key: cord-027649-6xn9swsq authors: addetia, amin; xie, hong; roychoudhury, pavitra; shrestha, lasata; loprieno, michelle; huang, meei-li; jerome, keith r.; greninger, alexander l. title: identification of multiple large deletions in orf7a resulting in in-frame gene fusions in clinical sars-cov-2 isolates date: 2020-06-23 journal: j clin virol doi: 10.1016/j.jcv.2020.104523 sha: doc_id: 27649 cord_uid: 6xn9swsq nan sars-cov-2 xgen enrichment panel (nc_045512; idt). sequence reads were trimmed using trimommatic v0.38 (5) , aligned to the sars-cov-2 reference genome (nc_045512.2) using bbmap (https://sourceforge.net/projects/bbmap/), trimmed of synthetic pcr primers using primerclip (https://github.com/swiftbiosciences/primerclip) if appropriate, and visualized in geneious v11.1.4 (6) . sequencing reads and consensus genomes are available under ncbi bioproject prjna610428. orf7a of sars-cov-2 interacts with the ribosomal transport proteins heatdr3 and mdn1 (10) , and has been demonstrated to inhibit cellular translation in sars-cov (11) . based on the size of the deletions recovered and structure of orf7a, we hypothesize that most biochemical functions of orf7a would be inactivated by these deletions. interestingly, orf6 of sars-cov-2 interacts with the mrna export proteins nup98 and rae1, and may inhibit cellular translation (10) . this redundancy may partially explain the orf7a deletions observed in our isolates. we predict global sequencing projects may yield additional clinical sars-cov-2 isolates with deletions in orf6 or orf7a, but not both. coast-to-coast spread of sars-cov-2 during the early epidemic in the united states metagenomic analysis reveals clinical sars-cov-2 infection and bacterial or viral superinfection and colonization rapid metagenomic next-generation sequencing during an investigation of hospital-acquired human parainfluenza virus 3 infections trimmomatic: a flexible trimmer for illumina sequence data geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data an 81 nucleotide deletion in sars-cov orf7a identified from sentinel surveillance in arizona structure and intracellular targeting of the sars-coronavirus orf7a accessory protein a dynamic nomenclature proposal for sars-cov-2 to assist genomic epidemiology a sars-cov-2 protein interaction map reveals targets for drug repurposing severe acute respiratory syndrome coronavirus inhibits cellular protein synthesis and activates p38 mitogen-activated protein kinase wa-uw-4570 and resulted in the fusion of orf7a and orf8. a 227-nucleotide deletion beginning at nt 27,524 was identified in b) wa-uw-5812 and resulted in the fusion of orf7a and orf7b. the deletions in c) wa-uw-4570 and d) wa-uw-5812 were confirmed by rt-pcr. an 826-bp product is expected for strains with an intact orf7a. 434-bp and 599-bp amplicons were obtained for wa-uw-4570 and wa-uw-5812, respectively. the deletions in e) wa-uw-4570 and f) wa-uw-5812 severely truncate the  residues retained are highlighted in purple, while those lost are highlighted in gold key: cord-010155-g5fk567p authors: schildgen, verena; rüngeler, elena; tillmann, ramona; schildgen, oliver title: absence of melaka-virus in european children with respiratory disease date: 2008-03-24 journal: j clin virol doi: 10.1016/j.jcv.2008.02.003 sha: doc_id: 10155 cord_uid: g5fk567p nan in july 2007 chua et al. from malaysia and australia detected a previously unknown member of the reovirus family (respiratory enteric orphan viruses) which was named melaka-virus. this virus was associated with acute respiratory disease in the 39-year-old male index patient and also somewhat later in two of his family members (chua et al., 2007) . furthermore, 14 out of 109 human volunteers living on the same island as the index patients proved positive for antibodies against pulau-virus that is closely related with melaka-virus. as our group is interested in the epidemiology of newly discovered viruses such as hmpv, human bocavirus, and newly discovered coronaviruses, in the cohort of hospitalized pediatric and adult high risk patients (2-5) we have screened 225 nasopharyngeal washes that were previously rt-pcr tested for rsv, hmpv, human coronaviruses (nl63, oc43, 229e, hku1, and sars), and human bocavirus (detailed protocols available on request and previously published in: 2-5) for the presence of melaka-virus rna. the rt-pcr detection protocol was kindly provided by dres. chua and wang who initially described melaka-virus (chua et al., 2007) . in total 29 (12.66%) out of the 225 samples tested were positive for rsv, 1 was positive for hmpv, 1 was positive for hmpv, 1 was positive for coronaviruses, 1 was positive for influenza virus a, and 1 (0.44%, each) was positive for human bocavirus. no double infections with any of the tested viruses were observed. melaka-virus rna was not found in any of the samples tested. although the lack of a melakavirus rna positive sample does not imply that it is absent in our clinical samples since it could have been below the detection limit of the rt-pcr assay, we can still conclude that melaka-virus plays no or only a minor role in hospitalized european pediatric patients. this conclusion is based upon the negative rt-pcr results. in similar epidemiological studies that we have performed for other viruses, the phenomenon that a newly described virus was not found in patient populations with corresponding symptoms was not observed. in other words, following the first descriptions of hmpv, human bocavirus, coronaviruses nl63 and hku1, at least a small percentage of patients turned out to be infected by these new viruses (kupfer et al., 2006; muller et al., 2007; volz et al., 2007; wilkesmann et al., 2006) contributing to the common cold. in contrast, no positive results were obtained for melaka-virus which is suspected to be transmitted by bats as a zoonotic pathogen. taking into account that none of our patients had known or suspected contact with bats, nor travelled to a region in which melaka-virus may be endemic, our results give rise to the hypothesis by chua et al. (2007) that melaka-virus may indeed be transmitted by bats rather than common cold pathogens. we finally conclude that melaka-virus testing should preferably be carried out in populations with suspected contact to the virus such as inhabitants of the endemic regions or air travellers with symptoms of respiratory disease (luna et al., 2007) . a previously unknown reovirus of bat origin is associated with an acute respiratory disease in humans severe pneumonia and human bocavirus in adult spectrum of viruses and atypical bacteria in intercontinental air travelers with symptoms of acute respiratory infection fatal pneumonia associated with human metapneumovirus (hmpv) in a patient with myeloid leukemia and adenocarcinoma in the lung prospective study of human bocavirus (hbov) infection in a pediatric university hospital in germany 1386-6532/$ -see front matter © 2008 elsevier b.v. all rights reserved human metapneumovirus infections cause similar symptoms and clinical severity as respiratory syncytial virus infections this work was partially supported by research grants from the else kröner-fresenius stiftung (p15/07//a22/07) and the european commission (lshm-ct-2006-037276). key: cord-026099-97luq10a authors: kok, j; rahman, h; carter, i; basile, k; donovan, l; kumar, s; tran, t; ko, d; alderson, s; sivaruban, t; eden, j-s; rockett, r; o’sullivan, mv; sintchenko, v; chen, sc; maddocks, s; dwyer, de title: response to correspondence received on our paper:interpret with caution: an evaluation of the commercial ausdiagnostics versus in-house developed assays for the detection of sars-cov-2 virus date: 2020-06-05 journal: j clin virol doi: 10.1016/j.jcv.2020.104484 sha: doc_id: 26099 cord_uid: 97luq10a nan using either in-house developed or commercial diagnostic assays. prior to intended use, such assays should be validated to ensure they are fit for purpose, particularly when testing for novel pathogens with pandemic potential. the ausdiagnostics ruo assay is a real-time, nested, intercalating-dye based pcr assay. probe-based assays (such as our in-house developed, real-time pcr [rt-pcr] assays based on the who recommended targets) are more specific than intercalating dye-based assays as non-specific pcr products and primer dimers may generate fluorescent signals. analysis of melting curves may help identify these non-specific amplicons, provided that the assay's target(s) are specific for sars-cov-2 and no other amplicons that are generated dissociate at the same temperature. as the primers used in the ausdiagnostics ruo assay are not publicly available, we were not able to verify the manufacturer's claims of the correct melting temperature. false positive results of other ausdiagnostics assays using the same methodology have been previously attributed to incorrectly calibrated equipment and poor quality power supply [meunier] . we reported that the sensitivity, specificity, positive predictive value (ppv) and negative predictive value of the ausdiagnostics ruo assay was 100%, 92.16%, 55.56% and 100%, respectively when compared to our rt-pcr assay. even if the specificity of the ausdiagnostics ruo assay was 99% (i.e. a 1% false positive rate), given the current prevalence of covid-19 infection in nsw of 0.84%, the calculated ppv of the assay would be 54.15%, which is concordant with our findings. cohen et al also estimated false positive rates of up to 7% in commercial diagnostics assays detecting sars-cov-2 [cohen] . whilst sars-cov-2 whole genome sequencing (wgs) may have resolved the issue of the four false positive samples, quality consensus sequences are often difficult to obtain from samples with rt-pcr cycle threshold values >30 [rockett, eden] . partial sequencing of the sars-cov-2 genome was considered less informative without knowledge of the ausdiagnostics ruo assay's target(s) and not attempted as it may not be able to distinguish closely related coronaviruses compared to wgs. furthermore, false positive rt-pcr results have also been reported from commercial kits that have been contaminated with sars-cov-2 sequences [bustin] . since our manuscript was written, ausdiagnostics pty ltd now offer several diagnostic assays for the detection of sars-cov-2, including the ausdiagnostics sars-cov-2, influenza and rsv 8-well assay (catalogue number 20081). of note, the reported sensitivity and specificity for this dual target assay is 100% and 100% for the "a" j o u r n a l p r e -p r o o f target and 97.7% and 99.4% for the "b" target, respectively [ausdiagnostics] . this suggests that during their evaluation, there were samples where the "a" but not "b" target was detected, despite the "b" target having a reported lower limit of detection (175 copies/ml vs 2150-4325 copies/ml). the reported specificity of 99.4% for the "b" target also implies that false positive results were encountered. the assay's instructions for use however, recommends that detection of either one of the two targets is sufficient to call a result positive. as stanley correctly points out, it is important that diagnostic assays have high sensitivity in order to detect all persons with suspected covid-19 and limit further transmission of infection. however, it is equally important that no conflicts of interest declared cov-2, influenza and rsv 8-well ref 20081 panel of assays instructions for use rt-qpcr testing of sars-cov-2: a primer false positives in reverse-transcription pcr testing for sars-cov-2. medrxiv 2020 evaluation of the ausdiagnostics mt cre eu assay for the detection of carbapenemase genes and transferable colistin resistance determinants mcr-1/-2 in mdr gram negative bacteria nsw covid-19 case statistics by local health district interpret with caution: an evaluation of the commercial ausdiagnostics versus in-house developed assays for the detection of sars-cov-2 virus revealing covid-19 transmission by sars-cov-2 genome sequencing and agent based modelling world health organization. molecular assays to diagnose covid19: summary table of available protocols key: cord-010160-wk8k2igu authors: chandrasekaran, alamelu; manji, ryhana; joseph, ansamma; zhang, fan; ginocchio, christine c. title: broad reactivity of the luminex xtag respiratory virus panel (rvp) assay for the detection of human rhinoviruses date: 2012-01-04 journal: j clin virol doi: 10.1016/j.jcv.2011.12.006 sha: doc_id: 10160 cord_uid: wk8k2igu nan human rhinoviruses (hrv) are a major cause of the common cold and a variety of both upper and lower respiratory tract infections including sinusitis, otitis media, bronchitis, primary pneumonia and have been associated with the worsening of asthma and chronic obstructive pulmonary disease. 1 with the advent of new antivirals directed at the treatment of serious hrv infections it is becoming increasingly important to detect a broad range of hrv strains so that targeted antiviral therapy can be appropriated instituted. 2, 3 the xtag respiratory virus panel (rvp, luminex molecular diagnostics, toronto, canada) is a us food and drug administration (us fda) cleared multiplex nucleic acid amplification test for the detection of respiratory viruses including adenovirus (adv), human metapneumovirus (hmpv), influenza a (influa with subtyping of seasonal h1 and seasonal h3), influenza b (influb), parainfluenza types 1 (piv-1), 2 (piv-2) and 3 (piv-3), respiratory syncytial virus (rsv) a and b, and hrv. some enteroviral (ev) strains are also detected due to cross reactivity with hrv and therefore the assay does not distinguish between hrv and ev. 4, 5 additional viruses detected by the full rvp (research use only in us) include piv-4, coronaviruses (corona) nl63, oc43, hku-1 and 229e. a multicenter study demonstrated that rvp can detect culture isolates of hrv serotypes 39 and 54 and hrv strains of phylogenetic groups a, b, c, e and f from clinical samples. 5 the aim of this study was to further assess the analytical reactivity of rvp for the detection of a wide variety of hrv serotypes and in clinical samples previously identified as hrv/ev positive by rvp. differentiation of hrv from ev in rvp hrv/ev positive samples was established using a laboratory developed hrv assay (ldthrv) based on a modified version of the method described by lu et al., 6 and the nuclisens easyq enterovirus assay (eva, biomérieux, durham, nc). 7 a 50 l aliquot from cultures of hrv species a and b (n = 98, serotypes 1-100, with the exception of serotypes 53 and 87), influa, influb, rsv a and b, and adv, and 200 l aliquots from discard clinical samples (nasopharyngeal swabs in universal transport media [utm, copan, brescia, italy]) were added to 2.0 ml nuclisens lysis buffer tubes (biomérieux). nucleic acids (na) were extracted using the nuclisens easymag (biomérieux) and tested with ldthrv, eva and rvp according to the manufacturer's instructions. all 98 hrv isolates were detected by rvp and ldthrv. eva was negative for 86/98 hrv isolates tested. the remaining 13 hrv isolates ( serotypes 5, 12, 15, 16, 22, 26, 33, 38, 42, 65, 69, 88, 99) gave positive eva results of varying intensity. the 13 hrv isolates had culture titers ranging from a tcid 50 of 1.1 × 10 −3 to 4.7 × 10 −5 and demonstrated varying levels of rvp reactivity with mfi values ranging from 716 to 4734. eva results were negative for isolates after testing ten-fold dilutions of the original culture. nucleic acids derived from 3 clinical samples that contained hrv species c tested positive with rvp, ldthrv and negative with eva. discard clinical samples, previously determined by rvp to be only hrv/ev positive (+) (n = 98), hrv/ev(+) with an additional virus (n = 6; 3 hmpv, 1 piv-2, 1 piv-3, 1 rsv-b), hrv/ev negative (−) but other respiratory virus (+) (n = 25; 1 adv, 4 corona nl63, 2 influa, 2 influb, 3 hmpv, 2 piv-1, 3 piv-2, 2 piv-3, 2 piv-4, 2 rsv-a, 2 rsv-b), gave the expected results. all samples positive for hrv/ev by rvp were detected by ldthrv and were negative by eva. all samples negative for hrv/ev by rvp were negative by ldthrv and eva. in conclusion, the xtag rvp can detect a broad range of hrv serotypes, including hrv a, b and c strains. although the assay cannot differentiate between hrv and ev, supplemental assays can be used to differentiate hrv and ev when clinically indicated. the detection of hrv will facilitate the use of appropriate targeted antiviral therapy. this study was funded in part by biota holdings, australia. ccg has received research funding from luminex and is a member of the luminex scientific advisory board. not required. the abcs of rhinoviruses, wheezing, and asthma study of the biological activity of novel synthetic compounds with antiviral properties against human rhinoviruses development of a respiratory virus panel test for the detection of twenty human respiratory viruses by use of multiplex pcr and a micro-bead based assay xtag tm rvp assay: analytical and clinical performance real-time reverse transcription-pcr assay for comprehensive detection of human rhinoviruses development, technical performance, and clinical evaluation of a nuclisens basic kit application for the detection of enterovirus rna in cerebrospinal fluid ginocchio a,b, * a department of pathology and laboratory medicine, division of infectious disease diagnostics nucleic acid extracts from specimens previously characterized as positive for rhinovirus group c by molecular detection and sequencing, were kindly provided by dr. kirsten st. george at the laboratory of viral diseases, wadsworth center, new york state department of health, albany, ny. human rhinovirus strains were kindly provided by dr. simon tucker of biota holdings limited, notting hill, vic, australia. key: cord-265760-ch4pcy21 authors: zhifeng, jiang; feng, aiqiao; li, tao title: consistency analysis of covid-19 nucleic acid tests and the changes of lung ct date: 2020-04-10 journal: j clin virol doi: 10.1016/j.jcv.2020.104359 sha: doc_id: 265760 cord_uid: ch4pcy21 background: covid-19, the latest outbreak of infectious disease, has caused huge medical challenges to china and the entire globe. no unified diagnostic standard has been formulated. the initial diagnosis remains based on the positive of nucleic acid tests. however, early nucleic acid tests were identified to be negative in some patients, whereas the patients exhibited characteristic ct changes of lung, and positive test results appeared after repeated nucleic acid tests, having caused the failure to diagnose these patients early. the study aimed to delve into the relationships between initial nucleic acid testing and early lung ct changes in patients with covid-19. method: in accordance with the latest covid-19 diagnostic criteria, 69 patients diagnosed with covid-19 treated in the infected v ward of xiaogan central hospital from 2020/1/25 to 2020/2/6 were retrospectively analyzed. the consistency between the first covid-19 nucleic acid test positive and lung ct changes was studied. in addition, the sensitivity and specificity of ct and initial nucleic acid were studied. result: the kappa coefficient of initial nucleic acid positive changes and lung ct changes was −1.52. with a positive nucleic acid test as the gold standard, the sensitivity of lung ct was 12.00 %, 95 % ci: 4.6–24.3; with the changes of ct as the gold standard, the sensitivity of nucleic acid positive was 30.16 %, 95 % ci: 19.2−43.0. conclusion: the consistency between the initial positive nucleic acid test and the ct changes in the lungs is poor; low sensitivity was achieved for initial nucleic acid detection and ct changes. covid-19, as the latest outbreak of infectious diseases, has imposed great damage on china and other countries worldwide. at present, there has been no universally recognized gold standard for initial diagnosis, and its initial diagnosis still relies on nucleic acid testing. the initial nucleic acid test was negative, whereas at this time characteristic lung changes appeared, by repeated nucleic acid tests, it was positive, as a result, a considerable number of early patients have been missed. studying the relationships between nucleic acid tests and ct changes in the lungs will help improve the diagnosis of covid-19. 69 patients diagnosed with covid-19 admitted to the infectious v ward of xiaogan central hospital from 2020/1/ 25-2020/2/6 were retrospectively analyzed, including 41 males and 28 females, with the maximum age of 82 years and the minimum age of 23 years. they had no history of lung infections before onset. throat swabs were collected from patients. covid-19 nucleic acid orf1ab gene and n gene were taken as target genes [1] , and rt-pcr was adopted to detect both as positive nucleic acid-positive indicators. if the initial nucleic acid test is negative, the test will be repeated at least once a day until the test is positive. based on the change of sheet-shaped frosted glass/flocculation/strand-like changes in the outer band of the lungs as covid-19 lung ct positive indicators [2] (fig. 1 ). study the consistency between ct changes and the positive of initial nucleic acid tests. at the same time, the sensitivity and specificity of ct changes were studied with the positive of nucleic acid test as the gold standard; the sensitivity and specificity of initial nucleic acid positives were studied with the ct of lung as the gold standard. nucleic acid pcr tests, the sensitivity of lung ct was 12.00 %, 95 % ci: 4.6-24.3, specificity was 100 %, and 95 % ci:82−100 (table 3) . with lung ct changes as the gold standard, nucleic acid pcr-positive sensitivity was 30.16 %, 95 % ci: 19.2-43.0, specificity was 100 %, and 95 % ci: 54.1-100 (table 4 ). there is no exact consistency between the initial positive nucleic acid test and ct changes in the lungs. by employing a positive nucleic acid test as the gold standard for initial diagnosis, the sensitivity of ct changes in the lung is low; using the ct change of the lung as the gold standard, the sensitivity of positive nucleic acid tests is low as well. if the initial nucleic acid test acts as a diagnostic indicator, numerous confirmed patients will be missed. the initial diagnosis should be performed in combination with nucleic acid tests and ct changes of lung. as the latest outbreak of infectious diseases, there has been no unified diagnostic standard for the diagnosis of covid-19. the latest chinese standards were split into suspected cases and confirmed cases [3] . the diagnosis of suspected cases should be combined with epidemiological history and clinical manifestations. epidemiological history includes: 1. history of travel or residence in the affected area; 2. history of contact with patients from epidemic areas with fever or respiratory symptoms or covid-19; 3. aggressive onset [2] . clinical manifestations consist of: 1 fever or respiratory symptoms; 2. characteristic lung imaging changes [2] . 3. the total number of white blood cells is normal or decreases in the early stage of onset, or the lymphocyte count decreases. the diagnostic criteria for suspected cases comply with any one of the epidemiological history and any two of the clinical manifestations. a suspected case with one of the following pathogenic evidence refers to a confirmed case: 1. pcr tests of covid-19 nucleic acid positive for respiratory specimens or blood specimens [4] . 2. respiratory or blood specimen virus gene sequencing is significantly homologous with known covid-19 [2] . however, in numerous patients, the initial nucleic acid test was identified to be negative, and some patients were positive after repeating the test for 5 times. before the nucleic acid was positive, the changes of ct has occurred in lung. the results suggested that the initial nucleic acid positivity was not consistent with variations in lung ct, and low initial nucleic acid positivity rate was achieved. if with the positivity of initial nucleic acid acts as the gold standard, the sensitivity of characteristic lung ct changes will be only 12 %, which will cause huge interference or even misleading to clinical work; as a result, diagnosis and treatment will be delayed, and even the potential patient will not be isolated in time, thereby causing the spread of the virus. if the characteristic lung ct changes are adopted as the gold standard, the sensitivity of the initial nucleic acid test will be 30.16 %, which is still low. the cause of this situation is still related to the low positive rate of initial nucleic acid test. this study considers that the causes of the low sensitivity of the initial nucleic acid test include the method of sample acquisition, the time of acquisition, as well as the reagents used for test, which will adversely affect the test results and decrease the positive rate. this study aimed to explore the relationships between positive initial nucleic acid test and the consistency of lung ct changes, as an attempt to facilitate the effective screening of suspected patients. no indepth analysis is conducted on the consistency of positive nucleic acid changes and lung ct changes after repeated nucleic acid tests, which requires further research. in conclusion, there is poor consistency between the positive rate of initial nucleic acid test and the changes of lung ct in patients with covid-19, and initial nucleic acid test exhibits low sensitivity. this study suggests that patients with negative initial nucleic acid test and lung ct changes should be isolated at an early stage, and repeated nucleic acid test is required. the authors declare there are not competing interests, no funding conflict. detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr clinical features of patients infected with 2019 novel coronavirus in a rapid advice guideline for the diagnosis and treatment of 2019 novel coronavirus (2019-ncov) infected pneumonia (standard version) lung ct image of a confirmed case of the 2019 novel coronavirus (2019-ncov) infected pneumonia (with differential diagnosis of the sars) office of state administration of traditional chinese medicine, notice on the issuance of a programme for the diagnosis and treatment of novel coronavirus (2019-ncov) infected pneumonia we would likely to express our gratitude for the medical teams in the fifth ward of xiaogan hospital affiliated to wuhan university of science and technology. jiang zhifeng collected all patient information and statistics and wrote the articles. dr. feng aiqiao, and dr. li tao were engaged in patient management and data collection and provided valuable opinions on article writing. key: cord-282576-mcx0xq0w authors: boutin, catherine-audrey; grandjean-lapierre, simon; gagnon, simon; labbé, annie-claude; charest, hugues; roger, michel; coutlée, françois title: comparison of sars-cov-2 detection from combined nasopharyngeal/oropharyngeal swab samples by a laboratory-developed real-time rt-pcr test and the roche sars-cov-2 assay on a cobas 8800 instrument date: 2020-09-04 journal: j clin virol doi: 10.1016/j.jcv.2020.104615 sha: doc_id: 282576 cord_uid: mcx0xq0w objective: although several assays have been developed to detect sars-cov-2 rna in clinical specimens, their relative performance is unknown. methods: the concordance between the cobas 8800 sars-cov-2 and a laboratory developed (ld) reverse transcriptase-polymerase chain reaction (rt-pcr) assay was assessed on 377 combined nasopharyngeal/oropharyngeal swabs in hanks medium. results: the positive and negative agreement between these assays were 99.3 % (95 % ci, 97.3–99.9) and 77.1 % (95 % ci, 67.7–84.4), respectively, for an overall agreement of 93.6 % (95 % ci, 90.7–95.7) beyond random chance (kappa of 0.82, 95 % ci, 0.75−0.85). of the 22 samples positive by cobas sars-cov-2 only, 9 were positive only for orf-1 gene and had cycle thresholds (ct) > 35.1, 8 were positive only for the e gene with ct > 35.5 and 5 were positive for both targets with ct > 33.9. samples positive only with the cobas assay were more often positive with only one gene target (77.3 %) than samples positive in both assays (16.9 %, p < 0.0001). ct values in the cobas sars-cov-2 assay were significantly higher in the 279 samples testing positive in both assays (32.9 %, 95 % ci 32.3–33.6) compared to the 22 samples with discordant results (36.6 %, 95 % ci 36.2–37.1; p = 0.0009). an excellent correlation (r(2) = 0.98) was obtained between ct values of the orf-1 and e targets in the cobas assays and a good correlation was obtained between ld rt-pcr test and cobas sars cov-2 orf-1 target (r(2) = 0.82). conclusion: our study demonstrated an excellent concordance between a ld rt-pcr and the cobas sars-cov-2 tests on the 8800 platform. since december 2019, a novel coronavirus, the severe acute respiratory syndrome coronavirus 2 (sars-cov-2) emerged as the cause of a severe respiratory disease and is causing a worldwide pandemic. tests based on reverse transcription-polymerase chain reaction (rt-pcr) are the most suitable mode of rapid diagnosis of acute sars-cov-2 infections which is essential for patient management and contact tracing (1) . several commercial and laboratory developed (ld) assays are available but few manufacture-independent evaluations and few comparisons between assays have been published up to now (1) . moreover, the comparison between assays is hampered by the absence of accepted gold standard test as well as our incomplete knowledge of the natural history of sars-cov-2 infection. studies evaluating the concordance between assays are thus needed at this point in the pandemic. we evaluated the concordance between the two-target cobas sars-cov-2 test (roche molecular diagnostics, laval, canada) on the fully automated cobas 8800 platform authorized by health canada and a laboratory-developed (ld) standardized rt-pcr test using widely used primer set and probe (2, 3) in samples submitted at the diagnostic laboratory for patient care at the centre hospitalier de l'université de montréal. a subset of combined nasopharyngeal/oropharyngeal swabs routinely collected in hanks media from 377 individuals between 21 april 2020 and 11 june 2020 were transported to the laboratory the same day and tested in parallel as part of routine clinical care using the cobas sarsprior to testing on the cobas 8800, each specimen was treated to inactivate potential infectious viruses: 400 µl of specimen in hanks was added to 200 µl of cobas 8800 lysis buffer, followed by an incubation at room temperature for 10 minutes. the detection of sars-cov-2 rna was then performed on the inactivated 600 µl-aliquot with the cobas 8800 instrument, as suggested by the manufacturer. a two-target rt-pcr was used on this instrument: one targeting orf1, a nonstructural region that is unique to sars-cov-2 coding for the rdrp activity of the virus, and the second targeting a conserved region in the structural protein envelope e gene for pan-sabercovirus detection. an internal rna control was detected in each sample to control for amplification efficiency and rna extraction from sample. uracil-n-glycosylase is also included in the master mix to catalyze contaminating amplicons. a data management software in the automated apparatus assigns test results to each sample. a sample was considered positive if a positive result was obtained for the orf1 gene only or for both orf1 and e genes, as suggested by the manufacturer's instructions. samples testing positive only for the e gene were considered as sars-cov-2 presumptive positive. testing was performed in 96 samples batches, including one positive control and one negative control. the limit of detection of the assay was 20 viral rna copies per ml of medium (data not shown). samples with discrepant results between the cobas and ldt assays were tested, when enough sample left was available, in the abbott realtime sars-cov-2 test on the abbott m2000 system (abbott molecular inc., des plaines, il), as suggested by the manufacturer (4). in the absence of gold standard for sars-cov-2 rna detection, data was analyzed using a contingency table to assess the overall, positive and negative agreement with 95% confidence intervals (95% ci) calculated. the level of agreement was also assessed using kappa statistics. by the results of the comparison of the cobas sars-cov-2 and ld rt-pcr on 377 routinely collected nasopharyngeal/oropharyngeal swabs are summarized in table 1 one showed inhibition, 8 were 'detected' with low cycle number (cn) values between 26.7 and 31.5, and 11 were 'not detected'. since these latter samples were weakly reactive initially in the cobas assay, had been frozen for 6 to 9 weeks and thawed, the 11 negative samples in the abbott realtime test yet initially positive in the cobas assay were retested in the cobas assay : only one out of 10 then scored positive in the cobas test. an excellent correlation (r 2 = 0.98, p<0.0001) was obtained between ct values for sars-cov-2 orf-1 target and e target in the cobas sars-cov-2 assays (figure 1 ). the correlation between ct values obtained in the ld rt-pcr test and cobas sars cov-2 orf-1 target for positive samples in both assays was good (r 2 = 0.82, data not shown). rt-pcr test. only discordant samples were tested in a third assay, we could thus not calculate the performance of the cobas test with an expanded gold standard. in conclusion, this study demonstrated an excellent agreement between the cobas sars-cov-2 test in the 8800 platform and a ld rt-pcr test, although the cobas assay detected a greater number of samples with low viral load infections. further studies comparing different platforms in parallel, as well as using clinical information will allow establishing a gold standard and determine the true performance of automated high throughput platforms. laboratory diagnosis of emerging human coronavirus infections -the state of the art detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr clinical evaluation of the cobas sars-cov-2 test and a diagnostic platform switch during 48 hours in the midst of the covid-19 pandemic comparison of abbott id now and abbott m2000 methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from symptomatic patients statistical methods for rates and proportions us cdc real-time reverse transcription pcr panel for detection of severe acute respiratory syndrome coronavirus 2 comparative performance of sars-cov-2 detection assays using seven different primer-probe sets and one assay kit table 1. detection of sars-cov-2 rna in 377 nasopharyngeal-oropharyngeal samples in hanks with cobas 8800 sars-cov-2 and ld rt-pcr assays overall agreement : 93 8 samples were positive only with the e gene and were presumptive positive samples. the other 14 samples were positive with for at least the sars-cov-2 orf1 gene we would like to thank all the laboratory technologists who performed the real time pcr assays for this study.j o u r n a l p r e -p r o o f key: cord-259558-remrzrq1 authors: leblanc, jason j.; heinstein, charles; macdonald, jimmy; pettipas, janice; hatchette, todd f; patriquin, glenn title: a combined oropharyngeal/nares swab is a suitable alternative to nasopharyngeal swabs for the detection of sars-cov-2 date: 2020-05-16 journal: j clin virol doi: 10.1016/j.jcv.2020.104442 sha: doc_id: 259558 cord_uid: remrzrq1 given the global shortage of nasopharyngeal (np) swabs typically used for respiratory virus detection, alternative collection methods were evaluated during the covid-19 pandemic. this study showed that a combined oropharyngeal/nares swab is a suitable alternative to np swabs for the detection of sars-cov-2, with sensitivities of 91.7% and 94.4%, respectively. the first reports of 2019 novel coronavirus disease (covid-19) caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) emerged from china in december, but quickly spread as a pandemic. [1] [2] [3] laboratory testing for sars-cov-2 plays an essential role in infection control and public health mitigation strategies; however, testing has been hampered by global supply chain shortage nasopharyngeal (np) swabs and universal transport medium (utm). as such, alternative collection methods were rapidly evaluated, including nasal swabs, oropharyngeal (op) swabs, throat washings, and saliva. [4] [5] [6] [7] [8] while np swabs in utm are the specimen of choice for respiratory virus testing, a recent study demonstrated the feasibility of covid-19 testing from nasal sample collected with a swab typically used for chlamydia and gonorrhea testing: the aptima multitest swab (hologic, inc.) and its accompanying specimen transport medium (stm). [9] this study sought to further validate the aptima swab/stm collection kit for the detection of sars-cov-2 using a single swab approach to sample the oropharynx and anterior nares (op/na). in community assessment centers prioritizing areas with suspected community spread of sars-cov-2, specimens were collected for covid-19 testing from 190 individuals using two different collection devices: a flocked np swab in 3 ml utm (copan diagnostics inc., murrieta, ca) and combined op/na sampling using the aptima multitest swab in 2.9 ml of stm (hologic, inc., san diego ca), according to an accompanying instructional video (https://vimeo.com/397169241). each specimen was stored at 4c until testing, and an aliquot was stored at -80c. both swabs were in parallel within 12h of collection using two molecular methods. first, the sars-cov-2 assay, was performed on a cobas 6800 system amplification was performed on an applied biosystems 7500 fast system (thermo fisher scientific), and threshold cycles (ct) values were determined by the manufacturer software. results for each instrument were classified as positive or negative, and specimens yielding discrepant results were subjected to testing using the xpert xpress sars-cov-2 assay (cepheid). each test was compared to a modified reference standard defined as concordant results from at least two methods with different genetic targets. sensitivity and specificity were calculated from 2 × 2 contingency tables with 95% confidence intervals (ci) for each collection (np or op/na swabs) and instrument (ldt and commercial assay) using j o u r n a l p r e -p r o o f online software (https://www.medcalc.org/calc/diagnostic_test.php). a fisher exact test was used to assess differences and p ≤ 0.05 was considered statistically significant. the limited and unpredictable supply of np swabs during the covid-19 pandemic prompted the evaluation of swabs that were readily available and commonly used for sexually transmitted infections. op/na was lower than np swabs using the ldt or commercial assays, no significant differences were observed (p = 0.679 and 0.115, respectively). patients with discrepant np and op/na results are summarized in (table 1) . with the exception of patient 4, the other five patients with discrepant np and op/na results had specimens with low viral loads (table 1) . low viral loads are known to occur in the early and late stages of covid-19 illness [4] [5] [6] [11] [12] [13] [14] [15] [16] [17] [18] [19] , and false negative results can arise from differences in analytical sensitivity between methods (table s1 ) [20, 21] , the variability in specimen collection, or factors influencing specimen stability or recovery of sars-cov-2 rna during specimen transport, storage or processing. [4, 13] for example, three different sars-cov-2 targets were detected between the various pcr methods used for testing of j o u r n a l p r e -p r o o f specimens from patient 1, yet high ct values were observed for these targets (table 1) . high ct values are suggestive of low viral loads, and it is known that detection of pcr targets near the limit of detection lacks reproducibility. [20, 21] therefore, low viral loads and differences in analytical sensitivity of the various molecular methods could explain differences in sars-cov-2 detection between the np and op/na collections (table s1 ). similar arguments could be made for patients 2 to 4, who were either asymptomatic or in the pre-symptomatic stage of infection where low viral loads can occur. [4] [5] [6] [11] [12] [13] [14] [15] [16] [17] [18] [19] discrepant results for patients 5 and 6 were in the setting of known positive cases, with symptoms predating their sample collection by 14 and 18 days, respectively. waning viral loads over time in the upper respiratory tract are well documented for sars-cov-2; however, discrepant np and op/na results from sampling in the later stages of illness may be of little clinical significance, as detection of sars-cov-2 rna does not imply infectivity. [4, 6, 11, 19] further analyses are underway to correlate sars-cov-2 detection, and better understand viral shedding from various anatomical sites in patients stratified by disease onset, clinical presentation, and outcomes. interestingly, patient 4 had a positive np swab with low ct values (i.e. high viral load) by three different methods, but the op/na on the same patient was negative. the exogenous internal control in the commercial assay was amplified from the op/na specimen (arguing against the presence of pcr inhibitors); however, the ldt endogenous control in the op/na reaction was near the cutoff (ct value of 34.9). while an unlikely alternative explanation could be a false-positive result for the np swab, it is more likely that there were collection or transport deficiencies for the op/na specimen. the data obtained from this study represents a relatively short time period in a community setting with a mixed population of asymptomatic and mildly-symptomatic patients. while op/na swabs collection showed excellent performance for the detection of sars-cov-2, as previously shown for nasal sampling [9] , one should exercise caution in applying these findings to other patient populations, collection *discrepant analysis using xpert testing was only performed on nasopharyngeal swabs in utm, as the op/na showed reduced sensitivity for this assay (table s1 ). abbreviations: threshold cycle (ct), envelope (e); laboratory-developed test (ldt); nucleoprotein (n2); not available (n/a); j o u r n a l p r e -p r o o f china novel coronavirus investigating and research team. a novel coronavirus from patients with pneumonia in china a pneumonia outbreak associated with a new coronavirus of probable bat origin the species severe acute respiratory syndrome-related coronavirus: classifying 2019-ncov and naming it sars-cov-2 the laboratory diagnosis of covid-19 infection: current issues and challenges evaluating the accuracy of different respiratory specimens in the laboratory diagnosis and monitoring the viral shedding of 2019-ncov infections clinical presentation and virological assessment of hospitalized cases of coronavirus disease 2019 in a travel-associated transmission cluster. infectious diseases (except hiv/aids) effect of throat washings on detection of 2019 novel coronavirus saliva is more sensitive for sars-cov-2 detection in covid-19 patients than nasopharyngeal swabs avaniss-aghajani a. 2020. validation of the hologic's aptima unisex and multitest specimen collection kits used for endocervical and male urethral swab specimen (aptima swab) for sample collection of sars-cov-2 detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr temporal dynamics in viral shedding and transmissibility of covid-19 clinical features of atypical 2019 novel coronavirus pneumonia with an initially negative rt-pcr assay stability issues of rt-pcr testing of sars-cov-2 for hospitalized patients clinically diagnosed with covid-19 comparisons of viral shedding time of sars-cov-2 of different samples in icu and non-icu patients novel coronavirus outbreak research team. epidemiologic features and clinical course of patients infected with sars-cov-2 in singapore sars-cov-2 viral load in upper respiratory specimens of infected patients infections in residents of a long-term care skilled nursing facility presymptomatic sars-cov-2 infections and transmission in a skilled nursing facility detection of low levels of sars-cov-2 rna from nasopharyngeal swabs using three commercial molecular assays on behalf of the covid-19 pandemic diagnostics investigation team of the canadian public health laboratory network (cphln) respiratory virus working group key: cord-285018-l26px1bc authors: ong, david s.y.; claas, eric c.j.; breijer, simone; vaessen, norbert title: comparison of the genefinder(tm) covid-19 plus realamp kit on the sample-to-result platform elite ingenius to the national reference method: an added value of n gene target detection? date: 2020-09-07 journal: j clin virol doi: 10.1016/j.jcv.2020.104632 sha: doc_id: 285018 cord_uid: l26px1bc background: due to the emergence of the coronavirus disease 2019 (covid-19) pandemic there is an urgent need for rapid and accurate testing on the severe acute respiratory syndrome coronavirus 2 (sars-cov-2). objectives: the aim of this study was to assess the diagnostic performance of the genefinder(tm) covid-19 plus realamp kit on the elite ingenius sample-to-result platform, which is a commercial nucleic acid amplification test (nat) targeting genes of sars-cov-2. study design: patients were eligible between march 18 and may 27, 2020, when they had respiratory symptoms that were suspected for covid-19. the ingenius platform was compared to routine in-house nat that was validated according to the national reference. results: of 128 randomly selected patients, 58 (45%) tested positive and 55 (43%) tested negative in both platforms. sensitivity of the ingenius platform was 100% (95% confidence interval 94-100). in the remaining 15 (12%) cases e and rdrp genes were not detected in both platforms but the nucleoprotein (n) gene was tested positive by the ingenius platform. all solitary n gene positive cases were confirmed by a n-gene specific in-house validated nat, and most of these patients could also be considered positive based on other recently available covid-19 positive respiratory samples or highly suspected radiological findings. conclusion: the ingenius platform for sars-cov-2 detection has excellent sensitivity, is easy to use and provides fast results. the inclusion of the n gene as a third gene target may further increase sensitivity for the diagnosis of covid-19 in comparison to the national reference method. in december 2019 the coronavirus disease 2019 (covid-19) outbreak started in wuhan (china) [1] , but covid-19 rapidly spread to other countries as well [2, 3] . in the fight against this pandemic, accurate and rapid diagnostics of the severe acute respiratory syndrome coronavirus 2 (sars-cov-2) are important. nucleic acid amplification tests (nats) are generally characterised by high specificity, but their sensitivity depends on the timing of disease presentation, quality and location of sampling, and severity of illness [4] . following the first validated national and international nats, numerous commercial nat platforms have been introduced into the market, of which many can produce faster results and do not require advanced molecular diagnostic skills to perform these tests. this study aimed to assess the diagnostic performance of the genefinder tm covid-19 plus realamp kit on the sample-to-result ingenius® platform in comparison to the national reference standard in the netherlands, and to determine the added value of nucleoprotein (n) gene detection to establish the diagnosis of covid-19. between march 18 and may 27, 2020, patients presenting to a teaching hospital, healthcare workers working in the same hospital, patients from nursing homes and outpatients were eligible for covid-19 testing if they had respiratory symptoms that were suspected for respiratory tract infection. the institutional review board (irb) waived the need for informed consent as tests were performed on samples which had been acquired for routine clinical care (irb protocol number 2020-071). patients were sampled from the oral cavity and subsequently from the nasal cavity using the same nasopharyngeal swab, which was tested by a validated in-house nat assay on the presence of covid-19 envelope protein (e) gene and rna dependent rna polymerase (rdrp) gene according to a reference method that was established after international collaboration [5] . rna extraction was performed from clinical samples using the dna and viral na large volume kit on the magna pure 96 j o u r n a l p r e -p r o o f system (roche, penzberg, germany) and subsequently real-time reverse-transcription polymerase chain reaction using the fast viral master mix (life technologies) on the lightcycler 480 system (roche, penzberg, germany). samples were considered to be positive in case both rdrp and e genes or only rdrp gene were detected. the sample was retested when only the e gene was detected and the result was interpreted as positive in case the e gene was detected again. in total, 58 sars-cov-2 positive and 70 negative samples, as determined by the national reference method, were randomly selected from a larger available collection of samples obtained during routine clinical care. samples were stored at 4°c before analysis in accordance with manufacturer instructions using the ce-ivd kit genefinder tm covid-19 plus realamp kit on the sample-to-result platform elite ingenius® (elitech, puteaux, france). this platform used the same e and rdrp targets but additionally included the sars-cov-2 n gene as a third gene target. samples that were tested negative for e and rdrp genes but tested positive for n gene were send for further analysis by another real-time polymerase chain reaction based on the centers for disease control and prevention (cdc) n gene (n2) assay [6] . before the implementation for routine use, the in-house nat, ingenius® platform and the specific n gene nat were all internally validated by testing a validation panel provided by the national institute for public health and the environment, and all performed well. all analyses were performed using sas 9.2 (cary, north carolina). we compared groups using non-parametric tests for continuous variables. p-values <0.05 were considered to be statistically significant. (table 1) . in these samples, the ingenius® platform detected all three genes in 47 (84%) samples, e gene and n gene only in 1 (2%), rdrp and n gene only in 2 (3%), and n gene only in 8 (14%). the sensitivity of the ingenius® platform was 100% (95% confidence interval (ci) 94-100). theoretically, the n gene should be the most sensitive target for sars-cov-2 detection as a result of higher abundance of subgenomic n gene messenger rnas in comparison to other targets [7] . in comparison to the in-house nat, advantages of the ingenius® platform include the lower turn-around-time of three hours (in contrast to five hours), reduced hands-on-time and easy-to-use making it suitable for a broad group of laboratory technicians not limited to molecular technicians. the platform has integrated automated nucleic acid extraction, real-time polymerase chain reaction amplification and result analysis. to the best of our knowledge only one other study has assessed the genefinder tm assay in 41 nasopharyngeal samples [8] , in which high agreement was found between this assay and another commercial assay. of note, in our study we primarily assessed nasopharyngeal swabs and many sample-to-result ce-ivd assays have been validated for nasopharyngeal samples only [9, 10] . the ingenius® platform has been registered for nucleic acid extraction and purification of all types of respiratory samples. there are some study limitations to consider. this study included only one commercial sample-to-result nat, but currently many other easy-to-use tests are available on the market, in conclusion, the ingenius® platform as a fully automated device has excellent sensitivity and could be a valuable asset in the molecular diagnostic testing arsenal of microbiological laboratories. further validation is needed to determine whether including the n gene as a third gene target for establishing the diagnosis of covid-19 can also improve clinical sensitivity, particularly in those patients with a longer time interval between onset of symptoms and testing. the authors declare no conflicts of interest. funding: this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. clinical characteristics of coronavirus disease 2019 in china rapidly increasing cumulative incidence of coronavirus disease (covid-19) in the european union/european economic area and the united kingdom current information about the novel coronavirus (covid-19) bilthoven: rivm sars-cov-2 viral load in upper respiratory specimens of infected patients detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr 2019-ncov) realtime rt-pcr diagnostic panel services sars-coronavirus-2 replication in vero e6 cells: replication kinetics, rapid adaptation and cytopathology the allplex 2019-ncov (seegene) assay: which performances are for sars-cov-2 infection diagnosis? clinical evaluation of three sample-to-answer platforms for detection of sars-cov-2 comparison of the analytical sensitivity of seven commonly used commercial sars-cov-2 automated molecular assays we would like to thank our laboratory technicians for their assistance in performing these molecular tests.contribution: dsyo and nv contributed to the conception and design of the study. dsyo, sb and nv acquired the data. dsyo and nv analysed the data. dsyo, ec, sb and nv contributed to the interpretation of the data. dsyo drafted the first manuscript and ec, sb and nv revised it critically for important intellectual content. all authors approved this manuscript version to be submitted. key: cord-256699-d2tf2g7f authors: brochot, etienne; demey, baptiste; handala, lynda; françois, catherine; duverlie, gilles; castelain, sandrine title: comparison of different serological assays for sars-cov-2 in real life date: 2020-08-02 journal: j clin virol doi: 10.1016/j.jcv.2020.104569 sha: doc_id: 256699 cord_uid: d2tf2g7f background: the emergence of the global sars-cov-2 pandemic required the rapid and large-scale deployment of pcr and serological tests in different formats. objectives: real-life evaluation of these tests is needed. using 168 samples from patients hospitalized for covid-19, non-hospitalized patients but infected with sars-cov-2, patients participating in screening campaigns, and samples from patients with a history of other seasonal coronavirus infections, we evaluated the clinical performance of 5 serological assays widely used worldwide (wantai®, biorad®, euroimmun®, abbott® and liaison®). results: for hospitalized patients, all these assays showed a sensitivity of 100 % from day 9 after the symptoms onset. on the other hand, sensitivity was much lower for patients who did not require hospitalization for covid-19 confirmed by pcr (from 91.6 % for wantai® to 69 % for liaison®). these differences do not seem to be due to the antigens chosen by the manufacturers but more to the test formats (igg detection versus total antibodies). in addition, more than 50 days after a positive pcr for cov-2-sars the proportion of positive patients seem to decrease. we did not observe any significant cross-reactions for these techniques with the four other seasonal coronaviruses. conclusion: in conclusion, the evaluation and knowledge of the serological tests used is important and should require an optimized strategy adaptation of the analysis laboratories to best meet patient’s expectations in the face of this health crisis. since the outbreak of coronavirus cases worldwide, a frantic race for the availability of pcr and serological tests has been launched by the entire community of in vitro diagnostic manufacturers (2) . antibody tests, such as enzyme-linked immunosorbent assays (elisa) or chemiluminescent assays (clia), can overcome some of these difficulties. serological tests can detect past infection with cov-2-sars in patients for whom pcr could not be performed or for whom the nasopharyngeal swab result was falsely negative (3) . for serological tests, manufacturers have often demonstrated very good performance in terms of sensitivity and specificity (4, 5) . however, for antibody testing in acute disease, the sensitivity is highly dependent on the kinetics of antibody development. similarly, specificity is dependent on the type of samples selected to evaluate cross-reactions. it is necessary to evaluate these cross-reactions to other viruses of the coronavirus family. in j o u r n a l p r e -p r o o f addition, firms have adopted different strategies in terms of selecting their antigenic base and the type of immunoglobulins detected. the rapid availability of these tests then requires on-site evaluation by users to detect flaws in the results (6, 7) . thus, we evaluated five commercial serological tests widely used worldwide on samples from patients hospitalized for covid-19, non-hospitalized patients but infected with sars-cov-2, patients participating in screening campaigns, and samples from patients with a history of other seasonal coronavirus infections. j o u r n a l p r e -p r o o f the study was conducted at amiens university medical center. the study was approved by the institutional review board of the amiens university medical center (number pi2020_843_0046, 21 april 2020). samples were derived from de-identified excess serum specimens sent to our clinical virology lab. patient serum samples used in this study were submitted to the routine serology laboratory. the assays were validated using serum samples from (i) patients hospitalized for covid-19 (n=20), non-hospitalized patients but pcr confirmed with sars-cov-2 (n= 58), patients participating in screening campaigns (n= 62), and samples from patients with a history of other seasonal coronavirus infections (n= 28). the list and characteristics of the different serological tests evaluated are listed in table 1 . the antigen used in the assay is sars-cov-2 nucleocapsid for abbott® and biorad®, spike 1 for euroimmun®, spike 1 and 2 for liaison® and receptor binding domain (rbd) for wantai®. abbott®, euroimmun® and liaison® detect immunoglobulin g while biorad® and wantai® detect total antibodies with j o u r n a l p r e -p r o o f double antigen bridging assay (daba). a sample with a doubtful signal was tested a second time and if the result was still the same, the result was considered negative for our evaluation. the demographic information of the 168 patients (sex, age) was extracted from the patient data software (detailed in supplementary table 1). sensitivity was defined as the proportion of patients correctly identified as having sars-cov-2 infections. percent of agreement and kappa index were calculated with graphpad software v5.1. all samples from the 4 patient groups were run through the 5 cov-2 sars antibody detection kits. for the first group, with 20 patients hospitalized for covid-19 with a positive nasopharyngeal sars-cov-2 pcr, all samples were positive with these serological assays evaluated ( figure 1a ). then for patients also screened for covid-19 but not hospitalized and patients participating in screening campaigns, disparities between the tests were found. the figures ranged from 91.6% (wantai®) to 69% (liaison®) for the first group and from 40.3% (wantai®) to 21% (liaison®) for the second. these differences do not seem to be due to the antigens chosen by the manufacturers but more to the test formats (igg detection versus total antibodies). we for these 168 samples divided into 4 groups for which the five serological techniques were performed, we compared the number of positive samples two by two and calculated the overall percent agreement (negative and positive samples) and kappa index ( table 2) . for positive samples, for all sera, the highest number was for j o u r n a l p r e -p r o o f wantai®/biorad® (n= 93) while the lowest number was for liaison®/euroimmun® and liaison®/abbott® (n= 70) ( table 2a) . the biorad® and abbott® techniques using the nucleocapsid as an antigenic base had a good percentage of positive approvals (91.4%) and a high kappa index (0.82) (table 2b and c). all kappa indices were above 0.6 but with a range from 0.61 (liaison®/biorad®) to 0.82 (biorad®/abbott®). finally, in order to better study the discrepancies in the positive results in the two groups for which we observed differences (outpatients with sars-cov-2 positive pcr and outpatients with no history of sars-cov-2 infection) , we mentioned the indexes on two-by-two comparison histograms (supplementary figure 1). we observe most of the time for the positives samples with one assay, that these index numbers are low and rarely at signal saturation. finally, we analyzed more finely for these two groups the number of positive tests (from 1 to 5). we obtained for the 88 positive sera by the most sensitive technique (wantai), 48 (55%) sera positive with the five different assays (table 3) . however, for the rest of the positive samples, we observed significant differences between assays, and in particular for the liaison® assay , 90.5% (48/53) samples found positive with this technique were also positive with the four other assays. in this study, using 168 samples from a diverse group of patients in the sars-cov-2 pandemic,, we compared the performance of five widely used serological tests from around the world. many serological tests in different formats are now available and evaluated by different authorities but never with the same panel of samples. this allows us to compare these tests under real-life conditions with different categories of patients. it is clear that for patients requiring hospitalization for covid-19, the humoral response to cov-2-sars is so exacerbated that all properly developed techniques will have 100% sensitivity. the sensitivity problem can arise under two conditions. the first is when the antibody detection is too early in the course of the infection, especially for techniques that detect only igg. the second condition concerns a percentage of sars-cov-2 infection with asymptomatic or mild forms, in which case igg synthesis is absent or low while igm is probably more frequently detected. moreover, for this sensitivity problem, manufacturers have had to make new devices available in record time but probably with a preference for specificity over sensitivity in order not to suffer from bad publicity in case of false positive reactions. for example, we have tested the euroimmun® iga kit which shows a specificity of 90% on the package leaflet which we have confirmed (data not shown). antibody testing may therefore be relevant in the following settings: i) diagnosis of patients who seek medical attention more than a week after the onset of j o u r n a l p r e -p r o o f symptoms; ii) contact tracing; iii) determining potential immunity and risk of infection; and iv) sero-epidemiological studies to understand the extent of covid-19 spread. there is a debate as to whether sensitivity or specificity should be preferred for an acute disease for which serology can only provide mainly epidemiological data. perhaps we will soon have more sensitive techniques while maintaining a good specificity. in terms of specificity, which we evaluated against other seasonal coronaviruses, all techniques gave excellent results. the different manufacturers have excellent specificity figures, but these must then be evaluated under real conditions because of the diversity of possible reactions and the non-exhaustive search for potential cross-reactions. as observed in figure 1b on samples more than 50 days post-pcr, the percentage of positive results tends to decrease as recently described for neutralizing antibodies (8, 9) . all these results raise the question of the role of humoral immunity in relation to cellular immunity in combating this infection and its persistence (10, 11) . although we cannot compare the periods in this figure 1b this work was supported by a grant from the amiens university medical center. cov-2 positive 44 35 50 28 f sars-cov-2 positive ns 43 51 57 m sars-cov-2 positive 68 61 52 41 f sars-cov-2 positive 68 60 53 51 f sars-cov-2 positive 69 57 54 31 m sars-cov-2 a pneumonia outbreak associated with a new coronavirus of probable bat origin substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (sars-cov-2) the important role of serology for covid-19 control comparison of the diagnostic sensitivity of sars-cov-2 nucleoprotein and glycoprotein-based antibody tests performance characteristics of the abbott architect sars-cov-2 igg assay and seroprevalence in an evaluation of covid-19 serological assays informs future diagnostics and exposure assessment dynamic profile for the detection of anti-sars-cov-2 antibodies using four immunochromatographic assays anti-spike, anti-nucleocapsid and neutralizing antibodies in sars-cov-2 inpatients and asymptomatic carriers longitudinal evaluation and decline of antibody responses in sars-cov-2 infection do not minimize the impact of cellular immunity in the development of vaccines and therapeutics for covid-19 types of assays for sars-cov-2 testing: a review key: cord-279563-4lu1n0s7 authors: gorzalski, andrew j.; tian, honglin; laverdure, chris; morzunov, sergey; verma, subhash c.; vanhooser, stephanie; pandori, mark w. title: high-throughput transcription-mediated amplification on the hologic panther is a highly sensitive method of detection for sars-cov-2 date: 2020-06-10 journal: j clin virol doi: 10.1016/j.jcv.2020.104501 sha: doc_id: 279563 cord_uid: 4lu1n0s7 background: as the demand for laboratory testing for sars-cov-2 increases, additional varieties of testing methodologies are being considered. while real time polymerase chain reaction (rt-pcr) has performed as the main method for virus detection, other methods are becoming available, including transcription mediated amplification (tma). the hologic aptima sars-cov-2 assay utilizes tma as a target amplification mechanism, and it has only recently received emergency use authorization (eua) by the food and drug administration (fda). objectives: we sought to compare the sensitivity and specificity of the aptima sars-cov-2 assay to rtpcr as a means of sars-cov-2 detection in a diagnostic setting. study design: we performed a limit-of-detection study (lod) to assess the analytical sensitivity of tma and rt-pcr. this preceded a comparison of the methods using previously evaluated clinical specimens (nasopharyngeal swabs) using 116 human specimens tested by both methodologies. specimens included sixty-one (61) specimens found reactive by real-time pcr, fifty-one (51) found non-reactive, and four (4) deemed inconclusive. results: the aptima sars-cov-2 assay showed a markedly higher analytical sensitivity than rt-pcr by lod study. evaluation of clinical specimens resulted in fewer inconclusive results by the sars-cov-2 assay, leading to potentially higher clinical sensitivity. conclusions: the higher analytical sensitivity may explain the assay’s ability to ascertain for the presence of sars-cov-2 genome in human specimens deemed inconclusive by real-time pcr. tma provides an effective, highly sensitive means of detection of sars-cov-2 in nasopharyngeal specimens. the foundation of covid-19 diagnostic testing has included direct detection of viral genomes through nucleic acid amplification methods. for tests that have been utilized under an emergency use authorization by the food and drug administration (fda), the sole mechanism of amplification used in such tests to date of this manuscript has been real-time pcr (rt-pcr). assessments of the sensitivities of these tests have been generated and provided to the scientific community, including comparisons of cdc 2019-ncov real-time rt-pcr diagnostic panel, the hologic panther fusion and the diasorin simplexa, among others (1) (2) (3) (4) . tests that utilize mechanisms of amplification other than the polymerase chain reaction are now becoming available. among them is the hologic panther (non-fusion) aptima platform which utilizes transcription mediated amplification (tma) to amplify the number of target genomes. the hologic panther is not uncommonly located in public health and clinical laboratories. this is primarily due to its ease-of-use and high-throughput capability. at the time of preparation of this manuscript, the hologic panther is located in 54% of public health laboratories, making it a strong candidate for contributing to the high-throughput testing needs of states and counties seeking to reopen their businesses and institutes (5) . additionally, while throughput of testing is a key feature that is sought in detection assays for sars-cov-2, sensitivity is likely also a very significant trait. reports of false negative results from real time pcr testing indicate that even the high analytical sensitivity of rt-pcr may be challenged by the pathology of covid-19 (6, 7) . for this reason, any new tool in the diagnostic arsenal should be assessed for its ability to detect sensitively this virus. herein, we present data from a comparison study between rt-pcr and tma as employed by the hologic aptima sars-cov-2 assay. this study includes nasopharyngeal swabs taken from individuals tested for sars-cov-2 either in a medical or public health screening setting. additionally, an assessment of analytical sensitivity and limit-of-detection was performed using a quantitated solution of viral genome diluted in transport matrices. specificity relative to one another, with 100% concordance through 20 specimens. real-time specimens may be "reactive", "non-reactive" and "inconclusive". inconclusive results by the utilized rt-pcr assays are caused when only one of two or three genomic targets shows amplification for a particular specimen. the cause of this is due either to the presence of very low numbers of viral genomic targets for detection (2) , or false, low-level reactivity for a singular primer/probe set. patient specimens were stored at -80°c for 1-5 weeks prior to assessment by transcription-mediated amplification. transcription-mediated amplification (tma) was performed on the hologic panther using ruo versions of the sars-cov-2 detection assay and included the following steps: 500 µl of vtm was added to 710 µl of hologic lysis tube solution. such specimens were loaded onto the hologic panther and tested by programmed protocol, which includes the analysis of 360 µl of lysed specimen. specimens resulted by the panther are recorded as "positive", "negative" or "invalid" ("invalid" did not occur during the course of this study). with consideration of inconclusive specimens: true positivity is ascertained by reactivity by two orthogonal molecular tests (in this case, tma and rt-pcr). as a result, two of the evaluated inconclusive specimens in this study are deemed true positives and two are considered true negatives. analytical sensitivity / limit-of-detection analysis was performed using quantitated genomic rna from sars-cov-2, isolate usa-wa1/2020 (bei resources, manassas, va). the stock solution of 5.5x10e7 genome equivalents/ml was diluted in 10-fold series in viral transport media or aptima multitest collection fluid. dilutions were tested in replicates of five. to assess differences in analytical sensitivity between real-time pcr and tma, we performed a limit-ofdetection (lod) study by creating a dilution series of purified / quantified sars-cov-2 genomic material either in vtm or aptima collection matrix. specimens at each dilution were tested in replicates of five each by either detection method. as shown in table 1 noting the sensitivity difference demonstrated by the lod study, we sought to assess the performance of tma on specimens previously tested by rt-pcr for sars-cov-2. one hundred and sixteen (116) specimens which were nasopharyngeal swabs, and for which sufficient volume existed were selected for testing. this included specimens that were tested by real-time pcr that were: reactive (51), nonreactive (61) and inconclusive (4) . reactive specimens, as evaluated by rt-pcr for the n1 gene had a ct for real-time pcr. percent agreement for specimens found non-reactive ("negative" by tma) by realtime pcr was 100% and was 98% for those found reactive ("positive" by tma). the hologic panther sars-cov-2 transcription mediated amplification test showed higher analytical sensitivity when compared to real time pcr for the detection of sars-cov-2. it additionally provided fewer inconclusive results when evaluating human specimens -perhaps as a result of enhanced j o u r n a l p r e -p r o o f sensitivity. in the assessment of clinical specimens, there was one specimen found to be reactive by rt-pcr and non-reactive by tma. this result is surprising considering the observed higher analytical sensitivity of tma. we hypothesize that the freezing and thawing, and perhaps storage of specimens may have had a detrimental effect on the specimen, prior to tma testing. it is notable as well that specimens (collected in vtm) were subject to some dilution prior to testing on the hologic aptima system. using manufacturer's recommendations, 500 µl of specimen material was first added to 710 µl of lysis buffer prior to testing. this means that the sensitivity of the aptima test may have been underestimated in the testing of human specimens. the finding of two specimens deemed inconclusive by rt-pcr but positive by tma match the findings of higher analytical sensitivity. a differential in sensitivities between the two mechanisms is not surprising. previous studies have shown higher sensitivities associated with tma based assays compared to rt-pcr for viral detection (8, 9) . specimens subjected to tma include a process where 360 µl of collected specimen (transport medium) enter the detection process and is tested. for real time pcr, while 200 µl enters the testing process (extraction), only 5 or 10 µl are subjected to pcr. moreover, the mechanisms of amplification are very different. pcr involves a doubling of target nucleic acid in each of 40 cycles while transcriptionmediated amplification includes the generation of potentially thousands of transcribed copies of target which can each be subsequently turned into transcriptional templates. an additional benefit of the panther (tma) platform, not quantified in this study, was its ease-of-use relative to rt-pcr. samples need only be loaded by random access to the panther device, which extracts and amplifies/detects in a fully automated fashion. rt-pcr can only be effectively utilized in a batch testing system, which includes extensive extraction prior to detection. this ability to perform high-throughput testing, on a sensitive molecular detection platform has potential to make a significant contribution to the covid-19 pandemic, where such high demands exist for testing. the hologic panther sars-cov-2 assay appears to have these traits. gorzalski: establishment of rt-pcr assays and test performance chris laverdure: test performance, limit of detection honglin tian: tma, limit of detection stephanie vanhooser: coordination of project sergey morzunov: laboratory support subhash verma: review, analysis mark pandori: conceptualization, data curation, formal analysis, project administration, writing rapid and sensitive detection of sars-cov-2 rna using the simplexa™ covid-19 direct assay us cdc real-time reverse transcription pcr panel for detection of severe acute respiratory syndrome coronavirus 2. emerg infect dis an assessment of real-time rt-pcr kits for sars-cov-2 detection comparison of four molecular in vitro diagnostic assays for the detection of sars-cov-2 in nasopharyngeal specimens covid-19 public health laboratory capacity and capabilities weekly data report | week false-negative of rt-pcr and prolonged nucleic acid conversion in covid-19: rather than recurrence novel coronavirus outbreak research team.epidemiologic features and clinical course of patients infected with sars-cov-2in singapore analytical characteristics and comparative evaluation of aptima hiv-1 quant dx assay with ampliprep/cobas taqman hiv-1 test v2.0 comparison of transcription mediated amplification (tma) and reverse transcription polymerase chain reaction (rt-pcr) for detection of hepatitis c virus rna in liver tissue key: cord-263389-m6x9gxwe authors: alghounaim, m.; xiao, y.; caya, c.; papenburg, j. title: diagnostic yield and clinical impact of routine cell culture for respiratory viruses among children with a negative multiplex rt-pcr result date: 2017-07-29 journal: j clin virol doi: 10.1016/j.jcv.2017.07.015 sha: doc_id: 263389 cord_uid: m6x9gxwe background: polymerase chain reaction (pcr) is the reference standard for respiratory virus testing. however, cell culture may still have added value in identifying viruses not detected by pcr. objectives: we aimed to estimate the yield and clinical impact of routine respiratory virus culture among children with a negative pcr result. study design: a retrospective cohort study was performed from jan. 2013 to sept. 2015. respiratory samples from hospitalized or immunocompromised patients <18 years old were routinely inoculated on traditional tube cell culture monolayers if they tested negative by a pcr assay for 12 respiratory viruses. we studied patients with a respiratory specimen negative by pcr and positive by culture. duplicates and samples of sold services were excluded. data on demographics, clinical history, laboratory findings, and patient management were collected from patients’ charts. descriptive and multivariate statistics were performed. results: overall, 4638 pcr-negative samples were inoculated in cell culture. of those, 196 (4.2%) were cell culture positive, and 144 met study inclusion criteria. most subjects (81.9%) were hospitalized. mean age was 2.4 ± 3.4 years. the viruses most frequently isolated were cytomegalovirus (33.3%) and enteroviruses (19.4%). cell culture results prompted a change in management in 5 patients (3.5%), all of whom had acyclovir initiated for localized hsv-1 infection. four of these had skin or mucosal lesions that could be sampled to establish a diagnosis. conclusion: in children, routine viral culture on respiratory specimens that were negative by pcr has low yield and minimal clinical impact. viral respiratory infection is a leading cause of hospitalizations, acute care visits, and antibiotic overuse in children [1] . the diagnosis is confirmed by identification of a respiratory virus in a respiratory specimen [2] . traditional diagnostic methods include viral isolation by cell culture and detection of viral antigens by immunofluorescence. the superior sensitivity of molecular methods such as reverse-transcriptase polymerase chain reaction (rt-pcr) has led to their increased use in clinical laboratories [3, 4] . still, some authors suggest performing viral culture in a backup role in respiratory specimens from high-risk populations to detect viruses that are not part of the rt-pcr assay or whose genomes have mutations that may lead to false-negative rt-pcr results [5, 6] . however, the implementation of a second diagnostic step, i.e., viral culture after a negative rt-pcr result, is associated with additional costs and unknown effect on clinical management. we aimed to estimate the yield of routine respiratory virus culture among children with a negative pcr and to describe the impact of a positive cell culture result on their care. we performed a single-center retrospective cohort study at the montreal children' population included all patients < 18 years old with a viral culture performed on a respiratory specimen that had tested negative by multiplex pcr. duplicate samples were excluded (> 1 viral culture for the same patient within 7 days or during the same illness episode). all respiratory virus specimens submitted to the clinical virology laboratory were tested using a laboratory-developed multiplex realtime pcr assay for 12 viruses (influenza a/b, parainfluenza 1/2/3, rsv, adenovirus, coronavirus 229e/oc43, human metapneumovirus, enterovirus, and rhinovirus) [7, 8] . the mean turnaround time for the pcr assay was ∼9 h [8] . respiratory samples from hospitalized or immunocompromised patients that tested negative by pcr were routinely inoculated on traditional tube cell culture monolayers (rmk, a-549, and mrc-5 cell lines; quidel corporation, san diego, ca). cell culture tubes were observed for cytopathic effect three times per week and incubated for a total of 16 days. hemadsorption was performed in one of the two rmk tubes between days 6 and 8. patient charts were reviewed to collect data on patient demographics, clinical history, significant underlying chronic co-morbidities, and medical management. data were analyzed using descriptive statistics. in addition, clinical factors associated with the isolation of a respiratory virus (compared to other viruses) were assessed by logistic regression. multivariate logistic regression model selection was guided by akaike information criterion. during the study period, 4638 respiratory specimens were processed for viral culture (fig. 1 ). of those, 196 (4.2%) specimens were culture +/pcr-and 144 (3.1%) specimens were included in the analysis. excluded specimens included 39 duplicate samples and 13 sold service specimens (medical record unavailable). subjects were mostly male (63.2%) and 118 (81.9%) were hospitalized (table 1) . sixty-two patients (43.1%) were previously healthy and without known comorbidities. the mean age was 2.35 ± 3.4 years. most specimens were nasopharyngeal samples (95%). the working diagnoses that most frequently prompted respiratory virus testing were unspecified febrile illness (30.6%) and lower respiratory tract infection (24.3%). there were 14 specimens (9.7%) that were processed for viral culture without clear indication. the mean turnaround time for a positive viral culture result was 9 days ( table 2 ). viruses that were not part of the pcr assay comprised 53.5% of culture-positive specimens. the most frequently isolated viruses were cytomegalovirus (33.3%) and enteroviruses (19.4%). in multivariate logistic regression analysis, factors independently associated with recovering a respiratory virus in cell culture (compared to other viruses) were a working diagnosis of upper or lower respiratory tract infection (adjusted odds ratio [aor] 4.88, 95% ci 1.87-12.76), malignancy comorbidity (aor 5.71, 95% ci 1.38-23.71) and lymphopenia (aor 2.91, 95% ci 1.13-7.52). cell culture results prompted a change in management in only 5 patients (3.5% of positive cultures, 0.1% of all cultures done), all of whom had acyclovir initiated for localized hsv-1 infection. four of these had skin or mucosal lesions that could have been or were sampled to establish a diagnosis. one of the 5 patients was immunosuppressed (receiving cytotoxic chemotherapy), and none were neonates. moreover, mumps, a reportable disease, was isolated in one patient in which mumps infection was not suspected. communication with a patient's family regarding culture results was documented in 4 instances where management had not been otherwise affected. no instances of cessation of antibiotics, discharge from hospital or initiation of antivirals for influenza or other respiratory viruses were observed in association with positive viral culture results. molecular testing for respiratory viruses is highly sensitive [2, 11] . we observed that only 2% of pcr-negative pediatric respiratory samples were positive by cell culture for a virus in our rt-pcr panel. moreover, positive cell culture results for any virus had little or no influence on clinical management. the diagnostic yield of viral culture depends on several factors including the viral load, the quality of the respiratory specimen and cell lines, and the laboratory staff expertise [4] . a major drawback of traditional tube cell cultures is the long turnaround time, which can take between 2 days to 2 weeks to produce a result. for this reason, the clinical usefulness of the technique is guarded as the result may arrive too late to impact physician decision making [12] . in our study, only patients with hsv infection had their management changed due to viral culture. this could be explained in part by the shorter time to positivity for hsv and the availability of specific antiviral treatment (acyclovir). another limitation of viral culture is that some respiratory viruses, e.g., group c rhinovirus, some group a coxackieviruses, coronaviruses, and polyomaviruses kiv and wuv, neither replicate nor produce identifiable cytopathic effect in standard cell culture lines [13] [14] [15] . viral culture has the advantage of isolating and identifying a wide range of viruses rather than detecting specific viral genetic targets by rt-pcr. this may be important in the immunocompromised and newborn populations where viral infections not typically included in respiratory pcr assays (cmv and hsv) may be of clinical importance [3, 16] . moreover, infections caused by viruses with genetic mutations may be falsely negative by pcr [3, 6, 17] . viral culture may have additional advantages at the public health level for monitoring phenotypic antiviral susceptibilities, informing vaccine development, and identifying rare or novel strains. because of the limitations and advantages of different diagnostic methods for respiratory viruses, a combination of methods is still recommended by some authors [5] . however, in our clinical laboratory, routine viral cultures from pcr-negative respiratory specimens had minimal impact on patient care. while viral culture may rarely alter management, it can aid in identifying the causative viral agent in certain clinical scenarios. in our study, seven patients had a working diagnosis of meningitis; 3 of 7 grew enterovirus from the nasopharyngeal specimen (2 echovirus and 1 coxsackievirus b5). in those three patients without microbiological evidence of bacterial meningitis, one can infer that the likely cause of the aseptic meningitis was enterovirus. to our knowledge, this is the first study to evaluate the impact of routine viral culture in respiratory specimens that were negative by multiplex pcr. this single-center study is limited by its retrospective nature; changes in patient management associated with viral culture results may not have been well documented in medical charts. moreover, our findings may not be applicable to shell vial methods, which have a more rapid turnaround time compared to traditional culture techniques [18] . nevertheless, over nearly three years, we observed that routine traditional viral cell culture on specimens negative by multiplex pcr had very low yield and minimal clinical impact in the pediatric population. our findings can aid microbiology labs to optimize the utilization of respiratory virus testing. we have since modified our laboratory practice to restrict cell culture to respiratory specimens from high-risk immunocompromised children or upon special request. none. j. p. has received investigator-initiated research funds from becton, dickenson & co., served on the scientific advisory board of rps diagnostics, and has received speaker's honoraria from cepheid. other authors declare no competing interests. approved by the mcgill university health centre pediatric research ethics board (study 15-380-muhc). infectious disease hospitalizations among infants in the united states pcr testing for paediatric acute respiratory tract infections role of cell culture for virus detection in the age of technology molecular techniques should not now replace cell culture in diagnostic virology laboratories benefits and drawbacks of molecular techniques for diagnosis of viral respiratory infections. experience with two multiplex pcr assays delayed rsv diagnosis in a stem cell transplant population due to mutations that result in negative polymerase chain reaction a real-time rt-pcr assay for detection of influenza h1n1 (swinetype) and other respiratory viruses multiplex respiratory virus testing for antimicrobial stewardship: a prospective assessment of antimicrobial utilization and clinical outcomes among hospitalized adults appendix 1 -hematological reference values, in lanzkowsky's manual of pediatric hematology and oncology appendices reference value in infancy and childhood in nathan and oski's hematology and oncology of infancy and childhood development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses comparison of conventional viral cultures with direct fluorescent antibody stains for diagnosis of community-acquired respiratory virus infections in hospitalized children detection of respiratory viruses and the associated chemokine responses in serious acute respiratory illness primary isolation of viruses diagnostic microbiology of the immunocompromised host point: is the era of viral culture over in the clinical microbiology laboratory? the impact of primer and probe-template mismatches on the sensitivity of pandemic influenza a/h1n1/2009 virus detection by real-time rt-pcr evaluation of r-mix shell vials for the diagnosis of viral respiratory tract infections we thank dr. patricia fontela for constructive feedback and discussions. key: cord-291553-j9nn5g70 authors: fridholm, helena; østergaard sørensen, line; rosenstierne, maiken w.; nielsen, henrik; sellebjerg, finn; bengård andersen, åse; fomsgaard, anders title: human pegivirus detected in a patient with severe encephalitis using a metagenomic pan-virus array date: 2016-01-29 journal: j clin virol doi: 10.1016/j.jcv.2016.01.013 sha: doc_id: 291553 cord_uid: j9nn5g70 we have used a metagenomic microarray to detect genomic rna from human pegivirus in serum and cerebrospinal fluid from a patient suffering from severe encephalitis. no other pathogen was detected. hpgv in cerebrospinal fluid during encephalitis has never been reported before and its prevalence in cerebrospinal fluid needs further investigation. metagenomic methodologies are excellent complement in cases where a diagnosis is difficult to establish with conventional laboratory tests and its usage is ever increasing. metagenomic approaches reveal presence of both pathogenic and commensals in patient samples where the focus is on identifying an underlying ethological agent for a specific disease condition. we report a case of severe encephalitis where the only microbe detected in the cns was human pegivirus (hpgv), hitherto only known to cause asymptomatic infections in humans. one previous report describes the detection of hpgv in brain tissue and csf [1] . in both cases it is uncertain if hpgv is pathogenic but it is noteworthy to detect a virus at a high viral load in the cns. in other cases, hpgv infections have been associated with beneficial outcomes in patients dually infected with hpgv and hiv or ebola [2] [3] [4] [5] . a 25-year old danish female was admitted to the hospital for abdominal pain, vomiting, dizziness and lower extremity pain. she was working as a bartender on a cruise ship, was sexually active but had no travel history outside scandinavia or exposure to blood transfusions, intravenous drugs or close contact to animals albeit recently received a tattoo. her past medical history included radiofrequency catheter ablation for wolf-parkinson-white syndrome and she awaited elective cholecystectomy due to prior gallstone attacks. upon admission she was alert and circulatory stable with a fever of 38.5 • c, glasgow coma score of 15 and a bmi of 20. routine blood test showed haemoglobin of 8.0 mmol/l, white blood cell count of 2.5 × 10 9 /l with lymphocytopenia, normal platelet count, c-reactive protein (crp) of 33 mg/l, alanine aminotransferase 270 u/l, lactate dehydrogenase 281 u/l, alkaline phosphatase 110 u/l and bilirubin of 8 mol/l. an acute laparoscopic cholecystectomy was performed but no pathology of the gall bladder was found. immediately following the surgery she developed increasing abdominal pain and fever and she underwent an explorative laparoscopy, again with normal findings. post-operatively the patient complained of headache and diplopia, which both disappeared within 24 h and she was discharged from the hospital. however, she was readmitted the following day with fever, headache, sudden behavioral change, photosensitivity and ataxia. she presented with somnolence and neck stiffness on physical examination (glasgow coma score 14). vital signs were within normal limits but she had a fever of 38.0 • c. peripheral blood showed crp of 17 mg/l, white blood count 3. pleocytosis of 150 cells/mm 3 (99% lymphocytes) and increased protein concentration of 3.5 g/l, indicative of a viral infection. an mri of the brain revealed leptomeningeal enhancement over the right hemisphere together with parenchymal changes, consistent with meningoencephalitis. she was treated with aciclovir for suspected viral encephalitis and with meropenem for possible bacterial infection. over the following days the patient worsened with mental status deterioration and progressed into coma and was transferred to an intensive care unit for mechanical ventilation. repeated lumbar puncture on day 9 disclosed an increase of mononuclear cells to 333 leukocytes/mm 3 (99% lymphocytes) with a protein concentration of 2.8 g/l. she received dexamethasone, methylprednisolone and later prednisolone. serum and csf were tested for relevant pathogens, all returned negative ( table 1) . because of the lack of a specific diagnosis serum and csf were sent to statens serum institut, copenhagen, where the specimens were run on a lawrence livermore pan-microbial array. this array contains 360000 probes against all sequenced bacteria and viruses present in the ncbi database as of 2010 [6, 7] . the only positive signal was for human pegivirus (hpgv) (acc. nr. gse67021), and two separate diagnostic laboratories subsequently confirmed hpgv rna in both serum and csf [8, 9] . the ct value for hpgv during the acute phase in serum and spinal fluid was 23.4 and 32.1, respectively. an rnaseq library was prepared from serum and sequenced on an illumina platform to obtain type information. the reads mapped to the entire reference genome (acc. nr. nc 001710) with a mean sequence depth of 48, a pariwise identity of 89.7% (nt) and 98,3% (aa), respectively. the assembled sequence (acc. nr. kp259281) clustered within genotype 2 [10] . after eight days with severe neurological symptoms the patient gradually recovered and was discharged from the hospital four weeks later for rehabilitation. five weeks after discharge she was still viremic for hpgv in serum but viral load had decreased 21 times (ct 27.8). hpgv is a flavivirus, characterized by enveloped virions with a single-stranded, positive-sense rna genome and is closely related to hepatitis c virus [11] . upon discovery hpgv was initially thought to cause acute hepatitis but this has later been disproven and an hpgv infection has not been linked to any clinical disease in humans [12, 13] . on the contrary, an infection has been associated with a beneficial outcome in hiv patients and also recently in ebola infected individuals [2, 4] . in 1998 radkowski et al. screened 17csf samples from patients suffering from aseptic meningitis or encephalitis by rt-pcr but could not detect hpgv in any of the samples [14] . more recently, both positive and negative rna-strands of hpgv was detected in post mortem brain tissue from a multiple sclerosis (ms) patient, implying that the virus was replicating in the brain tissue [1] . the authors also detected hpgv in the csf of the same patient, but screening of csf from an additional 27 ms patients were all negative. in developed countries 1-4% of healthy blood donors are viremic for hpgv [15] [16] [17] [18] [19] [20] (2.2% in denmark) [21] whereas in developing countries and for people with blood-borne or sexually transmitted diseases the prevalence reaches 20-40% [11] . clearance of hpgv coincides with the appearance of hpgv e2 antibodies [22] [23] [24] and healthy individuals normally clears the infection within two years. between 5-20% of the population are seropositive against the glycoprotein e2 reflecting a previous infection [11, 21] . hpgv is not routinely tested for during illnesses of the cns and it was surprising to detect it in csf of our patient as the only positive finding. we analyzed an additional 40 csf samples from encephalitis patients and 13 from patients with a relapse of ms for hpgv by qpcr. for 20 of the encephalitis samples we tested serum collected concurrently with the csf sample. all csf samples where negative for hpgv but one encephalitis patient was positive in serum (ct 27.2). interestingly, this patient also had csf pleocytosis, as our case patient. as hpgv is lymphotropic [25] the presence of hpgv in the csf could be attributed to passive transport of the virus as the cells are recruited to csf. it is uncertain if the hpgv infection and its presence in csf in any way influenced the clinical presentation but this possibility cannot be excluded. a few weeks after discharge she was still viremic for hpgv but the viral load in serum had decreased from ct 23.4 to 27.2. it seems that on rare occasions hpgv can enter the cns in high viral titers but it is unknown for how long it persists. clearance of virus from the csf is not a well understood process. herpesvirus (cmv, ebv, vzv and hsv 1/2) and flavivirus (tbev) can persist in individuals after encephalitis and may cause recurrent encephalitis. we have also excluded the possibility that the encephalitis is a result of a reactivation event due to the surgical procedure as the patient was negative for hsv and the symptoms coincided with the time of surgery. several viruses, bacteria and antibodies are known to be able to induce encephalitis but in many clinical cases the etiology remains unknown [26, 27] . metagenomic methodologies target a multitude of microbes simultaneously thereby reducing the number of tests and the total cost. due to their unbiased presentation of the nucleic acids present in a sample they have an unprecedented potential as a diagnostic tool for differential diagnosis. ngs has been used to resolve the presence of leptospira santarosai [28] and an astrovirus [29] in csf in cases of encephalitis, where comprehensive microbiological testing was inconclusive. more precise interpretations need to be developed as both pathogenic and non-pathogenic microbes will yield a signal and perhaps disclose known virus with unexpected pathogenetic potential. whether presence of hpgv in csf affects disease progression remains to be established but these findings needs to be reported as they add to our knowledge of the microbial flora and aids in pinpointing which microbes warrants further attention and study. deep sequencing for the detection of virus-like sequences in the brains of patients with multiple sclerosis: detection of gbv-c in human brain gb virus c: the good boy virus? diagnostic value of anti-gbv-c antibodies in hiv-infected patients gb virus c coinfections in west african ebola patients acquisition of gb virus type c and lower mortality in patients with advanced hiv disease the microbial detection array for detection of emerging viruses in clinical samples-a useful panmicrobial diagnostic tool a microbial detection array (mda) for viral and bacterial detection multiplex real-time pcr for the detection and quantification of latent and persistent viral genomes in cellular or plasma blood fractions hepatitis c virus and gb virus c/hepatitis g virus viremia in swedish blood donors with different alanine aminotransferase levels evidence for extensive genotypic diversity and recombination of gb virus c (gbv-c) in germany the gb viruses: a review and proposed classification of gbv-a, gbv-c (hgv), and gbv-d in genus pegivirus within the family flaviviridae g-pers creepers, where'd you get those papers? a reassessment of the literature on the hepatitis g virus gb virus-c-a virus without a disease: we cannot give it chronic fatigue syndrome lack of gb virus c/hepatitis g virus sequences in cerebrospinal fluid in patients with central nervous system infections a case-control study of transmission routes for gb virus c/hepatitis g virus in swedish blood donors lacking markers for hepatitis c virus infection gb virus c/hepatitis g virus infection in patients investigated for chronic liver disease and in the general population in southern sweden prevalence of gb virus c (also called hepatitis g virus) markers in norwegian blood donors seroprevalence of gb virus c and persistence of rna and antibody a novel t cell evasion mechanism in persistent rna virus infection humoral immune response to the e2 protein of hepatitis g virus is associated with long-term recovery from infection and reveals a high frequency of hepatitis g virus exposure among healthy blood donors gb virus c epidemiology in denmark: different routes of transmission in children and low-and high-risk adults detection of antibodies to a putative hepatitis g virus envelope protein antibody to gbv-c second envelope glycoprotein (anti-gbv-c e2): is it a marker for immunity? prevalence of gbv-c/hepatitis g virus rna and e2 antibody among subjects infected with human immunodeficiency virus type 1 after parenteral or sexual exposure evidence that the gbv-c/hepatitis g virus is primarily a lymphotropic virus causes of encephalitis and differences in their clinical presentations in england: a multicentre, population-based prospective study etiology of encephalitis in australia actionable diagnosis of neuroleptospirosis by next-generation sequencing diagnosis of neuroinvasive astrovirus infection in an immunocompromised adult with encephalitis by unbiased next-generation sequencing the authors declare no conflicts of interests. this study was partially funded by familiefonden egetrae. key: cord-262045-r2iqpmmc authors: smits, saskia l.; raj, v. stalin; pas, suzan d.; reusken, chantal b.e.m.; mohran, khaled; farag, elmoubasher a.b.a.; al-romaihi, hamad e.; alhajri, mohd m.; haagmans, bart l.; koopmans, marion p. title: reliable typing of mers-cov variants with a small genome fragment date: 2014-12-15 journal: j clin virol doi: 10.1016/j.jcv.2014.12.006 sha: doc_id: 262045 cord_uid: r2iqpmmc background: middle east respiratory syndrome coronavirus (mers-cov) is an emerging pathogen that causes lower respiratory tract infection in humans. camels are the likely animal source for zoonotic infection, although exact transmission modes remain to be determined. human-to-human transmission occurs sporadically. the wide geographic distribution of mers-cov among dromedary camels and ongoing transmissions to humans provides concern for the evolution of a mers-cov variant with efficient human-to-human transmission capabilities. phylogenetic analysis of mers-cov has occurred by analysis of full-length genomes or multiple concatenated genome fragments, which is time-consuming, costly and limited to high viral load samples. objective: to develop a simple, reliable mers-cov variant typing assay to facilitate monitoring of mers-cov diversity in animals and humans. study design: phylogenetic analysis of presently known full-length mers-cov genomes was performed to identify genomic regions with sufficient phylogenetic content to allow reliable mers-cov variant typing. rt-pcr assays targeting these regions were designed and optimized. results: a reverse-transcription pcr assay for mers-cov targeting a 615 bp spike fragment provides a phylogenetic clustering of mers-cov variants comparable to that of full-length genomes. the detection limit corresponds to a cycle treshold value of ∼35 with standard upe real time pcr assays on rna isolated from mers-cov emc. nasal swabs from rt-pcr positive camels (ct values 12.9–32.2) yielded reliable sequence information in 14 samples. conclusions: we developed a simple, reliable mers-cov variant typing assay which is crucial in monitoring mers-cov circulation in real time with relatively little investment on location. middle east respiratory syndrome coronavirus (mers-cov; family coronaviridae) may cause severe lower respiratory tract infection in humans [1, 2] . camels are considered the likely animal source for zoonotic infection; sporadic human-to-human transmission does occur, but is considered to be inefficient based on currently available data [3] [4] [5] [6] [7] [8] [9] [10] . until recently, new mers-cov infections in humans were reported at a steady low rate reaching ∼200 confirmed human cases early 2014. in march and april 2014, however, a surge of mers-cov infections occurred mainly in hospitals around jeddah, kingdom of saudi arabia (ksa) and united arab emirates (uae). this increased case load was in part attributed to an increase in community cases, but mostly to transmission within hospitals, with no evidence for evolution of a mers-cov variant with more efficient human-to-human transmission capabilities (who;http://www.who.int/csr/disease/coronavirus infections/ mers cov update 09 may 2014.pdf?ua=1). the ongoing occurrence of new cases, however, and the finding that mers-cov is endemic in dromedary camels in a wide geographic region [3, 10, 11] , stresses the need for surveillance of strain diversity, to help unravel the epidemiology of this newly identified pathogen, and to provide a reference for studies into mers-cov evolution. all currently sequenced human and camel mers-cov genomes share >99% nucleotide identity across the ∼30 kb genome. phylogenetic analysis has occurred mainly by analysing full-length genomes or multiple concatenated genome fragments, to provide reliable phylogenetic information [5, [12] [13] [14] . however, full length genome sequencing capacity is not widely available, and requires relatively high viral load, leading to limited success when trying to sequence animal or human samples [5] . an accurate typing of mers-cov variants, preferably with a simple assay encompassing a short region of the mers-cov genome, is crucial in monitoring the mers-cov outbreak in real time with relatively little investments on location. in this study, we describe the development of a mers-cov variant typing assay, which can be used in monitoring mers-cov circulation, especially when more information on virus type is required rapidly from a large number of viruses from animals/humans. full or near full-length mers-cov genomes encompassing nucleotides 215-29770 (numbering corresponding to mers-cov emc genome jx869059) were aligned with mafft version 7 (http://mafft.cbrc.jp/alignment/server/) ( table 1) . to remove the redundancy from the dataset, fastgroupii analysis (http://fastgroup.sdsu.edu/fg tools.htm) was performed grouping all currently available viral genomes based on nucleotide composition, resulting in 15 groups (table 1) . one viral genome from each group was taken as representative in subsequent analyses. a summary of nucleotide positions that vary across the genomes was created using bioedit v7.2.0 [15] and the number of nucleotide positions with variations was plotted over 1000 nucleotide windows. phyml trees were generated using seaview 4 software with the approximate likelihood ratio test based on a shimodaira-hasegawa-like procedure which used general time reversible as substitution model. nearest neighbor interchange, subtree pruning, and regrafting-based tree search algorithms were used to estimate tree topologies, as described previously [5] . total nucleic acids were isolated using an automated mag-napure 96 extraction with the total nucleic acid isolation kit (roche, mannheim, germany) as described previously [13] . the detection limit of the assay was determined on rna isolated from 10x dilutions of cell culture derived mers-cov emc 2012 (jx869059), as described above. virus stocks were prepared as described previously [16] . rna was isolated from serial 10-fold dilutions of mers-cov emc 2012 [13] . serial 10-fold dilutions of this rna were amplified in parallel with the mers-cov variant typing assay described above and the upe and n gene real time pcr assays [17, 18] . the sensitivity of the mers-cov variant typing assay was expressed as cycle threshold value based on the upe real time pcr assay. on may 13 and 15, 2014, the first two mers-cov infected patients in the netherlands who became infected upon travel to saudi arabia were reported to who; throat swabs from these patients were available [19] . in february and april 2014, nasal swabs were taken from dromedary camels of different age and sex from a slaughterhouse in doha, qatar [13] , which were available for this study. to identify genome regions for reliable phylogenetic analysis comparable to that of full-length genome, (near) full-length mers-cov genomes (table 1) were aligned. viral genomes that were 99.9% identical were grouped and one viral genome from each group was taken as representative in the analysis (table 1 ) and a phyml tree was generated (fig. 1a) . was plotted over 1000 nt windows (fig. 1b) . four genome fragments, two located in orf1a, one in s and one in orf4b, showed a relatively high number of snps (fig. 1b) and for this reason already had been used as concatenated genome fragment for phylogenetic analysis [12] . however, phylogenetic trees created for these four fragments separately did not accurately reflect the phylogenetic positions of the currently known full-length mers-cov genomes (data not shown). in a subsequent analysis all identified snps were inspected visually and regions containing snps with phylogenetic information regarding the previously identified four clusters of viruses were identified (fig. 1a) . the s2 domain of the spike protein contains a number of these mutations (fig. 1b) . a fragment of 615 bp, containing three of these snps, provided a phylogenetic tree similar to the one obtained upon full-genome analysis regarding the previously identified four mers-cov clusters (fig. 2) , whereas other mers-cov genome regions did not provide similar results. as observed for the full-length genomes, human, and camel mers-cov genomes shared >99% nucleotide identity across the 615 bp s2 domain fragment. mers-cov genomes that were released recently and not taken along in the variation analysis were typed using the 615 bp s2 domain and clustered similar to their phylogenetic positions as upon full genome analysis ( fig. 2 and table 1 ), thereby validating the assay. a sequencing rt-pcr targeting the identified genome fragment was developed and optimized using rna isolated from cell culturederived mers-cov. in limiting dilution experiments, the mers-cov variant typing assay amplified the 615 bp fragment down to a cycle treshold value of ∼35 as determined by diagnostic upe real time pcr assays [17, 18] . the mers-cov variant typing assay was used to type rt-pcr positive nose swabs from the first two human dutch mers-cov cases in 2014. the results showed grouping consistent with previous findings based on long sequence fragments [19] (fig. 2 ). in addition, the mers-cov variant typing assay was performed on camel samples from a slaughterhouse in qatar [13] and sequences for 14 mers-cov positive animals with cycle threshold values ranging from 12.9 to 32.2 as determined by upe real time rt-pcr [17, 18] were obtained (fig. 2) . five different camel mers-cov variants in clusters b1 and b2 were detected, without the need for full genome sequencing. phylogenetic analysis of representative mers-cov full-length genomes indicated that four regions in the mers-cov genome exist with a substantially higher nucleotide variation across genomes. however, phylogenetic analysis of these genome regions sepa-rately did not provide reliable phylogenetic information, in contrast to an analysis of the concatenated fragments [5, 12, 19] . subsequent analyses revealed a region in the open reading frame that encodes the spike protein with a number of positions in which nucleotide variation occurs between mers-cov variants with a strong phylogenetic signal regarding previously identified clusters of viruses based on full-length mers-cov genomes. the here[19] and from camels from a slaughterhouse in doha, qatar [13] . the observed detection limit of a cycle treshold value of ∼35 allows variant typing in clinical samples obtained from humans and animals with relatively low viral loads. it enables inclusion of samples in phylogenetic analysis that would not have been included when only full length genomes would have been accepted. this mers-cov variant typing assay, targeting a part of the mers-cov spike gene, is a relatively simple rt-pcr sequencing assay that could be performed more widely as initial screening assay in laboratories with basic sequencing capacity. it provides accurate crude mers-cov type information, applicable in monitoring viral variants in real time. new variants identified through this initial screening could then be sent to a reference laboratory for further characterization. the continued occurrence of transmission between humans in health care and family settings is an ongoing concern as stated by the world health organization (http://www.who.int/csr/disease/coronavirus infections/mers cov update 27 march 2014.pdf?ua=1), although the outbreaks appear to be self-limiting or extinguishable with rigorous implementation of appropriate infection control guidelines at present. however, as the primary route of transmission to humans is uninterrupted, human-to-human transmissions will continue to occur. the data obtained from the mers-cov variant typing assay would aid in informing the most effective international preparedness and response, allowing ad hoc risk assessment and implementation of containment strategies if necessary. state of knowledge and data gaps of middle east respiratory syndrome coronavirus (mers-cov) in humans isolation of a novel coronavirus from a man with pneumonia in saudi arabia middle east respiratory syndrome coronavirus infection in dromedary camels in saudi arabia mers coronaviruses in dromedary camels middle east respiratory syndrome coronavirus in dromedary camels: an outbreak investigation middle east respiratory syndrome (mers) coronavirus seroprevalence in domestic livestock in saudi arabia human infection with mers coronavirus after exposure to infected camels antibodies against mers coronavirus in dromedary camels seroepidemiology for mers coronavirus using microneutralisation and pseudoparticle virus neutralisation assays reveal a high prevalence of antibody in dromedary camels in egypt middle east respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study middle east respiratory syndrome coronavirus quasispecies that include homologues of human isolates revealed through whole-genome analysis and virus cultured from dromedary camels in saudi arabia middle east respiratory syndrome coronavirus (mers-cov) in dromedary camels isolation of mers coronavirus from a dromedary camel transmission and evolution of the middle east respiratory syndrome coronavirus in saudi arabia: a descriptive genomic study bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction assays for laboratory confirmation of novel human coronavirus (hcov-emc) infections middle east respiratory syndrome coronavirus (mers-cov) infections in two returning travellers in the netherlands this work was funded by zonmw top project 91213058z. this does not alter our adherence to all the policies on sharing data and materials. all authors contributed to gathering and analysis of the information. saskia smits, bart haagmans, and marion koopmans drafted and revised the manuscript based on all authors contributions. supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jcv.2014.12.006. key: cord-289740-nsiycudn authors: smithgall, marie c.; scherberkova, ioana; whittier, susan; green, daniel a. title: comparison of cepheid xpert xpress and abbott id now to roche cobas for the rapid detection of sars-cov-2 date: 2020-05-13 journal: j clin virol doi: 10.1016/j.jcv.2020.104428 sha: doc_id: 289740 cord_uid: nsiycudn background: the sars-cov-2 pandemic has created an urgent and unprecedented need for rapid large-scale diagnostic testing to inform timely patient management. however, robust data are lacking on the relative performance of available rapid molecular tests across a full range of viral concentrations. objective: this study aimed to compare two recently-authorized rapid tests, cepheid xpert xpress sars-cov-2 and abbott id now sars-cov-2, to the roche cobas sars-cov-2 assay for samples with low, medium, and high viral concentrations. study design: a total of 113 nasopharyngeal swabs from remnant patient samples were tested, including 88 positives spanning the full range of observed ct values on the cobas assay. results: compared to cobas, the overall positive agreement was 73.9% with id now and 98.9% with xpert. negative agreement was 100% and 92.0% for id now and xpert, respectively. both id now and xpert showed 100% positive agreement for medium and high viral concentrations (ct value <30). however, for ct values >30, positive agreement was 34.3% for id now and 97.1% for xpert. conclusions: while xpert showed high agreement with cobas across a wide range of viral concentrations, this study highlights an important limitation of id now for specimens collected in viral or universal transport media with low viral concentrations. further studies are needed to evaluate the performance of id now for direct swabs this is a pdf file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. this version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. keywords: covid-19, sars-cov-2, molecular diagnostics, point of care, pcr severe acute respiratory virus coronavirus 2 (sars-cov-2) emerged in wuhan, china in december 2019 and has since rapidly spread across the world, causing a global pandemic of coronavirus disease . the majority of cases are mild to moderate, but severe infections have overwhelmed healthcare systems in the united states, particularly in new york city. real-time polymerase chain reaction (rt-pcr) of viral rna from nasal or nasopharyngeal swabs has become the standard method used to confirm diagnosis. the first quantitative rt-pcr test for detecting sars-cov2 was designed and distributed in january 2020 by the world health organization (who) (1) . in the united states and many other countries, however, the slow rollout of large-scale diagnostic testing and the long turnaround times associated with laboratory tests, particularly those sent to reference laboratories, have significantly hampered public health efforts to contain the outbreak. in contrast, commercially-available rapid diagnostic assays can better inform timely patient management decisions to guide the need for quarantine, isolation, contact tracing, and therapeutic management. beginning in march 2020, multiple sars-cov-2 rapid tests received emergency use authorization (eua) from the u.s. food and drug administration (fda). however, manufacturer submissions for eua only require evaluation of the limit of detection and cross-reactivity of their assays, and do not address other important performance characteristics such as accuracy, precision, and reproducibility. in addition, most manufacturer submissions include studies of contrived positive samples with spiked viral rna, and do not j o u r n a l p r e -p r o o f assess performance on clinical patient specimens. two recently-authorized rapid tests, xpert xpress sars-cov-2 (cepheid, sunnyvale, ca) and id now sars-cov-2 (abbott, chicago, il) have been manufactured at wide-scale and distributed to numerous medical centers around the country. while initial studies on these two assays have been recently published, the number of patient samples evaluated to date has been relatively small, and significant questions remain about the accuracy of these tests across the full spectrum of viral loads (2) (3) (4) (5) . utilizing the high volume of patient testing performed at our medical center in new york city, we sought to evaluate and compare the performance of these two rapid assays across a wide range of clinical samples. deidentified remnant patient samples that underwent routine clinical testing with the cobas sars-cov-2 assay on the 6800 platform (roche diagnostics, indianapolis, in) were used to evaluate the xpert and id now assays. residual nasopharyngeal (np) swabs in transport media were held at 4° c prior to testing on the xpert and id now platforms, with all testing completed within 48 hours of sample collection. testing was performed according to the manufacturers' instructions on two separate id now instruments and a single genexpert infinity instrument. a total of 113 np swabs collected in 3 ml of viral transport media (m4rt vtm; thermofisher scientific, waltham, ma) or universal transport media (utm; becton dickinson and co., franklin lakes, nj) were included. the specimens were collected from april 8 to april j o u r n a l p r e -p r o o f 13, 2020 and included 111 adult and 2 pediatric patients who were all seen in inpatient or emergency room locations. to evaluate assay performance at varying viral concentrations, 88 positive specimens were selected to represent the full range of observed ct values on the cobas assay, ranging from 14 -38 cycles. positive agreement and 95% confidence intervals for the xpert and id now assays were calculated using cobas as the reference test. an additional 25 negative specimens were selected to evaluate negative agreement. the cobas assay utilizes rt-pcr to amplify and detect two viral targets: orf1 a/b, a non-structural region that is unique to sars-cov-2 and a conserved region in the e-gene, which is a structural protein envelope for pan-sarbecovirus detection. the xpert assay is an automated rt-pcr that amplifies and detects two viral targets: n2, a nucleocapsid recombinant protein unique to sars-cov-2 and a region in the structural envelope e-gene. the id now assay uses proprietary isothermal nucleic acid amplification technology for qualitative detection of sars-cov-2 rdrp gene using fluorescent reporter probes. this study was approved by the columbia university irving medical center institutional review board. j o u r n a l p r e -p r o o f of the 113 patient specimens, 111 were from adults ranging in age from 23 to 101 years and two were from pediatric patients, aged 1 day and 5 days old. the average age was 65 years for positive samples and 43 years for negative samples. overall, the majority of positive samples were from males (60.2%) and negative samples from females (68.0%) ( table 1) . testing results by abbott id now and cepheid xpert are shown in table 2 notably, one sample detected by xpert was a presumptive positive based on detection of the e-gene target but not the n2 target. there were also two samples that tested negative by cobas but positive by the xpert. these samples had ct values >40 for the n2 target only without detection of the e-gene target. for the e-gene target, ct values were generally 1 cycle lower for xpert than cobas (supplemental materials, table s1 and figure s1 ). to meet the urgent need for wide-scale diagnostic testing during the covid-19 pandemic, multiple rapid molecular tests have recently been authorized by the us fda, some of which are available in point-of-care (poc) or near patient settings. however, very few studies j o u r n a l p r e -p r o o f have been published to date on the relative performance characteristics of these assays, especially for patient specimens representing a wide range of viral concentrations (2) (3) (4) (5) . in this comparative analysis, the xpert assay showed a very high level of agreement with the cobas assay across the entire range of tested ct values, including low-level positives. these findings confirm those published by moran et al. (2) and show a high level of agreement between these two assays using an expanded number of positive clinical samples. in contrast, the id now assay reliably detected specimens with ct values ≤30, but did not detect the majority of specimens with ct values ≥ 30. whereas rhoades et al. (3) found an overall high level of agreement between id now and the modified cdc assay, hogan et al .(5) demonstrated lower agreement between id now and panther fusion (hologic, inc., marlborough, ma). our findings further highlight an important limitation of the id now for low-level positives. while all studies evaluated nasopharyngeal swabs eluted in transport media, it is important to note that the eua for id now was recently updated to remove the indication for swabs in transport media (6). our data support that the eua was appropriately modified, as samples may become too dilute in vtm and low-level positives may falsely test negative. in contrast to batch testing and the higher complexity required for the cobas assay, both xpert and id now offer shorter turnaround times and availability in near-patient settings. however, the two assays differ in throughput capacity and run time. each id now platform can run only a single specimen at a time, with results available in 13 minutes or less. xpert can be run on larger, random-access platforms that allow for significantly higher throughput, with results available in 45 minutes. both assays are available for use in poc settings, which introduces both benefits and drawbacks. on the one hand, poc molecular testing delivers the shortest possible interval between sample collection and result, which can facilitate faster clinical j o u r n a l p r e -p r o o f decision-making. however, concerns related to assay performance, quality management, and safety in the poc setting still remain. studies of poc molecular testing for influenza and respiratory syncytial virus have shown promising results, but also highlight some of these concerns (7) (8) (9) (10) . the risk of contamination and false positives is also much higher when testing is performed outside of a controlled environment and by non-laboratory trained personnel. nevertheless, the unique circumstances of a rapidly-spreading pandemic may ultimately necessitate the widescale adoption of poc assays in completely new patient settings, such as walk up or drive-thru testing centers. limitations of this study include the relatively few number of samples from pediatric patients, as only two samples from patients aged 1 day and 5 days were included, and both of these were negative on all three testing methods. we were also only able to evaluate id now for specimens in transport media. the performance of this assay with direct nasal swabs requires further evaluation in subsequent studies. another limitation is the use of the cobas assay as the comparator assay. two samples that were identified as positive only by xpert on the basis of n2 nucleocapsid gene detection were negative for both targets on cobas. whether these samples were truly positive or truly negative could not be determined. fast, readily available, and reliable test results are critically important during this pandemic, and each of the three assays evaluated in this study holds promise to deliver valuable clinical information. further head-to-head comparisons of molecular tests will be important in order to establish the usefulness of each method and to help medical providers determine the most appropriate diagnostic tests to best serve their patients and communities. data curation, formal analysis, investigation, methodology, validation, writing -original draft ioana scherberkova.: investigation, validation, writing -review and editing conceptualization, methodology, supervision, writing -review and editing green: conceptualization, methodology, formal analysis, supervision, writingreview and editing references coronavirus and the race to distribute reliable diagnostics the detection of sars-cov-2 using the cepheid xpert xpress sars-cov-2 and roche cobas sars-cov-2 assays comparison of abbott id now, diasorin simplexa, and cdc fda eua methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from individuals diagnosed with covid-19 clinical evaluation of the cobas sars-cov-2 test and a diagnostic platform switch during 48 hours in the midst of the covid-19 pandemic five-minute-point-of-care testing for sars-cov-2: not there yet detection of influenza a and b with the alere ™ i influenza a & b: a novel isothermal nucleic acid amplification assay. influenza other respir viruses evaluation of the molecular xpert xpress flu/rsv assay vs. alere i influenza a & b assay for rapid detection of influenza viruses multicenter clinical evaluation of the alere i respiratory syncytial virus isothermal nucleic acid amplification assay direct comparison of alere i and cobas liat influenza a and b tests for rapid detection of influenza virus infection table 2: positive and negative agreement of abbott id now sars-cov-2 and cepheid xpert xpress sars-cov-2 with roche cobas sars total total positive 65 (73.9 declarations of interest: none j o u r n a l p r e -p r o o f key: cord-260267-nau9kayk authors: ren, lili; gonzalez, richard; xie, zhengde; xiong, zhaohui; liu, chunyan; xiang, zichun; xiao, yan; li, yongjun; zhou, hongli; li, jianguo; yang, qingqing; zhang, jing; chen, lan; wang, wei; vernet, guy; paranhos-baccalà, gláucia; shen, kunling; wang, jianwei title: human parainfluenza virus type 4 infection in chinese children with lower respiratory tract infections: a comparison study date: 2011-06-01 journal: j clin virol doi: 10.1016/j.jcv.2011.05.001 sha: doc_id: 260267 cord_uid: nau9kayk background: human parainfluenza viruses (hpivs) are a leading cause of acute respiratory tract infections (artis). although hpiv-4 has been associated with mild artis for years, recent investigations have also associated hpiv-4 infection with severe respiratory syndromes and with outbreaks of artis in children. objectives: to characterize the role of hpiv-4 and its clinical features in children with acute lower respiratory tract infections (alrtis) in beijing, china. study design: nasopharyngeal aspirates were collected from 2009 hospitalized children with alrtis between march 2007 and april 2010. rt-pcr and pcr analyses were used to identify hpiv types and other known respiratory viruses. results: hpivs were detected in 246 (12.2%) patients, of whom 25 (10.2%) were positive for hpiv-4, 11 (4.5%) for hpiv-2, 51 (20.7%) for hpiv-1, 151 (61.4%) for hpiv-3, and 8 (3.3%) were co-detected with different types of hpivs. like hpiv-3, hpiv-4 was detected in spring, summer, and late fall over the study period. seasonal incidence varied for hpiv-1 and -2. the median patient age was 20 months for hpiv-4 infections and 7–11 months for hpiv-1, -2, and -3 infections, but the clinical manifestations did not differ significantly between hpiv-1, -2, -3, and -4 infections. moreover, co-detection of hpiv-4 (44%) with other respiratory viruses was lower than that of hpiv-1 (62.7%), hpiv-2 (63.6%), and hpiv-3 (72.7%). conclusions: hpiv-4 plays an important role in chinese paediatric alrtis. the epidemiological and clinical characteristics reported here improve our understanding of the pathogenesis associated with hpiv-4. background: human parainfluenza viruses (hpivs) are a leading cause of acute respiratory tract infections (artis). although hpiv-4 has been associated with mild artis for years, recent investigations have also associated hpiv-4 infection with severe respiratory syndromes and with outbreaks of artis in children. objectives: to characterize the role of hpiv-4 and its clinical features in children with acute lower respiratory tract infections (alrtis) in beijing, china. study design: nasopharyngeal aspirates were collected from 2009 hospitalized children with alrtis between march 2007 and april 2010. rt-pcr and pcr analyses were used to identify hpiv types and other known respiratory viruses. results: hpivs were detected in 246 (12.2%) patients, of whom 25 (10.2%) were positive for hpiv-4, 11 (4.5%) for hpiv-2, 51 (20.7%) for hpiv-1, 151 (61.4%) for hpiv-3, and 8 (3.3%) were co-detected with different types of hpivs. like hpiv-3, hpiv-4 was detected in spring, summer, and late fall over the study period. seasonal incidence varied for hpiv-1 and -2. the median patient age was 20 months for hpiv-4 infections and 7-11 months for hpiv-1, -2, and -3 infections, but the clinical manifestations did not differ significantly between hpiv-1, -2, -3, and -4 infections. moreover, co-detection of hpiv-4 (44%) with other respiratory viruses was lower than that of hpiv-1 (62.7%), hpiv-2 (63.6%), and hpiv-3 (72.7%). conclusions: hpiv-4 plays an important role in chinese paediatric alrtis. the epidemiological and clinical characteristics reported here improve our understanding of the pathogenesis associated with hpiv-4. © 2011 elsevier b.v. all rights reserved. human parainfluenza viruses (hpivs) are a leading cause of acute respiratory tract infections (artis). 1-3 hpivs account for 6.8% of hospitalizations due to fever and/or acute respiratory illnesses in children younger than 5 years of age. [1] [2] [3] [4] [5] [6] [7] [8] [9] four types of hpivs, 1 through 4, have been identified. studies of hpivs have focused primarily on hpiv-1 to -3, and detection methods include mainly cell culture and immunofluorescence. as the recovery rate of hpiv-4 in cell culture is inherently low and most clinical laboratories do not screen for hpiv-4, 10,11 the role of hpiv-4 in artis is unclear and may be underestimated. recent studies indicate that hpiv-4 is associated with respiratory infections including bronchitis and pneumonia. [10] [11] [12] [13] [14] however, the prevalence and clinical characteristics of hpiv-4 in chinese paediatric patients with acute lower respiratory tract infections (alrtis) have not been addressed fully. to characterize the role and clinical features of hpiv-4 in children with alrtis in beijing, china. nasopharyngeal aspirates (npa) were collected from children with alrtis, upon admission to beijing children's hospital between march 2007 and april 2010. no repeat samples or lower respiratory tract samples were collected. to exclude typical bacterial infections, physicians enrolled patients with body temperature ≥38 • c, respiratory symptoms and normal or low leukocyte count. similar numbers of samples were collected during each season over the study period, except in august 2009 when only eight samples were collected. nucleic acids were extracted from npa using nuclisens easymag tm (biomérieux, france). nested rt-pcr was used to detect hpivs, as described previously. 3, 5 invariant ␤-actin gene was used as an internal control for efficient extraction and amplification of viral nucleic acids. analytic sensitivity of rt-pcr was 1-10 copies for hpiv-2 and -4 and 10-100 copies for hpiv-1 and -3. to avoid contamination, the pcr process (including master mixture preparation for pcr, nucleic acid extraction, reaction installation and electrophoresis) was performed in different rooms. strict controls were used during the process of nucleic acid extraction and pcr analysis to monitor contamination. all pcr products were verified by sequencing. each specimen was also screened for other respiratory viruses, as described elsewhere. 3,15,16 distribution frequencies of hpivs were compared using pearson's chi square test or fisher's exact test. continuous variables for population parameters such as age, maximum temperature and duration of fever, laboratory investigations and other parameters were compared using one-way analysis of variance. p values <0.05 were statistically significant. a total of 2009 patients (1278 males and 731 females), 0.5 month to 16 years old (mean 2.5 years, median nine months), were enrolled in this study. hpiv rna was detected in 246 (12.2%) patients, from 1 month to 13 years old (mean 1.5 years; median nine months). the prevalence of hpiv was not significantly different between males (13.3%) and females (10.3%). twenty-five (10.2%) patients were positive for hpiv-4, 11 (4.5%) for hpiv-2, 51 (20.7%) for hpiv-1 and 151 (61.4%) for hpiv-3. the detection rate of hpivs varied significantly between age groups (x 2 = 57.680, p < 0.001). compared to hpiv-1 to -3, hpiv-4 was detected at a higher rate in 36-72 months-old patients and at a lower rate in 6-36 months-old patients ( table 1 ). the median age of hpiv-4 cases (20 months) was higher than that of hpiv-1 (11 months), hpiv-2 (10 months), and hpiv-3 cases (7 months). the seasonal distribution of hpivs fluctuated (fig. 1) 2008-2009, with varying seasonal incidence. hpiv-2 appeared sporadically during the study period (fig. 1 ). of the hpiv-positive patients, 63.8% were diagnosed with pneumonia, 15% with bronchopneumonia, 13% with bronchitis and 8.1% with peribronchitis or other conditions. the maximum body temperature was similar for patients with hpiv-4 and patients with other hpiv infections. congenital heart disease was reported in one (4%) patient with hpiv-4, four (3.9%) with hpiv-1, eight (5.3%) with hpiv-3, and in two (25%) co-infected with hpiv-4 and hpiv-1 or hpiv-4 and hpiv-3. the frequency of symptoms did not differ significantly between patients with different types of hpiv. chills, diarrhoea and vomiting were observed most frequently in patients with hpiv-2 ( table 1 ). the percentage of neutrophilic granulocytes, mean lymphocyte count or percentage of lymphocytes was similar between patients infected by different hpiv types. overall, the clinical manifestation of hpiv-4 infection resembles that of other hpiv types. co-infection was detected in 167 (67.9%) of the hpiv-positive cases, including eight (3.3%) co-detected with different types of hpivs and 159 (66.8%) co-detected with other respiratory viruses. co-detection rates of all hpiv types were statistically different ( table 2 ). hpiv-4 had the lowest co-detection rate, which was significantly lower than that of hpiv-3 (x 2 = 7.854, p = 0.005; table 2 ). respiratory syncitial virus (rsv) (65 cases) and rhinovirus (64 cases) were co-detected with hpivs most often ( table 2) . while co-infections of hpivs with rsv occurred mainly in spring and winter, those for rhinovirus occurred year round, corresponding to the seasonality of these viruses. clinical characteristics did not differ significantly between patients with single hpiv infections and those with co-infections. we present the first detailed study of hpiv-4 infections in chinese children with alrtis. in our study, we found that hpiv-3 cases are most prevalent, as previously reported, 2 followed by hpiv-1, then hpiv-4, and hpiv-2 cases. clinical manifestations did not differ significantly between hpiv-1, -2, -3, and -4 infections, but the median age of patients with hpiv-4 was higher than that for patients with any of the other hpiv types. in temperate climates, hpiv-1 and -2 infections occur annually during late fall and early winter, 1,2 whereas hpiv-4 infections occur biennially during late fall and winter, 2, 11, 14, 17 and hpiv-3 infections occur mainly during late spring and summer. 2 the seasonal distributions of hpiv-1, -3, and -4 reported here differ from those of previous reports. these discrepancies may be attributed to different geographical regions and study years. however, as the number of positive cases is limited in our study, large-scale investigation of hpiv incidence over a broader geographical range and longer time period is needed to better understand the seasonal patterns of hpivs. it is particularly interesting that hpiv-4 was more prevalent during spring and summer in 2007 and 2008 than in 2009 and 2010. we speculate that this finding is associated with the duration of protective immunities. if the protective immunity lasts long, the interval of epidemics could be longer. however, this hypothesis requires testing by immunological studies. to investigate the rate and role of co-infection, we screened each specimen for hpivs and other common respiratory viruses. most hpiv-positive patients (159, 66.8%) were co-infected with other viruses, but the co-detection rate was lowest in patients infected with hpiv-4. future investigations may want to consider screening for additional pathogens, such as bacteria, and using samples from different geographic locations to provide insight into the clinical significance of co-infections. overall, our results confirm that hpiv-4 is an important cause of severe symptoms associated with paediatric alrtis, which should be screened for routinely. [13] [14] [15] [16] parainfluenza viruses epidemiological features of parainfluenza virus infections: laboratory surveillance in england and wales, 1975-1997 prevalence of human respiratory viruses in adults with acute respiratory tract infections in beijing parainfluenza virus infection of young children: estimates of the populationbased burden of hospitalization simultaneous detection of fourteen respiratory viruses in clinical specimens by two multiplex reverse transcription nested-pcr assays adult croup: a rare but more severe condition a longitudinal study of respiratory viruses and bacteria in the etiology of acute otitis media with effusion pediatric hospitalizations for croup (laryngotracheobronchitis): biennial increases associated with human parainfluenza virus 1 epidemics epidemiology of respiratory infections in young children: insights from the new vaccine surveillance network human parainfluenza virus 4 outbreak and the role of diagnostic tests clinical and molecular epidemiology of human parainfluenza virus 4 infections in hong kong: subtype 4b as common as subtype 4a infections due to parainfluenza virus type 4 in children parainfluenza virus type 4 infections in pediatric patients human parainfluenza type 4 infections wu and ki polyomavirus present in the respiratory tract of children, but not in immunocompetent adults human bocaviruses are highly diverse, dispersed, recombination prone, and prevalent in enteric infections detection and identification of human parainfluenza viruses 1, 2, 3, and 4 in clinical samples of pediatric patients by multiplex reverse transcription-pcr we thank the clinicians of beijing children's hospital for assisting with sample collections. this study was supported by grants from the national major the authors report no conflicts of interest. key: cord-264360-eroqjkoh authors: risku, minna; lappalainen, suvi; räsänen, sirpa; vesikari, timo title: detection of human coronaviruses in children with acute gastroenteritis date: 2010-03-15 journal: j clin virol doi: 10.1016/j.jcv.2010.02.013 sha: doc_id: 264360 cord_uid: eroqjkoh background: human coronaviruses (hcovs) are known respiratory pathogens. moreover, coronavirus-like particles have been seen by electron microscope in stools, and sars-hcov has been isolated from intestinal tissue and detected in stool samples. objectives: to find out if hcovs can be found in stools of children with acute gastroenteritis and to assess the significance of hcovs in the etiology of acute gastroenteritis in children. study design: 878 stool specimens from children with acute gastroenteritis and 112 from control children were tested by rt-pcr to detect hcov groups 1b, 2a and sars. hcovs were typed by sequencing all pcr positive samples. results: twenty-two (2.5%) of the 878 stool specimens of children with acute gastroenteritis were positive for hcovs. the following hcov types were detected: oc43 (10 cases, 45.5%), hku1 (6 cases, 27.3%), 229e (2 cases, 9.1%) and nl63 (4 cases, 18.2%). in 4 of the cases a hcov was the only detected virus; in the remaining cases rotavirus or norovirus was found in the same sample. in control groups there were two hcov positive samples of 112 tested. conclusions: this study shows that all known non-sars hcovs can be found in stools of children with acute gastroenteritis. on the basis of this study, the significance of coronaviruses as gastrointestinal pathogens in children appears minor, since most of the coronavirus findings were co-infections with known gastroenteritis viruses. the first human coronaviruses (hcovs) 229e and oc43 were identified in the 1960s. [1] [2] [3] [4] these viruses are common causes of upper respiratory tract infections 5, 6 but also have association with lower respiratory tract disease especially in patients with underlying disease. [7] [8] [9] coronavirus-like particles have also been seen by electron microscope (em) in stool samples of both diarrheic and healthy patients evoking discussion about human enteric coronaviruses. 10 the clinical significance of these findings has been unclear and there are findings showing that such putative enteric coronaviruses are antigenically unrelated to oc43 and 229e viruses. 11 in 2003 interest towards coronaviruses increased when a new coronavirus was found to be a causative agent of sars (severe acute respiratory syndrome). [12] [13] [14] sars-hcov caused a serious lower respiratory tract infection with high mortality. [15] [16] [17] the main symptoms were fever, chills, myalgia, cough and headache, but also diarrhea was common and in one study registered in 38.4% of patients. in the same study sars-hcov was also isolated from intestinal tissue and viral rna was found in 16% of stool samples, which was comparable to the detection rate in nasopharyngeal aspirates. 18 in another cohort of patients diarrhea was seen in 73% of patients and viral rna was detected in 97% of stool specimens. in this cohort it was suggested that the outbreak was caused by faulty sewage system whereby the transmission might been fecal-oral rather than respiratory. 19 no association between the presence of diarrhea and mortality in sars cases has been observed, however. 20 a fourth human coronavirus, hcov-nl63, was identified in 2004 in the netherlands. it was isolated from a 7-month-old child suffering from bronchiolitis and conjunctivitis, and was categorized to be a new group 1 coronavirus. 21 soon after, another group in the netherlands independently detected the same virus in an 8-month-old child with pneumonia. 22 since the discovery, nl63 has been detected in patients with respiratory tract infection in several countries around the world, including canada, australia, korea and france. [23] [24] [25] [26] nl63 has been associated with severe lower respiratory tract infection and croup. 24, 27 the seroprevalence in 6-12-month-old children for nl63 is 28.6-40.0%. 28 less than a year later a second new coronavirus, hcov-hku1, was discovered in hong kong. this group 2 coronavirus was detected in a 71-year-old man with pneumonia. 29 hku1 has been found globally [30] [31] [32] [33] and in addition to respiratory samples it has been detected in stools, but no clear connection to enteric disease has been found. 34 considering the em findings, presence of gastrointestinal symptoms in sars, and the findings of hku1 in stools, we wanted to find out if non-sars human coronaviruses could be detected in stool samples of children with acute gastroenteritis using rt-pcr assay in order to assess the potential significance of coronaviruses in the etiology of acute gastroenteritis in children. the clinical material for the study was collected in a prospective study of acute gastroenteritis in children tampere and kuopio university hospital during a 2-year period 2006-2008 (räsänen et al., unpublished). healthy children (n = 36), children with indeterminate fever and vomiting (n = 43), and children with respiratory tract infection (n = 33) were used as control groups. also group a rotavirus, calicivirus (including norovirus genogroups i and ii, and sapovirus), aichivirus and human bocavirus were studied from the same material. adenovirus was not tested systematically but of 101 samples tested 13 were positive for adenovirus (six belonging to subgroup f, types 40 and 41) and none of these were co-infections with coronaviruses including two positive samples for coronavirus. a total of 878 samples from children with acute gastroenteritis, 43 samples from children with indeterminate fever and vomiting, 33 samples from children with respiratory tract infection and 36 samples from healthy children were tested for hcovs. before rna extraction the stool samples were diluted in phosphate-buffered saline (pbs) creating 10% stool suspension. viral rna was extracted using qiaamp viral rna mini kit (qiagen, germany) according to the manufacturer's protocol. extracted rna was stored at −70 • c until used. reverse transcription was done using random primers as previously described by pang et al. (2005) 35 except that reaction contained 1× first strand buffer (invitrogen, usa) and the final concentration of dntps (promega, usa) was 375 nm per each nucleotide. the produced cdna was stored at −20 • c. we used a two-step nested pcr which was set up and optimized in our laboratory. primers targeted to polymerase gene region were chosen because of regions conserved nature. hcov strains tc-adapted oc43 (vr-1558) and 229e (vr-740) were purchased from atcc (usa), and propagated in hct-8 and mrc-5 cells, respectively. in addition, positive hku1 and nl63 samples were provided by professor tobias allander (karolinska university, sweden) and professor lia van der hoek (university of amsterdam, netherlands). the specificity of pcr was confirmed by testing 35 different respiratory or enteric viruses and bacteria, with negative results. pcr-products were separated and recognized by gel electrophoresis, and all positive pcr products were confirmed to be coronaviruses and the specific type defined by sequencing. abi prism tm 310 genetic analyzer (applied biosystems, usa) was used in sequencing. sequences were aligned and confirmed by using sequencher tm 4.8 program (gene codes corporation, usa) and confirmed sequences were compared to reference strains by ncbi blast ® -program. twenty-two (2.5%) of the 878 stool specimens of children with acute gastroenteritis were positive for hcovs. a hcov as a single pathogen was detected in only four of the samples (18.2% of the positive samples). in the remaining cases either norovirus or rotavirus was detected in the same sample (table 1 ). in eleven (50%) of the 22 coronavirus positive cases there were symptoms of respiratory tract infection at the same time with gastroenteritis, or respiratory symptoms had been present before symptoms of gastroenteritis. three of the 4 patients with coronavirus as a single pathogen in stool sample had respiratory tract related symptoms. patient 1 ( table 1) had cough and rhinitis, and had just recovered from otitis media. patient 7 (table 1) did not have any respiratory tract symptoms. patient 11 (table 1 ) had tonsillitis and patient 19 (table 1) had headache and dizziness in addition to symptoms of respiratory tract infection. all non-sars human coronavirus types were found, members of group 2a; oc43 (10 of the cases, 45.5%) and hku1 (6 of the cases, 27.3%) were most common, whereas group 1b viruses 229e and nl63 were found only in 2 and 4 cases, respectively. no sars or sars-like viruses were found. still there might be unknown coronaviruses that our pcr method did not detect in spite of the universal primers in the 1st pcr. most hcov positive cases were found from january to april (fig. 1) . the age distribution of the coronavirus infected children was 9-75 months (median, 19.5 months), whereas in the total material the youngest child was 14 days and the oldest 14 years and 4 months (median, 17 months). of the coronavirus positive children 59% were males. within the control groups two (1.8%) of the 112 stool samples were positive for hcov. one of the cases was a 3-year-old female with pneumonia. oc43 was detected as the only pathogen in her stool samples on february 2007. two days after sample collection she also developed symptoms of gastroenteritis. the second patient was a healthy female aged 2 years and 11 months tested on july 2007. oc43 was again detected in a stool sample as a single pathogen. our study shows that human coronaviruses oc43, hku1, 229e and nl63 can be found in stool samples of children with acute gastroenteritis. the significance of coronaviruses as gastrointestinal pathogens seems at most marginal, even though it is also possible that our pcr method did not detect all existing coronaviruses and there still might be unknown coronaviruses related to diarrheal disease. most of the coronavirus findings were co-infections with well known enteric pathogens, norovirus and rotavirus. furthermore, half of the patients with coronavirus in stools had symptoms related to respiratory tract infection and, therefore, hcovs found in the stools could have originated from respiratory tract. unfortunately, no specimens from respiratory tract were collected to confirm the presence of coronaviruses in the respiratory tract in these patients, and further studies are needed to evaluate simultaneous presence of hcov in stools and respiratory tract. even if coronaviruses were found in respiratory tract in cases of acute gastroenteritis it would be difficult to determine whether they were primarily causing the respiratory or gastrointestinal symptom. studies with sars have shown that rna of sars coronavirus can be detected in stool samples for more than 10 weeks after symptom onset. 18 this elicits the question whether also non-sars coronaviruses might be detected after a prolonged time from the original infection. previous studies with em showed that coronaviruslike particles can be seen in stools of both diarrheic and healthy patients. 10 in our study one of the 36 healthy control patients had coronavirus detected in stool specimen and thus, there was no difference in the hcov detection rate between the cases of acute gastroenteritis and control children. this study was hospital based and did not include mild cases of gastroenteritis treated at home or healthcare centers. future studies should investigate such mild cases for hcovs. in conclusion, non-sars human coronaviruses can be found in stool samples of children with acute gastroenteritis. however, such findings are rare and occur usually with other well established gastroenteritis viruses. hcovs may also be found in occasional stool samples of children without gastroenteritis. taken together, it appears that known hcovs may at most have a minor etiologic role in the acute gastroenteritis of children. the study protocol and consent forms had been approved by the ethics committee of the pirkanmaa hospital district in 2006. none. none declared. our laboratory technicians and anna tiainen for excellent technical assistance in this project. a new virus isolated from the human respiratory tract the morphology of three previously uncharacterized human respiratory viruses that grow in organ culture recovery in tracheal organ cultures of novel viruses from patients with respiratory disease growth in suckling-mouse brain of "ibvlike" viruses from patients with upper respiratory tract disease occurrence and frequency of coronavirus infections in humans as determined by enzyme-linked immunosorbent assay viruses and bacteria in the etiology of the common cold an outbreak of coronavirus oc43 respiratory infection in normandy, france rhinovirus and coronavirus infectionassociated hospitalizations among older adults spectrum of clinical illness in hospitalized patients with "common cold" virus infections the human enteric coronaviruses adaptation of human enteric coronavirus to growth in cell lines coronavirus as a possible cause of severe acute respiratory syndrome a novel coronavirus associated with severe acute respiratory syndrome identification of a novel coronavirus in patients with severe acute respiratory syndrome a cluster of cases of severe acute respiratory syndrome in hong kong a major outbreak of severe acute respiratory syndrome in hong kong identification of severe acute respiratory syndrome in canada enteric involvement of severe acute respiratory syndrome-associated coronavirus infection clinical progression and viral load in a community outbreak of coronavirus-associated sars pneumonia: a prospective study viral replication in the nasopharynx is associated with diarrhea in patients with severe acute respiratory syndrome identification of a new human coronavirus a previously undescribed coronavirus associated with respiratory disease in humans human coronavirus nl63 infection in canada new human coronavirus, hcov-nl63, associated with severe lower respiratory tract disease in australia human coronavirus-nl63 infections in korean children human coronavirus nl63, france croup is associated with the novel coronavirus nl63 seroepidemiology of group i human coronaviruses in children characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia human respiratory coronavirus hku1 versus other coronavirus infections in italian hospitalised patients a prospective hospital-based study of the clinical impact of non-severe acute respiratory syndrome (non-sars)-related human coronavirus infection evidence of human coronavirus hku1 and human bocavirus in australian children coronavirus hku1 infection in the united states detection of the new human coronavirus hku1: a report of 6 cases multiplex real time rt-pcr for the detection and quantitation of norovirus genogroups i and ii in patients with acute gastroenteritis we thank professor tobias allander and professor lia van der hoek for providing control samples for setting up the pcr method. we also thank our studynurse marjo salonen for hard work, and all key: cord-263118-6sf41rsj authors: landry, marie l.; cohen, sandra; ferguson, david title: real-time pcr compared to binax now and cytospin-immunofluorescence for detection of influenza in hospitalized patients date: 2008-07-18 journal: j clin virol doi: 10.1016/j.jcv.2008.06.006 sha: doc_id: 263118 cord_uid: 6sf41rsj background: rapid tests have had a significant impact on influenza diagnosis, but more accurate tests are needed for hospitalized patients who test negative by rapid methods. objective: we sought to determine the increased yield obtained from influenza rt-pcr in hospitalized patients compared to two rapid methods. study design: binax now, cytospin-enhanced direct immunofluoroescence (dfa), and influenza a and b multiplex taqman rt-pcr were performed on 237 clinical samples. results: binax now detected 70 (53.0%), cytospin-dfa detected 127 (96.2%), and taqman rt-pcr detected 132 (100%) influenza-positive samples. the difference in sensitivity was significant between rt-pcr and binax now (p < 0.0001), but not between rt-pcr and cytospin-dfa (p = 0.0736). two samples testing positive for influenza b by all three methods, tested falsely positive for influenza a by binax. eight true positive samples did not become reactive by binax until 30 min, and thus were counted as negative. conclusions: the accuracy of real-time rt-pcr should greatly improve the diagnosis of influenza in hospitals using simple rapid flu tests, but may have a more modest impact in hospitals with expertise in cytospin-dfa. further studies are needed to determine the effect of influenza rt-pcr on patient management and costs in hospitalized patients. the impact of influenza on morbidity and mortality of young children as well as on elderly adults has been increasingly recognized (cdc, 2004) . early diagnosis can impact therapy and reduce unnecessary tests and treatments (barenfanger et al., 2000; bonner et al., 2003) . in the past, laboratory diagnosis of influenza was largely confined to culture in specialized laboratories. in recent years, rapid and simple influenza tests have become widely implemented, both in general laboratories and at the point of care (hurt et al., 2007) . with the introduction of real-time molecular methods and commercial kits, polymerase chain reaction (pcr) is more accessible to hospital laboratories and is becoming an option to replace culture (boivin et al., 2004) . in our hospital, cytospin-enhanced direct immunofluorescence (dfa) is performed on respiratory samples when virology is open, and a rapid influenza test, binax now, is used in the core laboratory when virology is closed (landry and ferguson, 2000; landry et al., 2004) . culture is reserved for hospitalized patients. due to the shorter assay time and greater sensitivity of pcr over conventional culture, a multiplex real-time rt-pcr procedure for influenza a and b was validated for clinical use in our laboratory (ward et al., 2004) . as part of the validation process, a prospective study was performed on a subset of clinical samples to determine the increased yield obtained from pcr in hospitalized patients. in total, 237 nasopharyngeal swabs from 234 patients collected in viral transport medium (m4, remel, lenexa, ks) and submitted to the clinical virology laboratory between january and april 2006 for respiratory virus dfa were utilized. patients ranged in age from 4 months to 93 years; 107 were ≤18 years and 130 were over 18 years of age. specimens were transported to the laboratory within 1 h of collection and were entered into the study if adequate sample was available to test by all three methods. since all dfa-negative samples could not be tested, only dfa-negative or inadequate samples (less than 25 respiratory epithelial cells) from inpatients were included. samples were tested on receipt by dfa and binax now. b two samples testing positive for influenza b by all three methods, also tested falsely positive for influenza a. eight true positive samples (two influenza a and six influenza b) were not reactive until ≥30 min of incubation and were called negative. an aliquot was frozen in lysis buffer at −70 • c and batch tested within 2 weeks by rt-pcr. during the study period, reflex viral cultures were ordered by physicians on another 683 dfa-negative non-study samples from hospitalized patients. samples were inoculated into primary rhesus monkey kidney (rhmk), mrc-5 and a549 cells in roller tubes, incubated at 35 • c, and examined for cpe and hemadsorption for 10 days. the influenza detection rate from cultured samples was compared to study samples tested by pcr. cytospin enhanced dfa using simulfluor respiratory screen reagents (chemicon, temecula, ca) and binax now (binax inc., portland, me) were performed as previously described (landry and ferguson, 2000) . binax results were read at 15 min according to manufacturer's instructions. nucleic acids from 200 l of sample were extracted using nuclisens easymag (biomerieux, durham, nc). a multiplex one-step influenza a and b taqman rt-pcr assay was performed using previously published primers and probes (ward et al., 2004) , universal master mix with ung and multiscribe (applied biosystems), 900 nm of each primer, 200 nm of each probe, and 5 l of nucleic acid extract in a 50-l reaction. the amplification protocol consisted of 48 • c for 30 min, one cycle for 10 min at 95 • c, followed by 45 cycles of 15 s at 95 • c and 1 min at 60 • c. a cycle threshold of <38 was considered a true positive. dfa-negative samples with a c t of ≥38 were re-extracted and tested in duplicate. if both replicates were positive, the sample was called positive. rt-pcr sensitivity was ≤0.01 tcid50/ml for both influenza a and b. rt-pcr was considered the reference standard. a subset of samples was monitored for inhibitors, and none were found. the results for binax now, cytospin-dfa and rt-pcr are shown in table 1 . one hundred thirty-two samples were positive by rt-pcr, 127 by cytospin-dfa and 70 by binax now. the difference in sensitivity between binax now and dfa, or binax now and rt-pcr, was significant (p < 0.0001). the difference between dfa and rt-pcr was not (p = 0.0736) (mcnemar's test). the results for detection of influenza a and b were similar and the impact of age on the sensitivity of binax now and dfa was minimal (table 2 ). two samples positive for influenza b by all three methods tested falsely positive for influenza a by binax. for one of these, the false reactivity for influenza a was stronger than the true reactivity for influenza b. eight true positive samples (two influenza a and six influenza b) became reactive by binax after 30 min of incubation. according to kit instructions, results must be read at 15 min to avoid erroneous results, thus these were considered negative. sixty-two binax now negative samples were rt-pcr positive. the specificity of cytospin-enhanced respiratory screen dfa was very high, with 127 of 128 dfa positives confirmed by pcr. the one sample that failed to confirm by pcr had only one dfa positive cell. while this could have been a true positive, for the purposes of the study it was deemed false positive. the c t values of samples positive by both dfa and binax now ranged from 16.00 to 28.92 (median 21.93). c t values of samples positive by dfa, but negative by binax, ranged from 20.49 to 40.02 (median 27.30). the eight samples with delayed reactivity by binax, and thus classified as negative, had c t values of 23.21-33.53. the relation of c t values to dfa and binax results is given in fig. 1 . c t results for influenza a and b were not significantly different and have been combined. five dfa-negative samples were found to be influenza a positive by rt-pcr only (table 3) . c t values ranged from 31.47 to 38.47, with a median of 34.93. four of the five were adults, and all had influenza-like illnesses for 2 days or more. one was from a child with underlying disease who had a prior positive sample. in a separate study, it was shown that culture-positive samples generally have c t values of <33 (data not shown). thus, only one of these five samples would be expected to be culture positive. since the study was performed as part of test validation prior to clinical use, the samples were batch tested by pcr. currently, the influenza pcr assay is performed once a day, monday through friday. according to the day and time of receipt in the lab, results for these samples would have been reported in 15-72 h (median 25 h). compared to influenza a and b rt-pcr, the sensitivity, specificity, positive and negative predictive values were 53.0%, 98.1%, 97.2% and 62.9% for binax now and 96.2%, 99.0%, 99.2% and 95.4% for cytospin-dfa. from the 683 separate dfa-negative samples that were cultured for clinical purposes, only three influenza a positives were detected. eight adenovirus, 16 rhinovirus, 1 parainfluenza type 4, 17 herpes simplex types 1 and 10 cytomegalovirus were also isolated. rapid flu tests are simple and fast, require no equipment, and can be performed at the point of care. in most situations, these are the only tests used. for hospitalized patients, a more sensitive and specific diagnosis may be warranted and dfa, rapid cell culture, conventional cell culture, and pcr are all options. in this study we assessed the potential impact of influenza a and b rt-pcr on hospitalized patients. selecting dfa negative and inadequate samples on hospitalized patients rather than random samples could have been introduced bias. however, we sought to evaluate the utility of pcr as it would be employed in our hospital. pcr greatly enhanced the accuracy of influenza detection compared to the rapid flu test, detecting an additional 62 positives beyond the 70 detected by binax now. binax also had two false positive influenza a results. of note, m4 transport media is used in our laboratory, since it allows multiple tests, including rapid flu, dfa, culture, and pcr, to be performed on one sample, however, it is possible that binax now would have performed better with a different, low volume collection fluid and a more concentrated sample. until now, conventional culture has been the standard clinical test for dfa-negative samples in our facility. during the study period, reflex cultures were performed on 683 dfa-negative samples, but only three influenza a positives were detected. in contrast, pcr detected five additional influenza positives out of 109 samples (93 dfa-negative and 16 dfa inadequate). thus, pcr provided a higher yield than culture, as expected from the analytical sensitivity of the pcr assay (≤0.01 tcid50/ml). ultimately, the impact of influenza diagnosis on management of hospitalized patients will depend not only on sensitivity, but also on time to result. antiviral treatment should be given within 48 h of symptom onset, but by the time patient arrives at the hospital, as shown in table 3 , often 2 days or more has already passed. for infection control practices to be implemented, it is best to have results prior to bed assignment. likewise to avert unnecessary use of antibiotics or diagnostic tests, results should as close to the time of admission as possible. of the more sensitive rapid test options, dfa results are available the fastest, namely within 2 h when virology is open, and within 10-14 h if the sample is submitted when virology is closed. however, dfa accuracy varies with the laboratory and cytospin preparation of slides is rarely employed. the newer r-mix cell cultures are within the capability of most laboratories, are highly sensitive for influenza, and results are reported at 1 and 2 days (barenfanger et al., 2001; dunn et al., 2004) . in our institution, influenza a and b pcr is now performed once a day, 5 days a week. thus time to result is 8-32 h weekdays, but up to 80 h or more on weekends. for the five samples detected by pcr only, results would have been reported in 15-72 h, and beyond the 48 h window recommended for antiviral therapy. the utility of pcr would be greatly enhanced if multiplexed to include multiple viruses while retaining sensitivity greater than culture; if viruses not detected by dfa, such as coronaviruses and rhinoviruses, were included; and if performed at least once a day. there are now commercially available kits using conventional rt-pcr that detect multiple respiratory virus targets (lee et al., 2007; li et al., 2007; mahony et al., 2007; nolte et al., 2007) . however the frequency with which these assays could be performed in the routine hospital laboratory remains uncertain. it is important to note that multiplex pcr assays may have sensitivities of only 82.8-86.2% for influenza a and 63.3-73.3% for rsv, the two most important viral respiratory pathogens (lee et al., 2007) , or only 83% for influenza b (mahony et al., 2007) . therefore it is critical that laboratories compare the newer methods in their own laboratories to validate improved sensitivity over current methods. to date, the cost benefits of rapid influenza tests in children (bonner et al., 2003) and respiratory virus cytospin dfa in adults and children (barenfanger et al., 2000; bonner et al., 2003) have been shown to have both clinical and cost benefits. whether respiratory virus pcrs will also have favorable cost/benefit profiles is not known, and will require prospective, controlled studies stratified by the age of the patient, severity of disease, and the presence of co-morbid conditions. in this study, rt-pcr for influenza a and b detected many additional positives not detected by binax now, but only a small number of positives not detected by cytospin-dfa. while the accuracy of real-time rt-pcr should be of significant benefit to those hospitals using simple rapid influenza tests, it may have a more modest impact on hospitals with expertise in cytospin-dfa. further studies are needed to assess the impact of influenza pcr, including highly multiplexed assays, on both patient outcomes and costs in the hospital setting. clinical and financial benefits of rapid detection of respiratory viruses: an outcomes study r-mix cells are faster, at least as sensitive and marginally more costly than conventional cell lines for the detection of respiratory viruses multiplex real-time pcr assay for detection of influenza and human respiratory syncytial viruses impact of the rapid diagnosis of influenza on physician decision-making and patient management in the pediatric emergency department: results of a randomized, prospective, controlled trial update: influenza-associated deaths reported among children aged <18 years-united states, 2003-2004 influenza season sensitivity of respiratory virus culture when screening with r-mix fresh cells performance of six influenza rapid tests in detecting human influenza in clinical specimens comparison of binax now and directigen for rapid detection of influenza a and b simulfluor respiratory screen for rapid detection of multiple respiratory viruses in clinical specimens by immunofluorescence staining high-throughput, sensitive, and accurate multiplex pcrmicrosphere flow cytometry system for large-scale comprehensive detection of respiratory viruses simultaneous detection and high-throughput identification of a panel of rna viruses causing respiratory tract infections development of a respiratory virus panel test for detection of twenty human respiratory viruses by use of multiplex pcr and a fluid microbead-based assay multicode-plx system for multiplexed detection of seventeen respiratory viruses design and performance testing of quantitative real time pcr assays for influenza a and b viral load measurement we thank gerri russo for collecting and organizing the data. key: cord-289139-5ljqnc39 authors: mengelle, c.; mansuy, j.m.; pierre, a.; claudet, i.; grouteau, e.; micheau, p.; sauné, k.; izopet, j. title: the use of a multiplex real-time pcr assay for diagnosing acute respiratory viral infections in children attending an emergency unit date: 2014-09-03 journal: j clin virol doi: 10.1016/j.jcv.2014.08.023 sha: doc_id: 289139 cord_uid: 5ljqnc39 background: the use of a multiplex molecular technique to identify the etiological pathogen of respiratory viral infections might be a support as clinical signs are not characteristic. objectives: the aim of the study was to evaluate a multiplex molecular real-time assay for the routine diagnosis of respiratory viruses, to analyze the symptoms associated with the pathogens detected and to determine the spread of virus during the period. study design: respiratory samples were collected from children presenting with respiratory symptoms and attending the emergency unit during the 2010–2011 winter seasons. samples were tested with the multiplex respifinder(®) 15 assay (pathofinder™) which potentially detects 15 viruses. results: 857 (88.7%) of the 966 samples collected from 914 children were positive for one (683 samples) or multiple viruses (174 samples). the most prevalent were the respiratory syncytial virus (39.5%) and the rhinovirus (24.4%). influenza viruses were detected in 139 (14.4%) samples. adenovirus was detected in 93 (9.6%) samples, coronaviruses in 88 (9.1%), metapneumovirus in 51 (5.3%) and parainfluenzae in 47 (4.9%). rhinovirus (40%) was the most prevalent pathogen in upper respiratory tract infections while respiratory syncytial virus (49.9%) was the most prevalent in lower respiratory tract infections. co-infections were associated with severe respiratory symptoms. conclusion: the multiplex assay detected clinically important viruses in a single genomic test and thus will be useful for detecting several viruses causing respiratory tract disorders. acute respiratory infections (aris) are more prevalent than any other form of infectious disease in children. they range from mild upper respiratory tract problems to serious lower respiratory infections such as bronchiolitis and pneumonia. viruses are the main pathogens and they account for many emergency hospital admissions [1, 2] . clinical signs and symptoms overlap between different viruses, but also between viruses and bacteria, making etiological e-mail address: mengelle.c@chu-toulouse.fr (c. mengelle). 1 both first authors equally contributed to this work. diagnosis based on clinical presentation alone difficult and sometimes leading to overuse of antibiotics. techniques involving culture, fluorescent detection of antigens or immunochromatography have been replaced by nucleic acid tests (nats). due to numerous viruses that might be involved, many monoplex nucleic acid tests are necessary to identify the pathogen(s) responsible for a respiratory disorder. this strategy is thus expensive and time consuming. the use of multiplex assays should significantly reduce hands-on time and cost, and rapidly provide reliable results. the multiplex ligation-dependent probe amplification technology (mpla)-respifinder ® respiratory assay [3] recently became commercially available. this assay is approved for in vitro diagnosis in europe and canada and can detect up to 15 respiratory viruses. this prospective study was done to evaluate this multiplex technique for use in clinical diagnosis. all the samples taken from http://dx.doi.org/10.1016/j.jcv.2014.08.023 1386-6532/© 2014 elsevier b.v. all rights reserved. children attending the emergency unit of the toulouse university hospital suffering from aris were collected prospectively and analyzed. clinical data related to the viruses detected were also analyzed, as was the spread of seasonal respiratory viruses for the winter following the influenza a h1n1pdm09 epidemic (october 2010 to march 2011). nasopharyngeal swabs (virocult ® kitnia, labarthe inard, france), aspirates or nasal washes were prospectively collected from children under 15 with symptoms of aris (see below) who attended the emergency unit of the toulouse university hospital between october 1, 2010 and march 31, 2011 and sent to the virology department for analysis. paediatricians completed a specific questionnaire related to the symptoms, including fever and upper respiratory manifestations (rhinitis, pharyngitis, otitis, sore throat, cough) and presence of symptoms of lower respiratory infections (bronchiolitis, pneumonia, acute flu and flu syndrome). whether or not a child had been vaccinated against influenza was also recorded. the collected samples were diluted in 1 ml minimum essential medium (gibco ® -life technologies, rockville, md, usa) and nucleic acids were extracted with the magna pure 96 tm instrument using the magna pure 96 dna and viral na small volume kit ® (roche diagnostics, meylan, france) according to the manufacturer's instructions (extracted volume: 200 l, elution volume: 100 l). extracts were analyzed using the respifinder ® 15 assay (pathofinder tm , maastricht, netherlands), a multiplex ligationdependent probe amplification (mlpa) technology [3] . this assay can detect 15 viruses: influenza viruses (iv) types a and b, parainfluenza viruses 1 to 4 (piv), respiratory syncytial viruses a and b (rsv), rhinovirus (rv), coronaviruses 229e, oc43 and nl63 (cov), human metapneumovirus (mpv) and adenovirus (adv). the test also includes a probe for detecting the avian influenza virus a h5n1. an internal control for pcr inhibitors detection was included in each test. a positive flu a sample and a negative sample were used as controls. samples that were positive for influenza a were subtyped with the realtime ready inf a/h1n1 detection set (roche diagnostics, meylan, france) on the light cycler 480 tm system (roche diagnostics, meylan, france). data were analyzed using stata tm v9.0 software (statacorp, texas, usa). qualitative variables were analyzed with the chisquared test. p values of less than 0.05 were considered significant. logistic regression was used to determine the odds ratios (or) of age and co-infections linked to severe respiratory symptoms. a total of 914 children, of whom 509/914 (55.7%) were male were enrolled in the study between october 1, 2010 and march 31, 2011 and provided 966 samples. the mean age was 1.6 ± 2.6 years and the median age was 7.3 months [range: 0.2-186], but 572/914 (62.6%) children were under 1 year old. the 914 children in the study group included 232/914 (25.4%) with upper respiratory tract infections (243 samples) defined as rhino-pharyngitis or sore throat, with or without otitis media. 682 children (723 samples) suffered from lower respiratory infections defined as bronchiolitis (338/914; 37%), pneumonia or bronchopneumonia (109/914; 11.9%), acute asthma (78/914; 8.5%) and flu or flu-like syndrome (158/914; 17.3%). 76 (8.3%) children were suffering from a chronic (n = 10) or a congenital disorder (n = 66): respiratory, haematological, neurological, cardiac disorders. 25/914 (2.7%) children had been vaccinated in the fall against flu, and 16/25 (64%) of them were suffering from a chronic or congenital disorder. we found co-infections in 24 (9.96%) samples from children with upper respiratory tract symptoms and in 144 (19.9%) samples from children with lower respiratory infections (p < 0.01). the most frequent co-infections in cases of severe respiratory symptoms involved rsv (associated with rv, adv, or cov) and rv associated with adv. 25% of the cases of bronchiolitis involving rsv were co-infections. rsv was more prevalent in children under 1 year old (48.2% vs 24.8%; p < 0.0001), while rv was not (26.4% vs 21.1%; ns). adv (14.8% vs 3.4%) and iv (24.4% vs 9.2%; p < 0.0001) were more frequent in children older than 6 months. co-infections were more frequent in younger children (1.3 years vs 1.7 years; p < 0.05). four parameters were included in the multivariate analysis: vrs infection, presence of co-infection, rv infection and age under 1 year. independent factors associated with severe respiratory symptoms were vrs infection (adjusted or, 3.8; 95% ci, 2.64-5.68), co-infections (adjusted or, 2.5; 95% ci, 1.55-3.94) and rv infection (adjusted or, 1.2; 95% ci, 0.85-1.83). age under 1 year was not associated with such symptoms. the frequency of positive samples varied from 71.4% (5/7 positive samples; week 40, 2010) to 98.4% (60/61 positive samples; weeks 1, 2011; p < 0.05) (fig. 3a) . all the viruses in the panel were detected in our patients, but their distributions varied (fig. 3b) . rv was the first of the three main viruses to appear and was detected throughout the study. rsv appeared in october and reached epidemic peak in week 51 of 2010; iv did not appear until december and reached a plateau between weeks 1 and 7 of 2011. iva was predominant until week 7 of 2011, while ivb was the most prevalent thereafter, decreasing slowly until the end of march. adv, mpv and cov were most frequently detected during the winter months, although piv was detected throughout the study. the availability of molecular assays has made laboratory diagnosis more efficient and has led to the improved detection of a broad spectrum of respiratory viruses [4, 5] . this study evaluates the use of a new multiplex molecular technique for detecting up to 15 respiratory viruses in routine practice. we collected respiratory samples from a group of children suffering from acute respiratory infections and the results obtained were analyzed in comparison to the clinical manifestations. the spread of the viruses was also analyzed during this winter period. a very high percentage of the samples were positive giving a virus signature in nearly 90% of cases, and all the viruses in the test panel were detected. these results are similar to those for young children and infants obtained by others (88-92%) [6] [7] [8] , whereas the rate of detection in adults was lower (43%) [9] . rv, rsv, and iv were the three most prominent pathogens detected, while adv, cov, mpv and piv were less frequent (<10% of cases). as expected, rv was the most frequently pathogen detected in upper respiratory infections [10] , but it was also found in lower respiratory infections, as was described recently by o'callaghan-gordo [11] . rsv remained however the most prominent agent in lower respiratory infections as published previously in bronchiolitis [12] and pneumonia [13] . adv, cov, mpv and piv also accounted for lower respiratory tract aris as shown previously: adv infection was shown to lead to severe chronic disease and to the increase in the mortality rate in children [14] , whereas cov [15] , mpv [16] and piv [17] can be responsible for severe lower respiratory tract infections requiring hospitalization, especially among the youngest. flu and flu syndromes were preferentially linked to influenza viruses and older children seemed to be more susceptible to these viruses. we found a relationship between an influenza virus infection and severe infection due to hyperthermia, but not with more severe respiratory symptoms, in contrast to the situation in adults [18] . the use of multiplex assays has demonstrated that infections with multiple viruses are common [4] ; the frequency of such infections can be as high as 27%, 30% or 46% [5, 19, 20] . this was exactly the case for our children: all the viruses in the panel were detected in co-infections, not only rsv, but also adv and covs. martin et al. [21] described similar results. they detected adv in association with other viruses in 52% of samples and cov in 50%. they also showed that multiple virus infections were correlated with less severe disease. the relationship between co-infections and illness severity remains uncertain and may depend upon the virus detected. dual infections involving rsv and rv [22] or rsv and mpv can lead to severe bronchiolitis [23] whereas co-infections without rsv do not [24] . we also analyzed the way viral infections spread during the winter. rsv and iv were epidemic while the frequency of the other viruses changed little. our study carried out in the winter following the influenza ah1n1pdm09 pandemia shows that iv and rv infections had returned to their pattern. this has also been described in germany by gröndahl et al. [25] who showed that the ah1n1pdm09 outbreak had a great impact on the spread of other respiratory viruses, but that the virus infections had return to their usual epidemiologic characteristics the year after. this new multiplex technique dramatically shortens hands-on time. the results for 15 viral pathogens can be obtained in about one day. it is also much simpler than conventional routine techniques, which need many and various steps and a wide range of technical competence (culture, pcr, immunofluorescence). while multiplex assays are more expensive than monoplex pcrs, laboratories can still choose to perform single pcrs in a strategic stepwise fashion. this strategy may appear to be less expensive but it needs regular revision to take into account the spread of virus(es). moreover, if several monoplex pcrs are needed, this then can become more expensive than multiplex pcrs. it must also be remembered that diagnosis of co-infections is more uncertain due to a smaller number of viruses tested. in conclusion, our results indicate that multiplex pcr techniques can be used in the routine etiological diagnosis of respiratory infections. the mlpa-respifinder ® 15 assay revealed that a high percentage of samples from children attending the emergency unit with aris during the autumn and winter of 2010/2011contained at least one virus, and that co-infections were very common. rsv and rv were the most prevalent pathogens, particularly in the youngest children, and co-infections were associated with more severe respiratory symptoms. the epidemiology of viruses responsible for aris had returned to its usual characteristics one year after the ah1n1pdm09 pandemic. none. none of the authors of this manuscript has any commercial or other association that might pose a conflict of interest (e.g., pharmaceutical stock ownership, consultancy). not required. rates of hospitalisation for influenza, respiratory syncytial virus and human metapneumovirus among infants and young children spectrum and frequency of illness presenting to a pediatric emergency department relative quantification of 40 nucleic acid sequences by multiplex ligationdependent probe amplification performance of a rapid molecular multiplex assay for the detection of influenza and picornaviruses pathogen chip for respiratory tract infections a prospective study of agents associated with acute respiratory infection among young american indian children comparison of multiplex pcr assays and conventional techniques for the diagnostic of respiratory virus infections in children admitted to hospital with an acute respiratory illness viral etiology of common cold in children prospective evaluation of a novel multiplex real-time pcr assay for detection of fifteen respiratory pathogens-duration of symptoms significantly affects detection rate do rhinoviruses cause pneumonia in children? lower respiratory tract infections associated with rhinovirus during infancy and increased risk of wheezing during childhood. a cohort study multiple viral respiratory pathogens in children with bronchiolitis viral pneumonia lower respiratory infections by adenovirus in children. clinical features and risk factors for bronchiolitis obliterans and mortality severity and outcome associated with human coronavirus oc43 infections among children burden of human metapneumovirus infection in young children viruses in community-acquired pneumonia in children aged less than 3 years old: high rate of viral coinfection adult hospitalizations for laboratory-positive influenza during the comparison of the luminex xtag respiratory viral panel with in-house nucleic acid amplification tests for diagnosis of respiratory virus infections epidemiology of viral respiratory tract infections in a prospective cohort of infants and toddlers attending daycare multiple versus single virus respiratory infections: viral load and clinical disease severity in hospitalized children severe lower respiratory tract infection in infants and toddlers from a nonaffluent population: viral etiology and co-detection as risk factors dual infection of infants by human metapneumovirus and human respiratory syncytial virus is strongly associated with severe bronchiolitis single versus dual respiratory virus infections in hospitalized infants: impact on clinical course of disease and interferon-gamma response the 2009 pandemic influenza a(h1n1) coincides with changes in the epidemiology of other viral pathogens causing acute respiratory tract infections in children the english text was checked by dr owen parkes. key: cord-276316-7ot9ds34 authors: lei, chunliang; lin, weiyin; deng, xilong; hu, fengyu; chen, fengjuan; cai, weiping; li, yueping; wen, chunyan; guan, yujuan; wang, jian; chen, xiaoting; cao, yi; li, feng; tang, xiaoping; li, linghua title: factors associated with clinical outcomes in patients with coronavirus disease 2019 in guangzhou, china date: 2020-10-14 journal: j clin virol doi: 10.1016/j.jcv.2020.104661 sha: doc_id: 276316 cord_uid: 7ot9ds34 background: coronavirus disease 2019 (covid-19) is threatening billions of people. we described the clinical characteristics and explore virological and immunological factors associated with clinical outcomes. methods: 297 covid-19 patients hospitalized in guangzhou eighth people's hospital between january 20 and february 20, 2020 were included. epidemiological, clinical and laboratory data were collected and analyzed. severe acute respiratory syndrome coronavirus 2 (sars-cov-2) rna in respiratory tract, blood samples and digestive tract was detected and lymphocyte subsets were tested periodically. result: among the 297 patients (median age of 48 years), 154 (51.9 %) were female, 245 (82.5 %) mild/moderate cases, and 52 (17.5 %) severe/critical cases. 270 patients were detected for sars-cov-2 rna in anal swabs and/or blood samples, and the overall positive rate was 23.0 % (62/270), higher in severe/critical cases than in mild/moderate cases (52.0 % vs. 16.4 %, p < 0.001). the cd4/cd8 ratio on admission was significantly higher in severe/critical cases than in mild/moderate cases (1.84 vs. 1.50, p = 0.022). during a median follow-up period of 17 days, 36 (12.1 %) patients were admitted to intensive care unit (icu), 16 (5.4 %) patients developed respiratory failure and underwent mechanical ventilation, four (1.3 %) patients needed extracorporeal membrane oxygenation (ecmo), only one (0.34 %) patients died of multiple organ failure. detectable sars-cov-2 rna in anal swabs and/or blood samples, as well as higher cd4/cd8 ratio were independent risk factors of respiratory failure and icu admission. conclusions: most of covid-19 patients in guangzhou are mild/moderate, and presence of extrapulmonary virus and higher cd4/cd8 ratio are associated with higher risk of worse outcomes. since december, 2019, severe acute respiratory syndrome coronavirus 2 (sars-cov-2) has caused an outbreak of respiratory illness termed coronavirus disease 2019 (covid19) globally. 1, 2 the disease has become a global pandemic, threatening billions of people and leading to over 730,000 death worldwide. 3 at the late march, the epidemic had been under control in china with the strong and sustained efforts of the whole country. despite many previous articles report mainly concentrating on the epidemiological findings and clinical characteristics of patients with covid-19 in hubei province and outside of hubei, 4-6 the clinical experience in guangzhou, a non-epidemic area but with high risk of imported cases from abroad, is still very valuable for controlling this emerging disease. previous study shows that most cases of covid-19 are mild with good prognosis, however, the proportion of organ failure, especially respiratory failure and mortality rate of severe patients is considerable. 7 one of the main challenges for the clinicians is how to quickly identify covid-19 patients at high risk for worse outcomes. however, effective early warning indicators are still limited so far. in this study, we comprehensively described the clinical characteristics, and j o u r n a l p r e -p r o o f explore virological and immunological factors associated with outcomes of hospitalized patients confirmed with covid-19, exploring valuable experiences for controlling covid-19 in non-endemic regions. this was a retrospective, observational study conducted at guangzhou eighth people's hospital. we analyzed hospitalized covid-19 patients between january 20 and february 20, 2020. the end of follow up was june 1st, 2020, or the day when patients recovered and discharged from hospital, or transferred to the designated hospital for critically ill patients, or died. people's hospital (approval no. 202001134). written informed consent was obtained from all patients. the medical records, nursing records and laboratory reports of all patients with covid-19 were retrospectively collected and reviewed by two physicians, and all radiological images were reviewed by two radiologists. peripheral blood mononuclear cells (pbmcs) were isolated from the whole blood of studied patients. pbmcs were stained with the following antibodies: cd3-pacific-blue, cd4-apc/cy7 and cd8-percp/cy5.5 to obtain percentage of cd3+ t cells, cd4+ t cells and cd8+ t cells, and cd4/cd8 ratio by flow cytometry. the specimens of throat swabs, anal swabs and blood samples were j o u r n a l p r e -p r o o f obtained every 3 to 6 days. sars-cov-2 nucleic acid was detected by realtime fluorescence reverse transcriptional polymerase chain reaction (rt-pcr) on the platform of da'an gene corporation, sun yat-sen university, guangzhou, china, which has been described. 8 based on "diagnosis and treatment of pneumonitis caused by new coronavirus (trial version 7)" issued by the national health commission of china on march 3, 2020, clinical classifications of patients with covid-19 were defined as follows. 11 mild status was defined as having mild clinical symptoms but no signs of pneumonia on imaging. moderate status was defined as having fever and respiratory symptoms, and pneumonia on imaging. severe status must meet any of the following conditions: 1) experiencing respiratory distress, rr ≥30 times/minute; 2) in the resting state, the oxygen saturation ≤93%; 3) arterial blood oxygen partial pressure (pao2)/oxygen concentration (fio2) data were expressed as counts and percentages for categorical variables and as mean and standard deviation or median and interquartile range (iqr) for continuous variables. qualitative and quantitative differences between subgroups were analyzed using χ 2 test or fisher's exact tests for categorical parameters and the student's t test or mann-whitney u-test for continuous parameters, as appropriate. cox regression model was performed to analyze the association of baseline parameters with clinical outcomes. all statistical tests were 2-sided. statistical significance was taken as p <0.05. all analyses were performed with spss software, version 26.0 (ibm, armonk, ny). from january 20, 2020 to february 20, 2020, 297 consecutive patients who had been confirmed with covid-19 and admitted to guangzhou eighth people's hospital were included in this study. the median age was 48 years, and 154 (51.9%) were female. 245 (82.5%) patients were diagnosed with mild/moderate cases, 52 (17.5%) severe/critical cases. the baseline characteristics are shown in table 1 . a total of 270 patients were detected for sars-cov-2 rna in anal swabs j o u r n a l p r e -p r o o f 8 / 25 and/or blood samples, and the overall positive rate was 23.0% (62/270), higher in severe/critical cases than in mild/moderate cases (52.0% vs. 16 181 patients were detected for viral rna both in anal swabs and blood samples, and 6 (3.3%) patients were double positive (all were male, age ranged from 30 to 82 years). notably, three of the six double positive patients were critical cases who developed respiratory failure and required mechanical ventilation in intensive care unit (icu), two patients were severe cases who need high-flow nasal cannula and close monitoring, only one patient was moderate case. 286 of the 297 patients (96.3%) were analyzed for the percentage of cd3 + t cells, cd4 + t cells and cd8 + t cells, and cd4/cd8 ratio by flow cytometry in peripheral blood mononuclear cell (pbmc). compared to the mild/moderate cases, the severe/critical cases had lower percentage of cd3 + t cells (52.6% vs. 61.4%, p<0.001) and cd8 + t cells (33.2% vs. 36.5%, p=0.034), but higher j o u r n a l p r e -p r o o f percentage of cd4 + t cells (62.8% vs. 55.8%, p=0.016) (figure 2a) among the 297 patients, nearly two thirds received oxygen inhalation, antibiotic therapy, traditional chinese medicine and antiviral therapy (including lopinavir/ritonavir, arbidol and chloroquine phosphate). in addition, 66 (22.2%) patients were treated with oseltamivir, 65 (21.9) with corticosteroids, and 35 (11.9%) with immunoglobulin, respectively (supplemental table 1 ). during a median follow-up period of 17 days (iqr, 13-24), 36 (12.1%) patients were admitted to icu for high-flow nasal cannula or higher-level oxygen support measures to correct hypoxemia ( table 2) . 16 as of june 1st, 2020, 284 (95.6%) patients had recovered and discharged from guangzhou eighth people's hospital, one (0.3%) 82-year-old patient died of multiple organ failure even though receiving ecmo treatment, twelve (4.0%) patients were transferred to the designated hospital for critically ill patients in guangzhou due to the deterioration of their illness within 8 days (iqr, [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] after admission ( table 2 ). all of the twelve transferred patients had recovered and discharged from hospital. no medical staff in our hospital had nosocomial infection of covid-19 since january. cox regression model was performed to analyze the association of baseline parameters including age, gender, comorbidities, clinical symptoms, laboratory index, imaging findings and extrapulmonary virological detection with the probability of respiratory failure ( sars-cov-2 rna can be detected not only in respiratory tract, but also in blood, digestive tract and feces. [12] [13] [14] patients with more severe disease tended to have a higher detection rate of extrapulmonary sars-cov-2 rna. 15 recently published research showed that sars-cov-2 rna in serum was associated with multiple organ damages and higher mortality rate. 16 our previous cross-sectional study indicated that detectable sars-cov-2 rna in blood was an indicator for the further clinical severity, another study showed that detectable sars-cov-2 rna in the digestive tract was a potential warning indicator of severe disease. 8, 9 in this larger sample size longitudinal study, we found patients with detectable extrapulmonary sars-cov-2 rna had an lymphocytopenia is often found in patients with covid-19, especially in severe ones. 7, 17 chen et al found lower cd4 + t cells count was associated with icu admission. 18 liu et al found the more serious the disease and the worse the prognosis, the lower were the t cell, cd4 + t cell, and cd8 + t cell counts on admission. 19 a recent published study found cd4/cd8 ratio was significantly higher in critically ill than in non-critically ill patients. 20 we found severe/critical patients had lower levels of lymphocytes, lower percentage of cd3 + t cells and cd8 + t cells but higher percentage of cd4 + t cells than mild/moderate ones. notably, higher cd4/cd8 ratio was independently associate with higher risk of respiratory failure and icu admission. this result indicated that lymphocyte subsets could be a useful parameter for early prediction of prognosis of covid-19. we also found that there was no significant change in the percentage of in this study, around 75% of mild/moderate patients and nearly 100% of the severe/critical patients received antiviral treatment including lopinavir/ritonavir j o u r n a l p r e -p r o o f (lpv/r), abidol and chloroquine. however, these antiviral regimens perform little benefit for improving the clinical outcomes including virus clearance of hospitalized mild/moderate covid-19 beyond supportive treatment [12] [13] [14] [15] . [21] [22] [23] the median days from admission to positive-to-negative conversion of viral rna exceeded 10 days (11 days [iqr, [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] ) in severe/critical cases disregard lpv/r or abidol or chloroquine, which indicates the antiviral failure of these medicines. even so, our study in another way implies that comprehensive therapy scheme could successfully prevent and treat covid-19 even without effective antiviral regimens currently. our study has some limitations. first, the comparison of different antiviral regimens was not randomized nor blinded, the baseline health status between antiviral and non-antiviral patients were not comparable. second, we did not collect information on absolute values of t cells, b cells, nk cells, monocytes and dendritic cells. in addition, we were unable to provide information on the changes in the absolute number of immune cells in these patients. further studies are needed to explore the relationship between these immunological indexes and outcomes of covid-19. all authors declare that they have no conflict or competing interests. j o u r n a l p r e -p r o o f a novel coronavirus from patients with pneumonia in china a new coronavirus associated with human respiratory disease in china health organization coronavirus disease 2019 (covid-19) situation report -204 clinical features of patients infected with 2019 novel coronavirus in wuhan epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in wuhan, china: a descriptive study clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in wuhan, china clinical characteristics of coronavirus disease 2019 in china association between detectable sars-cov-2 rna in anal swabs and disease severity in patients with coronavirus disease 2019 detectable 2019-ncov viral clinical and epidemiological features of 36 children with coronavirus disease 2019 (covid-19) in zhejiang, china: an observational cohort study diagnosis and treatment of pneumonitis caused by new coronavirus (trial version 7) (in chinese) detection and analysis of nucleic acid in various biological samples of covid-19 patients epidemiologic features and clinical course of patients infected with sars-cov-2 in singapore gastrointestinal symptoms of 95 cases with sars-cov-2 infection detection of sars-cov-2 rna in fecal specimens of patients with confirmed covid-19: a meta-analysis relationship between serum sars-cov-2 nucleic acid(rnaemia) and organ damage in covid-19 patients: a cohort study covid-19: immunopathology and its implications for therapy clinical progression of patients with covid-19 in shanghai lymphocyte subset (cd4+, cd8+) counts reflect the severity of infection and predict the clinical outcomes in patients with covid-19 increased cd4/cd8 ratio as a risk factor for critical illness in coronavirus disease 2019 (covid-19): a retrospective multicentre study a trial of lopinavir-ritonavir in adults hospitalized with severe covid-19 efficacy and safety of lopinavir/ritonavir or arbidol in adult patients with mild/moderate covid-19: an exploratory randomized controlled trial observational study of hydroxychloroquine in hospitalized patients with covid-19 c-reactive protein (iqr) -mg/l 10 j o u r n a l p r e -p r o o f 16 / 25 we thank all patients who participated in this study and all staff of guangzhou key: cord-253148-3t4o27xp authors: chow, brian d.w.; huang, yung t.; esper, frank p. title: evidence of human bocavirus circulating in children and adults, cleveland, ohio date: 2008-09-19 journal: j clin virol doi: 10.1016/j.jcv.2008.07.009 sha: doc_id: 253148 cord_uid: 3t4o27xp background: viral respiratory illness is a major cause of morbidity and mortality. the human bocavirus (hbov) is a recently recognized parvovirus isolated from human respiratory secretions. objectives: to define the clinical and epidemiologic characteristics in adult and pediatric patients with evidence of hbov. study design: from october 2005 through october 2006, we screened respiratory samples from children and adults negative for common respiratory pathogens for hbov by pcr. demographic and clinical characteristics were obtained from medical records of hbov positive individuals. results: of 2075 samples screened, 1826 (88.0%) represented distinct respiratory events: 1539 (84.3%) were pediatric (<18 years), and 273 (15.0%) adult (≥18 years). forty (2.2%) patients had hbov: 36 (2.3%) children and 4 (1.5%) adults. hbov positive children had history of prematurity (31.3%) and cardiac disease (18.8%). adults had underlying pulmonary (100%) and cardiac (50%) disease. twenty-seven children (84.4%) were hospitalized; 9 (28.1%) required intensive care. all adults were hospitalized; none required intensive care. nosocomial acquisition likely occurred in 3 patients. conclusions: hbov circulates in cleveland, oh, in children and adults with similar frequencies, and can warrant hospitalization and intensive care. further study would clarify our understanding of this newly recognized human pathogen. respiratory illness is an important reason for adult and pediatric emergency department visits. 1 in the united states, the proportion of pediatric hospitalizations caused by asthma, pneumonia, and acute bronchitis is nearly 22%. of all hospital discharges, 9.7% are attributed to diseases of the respiratory system. 2 in the united states, the annual burden to society for respiratory infections is estimated to be $112 billion. 3 allander et al. (2005) described a novel parvovirus isolated from human respiratory secretions from patients with pneumonia named the human bocavirus (hbov). 4 since that time, its presence in both the pediatric and adult population has been confirmed throughout the world. the incidence of this pathogen has ranged from 1.8% to 19%, with a variety of clinical presentations. [5] [6] [7] human bocavirus has been found in patients with upper and lower respiratory tract disease, 5, 8, 9 as well as gastrointestinal illness. [10] [11] [12] cases reported in children constitute the majority; adult cases are reported less frequently. 7, 13, 14 common presentations include cough, wheezing, fever, and emesis. 7, 14, 15 thai adults have been reported to have pneumonia associated with hbov severe enough to warrant hospitalization. 13 multiple studies have reported frequent detection of other viral pathogens in hbov positive samples. 16 it has been hypothesized that prolonged shedding or persistence may be a reason. because of this, questions remain about the role of hbov in respiratory infection. we sought to further define the clinical and epidemiologic characteristics of hbov in adult and pediatric patients in cleveland, oh. cleveland. samples were submitted to the core laboratory at the discretion of the primary medical teams. submitted samples originated from the emergency department, inpatient wards, intensive care units and hospital-affiliated primary care outpatient clinics. we obtained all clinical specimens from children and adults that had negative results for rsv, parainfluenza viruses (1-3), influenza a and b, and adenovirus by direct immunofluorescence assay (dfa). for dfa, samples were processed, applied to slides by cytocentrifugation, stained with respiratory panel 1 tm direct immunofluorescence assay (millipore, temecula, ca), and examined. from nucleic acid from each respiratory specimen was extracted with the magmax tm -96 viral rna isolation kit (applied biosystems, foster city, ca) according to the manufacturer's protocol. this product recovers both rna and dna from samples allowing us to screen for multiple respiratory pathogens. samples were then screened by pcr for the presence of hbov with platinum taq polymerase (invitrogen) according to the manufacturer's specification. primers used in the screening of the respiratory specimens were based on sequences in published reports and targeted the hbov np-1 gene. 15 the forward primer, 5 -gacctctgtaagtactattac-3 and reverse primer, 5 -ctctgtgttgactgaatacag-3 produce a 353 base-pair amplicon that corresponds to nucleotides 2351-2704 of the hbov np-1 gene. each set of pcr reactions contained appropriate negative controls. pcr amplification cycles were as follows: 95 • c for 3 min followed by 40 cycles of 94 • c for 1 min, 54 • c for 1 min, 72 • c for 30 s and completed with a 10-min 72 • cycle. sequencing was performed on abi prism 3730 dna analyzer automated sequencer. isolates positive for hbov were screened for common respiratory viruses by rt-pcr with published primer sets. viruses screened include respiratory syncytial virus, human parainfluenza virus 3, human metapneumovirus, adenovirus, rhinovirus, influenza, wu polyomavirus, and the human coronaviruses nl63, hku1, oc43, 229e. 17-21 the phylogenetic analysis included representative samples of cleveland isolates in addition to isolates from published reports. the region of analysis corresponded to a 228-base pair region of the np-1 gene spanning nucleotides 2426-2654 of the hbov genome. clustalw alignment was generated using bioedit 7.0.5.2 alignment software. five-hundred bootstrap data sets were created using the phylip program seqboot. phylogenetic analyses were conducted using the phylip program dnaml, with the default transition to transversion ratio of 2.0 and 1 jumble. available medical records for hbov positive-individuals were reviewed. demographic data and clinical characteristics of each individual were recorded on a standard collection form. pediatric cases were defined as patients whose age at the time of sample collection was less than 18 years; adult cases were defined as patient age at time of collection of 18 years and older. of 2075 samples screened, 1826 (88.0%) were determined to be separate respiratory events. samples collected greater than 28 days apart from a single individual were considered separate respiratory events. of these, 1539 (84.3%) were obtained from pediatric patients, and 273 (15.0%) from adult patients. demographic information was unavailable for 14 (0.8%) patients. samples were collected throughout the year, with more samples obtained during the winter months in cleveland. monthly sample collections ranged from 63 (july) to 271 (march) (fig. 1) . forty samples (2.2%) tested positive for hbov by pcr: 36 (90%) pediatric patients and 4 (10%) adult patients. medical records were unavailable for 1 (2.5%) subject. four (10.0%) samples had other respiratory pathogens identified by rt-pcr. these include rhinovirus (2) and coronaviruses hcov-nl63 (1) and hcov-229e (1). all coinfected samples originated from children and were excluded from clinical analysis. hbov samples were primarily identified in fall and winter, peaking in november where 6.8% of samples screened positive. hbov continued to circulate until may. no hbov was detected in the summer months of june, july, and august (fig. 1) . the median pediatric age was 12 months, with the range of ages from the 24 days to 8 years 5 months. the median adult age was 58 years, ranging from 20 years to 86 years. the 12-18 month age group had the highest prevalence, with hbov detected in 6.0% of respiratory samples screened (fig. 2) . the clinical presentation of the pediatric populations is described in table 1 . of pediatric patients testing positive, 66.7% were male, 53.1% were caucasian, and 31.3% were african-american. underlying conditions included prematurity (31.3%), cardiac disease (18.8%), immunodeficiency (9.3%), and pulmonary disease (9.3%). the most common symptoms reported included cough (75.0%), rhinorrhea (62.5%), and fever (53.1%). gastrointestinal symptoms were reported in 11 (34.3%) patients, and 8 (25.0%) patients had wheezing. of pediatric patients who screened positive for hbov, 27 (84.4%) were admitted to the hospital, including 9 (28.1%) who required intensive care. for patients admitted to an intensive care unit, the median stay in intensive care was 2 days (range 1-5 days). reasons for icu admission included respiratory distress (66.6%), apnea (11.1%), cardiac arrhythmia (11.1%), and shock (11.1%). of the remaining pediatric patients, 18 (56.3%) were admitted to a pediatric ward. disposition for one patient was unavailable. the median duration of hospitalization was 3 days (range 1-8 days). admission diagnoses for patients not requiring intensive care include bronchiolitis (22.2%), dehydration (16.7%), exacerbation of asthma or reactive airway disease (16.7%), pneumonia (11.1%), apparent life threatening event (11.1%), hypoxia (11.1%), and bronchopulmonary dysplasia exacerbation (5.6%). of all pediatric patients admitted, oxygen therapy was initiated or increased over baseline requirements in 10 (31.3%) patients. one patient (3.1%) was discharged on oxygen therapy not previously required. mean duration of oxygen therapy before return room air or baseline oxygen requirements was 4.7 days. in pediatric patients positive for hbov, there were no deaths. three (9.4%) pediatric patients were already hospitalized when respiratory samples were obtained. one patient with hypoplastic left heart syndrome was admitted in respiratory failure with respiratory syncytial virus (rsv). subsequent respiratory samples screened negative for rsv and hbov. thirty-one days into her admission a nasopharyngeal sample tested positive for hbov and negative for other respiratory pathogens by rt-pcr. two other cases involved newborn patients who had never been discharged from the hospital. one patient in the neonatal icu was not previously on respiratory support, and presented with multiple drops in oxygen saturation. she required oxygen therapy for 20 days. two subjects are twin siblings in the same household, both born prematurely with bronchopulmonary dysplasia, and were both admitted to the hospital sequentially with respiratory symptoms. in the adult group, all patients had underlying pulmonary disease; half had underlying cardiac disease ( table 1 ). the most common presenting symptoms were rhinorrhea (50%), cough (50%), and wheeze (50%). all were hospitalized, with median hospitalization of 1.5 days (range 1-4 days). admission diagnoses include change in mental status (50.0%) and asthma exacerbation (50.0%). none required oxygen therapy or intensive care, and there were no deaths. adult chest radiographs, while abnormal, were unchanged from previous studies. of the 24 patients who had a complete blood count with differential drawn, 44.4% were abnormal. abnormalities include immature granulocytes (37.5%), atypical lymphocytes (29.1%), and leukocytosis (20.8%). twenty-six (81.3%) pediatric patients had chest radiographs taken, with 76.9% of chest radiographs reported as abnormal. abnormalities included perihilar/peribronchial thickening or central inflammatory changes (42.3%), infiltrate (19.2%), ground glass disease (7.7%), pleural effusion (7.7%), hyperinflation (7.7%), and atelectasis (7.7%). phylogenetic analysis confirmed that a single strain of hbov circulates in cleveland, oh, and is similar to strains described in various studies reported worldwide. there was a pediatric diagnoses include multifocal atrial tachycardia, ventricular septal defect,atrial septal defect, patent ductus arteriosus, and hypoplastic left heart. in adults, diagnoses include heart failure, atrial fibrillation/flutter, and prosthetic mitral and tricuspid values. b include kippel-feil syndrome with asplenia, neutropenia secondary to chemotherapy, and common variable immune deficiency. c in pediatric patients, excludes lung disease associated with prematurity. includes asthma and hunter's disease. in adults, includes asthma, chronic obstructive pulmonary disease, transudative pleural effusion, and restrictive lung disease. d specific respiratory findings (number, %) -pediatric patients respiratory distress (13, 40.6%), hypoxia (9, 28.1%), ronchi (10, 31.2%), wheeze (8, 25 .0%), tachypnea (8, 25 .0%), rales (7, 21.8%), cyanosis (4, 12.5%), apnea (3, 9.3%). adult patients: tachypnea (3, 75%), wheeze (2, 50%), rales (1, 25%), and hypoxia (1, 25%). no difference in strains circulating among children and adults (fig. 3) . this study demonstrates that hbov circulates in cleveland, oh. in our study, hbov predominates in the winter months, and extends into the late spring and early fall. the predominate age group affected are children under 18 months. in our study, hbov is present in many patients who have cardiac or pulmonary disease. in many institutions, respiratory sample collection and viral screening occur infrequently in adults. however, it is notable that hbov was found at similar rates in both pediatric and adult patients in our population. we found hbov at slightly higher rates in adults than other reports. 6, 7 this underscores that viral respiratory disease leading to hospitalization in the adult population may be underappreciated. like prior studies, we find a substantial number of patients with gastrointestinal symptoms including emesis and diarrhea. gastrointestinal symptoms are reported with other respiratory viruses, but generally with lower frequency. 19, 22 by screening respiratory samples, this study is biased towards finding respiratory tract disease. further investigation of patients with gastrointestinal illness will improve our understanding of this virus in gastrointestinal pathology. our data suggests nosocomial acquisition of hbov in three cases, and close household contact in another. for the two patients who screened hbov positive in the nicu, vertical transmission cannot be ruled out. siblings with sequential hospitalization both screening positive for hbov does not prove that the children infected each other although it seems likely their infections originated from close contact. these cases highlight the importance of universal caregiver and visitor hygiene. further study on modes of transmission are needed to elucidate specific precautions needed for patients with hbov. hbov was the only identified pathogen in 36 (90%) isolates. this differs from other reports which demonstrate a higher rate of viral co-infection. 7 this discrepancy is likely due to our selection of samples that are negative for common respiratory pathogens routinely screened at this institution. as such, the co-infection rate seen in this study cannot be compared to those of other studies. screening of samples positive for other respiratory pathogens will likely increase the number of hbov positive samples. however, this report suggests that clinical disease associated with hbov alone may be severe enough to require admission to the hospital in both adults and children and to the intensive care unit in children. limitations of our study include its retrospective nature and lack of a control group. by screening samples of patients who present to a tertiary care center, there is likely an overrepresentation of patients with severe disease. in our study all 80-90% of samples screened were collected from patients who were hospitalized. other reports show that many patients with hbov can have either mild or severe respiratory tract disease. 