327j contemp med sci | vol. 8, no. 5, september-october 2022: 327–328 original femoral and popliteal artery pathway in varus and valgus aligned lower limb; a ct angiographic study seyed morteza kazemi1, sohrab keyhani1, mohamad qoreishi2, saman shakeri jousheghan2*, reza minaei noshahr1* 1bone joint and related tissues research center, akhtar orthopedic hospital, shahid beheshti university of medical sciences, tehran, iran. 2clinical research & development unit, akhtar hospital, shahid beheshti university of medical sciences, tehran, iran. *correspondence to: both authors fulfill the criteria of shared correspondence saman shakeri jousheghan, reza minaei noshahr (email: dr.saman.shakeri.1989@gmail.com) (submitted: 09 march 2022 – revised version received: 12 april 2022 – accepted: 21 april 2022 – published online: 26 october 2022) abstract objectives: the aim of this study was to compare the femoral and popliteal arteries pathway in varus and valgusaligned lower limbs. methods: a retrospective ct angiography (cta) study from october to december 2021 was conducted. distance of the femoral and popliteal artery to specific bony landmarks in thigh and knee was measured. results: eighty limbs including 40 varus and 40 valgus lower limbs were assessed. no significant difference between varus/valgus groups in terms of distances was noted. conclusion: our study compared pathway of pa and fa artery in varus and valgus knees using cta images; and no significant differences was seen between the two groups of varus and valus. keywords: femoral artery, popliteal artery, anatomy, varus alignment, valgus alignment, knee issn 2413-0516 introduction determining the pathway of the femoral and popliteal artery (fa and pa) is an essential step in performing surgical or radiological procedures. fa exits from the adductor canal then entering popliteal fossa posterior to the tibia plateau turning into popliteal artery.1-3 the pathway might vary in accordance with lower limb different alignments-varus or valgusin individuals. procedures in the area of distal femur or proximal tibia could be risky in terms of vascular complications as the adjacency of the arteries to the surgical cuts has been incompletely addressed in literature. limited studies are available to quantitatively describe the anatomic location of the fa and popliteal artery in relation to the shaft of the femur and tibia for a surgical approach guide in such region.4-6 the aim of this study was to compare the femoral and popliteal arteries pathway in varus and valgusaligned lower limbs. methods we carried out a retrospective study reviewing archived data images of patients aged 18–60 yrs undergoing lower limbs ct angiography (cta) from october to december 2021. the study design was approved by shahid beheshti university of medical sciences ethics research board. cases with pelvic, thigh and tibia fractures, and low-quality images were excluded. sixty cases -80 limbs: 40 varus/40 valgus-were assessed using two-dimensional (2d) and three-dimensional (3d) reconstructions cta (16-slice ct scanner, siemens, germany 2018). the perpendicular distance of the fa to medial, lateral and posterior cortex at the adductor tubercle and knee medial joint line was measured. the distances of the popliteal artery to the medial, lateral and posterior border of proximal tibia were also measured in axial images. parametric variables were given as mean ± sd; variables were analyzed with student t-test. nonparametric variables were reported as a median and range. the statistically significant threshold was p < 0.05. results eighty limbs including 40 varus (32 male, 8 females) and 40 valgus (19 males, 21 females) were assessed; mean age of participants was 41 ± 16 years (20–59 yr range) were included. there was detected no significant difference between varus/ valgus groups in terms of distances. also no statistically significant difference by age, limb side and sex were seen (p = 0.31). the average distance of the fa to the femoral cortex was 15.13/14.11 mm posteriorly, 26.30/27.40 mm medially, and 33.17/33.14 mm laterally at adductor tubercle level (varus/ valgus). the average distance for the popliteal artery to the tibial cortex were 5.68/5.34 mm posteriorly, 21.75/21.25 mm medially, and 13.85/13.25 mm laterally at fibular head level (varus/valgus). other distances to the specific anatomic levels are reported in table 1. no significant differences were noted between the two varus and valgus groups (p > 0.05). discussion damage to the neurovascular structures is a major operative complication of around the knee procedures.7-9 knowing the pathway of arteries in lower limbs espacially in both varus and valgus limbs could be helpful; the most important finding of our study was to compare distances of femoral and popliteal arteries to bony landmarks in both varus and valgus knees. no similar study was available to compare the results; only some reports have given limited data; a report9 showed that any kind of osteotomies occurred in knee could impose the risk of vascular injuries. another study evaluated cta in cadavers after the mipo interventions and found no disruptions in deep and superficial femoral arteries.10 previous studies assessed 2-d cta and reported the fa had at least 12 mm distance to the medial cortex of femur through its way;6 also reported that fa mailto:dr.saman.shakeri.1989@gmail.com 328 j contemp med sci | vol. 8, no. 5, september-october 2022: 327–328 fa and pa pathway in varus and valgus aligned lower limb original s.m. kazemi et al. was placed about 16 mm far from the borders of distal femur at minimum.11 a mri-based study detailed that the average distance between the pa and the tibia posterior cortex at the level of the knee joint was about 9.5 mm.12 being familiar with the pathway of the femoral and popliteal artery especially in both knee alignments -varus or valgus is important for managing fractures.1,2,8 the adductor tubercle, medial femoral condyle and fibular head would be imperative bony indices which are distinguished on imagings, so accurate orientations to the artery distance o such landmarks help surgeons decrease complications in operations.4,6,11-13 conclusion this study was focused on comparing pathway of femoral and popliteal artery in distal thigh and around the knee in both varus and valgus knees using cta images; no significant differences was reported between the two groups in our findings. conflicts of interest none.  this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. table 1. average distance of femoral and popliteal artery to considered anatomic points anatomic level distance to midline posterior cortex (mm) distance to posterior medial border cortex (mm) distance to posterior lateral border cortex (mm) p varus valgus varus valgus varus valgus femur just above adductor tubercle 15.13 ± 4.23 14.11 ± 2.13 26.30 ± 3.47 27.40 ± 3.14 33.17 ± 2.02 33.14 ± 3.02 0.33 level of knee joint line 3.23 ± 3.41 3.18 ± 2.31 21.20 ± 3.04 21.20 ± 3.04 19.25 ± 2.51 19.35 ± 3.22 0.29 tibia at the level of fibular head 5.68 ± 2.45 5.34 ± 2.62 21.75 ± 3.40 21.25 ± 3.31 13.85 ± 2.32 13.25 ± 2.65 0.30 tibia at the level of 5 cm below the knee joint line 10.58 ± 3.45 11.15 ± 3.15 19.55 ± 2.57 19.75 ± 2.45 12.30 ± 2.90 12.55 ± 2.70 0.28 references 1. shim s-s, leung g. blood supply of the knee joint. a microangiographic study in children and adults. clinical orthopaedics and related research. 1986(208):119–25. 2. olewnik ł, łabętowicz p, podgórski m, polguj m, ruzik k, topol m. variations in terminal branches of the popliteal artery: cadaveric study. surgical and radiologic anatomy. 2019;41(12):1473–82. 3. ricciardi a. thieme atlas of anatomy: general anatomy and musculoskeletal system. the yale journal of biology and medicine. 2015;88(1):100. 4. henry ak. extensile exposure: edinburgh; 1957. 5. hoppenfeld s, deboer p, buckley r. surgical exposures in orthopaedics: the anatomic approach: lippincott williams & wilkins; 2012. 6. kim j, allaire r, harner cd. vascular safety during high tibial osteotomy: a cadaveric angiographic study. the american journal of sports medicine. 2010;38(4):810–5. 7. visser j, brinkman j-m, bleys r, castelein r, van heerwaarden r. the safety and feasibility of a less invasive distal femur closing wedge osteotomy technique: a cadaveric dissection study of the medial aspect of the distal femur. knee surgery, sports traumatology, arthroscopy. 2013;21(1):220–7. 8. narulla rs, kanawati aj. safe zone for the superficial femoral artery demonstrated on computed tomography angiography. injury. 2016;47(3):748–51. 9. bisicchia s, rosso f, pizzimenti ma, rungprai c, goetz je, amendola a. injury risk to extraosseous knee vasculature during osteotomies: a cadaveric study with ct and dissection analysis. clinical orthopaedics and related research®. 2015;473(3): 1030–9. 10. jiamton c, apivatthakakul t. the safety and feasibility of minimally invasive plate osteosynthesis (mipo) on the medial side of the femur: a cadaveric injection study. injury. 2015;46(11):2170–6. 11. kim jj, oh hk, bae j-y, kim jw. radiological assessment of the safe zone for medial minimally invasive plate osteosynthesis in the distal femur with computed tomography angiography. injury. 2014;45(12):1964–9. 12. goes rfda, cardoso filho a, castro gnpdo, loures fb, palma imd, kinder a, et al. magnetic resonance study on the anatomical relationship between the posterior proximal region of the tibia and the popliteal artery☆. revista brasileira de ortopedia. 2015;50: 422–9. 13. iacono f, lo presti m, bruni d, raspugli gf, bignozzi s, sharma b, et al. the adductor tubercle: a reliable landmark for analysing the level of the femorotibial joint line. knee surgery, sports traumatology, arthroscopy. 2013;21(12):2725–9. https://doi.org/10.22317/jcms.v8i5.1280 167j contemp med sci | vol. 3, no. 9, winter 2017: 167–169 research elastic band ligation of hemorrhoids using flexible gastroscope hadi abd zaid al-khattabi,a ali azeez ali,a hameed hussein al-jameel,a ali mansoor al-amerib aal-hussein medical city, kerbala, iraq. bdepartment of microbiology and immunology, department of microbiology and immunology, college of medicine, university of kerbala, iraq. correspondence to hadi abd zaid al-khattabi (email: alkattabih12@yahoo.com). (submitted: 23 september 2016 – revised version received: 14 october 2016 – accepted: 20 october 2016 – published online: 26 march 2017) objective this study aims at investigating the outcome of rubber band ligation of piles in an outpatient setting. methods after taking an informed consent, 46 patients, 89% of them were males, mean age 52.5 years, with uncomplicated grade ii-iii piles were involved in the study. rubber band ligation of piles was made by pentax iscan gastroscope. the patients were followed up regularly to record any complication. results most of the patients (91.3%) need one session of treatment, 3 patients need 2 sessions, no more than 2 bands were used. additionally, a relatively low percentage of patients recorded certain complication of the operation, on follow up. conclusion high success rate, cost effectiveness and the simplicity of rubber band ligation as an outpatient procedure promote its use as the first line of treatment for first, second and early third degree hemorrhoids. keywords band ligation, internal piles, flexible gastroscope, outpatient setting introduction internal hemorrhoids are initially managed conservatively. the conservative therapy includes life-style changes such as increased fiber and liquid intake and regular cleansing. this might be combined with local anesthetic and antiphlogistic medication.1,2 more than 90% of patients with symptomatic piles can be treated conservatively or by rubber band ligation. infrared coagulation and cryotherapy are also the options, but are no longer commonly applied.3 since the early 1960s, the treatment of choice for persisting internal hemorrhoids is elastic band ligation by means of a rigid proctoscope (barron ligation).4,5 the ligation of hemorrhoids is widely used as an alternative method for the treatment of internal symptomatic hemorrhoids and has replaced hemorrhoidectomy in 45% of cases.6 this method gives good results in 69–94% of cases. although it is not associated with the problems that follow the typical surgical treatment of hemorrhoids.7–10 the rbl method is not free of complications and even deaths have been reported in immunosuppressed patients.11,12 though considered as a safe, simple and effective procedure, studies show complications like recurrence, pain, bleeding and even pelvic sepsis in some cases. there is a wide range of recurrence rate from 8 to 30%, greatest for grade iii hemorrhoids. pain is common for a few hours following rubber band ligation (rbl) and occasionally patients experience severe pain so as to require admission to hospital.13-16 on the other hand, a flexible endoscope with a ligation cap that is employed for the ligation of esophageal varices was tested to treat internal piles by some researchers.17-20 the advantages of a flexible endoscope might be summarized by maneuverability beside photographic documentation and a wider view field. materials and methods forty-six patients with uncomplicated hemorrhoids (abscess, thrombosis) grade ii-iii were involved in the study (table 1). patients were sedated by slow i.v. using diluted medazolam 3 mg and pethedine 50 mg. pentax iscan gastroscope was used with multiband ligator device (cook, usa) and the same was used in esophageal varices ligation. the hemorrhoids were suctioned into the ligation cap in either retrograde or ante grade fashion. one or two hemorrhoids were ligated in each session. all treatment sessions were performed in an outpatient setting. patients were encouraged to consult the hospital at any time and provided with facilities to contact us at any time if developed any abnormal events. result forty-six patients, mean age 52.5 years (30–75) and most of them were males (89%), were included in this study. most of them referred from the surgical department. a total of 45 patients were presented with a history of attacks of bleeding. one patient presented with active bleeding, and she was unfit for surgical intervention. most of patients need one session of treatment, 3 patients need two sessions, no more than 2 bands were used (table 2). on follow-up, a relatively low percentage of patients recorded certain complication of the operation as listed in table 3. discussion hemorrhoid is a disease of all ages, gender and socioeconomic status. this study shows high male proportion. this is also found in many other studies in karachi. shamim et al. also show a male predominance of 74.88%.21 it has been found that the treatment of choice is proctoscope-guided rubber band ligation and that it is cost effective. other works are trying to evaluate usefulness of new techniques.22–24 similarly, the use of a flexible endoscope for hemorrhoidal elastic band ligation was further analyzed using video endoscopic anoscopy and a single-handed ligator.24–26 these studies conclude that it is a safe and efficient method with some advantages, although costs are still a major drawback. cazemier compared the two procedures, and he concluded that both techniques were easy to perform, issn 2413-0516 168 j contemp med sci | vol. 3, no. 9, winter 2017: 167–169 elastic band ligation of hemorrhoids using flexible gastroscope research hadi abd zaid al-khattabi et al. pain and discomfort after the procedure. this may last for a few days till the banded portion get necrosed and sloughed off. this is more common in large prolapsing hemorrhoids with a wider base. some studies evaluated the use of a flexible endoscope equipped with a ligation cap, normally used for the ligation of esophageal varices, in treating hemorrhoids.16–28 a study from iran shows that, with rubber band ligation, 26% of patients reported mild and moderate pain and 1% complained of severe pain.28 a recent study from faisalabad show that 60% of patients developed mild to moderate bleeding in the first postoperative week.29 bernal show that 32% of the patients referred pain after ligation and 13.81% of cases were operated due to persistent rectal bleeding or hemorrhoidal prolapsed.13 in summary, endoscopic ligation is an effective, safe treatment and is comparable with proctoscopic ligation. however, the treatment is more expensive. conclusion rubber band ligation is simple and cost effective procedure with a high success rate, and, as an outpatient procedure, promotes its use as the first line of treatment for first, second and early third degree hemorrhoids. conflict of interest none. n table 1. frequency distribution of grade of piles in forty-six patients involved in the study no. hemorrhoid degree no.(%) 1 1st degree – (0%) 2 2nd degree 16 (34.7%) 3 3rd degree 30 (65.3%) 4 4th degree – (0 %) total 46 (100%) table 3. frequency distribution of complications of the rbl operation no. complications no. 1 pain 2 2 bleeding 2 3 thrombosis 0 4 ulceration 0 5 fall of elastic band 0 table 2. number of sessions of rbl treatment in the included patients rbl sessions degree of hemorrhoids no.( % ) 2nd degree 3rd degree single ligation 16 26 42 (91.3) two sessions 0 4 4 (8.7) well-tolerated and efficient.26 it was easier to perform more ligations with the flexible endoscope. no serious adverse events were reported. additional advantages of the flexible scope were the maneuverability and photographic documentation. treatment with the flexible endoscope seemed to be more painful and was more expensive. and he explained the more pain sensation by the learning curve he had to deal with and that more bands could be applied.27 in contrast, wehrmann et al. found no significant difference in pain.28 many studies evaluated the patients with threedimensional endosonography for the presence of possible sphincter defects and changes in the submucosa. they found no difference in the appearance of the anal configuration after treatment with either rubber band ligation or infrared coagulation,1 and these endosonographic findings confirmed that band ligation is a safe technique. pain or perianal discomfort is the commonest complaints after rubber band ligation.13,15 anorectal mucosa is sensitive to pain below dentate line. application of bands at or below this line cause considerable fig 1. rubber band ligation (rbl) of hemorrhoids is a widely used method for treatment of piles. references 1. poen ac, felt-bersma rj, cuesta ma, deville w, meuwissen sg. a randomized controlled trial of rubber band ligation versus infra-red coagulation in the treatment of internal haemorrhoids. eur j gastroenterol hepatol. 2000;12:535–539. 2. johanson jf, sonnenberg a. the prevalence of hemorrhoids and chronic constipation. an epidemiologic study. gastroenterology. 1990;98:380–386. 3. madoff rd, fleshman jw. american gastroenterological association technical review on the diagnosis and treatment of hemorrhoids. gastroenterology. 2004;126:1463–1473. 4. blaisdell pc. office ligation of internal hemorrhoids. am j surg. 1958;96:401–404. 5. barron j. office ligation of internal hemorrhoids. am j surg. 1963;105:563–570. hadi abd zaid al-khattabi et al. 169j contemp med sci | vol. 3, no. 9, winter 2017: 167–169 research elastic band ligation of hemorrhoids using flexible gastroscope 6. bleday r, pena jp, rothenberger da, goldberg sm, buls jg: symptomatic hemorrhoids: current incidence and complications of operative therapy. dis colon rectum. 1992;35:477–481. 7. gehamy ra, weakley fl: internal hemorrhoidectomy by elastic ligation. dis colon rectum. 1974;17:347–353. 8. arabi y, gate house d, alexander-williams j, keighley mr: rubber band ligation or rectal subcutaneous sphincterotomy for treatment of hemorrhoids. br j surg. 1977;64:739–740. 9. muller ca:internal hemorrhoidectomy by rubber band ligation. proctology. 1980;5:317–319. 10. wrobleski de, corman ml, veidenheimer mc, coller ja: long-term evaluation of rubber ring ligation in hemorrhoidal disease.dis colon rectum. 1980;23:478–482. 11. o’hara vs:fatal clostridial infection following hemorrhoid banding. dis colon rectum. 1980;23:570–571. 12. russell tr, donohue jh: hemorrhoidal banding: a warning. dis colon rectum. 1985;28:291–293. 13. bernal jc, enguix m, lopez garcia j, garciaromero j, trullenque peris. rubber-band ligation for hemorrhoids inacolorectal unit. a prospective study. rev esp enferm dig org ofic soc esp patologia dig. 2005;97(1):38–45. 14. iyer vs, shrier i, gordon ph: long-term outcome of rubber band ligation for symptomatic primary and recurrent internal hemorrhoids.dis colon rectum. 2004;47(8):1364–1370. 15. komborozos va, skrekas gj, pissiotis ca:rubber band ligation of symptomatic internalhemorrhoids: results of 500 cases. dig surg. 2000;17(1):71–76. 16. forlini a, manzelli a, quaresima s, forlini m: long-term result aft errubber band ligation for haemorrhoids. int j color dis. 2009;24(9):1007–1110. 17. trowers ea, ganga u, rizk r, ojo e, hodges d. endoscopic hemorrhoidal ligation: preliminary clinical experience. gastrointest endosc. 1998; 48: 49-52. 18. qureshi s, aziz t, afzal a, maher m.rubber band ligation of symptomatic internal haemorrhoids; result of 450 cases. j surg pak. 2009;14(1):19–22. 19. dickey w, garrett d. hemorrhoid banding using videoendoscopic anoscopy and a single-handed ligator: an effective, inexpensive alternative to endoscopic band ligationdickey w, garrett d. hemorrhoid banding using videoen. am j gastroenterol. 2000;95:1714–1716. 20. rehan abbas khan, muhammad iqbal, farhan zaheer, khalid ahsan malik, anis uz zaman, rubber band ligation for the symptomatic hemorrhoids. what troubles the patient? pak j surg. 2012;28(4):266–270. 21. takano m, iwadare j, ohba h, takamura h, masuda y, matsuo k, et al. sclerosing therapy of internal hemorrhoids with a novel sclerosing agent. comparison with ligation and excision. int j colorectal dis. 2006;21:44–51. 22. kwok sy, chung cc, tsui kk, li mk. a double-blind, randomized trial comparing ligasure and harmonic scalpel hemorrhoidectomykwok sy, chung cc, tsui kk, li mk. a double-blind, randomized trial comparing ligasure and harmonic scalpel hem. dis colon rectum. 2005;48:344–348. 23. fukuda a, kajiyama t, kishimoto h, arakawa h, someda h, sakai m, seno h, chiba t. colonoscopic classification of internal hemorrhoids: usefulness in endoscopic band ligation. j gastroenterol hepatol. 2005;20:46–50. 24. trowers ea, ganga u, rizk r, ojo e, hodges d. endoscopic hemorrhoidal ligation: preliminary clinical experience. gastrointest endosc. 1998;48:49–52. 25. dickey w, garrett d. hemorrhoid banding using video endoscopic anoscopy and a single-handed ligator: an effective, inexpensive alternative to endoscopic band ligation. am j gastroenterol. 2000;95:1714–1716. 26. cazemier m, felt-bersma rjf, cuesta ma, mulder cjj. elastic band ligation of hemorrhoids:flexible gastroscope or rigid proctoscope? world j gastroenterol. 2007;13:585–587. 27. wehrmann t, riphaus a, feinstein j, stergiou n. hemorrhoidal elastic band ligation with flexible videoendoscopes: a prospective, randomized comparison with the conventional technique that uses rigid proctoscopes. gastrointest endosc. 2004;60:191–195. 28. azizi r, rabani-karizi b, taghipour ma. comparison between ultroidand rubber band ligation in treatment of internal hemorrhoids. acta med iran. 2010;48(6):389–393. 29. dilawaiz m, bashir ma, rashid a. hemorrhoidectomy vs rubber band; comparison of post-operative complications. professional med j. 2011;18:571–574. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. 24 j contemp med sci | vol. 9, no. 1, january-february 2023: 24–27 the impact of the ercc2 lys751gln polymorphism on the risk of acute myeloid leukemia in an iraqi patients thamer mouhi jasiem1* , rand muhammed abdul-hussain al-hussaini2 1department of microbiology, college of science, al-karkh university of science, baghdad, iraq. 2department of biology, faculty of science, kufa university, najaf, iraq. *correspondence to: thamer mouhi jasiem (e-mail: thamerbio2000@gmail.com) abstract objectives: aml is the only type of acute leukemia diagnosed in adults and is less common in children. it has the lowest survival rate. epidemiological risk factors for aml expansion comprise environmental factors, for instance, smoking, and therapy-related factors. methods: the study was conducted on 70 acute myeloid leukemia patients–37 females and 33 males and on 30 healthy people–12 females and 18 males–as a control group. dna was extracted from the study groups’ whole blood samples using the gsynctm dna extraction kit. the t751g polymorphism of the ercc2 gene was determined by the pcr-rflp technique. results: in genetic analysis, it was shown that the carriers of allele lys and genotype lys/lys have a lower risk of developing aml, while allele carriers gln have an increased risk. the results showed the ercc2 gene, lys 751 gln (t/g) heterozygous tg genotypes, and the g allele were significantly higher (p < 0.05) in aml patients compared to the control group. in the sequencing of the region we studied, it was found that there is a site of diversity that is located between the cttcag and ctgcag, where a change in nucleotides (t to g) represents the restriction site of the restriction enzyme. conclusion: the polymorphic marker 751 gln> lys of the ercc2 gene was associated with the development of aml in iraqi patients. it was discovered that allele lys genotype lys/lys carriers have a lower risk of developing aml, whereas allele gln carriers have an increased risk. keywords: leukemia, myeloid, acute, ercc2, polymorphism, genetic, dna repair issn 2413-0516 introduction aml is the one type of acute leukemia diagnosed in adults and less common in children and is connected with the lowest survival rate.1 epidemiological risk factors for aml expansion comprise environmental factors, for instance, smoking and exposure to benzene, therapy-related factors.2 aml derives from hematopoietic stem cells with a stepwise acquisition of genetic and epigenetic alterations. these assembled mutations influence normal hsc functions, obstructing differentiation and rising self-renewal capacity.3 the excision repair cross-complementing group 2 (ercc2) gene, also known as the xeroderma pigmentosum group d (xpd) gene, is located on chromosome 19q13.3. the ercc2 gene is consists of 23 exons and stretches about 54,000 base pairs.4 the ercc2 gene produces a protein which consists of 760 amino acids with a molecular weight of 86,900 and has been 5'–3' dna helicase activity that is adenosine triphosphate-dependent. the ercc2 protein is a part of the core transcription factor iih, which is particpated in nucleotide excision repair of dna by opening dna around the damage.5 materials and methods the study group was conducted on 70 acute myeloid leukemia patients 37 females and 33 males at the department of hematology, baghdad teaching hospital, medical city, for the period from march 2022 to july 2022, and 30 healthy people 12 females and 18 males as a control group. the ages of patients and control ranged between 15–82 years. dna isolation and polymerase chain reaction (pcr) under aseptic conditions, genomic dna was extracted from nucleated cells. dna was extracted from the study groups’ whole blood samples using the gsynctm dna extraction kit from geneaid. t751g polymorphism of the ercc2 gene was determined by pcr-rflp with the following primers: sense, f: 5’-cctctccctttcctctgttc-3’ and antisense, r: 5’-caggtgagggggacatct-3’.6 the 734 bp product was digested with 5 u of the restriction enzyme psti. amplification was carried out in 25 μl tube of pcr premix reaction mixture (accupower pcr premix, bioneer) amplification was performed in a thermal cycler (cleaver scientific ltd/uk) programmed for 35 cycles of denaturation at 94°c for 30 sec, annealing at 57°c for 30 sec, and extension at 72°c for 1 min, preceded by an initial denaturation of 5 min at 95°c. final extension was for 5 min at 72°c. finally, the gel electrophoresis method was done according to sambrook and russell,7 and 5 μl of each samples was loaded onto 2% agarose gel. statistical analysis through the use of the spss version 26 software, statistical analyses of all findings were completed. the c2-test was used to test hardy-weinberg equilibrium in both controls and cases for each polymorphism. chi-square analysis was used to find the genotype and allele frequency differences between the patients and controls. a measure of the association of the polymorphic sites with aml was also determined using odds ratios (ors) and 95% confidence intervals (cis). a p-value of 0.05 was considered significant. results an ercc2 variant with decreased ability to repair dna breaks has been linked to a single nucleotide genetic polymorphism (snp) in codon 751 of exon 23 (rs13181), where a change in nucleotides (t to g) leads to an amino acid change (lys to gln). (submitted: 11 november 2022 – revised version received: 02 december 2022 – accepted: 21 december 2022 – published online: 26 february 2023) original https://orcid.org/0000-0003-3492-9128 mailto:thamerbio2000@gmail.com 25j contemp med sci | vol. 9, no. 1, january-february 2023: 24–27 t. m. jasiem et al. the impact of the ercc2 lys751gln polymorphism on the risk of acute myeloid leukemia in an iraqi patients the occurrence of ercc2 gene polymorphism was revealed by rflp-pcr technique. at this position three genotype were found; tt, gg and tg,6 found that this locus had three genotypes only. the results revealed that gg homozygous genotype relative frequency was found to be 11.5% and 0% in the aml patients and control group respectively that was statically significant. also the heterozygous genes revealed significant differences where the aml patients 47% contained tg heterozygous genotype, while in the control group this genotype was present in 40%. the tt homozygous genotype was present in 60% of the controls, whereas it was 41.5% in the aml patients as shown in table 1. the results showed that the “g” allele is highly prevalent in the aml patients which was 35% as compared to the controls 20%, whereas the relative frequency “t” allele was 65% in the aml patients and 80% in the controls, as shown in table 2. discussion the present study revealed that the g allele, tg and gg genotype in aml patients were over than the controls, and observed that individuals with the gg genotypes had higher risk for developing aml disease. in contrast, the “t” allele, and tt genotype have a rather preventive role. this may indicate that the “t” allele may be protective. a significant association between polymorphism of ercc2 lys751gln and aml, overall data analysis revealed that ercc2 lys751gln may be significantly correlated with elevated leukemia risk. we discovered a strong correlation between the polymorphism lys751gln with the risk of developing aml (p-value = 0.03, or = 2.15; 95% ci = 1.05–4.43 for the gln allele). in the case of lys751gln, individuals with aml were more likely to have the combined heterozygous genotypes than controls (or = 1.34; 95% ci = 0.56–3.19; p–value = 0.03). this was also detected when the gln/gln genotype was examined (or = 8.30; 95% ci = 0.46–148.51). in this study, showed that an increase in the lys/lys genotype and the lys allele in the ercc2 codon 751 polymorphisms play a protective role in aml, and a increase in gln/gln genotype in acute leukemia was associated with early relapse tables 3 and 4. the relationship between these ercc2 polymorphisms and leukemia risk has been examined in some case-control studies, but the results of these studies remain confusing rather than conclusive. although a number of studies have found a link between ercc2 polymorphisms and the risk of certain types of leukemia, many researchers have discovered that the variant 751gln allele is associated with an increased risk of aml.8-16 other studies, on the other hand, did not consider the ercc2 genetic variants to be risk or protective factors for leukemia because they demonstrated that the presence of the ercc2 751gln allele had a protective effect in the development of aml.17-19 sequencing of amplified ercc22 gene in order to check up the genetic variation in a rs 13181; lys751gln, t/g in exon 23 ercc2 gene. sequencing was table 2. comparative analysis of the distribution of allele frequencies of polymorphic marker ercc2 gene; lys751gln among patients with aml and in the control group alleles cases controls b2 p or n = 70 n = 30 value 95% ci allele t 91(65%) 48(80%) 4.46 0.03 0.46 0.23–0.96 allele g 49(35%) 12(20%) 2.15 1.05–4.43 table 3. distribution of ercc2 gene; lys751gln in the study population under dominant inheritance model genotypes cases controls b2 p or n = 70 n = 30 value 95% ci genotype t/t 29(41.5%) 18(60%) 2.91 0.09 0.47 0.20–1.13 genotype t/g+g/g 41(58.5%) 12(40%) 2.12 0.89–5.07 table 4. distribution of ercc2 gene; lys751gln in the study population under recessive inheritance model genotypes cases controls b2 p or n = 70 n = 30 value 95% ci genotype t/t+t/g 62(88.5%) 30(100%) 3.73 0.05 0.12 0.01–2.16 genotype g/g 8(11.5%) 0(0%) 8.30 0.46–148.51 table 1. comparative analysis of the distribution of genotype frequencies of polymorphic marker ercc2 gene; lys751gln among patients with aml and in the control group genotypes cases controls b2 p or n = 70 n = 30 value 95% ci genotype t/t 29(41.5%) 18(60%) 4.75 0.03 0.47 0.20–1.13 genotype t/g 33(47%) 12(40%) 1.34 0.56–3.19 genotype g/g 8(11.5%) 0( 0%) 8.30 0.46–148.51 original 26 j contemp med sci | vol. 9, no. 1, january-february 2023: 24–27 the impact of the ercc2 lys751gln polymorphism on the risk of acute myeloid leukemia in an iraqi patients t. m. jasiem et al. fig. 1 comparison of the alignment of nitrogenous bases in patient samples of a fragment of dna from the ercc2 gene, a rectangle indicates the difference site in one of the nitrogenous bases, which is the same as the restriction site of the enzyme. fig. 2 the location of the occurrence of genetic diversity in the studied sequence, the arrow indicates the genotype of patient as a result of the presence of one homozygous genetic pattern gg. fig. 3 the location of the occurrence of genetic diversity in the studied sequence, the arrow indicates the genotype of control as a result of the presence of one homozygous genetic pattern tt. performed to determine the genetic variation in iraqi patients with aml compared with the apparently healthy control. the complete nucleotide sequence is examined and the results were illustrated in figures 1-3. through the current study of the sequential sequence of the region we studied, it was found that there is a site of diversity which located between the cttcag and ctgcag where a change in nucleotides (t to g), which represents the restriction site of the restriction enzyme, and this means that the enzyme is cut in the case of the presence of g in the target site of a segment and not cut in the case of the presence of the base t, when compared to the source reference (ref.) or a comparison between patient samples and control samples (figure 1). original 27j contemp med sci | vol. 9, no. 1, january-february 2023: 24–27 t. m. jasiem et al. the impact of the ercc2 lys751gln polymorphism on the risk of acute myeloid leukemia in an iraqi patients for investigated the presence of genetic diversity or mutations in the region we used various and different genetic analysis methods, the results were compared with what was published in the gene bank website located within the american national center for biotechnology information (ncbi) website, which is http://www.ncbi. nlm.nih.gov/. the blast method was searched, which is a tool for searching for matches in sequences on the gene bank website, after removing excess and non-conforming sequences (rubbish) from both ends of the sequences and alignment them using the computerized bioedit program. the target region was obtained and compared with the sequences obtained for the patient and control samples. the ercc2 region was registered and published on the gene bank website located within the national center for biotechnology information (ncbi) website under assigned accession number (lc735410) https://www.ncbi.nlm.nih. gov/nuccore/lc735410.1/. conclusion an association of polymorphic marker 751 gln> lys of the ercc2 gene with the development of aml in iraqi patients. it was shown that the carriers of allele lys genotype lys/lys have a lower risk of developing aml, while allele carriers gln have an increased risk. conflicts of interest “the authors declare no conflicts of interest.”  this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. references 1. yamamoto, j.f. and m.t. goodman, patterns of leukemia incidence in the united states by subtype and demographic characteristics, 1997–2002: cancer causes control, 2008. 19(4): 379–90. doi: 10.1007/s10552-0079097-2. 2. zeeb, h. and m. blettner, adult leukaemia: what is the role of currently known risk factors. radiat environ biophys,1998. 36: 217–228. 3. corces-zimmerman, m. r. and r. majeti, pre-leukemic evolution of hematopoietic stem cells: the importance of early mutations in leukemogenesis. leukemia, 2014. 28(12): 2276–2282. 4. weber, c.a., et al., ercc2: cdna cloning and molecular characterization of a human nucleotide excision repair gene with high homology to yeast rad3. embo j, 1990. 9: 1437–47. doi: 10.1002/j.1460-2075.1990.tb08260.x. 5. schaeffer, l., et al., the ercc2/dna repair protein is associated with the class ii btf2/tfiih transcription factor. embo j., 1994. 13: 2388–92. doi: 10.1002/j.1460-2075.1994.tb06522.x. 6. dexi, j., et al., impact of polymorphisms in dna repair genes xpd, hogg1 and xrcc4 on colorectal cancer risk in a chinese han population. bioscience reports, 2019. 39: 1–9. 7. russell, d.w., and j. sambrook, molecular cloning: a laboratory manual. cold spring harbor: cold spring harbor laboratory, 2001. 8. james, m., et al., genetic variation in xpd predicts treatment outcome and risk of acute myeloid leukemia following chemotherapy blood, 2004. 104(13): 3872–3877. doi: 10.1182/blood-2004-06-2161. 9. ilhan, g., et al., risk factors and primary prevention of acute leukemia. asian pac. j. cancer prev. 2006. 7: 515–517. 10. ali, ö., et al., polymorphisms of the dna repair gene xpd (751) and xrcc1 (399) correlates with risk of hematological malignancies in turkish population. african journal of biotechnology, 2011. 10(44): 8860–8870. 11. meenaghan, t., et al., acute leukaemia: making sense of a complex blood cancer. br. j. nurs, 2012. 21 (76): 78–83. doi: 10.12968/bjon.2012.21.2.76. 12. duo, l., et al., the effect of xpd/ercc2 lys751gln polymorphism on acute leukemia risk: a systematic review and meta-analysis gene, 2012. 538: 209–216. doi: 10.1016/j.gene.2014.01.049 13. liu, d., et al., the effect of xpd/ercc2 lys751gln polymorphism on acute leukemia risk: a systematic review and meta-analysis. gene, 2014. 538(2): 209–16. 14. claudia, b., et al., influence of xpc, xpd, xpf, and xpg gene polymorphisms on the risk and the outcome of acute myeloid leukemia in a romanian population, tumour biol, 2016. 37(7): 9357–66. doi: 10.1007/s13277-0164815-6. 15. dolly, j., et al., association of xpd (lys751gln) and xrcc1 (arg280his) gene polymorphisms in myelodysplastic syndrome. ann hematol, 2016. 95(1): 79–85. doi: 10.1007/s00277-015-2528-3. 16. zohreh, s., et al., genetic variants of nucleotide excision repair pathway and outcomes of induction therapy in acute myeloid leukemia. per. med., 2019. 16(6): 479–490. doi: 10.2217/pme-2018-0077. 17. mehta, p.a., et al., xpd lys751gln polymorphism in the etiology and outcome of childhood acute myeloid leukemia: a children’s oncology group report, blood. 2006. 107(1): 39–45. doi: 10.1182/blood-2005-06-2305. 18. sorour, a., et al., the genotype distribution of the xrcc1, xrcc3, and xpd dna repair genes and their role for the development of acute myeloblastic leukemia. genet test mol biomarkers, 2013,17: 195–201. doi: 10.1089/ gtmb.2012.0278. 19. kais, d.et al., polymorphisms in xpc, xpd and xpg dna repair genes and leukemia risk in a tunisian population. leuk lymphoma, 2015. 56(6): 1856–62. doi: 10.3109/10428194.2014.974045. https://doi.org/10.22317/jcms.v9i1.1308 original https://www.ncbi.nlm.nih.gov/nuccore/lc735410.1/. https://www.ncbi.nlm.nih.gov/nuccore/lc735410.1/. https://doi.org/10.1007/s10552-007-9097-2 https://doi.org/10.1007/s10552-007-9097-2 https://doi.org/10.1002/j.1460-2075.1990.tb08260.x https://doi.org/10.1002%2fj.1460-2075.1994.tb06522.x https://doi.org/10.1182/blood-2004-06-2161 https://doi.org/10.12968/bjon.2012.21.2.76 https://doi.org/10.1016/j.gene.2014.01.049 https://doi.org/10.1007/s13277-016-4815-6 https://doi.org/10.1007/s13277-016-4815-6 https://doi.org/10.1007/s00277-015-2528-3 https://doi.org/10.2217/pme-2018-0077 https://doi.org/10.1182/blood-2005-06-2305 https://doi.org/10.1089/gtmb.2012.0278 https://doi.org/10.1089/gtmb.2012.0278 https://doi.org/10.3109/10428194.2014.974045 original 65j contemp med sci | vol. 8, no. 1, january-february 2022: 65–68 association of taqi polymorphism of vitamin d receptor (vdr) gene with anemia in saudi women maryam a. al-ghamdi1,2* 1department of biochemistry, faculty of science, king abdulaziz university jeddah 21589, saudi arabia. 2vitamin d pharmacogenomics research group, king abdulaziz university, jeddah, saudi arabia. *correspondence to: maryam a. al-ghamdi (e-mail: maaalghamdi3@kau.edu.sa) (submitted: 13 december 2021 – revised version received: 16 january 2022 – accepted: 23 january 2022 – published online: 26 february 2022) introduction fat soluble vitamin d is required by the body for normal bone development and maintenance. it acts by increasing absorption of phosphate, calcium and magnesium. vitamin d deficiency is implicated in a wide range of diseases, most notably in relation to bones.1 vitamin d deficiency is a health concern worldwide. recent studies have shown vitamin d deficiency to play a major role in many metabolic as well as physiological disorders such as diabetes, cardiovascular disease, cancer and thyroid disorders.2 sunlight accounts for about 50 to 90% of supply of vitamin d.3 vitamin d regulates bone turnover by the stimulation of osteoclastic and osteoblastic cells.4 variations of the vdr gene, that is present in chromosome 12, have been associated with various disorders and the polymorphisms vary to a great extent among different populations of the world.5 four frequently occurring single nucleotide polymorphisms (snps) namely: apai, bsmi, foki, and taqi, found at the 3´ end of the vdr gene have been studied in detail.6,7 the vdr suppresses activation of t cells, therefore, t-cell mediated autoimmune diseases are associated with polymorphisms in this receptor gene.8 polymorphisms in the vdr gene have been extensively studied.9 deficiency of iron leads to anemia. there are various variants of anemia, such as pernicious anemia, nutritional anemia, sickle cell anemia and hemolytic anemia. while some anemias are genetic, the most common form observed in a large section of the population worldwide is due to iron deficiency, in turn manifested as low levels of hemoglobin. according to a who report in 2008, 1;62 billion of the world population is anemic. in females, the main cause of anemia is blood loss during menstruation and pregnancy. since nutritional deficiency is the most common cause of iron deficiency anemia, this study is aimed at studying the possible association between anemic, vitamin d deficient women with vdr gene polymorphism at three restriction sites apai, taqi and bsmi. we found a significant association between the taqi polymorphisms and occurrence of anemia in the study population. materials and methods study subjects the study involved volunteers: 50 women in the age group 25–35 who were anemic and had low serum vitamin d levels. the control group consisted of 50 women in age group 25–35 who had sufficient blood hemoglobin and serum vitamin d levels. care was taken to only include women in both groups who did not have any other health conditions such as diabetes, hypertension, cardiac disorders, thyroid disorders etc. informed consent of the volunteers was obtained. hemoglobin levels of all the volunteers were measured using cbc. women who had hemoglobin levels lesser than 10 grams/dl were classified as anemic, while those with hemoglobin levels greater than 10 grams/dl were classified as healthy. serum vitamin d levels were measured by blood test for 25-hydroxyvitamin d: 25(oh)d. levels of less than 20 ng/ml are considered deficient, 20–30 ng/ml are considered as insufficient and levels greater than 30 ng/ml are considered sufficient. extraction of dna and amplification of vitamin d receptor gene the protocol followed is the same as the one in our previous study.9 genomic dna was extracted from whole blood using qiaamp dna blood mini kit (qiagen, usa, cat. no.51104). the extracted dna was stored at −20˚c for further pcr reactions (table 1). nanodrop2000c instrument from thermo scientific (usa) was used to calculate abstract objectives: this study aims to correlate occurrence of anemia in a population of saudi women with polymorphisms in the vdr gene. methods: the study sample consisted of 50 anemic women with vitamin d deficiency and 50 healthy women with normal hemoglobin and sufficient serum vitamin d levels. restriction fragment length polymorphism (rflp) analysis of the vdr genes was done for single nucleotide polymorphism (snp) sites namely apai, bsmi and taqi. statistical correlation was done between gene polymorphisms at these three sites and hemoglobin levels. results: we found a significant association between taqi site polymorphisms of the vdr gene and presence of anemia in the study population. conclusion: this is the first report of a significant association between vitamin d receptor gene polymorphisms and anemia in saudi population. further studies on a larger population size will pave way to elucidation of the mechanism in which vdr gene polymorphisms exert an influence on anemia. keywords: vdr polymorphism, anemia, taqi polymorphism, anemia, vitamin d deficiency issn 2413-0516 http://orcid.org/0000-000-0861953x association of taqi polymorphism of vitamin d receptor (vdr) gene with anemia in saudi women original maryam a. al-ghamdi 66 j contemp med sci | vol. 8, no. 1, january-february 2022: 65–68 table 1. represents the pcr reaction mixture 10–30 ng dna template 2x reaction buffer 4 mmmg+2 4 µm dntps 0.2 µm each of forward and reverse primers 0.45 u taq dna polymerase final volume made up with nuclease free water to 50 µl table 2. represents the pcr conditions for 30 cycles6 denaturation annealing extension final extension hold 95˚c for 30 sec 60˚c for 1 min 68˚c for 2 min 72˚c for 5 min 4˚c∞ table 3. pcr – rflp products for the restriction sites apai bsmi taqi aa – 2229 bp aa – 2229 bp, 1700 bp and 529 bp aa – 1700 bp, 259 bp bb 2229 bp bb – 2229 bp, 1579 bp, and 650 bp bb – 1579 bp and 650 bp tt 1982 bp and 247 bp tt – 1982 bp, 1780 bp, 202 bp, and 247 bp tt – 1780 bp, 202 bp, and 247 bp table 4. distribution of various alleles in healthy women (sufficient hemoglobin and vitamin d levels) restriction site genotype number of samples % frequency apai aa aa aa 18 21 11 (total 50) 36 42 22 (total 100%) bsmi bb bb bb 20 17 13 (total 50) 40 34 26 (total 100%) taqi tt tt tt 22 18 10 (total 50) 44 36 20 (total 100%) table 5. distribution of various alleles in women who were anemic as well as deficient in vitamin d restriction site genotype number of samples % frequency apai aa aa aa 19 21 10 (total 50) 38 42 20 (total 100%) bsmi bb bb bb 22 16 12 (total 50) 44 32 24 (total 100%) taqi tt tt tt 9 10 31 (total 50) 18 20 62 (total 100%) fig. 1 agarose gel (1%) showing the results of pcr-rflp comparison between the three restriction enzymes in anemia (p) and the control (c). lane m: dna marker. lane 2: negative control. lane 3: pcr product of size 2229 bp. lane 4, 5: rflp of apai digestion in control and patient. lane 7, 8: rflp of taqi digestion in control and patient. lane 10, 11: rflp of bsmi digestion in control and patient. results pcr-rflp analyses and distribution of the genotypes the restriction profiles obtained after pcr-rflp are summarized in table 3. the distribution of various alleles in control group and anemic group are presented in tables 4 and 5. from table 4, we observe that in the control group which comprised of healthy women with sufficient hemoglobin and serum vitamin d levels, there is no significant difference between the genotype frequencies in the single nucleotide polymorphisms (snps) at any of the three sites. in contrast, as seen in table 5, the study group of women with anemia and vitamin d deficiency clearly show a significant difference in concentration and purity of the extracted dna (table 2). the polymerase chain reaction (pcr) was carried out as described in our previous study.9 pcr amplification the amplification products were resolved on 1% agarose gels and 1x of tris-borate-edta (tbe) buffer followed by staining with ethidium bromide and visualized under uv light. genotyping of the vdr gene after its amplification, pcr product of ~2229 bp was exposed to enzymatic restriction digestion by three enzymes which were purchased from thermo scientific: apai, bsmi, and taqi (figure 1). the conditions for restriction digestion were followed according to iyer et al., 2017. the digested dna fragments and the dna size marker were segregated by electrophoresis on a 1% agarose gel stained with ethidium bromide and 1x tbe electrophoresis buffer. maryam a. al-ghamdi original association of taqi polymorphism of vitamin d receptor (vdr) gene with anemia in saudi women 67j contemp med sci | vol. 8, no. 1, january-february 2022: 65–68 genotype frequency at the taqi site. the genotype frequency of homozygous recessive alleles aa is 62% compared to tt and tt genotypes, while in control subjects the homozygous recessive genotype tt is observed in only 10% of the study subjects. discussion in recent times, anemia has been recognized as a world wide health issue. nutritional as well as metabolic disorders have been attributed to low hemoglobin levels associated with anemia. although we are well aware of the role of vitamin d in bone formation, metabolic regulation and overall growth and development, studies over the past few years have categorically suggested the role of vitamin d in erythropoiesis.10 studies by sim et al., 2010.,11 have shown significant association between vitamin d deficiency and anemia. cusato et al.,12 2015 proved the role of vdr gene polymorphisms in the ribavirin-induced anemia in hcv-patients at 2 and 4 weeks of medication. the vdr gene polymorphisms could attribute to significant receptor dysfunction thereby causing various disorders such as low bone mineral density, autoimmunity, infections, cardiovascular disease and cancers.13 moreover, studies on vdr gene polymorphism in various populations around the world have pointed out the significant role of the vdr gene in vitamin d deficiency.14 our own research group has established association of bsmi polymorphisms with type i diabetes, apai polymorphisms with type ii diabetes and taqi polymorphisms with gestational diabetes in saudi population.9 these findings encouraged us to probe the possible relation between anemia and vdr gene polymorphisms. with this as the premise, our current study was designed to look for a possible correlation between anemia and vitamin d deficiency with polymorphisms of the vdr gene at three snp sites namely apai, taqi and bsmi. we have taken extreme care to include only those subjects who were anemic as well as had low serum vitamin d levels as the study group while the control group were women with sufficient levels of hemoglobin as well as serum vitamin d. we have clearly observed that at the taqi site, there is a significant difference in genotype frequency between study group and control group. the homozygous recessive genotype tt was observed in 62% of the study group as against mere 20% in the control group. a study by yassin et al.,15 in an egyptian population showed no correlation between anemia and vdr polymorphism at apai and taqi sites. another study by yu et al.,16 showed a significant association between vdr polymorphisms and aplastic anemia in a chinese population. according to erturk et al.,17 bsmi polymorphism may have a role in anemia in hemodialysis patients with bb genotype being strongly associated with lower hemoglobin levels. to the best of our knowledge, our study is a pioneering finding that strongly establishes the association of homozygous recessive alleles tt of taqi polymorphism (rs731236) snp with anemia. the study is a very strong support for this finding because all the patients recruited for the study were anemic as well as vitamin d deficient, while the control group was sufficient in both hemoglobin as well as serum vitamin d level, clearly establishing the connection between the two deficiencies at the genotypic level. medrano et al.,18 previously have proved a role of calcitrol, the active form of vitamin d in hematopoiesis. this strongly supports our observation that links anemia and vitamin d anemia. conclusion our study is the first of its kind reporting a genotypic association between anemia and vitamin d deficiency with the homozygous tt genotype of the taqi snp showing significant association in the study group as compared to healthy control group. our study was conducted in women in the age group of 25–35, who are in active menstruation and childbirth age. it would be interesting to extend the study to a larger population, such as post menopausal women as well as children and observe any genotypic variation. acknowledgments the authors acknowledge king abdulaziz university, jeddah, for scientific research. disclosure statement the author declares no conflict of interest.  references 1. nair r, maseeh a. vitamin d: the ‘sunshine’ vitamin. j pharmacol pharmacother 2013;3:118–26. 2. sizar o, khare s, goyal a, et al. vitamin d deficiency. in: statpearls [internet]. [updated 2021 jul 21] 3. naeem z. vitamin d deficiencyan ignored epidemic. int j health sci 2010 jan;4(1):v–vi. 4. mukhtar m, sheikh n, suqaina sk, batool a, fatima n, mehmood r, nazir s. vitamin d receptor gene polymorphism: an important predictor of arthritis development. biomed res int. 2019 mar 18;2019:8326246. 5. nurminen v, seuter s, carlberg c. primary vitamin d target genes of human monocytes front physiol. 2019;10:194. 6. uitterlinden ag, fang y, van meurs jb, pols ha, van leeuwen jp. genetics and biology of vitamin d receptor polymorphisms. gene 2004;338:143–156 7. panierakis c, goulielmos g, mamoulakis d, petraki e, papavasiliou e, galanakis e. vitamin d receptor gene polymorphisms and susceptibility to type 1 diabetes in crete, greece. clin immunol 2009;133:276–281. 8. motohashi y, yamada s, yanagawa t, maruyama t, suzuki r, niino m, fukazawa t, kasuga a, hirose h, matsubara k, shimada a. vitamin d receptor gene polymorphism. j. clin endocrinol and metabolism 2003;88:3137–40. 9. iyer ap, new sl, khoja s, ghamdi ma, bahlas s. association of apa i polymorphism of vitamin d receptor gene with type 2 diabetes mellitus in saudi population. j. exp biol and agri sci, may 2017; volume – 5(2). 10. kersey m, chi m, cutts db. anaemia, lead poisoning and vitamin d deficiency in low-income children: do current screening recommendations match the burden of illness? pub health nutrition 2011;14(8):1424–28. 11. sim jj, lac pt, liu il, meguerditchian so, kumar va, kujubu da, rasgon sa, vitamin d deficiency and anemia: a cross-sectional study. ann hematol 2010;89(5):447–452. 12. cusato j, allegra s, boglione l, de nicolò a, cariti g, di perri g, d’avolio a, vdr gene polymorphisms impact on anemia at 2 weeks of anti-hcv therapy: a possible mechanism for early rbv-induced anemia. pharmacogen and genomics 2015;25(4):164–172. 13. plum la, deluca hf. vitamin d, disease and therapeutic opportunities. nature rev drug disc 2010;9(12):941–955. 14. bhanushali aa, lajpal n, kulkarni ss, chavan ss, bagadi ss, das br. frequency of foki and taqi polymorphism of vitamin d receptor gene in indian population and its association with 25hydroxyvitamin d levels. ind j hum genet 2009;15(3):108–113. association of taqi polymorphism of vitamin d receptor (vdr) gene with anemia in saudi women original maryam a. al-ghamdi 68 j contemp med sci | vol. 8, no. 1, january-february 2022: 65–68 this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i1.1163 15. yassin, fathy & said, noha & tarek, doha. association between vitamin d receptor gene polymorphisms and anemic patients. biochem lett. 2017; 12:1-10. 16. yu w, ge m, shi j, li x, zhang j, wang m, shao y, zheng y. role of vitamin d receptor gene polymorphisms in aplastic anemia: a case-control study from china. int j lab hematol. 2016 jun;38(3):273-83. 17. ertürk s, kutlay s, karabulut hg, keven k, nergizoglu g, ates k, bokesoy i, duman n. the impact of vitamin d receptor genotype on the management of anemia in hemodialysis patients. am j kidney dis. 2002 oct;40(4):816-23. 18. medrano m, carrillo-cruz e, montero i, perez-simon ja. vitamin d: effect on haematopoiesis and immune system and clinical applications. int j mol sci. 2018;19(9):2663. 159j contemp med sci | vol. 3, no. 9, winter 2017: 159–162 research intestinal parasitic infection effect on some blood components hanaa daaj khalaf al-mozan,a yahya tomaa daoud,b khalid majeed dakhilc abiology department, science college, thi-qar university, iraq. bbiology department, science for women college, baghdad university, iraq. ctechnical institute in nassiriyah, iraq. correspondence to hanaa daaj khalaf al-mozan (email: hanaa_daaj @yahoo.com). (submitted: 14 december 2016 – revised version received: 27 december 2016 – accepted: 10 january 2017 – published online: 26 march 2017) objectives to know the effect of intestinal parasitic infection on the differential count of white blood cells and sex factor effect on some blood criteria. methods the fecal samples were examined by direct and indirect methods. blood samples were withdrawn for the testing of the differential count of white blood cells, hb, pcv, t.wbc and numbers of eosinophils. results the results showed that al-jibaish general hospital was the highest with parasitic infection (50.4%) in comparison with other hospitals. a high percentage (30%) of entamoeba histolytica was formed. when compared with the percentage of each parasite under study between those hospitals, entamoeba histolytica appeared with 12% in al-shatra and 46.6% in al-jibaish. there were significant differences between the parasite types in the percent of lymphocytes, neutrophils, monocytes and eosinophils. it ranged from increase and decrease according to parasite type. the significant difference appeared at the six-factor effect on the number of eosinophils was calculated by using the statistical analysis (χ2) in level p < 0.05. conclusion e. histolytica is the most common parasite. al-jibaish district suffers from a lack of services. there is no effect on the sex factor on blood criteria. each one parasite has a different effect on blood components. keywords intestinal parasites, white blood cells, entamoeba histolytica, haemoglobin introduction intestinal parasitic infection is a serious public health problem throughout the world particularly in developing countries. it is estimated that intestinal parasites infect more than three billion people worldwide.1,2 these parasites cause several symptoms, including: diarrhea, fever, vomiting, coughing, anorexia, gas or bloating and anemia.3 anemia in children can be caused by iron deficiency and by health factors such as parasitic infection.4 many studies have shown that hook worm causes chronic intestinal blood loss,5 blood loss can also occur by trichuris infection.6 hemoglobin is the red pigment in red cell. its loss occurs in some pathological conditions including: parasitic infection, malnutrition, blood loss and chronic infection,7 which is expressed anemia.8 packed cell volume has relation with anemia where the loss of packed cell volume occurs as a result of specific conditions such as anemia.9 white blood cells are considered as one of the basic components of blood and present in peripheral blood,10 to provide defense against germs, parasites and tumors as well as other diseases.11 there are five types of white blood cells vary in size, proportions and functions which are as follow: neutrophils, eosinophils, basophils, lymphocytes and monocytes.9 materials and methods stool samples specimens were collected in clean containers to avoid contamination with urine, water or any other disinfectants. the stool samples were examined by the naked eye for color, odor, and the presence of blood or mucus.12,13 finally, they were examined microscopically by the direct method using normal saline and lugol’s iodine,14,15 and indirect method by floatation with zinc sulfate.12,13 blood samples blood samples (1 ml) were withdrawn by intravenous injection with sterile medical device and transferred to plastic tubes that contain the anticoagulant edta (ethylene diamine tetra acetic acid) and performed the following tests: packed red blood cell volume capillary tubes were filled with blood to three quarters. they were blocked at the end by artificial mud and wiped from outside. then they were put in microhematocrit rotor with speed 13000 r/min for 5 min. packed cell volume was read by using microhematocrit reader.9,16 measurement of hb hb was measured by a reflotron plus, the product by a german company roche established in accordance with the accompanying instructions of the company as follow: a limited volume of blood was taken by micropipette that accompanying with apparatus. blood was put on the exact location of the accompanying tape. there are some tapes were provided from company with apparatus, and there certain place (limited place) in the apparatus for the tape (to insert the tape) for it in the apparatus and was left for 3 min where the result appears on the screen of the apparatus and taking into account the zero of the apparatus before each using. total leukocytes count blood was put in tube contain edta. blood was taken by specific pipette for white blood cells count to gradient 0.5 that is issn 2413-0516 160 j contemp med sci | vol. 3, no. 9, winter 2017: 159–162 intestinal parasitic infection effect on some blood components research hanaa daaj khalaf al-mozan et al. marked on the pipette tube (20 micrometers). diluted liquid was withdrawn to the mark 11 (0.4 ml) and was mixed by hand until became homogenous. the solution was put in neubaur chamber and a cover slip was put on it. the chamber was left for 2 min to settle the cells. then, the cells were calculated under the microscope by the objective lens.17 differential count of white blood cells a drop of blood was put on a clean slide and was pulled by the edge of another slide taking into account the good distribution of the cells on smear. the slide was left to dry and was stained by leishman stain and was left to dry with room temperature then 100 cells of white blood cells were calculated using oily lens. the absolute number of each type of white blood cells in millimeter per cubic was extracted from the total count of white blood cells and percent of each type of white blood cells.9,18,19 the statistical analysis the statistical analysis was performed by using t-test and chi-square test (χ2) according to for 20. results intestinal parasite infection was found in 333 from total 1001 fecal samples of children aged seven years and less than that age who visited different hospitals in thi–qar province. entamoeba histolytica appeared with percent 12% in al-shatra and 46.6% in al-jibaish, as for the rest parasites h. nana, e. vermicularis, e. coli, t. homimis and g. lamblia, the statistical analysis (χ2) in level p < 0.05 not found significant differences between the hospitals forward those parasites (table 1). as for differential count of white blood cells, the results were changed either by excess from the normal criteria of blood or by decrease from the normal criteria of blood and in both cases the results were changed from the normal level. in other word there is effect of some parasites either by increase or by decrease according to type (species) of parasite while some types of parasites haven’t effect where the percent of lymphocytes was 71% at infection with g. lamblia and 33% with (e. histolytica + g. lamblia + t. hominis), neutrophils with 23.5% when infection by g. lamblia and 64% when infection by e. histolytica + g. lamblia + t. hominis. monocytes appeared with 13% at g. lamblia + h. nana and 1% with infection by e. histolytica + h. nana, eosinophils with 6% at infection by (g. lamblia + h. nana), (e. histolytica + h. nana) and 0% when the infection of e. histolytica + g. lamblia + t. hominis, and the differences were significant. and 3% represented the highest rate for basophils at infection with g. lamblia + h. nana. when statistical analysis compared between the percentages of white blood cells for the infected children with the percentages of white blood cells for non-infected children found some of them near and other far according to parasite type (table 2). as for the effect of sex, a number of eosinophils were 154.3 cells/mm3 in an infected male and 218.0 cell/mm3 in an infected female. no significant differences for the effect sex on criteria hb, pcv and wbc in those infected children (table 3). discussion e. histolytica with 30% represented the most common intestinal parasite in this study, which is in agreement with previous studies.21,22 e. histolytica is the highest prevalence in the world specially in tropical and sub tropical countries, and iraq is represented as one of them.23 the humid climate provides favourable environmental conditions for the maturity cyst of entamoeba,24 and then transmit it to human25 in addition to e. histolytica that can transmit directly (without need intermediate host).23 the presence high percentage of infection in al-jibaish may due to marginalization of the district from all services, such as healthy or environmentally, culturally and educationally also. dryness marshes and assemblage brackish water and breeding table 1. percent of infection with different type of parasites between hospitals of thi–qar province total infectional-jibaish general hospital al-rifaai general hospital al-shatra general hospital suq-al-shuyukh general hospital nassiriyah maternity and children hospitaltype of parasite %no. of infected %no. of infected %no. of infected %no. of infected %no. of infected %no. of infected 30.030046.66130.565123130.15040.193e. histolytica 3.6362.332.35257.2124.811g.lamblia 0.220.000.000.001.220.00t. hominis 0.110.810.000.000.000.00e. coli 0.550.000.000.820.001.33e. vermicularis 0.330.810.000.410.610.00h. nana 34.734750.46632.97015.13939.16546.1107total h. nanae. vermicularise. colit. hominisg. lambliae. histolyticax2 calculated 0.000.000.000.005.8821.68 1.001.00 0.200.001*sig. hospital hanaa daaj khalaf al-mozan et al. 161j contemp med sci | vol. 3, no. 9, winter 2017: 159–162 research intestinal parasitic infection effect on some blood components table 2. parasite's type effect on the differential count of white blood cells baso. % mean ± sd eosino.% mean ± sd mono. % mean ± sd neutro.% mean ± sd lymph % mean ± sd type of parasite 0.2 ± 0.151.3 ± 0.64.4 ± 253.3 ± 18.8140.8 ± 16.49e. histolytica n = 288 0 ± 0.003 ± 2.42.5 ± 0.723.5 ± 2.1271 ± 26.87g.lamblia n = 24 0 ± 0.002 ± 1.74 ± 1.549.5 ± 7.7744.5 ± 2.82e. vermicularis n = 5 2 ± 0.005 ± 0.004 ± 0.0042 ± 0.0047 ± 0.00h. nana n = 1 1 ± 0.003 ± 0.005 ± 0.0056 ± 0.0035 ± 0.00t . hominis n = 1 2 ± 0.004 ± 0.005 ± 0.0047 ± 0.0042 ± 0.00e. coli n = 1 1 ± 0.41 ± 0.73 ± 1.1546 ± 8.6249 ± 9.1e. histolytica + g. lamblia n = 10 0 ± 0.006 ± 0.001 ± 0.0042 ± 0.0051 ± 0.00e.histolytica + h. nana n = 1 3 ± 0.006 ± 0.0013 ± 0.0033 ± 0.0045 ± 0.00g.lamblia + h. nana n = 1 0 ± 0.000 ± 0.003 ± 0.0064 ± 0.0033 ± 0.00e. histolytica + g. lamblia + t. hominis n = 1 2.684.714.3912.5113.77t calculated 0.2 ± 0.262.3 ± 0.926 ± 2.1954 ± 15.4337.5 ± 12.64non infected n = 100 table 3. effect of sex factor on some blood components in children that infected with intestinal parasites sig.calculated x 2no. of infectedtests female n = 158 mean ± se male n = 175 mean ± se 0.830.0411.8 ± 0.4411.1 ± 0.32hb g/100 ml 0.900.9534.1 ± 0.8833 ± 0.85pcv cell/mm3 0.142.088385.7 ± 998.818573.5 ± 908.74wbc cell/mm3 0.001*11.01218.0 ± 37.57154.3 ± 33.92number of eosinophile cell/mm3 n, number; x 2 tabulated , 3.84; p < 0.05. animals in the houses led to attract huge number of insects that transfer diseases as well as vegetable cultivation by the population of that region and frequent eating it certainly does not help them to avoid the danger of its contamination, moreover drinking water of rivers and ponds without hesitation. as for differential count of white blood cells , the reason of presence significant differences between parasites, s types in percent of lymphocytes, neutrophils, monocytes eosinophils except basophils may be due to variation of damage nature that caused by each type of parasites (where worms usually more effect than protozoa on blood criteria) and variation of importance and work each cell of white bloods cells and immunity of patient. there is no significant difference for sex effect on hb and pcv which is in agreement with the past research26 and disagreement with other research.27 there were no significant differences on the total count of white blood cells between males and females which is in agreement with the already published research.26,27 it was found that sex factor effect on the number of eosinophils which is disagreement with refs. 26 and 27. the reason may belong to that both double infections with (e. histolytica + h. nana) and (h. nana + g. lamblia) in which the number of eosinophils increased with them. they have occurred in females excluding males. conclusion e. histolytica is the most common parasite in thi-qar province. al-jibaish district was the highest with intestinal parasitic infection as a result of lack of services. there is no effect for sex factor on blood criteria of infected children with intestinal parasitic where variations that occurred on blood criteria depend on parasite, s type. recommendations the study must be performed on parasites that resides in the blood. pay attention with hygiene and aren’t eaten fruits and vegetables unless after being washed. increased of attention with elimination of the vectors such as insects. increased of attention with al-jibaish district from all aspects and progress in it to the level that deserve it for being represent rural identity of iraq. conflict of interest none. n 162 j contemp med sci | vol. 3, no. 9, winter 2017: 159–162 intestinal parasitic infection effect on some blood components research hanaa daaj khalaf al-mozan et al. references 1. markell ek, john dt, krotoski wa. markell and voge’s medical parasitology. 8th ed. philadelphia: w.b. saunders 1999. 2. who intestinal parasites. available at: http://apps.who.int/ctd/intpara/ burdens.htm 2010. 3. dariel j. cleanse and purify thyself book one. medford, oregon. christobe publishing, u.s.a 2007. 4. i.n.a.c.g. guidelines for eradication of iron deficiency anemia. a report of the international nutritional anemia consultative group (inacg). new york, washington, nutrion foundation 1997. 5. crompton d. the public health importance of hook worm disease. parasitology. 2000;121:39–50. 6. stephenon ls, holland cd, cooper es. the public health significance of trichuris trichiura. parasitology. 2000;121:73–95. 7. al-asady har. epidemiological study for some pathogenic intestinal parasites with focus on viability of entamoeba histolytica in basrah city. phd thesis, college of sciences, al-basrah university 2007. 8. al-quraishy aas. study on anemia realty in al-qadisiya province during economic resource period. phd thesis, college of education, al-qadisiya university 2002. 9. harmening dm. clinical hematology and fundamentals of hemostasis. fifth edition. united states of america f.a. davis company. philadelphia 2009. 10. goldsby t, thomas j, osborne ba. immunology 4th ed. w.h. freeman comp., new york, 2000;25. 11. junqueira lc, carneiro j. basic histology. 10th ed., prentice – hall international inc. u.s.a 2003. 12. ichhpujani rl, bhatia r. medical parasitology, 1st ed. jaypee bros. med. publ., new delhi 1994. 13. paniker cj. textbook of medical parasitology. 6th ed. new delhi. jaypee brothers medical publishers 2007. 14. lumsden wh, burns s, mcmillan a. protozoa in practical medical microbiology. by collee jg, marmion bp, fraser ag and simmons a. churchill livingstone, tokyo 1996. 15. zeibig ea. clinical parasitology: a practical approach. w.b. saunders company, philadelphia 1997. 16. jubouri, talal hamad; ali musa. epidemiological study of patients with clinical and giardia giardiasis in children shirqat city 2008. 17. ahamid as, salhi em. practical physiology for community health departments. ministry of higher educ. & scientific research, foundation of technical institutes. al-mosul univ. press 1994. 18. talib vh, khurana sr. a handbook of medical laboratory technology . 5th ed., c.b.s. publ., new delhi. philadelphia 1996. 19. lewis sm, bain bj, bates i. dacie and lewis practical hematology. 9th ed. churchill livingstone 2001. 20. albeldawi aa. manners of statistics. first edition. jordan, d. w. for publishing and distribution 2009. 21. al-rekabi, nuha jabbar. a study of some intestinal parasites that cause diarrhea in children in the city of nasiriyah. master thesis. faculty of education university of thi-qar. 2006;92. 22. wadood ua, bari a, rhman au, qasim kf. frequency of intestinal parasite infestation in children hospital quetta. pakistan j med res. 2005;44. 23. razmjou e, rezaian m, haghighi a, kazemi b, farzami b, kobayashi s, et al. comparison of the recombinant glucose phosphate isomerase from different zymodems of entamoeba histolytica with their natural counterparts by isoenzyme electrophoresis. iranian j publ health. 2005;34:35–40. 24. egwunyenga a, ataikiru dp. soil – transmitted helminthiasis among school age children in ethiope east local government area of delta state, nigeria. afri j biotech. 2005;4:938–941. 25. garba cmg, mbofung cmf. relationship between malnutrition and parasitic infection among school children in the adamawa region of cameroon. pakistan j nutr. 2010;9:1094–1099. 26. al-zubaidi, zainab hadi. worm hookworm ancylostoma duodenale and its impact on the image mhimh blood in the village in the province of babylon. master thesis. faculty of science university of babylon. 2002. 27. al-khalifawi, mohammad jubair. study of the parasites of the gastrointestinal tract in children under five and their impact on some of the blood levels: master – faculty of science university of mustansiriya: 2006;92. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. case report 79j contemp med sci | vol. 8, no. 1, january-february 2022: 79–81 efficacy of amphotericin b on covid-19: a case report study shahrokh mehrpisheh1, roya farhadi1, vajihe ghaffari saravi1, azadeh memarian2*, farahnaz nikkhah3 1department of neonatology, faculty of medicine, mazandaran university of medical sciences, sari, iran. 2department of forensic medicine, faculty of medicine, mazandaran university of medical sciences, sari, iran. 3rasool akram medical complex clinical research development center (rcrdc), iran university of medical sciences, tehran, iran. *correspondence to: azadeh memarian (e-mail: memarian.a@iums.ac.ir) (submitted: 08 january 2022 – revised version received: 21 january 2022 – accepted: 01 february 2022 – published online: 26 february 2022) abstract the role of amphotericin b (amb) as an antiviral drug against some enveloped viruses has been studied in previous researches. coronavirus is an envelope, non-segmented and positive-sense rna virus which may be targeted by amb. our case was a 34-day-old female child with a 4-days history of low consciousness and dry cough, which gradually became productive. the infant was cyanotic at the admission time that transferred to the neonatal intensive care unit (nicu). after discharge, we were informed that result of pcr (polymerase chain reaction) test was positive which has been first reported as a false negative result. so the results drove our attention to that amphotericin b may cause a dramatic response to the coronavirus. because of the crucial role of the immune system in viral clearance, the amb as an immune response and pro-inflammatory stimulator may pave the way for preventing invasion in viral infections such as covid-19. keywords: covid-19, amphotericin b (amb), antiviral drug, severe dyspnea, intensive care units, neonatal introduction the novel coronavirus (2019-ncov) also named sars-cov-2 or coronavirus disease-2019 (covid-19), is an acute infectious disease first manifested in wuhan, china on december 26, 2019.1,2 patients with covid-19 often experience severe respiratory syndrome with the clinical signs of fever, fatigue, dizziness, dry cough, and gradually develop severe dyspnea.2 the diagnostic approaches for covid-19 have mainly relied on reverse transcription-polymerase chain reaction (rtpcr) or gene sequencing of sputum, throat swabs or lower respiratory tract excretions.1-3 the best preventive approach is to limit human-to-human transmission by early detection, isolation and caring for patients.2 patients with influenza who developed severe acute respiratory distress syndrome (ards) may also present invasive pulmonary aspergillosis (ipa), as the main leading cause of prolonged hospitalization and mortality rate.4,5 co-infections with bacteria and fungi have more occurred in 40% of hospitalized patients with covid-19 who developed ards, which is often associated with the development of ipa in patients taking corticosteroid drugs.6,7 it is not currently known whether covid-19-associated ipa antifungal therapy becomes a survival profit, however, diagnosis in most cases must result in early antifungal therapy.4 liposomal amphotericin b has been used as the ancient agent and treatment choice in the first-line therapy for various fungal infections specially ipa treatment in icu.8 amphotericin b (amb) belongs to the polyene group with broad-spectrum in vitro and in vivo antifungal activities and a valuable pharmaceutical profile which has low fungal resistance.9,10 since amb has a high affinity to ergosterol than cholesterol, it is effective against fungi and single-cell protozoa.11 several studies have been focused on the different mechanisms of action and the potential therapeutic effect of amb derivatives against some enveloped viruses, including human immunodeficiency virus (hiv),12 herpes simplex virus (hsv),13 japanese encephalitis virus and rubella virus.14,15 it has been expected that amb would change viral membrane integrity and envelope structure as well as host immunomodulatory effects.9,15 since coronaviruses belong to the enveloped viruses with positive-sense rna nucleic acid and club-like spikes, amb, may pave the way for designing a novel therapeutic option in covid-19 treatment. to the best of our knowledge, there is limited literature on the efficacy of amb against viral infection and no research is available on the role of amb in pediatrics with covid-19, so, we decided to share our experiences on a case report of the iranian 34-day-old child with signs of suspected covid-19 which may be of interest to health care workers who involved in health systems all over the world. case report the patient was a 34-day-old female infant who was admitted to the emergency department (ed) due to decreased level of consciousness. she had a dry cough from 4 days before the admission, which gradually became productive. she had no fever, shortness of breath, seizures, poor feeding and had the excretion of urine and feces. at the time of admission, the infant was cyanotic. her weight was less than 2,500 g (1900 g and the birth weight of 3000 g) and she was less than two months old, therefore, she was admitted to nicu. she had an opium-addicted mother who gave him opium in a lentil size since birth. the infant had a bilateral cleft lip and palate. her parents were non-appointed and both had a positive history of cough. no ecchymosis or purpura was found on physical exam, and she had no bulging or sunken fontanelles and her ears were normal. on physical exam of her eyes, the conjunctiva was swollen and the pupils had bilateral meiosis. the abdomen was soft and had no organomegaly. the genitals were girlish and normal. the infant was completely hypotensive with no response to stimulation. in the clinical record, she was reported a term neonate. totally, at the time of admission, she was cyanotic, unconscious, motionless, and intubated that was given cardiac massage and underwent salvage. in nicu, naloxone was administered and treatment with meropenem and vancomycin was continued, she was then intubated and underwent ventilation. issn 2413-0516 efficacy of amphotericin b on covid-19 case report s. mehrpisheh et al. 80 j contemp med sci | vol. 8, no. 1, january-february 2022: 79–81 during the course of hospitalization, the patient developed convulsive movements that started phenobarbital and then underwent echocardiography, which she showed small patent ductus arteriosus (pda), mild to moderate myocardial infarction (mi), and mild tricuspid regurgitation (tr). in electroencephalogram (eeg) monitoring, the epileptic waves were reported. extensive multicystic encephalomalacia was reported in brain computed tomography (ct). the test result was negative for covid-19, while bilateral lung opacity was seen on chest x-ray (cxr). because of non-response to 3-week-treatment with meropenem and vancomycin, the drugs were switched to cefepime and clindamycin, and amphotericin b was then started about 6 days later. the result of fungal test was negative but due to the organic response to amphotericin b, the drug continued and the ventilator set-up was rapidly reduced. the infant was disconnected from the ventilation device. the milk started and she was finally discharged with an improved general condition. after discharge, we were informed that result of pcr (polymerase chain reaction) test was positive which has been first reported as a false negative result. so the results drove our attention to that amphotericin b may cause a dramatic response to the coronavirus. discussion severe acute respiratory syndrome coronavirus (sars-cov-2) occurred in wuhan, hubei province, china, in early december 2019 in patients who had a history of entrancing to the huanan seafood wholesale market.16 the novel covid-19 caused by an un-segmented (+rna) coronaviruses presents the continuous spreading with arising mortality rate in the world.17 therefore, designing more effective therapeutic strategies and targeted therapies seem highly necessary to avert the spread of the upsetting pandemic worldwide. so far, there is no specific drug to directly target this novel virus and support organ failure in seriously ill patients which is considered as the main phase in clinical management.18 however, there are some marketed drugs available to avert ards as a main outcome of covid-19 in combination with nutrient supplements.18 in addition, applying drugs such as chloroquine and hydroxychloroquine in some covid-19 patients may be associated with many side effects.19 our case received treatment with naloxone followed by meropenem and vancomycin, both of them are antimicrobial agents which improve outcomes and shorten the duration of hospitalization in some cases with respiratory infections including pneumonia.20 recently, the clinical significance of therapeutic combination regimens in the management and monitoring of patients who suffer from covid-19 pneumonia has been considered.20 the use of the different combination regimens has been indicated to improve outcomes of covid-19 patients; the regimens include meropenem, levofloxacin, vancomycin as the antibacterial agents, and hydroxychloroquine, and oseltamivir as the antiviral agents.20 in addition to current therapeutic strategies, amb has become the center of attention recently as a possible antiviral agent for covid-19 treatment.15 therefore, its optimal therapeutic application is required to be more clarified by clinical trials. it seemed that amb has a more toxic effect on the virion of enveloped viruses than on the host cell, which is probably due to the differences and changes in the viral proteins derived from the host cell composition.15 therefore, these morphological and biological aspects of the viral envelope make it a suitable target for designing a novel antiviral therapy. in our case report, the patient did not show any improvement in the clinical outcome after long-term use of meropenem and vancomycin resulted in switching to cefepime and clindamycin, and finally amb. we observed the considerably improved outcomes immediately after starting the amb which may be due to the proper efficacy of this drug. moreover, amb has many indicative characteristics including accessibility, rare resistance, as well as broad-spectrum activity against many fungal and microbial infections, and viral rna nucleic acid and envelopes; therefore, designing further research studies and clinical trials seems necessary to fully recognize the role of amb in patients with covid-19. to the best of our knowledge, most enveloped viruses targeted by amb may have similar complexity and viral-specific proteins; moreover, considering the crucial role of the immune system in viral clearance, the amb as an immune response and pro-inflammatory stimulator may pave the way to prevent invasion in viral infections such as covid-19. the major aspects in the recovery of patients with covid-19 are establishing proper supportive maintenance and antibiotics-antiviral combination therapies which may take a long time to evaluate, and choosing specific antiviral agents as suitable therapeutic regimes for novel covid-19. relying on the results of previous studies about the unique characteristics and efficiency of amb against various enveloped viruses, the application of amb alone or in combination regimens may be effective in the reduction of drug side effects and improved prognosis of patients with covid-19 pneumonia. abbreviations amb: amphotericin b nicu: neonatal intensive care unit 2019-ncov: 2019-novel coronavirus rt-pcr: reverse transcription-polymerase chain reaction ards: acute respiratory distress syndrome hiv: human immunodeficiency virus hsv: herpes simplex virus ed: emergency department pda: patent ductus arteriosus mi: myocardial infarction tr: tricuspid regurgitation eeg: electroencephalogram ct: brain computed tomography cr: chain reaction sars-cov-2: severe acute respiratory syndrome coronavirus ethics approval institutional review board approval for case report was not required at our institution at the time of the study. written informed consent was obtained from the patient for publication of this case report. to keeping ethical principles, the name of the patient was not pointed in the paper and the rights of the subject were protected. the patient received treatment consistent with the current standard of care. s. mehrpisheh et al. case report efficacy of amphotericin b on covid-19 81j contemp med sci | vol. 8, no. 1, january-february 2022: 79–81 acknowledgments the authors thank the rasool akram medical complex clinical research development center (rcrdc) for its technical and editorial assists. conflict of interest the author reports no conflicts of interest in this work. consent for publication written informed consent was obtained from the patient’s legal guardian for publication of this case report and any accompanying images. informed consent written informed consent was obtained from the patient’s legal guardian for participation of the infant in the study. data availability statements the data that support the findings of this study are available from corresponding author on reasonable request. funding the authors declare that this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.  references 1. liu k-c, xu p, lv w-f, qiu x-h, yao j-l, jin-feng g. ct manifestations of coronavirus disease-2019: a retrospective analysis of 73 cases by disease severity. eur j radiol. 2020;126:108941. doi: 10.1016/j.ejrad.2020.108941. 2. liu r, han h, liu f, zhihua lv, kailang wu, yingle liu, et al. positive rate of rt-pcr detection of sars-cov-2 infection in 4880 cases from one hospital in wuhan, china, from jan to feb 2020. clinica chimica acta. 2020;505: 172-5. doi: 10.1016/j.cca.2020.03.009. 3. li g, fan y, lai y, tiantian han, zonghui li, peiwen zhou, et al. coronavirus infections and immune responses. j medl virol. 2020;92(4):424-32. doi: 10.1002/jmv.25685 4. arastehfar a, carvalho a, van de veerdonk fl, jeffrey d jenks, philipp koehler, robert krause, et al. covid-19 associated pulmonary aspergillosis (capa)—from immunology to treatment. j fungi. 2020;6(2):91. doi: 10.3390/jof6020091. 5. li e, knight jm, wu y, amber luong, antony rodriguez, farrah kheradmand, et al. airway mycosis in allergic airway disease. adv immunol. 2019;142: 85-140. doi: 10.1016/bs.ai.2019.05.002. 6. schauwvlieghe af, rijnders bj, philips n, verwijs r, vanderbeke l , van tienen c, et al. invasive aspergillosis in patients admitted to the intensive care unit with severe influenza: a retrospective cohort study. lancet respir med. 2018;6(10):782-92. doi: 10.1016/s2213-2600(18)30274-1 7. wauters j, baar i, meersseman p, meersseman w, dams k, de paep r, et al. invasive pulmonary aspergillosis is a frequent complication of critically ill h1n1 patients: a retrospective study. intensive care med. 2012;38(11):1761-68. doi: 10.1007/s00134-012-2673-2. 