J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

Original Article

Development of A Loop-Mediated Isothermal Amplification (LAMP) Assay for

Detection of Relapsing Fever Borreliae

Faezeh Houmansadr1; *Mohammad Soleimani2,3; *Saied Reza Naddaf4

1
Department of Cellular and Molecular Biology, Science and Research Branch, Islamic Azad University,

Tehran, Iran
2
Department of Microbiology, Faculty of Medicine, AJA University of Medical Sciences, Tehran, Iran

3
Tasnim Biotechnology Research Center, Faculty of Medicine, AJA University of Medical Sciences, Tehran,

Iran
4
Department of Parasitology, Pasteur Institute of Iran, Tehran, Iran

(Received 18 Mar 2019; accepted 04 Mar 2020)

Abstract
Background: This study aimed to develop a loop-mediated isothermal amplification (LAMP) assay for the rapid detec-

tion of tick-borne relapsing fever in resource-limited areas.

Methods: A set of six primers were designed based on the conserved regions of the Glycerophosphodiester phos-

phodiesterase (glpQ) gene of Borrelia species. For sensitivity assay, serial dilutions of a recombinant plasmid contain-

ing a 219bp sequence of the glpQ were prepared and used as the template DNA. The LAMP reactions containing the six

primers and the reagents required for amplification were incubated at 60–65 °C for 60min in a Loopamp real-time tur-

bidimeter. For the specificity test, DNA from 14 other bacteria were included in the assays, and double-distilled water

was used as the negative control. Also, DNA from dried blood spots (DBSs) of spirochetemic mice, and blood samples

from relapsing fever-suspected patients were examined by the LAMP along a Borrelia-specific nested PCR that targets

the rrs-rrl-IGS region.
Results: The LAMP detected as low as 90glpQ copies in reactions. The primers reacted with DNA from DBS of spi-

rochetemic mice showing spirochete concentrations of ≤ one per a 1000X microscopic field. In clinical samples, the

LAMP assay showed a higher sensitivity compared to nested-PCR. The LAMP specificity was 100%, as the primers did

not react with other bacteria DNA.

Conclusion: The high sensitivity and specificity of the test, along with the simplicity of the DNA extraction procedure,

make the LAMP a reliable and adaptable tool for the diagnosis of tick-borne relapsing fever in rural endemic areas.

Keywords: Relapsing fever; Loop-mediated isothermal amplification (LAMP); Iran

Introduction

The genus Borrelia comprises two distinct

groups of spirochetes with the difference in

diseases they cause. One group includes the

causative agents of Lyme disease and the oth-

er the relapsing fever borreliae (RFB). Cur-

rently, there are 22 confirmed RFB, and six oth-

er taxa have been proposed (1). Except for the

louse adapted Borrelia recurrentis, the major-

ity of species pathogenic to humans are trans-

mitted by the soft ticks of the genus Orni-

thodoros. A few species, such as Borrelia miya-

motoi and Borrelia lonestari, are vectored by

hard ticks and yet share genetic similarities with

the RFB (2). Soft tick-borne relapsing fever

(STBR) is endemic to Iran (3-5). Until now, de-

spite the improvement of housing and the re-

moval of the disease from mandatory report-

ing to the Ministry of Health and Medical Ed-

ucation (MHME), no year has passed without

reports of human infections. In Iran, four RFB,

including Borrelia persica, Borrelia microti,

Borrelia latyschewii and Borrelia baltazardi

have been described (5). Borrelia persica is the

primary cause of the disease especially in the

*Corresponding authors: Dr Mohammad Soleimani,
E-mail: soleimanidor@yahoo.com, Dr Saied Reza Nad-

daf, E-mail: saiedrezanaddaf@gmail.com

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

west and northwest of the country (5-7), while

in the south, epidemiological data and molec-

ular approved human infections indicated B.

microti and other B. microti-like borreliae as

the other cause of relapsing fever (3, 8, 9).

