J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 127 http://jad.tums.ac.ir Published Online: January 05, 2016 Original Article Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran *Sadegh Chinikar 1, Saeid Bouzari 2, Mohammad Ali Shokrgozar 3, Ehsan Mostafavi 4, Tahmineh Jalali 1, Sahar Khakifirouz 1, Norbert Nowotny 5, Anthony R. Fooks 6, Nariman Shah-Hosseini 1 1Arboviruses and Viral Hemorrhagic Fevers Laboratory (National Reference Laboratory), Pasteur Institute of Iran, Tehran, Iran 2Department of Molecular Biology, Pasteur Institute of Iran, Tehran, Iran 3National Cell Bank of Iran, Pasteur Institute of Iran, Tehran, Iran 4Department of Epidemiology, Pasteur Institute of Iran, Tehran, Iran 5Institute of Virology, Department of Pathobiology, University of Veterinary Medicine, Vienna, Austria 6Animal Health and Veterinary Laboratories Agency, Wildlife Zoonoses and Vector-Borne Diseases Research Group, Weybridge, New Haw, Addlestone, Surrey, United Kingdom (Received 10 May 2013; accepted 29 June 2014) Abstract Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were ana- lyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Ira- nian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either associa- tion with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we pro- pose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. Keywords: CCHFV, Molecular epidemiology, RT-PCR, Phylogeny, Reassortant virus, Iran Introduction Endemic regions of Crimean Congo Hem- orrhagic Fever (CCHF) have been reported in Africa, the Middle East, Eastern Europe and Western Asia (Elevli et al. 2010). In the past 10 years, Turkey, Bosnia, and Iran have been reported the most frequent outbreaks of CCHF worldwide (Mohammadi and Razmi 2014). The virus is transmitted to humans through the bite of infected Ixodid ticks (mostly of the Hyalomma genus) (Mehravaran et al. 2013, Champour et al. 2014), or direct contact with *Corresponding author: Dr Sadegh Chinikar, Email: sadeghchinikar@yahoo.com J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 128 http://jad.tums.ac.ir Published Online: January 05, 2016 infected blood, by meat from infected ani- mals or by nosocomial transmission (Chinikar et al. 2012c). CCHFV is a single stranded RNA virus with segmented negative sense genome consisting of a small (S), a medium (M) and a large (L) segment. The S RNA segment encodes the nucleocapsid (N) protein, and the M RNA segment encodes the glycoprotein precursor, resulting in the two envelope glycoproteins Gn and Gc, while the L segment encodes the putative RNA-dependent "RNA" polymerase (Papa et al. 2002). It has been proved that segmented RNA viruses have the potential of segment reassortment and form new distinct genomic variants if the host cells are subject to dual infection by more than one genetically distinct virus (Hewson et al. 2004b, Lukashev 2005). CCHFVs are relatively divergent in their genome sequence and grouped geograph- ically into seven distinct clades based on the S-segment sequence analysis (Han and Rayner, 2011). West-Africa in clade I, Cen- tral Africa in clade II, South-Africa and West-Africa in clade III, Middle-East and Asia in clade IV, Europe in clade V and Greece in clade VI (Deyde et al. 2006, Hewson et al. 2004a). The clade IV may be devided into two distinct clades, Asia-1 and Asia-2 (Hewson et al. 2004a). Beside the genome analysis on S segment, CCHFVs are divided into six clades based on M-RNA sequences; clade IV (Asia or Middle East) comprising strains in China, Pakistan, Oman, and South Africa, clade III (S Africa or W Africa 2) comprising those in Uzbekistan, Tajikistan, China, Pakistan, Iran, Iraq, South Africa and Nigeria, clade I (W Africa1) comprising those in Congo, Senegal, China, clade V (Europe) comprising those in Russia, Kosovo and Turkey, clade VI (Greece) including isolated strain from Greece, and clade VII (Mauritania) including isolated strain from Mauritania (Papa et al. 2005, Morikawa et al. 2002, Morikawa et al. 2007). In Iran, the first phylogenetic study on S- segment of CCHFV in 2004 showed that the CCHFV strains were clustered within clade Asia 1 with the highest similarity to Matin strain from Pakistan (Chinikar et al. 2004), previously a pioneering genetic characteri- zation