8. patterson tf, thompson iii gr, denning dw, fishman ja, hadley s, herbrecht r, et al. practice guidelines for the diagnosis and management of aspergillosis: 2016 update by the infectious diseases society of america. clin infect dis. 2016;63(4):e1-e60. doi: 10.1093/cid/ciw326. 9. al-khikani f, al-janabi a. topical amphotericin b formulas: promising new application. intj med sci curr res. 2019;2:187-96. 10. lanternier f, lortholary o. liposomal amphotericin b: what is its role in 2008? clin microbiol infect. 2008;14 suppl 4:71-83. doi: 10.1111/j.14690691.2008.01984.x. 11. sangalli-leite f, scorzoni l, mesa-arango ac, casas c, herrero e, mendes gianinni mjs, et al. amphotericin b mediates killing in cryptococcus neoformans through the induction of a strong oxidative burst. microbes infec. 2011;13(5):457-67. doi: 10.1016/j.micinf.2011.01.015. 12. konopka k, guo ls, düzgüneş n. anti-hiv activity of amphotericin b-cholesteryl sulfate colloidal dispersion in vitro. antiviral res. 1999; 42(3):197-209. doi: 10.1016/s0166-3542(99)00028-5 13. shiota h, jones b, schaffner c. anti-herpes simplex virus (hsv) effect of amphotericin b methyl ester in vivo. antimicrob agents chemother. 1978; 13(2):199–204. doi: 10.1128/aac.13.2.199. 14. kim h, kim s-j, park s-n, oh j-w. antiviral effect of amphotericin b on japanese encephalitis virus replication. j microbiol biotechnol. 2004;14(1):121-127. https://www.koreascience.or.kr/article/ jako200411923002271. 15. al-khikani fho. amphotericin b as antiviral drug: possible efficacy against covid-19. ann thorac med. 2020;15(3):118 -24. doi: 10.4103/atm.atm_147_20 16. andersen kg, rambaut a, lipkin wi, holmes ec, garry rf. the proximal origin of sars-cov-2. nature med. 2020;26(4):450-52. doi: 10.1038/s41591020-0820-9. 17. fehr ar, perlman s. coronaviruses: an overview of their replication and pathogenesis. methods mol biol 2015;1282:1-23. doi: 10.1007/978-1-49392438-7_1. 18. zumla a, azhar ei, arabi y, alotaibi b, rao m, mccloskey b, et al. hostdirected therapies for improving poor treatment outcomes associated with the middle east respiratory syndrome coronavirus infections. int j infect dis. 2015;40:71-4. doi: 10.1016/j.ijid.2015.09.005 19. wang m, cao r, zhang l, yang x, liu j, xu m, et al. remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-ncov) in vitro. cell res. 2020;30(3):269-71. doi: 10.1038/s41422-0200282-0. 20. vahedi e, ghanei m, ghazvini a, azadi h, izadi m, panahi y, et al. the clinical value of two combination regimens in the management of patients suffering from covid-19 pneumonia: a single centered, retrospective, observational study. daru j pharm sci. 2020:1-10. doi: 10.1007/s40199-020-00353-w. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i1.1115 192 j contemp med sci | vol. 7, no. 4, july-august 2021: 192–195 original abstract objective the aim of this study was to compare the effect of diphenhydramine and midazolam on sedation of children. methods this clinical trial was performed on children aged 1 to 7 years who referred to the emergency department for diagnostic radiology. patients were randomly divided into two groups of midazolam and diphenhydramine. then, 30 minutes before the start of the procedure, 0.5 mg/kg was given to the midazolam group and 0.5 cc/kg to the diphenhydramine group. if sedation occurred, the child was separated from the parents and transferred to a diagnostic procedure. after performing the intended diagnostic procedure, the information sheet was completed and the patient's vital signs were checked again. the data were then analyzed by spss version 19 software. results a total of 74 patients were included in the study. there was no significant difference between the two groups in terms of age and gender (p = 0.89; p = 0.32). the mean sedation in the midazolam and diphenhydramine groups was 1.02 and 1.59 years, respectively. a significant difference was found between the two groups in terms of sedation (p = 0.04), where a greater effect of diphenhydramine on sedation was observed. conclusion the findings showed that the use of diphenhydramine resulted in effective sedation for children. due to the fact that the main problem with midazolam is its bitter taste, which makes children reluctant to eat it, the use of diphenhydramine can be recommended. keywords diphenhydramine, midazolam, sedation comparison of the effect of oral diphenhydramine and midazolam on sedation of children neda naeimi bafghi, naeimeh naeimi bafghi*, shirin salajegheh clinical research center, shahid bahonar hospital, kerman university of medical sciences, kerman, iran. *correspondence to: naeimeh naeimi bafghi (e-mail: naeimehnaeimibafghi@yahoo.com) (submitted: 14 april 2021 – revised version received: 02 may 2021 – accepted: 29 may 2021 – published online: 26 august 2021) introduction fear and anxiety before a diagnostic-therapeutic process or before anesthesia and surgery can be a more traumatic experience than the process itself for many patients, especially children.1,2 according to studies, nothing could even replace parental support and caress in many cases, but this support is not effective in relieving preoperative fear and excitement, thus prodrug has a significant clinical effect in reducing the child’s harm from anesthesia and surgery.3,4 studies show that parental anxiety make it more difficult to separate children.5 some studies have also shown that prescribing sedatives before surgery prevent adverse postoperative reactions such as nocturnal enuresis and anorexia. numerous studies have shown that almost all sedatives are effective as prodrugs,6 however, the selection of an appropriate prodrug should be done by considering the desired amount of sedation on the one hand and the effectiveness, side effects and indications of each drug on the other hand. the need for prodrug varies depending on the patient’s condition, underlying disease, type and duration of surgery, method of induction, and mental structure of the child and his family. children under 8 months of age rarely need prodrugs, but after this age the child’s normal development causes fear of people and unfamiliar environment.3–5 preoperative drug administration is widely used for sedation and anti-anxiety effects in pediatric anesthesia.7 a good sedative is easy to use, rapid onset of action, short duration of action and lack of side effects.8 the prodrug used is enough to have only a sedative effect. on the other hand, prodrugs can be given by different routes oral, nasal, intravenous, or intramuscular, and rectal routs. certainly, oral and nasal routs are more acceptable and simpler in children and are not accompanied by pain and anxiety. the most commonly used drugs in children are diphenhydramine, dextromethorphan and midazolam. in the united states, midazolam has been produced as versed syrup in recent years, but this product is only available in the united states.9 midazolam is a good sedative that can be prescribed in several routs (oral, injectable, nasal and rectal).10 the onset of action is within 10 to 20 minutes and the duration of action is 30 minutes. midazolam at doses less than 0.5 mg/kg do not result in a change in hemodynamics7 and provides excellent sedation in 60 to 80% of patients.11 in the oral rout, the time to reach the peak effect is one hour and the reversal of the action of drug is long (up to about 4 hours), while the depth of sedation also varies. for this reason, the intranasal rout, which reaches the peak effect of the drug within ten minutes and the reversal time of the effect is not more than one hour, seems more acceptable.12 diphenhydramine has also been used as an inverse agonist of the histamine h1 receptor in a variety of allergic and psychiatric diseases. it is also used as an adjunct to insomnia or sleep disorders. the use of diphenhydramine in anesthesia is limited.13 therefore, the aim of this study was to evaluate the effect of oral diphenhydramine and midazolam on sedation of children referred to the hospital for imaging. materials and methods this clinical trial was performed on children aged 1 to 7 years who referred to the emergency department of bahonar hospital in kerman, iran, for diagnostic radiology procedures issn 2413-0516 193j contemp med sci | vol. 7, no. 4, july–august 2021: 192–195 n.n. bafghi et al. original comparison of the effect of oral diphenhydramine and midazolam on sedation of children from may to august 2019. patients who met the inclusion and exclusion criteria were included in the study. inclusion criteria: age of children between 1 to 7 years and level of consciousness in the mild-moderate range. exclusion criteria include: parental dissatisfaction, gcs ≤ 8 and unstable hemodynamics (lack of hemodynamics). sample size taking into account the first and second type errors, the sample size of 74 people was calculated using the formula of comparing the two means. n n s s z x x1 2 1 2 2 2 1 2 1 1 2 2 2 = = + +( ) − − −( ) ( ) z a b procedure after obtaining informed consent, patients were randomly divided into two groups of midazolam and diphenhydramine. then, 30 minutes before the start of the procedure, the drug was administered to the midazolam group at 0.5 mg/kg and to the diphenhydramine group at 0.5 cc/kg. if sedation occurred, the child was separated from the parents and transferred to a diagnostic procedure (ct, radiology, and ultrasound). after performing the diagnostic procedure, the information sheet was completed and the patient's vital signs were checked again and children were then returned to the parents if the child was found to be healthy. in fact, the child was resuscitated if there were unstable vital signs. the child was returned to the parents if he or she had stable vital signs. the measurement of effectiveness criteria was as follows: the patient is sedated to the extent of mild (minimal) moderate. this means that patients have a purposeful response to verbal or physical stimulation after receiving the substance by the above methods, and the airway, respiration, blood pressure and pulse are not disturbed. reaching or not reaching this amount in each of the studied methods was considered as outcome. sedation rates were assessed based on the the university of michigan sedation scale (umss) with patient questioning and examination. umss is capable of evaluating the level of changes on a five-point scale as follow: 1. sleepy / responds umss: o: a wake aurt 2. somnolent / arouses to light stimuli 3. deep sleep / arouses to deporplynsical stimuli 4. unarousable to stimuli data analysis independent t-test was used to compare the parameters in two independent groups. chi-square test was used to examine qualitative variables. data analysis was performed using spss software version 19 using statistical methods including descriptive and inferential statistics. a p value of 0.05 was considered to be statistically significant. ethical considerations a written letter of introduction to research centers was received from university officials. the purpose of the study was described for all research units and finally written consent was obtained. all patients, information was kept confidential. the declaration of helsinki was considered in the current study. the statements of the research ethics committees of the university of medical sciences were taken into account. the study was carried out after approval by the research council of the medical school and receiving the code (ir.kmu. rec.1397.520) of ethics letter of introduction. results a total of 74 patients were included in the study. the study population consisted of 39 female patients and 35 male patients who were divided into two groups of 37 patients. there was no significant difference between the two groups in terms of gender (p = 0.32) (table 1). the mean age in the diphenhydramine group was 2.89 years and the mean age was 2.83 years in the midazolam group (table 2). no significant difference was found between the two groups in terms of age (p = 0.89), indicating that the groups were the same at the beginning of the study and elimination of age effects. the mean sedation is given in table 3, which was determined to be 1.02 and 1.59 years in the midazolam and diphenhydramine groups, respectively. there was a statistically significant difference between the two groups (p = 0.04) so that a higher mean in the group of diphenhydramine indicates a greater effect of diphenhydramine in sedation. discussion prodrug administration in children using a safe method and appropriate dose is very important to achieve adequate sedation.14 the aim of this study was to compare the effect of diphenhydramine and oral midazolam on sedation of children. in this study, 74 children aged 1 to 7 years were examined. then, the findings of this study were analyzed and the final conclusion was presented. table 1. frequency distribution of subjects by gender variable female male total p-value diphenhydramine 21 (56.8%) 16 (43.2%) 37 0.32 midazolam 18 (48.6%) 19 (51.4%) 37 total 39 35 74 table 2. mean and standard deviation of age in the two groups variable mean sd t p-value diphenhydramine 2.89 1.86 0.13 0.89 midazolam 2.83 1.7 table 3. mean and standard deviation of sedation after intervention variable mean sd t p-value diphenhydramine 1.59 1.11 2.07 0.04 midazolam 1.02 1.23 194 j contemp med sci | vol. 7, no. 4, july-august 2021: 192–195 comparison of the effect of oral diphenhydramine and midazolam on sedation of children original n.n. bafghi et al. in the present study, there was no significant difference between the two groups in terms of gender and age. as a result, the confounding effect of these variables has been controlled. the most important finding of this study was the significant difference between the mean sedation in the midazolam and diphenhydramine groups, where a higher mean sedation was observed in the diphenhydramine group. cengiz et al. compared the safety and efficacy of midazolam–diphenhydramine combination and midazolam alone in pediatric sedation for magnetic resonance imaging. the results showed that the combination of oral diphenhydramine with oral midazolam is safe and effective in performing mri in children and its sedative failure is less during mri.15 findings of golzari et al.’s study also showed that the combination of diphenhydramine and midazolam has a higher sedative effect and less side effects compared to diphenhydramine alone.16 in heydarian’s research, the findings showed that the combination of oral diphenhydramine and oral midazolam leads to safe and effective sedation of children during ct scan. this combination can be more beneficial than midazolam alone.17 the results of a study by taghipor et al., which examined the sedative effect of three oral prodrugs (midazolam, dextromethorphan and diphenhydramine) in children, indicated that the rate of sedation before any intervention in the dextromethorphan group was significantly better. at the time of separation of children from parents, the three groups did not differ significantly in the intensity of sedation. however, the intensity of sedation in patients receiving dextromethorphan was significantly better than that of oral diphenhydramine and midazolam during induction of anesthesia and in the recovery.18 in some other studies, the effect of midazolam alone in pediatric sedation has been investigated. in 2008, lane et al. examined the use of intranasal midazolam for minor procedures in children, stating that intranasal midazolam is very suitable for providing anxiolysis reducing anxiety to children undergoing minor procedures in the pediatric department.19 in 2015, plum et al. examined the effect of intranasal midazolam in reducing anxiety in children with nasal fractures. the results showed that midazolam was quite effective in providing effective anxiolysis and had no adverse outcomes.20 in a 2015 study, musani et al. concluded that intravenous midazolam had a quick onset of action and a quick recovery from sedation. also, its proper effect required a lower dose through the intranasal route. finally, they concluded that intranasal midazolam is a suitable alternative to oral midazolam for a pediatric dental condition.21 many diagnostic and therapeutic measures in children require the full cooperation of the child. these diagnostic procedures include radiology, endoscopy, colonoscopy, aspiration, bone marrow biopsy, liver and kidney biopsy, bronchoscopy, and cerebrospinal fluid biopsy. the use of sedatives for diagnostic, biopsy, or minor surgery in children is a high priority. issues such as unfamiliarity with the ward, not realizing the importance of the issue, separation from parents will lead to poor cooperation of children. therefore, it should be tried that in the process of prescribing sedatives, drugs with ease of use, rapid onset of action, minimal side effects and more short recovery should be prescribed. non-injectable prescriptions are highly acceptable, although they have a longer onset of action than the injectable form and have a higher initial liver removal; also, it is possible that interpersonal differences in effect rate and rate of absorption may impair the process. sedation measures increase the quality of diagnosis and treatment and can reduce the psychological effects of the child. conclusion the results of this study showed that the use of diphenhydramine is suitable for sedation and reducing anxiety in children. due to the fact that the main problem with midazolam is its bitter taste, which makes children reluctant to eat it, the use of diphenhydramine can be recommended.  references 1. song jh. procedural sedation and analgesia in children. j korean med assoc. 2013;56(4):271-8. 2. eskandarian t, maghsoudi s, eftekharian h. clinical evaluation of the effects of two types of oral combination of midazolam in sedating pediatric dental patients. j dent shiraz univ med sci. 2010;11(1). 3. soleimanpour h, gholipouri c, salarilak s, raoufi p, vahidi rg, rouhi aj, et al. emergency department patient satisfaction survey in imam reza hospital, tabriz, iran. int j emerg med. 2011;4:2. 4. barkan s, breitbart r, brenner-zada g, et al. a double-blind, randomised, placebo-controlled trial of oral midazolam plus oral ketamine for sedation of children during laceration repair. emerg med j. 2013;31(8):649-53. 5. hosseini m, karami z, janzadenh a, et al. the effect of intrathecal administration of muscimol on modulation of neuropathic pain symptoms resulting from spinal cord injury; an experimental study. emergency. 2014; 2(4):151-7. 6. alimohammadi h, shojaee m, samiei m, abyari s, vafaee a, mirkheshti a. nerve stimulator guided axillary block in painless reduction of distal radius fractures; a randomized clinical trial. emergency. 2013;1(1):11-4. 7. azizkhani r, esmailian m, golshani k. rectal thiopental versus intramuscular ketamine in pediatric procedural sedation and analgesia; a randomized clinical trial. emergency. 2014;3(1):22-6. 8. khajavi m, emami a, etezadi f, safari s, sharifi a, moharari rs. conscious sedation and analgesia in colonoscopy: ketamine/propofol combination has superior patient satisfaction versus fentanyl/propofol. anesthesiol pain med. 2013;3(1):208-12. 9. alimohammadi h, azizi m-r, safari s, amini a, kariman h, hatamabadi hr. axillary nerve block in comparison with intravenous midazolam/fentanyl for painless reduction of upper extremity fractures. acta med iranica. 2014; 52(2):122-4. 10. krauss bs, krauss ba, green sm. procedural sedation and analgesia in children. n engl j med. 2014;370(15):e23. 11. moreira ta, costa ps, costa lr, et al. combined oral midazolam–ketamine better than midazolam alone for sedation of young children: a randomized controlled trial. int j paediatr dent. 2013;23(3):207-15. 12. maurizi p, russo i, rizzo d, et al. safe lumbar puncture under analgosedation in children with acute lymphoblastic leukemia. int j clin oncol. 2014;19(1):173-7. 13. green sm. what is the role of diphenhydramine in local anesthesia? academerg med. 1996;3(3):198-200. 14. alimohammadi h, baratloo a, abdalvand a, rouhipour a, safari s. effects of pain relief on arterial blood o2 saturation. trauma mon. 2014;19(1):e14034. 15. cengiz m, baysal z, ganidagli s. oral sedation with midazolam and iphenhydramine compared with midazolam alone in children undergoing magnetic resonance imaging. pediateric anesthesia 2006;16(6): 621–626. 16. golzari s, shahsavari nia k , sabahi m, soleimanpour h , mahmoodpoor a, safari s , et al. oral diphenhydramine-midazolam versus oral diphenhydramine for pediatric sedation in the emergency department. j comprped 2014 february;5(1):e17946. 17. heydarian n. comparison of the simultaneous use of midazolam and oral diphenhydramine with oral midazolam in pediatric patients 1 to 7 years old at the time of ct scan referring to the emergency department of besat hospital. army university of medical sciences, thesis. 2014. 195j contemp med sci | vol. 7, no. 4, july–august 2021: 192–195 n.n. bafghi et al. original comparison of the effect of oral diphenhydramine and midazolam on sedation of children this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. 18. taghipor anvari z, sheibani s, imani f, sheibani s. comparison of three oral premedication dextrometorphan, diphenhydramine and midazolam in pediatric eye exam under anesthesia. jap. 2011;2(3):9-17. 19. lane rd, schunk je. atomized intranasal midazolam use for minor procedures in the pediatric emergency department. pediatr emerg care. 2008 may; 24(5):300-3. 20. plum aw, harris tm. intranasal midazolam for anxiolysis in closed reduction of nasal fractures in children. int j pediatr otorhinolaryngol. 2015 jul; 79(7):1121-3. 21. musani ie, chandan nv. a comparison of the sedative effect of oral versus nasal midazolam combined with nitrous oxide in uncooperative children. eur arch paediatr dent. 2015 may 5. https://doi.org/10.22317/jcms.v7i4.1002 216 j contemp med sci | vol. 8, no. 4, july-august 2022: 216–219 original knowledge and practice of physicians about vitamin b12 deficiency among type 2 diabetes mellitus patients in buraidah, saudi arabia fahad alruamaykhani*, unaib rabbani family medicine academy, qassim health cluster, buraidah, saudi arabia. *correspondence to: fahad alruamaykhani (e-mail: fahad.r.m.k@gmail.com) (submitted: 13 april 2022 – revised version received: 08 may 2022 – accepted: 25 may 2022 – published online: 26 august 2022) abstract objectives: to assess knowledge and practice of physicians regarding vitamin b12 screening among type 2 diabetes mellitus (t2dm) and assess knowledge of physicians about recent american diabetic association (ada) guidelines updates. methods: a cross sectional study was conducted at primary health care (phc) centers in buraidah, qassim from january to april 2022. data was collected using a structured questionnaire which was based on ada guidelines among all physicians of phcs. statistical package for social sciences (spss) version 23.0 was used for analysis. frequencies and percentages were calculated for categorical variables and means with standard deviations were calculated for continuous variables. results: about 135 (72.2%) physicians would test t2dm patients who are on metformin for vitamin b12, and only 65 (34.8) would test them annually. early signs of diabetic peripheral neuropathy (dpn) are pain, burning sensation, tangling sensation, numbness and loss of protective sensation (lops). only 23 (12.3%) of them knew the all five symptoms. forty-five (45.5%) of participants would not treat dpn with b12 supplementation. only (57.2%) order vit b12 testing for dm2 who are on metformin, and (49.2%), (29.4%) would order them if the patient has neuropathy and on annual basis respectively. majority of physicians (70.6%) give vit b12 supplements as treatment of dpn. conclusion: there is poor knowledge and practices related to b12 deficiency among primary care physicians. this calls for training and educating primary care physicians regarding b12 deficiency screening, neuropathy and their management. there is also need for providing sufficient resources in order to ensure b12 screening in high risk diabetic patients. keywords: primary care, b12 screening, b12 supplementation, diabetics, saudi arabia issn 2413-0516 background type 2 diabetes mellitus (t2dm) is a major problem worldwide. its prevalence increasing globally, including saudi arabia.1 the world health organization (who) has reported that saudi arabia ranks the second highest in the middle east, and is seventh in the world for the rate of diabetes. it is estimated that around 7 million of the population are diabetic and almost around 3 million have pre-diabetes.2 one of the corner stone medications used for t2dm is metformin; which is reported to be associated with vitamin b12 deficiency up to 30% among patients who are in long term metformin treatment.3–6 a recent report from the diabetes prevention program outcomes study (dppos) suggesting periodic testing of vitamin b12.7 long‐term metformin therapy is significantly associated with lower serum vitamin b12 concentration, yet those at risk are often not monitored for b12 deficiency. prescription of vitamin b12 supplementation is common practice in physicians for diabetics who are on metformin without solid evidence of vitamin b12 levels. a research about the association of metformin use with vitamin b12 deficiency and peripheral neuropathy in saudi individuals with type 2 diabetes mellitus, found that the prevalence of b12 deficiency was 7.8% overall, but the b12 deficiency was 9.4% and 2.2% in metformin users and non-metformin users, respectively.8 a meta-analysis done 2014, six randomized controlled trials concluded that b12 concentration was significantly lower in metformin users compared to those on placebo (mean difference [md], –53.93 pmol/l; 95% confidence interval [ci], –81.44 to –26.42 pmol/l, p = 0.0001).9 testing for levels of and prescription of b12 supplementation have been found to be varying and discordant. a study published in 2017 in atlanta, georgia reported that, only 37% of older adults with diabetes receiving metformin were tested for vitamin b12 status after long‐term metformin prescription.10 another study conducted in riyadh 2019 found that among 57.9% of diabetics who were on vitamin b12 supplementation, and only 4.4% had available serum vitamin b12 levels. among physicians 39% do not know about the current ada recommendation, whereas 17% have no idea about the recommendations.11 there is limited evidence on prescription of b12 screening and supplementation for diabetic patients by physicians in saudi arabia. this study therefore aimed to assess knowledge and practice of physicians regarding vitamin b12 screening among t2dm and assess knowledge of physicians about recent ada guidelines updates. methodology this cross-sectional study was conducted among physicians working in primary health care (phc) centers in buraidah city january to april 2022. targeted participants were all physicians in phcs. there are about 40 functional phc centers in buraidah and there are 204 physicians working in those phc centers including family medicine trainees and trainers. given the limited population of physicians, we included all the primary care physicians who were working in phc centers of buraidah for at least one year in our study. we excluded those physicians working in polyclinics in phc centers and having other specialty. all the eligible physicians were mailto:fahad.r.m.k@gmail.com 217j contemp med sci | vol. 8, no. 4, july-august 2022: 216–219 f. alruamaykhani et al. original diabetics and b12 deficiency management approached in their respective phc centers and invited to participate in the study. data was collected using structured questionnaire. the questionnaire was developed based on american diabetics association (ada) guidelines. questionnaire had three sections. first section included variables related to social and professional information. second section assessed the knowledge about vitamin b12 and diabetic peripheral neuropathy. third section was about practice of physician regarding vitamin b12 screening. after taking permission from the regional director of phcs, the questionnaire were distributed directly to the physicians by trained data collectors, who were undergraduates medical students. the data was analyzed using statistical package for social sciences (spss) version 23.0. descriptive analysis was done and calculated frequencies and proportions of categorical variables while mean with standard deviations was calculated for continuous variables. ethical approval was taken from qassim regional bioethics committee. informed consent was taken from all participants and confidentiality was maintained as name and id of participants was not taken. approval was also taken from administration of phc centers. results a total of 250 physicians were invited to participate in the study period out of which 187 patients completed the questionnaire (response rate 74.8%). more than half (57.2%) were males. the mean (sd) age was 36.9 (8.55) years. more than half (58.3) of them were saudis. the professional ranks of the participants were as follows; general practitioners (gps) 63 (33.7%), residents 61 (32.6%), specialists 44 (23.5%) and consultant 19 (10.2%). with mean (sd) experience 9.18 (7.15) years (table 1). a total of 112 (59.9%) knew that vitamin b12 supplementation essential to patients who are taking metformin and have b12 deficiency. in terms of routine test for vit b12, about 135 (72.2%) physicians would test dm2 who are on metformin, and 65 (34.8) would test them annually. according to ada 2021 there are five special groups (pregnant or lactating ladies, older adults, vegetarians and people who are on low carb diets) for which multivitamins are recommended. in our sample, 21 (11.2%) were aware of the five groups. majority of participants (80.2%) knew that vitamin c and e are not advised for diabetic patients. early signs of diabetic peripheral neuropathy (dpn) are pain, burning sensation, tangling sensation, numbness and loss of protective sensation (lops). only 23 (12.3%) of them knew the all five symptoms. forty-five (45.5%) of participants would not treat dpn with b12 supplementation. more than half of the physicians (50.3%) knew that dmt2 patients on metformin taking larger dosage for long duration, are at higher risk of dpn (table 2). regarding the practices of prescription of vitamin b12 supplement, almost half of participants (48.1%) prescribed b12 supplements for diabetics who are on metformin, (36.4%) give only to symptomatic patients and (11.8%) would give every dmt2. of the physicians, only (57.2%) order vit b12 testing for dmt2 who are on metformin, and (49.2%), (29.4%) would order them if the patient has neuropathy and on annual basis respectively. seventeen participants (9.1%) prescribe table 1. socio-demographic characteristics variables n (%) age mean (sd) 36.9 (8.55) gender male female 107 (57.2) 80 (42.8) nationality saudi non-saudi 109 (58.3) 78 (41.7) qualification gp resident specialist consultant 63 (33.7) 61 (32.6) 44 (23.5) 19 (10.2) experience mean (sd) 9.18 (7.15) table 2. knowledge about b12 deficiency b12 supplement is required for every diabetic pt pts on metformin pts with neuropathy sx none of the above 8 (4.3) 112 (59.9) 63 (33.7) 4 (2.1) routine test for b12 dm t1 dm t2 both types idk 3 (1.6) 135 (72.2) 38 (20.3) 11 (5.9) routine test for b12 every 1 year every 5 years every 6 months for symptomatic pts idk 65 (34.8) 11 (5.9) 4 (2.1) 97 (51.9) 10 (5.3) indications of mv supplement one indication two indications three indications four indications five indications 28 (15.0) 57 (30.5) 58 (31.0) 23 (13.3) 21 (11.2) vit c and e supplement are required for dm t1 dm t2 idk not advised 1 (0.5) 18 (9.6) 18 (9.6) 150 (80.2) early signs of dpn one sign two signs three signs four signs five signs 32 (17.1) 44 (23.5) 66 (35.3) 22 (11.8) 23 (12.3) b12 is treatment of dpn yes no idk 96 (51.3) 85 (45.5) 6 (3.2) metformin related dpn is associated with longer duration higher dose both dose and duration irrelevant to dose and duration idk 60 (32.1) 7 (3.7) 94 (50.3) 18 (9.6) 8 (4.3) 218 j contemp med sci | vol. 8, no. 4, july-august 2022: 216–219 diabetics and b12 deficiency management original f. alruamaykhani et al. we found that, in practice 57.2% of the practitioners do routine testing on patients who are on metformin and 49.2%, 29.4% test their patients if they have neuropathy and annually respectively. compared to the study in riyadh,11 51.0% order vitamin b12 testing only if they have symptoms of neuropathy and 19.0% routinely order vitamin b12 testing. one explanation to the difference in knowledge and practice is lack of resources in phc settings which may hinder testing of b12 levels. in our study only 12.3% knew the five signs of dpn. this an important finding as this low knowledge of signs of dpn might lead to delay in identification and treatment of dpn. metformin use has been associated with dpn in prospective study where the prevalence of neuropathy was significantly higher among the patients with low levels of b12.7 this calls for educating primary care physicians regarding the dpn risk factors and sign and symptoms. the study has provided useful information regarding the knowledge and practices of primary care physicians about b12 among diabetic patients. however, there are two limitations should be kept under consideration. first, the knowledge and practices were self-reported and therefore are prone to response bias, as physicians may report better practice then their actual practices. however, we assume this to be of less importance as we ensured complete privacy and anonymity during data collection which would have encouraged respondents to give accurate responses. secondly, this study was conducted in one city only, therefore results may not be generalizable to whole region. none the less, this study has provided a base for further research on practices of b12 deficiency among diabetic patients. conclusion this study highlights the fact that there is lack of knowledge about the ada recommendation by phc physicians. routine testing for serum vitamin b12 level is not practiced in our centers. thus, there is need for doctors involved in the management of diabetes to keep abreast with guidelines and current recommendations and routinely monitor vitamin b12 levels particularly those who were on long-term use of metformin and the elderly patients to optimize management of diabetes and its complications. the difference between knowledge and practice due to lack of resources in phc, so we recommend that physicians and managers reach a solution to provide the needed resources. financial support and sponsorship this research did not receive any funding. conflict of interest there are no conflicts of interest. acknowledgment i would like to thank khalid alharbi, ahmad alshammari, saif alshammari, ghaida alfarhan, muath alharbi, ahmad alenezi for helping in data collection for this study.  table 3. practice about b12 deficiency i give b12 supplements for every t2 diabetic pt pts on metformin pts with neuropathy sx none of the above 22 (11.8) 90 (48.1) 68 (36.4) 7 (3.7) i order b12 test for dm t1 dm t2 both types i don’t order 1 (0.5) 107 (57.2) 26 (13.9) 53 (28.3) i order b12 test every 1 year every 5 years every 6 months for symptomatic pts i don’t order 55 (29.4) 10 (5.3) 6 (3.2) 92 (49.2) 24 (12.89) i give mv for one indication two indications three indications four indications five indications 35 (18.7) 62 (33.2) 57 (30.5) 16 (8.6) 17 (9.1) i give b12 as treatment for dpn yes no 132 (70.6) 55 (29.4) multivitamins to the five recommended groups. majority of physicians (70.6%) give vit b12 supplements as treatment of dpn (table 3). discussion type 2 diabetics particularly those on metformin are at risk for metabolically lower levels of vitamin b12. the mechanisms of vitamin b12 deficiency in metformin treatment has not been clear, but the most likely hypothesis is that metformin interferes with calcium-dependent membrane action responsible for vitamin b12 intrinsic factor absorption in the terminal ileum.6 in this study we found 59.9% knew that vit b12 supplementation is essential for dmt2 patients who are on metformin, but only 34.8% knew that it’s recommended to test for it annually. we found only 12.3% knew the 5 signs of dpn. regarding practice, we found 48.1% of physicians prescribe vit b12 supplementation for every patient on metformin, but only 29.4% order vit b12 test on annual basis. we also found that majority (70.6%) of physicians give vit b12 as treatment of dpn. in previous study11 44.0% of the respondents know the current recommendation of ada on vitamin b12 screening and supplementation among diabetic patients. seventy-two percent of our participants knew that routine testing of vit b12 for dmt2 patients on metformin and 34.8% knew that it’s recommended to test them annually. a possible explanation of lower knowledge in buraidah compared to riyadh is most of our participants were general practitioner (gps) compared to specialists in diabetic clinics in riyadh study. none the less this is an important finding and call for updating the knowledge of practitioners on this matter. 219j contemp med sci | vol. 8, no. 4, july-august 2022: 216–219 f. alruamaykhani et al. original diabetics and b12 deficiency management references 1. lam dw, leroith d. the worldwide diabetes epidemic. current opinion in endocrinology, diabetes, and obesity. 2012;19(2):93-96. doi: 10.1097/ med.0b013e328350583a. http://europepmc.org/article/med/22262000. 2. al dawish ma, robert aa, braham r, al hayek aa, al saeed a, ahmed ra, et al. diabetes mellitus in saudi arabia: a review of the recent literature. curr diabetes rev. 2016;12(4):359–368. doi: 10.2174/157339981166615072 4095130. https://pubmed.ncbi.nlm.nih.gov/26206092/. 3. damião cp, rodrigues ao, pinheiro mf, cruz filho ra, cardoso gp, taboada gf, lima ga. prevalence of vitamin b12 deficiency in type 2 diabetic patients using metformin: a cross-sectional study. sao paulo medical journal. 2016;134(3):473–9. doi: 10.1590/1516-3180.2015.01382111. http:// europepmc.org/article/med/28076635. 4. sánchez h, masferrer d, lera l, arancibia e, angel b, albala c. vitamin b12 deficiency associated with high doses od metformin in older people diabetic. nutricion hospitalaria. 2014 jun 1;29(6):1394–400. doi: 10.3305/ nh.2014.29.6.7405. http://europepmc.org/article/med/24972480. 5. ko sh, ahn yb, song kh, han kd, park ym, kim hs. association of vitamin b12 deficiency and metformin use in patients with type 2 diabetes. j korean med sci. 2014;29:965–72. http://europepmc.org/article/med/25045229. 6. ko sh, ko sh, ahn yb, et al. association of vitamin b12 deficiency and metformin use in patients with type 2 diabetes. journal of korean medical science. 2014;29(7):965–972. doi: 10.3346/jkms.2014.29.7.965. https:// pubmed.ncbi.nlm.nih.gov/31725641/. 7. aroda vr, edelstein sl, goldberg rb, knowler wc, marcovina sm, orchard tj, et al. diabetes prevention program research group. long-term metformin use and vitamin b12 deficiency in the diabetes prevention program outcomes study. j clin endocrinol metab. 2016;101(4):1754–61. doi: 10.1210/jc.2015-3754. https://pubmed.ncbi.nlm.nih.gov/26900641/. 8. alharbi tj, tourkmani am, abdelhay o, alkhashan hi, al-asmari ak, bin rsheed am, et al. the association of metformin use with vitamin b12 deficiency and peripheral neuropathy in saudi individuals with type 2 diabetes mellitus. plos one. 2018;13(10):e0204420. doi: 10.1371/journal. pone.0204420. https://pubmed.ncbi.nlm.nih.gov/30321183/. 9. liu q, li s, quan h, li j. vitamin b12 status in metformin treated patients: systematic review. plos one. 2014;9(6):e100379. doi: 10.1371/journal. pone.0100379. http://europepmc.org/article/med/24959880. 10. kancherla v, elliott jl jr, patel bb, holland nw, johnson tm, khakharia a, et al. long-term metformin therapy and monitoring for vitamin b12 deficiency among older veterans. j am geriatr soc. 2017;65(5):1061–1066. doi: 10.1111/jgs.14761. https://pubmed.ncbi.nlm.nih.gov/28182265/. 11. alshammari an, iqbal r, baksh ip. vitamin b12 deficiency and the knowledge and practice of physicians regarding screening for vitamin b12 deficiency among type 2 diabetic patients on metformin in selected hospitals in riyadh, saudi arabia. journal of family medicine and primary care. 2019;8(7):2306–2311. doi: 10.4103/jfmpc.jfmpc_416_19. http:// europepmc.org/article/med/31463247. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i4.1209 http://europepmc.org/article/med/22262000. https://pubmed.ncbi.nlm.nih.gov/26206092/. http://europepmc.org/article/med/28076635. http://europepmc.org/article/med/28076635. http://europepmc.org/article/med/24972480. http://europepmc.org/article/med/25045229. https://pubmed.ncbi.nlm.nih.gov/31725641/. https://pubmed.ncbi.nlm.nih.gov/31725641/. https://pubmed.ncbi.nlm.nih.gov/26900641/. https://pubmed.ncbi.nlm.nih.gov/30321183/. http://europepmc.org/article/med/24959880. https://pubmed.ncbi.nlm.nih.gov/28182265/. http://europepmc.org/article/med/31463247 http://europepmc.org/article/med/31463247 27j contemp med sci | vol. 8, no. 1, january-february 2022: 27–30 original mental health wellbeing of school age children is matter: a study to evaluate the effectiveness of a school-based mental health awareness program in the middle schools in oman yusra al nasiri1*, aisha al abri2, afra al rawahi2, al anood al harrasi2, amal al shuaibi2, amina al owisi2, arwa al rashdi3, atheer al shabibi1, balaqis al hakmani1, shamsa al harthi4 1oman college of health sciences, nursing program, muscat, oman. 2staff nurse, royal hospital, muscat, oman. 3staff nurse, bousher dialysis center, muscat, oman. 4staff nurse, khoula hospital, muscat, oman. *correspondence to: yusra al nasiri (e-mail: yusra444@hotmail.com) (submitted: 21 december 2021 – revised version received: 06 january 2022 – accepted: 21 january 2022 – published online: 26 february 2022) abstract objectives: the aim of this study is to assess the effectiveness of a school-based mental health awareness program among school age children. methods: this was a quantitative study that recruited 178 parents and 150 students from different levels (grades 5–10) attended the awareness activity at two middle schools in oman. a convenient sampling approach was utilized. results: there was a significant different in mood and feelings score between the grades (p = 0.001); with grade 10 being the highest disturbed mood changes (m = 23.25, sd = 5.54). the results also showed that 55% of students experienced anxiety. from the analysis, it was found that grade 10 (m = 36.15, sd = 18.43, p = 0.05) reported higher anxiety than others groups. the results indicated also a strong correlation between experience of bullying and mental health problems (r = 0.85). the evaluation of awareness program indicated that 91% of parents reported improvement in knowledge; 89% suggested that many information they were not aware of before. 92% rated the video as informative. 93% agreed that the program activities were entertaining and informative. 92% reported that the activity increased their awareness to observe the changes in their children emotional wellbeing. 98% of parents enjoyed the activities and rated the overall program as effective and very interesting. conclusion: there is a dire need to conduct various awareness programs in the community. such programs are not only helpful in improving the community knowledge on the factors influencing children’s mental health, but also assist in identifying the mental health problems at early stage; which may empower them to seek early management for their children. this study suggests an establishment of a mental health program for children in oman to identify the cases, assess the mental problems affecting children at different ages and refer them for further support and management. keywords: mental health, school age, children, awareness program issn 2413-0516 introduction & background mental health and emotional wellbeing in children is just as important as their physical health. good mental health allows children to think clearly, develop socially and learn new skills.1,2 in addition, fostering mental health helps children develop self-confidence, high self-esteem, and a healthy emotional life.3 promoting mental health will not only help children build resilience to cope up with life stressors, but also will nurture them to grow into well-grounded healthy adults.4 research indicates that children’s emotional health and positive attitude effect positively the children’ emotions and mood as it is reflected in their way of expression.1 positive mood predicted learning academic and cognitive progression, motivation, and interpersonal skills of children.1 a study identified the prevalence of anxiety and the relationship between anxiety and school performance among elementary, middle, and high school students (n = 478). the results revealed that 35 (7.3%) reported high level of anxiety.5 the results suggested abnormally high anxiety level that was negatively associated with school performance.6 similarly, another study revealed a significant relationship (p > 0.05) between children’s anxiety level and educational level. this study showed that the prevalence of anxiety was higher in boys, single children, children who had a family history of hereditary disease, and children who experienced corporal punishment at home.7 studies also suggest that school age children suffer from depression. a cross section study aimed to explore the prevalence of depression and its associated sociodemographic factors among school-going adolescents. among 1412 selected students, the prevalence of depression was found to be 49.2%. guilty feelings (69.48%) was one of the most prominent clinical factors associated with depression followed by pessimism (58.14%), sadness (56.52%), and past failure (55.81%).1 similarly, a high level of depressive symptoms reported among adolescents (38%). the study concluded that depressive symptoms was associated with poor academic performance, poor coping methods and suicidal ideations.4 similarly, another study showed that 35% of children less than 13 years suffered from depressive disorder, and that the prevalence in the adolescent sub-group was 15%.8,9 research also suggests an association between bullying experience and alteration in the mental health wellbeing for students. the prevalence of bullying at 6 schools in muscat governorate revealed that 38.4% of the students reported being bullied in the past month and 34.0% of the students reported having at least one physical injury in the past year that caused at least one full day absences from usual activities or required 28 j contemp med sci | vol. 8, no. 1, january-february 2022: 27–30 mental health wellbeing of school age children original y. al nasiri et al. medical treatment due to bullying.10 students who experienced bullying were found to suffer from family abuse and had history of tobacco, alcohol and drug use.3 in a study conducted in saudi arabia involving 9073 students; the results indicated that 26% of adolescents reported exposure to bullying. exposure to physical violence and bullying having more frequent symptoms of depression and anxiety. those exposed to physical violence were at higher odds of having poorer academic performance.10,11 some studies attempted to evaluate the effectiveness of mental health programs on reducing mental health symptoms affecting children. the results of a systematic suggested that the psychological program was effective and helpful in reducing anxiety in school age children. psychological programs at school can be a promising intervention targeted towards preventing the anxiety and other mental health problems among school age children.12 problem statement most children tend to grow up mentally healthy; however, recent literature suggests that mental problems in children and young adults are on the increase due to the changes in the way of living.7,13 the research highlights that mental health problems affect about 1:10 children and young adults and alarmingly, 70% of the effected children were not assessed at early stage and have not had corresponding interventions at a sufficient early age. there are many risk factors that make children vulnerable for mental health problems these include: changes in the environment the children’s lives in; for example, divorce of parents, abuse experience, moving to a new school environment, living in poverty, having a parent with alcohol or drug addict.13 other risk factors are: having long term physical illness, educational difficulties, experienced bullying and death of a close member in the family.12 based on the literature, common mental health problems that can effect children are: anxiety, depression, excessive worries, post-traumatic stress disorder, and self-harm.5,12,14 this study was done in response to the data received from the school health counselors from two middle-age schools in muscat on the increasing number of school age children suffering from negative thoughts, anxiety and other mental health issues. hence, this study was conducted to assess the mental health wellbeing of the students and evaluate the effectiveness of the planned school based mental health awareness program. materials and methods this is a quantitative study that aimed to evaluate the effectiveness of a school based mental health awareness program. an invitation was sent from the principals of two middle schools to parents of children to attend the awareness program that was hosted in one of the middle schools in muscat. 178 parents and 150 students from different levels (grades 5–10) attended the awareness activity recruited through convenience sampling approach. prior to conducting the awareness program, the students were asked to respond to five questionnaires: 1) anxiety scale (41 items); 2) mood & feelings (13 items); 3) depression (15 items); 4) bullying (6 items). the questionnaires adopted from different studies and showed very good reliability (>0.7). students were informed that their participation is voluntary. the students who accepted to participate were given a consent form to sign. the parents were asked to evaluate the effectiveness of the awareness program at the end of the activity using a tool that consisted of 12 items (knowledge improvement, materials, program activities, consultation service). description of the awareness program the awareness program consisted of 1) a power point presentation mental health wellbeing in children and the factors associated with mental health problems; 2) a video on the factors influencing the mental health status among school age children and the role of parents in enhancing the overall mental health wellbeing of their children. 3) role-play illustrated a case of a child suffered from a mental health problem due to family problems. the case was presented from the omani community. 4) poster presentation of the findings of a study done by the nursing students in previous years on mental health status among school age children; 5) a consultation corner by a psychologist to guide and address the parents’ concerns on child health mental illness and issues; 6) material distributions on mental health. the program was conducted in one of the middle schools in muscat region. the program lasted for 5 hours. results data were analyzed using spss, v.24. one-way anova was conducted to analyze the tools. frequencies and percentages were used to analyze the program effectiveness. the age of the students ranged between (9–14 years). 85% of the students were omanis, 15% were non-omanis. the result from the questionnaires revealed that 60% of students had experienced mood swings. there was a significant different in mood and feeling score between the grades (p = 0.001); with grade 10 being the highest disturbed mood changes (m = 23.25, sd = 5.54). the results also showed that 55% of students experienced anxiety. from the analysis, it was found that grade 10 (m = 36.15, sd = 18.43, p = 0.05) reported higher anxiety than others groups. in addition, the findings highlighted that 28.3% experienced a pre depression state. the study also attempted to correlate experience of bullying with the mental health status. the findings revealed that 89% of students experienced bullying and grade 5 were highly victimized from bullying than others group. the results indicated a strong correlation between experience of bullying and mental health problems (r = 0.85); which suggests that bullying could be a cause for experiencing mental health problems in school age children. the study also highlighted that a smaller rate of students (10.8%) had tendency for bullying. from the analysis, it was found that grade 10 (m = 4.05, sd = 3.57) had higher tendency for bullying than other groups. the evaluation tool for the awareness program indicated that 91% of parents reported improvement in knowledge after the program; 89% suggested that many information they were not aware of before. 92% rated the video as informative. 93% agreed that the program activities were entertaining and informative. 92% reported that the activity increased their awareness to observe the changes in their children emotional wellbeing. 98% of parents rated the overall program as effective and very interesting. 97% enjoyed the activities provided for them on that day. 29j contemp med sci | vol. 8, no. 1, january-february 2022: 27–30 y. al nasiri et al. original mental health wellbeing of school age children discussion creating awareness to parents on mental health wellbeing of school age children was effective as it led to improve knowledge of parents after the program. our findings were similar to the findings of study.12,15 the study found that the awareness program was very effective and helped improve the community knowledge regarding depression and anxiety. the program assisted people to assess signs of depression and offered them management options. the implementation of the awareness program was feasible and activities were very interesting to the parents. the activities planned made suitable for different age group of children & parents; older parents were able to grasp the information easily and able to track the program without any hassle. some studies supported the intervention we developed.12 the study of created a public awareness program on health and the findings suggested that the program was feasible and successful and empowered patients to seek early care and interventions. similarly, one study developed an anti-stigma awareness program and found that the program improved the public knowledge on various mental health problems and facilitated seeking of psychological support.16 to our knowledge, this was first study that assessed the mental health status among school age children in oman. the findings yielded from the study were alarming and highly important; which necessities the need to raise an awareness in the omani community on the importance of enhancing mental health status in children. community awareness serves as a means to disseminate the findings revealed from the study, shed the light on the common mental health problems in children, highlight the factors contributing to mental health problems and suggest ways for enhancing children’s mental health. limitations the sample size was very small; which limits the generalization of the findings to other settings. also, cross section designs do not examine the cause – effect relationship, data was only collected at one-time point and therefore, the causes of the reported percentages and changes in the children cannot be related to any causes. longitudinal studies are therefore recommended. recommendations it is recommended to replicate the study with more sample size from different schools and regions in oman. implications of the project conducting awareness yielded two fold advantages. first, it created an awareness in the community about the importance of maintaining mental health wellbeing for school age children. second, it created more attention to public about certain factors that may affect the mental health wellbeing of children. moreover, it helps to inform the nursing practice regarding the need to establish a mental health program in schools to target mental health problems affecting children. conclusion mental health and emotional wellbeing in children is just important as their physical health. this study assessed the mental health wellbeing of school age children at two middle age schools in oman. the study created a community awareness program to parents and their children on the importance of enhancing mental health wellbeing. the program was creative and effective in improving the parents’ knowledge on different mental health problems affecting school age children such as depression, anxiety, worries and mood changes and bullying. parents were provided with various guidelines to inform them about their roles in assessing and seek early management of the health issue. parents felt supported and cared. the information presented were simple and clear that could be understood by all parents from different age groups. in conclusion, there is a dire need to conduct various awareness programs in the community to help people feel supported, cared and valued. such programs are not only helpful in improving the community knowledge on the factors influencing children’s mental health, but also assist in identifying the mental health problems at early stage; which may empower them to seek early management for their children. this study suggests an establishment of a mental health program for children in oman to identify the cases, assess the mental problems affecting children at different age and refer them for further support and management. ethical consideration prior conducting the study, ethical approval of the oman college of health sciences was obtained. also, the approval of the schools’ principal was obtained. consent form was given to the students prior to data collection. acknowledgements we would like to thank dr. salem al touby, an associate professor and dean of college of nursing and pharmacy for his support and guidance. we also thank dr. nasir al balushi, a child psychologist at sultan qaboos university hospital for participating in the implementation phase of this study. conflicts of interest disclosures there is no conflict of interest.  references 1. jha k, singh s, nirala s, kumar c, kumar p, aggrawal n. prevalence of depression among school-going adolescents in an urban area of bihar, india. indian j psychological med, 2017;39(3):287–293. 2. patel h, varma j, shah s, phatak a, nimbalkar s. profile of bullies and victims among urban school-going adolescents in gujarat. indian paed. 2017;54 (10):841–843. 3. mello f, silva j, oliveira w, prado r, malta d, silva m. the practice of bullying among brazilian schoolchildren and associated factors. national school health survey. ciencia & saude coletiva. 2015;22(9):2939–2948. 4. chauhan s, panna l, harsavardhan n. prevalence of depression among school children aged 15 years and above in a public school in noida, uttar pradesh. international j of public health res. 2014;2278–5213. 30 j contemp med sci | vol. 8, no. 1, january-february 2022: 27–30 mental health wellbeing of school age children original y. al nasiri et al. 5. valiente s. linking students’ emotions and academic achievement. 2015: available from: https://www.coursehero.com/ file/7807695/ valiente-129–135 (accessed online 26/02/19). 6. mazzone l, ducci f, scoto m, passaniti e, d’arrigo v, vitiello b. the role of anxiety symptoms in school performance in a community sample of children and adolescents. 2011; bmc public health, 7(1). doi: 10.1186/1471– 2458–7–347. 7. banaeipour z, rostami s, kourosh z, bahman c. the prevalence of anxiety and its related factors among school age children in south west of iran. j med sciences. 2016;4(6):2019–25. 8. díaz c, sánchez j, martínez b. suicide in adolescents with depression: the need for early diagnosis. clinical case report. 2015;7(1):30–42. 9. hankin b, young j, abela j, smolen a, jenness j. oppenheimer c. depression from childhood into late adolescence: influence of gender, development, genetic susceptibility, and peer stress. j abnormal psych. 2015; 124 (4), 803–816. 10. al-saadooni m. (2014). the magnitude and impact of bullying among school pupils in muscat, oman. oman medical journal. 2017; 5(1):1–10. 11. al buhairan f, abou abbas o, el sayed, badri m, alshahri s, de vries. the relationship of bullying and physical violence to mental health and academic performance: a cross-sectional study among adolescents in kingdom of saudi arabia. int j ped & adolescent med. 2017;4(2): 61–65. doi: 10.1016/j.ijpam.2016.12.005. 12. werner-seidler a, perry y, calear a, newby j, christensen h. schoolbased depression and anxiety prevention programs for young people: a systematic review and meta-analysis. cl psych rev. 2017;51:30–47. 13. queky, tam w, zhang m, exploring the association between childhood and adolescent obesity and depression. a meta-analysis. obesity rev. 2017;18: 742–754. 14. hankin b, young j, abela j, smolen a, jenness j, gulley l, oppenheimer c. depression from childhood into late adolescence: influence of gender, development, genetic susceptibility, and peer stress. j psyc. 2015;124(4): 803–10. 15. bouchard s, gervias n, gagnier c, loranger c. evaluation of a primary prevention program for anxiety disorders using story books with children aged 9–12 years. j primary prevention. 2013;34 :345–358. doi: 10.1007%2fs10935–013–0317–0. 16. henderson c, robinson e, evans-lacko s, thornicoroft g. relationships between anti-stigma programme awareness, disclosure comfort and intended help-seeking regarding a mental health problem. br j psychiatry. 2017;11(5):316–322. doi: 10.1192/bjp.bp.116.195867. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i1.1128 https://europepmc.org/abstract/med/14615688?europe_pmc_abs_citations_citedby=/abstract/med/26576283 https://europepmc.org/abstract/med/14615688?europe_pmc_abs_citations_citedby=/abstract/med/26576283 https://dx.doi.org/10.1192%2fbjp.bp.116.195867 220 j contemp med sci | vol. 8, no. 4, july-august 2022: 220–223 original the association between iron deficiency anemia and obesity in children akrem m. atrushi1, farhad shaker armishty2*, sirwan a. saleh2, mehvan sh. abdulrahman3 1department of pediatric, college of medicine, university of duhok, kurdistan region, iraq. 2*department of clinical sciences, college of medicine, university of zakho, kurdistan region, iraq. 3department of pediatric, directorate of health, duhok, kurdistan region, iraq. *correspondence to: dr. farhad shaker armishty (e-mail: farhad.shaker@uoz.edu.krd) (submitted: 02 may 2022 – revised version received: 21 may 2022 – accepted: 15 june 2022 – published online: 26 august 2022) abstract background: obesity is a growing health problem all over the world. approximately 18–38% of under 5 years old children have iron deficiency anemia. obese people are more likely to be have iron deficiency. studies that dealt with the relationship between iron deficiency and obesity are not homogeneous. aim: to examine the association between obesity and iron status and the presence of iron deficiency anemia in children. methods: this case-control study included 100 children between 2–14 years of age who were divided into two ageand sex-matched equal groups of 50 children each. children with a body mass index (bmi) greater than or equal to 95th centile were categorized as obese while the other 50 children with a bmi greater than or equal to 5th centile but less than 95th centile were considered the normal weight group. children with cardiac disease, liver disease, chronic gastrointestinal disease and chronic hematologic disorders except iron deficiency (with or without anemia) and those taking vitamin or mineral supplements regularly during the previous year were excluded. each participant was sent for serum iron, ferritin, total iron binding capacity (tibc), transferrin saturation ts and complete blood count. iron deficiency is defined as transferrin saturation (ts) lower than 16% and ida is defined as ts lower than 16% and hemoglobin (hb) concentration lower than 120 g/l or 12 mg/dl for children. the data were analyzed using spss-23 software and for all data normal distribution was tested so that p-value <0.05 is the level of threshold for statistical significance. results: the gender distribution between the both group is reversed with male being more common in obese group but no statistical difference. the age distribution shows dominance of the age group 5–10 years in the both group with some differences which are of no statistical significance (p = 0.294). the values of hemoglobin, serum iron, serum ferritin, total iron binding capacity and transferrin saturation are obviously similar between the both genders of the whole study population with no statistically significant differences (p = 0.084, 0.469, 0.48, 0.4, 0.571 respectively). obese children have higher level of hemoglobin (p = 0.069), ferritin (p = 0.5) and total iron binding capacity (p = 0.449) but lower levels of serum iron (p = 0.234) and transferrin saturation(p = 0.45) but with no statistical significance. conclusion: there is no significant association between obesity and iron status and the presence of iron deficiency anemia despite a lower level of serum iron and lower transferrin saturation in obese than normal weight children. issn 2413-0516 introduction obesity is a growing health problem all over the world. its prevalence has increased apparently in recent years.1,2 up to 16–31% of children suffer from obesity nowadays.2,3 according to the world health organization (who) classification, the prevalence of iron deficiency anemia (ida) is in the medium level.4 approximately 18–38% of under 5 years old children have iron deficiency anemia.5 the rapid changes in lifestyles and dietary patterns with large amounts of fat, sugar and oil are of the most important causes of obesity.6-8 it has been found that obese people are more likely to be have iron deficiency. iron deficiency anemia is significantly more prevalent among obese than normal weight people.9-11 foods high in calorie are low in nutrients leading to poor diet. obese children are susceptible to a variety of micronutrient deficiencies.12 obesity is considered a low-grade inflammatory disease. adipose tissue is considered an endocrine organ that secret pro-inflammatory cytokines named adipokines that contribute to the inflammatory process that may have an important pathogenic role in some obesity-related comorbidities.13 it has been suggested that expansion of tissue mass and adipocyte size in obesity makes white adipose tissue hypoxic leading to inflammation and cellular dysfunction.14 moreover, when hypertrophied adipose tissue is unable to satisfy its storage function, there will be excess free fatty acids exposed to organs which are lipid intolerant leading to lipotoxicity and thereby low-grade inflammation in the adipose tissue. therefore, hypertrophy of adipocytes and local tissue hypoxia, triggers overproduction of adipokine that enhances macrophage infiltration in obesity.15 this inflammation can cause transformation of iron metabolism leading to overload of iron in tissues with decreased mobility and as a result reduction of the breakdown of myoglobin. this will decrease the serum iron needed for hematopoiesis.16 studies that dealt with the relationship between iron deficiency and obesity are not homogeneous.17-20 they are generally case/control or cross-sectional studies, in many cases, not population-based, but rather they considered many variables related to iron deficiency and obesity21,22 and used different criteria for defining iron deficiency. a frequently used iron parameter is serum ferritin23-25 which is an acute-phase reactant that is positively related to adiposity and thus reducing its sensitivity. to the best of our knowledge, no studies have been done locally to study the relation between obesity and each of iron status and the presence of iron deficiency anemia. the aim of study is to examine the association between obesity and iron status and the presence of iron deficiency anemia in children. methods this case-control study was out at zakho general hospital in the period from may 1st 2021 to may 1st 2022. a total of 100 mailto:farhad.shaker@uoz.edu.krd 221j contemp med sci | vol. 8, no. 4, july-august 2022: 220–223 a.m. atrushi et al. original the association between iron deficiency anemia and obesity in children children between 2–14 years of age were included in the study. the participants were divided into two equal groups of 50 children each. both groups were ageand sexmatched. children with a body mass index (bmi) greater than or equal to 95th centile were categorized as obese and termed as cases while the other 50 children with a bmi greater than or equal to 5th centile but less than 95th centile (as per the world health organization [who] standards) were the normal weight group and termed controls. the exclusion criteria were: 1any disorder, such as cardiac disease, liver disease, chronic gastrointestinal disease and chronic hematologic disorders except iron deficiency (with or without anemia). 2vitamin or mineral supplements taken regularly during the previous year. from each participant, about 5 cc of fasting blood were taken to evaluate the serum iron, ferritin, total iron binding capacity (tibc) and transferrin saturation ts, and about 2 cc citrated fasting blood sample were evaluated for complete blood count (cbc) and analyzed according to standard protocols. iron deficiency is defined as transferrin saturation (ts) lower than 16% and ida is defined as ts lower than 16% and hemoglobin (hb) concentration lower than 120 g/l or 12 mg/dl for children. the data were analyzed using spss-23 software and for all data normal distribution was tested so that p-value <0.05 is the level of threshold for statistical significance. results as shown in table 1, the gender distribution between the both group is reversed but no statistical difference has been found. the age distribution shows dominance of the age group 5–10 years in the both group with some differences which are of no statistical significance. so, the obese and normal weight children are age and gender matched. the laboratory findings of the whole participants are shown in table 2. the values of hemoglobin, serum iron, serum ferritin, total iron binding capacity and transferrin saturation are obviously similar between the both genders of the whole study population with no statistically significant differences. comparison between obese and normal weight children laboratory values shows the obese children have higher level of hemoglobin, ferritin and tibc but lower levels of serum iron and transferrin saturation but with no statistical significance as shown in table 3. discussion the sociodemographic characteristics show males are more commonly obese and that age group of 5–10 years are the most prevalent but no significant differences were noticed between the both groups. numerous previous studies have found higher prevalence of iron deficiency in obese children.28-35 our findings show a lower level of serum iron and lower transferrin saturation in obese children than normal weight but do not reveal a significant deficiency of iron in obese children. these results corroborate the results of perez et al.29 that found the prevalence of iron deficiency in otherwise healthy obese was not higher than in normal weight children so the effect of obesity on iron status was low. they suggested that table 1. the sociodemographic characteristics of cases and controls normal obese p-value gender male 24 (48%) 26 (52%) 0.689 female 26 (52%) 24 (48%) age under 5 years 12 (24%) 6 (12%) 0.2945–10 years 22 (44%) 25 (50%) above 10 years 16 (32%) 19 (38%) table 2. laboratory values of the study population mean ± sd male female total p-value hb 12.5380 ± .94694 12.5180 ± 1.07489 12.5280 ± 1.00786 0.084 iron 62.9948 ± 30.31192 59.0934 ± 28.53107 61.0441 ± 29.35148 0.469 ferritin 35.7664 ± 26.75804 30.3876 ± 23.27093 33.0770 ± 25.09420 0.480 tibc 378.0280 ± 82.31149 390.4890 ± 81.36954 384.2585 ± 81.66790 0.541 ts 19.6440 ± 22.87591 16.9146 ± 9.8158 18.2793 ± 17.566 0.571 table 3. relation between weight status and laboratory values normal obese p-value hb 12.4960 ± 1.12847 12.5600 ± .88133 0.069 iron 63.1104 ± 35.55115 58.9778 ± 21.63337 0.234 ferritin 30.0546 ± 21.68217 36.0994 ± 27.99161 0.5 tibc 368.0170 ± 72.77616 400.5000 ± 87.41108 0.449 ts 18.7760 ± 10.94805 17.7826 ± 22.42977 0.450 222 j contemp med sci | vol. 8, no. 4, july-august 2022: 220–223 the association between iron deficiency anemia and obesity in children original a.m. atrushi et al. specific cutoff values for iron deficiency in overweight adolescents need to be defined. this is in agreement with ferrari et al.36 who revealed that adiposity of the european adolescents was sufficient to cause chronic inflammation but not sufficient to impair iron status and cause iron deficiency. in line with our findings, demircioglu et al.37 found that serum iron and ferritin level were comparable between obese and normal weight children and stressed a significant role of hepcidin in obesity. cheng et al.38 did a study on obese adult women and found that obesity alone may not be sufficient to cause disturbances to iron metabolism which are clinically significant as previously described and qin39 [ida similar 9] found anemia to be even less prevalent in obese women and this is in agreement with our study on pediatric population. gajewska40 found that in obese children with sufficient iron intake, the altered ferroportin-hepcidin axis may occur without signs of iron deficiency or iron deficiency anemia. they suggested that the role of other micronutrients, besides dietary iron, may also be considered in the iron status of obese children while huang22 concluded that being overweight or obese would not be a risk factor of iron deficiency in adolescents, if it were defined by ferritin rather than iron level. in total, the paradoxical results of the studies regarding association between obesity and iron deficiency might be attributed to the differences in the definition of obesity or using different techniques to assess laboratory parameters.41 one of the limitations of this study is that we did not include the dietary intake of iron which if sufficient can overcome the effects of obesity on causing iron deficiency and anemia. also, it would have been much better if we studied the role of hepcidin in iron status in obesity as proved in many studies.37 conclusion there is no significant association between obesity and iron status and the presence of iron deficiency anemia despite a lower level of serum iron and lower transferrin saturation in obese than normal weight children. conflict of interest none.  references 1. ghadimi r, asgharzadeh e, sajjadi p. obesity among elementary schoolchildren: a growing concern in the north of iran, 2012. int j prev med 2015; 6: 99. 2. gahagan s. overweight and obesity. in: nelson text book of pediatrics, 19th ed. philadelphia: elsevier saunders 2011: 179–211. 3. ogden cl, carroll md, curtin lr, et al. prevalence of high body mass index in us children and adolescents, 2007–2008. j am med assoc 2010; 303(3):242–9. 4. bahrami m. malnutrition and its effects on development in iranian children. iran j pediatr 2004; 14(2): 149–56. [in persian] 5. world health organization. worldwide prevalence of anemia 1993–2005. who, global database on anaemia, geneva, switzerland, 2008. 6. sajjadi p, enayatzadeh h, ghadimi r. which food groups and macronutrients are more associated with central obesity in iranian children? caspian j social medicine 2015; 1(1): 24–30. 7. world health organization. diet, nutrition and prevention of chronic diseases, who technical report jointwho/fao expert consultation, geneva 2003. available at: http://www.who.int/dietphysicalactivity/publications/tr s916/en/gsfao_introduction.pdf 8. daniels sr, arnett dk, eckel rh, et al. overweight in children and adolescents: pathophysiology, consequences, prevention and treatment. circulation 2005; 111(15): 1999–2012. 9. nead kg., halterman js, kaczorowski jm, et al. overweight children and adolescents: a risk group for iron deficiency. pediatr 2004; 114(1): 104–8. 10. chambers ec, heshka s, gallagher d, et al. serum iron and body fat distribution in a multiethnic cohort of adults living in new york city. j am diet assoc 2006; 106(5): 680–4. 11. keikhaei b, askari r, aminzadeh m. adolescent with unfeasible body mass index: a risk factor for iron deficiency anemia. j health med informat 2012; 3(1). available at: http://www.omicsonline.org/adolescentwithunfeasible-body-mass-index-a-risk-factor-foriron-deficiencyanemia-2157-7420.1000109.pdf 12. daniels sr, arnett dk, eckel rh, gidding ss, hayman ll, kumanyika s, et al. overweight in children and adolescents: pathophysiology, consequences, prevention and treatment. circulation 2005; 111(15): 1999–2012. 13. coelho m, oliveira t, fernandes r. biochemistry of adipose tissue: an endocrine organ. arch med sci 2013;9(2): 191–200. 14. sarmiento ol, parra dc, gonzalez sa, gonzalez-casanova i, forero ay, garcia j. the dual burden of malnutrition in colombia. the american journal of clinical nutrition 2014;100(6):1628s-35s. doi: 10.3945/ ajcn.114.083816. 15. ramirez-zea m, kroker-lobos mf, close-fernandez r, kanter r. the double burden of malnutrition in indigenous and nonindigenous guatemalan populations. the american journal of clinical nutrition 2014;100(6):1644s-51s. doi: 10.3945/ajcn.114.083857. 16. richardson mw, ang l, visintainer pf, wittcopp ca. the abnormal measures of iron homeostasis in pediatric obesity are associated with the inflammation of obesity. int j pediatr endocrinol 2009; 2009: 713269. doi: 10.1155/2009/713269. 17. manios y, moschonis g, chrousos gp, et al. the double burden of obesity and iron deficiency on children and adolescents in greece: the healthy growth study. j hum nutr diet 2013; 26:470–478. 18. tussing-humphreys lm, liang h, nemeth e, et al. excess adiposity, inflammation, and iron-deficiency in female adolescents. j am diet assoc 2009; 109:297–302. 19. frelut ml, girardet p, bocquet a, et al. impact of obesity on biomarkers of iron and vitamin d status in children and adolescents: the risk of misinterpretation. arch pediatr 2018; 25:3–5. 20. johnson k, showell nn, flessa s, et al. do neighborhoods matter? a systematic review of modificable risk factors for obesity among low socioeconomic status black and hispanic children. chilhood obesity 2019; 15:71–86. 21. hutchinson c. a review of iron studies in overweight and obese children and adolescents: a double burden in the young. eur j nutr 2016; 55: 2179–2197. 22. huang yf, tok ts, lu cl, et al. relationship between being overweight and iron deficiency in adolescents. pediatr neonatol 2015; 56:386–392. 23. mattiello v, schmugge m, hengartner h, et al. diagnosis and management of iron deficiency in children with or without aaemia: consensus recommendations of the spog pediatric hematology group. eur j pediatr 2020; 179:527–545. 24. thomas dw, hinchliffe rf, briggs c, et al. british committee for standards guideline for the laboratory diagnosis of functional iron deficiency. br j haematol 2013; 161:639–648. 25. khan a, khan wm, maimoona a, et al. ferritin is a marker of inflammation rather than iron deficiency in overweight and obese people. j obes 2016; 2016:1937320. 26. siyaram d, bhatia p, dayal d. hypoferremic state in overweight and obese children. indian pediatr 2018; 55:72–73. 27. pinhas-hamiel o, newfield rs, koren i, et al. greater prevalence of iron deficiency in overweight and obese children and adolescents. int j obes 2003; 27:416–418. http://www.omicsonline.org/adolescentwith-unfeasible-body-mass-index-a-risk-factor-foriron-deficiency-anemia-2157-7420.1000109.pdf http://www.omicsonline.org/adolescentwith-unfeasible-body-mass-index-a-risk-factor-foriron-deficiency-anemia-2157-7420.1000109.pdf http://www.omicsonline.org/adolescentwith-unfeasible-body-mass-index-a-risk-factor-foriron-deficiency-anemia-2157-7420.1000109.pdf 223j contemp med sci | vol. 8, no. 4, july-august 2022: 220–223 a.m. atrushi et al. original the association between iron deficiency anemia and obesity in children 28. aloufi me, aljaed nm, aloufi ra, jafri sa, jafri su a, elnashar ma. prevalence of iron deficiency anemia in obese children in taif area saudi arabia. the egyptian journal of hospital medicine 2018;73(5): 6744–6752. 29. ortíz-pérez m, vázquez-lópez ma, ibáñez-alcalde m, et al. relationship between obesity and iron deficiency in healthy adolescents. childhood obesity. 2020;16(6):440–7. doi: 10.1089/chi.2019.0276 30. cepeda-lopez ac, osendarp sj, melse-boonstra a, aeberli i, gonzalezsalazar f, feskens e, villalpando s, zimmermann mb: sharply higher rates of iron deficiency in obese mexican women and children are predicted by obesity-related inflammation rather than by differences in dietary iron intake. am j clin nutr. 2011, 93 (5): 975–983. 10.3945/ajcn.110.005439. 31. alshwaiyat n.m., ahmad a., hassan w.m.r.w., al-jamal h.a.n. association between obesity and iron deficiency (review) exp. ther. med. 2021;22:1268. doi: 10.3892/etm.2021.10703. [pmc free article] [pubmed] [crossref ] [google scholar] 32. khemphet r, yupensuk n. prevalence and association between obesity and iron deficiency in children. j med assoc thai 2022; 105:212–8. 33. akca so, bostanci mo. the impact of anemia and body mass index (bmi) on neuromotor development of preschool children. rev. assoc. med. bras. 2017;63 (9) :779–786. 34. malden s, gillespie j, hughes a, gibson am, farooq a, martin a, et al. obesity in young children and its relationship with diagnosis of asthma, vitamin d deficiency, iron deficiency, specific allergies and flat-footedness: a systematic review and meta-analysis. obes rev 2020 aug 18. [ahead of print].10.1111/obr.13129 35. ibrahim ls, tayyem rf. evaluation of iron deficiency and the intake of macroand micronutrients among normal, overweight, and obese children under 5 years in amman. iran j ped hematol oncol. 2018; 8:21–36. 36. ferrari m, cuenca-garcía m, valtueña j, et al. helena study group. inflammation profile in over-weight/obese adolescents in europe: an analysis in relation to iron status. eur j clin nutr 2015; 69:247–255. 37. demircioğlu f., görünmez g., dağıstan e, et al. serum hepcidin levels and iron metabolism in obese children with and without fatty liver: case– control study. eur j pediatr 173, 947–951 (2014). https://doi.org/10.1007/ s00431-014-2268-8. 38. cheng hl, bryant ce, roonkey kb, steinbeck ks, griffin hj, petocz p, et al. iron, hepcidin and inflammatory status of young healthy overweight and obese women in australia. plos one. 2013; 4; 8(7):e68675. 39. qin y., melse-boonstra a., pan x, et al. anemia in relation to body mass index and waist circumference among chinese women. nutr j 12, 10 (2013). https://doi.org/10.1186/1475-2891-12-10. 40. gajewska j, ambroszkiewicz j, klemarczyk w, głąb-jabłońska e, weker h, chełchowska m. ferroportin-hepcidin axis in prepubertal obese children with sufficient daily iron intake. international journal of environmental research and public health. 2018; 15(10):2156. https://doi.org/10.3390/ ijerph15102156. 41. arshad m, jaberian f, pazouki a, riazi s, rangraz ma, mokhber s. iron deficiency anemia and megaloblastic anemia in obese patients. rom. j. intern. med 2017; 55(1): 3–7. https://doi.org/10.22317/jcms.v8i4.1236 this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.1089/chi.2019.0276 https://www.ncbi.nlm.nih.gov/pmc/articles/pmc8456489/ https://www.ncbi.nlm.nih.gov/pubmed/34594405 https://scholar.google.com/scholar_lookup?journal=exp.+ther.+med.&title=association+between+obesity+and+iron+deficiency+(review)&author=n.m.+alshwaiyat&author=a.+ahmad&author=w.m.r.w.+hassan&author=h.a.n.+al-jamal&volume=22&publication_year=2021&pages=1268&pmid=34594405&doi=10.3892/etm.2021.10703& https://doi.org/10.1111/obr.13129 https://doi.org/10.1007/s00431-014-2268-8 https://doi.org/10.1007/s00431-014-2268-8 https://doi.org/10.1186/1475-2891-12-10 https://doi.org/10.3390/ijerph15102156 https://doi.org/10.3390/ijerph15102156 145j contemp med sci | vol. 5, no. 3, may–june 2019: 145–148 original advantage of day 3 over day 2 embryo transfer hind abdulkadim* adepartment of urosurgery and infertility, college of medicine, university of kufa, najaf, iraq. bfertility center, al sader teaching hospital, najaf, iraq. *correspondence to hind abdulkadim (email: dr.hindabdulkadimd@yahoo.com). (submitted: 15 october 2018 – revised version received: 06 november 2018 – accepted: 18 february 2019 – published online: 26 june 2019) introduction working in vitro associate with stressors that present in the culture system, which are absent in vivo within the female reproductive tract. stressors evident in the embryology laboratory that have a negative influence on embryos include: frequent temperature fluctuation during manipulation, changes to the concentration of carbon dioxide with subsequent changes in ph, changes in atmospheric oxygen; and the accumulation of ammonium from amino acids.1 during early stages of embryonic life prior to activation of the embryonic genome, the embryo have only limited capacity at a molecular level to respond to a stress which can apply a major hazard on subsequent viability. in addition it is well known that the effects of a stress can be masked at the level of morphology and may only become evident at a subcellular level with the embryo having reduced metabolic activity, high rate of apoptosis, and lowering in pregnancy rate. some of these stressors are unavoidable sequel of in vitro culture even in the best ivf laboratory and earlier embryo transfer is adopted to minimize this hazard.2 to maximize the chance of pregnancy, selection of human embryos with a good developmental competence for transfer is mandatory. embryos are usually graded and selected depending on their morphology and progress rate. transfer of human embryo (et) in cleavage stage is commonly done on the 3rd day after oocyte pickup. the main reasons why et conducted when embryos are at the morula stage is that the human embryo is normally located in the endometrial cavity on days 4–5 after fertilization.3 so, the intrauterine environment is physiologically more suitable for developing morula on the 3rd day than it is on the 2nd day.4 also, extending the time of embryonic culture until activation of the embryonic genome at 4–8 cell stage might optimize the selection of viable embryos for transfer. the authors found that an extra 24 h of observation for embryonic development in vitro was possible by postponing and shifting the transfer until day 3 to recognize and discard the embryos that are developmentally arrested or retarded.5 generally, delaying et may therefore be appropriate, if embryo growth is satisfactory during in vitro culture and can increase the chance of successful implantation and facilitate the election of highest quality embryo for transfer.6 previous researches found that day 3 transfer associate with higher pregnancy and implantation rate than day 2 et.7–9 however, delaying et and keeping embryos in in vitro culture conditions could have adverse effects on embryo development and could reduce the number of viable embryos available for transfer.10 a lot of studies found an elevation in the percentage of growth-retarded embryos on day 3 and there were morphological similarities between days 2 and 3 embryos.11 in a study by laverge et al.,12 the implantation and pregnancy rates were identical between transfers done on day 2 vs. day 3; however, the overall quality score of the embryo decreased when the embryos were cultured up to day 3. further studies have shown the benefit of et in patients with poor response on day 2 compared with day 3. there have been an increase in clinical and ongoing pregnancy rates after et on day 2 than on day 3 in poor responders, indicating that the miscarriage rate can be reduced by limiting embryo culture to only 2 days which could also provide an alternative management for poor responders.13 in addition, racowsky et al.14 found that earlier embryo transfer can improve pregnancy rate for poorly progressed embryos suggesting that the in vivo environment can rescue less healthy embryos. however, the optimal day for et of human cleavage-stage embryos remains a matter of debate and some recent studies have found no difference in ivf outcome between days 2 and 3 et. materials and methods this study was a cohort retrospective study performed on infertile couples attending infertility treatment center in objectives this study was done to compare embryo quality and pregnancy rate between days 2 and 3 embryo transfer, the effect of extended culture on embryo development potential also analyzed. methods in an 18-month period extending from january 2014 to june 2015, all couples were undergoing infertility treatment in the form of intracytoplasmic sperm injection (icsi) whatever the cause and in whom fresh embryo transfer were done (258 cycle) were included in this prospective study. the patients were classified into two groups according to the day of embryo transfer. the policy of transfer was uniform in both groups and the transfer was done according to patient criteria or the number of embryos available. results the main outcome measures were embryo quality, embryo development potential and pregnancy rate. our data suggest no significant statistical difference in pregnancy rate between days 2 and 3 embryo transfer (42.9% vs. 42.0% respectively, p > 0.05). the percentage of good quality embryos was slightly insignificantly higher in day 2 group than day 3 (86.03% vs. 84.7%, p > 0.05). the percentage of slow growing embryos was significantly higher in those cultured for 3 days than those remain for just 2 days in vitro (15.9% vs. 23.3%, p < 0.05). conclusion a similar pregnancy rate was obtained by doing embryo transfer on days 2 and 3 after icsi in spite of slight regression in embryo quality and higher rate of developmental delay in cases of extended culture. so, no advantage for day 3 over day 2 embryo transfer. keywords embryo transfer, embryo quality, intracytoplasmic sperm injection issn 2413-0516 146 j contemp med sci | vol. 5, no. 3, may–june 2019: 145–148 advantage of day 3 over day 2 embryo transfer original h. abdulkadim al-sadr medical city in najaf, from january 2014 to june 2015. no written/verbal informed consent was provided from the patients. they underwent intracytoplasmic sperm injection (icsi) according to the standard protocols. demographic, clinical and laboratory informations about patients were collected. the subjects were couples undergoing icsi with fresh embryo transfer as a treatment option for various fertility problems (258 cycle) female partners was <42 years old and had normal endometrial thickness (7–12 mm) on et day, no apparent endometrial pathology and less than three failed previous cycles. controlled ovarian hyper stimulation was done either by pituitary down regulation in the early follicular phase with a gnrh agonist (decapeptyl 0.1 mcg/day) or mid follicular pituitary down regulation with a gnrh antagonist (cetrorelix, 250 mcg/day). 