In Iran, until recently, confirmation of re-

lapsing fever merely relied on observation of

the spirochetes in peripheral blood of febrile

patients using darkfield microscopy or Giem-

sa-stained blood smears. The disease is easily

diagnosed by microscopy during fever peaks

with a massive spirochetemia. However, be-

tween the peaks and in milder diseases, the

bacteria are scanty and are hard to identify in

blood smears. In Iran, PCR assays using vari-

ous molecular markers like flaB, glpQ and rrs

have successfully detected the Borrelia spp in

relapsing fever patients (3, 8) and animals (10).

The PCR assays exhibit high sensitivities but

are not commonly affordable in resource-lim-

ited laboratories of rural areas, where most of

the relapsing fever infections occur. Hence,

we prompted to develop an alternative DNA

amplification assay of lower cost for the de-

tection of the disease in these areas. Loop-me-

diated isothermal amplification (LAMP) has

proved as a robust, cheap, highly sensitive/

specific tool for the detection of various path-

ogenic agents including viruses, bacteria, fun-

gi, and parasites (11-14). This assay employs

a DNA polymerase and a set of 4–6 primers

that operate in isothermal conditions forming

loop structures that ultimately precipitate in

the reaction mixture (13). This assay has also

shown to be less prone to inhibition from DNA

preparations and allows adaptability to field

conditions (15, 16).

This study aimed to develop a (LAMP) as-

say for the rapid detection of relapsing fever

borreliae based on the glycerophosphodiester

phosphodiesterase (glpQ) gene, a sequence con-

served among all relapsing fever borreliae, but

absent from Lyme disease spirochetes (17).

Materials and Methods

Bacteria species and DNA extraction

We used B. microti strain IR-1, which was

maintained via continual passages in NMRI

mice for more than 15 years in the Parasitol-

ogy Department of Pasteur Institute of Iran.

Blood samples were obtained from B. microti-

infected mice when spirochetes reached 1.4×

106/ml of blood. DNA extraction from 1ml of

blood was performed using a Genomic DNA

Purification Kit (Promega, Madison, USA) as

described by the manufacturer.

Primer design

Initially, glpQ sequences of 10 relapsing

fever Borreliae (B. microti, Acc. No. JF825473;

B. microti, Acc. No. EU914144; B. recurren-

tis, Acc. No. KJ003842, Borrelia sp., Acc. No.

KX683865; Borrelia duttonii, Acc. No. DQ

346785; Borrelia crocidurae, Acc. No. CP

004267; Borrelia hispanica; Acc. No. GU

357573; B. persica, Acc. No. EU914143; B.

recurrentis, Acc. No. AF247152; Borrelia dut-

tonii, Acc. No. GU357577) were obtained from

the GenBank database and aligned by using

CLC Sequence Viewer 7 (CLC bio, Aarhus,

Denmark). A set of six primers including two

loop primers were designed based on the con-

served regions of the glpQ sequence, corre-

sponding to the nucleotides 261015–261682

of B. duttonii strain Ly (Fig. 1), by the online

software program, Primer Explorer V4 (Eiken

Chemical Co., Tokyo, Japan;

http://primerexplorer.jp/e/). The theoretical

specificity of the designed primers was con-

firmed by in silico analysis using BLAST and

Primer-BLAST software available in NCBI

(http://www. ncbi.nlm.nih.gov/). The primers

were synthesized by a commercial company

(Generay Biotechnology, Shanghai, China).

The main primers (glpQ-F3 and glpQ-B3) and

(glpQ-FIP and glpQ-BIP) target fragments of

219bp and 161bp size, respectively, and the

loop primer (glpQ-LF and glpQ-LB) produce

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

amplicons of various size with a ladder-like

pattern (Table 1).

