J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 60 http://jad.tums.ac.ir Published Online: March 14, 2017 Original Article Molecular Characterization and Phylogenetic Congruence of Hydropsyche sciligra (Tricoptera: Hydropsychidae) Using Mitochondrial and Nuclear Markers Naseh Maleki-Ravasan 1, Abbas Bahrami 2,3, Hassan Vatandoost 3, Mansoureh Shayeghi 3, Mona Koosha 3, *Mohammad Ali Oshaghi 3 1Malaria and Vector Research Group (MVRG), Biotechnology Research Center (BRC), Pasteur Institute of Iran (PII), Tehran, Iran 2Department of Medical Parasitology and Mycology, Faculty of Medicine, Alborz University of Medical Sciences, Alborz Province, Karaj, Iran 3Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran (Received 11 Apr 2015; accepted 18 Nov 2015) Abstract Background: Caddisflies have significant roles in freshwater ecosystems. Morphological identification is the major impediment in accurate species identification of Hydropsychids. Mitochondrial and nuclear markers are suitable for molecular systematics of these group of arthropods. Methods: Trichopteran specimens of Lavasan District in northeastern Tehran, Iran were collected in 2012, and de- scribed using the morphological and molecular characters of mitochondrial cytochrome c oxidase subunit I (mt-COI) and three expansion fragments of large subunit (LSU) nuclear ribosomal DNA (28S rDNA) D1, D2, and D3. The resemblance of the specimen sequences was obtained by conducting BLAST searches against the GenBank database and by using simple maximum likelihood clustering using COI, D1, D2, D3, and combination of D1-D2-D3 se- quence data sets. Results: Based on morphological traits the specimens were resembled to Hydropsyche sciligra however there were no its counterpart sequences in the GenBank. Due to lack of unique group of data set for each gene fragment, the specimens were associated with different taxa on molecular phylograms. The sequence contents of the COI, D1, D2, D3, and D1-D3 regions clustered H. sciligra with H. brevis, H. angustipennis, H. occidentalis, H. hedini, H. gra- hami, and H. longifurca/H. naumanni, respectively. Conclusion: Phylogenies obtained from combination of D1-D3 showed the highest bootstrap values for most of clades suggesting that long LSU-rDNA potentially is more useful for understanding phylogenetic relationships of caddisflies. A large-scale molecular and zoogeographic study on trichopteran species is suggested to revise and to develop the current knowledge of the caddisfly fauna and distributions in the country. Keywords: Caddisflies, Hydropsyche sciligra, COI, LSU rDNA, Molecular systematics Introduction Hydropsychid caddisflies (Trichoptera: Hydropsychidae) have significant importance due to their role as biomonitoring indicators, immense geographical distribution, and their ecological position in aquatic food webs (Geraci et al. 2010, Maleki-Ravasan et al. 2013a). They also are important for human and animal health since they are sources of severe allergy. For example, their extensive exuviae reason inhalant allergens or the tiny setae of their wings and bodies may cause swelling and soreness in the eyes of people who encounter these potential allergens. In addition, the newly emerged adults of cad- disflies may cause severe nuisance (Seshadri 1955, Fremling 1959, Corbet 1966). To date, more than 1600 hydropsychid species have been described worldwide *Corresponding author: Dr Mohammad Ali Oshaghi, E-mail: moshaghi@sina.tums.ac.ir J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 61 http://jad.tums.ac.ir Published Online: March 14, 2017 (Morse 2015). Genus Hydropsyche includes the most species lineages in all of Trichop- tera order with more than 500 described spe- cies and are distributed in Holarctic, Orien- tal, Afrotropical, and Australasian streams and rivers (Morse 2015). Hydropsyche lar- vae exhibit a wide range of pollution toler- ances (Resh and Unzicker 1975, Lenat 1993, Lenat and Resh 2001). Freshwater biomonitoring which involves identifying the species inhabiting an ecosys- tem to provide an ongoing assessment of wa- ter quality, promises to be an efficient and cost- effective method to manage water resources particularly in the countries with low precip- itations (Morse et al. 2007). Hence, species identification has become a prerequisite for any ecological study and biomonitoring ap- proach. Moreover, larva identification is im- portant for phylogenetic studies at higher level of trichopteran (Frania and Wiggins 1997). Although Hydropsychid caddisflies are among the most frequently encountered mac- ro-invertebrates in freshwater habitats and dis- plays a wide range of tolerance values (Lenat 1993), however, their application in biomon- itoring has been greatly impeded by the lack of identified and illustrated species, especial- ly in countries such as Iran, where Trichop- tera fauna was studied by non-autochthonous researchers (Schmid 1959, Malicky 1986, Mirmoayedi and Malicky 2002, Mey 2004, Malicky 2004, Chvojka 2006). Until recent- ly, 62 trichopteran species were known from Iran (Morse 2015). Morphological taxonomy of caddisflies is based on characters of adult male’s genitalia in association with its larva for species de- scription and illustration at species level. Con- ventional approaches to larval association usu- ally involve rearing larvae or morphological identification of metamorphotypes compris- ing mature pharate adult, larval sclerites, and pupal exuviae in the same pupal case (Milne 1938, Wiggins 