J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

204

Original Article
Pfcrt Gene in Plasmodium falciparum Field Isolates from Muzaffargarh,

Pakistan

*Sumrin Sahar 1, Akhtar Tanveer 1, Akbar Ali 2, Hazrat Bilal 3, Rana Muhammad Saleem 3

1Lab of Parasitology, Zoology Department, University of the Punjab, Lahore, Pakistan
2Department of Basic Health Sciences, Faculty of Pharmacy, Northern Border University, Rafha, Saudi

Arabia
3Medical Entomology and Disease Vector Control, Health Services Academy, Lahore, Pakistan

(Received 21 Dec 2014; accepted 22 June 2014)

Abstract
Background: The aim of the study was to identify the prevalence of different species of Plasmodium and haplotypes
of pfcrt in Plasmodium falciparum from the selected area.
Methods: Overall, 10,372 blood films of suspected malarial patients were examined microscopically from rural
health center Sinawan, district Muzaffargarh, Pakistan from November 2008 to November 2010. P. falciparum posi-
tive samples (both whole blood and FTA blood spotted cards) were used for DNA extraction. Nested PCR was used
to amplify the pfcrt (codon 72–76) gene fragment. Sequencing was carried out to find the haplotypes in the amplified
fragment of pfcrt gene.
Result: Over all slide positivity rate (SPR), P. vivax and P. falciparum positivity rate was 21.40 %, 19.37 % and
2.03% respectively. FTA blood spotted cards were equally efficient in the blood storage for PCR and sequencing.
Analysis of sequencing results of pfcrt showed only one type of haplotype SagtVMNT (AGTGTAATGAATACA)
from codon 72–76 in all samples.
Conclusion: The results show high prevalence of CQ resistance and AQ resistant genes. AQ is not recommended to
be used as a partner drug in ACT in this locality, so as to ward off future catastrophes.

Keywords: Malaria, pfcrt, Resistance, Pakistan

Introduction

Globally 106 countries from tropical and
subtropical are endemic for malaria (WHO
2010). These are in tropical or subtropical
zones with are suitable breading places far
anopheline mosquito. The regions included
in this area are Asia, Africa, Islands of South,
West and Central Pacific Ocean, Latin Amer-
ica, Turkey and certain Caribbean Islands
(Lamar et al. 2007). In the areas of malaria
transmission, epidemics of malaria have been
leading cause of high morbidity and mortal-
ity. Complex epidemics of malaria have been
observed in Kenya (May 1999–August 1999,
Burundi (September 2000–May 2001), South
Sudan (June 2003–November 2003), in two
areas of Ethiopia (July 2003–February 2004)

and India (January 2005–March 2005)
(Checchi et al. 2006, Kumari 2009).

In 3rd world countries including Pakistan,
malaria has always been major public health
problem and it accounts for more than 95%
of regional burden (Huda and Zamani 2009).
The main reason of malariogenic potential in
Pakistan is extensive agricultural practices,
vast irrigation network, monsoon rains and
poverty (WHO 2005). Annually, about
500000 episodes of malaria infection occur
(Yasinzai and Kakharsulemankhel 2008) in
rural areas, were associated with more peo-
ple live below poverty line (38.65%) than
urban areas (22.39%).

The main-stay in the control of malaria is

*Corresponding author: Dr Sumrin Sahar,
E-mail: sumrinsahar@yahoo.com

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

205

the increasing frequency of drug resistant
parasites especially P. falciparum (Gama et
al. 2010).

First reports of resistance against CQ came
from South America (Moore and Lanier 1961),
South East Asia (Harinausta et al. 1965).
Later, it reached to Africa. Across the world,
CQR strain of P. falciparum originated from
at least six locations independently: in Java,
Philippines, Papua New Guinea, South East
Asia and two locations in South America
(Wootton et al. 2002, Chen et al. 2003). In
Pakistan, the resistance of P. falciparum to
CQ was first detected in 1981 from
Sheikhupura and National Institute of Malaria
Research and Training (NIMRT) revealed that
R1 level of CQ resistance was widespread in
Pakistan (frequency ranging from 30–84%)
(Shah et al. 1997). Chloroquine was used as
a first line treatment in Pakistan from 1950–
2007 (Asif 2008). In the district Muzaffargarh,
response of P. falciparum to chloroquine was
found out during the time period of 2003–
2005. RI was 29.36 %, and RII was 29.41 %
(Rana 2009).

In 1990s, chloroquine resistant P. falcipa-
rum spread widely in Pakistan (Rab et al.
2001). Factors involved in the spread of drug
resistance are drug use practices, drug half
life, transmission intensity, clone multiplic-
ity, parasite density, host immunity and ge-
netic basis of drug resistance (Hasting and
Watking 2006, Pongtavornpinyo et al. 2008).
Resistance against many antimalarials has
arisen in the same geographic areas. These
areas have low transmission rate, low im-
munity level and higher parasites biomass
(White and Pongtavornpinyo 2003). Use of
substandard medicines can also be involved
in the emergence of drug resistance (Leslie
et al. 2009).

