J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

1 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

Original Article 

Infection by Rickettsia felis in Ctenocephalides felis felis Fleas from North of 

Colombia 
 

Verónica Contreras 1, Andrés F. Londoño 2, Jorge Miranda 1, *Salim Mattar 1, Leidy Y. 

Acevedo-Gutiérrez 2, Francisco J. Diaz 3, Juan D. Rodas 2 

 
1Instituto de Investigaciones Biológicas del Trópico, Universidad de Córdoba, Colombia 

2Grupo de Investigación en Ciencias Veterinarias, Centauro, Universidad de Antioquia, Colombia 
3Grupo de Inmunovirología, Universidad de Antioquia, Colombia 

 
(Received 22 Apr 2015; accepted 11 July 2018) 

 

Abstract 
Background: Rickettsia felis is an emergent Rickettsial agent whose main vector is Ctenocephalides felis, but ticks, 

mites and lice are also infected. We aimed to search for molecular evidence of Rickettsia spp. in fleas collected from 

dogs and wild rodents (Heteromys anomalous) from three villages of Córdoba and Antioquia provinces (Northern of 

Colombia), where outbreaks of rickettsioses have occurred, and discuss the possible role of fleas on endem-

ic/enzootic regions for rickettsia.  

Methods: During 2010 and 2012, 649 Ctenocephalides felis felis and 24 Pulex irritans fleas were removed from 

dogs and wild rodents (Heteromys anomalous), respectively, in 3 locations from Córdoba and Antioquia provinces 

(Colombia). These fleas were tested into pools for Rickettsial infection by PCR, targeting gltA, ompB, and ompA 

Rickettsial genes. 

Results: Almost 20% (30/153) of C. felis felis pools contained Rickettsial DNA. The fragments of ompB gene 

showed high identity values between sequences from Necocli and Los Cordobas with R. felis strain from Senegal 

(100% and 99.7% respectively) and all were highly related by phylogenetic analyses. Rickettsial DNA in pools of P. 

irritans was not detected. 

Conclusion: Our findings highlighted the endemicity of the infection by R. felis in fleas from northern of Colombia 

and showed the likely importance of dogs as hosts of C. felis felis fleas and their potential role as reservoirs of R. 

felis. 

 

Keywords: Rickettsia felis; Fleas; Dogs; Rodents; Ctenocephalides felis 

 
Introduction 
 

The genus Rickettsia comprised arthropod-

associated intracellular and gram-negative bac-

teria. It is divided into 4 groups based on their 

genotypic characteristics: Spotted fever group 

(R. rickettsii, R. conorii, R. parkeri, and sev-

eral others), typhus group (R. prowazekii and 

R. typhi), transitional group (R. felis, R. akari, 

and R. australis), and the nonpathogenic an-

cestral group (R. bellii and R. canadensis) (1). 

Rickettsia felis is globally distributed and is 

the etiological agent of flea-borne spotted fever. 

The main vector is the flea Ctenocephalides 

felis, but ticks, mites and lice have also been 

found infected (2). Rickettsia felis in C. felis  

 

 
populations is principally maintained by 

transstadial and transovarial transmission (3). 

In colonized C. felis fleas, vertical transmis-

sion of R. felis is thought to be the primary 

route of maintenance, since the reported prev-

alence of R. felis in C. felis colonies ranged 

from 43–100% (4-6). In nature, fleas feeding 

on R. felis-infected mammalian hosts likely 

amplify the prevalence of R. felis in a flea´s 

population. Studies on the ecology of R. felis 

identified a role for opossums in the trans-

mission cycle (7-9). Furthermore, a role for 

companion animals, rodents, and, specifical-

ly, their fleas as the potential source of human  

*Corresponding author: Dr Salim Máttar, E-mail: 
mattarsalim@gmail.com, 

smattar@correo.unicordoba.edu.co 



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

2 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

exposure has been suggested (4, 9, 10). 