1996). Both approaches work well when adequate resources and expertise are available (Resh 1972, Floyd 1995, Glover 1996). However, these approaches have some limitations in- cluding larvae that develop into adults no longer exist as larvae, and descriptions must be made from similar (deemed identical) in- dividuals. In addition, larval rearing is com- plicated by our imperfect understanding of species-specific microhabitat and water-chem- istry requirements, particularly for some groups such as hydropsychids. Metamorphotypes are relatively rare because that portion of the life cycle occurs for a short time only, which means that chance encounters play a signifi- cant role in metamorphotype associations. The molecular method for larval associa- tion could significantly accelerate the pro- cess of larval descriptions for a poorly known caddisfly fauna (Zhou et al. 2007). Recently, molecular methods have been developed for species determination and applied for differ- ent groups of insects at high or low level of phylogeny such as sand flies (Moin-Vaziri et al. 2007, Absavaran et al. 2009), mosquitoes (Oshaghi et al. 2003, 2006a, 2008, 2011, Mehravaran et al. 2011) and flies (Maleki- Ravasan et al. 2012). The main advantages of these methods are their sensitivity and specificity, independently of the stage, tissue or organ, live or dead of the specimen. The PCR-based species identification provides a convenient alternative for laboratories using primarily DNA-based techniques, and may be necessary when the study design already re- quires the use of individual DNA extractions for multiple purposes such as species con- firmation, determination of food in predators (Morales et al. 2003, Sheppard et al. 2005, Oshaghi et al. 2006b, Maleki-Ravasan et al. 2009, Li et al. 2011, Sint et al. 2011), finding symbiont flora (Dale and Moran 2006, Russell et al. 2012, Chavshin et al. 2012, 2014, 2015, Maleki-Ravasan et al. 2013b, 2015), infection status for various pathogens (Oshaghi et al. J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 62 http://jad.tums.ac.ir Published Online: March 14, 2017 2009a, 2009b, 2010), and population genetic studies (Oshaghi et al. 2007). Ribosomal DNA (rDNA) and cytochrome oxidase subunit I (COI) are the most widely used regions of the nuclear and mitochon- drial genome, respectively to infer genetic variations and phylogenetic relationships for a vast group of organisms. Among the mito- chondrion genes, the COI gene has been ex- tensively used for phylogenetic analysis by itself or in combination with nuclear genes, and has proven to be phylogenetically highly informative in many insect groups including trichopterans (Whiting et al. 1997, Hyliš et al. 2007, Sonnenberg et al. 2007, Zhou et al. 2009, Ishiwata et al. 2011, Johanson et al. 2012, Ruiter et al. 2013). In the present study, we aimed to provide and compare the sequences of three parts of rDNA (LSU rDNA D1, D2, D3) and COI genes for our poor morphologically identi- fied caddisfly specimens and to develop phy- logenetic topologies to identify or to bound species level for our caddisfly specimens. Materials and Methods Specimen collection This study was conducted in summer time of 2012 in Lavasan River, northeastern Teh- ran, Iran. Immature stages of trichopteran in- sects were collected using D-frame nets and replacing stones from riverbed where water run, riffle, or stream bank and trichopteran larvae stick their retreat under or beside the stones. The retreats that might dock juvenile insect preserved in 70% ethanol and trans- ferred to the School of Public Health (SPH) laboratory, Tehran University of Medical Sci- ences, Iran. The morphological characters of the extracted immature Trichoptera plus re- treats general feature were used to species identification using the morphological key (Pescador et al. 1995) under microscope (Olympus SZX12). DNA extraction, PCR, and sequencing Genomic DNA from larva and pharate adult was extracted using Qiagen DNeasy Tissue Kit (Qiagen, Hilden, Germany), which uses silica to bind DNA. The mt-COI gene ex- tending 690bp of 5' fragment as applied by (Lunt et al. 1996) was amplified using pri- mers of C1-J-2090 and C1-N-2735 (Table 1). The amplification was performed in 20μl reactions in premix ready to use kits under two thermal circulations. The first circulation started after initial denaturation at 94 °C for 2min, as follows: 5 cycles of 94 °C for 40s, 45 °C for 40s, and 72 °C for 1min. The second thermal cycle was repeated for 35 cycles for 94 °C for 40 s, 51°C for 40 s, and 72°C for 1 min followed by a final extension step at 72 °C for 5 min. Amplification of the nrDNA fragments was performed using 1µ L of genomic DNA from each specimen in 20- µ l reactions. The PCR mix was preheated at 94 °C for 3min followed by 40 cycles of 94 °C for 30s 60 °C for 45s, and 72 °C for 60 s. After 10min of final extension at 72 °C, the products were maintained at 4 °C. PCR products were visualized on a 1% aga- rose gel containing ethidium bromide using an UV transilluminator. The PCR products were directly sequenced by Seqlab (Gutten- berg, Germany). Sequences from both direc- tions were aligned and proofread with the program ChromasPro (version 1.2, Windows, Technelysium Pty Ltd, Tewantin, Queensland, Australia). Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1997) was used to compare the nucleotide sequences with data of NCBI database and to make sure cor- rect fragment amplification. Sequences of mt- COI and nrDNA regions were aligned with CLUSTALW as implemented in BioEdit (Hall 1999). Phylogenetic Analysis For phylogenetic analysis the sequences obtained in this study was combined with all of the D1, D2, D3, and COI sequences of the J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 63 http://jad.tums.ac.ir Published Online: March 14, 2017 Hydropsychid caddisflies available in Gen- Bank (Table 2) (http://www.ncbi.nlm). Due to the different lengths of the sequences, they were trimmed to obtain a consistent region for phylogenetic analysis. Pairwise sequence divergence, using Kimura’s two-parameter dis- tance algorithm, and the maximum likelihood trees presented herein were processed in MEGA 5.0 (Tamura et al. 2011). To combine three rDNA (D1, D2, D3) fragments we have to refine our analysis to the species that their sequences were available for the three frag- ments (Table 3). Phylogenetic analyses were performed on various datasets, including DNA of D1, D2, D3, and COI separately and com- bination of D1–D3 fragments. The reliability of the branching order was determined by 1000 bootstrap replications (Felsenstein 1985). Results The specimens were resembled to Hydro- psyche sciligra (Malicky 1977 Synonym: H. gracilis Martynov, 1909). PCR amplification was successfully per- formed for the mitochondrial and nuclear genes for the specimens as outlined in the material and method section. The lengths of PCR products were roughly 690bp for COI, and 330, 430, and 230bp for D1, D2, and D3 of LSU, respectively. The generated se- quences were deposited in GenBank data- base with accession numbers JX419389-96. The lengths of fragments used for phyloge- netic analysis were 570bp for COI, 269bp for D1, 397bp for D2, 162bp for D3, and 828bp for D1-D3. Sequence information of the data obtained in this study and the data retrieved from GenBank database for each fragment or combined dataset are summa- rized in tables 2 and 3 respectively. Cytochrome oxidase subunit I sequences were obtained for two specimens from Iran and 15 species from GenBank. COI length of the two specimens was 619bp, with three substitutions and their GC contents were 31% that is in agreement with known ade- nine/thymine (A/T)-rich content of mitochon- drial genes. D1 sequences were obtained for two specimens from Iran and compared with 21 species from GenBank. The D1 sequence length of both LD11 and PAD1 samples were 307bp with 8 substitutions and 56 and 57% GC contents respectively. D2 sequences of the Iranian specimens compared with 27 species from GenBank. The D2 sequence length of both LD12 and PAD2 samples were 419 bp with three substitutions and their GC contents were 66%. D3 sequences were ob- tained for the specimens from Iran and com- pared with 40 species from GenBank. The D3 sequence lengths of both samples were 318 bp with six substitutions and their 55–56% GC contents. D1–D3 sequences were ob- tained for the specimens and compared with 11 species from GenBank. The D1–D3 se- quence lengths of both specimens were 1044 bp with 17 substitutions and 60% GC content. Phylogenetic relevance based on COI sequence data showed affinity of the Iranian H. sciligra to H. brevis from West Palearctic ecozone with 30% bootstrap value (Fig. 1). The maximum likelihood tree topology based on D1 sequence data revealed that the Ira- nian Hydropsyche specimens were most close- ly related to H. occidentalis from Nearctic ecozone and H. angustipennis from East/ West Palearctic ecozone with 59% support (Fig. 2). Sequence analysis of D2 fragment re- vealed that the Iranian H. sciligra were as- sociated with H. hedini from Oriental ecozone with 23% bootstrap value. However, these pair species were associated with most of Hydropsyche including H. angustipennis, H. botosaneanui, H. instabilis, H. siltalai and H. saxonica from West Palearctic ecozone and formed a main clade with 99% support (Fig. 3). Tree topology based on D3 sequence data showed an association between the Iranian H. sciligra and H. cf graham from Oriental J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 64 http://jad.tums.ac.ir Published Online: March 14, 2017 part with only 31% support (Fig. 4). Phylo- genetic analysis using the combined dataset of D1-D3 fragments recovered the Iranian H. sciligra in affinity with H. longifurca from Southeast Africa and H. naumanni from In- donesia with 73% support (Fig. 5). General- ly, the bootstrap values were higher for long fragment of LSU than the individual frag- ments of LSU or even COI gene. However, the D2 fragment support strongly the mon- ophyly of most Hydropsyche species includ- ing H. sciligra, H. botosaneanui, H. an- gustipennis, H. hedini, H. instabilis, H. siltalai, and H. saxonica. Phylogenetic congruence of Iranian H. sciligra based on different genes and their worldwide distribution are shown in Table 4. Fig. 1. Phylogenetic relationship of Hydropsychid caddisflies inferred from 570bp of the mt-COI gene. Iranian samples are shown as JX419389-90. The bark beetle Hylesinus fraxini (Panzer, 1779) (Coleoptera: Scolytidae) used as out-group. Bootstrap values are shown at nodes. The scale of genetic distance is shown underneath J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 65 http://jad.tums.ac.ir Published Online: March 14, 2017 Table 1. Details of primers and PCR products used for amplification of caddisfly mitochondrial and nuclear genes Gene Name Primer name Sequence (5’ to 3’) PCR product (bp) Reference mt-COI COI C1-J-2090 AGTTTTAGCAGGAGCAATTACTAT ∼690 (Zhang and Hewitt 