With the advancement in molecular biol-
ogy and isolation of CQ resistance clone
(Dd2) helped in identification of molecular
markers in P. falciparum associated with drug
resistance (Jiang et al. 2008). In 1990, Thomas

Wellem along with his team performed a
cross between HB3, a chloroquine sensitive
(CQS) and Dd2, a chloroquine resistant
(CQR) strain (Wellem et al. 1990). It was
found that the main determinant of CQ
resistance is a locus on chromosome 7 of P.
falciparum (Wellem et al. 1991). It was fur-
ther noted that it is a 38 Kb fragment (10
genes) (Su et al. 1997). Fidock et al. (2000)
reported that a highly polymorphic 3.1 Kb
gene (composed of 13 exons) is involved in
resistance. Martin and Kirk (2004) reported
that it is a 48.6 kDa protein of 424 amino
acids long. It forms 10 transmembrane do-
mains. The protein is located on digestive
vacuole and it has transporter-like proper-
ties.  It was called P. falciparum chloroquine
resistant transport gene (pfcrt) and consid-
ered as a member of drug metabolite trans-
porter super family (Tran and Saier 2004). In
the past, SVMNT (ser-val-meth-asn-thr) al-
lele carrying parasites had been reported
twice, in 1996–1997 from Africa and in
2004 from Tanzania (Alifrangis et al. 2006).
Three common haplotypes of pfcrt are
CVMNK (CQS, present in all geographic
regions), CVIET (CQR found in Africa and
South East Asia), SVMNT (CQR, SagtVMNT
is present in some countries of Asia and Stct
VMNT is found in South America) (Wootton
et al. 2002, Ursing et al. 2006). The high
level of resistance to AQ metabolite
desethylamodiaquine (DEAQ) is found to be
associated with the presence of pfcrt codon
72–76 haplotype SVMNT. It replaces CVMNK
found in CQS strain (Wootton et al. 2002,
Warhurst et al. 2003, Sa et al. 2009, Beshir
et al. 2010). In oocyte system, competition
of drugs with CQ was checked by mutated
pfcrt. Drug quinine and AQ at normal con-
centration and mefloquine and primaquine at
higher concentration were able to compete
with CQ for transport by mutated pfcrt while
piperaquine and artemisinin did not interact
with pfcrt (Martin et al. 2009).

Keeping in view the situation of malaria,

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

206

this study was designed to identify the
chloroquine resistant genes of P. falciparum
which convert a chloroquine sensitive para-
site (CQS) to chloroquine resistant (CQR)
type parasite.

Materials and Methods

Selection of Area for Sampling
Muzaffargarh is located at latitude 30.06˚

longitudes 71.02˚, between the two rivers,
Chenab in the East and Indus in the West.
For present study, the area of Muzaffargarh
was selected on the basis of high endemicity.
Data obtained by the curtsy of Directorate
General Health Punjab, Pakistan (through per-
sonal communication) reported “1388 labor-
atory confirmed cases” in Punjab were with
15 % in district Muzaffargarh in 2006. In
2007, total number of positive malarial cases
was 1903, again highest positive cases
(7.5%) were observed in Muzaffargarh.

Sample Collection
Blood samples were collected from indi-

viduals presented with fever, persistent head-
ache and malaria like symptoms. Patient’s
consent was obtained prior to sampling, fin-
ger prick blood was used for slide prepara-
tion. Thick and thin blood smears were pre-
pared and stained by Giemsa stain (3%
solution in 7.2 pH phosphate buffer) (WHO
1991). Two ml blood of P. falciparum pos-
itive patients was collected in EDTA
vacutainers and spotted on Flinders Technical
Associates (FTA) classic cards (Whatman)
by micropipette according to manufacturer’s
instruction. Vacutainers were stored at 4 ˚C
and cards were stored at room temperature
till use for DNA extraction. Sampling was
done at Rural Health Centers Muzaffargarh
from November, 2008 to November, 2010
(25 months) as shown in Fig. 1.

DNA Extraction
For amplification of pfcrt gene, DNA was

eluted both from FTA cards and whole
blood. P. falciparum positive samples (by
microscopic review and RDTs method).
FTA Cards contain chemicals that lyses
(removes) blood cells, denature proteins and
protect nucleic acids from nucleases, oxidation
and UV damage. Captured nucleic acid is
ready for downstream applications in less
than 30 min and is stable for years at room
temperature. DNA was eluted according to
manufacturer’s instructions (Whatman). While
from whole blood, 200 μl of sample was
used for DNA extraction with the QIA amp
midi kit, as described by the manufacturer
(Qiagen). Extracted DNA was analyzed by
using 1 % agarose gel.