Infecting fleas have been reported in many 

American countries and human cases of spot-

ted fever by R. felis have been recently de-

scribed in the United States, Mexico, and Bra-

zil (11). Clinical manifestations of flea-borne 

spotted fever are variable and similar to oth-

er Rickettsial diseases. In Colombia, a trans-

versal serological study was performed in sev-

en municipalities of Caldas Province, and a 

human seroprevalence of 25.2% and 17.8% 

against R. typhi and R. felis, respectively was 

found (12). Additionally, the infection by R. 

felis in C. felis, C. canis, and P. irritans fleas 

was reported in the province of Caldas (13). 

Three important spotted fever group (SFG) 

rickettsiosis outbreaks occurred in Colombia, 

in the municipalities of Turbo y Necoclí (An-

tioquia Province) and Los Cordobas (Cór-

doba Province), between 2006 and 2008 (14, 

15). Consequently, these areas have been de-

scribed as endemic for Rickettsioses in this 

country.  

The purpose of this study was to search 

for molecular evidence of Rickettsia spp. in 

fleas collected from dogs and wild rodents 

(Heteromys anomalous) from the three zones 

where outbreaks of rickettsioses occurred and 

discuss the likely role of fleas in the epide-

miology of Rickettsia spp. in this region of 

Colombia. 

 
Materials and Methods 

 
Study area and sampling 

The study was conducted in 3 neighboring 

municipalities: Turbo, (8°8.272´N, 76°33.009´ 

W) located at 400 m above sea level (masl), 

and Necocli, (8°32.892´N, 76°34.429´W), at 

182 m above sea level. Both are located in 

the Antioquia Province, and Los Cordobas, 

(8°50.195´N, 76°20.252´W) located at eight 

meters above sea level, in the Cordoba 

Province (Fig. 1). All of these municipalities 

are placed on the Colombian Atlantic Coast. 

These three sites comprise part of the natural 

Caribbean region, and have a tropical humid 

climate characterized by a dry period from 

Jan to Mar and a rainy season from Apr to 

Dec, with an annual average temperature of 

28 °C and relative humidity of 85% (Fig. 1).  

During 2010 and 2012, a total of 649 

fleas were removed from 92 dogs of all stud-

ied locations (194 from Turbo, 225 from 

Necocli and 230 from Los Cordobas) and 24 

fleas from three Heteromys anomalus ro-

dents captured in Turbo and Necocli. They 

were obtained using tweezers or by combing 

wild and domestic animals, and care was 

taken to avoid damaging structures essential 

for taxonomic classification. The fleas were 

collected from each animal in one or various 

vials with alcohol 95% (depending on the 

number collected per animal) and were 

transported to the laboratory. Because the 

population of dogs in the study zones was 

unknown, a sample size was not determined. 

However, we were able to estimate the num-

ber of animals that lived with people at each 

site.  

Ethical, technical, scientific and adminis-

trative standards to perform research in ani-

mals were taken into consideration according 

to national regulations for the procedures of 

collection, management and conservation of 

samples (resolution No. 008430 of 1993 and 

Law 84 of Dec 27th from 1989). 
 

Molecular detection of Rickettsia spp. 

Fleas were classified according to mor-

phological keys (16-18). They were grouped 

in maximum “pools” of 10 individuals, ac-

cording to host and sampling site: 153 pools 

of C. felis felis were collected from dogs and 

six pools of Pulex irritans fleas were collect-

ed from rodents.  

DNA from pools was extracted by using 

QIAamp DNA Mini-Kit (Qiagen®, Valen-

cia, CA, USA), according to manufacturer 

conditions. Samples were stored at -20 °C 

until they were used for PCR assays. 



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

3 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

Samples were tested by PCR assay with 

primers CS-78 (forward GCAAGTATCGGT 

GAGGATGTAAT) and CS323 (reverse GC 

TTCCTTAAAATTCAATAAATCAGGAT), 

which amplify a 401bp fragment of the 

citrate synthase gene (gltA), previously re-

ported as appropriate for the screening of 

Rickettsia spp. (19). Samples that came up 

positive for gltA were tested with the pri-

mers Rr190.70p (forward: 5´ATGGCGAA 

TATTTCTCCAAAA)-Rr190.701 (reverse: 

