolloid 51:76-87. ahmed j., almusallamb a.s., al-salman f., abdulrahman m.h. and al-salem. e. 2013. rheological properties of water insoluble date fiber incorporated wheat flour dough. food sci. technol. 51:409-416. ajila c.m., leelavathi k. and prasada-rao u.j.s. 2008. improvement of dietary fiber content and antioxidant properties in soft dough biscuits with the incorporation of mango peel powder. j. cereal sci. 48:319-326. aoac. 1990. official methods of analysis (15th edn). association of official analytical chemists, washington, dc. bengtsson h., hall c and tornberg e. 2011. perception of the texture of homogenized fruit and vegetable fiber suspensions. j. texture studies 42:291-299. boubaker m., el-omri a., blecker c. and bouzouita n. 2016. fibre concentrate from artichoke (cynara scolymus l.) stem by-products: characterization and application as a bakery product ingredient. food sci. technol int. doi: doi.org/10.1177/1082013216654598. correa m.j., ferrer e., anon m.c. and ferrero c. 2014. interaction of modified celluloses and pectines with gluten proteins. food hydrocolloids 35:91-99. ital. j. food sci., vol. 31, 2019 18 garcía herrera p., sánchez-mata m.c. and cámara m. 2010. nutritional characterization of tomato fiber as a useful ingredient for food industry. innov. food sci. emerg. technol. 11:707-711. guadarrama-lezama a.y., carillo-navas h., vernon-carter e.j. and alverez-ramirez j. 2016. rheological and thermal properties of dough and textural and microstructural features of bread obtained from nixtamalized corn/ wheat flour blens. j. cereal sci. 69:158-165. hua x., xu s., wang m., chen y., yang h. and yang r. 2017. effects of high-speed homogenization and high-pressure homogenization on structure of tomato residue fibers. food chem. 232:443-449. ismail t., akhtar s., riaz m. and ismail a. 2014. effect of pomegranate peel supplementation on nutritional, organoleptic and stability properties of cookies. int. j. food sci. nutr. 65:661-666. kaur d., wani a.a., oberoi d.p.s. and sogi d. s.2008. effect of extraction conditions on lycopene extractions from tomato processing waste skin using response surface methodology. food chem. 108:711-718. liu x., mu t., yamul k.d., sun h., zhang m., chen j., fauconner m.l. and andrea p.v. 2017. evaluation of different hydrocolloids to improve dough rheological properties and bread quality of potato-wheat flour. j. food sci. technol. doi:doi.org/10.1007/s13197-017-2591-y. majzoobi m., sariri ghavi f., farahnaky a., jamalian j. and mesbahi g. 2011. effect of tomato pomace powder on the physicochemical properties of flat bread (barbari bread). j. food process. preserv. 35:247-256. martinez m.m., diaz a. and gomez m. 2014. effect of different microstructural features of soluble and insoluble fibres on gluten-free dough rheology and bread-making. j. food eng. 142:49-56. mildner-szkudlarz s., bajerska j., zawirska-wojtasiak r. and gorecka d. 2013. white grape pomace as a source of dietary fibre and polyphenols and its effect on physical and nutraceutical characteristics of wheat biscuits. j. sci. food. agric. 93:389-395. mis a. 2011. interpretation of mechanical spectra of carob fibre and oat wholemeal-enriched wheat dough using nonlinear regressions models. j. food eng. 102:369-379. misan a., mimica-dukic n., sakac m., mandic a., sedej i., simurina o. and tumbas, v. 2011. antioxidant activity of medicinal plant extract in cookies. j. food sci. 76:c1239-c1244. nasir m., siddiq m., ravi r., hartej b., dolan k.d. and butt. m.s. 2008. physical quality characteristics and sensory evaluation of cookies made with added defatted maize germ flour. j. food qual. 33:72-84. navarro-gonzález i., garcía-valverde v., garcía-alonso h. and periago, m. j. 2011. chemical profile, functional and antioxidant properties of tomato peel fiber. food res. int. 44:1528-1535. passos c.p., kukurova k., basil e., fernandes, p.a.r. nto a. and nunes f.m. 2017. instant coffee as a source of antioxidant-rich and sugar-free coloured compounds for use in bakery: application in biscuits. food chem. 231:114-121. prosky l., asp nils georg scheizer f.t., devries w.j. and fruda i. 1998. determination of insoluble, soluble, and total dietary fiber in food products: interlaboratory study. j aoac. 71:1071-1023. sharma s., saxena d.c. and riar c.s.2016. nutritional, sensory and in vitro antioxidant characteristics of gluten free cookies prepared from flour blends of minor millets. j. cereal sci. 72:153-161. slavin j. 2013. fiber and prebiotics: mechanism and health benefits: a review. nutrients. 5:1417-1435. sumczynski d., bubelova z. and fisera m. 2015. determination of chemical, insoluble dietary fibre, neutral-detergent fibre and in vitro digestibility in rice types commercialized in czech markets. j. food compos. anal. 40:8-13. sozer n., cicerelli l., heinio r.l. and poutanen k.2014. effect of wheat bran addition on in vitro starch digestibility, physicochemical and sensory properties of biscuits. j. cereal sci. 64:1-9. thebaudin j.y., lefebvre a.c., harrington m., bourgeois c.m. 1997. dietary fibers: nutritional and technological interest. trends food sci. technol. 8(2):41-48. wang j.s., rosell c.m. and de barber c.b. 2002. effect of the addition of different fibers on wheat dough performance and bread quality. food chem. 79(2):221-226. paper received march 26, 2018 accepted august 20, 2018 ijfs#1218_bozza ital. j. food sci., vol. 31, 2019 205 paper effects of ultrasound treatment on structural, chemical and functional properties of protein hydrolysate of rainbow trout (oncorhynchus mykiss) by-products g.b. misira and s. koral*b acentral fisheries research institute, vali adil yazar street, no:14, kasustu, trabzon, turkey bkatip çelebi university, faculty of fisheries, fish processing technology department, çiğli, i̇zmir, turkey *corresponding author: serkan.koral@ikc.edu.tr abstract in this study, the effects of ultrasound treatment on biochemical, physical, structural and functional properties of fish protein hydrolysate of rainbow trout (oncorhynchus mykiss) by-products were investigated. enzymatic hydrolysis was conducted by alcalase 2.4 l, ph 8, 1 h at 60°c, and enzyme/substrate ratio at 0.5%. a probe-type ultrasound was used for ultrasound assisted hydrolysis (uh) process. higher protein recovery was obtained in uh than in the conventional enzymatic hydrolysis (ch). the highest foaming capacities of ch and uh were measured as 137.5% and 152.5%, respectively (p<0.05). overall, our data suggest that ultrasound treatment helps to improve the functional properties such as foaming capacity and stability. keywords: by-products, fish protein hydrolysate, oncorhynchus mykiss, rainbow trout, ultrasound hydrolysis ital. j. food sci., vol. 31, 2019 206 1. introduction seafood processing industry generates high amounts of by-products during the processing steps. these by-products include backbone, head, tail, viscera, blood and cut-offs. pertaining to species and the process applied, the volumes of these by-products vary from 20 to 70% of the whole raw material. such amount of by-products brings about pollution and create severe problems at disposal points. based on the present industrial practice, most of the by-products are either discarded or used for various feed applications by processing them into fish silage, fishmeal and oil (hsu, 2010). the frame has a high-value biochemical composition with potential for higher-value food applications (arason et al., 2009; klomklao and benjakul, 2018). an increasing trend in industrial applications for the utilization of fishery byproducts, is the manufacture of water-soluble fish protein hydrolysates (fph). this will give an increased yield of solubilized proteins due to reduced molecular weight and an increase in the number of ionizable groups (kristinsson and rasco, 2000). besides utilization in the replacement of animal meals from other sources (li et al., 2018), protein hydrolysates can be used as functional additives in the food processing industry with many functional properties, such as water holding, gelling and foaming capacities, fat absorption, emulsifying and also antioxidant and antimicrobial activities. however, alternative methodologies have become necessary for improving yield, functional properties and bioactivity in protein hydrolysates. the quality and functional characteristics of the obtained products vary with the usage of different enzymes and production conditions. it is therefore, necessary to test alternative innovative technologies that will enhance product quality. these technologies need to be safe, cheap and easy to apply. it should also have no toxic and side effects. power ultrasound is an emerging and promising technology that has been applied in a variety of fields (arvanitoyannis et al., 2015). recently, enhancement in peptide production by ultrasound has become a focus of research in the food industry. with ultrasonic pretreatment of substrates, the enzymatic hydrolysis of wheat germ protein can be significantly stimulated (zang et al., 2015). in addition, hydrolysis of food protein can also be enhanced using sonicated enzymes (kadam et al., 2015). the ultrasound treatment seems to be useful in accelerating the release of peptides. ultrasound treatment is regarded as safe, non-toxic and environmentally friendly. it is also considered to be more advantageous to other technologies and is covered by "green technologies" (kentish and ashakkumar, 2011). food technologists focus on protein production using high-intensity ultrasound application to support enzymatic hydrolysis, and produce high-throughput peptides. in this study, it was aimed to determine the effects of ultrasound treatment on biochemical, physical, structural, antioxidant and functional properties of the fish protein hydrolysate that was produced from rainbow trout by-products. 2. material and methods 2.1. materials a total of 45 (weighing 12 kg) individual fresh rainbow trout (with average length and weight being 29.36±1.72 cm and 264.83±53.42 g, respectively), obtained from a local fish farming company, were transferred to the laboratory in styrofoam box with ice. after evisceration, the by-products (head, backbone, fins, tail and skin) were separated by hand and used as raw material; total weights of by-products are presented in table 1. to ital. j. food sci., vol. 31, 2019 207 minimize microbial contamination and internal enzyme activity, viscera was excluded. the food-grade alcalase 2.4 l (au/kg sigma aldrich, novozymes, bagswaerd, denmark) was used. all chemical reagents used for the experimental analysis were of analytic grade. the hydrolysation process was done on the same day the raw material reached the laboratory. table 1. total weights of by-products of rainbow trout. type total weight (g) head 2074,10 tail and backbone 1226,11 fins and skin 1298,93 total by-products used as raw material 4599,14 viscera (not used) 2194,51 2.2. methods 2.2.1 preparation of raw material by-products were chopped with mincing machine (super meat grinder, 5 mm; pore size), mixed with distilled water (1:1 w/w) and homogenized (200 rpm for 2 minutes) using wisetis˓hg-15d (daihan, seoul, korea). 2.2.2 preparation of protein hydrolysis protein hydrolysates were prepared using the ph-stat method according to sathivel et al. (2005) and kangsanant et al. (2004), with slight modifications. for maximum activity and stability of the enzyme, all reactions were conducted at ph 8 (adjusted with 1n naoh) and a temperature of 60°c. the prepared homogenate was used as raw material, divided into two equal aliquots and then placed in glass examination vessels. experiments were carried out in the shaking water bath (wisebath, wertheim, germany) agitating at 200 rpm for ch (conventional enzymatic hydrolysis) and uh (ultrasonicassisted enzymatic hydrolysis) processes, using alkalase (0.5% by weight of raw material). for ultrasound assisted system, a probe type ultrasound equipment (sonics vibra cell, usa, tapered micro tip, 142 x 6 mm) was used and the probe was immersed into the experimental vessel with 40% ultrasonic amplitude, pulse duration of 10 s ontime; 20 s off-time. in both vessels, the temperature was increased to 60°c for enzyme activation and kept constant during the experiment. hydrolysis was initiated by addition of enzyme and terminated after 60 min, the enzyme was inactivated by increasing the temperature to 90 ºc for 10 min. coarse filtration was applied to heated suspensions using glass cotton and filter paper. thereafter, filtrates (6000 g) were centrifuged in a refrigerated centrifuge (universal 320 r, hettich, germany) at 4°c for 35 min. after centrifugation, 3 separate phases occurred in the separation funnel; bottom phase: insoluble protein, middle phase: soluble protein heavily liquid, and upper phase: lipid fraction light liquid. the middle layer was collected. the supernatants were stored in a freezer at -80ºc and dried in a freeze-dryer (labconco freezone 2.5 benchtop freeze dryer, usa) for 48 hours. the resulting powdery hydrolysates were vacuum packed and stored in a freezer at -80°c until analysis. the hydrolysis process of ch and uh groups were done in duplicate. all the analysis for the ch and uh groups were performed in three parallels. ital. j. food sci., vol. 31, 2019 208 2.2.2.1 yield of fph fph yield was calculated following the method used by ilhan and gülyavuz, 2003. yield of fph (%) = [weight of fph (g)/weight of by-products (g)] x100 (1) yield of protein (%) = [(wf × pf)/ (wi × pi)] x100 (2) where wf is the weight in grams of fph, pf is the protein content (%) of fph, wi is the weight of by-products in grams and pi is the protein content (%) of by-products (pires et al., 2012). 2.2.3 determination of the degree of hydrolysis (dh) dh was analyzed with ph-stat method described by wrolstad et al., 2005. about 10 g of freeze-dried sample was weighted; hydrolysis conditions of fish by-products were applied. the solution was stirred with the magnetic stirrer (ika, rct basic, germany) and ph was adjusted to 8.0 with 0,1 n naoh for 60 min. naoh consumption was reported every 5 min. results were given as a percentage. the equation used in the calculation is given below; dh (%) = b × nb × 1/α × 1/mp × 1/htot × 100 (3) b: amount of alkali consumed (ml) nb: normality of the alkali; 0.5 n (= 0.5 mmol/ml) mp: the mass of substrate (protein (g), %n ×6.25) 1/α: the calibration factors for ph-stat htot: the content of peptide bonds. adler-nissen (1986) assumed htot as 8.6 mmolg-1 of protein and α as 1 for fish. 2.2.4 determination of biochemical composition total crude lipid content was determined by soxhlet extraction method and crude protein content was analyzed by kjeldahl method. the total protein content was calculated as %n using the standard conversion factor of 6.25. (aoac, 1990, method 2.507); moisture and ash contents were determined using aoac 1990 method 985.14 and method 7.009, respectively. 2.2.5 amino acid analysis total amino acid analyzes were carried out in kazlıçeşme r and d test laboratory (ab0513-t), an accredited laboratory in istanbul, turkey. after pre-column derivatization with hplc (agilent 1260 infinity), agilent eclipse aaa method was modified using fld/dad detectors and determined by an in-house laboratory method. a 0.2 g sample was weighed and mixed with 5 ml of 6 n hcl and stored in the condenser for 24 h. depending on the amount of amino acid, 0.6 g to 2 g of sample was transferred to 100 ml balloon flask, after addition of 5 ml norvaline standard, the flask volume was completed to 100 ml. thereafter, 0.5 μl of the filtered sample was injected into the device and analyzed. opa (ortho phthalaldehyde), fmoc (fluorenylmethoxy chloroformate) and borate was used as the derivatizing agent. ital. j. food sci., vol. 31, 2019 209 2.2.5.1 hplc conditions mobile phase a; 40 mn na2hpo4 (ph 7.8) and mobile phase b; asentonitrile/ methanol/water (45/45/10), a flow rate of 2 ml/min. zorbax eclipse-aaa 4.6 * 150 mm (3.5 μm) was used as the column. the column temperature was set at 40°c. the injection volume of sample was 0.5 μl. dad detector wave lengths were 338nm, 10nm bw; ref: 390 nm, 20 nm bw (for opa-amino acid) and 262 nm, 16 nm bw; ref: 324 nm, 8 nm bw (for fmoc-amino acid). 2.2.6 measurement of the color the color was measured using a color meter (konica minolta (specktropen cr10 japan)). three measurements were taken from the samples of ch and uh. l * (brightness), a * (redness), b * (jaundice), w (whiteness), chroma and h hue angle /saturation degree; w = 100 –[(100-l *) 2 + a * 2 + b * 2)]1/2 (5) chroma = (a * 2 + b * 2) ½ (6) h= b */ a * (7) (pires et al. (2012) 2.2.7 determination of functional properties 2.2.7.1 protein solubility protein solubilities of ch and uh were determined as reported by american oil chemists society (aocs) (1989). fph’s were dispersed in the water (10 g/l); ph of solutions were adjusted to 3, 5, 7 and 9 with 0.5 n naoh or 0.5 n hcl for 45 min with constant stirring. the solutions were then centrifuged for 30 min at 2.800 g. n contents in 15 ml of supernatants were determined according to the kjeldahl method; protein solubility (%) = protein content of the supernatant/total protein content. 2.2.7.2 foaming capacity and foaming stability foaming capacity (fc) and foaming stability (fs) were performed according to wilde and clark, 1996 and shahidi et al., 1995, with slight modifications. three g of fph was mixed with 100 ml of distilled water, then transferred into a 250ml graduated cylinder. the mixture was homogenized at 11000 rpm for 1 min at room temperature. the total volume was measured at 0, 1st, 5th, 10th, 40th and 60th min. fc was expressed as foam expansion at 0 min, while fs was expressed as foam expansion at 60 min. 2.2.7.3 oil binding capacity and water holding capacity oil binding capacity was determined by the protocol of shahidi et al., 1995. five hundred mg hydrolysate was put in a centrifuge tube and 10 ml of sunflower oil was added. after being thoroughly vortexed for 1 minute, it was centrifuged (hettich universal 320 r refrigerated centrifuge) at 4500 g for 30 min at a temperature of 4°c, thereafter the unconnected oil was discharged. the oil binding capacity was expressed as weight of fat (g) absorbed per gram of sample. water holding capacity was analyzed following the centrifuge method described by cobb and hyder (1972), with slight modifications. five hundred mg of fph was weighted into a centrifuge tube and 20 ml distilled water was added. the mixture was vortexed for 30 s, ital. j. food sci., vol. 31, 2019 210 then put in a dark place at room temperature for 6 h. thereafter, the tube at 2800 g was placed into the centrifuge for 30 min. obtained supernatant was filtered from whatman paper no: 1 and the volume of liquid was weighted. the water holding capacity calculation was done by dividing the volume of the filtrate obtained from the initially used water volume by the amount of sample. the results are expressed as ml/g. 2.2.8 scanning electron microscopy (sem) the surface morphology of ch and uh thin films was investigated using a jsm-6610 (jeol) scanning electron microscope (sem) equipped with an energy dispersive x-ray (edx) analyzer operated at 20 kv acceleration voltages. prior to the observation, the investigated specimens were coated with about 250 angstroms of gold by quorumsc7620 sputter coater. 2.2.9 antioxidant activity assay to observe antioxidant capacities of the groups, copper (ii) ion reducing antioxidant capacity (cuprac) and fe (iii) ion reducing antioxidant power methods were used. radical scavenging activity was determined by abts+•2,2’-azinobis-(3-etilbenzotiazolin-6sülphonic acid) radical scavenging method. 2.2.9.1 copper (ii) ion reducing antioxidant capacity assay (cuprac) the method is based on the reduction of copper (ii)-neokuproine to copper (i)neokuproine after addition of antioxidant solution to the medium (apak et al., 2004; mentese et al., 2015). a total of 10 mm cu(ii) chlorure (sigma chemical co, usa), 7.5 mmneokuproine (sigma chemical co, usa), and 1 m ammonium acetate tampon solution at ph 7.0 (one ml each) were pipetted into the test tubes. about 20 µl sample solutions were added to the medium and vortexed. final volume was completed to 4.1 ml and 1080 µl distilled water was added and again vortexed. the same procedure was applied for trolox® standard. after incubation at room temperature for 50 min, absorbance was read at 450 nm (1601uv-shimadzu, australia). using trolox® curve (8 4 2 1 0.5 0.25 0.125 0.0625 mm trolox®, (r2=0.999)), trolox® equivalent antioxidant capacity (mg teac/mg substance) per mg substance was calculated for each substance. 2.2.9.2 iron (iii) ion reducing antioxidant capacity assay (frap) the method is based on the measurement of the absorbance of the complex, fe2+ tptz complex at 593 nm (benzie and strain, 1999; can and baltas, 2016). firstly, 300 mm acetate buffer at ph 3.6 was dissolved in 40 mm hcl, and 10 mm tptz (2,4,6-tris (2pyridyl)-s-triazine and 20 mm of fecl3.6h2o solution were prepared. freshly prepared solutions were mixed in a ratio of 10: 1: 1 and frap reactive was obtained. a total of 100 ml aliquots of samples and 3000 µl frap reactive were transferred to each sample tube and vortexed. the reaction mixture was incubated for 5 min at room temperature, and absorbance was read at 593 nm. the same treatments were carried out for feso4.7h2o standard (r2 = 0.999) prepared at concentrations of 15.63 31.25 62.50 125 250 500 1000 μm, respectively. the absorbance of the test tubes, which were allowed to incubate for 5 min at room temperature, was measured at 593 nm (1601uv-shimadzu, australia) and the standard feso4.7h2o curve was used to calculate the equivalent antioxidant capacity (mm feso4.7h2o/mg substances). ital. j. food sci., vol. 31, 2019 211 2.2.9.3 abts•+cationic radical scavenging method the radical scavenging activity of the abts•+ [2,2'-azino-bis (3-ethylbenzothiazoline-6sulfonic acid)] groups were studied according to re et al., 1999; yilmaz et al., 2017. a 7 mm solution of abts in water was prepared and 10 ml of this solution was mixed with 2.45 mm and 5 ml potassium persulphate solution and allowed to incubate at room temperature for 18 hours to enable the formation of abts•+ cationic radical. the resulting radical solution was diluted with phosphate buffer (pbs) at ph 7.4, to give an absorbance of 0.700 ± 0.020 at 734 nm. 200 μl of the test compound (dissolved in dmso) was added to 1800 μl of the radical solution, vortexed, and after 5 min, the absorbance was read on the uv-visible spectrophotometer (1601 uv-shimadzu, australia) at a wavelength of 734 nm. the radical scavenge value of the groups was calculated from the following formula. the study consisted of three replications for each substance and standard. radical scavenging (%) = [(odcontrol-odtest)/( odcontrol)x100] 2.2.10 statistical analysis the obtained data were analyzed by analysis of variance (one way anova) and when significant differences were found, comparisons among means were carried out using the tukey and mann whitney u test (data not provided in the normality of assumptions) under the program called jmp 5.0.1 (sas institute. inc. usa) and spss 18.0 (spss inc., chicago, il) (sokal and rohlf, 1987). a significance level of 95% (p<0.05) was used throughout the analysis. 3. results and discussion 3.1. yields of by-products, fph’s (ch and uh) and the protein of fph the yield of by-product was calculated as 38.32 % using the data shown in table 1. the yields of ch and uh were calculated as 9.82% and 10.54%, respectively. ultrasound application may have increased the yield because ultrasound have a positive effect on alcalase activity due to the ability to break down the molecular aggregates, giving enzymes the opportunity to yield higher accessibility for reaction and increasing activity, (mcclements, 1995). ma et al. (2011) studied the mechanism of ultrasonic impact on protease activity and their results showed that ultrasound had an effect on the activity of alcalase. protein yields of fph’s were also calculated as 57.13% for ch and 61.76% for uh. liaset et. al. (2000) produced protein hydrolysate from atlantic salmon frames without heads. they used alcalase for conventional enzymatic hydrolysis and fph protein recovery was observed to be 61.8%. the higher protein recovery of the present study may be affected by different hydrolysis conditions. 3.2. biochemical composition of by-products from rainbow trout biochemical composition of raw material (trout by-products), ch and uh, are shown in table 2. ital. j. food sci., vol. 31, 2019 212 table 2. proximate composition of by-products, fish protein hydrolysates (ch) and (uh) protein(%) lipid(%) moisture(%) ash(%) by-products 14.82±0.18a 6.45±0.48a 72.19±1.38a 3.54±0.24a (ch) 86.40±0.32b 0.05±0.01b 1.36±0.08b 6.25±0.40b (uh) 86.75±0.28b 0.05±0.01b 2.10±0.18c 5.95±0.32b ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different superscript lowercase letters (a,b) represent statistical differences amongst the groups (p<0.05). protein content in by-products was very low (14.82%). the ch and uh samples have high and similar protein contents. the high protein content of fph is due to the characteristics of the hydrolysis process. during this process, proteins are solubilized and insoluble materials are removed by centrifugation (chalamaiah et al., 2010). lipid contents were the same for ch and uh and are very low (0.05%). this also may be as a result of characteristics of the hydrolysis process; the membranes tended to round up and form insoluble bubbles, which could cause the removal of membrane structural lipids. during the centrifugation stage after hydrolysis, these lipids separated into different layers and were removed from the medium. it is a desired feature for protein hydrolysates to have low lipid content (shahidi et al., 1995). as estimated, the moisture content of byproducts was high. whereas, it was very low in ch and uh because fphs were freezedried at the end of the hydrolysis process. the difference between ch and uh was significant (p<0.05). since by-products have skin and bone parts, ash content was higher than trout flesh (average 1.21%) (turcomp, 2014), but it was higher in ch and uh than the by-products; this may be due to the increased salts by addition of alkali into the medium to adjust the ph 8 during the hydrolysis process (benjakul and morrissey, 1997). there was no significant difference in the ash contents of ch and uh. 3.3. amino acids analysis the functional differences in hydrolysates are closely related to the amino acid groups present in the structures. table 3 shows the total amino acid contents in by-products, ch and uh, respectively. accordingly, values for by-products of amino acids were lower than all amino acid values of fph (p<0.05). amino acid contents of ch and uh were higher and close to each other. total amino acid contents were calculated as 2.01g/100g for by-products, 80.54g/100g for ch and 82.65g/100g for uh. generally, ultrasound application helps to open the surface of the substrate and increases the enzyme activity. as a result, it supports hydrolysis process. glycine was the highest in all groups. among the hydrophobic amino acids, (valine, methionine, leucine, isoleucine, alanine, tryptophan, phenylalanine and tyrosine), the value of leucine was the maximum and methionine was the minimum. indicating the increased antioxidant activity, the sum of the hydrophobic amino acids was calculated as 22.98g/100g for ch and 23.72g/100g for uh. differences for all amino acids of ch and uh were not significant, except valine (p<0.05). rajapakse et al., 2005 stated that hydrophobic amino acids, such as phenylalanine and glycine are highly soluble in lipids. soluble amino acids have more capability to gain closer access to the radicals than neutral or hydrophilic amino acids. ital. j. food sci., vol. 31, 2019 213 table 3. total amino acid contents of by-products, ch and uh(g/100 g). amino acid by-product ch uh cysteine 0.00±0.00a 1.81±0.25b 1.94±0.01b aspartate 0.12±0.01a 6.80±0.06b 7.10±0.13b glutamate 0.09±0.01a 10.98±0.11b 11.45±0.28b aspargine nd nd nd serine 0.11±0.01a 3.19±0.01b 3.24±0.17b glutamine nd nd nd histidine 0.06±0.01a 1.93±0.00b 1.90±0.04b glycine 0.36±0.01a 12.05±0.16b 12.06±0.38b threonine 0.11±0.01a 3.00±0.01b 3.08±0.15b arginine 0.09±0.01a 5.59±0.06b 5.75±0.20b alanine 0.14±0.01a 5.70±0.06b 5.88±0.17b tyrosine 0.12±0.01a 1.95±0.05b 2.08±0.06b valine 0.14±0.01a 3.06±0.02b 3.21±0.03c methionine 0.11±0.01a 1.65±0.04b 1.74±0.02b norvaline 0.02±0.00a 0.01±0.01a 0.02±0.01a tryptophane 0.06±0.01a 0.33±0.06b 0.34±0.06b phenylalanine 0.08±0.00a 3.84±0.05b 3.99±0.11b isoleucine 0.07±0.01a 1.91±0.04b 2.05±0.08b leucine 0.07±0.01a 4.84±0.04b 5.13±0.11b lysine 0.09±0.01a 5.83±0.13b 5.89±0.08b hydroxyproline 0.13±0.01a 2.28±0.08b 2.07±0.16b sarcosine nd nd nd proline 0.11±0.01a 3.89±0.05b 3.77±0.08b total 2,01±0,04a 80,54±0,75b 82,65±0,60b ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different superscript lowercase letters (a,b,c..) represent statistical differences amongst the groups (p<0.05). 3.4. measurement of the color at the end of the hydrolysis, yellowish brown liquid mixtures were obtained in both vessels (ch and uh). the liquid mixtures had three layers; the bottom, including bones brown in color, the middle; a dark yellowish brown clear liquid, and the top dense brown liquid. after centrifugation, collected liquids (ch and uh) were bright dark yellow. the colors of freeze-dried powders of ch and uh were creamy yellow and l*, a*, and b* values are presented in table 4. table 4. l*, a* and b* and w, c, h values of ch and uh. l* a* b* w c h ch 85.80±0.84a 2.90±0.51a 22.60±1.35a 73.15±0.78a 22.79±0.48a 7.80±0.46a uh 83.90±0.60a 3.50±0.30a 24.30±0.30a 71.10±0.56a 24.10±0.30a 6.80±0.34a ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 10. the different superscript lowercase letters (a,b,c..) represent statistical differences amongst the groups (p<0.05). ital. j. food sci., vol. 31, 2019 214 l*, a*, and b* values observed in ch were similar with uh. using l*, a*, b* values whiteness, chroma and h values were calculated (table 4). 3.5. dh fig. 1 illustrates the variation in the dh of ch and uh under experimental conditions, which showed a rapid increase in both groups due to many peptide bonds cleaved up to around 20th min regardless of ultrasound application. after this time, as fewer peptide bonds were available for cleavage, the reaction rate reduced for ch and uh. after about 35-40 min, a small decrease occurred in the dh of uh, which was significantly lower than dh of ch (p<0.05). this observation was not in accordance with the theory that ultrasound application would yield a higher dh than the conventional hydrolysis. kangsanant et al. (2014) produced enzymatic hydrolysate from nile tilapia assisted by continuous ultrasound with 40w. the researchers observed that ultrasound assisted hydrolysis provoked a decrease in dh, but this decrease was not significant compared to other researches which focused on different food items. this may be due to the low intensity of ultrasound applied in the present study (huang et. al., 2015; zhang et. al., 2015). figure 1. evolution of dh during the hydrolysis of ch and uh. ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different letters (a,b) represent statistical differences amongst the groups (p<0.05). 