Amplification of pfcrt Gene Fragment
Two-step nested PCR was done to am-

plify pfcrt gene fragment of 145 base pairs.
Primers were designed, using DNA sequence
of P. falciparum chloroquine resistant strain
Dd2/Indochina  (by Pub Med accession number
AF030694). The sequences of primers used
in round 1 and round 2 are given in Table1.

Preparation of PCR Reaction Mix for
Round 1 (pfcrt)

The PCR mixture contained 1X PCR
buffer (Promega), 2.0 mM MgCl2 (Promega),
0.2 mM dNTPs, 0.25 µM each primer, 1.25
units, 0.5 units Taq polymerase (Promega)
and 5 µ l template DNA. The total reaction
volume was 50 µ l.

Cycling conditions for PCR were: one
cycle of 95 ˚C for 5 minutes followed by 30
cycles of 95 ˚C for 10 seconds, 57 ˚C for 30
seconds and 72 ˚C for 30 seconds, followed
by a final extension at 72 ˚C for 10 minutes.

PCR Reaction Mix Preparation for Round
2 (pfcrt)

The PCR mixture contained 1X PCR buffer
(Promega), 2.0mM MgCl2 (Promega), 0.2 mM
dNTPs, 0.25 µ M each primer, 0.5 units Taq
polymerase (Promega) and 5 µltemplate DNA.

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

207

The total reaction volume was 50 µ l.
Cycling conditions for PCR were: one

cycle of 95 ˚C for 5 minutes followed by 35
cycles of 95 ˚C for 30 seconds, 48 ˚C for 30
seconds and 65 ˚C for 30 seconds, followed
by a final extension at 65 ˚C for 3 minutes.

Amplified PCR products of each gene
fragment were electrophoresed using 3 %
agarose gel and visualized on UV. PCR
products were cleaned using Exonuclease I
(BioLabs Inc) and sequenced in both direc-
tions using Big Dye® Terminator system.

Statistical Analysis
Results of sequencing were analyzed by

the programme of Applied Bio-system (se-
quence scanner V, 0.1).

Results

Sampling was carried out in Muzaffargarh,
Pakistan from November 2008 to November
2010 (25 Months), in order to find out the
malaria frequency. During this period, 10372
blood films of suspected malarial patients
were prepared and examined. Their positiv-
ity rates for the infection of Plasmodium
(both falciparum and vivax), P. vivax and P.
falciparum were 2220, 2009 and 211 respec-
tively. In this duration, slide positivity rate
(SPR), P. vivax positivity rate % (VPR) and
P. falciparum positivity rate (FPR) were
21.40 %, 19.37 % and 2.03 % respectively.
The difference in P. vivax (90.49%) and P.
falciparum (9.51%) infection was found

highly significant (χ2= 1456, P< 0.001).

Extracted DNA
Samples positive for P. falciparum (211)

were used for DNA extraction. Genomic
DNA is shown in Fig. 2, 3.

Amplification of pfcrt (codon 72–76)
All the 211 P. falciparum positive sam-

ples were amplified using polymerase chain
reaction. Amplification was carried out of
the extracted DNA from whole blood and
from FTA blood spotted cards.

pfcrt (codon 72–76) Amplification (by us-
ing disc of blood spotted FTA cards)

Amplification by using the disc (2mm)
was also conducted by using punched disc
from FTA blood spotted cards. Product of
(145bp) was visible as show in Fig. 4.

Similar PCR results were obtained using
DNA extracted from whole blood and FTA
blood spotted cards which showed that FTA
cards were found equally efficient for stor-
age of blood for PCR reaction.

Sequencing Result
Sequencing results were analyzed by us-

ing Applied-Biosystem VI software. It showed
only one type of haplotype sequence Sagt
VMNT (AGTGTAATGAATACA) from codon
72–76 in all samples. No wild type CVMNT
or other drug resistant (mutant) haplotype was
found. Fig. 5 is depicting sequencing results
of pfcrt (codon 72–76) with forward primer.

Table 1. Primers used for amplification of pfcrt gene fragment of 145 base pairs

PCR
Round

Primer Primer Sequence (5/–3/) Tm

1st Round
Crtd- A (forward primer) 5/- GGTGGAGGTTCTTGTCTTGGTA -3/ 57.5 ˚C
Crtd- B (reverse primer) 5/- GACCTATGAAGGCCAAAATGACTG-3/ 56.7 ˚C

2nd Round
Crtd- C (forward primer) 5/- TGTGCTCATGTGTTTAAACTT -3/ 50.06 °C
Crtd –D (reverse primer) 5/- CAAAACTATAGTTACCAATTTT -3/ 46.10 °C