3´GTTCCGTTAATGGCAGCATCT), that 

amplify a 632bp fragment of ompA genes 

(20); primers 120.M59 (forward 5´AAACAA 

TAATCAAGGTACTGT)-120.807 (reverse 

3´TACTTCCGGTTACAGCAAAGT) that 

amplify an 812bp fragment of ompB gene, 

previously described (21). Negative (molec-

ular grade water) and positive controls (DNA 

R. amblyomii) were included for each reac-

tion. Positive products were purified by using a 

Quick Gel Extraction kit (PureLinkTM, Invi-

trogen) and subsequently these were se-

quenced by a commercial facility (Macro-

gen). The sequences were assembled and 

edited with the Seqman program from the 

DNAstar packet (Lasergene®, Madison WI, 

USA), and phylogenetic analysis was per-

formed with the MEGA 6 (22) and MrBayes 

3.2 programs (23).  

 

Results 
 

Of 153 pools of C. felis felis (54 were 

from Turbo, 65 from Necocli and 34 from 

Los Cordobas), Rickettsial DNA was detect-

ed in 30 (19%) pools by gltA gene. Four 

pools amplified for ompB gene and none 

amplified for ompA. Pulex irritans pools 

were negative by PCR. The prevalence of 

Rickettsia in fleas expressed as percentage 

and minimum infection rate (MIR) of fleas 

were calculated. We made this assessment 

on the assumption that a PCR-positive pool 

contains only one positive specimen. The 

overall MIR of infected fleas was 4.45 

(30/673). Of these, 4.6% (9/194) of C. felis 

was from Turbo, 5.7% (13/225) from Neco-

cli and 3.5% (8/230) from Los Cordobas 

(Table 1). Nucleotide sequences of the ompB 

gene from Necocli and Los Cordobas were 

99.9% identical to each other (Fig. 2). Se-

quence homology obtained from Necocli and 

Los Cordobas were 100 and 99.7% with R. 

felis strain Senegal, respectively. Evolution-

ary history of gltA gene was inferred by us-

ing the Neighbor-Joining method (not 

shown) and the Bayesian method was used 

for ompB gene (Fig. 2).  

The sequences generated in this study 

have been submitted to GenBank under the 

accessions KP870106 to KP870109. 

 
Table 1. Prevalence of Rickettsia felis in fleas expressed as the minimum percentage of fleas in a pool with detecta-

ble Rickettsiae and Minimum Infection Rate (MIR) (IC 95%) 

 

Location Species of fleas Number 

Fleas 

Number Pools 

positive / 

Number tested 

pools 

% positives 

pools 

Minimum Infec-

tion Rate (MIR) 

Turbo C. felis felis 194 9/54 16 9/194 (4.6%) 

Pulex irritans 5 0/2 0 0/5 (0%) 

Necoclí C. felis felis 225 13/65 20 13/225 (5.7%) 

Pulex irritans 19 0/4 0 0/19 (0%) 

Los Córdobas C. felis felis 230 8/34 23 8/230 (3.5%) 

 Total fleas pools 673 30/159 19 30/673 (4.4%) 



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

4 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

 
 

Fig. 1. Geographic location of the study areas in northwestern of Colombia. Square corresponds to the municipality 

of Los Cordobas (Cordoba Province), the star and circle corresponds to the municipalities of Turbo and Necoclí 

(Antioquia Province), respectively 

 

 
 

Fig. 2. Bayesian phylogenetic tree of rickettsial ompB gene. Samples from this study are shown on bold font. Two 

parallel searches were runned by 1,000,000 generations sampling every 1,000 states. Average standard deviations of 

split frequencies were <0.01 at the end of the runs. Substitution model used was the General Time Reversible with a 

discrete Gamma distribution of the variation of the evolutionary rate (GTR+G), previously found as the best model 

by the Bayesian information criterion. The analysis was performed in MrBayes 3.2.0. There were a total of 723 posi-

tions in the final dataset. The tree was drawn in the software FigTree, 1.4 and it was rooted with R. prowazekii. 



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

5 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

Discussion 
 

We reported the infection by R. felis in 

C. felis felis fleas collected from dogs from 

endemic areas of rickettsioses in Cordoba 

and Antioquia provinces, northern of Co-

lombia. Values of minimum infection rates 

(MIR) reported herein for C. felis are similar 

to the one previously reported in the prov-

ince of Caldas, Colombia (5.3% MIR) (13). 