3.6. sem analysis to find out the structural effect of ultrasonic treatment on fph, the microstructure of lyophilized ch and uh were observed by sem under different magnifications. fig. 2 illustrates the sem images of ch and uh. as shown in fig. 2, different microstructures were obtained in ch and uh. uh had larger aggregates plate-shaped morphology and a smooth surface structure, whereas ch had smaller aggregates both in the form of round structures and plate-shaped morphology. the differences might be due to the changes in application of ultrasound that led to the unfolding of uh molecules. as a result, higher hydrophobic groups might occur at the surface of the molecules and interaction of these reaction time (min) 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 d h (% ) 0 5 10 15 20 25 30 ch uh a b a a a a a a a a a a a a a b b a a b b a b a b a b a ital. j. food sci., vol. 31, 2019 215 groups with each other formed larger structures. hu et al. (2013) found that treatments of different frequencies and times of ultrasound were effected on the structure of soy protein isolate dispersions. in their study, after ultrasound treatment, samples had larger and more heterogeneous structures. also, they observed that longer ultrasound application might result in larger structure size. zhou et al. (2016) investigated the effects of heat, ultrasound and combinations of heat/ultrasound and ultrasound/heat on corn gluten meal hydrolysate. researchers used 40 khz frequency, on-time 10 s and off time 3 s, 40 min duration at 20°c. they observed that the control was in the form of massive texture, but the surface became incompact and porous after ultrasound pretreatment. figure 2. sem analysis of ch (a,b,c) and uh (d,e,f). a d b e f c ital. j. food sci., vol. 31, 2019 216 in the present study, results are inconsistent with those emphasized studies. different shapes may be due to the different ultrasonic conditions (pretreatment, ultrasonic-assisted hydrolysis and time, temperature, etc.) and the raw material used in the study. 3.7. functional properties in the food industry, proteins have a special attribution in food products due to their several significant functional characteristics. among the functional properties, emulsifying, foaming, thickening and gelling capacities are often affected by their solubility (damodaran, 1997). soluble peptides obtained from enzymatic hydrolysis of proteins, can contribute to improving the emulsion and the foaming characteristics (raymundo et al., 2000). ultrasound applications led to an improvement in the functional properties of different food items (bryant and mcclements, 1999). but ultrasonic treatment conditions and variation in the rheological and thermos-physical properties of protein sources are considered effective on the functional properties of protein hydrolysates (avad et al., 2012). 3.7.1 protein solubility protein solubility of ch and uh are shown in fig. 3. it was low at acidic ph and gradually increased with increasing the ph, after neutral ph, it decreased again to ph 9. both groups have the highest solubility at ph 7, and the lowest at ph 3. the differences between groups were significant, except ph 3 (p<0.05). as shown in fig. 3, a parallel trend in ch and uh, ultrasound treatment was shown to improve the protein solubility. figure 3. protein solubility of ch and uh. ultrasound changes the conformation and structure of protein and hydrophilic amino acid residues directed towards water (arzeni et al., 2011). this situation explains the case of higher solubility of uh than ch. protein solubility is one of the most important representative factors in protein functionality. in the food industry, improvement in solubility led to a potential improvement in the functional properties of proteins (pelegrine and gasparetto, 2005). ph values 3 5 7 9 p ro te in s ol ub ili ty (% ) 90 92 94 96 98 100 102 uh ch a a a b a b b a ital. j. food sci., vol. 31, 2019 217 3.7.2 foaming capacity (fc) and foaming stability (fs) fc and fs of ch and uh are shown in fig. 4 a, b. the fc of uh in each duration was significantly higher than that of ch. the highest values for fc of ch and uh were measured accordingly as 137.5% and 152.5%, respectively. at the end of 60 min, it decreased to 11.0% in ch and 20.0% in uh. diffusion of soluble proteins, rapid conformational change and reorganization of molecules at air-water interface are needed in the protein-based foam formation (nalinanon et al., 2011). parallel to fc, fs of uh was also significantly higher than ch, this difference was significant (p<0.05) after the 5th to 60th min (fig. 4b). figure 4. foaming capacity (a) and stability (b) of ch and uh. ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different letters (a,b) represent statistical differences amongst the groups (p<0.05). it was reported that protein solubility has an important effect on functional properties of protein hydrolysates. in the present study, the results of fc and fs were in accordance with the solubility values. as the solubility increased with the ultrasound treatment, fc and fs increased. researchers also reported that higher solubility results in higher foaming characteristics from different protein sources (soria-hernández et al. 2015). jambrak et al., (2009) illustrated that ultrasound application is an effective way to improve the physical properties of soy proteins. anon, 2008 reported “the degree of hydrolyzation determines the functionality of the end products. low degree of hydrolyzation results in highly functional foaming agents and high degree of hydrolyzation results in hydrolysed vegetable protein (hvp) which are used in soups and sauces as flavor enhancers”. 3.7.3 oil binding capacity (obc) and water holding capacity (whc) obc shows a major functionality of ingredients in the food industry. kristinsson and rasco (2000) stated oil binding capacity ranged from 2.86 to 7.07 ml of oil/g of protein for atlantic salmon protein hydrolysates. the bulk density of the protein, the degree of hydrolysis and enzyme used in hydrolysis process affect this functionality. water holding capacity is another important factor. it especially improves the textural properties of duration (min) 0 1 5 10 40 60 f o a m in g c a p a ci ty ( % ) 0 20 40 60 80 100 120 140 160 ch uh a b a b a b a b a a bb duration (min) 0 1 5 10 40 60 f o a m in g s ta b ili ty ( % ) 0 20 40 60 80 100 ch uh a b a a a a a b a b ital. j. food sci., vol. 31, 2019 218 foods. different ingredients derived from proteins are used in muscle foods to improve water holding functions. data on obc and whc of ch and uh are presented in table 5. uh has a better obc than ch (p<0.05). on the contrary, whc was lower in uh than ch, but this difference was not significant (p>0.05). table 5. oil absorption and water holding capacity of ch and uh. ch uh oil absorption capacity (g/g oil) 4.47±0.23a 6,36±0.40b water holding capacity (ml/g) 5.40±0.57a 4,70±0.14a ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different superscript lowercase letters (a, b, c..) represent statistical differences amongst the groups (p<0.05). 3.8. antioxidant activity different measurement methods are used for antioxidant capacity determination. since only one experiment cannot give reasonable results, it was observed that the item act as antioxidant. accordingly, antioxidant activities of ch and uh were measured using the methods; cuprac, frap and abts•+ radical scavenging activities. many studies have shown that all protein hydrolysates consist of peptides or smaller protein fractions that are hydrogen donor and could react with radicals to convert them to more steady products, thereby finalizing the radical reaction (kittiphattanabawon et al., 2012). 3.8.1 cuprac and frap antioxidant activity cuprac method is easily used to measure total antioxidant capacities of both hydrophilic and lipophilic antioxidants (yavaşer, 2011). the results of the antioxidant activity obtained using the cuprac and the frap methods of the uh and ch are given in table 6. trolox equivalent antioxidant capacity (teac) values of the groups (according to the cuprac method) were calculated on the trolox® standard and feso4.7h2o standard. table 6. antioxidant activities of uh and ch, (cuprac (mm trolox/mg compound) and frap (mm feso4.7h2o/mg compound) methods). compounds teac values (µm trolox®/mg mixture) frap values (µm feso4.7h2o/mg mixture) uh 244.89±0.020a 13.175±0.009a ch 230.23±0.017b 12.161±0.003b ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different superscript lowercase letters (a,b,c..) represent statistical differences amongst the groups (p<0.05). teac method is based on electron transfer such as trolox equivalent antioxidant capacity (sarmadi and ismail, 2010). teac values for uh were significantly higher than ch (p<0.05). reduction activities of uh and ch to iron (iii) and iron (ii) were calculated according to frap method. frap values of uh were higher than ch (p<0.05) (table 6). in ital. j. food sci., vol. 31, 2019 219 both methods, higher antioxidant activities of uh samples might be due to change in the structures of fractions as the effect of ultrasound. jiang et al. (2014) stated that ultrasonic treatment causes higher interactions of protein hydrophobic sites exposed to the surface of the molecules and buried inside the molecules. 3.8.2 abts•+ radical scavenging activity the total radical scavenging capacities of ch and uh were determined using the abts•+ radical scavenging assay. abts•+ is generated by oxidation of abts with potassium per sulfate and is reduced in the presence of such as hydrogen or an electron donating antioxidant (binsan et al., 2008). the sc50 values for abts•+ radical scavenging activities of the ch and uh were presented in table 6. the ch exhibited efficient radical scavenging activity when compared to uh, at the all final concentration (table 7). increased compound concentrations caused an increase in radical scavenging ability. abts scavenging activity increased with increasing concentrations and it was stated that some amino acids like histidine, methionine, cysteine, phenylalanine and tyrosine might be effective in increasing the abts+ radicals scavenging activities (chalamaiah et al. 2010). aromatic amino acids in hydrolysates are capable of stabilizing free radicals by donating an electron. in the present study, total amounts of these amino acids were similar in ch and uh (11.18g/100g and 11.65g/100g, for ch and uh, respectively). histidine shows capabilities of stabilizing free radicals by donating an electron and inhibiting lipid oxidation through chelating and lipid trapping of the imidazole ring. in the present study, histidine was higher in ch than uh. lower sc50 values of ch display a higher radical scavenging effectiveness. the sc50 values for abts•+ method of ch and uh were found as 160.0 and 180.10 µg/ml, respectively (table 7). in a study, abts scavenging activities were similar for control and ultrasound pretreated (91.2% and 92.7%) bighead carp hydrolysate, at a hydrolysate concentration of 30% (yang et al., 2016). ital. j. food sci., vol. 31, 2019 220 table 7. abts•+ radical scavenging activities at various final concentrations (%) and sc50 values of the uh and ch. compounds abts•+ method radical scavenging (%) sc50 values (µg/ml) 1000 µg/ml 500 µg/ml 250 µg/ml 125 µg/ml 62.5 µg/ml 31.25 µg/ml uh 86.15±1.12a 77.54±0.72a 61.85±0.48a 36.62±0.30a 19.62±0.22a 6.92±0.12a 180.10±0.68a ch 87.08±0.90a 79.08±0.50a 64.31±0.56a 42.58±0.42b 24.46±0.28b 9.85±0.08b 160.00±0.45b ch: conventional enzymatic hydrolysis, uh: ultrasonic-assisted enzymatic hydrolysis, ± sd: n: 3. the different superscript lowercase letters (a,b,c..) represent statistical differences amongst the groups (p<0.05). ital. j. food sci., vol. 31, 2019 221 4. conclusion this research shows that fph derived from trout by-products may have a potential utilization as a functional and nutritional ingredient in food systems with desirable properties. ultrasound application improves protein solubility and it affects especially foaming capacity and stability, as well as oil absorption capacity of fph. there were no significant differences observed in other functional properties. the sc50 value for abts•+ radical scavenging activity was gained by ultrasound treatment. ultrasound assisted enzymatic hydrolysis of fph can be used as a novel hydrolyzation process. acknowledgements the authors wish to acknowledge dr. nimet baltaş for her valuable contributions in antioxidant activity analysis. this research did not receive any specific grant from funding agencies in the public, commercial, or non-profit sectors. references adler-nissen j. 1986. enzymic hydrolysis of food proteins. new york, usa:elsevier applied science publishers ltd. essex, england 612 p. anon 2008. soy processing. available at www.dspace.dial.pipex.com/town/park/gfm11/soya.shtml assessed 17/09/2017. aoac. 1990. official methods of analysis, 14th edition. association of analytical chemists. washington dc. aocs. 1989. official methods and recommended practices of the american oil chemists society, official method ba 1165. champaign, il:american oil chemists society. apak r., guclu k., ozyurek m. and karademir s.e. 2004. novel total antioxidant capacity index for dietary polyphenols and vitamins c and e, using their cupric ion reducing capability in the presence of neocuproine:cuprac method. j. agric. food chem. 52(26):7970-7981. doi: doi.org/10.1021/jf048741x. arason s., karlsdottir m., valsdottir t., slizyte r., rustad t., falch e., jakobsen g. 2009. maximum resource utilization value added fish by-products. nordic innovation, 108 p. arvanitoyannis i.s., kotsanopoulos k.v., and savva a.g. 2015. use of ultrasounds in the food industry. methods and effects on quality, safety and organoleptic characteristics of foods:a review. critical reviews in food sci nutr. 57(1):109-128. doi: doi.org/10.1080/10408398.2013.860514. arzeni c., martinez k., zema p., arias a., perez o.e., and pilosof a.m.r. 2012. comparative study of high intensity ultrasound effects on food proteins functionality. j. food eng. 108(3):463-472. doi: doi.org/10.1016/j.jfoodeng.2011.08.018. awad t.s., moharram h.a., shaltout o.e., asker d. and youssef m.m. 2012. applications of ultrasound in analysis, processing and quality control of food:a review. food res. int. 48(2):410-427. doi: doi.org/10.1016/j.foodres.2012.05.004. benjakul s.and morrissey m.t. 1997. protein hydrolysates from pacific whiting solid wastes. j. agric. and food chem. 45 (9) :3423-3430. doi: doi.org/10.1021/jf970294g. binsan w., benjakul s., visessanguan w., roytrakul s., tanaka m. and kishimura h. 2008. antioxidative activity of mungoong, an extractpaste, from the cephalothorax of white shrimp (litopenaeus vannamei). food chem. 106, pp. 185193. bryant c.m. and mcclements d.j. 1999.ultrasonic spectrometry study of the influence of temperature on whey protein aggregation. food hydrocolloids 13(6):439-444. chalamaiah m., rao g.n., rao d.g. and jyothirmayi t. 2010. protein hydrolysates from meriga (cirrhinus mrigala) egg and evaluation of their functional properties. food chem. 120(3):652-657. doi: doi.org/10.1016/j.foodchem.2009.10.057. ital. j. food sci., vol. 31, 2019 222 can z. and baltas n. 2016. bioactivity and enzyme inhibition properties of stevia rebaudiana. current enzyme inhib. 12:188-194. cobb b.f. and hayder k. 1972. development o f a process for preparing a fish protein concentrate with rehydration and emulsifying capacities. j. food sci. 37(5):743-750. damodaran s. 1997.protein-stabilized foams and emulsions. in s. damodaran and a. paraf (eds.), food proteins and their applications. new york: marcel dekker hsu k.c. 2010. purification of antioxidative peptides prepared from enzymatic hydrolysates of tuna dark muscle byproduct. food chem. 122(1):42-48. doi: doi.org/10.1016/j.foodchem.2010.02.013. huang l., dai c., li z. and ma h. 2015. antioxidative activities and peptide compositions of corn protein hydrolysates pretreated by different ultrasonic methods. j. food nutr. res. 3(7):415-421. doi: doi.org/10.12691/jfnr-3-7-2. ilhan r. and gülyavuz h. 2003. antalya körfezi’nden avlanan mürekkep balığının (sepia officinalis l. 1758) et kalitesi ve raf ömrünün belirlenmesi xii. ulusal su ürünleri sempozyumu, elazığ. jambrak a.r., lelas v., mason t.j., krešić g.and badanjak m. 2009. physical properties of ultrasound treated soy proteins. j. food eng. 93(4):386-393. doi: doi.org/10.1016/j.jfoodeng.2009.02.001. jiang z., tian b., brodkorb a. and huo g. 2010. production, analysis and in vivo evaluation of novel angiotensin iconverting enzyme inhibitory peptides from bovine casein. food chem. 123(3):779-786. kadam s.u., tiwari b.k. álvarez c. and o'donnell c.p. 2015. ultrasound applications for the extraction, identification and delivery of food proteins and bioactive peptides. trends in food sci. technol. 46(1):60-67. doi: doi.org/10.1016/j.tifs.2015.07.012. kangsanant s., murkovic m. and thongraung c. 2014. antioxidant and nitric oxide inhibitory activities of tilapia (oreochromis niloticus) protein hydrolysate:effect of ultrasonic pretreatment and ultrasonic-assisted enzymatic hydrolysis. inter j. food sci. technol. 49(8):1932-1938. doi: doi.org/10.1111/ijfs.12551. kentish s., ashokkumar m. 2011. the physical and chemical effects of ultrasound. in: feng h., barbosa-cánovas g.v., weiss j. (eds.), ultrasound technologies for food and bioprocessing. springer sci. business media, new york, pp. 1-12. kittiphattanabawon p., benjakul s., visessanguan w. and shahidi f., 2012. gelatin hydrolysate from blacktip shark skin prepared using papaya latex enzyme: antioxidant activity and its potential in model systems. food chemistry 135(3)1118-1126. doi: doi.org/10.1016/j.foodchem.2012.05.080. klomklao s.and benjakul s. 2018. protein hydrolysates prepared from the viscera of skipjack tuna (katsuwonus pelmamis):antioxidative activity and functional properties. turk. j. fish. aquat. sci. 18:69-79. doi: doi.org/10.4194/1303-2712-v18_1_08. kristinsson h.g. and rasco b.a. 2000. fish protein hydrolysates: production, biochemical and functional properties. crit. rev. food sci. nutr. 40(1):43-81. doi: doi.org/10.1080/10408690091189266. li x., wang l., zhang c., rahimnejad s., song, k. and yuan x. 2018. effects of supplementing low-molecular-weight fish hydrolysate in high soybean meal diets on growth, antioxidant activity and non-specific immune response of pacific white shrimp (litopenaeus vannamei) turk. j. fish. aquat. sci. 18:717-727. doi: doi.org/10.4194/1303-2712-v18_5_07. liaset b., lied e. and espe m. 2000. enzymatic hydrolysis of by-products from the fish-filleting industry; chemical characterisation and nutritional evaluation. j. sci. food agric, 80(5):581-589. doi: doi.org/10.1002/(sici)10970010(200004)80:5<581:aid-jsfa578>3.0.co;2-i. ma h., huang l., jia j., he r., luo l.and zhu w. 2011. effect of energy-gathered ultrasound on alcalase. ultrasonics sonochem. 18(1):419-424. doi: doi.org/10.1016/j.ultsonch.2010.07.014. mcclements d.j. 1995.advances in the application of ultrasound in food analysis and processing. trends in food sci. technol. 6(9):293-9. doi: doi.org/10.1016/s0924-2244(00)89139-6. menteşe e., yilmaz f., baltaş n., bekircan o. and kahveci b. 2015. synthesis and antioxidant activities of some new triheterocyclic compounds containing benzimidazole, thiophene and 1,2,4-triazole rings, j enzyme inhib med chem. 30(3):435-41. doi: doi.org/10.3109/14756366.2014.943203. nalinanon s., benjakul s., kishimura h. andshahidi f. 2011. functionalities and antioxidant properties of protein hydrolysates from the muscle of ornate threadfin bream treated with pepsin from skipjack tuna. food chem. 124:13541362. ital. j. food sci., vol. 31, 2019 223 pelegrine d.h.g. and gasparetto c.a. 2005.whey proteins solubility as function of temperature and ph. lwt food sci. technol. 38(1):77-80. doi: doi.org /10.1016/j.lwt.2004.03.013. pires c., clemente t., and batista i. 2012. functional and antioxidative properties of protein hydrolysates from cape hake by-products prepared by three different methodologies. j. sci. food agric. 93(4):771-780. doi: doi.org/10.1002/jsfa.5796. rajapakse, n. mendis, e. young w.k. and kim s.k. 2005. purification of a radical scavenging peptide from fermented mussel sauce and its antioxidant properties food research international 38, 2, 175-182 raymundo a., empis j. and sousa i. 2000. effect of ph and nacl on rheological and textural properties of lupin protein emulsions. in: p. a. williams and g. o. phillips (eds.).gums and stabilizers for the food industry. cambridge, uk: royal society of chemistry. re r., pellegrini n., proteggente a., pannala a., yang m. and rice-evans c. 1999. antioxidant activity applying an improved abts radicalcation decolorizati on assay, free radical biol. med. 26(9-10):1231-1238. doi: doi.org/10.1016/s0891-5849(98)00315-3. sarmadi b.h. and ismail a. 2010. antioxidative peptides from food proteins: a review, peptides, 31(10):1949-1956. doi: doi.org/10.1016/j.peptides.2010.06.020. sathivel s., bechtel p.j., babbitt j., prinyawiwatkul w., negulescu i.i. and reppond k.d. 2005. properties of protein powders from arrow tooth flounder (atheresthes stomias) and herring (clupea harengus) by-products. j. agric. food chem. 52(16):5040-5046. doi: doi.org/10.1021/jf0351422. shahidi f., han x. and synowiecky j. 1995. production and characteristics of protein hydrolysates from capelin (mallotus villosus). food chem. 53:285-293. doi: doi.org/10.1016/0308-8146(95)93934-j. sokal r.r. and rohlf f.j. 1987. introduction to biostatistics. 2nd edt., new york: w.h 486 freeman and company. soria-hernández c., serna-saldívar s. and chuck-hernández c. 2015. physicochemical and functional properties of vegetable and cereal proteins as potential sources of novel food ingredients. food technol. biotechnol. 53(3):269-277. doi: doi.org/10.17113 /ftb.53.03.15.3920. turkomp. 2014. turkish food composition database. www.turkomp.gov.tr/food/101,107,108. assessed 17/11/2017 wilde p.j. and clarke d.c. 1996. foam formation and stability. in methods of testing protein functionality, edt. g.m. hall pp. 110-52 london: blackie academic. wrolstad r.e., acree t.e., decker e.a., penner m.h., reid d.s., schwartz s.j., shoemaker c.f., smith d.m. and sporns p. 2005. handbook of food analytical chemistry, 768 p. wiley -interscience, hoboken, n. j. yang f., hu f., jiang q., xu y. and xia w. 2016. effect of pretreatments on hydrolysis efficiency and antioxidative activity of hydrolysates produced from bighead carp (aristichthys nobilis). j. aquat. food prod. technol. 25:(6):916-927. yılmaz f., menteşe e. and baltaş n. 2017. synthesis and antioxidant evaluation of some novel benzimidazole derivatives containing a triazole nucleus. letters in drug design discovery 14:201-208. zhang y., ma h., wang b., qu w., li y., he r. and wali a. 2015. effects of ultrasound pretreatment on the enzymolysis and structural characterization of wheat gluten. food biophysics 10(4):385-395. doi: doi.org/10.1007/s11483-015-9393-4. zhou, m. liu, j. zhou, y. huang, x. liu, f. pan,s. hu, h. (2016). effect of high intensity ultrasound on physicochemical and functional properties of soybean glycinin at different ionic strengths. innovative food science and emerging technologies 34:205-213. paper received july 23, 2018 accepted september october 30, 2018 ijfs#1617_bozza ital. j. food sci., vol. 32, 2020 234 paper occurrence of listeria spp. and antibiotic resistance profiles of listeria monocytogenes from raw meat at retail in turkey p. şanlibaba*1, b. uymaz tezel2, g.a. çakmak3, r. keski̇n4 and m. akçeli̇k5 1ankara university, engineering faculty, department of food engineering, 50th year settlement, 06830 gölbaşı, ankara, turkey 2çanakkale onsekiz mart university, bayramiç vocational school, food technology program, 17700 bayramiç, çanakkale, turkey 3akdeniz university, department of food engineering, faculty of engineering, 07058 antalya, turkey 4department of food engineering, engineering faculty, ankara university, 50th year settlement, 06830 gölbaşı, ankara, turkey 5ankara university, faculty of science, department of biology, 06100 ankara, turkey *corresponding author: sanlibab@ankara.edu.tr abstract a total of 190 raw meat samples were collected in ankara to examine the presence of listeria spp. and l. monocytogenes and its antibiotic resistance. of the examined samples, 57 were positive for listeria spp. and among them, 23 were identified as l. monocytogenes. among l. monocytogenes strains, 86.96% of isolates were positive for the presence of the hlya gene. all l. monocytogenes strains were resistant to ampicillin, fosfomycin, nalidixic acid, linezolid, and clindamycin. multi-drug resistance was observed in 73.91% l. monocytogenes strains. in conclusion, the presence of l. monocytogenes in raw meat may be indicative of poor hygiene or cross-contamination. keywords: listeria monocytogenes, prevalence, antibiotic resistance, raw meat ital. j. food sci., vol. 32, 2020 235 1. introduction listeria spp. are gram-positive, facultatively anaerobic, non-spore forming, rod-shaped bacteria with low g + c content and motile at 10–25°c (nayak et al., 2015; coroneo et al., 2016). so far, twenty-one species of the genus have been identified (ncbi, 2019). of them, listeria monocytogenes has been known as the main causative agent of listeriosis in human and other mammals since the 1920s, while l. ivanovii is an animal pathogen and rarely infects humans (doyle et al., 2001; fallah et al., 2012). the overall rate of listeriosis in humans is low but it can be lethal for high-risk groups like pregnant women, unborn or newly delivered infants, elderly people, severe underlying disease conditions like immune-suppression, organ transplants, patients undergoing treatment for cancer, and aids (khen et al., 2015; abay et al., 2017; du et al., 2017). it is difficult to control of contamination by l. monocytogenes as it can grow at refrigeration temperature, low oxygen levels, high salt concentration (20% w/v), wide ph values ranging from 4.3 to 9.6, low water content, and hypoxic conditions (almeida et al., 2013; du et al., 2017; kurpas et al., 2018; noll et al., 2018). this pathogen is also able to survive in vacuum-packed food and modified atmospheres (lambertz et al., 2012). l. monocytogenes is a widely distributed in the environment such as soil, contaminated silage, feces of some animals, and in non-treated water. therefore, it can easily contaminate food products of both animal and plant origin (pesavento et al., 2010; şanlibaba et al., 2018a). l. monocytogenes is also commonly found in food processing environments and various food items including ready-to-eat (rte) foods, milk and dairy products, meat and its products, unwashed raw vegetables, seafood products, and poultry products (fallah et al., 2012). l. monocytogenes is of particular concern in raw, undercooked or rte foodstuffs because processed foods are easily contaminated with raw foods in the foodprocessing environment or at homes (al-nabusi et al., 2015; oyelami et al., 2018). raw meat, such as red meat and chicken, may become contaminated with l. monocytogenes either environmentally or during shipping and prolonged storage, particularly if they are stored at above 4°c. the additional handling of raw meats at the retail also results in the transmission of l. monocytogenes to raw meats mainly via slicing, weighing, and packaging (kovacevic et al., 2012; kurpas et al., 2018). the main concern in raw meat is that it contaminated with l. monocytogenes can infect processed foods (pesavento et al., 2010). antimicrobial resistance (amr) in foodborne pathogens, especially multidrug resistance, is a great concern for human and animal health at both national and international levels (alonso-hernando et al., 2012; du et al., 2017). it has been reported that about 33000 deaths occur each year in the european union due to amr food-borne pathogens (anon., 2019a). l. monocytogenes is naturally susceptible to a wide range of antibiotics that act on gram-positive bacteria (gomez et al., 2014; wang et al., 2015; byrne et al., 2016; mohamed et al., 2016). however, since the first documented report on multi-drug resistant l. monocytogenes strain isolated from a patient with meningoencephalitis in france in 1988 (wang et al., 2013; noll et al., 2018), many strains isolated from food and environmental and clinical samples have shown resistance to one or more antibiotics used for treating listeriosis (şanlibaba et al., 2018a). the use of antimicrobials in veterinary medicine is the main cause of the development of amr foodborne bacterial pathogens including l. monocytogenes, as amr pathogens can easily be transported from animal to human via food consumptions (conter et al., 2009). the genes responsible for antibiotic resistance could be transferred through movable genetic elements such as conjugative transposons, mobilizable plasmids, and self-transferable plasmids to other foodborne bacteria in the gastrointestinal tract. in listeria spp., efflux pumps have also been reported ital. j. food sci., vol. 32, 2020 236 as the resistant mechanism (lungu et al., 2011). enterococcus spp. and staphylococcus spp. serve as a reservoir of resistance genes for l. monocytogenes (natratilova et al., 2004). many studies have been focused on the prevalence of l. monocytogenes from raw meat and their antibiotic resistance from the different parts of the world (dimic et al., 2010; pesavento et al., 2010; indrawattana et al., 2011; osaili et al., 2011; gomez et al., 2014; al-nabusi et al., 2015). however, most of the earlier studies carried out in turkey (akpolat, 2004; yücel et al., 2005; ceylan et al., 2008; erol and ayaz, 2011; dogruer et al., 2015; abay et al., 2017; kocaman and sarimehmetoğlu, 2017; şanlibaba et al., 2018a; şanlibaba et al., 2018b) have been focused on rte foods, dairy products, vegetables, cooked meat, and poultry. the information on the occurrence of listeria spp., particularly l. monocytogenes strains isolated from raw meat and their antimicrobial resistance, is limited. therefore, the primary aim of this study was: i) to determine the incidence of listeria spp., particularly l. monocytogenes, in raw meat samples (chicken meat and red meat) sold in ankara, turkey, ii) to identify the isolated strains by phenotypic and genotypic methods, and iii) to assess resistance in the isolated strains against 34 different antibiotics used for treating listeriosis. 2. materials and methods 2.1. collection of samples a total of 190 raw meat samples were randomly purchased from various supermarkets and butchers in the capital city of turkey over the period of january to april 2018. sampling locations were randomly selected. the samples were collected only once from each place. these samples consisted of: 1) 80 samples of red meat (minced beef, sliced lamb, and meat cubes) and, 2) 110 samples of chicken meat (legs and wings). all of the samples were non-frozen and kept at refrigeration condition in the retail outlets. while chicken samples analyzed were prepackaged including vacuum and normal atmosphere of packaging, red meat samples were non-packaged. all of the samples were checked for expiry dates and transported to the laboratory under aseptic and refrigerated conditions (+4°c) on the sampling day. 2.2. isolation and identification of listeria spp. the two-stage enrichment method, described by the international organization for standardization (en iso, 11290-1), was used for isolation and identification of listeria spp. briefly, 25 g of each sample was aseptically weighed and mixed with 225 ml half strength fraser broth (mercktm, germany) containing selective supplements as the first enrichment culture in a stomacher bag and homogenized in a stomacher (seward 400, usa) for 2 min. the homogenized sample was incubated at 30±1°c for 24±2 h. thereafter, 0.1 ml of preenriched fraser broth was inoculated into 10 ml of full-strength fraser broth containing selective supplements for second enrichment culture and incubated at 37°c for 48±2 h. after the enrichment procedure, a loopful each of the halfand full-strength fraser broths was plated on the chromogenic listeria agar (aloa agar) (mercktm, germany) and polymixin acriflavine lithium chloride ceftazidime aesculin mannitol (palcam) agar (mercktm, germany). the plates were incubated at 37°c for 24–48 h. the light blue colonies surrounded by an opaque halo on aloa agar and gray-green colonies surrounded by ital. j. food sci., vol. 32, 2020 237 diffuse black zone on palcam agar were considered to be of listeria spp. five presumptive colonies were picked up and further purified on tryptic soy agar supplemented with 0.6% of yeast extract (tsa-ye) (sigmatm, germany) as a non-selective medium. subsequently, the pinpoint colonies of tsa-ye were subjected to identification procedures, which included gram’s staining, catalase reactions, oxidase tests, carbohydrate utilization, camp tests with s. aureus and r. equi, and motility at 20-25°c. the isolated listeria species and the reference strains used in this study were inoculated on tryptic soy broth supplemented with 0.6% of yeast extract (tsb-ye) (sigmatm, germany) and brain heart infusion (bhi) broth (mercktm, germany) and incubated at 35°c for 24 h. all of the strains used in this study were stored at –20°c with 30% (v/v) glycerol (mercktm, germany) throughout the study period. the reference strains were obtained from the culture collection of food microbiology laboratory, department of food engineering, ankara university, ankara, turkey. 