J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 538 http://jad.tums.ac.ir Published Online: October 04, 2016 Original Article Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf) in Northeastern Iran Using Parasitological, Serological, and Molecular Methods Mehdi Mohebali 1,2, Kourosh Arzamani 3, *Zabiholah Zarei 1, Behnaz Akhoundi 1, Homa Hajjaran 1, Saber Raeghi 3, Zahra Heidari 1, Seyed Mousa Motavalli-Haghi 1, Samira Elikaee 1, Ahmad Mousazadeh-Mojarrad 3, Zahra Kakoei 1 1Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran 2Center for Research of Endemic Parasites of Iran, Tehran University of Medical Sciences, Tehran, Iran 3Vector-Borne Diseases Research Center, North Khorasan University of Medical Sciences, Bojnurd, Iran (Received 30 Nov 2014; accepted 8 Nov 2015) Abstract Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL) in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare. Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT). Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes. Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21), Jackals (Canis aureus, n=60) and wolves (Canis lupus, n=3) were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture) positive and L. infantum was confirmed by sequence analysis. Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran. Keywords: Canine visceral leishmaniasis, Wild canines, Iran Introduction Visceral leishmaniasis (VL) is one of the most important infectious diseases in human and canines. Mediterranean type of VL which caused by Leishmania infantum is common- ly seen in children less than 10 years old. Domestic and wild canines are known animal reservoir hosts and some genus and species of sandflies are the main vectors of the dis- ease (WHO 2010). Wild canines including fox, jackal and wolf were infected by L. infantum and it seems that these carnivores have the potential role in sylvatic transmission cycle of L. infantum in endemic areas of VL par- ticularly in villages located in mountainous regions, where the transmission cycle was established (WHO 2010). Determination of prevalence of canine visceral leishmaniasis particularly in endemic areas is necessary to define control measures for zoonotic visceral leishmaniasis (Tesh 1995). Based on annual reports of Bojnurd Health Centre from north- eastern Iran, 164 cases of human VL were *Corresponding author: Mr Zabiholah Zarei, E-mail: z-zarei@farabi.tums.ac.ir J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 539 http://jad.tums.ac.ir Published Online: October 04, 2016 microscopically diagnosed during two last decades which are higher than the average reported VL cases of Iran (Arzamani 2012). Based on a sero-epidemiological study that was done on 1385 children up to 12 year ages, VL was known as an endemic disease in some areas of North Khorasan Province from northern Northeastern Iran (Mohebali et al. 2011). In cause Because some of limi- tations in diagnosis and reporting of VL in the studied areas, it seems that real numbers of VL are being higher than registered cases. Considering that epidemiological aspects on sylvatic cycle of VL are unknown in endem- ic areas of the disease thus, this study was conducted on wild canines. The results of this study can be help to health authorities to make special managements for prevention and control of the disease. Materials and Methods Study areas This cross-sectional study was conducted for a period of 1 year from 2012 to 2013. Seven villages in North Khorasan Province were selected, where human VL had been reported in the last 10 years. Altogether, 21 foxes (Vulpes vulpes), 60 Jackals (Canis au- reus) and 3 wolves (Canis lupus) were trapped around the