23 the sensitivity of the nucleic acid extraction and primer set used has not been established. using different primer sets or alternate dna isolation techniques may identify further hbov positive samples. we find that hbov is circulating in cleveland, oh, in children and adults. disease associated with hbov is severe enough to warrant hospitalization and intensive care support. our study suggests that hbov may be transmitted between close household contacts and within the hospital. further study on the prevalence in adult patients, both in hospital settings and outpatient settings, would clarify our understanding of this virus. influenza other respiratory virus-related emergency department visits among young children hcup fact book no. 6. ahrq publication no. 05-0056 economic burden of respiratory infections in an employed population cloning of a human parvovirus by molecular screening of respiratory tract samples human bocavirus and acute wheezing in children human bocavirus infection human bocavirus infections in hospitalized children and adults human bocavirus in italian patients with respiratory diseases prospective study of human bocavirus (hbov) infection in a pediatric university hospital in germany human bocavirus a respiratory and enteric virus clinical and molecular epidemiology of human bocavirus in respiratory and fecal samples from children in hong kong detection of human bocavirus in children hospitalized because of acute gastroenteritis human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in thailand severe pneumonia and human bocavirus in adult human bocavirus infection in young children in the united states: molecular epidemiological profile and clinical characteristics of a newly emerging respiratory virus human bocavirus: passenger or pathogen in acute respiratory tract infections? identification of a novel polyomavirus from patients with acute respiratory tract infections rapid multiplex nested pcr for detection of respiratory viruses a one year experience with human metapneumovirus in children less than 5 years old evidence of a novel coronavirus associated with respiratory tract disease in infants and children evidence of coronavirus hku1 infection in the united states: clinical manifestations associated with hku1 in children < 5 years of age excretion patterns of human metapneumovirus and respiratory syncytial virus among young children human bocavirus in febrile children we are indebted the staff of the core laboratory at university collection of specimens and clinical data were approved by the university hospitals human investigation committee. none. key: cord-259798-fnm1im98 authors: lee, brian r.; hassan, ferdaus; jackson, mary anne; selvarangan, rangaraj title: impact of multiplex molecular assay turn-around-time on antibiotic utilization and clinical management of hospitalized children with acute respiratory tract infections date: 2018-11-23 journal: j clin virol doi: 10.1016/j.jcv.2018.11.006 sha: doc_id: 259798 cord_uid: fnm1im98 background: empiric antibiotic treatment is common among children with acute respiratory tract infections (arti), despite infections being predominately viral. the use of molecular respiratory panel assays has become increasingly common for medical care of patients with artis. study design: this was a 6-year retrospective, single-centered study of pediatric inpatients who tested positive for an arti respiratory pathogen. we examined the relationship between clinical outcomes and whether the patient was tested using the luminex respiratory viral panel ([rvp]; in-use: dec. 2009 – jul. 2012) or biofire respiratory pathogen panel ([rp]; in-use aug. 2012 – jun. 2016). the prevalence and duration of pre-test empiric antibiotics, post-test oseltamivir administration to influenza patients, chest x-rays and length of stay between the two assays was compared. results: a total of 5142 patients (1264 rvp; 3878 rp) were included. the median laboratory turn-around-time for rp was significantly shorter than rvp (1.4 vs. 27.1 h, respectively; p < .001). patients tested with rp were less likely to receive empiric antibiotics (or: 0.45; p < .001; 95% ci: 0.39, 0.52) and had a shorter duration of empiric broad-spectrum antibiotics (6.4 h vs. 32.9 h; p < .001) compared to rvp patients. rp influenza patients had increased oseltamivir use posttest compared to rvp influenza patients (or: 13.56; p < .001; 95% ci: 7.29, 25.20). conclusions: rapid molecular testing positively impacts patient management of artis. adopting assays with a shorter turn-around-time improves decision making by decreasing empirical antibiotic use and duration, decreasing chest x-rays, increasing timely oseltamivir administration, and reducing length of stay. acute respiratory tract infections (arti) -including the common cold, otitis media, pharyngitis, acute bronchiolitis, and pneumonia-are the most common diagnoses among patients seeking medical care in the us, and account for the majority of all antibiotic prescriptions [1, 2] . donnelly et al. estimated that each year there are 43 million emergency department (ed) visits for patients < 5 years of age with a diagnosis of arti (rate: 354 per 1000 ed visits). [3] . antimicrobials are not indicated for the common cold, bronchitis/bronchiolitis and the vast majority of pharyngitis cases, and specific criteria exists to target appropriate antibiotic use for otitis media, sinusitis and streptococcal pharyngitis. yet, antibiotic prescribing is very common among children with arti, for bronchitis (71%), sinusitis (89%), and acute otitis media (86%) [4] . a study evaluating bronchiolitis management before and after the 2006 aap guidelines found a significant reduction in rsv testing (p < .001) and decreased corticosteroids and bronchodilators use (p < .001) [5] . however, the trend in antibiotic use did not change (p = .07) in the post-aap guideline period further highlighting the significant problem of overuse of antibiotics for arti. while the use of stringent diagnostic criteria to confirm the diagnosis of arti is key in optimizing antibiotic prescribing, empiric treatment for arti remains common because viral symptoms are often clinically similar and difficult to distinguish from those caused by bacteria. therefore, laboratory testing that provides accurate and prompt detection of pathogens associated with respiratory infections is https://doi.org/10.1016/j.jcv.2018.11.006 received 27 august 2018; received in revised form 13 november 2018; accepted 19 november 2018 important for proper patient care management. molecular respiratory panel (mrp) assays are becoming increasingly popular due to their ability to detect multiple pathogens with high sensitivity and specificity and documented cost savings [6] [7] [8] . while research has demonstrated that mrps may have a positive impact on patient outcomes such as decreasing empiric antibiotic exposures, length of hospital stay (los), and improving timely oseltamivir treatment for influenza patients [9] [10] [11] [12] [13] [14] , there is a dearth of information on whether this clinical impact is conditional on the turn-around-time (tat) of the mrp assay. both xtag respiratory viral panel (rvp) and biofire respiratory panel (rp) are fda-cleared mrp assays that can detect 12 and 20 respiratory pathogens, respectively. the objective of this study was to compare the impact of rvp and rp on clinical outcomes for patients that were admitted in our hospital from 2009 to 2016. we hypothesized that the rapid detection of respiratory pathogens by rp compared to rvp would be positively associated with changes in antibiotic treatment, initiation of oseltamivir and los on pediatric patients < 18 years old. we performed a retrospective cohort study of pediatric patients who were admitted to our 354-bed free-standing children's hospital between december 2009-june 2016 and who tested positive for at least one of the respiratory pathogens on either the rvp (luminex inc., texas) or rp (biofire llc, idaho) mrp assay. data were abstracted from the electronic medical record for patients where the rvp or rp assay occurred either while admitted as an inpatient or during the ed encounter. for patients initially seen at the ed and subsequently admitted, all medical services were considered one clinical episode. patients were excluded for all who were either 1) undergoing immune suppressive therapy; 2) were admitted to the nicu; 3) had a los greater than 7 days; or 4) rvp or rp assay was not ordered within the first 48 h of hospitalization. this study was reviewed and approved by the children's mercy hospital institutional review board. in our hospital the rvp assay was introduced in december 2009 and was replaced by the rp assay in august 2012. patients' respiratory samples were tested by either the rvp or rp based on test in use date. at our institution rvp tests were run in batch mode once daily, 7 days a week, whereas rp tests were run as the samples arrived (24/7) in the clinical lab. the primary outcome of this study was appropriate antimicrobial therapy. binary treatment indicators were based on antimicrobial use during a 48-hour period both before and after the mrp assay results were reported in the laboratory information system (fig. 1) , including: 1) use of empiric systemic antibiotic treatment between time of admission and result availability and 2) administering oseltamivir to influenza positive patients during the 48 h following result availability. the prevalence of narrow-and broad-spectrum empiric antibiotic treatment was also calculated, including the duration of empiric therapy, which was defined as the time difference, in hours, between the first and last antibiotic administration. we considered penicillin, ampicillin and clindamycin as narrow-spectrum antibiotics; all other antibiotics were considered broad-spectrum. we also evaluated use of chest radiographs within the first 48 h of admission and los (in hours) as secondary outcomes. lastly, we calculated the turn-around-time ([tat]; i.e., time from when the clinical laboratory received the specimen to when the test was completed and results reported in the laboratory information system) for each specimen tested. we dichotomized our study time period into either rvp patients or rp patients. the patient's age at the time of admission was categorized into either < 90 days (infant sepsis work-up), 3-24 months (upper age range from 2015 aap guideline on bronchiolitis management [15] ) or 2 years and older. a mutually exclusive pathogen indicator was created based on the organism(s) detected in the rvp/rp assay (rhinovirus/ enterovirus, influenza virus, respiratory syncytial virus (rsv), adenovirus, human metapneumovirus, parainfluenza, co-detection [2+ viruses], or bacterial pathogen). for example, a patient who was positive for rsv only was categorized as 'rsv' whereas a patient who tested positive for both rsv and rhinovirus/enterovirus was categorized as 'co-detection'. any patient with a bacterial pathogen, regardless of concurrent viral infection, was categorized as 'bacterial pathogen'. in order to further depict clinical presentation and medical decision making, we included the location where the mrp assay was ordered (picu, ed, medical/surgical, or other) and the calendar quarter. the frequency distribution of our categorical outcomes was calculated for both rvp/rp time periods, with pearson's chi-square used to compare proportions. hospital los and tat were treated as continuous outcomes with the mann-whitney u test used to compare distributions. multivariable logistic models were used for each of our categorical outcomes to examine the relationship with rvp/rp time period, after adjusting to medical service, patient age, pathogen, and seasonality. all analysis were completed using sas (sas 9.4; sas institute, cary, nc). a total of 12,803 patients in whom either one of the mrp assays (luminex rvp or biofire rp) was obtained during the study time period were initially identified. we excluded 5129 (40.1%) patients who tested negative for any pathogens since the focus of the current study was to describe the impact of rapid detection of respiratory pathogens in management of hospitalized patients. we further excluded 349 (2.7%) who were admitted to either the nicu or hematology/oncology ward, 456 (3.6%) who did not have the rvp/rp ordered within the first 48 h of admission, 708 (5.5%) who had a los > 7 days, 1007 (7.9%) who were seen in the ed but were not admitted to the hospital, and 12 (.09%) who were ≥18 years old at the time of the admission. our final study group included 5142 patients a total of 1264 (24.6%) patients were tested with the rvp assay (table 1) . those patients who were ≥2 years old represented the largest age group in our analysis (n = 2246; 43.7%). nearly half of our patients tested positive for rhinovirus/enterovirus only whereas 110 (2.1%) patients were positive for ≥1 bacterial organisms. the frequency distribution of respiratory pathogens between the two rp/rvp time periods were comparable (fig. 2) utilizing mrp assays may increase the likelihood of optimal treatment of viral arti [9] [10] [11] [12] . however, since some of these studies have been restricted to adult patients [11] , examined clinical impact for influenza patients only [12] or only included data from peak respiratory seasons [9, 10] more studies are needed to provide a comprehensive assessment of the clinical impact for pediatric arti patients. our study included 5142 pediatric patients with positive respiratory pathogens that were collected over 6 years. we observed that relying on rapid diagnostic testing for arti cases may have a direct impact for the patient management, including reducing unnecessary antibiotic and radiation exposure, and reducing los. despite artis being predominately viral in nature, empiric antibiotic treatment for arti remains prevalent. kronman et al. found that antibiotics were frequently prescribed for bronchitis, sinusitis, and acute otitis media patients. [4] byington et al. examined patients who received a direct fluorescent assay for respiratory pathogens and found that only 12.8% of patients who also received bacterial cultures tested positive for a bacterial infections [16] . we propose that use of mrp assays significantly improves diagnostic yield and accurately identifies viral etiology in majority of patients (∼60%; internal data monitoring over past 5 years), providing clinicians added confidence in antibiotic treatment decisions. our findings provide much needed data to federal programs and insurance agencies that question the value of mrp assays in management of arti patients [17] . we feel our study contributes to existing evidence [18] on how rapid molecular diagnostics may further optimize appropriate care and management of arti patients. our study found that patients tested with rp, which had a shorter tat, were less likely to receive empiric antibiotics. we hypothesized that having a shorter tat may influence the clinician's decision making to delay empiric antibiotic therapy knowing that assay results would be available within a few hours. a study among patients who tested positive using a rapid influenza test found that when the clinician was aware of the results they were significantly less likely to prescribe antibiotics (7.3% vs. 24.5%) and more likely to give an antiviral [11] [12] [13] [14] [15] [16] prescription (18.8% vs. 6.7%) relative to when the clinician was unaware the patient was positive for influenza. [13] in our study, patients with rp test results available approximately 26 h faster than rvp were less likely to have empiric antibiotic therapy (32.0% vs. 51.1%) as well as a significantly shorter duration of empiric broad-spectrum (6.4 vs. 32.9 h) and narrow-spectrum therapy (9.1 vs. 31.4 h). according to cdc guidelines, anti-influenza therapy is recommended for patients < 2 years with signs and symptoms of flu-like illness. [19] in addition, multiple observational studies have demonstrated that receipt of oseltamivir significantly improves patient outcomes for patients with influenza [20] [21] [22] [23] [24] [25] , although clinical improvement is more likely if oseltamivir is initiated shortly after symptom onset [22, [21] [22] [23] [24] [25] . a prospective study of icu influenza patients compared early treatment vs. late treatment oseltamivir administration and found that early treatment had shorter icu los (18.4 vs. 22.7 days), shorter hospital los (27.2 vs. 34.0 days), and decreased likelihood of mortality (21.5% vs. 34.3%) [24] . in our study, nearly 80% of rp influenza patients received oseltamivir within 48 h of result availability, compared with 19.3% for rvp influenza patients. utilization of tests with shorter tat may ensure that optimal treatment for influenza infections is given. determination of cost effectiveness is important when hospitals decide on adopting rapid diagnostic testing. an increasing number of studies have concluded that rapid diagnostics that test for arti viruses provide a cost savings. [6, 7] in our study, rp patients had decreased empirical antibiotic use, decreased likelihood of chest x-rays, and shorter los which could translate into decreased hospital cost. further cost effectiveness research is needed that also considers the cost of the rapid test for all patients, not just those who test positive. there were limitations with this study. we excluded patients seen in the either the nicu or hematology/oncology ward as well as patients who had a los > 7 days. however, we purposely excluded these patients in an attempt to have a sample of otherwise healthy children. second, this was a single-center study at a freestanding pediatric hospital, therefore our results may not generalize to all centers that provide care for arti. third, we did not examine concurrent bacterial infections, which could partly explain empiric antibiotic treatment. since the prevalence of concurrent bacterial infection is unlikely to be influenced by the assay type (i.e., rvp/rp), we would argue the potential of this biasing our results is minimal. we observed less human metapneumovirus and influenza cases during the rp phase which may have influenced treatment strategies, especially oseltamivir use. patients tested but never admitted were excluded, thus our inpatient sample may represent patients with more severe arti symptoms. lastly, we did exclude patients who tested negative, thus our study does not provide a complete representation of arti patients but rather addresses the importance of rapid respiratory pathogen detection on management of hospitalized patients. we intend to conduct future research on mrp assays that includes both negative and positive patients. this study demonstrates that adopting mrp assays with a shorter tat can have a significant improvement for pediatric inpatients with viral arti, including decreased exposure to empirical antibiotics, decreased exposure to chest x-rays, increased optimization of timely oseltamivir administration, and shorter los. by providing respiratory pathogen results in a timely manner, rapid diagnostics have the ability to help guide clinicians on judicious antibiotic use for arti patients. none. none. antibiotic prescription rates for acute respiratory tract infections in us ambulatory settings trends in antimicrobial prescribing rates for children and adolescents antibiotic utilization for acute respiratory tract infections in u.s. emergency departments bacterial prevalence and antimicrobial prescribing trends for acute respiratory tract infections bronchiolitis management before and after the aap guidelines clinical and financial benefits of rapid detection of respiratory viruses: an outcomes study cost analysis of multiplex pcr testing for diagnosing respiratory virus infections comparison of the luminex xtag rvp fast assay and the idaho technology filmarray rp assay for detection of respiratory viruses in pediatric patients at a cancer hospital clinical impact of rt-pcr for pediatric acute respiratory infections: a controlled clinical trial impact of a rapid respiratory panel test on patient outcomes access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial implementation of filmarray respiratory viral panel in a core laboratory improves testing turnaround time and patient care impact of the rapid diagnosis of influenza on physician decision-making and patient management in the pediatric emergency department: results of a randomized, prospective, controlled trial impact of multiplex polymerase chain reaction testing for respiratory pathogens on healthcare resource utilization for pediatric inpatients clinical practice guideline: the diagnosis, management, and prevention of bronchiolitis the effect of rapid respiratory viral diagnostic testing on antibiotic use in a children's hospital proposed/draft local coverage determination (lcd): moldx: multiplex nucleic acid amplified tests for respiratory viral panels (dl37713) infectious disease society of america . better tests, better care antiviral agents for the treatment and chemoprophylaxis of influenza -recommendations of the advisory committee on immunization practices (acip) effect of oseltamivir on the risk of pneumonia and use of health care services in children with clinically diagnosed influenza efficacy and safety of oseltamivir in treatment of acute influenza: a randomised controlled trial, neuraminidase inhibitor flu treatment investigator group effects of antiviral treatment on influenzarelated complications over four influenza seasons timing of oseltamivir administration and outcomes in hospitalized adults with pandemic 2009 influenza a(h1n1) virus infection impact of early oseltamivir treatment on outcome in critically ill patients with 2009 pandemic influenza a effectiveness of neuraminidase inhibitors in reducing mortality in patients admitted to hospital with influenza a h1n1pdm09 virus infection: a meta-analysis of individual participant data key: cord-266359-uf1ao1x1 authors: hakki, morgan; rattray, rogan m.; press, richard d. title: the clinical impact of coronavirus infection in patients with hematologic malignancies and hematopoietic stem cell transplant recipients date: 2015-04-15 journal: j clin virol doi: 10.1016/j.jcv.2015.04.012 sha: doc_id: 266359 cord_uid: uf1ao1x1 background: compared to other respiratory viruses, relatively little is known about the clinical impact of coronavirus (cov) infection after hematopoietic stem cell transplant (hsct) or in patients with hematologic malignancies. objectives: to characterize the role of cov in respiratory tract infections among hsct and hematologic malignancy patients. study design: we conducted a retrospective review of all cases of cov infection documented by polymerase chain reaction, (pcr)-based testing on nasopharyngeal and bronchoalveolar lavage fluid samples between june 2010 and 2013. cases of cov infection occurring in hsct and hematologic malignancy patients were identified and the clinical characteristics of these cases were compared to other respiratory viruses. results: cov was identified in 2.6% (n = 43) of all samples analyzed (n = 1661) and in 6.8% of all samples testing positive for a respiratory virus (n = 631). 33 of 38 (86.8%) of patients in whom cov was identified were hsct and hematologic malignancy patients. among these patients, cov was detected in 9.7% of unique infection episodes, with only rhinovirus/enterovirus (rhv/env) infection being more common. group i cov subtypes accounted for 76.3% of cases, and 57% of infections were diagnosed between december and march. cov infection was associated with upper respiratory tract symptoms in most patients, similar to other respiratory viruses. possible and proven lower respiratory tract disease was less common compared to other respiratory viruses except rhv/env. conclusions: cov is frequently detected in hsct and hematologic malignancy patients in whom suspicion for a respiratory viral infection exists, but is less likely to progress to lower respiratory tract disease than most other respiratory viruses. the clinical significance of respiratory viruses such as influenza, respiratory syncytial virus (rsv), parainfluenza viruses (pivs), human metapneumovirus (hmpv), rhinovirus (rhv), and adenovirus (adv) in patients with hematologic malignancies or recipients of autologous or allogeneic hematopoietic stem cell transplant (hsct) is well described [1] [2] [3] [4] [5] [6] [7] [8] . far less data have been published that specifically address the impact of coronavirus (cov) infection in these patients [9] . lower respiratory tract disease (lrtd) due to cov has been described on a case-report level [10] [11] [12] [13] [14] , but a retrospective analysis of 46 bronchoalveolar lavage (bal) samples obtained from hsct recipients with any acute pulmonary process did not identify cov in any sample [3] . later, a prospective surveillance study in allogeneic hsct recipients performed at a single center over the course of one year found a relatively high cumulative incidence of cov infection (11%) in the first 100 days following allogeneic hsct, but only one case in which cov was detected in a lower respiratory tract sample [15] . other series studying the impact of respiratory viral infections have not specifically or directly assessed the clinical impact of cov in patients with hematologic malignancies and hsct recipients [16] [17] [18] [19] [20] [21] [22] . with an apparently high frequency of infection but relative paucity of information pertaining to the impact of cov in patients with hematologic malignancies and hsct recipients, we conducted a retrospective review of all cov infections at our institution over a three year period in order to further characterize the role of cov in respiratory tract infections in these patients. all nasopharyngeal (np) and bal samples submitted from outpatient clinics and inpatient wards for respiratory virus testing between june 01, 2010 and july 01, 2013 at oregon health and science university (ohsu) were included in this study. demographic and clinical information pertaining to each patient testing positive for cov or other respiratory viruses assayed as part of a multiplex pcr panel (described below), were obtained by medical chart review. a patient was considered to have a hematologic malignancy if they were diagnosed with, and were receiving treatment for, any type of leukemia, lymphoma, multiple myeloma, aplastic anemia, mastocytosis, myelodysplastic syndrome, or amyloidosis. all patients who underwent allogeneic or autologous hsct, or cord blood transplant (cbt), were included and classified as such regardless of the underlying disease necessitating transplant. testing was performed using a multiplex respiratory virus pcr panel assay (xtag rvp; luminex) [23] per manufacturer's instructions. since this assay does not distinguish between rhv and enterovirus (env), these results are grouped together in this analysis. the cov pcr reagents that are included in the rvp testing kit were further validated for clinical testing (under college of american pathologists (cap)-and clinical laboratory improvement amendments (clia)-regulatory conditions) by the ohsu molecular diagnostics lab. a unique episode of infection was counted at the initial identification of a respiratory virus in an np or bal sample. when the same respiratory virus was identified in multiple consecutive samples from the same patient without interim negative test results, this was considered as representative of prolonged shedding, and was therefore counted as a single unique episode of infection. mortality was attributed to respiratory virus infection if death was due to respiratory failure without identification of a cause other than a respiratory virus [19] . respiratory virus inpatient-acquired infection was defined as onset of new symptoms, 4 days or more after admission to an inpatient ward. criteria for possible and proven lrtd were identification of a respiratory virus in an np sample (possible lrtd) or bal sample (proven lrtd), along with new pulmonary infiltrates on thoracic imaging [24] . comparison of categorical variables between viral groups was performed using two-tailed fisher's exact test. a total of 1661 np and bal samples obtained from the general hospital inpatient and outpatient populations -inclusive of, but not limited, to hsct recipients and hematologic malignancy patientswere analyzed. of these, 631 samples (38%) submitted during 461 unique episodes of infection tested positive for a respiratory virus (table 1) . cov was the third most-common virus identified after rhv/env and piv3, accounting for 43 (6.8%) positive samples. three bal specimens were positive for cov (see below), representing 7% of all cov-positive samples. of the 461 unique episodes of infection, 339 (73.5%) were in the hematologic malignancy and hsct patient populations (table 1) . cov was identified in 38 (8.2%) episodes among all patients, and 33 (9.7%) of episodes among hematologic malignancy and hsct patients. 19 (57.5%) of the 33 episodes of cov infection in the hsct and hematologic malignancy population were diagnosed during the winter months of december-march ( fig. 1 ). 38 samples from the 33 hematologic malignancy and hsct patients tested positive for cov, with the majority (76.3%) being group i subtypes (nl63 (n = 15) and 229e (n = 14)), as compared to group ii subtypes (oc43 (n = 5) and hku1 (n = 4)). 30 of the 38 (78.9%) cov positive samples were positive only for cov, and the other 8 samples were co-infected with rhv [4] , rsv a [2] , hmpv [1] , and both rsv a and adv [1] . in order to better define the role of cov in respiratory tract syndromes among patients with hematologic malignancies and hsct recipients, we limited our clinical analysis to patients infected only with cov, excluding those co-infected with other respiratory viruses ( table 2 ). 29 patients were infected only with cov, and of those 28 (96.5%) had an underlying hematologic malignancy (n = 8) or had undergone allogeneic (n = 15) or autologous (n = 5) hsct. the clinical characteristics of cov infection in these 28 patients were examined and compared to episodes of mono-infection with other respiratory viruses (piv1-4, hmpv, rsv, and rhv/env) in the same patient population. the median age of those infected with cov was similar to the other respiratory viruses analyzed. surprisingly, cov was identified significantly more often in females (64%) than males compared to hmpv, piv1-4, and rhv/env, with a trend toward the same finding for rsv. five episodes of cov infection (17.8%) were hospital-acquired. four of these cases, all subtype nl63, occurred on the same inpatient hsct/oncology ward within a 60 day period between january 27 and march 24, 2012. while indicative of an epidemiological link, we were unable to conclusively prove this. according to surveillance performed as part of ohsu's infection control program, during this time period, only two other cases of nosocomial acquisition of a respiratory virus occurred on this ward -one rhv/env and one influenza a (personal communication, dr. lynne strasfeld). of cases acquired as an outpatient, 7 (30.4%) required admission to the hospital, typically for evaluation of fevers or new pulmonary infiltrates. the requirement for hospitalization during cov infection was not significantly different from those during infection with other respiratory viruses. similar to most other respiratory viruses, the majority of patients (85.7%) in whom cov was detected had uri symptoms (rhinorrhea, congestion, or sore throat). however, evidence of lrtd such as cough and new radiographic abnormalities was observed less frequently during cov infection, with a trend toward less hypoxemia as well. three patients (10.7%), all allogeneic hsct recipients, met criteria for possible cov lrtd (tables 2 and 3 ) based on the identification of cov from an np specimen and new radiographic abnormalities [24] , significantly less than during infection with the other respiratory viruses except rhv/env. none of these patients underwent bronchoscopy. two patients, both allogeneic hsct recipients, met criteria for proven lrtd based on identification of cov in a bal sample along with new radiographic abnormalities (tables 2 and 3 ) [24] . however, one of these patients also had rsv, adv, and methicillin-resistant staphylococcus aureus identified in the bal specimen, making the contribution of cov to lrtd unclear. the combined incidence of possible and proven lrtd was significantly lower during cov infection compared to all of the other respiratory viruses analyzed except rhv/env. four of the five cases of possible or proven lrtd occurred after day +100 following hsct, and all five were associated with acute or chronic graft-versus-host disease (gvhd). a third episode of proven lrtd, accounting for the third cov-positive bal (table 1) , occurred in a patient who had not undergone hsct and did not have an underlying hematologic malignancy; characteristics of that case were therefore not further analyzed. there were no cases in which mortality was directly attributable to cov infection. the results presented here complement and expand upon the few existing studies evaluating the role of cov infection in the immunocompromised host [15] [16] [17] 25] . cov, primarily group i subtypes, was frequently identified in the hsct and hematologic malignancy populations when suspicion for a respiratory viral infection prompted diagnostic testing. in this population, cov infection was associated with similar rates of uri symptoms, nosocomial acquisition, and requirement for hospital admission compared to most other respiratory viruses. however, cov infection resulted in less possible and proven lrtd than other respiratory viruses with the exception of rhv/env. the frequency of detection of cov among all samples tested in this study is consistent with previous reports of cov detection in patients hospitalized with respiratory syndromes [15] [16] [17] . however, our results may not reflect the true prevalence of cov infection in our patients as we do not routinely screen asymptomatic patients; doing so would most likely increase the prevalence of infection due to detection in asymptomatic shedders [15] . it is also important to note that the true rate of influenza a and b infection is under-represented in our results since the initial test of choice for these pathogens at our institution is an influenza-specific pcr assay, not the respiratory virus panel used in this study. accounting for this would reduce the relative frequency of cov as well as that of all other non-influenza respiratory viruses. we found that the hematologic malignancy and hsct populations accounted for the majority of patients testing positive for cov and the other respiratory viruses. this finding almost certainly reflects testing bias in that these patients are more likely to be tested for respiratory viruses when symptomatic given the importance placed on these pathogens [9] . interestingly, we also found a female-predominant gender distribution among those infected with cov, which to the best of our knowledge, has not been reported before [15] [16] [17] 25, 26] . while the frequency of respiratory illnesses in the general population has been described to be higher among females, perhaps due to increased exposure [27] , if this was responsible for the higher burden of cov infection among women compared to men, then a similar pattern might be expected for the other respiratory viruses as well. this finding requires confirmation by additional studies. the majority (76.3%) of cov identified in the hematologic malignancy and hsct patients in this study belongs to group i. similarly, group i covs have been associated with infection in the immunocompromised host more than group ii covs in several series and case reports [12, 13, 15, 26, 28] . in contrast, studies involving general or pediatric patient populations have reported a majority of cov belonging to group ii [16, 17, 25, 26, [29] [30] [31] [32] . group i and ii covs differ in the mechanism of virus entry into the host cell and the degree of genetic variability, but whether these differences affect pathogenicity is not known [33] . indeed, reports associating cov subtypes with disease manifestations are conflicting [17, 26, 31] . further studies into the relative incidence of cov subtypes among various patient populations are necessary and may provide insight into fundamental biological differences between group i and ii subtypes. similar to previous reports [3, 15] , the rate of cov-proven lrtd was low but was not significantly different from other respiratory viruses. however, these results must be interpreted with caution since bronchoscopy, which we used as a criteria for defining "proven lrtd", is no longer done in many cases when a respiratory virus is identified in an upper airway sample at this institution or others [24] . analyzing "possible lrtd" instead, cov was indeed associated with significantly less disease compared to all the other respiratory viruses analyzed except rhv/env, with the rate of possible lrtd due to the other respiratory viruses in this report being generally consistent with the published literature [9, 24] . however, not all patients had radiography performed at the time of diagnosis of respiratory viral infection, which may bias the results toward those more likely to have evidence of lower respiratory tract illness. interestingly, all cases of possible and proven cov-associated lrtd occurred in hsct recipients, whereas the cases of possible and proven lrtd during infection with the other respiratory viruses were divided more evenly among hsct recipients and hematologic malignancy patients. additionally, all cases occurred in the setting of acute or chronic gvhd. taken together, these findings suggest that cov may be inherently less virulent compared to other respiratory viruses, and therefore, requires augmented immune suppression after hsct in order to progress to lrtd. the low number of cov-associated lrtd in this study precludes meaningful risk factor assessment but additional studies may make this more feasible. aside from lrtd, cov infection was associated with other clinically-relevant consequences. namely, 30% of outpatients were admitted to the hospital based on manifestations of cov infection, and hospital acquisition occurred in 5 cases, with a cluster of 4 nosocomially-acquired cases occurring within a 2 month span. additionally, 50% of cov-infected patients received an empiric course of antibacterial therapy (data not shown). notably, while cov is detected as part of the respiratory virus panel used at our institution during the study period, the cov results were not reported in the medical record since the assay was not approved by the food and drug administration for this purpose. in theory, a "negative" respiratory virus panel result may lead to more frequent admission to the hospital for further medical evaluation, antibacterial use, or nosocomial transmission. however, we found the rates of these events during cov infection to be similar to those during infection with other respiratory viruses ( table 2 and data not shown), highlighting the overall impact of respiratory viral infections in these patients in terms of utilization of medical resources. in conclusion, we found that cov is detected frequently in patients with hematologic malignancies and hsct recipients in whom suspicion for a respiratory viral infection exists, but is associated with less lrtd than other respiratory viruses except rhv/env. the retrospective nature of this work mandates confirmation of our findings by additional, prospective studies. human metapneumovirus infection in hematopoietic stem cell transplant recipients rhinovirus infections in myelosuppressed adult blood and marrow transplant recipients rhinovirus infections in hematopoietic stem cell transplant recipients with pneumonia clinical characterization of human metapneumovirus infection among patients with cancer adenovirus infections in adult recipients of blood and marrow transplants parainfluenza virus infections after hematopoietic stem cell transplantation: risk factors, response to antiviral therapy, and effect on transplant outcome influenza infections after hematopoietic stem cell transplantation: risk factors, mortality, and the effect of antiviral therapy parainfluenza virus infections in children with hematologic malignancies changing epidemiology of respiratory viral infections in hematopoietic cell transplant recipients and solid organ transplant recipients coronavirus pneumonia following autologous bone marrow transplantation for breast cancer coronavirus-associated pneumonia in previously healthy children fatal lower respiratory tract disease with human corona virus nl63 in an adult haematopoietic cell transplant recipient coronavirus 229e-related pneumonia in immunocompromised patients use of a novel virus detection assay to identify coronavirus hku1 in the lungs of a hematopoietic stem cell transplant recipient with fatal pneumonia human rhinovirus and coronavirus detection among allogeneic hematopoietic stem cell transplantation recipients a prospective hospital-based study of the clinical impact of non-severe acute respiratory syndrome (non-sars)-related human coronavirus infection genetic variability of human coronavirus oc43-, 229e-, and nl63-like strains and their association with lower respiratory tract infections of hospitalized infants and immunocompromised patients respiratory viral infections after bone marrow/peripheral stem-cell transplantation: the christie hospital experience respiratory virus infections after stem cell transplantation: a prospective study from the infectious diseases working party of the european group for blood and marrow transplantation prospective study of the incidence, clinical features, and outcome of symptomatic upper and lower respiratory tract infections by respiratory viruses in adult recipients of hematopoietic stem cell transplants for hematologic malignancies epidemiology of viral respiratory tract infections in an outpatient haematology facility viral respiratory infections diagnosed by multiplex pcr after allogeneic hematopoietic stem cell transplantation: long-term incidence and outcome xtag rvp assay: analytical and clinical performance parainfluenza virus lower respiratory tract disease after hematopoietic cell transplant: viral detection in the lung predicts outcome clinical disease in children associated with newly described coronavirus subtypes epidemiology and clinical presentations of the four human coronaviruses 229e, hku1, nl63, and oc43 detected over 3 years using a novel multiplex real-time pcr method epidemiology of viral respiratory infections a prospective molecular surveillance study evaluating the clinical impact of community-acquired respiratory viruses in lung transplant recipients human coronavirus infections in rural thailand: a comprehensive study using real-time reverse-transcription polymerase chain reaction assays human (non-severe acute respiratory syndrome) coronavirus infections in hospitalised children in france coronavirus hku1 and other coronavirus infections in hong kong new vaccine surveillance network, human coronavirus in young children hospitalized for acute respiratory illness and asymptomatic controls fields virology the authors wish to thank dr. lynne m. strasfeld and kevin langstaff for providing data pertaining to nosocomially-acquired respiratory viral infections at ohsu. no conflicts of interest. none. none declared. approval from the institutional review board of ohsu was obtained prior to beginning this study. key: cord-263279-afdmegq0 authors: uhteg, katharine; jarrett, junko; richards, mahmia; howard, craig; morehead, elizabeth; geahr, melissa; gluck, linda; hanlon, ann; ellis, brandon; kaur, harsimar; simner, patricia; carroll, karen c.; mostafa, heba h. title: comparing the analytical performance of three sars-cov-2 molecular diagnostic assays date: 2020-04-26 journal: j clin virol doi: 10.1016/j.jcv.2020.104384 sha: doc_id: 263279 cord_uid: afdmegq0 in december 2019, a novel coronavirus (sars-cov-2) was first isolated from wuhan city, china and within three months, the global community was challenged with a devastating pandemic. the rapid spread of the virus challenged diagnostic laboratories to rapidly develop molecular diagnostic methods. as sars cov-2 assays became available for testing on existing molecular platforms, laboratories devoted unprecedented energy and resources into evaluating the analytical performance of the new tests and in some cases developed their own diagnostic assays under fda-eua guidance. this study compares the validation of three different molecular assays at the johns hopkins molecular virology laboratory: the realstar® sars-cov-2 rt-pcr, eplex® sars-cov-2, and the cdc covid-19 rt-pcr tests. overall, our studies indicate a comparable analytical performance of the three assays for the detection of sars-cov-2. the highly pathogenic betacoronavirus, sars-cov-2, first isolated in wuhan, china in december 2019 has caused a quickly evolving pandemic [1] [2] [3] . the outbreak was followed by characterization of the sars-cov-2 whole viral genome within weeks of its discovery, which allowed the development of various molecular diagnostic assays. the implementation of in-house molecular diagnostics nationwide was slower than the emergence of the pandemic. it was not until february 4th, 2020 that centers for disease control and prevention (cdc)'s covid-19 real-time pcr assay received an emergency use authorization (eua) (https://www.fda.gov/medical-devices/emergencysituations-medical-devices/emergency-use-authorizations# covid19ivd). clinical microbiology laboratories were not permitted to develop covid-19 testing in house and apply for their own eua approvals until february 29th, 2020. soon after that date, only a few commercial assays were available with insufficient reagents to meet national demands. of the first assays that were available for validations were the cdc covid-19 rt-pcr panel assay (idt, coralville, ia) as well as the realstar® sars-cov-2 rt-pcr (altona diagnostics, hamburg, germany), and both were initially validated for clinical use at the johns hopkins hospital medical microbiology laboratory. assays that offer the required analytical sensitivity and specificity are essential for early diagnosis and consequently early intervention especially for infection prevention and control purposes. molecular diagnosis using reverese-transcription rt-pcr is the current most conclusive approach for covid-19 diagnosis. an understanding of the analytical performance of different molecular asssays is essential for proper interpretation of the results and for defining the clinical sensitivity of rna detection. we validated three different assays for the molecular detection of sars-cov-2: the realstar® sars-cov-2 rt-pcr, eplex® sars-cov-2, and the cdc covid-19 rt-pcr tests. the analytical sensitivity of the three assays was compared using the same quantified genomic materials, which offered a side by side comparison of their lower limits of detection. the overall accuracy of the three assays was compared using patient' clinical specimens and the reproducibility was studied using contrived specimens. johns hopkins hospital. the study was approved by the johns hopkins university school of medicine irb (irb00246024). genomic viral rna, kindly provided by the university of texas medical branch (utmb) was used for the analytical sensitivity and reproducibility studies. the genomic rna was derived from the strain usa_wa1/2020 originating from washington, usa from a traveler from wuhan, china. this isolate demonstrates 100 % consensus match to genbank mn985325.1. per utmb product insert, rna was purified using trizol and the rna purity was 27 % viral and 73 % host as determined by next-generation sequencing. the viral rna concentration was determined to be equivalent to 6 × 10 4 pfu/μl(and the genome copies were noted to exceed the pfu counts in the range of 1000: 1) clinical specimens used for studies were remnant specimens available at the completion of standard of care testing from patients suspected of covid-19. specimens included nasopharyngeal swabs (np) and bronchoalveolar lavage (bal). archived frozen specimens (i.e., np and bal) were used as matrix to create contrived samples (matrix negative for sars-cov-2). the realstar® sars-cov-2 rt-pcr kit 1.0 is from altona diagnostics (hamburg, germany). this kit detects both b-βcov specific rna (e gene) and sars-cov-2 specific rna (s gene). (https://altonadiagnostics.com/en/products/reagents-140/reagents/realstar-realtime-pcr-reagents/realstar-sars-cov-2-rt-pcr-kit-ruo.html) the genmark (carlsbad, ca) eplex® sars-cov-2 test, for research use only (ruo) assay was performed on the eplex instrument. the company received fda-eua on march 19th. a single use eplex cartridge automates nucleic acid extraction, amplification, and detection. genmark has developed an innovative esensor technology that combines dna hybridization and electrochemical detection [4] . a volume of 200μlper specimen is added to the sample delivery device. the eplex® sars-cov-2 targets the nucleocapsid (n) protein (https://www. fda.gov/media/136282/download). the cdc covid-19 rt-pcr panel assay was developed by the cdc and was granted an eua on february 4th. the oligonucleotide primers and probes (two primer/probe sets) target regions of the nucleocapsid (n) gene. the panel includes a primer/probe set to detect the human rnase p gene (rp) for extraction and specimen quality evaluations (https://www.fda.gov/media/134922/download). automated nucleic acid extraction for both the the realstar® sars-cov-2 and the cdc assays was performed using either the nuclisens easymag or emag instruments (biomérieux, marcy-l'étoile, france) using software version 2.1.0.1. the input volume for all sources was 500μland the elution volume was 50 u l. all the specimens were initially processed in either bsl-3 or bsl-2 using bsl-3 biosafety measures and 2 ml of the easymag/ emag lysis buffer was added to each 500μlof the aliquoted specimens in a biosafety cabinet. specimens were incubated for 10 min and nucleic acid extraction protocol was followed for performing automated off board lysis extraction following biomérieux protocol. the realstar® sars-cov-2 rt-pcr kit 1.0 total reaction volume was 30 μl(10μlextracted sample and 20 μlmastermix). the kit contains two premade master mixes, a and b, which contain pcr buffer, magnesium salt, primers and probes, reverse transcriptase, and dna polymerase. the detectors used are fam (b-βcov), cy5 (sars-cov-2), and joe (internal control). taqman rt-pcr was performed using the prism 7500 sequence detection system (applied biosystems, foster city, ca) at the following cycling conditions: 1 cycle at 55.0°c for 20 min, 1 cycle at 95.0°c for 2 min and 45 cycles at 95.0°c for 15 s, 55.0°c for 45 s then 72.0°c for 15 s. the cdc covid-19 rt-pcr panel assay was performed using the idt primers and probes lot # 0000500383 and taqpathtm 1-step rt-qpcr master mix (4x) (thermofisher catalog no a15300). controls included the idt 2019-ncov_n_positive control, and the hs_rpp30 positive control plasmids. the assay was performed in three separate reactions per specimen for each target (n1, n2, and the internal control rp). the reaction volume is a total of 20 μl(8.5μlnucleasefree water, 1.5μlprimer and probe mix, 5μltaqpathtm 1-step rt-qpcr master mix, and 5μlextracted specimen (or controls). the detector used for all the targets is fam. taqman rt-pcr was performed using the prism 7500 sequence detection system (applied biosystems) at the following cycling conditions: 1 cycle at 25.0°c for 2 min, 1 cycle at 50.0°c for 15 min, 1 cycle at 95.0°c for 2 min and 45 cycles at 95.0°c for 3 s, 55.0°c for 30 s. to evaluate and compare the analytical sensitivity of the three methods, sars-cov-2 negative np or bal specimens were extracted using easymag or emag and eluates were spiked with serially diluted sars-cov-2 whole viral genomic materials. dilutions were tested with the realstar® sars-cov-2 rt-pcr, eplex® sars-cov-2, and the cdc covid-19 rt-pcr tests. the lower limit of detection (lod) was defined as the lowest concentration at which 95 % of the tested replicates were detected. for the realstar® sars-cov-2 rt-pcr, extracts from remnant clinical np or bal swabs were spiked with serially diluted genomic rna in 7 concentrations ranging from 120,000 pfu/ ml (1200,000 copies (cp)/ reaction (rxn)) to 0.12 pfu/ ml (1.2 cp/ rxn). three replicates were tested at all concentrations except for 120 cp/rxn (n = 30) and 12 cp/rxn (n = 24). the lod for the the realstar® sars-cov-2 rt-pcr for np specimens was at 1200 cp/ ml (12 cp/ rxn) ( table 1) . for the bal, extractions from archived clinical bal specimens were spiked with serially diluted genomic rna into 3 concentrations (cp/ rxn): 1200 (n = 20), 120 (n = 20), 12 (n = 3). the lod for the the realstar® sars-cov-2 rt-pcr for bal specimens was at 12,000 copies/ ml (120 cp/ rxn) ( table 1 ). it is notable that of the three bal specimens run at 12 cp/ rxn, 2 were positive for the b-βcov target but negative for the sars-cov-2 target. for the cdc covid-19 rt-pcr test, similarly, extracts from clinical np or bal were spiked with serially diluted genomic rna. the lod was identified to be 1200 cp / ml for both np and bal specimens (6 cp/ rxn) ( table 1) . for the eplex® sars-cov-2, negative np eluates were spiked with different concentrations of the viral genomic materials and tested following the genmark instructions for use. our data indicate that the lod of the assay is 600 cp/ ml (120 cp/ rxn). no lod studies were performed for bal specimens on this assay (table 1) . to compare the analytical performance of the three assays, positive and negative sars-cov-2 clinical specimens (using the realstar® sars-cov-2 as the reference method as this assay was the first to be offered in house for clinical diagnosis) were tested by the cdc covid-19 rt-pcr and/ or the eplex® sars-cov-2 assays. comparing the performance of the cdc covid-19 rt-pcr to the realstar® sars-cov-2 included testing 20 positive and 48 negative clinical np specimens. comparison showed 100 % agreement as well as similar trends in ct values for the positive specimens (table 2 ). for the negative specimens 100 % agreement was noted as well (data not shown). the agreement between the realstar® sars-cov-2 and the eplex® sars-cov-2 was tested by comparing 34 negative and 13 positive clinical specimens (initially diagnosed by realstar® sars-cov-2). our data showed 100 % agreement for both negatives (data not shown) and positives (table 3) . to assess the reproducibility of the three assays, replicate testing within the same run and in different runs was performed. for both the realstar® sars-cov-2 and the cdc covid-19 rt-pcr, np and bal specimens were spiked with dilutions of the sars-cov-2 genomic materials and replicates were tested over three separate runs after separate extractions by 3 different operators, using 3 different thermocyclers. for the realstar® sars-cov-2 np specimens, concentrations of spiked specimens were 12,000 cp/ml (n = 30) and 1200 cp/ml (n = 20). nineteen negative np samples were also included (table 4) . bal was run at concentrations of 120,000 cp/ ml (n = 21), 24,000 cp/ ml (n = 11), 12,000 cp/ ml (n = 20). thirty negative bal sepecimens were included (table 4) . our data showed a qualitative reproducibility of 100 %. for the the cdc covid-19 rt-pcr assay, concentrations of spiked specimens were 1200 cp/ml (n = 26). forty negative np samples were also included (table 5 ). bal was run at conecntrations of 1200 cp/ml (n = 27). thirty negative bal sepecimens were included ( table 5 ). the reproducibility of eplex® sars-cov-2 was assessed by running replicates of negative and contrived np specimens, spiked with different dilutions within the same day and over three separate runs, by different operators. overall, the runs showed 100 % reproducibility (table 6) . ct values' range of diagnosed patients after implementing the realstar® sars-cov-2 clinical assay the realstar® sars-cov-2 assay was the first assay validated and implemented at johns hopkins hospital. to assess the range of viral loads detected by this assay since its implementation, we examined the ct values of a subset of the initial positive specimens over time (fig. 1) . initially, diagnosed cases after the implementation of the assay had ct sars-cov-2 is the seventh and most novel human coronavirus. it emerged as a highly pathogenic species in december 2019 in wuhan city, china and has since quickly spread to all continents except antartica [5] . as of the time of this writing, the number of confirmed cases is more than one milion with thousands of deaths (https://www. who.int/emergencies/diseases/novel-coronavirus-2019/situationreports). the clinical manifestations of the disease (covid-19) range widely from mild upper respiratory tract infection to a more severe or critical disease [6, 7] . the rapid spread of the outbreak might be attributed to the successful transmissibility [8, 9] in addition to some evidence that asymptomatic individuals may transmit the infection [10] . sars-cov-2 was first identified in the bal fluid of a patient from china by metagenomics whole genome sequencing [11] . the quick characterization of the full genome of the virus has enabled the development of multiple molecular diagnostic methods, however, nationwide implementation of molecular diagnostics in the us was delayed. in the us, the cdc defined criteria for defining patients under investigation and priorities for testing, however, extensive testing in other countries was instrumental in controlling the spread of the disease and identifying a more accurate case-fatality rates [12, 13] . consequently, the implementation of laboratory developed testing in the us was essential to escalate the required testing capacity and to ensure rapid diagnosis that facilitated implementation of containment measures, utilization of high demand personal protective equipment and patient management. as so far, as molecular detection remains the gold standard for diagnosis, it is critical to understand the analytical performance of the available molecular assays. in this study, we compared the analytical performance of three different molecular assays for the detection of sars-cov-2; the realstar® sars-cov-2 rt-pcr, eplex® sars-cov-2, and the cdc covid-19 rt-pcr tests. the cdc assay and the genmark eplex target the n gene, and the altona realstar assay detects both the e and s genes. the three assays showed comparable analytical sensitivity that was between 600−1200 viral genome copies/ ml. there was 100 % agreement between the three assays for both negative and positive clinical specimens. generally, the realstar® sars-cov-2 rt-pcr assay has a higher throughput than the cdc assay as the cdc assay requires three separate wells per specimen. the genmark eplex, although it has a relatively short turn-around-time, offers open access and easier workflow, its full implementation is limited by inadequate supplies and inventory. it is in general difficult to understand the differences in the analytical sensitivity of different molecular assays due to inherent variabilities in specimen processing and reference materials used for validations in different laboratories. this study offered a side by side comparison using the same extraction methodology (the realstar® sars-cov-2 and the cdc assays) and viral genomic materials which offers a better assessment of the analytical performance. many questions remains to be answered about the clinical sensitivity of pcr assays for the diagnosis of covid-19 and the minimum acceptable analytical sensitivity. different studies have shown different detection patterns of the viral rna based on the specimen type and the specimen collection time in relation to the onset of symptoms. a recent study by a chinese group showed that viral rna is readily detectable in the nasopharyngeal, sputum, and stool specimens, with sputum specimens showing a more extended detection time frame that extends beyond 4 weeks (a mean of 22 days versus 16.2 days) and for both respiratory sources the peak viral load was during the first week after the onset of symptoms [14] . a different group consistently showed that the sputum as well as broncho-alveolar lavage specimens showed the highest positivity rates [15] . additional studies from other groups showed lower sensitivity of pcr for early detection in highly suspected patients in comparison to ct scan [16] or serology [17] . our data shows that many of our diagnosed specimens had viral loads that were below the assay's lower limit of detection (ct range of 32.74 for the sars-cov-2 channel, np sources (table 4) , and fig. 1) , which warrants an analytical sensitivity below 1200 copies/ ml to reduce the number of false negative results. in general, multiple factors other than the analytical sensitivity of the molecular assay could contribute to the clinical performance of various rna detection methods. this includes the specimen collection time and the specimen quality when collected. overall, it is appropriate to conclude that the rna detection remains the assay of choice for covid-19 confirmed diagnosis and until a better understanding of the dynamics of viral shedding and its correlation to the disease progression is achieved, assays with acceptable analytical performance are essential for enhancing the clinical diagnosis. in summary, our results show that the analytical performance of the three sars-cov-2 assays; the realstar® sars-cov-2 rt-pcr, eplex® sars-cov-2, and the cdc covid-19 rt-pcr tests is comparable. the clinical sensitivity of pcr in covid-19 diagnosis is still an area of investigation. credit authorship contribution statement a novel coronavirus from patients with pneumonia in china a familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster coronaviridae study group of the international committee on taxonomy of v, the species severe acute respiratory syndrome-related coronavirus: classifying 2019-ncov and naming it sars-cov-2 the genmark eplex((r)): another weapon in the syndromic arsenal for infection diagnosis diagnosis and treatment of an acute severe pneumonia patient with covid-19: case report evidence of sars-cov-2 infection in returning travelers from wuhan features, evaluation and treatment coronavirus (covid-19) early epidemiological assessment of the transmission potential and virulence of coronavirus disease 2019 (covid-19) in wuhan city: china presumed asymptomatic carrier transmission of covid-19 a new coronavirus associated with human respiratory disease in china substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (sars-cov2) diagnostic testing for severe acute respiratory syndromerelated coronavirus-2: a narrative review viral kinetics and antibody responses in patients with covid-19, medrxiv evaluating the accuracy of different respiratory specimens in the laboratory diagnosis and monitoring the viral shedding of 2019-ncov infections correlation of chest ct and rt-pcr testing in coronavirus disease 2019 (covid-19) in china: a report of 1014 cases antibody responses to sars-cov-2 in patients of novel coronavirus disease we thank the entire medical microbiology division for their assistance with this study. we also thank altona diagnostics for their support with the initial implementation of the covid-19 laboratory developed test. we also thank the university of texas medical branch (utmb) for providing quantified genomic sars-cov-2 rna material. key: cord-268567-2xoubkxb authors: samannodi, mohammed; hansen, michael; allana, ambreen; hasbun, rodrigo title: compliance with international guidelines in adults with encephalitis date: 2020-04-14 journal: j clin virol doi: 10.1016/j.jcv.2020.104369 sha: doc_id: 268567 cord_uid: 2xoubkxb background: encephalitis is associated with significant neurological disability and mortality. many guidelines are published for encephalitis management but compliance with them is unknown. objectives: to evaluate the appropriate management and compliance to the current guidelines in adults with encephalitis. study design: a retrospective multicenter study at 17 hospitals in the greater houston area from august 1, 2008 through september 30, 2017. all cases met the definition for possible or probable encephalitis as per the international encephalitis consortium guidelines. results: a total of 241 adults (age >17 years) with encephalitis were enrolled. the most common etiologies were unknown (41.9 %), viral (27.8 %) and autoimmune (21.2 %). an adverse clinical outcome was seen in 49 % with 12.4 % in hospital mortality. a high compliance with guidelines (>90 %) was only seen in obtaining a brain computerized tomography (ct) scan, blood cultures and cerebrospinal fluid (csf) gram stain and culture. a csf herpes virus simplex (hsv) polymerase chain reaction (pcr) was done in 84 % and only repeated in 14.2 % of patients with an initial negative result. furthermore, only two-thirds of patients were started empirically on intravenous acyclovir and antibiotics. evaluation for other etiologies were not uniformly performed: arboviral serologies (57.3 %), csf anti-n-methyl-d-aspartate receptor (nmda) receptor antibody (35.7 %), and csf varicella zoster virus (vzv) pcr (32 %). the highest yield for the tests were arboviral serologies (42 %), anti-nmda antibodies (41.2 %) and vzv pcr (16.4 %). conclusion: the management of encephalitis as per current guidelines is suboptimal leading to underutilization of currently available diagnostic tests and empirical therapy. encephalitis is an inflammatory process of the brain associated with mortality ranging between 4-36 % of patients depending on the etiological agent, country of the study, immunosuppression, and inclusion of adults or children or both [1, 2] . furthermore, up to two-thirds of survivors from viral encephalitis (herpes simplex virus, japanese encephalitis, west nile virus) have neurological and/or neurocognitive sequelae [3] [4] [5] . the incidence of encephalitis varies by country between 0.4-16 cases per 100,000 persons [2] . infections and autoimmune etiologies are considered to be the most important causes of encephalitis representing approximately 40 % and 20 %, respectively when systematically evaluated [1] . however, between 37-80 % of encephalitis cases remain with unknown etiologies [2, [6] [7] [8] . in the past, brain biopsy was the gold standard for diagnostic method for encephalitis but currently it is infrequently done as less invasive and highly sensitive diagnostic tools such as polymerase chain reaction (pcr) for viruses in the cerebrospinal fluid (csf) was introduced [9] . the variability in the proportion of unknown etiologies between studies is most likely driven by the availability and use of molecular diagnostic techniques, and testing for arboviral serologies and autoimmune etiologies [10] . in this study, we are evaluating the work up, management and outcome of 241 adults with encephalitis based on the majority of current guidelines recommendations in literature [11] [12] [13] [14] . to our knowledge, this is the first study evaluating the compliance to the current guidelines in adults with encephalitis https://doi.org/10.1016/j.jcv.2020.104369 received 20 february 2020; received in revised form 9 april 2020; accepted 11 april 2020 2. methods the study was approved by the ut health committee for the protection of human subjects, by the memorial hermann hospital research review committee and the harris health research committee. we conducted a retrospective study of 241 adults with a diagnosis of encephalitis. the study was collected from 17 hospitals from the memorial hermann health (mhh) system and harris health system (hhs) in the greater houston area between august of 2008 and september of 2017. primary outcome of the study was assessing encephalitis management and compliance to current guidelines in our population. as summarized in (supplemental digital content table 1 ), all guidelines of encephalitis management have major parts in evaluating and managing patients with encephalitis; exposure evaluation, appropriate utilization of diagnostic and neurodiagnostic studies, and proportion and timing of empirical antibiotic and antiviral therapy [11] [12] [13] [14] [15] . in our study, we followed these major parts and compared them with our population. as per iec guidelines, an encephalitis case was determined by the presence of the major criterion (presentation of altered mental status without alternative cause lasting more than 24 h) and at least 2 minor criteria: a. fever 72 h before or after presentation, b. new onset seizures, c. new onset focal neurological findings, d. white blood cell count > 5 mm 3 in the cerebrospinal fluid (csf), e. new neuroimaging findings, f. abnormal electroencephalogram consistent with encephalitis. case outcomes were defined using the glasgow outcome scale (gos), where, 5 is considered a good recovery, 4 being consistent with moderate disability, 3 with severe disability, 2 with a vegetative state, and 1 with death. anything that was scored as a 4 or less was defined as an adverse clinical outcome (aco) [16] . herpes viral infections (hsv, vzv, cmv and ebv) were identified by csf polymerase chain reaction (pcr). arboviral diseases were diagnosed via a panel of testing that included immunoglobulin m (igm) for st. louis encephalitis virus, eastern equine encephalitis virus, venezuelan equine encephalitis virus, la crosse virus, and west nile virus. bacterial diseases were identified either through csf culture or via relevant serological testing (igm) for rickettsia, brucella and mycoplasma. fungal infections were identified by csf culture or csf antigen. parasitic infections were identified by microscopic examination of brain tissues or csf antigen. patients were considered positive for an autoimmune encephalitis if the csf antibody test was present in an abnormal range in the absence of any other identified cause of encephalitis and presence of current autoimmune disease such as hashimoto thyroiditis. also positive csf antibodies for n-methyl-d-aspartate (nmda) or voltage -gated potassium channel (vgkc) defined as autoimmune encephalitis. medical records were reviewed independently by two physicians and all cases met the definition for possible or probable encephalitis as per the international encephalitis consortium (iec) guidelines [14] . data extraction from the medical record was done utilizing a standardized form. extracted data included information on demographics, clinical presentation, diagnostic testing, and treatment. all patients were assigned as infectious, autoimmune or idiopathic. a total of 1,241 patients were identified with an international classification of disease (icd)-9 discharge diagnosis code of encephalitis. after review of the medical records, we excluded the following patients: did not have a central nervous system infection (n = 580), healthcare-associated ventriculitis or meningitis (n = 148), community-acquired bacterial meningitis (n = 101), aseptic meningitis (n = 72), fungal meningitis (n = 68), tuberculous meningitis (n = 25), parasitic infection (n = 3), and incomplete medical records (n = 3). only 241 (19 %) met the definition of encephalitis. statistical analysis was performed with spps version 25 (ibm, austin, tx, usa). univariate analysis was performed using fisher's exact test, chi square, and student's t-test as appropriate. the demographic and clinical characteristics are shown in (table 2) . a total of 241 adults with encephalitis were enrolled. the median age was 49 years of age with the majority of patients being male (54 %), non-caucasian (55.6 %), and with private insurance (61.4 %). during our study period, average houston population was about 6,000,000 and the majority of houston population were hispanic (∼41 %) followed by caucasian (∼38 %) then african american (∼17 %) as reported by texas department of state health services. however, our study showed that african americans (30.3 %) were disproportionally affected. a total of 68 patients (28 %) were immunocompromised with ∼50 % of them being human immunodeficiency virus (hiv) positive (n = 36), recent chemotherapy due to malignancy (n = 17), chronic immunosuppressive therapy due to autoimmune diseases (n = 13) and solid organ transplantation (n = 2).the median duration of symptoms prior to admission was 5 days. the most common presenting symptoms included fever, headache, photophobia, respiratory symptoms and nausea/vomiting. a high opening pressure (> 20 cm h 2 o) was documented in 74 % of the patients with the most common clinical signs being focal neurological deficits (45.4 %), seizures (43.5 %), and obtundation (33 %). coma (gcs < 8) and status epilepticus was seen in 20 % and 10 %, respectively. laboratory findings and etiologies are summarized in (table 3 ). the csf profile consisted of a mild pleocytosis (median csf serum wbc was 30 cells/mm 3 ) with a lymphocytic predominance, a normal glucose and mildly elevated protein. the serum wbc count was 6,500 cells/ml with leukopenia and thrombocytopenia being documented in 7.5 % and 14.1 %, respectively. in terms of etiology, the most common cause of encephalitis was idiopathic (41.9 %) followed by viral (27.8 %) and autoimmune (21.2 %). the most common causes of viral encephalitis were west nile virus (wnv) and herpes simplex virus (hsv) were (42 %, 33 % respectively) followed by varicella zoster virus (vzv) (16.4 %). the most common cause of autoimmune encephalitis was due to anti-n-methyl-d-aspartate receptor (41.2 %). regarding bacterial etiologies, streptococci (group a streptococcus, s. pneumoniae) and staphylococci (s. aureus) were the most common etiologies. mycobacterium tuberculosis was seen in 4 patients. toxoplasma gondii was the only parasite isolated in our population. fungal etiology was not common in our study with total of three cases. the infectious disease society of america (idsa), british, australian, international consortium, and french guidelines recommend that clinicians evaluate for potential exposures and risk factors and to perform appropriate utilization of diagnostic studies in patients with suspected encephalitis. as shown in (table 4) , we found poor documentations of exposure risk factors in patients' medical charts. for example, high-risk sexual activity, recent travel history and occupational history was documented in about 30 %, 15 %, and 12.4 % of patients, respectively. all other exposure risk factors (e.g., insect, animal or, ill contact, fresh water exposure or recent vaccination history) were infrequently documented. although exposure and risk factors were poorly documented, most of them were had high yield results. as shown in (table 4 ), the utilization of diagnostic studies was variable. most of patients had chest x-ray and blood culture (95 %, 92.9 % respectively). other diagnostic tests were variable such as testing for hiv (77.2 %), arbovirus (57.3 %), syphilis (49.4 %), and for mycobacterial (sputum afb culture) or fungal etiologies (histoplasma urinary antigen, serum cryptococcal antigens) (< 20 %). testing for mycoplasma and rickettsial antibodies (igm) was done in a minority of patients. we found that when done many of the diagnostic studies have high yield results. the highest yield and the most significant test was serum arboviral antibodies (42 %) neurodiagnostic studies are summarized in (table 5 ). brain ct and mri were performed in 89.6 % and 79.3 % respectively. electroencephalography was underutilized in our study with a compliance rate of 66 %. csf gram stain and bacterial culture were done in the majority of patients. csf hsv pcr was obtained in about 84 % of patients reflecting that clinicians understand the importance of hsv in encephalitis. csf enterovirus pcr was obtained in about half of patients only. the tests with the highest yield were csf anti-nmda antibodies (41.2 %) and csf vzv pcr (16.4 %). csf infectious process was identified in 25 % of all immunocompromised patient (n = 17). all reviewed guidelines of encephalitis management recommend starting empiric antibiotics and acyclovir as soon as possible, pending results of diagnostic studies [11] [12] [13] [14] . as demonstrated in (table 6) , the compliance to empiric intravenous antibiotics and acyclovir was not favorable. additionally, there was significant delay in initiation of empiric intravenous antibiotics and acyclovir. about 12 % of our population developed acute kidney injury, which can be attributed to antimicrobials in addition to other causes. also, most of the guidelines recommends to repeat csf hsv pcr in 3-7 days in undiagnosed cases of encephalitis in which patients have clinical features or neuroimaging findings of hsv encephalitis [11] [12] [13] [14] . we found 148 undiagnosed cases with suspected features of hsv encephalitis, only 14.2 % had repeat csf hsv pcr and all were negative. in terms of outcome, approximately half of the patients had an adverse clinical outcome with a all reviewed guidelines recommend a thorough exposure evaluation to patients with encephalitis [11] [12] [13] [14] [15] . as shown in (table 4) , the compliance to exposure evaluation was the lowest. however, most of exposures and risk factors yielded important information in a substantial proportion of patients highlighting the importance in documenting them. the most common cause of encephalitis was idiopathic which is consistent with most studies [1, 2, 7, 8] . the most common infectious cause of encephalitis in our study was wnv. in the encephalitis study done in england, hsv was the most common cause of infectious encephalitis with no cases of wnv reported [7] . in contrast, wnv is endemic in the us. furthermore, 27 patients (96.4 %) with wnv encephalitis were diagnosed during the endemic season (between june and october) [10] . regarding diagnostic tests, most guidelines recommend obtaining hiv test and blood culture in all patients with encephalitis and other diagnostic tests can be done based on clinical clues and epidemiological risk factors [11] [12] [13] [14] [15] . the compliance rate was favorable in ordering blood culture (92.9 %) but suboptimal in hiv (77.2 %). in terms of neurodiagnostic evaluations, it is recommended by all guidelines to obtain csf analysis, csf gram stain and culture, csf hsv pcr, csf vzv pcr, csf enterovirus pcr, brain imaging which mri is preferable, and electroencephalography (eeg). further neurodiagnostic testing will be based on clinical necessity [11] [12] [13] [14] [15] . most of our patients had csf analysis, csf gram stain and culture, and brain imaging. eeg was underutilized in our study and was only performed in two third of patients. hsv is the most common treatable cause of encephalitis and the guidelines recommend that all patients should be tested. in our study, a csf hsv pcr was done in 84.2 %. additionally, the guidelines advocate to repeat a csf hsv pcr in undiagnosed cases of encephalitis in which patients have clinical features or radiological findings of hsv encephalitis [11] [12] [13] [14] [15] . in our study, a repeat csf hsv pcr was only done in 14.2 % of 148 undiagnosed patients with suspected features of hsv encephalitis. this raises the concern of underdiagnosing the most common treatable etiology. a csf vzv pcr were not uniformly done but had the highest yield in our study. additionally, [18] . although anti-nmda antibodies were checked only in about 35 % of our population, anti-nmda antibodies was the most common cause of autoimmune encephalitis in our study. all guidelines in agreement that empiric antibiotics and acyclovir should be started as soon as possible in patients with suspected encephalitis. in our study, empiric intravenous antibiotics and acyclovir were not started in about one third of the patients; this is worrisome as delays in therapy are associated with an increase adverse outcomes in both bacterial meningitis and herpetic encephalitis [4, 13, [19] [20] [21] . furthermore, the median time to initiate intravenous acyclovir was 12 h from arriving to the emergency room. a recent study of 438 patients with herpetic encephalitis documented unfavorable outcomes in 52.9 % of patients with age and glasgow coma scales as independent prognostic factors [4] . the authors were also able to correlate a delay in the initiation of acyclovir with a linear increase in adverse clinical outcomes and recommended to start antiviral therapy urgently in all patient with suspected encephalitis. the mortality rate in our study was 12.6 %; similar to the 5-15 % rates reported in the literature [1, 14, 22] . overall, the management of encephalitis in our population was suboptimal. the reason behind this fact was not fully clear. a possible reason could be due to the lack of awareness of the encephalitis diagnosis or guidelines and/or due to the relative lack of experience on the treating clinicians in this relative rare disease. our study had several strengths. it is the first study to evaluate the compliance with multiple encephalitis guidelines. second, it was a multicenter study done in 17 hospitals that included a wide variety of community hospitals and academic medical centers. third, we only included cases that met the iec definition of encephalitis and provided a comprehensive review of all the diagnostic and treatment modalities as recommended by guidelines. despite the strengths, our study had some limitations. first, due to the retrospective nature of the study, some missing data could limit the conclusion of the study. furthermore, the study was conducted in houston and the findings needs validation in other centers. finally, diagnosis of encephalitis still challenging and sometimes we proceed with invasive diagnostic measures such as brain biopsy to find the causative factor [9] . despite our currently available diagnostic tools, a large proportion of patients still have unknown etiologies. metagenomic sequencing of csf has recently been shown to aid in the further identifying infectious etiologies in patients with meningitis and encephalitis and could be a promising clinical tool in the near future [23] . adults with encephalitis continue to have high rates of unknown etiologies and adverse clinical outcomes. encephalitis management and compliance with the guidelines were suboptimal accounting for the underutilization of currently available diagnostic tests and empirical therapy in a significant proportion of patients. we hope that this study will increase awareness of encephalitis guidelines among clinicians with goals to improve the care and outcomes of this devastating disease. ms contributed to conception and design of the study, acquisition and analysis of data, and drafting a significant portion of the manuscript. mh contributed to conception and design of the study, and acquisition and analysis of data. aa contributed to acquisition and analysis of data. rh contributed to conception and design of the study, acquisition and analysis of data, and drafting a significant portion of the manuscript. this study was supported by the grant a starr foundation. dr. hasbun is a speaker and has research support from biofire®. all other authors do not have any conflicts of interest. acute encephalitis in immunocompetent adults epidemiology of infectious encephalitis causes in 2016 the epidemiology, clinical features, and long-term prognosis of japanese encephalitis in central sarawak results of a multinational study suggest the need for rapid diagnosis and early antiviral treatment at the onset of herpetic meningoencephalitis the neurocognitive and mri outcomes of west nile virus infection: preliminary analysis using an external control group in search of encephalitis etiologies: diagnostic challenges in the california encephalitis project causes of encephalitis and differences in their clinical presentation in england: a multicenter, population-based prospective study challenge of the unknown. a systematic review of acute encephalitis in non-outbreak situations herpes simplex virus encephalitis use of testing for west nile virus and other arboviruses the management of encephalitis: clinical practice guidelines by the infectious diseases society of america management of suspected viral encephalitis in adults -association of british neurologists and british infection association national guidelines consensus guidelines for the investigation and management of encephalitis case definitions, diagnostic algorithms, and priorities in encephalitis: consensus statement of the international encephalitis. consortium guidelines on the management of infectious encephalitis in adults meningitis with a negative cerebrospinal fluid gram stain in adults: risk classification for an adverse clinical outcome focal encephalitis following varicellazoster virus reactivation without rash in a healthy immunized young adult anti-nmda receptor encephalitis: report of ten cases and comparison with viral encephalitis adult herpes simplex encephalitis: fifteen years' experience outcome of and prognostic factors for herpes simplex encephalitis in adult patients: results of a multicenter study atypical manifestations and poor outcome of herpes simplex encephalitis in the immunocompromised predictors of outcome in acute encephalitis clinical metagenomic sequencing for diagnosis of meningitis and encephalitis we want to thank mr. and mrs. starr for their continued support of our research. key: cord-295189-bz3gi15h authors: jennings, lance c.; priest, patricia c.; psutka, rebecca a.; duncan, alasdair r.; anderson, trevor; mahagamasekera, patalee; strathdee, andrew; baker, michael g. title: respiratory viruses in airline travellers with influenza symptoms: results of an airport screening study date: 2015-03-14 journal: j clin virol doi: 10.1016/j.jcv.2015.03.011 sha: doc_id: 295189 cord_uid: bz3gi15h background: there is very little known about the prevalence and distribution of respiratory viruses, other than influenza, in international air travellers and whether symptom screening would aid in the prediction of which travellers are more likely to be infected with specific respiratory viruses. objectives: in this study, we investigate whether, the use of a respiratory symptom screening tool at the border would aid in predicting which travellers are more likely to be infected with specific respiratory viruses. study design: data were collected from travellers arriving at christchurch international airport, new zealand, during the winter 2008, via a symptom questionnaire, temperature testing, and respiratory sampling. results: respiratory viruses were detected in 342 (26.0%) of 1313 samples obtained from 2714 symptomatic travellers. the most frequently identified viruses were rhinoviruses (128), enteroviruses (77) and influenza b (48). the most frequently reported symptoms were stuffy or runny nose (60%), cough (47%), sore throat (27%) and sneezing (24%). influenza b infections were associated with the highest number of symptoms (mean of 3.4) followed by rhinoviruses (mean of 2.2) and enteroviruses (mean of 1.9). the positive predictive value (ppv) of any symptom for any respiratory virus infection was low at 26%. conclusions: the high prevalence of respiratory virus infections caused by viruses other than influenza in this study, many with overlapping symptotology to influenza, has important implications for any screening strategies for the prediction of influenza in airline travellers. there is very little known about the prevalence and distribution of common respiratory viruses in air travellers. the dissemination of novel human respiratory viruses by air travellers is well established. the introduction of sars into vietnam occurred by a businessman travelling by air from china through hong kong sar [1] . subsequent dissemination from hong kong to singapore, beijing, germany, canada and other countries by air travellers led to outbreaks of infection occurring [2, 3] . since, the first cases of mers-cov were reported in september 2012, limited transmission to european and other countries has occurred by international travelers returning from the middle east [4] . the rapid global spread of the novel influenza a(h1n1) pdm09 virus after first being detected in southern california in late april 2009 was also likely to have been via air travellers [5] . the first identification of the virus in new zealand in april 2009 was in high school students returning by air from mexico [6] . similarly, studies on international travelers arriving in australia in may 2009 [7] and on medical students returning to spain in june 2009, demonstrated outbreaks among the study group and their contacts [8] . while, these and previous reports documenting seasonal influenza among air travelers [2, [9] [10] [11] have focused primarily on the in-flight transmission of influenza, clearly air travellers are responsible for the introduction of influenza viruses into countries on an ongoing basis [12] . there are few reports of the dissemination of other respiratory viruses by air travellers. a mixed outbreak of parainfluenza type 1 and influenza b viruses was reported among tourists returning to the united states [13] , while an investigation of travelers by follin et al. reported the identification of rhinovirus, coronavirus, influenza a and b, parainfluenza virus, adenovirus, metapneumovirus and enterovirus in passengers with influenza-like illness (ili) [14] . with the emergence of the mers-cov, possible introduction by hajj pilgrims with a high rate of respiratory symptoms returning to france have been investigated with no cases identified [15] . in a 2008 study, we sought to assess the prevalence of influenza infection in symptomatic and asymptomatic arriving international airline travellers and whether using a symptom-screening questionnaire and temperature measurement could reliably predict seasonal influenza infection [16] . we tested symptomatic travellers for a range of other respiratory viruses and asked them to report their symptoms. in this study, we describe the spectrum of symptoms associated with infection with respiratory viruses in arriving airline travellers. we ascertain whether, the use of symptom screening at the border would aid in predicting which travellers are more likely to be infected with specific respiratory viruses. this assessment of the prevalence of other respiratory virus infections in arriving airline travellers was carried out at christchurch international airport, new zealand, from 23 june to 12 september 2008. a questionnaire on basic demographics and symptoms was distributed on board three airlines' flights from australia to christchurch, new zealand [17] . all symptomatic travellers (defined as those reporting at least one of cough, sore throat, sneezing, fever or chills, runny or blocked nose, muscle aches or pains, feeling generally unwell, chest discomfort or breathing difficulties) who completed the questionnaire were identified as they arrived at the airport and went through immigration ( fig. 1) , and following informed consent, were asked to provide a nose and throat swab and have their temperature measured. this paper reports on specimen results from these symptomatic travelers. all combined throat and nasal swab samples (copan, italy) were analysed at canterbury health laboratories, christchurch, new zealand. influenza a and b viruses were tested using a commercial easyplex ® multiplexed tandem pcr (mt-pcr) as described by the manufacturer (easyplex ® influenza a + b kit, cat no. 3005.01, ausdiagnostics, sydney, australia). the other respiratory viruses were tested using a similar commercial mt-pcr system (easyplex, respiratory panel 12c, cat no: 6062.1 ausdiagnostics, specifically manufactured for the study). picornaviruses were confirmed as either rhinoviruses or enteroviruses using two in-house singleplex pcr assays [18] [19] [20] . data were entered into microsoft excel and all statistical tests were conducted using stata 11. chi 2 tests were used to identify significant patterns in age or nationality by virus type. influenzalike illness was defined as a measured fever ≥37.8 • c and either a cough or sore throat [21] . for each demographic characteristic and each symptom, the prevalence of infection with each virus among participants with that characteristic was calculated. this is equivalent to the positive predictive value (ppv) of that characteristic for that virus. for participants infected with each virus, the number and proportion with each symptom and the mean number of symptoms were calculated to illustrate the pattern of symptoms associated with each virus. proportions and confidence intervals around means were calculated for groups with more than 10 participants. of 2714 symptomatic travellers, 49% agreed to provide a respiratory sample, 1331 respiratory samples were obtained, of which 1313 were valid and able to be tested for respiratory viruses. table 1 characteristics of study population and infection status a among 1313 symptomatic airline travellers from whom valid respiratory samples were obtained. b three people with a virus named above plus an "other" virus appear only in the named virus column. c ili indicates patient had a temperature ≥37.8 • c plus cough or sore throat. signs and symptoms a column numbers may not add to column total due to missing information. b three people with a virus named above plus an "other" virus appear only in the named virus column. c ili indicates patient had a temperature ≥37.8 • c plus cough or sore throat. forty-nine percent of participants were male and 51% were female, with an age range 0 to 85 years and median of 34 years. most were australians (42%) or new zealanders (40%), with some british (6%) and american (2%) ( table 1) . most study participants (971; 74%) had no detectable respiratory virus. this ranged from 58% in those ≥75 years to 80% in those aged 45-54. a respiratory virus was detected in 342 (26.0%) participants. of these, influenza virus was detected in 55 (4%) and another respiratory virus in 287 (22% the range of symptoms reported and prevalence of respiratory virus infection among participants with each symptom is shown in table 1 , for the more common viruses. although 51 (4%) participants reported fever, only 14 (1%) had a measurable fever at ≥37.8 • c. the most frequently reported symptoms were stuffy or runny nose (60%), cough (47%), sore throat (27%) and sneezing (24%). for individual symptoms, the proportion of symptomatic participants who were infected with any respiratory virus was between 22% (muscle aches and pains) and 43% (self-reported fever). although based on small numbers, this proportion was higher for measured temperature ≥ 37.8 • c (8/14, 57%), and ili (8/13, 62%). of those with ili, 5/13 (38%) were infected with influenza b (table 1) . table 2 shows the pattern of symptoms associated with each identified respiratory virus (other than picornaviruses which could not be confirmed as either an enterovirus or rhinovirus). of the viruses where there were at least 10 cases, influenza b was associated with the highest number of symptoms (mean of 3.4). for study participants with enterovirus infection, the most common symptom was a stuffy or runny nose (69%). this was also the most common symptom reported among those infected with rhinovirus (76%). as well, 52% of those with rhinovirus reported cough. those infected with influenza b most frequently reported cough (85%), stuffy or runny nose (63%), and sore throat (52%). only 10% had a temperature of ≥37.8 • c and 23% reported "fever" subjectively. in this study, during the winter of 2008, 1313 samples were obtained from 2714 symptomatic travellers arriving into christchurch, new zealand on flights from australia, and tested 11 (9) 36 (28) 16 (13) 8 (6) 4 (3) 2 (2) for respiratory viruses. the most frequently identified viruses were rhinoviruses followed by enteroviruses and influenza b viruses. the respiratory symptoms reported by symptomatic travellers during on board screening were diverse with a stuffy nose (60%), cough (47%) and sore throat (27%) being the most common. an aim of this study was to determine whether the use of symptom screening at the border would aid in predicting which travellers are more likely to be infected with a respiratory virus. however, a respiratory virus was detected in only 26.0% of these symptomatic participants sampled, i.e., the positive predictive value (ppv) of 'any symptom' for the prediction of a traveller with infection by 'any respiratory virus' was low at 26%. in this group who had at least one symptom, for individual symptoms associated with the most frequently identified viruses, the ppv for any respiratory virus was low; stuffy nose (31%), cough (29%) and sore throat (33%). ili (>37.8 • c plus cough or sore throat) had the highest ppv (69%); however, infections were largely with influenza virus and the numbers were small. we have previously estimated the prevalence of influenza in all travellers (symptomatic and asymptomatic) during the 'influenza season' period of high prevalence at 1.13% [22] . the ppv for influenza infection of 'any symptom' was 5.5%, and of ili was 24.7%. this study suggests that the use of symptoms as indicators of other respiratory virus infection, as well as influenza infection, in travellers is problematic. the major strengths of this study are the novel study design involving large numbers of arriving international airline travellers and the relatively high proportion (49%) of symptomatic travellers willing to provide respiratory samples for respiratory virus testing [17] . essentially, these were a random sample of passengers, with a similar sex distribution and wide age distribution, although the numbers of samples obtained from children 0 to 15 years and elderly 75+ years was smaller than for all other age groups. this is also one of the few studies where molecular techniques have been applied to the detection of a range of 13 common respiratory viruses in airline travellers. as culture was not performed on these samples, we are unable to comment on the infectiousness of these travellers and the potential transmissibility of their viruses on entering a community. a limitation of the study was the non-testing of asymptomatic travellers which did not allow estimates of the prevalence of noninfluenza respiratory viruses to be made [22] . a further limitation was the recovery of a virus from only 26% of the symptomatic travellers, which is lower than might be expected from other studies of populations with respiratory infection symptoms. few identifications of coronavirus or metapneumovirus were made, an observation also made in a previously healthy adult population during the winter influenza season [23] . coronaviruses −nl63 and −hku1 have been found to be present in higher numbers than coronavirus −229e or -oc43, however these viruses were not tested for in this study [24] . we have also found that there is variation in analytical agreement between molecular assays and that the easyplex assay used in this study may have had a reduced sensitivity for the detection of both metapneumovirus and bocavirus [20] . the collection of nasal and throat swabs rather than nasopharyngeal swabs, although pooled together may have been suboptimal, even though sensitive fully evaluated molecular techniques were used in this study [20] . it is also likely that, the commonest reported symptom (stuffy nose) might in some cases have been caused by the airline travel itself rather than infection. a wide range of viruses were detected, however, only three virus types were detected in more than 10 travellers. consequently, we could not draw conclusions on the association of symptoms with the virus types identified other than for rhinoviruses, enteroviruses and influenza viruses. even in a study of 155 travellers meeting a who case definition of suspected or probable sars (fever plus cough or difficulty breathing), a pathogen was only detected in 43.2% of cases [25] . enrolment of a substantially larger number of symptomatic but otherwise healthy travellers would be required to identify any additional predictive potential of their symptoms. the use of symptomatic predictors to identify which respiratory infections were caused by viral infections have largely focused on influenza viruses in a number of surveillance and clinical study settings. symptomatic predictors were initially believed to be problematic because the symptoms of many illnesses were very similar. even though fever and cough were most frequently identified in association with influenza infections, surveillance data were often obtained over long periods with varying levels of influenza virus activity, resulting in a low ppv for these symptoms for influenza virus infection [26] . the use of antiviral trial data where subjects were enrolled with ili during the influenza season found that fever (temperature ≥37 • c) and cough when used as predictors during periods of influenza virus prevalence had a ppv of up to 79% in adults [27] [27] . in children ≥5 years, fever (temperature ≥38 • c) and cough resulted in a ppv of 83% [26] . interestingly, in adults it was found there was little advantage of measuring other symptoms [27] . the current study was carried out in a relatively low influenza prevalence population (4% of symptomatic travellers) resulting in a low influenza ppv for fever and ili (fever and cough or sore throat). the symptom profiles over the course of common colds, up to 50% of which are caused by rhinoviruses, have been well established in otherwise healthy adults [28] and more recently in school-children [29] . common symptoms of rhinovirus infection in children include a runny nose, nasal obstruction and cough, with 50% of children reporting these during the first 5 days of illness. in adults, only a runny nose was reported in 50% of illnesses, persisting through day 4, indicating that the symptom profiles differs between children and adults, and over the course of the illness [29] . in our study, the most common symptoms recorded were a stuffy or runny nose in 69% of travellers with an enterovirus infection and 76% with a rhinovirus infection. as well, 52% of those with rhinovirus reported cough, which was the most frequently reported symptom in those infected with influenza b (85%). these symptoms were recorded at a single time point and the stage of the illness after symptom onset of each illness was not recorded. even with rhinoviruses, the most prevalent virus detected in this study, the symptoms generated are clearly shared by different viruses suggesting that it is not possible to identify this virus on the basis of symptoms. there was a substantial overlap in the symptom profiles between the respiratory viruses found in the study participants. the mean number of symptoms reported by on board screening was highest for those with influenza b (3.4; ci 2.7-4.0) followed by rhinovirus (2.2; ci 2.0-2.5) and enterovirus (1.9; ci 1.6-2.3). it is unlikely that, symptoms alone can be used to predict infections with specific respiratory viruses. in the meantime, we should continue to learn as much as possible about potential screening tools so that their potential role, and strengths and weaknesses, are more fully understood. the high prevalence of respiratory virus infections caused by viruses other than influenza in this study, many with overlapping symptoms to influenza, has important implications for any screening strategy for the prediction of influenza in airline travellers. on the basis of clinical symptoms alone it will be very difficult to distinguish influenza from other common respiratory viral infections. this work was supported by the centers for disease control and prevention, united states [grant number 1 u01ci000445-01]. this study was approved by the new zealand health and disability multiregion ethics committee (mec/06/12/172). confronting the new challenge in travel medicine: sars transmission of infectious diseases during commercial air travel transmission of the severe acute respiratory syndrome on aircraft world health organization. mers-cov update summaries spread of a novel influenza a (h1n1) virus via global airline transportation transmission of pandemic a/h1n1 2009 influenza on passenger aircraft: retrospective cohort study transmission of influenza on international flights pandemic influenza a(h1n1) outbreak among a group of medical students who traveled to the dominican republic an outbreak of influenza aboard a commercial airliner an outbreak of influenza a/taiwan/1/86 (h1n1) infections at a naval base and its association with airplane travel outbreak of influenza-like illness [corrected] related to air travel latitudinal patterns of travel among returned travelers with influenza: results from the geosentinel surveillance network mixed outbreak of parainfluenza type 1 and influenza b associated with tourism and air travel a variety of respiratory viruses found in symptomatic travellers returning from countries with ongoing spread of the new influenza a(h1n1) v virus strain. euro surveillance: bulletin europeen sur les maladies transmissibles lack of nasal carriage of novel corona virus (hcov-emc) in french hajj pilgrims returning from the hajj 2012, despite a high rate of respiratory symptoms thermal image scanning for influenza border screening: results of an airport screening study screening for influenza infection in international airline travelers real-time rt-pcr detection of 12 respiratory viral infections in four triplex reactions incidence and characteristics of viral community-acquired pneumonia in adults comparison of four multiplex pcr assays for the detection of viral pathogens in respiratory specimens influenza activity-united states effectiveness of border screening for detecting influenza in arriving airline travelers characterization of viral agents causing acute respiratory infection in a san francisco university medical center clinic during the influenza season coronavirus hku1 and other coronavirus infections in hong kong spectrum of viruses and atypical bacteria in intercontinental air travelers with symptoms of acute respiratory infection symptomatic predictors of influenza virus positivity in children during the influenza season clinical signs and symptoms predicting influenza infection rhinovirus infections in an industrial population ii characteristics of illness and antibody response symptom profile of common colds in school-aged children we thank the christchurch international airport limited, new zealand customs service, the participating airlines and passengers for their cooperation and assistance and technical assistance of canterbury health laboratories virology staff. key: cord-268093-ta6k0uyz authors: etemadi, mohammad reza; othman, norlijah; savolainen-kopra, carita; sekawi, zamberi; wahab, noraabd; sann, lye munn title: biodiversity and clinico-demographic characteristics of human rhinoviruses from hospitalized children with acute lower respiratory tract infections in malaysia() date: 2013-08-07 journal: j clin virol doi: 10.1016/j.jcv.2013.05.017 sha: doc_id: 268093 cord_uid: ta6k0uyz background: there is accumulating evidence that human rhinovirus (hrv) causes acute lower respiratory tract infections (alrti). recently, hrv-c was identified as a new species of hrv, but its spectrum of clinical disease is not well understood. objectives: we investigated the molecular epidemiology, demographic and clinical characteristics of hrvs among hospitalized children with alris. study design: one hundred and sixty-five nasopharangeal aspirates taken from children <5 years hospitalized with alrtis in serdang hospital, malaysia, were subject to reverse transcriptase-pcr for hrv. phylogenetic analysis on vp4/vp2 and 5′-ncr regions was used to further characterize hrv. other respiratory viruses were also investigated using semi-nested multiplex rt-pcr assay. clinical parameters were analyzed between hrv, rsv and ifv-a mono-infections and between hrv species. results: hrv was detected in 54 (33%) patients for both single (36 samples) and multiple (18 samples) infections, 61.1% (22/36) represents hrv-a strains while the remaining 14 hrv-c. strain p51was the first reported representative of hrv98. the majority of the single hrv cases were in the second half of infancy; hrv-c occurred among older children compared with hrv-a. hrv children were admitted significantly earlier and less febrile than rsv and ifv-a infection. hrv-c infected children were more likely to have rhonchi and vomiting as compared to hrv-a. pneumonia was the most common discharge diagnosis followed by bronchiolitis and post-viral wheeze in hrv patients. conclusion: our study showed high prevalence of hrvs and detection of hrv-c among hospitalized children with alrtis in malaysia. analysis of clinical parameters suggested specific features associated with hrvs infections and specific hrv groups. sequences in genomic databases revealing greater association of hrvs with serious alrtis such as deadly pneumonia [3] [4] [5] [6] [7] . the presence of the new hrv-c strain in severe respiratory disease has further instilled research interest in the clinical impact, molecular biology and epidemiology of hrvs. as research of hrv is limited [8] , especially in asian developing countries, this study aims to examine the molecular epidemiology, the demographic characteristics and clinical features including the newly discovered hrv-c species, among hospitalized children less than 5 years of age with alrti in malaysia. a study was conducted among children more than one-monthold and less than 5 years of age with the diagnosis of alrti to the pediatric wards at hospital serdang, selangor, malaysia, from june 16 to december 21, 2009 , after obtaining approval from both the medical research and ethics committee (mrec) of the ministry of health malaysia and university putra malaysia. selection of subjects was based on predetermined inclusion and exclusion criteria. children who met the final diagnosis for alrti had at least 3 of the following: fever, tachypnoea, cough, auscultation findings indicative of lower respiratory disease (including rhonchi, crackles, or bronchial breath sounds) and/or chest retraction supported with chest radiographic changes, if available, were included and if nasopharangeal specimens were collected within 24 h of admission. children who had one of the followings were excluded from the study: congenital or acquired immunosuppressive conditions and patients with conditions posing a potential hazard in obtaining the nasopharyngeal samples. a standardized study protocol was developed to record demographic and medical history of the patients, clinical features including symptoms and signs, outcome of the illness and hospital course, and laboratory and radiological findings. at the end of the hospitalization, the children's charts were reviewed by four of the co-investigators and the clinical diagnosis was determined by the principal investigator. the clinical diagnosis was categorized into pneumonia, bronchiolitis, and post-viral wheeze. during the first 24 h of admission, nasopharyngeal aspirates (npa) were taken from each patient. viral genome was extracted using magmax viral rna isolation kit (applied biosystems, ca, usa). detection of hrv was performed via reverse transcription on rna extracts using revertaid h minus first strand cdna synthesis kit (fermentase, usa). pcr was performed for all the samples using primers that amplified a fragment encompassing the vp4/vp2 region and the hyper-variable region in the 5 -ncr of human rhinoviruses [9] . both strands of pcr products were sequenced using abi 3730 xl dna analyzer (applied biosystems). specimens were also being tested for respiratory syncytial virus (rsv), human metapneumovirus (hmpv), influenza virus (ifv) type a and b, parainfluenzavirus 1-4 (piv1-4), coronaviruses (hcov) oc43 and 229e [10] , human bocavirus (hbov) and human adenovirus (hadv) using pcr [11, 12] . raw sequence data were analyzed using vector nti suite 10 (invitrogen corp., carlsbad, ca, usa), assembled using contig express and aligned using alignx software. multiple sequence alignments were made utilizing mega4 software [13] with default parameters followed by manual editing. phylogenetic tree was estimated with mega4 using neighbor-joining method [14] with maximum composite likelihood model with 1000 bootstrap replicates [15] . the nucleotide and deduced amino acid sequences of the vp4/vp2 regions were compared with those of hrv-a, hrv-b and hrv-c strains using reference sequences available in the genbank using blast (basic local alignment search toolhttp://blast.ncbi.nlm.nih.gov/). the sequences generated in this study were submitted to genbank under accession numbers hm044162 to hm044201. demographic and clinical parameters were compared between hrv, rsv, and ifv-a mono infections and also among hrv species. pearson chi-square or fisher's exact test were used for categorical variables. the student's independent sample ttest or non-parametric mann-whitney u test, anova tests or kruskal-wallis test were applied for continuous variables where it's applicable. all analyses were performed using spss version 16.0. p-values of <0.05 were considered statistically significant. a total of 165 children <5 years of age who fulfilled the inclusion criteria were enrolled in the study. rsv (49/165, 29.7%) was found to be the main single virus detected from the study population, followed by hrv (36/165, 21.8%) and ifv-a (10/165, 6.1%). multiple hrv infections were found in 18 samples (10.9%), including 14 in dual and 4 in triple infections as shown in table 1 . of these, dual infection of hrv and rsv (11/18, 61.1%) was the most prevalent multiple infection recorded. in total, 54 out of 165 (32.7%) samples were found infected with hrv. out of 36 hrv single infections, 25 (69.4%) were male. the mean age of hrv patients was 11.8 ranging from 2.0 to 45.1 months. they were older than children infected with rsv and younger than ifv-a patients (mean age of 9 and 12.7 months respectively). the mean age of hrv-c infections was significantly higher than hrv-a infections (16.3 vs. 7.1 months). the majority of the hrv-a infections were found in children of 6-11 months of age; while the peak age of patients hospitalized with hrv-c was 12-23 months. the clinical features of children infected with hrv, rsv and ifv-a are shown in table 2 . hrv infected patients were admitted earlier compared to rsv and influenza; children with hrv presented to the hospital after a mean duration of 1.9 days (ranged 1-9 days) as compared with hrv (4.0 days, p = <0.001) and ifv-a (4.8 days, p = 0.002). in terms of respiratory features, there were no distinctive differences among the three infections. however, fever occurred less often in hrv infections than in rsv and ifv-a. temperature equal or above 38 • c was presented in 17% of hrv as compared with 33% of rsv and 30% of ifv-a infections. majority of the hrv patients were hospitalized for shorter duration and received less antibiotic, particularly in comparison to rsv. disease severity characterized by need of oxygen, admission to intensive care unit (only one case of hrv) and prolonged hospital stay did not differ among the studied virus groups. diarrhea was less common in hrv single infections as compared with ifv-a (8.3% vs. 40%, respectively, p = 0.031). leukocytosis occurred significantly more frequently in hrv single infections than in rsv (p = 0.035). differential count showed neutrophilic predominance in hrv compared with rsv patients (p = 0.015). pneumonia was the most common discharge diagnosis among hrv patients followed by bronchiolitis and post-viral wheeze. vomiting occurred almost two times more with hrv-c 151 infection (p = 0.036), as shown in table 3 . hrv-c patients were more likely to present with rhonchi in comparison to hrv-a (86% vs. 47%, respectively, p = 0.024). the study also showed that hrv-c patients tended to have a higher neutrophil count (p = 0.032) while lymphocytosis was associated with hrv-a (p = 0.009). post-viral wheeze was more common with hrv-c infections. disease severity characterized by need of oxygen, admission to intensive care unit (only one case of hrv) and prolonged hospital stay did not differ among the studied species. hrv single infections were subjected to sequencing as the study aimed at looking into different variables of the single infections. thirty-three of 36 hrv single samples were retrieved in sequencing. additionally three hrv samples co-infected with other viruses were also sequenced. all 36 genetically typed hrv strains (1). we found that 14 (39%) of the samples were clustered in the separate clad distinct from hrv-a and hrv-b, along with representative strains of hrv-c (fig. 2) . hrv-b strains were not among the typed strains. the nucleotide similarities to closest prototype strain in hrv-a, varied from 85.1% to 95.0%, while the closest genetic relatives were observed with a variation range of 91.2% to 99.8%. the respective hrv-c strain similarities varied from 87.5% to 98.9%. genetic analysis used for typing revealed four human enterovirus (hev) strains in species hev-b, hev-c and hev-d. however, it should be noted here that the vp4/vp2 region used for genetic typing of hrv strains does not unequivocally allow typing of hev strains due to greater sequence similarity between strains within species. a significant burden of hrv infection, was found in 54 out of 165 patients (33%), and this concurs with previous studies with a rate varying from 26% to 33% in a hospitalized pediatric patient [8, [16] [17] [18] [19] [20] . this contradicts with the traditional notion that hrv is only associated with upper respiratory tract infections. earlier studies indicated that the clinical value of positive pcr is somewhat disputable among patients with alrti [3, 7, 19, 21] as asymptomatic hrv infections is known to occur in 15-30% of individuals. several subsequent clinical studies of small numbers of selected patients showed that hrv can replicate in lower respiratory tract. this finding concluded that detection of hrv especially in children less than 2 years does not simply represent asymptomatic infection but is related to true infection [7, 22] . in addition, the ability of hrv to infect lower respiratory airways and to induce cytotoxicity to bronchial epithelium has been shown experimentally among immunocompetent individuals [18] . in this study the most prevalent combination was found between hrv and rsv. the combination of hrv and rsv as a main double infection has been reported by others [16, 18, 23, 24] . high incidence of hrv coupled with rsv infection could be explained by the substantial overlapping of monthly distribution observed for these 2 viruses during the study period [23] . the relatively recent application of molecular study of pcr based methods for hrv has identified several novel hrvs, including hrv-c. our study showed that hrv-b was absent while hrv-a predominates from hrv-c. this finding seems to reinforce that hrv-b is a minor species worldwide; however it concurs with most findings by other investigators as hrv-a was the most prevalent compared to the other species. this may reflect apparent seasonality or yearly variation of circulating hrv. on the other hand, it may be associated with hrv-b of a milder form of disease presentation and consequent of lesser rate of hospitalization. consistent with other findings, our study showed that hrv infected children are older than those with rsv infections and younger than those with ifv-a infections [25, 8] . the results support the importance of hrv infections among infants with acute respiratory infections [3, 22] especially in its second half. hrv-a infections were more likely to occur during infancy as compared with hrv-c, further corroborating the findings that hrv-a infections are less prevalent in older age group as compared with hrv-c [26, 27] . few studies have described the clinical characteristics of hrv alri in infants and young children. our study revealed that hrv infected children were hospitalized earlier in the course of their disease and were less febrile on presentation as compared to rsv and ifv-a infections. they were also more likely to be discharged earlier and tend to receive lesser antibiotics as compared to the other two infections, especially to rsv. hrv is known to have a shorter incubation period and hence presented earlier as compared with hrv or occasionally with ifv-a especially with h1n1 infection. this could be explained further in terms of the cytopathology on the respiratory epithelial cells as hrv is the least invasive with minimal cell damage and secondary bacterial infection is far less a complication compared to rsv and ifv. as a result, patients were subjected to lesser antibiotics and stayed shorter in the hospital as seen in this study. however, neutrophilia as documented in the present study may not reflect secondary bacterial infection in hrv. several studies in the past, acknowledged the increase infection in both peripheral and airway neutrophils as a risk to development of asthmatic exacerbations. on the other hand, ifa-a infection tended to be associated with diarrhea, as the infection usually resulted in table 3 clinical characteristics of hrv-a and hrv-c single infections. a more systemic involvement with direct invasion of the gastrointestine by the virus [28] . this study further distinguishes certain clinical features of the two species of hrv in alrti. although in general, the clinical presentations were comparable for both hrv-a and c, rhonchi and vomiting were more common in hrv-c infected children as compared to hrv-a. in our study, the presence of rhonchi was associated with alrti rather than asthma, as only one had asthma as an underlying disease. as shown in previous studies, this finding further supports the role of hrv-c among patients with febrile wheeze in alrti. a large clinical cohort study indicated that this group of children has a preexisting predisposition to asthma in early childhood. on the other hand, vomiting has not been reported in other studies as a prominent presentation in hrv-c. vomiting with coughing is common in children (post-tussive vomiting) and it could be related to the wheezing episodes in our study and indicate a more severe form of infection in hrv-c as compared to hrv-a. likewise, no characteristic laboratory finding has been associated previously with any specific hrv species; the modest increase in lymphocytes in hrv-a and neutrophils in hrv-c in our study could be coincidental and probably of no clinical importance. consistent with the study by jin [29] , there was no significant difference in terms of disease severity for both species of hrv. on the other hand, miller [8] found that hrv-c patients were more likely to require supplemental oxygen than hrv-a. the variations could be partly attributed to bacterial co-infections, viral load and type of the studied population. therefore, these data must be interpreted with some caution. several different types were detected including outbreak-like clusters, e.g. hrv12. phylogenetic analysis confirmed global prevalence of hrv-c strains. this study showed the large variation of concomitantly circulating hrv strains as reported previously [30] . due to increased sequence typing efforts during recent years, most of the hrv strains of this study were shown to have very close genetic relatives circulating in other geographical areas. in this study, hrv has been implicated as a cause of hospitalization in children with alrti in our locality. the dominant presence of both hrv-a and c concurs with global epidemiologic studies in other parts of the world. there were also some differences between the demographic variables, clinical manifestations and laboratory findings of hrv, rsv and ifv-a infections and within the hrv species. however, corroboration of the clinical significance and its pathogenesis will require larger numbers of subjects and should include a control group with no respiratory infection. the study could not be generalized as only it involved small numbers and in-patients are involved. a prospective longitudinal multicenter population based studies, utilizing quantitative pcr methods, are needed to better explore and understand the role of hrv in alrtis. this work was partially supported by grants from the ministry of science, technology and innovation malaysia (grant number 5450401). the isolation of a new virus associated with respiratory clinical disease in humans masstag polymerase-chain-reaction detection of respiratory pathogens, including a new rhinovirus genotype, that caused influenza-like illness in new york state during role of respiratory viruses in acute upper and lower respiratory tract illness in the first year of life a birth cohort study etiology of community-acquired pneumonia in 254 hospitalized children etiology of communityacquired pneumonia in hospitalized school-age children: evidence for high prevalence of viral infections etiology of community-acquired pneumonia in hospitalized children based on who clinical guidelines rhinoviruses are a major cause of wheezing and hospitalization in children less than 2 years of age human rhinovirus c associated with wheezing in hospitalised children in the middle east genetic clustering of all 102 human rhinovirus prototype strains: serotype 87 is close to human enterovirus 70 development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses molecular typing of human adenoviruses by pcr and sequencing of a partial region of the hexon gene cloning of a human parvovirus by molecular screening of respiratory tract samples molecular evolutionary genetics analysis (mega) software version 4.0 the neighbor-joining method: a new method for reconstructing phylogenetic trees an empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis detection of viruses identified recently in children with acute wheezing clinical and molecular epidemiology of human rhinovirus c in children and adults in hong kong reveals a possible distinct human rhinovirus c subgroup association of rhinovirus infection with increased disease severity in acute bronchiolitis rhinovirus infections in children: a retrospective and prospective hospital-based study rhinovirus-associated hospitalizations in young children clinical effects of rhinovirus infections respiratory picornaviruses and respiratory syncytial virus as causative agents of acute expiratory wheezing in children mixed respiratory virus infections the impact of dual viral infection in infants admitted to a pediatric intensive care unit associated with severe bronchiolitis rhinovirus-associated wheezing in infancy: comparison with respiratory syncytial virus bronchiolitis a novel group of rhinoviruses is associated with asthma hospitalizations high prevalence of human rhinovirus c infection in thai children with acute lower respiratory tract disease influenza virus a2 infections presenting with febrile convulsions and gastrointestinal symptoms in young children prevalence and clinical characterization of a newly identified human rhinovirus c species in children with acute respiratory tract infections phylogenetic analysis of rhinovirus isolates collected during successive epidemic seasons we would like to extend our appreciation to the director of health for allowing us to carry out the above study. we are also grateful to all the doctors and nurses of the pediatric department, hospital serdang for extending their kind assistance in facilitating the study. we thank dr. sharifah aishah, the radiologist for her expertise in the interpretation and reporting of the radiographs. the authors involved in this study have no conflicts of interest to declare. approval was from both the medical research and ethics committee (mrec) of the ministry of health malaysia and university putra malaysia. informed consent was obtained from cares of the patients. key: cord-268830-8li6xhbu authors: kozak, robert; prost, karren; yip, lily; williams, victoria; leis, jerome a.; mubareka, samira title: severity of coronavirus respiratory tract infections in adults admitted to acute care in toronto, ontario date: 2020-03-29 journal: j clin virol doi: 10.1016/j.jcv.2020.104338 sha: doc_id: 268830 cord_uid: 8li6xhbu background: the world health organization has highlighted the need for improved surveillance and understanding of the health burden imposed by non-influenza rna respiratory viruses. human coronaviruses (covs) are a major cause of respiratory and gastrointestinal tract infections with associated morbidity and mortality. objectives: the objective of our study was to characterize the epidemiology of covs in our tertiary care centre, and identify clinical correlates of disease severity. study design: a cross-sectional study was performed of 226 patients admitted with confirmed cov respiratory tract infection between 2010 and 2016. variables consistent with a severe disease burden were evaluated including symptoms, length of stay, intensive care unit (icu) admission and mortality. results: covs represented 11.3% of all positive respiratory virus samples and oc43 was the most commonly identified cov. the majority of infections were community-associated while 21.6% were considered nosocomial. the average length of stay was 11.8 days with 17.3% of patients requiring icu admission and an all-cause mortality of 7%. in a multivariate model, female gender and smoking were associated with increased likelihood of admission to icu or death. conclusion: this study highlights the significant burden of covs and justifies the need for surveillance in the acute care setting. human coronaviruses (covs) are a significant cause of communityacquired respiratory tract infections. the symptoms associated with cov infection were first described over four decades ago [1] , and can range from relatively mild upper-to more severe lower-respiratory tract infections with increased severity in certain patient populations [1, 2] . it has been reported that immunocompromised patients, particularly hematopoietic cell transplant recipients, are at increased risk of lower respiratory tract infections, prolonged viral shedding and mortality, often comparable to what is seen with influenza virus [3, 4] . similar to other non-influenza respiratory viruses, covs are still relatively understudied despite being a common cause of hospital-and community-acquired respiratory infection [5, 6] . there is currently a paucity of canadian data on the burden of disease imparted by endemic covs, and their contribution to nosocomial respiratory virus outbreaks. this is likely due to the fact that laboratories may not routinely identify covs, and they are not generally reportable to public health agencies. thus, the world health organization (who) has highlighted the need for improved epidemiological surveillance and a better understanding of the health burden imposed by covs, as well as other non-influenza rna respiratory viruses [7] . four types of endemic covs are in current circulation, oc43, 229e, hku1, and nl63. recent findings demonstrate a seasonality for cov infections, with peak numbers being observed in the winter months [2] . however, this data is based on nationally-reported findings from the united states, and may not reflect local or national epidemiology in canada. moreover, the receptor-binding domain of the glycoprotein of 229e has undergone adaptation over the last 50 years [8] that ongoing viral evolution may influence which strains predominate from year to year. this is further supported by phylogenetic data examining oc43 isolates, which showed that the circulating genotypes in southeast asia changed over time [9] . a recent study in the midwestern usa reported frequent identification of hku1, whereas a separate study from china reported oc43 to be more prevalent [10, 11] . therefore, determining the regional prevalence is important to understand the burden of these infections. in acute care hospitals, much of the focus in diagnostics has been placed on influenza and respiratory syncytial virus (rsv) because of the severe infection and poor outcomes of hospitalized patients, yet the burden of cov in acute care is not well studied. most hospitals do not routinely test for cov resulting in gaps in our clinical and epidemiologic understanding of this virus. the predictors of severe infection are well known for cov associated with acute respiratory syndromes (eg. middle east respiratory syndrome cov, severe acute respiratory syndrome cov), yet few studies have identified these predictors for the more common four circulating cov strains such as oc43, 229e, hku1 and nl63 [12, 13] . the primary objective of this study was to describe the burden of cov among patients admitted to an acute care hospital in toronto, canada over a six-year period, and identify the predictors of severe disease. this cross-sectional study was performed at sunnybrook health sciences centre, a tertiary-care hospital with over 1300 total beds serving acutely ill and rehabilitating patients as well as long-term care residents. institutional ethics approval was obtained (reb#066-2017). the study participants included admitted patients ≥17 years of age who tested positive for a cov infection between january 1st 2010 and december 31st 2016. outpatients and residents of the affiliated longterm care facility were excluded. viral test results were obtained from nasopharyngeal (np), mid-turbinate (mt) swabs, and bronchoalveolar lavages (bals) tested as part of routine care for respiratory viruses using multiplex pcr (xtag rvp, xtag rvp fast v2 or rpp, luminex). viral targets in this assay included: influenza viruses a & b, rsv, adenovirus, rhinovirus/enterovirus, human metapneumovirus, parainfluenza viruses type 1-4 and coronavirus species oc43, 229e, nl63 and hku1. demographic and clinical data were obtained for all patients meeting inclusion criteria. cases were considered to be communityacquired if they were diagnosed within 72 h of admission and nosocomial if they were diagnosed ≥72 h after admission [14] . lower respiratory tract involvement was defined as radiographic evidence of acute disease, determined on review of radiology reports. dependent (outcome) variables were those associated with severity and burden of disease. these included: number of symptoms, presence or absence of fever, need for oxygen therapy or intubation, chest radiography changes, isolation of bacteria by conventional culture, admission to an intensive care unit (icu), number of days spent in the icu, antimicrobial and antiviral use, length of stay in hospital and death. independent variables included coronavirus strain (oc43 vs. non-oc43), gender, smoking status (not a smoker, previously a smoker, current smoker), and age. the age variable was converted into a categorical variable with three categories including: less than 60 years of age, patients between 61 and 80 years of age, and patients over 80 years of age. the chi-squared/fisher's exact test, kruskal wallis, mann-whitney and unpaired t-tests were used to assess the presence of statistically significant correlations between dependent and independent variables. statistically significant correlations were included in univariable logistic or non-parametric regression analyses to evaluate the predictive ability of the independent variable. a bivariate and a multivariate logistic regression analysis were also performed including the following variables: age, smoking status (current or previous smoker vs. non-smoker), viral strain (oc43 vs. non-oc43), nosocomial vs. community acquired infection, gender, and number of comorbidities (3 or more vs. less than 3). statistical analysis was performed using sas university edition (sas institute, cary, nc, usa). during the study period, 5038 samples were positive for a respiratory virus of which 11.3 % (n = 569) were positive for cov representing the third most frequently identified pathogen after influenza viruses and rhinoviruses/enteroviruses (fig. 1a) . it was noted that infections were identified year-round, but the peak number of cases occurred between november and february each year (data not shown). the number of cov infections increased between 2010 and 2016 ( fig. 1c) . from these samples, 226 patients met study inclusion criteria. amongst the covs, the most frequently identified strain was oc43, representing 50 % (n = 285) of covs, followed by 229e (22.3 %, n = 127), hku1 (13.9 %, n = 79) and nl63 (13.7 %, n = 78) (fig. 1b) . the age of patients spanned from 18 to 99 years old and the median age was 77 (table 1) . additionally, the distribution of cases was similar between males and females (44.7 % vs. 55.3 %). as shown in table 1 , comorbidities were common amongst our cohort, with vascular, cardiac and pulmonary comorbidities being the most frequently reported. only 3.1 % of patients were current smokers, and 12.8 % were former smokers. community-acquired infections accounted for 78.3 % (n = 177) of cases, and nosocomial infections accounted for 21.6 % (n = 49). symptoms included cough (48.6 %, n = 110), shortness of breath (sob) (37.1 %, n = 84), and fever (29.6 %, n = 67). furthermore, 81 % of patients had a chest x-ray performed within 24 h of presentation, and the majority of individuals (57.3 %, n = 130) demonstrated acute radiographic changes. hematology and biochemistry laboratory investigations indicated 30.9 % (n = 70) had elevated white blood cell counts. additionally, 38.9 % (n = 88) of patients had decreased lymphocytes counts (table 1) . bacterial co-infections were noted in 7.1 % of patients, and viral co-infections were detected in 3.9 % of patients, and in both groups no clear pathogen predominated (tables 1 & 2 ) . the average length of stay in hospital was 13 days (range 1−354 days), and 17.3 % required admission to the icu with a mean duration of 11.8 days (range 1-240 days). all-cause mortality was 7%. the predictor variables associated with severe disease outcomes are presented in table 3 . patients with oc43 had 2-fold odds of requiring o2 or intubation compared to non-oc43 strains, while no difference in mortality or icu admission was found based on cov strain. increased age was associated with increased numbers of symptoms, comorbidities, and radiographic changes. a bivariate analysis identified both this cross-sectional study spanning 6-years suggests that cov accounts for an important burden of respiratory infection, representing 1 out of 9 viral respiratory infections, with a propensity to cause lowerrespiratory tract infection and severe outcomes. notably, all-cause mortality and risk of icu admission were similar to rates reported for influenza and rsv [15, 16] . our findings indicate that cov is not a benign infection among those who are hospitalized, and is similar to available data elsewhere. garbino and colleagues found that 31 % of patients in their cohort were admitted to the icu, and noted an all-cause mortality of 10 %. lowerrespiratory tract infections (lrtis) are the fourth leading cause of mortality globally, and characterizing the epidemiology of respiratory viruses is a necessary first step to reducing the burden of disease [7] . predictors of severe outcome including need for icu admission or mechanical ventilation have been described for mers-cov, but there is a paucity of data on other covs [12, 17] . in our cohort smoking predicted icu admission and/or mortality, which is similar to what was reported in a prior study on patients infected with hku1 cov [18] the impact of gender on outcomes of cov, as determined by our multivariate analysis is in contrast with what is reported for mers cov. with other coronaviruses including mers-cov, there is often a predominance of male cases [19, 20] . however, females represented the majority of cov infections in our cohort, and our analysis indicated that female gender was associated with more severe outcome. this finding differs from what has been reported for sars-cov patients in singapore [21] , and merscov 17] where male gender was predictive of poor outcomes. interestingly, our bivariate analysis indicated that nosocomial acquisition was associated with poor prognosis. similar findings have been noted for infections with mers cov, where acquisition of the virus in the hospital was predictor of 72 h mortality in a multivariate analysis of cases in saudi arabia [13] . our findings indicate that there is heterogeneity in circulating strains, as oc43 and 229e were more prevalent than nl63 or hku1. previous studies have similarly shown oc43 and 229e account for up to approximately 30 % of common colds [22] , and our data indicate that approximately 70 % of coronavirus infections in our cohort were due to these two strains. more recent four-year prevalence data from military personnel in the usa revealed season-to-season variability where oc43 and 229e alternated as the most common strain identified [23] . other studies have highlighted prevalence of a particular strain, often showing variation between locations and patient populations (eg. transplant vs. non-transplant; inpatient vs. icu etc) [3, 10, 11, 23] . sequencing analysis by lau and colleagues of clinical isolates of oc43 suggested recombination may play a role in the generation of novel cov genotypes [24] . this highlights the importance of determining the local epidemiology, and suggests that genomic sequencing of isolates may be a necessary next step to investigate genetic changes over time. interestingly, there is increasing reports of both co-infections with multiple respiratory viruses and viral and bacterial pathogens, and data suggesting this may be associated with more severe disease [25] [26] [27] [28] . in our cohort bacterial co-infections were only identified in 7.9 % of individuals, and viral co-infections in 3.1 %; both of which are lower than what has been reported by other groups [28, 29] , and we did not have sufficient numbers to investigate any correlations with disease severity. however, this is an area where additional studies are needed. our study has several important limitations. we only included patients who presented to the hospital for acute care, thus representing a subset of the most ill patients with cov infection in the community. furthermore, it cannot be discounted that higher number of positives were seen during influenza season due to heightened testing of respiratory viruses during this time of year. importantly, our study did not include asymptomatic or subclinical cases or non-cov controls, which makes it challenging to identify determinants of severity relative to these other populations. moreover, as data emerges on the association of covs with central nervous system sequalae, future studies should investigate the incidence of strokes, and seizures in cases of cov infection [30] . the number of patients receiving extracorporeal membrane oxygenation should also be considered in subsequent studies. since our assay was not quantitative we are unable to determine the role of viral load in influencing disease severity, although it has been noted by others that viral load did not correlate with outcome [31] . furthermore, we did not include biomarkers associated with liver function. it has been reported that elevated alt was associated with adverse outcomes in patients infected with sars [32] , and further investigation is necessary to determine the prognostic value in other cov infections. finally, the relatively small numbers of cases of each strain (e.g. oc43, 229e, hku1, nl63) prevented separate analysis of any potential effects of individual strains on patient outcome. our study describes burden and risk factors associated with disease severity in patients infected with cov at a single urban healthcare centre. at present there is likely an under-reporting of cov infections in canadian hospitals, as many laboratories do not routinely test for these pathogens. collectively, this study highlights the significant burden of covs and justifies the need for surveillance in the acute care setting. credit author statement r.k. and s.m. were involved in the conceptualization and design of the study. r.k., k.p., l.y., v.w., j.a.l. were involved in data collection and analysis. k.p. and j.a.l. performed statistical analysis and interpretation. manuscript writing was performed by r.k., j.a.l. and s.m. and all authors participated in editing. all authors declare no conflicts of interest table 2 co-infections identified among 226 adult patients hospitalized with coronavirus respiratory tract infection. pathogen identified viral cytomegalovirus (n = 1), entero/rhinovirus (n = 3), human metapneumovirus (n = 2), parainfluenza virus 4 (n = 1), respiratory syncytial virus (n = 2) bacterial capnocytophage spp. (n = 1), coagulase-negative staphyloccocci (n = 4), escherchia coli (n = 2), haemophilus influenzae (n = 2), moraxella spp. (n = 3), streptococcus pneumoniae (n = 3), klebsiella pneumoniae (n = 1), pseudomonas aeruginosa (n = 1) table 3 association between severity of coronavirus infection and clinical factors based on univariate logistic regression analysis. independent variables included coronavirus strain (oc43 vs. non-oc43), gender, smoking status (not a smoker, previously a smoker, current smoker), and age. effects of a "new" human respiratory virus in volunteers human coronavirus circulation in the united states clinical significance of human coronavirus in bronchoalveolar lavage samples from hematopoietic cell transplant recipients and patients with hematologic malignancies prolonged shedding of human coronavirus in hematopoietic cell transplant recipients: risk factors and viral genome evolution viral infection in adults hospitalized with community-acquired pneumonia: prevalence, pathogens, and presentation global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study global epidemiology of non-influenza rna respiratory viruses: data gaps and a growing need for surveillance receptor-binding loops in alphacoronavirus adaptation and evolution identification and evolutionary dynamics of two novel human coronavirus oc43 genotypes associated with acute respiratory infections: phylogenetic, spatiotemporal and transmission network analyses epidemiology and clinical characteristics of human coronaviruses oc43, 229e, nl63, and hku1: a study of hospitalized children with acute respiratory tract infection in guangzhou, china, eur human coronavirus-hku1 infection among adults in mers transmission and risk factors: a systematic review the predictors of 3-and 30-day mortality in 660 mers-cov patients influenza surveillance-united states, 1992-93 and 1993-94 severe morbidity and mortality associated with respiratory syncytial virus versus influenza infection in hospitalized older adults clinical determinants of the severity of middle east respiratory syndrome (mers): a systematic review and meta-analysis clinical and molecular epidemiological features of coronavirus hku1-associated community-acquired pneumonia sex matters -a preliminary analysis of middle east respiratory syndrome in the republic of korea presence of middle east respiratory syndrome coronavirus antibodies in saudi arabia: a nationwide, cross-sectional, serological study sars in singapore-predictors of disease severity isolation of rhinoviruses and coronaviruses from 38 colds in adults species-specific clinical characteristics of human coronavirus infection among otherwise healthy adolescents and adults, influenza other respir molecular epidemiology of human coronavirus oc43 reveals evolution of different genotypes over time and recent emergence of a novel genotype due to natural recombination dual respiratory virus infections human coronavirus alone or in co-infection with rhinovirus c is a risk factor for severe respiratory disease and admission to the pediatric intensive care unit: a one-year study in southeast brazil epidemiology and microbiological investigations of communityacquired pneumonia in children admitted at the emergency department of a university hospital coronavirus hku1 and other coronavirus infections in hong kong detection of respiratory viruses and legionella spp. by realtime polymerase chain reaction in patients with community acquired pneumonia, scand human coronaviruses and other respiratory viruses: underestimated opportunistic pathogens of the central nervous system? epidemiology and clinical presentations of the four human coronaviruses 229e, hku1, nl63, and oc43 detected over 3 years using a novel multiplex real-time pcr method clinical significance of hepatic derangement in severe acute respiratory syndrome key: cord-253333-cwunxhyw authors: echavarría, m.; marcone, d.n.; querci, m.; seoane, a.; ypas, m.; videla, c.; o'farrell, c.; vidaurreta, s.; ekstrom, j.; carballal, g. title: clinical impact of rapid molecular detection of respiratory pathogens in patients with acute respiratory infection date: 2018-09-14 journal: j clin virol doi: 10.1016/j.jcv.2018.09.009 sha: doc_id: 253333 cord_uid: cwunxhyw background: acute respiratory infections (ari) are a leading cause of morbidity and mortality worldwide. there is a need to demonstrate the clinical impact of using the new, rapid and sensitive molecular assays in prospectively designed studies. objectives: to study the impact on medical management of a rapid molecular assay in patients with respiratory infections. study design: a prospective, randomized, non-blinded study was performed in patients presenting to the emergency department during two respiratory seasons (2016–2017). diagnosis was performed by filmarray respiratory panel (filmarray-rp) or by immunofluorescence assay (ifa). results: a total of 432 patients (156 children and 276 adults) were analyzed. diagnosis with filmarray-rp was associated with significant changes in medical management including withholding antibiotic prescriptions (or:15.52, 95%ci:1.99–120.83 in adults and or:12.23, 95%ci:1.56–96.09 in children), and reduction in complementary studies in children (or:9.64, 95%ci:2.13–43.63) compared to ifa. decrease in oseltamivir prescriptions was significantly higher in adults in the filmarray-rp group (p = 0.042; or:1.19, 95%ci:0.51-2.79) compared to adults managed with ifa. diagnostic yield was significantly higher by filmarray-rp (81%) than by ifa (31%)(p < 0.001). the median time from sample collection to reporting was 1 h 52 min by filmarray-rp and 26 h by ifa (p < 0.001). conclusions: the high respiratory viruses’ detection rate and availability of results within two hours when using filmarray-rp were associated with decreases in antibiotic prescriptions and complementary studies and more accurate use of oseltamivir. acute respiratory infections (ari) are a leading cause of morbidity and mortality worldwide. although usually more severe in children, the elderly and immunocompromised patients, all populations and age groups are susceptible. these infections have a significant impact on medical office and emergency department (ed) visits, antimicrobial prescriptions, hospitalizations and lost time from work and school. the most frequent agents responsible for ari are respiratory viruses followed by bacteria [1, 2] . empiric treatment with antibiotics is frequently initiated even when viral infection is a strong possibility, leading to unnecessary antibiotic use [3, 4] . direct diagnosis of respiratory viruses by antigen detection using immunofluorescence assays (ifa), is still used but is typically limited to eight viruses ( [rsv] ) and may lack sensitivity depending on the viral titer, patient´s age and time of testing in relation to the onset of symptoms [5] . molecular methods increase viral detection due to a greater analytic sensitivity compared to conventional methods such as antigen detection and/or viral culture. additional increased yield results from the detection of respiratory viruses that are not effectively detected by conventional methods, including rhinoviruses and coronaviruses. in children with ari, viral positivity rates range from 40 to 45% by ifa to 67-88% by molecular methods [6] [7] [8] [9] . viral positivity rates are lower in adults and can vary from 14 to 29% by ifa [10] to 66% by molecular methods [11] . new multiplex molecular systems using closed test formats have significantly decreased processing times. the filmarray ® respiratory panel (filmarray-rp) (biofire/biomérieux, salt lake city, ut) can detect 20 pathogens within two hours [9] . there is a need to demonstrate the clinical impact of using these new, rapid, sensitive molecular assays in prospectively designed studies [12] . the aim of this study was to determine if timely etiological diagnosis could have an impact on medical management in relation to antibiotic and antiviral prescription, and use of complementary studies, when patients were tested by either fimarray-rp or ifa. in addition, the diagnostic yield, admission rate and length of stay (los) in hospitalized patients, were compared between both diagnostic methods. we performed a prospective, randomized, non-blinded study in children and adults with acute lower respiratory infection (alri) who attended the ed at centro de educación médica e investigaciones clínicas (cemic) university hospital, buenos aires, argentina over two respiratory seasons (april-november 2016 and april-october 2017). inclusion criteria were: age 2 months -6 years of age (children) or greater than 18 years (adults), with signs/symptoms of alri with onset within the preceding 7 days, and signed informed consent. exclusion criteria were: congenital cardiac disease, neurological or genetic disorders, cancer, hiv, immunosuppression or solid organ or hematopoietic stem cell transplantation. this study was approved by the cemic institutional review board (n°0962). alri was defined as presence of at least two of the following signs or symptoms: fever/history of fever, cough, tachypnea, wheezing, difficulty breathing, diffuse or focal signs at auscultation or presumptive diagnosis of bronchiolitis, influenza-like illness (ili), bronchitis, laryngotracheitis or pneumonia. a change in medical management was defined as any change between the initial intention to treat with antibiotics or oseltamivir and/ or to order complementary studies and the final decision-after test results were available. while evaluating the patient, the attending physician invited the patient to participate in the study. after acceptance, the doctor documented demographic data, signs/symptoms, presumptive clinical diagnosis and medical management plan (planned antibiotic and antiviral prescriptions and complementary studies) on a standardized form. at that moment, the physician obtained a nasopharyngeal swab (puritan, usa) that was placed in 3 ml viral transport media. the physician called the laboratory for study randomization (filmarray-rp or ifa) that was assigned by a computer generated allocation. subjects were recruited monday through friday from 8 a.m. to 7 pm. from april to may 2016 the randomization ratio was 1:1. from july to november 2016, this ratio could not be maintained because of staffing constraints. thus, samples received from 10 a.m. to 5 pm were processed by filmarray-rp while samples received outside that period were processed by ifa. in 2017, randomization ratio returned to 1:1. samples assigned to the filmarray-rp group were retrieved from the ed by a member of the research team and immediately processed upon arrival in the virology laboratory, while samples that were assigned to the ifa group were transported to the general laboratory and subsequently to the virology laboratory by routine processes. the filmarray-rp detects 17 viruses (rsv, flua h1, h1-2009, h3, flub, adv, piv 1-4, rv/ev, hmpv, hcov oc43, 229e, nl63, hku1), and 3 atypical bacteria (bordetella pertussis, mycoplasma pneumoniae, and chlamydia pneumoniae). samples were tested according to the manufacturer´s instructions. addition of rehydration buffer and sample to the rp-filmarray pouch was performed in a biological safety cabinet and the pouch was then inserted into the filmarray instrument (version 1.5) (biofire/biomérieux). test time was approximately 65 min. the ifa was an indirect immunofluorescence assay with specific monoclonal antibodies for rsv, flua, flub, piv 1-3 and adv (millipore/ chemicon, temecula, ca) that takes a minimum of 3 h to perform. samples were batched and the assay was performed once per day, with results reported by 4:00 pm each day. ifa is used as standard of care in children at our institution. results of the filmarray-rp or ifa were reported by telephone to the physician who initially saw the patient, as soon as they were available and results were also uploaded into the laboratory system. at that moment, the physician was questioned by a member of the study team about any changes in medical management (antibiotic or antiviral therapy or complementary studies) between the original plan previously documented on the standardized form and the final management plan with the reported test results. in patients who required hospitalization, information about los, oxygen therapy, icu stay or mortality was obtained from medical records. complementary studies included chest x-ray, computerized tomography scan, complete blood count, urinary antigen for streptococcus pneumoniae or legionella pneumoniae and bacterial cultures of blood, urine or sputum. to identify a two-fold difference in medical change with a 95% confidence and a power of 80%, the minimum sample size required was 200 in the fimarray-rp group and 100 in the ifa group. demographic, clinical characteristics and changes in medical management between patients tested by filmarray-rp or ifa were compared using chi-square or fisher´s exact test for categorical variables and mann-whitney-wilcoxon test for numeric variables. multivariate analyses using logistic regression models were adjusted for age (months for children and years for adults), sex, and randomization using stata 14 (stata corp, college station, tx, usa). associations were measured by estimating the odds ratios (or) and associated 95% confidence intervals (ci). p values < 0.05 were considered statistically significant. from april-november 2016 and april-october 2017, 442 patients were enrolled in the study. ten of these patients (2%) were not included (3 had inadequate samples, 3 declined participation, 2 consented but the test was not performed, and 2 had incomplete forms). thus 432 patients (156 children and 276 adults) were enrolled and included in the analysis. demographic, epidemiological and clinical characteristics were similar between the two groups (table 1) . for children, the median age was 9 months, 64% were male, and 86% were up to date with mandatory vaccines. for adults, the median age was 43 years, 41% were male and 24% were older than 65 years. the lack of 1:1 ratio randomization during the second portion of 2016 resulted in a higher number of patients being enrolled in the filmarray-rp group: 289 were tested by filmarray-rp and 143 by ifa. the diagnostic yield was significantly higher for filmarray-rp than for ifa (p < 0.001). using filmarray-rp, a respiratory pathogen was detected in 93% of children (99% viruses and 1% m. pneumoniae) and in 74% of adults (100% viruses). in contrast, when using ifa, a respiratory virus was detected in 49% of children and in 23% of adults. respiratory pathogen distribution in children and adults for the ifa or filmarray-rp diagnostic group is shown in fig. 1 . the percentage of viral coinfections with filmarray-rp was 31% in children and 7% in adults. ifa did not detect any coinfections. the median transport time from sample collection at ed to arrival at the laboratory was 15 min (iqr 10-25) for the filmarray-rp samples and 120 min (iqr 42-930) for ifa samples (p < 0.001). the median time from sample collection to results reported to the attending physician (turnaround time [tat]) was 1h 52 min (iqr 1h 38min-2h 30min) for the filmarray-rp group and 26 h 40 min (iqr 20 hours-48 hours) for the ifa group (p < 0.001). overall, a change in medical management was four times more frequent in the filmarray-rp group than the ifa group. specifically, the odds ratio for changing was 8 times higher in children (or = 8.07 ci95% 3.03-21.47) (p < 0.001) and more than 2 times higher in adults (or = 2.67 ci95% 1.32-5.40) (p = 0.006) ( table 2 ). in children, the changes were associated with decreases in antibiotics and complementary studies. in adults, they were associated with decreases in antibiotics and oseltamivir prescriptions. univariate and multivariate analysis of the period with a 1:1 randomization ratio and without 1:1 randomization ratio (second portion of 2016) showed the same trend for the changes in medical management (suppl . table 1a and b). a significant change between the initial treatment plan and the final plan in relation to antibiotic prescriptions was observed more frequently in children (23%) and adults (14%) in the filmarray-rp group versus the ifa group (2% and 1%, respectively) (p = 0.001 for both children and adults). the odds ratios for these changes were: 12.23 (ci95% 1.56-96.09; p = 0.017) for children and 15.52 (ci95% 1.99-120.83; p = 0.009) for adults ( table 2 ). most changes in antibiotic management consisted of deciding not to treat with antibiotics in cases with viruses detected by the diagnostic test. the greatest change was observed in adult patients with bronchitis (31% in the filmarray-rp group versus 0% in the ifa group; p = 0.005) (or 9.27 ci95% 1.12-419.18, p = 0.019) and in adult patients with ili (11% in the filmarray-rp group versus 2% in the ifa group; p = 0.014) (supplemental table2). in the whole population, antibiotics were withheld in 52 patients (31%) out of 167 patients who empirically were prescribed antibiotics. in contrast, changes in plans consisting of a decision to initiate treatment with antibiotics when diagnostic test results were available occurred in 5 patients: 3 children (2 tested by filmarray-rp-one positive for mycoplasma pneumoniae and the other filmarray-rp negative-; the third patient tested by ifa with negative result) and 2 adults (both tested negative by filmarray-rp). in adults, a change from an initial intention to treat with oseltamivir and the final decision to not treat occurred in 12% of flua/b negative adults tested by filmarray-rp versus 9% of flua/b negative tested by ifa (p = 0.042). on the other hand, changes consisting of a decision to treat with oseltamivir made when the diagnostic test result was available were observed in flua/b positive adults tested by filmarray-rp of 66 adults who empirically were prescribed with oseltamivir, 21 (32%) were withheld in the filmarray-rp group and 9 (14%) in the ifa group. in children, oseltamivir usage was very low and no significant changes in treatment with the drug were observed between the two study groups. in children, significant changes consisting of a decrease in complementary studies was observed in the filmarray-rp group (25.7%) versus the ifa group (4.7%)(p = 0.001) with an or = 9.64 (95%ci 2.13-43.63)(p = 0.003). this change was associated with a reduction in ordering of chest x-rays (59%) and in blood cell counts (41%). of 100 patients who empirically had complementary studies ordered, 29% were withheld in the filmarray-rp group. in adults, there was no change in ordering of complementary studies in either diagnostic group. among children with alri attending the ed, 29/156 (18.6%) required hospitalization. the hospitalization rate was lower in children tested by filmarray-rp (17.7%) than by ifa (20.9%) but the difference among adults with alri attending the ed, 34/276 (12%) required hospitalization. hospitalization rates were 13.6% in the filmarray-rp group and 10% in the ifa group (p = 0.377). the median los was lower for the filmarray-rp group (4 days [iqr 2-8] than the ifa group (10 days [iqr 2-13]) although the difference was not statistically significant (p = 0.382). six adults died during the hospital stay, 3 were older than 96 years old. this study demonstrated that significant changes in medical management occurred in both children and adults when the results of a multiplex molecular respiratory panel were rapidly available to physicians in the ed compared to patient management using conventional testing (ifa). these changes included a decrease in antibiotic prescriptions in children and adults, more accurate oseltamivir treatment in adults (treatment in influenza positive patients and no treatment in influenza-negative patients) and a decrease in complementary studies in children. decreasing antibiotic prescription has an impact not only on avoiding collateral effects [13] but also in contributing to public health efforts to combat increasing antibiotic resistance. antibiotic overprescribing is a particular problem in primary care, where viruses cause most of the respiratory infections [4] . despite the fact that children and adults were managed by different attending physicians using different treatment protocols, our study demonstrated a change around 14-23% in decreasing antibiotic prescriptions in the ed when the filmarray-rp results were provided within two hours. studies evaluating the impact of respiratory virus diagnosis in relation to antibiotic use are mostly retrospectively and have shown controversial results for several reasons. use of a conventional real-time pcr assay showed little impact on antibiotic use most likely because test results were available only after 12-36 hours [14] . a retrospective study using the filmarray-rp in older adult outpatients showed a decrease in antibiotics only in influenza-positive patients [15] . other study showed that rapid diagnostic tests for influenza permitted a decrease in antibiotics when patients were influenza-positive [16] . recently, the first prospective randomized study in adults comparing filmarray-rp to conventional pcr assays (or no testing at all) was published from the u.k. although no reduction in antibiotic prescriptions was observed, a decrease in antibiotic doses (single dose or brief courses-less than 48 h) occurred in patients tested by filmarray-rp [17] . this was probably due to the fact that patients were immediately started on antibiotics even before test results were available. in our study, we were able to demonstrate a change in medical management in relation to a reduction in antibiotic prescriptions in patients tested by filmarray-rp. this change was observed not only in influenza-positive patients but also in those positive for other respiratory viruses. the greatest change was observed in patients with bronchitis and ili, while the smallest decrease was observed in patients with presumptive pneumonia in whom a positive viral diagnosis could not rule out a potential co-existing bacterial infection. brendish et al, also showed little change in antibiotic use in patients with pneumonia tested by filmarray-rp. they demonstrated that the greatest impact on antibiotic decrease was in patients with asthma and acute exacerbation of chronic obstructive pulmonary disease [17] . in relation to oseltamivir usage, chu et al. showed that the implementation of rapid influenza pcr testing was associated with a decrease in unnecessary antiviral use among adult inpatients who tested negative for influenza [18] . in our study, we demonstrated a significant decrease in oseltamivir prescriptions in adults when they were influenza-negative by filmarray-rp. on the other hand, an increase in oseltamivir use was observed in patients who tested influenza-positive permitting initiation of appropriate antiviral treatment within the time frame required for therapeutic efficacy. minimizing radiation exposure in children has become an increasing priority among pediatricians [19] . in our study, a significant decrease in complementary studies in children, mostly chest x-rays, occurred when the diagnosis was available in a timely manner, avoiding unnecessary irradiation. reduction in radiographs has also been observed when studying the impact of rapid diagnosis of influenza in the pediatric ed [20] . our study found trends toward reduced los in the filmarray-rp group when compared to the ifa group (mean of 3 days vs 5 days for children and 3 days vs 7.5 days for adults). these results were not statistically significant, probably due to the low number of patients who required hospitalization in this study. brendish et al. found a shorter mean los in patients tested by filmarray-rp. furthermore, patients with a positive filmarray-rp had the shortest length of stay [17] . a one-day los reduction for adults with respiratory infection represents a minimum mean cost saving of approximately 530 $us/day which is consistent with our previous study on respiratory infections and associated costs performed in children [21] . we found filmarray-rp had a very high yield in both children (92%) and adults (71%). ifa, although less sensitive and limited to eight viruses, provided adequate detection for rsv, flua and piv 1-3 in children. in contrast, the detection rate for the classical viruses was lower in adults, probably because of the lower viral load in the respiratory secretions of adults [22] . the rapidity in test result availability to physicians in this study was a key factor for determining changes in medical practice. performing this study in routine clinical practice with less assurance of rapid turnaround time (tat) may not have had the same impact on patient management and antimicrobial prescriptions. a very recent prospective study failed to achieve the optimum tat due to a delay in the specimen processing [23] . other strengths of this study are that it included both children and adults, and that enrollment took place during two respiratory seasons. the study demonstrated a change in medical management in decreasing antibiotics prescriptions in both populations. this study has limitations. it was a single center study and was not sufficiently powered to show a statistically significant drop in los. another limitation is that we could not maintain the intended 1:1 randomized enrollment during the second portion of 2016. however, we believe that the non-random allocation of patients during this period did not influence clinical behavior. logistic regression did not show a statistically significant effect of study period on outcome. in summary, in this prospective study of alri in immunocompetent patients who presented to the ed, the use of a rapid multiplex pcr respiratory panel (filmarray-rp) was associated with significant changes in medical management. the short tat from sample collection to reported results gave physicians the option to adjust empirical decisions and change medical management during the ed consultation, leading to decreased antibiotic prescriptions and complementary studies and permitting a more targeted use of oseltamivir. this work was partially supported by a grant provided by biofire/ biomérieux, usa. the sponsor had no involvement in the conduct of the study or the analysis of the data. me has received speaker's fee from biomérieux. the other authors report no conflict of interest. conceptualization, methodology, investigation, data curation, writing original draft marcone: formal analysis, investigation, data curation, writing original draft resources, writing review & editing; alejandro seoane: investigation, writing review & editing; martin ypas: investigation, writing review & editing; cristina videla: resources, writing review & editing guadalupe carballal: conceptualization, writing original draft principles and practice of infectious diseases community-acquired pneumonia requiring hospitalization among antibiotic prescribing practice for acute, uncomplicated respiratory tract infections in primary care settings antibiotic prescribing in ambulatory pediatrics in the united states accuracy of rapid influenza diagnostic tests: a meta-analysis epidemiology of viral respiratory tract infections in a prospective cohort of infants and toddlers attending daycare viral etiology of acute respiratory infections in hospitalized and outpatient children in comparison of fast-track diagnostics respiratory pathogens multiplex real-time rt-pcr assay with in-house singleplex assays for comprehensive detection of human respiratory viruses respiratory viral diagnosis by using an automated system of multiplex pcr (filmarray) compared to conventional methods influenza other respir viral infections in outpatients with medically attended acute respiratory illness during the 2012-2013 influenza season rapid viral diagnosis for acute febrile respiratory illness in children in the emergency department antibiotics for acute respiratory infections: shrinking benefit, increasing risk, and the irrelevance of antimicrobial resistance clinical impact of rt-pcr for pediatric acute respiratory infections: a controlled clinical trial clinical utility of on-demand multiplex respiratory pathogen testing among adult outpatients impact of rapid diagnosis on management of adults hospitalized with influenza routine molecular point-of-care testing for respiratory viruses in adults presenting to hospital with acute respiratory illness (respoc): a pragmatic, open-label, randomised controlled trial impact of rapid influenza pcr testing on hospitalization and antiviral use: a retrospective cohort study computed tomography -an increasing source of radiation exposure impact of the rapid diagnosis of influenza on physician decision-making and patient management in the pediatric emergency department: results of a randomized, prospective, controlled trial incidence of viral respiratory infections in a prospective cohort of outpatient and hospitalized children aged ≤5 years and its associated cost in clinical and financial benefits of rapid detection of respiratory viruses: an outcomes study multiplex pcr point of care testing versus routine, laboratory-based testing in the treatment of adults with respiratory tract infections: a quasi-randomised study assessing impact on length of stay and antimicrobial use we would like to thank all physicians from the pediatric and adult emergency departments for patient enrollment, in particular, drs. gisela andres,vanina masip, javier muñoz and alejandra abramovsky. we are grateful to dr. fernando poletta for statistical analysis, carmen ricarte (conicet) for her technical assistance, and to dafne santos, melina schapira and all the virology laboratory staff for their support. we would also like to thank drs. gregory storch and christine ginocchio for critical review of the paper. supplementary material related to this article can be found, in the online version, at doi:10.1016/j.jcv.2018.09.009. key: cord-269407-6i66zf0e authors: rutvisuttinunt, wiriya; klungthong, chonticha; thaisomboonsuk, butsaya; chinnawirotpisan, piyawan; ajariyakhajorn, chuanpis; manasatienkij, wudtichai; phonpakobsin, thipwipha; lon, chanthap; saunders, david; wangchuk, sonam; shrestha, sanjaya k.; velasco, john mark s.; alera, maria theresa p.; simasathien, sriluck; buddhari, darunee; jarman, richard g.; macareo, louis r; yoon, in-kyu; fernandez, stefan title: retrospective use of next-generation sequencing reveals the presence of enteroviruses in acute influenza-like illness respiratory samples collected in south/south-east asia during 2010–2013 date: 2017-07-14 journal: j clin virol doi: 10.1016/j.jcv.2017.07.004 sha: doc_id: 269407 cord_uid: 6i66zf0e background: emerging and re-emerging respiratory pathogens represent an increasing threat to public health. etiological determination during outbreaks generally relies on clinical information, occasionally accompanied by traditional laboratory molecular or serological testing. often, this limited testing leads to inconclusive findings. the armed forces research institute of medical sciences (afrims) collected 12,865 nasopharyngeal specimens from acute influenza-like illness (ili) patients in five countries in south/south east asia during 2010–2013. three hundred and twenty-four samples which were found to be negative for influenza virus after screening with real-time rt-pcr and cell-based culture techniques demonstrated the potential for viral infection with evident cytopathic effect (cpe) in several cell lines. objective: to assess whether whole genome next-generation sequencing (wg-ngs) together with conventional molecular assays can be used to reveal the etiology of influenza negative, but cpe positive specimens. study design: the supernatant of these cpe positive cell cultures were grouped in 32 pools containing 2–26 supernatants per pool. three wg-ngs runs were performed on these supernatant pools. sequence reads were used to identify positive pools containing viral pathogens. individual samples in the positive pools were confirmed by qrt-pcr, rt-pcr, pcr and sanger sequencing from the cpe culture and original clinical specimens. results: wg-ngs was an effective way to expand pathogen identification in surveillance studies. this enabled the identification of a viral agent in 71.3% (231/324) of unidentified surveillance samples, including common respiratory pathogens (100/324; 30.9%): enterovirus (16/100; 16.0%), coxsackievirus (31/100; 31.0%), echovirus (22/100; 22.0%), human rhinovirus (3/100; 3%), enterovirus genus (2/100; 2.0%), influenza a (9/100; 9.0%), influenza b, (5/100; 5.0%), human parainfluenza (4/100; 4.0%), human adenovirus (3/100; 3.0%), human coronavirus (1/100; 1.0%), human metapneumovirus (2/100; 2.0%), and mumps virus (2/100; 2.0%), in addition to the non-respiratory pathogen herpes simplex virus type 1 (hsv-1) (172/324; 53.1%) and hsv-1 co-infection with respiratory viruses (41/324; 12.7%). asia is an epicenter for the emergence of diverse respiratory pathogens representing major global public health threats [1] [2] [3] . accurate molecular identification of respiratory pathogens is a vital decisionmaking tool for public health officials and health care providers. unfortunately, traditional laboratory techniques do not allow a broad detection of viral pathogens during routine surveillance [4] . next-generation sequencing (ngs) is a powerful tool to detect emerging or re-emerging pathogens, and to obtain information about frequency of intra-host genetic variation and virological responses to treatments [5] [6] [7] . ngs has been utilized to study commonly circulating respiratory viruses and novel viruses found in vectors, animals, and humans [8] [9] [10] . in addition, whole genome ngs (wg-ngs) has been utilized to identify viruses in diagnostic clinical virology [11] [12] [13] and occasionally applied in parallel with standard diagnostic assays [12, 14] . during 2010-2013, the armed forces research institute of medical sciences (afrims) conducted routine acute respiratory illness surveillance in 5 countries in south/south east (s/se) asia: nepal, bhutan, thailand, cambodia, and philippines. 12,865 nasal and/or oropharyngeal swabs in universal transport media (utm) were collected from individuals seeking medical care for acute influenza-like illness (ili). these specimens were tested for influenza virus (ifv) by rrt-pcr, and 52.4% ifv negative specimens were sent for cell-based culture isolation. of these, 324 produced cpe but were negative for common respiratory virus serology tests suggesting the presence of uncommon respiratory viruses in the culture. we sought to determine if we could identify a pathogen in cpe positive samples despite the samples testing negative using antibody panels for common respiratory samples. the information obtained will be used to improve current molecular detection protocols, which can then be incorporated in routine surveillance and clinical diagnosis. to investigate whether wg-ngs can be used to uncover the etiology of ifv negative, but cpe positive specimens, we utilized the illumina miseq platform in conjunction with traditional molecular assays. viral isolations of ifv rrt-pcr negative that showed cpe positive were pooled and sequenced by wg-ngs. ngs sequences were utilized to identify positive pools containing viral pathogens. pcrs and sanger sequencing were further performed on individuals of the positive pools to identify the presence of specific viral genotypes in the positive specimens. nasal and/or oropharyngeal swabs in utm (copan diagnostics inc., california, usa) were collected from ili surveillance sites in s/se asia during 2010-2013. the surveillance samples were collected in nepal, bhutan, thailand, cambodia and philippines under protocols approved by the institutional review boards of host country institutions and the walter reed army institute of research (wrair). respiratory specimens negative by ifv rrt-pcr underwent viral isolation in madin-darby canine kidney (mdck) and hep-2 cells (fig. 1) [15, 16] . culture supernatant from cpe positive cultures were tested by hemagglutination inhibition (hai) for ifv and by indirect fluorescent antibody (ifa) for respiratory syncytial virus (rsv), ifv a, ifv b, human adenovirus (hadv), human parainfluenza (hpiv) 1, 2 and 3. cpe positive, but hai and ifa-negative supernatants were selected for further testing by wg-ngs. the supernatant of these cpe positives were grouped in 32 pools containing 2-26 supernatants per pool based on their country of origin, the year they were initially collected and cell line used for isolation (tables 1a and 1b) . equal volume of each cpe positive supernatant was pooled to make up a total of volume of 300 μl/pool. virus enrichment steps, including removal of host cells and virus concentrating steps were applied as described previously [16, 17] . qiaamp viral rna extraction kit (qiagen, ca, usa) was used for viral nucleic acid extraction. na-nodrop (wilmington, de, usa) and agilent tapestation1100 (agilent technologies, ca, usa) were utilized to quantify and determine the quality of the dna and rna (od 260 /od 280 values). truseq lt rna sample preparation was conducted following the manufacturer's instructions as described before [16, 17] . briefly, rna was heat-fragmented, followed by double stranded cdna synthesis (life technologies, ny, usa) and adapter ligation. dna quantity and quality control was validated and monitored by agilent tapestation1100, qubit ® 2.0 fluorometer (life technologies, ny, usa) and rrt-pcr (applied biosystems, ca, usa). three runs (10-12 pools/run) were conducted with illumina miseq reagent version2 according to the manufacturer's protocol. the quality control of sequence reads was done as previously described [16, 17] with additional steps used for novel pathogen findings [fig 2] . identification of individual viruses from the pool was performed as follows: viral genome quantification was conducted by (i) de novo assembly of sequence reads into contigs, consensus sequences assembled from sequence reads by trinity [18] followed by identification of the contigs in genbank by blastn and (ii) de novo assembly by meta-idba [19] , followed by blast against complete genome sequence data base. novel pathogen classification followed the analysis procedure by blastx alignment against the non-redundant (nr) protein database as described previously [20] with the cut-off at 500 kb or greater in contig length with undetectable similarity to reference real-time rt-pcr, rt-pcr or pcr was used to confirm the wg-ngs results from cpe culture and clinical specimens. table s1 displays the pcr and rt-pcr primers sequences used to confirm the wg-ngs results. the pan-ev rt-pcr [21] results were confirmed by sanger sequencing at aitbiotech pte ltd. company, singapore. the accession numbers of our sequences in genbank were described in table 3 with a small subset of samples previously published by zhou et al., 2016 . to determine the genetic variations and the relationships with the reference viruses, phylogenetic trees were constructed using seaview (v4.0) and gtr+g+i parameter calculated by mega v. 6.0. during routine ili surveillance in s/se asia in 2010-2013, approximately 4325 (33.6%) of 12,865 respiratory specimens collected were found to be positive for ifv by rrt-pcr and 8540 (66.4%) specimens were found to be negative (fig. 1) . approximately 52.4% (4478 of 8540) of the ifv rrt-pcr negative specimens were cultured, 12.8% of which (572 of 4478) were found to induce cpe positive in either mdck or hep-2 cells. a total of 339 of 572 (59.3%) of these cpe positive cultures were negative by standard respiratory hai and ifa assays, of which 324 (95.6%) (2-26 culture samples per pool) were pooled. a total of 32 distinct pools were sequenced by wg-ngs to identify viral agents present in the supernatant following the flow diagram illustrated in fig. 2 . a total of 46.1 million sequence reads were generated from 3 sequencing runs. after selecting sequence reads with ≥30q scores and removing background sequences, 5.9 million sequence reads remained for analyses. sequence alignment using blastn in ncbi nt database identified viral sequences in 29 of 32 (90.6%) pools (tables 1a and 1b) . pools from cambodia 2013, philippines 2012 and philippines 2013 yield sequence reads identified host background and not viral pathogens by blastn in ncbi nt database. sequence reads aligning with hsv-1 were found to be most common (25 of 32 pools, 78%). in addition to hsv-1, 11 other viral sequences were detected in the pools, including mumps virus (muv), enterovirus (ev), coxsackievirus (cv), echovirus (e), human rhinovirus (hrv), ifv a, ifv b, hpivs, human adenovirus (hadv), human coronavirus (hcov), and human metapneumovirus (hmpv). we verified the pools' results using conventional pcr and rt-pcr and were able to confirm the wg-ngs results in 63/105 cases (60%, tables 1a and 1b, shaded cells). a discrepancy occurred in the philippines 2012, where pcr/rt-pcr testing failed to corroborate the presence of any of the 4 viruses detected by wg-ngs. no pathogen identification was made by wg-ngs and pcr in three pools (tables 1a and 1b, italic letters). the 310 culture supernatants that made up the 29 pools were further tested by pathogen-specific pcr, rt-pcr or rrt-pcr to validate the wg-ngs findings and to quantify the percentage of samples within each pool where viruses were present ( table 2) . two hundred and thirty-one of the 310 (74.5%) individual samples were positive using at least one of the pathogen-specific pcr tests verifying the pathogens identified by ngs in the pooled samples (table 2 ). approximately 43.3% (100/231) of the positive samples were respiratory pathogens. of these, cvs were the most common respiratory viruses found, present in 31.0% (31/100) of all positive samples, followed by e, found in 22% samples. ev (16.0%), hrv, (3.0%), muv (2.0%), hmpv (2.0%) and hcov (1.0%) were all found at lesser frequencies ( table 2) . two samples positive for the pan-enterovirus (pan-ev) pcr could not be further typed and appear in table 2 as pan-ev positive (2%). also found were respiratory viruses that failed to be identified during the original screening for ifva and hadv due to few mismatched primer sequences (fig. s2) . the non-respiratory virus hsv-1 was the most common virus found in the individual supernatants, present in 172 of 310 samples (55.4%, table s3 ). in at least 41 of these samples (23.8%) hsv-1 appeared as a co-infecting agent, most commonly co-present with enteroviruses. one sample collected from philippines in 2012 contained hcov oc43 strain co-infected with hsv-1. in addition, standard molecular procedures were conducted in selected samples and results validated the presence of the identified pathogens in both clinical specimens and cpe culture. majority of clinical specimens were depleted and unavailable for this confirmation test. seventy-one ev positive (22 from hsv-1 co-infected samples) samples from nepal, bhutan, thailand, cambodia and philippines, were further subtyped within the ev genus utilizing the gtr+g+i model maximum likelihood tree (fig. 3) using the sanger sequences obtained from their pcr amplicons as previously described. the 71 positive pan-ev samples were found to be cv b5 ( [22] . five subtypes of the enterovirus genus and hrv species c were found in more than one country in se asia. the genetic distance among these samples of the same serotypes found in 5 countries were less than 0.2 (data not shown). one case of ev71 was detected from samples collected from thailand in 2011. seeking for viral pathogen identification of contigs: blastn against ncbi nt database of the pools table 2 confirmation of individuals samples by pcr, rt-pcr or rrt-pcr. a further characterization of enterovirus genus (from the pan-ev pcr-left side of dark grey column) of individual cpe samples were obtained from phylogenetic analysis of sequences (fig. 3) . total numbers of samples in the gray highlighted columns are equal to the number in the pan-ev column. bold letters confirmed the present of the pathogen previously identified in the pools by wg-ngs. asterisk indicated the exceptional 2 cases that the pathogens identified differently than indicated from the pools. unlined letters demonstrate samples contain mismatched sequences where primers of the rrt-pcr bind (table s2 ). a summary of the pathogens identified and the cases with still unclear etiology collected during routine respiratory surveillance 2010-2013 is illustrated in fig. 4 . our analyses found hsv-1 to be the most frequent virus present in our supernatant, followed by ev genus and other common respiratory viruses, which was in agreement with the observation in thailand reported by zhou et al. [22] . the frequency of hsv-1 positive samples was most likely due to the exacerbation of existing hsv-1 infections caused by common respiratory infections in patients and the subsequent hsv-1 viral shedding in the upper respiratory track at the time of sample collection. individuals with hsv-1 infections were routinely described as asymptomatic or subclinical [23] . it was estimated that hsv-1 seroprevalence was about 51% in se asia [24] and 33.3% in s asia [25] . viruses from the ev genus were the most common (71%) respiratory pathogens identified. nine samples from thailand 2010-2011 were sequenced individually and confirmed the present of the identical enterovirus serotypes sequences [22] . despite the spread of ev-d68 globally [26] , it was not detected in our surveillance study which enrolled adults 18-65 ages group during 2010-2013. our study, with limited sample size detected a similar range of enterovirus serotypes (cv b2, cv b3, cv b4, e6 and e9) in se asian countries as other recent studies in thailand [21, 22] . these serotypes identified outside thailand strains have genetic distance < 0.2 from the thai serotypes. this suggests some temporal and spatial structure of both the thai and, more broadly, the se asian ev populations, and thus may indicate some regional circulation of ev lineages and viral traffic between countries in se asia. overall, our study demonstrated that wg-ngs on pooled culture supernatants can be a useful tool to identify viral pathogens in clinical isolates. however, the identification of pathogens in the samples that yielded low sequence reads requires additional testing and controls. our data (tables 1a and 1b) showed total sequence reads without subtracting background sequence of the negative control experiment. the low sequence reads in several samples were likely generated from combination of cross talk among neighboring sequenced samples, contamination of barcodes and carries over from the previous runs. a specific example such as the philippines 2012 pool contained sequence reads that were identical to philippines 2011-2012 pool, which was performed next to each other during library preparation. in addition, three pools detected only host background and not viral pathogens possibly due to low viral load, no viruses growing in the culture, or misidentifying the morphology of culture identified as cpe positive. wg-ngs of pooled culture provided comprehensive information from samples with unclear etiology after routine respiratory assays. due to limitation of the study, a subset of the samples (2.9%) was selected for sequencing individually and the identity of the pathogens from sequence individually is in agreement of the results from the pooled samples. with the addition of wg-ngs, 29 of 32 (90.6%) pools were shown to contain viral pathogens identifiable using the genbank nt database. when broken down into individual samples, we were able to confirm the presence of other respiratory viruses in 100 of the 310 (32.3%) individual samples. wg-ngs significantly increased valid data information in addition to the standard respiratory assays. furthermore, the wg-ngs and bioinformatics analysis were able to identify viral pathogens from pooled cultures containing up to 26 samples, which potentially makes this method time, labor and cost effective. this procedure allows screening of larger numbers of samples, with practical applications to surveillance or clinical studies. however, the sensitivity of detection of this procedure may have some limitations [27] . mainly pooled cpe positive cultures were tested as opposed to individually sequencing primary specimens. without taking into consideration samples where hsv-1 was detected, approximately 67.8% of the samples in the pooled remained of unknown etiology after wg-ngs and bioinformatics data analysis (fig. 4) . a potential and likely significant limitation in this work was the cell lines selected for virus isolation. our limitation to our two cell lines may have curtailed the type of viruses we were able to isolate and identify. moreover, antibiotics required to maintain the mdck and hep-2 cultures may have also favored the growth of certain viruses over others. despite being a useful tool to screen for viral pathogens, the wg-ngs on pooled cultures may suffer of low resolution not only for pathogen identification but also for pathogen discovery. the wg-ngs utilizes random amplification which also amplifies host genome, increasing the complexity of the task of identifying pathogens generally present in low abundance in the clinical specimens and culture [28] . long sequence reads with high depth of coverage (doc) are optimal to identify diverse types of viruses from various types of clinical specimens [29] [30] [31] [32] . for novel pathogen discovery, it would be required to apply advanced sample preparation with higher capacity host cell removal procedures directly from the primary clinical specimen and efficient pathogen discovery bioinformatics pipelines. in summary, wg-ngs on pooled samples provides advantages as a screening tool to complement standard assays used during surveillance and diagnostic process. the wg-ngs does not require predefined target for identification of specific pathogens based on clinical presentation. in addition, the wg-ngs broadens the array, magnitude and complexity of pathogen detection since it is not limited by pathogen-specific primer and probe sequences. there are no requirements for the wg-ngs to update primer and probe sequences and the use of culture to isolate continuously. however, the technology provides complex results which require careful sample preparation, powerful sequencers, exhaustiveness of data analysis on well-planned bioinformatics pipelines and large databases for pathogen identification. armed forces health surveillance center − global emerging infections surveillance and response system (afhsc-geis). material has been reviewed by the walter reed army institute of research. there is no objection to its presentation and/or publication. the opinions or assertions contained herein are the private views of the author, and are not to be construed as official, or as reflecting true views of the department of the army, department of the navy or the department of defense. coronavirus host range expansion and middle east respiratory syndrome coronavirus emergence: biochemical mechanisms and evolutionary perspectives high genetic diversity and frequent genetic reassortment of avian influenza a(h9n2) viruses along the east asian-australian migratory flyway prevalence and molecular characterizations of enterovirus d68 among children with acute respiratory infection in china between unbiased detection of respiratory viruses by use of rna sequencing-based metagenomics: a systematic comparison to a commercial pcr panel the rna virus quasispecies: fact or fiction within-host nucleotide diversity of virus populations: insights from next-generation sequencing the first identification and retrospective study of severe fever with thrombocytopenia syndrome in japan biological characterization and next-generation genome sequencing of the unclassified cotia virus span232 (poxviridae) next-generation sequencing of elite berry germplasm and data analysis using a bioinformatics pipeline for virus detection and discovery development of a virus detection and discovery pipeline using next generation sequencing hiv research for prevention 2014: aids vaccine, microbicide and arv-based prevention science (hiv r4p) in cape town evaluation of unbiased next-generation sequencing of rna (rna-seq) as a diagnostic method in influenza virus-positive respiratory samples identification and characterization of highlands j virus from a mississippi sandhill crane using unbiased next-generation sequencing whole genome: next-generation sequencing as a virus safety test for biotechnological products the impact of primer and probe-template mismatches on the sensitivity of pandemic influenza a/h1n1/2009 virus detection by real-time rt-pcr simultaneous and complete genome sequencing of influenza a and b with high coverage by illumina miseq platform viral subpopulation diversity in influenza virus isolates compared to clinical specimens full-length transcriptome assembly from rna-seq data without a reference genome meta-idba: a de novo assembler for fig. 4. regional map displaying the distribution of respiratory viral pathogens identified by ngs from respiratory specimens collected during metagenomic data discovery of stl polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique t antigen by alternative splicing prevalence and characterization of enterovirus infections among pediatric patients with hand foot mouth disease, herpangina and influenza like illness in thailand metagenomics study of viral pathogens in undiagnosed respiratory specimens and identification of human enteroviruses at a thailand hospital public health strategies to prevent genital herpes: where do we stand? age-specific prevalence of infection with herpes simplex virus types 2 and 1: a global review seroprevalence of hsv1 and hsv2 infections in family planning clinic attenders clusters of acute respiratory illness associated with human enterovirus 68-asia, europe, and united states the use of next generation sequencing in the diagnosis and typing of respiratory infections the diagnosis of infectious diseases by whole genome next generation sequencing: a new era is opening next-generation sequencing technologies in diagnostic virology next-generation sequencing technology in clinical virology temporal response of the human virome to immunosuppression and antiviral therapy sequence analysis of the human virome in febrile and afebrile children we would like to thank dr. simon pollett and dr. damon ellison for comments on the manuscript; dr. kimberly bishop-lilly, mr. gregory rice, ms. ragina cer, dr. patrick chain for advices in bioinformatics; ms. thidarat intararit and the clinical research coordinator team for the support on the clinical information; mr. chitchai hemachudha, ms. angkana huang, ms. tipawan thipwong and the project management section for specimen processing and demographic data on study subjects;ms. kamonthip rungrojcharoenkit, ms. duangrat mongkolsirichaikul and the virology and serology laboratory team for processing viral isolates, cpe and hai. mr. kittinun hussem from afrims molecular section team and ms. phatcharin chotchuang an undergraduate student from burapha university for laboratory technical assistance on rrt-pcr, tapestation and qpcr. supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jcv.2017.07.004. key: cord-268335-mfcjldu3 authors: dimeglio, chloé; mansuy, jean-michel; charpentier, sandrine; claudet, isabelle; izopet, jacques title: children are protected against sars-cov-2 infection date: 2020-05-20 journal: j clin virol doi: 10.1016/j.jcv.2020.104451 sha: doc_id: 268335 cord_uid: mfcjldu3 nan 1 chloé dimeglio 1,2* , jean-michel mansuy 2 , sandrine charpentier 3,4 , isabelle claudet 4,5 , and jacques izopet 1 severe acute respiratory syndrome coronavirus 2 (sars-cov-2) emerged in wuhan, china in december 2019. its subsequent spread was mainly by sustained human-to-human transmission (1) and resulted in the who declaring the disease a pandemic (2). the covid-19 statistics for children and infants are quite limited. as infants and young children infected with respiratory tract viruses are particularly at risk of hospitalization (3) the paucity of pediatric patients with covid-19 has raised many questions for clinicians, epidemiologists and scientists. the study previously published by lancet infectious disease has important implications for the clinical management of these patients and the social distancing needed to prevent virus transmission (4). all 811 consecutive patients admitted to the emergency area of the toulouse university hospital (chu) from february 6 to april 2 2020 were enrolled in this study. each of them underwent a pcr test to determine the presence or absence of sars-cov-2. the cohort included 150 (18.5%) patients aged 16 years or under, which is close to the percentage in the french general population (18%, source insee). four children (2.7%) tested positive for the virus while the 661 adults included 178 (26.9%) who tested positive. as sars-cov-2 has been detected in stools (5), stool specimens from 6 children with respiratory symptoms were also tested: they were all negative for sars-cov-2 rna. thus sars-cov-2 was less common in children than in adults (or=0.07, 95% ci: [0.03;0.20], p<0.01) indicating that children are somehow protected against sars-cov-2 infection. the abovementioned study has found that children are susceptible to sars-cov-2 infection, but rarely display any physical signs of the disease. this raises the possibility that children are facilitators of virus transmission (4). we did not find that infected patients had mild or asymptomatic forms of covid-19 more often than adults but that children were less frequently infected with the virus. it is not at all clear why children should be less susceptible to sars-cov-2 infection. however, children are different from adults in many ways. perhaps the binding of the sars-cov-2 spike (s) glycoprotein to the human host cell angiotensin converting enzyme 2 (ace2) receptor is different, or the interferon-antagonizing and inflammasome-activating properties may differ. the most important finding emerging from this analysis is the clear evidence that children are less susceptible to sars-cov-2 infection than adults. if the difference is confirmed by serological studies, it could have major implications for public health policy. while children have been regarded as facilitators of virus transmission, we now need to identify the mechanism which protects them, at least partially, against sars-cov-2 infection. who virtual press conference on covid-19-11 respiratory viral infections in infants: causes, clinical symptoms, virology, and immunology clinical and epidemiological features of 36 children with coronavirus disease 2019 (covid-19) in zhejiang, china: an observational cohort study detection of novel coronavirus by rt-pcr in stool specimen from asymptomatic child, china. emerg infect dis the english text was edited by dr owen parkes. key: cord-273229-c1jws3ol authors: blairon, laurent; wilmet, alain; beukinga, ingrid; tré-hardy, marie title: implementation of rapid sars-cov-2 antigenic testing in a laboratory without access to molecular methods: experiences of a general hospital date: 2020-05-30 journal: j clin virol doi: 10.1016/j.jcv.2020.104472 sha: doc_id: 273229 cord_uid: c1jws3ol background: the covid-19 ag (antigen) respi-strip assay is a new immunochromatographic diagnostic tool recently available for antigenic diagnosis of sars-cov-2. the proposed sensitivity is not higher than 60%, but its high specificity allows both quick decisions for the management of patients and confirmation by molecular diagnosis for only negative tests. however, from the first tests performed, we suspected that the sensitivity observed with routine use was much lower than that announced by the manufacturer. materials and methods: over a period of one month, we compared the negative results obtained with the covid-19 ag respi-strip kit with those obtained from qrt-pcr performed in a laboratory qualified for the molecular diagnosis of sars-cov-2. all samples tested were naso-pharyngeal smears from utm-rt medium. results: of 774 patients tested, 714 negative samples were sent for confirmation, and 159 were found to be positive by qrt-pcr. the median positive percentage agreement was 23.9% (95% ci: 14.2%-38.2%). the cohen’s kappa score was 0.35. conclusion: using this immunochromatographic assay as a triage test did not significantly reduce the number of samples outsourced for covid-19 confirmation by qrt-pcr. in addition, even if the turn-around time is short, the assay is completely manual, which is not suitable for large volumes of routine samples. the sensitivity of this rapid test is poor, and improvements are needed to enhance its performance. the covid-19 ag (antigen) respi-strip assay is a new immunochromatographic diagnostic tool recently available for antigenic diagnosis of sars-cov-2. the proposed sensitivity is not higher than 60%, but its high specificity allows both quick decisions for the management of patients and confirmation by molecular diagnosis for only negative tests. however, from the first tests performed, we suspected that the sensitivity observed with routine use was much lower than that announced by the manufacturer. over a period of one month, we compared the negative results obtained with the covid-19 ag respi-strip kit with those obtained from qrt-pcr performed in a laboratory qualified for the molecular diagnosis of sars-cov-2. all samples tested were naso-pharyngeal smears from utm-rt medium. results. of 774 patients tested, 714 negative samples were sent for confirmation, and 159 were found to be positive by qrt-pcr. the median positive percentage agreement was 23.9% (95% ci: 14.2%-38.2%). the cohen's kappa score was 0.35. using this immunochromatographic assay as a triage test did not significantly reduce the number of samples outsourced for covid-19 confirmation by qrt-pcr. in addition, even if the turn-around time is short, the assay is completely manual, which is not suitable for large volumes of routine samples. the sensitivity of this rapid test is poor, and improvements are needed to enhance its performance. since the launch of the covid-19 ag respi-strip assay (coris bioconcept, gembloux, belgium) upon completion of a validation study under the national competent authority we read with great interest the early april who advice on the use of point-of-care immunodiagnostic tests for covid-19 [1] as well as the article recently published on the test validation [2] and wanted to evaluate our current way of working. this prospective study was conducted over a 1-month period between april 5, 2020, and may 4, 2020, at a single 550-bed hospital site. the beginning of this period corresponded to the epidemic peak of covid-19 in belgium. nasopharyngeal samples for the diagnosis of covid-19 were taken from utm-rt swabs (copan spa, brescia, it) and sent to the laboratory. the antigenic assessment was performed using the covid-19 ag respi-strip kit according to the manufacturer's instructions. after antigenic testing was performed, the molecular assessment of sars-cov-2 was outsourced to a university centre where it was carried out by qrt-pcr using e-gene sars-cov-2 primers/probes. under routine conditions, the sensitivity of the antigen detection of sars-cov-2 with the immunochromatographic covid-19 ag respi-strip kit was significantly lower than that announced by the manufacturer or reported by vandenberg [2] , although we limited ourselves to using qrt-pcr as the comparison method. in our series, we observed a median sensitivity of 23.9%. moreover, compared with the expected performance, the poor observed sensitivity gave rise to 80% more false negative samples and 2.2 times fewer positive samples answered on site. some authors reported a sensitivity of similar molecular methods close to 70% [3] . to obtain a better understanding of the actual sensitivity, we used the patient database constructed for a serological evaluation for which approval was obtained from our ethics committee [4] . when combining molecular diagnosis, chest ct scans and suggestive clinical patterns of covid-19, we observed that pcr was positive in only 199 patients among the 236 patients (76.2%) with suggestive symptoms of covid-19 or a positive chest ct. these results are in line with the previously published false negative rate of approximately 20% for qrt-pcr [5] [6] [7] . as mentioned in the who advice [1] , the performances of antigenic tests depend on several factors, such as the time from onset of illness, the specimen viral content, and other j o u r n a l p r e -p r o o f preanalytical and analytical considerations, as has been previously reported for other respiratory viruses. the who estimates that at least half of covid-19-infected patients might be missed by such tests and therefore does not currently recommend their use. vandenberg calculated their performance based on a threshold cycle (ct) below 22 [2] . in the meantime, a notice from the manufacturer signalled that some hospitals observed negative results with a ct of 13.45 or positive results with a ct higher than 33, underlining the unclear relationship between protein and rna detection. the main limitation of our investigation was our inability to match our results against the ct of the molecular analyses since these were outsourced. we also focused on the sensitivity of the test. however, specificity did not appear to be a priority, given that the high prevalence of disease amplifies positive predictive value of the test when it is are prescribed for patients in a covid-19-compatible clinic. our routine results demonstrate that the concordance between antigenic and molecular testing is fair regarding the kappa score [8] and that this rapid assay does not reduce costs per patient. a thorough validation in appropriate populations and settings should have been performed by the manufacturer before a large-scale implementation. funding: there were no funding resources to declare for this study. the authors have no relevant competing interests to disclose in relation to this work. the authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. advice on the use of point-of-care immunodiagnostic tests for covid-19; 2020. scientific brief development and potential usefulness of the covid-19 ag respi-strip diagnostic assay in a pandemic context sensitivity of chest ct for covid-19: comparison to rt-pcr validation of a chemiluminescent assay for specific sars-cov-2 antibody molecular and serological investigation of 2019-ncov infected patients: implication of multiple shedding routes chest ct for typical 2019-ncov pneumonia: relationship to negative rt-pcr testing correlation of chest ct and rt-pcr testing in coronavirus disease 2019 (covid-19) in china: a report of 1014 cases method agreement analysis: a review of correct methodology the authors thank all the members of the clinical laboratory staff for their technical assistance.credit authorship contribution statement laurent blairon, alain wilmet, ingrid beukinga and marie tré-hardy were responsible for data collection, analysis and interpretation. laurent blairon was responsible for writing the first draft. laurent blairon, ingrid beukinga and marie tré-hardy were responsible for the final version. key: cord-289947-z2dw2eaz authors: wong, river chun-wai; wong, ann han; ho, yolanda iok-ieng; leung, eddie chi-man; lai, raymond wai-man title: evaluation on testing of deep throat saliva and lower respiratory tract specimens with xpert xpress sars-cov-2 assay date: 2020-08-16 journal: j clin virol doi: 10.1016/j.jcv.2020.104593 sha: doc_id: 289947 cord_uid: z2dw2eaz background: xpert® xpress sars-cov-2 assay is only validated on nasopharyngeal specimens for detection of sars-cov-2. other specimen types such as deep throat saliva (dts), also known as posterior oropharyngeal saliva and lower-respiratorytract specimens (lrt) including sputum, tracheal aspirate and bronchoalveolar lavage are not validated. these non-validated specimen types, however, do have significant diagnostic value. objective: evaluate the performance of xpert xpress sars-cov-2 assay for detection of sars-cov-2 from dts and lrt specimens. methods: 162 specimens from 158 patients with suspected covid-19 disease were tested with xpert xpress sars-cov-2 assay. these included 120 dts and 42 lrt specimens i.e. 35 sputum, 6 tracheal aspirate and one bronchoalveolar lavage. results were compared to those by the tib-molbiol lightmix® sarbecov e-gene assay. results: xpert xpress sars-cov-2 assay has satisfactory performance when compared with reference method. the positive percent agreement (ppa) of dts and lrt specimens were 98.86% & 100% respectively while the negative percent agreement (npa) was 100% for both dts and lrt specimens. conclusions: this study demonstrated with appropriate sample pre-treatment, xpert xpress sars-cov-2 assay can be used to test on non-validated specimen types including dts & lrt specimens. severe acute respiratory syndrome coronavirus 2 (sars-cov-2) is a novel coronavirus responsible for cluster of atypical pneumonia outbreak in wuhan, china table 1 overall agreements between xpert xpress sars-cov-2 assay and reference method among 162 deep throat saliva and lower-respiratory-tract specimens for detection of sars-cov-2. the soc naat only allows batch testing. with the use of xpert xpress sars-cov-2 assay as a complementary test, it will allow rapid testing of ad-hoc samples received from aed & intensive care unit and provide round-the-clock service for samples received after batch testing cut-time. similar testing algorithm has been adopted in our laboratory for testing of influenza [10]. the overall performance of xpert xpress sars-cov-2 assay was satisfactory when tested with dts and lrt specimens. review of the sample with discrepancy showed that it was sent from a known positive covid-19 patient for disease monitoring. such discrepancy might be attributed to the low viral load in this sample (ct = 34.47) as well as potential rna degradation due to repeated freeze and thaw. with the use of exact diagnostics sars-cov-2 reference standard (biorad, usa), the analytical 95% lower limit of detection of xpert xpress sars-cov-2 assay and tib-molbiol lightmix® sarbecov e-gene assay was determined as 50 and 100 copies/ml respectively. to our knowledge, this is the first report to evaluate the use of pbs for sample homogenization of dts prior to testing with xpert xpress sars-cov-2 assay. previous study used viral transport medium (vtm) for sample homogenization [1] . one study recommended direct transfer of the liquid, non-viscous part of neat sample into the cartridge without pre-treatment [3] . our previous experience with xpert xpress flu/rsv assay showed that direct transfer of lrt samples, in particular sputum, into the cartridge resulted in a high error frequency. this study was the first to evaluate the testing of lrt specimens (mainly sputum) with pre-treatment to minimize potential invalid results or instrument error. these procedures can minimize the mucus and viscous substances among non-validated specimen types and broaden the testing scope of xpert xpress sars-cov-2 assay. [4] . in this study, we demonstrated that both pbs and mm can be used for sample homogenization. lrt samples were suspended with mm for virus isolation in our routine practice, however, this service was obsoleted in february 2020. as inevaluating the use of posterior oropharyngeal saliva in a point-of-care assay for the detection of sars-cov-2. emerg microbes infect deep throat saliva as an alternative diagnostic specimen type for the detection of sars-cov-2 saliva as an alternate specimen source for detection of sars-cov-2 in symptomatic patients using cepheid xpert xpress sars-cov-2 saliva as a noninvasive specimen for detection of sars-cov-2 posterior oropharyngeal saliva for the detection of sars-cov-2 multicenter evaluation of the cepheid xpert xpress sars-cov-2 test clinical evaluation of three sample-to-answer platforms for detection of sars-cov-2 brief validation of the novel genexpert xpress sars we would like to thank all the technical staff who provide technical assistance and contribute to sars-cov-2 testing in our department.j o u r n a l p r e -p r o o f key: cord-260338-or4faju7 authors: völz, sebastian; schildgen, oliver; klinkenberg, dennis; ditt, vanessa; müller, andreas; tillmann, ramona l.; kupfer, bernd; bode, udo; lentze, michael j.; simon, arne title: prospective study of human bocavirus (hbov) infection in a pediatric university hospital in germany 2005/2006 date: 2007-09-11 journal: j clin virol doi: 10.1016/j.jcv.2007.07.017 sha: doc_id: 260338 cord_uid: or4faju7 background: human bocavirus (hbov), a new species of the genus parvovirus newly detected in 2005, seems to be a worldwide distributed pathogen among children with respiratory tract infection (prevalence 2%–18%). recently published retrospective studies and one prospective birth cohort study suggest that hbov-primary infection occurs in infants. methods: prospective single center study over one winter season (november 2005–may 2006) with hospitalized children without age restriction using pcr-based diagnostic methods. results: hbov dna was detected in 11 (2.8%) of 389 nasopharyngeal aspirates from symptomatic hospitalized children (median age 9.0 months; range: 3–17 months). rsv, hmpv, hcov, and influenza b were detected in 13.9% (n = 54), 5.1% (n = 20), 2.6% (n = 10), and 1.8% (n = 7), respectively. there was no influenza a dna detected in any of the specimens. the clinical diagnoses were acute wheezing (bronchitis) in four patients, radiologically confirmed pneumonia in six patients (55%) and croup syndrome in one patient. in five to six patients with pneumonia, hbov was the only pathogen detected. while no patient had to be mechanically ventilated, 73% needed oxygen supplementation. in four (36.4%) patients at least one other viral pathogen was found (plus rsv n = 3; 27.3%; norovirus n = 1; 9.1%). conclusion: hbov causes severe respiratory tract infections in infants and young children. its role as a copathogen and many other open questions has to be defined in further prospective studies. human bocavirus (hbov) was first described by allander et al. (2005) (karolinska university hospital, stockholm) in 2005. the virus was identified in retrospectively analyzed clinical specimen from infants and children with respiratory tract infections (rti). hbov seems to be a worldwide distributed pathogen and has frequently been associated with respiratory tract infections among infants and young children. hbov-positive patients also presented with symptoms of gastrointestinal disease (arnold et al., 2006; kesebir et al., 2006) . hbov dna has recently been detected in stool samples of patients unrelated to respiratory infection (vicente et al., 2007) raising questions about different possible modes of transmission. unlike patients with rsv-infection (ogra, 2004; simon et al., 2006) , and similar to those with hmpv-associated respiratory tract infection , children older than 6 months seem to be most at risk (kesebir et al., 2006; manning et al., 2006; weissbrich et al., 2006) . to this point there have only been few reports of infection in adult populations (bastien et al., 2006; manning et al., 2006; sloots et al., 2006) . detection of hbov is only possible with rt-pcr (allander et al., 2005) . modified real time rt-pcr protocols have been recently published (kleines et al., 2007; lin et al., 2007; lu et al., 2006; schenk et al., 2007) and detected 10 1 -10 10 copies/ml in respiratory secretions of symptomatic patients. hitherto, no animal model and no method for virus culture are available. as koch's revised postulates are not yet fulfilled for hbov well designed clinical studies should investigate the association between the virus and respiratory and possible gastrointestinal manifestation (arnold et al., 2006; kesebir et al., 2006) . however, statistical significant association between hbov detection and previously unexplained disease (allander et al., 2007 (allander et al., , 2005 and a significantly higher frequency of hbov dna detection in symptomatic than in asymptomatic individuals (allander et al., 2007 (allander et al., , 2005 kesebir et al., 2006 ) support the idea of a possible association of virus and clinical symptoms. co-infection with other viral pathogens is a frequently confirmed feature in hbov infection raising the question of causality (allander et al., 2007; kaplan et al., 2006; smuts and hardie, 2006) . at the children's hospital, university of bonn, viral rtis are prospectively investigated in a multicenter surveillance study since 1998 . this report discusses the prospectively documented viral rtis in hospitalized pediatric patients in the 2005-2006 winter season and focuses on the hbov infections detected. to put our results into perspective, we analyzed 17 publications (allander et al., 2005; arnold et al., 2006; bastien et al., 2006; choi et al., 2006; foulongne et al., 2006a,b; kaplan et al., 2006; kesebir et al., 2006; kleines et al., 2007; lin et al., 2007; lu et al., 2006; ma et al., 2006; manning et al., 2006; regamey et al., 2007; schenk et al., 2007; sloots et al., 2006; smuts and hardie, 2006; weissbrich et al., 2006) dealing with hbov-infection. in november 1999 a specific software tool developed at our institution for the targeted surveillance of hospitalized rsv-infected pediatric patients was made available for data entry. inclusion criteria and details of the surveillance protocol have been published recently (simon et al., 2007a . in 2004, the database was modified and reopened to clinical data entry considering other pathogens which cause viral respiratory tract infections (virti ped database) (simon et al., 2007a,b; wilkesmann et al., 2006) . for the purpose of this prospective analysis, all pediatric inpatients (hospitalized from november 01, 2005 to may 31, 2006) with virologically confirmed rsv, hmpv, hcov and hbov infection were included irrespective of age (<18 years), underlying disease, comorbidity and whether the infection had been acquired in the hospital or at home. a lower respiratory tract infection was only documented as 'pneumonia' only if a chest radio-graph confirmed the clinical diagnosis (donnelly, 2001) . the study protocol of the virti ped study was approved by the ethics committee of the university of bonn. before enrolment and data entry into the database, informed consent was obtained from parents or the patients' legal guardians. nasopharyngeal specimen from patients suffering from respiratory illness were tested as previously described for the following viruses: rt-pcr for human coronaviruses (nl63, sars, hku1, oc43, 229e) as described below, rt-pcr for human metapneumovirus (schildgen et al., 2004; viazov et al., 2003; wilkesmann et al., 2006) , rt-pcr and now ® rsv elisa (inverness medical, cologne, germany) for respiratory syncytial virus , human influenza viruses a and b and now ® influenza a/b elisa (inverness medical, cologne, germany), and human bocavirus (allander et al., 2005; kupfer et al., 2006; simon et al., 2007b) . except for human coronaviruses all methods were described in detail previously (allander et al., 2005; kupfer et al., 2006; schildgen et al., 2004; simon et al., 2006; viazov et al., 2003; wilkesmann et al., 2006) . for the amplification of hcov-specific sequences rna was extracted from nasopharyngeal aspirates with the qiaamp minelute virus spin kit (qiagen, hilden, germany) and subjected to a single-round rt-pcr (qiagen, hilden, germany) using a set of primers designed on the basis of comparison of pol orf1b sequences of known human coronaviruses (kupfer et al., 2006) . rt was carried out for 30 min at 42 • c followed by a pcr with one initial step of denaturation (95 • c for 5 min), 35 cycles of amplification (95 • c for 30 s, 50 • c for 30 s, 72 • c for 30 s) and a final elongation step (72 • c for 5 min). the primers used for the pan-coronavirus pcr were sv387as (5 -tca cay ttw gga tar tcc ca), sv388s (5 -act car atr aat ctt aar tay gc), and sv389s (5 -act caa atr aat ttr aar tay gc) at final concentrations of 0.6 m each. pcr-amplicons with a length of 251 basepairs were electrophoresed on an agarose gel and visualized by ethidium bromide staining. all positive pcr results, especially those that were positive for human bocavirus, were confirmed by sequencing. other common respiratory viruses such as human parainfluenza virus, human rhinoviruses or adenovirus were not included in the screening panel. amplicons were purified using the qiaquick pcr purification kit (qiagen, hilden, germany) and subjected to sequencing in both directions (bigdye terminator dna sequencing kit v3.1, applied biosystems, darmstadt, germany) as previously described (schildgen et al., 2004) . blastn (http://www.ncbi.nlm.nih.gov/blast) was used for comparison of the obtained sequences to nucleotide sequence databases. from november 01, 2005 to may 31, 2006, 389 nasopharyngeal aspirates (npa) from hospitalized pediatric patients with respiratory tract infection were investigated. specimens from 2.8% (n = 11) of all patients were positive for hbov. rsv, hmpv, hcov, influenza b viruses were detected in 13.9% (n = 54), 5.1% (n = 20), 2.6% (n = 10), and 1.8% (n = 7), respectively. there was no influenzavirus a detected. taken together, in 23.4% of all investigated children, at least one of the viral pathogens included into the diagnostic panel could be detected. most patients with hbov infection were found in december 2005 (fig. 1 ). the proportion of the hbov-positive specimens referring to all investigated specimens varied between 0.0% and 5.7% in the corresponding month of surveillance (fig. 2) . the median age of the hbovpositive patients was 9.0 months (range, 3-17 months), eight (73%) were male. the median duration of symptoms before the admission to the hospital was 4 days (range 1-23 days), the median duration of hospitalization was 5 days (range 2-15 days). one patient had a preexisting comorbidity (premature birth, birth weight 980 g). the clinical diagnosis was acute wheezing (bronchitis) in four patients, pneumonia in six patients (55%) and croup syndrome in one patient. in eight (73%) hbov-positive patients, the attending physicians ordered a chest radiograph, which yielded pathologic findings in seven patients (one peribronchitis, four bronchopneumonias, two lobar pneumonias). in five of six patients with radiologically confirmed pneumonia, hbov was the only pathogen detected. while no patient had to be mechanically ventilated, 73% needed oxygen supplementation. the median leukocyte count at diagnosis was 11.3 × 10 9 l −1 (range: (6.7-16.7) × 10 9 l −1 ); the median c-reactive protein was 12.5 mg/l (normal < 0.3mg/l; range: < 0.3-114 mg/l). the patients received treatment with betamimetics (inhalative; 10/11; 91%), systemic steroids (6/11; 55%) and antimicrobial chemotherapy (9/11; 82%); it has to be considered, that only in those patients with rsv-coinfection, the attending physicians were aware of a viral pathogen at the time of the clinical event. beside one patient, in whom hbov was detected at two consecutive days in two respiratory specimens, no follow up investigations were performed. in 7 of 11 hbov-positive patients no other pathogen was detected, in 4 (36.4%) at least one other viral pathogen was found (plus rsv n = 3; 27.3%; norovirus n = 1; 9.1%). this report represents the first prospective investigation of hospitalized pediatric patients with hbov infection. although the proportion of hbov-positive specimens (2.8%) in our study was relatively low (range in the literature 1.5% (bastien et al., 2006) to 18.3% (kaplan et al., 2006) ), illness severity was remarkable with radiological confirmed pneumonia and need for oxygen supplementation in the majority of the patients. another recently published prospective study detected hbov in five (4.5%) of 112 infants with rti in a birth cohort study in switzerland (regamey et al., 2007) ; all these infants had mild disease and none was hospitalized. so, to define the definite role of hbov as a respiratory pathogen, prospective population-based multicentre studies will have to be performed. most authors observed a higher prevalence of hbovinfection in the cold winter and spring months (allander et al., 2005; regamey et al., 2007; smuts and hardie, 2006) . choi et al. (corea 2000 -2005 (choi et al., 2006) reported a relatively high occurrence of hbov in late spring and early summer and bastien et al. (2006) from canada detected hbov throughout the year with no apparent seasonal prevalence. our data was collected during the months november 2005 and may 2006 and therefore, cannot contribute to an evaluation of the incidence of hbov during the warm months of summer and early fall. nevertheless, it showed a steady incidence during the cold months of fall and winter (fig. 2) in accordance with most authors (allander et al., 2005; arnold et al., 2006; kesebir et al., 2006) . the prevalence of hbov-infection (more precisely defined: the detection of hbov-genome in respiratory secretions of symptomatic patients) among hospitalized children with respiratory tract infection in the analyzed studies ranged between 1.5% (bastien et al., 2006) and 18.3% (kaplan et al., 2006) . the majority of children with hbov-infection was younger than 24 months (allander et al., 2005; smuts and hardie, 2006) . two recently published studies included control groups of asymptomatic children (kesebir et al., 2006; manning et al., 2006) . kesebir and coworkers isolated hbov dna in 22 of 425 npa specimens from symptomatic children while in none of the specimens from 96 asymptomatic children hbov dna could be detected. only one of the 21 hbov-positive patients in the scottish study was an asymptomatic child (manning et al., 2006) . clinical symptoms most frequently associated with human bocavirus infection include cough, rhinorrhea and fever up to 39.5 • c (schenk et al., 2007) . gastrointestinal symptoms were described in up to 25% of all patients (arnold et al., 2006; kesebir et al., 2006) . two of the hbov dna positive individuals (18%) presented with diarrhea. in one of the two patients norovirus was detected in a stool sample, whereas the other patient showed no other pathogen in stool specimens. however, our study was not designed to evaluate gastrointestinal disease. members of the parvovirus family described in cattle cause gastrointestinal symptoms. considering the stability of the human parvovirus b19, long-term persistence of hbov in the inanimate environment may foster a fecal-oral route of transmission via contaminated fomites. further studies should consider testing stool samples for human bocavirus to confirm gastrointestinal manifestation. the most common clinical diagnoses of hbov-positive patients included upper respiratory tract infection, bronchitis, bronchiolitis, pneumonia and exacerbation of asthma bronchiale. this spectrum of diagnoses is in accordance with other viral respiratory tract infections. similar to the situation in rsv-and in hmpv-infection (williams et al., 2004) there is a lack of international consensus about the definition of certain diseases which are important in this clinical context (american academy of pediatrics, 2006; smyth and openshaw, 2006) . two studies provided differing definitions (arnold et al., 2006; choi et al., 2006) whereas the 15 remaining publications do not describe their criteria. the percentage of 'bronchiolitis' within the diagnostic spectrum ranged between 3.2% (weissbrich et al., 2006) and 46% (foulongne et al., 2006a,b) . only 6 out of 17 publications (allander et al., 2005; arnold et al., 2006; kesebir et al., 2006; kleines et al., 2007; ma et al., 2006; schenk et al., 2007) stipulated radiological confirmation of any 'pneumonia'. similar to rsv (weigl et al., 2003) or hmpv , there are no distinct clinical signs in hbov-infected patients which allow an etiological diagnosis on clinical grounds alone. arnold et al. (2006) reported a median leukocyte count of 13.3 × 10 9 l −1 ; ma et al. (2006) found a median leukocyte count of 13.1 × 10 9 l −1 and a median crp of 0.6 mg/l (< 0.2-4.48) in hbov-infected subjects. this confirms our findings, that elevated leukocyte and crp-values may be found in hbov-infected children. the high percentage of pathological findings on chest radiographs in our study is in accordance with the results of other clinical research groups, which ranged from 43% (allander et al., 2005) to 83% (foulongne et al., 2006a,b; kleines et al., 2007) . allander and co-workers reported interstitial bilateral infiltrates in six of seven performed chest-x-rays. obviously, hbov does not only cause central pneumonia ( fig. 1) but also interstitial and lobar pneumonia with or without pleural effusion (schenk et al., 2007) . neither clinical symptoms nor laboratory parameters nor radiological findings are sufficient to make a clear distinction between bacterial and viral cause of pneumonia in these patients (korppi, 2003 (korppi, , 2002 mcintosh, 2002) . the results of our study show a coinfection rate of 36%. such high percentage was also found in the majority of the analyzed studies which report coinfection rates of 18% (allander et al., 2005) to 72% (kaplan et al., 2006) with rsv being the most prevalent copathogen in most studies (kleines et al., 2007) . manning et al. (2006) detected a significantly higher rate of coinfections in hbov-positive patients (43% [23/53] vs. 17% [47/271] positive for another viral pathogen; p < 0.001). differences in sensitivity of screening methods and the diagnostic panel for the detection of additional respiratory pathogens strongly affect coinfection rates. our study's respiratory virus panel did not include adenovirus, human parainfluenza virus and human rhinovirus which might have contributed to an even higher rate of coinfection. since the incubation period of hbov-infection is unknown it is not possible to comment on the incidence rate of nosocomial infections. so far there have been neither studies on the tenacity of the virus nor the effect of commonly used disinfectant soap and solutions (hota, 2004) . parvovirus b19 shows high tenacity and great resistance to commonly used disinfectants (dowell et al., 1995) . due to the close relationship within the family of the parvoviridae it is possible that hbov shows similar characteristics. kesebir and co-workers reported three patients (14%) with nosocomial hbov-infection (n = 22). the infected infants (1, 4 and 6 months of age) had been hospitalized since birth. sequencing of two isolates showed identical nucleotide sequences. kleines et al. (2007) described three additional hbov dna positive patients, who developed respiratory symptoms after hospital treatment for other diseases for at least 4 weeks. kesebir et al. (2006) reported three patients (14%) with nosocomial hbov infection (n = 22). vertical transmission has not been ruled out as the authors did not acquire npas from the parents. none of the patients described in our study was suspected to have a nosocomially acquired hbov infection. in our centre 82% of hbov-positive patients received antibacterial chemotherapy. before hbov was known, for the responsible physicians, children with hbov-infection are mostly "rsv-negative patients with pneumonia". the uncertain etiology of the clinical illness of respiratory infections may explain the excessive application of antibiotics. viral infection of the respiratory tract has frequently been associated with recurrent airway obstruction ('wheezing') among infants and asthma exacerbation among older children. in our patients 4 out of 11 presented with wheezing as the leading symptom of their respiratory infection. all recently published clinical studies on hbov report asthma exacerbation as a clinical symptom in up to 27% of the hbov-positive patients (arnold et al., 2006; foulongne et al., 2006a,b) . half of the patients in the study by allander et al. (2005) presented asthma bronchiale as an underlying disease. recently, allander et al. (2007) detected hbov in 49 of 259 (19%) children (median age 1.6 years) hospitalized with acute wheezing. a large proportion of the cases were mixed infections with other viruses, but hbov was the only virus detected in 12 children (5%). high viral loads of hbov were noted mainly in the absence of other viral agents, suggesting a causative role for acute wheezing. in addition, infections that had uncertain clinical relevance and low viral loads were prevalent. hbov dna was frequently detected in serum specimens obtained from patients with acute wheezing, suggesting systemic infection. these recent results suggest a model for hbov infection in which high viral loads are potentially associated with respiratory symptoms and low viral loads indicate asymptomatic shedding. therefore, quantitative polymerase chain reaction analysis may be important for additional studies of hbov (allander et al., 2007; anderson, 2007) . several clinical research groups reported hbov-positive immunosuppressed/ immunodeficient patients in their studies (arnold et al., 2006; manning et al., 2006; smuts and hardie, 2006) . arnold et al. (2006) presented two pediatric patients with hbov-infection after organ transplantation. smuts and hardie (2006) reported hbov-infection in eight hiv-infected pediatric patients and manning and co-workers included two infected non-specified immunosuppressed adult patients in their study (arnold et al., 2006; manning et al., 2006; smuts and hardie, 2006) . there were no immunocompromised individuals among the hbov dna positive patients treated at our center during the winter season 2005/ 2006. our group has recently published the clinical case of a severe hbov-infection of a 28-year-old female patient with malignant b-cell lymphoma (kupfer et al., 2006) . on admission the patient showed pancytopenia, high fever and clinical and radiological signs of pneumonia (reticulo-nodular infiltrates in the ct-scan of the thorax). despite the application of antibiotics, antifungal agents and ganciclovir the patient presented persistent fever for 14 more days. hbov was retrospectively detected as the sole pathogen in the nasopharyngeal aspirate of this high-risk patient. the patient was discharged after 41 days of hospitalization. as long as we do have only a limited number of studies comparing detection rates in symptomatic and asymptomatic people (fry et al., 2007) , and neither an animal model nor a reliable cell culture method (anderson, 2007) , it remains difficult to confirm koch's postulates and prove the causative role of hbov as a real pathogen. how high is the rate of hospitalization in infected outpatients? fecal excretion of hbov as shown by vicente et al. (2007) adds new concern about the transmission of hbov. is hbov transmitted via fecal contamination in addition to respiratory secretions? human bocavirus is prevalent among children with acute wheezing and can cause systemic infection (allander et al., 2007) , raising the question whether there is a risk of parenteral transmission via blood products or blood contamination. also tenacity of hbov has not been determined yet and its susceptibility to hospital grade disinfectants will have to be investigated. studies from the united states and germany reported nosocomial infections (kesebir et al., 2006) . however, due to the limited number of investigated cases the true impact of hbov as nosocomial infection remains uncertain. its investigation requires additional prospective studies. co-infection is a frequent finding in hbov dna positive patients. it remains to be determined whether hbov plays a role modifying the clinical presentation of other viral respiratory tract infections (rsv, hmpv). to this point authors have collected very little data to evaluate the probability of bacterial superinfection in hbov infection. having been subject to several studies concerned with pediatric populations hbovs role as a pathogen in adult populations has still to be investigated. is hbov a clinically relevant pathogen among the elderly (copd, patients >60 years of age) and among patients with underlying diseases and predisposing risk factors (immunodeficiency, chronic lung diseases, prematurity)? due to the retrospective manner of data collection of most of the performed studies no sufficient evaluation of the outcome of therapeutic interventions could be made to this point. which therapeutic interventions are of confirmed benefit in children with severe hbov infection? prospective multicenter population based studies and much additional work in the virological laboratories will be necessary to clear up these points. human bocavirus and acute wheezing in children cloning of a human parvovirus by molecular screening of respiratory tract samples diagnosis and management of bronchiolitis human bocavirus: a new viral pathogen human bocavirus: prevalence and clinical spectrum at a children's hospital human bocavirus infection the association of newly identified respiratory viruses with lower respiratory tract infections in korean children practical issues concerning imaging of pulmonary infection in children parvovirus b19 infection in hospital workers: community or hospital acquisition? human bocavirus in french children human bocavirus in children human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in thailand contamination, disinfection, and cross-colonization: are hospital surfaces reservoirs for nosocomial infection? human bocavirus infection among children human bocavirus infection in young children in the united states: molecular epidemiological profile and clinical characteristics of a newly emerging respiratory virus high prevalence of human bocavirus detected in young children with severe acute lower respiratory tract disease using a standard pcr protocol and a novel real time pcr protocol community-acquired pneumonia in children: issues in optimizing antibacterial treatment mixed microbial aetiology of community-acquired pneumonia in children severe pneumonia and human bocavirus in an adult quantification of human bocavirus in lower respiratory tract infections in china erdman dd. real-time pcr assays for detection of bocavirus in human specimens detection of human bocavirus in japanese children with lower respiratory tract infections epidemiological profile and clinical associations of human bocavirus and other human parvoviruses community-acquired pneumonia in children respiratory syncytial virus: the virus, the disease and the immune response isolation of human bocavirus from swiss infants with respiratory infections human bocavirus dna detected by quantitative real-time pcr in two children hospitalized for lower respiratory tract infection new variant of the human metapneumovirus (hmpv) associated with an acute and severe exacerbation of asthma bronchiale the dsm rsv ped study group. respiratory syncytial virus infection in 406 hospitalized five premature infants: results from a prospective german multicentre database detection of bocavirus dna in nasopharyngeal aspirates of a child with bronchiolitis nosocomial respiratory syncytial virus infection: impact of prospective surveillance and targeted infection control evidence of human coronavirus hku1 and human bocavirus in australian children human bocavirus in hospitalized children high prevalence of human metapneumovirus infection in young children and genetic heterogeneity of the viral isolates human bocavirus, a respiratory and enteric virus can respiratory syncytial virus etiology be diagnosed clinically? a hospital-based case-control study in children under 2 years of age frequent detection of bocavirus dna in german children with respiratory tract infections human metapneumovirus infections cause similar symptoms and clinical severity as respiratory syncytial virus infections human metapneumovirus and lower respiratory tract disease in otherwise healthy infants and children this work was supported by a research grant from the else kröner-fresenius stiftung, germany. we are grateful to dr. tobias allander for providing the bocavirus control plamsid. this work was partially supported by research grants from the else kröner-fresenius stiftung (p15/07//a22/07) and the european commission (lshm-ct-2006-037276). key: cord-264713-38dlh3wg authors: vernet, guy title: molecular diagnostics in virology date: 2004-08-20 journal: j clin virol doi: 10.1016/j.jcv.2004.06.003 sha: doc_id: 264713 cord_uid: 38dlh3wg molecular biology has significantly improved diagnosis in the field of clinical virology. virus discovery and rapid implementation of diagnostic tests for newly discovered viruses has strongly beneficiated from the development of molecular techniques. viral load and antiviral resistance or subtyping assays are now part of the biological monitoring of patients chronically infected by human immunodeficiency virus (hiv), hepatitis b virus (hbv), hepatitis c virus (hcv) and cmv. it will be important to add to this panel assays for other viruses of the herpesviridae family. qualitative assays for the detection of blood-borne viruses have increased safety of blood donation and organ transplantation. screening of other blood-borne viruses (parvovirus b19, hav), multiplexing of detection and test automation to improve practicability and reduce costs will be the next steps. a major evolution in the near future will be the generalization of nat for the diagnosis of viral etiology in patients, mostly with respiratory, cns or gastro-intestinal diseases. major technical improvements have been made to avoid obstacles that still limit this generalization, i.e. genetic variability of viruses, multiplex detection, contamination risk. commercial offers already exist but menus must be extended to limit the validation and documentation work associated with home-brew assays. real-time amplification has allowed the development of new nat platforms but automation and integration of all steps of the reaction are still required to reduce hands-on-time, time-to-result and costs, and to increase throughput. molecular biology has revolutionized all domains of viruses diagnosis including the rapid identification of emerging or re-emerging viruses, viral safety of blood products or organ transplants and viral disease management. one of the major driving forces for the introduction of molecular techniques in virology has been the absence of easy and performing multiplication techniques similar to those developed for bacteriology. the most striking illustration of the power of molecular techniques concerns blood transmitted viruses-human immunodeficiency virus (hiv), hepatitis b virus (hbv) and hepatitis c virus (hcv) for which spectacular progresses in the detection and treatment of viral diseases have been made following the introduction of qualitative and quantitative nucleic acid tests (nat). the recent discovery of a new human coronavirus responsible for severe acute respiratory syndrome (sars) epidemic is another example. it is obvious that nat will encourage the development of antiviral drugs which, compared to antibiotics, has been delayed partly because performing efficiency assessment techniques were lacking. during the last 15 years, many new human pathogens have been discovered among which eight were viruses with various pathogenicity. molecular techniques have played a central role in their discovery (table 1) . the construction of cdna libraries by cloning techniques has been used to identify hcv and hepatitis e virus. representational difference analysis (rda) was successful in identifying human herpes virus 8 (hhv-8), and the hepatic viruses gbv-c and ttv. rda allows the detection of viral sequences by comparing whole nucleic acids sequences in cells from humans or animals before and after infection. reverse-trancription polymerase chain reaction (rt-pcr) with random or degenerate primers has been used to identify human metapneumovirus (hmpv), the virus sen and the coronavirus associated to sars (sars-cov). molecular techniques alone have allowed the characterization of very important human pathogens like hhv-8, responsible of kaposi sarcoma or hcv which induce acute or chronic hepatitis, cirrhosis and hepatocarcinoma. however, other viruses detected in a similar way are still waiting for the demonstration of their clinical importance. this illustrates the need to verify koch's postulate and the importance of keeping laboratory competencies for classical virology-tissue culture, electron microscopy and animal experiments-which plays a major role in virus discovery, together with epidemiological studies. large epidemiological studies are also required to assess the clinical interest of new pathogens. molecular diagnostics have been very rapidly implemented in clinical virology laboratories following the discovery of hmpv (van den hoogen et al., 2001; peiris et al., 2003; boivin et al., 2003) and sars-cov (ksiazek et al., 2003; drosten et al., 2003; anderson, 2003) . a prospective study on the prevalence of hmpv could be initiated as early as during the 2000-2001 winter, although the virus has been discovered in 2000 only. there has been only a few weeks lag between sequencing sars-cov and availability of the first commercial nat. nat are more and more used to exclude blood donations from patients infected by viruses (allain, 2003) . hcv and hiv testing has been implemented as part of routine screening in blood banks in 14 and 7 european countries respectively. in france, two commercial offers -procleix (gen-probe, inc. usa) and nuclisens extractor (biomerieux, france) associated with cobas ampliscreen (roche diagnostics, switzerland)-are used to screen donations for hiv and hcv infections. this allowed the reduction of residual risk from 1 in 400,000 to 1 in 2.5 millions for hiv and 1 in 760,000 to 1 in 5 millions for hcv (assal et al., 2003) . however, there is room from improvement as few contaminated blood units are still missed due to the lack of sensitivity induced by pooling strategies. cost constraints must also be considered if further improvements are to be considered. cost effectiveness of hiv and hcv nat addition to serology testing is already very low: in usa it has been calculated that the cost of each saved life is 4.7-11.2 millions us$ per year (jackson et al., 2003) . hepatitis b virus screening using molecular biology should also be included as even the most recent antigen assays (hbsag) assays miss infected blood units. as an example, single-sample hbv testing would allow the detection of 35-50 additional contaminated units among 10 7 units tested (biswas et al., 2003) . monovalent or trivalent assays (hiv, hbv, hcv) are proposed by roche diagnostics (ampli nat) and gen-probe (procleix ultrio) but blood units should not be pooled to provide sufficient sensitivity. procleix ultrio detects single seroconversions 20 days earlier than abbott prism-hbsag but only 13 days in pools of 8 and 11.5 days in pools of 24 (cambié, 2002) . alternatively, an ultracentrifugation step could be introduced following pooling to obtain a higher sensitivity compared to current antigen assays (roth et al., 2002) . screening for west-nile virus contamination has been implemented in us blood banks. from late june to mid-september 2003, approximately 2.5 million donations were screened. twelve hundred eighty-five (0.05%) were initially reactive for wnv by using nucleic acid-amplification tests and 601 (0.02% of the total donations) are considered presumptive viremic donations (i.e. a donation that is repeatedly reactive by the primary and/or alternate nat assay or a primary nat assay with a very high signal) (cdc, 2003) .other viruses (parvovirus b19, hepatitis a virus) are also transmitted by blood donation and may be part of the screening in a near future. however, nat may not always be the best diagnosis approach and antigen tests or antibody tests may be efficient and less expensive alternatives. automation and integration of nat is necessary to reduce costs and quarantine delays for blood units supply. in this respect, the recent approval by us food and drug administration (fda) of the tigris molecular diagnostic system (gen-probe, san diego, usa) is a major breakthrough as it has been designed to process 500 samples in 8 h. integration and time-to-result are also very important parameters to be considered to insure viral safety of transplant organs, especially lung, heart and liver. it is very important to determine the status of transplants regarding infection by hiv, hbv, hcv and viruses from the herpesviridae family. nat have significantly improved identification of viruses as etiologic agents of human diseases affecting various organs, especially respiratory and gastro-enteric tracts and central nervous system (cns). as a consequence, rapid antiviral treatments can be initiated and considerably reduce morbidity and mortality as, for example, in the case of herpes encephalitis. the increasing number of available antiviral drugs will even accentuate the need for positive viral identification. similarly, unnecessary antibiotic treatments can be avoided or reduced and hospitalisation durations shorten. treatments of chronic viral diseases are very efficiently monitored by viral load assays. however there are still obstacles that prevent a wider dissemination of molecular assays. the extreme genetic variability of some viruses, especially rna viruses (which rna-polymerases have no proofreading activity), often makes their diagnosis difficult. the most striking examples are found in the norovirus family which contains viruses responsible for the vast majority of gastro-intestinal epidemics in adults. hiv diagnosis is also quite difficult to achieve due to its high genetic variability. gardner et al. (2003) have deduced from sequence alignments that a real-time taqman assay should contain not less than nine primer and probe sets to detect with the same sensitivity all hiv strains in a geographically representative panel. to reduce the impact of variability on amplification and detection efficiency, one can use primers and probes with 2 o-methyl bases, degenerate bases or "universal" bases, such as inosine or nebularine. touchdown pcr protocols, in which the annealing temperature slightly decreases during the successive amplification cycles to bracket the melting temperature tm of the reaction, provides sensitivity even when primers have mismatches with target sequences of divergent species in a viral family. finally, degenerate primers or probes, with mixtures of the bases found in sequence databases among various species, may be useful to detect all species of a viral family. it is often desirable to provide the capability for panel detection, i.e. to detect several viruses that can be responsible for a disease. for example, coyle et al. have described at the winter meeting of european society for clinical virology (copenhagen, january 2004) a molecular viral respiratory strip for the detection of 12 common respiratory viruses. whenever possible, consensus primers able to detect all viruses from a family or genus must be used. there are several examples of such consensus primers for enterovirus (kammerer et al., 1994) , flavivirus (scaramozzino et al., 2001) or herpesviridae (tenorio et al., 1993) . however, their ability to amplify all viruses with the same efficiency must be carefully evaluated. if such an approach is not possible, two different possibilities exist for panel detection: multiplex detection in single tubes or parallel detection in individual tubes. mixing primers in a single amplification tube to achieve multiplex detection of viruses usually results in decreased sensitivity of assays compared to single tests. for example, we have observed, using a dna-microarray assay (see below), that the analytical sensitivity of multiplex rt-pcr detection of six viruses, i.e. influenza a, influenza b, rsv a/b, parainfluenza 1, 2 and 3 is reduced by a factor of <1-2 logs compared to single detections, depending on the virus. nevertheless, this multiplex assay was able to identify correctly 21/22 infections in respiratory specimen (one rsv b infection was misidentified as rsv a; unpublished data). the formation of primer dimers is generally considered as the major cause of sensitivity loss but careful optimisation of all parameters of amplification including primer, enzymes, nucleotides and salts concentrations as well as protocol conditions are required to obtain expected performances. realtime assays (see below) that monitor signal apparition during the amplification step are also limited in their capacity to realize multiplex detection by the number of available wavelengths in existing equipments which currently allows the detection of three viruses only. instead of mixing several pairs of primers in a single tube, nucleic acids purified from the original clinical specimen can be distributed into several tubes for independent amplification and detection. major drawbacks of this approach are the reduction of sensitivity because of lower amounts of nucleic acid available for each individual amplification, higher hands-on times required to manipulate all the different tubes, difficulty to automate the distribution of small volumes of purified nucleic acids without introducing cross-contaminations and higher costs due to the need for enzymes in each tube. internal controls (ic) are important components to monitor each step of the assay from extraction of nucleic acids to detection. because inhibitors of the amplification reaction, which are frequent in some specimen types, will also impact its amplification, the presence of an ic is a strong validation in case of negative result. niesters (2002) has described an original approach for internal control of nat: the use of viral universal controls that can be added to each specimen and be amplified with specific primers, preferably in a multiplex format with primers for the virus to detect. seal herpes virus 1 and phocine distemper virus can be used to control nat for dna and rna viruses respectively. of course, animal viruses which can not infect humans are required. other strategies for ic involve synthetic materials, i.e. plasmids or transcripts which contain sequences able to bind the test primers and a specific probe. clinical virology laboratories have high expectations in term of automation and integration of molecular assays. a major bottleneck in the workflow of these laboratories is at the level of sample preparation. table 2 shows automated systems for nucleic acid purification that are currently commercialised. most of them use the nucleic acid binding properties of silica (boom et al., 1990) . as many as 96 samples can be handled in a single run on the biorobot 9604 (qiagen gmbh, germany). time-to-result and, more important, hands-on-time tend to decrease, with the most recent equipments requiring no longer than 20 min of technician time for more than 24 samples. new labelling technologies that do not need solid-phase separation have allowed the development of real-time molecular assays in which the detection of amplicons is done as soon as they appear during amplification. the most simple real-time detection chemistry uses the sybr green dye which specifically binds during double-stranded dna generated during pcr. several probe technologies (fig. 1 ) have also been designed for real-time assays like taqman ( fig. 1a ) or molecular beacons (fig. 1b) in which a quencher molecule is removed from the vicinity of the fluorescent marker upon binding to rna or dna generated during amplification cycles. in the fret technology (fig. 1c) , two probes, one with a fluorescence donor and one with a fluorescence acceptor molecule are designed to bind adjacent sequences of the amplified material to generate signal (mackay et al., 2002) . real-time techniques have been designed for pcr or nasba amplification and have several advantages which facilitate automation and reduce time-toresult (30-120 min) and hands-on-times. they are performed in closed devices which do not need to be opened to transfer amplified material for end-point detection, thus reducing the risk of laboratory or samples cross-contamination. the use of real-time platforms makes the general organisation of molecular biology laboratories easier by reducing the constraints on activities segregation in different rooms to control contaminations. table 3 shows existing real-time automates. the next generation of nat platforms will integrate sample preparation, amplification and detection in a single test device genexpert (cepheid, usa) is the first fully integrated system which allows the detection of bacillus anthracis or group b streptococcus in approximately 45 min directly from clinical specimen. several viral assays based on real-time nasba on this platform will soon be available from biomerieux. several ivd companies offer commercial nat for the diagnosis of viral diseases. besides technical difficulties, another obstacle to the development of molecular assays is the importance of resources needed to optimise, produce and validate home-brew assays and to build up documentation required for qualification of techniques and laboratories. new european community regulations will even increase this need. it is the role of in vitro diagnostic (ivd) companies to provide reagents which are the results of careful optimisation and are produced according to high quality manufacturing procedures. they have clinical and regulatory affairs departments that conduct validation studies and assemble documentation required to get approval of the reagents. however, even for ivd companies, the conception and validation process is time-consuming and timeto-market may be long. this is especially a problem when a diagnostic tool is urgently needed in case of emergence of a new virus. one possibility to reduce time-to-market is to release "research use only" (ruo) assays or assays that have the "ce analytical" approval in europe or the status of "analyte specific reagent" (asr) in the usa. in this case, commercial products that have excellent analytical sensitivity and are manufactured according to quality standards of the ivd industry can be used by clinical virology laboratories, which have the responsibility to validate their use as diagnostic tools and obtain authorization to use them. infections by hiv and hepatitis b and c viruses are usually well diagnosed using serology. only diagnosis of early primo-infections may benefit from nat. platforms like amplicor amplicor from roche diagnostics or easyq from biomerieux that are usually used for viral load measurement during therapy (see below) are also suitable for the early detection of hiv or hcv infections. many other infections and especially acute infections for which igm appear only several days after onset of symptoms cannot be efficiently diagnosed using serology assays. forty to sixty percent of community acquired pneumonia that require hospitalisation 2 have no known aetiology despite intensive investigation and this percentage is even higher when less severe lower respiratory tract infections (lrti) are considered (l. kaiser, personal communication). in a recent study, henrickson et al. (2004) , have shown, using multiplex rt-pcr that 40% of children hospitalised for lrti are infected with the seven most common respiratory viruses. similarly, a recent survey of encephalitis leading to hospitalisation in the usa from 1988 to 1997 has revealed that nearly 60% had no aetiology (khetsuriani et al., 2002) . absence of specific antiviral treatments for most viruses, which limits prescription of biological tests and weak performances of diagnostic tests based on viral culture or serology are major explanations of this situation. nat, which have been implemented by many large european hospitals, significantly improve viral diagnosis. however, there are several obstacles to the generalization of molecular diagnostics in smaller, decentralized laboratories. a major obstacle is the fact that, except for hiv, hbv, hcv and cmv, virology nat are most often home-brew assays which sometimes suffer from bad performances and poor batch to batch consistency. however, quality of nat is the percentage of false-positive results which reflects laboratory or cross-contaminations and used to be high, dropped to 5.5% (wallace et al., 2003) . table 5 shows some products currently commercialised by major companies for viruses other than hiv, hbv and hcv, although the list may not be exhaustive. most of them are asr or ruo kits although some are ec marked. the majority of these reagents have been designed to run on realtime platforms. results shown by liolios et al. in 2001 illustrate the interest of multiplex detection of respiratory viruses by nat. one hundred forty-three clinical specimen were tested using the hexaplex assay from prodesse inc. (usa) which detects six viruses in a single tube using pcr and detection with microplate capture and peroxidase-labelled probes. 