2.3. molecular identification of listeria spp. and l. monocytogenes the isolates were subjected to polymerase chain reaction (pcr) analysis to confirm their identity as listeria spp. the genomic dna of the strains grown at 35°c overnight in tsbye was extracted using a genomic dna extraction kit (thermo fisher scientifictm), according to the manufacturer’s instructions. the following reference strains were used: l. monocytogenes atcc7644, listeria innocua atcc12612, listeria seeligeri slcc3945, listeria welshimeri atcc35897. the primer pairs designated as u1 (5'– cagcmgccgcggtaatwc–3') and li1 (5'–ctccataaaggtgaccct–3'), amplifying a 938-bp region in the 16s rrna gene sequence of the listeria genus, were used (usman et al., 2016). in order to detect the presence of the hlya gene, an additional pcr was performed, with dg69 (5'–gtgccgccaagaaaaggtta–3') and dg74 (5'cgccacacttgagatat–3') as primers specifically amplifying a 636-bp fragment of the hlya gene (fallah et al., 2013). a standardized pcr protocol was followed for the bacterial lysates, in a final volume of 50 µl reaction mixture containing 5 µl pcr buffer, 1 µl 2 mm dntp mix, 1 µl of each forward and reverse primers, 34.75 µl of sterile distilled water, 0.25 µl of tag dna polymerase, 4 µl of 25 mm mgcl2, and 3 µl of the dna template (blaiotta et al., 2002). the pcr amplification was performed in a programmed thermocycler (techne tc–512, staffordshire, uk). the pcr conditions were as follows: an initial hold of 2 min at 95°c, followed by 35 cycles each of 45 s denaturation at 95°c, 45 s annealing at 55°c and 2 min extension at 72°c, followed by a final extension for 7 min at 72°c and hold at 4°c. the pcr products were electrophoresed on 1% agarose gels and then stained with ethidium bromide solution (0.5 µg/ml). an o’gene rulertm 10000 bp dna molecular weight ladder (fermentastm, finland) was used as a standard. the gels were visualized under uv light using a kodak gel logic 200 imaging system (kodak, usa). amplified pcr fragments were purified by the pcr purification kit (thermo fisher scientifictm) and were sequenced by refgen biotechnology (ankara, turkey). basic local alignment search tool blast) was used to compare the sequences against the nucleotide database in national centre for biotechnology information (ncbi) (www. ncbi.nlm.nih.gov.tr/blast). ital. j. food sci., vol. 32, 2020 238 2.4. antibiotic resistance of l. monocytogenes strains resistance to different antibiotics was determined for all listeria isolates by the disc diffusion method using mueller-hinton agar (mercktm, germany) as the medium, containing 0.5% defibrinated sheep blood, as described by the clinical and laboratory standards institute (clsi) (2011). the selected antibiotics are the ones, commonly used in veterinary and human medicine against listeriosis. the following antibiotic discs were used: penicillin g (10 µg/disc), oxacillin (1 µg/disc), cefotaxime (30 µg/disc), fosfomycin (50 µg/disc), cephalothin (30 µg/disc), furazolidone (50 µg/disc), piperacillin (30 µg/disc), cefuroxime (30 µg/disc), cefoxitin (30 µg/disc), ampicillin (10 µg/disc), amoxicillin/clavulanic acid (20/10 µg/disc), erythromycin (15 µg/disc), clarithromycin (15 µg/disc), tetracycline (30 µg/disc), tigecycline (15 µg/disc), moxifloxacin (5 µg/disc), neomycin (10 µg/disc), ciprofloxacin (5 µg/disc), enrofloxacin (5 µg/disc), levofloxacin (5 µg/disc), nalidixic acid (30 µg/disc), linezolid (30 µg/disc), kanamycin (30 µg/disc), streptomycin (300 µg/disc), gentamicin (120 µg/disc), vancomycin (30 µg/disc), teicoplanin (30 µg/disc), meropenem (10 µg/disc), imipenem (10 µg/disc), clindamycin (2 µg/disc), trimethoprim (5 µg/disc), trimethoprim/sulfamethoxazole (1.25/23.75 µg/disc), chloramphenicol (30 µg/disc), and rifampicin (5 µg/disc). after the incubation at 35°c for 24 h, the diameters of the inhibition zones around each disc were measured. on the basis of the comparative results, the strains were categorized as susceptible, intermediate, or resistant as per the criteria established by clsi (2011). the breakpoints given for staphylococcus species were used to determine the antibiotic resistance profile of l. monocytogenes, as currently there are no resistance criteria given in the clsi guidelines for listeria spp. (wang et al., 2013; khen et al., 2015; du et al., 2017; kuan et al., 2017). e. coli atcc25922, s. aureus atcc6538, and l. monocytogenes atcc7644 were used as quality control strains. 2.5. dendogram construction method the sequences were aligned with the multiple sequence alignment by clustalw and neighbor-joining method was used for phylogenetic tree. 2.6. statistical analysis all statistical analyses were carried out using spss 16 package. the analysis of one-way variance (anova) followed by tukey’s test was applied to determine the differences in the prevalence of listeria spp. between the red meat and chicken samples, and also between the antibiotic resistance of l. monocytogenes strains. the statistical significance was set at p<0.05. 3. results 3.1. occurrence and incidence of listeria spp. and l. monocytogenes a total of 190 samples were examined for the presence of listeria spp. using a two-step selective enrichment method as recommended by en iso 11290-1. the occurrence of listeria spp. and l. monocytogenes in raw meat samples marketed in turkey is presented in table 1. listeria spp. was detected in 57 (30.00%) of the samples. the 16s rrna sequence ital. j. food sci., vol. 32, 2020 239 analysis indicated l. monocytogenes (12.10%; 23/190) to be the most prevalent in the raw meat samples, followed by l. innocua (11.05%; 21/190), l. welshimeri (6.31%; 12/190), and l. seeligeri (0.52%; 1/190). using neighbour joining method, phylogenetic relationships of 57 listeria spp. were allowed to group into two main clusters. cluster 1 was composed of 1 isolate. fifty-six isolates were belonged to cluster 2 (fig. 1). in addition, l. monocytogenes strains were also screened for the virulence-associated hlya gene. among the 23 l. monocytogenes strains, only 20 (86.96%) were positive for the presence of the hlya gene. lp6, lp16, and lp54 strains of l. monocytogenes, isolated from raw chicken samples, were identified as atypical strains since they were devoid of the hlya gene. the prevalence of listeria spp. in the raw chicken meat samples was as follows: 14.54% (16/110) for l. monocytogenes, 11.81% (13/110) for l. innocua, 6.36% (7/110) for l. welshimeri, and 0.90% (1/110) for l. seeligeri. on the other hand, the prevalence in the raw red meat samples was as follows: 10.00% (8/80) for l. innocua, 8.75% (7/80) for l. monocytogenes, and 6.25% (5/80) for l. welshimeri. the samples of raw chicken had the highest occurrence of listeria spp. (33.63%, 37/190), followed by red meat (25.00%, 20/190). in the prevalence of l. monocytogenes was significantly higher (p<0.05) in the raw chicken meat than that in the raw red meat. table 1. prevalence of listeria species in raw meat samples. food samples number of samples (n) number of positive samples n (%) listeria spp. l. monocytogenes l. innocua l. welshimeri l. seeligeri raw red meat 80 20 (25.00) 7 (8.75) 8 (10.00) 5 (6.25) 0 ( – )a raw chicken meat 110 37 (33.63) 16 (14.54) 13 (11.81) 7 (6.36) 1 (0.90) totals 190 57 (30.00) 23 (12.10) 21 (11.05) 12 (6.31) 1 (0.52) a not detected. 3.2. antibiotic resistance of l. monocytogenes strains the antimicrobial resistance of the 23 l. monocytogenes strains against 34 different antibiotics was examined using the disk diffusion method according to clsi (2011) (table 2). of the l. monocytogenes isolates, 23 were resistant to ampicillin, fosfomycin, nalidixic acid, linezolid, and clindamycin. frequent resistance was seen against piperacillin (86.96%, 20/23), oxacillin (82.61%, 19/23), kanamycin (82.61%, 19/23), neomycin (78.26%, 18/23), penicillin g (73.92%, 17/23), amoxicillin/clavulanic acid (73.92%, 17/23), levofloxacin (73.92%, 17/23), teicoplanin (73.92%, 17/23), moxifloxacin (69.57%, 16/23), ciprofloxacin (69.57%, 16/23), and furazolidone (52.17%, 12/23). furthermore, resistance to enrofloxacin (47.83%, 11/23), rifampicin (17.39%, 4/23), streptomycin (17.39%, 4/23), tigecycline (13.04%, 3/23), cefuroxime (13.04%, 3/23), cephalothin (13.04%, 3/23), trimethoprim/sulfamethoxazole (13.04%, 3/23), and cefotaxime (8.69%, 2/23) was also observed. at least one strain was resistant against either of tetracycline, gentamicin, and meropenem (4.35%). in contrast, all strains were susceptible to cefoxitin, erythromycin, clarithromycin, vancomycin, imipenem, trimethoprim, and chloramphenicol. the differences between the antibiotic resistance of l. monocytogenes strains were not found to be statistical significance (p > 0.05). ital. j. food sci., vol. 32, 2020 240 figure 1. dendrogram showing the evolutionary relationships among listeria isolates based on the 16s rrna sequence analysis. ital. j. food sci., vol. 32, 2020 241 table 2. antibiotic susceptibility and resistance (%) of l. monocytogenes strains isolated from raw red meat and chicken meat samples. antimicrobial agenta l. monocytogenes strains totals (n:23) raw red meat (n: 7) raw chicken meat (n:16) sb ib rb sb ib rb sb ib rb n % n % n % n % n % n % n % n % n % penicillins penicillin g -c 2 28.57 5 71.43 2 12.50 2 12.50 12 75.00 2 8.69 4 17.39 17 73.92 oxacillin 1 14.29 6 85.71 3 18.75 13 81.25 4 17.39 19 82.61 ampicillin 7 100.00 16 100.00 23 100.00 amoxicillin/clavulanic acid 1 14.29 2 28.57 4 57.14 2 12.50 1 6.25 13 81.25 3 13.04 3 13.04 17 73.92 piperacillin 2 28.57 5 71.43 1 6.25 15 93.75 3 13.04 20 86.96 cephalosporins cephalothin 4 57.14 1 14.29 2 28.57 15 93.75 1 6.25 19 82.61 1 4.35 3 13.04 cefotaxime 5 71.43 2 28.57 13 81.25 1 6.25 2 12.50 18 78.27 2 13.04 2 8.69 cefuroxime 6 85.71 1 14.29 14 87.50 2 12.50 20 86.96 3 13.04 cefoxitin 7 100.00 16 100.00 23 100.00 macrolides erythromycin 6 85.71 1 14.29 10 62.50 6 37.50 16 69.57 7 30.43 clarithromycin 5 71.43 2 28.57 14 87.50 2 12.50 19 82.61 4 17.39 tetracyclines tetracycline 5 71.43 1 14.29 1 14.29 14 87.50 2 12.50 19 82.61 3 13.04 1 4.35 tigecycline 6 85.71 1 14.29 14 87.50 2 12.50 20 86.96 3 13.04 quinolones ciprofloxacin 2 28.57 5 71.43 2 12.50 3 18.75 11 68.75 2 8.69 5 21.74 16 69.57 levofloxacin 1 14.29 2 28.57 4 57.14 1 6.25 2 12.50 13 81.25 2 8.69 4 17.39 17 73.92 nalidixic acid 7 100.00 16 100.00 23 100.00 moxifloxacin 3 42.86 4 57.14 4 25.00 12 75.00 4 17.39 3 13.04 16 69.57 enrofloxacin 4 57.14 2 28.57 1 14.29 3 18.75 3 18.75 10 62.50 7 30.43 5 21.74 11 47.83 monurol fosfomycin 7 100.00 16 100.00 23 100.00 a the diameters of the zones were compared with the diameters of the clinic laboratory standards institute (clsi 2011). bs : susceptible, i : intermediately resistant, r : resistant. cnot detected. ital. j. food sci., vol. 32, 2020 242 table 2. antibiotic susceptibility and resistance (%) of l. monocytogenes strains isolated from raw red meat and chicken meat samples (continued). antimicrobial agenta l. monocytogenes strains totals (n:23) raw red meat (n: 7) raw chicken meat (n:16) sb ib rb sb ib rb sb ib rb n % n % n % n % n % n % n % n % n % oxazolidinones linezolid 7 100.00 16 100.00 23 100.00 aminoglycosides kanamycin 1 14.29 6 85.71 3 18.75 13 81.25 4 17.39 19 82.61 streptomycin 4 57.14 2 28.57 1 14.29 12 75.00 1 6.25 3 18.75 16 69.57 3 13.04 4 17.39 gentamicin 5 71.43 2 28.57 10 62.50 5 31.25 1 6.25 15 65.22 7 30.43 1 4.35 neomycin 1 14.29 6 85.71 4 25.00 12 75.00 5 21.74 18 78.26 glycopeptides vancomycin 7 100.00 16 100.00 23 100.00 teicoplanin 2 28.57 5 71.43 4 25.00 12 75.00 6 26.08 17 73.92 carbapenems meropenem 5 71.43 1 14.29 1 14.29 11 68.75 5 31.25 16 69.57 6 26.08 1 4.35 imipenem 7 100.00 15 93.75 1 6.25 22 95.65 1 4.35 lincosamides clindamycin 7 100.00 16 100.00 23 100.00 sulfonamides/trimethoprim trimethoprim 4 57.14 3 42.86 14 87.50 2 12.50 18 78.26 5 21.74 trimethoprim/sulfamethoxazole 5 71.43 1 14.29 1 14.29 10 62.50 4 25.00 2 12.50 15 65.22 5 21.74 3 13.04 amphenicol chloramphenicol 7 100.00 16 100.00 23 100.00 rifamycins rifampicin 2 28.57 3 42.86 2 28.57 9 56.25 5 31.25 2 12.50 11 47.83 8 34.78 4 17.39 nitrofurans furazolidone 2 28.57 5 71.43 8 50.00 1 6.25 7 43.75 10 43.48 1 4.35 12 52.17 the diameters of the zones were compared with the diameters of the clinic laboratory standards institute (clsi 2011). bs : susceptible, i : intermediately resistant, r : resistant. cnot detected. ital. j. food sci., vol. 32, 2020 243 multi-drug resistance, i.e., resistance to three or more antimicrobial agents, was observed in 73.91% (17/23) l. monocytogenes strains. while 69.56% (16/23) of the l. monocytogenes strains were resistant to four antibiotics, and 60.86% (14/23) of the isolates were resistant to five antibiotics. on the whole, 13 of 23 (56.52%) l. monocytogenes strains showed resistance to more than six antibiotics. 4. discussion 4.1. prevalence of listeria spp. and l. monocytogenes from raw meat samples as a result of its psychotropic nature, l. monocytogenes is of great concern to the meat industry. l. monocytogenes contamination can occur in raw meat during processing and storage (abay et al., 2017). this initial contamination can spread, propagate, and increase during further processing of meat (yang et al., 2017). normally, only cooked meat is eaten, thus the existence of l. monocytogenes in raw meat could be problematic only if the meat is eaten raw or insufficiently cooked. we should not underestimate the risk of listeriosis in this type of food. there is no criterion for routine microbiological testing of raw meat for the presence of l. monocytogenes in turkey (anon., 2019b). among the 190 samples tested, 57 were positive for listeria spp. and the isolation rate of l. monocytogenes from raw meat samples (12.10%) was higher than our expectations. the presence of l. monocytogenes in raw meat may be attributed to: i) fecal contamination during evisceration, ii) food handlers, and iii) cross-contamination during processing, transportation or marketing (al-nabusi et al., 2015; gomez et al., 2015). this study was also aimed to detect the presence of the hlya gene in l. monocytogenes strains. this gene is one of the most virulent factors associated with l. monocytogenes and essential for intracellular infection (moreno et al., 2014; usman et al., 2016). it was interesting to note that this virulence gene was detected in 86.96% of the l. monocytogenes strains isolated from the raw chicken samples and the rest 13.04% were devoid of it. these strains were named as atypical strains. the presence of this gene in the pathogens thriving on meat suggests a serious risk to human health (zeinali et al., 2015). to the best of our knowledge, this is the first report on the isolation of atypical l. monocytogenes strains, devoid of the hlya gene from foods in turkey. our results are consistent with those reported by kaur et al. (2007), osaili et al. (2011), moreno et al. (2014), usman et al. (2016) and zeinali et al. (2015), who identified some atypical l. monocytogenes strains from food. the hlya gene has an important role in the invasion process of l. monocytogenes (zeinali et al. 2015). the occurrence of some mutations alternating the genes responsible for pathogenesis may be the reason of the absence of hlya. this may explain why some species do not cause infections. further studies are needed to determine the presence of other virulence genes in these strains. the overall incidence of listeria spp. in all raw meat samples was 30%, which is higher than that reported in italy (21.4%) (pesavento et al., 2010), but lower than that documented in japan (58.7%) (indrawattana et al., 2011), iran (34.7%) (fallah et al., 2012), canada (70%) (al-nabusi et al., 2015), and nigeria (80%) (oyelami et al., 2018). our study showed that the overall incidence of l. monocytogenes in raw meat was 12.10%. the prevalence of l. monocytogenes was higher in raw chicken meat (14.54%) than raw red meat (8.75%). the rate of l. monocytogenes contamination in raw meat, from different parts of the world, was found to be 23.3% in morocco (ennaji et al., 2008), 15.4% in japan (indrawattana et al., 2011), 18.2% in jordan (osaili et al., 2011), 14.1% in ital. j. food sci., vol. 32, 2020 244 iran (fallah et al., 2012), 12% in china (wang et al., 2013), 43.8% in canada (alnabusi et al., 2015), and 28% in nigeria (oyelami et al., 2018). these differences suggest that l. monocytogenes contamination rates may be affected by geographical location, weather conditions, environmental conditions, the actions of food handlers, monitoring studies and isolation methods. in previous studies carried out in turkey (akpolat, 2004; yücel et al., 2005; ceylan et al., 2008; erol and ayaz, 2011; dogruer et al., 2015; kocaman and sarimehmetoğlu, 2017), the contamination rate of l. monocytogenes in raw meat samples was found between 4.7% and 32.76%, which is partially consistent with our study. related to these past results, we observed no increase in the incidence of l. monocytogenes in raw meats from turkey. the reason for this consistency in the incidence of l. monocytogenes in raw meats may be the compliance with the good manufacturing practices (gmps), and hazard analysis and critical control point (haccp) systems. 4.2. antibiotic resistance in l. monocytogenes strains earlier, l. monocytogenes was considered to be susceptible to a wide range of antibiotics (lungu et al., 2011; alonso-hernando et al., 2012). however, there has been an increasing number of reports about l. monocytogenes strains resistant to one or more antibiotics from food, clinical, and environmental products since 1988 (gomez et al., 2014; wang et al., 2015). many strains of l. monocytogenes have been reported to be completely or partly resistant to fluoroquinolones, cephalosporins, aztreonam, pipemidic acid, fosfomycin, and macrolides, and other antibiotics, especially those of the third and fourth generations (ruiz-bolivar et al., 2011; wang et al., 2013; gomez et al., 2014; bryne et al., 2016). in the current study, the antimicrobial resistance tests of l. monocytogenes strains revealed that all of the l. monocytogenes strains were resistant to nalidixic acid, fosfomycin, ampicillin, linezolid, and clindamycin. we observed that 69.57%, 73.92%, 69.57% and 47.83 of l. monocytogenes strains were resistant to ciprofloxacin, levofloxacin, moxifloxacin, and enrofloxacin, respectively, which belong to the fluoroquinolones class of antibiotics. these high rates of resistance against fluoroquinolones could be ascribed to the frequent use of these antibiotics in animal feeds to treat infections (fallah et al., 2012; wang et al., 2015). however, unexpectedly our isolates of l. monocytogenes showed low resistance to cephalothin (13.04%), cefuroxime (13.04%), and cefotaxime (8.69%), and all of them were susceptible to cefoxitin (100%). the members of penicillin group antibiotics include ampicillin, oxacillin, penicillin g, amoxicillin, and piperacillin. they are the most active β-lactam compounds that inhibit the synthesis of bacterial cell wall peptidoglycan (etabu and arikekpar, 2016). l. monocytogenes is naturally susceptible to β-lactams (lungu et al., 2011; byrne et al., 2016). clinicians usually treat human listeriosis with the standard antibiotic therapy that includes high doses of penicillin, ampicillin, and amoxicillin alone or combined with gentamicin (korsak et al., 2012; gomez et al., 2014; shi et al., 2015; olaimat et al., 2018). in the present study, l. monocytogenes strains showed high resistance to ampicillin (100%), piperacillin (86.96%), oxacillin (82.61%), penicillin g (73.92%), and amoxicillin/clavulanic acid (73.92%). this finding is highly significant as far as the treatment of human listeriosis is concerned. however, our results were not similar to the previous studies conducted in turkey (terzi et al., 2015; kocaman and sarimehmetoğlu, 2017), which reported low resistance to these antibiotics. thus our observations are of great medical concern. trimethoprim alone or combined with ital. j. food sci., vol. 32, 2020 245 sulfamethoxazole is generally used in the case of allergy to beta-lactams and rifampin, erythromycin, vancomycin, linezolid, and meropenem can also be used as possible alternatives (al-nabusi et al., 2015; şanlibaba et al. 2018a). it is worth noting that our results showed that resistance to trimethoprim/sulfamethoxazole (13.04%) and meropenem (4.35%) was found to be low in this study. in addition, resistance to trimethoprim was not observed in this study, in line with wang et al. (2015), obaidat et al. (2015), and kuan et al. (2017). clindamycin interferes with bacterial protein synthesis in a similar way to erythromycin and chloramphenicol (shi et al., 2015). therefore, owing to the similar mode of action, a cross-resistance among clindamycin, erythromycin, and chloramphenicol can sometimes be detected (ruiz-bolivar et al., 2011; moreno et al., 2014). in this study, no resistance to chloramphenicol and erythromycin was observed; this concords with the findings of yücel et al. (2005), ennaji et al. (2008), and chen et al. (2010). in contrast, resistance to clindamycin was 100%. this, to the best of our knowledge, seems to be the first report from turkey showing the cross-resistance of these antibiotics. these results also concord with the theory of a specific enzyme that inactivates clindamycin, as previously reported for staphylococcus spp. (ruiz-bolivar et al., 2011; moreno et al., 2014). rifampin is the main antibiotic used in the treatment against mycobacterium tuberculosis and gram-positive bacteria (ruiz-bolivar et al., 2011). it has also been recommended to treat listeriosis (olaimat et al., 2018). fortunately, the resistance rate (17.39%), found in our work, does not seem to be alarming and is in agreement with fallah et al. (2013). vancomycin is one of the last therapeutic options for the treatment of human listeriosis especially in case of bacteremia and endocarditis (obaidat et al., 2015). fortunately, all l. monocytogenes strains were found susceptible to the vancomycin in accordance with the results of rahimi et al. (2010), okada et al. (2011), wang et al. (2015), al-nabusi et al. (2015), and bryne et al. (2016). the resistance of the isolates against vancomycin is a contrary finding to that obtained by ieren et al. (2013) and fallah et al. (2013). tetracycline and tigecycline are the members of tetracyclines, whose target of antimicrobial activity in bacteria is the ribosome (etebu and arikekpar, 2016). tetracycline resistance has most frequently been reported in listeria spp. of different origins (pesavento et al., 2010; fallah et al., 2012; korsak et al., 2012). this might have arisen due to the extensive and prolonged use of these antimicrobials in human medicine and as growth promoters in animals (bryne et al., 2016). in contrast, these results could not be confirmed by us, because only one and two of the examined l. monocytogenes strains were resistant to tetracycline and tigecycline, respectively. the rare occurrence of resistance to tetracycline (4.35%) and tigecycline (13.04%) is in accordance with rahimi et al. (2010), al-nabusi et al. (2015), and noll et al. (2018). tetracyclines are not used as the first drug of choice for listeriosis treatment and their use is also not recommended in children and pregnant women (ruiz-bolivar et al., 2011). while l. monocytogenes strains showed resistance to kanamycin (82.61%) and neomycin (78.26%), low resistance to streptomycin (17.39%) and gentamicin (4.35%) was also observed. the high frequency of resistance to kanamycin and neomycin was unexpected and might be in part due to the excessive use of these antibiotics in veterinary medicine in turkey. these results are in agreement with alonso-hernando et al. (2012) and shi et al. (2015). however, some authors have reported high sensitivity of l. monocytogenes to kanamycin (okada et al., 2011; wang et al., 2013; jamali et al., 2015; wu et al., 2015). in the present study, there was no significant association between the different l. monocytogenes strains in terms of antibiotic resistance (p< 0.05). ital. j. food sci., vol. 32, 2020 246 the prevalence of multidrug resistance l. monocytogenes strains isolated from raw meat was 73.91% (data not shown). the multi-resistance patterns reported in other countries are as follows: 16.4% in iran (rahimi et al., 2010), 48% in colombia (ruiz-bolivar et al., 2011), 64.3% in nigeria (ieren et al., 2013), 2.9% in spain (gomez et al., 2014), 21.25% in china (shi et al., 2015), 21% in germany (noll et al., 2018), and 81% in malaysia (kuan et al., 2017). these differences among multidrug resistance in l. monocytogenes strains could result from the differences in the use of antimicrobials at the regional level. the result of our study suggested that the overall incidence of antibiotic resistance in l. monocytogenes is alarming. further, the high resistance rate observed against antibiotics commonly used to treat listeriosis, such as penicillin, oxacillin, ampicillin, piperacillin, and amoxicillin/clavulanic acid, is also a great concern. 5. conclusions our results regarding the occurrence of l. monocytogenes in raw meat and the presence of virulence-associated genes in the strains indicate an alarming situation to the public health. the counts of l. monocytogenes in raw meat at the retail level are crucial for contaminating with cooked foods. retail centers must be controlled legally monitored. this study is the first report of hlya negative l. monocytogenes strains isolated from food in turkey. in this study, we have demonstrated that all l. monocytogenes strains were resistant to ampicillin, fosfomycin, nalidixic acid, linezolid, and clindamycin against gram-positive bacteria. the controlled use of antibiotics for therapeutic purposes may be important to limit the emergence of resistant l. monocytogenes strains in the world. acknowledgments this work was supported by the ankara university scientific research projects coordination unit (project number 15b0443010). references abay s., irkin r., aydin f., müştak h.k., and diker, k.s. 2017. the prevalence of major foodborne pathogens in readyto-eat chicken meat samples sold in retail markets in turkey and the molecular characterization of the recovered isolates. lwt-food sci. technol., 81:202-209. doi: dx.doi.org/10.1016/j.lwt.2017.03.052 akpolat n.ö., elci s., atmaca s., and gül k. 2004. listeria monocytogenes in products of animal origin in turkey. vet. res. commun., 28:561-567. almeida g., magalhaes r., carneiro l., santos i., silva j., ferreira v., hoqqi t., and teixeira p. 2013. foci of contamination of listeria monocytogenes in different cheese processing plants. int. j. food microbiol., 167:303-309. doi: dx.doi.org/10.1016/ j.ijfoodmicro. 2013.09.006 al-nabusi a., osaili t.m., awad a.a., olaimat a.n., shaker r.r., and holley r.a. 2015. occurrence and antibiotic susceptibility of listeria monocytogenes isolated from raw and processed meat products in amman, jordan. cyta-j. food, 13(3):346-352. doi: dx.doi. org/10.1080/19476337.2014.982191 alonso-hernando a., prieto m., garcia-fernandez c., alonso-calleja c., and capita, r. 2012. increase over time in the prevalence of multiple antibiotic resistance among isolates of listeria monocytogenes from poultry in spain. food control, 23:37-41. doi: dx.doi.org/10.1016/jfoodcont.2011.06.006 anonymous. 2019a. https://ec.europa.eu/health/amr/antimicrobial-resistance_en access date: 08.03.2019. ital. j. food sci., vol. 32, 2020 247 anonymous. 2019b. www.resmigazete.gov.tr/eskiler/2006/07/20060707-11.htm access date: 15/03/2019. blaiotta g., pepe o., mauriello g., villani f., andolfi r., and moschetti, g. 2002. 16s-23s rdna intergenic spacer region polymorphism of lactococcus gavriae, lactococcus raffinolactis and lactococcus lactis as revealed by pcr and nucleotide sequence analysis system. syst. applied microbiol., 25(4):520-527. doi: dx.doi.org/10.1078/ 07232020260517652 bryne v.v., hofer e., vallim d.c., and almeida, r.c.c. 2016. occurrence and antimicrobial resistance patterns of listeria monocytogenes isolated from vegetables. brazilian j. microbiol., 47:438-443. doi: dx.doi.org/10.1016/j.bjm.2015.11.033 ceylan z.g., demirkaya a.k., and adıgüzel, g. 2008. the incidence of listeria monocytogenes in retail chicken meat and establishing relationship with some bacteria by logistic regression. j. food qual., 31:121-130. chen b.y., pyla r., kim t.j., silva j.l., and jung y.s. 2010. antibiotic resistance in listeria species isolated from catfish fillets and processing environment. lett. appl. microbiol., 50:626-632. doi: dx.doi.org/10.1111/j.1472-765x.2010.02843.x clsi. 2011. performance standards for antimicrobial susceptibility testing: twenty-first informational supplement. clinical and laboratory standards institute, m100-s21. wayne, pa, usa, 2011. conter m., paludi d., zanardi e., ghidini s., vergara a., and ianieri, a. 2009. characterization of antimicrobial resistance of foodborne listeria monocytogenes. int. j. food microbiol., 128:497-500. doi: dx.doi.org/10.1016/j.ijfoodmicro.2008.10.018 coroneo v., carraro v., aissani n., sanna a., ruggeri a., succa s., meloni b., and sanna c. 2016. detection of virulence genes and growth potential in listeria monocytogenes strains isolated from ricotta salata cheese. j. food sci., 81(1):114120. doi: dx.doi.org/10.1111/1750-3841.13173 dimic g.r., kocic-tanackov s.d., jovanov o.o., cvetkovic d.d., markov s.l., and velicanski a.s. 2010. presence of listeria species in fresh meats from retail markets in serbia. acta periodica technologica, 41:1-6. doi: dx.doi.org/10.2298/apt1041001d dogruer y., telli n., telli a.e., and güner, a. 2015. presence and antibiotic susceptibility of listeria monocytogenes in retail meat and meat products. int. j. biol. res., 3(2):76-81. doi: dx.doi.org/10.14419/ijbr.v3i2.5323 doyle m.e., mazzotta s.m., wang t., wiseman d.w., and scott v. 2001. heat resistance of listeria monocytogenes. j. food prot., 64 (3):410-429. du x.j.x., zhang x., wang x.-y., su y.