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

208

Fig. 1. Map of district Muzaffargarh showing RHCs

Fig. 2. Gel electrophoresis picture showing extracted
genomic DNA of falciparum positive malarial pa-
tients (Lane L shows 100bp ladder, lane 1–7 show
genomic DNA)

Fig. 3. Gel electrophoresis picture showing amplified
pfcrt gene fragment (145bp) (by using DNA extracted
from the whole blood). Lane 1 and 2 show negative

and positive controls respectively, lanes 3 to 12 show
patient samples, lane 13 shows 100bp DNA Marker

Fig. 4. Picture of gel electrophoresis showing ampli-
fied pfcrt gene fragment (145bp) (by using disc of

blood spotted card). Lane 1 and 2 show negative and
positive controls respectively, lanes 3 to 12 show pa-

tient samples, lane 13 shows 100bp DNA Marker

Fig. 5. Sequencing results of pfcrt (codon 72–76)

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

209

Discussion

Present findings showed that overall SPR
observed in Muzaffargarh, Pakistan was
21.40 %. According to the report of Ministry
of Health, (2006) malaria was the second
most prevalent disease in Pakistan (Murtaza
et al. 2009). Akin figures of SPR (19.7% and
19.40%) were reported from Punjab and
Khyber Pakhtunkhwa (Idris et al. 2007, Mo-
hammad et al. 2010), which were respectively
1.64 % and 2.00 % less than present study.
SPR reported from India has shown the per-
centages of 25.2 % and 24.54 % (Dhiman et
al. 2010, Panigahi et al. 2011), which were
3.80% and 3.14% higher than in current study.

Although malaria is rife worldwide but
the maximum numbers of devastations caused
by it are in Sub-Saharan Africa (WHO 2010).
In Africa 30.20 %, 27.07 % and 22.60 % SPR
was reported from Uganda, Ethiopia and
Tanzania (Jensen et al. 2009, Yohannes and
Haile 2010, Mubi et al. 2011) and these fig-
ures indicated an enhancement of 8.80 %,
5.67 % and 1.20 % respectively than the fig-
ures of the current study. These differences
may be due to geographical, climatic, eco-
nomic and cultural variations.

In the current study, P. vivax, was the
predominant specie of this region. The over-
all infection caused by P. vivax and P. falci-
parum was 90.49 % and 9.51 % respec-
tively, and the difference between the infec-
tion of P. vivax and P. falciparum was highly
significant (χ2= 1456, P< 0.001). Similar fig-
ures were collected from Muzaffarabad, Azad
Kashmir and Khyber Pakhtunkhwa, occur-
rence of P. vivax infection (90.40% 92.20%,
92.20%) was far more than that caused by P.
falciparum infection (9.6%, 7.8% and 7.8%)
(Jan and Kiani 2001, Jamal et al. 2005, Jalal-
ul-din and Ally 2006). Similarly higher
incidence of P. vivax infection (72.4%) than
P. falciparum infection (24.1%) was report-
ed from Baluchistan province (Idris et al.
2007). Some other figures from the same prov-

ince showed higher incidence of P. vivax in-
fection (58.9%, 51.8%, 88.6%, 72.3%) than
P. falciparum infection (41%, 48.1%, 11.3%,
27.6%) (Yasinzai and Kakarsulemankhel
2008). Infections caused by P. vivax were also
reported more than those of P. falciparum
from some areas of Sind (Mahmood et al.
2005, Atif et al. 2009). P. vivax infection
(11.70%, 75%) was less than P. falciparum
infection (88.29%, 85%) in some areas or
Indian (Dhiman et al. 2010, Panigrahi et al.
2011). Similarly, P. falciparum (90%, 70%,
90.7% 68.53%) was predominant specie in
some African regions (Pinto et al. 2000,
Yohannes and Haile 2010, Lemma et al. 2011).

Currently, parasites strains are exhibiting
resistance to all major classes of drug pre-
sent in the field and some of them have been
withdrawn from use because of their inef-
fectiveness. Unfortunately we are unaware
that where the next generation of antimalar-
ial will come from (Grimberg and Mehlotra
2011). Core objective of the study was the
scrutiny of mutant and wild types of pfcrt
(codon 72–76). pfcrt gene fragment of 145bp
was amplified in all positive P. falciparum
(211) samples. Results showed 100 % Sagt
VMNT (ser-val-meth-asn-thr). No StctVMNT
haplotype or wild type (CVMNK) was ob-
served. Origin of SagtVMNT had been hy-
pothesized from Mato Grasso, Brazil (Vieira
et al. 2004) and was reported from Guyana,
Peru, Suriname, Venezuela (Contreras et al.
2002, Cortese et al. 2002, Peek et al. 2005,
Mehlotra et al. 2008, Griffing et al. 2010).
Clinical resistance to chloroquine (CQ) and
amodiaquine (AQ) was found associated
with mutations in pfcrt gene (Picot et al.
2009, Beshir et al. 2010). Sa et al. (2009)
correlated high level resistance to AQ me-
tabolite desethylamodiaquine (DEAQ) in
tests (in vitro) with the presence of SVMNT
haplotype of pfcrt. Mehlotra et al. (2008),
Zakeri et al. (2008), and Beshir et al. (2010)