1997) C1-N-2735 AAAAATGTTGAGGGAAAAATG TTA nrDNA D1 D1–UP GGAGGAAAAGAAACTAACAAGGATT ∼330 (Geraci et al. 2010) D1–DN CAACTTTCCCTTACGGTACT D2 D2-UP GAGTTCAAGAGTACGTGAAACCG ∼430 D2-DN CCTTGGTCCGTGTTTCAAGAC D3 D3–UP ACCCGTCTTGAAACACGGAC ∼230 D3–DN CTATCCTGAGGGAAACTTCGGA Fig. 2. Phylogenetic relationship of Hydropsychid caddisflies inferred from 269bp of the 28S-D1-rDNA gene. Ira- nian samples are shown as JX419391-92. Bootstrap values are shown at nodes. The scale of genetic distance is shown underneath J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 66 http://jad.tums.ac.ir Published Online: March 14, 2017 Fig. 3. Phylogenetic relationship of Hydropsychid caddisflies inferred from 397bp of the 28S-D2-rDNA gene. Ira- nian samples are shown as JX419393-94. Bootstrap values are shown at nodes. The scale of genetic distance is shown underneath. J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 67 http://jad.tums.ac.ir Published Online: March 14, 2017 Fig. 4. Phylogenetic relationship of Hydropsychid caddisflies inferred from 162bp of the 28S-D3-rDNA gene. Ira- nian samples are shown as JX419395-96. Bootstrap values are shown at nodes. The scale of genetic distance is shown underneath. J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 68 http://jad.tums.ac.ir Published Online: March 14, 2017 Fig. 5. Phylogenetic relationship of Hydropsychid caddisflies inferred from 828bp of the 28S-D1-D2-D3-rDNA gene. Iranian samples are shown as JX419391-96. Bootstrap values are shown at nodes. The scale of genetic distance is shown underneath Table 2. Details of GenBank sequence data used for phylogenetic analysis. The two first rows obtained in this study Nuclear Large Subunit rRNA [28S] Mitochondrial Cyto- chrome Oxidase subunit I [mt-COI] D1 D2 D3 Hydropsyche sciligra LD11 (JX419391) Hydropsyche sciligra LD12 (JX419393) Hydropsyche sciligra LD13 (JX419395) Hydropsyche sciligra L190 (JX419389) Hydropsyche sciligra PAD1 (JX419392) Hydropsyche sciligra PAD2 (JX419394) Hydropsyche sciligra PAD3 (JX419396) Hydropsyche sciligra PA90 (JX419390) Hydropsyche angustipen- nis (EF417120) Hydropsyche an- gustipennis (EF417120) Parapsyche elsis (AF436341) Hylesinus fraxini (HM002626) Wormaldia triangulifera (AF436226) Mexipsyche furcula (EF513990) Wormaldia triangulifera (AF436345) Hydropsyche fezana hap- lotype 02 (HM134822) Hydropsyche occidentalis (AF436212) Herbertorossia quadrata (EF513918) Hydropsyche occidentalis (AF436332) Hydropsyche fezana hap- lotype 01 (HM134821) Cheumatopsyche lepida (EF417118) Cheumatopsyche lepida (EF417118) Arctopsyche grandis (AF436342) Hydropsyche pellucidula haplotype 10 (HM134819) Cheumatopsyche oxa (AF436213) Caledopsyche sp. (EU254421) Caledopsyche sp. (EU254458) Hydropsyche pellucidula haplotype 06 (HM134815) Plectropsyche hoogstraali (HM167451) Potamyia flava (HM167448) Hydropsyche cf. grahami (EU254462) Hydropsyche pellucidula haplotype 09 (HM134818) Calosopsyche continentalis HM167450 Hydromanicus sp. (EF513893) Hydropsyche sparna (HSU65201) Hydropsyche incognita haplotype 03 (HM134807) Mexipsyche cf grahami (EU312009) Mexipsyche nr rhombo- ana (EF513991) Smicridea sp. (EU254467) Hydropsyche incognita haplotype 04 (HM134808) J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 69 http://jad.tums.ac.ir Published Online: March 14, 2017 Orthopsyche fimbriata (EU250332) Hydropsychehedini (EF513985) Orthopsyche thomasi (EU254468) Hydropsyche incognita haplotype 02 (HM134806) Homoplectra flinti (EU312025) Hydropsyche instabilis (HM167440) Maesaipsyche sp. (EU254474) Hydropsyche incognita haplotype 01 (HM134805) Aoteapsyche colonica (AF436215) Hydropsyche botosane- anui (HM167436) Trichoptera environmental (DQ086620) Hydropsyche incognita haplotype 05 (HM134809) Hydropsyche naumanni (EU312012) Hydropsyche siltalai (HM167444) Diplectrona zealandensis (EU254475) Hydropsyche brevis (JQ687920) Hydropsyche longifurca (EU312026) Mexipsyche nr rhombo- ana (EF514025) Smicrophylax sp. (EU254457) Hydropsyche fezana (JQ687901) Ceratopsyche bronta (AF436214) Herbertorossia sp. (EF514022) Aoteapsyche colonica (AF436335) Hydropsyche lobata (KF255638) Cheumatopsyche afra (EU312016) Mexipsyche nr rhombo- ana (EF513992) Hydropsyche longifurca (EU254472 Hydropsyche exocellata (KF255625) Diplectrona metaqui (EU312024) Hydropsychesaxonica (HM167443) Hydropsyche naumanni (HM167457) Hydropsyche dinarica (KF255619) Hydatopsyche melli (EU312008) Mexipsyche nr rhombo- ana (EF513994) Ceratopsyche bronta (AF436334) Hydropsyche instabilis (KF255636) Hydromanicusu mbonatus (EU312010) Hydropsyche longifurca (EU254450) Homoplectra flinti (EU254471) Hydropsyche maroccana (JQ687916) Streptopsyche parander (HM167449) Aoteapsychecolonica (HM167438) Diplectrona metaqui (EU254470) Hydropsyche teruela (KF255660) Orthopsyche Thomasi (EU31202228) Hydropsyche naumanni (EU254434) Streptopsyche parander (HM167453) Hydropsyche modesta (JQ687913) Cheumatopsyche triangu- laris (EU312013) Ceratopsyche bronta (HM167437) Hydatopsyche melli (EU254461) Hydropsyche bulbifera (JQ687900) Diplectrona metaqui (EU254448) Cheumatopsyche afra (EU254465) Hydropsyche tibialis (JQ687923) Homoplectra flinti (EU254449) Hydromanicus umbonatus (EU254463) Streptopsyche parander (EU254455) Hydropsyche exocellata (JQ687958) Hydromanicusumbonatus (EU254432) Hydropsyche instabilis (JQ687954) Hydatopsyche melli (EU254430) Hydropsyche pellucidula (JQ687950) Cheumatopsyche afra (EU254438) Hydropsyche modesta (JQ687949) Mexipsyche nr grahami (EF514002) Hydropsyche siltalai (JQ687948) Hydropsyche