-i., li p., and wang s. 2017. isolation and characterization of listeria monocytogenes in chinese food obtained from the central area of china. food control, 74:9-16. doi: dx.doi.org/10.1016j.foodcont.2016.11.024 ennaji h., timinouni m., ennaji m.m., hassar m., and cohen n. 2008. characterization and antibiotic susceptibility of listeria monocytogenes isolated from poultry and red meat in morocco. infect. drug resist., 1; 45-50. erol i., and ayaz n.d. 2010. serotype distribution of listeria monocytogenes isolated from turkey meat by multiplex pcr in turkey. j. food saf., 31:149-153. doi: dx.doi.org/ 10.1111/j.1745-4565-2010.00278.x etabu e., and arikekpar i. 2016. antibiotics: classification and mechanisms of action with emphasis on molecular perspectives. int. j. appl. microbiol. biotechnol. res, 4:90-101. fallah a.a., saei-dehkordi s.s., rahnama m., tahmasby h., and mahzounieh, m. 2012. prevalence and antimicrobial resistance patterns of listeria species isolated from poultry products marketed in iran. food control, 28:327-332. doi: dx.doi.org/ 10.1016/j.foodcont.2012.05.014 fallah a.a., saei-dehkordi s.s., and mahzounieh, m. 2013. occurrence and antibiotic resistance profiles of listeria monocytogenes isolated from seafood products and market and processing environments in iran. food control, 34:630636. doi: dx.doi.org/ 10.1016/j.foodcont.2013.06.015 gomez d., azon e., marco n., carraminana j.j., rota c., arino a., and yangüela j. 2014. antimicrobial resistance of listeria monocytogenes and listeria innocua from meat products and meat-processing environment. food microbiol., 42:6165. doi: dx.doi.org/ 10.1016/j.fm.2014.02.017 gomez d., iguacel l.p., rota m.c., carraminana j.j., arino a., and yangüela j. 2015. occurrence of listeria monocytogenes in ready-to-meat products and meat processing plants in spain. foods, 4:271-282. doi: dx.doi.org/10.3390/foods4030371 ital. j. food sci., vol. 32, 2020 248 ieren i.i., bello m., and kwaga j.k.p. 2013. occurrence and antibiotic resistance profile of listeria monocytogenes in salad vegetables and vegetable salads sold in zaria, nigeria. afr. j. food sci., 7 (9):334-338. doi: dx.doi.org/10.5897/ajfs2013.1036 indrawattana n., nibaddhasobon t., sookrung n., chonsanquan m., tungtrongchitr a., makino s., tunyong w., and chaicumpa w. 2011. prevalence of listeria monocytogenes in raw meats marketed in bankok and characterization of the isolates by phenotypic and molecular methods. j. health popul. nutr., 29 (1):26-38. jamali h., paydar m., ismail s., looi c.y., wonq w.f., radmehr b., and abedini a. 2015. prevalence, antimicrobial susceptibility and virulotyping of listeria species and listeria monocytogenes isolated from open-air fish markets. bmc microbiol., 25:144. doi: dx.doi.org/10.1186/s12866-015-0476-7 kaur s., mailk s.v.s. vaidya v.m., and barbuddhe s.b. 2007. listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex pcr. j. appl. microbiol., 103:1889-1896. khen b.k., lynch o.a., carroll j., mcdowell d.a., and duffy g. 2015. occurrence, antibiotic resistance and molecular characterization of listeria monocytogenes in the beef chain in the republic of ireland. zoonoses public health, 62:11-17. doi: dx.doi.org/ 10.1111/zph.12106 kocaman n., and sarımehmetoğlu b. 2017. isolation of listeria monocytogenes in lamb meat and determination of the antibiotic resistance. ankara üniv. vet. fak. derg., 64:273-279. korsak d., borek a., daniluk s., grabowska a., and pappelbaum k. 2012. antimicrobial susceptibility of listeria monocytogenes strains isolated from food and food processing environment in poland. int. j. food microbiol., 158:203-208. doi: dx.doi.org/ 10.1016/ j.ijfoodmicro.2012.07.016 kovacevic j., mcintyre l.f., henderson s.b., and kosatsky t. 2012. occurrence and distribution of listeria species in facilities producing ready-to-eat foods in british columbia, canada. j. food prot., 75(2):216-224. doi: dx.doi.org/10.4315/0362-028x.jfp-11-300 kuan c.h., rukayadi y., ahmad s.h., wan mohamed radzi c.w. j., kuan c,s., yeo s.k., thung t.y., new c.y., chang w.s., loo y.y., tan c.w., ramzi o.s.b., mohd fadzil s.n., nordin y., kwan s.y., and son r. 2017. antimicrobial resistance of listeria monocytogenes and salmonella enteritidis isolated from vegetable farms and retail markets in malaysia. int. food res. j., 4(4):1831-1839. kurpas m., wieczorek k., and osek j. 2018. ready-to-eat meat products as a source of listeria monocytogenes. j. vet. sci., 61:49-55. doi: dx.doi.org/10.2478/jvetres-2018-0007 lambertz s.t., nilsson c., bradenmark a., sylven s., and johansson a. 2012. prevalence and level of listeria monocytogenes in ready-to-eat foods in sweden 2010. int. j. food microbiol., 160:24-31. doi: dx.doi.org/10.1016/j.ijfoodmicro.2012.09.010 lungu b., o’bryan c.a., muthaiyan a., milillo s.r., johnson m.g., crandall p.g., and ricke s.c. 2011. listeria monocytogenes: antibiotic resistance in food production. foodborne pathog. dis., 8 (5):569-578. doi: dx.doi.org/10.1089/fpd.2010.0718 mohamed y., reda w.w., abdel-moein k., abd el-razik k.a., barakat a.m.a., el fadaly h.a., hassanain n.a., and hegazi a.g. 2016. prevalence and phylogenetic characterization of listeria monocytogenes isolated from processed meat marketed in egypt. j. genet. eng. biotechnol., 14:119-123. doi: dx.doi.org/ 10.1016/ j.jgeb.2016.06.001 moreno l.z., paixao r., de gobbi d.d.s., raimundo d.c., porfida ferraira t.s., micke moreno a., hofer e., dos resi c.m., matte g.r., and matte m.h. 2014. phenotypic and genotypic characterization of atypical listeria monocytogenes and listeria innocua isolated from swine slaughterhouses and meat markets. biomed res. int., article id 742032, 12 pages. doi: dx.doi.org/10.1155/2014/742032 natratilova p., schlegelova j., sustackova a., napravnikova e., lukasova j., and klimova e. 2004. prevalence of listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. vet. med. j., 49:234-252. nayak d.n., savalia c.v., kalyani i.h., kumar r., and kshirsagar d.p. 2015. isolation, identification, and characterization of listeria spp. from various animal origin foods. vet. world, 8 (6):695-701. doi: dx.doi.org/10.14202/vetworld.2015.695-701 ncbi. 2019. national centers for biotechnology information. taxonomy browser. www.ncbi.nlm.nih.gov/taxonomy/ browser/wwwtax.cgi?id=1637. access date: 07/03/2019 ital. j. food sci., vol. 32, 2020 249 noll m., kleta s., and dahouk, s.a. 2018. antibiotic susceptibility of 259 listeria monocytogenes strains isolated from food, food-processing plants and human samples in germany. j. infect. public health, 11:572-577. doi: dx.doi.org/10.1016/j.jiph. 2017.12.007 obaidat m.m., salman a.e.b., lafi s.q., and al-abboodi a.r. 2015. characterization of listeria monocytogenes from three countries and antibiotic resistance differences among countries and listeria monocytogenes serogroups. lett. appl. microbiol., 60:609-614. doi: dx.doi.org/10.1111/lam.12420 okada y., okutani a., asakura h., monden s., nakama a., maruyama t., and iqimi s. 2011. antimicrobial susceptibilities of listeria monocytogenes isolated in japan. j. vet. med. sci.,73(12):1681-1684. doi: dx.doi.org/10.1292/jvms.11-0051 olaimat a.n., al-holy m.a., shahbaz h.m., al-nabusi a.a., ghoush m.h.a., osaili t.m., ayyash m.m., and holley r.a. 2018. emergence of antibiotic resistance in listeria monocytogenes isolated from food products: a comprehensive review. compr. rev. food sci. food saf., 17:1277-1292 doi: dx.doi.org/10.1111/1541-4337.12387 osaili t.m., alaboudi a.r., and nesiar e.a. 2011. prevalence of listeria spp. and antibiotic susceptibility of listeria monocytogenes isolated from raw chicken and ready-to-eat chicken products in jordan. food control, 22:586-590. doi: dx.doi.org/ 10.1016/j.foodcont.2010.10.008 oyelami l.a., aboaba o.o., and banjo o.a. 2018. prevalence and antibiotics susceptibility profile of listeria monocytogenes isolated from processed and unprocessed meat products. fulafia j. sci. technol., 4 (1):55-61. pesavento g., ducci b., nieri d., comodo n., and lo nostro, a. 2010. prevalence and antibiotic susceptibility of listeria spp. isolated from raw meat and retail foods. food control, 21:708-713. doi: dx.doi.org/10.1016/j.foodcont.2009.10.012 rahimi e., ameri, m.h., and momtaz h. 2010. prevalence and antimicrobial resistance of listeria species isolated from milk and dairy products in iran. food control, 21:1448-1452. doi: dx.doi.org/10.1016/j.foodcont.2010.03.014 ruiz-bolivar z., neuque-ricco m.c., poutou-pinales r.a., carrascal-camacho a.k., and mattar s. 2011. antimicrobial susceptibility of listeria monocytogenes food isolates from different cities in colombia. foodborne pathog. dis., 8(8):913919. doi: dx.doi.org/ 10.1089/fpd.2010.0813 şanlıbaba p., tezel b.u., and çakmak g.a. 2018a. prevalence and antibiotic resistance of listeria monocytogenes isolated from ready-to-eat foods in turkey. hindawi journal of food quality, article id 7693782, 9 pages. doi: dx.doi.org/10.1155/2018/7693782 şanlıbaba p., tezel b.u. and çakmak g.a. 2018b. detection of listeria spp. in raw milk and dairy products retailed in ankara. the journal of food, 43 (2):273-282, doi: dx.doi.org/10.15237/gida.gd17107 shi w., qingping w., jumei z., moutong c., and zean y. 2015. prevalence, antibiotic resistance and genetic diversity of listeria monocytogenes isolated from retail ready-to-eat foods in china. food control, 47:340-347. doi: dx.doi.org/10.1016/j.foodcont.2014.07.028 terzi g., gücüklüoğlu a., çadırcı ö., uyanık t., and alişarlı m. 2015. serotyping and antibiotic susceptibility of listeria monocytogenes isolated from ready-to-eat foods in samsun, turkey. turk. j. vet. anim. sci., 39:211-217. doi: dx.doi.org/10.3906/vet-1407-15 usman u.b., kwaga j.k.p., kabir j., and olonitola o.s. 2016. isolation and antimicrobial susceptibility of listeria monocytogenes from raw milk and milk products in northern kaduna state, nigeria. j. appl. environ. microbiol., 4(3):46-54, doi: dx.doi.org/ 10.12691/jaem-4-3-1 wang x.m., lü x.f., liu h.f., zhang w.j., si w., yu s.y., shao m.l., and liu s.g. 2013. occurrence and antimicrobial susceptibility of listeria monocytogenes isolates from retail raw foods. food control, 32:153-158. doi: dx.doi.org/10.106/j.foodcont.2012.11.032 wang g., qijan w., zhang x., wang h., ye k., bai y., and zhou g. 2015. prevalence, genetic diversity and antimicrobial resistance of listeria monocytogenes isolated from ready-to-eat meat products in nanjing, china. food control, 50:202-208. doi: dx.doi.org/10.1016/j.foodcont.2014.07.057 wu s., wu q., zhang j., chen m., yan z., and hu h. 2015. listeria monocytogenes prevalence and characteristics in retail raw foods in china. plos one, 10 (8):e0136682. doi: dx.doi.org/10.1371/journal.pone.0136682 yang d., wu x., yu x., he l., shah n.p., and xu f. 2017. mutual growth-promoting effect between bifidobacterium bifidum wbbi03 and listeria monocytogenes cmcc 54001. j. dairy sci., 100 (5):3448-3462. doi: dx.doi.org/10.3168/jds.2016-11804 ital. j. food sci., vol. 32, 2020 250 yücel n., çıtak s., and önder m. 2005. prevalence and antibiotic resistance of listeria species in meat products in ankara, turkey. food microbiol., 22:241-245. doi: dx.doi.org/10.1016/j.fm.2004.03.007 zeinali t., jamshidi a., bassami m., rad m. 2015. serogroup identification and virulence gene characterization of listeria monocytogenes isolated from chicken carcasses. iran j. vet. sci.technol., 7 (2):9-19. paper received june 10, 2019 accepted november 19, 2019 ijfs#1805_bozza ital. j. food sci., vol. 32, 2020 605 paper quality of istrian and slavonian dry-fermented sausages j. pleadin*1, t. lešić1, g. krešić2, t. bogdanović3, m. malenica4, i. kos5, b.s. pulić6, s. petričević3, g. kušec7 and n. vahčić8 1croatian veterinary institute, laboratory for analytical chemistry, savska cesta 143, 10000 zagreb, croatia 2faculty of tourism and hospitality management, department of food and nutrition, university of rijeka, primorska 42, 51410 opatija, croatia 3croatian veterinary institute, regional veterinary institute split, poljička cesta 33, 21000 split, croatia 4department of biotechnology university of rijeka, radmile matejčić 2, 51000 rijeka, croatia 5faculty of agriculture university of zagreb, department of animal science and technology, svetošimunska cesta 25, 10000 zagreb, croatia 6administrative department of agriculture, forestry, hunting, fishery and water management, šetalište pazinske gimnazije 1, 52000 pazin, croatia 7faculty of agrobiotechnical sciences osijek, josip juraj strossmayer university of osijek, vladimira preloga 1, 31 000 osijek, croatia 8faculty of food technology and biotechnology, university of zagreb, pierottijeva 6, 10000 zagreb, croatia *corresponding author: pleadin@veinst.hr abstract the aim of this study was to investigate nutritive and sensorial quality of istrian and slavonian pork-meat dry-fermented sausages. sensorial analysis resulted in statistically significant differences (p<0.05) between these products in 11 sensorial parameters analysed. significantly higher protein content was determined in istrian in comparison with slavonian dry-fermented sausage, although the latter content significantly varied across the producing households. no significant differences in particular fatty acid esters and saturated, monounsaturated and polyunsaturated fatty acids were obtained. although some of the nutritional quality indices failed to meet health recommendations, the obtained values are consistent with data published for pork meat products. keywords: croatian households, dry-fermented sausages, nutritive properties, sensory properties, traditional pork meat sausages ital. j. food sci., vol. 32, 2020 606 1. introduction a long tradition of dry-cured meat production in rural households exists all over the world, especially in the mediterranean countries. a very important group of such products are dry-fermented sausages, whose properties widely vary due to various processing procedures often lacking uniformity (talon et al., 2007; garcíagonzález et al., 2013). suitable chemical and sensory markers enable better linkage between raw matter and processing parameters, and thus result in higher uniformity and consistency of the products (chizzolini et al., 1996; virgili and schivazappa, 2002; zanardi et al., 2010). a wide variety of dry-fermented sausages is characterized by specific flavour investigated into by a number of studies focused on clarifying the control mechanisms affecting the flavour development (toldrá, 1998; garcía-gonzález et al., 2013). the highest impact on sensory properties of these products is that of smoking and ripening operations (jerković et al., 2010; kovačević, 2014). of particular significance are the processes of fat lipolysis, free fatty acids’ formation, and degradation and oxidation of short-chain fatty acids, since these key reactions, taking place during ripening, affect the formation of specific odour and taste of the final product (kozačinski et al., 2006; miličević et al., 2014; marušić et al., 2014). raw material quality is influenced by farm animals’ genotype, manners of their keeping and feeding, procedures applied before slaughtering, and post-slaughtering conditions. technological processes, such as conditioning, fermentation, drying, smoking and ripening, as well as different technological parameters, such as temperature, relative humidity and air/smoke velocity, influence the properties of the final product, too. due to the application of various technological processes, the activity of technological microflora, especially during the fermentation process and long-term maturation of sausage stuffing during production, complex microbiological, physicochemical and biochemical changes take place in fundamental building materials (fats, proteins and carbohydrates), resulting in water loss and increase in dry matter weight (kovačević, 2014). during the recent decades, studies devoted to fermented meat products have mainly focused on evaluation of physicochemical, microbiological and sensory properties (comi et al., 2005, rantsiou et al., 2005, di cagno et al., 2008) in order to contribute to the better characterization of final products, the definition of unique quality markers and the improvement of product specification protocols essential when dealing with products of the protected designation of origin (pdo) or geographical indication (pgi) (bogdanović et al., 2016). however, it is known that significant differences exist among traditional dry-fermented sausages produced in different countries or even in the same country (kos et al., 2009; zanardi et al., 2010). as for traditional dry-fermented sausages produced in croatia, slavonian sausage is produced in the eastern croatia and represents a very important croatian pgi food brand. the same applies to istrian sausage produced in the western croatia, which is in the process of becoming a protected product. even though both sausages are produced from pork meat, istrian sausages contain less fat tissue and are spiced with pepper and garlic. the ingredient that makes these sausages specific is the local wine (malvasia). unlike these, slavonian sausages are spiced with garlic and red pepper and contain in general a larger amount of fat tissue. the production of slavonian sausage calls for the minimum of 70% of the secondand the third-category pork meat and the minimum of 30% of solid fat tissue, while the production of istrian sausage makes use of the meat of the same categories, but of not more than 6% of bacon. mincing (6-8 mm hole for slavonian and at least 10 mm for istrian ital. j. food sci., vol. 32, 2020 607 sausage) is followed by the addition of salt and spices; in case of slavonian sausage, sweet and hot red pepper and garlic are added, while in case of istrian sausage pepper and malvasia enriched with garlic extract and prepared according to a specific procedure, are added. in both cases, a thoroughly mixed mixture of the above-detailed ingredients is stuffed in pork small intestine used as casing, which should be at least 70 cm long when it comes to slavonian, and not longer than 50 cm when it comes to istrian sausage. in the further course of slavonian sausage production, the product is conditioned for a day, coldsmoked for 14 days tops, and ripened and dried in chambers for at least 45 days at temperatures not higher than 16°c, relative humidity thereby being kept at 70-85%. since istrian sausages should not be smoked, the subsequent course of their production upon stuffing involves ripening in chambers at temperatures of 9-16°c and with relative humidity of 65 to 85%. istrian sausages can be released to the market 30 days after the production commencement, while the entire production of slavonian sausages takes 60 days at least. as for their physicochemical properties, slavonian sausage is allowed to contain no more than 40% of fat, while water activity should be kept below 0.90; on the other hand, istrian sausage should contain 16% of proteins at the minimum and 40% of water at the maximum. according to specification, slavonian sausage has an elongated cylinder shape; one sausage pair should be at least 35 cm long and measure 2-3 cm in cross-section (ma, 2019). the casing is reddish/brown and should be free of smudges, folders, cracklings and surface moulds. the texture is expected to be solid and elastic, but not rubberish; the sausage should be easy-to-cut, not prone to crumbling, and easy-to-chew. the stuffing should be dark red in its cross-section, except for the fat tissue, which is coloured either white or orange; the stuffing resembles a mosaic, should be well entangled and free of holes, lacking a dark margin under the casing. prior to cutting, slavonian sausage has a smoky smell of an ash tree, hornbeam or beech; once the sausage is cut, the smell of fermented meat and garlic is released. istrian sausage assumes the shape of an elongated cylinder, measuring at least 50 cm in length and having a rounded diameter. the casing should not be damaged and should tightly adhere to the stuffing. in its cross-section, the sausage is solid, mosaic-like, the meat thereby being coloured red and the fat tissue being coloured white. the sausage should be compact and holes-free, while its stuffing should not get separated during cutting. given the fact that among complex factors that drive consumer dry-fermented sausages’ choice, nutritive and sensory properties are the major criteria, the aim of this study was to investigate into these qualities of the most important types of traditional croatian dryfermented sausages. the study was performed on istrian and slavonian sausages produced in different households situated in two croatian main fermented meat production regions. based on fatty acid content, nutritional quality indices were also assessed for both types of products. 2. materials and methods 2.1. sampling the study involved 40 samples of traditional croatian dry-fermented sausages named istrian (n=20) and slavonian sausage (n=20). sausages were collected randomly during a two-year period (2018-2019) from markets, fairs and producing households. the products originated from two croatian regions: the western region (istra and primorje) and the ital. j. food sci., vol. 32, 2020 608 eastern region (slavonia and baranja). pursuant to the ordinance on meat products (og 62/18) adopted by the republic of croatia, these sausages belong to the group of drycured sausages falling into the category of non-thermally processed meat products. the sausages were produced according to traditional recipes using traditional technologies observed by the producing rural household. to the end of their production, pork meat of the first, the second and the third category was used, together with fat and various amounts of salt and spices, depending on the sausage type (kovačević, 2017). 2.2. sensory characteristics sensory analysis was carried out by a trained panel (of 9 assessors). the assessors were selected and generically trained according to the iso standard (iso 11132:2012). sensory analysis was carried out in the sensory laboratory of the faculty of food technology and biotechnology according to iso 8589:2007. sensory assessment made use of a quantitative descriptive analysis (qda) and a unipolar numerical intensity scale was developed in collaboration with the centro studi assaggiatori (brescia, italy). the intensity of each sensorial property was assessed using an ascending left-to-right numerical scale, “zero” thereby representing the absence of a given sensorial property and “nine” its highest intensity. at each panel session, a repeated sample of a given product group was available; for each assessor, a number of statistical parameters descriptive of his/her efficacy was calculated. plates containing single-coded samples were served into sensory compartments, together with all materials required for sensory assessment. each assessor carried out a sensory assessment of the intensity of objective visual food item properties (colour of the minced meat, colour uniformity, fat content, cohesiveness), smell-related properties (favourable smell, unfavourable smell, smoky smell), taste-related properties (tenderness, juiciness, saltiness, sweetness, sourness, bitterness, spiciness) and aroma (coming from aromatic herbs, spice herbs, ripe meat, biochemical properties, fresh pork meat, moulds). the above was followed by the assessment of subjective properties (cross-section attractiveness, smell attractiveness, consistency attractiveness, maturity, richness of appealing aromas, steadiness of appealing aromas, overall attractiveness), which made use of the same numerical, intensity-measuring scale. 2.3. physicochemical analysis samples were cut into small pieces and homogenized for 15 sec at 6,000 rpm using a grindomix gm 200 (retsch, haam, germany). sample preparation was completed in full line with iso 3100-1:1991. all samples were analysed for physicochemical parameters within the next 48 hours upon arrival into the laboratory. the extracted fat was stored in a refrigerator at -18°c pending fatty acid composition analysis carried out within the next 48 hours. all chemicals used for analyses were of an analytical grade. the ph value was determined in a homogenate diluted with distilled water (1:10, p/v) using a ph/ion 510 – bench ph/ion/mv meter (eutech instruments pte ltd/ oakton instruments, usa) according to the ph/ion 510 instruction manual. water activity (aw) was measured at the room temperature (20±2ºc) using a rotronic hygrolab 3 (rotronic ag, bassersdorf, switzerland). the ph-value and water activity given for each sample represent the mean value of two independent measurements. the water content was determined gravimetrically (iso 1442:1997) at 103°c in an oven (uf75 plus, memmert, schwabach, germany), while the ash content was established according to iso 936:1998 by ital. j. food sci., vol. 32, 2020 609 virtue of burning the samples in a furnace at 550°c (lv9/11/p320 nobertherm, lilienthal, germany). the total fat content was determined using the soxhlet method (iso 1443:1973), which involves digestion of a sample in an acidic environment followed by fat extraction with petroleum ether using a soxtherm 2000 automated device (gerhardt, munich, germany). the total protein content was determined using the kjeldahl method (iso 937:1978) that employed a unit 8 basic digestion block (foss, höganäs, sweden) and an automated distillation & titration device (vapodest 50s, gerhardt, munich, germany). the salt content determination made use of the multiple standard addition potentiometric technique that employs an ion-selective electrode and a na easyplustm analyser (mettler toledo, germany). based on the established sodium content, the representation of sodium chloride (salt) was determined stoichiometrically. the carbohydrate content was calculated based on the water, ash, total protein and fat content. each sausage sample was analysed in duplicate and the results were expressed in form of weight percentage (%) with the accuracy of 0.01%. quality control of analytical methods used was performed using the reference material (rm) tet003rm (fapas, york, england). 2.4. fatty acid profile sample preparation for the analysis of fatty acid methyl esters was described earlier by pleadin et al. (2019). fatty acid methyl esters were analysed using gas chromatography (gc) according to iso 12966-4:2015 and en iso 12966-4:2015. to the above effect, a 7890ba gas chromatographer equipped with flame ionization detector (fid), a 60-m db23 capillary column having an internal capillary diameter of 0.25 mm and the stationary phase thickness of 0.25 μm (agilent technologies, santa clara, usa) was used. the components were detected by fid at the temperature of 280°c, hydrogen flow rate of 40 ml/min, air flow rate of 450 ml/min and nitrogen flow rate of 25 ml/min. the initial column temperature was 130°c; after a minute, it was increased by 6.5°c/min until the temperature of 170°c was reached. the temperature was further increased by 2.75°c/min until the temperature of 215°c was attained. the latter temperature was maintained for 12 min and then further increased rate by 40°c/min until the final column temperature of 230°c was reached, the latter being maintained for 3 min. one ml of a sample was injected into a split-splitless injector at the temperature of 270°c and with the partition coefficient of 1:50. the carrier gas was helium (99.9999%), flowing at the constant rate of 43 cm/sec. fatty acid methyl esters were identified by comparing their retention times with those of fatty acid methyl esters contained by the standard mixture. the results were expressed as a percent-share (%) of an individual fatty acid in total fatty acids, the accuracy thereby being 0.01%. each sausage sample was analysed in duplicate. the material used for quality control was crm bcr 163 (institute for reference materials and measurements, geel, belgium) that has a specified content of seven individual fatty acids. 2.5. nutritional quality of lipids data on fatty acid composition in terms of the mean values obtained by the analysis of two replicates, were used for the calculation of the following lipid quality indices: the atherogenic index (ai), the thrombogenic index (ti) and the hypocholesterolaemic/hypercholesterolaemic ratio (hh). the atherogenic index (ai) ital. j. food sci., vol. 32, 2020 610 indicates the relationship between the sum of the main saturates and the sum of the main non-saturates. this parameter was calculated as follows: ai = [(c12:0 + (4 x c14:0) + c16:0)] / [∑ mufa + pufa n-6+ pufa n-3] (ulbritcth and southgate, 1991) the thrombogenic index (ti) is defined as the relationship between the pro-thrombogenic (saturated) and the anti-thrombogenic fas (mufa, pufa n-6 & pufa n-3). the index was calculated as follows: ti = (c14:0 + c16:0 + c18:0) / [0.5 x ∑mufa + 0.5 x pufa n-6 + 3 x pufa n-3) + + (pufa n-3/pufa n-6)]. the ratio of hypocholesterolaemic over hypercholesterolaemic fatty acids (hh) takes into account well-known effects of certain fatty acids on cholesterol metabolism (santossilva et al., 2002). it was calculated as follows: hh = (c18:1n-9 + c18:2n-6 + c20:4n-6 + c18:3n-3 + c20:5n-3 + c22:5n-3 + c22:6n-3) / (c14:0 + c16:0) (ulbritcth and southgate, 1991). 2.6. data analysis statistical analysis was performed using the spss statistics software 22.0 (spss statistics, ny ibm, 2013) and the big sensory soft (centro studi assaggiatori, brescia, italy, 2005). in order to determine the differences between istrian and slavonian dry-fermented sausage in terms of physicochemical properties, fatty acid composition and sensory parameters, the independent sample t-test was used. the decisions on statistical significance were made at the significance level of p≤0.05. 3. results and discussion 3.1. sensory characteristics sensory qualities of fermented meat products are adjudicated based on their aroma, appearance, flavour, texture, aftertaste and sound properties (flores, 2011). it is important to point out that contrary to some foods, sensory assessment of fermented meat products, including fermented sausages, is not standardized, since no consensus on sensory attributes that should be evaluated hasn’t been reached yet. in several papers, these attributes have been selected and assessed through complex procedures involving sensory vocabulary generation so as to be able to compile a lexicon to be used to describe a sensory profile of a given fermented meat product, as well as through quantitativedescriptive analysis (ruiz-pérez-cacho et al., 2005; garcía-gonzález et al., 2006; garcía-gonzález et al., 2008; benedini et al., 2012). as for croatian householdproduced dry-fermented sausages, it has already been concluded that variations in their overall quality, especially sensory characteristics, represent a huge problem (frece et al., 2014). ital. j. food sci., vol. 32, 2020 611 the results of sensory evaluation of both istrian and slavonian dry-fermented sausage using quantitative descriptive analysis, carried out within this study frame, are shown in fig. 1. figure 1. descriptive sensory profile of objective characteristics (appearance, odour, texture, taste and aroma) of istrian and slavonian dry-fermented sausage. sensorial analysis resulted in statistically significant differences (p<0.05) between these products in 11 out of the total of 20 sensory characteristics analysed, including cohesiveness (p=0.001), smoky odour (p<0.001), tenderness (p<0.001), juiciness (p=0.008), sweetness (p<0.001), sourness (p<0.001), spiciness (p<0.001), aroma generated by the presence of aromatic herbs (p<0.001), ripe meat quality (p=0.011), biochemical parameters (p=0.016) and mould presence (p<0.001). these significant differences can be attributed to the differences in processing and to the use of different ingredients and spices during the production of the two. the cohesiveness is stronger in istrian in comparison with slavonian sausage. slavonian sausage scored higher for its smoky odour than did istrian sausage, whose score in this regard was around 0. the latter was to be expected given that slavonian sausage is smoked with cold smoke, while istrian sausage should not be smoked at all. slavonian sausage scored higher for tenderness and juiciness. it is known that these parameters are in correlation with moisture and fat content. istrian sausage was shown to be sweeter, as oppose to slavonian sausage, which was proven sourer, but they turned out to be equally salty. istrian sausage must have a delicate taste (never sour) and should be moderately salty, while the taste of slavonian dry-fermented sausage, according to its specifications (ma, 2019), should be mildly hot but never bitter, coming as a result of the combination of fermented meat, garlic, salt and red pepper used in its production. slavonian dry ital. j. food sci., vol. 32, 2020 612 fermented sausage is spicier as compared to istrian one due to the presence of red pepper spiking, while istrian sausage scores higher when it comes to aromatic herbs, which can also be attributed to spices added, i.e. garlic and local wine malvasia. the principal intensity scales applied in sensory profiling of similar dry-fermented sausages varied in terms of the different point intensity scales as well as the unstructured line scale (flores, 2011). the lack of consensus regarding the application of sensory scales sometimes makes the comparison and discussion of the results of similar studies quite difficult. however, the results pertaining to the texture descriptors (tenderness, juiciness), obtained in this study, are in agreement with those reported by kos et al. (2015) for dry sausages made from domestic pig and wild boar meat. in general, studies that employed sensorial analysis in order to compare dry-ripened sausages with similar fat levels reported higher sensory scores for texture attributes (fonseca et al., 2015). moreover, the amount of fat affects the colour of smoked sausages and is responsible for a high score obtained on the sensory attributes’ assessment scale (ahmad and amer, 2012), as was the case in this study, too. the smell and the taste of smoked sausages come as the result of decomposition of carbohydrates, lipids and proteins mediated by enzymes, as well as the due to the spices used in the production and the production process itself (kaban and kaya, 2009). the results descriptive of smelland taste-related attributes of istrian and slavonian sausages, obtained in this study, can also be compared to those obtained by kos et al. (2015), who also claimed that dry sausages made from domestic pig and wild boar meat have an intense aroma, higher salinity, more pronounced spiciness, pronounced herbal and ripe meat aroma, and more stable flavour. the intensity of subjective characteristics of istrian and slavonian dry-fermented sausage, assessed as a part of descriptive sensory analysis, is shown in fig. 2. figure 2. descriptive sensory profile of subjective characteristics of istrian and slavonian dry-fermented sausage ital. j. food sci., vol. 32, 2020 613 no significant differences (p>0.05) in any of the assessed attributes were established, showing a good acceptability of both types of dry-fermented sausages. 