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

210

detected high prevalence of this haplotype in
the parasitic population of Brazil, Papua New
Guinea, Laos, Afghanistan and Iran. Esmaeili
et al. (2008) also reported very high preva-
lence of K76T mutation in an endemic dis-
trict of Iran. These results were also sup-
ported by the study carried out (in vitro) on
natural P. falciparum isolate, laboratory ref-
erence strain, parasites transfected with al-
lelic replacement and progeny of genetic
crosses (Sidu et al. 2002, Sa et al. 2009). In
the past, SVMNT (ser-val-meth-asn-thr) al-
lele carrying parasites had been reported
twice, in 1996–1997 from Africa and in 2004
from Tanzania (Alifrangis et al. 2006). Three
common haplotypes of pfcrt are CVMNK
(CQS, present in all geographic regions),
CVIET (CQR found in Africa and South
East Asia), SVMNT (CQR, Sagt VMNT is pre-
sent in some countries of Asia and Stct
VMNT is found in South America) (Wootton
et al. 2002, Ursing et al. 2006). In the area of
Muzaffargarh P. vivax was pre-dominant spe-
cie so CQ exposure was higher. It may be the
main reason of high prevalence of spreading
CQR parasite (having pfcrt “SVMNT”) in
this area. Similar findings were reported from
India, mutant pfcrt “SVMNT” haplotype
was endemic in those areas, where P. vivax
was dominant specie (Mallick et al. 2012).

Conclusion

Prior to everything else, appropriate diag-
nosis of Plasmodium and its species is high-
ly necessary. A treatment initiated without
proper diagnosis not only increases the prob-
abilities of drug resistance, but also invites
complications. Malaria controlling policies
should be decentralized: made and imple-
mented at province and district levels. Prop-
er understanding and careful evaluation of
local epidemiological pattern and the other
aspects of malaria can produce base-line data
in planning task for devising control strate-
gies. The drug resistance issue is likely to

pose long term challenges for us. Hybrid of
conventional and neo drugs can help to
conserve the efficiency of valuable anti ma-
larial medicines, but choosing the right com-
bination partners will continue to require the
study of presently known and emerging mech-
anism.

The results show high prevalence of CQ
resistance and AQ resistant genes. Excessive
presence of CQ and AQ resistant genes in
plasmodium population isolated from the
people of Muzaffargarh suggest establishing
the base line for monitoring of mutations.
This is evident now that in this area, CQ or
AQ will not be effective for the victims of P.
falciparum infection. AQ is not recommend-
ed to be used as a partner drug in ACT in
this locality, so as to ward off future ca-
tastrophes.

Acknowledgements

Financial assistance was provided by
University of the Punjab Research Commit-
tee 2010–2011 and Higher Education Com-
mission Pakistan (Pin# 074-0551-(BM-4-033)
is gratefully acknowledged. Thanks to Dr
Hanan El Mohammady Ismail Head, Immu-
nology Section Clinical Trials Research
Programme US Naval Medical Research
Unit #3 (NAMRU-3) Cairo, Egypt for valua-
ble suggestions to improve the manuscript.
This paper is produced from PhD project
conducted by the principle author. The au-
thors declare that there is no conflict of in-
terests.

References

Alifrangis M, Dalgaard MB, Lusingu JP,
Vestergaard LS, Staalsoe T, Jensen
ATR, Enevold A, Rønn AM, Khalil IF,
Warhurst DC (2006) Occurrence of the
Southeast Asian/ South American
SVMNT haplotype of the chloroquine-

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

211

resistance transporter gene in Plasmo-
dium falciparum in Tanzania. J Infect
Dis. 193(12): 1738–1741.

Asif SA (2008) Departmental audit of ma-
laria control programme 2001–2005
North West Frontier Province (NWFP). J
Ayub Med Coll Abbottabad. 20(1):
98–102.

Atif S, Farzana M, Naila S, Abdul F (2009)
Incidence and pattern of malarial in-
fection at a tertiary care Hospital of Hy-
derabad. World J Med Sci. 4(1): 9–12.

Beshir K, Sutherland CJ, Merinopoulos I,
Durrani N, Leslie T, Rowland M,
Hallett RL (2010) Amodiaquine re-
sistance in Plasmodium falciparum ma-
laria in Afghanistan is associated with
the Pfcrt SVMNT allele at codons 72
to 76. Antimicrob Agents Chemother.
54(9): 3714–3716.