nr for- mosana (EF513958) Hydropsychefontinalis JQ687947 Table 2. Continued… J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 70 http://jad.tums.ac.ir Published Online: March 14, 2017 Ceratopsyche serpentine (EF513917) Hydropsyche infernalis (JQ687946) Hydropsyche fezana (JQ687939) Hydropsyche lobata (JQ687929) Hydropsyche tibialis (JQ687962) Hydropsyche dinarica (JQ687959) Hydropsyche incognita (JQ687951) Hydropsyche brevis (JQ687932) Hydropsyche teruela (JQ687961) Hydropsycheiberomaroc- cana (JQ687937) Cheumatopsyche lepida (JQ687965) Hydropsyche bulbifera (JQ687928) Table 3. Details of the GenBank sequence data used for phylogenetic analysis of rDNA D1-D2-D3 loci Species Country GenBank accession numbers 28S D1 28S D2 28S D3 Hydropsyche sciligra (Larvae) Iran JX419391 JX419393 JX419395 Hydropsyche sciligra (Pharate adult) Iran JX419392 JX419394 JX419396 Streptopsyche parander Dominican HM167449 EU254455 HM167453 Aoteapsyche colonica New Zealand AF436215 HM167438 AF436335 Hydropsyche naumanni Indonesia EU312012 EU254434 HM167457 Hydromanicus umbonatus China EU312010 EU254432 EU254463 Hydatopsyche melli China EU312008 EU254430 EU254461 Diplectrona metaqui USA EU312024 EU254448 EU254470 Ceratopsyche bronta USA AF436214 HM167437 AF436334 Homoplectra flinti USA EU312025 EU254449 EU254471 Hydropsyche longifurca Southeast Africa Mozambique EU312026 EU254450 EU254472 Cheumatopsyche afra South Africa EU312016 EU254438 EU254465 Cheumatopsyche lepida West Palearctic EF417118 EF417118 JQ687965 Table 2. Continued… J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 71 http://jad.tums.ac.ir Published Online: March 14, 2017 Table 4. Details of phylogenetic congruence of Iranian Hydropsyche sciligra Gene Putative species (Accession number) Biogeographic Ecozone COI H. brevis (JQ687920) West Palearctic (France) D1 H. occidentalis (AF436212) Nearctic H. angustipennis (EF417120) East Palearctic, West Palearctic (Netherlands, Belgium, Ger- many, Sweden, United Kingdom, Luxembourg, Norway, Finland, France, Austria, Czech Republic, Italy, Denmark, Russia, Slovenia, Hungary, Croatia, Isle of Man, Switzerland, Ireland, Greece, Macedonia) D2 H. botosaneanui (HM167436) West Palearctic (Greece, Belgium, Luxembourg, Germany France, Netherlands, Italy, Monaco) H. angustipennis (EF417120) Like above H. hedini (EF513985) Oriental (China) H. instabilis (HM167440) West Palearctic (Europe and Northern Asia (excluding China)) H. siltalai (HM167444) West Palearctic: Europe and Northern Asia (excluding China) (Norway, Sweden, Finland) H. saxonica (HM167443) West Palearctic: Europe and Northern Asia (excluding China) Germany D3 H. cf. grahami (EU254462) Oriental (China) D1-D2-D3 H. longifurca (EU312026, EU254450, EU254472) Afrotropical (South Africa, Lesotho, Zimbabwe, Swaziland) H. naumanni (EU312012, EU254434, HM167457) Oriental (Indonesia) Discussion In this study, we found only samples of one species H. sciligra in Lavasan district lo- cated in northeastern of Tehran. This species is widespread in Iran, Turkey and Caucasus (Morse 2015). This species has previously been reported from various parts of northern Iran including Chalus, Makou, Qazvin, Minou- dasht, and northern parts of Alborz Mountains Chain (Mirmoayedi and Malicky 2002, Ivanov 2011). The discovery in Lavasan indicates that the dispersal area of this species is wider than currently known. Besides of this species, there are twelve species of Hydropsyche pre- viously reported from certain provinces or regions of Iran and neighboring countries as follows: H. consanguinea, H. demavenda, H. djabai, H. mahrkusha, H. ressli, H. sakara- waka, H. supersonica, H. iokaste, H. bujnurdi- ca, H. esfahanica, H. lundaki, and H. masula (Morse 2015). Mitochondrial genes (mtDNA) particu- larly COI are used most frequently in differ- ent phylogenetic levels of trichopteran in- cluding order, families, subfamilies, genera, and species levels (Myers et al. 2001, Kjer et al. 2001, 2002, Johanson 2007, Malm and Johanson 2008, Pauls et al. 2008, Previšić et al. 2009, Johanson et al. 2009, Johanson and Malm 2010, Johanson and Espeland 2010, Espeland and Johanson 2010a, Espeland and Johanson 2010b, Malm and Johanson 2011). However, in this study bootstrap values of phylogenetic tree nodes were not enough high to support strongly the caddisflies rela- tionship. It reflects lack of enough available data in GenBank than the phylogenetic util- ity of the gene. In this study, 28S nrDNA was selected due to the high frequent available sequence data for trichoperan species in GenBank, J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 72 http://jad.tums.ac.ir Published Online: March 14, 2017 which has provided good opportunity to com- pare our data with other trichopteran species. Nuclear ribosomal DNA belongs to a multi- gene family, where hundreds to thousands of copies of the nrDNA unit appear in tandem along the chromosome. Although individual fragments of the rDNA did not support well the topology of branches and clades in the trees, however, combination of three parts of the gene revealed the highest bootstrap val- ues for the constructed trees. The combina- tion of the three fragments (D1-D3) revealed 73% support value for association of H. sciligra with H. longifurca and H. nauman- ni. However, the limited number of trichop- teran species (n=11) involved in the study may decline power of this analysis. Between the COI and individual LSU fragments, D2 fragment strongly supported the monophyly of most