Glycerophosphodiester Phosphodiesterase

Gene (glpQ) cloning

A 219bp fragment of the glpQ gene was

amplified by the primers glpQ-F3 and glpQ-

B3 (Table 1). The reaction contained 3mM

MgSO4 (Biobasic, Toronto, Canada), 1.6mM

dNTPs (Kawsar Biotech Co, Tehran, Iran), 1µl

10X buffer [100mM KCl, 100mM (NH4)2SO4,

200mM Tris HCl (pH 8.75)], 1% Triton X-100,

1mg/ml BSA (Biobasic, Toronto, Canada), 1U

Taq DNA Polymerase (Biobasic, Toronto, Can-

ada), 0.4µM of each primer, 1µl template DNA,

and double-distilled water (DDW) to the 25µl

final volume. The amplification was pro-

grammed in a thermal cycler (Eppendorf, Ham-

burg, Germany), for an initial denaturation at

94 oC for 4min followed by 35 cycles of 94 oC

for 45sec, 45 oC for 45sec, and 72 oC for 30sec,

and a final extension at 72 oC for 10min. The

PCR products were run on a 2% agarose gel

(Min Run Gel Electrophoresis System; Bio-

Equip co, Shanghai, China), stained with eth-

idium bromide (CinnaGen, Alborz, Iran), and

visualized under UV in Gel Documentation

system (E-BOX VILBER, Marne-la-Vallée,

France). The PCR product was purified using

a PCR Purification Kit (Bioneer, Daejeon,

South Korea), cloned into a TA vector (In-

sTAclone™ PCR Cloning Kit, Thermo Scien-

tific, MA, United States), and transformed in

Escherichia coli Top10F’. The bacteria were

incubated at 37 °C for 24h on Luria-Bertani

medium (Merck, KGaA, Darmstadt, Germa-

ny) containing 24mg/ml IPTG (isopropyl-beta-

D-thiogalactopyranoside) (Fermentas, Ontario,

Canada), 20mg/ml X-gal (5-bromo-4-chloro-

3-indolyl beta d-galactoside) (Fermentas, On-

tario, Canada), 10mg/ml tetracycline (Razak,

Alborz, Iran) and 50mg/ml ampicillin (Cosar,

Tehran, Iran). The recombinant bacteria were

identified by blue/white screening, with the

while colonies representing recombinant ones.

One white colony was added to Luria-Bertani

broth medium containing 10mg/ml tetracy-

cline and 50mg/ml ampicillin followed by in-

cubation at 37 °C for 16h while shaking at

180 RPM. Plasmid purification was performed

by the AccuPrep Plasmid Mini Extraction kit

(Bioneer, Daejeon, South Korea) and the pres-

ence of the glpQ gene in the recombinant plas-

mids was confirmed by PCR amplification with

the primers glpQ-F3 and glpQ-B3. The recom-

binant plasmid was named pTZ57R/T-glpQ.

Sensitivity assay

A serial 10-fold dilution of the recombi-

nant plasmid ranging from 9×108 to 9×10-1

copy numbers per microliter, equivalent to

≈32ng to ≈32×104 fg/µl of DNA was prepared

and used in assays.

Specificity assay

For specificity assays, we used DNA of 14

other bacteria including Shigella sonnei ATCC

9290, Klebsiella pneumoniae ATCC 7881, Ba-

cillus subtilis ATCC 6051, Staphylococcus

aureus ATCC 25923, Enterococcus faecalis

ATCC 29212, Enteropathogenic Escherichia

coli (EPEC) ATCC 43887, Yersinia entero-

colitica ATCC 23715, Pseudomonas aerugino-

sa ATCC 27853, clinical specimens of Esche-

richia coli, Salmonella typhi, Acinetobacter

baumannii, Citrobacter sp, Enterobacter sp,

and Leptospira interrogans in all assays. All

the bacteria, including L. interrogans, the close-

ly related bacteria to Borrelia species con-

tained glpQ sequence.

Loop Mediated Isothermal Amplification

(LAMP) assay

The LAMP reactions contained 40pM of

the inner (glpQ-FIP and glpQ-BIP) and 10pM

of outer (glpQ-F3 and glpQ-B3) and loop pri-

mers (glpQ-LF and glpQ-LB) (Table 1), 11.2

mM dNTPs (Kawsar Biotech Co, Tehran, Iran),

0.8M betaine (Sigma Aldrich, Taufkirchen,

Germany), 20mM Tris-HCl, 10mM KCl, 10mM

(NH2)SO4, 0.05% Triton X-100 (pH 8.8) (Bi-

olabs, New England, UK), 8mM MgSo4 (Bi-

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

obasic, Toronto, Canada), 0.1% Tween 20

(Acros Organics, Vernon, USA), 8U of Bst

DNA polymerase, large fragment (Biolabs,

New England, UK), 1μl of serial dilutions of

the recombinant plasmid, and DDW to the 25

μl final volume. The reactions were incubated

at temperatures ranging from 60–65 °C for

60min in a Loopamp real-time turbidimeter

(LA-320C; Teramecs, Kyoto, Japan), followed

by heating at 80 °C for 5min for enzyme in-

activation. In all assays, DNAs from 14 other

bacteria were included and DDW was used as

a negative control.