150–300 iu/l of recombinant fsh (gonal-f, 75 iu/l) were used to induce multiple follicle growth and the response was evaluated with serial ultrasound monitoring. when two or more follicles grow up to 17 mm or more, 10 000 iu/ml of human chorionic gonadotropin was taken as an ovulation trigger and oocytes were collected 34–36 h later through transvaginal ultrasound guided aspiration under general anesthesia. denudation of the oocytes was achieved both mechanically and enzymatically. after that all mature metaphase ii oocytes are injected with husband sperm (intracytoplasmic sperm injection). oocytes were examined for signs of fertilization 16–18 h post injection, the two pronuclei zygotes were cultured for 24–48 h in fertipro cleavage medium supplemented with 10% human serum albumin. two to three embryos at the four or eight cell stage were transferred to the uterus depending on the patient conditions and prognosis (particularly female age and previous unsuccessful attempts) on the 2nd or 3rd day after insemination. et performed using soft catheter (cook ob/gyn) on day 2 or 3 after oocyte retrieval. luteal phase support was started on the day of ovum pick up and patients used vaginal progesterone, 400 mg every 12 h. a positive pregnancy test was considered when β-hcg levels above 25 miu/ml, 2 weeks after et, fertilization rate, cleavage rate embryo quality and their developmental potential with the average number of embryos transferred were assessed. embryo grading depended on degree of fragmentation and morphology of blastomer. grades 1 and 2 embryos described as good quality embryos while grades 3 and 4 described as bad quality embryos. rate of embryo development also evaluated, embryo less than four cells on day 2 or less than eight cells on day 3 was regarded as slow growing embryos (days were calculated from time of oocyte injection). embryos with normal fertilization and of good quality (grades 1–2) were chosen for transfer. day 3 transfer was done on 1, day two fall on a holiday or 2. the patient cannot undergo day 2 transfer. embryo quality, embryo progression and pregnancy rate were compared between days 2 and 3 et. statistical analysis statistical analysis was done using statistical package for social science, version 20.0. numerical data expressed as mean ± sem. categorical data are expressed as frequencies and percentages. to compare between the parameters of two groups, independent samples, student’s t-test was used and chi-square was used for the comparison of categorical variables. the difference between the values were considered statistically significant at p < 0.05. results about 258 intracytoplasmic sperm injection cycle were included in this study. in 189 cycle embryo transfer was done in day 2 post-injection while day 3 transfer was done in 69 cycle. table 1 shows the main criteria of patients represented by their age, body mass index, duration of infertility, number of attempts, number of oocyte collected, number of mature injected oocyte and number of transferred embryos. no significant statistical difference in these parameters between days 2 and 3 groups (p > 0.05). table 2 shows fertilization rate of injected oocytes (number of zygotes/total number of injected oocytes), percentage of good quality embryos, percentage of bad quality and slow growing embryos. no significant statistical differences in fertilization rate and embryo quality between both groups (p > 0.05), while the ratio of slow growing embryos is significantly higher in group of day 3 et (p < 0.05). in table 3, pregnancy rate was calculated and compared between patients included in days 2 and 3 embryo transfer. no significant statistical difference in positive pregnancy rate was found between both groups (p > 0.05). table 1. the main criteria of patient included in the study variable day 2 (no. = 189) mean ± sem day 3 (no. = 69) mean ± sem p age (years) 29.6 ± 0.5 31.37 ± 0.8 0.07 bmi (kg/m2) 27.5 ± 5.2 27.7 ± 4.2 0.9 infertility period 7.4 ± 5.7 5.1 ± 6.6 0.3 no. of attempts 1.3 ± 0.7 1.4 ± 0.8 0.5 no. of oocyte 9.4 ± 0.4 9.04 ± 0.7 0.6 mii 7.8 ± 0.3 7.39 ± 0.6 0.5 no. of zygote 5.2 ± 0.2 4.75 ± 0.4 0.3 no. of embryo 4.9 ± 0.2 4.51 ± 0.4 0.4 transferred embryo 2.94 ± 0.81 2.77 ± 0.85 0.5 bmi, body mass index. table 2. fertilization rate, percentage of good and bad quality, and slow growing embryos variable (%) day 2 (no. = 189) mean ± sem day 3 (no. = 69) mean ± sem p fr 70.3 ± 1.6 68.5 ± 2.7 0.6 good 86.03 ± 1.8 84.7 ± 3.2 0.7 bad 14.8 ± 1.9 15.3 ± 3.2 0.9 slow growing embryos 15.9 ± 1.7 23.3 ± 4.01 0.049 table 3. pregnancy rate in day 2 vs. day 3 embryo transfer day 2, no. (%) day 3, no. (%) total p pt positive 81 (42.9) 29 (42.0) 110 (42.6) 0.9 negative 108 (57.1) 40 (58.0) 148 (57.4) total 189 (100) 69 (100) 258 (100) 147j contemp med sci | vol. 5, no. 3, may–june 2019: 145–148 original advantage of day 3 over day 2 embryo transferh. abdulkadim discussion a lot of research has documented that the implantation of the zygote was comparable to that of cleaved embryo.15,16 quinn et al.17 reported that the culture conditions used for the fertilized oocytes affected pregnancy rate. that is, in presence of suboptimal culture conditions, pregnancy rates can be increased by earlier transfer. the authors found that if culture environment is optimized, pregnancy rate would be the same after et on day 1 or 2. further studies, mentioned that embryos transferred on day 2 were comparable to day 3.5,18,19 however, in these studies, patients with good prognostic factor, fewer embryos were transferred, while for us the number of embryos transferred remained fixed. in a study done by laverge et al.,12 to compare pregnancy outcome between days 2 and 3 et, they observed that the clinical pregnancy and implantation rates was the same between days 2 and 3, but overall embryo quality scores were lower on day 3. shen et al.8 found that ongoing pregnancy rate were increased and abortion rate were decreased on day 2 et in cycles with low numbers of embryos in poor responders younger than 40 years. findings of these studies encourage earlier embryo transfer suggesting that in vivo environment will be healthier for early growing embryo. regarding our study, we found no differences in clinical outcomes regarding pregnancy rate and overall embryo quality. while, slow growing or arrested embryos were significantly higher in day 3 group. bahceci et al.4 found that pregnancy rate per transfer was significantly higher in day 2 vs. day 3 et for poor responder. a cochrane meta-analysis failed to prove any improvement in clinical outcome on day 3 transfer. shifting et from days 2 to 3, associated with an elevation in clinical pregnancy rates but due to a higher miscarriage rate with the day 3 et, the live birth rate remained the same. this may be due to unavoidable adverse effects of culture system on early stages of embryonic development causing elevation of miscarriage rate on day 3 transfer.18 however, in another study it was suggested that extended culture to day 3 may lead to selection of best quality embryos for transfer.20 in a retrospective study, dawson et al.6 showed that the pregnancy rate was insignificantly higher with day 3 et and on postponing et from days 2 to 3, 16% of embryos stopped growing. so, waiting until day 3 allowed us to recognize these growth retarded or arrested embryos and avoid their transfer thus lowering miscarriage rate. while certain studies suppose that earlier embryo transfer can rescue less healthy embryos. in our study, pregnancy rate was the same but slow growing embryos was significantly higher in day 3 group. this confirming dawson finding and suggesting that extended culture can be used as a non-invasive method to identify embryos with poor developmental potential. under most ideal conditions, the culture media could exert a negative impact on the developing embryos and led to a higher miscarriage rate with poor embryo quality. in our study, overall embryo quality was identical for both groups, which may be due to the restricted control on culture condition and laboratory environment. many studies have shown that in vitro cultured blastocysts have higher implantation rates, so may be more effective for those who produce enough number of high quality embryos at the cleavage stage, promoting the selection of the top quality embryos21,22 and improving pregnancy rate and offer the opportunity of single embryo transfer. dar et al.23 found a considerably elevated risk of preterm delivery (<37 weeks) in singletons following blastocyst culture compared with day 3 transfer. they supposed that extended culture may have adverse effects on the future placentation. the retrospective design of this study and random population are considered limitations which may have affected the outcomes. conclusion we conclude that the same outcomes was obtained in days 2 and 3 embryo transfer. so we suggest that there is no need to extend in vitro culture an extra 24 h and depending day 2 transfer as a routine instead of traditional day 3 et. this conclusion also offer to our patients the opportunity to select which day would be suitable for her to do et. further studies are recommended to confirm the influence of earlier embryo transfer on live birth and miscarriage rate in comparison with the extended culture. conflicts of interest none.  references 1. gardner dk, lane m, culture system for human embryo. in: gardner dk, weissman a, howles cm, shoham z (eds.). text book of assisted reproduction. taylor & francis group, 2018, pp. 200–210. 2. modares sz, zamaniyan n, baheiraei n, saharkhiz n, abed f, malih n, et al. a comparative analysis between day 2 and day 3 embryo transfer in ivf/ icsi: a retrospective cross-sectional study. int j women’s health reprod sci. 2016;3:119–124. 3. bastu e, celik c, keskin g, buyru f. evaluation of embryo transfer time (day 2 vs day 3) after imposed single embryo transfer legislation: when to transfer? j obstet gynaecol. 2013;33:387–390. 4. bahceci m, ulug u, ciray hn, akman ma, erden hf. efficiency of changing the embryo transfer time from day 3 to day 2 among women with poor ovarian response: a prospective randomized trial. fertil steril. 2006;86:81–85. 5. oatway c, gunby j, daya s. day three versus day two embryo transfer following in vitro fertilization or intracytoplasmic sperm injection. cochrane database syst rev. 2004:cd004378. 6. dawson kj, conaghan j, ostera gr, winston rm, hardy k. delaying transfer to the third day post-insemination, to select non-arrested embryos, increases development to the fetal heart stage. hum reprod. 1995;10:177–182. 7. carrillo aj, lane b, pridman dd, risch pp, pool tb, silverman ih, et al. improved clinical outcomes for in vitro fertilization with delay of embryo transfer from 48 to 72 hours after oocyte retrieval: use of glucoseand phosphate-free media. fertil steril. 1998;69:329–334. 8. shen s, rosen mp, dobson at, fujimoto vy, mcculloch ce, cedars mi. day 2 transfer improves pregnancy outcome in in vitro fertilization cycles with few available embryos. fertil steril. 2006;86:44–50. 9. frankfurter d, keefe dl, trimarchi jb. day 2 embryo transfer improves ivf-et outcome in the poor responder. fertil steril. 2003;80:61. 10. ashrafi m, kiani k, mirzaagha e, shabani f. the pregnancy outcomes of day 2 versus day 3 embryo transfer: a cross-sectional study. int j fertil steril. 2007;1:47–54. 11. dayal mb, frankfurter d, athanasiadis i, peak d, dubey a, gindoff pr. day 2 embryo transfer (et) and day 3 et afford similar reproductive outcomes in the poor responder. fertil steril. 2011;95:1130–1132. 12. laverge h, de sutter p, van der elst j, dhont ma. a prospective, randomized study comparing day 2 and day 3 embryo transfer in human ivf. hum reprod. 2001;16:476–480. 13. ertzeid g, dale po, tanbo t, storeng r, kjekshus e, abyholm t. clinical outcome of day 2 versus day 3 embryo transfer using serum-free 148 j contemp med sci | vol. 5, no. 3, may–june 2019: 145–148 advantage of day 3 over day 2 embryo transfer original h. abdulkadim culture media: a prospective randomized study. j assist reprod genet. 1999;16:529–534. 14. racowsky c, jackson kv, cekleniak na, fox jh, hornstein md, ginsburg es. the number of eight-cell embryos is a key determinant for selecting day 3 or day 5 transfer. fertil steril. 2000;73:558–564. 15. scott la, smith s. the successful use of pronuclear embryo transfers the day following oocyte retrieval. hum reprod. 1998;13:1003–1013. 16. dale b, fiorentino a, de simone ml, di matteo l, di frega as, wilding m, et al. zygote versus embryo transfer: a prospective randomized multicenter trial. j assist reprod genet. 2002;19:456–461. 17. quinn p, stone ba, marrs rp. suboptimal laboratory conditions can affect pregnancy outcome after embryo transfer on day 1 or 2 after insemination in vitro. fertil steril. 1990;53:168–170. 18. shahine lk, milki aa, westphal lm, baker vl, behr b, lathi rb. day 2 versus day 3 embryo transfer in poor responders: a prospective randomized trial. fertil steril. 2011;95:330–332. 19. de los santos mj, mercader a, galán a, albert c, romero jl, pellicer a. implantation rates after two, three, or five days of embryo culture. placenta. 2003;24:s13–s19. 20. dobson at, raja r, abeyta mj, taylor t, shen s, haqq c, et al. the unique transcriptome through day 3 of human preimplantation development. hum mol genet. 2004;13:1461–1470. 21. kaur p, swarankar ml, maheshwari m, acharya v. a comparative study between cleavage stage embryo transfer at day 3 and blastocyst stage transfer at day 5 in in-vitro fertilization/intra-cytoplasmic sperm injection on clinical pregnancy rates. j hum reprod sci. 2014;7:194–197. 22. van der auwera i, debrock s, spiessens c, afschrift h, bakelants e, meuleman c, et al. a prospective randomized study: day 2 versus day 5 embryo transfer. hum reprod. 2002;17:1507–1512. 23. dar s, librach cl, gunby j, bissonnette f, cowan l; ivf directors group of canadian fertility and andrology society. increased risk of preterm birth in singleton pregnancies after blastocyst versus day 3 embryo transfer: canadian art register (cartr) analysis. hum reprod. 2013;28:924–928. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. dx.doi.org/10.22317/jcms.06201905 347j contemp med sci | vol. 8, no. 5, september-october 2022: 347–351 original association between hormonal imbalance and interleulin-10 level with polycystic ovarian syndrome of iraqi women hiba aqeel muslem al-quraishy1*, hanaa addai ali2, fadhil jawad al-tu’ma3, mousa mohsin ali4, amir fadhil al-tu’ma5 1laboratory department, gynecological and obstetric teaching hospital, kerbala health directorate, ministry of health, kerbala, iraq. 2department of chemistry, college of science, university of kufa, kufa, iraq. 3department of chemistry and biochemistry, college of medicine, university of kerbala, kerbala, iraq. 4department of gynecology and obstetrics, college of medicine, university of kerbala, kerbala, iraq. 5department of medical laboratory technologies, college of medical and health technologies, university of ahlalbayt, kerbala, iraq. *correspondence to: hiba aqeel muslem al-quraishy (e-mail: hibaakil026@gmail.com) (submitted: 13 july 2022 – revised version received: 05 august 2022 – accepted: 29 august 2022 – published online: 26 october 2022) abstract objectives: to determine the level of interleukin-10 as inflammatory marker in pcos patients and compared with healthy control and explore the correlation between il-10 level and other biochemical markers in pcos patients. methods: whole blood samples of 80 pcos obese patients and 80 healthy people were collected in duration from dec., 2021 to april, 2022, at the gynecological and obstetric teaching hospital, kerbala health directorate, iraq. the rotterdam criteria-2003 was accepted to pcos females with age range between (18–40 years), while the apparently control group with age ranged between (18–40 years). bmi and whr and hormonal status (lh, fsh, lh/fsh ratio, prolactin, free testosterone) were determined. elabscience/usa elisa kit uses the sandwichelisa principle was used to determined il-10 level in serum. results: the obese pcos women had a seriously decrease in il-10 (pg/ml) level when compare with apparently healthy control group with mean ± sd for patients (2.192 ± 0.47) and for control group (4.532 ± 0.75) p value < 0.0001, and there are significant negative correlations between il-10 and (bmi p < 0.0001, r = –0.66), (whr p < 0.0001, r = –0.66), (lh p < 0.0001, r = –0.63), (lh: fsh ratio p < 0.0001, r = –0.72), (prolactin p = 0.008, r = –029). conclusion: our findings indicate that the il-10 level decrease in pcos obese patients and has significant association with pathogenesis and progression of disease. keywords: interleukin-10, polycystic ovary syndrome, iraq issn 2413-0516 introduction low-grade inflammation and inflammatory indicators have been linked to pcos. understanding the pathophysiology of pcos and its therapy by inhibition or regulation of associated pathways can be improved by looking into the inflammatory mediators involved for its development. because ovulation is a semi-inflammatory process, visceral adipose tissue can induce an inflammatory response and sustain the inflammation in adipocytes by influencing the release of inflammatory cytokines. out of this regulated inflammation, pcos can arise.1 interleukin-10 (il-10), which was first discovered in 1991, is an immunosuppressant and an anti-inflammatory cytokine that is essential for the body’s defense processes.2,3 the il-10 protein is a homodimer, and each of its components is 178 amino acids long.4 il-10 is a t-helper cell family member (th2) that inhibits the function of th1 cells.5 activated immune cells release interleukin-10, an anti-inflammatory cytokine. monocytes are capable of producing il-10 when they are stimulated.6 as well as non-immune cells like epithelial or neuronal cells.7 the trans-membrane receptor complex made up of il-10r1 and il-10r2 is how il-10 exerts its effects and regulates the actions of lymphocytes, macrophages, and a variety of other cells.8 it regulates the differentiation and proliferation of immune cells, such as macrophages, t cells, and b cells; reduces monocyte activation; and restricts the release of pro-inflammatory cytokines, such as tnf, il-1, il-6, il-12, and il-2.9 to keep the ovary functioning properly, the levels of inflammatory markers must be in equilibrium. alterations in steroidogenesis, delayed follicular maturation, and ovarian issues might result from an imbalance between pro-inflammatory and anti-inflammatory cytokines caused by increased production of tnf-α and il-6 and decreased production of il-10. it is thought that since it lowers th1 cell activity, progesterone is produced and the corpus luteum matures, maintaining pregnancy. obesity and the metabolic syndrome are linked to decreased il-10 levels. the fact that pcos patients had lower plasma levels of il-10 suggests that clomiphene citrate increases il-10 and helps pcos women become pregnant and ovulate more frequently.10 therefore, this study aimed to determine the level of interleukin-10 as inflammatory marker in pcos patients and compared with healthy control and explores the correlation between il-10 level and other biochemical markers in pcos patients of iraqi women in kerbala province. materials and methods this study is a case-control study involves 80 pcos patients. and 80 non-pcos women as a control in childbearing age at the reproductive fertility consultant of gynecological and obstetric teaching hospital, kerbala health directorate iraq and iraq’s university of kerbala college of medicine during the duration from dec., 2021 to april, 2022. an exhaustive interview gathering personal and family history, blood pressure, demographic information and laboratory examination was carried out. the rotterdam criteria-2003 was presumed to 80 pcos females with ages ranged between (18–40) years. mailto:hibaakil026@gmail.com 348 j contemp med sci | vol. 8, no. 5, september-october 2022: 347–351 association between hormonal imbalance and interleulin-10 level original h.a.m. al-quraishy et al. table 1. demographic parameters of the registered patients and the control demographic parameters control n = 80 mean ± sd patients n = 80 mean ± sd menstruation pattern (regular) 80 17 menstruation pattern (irregular) – 63 with hirsutism – 67 without hirsutism 80 13 primary infertility – 52 secondary infertility – 28 table 2. biochemical parameters of the registered patients and the control biochemical parameters control n = 80 mean ± sd patients n = 80 mean ± sd p-value age, year 26.8 ± 5.175 26.1 ± 5.3 0.15 bmi (kg/m2) 23.3 ± 1.156 32.5 ± 6.357 <0.0001 whr 0.777 ± 0.0143 0.912 ± 0.0563 <0.0001 lh (m.iu/ml) 106 ± 0.555 11.89 ± 3.188 <0.0001 fsh (m.iu/ml) 6.73 ± 0.65 5.36 ± 1.36 0.01 lh/fsh ratio 0.986 ± 0.041 2.414 ± 0.379 <0.0001 free testosterone (pg/ml) 2.97 ± 1.812 18.7 ± 14.98 <0.0001 prolactin (ng/ml) 12.19 ± 2.92 16.14 ± 4.05 <0.0001 il-10 (pg/ml) 4.53 ± 0.75 2.19 ± 0.47 <0.0001 patients with any 2 of the next 3 items can be recognized in diagnosis: oligomenorrhea or amenorrhea, increase androgen levels, ovarian volume >10 ml on u/s, and follicles ≥12 with diameter 2–9 mm.11 controller group has 80 ladies which ages reached between (18–40 years). they have regular menstruation, with normal ovaries as they were detected by the gynecologist. body mass index were calculated from the following equation: bmi = weight (kg)/height (m2). normal bmi level is (20–24.9) kg/m2 and (25–29.9) kg/m2 for overweight. when bmi ≥30 kg/m2, the woman is considered as obese.12 the whr diagnostic standard for obesity is 0.85 for women.13 the volume withdrawn from each patient was 3.0 ml was used for serum separation and used for hormonal assays. the hormonal levels of each of lh, fsh and prolactin were measured by the chemiluminescent automated immunoassay system (cobas e411, roche diagnostic, germany). free testosterone level was measured by competitive enzyme immunoassay using monobind/usa elisa kit and elabscience/usa elisa kit uses the sandwich-elisa principle was used to determined il-10 level in serum. the protocol for study was certified by the ethical research commission of college of medicine, university of kerbala and kerbala health directorate. approval also taken from administration of gynecological and obstetric teaching hospital and from each patient after explaining the nature and purpose of study. all statistical analyses were performed with the graph pad prism 9.0.0 was released on october 28, 2020. data were analyzed by t-test in statistical analysis the highly significant value is (p < 0.01) and the significant value is (p < 0.05). the data are presented as mean ± sd (standard deviation). the correlation coefficient spearman r test was calculated to examine association among parameters. results based on inclusion and exclusion criteria, 160 women were involved in the last data analysis, the women involved within the study finally were with an age ranged between (18–40) years and the mean ± sd of them were 26.1 ± 5.3 years. the results of this study were displayed in table 1. they incorporate the mean ± sd of the patients with and without hirsutism and those with primary or secondary infertility and (regular or irregular) menstruation pattern. it is clear that the two groups are almost well matched, thus obtained results could be estimable. the results of this study were displayed in table 2 using statistical unpaired t-test; age, bmi and whr as well as using statistical mann whitney test. significant elevations in lh concentrations (p < 0.0001), lh/fsh ratio (p < 0.0001), free testosterone levels (p < 0.0001) and prolactin level (p < 0.0001) were prevailed in the pcos patients group when contrasted with the control group. however, while significantly decrease in fsh level (p = 0.01) and il-10 level (p < 0.0001) during a comparable evaluation between pcos patients and control group. interleukin – 10 (il-10) correlation with anthropometric and biochemical parameters in pcos patients group was evaluated by spearman r test are showed in figure 1 and table 3. the result showed that there are significant negative correlations between il-10 and (bmi p < 0.0001, r = –0.66), (whr p < 0.0001, r = –0.66), (lh p < 0.0001, r = –0.63), (lh: fsh ratio p < 0.0001, r = –0.72), (prolactin p = 0.008, r = –029), and there are non-significant correlations with age and fsh revealed with il-10 cytokine. discussion the pathogenesis and progression of polycystic ovarian syndrome have been implicated in chronic low-grade inflammation as a major factor (pcos).1 il-10 levels were lower in pcos patients than in controls. th1 cells and macrophages’ expression of pro-inflammatory cytokines is down-regulated by the anti-inflammatory cytokine and suppressor il-10. alters steroidogenesis, delays follicular development, and causes ovarian dysfunction due to an imbalance between pro and anti-inflammatory cytokines.14 the main characteristics of the metabolic abnormalities typical of pcos include insulin resistance and hyperinsulinemia. although there is mounting evidence that tnfα, il-6, and il-10 are critical players in mediating insulin resistance, low il-10 levels have been linked to obesity and the metabolic syndrome.15 subeka abraham gnanadass’ research demonstrated a connection between metabolic syndrome and obesity and low il-10 levels. patients with pcos experienced a decrease in plasma il-10.10 interleukin (il)-10, which m. karadeniz demonstrated in his work, is a significant anti-inflammatory cytokine that has been linked to obesity and type 2 diabetes and that controls the production of these pro-inflammatory cytokines. patients with high bmi and insulin levels have been found to have low levels of il-10.16 in the past ten years, a lot of study has concentrated on the immunosuppressive and anti-inflammatory effects that are mediated by a variety of variables, including the anti inflammatory cytokine interleukin (il)-10. the pathogenesis 349j contemp med sci | vol. 8, no. 5, september-october 2022: 347–351 h.a.m. al-quraishy et al. original association between hormonal imbalance and interleulin-10 level fig. 1 correlation between il-10 cytokine level and a. bmi, b. whr, c. lh, d. lh: fsh ratio, e. free testosterone hormone and f. prolactin hormone level in pcos patients group. 350 j contemp med sci | vol. 8, no. 5, september-october 2022: 347–351 association between hormonal imbalance and interleulin-10 level original h.a.m. al-quraishy et al. of pcos is firmly implicated as being driven by chronic lowgrade inflammation. in several diseases, including pcos, il-10 has an anti-inflammatory and immune-suppressive effect. recent studies showed that women with pcos had considerably reduced serum levels of il-10.17–19 in his research, angel mercy sylus also demonstrated that inflammation is frequently linked to pcos, which affects these women’s ovarian folliculogenesis, abnormal steroidogenesis in the ovary, and hyperinsulinemia. an anti-inflammatory cytokine called interleukin-10 (il-10) controls how pro-inflammatory cytokines behave when there is inflammation. reduced il-10 levels have been observed in women with pcos and il-10 gene variation has been associated with pcos.20 this study showed negative correlation between il-10 cytokine level and bmi, whr, lh, lh/fsh ratio, prolactin hormone and free testosterone. while there is no correlation with age or fsh level. in his work, po-kai yang demonstrated that obesity has been suggested to have a modulatory effect on pcos patients’ ovulatory functioning. through increased il-10 synthesis in visceral fats, obesity may interfere with normal folliculogenesis.21 in pcos compared to controls, il-10 concentration was decreased. with respect to whr, which measures visceral adiposity, there were significant relationships.14 in pcos patients, a substantial positive link between the ratio of t regulatory cells and lh levels was found, however other hormones like fsh will not impact the ratio of t regulatory cells. t regulatory cells release anti-inflammatory cytokines like interleukin 10 (il-10). in his research, yiqing yang discovered that pcos patients had lower levels of the cytokine il-10 associated to t regulatory cells.21 according to umit cabus’ study, serum il-10 levels were greater in study participants than in controls, and the lh/fsh ratio was noticeably higher in pcos-affected women.22 when compared to controls, pcos patients’ mean plasma concentration of il10 was significantly lower, and it had no effect on the levels of fsh, lh, or prl.23 hyperinsulinemia stimulates the pituitary’s reaction to gonadotropin-releasing hormone (gnrh), which increases the release of luteinizing hormone and androgen. this influences how well the hypothalamus-pituitary-ovarian gonadal axis works (hpo axis). hyperandrogenism may prevent the growth of follicles, cause follicular atresia, and encourage insulin resistance as a result of feedback. the pathogenesis of pcos is associated with elevated pro-inflammatory cytokines and decreased anti-inflammatory (il-10) factors, and this inflammatory condition may harm insulin sensitivity and advance the onset of pcos.24 conclusion the observed results indicated that there is decrease in the mean of interleukin 10 cytokine in pcos patient’s. various hormones which are free testosterone, prolactin and lh in obese pcos women are increase as compared with control, while there is significant decrease in fsh values was obtained. the result also showed that there are significant negative correlations between il-10 and bmi, whr, lh, lh: fsh ratio, prolactin, and there are non-significant correlations with age and fsh revealed with il-10 cytokine. acknowledgments the authors thank the pcos patients for their cooperation and the medical staffs in the molecular research laboratory of the department of chemistry and biochemistry, college of medicine, university of kerbala and the laboratories of “gynecological and obstetric teaching hospital” kerbala health directorate. conflict of interest the authors advertise that they have no conflict of interest.  references 1. rostamtabar, m., esmaeilzadeh, s., tourani, m., rahmani, a., baee, m., shirafkan, f., saleki, k., mirzababayi, s. s., ebrahimpour, s. & nouri, h. r. 2021. pathophysiological roles of chronic low‐grade inflammation mediators in polycystic ovary syndrome. journal of cellular physiology, 236, 824–838. 2. moore, k. w., de waal malefyt, r., coffman, r. l. & o’garra, a. 2001. interleukin-10 and the interleukin-10 receptor. annual review of immunology, 19, 683–765. 3. gnanadass, s. a., prabhu, y. d. & gopalakrishnan, a. v. 2021. association of metabolic and inflammatory markers with polycystic ovarian syndrome (pcos): an update. archives of gynecology and obstetrics, 1–13. 4. nissar, s., sameer, a. s. & banday, m. z. 2021. genetic polymorphisms of essential immune pathogenic response genes and risk of cervical cancer. genetic polymorphism and cancer susceptibility, springer. 5. rasquinha, m. t., sur, m., lasrado, n. & reddy, j. 2021. il-10 as a th2 cytokine: differences between mice and humans. the journal of immunology, 207, 2205–2215. 6. said, e. a., dupuy, f. p., trautmann, l., zhang, y., shi, y., el-far, m., hill, b. j., noto, a., ancuta, p. & peretz, y. 2010. programmed death-1–induced interleukin-10 production by monocytes impairs cd4+ t cell activation during hiv infection. nature medicine, 16, 452–459. 7. sözen, t., özişik, l. & başaran, n. ç. 2017. an overview and management of osteoporosis. european journal of rheumatology, 4, 46. 8. ralston, s. h. & de crombrugghe, b. 2006. genetic regulation of bone mass and susceptibility to osteoporosis. genes & development, 20, 2492–2506. 9. bakiri, a. h. & mingomataj, e. ç. 2019. novel insights on interleukin-10 functions: a manipulative tool for the deviation of immune response and disease outcome. emj allergy immunol, 4, 88–94. 10. abraham gnanadass, s., divakar prabhu, y. & valsala gopalakrishnan, a. 2021. association of metabolic and inflammatory markers with polycystic ovarian syndrome (pcos): an update. archives of gynecology and obstetrics, 303, 631–643. 11. park, k. s., gang, w., kim, p.-w., yang, c., jun, p., jung, s.-y., kwon, o., lee, j. m., lee, h. j. & lee, s. j. 2022. efficacy and safety of acupuncture on table 3. correlation of il-10 with anthropometric and biochemical parameters in registered pcos patients group parameters r p-value age (y) 0.13 ns bmi (kg/m²) –0.68 <0.0001 whr –0.66 <0.0001 lh (m.iu/ml) –0.63 <0.0001 fsh (m.iu/ml) 0.13 ns lh : fsh –0.72 <0.0001 prolactin (ng/ml) –0.29 0.008 free testosterone (pg/ml) –0.53 <0.0001 351j contemp med sci | vol. 8, no. 5, september-october 2022: 347–351 h.a.m. al-quraishy et al. original association between hormonal imbalance and interleulin-10 level oligomenorrhea due to polycystic ovary syndrome: an international multicenter, pilot randomized controlled trial. medicine, 101, e28674–e28674. 12. ahmed, i., ali, i. & hussain, s. 2022. human body weight measures in association with better screening predictor among waist-to-hip ratio, body mass index and body fat percentage. bahria university journal of humanities & social sciences, 5. 13. milewska, m., przekop, z., szostak-węgierek, d., chrzanowska, m., raciborski, f., traczyk, i., sińska, b. i. & samoliński, b. 2022. prevalence of risk of sarcopenia in polish elderly population—a population study. nutrients, 14, 3466. 14. artimani, t., karimi, j., mehdizadeh, m., yavangi, m., khanlarzadeh, e., ghorbani, m., asadi, s. & kheiripour, n. 2018. evaluation of pro-oxidantantioxidant balance (pab) and its association with inflammatory cytokines in polycystic ovary syndrome (pcos). gynecological endocrinology, 34, 148–152. 15. vural, p., değirmencioğlu, s., saral, n. y. & akgül, c. 2010. tumor necrosis factor α (− 308), interleukin-6 (− 174) and interleukin-10 (− 1082) gene polymorphisms in polycystic ovary syndrome. european journal of obstetrics & gynecology and reproductive biology, 150, 61–65. 16. karadeniz, m., erdogan, m., zengi, a., tamsel, s., berdeli, a., saygili, f. & yilmaz, c. 2008. polymorphism of the interleukin‐10 gene in polycystic ovary syndrome. international journal of immunogenetics, 35, 119–123. 17. chugh, r. m., park, h.-s., el andaloussi, a., elsharoud, a., esfandyari, s., ulin, m., bakir, l., aboalsoud, a., ali, m. & ashour, d. 2021. mesenchymal stem cell this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. therapy ameliorates metabolic dysfunction and restores fertility in a pcos mouse model through interleukin-10. stem cell research & therapy, 12, 1–19. 18. shamsi, m., ghazavi, a., saeedifar, a. m., mosayebi, g. & ganji, a. 2022. the immune system’s role in pcos. molecular biology reports, 1–14. 19. umar, m., sastry, k. s. & chouchane, a. i. 2018. role of vitamin d beyond the skeletal function: a review of the molecular and clinical studies. international journal of molecular sciences, 19, 1618. 20. sylus, a. m., nandeesha, h. & chitra, t. 2020. matrix metalloproteinase-9 increases and interleukin-10 reduces with increase in body mass index in polycystic ovary syndrome: a cross-sectional study. international journal of reproductive biomedicine, 18, 605. 21. yang, y., xia, j., yang, z., wu, g. & yang, j. 2021. the abnormal level of hsp70 is related to treg/th17 imbalance in pcos patients. journal of ovarian research, 14, 1–9. 22. cabus, u., kabukcu, c., fenkci, s., caner, v., oztekin, o., fenkci, v. & enli, y. 2020. serum caspase-1 levels in women with polycystic ovary syndrome. taiwanese journal of obstetrics and gynecology, 59, 207–210. 23. talaat, r. m., mohamed, y. a., mohamad, e. h., elsharkawy, m. & guirgis, a. a. 2016. interleukin 10 (− 1082 g/a) and (− 819 c/t) gene polymorphisms in egyptian women with polycystic ovary syndrome (pcos). meta gene, 9, 254–258. 24. wang, w., zheng, j., cui, n., jiang, l., zhou, h., zhang, d. & hao, g. 2019. baicalin ameliorates polycystic ovary syndrome through amp-activated protein kinase. journal of ovarian research, 12, 1–12. https://doi.org/10.22317/jcms.v8i5.1285 160 j contemp med sci | vol. 5, no. 3, may–june 2019: 160–164 original comparison between gingival pyogenic granuloma and peripheral giant cell granuloma by immunohistochemical detection of cd34 and alpha smooth muscle actin aween auda ablahad,a ameera kamal khaleel,*b and jasim almahanab aministry of health, erbil, kurdistan region, iraq. bdepartment of dentistry, al-hussein university college, karbala, iraq. *correspondence to ameera kamal khaleel (email: amera1kam@yahoo.com). (submitted: 27 november 2018 – revised version received: 16 december 2018 – accepted: 12 march 2019 – published online: 26 june 2019) introduction oral mucosa is constantly exposed to external and internal stimuli and therefore manifests as a spectrum of diseases ranging from developmental, reactive, and inflammatory to neoplastic.1 localized gingival reactive hyperplastic lesions are classified into four sub-types like pyogenic granuloma (pg), peripheral giant cell granuloma (pgcg), focal fibrous hyperplasia, and peripheral ossifying fibroma.2 reactive lesions are non-neoplastic clinically and histologically and nearly they are clinically similar but possess distinct histopathological features.3 in general, pg is a common localized hyperplastic benign vascular lesion of the oral cavity, manifested as exophytic, sessile, erythematous, and painful nodule that is prone to bleeding and ulceration.4 three quarters of all oral pgs occur on the gingiva, and most of them are in response to gingival inflammation and chronic gingival irritants.5–7 peripheral giant cell granuloma is a painless, soft, reddish-bluish tumor-like reactive lesion, clinically bears resemblance to pg,8 however, it has significantly higher rate of recurrence than other reactive lesions and thus has to be treated with caution with complete excision and clearing of the lesion.9 hematopoietic progenitor cell antigen cd34 also known as cd34 antigen is a protein that in humans is encoded by the cd34 gene. the cd34 protein is a member of a family of single-pass transmembrane sialomucin proteins that show expression on early hematopoietic and vascular-associated tissue.10 cd34 is a surface glycophosphoprotein expressed on developmentally early hematopoietic stem and progenitor cells, small-vessel endothelia and embryonic fibroblasts.10 myofibroblasts are metabolically and morphologically distinctive fibroblasts expressing alpha smooth muscle actin (α-sma), and their activation plays a key role in development of the fibrotic response.11,12 they are involved in morphogenesis, inflammation, fibrosis and oncogenesis in many tissues and organs. myofibroblasts help in extracellular matrix reorganization by the production of numerous inflammatory mediators, growth factors and proteins of the extracellular matrix.13 transdifferentiation of fibroblasts into myofibroblasts is an early event in tumorigenesis and it is mediated by cytokines and growth factors which are expressed by tumor cells.14 the pathogenesis of pg and pgcg remains to be not fully understood. in such conditions, immunohistochemistry may provide some practical help and shed a light on the underlying pathogenesis of these lesions. the aim of this research was to study the immunohistochemical expressions of cd34 and α-sma for gingival pyogenic granuloma in comparison with peripheral giant cell granuloma. in such conditions, the immunohistochemistry may provide some practical help and shed a light on the underlying pathogenesis of these lesions. materials and methods the materials used in this study were consisting of 48 formalin fixed, paraffin-embedded biopsy specimens of gingival pg and 39 formalin fixed, paraffin-embedded biopsy specimens of pgcg. they were retrieved from the archives of rizgary teaching hospital, erbil (ministry of health, kurdistan region of iraq) in the period between january, 2013 and objectives the aim of this research was to study the clinical and the immunohistochemical expressions of cd34 and alpha smooth muscle actin (α-sma) for gingival pyogenic granuloma in comparison with peripheral giant cell granuloma. methods formalin fixed, paraffin-embedded biopsy specimens of 48 gingival pyogenic granuloma and 39 peripheral giant cell granuloma were used in the study. immunohistochemical analysis for cd34 and α-sma were studied in pyogenic granuloma (pg), peripheral giant cell granuloma (pgcg). results the mean numbers of the cd34 positive microvessels in pgs and pgcgs were 32.58 ± 17.778 and 22.4 ± 11.208, respectively. statistical analysis showed a highly significant difference present between them (p < 0.01). the mean numbers of blood vessels with vascular surrounding cells non-reactive to α-sma in pgs and pgcgs were 3.81 ± 2.228 and 10.53 ± 3.432, respectively. statistical analysis showed a highly significant differences present between them (p < 0.01). conclusion the mean number of cd34 positive microvessels in pgs was significantly more than that of pgcg, but the mean number of vascular surrounding cells non-reactive to α-sma was significantly less. this can add insight to the clinical behavior and might reflect the differences in pathogenesis of these lesions. keywords pyogenic granuloma, peripheral giant cell granuloma, cd34, α-sma issn 2413-0516 161j contemp med sci | vol. 5, no. 3, may–june 2019: 160–164 original comparison between gingival pyogenic granuloma and peripheral giant cell granulomaa.a. ablahad et al. august, 2016. ten control gingival samples were obtained from clinically healthy patients undergoing orthodontic extractions in erbil specialized dental center. the written consent to carry out biopsies which were required for the study was obtained from healthy volunteers, after the necessary instructions. demographic data and clinical aspects were registered in a special form, and only patients with biopsy proven gingival pg or pgcg were included. the pregnant and edentulous patients (epulis fissuratum) and patients with known systemic disorders such as diabetes and bleeding disorders were excluded from the study. sample collection was authorized by rizgary teaching hospital, ministry of health. the research project was approved by the research ethics committee at college of dentistry, hawler medical university under protocol. novolink™ polymer detection system codes re7140-k from leica microsystems (uk) which includes monoclonal mouse anti-human cd34 (clone qbend/10, dilution 1:100), and an anti-α-sma monoclonal antibody (clone 1a4, diluted 1:100; dako corporation, carpinteria, usa) were used. the staining procedure and the instructions included with each detection system were followed. after necessary data had been collected, the results were given as mean ± standard deviation. the potential difference among groups for histopathological data was evaluated using anova test. all statistical calculations were done using computer programs statistical package for the social science (spss inc., version 19). statistical significance of differences between the groups was tested with the mann–whitney u test. p-value ≤0.05 was considered statistically significant. results the samples used in this study consist of 48 cases of histologically proven pgs and 39 cases of histologically proven pgcgs. the age and sex distribution for both cases are seen in fig. 1. the maxilla was mostly affected by pg (66.7%), followed by the mandible (33.3%), 39.6% cases showed a maximum diameter <1.5 cm, 52.1% showed a maximum diameter 1.5–3 cm, and only 8.3% showed a maximum diameter >3 cm. the results also showed that the mandible was mostly affected by pgcg (72.4%), followed by the maxilla (27.6%). about 39.9% cases showed a maximum diameter <1.5 cm, 48.7% showed a maximum diameter of 1.5–3 cm, and only 15.4% showed a maximum diameter >3 cm. histopathological pictures hematoxylin and eosin results the pyogenic granuloma revealed hyperplastic keratinized stratified squamous epithelium with some areas of epithelial atrophy or ulcerations. the most important features are the occurrence of large numbers of endothelium-lined vascular spaces and the extreme proliferation of fibroblasts cells and inflammatory cells (fig. 2). microscopic examination of the sections of pgcg showed the presence of hyperplastic keratinized stratified squamous epithelium, and the overlying mucosal surface was ulcerated in some areas. histopathologically, fibroblasts in the stroma form a basic element of the lesion and are plump oval to spindle-shaped. multi-nucleated giant cells of variable shapes and sizes and containing multiple nuclei were seen scattered throughout the connective tissue stroma (fig. 3). the connective tissue stroma also reveals some vascularity with different types of inflammatory cell infiltration, and foci of hemorrhage were also observed. immunohistochemical results the number of cd34 positive microvessels was considered as a mvd. any brown staining of endothelial cells or cluster of endothelial cells with or without a lumen that is clearly separate from adjacent microvessels and other connective tissue elements is considered as a single vessel. branching structure fig. 1 age and sex distribution of (a) pyogenic granuloma and (b) peripheral giant cell granuloma. fig. 2 photomicrograph ofpyogenic granuloma with hyperplastic epithelium that overlies a connective tissue that contains numerous inflammatory cells and blood vessels (a1: h&e 100×). fibrodvascular connective tissue consisting of numerous endothelium-lined vascular spaces engorged with red blood cells (arrows), and numerous fibroblasts infiltrated with inflammatory cells (a2: h&e 400×). a b 162 j contemp med sci | vol. 5, no. 3, may–june 2019: 160–164 comparison between gingival pyogenic granuloma and peripheral giant cell granuloma original a.a. ablahad et al. was counted as a single vessel unless there was a break in the continuity of the structure. all samples used in the study demonstrated positive reaction for cd34 (figs. 4 and 5). the mvd for pg and pgcg was ranging (7.7–63.9) and (6.9– 46.4) respectively. statistical analysis of the mvd for pg showed no significant relation with the gender, site and the maximum diameter of the lesions. statistical analysis of mvd for pgcg showed significant relation (p < 0.05) with the gender, but a non-significant relations present with the site and the maximum diameter of the lesions (p > 0.05) as seen in table 1. the mean number of the cd34 positive microvessels in pgs, pgcgs, and normal gingiva was 32.58 ± ,17.778 11.208± 22.4, and 1.197 ± 8.21, respectively. statistical analysis showed a highly significant difference present between pg and normal gingiva, pg and pgcg, pgcg and normal gingiva regarding the mvd (p < 0.01) as seen in table 2. in this study, α-sma positive stromal cells and vascular surrounding spindle cells that showing brown cytoplasmic immunostaining, were considered to be myofibroblasts. vascular surrounding cells and other stromal mesenchymal cells in all samples of normal gingiva revealed immune negativity to α-sma. some of the vascular surrounding cells in pgs and pgcgs studied revealed immune positivity to α-sma especially in pg, but the other stromal mesenchymal cells were negative in both pg and pgcg. the number of blood vessels with vascular surrounding cells non-reactive to α-sma was counted. in pg, the number of non-reactive blood vessels was ranging 1.3–9.4. while in pgcg the number of non-reactive blood vessels was ranging 4.8–18.2. statistical analysis for pg and pgcg showed no significant relation with the gender, site and the diameter of the lesions (p > 0.05) as seen in table 3. the mean number of blood vessels with vascular surrounding cells non-reactive to α-sma in pg was 3.81 ± 2.228, but in pgcg, it was 10.53 ± 3.432. statistical analysis showed a highly significant differences present between pg and pgcg regarding the number of blood vessels with vascular surrounding cells non-reactive to α-sma (p < 0.01) as seen in table 4. discussion pyogenic granuloma and peripheral giant cell granuloma are common lesions of oral cavity. the pathogenesis remains to be fig. 3 photomicrograph of peripheral giant cell granuloma, revealed hyperplastic epithelium that overlies vascular connective tissue which contain numerous multinucleated giant cells (a1: h&e 100×). abundant multinuclenated giant cells (upper arrow) together with inflammatory cell infiltration and areas of hemorrhage (lower arrow) are also seen (a2: h&e 400×). a b fig. 4 photomicrographs revealed the microvessels expressed by cd34 marker in the pyogenic granuloma (arrows) (a1: immunohistochemistry 100×; a2: immunohistochemistry 400×). a b fig. 5 photomicrographs revealed the microvessels expressed by cd34 marker in the peripheral giant cell granuloma (arrows) (a1: immunohistochemistry 100×; a2: immunohistochemistry 400×). a b 163j contemp med sci | vol. 5, no. 3, may–june 2019: 160–164 original comparison between gingival pyogenic granuloma and peripheral giant cell granulomaa.a. ablahad et al. table 3. distribution of the mean and standard deviations of the number of blood vessels with vascular surrounding cells non-reactive to α-sma in relation to the gender, location, and the maximum diameter of pyogenic granuloma and peripheral giant cell granuloma. clinical parameter pg pgcg x ± sd p-value x ± sd p-value gender male 3.90 ± 1.973 0.548 11.43±3.614 0.241 female 4.73 ± 2.458 >0.05 9.91 ± 3.232 >0.05 ns ns site maxilla 3.94 ± 2.208 0.892 10 ± 3.338 0.558 mandible 3.77 ± 2.538 >0.05 10.85 ± 3.26 >0.05 ns ns table 4. the relations between the pyogenic granuloma and peripheral giant cell granuloma for α-sma. α-sma no. (negative) no. (positive) x ± sd p-value pg 0 48 3.81 ± 2.228 0.0001 pgcg 0 39 10.53 ± 3.432 *<0.0001 hs *comparison between pg and pgcg. x: mean, sd: standard deviation, no: number, hs: highly significant. table 1. distribution of the mean and standard deviations of microvessel density in relation to the gender, location, and the maximum diameter of pyogenic granuloma and peripheral giant cell granuloma clinical parameter pg pgcg x ± sd p-value x ± sd p-value gender male 26.79 ± 15.97 0.091 18.56 ± 12.047 0.03 female 37.06 ± 18.154 >0.05 25.06 ± 9.994 <0.05 ns s site maxilla 30.52 ± 16.964 0.852 25.5 ± 12.074 0.379 mandible 31.27 ± 19.216 >0.05 22.01 ± 11.806 >0.05 ns ns maximum diameter (cm) <1.5 35.44 ± 18.363 0.591 18.23 ± 9.807 0.131 1.5–3 30.82 ± 17.15 >0.05 24.22 ± 11.727 >0.05 >3 27.3 ± 21.463 ns 26.35 ± 11.39 ns pg: pyogenic granuloma, pgcg: peripheral giant cell granuloma, x: mean, sd: standard deviation, cm: centimeter, ns: non-significant, s: significant. table 2. the relations between the pyogenic granuloma, peripheral giant cell granuloma and normal gingiva for microvessel density cd34 (mvd) no. (negative) no. (positive) x ± sd p-value pg 0 48 32.58 ± 17.778 0.0001 *<0.01 hs 0.0001 pgcg 0 39 22.4 ± 11.208 **<0.01 hs 0.0001 normal gingiva 0 10 8.21 ± 1.197 ***<0.01 hs *comparison between pg and normal gingiva. **comparison between pg and pgcg. ***comparison between pgcg and normal gingiva. x: mean, sd: standard deviation, no: number, hs: highly significant. continued maximum diameter (cm) <1.5 3.73 ± 1.995 0.119 10.92 ± 3.709 0.143 1.5–3 4.4 ± 2.415 >0.05 11.05 ± 2.837 >0.05 >3 2 ± 0.816 ns 8 ± 3.949 ns pg: pyogenic granuloma, pgcg: peripheral giant cell granuloma, x: mean, sd: standard deviation, cm: centimeter, ns: non-significant. not fully understood. in such conditions, immunohistochemistry may provide some practical help and shed a light on the underlying pathogenesis of these lesions. cd34 immunostaining distribution in this study, the mean value of mvd of normal gingiva specimens was 8.21 ± 1.197. our results were nearly similar to seyedmajidi et al.’s15 result; they found the mvd of all samples of healthy gingiva was 7.95 ± 5.56. the mean value of mvd of samples of pgs was 32.58 ± 17.778. our results were less than vasconcelos et al.’s16 result which was 48.09 ± 30.031, but more than that of seyedmajidi et al.’s15 which was 20.01 ± 11.88. the increased expression of cd34 can be attributed to the increase in the number of blood vessels in pyogenic granuloma and appears to be involved in pathogenesis of oral pyogenic granuloma.15 the mean number of mvd of samples of pgcg was 22.4 ± 11.208. our results were less than hallikeri et al.’s17 result which was 30.05 ± 8.006. the higher expression of cd34 biomarkers in pg as a vessel-rich lesion compared with normal gingiva and pgcg, illustrates the role of these molecules as angiogenesis related markers. the variation of mean mvd among the groups suggests that angiogenesis may be one of the mechanisms possibly contributing to the different biological behavior, architecture or pattern of growth, and may be an important step for the study of new therapy.15 alpha-smooth muscle actin immunostaining distribution the most frequently used myofibroblast marker is α-sma.18 the number of blood vessels with vascular surrounding cells non-reactive to α-sma in pg was significantly less than that of pgcg. most of the small, large blood vessels and abnormal blood vessels and spaces in pg had two or more outer layers of mesenchymal cells (myofibroblast) positive for α-sma. the pattern of the distribution of these mononuclear myofibroblastic cells suggested that these cells might play a role in generating of newly formed blood vessels and spaces, since pg has more blood vessels in comparison with pgcg. epivatianos19 and kawachi20 also found that most perivascular spindle cells in pgs studied were strongly stained to α-sma. 164 j contemp med sci | vol. 5, no. 3, may–june 2019: 160–164 comparison between gingival pyogenic granuloma and peripheral giant cell granuloma original a.a. ablahad et al. the stromal mesenchymal cells between the blood vessels showed no reactivity to α-sma. despite the similarity of pg to granulation tissue, we did not detect any stromal myofibroblasts in all samples of pg. our results come in agreement with damasceno et al.,12 they did not noticed any stromal myofibroblast in pg. regarding the pgcg, this study showed that stromal spindle cells which morphologically resemble myofibroblasts were negative for α-sma, this result agree with that of damasceno et al.’s12 study, but disagree with filioreanu et al.21 and kujan22 studies, they found that smooth muscle specific actin was strongly stained in the spindle mononuclear cells (myofibroblasts) distributed through the lesion. the sub-classification of blood vessels into immature, intermediate and mature is required as this important using the combination of immunohistochemistry of cd34 and α-sma stain to demonstrate pericyte.17 this is required to differentiate the intermediate blood vessels from the mature blood vessels. since immature and intermediate blood vessels are considered as an indicator of the degree of angiogenic activity, and are the main target of anti-angiogenic therapy and not the mature blood vessels, quantification of immature blood vessels may be helpful in estimation of prognosis especially for agents that do selectively target angiogenic endothelial cells, information may provide additional evidence of therapeutic anti-vascular effect for the control and prevention of the growth by inhibition of angiogenesis by anti angiogenic therapy could be a potent therapeutic strategy. conclusion pyogenic granuloma showed more microvessel density and lesser number of blood vessels with vascular surrounding cells non-reactive to α-sma were seen. this can add insight to the clinical behavior and might reflect the differences in pathogenesis of these lesions. conflicts of interest none.  references 1. neville bw, damm dd, allen cm, bouquot je. oral and maxillofacial pathology. 2nd ed., 2005, pp. 371–372. 2. reddy v, saxena s, saxena s, reddy m. reactive hyperplastic lesions of the oral cavity: a ten year observational study on north indian population. j clin exp dent. 2012;4:e136–e140. 3. kamal r, dahiya p, puri a. oral pyogenic granuloma: various concepts of etiopathogenesis. j oral maxillofac pathol. 2012;16:79–81. 4. saghafi s, amoueian s, montazer m, bostan r. assessment of vegf, cd-31 and ki-67 immunohistochemical markers in oral pyogenic granuloma: a comparison with hemangioma and inflammatory gingivitis. iran j basic med sci. 2011;14:185–189. 5. jafarzadeh h, sanatkhani m, mohtasham n. oral pyogenic granuloma: a review. j oral sci. 2006;48:167–175. 6. gomes sr, shakir qj, thaker pv, tavadia jk. pyogenic granuloma of the gingival: a misnomer? a case report and review of literature. j indian soc periodontol. 2013;17: 514–519. 7. sharma a, mathur vp, sardana d. effective management of a pregnancy tumour using a soft tissue diode laser: a case report. laser ther. 2014;23:279–282. 8. ramu s, rodrigues ch. reactive hyperplastic lesions of the gingiva: a retrospective study of 260 cases. world j dent. 2012;3:126–130. 9. motamedi mh, eshghyar n, jafari sm, lassemi e, navi f, abbas fm, et al. peripheral and central giant cell granulomas of the jaws: a demographic study. oral surg oral med oral pathol oral radiol endod. 2007;103:e39–e43. 10. gold m, blanchet m-r, samayawardhena la, bennett j, maltby s, pallen cj, et al. cd34 function in intracellular signaling and mucosal inflammatory disease development. allergy asthma clin immunol. 2010;6:p15. 11. cherng sh, young j, ma h. alpha-smooth muscle actin (α-sma). j am sci. 2008;4:7–9. 12. damasceno ls, gonçalves fda s, costa e silva e, zenóbio eg, souza pe, horta mc. stromal myofibroblasts in focal reactive overgrowths of the gingiva. braz oral res. 2012;26:373–377. 13. rao k b, malathi n, narashiman s, trajan sh. evaluation of myofibroblasts by expression of alpha smooth muscle actin: a marker in fibrosis, dysplasia and carcinoma. j clin diagn res. 2014;8:zc14–zc17. 14. amatangelo md, bassi de, klein-szanto aj, cukierman e. stromaderived three-dimensional matrices are necessary and sufficient to promote desmoplastic differentiation of normal fibroblasts. am j pathol. 2005;167:475–488. 15. seyedmajidi m, shafaee s, hashemipour g, bijani a, ehsani h. immunohistochemical evaluation of angiogenesis related markers in pyogenic granuloma of gingiva. asian pac j cancer prev. 2015;16: 7513–7516. 16. vasconcelos mg, alves pm, vasconcelos rg, da silveira éjd, medeiros amc, de queiroz lmg. expression of cd34 and cd105 as markers for angiogenesis in oral vascular malformations and pyogenic granulomas. eur arch otorhinolaryngol. 2011;268:1213–1217. 17. hallikeri k, acharya s, koneru a, trivedi d. evaluation of microvessel density in central and peripheral giant cell granulomas. j adv clin res insights. 2015;2:20–25. 18. hinz b. formation and function of the myofibroblast during tissue repair. j invest dermatol. 2007;127:526–537. 19. epivatianos a, antoniades d, zaraboukas th, zairi e, poulopoulos a, kiziridou a, et al. pyogenic granuloma of the oral cavity: comparative study of its clinicopathological and immunohistochemical features. pathol int. 2005;55:391–397. 20. kawachi n. a comparative histological and immunohistochemically study of capillary hemangioma, pyogenic granuloma and cavernous hemangioma in oral region with special reference to vascular proliferation factors. int j oral med sci. 2011;9:241–251. 21. filioreanu am, popescu e, cotrutz c, cotrut ce. immunohistochemical and transmission electron microscopy study regarding myofibroblasts in fibroinflammatory epulis and giant cell peripheral granuloma. rom j morphol embryol. 2009;50:363–368. 22. kujan o, al-shawaf az, azzeghaiby s, almanadille a, aziz k, raheel sa. immunohistochemical comparison of p53, ki-67, cd68, vimentin, α-smooth muscle actin and alpha-1-antichymotrypsin in oral peripheral and central giant cell granuloma. j contemp dent pract. 2015;16:20–24. dx.doi.org/10.22317/jcms.06201908 189j contemp med sci | vol. 8, no. 3, may-june 2022: 189–193 original serum levels of homocysteine, troponin-i, and high sensitive c-reactive protein in iraqi covid-19 patients shahad sabah khalid*, zhahraa mohamed ali, mohanad faris raheem department of laboratory sciences, college of pharmacy, university of baghdad, baghdad, iraq. *correspondence to: shahad sabah khalid (e-mail: shahad_almukhtar@ymail.com) (submitted: 04 march 2022 – revised version received: 16 march 2022 – accepted: 25 april 2022 – published online: 26 june 2022) abstract objective: this study aimed to investigate if the homocysteine has recently been proposed as a serious predictive biomarker for covid-19 infection severity. methods: in this case-control study, which involved 90 participants, 5 ml of venous blood specimen was reserved for each participant, to measure homocysteine, troponin-i, and high sensitive c-reactive protein in their blood, to find if there was an association between these markers levels and covid-19 infection by using stata version 23. results: the current study found a significant increase in measured values of homocysteine in patients’ serum than controls p-value = 0.004 which is < alpha (0.05) with an area under the curve of 0.678, also found a significant increase in measured values of cardiac troponin-i; and hs-crp in covid-19 patients than controls, p-values were 0.02 and 0.00 respectively which are < alpha (0.05) with an area under the curve of 0.686 and 0.739 respectively. conclusion: homocysteine has been noted as a strong predictive biomarker for covid-19 infection severity in many articles, the current study showed that homocysteine had a moderate predictive biomarker for covid-19 infection. cardiac troponin-i showed a moderate predictive biomarker for covid-19 infection, while hs-crp was noted as a good predictive biomarker. many studies reported an association between high levels of hs-crp and mortality rate in covid-19 patients. keywords: covid-19, homocysteine, troponin i, c-reactive protein issn 2413-0516 introduction a novel form of coronavirus, “severe acute respiratory syndrome coronavirus 2” (sars-cov-2) was described in wuhan in 2019, is an rna airborne virus, that causes varied comorbidities and mortalities.1 covid-19 is occurring in two phases; first is viral replication then inflammatory response. the flare-up of coronaviruses begins to spread quickly through the world, which induces the world health organization (who) to state the disease “a worldwide health threat”. the exponential elevation in infected cases worldwide may be because of the lack of pre-virus immunity.2 homocysteine (hcy) is a non-essential α-amino acid, that does not take part in the protein synthesis.3 homocysteine has recently been suggested as a serious predictive biomarker for covid-19 infection severity, different forms of hcy are existing in the blood circulation these include: bound to plasma proteins (70–80%), joined with other hcy molecules to form a disulfide (20–30%), while free thiol represents the smallest part (~1%).4 sars-cov-2 passes on methyl group for viral rna supply from the host cell s-adenosylmethionine (sam), which will be transformed into s-adenosylhomocysteine (sah). homocysteine is formed as an intermediate product when sah hydrolase (sahh) removes adenosine from sah, homocysteine reprocessed by the remethylation and trans-sulphuration pathway in the human body.5 sars-cov2 entry into cells is through its spike proteins that attach to the ace2 cellular receptors to form a tunnel through which the virus enters the cell.6 homocysteine attaches also to the ace2 enzyme, in addition to the attachment to various ion-channel cellular receptors, and then enters cells.7,8 vasculitic damage is not only pertinent in the lung, where it leads to edema and acute respiratory distress syndrome, but also has a considerable turn in the cardiovascular diseases (ischemia, deep venous thrombosis, pulmonary thromboembolism) and cerebral injuries (ischemia, hemorrhage); its severity is regrettably not easily expected through currently used laboratory biomarkers such as d-dimer or prothrombin time/activated partial thromboplastin time (pt/aptt).9,10 the most widely used biomarker in the diagnosis of acute myocardial injury (ami) is troponin.11 troponin is constitutive of cardiac and skeletal muscles. the troponin complex is formed of three subunits; troponin t (tnt) which is considered as tropomyosin-binding subunit, and troponin i (tni) which is considered an inhibitory subunit, and troponin c (tnc) which is the calcium-binding part. troponin monitors the interaction that is mediated between actin and myosin by the effect of calcium which results in the contraction and relaxation of striated muscles.12,13 troponin i (tni) is the inhibitory subunit responsible for inhibiting the atpase activity of actinomyosin, it is a polar protein with a surplus of positively charged remnants. the expression of tni is based on the level of ontogenesis; both cardiac and slow skeletal types are available in the heart of the human fetus. after birth, the number of the slow skeletal type is diminished and the number of ctni is increased. it has been recorded that baby in age of nine months has ctni exclusively with no slow skeletal type.14 troponin is present in the blood circulation 4 to 6 hours after ami,15 reaches a peak after nearly 18 to 24 hours, and may stay increased for up to 14 days estimation of ctn-i by automated assay is recently one of the most sensitive and specific methods for diagnosing ami.16,17 the presently most favorable laboratory marker for cardiovascular risk is the estimation of crp at low levels [high sensitivity crp (hs-crp)], crp comprises five identical symmetrically organized 23-kda promoters, which are folded into mailto:shahad_almukhtar@ymail.com 190 j contemp med sci | vol. 8, no. 3, may-june 2022: 189–193 serum levels of homocysteine, troponin-i, and high sensitive c-reactive protein in iraqi covid-19 patients original s.s. khalid et al. two antiparallel -sheets, similar to the structure of lectins, and is generally raised in human plasma after bacterial infections, cancer, or after surgical procedures.18 this study aimed to measure homocysteine level, troponin-i, and high sensitive c-reactive protein in serum of covid-19 infected patients participating in this study. methods in a case-control study, which involved 90 participants, 45 were hospitalized patients diagnosed clinically with covd19, and with a positive result of nucleic acid amplification testing by real-time reverse transcription-polymerase chain reaction (rt-pcr) of respiratory samples which were nasal/ oropharyngeal swabs for covid-19 infection and 45 of them were healthy as control. the study was carried out in two centers for covid-19 in baghdad, iraq, these centers were: al-ataa, and dhare alphaeadh hospitals, during the period from october/2021 to february/2022. all covid-19 patients were treated with the same protocol, all blood samples were taken from the participants in the same conditions, all patients were on continuous positive airway pressure therapy (cpap), participants were interviewed by the researcher, and sociodemographic data including; name, age, gender, and history of any past disease and medication taken from them. inclusion criteria; adult (30–60) years old, patients with covid-19 infection with positive pcr, have no chronic disease. exclusion criteria; patients with cardiovascular disease, diabetes, and hypertension, autoimmune disease, pregnant and lactating women, patients with a history of asthma, smoking, malignancy, patients on steroid or immunosuppressive drugs as long term therapy previous to covid-19 infection. 5 ml of venous blood specimen was reserved for each participant and collected in a gel tube and left for an appropriate time at room temperature to allow them to clot then centrifuged for 10–15 minutes at 4400 rounds per minute (rpm) to get the serum that was used in the analysis for studied homocysteine, troponin-i, and hs-crp levels. statistical analysis: statistical analysis was conducted using the statistical package for social sciences (spss) version 23 software for windows. descriptive statistics are presented as median, interquartile range, and mean rank t-testmann whitney was used to measure the difference between the means of non-normally distributed variables. the receiver operating characteristic curve (roc) for measuring the area under the curve was used also. results in the present study, there was a significant increase in serum levels of homocysteine in covid-19 patients’ serum than controls (p-value = 0.004) which is < alpha (0.05), where the median (iqr) for covid-19 patients was 11.0 (30.735) while for control was 6.800 (4.295) a shown in table 1 and figure 1. also there was a significant increase in measured values of cardiac troponin-i, with p-value = 0.02 < 0.05, where covid-19 patients’ median (iqr) was 0.00646 (0.0056) while median (iqr) for control was 0.004135 (0.0041). the p-value for hs-crp was 0.00 < 0.05 which refers to a significant increase in hs-crp level in covid-19 patients than in control, where the median (iqr) for covid-19 patients was 52.955 (36.81) while for controls was 1.9810 (51.32) as shown in table 1, figures 2 and 3. homocysteine showed an area under the curve (auc) of 0.678 which was moderate strength a predictive value for covid-19 severity. the optimal cut-off value for hcy as a predictive value of covid-19 infection severity was estimated to be 8.10 (nmol/ml); sensitivity and specificity were 66.7% and 68.9%, respectively (as shown in table 2 and figure 4). cardiac troponin-i had an auc of 0.686, the optimal cut-off value was 0.004635 (ng/ml) with sensitivity and specificity of 75.5% and 60% respectively, while the auc for hs-crp was 0.739 making it a good predictive marker of covid-19 table 1. assessment of homocysteine, troponin-i, and hs-crp levels in studied groups parameter group median interquartile range mean rank p-value homocysteine nmol/ml patients 11.00 30.735 53.52 *0.004 controls 6.800 4.295 37.48 cardiac troponin-i ng/ml patients 0.00646 0.0056 53.89 *0.002 controls 0.004135 0.0041 37.11 hs-crp µg/ml patients 52.955 36.81 56.23 *0.00 controls 1.9810 51.32 34.77 *p < alpha (0.05) significant; r, spearman correlation coefficient. fig. 1 homocysteine levels in studied groups. 191j contemp med sci | vol. 8, no. 3, may-june 2022: 189–193 s.s. khalid et al. original serum levels of homocysteine, troponin-i, and high sensitive c-reactive protein in iraqi covid-19 patients fig. 2 troponin-i levels in studied groups. fig. 3 hs-crp levels in studied groups. fig. 4 receiver operating characteristic curve for measuring the area under the curve of homocysteine in patients with covid-19 infection. table 2. receiver operating characteristic curve for measuring the area under the curve of homocysteine, cardiac troponin-i, and hs-crp levels in patients with covid-19 infection variable auc 95% ci of auc p-value optimal cut-off sn sp homocysteine nmol/ ml 0.678 0.565–0.792 *0.004 8.100 0.667 0.689 cardiac troponin i ng/ml 0.686 0.575–0.798 *0.002 0.004635 0.756 0.600 hs-crp µg/ml 0.739 0.634–0.843 *0.000 8.7220 0.778 0.689 where: *p< alpha (0.05) significant; auc, the area under the curve; ci, is confidence interval; sn, sensitivity; sp, specificity (from the curve x-axis is 1-specificity). severity, the optimal cut-off value was 8.7220 (µg/ml) with sensitivity and specificity of 77.8% and 68.9% respectively figures 5 and 6. discussion homocysteine has been suggested as a crucial biomarker for cardiovascular complications in patients admitted to hospital with covid-19 infection.19 analysis by receiver operating characteristic (roc) for estimating the sensitivity and specificity of the cut-off at which fig. 5 receiver operating characteristic curve for measuring the area under the curve of cardiac troponin-i in patients with covid-19 infection. 192 j contemp med sci | vol. 8, no. 3, may-june 2022: 189–193 serum levels of homocysteine, troponin-i, and high sensitive c-reactive protein in iraqi covid-19 patients original s.s. khalid et al. fig. 6 receiver operating characteristic curve for measuring the area under the curve of hs-crp in patients with covid-19 infection. patients are considered infected with severe covid-19 disease is equal to or higher than the specified cut-off value, so the current study showed that homocysteine had an optimal cut-off value as a predictive value of covid-19 severe infection estimated to be (8.10) mol/ml sensitivity and specificity were 66.7% and 68.9%, respectively, and as a moderate predictive biomarker for covid-19 infection (auc of 0.678). ponti g et al. in a multicenter, retrospective analysis, ponti g et al. including patients hospitalized for covid-19 from april to september 2020, the study suggest that homocysteine level equal to or more than 16 μmol/l was the optimal cut-off value for hcy as predictive of in-hospital mortality with sensitivity and specificity of 41 and 83%, respectively; with auc is 0.55.20 many articles suggested hcy as a strong predictive biomarker for covid-19 infection severity.21 in a group of 273 chinese patients that were hospitalized with covid-19 disease and had mild symptoms, over 40 parameters were measured at admission. disease progression was recorded for 72 patients, hcy serum levels and monocyte-to-lymphocyte ratio (mlr) were the solely significant predictors in hyperhomocysteinemic patients (>15.4 µmol/l), evaluated to correspond with a three-fold elevated risk of disease evolution at radiological images. the most important thing is that hcy is the solely predictive marker specified which can be easily modifiable.22 c-reactive protein (crp), is an acute-phase protein23 synthesized in the liver as a response to interleukin-6 (il-6) and is a broadly available biomarker of inflammation.24 several recent studies have reported an association between higher crp concentrations and greater disease severity in covid-19 disease.25 in the current study, hs-crp was recognized as a good predictive biomarker with an auc of 0.739. many studies reported an association between high levels of hs-crp and mortality rate in covid-19 patients. a study done among 375 patients with confirmed sars-cov-2 infection detected that increased hs-crp levels were notably correlated with high mortality risk.26 juan li in a study aimed to explore the influencing factors on critical covid-19 disease estimated the hs-crp level median (iqr) for survival patients to be 18.4 (59.90) (mg/l) while for non-survivor was 113.30 (93.20) (mg/l) with p-value < 0.001 and auc (95% ci) was 0.879 (0.815–0.944).27 cardiac troponin-i shows a moderate predictive biomarker for covid-19 infection with an auc of 0.686, shi and colleagues explained in a huge sequential patient cohort with covid-19 that myocardial injury, identified at admission, was correlated with a higher risk of in-hospital mortality. for 416 hospitalized patients with covid-19 in china, 82 had an initial ctn-i higher than the upper reference range, proposing approximately 20% of the cohort had evidence of myocardial injury. those with elevated ctn-i, compared to those without, progress with a more severe disease on multiple measures. those with elevated ctn-i had many more cardiac comorbidities and showed a higher risk of death, both during the time from symptom onset (hazard ratio, 4.26 [95% ci, 1.92–9.49]) and admission to the endpoint (hazard ratio, 3.41 [95% ci, 1.62–7.16]).28 juan li (2021) in a study aimed to explore the influencing factors of critical coronavirus disease 2019 (covid-19) estimated the ctn-i level median (iqr) for survival patients to be 2.55 (4.73) (mg/l) while for non-survivor was 40.75 (652.83) (mg/l) with p-value < 0.001.27 conclusion homocysteine may be a beneficial biomarker that can assess clinicians to recognize patients who are at higher risk for severe covid-19 infection. hcy levels in plasma can be determined easily by a simple and affordable laboratory test. good and integral food and supplements of vitamin b especially b12, and folic acid could have protective clinical effects for patients with infectious disease, and also clinical management of covid-19 infection can be improved by early determination of many biomarkers to control therapeutic intervention efficacy and/or foretell the clinical course of the covid-19 disease not only for those diagnosed with covid-19 disease but also for subjects suspected and waiting for confirmation. limitation the current study is limited by the inclusion of hospitalized patients with covid-19 infection who had no previous chronic disease. the results cannot, therefore, be generalized to all covid-19 patients; also the number of cases is limited and so gave limited results. several exclusion criteria were used in the study to decrease the confusing effect; the baseline markers levels before being infected with covid-19 disease were unavailable, which made the accurate development of changes in the studied markers uncertain. abbreviations sars-cov-2, severe acute respiratory syndrome coronavirus 2; hs-crp, high sensitive c-reactive protein; who, world health organization; ace2, angiotensin-converting enzyme 2; hcy, homocysteine; auc, area under the curve. 193j contemp med sci | vol. 8, no. 3, may-june 2022: 189–193 s.s. khalid et al. original serum levels of homocysteine, troponin-i, and high sensitive c-reactive protein in iraqi covid-19 patients 14. farah cs, reinach fc. the troponin complex and regulation of muscle contraction. faseb j [internet]. 1995 jun 1;9(9):755–67. available from: https://doi.org/10.1096/fasebj.9.9.7601340. 15. sasse s, brand nj, kyprianou p, dhoot gk, wade r, arai m, et al. troponin i gene expression during human cardiac development and in end-stage heart failure. circ res. 1993 may;72(5):932–8. 16. christensen h, johannesen hh, christensen af, bendtzen k, boysen g. serum cardiac troponin i in acute stroke is related to serum cortisol and tnf-α. cerebrovasc dis. 2004;18(3):194–9. 17. ishii j, cui w, kitagawa f, kuno t, nakamura y, naruse h, et al. prognostic value of the combination of cardiac troponin t and b-type natriuretic peptide after initiation of treatment in patients with chronic heart failure. clin chem. 2003;49(12):2020–6. 18. thompson d, pepys mb, wood sp. the physiological structure of human c-reactive protein and its complex with phosphocholine. structure. 1999 feb;7(2):169–77. 19. ponti g, manfredini m, oliva g, ozben t, fontana c, tomasi a. predicting covid-19 hospitalized patients’ outcome with homocysteine. j clin cardiol. 2021;2(1). 20. ponti g, roli l, oliva g, manfredini m, trenti t, kaleci s, et al. homocysteine (hcy) assessment to predict outcomes of hospitalized covid-19 patients: a multicenter study on 313 covid-19 patients. clin chem lab med. 2021;59(9): e354–7. 21. ibrahimagić o, smajlović d, dostović z, vidović m, tupković e, kunić s. comment on an article: “homocysteine as a potential predictor of cardiovascular risk in patients with covid-19“. med hypotheses. 2020;143. 22. yang z, shi j, he z, lü y, xu q, ye c, et al. predictors for imaging progression on chest ct from coronavirus disease 2019 (covid-19) patients. aging (albany ny). 2020;12(7):6037. 23. tillett ws, francis jr t. serological reactions in pneumonia with a nonprotein somatic fraction of pneumococcus. j exp med. 1930;52(4):561. 24. morley jj, kushner i. serum c‐reactive protein levels in disease. ann n y acad sci. 1982;389(1):406–18. 25. potempa la, rajab im, hart pc, bordon j, fernandez-botran r. insights into the use of c-reactive protein as a diagnostic index of disease severity in covid-19 infections. am j trop med hyg. 2020;103(2):561. 26. yan l, zhang h, goncalves j. an interpretable mortality prediction model for covid-19 patients. nat. mach. intell. 2, 283–288 (2020). 27. li j, wang l, liu c, wang z, lin y, dong x, et al. exploration of prognostic factors for critical covid-19 patients using a nomogram model. sci rep. 2021;11(1):1–6. 28. shi s, qin m, shen b, cai y, liu t, yang f, et al. hospitalized patients with covid-19 in wuhan, china. jama cardiol 2020;5:e200950. jama cardiol. 2020;5(7):802–10. references 1. bchetnia m, girard c, duchaine c, laprise c. the outbreak of the novel severe acute respiratory syndrome coronavirus 2 (sars-cov-2): a review of the current global status. journal of infection and public health. 2020 nov 1;13(11):1601–10. 2. sisó-almirall a, kostov b, mas-heredia m, vilanova-rotllan s, sequeiraaymar e, sans-corrales m, et al. prognostic factors in spanish covid-19 patients: a case series from barcelona. plos one. 2020;15(8):e0237960. 3. mccully ks. homocysteine and the pathogenesis of atherosclerosis. expert rev clin pharmacol. 2015 mar;8(2):211–9. 4. hankey gj, eikelboom jw. homocysteine and vascular disease. lancet (london, england). 1999 jul;354(9176):407–13. 5. romagnoli s, peris a, de gaudio ar, geppetti p. sars-cov-2 and covid-19: from the bench to the bedside. physiol rev [internet]. 2020 jun 4;100(4):1455–66. available from: https://doi.org/10.1152/ physrev.00020.2020. 6. hammons a, summers c, woodside j, mcnulty h, strain jj, young i, et al. folate/homocysteine phenotypes and mthfr 677c>t genotypes are associated with serum levels of monocyte chemoattractant protein-1. clin immunol. 2009 aug 1;133:132–7. 7. chen c-h, beard rs, bearden se. homocysteine impairs endothelial wound healing by activating metabotropic glutamate receptor 5. microcirculation [internet]. 2012 may;19(4):285–95. available from: https://pubmed.ncbi. nlm.nih.gov/22221504. 8. naser nh, alibeg aaa. exacerbation of covid 19 in hypertensive patients? a review? iraqi j pharm sci (p-issn 1683-3597, e-issn 2521-3512). 2021;30(2):23–30. 9. huang c, wang y, li x, ren l, zhao j, hu y, et al. clinical features of patients infected with 2019 novel coronavirus in wuhan, china. lancet [internet]. 2020 feb 15;395(10223):497–506. available from: https://doi.org/10.1016/ s0140-6736(20)30183-5. 10. chen n, zhou m, dong x, qu j, gong f, han y, et al. epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in wuhan, china: a descriptive study. lancet [internet]. 2020 feb 15;395(10223):507–13. available from: https://doi.org/10.1016/s01406736(20)30211-7. 11. alqubbanchi fb, al-hamadani fy. a pharmacoeconomics study for anticoagulants used for hospitalized covid-19 patients in al-najaf alashraf city–iraq (conference paper). iraqi j pharm sci (p-issn 1683-3597, e-issn 2521-3512). 2021;30(suppl.):48–59. 12. ahmad m. biomarkers in acute myocardial infarction. j clin exp cardiol. 2012 nov 10;3. 13. ruseva a. laboratory diagnosis of acute myocardial infarction. trakia j sci. 2005;3(1):8–14. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i3.1193 conflicts of interest none.  82 j contemp med sci | vol. 8, no. 1, january-february 2022: 82–85 country report cancer control and oncology care in iraq nada a s al alwan* national cancer research center, university of baghdad, baghdad, iraq. *correspondence to: nada a s al alwan (e-mail: nadalwan@yahoo.com) (submitted: 13 january 2022 – revised version received: 28 january 2022 – accepted: 08 february 2022 – published online: 26 february 2022) abstract this country report focuses on the cancer control and oncology services in iraq. this report displaying the approaches that are made to implement the elements of the national cancer control program including cancer registration, prevention, early detection, treatment, palliative care and research. issn 2413-0516 introduction based on projected population models, the global burden of cancer is set to increase by more than 60% in 2040; specifically in low-and-middle-income countries.1 it has been predicted that the highest incidence of cancer within the coming years will be registered in the eastern mediterranean region (emr) for reasons attributed to population growth, aging, lifestyle modification, urbanization and exposure to carcinogens.2 iraq is one of the economies with upper middle income and had the most robust health-care system in the middle east before 1990. the impact of consecutive wars, conflicts and political instability resulted in remarkable shortage in the medical recourses and requested funds with disruption of the relevant services including cancer care.3-5 currently, the government spends 6–7% of its gdp on the health sector, nevertheless, it provides free of charge services to all citizens. there are numerous cancer care hospitals and centers distributed all over the iraqi governorates. this study focuses on the cancer control and oncology services in iraq; displaying the approaches that are made to implement the elements of the national cancer control program including cancer registration, prevention, early detection, treatment, palliative care and research. cancer statistics in 2020, the world health organization estimated that there were 19.3 million new cancer cases and 10.0 million cancer deaths.1 the iraqi ministry of health (moh) established the iraqi cancer registry (icr) since 1974 in collaboration with the international agency for research on cancer (iarc). data is documented routinely through the population based icr by well-trained staff instructed on the can reg and icd-o (international classification of diseases for oncology) coding systems. the registered information on new cancer cases and deaths are pooled from public and private hospitals and laboratories in all governorates.6 the age-standardized incidence and mortality rates of cancer among the iraqi population are 134.9 and 84.7 respectively.7 the latest icr6 revealed that the total number of new cancer cases was 35,864 in 2019 with an incidence rate reaching 92/100,000 population (table 1). breast cancer was the most common among the iraqi population (19.8%) followed by bronchus and lung cancer (7.9%), colorectal (6.5%), brain/ cns (6.4%) and leukemia (5.5%). the leading three cancers among males originated from the bronchus and lung (12.9%), followed by the urinary bladder (8.5%) and colorectal (8.2%); while the top three among females were the breast (34.1%), thyroid gland (6.9%) and brain/cns cancers (5.9%). children malignancies constituted 5.4% of the total cases of cancer at all age groups; the most prevalent was leukemia (30.2% of total childhood cancers), brain/cns (20.7%) and non-hodgkin lymphoma (7.9%). on the other hand, the total number of cancer deaths in iraq was 10,957 forming a mortality rate equivalent to 28/100,000 population (figure 1). the main causes of related deaths were due to cancers of the bronchus and lung (16%), breast (11.3%) and leukemia (8.6%). cancer control the iraqi cancer board (icb) was established by the ministry of health (moh) in 1985 to deal with the burden of cancer through coordinating the relevant activities including cancer registration, prevention, early detection, treatment, palliative care and research. globally, it has been well recognized that national cancer control plans (nccp) are crucial to address and prioritize all cancer control programs in a given country. a nccp was developed for iraq8 following the recommendations of the who cancer control strategy.9,10 risk factors among the emr the prevalence of tobacco smoking exceeded 30% among men9 whereas tobacco-related cancer deaths have reached 18.4%.11 the population based “steps survey of non-communicable disease” risk factors showed that 38.0% of men and 1.9% of women were current smokers in iraq.12 the average monthly expenditure on cigarette smoking was (34,485) iraqi dinars, whereas the cost of 100 packs of manufactured cigarettes as a percentage of per capita gdp was 2.4%.12,13 the same survey disclosed that 33.5% of iraqi adult populations were obese, 65.4% were overweight and 47% experienced insufficient physical activity.12 relatively it has been reported that 50% of men and 35% of women in the emr were overweight or obese.14 the majority of iraqi adults males (97.8%) were life time alcohol abstainers; only 0.6% were current drinkers.12,15 prevention of cancer the world cancer declaration target report of the international union against cancer (uicc) showed that iraq mailto:nadalwan@yahoo.com 83j contemp med sci | vol. 8, no. 1, january-february 2022: 82–85 nada a s al alwan country report cancer control and oncology care in iraq has made significant advances in the field of prevention through adopting tobacco control legislation;16,17 prohibition of public availability of alcohol;12,15 promoting public mobilization campaigns on tobacco control and early detection of breast cancer,18-23 physical activity, healthy diet; anthropometric screening in schools;12,15 and step wise surveillance survey on non-communicable disease risk factors.12,16 early detection and screening in order to downstage breast cancer at the time of presentation and reduce its related morbidity and mortality, a national program for early detection of breast cancer was initiated by the iraqi moh in 2001 through establishing specialized centers and clinics for early detection of breast cancer at the governorate level.18-23 the ministry of higher education and scientific research (mohesr) supported by developing a national cancer research program in 2010 focusing on breast cancer and a national cancer research center (ncrc) in 2012.24 the ncrc launched several awareness campaigns chaired by community leaders and developed an online information system database on breast cancer under the supervision of who/iarc.18,19,23-26 though not common among iraqi women, opportunistic screening of cervical cancer was carried out sporadically on a low scale. it has been reported that 9.9% of women (aged 30-49 years) in iraq had a pap smear test at least once in their life time.12,27 meanwhile, there are ongoing plans to initiate screening for colorectal cancer in iraq. cancer diagnosis pathologically, iraq initiated a process of establishing accreditation for cancer laboratory diagnosis according to international standards under supervision of iaea, who and the royal college of pathologists through adopting good laboratory practice.28 the medical city teaching hospital (mcth) and other major tertiary centers in iraq organized a plan of action to upgrade the genetic test procedures in different fields. at the imaging level, there were 152 ct scans and 90 mri machines in 2019 constituting 3.9 and 2.3/100,000 iraqi populations respectively. pet/ct is functioning in mcth and in private oncology centers in baghdad, najaf and erbil. there are five gamma cameras in baghdad and gamma knife procedure is readily practiced in erbil.29 on the other hand, excluding baghdad and erbil, there is a limited access to nuclear medicine diagnostic facilities. treatment and oncology care the main registered causes of death among the population are ischemic heart disease, followed by cancer and cerebrovascular accidents.6,29 currently the government spends 6–7% of its gdp on the health sector; providing free of charge services to all citizens. specialized care is also presented by private hospitals, the costs of which are met out-of-pocket.5,30,31 excluding kurdistan region, there are about thirty-five public cancer care facilities, i.e., hospitals, centers, and units; distributed over the iraqi governorates (ten of which are in the capital); comprising approximately 2,000 beds. the largest public tertiary hospital in baghdad, the “medical city teaching complex” (mctc), includes four specialized cancer facilities. “zhianawa cancer table 1. distribution of the top registered leading cancers in iraq in 2019 new mortality casesnew cancer cases mr**%no.ir*%no.top ten cancers / allrank 3.1611.291,23718.1719.827,109breast1 4.4815.991,7527.247.902,832bronchus & lungs2 1.77 6.31 6915.956.492,328colorectal3 2.278.11 8895.836.372,283brain/cns4 2.428.639465.055.511,977leukemia5 0.321.141254.615.021,802thyroid6 1.184.22 4624.374.771,710urinary bladder7 1.093.88 4253.774.121,477non-hodgkin lymphoma8 0.230.83913.353.661,311skin9 1.743.133436.19***3.411,224prostate10 20.6673.798,08561.4767.0724,05324,053total top ten 7.3426.212,87230.1932.9311,81111,811total others 28.0010010,95791.6610035,86435,864grand total fig. 1 incidence and mortality rates per 100,000 populations of the top ten cancers in iraq (2019). 