study had showed that the Iranian strain (ArTeh 193-3) obtained from ticks in the North-Eastern region of Khorasan Prov- ince in 1978 clustered within clade Africa I and had similarity with CCHFV strains from West Africa, mainly from Senegal and Mau- ritania (Sureau and Klein 1980). In 2008, further phylogenetic analysis in tick populations in Isfahan province in Cen- tral Iran, demonstrated that a variant strain clustered within clade IV (Asia 1) with the highest similarity to an Iraqi strain (Chinikar et al. 2012a). Genetic analyses in 2012 of one strain from Northern Iran illustrated that the Rus- sian CCHFV genome is circulating in this area, and accordingly the existence of Euro- pean clade V in Iran was confirmed (Chinikar et al. 2013). According to the previous phylogenetic studies, there are seven clades of CCHFV and Iranian strains of CCHFV distributed within three clade I (Africa I), clade IV (Asia 1) and clade V (Europe) (Chinikar et al. 2013). The main objective of this study was to obtain new insights into the molecular epi- demiology of CCHFV in Iran by analyzing the partial and complete nucleotide sequenc- es of the S and M segments of CCHFV genome obtained from Iranian patients and several sequences available from GenBank. Materials and Methods Investigation areas and sampling According to the distribution of CCHFV in Iran, CCHFV have been reported from 27 of 31 provinces until now. Nineteen provinces J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 129 http://jad.tums.ac.ir Published Online: January 05, 2016 encompassed all geographical areas and were randomly selected and investigated in a span of 11 years between 2002 and 2013. A total of 50 human sera samples were selected among previously RT-PCR positive samples which were stored in the Arboviruses and Viral Hemorrhagic Fevers Laboratory (Na- tional Ref. Lab) sample bank; Pasteur Insti- tute of Iran and also transferred samples to the this laboratory during the study. Geo- graphical distribution and the year of sampling related to each strain are shown in Table 1. Serological and molecular identification To investigate each human serum sample for the presence of CCHFV-specific anti- bodies, an ELISA was initially used to detect IgM (Garcia et al. 2006). Molecular analysis was subsequently applied. For this purpose, viral RNA was extracted from 140 μl of serum using a QIAamp RNA Mini kit, ac- cording to of the manufacturer's instructions (QI Agen GmbH, Hilden, Germany) (Ya- shina et al. 2003). Specific primers for am- plification of partial S, whole S and M seg- ments were designed by CLC main work- bench software version 5.0, based on availa- ble CCHFV sequences in GenBank. To amplify the partial of the S-segment, a primer pair (PSF5’-GAATGTGCATGGGTT AGCTC-3’) and (PSR 5’-GACATCACAA TTTCACCAGG-3’) was designed and used to amplify a 536 bp section. For reverse transcription, 50 °C (30 min) used. An initial enzyme activation step at 95 °C for 5 min was succeeded by 40 reaction cycles carried out with 30 sec at 94 °C, 30 sec at 50 °C, and 45 sec at 72 °C followed by a final incubation at 72 °C for 10 min. For amplification of the full-length of the S-segment, a touch down RT-PCR used with the following primers: WSF: 5’-TCTCAAA GAAACACGTGCCGC-3’ and WSR: 5’- TCTCAAAGATATCGTTGCCGC-3’ to am- plify a 1680 bp section of the S-segment. Thermal cycle condition designed as 45 °C (30 min) for reverse transcription and 95 °C (15 min) as an initial enzyme activation, and then followed by 40 reaction cycles at 94 °C (10 sec), 66-52 °C (30 sec), 68 °C (100 sec), eventually, 68 °C (10 min) as final extension. For amplification of the partial of the M- segment, the primers of PMF 5’-TGCAC TTGAGCATCTGCAA-3’ and PMR 5’-AG CTGATTCCTGTCCTTTC-3’ was designed and used to amplify a 557 bp section of the M-segment. For reverse transcription, 50 °C (30 min) used An initial enzyme activation step at 95 °C for 15 min was succeeded by 40 reaction cycles carried out with 30 sec at 94 °C, 30 sec at 45 °C, and 1 min at 72 °C followed by a final incubation at 72 °C for 10 min (Rodriguez et al. 1997). PCR prod- ucts were amplified using one-step RT-PCR, according to Rodriguez et al. The amplified products were visualized by ethidium bromide agarose gel staining (Yadav