villages after obtaining necessary permits from the Directorate General for the Environment (Fig. 1). Serological test All suspected canines were physically examined by a veterinary doctors and then blood samples (2 ml) were taken from them and processed 4–10 h after collection. The collected blood samples were centrifuged at 800 g for 5–10 min, and the sera were sepa- rated and stored at -20 ºC until tested by DAT. The Leishmania infantum antigens were prepared in the leishmaniasis Lab. of proto- zoology unit at the School of Public Health of Tehran University of Medical Sciences. The procedure for making DAT antigen were mass production of promastigotes of Iranian strain of L. infantum [MCAN/IR/07/Moheb- gh. (GenBank accession no FJ555210)] in RPMI1640 medium (Biosera, South Amer- ica) plus 10% fetal calf serum (Biosera, South America), following tripsinization of the par- asites, staining with coomassie brilliant blue R-250 (Sigma, USA) and fixing with formal- dehyde 1.2% (Harith et al. 1989, Edrissian 1996a, Mohebali et al. 2005, 2006). All collected serum samples were tested by DAT. Samples were diluted from 1:40 to give end-point titers of 1: 20480. One Nega- tive and one positive serum controls were included in each plate daily for comparing of the agglutination phenomena among all ex- amined sera in each 96 wells of each V shaped plate. The titer was defined as the highest dilution at which agglutination was still visible, as blue dot, compared to nega- tive control wells, which showed clear blue dots. Two individuals read the tests inde- pendently. Specific antibodies against Leish- mania infantum at a titer of 1:320 were con- sidered as positive based on previous studies (Edrissian 1996a, Boelaert et al. 1999, Mohe- bali et al. 2005). Parasitological study Parasitological examinations were per- formed in symptomatic canines (ie hair shed- ding, skin lesions and cachexia) with DAT positive results (≥ 1:320) after their euthani- zation with Ketamin and acepromizine. Mi- croscopical smears were prepared from any skin lesion, liver, spleen and large lymph nodes of all autopsied canines. All of the prepared smears were fixed with absolute methanol, stained with Giemsa 10% and ex- amined microscopically for the demonstra- tion of amastigote forms of Leishmania spp. Biopsy specimens were collected aseptically from the spleen and liver of the infected ca- J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 540 http://jad.tums.ac.ir Published Online: October 04, 2016 nines, then cultured into Novy Mac-Neal and Nicolle (NNN) culture media (prepared from nutrient agar containing 10% whole rabbit blood overlaid with normal saline containing 100–200 UI/ml penicillin G and 1 mg/ml strep- tomycin). The cultures were incubated at 23 °C for up to six weeks and examined weekly for the demonstration of promastigotes. Molecular Characterization Some Leishmania spp. isolated from in- fected wild canines, were checked by con- ventional PCR using α-tubulin and GAPDH genes.DNA was isolated from cultured pro- mastigotes and Giemsa-positive slides (amastigotes) using a commercial DNA ex- traction kit (Roche Diagnostics GmbH, Mann- heim, Germany, Lot No: 13779500 high pure PCR template preparation) according to the manufacturer’s instructions. PCR was done with α-tubulin and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) genes (Sheppard and Dwyer 1986, Kazemi- Rad et al. 2013) Gene and primers used in this study summarized in Table 1. Amplication was conducted using the PCR PreMix (Roche) in a 25 µ l total reac- tion volume. 