84 j contemp med sci | vol. 8, no. 1, january-february 2022: 82–85 cancer control and oncology care in iraq country report nada a s al alwan center” and “hiwa cancer hospital” were established in kurdistan. the latter is considered the second largest provider of public oncology care following “al-amal national cancer center” in baghdad.30,31 medical and radiation oncology oncology care is provided through specialized oncology and radiotherapy hospitals. clinical oncologists are licensed to perform chemotherapy and radiotherapy. it has been recorded that out of 11,585 specialized physicians in iraq there were 128 medical or radiation oncologists.31,32 excluding kurdistan, over 120 medical and radiation oncologists are officially registered at the present time in the iraqi moh; whereas 75 postgraduate medical students are completing their board-certified studies in oncology and radiotherapy. in addition, there are about 40 oncology physicians currently running the cancer care facilities in kurdistan. obviously the total number is still lower than that requested to reach the requested coverage rate according to the international recommendations on oncology consultant staffing.33 this shortage emphasizes the urgent need to invest in qualifying human resources in all aspects of cancer care.34 the moh imports cancer drugs and medical equipment through the “state company for marketing drugs and medical appliance” and distributes throughout all governorates.35 who developed its “model lists of essential medicines” to support countries in prioritizing their reimbursable medicine.36 in the past, many of the essential cancer drugs were not available; but the situation improved when the government increased the allocated budget to moh.4,33,35 progress in radiation oncology is proceeding in iraq through establishing specialized centers and rehabilitation of the staff. currently there are twenty-one mega voltage machines in iraq; six in baghdad.29,31 a high dose rate brachytherapy is functioning in zhinawa cancer center. the directory of radiotherapy centers of iaea has registered all public radiotherapy facilities within the iraqi governorates.37 the uicc declared that iraq has improved the free access to accurate diagnosis and multimodal treatment of cancer as almost 80% of the treatment protocols are covered and the waiting lists for radiotherapy have been significantly shortened.16 palliative care palliative care in the emr is impeded due to deficient national policies, inadequate financial resources, lack of trained staff and limited access to pain relieving drugs.38,39 during the past decade pain management units have been established in most tertiary hospitals in iraq. in cases of cancer, prescription of morphine and other opioids is the responsibility of the examining oncologists who refer patients to these clinics. a fellowship program in pain management has been initiated by the mohesr in 2016 for certified iraqi board specialists. cancer research in general, numerous research studies on the burden of cancer in iraq have been published by iraqi specialists in international peer reviewed journals, and are readily available online. emphasizing the role of research as one of the basic pillars in the adoption of a national cancer control strategy, a national breast cancer research program was established by the iraqi mohesr in 2009; from which stemmed the national cancer research center (ncrc) in 2012. an online information system data base for breast cancer patients was organized in coordination with the screening unit of iarc; which was later utilized to compare the demographic characteristics, clinicopathological presentations and management outcomes of breast cancer patients in the region through developing a “regional comparative breast cancer research project”.18,19,23,25-27 recently, a memorandum of understanding has been developed between the iraqi cancer board of moh and iarc. the objectives are to conduct high-quality evidence-based research in cancer prevention and control; focusing on registration, descriptive epidemiology, capacity building and biological material transfer. education and training the iraqi board for medical specialization grants certified board in oncology for postgraduate students. in general, the officially registered educational training programs belonging to the iraqi mohesr, moh and krg graduate hundreds of oncology specialists annually; thus yielding numerous studies on cancer care. that could assist in addressing the shortage of oncology physicians. many of the teaching hospitals in iraq are recognized training centers by the arab league council in various medical specialties.40 international collaborations in addition to the educational and training opportunities on cancer control offered through who and iarc, iaea signed a country program framework (cpf) with the republic of iraq in 2017 for the years (2018 2023). the cpf focused on building capacity of the health sector, particularly on nuclear medicine and radiotherapy. the core program includes provision of requested equipment and sponsoring training programs on quality assurance. the project involves collaboration with iaea/pact (program of action for cancer therapy) and who to implement the iraqi nccp. the capacity building program executed its first activities in 2017 through training iraqi pathology leaders in uk under supervision of the royal colleges.28 currently, who is assisting moh in the institutionalization of a national health account to support in the development of health care policy financing systems and social insurance through compiling relevant data on the country health expenditures.41 in 2020, who planned for a mission on cancer control in collaboration with iea/pact and iarc, to aid in implementing the nccp. acknowledgment the author would like to thank the iraqi cancer board, moh iraq and moh, krg for the assistance in providing the relevant information. conflict of interest the author declares no conflict of interest. funding none.  85j contemp med sci | vol. 8, no. 1, january-february 2022: 82–85 nada a s al alwan country report cancer control and oncology care in iraq references 1. sung h, ferley j, siegel rl et al. global cancer statistics 2020 (2021). globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. ca cancer j clin, 71:209–249. 2. pourghazian n, sankaranarayanan r, alhomoud s, slama s, (2019). strengthening the early detection of common cancers in the eastern mediterranean region. east mediterranean health journal, 25(11):767–768. 3. united nations, world bank, joint iraq needs assessment (2003). available at: http://siteresources.worldbank.org/irffi/resources/ joint+needs+assessment.pdf. accessed 26 dec 2021. 4. dfat country information report iraq, department of foreign affairs and trade, australian government, 2020. 5. country policy and information note. iraq: medical and healthcare issues, version 1.0, home office, uk, 2019. 6. annual report, iraqi cancer registry 2019. iraqi cancer board, ministry of health and environment, republic of iraq, 2021. 7. global cancer observatory: cancer today. globocan 2020. international agency for research in cancer, france. https://gco.iarc.fr/today/data/ factsheets/populations/368-iraq-fact-sheets.pdf. accessed 26 dec 2021. 8. iraqi national cancer control program five year plan (20102014), 2nd ed. iraqi cancer board, ministry of health, baghdad, iraq, 2010. 9. world health organization. strategy for cancer prevention and control in the eastern mediterranean region 2009—2013; who, office for the eastern mediterranean, 2010. 10. romero y, trapani d, johnson s, et al., (2018). national cancer control plans: a global analysis. the lancet oncology, 19 (10), e546-e555. https://doi. org/10.1016/s1470-2045(18)30681-8. accessed 22 oct 2021. 11. iraq country profile, who office, baghdad, iraq, 2017. https://www.who.int/ gho/countries/irq/country_profiles. accessed 24 dec 2021. 12. who steps survey, chronic disease risk factor surveillance, iraq 2015 / who regional office for the eastern mediterranean, 2015. 13. gyts global youth tobacco survey, fact sheet, iraq 2015 / who regional office for the eastern mediterranean and center for disease control and prevention, 2015. 14. amin j, siddiqui aa, al-oraibi s, et al., (2020). the potential and practice of telemedicine to empower patient-centered healthcare in saudi arabia. international medical journal, 27(2):151–154. 15. eastern mediterranean region: framework for health information systems and core indicators for monitoring health situation and health system performance 2018 / who regional office for the eastern mediterranean. 16. world cancer declaration progress report 2016, international union against cancer (uicc) 2017. 17. tobacco control laws, legislations by country, iraq, campaign for tobacco-free kids, 2020. https://www.tobaccocontrollaws.org/legislation/ country/iraq/summary. accessed 25 dec 2021. 18. alwan nas, kerr d, (2018). cancer control in war-torn iraq. the lancet oncology, 19(3):291–292. 19. alwan n, (2015). establishing guidelines for early detection of breast cancer in iraq. international journal of advanced research, 3(12):539-555. 20. alwan nas, tawfeeq fn, mallah n. demographic and clinical profiles of female patients diagnosed with breast cancer in iraq. journal of contemporary medical sciences, 2019;5(1):14–19. 21. alwan n, al-attar w, eliessa r, et al., (2012). knowledge, attitude and practice regarding breast cancer and breast self-examination among a sample of the educated population in iraq. eastern mediterranean health journal, who, eastern mediterranean regional office, 18(4):337–345. 22. von karsa l, qiao y, ramadas k, et al., (2014). prevention/screening implementation, in stewart bw and wild cp (eds): world cancer report 2014. who, international agency for research on cancer, lyon, france, 2014. 23. alwan n, (2014). iraqi initiative of a regional comparative breast cancer research project in the middle east. journal of cancer biology and research, 2(1):1016–1020. 24. the national cancer research center, university of baghdad, mohesr, iraq. http://www.bccru.baghdaduniv.edi.iq. accessed 27 dec 2021. 25. alwan nas (2016). breast cancer among iraqi women: preliminary findings from a regional comparative breast cancer research project. journal of global oncology, asco, 2(5):255–258. 26. alwan nas, kerr d, al-okati d, et al., (2018). comparative study on the clinicopathological profiles of breast cancer among iraqi and british patients. the open public health journal, 11:3-17. 27. alwan nas, al-attar wm, al mallah n, abdulla k, (2017). assessing the knowledge, attitude and practices towards cervical cancer screening among a sample of iraqi female population. iraqi journal of biotechnology, 16(2):38–47. 28. the royal college of pathologists (rcpath): international pathology day: a look back at the year with the international team, 2018, uk. https://www. rcpath.org/discover-pathology/news/international-pathology-day-a-lookback-the-year-with-the-international-team.html 29. annual statistical report 2019. planning directorate, ministry of health / environment, republic of iraq, 2019. https://moh.gov.iq/upload/upfile/ ar/1070.pdf. accessed 25 dec 2021. 30. skelton m, mula-hussain ly, namiq kf, (2017). oncology in iraq’s kurdish region: navigating cancer, war, and displacement. journal of global oncology, 4:1–4. 31. annual statistical report 2017. planning directorate, ministry of health / environment, republic of iraq, 2018. 32. mula-hussain l, alabedi h, al-alloosh f, alharganee a, (2019). cancer in war-torn countries: iraq as an example, in laher (ed.), handbook of healthcare in the arab world, springer, nature, cham, 1-14. https://doi.org/10.1007/978-3-319-74365-3_152-1. accessed 25 dec 2020. 33. the royal college of radiologists. scotland clinical oncology workforce census 2018 summery report. london: the royal college of radiologists 2019. https://www.rcr.ac.uk/system/files/publication/field_publication_ files/clinical-radiology-uk-workforce-census-report-2018.pdf . accessed 25 oct 2020. 34. mula-hussain l, al-ghazi m, (2020). cancer care in times of war: radiation oncology in iraq. int j radiat oncol biol phys, 108(3):523–529. 35. the state co. for marketing drugs and medical appliances, kimadia, ministry of health/environment, republic of iraq 2020. http://demo. kimadia.iq/en/article/view/8. accessed 24 dec 2021. 36. robertson h, barr r, shulman ln, forte gb, magrini n, (2016). essential medicines for cancer: who recommendations and national priorities. bulletin of the world health organization, 94:735–742. http://dx.doi. org/10.2471/blt.15.163998. 37. dirac (directory of radiotherapy centres), country: iraq. international atomic energy agency (iaea), vienna, austria 2020. available at: https://dirac.iaea.org/data/operator?country=irq. accessed 27 dec 2020. 38. lyons g, sankaranarayanan r, millar ab, slama s, (2020). scaling up cancer care in the who eastern mediterranean region. eastern mediterranean health journal, 4(1):104–110. https://doi.org/10.26719/2018.24.1.104. accessed 26 dec 2020. 39. fadhil i, lyons g, payne s, (2017). barriers to, and opportunities for, palliative care development in the eastern mediterranean region. the lancet oncology, 18(3):e176–e184. 40. mula-hussain l, shamsaldin an, al-ghazi m, et al., (2019). board-certified specialty training program in radiation oncology in a wartorn country: challenges, solutions and outcomes. clinical and translational radiation oncology, 19:46–51. 41. world health organization, regional office for the eastern mediterranean, iraq | programme areas | primary health care. http://www.emro.who.int/irq/programmes/primary-health-care.htm. accessed 27 dec 2021. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i1.1154 http://siteresources.worldbank.org/irffi/resources/joint+needs+assessment.pdf http://siteresources.worldbank.org/irffi/resources/joint+needs+assessment.pdf https://gco.iarc.fr/today/data/factsheets/populations/368-iraq-fact-sheets.pdf.%20%20%20accessed%2026%20dec%202021 https://gco.iarc.fr/today/data/factsheets/populations/368-iraq-fact-sheets.pdf.%20%20%20accessed%2026%20dec%202021 https://doi.org/10.1016/s1470-2045(18)30681-8 https://doi.org/10.1016/s1470-2045(18)30681-8 https://www.who.int/gho/countries/irq/country_profiles.%20%20accessed%2024%20dec%202021 https://www.who.int/gho/countries/irq/country_profiles.%20%20accessed%2024%20dec%202021 https://www.tobaccocontrollaws.org/legislation/country/iraq/summary https://www.tobaccocontrollaws.org/legislation/country/iraq/summary http://www.bccru.baghdaduniv.edi.iq https://www.rcpath.org/discover-pathology/news/international-pathology-day-a-look-back-the-year-with-the-international-team.html https://www.rcpath.org/discover-pathology/news/international-pathology-day-a-look-back-the-year-with-the-international-team.html https://www.rcpath.org/discover-pathology/news/international-pathology-day-a-look-back-the-year-with-the-international-team.html https://moh.gov.iq/upload/upfile/ar/1070.pdf. https://moh.gov.iq/upload/upfile/ar/1070.pdf. https://doi.org/10.1007/978-3-319-74365-3_152-1 https://www.rcr.ac.uk/system/files/publication/field_publication_files/clinical-radiology-uk-workforce-census-report-2018.pdf https://www.rcr.ac.uk/system/files/publication/field_publication_files/clinical-radiology-uk-workforce-census-report-2018.pdf http://demo.kimadia.iq/en/article/view/8 http://demo.kimadia.iq/en/article/view/8 http://dx.doi.org/10.2471/blt.15.163998 http://dx.doi.org/10.2471/blt.15.163998 https://dirac.iaea.org/data/operator?country=irq https://doi.org/10.26719/2018.24.1.104 http://www.emro.who.int/countries/irq/index.html http://www.emro.who.int/irq/programmes/ http://www.emro.who.int/irq/programmes/primary-health-care.htm 254 j contemp med sci | vol. 8, no. 4, july-august 2022: 254–258 original molecular analysis of carbapenem resistant genes in pseudomonas aeruginosa isolated from baghdad hospitals ali h. salih, adnan h. aubaid*, ghada b. ali department of medical microbiology, faculty of medicine, university of al-qadisiyah, al-qadisiyah, iraq. *correspondence to: adnan h. aubaid (e-mail: adnan.uobeed@qu.edu.iq) (submitted: 28 april 2022 – revised version received: 12 may 2022 – accepted: 26 may 2022 – published online: 26 august 2022) abstract objectives: this study aimed to molecular investigation of prevalence the carbapenem-resistant genes in p. aeruginosa in isolates collected from baghdad hospitals. methods: in a cross-sectional manner, p. aeruginosa were isolated and identified from patients who attended to hospital in baghdad city during the period of december 2021 to june 2022. genotypic characterization of 16srrna gene, plasmid profile, exoa gene, carbapenem resistance gene were tested. results: diagnosis of p. aeruginosa isolates was confirmed genotypically via the amplification of 16srrna gene with 1504 bp by using pcr amplification of genes encoding ambler class b mbl (blaimp, blavim, imi, blandm, blaspm-1, and blagim), and ambler class d carbapenemase (blaoxa-23, blaoxa-24, blaoxa-40, blaoxa-48, blaoxa-50, blaoxa-51 and blaoxa-58) were performed. the carbapenem resistant isolates were also evaluated for the presence of class d carbapenemase (blaoxa 50), genes by pcr. conclusion: this study proved that p. aeruginosa isolated had carbapenem-resistant genes that strongly correlated with antibiotic resistance according to phenotypic and genotypic characterization. keywords: carbapenems, pseudomonas aeruginosa, hospitals, iraq issn 2413-0516 introduction pseudomonas aeruginosa is a ubiquitous, gram-negative bacterium and versatile opportunistic pathogen, which is considered a significant reason for an ever-widening array of various life-threatening infections.1 over the past decades, the emergence and dissemination of p. aeruginosa and enterobacteriaceae, which are resistant to carbapenems, which are the broadest spectrum agents of the β-lactam group, has become apparent as an urgent threat to public health. the finding p. aeruginosa has intrinsic resistance to numerous antimicrobial agents and also easily acquires resistance to many antibiotics, including carbapenems resistance is an ominous development that challenges this last-resort antibiotic. unfortunately, carbapenems resistant p. aeruginosa has now emerged and is disseminating worldwide.2-3 resistance to carbapenems in p. aeruginosa can be mediated by several mechanisms, including mexab-oprm, ampc, decreased outer membrane permeability, up-regulation of the efflux pumps, hyper production of a chromosomal ampc-type cephalosporinases or the production of carbapenemases oprd.4 there is scarce information available on the distribution of mbls producing p. aeruginosa isolates in baghdad hospitals. therefore, immediate determination of carbapenemases and other mechanisms creating isolates is main to avoid the spread of p. aeruginosa inside and between hospitals and to correctly treat infections caused by this. the study aimed to identify the variations in phenotypic, genotypic characteristics and antibiotic resistance profile of pseudomonas aeruginosa isolated from inpatients in baghdad hospitals. additionally, the use of carbapenems has increased markedly during the past few years in baghdad city. the current study suspected that increased use of these antibiotics could cause the selection of isolates resistance to carbapenems. materials and methods isolation and identification of p. aeruginosa a total of 2000 clinical samples were collected from inpatients of many hospitals in baghdad city during the period from december 2020 to june 2021, which included: diabetic foot (50), otitis media (550), lower respiratory tract (150), urinary tract (725), wound (200), blood and burns (250). the clinical samples were transported to the laboratory without delay. all samples were cultivated, by using the standard loop of urine and sterile swabs of other samples, on the blood agar, macconkeys agar pseudomonas chromogenic agar, and cetrimide agar as selective media. p. aeruginosa and incubated overnight at 37°c for 18–24 hours. initial diagnosis of isolates was made on the basis of gram’s staining of culture, colonial morphology on different media, hemolysis on blood agar, pigment production, odor in cultures, size, edge, and oxidase test. suspected pseudomonas colonies were further identified to species level using routine biochemical tests and selective culture media.5 in addition to these tests, the p. aeruginosa isolates were also confirmed biochemically with the vitek-2 automated system and by 16srrna as a molecular method. oligonucleotide primer sequences used for pcr amplification 1. specific primer sequences of 16srrna gene were used to confirm the identification of p. aeruginosa by pcr according to jiang et al., 20066 provided by alpha dna company (canada) and prepared according to the instructions of the supplied company, as shown in table 1. 2. oligonucleotide primer for detection of carbapenem resistance genes in p. aeruginosa. these primers were provided by macrogen company from south korea are listed in table 2. 255j contemp med sci | vol. 8, no. 4, july-august 2022:254–258 a.h. salih et al. original molecular analysis of carbapenem resistant genes in pseudomonas aeruginosa isolated from baghdad hospitals pcr protocols for detection of carbapenem resistance genes pcr protocols for detection of carbapenem resistance genes. an oligonucleotide primer was prepared depending on the manufacturer’s instruction by dissolving the lyophilized sample with nuclease-free water after rotating down briefly. a working primer tube was prepared by diluting it with nuclease-free water. the final pico-moles depended on the procedure of each primer. the pcr tubes were placed into a thermocycler and the right pcr cycling program parameters conditions were installed as in table 3. pcr was used for detecting p. aeruginosa, the mixture of 25 μl consisted of 12.5 μl of gotaq hot star master mix (which contains taq dna polymerase, dntps, mgcl2, and reaction buffer at the optimal concentration for efficient amplification of dna templates by pcr), 5 μl dna template (20 ng.), 1 μl of each forward and reverse primer (10 pmol.) 5.5 μl of nuclease-free water to complete the amplification mixture volume. the pcr tubes containing the mixture were transferred to preheated thermo cycler under sterile condition. all requests, technical and preparations of agarose gel electrophoresis that were used for the detection of pcr products were done according to sambrook and russel.8 the pcr products separated in 1.5% agarose gels (after staining with 0.5 mg/ml ethidium bromide) were visualized using a gel ultraviolet transilluminator system. the positive results were distinguished when the pcr product base pairs were equal to the base pairs of the dna ladder. results and discussion according to the results of the present study, the overall count constitutes a total of 100/2000 samples, p. aeruginosa table 1. oligonucleotide primer sequences of 16srrna gene in p. aeruginosa used for confirmatory identification product sizereferenceprimer sequences (5’→3’)name of primer bp1504(jiang et al., 2006)6aga gtt tga tcm tgg ctc ag f16srrna cgg tta cct tgt tac gac ttr table 2. oligonucleotide primer for detection of carbapenem resistance genes in p. aeruginosa primer gene name sequence (5’→3’) product size genbank reference ndm bla-ndm f cagtcgcttccaacggtttg 529 bp mf379690.1 r atcacgatcatgctggcctt imp bla-imp f ctttcaggcagccaaaccac 371 bp design to this study r tggggcgttgttcctaaaca vim-1 bla-vim-1 f tccacgcactttcatgacga 503 bp design to this study r aagtcccgctccaacgattt gim blagim f agaaccttgaccgaacgcag 909 bp design to this study r gcaccagttttcccatacag oxa-48 blaoxa-48 f ttg gtg gca tcg att atc gg 744 bp design to this study r gag cac ttc ttt tgt gat ggc oxa-40 blaoxa-40 f cacctatggtaatgctcttgc 491 bp (woodford et al., 2006)7 r gtggagtaacacccattcc oxa-50 blaoxa-50 f aatccggcgctcatccatc 869 bp (woodford et al., 2006)7 r ggtcggcgactgaggcgg spm blaspm-1 f cctacaatctaacggcgacc 650 (woodford et al., 2006)7 r tcgccgtgtccaggtataac oxa58 bla oxa58 f aagtattggggcttgtgctg 599 (woodford et al., 2006)7 r cccctctgcgctctacatac oxa23 bla oxa23 f gatcggattggagaaccaga 501 (woodford et al., 2006)7 r atttctgaccgcatttccat oxa24 bla oxa24 f ggttagttggcccccttaaa 246 (woodford et al., 2006)7 r agttgagcgaaaaggggatt oxa 51 blaoxa 51 f taatgctttgatcggccttg 353 (woodford et al., 2006)7 r tggattgcacttcatcttgg imi blaimi f cca ttc acc cat cac aac 440 (woodford et al., 2006)7 r cta ccg cat aat cat ttg c 256 j contemp med sci | vol. 8, no. 4, july-august 2022: 254–258 molecular analysis of carbapenem resistant genes in pseudomonas aeruginosa isolated from baghdad hospitals original a.h. salih et al. table 3. programs of pcr thermocycling conditions for detection of carbapenem resistance genes genes temperature (c˚)/time cycle number initial denaturation cycling condition final extension denaturation annealing extension ndm 95°c/5 min 95°c/20 sec 56°c/30 sec 72°c/40 sec 72°c/5 min 35 imp 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 vim-1 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 gim 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 spm 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 oxa-48 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 oxa-40 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 oxa-50 95°c/5 min 95°c/20 sec 58°c/30 sec 72°c/40 sec 72°c/5 min 35 oxa-51 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 oxa-23 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 oxa-24 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 spm 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 imi 95°c/5 min 95°c/20 sec 50–60°c/30 sec 72–40°c/40 sec 72°c/5 min 35 representing (5%) of all the collected samples in this study. it’s well known that p. aeruginosa considers an important nosocomial pathogen in many medical centers throughout the world and a source of infections in any part of the body. also, this bacterium is able to cause infection in healthy individuals at a low rate and creates a serious public health disaster resulting in an enormous burden of morbidity, and mortality in both developing and developed countries.9 one of the reasons for the high pathogenicity of p. aeruginosa is the intrinsic high resistance to several antibiotics, as well as the development of multiple drug resistance.10 the results of amplification of 16srrna gene with dna extracted from one hundred p. aeruginosa isolates showed positive pcr product with amplicon size 1504 base pair (figure 1). these results agreed with alornaaouti11 who used the 16srrna gene which is considered one of the important gene to confirm the identification of p. aeruginosa and other bacterial species because have hyper constant sequencing and play a basic role in molecular identification and classification, also that can provide species-specific signature sequences useful for bacterial identification all type of bacteria.12 detection of class b (mbl) and class d carbapenemase the production of carbapenemases is of the utmost concern and became the mechanism of greater relevance towards carbapenem resistance due to the growing enzyme diversity. these enzymes have high versatility, as they are characterized by a very wide hydrolytic spectrum and affect almost all β-lactams, with the exception of monobactams.13 p. aeruginosa isolates producing carbapenemases are also associated with xdr phenotype. accordingly, the detection of carbapenemases production in p. aeruginosa is important not only for the adequate selection of antibiotic therapy but also for hospital epidemiology surveillance and infection control. in recent reports in najaf, the most common carbapenemases are the mbl and oxa variant enzymes of ambler class d.14-16 class b acquired mbl is one of the most important enzymes including imp, vim, spm, ndm, sim and gim, which expose huge-level of resistance against carbapenem.17–19 in this study, the pcr technique was used to identify the bla-imp, bla-vim, bla spm, bla-ndm, bla-sim and bla-gim genes only (figure 2), while the bla-aim, bla-khm, bla-dim and bla-fim genes was not included due to very few occurrences in adjacent nations to iraq. furthermore, as the present results revealed, two isolates carry the ndm encoding gene in addition to coexisting with the oxa-50 encoding gene. the co-harboring of two carbapenemase genes in p. aeruginosa isolates has been reported in several studies worldwide.19–21 this observation led to the emergence of a new drug resistant model for p. aeruginosa. however, this result is of great concern and has shed light on the fact that ndm producing xdr p. aeruginosa is now alarmingly on the increase in baghdad hospitals. although only three carbapenem-resistant p. aeruginosa isolates were identified to carry this gene in the present study, it is of concern as blandm producers may be disseminated rapidly in baghdad hospitals and this finding implies that fig. 1 agarose gel electrophoresis for 16srrna gene amplicons. 1% agarose (100 min at 100 volt/50 mamp). lane:1 (m 100 bp ladder) lane 1-10 local isolates, pcr product 1504 bp size. 257j contemp med sci | vol. 8, no. 4, july-august 2022:254–258 a.h. salih et al. original molecular analysis of carbapenem resistant genes in pseudomonas aeruginosa isolated from baghdad hospitals several new blandm cases will be found in the near future. consequently, the detection of five ndm-positive isolates in this study suggested possibilities of spread via its high rate of genetic transfer among pathogenic bacteria in baghdad hospitals, or possibilities to human factors such as hygiene and international tourists. it is believed that the emergence of blandm carried isolates in baghdad may have been a result of the introduction of ndm isolates via increasing medical tourism of iraqi patients to the indian subcontinent. at present, the prevalence of ndm-1 has increased significantly throughout the world and has been identified mostly in asia,19 europe, africa.20 therefore, the detection of ndm harboring p. aeruginosa isolates in this study indicates the immediate importance of the establishment of surveillance to prevent nosocomial infections and dissemination of ndm in baghdad hospitals.21-24 in the study of these genes blaspm, imp, vim1, gim, imi, oxa-48, oxa-40, oxa-58, oxa-23, oxa-24, and oxa51 were negative results (figure 3). in further studies conducted in najaf, 14 showed that two (5.9%) out of 34 carbapenem-resistant p. aeruginosa isolates were spm-type positive. interestingly, the present study showed that oxa-50 was the most frequent carbapenemase identified in xdr p. aeruginosa isolates (98.%). however, the occurring class-d oxacillinase oxa-50 was shown to be expressed constitutively in p. aeruginosa (figure 4). a similar enhancement in the prevalence of blaoxa-50 carrying p. aeruginosa isolates has been noticed earlier in a recent local study reported by rasool et al.,15 who found that the majority of the carbapenems resistant p. aeruginosa isolates carried the blaoxa-50 gene (53.8%). while al-janahi14 reported that only 8.8% of the carbapenem resistant p. aeruginosa isolated from najaf hospitals were harbored blaoxa-50. ethics consideration this study is in accordance with the ethics committee of al-diwaniaya teaching hospital, iraq. a verbal agreement was fig. 2 agarose gel electrophoresis for ndm gene amplicons. (1.5% agarose,100 min at 100 volt/50 mamp). lane:1 (m 1500 bp ladder) lane 4,11 and 28 local isolates, positive pcr product 528 base pair. fig. 3 agarose gel electrophoresis for oxa-50 gene amplicons. (1.5% agarose (100 min at 100 volt/50 mamp). lane:1 (m 1500 bp ladder) lane 1,2,3,4,5,6,7,8,10,11,12,13,14,15,17,18. positive pcr product 869 base pair, and 2 local isolates (9,16) negative oxa-50 gene. fig. 4 agarose gel electrophoresis for oxa-50 gene amplicons. (1.5% agarose, 100 min at 100 volt/50 mamp). lane:1 (m 1500 bp ladder) lane 4,17,4 and 2 local isolates, positive pcr product 869 base pair. obtained from participants in the study of the relative’s pretaking samples. conflict of interest no known conflict of interest correlated with this publication. funding this research did not receive any grant from agencies in the public, commercial, or not-for-profit sectors. availability of data and materials the data used and/ or analyzed throughout this study are available from the corresponding author on reasonable request.  references 1. rashid, a., akram, m., kayode, o.t. and kayode, a.a. (2020). clinical features and epidemiological patterns of infections by multidrug resistance staphylococcus aureus and pseudomonas aeruginosa in patients with burns. biomed. j. sci. tech. res. 25(4): 19272–19278. 2. jeong, s .j.; yoon, s. s.; bae, i. k.; jeong, s. h.; kim, j. m.; lee, k. (2014). risk factors for mortality in patients with bloodstream infections caused by cabapenem-resistant pseudomonas aeruginosa: clinical impact of bacterial virulence and strain on outcome. diagn microbiol infect dis; 80:130–135. 258 j contemp med sci | vol. 8, no. 4, july-august 2022: 254–258 molecular analysis of carbapenem resistant genes in pseudomonas aeruginosa isolated from baghdad hospitals original a.h. salih et al. 3. vural, e.; delialioglu, n.; ulger, s. t.; emekdas, g. and serin, m. s. (2020). phenotypic and molecular detection of the metallo-beta-lactamases in carbapenem-resistant pseudomonas aeruginosa isolates from clinical samples. jundishapur j. microbiol. 13(2): e90034. 10.5812/jjm.90034. 4. rostami, s.; sheikh, a. f.; shoja, s.; farahani, a.; tabatabaiefar, m. a.; jolodar, a. and sheikhi, r. (2018). investigating of four main carbapenem-resistance mechanisms in high-level carbapenem resistant pseudomonas aeruginosa isolated from burn patients. j. chin. med. ass., 81: 127–132. 5. collee, j.g. fraser, a.g.; marmion, b.p. et al. (1996). mackie and mccartney practical medical microbiology. 14th ed., churchill livingstone, new york, pp. 413–423. 6. jiang, h. dong, h. zhang, g. et al. (2006). microbial diversity in water and sediment of lake chaka, an athalassohaline lake in northwestern china. appl environmen microbiol., 72(6): 3832–3845. 7. woodford n., ellington m.j., coelho j.m., turton j.f., ward m.e., brown s., amyes s.g., livermore d.m. multiplex pcr for genes encoding prevalent oxa carbapenemases in acinetobacter spp. int. j. antimicrob. agents. 2006;27:351–353. doi: 10.1016/j.ijantimicag.2006.01.004. [pubmed] [crossref ] [google scholar]. 8. sambrook, j. and russel, d. w. (2001). molecular cloning: a laboratory manual. (3rd ed). cold spring harbor, usa. pp. 5–52. 9. strich jr, warner s, lai yl, et al. (2020). needs assessment for novel gramnegative antibiotics in us hospitals: a retrospective cohort study. lancet infect dis., 20(10): 1172–1181. 10. langendonk, r.f., neill, d.r. and fothergill, j.l. (2021). the building blocks of antimicrobial resistance in pseudomonas aeruginosa: implications for current resistance-breaking therapies. front. cell. infect. microbiol., 11 (april): 1–22. 11. alornaaouti, a. (2013). study of genotyping and virulence factors of pseudomonas aeruginosa. m.sc. thesis, college of education for pure science/ibn-al-haitham, university of baghdad. 12. brooks, g.f.; carroll, k.c.; butel, s.j. et al. (2013). jawetz, melnick, and adelbergs, medical microbiology. 26th ed. mcgraw-hill. united states. 13. botelho, j., grosso, f. and peixe, l. (2018). unravelling the genome of a pseudomonas aeruginosa isolate belonging to the high-risk clone st235 reveals an integrative conjugative element housing a blages-6 carbapenemase. j. antimicrob. chemother., 73: 77–83. 14. al-janahi, h.c. (2020). occurrence and molecular characterization of metallo-β-lactamase (mbl)-producing pseudomonas aeruginosa in najaf hospitals. m.sc. thesis. faculty of medicine. university of kufa. iraq. 15. rasool, a.a., almohana, a.m., alsehlawi, z.s., abed ali, i., al-faham, m. and al-sherees, h.a. (2021). molecular detection of carbapenems resistance genes in pseudomonas aeruginosa isolated from different hospitals in najaf, iraq. international journal of information research and review (ijirr), 8 (4): 7242–7247. 16. aubaid ah.; mahdi zh.; abd-alraoof ts and jabbar nm. (2020). detection of mec a, van a and van b genes of staphylococcus aureus isolated from patients in al-muthanna province hospitals. indian journal of forensic medicine & toxicology, 14(2):1002–1008. 17. dortet l, bernabeu s, gonzalez c, naas t. evaluation of the carbapenem detection set™ for the detection and characterization of carbapenemaseproducing enterobacteriaceae. diagn microbiol infect dis. 2018;91(3): 220–225. doi: 10.1016/j.diagmicrobio.2018.02.012. [pubmed] [crossref ] [google scholar]. 18. vatansevera, c., menekseb, s., dogana, o., gucera, l.s., ozera, b., ergonula, o. and cana, f. (2020). co-existence of oxa-48 and ndm-1 in colistin resistant pseudomonas aeruginosa st235. emerg. microb. infect., 9:152–154. 19. honda, n.h., aoki, k., kamisasanuki, t., matsuda, n., to, m. and matsushima, h. (2019). isolation of three distinct carbapenemaseproducing gram negative bacteria from a vietnamese medical tourist. j. infect. chemother., 25: 811–815. 20. yoon, e.j. and jeong, s.h. (2021). mobile carbapenemase genes in pseudomonas aeruginosa. fron. microbio., 12(2):614058. 21. mutar hm. and aubaid ah. (2021). molecular profile of meca, tst-1, hla, hlb, eta, etb, erma, and ermb virulence genes in staphylococcus aureus using rapd-pcr. annals of the romanian society for cell biology, 25(4): 3227–3238. 22. al-azawi, i.h.; al-hamadani, a.h.; and hasson, s.o. (2018). association between biofilm formation and susceptibility to antibiotics in staphylococcus lentus isolated from urinary catheterized patients. nano biomed. eng. 10(2):97–103. 23. hasson, s.o.; al-awady, m. and al-hamadani, a.h., et al. (2019). boosting antimicrobial activity of imipenem in combination with silver nanoparticles towards s. fonticola and pantoea sp. nano biomed. eng. 11(2):200–214. 24. hasson,s.o.; al-hamadani, a.h., and al-azawi, i.h. (2018). occurrence of biofilm formation in serratia fonticola and pantoea sp. isolates among urinary catheterized patients. nano biomed. eng. 10(3): 295–304. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i4.1257 111j contemp med sci | vol. 9, no. 2, march-april 2023: 111–115 original the impact of blood group phenotypes on covid-19 severity and mortality in duhok province: a prospective cross-sectional study fatima jaafar rasho1*, muayad aghali merza2 1department of medical laboratory sciences, college of health sciences, university of duhok, duhok, kurdistan region, iraq. 2department of internal medicine, azadi teaching hospital, college of medicine, university of duhok, duhok, kurdistan, iraq. *correspondence to: fatima jaafar rasho (e-mail: fatimajaafar2018@gmail.com) (submitted: 02 january 2023 – revised version received: 26 february 2023 – accepted: 25 march 2023 – published online: 26 april 2023) abstract objectives: this study aimed to determine the frequency of blood group types among covid-19 patients and to investigate its potential association with disease severity and patient outcomes. methods: this prospective cross-sectional study was conducted from february to july 2022 in three different healthcare facilities in the duhok region. all confirmed pcr confirmed covid-19 patients were classified into: mild, moderate, severe, and critical cases. information on demographic, clinical, and laboratory characteristics were collected using a standardized questionnaire. all patients were subjected to abo blood grouping. the statistical calculations were performed by jmp pro 14.3.0. a p value of < 0.05 was considered significant. results: the study comprised of 404 patients. the age range of the patients varied from 16 to 100 years with a male predominance (204, 50.5%). out of the total patients, 250 (61.88%) had mild-moderate course, while 154 (38.12%) had severe-critical course. the most frequent blood group was o (164, 41.58%), followed by blood group a (121, 29.95%). there was no significant difference in the distribution of the rh factor among the studied subjects (p = 0.426). there was a significant increase in disease severity and worse outcome with increasing age (p = <0.0001). considering blood group types, there were no significant differences between blood group types with covid-19 severity and patients’ outcome. conclusions: individuals with blood group o may have a higher risk of contracting covid-19. advanced age is a crucial predictor of disease severity and poor outcomes. there were no significant association between blood group types with covid-19 severity and patients’ outcome. however, further research is needed to confirm these findings and determine the underlying mechanisms behind any potential association between blood groups and covid-19 susceptibility, severity, and outcome. keywords: covid-19; severity, outcome, blood group issn 2413-0516 introduction coronavirus disease (covid-19), caused by novel coronavirus named severe acute respiratory syndrome coronavirus 2 (sars-cov-2), has rapidly spread around the world, leading to a global pandemic. the virus is transmitted primarily through respiratory droplets, but aerosol, direct contact with contaminated surfaces, and fecal–oral transmission were also reported during the covid-19 epidemic.1 as of april 12, 2023, the virus has infected over 750 million people and caused more than 6.5 million deaths worldwide.2 covid-19 has a broad range of clinical severity and often lacks specific symptoms. most patients experience mild or no symptoms and recover well, while a minority can develop severe-critical disease and potentially fatal complications, resulting in death.3 various risk factors have been implicated in the susceptibility, severity and mortality in patients with covid-19 infections, for e.g. gender, age, and comorbid diseases.4 however, other factors such as environment, hormones, and blood group phenotypes have suggested to play an important role too.5 there is conflicting evidence regarding the link between blood group typing and susceptibility to covid-19, as well as its outcomes.6 numerous studies have reported that individuals of any blood group are susceptible to contracting sars-cov-2 infection, without any particular preference for a specific blood group.7 however, other investigators found that individuals with certain blood group phenotypes may be more or less susceptible to the disease.8 a study form china found that patients with blood group a had a higher risk of covid-19 infection and developing severe disease, while blood group o had a lower risk.5 another study from usa found that blood group b and ab were more likely to acquire the virus so did those with rh positive blood type, while blood group o was less likely.9 the exact mechanism behind this association is not clear yet, but some investigators have suggested that blood group antigens may interact with the sars-cov-2 virus in a way that affects the severity of the disease.5 these factors may play an important role in the pathogenesis of covid-19 and subsequently developing a treatment. while several studies have investigated demographic, clinical, and laboratory characteristics of covid-19 in duhok province,10,11 the relationship between abo typing and covid-19 infection has not been explored yet. therefore, the objective of this study was to determine the frequency of blood group types among covid-19 patients and to investigate its potential association with disease severity and patient outcomes. patients and methods setting the study was conducted in three different healthcare facilities in the duhok region. the first facility was the duhok covid-19 hospital, which includes 50 ward beds and 20 icu beds and focuses on severe, critical, and complicated cases. the second facility was lalav infectious diseases hospital, a 100-bed hospital that mainly manages moderate to severe cases. the third facility was the zakho covid-19 center, mailto:fatimajaafar2018@gmail.com 112 j contemp med sci | vol. 9, no. 2, march-april 2023: 111–115 the impact of blood group phenotypes on covid-19 severity and mortality in duhok province original f.j. rasho et al. located in zakho emergency hospital, which consists of 48 beds and primarily manages moderate to severe cases. more severe cases are referred to the duhok covid-19 hospital. study design and patients this study is a prospective cross-sectional investigation conducted in the duhok province, kurdistan region, iraq, from february to july 2022. all pcr confirmed covid-19 patients who agreed to participate in the study were included, while those who were diagnosed based on laboratory tests other than pcr or radiological images were excluded. enrolled patients provided informed consent, and information on demographic, clinical, and laboratory characteristics were collected using a standardized questionnaire. the ethical committee of the directorate general of health (dgoh) in duhok, iraqi kurdistan approved the study (reference number: 1342022-2-12). classification of disease severity covid-19 patients were classified in accordance to national institutes of health covid-19 treatment guidelines3 (1) mild type: patients who have any of the various signs and symptoms of covid-19 (e.g., fever, cough, sore throat, malaise, headache, muscle pain, nausea, vomiting, diarrhea, loss of taste and smell). on the other hand, dyspnea or abnormal chest imaging should not be present. (2) moderate type: individuals who show evidence of lower respiratory disease during clinical assessment or imaging and who have an oxygen saturation (spo2) ≥94% on room air at sea level. (3) severe type: individuals who have spo2 <94% on room air at sea level, a ratio of arterial partial pressure of oxygen to fraction of inspired oxygen (pao2/fio2) <300 mm hg, a respiratory rate >30 breaths/min, or lung infiltrates >50%. (4) critical type: individuals who have respiratory failure, septic shock, and/or multiple organ dysfunction. laboratory investigations covid-19 diagnosis was conducted using real-time polymerase chain reaction (rt-pcr) on the upper respiratory tract specimens of all patients. additionally, blood samples were collected from each patient and analyzed using the standard abo blood typing method, as previously described.12 statistical analysis the demographic characteristics of the covid-19 patients were presented in mean and sta. deviation or number and percentage. the associations of demographic characteristics and blood groups with disease severity and patients’ outcomes were examined in pearson chi-squared tests. the null hypothesis was rejected in a p-value <0.05. the statistical calculations were performed by jmp pro 14.3.0 (https://www.jmp.com/ en_us/home.html). results the demographic, clinical and blood group characteristics of the covid-19 is demonstrated in table 1. the study comprised of 404 patients. the age range of the patients varied from 16 to 100 years, with a male predominance (50.5%). out of the total patients, 250 (61.88%) had mild-moderate course, while 154 (38.12%) had severe-critical course (table 1). table 2 presents the frequency distribution of abo blood grouping among covid-19 patients. among the 404 patients, the highest frequency was observed in blood group o, with 168 individuals (41.58%), followed by blood group a, with 121 table 1. demographic, clinical and blood group characteristics of the covid-19 patients characteristics (n = 404) statistics numbers percentages age (16–100 yrs) mean: 48.54 sd: 19.67 age category (16–100 yrs) 16–19 5 1.24 20–29 71 17.57 30–39 83 20.55 40–49 61 15.1 50–59 66 16.34 60–69 48 11.88 70–79 32 7.92 80–89 27 6.68 90–100 11 2.72 gender male 204 50.5 female 200 49.5 disease severity mild-moderate 250 61.88 severe-critical 154 38.12 patient outcome recovered 369 91.34 dead 35 8.66 blood group a– 3 0.74 a+ 118 29.21 ab– 1 0.25 ab+ 22 5.45 b– 6 1.49 b+ 86 21.29 o– 11 2.72 o+ 157 38.86 table 2. prevalence of abo blood groups and rh susceptibility with covid-19 blood group total no. (%) rh– rh+ p value a 121 (29.95) 3 (2.48) 118 (97.52) b 92 (22.77) 6 (6.52) 86 (93.48) 0.426 o 168 (41.58) 11 (6.55) 157 (93.45) ab 23 (5.69) 1 (4.35) 22 (95.65) total 404 (100) 21 (5.2) 383 (94.8) https://www.jmp.com/en_us/home.html https://www.jmp.com/en_us/home.html 113j contemp med sci | vol. 9, no. 2, march-april 2023: 111–115 f.j. rasho et al. original the impact of blood group phenotypes on covid-19 severity and mortality in duhok province individuals (29.95%). on the other hand, blood group ab patients were the least prevalent, accounting for only 5.69% of the cases. the chi-square test showed that there was no significant difference in the distribution of the rh factor among the studied subjects (p = 0.426). table 3 presents the association between blood groups with disease severity and patient outcomes among covid-19 patients. the table highlights a significant increase in disease severity and worse outcome with increasing age. considering blood group types, there were no significant differences between blood group types with covid-19 severity and patients’ outcome. table 4 provides comparison between each specific blood group in relation to severity and outcomes of covid-19. for blood group a, b, ab, and o, 64.46%, 63.04%, 69.57%, and 58.33% were classified as mild-moderate disease, respectively. rh-positive patients had 62.14% mild-moderate disease, while rh-negative patients had 57.14 mild-moderate disease. the data presented in table indicates no statistically significant differences between abo blood groups in terms of covid-19 severity and outcome, with p-value >0.05 discussion the distribution of abo blood typing among covid-19 patients has been a topic of interest for investigators due to its table 3. association between blood types and covid-19 severity and patient outcomes characteristics (n = 404) disease severity p-value* patient outcome p-value*mild-moderate (n = 250) severe-critical (n = 154) recovered (n = 269) dead (n = 35) age category (16–100 yrs) 16–19 4 (80.00) 1 (20.00) <0.0001 5 (100) 0 (0.00) <0.0001 20–29 66 (92.96) 5 (7.04) 71 (100) 0 (0.00) 30–39 66 (79.52) 17 (20.48) 83 (100) 0 (0.00) 40–49 43 (70.49) 18 (29.51) 61 (100) 0 (0.00) 50–59 44 (66.67) 22 (33.33) 61 (92.42) 5 (7.58) 60–69 16 (33.33) 32 (66.67) 38 (79.17) 10 (20.83) 70–79 9 (28.13) 23 (71.88) 24 (75.00) 8 (25.00) 80–89 2 (7.41) 25 (92.59) 22 (81.48) 5 (18.52) 90–100 0 (0.00) 11 (100.00) 4 (36.36) 7 (63.64) gender male 124 (60.78) 80 (39.22) 0.6466 185 (90.69) 19 (9.31) 0.6388 female 126 (63.00) 74 (37.00) 184 (92.00) 16 (8.00) blood group a– 3 (100) 0 (0.00) 0.4941 3 (100) 0 (0.00) 0.7954 a+ 75 (63.56) 43 (36.44) 104 (88.14) 14 (11.86) ab– 1 (100.00) 0 (0.00) 1 (100) 0 (0.00) ab+ 15 (68.18) 7 (31.82) 20 (90.91) 2 (9.09) b– 2 (33.33) 4 (66.67) 6 (100) 0 (0.00) b+ 56 (65.12) 30 (34.88) 80 (93.02) 6 (6.98) o– 6 (54.55) 5 (45.45) 11 (100) 0 (0.00) o+ 92 (58.60) 65 (41.40) 144 (91.72) 13 (8.28) * two-sided p value potential implications in covid-19 susceptibility, severity, and mortality. in our study, blood type o was found to be the most prevalent, followed by blood type a. this finding was consistent with a research conducted in sulaimaniyah, iraq, where the frequencies of abo types followed the pattern of o>a>b>ab and rh positive > rh negative.13 the outcome of our study contradicts another study in iraq , which identified blood group a as the most prevalent.14 however, a neighboring country, saudi arabia, reported results consistent with our study, indicating that blood type o (62.4%) was the most common blood group among covid-19 patients, followed by blood type a (25.2%).15 another study conducted in the usa reported that the prevalence of covid-19 was higher in patients with type o blood (45.5%) compared to those with a blood (34.2%).9 this finding was also observed in studies conducted in china5 and pakistan,7 where blood group o was found most frequent type. the finding in our study suggests that individuals with blood group o may have higher risk of contracting covid-19. however, it is important to note that this finding did not provide evidence of a causal relationship between blood groups and covid-19 susceptibility. on contrary, other literatures reported that individuals with blood group a had a higher risk of covid-19 infection, while individuals with blood group o had a lower risk of infection.9,16,17 however, we believe that 114 j contemp med sci | vol. 9, no. 2, march-april 2023: 111–115 the impact of blood group phenotypes on covid-19 severity and mortality in duhok province original f.j. rasho et al. the higher prevalence of covid-19 in blood type o in the present study can be explained by the fact that blood type o is more common in our regional population.18 in general, further prospective research with case control are warranted to better understand the association between blood group types and covid-19 susceptibility. considering risk factors associated with disease severity and mortality, we found that increasing age was associated with disease severity and worse outcome in covid-19 patients. several researchers documented this finding.10,19,20 this is because older individuals have impaired immunity, reduced production of t cells in the thymus, and an increased prevalence of comorbid diseases such as diabetes mellitus, and hypertension. these factors decrease the ability of the immune system to respond to pathogens, making older individuals more susceptible to severe illness from covid-19.19 it is interesting to note that the present study did not find gender to be a significant predictor of severity or mortality in covid-19 patients, which contrasts with the findings of our previous report where female gender was identified as a predictor of disease severity.10 other literatures described male gender as risk factor for severe covid-19.4,21 it is important to keep in mind that the findings of individual studies can vary and are subject to various factors such as sample size, study design, and population characteristics. further research may be necessary to better understand the relationship between gender and covid-19 severity and mortality. this study investigated the potential correlation between the abo blood group system and covid-19 severity and outcomes. however, our data did not indicate any significant association between any of the blood groups with the severity and outcome of covid-19, which contrasts previous study conducted in sulaimaniyah, iraqi kurdistan.13 in agreement to our findings, ishaq et al. reported no significant association between abo groups and infection severity or associated death in a retrospective cohort study of 1067 covid-19 patients.7 several other studies have also reported similar findings. for e.g., a large, multi-institutional, retrospective review found no association between abo blood type and covid-19 severity and death.9 likewise, studies from turkey demonstrated that blood groups did not have significant predictive effects on covid-19 severity and mortality,8,17 and there was no significant difference in the frequency of severe covid-19 infection among abo blood types.22 many studies conducted in countries such as kuwait,23 lebanon,24 china,25 italy,26 the usa,6,9 and france27 have also reported results that were in line with our findings. however, some studies have reported different findings regarding the association between blood types and covid-19 severity and outcomes. for example, a study in china found that blood group a patients had a higher risk of severity, while blood group o patients had a lower risk.28 another study in india found that blood group o patients had decreased mortality, while blood group b patients had increased mortality.29 yet another study in spain found that blood group a patients had a higher mortality risk, while group o patients had a lower mortality risk.16 further study from the usa suggested that individuals with blood group a and ab had a higher risk of severe disease and mortality than those with blood group o or b.30 nonetheless, limited data is available on the association between blood groups and covid-19 severity and outcomes, and further research is needed to fully understand the potential association between blood groups and covid-19 severity and mortality. this study has several limitations. first, we did not include a control group to determine the exact susceptibility of table 4. association of disease severity and patients’ outcomes among patients with different blood groups blood group disease severity p-value* patient outcome p-value*mild-moderate (n = 250) severe-critical (n = 154) recovered (n = 269) dead (n = 35) group a a 78 (64.46) 43 (35.54) 0.4848 107 (88.43) 14 (11.57) 0.1744 non-a 172 (60.78) 111 (39.22) 262 (92.58) 21 (7.42) group b b 58 (63.04) 34 (36.96) 0.7939 86 (93.48) 6 (6.52) 0.406 non-b 192 (61.54) 120 (38.46) 283 (90.71) 29 (9.29) group ab ab 16 (69.57) 7 (30.43) 0.4346 21 (91.30) 2 (8.70) 0.9955 non-ab 234 (61.42) 147 (38.58) 348 (91.34) 33 (8.66) group o o 98 (58.33) 70 (41.67) 0.2154 214 (90.68) 22 (9.32) 0.577 non-o 152 (64.41) 84 (35.59) 155 (92.26) 13 (7.74) rh rh– 12 (57.14) 9 (42.86) 0.6461 21 (100) 0 (0.00) 0.2391 rh+ 238 (62.14) 145 (37.86) 348 (90.86) 35 (9.14) *pearson chi-squared tests were performed for statistical analyses. 115j contemp med sci | vol. 9, no. 2, march-april 2023: 111–115 f.j. rasho et al. original the impact of blood group phenotypes on covid-19 severity and mortality in duhok province individuals with different blood types to covid-19; second, small sample size; third, observational study that did not prove causation. in conclusion, individuals with blood group o may have a higher risk of contracting covid-19. advanced age is a crucial predictor of disease severity and poor outcomes. there were no significant association between blood group types with covid-19 severity and patients’ outcomes. however, further research is needed to confirm these findings and determine the underlying mechanisms behind any potential association between blood groups and covid-19 susceptibility, severity, and outcome. acknowledgments our heartfelt appreciation goes out to ibrahim korshid from the laboratory department of the zakho directorate of health and zakya ageed from the zakho corona center for their invaluable assistance in facilitating the completion of this study. we would also like to extend our gratitude to all the patients who generously agreed to participate in this study. conflict of interest the authors declare that there is no conflict of interest.  this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v9i2.1333 references 1. harrison, a.g., t. lin, and p. wang, mechanisms of sars-cov-2 transmission and pathogenesis. trends in immunology, 2020. 41(12): p. 1100–1115. 2. world health organization. who coronavirus (covid-19) dashboard. available from: https://covid19.who.int/. 3. national institute of health. covid-19 treatment guidelines panel. coronavirus disease 2019 (covid-19) treatment guidelines. 2022; available from: https://www.covid19treatmentguidelines.nih.gov/. 4. zhang, j., et al., risk factors for disease severity, unimprovement, and mortality in covid-19 patients in wuhan, china. clinical microbiology and infection, 2020. 26(6): p. 767–772. 5. zhao, j., et al., relationship between the abo blood group and the coronavirus disease 2019 (covid-19) susceptibility. clinical infectious diseases, 2021. 73(2): p. 328–331. 6. anderson, j.l., et al., association of sociodemographic factors and blood group type with risk of covid-19 in a us population. jama network open, 2021. 4(4): p. e217429–e217429. 7. ishaq, u., et al., association of abo blood group with covid-19 severity, acute phase reactants and mortality. plos one, 2021. 16(12): p. e0261432. 8. göker, h., et al., the effects of blood group types on the risk of covid-19 infection and its clinical outcome. turkish journal of medical sciences, 2020. 50(4): p. 679–683. 9. latz, c.a., et al., blood type and outcomes in patients with covid-19. annals of hematology, 2020. 99: p. 2113–2118. 10. merza, m.a., et al., clinical and epidemiological characteristics and outcomes of coronavirus disease-19 patients in a large longitudinal study. international journal of health sciences, 2021. 15(4): p. 29. 11. merza, m.a., et al., covid-19 outbreak in iraqi kurdistan: the first report characterizing epidemiological, clinical, laboratory, and radiological findings of the disease. diabetes & metabolic syndrome: clinical research & reviews, 2020. 14(4): p. 547–554. 12. mujahid, a. and f.l. dickert, blood group typing: from classical strategies to the application of synthetic antibodies generated by molecular imprinting. sensors, 2015. 16(1): p. 51. 13. omer, n., et al., the correlation between the covid-19 infection severity and abo blood groups in sulaimaniyah city, iraq. 2021. 14. ad’hiah, a.h., et al., association between abo blood groups and susceptibility to covid-19: profile of age and gender in iraqi patients. egyptian journal of medical human genetics, 2020. 21(1): p. 1–10. 15. badedi, m., et al., clinical characteristics and abo blood groups in covid-19 patients, saudi arabia. medicine, 2021. 100(30). 16. muñiz-diaz, e., et al., relationship between the abo blood group and covid-19 susceptibility, severity and mortality in two cohorts of patients. blood transfusion, 2021. 19(1): p. 54. 17. solmaz, i̇. and s. araç, abo blood groups in covid‐19 patients; cross‐ sectional study. international journal of clinical practice, 2021. 75(4): p. e13927. 18. jaff, m.s., abo and rhesus blood group distribution in kurds. journal of blood medicine, 2010: p. 143–146. 19. guan, w.-j., et al., clinical characteristics of coronavirus disease 2019 in china. new england journal of medicine, 2020. 382(18): p. 1708–1720. 20. palaiodimos, l., et al., severe obesity, increasing age and male sex are independently associated with worse in-hospital outcomes, and higher inhospital mortality, in a cohort of patients with covid-19 in the bronx, new york. metabolism, 2020. 108: p. 154262. 21. onder, g., g. rezza, and s. brusaferro, case-fatality rate and characteristics of patients dying in relation to covid-19 in italy. jama, 2020. 323(18): p. 1775–1776. 22. boudin, l., et al., abo blood groups are not associated with the risk of acquiring sars-cov-2 infection in young adults. haematologica, 2020. 105(12): p. 2841. 23. al‐youha, s.a., et al., the impact of abo blood groups on clinical outcomes and susceptibility to covid‐19: a retrospective study in an unselected population. transfusion, 2021. 61(5): p. 1631–1641. 24. khalil, a., r. feghali, and m. hassoun, the lebanese covid-19 cohort; a challenge for the abo blood group system. frontiers in medicine, 2020: p. 813. 25. dai, x., abo blood group predisposes to covid-19 severity and cardiovascular diseases. european journal of preventive cardiology, 2020. 27(13): p. 1436–1437. 26. negro, p., et al., role of abo blood system in covid‐19: findings from a southern italian study. transfusion medicine, 2022. 32(3): p. 243–247. 27. kim, y., et al. relationship between blood type and outcomes following covid-19 infection. in seminars in vascular surgery. 2021. elsevier. 28. li, j., et al., association between abo blood groups and risk of sars‐cov‐2 pneumonia. british journal of haematology, 2020. 190(1): p. 24. 29. padhi, s., et al., abo blood group system is associated with covid-19 mortality: an epidemiological investigation in the indian population. transfusion clinique et biologique, 2020. 27(4): p. 253–258. 30. zietz, m., j. zucker, and n.p. tatonetti, associations between blood type and covid-19 infection, intubation, and death. nature communications, 2020. 11(1): p. 5761. http://www.covid19treatmentguidelines.nih.gov/ 28 j contemp med sci | vol. 2, no. 5, winter 2016: 28–32 research background stroke is one of the leading causes of death globally. awareness of stroke modifiable risk factors and warning signs are important for stroke prevention. objectives to assess hypertensive patients’ knowledge regarding lifestyle risk factors and warning signs of stroke. method a descriptive study was conducted on 114 hypertension patients who attended chronic disease center in sulaimani city. the study was carried out for the period of february to april 2015. a questionnaire has been used to collect relative data about patients’ characteristics and knowledge regarding lifestyle risk factors and warning signs of stroke. data were analysed through spss 20, and descriptive statistics (frequency, percentage and mean) and inferential statistics (f-test and t-test), the figure of p > 0.05 was considered as the statistical significant. result patients’ knowledge regarding stroke lifestyle risk factors and stroke warning signs were low of 55.3 and 76.3% respectively. physical inactivity has lower (17.5) percentage among lifestyle risk factors. the patients’ knowledge was influenced by patients’ age, gender, education levels and duration of hypertension (p > 0.05). conclusions hypertensive patients complained from lack of knowledge regarding stroke lifestyle risk factors and warning signs. physical inactivity was less identified risk factors. young, female, high level of education and longer duration of disease tended to have higher knowledge. recommendations our study results recommended that there was a need to bring high risk group awareness about stroke risk factors and warning signs, particularly to the population with hypertension. keywords hypertensive, knowledge, lifestyle, warning signs, stroke assessment of hypertensive patients’ knowledge about lifestyle risk factors and warning signs of stroke muhammad rashid amena issn 2413-0516 aphd, chn, rehabilitation nursing, head of adult nursing branch, college of nursing, faculty of medical science, university of sulaimani, sulaimani, iraq. correspondence to muhammad rashid amen (email: muhammad.amen@univsul.edu.iq). (submitted: 21 december 2015 – revised version received: 28 january 2016 – accepted: 7 february 2016 – published online: 26 march 2016) introduction stroke is one of the leading causes of death globally and is a major cause of disability worldwide.1 stroke is a preventable and treatable disease through the control of modifiable risk factors and the early recognition of stroke warning symptoms respectively.2 according to the third national mortality retrospective sampling survey in iraq, stroke disease has become the 2nd leading cause of death in iraq and is responsible for 11.3% of all deaths.3 the percentage of stroke among individuals in the kurdish population is around 19%, especially among hypertensive and older aged patients.4 in kurdistan region, more than half (58.8%) of the hypertensive patients were uncontrolled. the factors associated with uncontrolled hypertension were smoking, lack of exercise and irregularity of treatment.5 a known modifiable risk factors of stroke include physiological and lifestyle risks.6 importantly, modifiable risk factors linked to lifestyle, such as smoking, physical inactivity, obesity, unhealthy diet and high alcohol consumption, were among the most prevalent unfavourable behavioural patterns may promotes the development of well-documented physiological risk factors such as arterial hypertension, diabetes mellitus, or hyperlipidemia, and ultimately lead to atherosclerosis and ischemic stroke.7 people with hypertension are at increased risk for experiencing a stroke; effective stroke prevention programme should be focused to improve the high risk group awareness about the early warning symptoms of stroke and modifiable risk factors.8 hence, there was a need to study the knowledge and level of awareness among the high risk group such as hypertensive regarding warning signs, and modifiable risk factors to prevent occurrence or at least detect it early.9 another important component of successful stroke prevention is improvement of public knowledge about stroke.10 in addition lack of knowledge may lead to unhealthy lifestyle behaviours, which are a major problem because healthy lifestyle behaviours are associated with a lower risk of stroke. therefore, it is important to learn more about stroke knowledge and health behaviours among hypertensive patients.11 objectives of the study the aims of this study were: • to assess the level of hypertensive patients’ knowledge regarding the influence of life style risk (low physical activity, unhealthy diet, obesity, smoking and alcohol intake) and stroke warning signs. • to find out association between knowledge and patients characteristics such as age, gender, level of education, financial status, bmi and duration of hypertension. materials and methods with the use of a descriptive design, 114 hypertensive patients were recruited from chronic diseases center in sulaimani city (is the only center in sulaimani city which provide medications for patients with chronic disease free). the study was carried out for the period of february to april 2015. the exclusion criteria were patients with history of stroke; health care professional and unwilling to participate in the study. the patients were informed that participation is voluntary. they were also informed of the confidentiality of their participation. before administering the questionnaire, researcher mailto:muhammad.amen@univsul.edu.iq 29j contemp med sci | vol. 2, no. 5, winter 2016: 28–32 research assessment of hypertensive patients’ knowledge about strokemuhammad rashid amen stressed to patients that participation or lack of participation in the study would not influence care (medications) received. the study used purposive (non-probability) sampling technique to select sample. the data were collected during the patients’ visit to the center in order to receive medications. the study was approved by ethics committee in college of nursing, university of sulaimani. the stroke knowledge instrument used in our study was a questionnaire, which was prepared after a comprehensive research of relevant literatures and references,1,6–8,10–18 pretested and modified in terms of questions clarity and cultural adaptation by experts. the questionnaire was administered to ten hypertensive patients for evaluating test retest reliability. questionnaire consisted of three sections. the first section included eight items to provide information about the demographic and clinical characteristics of the respondents (age, gender, level of education, financial status, bmi, duration of hypertension, smoking, and alcohol intake). second section included five items to determine the knowledge regarding lifestyle risk factors (physical inactivity, obesity, unhealthy diet, smoking, and unhealthy use of alcohol). the third section included five items to determine the knowledge with regard stroke warning signs. the questionnaire was used close-ended questions to assess patient knowledge in 2nd and 3rd sections, with a ‘yes’ response indicating that the patient is knowledgeable and ‘no’ is not knowledgeable. one point was given for each ‘yes’ answer and zero for each ‘no’ answer. knowledge scores were categorised for each section as follows: low knowledge identify (≤2) risk factors or warning symptoms, moderate knowledge (3) and high knowledge (≥4).14 data analysis the data were analysed with spss 20. socio-demographic, clinical characteristics and level of knowledge were analysed using frequencies and percentage. patients’ stroke prevention knowledge (which includes stroke lifestyle risk factors and warning signs) were analysed using percentage of means. f-test and t-test were used to explore the relationship between stroke prevention knowledge and patients’ characteristics and the figure of p > 0.05 was considered as the statistical significant. results a total of 130 hypertensive patients were proposed to be included in the study, 114 patients were eligible and agreed to participate, giving a response rate of 87.7%. table 1 shows the demographic and some clinical characteristics of the study participants. participants’ mean age was (58.4 ± 14.2) years, the age more than 77% was between 45 and 65 years. of the respondents, 58.8% were male, 45.7% had low education (illiterate or primary school), and 43% with self reported insufficient financial status. most of the patients were insufficient or barely sufficient financially and had received a low or moderate level of education. the mean bmi of the study population was 28.6 ± 5.1 kg/m2. the percentage of normal body weight was 20.2; while 36.8% were found to be obese and remaining were overweight according to their calculated bmi. approximately more than half 50.9% of participant indicated that they smoked and 8.8% reported that they drink alcohol. regarding duration of their hypertension, 43% of them had it for less than 1 year, 31.6% was between 1 and 3 years and other one-fourth were more than 3 years. the main finding of present study presented in figs. 1, 2 show respondents’ knowledge about lifestyle risk factors and stroke warning signs. the patients’ knowledge about lifestyle stroke risk factors was low knowledge for 53.5%, moderate knowledge for 36% and only 10.5% of participant had high knowledge. knowledge regarding stroke warning signs was lower, it was low knowledge for 75.4%, moderate knowledge for 20.2% and high knowledge for 4.4%. lifestyle risk factors and stroke warning signs are shown in table 2. the mean of knowledge for the total stroke life risk table 1. socio-demographic and clinical characteristics of study characteristics frequency % age groups <45 years 6 5.3 45–65 years 88 77.2 >65 years 20 17.5 mean ± std 58.4 ± 14.2 gender female 47 41.2 male 67 58.8 levels of education high 20 17.5 medium 42 36.8 low 52 45.7 smoking no 56 49.1 yes 58 50.9 total 114 100 body mass index normal 23 20.2 over-weight 49 43.0 obese 42 36.8 mean ± std 28.6 ± 5.1 financial status sufficient 28 24.6 barely sufficient 37 32.5 insufficient 49 43.0 duration of disease/year <1 49 43.0 1–3 36 31.6 >3 29 25.4 alcohol intake no 104 91.2 yes 10 8.8 total 114 100 30 j contemp med sci | vol. 2, no. 5, winter 2016: 28–32 assessment of hypertensive patients’ knowledge about stroke research muhammad rashid amen the identified stroke warning signs by the participant in present study were lower than identified lifestyle risk factors, 34.2% did not recognised any warning sign, 22.7% identified one warning sign, two signs were identified by 17.5%, followed three signs by 20.2%, four warning signs were recognised by 4.4% only, and no participants had knowledge to recognise all warning signs as illustrated by in fig. 4. table 3 shows the results of the association of participants’ characteristics with stroke risk factors and stroke warning signs. there were significant association between age, gender and education with knowledge regarding stroke risk factors and warning signs, younger patients, female and more educated had more correct answer, while the duration of disease was associated to risk factors, but not to warning signs knowledge (p < 0.05). association was not found between financial status and bmi with any kind of knowledge (p > 0.05). discussion identification of the major lifestyle risk factors of stroke and its warning signs have a direct implication for the prevention of stroke with the possible therapeutic measures in high risk group such as hypertensive patients. this descriptive study found that hypertensive patients lacked stroke prevention knowledge which includes stroke lifestyle risk factors and factors was 36.3 ± 22.7 (low knowledge). of patients, 17.5% only identified physical inactivity as stroke risk factors, followed by obesity and smoking and tobacco use was 39.5%, excessive alcohol intake came third was 42.1%, and unhealthy diet had greatest percentage among lifestyle stroke risk factor was 43%. the mean knowledge for total stroke warning signs was 27.3 ± 26.3 it was low knowledge. the most common stroke warning signs indicated by participants were ‘sudden numbness or weakness of the face, arm, or leg’ 29.8%, followed by ‘sudden confusion, trouble speaking or understanding others’ 28.9%, then ‘severe headache with no known cause’ 23.7%, ‘sudden trouble seeing in one or both eyes’ 22.8% and ‘sudden dizziness, trouble walking, loss of balance or coordination’ 20.2%. more than 25% of participants did not identified any stroke lifestyle risk factor, 17.5% recognise one risk factors, (18.4%) identified two risk factors followed by (28.07%) identified three risks, 9.7% identified four risks and all risks were identified by <1%, as showed in fig. 3. fig. 1 percentage of knowledge levels regarding stroke lifestyle risk factors. fig. 2 percentage of knowledge levels regarding stroke warning signs. fig. 3 number and percentage of identified stroke lifestyle risk factors. fig. 4 number and percentage of identified stroke warning signs. 31j contemp med sci | vol. 2, no. 5, winter 2016: 28–32 research assessment of hypertensive patients’ knowledge about strokemuhammad rashid amen warning signs. more than half of the respondents had low knowledge; more than one-fourth were not aware of any established lifestyle stroke risk factors. about one-ten (10.5%) of subjects had high knowledge and were aware of four risk factors and more; the percentage of participants who identified all lifestyle risk factors was less than one. the respondents’ knowledge regarding established stroke risk factors was better than that for the warning signs of stroke, more than three-quarter of participants’ knowledge were low in identifying stroke warning signs, and more than one-third were unable to identify any warning signs. few (4.4%) of them had high knowledge or were able to list four warning signs. our finding was lower than pakistani study result which reported 86.9% of the participants correctly stated at least one of stroke risk factors, 70.2% knew at least two and 53% knew at least three. furthermore it was lower than the reported by an australia study, 76.2% respondents correctly listed ≤1 established stroke risk factor, but only 49.8% respondents correctly listed ≤1 warning sign.16 ‘unhealthy diet’ was the most common and physical inactivity was less common identified risk factors of stroke in this study. it is of interest that only few 17.5% of respondents identified ‘physical inactivity’ as a risk factor for stroke. a very worrisome finding in the current study was the respondents’ low knowledge of some stroke risk factors like physical inactivity and stroke warning signs. this may reflect that the health care professional focused on diet, stopping alcohol intake, smoking cession and reduce weight, while they ignored role of physical activity in controlling hypertension, and preventing stroke. this result agreed with the finding of a china study which reported most of the participants knew that hypertensive patients should eat foods that are low in sodium, quit smoking, and reduce alcohol consumption.11 the commonest stroke warning sign recognised by the patients were ‘confusion or trouble speaking or understanding others’ 34%, followed by ‘numbness or weakness of the face, arm, or leg’ 33%, and ‘severe headache with no known cause’ 27%. these figures were similar to finding of kuwaiti study, which reported the ‘confusion, problem in speaking and understanding’ 36.4% followed by ‘weakness of arm and leg’ 34.7% as a most warning sign identified. the most common warning sign identified by the people in pakistani study was weakness of one or both sides of the face or body 71.4% followed by numbness of one or both sides of the face or body 60.6%.15 while an iranian study considered smoking as the most identified lifestyle risk factor, and most common warning sign as a pain.17 furthermore the most identified risk was smoking and ‘blurred and double vision or loss of vision in an eye’ was most established warning signs in an australian study,16 and 62% of participants in study conducted in india described paralysis of one side of the body as the most common warning signs of stroke.19 we found a positive relationship between stroke prevention knowledge and patients’ characteristics indicating that the table 3. association between stroke risk factors, warning signs knowledge with respondents’ characteristics characteristics risk factors knowledge warning signs knowledge mean std mean std age groups/year <45 73.3 20.7 56.7 19.7 45–65 33.6 26.2 25 23.3 >65 37 29.2 29 28.7 f (p-value) 4.3 (0.007) 3.2 (0.026) gender female 40.6 27.6 30.8 27.3 male 30.2 26.9 22.6 21.5 t-test (p-value) 2.08 (0.045) 1.97 (0.049) level of education high 54 22.6 48 26.3 medium 44.8 26.1 41 19.2 low 22.7 24.4 8.5 13.3 f (p-value) 10.4 (0.0001) 34.8 (0.0001) financial status sufficient 40.7 25.2 30 23.4 barely sufficient 34.6 25.7 23.8 27.4 insufficient 35.1 30.7 28.6 24.8 f (p-value) 0.33 (0.8) 0.39 (0.76) body mass index normal 41.7 23.3 27.8 28.1 overweight 35.1 28.7 29 24.9 obese 34.8 29 25.2 24.6 f (p-value) 0.39 (0.76) 0.17 (0.92) duration of hypertension/year <1 year 28.6 25.8 22.9 24.2 1–3 years 37.2 27.5 28.3 25.9 >3 years 48.3 27.5 33.8 25.7 f (p-value) 3.35 (0.022) 1.19 (0.32) table 2. frequencies and percentage of participants’ positive responses to stroke risk factors and warning signs categories frequency % lifestyle stork risk factors physical inactivity 20 17.5 obesity 45 39.5 unhealthy diet 49 43 smoking and tobacco use 45 39.5 excessive intake of alcohol 48 42.1 total (mean ± std) 36.3 ± 22.7 stroke warning signs sudden confusion, trouble speaking or understanding others 33 28.9 sudden numbness or weakness of the face, arm, or leg 34 29.8 sudden dizziness, trouble walking, loss of balance or coordination 23 20.2 severe headache with no known cause 27 23.7 sudden trouble seeing in one or both eyes 26 22.8 total (mean ± std) 27.3 ± 26.3 32 j contemp med sci | vol. 2, no. 5, winter 2016: 28–32 assessment of hypertensive patients’ knowledge about stroke research muhammad rashid amen young, female, higher educated and longer duration of hypertension had better knowledge regarding stroke lifestyle risk factors and warning signs, while the knowledge not influenced neither by financial status nor bmi. low level of education and old age may lead to limited interaction with society and therefore to less interest in following medical developments, and thereby resulting in a low level of health care knowledge about stroke. previously, better stroke knowledge was observed in women compared with men in the majority of the studies although there is a general lack of knowledge in both genders. four out of 18 studies reported better risk factor knowledge and eight out of 15 studies reported better knowledge in stroke warning signs in women compared with men. women tended to know more evidence-based stroke risk factors than men.1 these findings are consistent with previous studies; pakistani study found strong association between intermediate and-above level of education and younger age group with their correct identification of stroke risk factors. same findings reported by other study conducted in india.19 furthermore iranian study reported that knowledge and attitude towards stroke were significantly associated with age and level of education. other study stated that one in five respondents were not aware of any stroke risk factors, and almost one in three was not aware of any stroke warning signs. stroke knowledge was poorest among groups that have the highest risk of stroke.17 the results of our study have contributed to the understanding of strokes’ lifestyle risk factor and stroke warning signs in at-risk individuals. the current findings and mentioned previous studies conducted in several countries may signify that the lack of awareness about stroke among the general public and high risk groups is a worldwide problem. one implication of our results was the importance of increasing public awareness about stroke and stroke prevention, particularly in the at-risk population. these findings have significant implications for clinical practice. it was important for nurses to pay more attention to patients’ knowledge concerning physical activity and stroke warning signs, so that they can assist patients to gain knowledge and engage in behaviours that could help patients prevent stroke. conclusions depending on our findings we concluded that knowledge regarding lifestyle risk factors and warning signs was low among hypertensive patient. majority of participants were unable to identify more than a single risk factor and recognise more than one stroke warning sign. physical inactivity was less identified risk factor and recognisation of warning signs was below one third. been young, female, high educated and long duration of hypertension possess more knowledge, while financial status and bmi had no effect on patients’ knowledge. recommendations the present findings emphasise the need for effective stroke education efforts in particular regarding physical inactivity and stroke warning signs. we believed that the use of public media and school education will probably change the level of the population’s knowledge towards stroke. male hypertensive patients and those with a lower education level need targeted stroke education. considerable emphasis should therefore be placed on improving stroke risk perception among hypertensive patients.  references 1. stroebele n, müller-riemenschneider f, nolte ch, müller-nordhorn j, bockelbrink a, willich sn. knowledge of risk factors, and warning signs of stroke: a systematic review from a gender perspective. int j stroke. 2011;6(1): 60–6. doi: 10.1111/j.1747-4949.2010.00540.x pmid: 21205242 2. alzawahmah m. assessment of stroke knowledge and attitudes among riyadh medical students: a cross-sectional study. neurology. 2015;84(14):p2.303. 3. who 2014. world bank and united nation for population. the top 10 causes of death. who 2014 updates. 4. al-shimmery ek, amein sh, al-tawil ng. prevalence of silent stroke in kurdistan, iraq. neurosciences (riyadh). 2010;15(3):167–71. pmid: 20831024 5. bushra b kh, kameran hi. uncontrolled hypertension in a group of hypertensive patients in erbil. j kufa f nurs sci. 2013;3(2). 