et al. 2012). Sequencing The PCR products were then sequenced using Big Dye Terminator V3.1 Cycle se- quencing Kit with Modified Sanger Se- quencing Method by ABI Genetic Analyzer 3130. For full-length S-segment sequencing, internal primers were designed as follow: Forward: 3'AATGCAAACACGGCAGCTTT 5' and Reverse: 3'GGAACTGTGAGACAG TCGGG5'. The obtained sequences were op- timized (gaps and noises were deleted) (Chinikar et al. 2010). Nucleotide sequence accession numbers Whole S segment isolates Iran-Gilan 69, Iran-Isfahan 78, Iran-Kerman 43, Iran-Kh Razavi 72, Iran-Tehran 65 and Iran-Zahedan 19 submitted to GenBank and assigned ac- cession No. KJ027521, KJ027522, KJ196326, KJ485700, KJ566219 and KJ676542 respec- tively. Sequence alignments and phylogeny analysis In addition to the 50 CCHFV sequences ob - J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 130 http://jad.tums.ac.ir Published Online: January 05, 2016 tained, several sequences available from GenBank at www.ncbi.nih.gov were incor- porated into the alignments for phylogenetic analyses (Table 2). The sequence alignment was performed by ClustalW and a scaled phylogenetic tree generated by the Maximum Likelihood (ML) with Kimura 2-parameter distance using Mega5 software. Bootstrap confidence limits were based on 1000 replicates. This method evaluates the topologies of different trees and chooses the best tree based on a speci- fied model. This model is based on the evo- lutionary process that can account for the conversion of one sequence into another (Tonbak et al. 2006, Aradaib et al. 2011). Results Viral RNA was extracted from 50 selected sera of infected patients originated from 19 provinces of Iran including Khorasane-Razavi, Khorasane-Jonobi, SistanvaBalochestan, Ker- man, Tehran, Gilan, Mazandaran, Isfahan, Yazd, Qom, Azarbaijane-Sharghi, Azarbaijane- Gharbi, Zanjan, Kermanshah, Hormozgan, Fars, Boshehr, Khuzestan and Lorestan col- lected between 2002 and 2013. Samples included in this study were cor- related to the prevalence of the CCHFV from each region. Accordingly, 11 sera were selected from the Southeast of Iran, 10 sera from Central Iran, 9 sera from Northeast Iran, 8 sera from Southern Iran, 4 sera from West, 3 sera from Northwest, 3 serum sam- ples from North, 1 serum sample from East and 1 serum sample from Southwest. Partial sequence phylogenetic analysis of S segment The phylogenetic analysis conducted by the Neighbor Joining (NJ) and Maximum- Likelihood (ML). Only ML are presented here, however phylogenetic tree that were created using the NJ algorithm had the same topology and strongly supported the same phylogenetic groups as the ML tree. Phylogenetic analysis using the partial S- segment (~500 bp) demonstrated, of 50 se- quenced CCHFV obtained from Iranian pa- tients, 40 sequences (80%), mainly in the Southeast and East of Iran, were located within clade IV (Asia 1). Two Iranian se- quences (4%), both in the Southeast of Iran, formed a distinct cluster in the clade IV (Asia 2). These two Iranian sequences fell in the subgroup consisting of the India. Nota- bly, two sequences had strong similarity to each other with 100 % bootstrap support. Seven sequences (14%) of Iranian strains, mainly in the Northwest of Iran, were lo- cated within clade V (Europe). One se- quence (Iran-Kerman/22) showed itself as out-group and had the highest differences with other clades. No Iranian sequences were positioned within clade III (S Africa and/ or W Africa 2), clade II (Central Africa), clade I (W Af- rica 1), and clade VI (Greece AP92). As expected, all sequences from an out- break in Mashhad city, Khorasane-Razavi province, in 2012 grouped in a cluster with the highest similarity to each other (Iran- KhRazavi 2, 3, 4, 5, 16 and 17) (Fig. 1). Complete genome sequence phylogenetic analysis of S segment The topology of complete genome se- quence analysis of S-segment (~1500 bp) was in accordance with partial genome se- quence analysis of the S-segment. The phy- logeny of the complete S segment nucleotide sequences from strains obtained in Gene- Bank indicated that eight major groups could be recognized. The Iranian S segment from strain Iran-Kerman/22 was least similar to all other S segments and stands as an out- group and considered as