However, there are lower than MIRs shown 

in other countries, such as Brazil (14.3%) 

(24), the United States (13.3%) (25) and 

Taiwan (8.2%) (26).  

The proportion of C. felis felis positive 

pools in our study was 19% (30/153) and the 

proportion obtained in Caldas (Colombia) 

was 41% (54/132) (13). The rates of MIRs of 

these studies were calculated based on the 

assumption that only one flea from each pos-

itive pool was positive for the Rickettsia 

gene evaluated. It may underestimate the 

frequency of R. felis in pools, possibly be-

cause of the greater amount of DNA in pools 

or other contaminants that may inhibit PCR 

assays (27). Otherwise, in Brazil, differences 

in the percentage of infection between re-

gions were related to the environmental and 

climatic conditions (28). Higher rates of R. 

felis infection in fleas were significantly re-

lated with regions with temperate climates, 

and lower rates were linked with dry climates.  

Several studies highlight the broad dis-

tribution of infection by R. felis in C. felis. 

Different proportions of infection have been 

reported in other American countries. For ex-

ample, in Mexico, 20% of 54 pools of C. felis 

collected from dogs were reported infected 

(29). Sixty-four percent (55/86) and 58% 

(47/81) of pools of C. felis removed from 

cats and dogs were infected in Guatemala 

and Costa Rica, respectively (30); and 41% 

of infected pools (25/62 C. felis and 2/4 C. 

canis) collected from 15 cats and dogs were 

reported in Uruguay (31). In our study, R.  

 

 

felis was detected in 30/153 (19%) C. felis 

pools removed from dogs, which is very 

similar to the Mexican report which, by the 

way, suggests the likely relevance of this 

host in maintaining C. felis and possibly R. 

felis in studied areas. Moreover, some stud-

ies have detected R. felis by PCR in blood of 

dogs, suggesting that dogs may have the 

potential to act as an important reservoir of 

infection (32, 33). 

In the present study, the sequences ob-

tained from Necocli and Los Cordobas were 

identical to each other and they showed ex-

tremely high sequence homology to a R. felis 

strain from Senegal (100 and 99.7% respec-

tively, Fig. 2). In province of Caldas (Co-

lombia), authors have described a high ho-

mology (>98%), between several R. felis 

sequences obtained from C. felis and the R. 

felis URRWXCal2 (Genbank accession CP 

000053). Likewise, they showed a very close 

monophyletic relationship of these sequenc-

es with the R. akari group (13).  

Sequences of R. felis from Necoclí (KP 

870109) and Los Cordobas (KP870106) ob-

tained in the present study were compared 

with the sequences obtained in Caldas (Co-

lombia), called Colombia5 and Colombia7 

(Fig. 2) (13). Phylogenetic relationship be-

tween the sequences of our results and Cal-

das (Colombia), showed identity values of 

95.9% of Necoclí vs Colombia5; and 92.7% 

of Los Cordobas vs Colombia7. Variations 

could exist between the sequences of strains 

of R. felis from two different areas of Co-

lombia. Moreover, Rickettsial DNA was not 

detected in P. irritans pools of our study, in 

contrast, 3/10 pools of this species infected 

with R. felis in Caldas were reported (Co-

lombia) (13). R. felis infection in P. irritans, 

has also been reported in studies from Dem-

ocratic Republic of the Congo (34) and the 

United States (4), that shows a likely wide 



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

6 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

distribution of R. felis in this fleas species 

around the world. 

Human infection with R. felis and its clin-

ical implications have been controversial. This 

microorganism may be an emerging human 

pathogen; meanwhile, other authors consider 

that their casual appearance in human sam-

ples and vector is a proof of endosymbiosis 

(11, 35, 36). Before we determine whether 

human beings of this region of Colombia 

could be at real risk of getting ill by R. felis, 

further studies are necessary to show the 

seroprevalence in humans and animals and 

demonstrate its presence in other human cas-

es compatible with rickettsiosis. 