9 samples were detected with the prodesse assay only and not with immunofluorescence or viral culture (table 6) . table 6 multiplex nat for the detection of respiratory viruses (hexaplex, prodesse inc.) dna-microarrays or dna-chips are very powerful detection tools that can be combined with amplification techniques to detect viruses or virus variants (reviewed in clewley, 2004) . wang et al. (2002) have described a microarray spotted with 70-mer oligonucleotides which represent the five most conserved sequences (more than 20/70 bases are conserved among all representative sequences in a virus sequence alignment) of each virus of interest. the chip contains 1600 different probes. following pcr amplification of genetic material in the clinical specimen using random primers, hybridisation onto the microarray was able to identify respiratory viruses in the enterovirus, rhinovirus, paramyxovirus, adenovirus and herpesvirus families. however, this technique has not yet been extensively validated for routine diagnosis in a clinical virology laboratory. we have developed assays combining rt-pcr and dna-microarrays for the detection of viruses. the arrays are manufactured using the photolithography in situ synthesis technology (affymetrix, usa) and contain 20-mer oligonucleotides. sequence signatures are identified using extensive sequence databases because they are conserved in all viruses of a genus or family or in all subtypes or isolates of a virus and are not found in other viruses. for each base of the signature, probes perfectly matching the target and probes with a mismatch at the interrogated position are present on the array. if polymorphisms are present in or near the signature, variant probes may also be present. consensus primers have been designed for enterovirus, flavivirus, herpesviridae, parainfluenza and influenza virus, rsv and adenovirus. they can be combined in multiplex detection pcr or rt-pcr assays for the diagnosis of viral respiratory or cns infections. following amplification, dna is labelled using a newly developed diazomethyl chemistry (laayoun et al., 2003) . a complete line of instruments (sample preparation, thermocycler, hybridisation station and laser scanner) is available to perform the assay. as described above, a respiratory assay designed to detect six major viruses (parainfluenza 1, 2 and 3, rsv a/b, influenza a and b) in a single specimen has demonstrated high clinical sensitivity in preliminary evaluation. fig. 2 illustrates the discriminatory capacity of this technology for cns viruses. assays for the identification of human papilloma virus (hpv) are commercialised by several companies. the detection of a highly pathogenic hpv type has a very high predictive value for cervical carcinoma. however, the number of hpv types that are more or less closely associated to cervical cancer is high. dna-microarrays may thus be appropriate for the multiplex detection of all these types. such an assay has been described by and is distributed by biomedlab co. (south-korea). it is based on a consensus amplification and on 30-mer probes that are able to detect and discriminate 22 hpv types and has shown an association of 92.5-97.5% between hpv positivity and lesions of different severity or carcinoma whereas hpv infection was only found in 35.1% of cases when cytology was normal. viral load platforms are available from several ivd companies (versant from bayer diagnostics; cobas ampliprep/ amplicor from roche diagnostics, minimag/nuclisens easyq from biomerieux). significant progress have been made in the ability of most hiv assays to detect all subtypes of hiv-1 but no commercial assay exist for hiv-2. the analytical sensitivity of hbv viral load assays should be increased to reach the same performances as those of hiv assays, especially in the case of infections by variants with low replication competencies. for efficient treatment monitoring of immunosuppressed patients, for example in the case of organ transplantation, viral load assays should also be developed for epstein-barr virus, varicella-zooster virus and hhv6. genotyping tests are now commercially available and are part of the biological follow-up of treated patients although home-brew assays are still used in most laboratories (korn et al., 2003) . hiv and hbv resistance assays as well as hcv subtyping assays are generally based on the sequencing technology (trugene hiv and hbv from bayer healthcare; vi-roseq hiv-1 from celera diagnostics; 5 genotyping hcv kit from bayer healthcare). hybridisation techniques, such as lipa assays (innogenetics, belgium) are also used. however, the number of probes that can be spotted on nitrocellulose strips is limited and only few polymorphisms can be detected which is convenient for hcv subtyping but does not for resistance tests which are based on the detection of a high number of mutations. in addition, hiv and hbv have highly variable genomes and naturally occurring polymorphisms that are present in the vicinity of resistance mutations may affect the binding efficiency of probes. dna-microarrays are an alternative for resistance or typing reagents for viruses or bacteria . we have developed an assay based on rt-pcr and detection with fig. 2 . biomerieux dna-microarray for the detection of neurotropic viruses. following nucleic acid purification, amplification is performed by pcr using a single touchdown protocol in three tubes, one for herpesviridae (one primer pair for hhv 1, 2, 3, 5 and 6), one for enteroviruses (one primer pair for all serotypes) and one for flaviviruses (one primer pair for all viruses). amplification products are combined and labelled using diazomethyl chemistry and hybridised on a dna-microaaray which contains 20-mer oligonucleotides. two or four probes are used for the detection of each base of sequence signatures determined for each virus. a total of 20,000 probes are synthesised on this dna-microarray which has been designed for the simultaneous detection of viruses from the herpesviridae family and from the flavivirus, enterovirus, paramyxovirus, poliomavirus, bunyavirus and orthopoxvirus genus. a: amplicons generated resolved using the bioanalyzer (agilent technologies). b: image of the dna-microarray obtained with a confocal laser reader. c: resolution capability of the array. closely related viruses hybridise with very different efficiency on heterologous probes. high density probe arrays, designed to detect 204 antiretroviral resistance mutations simultaneously in gag cleavage sites, protease, reverse transcriptase, integrase and gp41. this assay has been tested on a panel of 99 hiv-1 patients on a total of 4465 relevant codons in comparison with the classic sequence-based method. key resistance mutations were correctly identified in 95 and 92% of codons in protease and reverse transcriptase, respectively (gonzalez et al., 2004) . we have also developed a similar assay for the detection of polymorphisms in the complete hbv genome: 78 antiviral resistance mutations in pol gene, 146 vaccine, diagnostic or immunotherapy mutation in s gene and 209 mutations in basic core promoter, pre-core, core, x, pre-s1 and pre-s2 regions that may have an impact on disease evolution or treatment efficiency. this assay is currently under evaluation in the frame of hepbvar a european collaborative group for the study of emerging variants of hepatitis b virus. in the coming years, more and more laboratories will offer to clinicians viral diagnosis based on nucleic acid tests. many biological and instrumentation problems that have slowed the generalization of molecular assays have been resolved but several others remain and need to be addressed. major im-provements are expected in the integration and automation of nat diagnostic platforms to reduce hands-on-time, time-toresult and costs and to increase throughput. ivd companies have engaged in development programs to provide clinical virologists with equipments and application menus adapted to their diagnosis needs. technical constraints and recent improvements of molecular assays transfusion risks of yesterday and of today correlation of cervical carcinoma and precancerous lesions with human papillomavirus (hpv) genotypes detected with the hpv dna chip microarray method a novel coronavirus associated with severe acute respiratory syndrome application de la biologie moléculaireà la sécurité virale transfusionnelle: le dépistage génomique viral comparative sensitivity of hbv nats and hbsag assays for detection of acute hbv infection human metapneumovirus infections in hospitalized children rapid and simple method for purification of nucleic acids update: detection of west nile virus in blood donations-united states a role for arrays in clinical virology: fact or fiction identification of a novel coronavirus in patients with severe acute respiratory syndrome limitations of taq-man pcr for detecting divergent viral pathogens illustrated by hepatitis a, b, c, and e viruses and human immunodeficiency virus detection of hiv-1 antiretroviral resistance mutations with highdensity dna probe arrays national disease burden of respiratory viruses detected in children by polymerase chain reaction the cost-effectiveness of nat for hiv, hcv, and hbv in whole-blood donations nested pcr for specific detection and rapid identification of human picornaviruses burden of encephalitisassociated hospitalizations in the united states quality control trial for human immunodeficiency virus type 1 drug resistance testing using clinical samples reveals problems with detecting minority species and interpretation of test results characterization of a novel coronavirus associated with severe acute respiratory syndrome aryldiazomethanes for universal labeling of nucleic acids and analysis on dna chips comparison of a multiplex reverse transcription-pcr-enzyme hybridization assay with conventional viral culture and immunofluorescence techniques for the detection of seven viral respiratory pathogens real-time pcr in virology clinical virology in real-time children with respiratory disease associated with metapneumovirus in hong kong nat for hbv and anti-hbc testing increase blood safety comparison of flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-pcr assay for detection of flaviviruses targeted to a conserved region of the ns5 gene sequences a newly discovered human pneumovirus isolated from young children with respiratory tract disease species differentiation and antibiotic susceptibility testing with dna microarrays linkage between the journal and quality control molecular diagnostics (qcmd) microarray-based detection and genotyping of viral pathogens key: cord-268993-2sjh17mw authors: rödel, jürgen; egerer, renate; suleyman, aynur; sommer-schmid, beatrice; baier, michael; henke, andreas; edel, birgit; löffler, bettina title: use of the variplex(tm) sars-cov-2 rt-lamp as a rapid molecular assay to complement rt-pcr for covid-19 diagnosis date: 2020-08-31 journal: j clin virol doi: 10.1016/j.jcv.2020.104616 sha: doc_id: 268993 cord_uid: 2sjh17mw background: molecular assays based on reverse transcription-loop-mediated isothermal amplification (rt-lamp) may be useful for rapid diagnosis of the severe acute respiratory syndrome coronavirus-2 (sars-cov-2) because of the easy performance and the option to bypass rna extraction. objectives: this study was designed to evaluate the clinical performance of the ce-labeled variplextm real time sars-cov-2 rt-lamp assay in comparison to commercial rt-pcrs. study design: rna extracted from pharyngeal swabs was tested by variplex™ rt-lamp and corman’s lightmix™ e gene rt-pcr as reference. samples of respiratory secretions from coronavirus infection disease (covid-19) and negative control patients were analyzed by variplex™ without rna extraction and tested in parallel with the allplex™ and viasure bd max rt-pcrs. results: using isolated rna variplex™ rt-lamp showed a sensitivity of 75% compared to lightmix e gene rt-pcr but contrary to the latter it produced no false-positive results. for the evaluation of samples from respiratory secretions concordance analysis showed only a moderate agreement between the variplex™ rt-lamp conducted on unprocessed samples and allplex™ and viasure rt-pcrs (cohen’s κ ranging from 0.52-0.56). using the approach to define a sample as true-positive when at least two assays gave a positive result the clinical sensitivities were as follows: 76.3% for variplex™, 84.2% for allplex™ and 68.4% for viasure. however, when results of rt-pcr and rt-lamp were combined diagnostic sensitivity was increased to 92-100%. conclusion: the variplex rt-lamp may serve as a rapid test to be combined with a rt-pcr assay to increase the diagnostic accuracy in patients with suspected covid-19 infection. the severe acute respiratory syndrome coronavirus-2 (sars-cov-2) pandemic has already caused an enormous burden on healthcare systems worldwide [ high analytical sensitivity several studies reported on false-negative as well as fluctuating results in patients whose clinical diagnosis using chest ct was in accordance with covid-19 [2, 7] . problems with clinical sensitivity of nucleic acid amplification tests can be due to analytical errors of rna isolation procedures and choose of inadequate primers. other challenges in diagnostics are associated with the significantly increased requests for testing, resulting in time delays to generate diagnostic reports [8, 9] . moreover, mass testing has rapidly caused serious shortages in the supply of rna purification kits in many countries [9, 10] . for a rapid diagnosis of sars-cov-2 cost-effective methods with low hands-on time that circumvent limitations of rt-pcr may be helpful tools for a routine diagnostic workflow [9, 11] . rt-loop-mediated isothermal amplification (lamp) may offer the possibility to be established as an alternative diagnostic technique [12] [13] [14] . the combination of rt with bst polymerase possessing a dna strand displacement activity allows amplification of target genes at a constant temperature in less than one hour. rna purification can be bypassed j o u r n a l p r e -p r o o f depending on the sample type and different transport media because of the robustness of the polymerase. there are several studies that demonstrated satisfying sensitivity and specificity of rt-lamp for sars-cov-2 detection but little is known about its performance of testing clinical samples directly without rna extraction [11] [12] [13] [14] . in this study we evaluated the newly introduced ce-labeled variplex sars-cov-2 lamp assay and compared the clinical performance with commercial rt-pcr tests. testing was performed using pharyngeal washes and samples from respiratory secretions, including sputum, endotracheal secretions, and bronchoalveolar lavage. pharyngeal specimens were collected using eswab™ transport systems (copan, brescia, italy). total viral rna was extracted from 200 l of the sample medium using the qiasymphony dsp virus/pathogen mini kit (qiagen, hilden, germany. extraction was performed on the automated qiasymphony sp instrument (qiagen). purified rna was eluted in 60 l ave buffer and divided into two parts for testing. to rule out cross-reactivity with human coronaviruses 229e and oc43 external quality assessment samples (instand e.v., düsseldorf, germany) were processed in a similar manner. reference rt-pcr was performed using the lightmix modular sars-cov e-gene primers (tib molbiol, berlin, germany) and the lightcycler multiplex rna virus master (roche, penzberg, germany) [15] . rt-pcr was run on a lightcycler 480 (roche, penzberg, germany). the variplex sars-cov-2 is a qualitative molecular assay using a mix of 6 oligonucleotide primers targeting a 282-bp sequence of the membrane protein (m) gene. for a single test 15 l of rt master mix and 8 l of eluted rna were pipetted into two wells of a genie test strip (amplex diagnostics). 2 l of the primer mixes for sars-cov-2 or the inhibition control were added to one each well. tests were run at 65 o c for 40 min using a genie ii mk2a device (amplex diagnostics). amplification was measured by real-time fluorescence detection using a dna intercalating dye. data interpretation and calculations were automatically performed by the integrated eazyreport tm software (amplex diagnostics). for the viasure assay 200 l of the sample was used for rna extraction. viasure rehydration buffer and gene reaction tubes containing a ready-to-use master mix were loaded onto bd max exk tna-3 reagent strips. nucleic acid extraction and real time rt-pcr were performed on the automated bd max system (bd). to assess the analytical sensitivity of the assays the sars-cov-2 isolate jena/2020/5159 propagated and titrated on vero-76 cells was used. 10-fold serial dilutions of a virus stock of 10 7 tcid50/ml in a pharyngeal wash were mixed with copan sl solution and processed for the different assays as described above. the qualitative performance of the assays was assessed by calculating the specificity, sensitivity, negative and positive prospective values, and accuracy. for reference a sample was defined as true-positive when at least two different tests gave a positive result. concordance of two diagnostic tests was examined by cohen's  coefficient analysis. pearson coefficient analysis. first, we analyzed a panel of pharyngeal swabs sent to the laboratory for routine sars-cov-aliquots were tested. samples with divergent results between lightmix rt-pcr and rt-lamp were verified by viasure and allplex assays in order to identify false-positively tested specimen. 10 out of 96 rna eluates that were lightmix e-positive could not be confirmed by a second test and were defined as false-positive. their median ct value was 36.6 (iqr 36.1-37.6). in contrast, no false-positive results were observed using the variplex rt-lamp. however, the sensitivity of rt-lamp was only 75% ( to verify the sensitivity of rt-lamp extracted rna from a log-dilution series of a virus stock was tested. the variplex assay achieved a reliable detection at 1 tcid50/ml, corresponding to 0.03 tcid50/reaction. in comparison lightmix rt-pcr showed 100% detection down to 0.1 tcid50/ml. this concentration was positive by rt-lamp in 33% of the samples (table 2 ). next, we investigated a panel of clinical samples that were tested by rt-lamp without rna extraction. only samples from respiratory secretions and pharyngeal washes were used because in preliminary experiments we observed inhibitory effects by transport media of swabs on rt. a total of 43 specimens collected from 20 patients were included. from 6 patients 3 or more samples were obtained during the course of the disease. as controls we examined 30 samples from patients that were repeatedly tested negative by lightmix screening rt-pcr. respiratory secretions from covid-19 patients were often highly viscous and tough. to homogenize the specimens they were mixed with copan sl solution. this procedure was applied to all samples to standardize the methodology. homogenized samples diluted in lptv buffer were directly pipetted into the master mix for rt-lamp. for comparative analysis two aliquots were subjected to rna isolation and rt-pcr using the j o u r n a l p r e -p r o o f allplex and viasure bd max assays. all tests did not produce false-positives results in the group of control patients. from the samples of covid-19 patients heterogeneous results were obtained. as expected a high agreement of results was found for the three different targets of the allplex assay (table 3) . the results obtained with the variplex rt-lamp only showed a moderate agreement to both the allplex and viasure rt-pcr results (table 3) . to calculate how the moderate cohen's  concordance coefficients were related to different sensitivities of the assays we defined a sample as true-positive when at least two target genes of the virus were detected. when only one target gave a positive signal the sample was tested by the lightmix rt-pcr to verify the result. using this approach, all assay had sensitivities <90% (table 4 ). the allplex rdrp assay offered the highest sensitivity of 84%, followed by e and n gene tests from the same kit. combining the three targets of allplex did not result in a higher positive rate of the samples. the sensitivity of the viasure assay was only 68.4% and that of the variplex rt-lamp was in between, at 76.3% (table 4 ). however, when results of the variplex rt-lamp were combined with those of the viasure s or allplex rdrp rt-pcr diagnostic sensitivity was increased to 92 and 100%, respectively (table 4) table 5 shows the course of testing an icu patient over 30 days, illustrating the fluctuating results by different assays. in comparison the different sensitivities of the assays were also examined using simulated samples. for these experiments we started at 300 tcid50/ml because of the dilution of the samples in lptv buffer for direct rt-lamp testing. as shown in table 6 the allplex rt-pcrs reached higher sensitivities than the other assays. the lower sensitivity of the variplex rt-lamp was probably caused by the relatively high dilution of the sample in lptv buffer because the limit of detection of 0.004 tcid50/reaction was satisfying in comparison to the allplex rt-pcr. timely and accurate laboratory diagnosis of patients with the suspicion of sars-cov-2 infection is important for optimizing patient treatment and preventing transmission to other persons [3]. rt-pcr is the standard method to detect an acute infection and is also used to identify asymptomatic carriers [16, 17] . however, several studies have reported false-negative results in initial testing of symptomatic patients as well as during the course of the disease in no small measure that can have an impact on isolation or discharge of patients [2, 7]. it has been suggested that a single rt-pcr assay should not be the only laboratory diagnostic marker [7, 16] . the data of this study demonstrate that the variplex lamp sars-cov-2 assay may be suitable as an additional tool to close gaps in covid-19 diagnosis. by using extracted rna the variplex rt-lamp assay showed a lower sensitivity, compared to our screening e gene rt-pcr, but performance was acceptable when only e gene ct values <35 were considered. this cut-off has been chosen because on one hand it has been proposed that patients diagnosed with high ct values are rather non-infectious and on the other hand we could identify several false-positive rt-pcr tests that were associated with a high ct value [18] . a major advantage of rt-lamp is that it allows a simple testing of specimens when unprocessed samples are used, bypassing the bottleneck of rna extraction [9, 19] . against j o u r n a l p r e -p r o o f the background of irregularities regarding the delivery of rna isolation kits by many manufacturers rt-lamp would be highly attractive as an alternative easy-to-use technology [9, 13] . for direct testing we focused on samples from respiratory secretions and pharyngeal washes instead of swabs because several transport media can inhibit or reduce rt activity, as reported in recent studies [10, 11] . another reason was that the supply of swabs with fluid transport media was running into a critical shortage in a phase of significantly increased demand for testing. . by using rt-lamp to test unprocessed samples this problem is avoided but rt activity may be inhibited by carbohydrates and salts depending on the sample composition [10] . in this context suitable specimen types have to be carefully evaluated. saliva which has been described to contain high virus copy numbers may also represent a potential specimen type for direct rt-lamp testing [13, 20] . in conclusion this study shows that the variplex sars-cov-2 rt-lamp assay may serve as an easy-to perform rapid molecular test to be combined with rt-pcr in order to ensure an efficient workflow of timely and accurate diagnosis even at times of high work load and increased testing requests. the major limitation of this work was the relatively small sample size due to low numbers of covid-19 patients in our hospital. future studies are needed to examine the utility of rt-lamp under routine conditions with high sample throughput. the authors declare no conflicts of interest. the authors declare no conflicts of interest. [ sars-cov-2 detection by direct rrt-pcr without rna extraction rapid detection of novel coronavirus/severe acute respiratory syndrome coronavirus 2 (sars-cov-2) by reverse transcription-loop-mediated isothermal amplification development of a reverse transcription-loopmediated isothermal amplification as a rapid early-detection method for novel easycov: lamp-based rapid detection of sars-cov-2 in saliva rapid and visual detection of 2019 novel coronavirus (sars-cov-2) by a reverse transcription loop-mediated isothermal amplification assay detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr the allplex 2019-ncov (seegene) assay: which performances are for sars-cov-2 infection diagnosis? eur comparison of a laboratory-developed test targeting the envelope gene with three nucleic acid amplification tests for detection of sars-cov-2 viral rna load as determined by cell culture as a management tool for discharge of sars-cov-2 patients from infectious disease wards rapid and extraction-free deetction of sars-cov-2 from saliva with colorimetric lamp rapid implementation and validation of a cold-chain free sars-cov-2 diagnostic testing workflow to support surge capacity we thank katrin schützler, sylvia stoll, beate haschke, and christina gödicke for excellent technical assistance. the study was supported by internal funding. key: cord-271445-eft2vwgb authors: xepapadaki, paraskevi; psarras, stelios; bossios, apostolos; tsolia, maria; gourgiotis, dimitrios; liapi-adamidou, georgia; constantopoulos, andreas g; kafetzis, dimitrios; papadopoulos, nikolaos g title: human metapneumovirus as a causative agent of acute bronchiolitis in infants date: 2004-05-06 journal: j clin virol doi: 10.1016/j.jcv.2003.12.012 sha: doc_id: 271445 cord_uid: eft2vwgb background: human metapneumovirus (hmpv), has been recently isolated from children with acute respiratory tract infections (rtis), including bronchiolitis, and classified in the pneumovirinae subfamily within the paramyxoviridae family. objectives: since most bronchiolitis studies fail to detect any viral pathogen in part of the samples, we sought for the presence of hmpv in a well characterized bronchiolitis cohort. study design: nasal washes were obtained from 56 children admitted to the hospital for acute bronchiolitis. rna extraction and subsequent rt-pcr were used to detect hmpv, and correlated the presence of the virus with clinical characteristics of the disease. results and conclusions: pcr revealed the presence of hmpv in 16% of bronchiolitis cases, whereas respiratory syncytial virus (rsv; 67.9%) was the most frequently encountered viral pathogen. hmpv was identified either as a unique viral pathogen or co-existed with rsv, with whom they shared a similar seasonal distribution. there were no differences in disease characteristics, either clinical or laboratory, between bronchiolitis cases where hmpv was present and those caused by rsv or other viral pathogens. these findings suggest that hmpv is a common and important causative agent in infants with bronchiolitis, with clinical characteristics similar to that of rsv. a new respiratory virus, human metapneumovirus (hmpv), has been recently isolated from nasopharyngeal aspirates of young children in the netherlands (van den hoogen et al., 2001) . hmpv is the first human respiratory pathogen classified as a member of the metapneumovirus genus, which together with pneumoviruses constitute the pneumovirinae subfamily within the paramyxoviridae family (van den hoogen et al., 2001; boivin et al., 2002; viazov et al., 2003) . the clinical symptoms of the children from which the virus was isolated ranged from upper respiratory airway disease to severe bronchiolitis and pneumonia (van den hoogen et al., 2001) . subsequent studies established the association of this virus with acute rtis in all age groups (maggi et al., 2003; osterhaus and fouchier, 2003; boivin et al., 2003; vicente et al., 2003; stockton et al., 2002; boivin et al., 2002; peiris et al., 2003; freymouth et al., 2003) . however, several epidemiological as well as clinical aspects of hmpv infection are still to be firmly established and in this context the analysis of well defined respiratory disease cohorts is of particular importance (jartti et al., 2002; rawlinson et al., 2003) . we hypothesized that hmpv may be an important pathogen in the context of acute bronchiolitis of infancy. in addition to bronchiolitis cases being reported within the patients of published hmpv studies, this is further suggested by the observation that most bronchiolitis studies fail to identify a pathogen in a considerable proportion of cases. we have recently reported the results of virological evaluation of a well-characterized cohort of infants admitted to hospital with acute bronchiolitis, using reverse transcription polymerase chain reaction (pcr) for 11 respiratory pathogens (papadopoulos et al., 2002) . as expected, rsv was the predominant pathogen, while human rhinovirus (rv) was implicated in almost one-third of cases. adenoviruses, influenza viruses, parainfluenza viruses and corona viruses, were involved to a smaller extent. nevertheless, no pathogen was identified in almost one quarter of the samples (papadopoulos et al., 2002) . therefore, the aim of the present study was to assess the presence of hmpv in stored nasal secretions of this cohort and evaluate the relationship between the presence of the virus and the clinical and epidemiological characteristics of the disease. the study was carried out in the second pediatric clinic of the university of athens, greece, at the p&a kyriakou children's hospital, and was approved by the hospital's ethics committee. children were admitted in the hospital with the diagnosis of bronchiolitis, which was defined as an acute infection of the lower airway, characterized by increased respiratory effort (tachypnea of >50 respirations/min and/or use of accessory respiratory muscles), and expiratory wheezing and/or crackles. a detailed description of the cohort has been reported (papadopoulos et al., 2002) . nasopharyngeal washes (npw) have been obtained at admission, aliquoted and kept at −70 • c. a new aliquot was thawed and used for hmpv detection. sufficient material for analysis was available in 56 cases. viral rna was extracted using a phenol-guanidine isothiocyanate method as previously described (papadopoulos et al., 2002) . reverse transcription was performed at 37 • c in a 50 mm tris-hcl, 75 mm kcl, 3 mm mgcl 2 buffer containing 10 mm dtt, 0.4 mm dntps, 0.5 g random hexamer primers and 200 units of reverse transcriptase (superscript tm , invitrogen). cdna was stored at −20 • c until used. primers (upper mpvnf: 5 aggccctcagcaccagaca3 ; lower mpvnr: 5 ttgaccggccccataagc3 ) were designed against the n (nucleocapsid) region of the 00-1 isolate of hmpv (genbank accession nr. af371337.2) to amplify a 318 bp fragment corresponding to nucleotides 505-822 of the published hmpv genome (van den hoogen et al., 2001) . pcr reaction was conducted in the presence of 2.5 mm mgcl 2 , 400 m dntps, 0.25 m of each mpv primer and 2.5 units taq polymerase (invitrogen) for 40 cycles of 94 • c for 40 s, 55 • c for 40 s and 72 • c for 1 min. subsequently, 20% of the pcr reaction volume was run in a 1.8% agarose gel and, when present, 318 bp amplicons were excised and further purified with the concert rapid gel extraction system kit (gibcobrl), according to the manufacturers' instructions. selected samples were vacuum dried and sequenced using the mwg ag biotech (ebersberg, germany) sequencing facilities. comparison of the sequenced fragments to the hmpv genome was done by submission to the genbank using the standard nucleotide-nucleotide blast (blastn), whereas comparison between individual amplicons was conducted using blast2. npws obtained from 10 healthy children, without symptoms or signs of upper respiratory infection were also analyzed as negative controls. one-way analysis of variance was used for the comparison of continuous variables among subjects with hmpv, without hmpv and with rsv. chi-square was performed for the analysis of ordinal or categorical data. results of continuous data are expressed as mean ± standard error of mean. probability values of <0.05 were considered significant. hmpv was present in 9/56 samples (16.1%). sequence analysis of positive pcr products and comparison with the published sequences (van den peret et al., 2002) , confirmed the identity of the amplicons. rsv was the predominant pathogen in this cohort, found in 38/56 samples (67.9%), followed by human rhinovirus (eight cases: 14.3%), adenoviruses (four cases), coronavirus (three cases) and parainfluenza virus (one case). in 16 patients, two viruses were simultaneously present, while no pathogen was identified in nine cases. pcrs performed in npws of healthy control children obtained during the same period, were all negative for hmpv. among the hmpv positive samples, the virus was a unique pathogen in five cases (55.6%), while in four it was present together with rsv. no double positive cases of hmpv with other respiratory viruses were observed. most hmpv cases appeared in february and persisted, though gradually diminishing, until april (fig. 1) . the rsv season on that year was between december and march. there were no differences in disease characteristics between bronchiolitis cases were hmpv was identified and those caused by rsv or other pathogens (table 1) . there was also no difference in disease severity between double positive rsv-hmpv cases and single positive hmpv (severity index: 8.3±0.6 versus 8.4±0.6, respectively). similarly, no differences were found when components of the severity index (heart rate, respiratory rate, degree of wheezing, skin colour and oxygen saturation) were analyzed individually, or in laboratory findings (data not shown). unless otherwise indicated data are presented as number of positive/number of reported (%). a severity score was calculated by adding individual scores (1-3) for cardiac rate (<120, 120-160, >160), respiratory rate (<40, 40-60, >60), wheezing (expiratory, expiratory + inspiratory, audible without auscultation), skin color/feeding (normal, mild cyanosis/difficult feeding, cyanosis/feeding not possible) and sao 2 (>98%, 94-98%, <94%). the severity score ranges from 3-15. although rsv is indisputably the most common cause of acute bronchiolitis, virological analyses have failed to reveal a pathogen in a considerable fraction of cases in most studies. in this context, the recently isolated hmpv (van den hoogen et al., 2001) , could partially account for previously undiagnosed cases. the present study provides evidence of frequent involvement of hmpv in acute bronchiolitis in infants, using pcr-based detection. hmpv was present in 16% of bronchiolitis cases, a percentage only second to rsv, comparable to that of human rhinovirus (papadopoulos et al., 2002) , and clearly higher than that of the other respiratory viruses tested. similarly, viazov et al. (2003) detected hmpv in 17.5% (and rsv in 23.8%) of young children with respiratory tract illness, with most the cases diagnosed as bronchiolitis (viazov et al., 2003) . in another study, the percentage of hmpv within the bronchiolitis subgroup was 21% (maggi et al., 2003) . hmpv was either a unique pathogen, or co-existed with rsv. greensill et al. (2003) , analyzed bronchoalveolar lavage fluids collected from infants with rsv bronchiolitis and found that 70% of them were co-infected with hmpv (greensill et al., 2003) . in contrast, vicente et al. (2003) found no hmpv co-infections with any other virus in a pediatric population with acute rti (vicente et al., 2003) . the simultaneous presence of hmpv with rsv may reflect the considerably overlapping seasonal distribution of the two viruses. hmpv seasonal distribution observed in this study resembles those recently reported in finland and canada (jartti et al., 2002; boivin et al., 2003) . finally, it should be noted that this is the first report of hmpv infection in greece and the east mediterranean area, further confirming the worldwide distribution of this virus (van den hoogen et al., 2001; stockton et al., 2002; peret et al., 2002; howe, 2002; jartti et al., 2002; freymouth et al., 2003; viazov et al., 2003; peiris et al., 2003; vicente et al., 2003; maggi et al., 2003) . no differences were found between cases where hmpv was identified and those caused by rsv or other viral pathogens. we also found no difference in disease severity, or laboratory tests, between double positive rsv-hmpv cases and single positive hmpv cases. all the above support the notion that hmpv is able to induce bronchiolitis which is clinically identical to that caused by rsv. current evidence suggests that hmpv may account for a fraction of respiratory infection cases whose causative agent remained unidentified in previous cohorts (osterhaus and fouchier, 2003) . additional studies should be undertaken in order to characterize the role of hmpv in different human respiratory tract diseases and provide important information for future development of specific antiviral therapies and vaccines. virological features and clinical manifestations associated with human metapneumovirus: a new paramyxovirus responsible for acute respiratory-tract infections in all age groups human metapneumovirus infections in hospitalized children presence of the new human metapneumovirus in french children with bronchiolitis human metapneumovirus in severe respiratory syncytial virus bronchiolitis australian find suggests worldwide reach for metapneumovirus osterhaus ad, ruuskanen o. metapneumovirus and acute wheezing in children human metapneumovirus associated with respiratory tract infections in a 3-year study of nasal swabs from infants in italy human metapneumovirus in the community association of rhinovirus infection with increased disease severity in acute bronchiolitis children with respiratory disease associated with metapneumovirus in hong kong characterization of human metapneumoviruses isolated from patients in north america asthma exacerbations in children associated with rhinovirus but not human metapneumovirus infection a newly discovered human pneumovirus isolated from young children with respiratory tract disease analysis of the genomic sequence of a human metapneumovirus high prevalence of human metapneumovirus infection in young children and genetic heterogeneity of the viral isolates human metapneumovirus and community-acquired respiratory illness in children key: cord-301254-093yih5n authors: brittain-long, robin; westin, johan; olofsson, sigvard; lindh, magnus; andersson, lars-magnus title: prospective evaluation of a novel multiplex real-time pcr assay for detection of fifteen respiratory pathogens—duration of symptoms significantly affects detection rate date: 2010-01-18 journal: j clin virol doi: 10.1016/j.jcv.2009.12.010 sha: doc_id: 301254 cord_uid: 093yih5n background: nucleic acid amplification techniques have improved the diagnostic possibilities in respiratory tract infections, although their clinical applicability is not yet fully defined. we have evaluated a multiplex real-time pcr method for the detection of 13 respiratory viruses and 2 bacteria (mycoplasma and chlamydophila) in a clinical setting. objectives: the aim of the present study was to evaluate the diagnostic performance and clinical use of a novel multiplex pcr method in adults with community-acquired respiratory viral infection, and the impact of duration of symptoms on detection rates. study design: nasopharyngeal swab samples were prospectively collected from 209 adult outpatients with respiratory infections and 100 asymptomatic controls. results: an infectious agent was identified in 43% of samples from patients and 2% of asymptomatic controls. the detection rate was significantly higher in samples from patients with a duration of symptoms of 6 days or less (51%) than in samples from patients with a duration of symptoms of 7 days or more (30%, p < 0.01). for human corona viruses, and influenza virus a and b there was a correlation between the amount of virus in each patient sample as measured ct values and duration of symptoms. conclusions: duration of symptoms significantly affects the detection rate of respiratory pathogens by multiplex real-time pcr in nasopharyngeal swab samples from adult patients with respiratory infections. our finding should be taken into account when using these tests in clinical practise. real-time polymerase chain reaction (pcr) techniques are gaining increasing acceptance for diagnosis of viral respiratory tract infections (rti). high sensitivity and short analysis time along with the ability to detect several pathogens in a single sample are advantages compared with serology, viral culture and antigen detection. 1-3 pcr assays may enhance identification of viral respiratory pathogens by at least 50% compared with traditional diagnostic methods, 4-6 partly by detecting viruses for which no conventional methods exist, such as human rhinovirus (hrv), human coronavirus (hcov) and human metapneumovirus (hmpv). kaye et al. 7 found a respiratory virus as the only causative agent in 15% of adult patients admitted to hospital with acute rti. in patients with severe pneumonia, requiring intensive care treatment, who had negative bacterial cultures from bronchoalveolar lavage (bal) samples, legoff et al. 8 reported detection of a respiratory virus in as much as 63% of cases. viruses believed to cause only mild upper respiratory tract infections (urti), for example hrv and hcov have been detected in the lower respiratory tract in patients with severe disease. [9] [10] [11] on the other hand, it is not known if asymptomatic shedding occurs following clinical recovery or during subclinical infection, and results of molecular methods with high sensitivity must be assessed with caution regarding the clinical relevance of the finding. detection of viral agents in respiratory tract samples using multiplex real-time pcr is both quick and sensitive 12, 13 and will likely replace traditional means of diagnosing rti. the diagnostic performance of these methods in adult immunocompetent individuals and the optimal time point for specimen collection is, however, poorly defined. the aim of the present study was to evaluate the diagnostic performance and clinical use of a novel multiplex pcr method in adults with community-acquired respiratory viral infection, and the impact of duration of symptoms on detection rates. we conducted a prospective study in western sweden during two consecutive winter seasons, october through april 2006-2008. adult patients (≥18 years old) with symptoms of acute rti with duration of less than 2 weeks were included in the study, by the treating physician. an acute rti was defined as having at least two of the following symptoms; coryza, congestion, sneezing, soar throat, odynophagia, cough, chest pain, shortness of breath or fever, for which the physician found no other explanation. patients with suspected or confirmed bacterial infection were excluded. patients were asked to return for a follow-up visit 10 days (±2 days) after the initial visit. signs and symptoms were recorded in a web-based form. the same protocol was used at initial and follow-up visit. a control group of 100 healthy adults without history of fever or symptoms of rti during the preceding 14 days were also included. control subjects were contacted for a telephone interview 2 days after testing. individuals who had developed symptoms of rti were excluded, to avoid detecting virus that might be shed in high levels prior to onset of symptoms. nasopharyngeal and throat swab specimens were collected from each patient and control subject. the swabs were jointly placed in a sterile container with 1 ml of sodium-chloride solution, and sent to the virology laboratory the same day. at the laboratory, specimens were either analysed directly or frozen at −70 • c for later analysis. the research ethics committee at gothenburg university, gothenburg, sweden, approved the study and all patients gave their informed consent. we have focused on the analysis of viruses found with our pcr assay, although two bacteria were also included in the panel. we utilized a real-time pcr procedure, based on automated specimen extraction and multiplex amplification. primers and hydrolysis probes were obtained from the literature or developed in our laboratory. nucleic acid from 100 l of specimen was extracted into an elution volume of 100 l by a magnapure lc robot (roche molecular systems, mannheim, germany), using the total nucleic acid protocol, and was amplified in an abi 7500 real-time pcr system (applied biosystems, foster city, ca). amplification was then carried out in 50 l reaction volumes. after a reverse transcription step, 45 cycles of two-step pcr was performed. each sample was amplified in 5 parallel reactions, each containing primers and probes specific for 3 targets, as previously described, 14 ct values (cycle threshold) for each patient sample positive by real-time pcr were recorded for semi-quantitative estimation of the amount of dna/rna in each specimen. chi-square test was used to compare proportions and spearman's rank correlation coefficient to analyse correlations. a p-value of <0.05 was considered as significant. no of samples positive for one microbial agent or more, n (%) 94 (43) 2 (2) a one patient was excluded prospectively due to bacterial tonsillitis and one patient was excluded retrospectively due to pneumococcal sepsis. two hundred and nineteen patients with symptoms of rti and 100 asymptomatic controls were included in the study. ten patients were excluded (table 1) , leaving 209 for the final analysis. an infectious agent was identified in 94 patients (43%) and in 2 controls (2%). demographic characteristics and the agents detected are presented in table 1 . no cases of enteroviruses or chlamydia pneumoniae were identified. in 7% of positive outcomes (n = 7) more than one agent was identified (data not shown). the duration of symptoms ranged from 0 to 14 days. the majority of patients (63%) were included within the first 7 days of disease. the detection rate was significantly higher in samples from patients with a duration of symptoms of 6 days or less (51%) than in samples from patients with a duration of symptoms of 7 days or more (30%, p < 0.01) (fig. 1) . for hcov, ifa and ifb there was a correlation between ct values and duration of symptoms (n = 13, rs = 0.33, p < 0.05; n = 24, rs = 0.17, p < 0.05; n = 10, rs = 0.65, p < 0.01) for hrv no such correlation was found (fig. 2) . two patients with influenza a were omitted because of results incongruent with patient history (data not shown). in total, 63% (n = 138) of the patients returned for a follow-up visit 10 ± 2 days after the initial visit. nasopharynx/throat swab samples were collected. out of 94 patients with a positive sample at initial visit, 57 patients (61%) showed up for follow-up testing. the same pathogen was detected in 13 of these patients (23%) (see table 2 ). eight of 13 (62%) of samples positive for the same virus at initial and follow-up visit were positive for hrv. a new microbial agent was found in five subjects, all of who still had respiratory tract symptoms at follow-up. all patients still positive for the same agent on follow-up had a higher ct-value (corresponding to a lower table 2 follow-up (10 ± 2 days after initial visit) test result from analysis with real-time pcr of nasopharyngeal/throat swab specimens. amount of viral rna in the specimen) 10 days later except one patient with hrv on both occasions (data not shown). we have shown that the diagnostic yield increases significantly if a multiplex pcr assay for respiratory viruses is used within the initial 6 days of symptoms, in immunocompetent adults with rti. this is in concordance with reports on single-plex pcr assays for influenza where the detection rate correlates to duration of symptoms. 15 we detected an infectious agent in 43% of patients. previously, detection rates ranging between 43% and 63% have been described, 6, 12, 16, 17 with exceptions for very high rates among young children and infants. 18, 19 in asymptomatic children, higher frequencies of positive results have been reported. 20, 21 in particular detection of hrv and ev may represent a previous infection dating back 4-5 weeks, due to prolonged shedding of virus. 22 lack of pre-existing immunity, greater viral exposure as well as an immature immune system may cause higher levels of viral replication and prolonged viral shedding in children. templeton et al. reported a detection rate of only 24%, but hrv, hcov, adv or hmpv were not included in their panel. 23 studies performed retrospectively on clinical samples will select for a short duration of symptoms as will studies including children, who tend to seek medical care early and who may shed more virus during a longer time period. thus, the prospective approach and the adult population may explain the relatively low detection rate found in our sample. as the study period included the influenza season, we detected influenza a and b virus in a relatively high proportion of patients (41%), which is comparable to other studies of adults. 9 we detected a pathogen in only 2% of control subjects, both hrv. although most studies do not include controls, creer et al. 16 found a respiratory virus in 12% of controls, who reported no signs of respiratory tract infection during 2 months before sampling, predominantly hrv. asymptomatic shedding of hrv, rsv and piv has also been reported in immunocompromised patients. 24, 25 our results suggest that viral shedding exceeding 14 days is rare in immunocompetent adults. the rate of asymptomatic carriage of virus might be affected by epidemiological factors that vary over time. our control samples were, however, collected throughout the entire study period. for several viruses analysed in our study, the amount of viral dna/rna decreased with duration of symptoms, suggesting a gradual reduction of viral shedding from the epithelial surface over time. this is in concordance with the gradual reduction of rsv levels in nasopharyngeal aspirates described by gerna et al. 26 and campanini et al. 27 dual viral infections are previously described in approximately 5-20% of infected patients, with a higher frequency among young children. 17, 28, 29 in accordance with previous studies we found two viruses in 7% of the samples. the clinical impact of multiple infections remains to be determined. in one study of children with rsv infection, higher fever, longer hospital stays and more frequent use of antibiotics was associated with multiple infections. 30 semiquantification of viral dna, as measured by ct values, may be of use when determining the clinical relevance of a positive test, particularly in multiple infections. we found a correlation between ct values and duration of symptoms for hcov, ifa, and ifb but not for hrv. the high genetic variability of hrvs, which increase the probability of probe-target mismatch, may explain this. for other viruses, such as influenza b virus, with less genetic variability viral detection will be more stable. the lack of association between duration of illness and ct values in hrv infection may also reflect variations in viral shedding and differences in pre-existing immunity between individuals as well as limited sample size. interestingly, the majority of patients, 7/13 (62%) positive for any agent at the follow-up visit (day 10 ± 2 days) had hrv. whether this translates into a longer period of infectivity remains to be determined. however, the semi-quantitative estimation of viral loads by ct values must be interpreted with caution since relative viral loads were not compared to standard amounts of virus. the clinical relevance of the outcome of multiplex pcr tests for respiratory viruses is not yet fully determined. for some agents, such as influenza a and b virus, a positive test may provide the basis for antiviral treatment. it has been suggested that a rapid etiologic diagnosis of viral rti could reduce unnecessary prescription of antibiotics, but this remains to be shown. we conclude that duration of symptoms affects detection rate by real-time multiplex pcr in adult patients with rti. duration of symptoms should be taken into account when using these tests in clinical practise. for some viruses, with relatively low genetic variability, semi-quantification might be of value when interpreting results where more than one respiratory virus is found. none declared. development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses development and implementation of a molecular diagnostic platform for daily rapid detection of 15 respiratory viruses practical experience of high throughput real time pcr in the routine diagnostic virology setting respiratory viruses and severe lower respiratory tract complications in hospitalized patients enhanced identification of viral and atypical bacterial pathogens in lower respiratory tract samples with nucleic acid amplification tests impact of rapid detection of viral and atypical bacterial pathogens by real-time polymerase chain reaction for patients with lower respiratory tract infection surveillance of respiratory virus infections in adult hospital admissions using rapid methods high prevalence of respiratory viral infections in patients hospitalized in an intensive care unit for acute respiratory infections as detected by nucleic acid-based assays detection of respiratory viruses by molecular methods a recently identified rhinovirus genotype is associated with severe respiratory-tract infection in children in germany rhinovirus associated with severe lower respiratory tract infections in children rapid multiplex nested pcr for detection of respiratory viruses influenza diagnosis: from dark isolation into the molecular light west of scotland respiratory virus study group multiplex real-time pcr for detection of respiratory tract infections duration of influenza a virus shedding in hospitalized patients and implications for infection control aetiological role of viral and bacterial infections in acute adult lower respiratory tract infection (lrti) in primary care development of a respiratory virus panel test for detection of twenty human respiratory viruses by use of multiplex pcr and a fluid microbead-based assay viral etiology of common cold in children comparison of multiplex pcr assays and conventional techniques for the diagnostic of respiratory virus infections in children admitted to hospital with an acute respiratory illness human picornavirus and coronavirus rna in nasopharynx of children without concurrent respiratory symptoms predominance of rhinovirus in the nose of symptomatic and asymptomatic infants persistence of rhinovirus and enterovirus rna after acute respiratory illness in children rapid and sensitive method using multiplex real-time pcr for diagnosis of infections by influenza a and influenza b viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4 respiratory viral infections in transplant recipients respiratory virus infection among hematopoietic cell transplant recipients: evidence for asymptomatic parainfluenza virus infection correlation of viral load as determined by real-time rt-pcr and clinical characteristics of respiratory syncytial virus lower respiratory tract infections in early infancy human respiratory syncytial virus (hrsv) rna quantification in nasopharyngeal secretions identifies the hrsv etiologic role in acute respiratory tract infections of hospitalized infants respiratory picornavirus infections in korean children with lower respiratory tract infections detection and typing by molecular techniques of respiratory viruses in children hospitalized for acute respiratory infection in rome, italy multiple simultaneous viral infections in infants with acute respiratory tract infections in spain the authors would like to acknowledge the staff at the clinical virology laboratory, department of virus detection, at sahlgrenska university hospital for technical expertise and patients and staff at the following centres in the västra götaland region; the infectious disease clinics in uddevalla, skövde, borås, and göteborg, and primary health care centres in stenungsund, sollebrunn, floda, kungshöjd, kungsten, olskroken, carlanderska, and capio axess.funding: the study was partly funded by the swedish strategic programme against antibiotic resistance (strama), capio research foundation, grant # 2006-1166 and the västra götaland region research funds, grant # vgfoureg-8402.ethical approval: granted by the research ethics committee at gothenburg university, # 403-06. key: cord-294155-94skyx5f authors: terrosi, chiara; fabbiani, massimiliano; cellesi, carla; cusi, maria grazia title: human bocavirus detection in an atopic child affected by pneumonia associated with wheezing date: 2007-08-07 journal: j clin virol doi: 10.1016/j.jcv.2007.06.011 sha: doc_id: 294155 cord_uid: 94skyx5f background: human bocavirus (hbov) is a newly discovered human parvovirus. hbov was detected in respiratory samples by pcr, but its aetiologic role in the pathogenesis of acute respiratory infectious diseases is still unclear. results: in this report, we describe an atopic child affected by pneumonia, with a past history of wheezing. a panel of bacteria and respiratory viruses were searched in the nasopharyngeal swab, only human bocavirus was detected by pcr. conclusions: detection of hbov, as the only microbial agent, in samples from children with wheezing and acute respiratory diseases supports the assumption that this emerging virus could have an aetiologic role in the pathogenesis of respiratory diseases. screening of most of the known respiratory viruses by pcr has allowed us to diagnose many viral infections in the majority of individuals with respiratory illnesses. however, many respiratory infections still remain undiagnosed. a new parvovirus, the human bocavirus (hbov), has recently been discovered by the application of random pcr/cloning technique on respiratory samples (allender et al., 2005) . hbov is suspected to be an etiologic agent of respiratory disease in humans (manning et al., 2006; maggi et al., 2007; kesebir et al., 2007) . respiratory distress and abnormal radiographic chest findings have frequently been associated with hbov. however, its causative role is still unclear. most viruses have been identified by animal experiments or virus replication in tissue culture, but this virus was discovered by molecular screening of respiratory tract samples and it has not yet been grown in cell culture. although, koch's postulates have * corresponding author. tel.: +39 0577 233871; fax: +39 0577 233870. e-mail address: cusi@unisi.it (m.g. cusi). provided a standard for establishing a causal link between a pathogen and disease, in this case it was not possible to apply these rules. however, the frequent association of hbov infection with respiratory tract disease (anderson, 2007; schenk et al., 2007; simon et al., 2007) led us to consider this virus as a causative agent for respiratory tract diseases. some studies have shown that hbov is distributed all over the world (manning et al., 2006; maggi et al., 2007; simon et al., 2007; ma et al., 2006; bastien et al., 2007) and recent data have shown that it can also be detected in stool samples from children with gastroenteritis (vicente et al., 2007) . like other viruses, it is possible that hbov could be involved in both respiratory and enteric diseases. in this report, we describe a case of pneumonia and severe wheezing associated with hbov dna in the pharyngeal swab sample from a child. informed consent was obtained from the parents of the child who provided specimens. the child had been hospitalized at the age of 1 year due to rhinitis, airflow obstruction and acute wheezing. he was treated with corticosteroids and inhalative bronchodilatators to control bronchocostriction. no antibiotics were administered. no causative agent was found in nasopharyngeal swab or serological tests and no sign of chronic lung disease was present when he was released. during the following year, he frequently suffered from respiratory tract infections associated with bronchoconstriction. in order to understand the cause of bronchoconstriction, total and specific ige were measured and high values were reported for egg proteins. he was 3 years old when admitted for the most recent episode of respiratory distress. clinical examination revealed a weakened general condition, a body temperature of 38 • c, tachycardia (pulse rate 140 per min), tachypnea (respiratory rate 52 per min), dyspnea, subcostal retractions, wheezing and left apical fine rales upon lung auscultation. laboratory tests showed a leukocyte count of 22.0 × 10 9 l −1 , and c-reactive protein and erythrocyte sedimentation rate were normal. chest radiography, interpreted by a paediatric radiologist, revealed hyperinflation and pneumonic infiltrates of the upper left lobe. transcutaneously measured oxygen saturation was decreased to 82% while breathing ambient air and the patient required oxygen supplementation (8 l/min) and inhalative adrenaline. oxygen was given for an additional 3 days along with intravenous corticosteroids and salbutamol by inhalation for persistent bronchoconstriction. the child improved and was dismissed from hospital after 7 days. to assess the aetiology of this respiratory disease, blood and nasopharyngeal swab were drawn from the patient upon admission and tested for the presence of viral, bacterial and fungal pathogens. no infectious agent was detected by bacterial or fungal culture. the nasopharyngeal swab was also tested by pcr for chamydia pneumoniae, mycoplasma pneumoniae, bordetella pertussis and legionella pneumophila, respiratory syncytial virus (types a and b), metapneumovirus, influenza viruses (types a-c), parainfluenza viruses (piv-1, piv-2, piv-3 and piv-4), rhinovirus, enterovirus, adenovirus, coronavirus (hcov-oc43, hcov-229e, nl63 and hku11) and human bocavirus. the only positive result was obtained for hbov, using the primers described by simon et al. (2007) . briefly, 5 l of dna (extracted from 200 l of sample by using qiaamp mini kit; qiagen, milan, italy) was amplified using the forward primer 5 cccaagaaacgtcgtctaac 3 (hbov nt 2301-2320) and the reverse primer 5 gtgttgact-gaatacagtgt 3 (hbov nt 2681-2700), producing a fragment of 399 bp, partly overlapping the np1 gene. the cycling conditions were: an initial step at 94 • c for 5 min, followed by 40 cycles at 94 • c for 40 s, 48 • c for 40 s and 72 • c for 1 min; and a final incubation at 72 • c for 5 min. the sensitivity of this pcr was very high, detecting up to 10 copies of hbov genome (fig. 1) . virus detection was confirmed by sequence analysis of the pcr product. another specimen drawn from the child one month after he was discharged from the hospital was negative for hbov by pcr. the detection of hbov in the nasopharyngeal swab in a child with a clinical picture of pneumonia supports the assumption that this virus has a causative role in respiratory diseases. the fact that it has been detected in children with or without respiratory symptoms could demonstrate that this virus might become more aggressive or overgrow, causing disease in particular hosts. consequently, even the virus load could be an important parameter to be considered in the pathogenesis of the disease. we could not carry out a quantitative pcr due to the inadequacy of the sample and we did not have further samples from the child for a retrospective investigation. however, by a semi-quantitative assay, the sample had more than 10 5 genome equivalents per millilitre (fig. 1) . in this case, it should be noted that the patient was suffering from wheezing and atopy characterized by a t cell driven airway inflammatory process, making the host an excellent substrate for viral growth. no coinfection was revealed, indicating that the presence of hbov, the only agent in the sample, could not justify a pneumonia episode just as an innocent bystander. it is also possible that this virus, frequently detected in subjects with asthma or wheezing, could be reactivated by inflammatory processes and that this reactivation could cause severe respiratory diseases, particularly in children. this report is a further confirmation of other published data showing that hbov could be a causative agent of lower respiratory infections in young children. nevertheless, future studies are necessary to establish the pathological role of this virus in respiratory diseases. cloning of human parvovirus by molecular screening of respiratory tract samples human bocavirus: a new viral pathogen detection of human bocavirus in canadian children in a 1-year study human bocavirus infection in young children in the united states: molecular epidemiological profile and clinical characteristics of a newly emerging respiratory virus epidemiological profile and clinical associations of human bocavirus and other human bocavirus and other parvoviruses human bocavirus in italian patients with respiratory diseases detection of human bocavirus in japanese children with lower respiratory tract infections human bocavirus dna detected by quantitative real-time pcr in two children hospitalized for lower respiratory tract infection detection of bocavirus dna in nasopharyngeal aspirates of a child with bronchiolotis human bocavirus, a respiratory and enteric virus key: cord-272734-kawim93f authors: freire-paspuel, byron; vega-mariño, patricio; velez, alberto; castillo, paulina; cruz, marilyn; garcia-bereguiain, miguel angel title: evaluation of ncov-qs (mico biomed) for rt-qpcr detection of sars-cov-2 from nasopharyngeal samples using cdc fda eua qpcr kit as a gold standard: an example of the need of validation studies date: 2020-05-22 journal: j clin virol doi: 10.1016/j.jcv.2020.104454 sha: doc_id: 272734 cord_uid: kawim93f background: several qpcr kits are available for sars-cov-2 diagnosis, mostly lacking of evaluation due to covid19 emergency. objective: we evaluated ncov-qs (mico biomed) kit using cdc kit as gold standard. results: we found limitations for ncov-qs: 1) lower sensitivity 2) lack of rna quality control probe. conclusions: validation studies should be implemented for any sars-cov-2 rt-qpcr commercial kit to prevent unreliable diagnosis. highlighted corrections. 1 . line 29 and line 77. the rna extraction control in the cdc assay is rnase p. please correct. corrected on the text. 2. in the abstract, please remove or rephrase limitation #3. since the assay is real time rt-pcr, a quantitated standard could be used to to generate viral load data. line 20 deleted 3) no capacity to quantify viral load. deleted from the text. we only mention on the discussion that viral load cannot be calculated with the control provided in the kit, but it is possible with other control as reviewer suggested. besides those suggested changes we made other typing corrections and small changes highlighted in red, among them, we want to detailed: -in line 42 we eliminated any reference for 2 independent donors. that could be understood that one of the donations did not work, and we prefer to manage this information personally to donors. -line 32. we now point out the micobiomed sars-cov-2 rt-qpcr kit has not fda eua approval and has not been authorized in korea neither (2 new referencees added endorsing that). although the reference for korean cdc is updated for march 17th 2020, personal communication from k-cdc to the corresponding aunthor confirms that micobiomed do not have authorization to date. multiple in vitro rt-qpcr diagnosis kits are available on the market for the detection of sars-cov-2. some of them have received emergency use authorization (eua) from the u.s. food & drug administration (fda) while others only report validations made by manufacturers, and in general little is known about their performances using clinical specimens. the cdc designed 2019-ncov cdc eua kit (idt, usa) is based on n1 and n2 probes to detect sars-cov-2 that have received positive evaluation on recent reports (1) (2) (3) , and and rnase p as an rna extraction quality control. other kit avalaible in the market is ncov-qs (mico biomed; south corea) that include probes "orf3a" and "n" probes for sars-cov-2 detection but no probe for rna extraction quality control, with no eua approval neither from fda (usa) nor from korean cdc (4,5,6). this study compared the performance in terms of positive percent agreement (ppa) of ncov-qs fifty-four (54) clinical specimens (nasopharyngeal swabs collected on 0.5ml te ph 8 buffer) from patients selected as suspicious for sars-cov-2 infection were included on this study during the surveillance in galapagos islands started on april 8th 2020. also, six negative controls (te ph 8 buffer) were included as control for carryover contamination. both cov-qs and 2019-ncov cdc eua kits were used at sars-cov-2 diagnosis laboratory "labgal" at "agencia de regulación y control de la bioseguridad y cuarentena para galápagos" at puerto ayora in galapagos islands (ecuador), where we considered this validation necessary to guarantee the sensibility of sars-cov-2 during the surveillance. twenty-five (25) samples were tested following an adapted version of the cdc protocol (1) table 1 table 1 and 2b. we used cfx96 biorad to run qpcr but also results were confirmed using veri-q pcr316 instrument from mico biomed (4). the assay sensitivity indicated on manufacturers manual (1.8 copies/ul for ofr3a and 4.24 copies/ul for n) could not be validated because positive control concentration was not provided. in summary, overall ppa for ncov-qs was 66.7% (22 out of 33 positives samples for 2019-ncov cdc eua; p<0.001), and 70.5% and 62.5% for mico biomed and adapted cdc protocols, respectively. additionally, considering the viral loads calculated following adapted cdc protocol with 2019-ncov n positive control (idt, usa), the limit of detection (viral copies/ul) for ncov-qs kit is much higher than the one indicated at manufacturer's manual (6). although the main limitation of our study is the sample size (54 specimens), our results support that ncov-qs kit had a significant lower performance in terms on ppa and sensitivity compared to 2019-ncov cdc eua. also, the lack of any probe for rna extraction quality control like rnase p and the unreported concentration of positive controls provided for the kit that does not allow viral load calculations, are limitations to be considered when using ncov-qs kit. considering the worldwide high demand of reagents for sars-cov rt-qpcr diagnosis, supplies shortage is a fact, actually affecting harder to developing countries like ecuador. under this j o u r n a l p r e -p r o o f 6 scenario, validation studies are helpful to guarantee the quality of the supplies in the market for every country in the world. all samples have been submitted for routine patient care and diagnostics. ethical approval for this study was not required since all activities are according to legal provisions defined by the "comité de operaciones especiales regional de galápagos" that is leading the covid19 surveillance in galapagos islands. no extra specimens were specifically collected for this validation study. all data used in the current study was anonymized prior to being obtained by the authors. all authors contributed to study conceptualization, experimental procedures and revision and approval of final version of the manuscript. byron freire-paspuel and miguel angel garcía bereguiain analyzed the data and wrote the manuscript. none. all authors have no conflict of interest to declare. we thank the medical personnel from "ministerio de salud pública" at galapagos islands and the staff from the "agencia de regulación y control de la bioseguridad y cuarentena para galápagos" for their support. we also thank dr. ronald cedeño from ops/who for his work during covid 19 surveillance in galapagos islands. we specially thank gabriel iturralde, oscar espinosa and dr tannya lozada from "dirección general de investigación de la universidad de las américas", and also the authorities from universidad de las américas, for logistic support to make sars-cov-2 diagnosis possible in galapagos islands. j o u r n a l p r e -p r o o f interim guidelines for collecting, handling, and testing clinical specimens from persons for coronavirus disease 2019 (covid-19) comparison of abbott id now, diasorin simplexa, and cdc fda eua methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from individuals diagnosed with covid-19. accepted manuscript posted online comparative performance of sars-cov-2 detection assays using seven different primer/probe sets and one assay kit. comparative performance of sars-cov-2 detection assays using seven different primer/probe sets and one assay kit. jcm accepted manuscript posted online 8 covid-19 task force and the center for laboratory control of infectious diseases, the korea centers for disease control and prevention. guidelines for laboratory diagnosis of coronavirus disease 2019 (covid-19) in korea key: cord-277909-rn1dow26 authors: gunson, r.n.; collins, t.c.; carman, w.f. title: practical experience of high throughput real time pcr in the routine diagnostic virology setting date: 2006-02-07 journal: j clin virol doi: 10.1016/j.jcv.2005.12.006 sha: doc_id: 277909 cord_uid: rn1dow26 the advent of pcr has transformed the utility of the virus diagnostic laboratory. in comparison to traditional gel based pcr assays, real time pcr offers increased sensitivity and specificity in a rapid format. over the past 4 years, we have introduced a number of qualitative and quantitative real time pcr assays into our routine testing service. during this period, we have gained substantial experience relating to the development and implementation of real-time assays. furthermore, we have developed strategies that have allowed us to increase our sample throughput while maintaining or even reducing turn around times. the issues resulting from this experience (some of it bad) are discussed in detail with the aim of informing laboratories that are only just beginning to investigate the potential of this technology. the advent of polymerase chain reaction (pcr) has transformed the utility of the virus diagnostic laboratory. in comparison with traditional methods, pcr offers a highly sensitive and specific result within 24-48 h. the routine use of this test in diagnostic laboratories has led to many benefits including improved patient management, and increased ascertainment of previously under-diagnosed and undetectable viruses. the advent of real time pcr technologies has further improved upon these already significant benefits (arya et al., 2005; aslanzadeh, 2004; bustin and nolan, 2004; mackay, 2004; tan et al., 2004) . in comparison to traditional gel-based pcr assays, real time pcr offers increased sensitivity and specificity in a rapid format (turn around time from sample receipt to result <5 h). unlike traditional systems, which rely upon endpoint analysis, real time pcr assays visualise the reaction as it is taking place allowing quantification and reaction analysis (e.g., pcr efficiency). since real time pcr reactions are performed in a closed system (no gel analysis needed) the risk of contamination has been substantially reduced. this has also reduced the requirement for a stringent laboratory structure. the increasing number of chemistries and platforms available for real time pcr have reduced its overall cost significantly making this an increasingly attractive technique. over the past 4 years we have introduced a number of qualitative and quantitative real time pcr assays into our routine testing service. these include assays for the detection of influenza a, b and c, human metapneumovirus, respiratory syncytial viruses (rsv) a and b, rhinovirus, parainfluenza viruses 1-4, coronaviruses nl63, oc43 and 229e, chlamydia pneumoniae, mycoplasma pneumoniae, pneumocystis jiroveci, varicella zoster virus (vzv), herpes simplex virus (hsv) 1 and 2, cytomegalovirus (cmv), epstien barr virus (ebv), hhv-6, hhv-7, norovirus, adenovirus, rotavirus, astrovirus, sapovirus, erythrovirus b19, mumps, chlamydia trachomatis, mycoplasma genitalium, nesseria gonnorhoeae and enterovirus. each year we carry out more than 84,000 pcr tests. during this period we have gained substantial experience relating to the development and implementation of real time assays. furthermore we have developed strategies that have allowed us to increase our sample throughput while maintaining or even reducing turn around times. the issues resulting from this experience (some of it bad) are discussed in detail below with the aim of informing labo-ratories that are only just beginning to investigate the potential of this technology. there are numerous chemistries available to carry out real time pcr. these include dual labelled probes (often known as taqman tm probes), minor groove binding (mgb) probes, molecular beacons, fluorescence energy transfer (fret) probes, intercalating dyes (such as sybr green) and more recently developed fluorescent labelled primers such as sunrise tm , lux tm or scorpion primers tm . the advantages and disadvantages of each chemistry are discussed (arya et al., 2005; aslanzadeh, 2004; bustin and nolan, 2004; mackay, 2004; tan et al., 2004) (table 1) . most of the published real time probe based pcr assays for viral diagnosis utilise either molecular beacons or dual labelled probes although more recent publications tend to favour the use of dual labelled probes. currently all our real time pcr tests are dual labelled probe assays. however, we do have experience of both methods and have noted that there are several important differences between these two systems, which should be considered before developing or implementing a diagnostic virology test. molecular beacons are very specific (tyagi and kramer, 1996) . the specificity is a direct result of their structure. in free solution a molecular beacon adopts a hairpin-loop conformation in which the reporter fluorescence is quenched by its proximity to the quencher molecule ( fig. 1 ). this is a very stable state and a molecular beacon will only bind to a target sequence, become linear and fluoresce if it is highly complementary. any nucleotide differences between the beacon and the target sequence will greatly reduce the target binding efficiency of the probe. as a result molecular beacons have an increased propensity for false negative results. we encountered this problem during the implementation of a previously published molecular beacon based test for the detection of parainfluenza viruses. during the initial assessment, this detected all culture/direct immunoflorescence parainfluenza 3 positive samples detected between 2001 and 2002. however, all parainfluenza 3 positive samples detected by dif or culture in 2003 were negative when tested with this assay. to assess whether the primers were amplifying the parainfluenza 3 viral rna, sybr green was added to the pcr reaction in place of the molecular beacon. the formation of pcr product was observed. using melt curve analysis, identical melting peaks were observed in all parainfluenza 3 samples and controls (fig. 2) . running the pcr products on an agarose gel and observing a band of the expected size confirmed the successful amplification of parainfluenza 3 rna by the primers. based on these results we deduced that the molecular beacon was no longer complementary to the amplified target sequence. consequently, following analysis of more recently available sequences in the database, a new molecular beacon was designed, which detected all 2003 parainfluenza 3 samples. fig unlike molecular beacons, dual labelled probes are in a permanent linear conformation (lee et al., 1993) (fig. 3) . like primers, they can tolerate a small number of mismatches between the probe and target and still bind to the target. consequently, dual labelled probes are less likely to result in false negative reactions and may, in comparison with molecular beacons, be of greater use in viral diagnosis where occasional changes in even the most conserved target sequence may be expected to occur (although it should be noted that mismatches can also lead to false negative reactions with dual labelled probes). however, either method will be useful if targeting a highly conserved region. the second difference between molecular beacons and dual labelled probe chemistries is related to the normalised fig. 2. figure showing assessment of whether real time molecular beacon primers were amplifying the parainfluenza 3 viral rna. in this reaction, sybr green was added to the pcr reaction in place of the molecular beacon (all samples negative by molecular beacon assay). the formation of pcr product was observed. using melt curve analysis, identical melting peaks were observed in all parainfluenza 3 samples and controls (http://probes.invitrogen.com/handbook/figures/0710.html). fig . 3 . dual labelled probes (also known as taqman tm probes) are oligonucleotides that contain a fluorescent dye on the 5 base, and a quenching dye located on the 3 base. when excited the flourescent dye transfers energy to the nearby quenching dye molecule rather than fluorescing, resulting in a non-fluorescent probe. dual labelled probes are designed to hybridize to an internal region of a pcr product. during pcr, when the polymerase replicates a template on which the probe is bound, the 5 -exonuclease activity of the polymerase cleaves the probe. this separates the fluorescent and quenching dyes and fret no longer occurs, allowing detection of the signal from the reporter dye. fluorescence increases in each cycle, proportional to the rate of probe cleavage. change in fluorescence ( r n ) produced during successful real time pcr. we have found in most, but not all cases, that dual labelled probes produce a greater fluorescent change than molecular beacons (fig. 4) . a larger r n allows easier interpretation of results, as low positive results maybe more easily differentiated from the variable background. dual labelled probes provide a greater fluorescent change as the reporter dye is irreversibly released from the quencher during the extension stage of each pcr cycle. consequently there is a cumulative and permanent record of successful amplification, which is added to during subsequent pcr cycles. molecular beacons are not destroyed at the end of each cycle, but return to free solution during the denaturation phase and revert back to their hairpin-loop structure. consequently there is no accumulation of free reporter dye and the extra fluorescence produced is less after each cycle than when compared to dual labelled probes. since real time pcr is a relatively new technique, published assays may not be available for all viral pathogens. as a result many laboratories may wish to develop novel in-house real time pcr assays. the initial stages in developing a real time pcr assay are the same as those required for designing traditional gel based pcr tests. the first step is to identify a conserved region of the viral (or other pathogen) genome in which to design the assay. a literature review will often reveal which genes are conserved, and most often these will be genes encoding nonimmunogenic proteins. once a gene is identified, a blast search (http://www.ncbi.nlm.nih.gov/blast/) is performed to locate the most conserved regions within this gene. as real time amplicons are short and contain a third oligonucleotide (i.e., the probe), the ideal region to design an assay would be 100-150 nucleotides long with 3 regions of 30 bases devoid of all base degeneracies. it is best to find a conserved region of 400-500 bases to allow the software to identify a number of potential assays. several software programs are available to design real time assays, and often software is provided by the instrument supplier. beacon designer (prefig. 4 . comparison of the r n produced when using dual labelled probes (a) vs. molecular beacons (b). table 2 main factors to consider when developing a dual labelled probe pcr assay factors to consider when developing a dual labelled probe pcr assay identify a conserved region of the viral (or other pathogen) genome identify a region within this area of ∼400-500 bases in length check that the probe sequence contains more c residues than g residues ensure that the probe does not begin with a g the optimal primer t m values are 58-60 • c the optimal probe t m should be ∼10 • c higher the amplicon should not exceed 150 bp in length primers should not contain more than 2/5 g or c residues at the 3 check the amplicon for secondary structure, and for specificity mier biosoft) can be used to design either molecular beacon assays or dual labelled probe based assays, and has additional functionality such as blast and secondary structure searching. primer express (applied biosystems) is another useful tool for designing taqman based assays, and is the only software currently available for designing assays based on applied biosystems (abi) mgb probes. once the software has suggested a primer and probe set, it is important to ensure that they meet the criteria ( table 2) . assuming the primers and probe meet these criteria, it is advisable to check the amplicon for secondary structure, and for specificity. secondary structure prediction software is available on the internet, for example, michael zukers' m-fold server (http://www.bioinfo.rpi.edu/∼zukerm/rna/) is particularly useful. a highly structured amplicon (higher − g) may reduce the efficiency of reverse transcription or primer annealing (fig. 5 ). this may reduce the overall sensitivity of the assay. the final stage of the design process is to check the amplicon for specificity using the blast algorithm (http://www.ncbi.nlm.nih.gov/blast/). the assay should be specific for the sequence/organism of interest, and should not detect other sequences. non-specific matches may be picked up, but closer analysis of the primer and probe binding sites often confirms that these sequences will not be amplified or detected due to multiple base changes. when performing gel based pcr it is essential to fully optimise primer concentrations to achieve the best sensitivity of the assay and best end-point signal (brightness of band) (gunson et al., 2003) . in real time pcr, the signal is detected early in the amplification process, and therefore the end-point variation seen in gel-based assays does not affect the result. also, careful design of the assay can reduce primer-dimer formation fig. 5 . structure within pcr amplicons may affect the sensitivity of an assay. respiratory syncitial virus (rsv)-a detection limit is 10 2 copies/reaction, while rsv-b which is more structured has a detection limit of 10 4 -10 5 copies per reaction. and increase the efficiency of the specific amplification reaction. consequently, many manufacturers of real time pcr equipment and oligonucleotide primers and probes no longer recommend optimising primer and probe concentrations for real time taqman assays. despite this we still perform an initial optimisation of both primer and probe concentrations to ensure we are running our real time pcr assays at their most sensitive and efficient. although for the majority of our assays the optimal concentrations are 1000:1000:300 nm (forward:reverse:probe), we have observed on several occasions that the optimal primer and probe concentrations were different to the values recommended. our method for primer and probe optimisation is available online (www.clinical-virology.org). however, other methods will also be available. optimisation of a real time pcr requires positive control material. where positive control is not available (examples being a virus, which cannot be cultured or a highly pathogenic virus such as h5 influenza or sars coronavirus), dna or rna oligonucleotide targets may be ordered. these are also useful as alternatives to plasmids as standards in quantitative assays. it should be noted that these oligonucleotide controls must be ordered from a separate supplier to prevent contamination of the primer-probe set, and should be diluted in a separate laboratory prior to use as they may contain up to 10 17 target copies per ml, and are therefore a considerable source of potential contamination. we have observed contamination in erythrovirus b19 primers purchased several months after a full length oligonucleotide control was ordered from the same supplier (fig. 6 ). once the assay is optimised, it is essential to check the sensitivity and specificity of a new pcr assay by using a selection of sample 'panels'. there is much debate about what is an acceptable validation process. these should minimally include clinical samples known to be positive by the current standard assay and should consist of the sample types commonly submitted to be examined for the virus in question. clinical samples tested negative by the previous method should also be examined to determine if the new assay is more sensitive than the current test, and samples known to be positive for other agents should be tested to confirm assay fig. 6 . contamination of primer and probes with assay target produced at the same facility. label 1, reaction component: supplier a salt free negative control, mean c t value: 21.08; label 2, reaction component: supplier a salt free positive control (−7), mean c t value: 21.10; label 3, reaction component: supplier a hplc negative control, mean c t value: 33.28; label 4, reaction component: supplier a hplc positive control (−7), mean c t value: 30.68; label 5, reaction component: supplier b negative control, mean c t value: 40.00; label 6, reaction component: supplier b positive control (−7), mean c t value: 29.93. a full length dna oligonucleotide representing the amplicon of a b19 real time pcr assay was synthesised by supplier a. during a later investigation into assay contamination following a reagent change, primers and probes were again purchased from supplier a (salt free and hplc purified), and from an alternative supplier b. the reagents purchased from supplier b (5 and 6) were clean, whilst those from supplier a (1 + 2) were contaminated with the previously synthesised positive control, even after hplc purification (3 + 4). specificity. serial dilution series of known positive samples may also be prepared, and tested in parallel in the new and previous assay systems to determine which assay is more sensitive. ideally these dilution panels should represent all subgroups of the target virus to ensure the test is sensitive for all types. a new test must be at least as sensitive as the assay in current use, and should ideally be able to detect a wider range of virus subtypes/variants. an additional method to validate a new assay is to test the assay using samples from an external quality assurance program. panels may be obtained from various sources, including national external quality assessment service (neqas) and quality control for molecular diagnostics (qcmd), and the expected results may be compared with those obtained from the old and new assays in parallel. the use of such panels also allows the comparison of assays currently in use by different laboratories. when implementing a newly designed or previously published assay a number of changes can be made in order to reduce the turn around time of the assay and increase laboratory throughput. multiplex real time pcr assays allow the detection of multiple pathogens within a single tube. the utilisation of such assays reduces overall testing costs and turn around times, enabling a high throughput. there are a number of multiplex real time pcr assays described in the literature (draganov and kulvachev, 2004; gunson et al., 2005; hindiyeh et al., 2001; richards et al., 2004; templeton et al., 2004) . we recently described 4 triplex assays designed to detect 12 respiratory viral pathogens. designing a multiplex real time pcr is a complicated process often requiring a great deal of trial and error. below are outlined some general criteria that may prove useful when designing such assays. in order to design appropriate primers and probes users should follow the development protocols outlined above. however, care should be taken to ensure that there is no primer or probe interaction that may reduce the sensitivity or efficiency of the pcr reaction. most primer design software will allow primer-probe interactions to be examined. in order to optimise the multiplex assay each separate pcr should be optimised separately before being assessed when added together (see above section for details). further experiments should include assessing the sensitivity of the multiplex assay for the simultaneous detection of mixed infections (real or spiked) and low copy targets in high copy backgrounds. ideally, no loss in sensitivity should be observed when additional primers are added. however, if the multiplex assay is less sensitive, altering the ratio of primers/probes concentrations may prove useful. alternatively, changing the concentration of pcr reagents (enzyme, mg 2+ , dntps etc.) may also be beneficial. some manufacturers are now producing real time reaction mixes specifically designed for use with multiplex assays, and provide guidelines on the optimal primer and probe concentrations to use. however, if all these factors fail to improve the sensitivity of the multiplex assay then some or all of the primer and probes may have to be redesigned. the number of targets detected in one assay is limited by the number of detection channels available on the real time platform and the number of fluorescent-labelled dyes available. newer machines tend to have five channels. although there are many fluorescent dyes available, many of the excitation/emission spectra overlap and thus only certain combinations can be used. at present we are using fam, vic, and cy5 detectors as these are optimal for the filter set utilised in the abi 7500 (please note that this may differ when using other platforms). syndrome based testing policies are ideal for rapid, high throughput testing. in our laboratory we offer a number of such "menus", which negate the need for clinical coding and allow samples to be tested immediately upon receipt (table 3) . for example, all csf samples from patients with neurological illnesses such as encephalitis or meningitis are tested for enterovirus, hsv (1 and 2), vzv, ebv, cmv and hhv-6 regardless of patient or clinical details. similar testing protocols are in place for urethritis, gastroenteritis, respiratory illness and eye infections. however, although such policies aid high throughput and reduce turn around times (sample receipt until when result is ready), it should be noted that they may be more expensive and will occasionally produce results that are difficult to interpret, e.g. herpes viruses in respiratory samples (see below). automation of the extraction and liquid handling process has led to significant improvements in turn around times and allows high throughput with a reduced risk of user error. many manufacturers now supply automated equipment for the extraction of nucleic acid from diagnostic samples ( table 4) . some manufacturers provide open platforms, which can be used with other suppliers' kits and reagents, while others provide complete extraction solutions. although universal extraction kits (dna and rna pathogens and most specimen types) are available, it should also be noted that different kits can be used for particular samples types and pathogens (e.g., rna or dna) and may be more sensitive for a particular application. although automated extraction has many advantages, laboratories should also consider complementing this service with a manual extraction system. this can be used for testing emergency samples that have arrived in the laboratory after an automated extraction has begun or for samples requiring special processing, not suited for automation, e.g. tissue. many suppliers also supply automated liquid handling equipment, which can facilitate the set up of large numbers of pcr reactions. traditionally most published and in-house developed real time pcr methods consist of the following standard parame-ters: a taq dna polymerase activation step (usually 95 • c for 2-15 min depending upon pcr kit manufacturer) followed by 40-50 cycles of 95 • c denaturation for 15-30 s and an annealing/extension cycle of 60 • c for 60 s. if an rna virus is to be detected, an additional 30 min reverse transcription step is required before the taq dna polymerase activation. overall the reaction run time for a real time pcr is between 80 and 100 min. we have repeatedly shown using dilution series of a number of dna and rna viral pathogens that reducing the duration of the reverse transcription step, the denaturing and annealing/extension step by 50% can reduce the reaction run time of the assay significantly without any concurrent loss in sensitivity (table 5) . overall our reaction run time has reduced to approximately 60 min (70 min for rt-pcr), freeing up pcr machines for further tests and allowing more testing within the working day. most dual labelled probe real time pcr assays are designed to utilise the same pcr parameters (i.e., denaturation step of 95 • c for 30 s and an annealing and extention step of 60 • c for 60 s). theoretically, multiple different real time pcr assays can be carried out at the same time on the sample plate. we have also shown that, where dna and rna reagents are purchased from the same supplier, and therefore have identical taq activation requirements, dna assays do not suffer any loss in performance when run through rt-pcr cycling conditions. this will allow laboratories greater flexibility and provide a rapid service. pre-prepared, frozen real time pcr reagents are user friendly and lead to reduced trt and improved quality control (qc) when compared to the preparation of pcr mixes from separate reagents. we have assessed two different methods of pre-prepared real time pcr reagents: frozen aliquots of pooled primers and probes, and frozen aliquots containing all real time pcr reagents. both systems have been assessed over relatively short time period (up to a maximum of 10 weeks, which corresponds to the maximum period of time a pool would last before running out). ideally these would have been assessed over a longer period. we find that the pooled primer and probe approach best suits seasonal assays such as those for respiratory pathogens, whereas the latter approach is more suited to assays which are performed regularly throughout the year on a standard number of samples. the advantages and disadvantages are listed in table 6 . we have introduced pooled primer and probes for the majority of our routine dna and rna tests. this has proved especially useful for our high throughput assays such as the 'respiratory screen', which consists of five triplex real time rt-pcr assays. for each multiplex assay, the operator needs only to mix three tubes containing pre-aliquotted reagents: an aliquot of mastermix containing rox reference dye, one containing enzyme mix (rt + taq), and an aliquot of primer probe pool (containing three sets of primers and probes, and sufficient water). in this way, mastermix can be prepared rapidly. the reagents have been carefully quality controlled and the possibility of pipetting or calculation errors at the time of preparation is reduced. the production of a large number of aliquots at the same time (sufficient for approximately 3000 tests) also facilitates inter-run reproducibility and assists in maintaining the quality of the results. while some mix is unavoidably wasted, the time saved and the reduced number of failed runs compensates for this cost, and during the summer months when sample numbers are much reduced, smaller aliquots can be prepared. table 7 shows the ct values obtained from the coronavirus triplex assay using pooled primers and probed stored for up to 6 weeks, demonstrating the stability of the reagents when stored at −20 • c. we have now been using the same lot number of pooled primer-probe for the coronavirus assay for in excess of 10 weeks without loss of performance. with this system and pooled controls (see below) in use, we are now able to provide an efficient and reliable. 3.6.2. frozen pools of primers, probes, mastermix and enzyme the use of aliquots of frozen mastermix (containing all pcr reagents except template) is an alternative to frozen primer and probe aliquots described above. the laboratory user need only remove the desired number of aliquots (or plates if frozen in this format), defrost and then add the template to be tested. frozen aliquots are easier to use than the pooled primer and probe method, facilitate rigorous quality control and reduce the overall turn around times. however, they are less flexible than the primer probe aliquot system and wastage will be more expensive as it includes enzyme. furthermore, any mistakes in the making up of the aliquots will result in the loss of primers and probe and expensive mastermix. we have shown, using positive controls, that both rna and dna mastermix from a number of companies (applied biosystems, invitrogen, and qiagen) can be frozen for at least 1 month with no loss of sensitivity. positive and negative controls are an essential part of any diagnostic pcr service. until recently, we, and many other laboratories, utilised two dilutions of a positive control for each virus to be tested (the end-point of a dilution series of cultured virus tested in the relevant assay (acting as a sensitivity control) and the dilution 1 log less dilute). as a result, for each robot extraction run of 96 wells, a substantial number of wells were required for the positive controls alone. the inclusion of negative extraction controls further reduces the possible number of extractions available for samples. the use of numerous controls increases the cost per sample and the turnaround times of the service. pooled controls are a significant improvement on the previous method and we now use separate pools containing 12 respiratory viruses, and 6 gastrointestinal pathogens. in order to develop a pooled respiratory or gastrointestinal control, each virus culture or stool extract was serially diluted and table 7 ct of positive control on frozen primer/probe pools at 4, 6 and 8 weeks an end point established. for the respiratory virus control a 'high' positive control pool was prepared by adding an equal volume of the dilution 2 logs above the end point for each of the 12 culture fluids. a further 1 in 10 dilution of this 'high' positive control was prepared to produce the 'low' positive control. we now include just two respiratory controls on our robot extractions, freeing up an additional 22 wells for other samples. the preparation of a large volume of control at the one time allowed better qc and reproducibility to be achieved. aliquots of control are stored at −70 • c and have been found to be stable for up to 3 months so far. we have previously experienced lot-to-lot variation of both primers and probes resulting in reductions in test sensitivity. when a new batch of reagents is purchased we now run a performance test (using the new reagents at the same concentrations previously determined as optimal) by testing the 'old' and 'new' primer probe sets in parallel with the same positive control on the same pcr run. if the c t and r n values observed are comparable (newly prepared reagents must produce c t values falling within two standard deviations of the mean value determined for the reagents previously in use (when testing identical positive controls), the new reagents are released for routine use. if the assay is less sensitive than the previous assay then primer and/or probe optimisation should take place. ideally this should be done several weeks before the next batch is required for routine use as new probes or primers may need to be re-ordered. our experience over the winter of 2004-2005 is that re-optimisation has not been required for any of the respiratory assays. for validation of each real time pcr run we recommend the following. the c t of the positive control should be documented with each run and compared to the value derived from previous runs. this should help identify any loss in sensitivity that can be seen due to user error or degradation of pcr reagents. if the c t falls significantly below the expected value the run should be repeated (outwith two standard deviations of the mean value determined by previous runs (when testing identical positive controls). if the c t remains low or reduces further, new controls and pcr reagents may be required. in addition to this the overall fluorescence change should also be monitored with each run. reductions in fluorescence may cause interpretation difficulties and may also highlight a problem in the pcr reaction. as with changes in c t , large reductions in fluorescence may result in the need to repeat the pcr or introduce a new batch of controls and pcr reagents. ideally real time pcr tests should include an internal control in order to ensure confidence in negative results. there are many internal control pcr tests available targeting animal viruses (added to the sample before extraction) and synthetic controls (which are added to the mastremix), and human genes. however, the inclusion of such controls can be expensive as they may have to be carried out separately from the diagnostic assay. as a result many laboratories (including ourselves) do not use such controls on all tests. any laboratories performing real time pcr assays can perform quantitative assays with the addition of suitable standard quantitative controls to the assay, although a uniform sample type is required to obtain meaningful results (e.g., blood, urine). attempting to quantify virus in nonuniform sample types (such as respiratory samples or stool) is not recommended without thorough assessment of sampling reproducibility. in common with many laboratories, we prepare our quantitative standards (oligos or plasmids) in bulk, test these for acceptable linearity and slope (−3.33) for a good 10-fold dilution series (we allow a range of 3.18-3.45 which equates to a variation of ±5% in the efficiency of the reaction), and then aliquot this into volumes sufficient to last 1 week at 4 • c. aliquots are stored frozen at −20 • c until required. it is essential to track the c t values of the controls to check that the assay is performing satisfactorily, and to enable a smooth transition to a new control set when required (fig. 7) . we record our c t values in the form of a shewart control chart (davies, 2003) . newly prepared standards (produced annually) must have c t values falling within two standard deviation of the mean value determined for the standards previously in use. a second issue with quantitative assays that do not use extracted material as quantitative controls is that these assays are sensitive to changes in extraction methodology or efficiency. we have recently moved to a more efficient extraction kit (qiaamp virus robot kit), but as our standards are plasmid or cellular dna based and are not extracted alongside the specimens, we are now reporting higher viral loads for the same sample than with previous extraction procedures. this observed change in viral loads is only a problem during the crossover period from one extraction procedure to another, as subsequent samples will be analysed in the light of the new baseline level. to ensure intra-run extraction consistency, a positive or an internal control (of known quantity) should be extracted and run at the same time as the samples to be tested. this control should be monitored in the same way as outlined above (see routine validation of each real time pcr run). once an assay (or a number of assays) has been introduced into routine service it is important to re-assess the sensitivity of the assay in relation to current circulating viruses. this can fig. 7 . application of shewart control chart to track potential changes in assay performance. the mean ct values obtained for the 1 × 10 7 copies per ml standard were plotted over time. the average value of these ct values was calculated and plotted (red line) for each data set (along with two standard deviations above (pink line) and below (blue line) the average value). two standard deviations are generally accepted as the warning level in such analyses. the first 'jump' (a) represents a change in the set of standards used, and while this is not ideal, results in a much more reproducible assay. the second jump (b) is caused by a change in the primer-probe pool in use, and shows a significant change in the sensitivity of the assay. as a result of this analysis another batch of primer-probe pool was prepared and the results obtained returned to the acceptable range. for interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article. be carried out using positive samples detected by an alternative test or by comparing primers and probe to new sequences stored in surveillance databases. although most assays target a conserved region of the viral genome, small changes in the target can result in false negative reactions due to primer and/or probe mismatches. if a loss in sensitivity occurs primer or probe sequences may need to be updated or a new assay may have to be developed. interpreting real time pcr results is a relatively straightforward process. in a fully optimised assay all positive results should show increases in fluorescence in a characteristic exponential curve. however there are still pitfalls that we feel users should be made aware of when interpreting data. occasionally samples may show "signal drift" (traces that increase in fluorescence as the pcr progresses but are not exponential) (fig. 8) . signal drift can be produced for a number of reasons. true positive samples may show signal drift because of sub optimal pcr conditions, inhibition and primer mismatches. occasionally negative samples may also show signal drift. this may be due to probe breakdown resulting in a fluorescence increase. signal drift often occurs towards the end of the pcr reaction. some platforms allow multicomponent analysis of weak positive traces. this allows users to assess the changes of each fluorescent label in the reaction. genuine positive traces will show an exponential increase in the fluorescent signal whereas signal drift is often due to a change in the normalisation dye (e.g., rox). we currently repeat all positive samples with ct's greater than 35 cycles as we feel these may be either low copy number positive samples or non-specific reactions. some 96 well real time plates require sealing with optically clear plate seals before pcr can take place. on occasion these may not seal properly and pcr reagents evaporate during cycling. as a result of this a curve may be produced mimicking a positive pcr reaction. the correct placing of the threshold line is essential to allow accurate c t measurement. some of the computer software available with current real time pcr formats can automatically place the threshold line during result analysis. any sample with fluorescence above this line will be regarded as positive by the computer. always check the automatic placement of the threshold line as we have found that sometimes the computer will place it wrongly resulting in both false positive and negative results (fig. 9 ). an alternative is to use a fixed threshold line. the use of such a system will ensure the real time assay is directly comparable to previous runs this should not preclude careful analysis of the data. the increased sensitivity of real time pcr means that, like nested pcr, occasionally positive results will be obtained that fig. 8 . example of negative samples showing signal drift. the two sample shown in blue are showing an increases in flourescence when examined using the quantification option (shown above left). analysis of the raw cycling data (shown above right) shows that there is no increase in flourescence usually associated with a positive sample. are not in keeping with accepted knowledge. for example, herpes viruses in throat swabs should be interpreted with care. we often detect low positive ebv, hhv-6, hsv or cmv in throat swabs in cases of respiratory infection. whether these are the cause of disease or unrelated re-activations are unclear. although these findings may be irrelevant to the clinical illness it is important that these results are not ignored. for as we gain more experience with these sensitive assays we may identify new, previously unrecognised syndromes attributed to particular viral pathogens. there is no doubt that in the coming years an increasing number of virology laboratories will utilise real time fig. 10 . the turn around time of respiratory samples in 2002-2003 to 2004-2005. pcr assays. as a result virology laboratories will be able to offer more tests and process more samples while reducing turn around times. this can be highlighted by our winter respiratory surveillance service (servis), which currently tests for 12 pathogens. during the 2004-2005 season 509 samples were tested with 80% of results reported within 3 days of the samples arriving in the laboratory (fig. 10) . for 2002-2003 when gel based pcr was used to detect influenza a and b, rsv and picornavirus, 554 samples were tested in total. only 3.6% of results were available in 3 days with most results returned to users within 14 days. with a slightly extended working day, real time pcr results ought to be reported within 36 h of receipt. the routine use of real time pcr will have several benefits. first it will aid patient management (prognosis, treatment guidance and infection control) and may assist in the development of new antiviral therapies. real time pcr will also improve the sensitivity of the surveillance of viral pathogens, increasing our understanding of these important infections, providing accurate assessments of the morbidity and economic cost of disease and facilitating the implementation of public health prevention measures. 356 2.1. which real time pcr chemistry is best for viral diagnosis? automated extraction and liquid handling equipment continual assessment of the sensitivity of real time pcr primers and probe basic principles of real time quantitative pcr preventing pcr amplification carryover contamination in a clinical laboratory pitfalls of quantitative real time reverse-transcription polymerase chain reaction a coloured version of the j chart or the amc-d j-chart molecular techniques for detection, identification and analysis of human papillomaviruses (hpvs) my favourite primers: real time rt-pcr detection of 12 respiratory viral infections in four triplex reactions optimisation of pcr reactions using primer chessboarding evaluation of a multiplex real time reverse transcriptase pcr assay for detection and differentiation of influenza viruses a and b during the 2001-2002 influenza season in israel allelic discrimination by nick-translation pcr with fluorogenic probes real time pcr in the microbiology laboratory genogroup i and ii noroviruses detected in stool samples by real time reverse transcription-pcr using highly degenerate universal primers diagnostic value of real time capillary thermal cycler in virus detection rapid and sensitive method using multiplex real time pcr for diagnosis of infections by influenza a and influenza b viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3 and 4 molecular beacons: probes that fluoresce upon hybridization key: cord-297365-11es4w0u authors: peng, hui; gao, ping; xu, qiong; liu, maochang; peng, jing; wang, yang; xu, hua title: coronavirus disease 2019 in children: characteristics, antimicrobial treatment, and outcomes date: 2020-05-07 journal: j clin virol doi: 10.1016/j.jcv.2020.104425 sha: doc_id: 297365 cord_uid: 11es4w0u background: at present, coronavirus disease 2019 (covid-19) has spread in many countries. we conducted this study to help paediatricians to help pediatricians understand the conditions of covid-19 in children, we conducted this study. methods: we retrospectively summarized the characteristics, treatment and outcomes of pediatric cases in wuhan children's hospital which was the only designated hospital for children with covid-19 in hubei province. a cox proportional hazards regression analysis was used to evaluate factors associated with clinical outcomes. results: as of february 29, 75 children had been discharged, of which only one was has severe pneumonia and one was critical cases. children younger than 2 years were more susceptible to covid-19. all patients have received interferon-α nebulization, and eight cases including the severe and critical cases were co-administrated ribavirin. five patients with mild pneumonia were given arbidol. twenty-three patients were given traditional chinese medicine (tcm). the average length of stay (los) and the time of sars-cov-2 clearance were 10.57 and 6.39 days, respectively. none of the factors was associated with los or time of sars-cov-2 clearance. conclusions: the severity of covid-19 in pediatric cases were milder than adults. the efficacy of the antiviral therapy in children with covid-19 remains to be evaluated. in december 2019, a cluster of cases caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) was reported in wuhan, hubei province. by april 27, 2020, more than 2.8 million cases have been reported worldwide. for such a threat to global health, the clinical characteristics, treatment strategies and its outcomes are the most concerned issues for clinicians. people of all ages, including children, are susceptible to coronavirus disease 2019 . however, the sample size in the available reports on the clinical characteristics of children with covid-19 was usually small [1] . in addition, the outcome of the treatment regimen remains to be verified in children, although a few experts' consensuses about pediatric have been published [2] [3] [4] [5] . wuhan children's hospital is the only designated hospital for children diagnosed with covid-19 in hubei province. in this study, we retrospectively analyzed the characteristics, treatment and outcome of pediatric cases in this hospital. the observed cases were pediatric patients who were discharged from the wuhan children's hospital from december 8, 2019 to february 29, 2020 and diagnosed with covid-19. all cases were documented according to the oropharyngeal or anal swab samples tested positive for sars-cov-2 nucleic acid using rt-pcr. confirmed patients can be discharged if their clinical symptoms improved obviously and respiratory pathogenic nucleic acid is negative for two consecutive times [3] [4] [5] . data, included demographics, clinical, laboratory and radiological information, treatment and outcomes, were collected from patients' medical records. (1) the severity of illness was defined according to the experts' consensus [4] , that is acute upper respiratory tract infection, mild pneumonia, severe pneumonia and critical cases (supplementary table 1 a total of 75 patients have been discharged, and none have died by february 29 (table 1 ). the mean age was 6.06 years (range 1 month-15 years). as showed in the age distribution chart (figure 1 ), children younger than 2 years account for the highest proportion (28.0%) in pediatric covid-19. a majority of the children (82.7%) had family members diagnosed with covid-19. with the exception of fever (53.3%) and dry cough (61.3%), other clinical symptoms were less common. all cases have received chest ct examination. the normal, local patchy shadowing, bilateral patchy shadowing and ground-glass opacity chest ct were observed in 22 (29.3%), 22 (29.3%), 26 (34.7%) and 5 patients (6.7%), respectively. most children (58.7%) did not have complications. 32.0%, 6.7%, and 2.7% of patients had one, two, and three complications, respectively. the most common complication was an increase of creatine kinase-mb [6] . there was only one case with severe half of the patients have been treated with antibacterial agents (first-or second-generation cephalosporins), but most cases discontinued it after covid-19 was confirmed. it is worth noting that 37.3% of patients were co-j o u r n a l p r e -p r o o f infected with mycoplasma pneumoniae, and all of them were given azithromycin orally. the average los was 10.6 days. in a multivariate cox model analysis, we failed to observe any factor associated with los ( table 3 ). the mean time of sars-cov-2 rna clearance was 6.4 days. in the multivariate cox model analysis, none of the factors was related to the time of sars-cov-2 rna clearance. under the current global epidemic situation, clinicians' knowledge of the covid-19 in children is generally lacking. we summarize the characteristics, treatment and outcomes of pediatric patients discharged from our hospital, hoping to provide a reference for diagnosis and treatment of children in other countries. our data suggested that infected family members were the main cause of covid-19 in children, so healthy adults were recommended as the caregivers of children. young children are more dependent on their family members and infants are not suitable for wearing masks, which may explain why children younger than 2 years are the most vulnerable group to covid-19. the age distribution in our center was consistent with previous studies [7, 8] . overall, the severity of covid-19 in pediatric cases was milder than adults. chinese center for disease control and prevention has analyzed the illness severity of 44415 adult and pediatric patients, and found that severe and critical cases accounted for nearly 20% [9] . a epidemiological study in chinese children with covid-19 (n=2143) showed that severe and critical illness accounted for j o u r n a l p r e -p r o o f 5.8% [10, 11] . in this study only 2.7% of children were severe or critical cases. however, the severity of the disease may be underestimated because our data were calculated based on discharged patients rather than all confirmed cases, and mild cases were more likely to be discharged. the major clinical symptoms of children were similar to those of adults, such as fever and cough. but the typical symptoms (e.g. fatigue and sputum) of children were less frequent than that of adults [6] . in addition, the features of chest ct for pediatric patients were also different from adults, which has been specifically discussed by our colleagues [11] . the antiviral drugs for pediatric covid-19 recommended in the current consensuses were summarized in supplementary table 2 . interferon-α nebulization and tcm were recommended for all cases, especially children with mild pneumonia. since most of the children were relatively mild, this study was not powered to test the efficacy of these medications on outcomes. as early as 2003, the in vitro study has found that interferon-α could effectively inhibit sars-cov replication [12] , but its efficacy in patients remains inconclusive [13] . in our center and another three hospitals in zhejiang province, china, all children were given interferon-α by aerosolisation [9] . consequently, the efficacy of interferon remains to be evaluated. in fact, interferon was commonly used in combination with ribavirin rather than alone in the treatment of sars or middle east respiratory syndrome (mers) [14] . however, the efficacy of this combination in patients was still controversial [14, 15] . in our center, we have combined interferon with ribavirin for severe and critically ill patients. in the study of qiu et al., none of the patients received ribavirin, whereas, 39% of the patients used lopinavir-ritonavir (lpv/r) [9] . regardless of the illness severity and other baseline characteristics, the days of hospital stay (14±3 vs. 10.57±3.22 days) and sars-cov-2 clearance (10±2 vs. 6.39±2.29 days) in their centers were not shorter than ours. yet the efficacy needs to be confirmed by multi-center and large-sample research. several tcm treatment schedules have been proposed against covid-19. tcm has played an important role in the treatment of adult covid-19, especially the mild cases [13] . xia et al. compared the clinical outcomes of combined chinese and western medicine (34 cases) and that of western medicine (18 cases) in adult cases of covid-19. they found that the patients who received combined chinese and western medicine had better clinical outcomes, such as the improvement time of clinical symptom, length of hospital stay, and cure rate [10] . however, its efficiency and safety in children remain to be verified. arbidol is an antiviral agent indicated for upper respiratory tract infection caused by influenza virus in russia and china. in the treatment of covid-19, arbidol was often combined with lpv/r, and some researches showed that this combination was associated with better clinical outcomes than lpv/r alone [15, 16] . zhu et al. compared the efficacy of arbidol monotherapy with lpv/r, and found that patients in the arbidol group had a shorter duration of positive rna test (p<0.01) [17] . on february 19, arbidol was included in a case series of children with 2019 novel coronavirus infection: clinical and epidemiological features pediatric branch of hubei medical association; pediatric branch of wuhan medical association recommendation for the diagnosis and treatment of novel coronavirus infection in children in hubei diagnosis and treatment recommendations for pediatric respiratory infection caused by the 2019 novel coronavirus cardiovascular complications in patients with covid-19: consequences of viral toxicities and host immune response clinical characteristics of children with coronavirus disease covid-19 epidemic: disease characteristics in children clinical and epidemiological features of 36 children with coronavirus disease 2019 (covid-19) in zhejiang, china: an observational cohort study epidemiology of covid-19 among children in china covid-19 in children: initial characterization of the pediatric disease treatment of sars with human interferons treatment efficacy analysis of traditional chinese medicine for novel coronavirus pneumonia (covid-19): an empirical study from wuhan ribavirin and interferon alfa-2a for severe middle east respiratory syndrome coronavirus infection: a retrospective cohort study clinical features of 69 cases with coronavirus disease arbidol combined with lpv/r versus lpv/r alone against corona virus disease 2019:a retrospective cohort study arbidol monotherapy is superior to lopinavir/ritonavir in treating covid-19 key: cord-300018-3uzau7if authors: mak, gannon c.k.; lau, angela w.l.; chan, andy m.y.; chan, desmond y.w.; tsang, dominic n.c. title: the d614g substitution in the s gene and clinical information for patients with covid-19 detected in hong kong date: 2020-07-24 journal: j clin virol doi: 10.1016/j.jcv.2020.104550 sha: doc_id: 300018 cord_uid: 3uzau7if nan in an attempt to understand the relevance of d614g substitution among covid-19 patients in hong kong, full length s gene sequences from severe and non-severe cases were examined. covid-19 patients were confirmed by rt-pcr as described [12] . the severe cases were classified as described previously [13] . for this analysis, the original specimens of the respiratory samples from covid-19 patients were sequenced using sanger method. only one specimen from each patient was included. the pcr amplification and dna sequencing of the full length of s gene were performed using eight pairs of in-house designed primers (available on request). the sars-cov-2 virus reference sequence, nc_045512 (genbank accession number), was used in this analysis. from 22 jan 2020 to 12 jun 2020, a total of 113 cases were sequenced. among them, 11 and 102 were severe and non-severe cases respectively. of 11 severe cases, 4 (36.4%) showed d614g substitution while 39 (38.2%) non-severe cases showed d614g substitution. there is no association of d614g with severe illness (p=1.000, fisher's exact test, doubled one-sided). of the 49 cases (6 severe cases and 43 non-severe cases) sequenced between january and february, none of them showed d614g. the first case sars-cov-2 is an rna virus which evolves rapidly. it is interesting to see that the dominance of 614g virus is increasing over the 614d virus [14] [15] [16] . although functional characteristics are unknown, numerous s gene mutations are reported regularly in gisaid [17] . it is thus important that laboratory surveillance continues to monitor the mutations of the s gene for sars-cov-2 viruses. concurrent genetic surveillance would facilitate early detection of sites that can increase mortality and j o u r n a l p r e -p r o o f infectivity as well as sites that are selected for the virus to escape immunological restraint especially when the vaccine is available. none. j o u r n a l p r e -p r o o f safety, tolerability, and immunogenicity of a recombinant adenovirus type-5 vectored covid-19 vaccine: a dose-escalation, open-label, non-randomised, first-in-human trial receptor recognition by the novel coronavirus from wuhan: an analysis based on decade-long structural studies of sars coronavirus structure, function, and antigenicity of the sars-cov-2 spike glycoprotein genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding evolution of the novel coronavirus from the ongoing wuhan outbreak and modeling of its spike protein for risk of human transmission cryo-em structure of the 2019-ncov spike in the prefusion conformation could the d614g substitution in the sars-cov-2 spike (s) protein be associated with higher covid-19 mortality? sars-cov-2 viral spike g614 mutation exhibits higher case fatality rate evolutionary and structural analyses of sars-cov-2 d614g spike protein mutation now documented worldwide the d614g mutation in the sars-cov-2 spike protein reduces s1 shedding and increases infectivity the d614g mutation of sars-cov-2 spike protein enhances viral infectivity and decreases neutralization sensitivity to individual convalescent sera evaluation of rapid antigen test for detection of sars-cov-2 virus association of d222g substitution in haemagglutinin of 2009 pandemic influenza a (h1n1) with severe disease emerging sars-cov-2 mutation hot spots include a novel rna-dependent-rna polymerase variant spike mutation pipeline reveals the emergence of a more transmissible form of sars-cov-2 the sars-cov-2 spike protein d614g mutation shows increasing dominance and may confer a structural advantage to the furin cleavage domain key: cord-281495-beb164oy authors: charpentier, charlotte; ichou, houria; damond, florence; bouvet, elisabeth; chaix, marie-laure; ferré, valentine; delaugerre, constance; mahjoub, nadia; larrouy, lucile; le hingrat, quentin; visseaux, benoit; mackiewicz, vincent; descamps, diane; fidouh-houhou, nadhira title: performance evaluation of two sars-cov-2 igg/igm rapid tests (covid-presto and ng-test) and one igg automated immunoassay (abbott) date: 2020-09-03 journal: j clin virol doi: 10.1016/j.jcv.2020.104618 sha: doc_id: 281495 cord_uid: beb164oy the aim of this study was to assess the analytical performances, sensitivity and specificity, of two rapid tests (covidpresto® test rapid covid-19 igg/igm and ng-test® igm-igg covid-19) and one automated immunoassay (abbott sars-cov-2 igg) for detecting antisars-cov-2 antibodies. this study was performed with: (i) a positive panel constituted of 88 sars-cov-2 specimens collected from patients with a positive sars-cov-2 rt-pcr, and (ii) a negative panel of 120 serum samples, all collected before november 2019, including 64 samples with a cross-reactivity panel. sensitivity of covid-presto® test for igm and igg was 78.4% and 92.0%, respectively. sensitivity of ng-test® for igm and igg was 96.6% and 94.9%, respectively. sensitivity of abbott igg assay was 96.5% showing an excellent agreement with the two rapid tests (κ = 0.947 and κ = 0.936 for ngtest ® and covid-presto® test, respectively). an excellent agreement was also observed between the two rapid tests (κ = 0.937). specificity for igm was 100% and 86.5% for covid-presto® test and ng-test®, respectively. specificity for igg was 92.0%, 94.9% and 96.5% for covid-presto®, ngtest ®, and abbott, respectively. most of the false positive results observed with ng-test® resulted from samples containing malarial antibodies. in conclusion, performances of these 2 rapid tests are very good and comparable to those obtained with automated immunoassay, except for igm specificity with the ng-test®. thus, isolated igm should be cautiously interpreted due to the possible false-positive reactions with this test. finally, before their large use, the rapid tests must be reliably evaluated with adequate and large panel including early seroconversion and possible cross-reactive samples sars-cov-2 antibodies. this study was performed with: (i) a positive panel constituted of 88 sars-cov-2 specimens collected from patients with a positive sars-cov-2 rt-pcr, , in particular patients presenting strong covid-19 suspicions with negative pcr. serological tests also make it possible to catch up later with undiagnosed people at time of active infection, since antibodies have been found in almost all people who have been in contact with sars-cov-2 within a variable period depending on the severity of the infection [1, 2] . furthermore, studies showed that the kinetics of appearance of igm and igg were relatively close [3] . two types of tests are available to detect anti-sars-cov-2 antibodies: rapid lateral flow tests and automated immunoassays. several studies have assessed analytical performances of the automated immunoassays [4] [5] [6] [7] . on the other hand, although a very large number of rapid tests have been developed, few of them have been reliably evaluated with a suitable serum panel. however, this is very important to have data about the efficacy of these rapid tests to reliably detect anti-sars-cov-2 antibodies, since their increasing use in the world. the aim of this study was to assess the analytical performances (sensitivity and specificity) and agreement of two rapid tests and one automated immunoassay for detecting antibodies against sars-cov-2. in addition, we assessed five samples containing autoantibodies (four rheumatoid factor and one systemic lupus erythematosus). we also assessed the serum of 54 health-care workers who presented clinical symptoms during the epidemic period for whom sars-cov-2 rt-pcr was negative or not carried out. we evaluated two lateral flow tests: covid-presto ® test rapid covid-19 igg/igm (aaz, boulogne-billancourt, france) and ng-test ® igm-igg covid-19 (ng biotech, guipry, france) according to the manufacturer's instructions. five and ten microliters of serum for covid-presto ® test and ng-test ® , respectively, were added and results were read and interpreted 10 minutes after depositing serum. abbott sars-cov-2 igg kit (chemiluminescent microparticle immunoassay) (abbott, il, usa) was performed according to the manufacturer's instructions. the assay cut-off is an index of 1.40 and the assigned grey zone is comprised between 1.12 and 1.68. all statistical analyses were performed using excel. to assess sensitivity, rt-pcr results were chosen as gold standard. cohen kappa statistics and absolute agreement were calculated to evaluate the agreement between the different tests. all participants were not opposed to the collection of their data. sensitivity of covid-presto ® test was assessed on 88 samples collected between day 4 and day 42 after onset of symptoms and sensitivity of the ng-test ® was assessed on a subgroup of 59 samples among the 88 samples tested with covid-presto ® test, collected between days 7 and 28 after onset of symptoms ( table 1) . sensitivity of covid-presto ® test for igm was 67% (n=12/18), 88% (n=29/33) and 76% (n=28/37) for samples collected between days 4 and 9, between days 10 and 14, and after 14 days after onset of symptoms, respectively. sensitivity of covid-presto ® test for igg was 72% (n=13/18), 94% (n=31/33) and 100% (n=37/37) for samples collected between days 4 and 9, between days 10 and 14, and after 14 days after onset of symptoms, respectively. when combining igm and igg, sensitivity of covid-presto ® test was 83% (n=15/18), 97% (n=32/33) and 100% (n=37/37) for samples collected between days 4 and 9, between days 10 and 14, and after 14 days after onset of symptoms, respectively. sensitivity of ng-test ® for igm was 83% (n=5/6), 100% (n=22/22) and 97% (n=30/31) for samples collected between days 7 and 9 after, between days 10 and 14, and after 14 days after j o u r n a l p r e -p r o o f onset of symptoms, respectively. sensitivity of ng-test ® test for igg was 83% (n=5/6), 96% (n=21/22) and 97% (n=30/31) for samples collected between days 7 and 9, between days 10 and 14, and after 14 days after onset of symptoms, respectively. when combining igm and igg, sensitivity of ng-test ® test was 83% (n=5/6), 100% (n=22/22) and 97% (n=30/31) for samples collected between days 7 and 9, between days 10 and 14, and after 14 days after onset of symptoms, respectively. among the 59 serum samples of this pcr positive panel tested by the two rapid tests, 57 were compared with abbott sars-cov-2 igg automated immunoassay. sensitivity of abbott igg test was 67% (n=4/6), 100% (n=22/22) and 100% (n=29/29) for samples collected between days 7 and 9, between days 10 and 14, and after 14 days after onset of symptoms, respectively. agreement between abbott assay and rapid tests (igm/igg combined) was of 96.5% (n=55/57). in one case, the two rapid tests detected igg that were not detected by abbott (index=0.94), this sample was collected between days 7 and 9 after symptoms onset. for the second case, igg were detected in the greyzone of abbott (index=1.45) but not by ng-test ® . this latter sample was collected between days 10 and 14 after symptoms onset and igm were positive with the two rapid tests. specificity of covid-presto ® test was assessed on 120 samples described in the methods section. specificity of ng-test ® and abbott assay was assessed on a subgroup of 52 samples among the 120 samples tested with covid-presto ® test ( table 1) . npv was 97.5%, 95.9% and 94.3% for covid-presto ® , ng-test ® and abbott, respectively. in the present study, we evaluated two different lateral flow tests (covid-presto ® and ng-test ® ) and compared their performances to that of the automated abbott immunoassay using the same samples panel. sensitivity has been assessed using a panel of 88 serum samples of covid-19-infected patients (confirmed with a positive pcr), serum was collected between day 4 and day 42 after symptoms onset. sensitivity for igm, among the samples collected before day 9 after symptoms onset, was 67% and 83% for covid-presto ® test and ng-test ® , respectively. in the recent study of nicol et al., they found sensitivity of ng-test for igm of 43.8% for the samples collected before day 7 after symptoms onset and of 81.8% among all samples [5] . the excellent sensitivity of covid-presto ® test observed in our study confirmed the findings of the prazuck et al. study showing 100% of sensitivity in samples collected more than 15 days after symptoms [8] . among some samples collected before day 10 after symptoms onset, a simultaneous detection of igm and igg antibodies has been detected. these findings are in line with the antibodies kinetics described for igm and igg also using lateral flow rapids, as previously described with other techniques [3] . in the present study for covid-presto ® test, it allowed to increase the sensitivity from 67% when only igm are taken into account to 83% when both igm and igg are taken into account, highlighting the important added value to interpret the rapid tests by combining igm and igg antibodies. sensitivity for igg in samples collected later than 10 days after symptoms onset was excellent with the different tests being equal to 97.1%, 96.2% and 100% for covid-presto ® , ng-test ® , and abbott, respectively. thus, both rapid tests showed an excellent sensitivity for igg with a very good agreement with abbott. a previous study assessing abbott test performance j o u r n a l p r e -p r o o f showed sensitivity of 100% for igg for samples collected after 15 days after symptoms onset and of 69% for samples collected between 9 and 14 days after symptoms onset [6] . in this latter study, results sensitivity for igg were similar using ng-test ® [6] . in another study, igg sensitivity of abbott test was 91.8% for patients hospitalized 15 days after symptoms onset and 95.7% for patients non-hospitalized 20 days after symptoms onset. a limitation of our study could be that most of the patients of the positive panel presented severe infections, since 74% of them were hospitalized in infectious disease unit or in intensive care. interestingly, among the 14 out-patients, samples were collected for 9 of them 10 days after symptoms onset, showing positive igm and/or igg in seven cases with covid-presto ® test. insufficient quantity of serum for these patients was available to also test with ng-test ® and abbott. previous studies have reported that the kinetics and intensity of immune response could differ depending on the disease severity [1, 2] , thus it will be needed to also evaluate rapid tests in mild and pauci-symptomatic patients. another limitation is the difference in the number of tested samples for the early panel (serum samples collected before 9 days after symptoms onset) between the two rapid tests that which can bias the comparison between these tests for this group. a limitation is that we make this evaluation from serum samples and not from capillary blood specimens. regarding specificity evaluation, a crucial point for rapid tests, we used a large panel with 120 pre-endemic samples including 64 representatives of different profiles that can generate possible cross-reactivity. in our study, we showed an excellent specificity, above 96% in all cases and equal to 100% for igm with covid-presto ® test. the excellent specificity of covid-presto ® test was also observed in the study of prazuck et al. [8] . in our study, the only issue regarding specificity is for igm with ng-test ® , since specificity is only of 86.5%. however, this low specificity is mainly due to cross-reactivity with sera containing reactivity malarial antibodies. in the study of nicol et al. igm specificity with ng-test ® was 95.3% [5] , higher j o u r n a l p r e -p r o o f than in our study, however their negative panel contained no serum with malaria antibodies. regarding automated immunoassay, we showed a very good specificity of 96.2% for igg with abbott, confirming previous results of 99.3%, 99.6% and 100% [9] . serum samples containing malarial antibodies are absent or underrepresented in the negative panel of the other studies, although they are known to generate possible cross reactivity. this is very important to include it in the negative panel, since this is a differential diagnosis in patients returning from malaria endemic region with flu-like symptoms. overall, in our study, we observed a very good ppv and npv for both rapid tests. in conclusion, analytical performances for detection of anti-sars-cov-2 igg antibodies by two lateral flow rapid tests are very good and quite comparable to those obtained with automated immunoassay. however, serological tests should be used after day 10 following symptoms onset. before this, rt-pcr is the gold standard test for covid-19 diagnosis. the interpretation by combining igm and igg increased sensitivity of rapid tests. the presence of isolated igm should be cautiously interpreted due to the possible false-positive reactions. finally, the rapid tests must be reliably evaluated with adequate and large panels including early seroconversion and possible cross-reactive samples, before their large use and particular interest in low-resource settings. antibody responses to sars-cov-2 in patients with covid-19 different longitudinal patterns of nucleic acid and serology testing results based on disease severity of covid-19 patients interpreting diagnostic tests for sars-cov-2 inmicovid-19 laboratory team, performance evaluation of abbott architect sars-cov-2 igg immunoassay in comparison with indirect immunofluorescence and virus microneutralization test assessment of sars-cov-2 serological tests for the diagnosis of covid-19 through the evaluation of three immunoassays: two automated immunoassays (euroimmun and abbott) and one rapid lateral flow immunoassay (ng biotech) immunoassays in comparison with microneutralisation clinical evaluation of serological igg antibody response on the abbott architect sars-cov-2 infection evaluation of performance of two sars-cov-2 rapid whole-blood finger-stick igm-igg combined antibody tests saint-louis core (covid research) group, evaluation of covid-19 igg/igm rapid test from orient gene biotech key: cord-264406-s5c0grz0 authors: miró-cañís, sílvia; capilla-rubio, sílvia; marzo-checa, laura; fontanals-aymerich, dionisia; sanfeliu-sala, isabel; espasa-soley, mateu; asensio-de-la-cruz, oscar title: multiplex pcr reveals that viruses are more frequent than bacteria in children with cystic fibrosis date: 2016-11-13 journal: j clin virol doi: 10.1016/j.jcv.2016.11.004 sha: doc_id: 264406 cord_uid: s5c0grz0 background: cystic fibrosis is a degenerative disease characterized by progressive epithelial secretory gland dysfunction associated with repeated respiratory infections. bacterial infections are very frequent in children with cystic fibrosis, but because rapid methods: for screening for the wide variety of potentially involved viruses were unavailable until recently, the frequency of viral presence is unknown. multiplex pcr enables screening for many viruses involved in respiratory infections. objectives: this study aimed to evaluate the frequency of viruses and bacteria in respiratory specimens from children with cystic fibrosis and to clarify the incidence and characteristics (seasonality and age of patients) of different viruses detected in children with cystic fibrosis. study design: in this 2-year prospective study, we obtained paired nasopharyngeal-swab and sputum specimens from children with cystic fibrosis during clinical respiratory examinations separated by at least 14 days. we analyzed viruses in nasopharyngeal-swab specimens with multiplex pcr and bacteria in sputum with standard methods. results: we analyzed 368 paired specimens from 33 children. we detected viruses in 154 (41.8%) and bacteria in 132 (35.9%). bacteria were commoner in spring and summer; viruses were commoner in autumn and winter. in every season, staphylococcus aureus was the commonest bacteria and rhinovirus was the commonest virus. nearly all infections with haemophilus influenzae occurred in autumn and winter. viruses were more prevalent in children <5 years old, and bacteria were more prevalent in children ≥12 years old. conclusions: multiplex pcr screening for respiratory viruses is feasible in children with cystic fibrosis; the clinical implications of screening warrant further study. background: cystic fibrosis is a degenerative disease characterized by progressive epithelial secretory gland dysfunction associated with repeated respiratory infections. bacterial infections are very frequent in children with cystic fibrosis, but because rapid methods: for screening for the wide variety of potentially involved viruses were unavailable until recently, the frequency of viral presence is unknown. multiplex pcr enables screening for many viruses involved in respiratory infections. objectives: this study aimed to evaluate the frequency of viruses and bacteria in respiratory specimens from children with cystic fibrosis and to clarify the incidence and characteristics (seasonality and age of patients) of different viruses detected in children with cystic fibrosis. study design: in this 2-year prospective study, we obtained paired nasopharyngeal-swab and sputum specimens from children with cystic fibrosis during clinical respiratory examinations separated by at least 14 days. we analyzed viruses in nasopharyngeal-swab specimens with multiplex pcr and bacteria in sputum with standard methods. results: we analyzed 368 paired specimens from 33 children. we detected viruses in 154 (41.8%) and bacteria in 132 (35.9%). bacteria were commoner in spring and summer; viruses were commoner in autumn and winter. in every season, staphylococcus aureus was the commonest bacteria and rhinovirus was the commonest virus. nearly all infections with haemophilus influenzae occurred in autumn and winter. viruses were more prevalent in children <5 years old, and bacteria were more prevalent in children ≥12 years old. conclusions: multiplex pcr screening for respiratory viruses is feasible in children with cystic fibrosis; the clinical implications of screening warrant further study. © 2016 elsevier b.v. all rights reserved. cystic fibrosis is a degenerative disease characterized by progressive epithelial secretory gland dysfunction associated with repeated respiratory infections. the role of bacteria in cystic fibrosis is clear and widely studied [1] ; however, the role of respiratory viruses in the progression of lung disease in children with cystic fibrosis remains controversial. viruses may be associated with significant clinical deterioration [2, 3] and may predispose to bacterial infection [4, 5] . some viruses (e.g., influenza, parainfluenza, adenovirus, and respiratory syncytial virus) are clearly associated with pulmonary exacerbations and worsening lung function in healthy children and in children with cystic fibrosis [6] . before the advent of molecular detection methods, viral respiratory infections were diagnosed by antigen detection and virus isolation in cultures. however, the low sensitivity of antigen detection and the limitations of detecting only cultivable viruses made the prevalence of respiratory viruses in clinical specimens from children with cystic fibrosis remarkably low [7] . multiplex polymerase chain reaction (pcr) enables the detection of multiple respiratory viruses in a single reaction [8, 9] . this approach has clear clinical benefits as it helps physicians underhttp://dx.doi.org/10.1016/j.jcv.2016.11.004 1386-6532/© 2016 elsevier b.v. all rights reserved. stand the etiology of clinical events and thus avoid prescribing antibiotics unnecessarily. this study aimed to evaluate the frequency viruses and bacteria in respiratory specimens and to clarify the incidence and characteristics (seasonality and age of patients) of different viruses in children with cystic fibrosis. from september 2012 through august 2014, we prospectively studied all children followed up periodically for cystic fibrosis in our hospital. parents or legal guardians of all participants provided written informed consent and the institutional ethics committee approved the study. we obtained paired nasopharyngeal-swab and sputum specimens from each patient during clinical respiratory controls separated by at least 14 days. sputum was collected with the sputum induction method. viral dna and rna was extracted from nasopharyngeal swab samples with the qiamp viral mini kit protocol (qiagen ® ), amplified with specific primers with multiplex pcr (clart ® pneumovir dna array), and annealed to low-density arrays to detect 19 viruses simultaneously: adenovirus, bocavirus, coronavirus, enterovirus (echovirus), influenza a (subtypes h3n2, pandemic h1n1, and seasonal h1n1), influenza b, influenza c, metapneumovirus (subtypes a and b), parainfluenza 1, parainfluenza 2, parainfluenza 3, parainfluenza 4 (subtypes a and b), rhinovirus, and respiratory syncytial virus. in the data analysis, we combined the subtypes to make the results clearer. sputum specimens were cultured with routine techniques in agar media (blood, macconkey, colistin nalidixic acid blood and chocolate agar), and isolates were identified at 48 h by gram stain and biochemical tests. all statistical analyses were done with spss v 19. a total of 368 paired upper airway samples were collected from 33 children (aged 10 months to 17 years; mean 7.43, median 8.0), yielding a mean of 11.2 samples per patient. table 1 table 2 shows the results of the cultures. we detected bacteria in 132 of the sputum specimens (132/368; 35.9%); the most frequently detected microorganisms were staphylococcus aureus (102/368; 27.7%), haemophilus influenzae (14/368; 3.8%), and pseudomonas aeruginosa (9/368; 2.4%). other bacteria detected in less than 5 samples were klebsiella oxytoca, moraxella catarrhalis, enterobacter cloacae, and serratia marcescens. we found 54 virus-bacteria coinfections (54/368; 14.7%); the most common combination was rhinovirus plus s. aureus (28/54) ( table 3 ). in general, viruses did not persist; the same virus was detected in three or more samples during two months' follow-up in only 8/33 patients (4 rhinovirus and 2 adenovirus). by contrast, s. aureus was detected in subsequent sampling in 6/33 patients and persisted for more than 8 months in all but 1 patient, in whom it persisted for 2 months. no persistence of co-infections was observed. we also analyzed the seasonality of the respiratory infections detected. the highest prevalence of virus detection was in autumn (62/98; 63.2%), followed by winter (42/102; 41.2%); bacteria isolations were more common in spring (40/96; 41.7%) and autumn (40/98; 40.8%) (fig. 1) . the viruses detected in all four seasons were very similar; rhinovirus was the most common in every season. nearly all infections with h. influenzae occurred in autumn and winter (fig. 2) . the most common bacterial infection in all seasons was s. aureus. when we distributed patients into 5 age groups (<2 y, ≥2-<5 y, ≥5-<9 y, ≥9-<12 y, and ≥12 y), we found that the proportion of patients in whom viruses were detected decreased with age: 48.5% of samples were positive in children <2 years old, whereas only 31.4% of samples were positive in those ≥12 years old. by contrast, the proportion of infections due to bacteria was higher in patients >12 years old (fig. 3) . until sensitive, specific, efficient molecular methods of nucleic acid detection were devised, the lack of techniques that could detect a wide variety of respiratory viruses in specimens made it difficult to know the prevalence of the different respiratory viruses in different groups of patients such as children with cystic fibrosis [9] . multiplex pcr enabled us to screen for 19 viruses simultaneously in a single procedure on a single specimen. in our sample of 368 paired specimens, viral detection was more frequent than bacterial isolation (41.8% versus 35.9%), but the differences were not statistically significant (p = 0.06043, or: 1.271 (ic95%: 0.9415-1.719)). there were more virus-bacteria coinfections (54/368) than virus-virus coinfections (20/368). the most frequently identified virus in the 33 children with cystic fibrosis followed up for two years was rhinovirus (90/154 of positive samples). this is not surprising because rhinovirus is the most commonly detected virus in similarly aged pediatric populations when improved molecular techniques are used [10] . rhinovirus increases the intensity of respiratory symptoms such as decreased appetite, muscle aches, headache, sore throat, increased sputum production, wheezing, and chest pain [7] . other viruses such as adenovirus (19/154 of positive samples) or enterovirus (15/154) can be found in the respiratory tracts of even asymptomatic children and can persist for months after respiratory infection [9, 10] . by contrast, other viruses detected in our study such as parainfluenza (11/154), influenza (9/154), respiratory syncytial virus (5/154), and metapneumovirus (3/154) are usually present only in symptomatic children and are very rare in healthy children [11, 12] . whereas bacteria were detected more often in spring and summer, viruses were detected more often in autumn and winter. more than the half the viruses were detected in autumn (63.2%). we found scant information about the relative frequency of virus and bacterial infections in different seasons in children with cystic fibrosis. the pathogens causing respiratory infections differed with the patients' age. viruses were detected in nearly half the samples in children up to 5 years old (48.5%-50%), and the rates of bacterial infection were clearly lower in this group (17.3%-21.2%). by contrast, in the group of children aged >12 years, viruses were only detected in 31.4%, and bacteria were detected in 68.6% of the samples. the statistical analysis reveals that viruses were more frequent than bacteria with significant differences in <5y group in contrast with ≥5y group (p < 0.05, or: 2.71 (ic95%: 1.397-5.476)). one limitation of the current study is the lack of clinical data, although our findings about the higher prevalence of viruses compared to bacteria could be useful in the study of the clinical implications. another limitation is that we analyzed nasopharyngeal swab specimens rather than bronchoalveolar lavage specimens, where the detection of the viruses might be more clinically useful; however, nasopharyngeal swabs have the definite advantage that they are noninvasive and easy to obtain in routine clinical practice. respiratory specimens from children with cystic fibrosis are routinely screened for bacteria. viruses could be involved in pulmonary exacerbations and could increase the morbidity of bacteria. our study shows that routine screening for viruses is also feasible and recommendable, especially in children younger than 4 years old. multiplex pcr methods are available in clinical laboratories and allow relatively quick screening for a wide variety of respiratory viruses in a single procedure on a single sample. all authors no reported conflicts of interest. cystic fibrosis rhinovirus c and respiratory exacerbations in children with cystic fibrosis the differential clinical impact of human coronavirus species in children with cystic fibrosis virus exacerbating chronic pulmonary disease: the role of immune modulation ten years of viral and non-bacterial serology in adults with cystic fibrosis severe viral respiratory infections in infants with cystic fibrosis respiratory viruses in children with cystic fibrosis: viral detection and clinical findings respiratory viruses in children admitted to hospital intensive care units: evaluating the clart ® pneumovir dna array the role of multiplex pcr in respiratory tract infections in children new molecular virus detection methods and their clinical value in lower respiratory tract infections in children prevalence and impact of respiratory viral infections in young children with cystic fibrosis: prospective cohort study influenzae-associated cystic fibrosis pulmonary exacerbations abbot laboratories generously provided the reagents for the analyses; however, they had no role in the study design, in the collecting or analysis of data, in elaborating the manuscript or in the decision to submit it for publication. key: cord-295957-s17z2ccf authors: bordi, licia; piralla, antonio; lalle, eleonora; giardina, federica; colavita, francesca; tallarita, monica; sberna, giuseppe; novazzi, federica; meschi, silvia; castilletti, concetta; brisci, angela; minnucci, giulia; tettamanzi, veronica; baldanti, fausto; capobianchi, maria rosaria title: rapid and sensitive detection of sars-cov-2 rna using the simplexa™ covid-19 direct assay date: 2020-05-04 journal: j clin virol doi: 10.1016/j.jcv.2020.104416 sha: doc_id: 295957 cord_uid: s17z2ccf background: so far, one of the major drawbacks of the available molecular assays for the diagnosis of severe acute respiratory syndrome coronavirus-2 (sars-cov-2) is the need for viral nucleic acid extraction from clinical specimens. objective: the aim of this study was to evaluate the performances of a newly designed real-time rt-pcr (simplexa™ covid-19 direct assay), that is established with an all-in-one reagent mix and no separate extraction required. results: the lower limit of detection (lod) for both target genes resulted the same: 3.2 (ci: 2.9–3.8) log10 cp/ml and 0.40 (ci: 0.2–1.5) tcid50/ml for s gene while 3.2 log10 (ci: 2.9–3.7) log10 cp/ml and 0.4 (ci: 0.2–1.3) tcid50/ml for orf1ab. the lod obtained with extracted viral rna for both s gene or orf1ab was 2.7 log10 cp/ml. crossreactive analysis performed in 20 nasopharyngeal swabs confirmed a 100% of clinical specificity of the assay. clinical performances of simplexa™ covid-19 direct assay were assessed in 278 nasopharyngeal swabs tested in parallel with corman's method. concordance analysis showed an "almost perfect" agreement in sars-cov-2 rna detection between the two assays, being κ = 0.938; se = 0.021; 95% ci = 0.896-0.980. conclusions: the high sensitivity and specificity of this new assay indicate that it is promising for laboratory diagnosis, enabling highspeed detection in just over one hour, which is significantly faster than the up to five hours currently required by traditional extraction followed by amplification technologies, thus allowing prompt decision making regarding isolation of infected patients. the pandemic caused by the severe acute respiratory syndrome coronavirus-2 (sars-cov-2) has generated global concern given its rapid spread in multiple countries and fatal progression of the coronavirus infection disease (covid-19) (1, 2) . however, asymptomatic or paucisymptomatic cases especially in the early phase of the infection have also been reported (3, 4) . since the spread of sars-cov-2 out of china, one of the main concerns on the diagnosis of this new virus has been the development of rapid and sensitive diagnostic assays. so far, nucleic acid amplification testing is the gold standard for the diagnosis of sars-cov-2 in respiratory samples (5, 6) . molecular assays as previously demonstrated for epidemics caused by other coronaviruses (sars-cov and mers-cov), are crucial for rapid application of infection control measures, case identification and contact tracing (6, 7) . however, one of the major drawbacks of these assays is the need for viral nucleic acid extraction from clinical specimens. recently, diasorin s.p.a. (gerenzano, italy) has developed a sars-cov-2specific real-time rt-pcr (simplexa™ covid-19 direct assay) performed directly on clinical samples. this study was performed at two regional reference laboratories, with the following aims: i) to assess the analytical performances of the newly designed simplexa™ covid-19 direct assay; ii) to evaluate its clinical performance as compared to who protocols (7, 8) using different types of clinical specimens from patients with laboratory-confirmed covid-19. viral stock used to establish analytical sensitivity was the first italian isolate obtained from a patient hospitalized in the biosafety level 3 facility at national institute for infectious diseases "lazzaro spallanzani" (inmi) in rome, named 2019-ncov/italy-inmi1 (9) . the infectious titre of the viral stock used in the study, performed by reed and muench method on veroe6 cells, was 10 7 tcdi 50 /ml; for the establishment of analytical sensitivity, the viral stock was spiked into oral swab-utm matrix and serial dilutions (from 100 to 0.001 tcdi 50 /ml) were tested in multiple replicates. the evaluation of the corresponding rna copies/ml was performed based on standard curve obtained by corman"s e-sars-cov-2 gene. a total of 278 consecutive respiratory samples (nasal and nasopharyngeal swabs) collected for covid-19 diagnosis between 20 february and 24 march 2020 were included in the study; twenty additional nasopharyngeal swabs from patients known to be positive for other human coronaviruses were used to establish clinical specificity of the simplexa™ covid-19 direct assay. moreover, to evaluate the performance of the test in a different clinical specimen, a total of 33 broncho-alveolar lavage (bal) collected for covid-19 diagnosis between 20 march and 03 april 2020 were also analysed in parallel with the simplexa™ covid-19 direct assay and the routine laboratory method, based on the who protocols (7, 8) , using the abbot m2000 extraction platform. j o u r n a l p r e -p r o o f for simplexa™ covid-19 direct assay, one vial of reaction mix was thawed for each sample. respiratory samples were collected with a flexible nasopharyngeal nylon flocked swabs (floqswabs™, copan italia, brescia, italy) dipped in 2-3 ml universal transport medium (utm™, copan italia). after swirling, the swab was discarded and 50μl of sample and 50μl of reaction mix were added to their specific wells on a direct amplification disk, which was loaded onto the liaison® mdx instrument (diasorin). for bal, a pre-treatement with 1:1 sv40 sputagest selectavial (mast diagnostic gmbh, reinfeld, germany) was performed. total nucleic acids (dna/rna) were extracted from 200μl of nasal and nasopharyngeal specimens. clinical samples were pre-treated with 1:1 atl lysis buffer and extracted using the qiasymphony® instrument with qiasymphony® dsp virus/pathogen midi kit (complex 400 protocol) according to the manufacturer"s instructions (qiagen, qiagen, hilden, germany). the presence of sars-cov-2 rna was assessed by corman"s protocol, targeting e and rna-dependent rna polymerase (rdrp) genes as reference method (7) . according to the who guidelines corman"s protocol was carried out using the e assay for screening and the rdrp assay for confirmation (8). total nucleic acids (dna/rna) were extracted from 600μl of bal samples, pre-treated with 1:1 sv40 sputagest selectavial and then with 1:1 atl lysis buffer, using the abbott m2000 system according to the manufacturer"s instructions (abbott molecular, des plaines, il, usa). the analytical sensitivity (sars-cov-2 copy number at a 95% detection rate and sars-cov-2 tcdi 50 at a 95% detection rate) was calculated with probit analysis, using the medcalc statistical software, on to assess the sensitivity of the prototype assay, both live sars-cov-2 and extracted viral rna were tested. more in detail, for lod calculation with live virus, sars-cov-2 particles from 2019ncov/italy-inmi1 isolate were spiked into oral swab-utm matrix and serial dilutions from 100 to 0.001 tcdi 50 /ml were tested in replicates. we observed 100% detection down to about 1 tcid50/ml, corresponding to 4x10 3 cp/ml ( table 1 ). the analytical sensitivity (i.e. the lod, corresponding to the concentration of sars-cov-2-rna detected with response probability of 95% for either s or orf1ab) was determined by probit regression model (fig. 1 ). more in detail, the lod for both target genes resulted the same: 3.2 (ci: 2.9 to 3.8) log 10 cp/ml (fig. 1a) tcid 50 /ml (fig. 1d) for orf1ab. consistent, although slightly better results, were obtained for lod calculated on extracted viral rna. this was spiked in universal transport medium (utm) additioned with rnasin (1.6 u/µl) to avoid rna degradation, and replicate 10-fold serial dilutions of were loaded on the mdx instrument and tested with the simplexa™covid-19 direct assay. the lod obtained with extracted viral rna for both s gene or orf1ab was 2.7 log 10 cp/ml. in silico evaluation and preliminary in vitro analytical specificity study showed that the (table 3) . moreover, the performance of the assay in a different clinical specimen type, i.e. bal, that is considered of utmost importance in patients with lower respiratory tract implication, was also evaluated: a total of 33 bal samples were analysed in parallel with the simplexa™ covid-19 direct assay and corman"s method. for these samples, the abbot m2000 extraction platform was used, due to temporary restriction of qiasymphony® reagents (table 4) since furthermore, the simplicity of design and the all-in-one coupled with easy-to-use design, makes it suitable for the field settings, and for near-to-patient diagnosis. the lod of the prototype assay, established with both sars-cov-2 viral particles and sars-cov2 extracted viral rna, was less than 1,000 cp/ml. all the sars-cov-2 samples resulted positive with the reference test (corman"s method), also resulted positive with simplexa™ covid-19 direct assay, with a diagnostic sensitivity of 100% and "almost perfect" concordance. notably, simplexa™ covid-19 direct assay showed a slightly higher sensitivity with respect of the reference test, identifying near 3% additional positive samples. an high performance of the test was also observed using different clinical specimens: among the bal samples that were able to be analysed by both methods, a perfect agreement was observed; noteworthy, simplexa™ covid-19 direct assay was able to detect the virus in bal samples resulted invalid with the reference method. the discrepancy in the processing capability between the two systems is attributable to the highly viscous composition of bal, that could impair its accessibility to a traditional extraction method compared to a faster and easier sample processing method such as that used in the simplexa™ covid-19 direct assay. moreover a 100% of clinical specificity was observed against swabs resulted positive to other viruses, particularly human coronaviruses, indicating no cross-reactivity with other similar viruses. key advantages of this assay are simple operation procedures and high-speed of detection in just over an hour, which is significantly faster than the up to seven hours currently required by traditional extraction followed by amplification technologies. the lack of extraction reduces turnaround time (tat) for the diagnosis of covid -19, thus allowing prompt decision making regarding isolation of infected patients. the only limitation of the assay is the small number of samples which can be tested in a run, since each instrument can support a ring of maximum eight position; this limitation is offset by the rapidity of the j o u r n a l p r e -p r o o f assay, due to the lack of extraction. overall, the good analytical and clinical performances, coupled with user friendly architecture and short tat indicate that it is promising for laboratory diagnosis of covid-19 and field application. ethical approval was not required as human samples were routinely collected and patients' data remained anonymous. j o u r n a l p r e -p r o o f early transmission dynamics in wuhan, china, of novel coronavirus-infected pneumonia a novel coronavirus from patients with pneumonia in china novel coronavirus infection in hospitalized infants under 1 year of age in china a familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-toperson transmission: a study of a family cluster coronavirus as a possible cause of severe acute respiratory syndrome middle east respiratory syndrome coronavirus: another zoonotic betacoronavirus causing sars-like disease detection of 2019 novel coronavirus (2019-ncov) by realtime rt-pcr molecular characterization of sars-cov-2 from the first case of covid-19 in italy this research was supported by funds to national institute for infectious diseases "lazzaro spallanzani" irccs from ministero della salute, ricerca corrente, linea1; european commission -horizon 2020 (eu project 101003544 -convat; eu project 101003551 -exscalate4cov) and to key: cord-302528-wmxw9e0c authors: mitchell, stephanie l.; george, kirsten st. title: evaluation of the covid19 id now eua assay date: 2020-05-15 journal: j clin virol doi: 10.1016/j.jcv.2020.104429 sha: doc_id: 302528 cord_uid: wmxw9e0c • id now eua sars-cov-2 assay had an overall agreement of 78.7% when compared to the standard of care reference methods. • id now had a sensitivity of 71.7% and specificity of 100%. • all the false-negative results occurred with weakly positive samples, with reference method c(t) values ≥35.  all the false-negative results occurred with weakly positive samples, with reference method ct values ≥35. the sars-cov-2 pandemic caused a major surge in the diagnostic capacity needed for adequate response efforts. many commercial companies have developed diagnostic assays that are available for clinical testing in the usa, if authorized through the fda's emergency use authorization (eua) process. while most of the sars-cov-2 eua assays for molecular detection must be performed in moderate-to high-complexity clinical laboratories, a few are authorized as point-of-care devices, such as the abbott id now. in addition to clinical laboratories, this assay can be performed by trained non-laboratory personnel in patient care settings such an emergency departments, physician's offices or pharmacies, potentially bringing diagnostic testing for sars-cov-2 closer to the patient (1). among the marketing information for this new assay, potential advantages include its reported sensitivity (stated limit of detection (lod) of 125 genome equivalents/ml) and run time (detection of sars-cov-2 rna as early as five minutes and a negative result in thirteen minutes). also, the id now may provide rapid molecular results either from direct testing of nasopharyngeal, nasal, or oropharyngeal swabs or testing of the viral transport media (vtm) from swabs placed in this fluid after collection (2) . to date, reported performance of the id now sars-cov-2 assay in the peer-reviewed literature has been variable. the id now as compared to an ldt reference method, ranging from 75-87% (3) (4) (5) (6) . given the potential advantages of this device over more traditional format molecular tests such as real-time rt-pcr, a small evaluation of the id now covid-19 test was conducted at two laboratories to assess its performance. residual positive and negative nasopharyngeal patient samples collected in vtm were tested using the id now eua assay. samples had been stored at -80℃ prior to testing. results from the id now assay were compared to the original results from either the cdc eua or the new york eua assays, which served as the reference methods. positive and negative samples were alternated to assess for potential carry-over contamination of either the patient sample or amplicon. precision was assessed by running one strongly positive, one moderately positive and one negative sample in triplicate. at both facilities, the work was conducted inside a class ii biosafety cabinet (bsc) by certified laboratory personnel. in total 46 positive and 15 negatives were tested for a total of 61 samples. overall agreement of the id now with the reference method was 48/61 (78.7%). specificity was 100% (15/15). however, sensitivity was 71.7% (33/46) with the id now producing false negative results in 13 of the 46 positive samples tested. notably, all false-negative results corresponded to those samples that were weakly positive, with a cycle threshold (ct) values between 35-40 for all targets ( figure 1 ). this suggests that the id now has acceptable performance for strongly or moderately positive samples but may lack sensitivity when the sample contains low amount of viral rna. importantly, in a review of more than 5,000 positive sars-cov-2 results at wadsworth, 18% of the tests had after this evaluation was performed, a notice was issued by the manufacturer, stating that samples collected in vtm were no longer acceptable for the id now covid-19 eua assay, citing lower sensitivity for these specimens (7), which was also observed in our study. while removing this specimen type is an important step to reducing false-negative results, this now presents a challenge to both laboratories and patient care settings in verifying assay performance prior to implementation (8) . given that only the direct swab is acceptable, verification cannot be performed using residual or contrived samples that are readily available and commonly used for this purpose. notably, the direct swab positive control included with the assay does not contain sars-cov-2 material and therefore cannot be used for either a target amplification control or for assay verification. there were other challenges and considerations observed during the evaluation period. the test procedure requires multiple cartridge transfers and manipulations, which may be challenging for personnel not familiar with or accustomed to adhering to molecular techniques. manipulations also have the potential to cause contamination of the device and the operation environment. while no cross-contamination was observed during the evaluation period, frequent id now covid-19 instructions for use clinical evaluation of three sample-to-answer platforms for the detection of sars-cov-2" comparison of abbott id now and abbott m2000 methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from symptomatic patients comparison of abbott id now, diasorin simplexa and cdc fda eua methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from individuals diagnosed with covid-19 five-minute point-of-care testing for sars-cov-2: not there yet verification procedure for commercial tests with emergency use authorization for the detection of sars-cov-2 key: cord-295600-xe3ruu9a authors: calarota, sandra a.; chiesa, antonella; silvestri, annalisa de; morosini, monica; oggionni, tiberio; marone, piero; meloni, federica; baldanti, fausto title: t-lymphocyte subsets in lung transplant recipients: association between nadir cd4 t-cell count and viral infections after transplantation date: 2015-06-17 journal: j clin virol doi: 10.1016/j.jcv.2015.06.078 sha: doc_id: 295600 cord_uid: xe3ruu9a background: little is known about the kinetics of t-cell subsets in lung transplant recipients (ltr) and their association with the occurrence of opportunistic infections (oi). objectives: to analyze the kinetics of t-lymphocyte subsets in ltr and the association between nadir cd4 t-cell count and viral infections after transplantation. study design: serial measurements of peripheral blood cd4 and cd8 t-cell counts obtained during the first year post-transplantation from 83 consecutive ltr and their correlation with both viral oi and community-acquired infections post-transplantation were retrospectively analyzed. results: ltr with a nadir cd4 t-cell count <200 cells/μl had consistently lower cd4 and cd8 t-cell counts than ltr with a nadir cd4 t-cell count >200 cells/μl (p < 0.001). in ltr with a nadir cd4 t-cell count <200 cells/μl, the cumulative incidence of viral infections detected in peripheral blood and in bronchoalveolar lavage (bal) samples was higher than in ltr with a nadir cd4 t-cell count >200 cells/μl (p = 0.0012 and p = 0.0058, respectively). a nadir cd4 t-cell count <200 cells/μl within the first three months post-transplantation predicted a higher frequency of viral infectious episodes in bal samples within the subsequent six month period (p = 0.0066). conclusions: stratification of patients according to nadir cd4 t-cell count may represent a new and simple approach for early identification of patients at risk for subsequent virus infections. imens and management after transplantation, infections and rejection remain significant complications in lung transplant recipients (ltr). compared with other solid organ transplant recipients, ltr are more vulnerable to infections. this is related to intensive immunosuppressive treatments as well as to exposure of the allograft to environmental agents [1] . thus, both opportunistic (oi) and community-acquired (cai) infections remain a major cause of morbidity and mortality in ltr. in addition, the role of viral infections in favoring the occurrence of chronic lung allograft dysfunction has been suggested [2, 3] . therefore, early detection and appropriate treatment of infections is mandatory to improve the outcome in these patients. while microbial diagnostic techniques have been developed and/or improved over the years, markers of immunological recovery predicting the risk of infection after transplantation are still not routinely applied during the follow-up period. several studies have demonstrated that a low cd4 t-cell count represents a major risk factor for development of opportunistic complications [4, 5] , malignancies [6] and poor long-term outcome [7, 8] in individuals with human immunodeficiency virus type-1 (hiv-1) infection. additionally, it has been shown that a low nadir cd4 t-cell count predicts limited immune reconstitution [9, 10] and poor cd4 t-cell recovery [11] in hiv-1-infected patients who were receiving antiretroviral therapy. recently, we have shown that patients developing oi after heart transplantation had low nadir cd4 t-cell counts, while low cd8 t-cell counts were associated with the risk of oi following kidney transplantation [12] . similarly, a more recent study confirmed that low t-cell counts at month 1 post-transplant predicts the subsequent occurrence of oi after kidney transplantation [13] . however, limited data are available in ltr [14, 15] . to analyze the kinetics of cd4 and cd8 t-cell counts in peripheral blood obtained from ltr during the first year after transplantation and evaluated the association between nadir cd4 t-cell count with the development of viral infections posttransplantation. eighty-three consecutive patients who received a lung transplantation at the fondazione irccs policlinico san matteo, pavia, italy, between august 2003 and january 2011, with at least one-year follow-up, were retrospectively analyzed. demographic characteristics, donor and recipient human cytomegalovirus (hcmv) serostatus, transplant indication, type of lung transplant, induction therapy and immunosuppressive treatment, acute rejection episodes and cause of death were obtained from the patient's medical records and are presented in table 1 . peripheral blood and bronchoalveolar lavage (bal) samples were obtained as part of routine post-transplant monitoring of infectious complications. induction therapy with antithymocyte globulin (atg) was used in 28.9% of ltr. all ltr were receiving a standard triple immuosuppressive regimen including calcineurin inhibitors (cyclosporine a or tacrolimus), azathioprine or mycophenolate mofetil, and steroids and were treated with steroid pulses when an episode of acute rejection was diagnosed; grade ≥ a2 rejection were treated with a steroid bolus. no patient received antiviral drugs (ganciclovir or valganciclovir) for hcmv prophylaxis, while pre-emptive antiviral therapy was initiated when the hcmv dna level exceeded 3 × 10 5 copies/ml blood or 1 × 10 5 copies/ml bal [16, 17] . in the oi group were considered those infections related to cellular and humoral immunosuppression, which included in our study hcmv, epstein-barr virus (ebv), herpes simplex virus (hsv), varicella zoster virus (vzv), human herpesvirus 6 (hhv-6) and polyomavirus [12, 13, 18] . infections were defined as the presence of viral dna in blood or bal samples, determined using quantitative real-time pcr [16, 19, 20] , in the absence of symptoms. viral syndrome and disease were defined according to established criteria, which included quantification of viral dna in blood as well as body fluids or biopsies in the presence of symptoms [21] . in the cai group were included infections that could be acquired in the community or during hospitalization (nosocomial infection) independently from the patient's immune status, which include in our study parvovirus b19, rhinovirus, coronavirus, parainfluenza virus, adenovirus, influenza a and b. parvovirus b19, rhinovirus and coronavirus were quantified by real-time pcr as described [20, 22, 23] . samples were tested for parainfluenza virus, adenovirus, influenza a and b by direct fluorescence antibody (dfa) staining as described [24] . samples positive by dfa were quantified by real-time pcr for adenovirus [25] and influenza a and b [26, 27] . peripheral whole blood was stained with anti-cd3 (fitcconjugated), anti-cd45 (apc-alexa fluor 750-conjugated), anti-cd4 (apc-conjugated) and anti-cd8 (pe-conjugated) monoclonal antibodies (beckman coulter, milan, italy). after lysis of red cells, the percentage of cd4 and cd8 t lymphocytes was determined using a navios tm flow cytometer system (beckman coulter). absolute cd4 and cd8 t-cell counts (cells/l) were calculated taking into account the total (wbc) and differential lymphocyte counts estimated by an automated hematology analyzer used in our institution's clinical laboratory. measurements were performed in a total of 703 serial samples obtained during the first post-transplant year; the median number of samples per patient was 8 (range 3-16). since in hiv-1-infected individuals [6] and heart transplant recipients [12] the risk of oi increases below the threshold cd4 t-cell count of circa 200 cells/l, the ltr analyzed in this study were stratified in relation to an arbitrary cd4 t-cell count of 200 cells/l (referred to as the nadir cd4 t-cell count). cd4 t-cell count, cd8 t-cell count and cd4/cd8 t-cell ratio were compared over time using a longitudinal data analysis method. population-average generalized estimating equation models with an autocorrelation of order 1 were fitted considering cd4 t-cell count or cd8 t-cell count as dependent variables and the presence of infections, gender, age, nadir cd4 t-cell count (<200 cells/l or >200 cells/l), induction therapy, type of immunosuppressive regimen and acute rejection episodes as independent variables. data analysis was performed with the stata statistical package (version 11, stata corporation, college station, 2010, texas, usa). the kaplan-meier method and the receiver operating characteristic (roc) analysis were performed with graphpad prism 5.0 (graph-pad software inc., la jolla, ca, usa). all tests were two-sided. a p < 0.05 was considered statistically significant. at baseline, the mean (± standard deviation [sd]) cd4 t-cell count was 331.1 ± 71.9 cells/l and thereafter increased with time reaching 616.3 ± 52.9 cells/l at month 12 (fig. 1a) . the mean cd8 t-cell count at baseline was 449.1 ± 57.3 cells/l, this level dropped to 392.2 ± 43.6 cells/l at month one and then improved over the follow-up period reaching 893.8 ± 129.4 cells/l at month 12 (fig. 1a) . the mean cd4/cd8 t-cell ratio at baseline was 0.7 ± 0.1 and the highest level was observed at month one (1.7 ± 0.2), followed by a slight progressive decline over time reaching 0.9 ± 0.1 at month 12 (fig. 1b) . twenty-five (30.1%) ltr had a nadir cd4 t-cell count <200 cells/l (median 120, interquartile range [iqr] 76.5-167 cells/l) reached over a median of 3.9 (iqr 1.3-6.2) months post-transplant, whereas the remaining 58 (69.9%) ltr had a nadir cd4 t-cell count >200 cells/l (median 407, iqr 290-537 cells/l) reached over a median of 3.8 (iqr 1.5-6.9) months post-transplant. patients with a nadir cd4 t-cell count <200 cells/l maintained significantly lower cd4 t-cell counts (coefficient −427.9, 95% confidence interval [ci] −518.0 to −337.8, p < 0.001) up to month 12 posttransplant than patients with a nadir cd4 t-cell count >200 cells/l (fig. 1c) . in fact, while patients with a nadir cd4 t-cell count >200 cells/l maintained high cd4 t-cell counts during the follow-up period (mean ± sd, 506.4 ± 53.3 cells/l at baseline vs. 754.9 ± 67.5 cells/l at month 12), patients with a nadir cd4 t-cell count <200 cells/l showed a limited increase over time 155.8 ± 29.2 cells/l at baseline vs. 362.1 ± 42.1 cells/l at month 12, (fig. 1c) . additionally, patients with a nadir cd4 t-cell count <200 cells/l had significantly lower cd8 t-cell counts (coefficient −319.7, 95% ci −458.9 to −180.4, p < 0.001) than patients with a nadir cd4 t-cell count >200 cells/l (fig. 1d) . hcmv was the most common oi detected in blood (36 patients, 43.4%) followed by ebv (12 patients, 14.5%). hcmv was also the most frequently detected oi in bal samples (73 patients, 88%) followed by ebv (four patients, 4.8%). no hsv or vzv or hhv-6 or polyomavirus were observed during the study period. among cai, rhinovirus was the most common (27 patients, 32.5%) followed by coronavirus (nine patients, 10.8%), parainfluenza (three patients, 3.6%), influenza a (three patients, 3.6%), adenovirus (one patient, 1.2%) and influenza b (one patient, 1.2%). parvovirus b19 was detected in blood of one patient (1.2%). the highest proportion of patients with systemic infections was observed at month 1 ( fig. 2a) , while the highest proportion of patients with infections in bal was observed at month 2 after transplantation (fig. 2b) . as summarized in table 2 , no significant differences in cd4 and cd8 t-cell counts were observed between ltr with or without viral infections in blood. however, ltr developing viral infections in bal had significantly lower cd4 t-cell counts compared to those without infections (p = 0.036). no differences were observed regarding cd8 t-cell counts when comparing ltr with or without viral infections in bal. remarkably, both cd4 and cd8 t-cell counts in ltr were dependent on nadir cd4 t-cell count (p < 0.001). additionally, cd8 t-cell counts were higher in men than women and, without reaching statistical significance, ltr receiving atg tended to have lower cd4 t-cell counts, ltr with acute rejection episodes tended to have higher cd8 t-cell counts and cd8 t-cell counts appears to be dependent on age. in ltr with a nadir cd4 t-cell count <200 cells/l, the cumulative incidence of infections in blood was 61%, while in ltr with a nadir cd4 t-cell count >200 cells/l it was 29% (p = 0.0012, fig. 3a) . the cumulative incidence of infections in bal was significantly higher in ltr with a nadir cd4 t-cell count <200 cells/l than in ltr with a nadir cd4 t-cell count >200 cells/l (90% vs. 68%, p = 0.0058, fig. 3b ). a roc analysis was used to study the association between nadir cd4 t-cell count within the first three months post-transplantation and the frequency of infectious episodes within the successive six month period. although no significant differences in the number of infectious episodes (detected in blood) were observed between ltr with a nadir cd4 t-cell count <200 cells/l and those with a nadir cd4 t-cell count >200 cells/l (area under the roc curve 0.5972, 95% ci 0.4537 to 0.7407; fig. 4a ), the number of infectious episodes (detected in bal samples) in ltr with a nadir cd4 t-cell count <200 cells/l was significantly higher than in ltr with a nadir cd4 t-cell count >200 cells/l (area under the roc curve 0.6982, 95% ci 0.5671-0.8293; fig. 4b ). the present study provides a detailed analysis of t-cell subsets in peripheral blood during the first 12 months after lung transplantation and correlates these immunological data with infectious complications. patients with a nadir cd4 t-cell count <200 cells/l had significantly lower cd4 and cd8 t-cell counts as well as significantly higher cumulative incidence of viral infections than ltr with a nadir cd4 t-cell count >200 cells/l. furthermore, a nadir cd4 t-cell count <200 cells/l within the first three months posttransplantation was associated with a high frequency of infectious episodes in bal within the subsequent six-month period. few studies on t-cell subsets in peripheral blood obtained from ltr have been published [14, 15] and, when evaluating their association with infections, they were restricted to hcmv pulmonary infection. no difference was observed for cd4 or cd8 t cells in 13 ltr with or without hcmv pulmonary infection [14] . in another study, a decrease in the percentage of cd4 t cells was observed at one year post-transplant in 17 ltr compared with normal ranges; a decrease in the percentage of cd8 t cells in patients with hcmv infection was also observed [15] . another study evaluated the differences between lymphocyte subsets both in peripheral blood and bal in 24 ltr [28] . while the percentage of cd4 tcells decreased, cd8 t-cells increased in bal compared with blood. however, associations of t-cell subsets in peripheral blood with pulmonary infections were not fully addressed [28] . in the present study, peripheral t-cell subsets were analyzed in relation to both oi and cai in ltr. we found that patients developing infections in bal had significantly lower cd4 t-cell counts than those without infections. bal specimens have increasingly been used for the diagnosis of infections after lung transplantation and also for the investigation of cell subsets [14, [29] [30] [31] . even though bal provides information on the cellular component present in the alveolar space, the number of lymphocytes comprise a small percentage of total cells making bal analysis difficult to standardize, thus results regarding the phenotypic analysis of lymphocytes may be contradictory [28, 31] . therefore, based on our findings, the measurement of t-cell subsets in peripheral blood could represent a simple, less invasive tool to identify ltr at risk of developing infections. in our study, hcmv was the most frequent infection detected after lung transplantation, as was reported in other studies [1, 32] . cai can cause severe lower respiratory tract infections in ltr, resulting in important morbidity and mortality [1, 33, 34] . in agreement with other studies [35] , rhinovirus was the most frequently isolated in our ltr cohort. in this study, almost 29% of ltr received atg. a welldocumented effect of atg treatments is t-cell depletion [36] . in keeping with a recent study [13] , our data revealed that ltr receiving atg tended to have lower cd4 t-cell counts than those that did not. however, cd4 as well as cd8 t-cell counts were dependent on the nadir cd4 t-cell count. some limitations of this single-center study deserve mention, particularly those associated with the retrospective nature of the data, such as the nonsystematic t-cell measurements and the relatively small number of observations. although the study has limitations, our findings reveal an association between nadir cd4 t-cell count and incidence of infectious episodes in ltr, suggesting that, particularly in patients with low cd4 t-cell numbers, monitoring of infections should be intensified to improve early detection and treatment. in conclusion, stratification of patients according to nadir cd4 t-cell count may represent a simple and feasible approach for identification of patients at risk for infectious viral complications and adoption of tailored monitoring and treatment schedules. sandra a. calarota participated in study design, in data analysis and in the writing of the paper. antonella chiesa collected the data and participated in the analysis. annalisa de silvestri performed the statistical analysis. monica morosini participated in the performance of the study and collected the data. tiberio oggionni, piero marone and federica meloni participated in clinical data collection and in the writing of the paper. fausto baldanti participated in the study design, in data analysis and in the writing of the paper. all authors have approved the final manuscript. this work was supported by the ministero della salute, fondazione irccs policlinico san matteo ricerca corrente grant 80207. none declared. this retrospective study was performed according to the guidelines of the institutional review board on the use of biological specimens for scientific purposes in keeping with italian law (art.13 d.lgs 196/2003). common infections in the lung transplant recipient cytomegalovirus replication within the lung allograft is associated with bronchiolitis obliterans syndrome detection of epstein-barr virus dna in peripheral blood is associated with the development of bronchiolitis obliterans syndrome after lung transplantation rate, causes, and clinical implications of presenting with low cd4+ cell counts in the era of highly active antiretroviral therapy interruptions of cart limits cd4 t-cell recovery and increases the risk for opportunistic complications and death immunodeficiency as a risk factor for non-aids-defining malignancies in hiv-1-infected patients receiving combination antiretroviral therapy association of virus load, cd4 cell count, and treatment with clinical progression in human immunodeficiency virus-infected patients with very low cd4 cell counts hiv disease progression in a patient cohort treated via a clinical research network in a resource limited setting lower cd4+ t lymphocyte nadirs may indicate limited immune reconstitution in hiv-1 infected individuals on potent antiretroviral therapy: analysis of immunophenotypic marker results of aactg 5067 cd4 + t-lymphocyte nadir and the effect of highly active antiretroviral therapy on phenotypic and functional immune restoration in hiv-1 infection nadir cd4 t cell count as predictor and high cd4 t cell intrinsic apoptosis as final mechanism of poor cd4 t cell recovery in virologically suppressed hiv-infected patients: clinical implications kinetics of t-lymphocyte subsets and posttransplant opportunistic infections in heart and kidney transplant recipients kinetics of peripheral blood lymphocyte subpopulations predicts the occurrence of opportunistic infection after kidney transplantation blood and alveolar lymphocyte subsets in pulmonary cytomegalovirus infection after lung transplantation peripheral blood obtained from patients after thoracic organ transplantation evaluation of cytomegalovirus dnaaemia versus pp65-antigenaemia cutoff for guiding preemptive therapy in transplant recipients: a randomized study preemptive therapy for systemic and pulmonary human cytomegalovirus infection in lung transplant recipients a review of critical periods for opportunistic infection in the new transplantation era kinetics of epstein-barr virus dna load in different blood compartments of pediatric recipients of t-cell-depleted hla-haploidentical stem cell transplantation real-time quantitative pcr assays for detection and monitoring of pathogenic human viruses in immunosuppressed pediatric patients working group on infectious disease monitoring. american society of transplantation recommendations for screening, monitoring and reporting of infectious complications in immunosuppression trials in recipients of organ transplantation real-time reverse transcription-pcr assay for comprehensive detection of human rhinoviruses frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction correlation of rhinovirus load in the respiratory tract and clinical symptoms in hospitalized immunocompetent and immunocompromised patients rapid and quantitative detection of human adenovirus dna by real-time pcr rapid typing, subtyping and rna quantification of influenza virus type a strains in respiratory secretions virtual quantification of influenza a virus load by real-time rt-pcr analysis of bronchoalveolar lavage from human lung transplant recipients by flow cytometry bronchoalveolar lavage macrophage and lymphocyte phenotypes in lung transplant recipients longitudinal profile of bronchoalveolar lavage cell characteristics in patients with a good outcome after lung transplantation clinical utility of bronchoalveolar lavage cell phenotype analyses in the postoperative monitoring of lung transplant recipients cytomegalovirus and lung transplantation respiratory viruses in lung transplant recipients: a critical review and pooled analysis of clinical studies impact of human metapneumovirus and human cytomegalovirus versus other respiratory viruses on the lower respiratory tract infections of lung transplant recipients a prospective molecular surveillance study evaluating the clinical impact of community-acquired respiratory viruses in lung transplant recipients mechanisms of action of antithymocyte globulin: t-cell depletion and beyond the authors are grateful to daniela sartori for careful preparation of the manuscript and to laurene kelly for revision of the english. key: cord-292578-co5essuw authors: johnson, marina; wagstaffe, helen r.; gilmour, kimberly c.; mai, annabelle lea; lewis, joanna; hunt, adam; sirr, jake; bengt, christopher; grandjean, louis; goldblatt, david title: evaluation of a novel multiplexed assay for determining igg levels and functional activity to sars-cov-2 date: 2020-08-02 journal: j clin virol doi: 10.1016/j.jcv.2020.104572 sha: doc_id: 292578 cord_uid: co5essuw background: the emergence of sars-cov-2 has led to the development of serological assays that could aid in an understanding of the burden of covid-19 disease. many available tests lack rigorous evaluation and therefore results may be misleading. objectives: the aim of this study was to assess the performance of a novel multiplexed immunoassay for the simultaneous detection of antibodies against sars-cov-2 trimeric spike (s), spike receptor binding domain (rbd), spike n terminal domain and nucleocapsid antigen and a novel pseudo-neutralisation assay. methods: a multiplexed solid-phase chemiluminescence assay (meso scale discovery) was evaluated for the simultaneous detection of igg binding to four sars-cov-2 antigens and the quantification of antibody-induced ace-2 binding inhibition (pseudo-neutralisation assay). sensitivity was evaluated with a total of 196 covid-19 serum samples (169 confirmed pcr positive and 27 anti-nucleocapsid igg positive) from individuals with mild symptomatic or asymptomatic disease. specificity was evaluated with 194 control serum samples collected from adults prior to december 2019. results: the specificity and sensitivity of the binding igg assay was highest for s protein with a specificity of 97.4 % and sensitivity of 96.2 % for samples taken 14 days and 97.9 % for samples taken 21 days following the onset of symptoms. igg concentration to s and rbd correlated strongly with percentage inhibition measured by the pseudo-neutralisation assay. conclusion: excellent sensitivity for igg detection was obtained over 14 days since onset of symptoms for three sars-cov-2 antigens (s, rbd and n) in this multiplexed assay which can also measure antibody functionality. severe acute respiratory syndrome-related coronavirus-2 (sars-cov-2) was first recognised in january 2020 and rapidly spread world-wide (1) . tests designed to measure antibodies to sars-cov-2 antigens were rapidly developed and are important for diagnostics and seroprevalence studies. the latter could help inform disease burden estimates, studies of transmission dynamics and modelling of the epidemic. antibody tests are particularly important in the context of mild or asymptomatic disease where a swab reverse transcriptase polymerase chain reaction (rt-pcr) test may be negative. for this reason, an understanding of the sensitivity and specificity of the tests being used is critical. the trimeric spike (s) protein of sars-cov-2 is present on the viral surface and in most cases is cleaved by host proteases into the s1 and s2 subunits, responsible for receptor recognition and membrane fusion respectively. s1 uses a region of the molecule, known as the receptor binding domain (rbd) to bind to host ace-2 receptor and thereby gain entry to the cell (2) . specific immunoglobulin-g (igg) and igm antibody responses to sars-cov-2 s, n and rbd of the spike protein develop between 6-15 days following disease-onset (4) . despite a rapid increase in the number and availability of sars-cov-2 serologic assays, most have undergone minimal external evaluation and validation (5) . a recent large scale spanish seroprevalence study used a point of care igg test with a stated sensitivity of 97.2% but on verification found it to have a sensitivity of either 82.1%, 89.7%, 99.6% or 100% depending on the sample sets used for evaluation (6) . all assays currently suffer from the absence of a defined standard serum so results are reported as positive or negative or as optical density readouts complicating the comparison between assays and studies and for many binding assays the relationship between antibody concentration and function is unclear. we have evaluated a novel assay designed to simultaneously measure igg to four sars-cov-2 antigens; full-length trimeric s, rbd and ntd of spike as well as n protein. the assay, based on meso scale discovery (msd) technology, utilises a 96-well based solid-phase antigen printed plate and an electrochemiluminescent detection system. in addition this assay can measure the ability of serum to inhibit the interaction between spike protein components and soluble ace-2, also called a pseudo-neutralisation assay (7) . to evaluate the sensitivity and specificity of the msd assay, we were able to utilise a relatively large number of samples obtained from sars-cov-2 rt-pcr positive health care workers or patients as well as antibody positive health care staff enrolling in a large sars-cov-2 cohort study. samples were screened for igg to sars-cov-2 n protein using a commercially available kit (epitope diagnostics inc, san diego, usa) as previously described (8) . to measure igg antibodies, plates were blocked with msd blocker a following which reference standard, controls and samples diluted 1:500 in diluent buffer were added. after incubation, detection antibody was added (msd sulfo-tag™ anti-human igg antibody) and then msd gold™ read buffer b was added and plates read using a meso® sector s 600 reader. plates were blocked and washed as above, assay calibrator (covid-19 neutralising antibody; monoclonal antibody against s protein; 200µg/ml), control sera and test sera samples diluted 1 in 10 in assay diluent were added to the plates. following incubation plates an 0.25µg/ml solution of msd sulfo-tag™ conjugated ace-2 was added after which plates were read as above. percentage inhibition was calculated relative to the assay calibrator (maximum 100% inhibition). statistical analysis was performed using msd discovery workbench and graphpad prism version 8.0 (graphpad, san diego, ca). antibody concentration in arbitrary units (au) was interpolated from the ecl signal of the internal standard sample using a 4-parameter logistic curve fit. roc curves showing the sensitivity and specificity (plotted as 100%-specificity %) calculated using each value in the data as a cut-off were plotted for each antigen. a cut-off antibody concentration was chosen based on the lowest value leading to a positive likelihood ratio (lr) of >10, in order to maximise sensitivity while providing strong evidence to rule-in j o u r n a l p r e -p r o o f infection (9) . for s antigen binding, all lr's were above 10, therefore the llod was used as the cut-off for this antigen. comparisons between groups were performed by kruskal-wallis one-way anova with dunn's correction for multiple comparisons. correlation analysis was performed using spearman correlation. p values of <0.05 were considered as significant. latent class models with two classes were fitted with the binary antibody responses as outcome variables, using the polca package in the r statistical environment. the code used for the latent class analysis is available on request. the lower limit of detection (llod) was assigned as 1% of the standard value in au, and upper limit of detection (ulod) was assigned for ntd and rbd only as the s and n antigen did not reach an upper limit (table 1) . for statistical purposes, ulod was assigned the highest calculated concentration plus 20% and llod as 0.5%. the mean coefficient of variation (cv) between duplicates was <15% for all except ntd (17.4%, data not shown). the mean intra-assay cv was 6.2% and inter-assay variation <15% across all sars-cov-2 antigens except ntd (19.0%) on one of four samples (supplementary the specificity for s, rbd and n assays are shown in table 2 table 2 : assay specificity calculated for each sars-cov-2 antigen from the control cohort. table 3 . sensitivity and specificity was calculated for groups 0-7d, >7d, >14d and >21d since the onset of symptom the s antigen was the most sensitive of the three, with a sensitivity of 96.2% and 97.9% >14 days and >21 days respectively (table 3) . rocs were plotted to visualise the trade-off between sensitivity and specificity for s and rbd neutralisation. cut-offs (lr>10) were 0.162% for s and 0.524% for rbd (shown by the dotted line on figure 5a -b). sensitivity and specificity for s were 97.8% and 97.9% respectively but lower for rbd (77.2% and 92.8% respectively). in the covid-19 cohort there were some igg positive sera that did not demonstrate neutralisation (below cut-off, n= 4 for s and 36 for rbd). these sera were predominantly those taken soon after the onset of symptoms; 22 between 0-7 days, 9 over 14 days and 5 over 21 days. using a carefully defined cohort of known sars-cov-2 exposed individuals and relevant controls we were able to show the sensitivity and specificity of the assay for the four antigens of interest. comparing the performance of s and rbd assays in a recently published systematic review and metanalysis of the diagnostic accuracy of serological tests for covid-19 (10) the s assay we evaluated had superior sensitivity to all of the assays included in the review while rbd performance was superior to most. the reason for this could be related to the technical aspects of the assay itself including the integrity of the antigen used and the sensitivity of the detection platform but also the use of a well-defined cohort of individuals with known exposure to sars-cov-2. only the n terminal domain of the spike protein did not perform well in this assay with poor sensitivity due to the overlap in antibody titres between the covid-19 cohort and controls. the assay format permitted the measurement of antibody against spike protein derived from sars-1, mers and two seasonal coronaviruses, but the results of antibody binding to these antigens could not be assessed in the same way as for the sars-cov-2 antigens due to the absence of defined negative and positive serum sets. an advantage of this assay is its ability to measure antibody induced inhibition of ace-2 receptor-spike interaction thought to be the major mechanism by which sars viruses, including sars-cov-2 attach to host cell surfaces (11, 12) . in the covid-19 cohort, there was a good correlation between anti-s and anti-rbd igg and function although a few sera bound antigen but did not neutralize. these were dominated by sera taken soon after infection and as recently described, could be non-neutralising and targeting epitopes outside the rbd (13). few of the control cohort sera had any pseudo-neutralisation activity despite pre-existing igg to seasonal coronavirus spike proteins suggesting season coronavirus exposure is unlikely to modify interaction with sars-cov-2. other cross reactive immunological mechanisms (eg t cells) cannot be ruled out and may explain the varied clinical response following exposure to sars-cov-2 (14) . this pseudo-neutralisation assay has been shown to correlate well with neutralisation assays using live sars-cov-2 (msd, personal communication). in summary, the msd multiplexed coronavirus panel assay evaluated in this study is highly reproducible, specific and sensitive for the detection of anti-sars-cov-2 antibody over 14 days since the onset of covid-19 symptoms. the assay can be adapted to measure antibody function which corelated well with spike protein antibody concentration. funding: this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. none world health organisation. 