clade VII (Iran) (Fig. 2). J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 131 http://jad.tums.ac.ir Published Online: January 05, 2016 Partial sequence phylogenetic analysis of M segment Based on phylogenetic analysis on the partial sequence of M segment (~520 bp), six clades were distinguishable. The tree showed that seven Iranian strains clustered in the clade III (S Africa and/ or W Africa) and V (Europe) with other strains of Middle East and Europe. The Iranian CCHFV strains Iran-Kerman/ 43, Iran-Tehran/65 and Iran-KhRazavi/72 in accordance with the Iranian strains (DQ 446216 and DQ446215) formed a separate cluster within the clades III and showed maximum closeness with the Pakistan (AJ 538199). In addition, Iran-Gilan/69 and Iran- Isfahan/78 strains fell in clade V (Europe) and showed maximum association with the isolates from Russia, Kosovo and Turkey. Interestingly, Iran-Kerman/22 showed the highest similarity to clade V in the M seg- ment analysis (Fig. 3). Table 1. Details of the Iranian CCHFV strains isolated from human serum used in this study. The sequences used for analysis of partial S, complete S and partial M segments are indicated in table Strain Location Date Partial S Complete S Partial M Iran-KhRazavi/1 Northeast 2013 * Iran-KhRazavi/2 Northeast 2012 * Iran-KhRazavi/3 Northeast 2012 * Iran-KhRazavi/4 Northeast 2012 * Iran-KhRazavi/5 Northeast 2012 * Iran-KhRazavi/16 Northeast 2012 * Iran-KhRazavi/17 Northeast 2012 * Iran-KhRazavi/80 Northeast 2012 * Iran-KhRazavi/72 Northeast 2012 * * * Iran-Kerman/22 Southeast 2012 * * * Iran-Kerman/27 Southeast 2012 * Iran-Kerman/24 Southeast 2006 * Iran-Zahedan/25 Southeast 2012 * Iran-Zahedan29 Southeast 2012 * Iran-Kerman/43 Southeast 2013 * * * Iran-Zahedan/74 Southeast 2012 * Iran-Kerman/77 Southeast 2013 * Iran- SistanBalochestan/ 85 Southeast 2011 * Iran-Zahedan/19 Southeast 2012 * * Iran-Zahedan/20 Southeast 2012 * Iran-Shiraz/39 South 2012 * Iran-Minab/49 South 2007 * Iran- BandarAbas/50 South 2011 * Iran- Hormozgan/84 South 2011 * Iran-Booshehr/52 South 2010 * Iran- Hormozgan/87 South 2011 * Iran-Fars/89 South 2011 * Iran-Booshehr/97 South 2002 * Iran-KhJonobi/73 East 2012 * Iran-Zanjan/23 West 2012 * Iran-Zanjan/41 West 2006 * J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 132 http://jad.tums.ac.ir Published Online: January 05, 2016 Iran-Kerman- shah/55 West 2008 * Iran- KhorramAbad/56 West 2010 * Iran-Ahvaz/54 Southwest 2010 * Iran-Yazd/57 Central 2009 * Iran-Qom/58 Central 2011 * Iran-Tehran/65 Central 2011 * * * Iran-Isfahan/78 Central 2013 * * * Iran-Isfahan/81 Central 2011 * Iran-Kashan/15 Central 2005 * Iran-Qom/71 Central 2008 * Iran-Yazd/86 Central 2010 * Iran-Tehran/90 Central 2012 * Iran-Tehran/91 Central 2010 * Iran-Tabriz/99 Northwest 2003 * Iran-Oroomieh/100 Northwest 2003 * Iran-Tabriz/102 Northwest 2004 * Iran-Babol/14 North 2012 * Iran-Amlash/21 North 2012 * Iran-Gilan/69 North 2012 * * * Table 2. Details of CCHF virus strains originated from Iran and other countries retrieved from GenBank and used for sequence analysis Virus strains Location Date Clade/ Name (S segment) GenBank accession no S segment Clade/Name (M segment) GenBank accession no M segment NIV 112143 India 2011 IV/ASI-1 JN572089 - - SCT ex Afghanistan Afghanistan 2012 IV/ASI-1 JX908640 - - Afg09-2990 Afghanistan 2009 IV/ASI-1 HM452305 - - ArTec193-3 Iran 1978 I/WAFR-1 U15022 - - 766/02 Iran 2004 IV/ASI-1 AY366373 - - 787/02 Iran 2004 IV/ASI-1 AY366379 - - Iran 52 Iran 2002 - - III/S AFR,WAFR-2 DQ446215 Iran53 Iran 2002 - - III/S AFR,WAFR-2 DQ446216 Baghadad12 Iraq 1979 IV/ASI-1 AJ538196 III/S AFR,WAFR-2 AJ538197 China79121 China 1979 IV/ASI-2 AF358784 I/W AFR-1 AB069673 ChinaC68031 China 1968 - - IV/ASI DQ211629 Kosovo 1917 Kosovo 2009 V/EUR JN173797 - - Kososvo9553 Kosovo 2001 - - V/EUR AY675511 KosovoHoti Kosovo 2001 - - V/EUR EU037902 ArMg951 Madagaskar 1994 IV/ASI-1 U15024 - - IbAr10200 Nigeria 1966 III/S AFR,W AFR-2 U88410 III/S AFR,W AFR-2 AF467768 Matin Pakistan 1976 IV/ASI-1 AF527810 4/ASI AF467769 PakistanSR3 Pakistan 2000 IV/ASI-1 AJ538198 III/S AFR,W AFR-2 AJ538199 Drosdov Russia 1967 V/EUR DQ211643 V/EUR DQ211630 Kashmanov Russia 1967 V/EUR DQ211644 V/EUR DQ211631 SPU 128817 South Africa 1981 III/S AFR,W AFR-2 DQ076415 III/S AFR,W AFR-2 