During the optimization of the assay, some

amplifications were performed without the

loop primers. Also, in some reactions, we added

1μl of Fluorescent detection reagent contain-

ing Calcein (Eiken Chemical co., Tokyo, Ja-

pan), an indicator of DNA amplification.

Detection of LAMP products

The amplification in LAMP reactions was

examined by 1) naked eye observation of white

turbidity resulting from the accumulation of

magnesium pyrophosphate, a by-product of

the reactions, 2) a Loopamp real-time turbi-

dimeter that records the optical density of re-

actions every 6sec at 650nm (the reactions were

considered positive when the turbidity reached

≥ 0.1 within 60min), 3) the color change from

orange to green, as an indication of DNA am-

plification, and 4) gel electrophoresis of am-

plicons on 2% agarose gels.

A LAMP product resulting from the 9×108

dilution was purified using PCR Purification

Kit (Bioneer, Daejeon, Korea) and sequenced

in both directions by (ABI 3730xl/Bioneer

3730xl, Daejeon, Republic of Korea).

Preparation of DBSs from Borrelia-infected

mice

Amounts of 200µl blood from B. microti-

infected mice with various degrees of the spi-

rochetemia (225±61.34, 71±36.71, 3.3±1.63,

1.1±1.44, and 0.8±0.78 spirochetes per micro-

scopic field) were dotted on 30 DNA banking

cards (DBC) (Kawsar Biotech Co, Tehran, Iran).

Blood from non-infected mice was used as

controls on DBCs. The blood spots were al-

lowed to dry at room temperature, and the DBCs

were kept in the same condition until used.

Loop Mediated Isothermal Amplification

(LAMP) and PCR with DBS

Circles of 2mm from DBSs were cut and

washed three times with DNA extraction buff-

er (provided by the manufacturer), followed

by DDW. The circles were allowed to dry at

room temperature and then used in LAMP and

PCR assays as described above except that

instead of template DNA, DBS circles were in-

cluded in the reactions.

The sensitivity and specificity of the LAMP

assay were calculated in comparison with mi-

croscopy as the gold standard assay using Med-

Calc (2018 MedCalc Software bvba) software

available online

(https://www.medcalc.org/calc/diagnostic_tes

t.php).

Loop Mediated Isothermal Amplification

(LAMP) and nested-PCR amplification of

clinical specimens

DNA was extracted from 39 sera of febrile

patients residing in the relapsing fever en-

demic areas in the south and west of Iran us-

ing a commercial DNA extraction kit as de-

scribed above. The DNA samples were exam-

ined by the LAMP, and a Borrelia-specific

nested PCR that amplifies the rrs-rrl-IGS re-

gion using the outer primers F, 5´-GTATG

TTTAGTGAGGGGGGTG-3´ and R, 5´-GG

ATCATAGCTCAGGTGGTTAG-3 ́ and inner

nested primers F, 5´-AGGGGGGTGAAGTC

GTAACAAG-3 ́and R, 5 -́GTCTGATAAACC

TGAGGTCGGA-3´ (18). This PCR has exhib-

ited high sensitivity in detecting relapsing fe-

ver borreliae (3, 8, 19, 20). In all assays, for spec-

ificity test, DNAs from other bacteria species

were included and DDW was used as a negative

control. The LAMP reactions were checked for

DNA amplification as described above, and the

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

PCR products were resolved on 2% agarose

gels, visualized under UV and photographed.

Results

Glycerophosphodiester Phosphodiesterase

Gene (glpQ ) cloning

Amplification of the glpQ sequence from the

recombinant plasmid (pTZ57R/T-glpQ) with the

primers glpQ-F3 and glpQ-B3yielded the ex-

pected 219bp indicating the insertion of this

sequence in the plasmid.