3.2. physicochemical properties unlike industrial production, household technologies applied during the production of fermented sausages are not regulated, so that a number of production-related factors, such as uneven weight and quality of raw materials and differences in production technologies, result in the diversity of composition of the finished products. therefore, physicochemical properties of dry-fermented sausages show huge variability across individual producers and production periods (kozačinski et al., 2008). industrial production of traditional dry sausages leans on traditional recipes also used in rural households, but, as opposed to seasonal household production, is carried out under controlled processing conditions and is not seasonal in nature, thus allowing for a continuous market supply throughout a year. recent studies have shown that, due to healthy trends in meat products’ consumption in terms of low-fat and low-salt products’ preference, meat producers are facing a new challenge that comes down to attaining fat and salt reduction without any loss in sensory qualities (jiménez-colmenero et al., 2009, flores et al., 2013). physicochemical parameters of istrian and slavonian dry-fermented sausage determined in this study are shown in table 1. the results pertinent to chemical parameters indicate a similar nutritional composition of these two products, with statistically significant differences (p<0.05) in ph value, protein and ash content. table 1. physicochemical parameters of istrian and slavonian dry-fermented sausages. parameter ph water (% w/w) protein (% w/w) fat (% w/w) ash (% w/w) salt (% w/w) ch (% w/w) istrian dry-fermented sausage 5.72±0.59 24.99±5.79 30.66±5.05 38.76±8.44 5.00±0.72 5.51±0.96 0.59±0.43 slavonian dry-fermented sausage 5.12±0.27 28.10±4.28 26.68±3.57 39.48±8.58 4.54±0.59 4.16±0.67 1.20±0.92 p value 0.000 0.085 0.013 0.801 0.049 0.234 0.490 ch carbohydrates. results are expressed as the mean value (%, mean±sd); one sausage sample was taken and analysed in duplicate. the ph value is an indicator of fermentation and ripening of a meat product (salgado et al., 2005) and is commonly used for the assessment of their shelf-life. in dry-fermented sausages, the ph value spans from 4.7 to 6.3 (dellaglio et al., 1996; zanardi et al., 2010; demeyer et al., 2000; moretti et al., 2012; pleadin et al., 2014). in this study, the mean ph values equalled to 5.11 for slavonian sausage and 5.72 for istrian sausage, i.e. were within the acceptable range specified above. literature data suggest that, due to the longer drying and ripening of dry-fermented sausages and a high share of lean meat used in the preparation of their stuffing, water and protein content in finished ripened sausages are on an equal level (about 30-40% w/w), ital. j. food sci., vol. 32, 2020 614 suggesting a high nutritional value of the finished product (pleadin et al., 2014). in dryfermented sausages, the water content mostly raises up to 40% w/w (vignolo et al., 2010). the ratio of water over proteins of 1.2 to 1.3 is typical of dry sausages (incze, 2007). in this study, a higher protein as compared to water content was determined in istrian dry-fermented sausage, while in slavonian dry-fermented sausage the ratio of water over proteins was determined to be 1.05. when analysing dry sausages produced in croatian households, water over protein ratio ranged from 1.0 to 2.1, showing that these products are of a high nutritional value (kozačinski et al., 2008). the amount of total fat present in dry-fermented sausages generally varies widely (21.70 to 55.40% w/w) depending on the recipe and the producing household, but also on the origin of raw materials. such variations can be attributed to the differences in the amount of added fatback and the choice of more or less fatty meat made by individual manufacturers (pleadin et al., 2014). the ash content of meat products generally ranges from 3.52% to 6.06% w/w (ockerman and basu, 2007; jiménez-colmenero et al., 2010; karolyi and čurić, 2012). salt (sodium chloride) is an essential ingredient of fermented sausages, so that meat products are one of the richest sodium chloride food sources contributing to the increased water and fat binding capacity, the formation of colour, taste and texture of the product and its microbiological safety. the salinity of a product depends on the amount of added salt and the duration of drying and ripening of the product (wirth, 1986), and has a significant impact on hardness and elasticity of meat products and their resistance to chewing (kovačević et al., 2010). in fermented sausages’ stuffing, an average share of salt ranges from 2.0% to 2.6%, whereas during the drying process the value keeps growing up to its final level found in the finished product (ockerman and basu, 2007; stahnke and tjener, 2007). jiménez-colmenero et al. (2001) demonstrated that larger amounts of salt exceeding the value of 4-6% have been established in numerous fermented meats studies, which was also the case in both sausages under this study (4.165.51%). since the glucose content in meat is too low or much too variable, different carbohydrates like glucose, sucrose, lactose, maltodextrin, corn syrups, starches and sorbitol are added into fermented sausages’ stuffing (mastanjević et al., 2017) so as to enhance the growth of technological microflora (lucke, 1994). sugars, mostly glucose, facilitate dry sausage fermentation process, since they pose as a substrate for the lactic acid production and contribute to the specific aroma development. sugars added into fermented sausage stuffing in the maximal percent-share of 2% (usually 0.3-0.8% w/w) ensure the ph decrease from the initial 5.8-6.0 down to 4.8-5.4 (lucke, 2000). the carbohydrate content established in sausages under this study (0.59% in istrian and 1.20% in slavonian dryfermented sausage) can be explained in view of the above. 3.3. fatty acid profile table 2 shows the fatty acid composition and fat quality indices of istrian and slavonian dry-fermented sausage. statistical analysis of the fatty acid composition-related data did not show any significant differences between these two types of sausages (p>0.05). no significant differences in fatty acid esters and saturated (sfa), monounsaturated (mufa) and polyunsaturated (pufa) fatty acids were obtained, revealing these sausages to have the fatty acid profile of a typical pork meat product, with small composition variations attributable to the differences in the amount of added fatback and the stuffing fatness. the proportions of fatty acid groups found in both analysed sausages were as ital. j. food sci., vol. 32, 2020 615 follows (in descending order): mufa (46.66-46.83%) > sfa (42.91-43.00%) > pufa (10.2610.33%). this trend has also been confirmed in earlier studies of fatty acid profile of meat and meat products (marušić radovčić et al., 2014; woods and fearon, 2009; pleadin et al., 2014). table 2. fatty acid composition (% of total fatty acids) of istrian and slavonian dry-fermented sausage. fatty acid istrian dry-fermented sausage slavonian dry-fermented sausage p value c10:0 0.09±0.01 0.09±0.01 0.565 c12:0 0.08±0.01 0.08±0.01 0.968 c14:0 1.41±0.11 1.43±0.15 0.714 c16:0 25.39±0.30 25.92±1.22 0.274 c17:0 0.39±0.09 0.40±0.12 0.779 c18:0 14.31±1.12 14.21±1.13 0.817 c20:0 0.43±0.23 0.43±0.19 0.961 c21:0 0.46±0.18 0.44±0.10 0.805 sfa 42.91±1.98 43.00±2.22 0.921 c16:1 2.31±0.34 2.56±0.29 0.087 c18:1t 0.19±0.04 0.20±0.03 0.749 c18:1c 44.18±2.50 43.74 ±2.99 0.689 c22:1 0.14±0.09 0.17±0.07 0.386 mufa 46.83±2.65 46.66±3.13 0.885 c18:2n-6 8.97±3.17 9.13±2.64 0.586 c18:3n-6 0.23±0.02 0.24±0.03 0.469 c18:3n-3 1.01±0.16 0.95±0.20 0.365 pufa 10.26±3.25 10.33±2.59 0.805 n-6 9.22±3.19 9.37±2.64 0.902 n-3 1.04±0.15 0.96±0.20 0.246 results are expressed as the mean value (%, mean±sd); one sausage sample was taken and analysed in duplicate. lod (limit of detection)=0.05%. sfa saturated fatty acids, mufa monounsaturated fatty acids, pufa polyunsaturated fatty acids. as proven earlier, fatty acids most represented in different pork meat sausages are oleic (18:1n-9c), palmitic (16:0), stearic (18:0) and linoleic (c18:2n-6c) acid (lešić et al., 2017). the same was established in the study of fatty acid composition of industrial slavonian kulen (pleadin et al., 2014). oleic acid, as the predominant fatty acid in meat and meat products, ranged from 43.74±2.99% in slavonian sausage to the similar 44.18±2.50% in istrian dry-fermented sausage, and accounts for roughly 94% of all mufas in both products. among sfas, palmitic and stearic acid were shown to be dominating and accounted for roughly 93% of all sfas in both types of sausages. linoleic acid, as the dominating pufa, accounted for roughly 87-88% of all pufas in both sausages. ital. j. food sci., vol. 32, 2020 616 3.4. nutritional quality indices pufa/sfa and n-6/n-3 ratios are the most common parameters used to evaluate the nutritional quality of fat (jimenez-colmenero et al., 2010). additional indices, which take into account different effects that a single fatty acid might have on the incidence of pathogenic phenomena, such as atheroma and/or thrombus formation, i.e. the atherogenic (ai) and the thrombogenic index (ti), were also calculated. in order to gain insight into the effect of fatty acids on blood cholesterol, the ratio of hypocholesterolaemic over hypercholesterolaemic fatty acids (h/h) was determined, too. nutritional fat quality indices determined in this study for istrian and slavonian dryfermented sausage are shown in table 3. no statistically significant differences (p>0.05) in any of the indices were determined between the two. table 3. nutritional fat quality indices calculated for istrian and slavonian dry-fermented sausage. nutritional quality indices recommended value istrian dryfermented sausage slavonian dryfermented sausage p value n-6/n-3 < 4 8.90±3.07 10.28±4.18 0.340 pufa/sfa < 0.4 0.24±0.08 0.24±0.06 0.971 ai < 1 0.55±0.05 0.56±0.05 0.791 ti < 1 1.45±0.13 1.46±0.13 0.879 h/h as higher 2.01±0.17 1.98±0.17 0.676 h/h hypo-/hypercholesterolaemic fatty acids ratio; ai atherogenic index; ti thrombogenic index. results are expressed as the mean value (%, mean±sd); one sausage sample was taken and analysed in duplicate. literature has revealed that consumption of animal fats is related to an excessive intake of sfas and an increased proportion of n-6 pufas (n-6/n-3 ratio). it has been shown that in the current diet of consumers from western countries, the n-6/n-3 ratio is roughly 15-20+, while according to health recommendations it should be less than 4 if the incidence of chronic diet-related diseases is to be reduced (simopoulos, 2002; cordain et al., 2005). in order to meet health recommendations or reduce the risk of cardiovascular, autoimmune and other chronic diseases, the pufa/sfa ratio should be higher than 0.4 (simopoulos, 2002). in this study, the pufa/sfa ratio was in line with health recommendations, whereas n-6/n-3 ratio was approximately two to three times higher than the maximal recommended value. the mean n-6/n-3 ratios obtained in this study for istrian and slavonian sausage are not extremely high (about 10), however, still not in accordance with health recommendations; at least, they are consistent with the results of previous studies of similar pork meat products (lešić et al., 2017). the ai is considered to be a particularly useful index because, in addition to describing mufa content, it places the emphasis on myristic acid (c14: 0), which is believed to have the most harmful cardiovascular effects (higgs, 2002). the ai index takes into account the fact that some saturates, primarily myristic and palmitic acid, are considered to be proatherogenic (since they facilitate the adhesion of lipids onto the cells the immune and the circulatory system are composed of), while non-saturates are considered to be antiatherogenic (since they inhibit the formation of plaques and diminish the levels of ital. j. food sci., vol. 32, 2020 617 esterified fatty acids, cholesterol and phospholipids, therefore preventing microand macro-coronary disease) (ulbritcth and southgate, 1991). it is assumed that ais below 1 are beneficial to human health (pleadin et al., 2019). for both types of sausages under this study, the ais having the mean values of about 0.55 were in line with the recommendation, and similar to those found in other studies of different types of sausages (del nobile et al., 2009; stajić et al., 2011; razmaite and švirmickas, 2012; romero et al., 2013). the ti indicates the risk of blood clotting and represents the ratio of pro-thrombogenic (certain saturated) and anti-thrombogenic (unsaturated) fatty acids. for both sausages analysed within this study, the tis were about 1.5 times higher than the recommended values, which is consistent with literature data on similar types of sausages (del nobile et al., 2009; romero et al., 2013). recent studies show that fatty acids with an even number of c atoms (lauric, myristic and palmitic acid) increase the concentration of total and ldl cholesterol, as well as promote not only coagulation, but also inflammatory processes and insulin resistance (calder, 2015). the h/h index takes into account known effects of certain fatty acids (especially oleic and linoleic acid) involved in cholesterol metabolism. the higher value of this index shows better effects for human health (santos-silva et al., 2002). oleic acid, cis-mufa fatty acids in general and linoleic acid can reduce both total and ldl cholesterol, thereby reducing the risk of cardiovascular disease (calder, 2015). due to the wide range of potential beneficial biological effects (cell membrane functionality, gene expression and lipid metabolism), n-3 pufas play a role in the prevention and treatment of inflammatory processes, thus reducing the risk of cardiovascular disease and some cancers (arterburn et al., 2006). in this study, the h/h values approximated to 2 for both types of sausages; such a value is typical of meat, especially pork meat (santos-silva et al., 2002; razmaite and švirmickas, 2012). 4. conclusions despite of the fact that istrian and slavonian dry-fermented sausages are produced in two climatically different regions, they are nutritionally related. significant differences exist in their sensory properties due to the differences in traditional recipes used in their production. however, from the sensory evaluation standpoint, the existing sensory characteristics are highly accepted by consumers. since this research showed that certain nutritional indices, especially n-6 over n-3 ratio, are not within the desirable limits and in line with health recommendations, modifications to the fatty acid composition of these sausages, to be attained primarily through changes in animal feeding practices, are needed in order to improve their nutritional properties and ultimately their beneficial effects on consumer health. acknowledgements this work was supported by the croatian science foundation under the project “mycotoxins in traditional croatian meat products: molecular identification of mycotoxin-producing moulds and consumer exposure assessment” (no. ip2018-01-9017). ital. j. food sci., vol. 32, 2020 618 references ahmad s. and amer b. 2012. sensory quality of fermented sausages as influenced by different combined cultures of lactic acid bacteria fermentation during refrigerated storage. j. meat sci. technol. 2:51. arterburn l.m., hall e.b. and oken h. 2006. distribution, interconversion, and dose response of n-3 fatty acids in humans. am. j. clin. nutr. 83:1467. benedini r., parolari g., toscani t. and virgili r. 2012. sensory and texture properties of italian typical dry-cured hams as related to maturation time and salt content. meat sci. 90:431. bogdanović t., pleadin j., vahčić n. and petričević s. 2016. chemical and sensorial properties of fermented meat products. in “fermented meat products: health aspects” n. zdolec (ed.), p. 359. crc press taylor and francis group, llc, boca raton. calder p. 2015. functional roles of fatty acids and their effects on human health. j. parenter. enteral. nutr. 39:18. chizzolini r., novelli e., campanini g., dazzi g., madarena g., zanardi e, pacchioli m.t. and rossi a. 1996. lean colour of green and matured parma hams: comparative evaluation and technological relevance of sensory and objective data. meat sci. 44:159. comi g., urso r., iacumin l., rantasiou k., cattaneo p., cantoni c. and cocolin l. 2005. characterization of naturally fermented sausages produced in the north east of italy. meat sci. 69:381. cordain, l., eaton b.s., sebastian a., mannine n., lindeberg s., watkins b.a., o´keefe j.h. and brand-miller j. 2005. origins and evolution of the western diet: health implications for the 21st century. am. j. clin. nutr. 81:341. del nobile m.a., conte a., incoronato a.l., panza o., sevi a. and marino r. 2009. new strategies for reducing the pork back-fat content in tyipical italian salami. meat sci. 81:263. dellaglio s., casiraghi e. and pompei c. 1996. chemical, physical and sensory attributes for the characterization of an italian dry-cured sausage. meat sci. 42:25. demeyer, d., raemaekers m., rizzo a., holck a., de smedt a., ten brink b., hagen b., montel c., zanardi e., murbrekk e., leroy f., vandendriessche f., lorentsen k., k. venema, sunesen l., stahnke l., de vuyst l., talon r., chizzolini r. and eerola s. 2000. control of bioflavour and safety in fermented sausages: first results of a european project. food res. int. 33:171. di cagno r., cháves lópez c., tofalo r., gallo g., de angelis m., paparella a., hammes w. and gobbetti m. 2008. comparison of the compositional, microbiological, biochemical and volatile profile characteristics of three italian pdo fermented sausages. meat sci. 79:224. flores m., olivares a. and corral s. 2013. healthy trends affect the quality of traditional meat products in mediterranean area. acta agric. slov. suppl. 4:183. flores m. 2011. sensory descriptors for dry-cured meat products. in “sensory analysis of foods of animal origin” m.l. nollet and f. toldrá (ed.). p. 173. crc press, boca raton. fonseca s., gómez m., domínguez r. and lorenzo j.m. 2015. physicochemical and sensory properties of celta dryripened “salchichón” as affected by fat content. grasas y aceites 66:e059. frece j., kovačević d., kazazić s., mrvčić j., vahčić n., ježek d., hruškar m., babić i. and markov k. 2014. comparison of sensory properties, shelf-life and microbiological safety of industrial sausages produced with autochthonous and commercial starter cultures. food technol. biotechnol. 52:307. garcía-gonzález d.l., tena n., aparicio-ruiz r. and morales m.t. 2008. relationship between sensory attributes and volatile compounds qualifying dry-cured hams meat sci. 80:315. garcía-gonzález d.l., roncales p., cilla i., río s., poma j.p. and aparicio r. 2006. interlaboratory evaluation of drycured hams (from france and spain) by assessors from two different nationalities. meat sci. 73:521. garcía-gonzález d.l., aparicio r. and aparicio-ruiz r. 2013. volatile and amino acid profiling of dry cured hams from different swine breeds and processing methods. molecules. 18:3927. ital. j. food sci., vol. 32, 2020 619 higgs j. 2002. the nutritional quality of meat. in „meat processing improving quality“ j.p. kerry, j.f. kerry, d. ledward (ed.), p. 64-92. woodhead publishing ltd., cambridge, england. incze k. 2007. european products. in “handbook of fermented meat and poultry” f. toldrá (ed.), p. 307. blackwell publishing, iowa. iso standard iso 1442:1997. meat and meat products determination of moisture content. international organization for standardization. genève, switzerland. iso standard iso 936:1998. meat and meat products determination of total ash. international organization for standardization. genève, switzerland. iso standard iso 937:1978. meat and meat products determination of nitrogen content. international organization for standardization. genève, switzerland. iso standard iso 1443:1973. meat and meat products determination of total fat content. international organization for standardization. genève, switzerland. iso standard en iso 12966-2:2011. animal and vegetables fats and oils gas chromatography of fatty acid methyl esters part 2: preparation of methyl esters of fatty acids. international organization for standardization. genève, switzerland. iso standard iso 8589:2007. sensory analysis general guidance for the design of test rooms. international organization for standardization. genève, switzerland. iso standard en iso 12966-4:2015. animal and vegetables fats and oils gas chromatography of fatty acid methyl esters part 4: determination by capillary gas chromatography. international organization for standardization. genève, switzerland. iso standard iso 11132:2012. sensory analysis methodology guidelines for monitoring the performance of a quantitative sensory panel. international organization for standardization. genève, switzerland. iso standard 3100-1:1991. meat and meat products sampling and preparation of test samples part 1: sampling. international organization for standardization. genève, switzerland. jerković, i., kovačević d., šubarić d., marijanović z., mastanjević k. and suman k. 2010. authentication study of volatile flavour compounds composition in slavonian traditional dry fermented salami “kulen”. food chem. 119:813. jiménez-colmenero f, carballo j. and cofrades s. 2001. healthier meat and meat products: their role as functional foods. meat sci. 59:5. jiménez-colmenero f., ventanas j. and toldrá f. 2009. el jamón curado en una nutrición saludable. in proceedings of 5th world congress of dry-cured ham. aracena, spain. jiménez-colmenero f., pintado t., cofrades s., ruiz-capillas c. and bastida s. 2010. production variations of nutritional composition of commercial meat products. food res. int. 43:2378. kaban g. and kaya m. 2009. staphylococcus xylosus on the quality characteristics of dry fermented sausage (sucuk). j. food sci. 74:58. karolyi d. and čurić t. 2012. total fatty acids composition of raw and ripe slavonian kulen in relation to raw material used. acta agric. slov. suppl. 3:231. kos i., božac r., kaić a., kelava n., konjačić m. and janječić z. 2009. sensory profiling of dalmatian dry-cured ham under different temperature conditions. ital. j. anim. sci. 8:216. kos i., gredičak m., sinčić-pulić b., širić m. and mrkonjić-fuka m. 2015. sensory traits of dry sausages made from meat of domestic pig and wild boar. in proceedings of 50th croatian and 10th international symposium on agriculture. zagreb, croatia, pp. 438-442 kovačević d. 2014. technology of kulen and other fermented sausages. university of j.j. strossmayer. faculty of food technology, osijek, croatia. kovačević d. 2017. chemistry and technology of ham and prosciutto. university of j.j. strossmayer. faculty of food technology, osijek, croatia. ital. j. food sci., vol. 32, 2020 620 kovačević d., mastanjević k., šubarić d., jerković i. and marijanović z. 2010. physico-chemical, colour and textural properties of croatian traditional dry sausage (slavonian kulen). meso 12:270. kozačinski l., hadžiosmanović m., cvrtila fleck ž., zdolec n., filipović i. and kozačinski z. 2008. kakvoća trajnih kobasica i češnjovki iz individualnih domaćinstava. meso 10:45. kozačinski l., zdolec n., hadžiosmanović m., cvrtila ž., filipović i. and majić t. 2006. microbial flora of the croatian traditionally fermented sausage. arch. lebensmittelhyg. 57:141. lešić t., kolarić kravar s., krešić g. and pleadin j. 2017. nutritional quality of fat in industrial sausages. meso 19:496. lucke f.k. 1994. fermented meat-products. food res. int. 27:299. lucke f.k. 2000. utilization of microbes to process and preserve meat. meat sci. 6:105. ministry of agriculture of the republic of croatia (ma). 2019. „slavonian sausage“ – product specification. osijek, croatia. marušić radovčić n., heleš s., vidaček s., janči t., petrak t. and medić h. 2014. fat content, fatty acid composition and lipid oxidation in industrial and traditional baranja kulen. meso 15:265. marušić n., vidaček s., janči t., petrak t. and medić h. 2014. determination of volatile compounds and quality parameters of traditional istrian dry-cured ham. meat sci. 96 1409. mastanjević k., kovačević d., frece j., markov k. and pleadin, j. 2017. the effect of an autochthonous starter culture, sugars and different temperatures on the fermentation of slavonian kulen. food technol. biotechnol. 55:67. miličević b., danilović b., zdolec n., kozačinski l., dobranić v. and savić d. 2014. microbiota of the fermented sausages: influence to product quality and safety. bulg. j. agric. sci. 20:1061. moretti v.m., madonia g., diaferia g., mentasti t., paleari m.a., panseri s., pikrone g. and gandini g. 2012. chemical and microbiological parameters and sensory attributes of typical sicilian salami ripened in different conditions. meat sci. 66:845. ockerman h.w. and basu l. 2007. production and consumption of fermented meat products. in “handbook of fermented meat and poultry”. f. toldrá (ed.), p. 9. blackwell publishing, iowa. pleadin j., krešić g., barbir t., petrović m., milinović i. and kovačević d. 2014. changes in basic nutrition and fatty acid composition during production of „slavonski kulen“. meso 16:514. pleadin j., kvrgić k., zrnčić s., lešić t., koprivnjak o., vulić a., džafić n., oraić d. and krešić g. 2019. variations in nutritive composition of three shellfish species. ital. j. food sci. 31:716. rantsiou k., drosinos e., gialitaki m., urso r., krommer j., gasparik reichardt j., tóth s., metaxopoulos i., comi g. and cocolin l. 2005. molecular characterization of lactobacillus species isolated from naturally fermented sausages produced in greece, hungary and italy. food microbiol. 22:19. razmaite v. and švirmickas g.j. 2012. comparison of fatty acid composition in different pig tissues. vet. zootech.-lith. 58:77. romero m.c., romero a.m., doval m.m. and judis m.a. 2013. nutritional value and fatty acid composition of some traditional argentinean meat sausage. food sci.technol. 33:161. ruiz pérez-cacho m.p., galán-soldevilla h., león crespo f. and molina recio g. 2005. determination of the sensory attributes of a spanish dry-cured sausage. meat sci. 71:620. salgado a., garcía fontán m.c., franco i., lópez m. and carballo j. 2005. biochemical changes during the ripening of chorizo de cebolla, a spanish traditional sausage. effect of the system of manufacture (homemade or industrial). food chem. 92:413. santos-silva j., bessa r.j.b. and santos-silva f. 2002. effect of genotype, feeding system and slaughter weight on the quality of light lambs ii. fatty acid composition of meat. livest. prod. sci. 77:187. simopoulos a.p. 2002. the importance of the ratio of omega-6/omega-3 essential fatty acids. biomed. pharmacother. 56:365. ital. j. food sci., vol. 32, 2020 621 stahnke l.h. and tjener k. 2007. influence of processing parameters on cultures performance. ch 18. in "handbook of fermented meat and poultry". f. toldrá (ed.), p. 187. blackwell publishing, ames, ia. stajić s., živković d., perunović m., šobajić s. and vranić d. 2011. cholesterol content and atherogenicity of fermented sausages made of pork meat from various breeeds. procedia food sci. 1:568. talon r., lebert i., lebert a., leroy s., garriga m., aymerich t., drosinos e.h., zanardi e., ianieri a., fraqueza m.j., patarata l. and lauková a. 2007. traditional dry fermented sausages produced in small-scaleprocessing units in mediterranean countries and slovakia. 1: microbial ecosystems of processing environments. meat sci. 77:570. toldrá f. 1998. proteolysis and lipolysis in flavour development of dry cured meat products. meat sci. 49:101. ulbritcth t.l.v. and southgate d.a.t. 1991. coronary heart disease: seven dietary factors. lancet 338:985. vignolo g., fontana c. and fadda s. 2010. semidry and dry fermented sausages. in “handbook of meat processing”. f. toldrá (ed.), p. 379. wiley-blackwell, oxford. virgili r. and c. schivazappa. 