Checchi F, Cox J, Balkan S, Tamrat A,
Priotto G, Alberti KP, Zurovac D,
Guthmann JP (2006) Malaria epidem-
ics and interventions, Kenya, Burundi,
southern Sudan, and Ethiopia, 1999–
2004. Emerg Infect Dis. 12: 1477–1485.

Chen N, Kyle DE, Pasay C, Fowler EV,
Baker J, Peters JM, Cheng Q (2003)
pfcrt allelic types with two novel ami-
no acid mutations in chloroquine-re-
sistant Plasmodium falciparum isolates
from the Philippines. Antimicrob Agents
Chemother. 47(11): 3500–3505.

Contreras CE, Cortese JF, Caraballo A,
Plowe CV (2002) Genetics of drug-re-
sistant Plasmodium falciparum malaria
in the Venezuelan state of Bolivar. Am
J Trop Med Hyg. 67(4): 400–405.

Cortese JF, Caraballo A, Contreras CE,
Plowe CV (2002) Origin and dissemi-
nation of Plasmodium falciparum drug-
resistance mutations in South America.
J Infect Dis. 186(7): 999–1006.

Dhiman RC, Chavan L, Pant M, Pahwa S
(2010) National and regional impacts
of climate change on malaria by 2030.

Curr Sci. 101(3): 372–383.
Fidock DA, Nomura T, Talley AK, Cooper

RA, Dzekunov SM, Ferdig MT, Ursos
L (2002) Mutations in the Plasmodium
falciparum digestive vacuole
transmembrane protein Pfcrt and evi-
dence for their role in chloroquine
resistance. Mol Cell. 6(4): 861–871.

Gama B, de Oliveira N, de Souza J, Santos
F, de Carvalho L, Melo Y, Rosenthal
P, Daniel-Ribeiro C, Ferreira-da-Cruz
M (2010) Brazilian Plasmodium
falciparum isolates: investigation of can-
didate polymorphisms for artemisinin
resistance before introduction of
artemisinin-based combination therapy.
Malar J. 9(1): 355–359.

Griffing S, Syphard L, Sridaran S, McCollum
AM, Mixson-Hayden T, Vinayak S,
Villegas L, Barnwell JW, Escalante AA,
Udhayakumar V (2010) pfmdr1 ampli-
fication and fixation of pfcrt chloroquine
resistance alleles in Plasmodium
falciparum in Venezuela. Antimicrob
Agents Chemother. 54(4): 1572–1579.

Grimberg BT, Mehlotra RK (2011) Ex-
panding the Antimalarial Drug Arsenal-
Now, But How? Pharmaceuticals. 4(5):
681–712.

Hastings IM, Watkins WM (2006) Tolerance
is the key to understanding antimalar-
ial drug resistance. Trends Parasitol.
22(2): 71–77.

Huda A, Zamani G (2009) The progress of
roll back malaria in Eastern Mediter-
ranean region over the past decade.
East Mediterr Health J. 14: 82–9.

Idris M, Sarwar J, Fareed J (2007) Pattern of
malaria infection diagnosed at Ayub
Teaching Hospital Abbottabad. J Ayub
Med Coll Abbottabad. 19(2): 35–36.

Jalal-ud-din SAK, Ally SH (2006) Malaria
in children: study of 160 cases at a pri-
vate clinic in Mansehra. J Ayub Med
Coll Abbottabad. 18(3): 44–45.

Jan A, Kiani T (2001) Haematozoan para-

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

212

sites in Kashmiri refugees. Pak J Med
Res. 40(1): 10–12.

Jensen T, Bukirwa H, Njama-Meya D, Fran-
cis D, Kamya M, Rosenthal P, Dorsey
G (2009) Use of the slide positivity
rate to estimate changes in malaria in-
cidence in a cohort of Ugandan chil-
dren. Malar J. 8(1): 213.

Kumari R, Joshi P, Lal S, Shah W (2009)
Management of malaria threat follow-
ing tsunami in Andaman and Nicobar
Islands, India and impact of altered
environment created by tsunami on
malaria situation of the islands. Acta
Trop. 112(2): 204–211.

Lamar J, Martschinske R, Tetreault G, Doud
C (2007) Navy Medical Department
Pocket Guide to Malaria Prevention
and Control. Technical Manual NEHC-
TM PM 6250.1

Lemma H, San-Sebastian M, Lofgren C,
Barnabas G (2011) Cost-effectiveness
of three malaria treatment strategies in
rural Tigray, Ethiopia where both
Plasmodium falciparum and P. vivax
co-dominate. Cost Eff Resour Alloc. 9:
2–10.

Leslie T, Kaur H, Mohammed N, Kolaczinski
K, Ord RL, Rowland M (2009) Epidemic
of Plasmodium falciparum malaria in-
volving substandard antimalarial drugs,
Pakistan, 2003. Emerging Infect Dis.
15(11): 1753–1759.

Mahmood K (2005) Malaria in Karachi and
other areas in Sindh. Pak Armed
Forces Med J. 55: 345–348.