6. aycock m, kirkendoll d, coleman c, clark c, albright c, alexandrov w. family history of stroke among african americans and its association with risk factors, knowledge, perceptions, and exercise. j cardiovas nurs. 2015;30(2):p e1–e6. doi: 10.1097/jcn.0000000000000125 pmid: 24598552 7. von s, jukka p, ulrike g, beate g, ulf s, sami c et al.; investigators. lifestyle risk factors for ischemic stroke and transient ischemic attack in young adults in the stroke in young patients study. stroke. 2013;44:119–125. doi: 10.1161/strokeaha.112.665190 pmid: 23150649 8. yadav pk, shewta s, kumar vk, joshua a, krishnan s, kumar sp. survey of knowledge and awareness about cerebro-vascular stroke, its risk factors, warning signs and immediate treatment among mangalore urban population: a cross-sectional study. int j health rehabil sci. 2013;2(2):116–122. 9. mansour a. prevalence and control of hypertension in iraqi diabetic patients: a prospective cohort study. open cardiovasc med j. 2012;6:68–71. doi: 10.2174/1874192401206010068 pmid: 22654998 10. chiuve se, rexrode km, spiegelman d, logroscino g, manson je, rimm eb. primary prevention of stroke by healthy lifestyle. circulation. 2008;118(9):947–954. doi: 10.1161/circulationaha.108.781062 pmid: 18697819 11. wan lh, zhao j, zhang xp, deng sf, li l, he sz, et al. stroke prevention knowledge and pre-stroke health behaviors among hypertensive stroke patients in mainland china. j cardiovasc nurs. 2014;29(2):e1–9. doi: 10.1097/jcn.0b013e31827f0ab5 pmid: 23388703 12. zeng y, he gp, yi gh, huang yj, zhang qh, he ll. knowledge of stroke warning signs and risk factors among patients with previous stroke or tia in china; j clin nurs. 2012;21(19–20):2886–95. doi: 10.1111/j.13652702.2012.04118.x pmid: 22985321 13. sloma a, backlund lg, strender le, skånér y. knowledge of stroke risk factors among primary care patients with previous stroke or tia: a questionnaire study. bmc family practice. 2010;11:47. doi: 10.1186/14712296-11-47 pmid: 20550690 14. awad a, al-nafisi h. public knowledge of cardiovascular disease and its risk factors in kuwait: a cross-sectional survey. bmc public health. 2014;14:1131. doi: 10.1186/1471–2458-14–1131 pmid: 25367768 15. aly z, abbas k, kazim sf, taj f, aziz f, irfan a, et al. awareness of stroke risk factors, signs and treatment in a pakistani population. j pak med assoc. 2009;59(7):495–99. pmid: 19579747 16. sug ys, heller rf, levi c, wiggers j, fitzgerald pe. knowledge of stroke risk factors, warning symptoms, and treatment among an australian urban population. stroke. 2001;32:1926–1930. pmid: 11486127 17. borhani ha, karimi aa, amiri a, ghaffarpasand f. knowledge and attitude towards stroke risk factors, warning symptoms and treatment in an iranian population. med princ pract. 2010;19:468–472. doi: 10.1159/000320306 pmid: 20881415 18. reeves mj, hogan jg, rafferty ap. knowledge of stroke risk factors and warning signs among michigan adults. neurology. 2002;59(10):1547–1552. pmid: 12451195 19. pandian jd, kalra g, jaison a, deepak ss, shamsher s, singh y, et al. knowledge of stroke among stroke patients and their relatives in northwest india. neurol india. 2006;54(2):152–156. pmid: 16804258 http://www.ncbi.nlm.nih.gov/pubmed/?term=stroebele%20n%5bauthor%5d&cauthor=true&cauthor_uid=21205242 http://www.ncbi.nlm.nih.gov/pubmed/?term=m%c3%bcller-riemenschneider%20f%5bauthor%5d&cauthor=true&cauthor_uid=21205242 http://www.ncbi.nlm.nih.gov/pubmed/?term=nolte%20ch%5bauthor%5d&cauthor=true&cauthor_uid=21205242 http://www.ncbi.nlm.nih.gov/pubmed/?term=m%c3%bcller-nordhorn%20j%5bauthor%5d&cauthor=true&cauthor_uid=21205242 http://www.ncbi.nlm.nih.gov/pubmed/?term=bockelbrink%20a%5bauthor%5d&cauthor=true&cauthor_uid=21205242 http://www.ncbi.nlm.nih.gov/pubmed/?term=willich%20sn%5bauthor%5d&cauthor=true&cauthor_uid=21205242 http://www.ncbi.nlm.nih.gov/pubmed/21205242 http://www.ncbi.nlm.nih.gov/pubmed/?term=al-shimmery%20ek%5bauthor%5d&cauthor=true&cauthor_uid=20831024 http://www.ncbi.nlm.nih.gov/pubmed/?term=amein%20sh%5bauthor%5d&cauthor=true&cauthor_uid=20831024 http://www.ncbi.nlm.nih.gov/pubmed/?term=al-tawil%20ng%5bauthor%5d&cauthor=true&cauthor_uid=20831024 http://www.scopemed.org/?jid=20 http://www.scopemed.org/?jid=20&iid=2013-2-2.000 http://www.ncbi.nlm.nih.gov/pubmed/?term=mansour%20aa%5bauth%5d http://dx.doi.org/10.2174%2f1874192401206010068 http://www.ncbi.nlm.nih.gov/pubmed/?term=logroscino%20g%5bauthor%5d&cauthor=true&cauthor_uid=18697819 http://www.ncbi.nlm.nih.gov/pubmed/?term=manson%20je%5bauthor%5d&cauthor=true&cauthor_uid=18697819 http://www.ncbi.nlm.nih.gov/pubmed/?term=rimm%20eb%5bauthor%5d&cauthor=true&cauthor_uid=18697819 http://www.ncbi.nlm.nih.gov/pubmed/?term=wan%20lh%5bauthor%5d&cauthor=true&cauthor_uid=23388703 http://www.ncbi.nlm.nih.gov/pubmed/?term=zhao%20j%5bauthor%5d&cauthor=true&cauthor_uid=23388703 http://www.ncbi.nlm.nih.gov/pubmed/?term=zhang%20xp%5bauthor%5d&cauthor=true&cauthor_uid=23388703 http://www.ncbi.nlm.nih.gov/pubmed/?term=deng%20sf%5bauthor%5d&cauthor=true&cauthor_uid=23388703 http://www.ncbi.nlm.nih.gov/pubmed/?term=li%20l%5bauthor%5d&cauthor=true&cauthor_uid=23388703 http://www.ncbi.nlm.nih.gov/pubmed/?term=he%20sz%5bauthor%5d&cauthor=true&cauthor_uid=23388703 http://www.ncbi.nlm.nih.gov/pubmed/?term=zeng%20y%5bauthor%5d&cauthor=true&cauthor_uid=22985321 http://www.ncbi.nlm.nih.gov/pubmed/?term=he%20gp%5bauthor%5d&cauthor=true&cauthor_uid=22985321 http://www.ncbi.nlm.nih.gov/pubmed/?term=yi%20gh%5bauthor%5d&cauthor=true&cauthor_uid=22985321 http://www.ncbi.nlm.nih.gov/pubmed/?term=huang%20yj%5bauthor%5d&cauthor=true&cauthor_uid=22985321 http://www.ncbi.nlm.nih.gov/pubmed/?term=zhang%20qh%5bauthor%5d&cauthor=true&cauthor_uid=22985321 http://www.ncbi.nlm.nih.gov/pubmed/?term=he%20ll%5bauthor%5d&cauthor=true&cauthor_uid=22985321 http://www.ncbi.nlm.nih.gov/pubmed/22985321 http://www.ncbi.nlm.nih.gov/pubmed/?term=sloma%20a%5bauthor%5d&cauthor=true&cauthor_uid=20550690 http://www.ncbi.nlm.nih.gov/pubmed/?term=backlund%20lg%5bauthor%5d&cauthor=true&cauthor_uid=20550690 http://www.ncbi.nlm.nih.gov/pubmed/?term=strender%20le%5bauthor%5d&cauthor=true&cauthor_uid=20550690 http://www.ncbi.nlm.nih.gov/pubmed/?term=sk%c3%a5n%c3%a9r%20y%5bauthor%5d&cauthor=true&cauthor_uid=20550690 http://www.ncbi.nlm.nih.gov/pubmed/?term=aly%20z%5bauthor%5d&cauthor=true&cauthor_uid=19579747 http://www.ncbi.nlm.nih.gov/pubmed/?term=abbas%20k%5bauthor%5d&cauthor=true&cauthor_uid=19579747 http://www.ncbi.nlm.nih.gov/pubmed/?term=kazim%20sf%5bauthor%5d&cauthor=true&cauthor_uid=19579747 http://www.ncbi.nlm.nih.gov/pubmed/?term=taj%20f%5bauthor%5d&cauthor=true&cauthor_uid=19579747 http://www.ncbi.nlm.nih.gov/pubmed/?term=aziz%20f%5bauthor%5d&cauthor=true&cauthor_uid=19579747 http://www.ncbi.nlm.nih.gov/pubmed/?term=irfan%20a%5bauthor%5d&cauthor=true&cauthor_uid=19579747 http://www.ncbi.nlm.nih.gov/pubmed/?term=sug%20yoon%20s%5bauthor%5d&cauthor=true&cauthor_uid=11486127 http://www.ncbi.nlm.nih.gov/pubmed/?term=heller%20rf%5bauthor%5d&cauthor=true&cauthor_uid=11486127 http://www.ncbi.nlm.nih.gov/pubmed/?term=levi%20c%5bauthor%5d&cauthor=true&cauthor_uid=11486127 http://www.ncbi.nlm.nih.gov/pubmed/?term=wiggers%20j%5bauthor%5d&cauthor=true&cauthor_uid=11486127 http://www.ncbi.nlm.nih.gov/pubmed/?term=fitzgerald%20pe%5bauthor%5d&cauthor=true&cauthor_uid=11486127 http://www.ncbi.nlm.nih.gov/pubmed/?term=borhani%20haghighi%20a%5bauthor%5d&cauthor=true&cauthor_uid=20881415 http://www.ncbi.nlm.nih.gov/pubmed/?term=karimi%20aa%5bauthor%5d&cauthor=true&cauthor_uid=20881415 http://www.ncbi.nlm.nih.gov/pubmed/?term=amiri%20a%5bauthor%5d&cauthor=true&cauthor_uid=20881415 http://www.ncbi.nlm.nih.gov/pubmed/?term=ghaffarpasand%20f%5bauthor%5d&cauthor=true&cauthor_uid=20881415 http://www.ncbi.nlm.nih.gov/pubmed/?term=pandian%20jd%5bauthor%5d&cauthor=true&cauthor_uid=16804258 http://www.ncbi.nlm.nih.gov/pubmed/?term=kalra%20g%5bauthor%5d&cauthor=true&cauthor_uid=16804258 http://www.ncbi.nlm.nih.gov/pubmed/?term=jaison%20a%5bauthor%5d&cauthor=true&cauthor_uid=16804258 http://www.ncbi.nlm.nih.gov/pubmed/?term=deepak%20ss%5bauthor%5d&cauthor=true&cauthor_uid=16804258 http://www.ncbi.nlm.nih.gov/pubmed/?term=shamsher%20s%5bauthor%5d&cauthor=true&cauthor_uid=16804258 http://www.ncbi.nlm.nih.gov/pubmed/?term=singh%20y%5bauthor%5d&cauthor=true&cauthor_uid=16804258 207j contemp med sci | vol. 8, no. 3, may-june 2022: 207–212 original association between variant alleles of the x-ray cross complementing gene (xrcc1) with benzo[a]pyrene levels in iraqi workers alaa. r. omrain1, estabraq a.r. al-wasiti1,*, mohammed jassim hamzah2 1department of chemistry and biochemistry, college of medicine, university of al-nahrain, baghdad, iraq. 2college of pharmacy, university of al-nahrain, baghdad, iraq. *correspondence to: estabraq a.r. al-wasiti (e-mail: estabraqalwasiti@nahrainuniv.edu.iq) abstract objectives: assessment of a single nucleotide polymorphism of the xrcc1 (codon arg399gln) gene and its association with levels of benzo[a]pyrene in blood of car repairers and control group. methods: the current study included (111) participants, (37) of the iraqi car repairers, (37) sellers of spare part, and (37) healthy (control), with the same age range. benzo[a]pyrene was determined by using hplc technique. alleles frequency of single nucleotide polymorphisms of xrcc1 gene was determined by restriction fragment length polymorphisms (pcr-rflp). results: the results of current study indicated that there is a highly significant increase of b[a]p level (p = 0.0001) in the repairers group compared to the groups of spare part sellers and control together. the genotype frequencies studies of xrcc1 gene of car repairers group and controls. the effect of rs25487 genotypes on exposure to pahs include higher levels of pahs and pah-dna adduct in tt genotype followed by ct genotype and cc showed lower levels. conclusion: as results of prolonged exposure to the higher levels of pahs that iraqi car repairs suffer from, they have high levels b[a]p. especially those who have the tt genotypes, as results of the inefficiency of their dna repair system. compared to the other genotypes. keywords: polycyclic aromatic hydrocarbons (pahs), b[a]p, xrcc1 gene, car repairers, spar part seller issn 2413-0516 introduction polycyclic aromatic hydrocarbons (pahs) are a large group of aromatic organic compounds comprising two or more fused benzene rings, the main sources of these global pollutants are industrial processes and incomplete combustion of organic materials, its produced as complex mixture contain more than a hundred compounds.1 among all the compounds, b[a]p is considered a representative of all pahs compounds, and it is often applied in many studies as a positive control in biological assays for other pahs individuals.2,3 also benzo[a]pyrene, among all individuals of the pahs, represent one of the global studied pollutants and its found in car exhaust fumes. numerous studies have confirmed that its a potent immunosuppressive, proinflammatory and carcinogenic agent.3,4 fuel-powered cars and machines are protable sources that emit pahs and thus increasing pollution in areas. auto repairers are a group of the population are exposed to pahs emitted from car exhaust on a daily basis, the main routes exposure to pahs via inhalation or skin contact. this group have a high chance of exposure to pahs, because they are in direct contact with fume emitted by cars containing pahs, in addition to other reasons related to the personal hygiene and wear occupational safety equipments during work.4-6 garage workers are exposed to complex mixture of pahs, because of their occupation, also automobile mechanics are at an increased risk skin, lung, urinary tract cancer.7 several recent studies indicate that car repair shops are considered as anthropological sources of pahs and heavy metals in some cities of the world.8 generally, the carcinogencity of pahs espically b[a]p is begins after phase i biotransformation by inducible p450 superfamily (cyp1). and later the reactive speices like (benzo[a]pyrene-7,8-diol-9,10-epoxides) (bpde) are formed and mediated by the cyp2e1. the interaction between environmental and genetics factors play an effective role in the development of most cancers in humans.6 bulky pahs-dna adducts are repaired by two pathways, the first is base excision repair pathway (ber) and second is single strand breaks (ssb), where the x-ray repair cross-complementing gene (xrcc1) is implicated in both pathways, and it is play vitol role in the base excision repair pathway (ber).8 protein xrcc1 acts as a scaffolding protein in ber, via interaction with the adp-ribose polymerase, dna polymerase β, and dna ligase iii.14 a polymorphism of the xrcc1 gene at codon results from substitution of amino acidarginine in the place of glutamine, resulting in an ineffective repair pathway.9 we conducted the present study to investigate the relationship between pahs exposure in car repaires, and dna repairing gene (xrcc1) polymorphisms in detecting workers at risk. especially, the reports on occupational exposure and related health risks are almost non-existent, and this reflects paucity of availability of survey data and criteria for estimating whether unsafe exposure has occurred. subjects, materials and methods the current cross-sectional study included 111 male volunteers with age range (25–45 years). volunteers were divided according to their exposure to vehicle exhaust emissions into three groups: (i) (no. = 37) car repairers (as highly exposed group), (no. = 37) spare part sellers, and (iii) (no. = 37) non-exposed volunteers. all exposed subjects were matched in age, smoking status with unexposed group. five ml of venous blood sample was taken from each volunteers and divided into two tubes: a. one ml was placed into disposable edta containing tubes and stored at –20oc until it was used in the genotyping study after dna extraction. quantity and quality of extracted dna was determined by nano-drop, uk, using the scanning power of the diode assembly, within the wavelength 200–320 nm. the quantity and quality of mailto:estabraqalwasiti@nahrainuniv.edu.iq 208 j contemp med sci | vol. 8, no. 3, may-june 2022: 207–212 association between variant alleles of the x-ray cross complementing gene (xrcc1) original a.r. omrain et al. extracted dna was determined by calculating the (260/280) and (260/230) ratios. where samples that were (260/280) ratio less than 1.8 and/or (260/280) ratio 2, were re-extracted. the integrity and molecular weight of extracted dna was determined by agarose gel electrophoresis according samboork and russell. b. four milliliters of blood sample pushed slowly into disposable gel containing tubes, and was allowed to clots 20 minutes at room temperature. after coagulation, the sera were separated by centrifugation at 3000 rpm for 10 min and stored at –20oc until it was used in the estimation of b[a]p. quantification of benzo[a]pyrene pahs extraction five ml of aqueous ethanolic and 2n of sodium hydroxide [9:1] was added to 1 ml of serum, and solution was ultrasound for 2 hours at 42oc. the sample was extracted by mixing it well with 5 ml of n-hexane and ultrasoned at 42oc for 2 hours, and the organic layer has been withdrawn to another container. anhydrous sodium sulphate was added to clear supernatant to remove excess water, this sample was extracted two times with 10 ml of n-hexane. the extracts were evaporated to dryness at 40oc, and suspended with 0.25 ml of acetonitrile as shown in figure 1 and pah contents in the samples were determined by hplc.10,11 hplc analysis pyrene and benzo[a]pyrene in serum were analysed by using c18 reverse phase column. the rate of flow was 1 ml min–1, 10 µl of samples were injected into knauerhplc (with system components listed in table 1) and monitored at wavelength 254 nm. the peaks of individual pah (pyrene and benzo[a]pyrene) were recognized by comparing with the retention times of authenic standards as in figure 2. a gradient of mobile phase was prepared from water as (a) component, and acetonitrile as (b) component, and a gradient details is give in table 2. a serial dilution of standard of pahs mixture was prepared by acetonitrile to achieve a concentration from 0.02–200 ng/ml. pcr-rflp analysis design according to,12 the genotyping technique was selected, while the primers are designed according to protocol of 13 briefly as follows: the primers were designed by the aid of ncbi-primer blast online software (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/index.cgi?link_loc=blasthome), ar87f taagcaggcttcacagagcc ar87r tggcatcttcacttctgccc. and the produced primers were checked for specificity of their target sequence by performing a blast against the human genome, then the primers pair was selected according to the demand criteria such as: product length, the similarity of melting temperature, primers length, specificity, etc. then the mutations was interred according to the design demands. the primer ability to form secondary structure was checked by the aid of oligo calc online software (http://www.basic. northwestern.edu/biotools/oligocalc.html), the primer would be rejected if it had 5 bases or more able to form self-dimerization and/or it had 4 bases able to form hairpin. each primers pair was checked for dimer formation by the aid of “multiple primer analyzer” online software from thermo fisher scientific inc.©, the sensitivity of the software was adjusted to the value 2, the primer pair would be rejected if it made any dimers in this degree of sensitivity. table 1. system components of hplc, knuaer, germany no component model or version company and origin 1 binary high pressure gradient pump p6.1l knuaer, germany 2 diode array detector dad 2.1l knuaer, germany 3 sample loop (20 µl) and injector d1357 knuaer, germany 4 analyses and system control software claritychrom, v 7.4.2.107 dataapex, czech republic table 2. the gradient of mobile phase time (min) mobile a (water) concentration% mobile b (acetonitrile) concentration% flow rate (ml/min) initial 40 60 0.7 10 0 100 0.7 35 0 100 0.7 fig. 1 comparison of levels of b[a]p in studied groups (car repairers and spare part sellers). fig. 2 pcr-reaction products at different annealing temperatures (55, 58, 60, 63, 66 oc), under same optimized pcr conditions of arg399gln (rs25487). http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?link_loc=blasthome http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?link_loc=blasthome 209j contemp med sci | vol. 8, no. 3, may-june 2022: 207–212 a.r. omrain et al. original association between variant alleles of the x-ray cross complementing gene (xrcc1) restriction enzyme selection the selection of the suitable restriction enzyme (asuc2i cc^sgg sib) was performed by the aid of watcut online software (http://watcut.uwaterloo.ca/template), we selected the restriction enzyme according to several criteria such as: the lesser primer mutations needed, the distance of mutation from the variant, compatibility of the produced primers, cost and availability. optimization of pcr condition of arg399gln (rs25487) the mixture shown in table 3. was used as a preliminary mixture in the pcr reaction. then, different annealing temperatures were used to obtain a specialized and efficient product. the temperatures and optimized pcr condition used are shown in table 4. arg399gln (rs25487) genotyping genotyping of xrcc1 (rs25487) polymorphisms was conducted by pcr-rflp technique. and the restriction digestion of amplicon was digested by (asuc2i), and the reaction mixdture whose components were used: one unit of enzyme 0.25 µl, 5 µl of pcr product, 1.5 µl of buffer, and volume was completed to 15 µl by molecular graded water. the reaction mixture accubated in 37oc overnight. then the reaction product resolved in 2% of agarose gel. statistical analysis the statistical calculations included in this study were carried out using spss software (ibm corp. released 2012. ibm spss statistics for windows, version 21.0. armonk, ny: ibm. corp. usa) and microsoft excel (2010 microsoft corp. usa). the results expressed as mean ± sem, and p < 0.05 was considered table 3. optimized reaction mixture for pcr no composition concentration volume 1 master mix 2.5x 8 µl 2 forward primer 10 pmol/µl 1 µl 3 reverse primer 10 pmol/µl 1 µl 4 dna sample 10-20 ng/µl 2 µl 5 nucleases free water 7.5 µl 6 mgcl 2 25 mm 0.5 µl total volume 20 µl table 4. optimized pcr condition of arg399gln (rs25487) stage step temperature oc time no. of cycles 1 initial denaturation 94 5 min 1 2 dna denaturation 94 30 sec 35 primer annealing 55–67 30 sec extension 72 30 sec 3 final extension 72 5 min 1 table 5. comparison of b[a]p levels among studied groups based on t-student test group control mean ± sd car repaires mean ± sd spare part sellers mean ± sd p-value b[a]p – 1.97 ± 0.06 0.32 ± 0.045 <0.0001 fig. 3 pcr-rflp of (rs25487) genotyping; lane l = 100bp dna ladder; lane (362bp) = tt genotype; lanes (221bp + 141bp) = cc genotype; and lanes (362bp + 221bp + 141bp) = tt genotype. statistically significant. to evaluate the presence of significant differences, one way anova, and unpaired-sample t-test were employed. also regression analysis used to asses presence of correlations, and the logistic regression was performed to adjust odd ratio. results and discussion the results demonstrate that the highest level of b[a]p was recorded in the group of car repairers, followed by the group of workers whose work in the same area. where the results showed highest level of b[a]p in the group of car repairers (1.97 ± 0.06), followed by the group of spare part sellers (0.32 ± 0.04). where levels of b[a]p were significantly higher (p < 0.001) in group of car repairers compared to the group of spare part sellers (table 5, and figure 1). b[a]p is considered the first chemical carcinogen that was discovered among all the pahs individuals, and it was observed in the car exhaust fume.13 its carcinogenic pathway depends on the enzyme metabolize it, starting from the first step and ending with the mutagenic metabolite benzo[a]pyrene-7,8 diol-9,10-epoxide (bpde).14-15 also the recent studies indicated that the automobile mechanics are at an increased risk of skin and lung cancers as a result of exposure to pahs.16 annealing temperatures range (55–67oc) were used in optimization pcr conditions of arg399gln (rs25487) to obtain efficient product. the results obtained are shown in figure 2. the best pcr product was obtained at a temperature of 63oc . the results obtained from pcr-rflp of (rs 25487) genotyping shown in the figure 3, where the cc allele revealed 221bp and 141bp fragments, whiles tt allele was not digested, and visualized at 362bp single product. ct (hetrozoyget) allele revelaed three bands of 362bp, 221bp, and 141bp. the results of rflp-pcr for snp (rs25487) genotyping of xrcc1 gene are listed in table 6 for the car repaires, spar part sellers and control subjects. where the results of genotype http://watcut.uwaterloo.ca/template 210 j contemp med sci | vol. 8, no. 3, may-june 2022: 207–212 association between variant alleles of the x-ray cross complementing gene (xrcc1) original a.r. omrain et al. table 6. frequencies association between genotyping of xrcc1 gene of car repairs group samples and controls genotype control (n = 37) car repairers (n = 37) p-value odds ratio 95% c.i. cc wild 4 (10.81%) 25 (67.56%) <0.0001 17.18 4.49 to 9.702 ct heterozygous 16 (43.24%) 9 (24.32%) 0.088 0.421 0.156 to 1.139 tt mutant 17 (45.94%) 3 (8.10%) 0.001 0.103 0.027 to 0.398 allele frequency % allele control (n = 37) car repairers (n = 37) p-value odds ratio 95% c.i. c 24 59 <0.0001 8.1944 3.88 to 17.29 table 7. frequencies association between genotyping of xrcc1 gene of spare part sellers group samples and controls genotype control (n = 37) spare part sellers (n = 37) p-value odds ratio 95% c.i. cc wild 4(10.81%) 21(56.75%) 0.0001 10.828 3.181to36.849 ct heterozygous 16(43.24%) 9(24.32%) 0.088 0.421 0.156 to 1.139 tt mutant 17(45.94%) 7(18.91%) 0.0155 0.274 0.096 to 0.781 allele frequency % allele control (n = 37) worker (n = 37) p-value odds ratio 95% c.i. c 24 51 <0.0001 5.503 2.059 to 10.22 t 50 21 frequencies of car repaires specimens revealed that cc genotype were higher in sample of auto repairs (45.94%) compared to the control group (16.21%), this is showed a significant differences (<0.0001) with an odd ratio equal to (17.8). the heterozygous genotype ct had lower frequency in samples of car repaires (29.72%) than controls (32.34%) and this combined with non-significant (p = 0.08) and low odd ratio (0.421). the frequency of tt genotype was higher in control samples (51.35%) compared to the samples of car repaires (24.32%) with odd ratio (p <0.13) differences was significant (p = 0.001). the results of genotypes of xrcc1 gene of are listed in table 7 for the spare part sellers and control subjects. where the results of genotype frequencies of spare part sellers specimens revealed that cc genotype were higher in spare part sellers (45.94%) compared to the control group (16.21%), this is showed a significant differences (p < 0.0001) with an odd ratio equal to (17.8). the heterozygous genotype ct had lower frequency in samples of spare part sellers (29.72%) than controls (32.34%) and this combined with non-significant (p = 0.08) and low odd ratio (0.421). the frequency of tt genotype was higher in control samples (51.35%) compared to the samples of spare part sellers (24.32%) with odd ratio (p = 0.13) differences was significant (p = 0.001). effect of rs25487 genotypes on b[a]p levels the effects of snp (rs25487) genotyping of xrcc1 gene on b[a]p level are illustrated on the figures (3 and 4), whereas the highest level of b[a]p had been detected in the car repaires subjects who possess the tt genotype (1.76 ± 0.08) followed by heterozygouse genotype ct (1.607 ± 0.06) and then cc genotypes (0.424 ± 0.08). and also the spare part sellers, where the highest level of b[a]p was in the subjects who carriers tt genotype (0.963 ± 0.04), followed by heterozygouse genotype ct (0.681 ± 0.08) and then cc genotypes showed the lowest level (0.096 ± 0.04). the result of our study showed the cc dominant homozygous genotype of the xrcc1 (dna repairing gene) showed significantly lower levels of measured pahs comparison to the other genotypes, followed by heterozygous genotype ct, and than tt shown higher levels (figure 4). our results are agreement with many previous study17 found that the cc genotype has lower levels of pahs. it was also found in another study18 that the chinese coke oven workers carrying the tt genotype had higher levels of bpde-dna adduct. the variations in the levels of pahs among the studied genotypes are due to the variation in the activity of xenobiotics 211j contemp med sci | vol. 8, no. 3, may-june 2022: 207–212 a.r. omrain et al. original association between variant alleles of the x-ray cross complementing gene (xrcc1) metabolizing enzymes.19 many previous studies reported that the tt genotype had a decrease in activity of xenobiotics metabolizing enzymes (especially cyp2e1), as result, they have high levels of pahs. this resulting in long-term adverse effects, promoting cytotoxicity and genotoxicity, making individuals more susceptible to different types of cancers.19 and considering that b[a]p is a complete carcinogen, that act as an initiator and a promoter of carcinogensis according to epa, 2017.20 at the same time, it was observed that the cc genotypes had low levels of bpde-dna adduct levels this is supports findings of 21 matullo et al., who stated that the carriers of cc showed a relatively lower levels of bulky dna adduct in fig. 4 effects of snp (rs25487) genotyping of xrcc1 gene on b[a]p level. lymphocytes, which may be association with reduced capacity of dna repair system. also in meta-analysis conducted by kiyohara et al.22 tt genotype of the xrcc1 rs 25487 (arg399gln) polymorphism found that was increased pahs levels and it may be association with low dna repair capacity. the results obtained in this study were agreement with other previous study stating that ct and tt genotype is represent a risk of various types of cancer like lung cancer caused by the environment.23 conclusion as results of prolonged exposure to the higher levels of pahs that iraqi car repairs suffer from, they have high levels b[a]p. especially those who have the tt genotypes, as results of the inefficiency of their dna repair system. compared to the other genotypes. acknowledgments the authors are grateful to the staff of chemistry/biochemistry branch, college of medicine, al-nahrain university for their continuous support and encouragement. we thank the volunteers for their cooperation. conflicts of interest none.  references 1. ayodele, r. afolarin, o. (2020) decontamination of automobile workshop soils containing heavy metals and pahs using chelating agents, international journal of environmental pollution and remediation (ijepr) 8. 2. au, w.w. salama, s.a, sierra, c.h. (2003) functional characterization of polymorphisms in dna repair genes using cytogenetic challenge assays, environ. health perspect. 111(15)1843-1850. 3. khairy, ma. kolb, m. mostafa, ar. el-fiky, a. bahadir, m. (2009) risk assessment of polycyclic aromatic hydrocarbons in a mediterranean semienclosed basin affected by human activities (abu qir bay, egypt). j hazard mater; 170(1): 389-397. 4. blaszczyk, e. mielzynska, d. (2017) polycyclic aromatic hydrocarbons and pah-related dna adducts, j appl genetics 58, 321–330. 5. elovaara, e. mikkola, j. stockmann-juvala h, (2014) polycyclic aromatic hydrocarbon (pah) metabolizing enzyme activities in human lung, and their inducibility by exposure to naphthalene, phenanthrene, pyrene, chrysene, and benzo(a)pyrene as shown in the rat lung and liver. arch toxicol. 81.169-82. 6. palli, d. vineis, p. russo, (2001) int. j. cancer 87 (444). 7. hayder, o.h. ali, h.s. ala, h.h. haider, k.z. (2015) association of uromodulin rs13333226 and angiotensinogen rs699 genes variants with essential hypertension in arab iraqis of babylon province, 6(6).589. 8. hayder, o.h. mohammed, b. s. (2019) exploring the potential and limitations of pcr-rflp and pcr-sscp for snp detection: a review, j appl biotechnol rep. 6(4):137-144. 9. kim, b. m. lee, s.-b., kim, j. y., kim, s., seo, j., bae, g.-n., & lee, j. y. (2016). a multivariate receptor modeling study of air-borne particulate pahs: regional contributions in a roadside environment. chemosphere, 144, 1270–1279. 10. luigi, vimercati, lucia bisceglia, domenica, c. antonio, c. luigi, d. maria, c. vincenzo, c. giovanni, m. (2020) environmental monitoring of pahs exposure, biomarkers and vital status in coke oven workers, int. j. environ. res. public health 17 (2199). 11. ahmad, i. rehan, m. balkhyour, m. abbas, m. basahi, j. almeelbi, t. ismail, i.m. (2016) review of environmental pollution and health risks at motor vehicle repair workshops challenges and perspectives for saudi arabia. int. j. agric. env. res. 2, 1–23. 12. ahmad, i. rehan, m. balkhyour, m.a. ismail, i.m. (2017b) assessment of occupational health and safety in motor vehicle repair workshops in jeddah. biosci. biotech. res. asia. 14 (3), 901–913. 13. luigi, v. lucia. b, domenica. c, antonio, c. luigi, d.m. maria c.d. vincenzo, c. giovanni, m. f. (2020) environmental monitoring of pahs exposure, biomarkers and vital status in coke oven workers, int. j. environ. res. public health 17, 2199. 14. shehata, ra. helal, sf. rashed, la. rakha, am (2020) oxidative dna damage due to occupational exposure to polycyclic aromatic hydrocarbons among coal tar workers, egyptian journal of occupational medicine, 44 (2): 663–678. 15. therhi. k, lars. n, raija. v, kirsti. s, pertti. m, toomas. v, (2002) the effect of relevant genotypes on pah exposure-related biomarkers, journal of exposure analysis and environmental epidemiology 12, 81–91. 16. aisha, m. samir. dalia, a shaker, mona, m. fathy, s. mona, m. abdullatif. laila a. hany a. alghobary. (2019) urinary and genetic biomonitoring of polycyclic aromatic hydrocarbons in egyptian coke oven workers: associations between exposure, effect, and carcinogenic risk assessment, international of occupational and environmental medicine,10(3). 17. begum, a. ramaiah, m. khan, i. veena, k. (2009). analysis of heavy metals concentration in soil and litchens from various localities of hosur road, bangalore, india. j chem. 6(1), pp. 13–22. 18. bolling, ak. pagels, j. yttri, ke. barregard, l. sallsten, g. schwarze, pe. (2009) health effects of residential wood smoke particles: the importance of combustion conditions and physicochemical particle properties. part fibre toxicol (6)20. 19. hamidi, e.n. hajeb, p. selamat, j. abdull razis, a.f. (2016). polycyclic aromatic hydrocarbons (pahs) and their bioaccessibility in meat: 212 j contemp med sci | vol. 8, no. 3, may-june 2022: 207–212 association between variant alleles of the x-ray cross complementing gene (xrcc1) original a.r. omrain et al. a tool for assessing human cancer risk. asian pac. j. cancer prev. 17, 15–23. 20. international agency for research on cancer (iarc) (2012). globocan 2012: estimated cancer incidence, mortality and prevalence worldwide in 2012, world health organization, lyon, france. 21. ijaz, a. mansour, a. (2020) occupational exposure and respiratory health of workers at small scale industries, saudi journal of biological sciences 27 985–990. 22. olabanji i. o. asubiojo, o. komolafe m. akintomide anthony, and adeniji ayodeji oluwole (2019) determination of polycyclic aromatic hydrocarbons in blood plasma of neurology patients journal of toxicology and environmental health sciences, 11(1), 1-8. 23. sanna, k. pohjola, maija, l. markku, h. leena, r. kirsti, s. (2003) dna binding of polycyclic aromatic hydrocarbons in a human bronchial epithelial cell line treated with diesel and gasoline particulate extracts and benzo[a]pyrene mutagenesis. 18 (5) 429-438. https://doi.org/10.22317/jcms.v8i3.1231 this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. 120 j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 original outcomes of primary percutaneous coronary intervention in st-segment elevation myocardial infarction in kurdistan region of iraq ameen m mohammad1*, schivan u mohammed2, saad y saeed3 1department of internal medicine, college of medicine, university of duhok, iraq. 2department of biomedicine, college of medicine, university of zakho, duhok, iraq. 3department of community medicine, college of medicine, university of duhok, iraq. *correspondence to: ameen m mohammad (e-mail: doctoramb@yahoo.com) (submitted: 16 december 2021 – revised version received: 10 january 2022 – accepted: 27 january 2022 – published online: 26 april 2022) abstract objectives: this registry aims to clarify the characteristics and 6-weeks outcomes of patients with stemi after ppci in the region. methods: data from a total of 151 stemi patients undergoing ppci at duhok heart center, iraq from 2020 to 2021 was collected. patient’s demographic, clinical and ppci profiles were recorded. the major adverse cardiac events (mace) and left ventricle ejection fraction (lvef%) outcomes for 6 weeks period was registered. results: of the 151 consecutive patients with stemi who underwent ppci, 46 (30.4%) were <50 years old. majority of patients were males and have clusters of cardiometabolic risk factors. 64% of cases attained cath lab within first hour of initial chest pain. almost 90% of stemi cases were treated with stenting with timi3 in (94%). 80% of ppci cases discharged home within 24 hours uneventfully. 6-weeks lvef was preserved within normal range in 55% of cases. 36% had maces including impaired lvef. all cause-mortality happened in 5%. 4% were censored from follow up. the predictors of 6-weeks outcomes were depend on type/location of myocardial infarction, the culprit artery, timi flow post pci and length of hospital stay. conclusion: this registry has shown feasibility in doing ppci with reasonable outcomes in the region. networking of capable centers of ppci in the country is essential for augmenting the cardiac services and sharing the knowledge among cardiologists and people for better stemi outcomes. keywords: stemi, primary pci, iraq issn 2413-0516 introduction the cardiovascular diseases coming at the top of the list of the disease-related death in iraq.1 the incidence of stemi in the area is rapidly over happening particularly in young people.2 according to international medical guidelines the best approach to stemi patient is the ppci.3 the ppci services are generally new in our area. since long time the main modality of reperfusion in stemi was thrombolytics. in the last decade the interventional cardiology services and cath lab facilities entered to the field in our area, nevertheless, the systematic ppci per 24 hours/7 days per 365 days was relatively a new approach in our area. given the fact that the services of ppci are relatively recent in the area and the data about stemi and the feasibility of ppci are sparse. hence, this study was conducted in order to clarify the characters and 6-weeks outcomes of patients with stemi after primary percutaneous coronary intervention (ppci) in the region. methods belongs to azadi teaching tertiary hospital duhok heart center is a specialized center with a history of than 15 years. in regards to stemi, the center provided ppci services 24 hours/7 days per week in the last 4 years. the center has three equipped cath lab with continuous back up surgery and intensive care unit. the center has more than 12 interventional cardiologists with a group of cardiac surgeons and intensives, besides a large group of paramedics and staffs in the cath lab. in this prospective follow up study patients who presented with diagnosis of stemi from duhok and its districts and referred to duhok heart center inside azadi hospital for potential primary percutaneous coronary intervention were enrolled during the period of 2020 to 2021. the patients were given guideline directed medical therapy in from of loading doses of dual antiplatelets and anti-ischemic drugs. eligible patients after their acceptance and consent from patients were referred to cath lab for ppci. patients with established stemi or late presentations (> 12 hours) were excluded and admitted to coronary care unit for optimal medical therapy/ thrombolytics. during the procedure, the interventional cardiologists perform the procedure through either femoral or radial approach. all the procedural data including angiographic findings with culprit artery lesion and type of pci (whether stents, ballooning or medical therapy) were documented. platforms of stents were mentioned. successfulness of pci and procedure was based on the timi flow scores. after the procedure all patients were admitted for 24 hours monitoring in the intensive care unit of the center. all complications including mortality, if happened were registered. the estimation of lvef was performed. post discharge advices for regular complaint to medications, life style modifications and follow up schedule were given. then after patients were followed for a period of 6 weeks. the lvef (%) were performed for coming cases. in addition to registration of the rates of patient’s readmissions to hospital for major acute ischemic events (mace) like acute stent thrombosis, myocardial infarction and stroke. the cardiac death rate and censored cases for follow up during this period was documented. a detailed demographic, clinical, angiographic profile of all cases were recorded and stored on a file of excel. 121j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 a.m. mohammad et al. original outcomes of ppci in iraq ethical approval and patients consent the study was approved by the appropriate ethical committee at the kurdistan board of medical specialization (erbil, iraq. the number of order;) and an informed written consent was obtained from all participants, or legal guardians (either parent) as appropriate. statistical analysis data from the original excel file were transferred and analyzed by using microsoft office excel 2007 and spss for windows, version 16.0, chicago. continuous variables were calculated as mean ± (sd), and categorical variables were presented as counts and percentages. a chi-square test and fisher exact were used to compare the variables. p-value < 0.05 was regarded as significant. results the main findings of patients by age groups are summarized in table 1. the patients were predominately males. 30% were young (<50 years). the fast majority of ppci was performed within first 6 hours of onset of chest pain. risk factors were clustered among both young and old. anterior (49%) then inferior (40) stemi was the presentation. normal coronary lumen angiogram seen in (1.3%). drug eluting stents deployed in 92% of cases. successful result (timi3) obtained in 94%. 80% of ppci discharged home uneventfully with first 24 hours. 6-weeks lvef preserved in 64%. 36% of cases survived but with maces. all-cause mortality was 4.6%. no major differences were seen between different age groups. in table 2 the clinical, angiographic and outcomes findings of cases by the sex were summarized. however, the stemi equivalent presentations were more common among women, table 1. the main findings of patients (n = 151), by age groups clinical finding 21–49 years (n = 46) 50–90 years (n = 105) total (n = 151) p-value* no. % no. % no. % sex male 41 89.1 84 80.0 125 82.8 0.171 female 5 10.9 21 20.0 26 17.2 chief complaint chest pain 41 89.1 86 81.9 127 84.1 0.626sob 2 4.3 8 7.6 10 6.6 other 3 6.5 11 10.5 14 9.3 duration 0.5 hour 8 17.4 27 25.7 35 23.2 0.535 1 hour 18 39.1 45 42.9 63 41.7 2 hours 12 26.1 22 21.0 34 22.5 3–6 hours 3 6.5 3 2.9 6 4.0 > 6 hours 5 10.9 8 7.6 13 8.6 dm positive 8 17.4 38 36.2 46 30.5 0.021 negative 38 82.6 67 63.8 105 69.5 smoking positive 34 73.9 65 61.9 99 65.6 0.257ex-smoker 1 2.2 2 1.9 3 2.0 negative 11 23.9 38 36.2 49 32.5 hypertension positive 17 37.0 62 59.0 79 52.3 0.012 negative 29 63.0 43 41.0 72 47.7 dyslipidemia positive 39 84.8 86 81.9 125 82.8 0.666 negative 7 15.2 19 18.1 26 17.2 family history positive 9 19.6 25 23.8 34 22.5 0.565 negative 37 80.4 80 76.2 117 77.5 past medical history ihd 5 10.9 22 21.0 27 17.9 0.303previous stents 1 2.2 3 2.9 4 2.6 negative 40 87.0 80 76.2 120 79.5 drugs category 1 35 76.1 74 72.5 109 73.6 0.651 category 2 11 23.9 28 27.5 39 26.4 bmi (kg/m2) 18–24.9 7 15.2 18 17.1 25 16.6 0.37825–29.9 34 73.9 82 78.1 116 76.8 30–35 5 10.9 5 4.8 10 6.6 (continued) 122 j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 outcomes of ppci in iraq original a.m. mohammad et al. table 1. the main findings of patients (n = 151), by age groups—continued clinical finding 21–49 years (n = 46) 50–90 years (n = 105) total (n = 151) p-value* no. % no. % no. % diagnosis anterior stemi 29 63.0 45 42.9 74 49.0 0.205 inferior stemi 15 32.6 46 43.8 61 40.4 posterior stemi 1 2.2 8 7.6 9 6.0 lateral stemi 1 2.2 4 3.8 5 3.3 stemi equivalent 0 0.0 2 1.9 2 1.3 angiogr. findings normal cag 1 2.2 1 1.0 2 1.3 0.575 single v. disease 32 69.6 68 64.8 100 66.2 two v. disease 6 13.0 22 21.0 28 18.5 triple v. disease 7 15.2 14 13.3 21 13.9 culprit artery lad 28 60.9 47 44.8 75 49.7 0.169 rca 11 23.9 45 42.9 56 37.1 lcx 4 8.7 9 8.6 13 8.6 lms 2 4.3 3 2.9 5 3.3 normal 1 2.2 1 1.0 2 1.3 procedure stenting 41 89.1 98 93.3 139 92.1 0.231 ballooning 3 6.5 1 1.0 4 2.6 graft stent 0 0.0 1 1.0 1 0.7 surgery 0 0.0 2 1.9 2 1.3 medical rx 2 4.3 3 2.9 5 3.3 result of pci timi 0 flow 0 0.0 1 1.0 1 0.7 1.000 timi ii flow 1 2.2 4 3.8 5 3.3 timi iii flow 45 97.8 98 93.3 143 94.7 surgery 0 0.0 2 1.9 2 1.3 length of hospital stay 24 hours 39 84.8 82 78.1 121 80.1 0.343 > 24 hours 7 15.2 23 21.9 30 19.9 ef after 6 weeks 50–60 26 56.5 71 67.6 97 64.2 0.190 20–49 20 43.5 34 32.4 54 35.8 six-weeks outcome died 0 0.0 7 6.7% 7 4.6 0.137survived with complication** 20 43.5 35 33.3 55 36.4 survived without complications** 25 54.3 58 55.2 83 55.0 censored*** 1 2.2 5 4.8 6 4.0 *based on chi-square or fisher’s exact test. **stent thrombosis, readmission or ef < 50. ***not included in the statistical test (missing data). n.b. all the percentages are vertical; therefore, comparisons are to made horizontally, between the two age groups. the males had more anterior stemi. we notably not found a statistically significant difference between both gender in other parameters except of some expected risk factors like smoking among males. the table 3 showed the relation of cases’s characteristics to 6 weeks (ef). the predictors of 6-weeks outcomes and lvef were depend on type/location of stemi, the culprit artery, timi flow post pci and length of hospital stay. the impaired ef was observed among anterior stemi (p < 0.001), lad culprit (p < 0.001), less than timi3 pci result (p < 0.039). the overall mortality and morbidity (maces) and longer length of in-hospitalization time were registered in lower lvef. discussion this registry showed the feasibility of ppci with reasonable outcomes in stemi patients. there were generally no clear differences in characteristics outcomes of stemi with respect to gender and ages of patients. in the developed countries the cad is typically aged related with low incidence of the disease among young compared to our area. almost 30% of cases of stemi in this study were among young.5 another striking point is the predominate male gender affection by the disease in the current study. the potential explanation of this phenomena is that the males constitute the 123j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 a.m. mohammad et al. original outcomes of ppci in iraq table 2. clinical findings of the patients (n = 151), by sex clinical finding males (n = 125) females (n = 26) total p-value no. % no. % no. % chief complaint chest pain 107 85.6 20 76.9 127 84.1 0.449sob 8 6.4 2 7.7 10 6.6 other 10 8.0 4 15.4 14 9.3 duration 0.5 hour 27 21.6 8 30.8 35 23.2 0.080 1 hour 58 46.4 5 19.2 63 41.7 2 hours 25 20.0 9 34.6 34 22.5 3–6 hours 5 4.0 1 3.8 6 4.0 > 6 hours 10 8.0 3 11.5 13 8.6 dm positive 32 25.6 14 53.8 46 30.5 0.004 negative 93 74.4 12 46.2 105 69.5 smoking positive 97 77.6 2 7.7 99 65.6 <0.001ex-smoker 3 2.4 0 0.0 3 2.0 negative 25 20.0 24 92.3 49 32.5 hypertension positive 61 48.8 18 69.2 79 52.3 0.058 negative 64 51.2 8 30.8 72 47.7 dyslipidemia positive 104 83.2 21 80.8 125 82.8 0.777 negative 21 16.8 5 19.2 26 17.2 family history negative 95 76.0 22 84.6 117 77.5 0.339 positive 30 24.0 4 15.4 34 22.5 past medical history negative 98 78.4 22 84.6 120 79.5 0.900ihd 23 18.4 4 15.4 27 17.9 previous stents 4 3.2 0 0.0 4 2.6 drugs category 1 92 74.8 17 68.0 109 73.6 0.482 category 2 31 25.2 8 32.0 39 26.4 bmi (kg/m2) 18–24.9 22 17.6 3 11.5 25 16.6 0.73125–29.9 95 76.0 21 80.8 116 76.8 30–35 8 6.4 2 7.7 10 6.6 diagnosis anterior stemi 65 52.0 9 34.6 74 49.0 0.006 inferior stemi 50 40.0 11 42.3 61 40.4 posterior stemi 8 6.4 1 3.8 9 6.0 lateral stemi 2 1.6 3 11.5 5 3.3 stemi equivalent 0 0.0 2 7.7 2 1.3 angiogr. findings normal cag 1 .8 1 3.8 2 1.3 0.266 single v. disease 85 68.0 15 57.7 100 66.2 two v. disease 21 16.8 7 26.9 28 18.5 triple v. disease 18 14.4 3 11.5 21 13.9 culprit artery lad 65 52.0 10 38.5 75 49.7 0.051 rca 45 36.0 11 42.3 56 37.1 lcx 12 9.6 1 3.8 13 8.6 lms 2 1.6 3 11.5 5 3.3 normal 1 .8 1 3.8 2 1.3 procedure stenting 114 91.2 25 96.2 139 92.1 ballooning 4 3.2 0 0.0 4 2.6 graft stent 1 0.8 0 0.0 1 0.7 1.000 (continued) 124 j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 outcomes of ppci in iraq original a.m. mohammad et al. table 2. clinical findings of the patients (n = 151), by sex—continued clinical finding males (n = 125) females (n = 26) total p-value no. % no. % no. % surgery 2 1.6 0 0.0 2 1.3 medical rx 4 3.2 1 3.8 5 3.3 result of pci timi 0 flow 0 0.0 1 3.8 1 0.7 0.265 timi ii flow 4 3.2 1 3.8 5 3.3 timi iii flow 119 95.2 24 92.3 143 94.7 surgery 2 1.6 0 0.0 2 1.3 length of hospital stay 24 hours 98 78.4 23 88.5 121 80.1 0.242 > 24 hours 27 21.6 3 11.5 30 19.9 ef after 6 weeks 50–60 77 61.6 20 76.9 97 64.2 0.138 20–49 48 38.4 6 23.1 54 35.8 six-weeks outcome died 5 4.0 2 7.7 7 4.6 0.114survived with complication* 50 40.0 5 19.2 55 36.4 survived (ef ≥50) without compl 65 52.0 18 69.2 83 55.0 censored** 5 4.0 1 3.8 6 4.0 *stent thrombosis, readmission or ef < 50. **not included in the statistical test (missing data). n.b. all the percentages are vertical; therefore, comparisons are to made horizontally, between the two sexes. table 3. relation clinical findings of the patients (n = 151), with their outcome, in terms of ejection fraction (ef), after 6 weeks clinical finding six-weeks outcome (ef) p-value 50–60 (n = 97) 20–49 (n = 54) total no. % no. % no. % age 21–49 years 26 26.8 20 37.0 46 30.5 0.190 50–90 years 71 73.2 34 63.0 105 69.5 sex male 77 79.4 48 88.9 125 82.8 0.138 female 20 20.6 6 11.1 26 17.2 chief complaint chest pain 85 87.6 42 77.8 127 84.1 0.064sob 3 3.1 7 13.0 10 6.6 other 9 9.3 5 9.3 14 9.3 duration 0.5 hour 25 25.8 10 18.5 35 23.2 0.128 1 hour 41 42.3 22 40.7 63 41.7 2 hours 23 23.7 11 20.4 34 22.5 3–6 hours 1 1.0 5 9.3 6 4.0 > 6 hours 7 7.2 6 11.1 13 8.6 dm positive 31 32.0 15 27.8 46 30.5 0.593 negative 66 68.0 39 72.2 105 69.5 smoking positive 60 61.9 39 72.2 99 65.6 0.137ex-smoker 1 1.0 2 3.7 3 2.0 negative 36 37.1 13 24.1 49 32.5 hypertension positive 50 51.5 29 53.7 79 52.3 0.799 negative 47 48.5 25 46.3 72 47.7 dyslipidemia positive 81 83.5 44 81.5 125 82.8 0.752 negative 16 16.5 10 18.5 26 17.2 (continued) 125j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 a.m. mohammad et al. original outcomes of ppci in iraq table 3. relation clinical findings of the patients (n = 151), with their outcome, in terms of ejection fraction (ef), after 6 weeks—continued clinical finding six-weeks outcome (ef) p-value 50–60 (n = 97) 20–49 (n = 54) total no. % no. % no. % family history negative 77 79.4 40 74.1 117 77.5 0.454 positive 20 20.6 14 25.9 34 22.5 past medical history negative 78 80.4 42 77.8 120 79.5 0.869ihd 16 16.5 11 20.4 27 17.9 previous stents 3 3.1 1 1.9 4 2.6 drugs category 1 71 75.5 38 70.4 109 73.6 0.493 category 2 23 24.5 16 29.6 39 26.4 bmi (kg/m2) 18–24.9 15 15.5 10 18.5 25 16.6 0.83725–29.9 76 78.4 40 74.1 116 76.8 30–35 6 6.2 4 7.4 10 6.6 diagnosis anterior stemi 31 32.0 43 79.6 74 49.0 <0.001 inferior stemi 57 58.8 4 7.4 61 40.4 posterior stemi 4 4.1 5 9.3 9 6.0 lateral stemi 3 3.1 2 3.7 5 3.3 stemi equivalent 2 2.1 0 0.0 2 1.3 angiogr. findings normal cag 2 2.1 0 0.0 2 1.3 0.369 single v. disease 68 70.1 32 59.3 100 66.2 two v. disease 15 15.5 13 24.1 28 18.5 triple v. disease 12 12.4 9 16.7 21 13.9 culprit artery lad 33 34.0 42 77.8 75 49.7 <0.001 rca 50 51.5 6 11.1 56 37.1 lcx 9 9.3 4 7.4 13 8.6 lms 3 3.1 2 3.7 5 3.3 normal 2 2.1 0 0.0 2 1.3 procedure stenting 91 93.8 48 88.9 139 92.1 0.130 ballooning 2 2.1 2 3.7 4 2.6 graft stent 0 0.0 1 1.9 1 0.7 surgery 0 0.0 2 3.7 2 1.3 medical rx 4 4.1 1 1.9 5 3.3 result of pci timi 0 flow 0 0.0 1 1.9 1 0.7 0.039 timi ii flow 2 2.1 3 5.6 5 3.3 timi iii flow 95 97.9 48 88.9 143 94.7 surgery 0 0.0 2 3.7 2 1.3 length of hospital stay 24 hours 86 88.7 35 64.8 121 80.1 <0.001 > 24 hours 11 11.3 19 35.2 30 19.9 six-weeks outcome died 1 1.0 6 11.1 7 4.6 <0.001 survived with complication** 7 7.2 48 88.9 55 36.4 survived (ef ≥50) without compl. 83 85.6 0 0.0 83 55.0 censored*** 6 6.2 0 0.0 6 4.0 *stent thrombosis, readmission or ef < 50. **not included in the statistical test (missing data). n.b. all the percentages are vertical; therefore, comparisons are to made horizontally, between the two ef groups. 126 j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 outcomes of ppci in iraq original a.m. mohammad et al. bulk of the young premature cad and the second is the wellknown protective effect of estrogen in premenopausal age in females.6,7 in term of cardiometabolic risk factors there was clear trend of clustering of risk factors in our patients. and this clustering was the main attributable to stemi in our region. hence, the control of such risk factors should be the priority in health agenda as soon as possible. it is recognizable that the traditional risk is more important the genetic polymorphisms in this group of patients according to available data from the area.5,8 the fast majority of our cases were presented for first time with cad with negative past history of coronary disease. only one fifth of cases had past history of cad regardless of the original presentation. this highlight the significant increase in the new cases and incidence of the disease in this area.9 compared to previous report from our area the time of presentation of stemi cases to hospital and emergency department is mildly improved.10 since several years ago more than 50% of acute coronary syndrome cases were lately coming to hospital. in this registry the time of presentation was shorter than the time determined by previous report.10 this reflect some improvement in facilities and health education in the area. the angiographic profile of patient reflects another fact; the nature of coronary involvement in this study was extensive lesions. more than 30% of cases had more than one vessel diseased. and this point should raise the awareness about the silent cad before the stemi presentation.11 depend on some national reports the nature of coronary lesion among our patients has two characters: more extensive lesions and more calcification. this point needs a particular attention by the community of cardiology in the area.12 the feasibility of the primary pci procedure was achievable. almost more than 90% cases underwent successful stenting with drug eluting platforms of the culprit artery with timi 3 flow in the culprit artery. the adopted policy for discharging cases post successful ppci was within first 24 hours in 80% of cases and only 20% were stayed hospitalized for longer duration. this early discharge of stable cases after ppci will preserve the economic and health facilities for those with critical cases.13 in terms of 6 weeks follow up, the lvef were preserved in 65%. the remaining percent were presented with different level of impaired lvef especially among the more vulnerable patients. probably the stunning and particularly the hibernation of the myocardium is one of the expected causalities beyond the impaired lvef.14 in addition to different degree of heart failure and lv dysfunction there was higher rate of mace in this study compared to others.15 the predictors of 6-weeks adverse outcomes were depending mainly on type/ location of myocardial infarction, the culprit artery, timi flow post ppci and length of hospital stay. conclusion this study indicated that the 24 hours/7 days of week/ 365 days of year’s ppci is feasible procedure in our area with acceptable outcomes. within the accumulation of experiences in treating stemi and ppci among our health personnel and staff we do expect better outcomes in the near future particularly if these experiences come in line with the health awareness of stemi and chest pain among people. the implementation of recent stemi management protocols like codestemi or stemi alert in our area will add an additional step toward improving the stemi outcomes and cathlab services.16,17 conflicts of interest none.  references 1. mohammad, a.m., jehangeer, h.i. & shaikhow, s.k. prevalence and risk factors of premature coronary artery disease in patients undergoing coronary angiography in kurdistan, iraq. bmc cardiovasc disord 15, 155 (2015). https://doi.org/10.1186/s12872-015-0145-7 2. steg g, james s, atar d, badano l, bldmstrom-lundqvist c, di mario c, et al. management of acute myocardial infarction in patients presenting with persistent st-segment elevation: the task force on the management of st-segment elevation acute myocardial infarction of the european society of cardiology. eur heart j. 2012;33:2569–2619. 3. mohammad am, rashad hh, habeeb qs, rashad bh, saeed sy. demographic, clinical and angiographic profile of coronary artery disease in kurdistan region of iraq. am j cardiovasc dis. 2021;11(1):39–45. published 2021 feb 15. 4. ginanjar, e., sjaaf, a. c., alwi, i., sulistyadi, w., suryadarmawan, e., wibowo, a., & liastuti, l. d. (2020). code stemi program improves clinical outcome in st elevation myocardial infarction patients: a retrospective cohort study. open access emergency medicine: oaem, 12, 315–321. https://doi. org/10.2147/oaem.s259155 5. mohammad, a.m., othman, g.o., saeed, c.h. et al. genetic polymorphisms in early-onset myocardial infarction in a sample of iraqi patients: a pilot study. bmc res notes 13, 541 (2020). https://doi.org/10.1186/s13104-02005367-w 6. mohammad am, sheikho sk, tayib jm. relation of cardiovascular risk factors with coronary angiographic findings in iraqi patients with ischemic heart disease. am j cardiovasc dis res. 2013;1(1):25–9. 7. wake r, yoshiyama m. gender differences in ischemic heart disease. recent patents cardiovasc drug discov. 2009;4:234–240. doi: 10.2174/157489009789152249. 8. mohammad am, al-allawi nas. cyp2c19 genotype is an independent predictor of adverse cardiovascular outcome in iraqi patients on clopidogrel after percutaneous coronary intervention. j cardiovasc pharmacol. 2018; 71(6):347-351. doi: 10.1097/fjc.0000000000000577 9. abd rk, abd sn, raman v. tracing the risk factors of heart diseases at al-nasiriyah heart center in iraq. j cardiovascular disease res. 2019;10(1):31–4. 10. mohammad am, abdulhaleem bh, habeeb qs. first 24 hours’ outcomes of acute coronary syndrome in iraq. med j babylo 2020;17;154-8. 11. jin j. testing for “silent” coronary heart disease. jama. 2014;312(8):858. doi:10.1001/jama.2014.9191 12. ahmed l. fathala, salwa q. bukhari, and abdulaziz al-sugair. high prevalence of coronary artery calcification in saudi patients with normal myocardial perfusion. ann saudi med. 2017 mar-apr; 37(2): 154–160 13. awsan noman, azfar g zaman, [...], and rajiv das. early discharge after primary percutaneous coronary intervention for st-elevation myocardial infarction. eur heart j acute cardiovasc care. 2013 sep; 2(3): 262– 269. doi: 10.1177/2048872612475231 14. francone m, bucciarelli‐ducci c, carbone i, canali e, scardala r, calabrese fa, sardella g, mancone m, catalano c, fedele f, passariello r, bogaert j, agati l. impact of primary coronary angioplasty delay on myocardial salvage, infarct size, and microvascular damage in patients with st‐segment elevation myocardial infarction: insight from cardiovascular magnetic resonance. j am coll cardiol. 2009; 54:2145–2153. https://doi.org/10.1186/s12872-015-0145-7 https://dx.doi.org/10.1177%2f2048872612475231 127j contemp med sci | vol. 8, no. 2, march-april 2022: 120–127 a.m. mohammad et al. original outcomes of ppci in iraq 15. ahn kt, song yb, choe yh, yang jh, hahn j‐y, choi j‐h, choi s‐h, chang s‐a, lee s‐c, lee sh, oh jk, gwon h‐c. impact of transmural necrosis on left ventricular remodeling and clinical outcomes in patients undergoing primary percutaneous coronary intervention for st‐ segment elevation myocardial infarction. int j cardiovasc imaging. 2013; 29:835–842. 16. koh jq, tong dc, sriamareswaran r, yeap a, yip b, wu s, perera p, menon s, noaman sa, layland j. in‐hospital ‘code stemi’ improves door‐to‐ balloon time in patients undergoing primary percutaneous coronary intervention. emerg med australas. 2018; 30:222–227. 17. ameen m mohammad. the interventionist mindset: the ten eyes rule in cath lab. annals of medicine and surgery. 2020;60;644–645. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i2.1202 121j contemp med sci | vol. 9, no. 2, march-april 2023: 121–126 original physiological effects of calprotectin and b cell activating factor in covid-19 patients hazhar m. balaky1*, akam jasim mustafa2, parween abdulsamad ismail3, araz muhammad yousif4 1mergasor technical institute, erbil polytechnic university, erbil, iraq. 2department of chemistry, faculty of science, soran university, soran, kurdistan region, iraq. 3department of chemistry, college of education, university of salahaddin, erbil, iraq. 4basic science department, dentistry college, hawler medical university, erbil, iraq. *correspondence to: hazhar m. balaky (e-mail: hazharbalaky86@yahoo.com) (submitted: 04 january 2023 – revised version received: 27 january 2023 – accepted: 15 february 2023 – published online: 26 april 2023) abstract objectives: this study set out to determine how calprotectin and b cell activating factor contributes to early covid-19 patient severity prediction. methods: the study included 25 healthy controls and 52 patients with sars-cov2 infection who were clinically diagnosed with covid-19 illness and were between the ages of 23 and 35. the serum levels of calp and baff were measured using the elisa method. to gauge crp levels, an immunoturbidometric assay was performed. results: variations in serum levels of calp and baff were found to be statistically insignificant in the study (p = 0.7109 & p = 0.7575, respectively). when compared to the control group (103.95 ± 36.67 ng/ml; 403.03 ± 1.03), covid-19 patients had non-significantly raised levels of calp and baff (106.5 ± 4.67 ng/ml; 436.9 ± 12.77 pg/ml, respectively). according to roc curve analysis, the area under the receiver operating characteristics curve (auc) for calp and baff was (0.5170) and (0.5259), respectively. (r = 0.6923; p = 0.0001). there was a significant positive correlation between serum calp and baff levels. the connection between serum crp levels and calp (r = 0.3010; p = 0.1271) and baff levels (r = 0.2912; p = 0.1406) was insignificantly positive. conclusion: the current study’s findings suggested that serum calp and baff concentrations were increased in covid-19 patients, suggesting that these inflammatory markers may be helpful indicators of the severity of covid-19. keywords: calprotectin, b cell activating factor, c-reactive protein, covid-19 issn 2413-0516 introduction a pneumonia outbreak was reported in wuhan (hubei province, china) in december 2019 due to infection with a new coronavirus strain that causes the severe acute respiratory syndrome known as severe acute respiratory syndrome coronavirus 2 (sars-cov-2). the coronavirus disease 19 (covid-19) pandemic caused by this virus has affected millions of individuals worldwide.1 covid-19 is associated with several clinical signs and symptoms frequently seen in autoimmune illnesses, including arthralgias, myalgias, exhaustion, sicca, and rashes.2 patients with covid-19 have also been noted to exhibit thrombosis, myositis, myocarditis, arthritis, encephalopathy, and vasculitis, in addition to these less typical autoimmune disease symptoms.3 these clinical data, along with the rising number of “recovered” patients referred to as “long haulers” or “long covid” who still exhibit post-covid-19 symptoms, raise the hypothesis that inflammation in response to sars-cov-2 infection increases tissue damage during the acute phase and has some longterm consequences.4 furthermore, severe covid-19 is more likely to occur in persons with underlying conditions such as diabetes, hypertension, cardiovascular disease, and lung disease, and the age-related case fatality rate increases significantly.5 since the virus’s introduction, it has been of utmost importance to comprehend immunity to the virus, the kinetics and protective function of the immune response in the community, and the level of exposure as measured by serosurveys.6 neutrophil activation signature calprotectin has become a useful biomarker during the first wave of the pandemic to assess covid-19 patient risk.7 the self-aggravating thrombo-inflammatory storm in people with severe covid-19 may be directly attributed to the neutrophil-related inflammatory marker termed calprotectin. silvin et al.8 revealed the relationship between elevated calprotectin levels and immature neutrophils and nonclassical monocytes. he also claimed that increased damage-related molecular pattern creation causes this relationship. in light of this, it has been postulated that calprotectin is a crucial mediator of the hyperinflammatory host response and the rise in inflammatory monocytes, neutrophils, and platelets that contribute to the particular coagulopathy in severe covid-19.1 additionally, doctors are adopting calprotectin increasingly frequently to aid in diagnosing and treating a range of different inflammatory illnesses due to its stability, assay repeatability, and inexpensive cost. the molecular functions of calp in health and unresolved inflammation are poorly understood by most clinicians.9 b-cell activating factor (baff), a member of the tumor necrosis factor (tnf) class, is expressed by macrophages, monocytes, dendritic cells, activated neutrophils, and stromal cells.10 first, it has been shown to be necessary for the creation of the humoral response as well as the growth and survival of b lymphocytes.11 recent research suggests that baff may also regulate innate immune responses, particularly at the level of the respiratory mucosa.12 the membrane-bound or soluble protein baff, which can induce autoimmune disorders in mice and humans,13 is synthesized excessively. the transmembrane activator and cyclophilin ligand interactor (taci), the b cell maturation antigen, and the baff receptor are the three known baff receptors (bma). all of these receptors are present in b and t lymphocytes as well as antigen-presenting cells, proving that baff action goes beyond b cell biology.14 mailto:hazharbalaky86@yahoo.com 122 j contemp med sci | vol. 9, no. 2, march-april 2023: 121–126 physiological effects of calprotectin and b cell activating factor in covid-19 patients original h.m. balaky et al. therefore, this case-control study investigates circulating baff and calprotectin levels, function, diagnostic value, and prognostic relevance in covid-19 infected patients. materials and methods the 77 participants in the present study included 52 confirmed covid-19 patients between june 2021 to november 2022 aged (23 to 35 years) and 25 healthy volunteers as the control group. after a covid-19 clinical diagnosis was made using rt-pcr test, blood samples were taken before the study group’s condition was treated. each participant’s blood sample was taken at a volume of 5 ml and centrifuged for 15 minutes at 3500 rpm. after that, the serum was frozen and kept at 70°c. the research purpose elisa kits were used to measure the levels of calprotectin (calp) and b-cell activating factor (baff) following the manufacturer’s instructions (sunlong biotech, china). the crp levels were measured by immunoturbidometric assay via a fully automated biochemistry analyzer. statistical analysis statistical analysis was performed using graphpad prism version 8 computer program. the unpaired t-test (man-whitney u) was used to compare the biochemical parameters between the study groups. roc curve analysis and spearman correlation analysis were also performed for biochemical parameters. all comparisons were deemed significant if the p-value was less than 0.05. results serum level of calprotectin figure 1 and table 1 revealed a non-significant elevation (p = 0.7109) in circulating concentration of serum calprotectin levels in covid-19 patients (106.5 ± 4.67 ng/ml) as compared to controls (103.9 ± 5.36 ng/ml). fig. 1 calprotectin levels between the sera of the studied groups. table 1. comparison of calp and baff levels among covid-19 patients and healthy controls parameters controls covid-19 patients p-value calprotectin (ng/ml) 103.9 ± 5.36 106.5 ± 4.67 0.7109 b-cell activating factor (pg/ml) 403.0 ± 31.03 436.9 ± 12.77 0.7575 the value expressed in mean ± se. fig. 2 b cell-activating factor (baff) levels in sera of the two studied groups. serum level of b cell activating factor the results in figure 2 and table 1 also showed that there were non-remarkable increase (p = 0.7575) in circulating levels of baff in covid-19 patients (436.9 ± 12.77 pg/ml) as com pared to healthy controls (403.0 ± 31.03 pg/ml). relationship between calp, baff, and crp in covid-19 patients correlation analysis assessed the relationships among serum crp levels, calp and baff levels. baff and serum calp levels were positively correlated (r = 0.6923; p = 0.0001) (figure 3). figure 3 also shows a non-significant correlation between serum crp levels and calp (r = 0.3010; p = 0.1271) and baff level (r = 0.2912; p = 0.1406) (figure 3). these research results may link baff activation and the immuno-inflammatory and pathogenic response, indicating disease activity and tissue damage in various chronic viral infection illness states in covid-19. roc curve based on the (receiver operating characteristic) roc curve, the area under the curve (auc) of serum calp and serum baff were (0.5170) and (0.5259) respectively (figure 4). discussion serum level of calprotectin numerous recent studies have discovered that patients with coronavirus disease-19 illness had higher calprotectin levels.1,7 123j contemp med sci | vol. 9, no. 2, march-april 2023: 121–126 h.m. balaky et al. original physiological effects of calprotectin and b cell activating factor in covid-19 patients additionally, these investigations have demonstrated that calprotectin can predict the need for mechanical breathing, identify death, and differentiate between mild and severe illness states.8,13 calprotectin is widely distributed in neutrophils, making up around two-thirds of the cytosol’s soluble protein composition. the strong relationship between serum calprotectin levels and coronavirus’s present and potential severity indicates that neutrophils are implicated as active promoters of inflammation and respiratory impairment in coronavirus disease. the patients who needed mechanical ventilation while in the hospital also had much greater levels of calprotectin. this data shows a direct link between the severe acute respiratory syndrome caused by covid-19, elevated serum calprotectin levels, and neutrophil activation.13 two studies from medical schools in michigan, shanghai, and washington dc, on the role of calprotectin as an early indicator of neutrophil activation in covid-19 disease. the levels of calprotectin were noticeably elevated in hospitalized individuals with coronavirus illness. calprotectin levels also correlate with the severity of respiratory failure and the demand for mechanical ventilation. this favours using calprotectin as a biomarker to estimate the severity of a condition and the likelihood that it will result in mortality. higher levels of calprotectin were also associated with an increased risk of dying from thrombotic issues.13,15 according to fig. 3 correlation of serum calp with baff (a), serum crp with calp (b), serum crp with baff (c). fig. 4 receiver operating characteristic (roc) curve analysis of serum calp levels (a) and baff levels (b). recently released research in the academic journal cell, calprotectin may be able to differentiate between severe and mild covid-19 disease. the circulating biomarker most obviously elevated in patients with advanced illness was calprotectin. this study offers future therapeutic strategies explicitly targeting calprotectin to treat the severe form of covid-19 and shows its potential use in the prognosis of severe disease.8 similar to the current study, two inflammation-related biomarkers, growth differentiation factor-15 and calprotectin, have been researched for their potential role in predicting mortality and disease severity in sars-cov-2 infected patients. the study results show that calprotectin levels are markedly higher in people with covid-19, and they suggest that calprotectin may help assess the severity of the illness and forecast in-hospital mortality.1 calprotectin overexpression may be a direct source of the self-amplifying thrombo-inflammatory storm observed in patients with severe covid-19. silvin et al.8 investigation discovered a connection between elevated calprotectin levels and immature neutrophils and nonclassical monocytes, supporting their hypothesis that this correlation originates from the excessive production of damage-associated molecular patterns. due to the host’s hyperinflammatory response and the rise in inflammatory monocytes, neutrophils, and platelets, it has been proposed that calprotectin is a crucial mediator of specific coagulopathy in severe covid-19 patients.16 according 124 j contemp med sci | vol. 9, no. 2, march-april 2023: 121–126 physiological effects of calprotectin and b cell activating factor in covid-19 patients original h.m. balaky et al. and b lymphocytes, are able to produce baff.39,40 interleukin-10-producing b cells were enriched and more frequent in chronic hepatitis b patients during hepatic flare-ups, according to a study by das et al.32 a different study showed that individuals with chronic hepatitis b have frequently activated b cells, with an abnormally high proportion of these individuals’ b cells exhibiting activation markers. this demonstrates that this subset of b cells may control t-cell immunity in chronic hepatitis.31 the intrinsic b-cell activation molecule fc receptor like1, as well as the b-cell activation markers cd69 and cd86, were also shown to be present in increased amounts in acute and chronic hepatitis b patients.33 these results indicate that b cells are essential for the progression of hbv infection, as well as hbv viral antigens and their interactions with t lymphocytes. additionally, it was thought that baff had a negative impact on the microenvironments of solid and hematological malignancies. so far, it has been demonstrated that baff encourages invasive migration in hypoxic breast cancer cell lines.41 blood baff levels, generated by neutrophils, have been linked to oral cavity cancers.42 it has been observed that the prognosis and circulating baff levels in multiple myeloma are related.43 according to koizumi et al. report.44 it was found that baff promoted tumor invasion and dissemination in human pancreatic cancer cases. however, no research has yet been done to determine how baff contributes to the growth of hepatocellular carcinoma. therefore, based on the available literature data and the results of the present study, serum b cell activating factor contributes to early patient severity of covid-19 and may be a good predictive marker for the disease prognosis. diagnostic performance of serum calp and baff in covid-19 patients due to the non-significantly increased blood levels of calp and baff found in covid-19 patients in the present study, the ability of blood calp and baff to predict covid-19 was assessed using the roc curves. according to a presentation by chen et al.,18 extremely high levels of calprotectin were connected to the poor overall survival of covid-19 patients, supporting the predictability of calprotectin revealed by earlier investigations. recent studies by shi et al.13 and zuo et al.,15 and others13,15 demonstrated high serum calprotectin is closely connected to the likelihood of dying in covid-19, usually from thrombotic problems, which lends credence to the verdicts of the current study. calprotectin is said to have a higher predictive accuracy when compared to the covid-gram risk score created for prediction by liang et al.45 and chen et al.18 calprotectin was thought to have the highest prediction accuracy of all the predictors, according to chen et al.18 they examined the receiver operating characteristic curve (roc) analysis of calprotectin, hmgb1, covid-gram risk score, and calprotectin/hmgb1 combo for predicting icu admission and possible mortality to illustrate results similar to the present investigation. conclusion this study is the first to demonstrate that covid-19 patients had greater serum levels of the potent inflammatory markers calp, baff, and crp. the clinical illness condition of to a recent investigation, people with confirmed sars-cov-2 infection exhibited increased plasma calprotectin levels compared to suspected patients with negative rt-pcr.17 numerous researchers have confirmed the role of calprotectin in evaluating illness severity, including studies by chen et al.,18 kaya et al.,19 garcia de guadiana-romualdo et al.,1 mahler et al.,20 and bauer et al.21 neutrophils are crucial to the immunopathology of covid-19, according to a recent study by tomar et al.22 as a result, it has been discovered that measuring blood calprotectin levels is a trustworthy indication of covid-19 severity. studies proved that neutrophils mainly secrete calprotectin in response to inflammation. recently, it was shown that calprotectin is a biomarker of inflammation that can be used to track the progression of numerous inflammatory diseases.23–28 limited research studies look at the connection between the severity and predicator value of serum calprotectin in covid-19. patients brought to the icu had significantly higher serum levels of calprotectin than non-icu patients, and those who died had much higher levels, according to chen et al.,18 who conducted a study with 121 covid-19 patients (41 icu, 81 non-icu). additionally, that study discovered a correlation between higher mortality in covid-19 patients with a substantial rise in serum calprotectin. in their trial with 94 covid-19 patients, shi et al. study found that patients needing mechanical breathing had higher serum calprotectin levels than those not.13 based on the available literature and the present study results, we can conclude that serum calprotectin may be employed as a predictive biomarker for covid-19 disease severity and prognosis. serum level of b cell activating factor the greater b-cell activation in covid-19 patients may be responsible for the many autoantibodies and immune complexes frequently found in these individuals’ blood. our research offered the first conclusive evidence that circulating baff levels in covid-19 patients were higher than in healthy controls. these findings suggest that baff participates in persistent viral infection and aids in disease progression. specifically, baff impacts b cell development, maturation, survival, and activation.29,30 studies have shown that the process of viral infection caused by covid-19 and others induces contact between t cells and activated b cells with t cells.31-33 moreover, it has been shown that viral infections, including infections with the respiratory syncytial virus, might cause baff release.34,35 consequently, even though the fundamental mechanisms may change, it is believed that baff is frequently produced by viral infection.36 according to previous research, our findings provide new evidence that covid-19 infection may induce the biosynthesis and release of baff, which may affect how b cells react to viral infection. the tumor necrosis factor family member b-cell activating factor (baff), also known as b lymphocyte stimulator (blys) or b cell activating factor, has a unique role in regulating peripheral b-cell survival, homeostasis, and the antibody response.29,37 its believed that baff could reduce apoptosis and essentially enhances t cell-independent and t cell-dependent humoral immune responses. the study led by sutherland et al.38 found that baff increased tand b-cell responses, particularly th1-type responses. numerous cells, particularly those connected to the immuno-inflammatory response, such as monocytes, macrophages, neutrophils, dendritic cells (dcs), t lymphocytes, 125j contemp med sci | vol. 9, no. 2, march-april 2023: 121–126 h.m. balaky et al. original physiological effects of calprotectin and b cell activating factor in covid-19 patients covid-19 and increased baff levels are correlated. the sars-cov-2 infection risk and severity correlated with serum calp and baff levels. the study results suggest a connection between serum baff levels and the manifestation of covid-19, and assessing serum baff levels may be used as an inflammatory biomarker to identify and classify clinical problems related to covid-19. according to the available evidence, calprotectin may be a valuable inflammatory biomarker to evaluate the risk and severity of covid-19. the relationship between calprotectin and the inflammatory process may present fresh opportunities for managing and improving covid-19. the combined use of serum calp, baff and crp levels may be helpful to evaluate and understand how inflammation-related factors such as viral load, sars-cov2 antibodies, corticosteroid use, anticoagulants, and pharmaceutical agents would affect neutrophil function. a comprehensive prospective investigation is required to comprehend the progression of the covid-19 infection, the potential role of blood baff levels in determining and monitoring the condition’s prognosis, and the treatment response to immunomodulatory medicine. additional study is also required to completely comprehend the roles played by baff in the emergence of covid-19-associated diseases and the development of the infection. conflict of interest all authors declare that they have no conflicts of interest.  references 1. garcía de guadiana-romualdo, l. et al. circulating levels of calprotectin, a signature of neutrophil activation in prediction of severe respiratory failure in covid-19 patients: a multicenter, prospective study (calcov study). inflammation research 71, 57–67 (2022). 2. guan, w.-j. et al. clinical characteristics of coronavirus disease 2019 in china. new england journal of medicine 382, 1708–1720 (2020). 3. machhi, j. et al. the natural history, pathobiology, and clinical manifestations of sars-cov-2 infections. journal of neuroimmune pharmacology 15, 359–386 (2020). 4. chang, s. e. et al. new-onset igg autoantibodies in hospitalized patients with covid-19. nature communications 12, 1–15 (2021). 5. van kampen, j. j. et al. duration and key determinants of infectious virus shedding in hospitalized patients with coronavirus disease-2019 (covid-19). nature communications 12, 1–6 (2021). 6. ortega, n. et al. seven-month kinetics of sars-cov-2 antibodies and role of pre-existing antibodies to human coronaviruses. nature communications 12, 1–10 (2021). 7. udeh, r., advani, s., de guadiana romualdo, l. g. & dolja-gore, x. calprotectin, an emerging biomarker of interest in covid-19: a systematic review and meta-analysis. journal of clinical medicine 10, 775 (2021). 8. silvin, a. et al. elevated calprotectin and abnormal myeloid cell subsets discriminate severe from mild covid-19. cell 182, 1401–1418. e1418 (2020). 9. jukic, a., bakiri, l., wagner, e. f., tilg, h. & adolph, t. e. calprotectin: from biomarker to biological function. gut 70, 1978–1988 (2021). 10. wang, l. et al. b cell activating factor regulates periodontitis development by suppressing inflammatory responses in macrophages. bmc oral health 21, 1–15 (2021). 11. yang, s.-c., tsai, y.-f., pan, y.-l. & hwang, t.-l. understanding the role of neutrophils in acute respiratory distress syndrome. biomedical journal 44, 439–446 (2021). 12. veras, f. p. et al. sars-cov-2–triggered neutrophil extracellular traps mediate covid-19 pathology. journal of experimental medicine 217 (2020). 13. shi, h. et al. neutrophil calprotectin identifies severe pulmonary disease in covid‐19. journal of leukocyte biology 109, 67–72 (2021). 14. nascimento, m. et al. b-cell activating factor secreted by neutrophils is a critical player in lung inflammation to cigarette smoke exposure. frontiers in immunology 11, 1622 (2020). 15. zuo, y. et al. neutrophil extracellular traps in covid-19. jci insight 5 (2020). 16. hanssen, n. m., spaetgens, b., nagareddy, p. r. & murphy, a. j. dam pening mortality in covid-19: therapeutic insights from basic cardiometabolic studies on s100a8/a9. circulation 143, 971–973 (2021). 17. cherubini, f., cristiano, a., valentini, a., bernardini, s. & nuccetelli, m. circulating calprotectin as a supporting inflammatory marker in discriminating sars-cov-2 infection: an observational study. inflammation research 70, 687–694 (2021). 18. chen, l. et al. elevated serum levels of s100a8/a9 and hmgb1 at hospital admission are correlated with inferior clinical outcomes in covid-19 patients. cellular & molecular immunology 17, 992–994 (2020). 19. kaya, t. et al. serum calprotectin as a novel biomarker for severity of covid-19 disease. irish journal of medical science (1971-) 191, 59–64 (2022). 20. mahler, m., meroni, p.-l., infantino, m., buhler, k. a. & fritzler, m. j. circulating calprotectin as a biomarker of covid-19 severity. expert review of clinical immunology 17, 431–443 (2021). 21. bauer, w. et al. outcome prediction by serum calprotectin in patients with covid-19 in the emergency department. journal of infection 82, 84–123 (2021). 22. tomar, b., anders, h.-j., desai, j. & mulay, s. r. neutrophils and neutrophil extracellular traps drive necroinflammation in covid-19. cells 9, 1383 (2020). 23. romand, x. et al. systemic calprotectin and chronic inflammatory rheumatic diseases. joint bone spine 86, 691–698 (2019). 24. wirtz, t. h. et al. association of serum calprotectin concentrations with mortality in critically ill and septic patients. diagnostics 10, 990 (2020). 25. kunutsor, s. k. et al. plasma calprotectin and risk of cardiovascular disease: findings from the prevend prospective cohort study. atherosclerosis 275, 205–213 (2018). 26. wang, q., chen, w. & lin, j. the role of calprotectin in rheumatoid arthritis. journal of translational internal medicine 7, 126–131 (2019). 27. yurtsever kum, n. et al. elevated serum calprotectin as an inflammatory marker in obstructive sleep apnea. cranio®, 1–7 (2020). 28. candar, t., baklacı, d., kuzucu, i̇. & kayabaşı, s. a proinflammatory marker in chronic rhinosinusitis: serum calprotectin. acta biochimica polonica (2020). 29. do, r. k. g. & chen-kiang, s. mechanism of blys action in b cell immunity. cytokine & growth factor reviews 13, 19–25 (2002). 30. schneider, p. & tschopp, j. baff and the regulation of b cell survival. immunology letters 88, 57–62 (2003). 31. oliviero, b. et al. enhanced b-cell differentiation and reduced proliferative capacity in chronic hepatitis c and chronic hepatitis b virus infections. journal of hepatology 55, 53–60 (2011). 32. das, a. et al. il-10–producing regulatory b cells in the pathogenesis of chronic hepatitis b virus infection. the journal of immunology 189, 3925–3935 (2012). 33. wang, k. et al. overexpression of fc receptor-like 1 associated with b-cell activation during hepatitis b virus infection. brazilian journal of medical and biological research 45, 1112–1118 (2012). 34. toubi, e. et al. elevated serum b-lymphocyte activating factor (baff) in chronic hepatitis c virus infection: association with autoimmunity. journal of autoimmunity 27, 134–139 (2006). 35. mcnamara, p. et al. respiratory syncytial virus infection of airway epithelial cells, in vivo and in vitro, supports pulmonary antibody responses by inducing expression of the b cell differentiation factor baff. thorax 68, 76–81 (2013). 36. ittah, m. et al. induction of b cell-activating factor by viral infection is a general phenomenon, but the types of viruses and mechanisms depend on cell type. journal of innate immunity 3, 200–207 (2011). 37. rahman, z. s. & manser, t. b cells expressing bcl-2 and a signaling-impaired baff-specific receptor fail to mature and are deficient in the formation of lymphoid follicles and germinal centers. the journal of immunology 173, 6179–6188 (2004). 38. sutherland, a. p. et al. baff augments certain th1-associated inflammatory responses. the journal of immunology 174, 5537–5544 (2005). 39. nardelli, b. et al. synthesis and release of b-lymphocyte stimulator from myeloid cells. blood, the journal of the american society of hematology 97, 198–204 (2001). 126 j contemp med sci | vol. 9, no. 2, march-april 2023: 121–126 physiological effects of calprotectin and b cell activating factor in covid-19 patients original h.m. balaky et al. 40. scapini, p. et al. g-csf–stimulated neutrophils are a prominent source of functional blys. the journal of experimental medicine 197, 297–302 (2003). 41. zhu, j. et al. blys is up-regulated by hypoxia and promotes migration of human breast cancer cells. journal of experimental & clinical cancer research 31, 1–7 (2012). 42. jablonska, e. et al. overexpression of b cell-activating factor (baff) in neutrophils of oral cavity cancer patients—preliminary study. neoplasma 58, 211 (2011). 43. fragioudaki, m. et al. serum baff levels are related to angiogenesis and prognosis in patients with multiple myeloma. leukemia research 36, 1004–1008 (2012). 44. koizumi, m. et al. increased b cell-activating factor promotes tumor invasion and metastasis in human pancreatic cancer. plos one 8, e71367 (2013). 