2002. muscle traits for long matured dried meats. meat sci. 62:331. wirth f. 1986. zur technologie bei rohen fleischerzengniseen. fleischwirtschaft 66:531. woods v.b., fearon a.m. 2009. dietary sources of unsaturated fatty acids for animals and their transfer into meat, milk and eggs: a review. livest. sci. 126:1. zanardi e., ghidini s., conter m. and ianieri a. 2010. mineral composition of italian salami and effect of nacl partial replacement on compositional, physic-chemical and sensory parameters. meat sci. 86:742. paper received february 18, 2020 accepted march 27, 2020 ijfs#1373_bozza ital. j. food sci., vol. 31, 2019 556 paper chemical composition, antioxidant and antimicrobial activities of aloysia triphylla l. essential oils and methanolic extract l. rezig1, m. saada2, n. trabelsi3, s. tammar2, h. limam2, i. bettaieb rebey2, a. smaoui3, g. sghaier2, g. del re4, r. ksouri2 and k. msaada*2 1high institute of food industries, 58 alain savary street, el khadra city, tunis, 1003, tunisia 2laboratory of aromatic and medicinal plants, biotechnology center in borj cedria technopole, bp. 901 hammam-lif 2050, tunisia 3laboratory of olive biotechnology, biotechnology center of borj-cedria, p.o. box 901, 2050 hammam-lif, tunisia 4università dell'aquila, dipartimento di ingegneria industriale e dell'informazione e di economia, piazzale ernesto pontieri, monteluco di roio, 67100 l'aquila, italy *corresponding author: tel.: +21622205878; fax: +21679412638 e-mail address: msaada.kamel@gmail.com abstract the essential oil variability in aerial parts of aloysia triphylla, collected from four different tunisian regions was assessed. in addition, total polyphenols, flavonoids, and condensed tannins as well as antioxidant, antibacterial, and antifungal activities of methanolic extract and essential oils were determined. chromatographic analysis of aloysia triphylla essential oils showed the predominance of monoterpene aldehydes represented mainly by neral and geranial. rp-hplc analysis of aloysia triphylla methanolic extract revealed the predominance of p-coumaric acid among the 15 phenolic acids identified. antiradical activity was region-dependent and the methanolic extract of kairouan sample had the strongest activity. concerning the reducing power, the methanolic extract of kairouan, siliana, kairouan, and gabes samples were less active than the positive control. siliana sample showed the least ability to prevent the bleaching of β-carotene, whereas kairouan sample exhibited the strongest activity. obtained results of antimicrobial and antifungal activities showed that aloysia triphylla essential oil was endowed with important antibacterial and antifungal properties. overall, based on its methanolic extract and essential oil features, aloysia triphylla may be considered as a valuable source of new multipurpose products for industrial, cosmetic, and pharmaceutical utilization. keywords: aloysia triphylla l., regions, phenolic, essential oils, antioxidant activity, antimicrobial activity ital. j. food sci., vol. 31, 2019 557 1. introduction the lemon verbena, aloysia triphylla (l’herit), britt’s = lippia citriodora (lam.), is a perennial shrub belonging to the verbenaceae family (sharma et al., 2016). it grows naturally in south america and was introduced into north africa (tunisia) and in southern europe in the late seventeenth century (carnat et al., 1999; bensabah et al., 2014). leaves of aloysia triphylla are used for culinary purposes as food seasoning and beverage flavoring (dominguez-avila et al., 2016). furthermore, due to their aromatic, antispasmodic and digestive properties, leaves of aloysia triphylla are commonly used as infusion or herbal tea (bensabah et al., 2014). traditional applications of aloysia triphylla include its use as herbal remedy for colds, fever, spasms asthma, flatulence, colic, diarrhea, indigestion, insomnia, anxiety, analgesic and sedative (valentao et al., 1999). these therapeutic benefits were attributed to phenolic compounds (mainly flavonoids, phenolic acids, and phenylpropanoids) (pascual et al., 2001; quirantes-piné et al., 2009). antioxidants acting as radical scavengers are able to protect the human body as well as processed foods from oxidative damage. presently, much attention has been focused on the antioxidant effect of plant natural compounds due to their wide application in food. medicinal plants, being a promising source of phenolics, flavonoids, anthocyanins and carotenoids, are usually used to add flavor and improve the shelf life of dishes and processed food products. regarding these beneficial effects, low cost and properties of plant phenolics, the interest is to increase research on natural antioxidants, in order to improve on their use in the food industry and as preventive medicine (el babili et al., 2013). antioxidant properties of extracts of aloysia triphylla leaves, as well as chemical composition of their essential oil obtained from different localities were investigated by several authors (pascual et al., 2001; catalan and lampasona, 2002; crabas et al., 2003; kim and lee, 2004; santos gomez et al., 2005; choupani et al., 2014). the essential oil has been shown to exhibit antimicrobial and anti-candida activities (duarte et al., 2005; teixeira et al., 2007). according to ali et al. (2011), antimicrobial activity of aloysia triphylla essential oil may be attributed to the presence of high concentration of long-chain alcohols and aldehydes especially citral, citronellol, menthol, and βcaryophyllene. otherwise, antifungal activity is related to eugenol, camphene, and βcaryophyllene contents (magwa et al., 2006). there is hardly any available datum concerning aloysia triphylla cultivated in tunisia. in our present study, we have studied essential oil and methanolic extracts composition of aloysia trihpylla cultivated in tunisia and gathered from four distinct regions (kairouan, korba, siliana, and gabes). moreover, we have evaluated their antioxidant, antimicrobial, and antifungal activities. this report also stressed on the underlying variability of aloysia triphylla essential oil and methanolic extracts and their biological activities as affected by the collection site. 2. material and methods 2.1. plant material the aerial parts of four accessions of tunisian aloysia triphylla were gathered from four different regions in tunisia, namely kairouan (center), korba (northest), siliana (northwest), and gabes (southeast) (table 1). the aerial part samples were airdried and conserved in a desiccator at room temperature (~25°c) in darkness for further extraction. ital. j. food sci., vol. 31, 2019 558 table 1. geographical coordinates and bioclimatic classification of the collecting zone of aerial parts of aloysia triphylla. longitude latitude elevation (m) bioclimatic zone kairouan 10°05’30,93’’e 35°40’33,29’’n 62 arid superior korba 10°51’43,49’’e 36°34’50,18’’n 12 semi-arid superior siliana 9°21’52,32’’e 36°05’19,39’’n 425 semi-arid superior gabes 10°05’51,08’’e 33°53’17,08’’n 7 arid inferior 2.2. essential oil extraction dried aerial parts (100 g) were subjected to hydro distillation in a clevenger type apparatus for 3h according to the european pharmacopoeia (2017). 2.3. essential oil analysis analysis of volatile compounds by gc was carried out on a hewlett-packard 6890 gas chromatograph (palo alto, ca, usa) equipped with a flame ionization detector (fid) and an electronic pressure control (epc) injector. a polar polyethylene glycol (peg) hp innowax capillary column (30 m × 0.25 mm, 0.25 mm film thickness; hewlett-packard, ca, 127 usa) was used. the flow of the carrier gas (n2) was 1.6 ml/min. the split ratio was 60:1. the analysis was performed using the following temperature program: oven temperature kept isothermally at 35°c for 10 min, increased from 35°c to 205°c at the rate of 3°c/min and kept isothermally at 205°c for 10 min. injector and detector temperatures were held at 250°c and 300°c, respectively. the individual peaks were identified by comparing their relative retention indices to n-alkanes (c6-c22) with those of literature (adams, 2004) and/or with those authentic compounds available in our laboratory. volatile aroma compounds analysis by gc/ms was performed on a gas chromatograph hp 5890 (ii) interfaced with a hp 5972 mass spectrometer (palo alto, ca, usa) with electron impact ionization (70 ev is the ionization energy). a hp-5 ms capillary column (30 m × 0.25 mm, coated with 5% phenyl methyl silicone, 95% dimethylpolysiloxane, 0.25 mm film thickness; hewlett-packard, ca, usa) was used. the column temperature was programmed to rise from 50°c to 240°c at a rate of 5°c/min. the carrier gas was helium with a flow rate of 1.2 ml/min; split ratio was 60:1. scan time and mass range were 1 s and 40-300 m/z, respectively. identification of aroma compounds was made by matching their recorded mass spectra with those stored in the wiley/nbs mass spectral library of the gc/ms data system and other published mass spectra. 2.4. polyphenols extraction the air-dried aerial parts of aloysia triphylla were finely ground with a blade-carbide gringing (ika-werk type: a: 10). triplicate sub-samples of 1 g of each ground organ were separately extracted by stirring with 10 ml of pure methanol for 30 min. the extracts were then kept for 24 h at 4°c, filtered through a whatman no. 4 filter paper, evaporated under vacuum to dryness and stored at 4°c until analyzed (mau et al. 2004). 2.5. total phenolic content total phenolic contents were assayed using the folin-ciocalteu reagent, following the singleton’s method, which was slightly modified by dewanto et al. (2002). an aliquot ital. j. food sci., vol. 31, 2019 559 (0.125 ml) of a suitable diluted methanolic organ extract was added to 0.5 ml of deionized water and 0.125 ml of the folin-ciocalteu reagent. the mixture was shaken and allowed to stand for 6 min, before adding 1.25 ml of 7% na2co3 solution. the solution was then adjusted with deionized water to a final volume of 3 ml and mixed thoroughly. after incubation for 90 min at 23°c, the absorbance versus prepared blank was read at 760 nm. total phenolic contents of aerial parts (three replicates per treatment) were expressed as mg gallic acid equivalents per gram (mg gae/g of dw) through the calibration curve with gallic acid. the calibration curve range was 50-400 mg/ml (r2 = 0.99). all experiments were performed in triplicates. 2.6. total condensed tannins content the total tannin content was measured using the modified vanillin assay described by sun et al. (1998). a total of 3ml of 4% methanol vanillin solution and 1.5ml of concentrated h2so4 were added to 50 𝜇l of suitably diluted sample. the mixture was kept for 15 min, and the absorbance was measured at 500 nm against the blank (methanol). the amount of total condensed tannins was expressed as milligrams of (+)-catechin equivalent per gram of dry weight (mg of ce/g of dw) through the calibration curve with catechin. triplicate measurements were taken for all samples. 2.7. total flavonoid content total flavonoid content was measured according to dewanto et al. (2002). the 250 μl appropriately diluted methanolic aerial extract was mixed with 75 μl nano2 (5%). after 6 min, 150 μl of 10% alcl3 and 500 μl of naoh (1 m) were added to the mixture. finally, the mixture was adjusted to 2.5 ml with distilled water. the absorbance versus prepared blank was read at 510 nm. total flavonoid contents of aerial parts (three replicates per treatment) were expressed as mg catechin equivalents per gram (mg ce/g of dw) through the calibration curve with catechin. the calibration curve range was 50-500 mg/ml. 2.8. isolation and identification of phenolic compounds dried samples from aerial parts of aloysia triphylla were treated and used to hydrolize phenolic compounds following the method of proestos et al. (2006). thereafter, the analysis was carried out using an agilent technologies 1100 series liquid chromatograph (rp-hplc) coupled with an ultraviolet (uv)-vis multi wavelength detector. the separation was carried out on a 250 × 4.6-mm, and 4 µm hypersil ods c18 reversed phase column at ambient temperature. the mobile phase consisted of acetonitrile (solvent a) and water with 0.2% sulphuric acid (solvent b). the flow rate was kept at 0.5 ml/min. the gradient program was as follows: 15% a/85% b 0-12 min, 40% a/60% b 12-14 min, 60% a/40% b 14-18 min, 80% a/20% b 18-20 min, 90% a/10% b 20-24 min, and 100% a 24-28 min. phenolic compounds were identified based on their retention times and spectral characteristics of their peaks against those of the standards, as well as by spiking the sample with standards. analyses were performed in triplicate. 2.9. 2,2-diphenyl-1-picrylhydrazyl (dpph) scavenging assay the scavenging capacity of the obtained extracts was measured by bleaching of the purple-colored solution of the dpph radical according to the method of hanato et al. (1988). a total of 1 ml of different concentrations of extracts prepared in methanol was ital. j. food sci., vol. 31, 2019 560 added to 0.5 ml of a 0.2 mmol/l dpph methanolic solution. the mixture was shaken vigorously and kept at room temperature for 30 min. the absorbance of the resulting solution was then measured at 517 nm after 30 min. the antiradical activity was expressed as ic50 (μg/ml), which is the concentration required to cause 50% dpph inhibition. the ability to scavenge the dpph radical was calculated using the following equation: dpph scavenging effect % = [(ao – a1)/ao] x 100 where ao is the absorbance of the control at 30 min and a1 is the absorbance of the sample at 30 min. bht was used as a positive control. 2.10. reducing power assay the method of oyaizu (1986) was used to assess the reducing power of different extracts. a total of 1 ml of different concentrations of extracts in methanol was mixed with 2.5 ml of a 0.2 m sodium phosphate buffer (ph 6.6) and 2.5 ml of 1% potassium ferricyanide [k3fe(cn)6] and incubated in a water bath at 50°c for 20 min. then, 2.5 ml of 10% trichloroacetic acid was added to the mixture that was centrifuged at 650g for 10 min. the supernatant (2.5 ml) was then mixed with 2.5 ml of distilled water and 0.5 ml of 0.1% ferric chloride solution. the intensity of the blue-green color was measured at 700 nm. results were expressed as ec50 (mg/ml), which was the extract concentration at which the absorbance was 0.5 for the reducing power and was calculated from the graph of absorbance at 700 nm against the extract concentration. ascorbic acid was used as a positive control. 2.11. β-carotene bleaching test the β-carotene bleaching method is based on the loss of the yellow color of β-carotene due to its reaction with radicals formed by linoleic acid oxidation in an emulsion. the rate of βcarotene bleaching can be slowed down in the presence of antioxidants (kulisic et al., 2004). a modification of the method described by koleva et al. (2002) was employed. βcarotene (2 mg) was dissolved in 20 ml of chloroform and to 4 ml of this solution, linoleic acid (40 mg) and tween 40 (400 mg) were added. chloroform was evaporated under vacuum at 40°c and 100 ml of oxygenated ultra-pure water was added, thereafter, the emulsion was vigorously shaken. reference compound (bht), sample extracts were prepared in methanol. the emulsion (3 ml) was added to a tube containing 0.2 ml of different concentrations of extract (1, 10, 100 and 200 µg/ml). the absorbance was immediately measured at 470 nm and the test emulsion was incubated in a water bath at 50°c for 120 min, when the absorbance was measured again. bht was used as the positive control. for the negative control, the extract was substituted by an equal volume of methanol. the antioxidant activity (%) of the aloysia triphylla aerial parts extracts was evaluated in terms of bleaching of the β-carotene using the following formula: % inhibition = !"!!" !!!!" where at and ct are the absorbance values measured for the test sample and control, respectively, after incubation for 120 min. c0 is the absorbance values for the control measured at zero time during the incubation. the results are expressed as ic50 values (µg/ml), which is the concentration required to cause a 50% β-carotene bleaching inhibition. tests were carried out in triplicate. ital. j. food sci., vol. 31, 2019 561 2.12. screening of antibacterial and antifungal activities antibacterial activity was analyzed by the disc diffusion method against four human pathogenic bacteria including escherichia coli (atcc 35218), pseudomonas aeruginosa (atcc 4141), enterococcus faecalis (atcc 2212), and bacillus subtilis (cip 5265) according to the method of rios and recio (2005). the same agar-disc diffusion method was used for screening the antifungal activity of aloysia triphylla aerial parts extracts. four yeast strains (candida albicans (atcc 2091), candida kefyr, candida parapsilosis, and candida glabrata (atcc 90030)) were first grown on sabouraud chloramphenicol agar plate at 30°c for 18-24 h. several colonies of similar morphology of the clinical yeast were transferred into api suspension medium and adjusted to 2 mcfarland turbidity standards with a densimat. the inocula of the respective yeast were streaked on to sabouraud chloramphenicol agar plates at 30°c using a sterile swab and then dried. a sterilized 6 mm paper disc was loaded with 20 𝜇l (10 mg/ml) of aerial parts extract. the treated petri dishes were placed at 4°c for 1-2h and then incubated at 37°c for 18-24h. the inhibition of fungal growth was also evaluated by measuring the diameter of the transparent inhibition zone around each disc. the susceptibility of the standard was determined using a disc paper containing nystatin. 2.13. data analysis all analyses were performed in triplicate and the results expressed as mean values±standard deviations (sd). the data were subjected to statistical analysis using statistical program package statistica (statsoft, 1998). the one-way analysis of variance (anova) followed by duncan multiple range test was employed and the differences between individual mean values were significant at 𝑃 <0.05. 3. results and discussion 3.1. essential oil yields essential oil yields were determined by hydrodistillation of 100 g of aloysia triphylla dry aerial parts gathered from different localities. from these results, the optimal yield was observed in the sample of korba (0.56%) followed by the samples of kairouan, siliana and gabes. statistical examination revealed significant differences in the essential oil yield of aloysia triphylla originated from korba, and those from siliana, kairouan, and gabes. these values are closer to those reported by di leo lira et al. (2013) on essential oil yields of aloysia triphylla from argentina. when compared with other studies reported by moein et al. (2014) and el-hawary et al. (2011) on aloysia citriodora palau leaves and on lippia citriodora kunth fresh leaves, essential oil yields are higher than those of tunisia region, bearing essential oil contents of 1.3% and 0.9%, respectively. according to taghi ebadi et al. (2015), el-hawari et al. (2015), and bensabah et al. (2014), variation in the essential oil yield of aloysia triphylla is attributed to cultivation climates, edaphic variables, water quality irrigation, ripening stages, and drying methods. 3.2. variability in chemical composition of essential oil essential oils analyzed are divided into seven classes based on their chemical functional groups (table 2). ital. j. food sci., vol. 31, 2019 562 table 2. essential oils composition (peak area % w/w±sd) and analysis of variance analysis results (p-values) of essential oil aloysia triphylla aerial parts. compound* rri collection region p kairouan korba siliana gabes α-pinene 1031 0.42 c±0.03 0.55 a±0.04 0.35 d±0.02 0.44 b±0.03 0.002** sabinene 1132 0.22 a±0.01 0.13 d±0.01 0.20 b±0.01 0.19 c±0.02 0.268ns myrcene 1176 0.38 d±0.04 0.41 c±0.03 0.45 b±0.05 0.52 a±0.06 0.001** limonene 1202 7.27 c±0.54 6.34 d±0.43 7.52 b±0.74 7.80 a±0.81 0.000*** (z)-β-ocimene 1245 1.59 d±0.13 2.00 c±0.21 2.20 b±0.19 2.41 a±0.31 0.309ns γ-terpinene 1265 0.21 c±0.05 0.22 b±0.03 0.23 a±0.08 0.19 d±0.02 0.150ns cis -limonene oxide 1450 0.42 b±0.04 0.44 a± 0.03 0.39 c±0.03 0.35 d±0.03 0.501ns transsabinene hydrate 1474 0.26 a±0.02 0.15 d±0.01 0.19 c±0.02 0.24 b±0.01 0.918ns cissabinene hydrate 1556 0.23 a±0.02 0.22 b±0.02 0.20 c±0.01 0.22 b±0.02 0.034* linalol 1552 0.50 d±0.04 0.55 c±0.05 0.58 b±0.06 0.60 a±0.05 0.444ns terpinene-4-ol 1611 0.12 c±0.01 0.13 b±0.01 0.11 d±0.01 0.15 a±0.01 0.483ns α-cadinol 1620 0.49 d±0.05 0.54 c±0.05 0.58 a±0.06 0.57 b±0.07 0.009** trans-chrysanthenol 1684 0.89 a±0.07 0.77 b±0.06 0.69 b±0.07 0.68 bc±0.06 0.042* α-terpineol 1705 0.74 c±0.06 0.70 d±0.05 0.78 a±0.07 0.75 b±0.08 0.480ns cis-chrysanthenol 1762 0.58 a±0.06 0.51 b±0.05 0.40 c±0.03 0.38 d±0.03 0.004** nerol 1798 0.25 a±0.02 0.24 b±0.02 0.20 d±0.01 0.23 c±0.02 0.774ns geraniol 1856 5.57 d±0.54 6.02 b±0.59 5.87 c±0.61 6.42 a±0.54 0.024* geranyl acetate 1765 1.79 a±0.14 1.80 a±0.12 1.72 b±0.15 1.70 c±0.17 0.296ns chrysanthenone 1507 0.55 d±0.05 0.66 a±0.06 0.65 b±0.06 0.61 c±0.06 0.192ns neral 1240 17.22 b±1.80 14.81 d±1.25 15.60 c±1.44 18.73 a±1.75 0.000*** geranial 1742 25.15 c±2.15 26.85 b±2.17 27.41 a±2.45 24.85 d±2.51 0.000*** 1-8-cineole 1213 1.62 d±0.14 1.70 c±0.15 1.77 b±0.18 1.78 a±0.16 0.051ns α-cubebene 1350 0.29 b±0.03 0.33 a±0.02 0.25 c±0.03 0.28 bc±0.01 0.075ns β-cubebene 1466 0.11 c±0.01 0.10 cd±0.01 0.12 b±0.01 0.15 a±0.01 0.223ns δ-elemene 1479 0.45 d±0.03 0.48 c±0.05 0.50 b±0.06 0.55 a±0.06 0.318ns α-copaene 1497 0.16 c±0.01 0.18 b±0.01 0.19 ab±0.02 0.20 a±0.02 0.069ns β-bourbonene 1535 0.86 b±0.07 0.88 a±0.08 0.85 c±0.07 0.85 c±0.08 0.110ns cis-α-bergamotene 1560 0.46 a±0.05 0.38 b±0.03 0.35 c±0.03 0.34 c±0.02 0.003** β-copaene 1580 0.30 b±0.03 0.32 a±0.03 0.28 c±0.02 0.25 d±0.02 0.000*** α-cedrene 1583 0.52 b±0.05 0.50 d±0.04 0.53 a±0.03 0.51 c±0.06 0.910ns β-gurjunene 1597 0.36 a±0.03 0.26 b±0.02 0.21 c±0.02 0.19 d±0.01 0.036* α-caryophyllene 1610 1.64 d±0.15 2.21 c±0.20 2.23 b±0.21 2.24 a±0.25 0.244ns β-caryophyllene 1612 1.06 a±0.12 1.00 b±0.11 0.98 cd±0.07 0.99 c±0.08 0.000*** allo-aromadendrene 1630 0.48 a±0.04 0.44 b±0.03 0.41 c±0.05 0.48 a±0.05 0.000*** aromadendrene 1661 1.03 d±0.11 1.22 b±0.10 1.12 c±0.12 1.25 a±0.10 0.459ns α-amorphene 1679 1.23 d±0.12 1.40 b±0.11 1.33 c±0.10 1.52 a±0.14 0.279ns β-acoradiene 1688 0.41 b±0.03 0.40 c±0.05 0.44 a±0.04 0.38 d±0.03 0.255ns α-zingiberene 1720 0.94 a±0.08 0.85 b±0.07 0.84 c±0.08 0.83 d±0.09 0.000*** germacrene-d 1725 0.44 d±0.05 0.45 c±0.03 0.47 b±0.05 0.49 a±0.05 0.439ns bicyclogermacrene 1755 4.54 a±0.42 4.21 c±0.41 4.25 b±0.39 4.12 d±0.40 0.000*** ar-curcumene 1760 5.24 a±0.45 4.31 d±0.32 5.22 b±0.61 5.13 c±0.44 0.861ns α-cadinene 1773 0.42 c±0.04 0.40 d±0.03 0.47 b±0.05 0.48 a±0.04 0.344ns δ-cadinene 1776 0.63 d±0.05 0.68 c±0.06 0.72 b±0.07 0.77 a±0.08 0.621ns ital. j. food sci., vol. 31, 2019 563 caryophyllene oxide 2008 0.91 b±0.08 0.85 d±0.06 0.92 a±0.07 0.90 c±0.08 0.485ns (e)-nerolidol 2050 1.41 d±0.12 1.54 b±0.14 1.56 a±0.16 1.47 c±0.13 0.995ns spathulenol 2150 1.06 c±0.10 1.20 a±0.11 1.08 b±0.09 1.09 b±0.09 0.030* t-cadinol 2185 0.53 d±0.04 0.62 a±0.05 0.55 c±0.05 0.59 b±0.06 0.023* isospathulenol 2230 2.60 c±0.24 2.65 b±0.25 2.64 bc±0.26 2.66 a±0.29 0.995ns chemical classes monoterpene hydrocarbons 10.77 c±1.34 10.46 d±2.01 11.73 b±1.32 12.36 a±2.45 0.000*** monoterpene alcohols 9.14 d±0.76 9.46 b±0.95 9.21 c±0.83 9.78 a±0.89 0.000*** monoterpene esters 1.79 a±0.14 1.80 a±0.12 1.72 b±0.15 1.70 c±0.17 0.296ns monoterpene ketones 0.55 a±0.05 0.66 a±0.06 0.65 a±0.06 0.61 a±0.06 0.192ns monoterpene aldehydes 42.37 d±4.37 41.66 c±3.98 43.01 b±4.38 43.58 a±5.12 0.000*** monoterpene ethers 1.62 d±0.14 1.70 c±0.15 1.77 b±0.18 1.78 a±0.10 0.051ns sesquiterpenes 28.08 d±2.56 27.86 a±3.11 28.51 c±2.73 28.71 b±3.54 0.000*** total identified 94.29 c±7.52 93.60 d±8.64 96.60 b±8.72 98.52 a±7.24 0.000*** rri: relative retention index; ∗compounds in order of elution on hp-innowax; values of volatile essential oil percentages are the average of three determinations (n = 3). these values with different letters (a-d) are significantly different at p <0.05. ns: not significant. ∗∗p < 0.01. ∗∗∗p < 0.001. p: probability. a total of 48 compounds were identified representing 94.29%, 93.6%, 96.6%, and 98.52% of total volatiles in the samples of kairouan, korba, siliana, and gabes, respectively. these different identified compounds vary significantly (p < 0.05) from one region to another and are highly (p <0.001) affected by the regional factor (table 2). the major contribution was attributed to the monoterpene aldehydes fraction which represents 42.3%, 41.66%, 43.01%, and 43.58% of all compounds detected in kairouan, korba, siliana, and gabes samples, respectively. indeed, this latter fraction is dominated by geranial (24.85% in gabes and 27.41% in siliana) and neral (14.81% in korba and 18.73% in gabes). these results are in agreement with previous studies reported by moein et al. (2014) and taghi ebadi et al. (2015). our studies have reported that limonene was the third major compound in the essential oil of aloysia triphylla samples with a content ranging between 6.34% and 7.8% for korba and gabes samples, respectively. this result is similar to that reported by moein et al. (2014), on essential oil of aloysia citriodora palau cultivated in gardens where neral, geranial, and limonene rates reached 13.46%, 16.7%, and 12.41%, respectively. some authors reported citral to be present at a higher percentage than limonene in l. citriodora (kim and lee, 2004), while others reported the opposite (özek et al., 1996). santos-gomes et al. (2005) reported that the percentage of citral exceeded that of limonene. the ar-curcumene is the main component of sesquiterpene fraction with a rate ranging between 4.31% and 5.24% for the samples of korba and kairouan, respectively. from a statistical point of view, this compound seemed not to be affected by any regional factor. geraniol represented the main constituent in the monoterpene alcohols fraction with a percentage of 5.57%, 6.02%, 5.87%, and 6.42% in the sample of kairouan, korba, siliana, and gabes, respectively. with regard to the 1-8 cineole recognized for its antimicrobial and antifungal properties, this component showed lower amounts in all localities studied varying between 1.62% and 1.78% for kairouan and gabes samples, respectively. taghi ebadi et al. (2015) reported higher levels of 1-8 cineole in lippia citriodora kunth essential oil than those reported in our study. the 1-8 cineole content amounted to 4.5% and 7.3% in freeze dried and oven dried leaves, respectively. it must be pointed out that a variety of geographical and ecological factors can lead to qualitative and quantitative differences in the essential oil produced. at the ital. j. food sci., vol. 31, 2019 564 same time, essential oil composition can be affected by a number of other factors such as the development stage of the plant, its physiology, the age of leaves, and the growing conditions (santos gomes et al., 2005) as well as, the conditions and isolation method (crabas et al., 2003; kim and lee, 2004; santos gomes et al., 2005). 3.3. total polyphenols, flavonoids, and condensed tannins the aerial parts of aloysia triphylla were gathered from different localities, ranging from the center (kairouan), north (korba and siliana), and south (gabes) in tunisia characterized by diverse geographic and climatic conditions as mentioned in table 1. depending on its geographical origin, total polyphenols, flavonoids, and condensed tannins contents of aloysia triphylla extracts are illustrated in fig. 1. figure 1. total polyphenols (tpp), total flavonoids (tf), and total condensed tannin (tct) contents of different regions of aloysia triphylla aerial parts. gae: gallic acid equivalents; ce: catechin equivalents. the letters (a-d) indicate significant differences (p < 0.05). the results showed that the plant is a valuable source of phenolics with content ranging from 26.58 mg gae/g for kairouan to 14.25 mg gae/g for gabes, respectively. these results are lower than those cited by cheurfa and allem (2016) on hydro-alcoholic and aqueous extracts of algerian aloysia triphylla leaves. moreover, zhang and wang (2001) reported a total phenolic content of 1.55 mg gae/ g of fresh weight on aloysia triphylla herb extracted with phosphate buffer. statistical analysis revealed that the total polyphenol contents varied significantly (p < 0.05) between the four studied localities. likewise, the importance of the solvent type used in the extraction has been mentioned by choupani et al. (2014) and bettaieb rebey et al. (2012). according to vasco et al. (2008), differences in total phenol content may also be attributed to varieties, ripening stage, and post-harvest conditions (msaada et al., 2007). besides, the highest total flavonoid content was observed in kairouan (19.26±0.74 mg ec/ g) followed by korba (16.72±0.59 mg ec/g), siliana (15.3±1.46 mg ec/g), and gabes 10.59±1.1 mg ec/g), respectively. these results are much higher than those reported by vinha et al. (2012) on the aqueous extract of aloysia triphylla, showing a total flavonoid content of 43.38 mg c/100 g). it is well known that an important function of flavonoids and phenolic acids is 0 5 10 15 20 25 30 35 tpp mg gae/g dw tf mg ce/g dw tct mg ce/g dw korba kairouan gabes siliana a b c d a b c d a a b a ital. j. food sci., vol. 31, 2019 565 their action in plant defense mechanisms (dixon and paiva, 1995). indeed, flavonoids have several biological activities such as the inhibition of plasma platelet aggregation and cyclooxygenase activity, the suppression of histamine release, potent nitric oxide radical scavenging activity and exhibiting antibacterial, antiviral, anti-inflammatory and antiallergenic effects (cook and samman, 1996). among the different localities studied, no significant differences (p > 0.05) were found in the total condensed tannins contents of aloysia triphylla methanolic extracts. kairouan showed the highest total condensed tannins (1.10±0.17 mg ce/g of dw), followed in a descending order by korba (1.04±0.11 mg ce/g of dw), siliana (1.01±0.10 g ce/g of dw), and gabes (0.89±0.09 g ce/g of dw). interestingly, no condensed tannins were observed in aqueous extracts (infusion and decoction) of aloysia citriodora aerial parts (portmann et al., 2012). this finding was attributed to these authors in the absence of proanthocyanidins. meanwhile, el babili et al. (2013) reported a condensed tannins content of 1.97 g ce/kg dry in aqueous extract of verbena (verbena officinalis l.) belonging to the same botanical family (verbenacea). 3.4. individual phenolic compounds the phenolic compounds in methanol extracts of the aerial parts of aloysia triphylla were identified by a rp-hplc system. this system is a high resolution chromatographic technique widely used for simultaneous separation and quantification of phenolic substances. the results related to phenolic compounds are summarized in table 3. it is fair to say that methanol extracts of aloysia triphylla are rich in phenolics. in total, 15 compounds were identified. statistical analysis revealed that the identified compounds were significantly affected (p < 0.001) by the regional factor. the p-coumaric acid was the predominant phenolic compound. the highest content of p-coumaric acid was observed in kairouan (54.90%), followed by korba, siliana, and gabes. the second major compound was catechol with a content ranging from 6.00% to 12.23% for kairouan and korba, respectively. likewise, rp-hplc analysis was used for the identification and quantification of phenolic compounds in leaves of aloysia triphylla after extraction with a mixture of 62.5% aqueous methanol. authors reported the presence of only four compounds: caffeic acid (0.84%), ferulic acid (0.82%), hydroxytyrosol (0.4%), and apigenin (0.24%). the presence of caffeic and ferulic acids in methanol extracts of aloysia triphylla is worth noting with concentrations ranging between 0.28% and 2.39%, and 0.36% and 3.28% for korba and gabes, and gabes and siliana, respectively. furthermore, apigenin and hydroxytyrosol were not identified in our present study. the o-hydroxybenzoic acid, hydroxycaffeic acid, and 3-nitro-phthalic acid were also identified by gc-ms after sialylation according to proestos et al. (2006). three phenolic compounds; two phenolic acids, dihydrocaffeic acid and 4-hydroxycinnamic acid and a flavonoid glycoside, luteolin7-o-glucoside, were isolated and identified from the ethyl acetate fraction of the fresh aerial parts of lippia citriodora kunth cultivated in egypt (el hawary et al., 2012). luteolin 7-o glucoside was also identified in methanol extracts of the aerial parts of aloysia triphylla, which originated from korba (2.46%), siliana (0.16%), gabes (2.10%), and kairouan (0.35%). this flavonoid glycoside is one of the main flavonoid constituents in many herbs and is known to possess low oxygen radical absorbance capacity (orac) values (zhang and wang, 2001). 