2020. coronavrius disease 2019 (covid-19) situation report -51 relationship between anti-spike protein antibody titers and sars-cov-2 in vitro virus neutralization in convalescent plasma structural proteins in severe acute respiratory syndrome coronavirus-2 temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by sars-cov-2: an observational cohort study serodiagnostics for severe acute respiratory syndrome-related coronavirus-2: a narrative review prevalence of sars-cov-2 in spain (ene-covid): a nationwide, population-based seroepidemiological study a sars-cov-2 serological assay to determine the presence of blocking antibodies that compete for human ace2 binding comparison of four new commercial serologic assays for determination of sars-cov-2 igg diagnostic tests 4: likelihood ratios diagnostic accuracy of serological tests for covid-19: systematic review and metaanalysis angiotensin-converting enzyme 2: a functional receptor for sars coronavirus structural and functional basis of sars-cov-2 entry by using human ace2 characterization of neutralizing antibodies from a sars-cov-2 infected individual transmission, diagnosis, and treatment of coronavirus disease 2019 (covid-19): a review the study team would like to thank meso scale discovery for the donation of the plates and reagents that allowed us to complete the work, the costars study team at great ormond street children's hospital, staff in the great ormond street children's hospital clinical immunology laboratory for additional support and the nihr ucl great ormond street j o u r n a l p r e -p r o o f key: cord-296847-r752bcsu authors: campanini, giulia; percivalle, elena; baldanti, fausto; rovida, francesca; bertaina, alice; marchi, antonietta; stronati, mauro; gerna, giuseppe title: human respiratory syncytial virus (hrsv) rna quantification in nasopharyngeal secretions identifies the hrsv etiologic role in acute respiratory tract infections of hospitalized infants date: 2007-04-23 journal: j clin virol doi: 10.1016/j.jcv.2007.03.009 sha: doc_id: 296847 cord_uid: r752bcsu background: human respiratory syncytial virus (hrsv) detection in nasopharyngeal aspirates (npas) from infants with acute respiratory tract infection (arti) does not prove the hrsv etiology of the current arti episode. hrsv rna quantification may help in affording this issue. objectives: hrsv was detected by quantitative reverse transcription-pcr in npas taken upon admission to hospital and, whenever possible, at discharge and subsequent medical visits. study design: prospective study, including 63 infants affected by either hrsv upper or lower arti. results: based on the kinetics of viral load, hrsv etiology was identified in 25 infants in whom hrsv load dropped from 2.5 × 10(6) upon admission (presence of respiratory symptoms) to 7.5 × 10(2) rna copies/ml npa upon discharge (absence of symptoms) after a median time of 5 days, and in 19 infants, in whom hrsv load was determined at admission only, in association with clinical symptoms (2.4 × 10(6) copies/ml). furthermore, low levels of hrsv rna (<1 × 10(5) copies/ml npa) identified 14 patients with non-hrsv arti. finally, in 14 infants with hrsv coinfections or sequential infections, hrsv quantification defined the hrsv role in the current arti episode. conclusions: hrsv rna quantification is critical in defining the hrsv role in respiratory infections. human respiratory syncytial virus (hrsv) is the major cause of acute respiratory tract infections (arti) in infants during their first year of life and has become the single most common cause of infant hospitalization (boyce et al., 2000; leader and kohlhase, 2002; shay et al., 1999) . diagnosis of hrsv infection in nasopharyngeal aspirate (npa) secretions is currently achieved by cell culture (cc) (falsey et al., 2002; johnston and siegel, 1990; malley et al., 1998) , by the direct fluorescent antibody (dfa) assay (fong et al., 2000; halstead et al., 1990; landry and ferguson, 2000; rovida et al., 2005) or by reverse transcription-polymerase chain reaction (rt-pcr) (falsey et al., 2003; freymuth et al., 1995; paton et al., 1992; perkins et al., 2005) . however, the sole presence of hrsv in npa is not per se indicative of the etiologic involvement of the virus in the current episode of arti. comparable viral loads have been found in nasal secretions from the upper respiratory tract and tracheal secretions from the lower respiratory tract of children hospitalized for an 1386-6532/$ -see front matter © 2007 elsevier b.v. all rights reserved. doi:10.1016 all rights reserved. doi:10. /j.jcv.2007 arti (buckingham et al., 2002; malley et al., 1998; perkins et al., 2005) . in addition, hrsv subgroups a and b have been identified. although this finding is not universally confirmed (brouard et al., 1993; de vincenzo, 2004) , hrsv-a strains have been repeatedly shown to be shed at a higher titer than hrsv-b strains (perkins et al., 2005) and to cause more severe diseases than hrsv-b infections (mufson et al., 1991; walsh et al., 1997) . in the present study, we quantified the hrsv rna load (both subgroups a and b) in npas from hrsv-infected infants by quantitative rt-pcr to investigate the possibility of defining the etiologic role of hrsv in the current arti episode from a series of infants admitted to the hospital either with a single hrsv infection or with two or three simultaneous or sequential viral infections including hrsv. npas from a series of 253 infants aged less than 1 year and admitted to the hospital in the period november 2005-may 2006 with a diagnosis of arti were examined for hrsv as well as other respiratory viruses by dfa, cc, and qualitative rt-pcr, as reported (rovida et al., 2005) . npas were collected by trained personnel using a standardized procedure, as reported (de vincenzo, 2004) . in 63 hrsv-infected infants, hrsv rna was quantified upon admission and, whenever possible, upon discharge, and at subsequent medical visits, as reported below. overall, 49 infants had a single hrsv infection. in addition, 14 infants with multiple simultaneous (coinfections) or sequential (within 30 days) infections in the respiratory tract (including hrsv) were examined prospectively in order to identify the virus responsible for the current arti episode. hrsv rna was quantified by a single-step rt-pcr, using the superscript tm iii platinum ® one-step quantitative rt-pcr system (invitrogen). nucleic acids from npas were extracted using mini mag and nuclisens ® magnetic extraction reagents (biomérieux, lyon, france). degenerated primers ab1 and ab2 targeting the gene f, as reported elsewhere (coiras et al., 2003) were used to amplify both hrsv subgroups a and b. using the same primer set, a plasmid containing the pcr product of the reference hrsv long strain (subgroup a) cloned in ta-cloning (invitrogen) was serially diluted in the range of 10 5 to 10 0 input copies to construct external reference standards. in addition, an internal rna control was used, consisting of a predetermined amount of a synthetic heterologous rna sequence (armored rna ® , ebola virus, subtype zaire, ambion rna diagnostic, ambion, inc., austin, tx). armored rna ® was extracted in parallel with clinical samples and plasmid serial dilutions, and a fixed amount of the extracted rna (100 copies) was added to both rt-pcr reaction mixtures (samples and plasmids) containing, besides the primer pair hrsv ab1 (10 m) and hrsv ab2 (10 m), ebola-specific primers armebofor (10 m) and armeborev (10 m) (sanchez et al., 1999) . the thermal profile was: 10 cycles at 95 • c for 30 s, 55 • c for 2 min and 68 • c for 1 min + 3 s/cycle; then, 40 cycles at 95 • c for 30 s, 50 • c for 2 min, and 68 • c for 1 min + 3 s/cycle. amplicons were visualized in 3% agarose gel, and quantified densitometrically. by using the quantity one programme software (bio-rad, hercules, ca), external standards normalized with the internal control allowed construction of a standard curve, from which the rna copy number of test samples was derived. the sensitivity of the assay was 10 dna copies/10 l for both subgroups a and b. quantitative hrsv results were expressed as rna copy number/ml npa following data multiplication by 100. the hrsv subgroup was initially determined on a series of 10 subgroup a and 10 subgroup b hrsv strains by twostep rt-pcr targeting the gene f (nt 1-705) for the first step, and the gene f fragments nt 347-682 for subgroup a, and nt 30-614 for subgroup b strains for the second step, as previously reported (rovida et al., 2005) , in agreement with coiras et al. (2003) . subgrouping results were totally overlapping with those obtained by dfa staining of npa cells by monoclonal antibodies mab8581 and mab8582 (chemicon, temecula, ca). comparison between medians was done by using the mann-whitney u-test for unpaired data, while the wilcoxon test was used for paired data. distribution of frequencies was examined by the chi-square test. dna plasmids containing the amplified region were constructed for both subgroups a and b, showing that the pcr method has a sensitivity of at least 10 dna copies for each of the two subgroups (fig. 1) . in repeated experiments, at least 10 ebola armored rna copies could be consistently retrotranscribed and amplified ( fig. 1a-c) . potential variation in rt-pcr hrsv efficiency amplification of clinical samples was compensated through the normalization of target (hrsv) densitometric signals by internal control (ebola) signals (fig. 1c) . overall, of the 253 infants (399 npas) examined, 186 (73.5%) were found positive for a respiratory virus (278 npas, 69.7%). in detail, hrsv was the predominant infection, involving a total of 63 infants, i.e. 49 infants with a single infection, and 14 infants with a coinfection/sequential coinfection. the incidence of the other viral infections (for both infants and npas examined) is reported in table 1 . of a total of 134 npas examined for hrsv by cc, dfa and rt-pcr, 19 were found to be negative by each assay (table 2) . of the 115 samples found positive, 78 were positive by cc, 98 by dfa, and 102 by rt-pcr. in addition, the circulation rate of hrsv-a strains (n = 96) was found to be about five times higher than that of hrsv-b strains (n = 19) among children admitted to hospital in the winter-spring season 2005-2006 in our area. we were able to identify, among the 63 infants admitted to hospital with an acute episode of arti, four different clinical situations involving hrsv, which are reported in summary in fig. 2 . the first involved 25 infants, in whom the sharp drop in hrsv rna load from a high level (2.5 × 10 6 rna copies/ml npa, range 6.30 × 10 5 to 4.35 × 10 7 ) a median time of 3 (range 1-5) days after onset of symptoms, to a low level (7.5 × 10 2 rna copies: range 3.0 × 10 2 to 9.3 × 10 5 ) a median time of 8 (range 5-20) days after admission, unequivocally documented the resolution or attenuation of clinical symptoms, in association with the hrsv etiology of the arti episode (group i). the second interested 19 additional infants, in whom the high hrsv load at admission (2.4 × 10 6 rna copies/ml npa; range 6.2 × 10 5 to 2.1 × 10 7 ) at a median time of 3 (1-6) days after onset of symptoms, in association with clinical symptoms, indicated per se the hrsv etiology of arti (group ii). the third included eight infants admitted late (with respect to onset of hrsv infection) to hospital at a median time of 7 (range 7-15) days after onset of symptoms, with an intermediate viral load (1.4 × 10 5 , range 3.0 × 10 2 to 3.7 × 10 5 ) which rapidly became negative, thus representing the late stage of an hrsv arti (group iii). finally, six infants showed a sustained hrsv infection, with a low viral load in npa (5.9 × 10 3 , range 1.3 × 10 3 to 7.2 × 10 4 rna copies/ml npa) persistent at a median time of 20 (7-46) days after onset. thus, in these patients hrsv was presumably not directly involved in the current episode of arti (group iv). with the exception of median viral loads of groups i and ii at admission, and groups iv and i at discharge (p > 0.05), all the other medians were significantly different from each other (p < 0.05). overall, 9/58 infants belonging to the four groups reported above, as well as five additional infants (within the total number of 63 infants examined), were found to be affected by hrsv coinfections or sequential infections. based on previously acquired criteria, the hrsv etiology could be either confirmed by high hrsv load (>10 5 rna copies/ml npa) at admission or a sharp drop in hrsv load between admission (>10 5 rna copies/ml npa) and discharge (<10 2 rna copies/ml npa), or excluded by detection of a stable low (<10 2 copies/ml npa) or medium (10 3 to 10 4 copies/ml npa) level of viral load at follow-up visits (table 3) . respiratory viruses other than hrsv detected in hrsv coinfections and sequential infections are reported in table 3 . overall, hrsv strains from 56 infants could be typed, and found to be either subgroup a (n = 45 strains) or subgroup b (n = 11 strains). among the 44 infants in whom a high viral load in npa was detected upon admission to hospital (group i + group ii), the 33 infants infected by a subgroup a strain showed a median viral load of 1.77 × 10 6 rna copies/ml npa (range 6.30 × 10 5 to 4.35 × 10 7 ), while the nine infants infected by a subgroup b strain had a median viral load of 5.50 × 10 6 rna copies/ml npa (range 7.00 × 10 5 to 3.84 × 10 7 ). the difference was significant (p = 0.05). however, infants with subgroup b infections did not show a significantly greater severity of clinical symptoms (upper versus lower artis) nor a greater duration of the stay in the hospital (8 days versus 9 days) as compared to infants with subgroup a infections. two were the main objectives of this study investigating the impact of hrsv rna quantification in npas on the diagnosis of hrsv artis: (1) the definition or exclusion of hrsv etiology in episodes of arti at the time of infant admission to hospital; (2) the discrimination of the role of hrsv infection among infections by other respiratory viruses occurring simultaneously or sequentially in the same infant. as for the definition of hrsv etiology, results of our study indicate that infants admitted with a respiratory syndrome caused by hrsv displayed hrsv rna load greater than 10 5 rna copies/ml npa with a rapidly decreasing trend in the following days. in the past, experimental infection of adult healthy volunteers with hrsv had already shown that viral rna does not persist for a prolonged period (falsey et al., 2003) . in addition, it was shown that high viral load peaks at admission rapidly decline during the following days (buckingham et al., 2000) . in this study, the kinetics observed in infants examined upon admission and at discharge from the hospital allowed the correct interpretation of findings observed both in infants examined only upon admission (high viral load indicated per se hrsv etiology even in the absence of a decreasing trend) and in those admitted late (with respect to hrsv infection) to hospital with a low hrsv load rapidly declining. virus persistence at a low level was often associated with detection of coinfections, i.e. multiple infections simultaneously occurring in the same patient. in some infants reported in this study with a sustained low level of hrsv rna load, quantification of hmpv (a recently discovered virus often causing respiratory syndromes similar to those caused by hrsv) was sufficient to identify the virus responsible for the current episode of arti (data not reported). in case of coinfection, quantification of all viruses present in the same npa sample may be the sole approach available for the identification of the virus actually causing the acute respiratory syndrome. as for the different pathogenicity of hrsv subgroups a and b, it was reported that subgroup a strains may yield significantly higher viral loads than subgroup b strains (perkins et al., 2005) and may cause clinical syndromes of greater severity (hall et al., 1990; mufson et al., 1991; walsh et al., 1997) . in this study, we had a predominance of subgroup a infections. within these limits, we observed a significantly higher median viral load for subgroup b infections, which was not associated with greater clinical severity or a longer duration of the hospital stay. in conclusion, results of our study emphasize the need for the quantification of hrsv rna load in order to establish the etiologic role of the virus in the current arti episode. due to the high number of respiratory viruses causing similar syndromes in the infantile patient population, the discrimination among the different agents is a necessary requirement for the performance of both accurate epidemiological and clinical surveys and may become critical for the correct administration of specific antiviral drugs. rates of hospitalization for respiratory syncytial virus infection among children in medicaid prevalence and clinical aspects of a and b subgroups of respiratory syncytial virus infection. observation of 8 consecutive epidemics between 1982 and 1990 nasal quantity of respiratory syncytial virus correlates with disease severity in hospitalized infants a randomised, double-blind, placebo-controlled trial of dexamethasone in severe respiratory syncytial virus (rsv) infections: effects on rsv quantity and clinical outcome simultaneous detection of influenza a, b, and c viruses, respiratory syncytial virus, and adenoviruses in clinical samples by multiplex reverse transcription-nested pcr assay natural infection of infants with respiratory syncytial virus subgroups a and b: a study of frequency, disease severity and viral load diagnosis of respiratory syncytial virus infection: comparison of reverse transcription-pcr to viral culture and serology in adults with respiratory illness comparison of quantitative reverse transcription-pcr to viral culture for assessment of respiratory syncytial virus shedding evaluation of r-mix fresh cells in shell vials for detection of respiratory viruses detection of respiratory syncytial virus by reverse-transcription-pcr and hybridization with a dna enzyme immunoassay occurrence of groups a and b respiratory syncytial virus over 15 years: associated epidemiologic and clinical characteristics in hospitalized and ambulatory children evaluation of five methods for respiratory syncytial virus detection evaluation of direct immunofluorescence, enzyme immunoassay, centrifugation culture, and conventional culture for the detection of respiratory syncytial virus simulfluor respiratory screen for rapid detection of multiple respiratory viruses in clinical specimens by immunofluorescence staining respiratory syncytial virus-coded pediatric hospitalisation, 1997-1999 reduction of respiratory syncytial virus (rsv) in tracheal aspirates in intubated infants using humanized monoclonal antibody to rsv f protein a singleseason epidemic with respiratory syncytial virus subgroup b2 during 10 epidemic years, 1978 to 1988 rapid detection of respiratory syncytial virus in nasopharyngeal aspirates by reverse transcription and polymerase chain reaction amplification comparison of a real-time reverse transcription pcr assay and a culture technique for quantitative assessment of viral load in children naturally infected with respiratory syncytial virus monoclonal antibodies versus reverse transcription-pcr for detection of respiratory viruses in a patient population with respiratory tract infections admitted to hospital detection and molecular characterization of ebola viruses causing disease in human and nonhuman primates anderson lj. bronchiolitis-associated hospitalizations among us children severity of respiratory virus infection is related to virus strain we thank all the technical staff of the servizio di virologia for performing all the assays. we also are grateful to daniela sartori for preparing the manuscript, and to laurene kelly for revision of the english. this work was partially supported by ministero della salute, ricerca finalizzata fondazione irccs policlinico san matteo, grants 89282(05)/a and 89288(05). key: cord-310171-1fmsxx2s authors: goffard, anne; lambert, valérie; salleron, julia; herwegh, stéphanie; engelmann, ilka; pinel, claudine; pin, isabelle; perrez, thierry; prévotat, anne; dewilde, anny; delhaes, laurence title: virus and cystic fibrosis: rhinoviruses are associated with exacerbations in adult patients() date: 2014-02-25 journal: j clin virol doi: 10.1016/j.jcv.2014.02.005 sha: doc_id: 310171 cord_uid: 1fmsxx2s background: few studies have suggested the potential role of respiratory viruses in cystic fibrosis (cf) exacerbation, but their real impact is probably underestimated. method: sixty-four sputum samples collected from 46 adult patients were included in the study: 33 samples were collected during exacerbation of cf, and 31 during the stable phase. after extraction, nucleic acids were tested for the presence of respiratory viruses. when rhinovirus (hrv) was detected, the 5′utr and vp4/2 regions were sequenced, and phylogenetically analyzed. the characteristics of patients in exacerbation and stable phase were compared. results: viruses were found in 25% of samples. the hrv viruses were the most frequently detected followed by coronaviruses. only the hrv detection was significantly associated with the occurrence of cf pulmonary exacerbation (p < 0.027). characterization of 5′utr and vp4/2 regions of the hrv genome specified that hrv-a, -b, -c were detected. all hrv-c were recombinant hrv-ca. conclusions: hrv were the most frequently detected viruses; their detection was significantly associated with the occurrence of an exacerbation. the reality of viral recombination between hrv was demonstrated in cf patients for the first time, raising the role of viruses in lung microbiota. further studies are now warranted to decipher virus impact in cf. cystic fibrosis (cf) is the major genetic inherited disease in the european caucasian population. in addition to bacteria, which are well known to cause recurrent exacerbations of cf-associated pulmonary disease and often determine the vital prognosis of patients [1], many airborne particles such as viral entities or fungal spores can also colonize the respiratory tract of patients [1, 2] . for a long time, the detection of respiratory viruses, especially in exacerbations of chronic lung diseases has been underestimated because of the lack of sensitive methods for virus detection. since the sensitive molecular methods for detection of viruses are more and more common, several recent studies highlight the clinical importance of respiratory viruses especially during exacerbation of asthma, chronic obstructive pulmonary disease (copd) or cf [3] [4] [5] [6] [7] [8] [9] . in addition, viruses that were not previously sought are now detected, such as human rhinoviruses (hrvs) within the picornaviridae family. among the hrv genus, a new species of viruses named hrv-c has been described recently, is involved in severe respiratory infections in elderly and in immunocompromised patients [5, [10] [11] [12] hrv-c has been described in patients with cf exacerbation but the real impact in the progression of the lung disease remains unclear [7] . the primary objective of our study was to investigate the frequency and species of viruses present in sputa collected from cf adult patients with either pulmonary exacerbation or stable disease, and to determine the clinical relevance of viruses. as the most frequently detected viruses were hrvs, we phylogenetically characterized them and identified potential clinical associations, expressly for a significant relationship between hrv detections and occurrence of cf exacerbations. sixty four sputum samples collected from 46 cf patients in lille (31 samples, 24 patients), dunkerque (3 samples, 3 patients), and grenoble (30 samples, 19 patients) between october 2006 and december 2010 were prospectively screened for respiratory virus carriages (reference number of the institutional ethics committees of lille hospital, cpp 06/84 -written informed consent was obtained from each patient). all patients had a well-documented diagnosis of cf with either the mutations identified in the cftr gene or an abnormally high sweat chloride test. they were included by physicians according to the same criterion (an annual check-up or an exacerbation situation that required an expectorated sputum sample that allowed us to search also for bacterial and fungal microorganisms). clinical data including spirometry, therapeutic, radiological and biological data were collected by clinic staff at each time of the visit. at each sampling time, the clinical status of the patients was defined as pulmonary exacerbation or stable period according to the physician defined requirement (i.e. recent changes in clinical parameters and/or modification of the pulmonary function provide criteria of exacerbation according to ers statement) [13] . twenty eight patients had one sputum examined, and 18 patients had two sequential sputa examined, which were considered as independent events since the delay between the samples was at least 6 months [2, 14] . samples were performed by expectoration into a sterile cup after a water rinse to prevent excessive salivary contamination, analyzed according to a standardized protocol as previously described, and screened for respiratory virus carriage [2] . total nucleic acids were obtained after mechanical lysis of sputum sample. briefly, 200 l of each sample were subjected to fluidification in a magnalyser (roche diagnostics) according to the manufacturer's instructions. qiaampmin elute virus spin kit (qiagen) was used on crude lysate according to the manufacturer's instructions. purified nucleic acids were frozen at −80 • c until use. reverse transcription was performed with revertaid first strand cdna synthesis kit (fermentas) using 8 l of previously obtained rna. detection of respiratory viruses was performed with seeplex rv15 ace detection kit (seegene) in three independent pcr reactions targeting influenza viruses a and b, rsv a and b, human adenovirus, human metapneumovirus (hmpv), human coronavirus (hcov 229e, nl63, oc43 and hku1), human parainfluenza viruses 1-4, hrv, human enteroviruses, and human bocaviruses in three independent pcr reactions. amplification products were visualized after semi-automated capillary electrophoresis in a tapestation lab 901 (eurobio) and analysis was performed with tape ds12 software. samples that were positive for hrv were identified, based on sequencing of the vp4/vp2 and 5 utr regions, according to the previously described nested rt-pcr strategy and the primers listed in table 1 [15] . the three hrv-specific vp4/vp2, 5 utr inner sense primers were included in the second amplification step. the amplicons were directly sequenced using abi prism 3500xl (life technologies) and results were analyzed with the seqscape 2.7 software (applied biosystem). phylogenetic trees of the vp4/vp2 and 5 utr regions were constructed with unambiguously aligned sequences (516 and 285 sites for vp4/vp2 and 5 utr, respectively) using neighbor joining of pairwise maximum composite likelihood method implemented in mega5 program [16] . the reliability of internal branches was assessed using the bootstrap method with 1000 replicates. accession numbers of the sequences included in the dataset are listed in fig. 2 . quantitative variables were described by median, mean and standard deviation; qualitative variables were described by frequency and percentage. the comparison of sub-population regarding hrv carriage were performed using the mann-whitney u test for quantitative variables. qualitative variables were compared using chi-square test or fisher's exact test when appropriate. a p value of <0.05 was considered significant. all statistical analyses were performed under sas software (sas institute, cary, nc, usa; version 9.2). interactions between rhinovirus infection and the different variables were investigated with one interaction term with respective subterms in the model (univariate model) and then repeated with adjustments to dyspnea, s-k score, abpa, segmental or sub-segmental bronchiectasis, fungus detection, intravenous antibiotics or azithromycin treatment or systemic steroids regimens (multivariate model). forty six patients (23 males and 23 females) were included in this study, with a mean age of 25 years (mean ± sd: 25 ± 11.4). their characteristics at enrolment and at each sampling time are summarized in table 2 . a majority of patients (82%) were homozygous or heterozygous for the del-f508 mutation in the cftr gene overall, viruses were identified from 16 out of 64 sputum samples (25%). rhinoviruses (9/64; 14%) and hcov (5/64; 8%) were the main identified agents. eight hrvs were isolated from patients with acute exacerbation (8/33 occurrences; 24%, fig. 1a ) and 1 from a patient during a stable state (1/31 episodes; 3.2%, fig. 1b ). two (2/33; 6%) oc43/hku1 or 229e/nl63 hcovs have been detected from sputa collected during pulmonary exacerbation (fig. 1a) . three (3/31; 10%) hcovs, 1 (1/31; 3%) influenza a virus and 1 (1/31; 3%) parainfluenza 2 virus (piv-2) were detected in sputa collected from patient in stable clinical condition (fig. 1b) . detection of respiratory viruses occurred mainly in the winter season (fig. 1c) . no significant differences were found in baseline values between the subgroups composed of patients with and without virus detection. viral respiratory infections in our population of cf patients were not significantly associated with either respiratory symptoms, or deterioration of body mass index, of shwachman-kulczycki score, and of spirometry parameters, or comorbidity factors, or microbial colonization, or an increased use of antibiotics, of antifungal or steroids ( table 2 ). alterations confirmed by radiology or scanner as proximal bronchiectasis or as segmental/sub-segmental bronchiectasis (identified in 56.4% and 51.3% of the population, respectively) were not significantly associated with virus detection, but missing data were about 39%. regarding hrv detection, neither general features of cf patients (such as cftr mutations or body mass index), nor spirometric values, nor clinical criteria of respiratory function (such as dyspnea, wheezing, ronchi, or crackles), nor radiological and microbial parameters were significantly associated with hrv detection ( table 2 ). regarding clinical criteria of respiratory function, missing data were about 23% for dyspnea, and 21.8% for wheezing, ronchi, and crackles, which might explained the absence of statistical significance. interestingly, detection of rhinoviruses was significantly associated with pulmonary exacerbation (p = 0.027, table 2 ). sequencing the vp4/vp2 region (nucleotide positions 547-1087) was successfully performed in the 9 hrv positive samples. the obtained sequences were aligned with 13 published complete genome sequences and 12 available partial vp4/vp2 sequences ( fig. 2a) . four hrv sequences were identified as belonging to hrv-a species, 4 to hrv-c species and 1 to hrv-b species. the 8 samples that were assigned to hrv-c or hrv-a species were characterized further by sequencing the 5 utr region (nucleotide position 178-477; fig. 2b ). using a bootstrap value of 70% or greater to define clades, topologies of the trees constructed from vp4/vp2 and 5 utr regions were in agreement with previous published results [19] [20] [21] . surprisingly, the 4 sequences obtained classified as hrv-c by comparative analysis of vp4/vp2 sequences were related more closely to hrv-a strains when their 5 utr regions were analyzed. all query sequences grouped within the hrv-a clade, with bootstrap value of 90 and 84% (figure 2) , and belong to hrv-ca variants, according to recent published data [19] [20] [21] [22] . in the present study, we reported detection of respiratory viruses from adult patients with cf during either routine visit or acute pulmonary exacerbation. we detected respiratory viruses in 25% of 64 sputum samples. this proportion is close to previously published results obtained using conventional diagnosis methods but notably smaller than other recently published data, which might be related to our sampling method [8, 10, [23] [24] [25] . upper respiratory tract sample such as nasal washes or oropharyngeal swabs are the most frequent sample types used to detect respiratory viruses. sputa were considered as lower respiratory tract samples and has been recently described as suitable to identify viruses in cf patients [24, 26] . here, we performed a mechanical pre-treatment of each sputum sample before nucleic acid extraction; this pretreatment is newly recommended for respiratory virus detection in sputa from patients with asthma or cf [26, 27] . moreover, sputum analysis has been used for rhinovirus detection in cf patients, who present exacerbation and sputum production [26] . even if there is only a little data on the incidence of viral pathogens causing exacerbation in adult cf patients, coronavirus, piv-2, pandemic a/h1n1 were detected in our population as previously reported [6, 8, 25, [28] [29] [30] . our screening for respiratory viruses showed the presence of coronavirus in samples collected both from patients with exacerbation and from patients during stable disease. however, the presence of coronavirus in samples is not associated with the occurrence of an exacerbation, according to previous study [30, 31] . we detected influenza a virus in only one case, and therefore did not confirm the link between influenza infection and the occurrence of an exacerbation in cf previously described [29] . due to the potential severity of influenza infection in cf, it is recommended to vaccinate patients against influenza viruses, but the patient positive to a/h1n1 detection did not follow this recommendation and was not vaccinated. the low influenza a virus detection frequency observed here might be linked to the good matching of the influenza vaccine to the circulating influenza viruses during our study period, even if the vaccination status of our cf patient cohort was not documented. consistent with previous studies, we detected coronaviruses preferentially during the cooler months, hrv-a mainly in spring and autumn, and hrv-c variants preferentially during the autumn and winter months [15, 32, 33] . hrvs were the most commonly detected viruses, as previously reported in cf children [9, 25, 26] . whereas the physiopathology of virus-induced exacerbation in cf remains unclear, we established a significant association between hrv detection and respiratory exacerbation, confirming the results of recent studies [7, 32, 33] . the detection of hrvs is more frequent in nasal swabs, especially in patients in a stable phase of cf [9] . however, our results show that the detection of hrv in sputum is associated with the occurrence of an exacerbation suggesting that the analysis of sputum could be more relevant than nasal swabs when a viral cause of pulmonary exacerbation is suspected. some recent studies have shown that hrv-c are involved in severe respiratory infections especially during exacerbations of asthma [34, 35] . numerous findings underscore the polymicrobial nature of respiratory tract as well as the importance of lung microbiota as a distinctive feature of tissue compartmentalization, but viral microbiota (or virome) has been poorly studied in respiratory tract [22, 36] . respiratory virome appears composed of three major virus families: paramyxoviridae, orthomyxoviridae or picornaviridae for which a novel type of rhinovirus c was identified [36] . here, we performed sequence-based typing of 9 hrvs resulting in 1 hrv-b, 4 hrv-a, and 4 hrv-c. as previously described, hrv-a and hrv-c were the most frequently detected viruses compared to the frequency of hrv-b detection [37] . recent studies have shown recombination between the 5 utr region of hrv-c genome and the coding region of hrv-a genome leading the authors to propose a new classification of hrvs in two subspecies, hrv-ca and -cc [15, 19, 20, 38] . occurrence of such recombination was then confirmed, hrv-ca and hrv-cc being detected in various upper respiratory diseases [37] . here, we identified all the hrv-c isolates as belonged to the sub-species hrv-ca by sequencing both the vp4/vp2 and 5 utr regions. to our knowledge, the present study describes for the first time the presence of hrv-ca subtype in patients with cf. although the clinical significance of such recombination is still matter of debate, our results confirm the well-known recombination ability of enteroviruses (notably hrvs); a fact of particular relevance when phage community represents a key point in the lung microbiota analysis as well as in the improvement of resistosome concept [26, 35, 38, 39] . in fact, human microbiota represents a huge reservoir of mobilizable genes, as proposed by rolain and co-workers [39] ; some of those genes encoding antimicrobial resistance that the authors named 'resistome' [39] . this concept is based on few metagenomic studies that have analyzed viral and bacterial communities in cf sputum samples, revealing the presence of an important bacteriophage community containing genes encoding antimicrobial resistance, and demonstrating these bacteriophages are consistent with the characteristics of multidrug-resistant microbial communities that are commonly observed in cf patients [26, 35, 38, 39] . to conclude, we have reported a relatively high frequency of respiratory viruses in a cohort of cf adult patients from france, and demonstrated for the first time that rhinovirus detection including newly identified hrv-ca variants are the most frequent and significantly associated with respiratory exacerbations. our results can be considered as contribution to the characterization the role of viruses in cf pulmonary exacerbation, underscoring the importance of the lung virome that remains poorly understood in the context of cf. the authors thank phrc 1902 -vaincre la mucoviscidose -pfizer laboratories for their financial support. a polymicrobial perspective of pulmonary infections exposes an enigmatic pathogen in cystic fibrosis patients the airway microbiota in cystic fibrosis: a complex fungal and bacterial communityimplications for therapeutic management inflammatory responses to individual microorganisms in the lungs of children with cystic fibrosis viruses exacerbating chronic pulmonary disease: the role of immune modulation viral infections in exacerbations of asthma and chronic obstructive pulmonary disease the role of respiratory viruses in cystic fibrosis rhinovirus c and respiratory exacerbations in children with cystic fibrosis incidence of viral respiratory pathogens causing exacerbations in adult cystic fibrosis patients detection of viral and bacterial respiratory pathogens in patients with cystic fibrosis clinical features and complete genome characterization of a distinct human rhinovirus (hrv) genetic cluster, probably representing a previously undetected hrv species, hrv-c, associated with acute respiratory illness in children rhinovirus outbreak in a long term care facility for elderly persons associated with unusually high mortality rhinovirus infections in hematopoietic stem cell transplant recipients with pneumonia pulmonary exacerbation: towards a definition for use in clinical trials, report from the eurocarecf working group on outcome parameters in clinical trials dynamic colonisation by different pneumocystis jirovecii genotypes in cystic fibrosis patients screening respiratory samples for detection of human rhinoviruses (hrvs) and enteroviruses: comprehensive vp4-vp2 typing reveals high incidence and genetic diversity of hrv species c mega5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods clinical associations and prevalence of scedosporium spp. in australian cystic fibrosis patients: identification of novel risk factors? allergic bronchopulmonary aspergillosis in cystic fibrosis -state of the art: cystic fibrosis foundation consensus conference evidence of recombination and genetic diversity in human rhinoviruses in children with acute respiratory infection analysis of genetic diversity and sites of recombination in human rhinovirus species c genetics, recombination and clinical features of human rhinovirus species c (hrv-c) infections; interactions of hrv-c with other respiratory viruses characterization of the viral microbiome in patients with severe lower respiratory tract infections, using metagenomic sequencing severe viral respiratory infections in infants with cystic fibrosis viral and atypical bacterial infections in the outpatient pediatric cystic fibrosis clinic role of respiratory viruses in pulmonary exacerbations in children with cystic fibrosis respiratory viruses in children with cystic fibrosis: viral detection and clinical findings metagenomics and metatranscriptomics: windows on cf-associated viral and microbial communities association of respiratory viral infections with pulmonary deterioration in patients with cystic fibrosis influenza-associated cystic fibrosis pulmonary exacerbations the differential clinical impact of human coronavirus species in children with cystic fibrosis human coronavirus nl63 infection and other coronavirus infections in children hospitalized with acute respiratory disease in hong kong molecular epidemiology and dual serotype specificity detection of echovirus 11 strains in finland a retrospective overview of enterovirus infection diagnosis and molecular epidemiology in the public hospitals of marseille high rhinovirus burden in lower airways of children with cystic fibrosis alveolar macrophages and cc chemokines are increased in children with cystic fibrosis metagenomic analysis of respiratory tract dna viral communities in cystic fibrosis and non-cystic fibrosis individuals global distribution of novel rhinovirus genotype the abcs of rhinoviruses, wheezing, and asthma bacteriophages and diffusion of genes encoding antimicrobial resistance in cystic fibrosis sputum microbiota the authors thank all the clinicians from the three hospitals for their cooperation in collecting sputum samples and clinical data. the authors would like to thank carolyn engel-gautier for english editing. none. reference number of the institutional ethics committees of lille hospital, cpp 06/84. written informed consent was obtained from each patient. key: cord-279570-lgbqpfh5 authors: fragkou, paraskevi c.; thomas, konstantinos; sympardi, styliani; liatsos, george d.; pirounaki, maria; sambatakou, helen; marantos, theodoros; karofylakis, emmanouil; dourakis, spyridon p.; tsiodras, sotirios; kavvatha, dimitra title: clinical characteristics and outcomes of measles outbreak in adults: a multicenter retrospective observational study of 93 hospitalized adults in greece date: 2020-08-26 journal: j clin virol doi: 10.1016/j.jcv.2020.104608 sha: doc_id: 279570 cord_uid: lgbqpfh5 objectives: measles outbreaks are increasingly reported among countries that were close-to-eliminate measles infection. there are few reports of clinical characteristics of adult measles in the contemporary literature. in this study we aim to describe the clinical characteristics and complications of measles infection in hospitalized adults during the recent epidemic in greece. methods: a multicentre observational retrospective study was conducted in three tertiary hospitals in greece. all adult hospitalized patients (≥18 years old) with serologically confirmed and/or clinical features compatible with measles were included. pediatric patients and patients with missing data were excluded. results: in total, 93 patients, 40 males (43%) and 53 females (57%), mostly young patients were included. most of them (87%) had no past medical history. among women, 4 were pregnant. 56 (60.2%) and 25 (26.9%) patients reported either unknown or incomplete vaccination for measles. ribavirin was administered in 8 (8.6%) patients. pneumonitis and hepatic involvement were the most common complications, occurring in 43 (46.2%) and 75 (80.6%) patients respectively. pneumonitis was significantly associated with male sex, older age, lower lymphocyte counts and higher c-reactive protein (crp) on admission. one pregnant woman suffered spontaneous fetal miscarriage and one patient died due to acute respiratory distress syndrome (ards) and high-risk pulmonary embolism. conclusion: considerable proportions of incompletely vaccinated or unvaccinated adults have led to the re-emergence of measles in countries with reported close-to-elimination rates. pneumonitis is a major complication among adults with measles. more studies are imperative in order to explore the role of immune paresis in measles. measles infection is a highly contagious, air-borne, acute febrile illness caused by a paramyxovirus of the morbillivirus genus [1] and still remains an unresolved global issue with considerable mortality and morbidity rates [2] . the world health organization (who) has recently reported an upsurge of measles cases in the eastern mediterranean, the european and the americas regions, in areas with reported closeto-elimination or elimination of measles [2] [3] [4] . the re-emergence of measles infection possibly signifies the gap in previous vaccination strategies. according to latest who-unicef report only five european countries reported >95% vaccination coverage with both doses of measles-containing vaccine; the respective rates in greece for the first and second dose were 97-99% and 77-83% between 2008-2018 [5] . although the epidemic was contained in greece during 2019, there was a substantial upsurge in other european countries during the same year with a total of 13,460 cases [6] . similarly, an outbreak with 1,282 cases (of whom 29% adults) was reported in the united states of america (usa) during 2019, a country that declared measles elimination in 2000 [7] . the natural course of the infection has only been scantly defined in adults, making management challenging even for experienced clinicians. in this study, we describe our experience from the recent outbreak of measles in adult hospitalized patients in greece [8] . this study was approved by the research ethics committee of each participating institution (protocol numbers: auh: 1821a/22-9-16, tgh: 433/18-12-19, hgh: 2613/18-2-2020) and was conducted according to the outbreak reports and intervention studies of nosocomial infection (orion) reporting guidelines [9] . patients' data were collected and analyzed under strict anonymity in agreement with the declaration of helsinki. since this was a retrospective study, no informed consent was obtained. all patients were classified either as probable or as confirmed cases according to the case classification by the european centers for disease control and prevention j o u r n a l p r e -p r o o f 8 (ecdc) ( table 1) . definitions of pneumonitis and hepatic involvement are provided in table 1 . probable case of measles infection [10] any person meeting the clinical criteria with an epidemiological link. clinical criteria: fever and maculo-papular rash and at least one of: cough, coryza, conjunctivitis. εlevation of alτ above the ulnon admission (according to each centre's reference range) the severity was divided into 2 grades; in total 93 patients, 40 males (43%) and 53 females (57%) aged between 18 and 62 years old, were included ( table 2) . laboratory results are summarized in table s1 . in total, 43 (46.2%) patients (24 men) fulfilled the definition of pneumonitis. age-crp interaction was also included in the final model, however it was non-significant. alt: alanine aminotransferase, fio 2 : fraction of inspired oxygen, iqr: interquartile range, l: liter, n: number of patients, pao 2 : arterial partial pressure of oxygen, sd: standard deviation, u: units. table 5 . characteristics and outcomes of ribarivin group in patients with pneumonitis and hepatic involvement. hepatic involvement was found in 77 (82.8%) patients. among them, 47 (50.5%) and 28 (30.2%) patients had grade i and grade ii hepatic involvement respectively. when patients divided into those without or with grade i liver injury and those with grade ii hepatic involvement, no statistically significant differences j o u r n a l p r e -p r o o f regarding baseline characteristics and presenting symptoms or signs were noted apart from the gastrointestinal (gi) symptoms that were more frequent in those without or with grade i liver involvement (table s2) . a similar comparison between those with normal alanine aminotransferase (alt) and those with any degree of hepatic involvement did not reveal any statistically significant difference. a patient with confirmed measles was presented with a generalized vasculitic eruption instead of the typical rash, while another two males developed haematuria with dysmorphic red blood cells in urine sediment, suggestive of acute glomerulonephritis. in one of them, further work-up with c3, c4, rheumatoid factor and immunoglobulin levels disclosed normal values. furthermore, 1 out of the 4 pregnant women suffered spontaneous fetal miscarriage during her hospital stay at the 8 th week of gestation. no neurological complications were reported in this cohort. all but one patient, were discharged alive from hospital after a median hospitalization of 6 days (iqr= 4-7). pneumonitis was not correlated with the length of hospital stay (table 3) . one obese female patient with a grade ii hepatic involvement and pneumonitis that progressed rapidly into acute respiratory distress syndrome (ards) requiring mechanical ventilation, died within 6 days of her admission due to high-risk pulmonary embolism (pe) despite being treated with ribavirin. in this study we describe the clinical features and outcomes of mostly healthy and young adult hospitalized patients with measles. our data show that the most prevalent symptoms and signs are high-grade fever, cough and generalized maculopapular rash in concordance with previous reports in adults [11, 12] . hepatic involvement and pneumonitis frequencies were as high as 80.6% and 46.2% respectively. when compared to other recent studies including adults, our cohort was quite similar in terms of mean age, sex distribution, presenting symptoms and baseline laboratory findings [13] . despite the high prevalence of pneumonitis in this study, genotype b3 was the most common [8] . prior to this, a major outbreak occurred during 2005-2006 where genotypes d4 and d6 co-circulated [14] and a less severe one followed in 2010. pneumonitis is probably the most serious complication of measles. the prevalence of pneumonitis in our study (46.2%) was slightly higher than the one recently reported in israel (30.5%), in serbia (26.8%) and china (33%), although the latter two studies included pediatric and adolescent cases that could have affected the pooled results [13, 15, 16] . here, we show that male sex, older age, higher crp and low lymphocyte counts are significantly associated with the presence of pneumonitis. to our knowledge, only one recent study has focused on identifying risk factors for pneumonitis. tu et al reported that measles-associated pneumonia was associated with younger age, longer fever duration, higher white blood cell (wbc) counts and normal alt [16] . again, we believe that the inclusion of all age groups in this analysis may have a significant impact on the outcomes, making the extrapolation of the results in adults less sounding. indeed, children<8 months old had significantly higher rates of pneumonitis; moreover, normal lymphocytosis of childhood may have attenuated the impact of lymphopenia as an independent associated factor for pneumonitis. another interesting finding is the low proportion of patients with koplik spots seen in our cohort (30.4%). this could be possibly attributed to the long median time from symptom onset to hospital admission (4 days), given that koplik spots appear 1-2 days prior to skin rash and usually disappear within the second day of rash eruption. measles-induced lymphocytopenia as well as its grade, possibly has a role either as a disease severity biomarker or by predisposing to short-and long-term infectious complications. there is growing evidence that measles infection induces immunosuppression; a recent study in measles-infected children found significantly higher rates of hospitalization (during the first month), non-measles infections and antibiotics prescription up to 5 years post-measles [17] . mina et al showed that measles infection, but not mmr vaccination, reduces the humoral immune memory against numerous viruses in children [18] . another study demonstrated that measles compromises the protection acquired by vaccinations or previous infections by altering the memory b-lymphocyte diversity and leads to incomplete naïve b-cell reconstitution, characterized by a narrower post-infection b-cell receptor repertoire [19] . although it is generally believed that crp is not increased in patients with viral infections in the absence of pneumonitis, several studies have shown modest increases of crp in patients with influenza and other viruses even in the context of non-severe disease sparing the lower respiratory tract [20] [21] [22] . as for measles, griffin et al have reported in an older study including children 4-to 5-fold increases in crp even in uncomplicated cases. in concordance with the above, we do not consider the increased crp in our patients with and without pneumonitis unusual [23] . diagnosis of pneumonitis was followed by antibiotic prescription in 72% of patients, though we had no proven superinfections in this cohort. in contrast, an older study by loukides et al reported a bacterial pneumonia rate of 26% in measlesinfected young males during an epidemic in the greek army, with streptococcus pneumoniae and klebsiella pneumonia being the most commonly isolated pathogens [24] . in our cohort, only 8 patients received ribavirin. due to the small number of treated patients and the heterogeneity in its use among the participating centers, our study could not reach to any specific conclusions regarding its exact role in the management of patients with measles. ribavirin use in this setting is mainly supported by case reports or small case series [25, 26] . only one death was seen among 93 patients. this case was a 36-year old previously healthy female who developed measles-induced ards and pe with hemodynamic compromise. the interplay between viruses and pro-coagulant state has been previously reported; influenza has been associated with acute coronary syndromes [27] and possibly de novo pe in the absence of deep venous thrombosis [28] , while similar cases have also been reported with other viral infections [29] . apart from obesity, our patient did not have any other risk factors for pe, in agreement with a recently reported pediatric case [30] . this potentially fatal complication could be attributed to direct endothelial damage caused by the measles virus, given that endothelial dysfunction has already been reported in children with fatal measles encephalitis [31] . this particular complication in acutely ill patients with respiratory viral infections has become even more relevant in light of the covid-19 pandemic, where venous thromboembolism (vte) is increasingly reported, even in the presence of prophylaxis [32] . moreover, some evidence supports a survival benefit with vte treatment in critically ill patients with covid-19 (but not in those with non-covid-19 illness) and increased d-dimers [33] . current guidelines show significant divergence ranging between more conservative [34] and more liberal approaches [35] . regarding measles infection, we suggest that hospitalized patients with measles should be treated according to the existing vte prophylaxis guidelines in patients with acute medical illness. another finding of great interest is the disease pattern in pregnant women with measles. in our cohort, 4 women (7.5% of female patients) were pregnant and we recorded one miscarriage among them (25%). pregnant women are more likely to be hospitalized, develop pneumonia and die when compared to non-pregnant women and, although not regularly associated with a higher miscarriage rate, measles has been correlated with preterm labor, low birth weight and higher rates of admission in neonatal icu [36] . our study also has some limitations. the retrospective design could attribute to several biases and missing data, although the medical files were thoroughly reviewed and the percentage of missing data was quite low for almost all variables. moreover, treatment patterns across participating centers were not aligned, as it was depicted in the heterogeneity of ribavirin administration. this is not surprising, given the absence-to our knowledge-of guidelines establishing the role of ribavirin or other antivirals in immunocompetent adult patients with measles. finally, the inclusion of hospitalized patients may not precisely reflect the physical history of measlesassociated pneumonitis in general population, since a proportion of patients with a more indolent lung involvement might not require hospitalization. in summary, in this study we presented the clinical characteristics of measles infection during the recent epidemic in hospitalized adults in greece. we further conflict of interest: none of the authors has any conflicts to declare. funding: this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. the data that support the findings of this study are available from the corresponding author [pcf: evita.fragou@gmail.com] upon request. j o u r n a l p r e -p r o o f sporadic cases of adult measles: a research article measles -global situation who vaccine-preventable diseases: monitoring system. 2019 global summary national update on measles cases and outbreaks -united states ongoing measles outbreak in greece related to the recent european-wide epidemic the orion statement: guidelines for transparent reporting of outbreak reports and intervention studies of nosocomial infection -on the communicable diseases and related special health issues to be covered by epidemiological surveillance as well as relevant case definitions investigators, adult patients hospitalized for measles in france, in the 21st century clinical and laboratory features of measles in hospitalized adults measles-related hospitalizations and associated complications in jerusalem cocirculation of genotypes d4 and d6 in greece during the 2005 to 2006 measles epidemic epidemiological, clinical and laboratory characteristics of the measles resurgence in the republic of serbia clinical and immunological analysis of measles patients admitted to a beijing hospital in 2014 during an outbreak in china impact and longevity of measles-associated immune suppression: a matched cohort study using data from the thin general practice database in the uk measles virus infection diminishes preexisting antibodies that offer protection from other pathogens incomplete genetic reconstitution of b cell pools contributes to prolonged immunosuppression after measles c-reactive protein as a biomarker of severe h1n1 influenza c-reactive protein and respiratory viral infection the course of creactive protein response in untreated upper respiratory tract infection changes in serum c-reactive protein during complicated and uncomplicated measles virus infections bacterial pneumonia as a suprainfection in young adults with measles severe measles pneumonia in adults with respiratory failure: role of ribavirin and high-dose vitamin a severe measles pneumonitis in adults: evaluation of clinical characteristics and therapy with intravenous ribavirin acute myocardial infarction after laboratory-confirmed influenza infection h1n1-induced venous thromboembolic events? results of a single-institution case series zika and chikungunya virus and risk for venous thromboembolism fatal rare case of measles complicated by bilateral pulmonary embolism: a case report and short literature review brain endothelial cell infection in children with acute fatal measles high risk of thrombosis in patients with severe sars-cov-2 infection: a multicenter prospective cohort study difference of coagulation features between severe pneumonia induced by sars-cov2 and non-sars-cov2 antithrombotic therapy | coronavirus disease covid-19 covid-19 and vte-anticoagulation -hematology.org what obstetric health care providers need to know about measles and pregnancy severe measles infection: the spectrum of disease in 36 critically ill adult patients key: cord-273783-z71bquck authors: dijkman, ronald; jebbink, maarten f.; gaunt, eleanor; rossen, john w.a.; templeton, kate e.; kuijpers, taco w.; van der hoek, lia title: the dominance of human coronavirus oc43 and nl63 infections in infants date: 2011-12-19 journal: j clin virol doi: 10.1016/j.jcv.2011.11.011 sha: doc_id: 273783 cord_uid: z71bquck background: it is unknown to what extent the human coronaviruses (hcovs) oc43, hku1, 229e and nl63 infect healthy children. frequencies of infections are only known for hospitalized children. objectives: comparing infection frequencies in children who have mild infections with frequencies in children needing hospital uptake will determine whether infection by one of the four hcovs leads to more severe disease. in addition, the sequence of seroconversions can reveal whether infection by one hcov protects from infection by other hcovs. study design: two distinct study groups were monitored: healthy children and children hospitalized due to respiratory infection. hcov natural infection rates in healthy children were obtained by serology in 25 newborns (followed 0–20 months). the frequencies of severe hcovs infection was determined by real time rt-pcr among 1471 hospitalized infants (<2-years old) with acute respiratory tract disease. results: the majority of healthy children seroconverted for hcov-oc43 (n = 19) and hcov-nl63 (n = 17), less for hcov-hku1 (n = 9) and hcov-229e (n = 5). notably, hcov-hku1 seroconversion was absent after hcov-oc43 infection. also hcov-229e infection was rarely observed after hcov-nl63 infection (1 out of 5). in the hospital 207 (14%) out of 1471 children were hcov positive. again we observed most infection by hcov-oc43 (n = 85) and hcov-nl63 (n = 60), followed by hcov-hku1 (n = 47) and hcov-229e (n = 15). conclusions: hcov-nl63 and hcov-oc43 infections occur frequently in early childhood, more often than hcov-hku1 or hcov-229e infections. hcov-oc43 and hcov-nl63 may elicit immunity that protects from subsequent hcov-hku1 and hcov-229e infection, respectively, which would explain why hcov-oc43 and hcov-nl63 are the most frequently infecting hcovs. there are no indications that infection by one of the hcovs is more pathogenic than others. human coronaviruses (hcov) nl63, 229e, oc43 and hku1 are circulating worldwide among the human population and cause approximately 10% of all upper and lower respiratory tract illnesses. [1] [2] [3] in children, infections with hcov-nl63, hcov-229e, hcov-oc43 and hcov-hku1 are associated with acute respiratory tract illness, pneumonia and croup that eventually may lead to hospitalization. 4 the severe acute respiratory syndrome (sars) outbreak in 2002/2003 by a novel coronavirus, followed by the recent identification of hcov-nl63 (2004) and hcov-hku1 (2005) renewed research interest into hcov infections and their ability to seriously affect human health. [5] [6] [7] [8] despite the accumulating knowledge on hcov prevalence and burden of disease, there are limited studies on the frequency of infection by all 4 hcov infections in the non-hospitalized population during the first years of childhood. [9] [10] [11] we established a specific carboxyl-terminal nucleocapsid (nct) protein elisa system for hcov-oc43 and hcov-hku1 analogous to that described for hcov-nl63 and hcov-229e. 12 with this serological toolset we performed a survey with longitudinal sera from newborns to identify seroconversion events during the first years of 1386 life. we compared the serology data with the frequencies of infection of all 4 hcovs in hospitalized infants with acute respiratory tract disease. in addition the chain of seroconversions will reveal whether immunity to one hcov may protect against infection by one of the other hcovs. two distinct study groups were monitored: healthy children (newborns) and children hospitalized due to respiratory disease. human serum specimens from newborns were collected at the department of medical microbiology, academic medical center (amc), laboratory of experimental virology. all children (12 males and 13 females) were born to hiv-1-positive mothers, with various dates of birth (1993, n = 1; 1997, n = 1; 1998, n = 3; 1999, n = 4; 2000, n = 1; 2001, n = 1; 2002, n = 4; 2003, n = 7; and 2004, n = 3). in a previous study we compared the average age of seroconversion in the children born from hiv infected mothers and those born from healthy mothers. the mean seroconversion age was not different, 10 therefore we treated this group of 25 children as a representative of the wider population. serum samples were obtained at birth, age 1 month, 3 months, 12 months, approximately 20 months, and for some also at approximately 24 months. serum samples were stored at −80 • c. all newborns remained hiv-1 rna negative and were hiv-1 seronegative during the follow-up period. twenty-four of the 25 children were never hospitalized during the follow up period. one child was hospitalized in the first month of life due to an influenza infection. so none of the 25 children needed hospitalization at the moment they were infected by the hcovs. thirteen of the 25 newborns were part of a previous survey on hcov-nl63 and hcov-229e seroconversion. 10 respiratory samples were not collected. all serum samples were heat-inactivated at 56 • c for 30 min. respiratory samples from children hospitalized due to respiratory infection, were collected and analyzed at the elisabeth hospital, tilburg, netherlands (n = 168) and the edinburgh royal infirmary (south-east of scotland) (n = 1303) for routine respiratory virus screening. [13] [14] [15] samples had been collected during 5 consecutive years. samples in this study were selected from the complete set based on the following criteria: children who were hospitalized with acute respiratory tract illness and below the age of 2 years. this provides a selection of children of which the hcov infections are severe enough to require hospitalization and who encountered their primary hcov infection. in this study the carboxyl-terminal region of the nucleocapsid (nct) protein was used as antigen, instead of the previous used full length n protein. 10 this was done to increase the specificity of the serological assay. in a previous study we show that the carboxyl part of the n protein of 229e and nl63 elicit specific antibodies that allow differentiation between both species. 16 given the shared structural and functional domain features among coronavirus n proteins we applied the same approach for hcov-oc43 and hcov-hku1, since crossreactivity by the antibodies directed to the full-n of hcov-oc43 and hcov-hku1 has been reported in human sera. [16] [17] [18] the hcov-nl63 and hcov-229e recombinant nct proteins were produced as previously described. 12 the generation of the plasmid for nct-oc43 and nct-hku1 was performed using the same method. briefly, for nct-oc43 the following primer combination was used 5 oc43 n5 ct (5 -caccagattagagttggccaaagtg-3 ) and 3 oc43 nexp (5 -ttatatttctgaggtgtcttcagtatag-3 ), whereas for nct-hku1 the primer combination 5 -hku1 5n ct (5 -caccaaattagacttggttaaaagagtccg-3 ) and 3 hku1 nexp (5 -ttaagcaacagagtcttctacataag-3 ) was used. the generated pet100 oc43 nct and pet100 hku1 nct plasmids were sequenced and shown to be 100% identical to the virus reference sequences of hcov-hku1 (caen1, hm034837) and hcov-oc43 (vr-759, ay391777), respectively. subsequent expression and purification of the hcov recombinant carboxyl-terminal n (nct) proteins were performed exactly as described elsewhere. 10 the nct proteins from hcov-oc43, hcov-hku1, like those from hcov-nl63 and hcov-229e, retained their immunogenicity in elisa (checked with longitudinal sera from adults, or pooled human intravenous immunoglobulin (ivig, sanquin)). we performed competition experiments to ascertain specificity: positive human serum from adults or human ivig was diluted (1:200) in pbst containing 1% skim milk, and twofold serial dilutions (ranging from 0 to 50 g/ml) of nct protein of hcov-nl63, hcov-229e, hcov-oc43, or hcov-hku1 were added. the mixtures were briefly homogenized by vortexing prior to incubation for 1 h at rt. following the preincubations, the samples were measured by either nl63-and 229e-elisa or oc43-and hku1-elisa (so preincubated with the nct form the other virus of the same genus). no cross reactivity was observed. the procedure for the nct elisa of hcov-nl63, hcov-oc43, hcov-hku1 and hcov-229e was performed as previously described. 10, 12 briefly, 96-well elisa plates (greiner bio-one) were coated overnight at 4 • c with 3 g/ml of expressed recombinant nct protein. non-specific binding sites were blocked with phosphate-buffered saline-0.1% tween 20 (pbst) supplemented with 5% skim milk (fluka) for 1 h at room temperature (rt). longitudinal serum samples were diluted 1:200 in pbst containing 1% skim milk and incubated in the plate for 2 h at rt. after a washing, alkaline phosphatase-conjugated anti-human immunoglobulin g fc␥-tail antibody (jackson immunoresearch) diluted (1:1500) in 1% skim milk-pbst was added. following 1 h at rt, the plates were washed and signal was developed with 50 l of lumi-phos plus (lumigen). measurements were done with a glomax 96 plate luminometer (promega). all sera were tested in duplicate. seroconversion was defined as a signal increase of >2.5 compared to that of the preceding time point. calculations were performed using the prism software version 5 (graphpad). comparison of longitudinal results from the cumulative incidence of hcov-oc43, hcov-hku1, hcov-nl63 and hcov-229e seropositive time points was done with the kaplan-meier survival analysis, statistical significance was tested with the log-rank (mantel-cox) test. the time point of seroconversion was calculated by taking the midpoint between the last seronegative and the first seropositive time point. comparison of the mean prevalence for hcov-oc43, hcov-hku1, hcov-nl63 and hcov-229e infections among children under the age of 2 years was done with one-way anova, using the turkey's multiple comparison test. in this serological survey we measured the antibody levels towards all four hcovs in sera collected from 25 newborns who were followed until an average of 20 months of age. during this period none of the children were hospitalized due to an hcov infection. at birth we observed high levels of antibodies directed to all four hcovs that decreased to low detectable levels within a few months. this suggests that all newborns carry maternal antibodies directed to all four hcovs. in one newborn (subject 1) we did not observe any seroconversion for the hcovs during 19 months follow up (table 1) . for 5 newborns a single seroconversion was detected to one of the four hcovs, whereas for the remaining newborns we observed sequential or simultaneous seroconversion events. in total, we recorded 17 events of seroconversion towards hcov-nl63, 19 for hcov-oc43, 5 for hcov-229e and 9 towards hcov-hku1 (table 1) . no correlation was found between the antibody levels of some of the mothers before and after giving birth and the seroconversion outcome of their children (data not shown). to determine whether there is variability in seroconversion rates for the different hcov infections we used the cumulative incidence of seroconversion for each virus (fig. 1a) , using the mid-time point of each event (table 1) . statistical analyses (log-rank, mantel cox test) revealed that there are significant differences in the frequencies of the four hcovs. hcov-oc43 seroconversions occurred significantly more frequently than hcov-hku1 (p = 0.0095) and hcov-229e infections (p ≤ 0.0001), but not hcov-nl63 infections (p = 0.1773). for hcov-nl63 the frequency of seroconversion was significantly higher compared with hcov-229e (p = 0.0015). no significant difference in seroconversion rates between alpha-(nl63 and 229e) or betacoronavirus (oc43 and hku1) was found (p = 0.1529). our antibody data showed that seroconversion to hcov-oc43 and hcov-nl63 occurs most frequently. these seroconversion frequencies can be compared with the frequencies with which these viruses are found in hospitalized children -children of the same age group that appear with respiratory symptoms so severe that hospitalization was needed frequently. this study covered 5 consecutive years, and children were included at two locations: the netherlands and south-east of scotland. between december 2006 and february 2011 a total of 207 (14%) out of 1471 children were hcov infected. hcov-oc43 (n = 85) was most frequently detected, followed by hcov-nl63 (n = 60), hcov-hku1 (n = 47) and hcov-229e (n = 15) (fig. 1b) . the frequency of hcov-229e infection was significantly lower compared to hcov-nl63 (p ≤ 0.05) and hcov-oc43 (p ≤ 0.001). the frequency of hcov-hku1 infection was significantly lower compared to hcov-oc43 (p ≤ 0.05). thus, in hospitalized children under the age of 2 years, hcov-oc43 and hcov-nl63 were the most common coronaviruses detected, similar to the higher rates of seroconversion events observed for these two viruses. hcov-nl63 and hcov-229e belong to the alphacoronaviruses, whereas hcov-oc43 and hcov-hku1 are members of the betacoronaviruses. these groups were originally designed on serological reactivity, suggesting that antibodies could cross-react with the other virus from the same group (we were aware of potential cross reactivity and carefully designed the partial nct protein elisa to best specificity, see section 3). antibodies directed to the spike protein have the potential to be neutralizing, and in case these antibodies cross-react, seroconversion towards one hcov might protect against infection by the other virus from the same group. inspection of the nl63/229e seroconversion dates shows that child 7 seroconverted for hcov-nl63 6 months after hcov-229e (december 2004 versus june 2004), suggesting that an hcov-229e infection did not protect from hcov-nl63 infection. further inspection showed that in none of the hcov-229e seroconversions a recent infection by hcov-nl63 was noted (≤1 year before hcov-229e infection) also pointing towards hcov-nl63 eliciting protective immunity for hcov-229e infection. strikingly, exactly the same pattern is observed for oc43/hku1. hcov-hku1 seroconversions are only observed prior to hcov-oc43 seroconversion, telling that also for these two viruses an infection by hcov-oc43 elicits immunity that is protective towards an hcov-hku1 infection. this is not vice versa, child 6, 7, 10, and 21 seroconvert for hcov-oc43 while they had been infected previously by hcov-hku1, suggesting that an infection with hcov-hku1 does not protect against an hcov-oc43 infection. this is the first study on the seroconversion frequencies of all four hcovs. in healthy children high frequency of seroconversion towards hcov-oc43 and hcov-nl63 were detected, and to a lesser extent seroconversion to hcov-hku1 and hcov-229e. serosurveillance of otherwise healthy individuals subverts bias for analyses of patients with higher severity of symptoms as is an inevitable consequence of hospital based studies, thus providing a much clearer representation of virus epidemiology in the community. these data provide the opportunity to compare the natural infection frequency of each hcov with the frequency with which these viruses are found in hospitalized children with acute respiratory infections within a community, something that has not been achieved previously. we investigated children who were hospitalized with acute respiratory tract illness, below the age of 2 years. this provides a selection of children with severe hcov infections requiring hospitalization. prevalence data in these hospital children and the serology in the healthy children are in complete accordance, revealing that there are no indications that any of the four hcovs causes significantly more hospitalization than another. the characteristic frequency of infection, in the order hcov-oc43 ≥ hcov-nl63 > hcov-hku1 ≥ hcov-229e, observed via seroconversion but also by direct detection of the virus in hospitalized children over multiple years is in contrast with some previous studies. some studies addressed the frequency of hcov infection during childhood and suggested that hcov-nl63 infections were associated with more hospitalization compared to hcov-oc43. 3, 19, 20 in the majority of the abovementioned studies only 1 year was sampled and for hcovs a large year-to-year periodicity is known. 14, 21, 22 the significant differences of seroconversion rates between the coronaviruses observed here cannot be attributed to variable circulating frequencies as samples were collected over multiple years. there has never been a clear explanation for the higher frequency of infection for hcov-oc43 and hcov-nl63 compared to hcov-hku1 and hcov-229e among children. we hypothesize that an infection by hcov-nl63 elicits neutralizing antibodies directed to the nl63-spike protein that might also protect, or partially protect, against an hcov-229e infection, whereas this relationship may not be reciprocated, thus providing a greater likelihood of hcov-nl63 infection than hcov-229e. the same can count for hcov-oc43 for which neutralizing antibodies may protect against hcov-hku1 infection. the seroconversion data we show here support our hypothesis, yet confirmation with in vitro neutralization studies is needed. human respiratory coronavirus hku1 versus other coronavirus infections in italian hospitalised patients viral etiology of acute respiratory infections with cough in infancy: a communitybased birth cohort study human (non-severe acute respiratory syndrome) coronavirus infections in hospitalised children in france human coronaviruses: what do they cause identification of a novel coronavirus in patients with severe acute respiratory syndrome characterization of a novel coronavirus associated with severe acute respiratory syndrome identification of a new human coronavirus characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia seroepidemiologic studies of coronavirus infection in adults and children human coronavirus nl63 and 229 e seroconversion in children examination of seroprevalence of coronavirus hku1 infection with s protein-based elisa and neutralization assay against viral spike pseudotyped virus seroconversion to hcov-nl63 in rhesus macaques human polyomavirus ki and wu in adults with community acquired pneumonia in the netherlands epidemiology and clinical presentations of the four human coronaviruses 229e, hku1, nl63, and oc43 detected over 3 years using a novel multiplex real-time pcr method variability and diversity of nasopharyngeal microbiota in children: a metagenomic analysis differentiation between human coronaviruses nl63 and 229e using a novel double-antibody sandwich enzyme-linked immunosorbent assay based on specific monoclonal antibodies a line immunoassay utilizing recombinant nucleocapsid proteins for detection of antibodies to human coronaviruses development of a nucleocapsid-based human coronavirus immunoassay and estimates of individuals exposed to coronavirus in a u.s. metropolitan population coronavirus infection and hospitalizations for acute respiratory illness in young children human coronavirus nl63 infection and other coronavirus infections in children hospitalized with acute respiratory disease in hong kong, china the pediatric burden of human coronaviruses evaluated for twenty years burden of disease due to human coronavirus nl63 infections and periodicity of infection we thank margreet bakker for selecting the longitudinal children sera. r.d. and l. none declared. not required. key: cord-299388-okiqmy6e authors: wollmeister, elinara; alvarez, alfonso eduardo; bastos, juliana cristina santiago; marson, fernando augusto lima; ribeiro, josé dirceu; baracat, emílio carlos elias; arns, clarice weis; riccetto, adriana gut lopes title: respiratory syncytial virus in brazilian infants – ten years, two cohorts date: 2017-12-06 journal: j clin virol doi: 10.1016/j.jcv.2017.12.002 sha: doc_id: 299388 cord_uid: okiqmy6e background: each year, a considerable amount of children will experience at least one episode of acute viral bronchiolitis (avb) during their first year of life. about 10% of them will be hospitalized, with significant physical and economic burdens. objectives: to compare two cohorts of infants with avb, from same region, in a ten-year interval, regarding epidemiologic factors and viral etiology. study design: cohorts: 142 (2004) and 172 (2014) infants at ages zero to 12 months; clinical diagnosis of avb; medical care in hospital and genetic screening of nasopharyngeal secretion for respiratory viruses. results: the comparative analysis showed a difference in the percentage of respiratory syncytial virus (rsv) positive patients [2004 (33.1%); 2014 (70.3%)] (p < 0.01). no differences were noted regarding gender, breastfeeding, tobacco exposure, crowding and maternal education. there was a difference as to the month of incidence (seasonality) of avb (higher in april 2014). there was a higher age at attendance in the first cohort, and lower birth weight and gestational age ratios in the second cohort (p < 0.05). there were no differences in hospitalization time, need of mechanical ventilation and number of deaths, however a difference regarding co-morbidities was noted (higher in 2004) (p < 0.001). conclusion: none of the analyzed variables had an impact on severity features. virology and immunology must be considered in this kind of situation, by studying genetic variants and the maturation of the immune system in avb by rsv or other viruses. acute viral bronchiolitis (avb) is the most common cause of hospitalization among infants during the first 12 months of life [1] . a variety of viral etiologies are known to cause avb, particularly the respiratory syncytial virus (rsv) [2] . the rsv virus has two subtypes, a and b, which occur in different frequencies and combinations each year [3, 4] . about 10% of the avb cases demand hospitalization; mortality rates are 1% or less, mainly in cases with associated co-morbidities [5] . an effective vaccine is not available; current treatment is only supportive; preventive measures are limited to very expensive monoclonal antibodies [6] . avb seems to be correlated with seasonality, gender, gestational birth age, birth weight, breastfeeding, tobacco exposure, crowding, maternal education and viral etiology [7] [8] [9] [10] . in this study, epidemiologic risk factors, clinical features and viral identification in nasopharyngeal secretion by polymerase chain reaction (pcr) were evaluated and compared in two cohorts (2004 [11] and 2014) with 314 infants with avb. descriptive study with a comparison of two cohorts; sample was composed of infants under 12 months of age (for effect of comparison between two cohorts) with avb and that demanded hospitalization. patients were attended in a metropolitan region, in public and private hospitals, in a seasonal avb period for the region (april to september). diagnosis was based on clinical data, which defines avb as being the first episode of acute respiratory distress with wheezing, preceded by upper airway symptoms such as rhinorrhea and cough, with or without fever [1, 5] . the criterion for severe bronchiolitis was oxygen saturation lower than 92%, which demanded oxygen therapy [1] . exclusion criteria were previous episodes of wheezing. a total of 314 patients were selected (2004: 142; 2014: 172). the studies were approved by the ethical committee from university of campinas [#076/2003 (2004) and #00869612.7.0000.5404 (2014)]. in both cohorts' nasopharyngeal secretions were collected during the first 24 h after hospital admission. in the first cohort, by a washing technique with saline solution followed by aspiration. in the second cohort, collection was done by an aspiration technique without saline solution. only the described technique for each cohort was accepted. the collected samples were analyzed to viral etiology by polymerase chain reaction (pcr). in the first cohort, pcr rt kit (abi prism big dye terminator cycle sequencing ready reaction kit, applied biosystems tm, foster city, usa) screened rsv and metapneumovirus [11] ; in the second cohort, seeplex rv15 ace detection kit (seegene, concord, ca) screened 13 types of rna viruses and two of dna viruses: rsv subtypes a and b; rhinovirus a/b/c; parainfluenza virus 1, 2, 3, and 4; adenovirus; coronaviruses 229e/ nl63 and oc43; influenza a virus and influenza b virus; bocavirus 1/2/ 3/4; metapneumovirus; and enterovirus. epidemiologic data [gender, age at attendance, seasonality, gestational age, birth weight, breastfeeding, tobacco exposure, crowding (more than 5 people at home) and maternal education] were analyzed. clinical data such as previous comorbidities (lung disease, heart disease, immunodeficiency, undernourishment, down syndrome), time of hospitalization, need of mechanical ventilation and death were analyzed and compared in both cohorts. statistical analysis was performed using the mann-whitney, χ 2 and fisher exact tests in the statistical package for the social sciences software, version 24 (ibm corp. released 2015. ibm spss statistics for windows, version 24.0. armonk, ny: ibm corp.). adopted value of significance was 5%. comparison between epidemiologic data is displayed in table 1 ; the 2004 cohort presented lower chances of acquiring of avb in april (or = 0.538; 95%ci = 0.298 to 0.922), fewer patients with birth weight under 3000 g (or = 0.276; 95%ci = 0.153 to 0.485) and gestational age < 37 weeks (or = 0.361; 95%ci = 0.187 to 0.695). in the 2004 cohort (3.5 months), median was attendance age higher than in the 2014 cohort (3 months) (p-value = 0.019). comparison between clinical data can also be seen in table 1 table 2) . table 3 shows the frequency of viral types in the 2004 cohort; table 4 shows the frequency of viral types in the 2014 cohort. metapneumovirus was identified in 5.6% and 1.7% of patients in 2004 and 2014 cohorts, respectively (p = 0.035; or = 8.817; 95%ci = 1.111 to 4.019). comparison between the cohorts showed similarities for gender, breastfeeding, tobacco exposure, number of people in home (crowding) and maternal education. in both cohorts, there was a greater number of males, which is comparable what is described in literature [12, 13] . conversely, in the first cohort, the age at attendance was slightly higher; both cohorts had a median of under 4 months of age. around 30% of patients received breastfeeding for at least one month, in both cohorts. breastfeeding was considered a protective factor for respiratory infections, and is associated with better clinical evolution [14] [15] [16] . despite stimulus for breastfeeding being on the rise [17] , it is not yet a general behavior. similarly, tobacco exposure has been associated to some respiratory diseases in infants and children. a brazilian study with 2037 children under 60 months [18] demonstrated that 59.89% (1220/2037) had respiratory symptoms. it was clearly higher among children with passive tobacco exposure (65.53%-504/768) compared to no tobacco exposure children (56.42%-716/1269). in our study, there were lower levels of tobacco exposure and crowding in both cohorts; maternal education was mostly more than 5 years. these similarities can be explained by the economic situation in the studied region, considered the richest in the country, with a human development index comparable to some european regions [19] . in the 2014 cohort, despite some patients coming from private hospitals, it is possible to consider that, in general, all infants had a satisfactory economic condition and similar cultural environment. avb prevalence, seasonality, birth weight and gestational age displayed differences between the two cohorts. in the 2014 cohort, there was a higher incidence of avb in april, more babies with a birth weight < 3000 g and gestational age < 37 weeks. regarding the higher number of avb cases in april 2014, the fact that both cohorts had higher number of cases occurred in april, may and june (a typical seasonality previously described) has to be taken into account [11, 20, 21] . this difference can be attributed to special weather conditions or a different pattern of virus circulation in 2014. unfortunately, we don't have national data regarding rsv prevalence in 2004 and 2014 to support this claim. analyzing gestational age and birth weight together, as they can be considered co-dependents (in general, the lower the gestational age is associated with lower birth weight) a mention to specific facts related to the study region are necessary. brazil is well-known for its high number of cesarean births; in some private medical services, it can reach more than 50% of births which can result in babies with gestational age and birth weight artificially lower than expected [22, 23] . despite a deeper analysis not being carried out, the higher number of patients with birth weight at birth < 3000 g and gestational age < 37 weeks in this second cohort could be explained by the patients from private hospitals. clinical data were similar in both cohorts regarding time of hospitalization, need of mechanical ventilation and death, also in accordance with literature [24, 25] . in the 2004 cohort there were more patients with previous comorbidities; despite this, no influence was noted in the number of severe cases in this cohort which is the opposite to that described in literature [25] . on regards to virus analysis, different pcr kits were available at each time [8, 11] , each with different capacities. the kits used in the 2014 cohort made it possible to identify a wider spectrum of respiratory viruses, isolated or in combination. different rates of virus identification in both cohorts can be attributed to the use of different kits, despite the same technique being used to identify the viruses (pcr). nonetheless, the difference between the two cohorts also can be attributed to different prevalence of rsv in each year. studies have been trying to associate the viral type -rsv or other respiratory viruseswith a varying degree of severity in the clinical presentation of avb. however, the results are still inconclusive [8, 10, 23] . similar epidemiologic features (gender, breastfeeding, tobacco exposure, crowding and maternal education) could minimize the impact of these possible risk factors in the analysis of cohort comparison. differences in seasonality, gestational age and birth weight can be attributed to specific natural, cultural and economic conditions that were not deeply analyzed. previous co-morbidities were more frequent in the 2004 cohort but had no impact on hospitalization time, need for mechanical ventilation or death. these severity features were similar in both cohorts. viral type was not related to severity in any cohort. virology and immunology must be considered, studying genetic variants and the maturation of the immune system in avb by rsv or other viruses, mainly in the response to a virus in its initial phase of life [24] [25] [26] [27] . clinical practice guideline: the diagnosis, management, and prevention of bronchiolitis risk factors for respiratory syncytial virus associated with acute lower respiratory infection in children under five years: systematic review and meta-analysis respiratory syncytial virus (rsv) fusion protein expressed by recombinant sendai virus elicits b-cell and t-cell responses in cotton rats and confers protection against rsv subtypes a and b distribution and clinical impact of human respiratory syncytial virus genotypes in hospitalized children over 2 winter seasons viral bronchiolitis in children respiratory syncytial virus prevention and therapy: past, present, and future study group of italian society of neonatology on risk factors for rsv hospitalization. risk factors for bronchiolitis hospitalization during the first year of life in a multicenter italian birth cohort epidemiological and genetic characteristics associated with the severity of acute viral bronchiolitis by respiratory syncytial virus concurrent detection of other respiratory viruses in children shedding viable human respiratory syncytial virus single-and multiple viral respiratory infections in children: disease and management cannot be related to a specific pathogen genotypes and clinical data of respiratory syncytial virus and metapneumovirus in brazilian infants: a new perspective etiology and seasonality of viral respiratory infections in rural honduran children epidemiology characteristics of respiratory viruses found in children and adults with respiratory tract infections in southern china prospective validation of a prognostic model for respiratory syncytial virus bronchiolitis in late preterm infants: a multicenter birth cohort study maternal milk protects infants against bronchiolitis during the first year of life. results from an italian cohort of newborns breastfeeding can prevent hospitalization for pneumonia among children under 1-year old breast-feeding and socioeconomic cultural status: factors that lead to early weaning household smoking and respiratory disease in under-five children indicadores sociais: por que construir novos indicadores como o iprs sentinel surveillance of influenza and other respiratory viruses, brazil human respiratory syncytial virus in children hospitalized for acute lower respiratory infection who global survey on maternal and perinatal health research group: caesarean section without medical indications is associated with an increased risk of adverse short-term maternal outcomes: the 2004-2008. who global survey on maternal and perinatal health incidence and predisposing factors for severe disease in previously healthy term infants experiencing their first episode of bronchiolitis epidemiology of hospitalization for acute bronchiolitis in children: differences between rsv and non-rsv bronchiolitis paediatric intensive care admissions for respiratory syncytial virus bronchiolitis in france: results of a retrospective survey and evaluation of the validity of a medical information system programme novel inflammatory markers, clinical risk factors and virus type associated with severe respiratory syncytial virus infection polymorphisms of mannose-binding lectin and toll-like receptors 2, 3, 4, 7, and 8 and the risk of respiratory infections and acute otitis media in children luciana helena antoniassi da silva and fernando rosado spliki (veterinarian, phd in genetics and molecular biology to help in the viral identification. none to be declared. the studies were approved by the ethical committee key: cord-310631-ru5f69qg authors: joachim, denner title: sars-cov-2 and enhancing antibodies date: 2020-05-07 journal: j clin virol doi: 10.1016/j.jcv.2020.104424 sha: doc_id: 310631 cord_uid: ru5f69qg nan robert koch institute, berlin, germany. e-mail address: dennerj@rki.de (j. denner). human coronaviruses (cov) are common, and some of them are associated with mild respiratory infections including common cold [1] . in contrast, other cov infections including the severe acute respiratory syndrome (sars), the middle east respiratory syndrome (mers) and the recent covid-19 are characterised by a higher pathogenicity in certain human populations and may be lethal. cov infections were shown to induce an effective antibody response, however in addition to neutralising antibodies also enhancing antibodies were described, e. g., in the case of sars-cov [2] and mers-cov [3] . antibody-dependent enhancement (ade) occurs when antibodies facilitate viral entry into host cells. ade has been observed for a variety of viruses, most notable flaviviruses [4] . in the case of mers-cov, neutralising antibodies bind to the viral envelope protein and mediate viral entry into igg fc receptor-expressing cells. in persons infected by sars-cov enhancing antibodies and neutralising antibodies may partly counteract each other´s function. it is still unclear whether common cov, sars-cov, mers-cov and sars-cov-2 have related antigens and whether antibodies against one virus may cross-react with the others. in the case, cross-reactive enhancing antibodies exist, the infection with the new sars-cov-2 may be enhanced by these pre-existing antibodies against common cov. common cov circulate every year in the human population [1] and it sounds logical that the amount of anti-cov antibodies including potentially enhancing antibodies is higher in older persons. this may explain the fact that an sars-cov-2 infection in older persons is more severe compared with that in children who may not have had an infection with common cov. there is clear evidence that children get infected by sars-cov-2, but only a few children suffer severely from covid-19. the assumption of ade with pre-existing enhancing antibodies against common cov may also explain why in some regions the infection rate with sars-cov-2 and its pathogenicity is higher compared with other regions. these affected regions may be regions with a higher prevalence of common cov in the last years. the assumption of ade of sars-cov-2 infections may be tested easily in vitro, adding in infection experiments sera from elderly and younger people with and without previous cov infections. transmission of antibodies from individuals who recovered from sars-cov-2 infection is under development as possible therapy. although first clinical studies in china did not reveal negative results [5] , certainly because the neutralising antibodies are vastly outnumbered, it is theoretically possible, that also enhancing antibodies are transmitted, worsening the disease. the possible existence of enhancing antibodies is also of importance for the development of a vaccine against sars-cov-2. to induce enhancing antibodies after immunisation of a healthy person is certainly not the goal of this preventive measure. human coronavirus circulation in the united states immunodominant sars coronavirus epitopes in humans elicited both enhancing and neutralizing effects on infection in non-human primates molecular mechanism for antibody-dependent enhancement of coronavirus entry the bright and the dark side of human antibody responses to flaviviruses: lessons for vaccine design treatment of 5 critically ill patients with covid-19 with convalescent plasma sars-cov-2 infection in children key: cord-267928-dflkggjt authors: kantola, kalle; sadeghi, mohammadreza; lahtinen, anne; koskenvuo, minna; aaltonen, leena-maija; möttönen, merja; rahiala, jaana; saarinen-pihkala, ulla; riikonen, pekka; jartti, tuomas; ruuskanen, olli; söderlund-venermo, maria; hedman, klaus title: merkel cell polyomavirus dna in tumor-free tonsillar tissues and upper respiratory tract samples: implications for respiratory transmission and latency date: 2009-05-22 journal: j clin virol doi: 10.1016/j.jcv.2009.04.008 sha: doc_id: 267928 cord_uid: dflkggjt background: merkel cell polyomavirus (mcpyv) was discovered recently. it is considered a potential causative agent of merkel cell carcinoma, a life-threatening skin cancer. objectives: to study the prevalence of mcpyv in a large number of clinical samples of various types. most of the samples were examined also for the other newly found polyomaviruses ki (kipyv) and wu (wupyv). study design: altogether 1390 samples from immunocompetent or immunocompromised patients, including (i) tonsillar tissues and sera from tonsillectomy patients; (ii) nasopharyngeal aspirates (npas) and sera from wheezing children and (iii) nasal swabs, sera and stools from febrile leukemic children were studied for mcpyv. the tonsils, nasal swabs and stools were also studied for kipyv and wupyv. results: mcpyv dna was detected in 14 samples altogether; 8 of 229 (3.5%) tonsillar tissues, 3 of 140 (2.1%) npas, 2 of 106 (1.9%) nasal swabs and 1 of 840 (0.1%) sera. wupyv and kipyv were detected in 5 (2.2%) and 0 tonsils, 1 (0.9%) and 4 (3.8%) nasal swabs and 0 and 2 (2.7%) fecal samples, respectively. the patients carrying in tonsils mcpyv were of significantly higher age (median 42 years) than those carrying wupyv (4 years, p < 0.001). conclusions: mcpyv dna occurs in tonsils more frequently in adults than in children. by contrast, wupyv dna is found preferentially in children. mcpyv occurs also in nasal swabs and npas, in a frequency similar to that of kipyv and wupyv. the tonsil may be an initial site of wupyv infection and a site of mcpyv persistence. the merkel cell polyomavirus (mcpyv) is a human polyomavirus identified recently in merkel cell carcinoma (mcc) tissue by digital transcriptome subtraction. 1 a subsequent study confirmed that the virus occurs in ∼80% of mcc tissues. 1, 2 the clonal integration of the viral dna in the human genome in mcc tissues together with its relatively low incidence in skin tissues of healthy controls (∼16%) suggested that the virus might be pathogenetically associated with mcc. the potential role of mcpyv in mcc and in other forms of human cancer is yet to be clarified. our study objective was to determine the occurrence of mcpyv in a large number of samples of many different types among 1386-6532/$ -see front matter © 2009 elsevier b.v. all rights reserved. doi:10.1016/j.jcv.2009.04.008 immunocompetent and immunosuppressed individuals. for comparison, we studied the samples also for the two other newly found polyomaviruses kipyv and wupyv. the clinical material comprised nasal swabs, sera and fecal samples from 51 febrile children with acute lymphoblastic leukemia undergoing anticancer treatment (group 1) 3 ; nasopharyngeal aspirates (npas) and paired sera from 140 and 248 wheezing children, respectively (group 2) 3-6 ; and matched pairs of tonsillar tissue and sera from 229 asymptomatic children or adults (group 3) 7 (fig. 1) . the children of groups 1 and 2 have been studied extensively for 14 and 16 respiratory viruses, respectively, including adenovirus; coronaviruses 229e, oc43; rhinoviruses; enteroviruses; human bocavirus (hbov); influenza a and b viruses; human metapneumovirus and parainfluenza viruses 1-3. the tonsillar tissues were obtained during tonsillectomy due to chronic tonsillitis or tonsillar hypertrophy. total nucleic acids were extracted from the sera, tonsillar tissues, nasal swabs and npas with the dna mini kit (qiagen, crawley, uk), and from the fecal samples with qiaamp qiagen dna stool kit (qiagen) according to the manufacturer's instructions. the tonsillar tissues and fecal samples were examined individually whereas the sera, npas and nasal swabs were initially studied in pools of five, followed by individual examination of positive pools. a negative control of molecular biology grade water was extracted and included in the pcr between every 10 samples. for mcpyv detection, nested pcr was performed using as outer primers the previously described lt3 primers 1 and as inner primers a pair hybridizing to conserved regions within the lt3 region (lt3if 5 -tgacgtggggagagtgtttttg-3 ; lt3ir 5 -gaggaaggaagtaggagtctagaaaag-3 ). the 25-l amplification reaction consisted of 1× geneamp pcr buffer i (applied biosystems, warrington, uk), each dntp at 0.2 mm, 20 pmol each primer, 2.5 units of amplitaq gold dna polymerase (applied biosystems) and 5 l of sample. to increase the robustness of fecal pcrs, bsa (new england biolabs, ipswich, usa) included at a final concentration of 0.1 g/l. the cycling conditions for the first and the second pcrs were 5 min at 95 • c, followed by 40 cycles of amplification (95 • c for 17 s, 58 • c for 20 s and 72 • c for 20 s). all samples positive for mcpyv were reanalyzed with the lt1/m1 nested pcr primer set as described 2 and sequenced. samples positive with the lt3 nested primer set but negative with the lt1/m1 primer pair were analyzed with a third (seminested) pcr. primers lt3sf (5 -ctaagtgcgcttgtattagctgtaag-3 ) and lt3 antisense were used for the first-round pcr whereas the internal primers lt3sf and lt3ir were used for the second-round pcr. the mastermix and cycling conditions were as for the other two pcrs. wupyv and kipyv detection was performed by using primer set a as described. 8 all mcpyv and kipyv/wupyv pcr products of correct size were sequenced for confirmation of specificity. for use as positive controls and to determine assay sensitivities by limiting dilution analysis, plasmids containing the vp2 gene of wupyv (eu693907) and kipyv (eu358767) and the lt3 1 amplification product of mcpyv (eu375803) were constructed; the amplification products of the vp2 genes were cloned into pcr8/gw/topo (invitrogen; carlsbad, ca, usa) whereas the mcpyv lt3 region was synthesized and cloned into pgov4 by gene oracle, inc. (san leandro, usa). in the mcpyv and kipyv/wupyv assays, plasmid controls with 30 and 5 copies/reaction were reproducibly positive, respectively. of note, the sensitivities were unaffected by the inclusion of genomic human dna from cultured 293t cells at 100 ng per reaction (4 ng/l). in non-nested format with 40 pcr cycles the lt3 primers had a sensitivity 1 log lower than that of the nested assay both in the presence and absence of human genomic dna. three npas testing positive for mcpyv dna were selected for dnase treatment to determine the encapsidation status of the viral dna. the npas were centrifuged at 16,000 × g for 10 min whereafter both the supernatants and the pellets (after resuspension and sonication) were diluted 1:1 with molecular biology grade water and treated with 100 units of dnase i (roche, mannheim, germany) or mock treated with water. after 2 h at 37 • c, the enzyme was inactivated with 8 mm edta and heating at 70 • c for 10 min. dna was isolated with dna mini kit (qiagen). the three novel polyomaviruses, mcpyv, kipyv and wupyv, were detected in the nasal swabs of the leukemic children and npas of the wheezing children at frequencies of 0.9-3.8% (fig. 1) . sera from the children with mcpyv dna in npa were pcr-negative. two of the 75 fecal samples (2.7%) tested positive for kipyv dna whereas all tested negative for mcpyv and wupyv. of the 840 sera studied for mcpyv, only one from a leukemic child was pcr-positive. the wupyv/kipyv screening of npas and sera from the wheezing children had been done in a prior study (manuscript in submission). for mcpyv the highest frequency of viral dna detection in any sample type was in the tonsillar tissues; in this group of 229 subjects the average ages of the patients that were pcr-positive for mcpyv or wupyv were 39.4 years (median 42; range 7-70) and 4.8 years (median 4; range 2-8), respectively, whereas the average ages of the patients pcr-negative for the two viruses were 22 years (median 20; range 2-72) and 23 years (median 21; range 2-72), respectively. the ages of the patients with mcpyv or wupyv dna in tonsils were ranked 9 and compared with the unequal variance t-test, yielding a statistically significant difference of p < 0.001 (fig. 2) . also the difference in the median ages of the patients with and without mcpyv (p = 0.032) or wupyv (p < 0.001) in tonsil was statistically significant. serum samples from the tonsillectomy patients collected at the time of operation were pcr-negative for the three viruses. most of the tonsillar mcpyv findings were from patients with chronic tonsillitis or tonsillar hyperplasia, 5/108 (4.9%) and 3/42 (7.1%), respectively. wupyv occurred in patients with hyperplastic palatine or adenoid tonsillitis (2 of 25, 8%), chronic tonsillitis (2 of 108, 1.9%), and chronic pansinuitis (1 of 2, 50%). all three wheezing children with mcpyv dna in npa (aged 1.7, 1.2 and 4.2 years) showed co-infections with other respiratory viruses (hbov, rhinovirus and enterovirus along with respiratory syncytial virus (rsv)). of the two leukemic children with mcpyv dna in npa (aged 7 and 4 years), one tested positive for influenza a and rsv antigens whereas the other remained negative in tests for 12 respiratory viruses. in addition to fever, both had cough and rhinitis. among the 16 samples that, in our entire study, were positive for mcpyv by using the lt3 nested pcr, 13 tested positive also with the lt1/m1 nested pcr. of the three lt3 nested pcrpositive samples that were negative with the lt1/m1 nested pcr, one tested positive with the lt3 seminested pcr whereas the other two remained negative. all pcr products were sequenced for confirmation of specificity. throughout our study, only samples testing mcpyv positive with two different pcrs were considered mcpyv positive and are shown in fig. 1 . although not shown, the lower number of lt1/m1 positive samples was probably due to the lower sensitivity of the assay. 2 three of our mcpyv-positive npas were treated (before dna isolation) with dnase i. two were reproducibly resistant to the enzyme with no change in the level of viral dna. one sample was in three repeated assays fully susceptible to dnase i (pcr-negative versus pcr-positive), suggesting that the viral dna occurred in nonencapsidated form. in this study mcpyv dna was detected in clinical samples of many different types: nasal swabs and nasopharyngeal aspirates, tumor-free tonsillar tissues and sera. among immunocompetent children, the absence of mcpyv from the 496 serum samples tested is in accordance with our recent study (in submission) in which the two other polyomaviruses kipyv and wupyv were absent from all of these sera. interestingly, our literature survey did not reveal any evidence of occurrence of human polyomavirus dna in serum or plasma of immunocompetent individuals. on the contrary, blood cells of immunocompetent individuals have been shown to harbor bkv and jcv dna in several studies. the reported rates of bkv detection in lymphoid cells have been 0%, 10 26%, 11 53% 12 and 94% 13 and those of jcv 0%, 10 1%, 11 10% 14 and 83%. 13 bkv and jcv dna have also been reported in the sera or plasma of immunocompromised patients. 15, 16 among the three npas of wheezing children positive for mcpyv, the invariable occurrence of co-infections (100%) with respiratory viruses may indicate merely an "innocent bystander" role for mcpyv in respiratory disease, as previously suggested for kipyv and wupyv. 8 further studies are needed to determine whether mcpyv has any contribution to respiratory tract symptoms. a recent study reported an apparently higher prevalence of kipyv (8%) than of wupyv (1%) among respiratory specimens of 200 patients with respiratory symptoms, 89% of whom were immunocompromised. 17 in line with this, we found kipyv in 3.5% of nasal swabs and 2.7% of fecal samples from the febrile leukemic children whereas wupyv was found in only 0.9% and 0% of the samples, respectively. of note, wupyv has been reported in 2 of 377 (0.5%) fecal samples from immunocompetent children with acute gastroenteritis. 18 two very recent reports have disclosed the presence of mcpyv in npa samples of predominantly immunocompetent children (<15 years) with an average genoprevalence of 0.9%. 19, 20 our study, with even slightly higher mcpyv prevalences of 2% and 3% among immunocompetent and immunocompromised children, respectively, is in line with the other two. furthermore, we showed widespread occurrence of mcpyv dna in tonsillar tissue. this may be a general feature of human polyomaviruses, as tonsillar tissues can harbor both jcv 21 and bkv 22 dna and tonsillar stromal cells have been shown to be susceptible to jcv infection. 23 blood cellderived mcpyv positivity of the tonsils could not be completely ruled out as only serum samples (all of which tested negative for mcpyv dna) obtained at the time of operation were available from our tonsillectomy patients. the potential presence of mcpyv in blood cells of immunocompetent individuals as opposed to serum is an interesting topic for further research. the age distribution of our mcpyv-positive biopsy donors is in strong agreement with the study of goh et al. 20 showing in npas merkel cell virus dna more frequently in adults (8.5%) than in young children (0.6%). this is very interesting, as in the npas of immunocompetent individuals kipyv and wupyv occur more frequently in children than adults. 24 in light of the equivalent npa prevalences of wupyv and mcpyv among immunocompetent children, the notable age difference in tonsillar occurrence of mcpyv versus wupyv possibly reflects a major dissimilarity in the life cycles of these two viruses, related with persistence versus primary infection. indeed, our small-scale dnase data suggest that even among children mcpyv dna in the upper airways is not necessarily encapsidated among all individuals. on the basis of our results and those of goh et al. 20 showing mcpyv dna mainly in adults, it is tempting to speculate that the occurrence of mcpyv in the respiratory tract may involve active shedding coupled with respiratory transmission among children, leading to dna persistence towards adulthood. no conflicts. clonal integration of a polyomavirus in human merkel cell carcinoma frequent detection of merkel cell polyomavirus in human merkel cell carcinomas and identification of a unique deletion in the vp1 gene respiratory viral infections in children with leukaemia human bocavirus and acute wheezing in children respiratory picornaviruses and respiratory syncytial virus as causative agents of acute expiratory wheezing in children serodiagnosis of human bocavirus infection bioportfolio: lifelong persistence of variant and prototypic erythrovirus dna genomes in human tissue no evidence for an association between infections with wu and ki polyomaviruses and respiratory disease rank transformations as a bridge between parametric and nonparametric statistics bk and jc viruses in human immunodeficiency virus type 1-infected persons: prevalence, excretion, viremia, and viral regulatory regions polyomavirus persistence in lymphocytes: prevalence in lymphocytes from blood donors and healthy personnel of a blood transfusion centre human polyomaviruses dna detection in peripheral blood leukocytes from immunocompetent and immunocompromised individuals infection of human polyomaviruses jc and bk in peripheral blood leukocytes from immunocompetent individuals detection of jc virus dna in cerebrospinal fluid from multiple sclerosis patients polyomavirus bk versus jc replication and nephropathy in renal transplant recipients: a prospective evaluation testing for polyomavirus type bk dna in plasma to identify renal-allograft recipients with viral nephropathy polyomaviruses ki and wu in immunocompromised patients with respiratory disease wu polyomavirus in fecal specimens of children with acute gastroenteritis merkel cell polyomavirus dna in respiratory specimens from children and adults merkel cell polyomavirus in respiratory tract secretions detection of jc virus dna in human tonsil tissue: evidence for site of initial viral infection the role of bk virus in acute respiratory tract disease and the presence of bkv dna in tonsils jc virus infection of hematopoietic progenitor cells, primary b lymphocytes, and tonsillar stromal cells: implications for viral latency wu and ki polyomavirus present in the respiratory tract of children, but not in immunocompetent adults this study was supported by helsinki university central hospital research & education and research & development funds, the sigrid jusélius foundation and the academy of finland and the medical society of finland (fls). we wish to thank drs. tobias allander from the karolinska institute (sweden) and david wang from the washington university (usa) for providing the kipyv and wupyv plasmids, respectively. key: cord-264676-k531q3ir authors: liu, yi; chuang, ching-kai; chen, wei-june title: in situ reverse-transcription loop-mediated isothermal amplification (in situ rt-lamp) for detection of japanese encephalitis viral rna in host cells date: 2009-07-09 journal: j clin virol doi: 10.1016/j.jcv.2009.06.010 sha: doc_id: 264676 cord_uid: k531q3ir background: clinical diagnosis of japanese encephalitis is usually difficult due to non-specific signs at the early and acute stages of the infection. virus isolation from peripheral blood is also not possible because of the short period and low level of transient viremia even in the acute stage of the disease. it is thus urgent to develop a feasible and convenient method for laboratory diagnosis of the infection. objectives: to establish a newly designed molecular approach that can be used to detect intracellular japanese encephalitis viral rna in host cells. study design: the method was firstly established and then was carried out to test its efficacy in cultured bhk-21 cells, subsequently in peripheral blood mononuclear cells (pbmcs) isolated from mice that have been inoculated with je virus suspension. results: in this study, in situ reverse-transcription loop-mediated isothermal amplification (in situ rt-lamp) was established; which combines merits of recently developed loop-mediated isothermal amplification (lamp) and in situ reverse-transcriptase polymerase chain reaction (in situ rt-pcr). conclusions: the newly designed method can detect viral rnas in peripheral blood mononuclear cells (pbmcs) in a short time with high sensitivity and efficiency. japanese encephalitis (je) is one of the very important mosquitoborne viral infectious diseases in the world, infecting approximately 10% of the susceptible population in southeast asian countries each year. 1 the etiological agent of je belongs to the family flaviviridae which also includes many other related viruses such as yellow fever virus, dengue viruses, and west nile virus. the genome of the je virus is composed of a positive single-stranded rna of approximately ∼10,000 bases in length. 2 infection rates of je virus in epidemic regions usually vary, ranging from a few cases to 20% of the population. 3 clinically, at least 50,000 cases and 10,000 deaths occur each year, mostly among children in asia, 4 in spite of mass vaccinations which have been implemented in many endemic countries. 5 diagnosis of je by clinical symptoms is not feasible due to nonspecific signs at the early and acute stages of the infection. neither is it possible to isolate the je virus from peripheral blood because of the short period and low level of transient viremia even in the acute stage of the disease. 6 nowadays, the laboratory serodiagnosis of je uses a versatile and convenient approach to detect immunoglobulin m (igm) or igg antibodies in serum or cerebrospinal fluid (csf) by enzyme-linked immunosorbent assays (elisas). 7, 8 more recently, molecular techniques, e.g., the reverse-transcriptase polymerase chain reaction (rt-pcr), to amplify gene fragments of viral rnas are increasingly being used to make diagnoses. 9, 10 nevertheless, the low copy number of viral rna in the blood of je patients makes it difficult to extract rna from this source. 11 utilization of the rt-pcr to detect viral rnas in peripheral blood mononuclear cells (pbmcs), also called in situ rt-pcr, was thus developed as a molecular tool which does not require messenger (m)rna extraction. the technique has been applied to diagnosing je virus infection in pbmcs in a mouse model. 11 the technique of loop-mediated isothermal amplification (lamp) is based on the principle of a strand displacement reaction and the stem-loop structure that amplifies the target gene fragment under isothermal conditions. 12, 13 because the target is initially recognized by six distinct sequences, followed by another four distinct sequences, amplification of the target sequence is expected to be highly selective. 13 furthermore, there is no need for any high-cost instrument (such as a thermocycler or gel imaging system), making the technique reliable, simple, rapid, and cost-effective for detecting and differentiating examined genomic nucleic acids. 12 in this study, we aimed to establish a new approach, named as in situ reverse-transcription loop-mediated isothermal amplification (in situ rt-lamp), in order to detect je virus infection in cultured cells and in pbmcs isolated from infected mice. establishment of this approach is combined the techniques of rt-lamp and in situ rt-pcr which was previously described by this laboratory. je virus used in this study was the t1p1 strain that was previously isolated from field-caught armigeres subalbatus. 15 the virus was propagated in c6/36 cells and titrated in bhk-21 cells based on previous reports. bhk-21 cells are being maintained in our laboratory at 37 • c with 5% co 2 in minimum essential medium (gibco tm brl life technologies, grand island, ny, usa) that contains 2% nonessential amino acids, 2.2 g/ml sodium bicarbonate (nahco 3 ), 0.4% antibiotic-antimycotic, and 10% fetal bovine serum. the plaque assay following our previous description was used for virus titration in this study. 15 the virus titer was calculated and expressed as plaque-forming units per milliliter (pfu/ml). the oligonucleotide primers used for rt-lamp amplification used in this study were designed from the prm gene of the je virus. the sequence of the t1p1 strain was retrieved from the genbank database (accession no. af254453). sets of six primers comprising two outer (f3 and b3), two inner (fip and bip), and two loop primers (lf and lp) were selected based on the criteria shown in a previous description. 13 fip consists of a complementary sequence of f1 and a sense sequence of f2. bip consists of a complementary sequence of b1 and a sense sequence of b2. the two loop primers were designed to accelerate the amplification reaction. the lf and lb primers were composed of sequences complementary to the sequences between the f1 and f2 and the b1 and b2 regions, respectively. details of the primers with regard to their positions in the genomic sequence are shown in table 1 . genomic viral rna of the je virus was extracted from infected culture supernatant using viral nucleic acid extraction kit ii (geneaid biotech, taipei, taiwan) in accordance with the manufacturer's protocol. for total rna extraction from je virus-infected bhk-21 cells, the standard trizol (gibcobrl ® life technologies)chloroform-isopropyl-ethanol wash method was used as described previously. 15 in this study, the rt-pcr was used to compare with the rt-lamp assay described below. the primer pair (10f and 877r) was used to amplify a specific genomic fragment of nt 10-877 of the je virus, covering the 5 non-coding region, c, and prm genes. the sequences of the 10f sense primer and the complementary 877r primer respectively were 5 -ctgtgtgaacttcttggcttagtatcg-3 and 5 -tcagttttcatgagatatcgtgtgtggc-3 . in this study, rt was performed with the bip primer at 42 • c for 60 min. then the lamp reaction was carried out in a 25-l total reaction mixture containing 1 l cdna mixture, 0. in this study, bhk-21 cells were infected with the t1p1 strain of the je virus for 8 h at a multiplicity of infection (moi) of 1 and then transferred from a flask to microtubes. cells were fixed with 4% paraformaldehyde for 20 min, and then permeabilized with 0.1% triton x-100 for 3 min at 4 • c. for the in situ reaction, after rt, cells were precipitated by centrifugation at 2000 × g. after removing the rt reaction mixture, cells were re-suspended with the lamp reaction mixture, and the lamp reaction was performed as mentioned above. in the following step, cells were treated with a blocking solution (5% bovine serum albumin; bsa) for 15 min. in order to visualize the target cdna inside cells, we added 0.4 m digoxigenin (dig)-labeled primer (the 5 -end of the inner fip primer labeled with dig) or 0.01 mm dig-labeled dctp to the lamp reaction. after cells were washed with phosphatebuffered saline (pbs), 50 l of the diluted goat anti-dig antibody conjugated with alkaline phosphatase (roche, mannheim, germany) (1:500 in pbs) was added to the microtubes for a 1-h incubation. subsequently, cells were washed twice with washing solution 1 which contained 100 mm maleic acid and 150 mm nacl (ph 7.5) for 10 min followed by washing solution 2 (100 mm tris-hcl, 100 mm nacl, and 50 mm mgcl 2 ; ph 9.5). subsequently, the substrate nitroblue tetrazolium chloride/5-bromo-3-chloro-3indolyl-phosphate (nbt/bcip) was added to the microtubes and incubated for 10 min. cells were washed again with pbs, removed from the tubes, and distributed onto 12-well slides. in this study, each female icr mouse was intravenously injected with 100 l of pbs (the control group) or 3 × 10 6 pfu of the je virus suspension. pbmcs were then isolated from 1 to 2 ml of whole blood, taken at 1, 3, or 5 d post-inoculation, and pooled from seven or eight inoculated mice, with the ficoll-hypaque solution (ge healthcare biosciences, uppsala, sweden). dig-labeling of the primer or dctp was used in this study to visualize amplified gene fragments in rt-lamp; which was carried out by the method of southern blotting. briefly, a 20-l aliquot of rt-lamp products was first run by electrophoresis on a 2% agarose gel in tae buffer. the gel was treated with denaturing solution (1.5 m nacl and 0.5 n naoh) twice for 15 min each and then with neutralizing solution (0.5 m tris-hcl and 3 m nacl) for 30 min. after being transferred onto a nylon membrane, the membrane was exposed to uv for 3 min for cross-linking (spectrolinker xl-1000 uv crosslinker). the membrane was then immersed in blocking solution (0.05% bsa, 100 mm maleic acid, 150 mm nacl; at ph 7.5; then autoclaved) for 30 min, incubated with the anti-dig-ap antibody (1:5000 in blocking solution) for 30 min, and ultimately in the solution containing the nbt/bcip substrate until the color could be visualized. the success of the rt-lamp method relies on the specificity of the designed primer sets. the primers were selected to target the prm gene derived from the t1p1 strain of the je virus. in order to validate the sensitivity and specificity of the primer set, 0.1 and 0.5 g of total rna extracted from je virus-or mock-infected bhk-21 cells were separately subjected to the rt-lamp reaction at 42 • c and 60 min for rt and subsequently at 65 • c and 60 min for the lamp reaction. in the meantime, the rt-pcr was used in the same experiment as a positive control. the results indicated that the viral rna could be detected from the extract of je virus-infected bhk-21 cells, but not that from mock-infected cells, at both concentrations, shown as dna ladder-like products (fig. 1a) . in the rt-pcr, viral rna was also detected and showed a single band representing the 868-bp fragment (fig. 1b) . to examine the limit of the reaction time, lamp was performed at 10-min intervals (20-60 min). while the viral gene was detected as early as 40 min, a time course of 60 min for amplification was shown to be the optimal condition (fig. 2) . in this study, dig-labeling was used for better visualization after the reaction. when the in situ rt-lamp was run with the diglabeled primer, amplified dna ladder-like products were clearly detected in both groups using the unlabeled or dig-labeled primer, although the signal when using the latter primer was relatively weak (fig. 3a) . however, no signal appeared on the nylon membrane on which amplified dna fragments had been transferred, indicating that dig molecules had not been incorporated into the amplified fragments (fig. 3b) . on the other hand, using the in situ rt-lamp with the diglabeled dctp, dna ladder-like amplified products were shown in the unlabeled group and in two groups labeled with dctp (0.001 and 0.01 mm), but not in that from mock-infected bhk-21 cells ( fig. 4a ). when the rt-lamp products were transferred onto nylon membranes and visualized with the relevant antibody and substrate, as mentioned above, dna ladders were actually present on the membrane in a dose-dependent manner (fig. 4b ). when the in situ rt-lamp was run with the dig-labeled primer, no positive reaction was shown in either je virus-infected (fig. 5a ) or uninfected (fig. 5b ) bhk-21 cells. however, a positive reaction with a deep-brown color was obvious in je virus-infected bhk-21 cells (fig. 5c ), but not in uninfected cells (fig. 5d) , when the reaction was run with the dig-labeled dctp. using the dig-labeled dctp, results showed that the je virus was detected in all pbmcs isolated from mice that had been inoculated with the virus suspension for 1, 3, and 5 d (fig. 6a-c) , but not from mock-inoculated mice (fig. 6d ). in addition, the results revealed that the highest infection rate of pbmcs occurred at 3 d post-inoculation, while a relatively low rate of pbmcs was shown at 5 d post-inoculation (fig. 6b ). the known pathogenesis of je reveals that the virus enters pbmcs including monocytes/macrophages as the primary site for replication in vertebrate hosts. subsequently, the virus migrates to the central nervous system (cns) where brain inflammation or encephalitis may occur. 16 je can be fatal; fatality rates of the infection statistically differ in different localities from 10% to 50%. 17 those who recover from the infection with clinical symptoms often display sequelae with serious neurological impairment and/or mental retardation. 18, 19 as a result, rapid and efficient techniques for the early diagnosis of je are urgently and critically needed. in past years, virus isolation from nerve tissues and antibody (igm and igg) detection from serum and/or csf have extensively been used to detect je virus in most laboratories. however, molecular techniques including rt-pcr and real-time rt-pcr assays are believed to be more useful due to their characteristics of rapidity, high sensitivity, and high specificity. 20, 21 the techniques have been routinely used for identifying the je virus in acute-phase serum or csf samples from patients. 21 drawbacks of these molecular techniques actually include requirements for delicate labor and experienced techniques as well as a relatively expensive instrument, resulting in restricted application in a number of laboratories in developing countries. various gene fragment-amplification techniques, such as rt-pcr, real-time rt-pcr (taqman or sybr green), and nucleic acid sequence-based amplification (nasba), have been developed during the past decade, with the goal of rapidly identifying the je virus with greater accuracy. [22] [23] [24] despite the high magnitude of amplification, these pcr-based methods require either high-precision instruments for amplification or elaborate methods for detection of the amplified products. in the meantime, these methods are often cumbersome to adapt for routine clinical use. after the development of the lamp technique, a new era of the rapid and efficient identification of microbial infections has been initiated. it is particularly useful as its reaction can be monitored through real-time detection of changes in turbidity. 13, 25 moreover, the high sensitivity and specificity facilitates its potential use in the laboratory diagnosis of a number of infections, covering all kinds of organisms. 12 thus far, the technique has been applied to detect or identify viruses, [26] [27] [28] [29] fungi, 30 bacteria, 31 protozoa, [32] [33] [34] and even vertebrates. 35 recently, the technique of rt-lamp was modified from the conventional lamp; this is specifically useful in efficiently and rapidly detecting or identifying various rna viruses, including flaviviruses, 28, 36, 37 togaviruses, 38 the severe acute respiratory syndrome (sars) coronavirus, 26 and the h5n1 avian influenza virus. 27 application of rt-lamp to je virus detection has been shown to be relatively rapid and allows for virus quantification. 14 it was demonstrated that the technique can be used for the rapid diagnosis of je using acute-phase csf samples during an epidemic. 37 in spite of rt-lamp detection of the je virus being rapid and quantitative, this approach requires a larger number of serum or csf specimens to achieve a clinical diagnosis of je patients. it was noted that the je virus can persist in mice for 4-16 weeks following intraperitoneal inoculation and may later be reactivated. 39 in addition, the je virus is also reported to persist in the nervous system of some patients. 40 as a matter of fact, flaviviruses including the je virus and other flaviviruses have been identified to exist in pbmcs of convalescent blood samples, indicating the possibility of persistent viral infection in leukocytes. 41 moreover, je viral rna fragment has ever been amplified from white blood cells during the acute phase of infection. 42 this suggests that detection of such viruses in leukocytes may help make a diagnosis even though the blood was collected in the acute viremia stage. in order to achieve this goal, we herein established a technique called in situ rt-lamp, which was successfully applied to detect je virus in both cultured cells and pbmcs isolated from infected mice. the technique of in situ rt-lamp can avoid the drawback from the potential inefficiency of rna extraction that is a necessary step for conventional rt-pcr as well as rt-lamp. furthermore, one advantage is that the experiment can be run at a constant temperature. thus there is no need for a thermocycler that is necessary when running this technique with a conventional rt-pcr. although in situ rt-pcr can actually skip the process of rna extraction, it still needs an expensive instrument, a thermocycler. in other words, in situ rt-lamp actually is more convenient than both in situ rt-pcr and lamp. to build up a higher-efficiency protocol, we initially carried out dig-labeling of the primers. however, no satisfactory signal was shown either in gel electrophoresis or on blotted nc membranes in the experiment using infected bhk-21 cells. this suggested that the large size of dig molecules labeled on the outer primer fip probably interrupted their binding to stem-loop dna. thus we shifted the dig-labeling to dctp. it turns out that the amplification of nucleic acids was successfully detected; it could clearly be differentiated from that in the control group (mock-infection). this indicated that dig-labeling of dctp is relatively efficient, compared to primer labeling, and is much more efficient, resulting in better visualization and easier differentiation from negative results. in addition to detecting the je virus in cultured bhk-21 cells, the technique was also applied to detect the virus in pbmcs isolated from whole blood of infected mice. eventually, the virus was detected at 1, 3, and 5 d post-inoculation, consistent with our previous work using in situ rt-pcr. 11 nearly half of the inoculated mice dying of the disease (data not shown) suggested that most infected pbmcs may have migrated into brain tissues. 43 taken together, this newly designed technique of in situ rt-lamp is a sensitive (a higher detection rate), rapid (no more than 1 h), efficient (under isothermal conditions), cheap (no need for expensive instrument), and convenient (not labor-intensive) method. this new diagnostic design can serve as a robust tool for diagnosing je virus infection, especially in remote and developing countries. it is particularly useful to detect viruses in blood samples, usually the genomic copy number is low, 42 collected at the acute stage or which are persistently infected. theoretically, this delicate technique can also be applied to diagnosing other viruses that normally infect leukocytes or pbmcs, e.g., human immunodeficiency virus (hiv), with advantages of economy, convenience, and high efficiency. we would like to declare that there is no financial or personal relationship with other people or organizations that could inappropriately influence our work during the submission process. the epidemiology of japanese encephalitis: prospects for prevention flavivirus genome organization, expression, and replication monath tp. fields virology japanese encephalitis: current worldwide status new initiatives for the control of japanese encephalitis by vaccination viral infections of humans an intranasal challenge model for testing japanese encephalitis vaccines in rhesus monkeys rapid diagnosis of japanese encephalitis by using an immunoglobulin m dot enzyme immunoassay identification of dengue sequences by genomic amplification: rapid diagnosis of dengue virus serotypes in peripheral blood rapid identification of flavivirus using the polymerase chain reaction detection of japanese encephalitis virus in mouse peripheral blood mononuclear cells using an in situ reverse transcriptase polymerase chain reaction accelerated reaction by loop mediated isothermal amplification using loop primers loop-mediated isothermal amplification of dna rapid detection and quantification of japanese encephalitis virus by real-time reverse transcription loop-mediated isothermal amplification potential role of armigeres subalbatus (diptera: culcidae) in the transmission of japanese encephalitis virus in the absence of rice culture on liu-chiu islet a model to study neurotropism and persistency of japanese encephalitis virus infection in human neuroblastoma cells and leukocytes analysis of japanese encephalitis epidemic in western nepal in 1997 a survey of the clinical sequelae of japanese encephalitis a hospital-based surveillance for japanese encephalitis in bali sensitive and specific detection of strains of japanese encephalitis using a one-step taqman rt-pcr technique development and evaluation of sybr green i-based one-step real-time rt-pcr assay for detection and quantization of japanese encephalitis virus detection of west nile and japanese encephalitis viral genome sequences in cerebrospinal fluid from acute encephalitis cases in karachi nasba and other transcription-based amplification methods for research and diagnostic microbiology taqman reverse transcription polymerase chain reaction for the detection of japanese encephalitis virus detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus development of h5-rt-lamp (loop-mediated isothermal amplification) system for rapid diagnosis of h5 avian influenza virus infection rapid detection and differentiation of dengue virus serotypes by real-time reverse transcription loop-mediated isothermal amplification assay rapid and real-time detection of hepatitis a virus by reverse transcription loop-mediated isothermal amplification assay evaluation of loop-mediated isothermal amplification (lamp) to rapidly detect arbuscular mycorrhizal fungi specific and rapid detection of food-borne salmonella by loop-mediated isothermal amplification method development of a multiplex loop-mediated isothermal amplification (mlamp) method for the simultaneous detection of bovine babesia parasites species-specific loop-mediated isothermal amplification (lamp) for diagnosis of trypanosomosis evaluation of loop-mediated isothermal amplification (lamp), pcr and parasitological tests for detection of trypanosoma evansi in experimentally infected pigs rapid sexing of water buffalo (bubalus bubalis) embryos using loop-mediated isothermal amplification real-time reverse transcription loop-mediated isothermal amplification for rapid detection of west nile virus development and evaluation of reverse transcription-loop-mediated isothermal amplification assay for rapid and real-time detection of japanese encephalitis virus rapid and real-time detection of chikungunya virus by reverse transcription loop-mediated isothermal amplification assay persistence, latency and reactivation of japanese encephalitis virus infection in mice persistence of japanese encephalitis virus in the human nervous system japanese encephalitis virus latency in peripheral blood lymphocytes and recurrence of infection in children detection and isolation of japanese encephalitis virus from blood clots collected during the acute phase of infection the blood-brain barrier in the cerebrum is the initial site for the japanese encephalitis virus entering the central nervous system funding: this work was financially supported by grants from chang gung memorial hospital (cmrpd160162 and emrepd180191). key: cord-293890-thfros7x authors: carbo, ellen c.; sidorov, igor a.; zevenhoven-dobbe, jessica c.; snijder, eric j.; claas, eric c.; laros, jeroen f.j.; kroes, aloys c.m.; de vries, jutte j.c. title: coronavirus discovery by metagenomic sequencing: a tool for pandemic preparedness date: 2020-08-21 journal: j clin virol doi: 10.1016/j.jcv.2020.104594 sha: doc_id: 293890 cord_uid: thfros7x introduction: the sars-cov-2 pandemic of 2020 is a prime example of the omnipresent threat of emerging viruses that can infect humans. a protocol for the identification of novel coronaviruses by viral metagenomic sequencing in diagnostic laboratories may contribute to pandemic preparedness. aim: the aim of this study is to validate a metagenomic virus discovery protocol as a tool for coronavirus pandemic preparedness. methods: the performance of a viral metagenomic protocol in a clinical setting for the identification of novel coronaviruses was tested using clinical samples containing sars-cov-2, sars-cov, and mers-cov, in combination with databases generated to contain only viruses of before the discovery dates of these coronaviruses, to mimic virus discovery. results: classification of ngs reads using centrifuge and genome detective resulted in assignment of the reads to the closest relatives of the emerging coronaviruses. low nucleotide and amino acid identity (81% and 84%, respectively, for sars-cov-2) in combination with up to 98% genome coverage were indicative for a related, novel coronavirus. capture probes targeting vertebrate viruses, designed in 2015, enhanced both sequencing depth and coverage of the sars-cov-2 genome, the latter increasing from 71 to 98%. conclusion: the model used for simulation of virus discovery enabled validation of the metagenomic sequencing protocol. the metagenomic protocol with virus probes designed before the pandemic, can assist the detection and identification of novel coronaviruses directly in clinical samples. the severe acute respiratory syndrome coronavirus type 2 (sars-cov-2) pandemic of 2020 demonstrates the devastating effect an emerging virus can have. although previous pandemics such as the spanish flu (1918) and asian flu (1957) resulted in a multitude of fatal cases, the sars-cov-2 pandemic exhibits an unprecedented impact on public health, the economy and society as a whole. metagenomic next-generation sequencing (mngs) enables hypothesis-free sequencing of all nucleic acids in a given sample, including genomes of pathogens. all sequences are amplified, followed by classification of sequences based on a reference database. while research applications are more common, mngs is being introduced in clinical diagnostic laboratories as indicated by recently diagnosed cases of encephalitis [6] . implementation of mngs in clinical diagnostics requires validation of metagenomic protocols. metagenomic protocols and pipelines have been successfully used for detection of known pathogens [6] [7] [8] . however, detection and identification of novel, j o u r n a l p r e -p r o o f previously unknown emerging viruses presents a challenge due to the absence of their genome sequences in reference databases. in this study, we validated the identification of emerging coronaviruses by a viral metagenomic protocol, using clinical samples with sars-cov-2, and samples spiked with cultivated isolates sars-cov frankfurt-1 (sars-cov) and mers-cov emc/2012 (mers-cov). the validation included analysis of the performance of both an in-house and a commercially available data analysis pipeline, genome detective [9] . identification of coronaviruses was tested using modified databases lacking sars-cov-2, sars-cov, and mers-cov, mimicking the situation at the time of virus discovery. additionally, the efficacy of detection of novel coronaviruses using capture probes targeting vertebrate viruses [10] [11] known before the current pandemic was analyzed using a sars-cov-2 clinical sample. nasopharyngeal swabs were obtained from two patients who tested positive for sars-cov-2 by realtime pcr targeting the sars-cov-2 e-gene [12] with cq values of 20 and 30, respectively. these pcrs library preparation and sequencing were performed using a previously validated protocol [15] [16]. briefly, 200μl of patient samples were spiked with equine arteritis virus (eav) and phocid herpesvirus-1 (phhv-1) prior to na extraction using the magnapure 96 dna and viral na small volume extraction kit on the magnapure 96 system (roche, basel, switzerland) resulting in 100μl nucleic acid-containing eluate. of this eluate, 50μl per sample was used as input for the library prep, utilizing the nebnext ultra ii directional rna library prep kit for illumina (new england biolabs, ipswich, ma, usa), dual indexed nebnext multiplex oligos for illumina (1.5µm), and a protocol optimized for processing rna and dna simultaneously in a single tube [15] . library preps of the samples where processed both with and without enrichment for viruses using sequence capture probes (see below). subsequent sequence analysis was performed using a after quality pre-processing using an in-house qc pipeline, biopet version 0.9.0 [17] and removal of human reads after mapping them to human reference genome grch38 [18] with bowtie2 version 2.3.4 [19] , the remaining sequencing reads were taxonomically classified using centrifuge 1.0.2-beta [20] pre-processed short reads were de novo assembled into contigs using spades version 3.10.1 [22] . all contigs were analyzed using the ncbi basic local alignment search tool (blast 2.8.1) [23] using the blast ncbi's nucleotide (nt) database (accessed april 2018). only viral hits for contigs with a length of ≥500bp were selected to identify the best shared homology to viruses. a length of 500bp was taken to ensure coverage of the built contigs by at least 3 reads, to rule out any possible contamination. only hits dated prior to 2020 genomes were considered to mimic the virus discovery setting for sars-cov-2. after extraction of human reads, fastq files generated for sars-cov-2 samples (with and without viral enrichment) were uploaded for classification and de novo assembly by the commercial webbased tool genome detective v1.120 (www.genomedetective.com, accessed 2020-05-11) [9] , using a reference database (generated 2019-09-21). in brief, after removal of low-quality reads and trimming by trimmomatic [24] , candidate viral reads were identified using the protein-based alignment method diamond [25] in combination with the swissprot uniref90 protein database followed by de novo assembly using metaspades [26] . blastx and blastn [23] were used to search for candidate reference sequences using the ncbi refseq virus database (accessed 2019-09-21). consensus sequences were produced by joining de novo contigs using advanced genome aligner [27] . classification results of viral reads are shown in figure 1 and results of de novo assembly of all samples for contigs longer than 500bp are shown in table 2 . blastn was used to search for hits with sequence homology. only viral hits with the lowest e-value of all matches identified that were submitted before the publication of sars-cov-2 genomes were considered. blastn search results of the contigs with coronaviridae hits are listed in table 2 including the length of the longest contig for each sample. identity data of the hits with the lowest evalue are listed in supplementary table 1 . additional blast alignment figures of the longest contigs of both the sars-cov and mers-cov samples can be found in supplementary figure 1 and 2, respectively. genomedetective results of identification of sars-cov-2 sequences using a database created before the emergence of sars-cov-2 are shown in figure 2 . sars-cov-2 sequences were identified as sars-cov, with nucleotide and amino acid identity of 80-81% and 83-85% respectively in combination with up to 98% genome coverage, being indicative for a novel finding. the efficacy of a metagenomic sequencing protocol using capture probes targeting vertebrate virus sequences designed before the emergence of sars-cov-2, was studied in the context of virus discovery. we analyzed metagenomic data from the two sars-cov-2 positive samples prepared both with and without viral enrichment. the total amount of contigs and the number of contigs matching genomes of viruses form coronaviridae are shown in table 2 and reads mapping to the sars-cov-2 reference genome were used to visualize the difference in using capture probes as depicted in figure 3 , where the sars-cov-2 genome is almost completely covered. the two largest contigs built by spades that had a hit with the lowest e-value when blasted against genomes from coronaviridae, were 4866bp and 5811bp in length for the two sars-cov-2 samples enriched using probes. in this study, we evaluated the performance of a metagenomic sequencing protocol for the identification of emerging viruses using clinical samples in combination with a simulated reference database. high and low loads of sars-cov-2, sars-cov, and mers-cov in clinical samples could be detected as 'novel' viruses, using only reference sequences created before these viruses emerged. sequence reads were assigned to the closest relatives of these viruses available at that time and assembled with heterologous sequences to 'novel' consensus genomes. low identity of these consensus genomes with genomes of closely related ones indicated a novel virus. additionally, j o u r n a l p r e -p r o o f probes targeting sequences of vertebrate viruses, available prior to the coronavirus pandemic of 2020, succeeded in the capture of nearly the full genome of sars-cov-2. it must be noted that the validation was performed using emerging viruses with nucleotide identity of over 76% to their closest known relatives and conclusions cannot be extended to novel viruses which are less closely related. nucleotide (and amino acid) identities reported in literature with regard to novel human pathogenic viruses vary, for example 50% for older viruses like sars-cov [1] , 80% for mers-cov [14] , 88% for parts of the human metapneumovirus [28] and up to 97.2% for parts of sars-cov-2 [29] . several reports have shown an increase of 100-10.000 fold in sensitivity for detection of known viruses when using capture probes [10] , [30] and here we report the potential of using capture probes in the detection of novel viruses. sequence variation was addressed in the probe design by retaining mutant or variant sequences if sequences diverged by more than 90% [10] . lipkin and colleagues describe the capture of conserved regions of a rodent hepacivirus isolate with 75% identity using virseqcap vert, and even 40% for detection rather than whole genome sequencing is suggested [10] . the capture probes used in this study targeted sequences of several isolates of alpha-, beta-, gamma-, and deltacoronaviruses. in this study the whole genome of sars-cov-2, with 76-100% overall nucleotide identity to the probe targets, was detected using these probes. metagenomic sequencing is increasingly being used in diagnostic laboratories as a hypothesis-free approach for suspected infectious diseases in undiagnosed cases. metagenomic sequencing in diagnostic laboratories has resulted in the detection of pathogens present in the reference database but either not tested for by routine methods due to rare or unknown associations with a specific disease, or for which routine testing failed (e.g., due to primer mismatches). additionally, mngs enables the detection of novel pathogens not (yet) present in the databases. common bioinformatic classifiers are usually not designed for discovery purposes, so additional algorithms including a separate validation to assess the performance in a discovery setting are needed. reports on specific j o u r n a l p r e -p r o o f bioinformatic discovery tools typically describe the algorithm and an in silico analysis and here we present validation studies on the performance of virus discovery tools using clinical samples. implementation of virus discovery protocols in diagnostic laboratories may contribute to increased vigilance for emerging viruses and therefore aids in surveillance and pandemic preparedness. the authors have no conflicts of interest. j o u r n a l p r e -p r o o f table showing the total number of built contigs with a length >=500bp, the number of these contigs where the hit with the lowest e-value would be a hit to viruses, the number of contigs where the hit with the lowest e-value would be a hit to coronaviridae and of this last group the length of the longest contig, the alignment length, identity match, taxonomic name of blast result and the release years of sequences belonging to the species and subjects found by blast. identification of a novel coronavirus in patients with severe acute respiratory syndrome a novel coronavirus associated with severe acute respiratory syndrome laboratory validation of a clinical metagenomic sequencing assay for pathogen detection in cerebrospinal fluid vip: an integrated pipeline for metagenomics of virus identification and discovery metagenomics for pathogen detection in public health genome detective: an automated system for virus identification from highthroughput sequencing data virome capture sequencing enables sensitive viral diagnosis and comprehensive virome analysis', mbio enhanced virome sequencing using targeted sequence capture detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr mechanisms and enzymes involved in sars coronavirus genome expression isolation of a novel coronavirus from a man with pneumonia in saudi arabia retrospective validation of a metagenomic sequencing protocol for combined detection of rna and dna viruses using respiratory samples from pediatric patients the respiratory virome and exacerbations in patients with chronic obstructive pulmonary disease fast gapped-read alignment with bowtie 2 centrifuge: rapid and sensitive classification of metagenomic sequences interactive metagenomic visualization in a web browser spades: a new genome assembly algorithm and its applications to single-cell sequencing basic local alignment search tool trimmomatic: a flexible trimmer for illumina sequence data fast and sensitive protein alignment using diamond metaspades: a new versatile metagenomic assembler an alignment method for nucleic acid sequences against annotated genomes analysis of the genomic sequence of a human metapneumovirus a novel bat coronavirus closely related to sars-cov-2 contains natural insertions at the s1/s2 cleavage site of the spike protein improved diagnosis of viral encephalitis in adult and pediatric hematological patients using viral metagenomics we would like to thank joost van harinxma thoe slooten and alhena reyes for the library preparations and viral probe enrichments. additionally, we would like to thank lopje höcker, margriet kraakman and tom vreeswijk for all their technical assistance in the lab. key: cord-316723-srenbxa7 authors: zhao, jincun; wang, wei; wang, guang-fa; li, yonghua; zhuang, hui; xu, xiaoyuan; ren, furong; zhao, zhendong; gao, xiao-ming title: development and evaluation of an enzyme-linked immunosorbent assay for detection of antibodies against the spike protein of sars-coronavirus date: 2004-11-23 journal: j clin virol doi: 10.1016/j.jcv.2004.09.024 sha: doc_id: 316723 cord_uid: srenbxa7 background: severe acute respiratory syndrome (sars) is caused by infection with sars-associated coronavirus (cov). amino acid residues 450–650 of the spike (s) glycoprotein of sars-cov (s450-650) contains dominant epitopes for anti-viral antibodies (abs) in patient sera. objectives: to develop and evaluate an elisa system for detection of anti-s abs in patient sera. study design: express recombinant s450-650 in e. coli and evaluate the sensitivity and specificity of an elisa system based on the s450-650 polypeptide. results: the s450-650-based elisa detected igg abs in 41 out of 51 serum samples from 22 hospitalized patients with probable sars, a result closely correlated with that obtained with a virus-based elisa (r = 0.75, k = 0.8). differential anti-s igg responses were observed amongst sars patients. some of them produced anti-s abs early during their infection, while others failed to make igg abs against the s450-650 polypeptide. none of the serum samples from 100 healthy blood donors was positive in the s450-650-based assay. conclusion: the s450-650-based elisa can detect anti-s igg abs with high sensitivity and specificity. severe acute respiratory syndrome (sars) is caused by sars-associated coronavirus (sars-cov), an enveloped, positive-stranded rna virus of the coronaviridae family (rota et al., 2003; peiris et al., 2003) . the genome of sars-cov encodes several structural proteins including the spike (s) glycoprotein, nucleocapsid protein, membrane protein and envelope protein (marra et al., 2003) . membrane fusion between sars-cov and the host cell is mediated by its s glycoprotein xiao et al., 2003; dimitrov, 2003; wong et al., 2004; wang et al., 2004; sui et al., 2004) , which consists of 1255 amino acid residues with approximately 25% homology to that of the other human covs (spiga et al., 2003; ho et al., 2004) . the s1 subunit (amino acids 1-680) of the s glycoprotein contains a receptor-binding domain and is apparently the main target for neutralizing abs in patient sera (xiao et al., 2003; sui et al., 2004; wong et al., 2004; wang et al., 2004; babcock et al., 2004) . western blot (wb) and indirect immunofluorescence assays have been developed for detection of abs against the s protein chang et al., 2004; wu et al., 2004; woo et al., 2004; ho et al., 2004; he et al., 2004) . however, so far there is no enzyme-linked immunosorbent assay (elisa) available for easier and more sensitive detection of anti-s abs. our computer-assisted analysis suggested that amino acid residues 450-650 of the s glycoprotein (s450-650) of sars-cov is largely solvent accessible and likely to contain dominant b cell epitopes. this coincided with recently published results by lu et al. (2004) showing that residues 441-700 of the s protein of sars-cov contained dominant epitope(s) for anti-s abs in patient sera, as determined in wb assays. sequences outside the 441-700 region were relatively poorly recognized by patient sera . it is also supported by findings of zhou et al. (2004) that residues 485-625 of the s protein of sars-cov elicited neutralizing abs against the virus. in this study, the s450-650 fragment was expressed in e. coli and used as ag in an elisa system for detection of anti-s abs. restriction enzymes and t4 ligase were from invitrogen (usa). a kit for dna extraction and purification was from qiagen (hilden, germany). e. coli strains of bl21 (oe3) and dh5␣ were obtained from novagen (germany) and invitrogen (usa), respectively. complementary dna encoding full length s of sars-cov was a gift from china cdc. from march 24, 2003, a major outbreak of sars had taken place in beijing, china. we collected sequential blood samples (297 samples in total) from 122 patients (both sexes, 18-51 years of age, average 35.5 years), admitted to the first affiliated hospital of peking university, beijing, china between 15th april and 5th june, 2003. all patients fulfilled the who definition of probable sars (fever 38 • c or higher, cough, new pulmonary infiltrates on chest radiography in the absence of an alternative diagnosis to explain the clinical presentation). the blood samples were processed within 18 h of collection. all patient sera were tested for anti-sars-cov igg abs using an elisa kit produced by huada institute (see below). a total of 45 serum samples from 18 patients, randomly selected from the above patient group, were tested using our s450-650-based elisa kit. in addition, sera from 100 healthy blood donors (both sexes, 22-45 years of age, collected between may and july 2002) were provided by beijing red cross blood center. a small outbreak of sars took place in april 2004 involving nine patients in anhui and beijing, china. sequential serum samples from four of the confirmed patients (second or third generation cases), admitted to ditan hospital between 15th april and 10th june 2004, were also included in this study. dna coding for s450-650 of sars cov s protein was pcr amplified using high fidelity taq dna polymerase (takara biotech co. ltd., japan). the sequences of the primers employed in the pcr reaction were s450-650 5: cgc gga tcc atg ccc ttt gag aga gac ata tct (forward primer, carrying a bamhi restriction site) and s450-650 3: ccc gaa ttc tta aat gtc gca ctc ata aga agt g (reverse primer, carrying an ecori site). the pcr product was gel-purified and cloned into expression vector pet-28a (novagen, germany). the resultant construct, pet28a-s450/650, encodes for the s450-650 fragment with a histidine (his) tag (6 his) at the n terminus. dna sequence of the insert was determined and compared with the s gene sequence of sars-cov strain urbani (accession number ay278741) using dnastar software. pet28a-s450/650 was transformed into e. coli bl21 cells for expansion. a bacterial colony harboring the plasmid was inoculated into 2yt medium containing kanamycin (25 g/ml) and cultured, with continuous shaking, at 37 • c to appropriate density. isopropyl-␤-d-thiogalactopyranoside (iptg) was then added to a final concentration of 0.1 mm to induce the expression of the recombinant protein (for further 3.5 h). after centrifugation at 4000 × g for 15 min, the pellet was resuspended in pbs and subjected to sonication in an ice bath for 30 min. the inclusion bodies were solubilized with 8 m urea, after centrifugation at 12000 × g at 4 • c for 30 min, the supernatant was applied to an equilibrated ni column (novagen, germany). after on-column refolding procedure, proteins bound to the column were eluted with 800 mm imidazole in tris-buffered saline (ph 7.9). the eluted fractions were examined by sds-page and the proteins were either stained with coomassie blue or transferred to nitro-cellulose membrane for wb assays. the nitro-cellulose membranes, on which protein bands had been transferred, were blocked at room temperature for 2 h with block solution (5% non-fat dry milk) and then incubated for 2 h at room temperature with serum sample. after washing in tris-buffered saline (tbs, ph 8.0) containing 0.05% tween 20, the membranes were incubated with hrp-labeled goat anti-human igg ab (zhongshan biotech co., china). 3,3 -diaminobenzidine tetrahydrochloride (dab, sigma) was used to visualize the reaction. elisa plates (nunc, demark) were coated at 4 • c overnight with recombinant protein (2.5 pmol/well) in carbonate buffer (ph 9.6). immediately before use, the coated plates were incubated with blocking solution (2% bsa in pbs) for 2 h at 37 • c and then washed 4 times with pbs containing 0.05% tween 20 (pbs-t). serum samples (1/100 diluted, 100 l/well) were added in triplicate and incubated for 90 min at 37 • c. after washes with pbs-t, horseradish peroxidase (hrp)-labeled goat anti-human igg ab was added and incubated for 1 h at 37 • c. ortho-phenylenediamine (opd) substrate was used (100 l/well) as substrate with 2 m h 2 so 4 solution as stop buffer. the optical density (od) was immediately read at 492 nm. for elisas using the kit produced by huada institute (beijing, china), the manufacturers' instruction was followed. briefly, dilution buffer (100 l/well) was added to pre-coated wells followed by 10 l serum and incubated for 30 min at 37 • c. after washes, hrp-labeled detection ab (1/2000 diluted) was dispensed (100 l/well) and incubated for 20 min at 37 • c before further washes. substrate buffer containing abts [2,2 -azino-di-(3-ethylbenzo-thiazoline sulfonate)] was then added and allowed to develop for 10 min. after stop buffer was added and the plates were read at 450 nm. all experiments describe here have been repeated at least three times. results obtained using s450-650 recombinant protein-based elisa and sars-cov-specific kit were compared using the correl module of microsoft excel software. the cohen kappa test was performed to analyze the agreement between the results of the two elisa kits using spss software. complementary dna encoding s450-650 of sars-cov was cloned into expression vector pet-28a for expression in e. coli bl21. the his-tag-containing recombinant protein was purified to more than 95% homogeneity using a ni column. sds-page analysis of the affinity purified product revealed protein band of expected molecular weight (fig. 1) . in wb assays, convalescent serum from a sars patient (pt-lx) and anti-his-tag mab specifically recognized the recombinant s450-650 (fig. 1) . in the subsequent study, recombinant s450-650 was employed as coating ag for an elisa kit with hrp-labeled goat-anti-human igg abs as secondary ab. checker-board titration experiments were carried out to optimize the concentration of the coating ag (s450-650) and secondary ab (data not shown). a sars-cov-specific elisa kit, developed by huada institute, beijing, china, has been licensed by the ministry for public health of china. it employs the lysate of sars-covinfected vero-e6 cells as coating ags and has been widely used in china for sars-cov-specific ab testing with reliable results. by using the huada kit, we analyzed sequential serum samples (total 297 sera) from 122 hospitalized patients with probable sars and the results are summarized in table 1 . half of the patients seroconverted for igg abs against sars-cov by day 14 after the onset of illness. nearly 90% of them produced virus-specific serum abs by days 29-50. sera from three convalescent sars patients and two healthy individuals were serial diluted and tested in the s450-650-based elisas, which detected anti-s igg abs in a specific and sensitive manner, with the reactivity end point from 1:400 to 1:800 diluted patient sera (fig. 2) . serum samples from 100 healthy blood donors were subsequently screened and none of them was positive (fig. 3a) , suggesting a high specificity for the s450-650-based system. when sequential serum samples (45 total, 1/100 diluted) from 18 patients (randomly selected from the abovementioned 122 patient set) with probable sars were analyzed using the s450-650-baesd assays, 33 were positive (fig. 3b) . the huada kit detected anti-viral igg abs in 32 out of the 45 samples (fig. 3c) , 29 of which were positive in both assays. when the s450-650-based and virus-based elisa results were plotted against each other, a linear correlation (first degree regression, r = 0.75) was observed (fig. 4) , fig. 2 . sensitivity of the s450-650-based elisa. elisa plates were coated with recombinant s450-650. serum samples from 3 convalescent sars patients ( , ♦, ) and 2 healthy individuals ( , ) were serial diluted and dispensed, in triplicates, into the wells. hrp-labeled goat anti-human igg was used as secondary ab with opd as substrate. the results are expressed as absorbance reading at 492 nm wavelength. fig. 3 . comparison of s450-650-based and virus-based elisa results. the s450-650-based elisa kit was used to screen serum samples from (a) 100 healthy blood donors and (b) 18 patients (pt01 to pt18, collected between 10 and 42 days from the onset of illness) with probable sars. the serum samples were 100 folds diluted, results are expressed as absorbance reading at 492 nm wavelength. cutoff value was 0.46. elisa results obtained with the huada kit are shown in (c) for comparison. in this case, serum samples were 10 folds diluted, results are expressed as absorbance reading at wavelength of 450 nm. cutoff value was 0.139. each bar represents one serum sample, samples from each patient were group together in the order of collection time (days) after onset of illness. the cohen kappa test also confirmed an agreement between them (κ = 0.8). time courses of igg responses against the s protein and the whole virus in 7 out of the 18 patients are compared in fig. 5a and b. sera from patients pt01, pt02 and pt08 contained high titer anti-s but low titer anti-virus igg abs. in contrast, patient pt03 was a high responder against the whole virus but low responder against s450-650. patient pt03 seroconverted 36 days after the onset of symptoms, suggesting a possible case of sars-cov infection being acquired in the hospital ward. patient pt05 remained negative in both tests 2 months after the onset of illness and was eventually excluded as a sars patient. both the s450-650-based and the virus-based elisa kits were employed to screen sera from an additional 4 sars patients infected in april 2004. three of them were high responders against the s protein, while the other one (pt19) responded poorly to s450-650 but strongly to the whole virus ( fig. 5c and d) . in patient pt22, anti-s serum abs appeared earlier than that specific for other viral proteins. specific and sensitive detection methods for anti-viral abs in patient sera are of great value in diagnosis as well as research. virus-based assays have the advantage of being able to detect abs specific for all structural components of the virus. on the other hand, recombinant protein-based tests would allow analysis of anti-viral humoral immunity in much detail. the s protein of sars-cov is heavily glycosylated and contains many disulfide bonds (spiga et al., 2003; krokhin et al., 2003; tripet et al., 2004; ying et al., 2004) . it is difficult, however, to obtain s glycoprotein expressed in eukaryotic systems, which would otherwise be ideal for detection of anti-s abs in vitro. full-length s protein expressed in prokaryotic systems is often insoluble and therefore unsuitable as coating ag in elisa systems. our on-column refolding procedure allowed correct formation of some of the disulfide bonds in the s450-650 fragment, producing soluble recombinant protein at a reasonably high concentration (data not shown). results reported herein indicate that the s450-650-based elisa can detect anti-s abs in patient sera with high sensitivity and specificity. it has been suggested that the n-glycans of the s glycoprotein could have a significant effect on its antigenicity, as the presence of n-glycans contributes to the correct folding and biological function of glycoproteins. however, recently published results indicate that bacterial expressed fragment of the s protein (non-glycosylated) could maintain its antigenicity (zhou et al., 2004; lu et al., 2004) . in addition, neutralizing abs were successfully raised in mice after immunization using prokaryotically expressed s485-625 of sars-cov (zhou et al., 2004) . in this study we wound that most sars patients developed strong igg responses against the s glycoprotein of sars-cov. some of them had anti-s abs in significantly higher titer than that against other structural proteins of the virus (e.g. pt01 and pt08). in this situation, our s protein-based elisa would be more sensitive than the virus-based assays in detecting antiviral abs. there were also cases where the s450-650 was poorly recognized by abs in patient sera (e.g. pt22 in fig. 4c and d). it should be emphasized, however, that the s450-650 polypeptide covers less than 1/5 of the s protein sequence. a negative result such as this does not rule out possible presence of anti-s abs against epitopes outside the 450-650 region of the s protein. moreover, xu et al. (2004) have reported relatively high frequency of variations in s gene of sars-cov. natural variability in the s protein might also affect the validity of the s450-650-based elisa, although antigenic variation in s450-650 has not yet been fully characterized. amino acids 270 to 510 of the severe acute respiratory syndrome coronavirus spike protein are required for interaction with receptor antibody detection of sars-cov spike and nucleocapsid protein the secret life of ace2 as a receptor for the sars virus development of a western blot assay for detection of antibodies against coronavirus causing severe acute respiratory syndrome antigenicity and receptor-binding ability of recombinant sars coronavirus spike protein mass spectrometric characterization of proteins from the sars virus: a preliminary report angiotensin-converting enzyme 2 is a functional receptor for the sars coronavirus immunological characterization of the spike protein of sars-coronavirus the genome sequence of the sars-associated coronavirus coronavirus as a possible cause of severe acute respiratory syndrome characterization of a novel coronavirus associated with severe acute respiratory syndrome molecular modeling of s1 and s2 subunits of sars coronavirus spike glycoprotein potent neutralization of severe acute respiratory syndrome (sars) coronavirus by a human mab to s1 protein that blocks receptor association profiles of antibody responses against severe acute respiratory syndrome coronavirus recombinant proteins and their potential use as diagnostic markers structural characterization of the sars-coronavirus spike s fusion protein core expression cloning of functional receptor used by sars coronavirus a 193-amino acid fragment of the sars coronavirus s protein efficiently binds angiotensinconverting enzyme 2 relative rates of non-pneumonic sars coronavirus infection and sars coronavirus pneumonia early detection of antibodies against various structural proteins of the sars-associated coronavirus in sars patients the sars-cov s glycoprotein: expression and functional characterization sars-associated coronavirus quasispecies in individual patients proteomic analysis on structural proteins of severe acute respiratory syndrome coronavirus an exposed domain in the severe acute respiratory syndrome coronavirus spike protein induces neutralizing antibodies the first two authors contributed equally to this work. key: cord-307602-2cmgu7rf authors: mcerlean, p.; shackelton, l.a.; lambert, s.b.; nissen, m.d.; sloots, t.p.; mackay, i.m. title: characterisation of a newly identified human rhinovirus, hrv-qpm, discovered in infants with bronchiolitis date: 2007-05-07 journal: j clin virol doi: 10.1016/j.jcv.2007.03.012 sha: doc_id: 307602 cord_uid: 2cmgu7rf background: human rhinoviruses (hrvs) are some of the earliest identified and most commonly detected viruses associated with acute respiratory tract infections (artis) and yet the molecular epidemiology and genomic variation of individual serotypes remains undefined. objectives: to molecularly characterise a novel hrv and determine its prevalence and clinical impact on a predominantly paediatric population. study design: nucleotide sequencing was employed to determine the complete hrv-qpm coding sequence. two novel real-time rt-pcr diagnostic assays were designed and employed to retrospectively screen a well-defined population of 1244 specimen extracts to identify the prevalence of hrv-qpm during 2003. results: phylogenetic studies of complete coding sequences defined hrv-qpm as a novel member the genus rhinovirus residing within the previously described hrv-a2 sub-lineage. investigation of the relatively short vp1 sequence suggest that the virus is resistant to pleconaril, setting it apart from the hrv a species. sixteen additional hrv-qpm strains were detected (1.4% of specimens) often as the sole micro-organism present among infants with suspected bronchiolitis. hrv-qpm was also detected in europe during 2006, and a closely related virus circulated in the united states during 2004. conclusions: we present the molecular characterisation and preliminary clinical impact of a newly identified hrv along with sequences representing additional new hrvs. acute respiratory tract infections (artis) are a leading cause of human morbidity worldwide and are most frequently viral in origin. many newly identified viruses have recently been associated with arti, including human metapneumovirus (hmpv; van den hoogen et al., 2001) , human coronaviruses (hcov) nl63 (van der hoek et al., 2004) and hku1 (woo et al., 2005) , human bocavirus (hbov; allander et al., 2005) and the ki and wu polyomaviruses (allander et al., 2007; gaynor et al., 2007) . human rhinoviruses (hrvs) are the most common infectious agents associated with artis, comprising the largest genus of human pathogens, rhinovirus, in the family picornaviridae. despite a significant and growing body of evidence to implicate hrvs in more serious clinical outcomes (gern and busse, 1999; hayden, 2004) , the presence and role of more than 100 genetically and serologically distinct hrvs in illness is often unexplored. additionally, the viruses themselves are not considered to be individual entities with distinct circulation patterns as other respiratory viruses are. studies have produced unusual hrv-like sequences or made cursory reports of untypeable or variant hrv strains in the united kingdom (mori and clewley, 1994) , switzerland (deffernez et al., 2004) , finland (savolainen et al., 2002) , belgium (loens et al., 2006) , australia (arden et al., 2006) and the united states (lamson et al., 2006) . many of these strains may represent novel hrv serotypes. during an investigation of picornavirus pcr products we identified a cluster of more than 30 nucleotide sequences demonstrating <20% identity with any sequence on genbank (arden et al., 2006) . we proposed that these belonged to a novel genetic sub-lineage, hrv-a2. we further investigated one of these putative viruses and herein present the complete polyprotein coding sequence of a novel hrv, hrv-qpm, which was first detected in an infant with bronchiolitis. clinical specimens (n = 1244) were predominately nasopharyngeal aspirates (npa; 92%) collected from patients (52.9% male) aged between 1 day and 80 years (mean age 9.2 years, median age 1.3 years) who had presented to queensland hospitals or general practitioners with symptoms of arti during 2003. npas and purified nucleic acid extracts were stored at −70 • c. extracts were tested by rt-pcr (onestep, qiagen ® ) for hmpv, hrvs and enteroviruses (hevs), all four non-sars hcovs, hbov, respiratory syncytial virus (hrsv), influenza a and b viruses, parainfluenzaviruses and human adenoviruses (arden et al., 2006) . real-time rt-pcr employed 0.2-0.4 pmol of oligonucleotide. amplicons were purified when necessary and both strands sequenced (big dye v3.1, applied biosystems). real-time rt-pcr was performed on the rotor-gene tm 3000 (corbett research). first strand cdna synthesis (transcriptor rt, roche) using (t) 17 ata or gene specific primers was followed by second strand synthesis and amplification (platinum ® pfx, invitrogen). oligonucleotide sequences are available upon request. human cell lines (hela-ohio, a549, mrc-5 and wi-38) were inoculated with patient respiratory secretions stored at −70 • c. inoculated cells were rolled at 33 • c, watched daily for cytopathic effect and hrv-qpm rna levels were monitored by real-time rt-pcr. nucleotide or amino acid sequences were aligned with the program muscle (edgar, 2004 ) and, where necessary, backtranslated with the program protogene (moretti et al., 2006) . maximum likelihood trees were constructed using a gtr + i + 4 model of nucleotide substitution in paup* (swofford, 2003) , with outgroups as indicated. trees were visualized with treeedit (http://evolve.zoo.ox.ac.uk/software.html). the nucleotide distance matrix for neighbour-joining trees was generated using the kimura two-parameter estimation in mega 3.1 (kumar et al., 2004) . nodal confidence values indicate the results of bootstrap resampling (n = 1000). initial hrv-qpm sequences were used to design new pcr primers permitting determination of the continuous coding sequence from overlapping fragments, bracketed by partial untranslated regions (utrs). additional primers from hrv (loens et al., 2006) and hev (caro et al., 2001; oberste et al., 2004; simmonds and welch, 2006 ) studies supplemented the process. to confirm that our primary sequence belonged to a distinct virus and was not the result of mixed template in the patient's specimen, a second round of rt-pcr and sequencing of overlapping fragments was performed using newly designed hrv-qpm-specific primers targeting rna from the original specimen extract. discrepant sequence results were confirmed by a third round of rt-pcr and sequencing. to determine whether hrv-qpm was a distinct pathogen endemically circulating in brisbane, 1244 specimen extracts spanning all of 2003 were examined (fig. 1) . hrv-qpm 1b rna was detected in 1.4% (n = 17) of extracts by real-time rt-pcr and verified using a confirmatory assay targeting the 1d region. hrv-qpm prevalence peaked in winter but was also detected in spring and summer. no other micro-organisms were detected in 64.7% (n = 11) of positives (table 1 ). there were six co-detections with: hcov-nl63, hcov-nl63 and hbov, hbov, hmpv or hcov-229e. overall respiratory picornaviruses were the most frequently detected micro-organisms at 41.0% of microbial detections (n = 346) followed by hbov (12.0%, isolation of hrv-qpm was unsuccessful due to the age of the inoculum or perhaps because the hrv-a2 viruses are particularly fastidious. clinical information from the 10-month-old male index case (yielding hrv-qpm strain 001) revealed bronchiolitis following a 5-day history of rhinorrhoea, cough and respiratory distress. there were no fevers vomiting or diarrhoea noted. the infant had an audible wheeze with scattered crackles in both lung fields, right otitis media and pharyngitis. the chest x-ray showed bilateral patchy changes, worse in the right mid zone, consistent with a non-specific viral lower respiratory infection (lrti). the infant responded to nebulised ventolin and oral prednisolone and was discharged after a 48 h admission. clinical details from the other hrv-qpm positive cases demonstrated the following presenting symptoms and signs: rhinorrhoea, fever, cough and wheeze, with diagnoses including asthma and bronchiolitis, consistent with arti. eight (47.1%) of 17 positive patients presented with indications of lrti, most commonly presenting as bronchiolitis (5/8), wheezing (2/8) and one case suspected of pertussis (pcr negative) each in the absence of another micro-organism (table 1 ). the only two adult cases had underlying conditions. analysis of the deduced nucleotide sequence suggested hrv-qpm was a putative new member of the genus rhinovirus. the polyprotein coding sequence spanned 6429 nt; shorter than all other reported hrvs and hevs (lukashev et al., 2005; oberste et al., 2004; genbank #ef186077) . predicted protease cleavage sites, similar to other picornaviruses, were also identified with the unconfirmed division of the polyprotein into typical picornavirus structural (vp1-4) and non-structural proteins (2a-c and 3a-d; netpicorna world wide web server, blom et al., 1996; skern et al., 1985; stanway et al., 1984) . a highly conserved translation initiation site (mgaqvs) shared with other hrvs and hevs was also identified. a striking feature of the hrv-qpm genome was its deviation from all other sequenced members of the hrv-a species. members of hrv-a1 (represented by the complete coding sequences of serotypes 1b, 2, 16, 39 and 89) shared 71.6-85.5% predicted amino acid identity while hrv-qpm, the sole hrv-a2 coding sequence to date, shared 50.8-51.9% identity with hrv-a1 and 46.8% with hrv-b (serotype 14). given the extensive recombination observed in other picornaviruses (lukashev et al., 2005; simmonds and welch, 2006) , we next investigated the possible role of recombination in the emergence of hrv-qpm. phylogenies of multiple, distinct hrv polyprotein regions gave no indication of recombination involving hrv-qpm (data not shown), similar to recent findings (simmonds and welch, 2006) . the paucity of full-genome hrv sequences, however, is a limitation in these analyses. a number of further investigations were undertaken to confirm that hrv-qpm was neither a strain of an existing hrv serotype nor an artefact of pcr amplification or sequencing. the complete 1a, 1b and 1d regions (putatively encoding cleavage products vp4, vp2 and vp1) of all 17 hrv-qpm strains (001-017) were sequenced and compared to representative hrvs and hevs (fig. 2) . strains exhibited >96% nucleotide identity. these analyses confirmed that hrv-qpm exists as a novel genetic sub-lineage within the hrv-a species. data were obtained from the full vp1 sequences presented in fig. 3 . a minimum to maximum amino acid identity shared between hrv-qpm and the established hrv and hev serotypes. vp1 is the predominant viral surface protein and the common target both for serotyping and genotyping studies (oberste et al., 1999) and the development of antiviral agents (ledford et al., 2004 (ledford et al., , 2005 . complete vp1 sequences from all known hrv and hev serotypes were available for comparison to the prototype strain of hrv-qpm, 001. these data further confirmed that hrv-qpm was similar but distinct from other known hevs and hrvs ( fig. 3a and b and table 2 ) most likely representing a novel serotype within the hrv-a species. importantly, the putative hrv-qpm vp1 is 6-22 amino acids shorter than that of any other hrv serotype because of several deletions. additional in silico studies predicted that infection by hrv-qpm is not likely to respond to treatment with the capsid binding antiviral, pleconaril. to date all other members of the hrv-a species have proven susceptible to this antiviral compound. two amino acids reportedly conserved among all hrv-b viruses (ledford et al., 2004) , were altered in the hrv-qpm vp1 sequence (fig. 4) . using the amino acid numbering system from our study, the hrv-qpm-specific changes were tyr 152 to phe and a hydrophilic thr in place of a hydrophobic val 191 or leu 191 . changes at position 152 and 191 are implicated in complete resistance to the antiviral among naturally occurring hrv-b species (ledford et al., 2005) . a review of sequences located on genbank and in the literature reveals that variants and incompletely characterised hrvs have been noted over many years. most pcr-based hrv studies have targeted the 5 -utr region for nucleotide sequencing of these variants but this region's use as a discriminator of serotype is hindered by the paucity of complete utr sequences available both from known serotypes and hrv variants. the sequences encoding vp4/vp2 and vp1 have proven more reliable for genotyping and are comparable to serotyping (laine et al., 2005; ledford et al., 2004) . a recent study found sequences in belgium (sampled in 1998-1999) which appear to be related to hrv-qpm in the vp4 region (loens et al., 2006) . in collaboration with other investigators in western europe, we searched small numbers of specimens for hrvfig. 