45. liang, w. et al. development and validation of a clinical risk score to predict the occurrence of critical illness in hospitalized patients with covid-19. jama internal medicine 180, 1081–1089 (2020). this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v9i2.1327 408 j contemp med sci | vol. 8, no. 6, november-december 2022: 408–412 original an evaluation of blood components inventory management during hajj and umrah season at makkah hospitals saeed m kabrah* laboratory medicine department, faculty of applied medical sciences, umm al-qura university, makkah, kingdom of saudi arabia. *correspondence to: saeed m kabrah (e-mail: smkabrah@uqu.edu.sa) (submitted: 04 october 2022 – revised version received: 21 october 2022 – accepted: 12 november 2022 – published online: 26 december 2022) abstract objectives: the current study aims to utilize blood bank data collected from the army forces hospital in makkah to improve transfusion services at makkah hospitals and evaluate the inventory system during the hajj season. methods: three years’ results showed that blood centre production is not constant, with an average of 1800 units during hajj season that includes cryo (450), ffp (450), plt (450), and prbc (450) units. moreover, data indicated that the average usage of units is 1119 during the same season (120 cryo, 424 ffp, 207 plt and 368 prbc). results: this demonstrated that the inventory of blood units fluctuates during the year with an overproduction of cryo (80%), ffp (67%), plt (83%) and prbc (57%) units in hajj season. it can be concluded that the manner and effectiveness with which the present issues in makkah blood banking are having a major impact on the current system used to obtain the nation’s blood supply and the safety, adequacy, and operational cost of that supply. conclusion: the current study recommends building a generic data warehouse with smart decision support systems that use artificial intelligence to maintain blood bank production and inventory system during the year, especially during hajj and umrah seasons. keywords: blood banks, supply, equipment and supplies, blood units, makkah issn 2413-0516 introduction the islamic hajj gathering in makkah, saudi arabia, is considered as one of the largest global gatherings. the number of pilgrims for both hajj and umrah can reach up to 10 million people annually from more than 180 countries around the globe. during hajj in 2015, 2016, and 2017 more than 2 million pilgrims came to makkah.1 in saudi arabia and over the course of years, a modern surveillance system for hajj has been developed and is continually improving with experiences and advances in the technology.1,2 this surveillance system is essential to minimize accidents and ensure proper infection control during hajj and umrah. additionally, riyadh seasons, formula 1 saudi arabia grand prix and other massive gathering events are increasing in saudi arabia with recent development and changes. also, saudi arabia is threatened continuously by constant attacks to hit civilian areas, schools, and hospitals. planning and organising emergency plans in such a situation are essential to address all possible needs.3–5 such planning and organizational efforts require collecting and analysing data gathered from different authorities during such events.3–5 major traumatic injuries during hajj and umrah include stampedes, fire, traffic accidents and other injuries. for example, during the hajj season in september 2015, 107 pilgrims died, and 394 were injured in the crane collapse accident at the building site of the grand mosque in makkah.1,2 also, in the same year, 769 pilgrims died, and 934 were injured in the stampede accident in mina at the jamaraat bridge.6 the casualty numbers in these accidents created strains on all the healthcare systems in makkah region.1,6 of the main systems that could be affected during such incidents is the blood banking systems in different hospitals in the makkah region. these blood banks need to work effortlessly to provide blood units and blood components to cover the need. thus, careful planning and management of the blood banking systems in these situations are key to avoiding serious effects and losses of lives.7,8 this planning should be built around the distribution of abo and rh blood groups of blood donors in the ksa.9 in hajj, hospitals in the makkah region have records of the blood unit requests, numbers of donations, and shortages during that time. careful analysis of such data and reviewing of the finding to improve the plans and regulations during hajj, umrah and other events is critical. thus, this study aimed to measure donor attendance and donation trends in hajj and umrah seasons and evaluate the blood components productions simultaneously. furthermore, it measured the blood units’ demand to assist in efficient ways of managing blood supply and demand during the hajj and umrah and similar future public or mass gathering emergencies. methods study design the current study is a retrospective study based on data collection from a laboratory information system using blood donor records and unit production during the period from 1436 to 1440 hijri at security forces hospital program in makkah. ethical approval the data were obtained from the blood bank unit of the hospital after optioning ethical approval from the internal review board at security forces hospital program in makkah (0211-120818). data collection tools data for this study were obtained using an excel template (microsoft version 360) of donors’ lab records at the security forces hospital program (sfh) in makkah. all data during the period from 1436h to 1440 hijri were included in the study, as there were no exclusion criteria. subsequently, data cleaning was performed to organize the data and remove any duplication. mailto:smkabrah@uqu.edu.sa 409j contemp med sci | vol. 8, no. 6, november-december 2022: 408–412 s.m. kabrah original impact of hajj and umrah on blood inventory statistics data was reviewed and analysed using the statistical package of social sciences (spss version 24); the descriptive statistics were presented in count and percentages. the chi-square test was performed to compare the number of donors with other variables, and p-value > 0.05 were considered statistically significant. results overview of blood donation and unit production from 1436-1440h a retrospective study was conducted on 5473 blood donors who donated blood at the security forces hospital program in makkah from 1436h to 1440h. details of blood donation and blood units’ production were summarised in table 1. the table demonstrated that blood donation frequency varies through the years and months. only 11.4% (626) of the participant was in 1440h, which was the lowest year with recorded donations, and a large number of participants in 1437h, 27.8% (1523), followed by year 1439h were participant was 26.7% (1462). data demonstrated that blood donation was lowest in ramadan at 5% (272) compared to other months; also, shawal was 6.5% (355), dhul qadah was 9.7% (529), and dhul hijjah was 8.4% (458). results showed that a total of 21205 blood unit components were collected during the study period 1436– 1440. the most collected blood unit was packed red cells (25.8%), followed by platelet (25.1%), fresh frozen plasma (25.1%), and then cryoprecipitate (24%), respectively. the monthly report of blood donation distribution between 1436h to 1440h showed fluctuation in the number of donations depending on the month data for the five years were recorded from the month of muharram to dhul hijjah. the monthly breakdown of blood units collected each year is shown in figure 1. data indicated that the frequency of blood donation trends varies throughout the years and months. in muharram, the blood donation rate was low compared to other months, then it started to increase in the middle of the year and dropped again to a similar rate in dhul hijjah. there was a notable drop in the number of donors during ramadan in all years, and it was the lowest compared to other months in the same year. in addition to the 12th month of hajj, the donation rate also decreased compared to other months in all years. the year 1440h was the lowest compared to other years since donation numbers were zeroes from the 5th to 12th months, in addition to the year 1438h were zeros from month 8th to 12th. results indicated that there were statistical differences in comparing rates of donation, a p-value of 0.0001. utilization of blood components between 1436h to 1440h showed that the unit production did not cover the needs blood units’ production and usage data for the five years were recorded. the monthly breakdown of the percentage of blood units’ utilization for each year is shown in table 2. data demonstrated that utilization of blood units differs according to year, month, and type of blood unit. data indicated that during ramadan, production of the blood units exceeded the usage for cryo (52.9%), prbc (52.2%), plt (25.0%) and ffp (17.6%). a similar finding was observed during hajj too, where the production increased for cryo (81.1%), plt (91.6%) and ffp (55.8%), with the expectation of prbc, where the production decreased by (–29.5%). furthermore, results indicated that hajj and umrah seasons impact the unit’s utilisation where unit production does not cover the needs. table 1. characteristics of blood donation and production during the study period characteristic n % frequency of blood donation during arabic months 1. muharram 423 7.7 2. safar 487 8.9 3. rabi al-awwal 431 7.9 4. rabi al-thani 599 10.9 5. jamada al-awwal 558 10.2 6. jamada al-thani 494 9.0 7. rajab 461 8.4 8. shaban 406 7.4 9. ramadan 272 5.0 10. shawwal 355 6.5 11. dhul qadah 529 9.7 12. dhul hijjah 458 8.4 total 5473 100.0 frequency of blood donation during hijry years 1436 856 15.6 1437 1523 27.8 1438 1006 18.4 1439 1462 26.7 1440 626 11.4 total 5473 100.0 frequency of blood units produced cryo 5084 24.0 ffp 5326 25.1 plt 5322 25.1 prbs 5473 25.8 total 21205 100 this table shows the demographic characteristics of blood donors who participated in the study. number (n) and percentage (%). fig. 1 number of donors from 1436 to 1440. this figure shows the distribution of blood donors among hejry months. p-value was 0.0001. 410 j contemp med sci | vol. 8, no. 6, november-december 2022: 408–412 impact of hajj and umrah on blood inventory original s.m. kabrah ta bl e 2. p er ce nt ag e of th e ut ili za tio n of b lo od co m po ne nt s a t s fh -m ak ka h ho sp ita l ye ar un it ty pe m on th av er ag e pva lu e 1 2 3 4 5 6 7 8 9 10 11 12 14 37 cr yo 60 .0 10 0. 0 10 0. 0 68 .7 72 .4 36 .2 80 .5 83 .7 52 .9 67 .0 94 .7 81 .1 75 0. 05 1 ff p –8 .0 10 0. 0 85 .7 60 .0 75 .6 –5 8. 5 58 .5 67 .4 17 .6 46 .2 88 .6 55 .8 49 pl t 14 .0 90 .1 56 .0 19 .1 7. 3 9. 6 –2 .4 82 .6 25 .0 35 .2 96 .5 91 .6 44 pr bc 56 .0 53 .1 65 .9 29 .6 53 .7 28 .7 –2 2. 0 56 .5 52 .2 6. 6 41 .2 –2 9. 5 33 14 38 pr bc 22 .0 51 .4 28 .9 59 .6 46 .0 45 .7 –1 4. 1 59 .0 52 .3 41 .3 51 .7 30 .3 40 0. 04 9 cr yo 57 .8 10 0. 0 91 .2 95 .7 83 .3 75 .0 87 .1 94 .3 83 .0 85 .6 10 0. 0 74 .2 86 ff p 40 .4 10 0. 0 71 .9 75 .2 58 .7 47 .4 32 .9 67 .9 –0 .6 59 .3 90 .4 33 .5 56 pl t 39 .4 78 .0 63 .2 92 .2 51 .6 58 .6 83 .5 94 .8 91 .5 68 .9 77 .5 78 .1 73 14 39 cr yo 60 .0 10 0. 0 10 0. 0 68 .7 72 .4 36 .2 80 .5 83 .7 52 .9 67 .0 94 .7 81 .1 75 0. 05 0 ff p –8 .0 10 0. 0 85 .7 60 .0 75 .6 –5 8. 5 58 .5 67 .4 17 .6 46 .2 88 .6 55 .8 49 pl t 14 .0 90 .1 56 .0 19 .1 7. 3 9. 6 –2 .4 82 .6 25 .0 35 .2 96 .5 91 .6 44 pr bc 56 .0 53 .1 65 .9 29 .6 53 .7 28 .7 –2 2. 0 56 .5 52 .2 6. 6 41 .2 –2 9. 5 33 14 40 cr yo 60 .0 10 0. 0 10 0. 0 68 .7 72 .4 36 .2 80 .5 83 .7 52 .9 67 .0 94 .7 81 .1 75 0. 04 ff p –8 .0 10 0. 0 85 .7 60 .0 75 .6 –5 8. 5 58 .5 67 .4 17 .6 46 .2 88 .6 55 .8 49 pl t 14 .0 90 .1 56 .0 19 .1 7. 3 9. 6 –2 .4 82 .6 25 .0 35 .2 96 .5 91 .6 44 pr bc 56 .0 53 .1 65 .9 29 .6 53 .7 28 .7 –2 2. 0 56 .5 52 .2 6. 6 41 .2 –2 9. 5 33 to ta l cr yo 60 .0 10 0. 0 10 0. 0 68 .7 72 .4 36 .2 80 .5 83 .7 52 .9 67 .0 94 .7 81 .1 75 0. 04 ff p –8 .0 10 0. 0 85 .7 60 .0 75 .6 –5 8. 5 58 .5 67 .4 17 .6 46 .2 88 .6 55 .8 49 pl t 14 .0 90 .1 56 .0 19 .1 7. 3 9. 6 –2 .4 82 .6 25 .0 35 .2 96 .5 91 .6 44 pr bc 56 .0 53 .1 65 .9 29 .6 53 .7 28 .7 –2 2. 0 56 .5 52 .2 6. 6 41 .2 –2 9. 5 33 411j contemp med sci | vol. 8, no. 6, november-december 2022: 408–412 s.m. kabrah original impact of hajj and umrah on blood inventory discussion hospitals are the first place the wounded are relocated to when a natural or manufactured disaster occurs, and it may generate many types of injuries that may require the use of blood units. such events may also occur in mass gatherings such as hajj and umrah. for this reason, blood banks must be prepared for a rapid supply of units to the patients. for that, this study attempted to analyse the blood unit production and utilisation at sfh-makkah during 1436–1440. a close view of the blood units’ usage would help focus on frequent wastage and improve the blood bank services at makkah, especially during hajj and umrah seasons. subsequently, it would further help authorities design intervention measures to prevent such issues and improve blood unit management throughout makkah hospitals. the current statistics showed that the number of blood donors varies according to the islamic months, especially during hajj and umrah seasons, where the lowest donation number was observed in ramadan (272), shawal (355), dhul qadah (529), and dhul hijjah was (458). this indicates that the blood centre lacks an adequate number of volunteer and non-volunteer blood donors, which can impact the access to enough blood to meet patients’ current and future needs. similarly, alkahtani and jilani10 demonstrated that the number of blood donors decreased in june and september in 2017 and 2018, corresponding to the ramadan and hajj periods. they also proved the importance of predicting return donors and analysing blood donation time series using data mining techniques to sustain an adequate blood supply during islamic seasons. nevertheless, 43 well-defined blood group systems have more than 340 antigens,11 but generally, only abo and rhd blood group status is considered for donation and transfusion in saudi arabia. this increases the chances of alloimmunisation if the donor and recipient are of different ethnic backgrounds with varied blood antigenic profiles. during hajj and umrah, a large diversity of ethnicity is observed, especially since muslims worldwide visit makkah during different times of the year.12 such diversity can cause a challenge for hospitals to provide suitable blood units for non-saudi patients if needed. these facts highlight the need to promote local blood donation and the need for extended blood group phenotyping. a canadian researcher observed a similar finding that proved that global antigen demand affected community-directed recruitment, including blood drives and the benefits of the mass-scale cell genotyping.13 according to the results, blood unit use varies by year, month, and kind of blood unit. furthermore, the results revealed that the hajj and umrah seasons influenced unit usage when unit production was insufficient to meet demands. by reviewing the project outcomes with blood bank staff, it was noted that the significant reason for utilising the components might be communication between centres in makkah. it was also recommended that there is always a more considerable blood shortage, and a need for awareness is essential among laboratory staff, nurses, and physicians on handling blood products. similar to the results of other studies, where they indicated a significant improvement in blood products management after the educational programme.14,15 packed cells were the most frequently collected of the four blood components collected at sfh-makkah, followed by fresh frozen plasma, platelet, and cryoprecipitate. the current finding agrees with another research.16,17 the present study did not include the production and utilisation of the whole blood unit since whole blood is not frequently used except in a patient who lost more than 75% of the blood volume. consequently, the current results prove that the national health authorities must become more involved in the blood donation, unit production and transfusion field’s fundamental improvement. this involves establishing national legislation that acknowledges blood donation and production, unit safety and transfusion as top public health issues. the saudi health ministry must establish a national regulatory agency to manage a national blood bank quality system and the country’s blood supply. it would operate as a bridge between the many professionals in the blood transfusion business. a reliable haemovigilance reporting system is also necessary to track quality improvement and evaluate all transfusion-related mediumand long-term consequences. blood component management remains an issue for all health services worldwide; it requires inexpensive and easy interventions such as research and staff education, a centralised digital management system, and enhanced transportation. furthermore, identification modalities are required that can have a critical and dramatic influence on improving the management concerning cost and resource savings.1,4 cryo and ffp have a shelf life of 24 hours after preparation, and it has been noted in the current study that there needs to be a clear policy regarding requesting such units. moreover, as blood products have a restricted half-life, accurate strategies should be enforced for blood supplies to prevent loss and reduce waste as much as possible.4,5 the saudi health authority needs to create an emergency operations plan that focuses on education, assigning roles, and makkah blood banks practising and should be based on reviewing the national plan need to occur. there is also a need to integrate hajj data management systems with blood unit surveillance as an early warning system for blood donation and transfusion control during hajj and umrah. similar findings were also demonstrated if the infectious disease during hajj1,18 also during the covid-19 pandemic.19 international engagement is essential to strengthening national blood surveillance because blood groups differ based on ethnicity. this plan should include an intelligent digital management system that improves the current practice and reduces human error during mass gathering events. such a system should consist of an intellectual multi period decision-making framework for emergency blood allocation considering supply and demand uncertainties in the disaster maintenance operations.20 also, it should consider blood groups, age and blood substitution. the finding of this work presented a clear picture of the limitations and challenges that face the saudi ministry of health and the ministry of hajj and umrah each year during the hajj and umrah seasons. also, they provide insight into the importance of communication and information sharing during that period of the year. additionally, with the changes in the umrah allowance periods, now the season is open almost all year long, which presents the sectors with more significant challenges and solutions needed. additional events of massive gatherings are also planned in the near future, which would add up to the stress of managing emergencies. thus, recommendations are all aimed at expanding the current study to include all hospitals in makkah, as these hospitals are the hot spots facing these challenges. also, to activate the intelligent blood bank centralisation management system. this system should survey, gather data, and analyse it to plan. also, there should be a clear policy to manage massive gatherings 412 j contemp med sci | vol. 8, no. 6, november-december 2022: 408–412 impact of hajj and umrah on blood inventory original s.m. kabrah and procedures to follow to plan care and emergencies, including blood bank supply. this system should also manage the blood group distribution of patients and donors.9 another aspect to consider in future work is expanding the data analysis range to include more details, such as common and rare blood groups and planning to secure sources for such rare types. this is essential to consider as in the hajj and umrah seasons, people gather from all locations around the world with all possibilities for rare blood antigens. managing blood banks should be an essential topic in massive gatherings of management studies and policies and regulations. conclusion the study showed blood unit production and utilisation were influenced by hajj and umrah seasons at the sfc-makkah; the most shortage was observed in prbc and platelets. globally, the wastage of blood in hospitals is universal and should be addressed with easy and inexpensive interventions to improve blood component management. programs to encourage blood donations during hajj and umrah seasons should be increased to accommodate the needs of blood units during the same period. moreover, developing national and local guidelines prioritising blood transfusion during seasons and mass gathering is critical. such guidelines should closely monitor blood needs and supply, including the appropriate response for any events that are essential to avoid sudden blood shortages. also, an evidence-based emergency blood unit management plan and flexible regulatory policy should be implemented to manage any disaster that leads to blood shortage. finally, the current research highly recommends developing an intelligent decision-making system to improve the management of blood units, as blood is a vital and rare resource. acknowledgment the author would like to thank the sfh hospital, in makkah, saudi arabia, for supporting this work. conflict of interest the authors declare that there are no conflicts of interest regarding the publication of this paper. funding this project was not funded by any organisation. data and resource availability statement the data that support the findings of this study are available from sfh hospital makkah, but restrictions apply to the availability of these data, which were used under license for the current research and therefore are not publicly available. data are however available from the authors upon reasonable request and with permission of sfh hospital makkah. additionally, the resource generated during and/or analysed during the current study is available from the corresponding author upon reasonable request.  references 1. alotaibi bm, yezli s, bin saeed aa, turkestani a, alawam ah, bieh kl. strengthening health security at the hajj mass gatherings: characteristics of the infectious diseases surveillance systems operational during the 2015 hajj. j. travel med. 2017;24(3):1–6. doi:10.1093/jtm/taw087. 2. memish za, zumla a, alhakeem rf, assiri a, turkestani a, al harby kd, alyemni m, dhafar k, gautret p, barbeschi m, mccloskey b, heymann d, al rabeeah aa, al-tawfiq ja. hajj: infectious disease surveillance and control. lancet 2014;383(9934):2073–2082. doi:10.1016/s0140-6736(14)60381-0. 3. bundy kl, foss ml, stubbs jr. transfusion service disaster planning. immunohematology 2008;24(3):93–101. 4. zaheer ha, waheed u. blood transfusion service in disasters. transfus apher sci 2016;55(2):186–190. doi:10.1016/j.transci.2016.09.007. 5. gschwender an, laurie g. disaster preparedness in the blood bank. american society for clinical laboratory science 2017;30(4):250–257. 6. memish za, steffen r, white p, dar o, azhar ei, sharma a, zumla a. mass gatherings medicine: public health issues arising from mass gathering religious and sporting events. lancet 2019; 393(10185):2073–2084. doi:10.1016/s0140-6736(19)30501-x. 7. biddinger pd, baggish a, harrington l, d’hemecourt p, hooley j, jones j, kue r, troyanos c, dyer ks. be prepared—the boston marathon and mass-casualty events. n engl j med 2013;368(21):1958–1960. doi:10.1056/nejmp1305480. 8. dong yh, liu f, liu ym, jiang xr, zhao zx. emergency preparedness for mass gatherings: lessons of “12.31” stampede in shanghai bund. chin j traumatol. 2017;20(4):240–242. 9. kabrah sm, flemban af, khogeer aa, bawazir wm. reviewing publication discussing the frequency of abo and rhesus-d blood groups in saudi arabia. j res med dent sci. 2021;9(10):29–37. 10. alkahtani sa, jilani m. predicting return donor and analyzing blood donation time series using data mining techniques. int j adv comput sci appl 2019;10(8):113–118. 11. isbt. (2021). “red cell immunogenetics and blood group terminology.” retrieved 30/10, 2021, from https://www.isbtweb.org/working-parties/redcell-immunogenetics-and-blood-group-terminology. 12. gafs. (2021). “hajj report.” retrieved 30/10, 2021, from https://www.stats. gov.sa/en/statistical-knowledge. 13. trepanier p, chevrier mc, constanzo yanez j, baillargeon n, st-pierre c, perreault j. adapting to supply-and-demand emerging trends for antigen-negative red blood cell units. transfusion 2021;61(5):1489–1494. doi:10.1111/trf.16285. 14. islami vaghar m. the impact of an educational program on blood and blood products transfusion on nurses’ level of knowledge and performance. j med life 2018;11(3):238–242. doi:10.25122/jml-2018-0016. 15. riveira mc, louzon mj, tuott ee, monoski tj, cruz-cody vg, tesfamariam a, hess jr. blood school: a laboratory-based transfusion class for nurses. am. j. clin. pathol. 2020;153(4). 16. elsayid m, aseeri yy, saqri fa, alanazi a, qureshi s. a study of prevalence of blood group of saudi patients in king abdulaziz medical city, riyadh. sci j public health 2015;3(4). doi:10.11648/j.sjph.20150304.25. 17. safia moussa, fatmah al-zaylai, may o alnawmasi, mona s aljarwan, hayam a lshammari, layali m alrashedi, aloufi sa. pattern of distribution of abo and rhesus (rh) blood groups in hail province, saudi arabia. ijmrhs 2018;4(3). 18. qanta aa, maurizio b, ziad am. the quest for public health security at hajj: the who guidelines on communicable disease alert and response during mass gatherings. travel med infect dis. 2009; 7(4):226–230. 19. yahia aio. management of blood supply and demand during the covid-19 pandemic in king abdullah hospital, bisha, saudi arabia. transfus apher sci 2020;59(5):102836. doi:10.1016/j.transci.2020.102836. 20. ma z, wang k, dai y. an emergency blood allocation approach considering blood group compatibility in disaster relief operations. int j disaster risk sci 2019;10:74–88. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i6.1303 https://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-blood-group-terminology https://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-blood-group-terminology https://www.stats.gov.sa/en/statistical-knowledge https://www.stats.gov.sa/en/statistical-knowledge 28 j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 original comparison of rectal suppository and intramuscular morphine for management of patients with renal colic referred to the emergency department: a randomized double-blinded controlled trial arash ardestani zadeh1, mohammadreza moonesan2, fatemeh taheri1, davood arab1*, tahmineh mokhtari3,4* 1clinical research development unit, kowsar educational, research and therapeutic hospital, semnan university of medical sciences, semnan, iran. 2department of emergency medicine, kosar hospital, semnan university of medical sciences, semnan, iran. 3hubei key laboratory of embryonic stem cell research, hubei university of medicine, shiyan, china. 4department of histology and embryology, school of basic medical sciences, hubei university of medicine, shiyan, china. *correspondence to: tahmineh mokhtari (email: mokhtari.tmn@gmail.com), davood arab (email: drdavoodarab@semums.ac.ir) abstract objectives: to compare the analgesic effects of rectal suppository morphine (rsm) with intramuscular morphine (imm) in patients suffered from renal colic referred to emergency ward (ew). methods: in a controlled, randomized, clinical trial, 74/90 patients with renal colic referred to the ew between march 2016 and march 2017 were randomly enrolled into two groups of rsm (10 mg) and imm (10 mg/ml). vital signs and severity of pain were recorded at admission time (0), 15, 30 and 60 min after treatment. results: the results showed that there was a significant decrease in vas score of rsm group compared to imm group after 30 and 60 min of administration (p < 0.05). furthermore, no significant difference was recorded in vital signs, except there was a significant decrease in heart rate (15 and 60 min) and respiratory rate (60 min) of rsm group compared to imm group (p < 0.05) and no side effects were recorded during the investigation. conclusion: in conclusion, the use of rectal route of morphine had higher efficiency compared to the im route of morphine in relieving pain of patients with renal colic. although, decreased heart and respiratory rates were recorded, the values were in normal range. as well, no major complications were recorded for each method. keywords: renal colic, morphine; pain management, suppositories, injections, intramuscular issn 2413-0516 introduction urolithiasis has been shown to be a common disease with incidence of 8–15% in north americans and europeans for centuries.1 approximately 2.4/1000 people in iran suffer from renal colic, whereas it differs from 0.5 to 2 in every 1000 ones in other countries.2 the mean cost of urolithiasis and renal colic was estimated about 2.1 billion dollars in 2000.3 recently, it has been reported that changes in individuals’ diet and lifestyle leads to increase in incidence of renal colic worldwide.4 renal colic as a frequent disorder usually presents as an acute and severe pain in the flanks due to obstruction of the urinary flow via a stone or the passage of a stone from the urinary tract, which can radiate to the abdomen and genitalia.5,6 this type of pain is often defined as the worst pain which patient has ever experienced.7,8 the mechanism of pain is associated with the enhanced pressure in the urinary tract along with construction of urethral smooth muscles and enhanced pressure in the regional blood flow.9 a wide range of analgesics are used to manage the pain. in emergency ward (ew), opioids and non-steroidal anti-inflammatory drugs (nsaids) are most frequent to relieve the pain.10 according to the literature, stable doses of opioids can provide analgesic impacts for weeks or years and efficiency, low cost, and titration possibility make them popular for managing pain.3,11 the high doses of opiates administered systemically has been shown to be related to different side effects e.g., respiratory depression, vomiting, nausea, sedation, and pruritus.12 on the other hand, the human rectum is a body cavity in which drugs can be retained and absorbed easily and is effective rather than orally, especially in cases with nausea and vomiting.13 as a most common type of opioids, morphine is an analgesic with a direct impact on the central nervous system (cns) and the most powerful analgesic drugs in managing and curing severe, acute and chronic pains.14 different routes of morphine have been used to control pain in patients following operation or in emergency department.15-17 morphine suppositories administered via rectal route are one of the newly released morphine forms. different doses of 5, 10, 20, and 30 mg of morphine can be contained in each rectal suppository. it has been shown that about two-thirds of rectal morphine can be absorbed via the gastrointestinal tract and then, it paases through portal vein to be metabolized in the liver. the maximum effects of rectal route has been recorded 20–60 min following administration.12 the administration of suppository morphine is often forgotten by clinicians seeking to use the oral routs18 and to the best of our knowledge, there was no previous study to compare the analgesic effect of rectal suppository morphine (rsm) with intramuscular morphine (imm) to relieve pain in patients with renal colic. materials and methods study population this study was a randomized, controlled, clinical trial was performed between march 2016 and march 2017. ninety patients with renal colic (18 to 55 years) referred to ew of kosar hospital (semnan university of medical sciences, semnan, iran) were randomly selected, but 74 patients were eligible to be enrolled. this trial was approved by ethics committee of (submitted: 01 december 2022 – revised version received: 22 december 2022 – accepted: 02 january 2023 – published online: 26 february 2023) mailto:mokhtari.tmn@gmail.com mailto:drdavoodarab@semums.ac.ir 29j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 a.a. zadeh et al. original suppository or intramuscular morphine for pain control in renal colic semnan university of medical sciences (5/1/2016). written informed consent form was signed by all subjects to accept that they had adequate information about the investigation. the study was registered at iranian registry of clinical trial (irct number: irct2015111825098n1). inclusion and exclusion criteria in this study, 90 patients referred to ew with main complaint of flank pain, and the patients who clinically diagnosed for renal colic were selected. the inclusion criteria were defined as all cases with acute severe flank pain that radiated to ipsilateral groin or abdomen. then, the urinary stone was confirmed through ultrasonography, computed tomography (ct) scan, or intravenous (iv) pyelography, or the patients with stone passage and the patients were selected for investigation. the exclusion criteria was described as follows: patients with history of allergy to opioids, addiction, fever ≥38ºc, unstable hemodynamic status, liver failure, cardiac or respiratory failure, evidence of peritoneal inflammation, renal failure or kidney transplantation, aortic aneurysm or dissection, pregnancy, receiving any analgesia within 6 h before the study and age <18 and >55 years. an emergency medicine specialist performed all evaluations. sixteen cases were excluded from the study due to the above exclusion criteria. randomization and intervention in this study, a convenience sampling was used to select 90 patients (74 were eligible). then, patients were randomly allocated into two groups (37 in each group) using permuted balanced block randomization in a completely random manner. for this purpose, six blocks of four were used in which the structure of each block was four-way, the combination of two methods of interference in a perfectly balanced way. to random assignment of blocks to each group a random digits table was carried out. therefore, a list of eligible participants (n = 74) was prepared and according to this list each case was randomly enrolled in the study group, respectively. no additional matching was performed and one of the investigators scheduled for randomization before the initiation of study. none of participants and data analysts knew about the groups. the treatment groups were defined as below: ss-mp group (n = 37): patients received 10 mg morphine suppository (opirec® 10 mg, aburaihan pharmaceutical co.). im-mp group (n = 37): patients received 10 mg morphine intramuscularly (im) (morphine sulfate 10 mg/ml, daou pakhsh pharmaceutical co.). procedures and evaluations data were collected using a designed checklist containing the factors as below to make the assessments: a: patient’s demographic information including age, gender and weight. b: history of similar pain, history of urinary stones and main data including vital signs (blood pressure [bp], respiratory and heart rate [hr] and axillary temperature) and severity of pain using a 10-centimeter visual analogue scale (vas). vas was used for evaluation of the pain severity was in several time points of admission time (0), 15, 30 and 60 min after administration of medications. vas is a measurement instrument that tries to measure a pain severity scored 0 (no pain) -10 clinical observation.19 clinically, the difference of vas score between 0 and 15 min (0–15), 0 and 30 min (0–30), 0 and 60 min (0–60) time points were calculated and compared in two groups of morphine routes. moreover, other varibales including hr, bp (systolic and diastolic), respiratory rate, and the side effects of drugs (secondary outcomes including drowsiness, nausea & vomiting, facial flushing, and dizziness) were investigated in defined time points. after gathering the data, the vas scores of different time points were compared. after 60 min, if the severity of pain did not relief by 50%, 5 mg/im morphine was used to relive the pain. in this study, four patients were excluded due to missing or inconsistent data (n = 3 in rsm group and n = 1 in imm group) during the study and data of 70 cases were analyzed. due to incomplete information and data in the questionnaire, patients were excluded from the study (figure 1). sample size estimation and statistical analysis using the findings of the study performed by safdar et al. (2006) reporting an average reduction of one hour of pain equal to 5.0 ± 1.6 in patients with intramuscular morphine injection compared with the average further reduction of 6.0 ± 1.6 in patients with morphine suppository in term of vas, setting the statistical power and confidence levels to be 95%, a sample size of 136 people (68 in each group) was estimated to be enough using g*power.3.1 software. but conservatively up to 7 people were added in each group to deal with possible data loss.20 data were analyzed using spss (ver. 22). mean, standard deviation, frequency and percentage were used to summarize the data in tables. the analysis of variance (anova) for repeated measures models applied to compare the two groups. fisher’s exact tests and chi-square were used to determine the differences in the qualitative data. in addition, ttest was used for evaluation of differences in the quantitative data. significant level was defined as p < 0.05. results in this study, the data of 70/74 cases (n = 3 in rsm group and n = 1 in imm group were excluded) with renal colic treated fig. 1 consort flow diagram. 30 j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 suppository or intramuscular morphine for pain control in renal colic original a.a. zadeh et al. between the two groups (p = 0.030). in addition, there were no significant differences in hr of two groups based on time points of 0 (p = 0.116) and 30 (p = 0.139), but significant decreases were seen in time point of 15 (p = 0.04) and 60 min (p = 0.014) in rsm group compared to imm group. comparing two groups showed that there was no significant difference in terms of changes in the respiratory rate (per min) between the two groups (p = 0.622). based on time points, respiratory rate was significantly decreased in 60 min (p = 0.017) in rsm group compared to the imm group. however, in the other time points no differences was observed (0: p = 0.799, 15: p = 0.291, 30: p = 0.605, and 60: p = 0.855, respectively) (table 2 and figure 1). no major complications were reported in two groups. discussion in this investigation, we aimed to compare the influence of rectal and im morphine/pain management in patients with renal colic. in ew, management of patients with colic pain is one of the most important part of caring system.21 nsaids and opioids as well as the combination of spasmolytic and anti-inflammatory drugs have been recorded to be mostly used for pain control of these patients.10,22,23 among these, narcotics such as morphine, tramadol, codeine and meperidine have long been used.20,24,25 morphine, as an opioid analgesic, has been used for pain control of patients with renal colic given by different routes.26,27 morphine administered with iv route is a drug of choice to manage pain in acute renal colic.28 nevertheless, the other routes of morphine administration, e.g., oral, im and rectal are available to relieve pain in different conditions.29,30 studies have proven that im administration of opioids has been considered to be safer than iv.31 although, oral and parenteral narcotics are used usually for pain relief in ew or following surgical procedures, these routs can exacerbate the incidence of sedation, vomiting, and nausea, which ultimately delays recovery.32-34 thus, non-parenteral route of analgesic drugs, especially their rectal route has been suggested in different studies.13,35,36 according to the literature, it has been proved that rectal route morphine results less analgesia and lower pain scores compared to its iv administration.34,37 the findings of both groups showed the similarity in the different demographic features including age, gender, weight, table 1. comparing the characteristics of patients with renal colic based on study groups groups p-value ss-mp (n = 34) im-mp (n = 36) n (%) or mean ± sd* (range) n (%) or mean ± sd (range) age (year) 37.75 ± 10.92 (18–68) 38.89 ± 10.46 (18–60) 0.329 gender (male) 24 (70.6) 29 (80.6) 0.331 weight (kg) 79.88 ± 14.17 84.3 ± 23.41 0.446 history of urinary stones 23 (67.6) 22 (61.1) 0.568 history of simmilar pain 22 (64.7) 22 (61.1) 0.756 axillary temperature ( °c) 36.76 ± 0.53 36.76 ± 0.32 0.543 opioids for pain relief 3 (8.8%) 9 (25) 0.73 sd: standard deviation; upj: ureteropelvic junction. with morphine administered via im or rectal routes were considered. the demographic features of cases with renal colic in two groups were compared (table 1). the mean age of patients in rsm group was 37.75 ± 10.92 year (18 to 55) and imm group was 38.89 ± 10.46 year (18 to 55). no significant difference was reported in the mean age of two groups (table 1, p = 0.329). as well, 24 patients (70.6%) in rsm group and 29 patients (80.6%) in imm group were male and no significant differences were seen in the distribution of sex in two groups (table 1, p = 0.331). the mean weight of patients in rsm group was 79.88 ± 14.17 kg and in imm group was 84.3 ± 23.41 kg and no differences was recorded in the weight of patients in two groups (table 1, p = 0.446). the history of urinary stones and similar pains were compared between two groups as was shown in table 1. no significant differences were reported in the distribution of history of urinary stones (table 1, p = 0.568) and similar pains (table 1, p = .756) of patients in two treatment groups. furthermore, frequency of extra doses of opioids was not significant in two groups (table 1, p = 0.073). using chi-square test, no significant differences were observed in the distribution of side effects in both groups (table 1, p = .599). all these results proved that two groups were similar in these characteristics before the treatment period. the mean vas score, systolic bp (mmhg), diastolic bp (mmhg), hr (bpm), and respiratory rate (per min) were compared in two groups (table 2, figure 2). a significant difference was observed in terms of pain intensity between two groups (p = .017). also, there were significant differences in vas score of two treatment groups according to time points of 30 (p = .037) and 60 (p = 0.027) after treatment; but no differences were recorded in time point of 0 (p = 0.58) and 15 (p = 0.083). there was a significant difference in the mean vas score difference of 0–30 (p = 0.001) and 0–60 (p = 0.001) time points; but no significant difference was recorded for mean vas score difference of 0–15 min (p = 0.083). based on the results, no significant difference was also observed between groups for systolic (p = 0.201) and diastolic pressure (p = 0.350). as well, no significant difference was seen in the mean systolic pressure (p = 0.762, p = 0.068, p = 0.072 and p = 0.232, respectively), diastolic pressure (p = 0.345, p = 0.506, p = 0.222, and p = 0.105, respectively) on different time points of 0, 15, 30, and 60. in addition, significant difference was observed in terms of changes in the hr (per min) 31j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 a.a. zadeh et al. original suppository or intramuscular morphine for pain control in renal colic table 2. comparing the vital signs and pain severity (vas) between two groups based on different time points, including admission time (0), 15, 30 and 60 min after drugs administration groups ss-mp (n = 34) im-mp (n = 36) p-value mean ± sd* mean ± sd vas score 0 8.26 ± 1.79 9 ± 1.26 0.116 15 min after treatment 5.95 ± 1.78 6.73 ± 1.97 0.139 30 min after treatment 4.32 ± 2.58 5.58 ± 2.38 0.018 60 min after treatment 2.58 ± 2.95 4.19 ± 3.03 0.081 systolic pressure (mmhg) 0 124.38 ± 10.31 127.27 ± 16.38 0.762 15 min after treatment 116.56 ± 10.44 123.64 ± 14.32 0.068 30 min after treatment 113.75 ± 11.33 120 ± 12.82 0.073 60 min after treatment 115.31 ± 9.91 119.55 ± 12.14 0.232 diastolic pressure (mmhg) 0 79.38 ± 7.0 79.32 ± 11.37 0.848 15 min after treatment 76.88 ± 6.02 77.14 ± 11.37 0.988 30 min after treatment 72.5 ± 8.37 77.5 ± 11.73 0.889 60 min after treatment 72.5 ± 7.53 77.73 ± 10.99 0.888 heart rate (bpm) 0 78.4 ± 7.59 82.55 ± 8.23 0.115 15 min after treatment 76.4 ± 6.67 81.59 ± 7.08 0.04 30 min after treatment 76.6 ± 6.6 81.86 ± 7.32 0.073 60 min after treatment 75.23 ± 6.42 81.55 ± 8.15 0.017 respiratory rate (per min) 0 18.21 ± 2.11 18.48 ± 2.6 0.779 15 min after treatment 17.14 ± 0.81 17.76 ± 2.23 0.291 30 min after treatment 16.79 ± 1.76 17.19 ± 1.91 0.073 60 min after treatment 16.93 ± 1.77 17.05 ± 2.01 0.017 *sd: standard deviation. and also history of urinary stones and similar pain. based on the findings of present study, rectal route of morphine could decrease the vas score significantly compared to the imm group. additionally, the score differences of 0–30 and 0–60 showed significant improvement in rvs group. taken together, administration of rectal route of morphine could be successful in the management of pain in patients with renal colic. although the mean heart and respiratory rate decreased in rectal route group compared to im group, these criteria were within normal range in this group, which were not a cause for concern. as well, no serious complications have been reported in these two groups. based on the literature, efficiency of different routes of morphine have been compared in a wide range of painful conditions. to show the efficiency and safety of morphine administered via rectal route in relieving pain, rahimi et al. (2016) used preemptive suppository morphine after laparoscopic cholecystectomy in a placebo-controlled study. the results from vas score proved that administration of morphine suppository was effective in analgesic requirements following laparoscopic cholecystectomy.12 in a randomized controlled trial, butler et al. (2017) evaluated the effects of belladonna and opium suppositories for reduction of pain in vaginal surgery and showed that these drugs are safe to use following this surgery.37 as well, cole et al. (1990) demonstrated that morphine hydrogel suppository appears to be effective in management of postoperative pain.38 studies to compare the different routes of morphine especially the rectal and intramuscular routes of morphine are so limited. guldbrand and mellstrom (1995) compared the rectal rout of morphine-scopolamine with im route as a premedication in healthy children scheduled for minor ent surgery. their findings indicated that administration of rectal route of drug worked better and resulted in slightly less post-operative pain and nausea. they suggested to use rectal route of morphine-scopolamine as a premedication for minor ent surgery on children as a good alternative compared to the im route.39 additionally, in a study by wilkinson et al. (1992), the effectiveness of rectal vs. oral sustained-release morphine were compared in the patients with cancer. they found no significant difference between the oral and the rectal route in measurements based on vas score or side effects. as well, they recommended to use the rectal route of morphine, when the oral route is not accessible for long time.40 the bioavailability of im morphine is roughly complete (100%), whereas the bioavailability of rectal morphine is only 50–60%.41,42 therefore, the poorer rectal bioavailability leads to lower plasma concentrations of morphine compared with the im application. however, the evidence showed that the rectal and im morphine reached the peak plasma concentration after 30 min and 1 hour, respectively, indicating that the absorption was rapid in the rectal route.43 according to the results, no major complications were recorded for two forms of administrations. the safety and 32 j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 suppository or intramuscular morphine for pain control in renal colic original a.a. zadeh et al. fig. 2 comparing the vital signs and pain severity between two groups based on different time points including admission time (0), 15 min, 30 min, and 60 min after drug administration. effectiveness of morphine suppository in relieving pain have been proven in different studies. westerling et al. evaluated the bioavailability and absorption of rectally administered morphine in 21 healthy women undergoing gynaecological operations and demonstrated that the mean bioavailability was 31% (range 12%–61%) and none of the cases showed any clinical sign of respiratory depression.43 furthermore, babul et al. (2013) compared the safety and effectiveness of controlled‐release morphine tablets and suppositories in pain management of patients with cancer and reported that controlled‐release morphine suppositories provides pain control comparable to that provided by tablets when received every 12 h at a 1/1 dose ratio, and suggested a reliable alternative approach of pain management for patients unable to take oral opioid medications.44 in an experimental study by barnhart et al. (2000), the systemic bioavailability and therapeutic plasma levels of morphine following iv and im administration as well as respiratory, cardiovascular, and analgesic values were compared in dogs. no differences were recorded in analgesia values and vital organs e.g., respiratory and cardiovascular between control and morphine groups.45 33j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 a.a. zadeh et al. original suppository or intramuscular morphine for pain control in renal colic fig. 3 the schematic summary of the study. conclusion our findings indicated that the use of rectal morphine suppositories may be more effective in diminishing pain in cases referred to ew with renal colic compared with im route in ew. since the morphine suppositories are due to no adverse impact on the vital signs of patients and also have no other major complication, we recommend to use rectal route of morphine as a safe and more effective method in relieving pain of renal colic patients in ew (figure 3). limitation one of our study limitations was that the possibility of evaluating other variables attributed to alterations of pain severity. one of these limitations is the differences in the level of education and awareness of the patients under study that may have been effective in expressing the severity of pain based on vas. on the other hand, there are several variables that affect the pain severity, which of course has not been possible to consider all of them in one study. acknowledgments we would like to thank the clinical research development unit of kowsar educational and research and therapeutic center of semnan university of medical sciences for providing facilities to this work. funding semnan university of medical sciences (no. a-10-140-4). competing interest author declares no conflict of interest.  references 1. golzari se, soleimanpour h, rahmani f, zamani mehr n, safari s, heshmat y, et al. therapeutic approaches for renal colic in the emergency department: a review article. anesth pain med. 2014;4(1):e16222. 2. basiri a, shakhssalim n, khoshdel ar, pakmanesh h, radfar mh. drinking water composition and incidence of urinary calculus: introducing a new index. iranian journal of kidney diseases. 2011;5(1):15. 3. phillips e, hinck b, pedro r, makhlouf a, kriedberg c, hendlin k, et al. celecoxib in the management of acute renal colic: a randomized controlled clinical trial. urology. 2009;74(5):994–9. 4. romero v, akpinar h, assimos dg. kidney stones: a global picture of prevalence, incidence, and associated risk factors. reviews in urology. 2010;12(2-3):e86. 5. holdgate a, pollock t. systematic review of the relative efficacy of nonsteroidal anti-inflammatory drugs and opioids in the treatment of acute renal colic. bmj. 2004;328(7453):1401. 6. faridaalaee g, mohammadi n, merghati sz. intravenous morphine vs intravenous ketofol for treating renal colic; a randomized controlled trial. emergency. 2016;4(4):202. 7. edwards je, meseguer f, faura c, moore ra, mcquay hj. single dose dipyrone for acute renal colic pain. the cochrane database of systematic reviews. 2002(4):cd003867. 8. iguchi m, katoh y, koike h, hayashi t, nakamura m. randomized trial of trigger point injection for renal colic. international journal of urology : official journal of the japanese urological association. 2002;9(9):475–9. 9. serinken m, karcioglu o, turkcuer i, ozkan hi, keysan mk, bukiran a. analysis of clinical and demographic characteristics of patients presenting with renal colic in the emergency department. bmc research notes. 2008;1:79. 10. renal colic in adults: nsaids and morphine are effective for pain relief. prescrire international. 2009;18(103):217–21. 11. larkin gl, peacock wft, pearl sm, blair ga, d’amico f. efficacy of ketorolac tromethamine versus meperidine in the ed treatment of acute renal colic. am j emerg med. 1999;17(1):6–10. 12. rahimi m, farsani dm, naghibi k, alikiaii b. preemptive morphine suppository for postoperative pain relief after laparoscopic cholecystectomy. advanced biomedical research. 2016;5. 13. de boer ag, moolenaar f, de leede lg, breimer dd. rectal drug administration: clinical pharmacokinetic considerations. clinical pharmacokinetics. 1982;7(4):285–311. 14. morgan s. intravenous paracetamol in patients with renal colic. emergency nurse : the journal of the rcn accident and emergency nursing association. 2011;18(9):22–5. 15. blankenstein tn, gibson lm, claydon ma. is intramuscular morphine satisfying frontline medical personnels’ requirement for battlefield analgesia in helmand province, afghanistan? a questionnaire study. british journal of pain. 2015;9(2):115–21. 16. walford j. comparison of intravenous morphine and paracetamol. emergency nurse : the journal of the rcn accident and emergency nursing association. 2015;23(5):24–7. 17. poonai n, datoo n, ali s, cashin m, drendel al, zhu r, et al. oral morphine versus ibuprofen administered at home for postoperative orthopedic pain in children: a randomized controlled trial. cmaj : canadian medical association journal = journal de l’association medicale canadienne. 2017;189(40):e1252-e8. 18. cole l, hanning cd. review of the rectal use of opioids. journal of pain and symptom management. 1990;5(2):118–26. 19. ducharme j. analgesia, anesthesia, and procedural sedation. tintinalli’s emergency medicine. 2015:231–8. 20. safdar b, degutis lc, landry k, vedere sr, moscovitz hc, d’onofrio g. intravenous morphine plus ketorolac is superior to either drug alone for treatment of acute renal colic. ann emerg med. 2006;48(2):173–81, 81.e1. 21. turkcuer i, serinken m, karcioglu o, zencir m, keysan mk. hospital cost analysis of management of patients with renal colic in the emergency department. urological research. 2010;38(1):29–33. 22. holdgate a, pollock t. nonsteroidal anti-inflammatory drugs (nsaids) versus opioids for acute renal colic. cochrane database of systematic reviews. 2004(1). 23. golzari se, soleimanpour h, rahmani f, mehr nz, safari s, heshmat y, et al. therapeutic approaches for renal colic in the emergency department: a review article. anesthesiology and pain medicine. 2014;4(1). 24. portis aj, sundaram cp. diagnosis and initial management of kidney stones. american family physician. 2001;63(7):1329–38. 25. nakhaei amroodi m, reza shafiee g, mokhtari t. prevalence of the shoulder dislocation due to tramadol-induced seizure. shafa ortho j. 2015;2(1). 26. beltaief k, grissa mh, msolli ma, bzeouich n, fredj n, sakma a, et al. acupuncture versus titrated morphine in acute renal colic: a randomized controlled trial. journal of pain research. 2018;11:335. 27. mangal r, higgins d, pham t. is intravenous (iv) acetaminophen as effective as iv morphine for treatment of renal colic? evidence-based practice. 2018;21(3):6. 28. etteri m, maj m, maino c, valli r. intranasal ketorolac and opioid in treatment of acute renal colic. emergency care journal. 2018;14(1). 34 j contemp med sci | vol. 9, no. 1, january-february 2023: 28–34 suppository or intramuscular morphine for pain control in renal colic original a.a. zadeh et al. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. 29. tveita t, thoner j, klepstad p, dale o, jystad a, borchgrevink pc. a controlled comparison between single doses of intravenous and intramuscular morphine with respect to analgesic effects and patient safety. acta anaesthesiol scand. 2008;52(7):920–5. 30. borracci t, cappellini i, campiglia l, picciafuochi f, berti j, consales g, et al. preoperative medication with oral morphine sulphate and postoperative pain. minerva anestesiologica. 2013;79(5):525–33. 31. australian and new zealand college of anaesthetists and faculty of pain medicine: acute pain management: scientific evidence. 2005. 32. thomas sh. management of pain in the emergency department. isrn emergency medicine. 2013;2013. 33. rogers e, mehta s, shengelia r, reid mc. four strategies for managing opioid-induced side effects in older adults. clinical geriatrics. 2013;21(4):http://www.consultant360.com/articles/four-strategiesmanaging-opioid-induced-side-effects-older-adults. 34. butler ka, yi j, klauschie j, ryan dl, hentz jg, cornella jl, et al. 7: randomized clinical trial of postoperative belladonna and opium (b&amp;o) suppositories in vaginal surgery. american journal of obstetrics & gynecology. 2016;214(4):s459. 35. hanning cd, vickers ap, smith g, graham nb, mcneil me. the morphine hydrogel suppository: a new sustained release rectal preparation. british journal of anaesthesia. 1988;61(2):221–7. 36. butler k, yi j, wasson m, klauschie j, ryan d, hentz j, et al. randomized controlled trial of postoperative belladonna and opium rectal suppositories in vaginal surgery. american journal of obstetrics and gynecology. 2017;216(5):491.e1–.e6. 37. butler k, yi j, wasson m, klauschie j, ryan d, hentz j, et al. randomized controlled trial of postoperative belladonna and opium rectal suppositories https://doi.org/10.22317/jcms.v9i1.1316 in vaginal surgery. american journal of obstetrics & gynecology. 2017;216(5):491.e1–.e6. 38. cole l, hanning cd, robertson s, quinn k. further development of a morphine hydrogel suppository. british journal of clinical pharmacology. 1990;30(6):781–6. 39. guldbrand p, mellstrom a. rectal versus intramuscular morphinescopolamine as premedication in children. acta anaesthesiologica scandinavica. 1995;39(2):224–7. 40. wilkinson tj, robinson ba, begg ej, duffull sb, ravenscroft pj, schneider jj. pharmacokinetics and efficacy of rectal versus oral sustained-release morphine in cancer patients. cancer chemotherapy and pharmacology. 1992;31(3):251–4. 41. stanski dr, greenblatt dj, lowenstein e. kinetics of intravenous and intramuscular morphine. clinical pharmacology and therapeutics. 1978;24(1):52–9. 42. jonsson t, christensen cb, jordening h, frølund c. the bioavailability of rectally administered morphine. pharmacology & toxicology. 1988;62(4):203–5. 43. westerling d, lindahl s, andersson ke, andersson a. absorption and bioavailability of rectally administered morphine in women. european journal of clinical pharmacology. 1982;23(1):59–64. 44. babul n, provencher l, laberge f, harsanyi z, moulin d. comparative efficacy and safety of controlled-release morphine suppositories and tablets in cancer pain. the journal of clinical pharmacology. 1998;38(1):74–81. 45. barnhart md, hubbell ja, muir ww, sams ra, bednarski rm. pharmacokinetics, pharmacodynamics, and analgesic effects of morphine after rectal, intramuscular, and intravenous administration in dogs. american journal of veterinary research. 2000;61(1):24–8. http://www.consultant360.com/articles/four-strategies-managing-opioid-induced-side-effects-older-adults http://www.consultant360.com/articles/four-strategies-managing-opioid-induced-side-effects-older-adults 125j contemp med sci | vol. 5, no. 3, may–june 2019: 125–130 original maternal separation can affect the reproductive system by inflammasome activation in female mice kajal khodamoradi,a,b hossein amini-khoei,c zahra khosravizadeh,a seyed reza hosseini,d ahmad reza dehpour,e and gholamreza hassanzadeha* adepartment of anatomy, school of medicine, tehran university of medical sciences, tehran, iran. bmiller school of medicine, university of miami, miami, fl, usa. cmedical plants research center, basic health sciences institute, shahrekord university of medical sciences, shahrekord, iran. ddepartent of urology, school of medicine, tehran university of medical sciences, tehran, iran. eexperimental medicine research center, tehran university of medical sciences, tehran, iran. *correspondence to gholamreza hassanzadeh (email: hassanzadeh@tums.ac.ir). (submitted: 04 december 2018– revised version received: 16 january 2019 – accepted: 23 april 2019 – published online: 26 june 2019) introduction the early childhood is a sensitive age period in which development of brain can be affected harmfully by stressful events. the maternal separation model, as a model mimicking early-life stress, has been broadly studied to evaluate the effect of early-life stress on brain development and associated biological networks. exposure to this stressful event can affect children not only in their early years of life but also in their adult life. it seems that the repeated activation of the hypothalamic pituitary adrenal (hpa) axis and disruptions in pathways of the immune response and the neurotrophin production could play a critical role in the long-lasting effects of early-life stress.1,2 stress can trigger the activity of the adrenergic system that change the function of the endocrine and immune systems.3 cooperation between the immune and endocrine systems is necessary for normal development and function of the female reproductive system.4 according to psychoneuroimmunology studies, the physiological response to stressors affects function of the innate immune system even in the absence of pathogens that is known as sterile inflammatory response.5,6 although it remains unknown how innate immune function is stimulated by stress, the role of different factors including glucocorticoids, danger signals and catecholamines are evidenced by several studies.7–10 the transcription of inflammatory mediators such as cytokines and chemokines are activated during the inflammatory process.11 inflammasomes are intracellular multi-protein complexes which include a nod-like receptor/an aim-like receptor, the adapter molecule apoptosis-associated speck-like protein containing a card (asc), and caspase-1.12–14 nlrp3 along with the adaptor protein asc, active caspase-1 through assembly of the inflammasome, although the exact mechanism for this process is unclear. the nlrp3, the most described inflammasome, can be triggered by a wide range of exogenous and endogenous stress signals. caspase-1 activation leads to the cleavage of pro-interleukin (il)-1beta, pro-il-18 into active forms of il-1β, il-18, which play potential role in modulating innate immune function.15–17 moreover, caspase-1 plays a role in cell apoptosis via stimulation of caspase-3 and -7.18 on the other hand, psychosocial stressors via stimulation of inflammatory cytokines such as tnf-α, il1-β and il-6 can lead to the suppression of gonadotropin-releasing hormone (gnrh) secretion.19 since the main target of gnrh is the gonadotropes of anterior pituitary gland, stress-induced gnrh suppression can affect the secretion of gonadotropic hormones and consequently reproductive functions. mitochondria are responsible for the reactive oxygen species (ros) production, atp generation and apoptotic control.20 owing to the high levels of antioxidant enzymes, the mitochondria can regulate the balance between ros production and degradation.21 the findings of studies have confirmed that chronic stress can lead to disruption of mitochondrial function and free radicals production.22 it is apparent that mitochondria play a significant role in female reproductive processes including oocyte maturation, fertilization and early embryogenesis.23 the evidence for the involvement of oxidative injury in the objective the aim of this study is to investigate effect of maternal separation stress on the ovarian function in adult female mice. methods in this study, maternal separation in pups was performed during post-natal days 2–14. the histological alterations in ovarian tissue, reactive oxygen species (ros) production (using 2′,7′-dichlorofluorescin diacetate assay), gene expression of nlrp3, apoptosisassociated speck-like protein containing a card (asc), caspase-1, tlr4, bax, bcl-2 and tnf-α (using rt-pcr), protein levels of atp, gpx, interleukin (il)-1β and il-18 (using enzyme-linked immunosorbent assay). also, protein expression of caspase-3 and nlrp3 (using immunocytochemistry) were evaluated. results this showed that maternal separation decreased percentage of primordial follicles while increased percentage of secondary and graafian follicles. in addition, maternal separation increased ros production and decreased atp and gpx concentrations. furthermore, maternal separation significantly affected expression of cytokines and genes involved in inflammation and apoptosis including nlrp3, asc, caspase-1, tlr4, tnf-α, il-1β, il-18, bax and bcl2. findings also showed that stress-induced maternal separation significantly increased percentage of caspase-3 and nlrp3 positive cells. we concluded that maternal separation stress has harmful effects on ovarian tissue. conclusion it seems that these harmful effects probably occur through increase of ros production and impact on mitochondrial function, inflammatory process and apoptosis pathways. keywords maternal separation stress, inflammasome, inflammation, oxidative stress, apoptosis, reproductive system issn 2413-0516 126 j contemp med sci | vol. 5, no. 3, may–june 2019: 125–130 maternal separation affects reproductive system in female mice original k. khodamoradi et al. pathogenesis of infertility in females has been accumulating since long.24 since the adverse effects of early-life stress on the neuroendocrine and innate immune system, also adverse effects of oxidative stress on fertility status have been well described in previous studies, stress-induced maternal separation during early life may have an adverse effect on the female reproductive system. therefore, this study was designed to investigate the effect of maternal separation stress on ovarian function in adult female mice. materials and methods experimental animals pregnant naval medical research institute mice were obtained from the pasteur institute of iran. the animals were housed under a cycle of 12 h:12 h light/dark at controlled temperature (22–25°c) and humidity (55–65%). all animal procedures were carried out according to guidelines approved by the ethics committee of tehran university of medical sciences (ir.tums.medicine.rec.1395.2507). to produce maternal separation model, pups were separated from their mothers and placed in a clean cage for 3 h every day (9 am to 12 pm each day) from post-natal days (pnd) 2 to 14. the birthday of pups was considered as pnd 0.25–27 in this study, female pups were randomly divided into two groups: control and maternal separation group. the pups of the control group were left untouched. mice at pnd 70 were sacrificed by deep anesthesia and the ovaries were removed. one ovary from each mouse was used for histological assessment and the second ovary was used for molecular assessments. histological assessment the ovaries for histological assessment were immediately transferred to bouin’s fixative solution. the fixed ovaries were dehydrated in ascending graded series of ethanol (merck, darmstadt, germany) and then emerged in paraffin wax. the serial sections (5 μm thick) were prepared with a rotary microtome (microm, walldorf, germany) and rehydrated in descending graded series of ethanol. the sections were cleared in xylene, stained with hematoxylin and eosin (h&e) and mounted with dpx. for histological assessment, transverse sections from nine different regions of the ovaries were examined. the number of primordial, primary, secondary and graafian follicles were counted by light microscopy and imagej software (imagej u. s. national institutes of health, bethesda, md, usa). ros assay the level concentration of ros production in ovarian tissues was detected with flow cytometry using 2',7' dichlorofluorescin diacetate (dcfh-da; sigma-aldrich, st. louis, mo, usa) after enzymatic digestion of minced tissue.28 the ovarian tissues were mechanically homogenized in ham’s f-10 medium (life technology, carlsbad, ca, usa). the homogenates of ovarian tissue were centrifuged at 10,000g for 5 min and washed with pbs. then, the homogenates were incubated with 20 µm dcfh-da in dark at 37°c for 45 min. the homogenates of ovarian tissue were washed with pbs, and dcf fluorescence (green) was measured in the fl-1 channel using a bd facscan flow cytometer (becton dickinson, san jose, ca, usa).29 real-time reverse transcription polymerase chain reaction analysis the expression level of nlrp3, asc, caspase-1, tlr4, bax, bcl2 and tnfα genes was analyzed by real-time reverse transcription polymerase chain reaction (rt-qpcr). the total rna extraction from ovarian tissues was performed with trizol reagent according to the manufacturer’s instructions (invitrogen, carlsbad, ca, usa). the complementary dna was produced via reverse transcription reaction using a primescript rt reagent kit (takara, south korea) according to the manufacturer’s protocol. the rt-qpcr was carried out with gene specific primers and the hot firepol evagreen qpcr mix plus (solis biodyne, tartu, estonia) by an abi7500 (applied biosystems, foster city, ca, usa). the reference gene glyceraldehydes-3-phosphate dehydrogenase messenger rna (mrna) expression are used as the internal control to normalize mrna expression levels. the level of target genes expression was calculated using 2−δct. list of primer sequences used for rt-qpcr analysis are presented in table 1. enzyme-linked immunosorbent assay the ovarian tissues were homogenized in pbs on ice, then centrifuged at 800 × g for 5 min. the collected supernatants were used in the enzyme-linked immunosorbent (elisa) assay. the level concentrations of atp and gpx were measured with specific elisa kits (r&d systems, minneapolis, mn, usa) and the level concentrations of il-1β and il-18 in ovarian tissue were measured using elisa kits (koma biotech, seoul, korea) according to the manufacturer’s protocols. immunocytochemical analysis to determine caspase-3 and nlrp3 immunoreactivity, the fixed ovarian samples were dehydrated in graded ethanol and embedded in paraffin. after removing paraffin, samples were rehydrated through a graded series of ethanol and permeabilized with 10 mm sodium citrate and 0.05% tween 20. the samples were blocked in a blocking solution including 1% (w/v) bovine serum albumin (sigma-aldrich, st. louis, mo, usa) in pbs. then, the ovarian samples were incubated overnight at 4°c with primary antibodies against caspase-3 (1:1000 dilution, abcam, cambridge, ma, usa) and nlrp3 table 1. primer sequences genes forward primers reverse primers nlrp3 5′-ggacccacagtg-taacttgcaga-3′ 5′-aggctgcagttgtctaattccag-3′ asc 5′-cacaaatcagtctc-caacacc-3′ 5′-taaccattaccttgttccca-3′ caspase-1 5′-cactcgta-cacctcttgccctc-3′ 5′-ctttcacctctttcaccatctcca-3′ tlr4 5′-tgagtggtcagtgt-gattgtggt-3′ 5′-tgtagtgaaggcagaggtgaaag-3′ bax 5′-gcaaactggtgctcaa-gg-3′ 5′-cagccacaaagatggtca-3′ bcl2 5′-acttttaggcgtggct-gatg-3′ 5′-gtgctgctcactgtattttatttt-3′ tnf-α 5′-tgtctcagcctcttct-cattcctg-3′ 5′-aggccatttgggaacttctcatcc-3′ gadph 5′-tgacatcaagaaggtg-gtgaag-3′ 5′-cgaaggtggaagagtgggag-3′ 127j contemp med sci | vol. 5, no. 3, may–june 2019: 125–130 original maternal separation affects reproductive system in female micek. khodamoradi et al. (1:1000 dilution, abcam, cambridge, ma, usa). the samples were incubated with secondary antibody (1:500 dilution, abcam, cambridge, ma, usa) for 2 h at 37°c and then the cells’ nuclei were stained with pi (1:1000, sigma-aldrich, st. louis, mo, usa). the cell counting and merging of the pictures were performed by image j software (imagej u. s. national institutes of health, bethesda, ma, usa). statistical analysis the collected data were analyzed using spss version 20.0 software. the values were tested for normality using the kolmogorov–smirnov test. the statistical significance of the results was determined using the independent samples t-test and mann–whitney u test. the results were presented as the mean ± standard deviation (sd) and p ≤ 0.05 was considered as statistically significant. results histological assessment histological analysis of ovarian follicles was assessed with h&e staining (fig. 1). the results showed that percentage of primordial follicles in the maternal separation group (17.226 ± 9.096) was significantly lower compared with the control group (53.188 ± 4.485) (p < 0.001). there was no significant difference between percentage of primary follicles in the maternal separation group (5.584 ± 3.229) and percentage of primary follicles in the control group (5.839 ± 2.387) (p > 0.05). percentage of secondary follicles in the maternal separation group (28.247 ± 5.621) was significantly higher compared with the control group (16.899 ± 5.639, p < 0.01). in addition, percentage of graafian follicles in the maternal separation group (48.941 ± 7.826) was significantly higher comspared with the control group (24.072 ± 1.908, p < 0.001, fig. 2). ros evaluation reactive oxygen species production in ovarian tissue was detected using the dcfh-da assay. the level of ros production in ovarian tissue of the maternal separation group (614.4183 ± 28.6545) was significantly higher compared with the control group (363.9886 ± 48.3404, p < 0.01, fig. 3). rt-qpcr analysis the results of rt-qpcr analysis showed that expression of the following significantly increased in the maternal separation group compared with the control group: tnf-α (p < 0.001), nlrp3, asc, caspase-1, tlr4 and bax (p < 0.01). in contrast, the expression of bcl2 gene significantly decreased in the maternal separation group compared with the control group (p < 0.01) (fig. 4). enzyme-linked immunosorbent assa enzyme-linked immunosorbent assay results showed that the level concentrations of atp and gpx were significantly lower in the maternal separation group compared with the control group (2.4992 ± 0.03 vs. 3.03497 ± 0.02, p < 0.001 and 147.46 ± 11.58 vs. 399.3414 ± 23.39, p < 0.001 respectively). the il-1β and il-18 concentrations in the maternal separation group were higher than the control group (2.4773 ± 0.01 vs. 1.8753 ± fig. 1 the histopathological features provided from h&e-stained ovarian sections in the control (a) and the maternal separation (b) groups. scale bars are 20 µm. samples were analyzed in triplicate. a b fig. 2 effect of maternal separation on mice ovarian follicles. values are reported as mean ± sd. **p < 0.01, ***p < 0.001. samples were analyzed in triplicate. fig. 3 the level concentrations of ros production in the ovary. values are reported as mean ± sd. **p < 0.01. samples were analyzed in triplicate. ros, reactive oxygen species; sd, standard deviation. 0.02 and 3.3494 ± 0.04 vs. 1.9481 ± 0.08 respectively, p < 0.001 for both) (fig. 5). immunocytochemical analysis caspase-3 and nlrp3 markers were used to label the ovarian cells in the control and maternal separation groups. the nuclei were stained with pi (fig. 6). immunocytochemical analysis showed that the mean percentage of caspase-3 positive cells in the maternal separation group was significantly higher compared with the control group (50.6666 ± 1.76% vs. 24.00 ± 0.58%, p < 0.001). also, the mean percentage of nlrp3 positive cells was significantly higher in the maternal separation group 128 j contemp med sci | vol. 5, no. 3, may–june 2019: 125–130 maternal separation affects reproductive system in female mice original k. khodamoradi et al. inflammation and apoptosis including nlrp3, asc, caspase-1, tlr4, tnf-α, il-1β, il-18, bax and bcl2 were significantly affected in the maternal separation group. our results also showed that maternal separation stress significantly increased percentage of caspase-3 and nlrp3 positive cells. according to a large body of evidence, maternal separation has long-lasting effects on neurodevelopmental and behavioral health that can increase susceptibility to psychopathology in adulthood.30 it is known that the function of hpa axis, an essential hormonal response system to manage stress, adversely affected by maternal separation stress.31 considering the regulatory role of hpa axis in many homeostatic systems, these adverse modifications in hpa axis activity can result in functional alterations in the biological systems such as neuroendocrine, immune and reproductive systems.3,5,32,33 furthermore, stress can affect the function of the adrenergic system that change the activities of the endocrine and immune systems.3 cross-talk between the endocrine and immune systems is necessary for normal development and function of the female reproductive system.4 although it remains unknown how innate immune function is stimulated by stress, the role of different factors including glucocorticoids, danger signals and catecholamines are evidenced by several studies.7–10 previous studies have indicated that nlrs play a regulatory role in the reproductive and innate immune systems in mammals.34 the nlrp3 inflammasome, as a well-known nlr, is a cytoplasmic complex which is activated by danger signals derived from pathogens and metabolic dysregulation. activation of nlrp3 inflammasome lead to regulating the secretion of the pro-inflammatory cytokines il-1β and il-18.35 our findings showed that stress induced by maternal separation significantly affect the nlrp3 inflammasome components and inflammatory molecules including nlrp3, asc, caspase-1, tlr4, tnf-α, il1-β, il18and caspase-3. furthermore, maternal separation stress can significantly affect mitochondrial activation and resulted in increase of ros production and decrease of atp level. in addition, this chronic stress can affect the mrna expression of bcl2 and bax genes which are involved in apoptosis pathways. it is well known that increased ros production is associated with mitochondrial dysfunction and apoptosis. recently, it has been identified that mitochondria play a key role in activation of nlrp3 inflammasome.36 mitochondrial damage can trigger signals of apoptosis and induce nlrp3 inflammasome fig. 4 the gene expression of nlrp3, asc, caspase-1, tlr4, bax, bcl2 and tnf-α using rt-qpcr. values are reported as mean ± sd. **p < 0.01, ***p < 0.001. samples were analyzed in triplicate. sd, standard deviation; rt-qpcr, real-time reverse transcription polymerase chain reaction; asc, apoptosis-associated speck-like protein containing a card. fig. 5 the level concentrations of atp, gpx, il-1β and il-18 measured using elisa. data were analyzed using the mann–whitney u test. values are reported as mean ± sd. ***p < 0.001. samples were analyzed in triplicate. elisa, enzyme-linked immunosorbent assay. fig. 6 immunocytochemical analysis of ovarian cells for caspase-3 and nlrp3 markers. (a) control group; (b) maternal separation group; upper panel: pi stained pictures; lower panel: merged pictures of pi and secondary antibody stained cells. scale bars are 10 µm. samples were analyzed in triplicate. a b in compared with the control group (44.00 ± 1.53% vs. 20.6666 ± 1.45%, p < 0.001) (fig. 7). discussion the findings of this study showed that maternal separation stress led to significant histological alterations in the ovarian tissue, including decreased percentage of primordial follicles and increased percentage of secondary and graafian follicles. in addition, maternal separation stress during early life increased ros production and decreased atp and gpx concentrations. furthermore, expression of cytokines and genes involved in fig. 7 comparison of the mean percentage of positive cells for caspase-3 and nlrp3 markers by immunocytochemical assessment. values are reported as mean ± sd. ***p < 0.001. samples were analyzed in triplicate. 129j contemp med sci | vol. 5, no. 3, may–june 2019: 125–130 original maternal separation affects reproductive system in female micek. khodamoradi et al. activation through release of oxidized mitochondrial dna into cytosol.36,37 furthermore, the findings of studies indicated that mitochondrial ros and dna play an important role in nlrp3 inflammasome activation.38,39 in addition to its role in apoptosis, it has been suggested that bcl2 might play a role in the inhibition of nlrp3 inflammasome activation. shimada et al. have described that increased expression of bcl2 lead to decrease in il-1β levels. from this, it can be concluded that apoptosis plays a role in nlrp3 inflammasome activation.36 in addition, recently some studies have described that tnf, as a proinflammatory cytokine, can regulate the nlrp3 inflammasome activation.40,41 given these data and our findings, plus the known effects of stress on the neuroendocrine system, it seems that maternal separation stress can affect the nlrp3 inflammasome components and inflammatory molecules with alteration in level of ros, bcl2 and tnf-α and subsequently lead to increase of il1-β and il18production. our findings showed that maternal separation resulted in histological alterations in the ovarian tissue, including decreased percentage of primordial follicles and increased percentage of secondary and graafian follicles. in addition to reducing the number of primary follicles, stress likely accelerates the process of evolution of primary follicles to secondary and graafian follicles. it seems that maternal separation stress lead to fast down the folliculogenesis process that may reduce the ovarian follicular reserve and induce a shorter reproductive lifespan. in our study, maternal separation stress cause to increase of ros production and decrease of gpx concentration. cells have defensive strategies to prevent oxidative injury caused by excessive production of ros, such as anti-oxidant enzymes like catalase (cat), superoxide dismutase and gpx.42 although ros play physiological roles during folliculogenesis process, maturation of oocyte, and fertilization,43 increased ros production and oxidative stress can suppress the antioxidant defense and influences the fertilization capacity.44 the findings of studies indicated that oxidative stress lead to follicular atresia and ovarian follicle aging.43,45,46 furthermore, excessive production of ros and oxidative stress can lead to pathologic events in the ovary including inflammation and apoptosis.47 findings of studies described that il-1 is expressed in the mammalian ovary and play a physiological role in ovary. although inflammation is very important in reproductive processes such as ovulation, menstruation and implantation, uncontrolled inflammation has adverse effects on normal function of ovary.48,49 uri-belapolsky et al.50 have reported that il-1 may enhance the inflammatory genes expression and promote apoptotic signaling pathways that leads to exhaust the ovarian reserve. on the other hand, it is well known that follicular atresia can occur via mitochondrial pathway or binding of death receptors to their ligands such as tnf-α and fas.51 according to the above-mentioned data and the results of this study, we can conclude that maternal separation stress via activation of inflammatory and apoptosis pathways may have adverse effects on folliculogenesis process and the number of ovarian follicles. conclusion this study provides a glimpse of the effects of maternal separation stress on ovarian tissue in female mice as adults. based on this study, maternal separation stress had detrimental effects on ovarian tissue, in addition to the known effects of stress on the hpa axis and neuroendocrine system, probably through increase of ros production and impact on mitochondrial function, inflammatory process and apoptosis pathways. an improved insight into the mechanisms by which maternal separation stress affects the reproductive system may provide necessary information to keep the reproductive system healthy. acknowledgments this research has been funded by tehran university of medical sciences (tums); grant no. 32229. the authors thank tehran university of medical sciences for its support. conflict of interest the authors declare that there is no known conflict of interest regarding this publication.  references 1. tractenberg sg, levandowski ml, de azeredo la, orso r, roithmann lg, hoffmann es, et al. an overview of maternal separation effects on behavioural outcomes in mice: evidence from a four-stage methodological systematic review. neurosci biobehav rev. 2016;68:489–503. 2. harrison el, baune bt. modulation of early stress-induced neurobiological changes: a review of behavioural and pharmacological interventions in animal models. transl psychiatry. 2014;4:e390. 3. jóźków p, mędraś m. psychological stress and the function of male gonads. endokrynol pol. 2012;63:44–49. 4. ostanin aa, aizikovich bi, aizikovich iv, kozhin ay, chernykh er. role of cytokines in the regulation of reproductive function. bull exp biol med. 2007;143:75–79. 5. fleshner m. stress-evoked sterile inflammation, danger associated molecular patterns (damps), microbial associated molecular patterns (mamps) and the inflammasome. brain behav immun. 2013;27:1–7. 6. rock kl, latz e, ontiveros f, kono h. the sterile inflammatory response. annu rev immunol. 2009;28:321–342. 7. johnson jd, campisi j, sharkey cm, kennedy sl, nickerson m, greenwood bn, et al. catecholamines mediate stress-induced increases in peripheral and central inflammatory cytokines. neuroscience. 2005;35:1295–1307. 8. mazzeo rs, donovan d, fleshner m, butterfield ge, zamudio s, wolfel ee, et al. interleukin-6 response to exercise and high-altitude exposure: influence of α-adrenergic blockade. j appl physiol. 2001;91:2143–2149. 9. frank mg, thompson bm, watkins lr, maier sf. glucocorticoids mediate stress-induced priming of microglial pro-inflammatory responses. brain behav immun. 2012;26:337–345. 10. campisi j, sharkey c, johnson jd, asea a, maslanik t, bernstein-hanley i, et al. stress-induced facilitation of host response to bacterial challenge in f344 rats is dependent on extracellular heat shock protein 72 and independent of alpha beta t cells. stress. 2012;15:637–646. 11. gómez lópez m, domínguez lópez a, abarca rojano e, rojas hernández s, martínez godínez mde l, miliar garcía a, et al. 17β-estradiol transcriptionally modulates nlrp1 and nlrp3 inflammasomes in gonadectomized rats with inflammation. immunopharmacol immunotoxicol. 2015;37:343–350. 12. bazrafkan m, nikmehr b, shahverdi a, hosseini, hassani f, poorhassan m, et al. lipid peroxidation and its role in the expression of nlrp1a and nlrp3 genes in testicular tissue of male rats: a model of spinal cord injury. iran biomed j. 2018;22:151–159. 13. nikmehr b, bazrafkan m, hassanzadeh g, shahverdi a, sadighi gilani ma, kiani s, et al. the correlation of gene expression of inflammasome indicators and impaired fertility in rat model of spinal cord injury: a time course study. urol j. 2017;14:5057–5063. 14. mohamadi y, noori moghahi smh, mousavi m, borhani-haghighi m, abolhassani f, kashani ir, et al. intrathecal transplantation of wharton’s jelly mesenchymal stem cells suppresses the nlrp1 inflammasome in the rat model of spinal cord injury. j chem neuroanat. 2019;97:1–8. 130 j contemp med sci | vol. 5, no. 3, may–june 2019: 125–130 maternal separation affects reproductive system in female mice original k. khodamoradi et al. 15. yang ca, chiang bl. inflammasomes and human autoimmunity: a comprehensive review. j autoimmun. 2015;61:1–8. 16. jin c, flavell ra. molecular mechanism of nlrp3 inflammasome activation. j clin immunol. 2010;30:628–631. 17. ghaffari, n., hassanzadeh, g., nowrouzi, a., gholaminejhad, m., mokhtari, t., seifali, r., ... & akbari, m. (2018). antioxidative and anti-inflammatory effects of cichorium intybus l. seed extract in ischemia/reperfusion injury model of rat spinal cord. journal of contemporary medical sciences, 4(4). 18. shalini s, dorstyn l, dawar s, kumar s. old, new and emerging functions of caspases. cell death differ. 2015;22:526–539. 19. wagenmaker er, breen km, oakley ae, tilbrook aj, karsch fj. psychosocial stress inhibits amplitude of gonadotropin-releasing hormone pulses independent of cortisol action on the type ii glucocorticoid receptor. endocrinology. 2009;150:762–769. 20. keating dj. mitochondrial dysfunction, oxidative stress, regulation of exocytosis and their relevance to neurodegenerative diseases. j neurochem. 2008;104:298–305. 21. mailloux rj. mitochondrial antioxidants and the maintenance of cellular hydrogen peroxide levels. oxid med cell longev. 2018;2018:7857251. 22. madrigal jl, olivenza r, moro ma, lizasoain i, lorenzo p, rodrigo j, et al. glutathione depletion, lipid peroxidation and mitochondrial dysfunction are induced by chronic stress in rat brain. neuropsychopharmacology 2001;24:420–429. 23. cecchino gn, seli e, alves da motta el, garcía-velasco ja. the role of mitochondrial activity in female fertility and assisted reproductive technologies: overview and current insights. reprod biomed online. 2018;36:686–697. 24. agarwal a, aponte-mellado a, premkumar bj, shaman a, gupta s. the effects of oxidative stress on female reproduction: a review. reprod biol endocrinol. 2012;10:49. 25. amini-khoei h, amiri s, shirzadian a, haj-mirzaian a, alijanpour s, rahimi-balaei m, et al. experiencing neonatal maternal separation increased the seizure threshold in adult male mice: involvement of the opioid system. epilepsy behav. 2015;52:37–41. 26. amini-khoei h, amiri s, mohammadi-asl a, alijanpour s, poursaman s, haj-mirzaian a, et al. experiencing neonatal maternal separation increased pain sensitivity in adult male mice: involvement of oxytocinergic system. neuropeptides. 2017;61:77–85. 27. amini-khoei h, haghani-samani e, beigi m, soltani a, mobini gr, balali-dehkordi s, et al. on the role of corticosterone in behavioral disorders, microbiota composition alteration and neuroimmune response in adult male mice subjected to maternal separation stress. int immunopharmacol. 2019;66:242–50. 28. dym m, jia mc, dirami g, price jm, rabin sj, mocchetti i, ravindranath n. expression of c-kit receptor and its autophosphorylation in immature rat type a spermatogonia. biol reprod. 1995;52:8–19. 29. fatemi n, sanati mh, shamsara m, moayer f, zavarehei mj, pouya a, et al. tbhp-induced oxidative stress alters micrornas expression in mouse testis. j assist reprod genet. 2014;31:1287–1293. 