DQ157174 SPU9785 South Africa 1985 III/S AFR,W AFR-2 DQ211646 IV/ASI DQ211633 ArD39554 Mauritania 1984 III/S AFR,W AFR-2 DQ211641 VII/MAURITANIA DQ211628 AB1-2009 Sudan 2009 - - III/S AFR,W AFR-2 HQ378187 ArD8194 Senegal 1969 I/W AFR-1 DQ211639 I/W AFR-1 DQ211626 ArD15786 Senegal 1972 I/W AFR-1 DQ211640 - - Table 1. Countinued… J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 133 http://jad.tums.ac.ir Published Online: January 05, 2016 Semunya Uganda 1958 II/CENTRAL AFR DQ076413 UG3010 Congo 1956 II/CENTRAL AFR DQ211650 I/W AFR-1 DQ211637 Hodzha Uzbekistan 1967 IV/ASI-2 AY223475 III/S AFR,W AFR-2 AY223476 HU8966 Tajikistan 1990 - - III/S AFR,WAFR-2 AY179962 AP92 Greece 1975 VI/GREECE DQ211638 VI/GREECE DQ211625 Oman Oman 1997 IV/ASI-1 DQ211645 IV/ASI DQ211632 Dubai 616 Dubai 1979 IV/ASI-2 JN108025 - - Kelkit06 Turkey 2006 V/EUR GQ337053 - - 200310849 Turkey 2003 V/EUR DQ211649 V/EUR DQ211636 KT281/75 - - Dugbe virus AF434165 - - JC280 Pakistan 1992 Hazara virus M86624 - - Fig. 1. Phylogenetic tree of CCHFVs based on the 520-nucleotide S RNA sequences. The tree was constructed by using the maximum likelihood method with Mega 5. The sequences obtained from this study are shown by asterisk. The numbers above the branches indicate the bootstrap values in percentages (of 1000 replicates) Table 2. Countinued… J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 134 http://jad.tums.ac.ir Published Online: January 05, 2016 Fig. 2. Phylogenetic tree of CCHFVs full-length S RNA sequences (1500 bp). The tree was constructed by using the maximum likelihood method with Mega 5. The sequences obtained from this study are shown by asterisk. The num- bers above the branches indicate the bootstrap values in percentages (of 1000 replicates) J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 135 http://jad.tums.ac.ir Published Online: January 05, 2016 Fig. 3. Phylogenetic tree of CCHFVs partial M RNA sequences (500 nucleotides). The tree was constructed by us- ing the maximum likelihood method with Mega 5. The sequences obtained from this study are shown by asterisk symbol. The numbers above the branches indicate the bootstrap values in percentages (of 1000 replicates) Discussion In 1992, the first complete nucleotide se- quence of S-RNA segment of Chinese strain C68031 of CCHFV was determined (Marriott and Nuttall 1992). Afterwards, during an out- break of CCHF in the United Arab Emirates between 1994 and 1995, nested reverse transcriptase polymerase chain reaction (RT- PCR) amplifying of the partial S-RNA seg- J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 136 http://jad.tums.ac.ir Published Online: January 05, 2016 ment of CCHF virus was developed and used for analysis of CCHFVs (Schwarz et al. 1996). Phylogenetic studies relied on the sequence data of the S-RNA segment have demon- strated genetic diversity for many CCHFV strains from different regions of the world (Iashina et al. 2002). Despite the fact that re- combination is relatively scarce in CCHFV genome (Chare et al. 2003) and a partial se- quence of S-RNA segment can be used for phylogenetic analyses, but it is recommend- ed to use the full sequence data of the S- RNA segment for obtaining more precise phylogenetic analysis, as the possibility of re- combination is still expected (Lukashev 2005). There have been several genetic analyses of CCHFVs obtained from Iran; however, all the reported Iranian strains were obtained mostly from the South-East of Iran and just four obtained from Central and recently one strain from the Northern regions of Iran (Chinikar et al. 2012a, Chinikar et al. 2004, Chinikar et al. 2010, Chinikar et al. 2013). What makes this study unique is in that a large number of CCHFV strains have been characterized genetically by partial and com- plete nucleotide sequencing of virus small (S) and medium (M) segments with a wide geographical distribution. Fifty partial se- quences of S segment and six partial se- quences of M segment and seven complete sequences of S segments from various loca- tions have been studied. In this study, we have used a bioinfor- matics approach to analyze an alignment by estimating the phylogenetic relationship be- tween the obtained sequences from Iranian patients and GenBank available data. Phylo- genetic