4 . alignment of predicted vp1 amino acid sequences hrv-qpm and hrv-a (hrv-1a, 16, 82 and 98) and hrv-b (hrv-5, 14,2 and 42) species. numbering based on the hrv-qpm sequence (ef186077). the 25 residues of the pleconaril binding pocket are arrowed (majority hrv-b amino acid sequence listed below each arrow, ledford et al., 2005) . two regions, indicated by overhead lines, appeared to be absent in hrv-qpm when compared with all other hrv vp1 sequences on genbank (representative data shown here). two residues predicted by ledford to convey complete antiviral resistance to natural hrv-b strains (e.g. in hrv-5 and 14) are indicated by stars. residues identical to hrv-qpm are indicated by dots. the absence of a residue is indicated by a dash. qpm and were able to identify the virus in one country, with a similar prevalence, during its peak 2006 respiratory virus season (data not shown). we were unable to find hrv-qpm in the netherlands (specimens from 2002/2003 and 2004/2005) in new south wales, australia (2006 ) or in new zealand (2001 . however, a very similar virus was circulating in new york during 2004 (fig. 5) . together, these results suggest that hrv-qpm is not a geographically isolated hrv but one circulating globally. in this study, we have described the detection and distinguishing features of a newly identified hrv together with a summary of its clinical impact on a predominantly paediatric population. hrv-qpm was identified by intensively investigating 1 of more than 30 picornavirus-like sequences obtained during a previous study. in the present study we tested a well characterised set of respiratory specimens, mainly from children, and showed the virus to be present in 1.4% of them, with monthly detection frequencies as high as 5.0% in august and 4.2% in february. hrv-qpm was associated with a variety of clinical syndromes involving mild to severe illness, including a strong linkage with bronchiolitis in the absence of other detectable pathogens. our findings add to recent data about the largely unrecognised diversity of hrv and their importance in clinical illness, in particular, lrti. we found that approximately half of all hrv-qpm detections were from patients with lrt symptoms in whom hrv-qpm was the sole micro-organism detected, suggesting that this hrv at least is associated with more serious illness. detailed prospective clinical studies will be required to compare the prevalence of hrv-qpm in other ill populations and in suitably matched control groups without symptoms. detections of hrv-qpm in europe and a closely related virus in new york suggest that hrv-qpm is not a geographically isolated hrv but a global respiratory pathogen. a small, preliminary study of local specimen extracts collected during other years did not find any additional hrv-qpm strains. this is the first molecular epidemiology study to address the annual prevalence of an individual hrv and these findings may be suggestive of the nature of all hrv serotypes. immunity resulting from infection may protect a particular community from a certain serotype until a suitably large naïve community, either due to increasing numbers of non-immune infants and young children or adults with waning immunity, is available to again facilitate that serotype's unfettered infection and transmission. this period may encompass several years. it will be important to carry out future 'hrv-hunting' studies over many respiratory seasons to maximise the number of new viruses detected, overcome the restricting effects of herd immunity and better identify the length of time between cycles of infection for each hrv. since their discovery in the 1950s, infection by hrvs has been synonymous with the 'common cold' and, despite reports of association with more serious clinical outcomes (gern and busse, 1999; hayden, 2004; kaiser et al., 2006) , these viruses are still considered to be of minor clinical significance by many. consequently, the genus rhinovirus has been poorly characterised by modern standards; only six unique genomes from over 100 hrv serotypes currently reside on genbank. the paucity of sequence data undoubtedly parallels our understanding of individual serotypes. in a time when molecular diagnostics are considered the gold standard, a lack of sequence reduces our detection capabilities and therefore limits our understanding of the seasonal distribution and recurrence of each serotype. in turn, this has perpetuated the concept that the genus is a collection of "just rhinoviruses" rather than a large number of individual viruses each worthy of detailed characterisation. detailed studies of hrv-qpm and related hrv-a2s may now determine if this novel group represents a recently emerged global subset of hrvs that are more frequently associated with clinically severe respiratory outcomes or a previously unidentified viral group that has been circulating for many years. these and future findings will hopefully invigorate research into the genomics and epidemiology of these long ignored and clinically important respiratory viruses. identification of a third human polyomavirus cloning of a human parvovirus by molecular screening of respiratory tract samples frequent detection of human rhinoviruses, paramyxoviruses, coronaviruses, and bocavirus during acute respiratory tract infections cleavage site analysis in picornaviral polyproteins: discovering cellular targets by neural networks molecular strategy for 'serotyping' of human enteroviruses amplicon sequencing and improved detection of human rhinovirus in respiratory samples identification of a novel human polyomavirus from patients with acute respiratory tract infections association of rhinovirus infections with asthma rhinovirus and the lower respiratory tract chronic rhinoviral infection in lung transplant recipients mega3: integrated software for molecular evolutionary genetic analysis and sequence alignment phylogenetic analysis of human rhinovirus capsid protein vp1 and 2a protease coding sequences confirms shared genus-like relationships with human enteroviruses masstag polymerase-chain-reaction detection of respiratory pathogens, including a new rhinovirus genotype, that caused influenza-like illness in new york state during insights into the genetic basis for natural phenotypic resistance of human rhinoviruses to pleconaril vp1 sequencing of all human rhinovirus serotypes: insights into genus phylogeny and susceptibility to antiviral capsid-binding compounds detection of rhinoviruses by tissue culture and two independent amplification techniques, nucleic acid sequence-based amplification and reverse transcription-pcr, in children with acute respiratory infections during a winter season recombination in circulating human enterovirus b: independent evolution of structural and non-structural genome regions protogene: turning amino acid alignments into bona fide cds nucleotide alignments polymerase chain reaction and sequencing for typing rhinovirus rna molecular evolution of the human enteroviruses: correlation of serotype with vp1 sequence and application to picornavirus classification enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses genetic clustering of all 102 human rhinovirus prototype strains: serotype 87 is close to human enterovirus 70 frequency and dynamics of recombination within different species of human enteroviruses human rhinovirus 2: complete nucleotide sequence and proteolytic processing signals in the capsid protein region the complete nucleotide sequence of a common cold virus: human rhinovirus 14 a newly discovered human pneumovirus isolated from young children with respiratory tract disease characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia this work was supported by nhmrc project grant 455905 and the royal children's hospital foundation grants 912-011 and 922-202 sponsored by the woolworth's fresh futures programme. we are grateful to dr. lia van der hoek and dr. eric c.j. claas (the netherlands), dr. william rawlinson (nsw, australia) and dr. lance jennings (new zealand) for local hrv-qpm testing. we thank queensland heath pathology service for the provision of clinical specimens. key: cord-269519-8hr8wyrr authors: hirotsu, yosuke; maejima, makoto; shibusawa, masahiro; amemiya, kenji; nagakubo, yuki; hosaka, kazuhiro; sueki, hitomi; mochizuki, hitoshi; tsutsui, toshiharu; kakizaki, yumiko; miyashita, yoshihiro; omata, masao title: analysis of covid-19 and non-covid-19 viruses, including influenza viruses, to determine the influence of intensive preventive measures in japan date: 2020-07-07 journal: j clin virol doi: 10.1016/j.jcv.2020.104543 sha: doc_id: 269519 cord_uid: 8hr8wyrr background: severe acute respiratory coronavirus 2 (sars-cov-2) has spread and caused death worldwide. preventive measures and infection control are underway, and some areas show signs of convergence. other viruses in addition to sars-cov-2 cause cold-like symptoms and spread in the winter. however, the extent to which sars-cov-2, influenza viruses and other causative viruses have prevailed since implementing preventive measures is unclear. objectives: we aim to investigate the incidence of causative viruses and pathogens in patients. study design: we collected 191 nasopharyngeal swabs from patients with cold-like symptoms in japan. all samples were subjected to multiplex pcr with the filmarray respiratory panel and reverse transcription pcr (rt-pcr) to detect sars-cov-2. results: filmarray respiratory panel analysis detected at least one virus in 32 of 191 patients with cold-like symptoms (21%). of these, we frequently identified human rhinoviruses/enteroviruses (5.8%, n=11), human metapneumovirus (3.7%, n=7), coronavirus 229e (2.1%, n=4) and coronavirus oc43 (1.6%, n=3); while no influenza viruses were detected. rt-pcr analysis detected sars-cov-2 (4.2%, n=8) in patients who were not infected with the aforementioned respiratory viruses. conclusions: co-infection with sars-cov-2 and other viruses was not observed. causative viruses remain prevalent after implementing preventive measures. sars-cov-2 differs from influenza viruses in its infectivity. this is a pdf file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. this version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. the new emergent coronavirus, severe acute respiratory coronavirus 2 (sars-cov-2), broke out in wuhan, china [1] . the virus immediately spread worldwide, causing many covid-19 cases and deaths. sars-cov-2 resides in the upper respiratory tract and spreads via droplets from coughing or sneezing. the world health organization recommends washing hands with soap, maintaining social distancing, and avoiding crowded places to prevent the j o u r n a l p r e -p r o o f spread of viral infections [2] . in addition to these preventive measures, most countries recommend travel restrictions and curfews. influenza viruses, rhinoviruses, adenoviruses, coronaviruses (229e, oc43, nl63 and hku1) and the human metapneumovirus cause common cold-like symptoms [3] . of these viruses, influenza viruses are an annual epidemic in the winter. owing to the development of treatments and vaccines, the mortality rate from influenza viruses is low. in december 2019, the sars-cov-2 outbreak coincided with the influenza viral epidemic. seasonal influenza activity in japan was lower in 2020 than in previous years [4] . however, whether sars-cov-2 is more infectious than other viruses remains unknown. here, we performed genetic analyses to determine which viruses were spreading in the japanese population. this epidemiologic study shows the infectability of each virus after implementing social preventive measures against sars-cov-2. we studied 191 patients exhibiting cold-like symptoms from 10 march 2020 to 7 may 2020 in our district 100-150 km west of tokyo, japan. nasopharyngeal samples were collected from all patients using cotton swabs and universal transport media (copan, murrieta, ca, usa). the institutional review board at yamanashi central hospital approved this study and the use of an opt-out consent method (g-2019-1). the requirement for written informed consent was waived. participation in the study by patients was optional. to analyze the viral species related to patients' respiratory diseases, we performed multiplex pcr targeting 17 viruses and three bacterial species using the filmarray respiratory panel (biomérieux, marcy-l'etoile, france) per the manufacturer's instructions. briefly, buffer and 300 μl from the nasopharyngeal swab were injected into the filmarray pouch. the reaction proceeded automatically on the filmarray torch system. the limit of detection was listed as previously reported (table 1 ) [5] . the total nucleic acid was automatically isolated from the nasopharyngeal swabs using the magmax viral/pathogen nucleic acid isolation kit (thermo fisher scientific, waltham, ma, usa) on kingfisher duo prime (thermo fisher scientific) as previously described [6, 7] . to detect sars-cov-2, we performed rt-pcr as previously described [7, 8] . the rt-pcr assays were conducted on a steponeplus real-time pcr system with the following j o u r n a l p r e -p r o o f cycling conditions: 50°c for 5 min for reverse transcription, 95°c for 20 s, and 45 cycles of 95°c for 3 s and 60°c for 30 s. the threshold cycle (ct) value was assigned to each pcr reaction, and the amplification curve was visually assessed. of 191 patients, 32 (17%) were infected at least one causative virus, including human rhinovirus/enterovirus (n=11), human metapneumovirus (n=7), coronavirus 229e (n=4), coronavirus oc43 (n=3), adenovirus (n=2), respiratory syncytial virus (n=2) and coronavirus nl63 (n=1) ( table 2 ). two patients were simultaneously infected with two viruses each, one with adenovirus and human rhinovirus/enterovirus and one with adenovirus and human metapneumovirus ( table 2) (figure 1) . thus, the sars-cov-2 infection prevalence was 4%, while the influenza viral prevalence was 0% in this cohort ( figure 1 ). this comparative analysis suggests that sars-cov-2 was much more infectious than the influenza viruses were under the same conditions in the same region. the respiratory panel detected that 17% of the cohort (32/191 patients) were infected with causative viruses. seven viral species were detected, none of which were influenza viruses. at the start of the coronavirus epidemic, the infectivity of sars-cov-2 was unknown compared to that of influenza viruses. our data implies that influenza viral spread would be suppressed under the preventive measure. this study evaluated the differences in infectivity between sars-cov-2 and influenza viruses. infection prevention measures, such as handwashing and mask wearing, led to fewer influenza infections [9] . mask wearing is a common practice among japanese in the winter. after japanese government announced on the citizen to take preventive measures, "behavioural changes" (i.e. avoid crowded places, wearing a mask, handwashing with soap and hand sanitizers) were as clearly observed at the end of march [10] . sakamoto et al. analyzed epidemiological data from 2014-2020 and showed that the number of seasonal influenza cases was lower in 2020 than in previous years in japan [4] . these observations along with the current results suggest different infectious activity levels between seasonal influenza viruses and sars-cov2. we revealed the infection rate of respiratory viruses as well as sars-cov-2 (table 2) . recent study showed surgical mask is important to prevent viral shedding [9] . in particular, detection rate of common coronavirus and influenza virus decreased in droplet and aerosol after waring mask, but less effective for rhinovirus [9] . concordant with these results, our data showed highest infection rate is caused by the rhinovirus / enterovirus. although this was a prospective study, there were limitations. first, this study was conducted by a single-center in our district. national registry indicated a marked reduction in influenza viral infections at the end rather than at the beginning of winter [4] , which coincided with our study. second, it needs a comparator group. a retrospective and/or prospective study with data before and after preventive measure against would answer the difference of infectivity among viruses. third, the influenza vaccination status was not investigated. the this study showed that taking stringent measures may prevent influenza viruses, which have more strongly affected human life for a longer time. ethics approval the institutional review board at yamanashi central hospital approved this study and the use of an opt-out consent method. the requirement for written informed consent was waived. patients could refuse to participate in the study. the datasets in the current study are available from the corresponding author upon reasonable request. a novel coronavirus from patients with pneumonia in china world health organization, coronavirus disease (covid-19) advice for the public epidemiology and clinical presentations of the four human coronaviruses 229e, hku1, nl63, and oc43 detected over 3 years using a novel multiplex real-time pcr method seasonal influenza activity during the sars-cov-2 outbreak in japan filmarray, an automated nested multiplex pcr system for multi-pathogen detection: development and application to respiratory tract infection environmental cleaning is effective for the eradication of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) in contaminated hospital rooms: a patient from the diamond princess cruise ship pooling rt-pcr test of sars-cov-2 for large cohort of 'healthy' and infection-suspected patients: a prospective and consecutive study on 1,000 individuals double-quencher probes improved the detection sensitivity of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) by one-step rt-pcr respiratory virus shedding in exhaled breath and efficacy of face masks japanese citizens' behavioral we thank the medical and ancillary hospital staff and the patients for consenting to participate. we thank traci raley, ms, els, from edanz group (https://en-authorservices.edanzgroup.com/) for editing a draft of this manuscript.j o u r n a l p r e -p r o o f key: cord-299664-nexq5ntj authors: butt, s.a.; maceira, v.p.; mccallen, m.e.; stellrecht, k.a. title: comparison of three commercial rt-pcr systems for the detection of respiratory viruses date: 2014-08-18 journal: j clin virol doi: 10.1016/j.jcv.2014.08.010 sha: doc_id: 299664 cord_uid: nexq5ntj background: due to the insensitivity of rapid tests for respiratory viruses, nucleic acid amplification tests are quickly becoming the standard of care. objectives and study design: the performance of the filmarray respiratory panel (rp) and verigene rv+ (rv+) were compared in a retrospective analysis of 89 clinical specimens previously determined to be positive for the following viruses by our test of record, prodesse (pro): influenza a (29, flua), influenza b (13, flub), respiratory syncytial virus (12, rsv), human metapneumovirus (10, hmpv), parainfluenza (14, piv), and adenovirus (10, adv). samples positive for influenza a, b or rsv were tested by both methods, while the remainder were tested by rp only. true positives were defined as positive by two or more assays. results: limit of detection (lod) analyses demonstrated pro had the lowest lod for all flua strains tested, piv1, piv2 and adv; rv+ had the lowest lod for flub; and rp had the lowest lod for rsv, piv3 and hmpv. of the 55 samples tested by rv+, all 54 true positive samples were positive by rv+. of the 89 samples tested by rp, 85 of the 88 true positive samples were positive by rp. from these results, the overall sensitivities for influenza a, b and rsv were 100% and 98% for rv+ and rp, respectively. the overall sensitivity of rp for all viruses was 97%. conclusions: in summary, these systems demonstrated excellent performance. furthermore, each system has benefits which will ensure they will all have a niche in a clinical laboratory. respiratory viruses are major contributors to morbidity and mortality in all age groups [1] [2] [3] [4] . rapid identification is important for both therapeutic and infection control purposes. traditional rapid viral diagnoses such as immunoassays produce quick results and are simple to perform; however, have sub-optimal sensitivity [5] [6] [7] [8] . nucleic acid amplification assays (naat), which are relatively rapid and have greatly enhanced sensitivity, are becoming the method of choice [9] . more recently, less complex sample-toresult molecular platforms such as xpert flu assay (cepheid), rp (biofire diagnostics), rv+ (nanosphere), esensor respiratory viral panel (genmark diagnostic) and liat influenza a/b (iquum) have been introduced into the marketplace which have the potential to specimens, collected between january 2008 and february 2012 and stored at −80 • c, were selected based on results from original testing. samples were paired for differing viruses and tested as two-sample pools. discrepant samples were retested individually, while samples discrepant for adenovirus were refereed by viral culture as previously described [22] . specimens were defined as true positive if they were positive by two or more assays. the nattrol tm rvp verification panel (zeptometrix, buffalo, ny) was used for limit of detection analysis by serial dilution (1:10) in normal human plasma for endpoint detection. viral nucleic acid concentration determinations were based on quantified control viral rna (hologic gen-probe inc., san diego, ca) using pro. the verigene ® rv+ test (nanosphere, northbrook, il) combines conventional pcr with a gold nanoparticle probes detection system. initially, test cartridges, extraction trays, and amplification trays were loaded into processor sp after thawing the amplification trays for 10-30 min. specimen in viral transport (0.2 ml) was added to the extraction tray. automated sample lysing and target amplification of approximately 10% of the lysate was performed on the verigene processor sp as a multiplex assay for the detection of flua, 09h1, sh3, sh1, flub, rsv-a and rsv-b. within 5 min of completion of amplification, the rv+ test cartridge was removed from the processor, opened to release the hybridization slide, which was then inserted into the verigene reader. results were reported "detected" or "not detected" for each target, or a message of "no call" (nc) was reported in the event of assay failure, such as an internal control failure. nc samples were retested to obtain a valid result. the filmarray respiratory panel v1.6 (biofire diagnostics inc., salt lake city, ut), which at the time of the clinical evaluation, was a comprehensive panel for the detection of 15 respiratory viral targets (adv, coronaviruses [cov] hku1 and nl63, flua, 09h1, sh3, sh1, flub, hmpv, human rhinovirus/enterovirus (hrv), piv1-4, and rsv) by real-time pcr. the closed system integrates extraction, amplification, and detection into a simple, hands free test. briefly, 0.3 ml of specimen in viral transport was added to 0.5 ml sample buffer. the filmarray pouch was injected with 0.5 ml of hydration solution and 0.3 ml of the diluted sample. the pouch was inserted into the filmarray and within 70 min results were reported as detected, not detected or invalid for each target. invalid samples were retested to obtain a valid result. in addition, a result of equivocal for flua occurred when only one of the two flua specific targets was amplified. the prodesse assays for respiratory viruses (hologic|gen-probe, san diego, ca) are a series of either multiplex or uniplex, realtime pcr assays, including proflu+ (detects flua, flub and rsv), profast+ (differentiation of 09h1, sh3, and sh1), proadeno+, prohmpv+ and proparaflu+ (differentiates piv1-3). briefly, viral rna was extracted from 0.2 ml of specimen in viral transport, along with a universal internal control, using nuclisens magnetic extraction reagents and the easymag extractor (biomerieux, durham, nc) and eluted to a volume of 50 l. rna extract, 5 l, was amplified on smartcyclers (cepheid, carlsbad, ca) with the appropriate assay as requested for clinical purposes. probit analyses for the limit of detection with a 95% probability of detection were performed using spss version 8.0 (ibm, armonk, ny). the chi-square test was performed using microsoft excel 2013 (redmond, wa). p values of 0.05 were considered statistically significant. confidence intervals (ci) were determined using graph-pad (la jolla, ca). pro had the lowest lod for all flua viruses, while the lod for rv+ was within 0.5 log copies/ml of pro for the 09h1 and sh1, and more than 1 log greater for sh3 (table 1) . rv+ had the lowest lod for flub, but rp had the lowest lod for rsv. the analytical sensitivity was mixed as to whether pro or rp was more sensitive for piv, hmpv and adv. the determination of clinical performance involved 89 specimens previously positive for respiratory viruses by pro including one sample originally positive for sh3 that became negative upon archiving ( table 2 ). the 54 samples positive for flua, flub or rsv and the negative sample were tested by both rp and rv+ as two sample pools. initially, 24 sample pools were positive for the expected viruses by rv+, 1 was positive with 3 viruses, and 3 resulted as no call. the nc pooled samples (6) were retested individually; five additional samples were positive for the expected virus while the sixth was positive for two viruses. the discrepant samples, which involved a pool of a sh1 sample and a sh3 sample additionally positive for 09h1 and a sh3 sample additionally positive for flub, were retested individually. upon repeat each sample was positive only for the expected virus. when testing the same samples with rp, 51 of the 54 positive specimens were positive for the expected virus. one sample from a patient with dual rsv and adv infection was only positive for rsv and one 09h1 sample was equivocal for flua. in addition, one pool was positive for three viruses (an adv sample and a sh3 sample additionally positive for 09h1). again, the samples from this discrepant pool were tested individually. upon repeat each sample was positive only for the expected virus. the additional 33 specimens positive for piv, hmpv or adv were tested with rp, which tp tn fp fn invalid tp tn fp fn invalid 09h1n1 15 14 1 a 1 b 15 1 a sh3n2 12 12 12 1 sh1n1 2 2 2 flu b 1 3 13 13 1 a 3 rsv 11 11 11 2 hmpv 10 detected the appropriate virus in all but one sample positive for adv, for a total adv detection rate of 9/11 adv positive samples. in addition, adv was originally detected in all positive specimens by viral culture. from these findings the sensitivities for flua, b and rsv were 100% and 98% for rv+ and rp, respectively (95% ci = 92.1-100% and 89.3-100%, respectively). this difference in sensitivity was not statistical significance (two-tailed p value = 0.3129). the overall sensitivity of rp for all viruses was 97% (95% ci = 90.1-99.3%). the initial failure rates for these two assays with clinical samples were 10.7% and 0% for rv+ and rp. however, when including the lod analysis, the failure rates were 9.7% and 1%, respectively. all failed results resolved with repeat testing. pro. both systems are designed for on demand testing. the most cumbersome step for both was the test preparation, including sample addition. rp has an extra step of sample dilution, but the hands-on-time (hot) was only 5 min (table 3) . rv+ had the additional steps of thawing for frozen reagents, loading the cartridges and trays, and one return to the instrument post-amplification for cartridge reading, for a total hot of 21 min. pro is more manual, including nucleic acid extraction and amplification reagent preparation, but has higher throughput capabilities. cost analysis demonstrates that rp is the most expensive per test, however there are multiple targets reportable and billable per test, hence the cost/reportable is considerably lower than other methods. since their introduction in 2011, there have been numerous studies regarding the performance of rv+ [10, 15, 23] and rp [11, 12, 14, 24] ; however, only one compared the systems side by side [25] interestingly, in this study both rp and pro demonstrated significantly superior sensitivity for the detection of flua as compared to rv+. hence, it is surprising that in our study the lod for all flua strains tested were much lower with rv+ than rp; and both systems demonstrated excellent sensitivity with clinical specimens. furthermore, van wesenbeeck et al. [25] evaluated the lod of the different assays based on the virus titers in the clinical samples and were able to determine an lod for rp and pro for flua in the range of 3.5-4.5 log rna copies/ml, which is similar to our findings for pro but not for rp. one potential reason for the discrepancy between studies is that all specimens in the belgium study were collected between february and march 2012 and almost all flua specimens subtyped as sh3. hence, rv+ may perform suboptimally with the strain of sh3 circulating in belgium during the winter of 2012. our clinical samples would have been representative of the typical genetic diversity seen over a period of 4 years. in addition, these authors reported a higher than typical percentage of invalid results with rv+ (15.8%), which may indicate a system problem or improper handling of reagents which is critical for optimal performance. other samples in which the expected virus was not detected were two containing adv. in our study, the lod with rp for the virus strain in the nattrol tm rvp verification panel was similar to pro. however, it has been established that rp version 1.6 had low sensitivity for most group c adv as well as select serotypes with all other groups [11, 15] , whereas the version 1.7 kits demonstrated significant improvements in the range of adv detected [26] . interestingly, these two samples were still negative with version 1.7 kits; however, one was now negative with pro, and the other had a ct value of more than 37 which is very close to the lod. one limitation of these studies is that the clinical performance of pro cannot be assessed as sample selection was based on pro test results. in addition, assay specificity cannot be accurately assessed because the population was artificially skewed toward positive specimens rather than the annual respiratory virus positivity rate of 29% that we typically see at our institution. however, false positive results were seen with both rp and rv+. it is possible that the false positive results were an artifact of testing samples in pools. contamination is another possible source for false positive results. rp is a closed, real-time pcr; hence there is no opportunity for contamination with residual amplicon. of course, carry over contamination between samples is possible, but unlikely since the samples were all tested individually on one instrument. although rv+ does involve post-amplification processing, the manufacturer has indicated that amplicons are not released from their cartridges. in addition to the enhanced workflow, both rp & rv+ have many advantages and disadvantages (table 4 ). rv+ allows for a relatively simple, highly sensitive option for detecting flua, b and rsv at a more economical price. but since this system does not detect other respiratory viruses, a second system would be required if a full diagnostic profile is needed. rp has room temperature reagent storage and a total test time of little over an hour, making this system conducive for stat testing. rp also detects a broad range of organisms, including hrv and cov. after our studies were performed, the manufacturer added two more strains of cov, as well as three bacterial targets. both systems only test one specimen at a time per instrument; hence, multiple instruments are necessary for increased throughput. lastly, pro offers the advantage of high throughput testing and a broad menu with the ability to select different analytes. it is difficult to compare the labor costs for this system with the two on-demand systems as the labor per specimen needed for pro is highly dependent on the number of specimens tested. none-the-less, all three systems offer excellent sensitivity and each system offers different benefits to fit different laboratory needs. it is apparent that these highly automated assays demonstrate similar performance and greatly reduce the hands-on time. we acknowledge the kind generosity of nanosphere and biofire diagnostics inc., for providing the reagents for this study. mortality associated with influenza and respiratory syncytial virus in the united states respiratory syncytial virus infection in elderly and high-risk adults influenza-and respiratory syncytial virus-associated mortality and hospitalisations detection of respiratory viruses by molecular methods clinical performance of the 3m rapid detection flu a+b test compared to r-mix culture, dfa and binaxnow influenza a&b test low sensitivity of rapid diagnostic test for influenza diagnosis of 2009 pandemic influenza a (ph1n1) and seasonal influenza using rapid influenza antigen tests performance of a rapid antigen test (binax now(r) rsv) for diagnosis of respiratory syncytial virus compared with real-time polymerase chain reaction in a pediatric population update on influenza diagnostics: lessons from the novel h1n1 influenza a pandemic real-time detection of influenza a, influenza b, and respiratory syncytial virus a and b in respiratory specimens by use of nanoparticle probes comparison of the filmarray respiratory panel and prodesse real-time pcr assays for detection of respiratory pathogens comparison of two multiplex methods for detection of respiratory viruses: filmarray rp and xtag rvp evaluation of the cepheid xpert flu assay for rapid identification and differentiation of influenza a, influenza a 2009 h1n1, and influenza b viruses comparison of the idaho technology filmarray system to real-time pcr for detection of respiratory pathogens in children comparative evaluation of the nanosphere verigene rv+ assay and the simplexa flu a/b & rsv kit for detection of influenza and respiratory syncytial viruses laboratory diagnosis of clostridium difficile infections: there is light at the end of the colon clinical accuracy of a plex-id flu device for simultaneous detection and identification of influenza viruses a and b comparison of the biofire filmarray rp, genmark esensor rvp, luminex xtag rvpv1, and luminex xtag rvp fast multiplex assays for detection of respiratory viruses comparison of xtag respiratory virus panel and verigene respiratory virus plus for detecting influenza virus and respiratory syncytial virus evaluation of three influenza a and b real-time reverse transcription-pcr assays and a new 2009 h1n1 assay for detection of influenza viruses influenza and respiratory syncytial virus detection in clinical specimens without nucleic acid extraction using focus direct disc assay is substantially equivalent to the traditional methods and the focus nucleic acid extraction-dependent rt-pcr assay a one-step rt-pcr assay using an enzyme-linked detection system for the diagnosis of enterovirus meningitis the clinical utility of a near patient care rapid microarray-based diagnostic test for influenza and respiratory syncytial virus infections in the pediatric setting comparison of the luminex xtag rvp fast assay and the idaho technology filmarray rp assay for detection of respiratory viruses in pediatric patients at a cancer hospital comparison of the filmarray rp, verigene rv+, and prodesse proflu+/fast+ multiplex platforms for detection of influenza viruses in clinical samples from the 2011-2012 influenza season in belgium evaluation and implementation of filmarray version 1.7 for improved detection of adenovirus respiratory tract infection we thank the molecular diagnostics staff for their help with collecting respiratory specimens and performing pro. the authors declare no competing interests. obtained from albany medical center. key: cord-287206-ois4gnqx authors: eberhardt, j.n.; breuckmann, n.p.; eberhardt, c.s. title: multi-stage group testing improves efficiency of large-scale covid-19 screening date: 2020-04-23 journal: j clin virol doi: 10.1016/j.jcv.2020.104382 sha: doc_id: 287206 cord_uid: ois4gnqx background: sars-cov-2 test kits are in critical shortage in many countries. this limits large-scale population testing and hinders the effort to identify and isolate infected individuals. objective: herein, we developed and evaluated multi-stage group testing schemes that test samples in groups of various pool sizes in multiple stages. through this approach, groups of negative samples can be eliminated with a single test, avoiding the need for individual testing and achieving considerable savings of resources. study design: we designed and parameterized various multi-stage testing schemes and compared their efficiency at different prevalence rates using computer simulations. results: we found that three-stage testing schemes with pool sizes of maximum 16 samples can test up to three and seven times as many individuals with the same number of test kits for prevalence rates of around 5% and 1%, respectively. we propose an adaptive approach, where the optimal testing scheme is selected based on the expected prevalence rate. conclusion: these group testing schemes could lead to a major reduction in the number of testing kits required and help improve large-scale population testing in general and in the context of the current covid-19 pandemic. abstract: background: sars-cov-2 test kits are in critical shortage in many countries. this limits large-scale population testing and hinders the effort to identify and isolate infected individuals. objective: herein, we developed and evaluated multi-stage group testing schemes that test samples in groups of various pool sizes in multiple stages. through this approach, groups of negative samples can be eliminated with a single test, avoiding the need for individual testing and achieving considerable savings of resources. study design: we designed and parameterized various multi-stage testing schemes and compared their efficiency at different prevalence rates using computer simulations. results: we found that three-stage testing schemes with pool sizes of maximum 16 samples can test up to three and seven times as many individuals with the same number of test kits for prevalence rates of around 5% and 1%, respectively. we propose an adaptive approach, where the optimal testing scheme is selected based on the expected prevalence rate. conclusion: these group testing schemes could lead to a major reduction in the number of testing kits required and help improve large-scale population testing in general and in the context of the current covid-19 pandemic. keywords: group testing, testing, mass population tests the covid-19 pandemic is caused by the virus sars-cov-2 and despite drastic measures taken to limit disease dissemination, this pandemic will lead to a substantial death toll and an unforeseeable impact on health-care systems and the world economy. this shows the need for accurate data on prevalence to better inform political and public health decision making and to broadly identify infected individuals. so far, 1.6 million cases and over 100,000 deaths have been reported world-wide ([1], 10.4.2020). however, true prevalence rates are unknown as in most countries large-scale population testing has still not been introduced. tests are often restricted to specific groups of populations, such as healthcare workers, j o u r n a l p r e -p r o o f individuals with known sars-cov-2 exposure, covid-19 symptoms or with risk factors for severe diseases. one reason for the limited testing is the shortage of pcr testing reagents. this could be overcome by group testing, a method first suggested by dorfman for testing large populations of u.s. soldiers for syphilis [2] . the idea of group testing involves the division of the population into small groups. for each group, a combined sample ('pool') of its members is created and tested. if the pool tests negative, it can be concluded that all group members are negative and no individual tests will be required. if the pool tests positive, further tests will have to be performed to determine which group member(s) are positive. one ad-hoc model of group testing, using pools of up to 10 samples, has recently been applied for sars-cov-2 pcr [3] . more refined variants of group testing are for example used in hiv screening [3] [4]; but these pool sizes seem to exceed the sensitivity of current sars-cov-2 testing methods [5] . herein, we develop various group testing schemes and evaluate their resource efficiency for different prevalence rates. we define models that are presumed practical for sars-cov-2 testing applications (small pool sizes, small number of steps) and best suited to minimize the number of tests necessary. we developed and evaluated multi-stage group testing schemes that test samples in groups of various pool sizes in multiple stages. through this approach, groups of negative samples can be eliminated with a single test, avoiding the need for individual testing and achieving considerable savings of resources. design of testing schemes j o u r n a l p r e -p r o o f multi-stage group testing schemes p s ("pool size , stages") were designed on the basis of two integers (divisor) and (number of stages). the initial pool size is = −1 , which is divided by in each subsequent stage, resulting in pool sizes −1 , −2 , . . . , 0 = 1in stages1,2, . . . , . two-stage group testing applies this construction with setting = 2. to compare the performance of group testing schemes, we defined a quantity called improvement factor. mathematically, the improvement factor is the ratio of the population size and the expected value of the number of tests performed by the scheme. in other words, it is the average number of samples that can be tested with a single test, when the scheme is applied to a large population. importantly, the improvement factor depends on the prevalence rate . improvement factors of two-stage testing schemes pns2 were calculated using the formula /(1 + − (1 − ) )) [4] . to handle multi-stage testing schemes, a python program was written by us. additionally, python was used to implement a monte-carlo statistical method that performs multi-stage and matrix group testing schemes on 1m randomly generated groups of samples and averages the improvement factor over all groups. the two methods were compared and found to be in agreement with one another. the improvement factors for all two-/multi-stage schemes with pool sizes up to 10,000 and for the (8x12) matrix scheme were calculated with the above methods for all prevalence rates between 0% and 30% in steps of 0.05%. python was used to determine the optimal testing scheme amongst these examples. matplotlib was used to plot heatmaps visualizing the results. we presume that schemes are clinically feasible if their pool size is less or equal than 16 and their number of stages is less or equal than 4. a selection of presumed clinically feasible and optimal multi-stage schemes p3s3, p9s3, p4s2 and p16s3 was made. also, the schemes p32s2, p10s2 and the matrix scheme were considered as they appeared in earlier literature [6, 7] . matplotlib was used to plot their improvement factors for j o u r n a l p r e -p r o o f prevalence rates between 0% and 30%. data for prevalence rates over 30% was not plotted, since all testing schemes perform worse than individual testing in these cases. we designed group testing schemes with the goal of testing large numbers of samples more efficiently. samples are not tested individually from the start but rather arranged into groups ('pools') and then tested together. all samples in pools that are tested negative must be negative and no individual testing is needed. all samples in pools that are tested positive are further processed according to the design of the testing scheme. a commonly used approach is two-stage testing [2] , where pools containing for example 3 individual samples (p3, "pool of 3") are tested first, and in a second stage (s2, "2 stages") samples in positive pools are tested individually (fig 1a) . the resource efficiency of group testing stems from the fact that for low prevalence rates it is likely that a group of samples will not contain a positive sample and thus negative samples are eliminated in groups. group testing schemes can be refined in various ways. we expanded the design to multi-stage testing schemes. here, pools that are tested positive are split in multiple stages into smaller pools before eventually performing individual tests. we used integer powers (e.g. there are obvious variants, which are more complicated, such as using different divisors at each stage, but we did not consider these here. to evaluate and compare the performance of different group testing schemes, we defined the improvement factor compared to individual testing. the improvement factor describes how many more samples can be tested using the same (limited) number of ressources. simplistically speaking, an improvement factor of 10 indicates that 20,000 tests are sufficient to test an average population of 200,000 individuals. the improvement factor of each scheme depends on the prevalence rate. a calculation shows that for a prevalence rate and a pool size the improvement factor for two-stage testing is /(1 + − (1 − ) ). hence, if the prevalence rate approaches 0, the improvement factor approaches the pool size n. multi-stage testing schemes have the same asymptotic behaviour although explicit formulas for their improvement factor become more complicated. we next compared the improvement factors of each testing scheme assuming different prevalence rates up to 30%. results for selected prevalence rates (1%, 7.5% and 20%) are visualised in figure 2 . the data showed that group testing is more efficient than individual testing for prevalence rates under 30%. as expected, large pool sizes and more stages are preferable for lower prevalence rates, small pool sizes and fewer stages are preferable for higher prevalence rates, indicating that there is no group testing scheme that is optimal for all prevalence rates. for prevalence rates under 12%, multi-stage schemes had higher improvement factors than two-stage schemes. for prevalence rates around 1%, simple three-stage schemes such as p9s3 or p16s3 (fig 1b) yielded improvement factors of around 7. at prevalence rates of around 1%, group testing schemes with very large pool sizes and many stages, for example p81s5, are optimal in the mathematical sense but clinically impractical for several reasons: first, pcr testing is not arbitrarily sensitive. pooling positive with negative samples dilutes the positive samples, which increases the risk of false negative results. however, recent research indicates that pooling of 16 samples does not seem to substantially impact test sensitivity of sars-cov-2 pcr tests [5] . second, the number of stages should be reasonable. each additional stage increases the workload and the risk of human error. furthermore, stages have to be processed sequentially, increasing the time to get the diagnosis. therefore, we decreased complexity and restricted our further analysis to schemes with pool sizes up to 16 samples and a maximum of 4 stages. we determined the improvement factor of p3s2, p9s3, p4s2 and p16s4 for prevalence rates up to 30% (figure 3 a+b) and compared results with previously described schemes, namely the two-stage testing schemes with pool sizes of 10 (p10s2, [6] ), or 32 (p32s2, [5] ). we also assessed the matrix testing scheme [7] using a matrix of 96 samples (12x8) that groups samples in rows (8 pools comprising 12 samples) and columns (12 pools comprising 8 samples) a method that has also been used for epitope mapping in immunology research application [8] . we summarized the optimal testing schemes for different prevalence rates (table 1) : for low prevalence rates (0-3.5%), p16s3 is optimal among all the schemes we consider feasible, with improvement factors between 16 down to 3.8. for medium prevalence rates (3.5-12%), it becomes advantageous to reduce the pool size to 9 and perform 3 stages (p9s3), giving an improvement factor from 3.8 down to 1.5. for high prevalence rates between 12% and 30%, the pool size should be further reduced to three samples with 2 stages (p3s2), yielding an improvement factor from 1.5 down to 1. once the prevalence rate is 30% and above, individual testing should be performed. in summary, we showed that among all presumed clinically feasible testing schemes multi-stage schemes are preferable to two-stage schemes for prevalence rates of under 12%. for prevalence rates up to 3.5% p16s3 is preferable. from 3.5% up to 12% p9s3 performs best. however, for prevalence rates above 12% the two-staged testing scheme p3s2 is preferable. we introduced multi-stage group testing schemes which are highly efficient methods to test large numbers of samples and assessed their improvement factor depending on different prevalence rates. we found that three-stage schemes performed optimally for prevalence rates up to 12% and that initial pool sizes of 16 were best for prevalence rates up to 3.5% (p16s3, improvement factor 16 to 3.8) and pools of 9 samples for rates between 3.5% and 12% (p9s3, improvement factor 3.8 to 1.5). for prevalence rates between 12 and 30%, two-stage testing with pools of 3 samples performed best (p3s2, improvement factor 1.5 to 1). this suggests that an adaptive approach is necessary where the scheme is chosen depending on the estimated prevalence rate. the multi-stage group testing schemes defined in this paper outperform other approaches to group testing in the literature [7] . the high efficiency of multi-stage group testing allows for large-scale testing of populations. to estimate the potential savings of tests we can use real-world data [1] (dated 10.04.2020). in order not to overestimate the prevalence rate, we considered data from countries which have performed large-scale population testing, namely south korea and germany. in south korea a total of 503,051 people have been tested, of which 10,450 were positive. this gives an estimate for the underlying prevalence rate of 2%. at this prevalence rate the multi-stage testing scheme p16s3 is optimal and would allow for testing about five times as many individuals with the same number of tests. in germany, a total of 1,317,887 people were tested, of which 118,235 were positive. this gives a higher prevalence rate of around 9%. in this case the multi-stage scheme p9s3 is optimal; it would enable the testing of an additional 80% of individuals (compared to only 30% improvement based on the p10s2 scheme suggested in [6] ). note that these numbers have a selection bias, as individuals with covid-19 symptoms were more likely to be tested. by introducing large-scale testing, established true prevalence rates will probably be lower, which would automatically yield even better improvement factors of the testing schemes. our analysis and predictions are in silico observations and have to be confirmed in real life. in particular, these testing schemes will have to be established in a similar fashion as other novel individual laboratory testings with the aim of assessing and limiting potential false positive or negative results. the practical feasibility of our methods is supported by observations of yelin et al. which indicate that pooling up to 16 j o u r n a l p r e -p r o o f samples for sars-cov-2 pcr testing could potentially not decrease test sensitivity [5] . if further laboratory analyses show that the scheme p16s3 is not implementable and that pool sizes of 16 samples increase the false negative rate significantly, the scheme p9s3 presents a viable alternative. here, improvement factors are comparable (7.2 vs. 6 for 1% prevalence rate) while almost halving the pool size. however, it has been described that the viral load depends on the disease stage and is high during the early phase [9] . thus, larger pool sizes could be used for this subpopulation. additionally, individuals with higher and lower likelihood of infection could be combined into different pools to improve testing efficiency by choosing the appropriate testing scheme. as these group-testing schemes are agnostic towards practical application, they can be used in different settings. in the course of the current covid-19 pandemic and in view of the shortage of pcr testing kits, these multiple-stage schemes would allow for large-scale population testing and prevalence estimations. also, efforts are made to determine sero-prevalence of anti-sars-cov-2 antibodies as potential markers of previous infection and immunity and broad population testing will soon become necessary. here, multiple-stage testing could be employed and it has been shown for anti-hiv antibody testing that elisa tests of pooled serum samples can be performed without a significant decrease in sensitivity or specificity [10] . in summary, we identified group testing schemes that are more efficient than individual testing methods most laboratories currently employ under different prevalence rates. these findings can have the potential to significantly increase the mass testing efficiency in the context of the current covid-19 pandemic. each square represents a multi-stage scheme p s with pool size = −1 , divisor (x-axis) and stages (y-axis). color intensity represents the improvement factor, i.e. the average number of subjects tested with a single test (darker is higher). dashed lines indicate the cut-off with respect to the maximal initial pool size of 16. dotted lines indicate the cut-off with respect to the maximal number of stages of 4. a: for 1% prevalence rate, among all schemes, p81s5 performs best (improvement factor 8.4). among schemes with a pool size limited by 16, p16s5 performs best (improvement factor 7.3). finally, among schemes which are additionally limited to less than 5 stages, p16s3 performs best (improvement factor 7.1) testing 7.1 subjects with just one test, while still being practical. b: for 7.5% prevalence rate, p9s3 performs best (improvement factor 2). c: for a 20% prevalence rate, it is preferable to use a low number of stages. p3s3 performs best (improvement factor 1.22). a: improvement factors of the different schemes for prevalence rates below 5%. for prevalence rates below 3.5% scheme p16s3 is favorable, leading to an improvement factor of between 3-16-fold. above 3.5% scheme p9s3 becomes favorable, giving improvement factors of around 3-fold. note that for very low prevalence rates the improvement factors of multi-level schemes converge towards the maximum pool size, making schemes such as p10s1, p16s3 and p32s2 highly efficient. p32s2 is shown with a dashed line since its large maximum pool size may affect the reliability of the tests. for prevalence rates < 0.5% it rapidly converges towards an improvement factor of 32-fold. b: improvement factors of the different schemes for prevalence rates between 5-30%. the data shows that for prevalence rates below 12% scheme p9s3 gives the largest improvement rate, whereas above 12% scheme p3s2 becomes favorable. for prevalence rates of 30% and above all schemes considered here do not offer an advantage over individual testing. schemes with a large maximum pool size (p10s2, p32s2, matrix) offer lower improvement rates and are hence unfavorable in this regime. j o u r n a l p r e -p r o o f schemes which are compatible with our desiderata for clinical practicability (pool size ≦ 16 and low number of stages ≦ 4) and their properties. we show which scheme has the best performance for any underlying prevalence rate. the detection of defective members of large populations routine detection of acute hiv infection through rna pooling: survey of current practice in the united states sex transm dis optimal retesting configurations for hierarchical group testing evaluation of covid-19 rt-qpcr test in multi-sample pools ad hoc laboratory-based surveillance of sars-cov-2 by real-time rt-pcr using minipools of rna prepared from routine respiratory samples evaluation of group testing for sars-cov-2 rna the yellow fever virus vaccine induces a broad and polyfunctional human memory virological assessment of hospitalized patients with covid-2019 evaluation of human immunodeficiency virus seroprevalence in population surveys using pooled sera we thank john kwan for the careful reading of our manuscript and cocalc for providing a remote collaborative programming platform. key: cord-291029-oldket3n authors: sefers, susan e.; rickmyre, jamie; blackman, amondrea; li, haijing; edwards, kathryn; tang, yi-wei title: qiaamp minelute virus kit effectively extracts viral nucleic acids from cerebrospinal fluids and nasopharyngeal swabs() date: 2005-07-21 journal: j clin virol doi: 10.1016/j.jcv.2005.05.011 sha: doc_id: 291029 cord_uid: oldket3n background: nucleic acid preparation from a variety of clinical specimens requires efficient target recovery and amplification inhibitor removal and is critical for successful molecular diagnosis. the qiaamp minelute virus kit (qiagen inc., valencia, ca) was compared to the two existing methods currently used in our laboratory, isoquick (orca research inc., bothell, wa) for dna extraction and rnazol b (leedo laboratories inc., houston, tx) for rna extraction, of viral nucleic acids. study design: a total of 150 clinical specimens, including cerebrospinal fluid (csf) and nasopharyngeal swabs (nps), were used to determine the extraction efficiency of the minelute compared to the other two methods. nucleic acid recovery, hands-on time, turn-around-time and cost were compared across all kits. results: there was complete concordance between the minelute and isoquick/rnazol kits when herpes simplex virus (hsv), epstein–barr virus (ebv), varicella-zoster virus (vzv), influenza a virus or enteroviruses were detected using a colorimetric microtiter plate pcr system. the kits were equivalent in their ability to detect either dna or rna with superior ability to recover a high quality and quantity of rna. with the potential to process larger specimen volumes, the minelute kit can significantly shorten processing time from 2 h to 50–55 min. conclusions: although relatively high test kit costs were noted, the minelute kit provides another rapid and user-friendly specimen processing tool in the diagnostic molecular microbiology laboratory. in vitro nucleic acid amplification tests are now being incorporated more and more into clinical laboratories due to their high sensitivity and quick test turnaround time. one example is in the diagnosis of herpes simplex virus (hsv) encephalitis versus enteroviral meningitis. central nervous system (cns) infections caused by the two viruses can be difficult to distinguish clinically. early treatment of hsv encephalitis can reduce patient morbidity and mortality (skoldenberg et al., 1984; whitley et al., 1986) while early diagnosis of cns disease due to enterovirus can significantly shorten hospital stay and avoid overuse of broad range antibiotics (ramers et al., 2000; rotbart et al., 1994) . on the other hand, early recognition of viral respiratory diseases caused by respiratory syncytial virus (rsv) and influenza viruses is critical for isolating patients to prevent nosocomial transmission (rovida et al., 2005) . chemotherapy is more effective when the antiviral drugs are given at the earliest stage of diseases (hayden et al., 1997; treanor et al., 2000) . for several viral diseases such as severe acute respiratory syndrome and 1386-6532/$ -see front matter © 2005 elsevier b.v. all rights reserved. doi:10. 1016/j.jcv.2005.05.011 aseptic meningitis, the viral loads in clinical specimens could be low (lai et al., 2003; peiris et al., 2003) ; therefore, a technique to process larger amounts of specimens to reach greater sensitivity is desirable. there are rapid antigen tests available for both rsv and influenza, but these tests have low sensitivity (boivin et al., 2004; rovida et al., 2005) . molecular tests are now available that can be performed as an alternative to or in addition to these rapid tests, providing both a rapid and sensitive method to detect respiratory viruses. when using molecular techniques for virus detection, it is important to find a method for extracting nucleic acid from clinical samples that will concentrate the sample, provide a maximum yield of nucleic acids and also remove inhibitory substances. improvements in nucleic acid extraction methodology have resulted in better target nucleic acid recovery and amplification inhibitor removal (espy et al., 2001; read, 2001) . the more a target organism is present in a sample, the more chance there is of detecting the organism using pcr. if a larger specimen volume is processed, then more nucleic acid can be isolated. a nucleic acid extraction system that can handle diversified clinical specimens with different volumes is desirable. we have been using isoquick and rnazol b for dna and rna extraction in our clinical diagnostic services (smalling et al., 2002; tang et al., 1998 tang et al., , 1999 . both kits work well in concentrating and isolating nucleic acids while removing inhibitors; however, they are time-consuming procedures, and cannot be adapted to process larger volumes of sample. recently, a qiaamp minelute kit (qiagen inc., valencia, ca) became available, which can be used for simultaneous purification of viral rna and dna from a variety of specimen types without organic extraction or alcohol precipitation. a specimen can be processed by using either a vacuum or a spin procedure. with an additional adaptor, the minelute system can process specimens with large and variable volumes. in this study, we have chosen both nasopharyngeal swab (nps) and cerebrospinal fluid (csf) specimens submitted for influenza a virus, enterovirus and herpesvirus testing to validate the minelute nucleic acid extraction system. the quantity and quality of the extracted nucleic acids and the sensitivity and reproducibility for relevant pathogen detection were compared to the currently used isoquick/rnazol b methods. in addition, total extraction time and technologist hands-on time as well as costs for performing the system were determined. a total of 150 clinical specimens were included in the evaluation. forty-nine csf samples were collected from patients with suspected viral cns disease who visited vanderbilt university medical center between april 2002 and november 2003. an aliquot of csf was frozen at −70 • c until tested by both extraction methods. nps specimens were collected through a cdc-sponsored new vaccine surveillance network between october 2002 and march 2003. specimens collected by two dacron swabs were immediately placed in 2 ml of hanks' viral transport medium, and 0.2 ml of specimen suspension was mixed with 0.9 ml of a guanidine thiocyanate lysis buffer (nuclisens, biomerieux, durham, nc). the sample mixture was incubated for 10 min and then frozen at −80 • c until tested. for the isoquick protocol, 100 l of csf were extracted, and viral dna was resuspended in 25 l of rnase-free water as previously published (smalling et al., 2002; tang et al., 1998) . for the minelute protocol, viral dna was extracted by the minelute spin kit according to the manufacturer's instructions. in brief, 25 l of protease was added to 100 l of csf; a buffer al/carrier rna mixture was made and added to the csf/protease mixture. the sample mixture was incubated at 56 • c for 15 min, and 250 l ethanol was added. the entire volume of sample was then transferred to a qiaamp minelute column and centrifuged for 1 min at 6000 × g. a series of washes were performed and the total viral dna was eluted into 55 l of rnase-free water. for the rnazol b protocol, 100 l of csf or nps was extracted as previously published (smalling et al., 2002; tang et al., 1999) . for the minelute protocol, viral rna was extracted by the minelute vacuum kit according to the manufacturer's instructions. in brief, 100 l csf or 1.1 ml nps-lysis buffer mixture was mixed with 75 l of protease, and then 550 l of a buffer al/carrier rna mixture was added. after incubating at 56 • c for 15 min, 600 l of ethanol was added and the mixture was incubated for five more minutes. the entire volume of sample was then added to a spin column connected to a vacuum manifold. the sample was then drawn through the column to allow the nucleic acids to bind to the silica membrane. a series of washes were performed and viral rna was eluted into 55 l of sample diluent (applied biosystems, branchburg, nj) by centrifuging for 1 min at 12,000 × g. a colorimetric microtiter plate pcr (pcr-eia) system was used for the detection of herpesviral dna, which included hsv, varicella-zoster virus (vzv) or epstein-barr virus (ebv) in csf as previously described (tang et al., 1997 (tang et al., , 1998 . dna extraction volumes added into the pcr reaction were 10 l from isoquick and 20 l from minelute. all extracted samples were also tested for the ␤-actin "housekeeping" gene to detect the ability of the extraction kits to remove inhibitors . output signals were measured at optical densities of 450 nm (od 450 ) and 490 nm (od 490 ). a positive result was defined as an od 450 − od 490 value greater then or equal to 0.1 (tang et al., 1998) . a similar rt-pcr-eia system was used for the detection of all rna targets, including enteroviruses (csf) and influenza a virus (nps), as described previously (smalling et al., 2002; tang et al., 1999) . twenty-five microliters of extracted rna by rnazol b or minelute was added into the rt-pcr reaction. the primers and probes used for influenza a virus amplification and identification were described previously (poehling et al., 2002) . all extracts also were tested using a ␤-actin housekeeping gene with the same protocol by incorporating ␤-actin primers (forward: 5 -ttt cgt gga tgc cac agg act-3 ; antisense: 5 -tgg cca cgg ctg ctt cca gct-3 ) and probe (5 -ctc ttc cag cct tcc ttc ctg-3 ). output signals were measured at optical densities of 450 nm (od 450 ) and 490 nm (od 490 ). a positive result was defined as an od 450 − od 490 value greater then or equal to 0.1 (tang et al., 1999) . a real-time taqman pcr assay was used to compare the dna recovery of the isoquick and minelute extraction kits. a standard curve was achieved by using serial dilutions of a plasmid standard containing the primer-spanning region of the cmv glycoprotein b gene . cmv dna amplification was performed in a "real-time" format on the 7700 abi prism sequence detector (applied biosystems, foster city, ca). one csf specimens was spiked with a cmv plasmid to make a final concentration of 2.69 × 10 4 copies/reaction and extracted by using both the isoquick and minelute. cmv quantitation of the dna extracts were performed on the 7700 abi prism sequence detector as previously described . a real-time taqman rt-pcr assay was used to compare dna recovery of the isoquick and minelute extraction kits. a standard curve was achieved by using serial dilutions of hiv-1 rna extracted from an hiv-1-positive plasma with a known viral load. three csf specimens were spiked with an hiv-1-positive plasma to make a final concentration of 2.97 × 10 7 copies/reaction and extracted by using both the rnazol b and minelute. hiv-1 rna amplification was performed on the 7700 abi prism sequence detector. a 25 l reaction mixture containing 10 l of total rna, 0.5 m of each primer and 0.2 m of taqman probe was mixed with 25 l of the taqman one-step rt-pcr 2× master mix (applied biosystems). the reaction conditions were designed as follows: rt at 48 • c for 30 min and initial denaturation at 95 • c for 10 min followed by 40 cycles with 15 s at 95 • c for denaturing and 1 min at 60 • c for annealing and extension (deng et al., 2003) . a primer set for hiv-1 (gagf578: 5 -ayc arg cag cya tgc aaa tgt t-3 and gagr730: 5 -ctg aag ggt act agt agt tcc tgc tat rtc-3 , y = c or t, r = a or g) was designed to amplify a 152 base pair fragment in the hiv-1 gag gene (kwok et al., 1987) . the probe (gagp607: 5 -acc atc aat gag gaa gct gca gaa tgg ga-3 ) was dually labeled with a reporter dye (fam, 6-carboxy fluorescein) at the 5 end and a quencher dye (tamra, 6-carboxytetramethyrhodamine) at the 3 end. the cost per test was calculated for each assay and included test kit, materials and reagents. laboratory personnel salaries, equipment and laboratory overhead costs were not included in this cost. both hands-on time and total extraction time were counted when incubation or centrifuge time was equal to or less than 5 min while only total extraction time was counted when incubation or centrifuge time was greater than 5 min. an additional 15-20% turn-around-time was added to each procedure to account for specimen processing, reagent preparation, bench cleaning and record keeping. a cost saving due to shortened labor was estimated for each procedure based on a batch size of 10. a total of 150 clinical samples were included in this study to validate the minelute kit in comparison to either the iso-quick (dna detection) or rnazol b (rna detection) kit. human ␤-actin dna or rna was detected in all nucleic acid specimens extracted by either minelute or isoquick/rnazol b kit, indicating these nucleic acid extracts were free of amplification inhibitors. all 101 nps rna specimens, which were extracted by the minelute and rnazol b, were tested for influenza a virus by rt-pcr-eia. there was a 99% agreement between the minelute and rnazol b when influenza a virus was detected; one was detected in the minelute but not the rnazol b-extracted rna (table 1) . twenty csf samples were extracted by using the minelute and rnazol b in parallel, and tested for enteroviruses by rt-pcr-eia. there was 100% agreement among all 20 samples between the two extraction methods (table 1) . twenty-nine csf samples were extracted by using the minelute and isoquick in parallel, and tested for hsv, ebv or vzv by pcr-eia. there was 100% agreement again between the two extraction methods for herpesvirus detection. these results suggested that the minelute possesses a similar sensitivity as with the isoquick/rnazol b for both dna and rna virus detection. an analytical sensitivity of extraction kits was evaluated by extracting 10 csf samples in parallel using the minelute and isoquick/rnazol b. nucleic acid extracts were serially diluted and tested for rna (enterovirus and influenza a virus) and dna (hsv, ebv and vzv) by rt-pcr-eia and pcr-eia (fig. 1 ). these extractions were tested at a mean ± s.d. (recovery percentage) from triplicate runs. there were no statistical differences in recovery rates between minelute and iso-quick/rnazol b for both hiv-1 and cmv quantitation (p > 0.05). concentrations of undiluted, 1:10, 1:100 and 1:1000. when rna extraction methods (minelute versus rnazol b) were compared, the minelute produced significantly larger optical density (od) values than the rnazol b (p < 0.001). samples extracted by the minelute tested positive to the 1:1000 dilution while those extracted by the rnazol were only positive in the undiluted concentrations. the od values were similar when dna extraction methods were compared between the minelute and isoquick (p > 0.05). both extraction methods produced positive results to the 1:1000 dilutions. these data indicated that while both isoquick and minelute yielded similar amounts of dna, the minelute might yield higher quantities of rna than rnazol. nucleic acid recovery rates between the minelute and rnazol b were further determined by quantitating hiv-1 or cmv viral loads in extracted rna or dna specimens using a real-time taqman pcr. the samples were run in triplicate along with an unextracted control sample and the recovery rate was calculated by comparing the viral loads in the control. the minelute and isoquick had recovery rates for cmv dna of 74.3% and 66.9% and the minelute and rnazol b had recovery rates for hiv-1 rna of 20.3% and 15.2% (table 2) . while the dna recovery rate was higher than the rna for both extraction methods, there were no statistical differences in recovery rates between minelute and isoquick/rnazol b for both hiv-1 and cmv quantitation (p > 0.05). these data indicated that minelute possesses a similar organism-specific nucleic acid recovery rate in comparison to the isoquick for dna and the rnazol b for rna. cost per test was calculated for each extraction kit, which included test kit and additional materials and reagents used for nucleic acid extraction. the cost per test was us$ 2.86 for the isoquick, which was cheaper than the costs of the (table 3) . the purpose of this study was to validate the minelute vacuum and spin kits against our currently used isoquick and rnazol b kits. both minelute kits were able to effectively remove the amplification inhibitors existing in nps and csf specimens. the minelute kits possessed an equivalent sensitivity in nucleic acid recovery and detection, in comparison to the isoquick and rnazol b, for both dna and rna extraction. with adaption, the minelute can process variable and larger volumes to enhance test sensitivity which is important when the viral loads are extremely small (lai et al., 2003; peiris et al., 2003) . on the other hand, the minelute shortened the total time for dna/rna purification from 2 h to less than 1 h, which provided another rapid and user-friendly specimen processing tool in the diagnostic molecular microbiology laboratory. good specimen preparation and extraction comprises efficient target recovery, establishment of the integrity of nucleic acid targets, optimal removal of amplification inhibitors, elimination of components that affect other enzymatic substrates and sterilization of potentially hazardous organisms. the qiagen minelute kit was designed for simultaneous purification of viral rna and dna from plasma, serum and cell-free body fluids using vacuum or spin processing. nucleic acids bind specifically to the silica-gel membrane while contaminants pass through (boom et al., 1990) . no organic extraction or alcohol precipitation was involved in the processing, which is superior to phenol/chloroform-based chaotropic lysis included in the isoquick and rnazol b kits (smalling et al., 2002; tang et al., 1998 tang et al., , 1999 . several components in the organic phase (e.g., phenol) are strong amplification inhibitors. during specimen processing, if residual organic phase was carried over, the phenol would bind and inactivate the dna polymerase and cause false negative results (katcher and schwartz, 1994) . to avoid residual phenol carryover, we have implemented an additional spin step to make sure all organic solvents are removed. this, in turn, compromises dna recovery due to loss of some of the aqueous phase and increases the time needed for specimen processing. the minelute simplified and hastened viral rna and dna isolation processing. the minelute improved patient care through significant shortening of test turn-around-time, which is extremely attractive in the clinical setting when test results determine the urgent clinical intervention (hayden et al., 1997; ramers et al., 2000) . the high cost for performing the minelute was noted. since laboratory labor was not calculated in the cost per test, it is acceptable to assume that the savings in hands-on time and turn-around-time for performing the minelute would offset the higher costs of the test kit. both minelute vacuum and spin kits provided rapid purification of high quality viral dna and rna. the system yielded highly purified nucleic acids, which were free of contaminants and inhibitors, as well as an improved test turnaround-time by approximately 1 h. although relatively high test kit costs were noted, the minelute kit provides another rapid and user-friendly specimen processing tool in the diagnostic molecular microbiology laboratory. multiplex real-time pcr assay for detection of influenza and human respiratory syncytial viruses rapid and simple method for purification of nucleic acids cytokine expression in respiratory syncytial virus-infected mice as measured by quantitative reverse-transcriptase pcr detection of herpes simplex virus dna in genital and dermal specimens by lightcycler pcr after extraction using the isoquick, magna pure, and biorobot 9604 methods efficacy and safety of the neuraminidase inhibitor zanamivir in the treatment of influenzavirus infections. gg167 influenza study group a distinctive property of tth dna polymerase: enzymatic amplification in the presence of phenol identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection evaluation of realtime pcr versus pcr with liquid-phase hybridization for detection of enterovirus rna in cerebrospinal fluid measurement of human cytomegalovirus loads by quantitative real-time pcr for monitoring clinical intervention in transplant recipients clinical progression and viral load in a community outbreak of coronavirus-associated sars pneumonia: a prospective study bedside diagnosis of influenzavirus infections in hospitalized children impact of a diagnostic cerebrospinal fluid enterovirus polymerase chain reaction test on patient management recovery efficiencies on nucleic acid extraction kits as measured by quantitative lightcycler pcr diagnosis of enteroviral meningitis by using pcr with a colorimetric microwell detection assay monoclonal antibodies versus reverse transcription-pcr for detection of respiratory viruses in a patient population with respiratory tract infections admitted to hospital acyclovir versus vidarabine in herpes simplex encephalitis. randomised multicentre study in consecutive swedish patients molecular approaches to detecting herpes simplex virus and enteroviruses in the central nervous system molecular evidence and clinical significance of herpesvirus coinfection in the central nervous system a colorimetric microtiter plate pcr system detects respiratory syncytial virus in nasal aspirates and discriminates subtypes a and b comparative evaluation of colorimetric microtiter plate systems for detection of herpes simplex virus in cerebrospinal fluid efficacy and safety of the oral neuraminidase inhibitor oseltamivir in treating acute influenza: a randomized controlled trial. us oral neuraminidase study group vidarabine versus acyclovir therapy in herpes simplex encephalitis key: cord-283028-g2rjjq48 authors: christensen, andreas; nordbø, svein arne; krokstad, sidsel; rognlien, anne gro wesenberg; døllner, henrik title: human bocavirus in children: mono-detection, high viral load and viraemia are associated with respiratory tract infection date: 2010-09-15 journal: j clin virol doi: 10.1016/j.jcv.2010.07.016 sha: doc_id: 283028 cord_uid: g2rjjq48 background and objectives: human bocavirus 1 (hbov1) has recently been detected in children with respiratory tract infections (rti). in order to study whether hbov1 can cause rti, we investigated its presence in children with upper rti (urti), lower rti (lrti) and a control group of children without rti. study design: nasopharyngeal aspirates (npa) and blood samples were collected from children admitted to hospital with rti from 6 june 2007 to 28 february 2009 (n = 1154), and from children admitted for elective surgery who had no rti (n = 162). using polymerase chain reaction (pcr), the npas were examined for 17 infectious agents including hbov1. blood samples were tested with hbov1-pcr only. results: hbov1 was detected in npas from 10% of patients and 17% of controls. adjusted for age, gender and the presence of other viruses, hbov1 was not associated with rti. in the hbov1-positive npas, at least one other virus was detected in 75% and the virus appeared alone in 25%. adjusted for age and gender, the detection of hbov1 as the sole virus was associated with rti, but not with lrti. viraemia was found only in children with rti. the study showed that it was associated with rti and lrti. a high hbov1-load was associated with lrti, but not with rti. no interactions between hbov1 and other infectious agents were found. conclusions: our data support the hypothesis that hbov1 causes rti in children, because detection of hbov1 alone, viraemia and high viral load are associated with rti and/or lrti in this age group. however, hbov1 is common in healthy children. the human bocavirus, belonging to the family parvoviridae and the genus bocavirus, was discovered in 2005. 1 four different species of human bocavirus have been proposed, and the name human bocavirus 1 (hbov1) has now been suggested for the originally discovered virus. 2 it has been associated with respiratory tract infections (rtis) in children and a link to more complex clinical conditions in immunosuppressed patients has been suggested. [3] [4] [5] however, hbov1 is frequently found together with other respiratory viruses and consequently its causative role in childhood rti may be questioned. possible interactions between hbov1 and other viruses have also been discussed. 6 we studied the role of hbov1 in childhood rti by comparing its presence in children hospitalised with rti with a control group of symptom-free children admitted to elective surgery. we also looked for several other respiratory pathogens in order to evaluate their coexistence with hbov1. the study was performed at the department of paediatrics, st. olavs hospital, trondheim university hospital during the period 6 june 2007 to 31 august 2009. st. olav's hospital is a regional hospital for mid-norway covering a population of 640 000. as part of routine clinical work at our department, and on the discretion of the medical doctors, nasopharyngeal aspirates (npas) were collected from most children who were admitted with rti. the parents were informed about the study and asked to participate. in addition to the npa, a blood sample for the study was collected simultaneously with routine blood samples from included children. the children were classified as having either lower or upper respiratory tract infection (lrti; urti). lrti was diagnosed in the presence of dyspnoea, signs of lower airway obstruction (wheezing, retractions) and/or a positive chest x-ray (infiltrates, atelectasis and air trapping). urti was diagnosed when rhinitis, pharyngitis and/or otitis media were found without signs of lrti. a control group (n = 162) was included prospectively in the same time period. the controls were children admitted for elective surgery who had no symptoms of rti in the last 2 weeks. every week throughout the study period we asked the parents of 2-4 children to participate. most controls had surgery for cryptorchidism, hernia repair or benign skin tumours, and none for ear, nose and throat surgery. a total of 1316 samples were included in the study, 1154 from patients and 162 from controls. the mean ages in the patient and control groups were 35 and 43 months (p = 0.05). using polymerase chain reaction (pcr), the npas were tested for adenovirus, hbov1, coronavirus (oc43, 229e and nl63), enterovirus, human metapneumovirus, influenza a and b virus, parainfluenza virus type 1-3, rs-virus (rsv), rhinovirus, bordetella pertussis, chlamydophila pneumoniae and mycoplasma pneumoniae. nucleic acid was extracted with nuclisens ® easymag ® (biomerieux). all pcrs were in-house real-time assays based on taqman probes. the analyses were carried out as part of the daily laboratory routine and mainly performed within 24 h after sample collection. the target for the hbov1-pcr was the np-1 gene; the primers and probe have been previously described. 7 quantitative standards for the real-time hbov1-pcr assay were made by cloning a plasmid (pcr ® 4-topo ® ) containing the pcr product. the amount of nucleic acid was measured and serial dilutions covering a range of seven logs were made. the viral load in each sample was recorded semi-quantitatively and grouped in three categories: high viral load (10 6 -10 10 copies ml -1 ), medium viral load (10 4 -10 6 copies ml -1 ) and low viral load (10 3 -10 4 copies ml -1 ). the reportable range of the assay was from 1000 copies ml -1 (20 copies per reaction) to 10 10 copies ml -1 . in addition, plasma samples available from 60 of the 144 hbov1-positive children were examined with the hbov1-pcr. all npas were collected in ordinary virus transport media without antibiotics and were cultured for viruses using standard cell lines. the transport media were also used to culture bacteria using standard agarose media. growth of streptococcus pneumoniae, haemophilus influenzae and moraxella catharralis were recorded. plasma from a patient in whom hbov1 had been detected in blood was diluted 1:1000 and pre-centrifuged at 16 000 × g for 30 min. 175 l of the supernatant was then ultra-centrifuged at 27 psi (90 000 rpm) directly to 400 mesh carbonated formvarcovered copper grids and stained with 2% phosphotungstic acid. the grids were examined at magnifications 50 000× to 200 000× with jeol jem-1011 (jeol ltd.). statistical analysis was done by chi-squared test for categorical data and student's t-test for continuous data. multiple logistic regression analysis was used to evaluate the association between hbov1 and rti, controlling for differences in age, gender and the presence of other viruses among cases and controls. we report the odds ratio (or) with 95% confidence interval (95% ci) and the corresponding p-value as a measure of the strength of the association. all analyses were performed using spss software version 15 (statistical package of social science inc.). in all, 144 of 1316 samples (11%) were positive for hbov1. fewer hbov1-positive samples were found in the summer months, but the difference was not significant when adjusted for the number of samples received each month (fig. 1 ). in total, 63% of the children were boys (61% in the patient group and 75% in the control group). the mean age of the hbov1-positive patients was 19 months (sd: 10.6 months) and of the controls, 33 months (sd: 14.2 months) (p < 0.001). one-hundred and seventeen of 1154 samples (10%) from children with rti were positive for hbov1. of these, 40 (37%) had urti and 68 (63%) lrti (of which 49% had bronchiolitis and 14% pneumonia). of the 162 controls, 27 (17%) were positive for hbov1. in a multiple logistic regression analysis adjusting for age, gender and the presence of other respiratory viruses, we found no association between a positive hbov1-pcr test in npa and rti (or: 0.8, 95% ci: 0.5-1.3, p = 0.30). among the 144 hbov1-positive npa samples, hbov1 was detected alone in 25% (36 of 144). twenty-nine percent (34 of 117) of the patient samples were positive for hbov1 alone and 7% (2 of 27) of the controls (p = 0.02). one additional virus was found in 46%, two in 18%, three in 10% and four in 1% (n = 144). rhinovirus, enterovirus, adenovirus and rsv were the most commonly co-detected viruses (table 1) . a logistic regression analysis on the hbov1-positive samples, adjusted for age and gender, showed that detection of hbov1 alone was associated with rti (or: 5.2, 95% ci: 1.1-24.4, p = 0.04) but not lrti (or: 0.6, 95% ci: 0.2-1.4 p = 0.20). a high viral load (>10 6 copies ml -1 ) in the npa was found in 33% (39 of 117) of patients and 15% (4 of 27) of controls. however, when we adjusted for age, gender and presence of other viruses, a high viral load was not associated with rti (or: 1.4, 95% ci: 0.4-5.1, p = 0.57). a very high viral load (>2 × 10 8 copies ml -1 ), though, was clearly associated with rti, as no controls and 14 patient samples had a copy number higher than this. lrti was found in 82% (28 of 34) of the patients with a high viral load (>10 6 copies ml -1 ) and in 54% (40 of 74) of patients with moderate or low viral load. (nine children with complex clinical conditions were excluded from this analysis.) adjusted for age, gender and other viruses, a high viral load was associated with lrti (or: 3.6, 95% ci: 1.2-10.7, p = 0.02). hbov1-viraemia was found in 45% of patients with available samples (18 of 40) and in none of the controls (0 of 20). viraemia was almost exclusively detected in patients younger than 2 years (16 of 18). more children with lrti (57%, 16 of 28) than urti (20%, 2 of 10) had viraemia (p = 0.04). (two children with complex clinical conditions were excluded from this analysis.) furthermore, viraemia was present more frequently in patients with a high viral load in npa (70%, 14 of 20) compared to patients with a moderate or low viral load (10%, 4 of 40) (p < 0.001). thirty-three percent (6 of 18) of the patients with viraemia had hbov1 alone in the npa, compared to 10% (4 of 42) of the patients without viraemia (p = 0.052, fisher's exact test). rhinovirus (33%, 6 of 18) was the most commonly co-detected virus among the viraemic patients. electron microscopy examination of blood from a boy of 18 months with bronchiolitis, hbov1 alone and a high hbov1-load in npa and blood, showed viral particles with size ∼25 nm, compatible with human bocavirus (fig. 2) . adenovirus and enterovirus were more frequent in the hbov1positive npa samples than the negative ones ( table 2 ). in contrast, two other commonly detected viruses, rhinovirus and rsv, were as when bacteria were considered in addition to viruses, multiple detection was made in 85% of the hbov1-positive npa samples. one patient had m. pneumoniae. s. pneumoniae, h. influenzae and m. catharralis were present in 26%, 19% and 27% of the hbov1-positive samples, respectively. there were no differences in the distribution table 2 the four viruses most commonly co-detected with hbov1 distributed by study group and whether hbov1 was present (n = 144) or not (n = 1172). of bacteria among the hbov1-positive and negative samples, or between patients and controls (data not shown). our study confirms that hbov1 is frequently found in children with rti, and often simultaneously with other respiratory viruses. in contrast to most other studies, we also detected hbov1 in many children without rti. 3, [8] [9] [10] nevertheless, our findings indicate that hbov1 causes disease, because detection of the virus alone, a high viral load in npas and viraemia were associated with rti in hospitalised children. hbov1 was detected alone in a third of the patients but only in a few of the controls, and even if the majority in both groups had multiple viruses, this finding supports a causal role of hbov1 in relation to rti. hbov1 alone was not associated with a higher occurrence of lrti. this finding has been reported previously. 9, 11 we did not control for duration of symptoms before admission, and this may be an explanation because duration of symptoms and disease severity are likely to be related. we were surprised to find no association between a high viral load (>10 6 copies ml -1 ) in the npas and rti. this may also be due to the fact that we did not control for duration of symptoms before admission. however, an even higher viral load (>2 × 10 8 copies ml -1 ) was seen only in children with rti. furthermore, an association was found between a high viral load (>10 6 copies ml -1 ) and infection in the lower respiratory tract. this finding may indicate that high viral load is associated with more severe disease, and may represent a dose-effect argument for a causal relation between hbov1 and rti. the detection of hbov1-dna in plasma may represent viraemia or simply leakage of dna from infected cells. fig. 2 shows the presence of viral particles in blood from one patient. this may suggest that detection of hbov1-dna in blood represents a true viraemia, but this singular finding should be studied on a larger scale. nevertheless, as it has been shown before, 9, 12 hbov1-viraemia was strongly associated with rti in general and, although weaker, with lrti. it is most likely that a viraemia with hbov1 indicates a present hbov1-infection. another characteristic feature of hbov1-viraemia in our study was that it was almost exclusively seen in children of less than 2 years, and thus may be a marker for primary hbov1-infection. serological studies show a correlation between igm-response, iggseroconversion and an episode of hbov1-viraemia related to rti in small children. 11, 12 at the age of three, 70-90% of children are seropositive for hbov1, 11, 13 suggesting that the infection in early childhood gives immunity against later infections. most patients with viraemia, high viral load and lrti in our study were in the 12-17 months age group, the age at which most children have lost the protection of maternal antibodies. in the older children, however, the majority of the hbov1-detections could represent asymptomatic re-infections, reactivations of latent/persistent infections or long-time virus shedding. reactivation of other human pathogenic parvoviruses is known to happen. 14, 15 further studies on this issue are needed. most previous studies detected hbov1 among only a few controls, 3,8-10 but two reported similarly high rates to ours of hbov1-positive samples in healthy children. 16, 17 the major strengths of our study are the large case group and the prospective inclusion of controls from the same time period and same geographical area, and the use of the same sampling technique and test algorithm for both groups. patients admitted for ear, nose and throat surgery were not included in the control group because many of these diseases may be related to viral infections. the main differences between cases and controls that might influence the evaluation of hbov1 were age, gender and the presence of other viruses. in the analyses, we used multiple logistic regression analysis to adjust for these factors. we detected multiple viruses in three quarters of the nasopharyngeal samples, as have other pcr-based studies. 9, 18 adenovirus and enterovirus were more common in children with hbov1. enterovirus can be detected in samples from patients several weeks after infection, 19 and shedding of hbov1 over long periods has recently been documented. 17, 20 thus, hbov1 and enterovirus seem to share a common tendency for prolonged shedding, which may explain their frequent co-detection. a criterion of 2 weeks without respiratory symptoms before inclusion in the control group is, in this context, relatively short. long-time virus shedding is therefore a plausible explanation for the high occurrence of hbov1 in our control group. it has previously been shown that strong immune stimuli can cause reactivation of adenovirus in adenoid tissue, 21 and therefore we speculate that the association between hbov1 and adenovirus may be associated with reactivation of the latter. reactivation of hbov1, an alternative or supplementary explanation, has yet to be demonstrated. as expected, rsv was common in children with rti and rare among controls, appearing at similar rates in children with or without hbov1, which indicates the dominance of rsv. similarly, for each of the other viruses studied, co-detection of hbov1 did not increase the frequency of rti (table 2) . cultures for bacteria were included in the study in order to look for interactions with viruses, but no such interactions were seen for hbov1. therefore, our findings do not support the existence of significant interactions between hbov1 and other respiratory viruses or bacteria. however, more studies are needed to clarify these complex matters. cloning of a human parvovirus by molecular screening of respiratory tract samples frequent detection of highly diverse variants of cardiovirus, cosavirus, bocavirus and circovirus in sewage samples collected in the united states human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in thailand disseminated bocavirus infection after stem cell transplant human bocavirus in an immunocompromised child presenting with severe diarrhea impact of human bocavirus on children and their families human bocavirus commonly involved in multiple viral airway infections human bocavirus infection in young children in the united states: molecular epidemiological profile and clinical characteristics of a newly emerging respiratory virus human bocavirus and acute wheezing in children human bocavirus infection in children with respiratory tract disease clinical assessment and improved diagnosis of bocavirus-induced wheezing in children prevalence and clinical aspects of human bocavirus infections in children seroepidemiology of human bocavirus in hokkaido prefecture high prevalence of human parvovirus b19 dna in myocardial autopsy samples from subjects without myocarditis or dilative cardiomyopathy persistence of novel human parvovirus parv4 in liver tissue of adults human bocavirus infections in hospitalized children and adults clinical and epidemiologic characteristics of human bocavirus in danish infants: results from a prospective birth cohort study frequent detection of viral coinfection in children hospitalized with acute respiratory tract infection using a real-time polymerase chain reaction duration of enterovirus shedding in stool prolonged detection of human bocavirus dna in nasopharyngeal aspirates of children with respiratory tract disease latent species c adenoviruses in human tonsil tissues none. none. approved by the regional committee for medical and health research ethics in mid-norway. key: cord-314829-tmgmqtjq authors: scohy, anaïs; anantharajah, ahalieyah; bodéus, monique; kabamba-mukadi, benoît; verroken, alexia; rodriguez-villalobos, hector title: low performance of rapid antigen detection test as frontline testing for covid-19 diagnosis date: 2020-05-21 journal: j clin virol doi: 10.1016/j.jcv.2020.104455 sha: doc_id: 314829 cord_uid: tmgmqtjq background: ensuring accurate diagnosis is essential to limit the spread of the sars-cov-2 and for the clinical management of covid-19. although real-time reverse transcription polymerase chain reaction (rtqpcr) is the current recommended laboratory method to diagnose sars-cov-2 acute infection, several factors such as requirement of special equipment and skilled staff limit the use of these time-consuming molecular techniques. recently, several easy to perform rapid antigen detection tests were developed and recommended in some countries as the first line of diagnostic. objectives: the aim of this study was to evaluate the performances of the coris covid-19 ag respi-strip. study design. we performed a comparison study by testing nasopharyngeal samples with rt-qpcr and antigen rapid test. results: 148 nasopharyngeal swabs were tested. amongst the 106 positive rt-qpcr samples, 32 were detected by the rapid antigen test, given an overall sensitivity of 30.2%. all the samples detected positive with the antigen rapid tests were also positive with rt-qpcr. conclusions: highest viral load is associated with better antigen detection rates. unfortunately, the overall poor sensitivity of the covid-19 ag respi-strip does not allow using it alone as the frontline testing for covid-19 diagnosis. this is a pdf file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. this version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. a week after alerting the who of a cluster of pneumonia of unknown etiology in wuhan, the chinese authorities announced on 7 january 2020 that a novel coronavirus was identified as the cause of these pneumonia. according to phylogenetic analysis, this novel severe acute respiratory syndrome coronavirus 2 (sars-cov-2), previously named 2019-ncov, belongs to the b lineage of betacoronavirus genus and the sarbecovirus subgenus and has more than 85% j o u r n a l p r e -p r o o f nucleotide sequence identity with a bat sars-like cov genome published previously 1,2. initially described in china, the coronavirus disease (covid-19) caused by sars-cov-2 rapidly gained ground and evidence of human-to-human transmission rose. on january 30, who declared covid-19 outbreak a public health emergency of international concern and the disease has now spread worldwide. highly sensitive and specific tests are crucial to identify and manage covid-19 patients and implement control measures to limit the outbreak. real the aim of this study was to assess the performances of covid-19 ag respi-strip as a frontline testing in comparison to molecular technique. j o u r n a l p r e -p r o o f nasopharyngeal swab specimens were collected from samples received at the microbiology department of the cliniques universitaires saint-luc hospital, a tertiary hospital of more than 900 beds in brussels, between april 6 and april 21 2020. samples were selected at random. if the rapid antigen test was not performed immediately, samples were stored at 4°c until the test. in a second time, some samples were ultracentrifuged at 31510g for 2 hours at 4°c. after discarding the supernatant, the 150 µl of residual sample were vortexed and analyzed by the rapid test. the criteria used for the performance assessment of covid-19 ag respi-strip were sensitivity and specificity. rt-qpcr was considered as the gold standard for this evaluation, therefore positive and negative samples by molecular techniques were considered to be true positive and true negative samples, respectively. the overall percentage of agreement and cohen's kappa coefficient (κ) were used to evaluate assay agreement. analyses were performed using graphpad prism 7.0 (graphpad prism software inc., san diego, california) and medcalc 19.2.0 (medcalc software ltd, ostend, belgium). we collected 148 nasopharyngeal samples from 148 patients. the median age of the study population was 57.5 (range: 0-94) with a sex ratio of 0.8 (64 men and 84 women). according in the ongoing pandemic context of covid-19, diagnostic testing for sars-cov-2 is crucial in order to limit the spread of the virus as well as appropriately manage infected patients. different diagnostic test manufacturers have developed rapid tests based on sars-cov-2 proteins detection in respiratory samples. however, the analytical performances of these rapid antigenic tests depend on different factors including the viral load, the quality of the specimen and how it is processed. the performances also depend on the setting of patients tested. although the covid-19 ag respi-strip has several advantages such as the ease and fast achievement of the test, the rapid answer, the lower cost and the non-requirement of special equipment or skills compared with molecular techniques, data presented here suggested that this rapid test is suffering from poor sensitivity. the rapid antigen detection test is able to detect sars-cov-2 with high sensitivity in nasopharyngeal samples with high viral load equivalent at least to 1.7 x 10 5 copies/ml (ct <25), but the sensitivity declines substantially when the viral load decreases with ct values over 30, equivalent to 9.4 x 10 3 copies/ml, which is often the case in patients suffering of covid-19. actually, in our study, while the specificity was 100%, the overall sensitivity of the covid-19 ag respi-strip was 30.2%. this lack of sensitivity of rapid diagnostic tests for virus detection was already observed during the influenza a (h1n1) pandemic 5. ensuring accurate diagnosis is essential to limit the spread of the virus. the poor sensitivity of the covid-19 ag respi-strip leads to false negative results, which in these times of pandemic can be of great consequence. this rapid test was thought to be used as a first line covid-19 diagnostic test in belgium in order to possibility reduce the number of rt-qpcr testing in case of positive results, but requiring confirmation for negative results. however, because negative results cannot rule out sars-cov-2 infection, this test is of little use in a j o u r n a l p r e -p r o o f log (copies/ml) genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding a novel coronavirus from patients with pneumonia in china detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr laboratory testing strategy recommendations for covid-19. interim guidance evaluation of rapid influenza diagnostic tests for detection of novel influenza a (h1n1) virus -united states covid-19 ag respi-strip tests were provided by coris bioconcept, gembloux, belgium. the authors declare no conflicts of interest. key: cord-312971-r9sggqh8 authors: mancino, enrica; cristiani, luca; pierangeli, alessandra; scagnolari, carolina; nenna, raffaella; petrarca, laura; di mattia, greta; la regina, domenico; frassanito, antonella; oliveto, giuseppe; viscido, agnese; midulla, fabio title: a single centre study of viral community-acquired pneumonia in children: no evidence of sars-cov-2 from october 2019 to march 2020 date: 2020-04-29 journal: j clin virol doi: 10.1016/j.jcv.2020.104385 sha: doc_id: 312971 cord_uid: r9sggqh8 pneumonia is an important cause of morbidity and mortality in children. we described viral aetiologies, with particular interest in detecting sars-cov-2, in hospitalized pneumonia children. human rhinovirus was the most frequently detected agent. no children tested positive for sars-cov-2. our findings suggest that sars-cov-2 infection is rare in children and it was not circulating in rome before covid-19 outbreak. rhinovirus was the most frequently detected agent. no children tested positive for sars-cov-2. our findings suggest that sars-cov-2 infection is rare in children and it was not circulating in rome before covid-19 outbreak. key words: community acquired pneumonia, sars-cov-2, covid-19, virus community acquired pneumonia (cap) remains the leading cause of mortality and morbidity in children worldwide [1] . cap aetiology is difficult to establish and it is often multifactorial: viral and bacterial. a considerable number of childhood pneumonias is caused by viruses; in particular, viral infections appear to occur mostly in younger patients [1] . commonly identified viruses in children with cap include respiratory syncytial virus (rsv), influenza (flu) a and b, parainfluenza viruses (piv), adenovirus (adv), human rhinovirus (hrv), human metapneumovirus (hmpv) and human coronavirus (hcov) [2] . ample evidence describes that rsv is the most commonly detected virus in hospitalized children less than 5 years old, both as single virus and as coinfection [2] . varghese l. et al. characterized epidemiology and clinical features of hcovs (hcov 229e, hku1, nl63, and oc43) in children and they found that the proportion of all identified hcovs was highest among 1-5 years old. they detected hcovs both in a community cohort and in hospitalized children and they reported an increased clinical severity in hospitalized children with young age and comorbidity; however, the clinical severity was not associated with hcovs type [3] . several papers demonstrated that the spread of pneumococcal and haemophilus influenzae type b vaccinations reduced the global incidence of children pneumonia [4] . however, mycoplasma j o u r n a l p r e -p r o o f pneumoniae and other atypical bacterial associated pneumonias showed a significant increment, even among pre-school children [5] . in december 2019, a novel coronavirus (sars-cov-2) was identified as the cause of a new infectious disease, the coronavirus disease 2019 (covid-19). covid-19 became a pandemic and it has affected hundreds of thousands of people worldwide. surprisingly, only a small number of cases of covid-19 has been described in children, suggesting that sars-cov-2 infection in the paediatric population is unusual [6] . analysing clinical features of covid-19 hospitalized paediatric patients, chinese preliminary studies reported polypnea, fever and cough as the most common symptoms; a high rate of these patients presented unilateral or bilateral pulmonary lesions on chest computed tomography [7] . streptococcus pneumoniae and haemophilus influenza type b. the aim of the present study was to examine viral aetiologies in children less than 14 years old hospitalized with pneumonia from october 1, 2019 to march 31, 2020. in particular, the most interesting aspect was to test the sars-cov-2 presence and its diffusion among our paediatric population. hmpv and human bocavirus (hbov), as described [8] . real-time pcr reactions targeting the rdrp and the e-genes of sars-cov-2 were developed in-house following the protocols described by corman et al [9] . mycoplasma pneumoniae was detected by real-time pcr reactions on dna extracted from oropharyngeal swabs, as described [10] . demographic, epidemiological, clinical and laboratory data were systematically collected. on hospital admission, we assigned each child a clinical severity score (from 0 to 8) according to respiratory rate, oxygen saturation in room air, presence of retractions and ability to feed [8] . a chest x ray was obtained in all children and radiological findings were classified as single pulmonary consolidation, multiple pulmonary consolidations or interstitial findings. table 1) . our aim was to describe viral aetiologies, with particular interest in detecting sars-cov-2, in hospitalized pneumonia children under 14 years of age. in contrast to a plenty of papers declaring rsv the main cause of children's cap [2] , in our study hrv was more frequently associated with pneumonia. however, the clinical severity score was higher in rsv patients and hrv was found in 9/17 cases (53%) in coinfection, consistent with the notion that hrv is very frequently detected in respiratory infections j o u r n a l p r e -p r o o f during childhood. according to previous studies, no significant laboratory and radiological differences between children hospitalized for pneumonia were observed. since the enrollment period partially overlapped with covid-19 peak infection in italy, we investigated also sars-cov-2 distribution in children hospitalized with cap in a tertiary university hospital in rome. kelvin aa et al. suggest that children are susceptible to sars-cov-2 infection, but frequently they do not have notable disease, raising the possibility that they could be facilitators of viral transmission [11] . in our population, we detected two cases of hku1, an hcov belonging to the same genus beta of sars-cov-2, but no children with cap tested positive for the novel cov. these results seem consistent with several recent papers who have demonstrated that children appear to be less susceptible to severe sars-cov-2 infection [6, 12] . reasons remain unclear [12] . despite some evidences describing pneumonia as the most frequent clinical manifestation among covid-19 hospitalized children [7] , in our population, in rome, no children tested positive for covid-19, even picu admitted ones. another interesting aspect was the hospitalization rate, spanning from 13 (31%) in february to 3 (7%) in march. environmental risk factors such as household crowding and air pollution, as well as virulence factors, play a fundamental role in developing lower respiratory infection [13] and particularly pneumonia [14] . accordingly, the lockdown that italian authorities established to confine covid-19 and the resulting decrease in social interactions (schools and day nurseries closure) were likely determinant in reducing cap which required hospitalization. the major limitation of our study was the small size of the sample. however, to our knowledge, no reports about sars-cov-2 detection in children admitted for cap before and during covid-19 outbreak are available. in conclusion, in this small study, we demonstrated that no children tested positive for sars-cov-2 over october 2019-march 2020 period, confirming sars-cov-2 is very rare in children and it was not circulating in rome the months before the italian covid-19 outbreak. we community-acquired pneumonia in children -a changing spectrum of disease childhood pneumonia: the role of viruses epidemiology and clinical features of human coronaviruses in the pediatric population the effect of haemophilus influenzae type b and pneumococcal conjugate vaccines on childhood pneumonia incidence, severe morbidity and mortality detection of mycoplasma pneumoniae in children with lower respiratory tract infections systematic review of covid-19 in children shows milder cases and a better prognosis than adults clinical and ct features in pediatric patients with covid-19infection: different points from adults respiratory syncytial virus, human bocavirus and rhinovirus bronchiolitis in infants detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr detection of mycoplasma pneumoniae, chlamydia pneumoniae, and legionella spp. in clinical specimens using a single-tube multiplex real-time pcr assay covid-19 in children: the link in the transmission chain will children reveal their secret? the coronavirus dilemma risk factors for virus-induced acute respiratory tract infections in children younger than 3 years and recurrent wheezing at 36 months follow-up after discharge risk factors for severe acute lower respiratory infections in children: a systematic review and meta-analysis key: cord-310140-h7uwl0pb authors: templeton, k.e.; forde, c.b.; loon, a.m. van; claas, e.c.j.; niesters, h.g.m.; wallace, p.; carman, w.f. title: a multi-centre pilot proficiency programme to assess the quality of molecular detection of respiratory viruses date: 2005-07-12 journal: j clin virol doi: 10.1016/j.jcv.2005.05.005 sha: doc_id: 310140 cord_uid: h7uwl0pb objectives: to assess the quality of molecular detection of respiratory viruses in clinical diagnostic laboratories. study design: respiratory virus proficiency panels were produced from diluted stocks of respiratory viruses provided and tested by four reference laboratories. the panels consisted of strong positive, positive, low positive and negative samples for influenza viruses a and b, respiratory syncytial virus, parainfluenza viruses 1 and 3, adenovirus serotypes 4 and 7, human rhinovirus serotypes 16, 72 and 90, human coronaviruses oc43 and 229e. the panels were sent to 17 participants; results and information on methodology was collected. results: all laboratories returned results, of which five submitted complete data sets. so, for analysis all results were combined. samples were correctly identified by participants in 93.75%, 76.75% and 47.03% for the high positive, positive and low positive samples, respectively. one false positive was reported for all data sets (1.1%). the overall score for all assays using different methodologies was 78.8%. laboratory performance was not dependant on methodology as all in-house methodologies could achieve optimal results, but dependant on careful optimisation and procedures specific to the laboratory. conclusions: the first proficiency panel showed that in general all participants performed well. although, it also highlights areas for improvement for all participants in order to generate robust results for use in clinical diagnostics. detection of respiratory viruses in clinical samples is important for effective patient management and infection control. many viruses are involved in respiratory infection and include: influenza viruses a and b, respiratory syncytial virus (rsv), parainfluenza viruses (piv) 1-4, adenoviruses (adv), human rhinoviruses (hrv), human coronaviruses (hcov: oc43, 229e, nl-63, nl-hong kong and severe acute respiratory syndrome coronavirus (sars-cov)) and human metapneumoviruses (hmpv). many of the infections are indistinguishable by clinical features alone and require rapid laboratory investigation for optimal patient management and infection control. detection of respiratory viruses is becoming clinically important as the possibilities for antiviral treatment increase. some of the viruses (hrvs and hcovs) were initially considered as causing mild infections but are now more frequently found to be associated with severe infections (ison et al., 2003; van elden et al., 2004) . viral culture is the gold standard for laboratory diagnosis of respiratory viruses. however, some viruses grow poorly in cell culture, and therefore routine diagnosis is sub-optimal as, for example, with hmpv (van den hoogen et al., 2004) . furthermore, culture is relatively slow which affects the clinical value, and therefore alternatives are employed. rapid antigen detection tests are available for influenza viruses a and b, piv 1-3 and rsv and adenoviruses, which are widely used in routine laboratories. these have been shown to be less sensitive and less specific than culture, particularly in adult or elderly populations (casiano-colon et al., 2003; effler et al., 2002; storch, 2003) . amplification assays are now increasingly being used in the clinical laboratory and have proven to be more sensitive and specific than culture (syrmis et al., 2004; van elden et al., 2002; weinberg et al., 2002 weinberg et al., , 2004 . newer real-time pcr formats also enable rapid test results (templeton et al., 2004) while some conventional formats can detect a large number of respiratory viruses in a single test (puppe et al., 2004; coiras et al., 2004; gruteke et al., 2004) pcr is often the most appropriate means to diagnose slow growing viruses (van elden et al., 2004; van den hoogen et al., 2004) due to the difficulties sometimes observed with culture. currently, some commercial assays are available for respiratory virus testing (henrickson, 2004) but the majority of assays applied in clinical diagnostic laboratories have been developed in-house and standardisation is problematic for all formats. laboratories performing respiratory molecular tests want to report accurate and reliable results regardless of the type of assay in use and one of the best ways to assess performance is to participate in proficiency programmes, enabling laboratories to evaluate their performance (schirm et al., 2002; schloss et al., 2003; noordhoek et al., 2004; verkooyen et al., 2003) . a pilot study for the evaluation of nucleic acid amplification technologies (nats) for detection of respiratory viral pathogens was organised by quality control for molecular diagnostics (qcmd) (www.qcmd.org). the aim of the pilot programme was to perform a comparative study of the current nats and protocols used for the molecular detection of a variety of respiratory viruses. the aim of this study was to focus on the sensitivity and specificity of the nat protocols used, as well as the methodology employed for molecular testing. a project group comprising qcmd and four european laboratories was established to co-ordinate and produce materials for the proficiency programme panel. each laboratory was responsible for the production of bulk stocks for a number of defined viruses: specialist centre for virology (svc), gartnavel general hospital, glasgow, uk (influenza viruses a and b, rsv a); university medical centre utrecht (umcu), the netherlands (hrv 16, 72 and 90); erasmus medical center (emc), rotterdam, the netherlands (229e and oc43, hmpv); leiden university medical center (lumc), leiden the netherlands (piv 1 and 3, adv 4 and 7). at svc stocks of influenza a virus (a/new caledonia/20/99 (h1n1)) and influenza b virus (b/victoria/504/00) were prepared on mdck cells in medium 199. a rsv a clinical isolate (03.413667) was cultured on hep-2 cells in mem (+2%, v/v, fcs) . viral nucleic acid extraction was carried out using the biorobot blood dna kit (qiagen, crawley, uk). real-time pcr with taqman probes was used to amplify the influenza virus a ns gene, influenza virus b matrix gene and the rsv nucleocapsid gene on the i-cycler iq real-time detection system (biorad, hemel hempstead, uk). clinical isolates of adv 4 and 7 were cultured on a549 cells in mem (+10%, v/v, fcs) and the subtype was confirmed by serotyping and sequence analysis. clinical isolates of piv 1 and 3 were cultured on llc-mk2 cells and the subtype was confirmed by monoclonal antibody staining and sequence analysis. virus nucleic acid extraction was carried out with qiaamp blood dna mini spin protocol for adv and the qiaamp viral rna mini spin protocol for piv (qiagen, hilden, germany). real-time pcr with molecular beacons were used to amplify the adv hexon gene and the piv haemagluttinin-neuramididase gene on the i-cycler iq real-time detection system (biorad, veenendaal, the netherlands). atcc strains of 229e and oc43 and the hmpv isolate 00-1 (van den hoogen et al., 2001) were cultured on vero cells in mem (+10%, v/v, fcs). virus nucleic acid extraction was carried out using the magnapure lc total nucleic acid kit (roche applied science, almere, the netherlands). realtime pcr was performed with taqman probes to amplify and detect the nucleocapsid gene of oc43 and 229e and the nucleoprotein of hmpv on the abi prism 7700 sequence detection system (applied biosystems, nieuwerkerk aan de ijssel, the netherlands). the human rhinoviruses (hrv) were donated by dr. tapani hovi (ktl, helsinki, finland) and were originally obtained from atcc, hrv type 16), rivm (bilthoven, the netherlands, hrv type 72) and janssen pharmaceutica (beerse, belgium, hrv type 90). they were grown on hela ohio cells in roller tube cultures at 33 • c, and characterised by acid-lability testing, serotyping and sequence analysis. for production of stocks for the pilot proficiency panel, viruses were grown in human diploid fibroblast cells. virus nucleic acid extraction was carried out using the magnapure lc total nucleic acid kit and real-time pcr was performed on the abi prism 7700 sequence detection system with taq-man probes to amplify the 5 non-coding region (ncr) of rhinoviruses. each laboratory prepared a small-scale dilution series from their bulk stocks and determined the lower limit of detection (lld) for each virus stock, based on real-time cycle threshold (c t ) values (table 1) . this process was repeated by a second laboratory. thereafter, the project group selected three dilutions of each virus for inclusion in the proficiency panel. bulk dilution stocks were then prepared in virus transport medium (vtm) except for influenza virus b, which was prepared in medium 199 (+10%, v/v, fcs). the bulk dilution stocks were repeat tested using the same methodology (data not shown), dispensed into 1 ml aliquots and shipped on dry ice to qcmd for coding, packaging and distribution to participants. the panel samples were randomised by qcmd, labelled, packed and distributed to participants on dry ice along with a panel receipt form, an instruction leaflet, a reporting form and a questionnaire for technical details. the panel was distributed in the form of six sub-panels: panel a: containing influenza viruses a and b; panel b: piv 1 and 3; panel c: rsv a and hmpv; panel d: hrv 16, 72 and 90; panel e: adv 4 and 7; panel f: hcov 229e and oc43. each sub-panel contained a three-member dilution series for each virus, a mixed sample (except for panel c) and a negative sample. laboratories who had expressed an interest to qcmd in participating in a proficiency programme for molecular detection of respiratory viruses were asked to complete a questionnaire detailing technical aspects of the assays they had applied. each participating laboratory was assigned a unique, confidential code. participants were requested to return the result form and technical questionnaire, either by fax or by e-mail, before the closing date for return of the results, which was 6 weeks post-distribution. the majority of participants did submit results prior to the closing date, but as a number of participants requested additional time to complete testing, the date for return of results was extended to 10 weeks. results and questionnaire data was collated and validated by qcmd and participants were recontacted, if further information was required. result codes letters were sent to all participants after all results had been received. results were scored: 2 points for a correct result, 0 for an incorrect and 1 for an equivocal result on a positive sample or for detection of only one sample in a mixed sample in the influenza viruses a and b, piv 1 and 3 and coronavirus 229e and oc43 panels. the mixed samples in the adenovirus and rhinovirus panels were not scored, as they required typing results and this was not requested. the results of the molecular testing of the samples in the proficiency panel are shown in table 2 . three dilutions of each of the 13 different viruses were included in the qc panel. five of the 17 (29%) participants provided complete data sets on all viruses and none of these five reported 100% correct. the high positive sample was on average correctly identified by 93.8% (range 72.7-100%) by the participants. the mean only 2 of 11 participants achieved a 100% score for the hrv panel. three participants did not detect any of the hrv 72 samples, although they could detect the other rhinovirus types 16 and 90, even in the low positive. three participants who detected hrv 72 as the low positive did not detect both hrv 16 and 90 in the low positive. four of the 14 participants scored 100% in the adenovirus panel. all participants detected the strong positive adenovirus 4 (subtype e) sam-ple and 10 out of the 14 participants detected the low positive sample. in contrast, only 12 out of the 14 participants detected the strong positive adenovirus 7 (subtype b) sample and 8 out of the 14 participants detected the low positive adenovirus 7 sample. in the hcov panel, all participants detected the strong positive samples but none of the participants detected the low positive sample for oc43 in contrast, four out of eight participants detected the low positive for 229e. the performance of the 17 laboratories is shown in table 3 . the mean overall score was 78.8% with a range from 46.4% to 96.9%. ninety-four assays were used for all different targets of which 42 (44.5%), 27 (29%) and 25 (26.5%) were realtime pcr, nested pcr and other methodologies, respectively. six participants used a combination of methodologies. the scores obtained for each of the individual panels are shown in table 3 . the hmpv panel was performed best with 12 out methodology used as indicated by integers in superscripts: 1 real-time pcr; 2 nested pcr; 3 nucleic acid sequence amplification (nasba); 4 single pcr; 5 multiplex reverse line blot (pcr amplification with detection by reverse line blot); 6 rv ® chip assay (manufactured by bcs biotech spa, cagliari, italy); 7 only assay for 229e performed, nt = not tested, ns = not scored. of 14 participants scoring 100% whereas the piv panel had only one participant scoring 100% and 10 out of 15 scoring <70%. six participants performed real-time pcr, as the only nat technology, and their overall rank was 2, 4, 5, 7, 13 and 17. the only commercially available assay was the rv ® chip assay and this had an overall performance of 57.1%. the other assays were all in-house protocols and consist of many different parameters and technical aspects. the correlation between these aspects and a 100% score is given in table 4 and this shows that a maximum score in the panel could be achieved with any combination of methodology and protocol. the different genes targeted in the nat assay are shown in table 5 . four out of the five nats targeted to the matrix protein of influenza virus detected the weak positive sample, whereas only two of the five non-structural protein nats detected the low positive sample. the nat assays for the hn protein of piv detected the weak positive samples, whereas the nat targeting the nucleoprotein and fusion protein only detected the strong positive sample. the study described here is the first large-scale external quality assessment scheme for the molecular detection of respiratory viruses. application of nats for respiratory virus diagnosis is increasing as it is recognised as the best method for rapid, sensitive and specific diagnostic results (van elden et al., 2002) . sixteen of the 17 participants in this study have developed their own 'in-house' nat assays using a large variety of nat protocols. in order for laboratories to assess the quality of these in-house assays an external qa programme has been developed. the performance in external qa panels is an integral part in accreditation and quality management of clinical diagnostic laboratories. the preparation of a suitable panel that is reproducible and of a high quality to assess the performance of the nats is demanding. in this study, samples were grown in cell culture and dilutions were made so sensitivity and limited specificity of assays for these viruses could be assessed. the panels were assessed as a small-scale dilution series prior to distribution in a second laboratory to determine the detection limit after a freeze-thaw step. thereafter, the same stock viruses were used to prepare the final panels. these samples were not assessed by more than one reference centre prior to distribution so there have been some differences between the initial small-scale dilution series and the bulk panels sent to all participants. the lowest positive dilution used for oc43 was detected by none of the participants, so this dilution was too low for inclusion in further panels. however, for many of the panels, a number of the nats used have detected all dilutions of the viruses in the panels, showing that the panels employed gave a good indication of nat performance. in the future, the panel could be produced by freeze-drying the samples and include more pre-distribution testing to ensure more reproducible panels, as employed in other qcmd schemes (schirm et al., 2002; schloss et al., 2003) . the panels employed in this distribution used samples that reflected the limit of detection according to nats used in two reference laboratories. the clinical relevance of these detection levels was not assessed; as it is not known what detection limit is required to detect clinically relevant respiratory virus infections. the limit of detection employed in these panels probably reflects a good guide to assess the sensitivity of nats. at present, there is no international reference material for respiratory virus nat's and these panels can provide the basis for new internationally recognised stocks. one false positive was detected in the negative sample in the hrv panel. no false positives were detected in any other panels, giving a 1.1% false positive rate in the whole distribution. this shows a high level of technical skill in the participating laboratories. in other qa programmes in which many 'in-house' methods were used, the false positivity rates have been much higher (schloss et al., 2003) . the reduction of the false positivity rate may also be as a result of the use of real-time pcr, which reduces the chance of contamination. in general, correct results were obtained with a mean of 93.8% of the strong positive samples, with participants failing to detect a mean of 23.2% and 53.0% of the positive and low positives, respectively. the false negative results observed were either results of samples below the detection limit of the assays, or of primer and probes not detecting the viruses at all. the selection of primers and probes for respiratory viruses is essential as a single nat is employed for a specific virus that needs to detect many variants. adenoviruses comprise of six different serotypes that show large sequence variation and rna viruses show even greater sequence variation, as they lack proof reading capability. the virus included in the hmpv panel was a very well characterised (van den hoogen et al., 2001) , and therefore this information would have been used to generate nats whereas the pivs were clinical isolates with no publicly available sequence information. this knowledge of sequence information would affect the design of the nats, and hence one of the reasons why the hmpv panel had good performance scores and the piv poor. there were some assays that did not detect a particular virus at all, e.g. piv 1 and rsv while other nat's by the same laboratory performed well. this is a result of poor primer and probe design to a non-conserved region of the virus. most of the panels only contained one virus type; however, the panel for hrv contained three subtypes and the panel for adv contained two subtypes. these two panels showed that some assays were unable to detect certain subtypes, even in the high positive sample, but were able to detect the weak positive with other subtypes. this is a result of primer and/or probe selection, which were unable to detect these viruses owing to the sequence variation seen in these strains. therefore, participants who missed these strains would need to adapt their nat in order to detect the possible variations. these results indicate the problem of using nat methods for detection of respiratory viruses, in that they are not catchall methods and careful evaluation of the primers and probes needs to be performed to ensure that no false negatives are obtained. all respiratory viruses detected in clinical samples will have sequence variation. so, in future panels more viruses to determine the ability of assays to detect clinical isolates might be included. in the case of influenza a and b, the strains included could be the most common circulating strains from the previous winter. in this way, the quality of the nats can be monitored for detection of a wide variety of viral strains. the other reason that assays failed to detect viruses in the weak positive was the lack of sensitivity of the nat or procedures in the laboratory. there are a lot of factors that affect nat sensitivity but this study gives some indications as to ways to improve sensitivity with pcr format, selection of gene target for the pcr and design of primers and probe. firstly, all the individual components of the 83 in-house nat could achieve maximal sensitivity in one or more panels, so the difference in sensitivity is probably due to inter-laboratory variation. another factor that affects sensitivity is the methodology. however, all methodologies, except the one laboratory using the rv ® chip assay, could obtain maximum scores. so, again, the differences are probably due to inter-laboratory variations. a wide range in performance could be seen with the same methodology, e.g. real-time pcr. the selection of the gene target was also shown to affect the sensitivity, in that some targets result in a more sensitive nat. comparisons of different targets have been shown with hmpv where either the polymerase or the nucleoproteins were shown to be more sensitive than matrix, fusion and phosphoprotein (cote et al., 2003; maertzdorf et al., 2004) . the results here suggest that for influenza a the m protein is a good target and the hn for piv 3. the conservation of the target is also important as the primers and probe need to detect all the virus types, so in some cases, a primer with two or three mismatches may work for a particular virus although the sensitivity will be affected. therefore, assays, which only detected the strong positive dilution using a good sensitive methodology, may need to check for a mismatch of the primer and probe sequence and potentially include further forward or reverse primers to achieve good sensitivity. inclusion of additional primers or probes to improve the range of detection has been shown in the case of enteroviruses and rhinoviruses previously (deffernez et al., 2004; nijhuis et al., 2002) . respiratory virus detection by culture has limitations owing to the sensitivities of cell lines to clinical isolates, this is particularly apparent with hrv and hcov. although reference strains can be used to check sensitivity of a particular cell line this does not necessarily mean that it will detect all clinical isolates. this problem can be equally true for poorly evaluated nats. nevertheless, nat is becoming a valuable diagnostic tool, and hence the need for laboratories to perform quality control to evaluate sensitivity. the production and distribution of this first respiratory virus panel showed that 92.4% of participants detected the strong positive and 47% of participants detected the low positive correctly. the panel also gives a very good indication to participant as to where to improve the assay's design as well as providing a good measure for the integrity of the nat employed by a laboratory. lack of sensitivity of rapid antigen tests for the diagnosis of respiratory syncytial virus infection in adults simultaneous detection of fourteen respiratory viruses in clinical specimens by two multiplex reverse transcription nested-pcr assays comparative evaluation of real-time pcr assays for detection of the human metapneumovirus amplicon sequencing and improved detection of human rhinovirus in respiratory samples enhancing public health surveillance for influenza virus by incorporating newly available rapid diagnostic tests practical implementation of a multiplex pcr for acute respiratory tract infections in children advances in the laboratory diagnosis of viral respiratory disease rhinovirus infections in hematopoietic stem cell transplant recipients with pneumonia real-time reverse transcriptase pcr assay for detection of human metapneumoviruses from all known genetic lineages rapid and sensitive routine detection of all members of the genus enterovirus in different clinical specimens by real-time pcr multicentre quality control study for detection of mycobacterium tuberculosis in clinical samples by nucleic amplification methods evaluation of a multiplex reverse transcriptase pcr elisa for the detection of nine respiratory tract pathogens external quality assessment program for qualitative and quantitative detection of hepatitis c virus rna in diagnostic virology an international external quality assessment of nucleic acid amplification of herpes simplex virus rapid diagnostic tests for influenza a sensitive, specific, and cost-effective multiplex reverse transcriptase-pcr assay for the detection of seven common respiratory viruses in respiratory samples rapid and sensitive method using multiplex real-time pcr for diagnosis of infections by influenza a and influenza b viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3 and 4 van den hoogen bg, osterhaus dm, fouchier ra. clinical impact and diagnosis of human metapneumovirus infection polymerase chain reaction is more sensitive than viral culture and antigen testing for the detection of respiratory viruses in adults with hematological cancer and pneumonia frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction reliability of nucleic acid amplification methods for detection of chlamydia trachomatis in urine: results of the first international collaborative quality control study among 96 laboratories the value of polymerase chain reaction for the diagnosis of viral respiratory tract infections in lung transplant recipients superiority of reverse-transcription polymerase chain reaction to conventional viral culture in the diagnosis of acute respiratory tract infections in children seventeen european laboratories were invited by qcmd to take part in the respiratory virus pilot programme: key: cord-300316-r54ksiy3 authors: moesker, f.m.; van kampen, j.j.a.; aron, g.; schutten, m.; van de vijver, d.a.m.c.; koopmans, m.p.g.; osterhaus, a.d.m.e.; fraaij, p.l.a. title: diagnostic performance of influenza viruses and rsv rapid antigen detection tests in children in tertiary care date: 2016-03-25 journal: j clin virol doi: 10.1016/j.jcv.2016.03.022 sha: doc_id: 300316 cord_uid: r54ksiy3 background: rapid antigen detection tests (radts) are increasingly used to detect influenza viruses and respiratory syncytial virus (rsv). however, their sensitivity and specificity are a matter of debate, challenging their clinical usefulness. objectives: comparing diagnostic performances of binaxnow influenza ab(®) (bni) and binaxnow rsv(®) (bnr), to those of real-time reverse transcriptase pcr (rt-pcr), virus isolation and direct immunofluorescence (d-if) in paediatric patients. study design: between november 2005 and september 2013, 521 nasal washings from symptomatic children (age <5 years) attending our tertiary care centre were tested, with a combination of the respective assays using rt-pcr as gold standard. results: sensitivity, specificity, positive predictive value (ppv) and negative predictive value (npv) of bni were 69% (confidence interval [ci] [51–83]), 96% [94–97], 55% [39–70] and 98% [96–99] respectively. of eleven false-negative samples, rt-pcr ct-values were higher than all rt-pcr positive test results (27 vs 22, p = 0.012). of twenty false-positive samples, none were culture positive and two tested positive in d-if. sensitivity, specificity, ppv and npv for bnr were 79% [73–85], 98% [96–99], 97% [93–99] and 88% [84–91]. of the 42 false-negative samples the median ct-value was higher than that of all rt-pcr positive samples (31 vs 23, p < 0.0001). five false-positive samples were detected. three of these tested positive for rsv in virus isolation and d-if. conclusions: radts have a high specificity with bnr being superior to bni. however, their relative low sensitivity limits their usefulness for clinical decision making in a tertiary care paediatric hospital. influenza viruses and respiratory syncytial viruses (rsv) cause acute respiratory tract infections (artis) in children, being a leading cause of hospitalization [1] [2] [3] . identification of both viruses is important for disease management, as the presence of these infections may require specific treatment (i.e. oseltamivir) and hospital containment measures. the current gold standard for detection of these viruses is real-time reverse transcriptase pcr (rt-pcr) [4] . this is however not performed in all hospitals, as it requires a molecular diagnostic laboratory with specialized personnel and equipment. instead, rapid antigen detection tests (radts) are used as these assays are easier and cheaper to perform and less time-consuming [5] [6] [7] . the performance of these tests depends on factors like time between disease onset and sampling, quality and type of specimen and epidemiological parameters [8] . diagnostic value and clinical usefulness of radts for influenza diagnosis vary greatly [5] [6] [7] [9] [10] [11] [12] . this prompted us to evaluate the diagnostic performance of the routinely used radts (manufactured by alere binaxnow ® ) for these two viruses as used in our tertiary care paediatric hospital. comparing diagnostic performances of two radts, binaxnow influenza ab ® (bni) and binaxnow rsv ® (bnr), with those of rt-pcr in samples of paediatric patients attending our tertiary care centre with artis for a period of almost eight consecutive years. discrepant data were subsequently compared with those of virus isolation and direct immunofluorescence (d-if) assays. this study was conducted from november 2005 through september 2013, we identified paediatric patients between 0 and 5 years who attended erasmus mc-sophia's emergency department, out-patient-clinic and those who were hospitalized in this period. to analyse the performance of the bni and bnr compared to rt-pcr we selected 521 nasal washings of 489 patients with a median age of 4 months (minimum 0.03-maximum 58 months, lower interquartile range 1.6-upper interquartile range 9.8) and 55% (268/489) were male. nasal washings were obtained during routine clinical practice in symptomatic children and were tested immediately after sampling by trained laboratory personnel using all four diagnostic methods. multiple samples from the same patient were included in our analysis. therefore patients are referred to as cases. data regarding gender, age and hospital admission were obtained from the electronic patient files. data collection and analyses were conducted on anonymized samples, which does not require further medical ethics review as consented by our medical ethical board (mec-2015-306). all nasal washings were tested for the presence of selected viruses by means of rt-pcr with primers and probes sets used in the routine setting of our department [13] . in short, rna and dna were extracted using magnapurelc (roche diagnostics, almere, the netherlands) and the total nucleic acid isolation kit. the extractions were internally controlled by addition of a known concentration of phocine distemper virus (pdv) and phocine herpes virus (phv). uni-plex rt-pcr was used to detect rsv-a, rsv-b, human rhinovirus (hrv), parainfluenza virus (piv) type 3 (piv-3), adenovirus (adv), and human bocavirus (hbov). duplex reactions were performed combining influenza a virus and pdv, influenza b virus and human coronavirus (hcov) oc43 (hcovoc43), human metapneumovirus (hmpv) and piv-2, hcov229e and piv-4, and hcovnl63 and piv-1. a cycle threshold value (ct-value) of <40 was defined positive for any virus. rt-pcrs were developed in-house for influenza viruses and rsv-a and validated [13] . rsv-b primers and probes were used as reported by dewhurst-maridor et al. [14] . alere binaxnow ® influenza a and b (bni) and alere binaxnow ® rsv (bnr) (scarborough, maine, usa) are commercially available in vitro immunochromatographic assays for the qualitative detection with monoclonal antibodies directed against influenza a and b virus nucleoproteins and rsv fusion protein antigen, respectively. nasal washings were obtained using standard protocols and rapid antigen testing was performed as described by the manufacturer. for our analyses the test results of bni influenza a and influenza b were combined into a single influenza bni dataset as influenza b was not encountered frequently with only four influenza b bni positive samples, two of which were influenza b rt-pcr positive. virus isolation assays were always performed in combination with d-if. madin-darby canine kidney (mdck) cell line (nbl-2) (atcc ® ccl-34 tm ) and the human cell line hep-2 (atcc ® ccl-23 tm ) were used to isolate influenza viruses and rsv respectively. virus cultures were regularly checked for cytopathic effect by light microscopy. immunofluorescence with fluorescein isothiocyanate (fitc) labeled monoclonal antibodies was used to confirm the presence of influenza virus or rsv [15] . cells were isolated from nasal washings, dried on microscope slides, and fixed with acetone. subsequently, cells were stained with fitc conjugated monoclonal antibodies against influenza a virus, influenza b virus or rsv (imagen tm influenza a and b and imagen tm rsv, hampshire, united kingdom). specimens were incubated with fitc-conjugated antibodies for 15 min at 37 • c, subsequently excess reagent was washed off with phosphate buffered saline. the stained area was then mounted and viewed by fluorescent microscopy. the focus of our study was to compare data obtained with two radts, bni and bnr with those obtained by rt-pcr as gold standard. we defined false-negative tests as those for which the rapid test was negative and the gold standard rt-pcr positive; a falsepositive test result was defined if the rapid test tested positive and the gold standard rt-pcr tested negative. we compared the available ct-values in all respective categories of samples and analysed whether there was an association between ct-values and radts results and hospitalization. for influenza all ct-values were available, for rsv ct-values were available for 183/204 (90%) of the performed tests. missing ct-values were from samples tested in 2005 and 2006 when routine input of ct-values in our laboratory system was not yet performed and digital documentation was not available. finally, false-negative and false-positive test results were compared to test results obtained with the other virus detection methods: virus isolation and d-if assays. the main outcomes of this study were the sensitivity, specificity, positive predictive value (ppv) and negative predictive value (npv) of the bni and bnr rapid test results compared to rt-pcr during the total study period and during viral season (october 1st through march 31st). ct-values were compared with mann-whitney u tests. 1) . we also calculated these parameters only with samples obtained in the period from october 1st through march 31st, when respiratory viruses are more prevalent in the netherlands. sensitivity and specificity decreased with 2% and 1% respectively (69%-67% and 96%-95%). ppv and npv both decreased with 1% from 55% to 54% and 98%-97% respectively. of 514 nasal washings both rsv rt-pcr and bnr data were available. of these, 204 cases were rsv rt-pcr positive (204/514, 40%) with ct-values available for 183 samples ranging from 14 to 39 (median ct-value 23) and 167 were bnr positive (167/514, 32%) ( table 1) . hundred sixty-two samples were rt-pcr positive and bnr positive (162/514, 32%, median ct-value 21 , no ct-value available n = 15). forty-two cases were considered false-negative (42/514, 8%, median ct-value 31 [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] , no ct-value available n = 6). of the 310 rt-pcr negative cases, five were bnr positive and considered false-positive cases ( (305/347). we also calculated these parameters during the respiratory virus season (october-march) and sensitivity increased with 1% (79%-80%), but the specificity remained the same (98%). ppv increased with 1% (from 97% to 98%) and npv decreased with 3% from 88% to 85% respectively. from the eleven false-negative bni cases, influenza virus was successfully isolated in six cases (6/11, 55%, median ct-value 25 [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] ), three of which were also influenza d-if positive. by means of rt-pcr, virus isolation or d-if 7/11 (63%) samples tested positive for another virus, most frequently rsv (n = 3) or adenovirus adv (n = 3) (see supplemental table 1a in the online version at doi: 10. 1016/j.jcv.2016.03.022). bnr results were considered false-negative in 42 cases, in 25 (60%) of those rsv was cultured successfully. in these 25 cases the ct-values ranged from 22 to 39 with a median of 32. in addition, in 20/42 (48%) cases, rsv d-if tested positive (median ct-value 29 [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] ). co-infections were found in 16/42 (38%) cases and most often hrv (n = 7). in four cases bni tested positive for influenza, which could be confirmed for three samples by rt-pcr (see supplemental of the 20 influenza false-positive cases, six tested positive in bnr (6/20, 30%). moreover, six cases tested rsv rt-pcr positive (6/20, 30%) of which five were also bnr positive. in eight samples another respiratory virus than influenza virus or rsv was detected with rt-pcr (8/20, 40%). for two samples the d-if was positive for influenza, in accordance with the bni, but for both virus isolation did not yield influenza virus (see supplemental for bnr only five false-positive cases were found. three of these were rsv positive in virus isolation and d-if (3/5, 60%). one case tested negative in all methods except for bni (see supplemental table 2b in the online version at doi: 10.1016/j.jcv.2016.03.022). the sensitivity (80%), specificity (99%) and ppv (99%) increased if we considered the three rsv positive virus isolations as true-positive cases, resulting in only two false-positive cases (2/514, 0,4%). of all 521 patients tested for bni and bnr 361 patients (361/521, 69%) were hospitalized. hospitalization rates were 16/24 (67%) and 115/162 (71%) for true-positive bni and bnr cases respectively. false-negative test results did not seem to have a major impact on hospitalization with hospitalization rates of 7/11 (64% vs 69%, p = 1) and 25/42 (60% vs 71%, p = 0.1912) for bni and bnr test results respectively ( table 2) . comparing the ct-values of the respective categories, bni and bnr cases that were false-negative displayed overall higher ct-values (p = 0.012 vs p < 0.0001) (fig. 1a and b) . however, no differences were found in ct-values of hospitalized and non-hospitalized patients within the respective case groups (p > 0.5 for both bni and bnr) ( fig. 2a and b) . the bni test result did not differentiate for severe disease with three of the false-negative cases admitted to the paediatric intensive care unit (picu), but also three the present study evaluated the diagnostic performance of bni and bnr radts in a large number of symptomatic paediatric patients between 0 and 5 years attending our tertiary care paediatric hospital during almost eight consecutive years. by testing fresh nasal washings with rt-pcr, we found a relatively low sensitivity and ppv for bni. the overall test performance of bnr scored higher for all these aspects. both bni and bnr false-negative cases displayed a significantly higher ct-value compared to all rt-pcr positive and true-positive tested cases. the accuracy of rapid tests is generally less than that of rt-pcr and virus isolation assays. however, radts are valuable as a point-of-care test for their ease of use, fast results and laboratory independence [8] . these advantages, and especially the high specificity are important for their use as surveillance tools for influenza outbreaks as recommended by the world health organization [8] . indeed for surveillance purpose a high specificity is of importance, which we found to be the case in our study. however, for clinical management this is not sufficient. in theory, the decision to start antiviral therapy and to refrain from unnecessary further diagnostic testing and antibiotic use may be based on radt [16] [17] [18] . in addition, rapid test results may result in more effective isolation and containment measures [6] . for this purpose assay sensitivity is of utmost importance. therefore, we conclude that the relatively low sensitivity of the bni in our tertiary care centre is worrisome. of note, bnr test performance proved to be better compared to the bni, although false-negative cases were detected. based on our results we stopped using bni and will use rapid pcr-based tests for detection of influenza virus and rsv. we considered the clinical implications of a false-negative and false-positive test result in relation to hospitalization and found no significant differences between these groups and rt-pcr positive and bni positive tested cases, indicating that the clinical observation is still pivotal in admission decision-making as suggested by current guidelines. in the present study we were not able to study effects of testing on treatment since antiviral medication was not routinely used in our hospital before 2009. data on isolation and containment measures were not available. although the retrospective nature of our study has inherent limitations, we were able to include more than 500 samples of patients over time. since, our study spanned a considerably longer period of time than previous studies, we were able to test the clinical feasibility of radts "in a real life" clinical setting and for different circulating virus subtypes during eight consecutive seasons. overall, most studies reported a high specificity and high npv versus a low sensitivity and low ppv for bni, which is largely in agreement with our results [5] [6] [7] [9] [10] [11] [12] . we did find a relatively high sensitivity of 79% and an even higher ppv (97%) for bnr, which is in agreement with data obtained in other studies [5, 19, 20] . during the last decade, rt-pcr has become the gold standard for detecting the presence of respiratory viruses [4] . the downside of rt-pcr is the relatively long time (6-24 h) between sample collection and availability of test results [21] . this makes current rt-pcr formats less useful for admission decision-making and calls for faster methods. indeed, new rapid point-of-care pcrs are being developed and implemented with a shorter turnaround time [22] [23] [24] [25] [26] [27] . studies comparing their performances with those of rt-pcr would allow us to judge their potential for clinical decision-making. in conclusion, we evaluated the performance of the radts bni and bnr in a tertiary care paediatric hospital setting over eight consecutive years. we showed that sensitivity and ppv of bni were relatively low (69% and 55%), whereas those of bnr were higher (79% and 97%) when compared to the respective gold standard rt-pcr. false-negative samples consistently displayed high ct-values, although this did not influence whether patients were hospitalized or not. given the relatively low sensitivity and ppv of the bni we strongly advocate a restricted use of bni or similar rapid influenza antigen detection assays in a tertiary paediatric care setting. in contrast, the higher sensitivity and ppv of the bnr rendered this rapid test more useful, albeit still less sensitive than rt-pcr. pf participates in the iris trial, sponsored by hoffmann-la roche. pf, mk and ao received funding from the eu fp7 project prepare (602525) for studies on the pathogenesis of viruses in children. pf and ao received funding from virgo project nwo the netherlands (fes0908). ao received funding from n-rennt dfg germany. data collection and analyses were conducted on anonymized samples, which does not require further medical ethics review as consented by our medical ethical board (mec-2015-306). community-acquired pneumonia requiring hospitalization among u.s children global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis global burden of respiratory infections due to seasonal influenza in young children: a systematic review and meta-analysis diagnostic assays for respiratory syncytial virus disease antigen-based assays for the identification of influenza virus and respiratory syncytial virus: why and how to use them in pediatric practice update on influenza diagnostics: lessons from the novel h1n1 influenza a pandemic accuracy of rapid influenza diagnostic tests: a meta-analysis who recommendations on the use of rapid testing for influenza diagnosis, world health organization evaluation of five rapid diagnostic kits for influenza a/b virus diagnostic performance of the binaxnow influenza a&b rapid antigen test in ed patients performance of six influenza rapid tests in detecting human influenza in clinical specimens low sensitivity of rapid diagnostic test for influenza incidence of viral respiratory pathogens causing exacerbations in adult cystic fibrosis patients, scand development of a quantitative taqman rt-pcr for respiratory syncytial virus rapid diagnosis of infections caused by respiratory syncytial virus rapid viral diagnosis for acute febrile respiratory illness in children in the emergency department impact of the availability of an influenza virus rapid antigen test on diagnostic decision making in a pediatric emergency department impact of rapid influenza diagnostic test on physician estimation of viral infection probability in paediatric emergency department during epidemic period performance of a rapid antigen test (binax now ® rsv) for diagnosis of respiratory syncytial virus compared with real-time polymerase chain reaction in a pediatric population host and viral factors affecting clinical performance of a rapid diagnostic test for respiratory syncytial virus in hospitalized children the influenza virus: disease, diagnostics, and treatment evaluation of novel second-generation rsv and influenza rapid tests at the point of care evaluation of a rapid antigen detection point-of-care test for respiratory syncytial virus and influenza in a pediatric hospitalized population in the netherlands identification of respiratory viruses with a novel point-of-care multianalyte antigen detection test in children with acute respiratory tract infection performance of the alere i influenza a&b assay and maripoc test for the rapid detection of influenza a and b viruses diagnostic performance of near-patient testing for influenza prospective and retrospective evaluation of the cepheid xpert ® flu/rsv xc assay for rapid detection of influenza a, influenza b, and respiratory syncytial virus we thank hans kruining for his help with obtaining the data for the database. key: cord-302125-96w0nh9q authors: péré, hélène; wack, maxime; védie, benoit; guinet, nathalie demory; najiby, kassis chikani; janot, laurence; bélec, laurent; veyer, david title: sequential sars-cov-2 igg assays as confirmatory strategy to confirm equivocal results: hospital-wide antibody screening in 3,569 staff health care workers in paris date: 2020-09-03 journal: j clin virol doi: 10.1016/j.jcv.2020.104617 sha: doc_id: 302125 cord_uid: 96w0nh9q nan sequential sars-cov-2 igg assays as confirmatory strategy to confirm equivocal results: hospital-wide antibody screening in 3,569 staff health care workers in paris running title: sequential sars-cov-2 serology testing in health-workers hélène péré 1,2,3 , maxime wack 4 , benoit védie 5 , nathalie demory guinet 6 , kassis chikani najiby 7 , laurence janot 6 , laurent bélec 1,2,3 , david veyer 1, 8 surface protein, with the high-throughput unicel dxi 800 access immunoassay system (beckman coulter), to increase hospital productivity in sars-cov-2 igg serology testing. the analytical performance of the beckman coulter assay was assessed using serum samples obtained from inpatients with covid-19 confirmed by molecular diagnosis at least 4 weeks ago (n=104) and from patients randomly selected for whom serum samples were collected before the covid-19 outbreak (n=56). the access sars-cov-2 igg assay showed sensitivity of 93% (95% ci: 86%-97%), and specificity of 100% (95% ci: 93%-100%), demonstrating high analytical performances allowing convenient management of suspected on-going and past-infections, similar to the abbott sars-cov-2 igg assay. in france, the end of confinement took place on may 11 th , 2020. the virology laboratory of hôpital européen georges pompidou was then called upon to test all hospital staff exposed to the virus during the epidemic peak. from may 2 sd to 26 th june 2020, we unité de génomique fonctionnelle des tumeurs solides sars-cov-2-specific antibody detection in healthcare workers in germany with direct contact to covid-19 patients unexpected diagnosis of covid-19-associated disorders by sars-cov-2-specific serology the authors gratefully thank the department of clinical biochemistry, hôpital européen georges pompidou, paris, especially the technicians from the serological platform. the authors are also grateful to beckman coulter, france, for providing the access sars-cov-2 igg kits for the study.j o u r n a l p r e -p r o o f key: cord-324125-wau2xq0x authors: qiu, chao; yuan, songhua; tian, di; yang, yu; zhang, anli; chen, qingguo; wan, yanmin; song, zhigang; he, jing; li, liangzhu; sun, jun; zhou, mingzhe; qiu, chenli; zhang, zhiyong; lu, shuihua; zhang, xiaoyan; hu, yunwen; xu, jianqing title: epidemiologic report and serologic findings for household contacts of three cases of influenza a (h7n9) virus infection date: 2013-12-16 journal: j clin virol doi: 10.1016/j.jcv.2013.12.004 sha: doc_id: 324125 cord_uid: wau2xq0x background and objective: we conducted epidemiologic investigations and serologic assays on household contacts that were extensively exposed to three influenza a (h7n9) virus infected case-patients before infection-control practices were implemented. study design: data on the early clinical course of each patient and the exposure history for each patient's household contacts were obtained by interviewing household members and by reviewing medical records. viral rna in patient samples was tested using real-time reverse transcriptase polymerase chain reaction assay. antibodies against h7n9 virus in serum samples were tested using hemagglutination inhibition and pseudovirus based neutralization assays. results: all household contacts were extensively exposed to the case-patients without the use of measures to protect against infection. viral rna was detected in the specimens from case-patients for approximately 7–11 days after confirmation of infection. however, the results of the analyses of serum specimens taken from the household contacts 15–26 days post exposure revealed no evidence of transmission of h7n9 virus from the case-patients to the contacts. conclusion: despite ample unprotected exposures to case-patients during the virus shedding period, household members in this report were not infected by the h7n9 virus. household contact antibody a b s t r a c t background and objective: we conducted epidemiologic investigations and serologic assays on household contacts that were extensively exposed to three influenza a (h7n9) virus infected case-patients before infection-control practices were implemented. study design: data on the early clinical course of each patient and the exposure history for each patient's household contacts were obtained by interviewing household members and by reviewing medical records. viral rna in patient samples was tested using real-time reverse transcriptase polymerase chain reaction assay. antibodies against h7n9 virus in serum samples were tested using hemagglutination inhibition and pseudovirus based neutralization assays. results: all household contacts were extensively exposed to the case-patients without the use of measures to protect against infection. viral rna was detected in the specimens from case-patients for approximately 7-11 days after confirmation of infection. however, the results of the analyses of serum specimens taken from the household contacts 15-26 days post exposure revealed no evidence of transmission of h7n9 virus from the case-patients to the contacts. conclusion: despite ample unprotected exposures to case-patients during the virus shedding period, household members in this report were not infected by the h7n9 virus. © 2013 elsevier b.v. all rights reserved. a novel h7n9 influenza virus that causes human infections was identified in china early in 2013 [1] . being frequently exposed to case-patients during the contagious phase, household contacts are at a high risk for infection. similar to infection with seasonal and pandemic influenza viruses, a substantial number of h7n9 virus infected individuals are estimated to manifest mild to moderate symptoms [2, 3] . case ascertainment among most of the contacts in previous large epidemiologic reports has been mostly based on clinical symptoms and detection of virus using real-time reverse transcriptase polymerase chain reaction (rt-pcr) assay [3, 4] . this approach may not detect the asymptomatic cases or the individuals that have cleared the virus. detection of antibodies to h7n9 virus in serum specimens may reveal these undetected cases and may provide new information that aids in the understanding of the transmission of this novel influenza virus among humans. here we report the results of epidemiologic investigations and serologic findings on household contracts for three h7n9 infected patients hospitalized at the shanghai public health clinical center (shaphc), china [5] . the patients were diagnosed with h7n9 virus infection confirmed by the means of real-time rt-pcr assay. the infections with seasonal (h1 and h3) and 2009 pandemic h1n1 influenza viruses, and severe acute respiratory syndrome (sars-cov) were excluded using the rt-pcr assay [5] . the household contacts had not received any medications (including anti-influenza virus treatment), nor had they used any infection protection measures before confirmation of infection of the case-patients. we interviewed eight eligible contacts from three households. five of the contacts voluntarily provided postexposure serum samples. written informed consent was obtained from the each participant. the study was reviewed and approved by the shaphc ethics committee. information on the early clinical disease course for each casepatient and the history of exposure to the case-patient for each contact was obtained from medical records and from interviews with household contacts and doctors. a standardized form was used during each interview and the information was partially validated by interviewing other relatives of the patient and by examining medical records. specimens (throat swab, sputum, urine and stool) from patients were daily collected and promptly transported to the laboratory. real-time rt-pcr assays were used for detection of rna segments (hemagglutinin and neuraminidase) of h7n9 virus as previous report [5] . antibodies against the h7n9 virus were determined using hemagglutination inhibition (hi) assay with live virus (a/shanghai/4664t/2013 (h7n9)) and horse red blood cells in a biosafety level 3 (bsl-3) laboratory as the protocol developed by chinese center for disease control and prevention [6, 7] . pseudovirus based neutralization (pbn) assay was performed in a routine bsl-2 setting according to previous reported method [8] . case-patient 1 was a 79-year-old woman who had been on bed rest for months. she coughed frequently during eating because the anterior branch of her recurrent laryngeal nerve was previously damaged during a thyroidectomy. the h7n9 virus was detectable by real-time rt-pcr assay in her throat swab, sputum, urine, and stool for 10-11 days after she was transferred to the shaphc and for 17-18 days after the onset of symptoms. case-patient 1 lived with her son and his family. her son provided bedside care, without any infection prevention measures, for at least 4 h/day. after his mother finished eating, her son ate her uneaten food with the same tools. he cleaned her sputum, urine, and stool, and took her underwear to be washed in a washing machine. other household contacts included a grandson, a daughter-in-law, and a housemaid who declined to provide post-exposure blood. none of the contacts reported any signs of illness. the contacts had cared for the patient for 7 days from the onset of noticeable disease symptoms to the implementation of infection control measures. case-patient 2 was a 67-year-old man with diabetes and was in good physical condition. he experienced symptoms for 7 days before confirmation of infection. h7n9 virus persisted in his laboratory specimens for 7 days after his transfer to the shaphc. case-patient 2 lived with his wife. the wife provided much of his care, which included cleaning his sputum, urine, and stool, washing his clothing, and bathing him without the use of gloves. their son began to assist with the patient's care 4 days after the onset of symptoms in the patient. he sat at the patient's bedside for at least 6 h/day and provided extensive care that included cleaning urine and sputum. the family ate together and shared the eating utensils. the wife had a reported sore throat and diarrhea when the patient was hospitalized at the shaphc, but a real-time rt-pcr assay using a throat swab specimen as the source of template was negative for h7n9. the son reported no symptoms of illness. case-patient 3 was an 88-year-old man with severe underlying medical comorbidities. he was admitted to the hospital 7 days after the onset of symptoms. his laboratory specimens were positive for the virus by real-time rt-pcr assay for 11 days after admission to the shaphc. two daughters provided intermittent bedside care, which included cleaning sputum, urine, and stool, and washing the patient's underwear. we did not collect detailed exposure history for the daughters, because they could not be contacted. we collected serum samples from the contacts and the casepatients to determine whether the contacts had acquired the infection. antibodies against the h7n9 virus were detected using the hi and pbn assays. the antibodies against the h7n9 virus were undetectable in serum samples collected from contacts 15-26 days post exposure, but the reciprocal antibody titer were ≥40 in the samples collected from the case-patients 8-20 days after symptoms onset (table 1) . the report of family clusters of influenza a (h7n9) infection and a case for probable human-to-human transmission suggest the potential for h7n9 virus spread between close contacts, however, the sustained human-to-human transmission has not been observed with this novel potentially pandemic agent so far [4, 9] . our investigation suggests that for cases reported in this study, the h7n9 virus was not transmitted from the case-patients to their household contacts after prolonged and unprotected exposure. consistent with the observations in studies of h7n9 virus transmission in animal models, our results indicate that compared with globally disseminated seasonal and pandemic influenza viruses, the h7n9 virus is not readily transmitted in certain household settings [10] [11] [12] [13] . human infection with a novel avian-origin influenza a (h7n9) virus human infection with avian influenza a h7n9 virus: an assessment of clinical severity monitoring avian influenza a(h7n9) virus through national influenza-like illness surveillance preliminary report: epidemiology of the avian influenza a (h7n9) outbreak in china association between adverse clinical outcome in human disease caused by novel influenza a h7n9 virus and sustained viral shedding and emergence of antiviral resistance serologic study for influenza a (h7n9) among high-risk groups in china origin influenza a (h7n9) infection in influenza a(h7n9)-affected areas of china: a serological study safe pseudovirus-based assay for neutralization antibodies against influenza a (h7n9) virus probable person to person transmission of novel avian influenza a (h7n9) virus in eastern china, 2013: epidemiological investigation infectivity, transmission, and pathology of human-isolated h7n9 influenza virus in ferrets and pigs limited airborne transmission of h7n9 influenza a virus between ferrets household transmission of 2009 pandemic influenza a (h1n1): a systematic review and meta-analysis comparative epidemiology of pandemic and seasonal influenza a in households we thank dr. tianyi wang from the department of infectious diseases, university of pittsburgh, for his help with language editing. we thank yinyin ben, weihui fu, lingyan zhu, yanqin ren, jian chen, xiangqing ding, jingyu zhu, jing wang, zhidong hu, xiaonan ren and lingyan zhu for their help with processing samples. the authors have no conflicts of interest to declare. this study was reviewed and approved by the ethics committee of shaphc. key: cord-314028-sf8zt9r9 authors: esposito, susanna; voccia, emanuele; cantarelli, angelo; canali, andrea; principi, nicola; prati, andrea title: telemedicine for management of paediatric infectious diseases during covid-19 outbreak date: 2020-06-23 journal: j clin virol doi: 10.1016/j.jcv.2020.104522 sha: doc_id: 314028 cord_uid: sf8zt9r9 nan problems. to verify this hypothesis, a comprehensive paediatric infectious disease telemedicine programme at an urban academic medical centre in parma, emilia-romagna region, italy, was developed and activated on march 7, 2020. the academic hospital was directly connected to all the paediatric ambulatories that systematically followed the children in the community during the year. one paediatric infectious disease specialist coordinated the programme. a total of 36 primary care paediatricians of parma province who globally follow 30,000 children were enrolled. the service used telemedicine peripheral devices, apps for smartphones and broadband connections. telemedicine participants could connect for real-time interaction usually during the 4-hour/day period of primary care paediatrician activity in the ambulatory. evaluations of children generally began with a review of the available information that was discussed and, when possible, associated with a visual assessment of the child's overall appearance, respiratory pattern and behaviour. from march 7 to may 3, during the lockdown phase, 61 requests of telemedicine consultation (28, 45.9%, males; mean age ± standard deviation, 4.69 ± 3.22 years) to the paediatric infectious disease specialist in the hospital by the primary care paediatricians were made. a total of 55 (90.2%) paediatric problems that without telemedicine support could have led the patient to the emergency room of the hospital were solved in the community: 30 (54.5%) children with fever of unknown origin, 20 (36.4%) with skin rash, 3 (5.5%) with suspected primary immunodeficiency and 2 (3.6%) with acrocyanosis. in 6 out of 61 cases (9.8%), a medical visit was required because of skin rash (n=4, 66.7%) and acrocyanosis (n=2, 33.3%): in these cases nasopharyngeal swab was performed and resulted negative for sars-cov-2 using real-time polymerase chain reaction. none of the children needed further medical evaluation either in the community or in the hospital. this experience shows that during the covid-19 outbreak, the use of telemedicine for the management of paediatric infectious diseases permitted us to avoid hospital access j o u r n a l p r e -p r o o f in 90% of the cases, favouring reduction of the pressure on the hospitals. during the present covid-19 pandemic, telemedicine use has been promoted in some countries [2] [3] [4] . however, in the majority of the countries, despite a very large burden of covid-19, telemedicine was not included in the essential level of care granted by the national health system. our experience shows that telemedicine may be an easy and effective measure to solve many paediatric problems in the community during covid-19 outbreak, reducing emergency room visits. the activation of integrated software that can be used by paediatricians and parents from their mobile phone with the possibility to perform virtual visits and daily monitoring at home of patients with acute infections with respect to privacy law is advisable. none. andrea prati 4 , phd, for the parma covid-19 pediatric working group pediatric clinic, pietro barilla children's hospital, department of medicine and surgery virtually perfect? telemedicine for covid-19 online mental health services in china during the covid-19 outbreak a virtual care program for outpatients diagnosed with covid-19: a feasibility study rapid implementation of virtual clinics due to covid-19: report and early evaluation of a quality improvement initiative la tecnologia e l'innovazione per la lotta al key: cord-284841-flhfagp3 authors: nicol, thomas; lefeuvre, caroline; serri, orianne; pivert, adeline; joubaud, françoise; ducancelle, alexandra; lunel-fabiani, françoise; le guillou-guillemette, hélène title: assessment of sars-cov-2 serological tests for the diagnosis of covid-19 through the evaluation of three immunoassays: two automated immunoassays (euroimmun and abbott) and one rapid lateral flow immunoassay (ng biotech) date: 2020-06-15 journal: j clin virol doi: 10.1016/j.jcv.2020.104511 sha: doc_id: 284841 cord_uid: flhfagp3 background: the emergence of new sars-cov-2 has promoted the development of new serological tests that could be complementary to rt-pcr. nevertheless, the assessment of clinical performances of available tests is urgently required as their use has just been initiated for diagnose. objectives: the aim of this study was to assess the performance of three immunoassays for the detection of sars-cov-2 antibodies. methods: two automated immunoassays (abbott sars-cov-2 clia igg and euroimmun anti-sars-cov-2 elisa igg/iga assays) and one lateral flow immunoassay (lfia ng-test® igg-igm covid-19) were tested. 293 specimens were analyzed from patients with a positive rt-pcr response, from patients with symptoms consistent with covid-19 but exhibiting a negative response to the rt-pcr detection test, and from control group specimens. days since symptoms onset were collected from clinical information sheet associated with respiratory tract samples. results: overall sensitivity for igg was equivalent (around 80%) for clia, elisa and lfia. sensitivity for igg detection, >14 days after onset of symptoms, was 100.0% for all assays. overall specificity for igg was greater for clia and lfia (more than 98%) compared to elisa (95.8%). specificity was significantly different between iga elisa (78.9%) and igm lfia (95.8%) (p < 0.05). the best agreement was observed between clia and lfia assays (97%; k = 0.936). conclusion: excellent sensitivity for igg detection was obtained >14 days after onset of symptoms for all immunoassays. specificity was also excellent for igg clia and igg lfia. our study shows that ng-test® is reliable and accurate for routine use in clinical laboratories. a new acute respiratory syndrome named coronavirus disease 2019 has emerged from the region of wuhan in china in december 2019. this infection, widespread all over the world, is caused by a novel sarbecovirus designated severe acute respiratory syndrome coronavirus 2 (sars-cov-2), associated with severe morbidity and mortality [1] [2] [3] . the detection of viral rna by real time reverse transcriptase-polymerase chain reaction (rt-pcr) in respiratory tract samples is considered as the gold standard method for screening and diagnosis in the early phase of infection. however, sensitivity is variable depending on sample types, suitable sampling technique, the anatomic site, time of infection and viral load [4] [5] [6] . chest computed tomography (ct) may be helpful for the diagnosis, complementary to rt-pcr, but it remains unspecific [7] . development of new serological tests [8, 9] , readily available and easier to perform compared to requirements of molecular assays in laboratories [10] , could be helpful as a complementary diagnostic tool and to increase the sensitivity of tests especially in patients with late complications i.e. severe pneumonia. different assays have recently been commercialized: automated tests (enzyme-linked immunosorbent assays [elisa] or chemiluminescence enzyme immunoassays [clia]) or rapid detection test (lateral flow immunoassays, lfia). lfia seems to be very attractive for large seroprevalence studies because these tests can be used easily as point of care tests or in the laboratory, with a result in less than 15 minutes. serological tests can be used for symptomatic individuals for which rt-pcr testing was either not performed at the time of acute illness or for which nasopharyngeal swab result was found to be negative, and also for epidemiological studies (close contacts screening, screening of health care workers …) [11, 12] . however, the relevance of serological tests is highly related to their clinical performance, hence antibody (ab) assays with good sensitivity and specificity are needed. despite a growing number of available assays, related j o u r n a l p r e -p r o o f clinical performances are still scarce [13] [14] [15] [16] [17] or unknown and individual studies are usually inconclusive. moreover, the quality and diagnostic performance of rapid tests have already been questioned in spain and united kingdom [18, 19] . the aim of the study was to assess the clinical performance of ce marked assays available in europe to detect sars-cov-2 antibodies: two automated immunoassays (euroimmun and abbott assays) targeting two different proteins and also one lateral flow immunoassay (ng biotech). then, 25 serum samples with a potential cross-reaction to the sars-cov-2 immunoassays were investigated (table 1) . samples from 10 pregnant women and 10 sera from patients with positive rheumatoid factor (rf) were also tested. the study was approved by the institutional board of the angers university hospital. j o u r n a l p r e -p r o o f the euroimmun anti-sars-cov-2 elisa igg and iga assays (euroimmun, lüebeck, germany) were performed according to the manufacturer's guidelines on the ds2® system, an automated microplate technology (dynex technologies gmbh, denkendorf, germany). the microplate wells are coated with recombinant s1 structural protein and the assay detects anti-sars-cov-2 igg and iga against the viral spike protein (sp). the abbott sars-cov-2 igg (abbott, ireland) was performed according to the manufacturer's instructions on the automated abbott architect i2000sr instrument the assay is a clia for qualitative detection of igg antibodies against the sars-cov-2 nucleoprotein (np) in serum or plasma. ng-test® igg-igm covid-19 (ng biotech laboratoires, guipry-messac, france) is an immune colloidal technique intended for the qualitative detection of igg and igm antibodies against the sars-cov-2 nucleoprotein in serum or plasma. 10 μl of specimen, were added onto the sample loading area followed by 2 drops of sample dilution solution. the results were read and interpreted 15 min after testing. all statistical analyses were performed using ibm® spss® 15.0 statistics software (statistical package for social sciences, ibm corp., chicago, il). to assess the sensitivity and specificity, j o u r n a l p r e -p r o o f we choose the rt-pcr method as gold standard. time from onset symptoms was used to determine sensitivity and specificity. grey zone was considered positive for the statistical analyses. a p value <0.05 was considered statistically significant. the cohen's kappa value was determined for agreement between assays. sensitivities and specificities obtained with three immunoassays are summarized in table 2 table 3 summarized overall agreement and agreement relative to the time of symptoms onset between three immunoassays. overall, excellent agreement was observed between the three assays. the best agreement was observed between clia and lfia (97%; cohen kappa index of 0.936). even for the first week of symptoms onset, an excellent agreement was observed between elisa and lfia assays (95%; k=0.810). however, poor agreement was observed between elisa and clia (89%; k=0.687). overall agreement between igg/iga elisa and igg/igm lfia was excellent (96%; k=0.914). the iga, igm and igg ab kinetics were studied using specimens from seven patients (positive rt-pcr) with serial results and interesting kinetics ( figure 2) . then, five patients presented an earlier igg seroconversion using clia compared to elisa, the first week of symptom onset. among these patients, we observed in three patients an igm line with lfia and iga elisa was positive for four patients. using lfia, results were more easily interpretable for igg line than for igm line. igm line was difficult for reading, notably for seven sera. j o u r n a l p r e -p r o o f discussion a strong clinical performance of assays in diagnosis and management of covid-19 is essential to quickly contain the covid outbreak worldwide. therefore, the development of serological assays, routinely used in clinical laboratories to determine recent infection or previous contact with viruses, is a good option complementary to rt-pcr method [21] . on may, 2020, the french health authority (haute autorité de santé) and infectious diseases society of america recommended that patients with symptoms consistent with covid-19 but having a positive result for sars-cov-2 by rt-pcr may be diagnosed by serological tests [22, 23] . various immunoassays are available on the european market [24, 25] and subjected to european regulations with the mandatory ce marked for sales. nevertheless, the european commission, in its april 2020 recommendations, allowed exceptionally the marketing of tests that do not have the ce marked, in the interest of public health [22] . here, we evaluated three different ce marked commercial immunoassays for detection of sars-cov-2 antibodies in human serum and plasma. elisa assay was performed on a semiautomated microplate technology requiring high handling and with a limited capacity of tests per day (90 tests per 4h). in contrast, clia assay is a fully automated random-access test and that can perform over 4,000 tests per 24h. these two assays are used in clinical laboratories, unlike lfia, which can be used as a point of care test or in clinical laboratories and provides a result within 15 min. performance of euroimmun assay has been evaluated in some studies [13, 14, [26] [27] [28] [29] , showing sensitivity for igg between 85% and 95% >14 days after symptoms onset and specificity between 95 and 100%. few studies reported clinical performance of abbott assay [14, 16, 26, 28] . sensitivity for igg was between 94% and 100% more than 14 days post symptom onset and specificity between 99 and 100%. in our study, we showed a sensitivity for igg of j o u r n a l p r e -p r o o f 100% for clia abbott and elisa euroimmun assays >14 days after symptoms onset and an overall specificity for igg of 78.3% and 81.8% with elisa and clia respectively. we carried out a large cross-reactivity study and more false positives results were observed using elisa than clia as previously described [14] . recently, many ce marked lfia became available. two studies showed that sensitivity and specificity were similar to those of euroimmun assay [13, 29] .however, to our knowledge, only one study compared clinical performance between clia abbott and lfia [30] and no study described diagnostic performance of ng-test®. here, we observed an excellent agreement for igg between clia and lfia 15 days after onset symptoms (k=0.810), and an excellent sensitivity and specificity for both assays. lfia advantages are the ability to reach larger population groups, when used in point-of-care, and to evaluate the herd immunity without saturating the capacity of laboratories. however, these devices must be used with caution. trained staff or automated reader devices are needed for good interpretation of result. traceability of results may be at fault in case of use at the point-of-care and results may not be reported to the health authorities for seroprevalence studies. to evaluate sensitivity, some manufacturers or authors used the time from positive rt-pcr rather than the time from symptom onset. however, there is a risk of misestimating sensitivity as some patients presented late after the onset of symptoms with disease progression at time of the first pcr testing. then, sensitivity and specificity must be interpreted with caution. the use of rt-pcr as gold standard may decrease the real number of patients infected by sars-cov-2 due to false negative results. in our study, we observed false positive results with iga elisa and few with igm lfia. no false positive with igm lfia were observed with for rf specimens whereas interferences were described with some other immunoassays [31] . elslande et al pointed out that the elisa iga should not be used for the screening of asymptomatic persons. it might be better not to measure igm or iga since it may result in a significant number of false-positive results without improving diagnostic performance. [29] . it would appear here that igm detection with the lfia provides a gain in diagnostic performance. developed immunoassays target either the sp or the np of sars-cov-2 [32] , involving different immune ab responses. however, related studies are controversial. some studies described that early antibody response was targeted against np and then sp inducing an earlier positivity of the tests targeting np [14, 33] . by contrast, another study revealed that the spbased elisa was more sensitive than the np-based one in the detection of igm [34] . here, we did not observe any significant difference between sensitivity of iga elisa and igm lfia in conclusion, our study showed equivalent clinical performance for igg of three immunoassays (elisa, clia and lfia) >14 days after symptoms onset. the three assays had, as expected, a poor sensitivity during first days of symptom onset. therefore, serological tests can be useful to confirm past covid-19, to do epidemiologic studies 15 days after symptoms j o u r n a l p r e -p r o o f onset [36] or to identify people who could return to the workplace, even if its use is still widely discussed [37] . for asymptomatic patients with rt-pcr negative, a higher threshold must be used [16] . a lower threshold (8-14 days) should be used for symptomatic patients >7 days with negative rt-pcr and clinical presentation consistent with covid-19. currently, it is not clear whether igg antibodies are protective against reinfection [38] . finally, even if the lfia is reliable on serum or plasma, studies should be conducted to evaluate the performance on fingerstick; a process commonly used for seroprevalence studies. this research did not receive any specific grant from funding agencies. ng-test® igg-igm covid-19 rapid test cassettes (ng biotech laboratoires) were kindly provided by the manufacturer. the authors declare that they have no conflict of interest. world health organization china novel coronavirus investigating and research team, a novel coronavirus from patients with pneumonia in china clinical course and outcomes of critically ill patients with sars-cov-2 pneumonia in wuhan, china: a single-centered, retrospective, observational study vitro diagnostic assays for covid-19: recent advances and emerging trends laboratory diagnosis of emerging human coronavirus infections -the state of the art evaluating the accuracy of different respiratory specimens in the laboratory diagnosis and monitoring the viral shedding of 2019-ncov infections, medrxiv chest ct for typical 2019-ncov pneumonia: relationship to negative rt-pcr testing developing antibody tests for sars-cov-2 severe acute respiratory syndrome coronavirus 2-specific antibody responses in coronavirus disease 2019 patients world health organization significance of serology testing to assist timely diagnosis of sars-cov-2 infections: implication from a family cluster the laboratory diagnosis of covid-19 infection: current issues and challenges evaluation of two j o u r n a l p r e -p r o o f automated and three rapid lateral flow immunoassays for the detection of anti-sars-cov-2 antibodies clinical performance of two sars-cov-2 serologic assays serological immunochromatographic approach in diagnosis with sars-cov-2 infected covid-19 patients performance characteristics of the abbott architect sars-cov-2 igg assay and seroprevalence in diagnostic performance of covid-19 serology assays covid-19 in spain: unreliability of new tests delays effort to slow coronavirus spread in spain | society | el país in english says millions of coronavirus test kits bought from china are unreliable for most patients clinical and virological data of the first cases of covid-19 in europe: a case series different longitudinal patterns of nucleic acid and serology testing results based on disease severity of covid-19 patients place des tests sérologiques dans la stratégie de prise en charge de la maladie covid-19 idsa covid-19 antibody primer sars-cov-2 diagnostic pipeline brief clinical evaluation of six high-throughput sars-cov-2 igg antibody assays clinical performance of different sars-cov-2 igg antibody tests performance characteristics of four high-throughput immunoassays for detection of igg antibodies against sars-cov-2 diagnostic performance of 7 rapid igg/igm antibody tests and the euroimmun iga/igg elisa in covid-19 patients evaluation of covid-19 igg/igm rapid test from orient gene biotech a method to prevent sars-cov-2 igm false positives in gold immunochromatography and enzyme-linked immunosorbent assays interpreting diagnostic tests for sars-cov-2 the trinity of covid-19: immunity, inflammation and intervention evaluation of nucleocapsid and spike protein-based enzyme-linked immunosorbent assays for detecting antibodies against sars-cov-2 clinical performance of sars-cov-2 igg antibody tests and potential protective immunity, microbiology the important role of serology for covid-19 control waiting for certainty on covid-19 antibody tests -at what cost? protective immunity after covid-19 has been questioned: what can we do without sars-cov-2-igg detection? 9%) se: 59.4 (42.3-74.5%) se: 28.1 (42.3-74.5%) the authors thank the laboratory technicians who helped us.the authors thank thomas le guillou for proofreading the english manuscript.j o u r n a l p r e -p r o o f key: cord-311633-i9ret7bw authors: péré, hélène; védie, benoit; vernet, raphaël; demory, nathalie; kassis, najiby; mirault, tristan; lazareth, hélène; volle, geoffroy; denoix, elsa; lebeaux, david; podglajen, isabelle; bélec, laurent; veyer, david title: unexpected diagnosis of covid-19-associated disorders by sars-cov-2-specific serology date: 2020-08-04 journal: j clin virol doi: 10.1016/j.jcv.2020.104568 sha: doc_id: 311633 cord_uid: i9ret7bw facing the ongoing pandemic caused by sars-cov-2, there is an urgent need for serological assays identifying individuals with on-going infection as well as past coronavirus infectious disease 2019 (covid-19). we herein evaluated the analytical performances of the ce ivd-labeled abbott sars-cov-2 igg assay (des plaines, il, usa) carried out with the automated abbott architect™ i2000 platform at hôpital européen georges pompidou, paris, france, using serum sample panels obtained from health-workers with covid-19 history confirmed by positive nucleic acid amplification-based diagnosis and from patients randomly selected for whom serum samples were collected before the covid-19 epidemic. the abbott sars-cov-2 igg assay showed sensitivity of 94% and specificity of 100%, demonstrating high analytical performances allowing convenient management of suspected on-going and past-infections. in addition, the sars-cov-2 igg positivity rates were compared in covid-19 positive and covid-19 free areas from our hospital. thus, the frequency of sars-cov-2-specific igg was around 10-fold higher in covid-19 areas than covid-19 free areas (75% versus 8%; p < 0.001). interestingly, several inpatients hospitalized in covid-19 free areas suffering from a wide range of unexplained clinical features including cardiac, vascular, renal, metabolic and infectious disorders, were unexpectedly found seropositive for sars-cov-2 igg by systematic routine serology, suggesting possible causal involvement of sars-cov-2 infection. taken together, these observations highlight the potential interest of sars-cov-2-specific serology in the context of covid-19 epidemic, especially to assess past sars-cov-2 infection as well as possible unexpected covid-19-associated disorders. coronavirus disease 2019 caused by sars-cov-2 was declared by the world health organization (who) as global pandemic on march 11, 2020 [1] [2] [3] . controlling the outbreak in the community and in hospitals mainly relied on the availability and the sensitivity and specificity of rt-pcr testing [4, 5] . rapidly, it was demonstrated that serological testing looking for specific sars-cov-2 igg and/or igm could increase the sensitivity of the diagnosis [6] [7] [8] [9] [10] . on march 2, 2020, the who recommended serological testing in addition to molecular diagnosis for the diagnosis of strongly suspected patients of sars-cov-2 infection with negative rt-pcr [11] . at april, the abbott sars-cov-2 igg assay (abbott gmbh, rungis, france) received ce-ivd label and was installed on our automated i2000 platform (abbott architect™ i2000) at hôpital européen georges pompidou (hegp). our hospital, belonging to the assistance publique-hôpitaux de paris, which represents the largest group of university hospitals in europe, has been organized since mid-march to attend to patients with covid-19 related conditions (covid-positive area) in distinct areas from the patients without covid-19 related conditions (covid-free area). to analytically and clinically validate the abbott sars-cov-2 igg assay, we tested pre-epidemic sera, sera from pauci-symptomatic health-worker with sars-cov-2 positive rt-pcr and sera from hospitalized patients from both the covid-positive area and the covid-free area. to date, few data are available on serology testing, focusing mainly on the time of seroconversion after the onset of symptoms and the neutralizing capability of the produced antibodies [9, 12, 13, 14] . we herein report on lessons learned from our analytical and clinical validation of the abbott sars-cov-2 igg assay, including unexpected diagnosis of covid-19 associated disorders by sars-cov-2-specific serology assay. sensitivity was assessed using sera from hospital staff who had a history of positive sars-cov-2 rt-pcr at least one month before serology testing. specimens were collected by occupational medicine. finally, sera were also obtained from patients attending the hospital during the pandemic period, in april 2020, either for covid-19 related conditions in covid-positive area of the hospital or for non-covid-19 related conditions in covid-free area, for further sars-cov-2 igg serological testing. abbott sars-cov-2 igg assay sensitivity. hundred sera collected from hospital healthworkers previously positive for sars-cov-2 rt-pcr were tested for sars-cov-2 igg. in this group of health-workers, 69% were female and the median age was 34 (iqr=19.5 years) (table 1) . median delay between rt-pcr and serology was 39.5 days (iqr=9.25 days). ninety-four serum tested positive for sars-cov-2 igg. the sensitivity of the abbott sarscov-2 igg assay was 94% (95% ic: 87%-98%) ( table 1) the median age of the hospitalized patients was 60 years (iqr=25) and 31% of them were female. the difference between the demographic data (age and sex) within the health workers and the hospitalized patients were statistically significant (p=2.85x10 -17 and p=1.94x10 -8 , respectively) ( table 1 ). out of the 63 patients hospitalized for covid-19 related conditions that were tested for sars-cov2 igg, 47 (74.6%) tested positive ( table 1) chest ct-scan findings were only suggestive of acute bronchitis. sars-cov-2 rt-pcr was negative again, while index value of sars-cov-2 igg was 2.1. to our knowledge, this is the second study assessing the analytical performances of the abbott sars-cov-2 igg assay, the first one with samples collected in europe. in the first study, both specificity (99.9%) and sensitivity (100% after 17 days since the onset of symptoms) were excellent [14] . our results confirmed the excellent specificity of the assay (100%) but our sensitivity results were not as good as expected, especially in the healthworker group (sensitivity=94%). our results from the patients hospitalized for covid-19 were more comparable to the ones observed in the study of bryan et al. [14] . indeed, the median delay before the detectability of sars-cov-2 igg since the onset of symptoms was 17 days, as it has previously been described, and every tested patient after 20 days were positive. various hypotheses could be given to explain this discrepancy between hospitalized patients and health-workers. firstly, among health workers, only 2 were hospitalized and 98 j o u r n a l p r e -p r o o f were not hospitalized and had only little symptoms. furthermore, the median ages as well as the sex ratio between these 2 groups were statistically different. whether any of these factors (age, sex and symptoms) could be responsible for the relatively low sensitivity (94%) in our health workers group would need further investigations. one could also hypothesize that the sensitivity of the test might depend on the sars-cov-2 strain and that some specific antibodies might be not detected by the assay. furthermore, out of the 6 health workers that tested negative with positive rt-pcr, only one had a very low index value at 0.1, all the others had at least an index value of 0.4, which could indicate that some antibodies are produced but are weakly detected. among these 6 health-workers, one was tested for seroneutralizing antibodies in a research protocol context. he was positive with a low titer according to the technique (data not shown), which is in agreement with the fact that some antibodies are produced. in our study, we took advantage of our hospital organization, which was structured in covid-positive area and covid-free area to test some patients from the covid-free area. igg positivity in this area was 8.3% which is much higher when compared to the 1.79% described by bryan et al [14] . this could be explained by the fact that our samples were collected by mid-april, at the time of the epidemic peak in france and that a greater percentage of the population had been exposed to the virus at this time. nevertheless, these results confirmed that the organization in covid-positive and covid-free area was efficient as the igg positivity was highly different between both sectors. finally, our work demonstrated that sars-cov-2 serology could be a useful tool to retrospectively diagnose covid-19 infections with 8 cases of unexpected covid-19 diagnosis in the covid-19 free area. clinical features of these 8 patients were in agreement with the wide variety of organs that could be affected by sars-cov-2 [15] [16] [17] [18] [19] . indeed, 2 patients presented with nephropathy, 2 patients with cardiac symptoms, 2 patients with j o u r n a l p r e -p r o o f vascular symptoms, one patient with hyperglycemia and the last one with bacterial pneumonia. to our knowledge, this is the first study that underlines the retrospective clinical value of sars-cov-2 specific serology, especially when recent history of sars-cov-2 infection was not obvious. there is no doubt that generalizing the serology diagnosis would reveal unexpected sars-cov-2 infections associated with various organ disorders. j o u r n a l p r e -p r o o f a novel coronavirus from patients with pneumonia in china clinical characteristics of coronavirus disease 2019 in china the species severe acute respiratory syndrome-related coronavirus: classifying 2019-ncov and naming it sars-cov-2. nat microbiol virological assessment of hospitalized patients with covid-2019 nasal swab sampling for sars-cov-2: a convenient alternative in times of nasopharyngeal swab shortage a serological assay to detect sars-cov-2 seroconversion in humans an evolving approach to the laboratory assessment of covid-19 developing antibody tests for sars-cov-2 interpreting diagnostic tests for sars-cov-2 laboratory testing for coronavirus disease 2019 (covid-19) in suspected human cases: interim guidance neutralizing antibodies against sars-cov-2 and other human coronaviruses serologic responses to sars-cov-2 infection among hospital staff with mild disease in eastern france performance characteristics of the abbott architect sars-cov-2 igg assay and seroprevalence in pulmonary vascular endothelialitis, thrombosis, and angiogenesis in covid-19 acute kidney injury in covid-19: emerging evidence of a distinct pathophysiology clinical characteristics of 113 deceased patients with coronavirus disease 2019: retrospective study association of coronavirus disease 2019 (covid-19) with myocardial injury and mortality 2020. <scp>covid</scp> -19: a global threat to the nervous system key: cord-315782-tx2vqr64 authors: han, tae hee; chung, ju-young; kim, sang woo; hwang, eung-soo title: human coronavirus-nl63 infections in korean children, 2004–2006 date: 2006-11-29 journal: j clin virol doi: 10.1016/j.jcv.2006.10.009 sha: doc_id: 315782 cord_uid: tx2vqr64 background: human coronavirus-nl63 (hcov-nl63) has been isolated from children with respiratory tract infections and its prevalence in korea has not been reported. objectives: this study was designed to investigate the presence and the clinical features of hcov-nl63 during two winter seasons. study design: during april 2004–april 2006, nasopharyngeal specimens from children hospitalized with acute respiratory disease were tested for common respiratory viruses, including rsv, influenza a, influenza b, parainfluenza viruses, and adenovirus by ifa. hmpv infection was excluded by nested rt-pcr using primers for f-gene. to detect hcov-nl63, previously described nested pcr assays for 1a and 1b were used. pcr products of the 1a gene for hcov-nl63 were sequenced. results: out of 872 nasopharyngeal aspirate from children aged under 16 years, 14 (1.7%) were positive for hcov-nl63. most of the patients had croup (64.2%) or bronchiolitis (21.4%). the peak prevalence was found in november (28.5%). most were collected between november 2004 and february 2005. conclusions: hcov-nl63 may be one of the causative agents of acute respiratory tract infection, especially croup. human respiratory syncytial virus (rsv), parainfluenza viruses, adenoviruses, influenza viruses, and recently discovered human metapneumovirus (hmpv) are the most commonly isolated viruses in acute respiratory infection in children (peiris et al., 2003a,b; selwyn, 1990) . however, the etiologic agents are still unknown in a large proportion of respiratory infections. human coronaviruses are positive sense rna enveloped viruses (nokso-koivisto et al., 2000) . hcov-229e and hcov-oc43 are major causes of common colds. in 2002, a novel human corona virus, hcov-sars, was identified as a cause of severe acute respiratory syndrome (sars) (nokso-koivisto et al., 2000; peiris et al., 2003a,b) and a new kind of group 1 human coronavirus-nl63 (hcov* corresponding author. tel.: +82 2 950 1073; fax: +82 2 950 1955. e-mail address: pedchung@sanggyepaik.ac.kr (j.-y. chung). nl63) was discovered in the netherlands . another group from the netherlands also identified hcov-nl in a boy with pneumonia (fouchier et al., 2004) . although hcov-nl63 has been associated with upper and lower respiratory tract infections in children, there are no published reports in korea. we used nasopharyngeal aspirate specimens from hospitalized children with acute respiratory disease to determine the prevalence and clinical features of hcov-nl63 during two winter seasons in korea. a total of 1005 nasopharyngeal specimens were consecutively collected from children under 16 years of age, who were admitted with acute respiratory disease at sanggyepaik 1386-6532/$ -see front matter © 2006 elsevier b.v. all rights reserved. doi:10.1016/j.jcv.2006.10.009 hospital from april 2004 to april 2006. a total of 827 specimens were tested with ifa (dako, cambridgeshire, uk) for common respiratory viruses; rsv, influenza virus a, influenza b, parainfluenza viruses, and adenoviruses, were sought. the specimens were stored at −70 • c until further tested. informed consent was obtained at admission from parents. the possibility of hmpv infection was excluded by nested rt-pcr using specific primers to amplify a part of the f-gene as previously described (van den hoogen et al., 2004) . clinical definitions were: croup was hoarseness of voice, barking cough, and inspiratory stridor due to laryngeal obstruction; tracheobronchitis was cough and rhonchi and no laryngeal obstruction or wheezing; bronchiolitis was expiratory wheezing with or without tachypnea, air trapping, and substernal retractions; pneumonia was rales or evidence of pulmonary consolidation on physical examination or radiograph; bronchial asthma was acute wheezing occurring three or more times in children of any age or occurring one or more times in children aged >3 years. the diagnoses of the patients were croup in 29, pneumonia in 290, bronchiolitis in 257, acute bronchitis in 40, upper respiratory tract infection in 21, and bronchial asthma in 190. the median age was 15 months (range = patients ranged from 1 to 192 months in age): children 5 years of age or younger constituted 92.7% (759/827) of the study population. the ethics committee of faculty medicine, inje university, seoul, korea, approved the study. viral rna was extracted from each sample by qiaamp viral mini kit (qiagen gmbh, hilden, germany) according to the manufacturer's protocol. reverse transcription of 0.5 g of each rna sample was performed in a final volume of 20 l containing 5 m of random hexadeoxynucleotides, 1 mm of each dntp, 2 units of rnase inhibitor, and 9 units of reverse transcriptase (bioneer, daejeon, korea). after incubation at 42 • c for 1 h, the samples were heated for 5 min at 94 • c. to detect hcov-nl63, previously described nested pcr assays for 1a and 1b were used (arden et al., 2005) . all pcr assays were performed using 1 l of cdna and 0.6 m of each primer. to validate the amplification process and to exclude the presence of carryover contamination, positive and negative controls were run on each pcr, and positive samples were verified against an independent rna extraction. pcr products of the 1a gene were sequenced. amplicon was purified using qiaqucik (qiagen gmbh, hilden, germany) and sequenced in both directions using the bigdye terminator v3.1 cycle sequencing kit (applied biosystems, foster city, ca, usa). sequencing products were resolved with an abi 3730 xl autoanalyzer (applied biosystems, foster city, ca, usa). phylogenic trees were constructed using mega version 3.0 (kumar, tamura, nei 2004). from april 2004 to april 2006, a total of 827 nasopharyngeal specimens from children, hospitalized with acute respiratory disease, were tested for common respiratory viruses. ifa diagnosis indicated that 151 (18.2%) specimens were positive for rsv, 9 (1.1%) for parainfluenza virus, 5 (0.6%) for influenza a virus, 2 for adenoviruses, and 1 for influenza b virus. rt-pcr detected 83 (10.0%) samples containing hmpv, and 14 (1.7%) containing hcov-nl63. hcov nl-63 was detected during may (1 specimen), november (4 specimens), and december (1 specimen the hcov nl-63 positive patients were 5-58 months old (median, 11.5 months) and the ratio of males to females was 1.8:1. hcov-nl63 positive patients were diagnosed as croup in 9 (64.2%), bronchiolitis in 3 (21.4%), bronchial asthma exacerbation in 1, and pneumonia in 1 (table 1) . hcov-nl63 was positive in 31.0% (9/29) of children with croup in this study population. of the 20 cases of croup that were not associated with hcov-nl63, rsv was detected in 5 patients, hmpv in 3 patients, and parainfluenza virus in 3 patients. the clinical presentations of patients were cough (100%), fever (35.7%), sputum production (28.5%), and dyspnea (35.7%). no patients had predisposing factors or underlying diseases. the positive pcr products were confirmed by sequencing and the partial -sequences of the 1a gene were deposited in genbank (dq093116-dq093123, dq351988, dq453793-dq453795, dq534705-dq534706). direct sequencing of the pcr products of the 1a gene revealed that seven isolates had the same sequences and others limited variation of sequence (fig. 2) . this is the first report of hcov-nl63 infections in korean children hospitalized with acute respiratory disease. hcov-nl63 circulated in korean children during 2004-2006. coronaviruses are divided into three different groups: group 1 (hcov-229e and hcov-nl63); group 2a (hcov-oc43 and hcov-hku1); group 2b (sars-cov); group 3, but human pathogens are only found in groups 1 and 2. coronavirus hcov-nl63 infections have been reported in the netherlands, australia, japan, canada, usa, france, and hong kong (arden et al., 2005; bastien et al., 2005; chiu et al., 2005; ebihara et al., 2005; esper et al., 2005; vabret et al., 2005; van den hoogen et al., 2004) , which suggest that this newly discovered human coronavirus has a worldwide distribution. although, we did not include a healthy control group, hcov-nl63 presence in the nasal aspirates of children with acute respiratory disease, in the absence of an alternate etiology, suggests that it may have a role in the illness. however, the causal association hcov-nl63 cannot be established without including a healthy control group. the incidence of hcov-nl63 in patients with respiratory disease of unknown etiology is reported to be 1.2-9.3% (esper et al., 2005; moes et al., 2005; suzuki et al., 2005; vabret et al., 2005) . in this study, the positive rate of hcov-nl63 (1.7%) was comparable to that of australia and japan (arden et al., 2005; suzuki et al., 2005) . the differences in hcov-nl63 positivity rates among several studies may be due to the characteristics of the study populations and the collection time of respiratory specimens. in a japanese study, hcov-nl63 was detected in 2.5% of hospitalized children with acute bronchiolitis suggesting that it plays an etiological role in bronchiolitis (ebihara et al., 2005) . in this study, hcov-nl63 was associated with croup in most of the positive children (9/14, 64.1%), which is consistent with a recent report showing strong association between hcov-nl63 infection and croup (moes et al., 2005) . however, others have reported that mild and nonspecific symptoms are frequent in hcov-nl63 positive patients and that detection occurred occasionally in healthy children (boivin et al., 2005; moes et al., 2005; suzuki et al., 2005) . in this study, hcov-nl63 infections occurred in previously well patients which is consistent with what was found in previous studies (arden et al., 2005; chiu et al., 2005; ebihara et al., 2005) , although others have reported that many children with hcov-nl63 infection had an underlying disease such as prematurity or cardiac disease (esper et al., 2005; moes et al., 2005) . to elucidate, exactly, the clinical spectrum and significance of hcov-nl63 infection, further population-based studies are needed. in this study, most of the hcov-nl63 positive patients (85.7%, 12/14) were under 24 months old, and 42.8% (6/14) were under 12 months old. these results are similar to a recent report, which showed that hcov-nl63 causes lower respiratory tract symptoms in early life and that it is one of the important etiologic agents of acute respiratory infection in young children (kaiser et al., 2005) . two out of 14 sequences of hcov-nl63 detected in this study were identical to that of hcov-nl63 (nc-005831) and 5 sequences were identical to that of hcov-nl (ay518894). these results indicate that the 1a gene of hcov-nl63 is a highly conserved region which aids in its detection by rt-pcr. we do not think that our results are false positives because cross contamination controls were negative and all positive rt-pcr results were confirmed by a second run. although some reported high frequency (75%, 9/12) of mixed infection (boivin et al., 2005) , we detected co-infections with hcov-nl63 and another respiratory virus in only two cases. the prevalence of hcov-nl63 varies according to the geographical region, seasonality, and year. in the netherlands, canada, japan and belgium, hcov-nl63 was mostly detected during winter (bastien et al., 2005; fouchier et al., 2004; moes et al., 2005; van der hoek et al., 2005) , but some have been detected in spring (chiu et al., 2005; esper et al., 2005) . in this study hcov-nl63 was detected in spring and winter of 2004, and spring of 2006. although a comparable number of specimens were included, we could not detect hcov-nl63 in the respiratory specimens during winter [2005] [2006] . it is known that outbreaks of other coronaviruses including hcov-229e and hcov-oc43 occur every second year (monto and lim, 1974) . our results show that outbreaks of hcov-nl63 infections do not occur every year: further studies are needed to confirm the pattern of periodicity of outbreaks in korea. phylogenetic analysis showed that different strains are cocirculating in korea, which is similar to findings in other countries (arden et al., 2005; bastien et al., 2005; moes et al., 2005; vabret et al., 2005) . in conclusion, we confirmed the presence of hcov-nl63 infection in korean children hospitalized with acute respiratory tract disease. although the prevalence of hcov-nl63 is not high, it is one of the important etiologic agents of respiratory tract infections (especially croup) in hospitalized children. new human coronavirus, hcov-nl63, associated with severe lower respiratory tract disease in australia human coronavirus nl63 infection in canada infections by human coronavirus-nl in hospitalized children human coronavirus nl63 infection and other coronavirus infections in children hospitalized with acute respiratory disease in hong kong detection of human coronavirus nl63 in young children with bronchiolitis evidence of a novel human coronavirus that is associated with respiratory tract disease in infants and young children a previously undescribed coronavirus associated with respiratory disease in humans human coronavirus nl63 associated with lower respiratory tract symptoms in early life a novel pancoronavirus rt-pcr assay: frequent detection of human coronavirus nl63 in children hospitalized with respiratory tract infections in belgium the tecumseh study of respiratory illness. vi. frequency of and relationship between outbreaks of coronavirus infection respiratory coronary virus infections in children younger than two years of age children with respiratory disease with metapneumovirus in hong kong the severe acute respiratory syndrome coordinated data group of bostid researchers. the epidemiology of acute respiratory tract infection in young children: comparison of findings from several developing countries detection of human coronavirus nl-63 in children in japan antigenic and genetic variability of human metapneumoviruses identification of a new human coronavirus croup is associated with the novel coronavirus nl63 we thank to sj kim of the research center of sanggyepaik hospital for excellent technical assistance. key: cord-309763-8eywr57j authors: kuypers, jane; wright, nancy; corey, lawrence; morrow, rhoda title: detection and quantification of human metapneumovirus in pediatric specimens by real-time rt-pcr date: 2005-02-11 journal: j clin virol doi: 10.1016/j.jcv.2004.11.023 sha: doc_id: 309763 cord_uid: 8eywr57j background: human metapneumovirus (hmpv), a recently identified virus, causes respiratory illness in children. objectives: a real-time reverse transcription-polymerase chain reaction (rt-pcr) assay was developed and used to detect and quantify hmpv in respiratory specimens. study design: the quantitative rt-pcr assay amplified an approximately 70 base pair fragment from the hmpv fusion protein gene. the assay was validated and used to test respiratory specimens obtained from children seen at a hospital in seattle, washington, from december 2002 through may 2003. results: the assay detected 1000 hmpv copies/ml of specimen, did not detect 19 other respiratory viruses, and was able to detect and accurately quantify isolates from the four known hmpv genetic lineages in a proficiency panel of 20 previously tested samples. hmpv was detected in 52 (7.2%) of 719 pediatric respiratory specimens. the mean log 10 copies/ml of hmpv in the 52 positive specimens was 7.67 (range = 4.59–10.60). children aged 7–12 months had a significantly higher hmpv prevalence (12.4%) than did children younger than 7 months (4.7%) (p < 0.005). children in this age group also had significantly higher levels of hmpv in their respiratory specimens (mean log 8.43 copies/ml) than did the younger children (mean log 6.93 copies/ml) (p = 0.0025). conclusions: the rapid real-time rt-pcr assay described here is a sensitive test for clarifying the epidemiology of and diseases associated with hmpv. human metapneumovirus (hmpv), a member of the genus metapneumovirus in the paramyxoviridae family, was first isolated in 2001 from nasopharyngeal specimens obtained from young children (van den hoogen et al., 2001) and since then has been detected in respiratory specimens collected from patients in several countries throughout the world (peret et al., 2002; stockton et al., 2002; mackay et al., 2003; freyabbreviations: bp, base pair; dna, deoxyribonucleic acid; ml, milliliter; nm, nanometer; nm, nanomolar; rna, ribonucleic acid; rt-pcr, reverse transcription-polymerase chain reaction; l, microliter * corresponding author. tel.: +1 206 987 1850; fax: +1 206 987 3885. e-mail address: jane.kuypers@seattlechildrens.org (j. kuypers) . muth et al., 2003; peiris et al., 2003; maggi et al., 2003; viazov et al., 2003; madhi et al., 2003; ebihara et al., 2004; galiano et al., 2004) . both upper and lower respiratory tract infections have been associated with hmpv in young children and adults and the clinical symptoms are similar to those of respiratory syncytial virus (rsv) infection (van den hoogen et al., 2001; peret et al., 2002; freymuth et al., 2003; viazov et al., 2003; boivin et al., 2002) . hmpv cannot be reliably cultivated in many commonly used laboratory cell lines (van den hoogen et al., 2001; boivin et al., 2002) and there is no commercially available antigen detection test. however, hmpv genomic ribonucleic acid (rna) can be detected in clinical specimens using conventional (stockton et al., 2002; freymuth et al., 2003; peiris et al., 2003; maggi et al., 2003; viazov et al., 2003; madhi et al., 2003; ebihara et al., 2004; galiano et al., 2004; falsey et al., 2003; bastien et al., 2003; van den hoogen et al., 2003; williams et al., 2004; mullins et al., 2004; esper et al., 2004) or real-time reverse transcription-polymerase chain reaction (rt-pcr) (mackay et al., 2003; boivin et al., 2003) . genetic analysis has identified two major subgroups of hmpv, with two minor genetic clusters within each subgroup (van den hoogen et al., 2004; boivin et al., 2004) . reliable diagnostic tests that can detect hmpv strains from all four genetic lineages are needed for accurate diagnosis of hmpv infections. this study describes the design and application of a realtime rt-pcr assay using taqman techniques for the detection and quantification of hmpv in respiratory specimens from children. to rule out false negative results due to the presence of amplification inhibitors or poor quality of the rna extraction, specimens were evaluated by detection and quantification of an exogenous, unrelated rna control. detection of hmpv using this rapid and sensitive assay will provide important information about the role of hmpv in respiratory tract disease among all patient groups. from december 2002 through may 2003, 719 pediatric specimens (including 673 nasal washes, 27 nasal swabs, 13 tracheal aspirates, and 6 bronchoalveolar lavage (bal) specimens) that were submitted to the university of washington virology laboratory for respiratory virus fluorescent antibody assay (fa) or fa and culture, and contained sufficient residual material, were tested for hmpv by real-time rt-pcr. specimens were submitted from both hospitalized (76%) and non-hospitalized (24%) patients. the age of the 681 patients from whom samples were collected ranged from 1 day to 20 years (median age = 10 months). fifty-five percent of samples were from male and 45% were from female patients. thirty-six patients provided more than one specimen (mean interval = 40 days, range = 14-97 days). the 719 specimens represent approximately one-third of the total pediatric specimens submitted during this time period to the laboratory for respiratory virus fa analysis. there was no significant difference between the median ages of the patients whose sam-ples were tested by hmpv rt-pcr and those whose samples had insufficient volume for testing. specimens were tested for rsv, parainfluenza virus types 1, 2, and 3, influenza virus types a and b, and adenovirus using an indirect fluorescent antibody assay. in brief, cells obtained from patients' samples by centrifugation were suspended in buffer and spotted onto slides, air-dried, fixed in acetone, and incubated with a specific mouse anti-respiratory virus monoclonal antibody (chemicon, temecula, ca). after washing, goat anti-mouse fluorescein-conjugated monoclonal antibodies (icn, biomedicals, inc., costa mesa, ca) were applied to the sample, and the slides were incubated, washed, and read using a fluorescent microscope. the presence of bright green fluorescence within intact cells was considered positive. total nucleic acids were isolated from 200 l of each respiratory specimen as previously described (kuypers et al., 2004) . one low positive control with 2 × 10 4 copies/ml to 1 × 10 5 copies/ml (200-1000 copies/rt-pcr reaction) of hmpv harvested from cell culture and diluted in minimal essential medium (mem), and one negative control consisting of cultured, uninfected human epithelial cells, were extracted with each batch of clinical specimens. the hmpv rt-pcr primer and probe sequences, shown in table 1 , were designed using primer express software (applied biosystems, foster city, ca) from 16 aligned hmpv fusion protein gene sequences obtained from the ncbi database. four taqman primers and two probes were designed to amplify 69 bp and 74 bp fragments of the fusion protein genes from the two major hmpv genetic groups a and b, respectively. each gene sequence in the alignment matched at least one of the primer/probe sets with no more than one base mismatch per oligonucleotide. the probes were labeled on the 5 ends with the fluorescent dye 6fam and on the 3 ends with a minor groove binder non-fluorescent quencher table 1 real-time rt-pcr primer and probe sequences designed to detect hmpv (mgbnfq) (applied biosystems). a second primer set and vic-labeled probe (limaye et al., 2001) were added to a separate rt-pcr reaction to amplify and detect the exogenously added exo rna molecules (kuypers et al., 2004) . one-step rt-pcr reaction mixtures (taqman one-step rt-pcr master mix reagents, applied biosystems) were prepared as previously described (kuypers et al., 2004) , using 200 nm of each of the two hmpv forward and two reverse primers and 50 nm of each of the two hmpv probes in one reaction mix. one hmpv rt-pcr reaction for each rna sample was performed and analyzed in a 7000 sequence detection system (prism, applied biosystems). the threshold cycles of samples were compared to a standard curve generated by amplification of known numbers of hmpv or exo rna transcripts. results were expressed as hmpv copies/ml of original sample. all samples with negative hmpv results (<1000 copies/ml) required detection of at least 200 exo rna copies/reaction to be valid. rna extraction (if sufficient sample volume was available), and rt-pcr were repeated on all samples that were negative for both hmpv and exo. only specimens with satisfactory amplification of exo were used in the analyses (719 (98.8%) of 728). the hmpv pcr amplicons from several clinical specimens that were positive for hmpv were cloned and sequenced. clones with sequences matching each of the two primer/probe sets were transcribed as previously described for an rsv rt-pcr assay (kuypers et al., 2004) so that negative sense rna transcripts for hmpv subtype a and subtype b were synthesized. the rna was purified by two rounds of dnase treatment (dna free, ambion, inc., austin, tx), phenol chloroform extraction, and ethanol precipitation, confirmed for size and purity on a bioanalyzer (center for expression arrays, university of washington, seattle, wa), and quantified by absorbance at 260 nm. contaminating deoxyribonucleic acid (dna) was not detected by real-time pcr amplification of up to 10 7 copies of rna transcript/reaction. ten-fold serial dilutions containing 10 7 -10 1 copies of rna transcript were added to real-time rt-pcr reactions in duplicate. the results were used to generate standard curves for quantification of hmpv and exo rna in clinical samples. the specificity of the hmpv rt-pcr assay was assessed by testing rna or dna purified from at least two isolates each of 19 viruses commonly found in respiratory specimens including respiratory syncytial virus, parainfluenza virus types 1, 2, and 3, influenza virus types a and b, rhinovirus, coronavirus, enterovirus, coxsackie b virus, aden-ovirus, and herpes viruses 1 through 8. in addition, a proficiency panel of 20 unknown specimens, prepared by medimmune, inc. (mountain view, ca), was also tested. the content of the samples was not revealed until after results had been submitted to medimmune. the samples were also tested at medimmune using a quantitative rt-pcr assay with primers that target the hmpv nucleocapsid gene (maertzdorf et al., 2004) . the reproducibility of the rna extraction method and the rt-pcr reaction was evaluated using two previously quantified nasal wash specimens that were diluted in varying amounts into previously tested, hmpv negative nasal wash specimens. rna from four replicates each of eight specimens containing between 5000 hmpv copies/ml and 2 × 10 9 hmpv copies/ml was extracted and amplified. significant differences between groups were determined by the wilcoxon rank sum test for comparison of medians, the t-test for comparison of means, and the chi-squared test for comparison of proportions. the rt-pcr assay consistently detected 10 hmpv subtype a or b rna copies/reaction, which corresponds to a sensitivity of 1000 copies of hmpv/ml of specimen, and was linear to 10 8 copies/reaction. hmpv subtype a and subtype b rna transcripts generated standard curves with nearly identical characteristics and regression coefficients ≥0.98. nucleic acid extracted from at least 2 isolates each of 19 non-hmpv viruses commonly found in respiratory specimens was not detected by the assay. to evaluate the reproducibility of the assay, rna was extracted and amplified from four aliquots each of eight nasal washes containing between 5000 hmpv copies/ml and 2 × 10 9 hmpv copies/ml. the mean within-specimen coefficient of variation (cv) for the eight samples was 2.2%. the mean hmpv copies/reaction of the low positive control that was extracted and amplified with each batch of specimens was 380 (range = 212-829) copies/reaction, with an interassay cv of 6.2% for 17 assays. to further assess the accuracy of our assay, a proficiency panel of 20 coded specimens from medimmune, inc., containing samples of all 4 known hmpv genetic lineages, was tested in a blinded fashion. the results obtained with our assay were compared with those obtained by the medimmune rt-pcr assay (maertzdorf et al., 2004) (table 2 ). there was 100% concordance between the methods for detection of hmpv, and good correlation of quantification (r 2 = 0.864) (fig. 1) . hmpv was detected in 52 (7.2%) of 719 pediatric respiratory specimens overall, including 45 (6.7%) of 673 nasal maertzdorf et al. (2004) . c sample signal did not cross threshold during pcr amplification. washes, 5 (18.5%) of 27 nasal swabs, 1 (7.7%) of 13 tracheal aspirates, and 1 (16.7%) of 6 bal. the proportion of hmpv positive nasal swabs was significantly higher than the proportion of hmpv positive nasal washes (p = 0.025). hmpv was detected in 18 (15.8%) of 114 specimens collected in april and may compared to 34 (5.6%) of 605 specimens collected from december through march (p < 0.005) (fig. 2) . among the 36 children who provided more than one specimen, 32 were consistently hmpv negative, and 4 were positive for 1 of the 2 specimens submitted. the median age of the 52 hmpv positive children was 11.5 months, while the median age of the children providing the 667 mpv negative specimens was fig. 1 . the titer of hmpv obtained from the 12 hmpv positive samples listed in table 2 using the rt-pcr assay developed at the university of washington is plotted against the titer obtained using an rt-pcr assay performed at medimmune, inc. the linear regression trend line and r 2 -value of the line are shown. 9 months. fifty percent of the hmpv positive versus 55.5% of hmpv negative specimens were from males, and 69% of the hmpv positive versus 76.7% of the hmpv negative patients were hospitalized. eight (15%) of 52 hmpv positive specimens were positive by fa for another respiratory virus (5 rsv, 2 influenza a, and 1 adenovirus). among the 414 specimens that were negative by fa for 7 other respiratory viruses, 44 (10.6%) were hmpv positive. among the 44 patients with only hmpv detected, 63% were hospitalized compared to 87.5% of the 8 patients with dual respiratory virus infections. all eight of the dually infected samples were collected in january, february, or march. the mean log 10 hmpv copies/ml for the 52 positive specimens was 7.67 (range = 4.59-10.60). the mean log 10 copies/ml of hmpv in the 44 specimens for which hmpv was the only respiratory virus detected was 7.97 compared to a mean log 10 hmpv copies/ml of 6.03 in the 8 dually infected samples (p = 0.001). the hmpv prevalence and mean viral load for each of five patient age groups are shown in fig. 3 . children aged 7-12 months had a significantly higher prevalence of hmpv positive specimens (12.4%) than did children younger than 7 months (4.7%) (p < 0.005), but not those older than 12 months (7.4%). children in this 7-12 months age group also had significantly higher levels of hmpv in their respiratory specimens (mean log 8.43 copies/ml) than did children younger than 7 months (mean log 6.93 copies/ml) (p = 0.0025). there fig. 2 . the proportion of specimens positive for hmpv by rt-pcr was determined among the total number of respiratory specimens collected during each of the 6 months of the study period (december, 2002 through may, 2003 were no significant differences in viral load between male and female patients or between hospitalized and non-hospitalized patients. the one-step, real-time rt-pcr assay described in this report for the detection and quantification of hmpv was rapid, sensitive, specific among the viruses tested, and reproducible. several technical aspects of this assay warrant discussion. one of the strengths of our study was that, by testing every specimen for an external amplification control, false negative specimens due to inefficient rna extraction or the presence of pcr inhibitors could be ruled out. however, we could not control for other factors that could lead to false negative results, such as stage of the patient's illness, or possible degradation of viral rna during specimen transport. a previous re-port has suggested that rt-pcr primers that target the hmpv nucleoprotein or polymerase genes may be more suitable for hmpv detection than are primers that target the matrix, phosphoprotein, or fusion protein genes . as part of our study, we compared primers and probes designed to detect the hmpv fusion protein gene to an rt-pcr assay with primers that target the nucleoprotein gene (maertzdorf et al., 2004) . the hmpv fusion protein-based assay accurately detected and quantified hmpv isolates belonging to all four known genetic lineages. detection of all the known subtypes of hmpv was achieved by using two primer/probe sets in the pcr reaction. each set was designed to amplify isolates belonging to subtype a or b, but used together in one reaction mix. whether specific hmpv subtypes are associated with the severity of illness, as has been shown for rsv (martinello et al., 2002) , has not been determined. future work using the primer/probe sets from this assay in separate rt-pcr reactions will provide information about this question. fig. 3 . the proportion of specimens positive for hmpv by rt-pcr and the mean number of hmpv, expressed as log 10 copies/ml, detected in the positive specimens were determined among the total number of respiratory specimens collected from patients belonging to each of five age groups. the 7.2% prevalence of hmpv found in specimens obtained from children with respiratory illness in seattle is similar to the 4-18% prevalence reported by others in different parts of the world, using both conventional and real-time rt-pcr methods (peiris et al., 2003; viazov et al., 2003; ebihara et al., 2004; boivin et al., 2003; mullins et al., 2004) . the prevalence of hmpv in nasal swab specimens was significantly higher than in nasal wash specimens. the reason for collection of a swab rather than a wash from a particular patient is not known, making it difficult to draw conclusions about the relative utility of each of these samples for hmpv detection. however, these data show hmpv can readily be detected from swab specimens. interestingly, hmpv was detected in specimens submitted from symptomatic children in all months surveyed and ranged from 4.4% to 17.4% of specimens submitted. the peak months of april and may for hmpv detection in our population agree with some published reports that the prevalence of hmpv is higher in spring (march, april, or may) compared to winter months (december, january, or february) (peiris et al., 2003; galiano et al., 2004; boivin et al., 2003; williams et al., 2004; mullins et al., 2004; esper et al., 2004) . the median age of 11.5 months for hmpv positive children is also similar to that reported by others (williams et al., 2004; mullins et al., 2004) . of note, the patient age group with the highest prevalence of hmpv (7-12 months) was older than the age group with the highest prevalence of rsv infection (0-6 months) reported in a previous study (kuypers et al., 2004) . among the 15% of hmpv positive specimens that were co-infected with another respiratory virus as determined by fa, rsv, and influenza were the most common co-infections, similar to findings reported by others (viazov et al., 2003; boivin et al., 2003) . more importantly, hmpv was detected in 10.6% of specimens for which no other viral pathogen was detected by fa. this is the first report of quantification of hmpv in pediatric respiratory specimens, although interpretation of these results must take into account the variability between patients in collection of respiratory specimens. in our collection and testing methods, both inter and extra-cellular viral rna were detected by the assay so that the specimen volume, more than the number of cells in a sample, determined the viral load. volumes were recorded for each specimen and varied across the study by a factor of four. while the viral load comparisons in this paper are based on respiratory specimens that do vary in volume and inferences should be made with caution, a 10-fold difference in hmpv copies/ml between specimens is most likely a real difference. the mean number of hmpv in these specimens (7.67 log 10 copies/ml) was similar to the mean number of rsv (7.30 log 10 copies/ml) detected in pediatric respiratory specimens (kuypers et al., 2004) . for rsv infections, the virus load was significantly higher for patients in the lowest (0-6 months) age group compared to older rsv positive children (kuypers et al., 2004) , while for hmpv, children 7-12 months old had significantly higher levels of hmpv than did younger children. ongoing inves-tigations will help determine any associations between viral load and clinical signs and symptoms. the one-step, quantitative, real-time rt-pcr assay described here for the detection and quantification of hmpv in respiratory specimens is rapid, sensitive, and accurate when compared to another pcr assay. it will be a useful tool for further investigations on the epidemiology of and diseases associated with hmpv. human metapneumovirus infection in the canadian population virological features and clinical manifestations associated with human metapneumovirus: a new paramyxovirus responsible for acute respiratorytract infections in all age groups human metapneumovirus infections in hospitalized children global genetic diversity of human metapneumovirus fusion gene comparative evaluation of real-time pcr assays for detection of the human metapneumovirus human metapneumovirus infection in japanese children a 1-year experience with human metapneumovirus in children aged <5 years human metapneumovirus infections in young and elderly adults presence of the new human metapneumovirus in french children with bronchiolitis evidence of human metapneumovirus in children in argentina evaluation of quantitative and typespecific real-time rt-pcr assays for detection of respiratory syncytial virus in respiratory specimens from children cytomegalovirus (cmv) dna load in plasma for the diagnosis of cmv disease before engraftment in hematopoietic stem-cell transplant recipients molecular assays for detection of human metapneumovirus human metapneumovirus-associated lower respiratory tract infections among hospitalized human immunodeficiency virus type 1 (hiv-1)-infected and hiv-1-uninfected african infants real-time reverse transcriptase pcr assay for detection of human metapneumoviruses from all known genetic lineages human metapneumovirus associated with respiratory tract infections in a 3-year study of nasal swabs from infants in italy correlation between respiratory syncytial virus genotype and severity of illness human metapneumovirus infection among children hospitalized with acute respiratory illness children with respiratory disease associated with metapneumovirus in hong kong characterization of human metapneumovirus isolated from patients in north america human metapneumovirus as a cause of community-acquired respiratory illness a newly discovered human pneumovirus isolated from young children with respiratory tract disease prevalence and clinical symptoms of human metapneumovirus infection in hospitalized patients antigenic and genetic variability of human metapneumoviruses high prevalence of human metapneumovirus infection in young children and genetic heterogeneity of the viral isolates human metapneumovirus and lower respiratory tract disease in otherwise healthy infants and children the authors thank dr. guy boivin, a centre de recherche en infectiologie investigator, canada, and the us centers for disease control and prevention for providing a human metapneumovirus isolate for initial testing of the assay, and medimmune, inc., for providing the proficiency panel specimens and the results of their assay. key: cord-295873-kykyubdq authors: morikawa, saeko; kohdera, urara; hosaka, taisuke; ishii, kousuke; akagawa, shohei; hiroi, satoshi; kase, tetsuo title: seasonal variations of respiratory viruses and etiology of human rhinovirus infection in children date: 2015-10-22 journal: j clin virol doi: 10.1016/j.jcv.2015.10.001 sha: doc_id: 295873 cord_uid: kykyubdq background: using the polymerase chain reaction (pcr) method it is possible to detect uncultivable viruses and discover multiple viral infections. however, the clinical importance of these findings in relation to symptoms is not known. objectives: the seasonal fluctuations of respiratory viruses and the clinical outcomes of single infections and dual infections were investigated. study design: nasal aspirate samples were obtained from outpatients and inpatients of a children’s hospital and these samples were subjected to real-time pcr to detect 16 respiratory viruses. seasonal variations of the 16 viruses and the clinical outcomes such as wheezing, the need for oxygenation and prolonged hospitalization of patients with single viral infections and multiple infections were determined for the 5 most often detected viruses. results: among 512 specimens analyzed, one or more viruses were detected in 424 (83%) specimens. two or more viruses were detected in 160 samples (31% of all samples). the epidemic peaks of the viruses did not coincide with each other. rhinoviruses were the most frequently detected viruses and their coinfection rates were also higher. however, the disease severity in the lower respiratory tract did not differ in most respiratory viral infections regardless of whether there was single infection or dual infection with a rhinovirus and other respiratory virus. conclusions: seasonal distribution was seen for each virus. there were no significant differences in clinical symptoms in the children studied. because the infection of rhinoviruses is the common occurrence in children, it is hypothesized that the factors related to disease severity are mainly the underlying conditions of the children. respiratory tract infections are frequently seen in children and a significant number of these infections are caused by viral pathogens [1, 2] . especially for infants, viral respiratory infections carry a high risk for severe symptoms resulting in hospitalization. there is a abbreviations: pcr, polymerase chain reaction; rs virus, respiratory syncytial virus. * corresponding author. e-mail addresses: morikawa@iph.pref.osaka.jp (s. morikawa), kohdera@nakano-kodomo.or.jp (u. kohdera), thosaka@pd6.so-net.ne.jp (t. hosaka), kousuke. 22 .ishii@gmail.com (k. ishii), shohei@mbk.nifty.com (s. akagawa), hiroi@iph.pref.osaka.jp (s. hiroi), kasetetsuo@iph.pref.osaka.jp (t. kase). strong correlation between viral bronchiolitis in infants and wheezing later in childhood [3] . however, most children show mild symptoms during viral respiratory infections involving only the nose and upper respiratory passages. moreover, clinically useful antivirals do not exist for most such viruses and it is thought that for viral respiratory infections it is not necessary to examine the pathogen. recently, nucleic acid amplification tests such as pcr are increasingly being used to diagnose viral respiratory tract infections. several studies have shown that most common respiratory viruses have epidemic seasons in many areas [4, 7] . pcr makes it possible to detect uncultivable viruses such as human bocavirus and rhinovirus c and discover concurrent viral infections. however, the clinical importance of these findings with regard to symptoms is not known. some reports indicate that human "classical" subtypes http://dx.doi.org/10.1016/j.jcv.2015. 10 .001 1386-6532/© 2015 elsevier b.v. all rights reserved. table 1 the monthly variation of viruses detected in nasal aspirates during the study period. 