30. slotten ha, kalinichev m, hagan jj, marsden ca, fone kc. long-lasting changes in behavioural and neuroendocrine indices in the rat following neonatal maternal separation: gender-dependent effects. brain res. 2006;1097:123–132. 31. clarke as. social rearing effects on hpa axis activity over early development and in response to stress in rhesus monkeys. dev psychobiol. 1993;26:433–446. 32. kuhn cm, schanberg sm. responses to maternal separation: mechanisms and mediators. int j dev neurosci. 1998;16:261–270. 33. g m. central nervous regulation of the hypothalamic-pituitary-adrenal axis and its impact on fertility, immunity, metabolism and animal welfare-a review. arch anim breed. 2002;45:575–595. 34. peng h, zhang w, xiao t, zhang y. nlrp4g is an oocyte-specific gene but is not required for oocyte maturation in the mouse. reprod fertil dev. 2014;26:758–768. 35. tschopp j, schroder k. nlrp3 inflammasome activation: the convergence of multiple signalling pathways on ros production? nat rev immunol. 2010;10:210–215. 36. shimada k, crother tr, karlin j, dagvadorj j, chiba n, chen s, et al. oxidized mitochondrial dna activates the nlrp3 inflammasome during apoptosis. immunity. 2012;36:401–414. 37. shimada k, crother tr, karlin j, chen s, chiba n, ramanujan vk, vergnes l, ojcius dm, arditi m. caspase-1 dependent il-1β secretion is critical for host defense in a mouse model of chlamydia pneumoniae lung infection. plos one. 2011;6:e21477. 38. zhou r, yazdi as, menu p, tschopp j. a role for mitochondria in nlrp3 inflammasome activation. nature. 2011;469:221–225. 39. nakahira k, haspel ja, rathinam va, lee sj, dolinay t, lam hc, et al. autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial dna mediated by the nalp3 inflammasome. nat immunol. 2011;12:222–230. 40. wree a, mcgeough md, inzaugarat me, eguchi a, schuster s, johnson cd, et al. nlrp3 inflammasome driven liver injury and fibrosis: roles of il‐17 and tnf in mice. hepatology. 2018;67:736–749. 41. mcgeough md, wree a, inzaugarat me, haimovich a, johnson cd, peña ca, et al. tnf regulates transcription of nlrp3 inflammasome components and inflammatory molecules in cryopyrinopathies. j clin invest. 2017;127: 4488–4497. 42. ighodaro om, akinloye oa. first line defence antioxidants-superoxide dismutase (sod), catalase (cat) and glutathione peroxidase (gpx): their fundamental role in the entire antioxidant defence grid. alexandria j med. 2018;54:287–293. 43. agarwal a, gupta s, sekhon l, shah r. redox considerations in female reproductive function and assisted reproduction: from molecular mechanisms to health implications. antioxid redox signal. 2008;10: 1375–1403. 44. agarwal a, virk g, ong c, du plessis ss. effect of oxidative stress on male reproduction. world j mens health. 2014;32:1–17. 45. lim j, luderer u. oxidative damage increases and antioxidant gene expression decreases with aging in the mouse ovary. biol reprod. 2011;84:775–782. 46. tatone c, amicarelli f, carbone mc, monteleone p, caserta d, marci r, et al. cellular and molecular aspects of ovarian follicle ageing. hum reprod update. 2008;14:131–142. 47. behrman hr, kodaman ph, preston sl, gao s. oxidative stress and the ovary. j soc gynecol investig. 2001;8:s40–s42. 48. jabbour hn, sales kj, catalano rd, norman je. inflammatory pathways in female reproductive health and disease. reproduction. 2009;138:903–919. 49. herath s, williams ej, lilly st, gilbert ro, dobson h, bryant ce, et al. ovarian follicular cells have innate immune capabilities that modulate their endocrine function. reproduction. 2007;134:683–693. 50. uri-belapolsky s, shaish a, eliyahu e, grossman h, levi m, chuderland d, et al. interleukin-1 deficiency prolongs ovarian lifespan in mice. proc natl acad sci u s a. 2014;111:12492–12497. 51. hussein mr. apoptosis in the ovary: molecular mechanisms. hum reprod update. 2005;11:162–77. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. dx.doi.org/10.22317/jcms.06201901 388 j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 original circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus erythematosus iraqi patients zainab m. dahham*, namir i. a. haddad department of chemistry, college of science, university of baghdad, baghdad, iraq. *correspondence to: zainab m. dahham (email: zainab@sc.uobaghdad.edu.iq) (submitted: 11 august 2022 – revised version received: 10 september 2022 – accepted: 17 october 2022 – published online: 26 december 2022) abstract objectives: systemic lupus erythematosus (sle) is a chronic autoimmune disease characterized by a diversity of the phenotypes among the patients. sle is still one of the great challenges due to the lacking of specific biomarkers for diagnosis, assessing disease activity, and prediction of response to therapy. this study aimed to investigate the role of circulating levels of irf5 protein in sample of sle iraqi patients and its correlation with disease activity, to identify a potential immunological biomarker to mirror disease activity. methods: blood samples were taken from 59 participants diagnosed with sle cases classified according to the american college of rheumatology (acr) criteria. they were scored through the sle disease activity index 2000 (sledai-2k) to estimate the disease activity, and according to it they were subdivided into “sle-1 group” (sledai-2k ≤5), and “sle-2 group” (sledai-2k >5), as well as age and gender matched healthy control group. circulating levels of irf5 protein were measured in sera samples by elisa method. results: our result revealed that the circulating levels of irf5 protein were significantly higher in the sle-2 group rather than control group (p < 0.01), while there was a non-significant difference between sle-1 group and control group (p > 0.05), as well as between both sle patient groups. moreover, the circulating irf5 protein levels were found to be correlated positively and significantly with disease activity index in both sle patient groups. the correlation between the circulating levels of irf5 protein with other parameters revealed that a significant positive correlation was found in sle-1 group with esr and globulins, and negative correlation with hb and (albumin/globulin) ratio, while in sle-2 group were positively correlated with urea, creatinine, and uric acid. the analysis of receiver operator curves (roc) for circulating levels of irf5 protein in sle-1 and sle-2 groups showed a good accuracy to distinguish sle patients from healthy individuals (auc = 0.758, sensitivity = 65.5%, and specificity = 69%,), and (auc = 0.788, sensitivity = 77.3%, and specificity = 72.0%,), respectively. conclusion: the circulating levels of irf5 protein correlate with disease activity in sle patients reflects the possibility of using it as a potential immunological biomarker for diagnosis, and monitoring the disease activity. keywords: irf5 protein, lupus erythematosus, systemic, iraqi patients issn 2413-0516 introduction systemic lupus erythematosus (sle) is a chronic multi-system autoimmune disease. it is characterized by the production of excessive auto-antibodies due to break of immune system tolerance to self-antigen.1-3 this subsequently leads to formation of circulating immune complexes, and immunologically mediated tissues injury.4-6 sle is a heterogenous disease with a wide range of clinical manifestations and immunological disorders. although the etiology and pathogenesis of sle are still obscure, several lines of evidence documented that immune disorders may be caused by genetic susceptibility and/or environmental factors.7-9 the incidence of sle primarily afflicts women in the reproductive years rather than men, with female to male ratio of approximately 9:1.10,11 the diversity in the clinical manifestations among the patients is a great obstacle and might reflect the differences in underlying pathogenesis. sle is still one of the great challenging for physicians and investigators. for more accurate diagnosis it is necessary to find a new reliable and specific biomarker for sle.12-14 interferon regulatory factor-5 (irf5) is a member of the irf family of the transcription factors. it encodes a 60-63-kda polypeptides, acts as a regulator of the production of numerous pro-inflammatory cytokines, including type i interferon ifns (alpha and beta), il-12, il-6, il-23, and tumor necrosis factor alpha (tnf-α).15,16 it has been shown that the immune response against viral, fungal, and bacterial infections is regulated by irf5.17 several recent studies revealed important roles of irf5 in innate and adaptive immunity, cell growth regulation, apoptosis, and macrophage polarization.18 many genome-wide association studies document that there is a robust correlation between irf5 snps and sle, and that irf5 high-risk variants play an important role in sle pathogenesis.19 numerous studies reported that irf5 risk variants generally correlated with elevated irf5 expression levels in sle blood cells, and with interferon-alpha activity in sle patients.20 to date, there are few studies about endogenous and extracellular irf5 protein. wang and his colleagues (2018), they determined the level of irf5 protein in wbcs of community-acquired pneumonia (cap) patients and healthy donors using flowcytometry techniques.21 idborg et al. (2019), who confirm the presence of extracellular irf5 protein in circulation. they measured the concentration of it in plasma of sle patients and age matched healthy controls. the techniques that used are immunoprecipitation followed by mass spectrometry (ip-ms) and elisa method.22 this study aimed to determine the concentration of circulating irf5 protein in sera of sample of iraqi sle patients, and examine its correlation with disease activity to identify its predictive value using roc analysis for sle diagnosis as a potential immunological biomarker reflects disease severity. materials and methods subjects a total of 59 patients diagnosed with sle disease (56 females and 3 males) were recruited from the rheumatology unit of baghdad teaching hospital between november 2020 and february 2021. the sle patients had met the 1997 american mailto:zainab@sc.uobaghdad.edu.iq 389j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 z.m. dahham et al. original circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus college rheumatology (acr) revised criteria for the classification of sle.23 patients with other autoimmune disease, malignant disease, kidney disease, liver disease, alcohol intake, cigarette smoking, and other acute infections were excluded. full history was taking, clinical examination and all the required routine laboratory tests were performed for all patients in order to assessment the disease activity score using sle disease activity index 2000 (sledai-2k) score,24 and according to it they were subdivided into “sle-1 group” (sledai-2k ≤5) and “sle-2 group” (sledai-2k >5). a total of 29 age matched healthy controls were also recruited with no evidence of any chronic medical illness. samples collections venous blood specimens of 5 ml were drawn after overnight fasting from each participant, then the blood was immediately divided into two portions. the first one (2 ml) was transferred into tube containing k3edta, and they were stirred gently for a few seconds to avoid blood clotting and they were used for hematological parameters determination. the reminder blood was transferred into a glass tube with a gel separator. the blood samples were allowed to clot for 10 minutes at 37oc in a water bath, then they were centrifuged at 3000 × g for 10 minutes. the obtained clear serum was dispensed in several aliquots, and stored frozen at –20oc until being used to estimate the different parameters included in the study. hemolyzed sera were excluded. determination of circulating levels of irf5 protein irf5 protein levels were estimated in sera samples using human ifr5 (interferon regulatory factor5) elisa kit was supplied by (my biosource company, usa) according to manufacturer’s protocol. laboratory testing complete blood count (cbc) was done by abbott hematology auto-analyzer (cell-dyn-ruby, usa). erythrocyte sedimentation rate (esr) was determined by the westergren method. general urine examination (gue) was determined by routine techniques. protein urea was quantified by 24-h urine collections. anti-nuclear antibodies (ana) and ds-dna antibodies (ds-dna) were determined using elisa method by naissa immuno auto-analyzer (neomedica, europe). while c3 and c4 concentrations were determined using turbidimetry method by hipro immuno auto-analyzer (hipro, china). other biochemical tests were performed by colorimetric methods according to the manufacturer’s instructions using commercial kits. statistical analysis the results were presented as mean ± standard deviation (mean ± sd). the differences among the studied groups were calculated by applying analysis of variance one-way (anova), and followed by post hoc tukey analysis to test the differences between every two groups within anova. the degree of correlation between parameters was calculated by pearson’s correlation test. the percentage of significance was obtained by r and p values. the p-value is considered significant if it is < 0.05, and highly significant if it ≤0.01. receiver operator characteristics curve (roc) analysis was constructed for circulating levels of irf5 protein to estimate its diagnostic yield for sle disease, the area under the curve were considered exceptional (1–0.9), excellent (0.9–0.81), good (0.8–0.71), fair (0.7–0.61), and poor (0.6–0.5). the statistical analyses were performed using software statistical package for social science (spss) version 26.0 (im spss, chicago, il, usa) and graphpad prism, version. 9.3.1 (san diego, california, usa). results the demographic data, clinical and immunological characteristics of the 88 participants, 59 patients diagnosed as sle according to the american college rheumatology (acr) criteria, and 29 healthy controls are described in table 1. the treatment with medication that used at time of enrollment were also mentioned. it is clear from the results in table 1 that among the 59 sle patients, 95% (m:f = 3:56) are females. as for organ involvement, 45 patients (76.2%) had immunological disorders, and 31 patients (52.5%) had hematological disorders. the next common manifestations were arthritis in 25 patients (42.3%) and oral ulcers in 22 patients (37%), followed by renal disorders in 16 patients (27.1%). as for medications, most of the sle patients under therapy, 48 patients (81.3%) with prednisolone treatment, 43 patients (72.8%) with hydroxychloroquine treatment, and 15 patients (25.4%) with azathioprine treatment. there were no statistical differences in age, gender, and bmi among the three studied groups (sle-1, sle-2, and control), as well as in disease duration between the sle patient groups (p > 0.05). however, there is a significant difference in sledai–2k score between the sle patient groups (p < 0.05). the number of sle patients with family history in sle-1 group and sle-2 group are 4 (14%) and 8 (27%), respectively. on the other hand, all controls with no family history. to investigate the role of circulating levels of irf5 protein in sle pathogenesis, sera samples of sle patients and controls were analyzed. the results showed that circulating levels of irf5 protein were significantly increased in sle-2 group with a mean of 1.75 ± 0.65 ng/ml as compared with control group with a mean of 1.24 ± 0.19 ng/ml (p < 0.01). upon comparison between sle-1 group and control group the results show a slight increase of circulating levels of irf5 protein in sle-1 group with a mean of 1.48 ± 0.65 ng/ml than control group. but this increase was statistically non-significant, as well as non-significant difference was observed between sle patient groups as shown in figure 1. moreover, the circulating levels of irf5 protein in sle-1 and sle-2 groups were significantly and positively correlated with disease activity index (sledai-2k), (r = 0.441, p = 0.017) and (r = 0.502, p = 0.005), respectively as shown in (figure 2a and 2b). additionally, we found a significant positive correlation between circulating levels of irf5 protein and relative expression of irf5 mrna levels in both sle-1 and sle-2 groups, (r = 0.887, p < 0.0001) and (r = 0.847, p < 0.0001), respectively. data not shown as it is another part of our project and it is under publication elsewhere.25 the correlation of circulating levels of irf5 protein with other parameters in both sle patient groups were summarized in table 2. circulating levels of irf5 protein in sle-1 group were positively and significantly correlated with esr (r = 0.452, p = 0.014) and globulins (r = 0.463, p = 0.011), and negative correlation with hb (r = –0.459, p = 0.012) and (albumin/globulin) ratio (r = –0.484, 390 j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus original z.m. dahham et al. table 1. baseline characteristics of sle patients and healthy controls characteristic total sle patients sle-1 group sle-2 group control group p-value demographic data samples number 59 29 30 29 age (year), mean ± sd (range) 34.59 ± 10.96 (14–55) 34.53 ± 10.8 (18–55) 34.66 ± 11.2 (14–53) 33.03 ± 9.6 (18–52) 0.81 bmi (kg/m2), mean ± sd 27.17 ± 6.1 26.06 ± 6.3 28.32 ± 5.5 26.35 ± 5.6 0.285 gender female, n (%) male, n (%) 56 (95%) 3 (5%) 27 (93%) 2 (7%) 29 (97%) 1 (3%) 26 (90%) 3 (10%) 0.574 disease duration (year), mean (range) 4.85 (0.1–33) 4.64 (0.3–23) 5.04 (0.1–33) 0.956 family history with sle 12 (20%) 47 (80%) 4 (14%) 25 (86%) 8 (27%) 22 (73%) -yes, n (%) no, n (%) clinical and immunological manifestations vasculitis, n (%) 2 (3.3%) 0 (0%) 2 (6.6%) arthritis, n (%) 25 (42.3%) 10 (34.5%) 15 (50%) myositis, n (%) 0 (0%) 0 (0%) 0 (0%) pleurisy, n (%) 3 (5%) 0 (0%) 3 (10%) proteinuria, n (%) 12 (20.3%) 0 (0%) 12 (40%) hematuria, n (%) 2 (3.3%) 0 (0%) 2 (6.6%) urinary casts, n (%) 2 (3.3%) 0 (0%) 2 (6.6%) oral ulcers n (%) 22 (37.2%) 10 (0%) 12 (43.3%) alopecia, n (%) 11 (18.6%) 4 (13.8%) 7 (33.3%) fever, n (%) 10 (16.9%) 3 (10.3%) 7 (33.3%) new rash, n (%) 11 (18.6%) 5 (17.2%) 6 (36.6%) thrombocytopenia, n (%) 12 (20.3%) 3 (10.3%) 9 (30%) leucopenia, n (%) 4 (6.7%) 3 (10.3%) 1 (3.3%) anemia, n (%) 29 (49.1%) 11 (37.9%) 18 (60%) low complement n (%) 18 (30.5%) 3 (10.3%) 15 (50%) (+) ana, n (%) 40 (67.7%) 15 25 (+) ds-dna antibodies, n (%) 36 (61%) 15 (51.7%) 21 (70%) sledai-2k, mean ± sd (range) 7.37 ± 3.94 (2–18) 4.1 ± 0.72 (2–5) 10.53 ± 3.08 (6–18) <0.01 medications prednisolone yes, n (%) 48 (81%) 11 (19%) 22 (76%) 7 (24%) 26 (87%) 4 (13%) treatment no, n (%) hydroxychloroquine yes, n (%) 43 (73%) 16 (27%) 19 (66%) 19 (34%) 24 (80%) 6 (20%) treatment no, n (%) azathioprine yes, n (%) 15 (25%) 44 (75%) 8 (28%) 21 (72%) 7 (23%) 23 (77%) treatment no, n (%) methotrexate yes, n (%) 3 (5%) 56 (95%) 1 (3%) 28 (97%) 2 (7%) 28 (93%) treatment no, n (%) the collected data was analyzed by mean ± sd (mean ± standard deviation), range (minimum-maximum), or number (percentage). p-value was used for the comparison among the three studied groups (sle-1, sle-2, and control). p > 0.05 = non-significant differences, p < 0.05 = significant differences, p ≤ 0.01 = high significant differences. bmi, body mass index; ana, anti-nuclear antibodies; ds-dna antibodies, double strand deoxy nucleic acid antibodies; sledai-2k, systemic lupus erythematosus disease activity index 2000. 391j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 z.m. dahham et al. original circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus p = 0.008). while circulating levels of irf5 protein in sle-2 group were positively correlated with urea (r = 0.632, p < 0.0001), creatinine (r = 0.751, p < 0.0001), and uric acid (r = 0.595, p = 0.001). in order to estimate the ability of circulating levels of irf5 protein to distinguish the active sle patient from healthy subjects as a diagnostic biomarker. we analyzed it using roc curve analysis. the result showed that the circulating levels of irf5 protein in sle-1 and sle-2 groups had a good ability to discriminate sle patients from healthy persons. by which the auc, sensitivity and specificity were (0.758, 65.5%, 69.0%), and (0.778, 72.4%, 70.0%) respectively, at the cut off value of 1.35 (ng/ml), and 1.365 (ng/ml) respectively, which was the good value of sle correct prediction, as shown in (fig 3a and 3b). discussion this study has been prepared to evaluate the circulating levels of irf5 protein in a sample of sle iraqi patients, and to examine the association with disease activity index and other parameters. moreover, applying the roc curve analysis in fig. 1 circulating levels of irf5 protein among the studied groups. the results were expressed as mean ± sd (mean ± standard deviation), p > 0.05 = statistically non-significant differences, * statistically significant differences at p < 0.05, ** statistically significant differences at p ≤ 0.01. fig. 2 (a and b), the correlation between circulating levels of irf5 protein (ng/ml) and sledai-2k score in sle-1 group and sle-2 group, respectively. r, pearson coefficient. p > 0.05 = statistically non-significant correlation, *statistically significant correlation at p < 0.05, ** statistically significant correlation at p ≤ 0.01. table 2. the correlation between circulating levels of irf5 protein (ng/ml) with other biochemical parameters parameter circulating levels of irf5 protein (ng/ml) sle-1 group n = 29 sle-2 group n = 30 r p-value r p-value demographic data age (year) 0.353 0.06 0.124 0.515 gender (f/m) –0.259 0.175 –0.76 0.689 bmi (kg/m2) 0.218 0.255 0.084 0.659 disease duration (year) 0.098 0.612 -0.001 0.997 family history with sle –0.222 0.309 0.409 0.058 hematological parameters wbc x 103 /ul –0.297 0.118 0.353 0.060 rbc x 106 /ul –0.245 0.201 –0.212 0.261 hb (gm/dl) –0.459 0.012* –0.269 0.151 plt x 103 /ul 0.153 0.429 0.366 0.051 esr (mm/1 hr) 0.452 0.014* 0.106 0.546 biochemical parameters urea (mg/dl) 0.145 0.452 0.632 <0.0001** creatinine (mg/dl) 0.04 0.838 0.751 <0.0001** uric acid (mg/dl) 0.353 0.060 0.595 <0.001** got (u/l) -0.069 0.723 0.352 0.057 gpt (u/l) 0.224 0.242 0.184 0.0331 alp (u/l) 0.366 0.051 -0.51 0.79 total serum protein (g/l) 0.207 0.281 -0.172 0.364 serum albumin (g/l) -0.394 0.063 -0.180 0.340 globulins (g/l) 0.463 0.011* 0.011 0.954 albumin /globulins -0.484 0.008** -0.098 0.608 total cholesterol (mg/dl) -0.052 0.787 0.328 0.077 tri glyceride (mg/dl) 0.065 0.737 0.272 0.145 vldl (mg/dl) 0.063 0.747 0.272 0.145 hdl (mg/dl) -0.214 0.264 0.098 0.607 ldl (mg/dl) -0.029 0.879 0.302 0.105 r, pearson coefficient. p > 0.05 = statistically non-significant correlation, *statistically significant correlation at p < 0.05, **statistically significant correlation at p ≤ 0.01. bmi, body mass index; wbc, white blood cells; rbc, red blood cells; hb, hemoglobin; plt, platelets; esr, erythrocyte sedimentation rate; got, glutamate oxaloacetate transaminase; gpt, glutamate pyruvate transaminase; alp, alkaline phosphatase; vldl, very low-density lipopro tein; hdl, high-density lipoprotein; ldl, low-density lipoprotein. 392 j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus original z.m. dahham et al. order to predict the ability of it for diagnosis of sle patients as an immunological biomarker. our result revealed that circulating levels of irf5 protein were found to be increased in both sle-1 and sle-2 groups as compared with healthy controls, and correlated positively and significantly with disease activity index. irf5 is a transcription factor plays an important role in inflammatory response. it is likely a key regulator of the toll like receptors (tlrs). in the case of the unstimulated cell, irf5 is generally localized in the cytoplasm as a monomer. activation of the above receptors leads to cascading signals. irf5 undergoes posttranslational modification, which eventually leads to homodimerization, a critical event prior to nuclear translocation.17 the extracellular protein of irf5 still has an unknown function in the circulation and away from complete transcription factors and other nuclear molecules. it can have an unknown function or may regardless of the function.22 the functions of extracellular and intracellular protein might be different and unusual secretion is also probable.26 our finding is in agreement with idbord et al., who found that circulating levels of irf5 protein were significantly higher in sle patients compared with control individuals. they reported that the high level of irf5 protein in plasma samples of sle patients may be reflected the increase of cell death during apoptosis clearance in sle patients.22 in other hands, we cannot only be clarified by this reason because the reports of transcription factor in circulation are limited.27,28 there is no information about the function of extracellular of irf5 protein. however, the fact that irf5 may be present in microparticles, known to mediate cell-cell signaling thus further studies are needed about circulating irf5 protein.22 the expression of irf5 gene is significantly raised in peripheral mononuclear cells (pbmc) from sle patients as compared to age-matched healthy individuals, and this can stimulate the expression of type i interferon.29 the elevated serum levels of ifnalpha have been shown to be associated with the activity and severity of sle disease. these findings support to explain our results about the positive correlation between circulating levels of irf5 protein and disease activity.30 numerous studies in different countries population have showed that the hematological abnormalities are present in most of sle patients. the common hematological syndrome in sle patients is anemia, which is most often owing to the anemia of chronic disease. esr levels were significantly increase in sle patients during sle flare and infections as compared to healthy controls.31-33 many studies indicated that esr considered an important factor in assessing sle disease activity, as esr elevates when disease activity increase. it is believed that the reason for the high rate of erythrocyte sedimentation is the decrease in the concentration of proteins in the blood plasma, as well as the change in the shape of the surface of the erythrocytes and their adhesion to each other.34 these findings may be explaining our results about the negative correlation between hb and circulating irf5 protein, as well as the positive correlation between it and esr level. sle is characterized by raised levels of autoreactive antibodies and gamma globulin. the production of autoantibodies requires the synthesis of gamma globulin and this led to increase the globulin levels in blood sle patients.35,36 our results about positive proteinuria in sle patients as shown in table 1 are in agreement with previous studies that documented the presence of protein in urine in sle patients.37,38 serum albumin was determined in sle patients as a part of routine biochemical tests. the decrease of serum albumin levels in sle patients may be caused by elevating albumin catabolism as a result of chronic inflammation and/or because of poor diet from proteins content and calories. moreover, the common manifestation in sle patients is nephritis which characterized by attack the kidney membranes due to the presence of auto-antibodies against these membranes. consequently, membranes are disrupted and impaired its group auc se p-value 95% ic cut-off value sensitivity specificity ppv npv accuracy sle-1 0.758 0.064 0.001 0.633-0.883 1.350 65.5% 69.0% 67.9% 66.7% 67% sle-2 0.778 0.06 <0.001 0.659-0.896 1.365 72.4% 70.0% 72.4% 70.0% 71.1% fig. 3 (a&b) receiver operator curve (roc) analysis for the predictive value of circulating levels of irf5 protein in sle-1 (n = 29) and sle-2 (n = 30) versus healthy controls (n = 29), respectively. auc = area under the curve, se = standard error, ci = confidence interval, ppv = positive predictive value, npv = negative predictive value. 393j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 z.m. dahham et al. original circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus filtration ability. in normal condition the filtering membranes do not allow albumin and another blood proteins to be missing in the urine. however, in lupus nephritis the protein loss in urine which in turn lowers serum albumin concentrations,39,40 and this lead to decrease the ratio of albumin/globulin. kwon et al. (2018) found that the (albumin/globulin) ratio in sle with nephritis was lower than in sle without nephritis.36 all above findings supported our results about the positive correlation between circulating level of irf5 protein and globulins, as well as a negative correlation with the ratio of (albumin/ globulin). our results of the positive correlation with urea, creatinine, and uric acid could be explained by the existence of some patients with lupus nephritis as shown in table 1. consequently, the existence of any criterion correlated with kidney disorder for example proteinuria and hematuria lead to raise the score of disease activity. therefore, patients with lupus nephritis graded the high score of disease activity among the patients, subsequently increasing their levels of circulating irf5 protein. roc curve analysis, it showed that circulating levels of irf5 protein in sle-1 and sle-2 groups could represent a good predictor for sle diagnosis. conclusion our study results suggests that the irf5 may play an important role in sle pathogenesis, and irf5 may be useful in diagnosis of sle. the circulating levels of irf5 protein associated with disease flare in sle patients reflect the possibility of using it as a potential biomarkers for diagnosis, monitoring the disease course and response to therapy. moreover, the elisa method is more rapid and inexpensive rather than real time pcr for determination of irf5 gene expression. conflict of interest none.  references 1. la paglia, g.m.c., leone, m.c., lepri, g., vagelli, r., valentini, e., alunno, a. and tani, c., 2017. one year in review 2017: systemic lupus erythematosus. clin exp rheumatol, 35(4), pp. 551–561. 2. idborg, h. and oke, v., 2021. cytokines as biomarkers in systemic lupus erythematosus: value for diagnosis and drug therapy. international journal of molecular sciences, 22(21), p.11327. 3. abdulridha, r.h., saud, a.m. and alosami, m.h., 2022. evaluation of interferon alpha (ifn-α) in women with systemic lupus erythematosus in iraq. iraqi journal of science, pp. 4225–4233. 4. hellquist, a., järvinen, t.m., koskenmies, s., zucchelli, m., orsmark-pietras, c., berglind, l., panelius, j., hasan, t., julkunen, h., d’amato, m.a.u.r.o. and saarialho-kere, u., 2009. evidence for genetic association and interaction between the tyk2 and irf5 genes in systemic lupus erythematosus. the journal of rheumatology, 36(8), pp. 1631–1638. 5. trentin, f., zucchi, d., signorini, v., elefante, e., bortoluzzi, a. and tani, c., 2021. one year in review 2021: systemic lupus erythematosus. clin exp rheumatol, 39(2), pp. 231–241. 6. hiba s. ahmed, hind s. ahmed, ali ad’hiah, 2020. interleukin-1 single nucleotide polymorphisms and risk of systemic lupus erythematosus among iraqi patients. meta gene 23 (100640). 7. quan, w., an, j., li, g., qian, g., jin, m., feng, c., li, s., li, x., xu, y. and hu, x., 2021. th cytokine profile in childhood-onset systemic lupus erythematosus. bmc pediatrics, 21(1), pp. 1–10. 8. katsuyama, t., tsokos, g.c. and moulton, v.r., 2018. aberrant t cell signaling and subsets in systemic lupus erythematosus. frontiers in immunology, 9, p. 1088. 9. jasem, m.a., 2007. hyperprolactenemia in women with systemic lupus erythematusus. baghdad science journal, 4(4). 10. urrego, t., ortiz-reyes, b., vanegas-garcía, a.l., muñoz, c.h., gonzález, l.a., vásquez, g. and gómez-puerta, j.a., 2020. transferrina y ceruloplasmina en orina de pacientes con lupus eritematoso sistemico.? son utiles para diferenciar pacientes con nefritis lupica? reumatología clínica, 16(1), pp. 17–23. 11. tselios, k., gladman, d.d., touma, z., su, j., anderson, n. and urowitz, m.b., 2019. disease course patterns in systemic lupus erythematosus. lupus, 28(1), pp. 114–122. 12. liu, c.c., kao, a.h., manzi, s. and ahearn, j.m., 2013. biomarkers in systemic lupus erythematosus: challenges and prospects for the future. therapeutic advances in musculoskeletal disease, 5(4), pp. 210–233. 13. capecchi, r., puxeddu, i., pratesi, f. and migliorini, p., 2020. new biomarkers in sle: from bench to bedside. rheumatology, 59(supplement_5), pp. v12-v18. 14. rekvig, o.p., 2018. systemic lupus erythematosus: definitions, contexts, conflicts, enigmas. frontiers in immunology, 9, p. 387. 15. mancl, m.e., hu, g., sangster-guity, n., olshalsky, s.l., hoops, k., fitzgeraldbocarsly, p., pitha, p.m., pinder, k. and barnes, b.j., 2005. two discrete promoters regulate the alternatively spliced human interferon regulatory factor-5 isoforms: multiple isoforms with distinct cell type-specific expression, localization, regulation, and function. journal of biological chemistry, 280(22), pp. 21078–21090. 16. cevik, o., li, d., baljinnyam, e., manvar, d., pimenta, e.m., waris, g., barnes, b.j. and kaushik-basu, n., 2017. interferon regulatory factor 5 (irf5) suppresses hepatitis c virus (hcv) replication and hcv-associated hepatocellular carcinoma. journal of biological chemistry, 292(52), pp. 21676–21689. 17. wang, m., lim, k.h. and chow, k.t., 2019. native polyacrylamide gel electrophoresis immunoblot analysis of endogenous irf5 dimerization. jove (journal of visualized experiments), (152), p. e60393. 18. banga, j., srinivasan, d., sun, c.c., thompson, c.d., milletti, f., huang, k.s., hamilton, s., song, s., hoffman, a.f., qin, y.g. and matta, b., 2020. inhibition of irf5 cellular activity with cell-penetrating peptides that target homodimerization. science advances, 6(20), p. eaay1057. 19. ebrahimiyan, h., bagheri-hosseinabadi, z. and abbasifard, m., 2021. interferon regulatory factor 5 in rheumatoid arthritis and systemic lupus erythematosus. rheumatology research, 6(1), pp.1–13. 20. li, d., matta, b., song, s., nelson, v., diggins, k., simpfendorfer, k.r., gregersen, p.k., linsley, p. and barnes, b.j., 2020. irf5 genetic risk variants drive myeloidspecific irf5 hyperactivation and presymptomatic sle. jci insight, 5(2). 21. wang, x., guo, j., wang, y., xiao, y., wang, l. and hua, s., 2018. expression levels of interferon regulatory factor 5 (irf5) and related inflammatory cytokines associated with severity, prognosis, and causative pathogen in patients with community-acquired pneumonia. medical science monitor: international medical journal of experimental and clinical research, 24, p. 3620. 22. idborg, h., zandian, a., ossipova, e., wigren, e., preger, c., mobarrez, f., checa, a., sohrabian, a., pucholt, p., sandling, j.k. and fernandescerqueira, c., 2019. circulating levels of interferon regulatory factor-5 associates with subgroups of systemic lupus erythematosus patients. frontiers in immunology, 10, p. 1029. 23. hochberg, m.c., 1997. updating the american college of rheumatology revised criteria for the classification of systemic lupus erythematosus. arthritis and rheumatism, 40(9), pp. 1725–1725. 24. gladman, d.d., ibanez, d. and urowitz, m.b., 2002. systemic lupus erythematosus disease activity index 2000. the journal of rheumatology, 29(2), pp. 288–291. 25. zainab m. dahham, namir i. a. haddad, correlation between gene expression of interferon regulatory factor-5 and disease activity index in systemic lupus erythematosus iraqi patients. iraqi journal of science (under publication). 26. radisky, d.c., stallings-mann, m., hirai, y. and bissell, m.j., 2009. single proteins might have dual but related functions in intracellular and extracellular microenvironments. nature reviews molecular cell biology, 10(3), pp. 228–234. 27. raghavan, s., manzanillo, p., chan, k., dovey, c. and cox, j.s., 2008. secreted transcription factor controls mycobacterium tuberculosis virulence. nature, 454(7205), pp. 717–721. 28. lomnytska, m., dubrovska, a., hellman, u., volodko, n. and souchelnytskyi, s., 2006. increased expression of cshmt, tbx3 and utrophin in plasma of ovarian and breast cancer patients. international journal of cancer, 118(2), pp. 412–421. 394 j contemp med sci | vol. 8, no. 6, november-december 2022: 388–394 circulating levels of interferon regulatory factor-5 correlates with disease activity in systemic lupus original z.m. dahham et al. 29. feng, d., stone, r.c., eloranta, m.l., sangster‐guity, n., nordmark, g., sigurdsson, s., wang, c., alm, g., syvänen, a.c., rönnblom, l. and barnes, b.j., genetic variants and disease‐associated factors contribute to enhanced interferon regulatory factor 5 expression in blood cells of patients with systemic lupus erythematosus,” arthritis & rheumatism: official journal of the american college of rheumatology, vol. 62, no. 2 pp. 562–573, 2010. 30. jefferies, c.a., 2019. regulating irfs in ifn driven disease. frontiers in immunology, 10, p. 325. 31. sasidharan, p.k., bindya, m. and sajeeth kumar, k.g., 2012. hematological manifestations of sle at initial presentation: is it underestimated? international scholarly research notices, 2012. 32. newman, k., owlia, m.b., el-hemaidi, i. and akhtari, m., 2013. management of immune cytopenias in patients with systemic lupus erythematosus— old and new. autoimmunity reviews, 12(7), pp. 784–791. 33. ismail zoair, m., zaki el-ghannam, m., gaber, a.e.a. and mohammed soliman, a., 2021. assessment the role of urine osteoprotegerin as a biomarker in lupus nephritis. al-azhar medical journal, 50(3), pp. 2201–2212. 34. majeed, w.a., jasim, h.m., farhan, a.a., ali, a.s. and gorial, f.i., 2017. detection of hematological biomarkers associated with lupus nephritis in a sample of iraqi patients. journal of biotechnology research center, 11(2). this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i6.1299 35. baum, c.g., chiorazzi, n., frankel, s. and shepherd, g.m., 1989. conversion of systemic lupus erythematosus to common variable hypogammaglobulinemia. the american journal of medicine, 87(4), pp. 449–456. 36. kwon, o.c., lee, j.s., ghang, b., kim, y.g., lee, c.k., yoo, b. and hong, s., 2018, december. predicting eventual development of lupus nephritis at the time of diagnosis of systemic lupus erythematosus. in seminars in arthritis and rheumatism (vol. 48, no. 3, pp. 462–466). wb saunders. 37. nazri, s.k.s., wong, k.k. and hamid, w.z.w., 2018. pediatric systemic lupus erythematosus: retrospective analysis of clinico-laboratory parameters and their association with systemic lupus erythematosus disease activity index score. saudi medical journal, 39(6), p. 627. 38. al-sarray, z.a., al-rayahi, i.a., al-hafidh, a.h. and dwayyikh, a.t., 2020. serum protein electrophoresis in iraqi systemic lupus erythematous patient. al-nisour journal for medical sciences, 2(1). 39. yip, j., aghdassi, e., su, j., lou, w., reich, h., bargman, j., scholey, j., gladman, d.d., urowitz, m.b. and fortin, p.r., 2010. serum albumin as a marker for disease activity in patients with systemic lupus erythematosus. the journal of rheumatology, 37(8), pp. 1667–1672. 40. cojocaru, m., cojocaru, m.i., silosi, i. and vrabie, d.c., 2010. kidney damage in autoimmune diseases. journal of medical biochemistry, 29(2), pp. 61–65. 270 j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 original preoperative incentive spirometer to prevent postoperative pulmonary complications following open heart surgeries: a randomized single blinded multi-centric clinical trial jadeel noor faleh1*, sadeq al-fayyadh2 1al-muthanah health directorate, ministry of health, al-muthanah, iraq. 2department of the adult nursing, college of nursing, university of baghdad, baghdad, iraq. *correspondence to: jadeel noor faleh (e-mail: jadeel.nour1202a@conursing.uobaghdad.edu.iq) (submitted: 29 may 2022 – revised version received: 21 june 2022 – accepted: 26 july 2022 – published online: 26 august 2022) abstract objective: to determine the effect preoperative use of an incentive spirometer (is) has on preventing postoperative pulmonary complications among patients undergoing open heart surgeries. methods: a prospective, randomized, controlled single-blinded parallel-group design. data were collected from january 9th 2022 to april 1st 2022. a total of n = 64 eligible patients were equally randomized to either intervention or control group. patients in the intervention group performed preoperative is training for two days before the scheduled surgery. the primary endpoint was the incidence of in-hospital ppcs. the secondary endpoints were postoperative peak expiratory flow rate (pefr), intensive care unit (icu) stay, hospital length of stay (hlos). results: patients in the intervention group had a lower incidence of postoperative pulmonary complications compared to the control group (12.5% and 21.8%). there was a statistical significant difference between the two groups regarding postoperative pefr, hlos and intensive care unit stay. conclusion: preoperative rehabilitation (involving incentive spirometer is related to a lower incidence of postoperative pulmonary complications for the group that received the intervention). training with preoperative incentive spirometer resulted in a shortening of hospital length of stay and intensive care unit (icu) stay. trial registration: the study was registered in the iranian clinical trial registry, this at https://www.irct.ir/ reference number (irct20211224053503n1). keywords: incentive spirometer, breathing exercises, postoperative pulmonary complications cardiac surgery issn 2413-0516 summary statement what is already known about this topic? • the use of is in the postoperative period helps preventing pulmonary complications after major surgeries. • the evidence supporting the inclusion of preoperative breathing exercises to prevent ppc, is inconclusive. what this paper adds? • the use of preoperative training using flow-oriented incentive spirometer for two days, had better outcomes to prevent postoperative pulmonary complications following open heart surgeries. • preoperative training using flow-oriented incentive spirometer for two days improves patients’ outcomes. • use of is as a routine care in the preoperative period shortens overall hospital stay. background and aim cardiac surgery is considered a high-risk procedure in which a multidisciplinary team is required to manage patients throughout the whole operation phases. when performing a cardiac surgery, focused attention and maintenance are required since the respiratory system is related in both anatomic structure and physiological function.1 open heart surgery can cause various cardiovascular, renal, mental, and infectious complications. however, the occurrence of pulmonary complications remains one of the most challenging difficulties due to the consequential association with increased morbidity and mortality.2 the incidences of developing ppc among cardiac surgeries patients range from 10% to 25%, approximately 2% to 5% patients are likely to experience severe pulmonary dysfunction, such as acute respiratory distress syndrome (ards). patients undergoing cabg surgery are more likely to develop ppc, the incidence rate ranges from 30% to 60%, which contributes to increased morbidity, mortality and length of hospitalization that impose an economic burden on the health care system.3-5 in iraq it was reported that 56% of patients’ experience hypoxia as an early complication within the first 48 hrs. following cabg surgery.6 recently, mohammed and nadr,7 reported that 14.2% of iraqi patients undergoing cabg develop ppcs including chest infections and atelectasis. the implementation of breathing exercises for cardiac surgery patients is now a widely established kind of nurse-led intervention. these exercises are designed for both the preoperative and the immediate postoperative periods in an effort to lower the likelihood of developing postoperative pulmonary complications (ppc), functional capacity impairment, and prolonged hospitalization.8 is is a device that achieves sustained maximal inspiration through predetermined flow or volume. it provides a visual feedback when the patient inhales and sustains the inflation for minimally 5 seconds, it is commonly used in the perioperative care in particular for abdominal and cardiothoracic surgeries as a preventive maneuver for ppcs. usually, it is nurses 271j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 j.n. faleh et al. original preoperative incentive spirometer to prevent postoperative pulmonary and respiratory therapists’ responsibility to instruct patients about the correct method of training using this mechanical device.9-11 this study aims to answer whether the preoperative use of an incentive spirometer reduces the occurrence of postoperative pulmonary problems and improve peak expiratory flow rate (pefr), intensive care unit (icu) stay, hospital length of stay (hlos) for adult patients undergoing open heart surgeries? materials and methods study design an interventional, prospective, randomized, controlled single-blinded parallel-group multi-centric study. participants and study design the study recruited adult patients who were scheduled to undergo coronary artery bypass grafting (cabg) surgery, cabg combined with valve repair, or valve replacement/ repair surgeries. exclusion criteria of the study included: uncooperative patients, patients who lack intellectual capacity to demonstrate proper use of incentive spirometer, cases in which incentive spirometer is contraindicated such as thoracic, abdominal, or cerebral aneurysms (risk of rupture due to increased thoracic pressure), recent cardiothoracic or abdominal surgery. the sample consisted of 64 patients. these patients were equally allotted to the control group and intervention group. the sample size was calculated according to a-priori sample sizes for student t-tests. settings of the study data were collected from january 9th to april 1st at three different centers in baghdad, iraq: (the iraqi center for heart diseases (ichd) of the medical city directorate, ibn al-bitar center for cardiac surgery of the karkh health directorate, ibn al-nafees cardiology hospital of the rusafa health directorate). intervention eligibility was determined using the inclusion and exclusion criteria of the sample. patients were randomly assigned to a study group (sg) who received preoperative incentive spirometer training for two days before the surgery and a control group (cg), who did not receive the intervention. both groups received same postoperative deep breathing exercises, directed cough, early mobilization, and optimal analgesia. upon signing the consent forms, patients allocated to the intervention group received preoperatively individualized training, they were asked to maintain a sitting position on the edge of bed, hold the is in an upright position, place the lips tightly around the mouthpiece and perform slow and deep inhalation, allow the first ball in the 600 cc chamber to rise to the top, enhance breathing by allowing the second ball in the 900 cc chamber to rise to the top, keep enhance breathing to set the target of 1.200 cc. at maximum inhalation, the mouthpiece is removed, followed by a breath-hold and normal exhalation allowing the three balls to fall to the bottom of the column. after ensuring proper demonstration of steps, patients were asked to repeat the maneuver in a set of ten times hourly while awake until the day of the surgical operation. outcome measures the incidence of postoperative pulmonary complications throughout the in-hospital postoperative period was the primary outcome measure, they were scored by the attending physician who is blinded to participants’ allocation. secondary outcomes included, baseline peak expiratory flow rate which was recorded preoperative and then reassessed on the sixth postoperative days respectively by using truzone® peak flow meter which is a tool that measures peak flows from 60 liters per minute (lpm) to 800 lpm at fastest speed at which air is forced out of lungs after taking a deep breath. length of postoperative hospital and length of icu stay. randomization and blinding simple randomization technique was used for the assignment of subjects into a particular group, flipping a coin method was chosen the side of the coin (i.e., heads control, tails intervention) determines the assignment of each subject. the study is single-blinded, since the participants are intentionally kept unaware of which of the two groups they have been assigned to. statistical methods data were analyzed through the use of ibm-statistical package for social sciences (spss) version 24. paired sample t-test (used to measure the difference between study and control groups in regard to their postoperative outcomes. effect size (cohen’s d test) used to determine the level of impact that the pre-operative incentive spirometer exercise on the postoperative outcomes of patients. ethical considerations and official agreements upon submission of the study protocol ethical approval was sought and granted from the institutional review board (irb)scientific committee of the nursing faculty, university of baghdad. the researcher submitted a detailed description about the study, including problem statement, objectives and questionnaire to the ministry of planning (central statistical organization) and to the medical city directorate, the karkh health directorate, the rusafa health directorate (human development and training center), in order to obtain an official permission to carry out the study. clinical registration upon approval from the committees, the study was registered for iranian clinical trial registry, this at https://www.irct.ir/ reference number (irct20211224053503n1). date of enrollment: 4/01/2022. results the total numbers of patients allocated in the study was (84) figure 1. of the 84 eligible patients; 20 were excluded for table 1. minimum sample size determination parameter of calculating the minimum sample size selected values anticipated effect size (cohen’s d): 0.5 desired statistical power level: 0.8 probability level: 0.05 272 j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 preoperative incentive spirometer to prevent postoperative pulmonary original j.n. faleh et al. various reasons including (postponement or cancellation of surgery, patients’ infection with covid-19, missing data). a total sample of 64 patients were therefore considered in the final analysis. the first group of 32 patients was the intervention group and the second group of 32 patients was the control group table 1. the study group that received the intervention consisted of 28 males (87.5%) and 8 females (12.3%). in which (65.6%) of them were within the age range (50–60) years old. regarding smoking status those who were identified as light smokers and heavy smokers had the highest percentages of (31.3%) for both. more than a half of patients’ (53.1%) were considered to be overweight. the control group consisted of 24 males (75%) and 8 females (25%). less than two thirds (62.5%) of the group were table 1. descriptive statistics of patients’ demographic and lifestyle data variables study group n (%) n = 32 control group n (%) n = 32 age 50–60 years old 21 (65.6%) 20 (62.5%) gender male 28 (87.5%) 24 (75.0%) female 4 (12.5%) 8 (25.0%) smoking status (pack/year) never smoked (0.0 pack-year) 5 (15.6%) 10 (31.3%) light smoker (0.1–20.0 pack-year) 10 (31.3%) 4 (12.5%) moderate smoker (20.1–40.0 pack-year) 7 (21.9%) 7 (21.9%) heavy smoker (> 40 pack-year) 10 (31.3%) 11 (34.4%) body mass index (bmi) underweight – bmi < 18.5 kg/m2 2 (6.3%) 1 (3.1%) overweight – bmi ≥25 to 29.9 kg/m2 17 (53.1%) 16 (50.0%) obesity – bmi ≥30 kg/m2 13 (40.6%) 15 (46.9%) fig. 1 consort study flow chart. within the age range (50–60) years old. the results showed that (34.4%) of the control group patients were identified as heavy smokers. regarding the patients’ bmi, half of the control group (50%) were overweight. the underlined numbers in table 2 represent the highest percentages of the selected variables. in the study group, less than two thirds of the patients (62.5) had undergone cabg surgeries. all of the surgeries were elective with a cardio pulmonary bypass (cbp) time of less than two hours for half of them and an operative time of 6 hours for (81.3%) in both groups. more than half (59.4%) of the control group had undergone cabg surgery, the majority (87.5) of the procedures were elective with a cpb time of (2–4) hours for more than half (56.3) of the patients. peak expiratory flow rate (pefr), hospital length of stay (hlos) the https://doi.org/10.22317/jcms.v8i4.1261. a paired sample t-test was conducted to compare the differences between pre-operative pefr between the two groups. there was a statistically significant difference in the pre-operative peak expiratory flow rates (m = 40.00000, sd = 107.42589, t (31) = 2.106, p = .043). there was a statistically significant difference in the postoperative peak expiratory flow rates between control group and study group (m = 75.78125, sd = 81.43976, t (31) = 5.264, p = .0001. the effect size for this analysis (d = 0.93) was found to exceed cohen’s (1988) convention for a large effect (d = .80). there was a statistically significant difference in the number of days’ patients spent in the icu setting between control group and study group (m = –.56250, sd = .91361, t (31) = –3.483, p = .002). the effect size for this analysis (d = 0.61) was found to be a medium effect size. there was a statistically significant difference in the number of days’ patients spent in the hospital from postoperative day zero between control group and study group (m = –1.37500, sd = 1.87943, t (31) = –4.139, p = .0001, the effect size for this analysis (d = 0.73) was found to be a medium effect size. discussion the study result showed that (65.6%) of the study group and (62.5%) of the control group were within the age group (50– 60) years old at the time of data collection. mohammad et al.12 273j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 j.n. faleh et al. original preoperative incentive spirometer to prevent postoperative pulmonary table 2. descriptive statistics of patients’ clinical and surgical data variables study group n = 32 control group n = 32 current surgical procedure cabg 20 (62.5%) cabg 19 (59.4%) mvr 6 (18.8%) mvr 7 (21.9%) avr 4 (12.5%) avr 4 (12.5%) cabg & mvr 1 (3.1%) tvr 1 (3.1%) cabg & avr 1 (3.1%) cabg & dvr 1 (3.1%) operative time 5 hours 4 (12.5%) 5 hours 4 (12.5%) 6 hours 26 (81.3%) 6 hours 26 (81.3%) 7 hours 2 (6.3%) 7 hours 2 (6.3%) cardiopulmonary bypass time (minutes) less than 2 hours 16 (50.0%) less than 2 hours 12 (37.5%) 2–4 hours 15 (46.9%) 2–4 hours 18 (56.3%) more than 4 hours 1 (3.1%) more than 4 hours 2 (6.3%) cabg: coronary artery bypass grafting, avr: aortic valve replacement, mvr: mitral valve replacement, dvr: double valve replacement, tvr: tricuspid valve repair. table 3. descriptive statistics of patients’ clinical outcomes variables study group (n = 32) n (%) control group (n = 32) n (%) pre-operative pefr below normal (male = < 450 l/min) (female = < 320 l/min) 31 (96.9%) 31 (96.9%) post-operative pefr below normal (male = < 450 l/min) (female = < 320 l/min) 32 (100.0%) 32 (100.0%) post-operative pulmonary complications atelectasis 4 (12.5%) 5 (15.6%) tracheobronchitis – 1 (3.1%) pleural effusion – 1 (3.1%) icu length of stay 2 days 28 (87.5%) 19 (59.4%) hlos 8 days 14 (43.8%) 8 (25.0%) reported that coronary artery disease (cad) tends to occur earlier in iraqi population. this finding may be attributable to the lifestyle profile of the participants including their propensity to smoke, poor dietary habits, and low levels of health literacy.13 the majority of the sample were males with a percentage of (87.5%) for the study group and (75.0%) for the control group. this result is supported by jassim et al.6 this gender difference could be attributed to many etiologies, including limited tobacco use among iraqi females and dietary habits. coronary artery disease (cad) and the occurrence of a woman’s first acute myocardial infarction occur several years later in women than in men, before menopause, the well-known biological defense that women have against cad can postpone the onset of cad symptoms by more than ten years.14 the study findings showed that half of the study sample was overweight with a bmi of ≥25 to 29.9 kg/m2, which is similar to the results of the study conducted by alam et al.15. these results are not surprising, because being overweight and obese are closely associated to both known and emerging risk factors for cardiovascular disease.16 regarding smoking status, the highest percentages in the study group were heavy smoker and light smokers with (31.3%) respectively, whereas, (34.3%) of the control group were heavy smokers, this result is consistent with the results of sharif-kashani et al.17 where 43.7% of patients had a cumulative tobacco exposure of >40 pack years. these findings own up to the fact that smoking contributes significantly to premature coronary atherosclerosis and to the acceleration of atherosclerosis by increasing the oxidation of low-density lipoprotein (ldl) and impairing coronary endothelial vasodilation.18 as for the performed surgical operation, 62.5% of the study group and 59.4% of the control group had underwent coronary artery bypass grafting (cabg), this result is similar to.19 with regard to cardiopulmonary bypass time (cpb), half of the study group had cpb time of less than 2 hours (> 120 minutes) similar to faritous et al.20 this difference in cpb time between the two groups could be attributed to intraoperative encountered complications possibly occurred to the control group. the majority of the study sample of both group had an operative time of 6 hours, unlike a study conducted by matsuura et al.,21 where 109 patients out of 149 had an operative time of 480.90 ± 161.20, which exceeded the operative time in the present study. the patients involved in the aforementioned study may had more complex surgeries that required more time compared to the patients in the present study. 274 j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 preoperative incentive spirometer to prevent postoperative pulmonary original j.n. faleh et al. table 4. difference in pre-operative pefr between study and control groups paired differences preoperative pefr (study group) preoperative pefr (control group) mean difference std. deviation t df sig. (2-tailed) 40.00000 107.42589 2.106 31 .043 table 5. difference in post-operative pefr between study and control groups paired differences effect size postoperative pefr (study group) postoperative pefr (control group) mean difference std. deviation t df sig. (2-tailed) 75.78125 81.43976 5.264 31 .0001 0.93 effect sizes = small (d = 0.2), medium (d = 0.5), and large (d = 0.8). fig. 2 the mean plot shows that pefr decreased in the postoperative period compared to the baseline values in both the study group and control group. however, the study group had better values in the postoperative period. postoperative pulmonary complications the incidence of postoperative pulmonary complications in those who received the intervention and those who did not was (12.5% and 21.8%) respectively, these findings did not differ from the results of chen et al. (2019),22 in which the incidence of postoperative pulmonary complications was 10.2% in the study group and 27.3% in the control group. another study confirmed these results where atelectasis was 14.10% in the study group and 27.10% in the control group.23 in contrast, moradian et al.24 reported that the incidence of postoperative atelectasis was the same in both groups with 20% incidence rate in each group. this difference in the presented results may be due to the fact that the control group in the aforementioned study had received conventional physiotherapy which contributed to insignificance unlike the control groups of the current study and those that had similar results to it, who did not receive any form of physiotherapy or pre-rehabilitation in the preoperative phase. the most prevalent complication in the current study was atelectasis with an overall incidence rate of (28.1%) for both groups compared to lower incidence in hijas-gómez et al.25 who reported an overall incidence rate of (5.9%). it is possible that the decreased incidence rate was due to the fact that postoperative patients in the aforementioned study have received physiotherapy. patients’ clinical outcomes tables 4, 5 and figure 2 represent the differences between the two groups in terms of peak expiratory flow rates, which demonstrates that there was a statistically significant difference in the postoperative peak expiratory flow rates p = .0001 unlike the results of herdy et al.,26 who found that before discharge, pefrs returned to baseline values in the rehabilitation group (336 ± 105 l/min) but not in the control group (271 ± 132 l/min). the difference between the findings of the present study and those of the aforementioned article is that the pefrs 275j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 j.n. faleh et al. original preoperative incentive spirometer to prevent postoperative pulmonary fig. 4 the mean plot shows that patients in the control group had longer length of hospital stay when compared to the study group. table 6. difference in icu stay time/days between study and control groups paired differences effect sizeicu stay time/days (study group) mean std. deviation t df sig. (2-tailed) icu stay time/days (control group) –.56250 .91361 –3.483 31 .002 0.61 effect sizes = small (d = 0.2), medium (d = 0.5), and large (d = 0.8). fig. 3 the mean plot indicates that patients in the control group spent more days in the icu following surgery when compared to the study group. table 7. difference in hospital length of stay/days between study and control group paired differences effect sizehospital length of stay (study group) mean std. deviation t df sig. (2-tailed) hospital length of stay (control group) –1.37500 1.87943 –4.139 31 .0001 0.73 effect sizes = small (d = 0.2), medium (d = 0.5), and large (d = 0.8). values of the patients in the present study were already below the normal values in the preoperative period, and despite the significant difference between the two group none of them returned to the baseline values after the surgery. the results in table 6 represents the difference between the study group and control group regarding the length of days spent in the intensive care unit (icu) setting which shows that the use of preoperative is has decreased the icu stay in the study group compared to the control group as shown in figure 3, a previous study conducted in turkey supported these results as they stated that preoperative inspiratory muscle training reduced the icu stay.27 regarding hospital length of stay, as shown in table 7 and figure 4, there was a statistically significant reduction in the number of days the study group spent in the postoperative period (p = .0001), which indicates that the intervention had a 276 j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 preoperative incentive spirometer to prevent postoperative pulmonary original j.n. faleh et al. positive effect on reducing hlos, supporting this conclusion, multiple clinical trials have demonstrated that preoperative respiratory physiotherapy utilizing various maneuvers is effective in reducing hospitalization for patients undergoing cardiac surgeries.28-31 conclusion this study showed that preoperative rehabilitation involving incentive spirometer is related to a lower incidence of postoperative pulmonary complications for the group that received the intervention (21.9% vs. 12.5%) a difference which may be considered relevant. training with preoperative incentive spirometer resulted in a shortening of hospital length of stay and intensive care unit (icu) stay among patients in the intervention group than those in the control group. this, in turn, results in the efficient use of the limited resources and the reduction of health-care costs, which supports the well-established concept of “meaningful use” of healthcare resources. recommendations patients undergoing open heart surgery should have free access to incentive spirometers in the surgical units, as well as adequate training and encouragement, since this appears to have prophylactic effect against ppcs. further studies with a larger sample size that specifically target patients with preexisting respiratory diseases such as chronic obstructive pulmonary disease (copd), asthma are required to confirm these findings. future clinical trials should consider double blinding in the recruitment and outcome assessment procedures. patients’ adherence considerations must be integrated into future clinical trials in order to establish a more solid evidence basis and to draw relevant conclusions. limitation the primary limitation was the small sample size which limited the generalizability of the intervention effect. two centers postponed the operations for a duration of one week for each due to rapid spread of coronavirus omicron variant which caused impediment in data collection and time constraints. funding information the budget of this research work was not support by any governmental or non‐governmental organization. the authors of this manuscript covered all the research work‐related expenses. conflicts of interest none.  references 1. tanner tg, colvin mo. pulmonary complications of cardiac surgery. lung. 2020 dec;198(6):889–96. available from: https://doi.org/10.1007/s00408020-00405-7 2. mali s, haghaninejad h. pulmonary complications following cardiac surgery. archives of medical science-atherosclerotic diseases. 2019 dec 31;4(1):280–5. available from: https://doi.org/10.5114/amsad.2019.91432 3. bharathi ar. assess the effectiveness of deep breathing exercise with incentive spirometer on the respiratory status of cardio thoracic and vascular patients. journal of research in medical and dental science. 2021:276-83. available from: https://doi.org/10.5114/amsad.2019.91432 4. fischer mo, brotons f, briant ar, suehiro k, gozdzik w, sponholz c, kirkeby-garstad i, joosten a, neto cn, kunstyr j, parienti jj. postoperative pulmonary complications after cardiac surgery: the venice international cohort study. journal of cardiothoracic and vascular anesthesia. 2022 aug 1;36(8):2344–51. available from: https://doi.org/10.1053/j.jvca.2021.12.024 5. ubben jf, lance md, buhre wf, schreiber ju. clinical strategies to prevent pulmonary complications in cardiac surgery: an overview. journal of cardiothoracic and vascular anesthesia. 2015 apr 1;29(2):481–90. available from: https://doi.org/10.1053/j.jvca.2014.09.020 6. jassim s, ahmed sa, nagi ab. assessment of early and late complication post coronary artery graft by–pass surgery cabg. kufa journal for nursing sciences. 2013;3(1). available from: https://journal.uokufa.edu.iq/index.php/ kjns/article/view/2404 7. mohammed ak, nadr jh. early complications associated with obesity following coronary artery bypass graft surgery. journal of the faculty of medicine. 2021;63(4). available from: https://iqjmc.uobaghdad.edu.iq/ index.php/19jfacmedbaghdad36/article/view/1877 8. rodrigues sn, henriques hr, henriques ma. effectiveness of preoperative breathing exercise interventions in patients undergoing cardiac surgery: a systematic review. revista portuguesa de cardiologia (english edition). 2021 mar 1;40(3):229–44. available from: https://doi.org/10.1097/ aco.0000000000000045 9. restrepo rd, wettstein r, wittnebel l, tracy m. incentive spirometry: 2011. respiratory care. 2011 oct 1;56(10):1600–4. available from: https://doi. org/10.1097/aco.0000000000000045 10. so mw, heo hm, san koo b, kim yg, lee ck, yoo b. efficacy of incentive spirometer exercise on pulmonary functions of patients with ankylosing spondylitis stabilized by tumor necrosis factor inhibitor therapy. the journal of rheumatology. 2012 sep 1;39(9):1854–8. available from: https://doi. org/10.1097/aco.0000000000000045 11. sum sk, peng yc, yin sy, huang pf, wang yc, chen tp, tung hh, yeh ch. using an incentive spirometer reduces pulmonary complications in patients with traumatic rib fractures: a randomized controlled trial. trials. 2019 dec;20(1):1–8. available from: https://doi.org/10.1097/ aco.0000000000000045 12. mohammad am, rashad hh, habeeb qs, rashad bh, saeed sy. demographic, clinical and angiographic profile of coronary artery disease in kurdistan region of iraq. american journal of cardiovascular disease. 2021;11(1):39. available from: https://www.ncbi.nlm.nih.gov/pmc/articles/ pmc8012293/ 13. mousa am, mansour k. effectiveness of an instructional program concerning healthy lifestyle on patients’ attitudes after percutaneous coronary intervention at cardiac centers in baghdad city. iraqi national journal of nursing specialties. 2020 sep 27;33(1):1–1. available from: https://injns.uobaghdad.edu.iq/index.php/injns/article/view/396 14. gheisari f, emami m, raeisi shahraki h, samipour s, nematollahi p. the role of gender in the importance of risk factors for coronary artery disease. cardiology research and practice. 2020 jul 29;2020. available from: https:// injns.uobaghdad.edu.iq/index.php/injns/article/view/396 15. alam m, shehzad mi, hussain s, paras i, kanwal m, mushtaq a. spirometry assessment and correlation with postoperative pulmonary complications in cardiac surgery patients. cureus. 2020 oct 23;12(10). available from: https:// doi.org/10.7759/cureus.11105 16. katta n, loethen t, lavie cj, alpert ma. obesity and coronary heart disease: epidemiology, pathology, and coronary artery imaging. current problems in cardiology. 2021 mar 1;46(3):100655. available from: https://doi. org/10.1016/j.cpcardiol.2020.100655 17. sharif-kashani b, shahabi p, mandegar mh, saliminejad l, bikdeli b, behzadnia n, heydari g, sharifi h, aidanlou s. smoking and wound complications after coronary artery bypass grafting. journal of surgical research. 2016 feb 1;200(2):743–8. available from: https://doi.org/10.1016/j. cpcardiol.2020.100655 18. barua rs, ambrose ja. mechanisms of coronary thrombosis in cigarette smoke exposure. arteriosclerosis, thrombosis, and vascular biology. 2013 jul;33(7):1460–7. available from: https://doi.org/10.1161/ atvbaha.112.300154 277j contemp med sci | vol. 8, no. 4, july-august 2022: 270–277 j.n. faleh et al. original preoperative incentive spirometer to prevent postoperative pulmonary https://doi.org/10.22317/jcms.v8i4.1261 this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. 19. vitomskyi v, al-hawamdeh k, lazarіeva о, vitomskа m. the efficacy of using tri-ball breathing exerciser in respiratory function recovery of the patients undergoing cardiac surgery. available from: doi:https://doi.org/10.14198/ jhse.2022.172.09 20. faritous z, yaghouti f, ghadrdoost b, heidarpour e, ziyaeifard m. transfusion of blood components and postoperative outcomes in patients undergoing cardiac surgery. iranian heart journal. 2020 apr 1;21(2):64–70. available from: http://journal.iha.org.ir/ article_105529_8d00957b143c9d7b22b909c7143b57ca.pdf 21. matsuura y, kamidaira m, tamura a. risk factors for postoperative delirium after cardiac surgery. int arch nurs health care. 2018;4:103. available from: https://doi.org/10.23937/2469-5823/15100103 22. chen x, hou l, zhang y, liu x, shao b, yuan b, li j, li m, cheng h, teng l, guo m. the effects of five days of intensive preoperative inspiratory muscle training on postoperative complications and outcome in patients having cardiac surgery: a randomized controlled trial. clinical rehabilitation. 2019 may;33(5):913–22. available from: https://doi.org/10.23937/2469-5823/15100103 23. gilani sr, hussain g, ahmad n, baig ma, zaman h. comparison of post-operative atelectasis in patients undergoing coronary artery bypass grafting with and without pre-operative incentive spirometry. journal of postgraduate medical institute. 2016 apr 28;30(2). available from: https:// applications.emro.who.int/imemrf/j_postgrad_med_inst/j_postgrad_ med_inst_2016_30_2_169_172.pdf 24. moradian st, heydari aa, mahmoudi h. what is the role of preoperative breathing exercises in reducing postoperative atelectasis after cabg?. reviews on recent clinical trials. 2019 dec 1;14(4):275–9. available from: https://doi.org/10.2174/1574887114666190710165951 25. hijas-gómez ai. preoperative respiratory physiotherapy and postoperative complications following valve replacement surgery. ec pulmonology and respiratory medicine. 2017;4:92–100. available from: https://www.semanticscholar.org/paper/preoperative-respiratoryphysiotherapy-and-valve-hijas-g%c3%b3mez-andr%c3%a9s-prado/ a503fca480819c9c4531223a2cc6e653801bd95e 26. herdy ah, marcchi pl, vila a, tavares c, collaço j, niebauer j, ribeiro jp. preand postoperative cardiopulmonary rehabilitation in hospitalized patients undergoing coronary artery bypass surgery: a randomized controlled trial. american journal of physical medicine & rehabilitation. 2008 sep 1;87(9):714–9. available from: doi: 10.1097/phm.0b013e3181839152. pmid: 18716482. 27. savci s, degirmenci b, saglam m, arikan h, inal-ince d, turan hn, demircin m. short-term effects of inspiratory muscle training in coronary artery bypass graft surgery: a randomized controlled trial. scandinavian cardiovascular journal. 2011 oct 1;45(5):286–93. available from: doi: 10.1097/phm.0b013e3181839152. pmid: 18716482. 28. hulzebos eh, helders pj, favié nj, de bie ra, de la riviere ab, van meeteren nl. preoperative intensive inspiratory muscle training to prevent postoperative pulmonary complications in high-risk patients undergoing cabg surgery: a randomized clinical trial. jama. 2006 oct 18;296(15): 1851–7. available from: doi: 10.1001/jama.296.15.1851. 29. nardi p, pellegrino a, pisano c, vacirca sr, anselmi d, saulle s, dandi r, romano a, servadio a, gianlorenzi a, ruvolo g. the effect of preoperative respiratory physiotherapy and motor exercise in patients undergoing elective cardiac surgery: short-term results. kardiochirurgia i torakochirurgia polska/polish journal of thoracic and cardiovascular surgery. 2019 jul;16(2):81–7. available from: doi: 10.1001/ jama.296.15.1851. 30. shahood h, pakai a, rudolf k, bory e, szilagyi n, sandor a, zsofia v. the effect of preoperative chest physiotherapy on oxygenation and lung function in cardiac surgery patients: a randomized controlled study. annals of saudi medicine. 2022 jan;42(1):8–16. available from: https://doi. org/10.5144/0256-4947.2022.8 31. sobrinho mt, guirado gn, silva ma. preoperative therapy restores ventilatory parameters and reduces length of stay in patients undergoing myocardial revascularization. brazilian journal of cardiovascular surgery. 2014 apr; 29:221–8. available from: https://doi.org/10.5935/16789741.20140021. 127j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 original a potential role of extracellular dna in biofilm and ciprofloxacin resistance hind tahseen ibrahim1, ali a. mussa2, harith jabbar fahad al-mathkhury2* 1department of medical laboratory techniques, college of medical (technology), al-farahidi university, baghdad, iraq. 2department of biology, college of science, university of baghdad, baghdad, iraq. *correspondence to: harith jabbar fahad al-mathkhury (e-mail: harith.fahad@sc.uobaghdad.edu.iq) (submitted: 26 january 2023 – revised version received: 19 february 2023 – accepted: 03 march 2023 – published online: 26 april 2023) abstract objectives: this study aims to broaden our knowledge of the role of edna in bacterial biofilms and antibiotic-resistance gene transfer among isolates. methods: staphylococcus aureus, e. coli, and pseudomonas aeruginosa were isolated from different non-repeated 170 specimens. the bacterial isolates were identified using morphological and molecular methods. different concentrations of genomic dna were tested for their potential role in biofilms formed by study isolates employing microtiter plate assay. ciprofloxacin resistance was identified by detecting a mutation in gyra and parc. results: the biofilm intensity significantly decreased (p < 0.05) concerning s. aureus isolates and insignificantly (p > 0.05) concerning e. coli isolates. yet, one e. coli isolate’s biofilm was significantly decreased (p < 0.05) linearly with increasing edna. of considerable interest, the addition of edna led to a significant increase (p < 0.05) in the biofilm of the two-tested p. aeruginosa isolates. moreover, edna participated in transferring ciprofloxacin resistance to the sensitive isolate when it presents in its biofilm. conclusion: edna has a dual effect on bacterial biofilms either supportive or suppressive following bacterial species per se. also, it seems to play an important role in antibiotic resistance within the biofilm. keywords: edna, biofilm, staphylococcus aureus, escherichia coli, pseudomonas aeruginosa issn 2413-0516 introduction staphylococcus aureus inhabited approximately 30% of healthy people, mostly in the anterior nares. nevertheless, it is also a leading cause of hospital-associated and community-associated bacterial infections in humans, associated with numerous mild skin and soft tissue infections and life-threatening pneumonia, aimeretcab, osteomyelitis, endocarditis, sepsis, and toxic shock syndrome. the increasing prevalence of methicillin-resistant s. aureus (mrsa) and its ability to resist multiple drugs has posed a serious challenge to infection control.1,2 escherichia coli is one of the earliest colonizers of the gastrointestinal tract; although eventually, it is a minor component of the colonic gut microbiome in humans, where it represents less than 0.1% of the total bacterial cells. nevertheless, due to the overall high cell density in the colon, this small percentage translates into around 108 cells/ml.3 indeed, e. coli is the causative agent of various intestinal and extra-intestinal diseases, including being suspected to be the cause of sudden infant death syndrome.4,5 pseudomonas aeruginosa is an opportunistic gram-negative pathogen and the leading cause of diverse nosocomial infections and it is commonly difficult to eradicate with conventional antibiotic therapy, particularly when established as biofilms.6 although p. aeruginosa rarely infects healthy people, those individuals whose skin, mucous membranes, or immune system are affected, are more susceptible to becoming infected by this organism; for example, burn victims, patients with cystic fibrosis, or cancer patients treated with chemotherapy.7 biofilms are surface-associated bacterial communities embedded in an extracellular matrix that is considered to be a major problem in the context of chronic infections because biofilm-dwelling cells have increased antibiotic resistance compared to their planktonic counterparts.8 the critical roles of the matrix for microbial interactions and virulence, as well as for antimicrobial tolerance, are being increasingly recognized. the matrix production enhances bacterial cell adhesion and cohesion (resulting in densely packed cell aggregates), providing mechanical stability.9 extracellular deoxyribonucleic acid (edna) is widely recognized as an integral component of biofilms’ extracellular polymeric matrix (ecm). many studies mentioned that edna plays a pivotal role in bacterial biofilm formation. the involvement of edna in biofilms includes providing nutrition and energy for sessile cells promoting horizontal gene transfer (hgt) in naturally competent cells or maintaining the biofilm integrity.10 while others have proved that edna could destabilize the biofilm formation process and that effect would depend on the bacterial species or its serotypes.11 upon the aforementioned facts, this study aimed at 1) investigating the effect of increasing concentration of edna on biofilm formation and 2) inspecting the transferring possibility of the antibiotic-resistant gene from edna to bacterial cell within the biofilm. materials and methods ethical statement this work is approved by the college of science research ethics committee (ref. csec/1220/0081). all participants agreed to provide the investigator with the specimens. informed consent according to the declaration of helsinki was obtained from all participants. specimen collection a total of 170 different non-repeated specimens were collected from patients referring to hospitals in baghdad, iraq. these specimens comprised anterior nares swabs (n = 20) were taken from healthcare workers as well as the patients, sputum (n = 30), mid-stream urine (n = 95), burn swabs (n = 13), and mailto:harith.fahad@sc.uobaghdad.edu.iq 128 j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 a potential role of extracellular dna in biofilm and ciprofloxacin resistance original h.t. ibrahim et al. blood (n = 12). the specimens were cultured on different selective culture media; mannitol salt agar, macconkey agar, eosin methylene blue (emb) agar, and cetrimide agar and subsequently subjected to conventional biochemical tests including catalase, oxidase, coagulase, acetoin production, imvic, motility, and haemolysin production test) to identify staphylococcus aureus, e. coli, and pseudomonas aeruginosa, salmonella enterica serovar typhi and klebsiella pneumoniae isolates.12 all the bacterial isolates were then tested for ciprofloxacin resistance by measuring the minimal inhibitory concentration for ciprofloxacin using the agar diffusion method following the method described by jennifer.13 polymerase chain reaction bacterial genomic dna was extracted using presto™ mini gdna bacteria kit (geneaid, taiwan) and all amplifications were carried out using accupower® pcr premix, and gradient master cycler (eppendorf, germany). all s. aureus-suspected isolates were screened for the presence of the s. aureus species-specific 16s rdna gene using specific primers, sa1: (aatctttgtcggtacacgatattcttcacg) and sa2: (cgtaatgagatttcagtagataatacaaca) were used to amplify 108 bp segment of s. aureus species-specific 16s rdna gene. the reaction protocol was as followed: initial denaturation at 92°c for 3 min followed by 30 cycles of 92°c 1 min, 56°c 1 min, and 72°c 1 min; following that 3 min at 72°c for final extension.14 s. aureus isolates were also screened for methicillin resistance by detecting meca gene using specific primers meca1: (gtagaaatgactgaacgtccgataa) and meca2: (ccaattccacattgtttcggt); the reaction condition included initial denaturation at 94°c for 10 min followed by 10 cycles of 94°c 45 sec, 55°c 45 sec and 72°c 75 sec; followed by 25 cycles of 94°c 45 sec, 50°c 45 sec and 72°c 75 sec.15 escherichia coli-suspected isolates were also screened for the presence of the uspa gene by the same technique employing specific primers uspa-f (ccgatacgctgccaatcagt) and uspa-r (acgcagaccgtaggccagat), the conditions were: initial denaturation at 95°c for 5 min followed by 30 cycles of 94°c 30 sec, 56°c 30 sec and 72°c 30 sec; following that 5 min at 72°c for final extension.16 two ciprofloxacin-resistant s. aureus isolates were selected to detect any possible mutation in gyra and parc coding for dna gyrase subunit a and dna topoisomerase iv, respectively using the specific primers. gyra-f: aaatctgcccgtgtcgttggt and gyra-r gccatacctacggcgatacc for gyra; parc-f: gtatgcgatgtctgaact and parc-r ttcggtgtaacgcattgc for parc. the amplification program involved initial denaturation at 95°c for 2 min followed by 35 cycles of 95°c 30 sec, 55.4°c 60 sec, and 72°c 60 sec.17 the sequences of the pcr products were obtained using the sanger method and then were aligned with gene sequences from national center for biotechnological information (ncbi) (https://www.ncbi.nlm.nih.gov/) to investigate for mutations. all ciprofloxacin resistant isolates were screened for the presence of acra gene coding for acrab efflux pump. the primers that were used are acra-f: (atgaacaaaaacagagg) and acra-r: (tttcaacggcagttttcg) in a pcr reaction program of initial denaturation at 94°c for 5 min followed by 30 cycles of 94°c 1 min, 52°c 1 min and 72°c 1 min followed by 5 min at 72°c for final extension.18 biofilm formation assay quantification of biofilm formation by e. coli, s. aureus, and p. aeruginosa on abiotic surfaces was assessed as previously described.19 in brief; wells of sterile 96-well u-shaped bottomed polystyrene microplates were filled with 200 μl of an overnight tsb (bacteria concentration was adjusted to in equivalence to mcfarland standard no. 0.5) before the plates were covered and incubated aerobically at 37°c for 24 h. each bacterium was tested in triplicate. control wells were performed by adding bacteria-free tsb. the wells were aspirated and washed three times with 200 μl sterile phosphate-buffered saline (pbs); the remaining attached bacteria were fixed with 200 μl methanol for 15 min. after drying in air, the wells were stained with 200 μl 0.1% crystal violet solution for 15 min at room temperature. the excess stain was rinsed off by placing the plate under running tap water. thereafter, the plates were dried. subsequently, the adherent cells were resolubilized with 200 μl of 33% glacial acetic acid for 15 minutes. finally, the optical density (od) of each well was obtained at 600 nm using a microplate reader (biotek, uk). cut off value (odc) was calculated as the mean of od of control wells plus 3 standard deviations. the isolates were then interpreted as non–producer (od ≤ odc), weak producer (odc < od ≤ 2*odc), moderate producer (2*odc < od ≤ 4*odc), or strong producer (4*odc < od). to investigate the impact of edna concentration on biofilms of e. coli, s. aureus, and p. aeruginosa, the same protocol described previously was followed; nonetheless, different concentrations (400 ng/µl, 200 ng/µl, 100 ng/µl, and 50 ng/µl as a final concentration) of purified edna were added to each well separately. moreover, 100 μl of te buffer was added to the control wells instead of purified edna. thereafter, plates were incubated, stained, and quantified as it is mentioned earlier. determining the role of edna in gene transfer an aliquot of 100 µl of the bacterial growth (compatible with mcfarland standard no. 0.5) of ciprofloxacin sensitive isolates of e. coli (e4), s. aureus (s4) and p. aeruginosa (p1) was added to wells of sterile 6-well u shaped-bottomed polystyrene microplates; thereafter, three ml of sterile tryptic soy broth were added to each well. a volume of one ml of edna (400 ng/µl) extracted from ciprofloxacin-resistant isolate (s. aureus isolate s17) was added to each well. all plates were covered and incubated at 37°c for 24 h. then washed thrice with sterile pbs. biofilms were removed from each well by scraping, suspended in a sterile broth medium, and incubated at 37°c for 18 h. the minimal inhibitory concentration to ciprofloxacin was determined and further investigation was carried out using pcr technique for gyra, parc, and acra genes as it is mentioned previously, followed by sequencing of amplified products. statistical analysis biofilm data were analyzed using two-way anova followed by lsd0.05. the differences were considered significant when p < 0.05. https://www.ncbi.nlm.nih.gov/ 129j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 h.t. ibrahim et al. original a potential role of extracellular dna in biofilm and ciprofloxacin resistance results and discussion identification results revealed that 25, 24, and 2 isolates were identified as s. aureus, e. coli, and p. aeruginosa, respectively. furthermore, all s. aureus isolates were found to be methicillin resistant due to harboring the meca gene. the polymerase chain reaction was also employed to detect the presence of acrab efflux pump using primers that are specific for acra gene encoding for this pump in all ciprofloxacin-resistant isolates (two s. aureus & 13 e. coli isolates). the result revealed the presence of a single gene with 495 bp in all of these isolates. the present results are in line with those obtained by pakzad et al.18 in that all the resistant isolates harbored the acra gene. on the other hand, these results differ considerably from those reported by the same authors as they reported that not all ciprofloxacin-sensitive isolates contained this gene. detection of gyra and parc mutations ciprofloxacin-resistant s. aureus isolates (s17 and s18) were carefully chosen to be investigated for mutations in gyra and parc genes. two specific sets of primers were used to amplify gyra and parc genes in separate pcr reaction tubes; after electrophoresis of the products and illumination under uv light, specific bands were obtained at 344 and 230 bp for gyra and parc, respectively. such results were expected as these genes are considered to be part of the structural genes of the bacterial cell. the sequences of the pcr product of the isolate s17 were obtained and compared to sequences of gyra and parc genes from ncbi; as illustrated in table 1 and table 2, about 40 and table 1. list of mutations in gyra forward strand no. mutation type no. mutation type 1 g®c transversion 21 a®c transversion 2 t®c transition 22 c®t transition 3 t®g transversion 23 a®c transversion 4 t®a transversion 24 c®t transition 5 g®deletion 25 t®a transversion 6 a®c transversion 26 c®t transition 7 g®a transition 27 g®a transition 8 a®t transversion 28 t®c transition 9 a®c transversion 29 a®g transition 10 t®a transversion 30 a®t transversion 11 a®c transversion 31 a®c transversion 12 g®a transition 32 c®a transversion 13 c®t transition 33 a®c transversion 14 a®c transversion 34 t®g transversion 15 a®t transversion 35 c®a transversion 16 a®c transversion 36 g®t transversion 17 g®t transversion 37 a®t transversion 18 c®a transversion 38 c®t transition 19 g®a transition 39 c®t transition 20 a®t transversion 40 g®c transversion table 2. list of mutations in gyra reverse strand no mutation type no mutation type 1 a®– deletion 27 t®g transversion 2 t®– deletion 28 a®g transition 3 c®a transversion 29 g®a transition 4 g®t transversion 30 a®g transition 5 a®c transversion 31 c®t transition 6 g®t transversion 32 c®t transition 7 t®g transversion 33 g®a transition 8 t®a transversion 34 a®t transversion 9 a®g transition 35 t®g transversion 10 t®c transition 36 c®t transition 11 a®g transition 37 a®t transversion 12 c®t transition 38 a®t transversion 13 g®a transition 39 g®t transversion 14 a®t transversion 40 t®g transversion 15 g®a transition 41 t®g transversion 16 t®c transition 42 t®a transversion 17 g®a transition 43 a®t transversion 18 t®c transition 44 g®a transition 19 a®c transversion 45 a®t transversion 20 c®t transition 46 a®g transition 21 g®t transversion 47 g®a transition 22 t®g transversion 48 t®c transition 23 t®g transversion 49 t®g transversion 24 t®a transversion 50 t®a transversion 25 t®g transversion 51 g®a transition 26 g®a transition 51 mutations in the forward and reverse strands, respectively, were detected in gyra of the tested isolate; since gyra encodes for dna gyrase, these mutations while leading to amino acid substitutions, alter the target protein for fluoroquinolone structure and subsequently the fluoroquinolone binding affinity of the enzyme, leading to drug resistance.20 on the other hand; after comparing the obtained sequence of parc from the tested isolate with sequences from ncbi, the result revealed complete similarity, and no mutations were recorded. in plain words, resistance to ciprofloxacin in the tested isolates is due to a mutation in gyrase rather than topoisomerase iv. biofilm formation assay the microtiter plate assay is the most widely used and was considered a standard test for the detection of biofilm formation. this method has been reported to be the most sensitive, accurate, and reproducible screening method for the determination of biofilm production by clinical isolates of s. aureus, e. coli, and p. aeruginosa and has the advantage of being a quantitative tool for comparing the adherence of different strains.21 130 j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 a potential role of extracellular dna in biofilm and ciprofloxacin resistance original h.t. ibrahim et al. the result revealed that only 8% of s. aureus isolates were strong biofilm producers; while 60% and 32% of the isolates were moderate and weak producers, respectively. on the other hand, none of the tested e. coli isolates were strong biofilm producers; whereas 68% and 32% of the isolates were moderate and weak producers, respectively. similar trends have been reported by mohammed et al.22 in that 14% of their local s. aureus isolates were strong biofilm-producers, 43% were low biofilm intensity and 43% were biofilm-negative. mathur et al.21 similarly conclude from their data that about 14.47% and 39.4% of s. aureus isolates exhibited high and moderate biofilm formation, respectively; while 46% were weak isolates. these data are not consistent with those reported by saeed et al.23 who stated that about 12.5% of isolated local strains of e. coli were strong biofilm producers while it agreed partially with their findings in that 87.5% of e. coli were moderate biofilm producers. it also disagrees greatly with fattahi et al.24 who found 38% of e. coli isolates were strong biofilm producers while 22%, 32%, and 8% of the isolates were moderate, weak, and non-biofilm producers respectively. the results are generally consistent with the findings of ghafil25 in that the ability of s. aureus to form biofilm was higher than that of e. coli. s. aureus biofilms, once established, are recalcitrant to antimicrobial treatment and the host response, and therefore are the etiological agent of many recurrent infections that have a demonstrated biofilm component.26 chronic infections are associated with the biofilm mode of growth where s. aureus can attach and persist on host tissues, such as bone and heart valves, to cause osteomyelitis and endocarditis respectively, or on implanted materials, such as prosthetic joints,27 catheters,28 table 3. impact of edna on biofilm isolate code od 600 p-value lsd 0.05control (no edna) 50 ng/µl of edna 100 ng/µl of edna 200 ng/µl of edna s1 0.151 0.114 0.108 0.112 0.004000 0.018 s2 0.181 0.152 0.149 0.113 0.000024 0.012 s3 0.193 0.182 0.154 0.167 0.016000 0.020 s4 0.178 0.133 0.143 0.134 0.035000 0.027 s5 0.151 0.150 0.133 0.127 0.160000 – e1 0.135 0.124 0.122 0.112 0.246066 – e2 0.131 0.133 0.118 0.109 0.204402 – e3 0.166 0.178 0.204 0.159 0.221004 – e4 0.142 0.173 0.164 0.151 0.501460 – e5 0.148 0.131 0.119 0.099 0.000206 0.011 p1 0.143 0.156 0.220 1.036 0.000001 0.012 p2 0.112 0.111 0.124 0.138 0.000010 0.004 k1 0.097 0.130 0.235 0.751 0.000004 – k2 0.113 0.171 0.185 0.217 0.000024 – se1 0.112 0.134 0.115 0.109 0.006000 0.019 se2 0.154 0.162 0.142 0.126 0.033009 – se3 0.164 0.162 0.159 0.148 0.449729 – se4 0.150 0.142 0.127 0.116 0.084083 – se5 0.301 0.291 0.289 0.266 0.399151 – and pacemakers.29 chronic s. aureus infections that are associated with biofilm frequently lead to significant increases in both morbidity and mortality, mainly when the infection is associated with indwelling medical devices.30 implanted materials become coated with host proteins upon insertion, and the matrix-binding proteins on the surface of s. aureus facilitate attachment to these proteins and the development of a biofilm. in cases of infected medical devices, removal of the device is often necessary to treat the infection.31 complications in e. coli-related infection have been mainly attributed to biofilm formation. e. coli biofilm formation is an intricate process that involves several steps such as initial adhesion, early development, maturation, and dispersion. these steps are governed by many genes that serve specific functions in the formation of the biofilm. e. coli biofilm has frequently been resistant to numerous antibiotics, mostly accredited to putative multidrug resistance pumps. the development of the extracellular matrix and the observed increased resistance to common antibiotics create a challenge to control the infections caused by e. coli biofilms.32 impact of edna concentration on biofilm intensity to investigate the impact of edna on biofilm, different concentrations of genomic dna were added to the wells of a microtiter plate containing selected bacterial isolates of the species e. coli, s. aureus, p. aeruginosa, salmonella enterica serovar typhi and klebsiella pneumonia. the result presented in table 3 revealed that the addition of increasing concentrations 131j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 h.t. ibrahim et al. original a potential role of extracellular dna in biofilm and ciprofloxacin resistance from figure 1, it can be noted that only 8% of s. aureus isolates were resistant to ciprofloxacin; whereas 28% developed intermediate resistance and 64% were sensitive to this antibiotic. on the other hand, about 44% of e. coli isolates were resistant to ciprofloxacin while no intermediate resistance was observed among the tested isolates; nevertheless, 56% were sensitive. regarding p. aeruginosa, the two tested isolates were ciprofloxacin-sensitive. these findings confirm those of earlier studies, such as mohamed et al.37 who found that the resistance of locally isolated e. coli strains from iraqi patients to ciprofloxacin was about 40.7%. whereas they differ slightly from those reported by al-jebouri and mdish38 who found that only 25% of e. coli and 40% of s. aureus isolates were resistant to ciprofloxacin. furthermore, our findings are in good agreement with al-marjani et al.39 who stated that about 16% of s. aureus isolates were resistant to ciprofloxacin. the increasing resistance of bacteria to ciprofloxacin could probably be augmented by using it to treat many infections including prostatitis, uti, endocarditis, gastroenteritis, infections of bones and joints, lower respiratory tract infection, and enteric fever, among others, even though the risk of tendon rupture could increase upon using it. notably, another factor contributing to the problem is the availability of ciprofloxacin as an oral suspension that is currently flooding the market; even though, it is not licensed by the fda to treat children with ciprofloxacin due to the high risk of permanent injury to the musculoskeletal system except for inhalation anthrax and cystic fibrosis.40 determining the role of edna in gene transfer this experiment was designed to assess the possible role of edna in the transfer of antibiotic-resistance genes. since the addition of edna has increased the biofilm intensity of p. aeruginosa isolate p1 only, our study was focused on that isolate. the mic of ciprofloxacin was measured before and after the growth of the sensitive isolate in the presence of the dna of ciprofloxacin-resistant isolate (s. aureus isolate s17), the result revealed that the mic value increased significantly (p < 0.05) from 1 to 4 µg/ml turning the bacterial isolate from sensitive to resistant to ciprofloxacin. the acquired resistance was also tested after three successive generations and it was shown that the mic value remained at 4 µg/ml. the same experiment was repeated using ciprofloxacin-sensitive e. coli e4 and s. aureus s4 isolates as a recipient for gene transfer. nonetheless, when measuring the mic values before and after the gene transfer, it remained at 1 µg/ml; hence, the isolates of edna resulted in a significant decrease (p < 0.05) in biofilm intensity for the majority of the tested s. aureus isolates. s1-s5: s. aureus isolates 1-5; e1-e5: e. coli isolates 1-5; p1 and p2: p. aeruginosa isolate 1 and 2; k1 and k2: klebsiella pneumoniae isolates; se1-se5: s. typhi isolates moreover, the biofilm intensity significantly decreased (p < 0.05) linearly with increasing concentrations of edna; on the other hand, although edna addition had led to thinner biofilm in the tested e. coli and s. typhi isolates, the increasing concentration did not have a significant effect (p > 0.05) on the biofilm intensity; nevertheless, the biofilm of one strain of e. coli and two strains of s. typhi was significantly decreased (p < 0.05) linearly with increasing edna. surprisingly, the addition of edna led to a significant increase (p < 0.05) in the biofilm of the tested isolates of p. aeruginosa and k. pneumonia. the findings of this study agreed with the findings of berne et al.33 who had informed that the biofilm formation of caulobacter crescentus is significantly inhibited by the presence of edna. those results suggested that the bacteria would probably have a better chance for attachment to abiotic surfaces in the presence of dnase i, hence their ability to form more compact biofilm would increase; additionally, the biofilm formation in salmonella had significantly been inhibited upon the addition of exogenous edna. another study conducted by özdemir et al.34 revealed that edna could either enhance or decrease the biofilm formation by salmonella and such effect of edna would be reliant on salmonella serotype. other studies that were conducted on the biofilm of listeria monocytogenes and neisseria meningitides come in contrast to our findings in which the biofilm formation had not been significantly affected by the addition of purified edna. however, crude extracts of edna in combination with probably some specific proteins or cell wall fragments promote the process of biofilm formation.35,36 due to the interaction of edna with one or more of the biofilm components needs further investigation. inhibiting role of edna in the biofilm development of either s. aureus, e. coli or s. typhi from our findings was another study carried out by wang et al.11 demonstrated the inhibitory effect of edna on salmonella enterica biofilm who stated that salmonella strains formed a thicker layer of biofilm in the presence of dnase i. of c. crescentus, which prevented the cells from settling into and encouraged the dispersal of cells. determination of minimal inhibitory concentration (mic) using agar diffusion method the susceptibility of the bacterial isolates (s. aureus, e. coli, and p. aeruginosa) towards ciprofloxacin was tested by determining the mic using the agar diffusion method. from the findings of the present study, various levels of susceptibilities to ciprofloxacin among isolates were observed. the results are summarized in figure 1. fig. 1 susceptibility of bacterial isolates to ciprofloxacin. 