 
Conclusion 
 

In the present study, we reported the in-

fection by Rickettsia felis in C. felis felis 

fleas collected from dogs from endemic are-

as of rickettsioses in Cordoba and Antioquia 

provinces (Colombia). Almost 20% (30/153) 

of C. felis felis pools contained Rickettsial 

DNA. Our findings highlighted the endemic-

ity of the infection by R. felis in fleas from 

northern of Colombia and suggest the im-

portance of dogs as host of C. felis felis fleas 

and their potential as reservoirs of R. felis. 

Human infection with R. felis and its clinical 

implications have been controversial. May 

before we determine whether human beings 

of this region of Colombia could be at real 

risk of getting ill by R. felis, further studies 

are necessary to show the seroprevalence in 

humans and animals and demonstrate its 

presence in other human cases compatible 

with rickettsiosis.  

 
Acknowledgements 
 

We thank Colciencias for the financial 

support through grant No. 111549326228 

(“Estudio ecológico de endemicidad por Rick-

ettsia en Colombia”). We thank also the Uni-

versidad de Antioquia program “Sostenibilidad 

2013/2014”. To University of Cordoba, Vice-

rector of Investigation, Sustainability program 

of research groups, 2017-2018.  

The authors declare that the disclosure of 

this paper will not generate or constitute any 

conflict of interest. 

 
References 
 

1. Mansueto P, Vitale G, Cascio A, Seidita 

A, Pepe I, Carroccio A, di Rosa S, 

Rinni GB, Cillari, Walker DH (2012) 

New Insight into Immunity and Im-

munopathology of Rickettsial Diseases. 

Clin Dev Immunol. 2012: 967852. 

2. Labruna MB, Mattar S, Nava S, Bermudez 

S, Venzal JM, Dolz G, Abarca K, 

Romero L, de Sousa R, Oteo J, Zavala-

Castro J (2011) Rickettsioses in Latin 

America, Caribbean, Spain and Portugal. 

Revista MVZ Córdoba. 16(2): 2435–

2457. 

3. Azad AF, Radulovic S, Higgins JA, 

Noden BH, Troyer JM (1997) Flea-

borne rickettsioses: ecologic considera-

tions. Emerg Infect Dis. 3: 319–327. 

4. Wedincamp J Jr, Foil LD (2002) Vertical 

transmission of Rickettsia felis in the 

cat flea (Ctenocephalides felis Bouche). 

J Vector Ecol. 27: 96–101. 

5. Henry KM, Jiang J, Rozmajzl PJ, Azad 

AF, Macaluso KR, Richards AL (2007) 

Development of quantitative real-time 

PCR assays to detect Rickettsia typhi 

and Rickettsia felis, the causative agents 

of murine typhus and flea-borne spot-

ted fever. Mol Cell Probes. 21: 17–23. 

6. Boostrom A, Beier M, Macaluso JA, 

Macaluso KR, Sprenger D, Hayes J, Rad-

ulovic S, Azad AF (2002) Geographic 

association of Rickettsia felis-infected 

opossums with human murine typhus, 

Texas. Emerg Infect Dis. 8: 549–554. 

7. Schriefer M, Sacci Jr, Taylor JP, Higgins  



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

7 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

JA, Azad AF (1994) Murine typhus: 

updated roles of multiple urban com-

ponents and asecond typhus-like Rick-

ettsia. J Med Entomol. 31: 681–685. 

8. Williams SG, Sacci JB, Schriefer ME, 

Andersen EM, Fujioka KK, Sorvillo 

FJ, Barr AR, Azad AF (1992) Typhus 

and typhus-like rickettsiae associated 

with opossums and their fleas in Los 

Angeles County, California. J. Clin. 

Microbiol. 30: 1758–1762. 

9. Case JB, Chomel B, Nicholson W, Foley J 

(2006) Serological survey of vector-

borne zoonotic pathogens in pet cats 

and cats from animal shelters and feral 

colonies. J Feline Med Surg. 8: 111–117. 

10. Psaroulaki A, Antoniou M, Papaeustathi-

ou A, Toumazos P, Loukaides F, Tse-

lentis Y (2006) First detection of Rick-

ettsia felis in Ctenocephalides felis fleas 

parasitizing rats in Cyprus. Am J Trop 

Med Hyg. 74: 120–122.  