0 0 4 4 2 1 3 0 1 0 0 0 1 16 (3.1) parainfluenzavirus 2 0 0 0 1 0 0 0 0 0 0 0 0 0 1 (0.2) parainfluenzavirus 3 5 17 9 6 2 0 0 0 0 0 0 0 2 41 (8.0) parainfluenzavirus 4 0 0 1 3 8 2 0 0 0 0 0 0 0 14 (2.7) rsvirus 2 3 3 3 3 6 8 7 5 0 2 8 2 of coronavirus, oc43, nl63, 229e and hku-1, have low impacts on respiratory health [8, 9] . in this study, separate real-time pcr assays were used to detect 16 respiratory viruses in nasal aspirates taken from pediatric patients and we investigated the seasonal fluctuations of the respiratory viruses. we also compared the clinical outcomes such as wheezing, the need for oxygenation and prolonged hospitalization, for patients with single and multiple viral infections. from week seventeen 2013 to week sixteen 2014, nasal aspirate samples were obtained from outpatients and inpatients of a children's hospital. their symptoms were systematically recorded by the attending physicians. written informed consent was obtained from the parents. of the 513 samples obtained, 1 specimen was excluded because of withdrawal of approval. the median age of the patients was 1y (range 0-14 years). age groups were: 0 year 35.9% (n = 184), 1 year 32.4% (n = 166), 2 years 11.9% (n = 61), 3years 7.2% (n = 37), 4 years 5.6% (n = 30), and ≥5 years 6.8% (n = 35). the proportion of females was 41.4%. each sample was amplified using primers and probes specific for each of the targets as previously described [10] . briefly, nucleic acids were extracted from 200 l specimens using the magtration system with a magdea viral dna/rna 200 kit (precision system science co., ltd., chiba, japan) with a 50 l elution volume. rt reactions were performed using a revertra ace qpcr rt kit (toyobo co., ltd., osaka, japan) following the manufacturer's instructions. the cdna was then amplified using realtime pcr master mix (toyobo) with a total volume of 25 l. the sensitivity of each of the realtime pcr methods was reported previously [10] . enteroviruses and rhinoviruses were genotyped by direct sequencing. amplification of the vp4/vp2 region of the enterovirus or rhinovirus for typing was performed with semi-nested rt-pcr as previously described [11] . the purified pcr products were subjected to direct sequencing with a bigdye terminator v1.1 kit as per the manufacturer's instructions (applied biosystems, ca, usa). sequence analysis was performed using the dnadynamo program (blue tractor software, uk). using mega5.2 (tamura et al., 2011, ver5.2.2), we employed the neighbor-joining method [12] to construct phylogenetic trees from the vp4/vp2 region (420 nt) sequences of prototype isolates of each rhinovirus type commonly used in epidemiologic studies of human rhinoviruses retrieved from genbank [13] [14] [15] and new types proposed previously [13, 16, 17] . genotypes were assigned on the basis of their clustering with known prototype reference strains. the kruskal-wallis test, mann-whitney u-test and fisher's exact test were used for comparisons. for all analyses, a p-value of less than 0.05 was considered significant. statistical analysis was performed using spss v16.0 (spss inc., tokyo, japan). among the 512 specimens analyzed, one or more viruses were detected in 424 (83%) specimens (table 1) . two or more viruses were detected in 160 samples (31% of all samples). only one specimen included 5 distinct viruses (human metapneumovirus, rhinoviruses were found most often (n = 192, 37.5% of all samples and 45.3% of positive samples) followed by adenoviruses (n = 86, 16.8% of all samples) and human metapneumovirus (n = 68, 13.3%). influenza virus types a and b were detected in the winter and human metapneumovirus was detected during the spring months. human bocavirus and parainfluenza virus type 3 were found during the spring and early summer. parainfluenza virus type 1 and parechovirus were detected mainly in the summer. the detection of rs virus increased in the autumn. genetically conserved regions of both enteroviruses and rhinoviruses were detected by real-time pcr all year round with a high proportion of positive samples. genotyping revealed the presence of enteroviruses in the summer and a decrease in rhinovirus a in the winter. on the other hand, rhinovirus c was detected in the winter months. adenoviruses were detected mainly in the summer and winter (fig. 1 ). next, we evaluated the prevalence of multiple infections by the viruses. for the human bocavirus, parechovirus and rhinoviruses a and c, the rates of coinfection were high compared with other respiratory viruses. rhinoviruses were the most frequently detected viruses and their coinfection rates were also higher than those of the other viruses. therefore, we compared the clinical symptoms caused by five types of viruses, adenoviruses, human bocavirus, rs virus, parainfluenza virus type 3, and human metapneumovirus, which were detected most often after rhinoviruses, and rhinovirus single infections and symptoms in cases with dual infections including rhinoviruses. there was no significant difference between the number of days of hospitalization caused by rhinoviruses and the other five viruses. the number of days in the hospital of patients in whom rs virus was detected was longer than that of patients infected with human metapneumovirus (table 2) . for the five viruses discussed above, we compared the number of hospitalization days of the cases with single infections by the each 5 viruses with those having dual infections with a rhinovirus and those with dual infection with a virus other than a rhinovirus. the number of days of hospitalization of the children with parainfluenza virus type 3 infection alone was shorter than for children with paranfluenza virus and rhinovirus dual infection. on the other hand, children with infection by human metapneumovirus alone spent fewer days in the hospital than those with dual infections by human metapneumovirus and a respiratory virus other than a rhinovirus (table 3) . we next compared the requirement for oxygenation and the presence of wheezing of the children with single infections and dual infections with a rhinovirus or other respiratory virus. the patients with dual infections with an adenovirus and rhinovirus needed significantly more oxygenation than those with an adenovirus infection or dual infection with an adenovirus and other respiratory virus. however, the severity of the lower respiratory tract disease for which the requirement of oxygenation was assumed and the presence of wheezing as an index did not differ among most respiratory viral infections, regardless of whether they were single infections or dual ones with a rhinovirus and other respiratory virus (table 4 ). in this study, separate real-time pcr assays were used to detect 12 rna viruses and two dna viruses, and real-time reverse transcription (rt) pcr was used to detect influenza viruses a and b. of the 512 samples analyzed, 424 were positive 1 virus or more. the overall viral detection rate was 83%, which was much higher than in similar past reports [5] [6] [7] 18] . the reason may be that our method had many detection targets. furthermore, the higher detection rates among young children likely correspond to the higher incidence of viral respiratory tract infections in children, although other factors such as pre-existing immunity might also have played a role [4] . since the specimens from children aged 1 year or younger accounted for 68% of those studied, it is considered that the rate of viral detection and the rate of concurrent infections became higher than in past reference data. the largest number of viruses detected in one sample was 5 in the nasal aspirate from a 9-month-old girl. when comparing the number of viruses detected per specimen, it was found that the specimens from younger patients tended to include more than one virus (data not shown). seasonal distribution was seen for each virus. the epidemic peak of each virus was about the same as in another report from japan [19] . seasonal influenza virus type a migrates globally between epidemics and is reintroduced every winter season in temperate climates [20] , although the underlying cause of the seasonality of the other respiratory viruses remains unknown. it has been suggested that rhinovirus infections could reduce subsequent rs virus and influenza virus type a infections by inducing an interferon response, thereby creating an undesirable environment for these viruses [21, 22] . in this study, the peaks for the various viral epidemics did not coincide. thus, it is thought that some kind of interference by viruses may influence epidemics of respiratory viruses. in this study, human rhinoviruses were the most common viruses. rhinoviruses are thought to be mainly associated with the common cold, causing mild respiratory symptoms [23] . these viruses are classified into three species and divided into more than 160 serotypes or genotypes. thus they are among the mostly commonly detected viruses in respiratory specimens of children [10] . however, recent reports suggest that rhinovirus infections may induce and/or exacerbate asthma and be responsible for lower respiratory tract infections with severe symptoms [24, 25] . based on the sequence data, rhinovirus c was detected mainly in the winter, whereas rhinovirus a was detected all year round, with a high proportion of positive samples in june (44% of the samples). although rhinovirus b was detected, its seasonality was not clear. however, it became clear that there was a difference in the epidemic seasons of rhinoviruses a and c. furthermore, the detected rhinoviruses consisted of 32 genotypes of group a, 5 genotypes of group b and 21 genotypes of group c, suggesting that multiple genotypes were brought into the area and that epidemics of some of them might occur at the same time (supplementary table 1 ). rhinovirus a consists of 80 serotypes and b consists of 32 types, including genotypes, and there are now 55 rhinovirus c genotypes proposed [17] . it is not clear whether the genotypes of the rhinoviruses detected in this study cause severe illness. we also compared the clinical symptoms of single infections and dual infections by rhinoviruses and other respiratory viruses of the children infected by one of the five most commonly detected respiratory viruses. the results revealed that there were no significant differences in the number of days of hospitalization, the necessity for oxygen inhalation or the existence of wheezing between the children with single infections and those with dual infections. in former reports that evaluated the impacts of rhinoviruses on lower respiratory infections, there were only marginal differences between the different rhinovirus groups and between single rhinovirus infection and rhinovirus coinfection [26, 27] . though there was no significant difference in the number of hospitalization days of patients with single infections by rhinoviruses or other respiratory viruses, our data suggested the importance of rhinoviruses as a potential cause of pediatric pneumonia. recently, our group evaluated the prevalence of rhinovirus infections among asymptomatic children [10] . rhinoviruses were often detected in their throats at a time without any symptoms. since rhinoviruses do not exist in the upper respiratory tract for a long time even if a child does not show symptoms, these were "active" asymptomatic infections rather than persistent infections. in conclusion, rhinoviruses are causative agents of various conditions ranging from asymptomatic infection to lower respiratory tract infection and pneumonia. rhinovirus coinfection with other respiratory viruses is not responsible for more severe symptoms, so it is hypothesized that the factors related to disease severity are mainly the underlying conditions of the children. respiratory viral infection in infants: causes, clinical symptoms, virology, and immunology frequency of viruses associated with acute respiratory infections in children younger than five years of age at a locality of mexico city wheezy babies-wheezy adults? review on long-term outcome until adulthood after early childhood wheezing seasonal variations of 15 respiratory agents illustrated by the application of a multiplex polymerase chain reaction assay, scand clinical impact of rt-pcr for pediatric acute respiratory infections: a controlled clinical trial viral etiology of respiratory infections in children in southwestern saudi arabia using multiplex reverse-transcriptase polymerase chain reaction ten years' experience with year-round active surveillance of up to 19 respiratory pathogens in children high incidence but low burden of coronaviruses and preferential associations between respiratory viruses human coronavirus in young children hospitalized for acute respiratory illness and asymptomatic controls detection of respiratory viruses in gargle specimens of healthy children molecular diagnosis of human enteroviruses by phylogeny-based classification by use of the vp4 sequence the neighbor-joining method: a new method for reconstructing phylogenetic trees proposals for the classification of human rhinovirus species a, b and c into genotypically assigned types prospective genotyping of human rhinoviruses in children and adults during the winter of molecular epidemiology of human rhinovirus c in patients with acute respiratory tract infections in osaka city proposals for the classification of human rhinovirus species c into genotypically assigned types picornaviridae study group comparison of real-time pcr assays with fluorescent-antibody assays for diagnosis of respiratory virus infections in children epidemiological study of respiratory viruses detected in patients under two years old who required admission because of lower respiratory disease phylogenetic analysis reveals the global migration of seasonal influenza a viruses do rhinoviruses reduce the probability of viral co-detection during acute respiratory tract infections? does viral interference affect spread of influenza? viral etiology of common cold in children, finland emerg wheezing rhinovirus illness in early life predict asthma development in high-risk children the abcs of rhinoviruses, wheezing and asthma impact of rhinoviruses on pediatric community-acquired pneumonia human rhinovirus in the lower respiratory tract infections of young children and the possible involvement of a secondary respiratory viral agent the authors would like to thank maki otsuka for helpful technical assistance in amplification and kim barrymore for editing the manuscript. this work was supported by grant-in-aid for scientific research (c) grant number from the japan society for the promotion of science. none declared. this study was approved by the osaka prefectural institute of public health ethical committee (no. 1302-05-01) . supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jcv.2015.10.001. key: cord-323567-1397kds0 authors: bialasiewicz, s.; whiley, d.m.; lambert, s.b.; gould, a.; nissen, m.d.; sloots, t.p. title: development and evaluation of real-time pcr assays for the detection of the newly identified ki and wu polyomaviruses date: 2007-08-21 journal: j clin virol doi: 10.1016/j.jcv.2007.07.015 sha: doc_id: 323567 cord_uid: 1397kds0 background: recently, novel human polyomaviruses, ki (kiv) and wu (wuv) were described. their role in human disease has not yet been determined. objectives: the aim of this study was to develop sensitive and specific assays for the detection of kiv and wuv. study: two kiv (ki-a and ki-b) and three wuv (wu-a, wu-b and wu-c) real-time polymerase chain reaction (rtpcr) assays were developed and evaluated. clinical sensitivities and specificities were determined by testing 200 respiratory specimens and the results compared to those for previously described conventional pcr assays. limits of detection were determined, and the analytical specificities of the assays were investigated. results: no cross-reactivity was observed between the rtpcr methods and unrelated organisms. all five rtpcr assays could reliably detect 10 copies of genomic dna equivalents per reaction, which was more sensitive than conventional methods. compared to the conventional pcr assays, the sensitivity of the ki-a, ki-b, wu-a, wu-b and wu-c assays was 100%, 86.7% 95.5%, 100% and 100%, respectively. specificity was 94.6%, 97.3%, 96.6%, 97.7% and 97.2%, respectively. conclusions: the ki-a, wu-b and wu-c assays provide the most sensitive detection of kiv and wuv in clinical specimens and may be used for further research into these viruses. the non-enveloped small double-stranded circular dna viruses of the polyomaviridae are known to infect a wide variety of birds and mammals. until recently, only two, jc virus (jcv) and bk virus (bkv), were known to commonly infect humans. both are ubiquitous in the human population (knowles, 2006) , establish persistent infections in the kidneys and in other tissue sites without overt disease (randhawa et al., 2006) , and may be detected in the urine of healthy adults and occasionally in the feces of children (vanchiere et al., 2005; knowles, 2006) . both jcv and bkv may cause human disease, particularly in immunocompromised patients. jcv is the causative agent of the neurological disease progressive multifocal leukoencephalopathy (pml), which occurs primarily in aids affected patients (dubois et al., 1998) . bkv-associated disease includes hemorrhagic cystitis and other urinary tract diseases, which most commonly manifest in transplant patients undergoing immunosuppressive therapy (bogdanovic et al., 2006) . in addition, both jcv and bkv exhibit oncogenic properties in experimental animals. indeed, in the past few years jcv, bkv and a simian polyomavirus, sv-40, have come under greater scrutiny for their potential roles in several human cancers (lee and langhoff, 2006) . in 2007, two novel human polyomaviruses, ki polyomavirus (kiv) and wu polyomavirus (wuv), were described by independent groups in sweden and the usa (allander et al., 2007; gaynor et al., 2007) . the two viruses are genetically closely related and together form a new subfamily of polyomaviruses; they have comparable genomes in the early coding regions to other primate polyomaviruses, but are dissimilar in their late regions (gaynor et al., 2007) . so far, the role of these novel polyomaviruses in human disease has not been established. initial data show that both kiv and wuv can be detected in up to 4.5% of respiratory samples obtained from patients with acute respiratory tract infection (bialasiewicz et al., submitted for publication) . however, a precise role in respiratory disease has been confounded by high co-detection rates with other respiratory viruses. unlike jcv and bkv, kiv and wuv nucleic acids have not been detected in urine samples, raising further questions over the persistence of these viruses in the human body, as well as modes of transmission. clearly, further studies are needed to elucidate the epidemiology, pathogenesis and potential for oncogenesis of kiv and wuv. in order to facilitate these investigations, rapid and sensitive detection methods to specifically detect these viruses should be developed. real-time pcr (rtpcr) assays offer enhanced sensitivity, specificity, rapid turnaround time, decreased contamination risk, and the ability to quantify pathogen targets within clinical samples (mackay, 2004; espy et al., 2006) . in this study we describe the development and evaluation of rtpcr assays for the detection of kiv and wuv. the primers and hydrolysis (taqman) probes used in the rtpcr methods were designed using bioedit 7.0.5.3 (hall, 1999) and primer express 2.0 software (applied biosystems pty. ltd., australia). briefly, bioedit 7.0.5.3 was used to identify conserved sequence regions using alignments of full-length genomic kiv and wuv sequences (genbank accession numbers ef127908, ef127907, ef127906, ef444554, ef444553, ef444552, ef444551, ef444550, ef444549). predicted conserved regions were input into primer express 2.0 software to search for potential kiv and wuv primer and probe targets. two assays, ki-a and ki-b, targeting the regulatory region and the small t antigen, respectively, were identified as candidates for specific real-time detection of kiv (table 1) . similarly, three wuv assays were designed, with both the wu-a and wu-c assays targeting the regulatory region, and wu-b targeting the terminal end of the large t antigen (table 1) . real-time pcr was performed on a rotorgene 3000 (corbett robotics, australia). all five real-time assays utilized a table 1 primer and probe sequences used in the development of real-time pcr assays for the detection of ki and wu polyomaviruses common pcr mix and cycling conditions. briefly, 12.5 l of qiagen quantitect probe master mix (qiagen, australia), 10 pmol of each primer, 4 pmol of the corresponding probe, and 2 l of sample nucleic acid extract in a final reaction volume of 25 l, were cycled under the following parameters: incubation of 15 min at 95 • c, followed by 55 cycles of 95 • c for 15 s, and 60 • c for 1 min. signal acquisition was obtained at the latter end of extension on each cycle on the fam channel. clinical sensitivity and specificity were determined by retrospectively testing 200 nasopharyngeal aspirate (npa) specimens by the five rtpcr methods and comparing the results to those obtained using previously described wuv and kiv conventional pcr assays. the npa specimens were collected between june and september 2003 from hospitalized patients or patients presenting at hospital emergency departments in queensland, australia with acute respiratory tract illness. nucleic acid extraction was performed using the high pure nucleic acid kit (roche diagnostics, australia) according to manufacturer's instructions. the previously described conventional kiv and wuv pcr assays utilized primers polvp1-39f; polvp1-363r (kiv; allander et al., 2007) and ag0044 and ag0045 (wuv; gaynor et al., 2007) and were performed with some modifications. separate reactions were performed for each virus. briefly, each reaction mix contained 2.5 pmol of each primer, 0.625 l of 10 mm dntps, 0.5 l of 25 mm mgcl 2 , 2.5 l of 10x qiagen pcr buffer (qiagen, australia), 1.25u of qiagen hotstart taq, and 2 l of nucleic acid extract in a final volume of 25 l. kiv pcr cycling was performed on an abi geneamp 2700 instrument (applied biosystems pty. ltd., australia) with the following parameters; a 15 min incubation at 95 • c, followed by 40 cycles of 95 • c for 30 s, 54 • c for 30 s, and 72 • c for 1 min, followed by a final extension of 72 • c for 10 min. the wuv screening assay used a similar cycling profile to the kiv method but with an annealing temperature of 56 • c. pcr products were visualised by electrophoresis on 2% agarose gel with ethidium bromide staining. a panel of commensal and pathogenic organisms was used to investigate assay specificity (table 2) . also, human nucleic acid was extracted from whole blood and used to test for non-specific cross-reactions with human genomic dna. the detection limits of the assays were determined using dilutions of viral genomic dna. initially, plasmids were created using the pgem-t-easy vector system (promega, madison, usa). the plasmid kip001 contained an 1149 bp kiv genome fragment, which was synthesized using primers kip001-4313f and kip001-372-r (table 1) , and encompassed the targets for the ki-a real-time assay. similarly, plasmid wup001 incorporating a 570bp fragment of wuv was synthesized using primers wup001-107-f and wup001-636-r (table 1) , and contained the target sequences for the wu-a real-time pcr assay. plasmid copy numbers were calculated based on molecular weight and optical density measurements. ten-fold dilutions of the plasmids were tested in their respective rtpcr assays and used to generate standard curves using the rotorgene 3000 software (corbett robotics, australia). these standard curves were then used to quantify secondary control samples containing the viral genomic dna previously extracted from clinical specimens collected from a kiv-and wuv-positive patient, respectively. detection limits were determined by testing 10-fold dilutions of the quantified genomic kiv and wuv dna in triplicate in all assays, including the conventional pcr methods. the limit of detection was defined as the final dilution in which all three replicates tested positive. a total of 200 clinical respiratory sample extracts were tested to determine clinical sensitivity and specificity of the real-time assays (table 3) . kiv dna was detected in 13 samples by the kiv conventional pcr and both kiv rtpcr assays. two specimens were positive by the kiv conventional and ki-a real-time methods, but were negative by the ki-b assay (samples 1 and 2; table 4 ). these were considered false-negative results by the ki-b assay. five samples gave positive results in both kiv rtpcr assays and were negative by conventional pcr, and a further five samples were positive by ki-a alone. all of these samples provided high cycle threshold (ct) values in the rtpcr methods (samples 3-11, 21; table 4 ). wuv dna was detected in 21 of the 200 clinical samples by the wuv conventional pcr and the three wuv real-time assays. assay wu-a failed to detect one specimen that was detected by the conventional pcr, wu-b and wu-c assays and so was considered to be a false-negative result (sample 12; table 4 ). two samples gave positive results in the three wuv rtpcr assays and were negative by the wuv conventional pcr (samples 13 and 21; table 4 ). a further seven samples provided positive results in one or more of the realtime methods but were negative in the wuv conventional pcr assay (samples 14-20; table 4 ). again, all of the additional detections made by the wuv real-time assays yielded high ct values. one specimen provided positive results for both kiv and wuv in all real-time and conventional pcr assays and was considered a co-infection (sample 22; table 4 ). a further five specimens provided positive results for both kiv and wuv using one or more of the real-time and conventional pcr assays (samples 2, 5 10, 20 and 21; table 4 ). twenty-one different viruses and 12 different bacterial species were used to test assay specificity (table 2) . no crossreactions were observed with these organisms or with human genomic dna. in addition, the two kiv real-time assays did not cross-react with wild-type wuv genomic dna, and the three wuv real-time assays did not cross-react with wildtype kiv genomic dna. dilutions of genomic kiv dna tested in the ki-a and ki-b assays demonstrated a reliable detection limit of approximately 10 copies per reaction for both assays. the kiv conventional reference assay (39f; 363r) had a detection limit of approximately 100 copies per reaction, and so was considered to be one log concentration less sensitive than the real-time kiv methods (table 5) . similarly, the wuv conventional assay was considered to be comparatively one log less sensitive than the wuv real-time assays, with the three wuv real-time assays consistently detecting 10 copies per reaction and the wuv conventional reference assay (ag44; 45) detecting 100 copies per reaction (table 5) . the clinical significance of the newly described human polyomaviruses ki and wu is currently unknown. what is clear, however, is the need for sensitive and specific detection methods to help facilitate further investigations. the successful development of any pcr assay for microbial detection is dependant on the availability of sufficient sequence information to ensure the assays' primer and probe targets are both conserved and specific. however, for many organisms, both novel and characterized, the necessary spectrum of sequence data is lacking. this is particularly so for newly described organisms. therefore, in our opinion, a comprehensive validation of potential pcr assays for the detection of novel micro-organisms in samples from different population groups requires the simultaneous evaluation of multiple targets, in case unknown genetic variants exist. in this study two kiv and three wuv real-time pcr assays were evaluated in parallel and compared to conventional pcr for the respective viruses. although all of the real-time methods proved to have lower detection limits than the conventional pcr methods, two real-time assays, ki-b and wu-a, demonstrated a reduced clinical sensitivity in specimens (86.7% and 95.5%, respectively) when using the respective conventional assays as the reference. the falsenegative results obtained with these assays may have been due to sequence variation in the oligonucleotide targets. in our experience, very few mismatches between primers and/or probes and their respective targets are needed to affect the sensitivity of a pcr assay. it is for these reasons that multiple genetic targets should be examined in initial evaluations, and then the chosen targets should be re-examined at later time periods, particularly when dealing with new viral agents that may exhibit considerable genomic variation. on this basis, we deemed the ki-b and wu-a assays to be unsuitable for use in further research of these viruses. compared to the conventional assay, none of the rtpcr methods achieved a clinical specificity of 100% (table 3) . this was because all assays made additional detections of either kiv or wuv. these additional positive results were assumed to be false-positive reactions for the purpose of specificity calculations. nevertheless, it is unlikely that all of these represent false-positive results by the rtpcr methods, as five of the nine additional kiv positive specimens were positive by both the ki-a and ki-b methods (table 4) . similarly, four of the nine additional wuv-positive specimens were positive by more than one wuv rtpcr assay. further, all of the real-time assays target different sequences on the respective kiv and wuv genomes, making simultaneous cross-reactions much less likely. significantly, no cross-reactions were observed when the assays were used to test a panel of other unrelated viruses and bacteria. in contrast, it is likely that these additional positive results represent true false-negative results by the conventional pcr assays. this is supported by our demonstration that the conventional assays were approximately one log of concentration less sensitive than the real-time pcr methods. standards containing kiv or wuv dna at a concentration returning a ct value of 33 or greater in the real-time methods could not be detected by the conventional pcr assay (table 5) . sensitivity issues are commonly encountered when evaluating rtpcr methods, as the assay under evaluation is often more sensitive than the reference method. approaches such as discrepant analysis are often used to circumvent these problems. however, we refrained from using discrepant analysis on these specimens, given this approach has previously been criticised for introducing bias when used to recalculate sensitivity and specificity values (hadgu, 2000) . in this study, we describe the development and validation of sensitive rtpcr assays for the detection of the recently described ki and wu polyomaviruses. overall, the results show that the ki-a, wu-b and wu-c assays provide sensitive detection of kiv and wuv in clinical specimens. we will use these assays to conduct further research into the epidemiology and pathogenesis of these viruses. identification of a third human polyomavirus presence of the newly discovered human polyomaviruses ki and wu in australian patients presenting with acute respiratory infection a related donor and reduced intensity conditioning reduced the risk of development of bk viruspositive haemorrhagic cystitis in allogeneic haematopoetic stem celltransplanted patients prevalence of jc virus viraemia in hiv-infected patients with or without neurological disorders: a prospective study real-time pcr in clinical microbiology: applications for routine laboratory testing identification of a novel polyomavirus from patients with acute respiratory tract infections discrepant analysis is an inappropriate and unscientific method bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt discovery and epidemiology of the human polyomaviruses bk virus (bkv) and jc virus (jcv) polyomavirus in human cancer development real-time pcr in the microbiology laboratory the pathobiology of polyomavirus infection in man frequent detection of polyomaviruses in stool samples from hospitalized children this study was supported by the royal children's hospital foundation grant i 922-034, sponsored by the "woolworths fresh futures" appeal. all the necessary ethics approval for this study was obtained from the institute's (royal children's hospital) ethics committee. we wish to thank mr kevin jacob and the staff of the microbiology division of the queensland health pathology service central. key: cord-313375-rs3jjiuj authors: panning, marcus; baumgarte, sigrid; laue, thomas; bierbaum, sibylle; raith, sabine; drexler, jan felix; helmer, angelika; falcone-kapper, valeria; kochs, georg; campe, hartmut; huzly, daniela; eis-hübinger, anna maria; drosten, christian title: singleplex real-time rt-pcr for detection of influenza a virus and simultaneous differentiation of a/h1n1v and evaluation of the realstar influenza kit date: 2010-11-13 journal: j clin virol doi: 10.1016/j.jcv.2010.10.010 sha: doc_id: 313375 cord_uid: rs3jjiuj background: a novel influenza a virus, subtype a/h1n1v emerged in april 2009 and caused the first influenza pandemic of the 21st century. reliable detection and differentiation from seasonal influenza viruses is mandatory for appropriate case management as well as public health. objectives: to develop and technically validate a novel one-step real-time rt-pcr assay which can be used for influenza a virus screening and subtyping of a/h1n1v in a singleplex fashion. to assess the clinical performance of a novel commercial influenza rt-pcr kit based on the in-house version. study design: a real-time rt-pcr assay targeting the matrix gene of influenza a viruses was developed and validated using in vitro transcribed rna derived from influenza a/h1n1v, a/h1n1 and a/h3n2 virus as well as plaque-quantified influenza a/h1n1v, a/h1n1 and a/h3n2 virus samples. after validation of the in-house version the commercial realstar kit was used to assess the clinical performance and specificity on a panel of influenza viruses including a/h1n1v, a/h1n1, swine a/h1n1, a/h3n2, avian a/h5n1 as well as patient specimens. results: the lower limit of detection of the in-house version was 2149, 1376 and 2994 rna copies/ml for a/h1n1v, a/h1n1 and a/h3n2, respectively. the realstar kit displayed 100% sensitivity and specificity and could reliably discriminate influenza a viruses from a/h1n1v. no cross reaction with swine a/h1n1 and a/h1n2 was observed with the realstar a/h1n1v specific probe. conclusion: both assays demonstrated high sensitivity and specificity and might assist in the diagnosis of suspected influenza cases. background: a novel influenza a virus, subtype a/h1n1v emerged in april 2009 and caused the first influenza pandemic of the 21st century. reliable detection and differentiation from seasonal influenza viruses is mandatory for appropriate case management as well as public health. objectives: to develop and technically validate a novel one-step real-time rt-pcr assay which can be used for influenza a virus screening and subtyping of a/h1n1v in a singleplex fashion. to assess the clinical performance of a novel commercial influenza rt-pcr kit based on the in-house version. study design: a real-time rt-pcr assay targeting the matrix gene of influenza a viruses was developed and validated using in vitro transcribed rna derived from influenza a/h1n1v, a/h1n1 and a/h3n2 virus as well as plaque-quantified influenza a/h1n1v, a/h1n1 and a/h3n2 virus samples. after validation of the in-house version the commercial realstar kit was used to assess the clinical performance and specificity on a panel of influenza viruses including a/h1n1v, a/h1n1, swine a/h1n1, a/h3n2, avian a/h5n1 as well as patient specimens. results: the lower limit of detection of the in-house version was 2149, 1376 and 2994 rna copies/ml for a/h1n1v, a/h1n1 and a/h3n2, respectively. the realstar kit displayed 100% sensitivity and specificity and could reliably discriminate influenza a viruses from a/h1n1v. no cross reaction with swine a/h1n1 and a/h1n2 was observed with the realstar a/h1n1v specific probe. conclusion: both assays demonstrated high sensitivity and specificity and might assist in the diagnosis of suspected influenza cases. © 2010 elsevier b.v. all rights reserved. in april 2009 a novel influenza a virus, subtype a/h1n1v emerged and caused the first influenza pandemic of the 21st century. 1 although predominance of a/h1n1v is likely during the upcoming influenza seasons, co-circulation of seasonal influenza a subtypes may occur. 2 definite laboratory diagnosis remains crucial for individual patient management as well as epidemi-ological surveillance. most testing algorithms include universal screening assays for influenza a virus and, in case of positive results, type-specific differentiation by separate assays. 3, 4 due to the cumbersome work flow and high costs, multiplex assays have been proposed that can simultaneously screen for a/h1n1v and the former seasonal viruses. 5 however, multiplexing of pcr reactions generally reduces their sensitivity and reliability. in addition, these assays have so far not been available in a uniform, qualitycontrolled, and ready-to-use format that can easily be adopted by clinical laboratories. the aims of this study were twofold. we developed a matrix gene-based real-time rt-pcr that allows for detecting seasonal influenza a and simultaneously a/h1n1v. this assay was not a multiplex assay, but used only a single amplicon. discrimination of the respective viruses is accomplished by use of two different fluorescent probes. in a second step the assay was transformed into a commercially available, homogenous test kit format and evaluated on a comprehensive panel of clinical specimens. the commercial assay used the same oligonucleotides as the in-house version and included an internal control system to monitor possible inhibitory substances or procedural failures. to develop and validate a singleplex real-time rt-pcr assay for rapid detection and simultaneous differentiation of influenza a from a/h1n1v virus. to compare the limit of detection of the in-house assay with a commercial assay, based on the in-house version. to evaluate this commercial kit on a panel of clinical samples. upon alignment of 373 contemporary sequences of segment 7 of various influenza a virus subtypes primer and probe combinations were selected manually using procedures as described. 6 a universal primer pair was chosen to amplify an 87 bp amplicon and two specific hydrolysis probes to discriminate influenza a virus and a/h1n1v (fig. 1 ). reaction conditions are outlined in table 1 . based on these same oligonucleotides, the realstar influenza rt-pcr version 1.0 (astra diagnostics, hamburg, germany) kit was developed using proprietary technology. this commercial assay contained 10 l rna sample in a total reaction volume of 25 l. an internal heterologous control system was included to monitor possible inhibitory effects of the sample matrix. it comprises an exogenously spiked rna at low copy numbers. the realstar kit was performed on an abi prism 7500 real-time cycler (applied biosystems, weiterstadt, germany). the majority of clinical specimens were nasopharyngeal swabs in universal transport medium (copan, brescia, italy) and a few broncho-alveolar lavage fluids. rna was extracted by the viral rna mini kit (140 l input and 60 l elution volume; qiagen, hilden, germany). to determine the lower limit of detection (lod) of the in-house assay plaque-quantified influenza a/h1n1/texas/91, a/h3n2/hk/1/68 and a/h1n1v/fr/09 cell culture supernatants as well as in vitro rna transcripts of partial segment 7 were spiked into viral transport medium and extracted and processed as described. 3 for influenza a/h1n1/texas/91 and a/h3n2/hk/1/68 partial fragments of the matrix gene were amplified using primers h1s (5 -agtcttctaaccgaggtcgaaacgt-3 ) and h1as (5 -gtctacgctgcagtcctcgctcactgg-3 ) for a/h1n1 and h3s (5 -gatgagccttctaaccgaggtcga-3 ) and h3as (5 -gaacgttatctccctcttaagtttcc-3 ) for a/h3n2, respectively. in-vitro rna transcripts were constructed as described. 3 crossreactivity of the in-house assay was tested on a panel of 30 respiratory samples containing adenovirus (n = 1), respiratory syncytial virus-a (n = 8), respiratory syncytial virus-b (n = 2), human coronaviruses oc43 (n = 2), 229e (n = 2) and nl63 (n = 1), human metapneumovirus (n = 2), parainfluenzavirus 3 (n = 4), parainfluenzavirus 4 (n = 1) and entero-/rhinoviruses (n = 7). an additional 20 samples negative for any respiratory virus was also analyzed by the in-house assay. 55 stored influenza a virus positive patient samples including 20 a/h1n1v samples were re-analyzed by the in-house assay only. specificity was also tested on 22 a/h1n1v and 27 seasonal influenza a pcr positive samples. additionally the realstar kit was evaluated on a panel of influenza a virus cell culture supernatants including a/h5n1, a/h3n3, a/h3n8, a/h3n2, a/h1n1, a/h1n1v, classical swine influenza a/h1n1 and a/h1n2, and on a panel of 126 previously quantified a/h1n1v patient specimens. 7 in a first step we used in vitro transcribed rna to assess the linear range of the in-house assay. tenfold serial dilutions were tested in triplicates. a linear relationship was observed from 4 × 10 1 to at least 4 × 10 7 copies per reaction for influenza a/h1n1v, a/h1n1 and a/h3n2, respectively (data not shown). pcr efficiency was calculated to be 1.8 for a/h1n1v, 1.9 for a/h1n1 and 1.9 for a/h3n2, respectively according to the pcr amplification formula table 1 oligonucleotides for singleplex real-time rt-pcr assay. e = 10 (1/slope) ; e being the pcr efficiency. next in vitro transcribed rna was used to determine the limit of detection (lod) using probit analysis. 3 (table 2 ). in both influenza a virus panels a range of different rna target concentrations was used with cycle threshold (c t ) values from 21.7 to >40. accordingly 55 stored influenza a virus positive patient samples including 20 a/h1n1v samples yielded positive results by the in-house assay. the lod of the realstar kit was assessed using the plaquequantified influenza a/h1n1, a/h3n2 and a/h1n1v virus. tenfold limiting dilution series were tested in triplicates. at least 1-10 pfu/ml were detectable by both assays rendering them equally sensitive (data not shown). correspondingly the lod was determined using in vitro transcribed rna as above. a 95% lod of 380 [95% ci 285-998], 586 [95% ci 427-1300] and 1399 [95% ci 1006-2831] rna copies/ml for influenza a/h1n1v, seasonal influenza a/h1n1 and a/h3n2 was determined, respectively. a panel of different influenza a virus subtypes including swine a/h1n1 and a/h1n2 yielded no fluorescent signal by the a/h1n1vspecific probe but was positive by the universal influenza a virus probe. furthermore all 27 seasonal influenza a and 22 a/h1n1v positive samples were correctly identified by the realstar assay ( table 2 ). similar to the in-house version even low concentrated samples were detectable. of note, c t values obtained by the realstar kit were in general lower than those obtained by the in-house version and the reference assays which might in part reflect the higher sample input volume of the kit. finally, 126 a/h1n1v positive patient samples were re-evaluated by the real-star kit and all yielded concordant results. 7 c t values for the a/h1n1v specific rt-pcr ranged from 22.5 to 42 (mean 32.8) and for the realstar kit from 17.9 to 38.5 (mean 27.4), respectively (p < 0.0001, paired t-test). the internal control yielded a valid reaction in 126/126 samples demonstrating the robustness of the assay. the described matrix gene-based assay simultaneously detects influenza a viruses and differentiates a/h1n1v in a singleplex fashion with uniformly good overall sensitivity. analytical sensitivity of the in-house version was comparable to published singleplex rt-pcr assays. 3, 8 for the first time the lod for each of the contemporary human influenza a viruses was thoroughly assessed from a technical standpoint. in addition we describe the evaluation of one of the first commercial test kits specifically designed to meet the demands of the current pandemic. the realstar kit rendered to be even more sensitive than the in-house assay most likely attributed to the higher sample input volume and equally specific. particularly on a panel of original a/h1n1v patient samples the realstar kit showed superior performance to a widely used realtime rt-pcr. 3 detection of low concentrated samples may become important to, e.g. monitor virus concentrations in patients treated with oseltamivir. 9 in the midst of an epidemic rapid provision of ready-to-use test kits has a significant impact on the performance of laboratories. 10, 11 although a/h1n1v in house diagnostic tests were designed and implemented with outstanding rapidity frontline laboratories may lack the capacity to implement these assays. 11 availability of ready-to-use systems might therefore assist laboratories in patient management and surveillance. combined with its rapidity, internal control system and quality controlled reagents this approach might be useful for general public health laboratories. in conclusion both assays have demonstrated their usefulness in the current pandemic and might assist laboratories to provide results in a timely, standardized and cost effective manner. emergence of a novel swine-origin influenza a (h1n1) virus in humans epidemiological characteristics of pandemic influenza h1n1 2009 and seasonal influenza infection detection of influenza a(h1n1)v virus by real-time rt-pcr development of a real-time rt-pcr for the detection of swine-lineage influenza a (h1n1) virus infections development of a multiplex real-time rt-pcr that allows universal detection of influenza a viruses and simultaneous typing of influenza a/h1n1/2009 virus diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all european biosafety level 4 laboratories poor clinical sensitivity of rapid antigen test for influenza a pandemic (h1n1) 2009 virus performance of the realstar chikungunya virus real-time reverse transcription-pcr kit viral load in patients infected with pandemic h1n1 2009 influenza a virus coordinated implementation of chikungunya virus reverse transcription-pcr sars molecular detection external quality assurance we are grateful to berit hollmann and ulrike reber for excellent technical assistance. we would like to thank dr. ralf dürrwald (idt biologika, dessau-rosslau, germany) for providing swine influenza a viruses. this work was supported by bmbf (contract #01es0830). the authors declare no conflict of interest. key: cord-310680-klywz85w authors: li, qihan; wang, lichun; dong, chenghong; che, yanchun; jiang, li; liu, longding; zhao, hongling; liao, yun; sheng, yi; dong, shaozhong; ma, shaohui title: the interaction of the sars coronavirus non-structural protein 10 with the cellular oxido-reductase system causes an extensive cytopathic effect date: 2005-04-06 journal: j clin virol doi: 10.1016/j.jcv.2004.12.019 sha: doc_id: 310680 cord_uid: klywz85w the pathological mechanism of sars-cov infection was investigated. the gene for the sars-cov non-structural protein 10, which is located in the open reading frame of pp1a/pp1ab gene, was synthesized and used to screen for the specific cellular gene coding for the protein interacting with this nsp10 protein in a human embryo lung cdna library using a yeast trap method. the results indicated that apart from the two subunits of cellular rna polymerase complex, btf3 and atf5, this nsp10 protein was also able to interact specifically with the nadh 4l subunit and cytochrome oxidase ii. further study revealed that the activity of the nadh-cytochrome was altered and the inner mitochondrial membrane was depolarized in the transfected human embryo lung fibroblast by the nsp10 protein gene. the cytopathic effect of the coronavirus 229e strain appeared more extensive in these cells than in the control cells. the newly identified severe acute respiratory syndrome coronavirus (sars-cov), caused an epidemic during the period february to june, 2003 , which spread to 32 countries infecting more than 8000 people of which 900 died (pearson, 2003) . this disease was typically characterized by fever, malaise, rigor, headache and dyspnea, followed by severe respiratory failure, which led to a 15% fatality rate among infected patients (booth et al., 2003) . the pathological analysis of the lung tissue from the deceased patients revealed severe abbreviations: sars-cov, severe acute respiratory syndrome coronavirus; btf3, basic transcription factor-3; atf5, activation transcription factor-5; nadh, nicotinamide adenine dinucleotide dehydrogenase; fbs, fetal bovine serum; dmem, double minimal essential media; qdo, quartdrop-out; nc, nitrocellulose; he, hematoxyline and eosin method; gfp, green fluorescence protein; gst, glutathione s-transferase * corresponding author. lesions of the pulmonary alveolar, flooding of the alveolar lumina with proteinaceous fluid and necrosis of the bronchiolar epithelium (peiris et al., 2003) . the extent of tissue lesions usually depends on cell damage caused mainly by the virus (lee et al., 2003) , or, by the immune cytotoxic effect against the viral antigens (tyler and fields, 1990) . to date, no data strongly supports the idea that the pathological effect of the sars coronavirus are due to autoimmune damage against the cells infected by the virus, though clinical treatment indicates that corticosteroids can inhibit the development of this disease. therefore, it could be hypothesized that the cytopathic effect produced by sars-cov in alveolar cells and bronchiolar epithelium is probably the main factor causing the severe pathology. however, there is insufficient data to interpret the replication process of sars-cov in cells, and the observation of the cellular morphology change by sars-cov in vitro only exhibits the cytopathic effect including rounded, swollen cellular organelle, like golgi sacs, and numerous smoothmembraned vacuoles in the cytoplasm (ksiazek et al., 2003) . these observations suggest that the cytopathic effect caused by the replication of sars-cov in cells could be involved. in this case, the sars-cov or the components of this virus are possibly interacting directly or indirectly on a specific cellular organelle during the virus replication in cells. to investigate the pathological mechanism of sars-cov during its replication in cell culture, we investigated several nonstructural proteins of sars-cov, which are produced by the 3cl pro cleaving pp1a/pp1ab in the sars-cov's infection (thiel et al., 2003) . the results, interestingly, suggested that the non-structural protein 10 (nsp10) could be involved in the pathological function of sars-cov in cells. using the yeast trap method (fields and sternglanz, 1994) , the synthesized gene of sars-cov nsp10 was used to screen the specific genes of proteins probably interacting with this protein in a human embryo lung cdna library. surprisingly, the results indicated that apart from the two subunits of cellular rna polymerase b complex, btf3 and atf5, this sars-cov non-structural protein 10 was able to interact specifically with the nadh 4l subunit and cytochrome oxidase ii. this result was also supported by the pull-down detection of nsp10-gst fusion protein and western blotting with antibody against cytochrome oxidase. to further investigate the contribution of this interaction to the cytopathic effect of sars-cov, a detection series of mitochondrial function and the activity of the oxido-reductase system in the human embryo lung fibroblast transfected with the nsp10 gene was performed. the results suggested that the interaction of this protein with nadh and cytochrome oxidase ii in cells infected by the coronavirus 229e interrupted the physiological function of mitochondria and caused severe damage to the cells. the results obtained in this work could provide some data to explain the possible mechanism of the sars-cov infection, which causes more severe damage in lung tissue than infection with other coronaviruses. human embryo fibroblast, kmb-17 strain, was originated from human fetal lung tissue and grown in dmem, 5% (v/v) fetal bovine serum (fbs) to form a monolayer in a culture plate (guo et al., 1974) . the cells used were in the 18-20th passage. coronavirus 229e strain was grown in these kmb-17 cells in serum free dmem and harvested from the supernatant of the culture (li et al., 2002) . the virus was titrated in kmb-17 cells. the sars-cov nsp10 gene with the length of 423bp encoding 141 amino acids (according to the genome of sars-cov, accession no. ay291315. the gene location is from 12955nt to 13371nt, and added atg and taa) was synthesized by eight oligonucleotides (tokara co.) in a pcr system (thiel et al., 2003) . the gene fragment cloned in puc-18 was identified using a restricted enzyme method and sequencing. plasmid pcdna-nsp10 was constructed by inserting sars-cov non-structural protein 10 gene into the ecori site of pcdna-3 and pgfp (takara co.) as the eukaryotic expression vectors. plasmid pgbk-nsp10 expressing gal4-nsp10 fusion protein was constructed by inserting an nsp10 gene into the ecori site of pgbk-t7 (invitrogen) to express a bait protein in a yeast two-hybrid system. all constructed plasmids were confirmed with restrictive endonuclease digestion and sequencing. the plasmid pgbk-sl was used to screen a cdna library of human embryo lung (clontech). the procedure was conducted according to the manufacturers' protocol. after screening twice, using the qdo plate and the ␤-galactosidase assay, the cdna gene fragments from the library encoded the proteins capable of interacting with the nsp10 protein, were isolated and identified by sequencing. gst, gst-nsp10 were expressed in e. coli bl21 and purified according to standard protocols. the gst and the gst-nsp10 fusion proteins were incubated overnight at 4 • c with a kmb-17 cell extract pre-labeled with [ 35 s] methionine (prepared in lysis buffer (50 mm tris-hcl, ph 8.0, 150 mm nacl, 1% nonidet p-40, 1 mm edta, 0.5% na deoxycholate, and 0.1% sds) containing phenylmethylsulfonyluoride (pmsf, sigma), and conjugated further with glutathione-sepharose 4b beads in a total volume of 500 l of buffer (20 mm tris, ph 7.5, 75 mm kcl, 50 mm nacl, 1 mm edta, 0.1% nonidet p-40, 10% glycerol, 1 mm dithiothreitol, and pmsf). after centrifugation, the beads were washed five times with incubation buffer and resuspended in pbs buffer, boiled for 5 min, and centrifuged. the supernatant was subjected to electrophoresis in a 12% sdspolyacrylamide gel. after drying, the gels were exposed to x-ray film. the monolayer kmb-17 cells grown in dmem was transfected with the plasmid of pgfp-nsp10 according to the protocol described below. in the 24-36 h after transfection, the cells were observed under a fluorescence microscope. the recombined plasmid pcdna-nsp10 containing sars-cov non-structural protein 10 gene was linearized by digestion with restriction enzyme hindiii. kmb-17 cells were transfected with linearized pcdna-nsp10 and lipotamine tm 2000 as described in the manufacturer's instructions. the control cells were transfected with linearized pcdna-vp3 (a structural protein gene of poliovirus) and lipotamine tm 2000 in the same condition. the transfected cells were maintained in dmem 5% fbs for 24-48 h. to confirm the expression of the nsp10 protein, a western blot was performed using a specific antibody against nsp10 protein produced in mice immunized by nsp10 protein expressed in escherichia coli. the transfected cells, where the expression of the nsp10 protein was detected, could be used for the next experiment. subconfluent, control cells transfected with pcdna-vp3 and the cells transfected with pcdna-nsp10, were collected, rinsed in pbs, resuspended in 5 m rhodamine-123 (eugene, co.), and incubated at room temperature for 30 min. the cells were then analyzed with a flow cytometer (becton dickinson) as described previously (li et al., 2002) . the data from the flow cytometer analysis were analyzed by cellquest software (becton dickinson). the cells transfected with pcdna-nsp10 or pcdna-vp3 were grown in dmem with 5% fbs and collected by scraping 24, 48 and 72 h after transfection. after rinsing twice with cold pbs, the cells were homogenated with a sonicator at 450 w, 10 s × 10 and centrifuged at 2500 rpm for 10 min to yield a pellet. fifty unit liters of the supernatant was used to detect its activity of nadh-cytochrome oxidase with cytochrome 1 ml (1 mg/ml), nadh 100 ul (6 mg/ml), pbs 500 ul and 0.9% nacl 500 ul at 25 • c for 20 min. the reactive solution was read in a spectrophotometer (bio-rad m-550) at od 550 . meanwhile, the protein in this supernatant was quantified by the standard lowry method (lowry et al., 1951) . the activity unit of the enzyme was determined according to od 550 value for each milligram of protein at 25 • c for 1 min. the transfected kmb-17 cells grown in dmem for longer than 24 h were scraped off and rinsed in pbs. the washed cells were lysed in rsb buffer (10 mm tris-hcl, ph 7.5; 1.5 mm, mgcl 2 ), np-40 1% at 4 • c for 1 h. then, the lysed cells were centrifuged at 12,000 rpm for 10 min. the components of the supernatant were separated by sds-page 12% (v/v) and transferred to a nc membrane. a western blot of the nsp10 antibody on this membrane was performed as described in the standard protocol (towbin et al., 1979) . meantime, the proteins collected in the pull-down test (see above) were separated in sds-page gel and transferred to a nc membrane for the western blot with the antibody against cytochrome oxidase. transfected kmb-17 cells, grown in dmem for 24 h, was infected by coronavirus 229e at moi 0.5. the control cells transfected by pcdna-vp3 were also infected with the virus using the same procedure. after 24, 48, 72, 96 and 108 h post-infection, the sample and control cells were harvested and treated according to described protocols (bonavia et al., 1997) . the harvested virus was titrated in kmb-17 cells according to the method described (racaniello and baltimore, 1981) . the transfected kmb-17 cells were grown on a glass plate and were infected by the virus as described above. twenty-four hour post-infection, the cells were observed under a light microscope (hehine, 1981) . for electron microscopy the same cells were grown on a 100-mm plate and treated as above. the cells were scraped off and further fixed in 75% ethanol for observation under an electron microscope according to standard protocol (slater, 1991) . using a gal-nsp10 fusion protein expressed in yeast as bait, a human embryo lung dna library was screened using the yeast two-hybrid method (more than 2 × 10 6 clones). after screening twice using sd/-leu/-trp/-his/+25 mm 3amino-1,2,4-triazole (3-at) plates, five clones were identified as corresponding to nsp10. among them, one gene of unknown function warranted further investigation. the other proteins encoded by the other four genes were nadh 4l subunit, cytochrome oxidase ii, rna polymerase b transcription factor 3 and activation transcription factor 5, through comparison with gene sequences in genbank. to define the binding specificity of the nsp10 protein to these five proteins, a yeast-mating assay was conducted, which indicated that the nsp10 protein had a higher affinity to the nadh 4l subunit and cytochrome oxidase ii (fig. 1) . as we know, the sars-cov non-structural protein 10, formerly known as a growthfactor-like protein, exhibits 55-58% homology with other coronaviruses. however, little is known about its function in the coronavirus replication process (marra et al., 2003) . some data suggest that it could be part of the viral replicase polyprotein (thiel et al., 2003; anand et al., 2003) . however, the possible interaction between this protein and the nadh subunit 4l and cytochrome oxidase ii did provide a clue for further understanding its contribution in the pathogenesis of sars-cov. a pull-down detection of nsp10-gst fusion protein in the extract of labeled kmb-17 cells indicates that the nsp10 protein is able to bind several proteins from kmb-17 cells (fig. 2a) , one of which is confirmed being the component of cytochrome oxidase complex in the western blot (fig. 2b) . the observation of nsp10-gfp fusion protein expressed in kmb-17 cells shows that nsp10 protein is accumulated as a distributed cluster in the cytoplasm (fig. 2c) . this illustrates that, to some extent, the nsp10 attaches to a specific cellular apparatus in the cytoplasm. these data suggest probably the interaction of nsp10 and the component of cellular mitochondria in vivo. fig. 1 . specific binding activities of the proteins identified using a yeast two-hybrid system with the sars-cov non-structural protein 10 in mating assays. the identified gene clone in the yeast trap was transfected into y187 strain together with pgbk-7-nsp10. this transfectant was grown in the selection media of sd/-leu/-trp/-his/+25 mm 3-at followed by growth in a 1.5 ml sd medium. the supernatants were collected after being centrifuged at 10,000 rpm in an eppendorf tube. the od 600 of the culture was recorded. one hundred microliters of the supernatant was reacted with o-nitropheng/␤-d-galacto-pyranoside (onpg) in z-buffer with ␤-mercaptoethanol. the final od 420 nm value was recorded after at least 30 min. the negative sample is supernatant of yeast y187 transfected with pgbkt7 and pgadt7. the positive control is from the yeast y187 transfected with pgbkt7-53 and pgadt7-t as provided by the manufacturer. the ␤-galactosidase units were calculated using the formula: units = 1000 × od 420 /(t × v × od 600 ); t, elapsed time of incubation; v, 0.1 ml × concentration factor. approximately 4 ug expressed and purified gst-nsp10 fusion protein and gst protein were respectively mixed with the 500 ul labeled extract of kmb-17 cells (5 × 10 6 cells), which were lysed in lysis buffer at 4 • c overnight. the gst and gst-nsp10 complex were conjugated with glutathione-sepharose 4b beads in a total volume of 500 l of buffer in 25 • c for 4 h. after centrifugation, the beads were washed three times with cold pbs and boiled at 100 • c with 20 ul sample buffer for 2 min. after centrifugation, the supernatants were loaded in a 12% sds-page gel for electrophoresis. lane a-1, gst protein interacting with the extract of kmb-17 cells; lane a-2, gst-nsp10 fusion protein interacting with the extract of kmb-17 cells. (b) western blot of antibody against cytochrome oxidase complex to detect the proteins collected from pull-down test. the protein samples collected from pull-down test were separated in sds-page gel and transferred to nc membrane. this membrane was interacted with the polyclonal antibody against cytochrome oxidase complex and visualized. lane b-1, proteins from the sample of gst-nesp10 fusion protein interacting with the extract of kmb-17 cells; lane b-2, proteins from the sample of gst protein interacting with the extract of kmb-17 cells. (c) the distribution of nsp10-gfp fusion protein in kmb-17 cells. the nsp10 gene was inserted into pgfp plasmid and expressed as a fusion protein of nsp10-gfp after the pgfp-nsp10 was transfected into kmb-17 cells. the distribution of nsp10-gfp fusion protein in cells was observed under a fluorescence microscope with the amplification of 400×. lane c-1, observation of nsp10-gfp fusion protein in kmb-17 cells; lane c-2, observation of mitochondria stained with rhodamine-123 fluorescence in kmb-17 cells. depending upon the result provided by the yeast two-hybrid test and other experiments, the nsp10 protein is hypothesized to be able to impact the oxido-reductase system in mitochondria as it was expressed in vivo. a detection series was performed to determine the activity of cytochrome oxidase and the physiological function of mitochondria with the kmb-17 cells transfected by the dna-nsp10 plasmid. the expression of the nsp10 protein was identified by western blot analysis using a specific antibody, in the kmb-17 cells transfected (data not shown). the activity of cytochrome oxidase was detected at different time points after transfection. the results indicated a decrease of this activity in the cells transfected by the pcdna-nsp10 plasmid compared with the control cells (fig. 3a) . meanwhile, a marked decrease in rh-123 fluorescence intensity in the rhodamine-123 fluorescence profiles of the cells at the 24th hour and the recovery at the 48th hour after transfection were noticed in the detection of the depolarization of the inner mitochondrial membrane in the kmb-17 cells transfected with the nsp10 gene (fig. 3b ). this suggests a loss in the cellular inner mitochondrial membrane potential. by combining these two results, we can probably conclude that the nsp10 protein impacts the oxido-reductase system of mitochondria via an unknown mechanism. to further investigate the role of the nsp10 protein in the process of viral replication, the kmb-17 cells transfected by pcdna-nsp10 were infected with the coronavirus 229e. the infected cells were observed under a light and electron microscope every 24 h from the 24th until the 72nd hour post-infection. extensive cytopathic effect was observed in the transfected cells infected by the virus at the 24th hour post-infection and remained continuous when compared to the control cells (fig. 4a) . the cytopathological analysis indicated an obvious cellular edema, severe vacuolar degeneration with the large nuclear, chromosome condensation, the necrosis of some cellular apparatus, and the damage of mitochondria or endoplasm membrane when viewed through the electron microscope (fig. 4b) . this was also supported by the observation of the stained cells by the he method (data not shown). compared with these pathological changes, the control cells transfected with the pcdna-vp3 plasmid in the same condition and infected by the same moi of virus showed only a slight change, such as a few cells rounded in their morphology during 24-48 h post-infection. in the latter time of the infection (72-96 h after post-infection of coronavirus 229e), the classic cytopathic effect appeared in the control cells. these results suggest that the nsp10 protein might have a role in viral replication, which amplifies the cytopathic effect of the virus. generally speaking, the cytopathic effect of the virus indicates that the viral replication in cells uses the cellular apparatus for virus synthesis and causes cellular structure damage. in this case, the cytopathic effect is an indicator of viral proliferation in cells. to analyze the severe cytopathic effect appearing in the cells transfected by the nsp10 gene during the infection of virus, a titration of the virus harvested from the transfected cells was performed at different time points. a lower yield of the virus was demonstrated in the cells transfected by the pcdna-nsp10 plasmid compared with control cells transfected by the pcdna-vp3 (fig. 5 ). this suggests that the nsp10 protein expressed in the cells inhibits replication of this virus in the unknown way. however, its mechanism remains unclear. as a new species of coronavirus, the sars-cov should have a similar method of viral replication as other coronaviruses. in fact, infection with sars-cov causes a severe pathological process with its own specific and unknown mechanism, which can bring about a severe respiratory syn-drome in patients (ng et al., 2004) . this clinical characterization suggests two possibilities in the pathogenesis of sars. one is immune pathogenesis, in which the damage of alveolar cells and bronchiolar epithelium could be caused by sars-cov specific cytotoxic t-cells. however, the data reported to date does not provide strong evidence to support this possibility. the results obtained from the sars animal model also indicate that no obvious lymphocytes accumulate in the lung tissue of those infected by sars-cov (fouchier et al., 2003) . the other possibility is that the extensive cytopathic effect of sars-cov leads to a wider necrosis in lung tissue and impairs the respiratory function. this study seems to support this hypothesis. however, some previous data indicated that the protein component of coronavirus targets the cellular apparatus, like the golgi complex for releasing virus particles (emily and machamer, 2002) . the sars-cov nonstructural protein 10, as it is produced from the viral polyprotein pp1a/pp1ab by 3cl pro cleavage during sars-cov infection in cells, should theoretically function in the viral replication while interacting with the specific cellular protein. the yeast two-hybrid system analysis of the human embryo lung tissue dna library identified potential targeting proteins of the nsp10, including the proteins involved in the cellular transcription process and the enzyme components of the oxidoreductase system in mitochondria. this result suggests that the nsp10 protein could affect the activities of nadh and cytochrome oxidase ii via a direct interaction while being involved in viral replication. in this investigation, the localization test of the nsp10 protein fusing with the gfp fluorescence protein also showed that the nsp10 protein was accumulated as a cluster in the cytoplasm. this illustrates, to some extent, that the nsp10 protein attaches to a specific cellular apparatus in the cytoplasm compared with the localization results of mitochondria with rhodamine-123 staining. the pull-down test and western blot with antibody against the cytochrome oxidase complex also suggest the interaction of nsp10 and oxidoreductase system in vivo. the most important evidence is the change of two physiological indicators of human embryo lung fibroblast transfected with the nsp10 gene, which include the decreased tendency of cytochrome oxidase activity of the transfected cells, and a loss in the cellular inner mitochondrial membrane potential exhibited by the decreased rhodamine-123 fluorescence intensity. therefore, we could infer that the nsp10 protein might contribute to the severe damage of the cells infected by the sars-cov with its effect on the enzyme, like nadh or cytochrome oxidase of the mitochondria. depending upon this hypothesis, we further investigated the possible biological properties of the nsp10 protein in the replication of coronavirus 229e. this virus is able to replicate and cause cytopathic effect in kmb-17 fibroblasts. interestingly, these results revealed that the expression of the nsp10 protein in the cells enhanced the cytopathic effect of coronavirus 229e. the morphological observations indicated that the cells transfected by the pcdna-nsp10, in which the expression of the nsp10 protein was confirmed by western blot analysis, appeared to show a severe cytopathic effect, while in contrast, the control cells transfected by the pcdna-vp3 did not show any obvious cytopathic effect within 24-72 h after infection with the virus, this suggested that the cytopathic effect was unrelated to the accumulation of the expressed exogenous protein in the cells. titration of the virus harvested from the cells at different time points demonstrated the obvious difference between the experimental sample and the control cells. there was little increase in titre of virus in cells transfected by the nsp10 gene, while the virus titre in the control cells transfected only with the pcdna-vp3 plasmid had increased by about 2-3 log. this result seems to contradict the obvious cytopathic effect of the cells transfected with the nsp10 gene. however, as the extensive cytopathic effect appeared rapidly, we could deduce that the blocking of virus replication in these cells is due to damage to the cellular apparatus probably caused by the nsp10 protein, and the possible interaction of nsp10 protein and btf3 or atf5 indicated in yeast trap test. these results suggest that the sars-cov non-structural protein nsp10 probably enhances the cytopathic effect of sars-cov in the cells by impairing the oxido-reductase system in the mitochondria, which could be one possible reason for the cytopathogenicity of the sars-cov in vivo. nevertheless, further experiments are required to explore the effect of the nsp10 protein in sars-cov replication before we can use these results to analyze the pathological changes seen in sars patients. coronavirus main proteinase (3clpro) structure: basis for design of anti-sars drugs infection of primary cultures of human neural cells by coronavirus 229e and oc43 clinical features and short-term outcomes of 144 patients with sars in the greater toronto area the cytoplasmic tail of infectious bronchitis virus e protein directs gulgi targeting the two-hybrid system: an assay for protein-protein interactions koch's postulates fulfilled for sars virus the biological properties of the human embryo fibroblast (kmb-17 strain) block staining of mammalian tissue with hematoxyline and eosin sars working group. a novel coronavirus associated with severe acute respiratory syndrome a major outbreak of severe acute respiratory syndrome in hong kong an sr-protein induced by hsv i binding to cells functioning as a splicing inhibitor of viral pre-mrna protein measurement with phenol reagent the genome sequence of the sars-associated coronavirus inflammatory cytokine profile in children with severe acute respiratory synchorme sars: what we learned was the fuss overblown hku/uch sars study group. clinical progression and viral load of sars coronavirus pneumonia in a community outbreak molecular cloning of poliovirus cdna and determination of the complete nucleotide sequence of the viral genome a method for the examination of the same cell using light, scanning and transmission electron-microscope mechanisms and enzymes involved in sars coronavirus genome expression electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: procedure and some application pathogenesis of viral infections we would like to thank san francisco edit (www.sfedit.net) for its assistance in editing this manuscript. this work was supported by the natural science fund 30370065 in china and natural fund 2003c0002r in yunnan. key: cord-322220-mlphue1r authors: bosis, samantha; esposito, susanna; niesters, hubert g.m.; tremolati, elena; pas, susan; principi, nicola; osterhaus, albert d.m.e. title: coronavirus hku1 in an italian pre-term infant with bronchiolitis date: 2007-02-21 journal: j clin virol doi: 10.1016/j.jcv.2006.11.014 sha: doc_id: 322220 cord_uid: mlphue1r nan respiratory syncytial virus (rsv) is the major cause of bronchiolitis, a common disease in the first months of life lanari et al., 2002; purcell and fergie, 2004) . bronchiolitis is also associated with influenza and parainfluenza viruses, adenovirus, rhinoviruses, and enteroviruses coiras et al., 2003; legg et al., 2005) . although human metapneumovirus (hmpv) and human coronavirus nl63 (hcov-nl63) have been identified and associated with a significant proportion of bronchiolitis over the last 3 years, no pathogen is recovered in a substantial proportion of cases (bastien et al., 2005; chiu et al., 2005; esper et al., 2005; principi et al., 2004 principi et al., , 2006 . while studying the epidemiology of viral respiratory infections in 2156 children (1190 males; mean age ± s.d., 3.39 ± 3.40 years) who attended the emergency department of milan university's institute of pediatrics because of acute disease (58.2% respiratory tract infections, 12.9% gastrointestinal and intra-abdominal diseases, 5.1% fever of unknown origin, 4.5% seizures with or without fever, 4.7% exanthematious disease, 4.4% nephritic or nephrotic syndrome, 3.7% skin and soft tissue infections, 2.3% bone or joint infections, 1.7% coagulation disorders, 1.0% meningitis/encephalitis, 0.9% sepsis, and 0.6% conjunctivitis) during a 1.5-month-old premature male italian infant was admitted to the emergency department of milan university's institute of pediatrics in february 2005 with a 2-day history of poor feeding, rhinorrhea, cough, and dyspnea in the absence of fever. he had been spontaneously delivered after a premature membrane rupture at the gestational age of 33 weeks (birth weight 2670 g; apgar score 9 at 1 min). at birth, he was asymptomatic and no respiratory support was required. he was hospitalised for 7 days before being sent home. he was mixed-fed from birth, and showed adequate growth. he had never left italy, and none of his contacts had travelled abroad in the previous 6 months. the child's father had experienced an uncomplicated febrile upper respiratory tract infection starting the day before the child was admitted. bronchiolitis was diagnosed on the basis of the findings of rhinorrhea, tachypnea, chest retractions, wheezing and bibasilar rales. chest radiography showed hyperinflated lungs and an increased anteroposterior diameter in lateral view without any parenchymal abnormalities. a nasopharyngeal aspirate was tested for adenovirus, influenza virus types a and b, rsv types a and b, parainfluenza viruses types 1, 2, 3 and 4, rhinoviruses, human metapneumovirus, human coronavirus 229e human coronavirus oc43, human coranovirus nl63 and hcov-hku1 by real-time amplification assays at the department of virology, erasmus university medical center, rotterdam, the netherlands fouchier et al., 2004; heim et al., 2003; kares et al., 2004; maertzdorf et al., 2004; van der hoek et al., 2004; woo et al., 2005a) . total nucleic acids were isolated using a magna-purelc isolation station (roche applied science, penzberg, germany), and a universal internal control virus to monitor the process from isolation of the nucleic acids until their real-time detection (niesters, 2002) . the rna was amplified in a single-tube, two-step reaction using taqman reverse transcription reagents and a pcr core reagent kit (applied biosystems, nieuwerkerk a/d ijssel, the netherlands) in an abi 7700 or abi 7500 sequence detection system (applied biosystems). a cultured virus was used as a positive control for each assay except in the case of hcov-hku1, for which a cloned construct was synthesised from published sequences of part of the nucleoprotein gene (woo et al., 2005a) . on the basis of proficiency testing data (templeton et al., 2006) , the estimated sensitivity of each assay was less than 500-1000 copies/ml. in the case of hcov-hku1, the np gene (1326 bp), s gene (4441 bp) and part of the polymerase (orf1b, 2815 bp) were amplified and sequenced using previously described primers (woo et al., 2005c) , and the sequence data analysed using a sequence navigator software sequencer (applied biosystems) and seqman (dnastar, madison, wi). the sequences were aligned using clustal w (bioedit 7.0.1). all of the available sequences of the corresponding gene sequences in genbank were aligned, and their phylogenetic relations were calculated by means of bootstrapping resampling in order to calculate nodal confidence (n = 1000) using kamura's two-parameter neighbour-joining method and mega 3.1. the data are shown in fig. 1 . only one of 2156 aspirates was positive for hcov-hku1, and the low threshold cycle value (16) indicated a high viral load. therapy consisted of oxygen supplementation, intravenous rehydration, and inhaled bronchodilators. the infant was discharged after 6 days and no respiratory recurrences were observed in the subsequent 6 months. hcov-hku1 is a coronavirus that has been detected in adults with pneumonia in china, and in small groups of children with respiratory or enteric infections in china, australia, france and the united states (esper et al., 2006; lau et al., 2006; sloots et al., 2006; vabret et al., 2006; woo et al., 2005a,b,c) . complete genome sequence analyses suggests that it originated from one major and some minor recombinations of group 2 coronaviruses . the milan hcov-hku1 is closely related to the original viruses described by woo et al. (2005a,b) , with minimal changes in the np, s, and a large part of the polymerase 1b gene fragment. the smaller part of the polymerase 1b fragment discriminates the milan virus more clearly from the others (sloots et al., 2006; woo et al., 2006) , and has a closer relationship with the hong kong sequences and is distant from the australian sequences. although the cause-effect relationship between hcov-hku1 and the disease of our patient could have only been confirmed by means of a respiratory tissue biopsy or serology on paired sera, it seems likely that this case of bronchiolitis was caused by hcov-hku1, which was present in large quantity. this is the second time that bronchiolitis has been associated with this virus, which has never been previously demonstrated in southern europe (esper et al., 2006; sloots et al., 2006; vabret et al., 2006; woo et al., 2005a,b,c) . detecting hcov-hku1 in the nasopharyngeal secretions of a premature bronchiolitic infant confirms that hcovs can cause moderate/severe respiratory infections (fouchier et al., 2005; kahn and mcintosh, 2005) . as only a few patients with hcov-hku1 infection have been described so far, it is impossible to define the real importance of the virus. the fact that the majority of the reported cases (including ours) experienced a lower respiratory infection requiring hospitalisation suggests that its clinical impact may be significant. previous studies have demonstrated that children aged less than 2 years are most at risk of hcov-hku1 infection, which significantly contributes to the microbial burden of patients with respiratory and enteric diseases during the colder months (esper et al., 2006; lau et al., 2006; sloots et al., 2006; vabret et al., 2006) . hcov-hku1 can also be present as a persistent asymptomatic infection in patients with underlying conditions vabret et al., 2006) . however, further epidemiological and clinical investigations are needed to precisely define the role of hcov-hku1 in respiratory infections. human coronavirus nl-63 infections in children: a 1-year study impact of human metapneumovirus in childhood: comparison with respiratory syncytial virus and influenza viruses human coronavirus nl63 infection and other coronavirus infections in children hospitalized with acute respiratory disease in hong kong simultaneous detection of influenza a, b, and c viruses, respiratory syncytial virus, and adenoviruses in clinical samples by multiplex reverse transcription nested-pcr assay evidence of a novel human coronavirus that is associated with respiratory tract disease in infants and young children coronavirus hku1 infection in the united states clinical and socioeconomic impact of influenza and respiratory syncytial virus (rsv) infection on healthy children and their households a previously undescribed coronavirus associated with respiratory disease in humans newer respiratory virus infections: human metapneumovirus, avian influenza virus, and human coronaviruses pring-akerblom p. rapid and quantitative detection of human adenovirus dna by real-time pcr history and recent advances in coronavirus discovery realtime pcr for rapid diagnosis of entero-and rhinovirus infections using lightcycler prevalence of respiratory syncytial virus infection in italian infants hospitalized for acute lower respiratory tract infections, and association between respiratory syncytial virus infection risk factors and disease severity coronavirus hku1 and other coronavirus infections in hong kong frequency of detection of picoronaviruses and seven other respiratory pathogens in infants real-time reverse transcriptase pcr assay for detection of human metapneumovirus from all known genetic lineages clinical virology in real time human metapneumovirus infection in pediatric age human metapneumovirus in otherwise healthy infants and children children's hospital respiratory syncytial virus database risk factors, treatment and hospital course in 3308 infants and young children evidence of human coronavirus hku1 and human bocavirus in australian children a multi-centre pilot proficiency programme to assess the quality of molecular detection of respiratory viruses detection of the new human coronavirus hku1: a report of 6 cases identification of a new human coronavirus characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia phylogenetic and recombination analysis of coronavirus hku1, a novel coronavirus from patients with pneumonia clinical and molecular epidemiological features of coronavirus hku1-associated community-acquired pneumonia comparative analysis of 22 coronavirus hku1 genomes reveals a novel genotype and evidence of natural recombination in coronavirus hku1 key: cord-314888-i7nn2e3m authors: degroote, nicholas p.; haynes, amber k.; taylor, calli; killerby, marie e.; dahl, rebecca m.; mustaquim, desiree; gerber, susan i.; watson, john t. title: human parainfluenza virus circulation, united states, 2011–2019 date: 2020-01-09 journal: j clin virol doi: 10.1016/j.jcv.2020.104261 sha: doc_id: 314888 cord_uid: i7nn2e3m background: human parainfluenza viruses (hpivs) cause upper and lower respiratory tract illnesses, most frequently among infants and young children, but also in the elderly. while seasonal patterns of hpiv types 1–3 have been described, less is known about national patterns of hpiv-4 circulation. objectives: to describe patterns of hpivs circulation in the united states (us). study design: we used data from the national respiratory and enteric virus surveillance system (nrevss), a voluntary passive laboratory-based surveillance system, to characterize the epidemiology and circulation patterns of hpivs in the us during 2011–2019. we summarized the number of weekly aggregated hpiv detections nationally and by us census region, and used a subset of data submitted to nrevss from public health laboratories and several clinical laboratories during 2015–2019 to analyze differences in patient demographics. results: during july 2011 june 2019, 2,700,135 hpiv tests were reported; 122,852 (5 %) were positive for any hpiv including 22,446 for hpiv-1 (18 %), 17,474 for hpiv-2 (14 %), 67,649 for hpiv-3 (55 %), and 15,283 for hpiv-4 (13 %). hpiv testing increased substantially each year. the majority of detections occurred in children aged ≤ 2 years (36 %) with fluctuations in the distribution of age by type. conclusions: hpivs were detected year-round during 2011–2019, with type-specific year-to-year variations in circulation patterns. among hpiv detections where age was known, the majority were aged ≤ 2 years. hpiv-4 exhibited an annual fall-winter seasonality, both nationally and regionally. continued surveillance is needed to better understand national patterns of hpiv circulation. human parainfluenza viruses (hpivs) are enveloped, singlestranded rna viruses in the paramyxoviridae family with four antigenically distinct types known to infect humans: hpiv-1, hpiv-2, hpiv-3, and hpiv-4 [1] . hpivs can cause a range of upper and lower respiratory tract illnesses including bronchitis, bronchiolitis, laryngotracheobronchitis (croup), and pneumonia [2] . hpivs are the second most common cause of acute respiratory illness-related hospitalizations in children < 5 years of age, second only to respiratory syncytial virus (rsv). hpivs account for approximately 7 % of all hospitalizations for fever, acute respiratory illness (ari), or both [3] . co-infections of hpiv and other respiratory viruses are common and may lead to more complicated and prolonged disease course, especially among children [1, 3] . clinical presentation can vary by type; hpiv-1 and hpiv-2 commonly cause croup and cold-like symptoms and hpiv-3 is more often associated with bronchiolitis and pneumonia [4] . hpiv-4 is less well-characterized, as it has been less commonly included in respiratory virus diagnostic panels, but has been suggested to have a similar clinical presentation as hpiv-3 [3, 5, 6] . infants, young children, the elderly, and those that are immunocompromised are at higher risk for severe hpiv illness. in healthy adults, hpiv illness is usually limited to mild upper respiratory track symptoms [6] . in the united states, hpivs typically circulate seasonally with variations in annual prevalence. hpiv-1 peaks in the fall of odd-numbered years, hpiv-2 peaks in the fall of even-numbered years, and hpiv-3 peaks annually in the spring and early summer, when hpiv-1 and hpiv-2 are not present [1, 4, [7] [8] 9] . hpiv-4 seasonal patterns are less well-described; the few studies that assessed hpiv-4 focused on solitary outbreaks of hpiv-4 or were limited to countries outside the united states [10] [11] [12] [13] [14] [15] [16] . available studies that have documented patterns of https://doi.org/10.1016/j.jcv.2020.104261 received 31 october 2019; received in revised form 2 january 2020; accepted 8 january 2020 hpiv-4 circulation have reported conflicting findings, suggesting that hpiv-4 peaks either in the fall of odd-numbered years or annually following hpiv-3 peaks [6, 7] . however, these studies reflect regional or local circulation and are not necessarily representative of national hpiv-4 circulation patterns. we aimed to characterize the epidemiology and describe patterns of hpiv 1-4 circulation in the united states during 2011-2019 using data available from the national respiratory and enteric virus surveillance system (nrevss). nrevss is a voluntary passive laboratory-based surveillance system that collects weekly aggregate specimen data on respiratory and enteric viruses, including hpivs, from participating u.s. laboratories. from 2011-2019, approximately 500 laboratories reported to nrevss including state and local public health laboratories (phls), reference laboratories, and clinical hospitals. for nrevss, laboratories report on a weekly basis the aggregated total number of tests performed and the number of positive tests determined in the previous week by either of three categories of detection methods; molecular diagnostic assays, virus antigen detection, and viral isolation by culture. the diagnostic method reported from each laboratory varies by surveillance year and by virus. the nrevss surveillance year begins in july and ends in june of the following year in order to first capture the onset followed by the offset of most respiratory viruses within a 12-month period. a surveillance week was defined as a seven day period lasting from sunday through saturday. data are submitted to nrevss either directly from clinical, state, and local phls or indirectly by larger hospital networks or public health jurisdictions. laboratories reporting directly voluntarily report to the nrevss data submission portal and include weekly aggregated tests and positive detections of pathogens surveyed. additionally, nrevss receives data electronically via two mechanisms by which phls and non-commercial labs report surveillance data to the centers for disease control and prevention (cdc): the public health laboratory interoperability project (phlip) and the public health lab information system replacement (phlis2). phlip, a partnership between the association of public health laboratories, cdc, phls, and standard organizations, streamlines the data submission process by electronically sending specimen-level data including basic patient demographics and co-infections if detected [17, 18] . of the 14 nrevss-participating laboratories reporting through phlip/phlis2 at the time of analysis, 11 were phls, two were military health research centers and one was a clinical lab. ten of the 11 participating laboratories had more than 80 % of data available and were included in the analysis. once received, the specimen-level data is then aggregated and entered directly into the nrevss platform with the aggregate number of tests performed and positive detections summarized by virus and surveillance week. we characterized the circulation of hpivs by surveillance week from july 2011 -june 2019. we analyzed tests determined by molecular diagnostic assays as they were the most prevalent test type reported (encompassing approximately 75 % of hpiv detections) and limited to laboratories that reported at least one hpiv test and one detection during the analysis period. the total number of weekly positive hpiv detections were summarized both nationally and by us census regions, as testing for hpiv occurred throughout the year. the us census regions are divided into northeast, midwest, west, and south [19] . for 2015-2019, using available phlip and phlis2 data, we analyzed gender and age differences among the four hpiv types. using the chi square test, associations were considered significant at p < 0.05. lastly, the frequency and percentage of hpiv co-detections were assessed with the following viruses: rsv, respiratory adenovirus, influenza a/b, human metapneumovirus, rhinovirus/enterovirus, and coronavirus. analyses were completed using sas 9.4 (sas institute, cary, nc). among specimens with at least a single hpiv detection, 2618 (96 %) had complete gender and age data, 79 (3 %) had only age data available, and 20 (1 %) had only gender data available. hpiv was predominantly detected among younger age groups, specifically in children two years or younger (36 %). the median age was seven years with a range from 0 to 102 years. the largest proportion of detections were reported among those ≤2 years for all types, notably hpiv-1 (32 %), hpiv-2 (26 %), hpiv-3 (41 %), and hpiv-4 (37 %) (fig. 3) . by gender, 1353 were male (51 %); males significantly predominated for hpiv-2 only. of the 2717 positive hpiv tests submitted to phlip, 2009 (74 %) were also tested for rsv, respiratory adenovirus, influenza a/b, human metapneumovirus, rhinovirus/enterovirus, and four coronavirus subtypes: 229e, oc43, nl63, and hku1. although 1383 (69 %) reported a single hpiv detection, 7 (0.3 %) reported two or more hpiv types, and 619 (31 %) reported hpiv co-detections with other respiratory viruses. the most common co-detections with other respiratory viruses were rhinovirus/enterovirus (56 %) and influenza (20 %) (supplemental table 1 ). increased availability of multiplex molecular testing and the expansion of panels to include hpiv-4 as a target has contributed to the more comprehensive characterization of hpiv-4 circulation in the us according to nrevss. we found that nationally, hpiv-4 exhibited a unique circulation pattern, with a winter peak occurring annually. previously published descriptions of hpiv-4 circulation have been conflicting, finding either a biennial peak in the fall of odd-numbered years or a peak in the winter of each year [6, 7] . these studies were limited in geographic scope, focusing on local circulation patterns which may explain the difference in conclusions. hpiv-1, 2, and 3 were also characterized by distinct circulation patterns. biennial peaks of hpiv-1 were seen in the winter of oddnumbered years, with a steady decline in the following spring as described in prior studies [1, 6, 20, 21] . biennial peaks of hpiv-2 were discernable during the winter of even-numbered years. our analysis of national-level data demonstrates that peaks of these two serotypes were distinct, occurring in alternating-year cycles during the fall of each respective year. hpiv-3 peaks were typically seen annually during the spring and summer, with smaller peaks in the fall occurring at irregular intervals, as previously noted [1, 3, 6, 20] . we noted no substantial differences among regions in seasonal circulation of hpiv, as noted elsewhere [1, 3, 8] . among those with demographic characteristics and co-detections data available, these factors varied by hpiv type. while children ≤2 years accounted for the largest proportion of hpiv detections of all types, the distribution of detections by age was highly variable in our study. approximately 37 % of hpiv-4 detections were among children ≤2 years, similar to other hpiv types. while hpiv detections may peak during influenza season, we found that hpiv testing continues throughout the year (supplemental fig. 1) . this year-round testing trend indicates that the circulation patterns observed were not merely an artifact of testing practices such as increased testing for influenza. our study is subject to several limitations. first, nrevss is a passive laboratory-based surveillance system that receives voluntary reports from participating laboratories. as a result, certain laboratories or regions of the us may be overrepresented or underrepresented in the analysis. nrevss cannot be used to determine prevalence or incidence of infection because reports represent virus detections but not the number of patients testing positive. phlip data represent a subset of nrevss data, limiting our assessment of age and gender of hpiv detections. molecular panel tests, which contain hpiv, are more frequently ordered among children than adults in nrevss, which may have affected the age distribution [22] . additionally, these data include only a limited pool of clinical and sociodemographic factors including information on comorbidities, racial/ethnic background, or clinical course of infection, which limited the ascertainment of clinical associations among the hpiv types. future studies should explore these other factors. lastly, while hpiv testing increased over time, this increase may not be representative of viral activity, but a result of increased availability of multiplex molecular panels which contain hpiv targets. despite these limitations, data collected through nrevss provides a comprehensive understanding of hpiv trends in the us. the extensive laboratory network routinely reporting to nrevss allows us to identify circulation patterns and monitor year-to-year changes in hpiv types, including hpiv-4. although the epidemiology and clinical presentation of hpiv types 1-3 are well documented, less is known about hpiv-4. historically, hpiv-4 has been rarely reported due to the non-specific clinical manifestations of hpiv-4 illness, as well as the difficulty in accessibility of laboratory diagnostics used for hpiv-4 detection [1, 16] . the increased use of multiplex rt-pcr respiratory panels with hpiv-4 included has aided in the increased testing, recognition, and reporting of respiratory viruses owing to ease of use in clinical settings and high sensitivity and specificity of the assays [17] . broader testing for hpiv allows for the characterization of national and regional patterns of circulation and improved understanding of the epidemiology associated with the four hpiv types. the increased characterization of hpivs is especially important as hpivs are responsible for a substantial proportion of respiratory illnesses, particularly in young children. increased use of panels that include hpivs and improved surveillance can provide a more conclusive characterization parainfluenza viruses human parainfluenza viruses (hpivs): symptoms and illnesses parainfluenza virus infection of young children: estimates of the populationbased burden of hospitalization seasonal trends of human parainfluenza viral infections: united states a prospective study of parainfluenza virus type 4 infections in children attending daycare epidemiology and clinical presentation of parainfluenza type 4 in children: a 3-year comparative study to parainfluenza types 1-3 seasonality and clinical impact of human parainfluenza viruses, influenza other respir population-based surveillance for medically attended human parainfluenza viruses from the influenza incidence surveillance project epidemiology and clinical presentation of the four human parainfluenza virus types distribution and trends of human parainfluenza viruses in hospitalised children human parainfluenza type 4 infections human parainfluenza virus type 4 infection in chinese children with lower respiratory tract infections: a comparison study human parainfluenza virus types 1-4 in hospitalized children with acute lower respiratory infections in china seroprevalence of human parainfluenza virus types 1-4 among healthy children under 5 years of age in korea use of laboratory and administrative data to understand the potential impact of human parainfluenza virus 4 on cases of bronchiolitis human parainfluenza virus 4 outbreak and the role of diagnostic tests association of public health laboratories the evolution of the who/nrevss influenza surveillance system: the challenges and opportunities that accompany electronic laboratory data census regions and divisions of the united states pediatric hospitalizations for croup (laryngotracheobronchitis): biennial increases associated with human parainfluenza virus 1 epidemics parainfluenza virus infection respiratory syncytial virus testing capabilities and practices among national respiratory and enteric virus surveillance system laboratories progress in the development of human parainfluenza virus vaccines new antiviral approaches for human parainfluenza: inhibiting the haemagglutininneuraminidase the authors declare no potential conflicts of interest supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.jcv.2020.104261. key: cord-321287-mh2j2koa authors: trémeaux, pauline; lhomme, sébastien; abravanel, florence; raymond, stéphanie; mengelle, catherine; mansuy, jean-michel; izopet, jacques title: evaluation of the aptima™ transcription-mediated amplification assay (hologic®) for detecting sars-cov-2 in clinical specimens date: 2020-07-06 journal: j clin virol doi: 10.1016/j.jcv.2020.104541 sha: doc_id: 321287 cord_uid: mh2j2koa background: the spread of severe acute respiratory syndrome coronavirus 2 (sars-cov-2), which appeared in late 2019, has been limited by isolating infected individuals. however, identifying such individuals requires accurate diagnostic tools. objective: this study evaluates the capacity of the aptima™ transcription-mediated amplification (tma) assay (hologic® panther system) to detect the virus in clinical samples. study design: we compared the aptima™ assay to two in-house real-time rt-pcr techniques, one running on the panther fusion™ module and the other on the magna pure 96 and light-cycler 480 instruments. we included a total of 200 respiratory specimens: 100 tested prospectively and 100 retrospectively (25 -ve/75 +ve). results: the final cohen’s kappa coefficients were: κ = 0.978 between the aptima™ and panther fusion™ assays, κ = 0.945 between the aptima™ and magna/lc480 assays and κ = 0.956 between the magna/lc480 and panther fusion™ assays. conclusion: these findings indicate that the aptima™ sars-cov-2 tma assay data agree well with those obtained with our routine methods and that this assay can be used to diagnose coronavirus disease 2019 (covid-19). this study evaluates the performance of the automated commercial aptima™ sars-cov-2 assay (hologic® panther™ system) on clinical samples. this test, which uses transcription-mediated amplification (tma) to detect sars-cov-2, was compared to two in-house reverse transcriptasepolymerase chain reaction (rt-pcr) assays we presently use to diagnose covid-19. the aptima™ sars-cov-2 assay was performed following the manufacturer's instructions. virus transport medium (500 µl) was manually placed in the panther™ tube containing 710 µl of lysis buffer. the instrument used 360 µl of this mix for the lysis and capture of nucleic acids. the aptima™ assay targets two virus sequences located on the orf1ab gene. an internal control was included. our two in-house assays that both target virus sequences on the sars-cov-2 rna-dependent rnapolymerase (rdrp) gene, use primers and probes (ip-2 and ip-4) and amplification programs from the institut pasteur, paris (4). the first assay uses the magna pure 96 instrument (roche diagnostics) to extract nucleic acids from 200 µl of virus transport medium eluted in 100 µl. rt-pcr is then j o u r n a l p r e -p r o o f performed on the light-cycler 480 instrument (lc480) (roche diagnostics) using the accustart™ taq dna polymerase (quantabio) and 2 µl of nucleic acids (total reaction volume: 10 µl). the second assay uses the same primers and probes on the panther fusion™ module (hologic®) in open access. samples were prepared as described above for the aptima™ assay. because there is no reference standard method for the detection of sars-cov-2, we calculated the concordance between assays by using cohen's kappa coefficient (κ), the positive percent agreement, the negative percent agreement and overall percent agreement, all with 95% confidence intervals (6, 7). the prospective study provided 2 positive and 98 negative samples, and there was perfect concordance between results of the aptima™ assay and those of the panther fusion™ assay and very good concordance between the aptima™ assay and the magna/lc480 assay. one sample was faintly positive with the magna/lc480 assay (virus ip-4 target, ct = 39.97 and ip-2 -ve) and negative with the other two assays (sample a2 0141 0134, cf. table s1 in supplementary materials). all positive samples with ct values < 35 (n = 50) with the panther fusion™ assay tested positive with the other two assays. the magna/lc480 assay detected only one virus target (ip-4) in 6 of these samples (initial ct: 32-35) (cf. table s2 in supplementary materials). the 25 (ct > 35) positive samples detected by the panther fusion™ assay included 20 (80%) samples that were positive with the aptima™ assay and 17 (68%) that were positive with the magna/lc480 j o u r n a l p r e -p r o o f assay. these latter included 13 (65%) in which only one virus target (ip-4) was detected. five (20%) samples were negative with the aptima™ assay and eight (32%) with the magna/lc480 assay, four of these were negative with both assays. these nine samples were tested again with the panther fusion™ assay since sample storage can result in the partial degradation of virus rna, and thus to reduced assay sensitivity. four were negative and five were positive or inconclusive (three with only ip-2, one with only ip-4 and one with both targets) (cf. table s2 ). these discrepancies could also be due to selection bias -samples were chosen based on the panther fusion™ assay results. all the panther fusion™ assay negative samples were also negative with the aptima™ assay, except for one invalid sample. one sample was positive with the magna/lc480 assay, but displayed atypical pcr curves. a second rt-pcr on the same nucleic acid extract was negative (sample a2 0139 3655, cf. table s2 ). the invalid rate, all results included, with the aptima™ assay was 0.5% (1/200 the aptima™ sars-cov-2 tma assay was given emergency use authorization by the united states food and drug administration (8) and the ce mark for in vitro diagnostic use in europe. with those obtained with our in-house assays. it includes an internal control to detect inhibition of amplification. the panther™ instrument also provides random access, which allows urgent samples prioritization to obtain results within 3.5 hours with the aptima™ assay, and can deliver up to 60 results per hour. this can help laboratories provide rapid, high-throughput diagnosis during the covid-19 pandemic crisis. none declared. this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. [4] world heanlth organisation. 24 january 2020 2020. molecular assays to diagnose covid-19: summary table of available protocols. https://www.who.int/docs/defaultsource/coronaviruse/whoinhouseassays.pdf?sfvrsn=de3a76aa_2&download=true. accessed 10 february 2020. [5] tang yw, schmitz je, persing dh, stratton cw. 2020. laboratory diagnosis of covid-19: current issues and challenges. j clin microbiol 58. emergency use authorization information -in vitro diagnostic products https://www.fda.gov/emergencypreparedness-and-response/mcm-legal-regulatory-and-policy-framework/emergency-use-authorization covidinvitrodev. accessed 05 june 2020. ct: cycle threshold, rlu: relative light unit j o u r n a l p r e -p r o o f china novel coronavirus i, research t. 2020. a novel coronavirus from patients with pneumonia in china world heanlth organisation detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr key: cord-302896-3zvjyl3g authors: minosse, c.; selleri, m.; zaniratti, m.s.; cappiello, g.; spanò, a.; schifano, e.; lauria, f.n.; gualano, g.; puro, v.; campanini, g.; gerna, g.; capobianchi, m.r. title: phylogenetic analysis of human coronavirus nl63 circulating in italy date: 2008-07-03 journal: j clin virol doi: 10.1016/j.jcv.2008.04.015 sha: doc_id: 302896 cord_uid: 3zvjyl3g background: five known human coronaviruses infect the human respiratory tract: hcov-oc43, hcov-229e, sars-cov, hcov-nl63 and hcov-hku1. objectives: to evaluate the prevalence of hcov-nl63 in hospitalized adult patients and to perform molecular characterization of italian strains. study design: hcov-nl63 was sought by rt-pcr in 510 consecutive lower respiratory tract (lrt) samples, collected from 433 central-southern italy patients over a 1-year period. phylogenetic analysis was performed by partial sequencing of s and orf1a. additional s sequences from northern italy were included in the phylogenetic trees. results: hcov-nl63 was detected in 10 patients (2.0%) with symptomatic respiratory diseases, mainly during winter. phylogenetic analysis indicated a certain degree of heterogeneity in italian isolates. the orf1a gene clustering in phylogenetic trees did not match with that of the s gene. conclusions: as observed by others, hcov-nl63 is often associated with another virus. phylogenetic characterization of hcov-nl63 circulating in italy indicates that this virus circulates as a mixture of variant strains, as observed in other countries. coronaviruses (covs) are large, enveloped rna viruses of both medical and veterinary importance. five human covs (hcovs) are known to infect the human respiratory tract: hcov-oc43, hcov-229e (vabret et al., 2001) , sars-cov abbreviations: cov, coronavirus; sars, severe acute respiratory syndrome; hcov, human coronavirus; lrt, lower respiratory tract; s, spike; sp, sputum; bal, bronchoalveolar lavage; ea, endotracheal aspirates; flu, influenzavirus; hmpv, human metapneumovirus; adv, adenovirus; piv, parainfluenzavirus; rsv, respiratory syncytial virus; hrv, human rhinoviruses; bp, bronchopneumonia; copd, chronic obstructive pulmonary disease; cap, community-acquired pneumonia; arf, acute respiratory failure; rf, respiratory failure. * corresponding author. tel.: +39 0655170434; fax: +39 065582346. e-mail address: capobianchi@inmi.it (m.r. capobianchi). (peiris et al., 2003) , hcov-nl63 (fouchier et al., 2004; van der hoek et al., 2004) and hcov-hku1 (woo et al., 2005) . hcovs are divided into three distinct groups ; virus taxonomy, viiith report of the ictv): group 1, including hcov-229e and hcov-nl63; group 2, including hcov-oc43, hcov-hku1 and sars-cov; group 3 covs, including mainly avian viruses. hcovs represent the second most frequent causes of common cold and upper respiratory tract infections, after rhinoviruses (mäkelä et al., 1998) . particularly, hcov-nl63 can be recovered from the lower respiratory tract (lrt) specimens of patients with pneumonia or lrt complications, mainly involving young infants, and immunocompromised persons (gagneur et al., 2002; garbino et al., 2006; gerna et al., 2006; van der hoek et al., 2006; wu et al., 2008) . hcov-nl63 can be considered as a new important cause of respiratory illness, although the available data mainly refer to pediatric populations (arden et al., 2005; bastien et al., 2005b; boivin et al., 2005; chiu et al., 2005; ebihara et al., 2005; kuypers et al., 2007; moës et al., 2005) . based on phylogenetic analysis of different genome regions, several subtypes, currently co-circulating in the human population, have been identified in france, canada, australia, belgium, netherlands, sweden, china and korean (arden et al., 2005; bastien et al., 2005a; chiu et al., 2005; han et al., 2007; koetz et al., 2006; moës et al., 2005; vabret et al., 2005; van der hoek et al., 2004) . we investigated the prevalence of hcov-nl63 in samples from the lrt of hospitalized adult patients. molecular characterization was performed by sequencing a fragment of the spike (s) and of orf1a genes. a total of 510 consecutive lrt samples, including 329 sputums (sp), 165 endotracheal aspirates (ea) and 16 bronchoalveolar lavages (bal), were collected from 433 adult patients, admitted to three italian hospitals, during april 2004-may 2005. all specimens were screened with a molecular panel for detecting 12 respiratory viruses. of the 510 samples tested, 220 (43.1%) were positive for one respiratory virus and 33 (6.5%) were positive for more than one virus. the detailed prevalence for each of these pathogens is published elsewhere (minosse et al., 2008) . hcov-nl63 was detected by nested rt-pcr, targeting a 237 bp fragment of the orf1b (van der hoek et al., 2004) . as a positive control, a clinical sample positive for hcov-nl63 by rt-pcr and confirmed by sequence analysis, was used. as negative controls, water and a nasopharyngeal swab from an individual without respiratory symptoms were used in each analytical session. the sensitivity of our rt-pcr protocol, established by probit analysis of serial replicate dilutions of a plasmid containing the rt-pcr amplicon as the insert, was 1 copy/reaction, corresponding to 42 copies/ml of the starting sample. the rt-pcr assay was validated through participation in an external quality assessment (qcmd 2006 rhinovirus & coronavirus rna eqa pilot study, glasgow, uk), where hcov-nl63 was detected in all positive samples included in the panel. for phylogenetic analysis, two different genomic regions were amplified and sequenced: a 523 bp fragment of s gene and a 525 bp fragment of orf1a, by using primers previously described (bastien et al., 2005a; vabret et al., 2005) . the age of the 433 patients included in the study ranged from 15 to 93 years, mean (±s.d.): 56.3 (18.2) years, median (iqr): 57.0 (41.0-72.0) years. temporal distribution of samples collected over the 1-year study period is shown in fig. 1 . hcov-nl63 was detected in 10 (2.0%) of 510 samples. of the 10 positive samples, 3 were co-infected with human rhinovirus (hrv) and 1 with adenovirus (see table 1 ). demographic and clinical characteristics of positive cases are reported in table 1 . the overall frequency of hcov-nl63 infected patients was equally distributed between genders. the age of hcov-nl63 positive patients ranged from 29 to 85 years (mean ± s.d. was 60.1 [18.3] years; median iqr was 64.5 [41.5-76.0] years). all patients were symptomatic, and had clinically relevant respiratory diseases, including bronchopneumonia, chronic obstructive pulmonary disease, community-acquired pneumonia, and acute respiratory failure. three patients were in the intensive care unit and needed mechanical ventilation; two patients were immunosuppressed, due to solid organ tumour or hiv infection. only 5 of 10 positive samples had sufficient material to allow for genetic characterization. sequence analysis of the s and orf1a gene fragments showed 97-99% similarity to the prototype hcov-nl63 1988 and 2003 netherland isolates (genbank accession numbers: ay567487, ay518894). as expected, the phylogenetic tree built on orf1a contained two clusters: 4 out of the 5 of italian isolates were included in cluster 1, while one isolate (r3) had the characteristics of an outlier (fig. 2) . the phylogenetic analysis of s gene nucleotide sequences is shown in fig. 3 . besides the 5 patients described in fig. 2 (indicated as southern-central italy), 7 additional patients identified in pavia (indicated as northern italy) had s gene sequence data available, and were included in this analysis, together with 12 french isolates and 2 prototype isolates whose sequences were available in genbank. from this tree it was not possible to identify any cluster with bootstrap values >80. however, one of the italian isolates (pv5) was included in a subcluster with the french isolate ay994247 (bootstrap values = 78; fig. 3) , that was proposed to be an outlier by vabret et al. (2005) . the phylogenetic analysis of the predicted amino acid sequences for the analyzed s and orf1a gene fragments was consistent with that based on nucleotide sequences (not shown). generally, hcov-229e and hcov-oc43 cause disease much like the common cold, but they have also been associated with more severe lrt conditions, especially in weakened patients (kuypers et al., 2007; pene et al., 2003; vabret et al., 2001) . the spectrum of clinical symptoms associated with hcov-nl63 infection still needs to be determined. in this study, we detected hcov-nl63 in 2.0% of hospitalbased adult patients with lrt diseases. this frequency is consistent with prevalence data from previous studies, ranging from 1.0% to 9.3% (arden et al., 2005; bastien et al., 2005a,b; chiu et al., 2005; ebihara et al., 2005; kaiser et al., 2005; kuypers et al., 2007; moës et al., 2005; suzuki et al., 2005; vabret et al., 2005; van der hoek et al., 2005) . due to the lack of matched healthy subjects for comparison, it is not possible to attribute any causal role to hcov-nl63 in lrt diseases. nevertheless, the following points can be derived from our results: (a) hcov-nl63 was detected in lrt secretions of a small number of adult patients with clinically overt lrt disease; however, it is not possible to rule out that the virus detected could actually derive from contamination by upper respiratory tract secretions; (b) hcov-nl63 is often combined with other respiratory viruses, in agreement with previous data ; in fact, 3 out 10 hcov-nl63 positive samples were co-infected with fig. 2 . phylogenetic analysis of the partial orf1a nucleotide sequences of hcov-nl63 isolates from southern-central italy. a region spanning nt position 5844 to 6169 of the reference strain ay518894 was analyzed. italian isolates are in bold character. the nucleotide sequences of 2 prototype hcov-nl63 sequences available in genbank (ay567487 and ay518894, indicated as hcov-nl63 1988 and hcov-nl 2003, respectively) were included in the analysis. hcov-229e was used as an outgroup. bootstrap analysis with 500 replicates was performed to assess the significance of the nodes; values greater than 80% were considered significant. the orf1a nucleotide sequences from the 5 strains of hcov-nl63 from southern-central italy have been lodged in the genbank sequence database under accession no. eu030684, eu030685, eu125188 to eu1250190. hrv and 1 with adenovirus; these findings raise the possibility that hcov-nl63 may be only a bystander virus present in people with lrt disease due to other causative agents, rather than directly being involved in the disease aetiology; in addition, our numbers are too low to draw any conclusion on the role of immunosuppression on prevalence and clinical presentation of hcov-nl63 infection; (c) temporal distribution of hcov-nl63 positive samples (fig. 1) is consistent with winter seasonality of the infection, as previously reported (arden et al., 2005; bastien et al., 2005a; ebihara et al., 2005; moës et al., 2005; vabret et al., 2005; van der hoek et al., 2005) . fig. 3 . phylogenetic analysis of the s gene nucleotide sequences of hcov-nl63 isolates from southern-central and northern italy. a region spanning nt position 22567 to 23039 of the reference strain ay518894 was analyzed. italian isolates are in bold character. the nucleotide sequences of 2 prototype hcov-nl63 sequences available in genbank (ay567487 and ay518894, indicated as hcov-nl63 1988 and hcov-nl 2003, respectively) were included in the analysis. hcov-229e was used as an outgroup. bootstrap analysis with 500 replicates was performed to assess the significance of the nodes; values greater than 80% were considered significant. the s nucleotide sequences from the 5 strains of hcov-nl63 from southern-central italy have been lodged in the genbank sequence database under accession no. eu025124 to eu025128. recent reports indicate that hcov-nl63 has a worldwide distribution. sequence data from australia, japan, canada, france, belgium, and the netherlands indicate that this virus circulates as a mixture of variants, without a specific geographical segregation . in fact, rna viruses have an enormous potential to generate genetic diversity due to their high mutation rates. as a consequence, hcov-nl63, like other rna viruses, may exist as a dynamic distribution of closely related variants. this report shows the phylogenetic characterization of hcov-nl63 circulating in italy. the results, based on two different genomic regions (a portion of the s gene and of orf1a), shows a certain degree of heterogeneity in italian isolates, suggesting that different subtypes may be currently co-circulating, as observed in other countries (france, netherlands, australia, canada, and belgium), without the emergence of geographically distinct clusters (moës et al., 2005; vabret et al., 2005; van der hoek et al., 2006) . in agreement with literature data, the clustering based on the orf1a gene does not match with that of the s gene. as suggested in other reports, recombination occurring between different hcov-nl63 isolates may account for this finding (pyrc et al., 2007; moës et al., 2005; van der hoek et al., 2006) . new human coronavirus, hcov-nl63, associated with severe lower respiratory tract disease in australia human coronavirus nl63 infection in canada human coronavirus nl-63 infections in children: a 1-year study infections by human coronavirus-nl in hospitalized children human coronavirus nl63 infection and other coronavirus infections in children hospitalized with acute respiratory disease in hong kong, china detection of human coronavirus nl63 in young children with bronchiolitis virus taxonomy viiith report of the international committee on taxonomy of viruses a previously undescribed coronavirus associated with respiratory disease in humans coronavirusrelated nosocomial viral respiratory infections in a neonatal and paediatric intensive care unit: a prospective study a prospective hospital-based study of the clinical impact of non-severe acute respiratory syndrome (non-sars)-related human coronavirus infection genetic variability of human coronavirus oc43-, 229e-, and nl63-like strains and their association with lower respiratory tract infections of hospitalized infants and immunocompromised patients human coronavirus-nl63 infections in korean children human coronavirus nl63 associated with lower respiratory tract symptoms in early life detection of human coronavirus nl63, human metapneumovirus and respiratory syncytial virus in children with respiratory tract infections in south-west sweden clinical disease in children associated with newly described coronavirus subtypes viruses and bacteria in the etiology of the common cold frequency of detection of respiratory viruses in the lower respiratory tract of hospitalized adults a novel pancoronavirus rt-pcr assay: frequent detection of human coronavirus nl63 in children hospitalized with respiratory tract infections in belgium coronavirus as a possible cause of severe acute respiratory syndrome coronavirus 229e-related pneumonia in immunocompromised patients the novel human coronaviruses nl63 and hku1 detection of human coronavirus-nl63 in children in japan direct diagnosis of human respiratory coronaviruses 229e and oc43 by the polymerase chain reaction identification of a new human coronavirus croup is associated with the novel coronavirus nl63 human coronavirus nl63, a new respiratory virus characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia clinical manifestations of human coronavirus nl63 infection in children in taiwan this work was supported in part by grants from the italian ministry of health (fondi ricerca corrente, ricerca finalizzata, and "fondi per la creazione di un polo centralizzato per la crioconservazione") to inmi "l. spallanzani", and rf [grant 89282(05)/a] and rc (grant 80557) to fondazione irccs "policlinico san matteo". neither funding source influenced the design, conduct or reporting of this study.we acknowledge the enthusiastic contribution of m. visca and m. cava, who assisted in clinical investigation and collaborated with sample and data collection. key: cord-302864-2xnq1oq7 authors: quartuccio, luca; sonaglia, arianna; mcgonagle, dennis; fabris, martina; peghin, maddalena; pecori, davide; monte, amato de; bove, tiziana; curcio, francesco; bassi, flavio; vita, salvatore de; tascini, carlo title: profiling covid-19 pneumonia progressing into the cytokine storm syndrome: results from a single italian centre study on tocilizumab versus standard of care date: 2020-05-15 journal: j clin virol doi: 10.1016/j.jcv.2020.104444 sha: doc_id: 302864 cord_uid: 2xnq1oq7 objective: approximately 5% of patients with coronavirus disease 2019 (covid-19) develop a life-threatening pneumonia that often occurs in the setting of increased inflammation or “cytokine storm”. anti-cytokine treatments are being evaluated but optimal patient selection remains unclear, and the aim of our study is to address this point. methods: between february 29 to april 6, 2020, 111 consecutive hospitalized patients with covid-19 pneumonia were evaluated in a single centre retrospective study. patients were divided in two groups: 42 severe cases (toci) with adverse prognostic features including raised crp and il-6 levels, who underwent anti-cytokine treatments, mostly tocilizumab, and 69 standard of care patients (soc). results: in the toci group, all received anti-viral therapy and 40% also received glucocorticoids. in toci, 62% of cases were ventilated and there were 3 deaths (17.8 ± 10.6 days, mean follow up) with 7/26 cases remaining on ventilators, without improvement, and 17/26 developed bacterial superinfection. one fatality occurred in the 15 toci cases treated on noninvasive ventilation and 1 serious bacterial superinfection. of the 69 cases in soc, there was no fatalities and no bacterial complications. the toci group had higher baseline crp and il-6 elevations (p < 0.0001 for both) and higher neutrophils and lower lymphocyte levels (p = 0.04 and p = 0.001, respectively) with the toci ventilated patients having higher markers than non-ventilated toci patients. conclusion: higher inflammatory markers, more infections and worse outcomes characterized ventilated toci cases compared to ward based toci. despite the confounding factors, this suggests that therapy time in anti-cytokine randomized trials will be key. caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) is a global pandemic [1] . about twenty-five percent of patients have a seriously ill disease. a fraction of them may develop a very severe pneumonia which may progress to acute respiratory distress syndrome (ards) or end-organ failure that may be associated with a cytokine storm syndrome [2] . laboratory features associated with ards or death included neutrophilia, coagulation dysfunction [e.g., higher lactate dehydrogenase (ldh) and d-dimer] [3] . markedly high levels of interleukin (il)-2r, il-6, il-10, and tnf-α and the absolute numbers of cd4+ and cd8+ t lymphocytes being markedly low seem to characterize the most severe cases [4] . starting from the first preliminary experience on the apparent efficacy of tocilizumab in covid-19 pneumonia [5] , many multicenter trials are ongoing to test anti-cytokine treatments in critically ill patients. nevertheless, robust data to predict the outcome of covid-19 pneumonia after the hospital admission are still lacking [6] , though they are urgently needed in order to facilitate the assessment of anti-cytokine treatment efficacy in worse prognosis patient groups and not milder disease. the aim of this retrospective study was to evaluate baseline laboratory and immunological features in patients hospitalized for covid-19 pneumonia and to explore such parameters in relationship to standard of care (soc group) therapy versus anti-cytokine therapy, mainly tocilizumab, (toci group) that was mostly used either in ventilated patients in the icu or non-invasively ventilated patients, mostly in the ward setting. our single centre experience and approach showed that the milder hospitalized soc group faired well as did cases with cytokine storm treated with tocilizumab outside of the icu setting without ventilator support. severe complications including bacterial infections complicated tocilizumab in the icu setting but not ward-based tocilizumab therapy. therefore, randomized trials should target non-icu patients to prevent cytokine storm evolution. this study was undertaken to identify laboratory features for more serious covid-19 disease (i.e., to determine which cases that might theoretically benefit from anti-cytokine drugs). in this monocentric retrospective case-control study, the clinical and immunological characteristics of 111 consecutive patients with covid-19 were analyzed. patients were admitted to our hospital from february 29 to april 6, 2020. all but 6 patients presented to our hospital with 6 cases transferred from three other hospitals (all of whom eventually received tocilizumab). oral or written consent was obtained from patients. the study was conducted in accordance with the ethical principles of the helsinki declaration and ethical approval was given by local ethics committee (ceur-2020-os-102). besides clinical evaluation, the level of crp and il-6, when available, guided the decision towards anti-cytokine treatments. clinical decisions for the treatment of all these patients were taken usually within the first week after the admission, and during this time, the laboratory tests were repeated. demographic, clinical and laboratory characteristics, treatments and outcome data were collected. identification of cases of covid-19 virus was based on the detection of unique sequences of virus rna by nucleic acid amplification tests (naat) such as rt-pcr with confirmation by nucleic acid sequencing. the following genes were investigated: e gene for screening and then rdrp and n genes of sars-cov-2 for confirmation [7] . some laboratory data analysed at the admission are reported in table 1, including flow cytometry analysis with antibodies for the following subpopulations: cd19+ b cells, cd3+cd4+ t cells, cd3+cd8+ t cells, cd56+ nk cells, platelet count (cell/microl) and serum il-6 (pg/ml), measured by ce_ivd electrochemiluminescence immunoassay (elecsys il6, cobas, physiological range < 7pg/ml) with results being available within 48 hours. variables were reported as mean and standard deviation or median and interquartile range (iqr), as appropriate, or frequency rates and percentages if categorical; consequently, comparisons between toci and soc groups were made by parametric tests (t-test for two independent samples) or no parametric tests (mann-whitney test) for continuous variables. proportions were compared by χ2 test, or fisher exact test. bivariate correlation was made by two tailed pearson or spearman tests. all statistical analyses were performed using spss version 15.0 software (spss inc). for unadjusted comparisons, a 2-sided α of less than .05 was considered statistically significant. no corrections were made for multiple comparisons due to the explorative nature of the study. when the laboratory parameters were available, the patients were classified into two groups: the first group comprised 42 cases who developed a serious covid-19 disease that were deemed suitable for tocilizumab 8 mg/kg intravenously as a single infusion. in toci failures, two patients were then treated with anakinra 200 mg/day subcutaneously for three consecutive days. a second group of 69 cases who received supportive therapy [standard of care group (soc)] comprised those initially admitted to the hospital for covid-19, and who were treated with soc based on clinical and laboratory features (table 1) . j o u r n a l p r e -p r o o f antiviral treatments were employed in 100% of toci group and 80% of soc group (table 1) . notably, nearly 40% of toci group received glucocorticoids but none of the soc group did (table 1 ). there was no difference between groups regarding the time of reaching a negative swab test (supplemental file). among toci group, 18 (43%) patients were originally referred to the infectious disease unit with 3 being subsequently transferred to icu before tocilizumab administration ( figure 1 figure 1 ). importantly, at the hospital admission, toci patients who required invasive ventilation showed higher levels of inflammation markers, higher ldh and lower lymphocyte count than non-ventilated toci patients (table 2) . while all the patients in the soc group recovered, in the toci group, 9/42 (21.4%) patients completely recovered, and 21/42 (50%) patients showed a clear and rapid improvement after tocilizumab. a rapid improvement on anakinra after tocilizumab occurred in one case. in the 21 recovered toci treated group complicating infections arose in 11 (52.4%). in the remaining 12 nonresponder patients, four of them died, including one treated with anakinra after tocilizumab failure, and almost all showed co-morbidities including hypertension, obesity, ischemic heart disease or diabetes, or experienced superinfections, which substantially complicated the course. at hospital admission, toci group showed a significantly higher level of systemic inflammation as worst clinical presentation at the admission (n=24). a moderate to high correlation (>0.5) was found between crp and the following variables: d-dimer, ldh, neutrophil count and nlr (table 2) . by excluding those patients admitted to the icu within 24 hours (i.e., the most serious) (table 3b) , crp and il-6 remained statistically significant as discriminant variables between the two groups (table 3 ). yet, correlations between crp and il-6, total white blood cell count, neutrophil count, nlr, ldh were still significant (table 3b) . furthermore, the same analysis in the whole cohort by splitting the two group (n=42 for toci and n=69 for soc), showed that baseline crp value correlated with il-6, d-dimer, ldh, wbc, neutrophil count and nlr only in the soc group, while in the toci group, baseline crp correlated only with ldh, wbc, neutrophil and nlr (data not shown). our retrospective study was designed to evaluate which baseline standardized laboratory features in hospitalized covid-19 pneumonia may facilitate optimal employment of experimental anti-cytokine therapy [8, 9] . some case reports and one case series on the treatment with tocilizumab have been reported in the literature, suggesting some benefits in seriously ill patients [10] [11] [12] [13] [14] [15] [16] . more clearly, our data suggested that tocilizumab treatment in patients with cytokine storm features may be more effective outside of the icu setting in non-ventilated patients. however, there were differences in the degree of inflammation between non-ventilated and ventilated patients treated with tocilizumab, so it cannot be inferred that use of tocilizumab prior to icu admission is superior, given the generally milder inflammation in the former group. also, serious superimposed bacterial infections were largely confined to the icu. more worryingly, half the icu ventilated patients treated with toci remain ventilated or have died with only half of this group showing meaningful clinical improvement so far. our findings confirmed that the milder patient group receiving standard of care therapy without the utilization of tocilizumab all made full recoveries. our findings do point towards trials focused on the earlier use of such therapeutic strategies. notably, our soc and toci groups were different in terms of co-treatments, which could have affected the overall outcome, and all of the toci cases also received antiviral therapy. these findings are preliminary and the results of ongoing randomized controlled trials will definitely clarify anti-cytokine use. in our study, neutrophilia, lymphopenia, in particular low cd8+ t cell count rather than cd4+ t cell, higher crp, higher ldh and higher ck showed the highest significance to distinguish the two patient groups at initial hospital admission. also, serum il-6 was significantly higher in the toci group, thus reflecting the very high inflammatory state of those patients at baseline. very recently, il-6 serum levels were also closely correlated with viral load in critically ill patients and it is important to point out that all our patients belonging to toci group received anti-viral agents [17] . notably, baseline crp and il-6 continued to distinguish the two groups (toci versus soc) even after excluding the most seriously ill patients from analyses. thus, these biomarkers could useful for decision making. notably, a higher nlr, as well as a higher monocyte to lymphocyte ratio, have been associated with mortality and imaging progression in hospitalized patients for covid-19 [18] [19] [20] . it is well known that nlr is a biomarker for poor outcome even in various cancers [21] . lymphocyte biology probably plays a great role in the pathogenesis of covid-19 disease [4, [22] [23] [24] [25] . since cd4+ t cells and cd8+ t cells are a crucial arm against infections [26] , our findings also indicated that the lymphopenia in the toci group may be relevant for secondary infections. given that, treatment with tocilizumab might favor the persistence of the virus and iatrogenic infections. anakinra might be safer and more flexible than repeating tocilizumab infusion in seriously ill patients. a role for anticoagulation is increasingly recognized in severe covid-19 [27, 28] . in our study, a significant correlation between crp and d-dimer, as well as with ldh and neutrophil count (and nlr) was shown. very recent data showed that low molecular weight heparin or unfractionated heparin at prophylactic doses are associated with a reduced short-term mortality in more severe covid-19 patients [28] , and most of our patients, particularly, in icu, were administered heparin which may have impacted on the overall outcome. moreover, inflammatory diseases carry a higher risk of thrombosis, as seen in chronic autoimmune diseases [29] . it remains to be seen whether the possible efficacy of anti-cytokine therapy may be even to mitigate against immunothrombosis. increased levels of ldh and ck may also reflect the level of the organ damage in a systemic disease, as occurs in the macrophage activation syndrome [30] , where a hypercoagulable state often complicates the course, and it may be the case for covid-19. thus, it is not surprisingly that ldh has been already noticed as biomarker of severity as long as neutrophils, in covid-19 [3, 31] . this study has several limitations. it is a retrospective study, with some missing data due to the emergency context in which it has been realized. no conclusions on the efficacy and safety of treatment approach employed can be provided. six patients were transferred from other hospitals so original baseline values from the first admission were unavailable. about 50% of the toci group were admitted to the icu within 24 hours from admission, thus they already presented a more serious disease at the time of admission. the follow-up was limited from our hospital admission to discharge. finally, measurement of viral load was not available. nevertheless, the cohort is monocentric and it showed similar characteristics to those reported by wang et al. [2] , thus supporting the results, though preliminary. to conclude, our study showed that toci treated patients covid-19 pneumonia were at the highest risk of cytokine storm [32] . tocilizumab use prior to ventilation in icu may be optimal since 50% of such cases died, remain ventilated and show serious superinfection. whether the use of tocilizumab j o u r n a l p r e -p r o o f prior to ventilation will be vindicated in randomized trials is of major interest. our findings also showed that cases receiving tocilizumab on ventilation generally had higher levels of inflammation than non-ventilated toci treated subjects, possibly suggesting that the latter group has an intrinsically milder disease with a better prognosis. timing of anti-cytokine therapy is a key issue. lq designed data collection tools, monitored data collection for the whole study, wrote the statistical analysis plan, cleaned and analysed the data, drafted and revised the paper. he is guarantor. as collected the data, analysed the data, and revised the paper. fc, mf, tb, adm, fb, mp, dp collected the data, analysed the data, and revised the paper. sdv, dm analysed the data, drafted and revised the paper. ct designed data collection tools, analysed the data, revised the paper. this research received no external funding. the study was conducted in accordance with the ethical principles of the helsinki declaration. patients' consents for using data for research purpose were obtained at the time of hospital admission. ethical approval for the present retrospective observational study was given by "comitato etico unico regionale (ceur)", with the following registration number: ceur-2020-os-102. patients treated with tocilizumab were then enrolled into the observational part of the tocivid-19 italian study (eudract: 2020-001110-38), a single arm, open-label trial on the efficacy and safety of tocilizumab in covid-19 pneumonia. the data that support the findings of this study are available on request from the corresponding author, conflicts of interest: "the authors declare no conflict of interest." clinical features of patients infected with 2019 novel coronavirus in wuhan, china clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in wuhan, china risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease clinical and immunological features of severe and moderate coronavirus disease 2019 tocilizumab treatment in covid-19: a single center experience prediction models for diagnosis and prognosis of covid-19 infection: systematic review and critical appraisal diagnosing covid-19: the disease and tools for detection acs nano. 2020 mar 30: acsnano.0c02624 the use of anti-inflammatory drugs in the treatment of people with severe coronavirus disease 2019 (covid-19): the perspectives of clinical immunologists from china the role of cytokines including interleukin-6 in covid-19 induced pneumonia and macrophage activation syndrome-like disease effective treatment of severe covid-19 patients with tocilizumab tocilizumab, an anti-il6 receptor antibody, to treat covid-19-related respiratory failure: a case report rapid and severe covid-19 pneumonia with severe acute chest syndrome in a sickle cell patient successfully treated with tocilizumab favorable changes of ct findings in a patient with covid-19 pneumonia after treatment with tocilizumab. diagn interv imaging gemelli against covid-19 group (members are listed in the acknowledgments section). off-label use of tocilizumab in patients with sars-cov-2 infection why tocilizumab could be an effective treatment for severe covid-19? tocilizumab treatment in covid-19: a single center experience detectable serum sars-cov-2viral load (rnaemia) is closely correlated with drastically elevated interleukin 6 (il-6) level in critically ill covid-19 patients neutrophil-to-lymphocyte ratio as an independent risk factor for mortality in hospitalized patients with covid-19 dysregulation of immune response in patients with covid-19 in wuhan predictors for imaging progression on chest ct from coronavirus disease 2019 (covid-19) patients. aging (albany ny) prognostic role of neutrophil-to-lymphocyte ratio in solid tumors: a systematic review and meta-analysis prediction for progression risk in patients with covid-19 pneumonia: the call score clinical course and outcomes of critically ill patients with sars-cov-2 pneumonia in wuhan, china: a single-centered, retrospective, observational study clinical characteristics of coronavirus disease 2019 in china transcriptomic characteristics of bronchoalveolar lavage fluid and peripheral blood mononuclear cells in covid-19 patients airway memory cd4(+) t cells mediate protective immunity against emerging respiratory coronaviruses microvascular covid-19 lung vessels obstructive thromboinflammatory syndrome (microclots): an atypical acute respiratory distress syndrome working hypothesis anticoagulant treatment is associated with decreased mortality in severe coronavirus disease 2019 patients with coagulopathy risk of thrombosis in sjögren syndrome: the open question of endothelial function immune-mediated dysregulation risk factors for severity and mortality in adult covid-19 inpatients in wuhan on the alert for cytokine storm: immunopathology in covid-19. arthritis rheumatol legend: sd, standard deviation wbc, white blood cells lmwh, low molecular weight heparin; biologic, anticytokine treatment group l/r) in 56 patients (all as first-line antiviral treatment) patients (as first-line antiviral treatment in 40, as second remdesivir in 3 patients, all as second-or third-line treatment patients; the first two days, then steroids were tapered and finally suspended in 7 days. #as prophylactic treatment we thank the following colleagues for their valued contribution to this work: ginevra key: cord-290352-0pc5eji4 authors: de jong, menno d.; hien, tran tinh title: avian influenza a (h5n1) date: 2005-10-06 journal: j clin virol doi: 10.1016/j.jcv.2005.09.002 sha: doc_id: 290352 cord_uid: 0pc5eji4 since their reemergence in 2003, highly pathogenic avian influenza a (h5n1) viruses have reached endemic levels among poultry in several southeast asian countries and have caused a still increasing number of more than 100 reported human infections with high mortality. these developments have ignited global fears of an imminent influenza pandemic. the current knowledge of the virology, clinical spectrum, diagnosis and treatment of human influenza h5n1 virus infections is reviewed herein. periodically, completely novel antigenic subtypes of influenza viruses have been introduced in the human pop* corresponding author. tel.: +84 8 9237 954; fax: +84 8 9238 904. ulation, causing large-scale global outbreaks with high death tolls. the most devastating influenza pandemic in modern recorded history, known as the "spanish flu", occurred in 1918-1919, killing up to 100 million people worldwide. other less destructive pandemics during the previous century occurred in 1957 and 1968 . avian influenza a viruses are key to the emergence of human influenza pandemics. the virus strains implicated in the 20th century's influenza pandemics originated directly from avian influenza viruses, either through genetic reassortment between human and avian influenza strains (1957 and 1968) or possibly through adaptation of purely avian strains to humans (1918) . it was long thought that the restricted host range of avian influenza viruses precluded direct transmission to humans, and that the emergence of pandemic strains required genetic reassortment between avian and human strains. however, occurrences of direct bird-to-human transmission of avian influenza viruses have increasingly been reported in recent years, culminating in the ongoing outbreak of influenza a (h5n1) among poultry in several asian countries with associated human infections. these unprecedented developments have resulted in increasing global concerns about the pandemic potential of these viruses. influenza viruses are pleomorphic, enveloped rna viruses belonging to the family of orthomyxoviridae. protruding from the lipid envelope are two distinct glycoproteins, the hemagglutinin (ha) and neuraminidase (na) . ha attaches to cell surface sialic acid receptors, thereby facilitating entry of the virus into host cells. since it is the most important antigenic determinant to which neutralizing antibodies are directed, ha represents a crucial component of current vaccines. na is the second major antigenic determinant for neutralizing antibodies. by catalyzing the cleavage of glycosidic linkages to sialic acid on host cell and virion surfaces, this glycoprotein prevents aggregation of virions thus facilitating the release of progeny virus from infected cells. inhibition of this important function represents the most effective antiviral treatment strategy to date. a third membrane protein, the m2 protein, is present in small quantities in influenza a viruses. by functioning as an ion channel, this protein regulates the internal ph of the virus, which is essential for uncoating of the virus during the early stages of viral replication. this function is blocked by the antiviral drugs amantadine and rimantadine. the genome of influenza viruses is segmented, consisting of 8 single-stranded, negative sense rna molecules, which encode 10 proteins. the rna segments are contained within the viral envelope in association with the nucleoprotein (np) and three subunits of viral polymerase (pa, pb1, and pb2), which together form the ribonucleoprotein (rnp) complex responsible for rna replication and transcription. additional proteins contained within the virion include m2 and the viral nuclear export protein (nep), which function in assembly and budding, and export of rnp from the nucleus, respectively. based on antigenic differences in np and m proteins, influenza viruses are classified as types a, b, and c. influenza b and c viruses are not divided into subtypes. all avian influenza viruses are classified as type a. further subtyping of influenza a viruses is based on antigenic differences between the two surface glycoproteins ha and na. to date, 16 ha subtypes (h1-h16) and 9 na subtypes (n1-n9) of influenza a viruses have been identified (fouchier et al., 2005) . the standard nomenclature for influenza viruses includes the influenza type, the host of origin (excluding humans), the place of isolation, the strain number, the year of isolation, and finally the influenza a subtype in parentheses (e.g. a/duck/vietnam/11/04 (h5n1)). the natural reservoir of influenza a viruses are aquatic birds, in which the viruses appear to have achieved an optimal level of host adaptation (webster et al., 1992) . transmission between birds occurs directly or indirectly through fecally contaminated aerosols, water, feed, and other materials. the spectrum of disease in birds ranges from asymptomatic infection, to mild respiratory illness, to severe and rapidly fatal systemic disease. most avian influenza viruses isolated from birds are avirulent, i.e. result in asymptomatic infection or only mild disease. avian influenza viruses capable of causing outbreaks of severe disease (fowl plague) in chickens or turkeys are classified as highly pathogenic, and are currently restricted to h5 and h7 subtypes. infection of poultry by highly pathogenic avian influenza viruses is characterized by disseminated infection, and clinically manifested by decreased egg production, respiratory signs, excessive lacrimation, edema of the head, diarrhea, neurological symptoms, and death. from the principal reservoir of aquatic birds, viruses are occasionally transmitted to other animals, including mammals and domestic poultry, causing transitory infections and outbreaks. through adaptation by mutation or genetic reassortment, some of these viruses may establish speciesspecific permanent lineages of influenza a viruses, and cause epidemics or epizootics in the new host. in the human population, the establishment of these lineages in the 20th century was preceded by influenza pandemics. transmission of viruses and transitory infections may also occur among the new hosts, e.g. between humans and pigs or chickens and humans. although all ha and na subtypes are found in aquatic birds, the number of subtypes that have crossed the species barrier and established stable lineages in mammals is limited. only three ha and two na subtypes (i.e. h1-3 and n1-2)) have circulated in humans since 1918. in horses, only two influenza a subtypes (h7n7 and h3n8) are found, while, despite susceptibility to all avian subtypes in experimental settings, the only subtypes recovered from pigs in nature are h1, h3, n1, and n2. the molecular, biological or ecological factors determining the apparent subtype-specific ability of viruses to cross species barriers and spread among a range of hosts remain largely unresolved. while interspecies transmission does occur at times, there certainly are host range restrictions. human influenza strains preferentially bind to sialic acid residues linked to galactose by the ␣2,6 linkage, while avian and equine influenza strains recognize sialic acid linked to galactose by ␣2,3 linkage (connor et al., 1994; gambaryan et al., 1997; matrosovich et al., 1997 matrosovich et al., , 2004 rogers and d'souza, 1989; . correspondingly, human respiratory epithelial cells predominantly contain ␣2,6 sialic acid-galactose linkages, while the host cells in birds and horses mainly contain ␣2,3 linkages (couceiro et al., 1993; ito et al., 1998; matrosovich et al., 2004) . respiratory epithelial cells in the pig contain both ␣2,3and ␣2,6 linkages, which explains why this animal is susceptible to both human and avian influenza viruses (ito et al., 1998) . because of this trait, the pig is widely regarded as a potential source of new pandemic strains, since it could serve as a non-selective host in which mixed infection of avian and human strains efficiently occurs, potentially resulting in new reassortant viruses, or in which purely avian strains can adapt to human receptor recognition. introduction of an influenza a virus with a novel ha gene in a population which lacks immunity to this ha has the potential to cause a pandemic when the virus posesses the ability to spread efficiently among humans. during the 20th century, this has happened three times, in 1918, 1957, and 1968 , killing millions of people worldwide. in all three pandemics, the viruses originated from avian influenza viruses. the virus strains responsible for the influenza pandemics of 1957 and 1968 both first emerged in southeastern asia, and both arose through reassortment of genes between avian viruses and the prevailing human influenza strain (scholtissek et al., 1978) . the "asian influenza" pandemic of 1957 was caused by an h2n2 virus that had acquired three genes (h2, n2, and pb1) from avian viruses infecting wild ducks, in a backbone of the circulating h1n1 human influenza strain. as the asian flu strain emerged and established a permanent lineage, the h1n1 strains soon disappeared from the human population for unclear reasons. similarly, the h3n2 virus causing the "hong kong influenza" pandemic of 1968 consisted of two genes from a duck virus (h3 and pb1) in a background of the human h2n2 strain circulating at that time. the latter virus disappeared with the emergence of the h3n2 virus and since then has not been detected in humans. sequence analysis of the hypothetical precursor strain, which immediately preceded the pandemic h3n2 virus suggested that fewer than six amino acids in ha had changed during the avian-to-human transition . interestingly, a number of these changes may reflect adaptation to the new host since they modified the area surrounding the receptor-binding pocket of ha, including a glu to leu change at position 226 which is particluarly implicated in determining specificity for human receptors. the fact that, beside one or two novel surface glycoproteins, both pandemic strains also posessed a pb1 gene of avian origin is intriguing and may suggest a role of this gene in interspecies transmission (kawaoka et al., 1989) . although millions of people died during the 1957 and 1968 pandemics, the viruses involved did not appear particularly virulent, suggesting that lack of immunity was the main reason for the excess mortality. this was different during the "spanish flu" pandemic of 1918, in which lack of immunity in the human population was combined with an apparent extremely high virulence of the virus, resulting in the demise of up to 100 million people worldwide. because the 1918 pandemic occurred before viruses were identified as the causative agents, no intact virus has been available for analysis. this and the similar lack of available human and animal influenza strains circulating before 1918 has made it difficult to determine the exact origin of the pandemic h1n1 virus and the reason for its extreme virulence. however, valuable insight has been provided by the recovery of fragments of viral rna isolated from archived autopsy specimens and tissue from alaskan flu victims buried in the permafrost (taubenberger et al., 1997) . this enabled sequence analysis of five of the eight genes (ha, na, np, m, and ns) (reid et al., 2004) . phylogenetic analyses of these genes suggest that the 1918 h1n1 virus may not have arisen by the same mechanism as the 1957 and 1968 pandemic viruses, i.e. by reassortment of avian and human influenza viruses, but perhaps by direct transmission from an avian source after adaptation in humans or another permissive mammalian host, such as the pig (reid et al., 2004) . this is supported by the observation that the 1918 pandemic strain retained the amino acid residues at positions 226 and 228 of ha predictive for binding to avian receptors (taubenberger et al., 1997) . recent chrystallographic studies showed that structural changes in the h1 ha allowed the virus to recognize human receptors despite the presence of these avian-like residues, which may explain why the virus could nevertheless efficiently infect and spread among humans (gamblin et al., 2004; stevens et al., 2004) . the possibility that the 1918 strain had retained the structure and biological properties of its avian ancestors while acquiring the ability to recognize and efficiently infect human cells may explain the high virulence of this virus. mathematical modelling studies have suggested that the transmissability of the 1918 virus was not remarkably different than regular human influenza strains, suggesting that extremely efficient spread did not account for the high morbidity and mortality (mills et al., 2004) . while part of the high mortality of the 1918 pandemic could be explained by the lack of antibiotics to treat secondary bacterial pneumonia and poor living conditions, the extremely rapid and severe clinical course implies high pathogenicity of the virus as the major cause. the molecular basis for this high virulence remains unclear. the 1918 h1 ha lacks the multibasic cleavage site characteristic of highly pathogenic avian influenza viruses (reid et al., 1999; taubenberger et al., 1997) . there are conflicting observations concerning the role of the ns gene in the 1918 pandemic strain. in mice, the presence of the complete ns or only the ns1 segment seemed to confer decreased, rather than enhanced pathogenicity of reassortant h1n1 viruses (basler et al., 2001) . in contrast, in vitro experiments in human lung cells suggested more efficient inhibition of interferon-regulated genes by h1n1 virus in the presence of the 1918 ns gene (geiss et al., 2002) . the most convincing evidence implicates ha as an important determinant of the high virulence. the presence of ha of the 1918 virus conferred high pathogenicity in mice to human strains that were otherwise non-pathogenic in this host (kobasa et al., 2004) . furthermore, these infections were associated with severe hemorrhagic pneumonia and the induction of high levels of macrophage-derived cytokines and chemokines, strikingly reminiscent of clinical observations in humans during the spanish flu pandemic, as well as of recent in vitro and in vivo observations of infections with highly pathogenic avian influenza h5n1 viruses (cheung et al., 2002; oxford, 2000; peiris et al., 2004; to et al., 2001) . in recent years, it has become clear that human infections with highly pathogenic influenza h5n1 viruses are associated with severe, often fatal disease. in may 1997, following outbreaks of influenza h5n1 among poultry on three farms in the new territories of hong kong, an influenza h5n1 virus was isolated from a 3-year-old boy in hong kong, who died of severe pneumonia complicated by acute respiratory distress syndrome and reye's syndrome (subbarao et al., 1998) . in november and december of the same year, concomittant with outbreaks of influenza h5n1 among chickens in poultry markets and on farms in hong kong, 17 additional cases of human h5n1 infections were identified, 5 of which were fatal (chan, 2002; yuen et al., 1998) . the outbreak was contained after the slaughtering of all 1.5 million chickens in hong kong. in response to the outbreak, influenza surveillance in poultry was intensified permitting early recognition of other outbreaks of avian influenza in 2001 and 2002. no further human h5n1 infections were reported until february 2003, when two laboratory-confirmed cases and one probable case were identified in one family from hong kong (peiris et al., 2004) . the daughter died of an undiagnosed respiratory infection while visiting fujian province in mainland china. upon their return to hong kong, the father and son developed severe respiratory illnesses of which the father died. h5n1 virus was isolated from both patients. in december 2003, an outbreak of highly pathogenic h5n1 virus was identified among poultry in the republic of korea (lee et al., 2005) . subsequently, outbreaks by antigenically related viruses were reported among poultry in thailand, viet nam, japan, china, cambodia, laos, malaysia, and indonesia. the reason for this apparent simultaneous occurrence of h5n1 outbreaks in many asian countries remains unclear. however, h5n1 viruses have also been found in dead migratory birds, which may suggest a role of wild birds in the maintenance and spread of h5n1 viruses in the region (chen et al., 2005; li et al., 2004) . human infections during the southeast asian outbreaks were first reported in early 2004 from viet nam and thailand, followed by still ongoing resurgences of human cases in viet nam, cambodia, and indonesia from then onwards (chotpitayasunondh et al., 2005; tran et al., 2004) . at the time of this writing (august 2005), the total number of confirmed human cases of influenza h5n1 in the 4 countries amounts to 112 (thailand: 17; cambodia: 4; indonesia: 1; viet nam: 90), of which 57 were fatal (who, 2005) . it cannot be excluded and may even be likely that additional cases have gone unnoticed in these and other affected countries due to a lack of clinical awareness, active surveillance, or diagnostic facilities (hien et al., 2004) . while many countries initially affected by poultry outbreaks in 2004 have been declared free of the virus, h5n1 virus seems to have reached endemic levels in poultry and aquatic birds in several asian countries, despite attempts to contain the outbreak by extensive culling of poultry. in these countries, continuing occurrences of bird-to-human transmissions increase the opportunity of the virus to adapt to humans and acquire the ability to spread between humans. in addition, continuing cocirculation of avian and human viruses in these countries, where humans live in close proximity with poultry and pigs, increases the risk of reassortment between both in co-infected humans or other mammalian hosts, such as the pig. the recent isolation of h5n1 viruses from pigs in china (chen et al., 2004) , and, albeit at low prevelance, the detection of h5n1 antibodies in vietnamese pigs (choi et al., 2005) , are concerning in this respect. for all these reasons, the current developments in southeast asia seem to justify the global concern that, similar to 1957 and 1968, a new pandemic influenza strain may emerge from this region in the near future. at presentation, most cases of human h5n1 infections were characterized by a severe influenza syndrome, clinically indistinguishable from severe human influenza, with symptoms of fever, cough and shortness of breath, and radiological evidence of pneumonia (chotpitayasunondh et al., 2005; tran et al., 2004; yuen et al., 1998) . abnormalities on chest radiographs at presentation included extensive, usually bilateral infiltration, lobar collapse, focal consolidation, and air bronchograms. radiological evidence of pulmonary damage could still be observed in surviving patients several months after the illness. beside respiratory symptoms, a large proportion of patients also complained of gastrointestinal symptoms such as diarrhea, vomiting, and abdominal pain, which are common in children with human influenza, but not in adults. in some cases, diarrhea was the only presenting symptom, preceding other clinical manifestations (apisarnthanarak et al., 2004; de jong et al., 2005) . unlike human infections with h7 or h9 viruses, conjunctivitis was not prominent in h5n1-infected patients. the clinical course of the illness in severe cases was characterized by rapid development of severe bilateral pneumonia necessitating ventilatory support within days after onset. complications included acute respiratory distress syndrome, renal failure, and multi-organ failure. evidence that the clinical spectrum of human h5n1 infections is not restricted to pulmonary symptoms was provided by a reported case of possible central nervous system involvement in a vietnamese boy who presented with diarrhea, followed by coma and death. influenza h5n1 virus was isolated from throat, rectal, blood, and cerebrospinal fluid specimens, suggesting widely disseminated viral replication (de jong et al., 2005) . his sister had died of a similar illness 2 weeks earlier, but no diagnostic specimens were obtained. although highly virulent h5n1 viruses have shown neurotropism in mammals such as mice and cats (keawcharoen et al., 2004; lipatov et al., 2003; tanaka et al., 2003) , these cases may be similarly rare as central nervous system manifestations associated with human influenza (morishima et al., 2002; sugaya, 2002) . genetic predisposition of the host to such manifestations may play a role. striking routine laboratory results in h5n1-infected patients, especially in severe cases, were an early onset of lymphopenia, with a pronounced inversion of the cd4+/cd8+ ratio, thrombocytopenia and increased levels of serum transaminases (chotpitayasunondh et al., 2005; tran et al., 2004; yuen et al., 1998) . high levels of cytokines and chemokines have been observed in several h5n1-infected patients, suggesting a role of immune-mediated pathology in the pathogenesis of h5n1 infections (peiris et al., 2004; to et al., 2001) . this was supported by pathological examination in two patients who died during the outbreak in hong kong, which showed reactive hemophagocytosis as the most prominent feature . other findings included diffuse alveolar damage with interstitial fibrosis, hepatic central lobular necrosis, acute renal tubular necrosis, and lymphoid depletion. although the gastrointestinal, hepatic, renal, and hematologic manifestations could suggest wider tissue tropism, there was no evidence of viral replication in organs outside the respiratory tract . however, viral replication in the gastrointestinal is strongly suggested by reported virus isolation and detection of positive strand viral rna from fecal specimens (de jong et al., 2005; uiprasertkul et al., 2005) . while many laboratory-confirmed h5n1 infections were associated with severe, often fatal disease, milder cases have also been reported, especially during the outbreak in hong kong (chan, 2002; yuen et al., 1998 ). an increasing number of milder cases also seemed to occur in viet nam, as the outbreak progressed in 2005 (who, 2005) . while increased clinical awareness and surveillance may account for such observations, progressive adaptation of the virus to humans is the dreaded alternative explanation. the occurrence of mildly symptomatic and asymptomatic infections have also been suggested during the outbreak in hong kong by seroepidemiological studies in household members of h5n1-infected patients and health care workers. in these studies, 8 of 217 exposed and 2 of 309 non-exposed healthcare workers were seropositive for h5n1-specific antibodies (bridges et al., 2002) . seroconversion was documented in two exposed nurses, one of whom reported a respiratory illness 2 days after exposure to an h5n1-infected patient. more importantly than showing the occurrence of asymptomatic infections, these data indicated that nosocomial person-to-person transmission had occurred, albeit limited to a few cases. an additional case of possible human-to-human transmission during the hong kong outbreak was suggested by h5n1-seropositivity in a household contact of a patient, who had no history of poultry exposure (katz et al., 1999) . seroepidemiological studies in health care workers involved in the care of h5n1infected patients in thailand and viet nam in 2004 have not shown evidence of person-to-person transmission, despite the absence of adequate infection control measures in the vietnamese cohort at the time of study (apisarnthanarak et al., 2005; liem and lim, 2005; schultsz et al., 2005) . during the outbreak in thailand in 2004, extensive epidemiological investigations have suggested person-to-person transmission from a child, who died of presumed h5n1 infection, to her mother who had no history of exposure to poultry and had provided prolonged unprotected nursing care to her daughter . an aunt of the child may have been infected by the same route since her last exposure to poultry before infection had been 17 days, considerably longer than the estimated incubation period of 2-10 days. there have been several similar family clusters of h5n1 cases in viet nam, which have all ignited concerns about the possibility of human-to-human transmission, but most of which could be explained by common exposure to poultry. while there has been no evidence of efficient transmission of influenza h5n1 virus between humans to date, caution and detailed investigations remain warranted in case of any cluster of infections, especially in view of the relatively rapid evolution h5n1 viruses have exhibited in recent years. in 1996, an h5n1 virus was isolated from geese during an outbreak in guangdong province in china (influenza a/goose/guangdong/1/96 (a/g/gd/96)) (xu et al., 1999) . this virus proved to be the donor of the ha gene of the reassortant h5n1 viruses causing the outbreak among poultry and humans in hong kong in 1997. the internal genes of the hong kong h5n1 viruses were closely related to those of an h9n2 virus isolated from quail (guan et al., 1999) . the origin of the na gene remains unclear, but was notable for a 19-amino acid deletion in the stalk region (subbarao et al., 1998) . such deletions may be associated with adaptation of influenza viruses to land-based poultry (matrosovich et al., 1999) . the ha gene contained multibasic sequences at the cleavage site, in accordance with its classification as a highly pathogenic strain (claas et al., 1998; matrosovich et al., 1999) . after the eradication of the 1997 hong kong strain, the goose precursor viruses continued to circulate in geese in southeastern china (cauthen et al., 2000; webster et al., 2002) . through reassortment between this virus and other avian viruses, multiple antigenically similar genotypes, that were highly pathogenic in chickens but not in ducks, emerged and again were eradicated in hong kong in 2001 and 2002 . then, in late 2002, h5n1 strains isolated from wild migratory birds and resident waterfowl in two hong kong parks showed marked antigenic drift and exhibited high pathogenicity in ducks sturm-ramirez et al., 2004) . the latter property is rarely found in nature, and had not been observed in strains isolated during previous years. an antigenically and molecularly similar virus caused the two confirmed human infections in early 2003 in a family from hong kong peiris et al., 2004) . h5n1 influenza viruses isolated from healthy ducks in southern china between 1999 and 2002 were all antigenically similar to the precursor influenza a/g/gd/96 virus (chen et al., 2004) . it is thought that these ducks played a central role in the generation of the virus responsible for the outbreaks in southeast asia since 2003. detailed genetic analyses of h5n1 strains isolated during the period 2000-2004 from poultry and humans in china, hong kong, indonesia, thailand, and viet nam, demonstrated that a series of genetic reassortment events, all traceable to the a/g/gd/96-precursor virus, ultimately gave rise to a dominant h5n1 genotype (genotype z) in chickens and ducks . this genotype is implicated in the human cases in hong kong in 2003 and the outbreaks among poultry and humans since 2004. the evolution of h5n1 viruses in recent years has been associated with increasing virulence and an expanding host range, which beside terrestrial poultry and wild birds, also includes mammals. while all h5n1 viruses isolated from ducks in china between 1999 and 2002 were highly pathogenic in chickens, an increasing level of pathogenicity was observed in mice with the progression of time: virus isolated in 1999 and 2000 were less pathogenic than those isolated in 2001 and 2002 (chen et al., 2004) . it has been suggested that the increasing ability to replicate in mammals has resulted from transmission between ducks and pigs. the expanding host range is also illustrated by successful experimental infection of domestic cats, and natural infections of tigers and leopards with recent h5n1 strains (keawcharoen et al., 2004; kuiken et al., 2004) . in summary, continued evolution of h5n1 viruses since 1997, involving multiple genetic reassortment events between a/g/gd/96-like viruses and other avian viruses and perhaps transmission between birds and pigs or other mammalian hosts, have resulted in a highly virulent genotype with an expanded host range which is now causing widespread outbreaks among poultry and humans in southeast asia. while transmission between birds and humans at present still seems inefficient, as does transmission between humans, this may change when the virus is allowed to continue its evolution through adaptation and reassortment. although virus isolation remains the gold standard of diagnosis and indispensable for virus characterization, rapid laboratory confirmation of suspected human influenza in routine diagnostic laboratories is usually performed by immunochromatographic or immunofluorescent detection of influenza virus antigens, or reverse transcriptase (rt) pcr detection of viral nucleic acids in respiratory specimens. in addition, serological evidence of human influenza a virus infection can be obtained by commercially available elisa kits which detect antibodies to conserved viral antigens, such as the nucleoprotein. in the absence of cocirculating avian influenza strains in the human population, further subtyping of influenza viruses or detection of subtype-specific antibodies are usually not done by routine diagnostic laboratories, but are restricted to reference laboratories involved in epidemiological analyses and planning of vaccine strains. however, in case of an outbreak of avian influenza, efforts to further subtype the virus, e.g. by subtype-specific rt pcr methods, should be made by routine laboratories since immediate knowledge about the infecting influenza subtype is essential for infection control and timely epidemiological investigations. dependence on reference laboratories, which in the case of many southeast asian countries affected by avian influenza outbreaks, are situated abroad, potentially results in unacceptable delays and hampers timely recognition of outbreaks and institution of adequate control measures (hien et al., 2004) . however, the reality is that diagnostic facilities in many affected countries are scarce and often not sufficiently equipped for virological diagnostics, let alone subtyping of influenza viruses. global efforts to improve diagnostic capacity in resource-poor countries may prove an important step towards the prevention and control of pandemic influenza (hien et al., 2004) . similar to human influenza viruses, avian viruses can be isolated in embryonated eggs or in cell culture, using permissive cells such as madin darby canine kidney (mdck) cells or rhesus monkey kidney (llc-mk2) cells. unlike human strains and avirulent avian strains and in accordance with their promiscuity for cellular proteases, highly pathogenic avian viruses do not require the addition of exogenous trypsine for efficient replication in cell culture. for safety purposes, the isolation of highly pathogenic avian influenza virus requires biosafety level 3 laboratory facilities or higher. cytopathic effects in cell culture are non-specific. initial identification of influenza a virus can be performed by immunofluorescent staining with monoclonal antibodies against the nucleoprotein. further ha and na subtyping is performed by subtype-specific rt pcrs of culture supernatant or hemag-glutination inhibition and neuraminidase inhibition assays using a panel of reference antisera against various subtypes. in human infections, avian influenza viruses have mostly been isolated from conjunctival swabs and respiratory specimens such as throat or nasal secretions or washings tran et al., 2004; yuen et al., 1998) . in one reported case of h5n1 infection, virus was also isolated from serum, cerebrospinal fluid, and a rectal swab (de jong et al., 2005) . detection of influenza a viral antigens in clinical specimens by direct immunofluorescence or by rapid immunochromatographic assays are widely used for diagnosis of human influenza because of their ability for rapid diagnosis. however, in patients with avian influenza, the usefulness of these assays seems limited due to low sensitivity (peiris et al., 2004; yuen et al., 1998) . in addition, some rapid antigen detection kits do not distinguish between influenza types a and b, and none of the currently available immunofluoresent and immunochromatographic assays distinguish between influenza a subtypes. however, developments of h5n1-specific rapid antigen detection tests are ongoing . rt pcr methods allow for sensitive and specific detection of viral nucleic acids and have shown to increase the diagnostic sensitivity for many viral pathogens when compared to culture or antigen detection methods. during the h5n1 outbreaks in hong kong and southeast asia, rt pcr methods for specific detection of h5n1 viral nucleic acids have proven valuable and seem the diagnostic methods of choice in case of an outbreak of avian influenza (chotpitayasunondh et al., 2005; tran et al., 2004; yuen et al., 1998) . especially when using real-time pcr technology, a reliable subtype-specific diagnostic result can be generated within a few hours after specimen collection. a disadvantage of rt pcr methods is its proneness for contamination and the consequent risk of false-positive results, which should be be minimized by proper precautions, including physical separation of laboratories for pcr preparation and amplification, and the use of the uracil-n-glycosylase system to prevent contamination by carryover of amplimers. in addition, the inclusion of an internal control in rt pcr assays is highly desirable to monitor for false-negative results due to inefficient nucleic acid extraction, cdna synthesis, or amplification. during outbreaks of avian influenza, the detection of subtype-specific antibodies is particularly important for epidemiological investigations. hemagglutination inhibition (hi) assays are the gold standard for detection of antibodies against human influenza viruses. however, their usefulness for detection of antibodies against avian viruses in mammalian species, including humans, seems limited (beare and webster, 1991; hinshaw et al., 1981; kida et al., 1994) . several studies have shown a failure to detect hi antibodies against avian viruses in mammals, even in cases where infection was confirmed by virus isolation. possible reasons for this failure include poor immunogenicity of some avian viruses and lack of sensitivity to detect low titered or less avid antibodies induced by avian viruses (hinshaw et al., 1981; kida et al., 1994; lu et al., 1982; rowe et al., 1999) . it has been demonstrated that hi testing with subunit ha, but not with intact virus, could detect antibodies against an avian h2n2 virus (lu et al., 1982) . however, neutralizing antibodies against this virus could readily be detected with intact virus. a direct comparison of hi testing with a microneutralization assay in h5n1-infected persons from the 1997 hong kong outbreak indeed showed the latter to be more sensitive . while an indirect elisa assay using recombinant ha from h5n1/97 showed at least equal sensitivity as the microneutralization assay, the specificity in adult sera was inferior, possibly due to the presence of crossreactive epitopes common to all has . based on these observations, neutralization assays are the methods of choice for detection of antibodies against avian viruses in humans. using these assays, it has been shown that the kinetics of the antibody response against h5n1 virus in patients infected during the hong kong outbreak are similar to the primary response to human influenza viruses (katz et al., 1999) . neutralizing antibodies were generally detected 14 or more days after the onset of symptoms and titers equal to or higher that 1:640 were observed 20 or more days after onset. currently, two classes of drugs are available with antiviral activity against influenza viruses: inhibitors of the ion channel activity of the m2 membrane protein, amantadine and rimantadine, and inhibitors of the neuraminidase, oseltamivir, and zanamivir. the therapeutic efficacy of amantadine in human influenza is unclear due to a paucity of reliable clinical studies, but reductions of fever or illness by 1 day have been observed in adults and children (nicholson et al., 2003) . major disadvantages of amantadine include neurotoxicity and a rapid development of drug resistance during treatment. resistance is conferred by single nucleotide changes resulting in amino acid substitutions at positions 26, 27, 30, 31, or 34 of the m2 protein. rimantadine causes less neurological side effects but is not available in most parts of the world. although several h5n1-infected patients have been treated with amantadine during the 1997 h5n1 outbreak in hong kong, the numbers were too small to draw any meaningful conclusions concerning its activity against this virus (yuen et al., 1998) . in vitro sensitivity testing of virus isolated from the first patient during this outbreak showed normal susceptibility to amantadine (subbarao et al., 1998) . strikingly, genotype z h5n1 viruses isolated from poultry and humans in thailand and viet nam in 2004 invariably showed an amantadine-resistance conferring amino acid substitution at position 31 of the m2 protein, indicating that amantadine treatment is not an option during the ongoing outbtreak in southeast asia puthavathana et al., 2005) . both oseltamivir and zanamivir have proven efficacy in the treatment of human influenza when started early during the course of illness, and are particularly effective as seasonal or postexposure prohylaxis (nicholson et al., 2003) . zanamivir has poor oral availability and is therefore administered by inhalation, which has limited its use in the elderly and may induce bronchospasm. oseltamivir can be given orally. the development of drug resistance during treatment has been reported for both drugs and is associated with mutations in the active site of neuraminidase or in the hemaglutinin. the latter mutations decrease the affinity of ha for the cellular receptor, thereby obviating the need for neuraminidase to escape the cells. data on the efficacy of neuraminidase inhibitors in avian influenza virus are scarce. the h5n1 strains implicated in the 1997 hong kong outbreak were susceptible in vitro to oseltamivir and zanamivir (govorkova et al., 2001; leneva et al., 2000) . oral oseltamivir and topical zanamivir also showed therapeutic and protective activities against hong kong h5n1 isolates in murine animal models (gubareva et al., 1998; leneva et al., 2001) . recent murine studies suggest that, perhaps due to higher virulence, higher doses of oseltamivir and longer durations of treatment are necessary to achieve antiviral effects in mice against h5n1 strains causing the southeast asian outbreak since 2004, when compared to the 1997 hong kong h5n1 strain (yen et al., 2005) . oseltamivir treatment has been given to several h5n1infected patients, but no conclusions can be made concerning its efficacy. however, the timing of antiviral treatment may not have been optimal in many cases of avian influenza so far. beneficial effects of antiviral treatment in human influenza are optimal when started within 48 h after onset of the illness. during the h5n1 outbreak in viet nam in 2004, h5n1infected patients were admitted 5 days or later after onset of symptoms (tran et al., 2004) . earlier recognition of avian influenza in humans may improve the efficacy of antiviral treatment. while several h5n1-infected patients have received steroids in addition to oseltamivir, the potential benefits of this need formal evaluation in clinical studies (tran et al., 2004) . considering the observed cytokine dysregulation in h5n1-infected animals and humans, a beneficial effect of immunomodulating agents could be hypothesized and perhaps requires further study. finally, neutralizing monoclonal antibodies have been shown effective in treating established influenza a virus infection in mice with severe combined immunodeficiency (palladino et al., 1995) . although mice are not men, this strategy deserves attention in the treatment of a severe illness such as influenza h5n1. birds infected with avian influenza excrete large amounts of virus in feces and other secretions, which contaminate the direct environment, such as dust, soil, water, cages, tools, and other fomites. avian influenza virus may remain infectious in soil, water, or contaminated equipment for weeks to months, depending on the temperature and humidity (i.e. longer in colder climates). illness in birds caused by highly pathogenic avian influenza viruses results in systemic replication and the presence of infectious virus in their eggs and many tissues and organs. transmission of avian influenza viruses between birds occurs directly or indirectly through contact with fecally contaminated aerosols, water, feed, and other materials. birdto-human transmission likely occurs via the same route, i.e. direct contact with birds or contaminated fomites. most, but not all human infections with avian influenza viruses involved handling of affected poultry or direct exposure to live poultry in the week before onset of the illness (koopmans et al., 2004; mounts et al., 1999; tran et al., 2004) . case-control studies during the 1997 h5n1 outbreak in hong kong identified visiting a stall or market selling live poultry during the week before the illness as a risk factor, whereas eating or preparing poultry products were not (mounts et al., 1999) . in cases in which no apparent direct exposure to poultry could be identified, contact with contaminated environment, such as water, has been suggested (de jong et al., 2005) . of note, it has been shown that ducks infected by the currently circulating h5n1 strain in southeast asia remain healthy but excrete large amounts of virus for prolonged periods of time (hulse-post et al., 2005) . since water in ponds and canals in which large flocks of ducks reside, is widely used for bathing and drinking in rural areas of many southeast asian countries, it may not be unlikely that such water represents a source of transmission when contaminated by infected ducks. in fact, contact with contaminated water is regarded as the most important mode of transmission between aquatic birds. a limited number of possible human-to-human transmissions of influenza h5n1 have been reported, which involved prolonged, close and unprotected contact with infected patients (katz et al., 1999; koopmans et al., 2004; ungchusak et al., 2005) . similar to human influenza, droplet and contact transmission are probably the most effective means of transmission of avian influenza virus between humans, should the virus acquire the ability for efficient spread, but airborne transmission remains a possibility. the occurrence of diarrhea in h5n1-infected patients, which may contain infectious virus, represents a potential non-respiratory route of transmission, which needs to be considered in infection control practices (apisarnthanarak et al., 2004; de jong et al., 2005; tran et al., 2004) . data concerning excretion patterns and periods of potential infectivity are lacking for human infections with avian influenza viruses. based on exposure histories, the incubation time for human h5n1-infections has been estimated 2-10 days, but it is not known whether excretion of virus occurs during this time (tran et al., 2004; yuen et al., 1998) . based on the current (lack of) knowledge, infection control measures during contact with potentially infected birds or environment, or with patients with suspected or confirmed infection should prevent contact, droplet, and airborne transmission. these measures include mask (preferably high efficiency masks, with surgical masks as a second alternative), gown, face shield, or goggles and gloves. the efficacy of neuraminidase inhibitors as seasonal or postexposure prohylaxis against human influenza is high (nicholson et al., 2003) . offering prophylactic treatment to potentially exposed people in the setting of a poultry outbreak of avian influenza, as has been done during h7-outbreaks in the netherlands and canada (koopmans et al., 2004; tweed et al., 2004) , is rational but hardly feasible during the ongoing outbreak in southeast asia for logistical and financial reasons. postexposure prophylaxis to unprotected healthcare workers and close contacts of infected patients is advisable. the potential use of specific monoclonal antibodies for prophylaxis warrants further investigation. eliminating the source of infection, i.e. infected birds, remains the most effective infection control measure. culling of all infected poultry have proven succesful during avian influenza outbreaks in hong kong, the netherlands and canada (chan, 2002; koopmans et al., 2004; tweed et al., 2004) . however, considering the geographic extensiveness of the outbreak in southeast asia, the different farming practices, and the reported h5n1 infections in migratory birds (chen et al., 2005) , it seems very unlikely that culling of poultry alone will contain the outbreak in that region. the bulk of human influenza vaccines are produced from inactivated viruses grown in embryonated eggs. vaccine production against highly pathogenic avian influenza viruses is complicated because of the requirement for high biosafety containment facilities, and the difficulty, in some cases, to obtain high virus yields in embryonated eggs because of the virus' pathogenicity (stephenson et al., 2004; wood and robertson, 2004) . several other approaches have been used in an attempt to overcome these obstacles, including the use of reverse genetics techniques, generation of recombinant hemagglutinin, dna vaccination and the use of related apathogenic h5 viruses with and without different adjuvants (nicholson et al., 2003; stephenson et al., 2004; webby et al., 2004; wood and robertson, 2004) . experimental h5n1 vaccines in which important virulence determinants were altered using plasmid-based reverse genetics, have shown protective efficacy to homologous and heterologous h5 strains in animal models and may prove an attractive approach (li et al., 1999; lipatov et al., 2005; takada et al., 1999) . studies in humans using an h5n3 vaccine developed from a 1997 apathogenic avian virus showed high rates of seroconversions to the vaccine strain and heterologous h5n1 strains after three doses, but only when the vaccine was given with the adjuvans mf59 . in animal models, baculovirusderived recombinant h5 vaccines were immunogenic and protective, but results in humans were disappointing even when using high doses (crawford et al., 1999; treanor et al., 2001) . h5 dna vaccines protected mice from infection by homologous, but not by heterologous h5n1 viruses (epstein et al., 2002; kodihalli et al., 1999) . the increasing frequency of outbreaks with highly pathogenic avian influenza viruses among poultry and direct transmission of these viruses to humans, culminating in the ongoing extensive h5n1 outbreak in southeast asia, has ignited grave concerns about an imminent influenza pandemic. indeed, two of three prerequisites for a human pandemic have been met in the southeast asian h5n1 outbreak: the emergence of an antigenically novel strain to which the population has no immunity, and the transmission of this strain to humans in whom it can cause severe disease. to date, there is fortunately no evidence of efficient spread of h5n1 virus between humans, but continued circulation of this strain, which now has reached levels of endemicity among poultry in several southeast asian countries, increases the opportunity to adapt to humans through mutation or genetic reassortment in humans or intermediate mammalian hosts. as suggested by the "spanish flu" pandemic of 1918, extremely high transmissability is no prerequisite for a severe pandemic killing tens of millions of people, and as shown by the severe acute respiratory syndrome (sars) virus epidemic in 2003, viruses can rapidly spread across the globe in the current age of intense global travel. as a consequence of all this, pandemic preparedness has become an important issue worldwide. pandemic plans, which include stock-piling of antivirals and candidate vaccines, are being developed by an increasing number of countries worldwide, and alternative methods for rapid vaccine production and potential methods enabling dose reduction of vaccines are increasingly propagated (schwartz and gellin, 2005; stephenson et al., 2004; webby et al., 2004; webby and webster, 2003; wood and robertson, 2004) . notwithstanding the importance of these efforts to prepare for a possible h5n1 pandemic, more structural and longer term global efforts are needed to allow for early recognition of novel influenza viruses or other emerging pathogens infecting humans in the future. in 2002, a who global agenda for influenza surveillance and control has been adopted, of which the main objectives are to strengthen surveillance, improve knowledge of the disease burden, increase vaccine use, and accelerate pandemic preparedness (stohr, 2003) . it is essential that these objectives are increasingly focused on the southeast asian region, which has been the source of previous pandemics and is the epicentre of the current pandemic threat. many southeast asian countries currently lack the expertise, financial means, and infrastructure for human and animal diagnostics and surveillance. global investments to improve public health care infrastructures and laboratory facilities, and to transfer clinical, epidemiological, and technical knowledge to these countries are much needed (hien et al., 2004) . the window of opportunity in the era of global travel is narrow. local capacity, and less dependence on foreign laboratories and expertise, will allow for earlier recognition and quicker responses to epidemics. in addition, local availability of clinical, scientific, and laboratory capacity facilitates and expedites clinical, virological, and epidemiological analyses needed to optimize outbreak control, infection control, and clinical managment. it also guarantees the timely availability of virus strains for monitoring virus evolution and planning of vaccines by reference laboratories. such global investments to enhance local infrastructure and expertise will increase the chances of success of containing an influenza pandemic at the source by antiviral prophylaxis and other preventive measures suggested by recent mathematical modelling studies (ferguson et al., 2005; longini et al., 2005) . seroprevalence of anti-h5 antibody among thai health care workers after exposure to avian influenza (h5n1) in a tertiary care center sequence of the 1918 pandemic influenza virus nonstructural gene (ns) segment and characterization of recombinant viruses bearing the 1918 ns genes evolution of the h3 influenza virus hemagglutinin from human and nonhuman hosts replication of avian influenza viruses in humans risk of influenza a (h5n1) infection among poultry workers continued circulation in china of highly pathogenic avian influenza viruses encoding the hemagglutinin gene associated with the 1997 h5n1 outbreak in poultry and humans outbreak of avian influenza a(h5n1) virus infection in hong kong in 1997 the evolution of h5n1 influenza viruses in ducks in southern china avian flu: h5n1 virus outbreak in migratory waterfowl induction of proinflammatory cytokines in human macrophages by influenza a (h5n1) viruses: a mechanism for the unusual severity of human disease? studies of h5n1 influenza virus infection of pigs by using viruses isolated in vietnam and thailand in 2004 human disease from influenza a (h5n1) thailand human influenza a h5n1 virus related to a highly pathogenic avian influenza virus receptor specificity in human, avian, and equine h2 and h3 influenza virus isolates influenza virus strains selectively recognize sialyloligosaccharides on human respiratory epithelium; the role of the host cell in selection of hemagglutinin receptor specificity baculovirus-derived hemagglutinin vaccines protect against lethal influenza infections by avian h5 and h7 subtypes fatal avian influenza a (h5n1) in a child presenting with diarrhea followed by coma dna vaccine expressing conserved influenza virus proteins protective against h5n1 challenge infection in mice strategies for containing an emerging influenza pandemic in southeast asia characterization of a novel influenza a virus hemagglutinin subtype (h16) obtained from black-headed gulls avian influenza a virus (h7n7) associated with human conjunctivitis and a fatal case of acute respiratory distress syndrome specification of receptor-binding phenotypes of influenza virus isolates from different hosts using synthetic sialylglycopolymers: non-egg-adapted human h1 and h3 influenza a and influenza b viruses share a common high binding affinity for 6 -sialyl(n-acetyllactosamine) the structure and receptor binding properties of the 1918 influenza hemagglutinin cellular transcriptional profiling in influenza a virus-infected lung epithelial cells: the role of the nonstructural ns1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza comparison of efficacies of rwj-270201, zanamivir, and oseltamivir against h5n1, h9n2, and other avian influenza viruses emergence of multiple genotypes of h5n1 avian influenza viruses in hong kong sar h5n1 influenza: a protean pandemic threat molecular characterization of h9n2 influenza viruses: were they the donors of the "internal" genes of h5n1 viruses in hong kong? characterization of influenza a/hongkong/156/97 (h5n1) virus in a mouse model and protective effect of zanamivir on h5n1 infection in mice avian influenza-a challenge to global health care structures replication of avian influenza a viruses in mammals role of domestic ducks in the propagation and biological evolution of highly pathogenic h5n1 influenza viruses in asia molecular basis for the generation in pigs of influenza a viruses with pandemic potential antibody response in individuals infected with avian influenza a (h5n1) viruses and detection of anti-h5 antibody among household and social contacts avian-to-human transmission of the pb1 gene of influenza a viruses in the 1957 and 1968 pandemics avian influenza h5n1 in tigers and leopards potential for transmission of avian influenza viruses to pigs enhanced virulence of influenza a viruses with the haemagglutinin of the 1918 pandemic virus dna vaccine encoding hemagglutinin provides protective immunity against h5n1 influenza virus infection in mice transmission of h7n7 avian influenza a virus to human beings during a large outbreak in commercial poultry farms in the netherlands avian h5n1 influenza in cats characterization of highly pathogenic h5n1 avian influenza a viruses isolated from south korea efficacy of zanamivir against avian influenza a viruses that possess genes encoding h5n1 internal proteins and are pathogenic in mammals the neuraminidase inhibitor gs4104 (oseltamivir phosphate) is efficacious against a/hong kong/156/97 (h5n1) and a/hong kong/1074/99 (h9n2) influenza viruses genesis of a highly pathogenic and potentially pandemic h5n1 influenza virus in eastern asia recombinant influenza a virus vaccines for the pathogenic human a/hong kong/97 (h5n1) viruses lack of h5n1 avian influenza transmission to hospital employees neurovirulence in mice of h5n1 influenza virus genotypes isolated from hong kong poultry in 2001 efficacy of h5 influenza vaccines produced by reverse genetics in a lethal mouse model containing pandemic influenza at the source failure to detect hemagglutinationinhibiting antibodies with intact avian influenza virions the surface glycoproteins of h5 influenza viruses isolated from humans, chickens, and wild aquatic birds have distinguishable properties avian influenza a viruses differ from human viruses by recognition of sialyloligosaccharides and gangliosides and by a higher conservation of the ha receptor-binding site human and avian influenza viruses target different cell types in cultures of human airway epithelium transmissibility of 1918 pandemic influenza encephalitis and encephalopathy associated with an influenza epidemic in japan case-control study of risk factors for avian influenza a (h5n1) disease influenza a pandemics of the 20th century with special reference to 1918: virology, pathology and epidemiology virus-neutralizing antibodies of immunoglobulin g (igg) but not of igm or iga isotypes can cure influenza virus pneumonia in scid mice re-emergence of fatal human influenza a subtype h5n1 disease molecular characterization of the complete genome of human influenza h5n1 virus isolates from thailand origin and evolution of the 1918 "spanish" influenza virus hemagglutinin gene evidence of an absence: the genetic origins of the 1918 pandemic influenza virus receptor binding properties of human and animal h1 influenza virus isolates receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the h3 hemagglutinin based on species of origin single amino acid substitutions in influenza haemagglutinin change receptor binding specificity detection of antibody to avian influenza a (h5n1) virus in human serum by using a combination of serologic assays on the origin of the human influenza virus subtypes h2n2 and h3n2 avian influenza h5n1 and healthcare workers vaccination strategies for an influenza pandemic cross-reactivity to highly pathogenic avian influenza h5n1 viruses after vaccination with nonadjuvanted and mf59-adjuvanted influenza a/duck/singapore/97 (h5n3) vaccine: a potential priming strategy confronting the avian influenza threat: vaccine development for a potential pandemic structure of the uncleaved human h1 hemagglutinin from the extinct 1918 influenza virus the global agenda on influenza surveillance and control reemerging h5n1 influenza viruses in hong kong in 2002 are highly pathogenic to ducks characterization of an avian influenza a (h5n1) virus isolated from a child with a fatal respiratory illness influenza-associated encephalopathy in japan avirulent avian influenza virus as a vaccine strain against a potential human pandemic neurotropism of the 1997 hong kong h5n1 influenza virus in mice initial genetic characterization of the 1918 "spanish" influenza virus pathology of fatal human infection associated with avian influenza a h5n1 virus avian influenza a (h5n1) in 10 patients in vietnam safety and immunogenicity of a recombinant hemagglutinin vaccine for h5 influenza in humans human illness from avian influenza h7n3, british columbia influenza h5n1 replication sites in humans probable person-to-person transmission of avian influenza a (h5n1) responsiveness to a pandemic alert: use of reverse genetics for rapid development of influenza vaccines are we ready for pandemic influenza? evolution and ecology of influenza a viruses characterization of h5n1 influenza viruses that continue to circulate in geese in southeastern china cumulative number of confirmed human cases of avian influenza a/(h5n1) reported to who from lethal virus to life-saving vaccine: developing inactivated vaccines for pandemic influenza latex agglutination test for monitoring antibodies to avian influenza virus subtype h5n1 genetic characterization of the pathogenic influenza a/goose/guangdong/1/96 (h5n1) virus: similarity of its hemagglutinin gene to those of h5n1 viruses from the 1997 outbreaks in hong kong virulence may determine the necessary duration and dosage of oseltamivir treatment for highly pathogenic a/vietnam/1203/04 (h5n1) influenza virus in mice clinical features and rapid viral diagnosis of human disease associated with avian influenza a h5n1 virus we thank the staff of the hospital for tropical diseases ho chi minh city, the health service of ho chi minh city and the ministry of health, viet nam. menno de jong is funded by the wellcome trust, uk. key: cord-291930-n7wq09rq authors: arden, k.e.; faux, c.e.; o’neill, n.t.; mcerlean, p.; nitsche, a.; lambert, s.b.; nissen, m.d.; sloots, t.p.; mackay, i.m. title: molecular characterization and distinguishing features of a novel human rhinovirus (hrv) c, hrvc-qce, detected in children with fever, cough and wheeze during 2003 date: 2010-01-27 journal: j clin virol doi: 10.1016/j.jcv.2010.01.001 sha: doc_id: 291930 cord_uid: n7wq09rq background: human rhinoviruses (hrvs) are associated with more acute respiratory tract infections than any other viral group yet we know little about viral diversity, epidemiology or clinical outcome resulting from infection by strains, in particular the recently identified hrvs. objectives: to determine whether hrvc-qce was a distinct hrv-c strain, by determining its genome and prevalence, by cataloguing genomic features for strain discrimination and by observing clinical features in positive patients. study design: novel real-time rt-pcrs and retrospective chart reviews were used to investigate a well-defined population of 1247 specimen extracts to observe the prevalence and the clinical features of each hrv-qce positive case from an inand out-patient pediatric, hospital-based population during 2003. an objective illness severity score was determined for each hrvc-qce positive patient. results: differences in overall polyprotein and vp1 binding pocket residues and the predicted presence of a cis-acting replication element in 1b defined hrvc-qce as a novel hrv-c strain. twelve additional hrvc-qce detections (1.0% prevalence) occurred among infants and toddlers (1–24 months) suffering mild to moderate illness, including fever and cough, who were often hospitalized. hrvc-qce was frequently detected in the absence of another virus and was the only virus detected in three (23% of hrvc-qce positives) children with asthma exacerbation and in two (15%) toddlers with febrile convulsion. conclusions: hrvc-qce is a newly identified, genetically distinct hrv strain detected in hospitalized children with a range of clinical features. hrv strains should be independently considered to ensure we do not overestimate the hrvs in asymptomatic illness. acute respiratory tract infections (artis), a major cause of human morbidity and hospitalization, are most frequently viral in origin. the human rhinoviruses (hrvs) have for over a decade been associated, more than any other individual factor, with asthma 1-3 and chronic obstructive pulmonary disease exacerbations 4 and the majority of cold and flu-like illnesses (cflis). 5, 6 it has been shown that hrvs infect both upper and lower respiratory tract tissues. 7, 8 classical serotypes (hrv-1 to 100) or "strains", the term we use to indicate a molecular equivalent, form two accepted species within the heavily populated genus enterovirus, family picornaviridae. despite the considerable economic burden of hrv infections, 9 deliberate and comprehensive investigation of strain-specific clinical data is lacking. in 2006 we proposed that a clade of divergent sequences belonged to a novel viral subgroup, hrv-a2, 10 which we later redefined 11 as a putative third species, hrv-c, in agreement with lau et al. 12 to date, nine complete polyprotein sequences of hrv-c strains have been determined from australia (hrvc-qpm 10 hrvc-ny074 14 ) , hong kong (hrvc-c024, hrvc-c025 and hrvc-c026 12 ) and shanghai (hrvc-n4 and hrvc-n10 15 ). many hrv strains have distinct genetic, antigenic, immunogenic and epidemiologic profiles which are similar in nature to those of other respiratory virus species including human respiratory syncytial virus (hrsv). the prospect of variation in sensitivity to antivirals is also an important reason to investigate each novel strain comprehensively, as is the chance that infection by specific hrv species could be associated with more severe illness or particular pre-existing conditions. disappointingly, the possibility that discrete hrv strains exist as distinct viral entities is not accounted for in asymptomatic control populations because strain identification is not routinely conducted. as a consequence elevated prominence is, by default, assigned to hrvs as if to a single virus. we sought to genomically characterize hrv-qce, an apparently distinct hrv-c strain whose novel subgenomic sequences were first detected in a child with exacerbated asthma and to define distinct molecular features among the hrv-cs that are useful in discriminating strains for future studies and observe the clinical features amongst hrvc-qce positive patients. clinical specimens (n = 1247; three additions were made to the previously described hrvc-qpm population 10 ) were predominantly nasopharyngeal aspirates (npa; 93%) from patients (59% male) aged 1 day to 80 years (mean 9.2 years, median 1.3 years) presenting to queensland hospitals with symptoms of arti during 2003. extracts were stored and tested as previously described. 10 a clinical illness severity scoring system was applied as previously described. 11 this study was approved by the royal children's hospital and university of queensland medical research ethics committees (specific approvals #2006/097 and #2008/020 and #2007000004). primers for genome deduction were first designed using early hrvc-qce sequences in 1a/1b (eu131891 and eu155152). all oligonucleotide sequences are available upon request. additional primers supplemented the process. 10, 12, 16 to confirm our primary sequence belonged to a distinct virus and was not the result of mixed hrv template, a second round of rt-pcr and sequencing of overlapping fragments was performed on rna from the original patient specimen using newly designed hrvc-qce-specific primers. discrepant sequence results were confirmed by additional rounds of rt-pcr and sequencing. two specific diagnostic real-time rt-pcrs (rt-rtpcrs) were performed on the rotor-gene tm 3000 (corbett research) for diagnostic screening. polyprotein protease cleavage sites were sought using the net-picorna server. 17 cis-acting replication element (cre) sequences 18 were sought using the rnaalifold server and structures were predicted using mfold. 19 the polyprotein encoding sequence (genbank #gq323774) of hrvc-qce, a new member of the species human rhinovirus c, spanned 6423 nt; shorter than all hevs and hrvs except hrv-ny074. 14, 20, 21 it had a g + c content of 43% and 2140 predicted amino acids terminating in an hrv-c-specific isoleucine. 11 the hrvc-qce polyprotein shared 54% average amino acid identity with hrv-a strains, 50% with hrv-bs and 79% with other hrv-cs. ten protease cleavage sites were predicted to reduce the hrvc-qce polyprotein into typical picornavirus structural (vp1-4) and non-structural proteins (2a-c and 3a-d 17, 22, 23 ). hrvc-qce shared a translation initiation site (mgaqvs) with most other hrvs and three motifs crucial for rna polymerase binding (ygdd, tflkr and sirwt) shared by hrvs, and hevs 24,25 but lacked two of three exposed vp1 motifs previously conserved among hrv polyproteins 26 were absent in hrv-qce. phylogeny inferred from a discontinuous alignment of 10 amino acids in vp3 and vp1 which comprise the predicted intercellular adhesion molecule (icam)-1 footprint 27 in major group hrv strains, placed hrvc-qce amongst other hrv-cs on a branch with hrv-1 (a minor group hrv which employs a different receptor) but distinct from the known major (employing the icam-1 molecule as receptor) or remaining minor group hrv strains (fig. 1) . key residues on the vp1 bc loop involved in receptor contact with the vldlr 19 are missing in hrvc-qce and there are differences in the hi loop compared to the classical strains. antigenic site a 28 is absent in hrvc-qce and the sequence at site b is unique to hrvc-qce. as with other hrv-c strains identified to date, 18 the conserved loop sequence motif constituting a cre, r 1 nnna 1 a 2 r 2 nnnnnnr 3 was identified (gcucaagcaaauca) in 1b of hrvc-qce in the context of an appropriate predicted rna stem-loop structure (not shown). all classical hrv-a strains and 18/25 hrv-b strains are susceptible to the antiviral compound, pleconaril. among the 25 key contact residues lining the antiviral binding pocket, there were 11 or 12 hrvc-qce-specific differences compared to hrv-a or hrv-b consensus sequences, 29 respectively (fig. 2) ; 11 differences exist between hrv-as and bs and two differences between the consensus sequence of hrv-b sensitive versus resistant strains. changes at two hrvc-qce residues historically important for identifying naturally resistant strains were identified as tyr 152 (in resistant strains) to phe 152 and val 191 to thr 191 . his 245 , conserved in nearly all other classical hrv strains, varied in hrvc-qce and among other hrv-cs. other conserved hrv residues including ile/leu 106 and tyr/phe/ala 150, differed in hrvc-qce (fig. 2) . to examine whether hrvc-qce was a variant of a previously identified hrv strain, we first compared the full polyprotein against public sequence databases. the nearest matches were hrvc-c026 (93.5% identity, 2003 identical amino acids) and hrvc-qpm (92.9%, 1991 amino acids). the inferred amino acid sequences from complete 1d regions of eight hrvc-qce-positive extracts (variants 001-004, 006, 009, 010, 012; intra-strain amino acid identity, 99.5%; genbank accession number gq323774 and bankit numbers, 1304337, 1304336, 1304343, 1304341, 1304344, 1304335, 1304320) were compared to those from known hrv and hev serotypes and to previously described hrvc-qpm variants (n = 17; intra-strain identity of 99.8%; fig. 3 ). the amino acid identity between variants of the hrvc-qpm and hrvc-qce strains (91.2%) was lower than among variants of the two strains (≥99.5%). at least 93% polyprotein-length pairwise identity is also shared by 80% (n = 60) of antigenically distinct and officially recognised hrv-a strains (60 strains occur in at least one pairing in which sequence identity is ≥93%; hrv-8 and 95, hrv-1a and 1b and hrv-82 and sc were not considered discrete viruses). the hrvc-qce vp1 (272 aa) is 9-24 amino acids shorter than that of other hrv serotypes. the hrvc-qce residues aligning with the 10 residue icam-1 footprint differed by one from those of the most similar strain (hrvc-c026). in vp1, two of 6 amino acids from antigenic site b, four of 20 from the ef loop, one of 3 from the fg loop, two of 32 from the gh loop, three of 8 from the hi loop, one of 24 constituting the binding pocket and two of 48 nt in the 1b cre differed from the most similar hrv-c strain. since dq875928 = ny60). the complete polyprotein of most of these strains has not been described and for the one that has (hrvc-nat001), no additional variants were sought and only preliminary clinical studies were performed. hrvc-qce rna was detected in 1.0% (n = 13) of 1247 specimen extracts collected from january to december 2003 using a 1b targeted rt-rtpcr and confirmed by an assay targeting the 2c region. no control patients were sampled in 2003. hrvc-qce prevalence was bimodal with the major peak in summer when 3.5% of specimens were positive (7.6% of 119 specimens from february were positive representing 76.9% of all hrvc-qce positives and 16.1% of all virus detections (n = 56) that month). hrvc-qce was the only hrv detected in january. the remaining 23.1% of hrvc-qce positives were detected in winter (0.8% of specimens, peaking at 3.8% of all viral detections in june). no other viruses were detected in 61.5% (n = 8) of hrvc-qce positives (table 1 ) leaving five extracts in which another viral sequence was identified. respiratory picornaviruses were the most frequently detected virus at 40.9% of detections (n = 351) followed by hbov (11.8%, n = 101), hrsv (8.3%, n = 71) and hmpv (7.7%, n = 66). no viruses were found in 46.0% (n = 574) of extracts. isolation of hrvc-qce in culture was not attempted because of the age of the clinical specimens. chart review of the 13 hrvc-qce positive cases revealed presentation with lower respiratory tract illnesses (6/13; 46.2%), most commonly involving wheeze and administration of bronchodilators (table 1) . antibiotics were not usually given to wheezers compared to non-wheezers. eleven of the 13 cases (84.6%) were admitted to hospital and hrvc-qce was the sole detection in 61.5% (8/13) of patients. the average severity score among single hrvc-qce detections was higher (1.6) than that for co-detections (1.2) and was higher in summer (1.6) than in winter (1.0). average scores were highest among lower respiratory tract presentations (1.8) and scores of 0 were obtained from an upper respiratory tract illness and a cystic fibrosis patient with an hrsv co-detection. there were no adult cases, despite adults comprising 15.8% of the screened population. most (84.6%) patients were 2 years of age or younger. we have described the detection, polyprotein coding region and distinguishing genetic features of a newly identified and evidently genetically distinct hrv-c strain. we have summarised the clinical features of a predominantly pediatric population from whom hrvc-qce variants were detected. the relatively shortened genome with truncations and sequence diversity in the 1d capsid region may affect receptor usage, antigenicity and sensitivity to antivirals. phe 152 in vp1 is a distinctive feature of pleconaril resistant clinical hrv-b strains, 30 and was present in the vp1 of hrvc-qce as was thr 191 , which is found in both resistant and sensitive strains. the predicted hrv-c-specific cre motif in 1b, the terminal isoleucine, the comparatively elevated g + c content and other features we have previously defined, 11 identified hrvc-qce as a candidate for the proposed new species hrv-c. hrvc-qce appears to be a distinct global pathogen however no consensus molecular criteria exist which define strains or provide identity thresholds below which a clinical detection may be defined as a novel strain nor above which it may best be called a variant of a previously described strain. 11 the hrv literature notes infections which apparently have not elicited a cross-protective immune response as demonstrated by patients infected by distinct strains of the same or different species such over a defined period which share 62-93% amino acid identity in vp4. 12, 31, 32 these biological data together with strain-determining genetic criteria permit the proposal of a practical molecular threshold, for example ≤93% amino acid identity, that could be used as a surrogate to define the biological distinctiveness of hrvs that cannot be cultured. strain-defining criteria are especially useful to determine whether it is more accurate to consider "the hrvs" as a single group or as a collection of related but mostly antigenically discrete viruses, as is the norm for hrsv or hmpv for example. applying strain-defining criteria to control populations may very likely redefine our concept of the hrvs in asymptomatic illness, since the proportion of specimens positive for any distinct hrv strain in controls will be less than that which is positive for the hrv super-group when considered as a whole. approximately half of hrvc-qce detections were from patients with lower respiratory tract symptoms and 85% of hrvc-qce positives were detected from hospitalized children. hrvc-qce was the sole virus detected in over half of all cases. the paucity of sequence data, strain-defining criteria and clinical investigations of the novel hrvs or of individual classical strains parallel our limited knowledge of the extent and clinical impact of hrv diversity. the most recent significant healthcare impact attributed to hrvs was the 2009 h1n1v influenza pandemic when hrvs were the most common viruses detected among patients qualifying, but laboratory-negative for, pandemic virus testing. 33 similar findings were described during the sars-cov outbreak. 34 a lack of viral sequence data weakens our differential diagnostic and overall detection capabilities which limits our ability to define epidemiological features as well as the occurrence of strain-, or species-specific clinical outcomes and potentially differentiating genetic features. due to the retrospective nature of our study, no temporally comparable control population was available for testing. this is a limitation among most other hrv studies as is the current inability to culture the newly identified hrvs. when a control population is included however, strain typing is usually not conducted and so a higher proportion of asymptomatic illness is attributed to all hrvs as a total group. additionally, because we and others cannot fulfil koch's postulates for the currently unculturable hrv-cs, the clinical observations cannot be specifically associated with the pcr-determined presence of hrvc-qce rna. our findings highlight the need to better understand the genomics, taxonomy, epidemiology and clinical impact of the newly identified hrv strains to accurately quantify the scope of their clinical impact as distinct respiratory viruses. none. personal exposure to nitrogen dioxide (no2) and the severity of virus-induced asthma in children community study of role of viral infections in exacerbations of asthma in 9-11 year old children rhinovirus and respiratory syncytial virus in wheezing children requiring emergency care overview of virus-induced airway disease picornavirus infections: a primer for the practitioner viral etiology of common cold in children localization of human rhinovirus replication in the upper respiratory tract by in situ hybridization basal cells of differentiated bronchial epithelium are more susceptible to rhinovirus infection the cost of community-managed viral respiratory illnesses in a cohort of healthy preschool-aged children characterisation of a newly identified human rhinovirus, hrv-qpm, discovered in infants with bronchiolitis distinguishing molecular features and clinical characteristics of a putative new rhinovirus species, human rhinovirus c (hrv c) clinical features and complete genome characterization of a distinct human rhinovirus genetic cluster, probably representing a previously undetected hrv species, hrv-c, associated with acute respiratory illness in children pan-viral screening of respiratory tract infections in adults with and without asthma reveals unexpected human coronavirus and human rhinovirus diversity sequencing and analyses of all known human rhinovirus genomes reveals structure and evolution evidence of recombination and genetic diversity in human rhinoviruses in children with acute respiratory infection frequency and dynamics of recombination within different species of human enteroviruses cleavage site analysis in picornaviral polyproteins: discovering cellular targets by neural networks the cis-acting replication elements define human enterovirus and rhinovirus species x-ray structure of a minor group human rhinovirus bound to a fragment of its cellular receptor protein recombination in circulating human enterovirus b: independent evolution of structural and non-structural genome regions enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses human rhinovirus 2: complete nucleotide sequence and proteolytic processing signals in the capsid protein region the complete nucleotide sequence of a common cold virus: human rhinovirus 14 sequence analysis of human rhinoviruses in the rna-dependent rna polymerase coding region reveals within-species variation complete genomic sequencing shows that polioviruses and members of human enterovirus species c are closely related in the noncapsid coding region alignment of capsid protein vp1 sequences of all human rhinovirus prototype strains: conserved motifs and functional domains molecular characterization of human rhinovirus field strains isolated during surveillance of enteroviruses structure of human rhinovirus serotype 2 (hrv2) vp1 sequencing of all human rhinovirus serotypes: insights into genus phylogeny and susceptibility to antiviral capsid-binding compounds insights into the genetic basis for natural phenotypic resistance of human rhinoviruses to pleconaril recurrent human rhinovirus infections in infants with refractory wheezing clinical and molecular epidemiology of human rhinovirus c in children and adults in hong kong reveals a possible distinct human rhinovirus c subgroup a variety of respiratory viruses found in symptomatic travellers returning from countries with ongoing spread of the new influenza a(h1n1)v virus strain sars surveillance during emergency public health response mega3: integrated software for molecular evolutionary genetic analysis and sequence alignment we are grateful to patrick woo and susanna lau for primer and hrv strain sequences and to daniel gerlach for bioinformatics support. we thank pathology queensland central for the provision of clinical specimens.funding. this work was supported by an australian nhmrc project grant 455905. key: cord-307261-0a3iztns authors: hayden, randall t.; gu, zhengming; rodriguez, alicia; tanioka, lisa; ying, claire; morgenstern, markus; bankowski, matthew j. title: comparison of two broadly multiplexed pcr systems for viral detection in clinical respiratory tract specimens from immunocompromised children date: 2012-01-30 journal: j clin virol doi: 10.1016/j.jcv.2011.12.020 sha: doc_id: 307261 cord_uid: 0a3iztns background: the detection of viral respiratory tract infections has evolved greatly with the development of pcr based commercial systems capable of simultaneously detecting a wide variety of pathogens. objectives: evaluate the relative performance of two commercial broad range systems for the detection of viral agents in clinical respiratory tract specimens from immunocompromised children. study design: a total of 176 patient samples were included in the analysis, representing only the first sample collected for each patient, and excluding failed reactions. samples were de-identified and assayed in parallel using two different, broadly multiplexed pcr systems: resplex™ ii panel v2.0 (resplex), qiagen, hilden, germany and filmarray(®) respiratory panel (filmarray), idaho technology inc., salt lake city, ut. method comparison was based upon pair-wise concordance of results according to patient age, viral target and number of targets detected. results: the two systems showed an overall concordance, by patient, of 83.8% (p = 0.0001). filmarray detected at least one target in 68.8% of samples, while resplex detected at least one target in 56.8%. resplex failed to detect 20.7% of filmarray positives, and filmarray failed to detect 4% of resplex positives. the relative performance of each system (including which system detected a higher number of positive samples) varied when stratified by target viral pathogen. conclusions: broadly multiplexed pcr is an effective means of detecting large numbers of clinically relevant respiratory viral pathogens. viral respiratory tract infections can cause serious morbidity and increased mortality in immunocompromised pediatric patients. the rapid and sensitive detection of such agents has implications for treatment decisions, clinical care, and infection control practices. as in other areas of diagnostic virology, molecular diagnostic methods have shown promise in markedly improving diagnostic sensitivity when compared to culture or antigen detection assays. while such favorable performance characteristics have made molecular methods appealing, their introduction in the clinical laboratory has been slowed by issues related to cost and technical expertise required to perform this testing. early versions of such tests have focused on a limited number of pathogens, and typically detected only one or two viruses (or groups of viruses) at a time. [1] [2] [3] [4] [5] [6] [7] thus, detection of all clinically relevant entities has required running an entire panel of tests, compounding costs, and staffing requirements. the advent of broadly multiplexed assays has sought to address some of these issues. 