Hydropsyche spe- cies. The D2 expansion fragment of 28S ri- bosomal RNA (rRNA) is one of the most highly variable regions in eukaryote rRNA. The length and nucleotide composition of this fragment is highly variable among in- sects (Gillespie et al. 2004). These signifi- cant variations limited the utility of D2 in deep-level phylogeny because of difficulties in alignment, although universally conserved RNA secondary structures have provided so- lutions for some taxa (Gillespie et al. 2004). Conclusion Many areas in Iran have not been or poor- ly investigated for caddisfly fauna. Hence, a large-scale zoogeographic study using mor- phological and molecular characters com- prising mitochondrial and nuclear markers together with population level sampling of all nominal taxa of trichopteran in poorly in- vestigated areas of the country is highly sug- gested. These studies will revise and im- prove the current knowledge of the caddisfly distributions of the country and will enable better-applied strategies in protection for this beneficial group of aquatic insects. Acknowledgements This work has been supported by Tehran University of Medical Sciences, Iran. Our sin- cere thanks also go to Dr Vladimir D Ivanov, an expert trichopterologists from Russia, who morphologically identified the specimens. The authors declare that there is no conflict of in- terests. References Absavaran A, Rassi Y, Parvizi P, Oshaghi MA, Abaie M, Rafizadeh S, Mohebali M, Zarea Z, Javadian E (2009) Iden- tification of sand flies of the subgenus Larroussius based on molecular and mor- phological characters in North Western Iran. Iran J Arthropod-Borne Dis. 3(2): 22–35. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI- BLAST: a new generation of protein database search programs. Nucleic Ac- ids Res. 25(17): 3389–3402. Chavshin AR, Oshaghi MA, Vatandoost H, Pourmand MR, Raeisi A, Enayati AA, Mardani N, Ghoorchian S (2012) Iden- tification of bacterial microflora in the midgut of the larvae and adult of wild caught Anopheles stephensi: a step to- ward finding suitable paratransgenesis candidates. Acta Trop. 121(2): 129–134. Chavshin AR, Oshaghi MA, Vatandoost H, Pourmand MR, Raeisi A, Terenius O (2014) Isolation and identification of culturable bacteria from wild Anophe- les culicifacies, a first step in a para- transgenesis approach. Parasit Vectors. 7: 419–426. Chavshin AR, Oshaghi MA, Vatandoost H, Yakhchali B, Zarenejad F, Terenius O J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 73 http://jad.tums.ac.ir Published Online: March 14, 2017 (2015) Malpighian tubules are important determinants of Pseudomonas transsta- dial transmission and longtime persis- tence in Anopheles stephensi. Parasit Vectors. 8: 36–42. Chvojka P (2006) Contribution to the knowledge of the caddisfly fauna (Tri- choptera) of Iran: description of new species and new distributional data. Acta Entomol Mus Nat Pragae. 46: 245–255. Corbet PS (1966) A quantitative method of assessing the nuisance caused by non- biting aquatic insects. Can Entomol. 93: 683–687. Dale C, Moran NA (2006) Molecular inter- actions between bacterial symbionts and their hosts. Cell. 126: 453–465. Espeland M, Johanson K (2010a) The effect of environmental diversification on species diversification in New Caledo- nian Orthopsyche and Caledopsyche caddisflies (Insecta: Trichoptera: Hy- dropsychidae). J Biogeogr. 37: 879–890. Espeland M, JohansonKA (2010b) The di- versity and radiation of the largest mon- ophyletic animal group on New Cal- edonia (Trichoptera: Ecnomidae: Ag- mina). J Evolution Biol. 2: 2112–2122. Felsenstein J (1985) Phylogenies and the com- parative method. Amer Nat. 125: 1–15. Floyd MA (1995) Larvae of the caddisfly genus Oecetis (Trichoptera: Leptoceri- dae) in North America, Ohio Biologi- cal Survey, College of Biological Sci- ences, Ohio State University. New Ser- ries 10: 1–85. Frania HE, Wiggins GB (1997) Analysis of morphological and behavioural evidence for the phylogeny and higher clas- sification of Trichoptera (Insecta), Life Sci Contrib R Ont Mus. 160: 1–62. Fremling CR (1959) Biology and possible control of economically important Tri- choptera and Ephemeroptera of the up- per Mississippi River. [PhD disserta- tion]. Iowa State University of Science and Technology, Ames, Iowa. Geraci CJ, Zhou X, Morse JC, Kjer KM (2010) Defining the genus Hydropsy- che (Trichoptera: Hydropsychidae) based on DNA and morphological evidence. J N Am Benthol Soc. 29: 918–933. Gillespie J, Cannone J, Gutell R, CognatoA (2004) A secondary structural model of the 28S rRNA expansion segments D2 and D3 from rootworms and related leaf beetles (Coleoptera: Chrysomelidae, Galerucinae). Insect Mol Biol. 13(5): 495–518. Glover JB (1996) Larvae of the caddisfly genera Triaenodes and Ylodes (Trichop- tera: Leptoceridae) in North America, Ohio Biological Survey, College of Bi- ological Sciences, Ohio State Univer- sity New Series 11. Hall TA (1999) BioEdit: a user-friendly bi- ological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symp Ser. 41: 95–98. Hyliš M, Oborník M, Nebesářová J, VávraJ (2007) Aquatic tetrasporoblastic micro- sporidia from caddis flies (Insecta, Tri- choptera): Characterization, phylogeny and taxonomic reevaluation of the gen- era Episeptum Larsson, 1986, Pyrothe- ca Hesse, 1935 and Cougourdella Hes- se, 1935. Eur J Protistol. 43(3): 205–224. Ishiwata K, Sasaki G, Ogawa J, Miyata T, Su ZH (2011) Phylogenetic relationships among insect orders based on three nuclear protein-coding gene sequences. Mol Phylogenet Evol. 58: 169–180. Ivanov VD (2011) Caddisflies of Russia: Fauna and biodiversity. Zoosymposia. 