11. Pérez-Osorio CE, Zavala-Velázquez JE, 

León JJ, Zavala-Castro JE (2008) Rick-

ettsia felis as emergent global threat for 

humans. Emerging Infect Dis. 14(7): 

1019–1023. 

12. Hidalgo M, Montoya V, Martínez A, 

Mercado M, De la Ossa A, Vélez C, 

Estrada G, Pérez JE, Faccini-Martínez 

AA, Labruna MB (2013) Flea-borne ri-

ckettsioses in the North of Caldas pro-

vince, Colombia. Vector Borne Zoono-

tic Dis. 13: 289–294 

13. Ramírez-Hernández A, Montoya V, Mar-

tínez A, Pérez JE, Mercado M, de la 

Ossa A, Vélez C, Estrada G, Correa 

MI, Duque L (2013) Molecular detec-

tion of Rickettsia felis in different flea 

species from Caldas, Colombia. Am J 

Trop Med Hyg. 89: 453–459. 

14. Hidalgo M, Miranda J, Heredia D, Zam-

brano P, Vesga JF, Lizarazo D, Mattar S, 

Valbuena G (2011) Outbreak of Rocky 

Mountain spotted fever in Córdoba, Co-

lombia. Mem Inst Oswaldo Cruz. 106(1):  

117–118.  

15. Pacheco O, Giraldo R, Martínez M, Hi-

dalgo M, Galeano A, Echeverri I, Ech-

evarría L, Parra E, Rey G (2008) Estu-

dio De Brote Febril Hemorrágico En El 

Village De Alto De Mulatos-Distrito 

Especial Portuario De Turbo, Antio-

quia. Inf Quinc Epidemiol Nac Vol. 13: 

145–160,  

16. Furman DP, Catts EP (1982). Manual of 

medical entomology. Cambridge Uni-

versity. (Ed. 4). 

17. Wenzel R, Vernon. T (1966) Ectopara-

sites of Panama, Field Museum of Nat-

ural History. 

18. Linardi PM, Guimarães LR (2000) Si-

fonápteros do Brasil. Mus Zool da Univ 

São Paulo. São Paulo. pp. 48–53. 

19. Labruna MB, Whitworth T, Horta MC, 

Bouyer DH, McBride JW, Pinter A, 

Popov V, Gennari SM, Walker DH 

(2004) Rickettsia species infecting Am-

blyomma cooperi ticks from an area in 

the State of São Paulo, Brazil, where 

Brazilian spotted fever is endemic. J 

Clin Microbiol. 42: 90–98. 

20. Regnery RL, Spruill CL, Plikaytis BD 

(1991) Genotypic identification of Rick-

ettsiae and estimation of intraspecies 

sequence divergence for portions of two 

rickettsial genes. J Bacteriol. 173: 1576–

1589. 

21. Roux V, Raoult D (2000) Phylogenetic 

analysis of members of the genus Rick-

ettsia using the gene encoding the outer 

membrane protein rOmpB (ompB). Int 

J Syst Evol Microbiol. 50: 1449–1455. 

22. Tamura K, Stecher G, Peterson D, Filip-

ski A, Kumar S (2013) MEGA6: Mo-

lecular evolutionary genetics analysis 

Version 6.0. Mol Biol Evol. 30(12): 

2725–2729  

23. Fredrik Ronquist, Maxim Teslenko, Paul 

van der Mark, Daniel L. Ayres, Aaron 

Darling, Sebastian Höhna, Bret Larget, 

Liang Liu, Marc A. Suchard, John P. 



J Arthropod-Borne Dis, March 2019, 13(1): 1–8                                                    V Contreras et al.: Infection by Rickettsia … 

8 
 

http://jad.tums.ac.ir 

Published Online: April 27, 2019 

 

Huelsenbeck (2012) MrBayes 3.2: Ef-

ficient bayesian phylogenetic inference 

and model choice across a large model 

space. Syst Biol. 61(3): 539–542 

24. Gehrke FS, Gazeta GS, Souza ER, Ribei-

ro A, Marrelli MT, Schumaker TT 

(2009) Rickettsia rickettsii, Rickettsia 

felis and Rickettsia sp. TwKM03 in-

fecting Rhipicephalus sanguineus and 

Ctenocephalides felis collected from 

dogs in a Brazilian potted fever focus 

in the State of Rio De Janeiro/Brazil. 