analysis based on large collections of partial and complete sequences of the S seg- ment has indicated the existence of eight distinct clades for CCHFV (Drosten et al. 2002). Accordingly, the most surprising finding in this study is discovery of a novel genomic variant of CCHFV. In other words, this study suggests the emergence of VII- IRAN clade for CCHFV in Iran as a novel clade based on S segment analysis. In general, this phylogenetic analysis based on sequences of S-RNA of CCHFVs reveals that the majority of CCHFV se- quences from Iran belongs to clade IV (Asia 1), and clade V (Europe), which is in con- sistent with previous reports from Iran (Chinikar et al. 2004, Chinikar et al. 2012b). In addition, for the first time, two sequences (Iran-Zahedan/19 and Iran-SistanBalochestan/ 85, which were obtained from the South- East Iran, were seen within clade IV (Asia 2) with the highest proximity to strains from India (JN572089). The data of this study are in conformity with previous studies which showed similar- ity between Iranian S segment of CCHFV strains with Pakistan, Afghanistan (Chinikar et al. 2004) and Iraq (Chinikar et al. 2012a), Interestingly findings regarding all phy- logeny studies during these years is that CCHFV strain Iran/ArTec 193-3 is likely fade away from Iran and it has been never reported since 35 years ago when it was re- ported as the first CCHFV strain from Iran by Sureau (Sureau and Klein 1980). Our data based on the S segment shows that CCHFVs are grouped in eight different clades and have correlation with their geo- graphical location (Morikawa et al. 2007). Previous phylogenetic studies based on L- RNA segment sequences have showed that the L tree topology is similar to the S tree topology (Hewson et al. 2004b). However, the phylogenetic topology based on M-RNA segment sequences of CCHFVs is different from that of S-RNA segments (Seregin et al. 2004, Ahmed et al. 2005). These analyses show that CCHFVs are likely to be grouped in six different phylogenetic clades based on M-RNA sequences (Deyde et al. 2006, Car- roll et al. 2010). To obtain a phylogenetic tree based on M segment, a partial sequence data can be used (Morikawa et al. 2007), indicating that re- J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 137 http://jad.tums.ac.ir Published Online: January 05, 2016 combination within the M segments is not common during evolution of the CCHFVs. However, genetic re-assortment occurs fre- quently in CCHFVs, when host ticks co-in- fected with different types of CCHFVs (Deyde et al. 2006). The reason why M-RNA segment re-assortment is more frequently ob- served is not clear, however, strong interrela- tion between N protein encoded in the S- RNA segment and RNA polymerase encoded in the L-RNA segment may be required to produce viable virus (Chamberlain et al. 2005). Different examples of RNA segment re- assortment can be seen in the M segment phylogenetic tree. Tree based on M segment nucleotide and deduced amino acid sequence differences were very similar to each other. Like Mauritanian strain ArD39554 that be- longs to group III in S and stands as an out- group VII in M segment trees, surprisingly in our obtained strains, the Iranian strain Iran-Kerman/22 forms a unique group and considered as clade VII in S tree (Fig. 2), whereas it grouped within group V (Europe) with 100 % bootstrap support for this topol- ogy in M tree (Fig. 3), suggesting that it representing M segment re-assortment. Other potential M segment re-assortment events include Iranian strains Iran-Ker- man/43 and Iran-KhRazavi/72 that were in group IV (Asia 1) in S tree, while cluster within group III in the M segment tree. Conclusion The CCHFVs in Iran have multiple ori- gins with vivid geographical relationships between virus strains. Moreover, phyloge- netic results reveal subtle links between dis- tant geographical locations, which may orig- inate either from livestock trade or from long-distance carriage of virus by infected ticks during bird migration. According to all previous phylogeny stud- ies, four genetic lineages of CCHF viruses, clade IV (Asian 1 and II), clade V (Europe) and new clade VII (Iran) exist in Iran. Based on mentioned above data, having a high genomic variation of CCHFV, have been