5: 171–209. Johanson KA (2007) Association and de- scription of males, females and larvae of two New Caledonian Xanthochore- ma species (Trichoptera: Hydrobiosidae) based on mitochondrial 16S and COI sequences. J Entomol Sci. 10: 179–199. J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 74 http://jad.tums.ac.ir Published Online: March 14, 2017 Johanson KA, Espeland M (2010) Phylog- eny of the Ecnomidae (Insecta: Tri- choptera). Cladistics. 26: 36–48. Johanson KA, Kjer K, Malm T (2009) Test- ing the monophyly of the New Zealand and Australian endemic family Conoe- sucidae Ross based on combined mo- lecular and morphological data (Insec- ta: Trichoptera: Sericostomatoidea). Zool Scripta. 38: 563–573. Johanson KA, Malm T (2010) Testing the monophyly of Calocidae (Insecta: Tri- choptera) based on multiple molecular data. Mol Phylogenet Evol. 54: 535–541. Johanson KA, Malm T, Espeland M, Weingart- ner E (2012) Phylogeny of the Pol- ycentropodidae (Insecta: Trichoptera) based on protein-coding genes reveal non-monophyletic genera. Mol Phylo- genet Evol. 65: 126–135. Kjer KM, Blahnik RJ, Holzenthal RW (2001) Phylogeny of Trichoptera (cad- disflies): characterization of signal and noise within multiple datasets. Syst Biol. 50: 781–816. Kjer KM, Blahnik RJ, Holzenthal RW (2002) Phylogeny of caddisflies (Insecta, Tri- choptera). Zool Scripta. 31: 83–91. Lenat DR (1993) A biotic index for the southeastern United States: derivation and list of tolerance values, with crite- ria for assigning water-quality ratings. J N Am Benthol Soc. pp. 279–290. Lenat DR, Resh VH (2001) Taxonomy and stream ecology-the benefits of genus- and species-level identifications. J N Am Benthol Soc. 20(2): 287–298. Li K, Tian J, Wang Q, Chen Q, Chen M, Wang H, Zhou Y, Peng Y, Xiao J, Ye G (2011) Application of a novel method PCR-ligase detection reaction for track- ing predator-prey trophic links in in- sect-resistant GM rice ecosystem. Eco- toxicol. 20(8): 2090–2100. Lunt DH, Zhang DX, Szymura JM, Hewitt GM (1996) The insect cytochrome ox- idase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect Mol Biol. 5(3): 153–65. Maleki-Ravasan N, Oshaghi MA, Afshar D, Arandian MH, Hajikhani S, Akhavan AA, Yakhchali B, Shirazi MH, Rassi Y, Jafari R, Aminian K, Fazeli-var- zaneh RA, Durvasulla R (2015) Aero- bic bacterial flora of biotic and abiotic compartments of a hyperendemic Zo- onotic Cutaneous Leishmaniasis (ZCL) focus. Parasit Vectors. 8: 63. Maleki-Ravasan N, Bahrami A, Shayeghi M, Oshaghi MA, Malek M, Mansoorian AB, Vatandoost H (2013a) Notes on the Iran Caddisflies and Role of Annu- lipalpian Hydropsychid Caddisflies as a Bio-monitoring Agent. J Arthropod- Borne Dis. 7(1): 71–82. Maleki-Ravasan N, Oshaghi MA, Hajikhani S, Saeidi Z, Akhavan AA, Gerami- Shoar M, Shirazi MH, Yakhchali B, Rassi Y, Afshar D (2013b) Aerobic microbial community of insectary pop- ulation of Phlebotomus papatasi. J Arthropod Borne Dis. 8(1): 69–81. Maleki-Ravasan N, Shayeghi M, Najibi B, Oshaghi MA (2012) Infantile Noso- comial Myiasis in Iran. J Arthropod- Borne Dis. 6(2): 156–163. Maleki-Ravasan N, Oshaghi MA, Javadian E, Rassi Y, Sadraei J, Mohtarami F (2009) Blood meal identification in field-cap- tured sand flies: comparison of PCR- RFLP and ELISA assays. Iran J Ar- thropod Borne Dis. 3(1): 8–18. Malicky H (1986) Die Köcherfliegen (Tri- choptera) des Iran und Afghanistans. Z Arbeitsgem Osterr Entomol. 38: 1–16. Malicky H (2004) Neue Köcherfliegen aus Europa und Asien. Braueria. 31: 36–42. Malm T, Johanson KA (2008) Revision of the New Caledonian endemic genus Gracilipsodes (Trichoptera: Leptoceri- dae: Grumichellini). Zool J Linnean Soc. 153: 425–452. J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 75 http://jad.tums.ac.ir Published Online: March 14, 2017 Malm T, Johanson KA (2011) A new clas- sification of the long-horned caddisflies (Trichoptera: Leptoceridae) based on molecular data. BMC Evol Biol. 11(1): 10–26. Mehravaran A, Oshaghi MA, Vatandoost H, Abai M, Ebrahimzadeh A, Roodi AM , Grouhi A (2011) First report on Anophe- les fluviatilis U in southeastern Iran. Acta Trop. 117(2): 76–81. Mey W (2004) Beitrag zur Trichoptera-Fauna Armeniens und des Iran (Trichoptera). Entomol Nachr Ber. 48: 81–87. Milne MJ (1938) The "Metamorphotype Meth- od" in Trichoptera. J N Y Entomol Soc. 46: 435–437. Mirmoayedi A, Malicky H (2002) An up- dated checklist of caddisflies (Insecta, Trichoptera) from Iran, with new rec- ords. Zool Middle East. 26: 163–168. Moin-Vaziri V, Depaquit J, Yaghoobi-Ershadi MR, Oshaghi MA, Derakhshandeh-Pey- kar P, Ferte H, Kaltenbach M, Bargues MD, Leger N, Nadim A (2007) Intra- specific variation within Phlebotomus sergenti (Diptera: Psychodidae) based on mtDNA sequences in Islamic Re- public of Iran. Acta Trop. 102(1): 29–37. Morales ME, Wesson DM, Sutherland IW, Impoinvil DE, Mbogo CM, Githure JI, Beier JC (2003) Determination of Anoph- eles gambiae larval DNA in the gut of insectivorous dragonfly (Libellulidae) nymphs by polymerase chain reaction. J Am Mosq Control Assoc. 19: 163–165. Morse JC (ed.) (2015) Trichoptera World Checklist. Available at: http://entweb. clemson.edu/database/trichopt/index.htm [Accessed 26 October 2015]. Morse JC, Bae YJ, Munkhjargal G, Sangpra- dub N, Tanida K, Vshivkova TS, Wang B, Yang L, Yule CM (2007) Freshwa- ter biomonitoring with macroinverte- brates in East Asia. Front Ecol Envi- ron. 5(1): 33–42. Myers MJ, Sperling F, Resh V (2001) Dispersal of two species of Trichoptera from desert springs: Conservation implications for isolated vs connected populations. J Insect Conserv. 