Loop Mediated Isothermal Amplification

(LAMP) assay with recombinant pTZ57R/

T-glpQ

We observed amplification of glpQ sequence

in the LAMP reactions by naked eye observa-

tion of turbidity and the Loopamp real-time tur-

bidimeter down to 9×103 copies of recombi-

nant plasmid equivalent to 0.32fg DNA (Fig.

2A). However, gel electrophoresis revealed am-

plifications in two lower dilutions of 9×102 and

9×101, equivalent to 3.2fg and 0.32fg DNA,

respectively (Fig. 2B). Our LAMP assay was

100% specific as the primers reacted with none

of the other 14 bacterial DNA, including L. in-

trogans. In the reactions containing calcein and

the Borrelia DNA, the color turned from or-

ange to green.

The 137bp sequence resulted following the

sequencing of the LAMP amplicon matched

with the glpQ sequence of B. microti strain IR-1

(acc. No. JF825473) corresponding to nucleo-

tides 261158–261295 of the whole genome

sequence of B. duttonii Ly (acc. No. CP000796).

The results were the same within the tempera-

ture range of 60–65 °C. In the reactions, in ab-

scence of loop primers, the optimum time for

isothermal amplification was 60min, whereas,

in those with the loop primers, the incubation

time reduced to 45min.

Loop Mediated Isothermal Amplification

(LAMP) and PCR with DBSs

Of the 30 B. microti-positive DBS, all (100%)

showed turbidity with the naked eye indicating

amplification, while the glpQ-PCR (with the

primers glpQ-F3 and glpQ-B3) yielded the ex-

pected 219bp band in 20 positive DBSs (66.67

%). The negative PCR reactions belonged to

the mice with the lowest level of spirochetemia

[1.1±1.44 (n= 4) and 0.8±0.78 (n= 6) spiro-

chete per microscopic field]. Neither LAMP

nor PCR amplification was observed with the

negative controls (DDW) or reactions contain-

ing other bacteria DNA as the template.

By considering microscopy as the gold stand-

ard, the sensitivity of glpQ-LAMP and glpQ-

PCR were 100% and 66.67%, respectively. The

specificity was 100% for both assays.

Loop Mediated Isothermal Amplification

(LAMP) and PCR with clinical samples

Of 39 clinical samples, 11 became turbid in

the LAMP assay indicating amplification of

glpQ gene, whereas PCR amplification of IGS

sequence only yielded the expected 540bp band

in three specimens (Fig. 3).

Table 1. The primers designed and used for amplification of glpQ gene by LAMP assay

Primers Name Sequences (5' to 3')

glpQ-F3 Forward outer primer AATGCACGATCCTGAACT

glpQ-B3 Backward outer primer TCTTCTTCTAGGGTTGGAATT

glpQ-FIP Forward inner primer TGCTAATGTGAAATCGACGGAATAA-

CAACAACAAATGTTGCAAAGC

glpQ-BIP Backward inner primer AATCACTAAGCCTTAGCGAAAGAT-

TGTTGCAGGAAAACGGTTA

glpQ-LF Forward loop primer TCTCTAGCTCTTCCTGGAAACA

glpQ-LB Backward loop primer CCTGAAACACAACAACCAATATACC

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

Fig. 1. The regions of the glpQ from which the primers designed for LAMP assay. Forward outer primer, glpQ-F3;
backward outer primer, glpQ-B3; forward inner primer, glpQ-FIP (F2)+glpQ-FIP (FIc); backward inner primer, glpQ-

BIP (B2)+glpQ-BIP (BIc); forward loop primer, glpQ-LF; backward loop primer, glpQ-LB

Fig. 2. The sensitivity of the Loop Mediated Isother-
mal Amplification (LAMP) assay measured by a 10-

fold serial dilution of a recombinant plasmid

pTZ57R/T-glpQ plasmid ranging from 9×109 to 9×10-

1/µl. A) The amplification curves generated by the

Loopamp real-time turbidimeter, colored lines 1–7,

serial dilutions 9×109, 9×108, 9×107, 9×106, 9×105,

9×104 and 9×103; line 8, serial dilutions ≤ 9×102. B)

the LAMP products resolved on agarose gel, lane M,

50bp DNA ladder, lane 1, dilution 9×109; lane 2, dilu-

tion 9×108; lane 3, dilution 9×107; lane 4, dilution
9×106; lane 5, dilution 9×105; lane 6, dilution 9×104;

lane 7, dilution 9×103; lane 8, dilution 9×102; lane 9,

dilution 9×101; lane 10, dilution 9×100; lane 11, dilu-

tion 9×10-1; lane 12, negative control

Fig. 3. Gel electrophoresis of PCR amplification of the
rrs-rrl-IGS region. Lane M, 5bp DNA ladder; lanes 1–