12 µ l Master mix, 1 µ l of each primer (10 pmol), 1 µ l DNA and for the rest Distilled Water were used. The Both ampli- cons, 154 bp for α-tubulin and 119 bp for GAPDH, were analysed on 2% agarose gels and visualized by UV light after staining with GelRed stain. Parasite species were determined by comparing the profiles of the samples with those of the reference species (Fig. 2). The results were compared with standard species of L. infantum (MCAN/IR/97/LON49), L. tropica (MHOM/SU/74/K27) and L. major (MRHO/IR/75/ER) at the School of Public Health, Tehran University of Medical Sciences. The PCR products of one fox and one jackal samples were purified using an Accuprep Gel Purification kit (Bioneer, Deajeon, Korea), then sequenced (MWG-Biotech, Ebersberg, Germany) by the primers employed in the PCR. Sequence alignments were constructed using the program ClustalW version 1.83. (http://www.ddbj.nig.ac.jp/search/clustalwe. html). ClustalW alignment and phylogenetic analysis with the construction of a gene tree were performed using the Tamura 3-param- eter model. Ethical approval The trial was reviewed and approved by ethical committee from vice-chancellor for research, Tehran University of Medical Sci- ences as well as Vector-borne Diseases Re- search Center, North Khorasan University of Medical Sciences, Bojnurd, Iran. Results DAT results Among the 84 wild canines examined, the sera of six Vulpes vulpes (foxes), and seven Canis aureus (jackals) showed anti- bodies against Leishmania infantum with titers ranging from 1:80–1:20480 indicating that these animals were infected with Leish- mania spp. Parasitological (microscopic and culture) results Necropsy was performed on all sero- positive Vulpes vulpes (n=6) and Canis au- reus (n=7) accompanied by symptomatic Vulpes vulpes (no.2) and symptomatic Canis aureus (no.4). Leishmania spp. was found in one Vulpes vulpes (12.5%) and one Canis aureus (9.09%) using parasitological meth- ods. All of the three wolves were dead and no clinically signs and symptoms were found. All of the three wolves were dead and had not appropriate samples for finding of Leishmania infection. J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 541 http://jad.tums.ac.ir Published Online: October 04, 2016 Molecular results (conventional PCR and sequencing) Two positive parasitilogical samples in- cluding one Canis aureus (12.5%) and one Vulpes vulpes (9.09%) subjected to conven- tional PCR using α-tubulin and GAPDH genes (Fig. 2A and B) and L. infantum was identified by sequencing results. All the DNA sequences were aligned using Multalin and analyzed with Mega 6 software (Fig. 3). The GAPDH sequence was submitted in GenBank (Accession No. KM350534). Fig. 1. Geographical locations of collected wild canines (fox, jackal, and wolf) of North Khorasan Province,Norteastern Iran, 2012-2013. 1. Gerati, Esfraien, 2. Estarkhi Shirvan, 3. Gelian, Shirvan, 4. Titkanloo, Faruj 5. Zoeram Shirvan, 6. Shirvan, 7. Sisab, Bojnurd, 8. Naveh, Bojnurd, 9. Babamoosa, Bojnurd, 10. Asadli, Bojnurd, 11. Mehnan, Metranloo, Bojnurd, 12. Bidak, Bojnurd, 13. Tatar, Bojnurd, 14. Ashkhaneh, Mane and Samalghan, 15. Gifan, Bojnurd, 16. Jodar, Bojnurd, 17. Kohne Jolge, Mane and Samalghan, 18. Yekeh Suod, Raz and Jargalan Table 1. Gene and primers used for conventional PCR assay Gene Primer designations and sequences (5′–3′)1 Cycling Conditions2 Amplicon size (bp) α-tubulin F:CAGGTGGTGTCGTCTCTGAC d:96ºc, 4min 119 c:30 R:TAGCTCGTCAGCACGAAGTG d:94ºc, 30sec a:60ºc, 30sec e:72 ºc, 45sec GAPDH F: GCATGTGCTGACAAAGGAGA d:96ºc, 4min 154 R:GGTCGTACTCGGGATGATGT c:30 d:94ºc, 30sec a:60ºc, 30sec e:72 ºc, 45sec 1F: forward, R: reverse. 