8, 9 front-end multiplexed amplification (typically pcr) followed by detection is capable of identifying over 20 different targets. thus, a single assay utilizing the sensitivity of pcr can mimic the diagnostic spectrum of culture creating the potential for increasing routine detection beyond cultivable viruses, reducing processing costs, staffing requirements, and turn-around time. this technology also offers the possibility of increased ability to detect multi-viral infection. while the clinical importance of such capabilities is presently uncertain, this may carry important prognostic or infection control related implications, particularly among immunocompromised patients, such as those studied here. a number of different methodologies have now been proposed or marketed that use such an approach; however, limited published studies have compared different broadly multiplexed systems to one-another. in the current study, we compared two such systems to each other and to a panel of real-time pcr assays targeting individual viruses. technologies evaluated included the resplex ii panel v2.0 (resplex), qiagen, hilden, germany and the filmarray respiratory panel (filmarray), idaho technology, inc., salt lake city, ut. both products used for this study were for research use only (ruo). the filmarray product has only recently become available as an fda-cleared assay, and at the time of this submission few studies have been published examining performance of this method using clinical respiratory tract specimens. two broadly multiplexed pcr systems were compared to each other and to a panel of laboratory developed tests for the detection of respiratory viral pathogens in clinical respiratory tract specimens from pediatric immunocompromised children. samples were collected prospectively, as part of routine clinical care at st. jude children's research hospital (sjcrh) between january 13 and may 4, 2010, from children presenting with signs and symptoms of upper respiratory tract infection. results from patients 19 years of age and above were excluded from the analysis. the sjcrh institutional review board (irb) classified this study as non-human research; the study was exempted from irb approval and informed consent requirements were waived. samples consisted of bronchoalveolar lavage (bal) specimens, nasopharyngeal swabs (nps), nasopharyngeal washes (npw), and tracheal aspirates (ta). unused samples remaining after routine diagnostic testing were de-identified and blinded prior to study inclusion. unique patient and sample identifiers were assigned to each sample in order to match the results obtained from the various methods being compared. samples were divided into two 0.5 ml aliquots where one was tested by the laboratory developed test panel(ldtp), which included the pro hmpv assay kit (gen-probe, san diego, ca) for detection of hmpv, at sjrch and the other was tested using the filmarray assay. left over sample from the clinical aliquot was then tested by the resplexii assay at diagnostic laboratory services (dls), aiea, hi. extraction was performed at sjcrh and nucleic acid was sent and stored frozen to dls until testing at this remote site. this collection, transport, and storage method was used to allow preanalytical standardization between the testing methods. a 50 l nucleic acid solution was extracted from 250 l of respiratory sample together with prior addition of rna and dna controls for ldtp test; a second 50 l nucleic acid solution was extracted from 250 l aliquots of the same respiratory sample without addition of the rna and dna controls, for respplexii testing. extractions were otherwise identical and were performed using the nuclisens ® minimag magnetic extraction system (biomérieux inc., durham, nc), per manufacturer's instructions. the rna control was purchased as a ready-to-use lyophilized beadcontaining a 1 kb armored synthetic nucleic acid (cepheid). the dna control was a plasmid constructed by inserting a 357-bp dna fragment of phocid herpesvirus type 1 gb gene into vector puc57 (designed in-house at sjcrh and manufactured at genscript corp., piscataway, nj). both controls were detected only in ldtp test. a panel of real-time pcr assays was developed to detect infa and infb, rsv, adenovirus, and parainfluenza viruses 1, 2, and 3 from respiratory specimens. the pro hmpv assay kit was also run as part of this panel. the assays utilized taqman chemistry and realtime pcr technology and were carried out on the smartcycler ii platform (cepheid, sunnyvale, ca). the molecular detection targets, primer and probe sequences are listed in table s1 . the resplex tm ii panel v2.0 uses a multiplex rt-pcr analysis to amplify and detect 18 respiratory viruses ( filmarray utilizes a prefabricated pouch containing lyophilized reagents. the sample is added directly to the pouch wherein specimen preparation, amplification, and detection all take place without further offline sample manipulation. 300 l of original sample was mixed with 500 l of filmarray lysis buffer. approximately 1 ml of hydration solution was added by syringe to the filmarray pouch through hydration solution inlet port and 300 l of sample/lysis buffer mix was added to the pouch through the sample inlet port. the pouch was then loaded on the filmarray instrument, with automated extraction, amplification, and data analysis; total run time, approximately 1 h (5 min hands-on time). quality of testing was assured by the inclusion of two rna process controls(pc) in each pouch (proprietary sequences, idaho technology). the rna process controls were carried through all stages of the test process from samples lysis to pcr and dna melt analysis. both controls had to produce positive results for validation of test results. filmarray detected viral targets: adenovirus, bocavirus, coronavirus 229e, hku1, nl63, oc43, enterovirus, hmpv, human rhinovirus, influenza virus types a and b, parainfluenza viruses 1, 2, 3 and 4, and rsv. the mcnemar test was used to compare the accuracy of all three tests; comparison was made in pair-wise fashion and exact methods were used when discordant cells had less than 20 observations. to reduce bias, only the first sample of each patient with multiple samples was included in the analysis. for purposes of analysis, patient age was divided into four different age groups based on years of age: ≤2, 3-5, 6-13, and 14-18. this was a paired study, pairwise comparisons being made between performance of filmarray and resplex, filmarray and ldtp, and resplex and ldtp. when targets differed between the systems under comparison, results were collapsed into the narrowest taxonomic category that encompassed both systems of a pair. results from individual samples in which the first run failed were excluded from the analysis. however, results from second run from consecutive samples in which the entire run failed were included in the analysis as it was assumed that a systematic or technologist error was most likely the cause for the failure of the entire run for the resplex system, a positive result was determined using a cut-off mean fluorescent intensity (mfi) of 200. a total of 440 samples were collected from 210 children during the study period. after excluding samples from patients aged 19 and above, samples obtained after the first collection, and failed runs, the total number of samples analyzed was 176; only a single sample was tested per patient. while there were no failures with the ldtp, the total number of failed runs by filmarray was 11 and with resplex was 15. the mean age of children with samples included in the analysis was 6.9 years, ranging from 2 months to 18 years. the vast majority of samples were npw with 167 samples (94.9%), followed by ta with 6 samples (3.4%), bal with 2 samples (1.1%) and one nps (0.6%). over 80% of tested samples came from children who were 13 or younger: samples from children two years or less accounted for 27.3% (48) of samples, between three and five years inclusive were 24.4% (43), between six and 13 were 32.4% (57), and 15.9% (28) of samples came from children aged between 14 and 18, inclusive. overall difference in detection of targets between filmarray and resplex was found to be significant (p < 0.0001). out of the 121 samples detected positive by filmarray, resplex did not detect a target for 20.7% (25) of samples, while filmarray missed 4% (4) of samples detected positive by resplex ( table 1 ). the total number of samples for which both systems agreed was 147 samples; 96 samples testing positive and 51 samples testing negative. after stratifying by different targets and target groups, differences were observed in the detection of coronavirus 229e (exact p = 0.0313), infa (exact p = 0.0313), enterovirus (p < 0.0001), and rhinovirus (p < 0.0001). analysis stratified by patient age showed that in ages 3-5, 83.7% of samples were positive by filmarray and of these, resplex missed eight samples (22.2%), p = 0.0391; likewise, age group 6-13, 63.2% of samples were positive by filmarray but resplex missed 19.4% (7), p = 0.0156 (table s2) . when positive results were stratified by the number of targets detected by filmarray, differences in detection were found to be significant in cases where the filmarray system detected one or two targets (table s3 ). in the 76 cases where filmarray detected one target, resplex did not detect 18 of those cases, p < 0.0001. resplex did not detect any targets in six samples of the 34 samples for which filmarray detected the presence of two targets, p = 0.0313. in these six samples, the targets not detected by resplex were rhinovirus (4), coronavirus hku1 (2), rsv (2), adenovirus (1), bocavirus (1), coronavirus oc43 (1), and enterovirus (1). analysis for this comparison included only viruses targeted by both systems. these target groups were: adenovirus, hmpv, infa, parainfluenza types 1-3, and rsv. there were no differences in the number of positives detected by either system over the other, either overall or when stratified by target (table 2) . differences in detection rate were not observed when data were stratified by age groups (table s2) . after stratifying by number of targets detected by filmarray, ldtp detected viruses in six samples that filmarray called negative (p = 0.0313); but ldtp did not detect targets in seven samples in which filmarray detected one target, p = 0.0156 (table s4 ). the percentage of samples detected positive by resplex (24.4%) was lower than that for the ldtp (34.7%). among the samples detected positive by resplex, ldtp did not detect 1.1% (2); resplex did not detect targets in 20 samples (11.4%) that were detected positive by ldtp, p = 0.0001. the only target group for which significant differences were observed was influenza a; ldtp detected 12 samples as positive for influenza a but resplex did not detect 50% of these p = 0.0313 (table 3) . when results were stratified by age group, significant differences were observed in samples taken from children aged 3 to 13 (table s2 ). resplex detected 50% less positives compared to ldtp in samples from children aged between 3 and 13; and 25% less in the remaining age groups, though these differences were not significant. differences in detection between resplex and ldtp were significant in samples where resplex did not detect any targets (table s4) . the introduction of multiplex molecular amplification assays for the detection of viral respiratory pathogens has improved the sensitivity of routine viral detection methods. the range of agents detected [10] [11] [12] has been expanded to include newly discovered and emerging respiratory viruses such as coronaviruses nl63 and hku1, human metapneumovirus (hmpv), and bocavirus. [13] [14] [15] [16] [17] [18] [19] the broadly multiplexed molecular approach studied here has the capability to detect and identify more viruses simultaneously than traditional methods (i.e. culture and dfa) and shows an increased detection rate for co-infections. 8, 9, [20] [21] [22] [23] [24] in the current study, coinfections were detected in the range of 1-26%, which is similar to other investigators. sanghavi et al. investigated both adult and pediatric patients, including organ transplants and found dual infections at 10.4% and triple at 1.3%. 25 in a 2003 study, guittet et al. reported a range of 5-40% in hospitalized children. 26 the clinical significance of detecting more than one virus is not clear, but calvo et al. reported multi-viral infections more frequently in hospitalized infants with respiratory tract disease (17.4%). these infections were also linked to higher fever, longer hospital stays, and more frequent use of antibiotics than single rsv infections. 27 in another study by semper et al. co-infection with hmpv and rsv revealed a tenfold increase in the relative risk for admission into the pediatric intensive-care unit for mechanical ventilation as a result of severe bronchiolitis. 28 there is little published data beyond this on the clinical significance of multi-viral respiratory tract infection, and no work specific to the importance of detecting >2 viruses. the findings here suggest that as broadly multiplexed pcr systems become more common, a new body of literature will need to be developed to address the relevance and implications of such findings for prognosis, treatment, and infection control. the current study, to our knowledge, is the first reported that compares the filmarray with the resplex ii v2.0 for the direct detection of viral agents in clinical respiratory tract specimens from immunocompromised children. the viral targets for the two systems were similar with previously noted exceptions. overall 29 even though both systems detected 40-50% more viruses than traditional methods, the filmarray detected significantly more viruses and mixed infections than the xtag rvp. in the current study, resplex detected less rsv, influenza type a, hmpv, and adenovirus than the filmarray. increased rsv detection by the filmarray was also noted by rand et al. compared to the xtag rvp. 29 adenoviruses were not typed in this study, but the reduced rate of detection by resplex may relate to the fact that it detects only subtypes b and e, compared to the filmarray which detects all subtypes. it was noteworthy that the detection rate for enterovirus and rhinovirus were inversely related when the two systems were compared to each other. furthermore, if the filmarray and resplex enterovirus/rhinovirus were added together in each case, they would be approximately equal in the total number of detections (78 vs. 72, respectively). this could be the result of crossover detection related to differences in the nucleic acid sequences between the two assays. rhinoviruses and enteroviruses show extensive genomic similarity, but yet can be very different in their phenotypic characteristics. 30 the self-contained nature of the pouch system used by the filmarray, where sample preparation, amplification, and detection take place in a closed system markedly reduces any risk for carry-over contamination between specimens. both the resplex ii v2.0 and the xtag rvp require external nucleic acid extraction followed by multiplexed amplification and detection using a liquid-phase array technology. this approach may carry a risk of carry-over contamination due to both additional sample manipulation and the lack of a closed system. the difference in nucleic acid extraction prior to amplification and detection, along with other variables, such as nucleic acid sequence variations and chemistry may also contribute to the differences in test performance. 31 specimen collection procedures can also contribute to a difference in the overall test performance for any molecular test. the use of oropharyngeal swabs, nasopharyngeal swabs, or nasopharyngeal washings showed multiplex real-time rt pcr detection rates of 54.2%, 73.3%, and 84.9%, respectively in a study by lieberman et al. 32 other investigators have shown similar differences with the use of different swabs and collection procedures. 33, 34 the performance of both traditional and molecular-based tests varies according to the age group studied. 35 however, generally the younger children tend to show a higher viral load than older individuals. in general, this observation may account for a more favorable performance between traditional and molecular-based testing in the younger age group. in the present study, both the film-array and the resplex exhibited similar viral detection in the ≤2 years age group. however, the filmarray outperformed the resplex in the 3-5 year and 6-13 year groups. the viral load may have been lower in the >2 years group, accounting for the overall increase in sensitivity for the filmarray. the material costs for most molecular testing are greater than for dfa and culture, but the overall benefit may depend upon the protocol involved and could result in an overall cost reduction as described by mahony et al. 36 the other aspect of the cost analysis is the actual labor time involved for the filmarray and resplex. in the current study, the hands-on-time for the resplex was approximately 1 h with a total time of 4 h for testing 24 samples. the filmarray involved only 5 min for handson-time with a total time of 1 h/sample. based on the one cartridge per machine design of the filmarray instrument, the throughput for filmarray is integrally related to the number of machines available in a given laboratory. so while laboratories that process less than one sample per hour would be able to take advantage of apparently improved turnaround time with filmarray, resplex is more accommodating of larger specimen loads. it would therefore take six filmarray instruments to meet the 4-h turnaround time of a full resplex run. likewise, the apparent labor-saving benefits of the film-array system apply primarily to low volume settings. although with practice, processing time might be less than the above stated 5 min per sample, total hands-on time for more than 15-20 samples might be expected to meet or exceed that of resplex. this study demonstrates the promise of automated, broadly multiplexed pcr systems for the detection of viral respiratory pathogens. such methods combine the exquisite sensitivity of molecular amplification with a breath of targets previously attainable only through the use of culture-based techniques. these operating characteristics, together with increasingly selfcontained, automated, and easy-to-use methods, bring us closer to the mainstream adaptation of molecular diagnostic testing, no longer limited to academic centers or reference laboratory settings. the widespread use of these powerful techniques will have implications for diagnosis, treatment, infection control, and resource utilization in the healthcare setting. funding for this study was supported in part by the american lebanese syrian associated charities, alsac and the anderson charitable foundation. reagents were kindly supplied by qiagen and idaho technology, inc. instrumentation for the filmarray process was provided by idaho technology, inc. development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses multiplex real-time pcr assay for detection of influenza and human respiratory syncytial viruses use of a multiplex real-time pcr to study the incidence of human metapneumovirus and human respiratory syncytial virus infections during two winter seasons in a belgian paediatric hospital multiplex real-time pcr for detection of respiratory tract infections evaluation of the prodesse hexaplex multiplex pcr assay for direct detection of seven respiratory viruses in clinical specimens evaluation of the hexaplex assay for detection of respiratory viruses in children rapid and sensitive method using multiplex real-time pcr for diagnosis of infections by influenza a and influenza b viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4 development of a respiratory virus panel test for detection of twenty human respiratory viruses by use of multiplex pcr and a fluid microbead-based assay multicode-plx system for multiplexed detection of seventeen respiratory viruses multiplex pcr and emerging technologies for the detection of respiratory pathogens detection of respiratory viruses by molecular methods nucleic acid amplification-based diagnosis of respiratory virus infections cloning of a human parvovirus by molecular screening of respiratory tract samples human metapneumovirus infections in young and elderly adults metapneumovirus and acute wheezing in children human metapneumovirus: a newly emerging respiratory pathogen a newly discovered human pneumovirus isolated from young children with respiratory tract disease identification of a new human coronavirus characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia a novel multiplex real-time rt-pcr assay with fret hybridization probes for the detection and quantitation of 13 respiratory viruses evaluation of commercial resplex ii v2.0, multicode-plx, and xtag respiratory viral panels for the diagnosis of respiratory viral infections in adults immunofluorescence versus xtag multiplex pcr for the detection of respiratory picornavirus infections in children viral and atypical bacterial detection in acute respiratory infection in children under five years comparison of the eragen multi-code respiratory virus panel with conventional viral testing and real-time multiplex pcr assays for detection of respiratory viruses clinical evaluation of multiplex real-time pcr panels for rapid detection of respiratory viral infections rhinovirus and acute respiratory infections in hospitalized children retrospective study multiple simultaneous viral infections in infants with acute respiratory tract infections in spain dual infection of infants by human metapneumovirus and human respiratory syncytial virus is strongly associated with severe bronchiolitis comparison of two multiplex methods for detection of respiratory viruses: filmarray rp and xtag rvp new complete genome sequences of human rhinoviruses shed light on their phylogeny and genomic features real-world comparison of two molecular methods for detection of respiratory viruses identification of respiratory viruses in adults: nasopharyngeal versus oropharyngeal sampling pooled nasopharyngeal and oropharyngeal samples for the identification of respiratory viruses in adults development and evaluation of a flocked nasal midturbinate swab for selfcollection in respiratory virus infection diagnostic testing performance of diagnostic tests to detect respiratory viruses in older adults cost analysis of multiplex pcr testing for diagnosing respiratory virus infections r. hayden has served as a consultant for idaho technology. other authors have no competing interests to report. the study was classified as non-human research; study was exempted from irb approval and informed consent requirements were waived. supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jcv.2011.12.020. key: cord-329052-jan20ljs authors: gombar, saurabh; chang, marcello; hogan, catherine a.; zehnder, james; boyd, scott; pinsky, benjamin a.; shah, nigam h. title: persistent detection of sars-cov-2 rna in patients and healthcare workers with covid-19 date: 2020-05-30 journal: j clin virol doi: 10.1016/j.jcv.2020.104477 sha: doc_id: 329052 cord_uid: jan20ljs background: current guidelines for returning health care workers (hcw) to service after a positive sars-cov-2 rt-pcr test and ceasing of transmission precautions for patients is based on two general strategies. a test-based strategy that requires negative respiratory rt-pcr tests obtained after the resolution of symptoms. alternatively, due to the limited availability of testing, many sites employ a symptom-based strategy that recommends excluding hcw from the workforce and keeping patients on contact precautions until a fixed period of time has elapsed from symptom recovery. the underlying assumption of the symptom-based strategy is that waiting for a fixed period of time is a surrogate for negative rt-pcr testing, which itself is a surrogate for the absence of shedding infectious virus. objectives: to better understand the appropriate length of symptom based return to work and contact precaution strategies. study design: we performed an observational analysis of 150 patients and hcw that transitioned from rt-pcr sars-cov-2 positive to negative over the course of 2 months at a us academic medical center. results: we found that the average time to transition from rt-pcr positive to negative was 24 days after symptom onset and 10 % remained positive even 33 days after symptom onset. no difference was seen in hcw and patients. conclusions: these findings suggest until definitive evidence of the length of infective viral shedding is obtained that the fixed length of time before returning to work or ceasing contract precautions be revised to over one-month. that waiting for a fixed period of time is a surrogate for negative rt-pcr testing, which itself is a surrogate for the absence of shedding infectious virus. objectives: to better understand the appropriate length of symptom based return to work and contact precaution strategies. we performed an observational analysis of 150 patients and hcw that transitioned from rt-pcr sars-cov-2 positive to negative over the course of 2 months at a us academic medical center. we found that the average time to transition from rt-pcr positive to negative was 24 days after symptom onset and 10% remained positive even 33 days after symptom onset. no difference was seen in hcw and patients. these findings suggest until definitive evidence of the length of infective viral shedding is obtained that the fixed length of time before returning to work or ceasing contract precautions be revised to over one-month. health care workers (hcw) who test positive for sars-cov-2 via reverse transcriptase pcr (rt-pcr) of nasopharyngeal swab (np) specimens are asked to self-quarantine and only return to work after symptoms resolve and/or a fixed duration of time has passed. similarly, hospitalized patients with covid-19 are subject to transmission-based precautions to limit nosocomial spread. the cdc provides guidance for hcw to return to work, and for j o u r n a l p r e -p r o o f discontinuation of transmission-based precautions in hospitalized patients, for confirmed or suspected covid-19 infection 1 . both of these guidelines, last updated on april 30th, offer two strategies to proceed with routine processes. a test-based strategy requires two consecutive negative respiratory rt-pcr tests obtained after the resolution of symptoms. alternatively, due to the limited availability of testing, a symptom-based strategy recommends excluding hcw from the workforce and keeping patients on contact precautions until at least 3 days after symptomatic recovery, and at least 7 days since initial symptom onset. the underlying assumption of the symptom-based strategy is that waiting for a certain period of time is a surrogate for negative rt-pcr testing, which itself is a surrogate for the absence of table 1) . for the patients, the average age was 57.2 years (standard deviation 21.7), with 48.7% female. our study, and similarly all studies based on rt-pcr analysis do not directly measure infectivity. our analysis could be overestimating the length of infectious spreading by detecting non-infectious viral shedding. large trials that rely on methods that detect the infective virus (ie viral culture) have not yet been reported in the literature. until such studies are completed we suggest that return to work and contact precaution guidelines should require negative pcr tests or assume viral shedding for 33 days following symptom onset. declarations of interest: none'. tables: table 1 : selected demographics of patients and healthcare workers. covid-19) positive rt-pcr test results in patients recovered from covid-19 a case of a readmitted patient who recovered from covid-19 in chengdu serial ct features in discharged covid-19 patients with positive rt-pcr re-test emergency use authorizations. u.s. food and drug administration comparison of the panther fusion and a laboratory-developed test targeting the envelope gene for detection of sars-cov-2 prolonged persistence of sars-cov-2 rna in body fluids dynamic profile of rt-pcr findings from 301 covid-19 patients in wuhan, china: a descriptive study none. key: cord-308921-lpcjhxvg authors: stellrecht, kathleen a.; cimino, jesse l.; wilson, lisa i.; maceira, vincente p.; butt, shafiq a. title: panther fusion® respiratory virus assays for the detection of influenza and other respiratory viruses() date: 2019-11-09 journal: j clin virol doi: 10.1016/j.jcv.2019.104204 sha: doc_id: 308921 cord_uid: lpcjhxvg background: nucleic acid amplification tests (naats), such as pcr, are preferred for respiratory virus testing, due to superior diagnostic accuracy and faster turnaround time. panther fusion® respiratory assays (fusion), which includes flua/b/rsv (ffabr), paraflu and adv/hmpv/rv, offers a modular approach to syndromic testing on a fully automated platform while improving gene targets and expanding the test menu. objectives and study design: we evaluated fusion using 275 consecutive nasopharyngeal specimens previously used in an analysis of five pcrs, as well as 225 archived specimens. results: of the combined 500 specimens, 134 were positive for influenza a (flua), 54 for flub, 65 for rsv, 64 for parainfluenza (piv), 24 for adenovirus (adv), 21 for humanmetapneumovirus (hmpv), and 40 for rhinovirus (rv) with fusion. of the positive samples fusion correlated with historical results for all but one, despite multiple freeze-thaws cycles of this collection. fusion was positive for an additional 33 samples, including 11 fluas, 7 rsvs, 3 piv3s, 3 adv, 6 hmpv and 3 rvs. these samples were retested with corresponding prodesse (pro) assays using quadruple sample volume. this resolver test confirmed fusion results for an additional 4 fluas, 4 rsvs, 1 piv3 and 3 advs. the sensitivity and specificity ranges of fusion were 99–100% and 98–100%. limit of detection (lod) analyses were performed on a variety of flu isolates. the lods ranged from 2.69 to 2.99 log copies/ml and demonstrated superior lod as compared to previously published data for some assays or to concurrent analyses with two new commercial tests. respiratory tract infections (rti) are common and are associated with significant health burden. the major viral agents of rti include flua/b, rsv, hmpv, piv1-4, adv, and rv. the spectrum of diseases associated with viral infection of the upper and lower respiratory tract include the common cold, otitis media, influenza-like illness, croup, bronchiolitis and pneumonia; all of which can be caused by any one of these viruses, leading to diagnostic limitations based on symptoms alone. rapid identification is important for both therapeutic and infection control purposes. traditional rapid diagnostics, such as immunoassays, produce quick results and are simple to perform but have sub-optimal sensitivity (reviewed in [1] ). naats, which are rapid and have enhanced sensitivity, are considered the method of choice by many and are recommended by idsa guidelines [2] [3] [4] . however, performance differences have been observed among commercial naats, particularly after 2014 when sequence divergence in the matrix gene of a(h3n2) viruses emerged [5] [6] [7] . especially problematic was a c163 t mutation that was first observed among 3c.2a clades of a(h3n2) [8] [9] [10] . commercial assays with significantly reduced sensitivities after the c163 t mutation emerged, included prodesse proflu+ (pflu) and xpert® flu (xpt). the panther fusion® respiratory virus assays on the fully-automated panther fusion® system include the flu a/b/rsv, paraflu, and adv/hmpv/rv (table 1 ). this new system from hologic has redesigned amplification reactions as compared to pro. the flua component still targets the matrix gene, but it uses a dual target approach with multiple probes for added redundancy to help safeguard against genetic drift. both flub and rsv now target the matrix gene and the adv hexon gene target is designed to detect all adv genotypes. the gene targets for hmpv and piv 4 are the nucleocapsid genes, while those for piv [1] [2] [3] and rv are the hemagglutinin-neuraminidase region and the 5′ utr, respectively. this test system also expands the menu of virus detected with the inclusion of a rv and piv4. this study looks at the performance of the panther fusion® respiratory virus panels on a collection of samples that were previously analyzed with five other respiratory virus assays [7] , to effectively enable a comparative analysis. this population set was also highly representative of the a(h3n2) clade (3c.2a), truly challenging any flua assay. clinical specimens included 275 consecutive nasopharyngeal swab specimens, in 3 ml of viral transport medium, received into the laboratory for the detection of respiratory viruses during a 2-week period in the winter of 2015 (age range 22 d to 93 yr., median 25 yr., 45% pediatric cases, table s1 ). these specimens were previously used in a prospective analysis of pflu and pfast (hologic, san diego, ca), filmarray respiratory panel 1.7 (rp, biofire, salt lake city, ut), and cobas® influenza a/b test (ciab, roche diagnostics, indianapolis, in) specifically for the detection of flua. subsequently, xpt (cepheid, carlsbad, ca) was analyzed retrospectively. specimens were stored at -80°c, after original testing with pflu/pfast (49%) or rp (51%), thawed for ciab and rp or pfast testing, frozen at -80°c, thawed and frozen for xpt testing. some were frozen and thawed additional times for previous discrepancy analysis. they were again thawed for testing by fusion. selected archived samples positive for respiratory viruses (n-225), previously tested by various combinations of naats, were analyzed. clinical specimens containing low ct values on fusion (presumably high titers) of rsv, piv1, piv3, hmpv, adv, and rv were serially diluted for endpoint comparison of fusion with the appropriate pro assays (pflu, pfast, proparaflu+, proadeno+, or pro_hmpv+, hologic) except for the rv sample which was compared with rp2. fusion assays (hologic) were performed on the fully automated panther fusion® with continuous, random access. this instrument utilizes universal nucleic acid extraction and pcr chemistry. the assay specific reagents are available in ready to use reagent cartridges. initially, 500 μl of specimen was added to a panther fusion specimen lysis tube containing 750 μl buffer and 360 μl of the mixture is used for an extraction. the nucleic acid was subsequently eluted into 50 μl and 5 μl were amplified for an effective sample volume tested of 14.4 μl. lod studies were expanded to newer tests kits, rp2 and cepheid xpert® xpress flu (xpress), both of which have been marketed as having improved sensitivities among currently circulating strains of influenza. testing was performed in accordance with the manufacturer's package insert. specimens were considered true positive (tp) using a composite reference standard (crs) defined as positive with previously published results [11] . samples equivocal for flua with rp were considered positive by that test method. the resolver test involved a modification of pro assays to enhance the analytical sensitivity. specifically, viral rna was extracted from 0.4 ml of specimen (twice the normal volume) using the easymag extractor (biomérieux, durham, nc) and eluted to a volume of 25 μl. rna extracts, 5 μl (effective sample volume tested of 80 μl), were amplified with the appropriate pro assay on smartcyclers (cepheid). sensitivities, specificities, and confidence intervals (ci) were determined using microsoft excel 2016 (redmond, wa) [11] . probit analyses for the limit of detection with a 95% probability of detection were performed using spss version 8.0 (ibm, armonk, ny). the performance of fusion was first evaluated using 275 consecutive nasopharyngeal specimens collected during the peak of the influenza season in january-february 2015. this sample set was previously used in a prospective analysis for ciab, pflu/pfast, rp and xpt. the incidence of flua in this population was previously considered to be 24%, exclusively a(h3n2), with 66 true positive cases. even though this collection of specimens has been used in multiple studies and has gone through multiple freeze-thaws cycles, ffabr was flua positive for 65 of the tp cases ( table 2 ). the one false negative sample was previously positive by rp only. ffabr was positive in an additional 10 samples which were previously negative by other methods. the 10 additionally positive samples were analyzed with a resolver test which involved analyzing quadruple the initial specimen volume for testing by pfast, resulting in an additional 4 t p specimens. as a result of reclassification after resolver testing, the incidence of flua in the sample set was now 25%. the sensitivity and specificity of ffabr for the detection of a(h3n2) circulating in 2015 were 98.7% and 97.1%. this sample set was also positive for multiple other viruses, including rsv (55), piv2 (1), piv3 (10), adv (7), hmpv (8) (17), hmpv (7), and rv/ev (20) , as well as 25 samples negative for all fusion detectable viruses but positive for either coronaviruses or atypical bacteria (table 3) fusion correlated with all historical positive results except 6 samples negative with fusion rv but positive for ev/rv by rp. these six samples were tested by our lab developed assay for ev and were positive, excluding them as false negative cases. fusion had 29 positive test results not detected by another method, including 1 more flua, 7 rsv, 3 piv3, 3 adv, 6 hmpv and 3 rv. these samples, except the 3 positive for rv, were analyzed by the appropriate resolver tests, which confirmed fusion results for 4 rsv, 1 piv3 and 3 adv. the sensitivity of fusion ranged from 99 to 100% for the various viruses and the specificity ranged from 98% to 100% (table 4 ). because previous studies demonstrated flua assay performance variations can be strain associated, we performed lod analyses with six isolates of flu. we also included rp2 and xpress in this analysis as these assays were new to market and considered to have improved viral strain coverage. fusion demonstrated excellent analytical sensitivity with low lods ranging from 2.69 to 2.99 log copies/ml ( table 5 ). the lods were highly consistent across the strains and clades of flua. the assay was highly reproducible with coefficient of variances ranging from 0.5 to 4.2% across the dilutions (data not shown). rp2 and xpress demonstrated improved analytical sensitivity and consistency as compared to the manufacturer's previous test systems. however, the lods were still relatively higher, particularly with newly circulating a(h3n2) subclades. to assess differences in analytical sensitivity for the other fusion targets versus pro or rp, clinical specimens containing rsv, piv1, piv3, hmpv, adv, and rv were serially diluted for endpoint comparison. fusion was positive for an additional 10-fold dilution for rsv, piv3, and adv and two 10-fold dilutions for hmpv, while the endpoint positivities were similar between fusion and pro or rp for piv1 and rv (data not shown). since their introduction, there have been numerous studies regarding the performance of naats for respiratory virus detection, whether multianalyte panels or flu or flu/rsv specific, as various systems came on the market to fill individual niches and needs (reviewed in [12] ). prodesse assays had always been thought of as a necessary comparator system, if not the gold standard [13] [14] [15] [16] [17] [18] . but flua target failures became common with a(h3n2) subclades that emerged in 2013 [7, 9] . in fact, since 2014 most all circulating a(h3n2) viruses had m1 gene mutations which significantly affected the sensitivities of pflu and xpt. as a result, many manufacturers modified their systems to enable expanded clade coverage. indeed, hologic uses influenza redundancy in the design of the panther fusion flua/b/rsv assay. our sample populations offered a unique opportunity to challenge the performance of fusion with a(h3n2) samples containing the highly problematic c163 t mutation in the m1 target region [6, 7] , as well as evaluate the performance among historic clades and strains of virus. furthermore, many of these samples have been used in previous analyses of other systems, effectively enabling a multisystem analysis. in a recent study by banerjee et al. [19] , ffabr was compared to 5 flua/b pcrs, including ciab and rp. however, this study involved selected pediatric specimens collected over five respiratory virus seasons, as opposed to all specimens received within a period of high incidence, which is a better challenge of test sensitivity. in addition, pediatric cases are known to have higher viral titers, which also poses less of challenge with regards to test sensitivity. as a result, the sensitivities of all assays with this contrived population were comparable. interestingly, in our study, fusion was positive for all but one virus previously detected in these samples, even though this collection has been used in multiple studies and has gone through multiple freezethaw cycles. there were 12 additional fusion positive samples, which were confirmed true positive by analysis on pro using higher sample input volumes. indeed, the need for more sensitive methods for discrepancy analysis for fusion has been demonstrated by others [20] . this leaves 21 samples not confirmed by a different method. it is not clear if this phenomenon is due to the greater analytic sensitivity of fusion or due to true false viral detection. the superior analytical sensitivity was demonstrated in the lod and endpoint dilution studies, in addition to the fact that the test performed exceptionally well with highly compromised samples in terms of specimen handling for maintaining viral rna titers. indeed, it appears the fp samples had much lower virus titers, as demonstrated by ct values (supplemental figure 1) ; hence, a system with superior analytical sensitivity would demonstrate better performance with such specimens. furthermore, the additional positive viruses were only observed in samples collected during periods of high viral prevalence, for example during the 2-week period of 25% flua incidence. false positive detection or signal would be a random event and be equally evident at periods of low viral incidence. it is also important to point out that 3 f p samples were due to rv and unfortunately, we only had one other system available in our lab to test for rv. hence, there was no true referee of the difference in the two systems. although this manuscript was not a reanalysis of ciab, pro, rp, and xpt, the reclassification of some samples as tp would result in changes in the sensitivities and specificities of these other test systems. in particular, for the consecutive samples from 2015, the specificities of these other assays would improve to 100% from our previous publication [7] . however, the sensitives would decrease by 4 to 10%. it is also important to point out the choice of reference method in the absence of a gold standard has a significant impact on test performance. if this study involved submission of a diagnostic test to the food and drug administration (fda), a majority criteria would be required for a non-reference standard and a resolver test would not be allowed for the determination of positive and negative agreement, so as to prevent the introduction of bias in favor of the new test [21] . however, it is also known that this approach is biased against a new test with superior analytical sensitivity and in such situations a crs is recommended [11] . another limitation with this study is the fact that the resolver method does not test another target. however, our need was to have a resolver that more closely matches the lod of the fusion. having an assay with a low lod is not an easy feat; hence, it's not easily accomplished with another gene target for the sake of a less biased resolver. pro was chosen as the resolver because 1) it had lod lower than any of the other commercial assays [10] and 2) it can be modified to increase the effective testing volume. likewise, sanger sequencing which is often used as a resolver, it doesn't have a low lod. for example, hiv genotyping can only be performed on patients with viral loads of 1000 copies/ml. indeed, our lab was only able sequence the influenza matrix gene for samples with low ct values [10] . besides the exquisite sensitivity seen with fusion, the system has numerous other benefits (table 6 ). it is a fully automated, high throughput system with on-demand testing capabilities. the strategy used by hologic is for a modular approach to syndromic testing, with 3 respiratory assays for 10 targets. however, it is lacking subtyping for flua strains. another plus is that the reagents are stable on-board for up to 60 days; however, refrigeration is needed for assay cartridge storage. in summary, fusion offers exquisite sensitivity for the detection of respiratory viruses on a fully automated platform. there are many options for respiratory virus testing, each with their own niche. fusion appears to be the leader with regards to sensitivity, protections against genomic drift, while maintaining high throughput and minimal hands on time. reagents were provided by hologic, inc. (usa). the previously published study used for comparison was sponsored in part by roche diagnostics (usa). studies were performed in accordance with irb requirements at albany medical center. the authors' institution received several research grants from abbott molecular, bd, biomerieux, cepheid, hologic and roche diagnostics. dr. stellrecht received reimbursement of travel expenses for attending meetings and conferences from abbott molecular, hologic, quidel and roche diagnostics. lacks subtyping for influenza a strains modular approach to syndromic testing, the same extract can be used for 1 to 3 respiratory assays the storage capacity for the reaction tubes does not meet the needs of the maximum specimen capacity highly automated with little hands on time controls cannot be tested prior to specimen testing; at least one specimen or a blank must be tested concurrently on demand testing process up to 335 respiratory tests in 8 hrs. multiple pcrs and tmas on board; can run up to 12 different protocols at one time reagents stable on-board for up to 60 days. reagent and consumable tracking with advance warning if more is needed and when it is needed rapid antigen tests for influenza: rationale and significance of the fda reclassification update on influenza diagnostics: lessons from the novel h1n1 influenza a pandemic diagnostic accuracy of novel and traditional rapid tests for influenza infection compared with reverse transcriptase polymerase chain reaction: a systematic review and meta-analysis clinical practice guidelines by the infectious diseases society of america: 2018 update on diagnosis, treatment, chemoprophylaxis, and institutional outbreak management of seasonal influenza influenza a virus drift variants reduced the detection sensitivity of a commercial multiplex nucleic acid amplification assay in the season severe sensitivity loss in an influenza a molecular assay due to antigenic drift variants during the 2014/15 influenza season effect of genomic drift of influenza pcr tests incidence of matrix genes mutations affecting pcr tests among influenza h3n2 clades circulating during the 2014/15 season history of matrix genes mutations within pcr target regions among circulating influenza h3n2 clades over ten-plus-years the drift in molecular testing for influenza: mutations affecting assay performance methods and recommendations for evaluating and reporting a new diagnostic test molecular testing for respiratory viruses evaluation of three influenza a and b real-time reverse transcription-pcr assays and a new 2009 h1n1 assay for detection of influenza viruses comparison of the filmarray respiratory panel and prodesse real-time pcr assays for detection of respiratory pathogens evaluation of the cepheid xpert flu assay for rapid identification and differentiation of influenza a, influenza a 2009 h1n1, and influenza b viruses clinical accuracy of a plex-id flu device for simultaneous detection and identification of influenza viruses a and b influenza and respiratory syncytial virus detection in clinical specimens without nucleic acid extraction using focus direct disc assay is substantially equivalent to the traditional methods and the focus nucleic acid extraction-dependent rt-pcr assay comparison of three commercial rt-pcr systems for the detection of respiratory viruses comparison of six sampleto-answer influenza a/b and respiratory syncytial virus nucleic acid amplification assays using respiratory specimens from children evaluation of performance characteristics of panther fusion assays for detection of respiratory viruses from nasopharyngeal and lower respiratory tract specimens fda, statistical guidance on reporting results from studies evaluating diagnostic tests we thank the molecular diagnostics staff for their help with collecting respiratory specimens and performing original testing. this study was presented in part at the 2018asm clinical virology symposium. key: cord-326816-a7yovhvk authors: piralla, antonio; principi, nicola; ruggiero, luca; girello, alessia; giardina, federica; de sando, elisabetta; caimmi, silvia; bianchini, sonia; marseglia, gian luigi; lunghi, giovanna; baldanti, fausto; esposito, susanna title: enterovirus-d68 (ev-d68) in pediatric patients with respiratory infection: the circulation of a new b3 clade in italy date: 2018-01-12 journal: j clin virol doi: 10.1016/j.jcv.2018.01.005 sha: doc_id: 326816 cord_uid: a7yovhvk background: in recent years, several outbreaks due to enterovirus d-68 (ev-d68) have been reported, and it was confirmed that the virus can cause upper and lower respiratory tract diseases and be associated with the development of neurological problems. objectives: the main aim of this research was to study the genetic characteristics of ev-d68 strains that were circulating in italy identified during an outbreak of an ev-d68 infection that occurred in italy during the period march-october 2016. study design: a retrospective study of the circulation of different types and subtypes of ev-d68 was performed. nasopharyngeal swabs were collected from march 2016 through october 2016 in children admitted to the emergency room with respiratory diseases. results: among 390 children, 22 (59.1% males; mean age 47 months) were found to be infected by ev-d68 and most of them were immunocompetent (72.7%). pneumonia was diagnosed in 12 (54.5%) children. phylogenetic analysis of the vp1 region showed that all the strains identified in this study belonged to clade b3. within b3 subclade, the italian ev-d68 strains were most closely related to strains detected in southern china in 2015 as well as to strains detected in us and the netherlands in 2016. conclusions: these results showed that ev-d68 infections are a common cause of lower respiratory illness in pediatric age. the circulation of one ev-d68 lineage has been proven in italy and in the european region during 2016. however, further studies are required to investigate whether some strains or lineages may possess a higher affinity for the lower airway or central nervous system. human enterovirus d68 (ev-d68) was originally isolated in 1962, and for many years it was considered a rare cause of respiratory disease because it was identified in isolated cases and in small outbreaks [1] . although outbreaks of ev-d68 infection occurred in the philippines [2] , italy [3, 4] , the netherlands [5] and japan [6] between 2005 and 2012, it was only in 2014 that the virus gained epidemiological and clinical relevance. in that year, a large-scale outbreak of severe respiratory infections due to this agent, in some cases associated with central nervous system diseases, occurred in the usa and canada [7] , with subsequent cases in other countries [8] [9] [10] [11] [12] [13] [14] [15] [16] . since that period, several outbreaks in different continents have been reported, and it was confirmed that the virus can cause upper and lower respiratory tract diseases and be associated with the development of neurological problems, including acute flaccid paralysis (afp), encephalitis and aseptic meningitis [17] [18] [19] . phylogenetic analysis of ev-d68 strains detected worldwide has led to the identification of four distinct viral clades that are designated groups a-d according to the characteristics of the structural protein vp1, the most variable region of the ev genome [20] . moreover, within clades, subgroups were identified according to amino acid substitutions https://doi.org/10.1016/j.jcv.2018.01.005 in structural and nonstructural proteins. several studies have shown that these different clades and subgroups can circulate or co-circulate during different periods and be associated with both mild and severe diseases [21] . however, little is known about the molecular evolution of this virus during outbreaks, and it is not precisely defined whether specific genetic variances are responsible for the most severe cases. studies regarding the molecular phylogeny, diversity, and epidemiology of ev-d68 are essential to understanding the evolution of this virus and its adaptation to the human host. moreover, they can contribute to the development of effective preventive and therapeutic measures. the main aim of this research was to study the genetic characteristics of ev-d68 strains that were circulating in italy during the period march-october 2016. a retrospective study of the circulation of different types and subtypes of ev-d68 was performed. nasopharyngeal swabs collected from march 2016 through october 2016 in children admitted to the emergency room with respiratory diseases and stored in a freezer at −80°c were tested. the sample collection had occurred in the pediatric department of the fondazione irccs policlinico san matteo, university of pavia (italy) and in the pediatric highly intensive care unit of the fondazione irccs ca' granda policlinico, university of milan (italy). the ethics committees of both institutions approved the study. written informed consent was obtained from a parent of a legal guardian of each enrolled child. children aged ≥8 years were asked for their assent. clinical data were retrieved from archived clinical charts. respiratory samples were extracted using a qiasymphony ® instrument with a qiasymphony ® dsp virus/pathogen midi kit (complex 400 protocol) according to the manufacturer's instructions (qiagen, qiagen, hilden, germany). panels of laboratory-developed real-time rt-pcr or real-time pcr [22, 23] were used to detect and quantify the following viruses: influenza virus a and b (including subtype determination), human rhinovirus (hrv), human parainfluenza virus (hpiv) 3, respiratory syncytial virus (rsv) types a and b, human coronavirus (hcov)-oc43, -229e, -nl63, and -hku1, human metapneumovirus (hmpv) and human adenoviruses (hadvs). extracted samples were also amplified using ev-d68-specific real-time rt-pcr as previously described [24] . complete vp1 sequences were amplified for all ev-d68-positive samples according to the method of piralla et al. [4] . purified pcr products were sequenced using a bigdye terminator cycle-sequencing kit (applied biosystems, foster city, usa) in an abi prism 3130xl genetic analyzer (applied biosystems, foster city, usa). the sequences were assembled using sequencher software, version 4.6 (gene codes corporation, ann arbor, usa). sequence alignment and phylogenetic analysis were performed using the mega software, version 7 with the tn92 + g nucleotide substitution model, which was selected using the hierarchical likelihood ratio test [25] . statistical support of specific clades in the inferred tree was evaluated by using the bootstrap analysis (1000 replicates).the vp1 secondary structure was investigated using the jpred4 server [26] . the nucleotide dataset of the vp1 gene was obtained by including sequences from complete genome (n = 84), partial vp1 (n = 20) from the netherlands outbreak 2016 [27] as well as from ev-d68 strain sequences that were circulating in italy during the period 2008-2014 (n = 30). the ev-d68 sequences originated in this study were deposited in the genbank database (accession numbers: mf073335-mf073354). tests for positive selection were conducted using single-likelihood ancestor counting (slac), fixed-effects likelihood (fel), random-effects likelihood (rel), internal branch fixed-effects likelihood (ifel), the mixed-effects model of evolution (meme), and fast unconstrained bayesian approximation (fubar) on the datamonkey server [28] , with the dn/ds ratios being calculated using the slac and fel codon-based maximum likelihood approaches. slac counts the number of non-synonymous changes per non-synonymous site (dn) and tests whether it is significantly different from the number of synonymous changes per synonymous site (ds). fel estimates the ratios of non-synonymous to synonymous changes for each site in an alignment [29] . the ifel method is similar to fel but tests for site-by-site selection only along internal branches of the phylogeny. to avoid an excessive false-positive rate, sites with slac, fel, ifel and meme p-values of < 0.1 and a fubar posterior probability of > 0.90 were accepted as candidates for selection. samples obtained from 390 children, 270 from pavia and 120 from milan, were tested. twenty-two patients (13 males; 59.1%), mean age 47 months (range, 1-174 months) were found to be infected by ev-d68 ( table 1 ). the majority of cases (14/22; 63.6%) occurred in june (n = 9) and july (n = 5). the remaining cases were observed in april (n = 1), may (n = 2), september (n = 2), and october (n = 3). pneumonia was diagnosed in 12 (54.5%) children, whereas viral wheezing, rhinopharyngitis, asthma and bronchiolitis, were diagnosed in four children, three children, two children, and one child, respectively. the previous clinical history was negative in most of the cases (16/22; 72.7%). however, two (9.1%) children previously suffered from leukemia and had been recently transplanted with hematopoietic stem cells; 2 (9.1%) children had a history of recurrent episodes of viral wheezing; and 2 (9.1%) children had allergic asthma. the disease severity was judged to be mild-to-moderate in all the patients. lower than 92% oxygen saturation (sao 2 ) values at the first visit in the emergency room were found only in 5 (22.7%) children. hospitalization occurred in 19/22 (86.4%) children, with a mean duration of 4 days (range, 4-8 days). none of the patients had to be admitted to the intensive care unit. in 16/22 (72.7%) cases, ev-d68 was the only infectious agent detected in the respiratory samples. coinfection with human adenovirus (hadv) and with human rhinovirus (hrv) was detected in 4 (18.2%) and 2 (9.1%) of the children, respectively. in all these cases, coinfecting agents were detected in very low concentrations (almost all below 1.0 × 10 3 copies/ml). the median ev-d68 load observed was 1.3 × 10 5 rna copies/ml of respiratory sample (range, 9.0 × 10 2 -5.1 × 10 6 rna copies/ml of respiratory sample). no association was found between disease severity (measured by the sao 2 values) and ev-d68 load. the 368 samples negative for ev-d68 resulted positive for hrv (60.2%), rsv (26.6%), bocavirus (10.1%), hmpv (8.2%), and hadv (7.9%). in 48 (13%) cases, particularly when hrv was detected, coinfection between two viruses was evidenced. ten children with rsv infection, two with hmpv and one with hadv were hospitalized for severe disease and three of those with rsv required admission to the intensive care unit. complete vp1 sequencing was obtained for all the ev-d68-positive patients. phylogenetic analysis of the vp1 region showed that all the strains identified in this study belonged to clade b3, while ev-d68 strains circulating in italy in the period 2008-2014, highlighted in red, clustered in the others clades and subclades (fig. 1) . within b3 subclade, the italian ev-d68 strains were most closely related to strains detected in us and the netherlands in 2016 and southern china and japan in 2014-2015. the average nucleotide identity between italian ev-d68 subclade b3 strains was 98.9% (range, 96.9-100%), with a maximum of 21 nucleotides and 3 amino acid changes eight β-sheets (βb to βi) were predicted in the vp1 sequences by the jpred4 server. among b3 subclade were also clustered ev-d68 strains identified in japan and china between 2014 and 2015. in addition, the average nucleotide identity between ev-d68 subclade b3 strains and b1 and b2 subclade strains was 92.3% and 94.7%, respectively. inside the motifs corresponding to the bc and de loops, no changes were observed compared with other ev-d68 strains belonging to clade b1-3 (fig. 2) . the ev-d68 strains belonging to the new circulated b3 clade are characterized by 2 unique substitutions (a6g, s218t; fig. 2 ). codon 218 is included in the gh loop that is also involved in the sialic acid receptor binding site [30] . in addition, four strains harbored the i258 v mutation (highlighted with an asterisk in fig. 1 ) that was only present in the ev-d68 atcc strains (evd68/homo sapiens/xxx/atcc vr-1197; kt725431). one strain (ita/mi-esc128/2016) was characterized by the k256i change, which had never been previously observed. of note, one strain (ita/pv-38993/2016) was characterized by the e168k change. this mutation was also present in the fermon reference strain (ay4263531) but was more present in a few ev-d68 sequences belonging to all the three ev-d68 clades. to assess the signatures of evolution in the vp1 gene region, the overall dn/ds ratio was estimated as 0.08. several codons (more than 150) were identified to be under negative selection by at least three of the methods used (slac, fel, rel, fubar or meme). similarly, no positively selected codons were identified by the ifel model used to determine the selection pressure acting on the codons along the internal branches of the tree. this retrospective study did not test all the nasopharyngeal samples collected in children with respiratory symptoms during the period march-october 2016 in pavia and milan. consequently, no definitive data regarding the epidemiology and clinical relevance of this infectious agent in children could be drawn. however, the collected data enables the integration of available information regarding the circulation of and genetic differences among different ev-d68 clades and can help elucidate the molecular evolution of this virus. the four ev-d68 clades have exhibited a differing predominance in recent years. the italian ev-d68 strains identified in 2008 belonged to clade a and clade c. clade a was again identified in 2010, but in 2012, clade b became predominant [4] . during the 2014 ev-d68 epidemic in europe, most of the 205 sequenced viruses collected in 17 countries in the second semester of the year were found to belong to b1 and b2 clades, whereas a clades, although co-circulating, were detected in a smaller number of patients [31] . since april 2016, ev-d68 infection outbreaks have been reported in several european countries, particularly in northern europe [31] [32] [33] . phylogenetic analyses showed that these viruses belonged to the b3 lineage [32] . the same results were obtained with this study, suggesting that all the 2016 european outbreaks originated from a common source and that the b3 clade has emerged and become preeminent, eclipsing clades a and clades b1 and b2. the worldwide importance of clade b3 appears to be confirmed by the evidence that outbreaks of infections due to ev-d68 infection belonging to clade b3 have been reported in 2015 in china [34] , and almost simultaneously with the european epidemics, in the usa [35] . in most of the cases, ev-d68 was detected as a single infectious agent. moreover, when a coinfection was demonstrated, the co-infecting virus was found at a very low concentration, suggesting a bystander role. this result highlights the pathogenetic role of ev-d68, although a strict relationship between viral load and infection site or disease severity is not evidenced. the relatively low number of tested children with ev-d68 might explain this limitation. in this study, ev-d68 infections were diagnosed mainly in june and july and in pre-school children. these findings agree with those reported by other authors, who found a higher incidence of ev-d68 diseases in warm months and in younger subjects [36] [37] [38] [39] . however, in this study, differently from other viral infections, particularly those due to rsv, the ev-d68-related respiratory infections were all of mild or moderate severity, and no patients showed signs and symptoms of nervous system involvement. even when sao 2 levels were < 92%, the respiratory signs and symptoms rapidly subsided, and no patients were admitted to the intensive care unit. this result is in contrast to the findings reported by dyrdak et al. who, among the 74 patients with ev-d68 clade b3 infection they identified, observed ten cases with severe respiratory or neurological symptoms and one death [33] . knoester et al. also reported a high incidence of severe disease among children infected by ev-d68 [32] . these authors had to admit to the intensive care unit 13/17 (76.4%) of the children seen with respiratory disease. moreover, in one case, afp developed. by contrast, a child with ev-d68 b3 clade respiratory infections associated with acute flaccid paralysis has been recently described in italy, in the same region and in the same period of the cases reported in this study [19] . in the past, it has been proposed that the development of a severe clinical picture following ev-d68 infection is the consequence of mutations occurring in the virus. in a study in which ev-d68 b1 strains associated with afp cases diagnosed in the usa in 2014 were examined, 6 polymorphisms were identified and potentially associated with neuropathogenesis [40] . other viral variants were identified in ev-d68 strains associated with severe disease in taiwan [41] ; moreover, in this case, it was proposed that the variants were associated with the severity of ev-d68. however, these findings have not been completely confirmed by other studies [20, 42] . by contrast, based on our strains sequences analyses, no evidence of increased clinical severity associated with specific molecular signatures in vp1 sequences has emerged from the present study. further analysis on full-genome sequencing in a large cohort of positive patients with a well-define clinical syndrome could allow to correlated specific molecular signatures with clinical syndromes. based on adaptive evolution analysis, the overall dn/ds ratio (dn/ ds < 1) of the vp1 gene observed in this study was similar to those reported by lau et al. [43] although several amino acid changes have been observed in vp1 sequences the meaning of dn/ds ratio reveal a purifying (negative) evolution for the vp1 protein. in addition, in keeping with this report, no codons with a significant signal of positive selective pressure were detected in the vp1 gene. by contrast, the phylogenetic analysis showed how the genetic changes may have driven the emergence of a new lineage of ev-d68 during the last 2 years. in fact, the worldwide circulation of ev-d68 strains belonging to the b2 and b3 lineages might have evolved from a common ancestor originating in 2011-2012 [44] . recently, the evolutionary analyses performed on complete genome sequences have suggested that subclade b3 was not originated by a mutation occurred on subclade b1 strains. indeed, it has been suggested a distinct evolutionary origin for the new b3 subclade [45] . multiple clades of ev-d68 have worldwide circulated simultaneously between 2005 and 2014 [9] , while a predominance of one clade (subclade b3) has recently been observed. additional both epidemiological and molecular studies are needed to better clarify the reasons of this ev-d68 strain selection and widespread diffusion. it is interesting to note that the emergence of new ev-d68 lineages does not represent the circulation of a new virus. therefore, diagnostic real-time assays, designed in a well conserved region (5′ utr), are capable to detect all the new ev-d68 variants. in conclusion, ev-d68 infections have been confirmed as a cause of lower respiratory illness in pediatric age. the circulation of one ev-d68 lineage has been proven in italy as well as in the european region during 2016. however, further studies are required to investigate whether some strains or lineages may possess a higher affinity for the lower airway or central nervous system. in addition, the continuous global monitoring of the clinical and molecular epidemiology of ev-d68 should be improved to understand the factors determining possible spatiotemporal differences of ev-d68 infections. centers for disease control and prevention. enterovirus surveillance-united states enterovirus 68 among children with severe acute respiratory infection, the philippines human rhinovirus and human respiratory enterovirus (ev68 and ev104) infections in hospitalized patients in italy phylogenetic characterization of enterovirus 68 strains in patients with respiratory syndromes in italy emergence and epidemic occurrence of enterovirus 68 respiratory infections in the netherlands in 2010 amino acid changes in vp1 sequences according to different clades. amino acid residues characterizing clade b3 ev-d68 strains are indicated with black square. amino acids included in vp1 motifs corresponding to protein loops are highlighted with a dashed line. the gaps are indicated by a dash (−) and the conserved amino acid residues by a dot (.). numbering of amino acidic changes is according acute respiratory infections due to enterovirus 68 in yamagata outbreak of enterovirus d68 in north america enterovirus d68: a focused review and clinical highlights from the 2014 united states outbreak global reemergence of enterovirus d68 as an important pathogen for acute respiratory infections severe respiratory illness associated with enterovirus d68-missouri and illinois continued seasonal circulation of enterovirus d68 in the netherlands molecular epidemiology of enterovirus d68 from 2013 to 2014 in philippines genome sequence of enterovirus d68 and clinical disease genome sequence of enterovirus d68 from st louis enterovirus d68-associated severe pneumonia low-level circulation of enterovirus d68-associated acute respiratory infections a fatal central nervous system enterovirus 68 infection enterovirus-d68 in the cerebrospinal fluid of two children with aseptic meningitis acute flaccid myelitis associated with enterovirus-d68 infection in an otherwise healthy child molecular evolution and intraclade recombination of enterovirus d68 during the 2014 outbreak in the united states european surveillance for enterovirus d68 during the emerging north-american outbreak in 2014 phylogenetic patterns of human respiratory picornavirus species, including the newly identified group c rhinoviruses, during a 1-year surveillance of a hospitalized patient population in italy filmarray ® respiratory panel performance in respiratory samples from neonatal care units a new real-time reverse transcription-pcr assay for detection of human enterovirus 68 in respiratory samples mega7: molecular evolutionary genetics analysis version 7.0 for bigger datasets jpred4: a protein secondary structure prediction server datamonkey 2010: a suite of phylogenetic analysis tools for evolutionary biology not so different after all: a comparison of methods for detecting amino acid sites under selection sialic acid-dependent cell entry of human enterovirus d68 european surveillance for enterovirus d68 during the emerging north-american outbreak in 2014 outbreak of enterovirus d68 of the new b3 lineage in identification and whole-genome sequencing of four enterovirus d68 strains in southern china inlate complete genome sequences of nine enterovirus d68 strains from patients of the lower hudson valley enterovirus d68 in hospitalized children: sequence variation, viral loads and clinical outcomes clinical course of enterovirus d68 in hospitalized children enterovirus d68 infection among children with medically attended acute respiratory illness enterovirus d68-associated community-acquired pneumonia in the pediatric age group a novel outbreak enterovirus d68 strain associated with acute flaccid myelitis cases in the usa (2012-14): a retrospective cohort study molecular evolution and the global reemergence of enterovirus d68 by genome-wide analysis genetic divergence of enterovirus d68 in china and the united states enterovirus d68 infections associated with severe respiratory illness in elderly patients and emergence of a novel clade in hong kong global distribution and evolutionary history of enterovirus d68, with emphasis on the enterovirus d68 subclade b3 strain circulating and causing an outbreak in the united states in 2016 the authors declare that they have no potential conflict of interest. the ethics committees of fondazione irccs policlinico san matteo, university of pavia (italy) and the pediatric highly intensive care unit of the fondazione irccs ca' granda policlinico, university of milan (italy) approved the study. written informed consent was obtained from a parent of a legal guardian of each enrolled child. children aged ≥8 years were asked for their assent. key: cord-320156-xs936r6u authors: nunes, marta c.; kuschner, zachary; rabede, zelda; cutland, clare l.; madimabe, richard; kuwanda, locadiah; klugman, keith p.; adrian, peter v.; madhi, shabir a. title: polyomaviruses-associated respiratory infections in hiv-infected and hiv-uninfected children date: 2014-10-28 journal: j clin virol doi: 10.1016/j.jcv.2014.10.013 sha: doc_id: 320156 cord_uid: xs936r6u background: two recently discovered polyomaviruses (pyv), wu and ki, have been identified in respiratory-tract specimens from children with acute respiratory infections, although there are limited data in hiv-infected children. objectives: to determine the prevalence and clinical manifestations of wupyv and kipyv-associated lower respiratory tract infections (lrtis) hospitalization in hiv-infected and -uninfected children; and probe the role of pneumococcal co-infection. study design: nasopharyngeal aspirates were collected from a cohort of 39,836 children randomized to receive 9-valent pneumococcal conjugate vaccine (pcv9) or placebo when hospitalized for lrtis, and were screened by pcr for wupyv, kipyv and other respiratory viruses. results: in placebo-recipients the prevalence of wupyv was 6.3% (18/285) in hiv-infected and 13.9% (66/476) in hiv-uninfected children (p = 0.002). in wupyv-positive lrtis hiv-infected children had lower oxygen saturation at admission and a higher case fatality rate (11.1% vs. 0%; p = 0.04). kipyv was identified in 10.2% (29/285) of hiv-infected and in 7.4% (35/476) of hiv-uninfected placebo-recipients with lrtis (p = 0.13). hiv-infected compared to hiv-uninfected children with kipyv-positive lrtis had lower oxygen saturation, higher respiratory rate and longer duration of hospitalization. co-infections with other respiratory-viruses were detected in 65.5% of wupyv-positive lrtis and in 75.0% of kipyv-positive lrtis. among hiv-uninfected children, there was a lower incidence of hospitalization for clinical pneumonia episodes in which kipyv (80%; 95% ci: 41, 93) and wupyv (49%; 95% ci: 9, 71) were identified among pcv9-recipients compared to placebo-recipients. conclusions: polyomaviruses were commonly identified in hiv-infected and -uninfected children hospitalized for lrtis, frequently in association with other viruses and may contribute to the pathogenesis of pneumococcal pneumonia. lower respiratory tract-infections (lrtis) are a major cause of hospitalizations during childhood [1] . determining pathogen specific causality of lrtis is hampered by lack of sensitive methods for diagnosing bacterial pneumonia, as well as the concurrent identification of multiple respiratory-viral pathogens, particularly when using molecular assays [2] . nevertheless, worldwide studies attribute a large proportion of lrtis to viral infections [3, 4] . largescale molecular screening based technologies have contributed to the discovery of new infectious pathogens, including in 2007 two polyomaviruses (pyv), wu-and ki-polyomavirus [5, 6] . these pyv belong to the polyomaviridae family and have been associated with respiratory disease in humans, although direct evidence of causality is lacking [7] . two other polyomaviruses (bkpyv and jcpyv) have been implicated in disease in immunocompromised patients [8] [9] [10] . there are, however, conflicting data with regard to the role of wupyv and kipyv in immunocompromised individuals [11] [12] [13] . previous studies have used pneumococcal-conjugate-vaccine (pcv) randomized placebo-controlled trials (rct) as a probe to establish the probability of co-infections by streptococcus pneumoniae (pneumococcus) vaccine-serotypes and respiratory-virus in children hospitalized for pneumonia [14, 15] . the rational of this approach is that any biological-plausible difference between pcv-and placebo-recipients in the incidence of any disease which could be associated with vaccine-serotype pneumococcal infection would indicate a role of vaccine-serotypes in the outcome of interest (for review [16] ). for example, we have previously reported that pcv-recipients, had a 45% lower incidence of pneumonia hospitalizations in which influenza-virus was identified, and as such concluded that at least a similar proportion of the influenza-associated pneumonias among placebo-recipients was precipitated by co-infection with pcv-serotypes [14] . the aim of this study was to determine the burden and clinical features of wupyv and kipyv infections in hiv-infected and hiv-uninfected children hospitalized for lrtis. furthermore, as an exploratory analysis we used the design of a rct of a 9-valent pcv (pcv9) to probe whether pneumococcal co-infection may contribute to hospitalization for pyv-associated pneumonia. we analyzed respiratory specimens collected from children who participated in rct in south africa as previously described [14, 17] . briefly, 39,836 children were randomized (1:1) from 1998 to 2000 to receive 3 doses of pcv9 or placebo [17] . hospitalbased surveillance for all-cause hospitalization was undertaken, all hospitalized children underwent hiv testing [17] . nasopharyngeal aspirates (npas) were obtained from children hospitalized with lrtis for identification of selected respiratory-viruses [14] and archived from february 2000 onward. in this study only npas collected from february 2000 to january 2002 from children <2 years old were analyzed. if a child had recurrent lrti hospitalizations, only npas collected >28 days apart were included in the analysis. these samples had been previously investigated for respiratory syncytial virus (rsv), influenza a/b, parainfluenza viruses (piv) and adenovirus using immunofluorescence and for humanmetapneumovirus (hmpv) by nested-pcr, as described [14, 15] . archived npas were tested by real-time reverse transcriptase-pcr (rrt-pcr) using the primers and probes as described [18] . we tested for wu-and ki-polyomavirus, as well as for human-bocavirus (hbov), human-rhinovirus (hrv), and four human-coronaviruses (cov). a comprehensive overview of the identified individual viruses has been reported separately [18] . the current analysis details the epidemiology of wupyv and kipyv-positive lrtis in the study cohort. the clinical definitions used in this study have been described [14] . the analyses on the epidemiology of wupyv and kipyv in children hospitalized for lrtis were restricted to placebo-recipients in the context of the initial trial [17] . proportions were compared by chi-square or fisher's exact tests and continuous variables by student's t-test or mann-whitney test. regression analyses were performed to compare clinical features between hiv-infected and -uninfected children. multiple regressions were controlled for age at hospitalization, detection of a virus previously-tested and year of collection. in an exploratory analysis using the concept of vaccine-probe studies [14, 19] , we explored whether there was any association between pcv9 and the risk of hospitalization for lrtis in which wupyv or kipyv were detected by estimating vaccine efficacy (ve) based on the formula: incidence rate in the unvaccinated − incidence rate in the vaccinated incidence rate in the unvaccinated × 100 children were included in the per-protocol analysis if they received all the study-vaccines as per planned schedule and the lrti event occurred >14 days after the third dose of study-vaccine. only the first episode of viral detection was included in the ve calculation for an individual participant. p-values <0.05 were considered significant. analyses were performed using stata version 12.1 (college station, tx, usa). a total of 1460 npas were analyzed by rrt-pcr, including 699 from pcv9-recipients (48.8%) and 761 (52.1%) from placeborecipients [18] . wupyv was detected less frequently in hiv-infected (6.3%) compared to hiv-uninfected children (13.9%, p = 0.002) ( table 1) . one hiv-infected and three hiv-uninfected children had at least two episodes of wupyv-positive lrtis more than 28 days apart. among hiv-uninfected children, wupyv was generally detected concurrently with other respiratory-viruses (72.7%), which was at a higher frequency compared to hiv-infected children (38.9%, p = 0.005) ( table 1 ). the most common co-detected viruses were hrv (31.8%, n = 21), hbov (16.7%, n = 11), rsv (12.1%, n = 8) and hmpv (10.6%, n = 7) in hiv-uninfected children; and hrv (27.8%, n = 5) and kipyv (16.7%, n = 3) in hiv-infected children. by multivariate analysis of wupyv-associated lrtis, hivinfected compared to hiv-uninfected children were more likely to have oxygen saturation <90%, present clinicallyas pneumonia f other laboratory investigations assessed that were not significantly different between hiv-infected and hiv-uninfected children included: percentage of children presenting with c-reactive protein levels ≥40 mg/l or procalcitonin levels ≥2 ng/ml and mean white cell count. g streptococcus pneumoniae was isolated from one hiv-infected child and in two hiv-uninfected children in whom wupyv was detected. h bacteria isolated from hiv-infected children in whom kipyv was detected included: streptococcus pneumoniae (n = 3), escherichia coli (n = 2) and haemophilus parainfluenzae (n = 1). rather than bronchiolitis. pneumococci were isolated by blood culture in one hiv-infected child and two hiv-uninfected children with wupyv-associated lrti (table 1) . hiv-infected (11.1%) compared to hiv-uninfected children (0%, p = 0.04) had a higher case fatality rate (cfr). the two hiv-infected children who died were 13 and 15 months old, both presented with pneumonia and wupyv was the only respiratory-virus identified, neither had evidence of bacteraemia nor pulmonary tuberculosis and the one child tested for pneumocystis jiroveci (pcp) infection was negative (table 2) . kipyv was detected in 10.2% of the specimens available from hiv-infected and in 7.4% from hiv-uninfected children (p = 0.13) ( table 1) . recurrent kipyv-associated lrti episodes occurred in five hiv-infected children, including three children with two episodes each, one child with 3 episodes and one child with 5 episodes. there was a single hiv-uninfected child with two kipyv-positive lrtis. identification of kipyv was perennial, albeit uncommon during november and december 2001 (fig. 1) . there was a lower prevalence of kipyv detection in 2000 compared to 2001 among hiv-infected (6.6% [13/198] kipyv was frequently detected in combination with other respiratory-viruses in both hiv-infected (75.9%) and hivuninfected children (74.3%) ( table 1 ). in hiv-infected the most common co-detected viruses included hrv (51.7%, n = 15), wupyv and hmpv (10.3%, n = 3 each). in hiv-uninfected the most common viruses associated with kipyv were hrv (31.4%, n = 11), hmpv (14.3%, n = 5) and wupyv (11.4%, n = 4). hiv-infected compared to hiv-uninfected children with kipyvassociated lrtis were more likely to have oxygen saturation <90%, higher respiratory rate, longer duration of hospitalization (median [range]: 5.0 days vs. 1.0 day [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] ; p = 0.008) and were more likely to have alveolar consolidation on chest x-ray (cxr-ac) and concurrent bacteraemia (table 1) . pneumococci were isolated from three hiv-infected children. four hiv-infected (13.8%) and two hiv-uninfected (5.7%) children in whom kipyv was detected died during hospitalization. hiv-uninfected children with kipyv-associated lrti who died compared with those who survived were younger (3 vs. 12 months; p = 0.03). both hiv-uninfected children, aged 3 months, presented with pneumonia, had co-infections with other viruses and one child (who was malnourished) also had pcp infection (table 2) . of the four hiv-infected children who died, kipyv was the only respiratory-virus identified in two of them although at least one was co-infected with pcp. overall, five of the six children who died had indirect markers of bacterial infection, including three hiv-infected with raised c-reactive protein and procalcitonin levels (two of whom also had escherichia coli bacteraemia) and the other two (one hiv-infected and one hiv-uninfected) with cxr-ac ( table 2) . as an exploratory analysis the effect of pcv9-vaccination on the incidence of polyomavirus-associated pneumonia hospitalizations was evaluated. in fully vaccinated hiv-uninfected children, the incidence of wupyv-positive clinical pneumonia hospitalizations was 48.5% (95% ci: 9.1, 70.8) lower in children who received pcv9 compared to placebo-recipients (table 3) . a similar ve pointestimate was observed in cases restricted to episodes in which wupyv was the sole detected virus (45.4%, 95% ci: −47.6, 79.8). there were also reductions in the incidence of hospitalization for kipyv-associated clinical pneumonia in pcv9-recipients compared to placebo-recipients overall (51.3%, 95% ci: 14.5, 72.3) and specific in hiv-uninfected children (80.0%, 95% ci: 41.4, 93.2). similar reductions were observed when kipyv was the only identified virus (table 3) . no differences in incidence were observed between pcv9-and placebo-recipients in hospitalizations for wupyv-or ki-associated clinical pneumonia in hiv-infected children and in hospitalizations for wupyv-or kipyv-associated bronchiolitis. to our knowledge, this is the most detailed report on the prevalence and clinical features of lrtis where polyomaviruses were detected in hiv-infected and -uninfected children. among hospitalized hiv-infected children, wupyv was detected in 6% of the cases and kipyv in 10%. in hiv-uninfected children the prevalence of wupyv was 14% and of kipyv was 7%. in hiv-infected children 11-14% of the cases positive for at least one polyomavirus were fatal and in 67% (4 cases in total) of these wupyv or kipyv were identified as single-detections. our study also established a possible interaction between polyomaviruses and pneumococcus in hiv-uninfected children, although this may have been masked in hiv-infected children in whom pcv9-vaccination was demonstrated to be less efficacious against pneumonia [17] . wupyv was detected in 9% of respiratory samples from children presenting with upper or lrti in germany, 7% in south korea and south africa and 6% in thailand; kipyv has been identified in 1-6% of children presenting with respiratory-tract infections [12, 13, [20] [21] [22] . another study from south africa reported that 57% of 21 children with lrtis with wupyv and 33% of 3 with kipyv were hiv-infected, however, the hiv-status was unknown in 50% of the cases [12] . in that same study, both polyomaviruses were table 3 differences in incidence of wupyv and kipyv-associated lower respiratory tract infections between fully-immunized children who received 9-valent pneumococcal conjugated vaccine and placebo recipients; per-protocol analysis. absent among 50 healthy immunocompetent controls [12] . the role of wu/kipyv as more serious pathogens in immunocompromised individuals is uncertain. higher viral loads of pyv were documented in lymphoid tissues and in the brains of hiv-infected adults compared to those from immunocompetent individuals [23, 24] . similarly higher kipyv viral loads were found in respiratory-tract specimens from haematology/oncology paediatric patients with respiratory infections, however, whether the viral loads correlated with disease severity was not established [13] . these observations suggest that there may be more viral replication and/or that polyomaviruses might reactivate in immunosuppressed individuals, implying that t-cell impairment might be a factor in facilitating polyomavirus replication. norja et al. found that wu/kipyv detection on respiratory samples occurred predominantly in two groups of subjects: immunocompetent <2 years of age with lrtis (7%) in whom there was a high frequency of co-infection (75%), and among older, generally immunocompromised individuals without respiratory illness (11%) or with mild upper respiratory-tract infections (7%) [7] . although our study was not designed to establish whether polyomavirus infections caused more severe disease in hiv-infected children, among hospitalized children in whom polyomaviruses were detected hiv-infected were more likely to present with pneumonia rather than bronchiolitis, had a longer duration of hospitalization and higher cfr compared to hiv-uninfected children. similar observations have been detected between hiv-infected and hiv-uninfected children for other viruses [18] , and consequently may not necessarily infer causality for polyomaviruses precipitate more severe illness in hiv-infected children. the increased morbidity and mortality in hiv-infected children could have been related to other co-morbidities such as bacterial or other non-viral co-infections. in the absence of sensitive tools for diagnosing bacterial pneumonia, as well as lack of investigating for other non-viral causes of pneumonia, our study is unable to conclude the actual role of polyomaviruses to more severe disease in hiv-infected children. nonetheless, the higher cfr, as well as that four fatal cases with polyomavirus as the sole respiratory-virus detected were all hiv-infected children suggest a possible association of polyomavirus causing severe disease in hiv-infected. furthermore, five hiv-infected children had recurrent kipyv-positive lrtis compared to only one hiv-uninfected child. this could have been due to extended viral shedding, viral reactivation or reinfection. a study from germany detected kipyv dna in the respiratory-tract of an immunocompromised child for 7 months and hypothesized that a kipyv infection during childhood could result in latency of the virus in normal individuals, however, an immune impairment could result in viral reactivation [25] . in 2001 the detection rate of kipyv in hiv-infected children was higher than in 2000 this may be because of the older cohort in 2001, hence possibly different risk of infection, or differences in year-to-year epidemics. the concept of a vaccine-probe analysis was initially used in attributing the contribution of haemophilus influenza-type b in the aetiology of radiological-confirmed pneumonia, as well as subsequently in pcv trials [14, 16, 19] . we have used the same approach in probing the likelihood of co-infection by pcv9-serotypes in children hospitalized for pneumonia associated with influenza virus, piv and hmpv [14, 15] ; and we demonstrated that 44-58% of children hospitalized for pneumonia-associated with these viruses were likely to have pneumococcus co-infection [14, 15] . using this type of analysis, our study suggests that co-infections with pcv9serotypes contribute to hospitalizations for clinical pneumonia in which wu/kipyv were identified. the imputed rate of coinfection of pneumococci in children with polyomaviruses-positive pneumonia from our study provides a conservative estimate of this possible interaction as only 9 serotypes were included in the vaccine and ve even against vaccine-serotypes pneumococcal pneumonia was not 100%. the high ve estimate for kipyv-positive disease needs to be contextualized within the wide uncertainty bounds of this estimate. the suggested interaction between polyomaviruses and pneumococcus warrants further study. high co-infection rates with other respiratory-viruses were found for wupyv and kipyv which are similar to previous reports [6, 13, 20] . in the absence of a control group of children without lrtis a definitive causal relationship between polyomavirus detection and disease could not be inferred and this constitutes a limitation of our study. another limitation of our study is that we relied on npas, where identification of an organism does not necessarily imply infection. also in our study the hiv-infected children were not treated with anti-retroviral treatment (art), which may have contributed to their clinical course and may differ to hiv-infected children treated with art. determining the aetiology of pneumonia remains a challenge, especially in children and the pathogenic potential of some of the newly-described respiratory-viruses is difficult to address in the context of multiple infections and without specific symptoms. although polyomaviruses were frequently detected in children hospitalized for lrtis in our study, further studies which include autopsy samples from fatal lrti cases, lung aspirate ant-mortem and also enrolment of healthy controls [26] , are required to clarify the role of polyomaviruses in the pathogenesis of pneumonia. global and regional burden of hospital admissions for severe acute lower respiratory infections in young children in 2010: a systematic analysis etiology of community-acquired pneumonia in 254 hospitalized children viral infections of the lower respiratory tract: old viruses, new viruses, and the role of diagnosis viral pneumonia identification of a third human polyomavirus identification of a novel polyomavirus from patients with acute respiratory tract infections no evidence for an association between infections with wu and ki polyomaviruses and respiratory disease human polyomavirus (bk) infection and ureteric stenosis in renal allograft recipients renal failure due to bk virus infection in an immunodeficient child cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy polyomaviruses ki and wu in immunocompromised patients with respiratory disease human polyomaviruses: wu and ki in hiv exposed children with acute lower respiratory tract infections in hospitals in south africa wu and ki polyomavirus infections in pediatric hematology/oncology patients with acute respiratory tract illness a role for streptococcus pneumoniae in virus-associated pneumonia pneumococcal coinfection with human metapneumovirus use of vaccines as probes to define disease burden a trial of a 9-valent pneumococcal conjugate vaccine in children with and those without hiv infection clinical epidemiology of bocavirus, rhinovirus, two polyomaviruses and four coronaviruses in hiv-infected and hiv-uninfected south african children randomised trial of haemophilus influenzae type-b tetanus protein conjugate vaccine [corrected] for prevention of pneumonia and meningitis in gambian infants presence of the newly discovered human polyomaviruses ki and wu in australian patients with acute respiratory tract infection wu polyomavirus in children with acute lower respiratory tract infections prevalence and molecular characterization of wu/ki polyomaviruses isolated from pediatric patients with respiratory disease in thailand reactivation and mutation of newly discovered wu: ki, and merkel cell carcinoma polyomaviruses in immunosuppressed individuals wu and ki polyomaviruses in the brains of hiv-positive patients with and without progressive multifocal leukoencephalopathy prolonged ki polyomavirus infection in immunodeficient child pneumonia etiology research for child health. introduction this work is based upon research supported in-part by the south african research chairs initiative of the department of science and technology (dst) and national research foundation (nrf) in vaccine preventable diseases. additional funding support was received from the national health laboratory service research fund and medical research council (respiratory and meningeal pathogens research unit). any opinion, findings and conclusions or recommendations expressed in this material are those of the author(s) and therefore the nrf and dst do not accept any liability with regard thereto. mcn had financial support from the university of the witwatersrand. the authors thank the essential contribution of the members of the vaccine trialist group [17] for their involvement in the original study, all the trial participants and all rmpru staff involved in the study. the authors also thank john w. rossen for technical assistance and biomérieux south africa for providing reagents. the authors have no conflicts of interest to disclose. the main efficacy trial and subsequent retrospective analyses were approved by the human research ethics committee (hrec) of the university of the witwatersrand. signed written informed consent was obtained from the parent/legal guardians as part of the trial. hrec did not require additional consent for this analysis. the main study was not registered under any clinical trial registry as it was undertaken prior to registration being mandatory. key: cord-319864-t6ql9hz2 authors: lima, amorce; healer, vicki; vendrone, elaine; silbert, suzane title: validation of a modified cdc assay and performance comparison with the neumodx™ and diasorin® automated assays for rapid detection of sars-cov-2 in respiratory specimens date: 2020-11-11 journal: j clin virol doi: 10.1016/j.jcv.2020.104688 sha: doc_id: 319864 cord_uid: t6ql9hz2 severe acute respiratory syndrome coronavirus 2 (sars-cov-2), the virus that causes coronavirus disease 2019 (covid-19), has spread rapidly around the globe since it was first identified in december of 2019 in wuhan, china. in a race to contain the infection, researchers and healthcare officials have developed several assays to help diagnose individuals with covid-19. to help laboratories decide what assay to bring into testing lines, factors such as assay availability, cost, throughput, and tat should be considered. here we validated a modified version of the cdc assay and used it as a reference to evaluate the performance of the neumodxtm sars-cov-2 and diasorin simplexatm covid-19 direct assays. in silico analysis and clinical sample testing showed that the primers/probes designed by the cdc were specific to the sars-cov-2 as they accurately detected all reactive samples with an assay lod of 200 copies/ml. the performance of the three assays were analyzed using 159 nasopharyngeal swabs specimen tested within 1 to 5 days after routine testing. a 100% agreement was observed between the commercial assays and the modified cdc sars-cov-2 assay. a deeper look at the ct values showed no significant difference between neumodx and the modified cdc sars-cov-2 assay, whereas diasorin had lower overall ct values than the modified cdc sars-cov-2 assay. neumodx and diasorin workflows were much easier to perform. neumodx has the highest throughput and shortest tat, whereas although the modified cdc sars-cov-2 assay has comparable throughput to diasorin, it has the longest hands-on time and highest tat. severe acute respiratory syndrome coronavirus 2 (sars-cov-2), which started in wuhan city in china at the end of december 2019, has spread to over 200 countries and was declared a global pandemic by the world health organization (who) on march 11, 2020 (1). as of july 12, there were more than 12,740,000 confirmed cases of covid-19 and 565,000 deaths (https://coronavirus.jhu.edu/map.html). the united states (us) led the world with over 3,280,000 cases of covid-19 and over 135,000 deaths as of july 12, 2020. the rate of new cases continues to rise in the us, brazil and india with no apparent end in sight. to meet diagnostic needs as the pandemic grows, the u.s. food and drug administration (fda) granted several commercial sars-cov-2 tests emergency use authorization (eua). since that, there has been a race against time to develop tests for sars-cov-2 detection so individuals with covid-19 could be identified and isolated to slow the spread of the disease. in january 2020, the cdc developed a taqman probe-based molecular test (2) . in the following months, several commercial assays became available and have been used in the laboratory under the fda's eua (3) (4) (5) (6) . with the rapid development of those tests, came the challenge of assay sensitivity and specificity. our laboratory at tampa general hospital validated a modified version of the cdc assay following the fda eua guidelines and brought in commercial assays to help respond to the testing demand. the modified cdc sars-cov-2 assay involves off-instrument cell lysis and nucleic acid extraction steps, and an amplification step on a different instrument. the assay includes a panel of primer/probe sets targeting the viral n gene and the human rnase p gene. the neumodx™ sars-cov-2 and diasorin simplexa® covid-19 direct assays are fully automated sample-to-answer multiplex assays targeting two different regions of the viral genome. neumodx assay targets the nsp2 and the n genes while diasorin test targets the orf1ab and j o u r n a l p r e -p r o o f s gene. the neumodx™ sars-cov-2 assay is performed on a random-access, high throughput instrument allowing for with high priority and high volumes testing which is crucial in an outbreak. in this study, we sought to describe a modified cdc sars-cov-2 assay validation and compare its performance and workflow to that of the neumodx sars-cov-2 and diasorin simplexa covid-19 direct assays using respiratory specimens. the primer/probe sets used in this validation were selected from regions of the sars-cov-2 virus nucleocapsid (n) gene and were described in the cdc eua protocol for covid-19 diagnostic testing (7) . the cdc original panel was designed for both universal detection of sarslike coronaviruses (n3 primer/probe set) and specific detection of the sars-cov-2 (n1 and n2 primer/probe sets). moreover, the original cdc protocol included two sets of controls: hsc (human specimen extraction control) and rp (human rnase p gene to assess specimen quality). our modified protocol included the n1 and n2 primer/probe sets and the rp control. primer and probe sets used in this validation were purchased from integrated dna technologies (coralville, ia). total nucleic acid extraction was carried out on the biomérieux nuclisens® easymag® automated system (biomerieux, france) from a 200 µl of the sample and eluted in 50 μl of easymag elution buffer. a separate reaction mix containing 5 µl of the eluate, 5 µl of taqpath tm 1-step rt-qpcr master mix (4x), 1.5 µl of combined primer/probe mix (500nm and 125nm final concentration of primers and probes, respectively) and 13.5 µl of nuclease-free water was made for each of the assay target (n1, n2, and rp). a no-template water control (ntc) and ncovpc plasmid were used as template for each of the primer/probe set; hs_rpp30_positive control plasmid was used as template for rp primer/probe. the rt-pcr cycling conditions were set up on the rotor-gene 3000 thermocycler (corbett research, australia) as followed: 25°c for 2 min, j o u r n a l p r e -p r o o f 50°c for 15 min, 95°c for 2 min, followed by 45 cycles of 95°c for 3 s and 55°c for 30 s with fluorescence (fam) detection during the 55°c incubation step. a sample was positive for sars-cov-2 if at least one of the two targets (n1, n2) was detected regardless whether rp was amplified, negative if none of the targets was detected and rp was detected, and invalid if rp and the two targets were not detected. for the analytical evaluation, we used sars-cov-2 rna (strain usa_wa1/2020) kindly provided by the university of texas medical branch (utmb) in galveston. a series of two-fold dilutions of the rna were spiked in pooled sputum at concentrations of 800 copies/ml to 0.05 copies/ml to determine the limit of detection (lod) of the assay. all samples were processed and tested in triplicate as described above. the lod was confirmed by further testing in 20 replicates. the analytical specificity was determined by testing 22 samples previously positive for different respiratory species, including 15 patient samples, 4 atcc strains, and 3 commercially available nucleic acid controls. the clinical performance was established by testing 30 contrived np swabs and sputum specimens and 30 non-reactive specimens. of the 30 contrived specimens, 20 were spiked with sars-cov-2 strain usa_wa1/2020 rna at 1x-2x lod concentrations and 10 were spiked at concentrations spanning the assay's testing range (60,000 copies/ml to 234 copies/ml). a total of 159 np swabs were used to compare clinical performance of the three sars-cov-2 assays. samples were processed as described above for the modified cdc sars-cov-2 assay; for the neumodx sars-cov-2 assay and the diasorin simplexa covid-19 direct assay samples since the cdc primer/probe panel became available, many sars-cov-2 isolates have been sequenced. therefore, we ascertained that the primer/probe sets were specific to all available sequences for sars-cov-2 in the ncbi's genbank. multiple sequence alignment of the nucleocapsid gene of sars-cov-2 and the two closely related coronaviruses, sars-cov and mers-cov, showed the positions of the primer/probe sets (fig. 1a) . the n1 set amplified a 72 bp fragment of the nucleocapsid gene, n2 amplified a 67 bp of the same gene, and the primer/probe set for human rp gene internal control produced a 57 bp amplicon (fig. 1b) . the pcr efficiency was determined by testing a series of 10-fold dilutions of the 200,000 copies/µl concentration of the ncovpc plasmid. the data showed that the pcr was linear over 6 orders of magnitude with great pcr efficiency (n1=111% and n2=100) and r 2 of 0.99 for each of the primer/probe set (fig. 2) . the analytical sensitivity of the modified cdc sars-cov-2 assay was determined by testing pooled sputum samples spiked with a series of two-fold dilutions at concentrations of 800 copies/ml to 50 copies/ml of sars-cov-2 strain usa_wa1/2020. the lod was determined to be 200 copies/ml (table 1a) . it was confirmed by further testing 20 replicates that were inoculated with 200 copies/ml; all 20 replicates were tested positive (table 1b) . the analytical specificity of the assay was determined by testing 22 previously positive samples, which included 15 patient samples, 4 atcc strains, and 3 commercially available nucleic acid controls. the result showed that none of the targets was detected ( table 2 ). the performance of the assay was evaluated in 60 sputum samples to mimic the extent of viral colonization in respiratory specimens. the assay detected sars-cov-2 in all 30 contrived samples; no amplification was seen in the 30 nonreactive samples (table 3) . one hundred and fifty-nine np samples with a wide range of ct values were used to compare the performance of the three assays. of the 43 samples used for comparison between modified cdc sars-cov-2 assay and simplexa covid 19 direct assay, 37 samples were run within 2 days and 6 were run within 5 days of first testing. of the 116 samples used for comparison between the modified cdc sars-cov-2 assay and neumodx sars-cov-2 assay, 102 samples were run within a day and 14 were run within 5 days of first testing. all the samples tested by the modified cdc sars-cov-2 assay matched the results using the two commercial assays evaluated yielding a 100% ppv and npv for each assay (table 4a ). neumodx did not yield a ct value for one of the two targets in 5 samples: 4 were negative for nsp2 gene target and 1 was negative for the n gene target. however, they were still considered positive as only one detected target was needed for a positive result. although 100% agreement was observed among the assays, further analysis showed that there were some differences in the ct values. the average ct value difference in samples ran within 24 hours between neumodx sars-cov-2 and the modified cdc sars-cov-2 assay was -0.14, and -2.13 between samples ran within 5 days. the overall ct value difference for all samples ran between the two assays was -0.346. on the other hand, the average ct values difference between samples ran within 2 days between diasorin simplexa covid 19 direct assay and the modified cdc sars-cov-2 assay was -2.42, and -6.0 between samples ran within 5 days. the overall ct value difference for all samples between the two assays was -3.47. we assessed the workflow and compared the throughput, time of sample-to-result, and cost per sample for each assay. based on 8 samples/run, it was estimated to be 2 h and 50 min for sample processing and pcr runs were staggered. the most cost-effective test was the neumodx. reagents for this test is a little more expensive than the modified cdc sars-cov-2 assay, but less expensive than the diasorin. the labor involved on the modified cdc sars-cov-2 assay, however, is considerably greater than on the neumodx and diasorin assays, which ends up increasing the cost of the test. the ongoing pandemic still poses great risks for many around the world, and with the easing of certain restrictions, the need for health care facilities to be equipped and accurately test for the j o u r n a l p r e -p r o o f virus to limit its spread is as crucial as it will ever be. to that extent, laboratories have brought in sars-cov-2 assays and molecular platforms to respond to the need of their communities. there have been a few publications on head-to-head comparisons of those assays, including a couple very recently as we were preparing this article, in order to shed light on their performance characteristics and help laboratories make informed decisions on acquiring those assays (4, (8) (9) (10) . in this study, we validated a modified cdc sars-cov-2 assay and found that the assay is very sensitive and specific to sars-cov-2. the clinical performance comparison between neumodx sars-cov-2 assay, simplexa covid-19 direct assay, and the modified cdc sars-cov-2 assay showed an overall agreement of 100%. the ct value difference between the modified cdc assay and the neumodx assay suggests that there is not a significant difference between the two assays; however, there seems to be a greater difference in ct values between simplexa sars-cov-2 direct assay and the modified cdc sars-cov-2 assay, with the former having lower ct values. the difference is greater in samples that were run 5 days after the routine testing on the modified cdc sars-cov-2 assay. this is in line with previously published data that showed ct values on simplexa sars-cov-2 direct assay was much lower than those on an a modified cdc sars-cov-2 assay by an average ct difference of -2.1 (9) . the overall data also suggest that depending on the viral burden np samples can be refrigerated for at least 5 days and still maintain the rna integrity for viral detection by the assays in this study. a limitation of this study was that the same samples were not tested by the three different assays, so a head-to-head comparison of the three assays was not performed due to the limited kits available for routine patient care. however, a head-to-head comparison of the assay's workflow was performed. neumodx has the shortest time-to-result, the highest throughput, and is the most cost-effective of the three assays evaluated. therefore, it allows the clinical laboratory to significantly increase throughput and reduce tat in a time when more testing is needed, and faster result is crucial to speed up isolation measures. the tat comparison between the three j o u r n a l p r e -p r o o f assays was based on 8 samples/run since the liason® mdx instrument can only accommodate 8 samples/run. the overall throughput of the modified sars-cov-2 cdc assay can be improved to 24 samples if the 72-pcr tube adaptor option for the rotor-gene 3000 is used. laboratories that are equipped with 96-well nucleic acid extraction platforms and pcr instruments, as well as the personnel can further scale up testing and significantly increase the throughput of the cdc assay. nevertheless, the increased demand for testing highlighted a well-known short resource of skilled laboratory personnel and having to train new staff usually takes some time. acquiring two neumodx96 instruments helped our laboratory to increase the testing capacity from 200 tests/day to about 700 tests/day while maintaining the same number of laboratory personnel. therefore, although the three assays have the same accuracy, due to its random-access and high throughput capacity, neumodx sars-cov-2 assay outperforms the other two assays. diagnostic laboratories around the world have faced with unprecedented challenges due to the sars-cov-2 pandemic. the testing requirement has not only forced laboratories to bring in new technologists to help with testing, but it has also led to shortage of reagents. consequently, multiple assays and platforms are used to meet testing demand. as much as ldt assays, were instrumental at the onset of the pandemic, their overall testing capacity are very limited. therefore, it is necessary for laboratories to acquire multiple high throughput automated instruments that can test high volume of samples quickly with almost the same number of qualified laboratory professionals. there is no conflict of interest to disclose. j o u r n a l p r e -p r o o f j o u r n a l p r e -p r o o f j o u r n a l p r e -p r o o f j o u r n a l p r e -p r o o f a novel coronavirus from patients with pneumonia in china first case of 2019 novel coronavirus in the united states evaluation of the qiastat-dx respiratory sars-cov-2 panel, j o u r n a l p r e -p r o o f the first rapid multiplex pcr commercial assay for sars-cov-2 detection clinical evaluation of a sars-cov-2 rt-pcr assay on a fully automated system for rapid on-demand testing in the hospital setting rapid and sensitive detection of sars-cov-2 rna using the simplexa™ covid-19 direct assay clinical evaluation of the cobas sars-cov-2 test and a diagnostic platform switch during 48 hours in the midst of the covid-19 pandemic us cdc real-time reverse transcription pcr panel for detection of severe acute respiratory syndrome coronavirus 2 comparison of abbott id now, diasorin simplexa, and cdc fda eua methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from individuals diagnosed with covid-19 comparison of commercially available and laboratory developed assays for in vitro detection of sars-cov-2 in clinical laboratories clinical evaluation of three sample-to-answer platforms for the detection of sars-cov-2 we are grateful to university of texas medical branch for providing sars cov-2 rna template for the validation of the modified cdc sars-cov-2 assay. j o u r n a l p r e -p r o o f key: cord-311275-ysr9nqun authors: chuaychoo, benjamas; ngamwongwan, sopita; kaewnaphan, bualan; athipanyasilp, niracha; horthongkham, navin; kantakamalakul, wannee; muangman, nisa title: clinical manifestations and outcomes of respiratory syncytial virus infection in adult hospitalized patients date: 2019-07-03 journal: j clin virol doi: 10.1016/j.jcv.2019.07.001 sha: doc_id: 311275 cord_uid: ysr9nqun background: respiratory syncytial virus (rsv) is an important virus found in adult hospitalized patients. objectives: to study the clinical outcomes of hospitalized patients aged ≥ 15 years and diagnosed with rsv infection. study design: both retrospective and prospective cohort studies were conducted at a university hospital between may 2014 and december 2015. results: rsv was detected in 86 of 1562(5.5%) adult hospitalized patients suspected of respiratory viral infection. sixty-nine patients were included in the study. rsv was detected by rt-pcr (82.6%), ifa (10.1%), and both rt-pcr and ifa (7.3%). most patients (87.0%) were aged ≥ 50 years. cardiovascular diseases, pulmonary diseases, immunocompromised hosts, and diabetes were the major comorbidities. the common manifestations were cough (92.8%), dyspnea (91.3%), sputum production (87.0%), tachypnea (75.4%), wheezing (73.9%), and fever (71.0%). fiftyfive patients (79.7%) were diagnosed with pneumonia. hypoxemia (spo2 ≤ 92%) was found in 53.6% patients. twenty-five of 69(36.2%) patients developed respiratory failure and required ventilatory support. cardiovascular complications were found in 24.6% of patients. congestive heart failure, acute myocardial infarction (mi), new atrial fibrillation, and supraventricular tachycardia were found in 9(13.0%), 7(10.1%), 4(5.8%), and 3(4.3%) of 69 patients, respectively. overall mortality was 15.9%. pneumonia (81.8%) and acute mi (18.2%) were the major causes of death. conclusions: most adult hospitalized patients with rsv infection were of advanced age and had comorbidities. cardiopulmonary complications were the major causes of death. management and prevention of rsv infection in these vulnerable groups are necessary. respiratory syncytial virus (rsv) is an important cause of acute respiratory infection (ari) in infants and young children [1] [2] [3] . nevertheless, it has been recognized as a cause of adult ari, especially in the elderly, those with comorbidities, and immunocompromised hosts, which leads to hospitalization and increases morbidity and mortality [1, [4] [5] [6] [7] [8] . the prevalence of rsv infection in adults varies from 3% to 13% depending on age groups, underlying diseases, diagnostic techniques, study periods, and geographic regions. [3] [4] [5] [7] [8] [9] , in addition, disease severity ranges from mild to severe acute respiratory illness [4] . a total of 4%-16% of adult patients with rsv infection required hospitalization [3, 4, 10] , with high complications including cardiopulmonary complications and mortality [4, 5, 8, 11] . there were a few data of adult hospitalized patients with rsv infection, with high complications, in thailand; [3, 12, 13] however, additional clinical data are required for planning patient management and also disease prevention in this region. the objective of the study was to determine the clinical manifestations and outcomes of rsv infection in adult hospitalized patients. immunocompromised patients were defined as patients who received chemotherapy, corticosteroids > 20 mg/day prednisolone equivalent, hematologic malignancy, or hiv infection. pneumonia was diagnosed if patients had fever, cough, and dyspnea with new pulmonary infiltrates on chest radiography. acute bronchitis was defined as an acute respiratory infection manifested predominantly by cough without pneumonia, common cold, or exacerbation of asthma or copd [14] . chest radiography was independently interpreted by two chest radiologists who did not know the clinical course of patients. if the results were discordant, the consensus was made after the discussion. hospital-acquired pneumonia (hap) was defined as pneumonia that developed 48 h or more after admission without endotracheal intubation. ventilator-acquired pneumonia (vap) was defined as pneumonia that developed more than 48 h after endotracheal intubation [15, 16] . copd exacerbation was defined as a sustained worsening of the copd patients' condition beyond normal day-to-day variations, acute onset and necessitates a change in regular medication [17] . asthma exacerbation was defined by changes in symptoms and rescue use, which were outside the patients' usual range of day-to-day variation [18] . worsening or new congestive heart failure were diagnosed by cardiologists based on clinical signs, laboratory investigation such as chest radiography and echocardiography. the pasw statistics 18.0 (spss inc., chicago, il, usa) was used for the analysis. categorical data were described as percentages. normally distributed continuous data were presented as mean and standard deviation (sd), whereas non-normally distributed data were presented as median and interquartile range (iqr). categorical and continuous variables were compared between groups using chi-square test or fisher's exact test and unpaired t-test or mann-whitney test as appropriate. multiple logistic regression analysis was performed to identify the risk factors of complications and were presented as odds ratio and 95% confidence interval. a p-value of < 0.05 was considered a statistically significant difference. respiratory specimen of 1562 adult hospitalized patients suspected of respiratory viral infection were sent to detect rsv during may 2014 and december 2015. rsv was detected in 86 (5.5%) of patients in 5 months a year between july and november during two consecutive rainy seasons (fig. 1 ). sixty-nine rsv positive patients provided written informed consent and were included in the study. rsv was detected by rt-pcr (82.6%), ifa (10.1%) and both rt-pcr and ifa (7.3%). clinical outcomes in terms of acute respiratory illnesses (ari) and mortality are demonstrated in fig. 2 . community-acquired and nosocomial-acquired rsv infections were found in 57 (82.6%) and 12 (17.4%) patients, respectively. twenty-one of 57 (36.8%) community-acquired rsv infected patients had a history of contact with persons having acute respiratory tract infection in their families. the nosocomial-acquired infections were detected during outbreak, 5 patients at hematologic ward, and 7 patients at general medical ward. pneumonia was the most common ari in both groups. mortality rates of the community-acquired and nosocomial-acquired rsv infections were 15.8% (9 of 57) and 16.7% (2 of 12), respectively. the clinical manifestations of community-acquired and nosocomial-acquired rsv infections were similar, and the data were combined for analysis. the median age of patients was 72 years (iqr 58-81 years) (table1). sixty of 69 (87.0%) patients aged ≥ 50 years with the highest prevalence (36.2%) of age 65-79 years. among patients aged < 50 years, 7 of 9 (77.8%) were immunocompromised hosts (3 hematologic malignancy, 2 hematopoietic stem cell transplant recipients, and 2 connective tissue diseases on immunosuppressive drugs). females were the predominant. all patients had at least one comorbidity. the most common comorbidities were pre-existing cardiovascular diseases (33.3%), pulmonary diseases (29.0%), immunocompromised hosts (29.0%), diabetes (29.0%), and chronic kidney diseases (26.1%). the median duration of symptoms at presentation was 3days (iqr 2-3.5days). the common presenting symptoms ( table 2) were cough (92.8%), dyspnea (91.3%), sputum production (87.0%), and history of fever (81.2%). rhinorrhea was present in 46.4%of patients. the common initial physical findings were tachypnea (75.4%), wheezing (73.9%),and fever (43.5%). wheezing was found in 69.6% (39 of 56) of patients after excluding asthma or copd. fever (bt ≥ 37.8°c) was foundin approximately 71.0% patients in the first 2 days of admission with mean temperature 38.7 ± 0.6°c. after excluding hematologic malignancy and bacterial co-infection, the median white blood counts were 7995 cells/mm 3 (iqr 5,632-10,842 cells/mm 3 ). median neutrophil and lymphocyte counts were 72.6% (iqr 60.0-84.2 %) and 16 .6% (iqr 9.0-24.5%), respectively. chest x-rays were performed for all patients. pneumonia and acute bronchitis were diagnosed in 79.7% (55/69) and 17.4% (12/69) patients, respectively (fig. 2) . chest radiography findings of pneumonia were diffuse interstitial infiltrations alone 60.0% (33/55), mixed diffused interstitial and alveolar infiltrations 30.9% (17/55), and alveolar infiltrations alone 9.1% (5/55). exacerbations were occurred in 9 of 10 asthma and all 3 copd patients. hypoxemia (peripheral oxygen saturation (spo 2 ) ≤ 92%) was found in 26 patients (37.7%) at the initial presentation and increased to 37 patients (53.6%) during the hospitalization. twenty-five of 69 (36.2%) patients developed acute respiratory failure and required ventilatory support (22 patients needed invasive mechanical ventilation and 3 patients required non-invasive ventilation). 2 . summary of clinical outcomes in terms of ari and mortality of community-acquired and nosocomial-acquired rsv infections in adult hospitalized patients. rsv, respiratory syncytial virus; ari, acute respiratory illness; copd, chronic obstructive pulmonary disease; hap, hospital-acquired pneumonia; vap, ventilator-associated pneumonia. seventeen of 69 patients (24.6%) developed cardiovascular complications and 9 of 17 (52.9%) patients had pre-existing cardiovascular diseases (cvd). congestive heart failure (chf), acute myocardial infarction (mi), new atrial fibrillation (af), and supraventricular tachycardia (svt, heart rate 130, 160 and 220 beats/min) were found in 9 (13.0%), 7 (10.1%), 4 (5.8%), and3 (4.3%) of 69 patients, respectively. four of 9 chf patients had worsening chf. among 5 new onset chf patients, 4 patients had pre-existing coronary artery disease and valvular heart disease, and the other one had no previous diagnosis of cvd but had left ventricular ejection fraction (lvef) 33.5% during rsv infection. all acute mi were diagnosed as non-st-elevation mi (nstemi). five of 7 (71.4%) acute mi had concomitant chf. three of 7 (42.8%) acute mi patients were first diagnosed, and all had the risk factors of coronary artery disease (dm, hypertension and dyslipidemia). the pre-existing coronary arterial disease (cad) was the risk factor of overall cardiovascular complications in hospitalized adult patients with rsv infection with odds ratio 6.18, (95% ci 1.18-32.5), p = 0.03, adjusted for age, sex, ht, dlp, dm, pre-existing chf, arrhythmia, and vhd. sixty-five (94.2%) and 51 (73.9%) patients received initial empirical antibiotics and antiviral drugs (oseltamivir), respectively. after confirmed rsv infection, 32 (46.4%) patients received oral ribavirin in cases of respiratory failure that needed mechanical ventilator, hematologic malignancy, immunosuppressive therapy, or hiv infection. mortality rates in patients treated with oral ribavirin compared to those without oral ribavirin were 18.8% (6/32) vs 13.5% (5/37), p-value 0.553. sputum specimens were collected in 54 (78.3%) patients, but only 18 of 54 (33.3%) specimens were acceptable for bacterial culture. bacterial co-infection with rsv identified by sputum culture were found in 6(8.7%) patients, haemophilus influenzae (1), klebsiella pneumoniae (1), pseudomonas aeruginosa (2), acinetobacter baumannii (1), and pasteurella multocida (1). hemoculture for bacteria was performed on 65 patients (94.2%). three patients had concomitant bacteremia, escherichia coli (2), and aeromonas hydrophila (1). one patient with e. coli bacteremia had urinary tract infection, whereas the source of infection including sputum culture was not identified in other two patients. the overall mortality rate was 15.9% (11 of 69 patients). two patients of nosocomial rsv infection had hematologic malignancy with agranulocytosis. they received oral ribavirin, empirical antibiotics, and antifungal drugs; however, rsv persisted and had no evidence of other organisms (bacteria or fungus). nine patients of community-acquired rsv infection were of advanced age (64-95 years) and had comorbidities. pneumonia (9 of 11, 81.8%) and acute mi (2 of 11, 18.2%) were the most and the second common causes of death. most (87.0%) adult hospitalized patients with rsv infection of age ≥ 50 years had comorbidities. rsv is an important pathogen not only in patients of age ≥ 65 years but also in the age range 50-64 years, which was similar to previous studies [9, 19, 20] . nevertheless, we found the highest prevalence in age range 65-79 years (36.2%). the major comorbidities were pre-existing cardiopulmonary diseases, hematologic malignancy, immunocompromised hosts and dm. these findings were similar to the results of previous studies [4, 6, 11, 19, 21] . rsv infection is a seasonal disease [3, 22, 23] . we found rsv infection in the hospitalized patients during rainy seasons, which was similar to the results of a previous study in another region of thailand [3] . the common manifestations were cough, dyspnea, sputum production, fever, wheezing, and tachypnea, similar to the previous studies. [6, 9, 11, 21, 24] nevertheless, nasal congestion and rhinorrhea were not the predominant symptoms in our study. these findings suggested predominant involvement of lower respiratory tract, which might be associated with disease severity. the prevalence of pneumonia and acute respiratory failure, which required ventilatory support, was higher than those in previous studies, 79.7% vs 29%-67.5% and 36.2% vs 3.4%-17.0%, respectively [6, 7, 11, [25] [26] [27] . chest radiologic findings of rsv pneumonia in our study included predominant interstitial infiltrations (60.0% diffuse interstitial infiltrations alone and 30.9% mixed diffused interstitial and alveolar infiltrations). in contrast, those of most previous studies were consolidation or ground-glass opacity in unilateral and basilar in location [6, 11, 24, 28] . however, our radiologic findings were similar to those of a previous study conducted in rural thailand by another research group [12] . cardiovascular complications were found in 24.6% of patients including both worsening and new onset chf, acute mi, new af and svt, and 52.9% of them had pre-existing cardiovascular diseases. the prevalence of cardiovascular complications in adult rsv infection had been reported in 14.3%-22.0% of patients [6, 11] . a risk of overall cardiovascular complications in our study was pre-existing coronary arterial disease (cad) with adjusted odds ratio 6.18, (95% ci 1.18-32.5), p = 0.03. in addition, we found that acute mi was the second cause of death. these supported the importance of cardiovascular complications in adult hospitalized patients with rsv infection. patients with cardiovascular disease have higher rates of health care utilization for rsv-related illness and worse outcomes [29] . most patients received initial empirical antibiotics (94.2%) and oseltamivir (73.9%), which had no effect on rsv. we might reduce the unnecessary uses of antibiotics and anti-influenza drugs, if we knew pathogen earlier. oral ribavirin was used in patients with severe respiratory failure who needed mechanical ventilator and immunocompromised hosts in our observational study; however, the benefit of treatment is not clear. the mortality rate was high (15.9%) compared to other studies (5.8%-11.9%) [4, 6, 21] . this might be because of severe rsv infection, where pneumonia was found in 79.7% of patients. in the adult hospitalized patients with rsv infection, mortality was higher in the elderly with comorbidities and young patients with hematologic malignancy. cardiopulmonary complications such as pneumonia and acute mi were the most and the second causes of death, respectively. high complications and mortality of rsv infection in our study supported the importance of rsv infection in adult hospitalized patients. rsv causing severe complications and high mortality in the elderly similar to or higher than influenza had been reported [7, 11, 30] . adult severe pneumonia can occur in other viruses including human metapneumovirus (hmpv), human rhinovirus, parainfluenza virus, adenovirus, and coronavirus [5, 10, 31] . more studies of respiratory viral infections in adult patients are needed to identify the incidence and the impact of these viruses in thailand. the mechanisms of these severe diseases in the elderly are not clear. however, the experimental studies in aged mice infected with rsv and/or hmpv demonstrated that cd4 + t lymphocytes, the cytokine response, or a defect in humoral response may be associated with the severity in this population [32, 33] . the first limitation of the study is the combination of retrospective and prospective studies, even though most of the patient data were recorded by pulmonologists on duty. the retrospective study might affect the presenting symptoms of patients; however, it should not affect the clinical outcomes including cardiopulmonary complications and mortality. the second limitation is that only the respiratory specimens of patients suspected of respiratory viral infection were sent for the detection of rsv. it may lead to bias in the prevalence and clinical presentations. the prospective study of all adult hospitalized patients with acute respiratory illness should be conducted to determine the prevalence, clinical manifestations, and outcomes of the virus. most of the adult hospitalized patients with rsv infections aged ≥ 50 years old and had pre-existing cardiopulmonary diseases, hematologic malignancy, immunocompromised hosts, and dm. pneumonia and acute mi were the major causes of death. management and preventive strategies of rsv infection in these vulnerable groups in both community-acquired and hospital-acquired infections are necessary. this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. credit authorship contribution statement respiratory syncytial virusa comprehensive review respiratory syncytial virus-associated hospitalizations among children less than 24 months of age hospitalizations for acute lower respiratory tract infection due to respiratory syncytial virus in thailand respiratory syncytial virus infection in elderly and high-risk adults respiratory syncytial virus and other respiratory viral infections in older adults with moderate to severe influenza-like illness respiratory syncytial virus infection-associated hospitalization in adults: a retrospective cohort study respiratory viral infections among hospitalized adults: experience of a single tertiary healthcare hospital, influenza other respir risk factors for severe respiratory syncytial virus infection in elderly persons medically attended respiratory syncytial virus infections in adults aged &/= 50 years: clinical characteristics and outcomes rates of hospitalizations for respiratory syncytial virus, human metapneumovirus, and influenza virus in older adults high morbidity and mortality in adults hospitalized for respiratory syncytial virus infections the burden of hospitalized lower respiratory tract infection due to respiratory syncytial virus in rural thailand incidence of respiratory pathogens in persons hospitalized with pneumonia in two provinces in thailand diagnosis and management of cough executive summary: accp evidencebased clinical practice guidelines infectious diseases society of a. guidelines for the management of adults with hospital-acquired, ventilator-associated, and healthcareassociated pneumonia the alphabet soup of pneumonia: cap toward a consensus definition for copd exacerbations statement: asthma control and exacerbations: standardizing endpoints for clinical asthma trials and clinical practice respiratory syncytial virus hospitalization in middle-aged and older adults seasonal incidence of medically attended respiratory syncytial virus infection in a community cohort of adults &/=50 years old respiratory syncytial virus-and human metapneumovirus-associated emergency department and hospital burden in adults latitudinal variations in seasonal activity of influenza and respiratory syncytial virus (rsv): a global comparative review respiratory syncytial virus circulation in seven countries with global disease detection regional centers is clinical recognition of respiratory syncytial virus infection in hospitalized elderly and high-risk adults possible? morbidity and mortality among patients with respiratory syncytial virus infection: a 2-year retrospective review risk of mortality associated with respiratory syncytial virus and influenza infection in adults high viral load and respiratory failure in adults hospitalized for respiratory syncytial virus infections initial radiographic features as outcome predictor of adult respiratory syncytial virus respiratory tract infection respiratory syncytial virus and associations with cardiovascular disease in adults severe morbidity and mortality associated with respiratory syncytial virus versus influenza infection in hospitalized older adults pneumonia severity index in viral community acquired pneumonia in adults age-associated aggravation of clinical disease after primary metapneumovirus infection of balb/c mice respiratory infections by hmpv and rsv are clinically indistinguishable but induce different host response in aged individuals the authors thank professor khun nanta maranetra and mr. brian rochana for proof reading the article. the authors also thank miss khemajira karaketklang and miss kanokwan rattanasaengloet for review of the statistical analysis. the authors also thank miss pattranan vaidyakula for the data recording. key: cord-313749-f2ct57em authors: brittain-long, robin; nord, sandra; olofsson, sigvard; westin, johan; anderson, lars-magnus; lindh, magnus title: multiplex real-time pcr for detection of respiratory tract infections date: 2007-12-26 journal: j clin virol doi: 10.1016/j.jcv.2007.10.029 sha: doc_id: 313749 cord_uid: f2ct57em background: broad diagnostics of respiratory infection by molecular assays has not yet won acceptance due to technical difficulties and high costs. objectives: to evaluate clinical applicability of multiplex real-time pcr. study design: an assay targeting influenza virus a (ifa) and b (ifb), parainfluenza 1-3 (piv), human metapneumovirus (mpv), respiratory syncytial virus (rsv), rhinovirus (rv), enterovirus (ev), adenovirus (adv), human coronaviruses (229e, oc43, nl63), m. pneumoniae and ch. pneumoniae was developed and run daily on consecutive clinical nasopharyngeal swab samples. results: an etiology was identified in 48% of the 954 samples, with ifa in 25%, rv in 20%, mpv in 10% and m. pneumoniae in 10% of the positive. by a rational procedure costs could be reduced and the customer price set relatively low (€33 per sample). conclusion: streamlined testing and cost limitation is achievable and probably critical for implementation of a broad molecular diagnostics of respiratory infections. community acquired respiratory tract infections are frequent and constitute an important cause of morbidity in sweden and other european countries. a significant part of these infections are caused by viral pathogens (creer et al., 2006; diaz et al., 2007) . it is often difficult for the clinician to distinguish between viral and bacterial aetiologies, and this may result in overuse of antibiotics (lundborg et al., 2002) . diagnosis of viral respiratory tract infections using viral culture, antigen detection or serology is either too slow or too insensitive to be applicable in clinical practice (gunson et al., 2005) . the more reliable, specific and sensitive pcr methods have not yet won acceptance as the first choice for diagnosis owing to the high cost when several agents are targeted. recently, multiplex assays that detect a large number of viral agents have been described. some of these are based on traditional pcr (bellau-pujol et al., 2005; gruteke et al., 2004 ; * corresponding author. tel.: +46 73 8000 400. e-mail address: robin.bl@telia.com (r. brittain-long). liolios et al., 2001; puppe et al., 2004) , others on real-time pcr (gunson et al., 2005; kuypers et al., 2006; templeton et al., 2004; watzinger et al., 2004) or pcr combined with luminex liquid chip hybridization and identification (li et al., 2007) . we developed a real-time pcr procedure, based on automated specimen extraction and multiplex amplification, at a relatively low cost (d 33). primers and hydrolysis probes were obtained from the literature or developed in our laboratory. the following agents were analysed: influenza virus a (ifa) and b (ifb), parainfluenza 1-3 (piv), human metapneumovirus (mpv), respiratory syncytial virus (rsv), rhinovirus (rv), enterovirus (ev), adenovirus (adv), human coronaviruses 229e, oc43 and nl63. in addition, m. pneumoniae and ch. pneumoniae were included in the panel. nucleic acid from 100 l of specimen was extracted into an elution volume of 100 l by a magnapure lc robot 1386-6532/$ -see front matter © 2007 elsevier b.v. all rights reserved. doi:10. 1016/j.jcv.2007.10.029 (roche molecular systems, mannheim, germany), using the total nucleic acid protocol, and was amplified in an abi 7500 real-time pcr system (applied biosystems, foster city, ca). amplification was then carried out in 50 l reaction volumes, including 10 l of sample preparation and 25 l of one-step rt-pcr master mix from applied biosystems (this was exchanged to a master mix from invitrogen (carlsbad, ca) in the later part of the study period to improve sensitivity). after a reverse transcription step at 46 • c for 30 min followed by 10 min of denaturation at 95 • c, 45 cycles of two-step pcr was performed (15 s at 95 • c, 60 s at 58 • c). each sample was amplified in 5 parallel reactions, each containing primers and probes specific for 3 targets (mixtures a-e), as described in table 1 . multiplexing tended to hamper the performance of the amplification significantly for many combinations, and therefore the reagent mixtures were carefully evaluated: combinations were only accepted if the ct value in multiplex was no more than 2 cycles higher than when detection was carried out in separate reactions. the performance was evaluated using puc57 plasmids with inserts during the period from october 2006 through march 2007, 954 specimens were collected from patients of all ages with symptoms of respiratory tract infections who had been admitted to hospital clinics as well as health care centers in the göteborg region in western sweden (catchments area of approximately 600,000 inhabitants). both in-patients and out-patients were included. the specimens were obtained from either oropharynx or nasopharynx by rotating swabs. the specimens were submitted for diagnosis to the virology laboratory at sahlgrenska university hospital. out of the 954 specimens analysed 457 (48%) were positive for one ore more agents. the following agents were detected in order of frequency (n, % of positives): ifa (n = 114, 25%), rv (n = 93, 20%), mpv (n = 46, 10%), rsv (n = 41, 9%), oc43 (n = 33, 7%), ad (n = 33, 7%), nl63 (n = 26, 6%), piv (n = 19, 4%), ifb (n = 4, 1%), and ev (n = 1). m. pneumoniae was the most frequent bacterium (n = 44, 10%) whereas ch. pneumoniae was found only in 2 specimens. thirty-one specimens were positive for two agents, and one specimen was positive for 3 agents. the procedure was run every working day and results from samples arriving in the morning could be delivered during the same day to the clinician. the positivity rate (48%) is comparable with previous reports with similar study subjects. the rate of rsv and ifb were remarkably low, probably because these infections had appeared in extensive epidemics the preceding year. by targeting multiple agents in each reaction well, a broad range of aetiologies could be investigated in each run. the cost per sample could be kept low, since the procedure was streamlined and a reasonable number of samples arrived to the laboratory each day. the cost for was divided on reagents for nucleic acid extraction (d 3), reagents for real-time pcr (d 11), personnel (d 8), laboratory space (d 3), instrument cost (d 1), and overhead (d 5), yielding a customer price of d 33. we believe that a combination of low cost, high accuracy and prompt result delivery is the key to achieving a wide clinical use of molecular diagnostics of respiratory infections. we have also noted that inclusion of bacterial agents has promoted the willingness from clinicians to use our service, probably because mycoplasma pneumoniae or ch. pneumoniae infections may require antibiotic treatment. viral detection may support the clinician's decision to avoid antibiotics, or may prompt antiviral treatment such as oseltamivir (against influenza) to the patient or exposed family members. identifying the aetiology also allows the clinician to better inform the patient about the prognosis and ways of limiting the spread to other individuals. we therefore believe that an expanded use of molecular diagnostics of respiratory infections is of great clinical value. it should, of course, be kept in mind that viral agents detected by highly sensitive assays might reflect asymptomatic infection rather that being the cause of the present illness, and that an identified viral agent does not exclude concomitant bacterial infection. to some extent, the probability that a given agent constitutes an aetiological agent should be related to the ct value: the lower ct value, the higher the probability, and this may also be of relevance for the interpretation of double infections. further studies of respiratory infection aetiologies in different patient categories, and of the clinical utility of this and similar multiplex assays, need to be carried out. development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses aetiological role of viral and bacterial infections in acute adult lower respiratory tract infection (lrti) in primary care etiology of community-acquired pneumonia in hospitalized patients in chile: the increasing prevalence of respiratory viruses among classic pathogens practical implementation of a multiplex pcr for acute respiratory tract infections in children real-time rt-pcr detection of 12 respiratory viral infections in four triplex reactions pring-akerblom p. rapid and quantitative detection of human adenovirus dna by real-time pcr comparison of real-time pcr assays with fluorescent-antibody assays for diagnosis of respiratory virus infections in children simultaneous detection and high-throughput identification of a panel of rna viruses causing respiratory tract infections comparison of a multiplex reverse transcription-pcr-enzyme hybridization assay with conventional viral culture and immunofluorescence techniques for the detection of seven viral respiratory pathogens antibiotic prescribing in outpatients: a 1-week diagnosis-prescribing study in 5 counties in sweden evaluation of a multiplex reverse transcriptase pcr elisa for the detection of nine respiratory tract pathogens rapid and sensitive method using multiplex real-time pcr for diagnosis of infections by influenza a and influenza b viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4 design and performance testing of quantitative real-time pcr assays for influenza a and b viral load measurement real-time quantitative pcr assays for detection and monitoring of pathogenic human viruses in immunosuppressed pediatric patients we are grateful to dr lars nielsen, copenhagen, for sharing experience, oligonucleotide sequences and samples. key: cord-318012-bg9y2nsp authors: cantais, aymeric; mory, olivier; pillet, sylvie; verhoeven, paul o.; bonneau, julie; patural, hugues; pozzetto, bruno title: epidemiology and microbiological investigations of community-acquired pneumonia in children admitted at the emergency department of a university hospital date: 2014-05-22 journal: j clin virol doi: 10.1016/j.jcv.2014.05.006 sha: doc_id: 318012 cord_uid: bg9y2nsp background: the management of children with community-acquired pneumonia (cap) is largely influenced by the development of new molecular diagnostic tests that allow the simultaneous detection of a wide range of pathogens. objectives: evaluation of a diagnostic approach including multiplex pcr assays for revisiting the epidemiology and etiology of cap in children at hospital. study design: children of all ages consulting at the emergency department of the university hospital of saint-etienne, france, during the 2012–2013 winter period were included. in addition to bacterial cultures, the following pathogens were detected using biplex commercially-available rt-pcr tests: adenovirus, respiratory syncytial virus, human metapneumovirus, bocavirus, rhinovirus/enterovirus, coronavirus, influenza viruses a and b, parainfluenza viruses, mycoplasma pneumoniae and chlamydophila pneumonia. results: from 85 patients with cap, at least one pathogen was identified in 81 cases (95.3%), including 4 bacterial exclusive infections (4.7%), 53 viral exclusive infections (62.4%) and 24 mixed infections (28.2%). coinfection by at least two viruses was observed in 37 cases (43.5%). mean age was higher in the case of documented bacterial infection (p < 0.05). in the subgroup of viral exclusive infection, the mean age of severe cases was 2.0 years vs 3.8 years in mild and moderate cases (p < 0.05). conclusions: these findings highlight the huge proportion of cap of viral origin, the high number of co-infection by multiple viruses and the low number of bacterial cap, notably in children under 5 years, and address the need to re-evaluate the indications of empiric antimicrobial treatment in this age group. community-acquired pneumonia (cap) is the leading cause of death in children under five years of age in the world [1] . in developed countries, the systematic prescription of antimicrobial drugs to patients with cap has led to a dramatic reduction in mortality linked to this pathology [2, 3] . however, a bacterial origin of cap has not been documented in a large proportion of cases despite extensive aetiological investigations. the current recommendations [4] [5] [6] encourage pediatricians to prescribe a probabilistic antimicrobial treatment, even when no bacterial infection is documented, which results in prolonged use of antibiotics and in the possible selection of resistant strains within the endogenous flora [7] . until the beginning of the current century, the absence of documented bacterial infection was attributed to the difficulty in obtaining deep respiratory specimens that are not contaminated by bacteria from the local flora [8] together with the lower sensitivity of blood cultures in proving bacterial sepsis [9] . at this time, most of the epidemiological data from pediatric cap relied on traditional bacteriological cultures. with the occurrence of new diagnostic tools and notably of multiplex pcr assays able to simultaneously detect a large panel of viruses and atypical bacteria, it now appears that a large proportion of cap could be related to viral infection [10] [11] [12] . many studies have evaluated these new tools but most of them were limited to subgroups of children notably to the young [13, 14] , to hospitalized children [11, [13] [14] [15] [16] [17] , or for selected pathogens [10, 12, 18, 19 ]. the aim of the present study was to document the presence of a large variety of pathogens in respiratory specimens from children attending the pediatric emergency department of the university hospital of saint-etienne, france, during a six-month period and presenting a cap based on clinical and radiological evidence. the microbiological diagnostic approach combined bacterial cultures and biplex commercially available rt-pcr tests detecting a wide range of respiratory pathogens. a single center epidemiological observational study was conducted over a six-month period (november 2012 to april 2013) on children aging from one month to 16.5 years and presenting with cap at the pediatric emergency department of the university hospital of saint-etienne, france. the study was submitted for approval to the local ethics committee. after oral information was given together with a form explaining the content of the research, a consent form was signed by a parent or legal tutor before inclusion of each patient. a cap case was defined [6] as a subject with fever of at least 38.5 • c, an age-corrected polypnea [20] and a chest radiograph showing images of acute pneumonia confirmed by a second examiner (a pediatric radiologist for ambulatory children or a pediatrician for hospitalized patients). a few subjects were excluded after this second reading, notably in the case of associated bronchiolitis. the data collected at inclusion comprised the demographic characteristics of the child, their vaccine status, the smoking habits of parents, the date of the beginning of the current respiratory episode and the drugs, including antimicrobials, that they received during this period. according to the current guidelines [4] [5] [6] , a pneumonia was defined as severe for this study if the patient presented at least one of the following criteria: respiratory rate above 70 per minute in infants less than 1 year of age and above 50 per minute for older children, a tachycardia adjusted to age, a capillary refill time >3 s and an oxygen saturation <92%. a control visit was systematically carried out at days 2 and 5 either by phone call for ambulatory-treated children or after a physical examination in the service of hospitalization for children admitted to hospital. a number of biological parameters were recorded systematically, including c reactive protein (crp), procalcitonin (pct), white blood cell count and natremia. nasopharyngeal secretions obtained by sputum induction [21, 22] were sampled at entry for all the participants. the following tests were performed at inclusion: standard detection of conventional bacteria by culture, detection of five different viruses (respiratory syncytial virus (rsv), influenza viruses a and b, parainfluenza viruses, metapneumovirus and adenovirus) by indirect immunofluorescence (ifi) assay and detection of atypical bacteria by pcr as previously described [23] . in parallel, blood cultures and pneumococcal antigenuria were tested if prescribed by the clinician, notably in the case of hospitalization. in addition to the test listed above that were performed at the time of hospital attendance, a rtpcr assay was performed at the end of the study on an aliquot fraction kept frozen at −80 • c for the whole panel of nasopharyngeal aspirates, as previously described [24] . briefly, 200 l of aspirate was extracted on nuclisens ® easymag tm (biomérieux, marcy l'etoile, france). the respiratory multi well system (mws) r-gene tm (chla/myco pneumo, influenza a/b, rsv/hmpv, ad/hbov, hcov/hpiv, and rhino&ev/cc) from biomérieux was used for molecular testing. it consists of a series of biplex assays detecting either a couple of pathogens or a single pathogen and a cell control (cc) attesting for the presence of cellular nucleic acids within the specimen. the following pathogens were tested: mycoplasma pneumoniae and chlamydophila pneumoniae, influenza viruses a and b, rsv and human metapneumovirus (hmpv), adenovirus (adv) and bocavirus (bov), parainfluenza viruses and coronaviruses, rhinovirus/enterovirus (hrev) and a cell control. an univaried analysis was performed to compare the cases documented as probably related to a bacterial infection (threshold of 10 7 cfu/ml for conventional cultures [25, 26] or the presence of atypical bacterium by pcr in nasopharyngeal aspirates), and the others. comparisons adjusted for age, severity of pneumonia and mono/multiple infection were also performed. the chi-square test or the fisher exact test was used to compare qualitative variables whereas the student t test was used for quantitative variables. a p value of 0.05 was considered as statistically significant. a multivariate analysis of factors independently associated with detection of bacterial was secondarily performed; the parameters included in the logistic regression model were those with p < 0.10 by univaried analysis. over the six-month period of the study, 95 children thought to have cap were included; 10 of them were excluded secondarily, comprising 7 cases with non-cap infection, 2 cases without nasopharyngeal aspirate and one case of cap whose inclusion was not consented by the child's family. with reference to the total number of cases of cap recorded over the same period in the pediatric emergency department (n = 97), the representation rate was of 87.6% (85/97). the demographic and clinical characteristics of the 85 included cases together with the mode of management (ambulatory or hospital) and the probabilistic antimicrobial treatment are listed in table 1 . apyrexia was observed in 85.9 and 98.8% of cases at day 2 and 5, respectively. from the 35 children hospitalized at entry, 33 (94.3%) and 5 (14.3%) were still hospitalized at day 2 and 5, respectively. only one child needed intensive care within the pediatric intensive care unit. the antimicrobial treatment was modified in only three cases. neither fatal cases nor immediate sequelae were observed during the study. twenty-six cases (30.6%) were classified as severe cap. the general biological characteristics of the included cases were as follows: the median count of leukocytes was 14.7 10 9 per liter (interquartile range 10.84-20.08), with 66.5% of neutrophils; the crp median rate was of 64.5 mg/l (interquartile range: 19-163), the pct median rate was of 0.87 g/l (interquartile range: 0.17-5.14); an hyponatremia (<135 meq/l) was observed in 23 cases (27%). by using ifi prospectively, only 26 of the 85 nasopharyngeal aspirates (30.6%) were found positive, including 17 rsv, 9 adv and 4 influenzavirus b; all of these infections were confirmed by the retrospective rt-pcr assay. the pneumococcal antigenuria, available in 60 cases, was positive in 13 patients, 3 of them exhibiting a threshold of 10 7 cfu/ml by conventional culture. in the three other pneumococcal infections, no antigenuria was available. blood culture, performed in 38 cases (44%), was found positive for streptococcus pneumoniae in only one case. by combining bacterial culture and retrospective rt-pcr assays, at least one pathogen was identified in 81 cases (95.3%). the number of detected pathogens was of 0, 1, 2, 3, 4 and 5 in 4 (4.7%), 30 table 2) . from the 85 cases of cap, 4 bacterial exclusive infections were observed (4.7%), 24 infections with at least one bacterium and one virus (28.2%) and 53 viral exclusive infections (62.4%). coinfection by at least two viruses was observed in 37 cases (43.5%). table 3 displays the distribution of the identified pathogens and specifies the various associations, the most common being adv/rsv (10 cases), haemophilus influenzae/adv(8 cases) and hrev/bov (8 cases). the monthly distribution of microbiological infections is depicted in fig. 1. as shown in table 4 , none of the variables tested was statistically correlated to the presence of a bacterial pathogen by univaried analysis, with the exception of age that was higher in the case of documented bacterial infection (mean age of 5.45 vs 3.49 years; p < 0.05 by student t test) and the presence of abdominal pain at clinical examination at entry (p = 0.02). concerning biological parameters, no correlation was observed between bacterial and non-bacterial cases for the most of them, notably for crp and pct, with the exception of the white blood cell count that was higher in case of viral infection. severity was statistically associated neither to the bacterial or non bacterial etiology of cap, nor to a younger age, except in the subgroup of viral exclusive infection (n = 53), in which the mean age of severe cases was 2.0 years vs 3.8 years in mild and moderate cases (p < 0.05 by student t test). coinfection was not associated to a younger age or a more severe disease, even if the number of detected pathogens tended to be related to the severity of cap (2.1 infected agents in severe cases vs 1.7 in non-severe cases, p = 0.09 by student t test). by multivariate analysis, none of the tested variables was independently associated with bacterial infection. the demographic characteristics of the included patients were coherent with those of the literature [6] in terms of age (median age of 2.8 years; interquartile range: 1.5-5.7 years) and sex ratio (1.18 to the benefit of males). those patients with cap were shown to exhibit different risk factors as illustrated by a lower vaccination coverage as compared to that of the french population, an elevated rate of previous hospitalization (17/85, 20 .0%), a history of frequent respiratory disease (26/85; 30.6%) and a high level of smoking habits in parents (table 1) . approximately 4 children out of 5 reached hospital without having consulted another physician; most of them had already received an antipyretic treatment, mainly acetaminophen but also non-steroidal anti-inflammatory drugs (nsaid), despite the fact that the use of nsaid may be harmful [27] . at entry, 95.3% (81/85) of children had received an antimicrobial treatment. in most cases, the first choice for antimicrobial drug was amoxicillin, as currently recommended [4] [5] [6] . despite the limited size of the present study and its restriction to a single center, its originality lies in the diversity of the included table 3 detailed presentation of cases of community-acquired pneumonia exhibiting an infection with at least 2 pathogens. gray boxes indicate the total number of positive cases for each pathogen. white boxes corresponds to the cases with co-infection. from a microbiological point of view, it is first useful to justify the definition of what level of detection constitutes a causative agent in children with cap included in this study. concerning bacterial loads, the threshold of 10 7 cfu/ml was retained as recommended by european experts when induced sputum specimen are used [25] . it helps the discarding of pneumococcal colonization with prevalence of up to 57-65% in children of less than 5 years old [28, 29] from true infection. by contrast, "the asymptomatic carrier state of viruses is rather uncommon for most respiratory viruses [12, 30] , apart from the post active phase of respiratory virosis" [25] , which justifies to consider the detection of viral genome in respiratory specimens as a marker of probable viral infection. in the more exhaustive studies performed earlier, the percentage of elucidated cases from a microbiological point of view ranged from 72% to 86% [6, 11, 30] whereas it was of 95.3% in the present study detecting a wide spectrum of infectious agents with respiratory tropism. as reported earlier [30] , viral infections were shown to be predominant in children under 5 years of age and only 32% of all cap were found to be of bacterial origin. eighteen children received antimicrobial therapy before emergency consultation, which could be considered as a source of false-negative culture. however, all of them were always symptomatic at entry, which implies that a bacterium, if present, had a significant opportunity to be recovered by culture. an interesting finding of this study is the large proportion of viral coinfection (43.5%), much higher than that previously reported [10, 12, 30] , notably for bocavirus, metapneumovirus and adenovirus that were detected in association with at least one other virus in more than 80% of the cap cases involving these agents ( table 2 ). it has been suggested that infection by several viruses could enhance the severity of cap [12, [30] [31] [32] . in the present study, a trend was observed in the association between the mean number of infectious agents and the severity of cap as defined above (p = 0.09); a larger effective size would have been needed to determine a statistically significant difference. in terms of clinical evolution, neither death nor major complications were reported in this study, despite rates of 30.6% for severe pneumonia and 42.4% for hospitalization. there was no statistical difference in the severity of cap between viral and bacterial infections. almost all of the children received antibiotics, which was unnecessary in a large proportion of cases (62.4%) for which only viruses were detected. this finding raises the question of the systematic use of antimicrobials to treat childhood cap, which is still recommended in different guidelines [4] [5] [6] . the present findings, together with those of others, allowed the identification of a subpopulation of children less than 5 years of age with mild or moderate symptoms for which a viral etiology of cap is highly probable. this situation represents half of the cases recorded in this study: 62 children (72.9%) were less than five-years old, and 40 of them presented a mild or moderate cap, which corresponds to 47.1% of all cases. the use of a rapid molecular test detecting a large set of viral and bacterial pathogens within 2 or 3 hours, such as that described in [33] , would allow an improvement in the management of the antimicrobial treatment. in the case of positive result, it would be recommended to avoid the use of amoxicillin as a first-intent therapy (or to prescribe erythromycin in the case of detection of an agent of atypical pneumonia) and to reconsider the use of antimicrobial treatment 24-48 h later according to the clinical evolution and to the results of bacterial cultures. conversely, the negativity of the rapid test would lead to the empiric prescription of amoxicillin, as currently recommended [4] [5] [6] . it is obvious that this attitude would be dedicated to cap with mild or moderate symptoms and that cap with severe presentation at entry should include a systematic probabilistic antimicrobial therapy, whatever the results of pcr assay. the present results are indicative that this strategy could dramatically reduce the proportion of unnecessary antimicrobial treatments in mild or moderate child cap. wider studies are needed to prospectively evaluate the benefits of this approach in terms of patient recovery, prevention of antibiotic resistance and medical economy. the reagents used for the retrospective analysis were funded by a grant from the medical association of pediatricians of the university hospital of saint-etienne for research and studies (aderps), france. from the medical association of paediatrician of the university-hospital of saint-etienne for research and studies (aderps). who estimates of the causes of death in children global, regional, and national causes of child mortality in 2008: a systematic analysis epidemiology and etiology of childhood pneumonia the management of community-acquired pneumonia in infants and children older than 3 months of age: clinical practice guidelines by the pediatric infectious diseases society and the infectious diseases society of america japanese guidelines for the management of respiratory infectious diseases in children 2007 with focus on pneumonia british thoracic society guidelines for the management of community acquired pneumonia in children: update antibiotic therapy for pediatric community-acquired pneumonia: do we know when, what and for how long to treat? breathing new life into pneumonia diagnostics blood culture is poor method of confirming pneumococcus as cause of childhood pneumonia association of human metapneumovirus with radiologically diagnosed community-acquired alveolar pneumonia in young children comprehensive detection of causative pathogens using real-time pcr to diagnose pediatric community-acquired pneumonia viruses in community-acquired pneumonia in children aged less than 3 years old: high rate of viral coinfection etiology of community-acquired pneumonia in hospitalized school-age children: evidence for high prevalence of viral infections etiology of community-acquired pneumonia in hospitalized children based on who clinical guidelines community acquired pneumonia -a prospective uk study epidemiology and clinical characteristics of community-acquired pneumonia in hospitalized children human metapneumovirus and community-acquired pneumonia in children development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses role of mycoplasma pneumoniae and chlamydia pneumoniae in children with community-acquired lower respiratory tract infections diagnostic value of tachypnoea in pneumonia defined radiologically comparing nose-throat swabs and nasopharyngeal aspirates collected from children with symptoms for respiratory virus identification using real-time polymerase chain reaction induced sputum in the diagnosis of childhood community-acquired pneumonia development and evaluation of chlamylege, a new commercial test allowing simultaneous detection and identification of legionella, chlamydophila pneumoniae, and mycoplasma pneumoniae in clinical respiratory specimens by multiplex pcr comparative evaluation of six commercialized multiplex pcr kits for the diagnosis of respiratory infections european manual of clinical microbiology pneumonia methods working group, et al. laboratory methods for determining pneumonia etiology in children prevalence and risk factors of suppurative complications in children with pneumonia indirect effect of 7-valent pneumococcal conjugate vaccine on pneumococcal colonization among unvaccinated household members the descriptive epidemiology of streptococcus pneumoniae and haemophilus influenzae nasopharyngeal carriage in children and adults in kilifi district impact of viral infections in children with community-acquired pneumonia: results of a study of 17 respiratory viruses human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in thailand unsolved problems in the approach to pediatric community-acquired pneumonia comparison of the idaho technology filmarray system to real-time pcr for detection of respiratory pathogens in children the authors are indebted to the patients' families who gave their consent for participating to this study. philip lawrence is warmly acknowledged for his careful checking of english language. the reagents used for the retrospective analysis were funded by a grant the authors declare that they have no conflict of interest regarding the object of this study. the study was submitted for approval to the local ethics committee. key: cord-332723-rz1iilsv authors: creager, hannah m.; cabrera, barbara; schnaubelt, andy; cox, jesse l.; cushman-vokoun, allison m.; shakir, salika m.; tardif, keith d.; huang, meei-li; jerome, keith r.; greninger, alexander l.; drobysheva, daria; spaulding, usha; rogatcheva, margarita; bourzac, kevin m.; hinrichs, s.h.; broadhurst, m.j.; fey, p.d. title: clinical evaluation of the biofire® respiratory panel 2.1 and detection of sars-cov-2 date: 2020-07-06 journal: j clin virol doi: 10.1016/j.jcv.2020.104538 sha: doc_id: 332723 cord_uid: rz1iilsv we evaluated the performance of the biofire® respiratory panel 2.1 (rp2.1) in the detection of sars cov-2 in comparison against three other sars cov-2 eua assays. in these studies, the rp2.1 panel had 98% positive percent agreement (48/49) and 100% negative percent agreement (49/49). since 30% of nasopharyngeal swab specimens have a sars cov-2 ct >30 and thus detection of virus in low titers is clinically relevant, a sample with a high titer was diluted and each 10 fold dilution was tested in triplicate and compared against 6 other eua approved sars cov-2 assays. these data suggested that the biofire® rp2.1 panel, along with four other sars cov-2 assays (roche cobas, cepheid xpert xpress, biofire® defense covid19, and necov19), consistently detected viral rna at the 10-7 dilution. overall, these studies suggest that the biofire® rp2.1 assay can be used to detect acute cases of sars cov2 in addition to patients with low viral titer later in disease presentation. the gold standard for sars-cov-2 diagnosis is detection of viral rna in nasopharyngeal (np) swab specimens. sample-to-answer nucleic acid amplification assays for the detection of sars-cov-2 rna are available for a limited number of high-throughput diagnostic platforms including the roche cobas 6800/8800 (1, 2) , the hologic panther and panther fusion, (3) (4) (5) (6) and the abbott m2000 (7) . high-throughput platforms are mostly utilized in larger reference laboratories, state public health laboratories, and academic medical centers, but these assays are not well-suited to use in other settings that lack large testing volumes or the capacity to perform high complexity tests. this has led to the centralization of sars-cov-2 testing, meaning that turnaround time may be prolonged by the need to transport specimens over long distances. as sars-cov-2 prevalence increases, decentralized testing capability is needed to facilitate rapid identification of sars-cov-2 cases. to date, the biofire covid-19, cepheid xpert xpress sars-cov-2 (8), diasorin simplexa (9) and the genmark eplex sars-cov-2 tests (6) have emerged as rapid covid19 testing platforms that fill this niche. the biofire ® filmarray ® system (biofire diagnostics, llc, salt lake city, ut, "biofire") is another testing platform that is widely used in multiple laboratory environments. this multiplex, residual natural nasopharyngeal swab in transport media (nps) specimens leftover from sars-cov-2 testing performed as part of patient care were collected during march and april of 2020 at the university of washington (seattle, wa), university of nebraska medical center (omaha, ne), and arup laboratories (salt lake city, ut). original specimen testing for sars-cov-2 was conducted according to manufacturer's instructions at arup laboratories using the hologic panther fusion sars-cov-2 assay (fda eua), at the university of nebraska medical center using the roche cobas sars-cov-2 assay (fda eua), or at the university of washington using a laboratory developed test based on the cdc n1 and n2 sars-cov-2 assays (washington eua) conducted as described in perchetti et al. (10) . specimens were frozen upon study enrollment to allow for storage and shipping. additional nps specimens collected before december 2019 and therefore presumed to be negative for sars-cov-2 were provided by biofire diagnostics. ten-fold serial dilutions of a natural nasopharyngeal swab specimen with known high positivity for sars-cov-2 rna (e gene detected at a cycle threshold (ct) of 16.6 by the cobas sars-cov-2 assay) were prepared with a diluent of pooled nps. diluent was prepared from samples that tested negative for sars-cov-2 using an assay developed at nebraska medicine (necov19; fda eua) and was confirmed to be pcr negative prior to use. these samples were not tested for other respiratory viruses prior to pooling. on two separate subsequent occasions, an aliquot of the 10 -4 or 10 -5 diultions was thawed and added to newly generated pools of nps to create additional intermediate dilutions between 10 -6 and 10 -8 . single-use aliquots of each dilution were stored at -80°c and thawed immediately prior to use. testing by commercial assays (biofire rp2. performed according to manufacturer's instructions with the exception of the abbot id now. the instructions for use for this assay have been revised and now limit testing to swab specimens that can be used to directly inoculate the sample cup. because comparison between platforms required use of a liquid specimen, we followed the instructions for use associated with the original j o u r n a l p r e -p r o o f eua for the abbot id now assay and used transfer pipettes from the kit to add 200 μl of np swab specimens in transport medium to the sample cup. table 1 ). the remaining fifty specimens were expected to test negative for sars-cov-2 because they were collected prior to december 2019. testing of one positive and one negative specimen yielded invalid results due to instrument errors; these could not be retested according to the instructions for use due to insufficient specimen volume. these specimens were excluded from the analyses, resulting in reduction of sample size to 49 valid positive and 49 valid negative specimens. the 49 negative specimens tested negative for sars-cov-2 on the biofire rp2.1 assay (100% negative percent agreement, table 1 ). the biofire rp2.1 assay detected sars-cov-2 in 48/49 positive specimens (98% positive percent agreement, table 1 performance of the sars-cov-2 assay on the biofire rp2.1 was comparable to that of necov19, cobas, genexpert, and biofire defense assays ( table 2, supplemental table 1 ) with detection of sars-cov-2 in all replicates down to the 10 -7 dilution. applying ct values from the ldt to a standard curve generated from extracted sars-cov-2 quantitated rna standard showed that this dilution contains approximately 10 3 copies/ml. virus detection was inconsistent at lower concentrations. sars-cov-2 detection dropped off below the 10 -6 dilution and 10 -5 j o u r n a l p r e -p r o o f dilutions for the hologic aptima assay and abbott id now assay, respectively (table 2, supplemental table 1 ). our studies show that the biofire rp2.1 has similar performance to high throughput shedding at levels unlikely to result in transmission, a false negative result would be less consequential (13, 14) . the addition of a sars-cov-2 test to a commonly used multiplex pcr panel will expand the number of laboratories able to test for sars-cov-2 and will allow detection of coinfection as well as of alternative diagnoses. once the northern hemisphere respiratory season arrives, the ability to test for influenza, rsv, and sars-cov-2 simultaneously on the biofire rp2.1 will greatly benefit hospitals as an important infection control management tool. the corresponding author has acted as a consultant and received grant funding from biofire diagnostics. ct values are shown for each assay used for characterizing clinical specimens, as indicated on the x axis. horizontal bars represent ct median values for each assay. j o u r n a l p r e -p r o o f the detection of sars-cov-2 using the cepheid xpert xpress sars-cov-2 and roche cobas sars-cov-2 assays comparison of sars-cov-2 detection from nasopharyngeal swab samples by the roche cobas(r) 6800 sars-cov-2 test and a laboratory-developed real-time rt-pcr test rapid random access detection of the novel sarscoronavirus-2 (sars-cov-2, previously 2019-ncov) using an open access protocol for the panther fusion comparison of the panther fusion and a laboratory-developed test targeting the envelope gene for detection of sars-cov-2 comparison of commercially available and laboratory developed assays for in vitro detection of sars-cov-2 in clinical laboratories comparison of four molecular in vitro diagnostic assays for the detection of sars-cov-2 in nasopharyngeal specimens comparison of abbott id now and abbott m2000 methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from symptomatic patients multicenter evaluation of the cepheid xpert xpress sars-cov-2 test rapid and sensitive detection of sars-cov-2 rna using the simplexa covid-19 direct assay validation of sars-cov-2 detection across multiple specimen types detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr research use only 2019-novel coronavirus (2019-ncov) real-time rt-pcr primers and probes virological assessment of hospitalized patients with covid-2019 this work was funded by a grant from biofire diagnostics to pdf. we would like to thank key: cord-328290-kbysppgb authors: beckmann, christiane; hirsch, hans h. title: diagnostic performance of near-patient testing for influenza date: 2015-03-31 journal: j clin virol doi: 10.1016/j.jcv.2015.03.024 sha: doc_id: 328290 cord_uid: kbysppgb background: rapid diagnosis of influenza is important for controlling outbreaks and starting antiviral therapy. direct antigen detection (dad) is rapid, but lacks sensitivity, whereas nucleic acid amplification testing (nat) is more sensitive, but also more time-consuming. objectives: to evaluate the performance of a rapid isothermal nat and two dads. study design: during february–may 2014, we tested 211 consecutive patients with influenza-like illness using a commercial isothermal nat (alere™ influenza a&b) as well as the dad sofia(®) influenza a + b and binaxnow(®) influenza a&b for detection of influenza-a and -b virus. respifinder-22(®) a commercial multiplex nat served as reference test. serial 10-fold dilutions of influenza-a and -b cell culture supernatants were examined. another 225 patient samples were tested during december 2014–february 2015. results: compared to respifinder-22(®), the isothermal nat alere™ influenza a&b, and the dad sofia(®) influenza a + b and binaxnow(®) influenza a&b had sensitivities of 77.8%, 59.3% and 29.6%, and specificities of 99.5%, 98.9% and 100%, respectively, for the first 211 patient samples. alere™ influenza a&b showed 85.7% sensitivity and 100% specificity in the second cohort. isothermal nat was 10-100-fold more sensitive compared to dad for influenza virus culture supernatants with a lower limit of detection of 5000–50,000 copies/ml. the average turn-around time (tat) of isothermal nat and dads was 15 min, but increased to 110 min for alere™ influenza a&b, 30 min for binaxnow(®) influenza a&b, and 45 min for sofia(®) influenza a + b, when analyzing batches of 6 samples. conclusion: simple sample processing and a tat of 15 min render isothermal nat alere™ influenza a&b suitable for sequential near-patient testing, but the tat advantage is lost when testing of larger series. community-acquired respiratory virus isothermal pcr turn-around time (tat) antigen detection nucleic acid amplification testing (nat) a b s t r a c t background: rapid diagnosis of influenza is important for controlling outbreaks and starting antiviral therapy. direct antigen detection (dad) is rapid, but lacks sensitivity, whereas nucleic acid amplification testing (nat) is more sensitive, but also more time-consuming. objectives: to evaluate the performance of a rapid isothermal nat and two dads. study design: during february-may 2014, we tested 211 consecutive patients with influenza-like illness using a commercial isothermal nat (alere tm influenza a&b) as well as the dad sofia ® influenza a + b and binaxnow ® influenza a&b for detection of influenza-a and -b virus. respifinder-22 ® a commercial multiplex nat served as reference test. serial 10-fold dilutions of influenza-a and -b cell culture supernatants were examined. another 225 patient samples were tested during december 2014-february 2015. results: compared to respifinder-22 ® , the isothermal nat alere tm influenza a&b, and the dad sofia ® influenza a + b and binaxnow ® influenza a&b had sensitivities of 77.8%, 59.3% and 29.6%, and specificities of 99.5%, 98.9% and 100%, respectively, for the first 211 patient samples. alere tm influenza a&b showed 85.7% sensitivity and 100% specificity in the second cohort. isothermal nat was 10-100-fold more sensitive compared to dad for influenza virus culture supernatants with a lower limit of detection of 5000-50,000 copies/ml. the average turn-around time (tat) of isothermal nat and dads was 15 min, but increased to 110 min for alere tm influenza a&b, 30 min for binaxnow ® influenza a&b, and 45 min for sofia ® influenza a + b, when analyzing batches of 6 samples. conclusion: simple sample processing and a tat of 15 min render isothermal nat alere tm influenza a&b suitable for sequential near-patient testing, but the tat advantage is lost when testing of larger series. © 2015 elsevier b.v. all rights reserved. rapid and sensitive diagnostic tests for influenza virus permit timely treatment decisions and infection control measures in emergency rooms, hospital wards, and nursing homes [1] [2] [3] . the current methods used for the laboratory diagnosis of influenza include virus isolation by cell culture, direct antigen detection (dad), and nucleic acid amplification testing (nat). virus isolation by cell culture permits identification of infectious virus with fairly high sensitivity, but is time-and resource-consuming and largely limited to specialized laboratories. dad has been widely used because of its short turn-around time (tat), but is limited by its lower sensitivity, especially in adult patients and those presenting several days after symptom onset [4, 5] . nat is characterized by high sensitivity and specificity, semi-quantification in real-time formats, and its amenability to automation and multiplexing [6] . however, nat requires a molecular diagnostic laboratory with skilled personnel, appropriate instrumentation, but rarely delivers results with tat of <6 h. to evaluate the performance of the isothermal pcr for influenza (alere tm influenza a&b) and two dads (sofia ® influenza a + b and binaxnow ® influenza a&b) versus a commercial multiplex nat (respifinder-22 ® ). between february 2014 and may 2014, we tested a first cohort of 211 consecutive nasopharyngeal swabs from patients with influenza-like illness by the isothermal nat alere tm [6, 8] . discordant samples were resolved by inhouse qnat for influenza [7] with a tat of 6 h. total nucleic acids were extracted from 200 ul of the respiratory sample using the corbett cas-1200 system (qiagen hilden, germany). in total, 57/436 samples (13.1%) were positive for influenza-a the performance of all three rapid tests compared to the reference method for influenza-a and -b combined is shown in table 1 . using multiplex nat as reference, alere tm influenza a&b, sofia ® influenza a + b, and binaxnow ® influenzaa&b had sensitivities of 82.3%, 59.3% and 29.6%, and specificities of 99.7%, 98.9% and 100%, respectively. specificity of the test could be confirmed with influenzanegative samples that had been tested with respifinder-22 ® (n = 373). multiplex nat detected 14 other pathogens in these samples including rhinovirus/enterovirus, coronavirus oc43, nl63, 229e and hku1, human bocavirus, rsv a and rsv b, adenovirus, parainfluenza-3, parainfluenza-4, human metapneumovirus and the bacteria bordetella pertussis and mycoplasma pneumoniae. none of the 11 false-negative samples were positive for another pathogen. overall, the sensitivity, specificity, positive predictive value (ppv), negative predictive value (npv) and ä values (interobserver agreement) for influenza-a and -b were slightly higher for specimens from pediatric patients (89.5%). the limit of detection for the tests was evaluated using serial dilutions of fresh cell culture supernatant of influenza-a h3n2 and h1n1 and influenza-b grown on llc-mk2 cells (fig. 1) . for influenza-a, the detection limit of the alere tm influenza a&b according to qnat was approximately 5,000 geq/ml (h3n2), 50,000 geq/ml (h1n1), and 10,000 geq/ml for influenza-b. overall, the sensitivity of both dads (sofia ® influenza a + b and table 1 performance the dilutions were directly tested using the alere tm influenza a&b (alere, triangles), sofia ® influenza a + b (sofia, circles), and binaxnow ® influenza a&b (binax, squares). in parallel, the dilutions were extracted and quantified by qnat as described in study design [7] . solid symbols, positive testing; open symbols, negative testing; lines, lower limit of detection of indicated rapid test; hatched area, limit of detection of the influenza qnat. binaxnow ® influenza a&b) were about 1-2 orders of magnitude lower than for alere tm influenza a&b. in our prospective study, the overall sensitivity and specificity of the alere tm influenza a&b assay was 82.3% and 99.7% for influenza. several factors may have played a role: 1. a large number of the samples (n = 211) from the first cohort were obtained towards the end of the influenza season between february and may 2014, which decreases the positivity rate and pretest probability. 2. 13/436 samples were analyzed retrospectively from frozen samples, but the manufacturer recommends using fresh samples. by excluding these 13 samples from analysis, the sensitivity increased to 86.5% and the specificity to 100%. possibly, tests using high-grade extraction-amplification procedures are less affected by testing frozen samples, even with lower amounts of influenza virus, than alere tm influenza a&b. of those 13 samples 5 resulted in discordant results with the alere tm influenza a&b assay, with viral qnat loads between 30 and 18,000 geq/ml. 3. influenza-a and -b from cell culture estimated the limit of detection of around 5,000 to 50,000 geq/ml for alere tm influenza a&b. therefore, patients with lower viral loads might not be identified. an independent conclusion about the assay performance. other studies report a sensitivity of alere tm influenza a&b of 73%-99% for influenza-a, 97%-100% for influenza-b; and specificity of 95%-100% for influenza-a, and 100% for influenza-b [9] [10] [11] . in cohort-1, alere tm influenza a&b yielded 1 false-positive result among 211 samples, and no false-positives among 225 samples of cohort-2. the rate corresponds to 0.23% or 1 among 436 symptomatic patients, which would be unjustifiably treated or isolated. conversely, antiviral treatment would be withheld in 373 patients tested negative. while the data suggest that testing of patients improves timely delivery of antivirals, 15 per 100 infected would not receive this treatment. the clinical impact may differ depending on the clinical scenario: hospitalized patients are likely to be confirmed during the course of their disease, whereas outpatients are less likely to be re-tested unless symptoms persist. the current study indicates that isothermal nat as provided by the alere tm influenza a&b is significantly faster than conventional qnat (15 min versus 6-8 h) or multiplex nat (16 h) and comparable to dad. as the sample preparation is equally simple, the alere tm influenza a&b could potentially be performed outside of the molecular diagnostic laboratory setting e.g., in a physician's office or in the emergency room. this could save transport time to the laboratory. however, care needs to be taken that the individuals operating the system are properly trained and certified. in the single sample testing, however, running larger numbers of more than 6 patient samples becomes challenging, and the tat advantage of isothermal pcr is lost. taken together, the alere tm influenza a&b can reduce the tat compared to multiplex nat or qnat. the sensitivities and specificities were comparable to conventional nat reference tests and superior to the two dad assays. the alere tm influenza a&b may be attractive for first-line rapid testing of individual patients presenting to health care, followed by qnat or multiplex nat, when information on relative amounts or the presence of other viruses is needed. none. none declared. not required. rapid diagnosis of influenza infection in older adults: influence on clinical care in a routine clinical setting impact of rapid diagnosis on management of adults hospitalized with influenza ecil-4): guidelines for diagnosis and treatment of human respiratory syncytial virus, parainfluenza virus, metapneumo virus, rhinovirus, and coronavirus rapid influenza diagnostic test use and antiviral prescriptions in outpatient settings pre-and post-2009h1n1 pandemic influenza viruses: update on epidemiology, clinical features, treatment and vaccination comprehensive diagnostics for respiratory virus infections after transplantation or after potential exposure to swine flu a/h1n1: what else is out there? outcome of influenza infections in outpatients after allogeneic hematopoietic stem cell transplantation a retrospective analysis of nosocomial viral gastrointestinal and respiratory tract infections multicenter clinical evaluation of the novel alere i influenza a&b isothermal nucleic acid amplification test evaluation of the alere i influenza a&b nucleic acid amplification test by use of respiratory specimens collected in viral transport medium evaluation of alere i influenza a&b for rapid detection of influenza viruses a and b we thank our colleagues of the division infection diagnostics and the technicians of the molecular diagnostics and virus isolation laboratories for support and assistance. key: cord-299537-lbx1plqx authors: wang, wei; cavailler, philippe; ren, peijun; zhang, jing; dong, wei; yan, huajie; mardy, sek; cailhol, johann; buchy, philippe; sheng, jun; fontanet, arnaud; deubel, vincent title: molecular monitoring of causative viruses in child acute respiratory infection in endemo-epidemic situations in shanghai date: 2010-09-19 journal: j clin virol doi: 10.1016/j.jcv.2010.08.005 sha: doc_id: 299537 cord_uid: lbx1plqx background: numerous viruses are responsible for respiratory infections; however, both their distribution and genetic diversity, in a limited area and a population subgroup, have been studied only rarely during a sustained period of time. methods: a 2-year surveillance program of children presenting with acute respiratory infections (aris) was carried out to characterize the viral etiology and to assess whether using gene amplification and sequencing could be a reliable approach to monitor virus introduction and spread in a population subgroup. results: using multiplex rt-pcr, 15 different respiratory viruses were detected within the 486 nasopharyngeal positive samples collected among 817 children aged <9-year old who presented with ari during october 2006 to september 2008. a single virus was detected in 373 patients (45.7%), and two to four viruses in 113 patients (13.8%). the most frequent causative viruses were respiratory syncytial virus (rsv) (24.7%), human bocavirus (24.5%), and human rhinovirus (hrv) (15%). rsv was more prevalent in winter and among young infants. cases of seasonal influenza a and b viruses were reported mainly in january and august. an increase in adenovirus infection was observed during the spring of the second year of the study. sequence analyses showed multiple introductions of different virus subtypes and identified a high prevalence of the newly defined hrv-c species. a higher viral incidence was observed during the winter of 2008, which was unusually cold. conclusions: this study supports the usefulness of multiplex rt-pcr for virus detection and co-infection, and for implementation of a molecular monitoring system for endemic and epidemic viral respiratory infections. since the epidemic of severe acute respiratory syndrome (sars) in 2003, and the recent attention on possible influenza pandemics, sustained surveillance project was required to detect endemic, epidemic and newly emerging respiratory pathogens. the diagnosis of respiratory viruses mainly relies on molecular techniques. multiplex rt-pcr (mrt-pcr) techniques allow identification of a majority of respiratory viruses [8] [9] [10] as well as co-infections. 11, 12 in the present 2-year study, we used a five-tube mrt-pcr assay we implemented in the pasteur institute network in the asian region (http://www.pasteur-international.org/ip/easysite/ pasteur-international/activites-scientifiques/projets/tous-lesprojets/sisea), which covered 17 common respiratory viruses, 10 to identify viruses in nasopharyngeal specimens in 817 children with table 1 criteria of patient enrollment. children younger than 9-year old, first onset within 48 h, subjects already under antiviral treatment for any prophylactic or curative purpose and fever (t ≥ 38 • c) plus cough and/or sore throat and/or dyspnoea or tachypnea, cyanosis, cough, pleuritic chest pain, hypoxemia and signature of the patient consent agreement ari. sequencing primers specific to other fragments of viral genes were employed to amplify the positive samples for sequencing and phylogenetic analysis. the sequences showed the genetic variation of viruses circulating in the region, and identified the virus evolution and introduction of new variants. this study allowed cartography of viral etiology of a large panel of viruses that were co-circulating in ari in children in a district of shanghai, with the aim of implementing a monitoring system for endemic or epidemic viral respiratory infections. between october 1, 2006 and september 30, 2008 , all subjects aged <9 years, who presented with an ari syndrome and attended the outpatient ward of the pediatric department of shanghai nanxiang hospital, china, were enrolled prospectively. the protocol was approved by the ethical committee of shanghai nanxiang hospital and by the biomedical committee of institut pasteur in paris. written informed consent of a parent or a legal guardian was required. ari was defined as the presence of fever (at least 38 • c) plus cough and/or sore throat (table 1) . study enrollment was organized twice weekly (every monday and thursday); all patients who consulted on monday and thursday and presented with the above case definition were included in the study. upon enrollment, systematic recordings were made of the patients' demographic characteristics and medical history using a standardized questionnaire. the questions included detailed signs and symptoms, laboratory and radiology examinations; the presence of a chronic underlying disease; and family smoking history. after a complete physical examination, the children were classified into three different disease groups on the basis of signs and/or symptoms indicating the inflammation site: upper respiratory tract infection, bronchitis and pneumonia. patients and their parents were interviewed by the same doctor to obtain demographic data and information about their clinical presentation. for each ari case, nasopharyngeal swabs (npss) were obtained by the same nurse. specimens were collected with sterile cottontipped swabs that were introduced into the nostril and the pharyngeal areas, and then placed in 2 ml viral transport medium. the npss were then transported at 4 • c to the virology department of the institut pasteur of shanghai, where they were divided into aliquots, and stored at −80 • c. rna extraction-total rna from nps aliquots was extracted using a qiaamp viral rna minikit (qiagen, hilden, germany) in accordance with the manufacturer's protocol. purified rna was frozen at −80 • c in aliquots. multiplex rt-pcr-a mrt-pcr previously published was improved and employed in this study for virus detection. it was initially described by bellau-pujol et al. (2005) for 12 virus identification including iav, ibv, icv, rsv, hmpv, piv1-4, hcov-oc43 and 229e, and hrv in three tubes with hemi-nested pcr 8 then later improved by vabret et al. for 14 viruses plus with hcov-hku1 and hcov-nl63 in four tubes. 13 besides, the primers used for hrv detection could also detect hev, and the two viruses were then differentiated based on the sizes of the amplified products. the dna band with the size of 550-574 bp corresponded to rhinovirus while the band with the size of 600-700 bp corresponded to enterovirus. hence, the mrt-pcr could detect 15 viruses. the mrt-pcr multiplex 1 and the hemi-nested multiplex 1 detected 1 and 0.1 tcid50 of rsv a, respectively, and 0.01 and 0.001 tcid50 of influenza virus a/h3n2, respectively. 8 we have improved the method to detect 17 viruses in a fivetube mrt-pcr assay by introducing specific primers to adv and hbov. 14,15 moreover, we eliminated previous hemi-nested pcr step to avoid cross-contamination but introduced sequencing of amplification products. the assay was compared with commercialized resplex ii assay (qiagen) in previous study and its sensitivity reached 0.01 tcid50 of rsv b, 0.3 tcid50 of influenza virus a/h1n1, and 0.001 tcid50 of ibv, respectively. 12 tube 1 targeted iav, ibv, rsv, hmpv; tube 2, piv1-4; tube 3, hrv and icv; and tube 4, hcov-229e, hcov-oc43, hcov-nl63 and hcov-hku1. 8,10,12 tube 5 targeted adv and hbov using previously published primers: hbov (188f, 5 -gasctctgtaagtactattac-3 ; 542r, 5 -ctctgtgttgactgaatacag-3 ); adv (adhex1f, 5 -caacacctaygastacatgaa-3 ; adhex2r, 5 -acatccttbckgaagttcca-3 ). 14,15 rna was amplified using a one-step rt-pcr kit (qiagen) as previously described. 12 in brief, 2.5 l of extracted rna was mixed with a 5× buffer and 0.2 mm dntp, 0.2 m of each primer, and l l of enzyme mix, and depctreated ultrapure water was added to a final volume of 25 l. amplification programs included reverse transcription at 50 • c for 30 min, inactivation at 95 • c for 15 min, followed by 40 cycles at 94 • c for 30 s, 50 • c (tubes 1, 2 and 5) or 55 • c (tubes 3 and 4) for 30 s, 72 • c for 45 s and final extension at 72 • c for 10 min. the amplified dna products were detected by 0.5 g/l ethidium bromide/2% agarose gel electrophoresis. cloning and sequencing-sequencing primers were designed based on the conserved region of each virus or on previous publications [16] [17] [18] [19] [20] [21] (table 2) . extracted rna was amplified by specific monoplex rt-pcr following the same protocol as above, but with a hybridization temperature of 53 • c. the dna products were purified from agarose gels using qiaquick gel extraction kit (qiagen), and were ligated into pmd20-t vector (takara biotechnology, dalian, china). recombinant plasmids were sequenced by biosune sequence company and invitrogen biotechnology company in shanghai, china. phylogenetic analysis-multiple sequences were aligned using clustal x (v1.83). the multiple-sequence alignment was subjected to phylogenetic analyses using programs in the phylip package (v3.6). bootstrap analysis was performed using seqboot, in which replicate number was 1000. dnadist and neighbor were used to obtain a distance matrix; in dnadist, the transition/transversion ratio was 4. consensus trees were computed by consense, and then rerooted with retree. the final tree was visualized and edited with mega version 4. the patient data were analyzed using statistical package for the social sciences (spss) for window version 17.0 (spss inc. chicago, a viral etiology could be determined in 486 of the 817 (59.5%) patients. multiple viral infections were detected in 113 (13.8%) patients (94 with two pathogens, 18 with three pathogens, and one with four pathogens) ( table 3 ). among 486 virus-positive cases, 346 (71.2%) were diagnosed by clinicians as bronchitis, 135 (27.8%) as pneumonia, and 5 (1.0%) were diagnosed with upper respiratory tract infection. overall, 618 viral pathogens were detected: rsv was the most frequent pathogen (n = 120, 19.4%). the second to the fifth most frequent pathogens were hbov (n = 119, 19.3%); iv (iav and ibv) (n = 108, 17.5%); piv1, 3 or 4 (n = 77, 12.5%), and hrv (n = 73, 11.8%). hmpv (n = 44, 7.1%), adv (n = 43, 7.0%), hcov-oc43, 229e, nl63 or hku1 (n = 24, 3.9%). hev (n = 11, 1.8%) were also detected occasionally. among the 113 patients diagnosed with a multiple viral infection, the most frequent pathogens were hbov, rsv, hrv and adv (data not shown). the monthly distribution of viruses is presented in figs. 1 and 2. viruses were detected significantly more often during fall or winter than during other seasons (71% and 49%, respectively, p < 0.01). rsv and hbov identifications were most frequent in the fall and winter. iv showed a biannual distribution, one peak in winter and another in the summer. patients included in this study were aged from 1 month to 9 years. the median age was 3 years. rsv was more frequent in younger children (p = 10 −7 ) with 12 out of 23 virus-positive cases from 6 months to 2 years age group. no iav or ibv infection was detected in children younger than 1-year old (table 4 ). only 8 patients from 1 to 6 months age group were enrolled in the study. to identify the prevalent subtype of different viruses and the similarity of the virus strains, virus-positive samples were sequenced for target genes, when the amount of genetic material amplified was sufficient (table 5) , and phylogenetic trees were constructed (data not shown; dendrograms are available on request to table 4 . in 40 sequenced adv strains, 37 were species b (92.5%) and three were species c (7.5%). most of them were similar to serotype adv-2 (data not shown). in 65 hrv strains, 25 were species a (38.5%), five were species b (7.7%), and 35 were species c (53.8%). hrv showed high variation in nucleotide identity (73-100% in hrv-a, 75-82% in hrv-b, and 68-100% in hrv-c) as previously described (huang et al.) . 26 among 37 iav strains, 16 were seasonal h1n1 (95-99% nucleotide identity in the ha gene) and 21 were seasonal h3n2 (92-99% identity) strains. in 36 out of 55 ibv strains, ha and na gene fragments were sequenced, and comparison showed that the ibv strains were more conserved in the na gene (96-100% nucleotide identity) than ha gene (87-99% identity). only 17 out of 119 hbovs were sequenced but showed high nucleotide identity in the st2 gene as previously described. 7 the sequences of hcovs were highly conserved (94-100% nucleotide identity in hcov-nl63, 99% in hcov-229e). in 39 hmpv strains, 16 were genotype b1 (41%), 16 were genotype b2 (41%), and seven were genotype a1 (17.9%) with high nucleotide identity (98-99% in a1 and 97-100% in b1 and b2). only 27 out of 120 rsvs were sequenced and nucleotide sequence analysis of a glycoprotein gene fragment showed all of the strains were classified into rsv a subtype (data not shown). the results indicated a low variability of these viruses that circulated in the region during the 2-year period. among 486 virus-positive cases, 483 (99.4%) patients presented with high fever (>38 • c) and cough, 25 (5.1%) patients with dysresponse may be linked to a bacterial infection. no specific virus was associated to polynucleosis. from october 2006 to september 2008, 817 outpatients aged from 1 month to 9 years were included in a surveillance program of viral etiology in ari. less than 1% of the children enrolled in this outpatient study were aged of less than 6 months, suggesting that very young children may show more severe symptoms and hospitalized. fifteen different viruses were detected in 486 samples (59.5%). thus, respiratory viruses were the major pathogens responsible for ari in children in shanghai and multi-infections of different viruses (13.8%) were frequently observed. although serotype identification is critical for epidemiological surveillance, the serotyping is time consuming and costly, and limited due to cross-reactivity of the tests. we sequenced the fragments of genes coding for virus antigenic proteins and analyzed by phylogenetic analysis the sequence diversity to monitor the molecular evolution of circulating virus. during the outbreak of adv from march to june in 2008, the majority of strains (37 out of 40) was adv-b species and of serotype adv-2. in adv-b species, only serotype adv-14 was reported to cause severe infection, 22 which may partly explained that in our study adv-infected patients showed only mild symptoms. the iav strains detected during the period from january 2007 to april 2008 were mainly h3n2 but the strains detected from july 2008 to september 2008 were mainly h1n1. this suggests that subtype h1n1 replaced the h3n2 subtype and predominated during the next year in the region. as vaccination for seasonal influenza (iav h1n1, h3n2 and ibv) was not included in the children's routine vaccination program in shanghai, and was usually based on the strains circulating worldwide in the precedent summer, the local population was not protected against the new subtype that emerged in the summer of 2008. hrv is classified into three species: hrv-a, hrv-b and hrv-c by phylogenetic analysis based on sequences of vp4 gene and/or 5 utr. [23] [24] [25] a predominance of the newly identified species hrv-c (53.8%) and the recombinant strains were observed based on which two new subspecies of hrv-c were proposed as hrv-ca and hrv-cc. 26 this suggests the emergence of new variant strains of hrv in future that might cause a new epidemic. eleven hev were detected in the study but were not analyzed further. hmpv is another recently identified respiratory virus 27 and has been found worldwide. 28 it is grouped into four distinct genetic lineages based on the f gene: a1, a2, b1, and b2. 29 in this study, two strains of hmpv-a1, 11 strains of hmpv-b1 and two strains of hmpv-b2 were detected in the first season, whereas one strain of hmpv-a1, three strains of hmpv-b1 and 12 strains of hmpv-b2 were identified in the second season. no hmpv-a2 lineage was found. hence, a change of predominant lineage in the seasons was observed, but no association between the severity of infection and genetic drift of hmpv was found, as shown in other previous studies. 30, 31 besides, studies showed more sequence diversity in g and sh genes but not in f gene, 30 which could explain the constant incidence of hmpv infection in the population. hcov-hku1 (in group ii with hcov-oc43) and hcov-nl63 (in group i with hcov-229e) are two novel coronaviruses. 32, 33 during the present 2-year study, hcov-nl63 and hcov-229e were the major hcov circulating in shanghai, whereas only one strain of hcov-oc43 and one of hcov-hku1 were detected, indicating a sporadic introduction of group ii hcov to the region. in context that the recent emerged hcov, like hku-1 and sars whose sequence is more homologous to group ii virus, could cause severe respiratory infection, the surveillance for emergence of new species of hcov is necessary. the co-infection of rsv and hbov was frequently detected among the samples, whereas these two viruses co-dominated in cold season. hbov was the second most prevalent virus (24.5%), and the co-infection rate of hbov with other respiratory viruses was 54.6%, compared to 14% in non-hbov-infected patients. this was lower than the co-infection rate reported previously, which ranged up to 71%. [34] [35] [36] [37] a previous study showed that hbov increased the severity of bronchiolitis in children less than 1-year-old co-infected with rsv, and that it is not an occasional virus. 38 however, no correlation of hbov infection with clinical severity was observed in this and its related study. 7 one study carried out in wuhan, china analyzed peripheral blood samples by indirect immunofluorescence to detect rsv, iav, ibv, adv, piv1-3, chlamydia pneumonia and mycoplasma pneumonia in children ari inpatients and used viremia as sign of severe infection. 39 it showed that 36% of cases were co-infected by multiple agents and iav, ibv and piv1 were associated with co-infection. in addition, studies showed up to 30% of co-infection in hospitalized children 40 and rsv co-infection was associated with clinical severity. 38, 39 however, no such correlation was found in this study. this may be due to differences in the criteria of patient enrollment and in the lower severity of clinical signs observed. bacteria-virus co-infection was commonly found in inpatients. in our study, only polynucleosis (>10,000 on absolute count) was considered as a sign of bacterial infection and was observed in 30 patients infected with a respiratory virus. hence, future studies should focus on severe respiratory infection to identify viral determinants of disease severity and should introduce bacteriological test. up to 331 specimens were negative in mrt-pcr, despite all of them matched well with the inclusion criteria for ari. negative results could have resulted from the low load of viral material in samples, or to infection with bacteria instead of virus. new sensitive tools such as mass-tag 41 or high-throughput sequencing 42 have been developed recently to identify new viruses and bacterial pathogens. 43 implementation of these new molecular techniques for samples that are negative in mrt-pcr might be considered in the future. this is believed to be the first study in china to characterize 17 common respiratory viruses in pediatric ari during a 2-year consecutive period in a limited community with an important immigrant population. using mrt-pcr followed by sequencing and phylogenetic analysis, we could identify a wide variety of agents and differentiate highly pathogenic viruses from less virulent seasonal respiratory viruses. the sequence analysis result could be useful to improve the primer design for rt-pcr and to identify new subtype virus, for example hrv-c. it monitored sustaining virus circulation in the community, which could serve as a baseline of the annual distribution of viruses for surveillance of unusual prevalence of one specific virus. bronchiolitis-associated hospitalizations among us children trends in infectious disease mortality in the united states during the 20th century human rhinoviruses: the cold wars resume human bocavirus and acute wheezing in children human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in thailand serodiagnosis of human bocavirus infection correlation between bocavirus infection and humoral response, and co-infection with other respiratory viruses in children with acute respiratory infection development of three multiplex rt-pcr assays for the detection of 12 respiratory rna viruses direct screening of clinical specimens for multiple respiratory pathogens using the genaco respiratory panels 1 and 2 comparison of multiplex pcr assays and conventional techniques for the diagnostic of respiratory virus infections in children admitted to hospital with an acute respiratory illness evidence from multiplex molecular assays for complex multipathogen interactions in acute respiratory infections simultaneous detection of respiratory viruses in children with acute respiratory infection using two different multiplex reverse transcription-pcr assays human (non-severe acute respiratory syndrome) coronavirus infections in hospitalised children in france cloning of a human parvovirus by molecular screening of respiratory tract samples molecular identification of adenoviruses in clinical samples by analyzing a partial hexon genomic region a novel pancoronavirus rt-pcr assay: frequent detection of human coronavirus nl63 in children hospitalized with respiratory tract infections in belgium human metapneumovirus infection in hospitalized children with acute respiratory disease in korea detection and characterization of new influenza b virus variants in 2002 cocirculation and evolution of two lineages of influenza b viruses in europe and israel in the 2001-2002 season a diverse group of previously unrecognized human rhinoviruses are common causes of respiratory illnesses in infants genetic clustering of all 102 human rhinovirus prototype strains: serotype 87 is close to human enterovirus 70 acute respiratory disease associated with adenovirus serotype 14-four states clinical features and complete genome characterization of a distinct human rhinovirus (hrv) genetic cluster, probably representing a previously undetected hrv species, hrv-c, associated with acute respiratory illness in children distinguishing molecular features and clinical characteristics of a putative new rhinovirus species, human rhinovirus c (hrv c) multiplex masstag-pcr for respiratory pathogens in pediatric nasopharyngeal washes negative by conventional diagnostic testing shows a high prevalence of viruses belonging to a newly recognized rhinovirus clade evidence of recombination and genetic diversity in human rhinoviruses in children with acute respiratory infection a newly discovered human pneumovirus isolated from young children with respiratory tract disease human metapneumovirus: a newly emerging respiratory pathogen antigenic and genetic variability of human metapneumoviruses genetic variability of human metapneumovirus infection: evidence of a shift in viral genotype without a change in illness the role of human metapneumovirus in upper respiratory tract infections in children: a 20-year experience characterization and complete genome sequence of a novel coronavirus, coronavirus hku1, from patients with pneumonia identification of a new human coronavirus human bocavirus detection of human bocavirus in hospitalised children human bocavirus infections in hospitalized children and adults high incidence of human bocavirus infection in children in spain respiratory syncytial virus, human bocavirus and rhinovirus bronchiolitis in infants multipathogen infections in hospitalized children with acute respiratory infections sole pathogen in acute bronchiolitis: is there a role for other organisms apart from respiratory syncytial virus? diagnostic system for rapid and sensitive differential detection of pathogens a metagenomic survey of microbes in honey bee colony collapse disorder a new arenavirus in a cluster of fatal transplant-associated diseases the study was supported by the li ka-shing foundation (respari network) for discovery of new emerging viruses, the french agency for the development for surveillance and investigation of epidemic situations in southeast asia (sisea project), the national science and technology major project (2009zx10004-105) of the chinese ministry of health for the establishment of pathogen and immuno-response detection platforms for respiratory and central nervous system viral infections, the areva foundation which supports the salary of dr. wei wang. we thank drs. franç ois freymuth (virology laboratory, chu caen, france) and sylvie van der werf (national reference center for influenza virus in northern france, institut pasteur paris), and dr. jean-claude manuguerra (urgent response to biological threats) for having facilitated this work. we also thank y.m. zheng for manuscript preparation. the authors declare no conflict of interest. key: cord-336237-hmczy0am authors: kitagawa, yutaro; orihara, yuta; kawamura, rieko; imai, kazuo; sakai, jun; tarumoto, norihito; matsuoka, masaru; takeuchi, shinichi; maesaki, shigefumi; maeda, takuya title: evaluation of rapid diagnosis of novel coronavirus disease (covid-19) using loop-mediated isothermal amplification date: 2020-05-21 journal: j clin virol doi: 10.1016/j.jcv.2020.104446 sha: doc_id: 336237 cord_uid: hmczy0am with the rapid spread of severe acute respiratory syndrome coronavirus 2 (sars-cov-2), there is an urgent need for more rapid and simple detection technologies at the forefront of medical care worldwide. in this study, we evaluated the effectiveness of the loopamp® 2019-sarscov-2 detection reagent kit, which uses loop-mediated isothermal amplification (lamp) technology. in this protocol, cdna is synthesized from sars-cov-2 rna using reverse transcriptase, followed by dna amplification under isothermal conditions in one step. the rt-lamp test kit amplified the targeted rna of a sars-cov-2 isolate with a detection limit of 1.0 × 101 copies/μl, which was comparable to the detection sensitivity of quantitative reverse transcription pcr (rt-qpcr). comparison with the results of rt-qpcr for 76 nasopharyngeal swab samples from patients with suspected covid-19 showed a sensitivity of 100% and a specificity of 97.6%. in the 24 rna specimens derived from febrile japanese patients with or without influenza a, no amplification was observed using rt-lamp. rt-lamp could be a simple and easy-to-use diagnostic tool for the detection of sars-cov-2. severe acute respiratory syndrome coronavirus 2 (sars-cov-2), which causes coronavirus disease 2019 (covid-19), has emerged as a serious threat to human health worldwide [1, 2] . with the rapid increase in the number of patients, a reliable, rapid, and simple detection system for sars-cov-2 is needed that can be used in all medical institutions as quickly as possible [3] . loop-mediated isothermal amplification (lamp)-based analysis, which can be performed without a thermal cycler, is suitable for the diagnosis of infectious diseases as a point-of-care test in resource-limited settings [4, 5] . in particular, the use of bst dna polymerase with high strand displacement activity, to which reverse transcriptase (rt) activity has also been added, makes amplification of specific viral rna possible in one step at a constant temperature. this study examined the usefulness of a commercially available rt-lamp-based diagnostics kit for covid-19 (loopamp ®︎ 2019-sars-cov-2 detection reagent kit; http://loopamp.eiken.co.jp/), with the view that if the approach proves feasible, it could support the rapid detection of sars-cov-2. to evaluate the analytical sensitivity of the rt-lamp method, we used purified and quantified total rna of sars-cov-2, which was provided by the national institute of infectious diseases, japan, as a standard specimen for the molecular diagnosis of covid-19. analytical sensitivity was determined using 10-fold serially diluted standard rna ranging from 1.0 × 10 3 copies/μl to 1.0 copy/µl and stored at -30 °c until required. the specificity of the rt-lamp reaction was evaluated using 12 rna samples extracted from nasopharyngeal swabs taken from patients with influenza a at saitama medical university hospital, japan, from november to december 2019. in addition, 12 rna samples negative for influenza a from febrile japanese patients during the same period were also used in this study. during this sampling period, there were no cases of covid-19 in japan. the rt-lamp reaction was performed using the same kit and conditions described above. a 10-fold serial dilution of sars-cov-2 rna was amplified to determine the lower limit of detection with the rt-lamp kit. figure 1 shows the results for the detection of real-time turbidity with the la-200 turbidimeter. the minimum amount of rna detected was 1.0 × 10 1 copies/µl, which was achieved within 35 min in this procedure. after measurement, turbidity of the reaction solution could be observed visually under natural light (fig. 2) . based on the analysis of conventional rt-qpcr, 30 of the 76 patients were identified as positive for sars-cov-2; the median ct value obtained was 30.85 (interquartile range, 25.31 to 36.08). of the 76 patients who underwent conventional rt-qpcr, 32 were positive and 44 were negative by rt-lamp. as shown in table 1 , the agreement between rt-qpcr and rt-lamp was 97.4% (74/76). among them, 2 patients were found to be negative with rt-qpcr but positive with rt-lamp. in the 24 rna specimens derived from febrile japanese patients with or without influenza a, no amplification was observed using rt-lamp. rt-qpcr is a sensitive and specific nucleic acid amplification method that can be used to diagnose emerging viral infections, including covid-19. however, it requires trained personnel, expensive equipment, and an extended period of time to generate test results. conversely, rt-lamp is extremely convenient to use (the isothermal reaction requires a simple heating device) and produces rapid results (within 30-60 min). in addition to these advantages, the amplification products generated by the rt-lamp test kit can be detected by turbidity under natural light. in this study, we found that the detection limit of the rt-lamp test kit was 1.0 × 10 1 copies/µl within 35 min with real-time detection of its amplification products. previous studies using the same molecular diagnostic strategy reported sensitivity ranging from 2.0 × 10 1 to 1.0 × 10 2 copies/reaction, indicating that this rt-lamp test kit has extremely high sensitivity and is also valuable for diagnosis, in terms of not only its convenience but also its detection sensitivity [7, 8] . it is highly specific because it uses a set of four primers that recognize at least six different sequences in sars-cov-2 rna. in the present study, it was considered that there was no nonspecific amplification with the rt-lamp test kit. the results for two samples, re-collected at more than 1 week after the initial sars-cov-2-positive result, were inconsistent with those for rt-qpcr (rt-lamp was positive, whereas rt-qpcr was negative). this phenomenon may depend on the concentration gradient or the aspiration rate in the rna extracts because the amount of sample used for rt-qpcr was 5 μl, while that used for rt-lamp was 10 μl. masaru matsuoka: prepared the manuscript, providing scientific guidance. shinichi takeuchi: provided scientific guidance, reviewed and edited shigefumi maesaki: provided scientific guidance clinical features of patients infected with 2019 novel coronavirus in wuhan, china early transmission dynamics in wuhan, china, of novel coronavirus-infected pneumonia exploring the reasons for healthcare workers infected with novel coronavirus disease 2019 (covid-19) in china operational feasibility of using loop mediated isothermal amplification (lamp) for the diagnosis of pulmonary tb in microscopy centers of developing countries evaluation of a simple loop mediated isothermal amplification test kit for the diagnosis of tuberculosis manual for the detection of pathogen 2019-ncov ver.2.6 development of reverse transcription loopmediated isothermal amplification (rt-lamp) assays targeting sars-cov-2 rapid and visual detection of 2019 novel coronavirus (sars-cov-2) by a reverse transcription loop-mediated isothermal amplification assay none.j o u r n a l p r e -p r o o f all authors have no conflicts of interest to declare. the authors declare that they have no competing interests. key: cord-349541-7g50vg14 authors: poulikakos, dimitrios; sinha, smeeta; kalra, philip a. title: sars-cov-2 antibody screening in healthcare workers in a tertiary centre in north west england date: 2020-07-07 journal: j clin virol doi: 10.1016/j.jcv.2020.104545 sha: doc_id: 349541 cord_uid: 7g50vg14 nan please cite this article as: poulikakos d, sinha s, kalra pa, sars-cov-2 antibody screening in healthcare workers in a tertiary centre in north west england, journal of clinical virology (2020), doi: https://doi.org/10.1016/j.jcv.2020.104545 this is a pdf file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. this version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. in brief, we used a fully automated ce marked chemiluminescent immunoassay (snibe, shenzhen, china) (2) and the analysis was performed by medical diagnosis ltd, in conjunction with affinity biomarker labs. in total 281 hcw from the renal (242) and biochemistry (39) departments were tested between 4th and 6th may 2020. 205 (73%) were females, 55 (19·6%) were of black, asian or minority ethnic origin (bame), 25 (8·9%) did not declare ethnicity and 195 (69·4%) were dipc. a history of symptoms compatible with sars-cov-2 was reported by 103 (36·7%). amongst the 22 (7·8%) hcw with previous sars-cov-2 pcr nasopharyngeal swabs, 2 were positive, 12 were negative, and 7 did not disclose the result. positive sars-cov-2 igg was detected in 17 (6%) hcw and 6 (35·3%) had been asymptomatic. all igg positive cases were in dipc hcw (17 out of 195; 8·7%). six of 55 (10·9%) bame hcw were igg positive versus 10 of 201 (5%) caucasian hcw (p = 0·120) whereas 6 of 75 (8%) were males versus 11 of 205 (5·4%) females (p = 0·384). one igg positive hcw did not disclose ethnicity. england most likely reflect general community transmission rather than hospital exposure sars-cov-2-specific antibody detection in healthcare workers in germany with direct contact to covid-19 patients hospital-wide sars-cov-2 antibody screening analytical performances of a chemiluminescence immunoassay for sars-cov-2 igm/igg and antibody kinetics first experience of covid-19 screening of health-care workers in england evaluating the national ppe guidance for nhs healthcare workers during the covid-19 pandemic key: cord-349921-v1tewoi0 authors: giorgi rossi, paolo; broccoli, serena; angelini, paola title: case fatality rate in patients with covid-19 infection and its relationship with length of follow up() date: 2020-05-05 journal: j clin virol doi: 10.1016/j.jcv.2020.104415 sha: doc_id: 349921 cord_uid: v1tewoi0 nan in their systematic review on the clinical characteristics of covid-19, wu and colleagues report a 3.2% case fatality rate (cfr), ranging from 2% to 4% 1 with strong heterogeneity between studies (i 2 =100%). one study from the initial phase of the epidemic in wuhan showed higher cfr and was responsible of the heterogeneity of results. 2 the authors suggest that higher complication and fatality rate in wuhan could be due to the limited clinical experience in the initial phase of the epidemic. when comparing data from china to those from italy, cfr is the most impressive difference, with data from italy, and now also from other european countries, 3 reporting rates three to ten times higher than in china. 1, 4 other studies tried to justify this difference as due to the extremely old italian population and provided similar age-specific cfr in the two countries. 