6, human blood samples (a 540bp in lanes 4 and 5 indi-

cates amplification of Borrelia DNA); lane 7, negative

control (DDW)

Discussion

In Iran, blood analysis of relapsing fever

patients by examination of wet smears using

dark-field microscopy or Giemsa-stained blood

slides has been a common practice for years.

This approach was efficient in endemic areas,

where the disease commonly appeared in clus-

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

ters (5), and overlooking the spirochetes in the

blood of some febrile patients did not ques-

tion the identity of the causative agent. How-

ever, with the decline of the disease in the en-

demic regions and reports of sporadic cases from

other areas application of more sensitive ap-

proaches for the identification RFB became

necessary. In Iran, over the past decade, PCR

assays by based on various molecular mark-

ers, such as glpQ, rrs, and flaB, were devel-

oped for the identification of Borrelia infec-

tion in Ornithodoros ticks (21, 22) or charac-

terization of the tick-originated relapsing fe-

ver borreliae (9, 23), but rarely clinical sam-

ples were included. Lately, qPCR and con-

ventional PCRs identified a B. microti-like strain,

presumably, an ecotype of African B. duttonii,

in relapsing fever patients from southern Iran

(3, 8).

In our previous work, using B. persica-spiked

blood samples, we consistently observed bacte-

ria by microscopy in the blood samples with

densities ≥ 800–1000 spirochetes/µl (24). Here-

in, with the DBSs prepared with the spiro-

chetemic murine blood, the LAMP could de-

tect borrelial DNA in blood specimens show-

ing less than one spirochetes per 1000X mi-

croscopic field. Our LAMP assay also showed

a higher sensitivity in comparison with a nest-

ed-PCR amplification of the IGS in the diag-

nosis of clinical samples. The specificity of

the LAMP assay for the diagnosis of B. microti

DNA was 100% as the designed primers exhib-

ited no cross-reaction with DNA from the oth-

er 14 bacteria used in this study. Our LAMP

method requires to be further tested with blood

samples from RF patients infected with other

Borrelia species to ensure the sensitivity and

specificity of the assay.

LAMP method has also shown promise for

the detection of borreliae DNA and other path-

ogens in the tick vectors. In China, the LAMP

could detect B. burgdorferi s. l. in ticks, with

a higher sensitivity than a conventional PCR

(25). Also, in recognizing spotted fever group

rickettsia, the LAMP appeared ten times more

sensitive than an end-point PCR targeting the

same gene fragment (26).

Conclusion

Such a reliable sensitivity and specificity,

as well as the simplicity of the DNA extrac-

tion procedure, make the LAMP a suitable and

adaptable assay for field studies in relapsing

fever endemic areas. In resource-limited rural

health centers, LAMP can readily check field-

collected blood samples, preferably on DBS,

for relapsing fever borreliae with the least

equipment accessible, i.e., a heat block. Hav-

ing access to a Loopamp real-time turbidim-

eter is preferable. However, LAMP is a qual-

itative assay, and the result can also be moni-

tored by color change with calcein in the fluo-

rescent detection reagent or by the turbidity of

magnesium pyrophosphate in the reaction

tubes. Hence, a heating system that provides a

temperature within the range of 60–65 °C would

suffice.

Acknowledgements

We thank the Tasnim Biotechnology of

Research Center (TBRC), AJA University of

Medical Sciences, for their technical support.

The authors declare that there is no conflict of

interest.

References

1. Talagrand-Reboul E, Boyer PH, Bergstrom

S, Vial L, Boulanger N (2018) Relaps-

ing Fevers: Neglected Tick-Borne Dis-

eases. Front Cell Infect Microbiol. 8: 98.