made Iran as a miniature model of the world for genetic analysis of CCHFV with various strains for CCHFV. Acknowledgements This manuscript is based on the results of corresponding author's PhD thesis. We thank all members of the Arboviruses and Viral Hemorrhagic Fevers Laboratory (National Reference Lab), Pasteur Institute of Iran, and Keyhan Azadmanesh, and Ms Niknam and Mohsen Chiani for their technical assistance. Corresponding author would like to express his sincere gratitude to Nariman Shah- Hosseini, as this research could not be done possible without his assistance and support. This research has been financially supported by Pasteur Institute of Iran. The authors declare that there is no conflict of interests. References Ahmed AA, Mcfalls JM, Hoffmann C, Filone CM, Stewart SM, Paragas J, Khodjaev S, Shermukhamedova D, Schmaljohn CS, Doms RW (2005) Presence of broadly reactive and group-specific neutralizing epitopes on newly described isolates of Crimean- Congo hemorrhagic fever virus. J Gen Virol. 86: 3327–3336. Aradaib IE, Erickson BR, Karsany MS, Khristova ML, Elageb RM, Mohamed ME, Nichol ST (2011) Multiple Crimean-Congo hemorrhagic fever virus strains are associated with disease outbreaks in Sudan, 2008–2009. PLoS Negl Trop Dis. 5(5): 1159-1168. Carroll SA, Bird BH, Rollin PE, Nichol ST (2010) Ancient common ancestry of Crimean-Congo hemorrhagic fever virus. Mol Phylogenet Evol. 55: 1103–1110. J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 138 http://jad.tums.ac.ir Published Online: January 05, 2016 Chamberlain J, Cook N, Lloyd G, Mioulet V, Tolley H, Hewson R (2005) Co- evolutionary patterns of variation in small and large RNA segments of Crimean-Congo hemorrhagic fever virus. J Gen Virol. 86: 3337–3341. Champour M, Chinikar S, Mohammadi G, Razmi G, Shah-Hosseini N, Khakifirouz S, Mostafavi E, Jalali T (2014) Mole- cular epidemiology of Crimean–Congo hemorrhagic fever virus detected from ticks of one humped camels (Camelus dromedarius) population in northeast- ern Iran. J Parasit Dis. (in Press). Chare ER, Gould EA, Holmes EC (2003) Phylogenetic analysis reveals a low rate of homologous recombination in negative-sense RNA viruses. J Gen Virol. 84: 2691–2703. Chinikar S, Shah-Hosseini N, Bouzari S, Jalali T, Shokrgozar MA, Mostafavi E (2013) New circulating genomic variant of Crimean-Congo hemorrhagic fever virus in Iran. Arch Virol. 158: 1085– 1088. Chinikar S, Ghiasi SM, Naddaf S, Piazak N, Moradi M, Razavi MR, Afzali N, Haeri A, Mostafavizadeh K, Ataei B (2012a) Serological evaluation of Crimean-Con- go hemorrhagic fever in humans with high-risk professions living in enzootic regions of Isfahan Province of Iran and genetic analysis of circulating strains. Vector Borne Zoonotic Dis. 12(9): 733–738. Chinikar S, Shayesteh M, Khakifirouz S, Jalali T, Rasi Varaie FS, Rafigh M, Mostafavi E, Shah-Hosseini N (2012c) Nosocomial infection of Crimean- Congo haemorrhagic fever in eastern Iran: Case report. Travel Med Infect Dis. 11(4): 252–255. Chinikar S, Mojtaba Ghiasi S, Moradi M, Goya M, Reza Shirzadi M, Zeinali M, Mostafavi E, Pourahmad M, Haeri A (2010) Phylogenetic analysis in a re- cent controlled outbreak of Crimean- Congo haemorrhagic fever in the south of Iran, December 2008. Euro Surveill. 15 (47): 1–4. Chinikar S, Persson SM, Johansson M, Bladh L, Goya M, Houshmand B, Mirazimi A, Plyusnin A, Lundkvist, Nilsson M (2004) Genetic analysis of Crimean-Congo hemorrhagic fever virus in Iran. J Med Virol. 73: 404–411. Deyde VM, Khristova ML, Rollin PE, Ksiazek TG, Nichol ST (2006) Crimean- Congo hemorrhagic fever virus ge- nomics and global diversity. J Virol. 80: 8834–8842. Drosten C, Minnak D, Emmerich P, Schmitz H, Reinicke T (2002) Crimean-Congo hemorrhagic fever in Kosovo. J Clin Microbiol. 40: 1122–1123. Elevli M, Ozkul AA, Civilibal M, Midilli K, Gargili A, Duru NS (2010) A newly identified Crimean-Congo hemorrhag- ic fever virus strain in Turkey. Int J Infect Dis. 14: 213–216. Garcia S, Chinikar S, Coudrier D, Billecocq A, Hooshmand B, Crance J, Garin D, Bouloy M (2006) Evaluation of a Crimean-Congo hemorrhagic fever virus recombinant antigen expressed by Semliki Forest suicide virus for IgM and IgG antibody detection in human and animal sera collected in Iran. J Clin Virol. 