2d: denaturation, c: cycles, a: annealing, e: extension. Final elongation for all assays was at 72 C for 10 min. J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 542 http://jad.tums.ac.ir Published Online: October 04, 2016 Table 2. Parasitology, serology and molecular results in wild canines (fox, jackal) trapped in northeastern Iran during 2012–2013 Animal Microscopic exami- nation Culture Serologic examina- tion Molecular Examina- tion Total Examined Positive Examined Positive Examined Positive Examined Positive Fox 8 1 8 1 21 6 0 0 21 Jackal 11 1 11 1 60 7 1 1 60 All of the three wolves were dead and had not appropriate samples for finding of Leishmania infection. Fig. 2. Conventional PCR Patterns of α-tubulin and GAPDH genes obtained from test samples and standard Leish- mania stocks A: α-tubulin. B: GAPDH. Lane 1 and 2 are Samples of one jackal and one fox. M: 100bp size marker. Lane 4: Leishmania major (MRHO/IR/75/ER), Lane 5: Leishmania tropica (MHOM/SU/74/K27) and Lane 6: Leishmania infantum (MCAN/IR/97/LON49) as positive controls. Lane 7: Negative control Fig. 3. Dendrogram based on the sequence of the GAPDH gene from species of the Genus Leishmania (sequences from this study and retrieved from GenBank), with standard Leishmania tropica sequence for comparing. The access numbers for sequences retrieved from Gen Bank are given in brackets. The numbers under the branch indicate boot- strap J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 543 http://jad.tums.ac.ir Published Online: October 04, 2016 Discussion VL Visceral leishmaniasis is a potential- ly fatal protozoan infection that is endemic in some parts of Iran (Mohebali 2013) Do- mestic dogs (Canis familiaris) are the princi- pal reservoir hosts that can carry either L. infantum or L. chagasi (WHO 2010). It has been reported that our review indicates DAT is an easy-to-perform, highly sensitive, spe- cific, reliable, and cost-effective technique for the diagnosis and sero-epidemiological study of VL in humans and canines across different geographical regions. Even a small amount of serum or plasma specimen, or a drop of dried blood taken from the tip of the finger on a filter paper could be used for DAT (Harith et al. 1986, Edrissian et al. 1996b, Mohebali et al. 2006, 2011, Mohebali 2013). VL Visceral leishmaniasis as an important vector borne disease is endemic in some parts of north east, north west and south areas of Iran and the infections caused by L. infantum were reported in infected humans, domestic canines and phlebotomine vectors (Mohebali et al. 2005, Rassi et al. 2009, Oshaghi et al. 2009, Yaghoobi-Ershadi 2012, Hajjaran et al. 2013). In recent years many studies had been performed on various aspects of VL in do- mestic dogs in the endemic areas of Iran but investigations on VL in wild canines were rare. In the present study, DAT was applied to determine the circulating Leishmania spp iso- lated from animal reservoirs. Samples from one fox and one jackal that showed positive results throw parasitological methods were subjected to molecular methods. Convention- al PCR was performed with GAPDH as the housekeeping gene (Kazemi-Rad et al. 2013). Although the results confirmed microscopic detections, the electrophoretic models were identical for all the tests and controls because of high similarity in various species (differ- ence in a few nucleotides), (Fig. 2). Hence, for species identification, sequencing technique was employed. The results were analyzed using Mega 6 software and the sequence de- rived was compared with other reference species in GenBank. Molecular phylogenetic analysis using Mega 6 software was conducted by applying the Maximum Likelihood method based on the Kimura 2-parameter model. The findings showed that most of the Leishmania spp. belonged to the monophylogenetic group, and the sequence