2. Cutler SJ (2015) Relapsing Fever Borreli-

ae: A Global Review. Clin Lab Med. 35

(4): 847–865.

3. Naddaf SR, Ghazinezhad B, Sedaghat MM,

Asl HM, Cutler SJ (2015) Tickborne re-

http://jad.tums.ac.ir/

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

lapsing fever in southern Iran, 2011–2013.

Emerg Infect Dis. 21(6): 1078–1080.

4. Masoumi Asl H, Goya MM, Vatandoost H,

Zahraei SM, Mafi M, Asmar M, Piazak

N, Aghighi Z (2009) The epidemiology

of tick-borne relapsing fever in Iran dur-

ing 1997–2006. Travel Med Infect Dis.

7(3): 160–164.

5. Karimi U (1981) Relapsing Fever and its

Epidemiology. Pasteur Institute of Iran

Press, Tehran (In Persian).

6. Karimi Y, Hovind-Hougen K, Birch-Ander-

sen A, Asmar M (1979) Borrelia persica

and B. baltazardi sp. nov.: experimental

pathogenicity for some animals and com-

parison of the ultrastructure. Ann Micro-

biol (Paris). 130B(2): 157–168.
7. Karimi Y, Hannoun C, Ardouin P, Ameli

M (1976) Sur le purpura he'morragique

observe 'dans l'Azerbaidjan-Est de l'Iran.

Me'd Mal Infec. 6: 399–404.

8. Naddaf SR, Ghazinezhad B, Kazemirad E,

Cutler SJ (2017) Relapsing fever causa-

tive agent in Southern Iran is a closely

related species to East African borreliae.

Ticks Tick-Borne Dis. 8(6): 882–886.

9. Naddaf SR, Ghazinezhad B, Bahramali G,

Cutler SJ (2012) Phylogenetic analysis

of the spirochete Borrelia microti, a

potential agent of relapsing fever in Iran.

J Clin Microbiol. 50(9): 2873–2876.

10. Shirani D, Rakhshanpoor A, Cutler SJ

Ghazinezhad B, Naddaf SR (2016) A

case of canine borreliosis in Iran caused

by Borrelia persica. Ticks Tick Borne

Dis. 7(3): 424–426.

11. Han F, Ge B (2010) Quantitative detection

of Vibrio vulnificus in raw oysters by

real-time loop-mediated isothermal am-

plification. Int J Food Microbiol. 142

(1): 60–66.

12. McKenna JP, Fairley DJ, Shields MD, Cosby

SL, Wyatt DE, McCaughey C, Coyle PV

(2011) Development and clinical valida-

tion of a loop-mediated isothermal am-

plification method for the rapid detection

of Neisseria meningitidis. Diagn Micro-

biol Infect Dis. 69(2): 137–144.

13. Notomi T, Okayama H, Masubuchi H,

Yonekawa T, Watanabe K, Amino N,

Hase T (2000) Loop-mediated isother-

mal amplification of DNA. Nucleic Acids

Res. 28(12): e63.

14. Mansour SM, Ali H, Chase CC, Cepica A

(2015) Loop-mediated isothermal ampli-

fication for diagnosis of 18 World Or-

ganization for Animal Health (OIE) no-

tifiable viral diseases of ruminants, swine

and poultry. Anim Health Res Rev. 16(2):

89–106.

15. Caipang CMA, Haraguchi I, Ohira T, Hi-

rono I, Aoki T (2004) Rapid detection

of a fish iridovirus using loop-mediated

isothermal amplification (LAMP). J Virol

Methods. 121(2): 155–161.

16. Mori Y, Notomi T (2009) Loop-mediated

isothermal amplification (LAMP): a rapid,

accurate, and cost-effective diagnostic

method for infectious diseases. J Infect

Chemother. 15(2): 62–69.

17. Schwan TG, Schrumpf ME, Hinnebusch BJ,

Anderson DE, Jr, Konkel ME (1996)

GlpQ: an antigen for serological dis-

crimination between relapsing fever and

Lyme borreliosis. J Clin Microbiol. 34

(10): 2483–2492.

18. Bunikis J, Garpmo U, Tsao J, Berglund

J, Fish D, Barbour AG (2004) Sequence

typing reveals extensive strain diversity

of the Lyme borreliosis agents Borrelia

burgdorferi in North America and Bor-

relia afzelii in Europe. Microbiology.