35: 154–159. Han N, Rayner S (2011) Epidemiology and mutational analysis of global strains of Crimean-Congo haemorrhagic fever virus. Virol Sin. 26: 229–244. Hewson R, Chamberlain J, Mioulet V, Lloyd G, Jamil B, Hasan R, Gmyl A, Gmyl L, Smirnova S, Lukashev A (2004a) Cri- mean-Congo haemorrhagic fever virus: sequence analysis of the small RNA segments from a collection of viruses world wide. Virus Res. 102: 185–189. Hewson R, Gmyl A, Gmyl L, Smirnova S E, Karganova G, Jamil B, Hasan R, J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 139 http://jad.tums.ac.ir Published Online: January 05, 2016 Chamberlain J, Clegg C (2004b) Evi- dence of segment reassortment in Crimean-Congo haemorrhagic fever virus. J Gen Virol. 85: 3059–3070. Iashina L, Petrov V, Petrova I, Gutorov V, Kazakov S, Ospanov K, Karimov S, Tiunnikov G, Seregin S, Kuzina I (2002) Genetic identification of the Crimean-Congo hemorrhagic fever virus during epidemic outbreak in Kazakh- stan in 2000. Mol Gen Mikrobiol Virusol. 4: 31–35. Lukashev AN (2005) Evidence for recom- bination in Crimean-Congo hemorrhagic fever virus. J Gen Virol. 86: 2333–2338. Marriott AC, Nuttall PA (1992) Comparison of the S RNA segments and nucleopro- tein sequences of Crimean-Congo hem- orrhagic fever, Hazara, and Dugbe viruses. Virology. 189: 795–799. Mehravaran A, Moradi M, Telmadarraiy Z, Mostafavi E, Moradi AR, Khakifirouz S, Shah-Hosseini N, Varaie FSR, Jalali T, Hekmat S (2013) Molecular detec- tion of Crimean-Congo haemorrhagic fever (CCHF) virus in ticks from southeastern Iran. Ticks Tick Borne Dis. 4: 35–38. Mohammadi GR, Razmi GR (2014) Sero- epidemiology of Crimean-Congo hem- orrhagic fever virus in one-humped camels (Camelus dromedarius) popula- tion in northeast of Iran. J Vector Borne Dis. 51: 62–65. Morikawa S, Saijo M, Kurane I (2007) Recent progress in molecular biology of Crimean-Congo hemorrhagic fever. Comp Immunol Microbiol Infect Dis. 30: 375–389. Morikawa S, Qing T, Xinqin Z, Saijo M, Kurane I (2002) Genetic diversity of the M RNA segment among Crimean- Congo hemorrhagic fever virus isolates in China. Virology. 296: 159–164. Papa A, Papadimitriou E, Bozovic B, An- toniadis A (2005) Genetic character- ization of the M RNA segment of a Balkan Crimean-Congo hemorrhagic fever virus strain. J Med Virol. 75: 466–469. Papa A, Ma B, Kouidou S, Tang Q, Hang C, Antoniadis A (2002) Genetic charac- terization of the M RNA segment of Crimean Congo hemorrhagic fever virus strains, China. Emerg Infect Dis. 8(1): 50–53. Rodriguez LL, Maupin GO, Ksiazek TG, Rollin PE, Khan AS, Schwarz TF, Lofts RS, Smith JF, Noor AM, Peters CJ (1997) Molecular investigation of a multisource outbreak of Crimean-Con- go hemorrhagic fever in the United Arab Emirates. Am J Trop Med Hyg. 57: 512–518. Schwarz TF, Nsanze H, Longson M, Nitschko H, Gilch S, Shurie H, Ameen A, Zahir ARM, Acharya UG, Jager G (1996) Polymerase chain reaction for diagno- sis and identification of distinct vari- ants of Crimean-Congo hemorrhagic fever virus in the United Arab Emir- ates. Am J Trop Med Hyg. 55: 190– 196. Seregin SV, Samokhvalov EI, Petrova ID, Vyshemirskii OI, Samokhvalova EG, Lvov DK, Gutorov VV, Tyunnikov GI, Shchelkunov SN, Netesov SV (2004) Genetic characterization of the M RNA segment of Crimean-Congo hemor- rhagic fever virus strains isolated in Russia and Tajikistan. Virus Genes. 28: 187–193. Sureau P, Klein J (1980) Arboviruses in Iran. Med Trop. 40: 549-554. Tonbak S, Aktas M, Altay K, Azkur A K, Kalkan A, Bolat Y, Dumanli N, Ozdarendeli A (2006) Crimean-Congo hemorrhagic fever virus: genetic anal- ysis and tick survey in Turkey. J Clin Microbiol. 44: 4120–4124. Yadav PD, Cherian SS, Zawar D, Kokate P, Gunjikar R, Jadhav S, Mishra AC, J Arthropod-Borne Dis, June 2016, 10(2): 127–140 S Chinikar et al.: Genetic Diversity of … 140 http://jad.tums.ac.ir Published Online: January 05, 2016 Mourya DT (2012) Genetic charac- terization and molecular clock anal- yses of the Crimean-Congo Hemor- rhagic Fever virus from human and ticks in India, 2010–2011. Infect Genet Evol. 14: 223–231 Yashina L, Vyshemirskii O, Seregin S, Petrova I, Samokhvalov E, Lvov D, Gutorov V, Kuzina I, Tyunnikov G, Tang Y W. (2003). Genetic analysis of Crimean- Congo hemorrhagic fever virus in Russia. J Clin Microbiol. 41: 860–862.