determined in the present study (Accession No. KM350534.1) had 100% homology with L. infantum /L. chagasi (XM_001467109/KF041811.1) and 99% with L. donovani (XM_003862963) and presented phylogenetic relationships (Fig. 3). Similar- ly, the results of another study on Leishma- nia spp. based on trypanosomatid barcode (SSU rDNA) and gGAPDH genes also re- vealed phylogenetic relationships (Marcili et al. 2014). However, although a previous study on Trypanosoma spp. using gGAPDH and SSU rDNA demonstrated phylogenetic rela- tionships, a similar study on Leishmania spp. showed unrelated results (Hamilton et al. 2004, 2007). Similarity of our study strain se- quence with documented GAPDH sequence of Leishmania infantum in GenBank (XM_ 001467109) that derived JPCM5 strain iso- lated from a naturally infected dog and its ability for infecting human macrophage re- veals and also this study strain can infect human (Peacock et al. 2007). Conclusion Our findings indicate that wild canines have potential role in sylvatic transmission cycle of VL similar to other Mediterranean regions and the disease is turning among domestic dogs and wild canines in endemic areas of VL in Iran. J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 544 http://jad.tums.ac.ir Published Online: October 04, 2016 Acknowledgements This study received financial support from Center for Research of Endemic Parasites of Iran (CREPI), Tehran University of Medical Sciences (Project No: 91-04-160-20312) and also Vector-borne Diseases Research Center, North Khorasan University of Medical Sci- ences, Bojnurd, Iran.We wish to thank Dr E Kazemi-Rad, Mr MT Satvat and Mrs.Sorour Charehdar for laboratory helps. References Arzamani K (2012) Visceral leishmaniasis in North Khorasan Province, north east of Iran, 15th International Congress on Infectious Diseases. June 13–16, 2012. Bangkok, Thailand. Boelaert M, Safi S, Jacquet D, Muynck A, Van der Stuyft P, Le Ray D (1999) Operational validation of the direct agglutination test for diagnosis of vis- ceral leishmaniasis. Am J Trop Med Hyg. 60(1): 129–134. Edrissian GhH (1996a) Visceral leishmania- sis in Iran and the role of serological tests in diagnosis and epidemiologi- cal studies. Parasitology for 21st Century (ICOPA VIII). CAB Inter- national. Izmir, Turkey, pp. 63–78. Edrissian GhH, Hajjaran H, Mohebali M, Soleimanzadeh G, Bokaei S (1996b) Application and evaluation of direct agglutination test in serodiagnosis of visceral leishmaniasis in man and ca- nine reservoirs in Iran. Iranian J Med Sci. 21: 119–124. Hajjaran H, Mohebali M, Mamishi S, Va- sigheh F, Oshaghi MA, Naddaf SR, Teimouri A, Edrissian GH, Zarei Z (2013) Molecular identification and polymorphism determination of cutane- ous and visceral leishmaniasis agents isolated from human and animal hosts in Iran. Biomed Res Int. Article ID: 789326: 1–7. Hamilton PB, Gibson WC, Stevens JR (2007) Patterns of co-evolution between tryp- anosomes and their hosts deduced from ribosomal RNA and protein- coding gene phylogenies. Mol Phylo- genetics Evol. 44: 15–25. Hamilton PB, Stevens JR, Gaunt MW, Gid- ley J, Gibson WC (2004) Trypano- somes are monophyletic: evidence from genes for glyceraldehyde phos- phate dehydrogenase and small sub- unit ribosomal RNA. Int J Parasitol. 34: 1393–1404. Harith A, Kolk AHJ, Kager PA, Leeuwen- burg J, Muigai R, Kiugu S, Kiugu S, Laarman JJ (1986) A simple and eco- nomical direct agglutination test for serodiagnosis and sero-epidemiologi- cal studies of visceral leishmaniasis. Trans R Soc Trop Med Hyg. 80: 583– 587. Harith A, Salappendel RJ, Reiter I, Knapen F, Korte P, Huigen E, Jelsma T, Ka- ger PA (1989) Improvement of direct agglutination test for field studies of visceral leishmaniasis. J Clin Micro- biol. 26(7): 13221–13225. Kazemi-Rad E, Mohebali M, Khadem-Erfan MB, Saffari M, Raoofian R, Hajjaran H, Hadighi R, Khamesipour A, Rezaie S, Abedkhojasteh H, Heidari M (2013) Identification of antimony resistance markers in Leishmania tropica field isolates through a cDNA-AFLP ap- proach. Exp Parasitol. 