150(Pt 6): 1741–1755.

19 . Scott JC, Wright DJM, Cutler JC (2005)

Typing African relapsing fever spiro-

chetes. Emerg Infect Dis. 11(11): 1722–

1729.

20. Cutler SJ, Bonilla EM, Singh RJ (2010)

Population structure of East African re-

lapsing fever Borrelia spp. Emerg Infect

http://jad.tums.ac.ir/
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC102748/
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC102748/
https://www.ncbi.nlm.nih.gov/pubmed/?term=Bunikis%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15184561
https://www.ncbi.nlm.nih.gov/pubmed/?term=Garpmo%20U%5BAuthor%5D&cauthor=true&cauthor_uid=15184561
https://www.ncbi.nlm.nih.gov/pubmed/?term=Tsao%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15184561
https://www.ncbi.nlm.nih.gov/pubmed/?term=Berglund%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15184561
https://www.ncbi.nlm.nih.gov/pubmed/?term=Berglund%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15184561
https://www.ncbi.nlm.nih.gov/pubmed/?term=Fish%20D%5BAuthor%5D&cauthor=true&cauthor_uid=15184561
https://www.ncbi.nlm.nih.gov/pubmed/?term=Barbour%20AG%5BAuthor%5D&cauthor=true&cauthor_uid=15184561

J Arthropod-Borne Dis, March 2020, 14(1): 47–55 F Houmansadr et al.: Development of …

http://jad.tums.ac.ir

Published Online: March 31, 2020

Dis. 16(7): 1076–1080.

21. Rafinejad J, Choubdar N, Oshaghi M, Piazak

N, Satvat T, Mohtarami F, Barmaki A

(2011) Detection of Borrelia persica In-

fection in Ornithodoros tholozani Using

PCR Targeting rrs Gene and Xenodiag-

nosis. Iran J Public Health. 40(4): 138–

145.

22. Barmaki A, Rafinejad J, Vatandoost H,

Telmadarraiy Z, Mohtarami F, Leghaei

Sh, Oshaghi M (2010) Study on Pres-

ence of Borrelia persica in Soft Ticks in

Western Iran. Iran J Arthropod Borne

Dis. 4 (2): 19–25.

23. Oshaghi MA, Rafinejad J, Choubdar N,

Piazak N, Vatandoost H, Telmadarraiy

Z, Mohtarami F, Ravasan NM (2011)

Discrimination of relapsing fever Borre-

lia persica and Borrelia microtti by di-

agnostic species-specific primers and pol-

ymerase chain reaction-restriction frag-

ment length polymorphism. Vector Borne

Zoonotic Dis. 11 (3): 201–207.

24. Naddaf SR, Kishdehi M, Siavashi M (2011)

Comparison of PCR-Based Diagnosis with

Centrifuged-Based Enrichment Method

for Detection of Borrelia persica in An-

imal Blood Samples. Iran J Arthropod

Borne Dis. 5(1): 7–12.

25. Yang J, Guan G, Niu Q, Liu Z, Li Y, Liu

J, Ma M, Ren Q, Liu A, Yin H (2013)

Development and application of a loop-

mediated isothermal amplification assay

for rapid detection of Borrelia burgdor-

feri s. l. in ticks. Transbound Emerg Dis.

60(3): 238–244.

26. Noden BH, Martin J, Carrillo Y, Talley JL,

Ochoa-Corona FM (2018) Development

of a loop-mediated isothermal amplifi-

cation (LAMP) assay for rapid screen-

ing of ticks and fleas for spotted fever

group rickettsia. PLoS One. 13(2):

e0192331.

http://jad.tums.ac.ir/
https://www.ncbi.nlm.nih.gov/pubmed/?term=Barmaki%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Rafinejad%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Vatandoost%20H%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Vatandoost%20H%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Telmadarraiy%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Mohtarami%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Leghaei%20Sh%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Leghaei%20Sh%5BAuthor%5D&cauthor=true&cauthor_uid=22808396
https://www.ncbi.nlm.nih.gov/pubmed/?term=Oshaghi%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22808396