Clin Microbiol Infect. 15(Suppl 2): 267–

268. 

25. Abramowicz KF, Wekesa JW, Nwadike 

CN, Zambrano ML, Karpathy SE, Cec-

il D, Burns J, Hu R, Eremeeva ME 

(2012) Rickettsia felis in cat fleas, Cten-

ocephalides felis parasitizing opossums, 

San Bernardino County, California. Med 

Vet Entomol. 26: 458–462. 

26. Tsai KH, Lu HY, Huang JH, Wang PJ, 

Wang HC, Huang CG, Wu WJ, Shu 

PY (2009) Rickettsia felis in cat fleas 

in Taiwan. Vector Borne Zoonotic Dis. 

9: 561–563 

27. Demeke T, Jenkins GR (2010) Influence 

of DNA extraction methods, PCR in-

hibitors and quantification methods on 

realtime PCR assay of biotechnology 

derived traits. Anal Bioanal Chem. 396: 

1977–1990. 

28. Horta MC, Ogrzewalska M, Azevedo MC, 

Costa FB, Ferreira F, Labruna MB (2014) 

Rickettsia felis in Ctenocephalides felis 

felis from Five Geographic Regions of 

Brazil. Am J Trop Med Hyg. 91(1): 

96–100.  

29. Zavala-Velazquez J, Zavala-Castro J, Vado-

Solis I, Ruiz-Sosa J, Moron C, Bouyer 

D, Walker D (2002) Identification of 

Ctenocephalides felis fleas as a host of 

Rickettsia felis, the agent of a spotted 

fever rickettsiosis in Yucatan, Mexico. 

Vector Borne Zoonotic Dis. 2: 69–75. 

30. Troyo A, Álvarez D, Taylor L, Abdalla G,  

Calderón-Arguedas Ó, Zambrano ML, 

Dasch GA, Lindblade K, Hun L, Ere-

meeva ME (2012) Rickettsia felis in 

Ctenocephalides felis from Guatemala 

and Costa Rica. Am J Trop Med Hyg. 

86: 1054–1056. 

31. Venzal JM, Pérez‐Martínez L, Felix ML, 

Portillo A, Blanco JR, Oteo JA (2006) 

Prevalence of Rickettsia felis in Cten-

ocephalides felis and Ctenocephalides 

canis from Uruguay. Ann N. Y Acad 

Sci. 1078: 305–308.  

32. Hii SF, Kopp SR, Abdad MY, Thompson 

MF, O’Leary CA, Rees RL, Traub RJ 

(2011) Molecular Evidence Supports 

the Role of Dogs as Potential Reser-

voirs for Rickettsia felis. Vector-Borne 

Zoonotic Dis. 8: 1007–1012. 

33. Oteo JA, Portillo A, Santibáñez S, Blan-

co JR, Pérez-Martínez L, Ibarra V 

(2006) Cluster of cases of human Rick-

ettsia felis infection from Southern Eu-

rope (Spain) diagnosed by PCR. J Clin 

Microbiol. 44(7): 2669–2671.  

34. Sackal C, Laudisoit A, Kosoy M, Mas-

sung R, Eremeeva ME, Karpathy SE, 

Van Wyk K, Gabitzsch E, Zeidner NS 

(2008) Bartonella spp. and Rickettsia 

felis in fleas, Democratic Republic of 

Congo. Emerg Infect Dis. 14: 1972–1974. 

35. Faccini-Martínez AA, Forero-Becerra E, 

Cortés-Vecino J, Polo-Teran L, Jácome 

J, Vargas J, Valbuena G, Hidalgo M 

(2013) Caso probable de fiebre man-

chada (Rickettsia felis) transmitida por 

pulgas. Biomédica. 33(1): 9–13. 

36. Labruna MB, Walker D (2014) Rickett-

sia felis and Changing Paradigms about 

Pathogenic Rickettsiae. EID. 20(10): 

1768–1769.