135(2): 344–349. Marcili A, Sperança MAp, Costa AP, Ma- deira M de F, Soares HS, Sanches COCC, Acosta ICL, Girotto A, Mi- nervino AHH, Horta MC, Shaw JF, Gennari SM (2014) Phylogenetic relationships of Leishmania species based on trypanosomatid barcode (SSU rDNA) and gGAPDH genes: J Arthropod-Borne Dis, December 2016, 10(4): 538–545 M Mohebali et al.: Canine Visceral Leishmaniasis … 545 http://jad.tums.ac.ir Published Online: October 04, 2016 Taxonomic revision of Leishmania (L.) infantum chagasi in South America Infection. Genetics Evol. 25: 44–51. Mohebali M (2013) Visceral leishmaniasis in Iran: Review of the Epidemiological and Clinical Features. Iranian J Para- sitol. 8(3): 348–358. Mohebali M, Edrissian Gh H, Nadim A, Hajjaran H, Akhoundi B, Hooshmand B, Zarei Z, Arshi Sh, N Mirsamadi, K Manouchehri Naeini, S Mamishi, AA Sanati, AA Moshfe, S Charehdar, M Fakhar (2006) Application of direct agglutination test (DAT) for the diag- nosis and seroepidemiological studies of visceral leishmaniasis in Iran. Ira- nian J Parasitol. 1(1): 15–25. Mohebali M, Edrissian GhH, Shirzadi MR, Akhoundi B, Hajjaran H, Zarei Z, Molaei S, Sharifi I, Mamishi S, Mah- moudvand H, Torabi V, Moshfe A, Malmasi A, Motazedian MH, Fakhar M (2011) An observational study on the current distribution of visceral leishmaniasis in different geograph- ical zones of Iran and implication to health policy. Travel Med Infect Dis. 9(2): 67–74. Mohebali M, Hajjaran H, Hamzavi Y, Mobedi I, Arshi S, Zarei Z, Akhoundi B, Naeini KM, Avizeh R, Fakhar M (2005) Epidemiological aspects of canine visceral leishmaniasis in the Islamic Republic of Iran. Vet Parasi- tol. 129(3–4): 243–251. Oshaghi M A, Maleki Ravasan N, Javadian E, Mohebali M, Hajjaran H, Zare Z, Mohtarami F, Rassi Y (2009) Vector incrimination of sand flies in the most important visceral leishmaniasis focus in Iran. Am J Trop Med Hyg. 81(4): 572–577. Peacock ChP, Seeger K, Harris D, Murphy L, Ruiz JC, Quail MA, Peters N, Adlem E, Tivey A, Aslett M, Kerhornou A, Ivens A, Fraser A, Rajandream MA, Carver T, Norbertczak H, Chillingworth T, Hance Z, Jagels K, Moule S, Ormond D, Rutter S, Squares R, Whitehead S, Rabbinowitsch E, Arrowsmith C, White B, Thurston S, Bringaud F, Baldauf SL, Faulconbridge A, Jeffares D, Depledge DP, Oyola SO, Hilley JD, Brito LO, Tosi LR, Barrell B, Cruz AK, Mottram JC, Smith DF, Berriman M (2007) Com- parative genomic analysis of three Leishmania species that cause diverse human disease. Nat Genet. 39(7): 839–847. Rassi Y, Javadian E, Nadim A, Rafizadeh S, Zahraii A, Azizi K, Mohebali M (2009) Phlebotomus perfiliewi Trans- caucasicus, a vector of Leishmania infantum in northwestern Iran. J Med Entomol. 46: 1094–1098. Sheppard HW and Dwyer DM (1986) Clon- ing of Leishmania donovani genes encoding antigens recognized during human visceral leishmaniasis. Mol Bi- ochem Parasitol. 19: 35–43. World Health Organization Control of the leishmaniases (2010) Technical Re- port Series 949, Report of a meeting of the WHO Expert Committee on the Control of Leishmaniases. Ge- neva, 22–26 March. Yaghoobi-Ershadi MR (2012) Phlebotomine sand flies (Diptera: Psychodidae) in Iran and their role on Leishmania transmission. J Arthropod-Borne Dis. 6(1): 1–17. Tesh R (1995) Control of zoonotic visceral leishmaniasis: is it time to change strateries?. Am J Trop Med Hyg. 57: 287–292.