5 but this was in an initial phase of the epidemic, when official statistics reported 7.2% cfr in italy. now overall cfr reported by routine statistics in italy, spain, uk, the netherlands and france is over 10% 1 and it is difficult to justify the difference only with the older age of patients. here we propose a simple explanation: the length of follow up. we report data from the covid-19 information system set up in italy by the national institute of health and described elsewhere, 5,6 diagnosed from february 20 to march 29 and followed up to april 5 in emilia-romagna region (approximately 4.5 million inhabitants). briefly the dataset collects individual information on date of symptom onset, rt-pcr test, hospitalization, intensive care admission, death or recovery for all sar-2-cov rt-pcr positive patients in italy. the cfr increases with the length of follow up of cases, from 8% for cases diagnosed between march 23 and march 29, to about 20% for those diagnosed from february 20 to march 8 (table 1) . including only cases with symptom onset (or laboratory diagnosis, when symptom onset was not reported) before march 15, ie with at least 22 days of follow up, we constructed a frequency distribution of the distance from symptom onset to death (figure1a). the median in this subpopulation is 12 days. the definition of clinically recovered patients includes patients with two consecutive negative swabs and those who had no symptoms in the preceding three days at least. the median time to recovery is 20 days. given that the minimum follow up in this cohort is 22 days, we are by far underestimating the median time to recovery. our data show that, according to the italian definition of covid-related death, 5,6 the cfr can reach about 20% if we follow up patients for a long enough time to observe the vast majority of deaths. these findings are identical to those in other italian regions. 6 it is possible that italian surveillance is now testing only severe cases, thus overestimating cfr, but the increase with increasing observation time is probably generalizable to other case definitions. unfortunately, previous studies did not focus on this point. prevalence and severity of corona virus disease 2019 (covid-19): a systematic review and meta-analysis clinical features of patients infected with 2019 novel coronavirus in wuhan an interactive web-based dashboard to track covid-19 in real time clinical characteristics of coronavirus disease 2019 (covid-19) in china: a systematic review and meta-analysis case-fatality rate and characteristics of patients dying in relation to covid-19 in italy epidemiological characteristics of covid-19 cases in italy and estimates of the reproductive numbers one month into the epidemic the following are members of the emilia-romagna covid-19 working group: andrea mattivi, giulio matteo, key: cord-313821-5f5b107l authors: poelman, randy; schölvinck, elisabeth h.; borger, renze; niesters, hubert g.m.; van leer-buter, coretta title: the emergence of enterovirus d68 in a dutch university medical center and the necessity for routinely screening for respiratory viruses date: 2014-11-15 journal: j clin virol doi: 10.1016/j.jcv.2014.11.011 sha: doc_id: 313821 cord_uid: 5f5b107l background: since august 2014, an increase in infections caused by enterovirus d68 (ev-d68) was reported in the usa and canada, for the most part in children presenting with severe respiratory symptoms. objectives: to determine whether an increase in severe ev-d68 respiratory infections was observed in our region. study design: samples from patients with respiratory symptoms were screened for viral pathogens, including rhinovirus and enterovirus. subsequently, samples positive for rhinovirus and enterovirus were routinely sequenced for phylogenetic analysis. furthermore, an additional method was used to detect ev-d68 specifically. results: during the first three quarters of the year 2014, 1896 respiratory samples were analyzed; 39 (2%) of them tested positive for enterovirus. eighteen samples tested positive for ev-d68, obtained from 16 different patients admitted to our hospital. eleven were children below the age of 18, of whom five children needed intensive care treatment. the remaining five samples were from adults, who all had an underlying disease; three were transplant patients (heart, lung and renal transplantation), the other two had an underlying lung condition (copd, asthma). phylogenetic analysis showed a close relationship with the strains circulating currently in the usa, all belonging to the known ev-d68 genetic subtypes. conclusions: we observed an increase of ev-d68 infections in our population, both in children as well as in adult. in 2014 there have been 16 cases so far, compared to none in 2011 and 2013 and a single case in 2012. phylogenetic analysis identified two similar clusters as shown in the usa and canada. since august 2014, an increase in infections caused by enterovirus d68 (ev-d68) has been reported in the usa and canada. in this outbreak, the majority of samples analyzed are from children with severe respiratory illness, many of whom have symptoms of wheezing. also, some fatalities have been documented [1] . in the years 2009 and 2010, our hospital in the northern part of the netherlands was confronted with an increase in respiratory illness, which was not only seen in our tertiary care hospital, but also regionally [2] . an outbreak of ev-d68 was shown to be the cause of the increased incidence of respiratory infections. because ev-d68 was not detected by our routine respiratory panel at that time, we added an enterovirus pcr into our routine screening panel of 14 respiratory viruses (influenza a, influenza b, parainfluenzavirus 1-4, coronaviruses oc43, nl63 and 229e, adenovirus, bocavirus, rsv-a, rsv-b and human metapneumovirus). moreover, we expanded our testing by routinely sequencing all enterovirus and rhinovirus strains to identify virus strains and to chart outbreaks and transmission patterns. adding to this sequencing strategy, we included noroviruses as well as parechoviruses. nationally, a structure called typened was available through the dutch national institute of health (rivm) [3] . furthermore, by using our regional sequencing and epidemiological strategy, called regiotype, we were able to speed up the flow of information from our region, including hospitals and public health services covering the (not densely populated) northern part of the netherlands. the aim of this regiotype strategy is to provide a rapid sequencing http://dx.doi.org/10.1016/j.jcv.2014.11.011 1386-6532/© 2014 the authors. published by elsevier b.v. this is an open access article under the cc by-nc-nd license (http://creativecommons.org/licenses/by-nc-nd/3.0/). service for the whole region. this not only completes our diagnostics with sequencing data, but as clinical data are fed back into our database, we create a source of information which serves to obtain more insights in epidemiology patterns. recently, the european center for disease prevention and control (ecdc) concluded in a "rapid risk assessment" [4] that no epidemic clusters of severe disease caused by ev-d68 in eu/eea countries were observed and that a moderate risk of ev-d68 was expected. the ecdc rapid risk assessment attributes the low level of reporting of ev-d68 to the low number of laboratories which routinely screen respiratory samples for ev-d68. subsequently, only a small number of ev-d68 cases (11) are observed in the netherlands during the enterovirus 'peak season' in 2014, through both the entero-surveillance and the ili/ari surveillance networks [5] . however, we are observing an increase in infections caused by ev-d68 in our tertiary care hospital since may 2014, similar to the outbreak in the usa and canada. to improve the specific diagnostics for ev-68, we developed a specific real-time pcr method. to determine the circulation of ev-d68 in our region, during a time when an outbreak of this virus is ongoing in north america, and to develop an ev-d68 specific pcr method. samples from patients with respiratory symptoms, are routinely screened for several viruses, including influenza a and b, rsv type a and b, metapneumovirus, parainfluenzavirus type 1-4, coronavirus (oc43, 229e and nl63), adenovirus, bocavirus, rhinovirus and enterovirus. during the first three quarters of the year 2014, 1896 respiratory samples were analyzed. samples that tested positive for enterovirus were selected for sequencing. all primary patient materials sent to our laboratory for analysis of respiratory viruses, are routinely screened for rhinovirus and enterovirus by a laboratory developed real-time pcr that amplifies a 116 bp fragment of the 5 ntr region of both rhinovirus and enterovirus. differentiation between both viruses is done by the use of highly specific probes containing locked nucleic acids (lna) at the 5 terminus (table 1) . rna was extracted from 190 l sample with the addition of 10 l internal control, phocine distemper virus (pdv), using the nuclisense easymag (biomérieux, lyon, france). pcr was performed in a total reaction volume of 25 l using 10 l rna, 1xtaqman ® fast virus 1-step master mix (applied biosystems, foster city, ca, usa), 750 nm forward and reverse primer for rhinovirus/enterovirus, 250 nm rhinovirus probe, 125 nm enterovirus probe each, 300 nm forward and reverse primer for pdv, 100 nm probe for pdv and dnase/rnase free water (sigma). reactions were run on an abi7500 using the profile of 2 min 50 • c, 20 s 95 • c, followed by 45 cycles of 3 s 95 • c and 32 s 60 • c. rhinovirus and enterovirus positive samples were routinely typed by sequencing. identification of the rhinovirus strains was done by amplification and sequencing of a 549 nucleotide fragment spanning the hyper variable part of the 5 ntr, the entire vp4 gene and the 5 terminus of the vp2 gene with primers described by savolainen et al. [6] . identification of the enterovirus strains was done by amplification and sequencing of 350-400 basepairs part of the vp1 gene as has been described by nix et al. [7] . an automated dna sequencer was used (abi 3130xl). sequence data were analyzed with sequencing analysis (version 5.3; abi) and subsequently phylogenetic analysis was performed using bionumerics software 6.6 (applied maths, sint-martens-latem, belgium). to support initiatives for the rapid and specific detection of ev-d68, a real-time pcr was developed for fast detection of ev-d68. primers and probes were developed using a clustalw2.0 alignment of all currently available 5 non coding region (ncr) sequences in the ncbi database and primer express 3.0 software (applied biosystems). twenty-two samples, spanning a period from 2010 to 2014, previously detected by rt-pcr and identified with ev-d68 by sequencing, were tested for validation. for determining specificity, six currently circulating human rhinovirus (hrv) strains of the genogroups a, b and c (hrv-a38, hrv-a43, hrv-b17, hrv-b70, hrv-c2 and hrv-c18) and 11 samples from 2014 containing different enterovirus species (cv-a2, cv-a4, cv-a6, cv-a10, cv-a11, cv-b4, e-3, e-16, e-25, ev-c105 and ev-c117) were included in testing, as well as five reference strains provided by the dutch national institute of health (cv-a12, cv-a15, e-5, e-11 and the ev-d68 reference fermon strain). sample types included were sputum, nasopharynx, flocked swab, stool and cerebrospinal fluid. rna was extracted as described previously. pcr was performed in a total reaction volume of 25 l using 10 l rna, 1xtaqman ® fast virus 1-step master mix (applied biosystems, foster city, ca, usa), 600 nm forward and reverse primer for evd68, 200 nm ev-d68 probe each (table 3) and dnase/rnase free water (sigma). reactions were run on a abi7500 as follows: 15 min 50 • c, 20 s 95 • c, followed by 45 cycles of 5 s 95 • c, 5 s 50 • c and 45 s 60 • c. since the beginning of 2014, 1896 respiratory samples were tested, of which 39 (2%) were positive for enterovirus. eighteen samples tested positive for ev-d68, obtained from 16 different patients admitted to our hospital. (table 2 ). eleven cases were children of whom five presented with severe respiratory illness, requiring intubation and mechanical ventilation. of these five severely ill children, two (aged 1 year and 1 year/7 months) had been previously healthy and two were ex-prematures (aged 3 years/10 months and 1 month). one of the previously healthy children (patient 6) was given resuscitation prior to admission to the pediatric intensive care unit. one child had sickle cell anemia as underlying condition (3 years/9 months). two children were admitted with a moderately severe bronchiolitis-type respiratory infection with wheezing and shortness of breath. four children had mild respiratory infections with common cold-symptoms only. these children all had underlying conditions for which they were admitted to our hospital. interestingly, two of these children (patient 8 and 9) acquired the infection several days after admission. the sequences of these isolates were identical with the sequence of patient 7 (genbank accession numbers: km887895, km887898 and km887899). both patient 8 and 9, were admitted to the same pediatric intensive care unit during the same period as the admission of patient 7, which suggests nosocomial transmission. five cases of ev-d68 infections were from adults. all adult patients had underlying conditions predisposing them to respiratory tract infections. one patient was a heart transplantation patient, one was a lung transplant patient, one was a kidney transplantation patient, one had asthma and one had chronic obstructive pulmonary disease (copd). all five adults had to be admitted to the hospital with symptoms of cough, shortness of breath and wheezing. the patient with a kidney transplant (patient 16) had radiological signs compatible with pneumonia. in all 16 cases, the diagnosis of ev-d68 infection was made following a positive pcr result for enterovirus and subsequent sequencing. ev-d68 partial vp1 sequences were submitted to genbank, accession numbers: km887894-km887906 and km924544-km924547. we tested 1896 respiratory samples in our laboratory during the first three quarters in 2014. 39 (2%) samples were tested positive for enterovirus. different enterovirus types were isolated, of which 18 samples were ev-d68 (table 3) the ev-d68 test was highly specific, all strains were tested negative for types other than ev-d68 as described in section 2. the assay was designed in the 5 ncr. all clinical samples of 2014 which tested positive in the standard ev assay and subsequently typed as ev-d68, were also tested positive in the ev-d68 specific pcr. table 3 enteroviruses detected from respiratory samples, umcg 2014. number of samples total 39 a nd, not defined. phylogenetic analysis shows that 3 out of the 17 sequences correspond with clade a and 14 out of 17 sequences with clade b, as described by tokarz et al. [8] . none of our sequences corresponded with clade c. usa strains correspond with both, clade a and clade b, suggesting that similar strains are currently circulating in the usa and europe (fig. 2) . in this paper, we presented 16 cases of respiratory ev-d68 infections in the northern part of the netherlands in 2014. these patients were in most cases admitted to the hospital because of a serious respiratory illness. of these 16 cases, five were children with a life-threatening respiratory illness. we also noted five ev-d68 infections in adults, all with underlying conditions, predisposing to more severe respiratory illness. three were transplantation patients and two had pulmonary conditions. all of these five adults required hospital care for respiratory infections. this upsurge of respiratory infections caused by ev-d68 was similar to what was seen in our hospital in 2009 and 2010 [2] . more importantly, the 2014 ev-d68 upsurge in our hospital occurred during a time period while a large ev-d68 outbreak took place in the usa and canada, involving around a thousand children. also in the usa, only the children admitted to the hospital were tested and reported. we expect that the number in north america could be higher if the adult population with severe respiratory illness were included. the incidence of ev-d68 observed in our hospital, which is located in the least densely populated part of the netherlands, is contrasted by the low number of reported ev-d68 infections in rest of the netherlands, while no data are known about the current situation in europe [4, 5] . after all, it seems unlikely that ev-d68 is causing problems only in the usa, canada and the northern part of netherlands, without affecting other european regions. in the 2009-2010 upsurge, a number of children became severely ill. moreover, it was then shown that 21% of the cases were hospital acquired, which highlights the need for testing of not only patients with severe respiratory disease, but also patients with mild symptoms, who may spread the virus. similarly, in the current 2014 study, we possibly witnessed in-hospital transmission of ev-d68 from one severely ill child to two children who developed mild respiratory symptoms. the low number of reported ev-d68 infections in europe may be caused by the overall low circulation of ev-d68. however, it could also be caused by the under-diagnosis of ev-d68 infections due to insufficient sampling of patients with respiratory illness, or an insufficient detection of this virus in routine screening panels, whether using laboratory developed tests (ldts) or commercial assays. from qcmd quality assurance data, it is known that the respiratory virus testing performed in a number of laboratories failed to detect ev-d68 (dr. paul wallace, personal communication, qcmd, glasgow, united kingdom). the recent ecdc report claims that the circulation of ev-d68 in europe is low, thus has to be viewed in the context of a near absent detection of this pathogen [4] . in addition, the potential for undersampling has to be considered. although no exact data exists on underdiagnoses as yet, it is our experience that clinicians, at least in the netherlands, are discouraged from performing diagnostic tests for patients presenting with probable viral illnesses because of financial constraints. and if testing is done, only influenza virus and rsv are preferably tested. a recent initiative by the european society for clinical virology (escv) in collaboration with the ecdc was started to investigate the prevalence of ev-d68 in europe. further epidemiological information is needed on a larger scale than currently available to determine the circulation for this virus. the implicit risk of focusing on a limited number of viruses for diagnostic purposes, or not performing virological diagnostics at all, is contestable. patients with an underlying disease, whether children, transplant patients, or patient with a chronic respiratory condition, are not getting optimal care if the diagnostic options are limited or even absent. therefore, a diagnostic stewardship program should be discussed asides antimicrobial stewardship and an infection control programs, which are currently being introduced in many hospitals [9] . we have documented upsurges of ev-d68 associated with sometimes severe morbidity twice in the last 5 years, i.e. in 2009/2010 and in 2014. it can be anticipated that the virus will reappear regularly and therefore diagnostic assays, whether ldts or commercial assays, should be able to detect this virus. the ev-d68 specific assay we describe in this paper, may be used for this purpose. all 16 cases described in this paper were diagnosed as ev-d68 infections by following routine protocols of our laboratory, in which respiratory samples are tested for enterovirus along with 14 other respiratory targets, and all enterovirus isolates are routinely sequenced. our sequencing data, compared to the usa sequence data, suggest that similar strains are circulating in the usa and europe. in conclusion, by following a routine protocol of screening respiratory samples for enterovirus and sequencing, we not only identified ev-d68 as the cause of 16 respiratory infections in our hospital, but we also were able to show a potential link with the ongoing ev-d68 in north-america. ev-d68 is associated with at times severe respiratory illness. adequate surveillance for viruses like ev-d68 which can cause severe respiratory illnesses, is therefore desirable for university medical centers and reference centers. a collaborative approach effort between the diagnostic and reference laboratories could be taken to achieve this. the ev-d68 specific assay we present in this paper may aid in the assessment of the real prevalence of this virus in our population, both in children and adults. no funding was received for this study. upsurge of human enterovirus 68 infections in patients with severe respiratory tract infections laboratory-based surveillance in the molecular era: the typened model, a joint data-sharing platform for clinical and public health laboratories european centre for disease prevention and control. enterovirus d68 detections in the usa and canada -first update 15 continued seasonal circulation of enterovirus d68 in the netherlands genetic clustering of all 102 human rhinovirus prototype strains: serotype 87 is close to human enterovirus 70 sensitive, seminested pcr amplification of vp1 sequences for direct identification of all enterovirus serotypes from original clinical specimens worldwide emergence of multiple clades of enterovirus 68 navigating the web in search of resources on antimicrobial stewartship in healthcare institutions the development of a qualitative real-time rt-pcr assay for the detection of hepatitis c virus the authors have no competing interests to report. no ethical approval was required for this study. key: cord-349782-djzxkus2 authors: van kasteren, puck b.; van der veer, bas; reusken, chantal b.e.m.; meijer, adam title: response to letter of concern by oladimeji and pickford of primerdesign date: 2020-06-29 journal: j clin virol doi: 10.1016/j.jcv.2020.104526 sha: doc_id: 349782 cord_uid: djzxkus2 nan a national institute for public health and the environment (rivm) center for infectious disease control (cib) bilthoven, the netherlands 24 june 2020 over the past months, our experienced team of technicians has worked tirelessly to provide diagnostic support to our national healthcare community. on top of this, they have dedicated their time to providing the global diagnostic community with a much needed initial comparison of commercially available covid-19 rt-pcr kits, which was recently published in the journal of clinical virology (1). we strongly object to the suggestion that our work was methodologically flawed, but thank dr. oladimeji and dr. pickford of primerdesign (2) for providing us here with the opportunity to add some additional clarifying notes to our study. similar to the find initiative (3), although less in number, we have used a selection of archived clinical samples to obtain retrospectively an indication of the diagnostic performance of the evaluated kits (we used the terms clinical sensitivity and specificity to express the diagnostic performance with clinical samples). our study was performed under strictly controlled circumstances to exclude influence of confounding factors on the results. rna was extracted anew from the selected archived samples simultaneously, aliquoted, and stored at -20°c for a maximum of 4 weeks. in our extraction process we add yeast trna to stabilize the extracted rna. a fresh aliquot of this single batch was thawed for each run of rt-pcr kits and our in-house reference assay, thus guaranteeing inter-assay equivalency. in case a process control for the pcr component of the kit was included, this was measured. without exception these provided a positive result in all samples, in the case of primerdesign ranging between ct 23.26-25.17. thus indicating that the call of a negative result in samples that were in fact positive was not due to pcr issues. obviously, our selection of 13 sars-cov-2-positive clinical samples does not reflect the variation encountered in the field, especially since we specifically included several samples with relatively high ct values. precisely to assess clinical performance with those viral loads where differences between kits become apparent. for this reason, we deliberately refrained from expressing the observed detection rate as a percentage, as this would imply that we had determined the precise diagnostic performance in clinical sensitivity, which we did not. however, in the discussion section we do speculate that the detection rate we observe would translate to a clinical sensitivity in the field of >96% for all kits, as only 3.6% of clinical samples in our database have a ct value >34.5 with our in-j o u r n a l p r e -p r o o f house rt-pcr and all kits detected samples with ct values <34.5 with our in-house rt-pcr. this finding is perfectly in line with the clinical sensitivity of 100% (95% confidence interval: 93-100) found for most of the assays including primerdesign by the find initiative (4) . notably, the find initiative protocol (3) and the presented results for primerdesign and other kits (4) do not provide information regarding the composition of the 50 positive samples included in the study and no information on viral loads using e.g. reference ct values. it is therefore unclear to what extent these find samples do provide a true reflection of the variation in the field and especially on viral loads that are only detected by highly sensitive tests such as our in-house test. if only samples from patients in the hospital setting that have relatively high viral loads have been selected, every kit will score a near 100% diagnostic clinical sensitivity. we have specifically sought for the clinical performance using samples that have a viral load around the lod of the kits. regarding the preliminary limits of detection (lods) determined in our study, we do not agree that there are major differences compared to what was found by the find initiative (4). we agree that our assessment is less precise than that by the find initiative due to the lower number of replicates tested, but the point estimate still provides comparable information. in the find study, the vast majority of assays fall in the highest banding of 1-10 copies/reaction (4). this banding allows for a 10-fold difference between kits. in our study we observe a mere 6-fold difference between the lowest and highest lods, which is thus again in good agreement with the results of the find initiative. our finding that the rt-pcr kit with the best analytical sensitivity (altona) did not detect the clinical samples with the highest ct values in our in-house assay, highlights the importance of determining both analytical sensitivity using quantified standards and diagnostic clinical sensitivity using samples representing the complete range of viral loads detected in clinical practice during kit validation. considering the controlled set-up of our comparative study we strongly disagree that the comparative lods we reported are unverified. in conclusion, we performed this study to confirm that commercially available covid-19 rt-pcr kits are suitable for use in the field, not to provide a ranking of various competitors in this currently exploding field. we were content that all of the kits included in our assessment passed the basic requirements and explicitly note that more elaborate clinical evaluation in different settings (e.g. comparison of seven commercial rt-pcr diagnostic kits for covid-19 comparison of seven commercial rt-pcr diagnostic kits for covid-19 comparative evaluation of molecular tests that directly detect the nucleic acid of sars-cov-2 find. sars-cov-2 molecular assay evaluation: results. available at national institute for public health and the environment (rivm), bilthoven, the netherlands declarations of interest: none key: cord-353640-giznbcpd authors: barza, ruby; patel, parul; sabatini, linda; singh, kamaljit title: use of a simplified sample processing step without rna extraction for direct sars-cov-2 rt-pcr detection date: 2020-08-11 journal: j clin virol doi: 10.1016/j.jcv.2020.104587 sha: doc_id: 353640 cord_uid: giznbcpd the severe acute respiratory syndrome coronavirus (sars-cov-2) pandemic has resulted in significant shortages of rt-pcr testing supplies including rna extraction kits. the goal of our study was to determine if a simplified heat-rna release method would provide comparable detection of sars-cov-2 without the need for nucleic acid extraction. rt-pcr results using the chromacode hdpcr™ sars-cov-2 were compared using the heat-rna release method and an automated rna extraction system (emag). the heat-rna release method correctly identified 94% (81/86 nasopharyngeal samples) that were positive for sars-cov-2. five samples that were missed by heat-rna release method had a mean ct value: 35 using the automated extraction instrument, indicating a very low viral load. our findings show that a simple heat-rna release method is a reasonable alternative for the majority of covid-19 positive patients and can help overcome the cost and availability issues of rna extraction reagents. the severe acute respiratory syndrome coronavirus (sars-cov-2), continues to be a growing worldwide public health concern and the expansion of diagnostic testing is considered a critical requirement for case detection, contact tracing and control of the spread of covid-19 infection (1) . shortages of test materials have resulted in a forced narrow testing strategy in the united states dedicated to managing the care of the sickest patients that require hospitalization, thereby hampering efforts to identify and prevent community transmission of covid-19 (2) . of growing concern is the expansion of the pandemic in low-to middle-income countries which already lack testing materials and the ability to compete with powerful developed countries to procure test reagents for their population (3) . the centers for disease control and prevention (cdc) and the world health organization (who) both recommend standardized sars-cov-2 molecular diagnostic protocols that include an rna extraction step from an upper respiratory sample followed by reverse transcription polymerase chain reaction (rt-pcr) to detect the purified sars-cov-2 rna (4). however, recent shortages of testing materials, particularly shortages of rna extraction reagents, poses a major obstacle. a potential solution during a period of extraction reagent shortages might be to use a simple heat inactivation and extraction step as an alternative to automated rna extraction systems or manual kits which are also more expensive and time and labor intensive (4) . the destabilization of the physical integrity of viruses by heating results in the release of viral rna which is then available for a rt-pcr detection. however, the temperature at which virus particles disintegrate during heating differs significantly between virus types and physicochemical conditions (5) . to improve the real-time rt-pcr detection of sars-cov-2 rna, a heat release and inactivation step was evaluated. our goal was to simplify the pre-pcr step and demonstrate that a simple heat-j o u r n a l p r e -p r o o f rna release step can be an alternative to the traditional rna extraction approach. we compared the diagnostic sensitivity of the heat-rna release method for detection of sars-cov-2 using np swabs in viral transport media (vtm) to results obtained using an automated rna extraction system (emag ® , biomerieux, durham, nc). a total of 174 covid-19 positive samples were used for the study comprising 87 unique covid-19 np including ct values using the heat-rna release method were compared to the results obtained using the automated rna-extraction method with both the ldt and chromacode sars-cov-2 assays. both the chromacode sars-cov-2 ruo and the in-house ldt assay showed good agreement using the two different extraction methods, 99% (86/87 samples) with the emag ® automated extraction and 93% (81/87 samples) for the heat-rna release method. comparison of the heat-rna release method to emag ® using the chromacode sars-cov-2 ruo alone yielded a 94% agreement (81/86 positive samples). we observed slightly higher ct values using the heat-rna release method but most of the observed ct difference fell between <1 to 3 ct values. use of the heat-rna release method yielded 100% (29/29) agreement for samples with ct value <20, 100% (29/29) agreement for ct values between 20-30 and 83% (24/29) agreement for ct values between 30-40. the five samples that were missed using the heat-rna release method all had low amounts of rna with a median ct value 36 (table 1) . of 675 cases with a positive sars-cov-2 diagnosis at our institution, only 8% would fall into this low copy range (figure 2 ). we found that the direct detection of sars-cov-2 using a 65°c heat inactivation and release step for 20minutes without rna extraction and purification performed very well compared to the use of an automated rna extraction instrument. thermal pre-treatment is important as it inactivates virus, causes exposure of viral genome and denatures inhibitors of the rt and/or pcr enzymes in the np matrix. in contrast, the common practice of heating at high temperatures (95°c for a few minutes) for direct rt-pcr in lieu of rna extraction often results in lower rt-pcr sensitivity, presumably due to breakage of phosphodiester bonds within the targeted sequence (7). we observed slightly higher ct values using the heat-rna release step but this is likely because rt-pcr performed with the automated extraction method uses a 10-fold higher concentration of the final eluate (500ul vtm used for a final extraction volume of 50ul). the concentration of final sample volume using the automated extraction method is also the likely explanation for the lower positive yield observed at ct values ≥ 35, which represents a very low viral load. as noted above, this low-copy range would only comprise 8% (56/675) of pcr j o u r n a l p r e -p r o o f positive samples in our laboratory. in conclusion, a substantial number of samples can be processed quickly without costly instrument and extraction reagent kits using a simple, calibrated heat inactivation and release method. the authors declare that there are no conflicts of interest this work received no specific grant from any funding agency j o u r n a l p r e -p r o o f response and the president's plan for opening america up again failing the test -the tragic data gap undermining the u.s. pandemic response access to lifesaving medical resources for african countries: covid-19 testing and response, ethics, and politics direct rt-qpcr detection of sars-cov-2 rna from patient nasopharyngeal swabs without an rna extraction step development of a taqman® rt-pcr assay without rna extraction step for the detection and quantification of african chikungunya viruses bei resources product information sheet for nr-52286 use of reverse transcription and pcr to discriminate between infectious and non-infectious hepatitis a virus the authors would like to thank chromacode for providing the chromacode hdpcr™ sars-cov-2 research use only (chromacode ruo) assay kit key: cord-349485-iomk99lv authors: eis-hübinger, anna m.; hönemann, mario; wenzel, jürgen j.; berger, annemarie; widera, marek; schmidt, barbara; aldabbagh, souhaib; marx, benjamin; streeck, hendrik; ciesek, sandra; liebert, uwe g.; huzly, daniela; hengel, hartmut; panning, marcus title: ad hoc laboratory-based surveillance of sars-cov-2 by real-time rt-pcr using minipools of rna prepared from routine respiratory samples date: 2020-04-22 journal: j clin virol doi: 10.1016/j.jcv.2020.104381 sha: doc_id: 349485 cord_uid: iomk99lv background: a novel coronavirus, severe acute respiratory syndrome coronavirus 2 (sars-cov-2), emerged in china in late 2019 and subsequently caused a pandemic. surveillance is important to better appreciate this evolving pandemic and to longitudinally monitor the effectiveness of public health measures. objectives: we aimed to provide a rapid, easy to establish and costeffective laboratory-based surveillance tool for sars-cov-2. study design: we used minipools of rna prepared from nucleic acid extractions of routine respiratory samples. we technically validated the assay and distributed the protocol within an informal network of five german university laboratories. results: we tested a total of 70 minipools resembling 700 samples shortly before the upsurge of cases in germany from 17.02.202010.03.2020. one minipool reacted positive and after resolution one individual sample tested sars-cov-2 positive. this sample was from a hospitalized patient not suspected of having contracted sars-cov-2. conclusions: our approach of a laboratory-based surveillance for sarscov-2 using minipools proved its concept is easily adaptable and resource-saving. it might assist not only public health laboratories in sars-cov-2 surveillance. as of 11 march 2020, who declared covid-19 a pandemic (1) . early case detection is crucial to contain the pandemic and symptom-based case definitions have been set up in many countries worldwide. however, there is evidence that transmission chains can be initiated by asymptomatic cases or only mildly diseased covid-19 patients (2) . these cases will be missed by currently recommended symptom-based case definitions and may lead to unrecognized local spread, which has been seen in italy, iran and more recently in the us. to limit the pandemic an aggressive public health response has been set up in many countries worldwide. however, a resurgence of cases is anticipated whenever the strict public health isolation measures will be lifted. therefore, one of the biggest challenges and unresolved issues for public health will be the surveillance and rapid identification of sars-cov-2 in the time between epidemic peaks. to rapidly identify unrecognized cases in hospitals in an efficient, resource-saving and cost effective manner we propose an ad hoc laboratory-based surveillance approach for sars-cov-2. it is based upon minipool (mp) testing of nucleic acid preparations of respiratory samples submitted to laboratories for routine diagnostics. the workflow comprises individual nucleic acid (na) extraction of respiratory samples, pooling of extracted na samples in batches of 10 and sars-cov-2 specific real-time rt-pcr. in a first step, we analyzed the impact of minipool (mp) testing in batches of 10 samples per pool. nucleic acid was extracted from 200 µl respiratory specimen (pharyngeal swabs in viral transport medium, sputum, broncho-alveolar lavage fluid) using the minelute virus kit (qiagen, hilden, germany) on the qiacube system as recommended. elution was done in a volume of 100 µl. for setting up mp, 5 µl of each individual na preparation was combined in pools of 10 (dilution factor of 10). we retrieved 40 left-over na preparations of respiratory samples from 2019 representing a variety of non-sars-cov-2 viruses from our local biobank in freiburg and set up mp. we tested four mp using the same rt-pcr as for individual patient testing as described (3) . to exclude possible unspecific reactions of the mp procedure these mp were also tested using the sars-cov-2 specific real-time rt-pcr as described below. to determine the analytical sensitivity of the mp approach, we used in vitrotranscribed rna standards for the e gene obtained by the european virus archive global (evag), https://www.european-virus-archive.com, and the sars-cov-2 e gene rt-pcr assay as described (4) . rt-pcr was done on an abi 7500 instrument (applied biosystems, weiterstadt, germany). we spiked different in vitro-transcribed rna concentrations in stored na preparations of respiratory samples from 2019 and established mp. replicate testing was done to determine the limit of detection (lod) as described (4) . finally, we used na preparations from three actual sars-cov-2 cases in freiburg (containing 4x10 4 copies/ml; j o u r n a l p r e -p r o o f 3.2x10 7 copies/ml; 1.6x10 7 copies/ml, respectively) and set up three mp each containing one sars-cov-2 positive na preparation and retested these samples. we distributed the workflow within an informal network of 5 german laboratories ( table 2 ). all sites are tertiary care centers with a total of 1.600 (site a), 1.300 (site b), 1.400 (site c), 840 beds (site d), and 1.500 (site e), respectively. ethical approval for this study was not required since all activities are according to legal provisions defined by the german infection protection act (ifsg). all samples have been submitted for routine patient care and diagnostics and written informed consent has been obtained by each patient. all data used in the current study was anonymized prior to being obtained by the authors. we were able to detect all non-sars-cov-2 pathogens in mp which tested positive in individual rt-pcr (table 1) we report a diagnostic workflow for the laboratory-based surveillance of sars-cov-2 in a rapid and cost effective manner. shortly after the identification of sars-cov-2 specific realtime rt-pcr protocols were set up and have been distributed worldwide (4, 5) . the availability of rapid and reliable diagnostics for early case detection is instrumental in an outbreak scenario (6) . from a public health perspective an easy to establish and cost effective laboratory-based screening strategy may assist in rapid case detection, surveillance and ultimately in a better understanding of this epidemic (7) . technically, this can be done in parallel using samples from routine diagnostics which are subsequently tested for sars-cov-2 rna (8). however, with the circulation of influenza cases across europe merging with the upsurge of sars-cov-2 many laboratories may lack the capacity and resources to perform additional single patient sample testing for sars-cov-2. in addition, a shortage of pcr reagents has become an issue of concern as huge numbers of additional sars-cov-2 molecular tests are performed globally in a relatively short period of time. to minimize work load, resources and costs a pooling approach of nucleic acid extractions might be considered. we used the assay described by corman et al. and were able to demonstrate an almost exactly j o u r n a l p r e -p r o o f 10-fold higher lod which is due to mp related dilution factor of 10 (4). data from china showed sars-cov-2 rna concentrations in the range of 1,5x10 4 to 1,5x10 7 copies per milliliter giving rise to the notion that the mp procedure will be sensitive enough for most clinical samples (9) . another study of only mildly disease patients showed an average of 3,4x10 5 copies per swab. however, at the moment there is a lack of comprehensive information on viral rna concentrations in mildly diseased or asymptomatic cases. critically, we were not able to detect one low concentrated samples diluted into a mp, which was close to the lod of the pooling procedure. networks are paramount for an efficient response to emerging infections and we aimed to provide an easy to implement workflow (4, 10). we set up an informal network and were able to test a total of 70 mp covering different geographic regions of germany. in perspective, this approach can be set up rather easily e. g. by public health laboratories, can be done on a daily basis and at reduced costs compared to individual patient testing. it could allow for longitudinally monitoring the effectiveness of contact reduction measures at the population level and early detection of epidemic waves. in light of an evolving sars-cov-2 epidemic and the possibility of unrecognized spread within the population we propose a rapid and straightforward screening strategy for sars-cov-2. this approach proved its principle and might assist public health laboratories in europe and elsewhere to rapidly detect sars-cov-2 cases which might otherwise remain undetected. all samples have been submitted for routine patient care and diagnostics. ethical approval for this study was not required since all activities are according to legal provisions defined by the german infection protection act (ifsg). written informed consent has been obtained by each patient. all data used in the current study was anonymized prior to being obtained by the authors. competing interests all authors have no conflict of interest to declare. world health organization. director-general's opening remarks at the media briefing on covid-19 -11 substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (sars-cov2) influenza a virus drift variants reduced the detection sensitivity of a commercial multiplex nucleic acid amplification assay in the season 2014/15 detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr laboratory readiness and response for novel coronavirus (2019-ncov) in expert laboratories in 30 eu/eea countries potential scenarios for the progression of a covid-19 epidemic in the european union and the european economic area defining the epidemiology of covid-19 -studies needed differential diagnosis of illness in patients under investigation for the novel coronavirus (sars-cov-2) sars-cov-2 viral load in upper respiratory specimens of infected patients detection of influenza a(h1n1)v virus by real-time rt-pcr we are grateful to claudia ehret, monika häffner, verena schillinger and the team in freiburg and the entire molecular diagnostic teams in bonn, frankfurt, leipzig, and regensburg for expert technical assistance. key: cord-336636-xgfw21hk authors: spezia, pietro giorgio; macera, lisa; mazzetti, paola; curcio, michele; biagini, chiara; sciandra, ilaria; turriziani, ombretta; lai, michele; antonelli, guido; pistello, mauro; maggi, fabrizio title: redondovirus dna in human respiratory samples date: 2020-08-15 journal: j clin virol doi: 10.1016/j.jcv.2020.104586 sha: doc_id: 336636 cord_uid: xgfw21hk abstract background redondovirus (redov) is a recently discovered circular, rep-encoding single-stranded dna (cress-dna) virus in humans. its pathogenesis and clinical associations are still completely unknown. methods the presence of redov dna was investigated in biological specimens of 543 italian subjects by in-house developed pcr assays. results the overall redov prevalence was about 4% (23 of 543 samples). the virus was detected in 22 of 209 (11 %) respiratory samples. one stool sample was also redov positive. viral dna was not found in blood samples from immunocompetent and immunosuppressed subjects and cerebrospinal fluids from patients with neurological diseases. genomic nucleotide differences were detected among the redov isolates by sequencing a 582-nucleotide fragment of the capsid gene of the viral genome. conclusions the results demonstrate that redov is mainly present in the respiratory tract of infected people. further investigations are needed to reveal possible clinical implications of this new cress-dna virus in humans. while attempting to study human virome in bronchoalveolar lavage (bal) samples of lung transplant patients [1, 2] , abbas and colleagues identified sequence reads that aligned with low-coverage to a poorly characterized circovirus, named porcine stool-associated circular virus-5 (poscv-5) [3] . further genomic characterization of these reads revealed that they belonged to a novel virus having a single, closed molecule of circular dna approximately 3,000 nucleotides (nt) in length called redondovirus (redov) [4] . it was proposed as the second most prevalent eukaryotic virus, after anelloviruses, in human respiratory samples from viral metagenomics studies. the circumstance that the genomic organization and homology of redov differ from that of other known circular, singlestranded dna viruses [including those belonging to the group of circular rep-encoding singlestranded dna (cress) viruses] [5, 6] has suggested that redov is the first member of the new viral family, named redondoviridae [4, 7] . to date, 22 redov genomes have been completely sequenced [4, 8] and, based on 50% rep protein identity [9] [10] [11] , grouped in two species highly prevalent in the respiratory tract: vientovirus and brisavirus [4] . the redov genome contains two ambisense major open reading frames (orf) encoding capsid and rep proteins [449-531 and 334-363 amino acids, respectively] [4] . the capsid protein, like that of other single-stranded dna viruses [5, 6, 12] , contains a basic amino terminus, while the rep protein has two domains, similar to many small dna and rna viruses [13, 14] . surprisingly, the capsid protein is more conserved than rep protein among redov sequences, being the range of amino acid identities (67.5-99.6% and 36.6-99.7%, respectively). all redov genomes also contain a third orf (orf3) overlapping the capsid gene. epidemiology, biological properties, and pathogenic potential of redov are still completely understood. abbas and colleagues [4] have investigated redov prevalence by re-analyzing for homology to the virus metagenomics sequence data of 7,581 samples from 173 datasets covering 51 organisms or environments and 18 human body sites or fluids. redov sequences were detected only in human samples, from oral cavity (3.8%), lung (3.3%), nasopharynx j o u r n a l p r e -p r o o f (0.95%), and gut (0.59%). the presence of redov was also tested in oropharyngeal swabs from 129 individuals by real-time pcr. redov dna was detected in 12%, at levels that in critically diseased patients were 10 4 -fold higher than in healthy individuals. additionally, consecutive samples from some subjects obtained at later times for 2-3 weeks remained redov positive, suggesting the persistence of virus infection. these observations suggest that redov is not part of the normal oral and/or respiratory microflora of humans, differently to other circular single-stranded dna viruses [5, 15] and that its infection might be involved in clinically relevant disorders. a total of 543 human biological specimens were studied. specimens had been submitted to our laboratory by local hospitals where they were processed for routine virological analysis. the study was run after ethical approval from comitato etico di area vasta nord-ovest (protocol numbers 39238, and 63409). the most specimens (n. 443) were obtained from diseased patients: 209 respiratory specimens (151 nasopharyngeal swabs, 36 sputum samples, and 22 pharyngeal swabs obtained between april and july 2019) from individuals with acute and chronic respiratory diseases, 79 whole blood samples from transplant recipients, 105 stools from individuals with gastroenteric illness, and 50 cerebrospinal fluids from neurological patients. the remaining 100 plasma samples were obtained from healthy blood donors. all the respiratory specimens were submitted to systematic testing for common respiratory virus detection by commercial real-time pcr assays, according to the manufacturer's instructions. viral dna was extracted from 200 µl of samples by using the qiaamp dna mini kit (qiagen, chatsworth, ca) manually or associated with a qiasymphony sp/as instrument. extracted dna was amplified with two different pcr protocols, both developed in our laboratories and targeting the capsid gene of the viral genome. the first amplification was performed by a semiquantitative one-step real-time pcr based on sybr-green pcr (sy-pcr) coupled with a melting temperature analysis of 90 nucleotide-length fragment. experiments, and the coefficient of variation was calculated. the differences between input (830,000 copies) and calculated copy numbers were small, the latter ranging between 733,000 and 862,000 with the maximum inter-assay variation lower than 0.1 log, thus indicating good reproducibility of the sy-pcr assay. the lower detection limit of the procedure was measured by testing serial dilutions of a known concentration of a recombinant plasmid and was found to be of 10 copies. table 2) . only one stool specimen resulted positive for redov. this was from a 60-year old woman receiving hematopoietic stem cell transplantation (hsct) for a history of lymphoma. this patient's stool sample was also positive for rotavirus antigen. sequencing was limited to 10 amplicons obtained from independent pcr runs, confirming the detection of redov dna, and phylogenetic analysis showed that all the isolates were related to the previously published strains (figure 1) . most of them were very closely related (overall mean distance: 0.104; range: 0.000-0.295). again, our isolates differed little from the ones already in genbank (figure 1 ). the recent discovery of redov inspired this retrospective study on biological specimens collected from diseased patients and healthy blood donors. [11, 17] . in this study, the majority of virus-positive patients had more severe respiratory diseases, and most of them yielded no other common respiratory viruses and/or microbial agents that might have been responsible for the clinical forms from which the patients suffered. while the number of patients studied here is too small to be definitive regarding the association of redov with severe respiratory tract disease, the observation of particularly higher redov levels in critically ill patients than in healthy subjects [4] encourages to pursue the observation furtherly focusing on expanding the sample set and on specific pulmonary disease cohorts (e.g. asthma, cystic fibrosis, etc). after all, the finding suggests that redov could be not a frequent commensal virus inhabiting the respiratory tract in the absence of symptomatic disease. again, the follow-up of redov positive patients will be important j o u r n a l p r e -p r o o f for understanding if the virus remains consistently persistent or is able only to give short-lasting acute infections in the infected host. of interest is the demonstration of redov dna in the feces of one subject. the finding might indicate that, similar to other respiratory viruses [18, 19] , redov may not remain restricted to the respiratory tract. it is noteworthy that the subject in whom the observation was done receiving hsct, suggesting that an immunosuppressed status of an infected host could favor this event. however, further studies will be needed to establish whether redov can represent a further agent of viral enteritis or can just be excreted with the stools similar to other viruses primarily infecting the respiratory tract. again, the short pcr fragment sequenced does not allow us to classify the redov dnas in one of the two species in which the virus has been genetically characterized. sequencing of near full-length or full-length genomes will be necessary for better exploring the genetic variability of redov and for improving its phylogenetic classification. we declare that we have no conflicts of interest. funding: this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. i declare that the authors haven't any financial or personal relationship with other people or organizations that could create a potential conflict of interest or the appearance of a conflict of interest with regard to the work. the perioperative lung transplant virome: torquetenoviruses are elevated in donor lungs and show divergent dynamics in primary graft dysfunction bidirectional transfer of anelloviridae lineages between graft and host during lung transplantation identification of a novel single-stranded circular dna virus in pig feces redondoviridae, a family of small, circular dna viruses of the human oro-respiratory tract associated with periodontitis and critical illness eukaryotic circular rep-encoding single-stranded dna (cress dna) viruses: ubiquitous viruses with small genomes and a diverse host range diverse circular ssdna viruses discovered in dragonflies (odonata:epiprocta) further defining the human virome using ngs: identification of redondoviridae identification and genetic characterization of a novel circular single-stranded dna virus in a human upper respiratory tract sample consensus statement: virus taxonomy in the age of metagenomics genomoviridae: a new family of widespread single-stranded dna viruses smacoviridae: a new family of animal-associated single-stranded dna viruses molecular properties, biology, and clinical implications of tt virus, a recently identified widespread infectious agent of humans conserved sequence motifs in the initiator proteins for rolling circle dna replication encoded by diverse replicons from eubacteria, eucaryotes and archaebacteria a new superfamily of putative ntp-binding domains encoded by genomes of a small dna and rna viruses torquetenovirus: the human virome from bench to bedside a novel rolling circle amplification assay to detect members of the family anelloviridae in pigs and humans the fecal virome of south and central american children with diarrhea includes small circular dna viral genomes of unknown origin human bocavirus and paediatric infections respiratory viruses other than influenza virus: impact and therapeutic advances the aminoacidic (a) and nt (b) trees based on a 582-bp segment from the capsid gene of the viral genome was obtained by applying neighbor-join and bionj algorithms to a matrix of pairwise distances estimated using jones-thornton-taylor (jtt) and maximum composite likelihood (mcl) models, respectively. bootstrap resampling (1,000 replicates) was used to test the robustness of the trees. the tree was drawn by using mega x program (version 10.0.5). redov sequences from the present study obtained by respiratory and stool samples are indicated by solid and open circles, respectively. the 22 sequences of redov the porcine stool-associated circular virus/bel/15v010 isolate 15v010 (accession number ky214434) was used as the outgroup. the bar represents the number of substitutions per site j o u r n a l p r e -p r o o f key: cord-343800-nbydaoac authors: cerutti, francesco; burdino, elisa; milia, maria grazia; allice, tiziano; gregori, gabriella; bruzzone, bianca; ghisetti, valeria title: urgent need of rapid tests for sars cov-2 antigen detection: evaluation of the sd-biosensor antigen test for sars-cov-2 date: 2020-09-29 journal: j clin virol doi: 10.1016/j.jcv.2020.104654 sha: doc_id: 343800 cord_uid: nbydaoac at the time of writing, find has listed four ce-marked sarscov-2 antigen tests. we evaluated the recently ce-approved rapid poct sd-biosensor for sars-cov-2 nucleoprotein detection in nasopharyngeal secretions from 330 patients admitted to the emergency room for a suspect of covid-19 and travelers returning home from high risk countries. sensitivity, specificity, accuracy, negative and predictive values were consistent with the use of the test to mass-screening for sars-cov-2 surveillance. this is a pdf file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. this version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. that demands rapid and cost-efficient approaches. the currently gold standard for the detection of sars-cov-2 relies on viral rna amplification by real-time rt-pcr (rt-pcr) and requires few hours before results release [1] . the pandemic highlighted the limits of production and trade for molecular tests as we are facing a worldwide shortage of reagents. point-of-care diagnostic tests (pocts) for detecting viral antigens in clinical samples would be very helpful for the diagnosis of covid-19 [2] either as mass-screening or first aid tests at the emergency room. at the time of writing, the foundation for innovative new diagnostics (https://www.finddx.org/) has listed four ce-marked rapid sars-cov-2 antigen tests, which are primarily lateral flow immunochromatographic assays from nasopharyngeal swab (np) with result reporting in less than 30 minutes. the evaluation of these tests by the scientific community, even if limited, outlines the major concern of false-negative results due to low viral loads. in fact, recently published works from different countries evaluating commercial and in-house pocts for sars-cov-2 showed a concordant high level of specificity (from 99.5 to 100%), but a wide range of sensitivity (30% -93.9% [3, 4] . therefore, great efforts for the implementation of antigen test performance are currently on-going. to evaluate a recently ce-approved poct, the standard q covid-19 ag (sd-biosensor, relab, i), for the detection of sars cov-2 nucleoprotein in np swabs in comparison with the gold standard rt-pcr. poct performances were studied in terms of sensitivity, specificity, and negative and predictive values to assess the contribution of this test to massscreening for covid-19. the standard q covid-19 ag (r-ag) was applied to 330 patients of two different populations from the phase-1 and -3 of the pandemic according to the italian government measures detection rates of sars cov-2 by r-ag and rt-pcr were 23.3% (77/330) and 33% (109/330), respectively; no false positive with r-ag were observed ( according to different mean ct classes (≤25, 25-28, 28-30, 30-35, >35) the detection rate of r-ag was 100% for samples with a ct <28 and decreased to 38.5%, 26.7%, and 9.1% in the other ranks. figure 2 shows the roc curve for r-ag to estimate the ct threshold value for r-ag to detect a positive swab (equal to 27.7). in table 2 to control covid-19 pandemic, improvement of sars cov-2 diagnosis with easy, rapid and cost-efficient approaches is urgently required. pocts for the detection of sars-cov-2 j o u r n a l p r e -p r o o f antigens are quite promising; however, the principal concerns are the false-negative rate due to low viral loads [3] [4] [5] [6] [7] [8] . the standard q covid-19 ag identified 70.6% of rt-pcr positive sample, respectively, with no false positive results (100% of specificity). using the ct value by rt-pcr as a proxy for viral load, r-ag-positive samples had a significantly lower ct than that of r-agnegative samples; the majority of discordant rt-pcr-positive/r-ag-negative samples reported negative results when cell-cultured. therefore, r-ag false negative results were found in samples with a low viral load, consistent with low viable virus and low infectiousness [9, 10] . a major limit of our study was that the test was assessed in suboptimal conditions using utm samples instead of on-site np swabs. the clinical performance of pocts largely depends on the circumstances in which they are used, and the appropriate setting should be identified. in agreement with recently published works, our data confirm that this poct is effective during the acute/recent phase of the disease within a few days after symptoms onset when the viral load in the upper respiratory tract is at its peak [3] [4] [5] 11 ]. the adoption of poct for sars cov-2 testing is certainly more suitable in point of care centers for mass screening where the prevalence of covid-19 is much lower and the pre-test probability of not having the disease is higher than that in the patients admitted to the emergency room were the pre-test probability of having covid-19 is significantly higher and false negative results are relevant for the correct management of patients. the main advantages of pocts for antigen testing are rapidity, easy of interpretation, limited technical skill and infrastructure required, and this continues to make them worth pursuing. lastly, the adoption of pocts in mass screening testing could decrease the burden on virology laboratories that have been overwhelmed during the last covid-19 pandemics, and the shortage of reagent they are facing. we thank relab for the donation of the standard q covid-19 sd-biosensor kits to pursue the study. no other specific grant from public funding agencies was received. the authors declare no competing interest. detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr. eurosurveillance evaluation of rapid antigen test for detection of sars-cov-2 virus evaluation of novel antigen-based rapid detection test for the diagnosis of sars-cov-2 in respiratory samples low performance of rapid antigen detection test as frontline testing for covid-19 diagnosis evaluation of a rapid diagnostic assay for detection of sars cov-2 antigen in nasopharyngeal swab severe acute respiratory syndrome coronavirus 2 from patient with 2019 novel coronavirus disease, united states. emerg infect dis development of a portable, ultra-rapid and ultra-sensitive cell-based biosensor for the direct detection of the sars-cov-2 s1 spike protein antigen development and potential usefulness of the covid-19 ag respi-strip diagnostic assay in a pandemic context. front med viral rna load as determined by cell culture as a management tool for discharge of sars-cov-2 patients from infectious disease wards predicting infectious sars-cov-2 from diagnostic samples sars-cov-2 qrt-pcr ct value distribution in japan and possible utility of rapid antigen testing kit key: cord-325120-jlrievxl authors: abd el wahed, ahmed; weidmann, manfred; hufert, frank t. title: diagnostics-in-a-suitcase: development of a portable and rapid assay for the detection of the emerging avian influenza a (h7n9) virus date: 2015-05-19 journal: j clin virol doi: 10.1016/j.jcv.2015.05.004 sha: doc_id: 325120 cord_uid: jlrievxl background: in developing countries, equipment necessary for diagnosis is only available in few central laboratories, which are less accessible and of limited capacity to test large numbers of incoming samples. moreover, the transport conditions of samples are inadequate, therefore leading to unreliable results. objectives: the development of a rapid, inexpensive, and simple test would allow mobile detection of viruses. study design: a suitcase laboratory “diagnostics-in-a-suitcase” (56 cm × 45.5 cm × 26.5 cm) containing all reagents and devices necessary for performing a reverse transcription recombinase polymerase amplification (rt-rpa) assay was developed. as an example, two rt-rpa assays were established for the detection of hemagglutinin (h) and neuraminidase (n) genes of the novel avian influenza (h7n9) virus. results: the sensitivities of the h7 and the n9 rt-rpa assays were 10 and 100 rna molecules, respectively. the assays were performed at a single temperature (42 °c). the results were obtained within 2–7 min. the h7n9 rt-rpa assays did not show a cross-detection either of any other respiratory viruses affecting humans and/or birds or of the human or chicken genomes. all reagents were used, stored, and transported at ambient temperature, that is, cold chain independent. in addition, the diagnostics-in-a-suitcase was operated by a solar-powered battery. conclusions: the developed assay protocol and mobile setup performed well. moreover, it can be easily implemented to perform diagnoses at airports, quarantine stations, or farms for rapid on-site viral nucleic acid detection. reliable rapid diagnostic tools can generally help confirm infection in suspected cases during disease outbreaks, and therefore they can help improve hygiene management and prevent the further spread of the disease. the most extensively used tools are rapid antigen detection tests (rdts) [1, 2] . rdts are simple, fast (10-15 min) , and suitable for point-of-care screening. nevertheless, many reports stress the limited sensitivity and specificity of rdts [2] [3] [4] [5] , and rdt results are yet to be confirmed by real-time polymerase chain reaction (pcr). currently, real-time pcr is the standard of molecular diagnosis [6] [7] [8] . samples are sent to regional or central laboratories for testing. alternatively, a mobile real-time pcr system can be used at an outbreak site for the detection of pathogen nucleic acid. however, mobile real-time pcr devices are large, expensive, and complex. in addition, the test run time varies between 50 and 90 min [9] . for rapid wide-scale testing, robust easy-to-use molecular test systems that can be applied in the field provide a big advantage, as they allow rapid on-site nucleic acid detection at the point of need. smart mobile assays should be able to discover silent or clinical relevant cases even in rural areas with low infrastructure. recombinase polymerase amplification (rpa) [10] represents an alternative technology to the real-time pcr. rpa is an isothermal dna amplification and detection technology. this assay is rapid (2-15 min) and operated via a compact portable device (i.e., a tube scanner, 19 cm × 17.5 cm) [11] [12] [13] [14] . in this study, reverse transcription rpa (rt-rpa) assays were developed for the detection of avian influenza a (h7n9) virus. moreover, "diagnostics-in-a-suitcase" (dias) was established in order to facilitate its use at the site of an outbreak. the quality control for molecular diagnostics, glasgow, scotland, uk; the landesgesundheitsamt niedersachsen, hanover, germany; and robert koch institute, berlin, germany, provided the human viruses and viral nucleic acids (table 1 ) used in this study. the avian respiratory viral nucleic acid panel (table 1 ) was provided by the friedrich-loeffler-institute, greifswald-insel riems, germany. two rt-rpa assays were developed. as no program or strict rules for designing rpa primers and probe were available, three forward primers (fps), three reverse primers (rps), and one exo-probes (exo-ps) were tested for each assay to select the combination producing the highest rt-rpa assay analytical sensitivity ( table 2 ). oligonucleotides were synthesized by tib molbiol (berlin, germany). to simplify the use of h7n9 rt-rpa assays at the site of an outbreak, dias ( fig. 1 ) was created. dias contains all reagents and equipment necessary for performing h7n9 rt-rpa assays. a table 1 list of viral nucleic acids. h7n9 rt-rpa assays detected only h7 and n9 rna but not other nucleic acids of viruses causing respiratory manifestations. h7 rt-rpa assay n9 rt-rpa assay coronavirus 229e, nl63, and oc43 case of size 56 cm × 45.5 cm × 26.5 cm (zarges gmbh, weilheim, germany) is lined with foam at its base to act as a shock absorber during transport. a pvc layer is attached to the foam, into which indents are cut and sealed to render them watertight (fig. 2) . these indents house the equipment needed to perform the sample processing and amplification reactions: a tube scanner (twista, twistdx, cambridge, uk), disinfectant wipes (pursept ® -a xpress, merz consumer hygiene gmbh, luetjenburg, germany), a waste container (sarstedt, nuembrecht, germany), a vortex (lab-dancer, ika ® , staufen, germany), a sprout ® minicentrifuge (omnilab, bremen, germany), and two easily refillable pipette tip boxes (brand, wertheim, germany), in addition to a micro-tube rack, scissors, and a magnetic stand (beckman coulter, krefeld, germany). the lid of the case contains a box for gloves, an ffp3 mask, protection table 2 sequence of primers and exo-probes for h7n9 rt-rpa assays. name sequence 5 -3 amplicon size (nt) h7-rpa-fp and h7-rpa-rp are forward and reverse rpa primers for the h7 rt-rpa assay; n9-rpa-fp and n9-rpa-rp are forward and reverse rpa primers for the n9 rt-rpa assay; h7-rpa-p and n9-rpa-p are exo-probes; bhq1-dt, thymidine nucleotide carrying black hole quencher-1; thf, tetrahydrofuran spacer; fam-dt, thymidine nucleotide-carrying fluorophore; nt, nucleotides. goggles, 1-10-and 10-100-l automatic micropipettes (eppendorf ag, hamburg, germany), marker and boxes for storage buffers, and rpa kits. a solar panel and a power pack (yeti 150 set, goalzero, south bluffdale, ut, usa) provide the energy needed. the workflow consisted of total viral nucleic acid extraction using magnetic beads (dynabeads ® silane viral na, life h7 and (b) the n9 rt-rpa assays. fluorescence development via real-time detection using a dilution range of 10 7 -10 1 rna molecules/l of the h7 and n9 rna molecular standards (graph generated by esequant tube scanner studio software). the sensitivities were 10 and 100 rna molecules for the h7 (a) and the n9 (b) rt-rpa assays, respectively. the reverse transcription took place in the first minute. to increase the sensitivity, a mixing step was performed after 3 min (no fluorescence signal was detected). 10 7 represented by black line; 10 6 , gray; 10 5 , red; 10 4 , blue; 10 3 , green; 10 2 , cyan; 10 1 , dark khaki; and negative control, orange. (for interpretation of the references to color in this text, the reader is referred to the web version of the article.) technologies, darmstadt, germany) according to the manufacturer's instructions with few modifications. in summary, 200 l of the sample was incubated with 50 l of proteinase k and 300 l of lysis buffer for 5 min at room temperature. thereafter, 150 l of isopropanol and 50 l of dynabeads were added and incubated for 10 min followed by two washing steps. nucleic acid bound to the dynabeads was left to dry for 5 min, followed by elution. the total time needed for the extraction was 30 min. for the rt-rpa assay, the ready-to-use twistamp tm rt exo (twistdx, cambridge, uk) was used as described [11] . briefly, rpa primers (420 nm), the probe (120 nm), 45 l of rehydration buffer containing 14 mm mg acetate, and 5 l of extracted rna were added. the tube was closed and mixed well, and then placed in the tube scanner for 10 min at 42 • c. the total time for the rt-rpa test was 15 min. all pipetting steps were performed in the suitcase area. surfaces outside of the suitcase were not used. in vitro transcribed ha and na rnas of the h7n9 a/anhui/1/2013 virus (accession numbers: epi439507, epi439509) were provided by the friedrich-loeffler-institute, greifswald-insel riems, germany [15] . to determine the analytical sensitivity of rt-rpa assays, rna molecular standard quantities ranging from 10 7 to 10 1 rna molecules/l were used. the rt-rpa assay was performed using the ready-to-use twistamp tm rt exo (twistdx, cambridge, uk) as described before [15] . using prism (graphpad software inc., san diego, ca, usa), the threshold time was plotted against molecules detected and a semilog regression was calculated. to determine the limit of detection at 95% probability, a probit regression was performed using statistica (statsoft, hamburg, germany). the specificity of rt-rpa assays was determined by testing six h7n9-negative chicken samples and a reference human genome. in addition, the cross-reactivity was tested using the viral nucleic acids listed in table 1 . for comparison, h7n9 real-time rt-pcr was performed as previously described [16] . two rt-rpa assays were designed for the detection of avian influenza a (h7n9) virus. two molecular in vitro transcribed rna standards (h7 and n9) were implemented to evaluate both rt-rpa assays. a dilution range of 10 7 -10 1 molecules/l of the rna h7 and n9 molecular standards was used to select the rt-rpa primer and probe combination to produce the highest assay analytical sensitivity. rpa primers and exo-ps listed in table 2 yielded an analytical sensitivity between 10 and 100 rna molecules for the h7 and n9 rt-rpa assays, respectively (fig. 3) . using the data of eight rt-rpa runs of rna molecular standard serial dilutions, a semilog regression (fig. 4) and probit regression analysis (fig. 5) were carried out. the run times for both assays were between 2 and 7 min (fig. 4) . the limits of detection in 95% of cases were calculated to be 14 (fig. 5a) and 179 (fig. 5b ) rna molecules detected for the h7 and the n9 rt-rpa assays, respectively. both the h7 and n9 rt-rpa assays were specific. they detected neither viral nucleic acids of other respiratory viruses (table 1) nor the human or the avian genome. unfortunately, no clinical samples were available to test the clinical sensitivity of the assay. the avian influenza a (h7n9) virus, which mainly infects birds, also occasionally infects humans [17] . as of 22 december 2013, 71 deaths of 166 laboratory-confirmed human cases were recorded by the world health organization (who) in restricted parts of china semilogarithmic regression of the data collected from eight h7n9 rt-rpa test runs on the rna molecular standard using prism software. both assays yielded results between 2 and 7 min. in the h7 rt-rpa assay, 10 7 -10 2 rna molecules were detected in eight out of eight, and 10 in six of eight rt-rpa runs. in the n9 assay, 10 7 -10 3 rna molecules were detected in all rt-rpa runs, 10 2 in seven out of eight, and 10 in two out of eight. probit regression analysis using statistica software on the data set of the eight rt-rpa assay runs. the limit of detection at 95% probability (14 and 179 rna molecules for the h7 and n9 rt-rpa assays, respectively) is represented by a triangle. including hong kong. by 14 november 2014, the number of confirmed human cases increased to 458, 177 of which were fatalities. in addition, infected cases were reported in taiwan and malaysia [18] , suggesting the spread of the virus to other countries as well. thus, it is absolutely necessary to detect an h7n9 outbreak as early as possible to initiate appropriate control measures and prevent further spread among birds or transmission to humans. several real-time rt-pcrs were developed for sensitive detection of avian influenza (h7n9) virus [15, 16, 19] . they produced results in 50-90 min. to avoid contamination of reagents or the workplace with pcr amplicons, the preparation of the master mix, addition of the sample rna to the mix, and the pcr reaction must be performed in separate biological safety cabinets or pipetting hoods. moreover, real-time rt-pcr reagents must be stored in a freezer at −20 • c. therefore, real-time rt-pcr is not easy to use at the point of need or in the field. the detection of avian influenza (h7n9) virus was also performed by reverse transcription-loop-mediated isothermal amplification (rt-lamp) [20] [21] [22] [23] [24] . rt-lamp amplification was achieved at 60 • c in >30 min, and readout was done with the naked eye or sybr green-based detection. however, rt-lamp needs six to 12 primers for the amplification of the h7 and n9 genes, which are not easy to design especially for highly variable rna viruses. by contrast, the h7n9 rt-rpa assays developed in this study were very fast (2-7 min). they were operated at a single temperature (42 • c), and only four primers and two exo-ps were needed for the amplification and detection of two genes (h7 and n9). moreover, the analytical sensitivity and specificity of the rt-rpa assays were as good as that of the published real-time-rt-pcr [16] . to allow for the use of the rt-rpa assay at quarantine stations, ports, or the site of outbreak, the developed dias contains the complete equipment and reagents needed to perform on-site rpa-based diagnostic test. dias has the same size as a standard suitcase, which is easy to carry, transport, and ship. the dias currently costs around 5000 euro. the system can be used with a solar panel and/or power pack as a source of energy for easy use in lowresource settings. all rt-rpa reagents and oligonucleotides can be stored at ambient temperature for up to 3 months. rna extraction is achieved by a magnetic-bead-based method, which reduces the risk of environmental contamination because no centrifugation step is needed. six samples can be tested at the same time, in addition to negative and positive controls. kits for up to 98 samples can be stored in the dias. the dias storage box can be refilled whenever needed. results are displayed as positive or negative on the screen of the tube scanner without the need of a laptop. overall, nine pipetting steps are needed. further improvements to reduce the pipetting steps could be to include lyophilized rpa primers and probe into the rpa pellet, to employ a multiplex rt-rpa assay, and to apply simple non-purification lysis. in addition, generic influenza rt-rpa assays for detection of influenza type a and b as well as h5n1 are being developed, but they have not yet been included [25] . in conclusion, the developed dias represents a portable, rapid, and simple platform for the detection of avian influenza a (h7n9) virus at the point of need and in low-resource settings. dias depends on the rpa technique for identifying the rna of the h7n9 virus, which can be optimized for the detection of the genome of other infectious agents as well. the development of avian influenza a (h7n9) assays was funded by the federal ministry of education and research (bmbf), germany (project name: rescheck, grant no: fkn: 16sv5436). the funders had no role in design of the study, data collection and analysis, decision to publish, or preparation of the manuscript. rapid antigen detection in the diagnosis of highly pathogenic avian influenza (h5n1) virus in nigeria evaluation of twenty rapid antigen tests for the detection of human influenza a h5n1, h3n2, h1n1, and b viruses commercial dengue rapid diagnostic tests for point-of-care application: recent evaluations and future needs? a systematic review and meta-analysis of the diagnostic accuracy of rapid immunochromatographic assays for the detection of dengue virus igm antibodies during acute infection evaluation of diagnostic tests: dengue real-time rt-pcr for h5n1 avian influenza a virus detection development of real time rt-pcr assays for detection of type a influenza virus and for subtyping of avian h5 and h7 hemagglutinin subtypes development of real-time rt-pcr for the detection of avian influenza virus portable nucleic acid thermocyclers dna detection using recombination proteins a portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus reverse transcription recombinase polymerase amplification assay for the detection of middle east respiratory syndrome coronavirus a new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay recombinase polymerase amplification assay for rapid detection of rift valley fever virus nucleic acid-based detection of influenza a virus subtypes h7 and n9 with a special emphasis on the avian h7n9 virus specific detection by real-time reverse-transcription pcr assays of a novel avian influenza a(h7n9) strain associated with human spillover infections in china. euro surveillance: bulletin europeen sur les maladies transmissibles h7n9: preparing for the unexpected in influenza who. avian influenza a (h7n9) virus detection of a novel avian influenza a (h7n9) virus in humans by multiplex one-step real-time rt-pcr assay development of a reverse transcription loop-mediated isothermal amplification method for the rapid detection of subtype h7n9 avian influenza virus rapid and sensitive detection of novel avian-origin influenza a (h7n9) virus by reverse transcription loopmediated isothermal amplification combined with a lateral-flow device development of reversetranscription loop-mediated isothermal amplification assay for rapid detection of novel avian influenza a (h7n9) virus development of a reverse transcription loop-mediated isothermal amplification assay for the rapid diagnosis of avian influenza a (h7n9) virus infection rapid and sensitive detection of h7n9 avian influenza virus by use of reverse transcription-loop-mediated isothermal amplification development of a panel of recombinase polymerase amplification assays for detection of respiratory viruses the authors thank dr. bernd hoffmann, friedrich-loeffler-institute, greifswald-insel riems, germany, for providing the h7 and n9 in vitro transcribed rna, avian respiratory viruses, and h7n9 negative chicken samples; the global initiative on sharing all influenza data (gisaid) for the avian influenza a (h7n9) sequence; and quality control for molecular diagnostics (qcmd), glasgow, scotland, uk, landesgesundheitsamt niedersachsen, hanover, germany, and robert koch institute, berlin, germany, for human viruses and viral nucleic acid. we thank the university medical centre, goettingen, germany, for providing support and workspace until 30 september 2014. mr. manfred lawendel helped us fix the pvc layer to the bottom of the case. we thank doris heidenreich for technical help, and dr. christiane stahl-hennig and shereen petersen for english proofreading. the authors have declared that no competing interests exist. this is non-applicable as no materials from humans or animals were used. key: cord-335067-tg66h99q authors: woolhouse, mark e.j.; adair, kyle title: ecological and taxonomic variation among human rna viruses date: 2013-03-19 journal: j clin virol doi: 10.1016/j.jcv.2013.02.019 sha: doc_id: 335067 cord_uid: tg66h99q only a minority of rna viruses that can infect humans are capable of spreading in human populations independently of a zoonotic reservoir. this is especially true of vector-borne rna viruses; the majority of these are not transmissible (via the vector) between humans at all. understanding the biology underlying this observation will help us evaluate the public health risk associated with novel vector-borne rna viruses. the realisation that many newly discovered and/or emerging pathogens have zoonotic origins has prompted much interest in the nature of the non-human reservoirs and biological characteristics that enable pathogens to jump between host species. 1 here, we focus on an important group of pathogens -rna viruses -and consider how taxonomic diversity and various aspects of ecological diversity -host range, route of infection and transmissibility -are related to one another. comparative biology is routinely used on a case by case basis to assess the threat to public health posed by newly discovered pathogens -schmallenberg virus being a recent example. here we aspire to a more systematic approach to answering the question 'which kinds of viruses should we be most worried about?' in surveying human viruses we follow the nomenclature and taxonomy set out by the international committee for the taxonomy of viruses (ictv). 2 we catalogue ictv-recognised rna virus species for which we can find convincing evidence of natural human infection in the peer-reviewed scientific literature (see ref. 3 for more methodological details). whilst having a number of limitations (discussed elsewhere 4 ), the use of virus species as our unit of study is a natural starting point. our procedure reveals a total of 158 human infective rna virus species from 47 genera and 17 families (with one genus unassigned to a family). this inventory is almost certainly incomplete: we are still discovering or recognising new human infective rna viruses at an * corresponding author. tel.: +44 1316505456. average rate of more than 2 species per year (data from ref. 5). statistical analysis of rates of discovery confirms that there are still many more species yet to be discovered. 5 however, most of these new viruses are not that different, in terms of their taxonomy or ecology, from previously recognised viruses, implying that studying known viruses should provide insights as to what to expect in the future. among the human rna viruses 22% (34 species) infect only humans. the remaining 78% are zoonotic, i.e. they naturally infect vertebrate hosts other than humans. breaking this down we find that these "other" hosts are usually mammals (84 species) and sometimes other mammals or birds (40 species). humans do not share their rna viruses with any other kinds of vertebrate. at higher taxonomic levels the overlap between rna viruses of humans and of other mammals is even more striking: all but three species (hepatitis c, hepatitis delta and rubella) have close relatives, usually congenerics, which infect other mammals. the overlap is also illustrated in that 47 out of 60 recognised mammal virus genera contain human infective species, as do 17 out of 19 families. the overlap with avian viruses is less marked, although influenza a is an important instance. these observations give the strong impression that human infectivity evolves relatively easily among mammal rna viruses. this is supported by phylogenetic analyses suggesting that many human rna viruses have evolved by host switching from other mammals, 6 with hiv-1 as an obvious example. 7 humans may be infected by rna viruses via any of several possible routes including inhalation, ingestion, bites or broken skin, sexual contact, in utero, iatrogenic and arthropod vectors. some viruses can infect by multiple routes. here we focus on the distinction between viruses which are vector-borne and those which are not. there are 68 species of vector-borne rna virus that can infect humans. this is >40% of the total but they are confined to just 10 genera from 6 families. we have previously reported that there is a strong positive association between vector-borne transmission and a broad host range, which is likely due to the need for a pathogen to be able to infect whatever host its vector may bite. 8 for human rna viruses this tendency is very marked: there are none that are vector-borne and infect only humans, and just two (dengue and yellow fever) that are primarily viruses of primates; all the remainder have (or are believed to have) reservoirs in non-primate mammals or birds. we can distinguish three categories of human rna viruses based on their basic reproduction number in human populations (r 0 ). first, there are viruses for which r 0 may exceed 1, which implies that they are sufficiently transmissible between humans (via any natural route of infection, which may involve a vector) to cause major epidemics and/or persist endemically in human populations. there is a total of 52 species (including some zoonotic species, e.g. influenza a) in this category. other viruses always have r 0 less than 1. some of these are transmissible between humans but not sufficiently so that they can cause major epidemics and/or persist endemically; they are restricted to self-limiting outbreaks. we estimate that there are 28 species of this kind. the remaindercomprising almost half the total of human rna virus species -is not known to be transmissible between humans at all. this generally reflects their inability to replicate in tissues that permit release from the body (notably the upper respiratory tract, lower gastrointestinal tract, urogenital tract or possibly blood). of particular interest are characteristics of the r 0 > 1 rna viruses. here, we consider just one of many possibilities: whether such viruses are more or less likely to be vector-borne. we find a very strong and statistically significant tendency for human infective vector-borne rna viruses (in comparison to those transmitted by other routes) to be much less likely to have r 0 > 1 -dengue virus and yellow fever virus are the only examples. there is a similar pattern for being transmissible at all -just 14 of the 68 vectorborne species are that category. these results are illustrated in fig. 1 . here, we both confirm that the great majority of human rna viruses are zoonotic and highlight the considerable taxonomic overlap between those found in humans and those found in other mammals (and sometimes birds). we also find that few vector-borne human rna viruses spread efficiently through human populations, and the ones than can are primate specialists. the reasons for this remain unclear. however, patterns of this kind suggest that it may be possible to identify characteristics of novel viruses that predict their propensity to become significant public health problems, although we stress that we are describing trends not absolute rules. we offer two observations. first, rna viruses show little respect for any distinction we might make between ourselves and other mammals (or birds), and the study of their emergence in human populations is a classic "one health" problem. reflecting this, several important virus taxa -including the retro-, rota-and corona viruses -were known as animal pathogens before they were found in humans and, at least initially, there was greater knowledge of them in the veterinary community than the medical community. second, we cannot hope to understand the characteristics that make some viruses serious threats to public health if we do not also study those that are not. so we end with a plea not to neglect the more obscure and unregarded human rna viruses; they too have something to teach us. this work was supported by the wellcome trust (grants 093724 and 095831). we are grateful to liam herbert for statistical assistance and to numerous colleagues (too numerous to list individually) who have contributed to the ideas discussed here. emerging pathogens: the epidemiology and evolution of species jumps virus taxonomy ixth report of the international committee on taxonomy of viruses risk factors for human disease emergence how many human rna viruses are there? human viruses: discovery and emergence family level phylogenies reveal modes of macroevolution in rna viruses the evolution of hiv-1 and the origin of aids population biology of multi-host pathogens none. no ethical approvals were required for this work. key: cord-335208-xv2evahh authors: o loughlin, d.w.; coughlan, s.; de gascun, c.f.; mcnally, p.; cox, d.w. title: the role of rhinovirus infections in young children with cystic fibrosis date: 2020-06-01 journal: j clin virol doi: 10.1016/j.jcv.2020.104478 sha: doc_id: 335208 cord_uid: xv2evahh rhinovirus (rv) is an important virus in children with chronic respiratory conditions such as asthma; however, little is known about its role in cf. our aim was to examine the prevalence and clinical impact of different rv species in young children with cf. we collected clinical data and nasal swabs on patients at home and in the hospital setting. parents filled out symptom diaries and collected nasal swabs when their children were symptomatic and asymptomatic. a novel rv typing pcr assay was used to determine the rv species present. we collected 55 nasal swab samples from ten preschool cf patients over a six month period. the quality of parent collected samples at home was sufficient for pcr analysis. rv was the most common virus detected in young children with cf. there was no difference in the frequency of rv species between symptomatic and asymptomatic subjects. however, parental home-sampling is an acceptable and feasible approach to monitoring young children with cf. the role pulmonary exacerbations due to bacterial infections play in the development of cf lung disease is well documented [6, 7] . however, viruses are the major cause of acute respiratory illnesses in infants and young children, and there is increasing evidence that they play a role in the development of pulmonary exacerbations and cf lung disease in children with cf [8, 9] . additionally, rhinovirus (rv) has emerged as a significant pathogen in the development of asthma and recurrent wheeze in young children [10] . rv is prevalent and associated with pulmonary exacerbations in both adults and children with cf [9, [12] [13] [14] . while the role of rv species is well studied in children with asthma [15, 16] , there is limited evidence on their clinical impact in children with cf [12, 17] . previous studies have used nasal swabs (ns) collected at home by parents. however, the optimal sampling collection methodology in a community setting has not been fully validated in a young cf population [18] . we conducted a pilot study to examine the prevalence and clinical impact of different rv species in young children with cf and to assess the feasibility of parental home-sampling in this population. the study was conducted over a six month period (october 2015-april 2016) at children's health ireland, crumlin (chi) in dublin, ireland. children with cf under the age of six attending chi were invited to participate. ethical approval was obtained from the hospital ethics committee and informed consent was obtained from parents of participants. j o u r n a l p r e -p r o o f parents were taught how to take ns and provided with kits to collect samples and return by post. flocked ns (eswab, copan™) containing a transport medium were used for this study. parents were instructed to collect a nasal swab within 48 hours of their child developing acute respiratory symptoms. if the sample was taken on a weekend day, then we requested that the parent would keep the specimen refrigerated until monday and then send it in the post to us. they recorded the child's symptoms in a symptom diary for the duration of the study, including details on respiratory symptoms, absence from playschool, and treatment prescribed. we collated clinical information using the symptom diaries and medical records. ns were also collected at any scheduled or unscheduled hospital encounters by nursing staff. in addition, paired throat swabs as well as ns were collected by nursing staff if the parents reported symptoms at these hospital attendances. samples were initially stored at -80c at chi and were then sent to the national virus reference laboratory for analysis. a lab developed (ldt) real-time rt pcr targeting the 5'untranslated region of enteroviruses (ev) and rv was used to detect the presence of rv in all samples [27, 28] . positive rv specimens were further characterised using a novel rv typing assay [19] . nucleic acid was extracted using a roche magna pure 96 (roche, usa). a semi-nested pcr was used to amplify a variable segment of the 5' untranslated region and sanger sequencing was performed. rivm enterovirus online genotyping tool was used for characterisation [11] . the luminex respiratory pathogen panel rpp was used to test for the presence of other viral respiratory pathogens (luminex corp, usa). statistical analysis was performed with chi-squared testing to compare the presence of respiratory symptoms with rv detection using spss 24, ibm. ten participants were recruited to the study (50% male). the median age was 33 months (range 3-54 months). half (50%) of the cohort was homozygous for the ∆f508 genotype. over the six month period, 55 ns were collected, 39 (70.9%) of which were taken from symptomatic subjects and 16 (29.1%) from asymptomatic at the time of sampling. rhinorrhoea, cough, and wheeze were the most common respiratory symptoms reported in the symptom diaries. the median number of samples collected per subject over the study period was 6.0 ± 1.54 (range 3-8). of the 55 ns collected, 55/55 (100%) were adequate for viral pcr analysis. rhinorrhoea was the most common symptom recorded in the symptom diaries and the symptom was logged by parents in 85.7% of encounters. cough was the next most frequently recorded symptom, reported in 67.9% of encounters. other common symptoms reported were wheeze (25%) and fever (14.2%). rv was the most frequent virus detected in both symptomatic and asymptomatic subjects, being identified at least once in 80% of subjects. while rv was present in 21/55 (38.2%) nasal samples, it was detected in 14/39 (35.9%) samples taken when the child was symptomatic (table 1) (table 1) . rv-a was the commonest rv species detected, being present in 5 (35.8%) of the samples, rv-c was found in 4 (28.6%), rv-b in two (14.3%), and three (21.4%) samples had an rv that could not be typed. in asymptomatic subjects, rv was identified in the 7/16 (43.8%) of samples collected; rv-c was identified in 4 (57.1%), rv-b in 1 (14.3%), rv-a in none, and 2 (28.6%) samples had an rv that could not be typed (table 1) . no virus was detected in 9 (56.2%) subjects re-infection with a different rv species was seen in 40% of subjects. the median time to reinfection in subjects with another rv species was 40 ± 39.7 (range 28-138) days. the same rv species was seen in one subject four weeks after their initial swab was collected and symptoms had resolved. paired throat swabs for bacterial culture were collected on 17/39 (43.6%) symptomatic subjects. only 10/17 (58.8%) samples had a significant bacterial growth on culturing. staphylococcus aureus was the most common bacterium identified, representing 5/10 (50%) samples. haemophilus influenzae 3/10 (30%) and streptococcus pneumoniae 2/10 (20%) were the other bacteria detected on cultures. in subjects who were symptomatic, 9/17 (52.9%) were treated with a two week course of antibiotics. in asymptomatic children, 4/16 (25%) samples had a significant bacterial growth on culturing. staphylococcus aureus was the most common bacterium detected, seen in 3/4 (75%) of samples and haemophilus influenzae was detected in one (25%) sample. in all subjects, the median number of symptomatic days was 3.0 ± 3.73, range 1-15. there was no difference in the median number of days of symptoms for virus positive patients (3.0 ±3.4, range 2-12 days) versus virus negative patients (3.5 ± 4.53, range 1-15 days). rv positive subjects were not more likely to have symptoms when compared with rv negative subjects (chi-square = 1.01, p=0.31 although rv-a was detected in 35.8% of samples from symptomatic subjects, and in 0% of samples from asymptomatic subjects, numbers were not sufficient for further statistical analysis on whether there was a difference between rv species in relation to symptoms. this pilot study demonstrated the feasibility of parents collecting viable samples repeatedly from children with cf in their home environment. the high microbiological yield from home sampling and the use of up-to-date molecular rv typing methods are significant strengths of the study. our study demonstrated that 100% of the samples collected were of good quality which is comparable to other similar studies [17] . however, other studies have reported issues with the transport and viability of samples on arrival by mail [18, 26] that we did not experience. this study suggests that although rv is the most prevalent virus in young children with cf, it is not always associated with symptomatic infections. previous studies also found a high prevalence of rv infections in asymptomatic individuals with cf [9, 20, 21] . others have suggested that rv more frequently and persistently infects children with cf when compared with healthy controls [21] . this may be because of diminished antiviral defences in cf patients [22, 23] . rv-a was the most common species identified in symptomatic subjects. however, little data exists on the prevalence of rv species in children with cf [12, 17, 24] . previous studies indicate that rv-c is associated with more severe and frequent asthma and respiratory exacerbations in cf [15, 16, 17, 25] while another identified rv-a as the major rv species in cf exacerbations [12]. the prevalence rates of different rv species require further investigation in larger cohorts using methods to identify pathogenicity of different viruses. in conclusion, while the small number of subjects studied is a limitation of the study, our reported prevalence rates are similar to larger studies of similar cohorts [9, 20, 21] . significantly, this is the first study in ireland to report data on the prevalence of different rv species in an irish cf cohort using molecular rv typing methods and parent-led sampling, demonstrating the feasibility of these methods for studies in the future. cystic fibrosis bronchiectasis in infants and preschool children diagnosed with cystic fibrosis after newborn screening infection, inflammation, and lung function decline in infants with cystic fibrosis early bronchiectasis in cystic fibrosis detected by surveillance ct cystic fibrosis in young children: a review of disease manifestation, progression, and response to early treatment treatment of pulmonary exacerbations in adult cystic fibrosis patients: a review cystic fibrosis pulmonary guidelines: treatment of pulmonary exacerbations the role of respiratory viruses in cystic fibrosis role of respiratory viruses in pulmonary exacerbations in children with cystic fibrosis rhinovirus and the initiation of asthma enterovirus genotyping tool version 0 human rhinovirus infection in children with cystic fibrosis incidence and clinical impact of respiratory viruses in adults with cystic fibrosis virus and cystic fibrosis: rhinoviruses are associated with exacerbations in adult patients association between human rhinovirus c and severity of acute asthma in children rhinovirus is the most common virus and rhinovirus-c is the most common species in paediatric intensive care respiratory admissions rhinovirus c and respiratory exacerbations in children with cystic fibrosis feasibility of parental collected nasal swabs for virus detection in young children with cystic fibrosis improved molecular typing assay for rhinovirus species a, b, and c respiratory viruses in children with cystic fibrosis: viral detection and clinical findings. influenza other respir viruses frequency and duration of rhinovirus infections in children with cystic fibrosis and healthy controls: a longitudinal cohort study interferon response of the cystic fibrosis bronchial epithelium to major and minor group rhinovirus infection impaired type i and type iii interferon induction and rhinovirus control in human cystic fibrosis airway epithelial cells pathogenicity of individual rhinovirus species during exacerbations of cystic fibrosis human rhinovirus species c infection in young children with acute wheeze is associated with increased acute respiratory hospital admissions nasal swab samples and real-time polymerase chain reaction assays in community-based, longitudinal studies of respiratory viruses: the importance of sample integrity and quality control multiplex real-time pcr for detection of respiratry tract infections development and assay of rna transcripts of enterovirus species a to d, rhinovirus species a to c, and human parechovirus: assessment of assay sensitivity and specificity of real-time screening and typing methods key: cord-336535-r3a57m57 authors: kohmer, niko; westhaus, sandra; rühl, cornelia; ciesek, sandra; rabenau, holger f. title: brief clinical evaluation of six high-throughput sars-cov-2 igg antibody assays date: 2020-06-01 journal: j clin virol doi: 10.1016/j.jcv.2020.104480 sha: doc_id: 336535 cord_uid: r3a57m57 serological sars-cov-2 assays are urgently needed for diagnosis, contact tracing and for epidemiological studies. so far, there is limited data on how recently commercially available, high-throughput immunoassays, using different recombinant sars-cov-2 antigens, perform with clinical samples. focusing on igg and total antibodies, we demonstrate the performance of four automated immunoassays (abbott architect™ i2000 (n protein-based)), roche cobas™ e 411 analyzer (n protein-based, not differentiating between iga, igm or igg antibodies), liaison®xl platform (s1 and s2 protein-based), virclia® automation system (s1 and n protein-based) in comparison two elisa assays (euroimmun sars-cov-2 igg (s1 protein-based) and virotech sars-cov-2 igg elisa (n protein-based)) and an in-house developed plaque reduction neutralization test (prnt). we tested follow up serum/plasma samples of individuals pcr-diagnosed with covid-19. when calculating the overall sensitivity, in a time frame of 49 days after first pcr-positivity, the prnt as gold standard, showed the highest sensitivity with 93.3% followed by the dual-target assay for the virclia® automation system with 89%. the overall sensitivity in the group of n protein-based assays ranged from 66.7 to 77.8% and in the s protein-based-assays from 71.1 to 75.6%. five follow-up samples of three individuals were only detected in either an s and/or n protein-based assay, indicating an individual different immune response to sars-cov-2 and the influence of the used assay in the detection of igg antibodies. this should be further analysed. the specificity of the examined assays was ≥ 97%. however, because of the low or unknown prevalence of sars-cov-2, the examined assays in this study are currently primarily eligible for epidemiological investigations, as they have limited information in individual testing. . in addition, the sars-cov-2 serostatus of asymptomatic individuals or patients with mild clinical course, who present late (a couple of weeks) after infection, is of interest. ideally, a positive igg status will offer a potential immunity, but if so, questions on how long it will last, still remain. furthermore for therapeutic or prophylactic approaches, convalescent plasma may be used as vaccines and other drugs are under development (3) . for these purposes, sensitive and especially highly specific antibody assays are needed. the spike (s) protein of sars-cov-2 has shown to be highly immunogenic and is the main target for neutralizing antibodies (4) . currently there are different spike (s) and/or nucleocapsid (n) proteinbased commercially or in-house developed assays available, but there is limited data on how these tests perform with clinical samples. this study aims to provide a quick overview on some of these assays (two commercially available elisa assays, four automated immunoassays and a plaque reduction neutralization test (prnt)) focusing on the detection and neutralization capacity of igg antibodies in follow up serum or plasma samples of individuals with pcr-diagnosed infections with sars-cov-2. when calculating the overall sensitivity we used the total time frame of 49 days after first pcr-positivity and focussed on the different antigens (s-or n-antigen) used as binding antigen(s) in the assays. typically, the majority of j o u r n a l p r e -p r o o f we collected follow up serum or plasma samples (in the following simply stated as samples) from individuals with pcr-diagnosed infections with sars-cov-2 (n=45) (table s1) (table s2) . the non-sars-cov-2 samples were used to assess potential cross reactivity and the risk of potential false positive results. samples were tested within one day, in batches, on multiple commercially available (mostly automated) immunoassay platforms (table 1) according to the manufacturers' protocol. the euroimmun sars-cov-2 igg elisa (euroimmun, lübeck, germany) and virotech sars-cov-2 igg elisa (virotech diagnostics gmbh, rüsselsheim, germany; table 1) were used, in an identical manner, according to the manufacturer's recommendation. samples were diluted 1:101 in sample buffer and incubated at 37° for 60 or 30 mins, respectively, in a 96-well microtiter plate followed by each protocols' washing and incubation cycles, including controls and required reagents. optical density (od) was measured for both assays at 450 nm using the microplate reader of a virclia® automation system (vircell spain s.l.u., granada, spain). the signal-to-cut-off ratio was calculated and values expressed according to each manufacturer's protocol. for these purposes, there is a demand for (cost-effective) high-throughput assays, which can be automated and used for large sample sizes. the sensitivity of these assays depends on the used assay and moment of testing in the infection phase (low sensitivity a couple of days after infection vs. higher sensitivity a couple of weeks after infection (5, 6) . the commercially available assays examined in our study, generated consistent results regarding the detection of sars-cov-2-igg antibodies. the sensitivity (without differentiating the timepoint of sampling) varied within the group of assays using the same antigen as target for the antibodies. while the majority of antibodies are typically produced against the n-protein (which therefore might be the most sensitive target protein), antibodies produced against the s-protein are expected to be more specific and potentially neutralizing. in the group of n protein-based assays the sensitivity varied from 66.7 to 77.8% and in the s proteinbased assays from 71.1 to 75.6%. this might be due to differences within the used recombinant antigen and/or is a system-inherent feature. the dual target (s1 and n protein-based) assay for the vircell virclia® automation system and the prnt demonstrated the highest sensitivity with 89% and 93.3%, respectively. there is a large discrepancy in the determined sensitivities for the assays examined in our study to the sensitivities according to the manufacturers' specifications and the data described in literature. this is not because of the small examined sample size, but because overall sensitivities (not differentiating between the time-points after positive pcr-testing) were given in this study. this was done for a better comparability of the examined assays in terms of demonstrating the differences in the used antigens of the assays on its ability to detect antibodies, independent from the time point of sampling. as gold standard, the prnt is hands on-and time-intensive and can j o u r n a l p r e -p r o o f only be performed for smaller sample sizes in a bsl-3 laboratory. however, it is capable to detect neutralizing antibodies. in our study, the antibody titers generated with the commercially available assays correlated well with the prnt titers. the mechanism of immunity, especially of protective immunity (if applicable) and how long it will last, need to be further investigated. a titer needed for potential protective immunity is not yet (officially) defined. besides humoral mediated immunity, there is evidence that t-cell mediated immunity plays a role (7) . interestingly, in samples of three individuals with mild clinical course of covid-19, examined in our study (1, 2, 3 in the automated immunoassays demonstrated a higher overall sensitivity than the elisa based assays. especially the assay using the s and n protein as antigens showed the highest sensitivity within the group of commercially available assays examined in this study (including samples with individual characteristics). the titers generated with these assays correlated well with the prnt, demonstrating the neutralizing capacity of detected antibodies. because of the low prevalence of sars-cov-2 at the moment, these assays are currently primarily eligible for epidemiological investigations, as they are only of limited informative value in individual testing. nk and hr designed the study. nk, cr and sw performed experiments. nk, hr and sc analyzed data. nk and hr wrote the manuscript. all authors discussed the results and commented on the final manuscript. sars-cov-2 and coronavirus disease 2019: what we know so far viral load dynamics and disease severity in patients infected with sars-cov-2 in zhejiang province convalescent plasma transfusion for the treatment of covid-19: systematic review characterization of spike glycoprotein of sars-cov-2 on virus entry and its immune cross-reactivity with sars-cov antibody detection and dynamic characteristics in patients with covid-19 profile of specific antibodies to sars-cov-2: the first report the trinity of covid-19: immunity, inflammation and intervention temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by sars-cov-2: an observational cohort study severe acute respiratory syndrome coronavirus 2-specific antibody responses in coronavirus disease *two equivocal results (hcov-oc43, negative control cohort) were considered as negative **including follow up samples of sars-cov three equivocal results (one hcov-229e sample *one equivocal result for one sars-cov sample was considered negative key: cord-337799-mc1oqhf4 authors: mak, gannon ck; lau, stephen sy; wong, kitty ky; chow, nancy ls; lau, cs; lam, edman tk; chan, rickjason cw; tsang, dominic nc title: analytical sensitivity and clinical sensitivity of the three rapid antigen detection kits for detection of sars-cov-2 virus date: 2020-10-29 journal: j clin virol doi: 10.1016/j.jcv.2020.104684 sha: doc_id: 337799 cord_uid: mc1oqhf4 background: numerous rapid antigen detection (rad) kits for diagnosing covid-19 patients are available in the market recently. objective: to compare analytical sensitivity and clinical sensitivity for the three commercially available rad kits. study design: analytical sensitivity for the detection of sars-cov-2 virus was determined by limit of detection (lod) using pcr as a reference method. clinical sensitivity was evaluated by using respiratory specimens collected from confirmed covid-19 patients. results: the lod results showed that the three rad kits varied 102 to 105 fold less sensitive than rt-pcr. clinical sensitivity of rad kits ranged from 22.9% to 71.4% for detecting specimens from covid-19 patients. conclusions: although rad kits were less sensitive than rt-pcr, understanding the clinical characteristics of different rad kits can guide us to obtain suitable specimens for testing. the likelihood of positive results for rad kits will be higher. the rapid diagnosis of covid-19 patients is essential to reduce the disease spread. besides rt-pcr, rapid antigen detection (rad) kits for qualitative determination of sars-cov-2 antigen are available. rad kits are less expensive than rt-pcr. in addition, the test results of rad kits can be available without specialized instrument and interpreted within 30 min. currently, who does not recommend specific commercial rad kit for patient care. however, researches of different rad kits are encouraged especially for the performance of sensitivity [1, 2] . we previously evaluated a rad kit for sars-cov-2 on may 2020 [3] . since then, many new rad kits are commercially available. data on the performance of rad kits varied between different studies and different brands [4] [5] [6] [7] [8] [9] . the purpose of this evaluation is to assess analytical sensitivity of the three sars-cov-2 rad kits by means of limit of detection (lod) using a set of serial tenfold dilution samples; and the rad kits selected in the present study were all commercially available in hong kong. these kits were either evaluated in previous studies or demonstrated good clinical performance mentioned in the kit inserts. the three kits evaluated were: (1) these three kits employ a lateral flow test format to detect viral antigen by the immobilized coated sars-cov-2 antibody on the device. the test results can be interpreted without a reader at 15 min. the intended use for these kits is for the detection of sars-cov-2 virus in either nasopharyngeal swabs or secretions. the procedures were carried out according to manufacturer's instructions. for the nadal, since our specimens were placed in viral transport media or phosphatebuffered saline, 350μl specimen volume was mixed with 10 drops of extraction buffer (personal communication with nal von minden gmbh). the subsequent procedures were carried out according to the manufacturer's instructions. to determine lod between different kits, a respiratory specimen was selected to perform a serial tenfold dilution. the selected specimen was nasopharyngeal aspirate and throat swab (npa & ts) which was obtained from the hong kong covid-19 patient, hcov-19/hong kong/vm20030475/2020. to minimize the number of freezethaw cycle, the three kits were tested in parallel for this set of serial dilution at the same time. the biocredit covid-19 ag (rapdgen inc. korea) kit was also tested as a reference method simultaneously. virus concentrations in each dilution were estimated from cycle threshold (ct) value as described [3] . j o u r n a l p r e -p r o o f ideally, the specimens selected should be tested in parallel for the three kits. in order to evaluate the three kits simultaneously, a total specimen volume of 800μl is needed (coris=100μl, nadal=350μl, standard q=350μl). due to the limited quantity for each specimen, the same specimen cannot be tested for all kits. since both coris and standard q shared similar operating procedures, they were tested together using the same set of specimens. another set of specimens were tested for nadal. for these two sets of specimens were roughly the same, specimens of various ct values up to ∼34 were selected (which is close to the limit of detection for rt-pcr). the technicians performing the rad kits were blinded to the rt-pcr results. all of the kits evaluated were not involved using readers for determining a positive or negative result. visual output of the cassettes was read by two technicians. in case of disagreement, the visual output was read by the third technician. j o u r n a l p r e -p r o o f the lod of the reference rad kit, biocredit covid-19 ag was 10 5 fold less sensitive than rt-pcr (biocredit covid-19 ag: 10− 2 ; rt-pcr: 10− 7 ) which was concordant to our previous study in may 2020. as shown in table 1 , the three rad kits shared the same lod at 10− 2 , they were biocredit covid-19 ag, coris and nadal. the lod of standard q was 10− 5 . the corresponding ct values for lod at 10− 2 and 10− 5 were 18.44 and 28.67 respectively. although viral culture was not performed in the present study, the standard q was 10 2 fold less sensitive than rt-pcr, it corresponded to the lod of viral culture based on our results reported previously. since the cut-off of 18.57 for biocredit covid-19 ag was utilized in our previous study in may 2020, it was also used in the present study for consistency to classify specimens as 'high viral load'. specimens with ct values between 18.57 and 28.67 were classified as 'normal viral load' while specimens >28.67 were classified as 'low viral load'. of the 280 specimens tested, 72, 132 and 76 specimens were classified as 'high viral load', 'normal viral load' and 'low viral load' specimens respectively. the ratio was approximately 1:2:1 which was similar to the viral load distribution of specimens collected by phlsb. rad kits showed high sensitivity (77.8% to 100%) for high viral load specimens but low sensitivity (0 to 11.1%) for low viral load specimens. for normal viral load specimens, one kit was capable of having sensitivity of ≥75% while the other two kits ranged from 6 in the cross-reactivity test using virus isolates, all were tested negative by the rad test. the purpose of this study is to evaluate if the commercially available rad kits are j o u r n a l p r e -p r o o f suitable for diagnosing sars-cov-2 infection, however, ranking of rad kits is not our objective. our study demonstrated a good correlation between lod and clinical sensitivity. it means that the sensitivity of rad kits is viral load dependent. viral load depends on whether the patients are symptomatic and the course of the disease. it should be noted that although our data indicated that rad kits were capable of detecting sars-cov-2 virus in throat saliva, majority of invalid results were found in throat saliva which should be due to the viscous nature of throat saliva. similar findings were also observed in our previous study [3] . throat saliva is not recommended as a specimen of choice where the collection of other types of specimens is available. understanding the clinical characteristics of different rad kits can guide us to obtain suitable specimens for testing. the performance of rad kits could be tailored by targeting a specific patient group. specimens obtained ≤5 days after symptom onset are most likely contain high viral loads [10] . we have analyzed the proportion of specimen for the two cut-offs, ct ≤18.57 and ct ≤28.67, according to days after symptom onset from ≤day 1 to ≤day 7. a total of 3932 specimens were available for analysis. these specimens comprised throat saliva, nps & ts, npa & ts, nps collected from 31 jan 2020 to 13 sep 2020. information of date of symptom onset for j o u r n a l p r e -p r o o f each specimen was collected [11] . we found that viral loads of some specimens collected early after symptom onset have similar viral loads for specimens collected late after symptom onset. it means that if we set a cut off by means of ≤day x after symptom onset for performing rad kits, we will miss another group of specimens having a similar high viral load. we found that for ct ≤18.57, testing specimens obtained ≤5 days after symptom onset will likely to match the high viral load specimens while keeping the minimum proportion of specimens having a similar high viral load that were missed. for ct ≤28.67, specimens obtained ≤7 days after symptom onset are optimum (supplementary table s ). this observation was concordant to the who guideline that symptomatic cases should be tested within the first 5-7 days of illness [2] . the standard q might be suitable for use as an aid to early diagnosis of sars-cov-2 infection in terms of analytical and clinical sensitivity. this kit is listed in the 'who emergency use listing for in vitro diagnostics (ivds) detecting sars-cov-2' [12] . the exact time period after symptom onset for use is not mentioned by the standard q. a recent study showed that the sensitivity can be decreased from 83.9% to 76.3% when specimens obtained ≤5 and ≤7 days after symptom onset respectively [13] . our data showed that although the prevalence of specimens with ct ≤28.67 decreased j o u r n a l p r e -p r o o f from 81.8% to 79.9% when specimens obtained ≤5 and ≤7 days after symptom onset respectively, the number of specimens with ct ≤28.67 that were skipped for testing was decreased from 18.2% to 9.4% (table s2) . therefore, we recommended specimens obtained ≤7 days after symptom onset for use with the standard q. then, the rad kit can serve as a covid-19 filter (filtered out of the infected persons and prevent spread to the others). the balance between turnaround time and sensitivity should be considered. a diagnostic test with high analytical sensitivity can still be failed to be a covid-19 filter [14] . the limitation of this study is to use ct value to estimate viral load. ct values for a given target rna can vary between rt-pcr assays and both intra-and inter-pcr runs. however, the same in-housed developed rt-pcr assay is consistently used for diagnosing sars-cov-2 infection in phlsb and also our evaluations, variations of ct values can be minimized. although ct is a semiquantitative value, it can also be used for guiding infection control and public health decisions [15, 16] . it is expected that many rad kits for diagnosing sars-cov-2 infection are emerged in this exploding field. access to laboratory services based on rapid diagnostic tests alone is common in developing countries [17] . with the lack of regulatory policies, j o u r n a l p r e -p r o o f laboratories took the responsibility for governance and quality control for rapid diagnostic tests [18] . the difficulty of evaluating rad kits is limited by collecting a large number of positive specimens of different types. the lod can predict the performance of rad tests and it has been utilized in rad kits for diagnosing influenza [19] . in future, the lod approach will be performed first in our setting. when the lod results demonstrate better results than the reference method, a full evaluation using clinical specimens of various concentrations will be performed. it should be noted than when determining clinical sensitivity, if only specimens of high viral load were selected, every kit will have a 100% clinical sensitivity [20] . in conclusion, adoption of rad kit for clinical use should be guided by evidences. when the study is well-performed to understand the clinical characteristics, the rad kit will be safe to use. none. j o u r n a l p r e -p r o o f advice on the use of point-of-care immunodiagnostic tests for covid-19. scientific brief antigen-detection in the diagnosis of sars-cov-2 infection using rapid immunoassays. interim guidance evaluation of rapid antigen test for detection of sars-cov-2 virus development and potential usefulness of the covid-19 ag respi-strip diagnostic assay in a pandemic context. front med (lausanne) evaluation of a rapid diagnostic assay for detection of sars-cov-2 antigen in nasopharyngeal swabs low performance of rapid antigen detection test as frontline testing for covid-19 diagnosis implementation of rapid sars-cov-2 antigenic testing in a laboratory without access to molecular methods: experiences of a general hospital evaluation of two rapid antigen tests for detection of sars-cov-2 virus urgent need of rapid tests for sars cov-2 antigen detection: evaluation of the sd-biosensor antigen test for sars-cov-2 spatial and temporal dynamics of sars-cov-2 in covid-19 patients: a systematic review and meta-analysis latest situation of cases of covid-19 who. who emergency use listing for in vitro diagnostics (ivds) detecting sars-cov-2 clinical evaluation of bd veritor sars-cov-2 point-of-care test performance compared to pcr-based testing and versus the sofia 2 sars antigen point-of-care test rethinking covid-19 test sensitivity -a strategy for containment predicting infectious severe acute respiratory syndrome coronavirus 2 from diagnostic samples a call for diagnostic tests to report viral load point-of-care tests for diagnosing infections in the developing world how are rapid diagnostic tests for infectious diseases used in clinical practice: a global survey by the international society of antimicrobial chemotherapy (isac) epub ahead of print comparative analytical sensitivities of six rapid influenza a antigen detection test kits for detection of influenza a subtypes h1n1, h3n2 and h5n1 response to letter of concern by oladimeji and pickford of primerdesign key: cord-340336-u59l0taa authors: perchetti, garrett a.; nalla, arun k.; huang, meei-li; jerome, keith r.; greninger, alexander l. title: multiplexing primer/probe sets for detection of sars-cov-2 by qrt-pcr date: 2020-06-08 journal: j clin virol doi: 10.1016/j.jcv.2020.104499 sha: doc_id: 340336 cord_uid: u59l0taa background: the novel respiratory virus sars-cov-2, responsible for over 380,000 covid-19 related deaths, has caused significant strain on healthcare infrastructure and clinical laboratories globally. the pandemic's initial challenges include broad diagnostic testing, consistent reagent supply lines, and access to laboratory instruments and equipment. in early 2020, primer/probe sets distributed by the cdc utilized the same fluorophore for molecular detection requiring multiple assays to be run in parallel consuming valuable and limited resources. methods: nasopharyngeal swabs submitted to uw virology for sars-cov-2 clinical testing were extracted, amplified by our laboratory developed test (ldt) a cdc-based quantitative reverse transcriptase pcr reaction and analyzed for agreement between the multiplexed assay. laboratoryconfirmed respiratory infection samples were included to evaluate assay cross-reaction specificity. results: triplexing correctly identified sars-cov-2 in 98.4% of confirmed positive or inconclusive patient samples by single-plex ldt (n = 183/186). all 170 sars-cov-2 negative samples tested by single-plex ldt were negative by triplexing. other laboratory-confirmed respiratory infections did not amplify for sars-cov-2 in the triplex reaction. conclusions: multiplexing two virus-specific gene targets and an extraction control was found to be comparable to running parallel assays independently, while significantly improving assay throughput.  -of all 356 samples tested, triplexing demonstrated 99.2% (n=353/356) assay agreement abstract: background -the novel respiratory virus sars-cov-2, responsible for over 380,000 covid-19 related deaths, has caused significant strain on healthcare infrastructure and clinical laboratories globally. the pandemic's initial challenges include broad diagnostic testing, consistent reagent supply lines, and access to laboratory instruments and equipment. in early 2020, primer/probe sets distributed by the cdc utilized the same fluorophore for molecular detection -requiring multiple assays to be run in parallel -consuming valuable and limited resources. methods -nasopharyngeal swabs submitted to uw virology for sars-cov-2 clinical testing were extracted, amplified by our laboratory developed test (ldt) -a cdc-based quantitative reverse transcriptase pcr reaction -and analyzed for agreement between the multiplexed assay. laboratory-confirmed respiratory infection samples were included to evaluate assay cross-reaction specificity. results -triplexing correctly identified sars-cov-2 in 98.4% of confirmed positive or inconclusive patient samples by single-plex ldt (n=183/186). all 170 sars-cov-2 negative samples tested by single-plex ldt were negative by triplexing. other laboratory-confirmed respiratory infections did not amplify for sars-cov-2 in the triplex reaction. the novel virus responsible for causing coronavirus disease 2019 (covid-19), severe acute respiratory syndrome coronavirus 2 (sars-cov-2), has infected more than six million individuals in 188 countries as of writing [1] . emerging from wuhan, china in late 2019, the ongoing pandemic has been intensified by lack of adequate diagnostic testing in the us and internationally [2] . sars-cov-2 is highly communicable with significant morbidity and mortality [3, 4, 5] . early detection of sars-cov-2 can identify patients who are more likely to experience significant disease and so curb pathogen transmission and scope of global contagion. many labs use the centers for disease and control and prevention (cdc) primer and probe sets targeting n1 and n2 for sars-cov-2 and rpp30 as a human control [6] . as the cdc kits utilize the same fluorescent reporter for each of the primer/probe sets, reactions are required to be run separately, leading to fewer than 30 samples per 96-well plate. to increase throughput of sars-cov-2 testing in clinical laboratories, we designed a multiplexed real-time quantitative reverse transcription pcr (qrt-pcr) assay utilizing primers and probe sets from the cdc combined with an internal extraction control. multiplexed qrt-pcr is a powerful tool in laboratory medicine, able to detect infectious disease pathogens effectively and efficiently. multiple target assays are critical for accurate sars-cov-2 detection, as it is possible to miss low viral load infections if only a single gene amplicon is used. after running a duplex reaction with n1 and n2 in separate wells with internal control, we developed a three-target single-reaction triplex assay with the same viral nucleocapsid gene targets. multiplexing offers increased throughput of sars-cov-2 detection by reducing the quantity of qrt-pcr reactions run in parallel [7] . here, we describe a singlereaction, triplex assay for sars-cov-2 that demonstrates comparable sensitivity to individual parallel assays. the sars-cov-2 positive control consisted of a wild-type clinical nasopharyngeal (np) swab tested at uw virology in late february, 2020. hela cells for extraction and no template controls of water for amplification were included as negative standards. np swabs in viral transport media were submitted to uw virology for covid-19 clinical testing by ldt beginning in march 2020. specimens were subsequently compared to triplex assay performance by cts and percent of positive samples detected. nucleic acid (na) extraction was performed on roche's magna pure 96 instrument enabling high-throughput total na extraction using the pathogen universal kit [8] . in brief, 200µl of sample was extracted and eluted into 50µl elution buffer and 5µl of eluted template was utilized for each subsequent 25µl ldt assay, whereas 11µl of eluted rna was used for triplexing. distinct amplicons within the n gene, the region encoding a nucleocapsid protein of sars-cov-2, were targeted for detection: n1 and n2. each target was combined with exo (a 130-base rna transcript derived from jellyfish dna) to serve as an internal extraction control [9, 10] . if all targets amplified, the result was determined positive. if only one of the n gene targets amplified with exo, then the result is inconclusive and subsequently re-tested. not detected (ndet) test results required the amplification of exo, without n1 or n2 amplification. reaction, the threshold was set at 0.025 for n1 and n2, while exo's threshold was set at 0.02 [13] . we compared the performance of a novel triplex three-target assay run in parallel to the washington state emergency use authorization ldt performed at uw virology. positive multiplexing offers a two-reaction or even single-reaction assay that significantly reduces reagent consumption, labor, inconsistencies in reporting, and frees up valuable lab equipment when it is critically needed. we demonstrated that the cdc individual assays can be triplexed into a single-reaction without substantially compromising sensitivity, detecting 98.4% of samples determined positive or inconclusive by sars-cov-2 ldt. this work was supported by the department of laboratory medicine at the university of washington medical center. the authors declare no conflict of interest. j o u r n a l p r e -p r o o f an interactive web-based dashboard to track covid-19 in real time clinical features of patients infected with 2019 novel coronavirus in wuhan, china, the lancet estimating clinical severity of covid-19 from the transmission dynamics in wuhan, china coronavirus fatality rate estimated by imperial scientists | imperial news | imperial college london estimating case fatality rates of covid-19 what went wrong with coronavirus testing in the u.s. | the new yorker, the new yorker triplex real-time rt-pcr for severe acute respiratory syndrome coronavirus 2, emerg performance of the magna pure 96 system for cytomegalovirus nucleic acid amplification testing in clinical samples mucosal shedding of human herpesvirus 8 in men comparison of a multiplex real-time pcr assay with a multiplex luminex assay for influenza virus detection comparative performance of sars-cov-2 detection assays using seven different primer/probe sets and one assay kit jcm;jcm.00557-20v1 cdc 2019-novel coronavirus (2019-ncov) real-time rt-pcr diagnostic panel pcr inhibitors -occurrence, properties and removal detection and quantification of human metapneumovirus in pediatric specimens by real-time rt-pcr comparison of real-time pcr assays with fluorescent-antibody assays for diagnosis of respiratory virus infections in children clinical disease in children associated with newly described coronavirus subtypes looming threat of covid-19 infection in africa: act collectively, and fast, the lancet triplex real-time rt-pcr for severe acute respiratory syndrome coronavirus detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr we would like to acknowledge all essential workers in healthcare and the front lines during the covid-19 pandemic. we would also like to thank reigran sampoleo for assistance with exo sequence data. key: cord-345603-mirsz6m8 authors: wehrhahn, michael c.; robson, jennifer; brown, suzanne; bursle, evan; byrne, shane; new, david; chong, smathi; newcombe, james p.; siversten, terri; hadlow, narelle title: self-collection: an appropriate alternative during the sars-cov-2 pandemic date: 2020-05-04 journal: j clin virol doi: 10.1016/j.jcv.2020.104417 sha: doc_id: 345603 cord_uid: mirsz6m8 objectives: to evaluate the reliability of self-collection for sars-cov-2 and other respiratory viruses because swab collections for sars-cov-2 put health workers at risk of infection and require use of personal protective equipment (ppe). methods: in a prospective study, patients from two states in australia attending dedicated covid-19 collection clinics were offered the option to first self-collect (sc) throat and nasal swabs (scnt) prior to health worker collect (hc) using throat and nasal swabs (site 1) or throat and nasopharyngeal swabs (site 2). samples were analysed for sars-cov-2 as well as common respiratory viruses. concordance of results between methods was assessed using cohen's kappa (κ) and cycle threshold (ct) values were recorded for all positive results as a surrogate measure for viral load. results: of 236 patients sampled by hc and sc, 25 had sars-cov-2 (24 by hc and 25 by sc) and 63 had other respiratory viruses (56 by hc and 58 y sc). sc was highly concordant with hc (κ = 0.890) for all viruses including sars-cov-2 and more concordant than hc to positive results by any method (κ = 0.959 vs 0.933). mean sars-cov-2 e-gene and n-gene, rhinovirus and parainfluenza ct values did not differ between hc and scnt. conclusions: self-collection of throat and nasal swabs offers a reliable alternative to health worker collection for the diagnosis of sars-cov-2 and other respiratory viruses and provides patients with easier access to testing, reduces exposure of the community and health workers to those being tested and reduces requirement for ppe. on the 11 th march 2020, the world health organisation (who) announced covid-19 as a pandemic. 1 the who director-general issued a call for urgent action and encouraged all countries to 'innovate and learn' in their response to this crisis. self-collected swabs in the community for sars-cov-2, the agent of covid-19, and for other respiratory viruses offers potential significant benefit in the current pandemic by j o u r n a l p r e -p r o o f reducing requirement for ppe, limiting exposure of patients and staff to infection, increased convenience and access for patients and timeliness of a sample receipt. 2, 3 patients report selfcollected nasal swabs are easy to perform 2,4,5 and highly acceptable. 2, 4 a meta-analysis of 9 studies comparing self-collect (sc) and health care worker collect (hc) for influenza testing reported a pooled sensitivity of 87% and specificity of 99% for sc compared to hc. 6 irving et al studied paired samples from 240 adults and found sensitivity using nasal or nasopharyngeal (np) collection for influenza did not vary significantly when using a highly sensitive molecular test. 7 a study in 230 children reported equivalent sensitivity for all respiratory viruses except respiratory syncytial virus (rsv) when comparing nasal swab and np aspirate. 8 larios et al demonstrated that using flocked swabs and sensitive molecular methods, equivalent sensitivity and specificity was obtained for matched self-collected midturbinate nasal swabs and np swabs in 38 individuals for a range of respiratory viruses including human coronaviruses. 9 recent reports on sars-cov-2 in respiratory specimens indicate early high viral loads in symptomatic and asymptomatic patients in a variety of clinical specimens including nasal and throat swabs, sputum and saliva samples. [10] [11] [12] [13] [14] wang et al reported that in 205 patients with covid-19 the highest positive rates were found from bronchoalveolar lavage fluid, sputum and nasal swabs respectively. 15 wolfel 14 and colleagues reported that in hospitalized cases of covid-19 there was no discernible difference between np and throat swabs with high viral load present in both specimens early in the illness and suggested that simple throat swabs may provide sufficient sensitivity when patients are first tested with mild symptoms of covid-19. the aim of this study was to compare prospectively the performance of hc with separate sc nasal (scn) and throat swabs (sct) and the combination of the two (scnt) for respiratory viruses including sars-cov-2. this study was conducted across two laboratory sites (site 1 and site 2) and had ethics approval with all participants providing informed consent. for a period of one week in march 2020, patients presenting for sars-cov-2 testing at dedicated covid-19 collection rooms were offered participation in the study. demographic data was recorded including the address postcode to assess the index of education and occupation (ieo) which assesses education level based on a scale of 1 to 5 with 5 being the highest level of education. 16 a positive result on either hc or sc was defined as the benchmark result all positives (ap). concordance between hc and sc swabs and ap was calculated using cohen's kappa (κ), which measures agreement between the categorical assignments given by two methods. the statistic takes values typically between zero and one. a κ >0·80 indicates very good agreement, while κ=1 indicates perfect concordance. cycle threshold (ct) values were recorded for all positive test results as a surrogate measure for viral load. mean ct was compared between hc and scnt (combined category using the lowest ct of either scn or sct), using linear mixed effects models, with a random effect for patient identification. hc and sc sars-cov-2 positivity rates were compared with pearson's χ 2 test. from power calculations assuming a significance level of 5% and a null hypothesis of low concordance between the hc and sc methods (h 0 : κ=0·3), there was at least 80% power to detect a concordance of 0·6 or more with a sample size of 66. significance level α was set at 0·05, however for concordance and regression analyses, a bonferroni multiple testing correction was applied such that minimum α'=0·05/8=0·0063. statistical analyses were completed in the r statistical computing environment, 19 including the package irr. table 1) . a positive result on either hc or scnt was included in the group ap. table 2 when all detections by hc and scnt were compared with ap, the sensitivity of scnt and hc to detect sars-cov-2 was 1·0 (95%ci: 0·86-1) and 0.96 (95%ci: 0·8-1) respectively; for other respiratory viruses it was 0·94 (95%ci: 0·87-0·98) and 0.91 (95%ci: 0·83-0·96) respectively. j o u r n a l p r e -p r o o f table 3 summarises concordance between ap and each collection method. both scnt and hc showed very high concordance with ap at each site and overall, with scnt slightly higher (κ=1, 0·934, 0·959 at site1, site2, combined sites) than hc (κ=0·929, 0·934, 0·933). additionally, scnt was highly concordant with hc (κ=0·929, 0·863, 0·890 at site 1, site 2, combined sites). when ct values for covid-19 cases were compared by collection method (figure 1) , mean e-gene ct did not differ between hc and scnt or scn (p=0·236, 0·083, against α'=0·0083) but was significantly higher in sct compared with hc (β=7·31, p<0·001). mean n-gene ct did not differ between hc and scnt (p=0·041; α'=0·0083) but was higher in scn and sct (β=4·00, p=0·006; β=7·63, p<0·001). in rhinovirus cases ( figure 2 ), mean ct was not significantly higher in scnt compared with hc (p=0·036; α'=0·.017) but was higher in scn and sct (β=2·50, p=0·002; β=6·68, p<0·001). in parainfluenza cases, mean ct differed between hc and scn (β=4·67, p=0·014) but not the other methods (scnt v hc, p=0·231; sct v hc, p=0·119; α'=0·017). at site 1 an analysis of acceptability was performed using a questionnaire and was completed by 42/70 (60%) participants with 31/42 (74%) preferring self-collection over trained collectors, with all considering it acceptable. analysis of the ieo found that the median (lq, uq) ieo was 3 (2, 4) with participants identified across all educational levels but the majority (30/42, 71%) were in the 3 lowest education levels and a smaller proportion (12/42, 29%) in the highest 2 levels. following this study, site 1 has since processed a small percentage of sc swabs (7% of all collections). there was no significant difference in the sars-cov-2 detections between hc with 242/13851 (1·8%) and sc with 20/1035 (1·9%) (p=0·753 from χ 2 test). in our group of 236 ambulatory, literate, mostly adult patients, the performance of selfcollected nasal and throat swabs was at least equivalent to that of health care worker collected swabs for the detection of sars-cov-2 and other respiratory viruses. this study included two different sites using two different methods of hc (combined n + t and combined np + t) and also employed two different molecular strategies for detection of sars-cov-2. as such these findings are more widely applicable. at site 1 where scnt was compared with hc using the same swab and collection methods, when data from each site was combined, concordance between scnt or hc with the all positive rate was very high, slightly favouring scnt. the similar sars-cov-2 percentpositivity rate in ongoing comparison data between those having only hc or sc provides further reassurance that scnt is equivalent to hc. the advantages of self-collection are even more important at a time of global health crisis. self-collection greatly reduces the number of patients requiring trained health workers and the necessary ppe to protect them. access to testing is increased, as swab kits can be j o u r n a l p r e -p r o o f provided quickly by clinicians or available at dedicated covid-19 collection centres aiding timeliness of testing 3 which is critical in the current pandemic. 2,3 safety for both patients and staff using a sc model is also increased as exposure to others is limited. further, data from patients at site 1 suggests that sc is accessible and achievable over a range of education levels with all finding sc acceptable and the majority having a preference for this method over hc as has previously been reported. 2, 4, 5 this may relate to the ability of patients to control the comfort level of throat and nasal collection better than a trained collector can. recent studies suggest there is a high viral load in patients with early covid-19 across the upper and lower respiratory tracts, including nasal and throat sites [10] [11] [12] 14 as well as in saliva, 13 even in asymptomatic, mild or prodromal states. wolfel et al noted no discernible difference between nasopharyngeal and oropharyngeal viral loads in hospitalized cases of covid-19. 14 given these high viral loads throughout the respiratory tract it may be that requiring np sampling is not as significant for sars-cov-2 as for some other respiratory viruses. it may also be that pcr methods for viral detection are improving the sensitivity of a range of sample and collection methods as shown for a range of respiratory viruses but also group a streptococcal detection. 9, 10 we hypothesize that the high viral load of sars-cov-2 and sensitive molecular techniques may explain the equivalent sensitivity of sc to hc samples in covid-19 patients. our data support the decision by the communicable disease network of australia (cdna) 21 to recommend sampling of both nasal and throat sites for the diagnosis of respiratory viruses including for sars-cov-2, due to the concern of a possible missed diagnosis if only one site is sampled. this was the case for two covid-19 positive patients on sc who were only diagnosed by scn and another only by sct. if only one swab site was obtainable, our data further data on self-collection would be helpful to confirm these findings. the world is facing unprecedented demands on health care services during the covid-19 pandemic. innovative ways to address this crisis are required and we believe that this study provides early evidence that self-collection of throat and nasal swabs for sars-cov-2 offers an acceptable and reliable alternative to health care worker collected samples. this is achieved whilst preserving critically needed ppe supplies, optimizing the time to testing and reducing exposure of health care workers to potentially infected patients. funding: this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. who director-general's opening remarks at the media briefing on covid-19 -11 the acceptability and validity of self-collected nasal swabs for detection of influenza virus infection among older adults in thailand self-collected nasal swabs for respiratory virus surveillance equivalence of self-and staff-collected nasal swabs for the detection of viral respiratory pathogens effectiveness of patient-collected swabs for influenza testing self-collected compared with professionalcollected swabbing in the diagnosis of influenza in symptomatic individuals: a meta-analysis and assessment of validity comparison of nasal and nasopharyngeal swabs for influenza detection in adults nasal swab versus nasopharyngeal aspirate for isolation of respiratory viruses self-collected mid-turbinate swabs for the detection of respiratory viruses in adults with acute respiratory illnesses sars-cov-2 viral load in upper respiratory specimens of infected patients viral load of sars-cov-2 in clinical samples viral load kinetics of sars-cov-2 infection in first two patients in consistent detection of 2019 novel coronavirus in saliva virological assessment of hospitalized patients with covid-2019 detection of sars-cov-2 in different types of clinical specimens census of population and housing: socio-economic indexes for areas (seifa) australia 2019-novel coronavirus (2019-ncov) real-time rrt-pcr panel primers and probes equal performance of self-collected and health care worker-collected pharyngeal swabs for group a streptococcus testing by pcr public health laboratory network (phln) guidance on laboratory testing for sars-cov-2 (the virus that causes covid-19) we thank the patients who participated in this study, the training and patient services departments, the collection and clinical area managers, clinical supervisors, collection staff, and molecular laboratory staff without whom this study would not have been possible. key: cord-338923-hc7gagnq authors: jääskeläinen, aj; kuivanen, s; kekäläinen, e; ahava, mj; loginov, r; kallio-kokko, h; vapalahti, o; jarva, h; kurkela, s; lappalainen, m title: performance of six sars-cov-2 immunoassays in comparison with microneutralisation date: 2020-06-15 journal: j clin virol doi: 10.1016/j.jcv.2020.104512 sha: doc_id: 338923 cord_uid: hc7gagnq there is an urgent need for reliable high-throughput serological assays for the management of the ongoing covid-19 pandemic. preferably, the performance of serological tests for a novel virus should be determined with clinical specimens against a gold standard, i.e. virus neutralisation. we compared the performance of six commercial immunoassays for the detection of sars-cov-2 igg, iga and igm antibodies, including four automated assays [abbott sars-cov-2 igg (ce marked), diasorin liaison® sars-cov-2 s1/s2 igg (research use only, ruo), and euroimmun sars-cov-2 igg and iga (ce marked)], and two rapid lateral flow (immunocromatographic) tests [acro biotech 2019-ncov igg/igm (ce marked) and xiamen biotime biotechnology sars-cov-2 igg/igm (ce marked)] with a microneutralisation test (mnt). two specimen panels from serum samples sent to helsinki university hospital laboratory (huslab) were compiled: the patient panel (n=70) included sera from pcr confirmed covid-19 patients, and the negative panel (n=81) included sera sent for screening of autoimmune diseases and respiratory virus antibodies in 2018 and 2019. the mnt was carried out for all covid-19 samples (70 serum samples, 62 individuals) and for 53 samples from the negative panel. forty-one out of 62 covid-19 patients showed neutralising antibodies.the specificity and sensitivity values of the commercial tests against mnt, respectively, were as follows: 95.1%/80.5% (abbott architect sars-cov-2 igg), 94.9%/43.8% (diasorin liaison sars-cov-2 igg; ruo), 68.3%/87.8% (euroimmun sars-cov-2 iga), 86.6%/70.7% (euroimmun sars-cov-2 igg), 74.4%/56.1% (acro 2019-ncov igg), 69.5%/46.3% (acro 2019-ncov igm), 97.5%/71.9% (xiamen biotime sars-cov-2 igg), and 88.8%/81.3% (xiamen biotime sars-cov-2 igm). this study shows variable performance values. laboratories should carefully consider their testing process, such as a two-tier approach, in order to optimize the overall performance of sarscov-2 serodiagnostics. serosurveys are considered essential for creating timely snapshots for global and regional public health management of the ongoing covid-19 pandemic [1] . thus, there is an urgent need for the j o u r n a l p r e -p r o o f development of high-throughput serological assays, which enable population screening, as well as other epidemiological investigations. setting up a serological assay for a completely novel pathogen is challenging in many respects. at present, there is inadequate knowledge as to when and what kind of immune response follows sars-cov-2 infection [2] . we are also yet to learn about factors that may disturb reliable serology, such as potential cross reaction from seasonal coronaviruses. the patient samples consisted of serum specimens sent to the department of virology and immunology, helsinki university hospital laboratory, finland for diagnostic purposes. a subset of these specimens has been included in a previous publication evaluating the euroimmun sars-cov-2 igg and iga assays, and are included here for comparison [3] . the negative panel consisted of 81 serum samples (from 81 individuals) (median age 64 years, range 2-89 years; 33 males, 48 females) ( table 1) the analysis of sars-cov-2 igg or iga antibodies were carried out using the architect plus i2000sr analyzer (abbott, illinois, usa) and sars-cov-2 igg cmia kit (nucleoprotein based antigen; abbott; ce marked), eurolabworkstation (euroimmun, lübeck, germany) and sars-cov-2 igg and iga elisa kits (s1-based antigen; euroimmun) and diasorin liaison ® xl (diasorin, saluggia, italy) and sars-cov-2 s1/s2 igg clia kit (s1/s2 based antigen; diasorin; ruo) according to the manufacturers´ instructions. all samples from the negative panel (n=81) and the patient panel (n=70) were tested with abbott sars-cov-2 igg, and euroimmun sars-cov-2 iga and igg. all samples from the negative panel (n=81) and (due to limited kit supply) 61/70 samples (53/62 individuals) from the covid-19 patient panel were tested with diasorin sars-cov-2 s1/s2 igg. mnt was performed in a bsl-3 laboratory as described previously [5] the growth medium was removed and the virus-serum mixture was added to the cells and incubated for 4 days at 37 °c with 5% co2, after which the cells were stained with crystal violet to detect cytopathic effect (cpe). the neutralisation endpoint titer was determined as the endpoint serum dilution that inhibited the sars-cov-2 induced cpe in at least 2 out 3 parallel wells. the mnt titer ≥40 was considered as positive. for 55 covid-19 patients out of 62, the date of disease onset was available, and disease severity could be rated (mild, moderate or severe; based on siddiqi et al. [2020; 6] ) (table 2, figure 1 ). in the covid-19 patients included in this study, the earliest time point for the mnt to become j o u r n a l p r e -p r o o f positive was 3 days from onset of illness (patient id 50), while the furthest time point for a negative mnt was 16 days from onset (patient id 5) ( figure 1e ; table 2 ). disease severity did not appear to be reflected in the mnt titers of the patients, however, the number of patients in each category was too low to assess significance ( table 2) figure 2 . by using the cut-offs provided by the manufacturers, a trend was observed in which abbott igg yielded positive signals in specimens still negative in euroimmun igg and liaison (ruo) igg ( figure 2 ). rheumatoid factor was detected in five of negative panel specimens (table 1 ). more detailed results are provided in tables 1-3. all of the six immunoassays gave reactive results to a varying degree for the negative panel specimens (table 1) . particularly the acro biotech rapid test and euroimmun iga assay reacted in samples retrieved from patients with autoantibodies. as the sensitivity of the acro biotech rapid test was lower than the other immunoassays tested, we randomly chose an mnt positive specimen (id 61), conducted a dilution series of 1:2 for it, and tested the specimen again with the acro biotech test. an evident prozone effect was detected, and the originally negative test turned igg positive at serum dilution 1:4 up until dilution of 1:16. as serological assays for sars-cov-2 are now becoming available in the market in abundance [7] , assessment of their analytical performance by using clinical specimens is of critical importance. in this study, we assessed the specificity and sensitivity of six commercial immunoassays for the detection of sars-cov-2 antibodies, including two rapid lateral flow tests, in comparison with a neutralisation test. while neutralisation assays are considered to be the gold standard in terms of specificity, they also provide evidence as to development of immunity. eighty-one of the specimens were retrieved in 2018 and 2019 in finland, rendering these specimens as ascertained negative for sars-cov-2 antibodies, and subsequently verifying the very high specificity of the neutralisation test we used (100 % were negative in mnt). we chose serum dilution 1/40 as the limit of detection for the mnt. rf, which is an autoantibody against the fc portion of igg, and a common cause of cross-reactivity in immunoassays [8] , was analysed in the specimens collected in 2018 and 2019. five out of 39 of these specimens were positive for rf; 4/5 were negative in all sars-cov-2 immunoassays, and 1/5 gave a positive reaction in the acro igg and igm test. we conclude that the majority of positive test reactions in the six different immunoassays by using the negative serum panel from 2018-2019 were not due to rf. of note, we observed a prozone phenomenon [9] by diluting specimen id 61 for the acro lateral flow assay. while we did not investigate prozone phenomenon extensively in this study, we do consider it may be an important cause for false negative test results. the prozone phenomenon has been reported for other lateral flow assays previously [10] . of the automated assays included in this study, and by using the cut-off values set by the manufacturers, the best specificity values were observed with abbott igg (95.1%). a previous report from the united states reported a 99.9% specificity [11] . in our study, liaison igg (ruo) assay (94.9%) also showed a good specificity. euroimmun sars-cov-2 iga assay had the best positive agreement (sensitivity) (87.8%), while the positive agreement of the liaison igg (ruo) assay was the lowest (43.8%). the ce marked diasorin liaison sars-cov-2 igg assay was not available for this evaluation. the automated assays from the three manufacturers were all based on different antigen components (s1, s2, nucleocapsid). this is noteworthy, as antibody responses against each of these antigens may develop with varying kinetics, which remains a subject for further investigation. in addition, the immunoassays may detect nonneutralizing antibodies, not detected by neutralization assays. however, the topic of interest in our study was specifically on comparability of the assays with neutralising antibodies. when interpreting sensitivity values, the time from onset of illness in covid-19 patients needs to be accounted for. by using the abbott igg assay, sars-cov-2 igg seroconversion was previously reported in all patients by the day 17 post onset of illness [11] . previous reports suggest a median seroconversion time for sars-cov-2 from 11 days [12] to 13 days [13] . the present study also suggests a relatively long period required for serological response to take place (table 2, figure 1e ). even though extensive conclusions cannot be made from our data, liaison igg (ruo) appears to turn positive at a later point in time from onset of illness in comparison with the other immunoassays evaluated in our study ( table 2 ). perkmann et al (14; 2020) have also reported this phenomenon, and it should be investigated more thoroughly whether antibodies against sars-cov-2 s1/s2 antigen, in general, are detected in later time point. of the two rapid lateral flow assays, the xiamen igg/igm showed a good specificity (97.5% / 88.8%) with a modest positive agreement (sensitivity) (71.9% / 81.3%). in line with a previous report [15] , the performance of the acro biotech igg/igm rapid test appears not to be adequate for the important role of serology for covid-19 control severe acute respiratory syndrome coronavirus 2-specific antibody evaluation of commercial and automated sars-cov-2 igg and iga elisas using coronavirus disease (covid-19) patient samples detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr serological and molecular findings during sars-cov-2 infection: the first case study in finland covid-19 illness in native and immunosuppressed states: a clinical-therapeutic staging proposal developing antibody tests for sars-cov-2 rheumatoid factor in acute viral infections: interference with determination of igm, igg, and iga antibodies in an enzyme immunoassay antigen excess in modern immunoassays: to anticipate on the unexpected false-negative serum cryptococcal lateral flow assay result due to the prozone phenomenon performance characteristics of the abbott architect sars-cov-2 igg assay and seroprevalence in antibody responses to sars-cov-2 in patients of novel coronavirus disease 2019 antibody responses to sars-cov-2 in patients with covid-19 side by side comparison of three fully automated sars-cov-2 antibody assays with a focus on specificity germany) c liaison® sars-cov-2 igg (diasorin, saluggia, italy) d 2019-ncov igg/igm rapid test cassette microneutralisation assay were carried out according protocol described by table 1. negative serum sample panel consisting of samples collected retrospectively during years 2018-2019, prior the sars-cov-2 epidemic all results were determined according to manufacturers´ instructions diasorin) was research use only (ruo) kit. abbott sars-cov-2 igg chemiluminescent microparticle immunoassay (cmia) all results were determined according to manufacturers´ instructions *two separate samples were available from the patients. first number is the identification code for patient we would like to thank pamela österlund (finnish institute for health and welfare, helsinki, finland) for providing the virus strain. we would also like to thank (in alphabetical order) anu 10-1 * moderate <40 neg neg neg neg 26 severe <40 neg pos neg neg 24 severe <40 neg neg neg neg 38 severe <40 neg pos neg neg 43 severe <40 neg pos neg neg 32 severe *due to limited kit supply, not all specimens tested with mnt could be analysed with these commercial tests. table 3 . specificity and sensitivity of the six commercial immunoassays compared with mnt. mnt titer ≥40 was considered as positive. equivocal results of the commercial assays were regarded as reactive in this analysis. the total number of specimens tested with mnt, and each of the commercial immunoassays, with their respective results are presented in tables 1-2. key: cord-331707-kfja1i6s authors: andrés, cristina; vila, jorgina; gimferrer, laura; piñana, maria; esperalba, juliana; codina, maria gema; barnés, meritxell; martín, maria carmen; fuentes, francisco; rubio, susana; alcubilla, pilar; rodrigo, carlos; pumarola, tomàs; antón, andrés title: surveillance of enteroviruses from paediatric patients attended at a tertiary hospital in catalonia from 2014 to 2017 date: 2018-11-30 journal: j clin virol doi: 10.1016/j.jcv.2018.11.004 sha: doc_id: 331707 cord_uid: kfja1i6s background: enterovirus (ev) infections are usually asymptomatic or mild, but symptomatic infections can evolve to severe complications. outbreaks of ev-a71 and ev-d68 have been recently reported worldwide, sometimes related to severe clinical outcomes. objective: to describe ev genetic diversity and the clinical outcomes from paediatric patients attended at a tertiary university hospital in barcelona (catalonia, spain) from 2014 to 2017. study design: specimens were collected from paediatric (<17 years old) cases with suspicion of respiratory tract infection or ev infection. ev laboratory-confirmation was performed by specific real-time multiplex rt-pcr assay. partial viral vp1 protein was sequenced for genetic characterisation by phylogenetic analyses. results: a total of 376 (7%) from 5703 cases were ev laboratory-confirmed. phylogenetic analyses of vp1 (210; 81%) sequences distinguished up to 27 different ev types distributed within ev-a (82; 40%), ev-b (90; 42%), ev-c (5; 2%), and ev-d (33; 15%), in addition to 50 (19%) rhinoviruses. the most predominant were ev-a71 (37; 45%) and ev-d68 (32; 99%). ev-a71 was highly related to neurological complications (25/39, 63%), of which 20/39 were rhombencephalitis, and most ev-d68 (28/32, 88%) were associated with lower respiratory tract infections (lrti), and exceptionally one (3%) with acute flaccid paralysis. conclusions: ev-a71 and ev-d68 were the most detected ev in respiratory specimens. ev-a71 was highly related to neurological disease and ev-d68 was often associated with lrti. however, both potential relatedness to neurological diseases makes the monitoring of ev circulation obligatory. enteroviruses (evs) are lineal, single-stranded, positive-sense rna viruses, belonging to the picornaviridae family. more than 100 different types of human enterovirus (ev) have been described, distributed in 4 species (ev-a, -b, -c and -d), which together with rhinoviruses (rvs) and non-human evs compose the genus enterovirus [1, 2] . ev infections are usually asymptomatic or mild, but infections can sometimes evolve to severe diseases. evs have been implicated in a wide range of diseases, including hand-foot-mouth disease (hfmd), herpangina, respiratory syndrome, meningitis, encephalitis and acute flaccid paralysis (afp), among others [3] . ev infections can occur at any age, but the paediatric population is the most susceptible, especially children < 5 years old, who do not have specific immune response to a particular type of ev [4] . evs circulate around the world all over the year. in temperate countries, ev infections usually follow a seasonal pattern reporting the highest incidence during the late summer and early autumn [5, 6] . however, a second peak can be also reported between spring and early summer, as occurred in our geographical area [7] . the circulation of the different ev types is variable from one year to another. furthermore, while in some regions an ev might be endemic, in others it might be the aetiological agent of limited sporadic outbreaks [8] . the ev surveillance has been reinforced from 2014 and on due to ev-d68 and ev-a71 outbreaks in north america and europe, respectively [9, 10] . the main objective of this study is to describe the seasonality, the prevalence, the genetic diversity and the clinical features related to respiratory ev from the paediatric cases attended at a tertiary hospital in barcelona (catalonia, spain) during the 2014-2017 seasons. this is a descriptive, observational, retrospective and longitudinal study performed at the respiratory viruses unit of the microbiology department and the paediatric department at the vall d'hebron university hospital. from october 2014 (week 40/2014) to may 2017 (week 20/2017), upper (nasopharyngeal aspirates or swabs) and lower (bronchoalveolar lavages, bronchoaspirates and tracheal aspirates) respiratory tract specimens were collected for respiratory viruses' laboratory-confirmation from paediatric patients (< 17 years old) with suspicion of acute respiratory tract infection (rti) or enterovirus infection who were [29] [30] [31] [32] [33] [34] [35] attended at the emergency department or admitted to the hospital. demographic features (sex and age) and clinical data were retrospectively collected from ev laboratory-confirmed cases. the inclusion criteria, according to the hospital diagnostic pipeline, included all paediatric patients with respiratory infection or neurologic complication by ev infection (mainly during the 2016 outbreak). upper rti (urti) included those respiratory infections from the nose to the larynx, excluding hfmd and herpangina. lower rti (lrti) included recurrent wheezing, asthma, bronchiolitis, and pneumonia; lrti severity was studied in patients requiring admission due to the rti, to ensure that the length of hospital stay or the respiratory support were only related to the disease. aseptic meningitis was defined as an inflammatory process of the leptomeninges causing signs and symptoms indicative of meningeal irritation, with a cerebrospinal fluid (csf) study characterised by pleocytosis, normal or increased protein levels, and the absence of microorganisms on gram stain and on routine culture. rhombencephalitis was referred to inflammatory diseases affecting the hindbrain (brainstem and cerebellum), causing dysfunction of these structures, with normal or elevated leukocyte count in csf. typical magnetic resonance (mr) findings were considered in the diagnostic confirmation of rhombencephalitis, with the isolation of ev in respiratory samples. according to the world health organisation (who), afp is defined as a sudden onset of paralysis/weakness in one or more limbs of a child < 15 years old with the absence or decreased myotatic reflexes. detection of ev was performed by specific real-time multiplex rt-pcr assays (anyplex ii rv16 assay, from october 2014 to november 2016, or allplex respiratory panel assay, from december 2016 to may 2017, seegene, korea). for samples received between october 2014 and november 2016, an additional real-time rt-pcr (seegene, korea) was performed to improve the detection of all evs due to the inaccurate detection of some evs, as previously described [11] . prior to pcr-based assays, total nucleic acids were extracted using nuclisense easymag (biomérieux, france) according to the manufacturer's instructions. vp1 amplification and sequencing were performed based on the protocol recommended by the who [12] , with minor modifications. pcr products purification was performed using exo-sap-it (usb, affymetrix inc., usa) for single pcr products (350bp), or in case of unspecific pcr products in the 2% agarose gel electrophoresis, using genelute gel extraction kit (sigma-aldrich, usa). purified pcr products were sequenced using the abi prism big dye terminator cycle sequencing kit v3.1 (thermo fisher scientific, usa) on the abi prism 3130xl genetic analyser (thermo fisher scientific, usa). nucleotide sequences were edited and assembled using mega v5.2 [13] and preliminarily analysed by the enterovirus genotyping web-based tool [14] . a multiple alignment of sequences together with reference sequences to ev types belonging to the four species (ev-a, -b, -c, and -d) downloaded from ncbi genbank (supplementary table 1 ) was performed using the muscle software in mega v5.2 [13] . prior to phylogenetic analysis, the molecular evolutionary models of nucleotide substitutions were fitted to the multiple sequence alignments using evolutionary analysis, conducted in mega v5.2 [13] . the phylogenetic trees were constructed using a neighbor-joining distance method as implemented in mega v5.2 with the evolutionary model with the lowest bayesian information criterion score [13] . the topological accuracy of the internal branch was evaluated by the bootstrap method (1000 replicates). statistical analysis was performed using spss v22 (spss inc., usa). continuous variables were described by the median and the interquartile range (iqr) and categorical variables by frequencies and proportions. mann-whitney and chi-squared tests were calculated to assess associations between categorical variables. p values < 0.05 were considered to be statistically significant. during the study, 10,260 samples from 5703 patients were received and processed for laboratory confirmation. a total of 397 (4%) samples from 376 (7%) patients were ev laboratory-confirmed (fig. 1) . moreover, other respiratory viruses were also detected, such as influenza viruses (fluv) (21%), rvs (16%), respiratory syncytial virus (rsv) (9%), adenovirus (4%), coronaviruses (3%), human metapneumovirus (hmpv) (2%), bocavirus (1%), and parainfluenza viruses (1%). were distinguished. the ev seasonality was variable along the study, showing detection peaks during spring and autumn (fig. 2) . while some types of ev were sporadically detected, like echovirus (e)-25 and coxsackievirus (cv)-a5, other types were most frequently observed, particularly ev-a71 (35 belonging to subgenogroup c1, and 2 to c2) ( supplementary fig. 1 ) and cv-a6 (11/210; 5%) in ev-a; e-30 (13/ 210; 6%) and cv-b3 (10/210; 5%) in ev-b and ev-d68 (29 belonging to clade b3, and 3 to b2) ( supplementary fig. 2 ) in ev-d (fig. 3) . regarding the clinical syndromes (fig. 4) , 151 (72%) patients had initially fever, followed by rti (122; 58%) with a cough, dyspnoea or wheezing. a total of 39/210 (19%) neurological affections, such as meningitis, rhombencephalitis or afp were observed. occasionally, patients had exanthema (18/210; 9%), gastroenteritis (13/210; 6%), herpangina (11/210; 5%), and hfmd (10/210; 5%). a total of 74/122 (61%) patients had lrti and 48/122 (39%), urti. ev-d68 (29; 24%) was the main virus related to rti and children < 2 years old were the most affected population (p = 0.915) (tables 1 and 2 ). in the lrti group, 59/74 (80%) patients were admitted to the hospital due to the rti (42% due to ev-d68) and the median length of stay was 3 days (iqr 2-5). most patients (46/59; 78%) required respiratory support (51% conventional oxygen; 17% high flow nasal cannula; and 8% mechanical ventilation). moreover, 5 (8%) patients required intensive care unit (icu) admission (3 ev-d68, 1 cv-b4, and 1 not typed), in which the median icu stay was 6 days (iqr 4-8.5), longer in the ev-d68 group (median 7 days; iqr 4-10) compared to cv-b4 (median 4 days; iqr 2-7) (p = 0.35). hospitalisations associated with ev-d68-related lrti (25/28; 89%) were moderate and 22/28 (79%) were children < 5 years old. a total of 14 (50%) had recurrent wheezing or asthma and 14 (50%) had fever. the median length of stay was 3 days (iqr 2-5), in which 19/28 (68%) required respiratory support (58% conventional oxygen; 26% high flow nasal cannula; and only one required intubation and invasive mechanical ventilation) and 2/28 (7%) required non-invasive mechanical ventilation. most of the studied cases (39; 19%) were from the 2016 spring outbreak occurred in catalonia, of which 34 (87%) corresponded to rhombencephalitis, 4 (10%) to aseptic meningitis, and 1 (3%) to afp. a total of 34/39 (87%) were children < 5 years old (table 3) . aseptic meningitis was related to e-30, e-5, e-9, and ev-c109. the main symptoms were fever, headache, and positive meningeal signs, with pleocytosis in the cfs. ev laboratory-confirmation in the csf was positive in all patients but one. otherwise, rhombencephalitis was the principal neurological complication, in which most cases (25/34; 74%) were detected during the outbreak associated with ev-a71. a total of 20/25 (80%) patients had symptoms with mr findings suggesting rhombencephalitis and the remaining (5/25; 20%) had symptoms but mr was normal. before the neurologic complications, 5/25 (20%) of cases began with ev-a71-related hfmd, 3/25 (12%) with herpangina (2 ev-a71 and 1 cv-a10) and 6/25 (24%) with exanthema (5 ev-a71 and 1 ev-c109). only one patient developed permanent neurologic disabilities due to cardiorespiratory failure and hypoxic-ischemic encephalopathy, in addition to one afp case, but associated with ev-d68 infection [15] . the present study describes the epidemiology, the genetic diversity and the clinical features related to respiratory ev laboratory-confirmed infections in paediatric patients attended at a tertiary university hospital in spain. in comparison with other respiratory viruses, the prevalence of ev was relatively low (7%) during the study period. however, regarding the disease presentation and compared to rvs, which were more prevalent but also more related to mild respiratory disease (unpublished data), clinical complications due to ev infection are reason enough to consider evs as subjects under surveillance. in temperate countries, ev circulation showed a clear pattern of seasonality with a major prevalence during late summer and early autumn, even though a second peak during spring it was also detected, as usually reported in catalonia [7] . moreover, the age is a determinant for the susceptibility, as the younger the age, the higher the susceptibility. children < 5 years old were the most susceptible population to ev infection, as also described before [4, 16] . the phylogenetic analysis of partial vp1 sequences revealed that most evs belonged to ev-a and ev-b, while a minor percentage belonged to ev-c and ev-d. ev-a71 and ev-d68 were the most prevalent ev, particularly ev-a71 genogroup c (c1 and c2) and ev-d68 genogroup b (b2 and b3), which are the predominant genogroups circulating around europe and worldwide [8] . ev-a71 and ev-d68 should be considered subjects under surveillance, not only because of the 2014 ev-d68-related outbreak and its relatedness to afp, but also for the 2016 rhombencephalitis outbreaks associated with ev-a71 infection in several european countries [7, 17] . an outbreak of ev-d68 was reported in north-america in 2014, characterised by severe respiratory illness and, occasionally accompanied by neurological complications [18] . nonetheless, in the european region, a study reported a very low rate (2%), mainly associated with mild disease, with few severe cases [8] . the ev-d68 circulation was also low (32/5703; 0.6%) in the present study, although it showed a higher detection rate during 2016, like other spanish reports [1, 19] as well as during the current year 2018 in our hospital and recently reported data (october 2018) from the european non-polio enterovirus network (unpublished data). regarding the clinical manifestations, most of ev-d68 detected were associated with lrti, highlighting its possible association with severe respiratory illnesses [20] . similarly to other european cases [21, 22] , only one case, a 2-year-old girl, developed afp in february 2016 [15] . ev-d68 usually causes more severe disease in patients with asthma or reactive airway, as previously reported [23, 24] , but herein only one case was reported. therefore, due to the relatedness of ev-d68 infection to severity, non-polio ev surveillance has been enhanced, and since ev-d68 has a predominant respiratory tropism, respiratory specimens should be studied to monitor ev-d68 circulation [25] . otherwise, the second most predominant ev was ev-a71, mostly detected in specimens of cases involved in the 2016 rhombencephalitis outbreak occurred in catalonia and other spanish regions [1, 7, 10] . neurologic manifestations of ev-a71 mainly occurred in children < 5 years old and rhombencephalitis was the most common neurologic presentation, but the ev-a71 detection at hospital level might be underestimated because of the severity of the disease. a question which really remained unanswered was whether ev-a71 simultaneously circulated in the community during the outbreak, but related to mild diseases such as hfmd or herpangina, and hence, attended at the primary care centres. likewise, cv-a6 is well-known to cause hfmd [26] , and it could have circulated in the community during the study period. however, cv-a6 was not frequently detected in our series (11/210), maybe due to the mildness of the disease that does not require to go to the hospital. a recent french study conducted an ambulatory clinicbased surveillance to report the underestimation of ev detected only in hospitals [27] . it is well-known that one ev type can be related to several clinical manifestations, and inversely. cv-a10, e-5, e-30, cv-b3, and ev-c109 were also associated with neurological affections, as previously described [28] [29] [30] [31] , in addition to milder diseases. instead, e-6 was only related to respiratory symptoms or fever, in discordance with previous studies [32] . despite their low prevalence, all evs are considered to be neurotropic [33] and therefore, they should be subject under surveillance. a relevant percentage of specimens confirmed as ev using the multiplex pcr-based assay (19%), were finally characterised like rvs. the high genetic similarity between rvs and evs is an important factor that affects the specificity of diagnostic molecular methods, which are specially designed to distinguish between both viruses [11] . in summary, the present study reports the virological and clinical surveillance of ev in a tertiary hospital in spain from 2014 to 2017. it reports recent and valuable information regarding the ev prevalence, seasonality, genetic diversity, and associated clinical features. in addition, this study remarks the necessity to perform ev surveillance in primary care settings to predict the early circulation in the community of all evs, but those related to severe diseases such as ev-d68 or ev-a71. author contribution section c.a., j.v. and a.a. conceived the presented idea and wrote the manuscript. c.a. developed the theory, performed the molecular characterisation by phylogenetic analysis and interpretation of the results. f.f., s.r., mc.m., and p.a. contributed in the sample preparation and performed the diagnosis. j.v. and m.b. collected all the clinical data and described the major clinical findings of the manuscript. t.p. and c.r. helped in supervising the project. all authors discussed the results and contributed to the final manuscript. el estudio de las infecciones por enterovirus y parechovirus gpee neonatal enterovirus infections reported to the national enterovirus surveillance system in the united states enterovirus d68 in critically ill children: a comparison with pandemic h1n1 influenza prevention cfdca, enterovirus surveillance-united states a polymerase chain reaction-based epidemiologic investigation of the incidence of nonpolio enteroviral infections in febrile and afebrile infants 90 days and younger comparative analysis of viral shedding in pediatric and adult subjects with central nervous system-associated enterovirus infections from 2013 to 2015 in switzerland rapid risk assesment -outbreak of enterovirus a71 with severe neurologycal symptoms among children in catalonia european surveillance for enterovirus d68 during the emerging north-american outbreak in 2014 outbreaks of enterovirus d68 continue across the usa outbreak of brainstem encephalitis associated with enterovirus-a71 in catalonia, spain (2016): a clinical observational study in a children's reference centre in catalonia first enterovirus d68 (ev-d68) cases detected in hospitalised patients in a tertiary care university hospital in spain enterovirus surveillance guidelines -guidelines for enterovirus surveillance in support of the polio eradication iniciative mega5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods an automated genotyping tool for enteroviruses and noroviruses first cases of severe flaccid paralysis associated with enterovirus d68 infection in spain enterovirus neurological disease and bacterial coinfection in very young infants with fever centre for disease prevention and control. rapid risk assessment -enterovirus detections associated with severe neurological symptoms in children and adults in european countries severe respiratory illness associated with enterovirus d68 -missouri and illinois molecular epidemiology of enterovirus and parechovirus infections according to patient age over a 4-year period in spain severe respiratory illness associated with a nationwide outbreak of enterovirus d68 in the usa (2014): a descriptive epidemiological investigation emergence of enterovirus d68 in denmark two cases of acute severe flaccid myelitis associated with enterovirus d68 infection in children enteroviruses in the early 21st century: new manifestations and challenges severe enterovirus 68 respiratory illness in children requiring intensive care management recommendations for enterovirus diagnostics and characterisation within and beyond europe the increasing epidemic of hand, foot, and mouth disease caused by coxsackievirus-a6 ambulatory pediatric surveillance of hand, foot and mouth disease as signal of an outbreak of coxsackievirus a6 infections an approach for differentiating echovirus 30 and japanese encephalitis virus infections in acute meningitis/encephalitis: a retrospective study of 103 cases in vietnam genomic characterization of coxsackievirus type b3 strains associated with acute flaccid paralysis in south-western india type 1 wild poliovirus and putative enterovirus 109 in an outbreak of acute flaccid paralysis in congo viro-typened, systematic molecular surveillance of enteroviruses in the netherlands between increase in echovirus 6 infections associated with neurological symptoms in the netherlands neurotropic enterovirus infections in the central nervous system this work was partially supported by fondo de investigación sanitaria (grants fis pi08/0118, fis pi11/01864, fis pi14/01838) from the spanish ministry of health; the spanish network for the research in infectious diseases (reipi rd12/0015/0003); and the european regional development fund (erdf). cristina andrés has been a recipient of a predoctoral fellowship from the vall d'hebron research institute (pred-vhir-2013). in addition, we would like to acknowledge dr. catherine moore (public health wales), for her technical support in developing the molecular characterisation of enterovirus. the authors declare no conflicts of interest. institutional review board approval (pr(ag)173/2017) was obtained from the vall d'hebron university hospital (huvh) clinical research ethics committee. supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.jcv.2018.11.004. key: cord-335891-j78pnwgk authors: piñana, maria; vila, jorgina; maldonado, carolina; galano-frutos, juan josé; valls, maria; sancho, javier; nuvials, francesc xavier; andrés, cristina; martín-gómez, maría teresa; esperalba, juliana; codina, maria gema; pumarola, tomàs; antón, andrés title: insights into immune evasion of human metapneumovirus: novel 180and 111-nucleotide duplications within viral g gene throughout 2014-2017 seasons in barcelona, spain date: 2020-08-11 journal: j clin virol doi: 10.1016/j.jcv.2020.104590 sha: doc_id: 335891 cord_uid: j78pnwgk background: human metapneumovirus (hmpv) is an important etiologic agent of respiratory tract infection (rti). this study aimed to describe its genetic diversity and clinical impact in patients attended at a tertiary university hospital in barcelona from the 2014-2015 to the 2016-2017 seasons, focusing on the emerging duplications in g gene and their structural properties. methods: laboratory-confirmed hmpv were characterized based on partialcoding f and g gene sequences with mega.v6.0. computational analysis of disorder propensity, aggregation propensity and glycosylation sites in viral g predicted protein sequence were carried out. clinical data was retrospectively reviewed and further associated to virological features. results: hmpv prevalence was 3%. the 180and 111-nucleotide duplications occurred in a2c lineage g protein increased in prevalence throughout the study, in addition to short genetic changes observed in other hmpv lineages. the a2c g protein without duplications was calculated to protrude over f protein in 23% of cases and increased to a 39% and a 46% with the 111and 180-nucleotide duplications, respectively. children did not seem to be more affected by these mutant viruses, but there was a strong association of these variants to lrti in adults. discussion: hmpv presents a high genetic diversity in all lineages. novel variants carrying duplications might present an evolutionary advantage due to an improved steric shielding, which would have been responsible for the reported increasing prevalence and the association to lrti in adults. abstract: background. human metapneumovirus (hmpv) is an important etiologic agent of respiratory tract infection (rti). this study aimed to describe its genetic diversity and clinical impact in patients attended at a tertiary university hospital in barcelona from the 2014-2015 to the 2016-2017 seasons, focusing on the emerging duplications in g gene and their structural properties. methods. laboratory-confirmed hmpv were characterized based on partialcoding f and g gene sequences with mega.v6.0. computational analysis of disorder propensity, aggregation propensity and glycosylation sites in viral g predicted protein sequence were carried out. clinical data was retrospectively reviewed and further associated to virological features. results. hmpv prevalence was 3%. the 180-and 111-nucleotide duplications occurred in a2c lineage g protein increased in prevalence throughout the study, in addition to short genetic changes observed in other hmpv lineages. the a2c g protein without duplications was calculated to protrude over f protein in 23% of cases and increased to a 39% and a 46% with the 111-and 180-nucleotide duplications, respectively. children did not seem to be more affected by these mutant viruses, but there was a strong association of these variants to lrti in adults. discussion. hmpv presents a high genetic diversity in all lineages. novel variants carrying duplications might present an evolutionary advantage due to an improved steric shielding, which would have been responsible for the reported increasing prevalence and the association to lrti in adults. human metapneumovirus, duplication, steric shielding, epidemiology, genetic diversity, clinical impact. the fusion (f) and the attachment (g) proteins are the major envelope glycoproteins. f protein is the major cross-protective antigenic determinant and is highly conserved between genotypes (88%) [4] . hence, it is the main target for most vaccine strategies under development [6] . differently, g protein is weakly immunogenic [7] , with 28% genetic divergence between genotypes and 74-82% intra-genotype [4] . in addition, 180-and 111-nucleotide duplications have been recently described into g protein's ectodomain [8] [9] [10] [11] . the aims of this study were to describe circulation pattern, genetic diversity and clinical impact of hmpv in paediatric and adult population attended at a tertiary university hospital in barcelona from the 2014-2015 to the 2016-2017 seasons, focusing on the emergence and spread of variants carrying these two nucleotide duplications. from october/2014 to may/2017, respiratory specimens (nasopharyngeal aspirates, nasal and pharyngeal swabs, bronchoaspirates, bronchoalveolar, bronchoselective and tracheal washes and sputums) were received for the laboratory-confirmation of respiratory viruses from children and adults attended at the hospital universitari vall d'hebron with suspicion of respiratory tract infection (rti). institutional review board j o u r n a l p r e -p r o o f the propensity to adopt disordered conformations of three g sequences with and without nucleotide duplications was analysed using the metadisorder server [14] , their propensity to aggregate using the pasta 2.0 server [15] , and the prediction of potential n-and o-glycosylation sites using netnglyc 1.0 [16] and netoglyc 4.0 [17] servers, respectively. ensembles consisting of 2,000 unfolded conformations were generated for each of the three g sequences using the protsa server [18] . the pdb file of each conformation was analysed to compute the distance between the n atom of the first extracellular residue (asn52) and the more distant atom, as well as the radius of gyration of the particular conformation. demographic (age and sex) and clinical features (urti/lrti, co-morbidities, coinfections, antibiotic use, need, type and length of respiratory support, length of hospital stay, icu admission or exitus) of hmpv-laboratory confirmed cases were retrospectively reviewed from medical records and related to viral features. patients included in the demographic study were those with clinical presentation of urti or lrti, whilst patients with other symptoms rather than respiratory were excluded from the study. for the severity study, only patients hospitalised due to lrti were included, and exclusion criteria were those cases with other symptoms rather than lrti and hospitalisation due to other clinical reasons even though the patient manifested rti. data were analysed with r software v3.5.1. for categorical data, chi-squared or fisher's exact test were performed. for numerical variables, t student, mann-withney, anova or kruskall-wallis tests were performed according to the need. statistical significance was taken at the p-value <0.05. a total of 20,132 samples of 14,769 patients were tested, of which 9,370 (47%) were laboratory-confirmed for at least one respiratory virus. though being in a similar period, hrsv and influenza epidemics varied between seasons ( figure 1a table 1 ). regarding the methods for detection, from all these 14,769 patients, 3,316 samples (22%) were tested with the immunofluorescence assay, while 8,483 (57%) were tested with the real-time rt-pcr multiplex assays. importantly, 656 (4%) samples which tested negative for the immunofluorescence assay were re-tested with the real-time rt-pcr multiplex assays. the remaining samples had been tested with a rapid test. the use of immunofluorescence and pcr-based assays were changing throughout the period of study, decreasing for immunofluorescence assays and increasing for molecular (11, 13%) , hrsv (6, 7%), human coronavirus (hcov) 229e (5, 6%), hcov oc43 (5, 6%), hcov nl63 (2, 2%), human parainfluenza 3 (1, 1%), influenza a (1, 1%) and b (1, 1%). weekly distribution of hmpv showed a higher circulation from february to april in the first two seasons, but started at mid december in 2016-2017 season ( figure 1b ). the peaks of incidence of the first two seasons were in march, but the last season presented a pattern with two peaks. phylogenetic analyses of hmpv f and g sequences from 387 strains revealed that (table 3) . phylogenetic analyses of f (382, 94%) and g (365, 90%) sequences ( figure 2) showed congruent results. overall, 11 (3%) samples belonged to a2a, 37 (10%) to a2b, 153 (40%) to a2c, 106 (27%) to b1 and 79 (20%) to b2 (table 3) . genetic characterisation of a2 g revealed that a2a and a2c sequences generally had a length of 220 aa, and a2b of 218 due to premature stop codons. genetic characterisation of 153 a2c strains revealed the presence of the novel 180-(a2c180dup; 46; 30%) and 111-nucleotide (a2c111dup; 13; 9%) duplications into g ectodomain with increasing prevalence (table 3) . while all a2c180dup clustered together, two subgroups j o u r n a l p r e -p r o o f could be observed in the f phylogenetic tree ( figure 2) . differently, a2c111dup g clustered into 2 groups but their f genes clustered together (except nsvh2017-09-82477). b1 g clustered into two phylogenetic groups (i and ii), differing in the acquisition of a premature stop codon in the 232 aa (relative to ku375606) in all strains belonging to group ii (figure 2 ), but one (nsvh2015-12-87728). in addition, two sequences the sequences of the present study were submitted to genbank (mn617398-mn617753). the ectodomain ensemble of the non-glycosylated form of g protein of nsvh2015-06-62150 (a2cwt) was simulated [18] [19] [20] the pre-fusion conformation of the f trimer is calculated to protrude 13 nm [21] . according to the distance distributions of the three ensembles, the actual fraction of g protein's ectodomain protruding more than 13 nm from the membrane amounts to 23% in the a2cwt, and it increases to 39% in a2c111dup and 46% and a2c180dup. due to the absence of clinical information (2), non-amplification (20) or manifestation of other syndromes rather than urti or lrti (20) , clinical features of 203 paediatric and 162 adult cases were finally studied ( for the severity study, only patients hospitalised due to lrti (176) were considered, being 116 (66%) paediatric (table 5 ) and 60 (34%) adult patients (table 6 ). children infected with a2 were more likely to be admitted in the icu (or 5.14, ic 95% 1.06-24.95, p 0.031). no other variables were found to be significant. this study reports recent data on prevalence, genetic diversity, structural biology of g protein and clinical features of hmpv in barcelona, spain. the positivity rate of hmpv was similar to recent reports [4, 22, 23] . interestingly, the prevalence in adults was similar or even higher than in children, which emphasizes the importance of hmpv in adults. hmpv prevalence increased throughout the three seasons, probably due to the higher implementation of molecular methods, though there might be an underestimation, as a large number of positive samples for hrsv and influenza by rapid assay were not tested for other respiratory viruses. most coinfections were with rhinoviruses, adenoviruses and bocaviruses, as previously reported [23, 24] . hmpv presented a clear seasonality, as previously described [2,6,24]. interestingly, the last season presented a different pattern, showing two different peaks in one epidemic season without changes among circulating genotypes. interestingly, the prevalence of hmpv was higher out of the hrsv/influenza epidemics in the first season but did not vary in the second and third seasons. this could be due to the higher implementation of pcr-based assays in detriment to the use of immunofluorescence assays. moreover, the great majority of hmpv laboratoryconfirmed samples during these epidemics were previously tested by rapid assays and had a negative result, which would suggest that there might be many more samples that would be positive for hmpv but are not tested due to a hrsv or influenza positive result when hmpv circulation is coincidental with influenza epidemics. thus, hmpv prevalence could be underestimated due to the lack of search of this virus when samples are hrsv or influenza laboratory-confirmed during the epidemics. genetic characterisation revealed that both genotypes co-circulated with a shift in predominance, as expected [2]. however, there was an unpredicted co-predominance congruent classification of both f and g genes was expected, as no genetic recombination has been described for hmpv. all subgenotypes were detected except a1, suggesting it has extinguished and been replaced by a2, according to previous studies [3] . according to the data of the present study, a2c lineage appears to be replacing a2a and a2b. moreover, a2c strains with duplications might be replacing a2cwt in the near future, as they might present an improved mechanism of immune evasion. in fact, a group in japan observed that a2c111dup had totally replaced the rest of a2 strains [25] , including a2c180dup. interestingly, our group has observed how both a2c111dup and a2c180dup have replaced together the rest of hmpv-a viruses, being the latter more prevalent [26] . different lengths of g protein have been observed due to premature stop codons, as previously described [3] . a2b and a2c lineages included viruses with g proteins of 218 and 220 aa respectively; and two different genetic groups (i and ii) could be distinguished within b1 subgenotype, with a difference of 10 aa in length, which might evolve into novel lineages. also, nucleotide duplications can lengthen the g aa sequence, such as long duplications in a2c, and short duplications in b2. for b2 viruses, ke duplications or ker variants should be monitored next seasons to reveal whether they confer an evolutionary advantage. the deletions observed seem not to have been fixed in the viral population. once these a2c111dup and a2c180dup were described, one of the aims was to study their structural properties. g has a heavily glycosylated pattern [21] , enhanced by the emergence of duplications that increase the number of potential glycosylation sites. although it is a very disordered protein and seems to have numerous random conformations, a composition of these conformations could be done. this prediction j o u r n a l p r e -p r o o f suggests that both a2c180dup and a2c111dup proteins protrude more than a2cwt. this finding supports the hypothesis of leyrat [21] , who suggested that g protein had a shielding function towards f protein, masking its antigenic epitopes, and at the same time validates the hypothesis that these novel long duplications would enhance this immune evasion mechanism, as it would hide more efficiently f epitopes [8] . sequences of the newly described a2c lineage [3,4] were compared to sequences of the previously described a2b1 and a2b2 sublineages [27, 28] and clustered together; that is to say, a2b and a2c lineages are exactly the same as a2b1 and a2b2, respectively. this misunderstanding between the genetic classification used in several articles highlights the urgent need of an official classification, as well as universal criteria to define new genotypes or lineages. furthermore, clinical impact was also assessed. as in literature [2], lrti is more common in children under 2 and adults over 65. moreover, adults have an increase of 1.03 times the odds of suffering lrti every passing year. the presence of chronic medical conditions as cardiopathy, more frequent in the elderly, may be responsible for this, so hmpv should be tightly surveilled in these cases. comorbidities are also associated with lrti in children, especially respiratory comorbidities and immunodepression. in this study, prematurity and cardiopathies were not associated with a major risk of developing lrti in children, in opposite to previous studies [29] [30] [31] [32] . paediatric and adult patients underwent more antibiotic treatment when manifesting lrti than urti. however, only 8% of children and 30% of adults treated with antibiotics had a positive bacterial culture. hence, over-antibiotic prescription is still reported. regarding infections by a2c, children seemed to be as affected by a2c with duplications as by a2cwt or other lineages, as it is probably a primary infection. instead, a2c with duplications were more associated with lrti in adults than a2cwt or other lineages. although adults should have an efficient immune response [6], they have 3.45 times more odds of manifesting lrti when infected by a2c with duplication than by a2cwt. this suggests that it might be acting as a primary infection, which supports the hypothesis of g protein's steric shielding over f protein. hmpv is known for the many immune evasion strategies it has, so this could be a new mechanism developed in recent years [33, 34] . whether strains with duplication cause more severe disease could be demonstrated neither in children nor in adults. the increasing prevalence of viral variants carrying a duplication into the ectodomain of the g protein throughout the study period, the association of a2c111dup and a2c180dup with more severe disease in adults, and the prediction of an enhancing steric shielding of the g protein masking antigenic epitopes of the f protein suggest that these duplications might confer an evolutionary advantage contributing to the immune evasion during the infection. this mechanism would be similar to that described for other viruses which have been reported to evade the immune response due to the glycosylation they present in their envelopes [35] . given that f protein is the main target for most vaccine strategies currently under development, the fact that it could be masked by g should be taken into account. genetic diversity and molecular evolution of the major human metapneumovirus surface glycoproteins over a decade novel human metapneumovirus with a 180-nucleotide duplication in the g gene a novel human metapneumovirus carrying a 111-nucleotide duplication within the g gene detected at a tertiary university hospital in catalonia since the 2015-2016 season 180-nucleotide duplication in the g gene of human metapneumovirus a2b subgroup strains circulating in yokohama city a novel 111-nucleotide duplication in the g gene of human metapneumovirus mega6: molecular evolutionary genetics analysis version 6.0 alter: program-oriented conversion of dna and protein alignments metadisorder: a meta-server for the prediction of intrinsic disorder in proteins pasta 2.0: an improved server for protein aggregation prediction prediction of n-glycosylation sites in human proteins precision mapping of the human o-galnac glycoproteome through simplecell technology protsa: a web application for calculating sequence specific protein solvent accessibilities in the unfolded ensemble a structural model for unfolded proteins from residual dipolar couplings and small-angle x-ray scattering sequence-specific solvent accessibilities of protein residues in unfolded protein ensembles structural insights into the human metapneumovirus glycoprotein ectodomain human metapneumovirus: insights from a ten-year molecular and epidemiological analysis in germany clinical and genetic features of human metapneumovirus infections in children epidemiological and clinical features of human metapneumovirus in hospitalised paediatric patients with acute respiratory illness: a cross-sectional study in southern china predominant detection of the subgroup a2b human metapneumovirus strain with 111-nucleotide duplication in yokohama city human metapneumovirus: are the new duplications within the g gene responsible for doubling its prevalence?, in: 21st congr increase human metapneumovirus mediated morbidity following pandemic influenza infection human metapneumovirus prevalence and molecular epidemiology in respiratory outbreaks in ontario, canada human metapneumovirus infection is associated with severe respiratory disease in preschool children with history of prematurity comparison of risk factors for human metapneumovirus and respiratory syncytial virus disease severity in young children ampofo, incidence, morbidity, and costs of human metapneumovirus infection in hospitalized children modulation of host immunity by the human metapneumovirus human metapneumovirus antagonism of innate immune responses the secret life of viral entry glycoproteins: moonlighting in immune evasion this study was supported by the spanish ministry of economy and competitiveness (grants bfu2016-78232-p), instituto de salud carlos iii and by the european regional development fund, through the interreg v-a programme: poctefa 2014-2020 (grant pirepred efa086/15). it was also co-financed by the european development regional fund (erdf) "a way to achieve europe", spanish network for research in infectious the authors declare no conflicts of interest. key: cord-344979-ngujhhp6 authors: lübke, nadine; senff, tina; scherger, sara; hauka, sandra; andrée, marcel; adams, ortwin; timm, jörg; walker, andreas title: extraction-free sars-cov-2 detection by rapid rt-qpcr universal for all primary respiratory materials date: 2020-08-05 journal: j clin virol doi: 10.1016/j.jcv.2020.104579 sha: doc_id: 344979 cord_uid: ngujhhp6 background: fast and reliable detection of sars-cov-2 is crucial for efficient control of the covid-19 pandemic. due to the high demand for sars-cov-2 testing there is a worldwide shortage of rna extraction reagents. therefore, extraction-free rt-qpcr protocols are urgently needed. objectives: to establish a rapid rt-qpcr protocol for the detection of sars-cov-2 without the need of rna extraction suitable for all respiratory materials. material and methods: different sars-cov-2 positive respiratory materials from our routine laboratory were used as crude material after heat inactivation in direct rt-qpcr with the primedirect™ probe rt-qpcr mix (takara). sars-cov-2 was detected using novel primers targeted to the e-gene. results: the protocol for the detection of sars-cov-2 in crude material used a prepared frozen-pcr mix with optimized primers and 5 µl of fresh, undiluted and pre-analytically heat inactivated respiratory material. for validation, 91 respiratory samples were analyzed in direct comparison to classical rna-based rt-qpcr. overall 81.3% of the samples were detected in both assays with a strong correlation between both ct values (r = 0.8492, p < 0.0001). the sars-cov-2 detection rate by direct rt-qpcr was 95.8% for ct values <35. all negative samples were characterized by low viral loads (ct >35) and/or long storage times before sample processing. conclusion: direct rt-qpcr is a suitable alternative to classical rna rt-qpcr, provided that only fresh samples (storage <1 week) are used. rna extraction should be considered if samples have longer storage times or if pcr inhibition is observed. in summary, this protocol is fast, inexpensive and suitable for all respiratory materials. fast and reliable detection of sars-cov-2 is crucial for efficient control of the covid-19 pandemic. due to the high demand for sars-cov-2 testing there is a worldwide shortage of rna extraction reagents. therefore, extraction-free rt-qpcr protocols are urgently needed. to establish a rapid rt-qpcr protocol for the detection of sars-cov-2 without the need of rna extraction suitable for all respiratory materials. different sars-cov-2 positive respiratory materials from our routine laboratory were used as crude material after heat inactivation in direct rt-qpcr with the primedirect™ probe rt-qpcr mix (takara). sars-cov-2 was detected using novel primers targeted to the e-gene. the protocol for the detection of sars-cov-2 in crude material used a prepared frozen-pcr mix with optimized primers and 5 µl of fresh, undiluted and pre-analytically heat inactivated respiratory material. for validation, 91 respiratory samples were analyzed in direct comparison to classical rnabased rt-qpcr. overall 81.3% of the samples were detected in both assays with a strong correlation between both ct values (r=0.8492, p<0.0001). the sars-cov-2 detection rate by direct rt-qpcr was 95.8% for ct values <35. all negative samples were characterized by low viral loads (ct >35) and/or long storage times before sample processing. direct rt-qpcr is a suitable alternative to classical rna rt-qpcr, provided that only fresh samples early identification and sequencing of the virus enabled a fast development of protocols for the detection of viral rna in respiratory specimens by real-time reverse transcription pcr (rt-qpcr) to manage the outbreak by allowing early detection of cases and taking appropriate measures to prevent the transmission of the virus. [1, 2] . the massive demand for sars-cov-2 rt-qpcr testing, also recommended by the who resulted in a worldwide shortage of diagnostic reagents including rna extraction kits which is still a major challenge [3] . to overcome the lack of reagents and to increase the capacities for sars-cov-2 testing various approaches like pooling strategies, direct rt-pcr using primary material or isothermal methods are currently being established [4] [5] [6] [7] [8] . the biggest challenge is to maintain analytical sensitivity and to deal with different respiratory specimens. the aim of this study was to establish a rapid protocol of a direct rt-qpcr for the detection of sars-cov-2 without the need for prior rna extraction. in addition, this method should be independent of the respiratory material used while maintaining detection sensitivity all specimens used to establish the direct rt-qpcr for the detection of sars-cov-2 were part of routine diagnostic detected to be positive for sars-cov-2 by rna-based rt-qpcr with the protocol by corman and colleagues [1] or by the cobas® sars-cov-2 test on the cobas® 6800 sytem (roche). a total of 36 different respiratory samples were used to establish the protocol for the detection of sars-cov-2 in crude specimen. the validation of the protocol was performed with 91 different respiratory samples, including nasopharyngeal or throat swabs (n=78), tracheal secretion (ts=8), bronchoalveolar lavage fluid samples (bal=2), aspirate (as=2) and saliva (s=1) ( table s1 ). viscous samples were pre-incubated with remel™ sputasol (thermo scientific™). for a direct comparison of direct rt-qpcr to the gold standard rt-qpcr using purified nucleic acid, total nucleic acid was extracted by the ez1 platform with the ez1 virus mini kit v2.0 (qiagen) using 200 µl sample volume eluted in 60 µl buffer. the input of purified nucleic acid for the rt-qpcr was adapted equivalent to the source material with a dilution factor of 3.33 using nuclease-free water. for the analysis of crude specimen, 50 µl of respiratory material was heat inactivated at 99°c for 5 min and centrifuged at 4000 rpm for 5 min to ensure safe working and lysing of virus and cells. rt-qpcr was performed using the primedirect™ probe rt-qpcr mix (takara), which is designed for one-step real-time rt-qpcr without the need of a pre-analytic extraction step. to reduce hands on time pcr mixes were prepared in large batches and frozen ("frozen-pcr mixes"). per reaction 25 μl rt-qpcr mixture containing 1x primedirect™ rt-qpcr, 200 nm probe and 400 nm each primer (table 1 ) were aliquoted in 8-strips and stored at −20 °c until usage. for amplification, tubes were thawed and 5µl heat-inactivated respiratory material were used for rt-qpcr. reverse transcription condition were 30 s at 95 °c and 5 min reverse transcription at 60°c followed by 45 qpcr cycles each 5s 95 °c and 30s annealing/extension at 60°c. rt-qpcr cycling was performed on a quantstudio 5 real-time j o u r n a l p r e -p r o o f pcr system (applied biosystems). samples were considered positive when a signal was detected, negative if only the internal control was amplified and invalid when internal control was negative. statistical analyses were performed using graphpad prism 8.0.2. for the comparison of matching samples a paired t-test was performed and correlations were calculated using pearson correlation. the primedirect™ probe rt-qpcr sars-cov-2 protocol has different requirements for each respiratory material and therefore is unsuitable for routine diagnostics of clinical care. thus, we first optimized the protocol with the aim to be suitable for all respiratory materials including swabs in different transport media, tracheal secretions, aspirates, saliva and bronchoalveolar lavages. in a first step, we reduced the size of the pcr product by generating new primers and probes optimized to the short thermal protocol recommended for the primedirect™ kit. in our sars-cov-2 routine diagnostics we use the recommended sarbeco primers and probes located in the e-gene of sars-cov-2 with a product size of 113 bp [1] . the newly designed primers and probes are also located in the e-gene with overlaps to the sarbeco primers and probe but with a product size of only 103 bp ( table 1) . after validation of primers and probes the efficiency of the new e-gene cov-2 primers were compared to the sarbeco e-gene primers. to do so, we first compared the detection of viral rna in 20 respiratory samples from confirmed sars-cov-2 patients both, by sarbeco e-gene and our cov-2 e-gene primers using the primedirect™ rt-qpcr kit. (figure 1a ). the new developed cov e-gene primers lead to a significant increase in sensitivity with a mean decrease of ∆ct 1.0 (∆ct range 0.2-j o u r n a l p r e -p r o o f 6 3.7; p=0.0005; figure 1 ). additionally, two samples (one swab and one sputum) with ct values >35 were exclusively detected with the new cov e-gene primers. to further establish a streamlined workflow, we also explored preparation and storage of large "ready-to use" pcr-mixes ("frozen pcr-mixes"). comparison of freshly prepared mixes to the frozen pcr-mixes which were stored at -20°c for 1 week showed no significant differences in ct values (figure 1b) , which confirms the efficiency of frozen pcr-mixes for the detection of sars-cov-2. rna extraction is expensive, time-consuming and one of the most-limited reagents in the current pandemic. several reports indicate that rt-qpcr on crude specimen without purification is feasible, however needs optimization [5, 9, 10] . to do so, the influence of source material, sample storage, sample dilution, sample input volume and time of heat inactivation on analytical sensitivity was analyzed ( figure 2 ). the performance of each optimisation step was evaluated by comparison to classical rna-based rt-qpcr and given as δct. in order to determine the optimal duration of the heat inactivation step, that is sufficient for cell and virus lysis while not degrading rna , three patient samples with ct values 16.1 (ts), 23.4 (swab) and 26 (ts) were heat treated for 1, 2, 5 and 10 minutes at 99°c. heat inactivation for 1 and 2 minutes seemed sufficient for tracheal secretions however not for the swap sample with δct 3 and 1.2 compared to extracted rna, respectively. heating to 99°c for 5 and 10 minutes resulted in a more uniform detection pattern with δct 0.7 and 0.9 ( figure 2 ). since δct between 5 and 10 minutes did not differ significantly, all further inactivations we carried out for 5 minutes to save time. next, we analyzed if an increase in crude sample material input increases detection of sars-cov-2. finally, the influence of sample storage conditions was analyzed. therefore, crude specimens were stored overnight at 4°c or were frozen at -20°c and subsequently used in direct rt-qpcr. as shown in figure 2 storage at -20°c resulted in a mean δct of 15.7 compared to δct 0.4 for fresh specimens stored at 4°c not longer than overnight. thus, storage of crude specimen at -20°c is not recommended. since we observed this drastic increase in δct when samples were frozen before direct rt-qpcr, the stability of samples over a period of 4 weeks at 4°c was analyzed. as illustrated long-term storage at 4°c significantly increased the δct value in direct rt-qpcr ( figure 3 ). in detail, 26/32 of the analyzed samples (81.3%) have shown an increase of δct >3 after long-term storage at 4°c with a mean δct increase of 8.6 (δct range 3.1-14.5). of note, a total of 11 samples could no longer be detected after long-term storage. in summary, the optimal performance is achieved with 5µl fresh sample and heat-inactivated for 5 min at 99°c. for all following experiments this protocol was applied. after optimization the sensitivity of the direct rt-qpcr protocol was verified with 91 respiratory samples which were detected positive for sars-cov-2 either by in-house rt-qpcr with the protocol by corman and colleagues [1] or by using the cobas® sars-cov-2 test (roche). for direct comparison 1.5 µl extracted rna was used as input volume which is equivalent to 5 µl input volume of crude specimen. overall 74/91 samples (81.3%) were detected in both, extracted rna as well as crude material with a significant correlation of ct values (r=0.8492, p<0.0001; figure 4) . interestingly, one sample identified as negative in the rna rt-qpcr, was detected by direct rt-qpcr with a ct value of 34.1. of the remaining samples, 16 (17.6%) were positive in rna rt-qpcr however, not in the direct rt-qpcr (table s1 ). in detail, 10 (table s1 ). of note, all undetected samples had in common that they were swab samples and were stored for 2 to 6 weeks at 4 ° c before direct rt-qpcr was performed. no detection failures were observed with other respiratory materials. after successful validation the protocol was implemented in our routine diagnostic for staff surveillance. notably, between 6 th june and 11 th july 2020, in total 523 samples have been screened using the prime direct protocol and only 0.6% of the samples were invalid which demonstrates the good implementation capability and reliability of this method. direct rt-qpcr for the detection of sars-cov-2 without the need for prior rna extraction is one possibility to overcome the shortage of extraction reagents. the primedirect™ probe rt-qpcr mix used in this study is suitable for all respiratory materials, had a similar detection rate compared to extracted rna and is very fast (47min cycling). several reports indicate that rt-qpcr are compatible with direct testing of nasopharyngeal and oropharyngeal swab specimens without a prior purification or extraction step, but these studies only analyzed swab samples or had insufficient sensitivity [5, [9] [10] [11] [12] . based on our optimization, the following conditions are suitable for all respiratory materials from our routine: (1) primers and probes optimized for short cycling conditions; (2) heat inactivation of primary material at 99°c for 5 min; (3) input volume of 5 µl fresh and undiluted respiratory material. importantly, we could confirm that storage of the respiratory samples at -20°c before rt-qpcr significantly reduces sensitivity, as already has shown by merindol and colleagues [7] . in addition, direct rt-qpcr after long-term storage at 4°c is not recommended as the detection rate decreases significantly over time. ct values of 91 sars-cov-2 positive samples analyzed in direct comparison by rt-qpcr using different primary materials and extracted rna showed a significant correlation. as already indicated, not all samples were detected by both protocols. while only one sample was negative by rna rt-qpcr, 17 .6% of previously positive tested sars-cov-2 samples could not be detected with the optimized direct rt-qpcr protocol. detailed analyzes have shown that a reduced sensitivity of sars-cov-2 detection was predominantly associated with samples that had ct values >35 (52.6%), as also seen in other studies [4, 5, 7, 12] . nevertheless, also a small number of samples with ct values < 35 were negative for the detection of sars-cov-2 by direct rt-qpcr (4.2%), which was most likely associated with long-term sample storage at 4°c indicating a low stability of viral rna without an extraction step. only one sample in this study was rt-qpcr invalid (sars-cov-2 and internal control negative) indicating low drop off by pcr-inhibition of crude material. another major advantage of the primedirect™ rt-qpcr is the very fast pcr cycling program (47min in total) in combination with existing, accredited laboratory equipment. isothermal detection of sars-cov-2 like lamp (loop-mediated isothermal amplification) [13] [14] [15] [16] are faster and can be done without real-time pcr cyclers, however examination of a color change is not an alternative for routine diagnostics, especially when there is no internal control. compared to alternative high throughput crude specimen methods like lampseq [16] or lampore (oxford nanopore technologies) the direct rt-qpcr is one order of magnitude cheaper. we found a very high sars-cov-2 detection rate of 95.8% for ct values <35 by direct rt-qpcr and an overall detection rate of 81.3%. these detection rates are comparable to other protocols for direct sars-cov-2 pcr [4, 5] , however, our protocol is suitable for all kinds of respiratory material. of note, several recent studies showed reduced or absence of infectivity in samples with a ct value >35 [17, 18] , therefore our detection rate is acceptable for mass screening or staff surveillance. taken together this protocol is an improvement to the currently available protocols and permits detection of sars-cov-2 from all kind of crude respiratory material. an internal control is mandatory j o u r n a l p r e -p r o o f detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr a hundred days into the coronavirus disease (covid-19) pandemic who. report of the who-china joint mission on coronavirus disease validation of an extraction-free rt-pcr protocol for detection of sars-cov2 rna direct rt-qpcr detection of sars-cov-2 rna from patient nasopharyngeal swabs without an rna extraction step pooling of samples for testing for sars-cov-2 in asymptomatic people. the lancet infectious diseases sars-cov-2 detection by direct rrt-pcr without rna extraction rapid and visual detection of 2019 novel coronavirus (sars-cov-2) by a reverse transcription loop-mediated isothermal amplification assay. clinical microbiology and infection : the official publication of the european society of clinical microbiology and infectious diseases massive and rapid covid-19 testing is feasible by extraction-free sars-cov-2 rt-qpcr rapid direct nucleic acid amplification test without rna extraction for sars-cov-2 using a portable pcr thermocycler fast sars-cov-2 detection by rt-qpcr in preheated nasopharyngeal swab samples detection of sars-cov-2 rna by direct rt-qpcr on nasopharyngeal 1 specimens without extraction of viral rna screening for sars-cov-2 infections with colorimetric rt-lamp and lamp sequencing rapid molecular detection of sars-cov-2 (covid-19) virus rna using colorimetric lamp rapid sars-cov-2 testing in primary material based on a novel multiplex lamp assay lamp-seq: population-scale covid-19 diagnostics using combinatorial barcoding viral rna load as determined by cell culture as a management tool for discharge of sars-cov-2 patients from infectious disease wards predicting infectious sars-cov-2 from diagnostic samples figure 1: analysis of pcr conditions for the detection of sars-cov-2 by direct rt-qpcr direct rt-qpcr with the sarbeco and the new cov-e primers patient matched respiratory crude samples (n=20) including swabs, tracheal secretion, brochoalveolare lavage and sputum were analyzed for the detection of sars-cov-2 by direct rt-qpcr with the sarbeco primers and the new cov-e primers direct rt-qpcr with fresh and pre-frozen pcr-mixes patient matched respiratory crude samples (n=8) including swabs, tracheal secretion and bal were analyzed for the detection of sars-cov-2 by direct rt-qpcr with either fresh prepared master-mixes (mmx) or pre-frozen master-mixes the authors gratefully acknowledge the takara™ employees, especially sascha deppermann and matthieu lewis for continuous scientific and technical support in establishment and optimization of j o u r n a l p r e -p r o o f hbv-synq (internal control): a synthetical plasmid coding for an inactivated s-antigen of hepatitis b