Mallick P, Joshi H, Valecha N, Sharma S,
Eapen A, Bhatt R, Srivastava H,
Sutton P, Dash A, Bhasin V (2012)
Mutant pfcrt "SVMNT" haplotype and
wild type pfmdr1 "N86" are endemic
in Plasmodium vivax dominated areas
of India under high chloroquine
exposure. Malar J. 1(11): 16.

Martin RE, Kirk K (2004) The malaria
parasite's chloroquine resistance trans-

porter is a member of the drug/
metabolite transporter superfamily. Mol
Biol Evol. 21(10): 1938–1949.

Martin RE, Marchetti RV, Cowan AI,
Howitt SM, Bröer S, Kirk K (2009)
Chloroquine transport via the malaria
parasite’s chloroquine resistance
transporter. Sci. 325(5948): 1680–1682.

Mehlotra RK, Mattera G, Bockarie MJ,
Maguire JD, Baird JK, Sharma YD,
Alifrangis M, Dorsey G, Rosenthal PJ,
Fryauff DJ (2008) Discordant patterns
of genetic variation at two chloroquine
resistance loci in worldwide popu-
lations of the malaria parasite
Plasmodium falciparum. Antimicrob
Agents Chemother. 52(6): 2212–2222.

Moore DV, Lanier JE (1961) Observations
on two Plasmodium falciparum infec-
tions with an abnormal response to
chloroquine. Am J Trop Med Hyg.
10(1): 5–9.

Mubi M, Janson A, Warsame M, Martensson
A, Kallander K, Petzold MG, Ngasala
B, Maganga G, Gustafsson LL, Massele
A (2011) Malaria rapid testing by
community health workers is effective
and safe for targeting malaria treat-
ment: randomized cross-over trial in
Tanzania. Plos one. 6(7): e19753.

Muhammad W, Khan A, Faiz-ur-Rehman
Ali A, Irshad S (2010) Slide positivity
rate in clinically suspected malaria
cases. J Med Sci. 18(2): 101–103.

Murtaza G, Memon IA, Memon AR, Lal M,
Kallar NA (2009) Malaria morbidity in
Sindh and the Plasmodium species
distribution. Pak J Med Sci. 25(4):
646–649.

Panigrahi B, Kerketta A, Mohapatra A,
Hazra R, Parida S, Marai N, Kar S,
Mahapatra N (2011) Effect of con-
struction of an irrigation canal on ma-
laria situation in two primary health
centers of Dhenkanal district of Orissa,
India. Trop Biomed. 28(1): 76–84.

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

213

Peek R, Van Gool T, Panchoe D, Greve S,
Bus E, Resida L (2005) Drug resistance
and genetic diversity of Plasmodium
falciparum parasites from Suriname.
Am J Trop Med Hyg. 73(5): 833–838.

Peter BB (2001) Drug Resistance in Malaria.
WHO/CDS/CSR/DRS/2001.4, World
Health Organization.

Picot S, Olliaro P, De Monbrison F, Bienvenu
AL, Price RN, Ringwald P (2009) A
systematic review and meta-analysis of
evidence for correlation between mo-
lecular markers of parasite resistance
and treatment outcome in falciparum
malaria. Malar J. 8: 89.

Pinto J, Sousa C, Gil V, Goncalves L, Lopes
D, do Rosario V, Charlwood J (2000)
Mixed-species malaria infections in
the human population of Sao Tome
island, West Africa. Trans R Soc Trop
Med Hyg. 94(3): 256–257.

Pongtavornpinyo W, Yeung S, Hastings I,
Dondorp A, Day N, White N (2008)
Spread of anti-malarial drug resistance:
mathematical model with implications
for ACT drug policies. Malar J. 7(1):
229–240.

Prashant KM, Hema J, Neena V, Surya
KS, Alex E, Rajendra MB, Harish
CS, Patrick LS, Aditya PD, Virendra
KB (2012) Mutant pfcrt "SVMNT"
haplotype and wild type pfmdr1"N86"
are endemic in Plasmodium vivax
dominated areas of India under high
chloroquine exposure. Malar J. 11: 16.

Punjab Strategic Plan for Malaria Control
(2005) National Malaria Control
Programme, Ministry of Health, Gov-
ernment of Pakistan. Strategic Plan.
15–21.

Rab M, Freeman T, Durrani N, De Poerck
D, Rowland M (2001) Resistance of
Plasmodium falciparum malaria to
chloroquine is widespread in eastern
Afghanistan. Ann Trop Med
Parasitol. 95(1): 41–46.

Rana SM (2009) Treatment responses of
uncomplicated falciparum malaria to
different antimalaria drugs by mono
and combination therapy in Punjab,
Pakistan. [PhD thesis]. Department of
Zoology, University of the Punjab
Lahore, Pakistan.