5: 207–215. Oshaghi MA, Sedaghat M, Vatandoost H (2003) Molecular characterization of the Anopheles maculipennis complex in the Islamic Republic of Iran. East Mediterr Health J. 9(4): 659–666. Oshaghi MA, Shemshad K, Yaghobi-Ershadi M, Pedram M, Vatandoost H, Abaie M, Akbarzadeh K, Mohtarami F (2007) Genetic structure of the malaria vector Anopheles superpictus in Iran using mi- tochondrial cytochrome oxidase (COI and COII) and morphologic markers: a new species complex? Acta Trop. 101 (3): 241–248. Oshaghi MA, Vatandoost H, Gorouhi A, Abai M, Madjidpour A, Arshi S, Sadeghi H, Nazari M, Mehravaran A (2011) Anopheline species composition in borderline of Iran-Azerbaijan. Acta Trop. 119(1): 44–49. Oshaghi MA, Yaaghoobi F, Abaie M (2006a) Pattern of mitochondrial DNA varia- tion between and within Anopheles ste- phensi (Diptera: Culicidae) biological forms suggests extensive gene flow. Acta Trop. 99(2–3): 226–233. Oshaghi MA, Chavshin AR, Vatandoost H (2006b) Analysis of mosquito blood- meals using RFLP markers. Exp Para- sitol. 114(4): 259–264. Oshaghi M, Yaghobi-Ershadi M, Shemshad K, Pedram M, AmaniH (2008) The Anopheles superpictus complex: intro- duction of a new malaria vector com- plex in Iran. Bull Soc Pathol Exot. 101: 429–434. Oshaghi MA, Rasolian M, Shirzadi MR, Moh- tarami F, Doosti S (2010) First report on isolation of Leishmania tropica from sandflies of a classical urban Cutaneous leishmaniasis focus in southern Iran. Exp Parasitol. 126(4): 445–450. J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 76 http://jad.tums.ac.ir Published Online: March 14, 2017 Oshaghi MA, Ravasan NM, Hide M, Ja- vadian EA, Rassi Y, Sadraei J, Mohe- bali M, Sedaghat MM, Hajjaran H, Zarei Z (2009a) Phlebotomus perfil- iewi transcaucasicus is circulating both Leishmania donovani and L. infantum in northwest Iran. Exp Parasitol. 123 (3): 218–225. Oshaghi MA, Ravasan NM, Javadian EA, Mohebali M, Hajjaran H, Zare Z, Mohtarami F, Rassi Y (2009b) Vector incrimination of sand flies in the most important visceral leishmaniasis focus in Iran. Am J Trop Med Hyg. 81(4): 572–577. Pauls SU, Graf W, Haase P, Lumbsch HT, Waringer J (2008) Grazers, shredders and filtering carnivores-the evolution of feeding ecology in Drusinae (Tri- choptera: Limnephilidae): insights from a molecular phylogeny. Mol Phyloge- net Evol. 46: 776–791. Pescador ML, Rasmussen AK, Harris SC (1995) Identification manual for the caddisfly (Trichoptera) larvae of Flor- ida. Fla Dept Environ Prot, Tallahas- see, FL. Previšić A, Walton C, Kučinić M, Mitrikeski PT, Kerovec M (2009) Pleistocene di- vergence of Dinaric Drusus endemics (Trichoptera, Limnephilidae) in multiple microrefugia within the Balkan Penin- sula. Mol Ecol. 18: 634–647. Resh VH (1972) A technique for rearing caddisflies (Trichoptera). Can Entomol. 104: 1959–1961. Resh VH, Unzicker JD (1975) Water quality monitoring and aquatic organisms: the importance of species identification. J Water Pollut Control Fed. 47: 9–19. Ruiter DE, Boyle EE, Zhou X (2013) DNA barcoding facilitates associations and diagnoses for Trichoptera larvae of the Churchill (Manitoba, Canada) area. BMC Ecol. 13(1): 5–43. Russell JA, Funaro CF, Giraldo YM, Goldman- Huertas B, Suh D, Kronauer DJ, Moreau CS, Pierce NE (2012) A ver- itable menagerie of heritable bacteria from ants, butterflies, and beyond: broad molecular surveys and a system- atic review. PloS One. 7(12): e51027. Schmid F (1959) Trichoptères d'Iran. Akad- emie-Verlag. Sheppard S, Bell J, Sunderland K, Fenlon J, Skervin D, Symondson W (2005) De- tection of secondary predation by PCR analyses of the gut contents of inverte- brate generalist predators. Mol Ecol. (14): 4461–4468. Seshadri AR (1955) An extraordinary out- break of caddis flies (Trichoptera) in the Meltrudam township area of Salem district, South India. S Indian J En- tomol. 3: 337–340. Sint D, Raso L, Kaufmann R, Traugott M (2011) Optimizing methods for PCR- based analysis of predation. Mol Ecol Resour. 11(5): 795–801. Sonnenberg R, Nolte AW, Tautz D (2007) An evaluation of LSU rDNA D1-D2 sequences for their use in species iden- tification. Front Zool. 4(1): 6–17. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analy- sis using maximum likelihood, evolu- tionary distance, and maximum parsi- mony methods. Mol Biol Evol. 28(10): 2731–2739. Whiting MF, Carpenter JC, Wheeler QD, Wheeler WC (1997) The Strepsiptera problem: phylogeny of the holometab- olous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Syst Biol. 46: 1–68. Wiggins GB (1996) Larvae of the North American caddisfly genera (Trichop- tera), University of Toronto Press To- ronto, p. 457. Zhang DX, Hewitt GM (1997) Insect mito- chondrial control region: a review of J Arthropod-Borne Dis, March 2017, 11(1): 60–77 N Maleki-Ravasan et al.: Molecular Characterization … 77 http://jad.tums.ac.ir Published Online: March 14, 2017 its structure, evolution and usefulness in evolutionary studies. Biochem Sys Ecol. 25: 99–120. Zhou X, Adamowicz SJ, Jacobus LM, Dewalt RE, Hebert PD (2009) Towards a comprehensive barcode library for arc- tic life-Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Can- ada. Front Zool. 6: 30–39. Zhou X, Kjer KM, Morse JC (2007) Asso- ciating larvae and adults of Chinese Hydropsychidae caddisflies (Insecta: Trichoptera) using DNA sequences. J N Am Benthol Soc. 26(4): 719–742.