3.5. antioxidant activities of methanol extracts the results for antioxidant activities from the different accessions are displayed in table 4. anova analysis (table 4) showed that the methanol extracts are highly influenced by the ital. j. food sci., vol. 31, 2019 566 regional effect (antiradical activity was region-dependent). methanolic extract of kairouan sample shows the highest antioxidant activity (ic50 = 5.78±0.08 µg/ml), which was stronger than that of the positive control: bht (11.5±1.23 µg/ml). the reduced activity was observed in the sample of gabes (30.67 µg/ml). cheurfa and allem (2016) have reported antiradical of aqueous extract of algerian aloysia triphylla leaves activity with an ic50 of 27.4 mg/ml. this value was significantly higher (p < 0.05) than that of hydroalcoholic extract witnessing an ic50 of 23.52 mg/ml. on the other hand, the positive control bht exhibited a significantly lower ic50 value (p < 0.05) when compared to the two studied extracts (6.96 mg/ml). these antiradical activities are lower than those reported in our present study. other studies conducted on culinary decoction of verbena (verbena officinalis l.), belonging to the same botanical family of aloysia triphylla, showed an ic50 of 15.76 mg/ml (el babili et al., 2013). it is worth mentioning now that there is a linear correlation between total polyphenols, flavonoids, and condensed tannins, and the scavenging activity against dpph for the methanolic extracts of the aerial parts of aloysia triphylla. in fact, the methanolic extract of kairouan sample, rich in polyphenols, flavonoids, and condensed tannins, was a more effective scavenger of dpph radicals than the poor ones observed in korba, siliana, and gabes samples. consistency can be seen in our results and those obtained by cheurfa and allem (2016) who analyzed the total polyphenols, flavonoids, and scavenging activity of dpph in aqueous and hydro-alcoholic extracts of aloysia triphylla leaves. meanwhile, el-babili et al. (2013) failed to show any positive correlation between phenol contents and anti-oxidant activities according to the abts/dpph assays on culinary decoction of verbena officinalis l. besides, table 4 showed that the fe3+ reducing power of aloysia triphylla methanolic extracts differs greatly depending on accession provenance. gabes sample showed the higher reducing capacity (ec50 = 482.00 µg/ml) followed by siliana (ec50 = 371.00 µg/ml), korba (ec50 = 322.66 µg/ml), and kairouan (ec50 = 209.33 µg/ml). furthermore, in comparison with the positive control: ascorbic acid (ec50 = 37.33 µg/ml), kairouan, korba, siliana, and gabes samples methanolic extracts exhibited 6, 9, 10, and 13 fold lower activities, respectively. these results indicate that the different methanolic extracts are able to act as electron donor and, therefore, react with free radicals, converting them to a more stable products and, thereby, terminating radical chain reactions. on the other hand, statistical analysis revealed a higher region effect (p < 0.001) on reducing power (table 4). the antioxidant activity of aloysia triphylla methanolic extract was also evaluated by the βcarotene-linoleate bleaching method (table 4). this method was based on the loss of the yellow color of β-carotene due to its reaction with radicals formed after linoleic acid oxidation in emulsion. the rate of β-carotene bleaching can be slowed down in the presence of antioxidants (kulisic et al., 2004). siliana sample showed the lowest ability to prevent the bleaching of β-carotene (ic50 = 4066.67 µg/ml), whereas kairouan sample exhibited the strongest activity (ic50 = 500 µg/ml). on the other hand, all the methanolic extracts had lower antioxidant activities than bht with ic50 of 75.00 µg/ml (table 4). in addition, the β-carotene-linoleate bleaching values were highly (p < 0.001) affected by the accession provenance. it is worth mentioning that differences in antioxidant activities according to the dpph/βcarotene bleaching inhibition/reducing power might reflect differences in the ability of anti-oxidant compounds to act against the different radicals present or formed during each specific reaction. 3.6. antibacterial activity the test results of the antibacterial effect are summarized in table 5. the results showed that the diameter of the inhibition zone (iz) is highly affected by the region’s factor for ital. j. food sci., vol. 31, 2019 567 escherichia coli (atcc 35218) and bacillus subtilis (cip 5265) strains (p < 0.001). on the other hand, essential oils of aloysia triphylla did not exhibit an antibacterial activity against pseudomonas aeruginosa (atcc 4141) and enterococcus faecalis (atcc 2212) strains. the highest antibacterial activity was observed against bacillus subtilis (cip 5265) witnessing an inhibition zone equal to 85±7.67 mm for the aloysia triphylla essential oil of kairouan, followed by that of siliana (iz = 32±3 mm), korba (iz = 26±4.08 mm), and gabes (iz = 25.33±9.62 mm). the lower antibacterial activity of aloysia triphylla essential oils against escherichia coli, when compared to that against bacillus subtilis, was attributed to the cellwall of the gram-negative bacteria covered by an outer membrane (lipopolysaccharide, phospholipid and some proteins) (chao et al., 2000). this latter prevents uptake of oils or protect peptidoglycan layer from oils. hence, lipopolysaccharide (lps) membrane of gram-negative bacteria presents a permeability barrier to hydrophobic substances that can enter and inhibit the gram-positive bacteria. in gram-positive bacteria, the peptidoglycan layer is on the outside and more in contact with the oils. our results are in compliance with those reported by ali et al. (2011) who reported a very strong antibacterial activity of aloysia triphylla essential oil against bacillus subtilis (caicc) (iz ≥ 16 mm) and a negative one against escherichia coli (atcc 25922) (iz = 0 mm). the interesting antibacterial activity against bacillus subtilis was attributed to the presence of a high concentration of long-chain alcohols especially geranial and neral, particularly active against gram-positive bacteria (delaquis et al., 2002). in addition, ali et al. (2011) reported that the antibacterial nature of aloysia triphylla essential oil was apparently related to the presence of β-caryophyllene, showing in vitro activity against escherichia coli, pseudomonas aeruginosa, and staphylococcus aureus (sacchetti et al. 2004). 3.7. antifungal activity aloysia triphylla essential oils had a significant antifungal activity against the four strains of candida species studied as shown in table 5. the highest antifungal activity was recorded for the aloysia triphylla essential oil of kairouan, showing inhibition diameter zones of 85±8.27 mm, 85±7.89 mm, 85±6.59 mm, and 85±8.57 mm against candida albicans (atcc 2091), candida kefyr, candida parapsilosis, and candida glabrata (atcc 90030), respectively. these antifungal activities were higher than that observed for nystatin (iz = 25±2.68 mm) and used as a reference substance. higher antifungal activities were also observed for the aloysia triphylla essential oil of siliana with inhibition diameter zones of 85±8.04 mm for candida albicans (atcc 2091), 85±8.45 mm for candida parapsilosis, and 85±8.81 mm for candida glabrata (atcc 90030), respectively. moreover, aloysia triphylla essential oil of gabes, showed an antifungal activity higher than that of korba against candida albicans (iz = 85±2.48 mm vs 46.33±2.61 mm) and lower than those observed for the three other strains of candida studied. our results are higher than those observed by ali et al. (2011) on antifungal activity of aloysia triphylla essential oil against candida albicans caicc 51, witnessing an inhibition diameter zone between 10 and 15 mm. antifungal activity presented by aloysia tripylla essential oils could be associated with the presence of citral. in fact, literature points to the fact that citral acts as a fungicidal agent because it is capable of forming a charge transfer complex with an electron donor of fungal cells, resulting in fungal death (kurita et al., 1981). ital. j. food sci., vol. 31, 2019 568 table 3. phenolic composition (peak area %, w/w) and analysis of variance results (p-value) of methanol extracts of aloysia tripyllla aerial parts. compound collection region p kairouan korba siliana gabes resorcinol 1.19 d±0.07 1.96 a±0.07 1.72 b±0.02 1.25 c±0.01 0.000*** catechol 6.00 d±0.39 12.23 a±0.34 11.14 b±0.08 8.23 c±0.11 0.000*** epigallocatechin 1.30 b±0.06 0.09 cd±0.03 0.10 c±0.01 1.34 a±0.02 0.000*** caffeic acid 1.50 b±0.10 0.28 d±0.07 1.11 c±0.09 2.39 a±0.03 0.000*** syringic acid 1.92 b±0.28 2.10 a±0.13 1.49 c±0.13 0.96 d±0.36 0.000*** p-coumaric acid 54.90 c±1.33 38.91 a±0.53 38.81 a±2.50 38.23 b±3.34 0.000*** sinapic acid 3.97 a±0.36 1.82 c±0.18 0.86 d±0.10 3.73 b±0.32 0.000*** ferulic acid 0.38 c±0.03 1.24 b±0.04 3.28 a±0.26 0.36 d±0.03 0.000*** luteolin 7-oglucoside 0.35 c±0.02 2.46 a±0.10 0.16 d±0.03 2.10 b±0.07 0.000*** coumarin 1.45 c±0.06 0.22 d±0.02 1.63 b±0.05 1.92 a±0.21 0.000*** rutin 0.52 b±0.03 0.25 c±0.01 1.03 a±0.10 1.04 a±0.36 0.000*** rosmarinic acid 1.20 b±0.09 0.22 d±0.01 1.33 a±0.03 0.49 c±0.16 0.000*** resveratrol 0.20 d±0.01 0.61 b±0.02 0.44 c±0.11 0.76 a±0.06 0.000*** ellagic acid 0.28 d±0.13 1.26 a±0.11 0.31 c±0.02 0.70 b±0.06 0.000*** quercetin 0.26 d±0.06 0.45 b±0.05 1.39 a±0.03 0.38 c±0.40 0.000*** the values of the levels and percentages of phenolic compounds represent the average of three replicates (𝑛 = 3). letters (a-d) indicate significant differences at 𝑃 < 0.05. *** significant effect at 𝑃 < 0.001. 𝑃: probability. ital. j. food sci., vol. 31, 2019 569 table 4. dpph scavenging activity (ic50 µg/ml), reducing power (ec50 µg/ml), and β-carotene bleaching (ic50 µg/ml) and analysis of variance results (p-value) of methanol extracts of aloysia tripyllla aerial parts. collection region bht ascorbic acid kairouan korba siliana gabes p value dpph scavenging activity (ic50 µg/ml) 5.78 d±0.08 6.07 c±0.13 13.23 b±0.28 30.67 a±1.31 0.000*** 11.5±1.23 reducing power (ec50 µg/ml) 209.33 d±1.30 322.66 c±2.84 371.00 b±1.13 482.00 a±2.26 0.000*** 37.33±3.41 β-carotene bleaching (ic50 µg/ml) 500.00 c±11.32 3966.67 a±65.33 4066.67 a±65.33 1566.67 b±130.66 0.000*** 75±5.12 values are means of triplicates±sd. values in the same row with different superscripts (a–d) are significantly different at p < 0.05. *** p <0.001. table 5. antibacterial and antifungal (iz mm) activities and analysis of variance results (p-value) of essential oils of aloysia tripyllla aerial parts. collection region p tetracycline 10 µg/ml nystatin 10 µg/ml kairouan korba siliana gabes bacteria escherichia coli (atcc 35218) 12 a±1.96 11 c±1.13 8.67 d±0.65 11.33 b±0.65 0.000*** 23±2.55 pseudomonas aeruginosa (atcc 4141) na na na na 22±2.71 enterococcus faecalis (atcc 2212) na na na na 24±2.64 bacillus subtilis (cip 5265) 85 a±7.67 26 c±4.08 31.67 b±3.27 25.33 d±9.62 0.000*** 25±2.11 fungi candida albicans (atcc 2091) 85 a±8.27 46.33 a±2.61 85 a±8.04 85 b±2.48 0.000*** 25±2.68 candida kefyr 85 a±7.89 21.67 c±4.71 28.33 b±1.73 19.33 d±1.31 0.000*** 24±2.18 candida parapsilosis 85 a±6.59 28.67 b±9.15 85 a±8.45 25 c±2.56 0.000*** 25±3.05 candida glabrata (atcc 90030) 85 a±8.57 18 b±4.08 85 a±8.81 14 c±1.96 0.000*** 23±2.33 results are the mean of three replications. the diameter of disc was 6 mm. values with different superscripts (a-d) are significantly different at 𝑃 < 0.05. na: not active. ns: not significant. 𝑃: probability. ** 𝑃 < 0.01. *** 𝑃 < 0.001. ital. j. food sci., vol. 31, 2019 570 4. conclusions this study has revealed that aloysia triphylla methanolic extracts and essential oils features are markedly influenced by the regional factor. korba sample have high potential for selecting variety rich in essential oil, while kairouan sample was suitable for being a valuable source of antioxidants, including condensed tannins, flavonoids, phenolic compounds, and polyphenols. the high content of these bioactive compounds both highlights their nutritional and medicinal values and provides a high protection against oxidation phenomenon. essential oil of aloysia triphylla, which originated from kairouan stood out for presenting the best selective antibacterial and antifungal performances. additional researches on the bioactivities of aloysia triphylla might pave the way for its broad application in industrial, pharmaceutic, and cosmetic fields. references adams r.p. 2004. identification of essential oil components by gas chromatography/mass spectrometry. allured, il: carol stream. ali h.f.m., el-beltagi h.s. and nasr n.f. 2011. evaluation of antioxidant and antimicrobial activity of aloysia triphylla. elec. j. envir. agric. food chem. 10:2689-2699. bensabah f, lamiri a, and naja j. 2014. effect of purified wastewater from the city of settat (morocco) on the quality of lippia citriodora essential oil and infusion. j. saudi soc. agric. sci. 14:101-108. bettaieb rebey, i, bourgou s, ben slimen debez i, jabri karoui i, hamrouni sellami i, msaada k, limam f, and marzouk b. 2012. effects of extraction solvents and provenances on phenolic contents and antioxidant activities of cumin (cuminum cyminum l.) seeds. food bioprocess technol. 5:2827–2836. carnat a., carnat a.p., fraise d. and lamaison, j.l. 1999. the aromatic and polyphenolic composition of lemon verbena tea. fitoterapia 7:44-49. catalan c.a.n., de and lampasona m.e.p. 2002. the chemistry of the genus lippia (verbenaceae). in: kintzios, s.e. (ed.), oregano: the genera origanum and lippia, first ed. taylor and francis inc. 127-149. pp. chao s.c., young d.g. and oberg c.j. 2000. screening of inhibitory activity of essential oils on selected bacteria, fungi and viruses. j. essent. oil res. 12:639-649. cheurfa m. and allem r. 2016. evaluation of antioxidant activity of different extracts of aloysia triphylla leaves (l’herit.) from algeria in vitro. phytother. 14:181-187. choupani m., arabshahi delouee s. and alami m. 2014. antioxidant properties of various solvent extracts of lemon verbena (lippia citriodora) leaves. inter. j. adv. biol. biomed. res. 2:1340-1346. cook n.c. and samman s. 1996. flavonoidschemistry, metabolism, cardio protective effects and dietary sources. j. nutr. biochem. 7:66-76. crabas n., marongiu b., piras a., pivetta t. and porcedda s. 2003. extraction, separation and isolation of volatiles and dyes from calendula officinalis l. and aloysia triphylla (l’her.) britton by supercritical co2. j. essent. oil res. 15:350-355. delaquis p.j., stanich k., girard b. and mazza g. 2002. antimicrobial activity of individual and mixed fractions of dill, cilantro, coriander and eucalyptus essential oils. inter. j. food microbiol. 74:101-109. dewanto v., wu x., adom k. and liu r.h. 2002. thermal processing enhances the nutritional value of tomatoes by increasing total antioxidant activity. j. agric. food chem. 50:3010-3014. di leo lira p., van baren c.m., lόpez s., molina a., heit c., viturro c. and de lampasona m.p. 2013. northwestern argentina: a center of genetic diversity of lemon verbena (aloysia citriodora paláu, verbenaceae). chem. biodiv. 10:251-261. dixon r.a. and paiva n.l. 1995. stress-induced phenylpropanoid metabolism. the plant cell 7:1085-1097. ital. j. food sci., vol. 31, 2019 571 domίnguez-avila j.a., gonzález-aguilar g.a., alvarez-parrilla e. and de la rosa l.a. 2016. modulation of ppar expression and activity in response to polyphenolic compounds in high fat diets. inter. j. mol. sci. 17 (7):1002. duarte m.c.t., figueira g.m., sartoratto a., rehder v.l.g. and delarmelina c. 2005. anti-candida activity of brazilian medicinal plants. j. ethnopharmacol. 97:305-311. el babili f., babili m.e.l., souchard j.p., chatelain c. 2013. culinary decoctions: spectrophotometric determination of various polyphenols coupled with their antioxidant activities. pharm. crops, 4, 15-20. el hawary s., yousif m., abdel motaal a. and abd-el hameed l. 2011. composition and bioactivities of the essential oil from leaves of lippia citriodora kunth cultivated in egypt. j. biol. active prod. nat. 1:112-119. el-hawary s.s., yousif m.f., abdel motaal a. and abd-hameed lm. 2012. bioactivities, phenolic compounds and invitro propagation of lippia citriodora kunth cultivated in egypt. bull. fac. pharm. cairo univ. 50:1-6. european pharmacopoeia (ph. eur.) 9th ed. 2017. https://www.edqm.eu/en/european-pharmacopoeia-9th-edition. hanato t., kagawa h., yasuhara t. and okuda t. 1988. two new flavonoids and other constituents in licorice root: their relative astringency and radical scavenging effect. chem. pharm. bul.l 36:1090-1097. kim n.s. and lee d.s. 2004. headspace solid-phase microextraction for characterization of fragrances of lemon verbena (aloysia triphylla) by gas chromatography mass spectrometry. j. sep. sci. 27:96-100. koleva i.i., teris a.b., jozef p.h., linssen a.g., lyuba n.e. 2002. screening of plant extracts for antioxidant activity: a comparative study on three testing methods. phytochem. anal. 13, 8–17. kulisic t., radonic a., katalinic v. and milos m. 2004. use of different methods for testing antioxidative activity of oregano essential oil. food chem. 85:633-640. kurita n., miyaji m., kurane r. and takahara y. 1981. antifungal activity of components of essential oils. agric. biol. chem. 45:945-952. magwa m.l., gundidza m., gweru n. and humphrey g. 2006. chemical composition and biological activities of essential oil from the leaves of sesuvium portulacastrum. j. ethnopharmacol. 103:85-89. mau j.l., chang c.n., huang s.j. and chen c.c. 2004. antioxidant properties of methanolic extracts from grifola frondosa, morchella esculenta and termitoymyces albuminosus mycelia. food chem. 87:111-118. moein m.m., zarshenas m. and etemadfard h. 2014. essential oil composition and total flavonoid content of aloysia citriodora palau under different cultivation systems. inter. j. plant anim. envir. sci. 4:353-358. msaada k., hosni k., ben taarit m., chahed t., kchouk m.e. and marzouk b. 2007. changes on essential oil composition of coriander (coriandrum sativum l.) fruits during three stages of maturity. food chem. 102:1131-1134. oyaizu m. 1986. studies on products of browning reaction: antioxidative activity of products of browning reaction. jap. j. nutr. 44:307-315. özek t., kirimer n., baser k.h.c. and tümen g. 1996. composition of the essential oil of aloysia triphylla (l’herit.) britton grown in turkey. j. essent. oil res. 8:581-583. pascual m.e., slowing k., carretero e., šanchez mata d. and villar a. 2001. lippia: traditional uses, chemistry and pharmacology: a review. j. ethnopharmacol. 76:201-214. portmann e., lópez nigro m.m., reides c.g., llesuy s., ricco r.a. and wagner m.l. 2012. aqueous extracts of lippia turbinata and aloysia citriodora (verbenaceae): assessment of antioxidant. inter. j. toxicol. 31:192-202. proestos c., boziaris i.s., nychas g.j.e. and komaitis m. 2006. analysis of flavonoids and phenolic acids in greek aromatic plants: investigation of their antioxidant capacity and antimicrobial activity. food chem. 95:664-671. quirantes-piné r., funes l., micol v., segura-carretero a. and fernández-gutiérrez a. 2009. high-performance liquid chromatography with diode array detection coupled to electrospray time-of-flight and ion-trap tandem mass spectrometry to identify phenolic compounds from a lemon verbena extract. j. chromatogr. a 1216:5391-5397. rίos j.l. and recio m.c. 2005. medicinal plants and antimicrobial activity. j. ethnopharmacol. 100:80-84. sacchetti g., medici a., maietti s., radice m., muzzoli m. and manfredini s. 2004. composition of functional properties of the essential oil of amazonian basil, ocimum micranthum willd. labiatae in comparison with commercial essential oils. j. agric. food chem. 52:3486-3491. ital. j. food sci., vol. 31, 2019 572 santos-gomes p.c., fernandes-ferreira m. and vicente a.m.s. 2005. composition of the essential oils from flowers and leaves of vervain (aloysia triphylla (l’herit.) britton) grown in portugal. j. essent. oil res. 17:73-78. sharma a., flores-vallejo r.d.c. cardoso-taketa a. and villarreal m.l. 2016. antibacterial activities of medicinal plants used in mexican traditional medicine. j. ethnopharmacol. 208:264-329. statsoft. 1998. statistica for windows (computer program electronic manual); statsoft inc.: tulsa, ok. sun b., ricardo-da-silva j.m. and spranger i. 1998. critical factors of vanillin assay for catechins and proanthocyanidins. j. agric. food chem. 46:4267-4274. taghi ebadi m., azizi m., sefidkom f. and ahmadi n. 2015. influence of different drying methods on drying period, essential oil content and composition of lippia citriodora kunth. j. app. res. med. arom. plants. 2:182-187. teixeira duarte m.c., leme e.e., delarmelina c., soares aa., figueira g.m. and sartoratto a. 2007. activity of essential oils from brazilian medicinal plants on escherichia coli. j. ethnopharmacol. 111:197-201. valentão p., andrade p.b., areias f., ferreres f. and seabra r.m. 1999. analysis of vervain flavonoids by hplc/diode array detector method. its application to quality control. j. agric. food chem. 47:4579-4582. vasco c., ruales j. and kamal-eldin a. 2008. total phenolic compounds and antioxidant capacities of major fruits from ecuador. food chem. 111:816-823. vinha a.f., soares m.o., castro a., santos a., oliveira m.b.p.p. and machado m. 2012. phytochemical characterization and radical scavenging activity of aqueous extracts of medicinal plants from portugal. eur. j. med. plants 2:335-347. zhang w. and wang s.y. 2001. antioxidant activity and phenolic compounds in selected herbs. j. agric. food chem. 49:5165-5170. paper received october 10, 2018 accepted february 1, 2019 ijfs#1521_bozza ital. j. food sci., vol. 31, 2019 731 paper antioxidant capacity and heat damage of powder products from south american plants with functional properties a. brizzolaria1, a. brandolini*b, p. glorio-pauletc and a. hidalgo*d a department of health sciences, università degli studi di milano, via di rudinì 8, 20142 milan, italy bconsiglio per la ricerca in agricoltura e l’analisi dell’economia agraria unità di ricerca per la zootecnia e l’acquacoltura (crea-za), via forlani 3, 26866 s. angelo lodigiano (lo), italy c universidad nacional agraria la molina, facultad de industrias alimentarias, departamento de ingeniería de alimentos y productos agropecuarios. av. la molina s/n, lima 12, peru d department of food, environmental and nutritional sciences (defens), university of milan, via celoria 2, 20133 milan, italy 1present address: dan europe research division, dan europe foundation, roseto degli abruzzi (te), italy *corresponding author: andrea.brandolini@crea.gov.it; alyssa.hidalgovidal@unimi.it abstract aim of the study was to evaluate color, total polyphenol content (tpc), antioxidant capacity (abts, frap, dpph), reducing sugars and heat damage (furosine, hydroxymethylfurfural, glucosylisomaltol) of 21 commercial powder products obtained from south-american fruits (mesquite, lucuma, camu camu), seeds (amaranth, purple maize), roots and tubers (yacon, maca, mashua, tocosh), bark (cat’s claw) and leaves (graviola). tpc and antioxidant capacity were maximum in camu camu and cat’s claw powders, and minimum in tocosh, amaranth, lucuma and maca; graviola, mashua, purple maize and mesquite also showed good antioxidant properties. yacon, mashua and lucuma powders had high reducing sugars content (40.9, 34.4 and 21.2 g/100 g dm, respectively) and heat damage (hmf 146.6 mg/kg, furosine 2399.8 and 2228.4 mg/100 g protein, respectively). overall, camu camu powders and cat’s claw were the most interesting products, having high levels of total polyphenols and antioxidant capacity together with very low heat damage. keywords: camu camu, cat’s claw, maca, mashua, mesquite, yacon ital. j. food sci., vol. 31, 2019 732 1. introduction a major threat to human wellbeing is the oxidative stress, an “imbalance between oxidants and antioxidants in favour of the oxidants” (sies, 1997), which can lead to cellular damage and facilitate the insurgence of cardiovascular and neurodegenerative diseases, diabetes mellitus, cancer and inflammatory illness (uttara et al., 2009). an effective approach to prevent oxidative stress is to include in the daily diet products rich in antioxidants, which can quench the oxygen free radicals, preventing the oxidation of the cell membrane. plants and plant-derived ingredients have been used as medical remedies from prehistoric ages, and still are a major source of health-promoting elements. in recent years, the interest in the identification and utilization of plants rich in antioxidant compounds to limit the oxidative stress (almeida et al., 2011; krishnaiah et al., 2011) has been steadily growing, because they may behave as preventive medicine. several authors have reviewed the beneficial uses of underexploited and little-known plant species used in food production but also in traditional medicine (e.g. biel et al., 2017; campos et al., 2013; chirinos et al., 2013; contreras-calderón et al., 2011; krishnaiah et al., 2011). peru, thanks to its widely diversified climatic zones, is home to a broad array of endemic plants, which show huge differences in the content and type of nutrients and that are potential sources of valuable bioactive compounds (campos et al., 2018). the antioxidant capacities of plant-derived products vary depending on their content in polyphenols, vitamin c, tocols and carotenoids, (saura-calixto and goñi, 2006), as well as on the different processing conditions. while in some cases the plant products are consumed fresh, most often they undergo some type of transformation and/or drying to improve shelf life, to lower transport costs and to reach far off consumers (cinar, 2018). accordingly, powders from south-american plants with known health-promoting features (supplementary table 1) are manufactured by several industries to find new market niches and to foster the consumption of health-promoting natural products. these innovative powder products, obtained from fruits (mesquite, lucuma and camu camu), seeds (amaranth and purple maize), roots and tubers (yacon, maca, mashua and tocosh), bark (cat’s claw) and leaves (graviola), are currently used for the preparation or enrichment of infusions, juices, shakes/smoothies, yogurts, desserts, as well as ingredients in cosmetic and pharmaceutical recipes. the aim of our study was to evaluate some characteristics of these powder products for their possible utilization as enhancing ingredients in wheat-based oven products. to achieve this goal, 21 commercial powder samples of the above-mentioned species were assessed for color, total polyphenol content, antioxidant capacity, reducing sugars and heat damage. 2. materials and methods 2.1. samples the powders analyzed were acquired in 2016 at an industrial fair dedicated to peruvian export products (expoalimentaria, lima, peru; www.expoalimentariaperu.com) except amaranth, obtained from the peruvian market, and two maca samples, bought from the italian market. several samples (3-5) of each powder product were collected. a detailed list of the products tested is presented in table 1. ital. j. food sci., vol. 31, 2019 733 2.2. physical and chemical analyses 2.2.1 color the color coordinates l* (luminosity), a* (red-green) and b* (yellow-blue) of the samples were scored with a tristimulus colorimeter (chroma meter cr-300, minolta italia s.p.a., italy) using the standard-white reflector plate and illuminant c. four measurements for each sample were performed. table 1. samples analyzed: species, brands, codes, average dry matter and protein contents (g/100 g). product species brand code sample code dry matter protein bark cat’s claw uncaria tomentosa l. a cat’s claw 1 91.8 0.3 cat’s claw bio uncaria tomentosa l. b cat’s claw 2 92.8 2.7 cat’s claw tea uncaria tomentosa l. b cat’s claw tea 92.5 3.0 seeds amaranth flour amaranthus caudatus l. c amaranth fr 90.4 11.5 amaranth flakes amaranthus caudatus l. d amaranth fs 90.4 8.8 purple maize zea mays l. b purple maize 90.3 7.0 roots yacon smallanthus sonchifolius (poepp. &t endl.) h. robinson b yacon 87.8 1.8 maca gluten free lepidium meyenii chacon e maca 1 85.9 10.6 maca bio lepidium meyenii chacon b maca 2 87.3 9.0 maca hp lepidium meyenii chacon b maca 3 90.3 8.5 maca extract lepidium meyenii chacon a maca 4 85.4 9.3 maca lepidium meyenii chacon a maca 5 86.6 7.7 maca root lepidium meyenii chacon f maca 6 92.9 12.0 maca energia lepidium meyenii chacon g maca 7 90.4 7.0 tubers tocosh solanum spp. h tocosh 83.4 2.2 mashua tropaeolum tuberosum ruiz & pav. e mashua 84.7 9.0 leaves graviola bio annona muricata l. b graviola 91.9 10.8 graviola tea annona muricata l. b graviola tea 91.0 11.0 fruits mesquite prosopis spp. b mesquite 89.3 8.7 lucuma pouteria lucuma ruiz & pav. b lucuma 88.9 3.4 camu camu myrciaria dubia (kunth) mcvaugh b camu camu 87.4 5.4 ital. j. food sci., vol. 31, 2019 734 2.2.2 dry matter and protein content dry matter was determined following the gravimetric method, drying 2 g of product at 130 °c for 90 min; protein content was assessed by kjeldahl (n x 6.25). these and all the following analyses were performed in triple. 2.2.3 samples preparation for total polyphenols content and antioxidant capacity analysis all the reagents, of analytical grade, were purchased from sigma-aldrich co. (milan, italy). two different solvents were tested for the extraction of total polyphenols and the evaluation of the antioxidant capacity, i.e. ethanol:h2o (etoh:h2o; 80:20) and methanol:h2o:acetic acid (meoh:h2o:acet; 50:42:8). exactly 0.15 g of powdered product were weighed in 2 ml tubes and subjected to three extractions, adding 1 ml of an etoh:h2o solution each time. in the first extraction, the samples were stirred with a vortex (reax 2000, meindolph heidolph, schwabach, germany) for 1 min and sonicated (f5200b, decon, uk) twice for 20 min; in the second extraction the samples were stirred with a vortex for 1 min, an orbital shaker (multirotator grant-bio, cambridge, uk) for 20 min and sonicated for another 20 min; in the third extraction the samples were stirred with a vortex for 1 min and sonicated for 5 min. after each extraction, the samples were centrifuged with a 4224 centrifuge (alc apparecchi per laboratori chimici srl, milan, italy) for 5 min at 8048 g and all the supernatants were mixed in a single tube. the extractions were performed at 10 °c and away from light as far as possible. following the same procedures, 0.3 g of powdered product underwent three extraction cycles, adding respectively 1.5, 1.5 and 1.0 ml of a meoh:h2o:acet solution. 2.2.3.1 total polyphenol content total polyphenol content (tpc) in samples extracted with etoh:h2o and meoh:h2o:acet was assessed with the folin-ciocalteu method as described by brandolini et al. (2013) using a du-62 beckman spectrophotometer (beckman coulter, nyon, vd, switzerland). the tpc, in mg gallic acid equivalent (gae)/kg dm, was computed from a reference curve obtained from six gallic acid concentrations (range: 0-150 mg/l). 