Sá JM, Twu O, Hayton K, Reyes S, Fay
MP, Ringwald P, Wellems TE (2009)
Geographic patterns of Plasmodium
falciparum drug resistance distin-
guished by differential responses to
amodiaquine and chloroquine. Proc
Natl Acad Sci. 106(45): 18883.

Sandie M, Isabelle M, Rachida T, Collins S,
Pembe IM, Xavier I, Françoise B,
Brigitte L, Jean-François M, Parfait A,
Leonardo KB, Antoine B (2012) Mo-
lecular monitoring of Plasmodium
falciparum drug susceptibility at the
time of the introduction of artemisinin-
based combination therapy in Yaoundé,
Cameroon: Implications for the future.
Malar J. 11: 113.

Shah I, Rowland M, Mehmood P, Mujahid
C, Razique F, Hewitt S, Durrani N
(1997) Chloroquine resistance in Paki-
stan and the upsurge of falciparum ma-
laria in Pakistani and Afghan refugee
populations. Ann Trop Med Parasitol.
91(6): 591–602.

Sidhu ABS, Verdier-Pinard D, Fidock DA
(2002) Chloroquine resistance in
Plasmodium falciparum malaria para-
sites conferred by pfcrt mutations. Sci.
298(5591): 210–213.

Su X, Kirkman LA, Fujioka H, Wellems TE
(1997) Complex polymorphisms in an
330 kDa protein are linked to
chloroquine-resistant Plasmodium
falciparum in Southeast Asia and
Africa Cell. 91(5): 593–603.

Tran CV, Saier MH (2004) The principal
chloroquine resistance protein of
Plasmodium falciparum is a member
of the drug/ metabolite transporter

http://jad.tums.ac.ir
Published Online: March 11, 2015



J Arthropod-Borne Dis, December 2015, 9(2): 204–214 S Sahar et al.: Pfcrt Gene in Plasmodium …

214

superfamily. Microbiol. 150(1): 1–3.
Ursing J, Zakeri S, Gil J, Bjorkman A (2006)

Quinoline resistance associated poly-
morphisms in the pfcrt, pfmdr1 and
pfmrp genes of Plasmodium falciparum
in Iran. Acta Trop. 97(3): 352–356.

Vieira PP, Urbano FM, Alecrim MG,
Alecrim WD, da Silva LHP, Sihuincha
MM, Joy DA, Mu J, Su X, Zalis MG
(2004) pfcrt Polymorphism and the
spread of chloroquine resistance in
Plasmodium falciparum populations
across the Amazon Basin. J Infect Dis.
190(2): 417–424.

Warhurst DC (2003) Polymorphism in the
Plasmodium falciparum chloroquine-
resistance transporter protein links
verapamil enhancement of chloroquine
sensitivity with the clinical efficacy of
amodiaquine. Malar J. 2: 31.

Wellems TE, Panton LJ, Guzman IY, do
Rosario VE, Gwadz RW, Walker-Jonah
A, Krogstad DJ (1990) Chloroquine
resistance not linked to mdr-1 like
genes in a Plasmodium falciparum cross.
Nature. 345: 253–255.

Wellems TE, Walker-Jonah A, Panton LJ
(1991) Genetic mapping of the
chloroquine-resistance locus on Plas-
modium falciparum chromosome 7.
Proc Natl Acad Sci. 88(8): 3382–3386.

White N, Pongtavornpinyo W (2003) The

denovo selection of drug–resistant ma-
laria parasites. Proc R Soc Lond B
Biol Sci. 270(1514): 545–554.

Wootton JC, Feng X, Ferdig MT, Cooper
RA, Mu J, Baruch DI, Magill AJ, Su X
(2002) Genetic diversity and chloroquine
selective sweeps in Plasmodium falci-
parum. Nature. 418(6895): 320–323.

World Health Organization (2005) World
malaria report. Geneva.

World Health Organization (2010) World
malaria report. Geneva.

Yasinazi MI, Kakarsulemank JM (2008) In-
cidence of Human Malaria Infection in
Northern Hilly Region of Balochistan
Adjoining with NWFP, Pakistan: Dis-
trict Zhob. Pak J Biol Sci. 11(12):
1620–1624.

Yohannes M, Haile M (2010) The potential
of in situ rain water harvesting for
water resources conservation on ma-
laria transmission in Tigray, Northern
Ethiopia. Momona Ethiopian J Sci.
2(2): 49–63.

Zakeri S, Afsharpad M, Kazemzadeh T,
Mehdizadeh K, Shabani A, Djadid ND
(2008) Association of pfcrt but not
pfmdr1 alleles with chloroquine re-
sistance in Iranian isolates of Plasmo-
dium falciparum. Am J Trop Med
Hyg. 78(4): 633–640.

http://jad.tums.ac.ir
Published Online: March 11, 2015