2.2.3.2 assessment of antioxidant capacity using the abts method the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (abts) radical scavenging capacity was analysed as described by yilmaz et al. (2015). a stable stock solution of the abts radical cation was prepared by reacting 10 ml of an aqueous solution of 2-2’azinobis-3-etilenbenzotiazoline 7 mm and 176 µl potassium persulfate 140 mm in the dark at room temperature for 12-16 h. the etoh:h2o or meoh:h2o:acet extracts (150 ml) were reacted with 5 ml of a diluted abts radical solution in ethanol (absorbance: 0.70±0.02 au at 734 nm); the absorbance was measured at 734 nm, after 6 min at 30 °c, with a v650spectrophotometer (jasco, japan), using ethanol as blank. the antioxidant capacity was evaluated as percentage of absorbance decrease (inhibition percentage). a reference curve was built with 11 concentrations (from 0.05 to 0.72 mm) of trolox. the results are expressed as mmol trolox equivalents (te)/kg dm. ital. j. food sci., vol. 31, 2019 735 2.2.3.3 assessment of the reduction power using the frap method the ferric reducing antioxidant power (frap) was determined as described by yilmaz et al. (2015), following the method proposed by benzie and strain (1996). briefly, 200 ml of etoh:h2o or meoh:h2o:acet extracts were mixed with 4.5 ml frap reagent. absorption was measured with a v650 spectrophotometer (jasco, japan) at a wavelength of 593 nm after 60 min incubation at 37 °c; acetate buffer 0.3 m ph 3.6 was used as blank. the frap reagent, prepared daily, consisted of 0.3 m acetate buffer (ph 3.6), 10 mm 2,4,6-tris(2pyridyl)-s-triazine (tptz) in 40 mm hcl and 20 mm fecl3 (10:1:1 v/v/v). frap values were obtained by comparing the results to a calibration curve built with 18 concentrations (0.06 0.90 mm) of trolox. the antioxidant capacity was expressed as mmol te/kg dm. 2.2.3.4 assessment of antioxidant capacity using the dpph method the 2,2-diphenyl-1-picrylhydrazyl (dpph) radical cation scavenging capacity of etoh:h2o and meoh:h2o:acet extracts was evaluated according to brandolini et al. (2013) using a du-62 spectrophotometer (beckman, usa). for each extract five different dilutions were analysed. a dose-response line was computed for each sample and the powder quantity needed to scavenge 50% of the radical (i50) was determined. a reference regression line was computed for the antioxidant trolox, with concentrations between 3 and 50 μm. the antioxidant capacity was expressed as ratio between i50 of trolox and i50 of the sample, i.e. mmol te/kg dm. 2.2.4 sugars content fructose, glucose, maltose and sucrose were assessed by hplc, following hidalgo and brandolini (2011). for peak quantification, sugars calibration curves were constructed using 15 different concentrations (between 0 and 155 mg/l) of fructose, 19 different concentrations (between 0 and 428 mg/l) of glucose, 19 different concentrations (between 0 and 385 mg/l) of maltose, and 15 different concentrations (between 0 and 153 mg/l) of sucrose standards (sigma, st. louis, mo, usa). the calibration curves, after log transformation, were linear (r2 = 1.00; p≤0.001) in the concentration ranges considered. the results are reported as g/100 g dm. 2.2.5 heat damage indices furosine was determined by hplc as described by hidalgo and brandolini (2011). a calibration curve was built using nine different concentrations (between 0.33 and 5.13 mmol/l of furosine dihydrochloride (neomps, polypeptide laboratories, strasbourg, france) in 3 n hcl. the calibration curve was linear (r2 = 1.00; p≤0.001) in the concentration ranges considered. the results are expressed as milligrams of furosine/100 g of protein. hydroxymethlfurfural (hmf) and glucosylisomaltol (gli) were determined following the hplc method of rufián-henares et al. (2008) as described by hidalgo and brandolini (2011). for peak quantification, a calibration curve was constructed using 13 different concentrations (between 0 and 6.25 mg/l) of hmf (safc, st. louis, mo, usa). the calibration curve was linear (r2 = 1.00; p≤0.001) in the concentration range considered. gli quantification was computed considering the response factor of hmf at 280 nm. the results are expressed as mg/kg dm. ital. j. food sci., vol. 31, 2019 736 2.3. statistical analysis the data were processed by one-way analysis of variance (anova) considering the samples as factors. the distribution of the data was checked and, for normalization purposes, l* and b* values were squared, while the other parameters were log10transformed; however, for easier comprehension, in tables and figures the original data are reported. when significant differences were found (p≤0.05), fisher’s lowest significant difference (lsd) was computed at a 95% significance level. to compare the results of the two solvents used for the preparation of the extracts, the t-test was applied (p≤0.05). anova, lsd test and t-test were conducted using the statistical program statgraphics® centurion. mean, standard error and coefficient of variation were computed using the program excel (microsoft® office excel 2007). principal components analysis (pca), performed considering the mean values of the 21 samples and all the parameters, was carried out with the software the unscrambler x 10.2 (camo software as, norway). 3. results and discussion 3.1. powders color supplementary table 2 shows the average values and the results of the lsd test for the color coordinates l*, a*, b* of the twenty-one samples. the results obtained grouping the samples by species are reported in fig. 1. figure 1. colour coordinates (l*, a*, b*) of powdered products from 11 species. different letters indicate significant differences (lsd, p≤0.05) among species. the broad heterogeneity of the samples led to an anova (not presented) showing significant differences for all the parameters. in fact, a preliminary visual control gave the following color characterization: mashua and purple corn were purple; maca, yellowc e a d g g d cd g f b 0 10 20 30 40 50 b* c bc bc ef bc g e d ab f a 0 10 20 30 40 50 a* d c d f g a b c e b e 0 20 40 60 80 100 camu camu lucuma mesquite graviola mashua tocosh maca yacon purple maize amaranth cat's claw l* ital. j. food sci., vol. 31, 2019 737 orange; cat's claw, mesquite and yacon, orange; graviola, green-brown; camu camu, yellow-brown; tocosh, white; amaranth, cream-white; lucuma, ocher. the tocosh powder was the brightest (l*: 86.6), followed by most maca samples (76.2-83.9) and amaranth (78.5-80.3). one maca (maca 4) had an l* of 72.0, lower than the other maca samples. camu camu had a l* like the lyophilized samples (60.45±2.78) and higher than the spouted bed dried samples (36.6-40.8) described by fujita et al. (2013). overall, mashua presented the lowest brightness (28.3), followed by graviola (43.3-41.0). cat’s claw and purple corn scored the highest a* red component values (12.1-13.5 and 10.8, respectively), while tocosh presented the lowest (0.5). the variation among the different maca samples was quite limited, ranging from 1.2 (maca 7) to 5.1 (maca 4). mesquite presented the highest b* yellow component (34.1), followed by cat’s claw (on average 31.6), five maca samples (22.2-26.2) and graviola (on average, 25.6); maca 1 and maca 4 had values different from the other maca (28.3-30.2). purple corn presented the lowest b* value, hence the major blue component (2.8), followed by mashua (5.3) and tocosh (9.7). the differences observed between maca samples may be due either to the different treatments utilized for their preparation (onwude et al., 2017) or to cultivars with different chromatic characteristics. no information or comparisons for the color components are available in literature. 3.2. total polyphenol content supplementary table 3 reports the results of tpc, performed on the etoh:h2o and meoh:h2o:acet extracts, as well as the results of the lsd test comparing the products. the great heterogeneity of the samples led to anovas (not shown) always with significant differences. the average values, obtained by grouping the samples according to the species, are depicted in fig. 2. figure 2. total polyphenol content (tpc) of the ethanol 80% (etoh:h2o) and methanol:h2o:acetic acid (meoh:h2o:acet) extracts of powdered products from 11 species. different letters indicate significant differences (p ≤0.05) among species. a g ef cd bc i g f de h b 0 10 20 30 40 50 60 70 80 90 tpc (mg gae/kg dm) meoh:h2o:acet a e d c bc g e d c f b 0 10 20 30 40 50 60 70 80 90 camu camu lucuma mesquite graviola mashua tocosh maca yacon purple maize amaranth cat's claw tpc (mg gae/kg dm) etoh:h2o ital. j. food sci., vol. 31, 2019 738 etoh:h2o showed a lower tpc extraction capacity than meoh:h2o:acet, but the information provided was similar, as demonstrated by their very high linear coefficient of correlation (r=0.98). tpc was maximum for camu camu (38.3 and 76.4 g gae/kg dm, respectively), followed by cat's claw 2 (24.2 and 53.6 g gae/kg dm, respectively); the lowest tpcs were recorded in tocosh (2.5 and 2.8 g gae/kg dm), amaranth (on average, 3.1 and 2.8 g gae/kg dm), lucuma (2.8 and 7.5 g gae/kg dm) and six maca samples (on average, 3.6 and 6.7 g gae/kg dm). the values generally fell within the range of variation reported in the literature for camu camu (fujita et al., 2013), cat’s claw (berlowski et al., 2013; galvez ranilla et al., 2010), amaranth (repo-carrascovalencia et al., 2010), lucuma (fuentealba et al., 2016), mesquite (cardozo et al., 2010), maca (galvez ranilla et al., 2010; campos et al., 2013), mashua (chirinos et al., 2007; chirinos et al., 2013), yacon (campos et al., 2013), but were lower than those described for graviola frozen pulp (zielinski et al., 2014). for peruvian purple maize the information available on tpc is reported in chlorogenic acid equivalent and is not directly comparable to our results, while for tocosh no similar information was found in literature. the folin-ciocalteu method sometimes overstates total phenolics content because other compounds, including reducing sugars (e.g. glucose and fructose), may interfere with the results; however, in this research the powders with the highest sugars content (yacon, mashua, lucuma and maca), generally have low tpc; conversely, the two highest tpc values were from camu camu and cat’s claw, which showed very low sugars content. 3.3. antioxidant capacity the antioxidant capacity of the samples, assessed by the abts, frap and dpph tests carried out on the etoh:h2o and meoh:h2o:acet extracts are shown in supplementary table 3, along with the results of the lsd test. the great heterogeneity among samples led to anovas (not presented) always indicating significant differences, as previously remarked for color and total polyphenols content. the average antioxidant capacities obtained by grouping the samples according to the type of product are presented in fig. 3. the abts, frap and dpph tests give similar and highly correlated results (r between 0.98 and 1.00 for both etoh:h2o and meoh:h2o:acet extracts). a higher antioxidant capacity was observed in the meoh extracts, the exceptions being amaranth (for all three methods), maca and tocosh (abts), graviola tea and maca 5 (dpph). camu camu, which had the highest tpc concentration (fig. 2) but also an outstanding vitamin c content (fujita et al., 2013), showed the highest antioxidant capacity (fig. 3), followed by cat’s claw, graviola, mashua, purple maize and mesquite. on the other hand, tocosh, amaranth, yacon, maca and lucuma had low antioxidant activities, like that of wheat (yilmaz et al., 2015). comparable results were reported for camu camu (dpph: 153-185 mmol te/g fw; chirinos et al., 2010), cat’s claw (abts: 513 mmol te/kg dm; berlowski et al., 2013), graviola (abts: about 200 mmol te/kg dm; berlowski et al., 2013), mashua (abts: 24.3-247.7 mmol te/g dm; dpph: 23.2-157.1 mmol te/g dm; chirinos et al., 2013), mesquite (abts: 57.0-61.6 μmol te/g dm; cardozo et al., 2010), yacon (abts 23-136 mmol te/g dm; campos et al., 2012), purple maize (dpph: 23.1 mmol te/g dm; cevallos-casals and cisneros-cevallos, 2003), lucuma (abts: 5.6-304.6 mmol te/g dm; dpph: 0.7-132.9 mmol te/g dm; fuentealba et al., 2016) and amaranth (abts: 3.7 mmol te/g dm; dpph: 1.2 mmol te/g dm; chirinos et al., 2013). on the other hand, those of maca were slightly lower than the levels (abts: 67 mmol te/g dm) observed by fuentealba et al. (2016). ital. j. food sci., vol. 31, 2019 739 figure 3. antioxidant capacity (abts, frap and dpph tests,)of the ethanol 80% (etoh:h2o) and methanol:h2o:acetic acid (meoh:h2o:acet) extracts of powdered products from 11 species. different letters indicate significant differences (p ≤0.05) among species. 3.4. sugars content the anova (not presented) showed the existence of significant differences for sugars content among samples. the average values and the results of the lsd test for the different sugars are reported in supplementary table 2. the reducing sugars results obtained grouping the samples by species are presented in fig. 4. a e d c cd h f ef d g b 0 400 800 1200 1600 2000 camu camu lucuma mesquite graviola mashua tocosh maca yacon purple maize amaranth cat's claw abts (mmol te/kg dm) etoh:h2o a e d c bc g e e cd f b 0 400 800 1200 1600 2000 abts (mmol te/kg dm) meoh:h2o:acet a e d c bc g e d c f b 0 400 800 1200 1600 2000 camu camu lucuma mesquite graviola mashua tocosh maca yacon purple maize amaranth cat's claw frap (mmol te/kg dm) a * g ef cd bc i g f de h b 0 400 800 1200 1600 2000 frap (mmol te/kg dm) a e cde abc abc g e cde bcd f ab 0 100 200 300 400 camu camu lucuma mesquite graviola mashua tocosh maca yacon purple maize amaranth cat's claw dpph (mmol te/kg dm) a f de d bc h g e cd h b 0 100 200 300 400 dpph (mmol te/kg dm) ital. j. food sci., vol. 31, 2019 740 figure 4. reducing sugars (fructose, glucose and maltose) and heat damage indices (furosine; hydroxymethylfurfural, hmf; glycosylisomaltol, gli) of powder products from 11 species. different letters indicate significant differences (p ≤0.05) among species. fructose and glucose were detected in all samples, and were particularly abundant in yacon, mashua and lucuma; maltose was detected only in cat’s claw, most maca samples, lucuma and graviola. overall, yacon (40.9 g/100 g dm), mashua (34.4 g/100 g dm) and lucuma (21.2 g/100 g dm) showed the highest content of reducing sugars, which, on the other hand, were almost absent in tocosh (0.11 g/100 g dm) and amaranth (0.30 g/100 g dm). sucrose (a non-reducing sugar, but a possible source of monosaccharides) was present in moderate quantities in mesquite, maca, mashua, lucuma and yacon (42.5, 25.9, 16.4, 8.30, 8.20 g/100 g dm, respectively) and was very scarce in all the other products. the presence of reducing sugars is important, because they are one of the basic reactants involved in the formation of amadori products during the maillard reaction, when exposed to high temperatures (e.g. oven drying, cooking, baking): therefore, higher reducing sugars concentrations forebode higher heat damage during products manufacturing. among the plants tested, yacon is a well-known source of fructo-oligosaccharides (campos et al., 2012) and our results are confirmed by the observations (49.2 g/100 g) of scher et al. (2009). the reducing sugars content found in mashua is de a c c a f bc b de e de 0 500 1000 1500 2000 2500 3000 camu camu lucuma mesquite graviola mashua tocosh maca yacon purple maize amaranth cat's claw furosine (mg/100 g protein) f bcd bcd de bc de bcd a f e cd 0 20 40 60 80 100 120 140 160 hmf (mg/kg dm) 0 2 4 6 8 10 12 gli (mg/kg dm) bc a bc bc a e b a cd d c 0 5 10 15 20 25 30 35 camu… lucuma mesquite graviola mashua tocosh maca yacon purple… amaranth cat's claw fructose (g/100 g) bcd a cd de a f c ab de ef cd 0 5 10 15 20 25 30 35 glucose (g/100 g) ​ ab ​ c ​ ​ a ​ ​ ​ bc 0 5 10 15 20 25 30 35 maltose (g/100 g) ital. j. food sci., vol. 31, 2019 741 analogous to the quantity (6.4-45.3 g/100 g dm, average 28.4 g/100 g dm) reported by guevara-freire et al. (2018), while those of maca are slightly lower than the value (13.10±0.17 g/100 g dm) described by rondán-sanabria and finardi-filho (2009), and that of mesquite is slightly inferior to the data (3.17-3.74 g/100 g dm) reported by cardozo et al. (2010) for different prosopis spp. for fructose and glucose content our lucuma results are within the broad range of variation (1.28-12.71 and 2.48-17.37 g/100 g dm) reported by fuentealba et al. (2016), and the amaranth ones are very similar to those (0.12 and 0.34 g/100 g dm) presented by gamel et al. (2006). 3.5. heat damage the anova (not presented) showed the existence of significant differences for heat damage among the samples. the average values and the results of the lsd test for heat damage indices, i.e. furosine, gli and hmf, are reported in supplementary table 2. the results obtained grouping the samples by species are reported in fig. 4. non-enzymatic browning in dried products may be influenced by water activity, drying temperature, ph and chemical composition of foods (sagar and suresh kumar, 2010). furosine is an index of the first steps of maillard reaction, while gli and hmf are markers of intermediate phases; gli is formed by the heating of maltose and aminoacids (especially glutamine), while hmf is created not only by degradation of amadori compounds but also of sugars. furosine content was very high in mashua and lucuma (>2000 mg/100 g protein), high in yacon and most maca samples and low in camu camu, amaranth, purple maize as well as in two cat’s claw samples. maca 6 and maca 7 had significantly lower furosine content than the other maca samples. hmf was high only in yacon, but was detected, at lower levels, in several other samples, while gli was found only in maca 3, maca 6 and cat’s claw 1. no maillard reactions developed in tocosh (a characteristic food, obtained by natural bacterial fermentation of straw-wrapped potatoes kept in running water for several months) as furosine and gli were lower than the detection limit and hmf was very low, while camu camu, purple maize, amaranths, and cat’s claw tea had limited heat damage (low furosine levels and generally below-detection gli and hmf). furfural, an indicator of more advanced maillard reaction stages mainly produced by pentose degradation or thermal degradation of hmf during caramelization, was absent in all samples, even if the method used for gli and hmf analysis is able to determine its presence. since water activity values for all the samples were very similar, ranging between 0.492 and 0.585, and no correlation between heat damage indices and protein content (table 1) exists, the development of the maillard reaction seems completely attributable to processing conditions and reducing sugar concentration. the lofty heat damage of yacon (981.3 mg/100 g protein of furosine and 146.6 mg/kg dm of hmf) is justified by its high fructose and glucose content and by the strong thermal treatment needed to inactivate its highly thermostable polyphenol oxidase enzyme (neves da silva, 2007) for a luminous color (fig. 1). these conditions lead to the degradation of the amadori compounds and to the formation of intermediate compounds (i.e. hmf). the furosine levels of the other samples correlate well to the concentration of reducing sugars (r = 0.93). thus, mashua, lucuma and most of maca powders with relevant content of reducing sugars have high furosine levels while samples with low reducing sugars content present limited furosine. however, furosine alone is not suitable to completely describe the heat damage of all powder products. the presence of hmf (0.9-11.8 mg/kg dm) in most samples points to ital. j. food sci., vol. 31, 2019 742 an intermediate development of maillard reaction. the samples with detectable gli (maca 3, maca 6 and cat’s claw 1) showed the highest maltose levels but relatively low reducing sugar concentrations (4.0-7.7 g/100 g dm). the simultaneous formation of hmf suggests higher-than-the-average processing temperatures for these samples. a similar hypothesis can be made for some samples with very low reducing sugar concentrations (0.2-2.5 g/100 g dm) and significant hmf content (1.3-6.0 mg/kg dm). to the best of our knowledge, no information on heat damage in this type of powder products is available. with reference to other vegetables, furosine contents of 14-262 mg/100 g protein (rufián-henares et al., 2013) and of 457-1172 mg/100 g protein (bignardi et al., 2016) are reported in sweet pepper and in dried red chili pepper, respectively; similarly, ríos-ríos et al. (2018) describe furosine concentrations of 46.6110.1 mg/100 g protein in black garlic powder, while hmf levels of 1.3-9.5 mg/kg dm are recorded by soria et al. (2009) in carrots dried under different conditions. 3.6. principal components analysis fig. 5 depicts the biplots of scores and loadings obtained by the principal components analysis (pca) performed considering all samples and parameters. pc1 and pc2 describes 46% and 16% of variation (fig. 5a), while pc3 and pc4 10% and 9% (fig. 5b); therefore, the initial four pc explain 81% of total variation. the pca unmistakably separates the different species. pc1, characterized by antioxidant properties, differentiates camu camu and cat’s claw along the left side, while pc2, mainly related to heat damage, positions mashua, yacon and lucuma in the upper side (high furosine, hmf, glucose and fructose contents), and maca 3, maca 6, amaranth and tocosh in the bottom side (high l*, gli, maltose and protein). pc3 further splits purple maize, graviola, amaranth and tocosh, from mesquite and maca samples, while pc4 divides mashua (top of the plot, characterized by high protein and furosine contents) from yacon (bottom, high hmf and l*); maca 3 sits alone in a spot defined by high gli content. ital. j. food sci., vol. 31, 2019 743 figure 5. bi-plot of scores and loads for the first four principal components (pc1 vs. pc2, a; pc3 vs. pc4, b) of the principal component analysis carried out on colour coordinates (l*, a*, b*), protein content, total polyphenol content (tpc) and antioxidant capacity (abts, frap and dpph tests) of the ethanol:h2o (et) and methanol:h2o:acetic acid (me) extracts, reducing sugars, furosine, hydroxymethylfurfural (hmf), and glycosylisomaltol (gli) of 21 powder products. 4. conclusions our results show that, for the traits analysed, camu camu and cat’s claw powders are excellent products, because they have high levels of total polyphenols and antioxidant capacity together with low heat damage. other interesting products are the powders of graviola, purple maize and mesquite, while the high antioxidant properties of mashua are coupled to severe heat damage. for an effective use in the food industry it will be necessary to evaluate the stability of the antioxidant capacity of the powders during the manufacturing process and the digestion of innovative high-nutritional-value foods, as well as to assess the sensorial quality of the end products. supplementary table 1. beneficial properties of the species analyzed, and bibliographic references. species putative properties references cat’s claw immune-modulatory, antioxidant, antiviral, antibacterial and anti-inflammatory steinberg, 1995; heitzman et al., 2005 amaranth balanced aminoacid composition repo-carrasco et al., 2010; bressani et al., 1993 purple maize anti-inflammatory, prevention of obesity, diabetes, hyperglycemia and hypertension tsuda et al., 2003; finkel et al., 2013 yacon low glycemic index, resistance to infections and allergic reactions, prevention of colon cancer delgado et al., 2013 ; de moura et al., 2012 maca sexual dysfunctions, menopausal symptoms, osteoporosis, benign prostatic hyperplasia, lipid and glucose metabolism, skin protection from uv gonzales et al., 2005; gonzales-castañeda and gonzales, 2008; rubio et al., 2011; vecera et al., 2007 ; zhang et al., 2006 ital. j. food sci., vol. 31, 2019 744 tocosh antimicrobial lopez campos, 2017 mashua anticancer noratto et al., 2004 graviola anti-inflammatory and anti-malarial, prevention of some cancers foong and hamid, 2012; mishra et al., 2013; yang et al., 2015 mesquite antidiabetic, anti-inflammatory, anticancer and antimicrobial henciya et al., 2017 lucuma antioxidant, antihyperglycemic fuentealba et al., 2016 camu camu antioxidant, anti-inflammatory, antimicrobial and anti-diabetic akter et al., 2011; fujita et al., 2015 akter, m., oh, s., eun, j., and ahmed, m. (2011). nutritional compositions and health promoting phytochemicals of camu-camu (myrciaria dubia) fruit: a review. food research international, 44:1728-1732. bressani, r., de martell, e., and godinez, c. (1993). protein quality evaluation of amaranth in adult humans. plant foods for human nutrition, 43:123-143. de moura. n. a., caetano, b. f., sivieri, k., urbano, l. h., cabello, c., rodrigues, m. a., and barbisan, l. f. (2012) protective effects of yacon (smallanthus sonchifolius) intake on experimental colon carcinogenesis. food and chemical toxicology, 50:2902-2910. delgado, g. t., tamashiro, w. m., maróstica-junior, m. r., and pastore, g. m. (2013). yacon (smallanthus sonchifolius): a functional food. plant foods for human nutrition, 68:222-228. finkel, m. l., sanchez, s., mak, t., granstein, j., and lefkowitz, a. (2013). anthocyanin-rich purple corn extract and its effects on the blood pressure of adults. journal of evidence-based complementary and alternative medicine 18:237-242. foong, c. p., and hamid, r. a. (2012). evaluation of anti-inflammatory activities of ethanolic extract of annona muricata leaves. revista brasileira de farmacognosia, 22:1301-1307. fuentealba, c., gálvez, l., cobos, a., olaeta, j. a., defilippi, b. g., chirinos, r., campos, d., and pedreschi, r. (2016). characterization of main primary and secondary metabolites and in vitro antioxidant and antihyperglycemic properties in the mesocarp of three biotypes of pouteria lucuma. food chemistry 190:403-411. fujita, a., sarkar, d., wu, s., kennelly, e., shetty, k., and genovese, m. i. (2015). evaluation of phenolic-linked bioactives of camu-camu (myrciaria dubia mc. vaugh) for antihyperglycemia, antihypertension, antimicrobial properties and cellular rejuvenation. food research international, 77:194-203. gonzales, g. f., miranda, s., nieto, j., fernández, g., yucra, s., rubio, j., yi, p., and gasco, m. (2005). red maca (lepidium meyenii) reduced prostate size in rats. reproductive biology and endocrinology, 3, 5. gonzales-castañeda, c., and gonzales, g. f. 2008. hypocotyls of lepidium meyenii (maca), a plant of the peruvian highlands, prevent ultraviolet a-, b-, and c-induced skin damage in rats. photodermatology, photoimmunology and photomedicine, 24:24-31 heitzman, m. e., neto, c. c., winiarz, e., vaisberg, a. j., and hammond, g. b. (2005). ethnobotany, phytochemistry and pharmacology of uncaria (rubiaceae). phytochemistry, 66:5-29. henciya, s., seturaman, p., james, a. r., tsai, y. h., nikam, r., wu, y. c., dahms, h. u., and chang, f. r. (2017). biopharmaceutical potentials of prosopis spp.(mimosaceae, leguminosa). journal of food and drug analysis, 25:187-196. lopez campos, y. y. (2017). efecto inhibitorio in vitro de solanum tuberosum (papa fermentada) comparado con vancomicina y oxacilina sobre cepas de staphylococcus aureus. t_med.huma_2023. universidad privada antenor orrego (upao), trujillo, peru. mishra, s., ahmad, s., kumar, n., and sharma, b. k. (2013). annona muricata (the cancer killer): a review. the global journal of pharmaceutical research, 2:1613-1618. noratto, g., cisneros-zevallos, l., and mo, h. (2004). tropaeolum tuberosum (mashua) extracts suppress tumor cell proliferation. the faseb journal, 18, a886. repo-carrasco-valencia, r., hellström, j. k., pihlava, j. m., and mattila, p. h. (2010). flavonoids and other phenolic compounds in andean indigenous grains: quinoa (chenopodium quinoa), kañiwa (chenopodium pallidicaule) and kiwicha (amaranthus caudatus). food chemistry 120:128-133. rubio, j., qiong, w., and liu, x. (2011). aqueous extract of black maca (lepidium meyenii) on memory impairment induced by ovariectomy in mice. evidence-based complementary and alternative medicine, 7. steinberg, p.n. (1995). cat's claw: an herb from the peruvian amazon. sidahora: un proyecto del departamento de publicaciones del pwa coalition, ny, usa. pp. 35. tsuda, t., horio, f., uchida, k., aoki, h., and osawa, t. (2003). dietary cyanidin 3o-beta-d-glucoside-rich purple corn color prevents obesity and ameliorates hyperglycemia in mice. journal of nutrition 133:2125-2130. vecera, r., orolin, j., and skottová, n. (2007). the influence of maca (lepidium meyenii) on antioxidant status, lipid and glucose metabolism in rat. plant foods in human nutrition, 62:59-63. yang, c., gundala, s. r., mukkavilli, r., vangala, s., reid, m. d., and aneja, r. (2015). synergistic interactions among flavonoids and acetogenins in graviola (annona muricata) leaves confer protection against prostate cancer. carcinogenesis, 36:656-665. zhang, y., yu, l., and ao, m. (2006). effect of ethanol extract of lepidium meyenii walp. on osteoporosis in ovariectomized rat. journal of ethnopharmacology, 105:274-279. ital. j. food sci., vol. 31, 2019 745 supplementary table 2. mean±standard error and lds results for colour coordinates (l*, a*, b*), sugars content (fructose, glucose, maltose and sucrose, g/100 g dm) and heat damage indices (furosine, mg/100 g protein; hydroxymethylfurfural, hmf, mg/kg dm; and glycosylisomaltol, gli, mg/kg dm) of 21 commercial powder samples. l* a* b* fructose glucose maltose saccharose furosine hmf gli cat’s claw 1 66.3l±0.4 13.2ab±0.2 31.1c±0.3 0.7l±0.003 1.1il±0.02 2.2b±0.08 0.9n±0.01 ndp 11.8b±0.7 1.2c±0.03 cat’s claw 2 57.7o±0.4 12.1b±0.1 30.3d±0.1 1.0h±0.01 1.2i±0.07 0.1g±0.01 1.0l±0.03 324.5j±20.4 ndl ndd cat’s claw tea 50.2q±0.5 13.5a±0.2 32.8b±0.2 0.8i±0.03 1.1il±0.09 0.1h±0.01 0.9n±0.01 88.6l±0.6 0.9j±0.02 ndd amaranth fr 80.3c±0.3 2.2l±0.0 19.6m±0.1 0.1q±0.002 0.1r±0.002 ndi 1.8h±0.03 34.9n±1.1 3.1h±0.2 ndd amaranth fs 78.5ef±0.2 1.9m±0.0 19.3m±0.2 0.2p±0.01 0.2q±0.005 ndi 1.9h±0.02 29.0o±0.2 ndk ndd purple maize 55.3p±0.3 10.8c±0.1 2.8o±0.1 0.5n±0.01 0.6o±0.01 ndi 1.5i±0.02 79.5l±2.0 ndk ndd yacon 74.9h±0.5 3.9g±0.2 26.8f±0.5 32.7a±2.09 8.2c±0.04 ndi 8.2g±0.13 981.3cd±1.9 146.6a±0.1 ndd maca 1 77.8f±0.2 2.0m±0.1 28.3e±0.1 5.4d±0.01 5.8e±0.2 0.5e±0.01 28.8c±0.35 825.3e±6.8 3.3h±0.1 ndd maca 2 76.2g±0.3 3.8g±0.1 24.6h±0.2 4.2e±0.19 3.6g±0.15 0.5ef±0.03 35.4b±0.43 971.9cd±8.2 5.5de±0.8 ndd maca 3 78.4ef±0.2 4.0g±0.1 26.2fg±0.3 0.2o±0.01 0.7n±0.01 4.2a±0.04 21.2e±0.25 728.5f±17.5 4.4fg±0.2 27.3a±0.3 maca 4 72.0i±0.2 5.1f±0.1 30.2d±0.3 5.3d±0.06 4.6f±0.15 0.4f±0.05 24.4d±0.96 877.7de±20.8 10.4b±0.3 ndd maca 5 83.9b±0.5 1.9m±0.0 22.2l±0.2 5.6d±0.04 7.0d±0.20 ndi 26.4cd±0.47 1008.6c±0.0 4.3fg±0.03 ndd maca 6 79.4d±0.3 2.8i±0.1 23.5i±0.2 5.4d±0.002 0.5p±0.02 1.8c±0.01 27.8c±0.16 378.0i±6.0 3.0h±0.2 8.9b±0.4 maca 7 78.7de±0.1 1.2n±0.0 24.8h±0.1 0.6m±0.005 0.5o±0.004 ndi 17.1f±0.14 167.7k±3.7 5.0ef±0.07 ndd tocosh 86.6a±0.7 0.5o±0.1 9.7n±0.2 0.01r±0.002 0.1s±0.004 ndi 0.1o±0.003 ndp ndk ndd mashua 28.3t±0.4 7.7d±0.1 5.3o±0.0 17.5b±0.27 16.9a±0.25 ndi 16.4f±0.05 2399.8a±107.6 7.5c±0.1 ndd graviola 43.3r±0.3 3.1h±0.0 26.1g±0.1 nds 0.6o±0.03 0.1g±0.001 0.9n±0.03 445.6h±23.4 1.3i±0.02 ndd graviola tea 41.0s±0.3 2.0lm±0.0 25.1h±0.1 1.3g±0.08 1.0l±0.05 0.1h±0.01 1.0lm±0.07 608.2g±6.0 1.3i±0.02 ndd mesquite 63.4n±0.4 8.1d±0.2 34.1a±0.2 1.6f±0.04 0.9m±0.02 ndi 42.5a±0.1 450.5h±0.1 6.0d±0.6 ndd lucuma 72.3i±0.2 8.0d±0.1 22.2l±0.2 10.3c±0.1 9.6b±0.02 1.3d±0.03 8.3g±0.02 2228.4b±334.5 4.1g±0.2 ndd camu camu 64.6m±0.3 6.6e±0.1 28.0e±0.1 1.4g±0.02 1.8h±0.19 ndi 0.9mn±0.04 48.2m±0.7 ndl ndd for each parameter, diverse letters indicate significant differences (lsd, p≤0.05) among samples; nd, not detectable. ital. j. food sci., vol. 31, 2019 746 supplementary table 3. mean and lds results for total polyphenols content (tpc; mg gae/kg dm) and abts, frap and dpph antioxidant capacity (mmol te/kg dm) of 21 powder samples extracted with ethanol 80% (etoh:h2o) and methanol:h2o:acetic acid (meoh:h2o:acet). tpc abts frap dpph etoh:h2o meoh:h2o:acet etoh:h2o meoh:h2o:acet etoh:h2o meoh:h2o:acet etoh:h2o meoh:h2o:acet cat’s claw 1 16.1c±0.5 30.7c±0.0 267.4c±0.0 331.5c±6.1 229.9c±4.2 391.9c±10.0 26.2c±0.1 43.4c±0.04 cat’s claw 2 24.2b±0.4 53.6b±0.8 590.9b±21.0 802.6b±10.6 460.7b±52.8 872.8b±2.3 49.6b±0.2 125.9b±1.1 cat’s claw tea 9.2f±0.1 20.1e±0.6 135.6f±0.2 280.7d±14.1 110.0ef±4.0 255.1e±2.6 9.9e±0.02 32.3e±0.3 amaranth fr 3.5m±0.0 2.9q±0.0 5.7o±0.0 4.9o±0.0 5.1n±0.1 4.6s±0.0 0.2q±0.0 nd amaranth fs 2.6o±0.0 2.6r±0.0 5.5o±0.0 4.6o±0.0 5.2n±0.1 3.3t±0.0 nd nd purple maize 7.8g±0.3 13.7g±0.1 103.1g±0.2 148.8g±0.3 97.3f±0.8 200.1g±3.1 5.8h±0.1 21.1f±0.3 yacon 4.8i±0.1 11.7h±0.1 31.6l±0.3 34.5i