132 j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 a potential role of extracellular dna in biofilm and ciprofloxacin resistance original h.t. ibrahim et al. remained sensitive to ciprofloxacin; consequently, no gene transfer occurred. the sequence analysis of the gyra gene for the isolate before and after the addition of edna revealed slight variation, which furthermore confirms that the gene transfer process might have occurred and edna was responsible for that process. correspondingly, no pcr product was obtained when trying to amplify the acra gene after the gene transfer which implies that the acra gene has not been transferred during the process. the pool of edna found in bacterial biofilms provides a rich substrate for naturally occurring genetic transformation, which is the only alternative to mobile genetic elements and bacteriophage-induced gene transfer. this observation led to investigations into the role of dna donor cells in biofilms and the conclusion that biofilm cells actively donate dna to their prokaryotic neighbors.41 extracellular dna active in the natural transformation was shown to be released by both gram-positive and gram-negative members of soil bacteria, thereby facilitating naturally occurring genetic transformation. natural habitats suitable for horizontal gene transfer are not limited to the soil. the majority of bacterial populations on earth are accompanied by edna, and it is known that such edna is suitable for horizontal gene transfer.42 furthermore, it is well established that gene transfer occurs with enhanced efficiency in biofilms.43-46 such horizontal gene transfer is facilitated by a biofilm lifestyle, which is characterized by cohabitation in close vicinity. this sharing of genetic material may function as the prokaryotic equivalent to sexual selection,47 leading to beneficial adaptations such as antibiotic resistance48 or pathogenicity.49 conclusion extracellular dna has a major role in the gene transfer process to biofilms. given that, the addition of increasing concentrations of edna resulted in a significant decrease (p < 0.05) in biofilm intensity for the majority of the tested s. aureus and e. coli isolates. whereas, it has led to a significant increase (p < 0.05) in the biofilm of the two tested p. aeruginosa isolates. acknowledgment the authors would like to thank the patients for agreeing to participate in the study. conflict of interest “the authors declare no conflict of interest”.  references 1. akmatov, m. k., mehraj, j., gatzemeier, a., strompl, j., witte, w., krause, g., et al., serial home-based self-collection of anterior nasal swabs to detect staphylococcus aureus carriage in a randomized population-based study in germany. int j infect dis. 2014; 25: 4–10. doi:10.1016/j.ijid.2014.01.021 2. junie, l. m., simon, l. m., pandrea, s. l. resistance to the chemotherapeutic agents of staphylococcus aureus strains isolated from hospitalized patients. international journal of infectious diseases. 2014; 21:79–80. doi:10.1016/j. ijid.2014.03.593 3. rossi, e., cimdins, a., luthje, p., brauner, a., sjoling, a., landini, p., et al., “it’s a gut feeling” escherichia coli biofilm formation in the gastrointestinal tract environment. crit rev microbiol. 2018; 44(1): 1–30. doi:10.1080/104084 1x.2017.1303660 4. bettelheim, k. a., goldwater, p. n. escherichia coli and sudden infant death syndrome. front immunol. 2015; 6: 343. doi:10.3389/fimmu.2015.00343 5. blount, z. d. the unexhausted potential of e. coli. elife. 2015; 4. doi:10.7554/ elife.05826 6. soukarieh, f., vico oton, e., dubern, j. f., gomes, j., halliday, n., de pilar crespo, m., et al., in silico and in vitro-guided identification of inhibitors of alkylquinolone-dependent quorum sensing in pseudomonas aeruginosa. molecules. 2018; 23(2). doi:10.3390/molecules23020257 7. markou, p., apidianakis, y. pathogenesis of intestinal pseudomonas aeruginosa infection in patients with cancer. front cell infect microbiol. 2014; 3: 115. doi:10.3389/fcimb.2013.00115 8. flemming, h. c., wingender, j., szewzyk, u., steinberg, p., rice, s. a., kjelleberg, s. biofilms: an emergent form of bacterial life. nat rev microbiol. 2016; 14(9): 563–575. doi:10.1038/nrmicro.2016.94 9. liu, y., ren, z., hwang, g., koo, h. therapeutic strategies targeting cariogenic biofilm microenvironment. adv dent res. 2018; 29(1): 86–92. doi:10.1177/0022034517736497 10. mulcahy, h., charron-mazenod, l., lewenza, s. pseudomonas aeruginosa produces an extracellular deoxyribonuclease that is required for utilization of dna as a nutrient source. environ microbiol. 2010; 12(6): 1621–1629. doi:10.1111/j.1462-2920.2010.02208.x 11. wang, h., huang, y., wu, s., li, y., ye, y., zheng, y., et al., extracellular dna inhibits salmonella enterica serovar typhimurium and s. enterica serovar typhi biofilm development on abiotic surfaces. curr microbiol. 2014; 68(2): 262–268. doi:10.1007/s00284-013-0468-5 12. harley, j. b. laboratory exercises in microbiology. 10 ed: mcgrawhill education; 2016. 13. jennifer, m. a. determination of minimum inhibitory concentrations. j antimicrob chemother. 2001; 48: 5–16. 14. martineau, f., picard, f. j., roy, p. h., ouellette, m., bergeron, m. g. speciesspecific and ubiquitous-dna-based assays for rapid identification of staphylococcus aureus. j clin microbiol. 1998; 36(3): 618–623. 15. mcclure, j. a., conly, j. m., lau, v., elsayed, s., louie, t., hutchins, w., et al., novel multiplex pcr assay for detection of the staphylococcal virulence marker panton-valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci. j clin microbiol. 2006; 44(3): 1141–1144. doi:10.1128/jcm.44.3.11411144.2006 16. anastasi, e. m., matthews, b., gundogdu, a., vollmerhausen, t. l., ramos, n. l., stratton, h., et al., prevalence and persistence of escherichia coli strains with uropathogenic virulence characteristics in sewage treatment plants. appl environ microbiol. 2010; 76(17): 5882–5886. doi:10.1128/ aem.00141-10 17. gomig, f., galvao, c. w., freitas, d. l., labas, l., etto, r. m., esmerino, l. a., et al., quinolone resistance and ornithine decarboxylation activity in lactose-negative escherichia coli. braz j microbiol. 2015; 46(3): 753–757. doi:10.1590/s1517-838246320131291 18. pakzad, i., zayyen karin, m., taherikalani, m., boustanshenas, m., lari, a. r. contribution of acrab efflux pump to ciprofloxacin resistance in klebsiella pneumoniae isolated from burn patients. gms hyg infect control. 2013; 8(2): doc15. doi:10.3205/dgkh000215 19. nakao, r., ramstedt, m., wai, s. n., uhlin, b. e. enhanced biofilm formation by escherichia coli lps mutants defective in hep biosynthesis. plos one. 2012; 7(12): e51241. doi:10.1371/journal.pone.0051241 20. darbani, r., farshadfar, c., tavana, s., saljoughi, h., zonouri, s. s. identification of dna gyrase subunit a mutations associated with ciprofloxacin resistance in staphylococcus aureus isolated from nasal infection in kurdistan-iran. j mol biol res. 2017; 7(1): 186. doi:10.5539/jmbr. v7n1p186 21. mathur, t., singhal, s., khan, s., upadhyay, d., fatma, t., rattan, a. detection of biofilm formation among the clinical isolates of staphylococci: an evaluation of three different screening methods. indian journal medical microbiology. 2006; 24: 25–29. 22. mohammed, m. k., rasheed, m. n., nadeer, m. i. detection of biofilmassociated genes in clinical staphylococcus aureus isolates from iraqi patient. iraqi j sci nat 2015; 6: 19–22. 133j contemp med sci | vol. 9, no. 2, march-april 2023: 127–133 h.t. ibrahim et al. original a potential role of extracellular dna in biofilm and ciprofloxacin resistance 23. saeed, e. a., bnyan, i. a., al saadi, m. a. k. quorum sensing and biofilm formation by bacterial isolates from hemodialysis patients. research in pharmacy. 2013; 3: 33–40. 24. fattahi, s., kafil, h. s., nahai, m. r., asgharzadeh, m., nori, r., aghazadeh, m. relationship of biofilm formation and different virulence genes in uropathogenic escherichia coli isolates from northwest iran. gms hyg infect control. 2015; 10: doc11. doi:10.3205/dgkh000254 25. ghafil, j. a. assessment the effect of non-thermal plasma on escherichia coli and staphylococcus aureus biofilm formtion in vitro. iraqi j sci. 2018; 59: 25–29. 26. archer, n. k., mazaitis, m. j., costerton, j. w., leid, j. g., powers, m. e., shirtliff, m. e. staphylococcus aureus biofilms: properties, regulation, and roles in human disease. virulence. 2011; 2(5): 445–459. doi:10.4161/viru.2.5.17724 27. barrett, l., atkins, b. the clinical presentation of prosthetic joint infection. j antimicrob chemother. 2014; 69 suppl 1: i25–27. doi:10.1093/jac/dku250 28. chatterjee, s., maiti, p., dey, r., kundu, a., dey, r. biofilms on indwelling urologic devices: microbes and antimicrobial management prospect. ann med health sci res. 2014; 4(1): 100–104. doi:10.4103/2141-9248.126612 29. kiedrowski, m. r., horswill, a. r. new approaches for treating staphylococcal biofilm infections. ann n y acad sci. 2011; 1241: 104 –121. doi:10.1111/ j.1749-6632.2011.06281.x 30. moormeier, d. e., bayles, k. w. staphylococcus aureus biofilm: a complex developmental organism. mol microbiol. 2017; 104(3): 365–376. doi:10.1111/mmi.13634 31. lister, j. l., horswill, a. r. staphylococcus aureus biofilms: recent developments in biofilm dispersal. front cell infect microbiol. 2014; 4: 178. doi:10.3389/fcimb.2014.00178 32. sharma, g., sharma, s., sharma, p., chandola, d., dang, s., gupta, s., et al., escherichia coli biofilm: development and therapeutic strategies. j appl microbiol. 2016; 121(2): 309–319. doi:10.1111/jam.13078 33. berne, c., kysela, d. t., brun, y. v. a bacterial extracellular dna inhibits settling of motile progeny cells within a biofilm. mol microbiol. 2010; 77(4): 815–829. doi:10.1111/j.1365-2958.2010.07267.x 34. özdemir, c., karaca, b., akçelik, n. the role of extracellular dna in salmonella biofilms: is it in intimate relationship with matrix or initial adhesion? 25th eccmid conference; copenhagen, denmark. 2015. 35. harmsen, m., lappann, m., knochel, s., molin, s. role of extracellular dna during biofilm formation by listeria monocytogenes. appl environ microbiol. 2010; 76(7): 2271–2279. doi:10.1128/aem.02361-09 36. lappann, m., claus, h., van alen, t., harmsen, m., elias, j., molin, s., et al., a dual role of extracellular dna during biofilm formation of neisseria meningitidis. mol microbiol. 2010; 75(6): 1355–1371. doi:10.1111/j.13652958.2010.07054.x 37. mohamed, t. j., rabeea, i. s., abd, a. h., abdulkhaleq, m. a. efficacy of combination of meropenem with ciprofloxacin, and nitrofurantoin against resistant e. coli isolated from patients with urinary tract infections: in vitro study. al-yarmouk journal. 2011; special volume: 61–75. 38. al-jebouri, m. m., mdish, s. a. antibiotic resistance pattern of bacteria isolated from patients of urinary tract infections in iraq. open journal of urology. 2013; 03(02): 124–131. doi:10.4236/oju.2013.32024 39. al-marjani, m. f., kadhim, k. a., a., k. a., kinani, a. ciprofloxacin resistance in staphylococcus aureus and pseudomonas aeruginosa isolated from patients in baghdad. international journal of pharma sciences and research. 2015; 6 382–385. 40. abdullah, f. e., memon, a. a., bandukda, m. y., jamil, m. increasing ciprofloxacin resistance of isolates from infected urines of a cross-section of patients in karachi. bmc res notes. 2012; 5: 696. doi:10.1186/1756-0500-5-696 41. thomas, c. m., nielsen, k. m. mechanisms of, and barriers to, horizontal gene transfer between bacteria. nat rev microbiol. 2005; 3(9): 711–721. doi:10.1038/nrmicro1234 42. kaneko, s., itaya, m. stable extracellular dna: a novel substrate for genetic engineering that mimics horizontal gene transfer in nature in: kikuchi, y., rykova, e. y., editors. extracellular nucleic acids. nucleic acids and molecular biology series. 25 ed. berlin, heidelberg: springer-verlag; 2010. p. 3953. 43. bjorklof, k., nurmiaho-lassila, e. l., klinger, n., haahtela, k., romantschuk, m. colonization strategies and conjugal gene transfer of inoculated pseudomonas syringae on the leaf surface. j appl microbiol. 2000; 89(3): 423–432. doi:10.1046/j.1365-2672.2000.01130.x 44. springael, d., peys, k., ryngaert, a., van roy, s., hooyberghs, l., ravatn, r., et al., community shifts in a seeded 3‐chlorobenzoate degrading membrane biofilm reactor: indications for involvement of in situ horizontal transfer of the clc‐element from inoculum to contaminant bacteria. environ microbiol. 2002; 4: 70–80. 45. molin, s., tolker-nielsen, t. gene transfer occurs with enhanced efficiency in biofilms and induces enhanced stabilisation of the biofilm structure. current opinion in biotechnology. 2003; 14(3): 255–261. doi:10.1016/s09581669(03)00036-3 46. roberts, a. p., pratten, j., wilson, m., mullany, p. transfer of a conjugative transposon, tn5397 in a model oral biofilm. fems microbiol lett. 2006; 177: 63–66. 47. spoering, a. l., gilmore, m. s. quorum sensing and dna release in bacterial biofilms. curr opin microbiol. 2006; 9(2): 133–137. doi:10.1016/j. mib.2006.02.004 48. sykes, r. the 2009 garrod lecture: the evolution of antimicrobial resistance: a darwinian perspective. j antimicrob chemother. 2010; 65(9): 1842–1852. doi:10.1093/jac/dkq217 49. dillard, j. p., seifert, s. a variable genetic island specific for neisseria gonorrhoeae is involved in providing dna for natural transformation and is found more often in disseminated infection isolates. mol microbiol. 2001; 41: 263–277. doi:10.1046/j.1365-2958.2001.02520.x this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v9i2.1338 284 j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 original explaining the conceptual considerations of virtual university in medical education: a systematic review soleiman ahmady1 , amin habibi1* , zohreh koshgoftar2 1department of medical education, virtual school of medical education and management, shahid beheshti university of medical sciences, tehran, iran. *correspondence to: amin habibi (email: amin28@gmail.com) (submitted: 23 july 2022 – revised version received: 02 august 2022 – accepted: 16 august 2022 – published online: 26 october 2022) abstract aim: most of existing literature on the concept of virtual university of medical sciences have been collected in a non-systematic manner. this issue highlights the need to conduct research on virtual university-related topics through systematic research evidence and empirical evaluations. the aim of the present study is to investigate the real complexity and diversity of the concept of virtual university of medical sciences. methods: this was a systematic review with the behemoth approach and aimed to identify, review, analyze and integrate models, theories and frameworks related to the concept of virtual university of medical sciences. eligible articles were searched in pubmed, eric, ieee, isi, scopus, ecampus research unit from 2001 to 2022 using related keywords in three stages. results: a total of 13 articles were finally identified according to inclusion and exclusion criteria. pedagogical, technology, managerial, educational design, technology implementation, and educational-administrative management components were referred to in 5, 5, 4, 7, 6 and 4 articles, respectively. thematic analysis of the models was carried out in two theoretical dimensions (pedagogical component, managerial component and technological component) and operational dimension (educational design, administrative-educational management and technology implementation). conclusion: the results of the present study emphasize the need to pay attention to these six components in the establishment and development of virtual universities of medical sciences. in order to improve the education process in virtual universities, the process quality evaluation framework can be used. keywords: virtual university, medical education, systematic review, models issn 2413-0516 introduction the use of online education as a means of delivering education has grown dramatically over the past decade. online learning environments have become an important part of online training and evidence shows that this trend will continue with the technological advancement. organizations and educational institutions have welcomed this movement and are using the advantages of using computer and communication technology as a tool to transfer learning to learners.1,2 the virtual learning is a broad and multifaceted term that includes different methods of special presentation. although virtual learning has different specific architectures, the physical separation of the teacher and the learner is the basis of all types of this phenomenon. besides, it is assumed in virtual learning that the educational materials are presented using technology to facilitate learning.3 the terms e-learning, distance education, virtual education, online education and other similar descriptions are synonymous and are all used interchangeably in the present research. decades ago, virtual education could be thought of as a video recorded lecture by a teacher that was listened to by students using a videocassette player. today, this term means using a computer and usually the internet to provide this content.5 modern virtual education uses methods such as e-mail, chat rooms, online forums and discussions with the guidance of instructors. it can be stated that the virtual university is a multimedia network learning environment that is different from traditional learning environments in terms of the possibility to personalize and customize the teaching environment.2 harasim et al. state that the virtual university supports the design and delivery of courses and programs for any type of graduate education, which can include the provision of academic degrees, staff training services, professional development and workplace training.6 leidner & jaronpa suggest a similar definition. they state that the mission and vision of any type of virtual learning environment (such as a virtual university) is to redefine the physical boundaries of the classroom; enable more teamwork; transformation of learning into a continuous and time-independent process and the possibility of creating multi-level and multi-speed knowledge using information technology.7 a critical review of virtual university literature showed that there are many different terms related to virtual universities. virtual universities are also known as virtual teaching/learning environments, online teaching/learning, web-based teaching/learning environments, virtual learning communities and flexible learning environments.8 benatallah et al. explain that “the online or virtual university has emerged as a powerful vision for the future of higher education by using new information and communication technologies to fundamentally restructure higher education and re-equip the university institution in the face of new environmental changes.”9 such a scenario generally includes a university without walls, consisting of elements including learners and professors (students and employees), employers (job performance) and graduates, where the entire process of teaching and learning, research is implemented by information technology-based programs.10 despite the validity of the previously mentioned definitions, virtual university is as much related to a method of distance education as it is different from it. the main difference is related to the totality and individuality of its function. this means that the virtual university continues to work and exist https://orcid.org/0000-0003-0551-6068 https://orcid.org/0000-0002-0184-6716 https://orcid.org/0000-0002-8178-2619 mailto:amin28@gmail.com 285j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 s. ahmady et al. original explaining the conceptual considerations of virtual university in medical education without the need for a geographic environment to represent its existence (for example, traditional academic campuses). the existing literature on the virtual university has identified some research issues associated with the transformation of a traditional classroom-based university into a virtual university. however, it is important to note that the current literature does not provide a deep understanding of these issues, but tends to only acknowledge their existence.2 dealing with the advantages and disadvantages of virtual universities, as well as providing guidelines for a shift towards virtual universities, should be one of the most basic priorities of any research in this field. this is important because universities should be aware of the positive and negative aspects of virtual universities before converting from a traditional educational environment to a virtual educational environment. it is also important for instructional designers to be aware of these issues. they need to follow such guidelines in order to reduce the potentially harmful effects and increase the advantages of virtual universities. most of existing literature on the concept of virtual university of medical sciences have been collected in a non-systematic manner. this issue highlights the need to conduct research on virtual university-related topics through systematic research evidence and empirical evaluations.11 the aim of the present study is to investigate the real complexity and diversity of the concept of virtual university of medical sciences. methods this was a systematic review with the behemoth approach and aimed to identify, review, analyze and integrate models, theories and frameworks related to the concept of virtual university of medical sciences. in recent years, the medical science research community has increasingly recognized the potential contribution for educational theories and models in systematic reviews. however, the identification of educational theories and models during a systematic review is generally opportunistic or even incidental in many cases. therefore, there is a need for systematic, formal and predetermined methods in a systematic review to identify sources that identify theories and models in the literature.12 such findings have led to the development of the behemoth framework as a search method. this approach is a process to identify theories, models and frameworks for developing and testing complex interventions using systematic reviews. considering that the goal of researchers is to combine frameworks; models and theories instead of examining interventions, therefore, with such a presumption in mind, the behemoth approach was used in the present study in order to search for theories, models and educational frameworks related to the concept of virtual university. in this approach, four main elements of behavior of interest (be), health context (h), exclusions (e) and models or theories (moth) are determined. then various related theories are identified and the practical application of each theory is identified subsequently.13 to define and guide the final search strategy, the behemoth model was used to systematically identify models, define be, h, e, and moth (table 1). search strategy: in this systematic study, all published and peer-reviewed articles and related theses published table 1. definition of behemoth framework elements in the present study be: behavior of interest virtual university, open university, cyber university h: health context healthcare, medical education e: exclusion no reference to the model, framework and theory no studies in the field of medical sciences articles published before 2001 non-english articles articles published in newspapers, general journals, reports and letters to the editor moth: models or theories: model* or theory* or concept* or framework* between 2001 and 2022 were searched in pubmed, eric, ieee, isi, scopus, ecampus research unit using keywords including (virtual university) or (open university) or (cyber university)) and ((health care) or (medical education))) and ((((theor*) or (model*)) or (concept*)) or (framework*). the search process was guided in three different stages (table 2). inclusion and exclusion criteria the inclusion criteria included peer-reviewed english articles published from 2001 until now that were related to the concept of virtual university of medical sciences. in order to achieve the research objective, the following exclusion criteria were taken into account: no reference to the model, framework and theory no studies in the field of medical sciences, articles published before 2001, non-english articles. articles published in newspapers, general journals, reports and letters to the editor. selection of articles to avoid selection bias, the search was conducted by two researchers independently, and then similar and repeated searches were excluded from the study. at baseline, the titles of the articles that were searched by the research team using the above-mentioned keywords were equal to 64,571 titles. finally, 66 articles were fully reviewed and 13 related articles were included in the final analysis phase after the searching process (figure 1). a checklist was designed based on the study objectives and literature review, which investigates 6 pedagogical, technological, managerial, educational design, technology implementation and educational-management components (table 3). quality assessment to assess the quality of theoretical studies, there are no comparable tools like other types of studies such as the prisma checklist, pico for clinical evidence, or casp and spider for qualitative studies.14 on the other hand, theoretical evidence cannot be evaluated using a variety of tools that have been developed for routine systematic reviews, most of which focus 286 j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 explaining the conceptual considerations of virtual university in medical education original s. ahmady et al. table 2. steps to conducting a systematic search based on the behemoth approach steps search strategy database all articles found number of articles after removing duplicates step 1a be and h ((virtual university) or (open university) or (cyber university)) and ((health care) or (medical education)) 199023 jul 2021 pubmed, eric, ieee, isi, scopus, ecampus research unit sid, magiran 64571 138 step 1b be and h and models, theories, concepts or framework (((virtual university) or (open university) or (cyber university)) and ((health care) or (medical education))) and ((((theor*) or (model*)) or (concept*)) or (framework*)) 20831 53 step 1c be or h and models, theories, concepts or framework (((virtual university) or (open university) or (cyber university)) and ((((theor*) or (model*)) or (concept*)) or (framework*))) or (((health care) or (medical education)) and ((((theor*) or (model*)) or (concept*)) or (framework*))) 123477 168 step 2 step 1(a,b,c) with list of most common theories step 1(a and b and c) with number of lists of most common theories step 1(a and b and c) :359 step 1(a and b and c) :64 number of lists of most common theories:4 step3 step 2 and key original model citation(s) step 2 and key original model citation(s) step 2(68) and key original model citation (5) 73 287j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 s. ahmady et al. original explaining the conceptual considerations of virtual university in medical education ta bl e 3. c he ck lis t d es ig ne d ba se d on st ud y ob je ct iv es th em es ex tr ac te d in th e fra m ew or k bu ild in g a v irt ua l u ni ve rs ity fo r o rt ho pa ed ic s (4 6) a n io m t ba se d cy be r tr ai ni ng fra m ew or k (4 5) vi rt ua l u ni ve rs ity ed uc at io n in th e co nt ex t of th e he al th em er ge nc y du e to co vi d -1 9 (4 4) to w ar ds g rid s er vi ce s fo r a v irt ua l re se ar ch en vi ro nm en t (4 3) th e ev ol ut io n of p ed ag og ic m od el s f or w or kba se d le ar ni ng w ith in a vi rt ua l un iv er sit y (4 2) m et ho do lo gy fo r d es ig n of v irt ua l le ar ni ng en vi ro nm en ts – vi rt ua l u ni ve rs iti es (4 1) a d yn am ic m od el fo r a cy be r ph ys ic al h ea lth ca re (4 0) a s tu dy o f pe da go gi ca l a sp ec ts of a v irt ua l un iv er si ty (3 9) a fr am ew or k pr op os al fo r bl oc kc ha in ba se d sc ie nt ifi c pu bl ish in g u sin g sh ar ed g ov er na nc e (3 8) th e vi rt ua l h ea lth u ni ve rs ity (3 7) m od el lin g of w eb ba se d vi rt ua l u ni ve rs ity ad m in is tr at io n fo r n ig er ia n u ni ve rs itie s (3 6) in no va tio n m od el in h um an re so ur ce s ca pa ci ty d ev el op m en t in s up po rt in g u ni ve rs ita s te rb uk a as a c yb er u ni ve rs ity (3 5) a st ra te gi c m od el of v irt ua l un iv er si ty (3 4) pe da go gi ca l co m po ne nt te ch no lo gy co m po ne nt m an ag em en t co m po ne nt ed uc at io na l de si gn te ch no lo gy im pl em en ta tio n ad m in is tr at iv e ed uc at io na l m an ag em en t 288 j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 explaining the conceptual considerations of virtual university in medical education original s. ahmady et al. on internal validity and study design. in fact, study methodology and theoretical development are different areas of research that require different skills.15 therefore, the research team adopted a recommended inductive and subjective approach instead of using checklist-like tools. “applied quality assessment prompts” were used as the most appropriate framework to ensure clarity of objectives, having a specific and appropriate research design, providing a clear report of findings and sufficient data to support the interpretations and appropriate analysis.15 methodological quality assessment was carried out with data simultaneously. table 4 shows the five steps to quality assessment guidelines as a framework that is used in research to assess the quality of articles and perform the final synthesis. results & discussion the aim of the present research was to identify, investigate, analyze and integrate models, theories and frameworks related to the concept of virtual university in the field of medical sciences and health system. a total of 13 articles were identified in the data extraction stage. the articles were reviewed using on a checklist. pedagogical, technology, managerial, educational design, technology implementation, and educational-administrative management components were referred to in 5, 5, 4, 7, 6 and 4 articles, respectively. the research team performed the thematic analysis of the extracted models based on two theoretical and operational dimensions (figure 2), which include table 4. qualitative assessment of articles review stage criteria inclusion criteria to include a model/theory or framework in a study, a mechanism should be defined in which the main components of a virtual university in the health system and the relationship between them were clearly shown. literature search the review included multiple forms of formal electronic and manual searches and citation tracking to follow the development and impact of known theories on subsequent relevant literature. data extraction spreadsheets were created from the data extracted from the models. quality control the review of models and theories did not involve conducting a standardized critical evaluation. synthesis they were graded according to the review question as well as by checking the details or originality. 1. theoretical dimension: this dimension includes three main components: • pedagogical component. • technology component. • management component. 2. operational dimension: this dimension considers the strategies, actions and procedures based on which subsystems of a university operate and includes three main components: • educational design. • technology implementation. • administrative-educational management. all these dimensions and the relationship between them will be explained separately. it is also necessary to mention that the operational components of this framework are semantically placed among the theoretical dimensions of the framework considering their operational nature, and therefore, each of these components will be explained in combination with the theoretical components. theoretical dimension pedagogy and educational design pedagogy is defined as guiding the child and is known as the art and science of teaching children. pedagogic techniques for effective content transfer include learning content, learning style, time of learning, learning with the help of the instructor, and responsible instructor.16 fig. 2 components of the virtual university. 289j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 s. ahmady et al. original explaining the conceptual considerations of virtual university in medical education such definition is based on the perspective of theorists in the field of education and is thus consistent with the “teacher centered approach” at the school level. developments in the field of education and learner-centered and learning-centered approaches, emphasis on the facilitating role of the teacher, as well as the development of pedagogy in higher education have led to the redefinition of pedagogy. also, the current understanding of pedagogy is not limited to child education, but is considered as a basic teaching concept for in all academic courses. considering such a definition of the pedagogy and looking at the extensive changes made in different pedagogic concepts, the change of the educational paradigm is reflected in this component of the proposed framework. here, the curriculum is seen as a continuum where the main importance is acquired competencies, not just completed assignments. besides, assessment becomes an important element in the teaching and learning process and is not merely a punishment or a factor for determining grades. the main focus of this component is on learning modules, communication, interaction and cooperation between learners, and the use of the latest information and communication technology is also emphasized. technologies that provide the possibility of academic networking between students and professors. in this component, a “learning unit” as a wide conceptual area includes three basic elements, namely “content”, “interaction” and “evaluation”.17 as these elements play an important role in the learning process and the type of their evaluation based on the theory of active learning. the content, level of interaction and types of communication activities are determined by the learning objectives. then, the educational design layer is placed as one of the operational components of the framework at a higher level where the basic planning, design and implementation of teaching-learning processes, especially the learning units and related activities are determined.17–19 educational design as a basic component of the framework is carried out in six separate but related steps: 1. specifying and explaining the available educational and technological options: in this step, the learning needs are identified, the target audience is defined, the human and financial resources and the existing technological infrastructure are evaluated. in other words, possible options are identified and selected for a successful educational design. 2. general design of the course (main program): in this step, goals, background, prerequisites, themes, content and keywords are determined for each educational course. in a general view, this step includes deciding on the structure of the course and summarizing the anticipated activities and strategies, as well as compiling the course timetable and relevant bibliography. 3. designing course units: in this step, teaching and learning units are designed along with units related to modular learning. the educational strategies for each unit, as well as the content and calendar of activities are determined according to the duration of the course. 4. interactive system design: in this step, learning activities, their dynamic level, the sequence, the resources and tools used, as well as the writing of practical guides and other teaching strategy elements are designed to ensure their proper implementation. 5. designing a feedback system: here, while emphasizing the educational effect of the concept of feedback, the aim is self-evaluation design, systematic and final evaluation of the course, for continuous and interactive feedback during the teaching-learning process. 6. final design and presentation of general information: upon reaching the final step, the final evaluation of the entire process will be implemented. in this step, there is the possibility of final adjustment of the general program and its reorganization according to individual activities (second and third steps) as well as the evaluation program (fourth step).17-20 after expanding the concept of the pedagogical component and identifying some of its most important elements, the present framework proposes the following schematic view as the pedagogical components of the virtual university in the health system (figure 3). fig. 3 pedagogical components of the virtual university in the health system. 290 j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 explaining the conceptual considerations of virtual university in medical education original s. ahmady et al. technology components and technology implementation today, all users of virtual networks have become active producers of knowledge by using open-source software as well as a variety of information technology tools with different levels of complexity. from this point of view, the most important features of the virtual university technology component in the health education system include “interactivity” and the possibility of reusing technology. in this component, the technology implementation element has a strong presence as one of the elements of the operational component of the framework. the implementation of information technology generally consists of a number of successive steps including requirements analysis, project design, testing, establishment and maintenance. although documentation and training are often added to these steps.36,38,41,43 in these components, three basic parts that work together were identified: part 1: technological support online and technical support services are very necessary to speed up the education process for all users, teachers and students. on the other hand, information technology support has an important effect on knowledge process capabilities; because it allows knowledge creation and sharing at lower costs and is considered a key component in knowledge management. therefore, the concept of support in a virtual university goes beyond mere provision of different principles and guides and has a direct impact on the process of knowledge management in a virtual university. in the current framework, this part is considered as a basis for providing other services, and its components and tools are shown separately in figure 4.19-21-22 part 2: data this part focuses on accepted international protocols and standards, which, in addition to validating university activities, provide the possibility of cooperation between educational and service institutions, as well as information retrieval. e-learning standards are a set of laws that not only ensure coordinated provision of education everywhere; but also, it provides a common language for the learning management system and e-learning courses, so that they can share information with each other and work together. in fact, components of the training course or training objects are identified and defined using these rules.23 fig. 4 technological support. e-learning standards are divided in different ways from the meaning point of view. here, first, they are divided from the perspective of content coverage they provide, and then the most important e-learning standards for use in a virtual university will be discussed. 1. meaning: this field focuses on the general concepts of understanding: semantics, pragmatics, etc. 2. quality: this field includes all aspects of quality management, including development, assurance of results, processes and potentials. 3. didactics: this area focuses on issues related to educational questions: methods, learners and learning environments. 4. educational technology: this area focuses on all technological solutions that have been created for educational purposes: such as information exchange, interfaces and accessible questions. 5. learning content: this area includes all aspects related to e-learning objects and collects resources and packaging. 6. context: the main purpose of this area includes all disciplines and information related to electronic education, including laws and regulations (49). table 5 shows the most common standards in electronic education. our conceptual advancement in the technology component and its expansion gives a more complete picture of the framework (figure 5). part 3: services this part of the technological component indicates the services provided by a virtual university to users, learners and faculty members. these educational services should promote and support an open and collaborative environment. the portal is known as the most basic service for providing virtual university services, but according to the proposed framework, the university portal should act in such a way as to provide access to various resources and services and communication and collaboration tools for all users. it also allows interaction between students, faculty members and users who are interested in the field of healthcare and health sciences as a whole. such a portal facilitates interaction, communication, study and discussion about clinical cases. services are also provided by electronic learning management system. a learning management system creates a communication channel between instructors and learners and helps instructors manage online learning. software are able to manage all types of content, including videos, courses, documents, etc., and allow students to communicate with learning 291j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 s. ahmady et al. original explaining the conceptual considerations of virtual university in medical education fig. 5 adding the data part to the part 1. table 5. e-learning standards standard developer important component website ims ims global learning consortium standard packaging (www.imsproject.org) scorm adl a combination of several standards (scorm; www.adlnet.org/scorm/history/2004/ index.cfm) ltsc ieee content relevance (ltsa; http://ltsc.ieee.org/wg1/files/ ieee_1484_01_d09_ltsa.pdf ) lom ieee metadata (lom; http://ltsc.ieee.org/wg12) papi ieee learner profile (www.edutool.com/papi/drafts/08/) aicc aicc supply, control, presentation and follow-up of results between educational management systems and online courses www.aicc.org management system software through any device. instructors can also evaluate learners by using features such as receiving their assignment reports, progress status and similar cases. such a system will be the backbone of a virtual university. here we are dealing with a web-based software and program that manages, documents, follows up, reports, and provides educational courses and educational programs. this software allows the instructor to provide the content of the educational course as easily as possible to the participants and students, to hold quizzes, tests and exams offline or in person (online in class), assign related assignments to students in a web-based system, follow up student status, and access other such facilities in an internet-based system. online classes are one of the other educational facilities that can be held with the help of the university’s learning management system. the virtual classroom is an educational tool that is based on communication networks and can replace the traditional classroom and solve the associated problems. although the virtual classroom does not change the channels of information transmission, it tries to use appropriate tools to carry out this information transfer in the best possible way.17 in addition to increasing the educational quality, such optimization also reduces educational costs. the virtual classroom is, in fact, a discussion group whose topic is the same as the lesson subject. a discussion group whose title is the same as the lesson title is created on the network, and the students become members of the discussion group. then, the faculty member who is also a member of the group, will present the related course materials at regular intervals. they should also be designed as an interactive learning space that simultaneously pursues formal and informal educational activities. rather being related to educational content, interaction in this class means interaction and mutual effect of educational activities and communication. the virtual clinic is another interactive space that is identified in the proposed framework, and all learners and faculty members will be able to use its services from the moment they enter the university. education is provided in this space based on diagnostic discussions (a virtual space in which people discuss the cases of interest to make a definitive diagnosis online), clinical pathology topics (topics related to the postmortem findings of pathologists) and presentation of clinical cases. education through the presentation of clinical cases and scenarios is currently recognized as one of the leading and effective methods in the field of medical sciences. the use of the case-based learning method prepares students with diverse experiences such as problem solving, building knowledge 292 j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 explaining the conceptual considerations of virtual university in medical education original s. ahmady et al. in the presence of each other, communication and group participation. just like traditional universities, another element of the framework that guarantees the success of virtual universities is a virtual library. the virtual library makes it possible to provide all the appropriate information that are supposed to be exchanged between students and faculty members of the virtual university and to support the researches of the virtual university. such a library helps users to find the required information through the resources available in the library databases and performs the tasks of information collection, accessibility and dissemination. the virtual attribute mostly refers to the lack of spatial dimension of this type of library. this type of library does not exist physically, is created on computer networks and enables the access of virtual university users to electronic and network resources.24 in this framework, it is recommended to use blockchain technology and launch the digital library of the virtual university of medical sciences in such a network.25 by definition, blockchain refers to a database consisting of a list of transaction records, which are always growing and increasing in number. these records are called blocks, which are connected to each other through cryptography. blocks are placed in a chain of nodes with a peer-to-peer network, and the resulting storage is called a digital ledger.26 this meaning fits well with what librarians have always done, that is to collect, keep, and share authoritative information. blockchain can help librarians achieve this goal, especially in the world of scientific publications. one of the potential applications of blockchain is to create verifiable and scheduled copies of journal articles. another potential application of blockchain in libraries is a digital rights management tool.25 digital resources are inherently reproducible, which in turn creates issues for libraries and publishers. because blockchain creates a unique verifiable record that anyone can access, it can be attached to digital material and used as a way to show the “provable scarcity” of that resource. this enables digital materials to be uniquely identified, controlled and transferred. publishers can be also assured that there have been no copies of them. web 2.0 tools web 2.0 is a set of programs and digital technologies that enable users to interact and collaborate with each other and share their content and information. unlike web 1.0, which is called a static and read-only network, web 2.0 is a dynamic network that can read and write content. this technology allows the user to add, play, evaluate and change information. although these technologies have not been formed with the approach of educational application, they have formed new conceptualizations regarding the dynamics of virtual university education (figure 6). web 2.0 challenges the existing models of designing web-based curricula, entails new epistemological considerations, and proposes a different theoretical basis. in this type of learning, the way educational content is produced and published is similar to web 2.0. in other words, the content does not follow the traditional method of production, organization and distribution, instead it is a collaborative effort (table 6).19-21-22 finally, the technology component is displayed in the form of a conceptual pyramid after putting different parts together (figure 7). management components and administrative-educational management these components are identified with the following four basic elements in the current framework: 1. vision: vision, which is called perspective, view, imagined future, or ideal and desirable future, is a description of future conditions, in other words, it is an vision of the future state of a group, when goals and strategies are achieved. the vision of the organization should be brief, memorable, desirable and ideal and should take into account all levels (17-26-27). furthermore, such a university is recognized as a virtual campus with a networked, open-source learning method based on real health care processes that are approved by the ministry of health and medical education. fig. 6 types of web and its applications. table 6. classification of web 2.0-based technologies based on the educational design parts of the framework subcategories technologies related to each subcategory teaching planning and design 1. mihanblog 2. blogfa 3. crocodile 4. huppa 5. rubistar 6. irubric 7. ning 8. edmodo 9. moodle 10. google 11. sketchup 12. gliffy 13. google 14. sites 15. salam.ir 16. parsijoo.ir 17. audacity presentation and teaching methods 1. flashcardexchange 2. wordnik 3. del.icio.us 4. flickr 5. google 6. salam.ir 7. parsijoo.ir 8. webspiration 9. slideshare 10. gliffy 11. paint 12. audacity 13. evernote 14. community 15. walk 16. footnote 17. googlemap 18. create a graph 19. movie maker 20. wordle 21. viber 22. telegtam 23. youtube 24. surveymonke 25. polldaddy 26. polleverywhere 27. prezi 28. protagonize 29. glogster 30. blogfa 31. mihanblog 32. powerpoint assessment edmodo, ning, moodle, polleverywhere google trends, crocodile, huppa, viber, bubble.us quizstar telegram, paint, footnote, microsoft office word 293j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 s. ahmady et al. original explaining the conceptual considerations of virtual university in medical education fig. 7 technology component and its elements. 2. planning: the implementation strategies of a virtual university in the health education system are considered in this element: • building and maintaining an educational virtual space for online interaction, learning and work in order to develop the professional competencies and qualifications of medical students. • training of human resources for the efficient application of information and communication technology in the fields of education and health. • strengthening the educational capacities of academic institutions and health service providers. • integration and systematization of national health information and knowledge management. • using information and communication technology for online education, based on the technical capacity available in academic health services institutions. • methodological development of clinical training related to the health needs of iran. 3. operational management: project management is a goalbased management model that defines the demarcation of different decisions, allocation of resources and assignment of responsibilities based on different components (courses, clinical topics, etc.) in different academic and service institutions. in this sense, management takes place in two different parts. • the first case is pedagogical management, which is related to the teaching-learning process and basic functions of faculty members such as educational design and creation of educational resources. • the second case is institutional management, which deals with administrative and executive processes, where leaders and managers act at institutional and local levels, including the creation of logistics coordination and training regarding virtual learning environments (42-40-34). 4. process quality evaluation: in this proposed framework, follow-up, control and evaluation are carried out to improve the quality of the program process through process analysis, academic results and the quality of services provided by the university. in this evaluation, managers’ self-criticism has been identified as a fundamental pillar of process improvement. also, continuous surveying of different university groups (faculty members, students, users) makes it possible to improve the quality of curricula and services at both institutional and curriculum levels. conclusion the results of the present study emphasize that the six components of pedagogy, technology, management, educational design, technology implementation and administrative-educational management are essential in the establishment and development of virtual universities of medical sciences. virtual university of medical sciences plays an important role in the development of electronic learning, the realization of educational justice and the creation of various educational opportunities in virtual form. in this regard, the process quality assessment framework can be used to improve the education process in these universities. conflict of interest none.  294 j contemp med sci | vol. 8, no. 5, september-october 2022: 284–294 explaining the conceptual considerations of virtual university in medical education original s. ahmady et al. references 1. barnett r. realizing the university (london, institute of education, university of london). blake, r. smith, and p. standish (1998) the universities we need: higher education after dearing. 1997. 2. anderson m. virtual universities: future implications for students and academics. in 16th annual conference of the australasian society for computers in learning in tertiary education (ascilite), brisbane, australia. retrieved september 1999 (vol. 17, p. 2003). 3. robins k, webster f, editors. the virtual university? knowledge, markets, and management. oxford university press; 2002 nov 7. 4. rada r. understanding virtual universities. intellect books; 2001. 5. ahmad r, piccoli g. virtual learning environments: an information technology basic skills course on the web. amcis 1998 proceedings. 348. 6. harasim lm, hiltz sr, teles l, turoff m. learning networks: a field guide to teaching and learning online. mit press; 1995. 7. leidner de, jarvenpaa sl. the use of information technology to enhance management school education: a theoretical view. mis quarterly. 1995 sep 1:265–91. 8. anastasiades ps. virtual universities: a critical approach. ininternational conference on computers in education, 2002. proceedings. 2002 dec 3 (pp. 1170-1171). ieee. 9. dabous ft, rabhi fa, ray pk, benatallah b. middleware technologies for b2b integration. annual review of communications. 2003 nov;56(3). 10. slaughter s, leslie ll. academic capitalism: politics, policies, and the entrepreneurial university. 1999. 11. cornford j. the virtual university is... the university made concrete? information, communication & society. 2000 jan 1;3(4):508–25. 12. hean s, o’halloran c, pitt r, green c, temple j. a systematic review of the contribution of theory to the development and delivery of effective interprofessional curricula in health professional education. hentet fra https://www. bemecollaboration.org/downloads/1243/hean_protocol_ dec2012. pdf. 2013. 13. booth a, harris j, croot e, springett j, campbell f, wilkins e. towards a methodology for cluster searching to provide conceptual and contextual “richness” for systematic reviews of complex interventions: case study (cluster). bmc medical research methodology. 2013 dec;13(1):1–4. 14. votruba n, ziemann a, grant j, thornicroft g. a systematic review of frameworks for the interrelationships of mental health evidence and policy in low-and middle-income countries. health research policy and systems. 2018 dec;16(1):1–7. 15. campbell m, egan m, lorenc t, bond l, popham f, fenton c, benzeval m. considering methodological options for reviews of theory: illustrated by a review of theories linking income and health. systematic reviews. 2014 dec;3(1):1–1. 16. pedagogical perspectives, inspirational horizons in the higher education curriculum. bi-quarterly journal of higher education curriculum studies.; 10 (19): 171–93. 17. méndez jb. the virtual health university: an elearning model within the cuban health system. medicc review. 2008 mar 28;10(1):22–8. 18. ivanova g, smrikarov a. methodology for design of virtual learning environments–virtual universities. in e-learning ii conference, berlin, germany 2005. 19. conole g, wills g, carr l, vadcard l, hall w, grange ss. building a virtual university for orthopaedics. inedmedia+ innovate learning 2003 (pp. 2227). association for the advancement of computing in education (aace). 20. abdollahi d. a study of pedagogical aspects of a virtual university. international journal of educational and psychological researches. 2018 jan 1;4(1):12. 21. mbam bc, odachi gn. modelling of web-based virtual university administration for nigerian universities. afrrev stech: an international journal of science and technology. 2014 jul 3;3(2):86–107. 22. cecil j, gupta a, pirela-cruz m, ramanathan p. an iomt based cyber training framework for orthopedic surgery using next generation internet technologies. informatics in medicine unlocked. 2018 jan 1; 12:128–37. 23. fallon c, brown s. e-learning standards: a guide to purchasing, developing, and deploying standards-conformant e-learning. crc press; 2002 nov 25. 24. van drie jh, lajiness ms. approaches to virtual library design. drug discovery today. 1998 jun 1;3(6):274–83. 25. mackey tk, shah n, miyachi k, short j, clauson k. a framework proposal for blockchain-based scientific publishing using shared governance. frontiers in blockchain. 2019 nov 15; 2:19. 26. gupta ss. blockchain. ibm online (http://www. ibm. com). 2017. 27. flores rr, vértiz-osores ri, ochoa gl, romero aa. virtual university education in the context of the health emergency due to covid-19: challenges in the evaluation processes. international journal of early childhood special education (int-jecse). 2020;12(1):467–77. 28. shahtalebi s, shatalebi b, shatalebi f. a strategic model of virtual university. procedia-social and behavioral sciences. 2011 jan 1; 28:909-13. 29. bradley c, oliver m. the evolution of pedagogic models for work-based learning within a virtual university. computers & education. 2002 jan 1;38(1-3):37–52. 30. khayal is, farid am. a dynamic model for a cyber-physical healthcare delivery system with human agents. in2017 ieee international conference on systems, man, and cybernetics (smc) 2017 oct 5 (pp. 3624-3629). ieee. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i5.1253 153j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 diversity and colonization of endophytic actinomycetes in some medicinal plants: review kholoud alzahrani1,2, samyah jastaniah1, reda amasha1, magda m. aly1,3,* 1department of biology, faculty of sciences, king abdulaziz university, jeddah, saudi arabia. 2department of biology, university college of umluj, university of tabuk, saudi arabia. 3botany and microbiology department, faculty of sciences, kafrelsheikh university, kafr el-sheikh, egypt. *correspondence to: magda m. aly (e-mail: magdammali@hotmail.com) (submitted: 19 december 2021 – revised version received: 04 january 2022 – accepted: 25 january 2022 – published online: 26 june 2022) abstract the diversity of culturable endophytic actinomycetes related to plants and especially medicinal plants are isolated and characterized. the increased colonization and distribution of endophytic actinomycetes in plants have been reported in many studies. endophytic actinomycetes belong to different genera are distributed in plants species such as streptomyces, which is the dominant genus, micromonospora, microbispora, nocardiopsis, rhodococcus and nocardia. moreover, there are many novel strains had been described belong to these genera. endophytic actinomycetes seem to contribute with plant development and displaying beneficial traits that can be exploited in plant maintenance, substances supplements, protection and defense. colonization of endophytic actinomycetes in plant tissues are largely influenced by plant species and the environmental factors surrounding the host plants such as soil ph, water content, rainfall, soil salinity, and temperatures. some endophytic actinomycetes may occur in low numbers and sometimes in localized positions within the plant. thus, this review summarizes an aspect of the diversity and colonization of endophytic actinomycetes, including their mechanism of action, importance, and isolation and identification methods. keywords: endophytic, actinobacteria, plants, streptomyces, colonization issn 2413-0516 introduction actinomycetes are high guanine and cytosine ratio (>50%) of their dna content, gram-positive and filamentous bacteria that form non-septate branching mycelia similar to those of fungi.1 they had prokaryotic nucleus and their colonies are powdery consistency and stick firmly to agar surface, producing hyphae with conidia or sporangia.2 actinomycetes are distributed in various natural habitats, including soil, extreme environments, plants, lichens and fresh and marine water.3 the endophytic microorganisms colonize the interior of all plant parts, viz: root, stem, or seeds, regardless of their place of origin, without causing any harmful effects on host plant.4 their ability to access and thrive in the host tissues make them unique by many specific interactions within the host plants.5 there are increasing reports for the existence of new endophytic actinomycetes within various tissues of crops and medicinal plants. in the early stages of endophytic colonization, endophytic actinomycetes are firstly observed in subsequently in the root cortex, and root hairs.6,7 from their point of entry, endophytic actinomycetes may systemically colonize plants from roots to shoots, shoots to flowers or fruits, and/or from flowers to fruits and seeds, and they may also cause localized colonization inside/outside plant organs.8 the diversity aspects of endophytic actinomycetes have addressed by few research groups includes thorough collections and sampling of plant specimens (herbs, shrubs, trees, and woody climbers) and subjecting the specimens to surface sterilization and isolations of endophytes.9 in last twenty years, many studies have focused on endophytic actinomycetes by investigating their existence into the medicinal plants’ organs. also, they have developed many methods to sterilize the plants organs surfaces and modified many culture media. these studies help understanding the colonizing and diversity of endophytic actinomycetes in medicinal plants.10,11 therefore, according to these studies and reviews as well, this review highlights the endophytic actinomycetes colonizing and their diversity in different medicinal plants organs from multiple habitats in many countries. colonization of endophytic actinomycetes in plants the word endophyte is derived from the greek words endon (within) and phyton (plant), which means “in plant”. this term is used as broad as its literal definition and spectrum of potential hosts and inhabitants, e.g., endophytic actinomycetes.10 many studies indicated that almost all the plants are colonized by endophytes microorganisms.12 the diversity of endophytic microorganisms in plants has been reported from different types such as archaea, eubacteria, and fungi. among bacteria, endophytic bacteria were isolated from different phylum mainly: actinobacteria, firmicutes, proteobacteria and bacteroidetes. distribution of endophytic actinomycetes varied in all bacterial phyla. however, proteobacteria were most dominant phyla followed by actinobacteria.4 gohain et al.13 (2015) investigated six selective medicinal plants, emblica officinalis, terminalia chebula, t. arjuna, murraya koenigii, rauwolfia serpentina and azadirachta indica for isolation of endophytic actinomycetes which gained specific niches in plants by colonizing stems, roots, petioles, leaves, fruit, buds and seeds. the ability to enter and thrive in the host plant tissues, make endophytic actinomycetes unique, and showing multidimensional interactions.11 furthermore, endophytic actinomycetes can play myriad crucial roles in hosted plants. some of these roles have been discovered and linked to many enhancements of growth and defense mechanisms towards pathogens infections while others still unknown till now. review mailto:magdammali@hotmail.com 154 j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 diversity and colonization of endophytic actinomycetes in some medicinal plants: review review k. alzahrani et al. colonizing mechanisms in plant organs the colonization of endophytic actinomycetes in different plants is multivariate depending on many factors. thus, understanding these factors approach a better explanation of the relationships between endophytic actinomycetes and hosted plants. multiple plant host activities are influenced by the presence of endophytic actinomycetes, which can promote plant host growth, evoke defense responses against pathogens attacks.5 flourishing colonization by endophytic actinomycetes is affected by different factors including the plant tissue type, the plant genotype, the microbial taxon and strain type, and biotic and abiotic environmental conditions.14 the communities of endophytic actinomycetes have been categorized into three groups, which are “obligate” or “facultative” and “passive”. obligate actinomycetes endophytes are depend basically on plants metabolism for survival, and whose transmission amongst plants take place by the action of various vectors or by vertical transmission.15 facultative actinomycetes endophytes spend definite stages of their life cycle in host plant independently. indirectly, they are associated with hosted plants through soil environment and atmosphere.16 actinomycetes endophytes which are lacking the capability to colonize and infect, can enter plant via wounds and cracks on the plant. they are documented as a passive mode of endophytic colonization.17 in hosted plants, emerging lateral roots build naturally forming a ‘highway’ for actinomycetes endophytes to enter by breaking through the endodermis, cortex, epidermis casparian strip (band around endodermis) and pericycle. from these cells, endophytes can further enter the phloem and xylem vessels that transport photosynthates, nutrients and water.8 actinomycetes endophytes are beneficial guests to their plant hosts. they have albitites to produce chemical diversity of secondary metabolites. much of the natural products by actinomycetes endophytes have likely evolved due to their interactions with other microorganisms in highly diverse environments.18,19 for instance, root exudates such as proteins, amino acids, organic acids, abundance of carbohydrates and inorganic nutrients may be involved in recruiting actinomycetes endophytes from the rhizosphere.14,20 endophytic actinomycetes have to compete with plant cells for iron, and therefore, siderophore production is increasing availability of minerals in addition to iron chelation which is highly important for endophytic growth.21 defense mechanisms in plant tissues plants have a variety of defense mechanisms against pathogens. the response of the host plant drastically differs to the colonization of endophytic actinomycetes and pathogens. on the other hand, endophytic actinomycetes enhance the disease resistance through the mechanism of induced systematic resistance and systemic acquired resistance.22 pathogenic microorganisms, which include bacteria, fungi or viruses, are associated molecular patterns. these are essential structures that are conserved and necessary for pathogens survival, but plants have developed multiple families of receptor proteins to recognize them and encourage the plant immune system.23 pattern-recognition receptors have enhanced to recognize common pathogens compounds, such as bacterial flagellin or fungal chitin or microbial/pathogen-associated molecular patterns. pattern recognition is translated into a first line of defense which keeps the most potential invaders under control.24 endophytic actinomycetes have been equipped with necessary traits that enable them to invade, colonize and translocate in the plant’s interior.25 plants may subsequently influence the biocontrol expression of endophytic actinomycetes against the pathogen.26 colonizing organs in plant tissues diversity of endophytic actinomycetes from plant species are documented from various regions around the world. as a matter of fact, they used morphological and microscopic identification methods in addition to methods based on sequencing of highly conserved macromolecules, notably 16s rrna genes, which has provided valuable data for constructing phylogenies above the genus level.27 thus, studying the diversity of endophytic actinomycetes by isolating them from inner plant organs, give a supportive hypothesis about their roles in plants. they are able to colonize both intracellularly and extracellularly the interior of plants after inoculation the soil with these microorganisms.25,26,28 matsumoto and takahashi29 (2017) revealed that specific strains belonging to various genera could be isolated from plant roots but not from soil. endophytes inside a plant may either become localized at the point of entry or spread throughout the plant.4 the maximum endophytic actinomycetes have been gained from roots followed by stems and least isolates were in leaves and they have been detected in plant reproductive organs, such as flowers, fruits and seeds, but in small numbers (table 1). specifically, in a leaf, endophytic actinomycetes can colonize in xylem vessels, palisade mesophyll cells, upper epidermis cells as well as spaces between spongy cells of mesophyll layer.30 alternatively, these endophytic actinomycetes can get into phyllosphere epiphytes through natural openings (e.g., stomata, hydathodes), wounds and cracks generated by wind, insect and pathogen attacks.31 endophytic actinomycetes genera distribution even thought, there are many reports demonstrated the distribution of endophytic actinomycetes in several organs in plants mainly in roots, stems or leaves. the isolation of endophytic actinomycetes from herbaceous and woody plants is a matter to speculate, as no consensus exists between the research groups.9 the total number of endophytic cultured, uncultured or rare isolates in addition to their genera and families were recorded. chen et al.32 (2011) reported 8 endophytic actinomycetes from root of elaeagnus angustifolia while 47 isolates were detected in roots of four different plants, phyllanthus niruri, withania somnifera, catharanthus roseus and hemidesmus indicus.33 goudjal et al.34 (2013) identified 27 isolates from roots of cleome arabica, solanum nigrum, astragallus armatus, aristida pungens and panicum turgidum while rahayu et al.35 (2019) isolated 7 endophytic actinomycetes from roots of zingiber officinale. endophytes actinomycetes importance actinomycetes are widespread in nature and represent the largest taxonomic group within the domain bacteria. they are 155j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 k. alzahrani et al. diversity and colonization of endophytic actinomycetes in some medicinal plants: review table 1. number of endophytic actinomycetes isolates from different plant parts country plant species organ no. of isolates references india brassica juncea root stem leaf 13 4 3 chaudhry et al., 202036 vietnam cinnamomum cassia presl root stem leaf 29 67 15 vu et al., 202037 thailand andrographis paniculata asystasia gangetica berleria lupulina clinacanthus nutans justicia subcoriacea ruellia squarrosa root stem leaf 49 1 2 phongsopitanuna et al., 202038 china thymus roseus schipcz root stem leaf 54 35 37 musa et al., 202039 india ageratum houstonianum scoparia dulcis (l.) phyllanthus niruri (l.) discorea bulbifera (l.) root stem leaf flower 7 5 2 2 momin et al., 201940 china camellia sinensis root stem leaf 18 9 19 shan et al., 201841 indonesia ficus deltoidea root stem leaf fruit 6 7 24 2 janatiningrum et al., 201842 china dracaena cochinchinensis lour root stem leaf 117 113 74 salam et al., 201743 india catharanthus roseus root leaf 6 5 ranjan and jadeja, 201744 brazil vochysia divergens stem leaf 5 5 gos et al., 201745 india rauvolfia serpentine gymnema sylvestre stevia crenata bacopa monnieri andrographis paniculata withania somnifera root stem leaf 27 17 24 singh and gaur, 201646 india syzygium cumini root stem leaf 28 21 1 saini et al., 201647 india azadirachta indica a. juss. root stem leaf 15 13 7 kaur, 201648 india schima wallichii root stem leaf fruit 9 6 4 3 passari et al., 201649 thailand centella asiatica (l.) root stem leaf fruit 9 19 4 4 phuakjaiphaeo and kunasakdakul, 201550 india combretum latifolium blume root stem leaf 64 31 22 rao et al., 201551 india emblica officinalis gaertn root stem leaf 18 9 9 gangwar et al., 201552 (continued) review 156 j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 diversity and colonization of endophytic actinomycetes in some medicinal plants: review review k. alzahrani et al. table 1. number of endophytic actinomycetes isolates from different plant parts country plant species organ no. of isolates references india aloe vera mentha arvensis ocimum sanctum root stem leaf 28 7 5 gangwar et al., 201453 algeria triticum durum root leaf 16 7 sadrati et al., 201354 australia callitris preissii root stem leaf 189 3 2 kaewkla and franco, 201355 eucalyptus camaldulensis root stem leaf 9 8 2 eucalyptus microcarpa root stem leaf 169 21 1 pittosporum phylliraeoides root stem leaf 91 28 33 abundant in soil and into plant tissues and have been extensively explored for their therapeutic applications.56 targeting a compound for a particular biological activity involves the screening of a number of strains against wide targets, the resulting positive is designated as the “lead”.9 symbiotic actinomycetes residing as endophytes within the plant tissues have generated immense interest as potential source of novel compounds, which may find applications in medicine, agriculture, and environment such as antibacterial, antifungal, antiviral and anticancer.56 the antimicrobial compounds produced by endophytic bacteria represent a promising alternative protection to plants against phytopathogens.57 the genera streptomyces and micromonospora are the potential producers of antibiotics. newer antibiotics are being discovered from actinomycetes and the endophytes are the better choices for antibiotics. actinomycetes are the potent producers of enzyme inhibitors. enzyme inhibitors are specific biochemical tools that are potential in the treatment of diseases.9 cell-wall degrading enzymes are important for plants to break plant cell walls and translocate compounds to the apoplast. genes encoding cell-wall degrading enzymes widely exist in the genomes of endophytic bacteria. for example, genes encoding plant polymer-degrading cellulases, xylanases, cellobiohydrolases, endoglucanase, cellulose-binding proteins, pectinase and chitinase, are found in endophytic actinomycetes.58,59 enzymes produced from actinomycetes play an important role in food, fermentation, textile and paper industries.60 the use of actinomycetes endophytes in agriculture has immense potential to reduce the environmental impacts caused by chemical fertilizers, especially n fertilizers.61 common characteristics of actinomycetes endophytes include the ability to synthesize plant hormones such as indole-3acetic acid, solubilize phosphate, secrete siderophores, and confer plant tolerance to biotic and abiotic stresses.62–64 some actinomycetes endophytes carry genes necessary for biological nitrogen fixation (bnf), potentially enabling them to convert dinitrogen gas (n2) into usable forms of nitrogen such as ammonium and nitrate within the host plant.65 endophytic streptomyces as a dominant genus streptomyces accounts for the major dominant genus in many studies, which is the most commonly isolated endophytic actinomycetes. they were targeted for the first time for endophytic actinomycetes isolates. streptomyces isolates were about 66%, which is closely to a study for kaur48 (2016) who reported that 65.7% of all endophytic isolates belong to genus streptomyces. also, salam et al.43 (2017) found that 86.8% of all isolates from roots, stems and leaves of dracaena cochinchinensis were identified as streptomyces species. from tea plants (camellia sinensis), shan et al.41 (2018) detected that 51.1% of the isolates were identified as streptomyces. priya33 (2012) studied four medicinal plants, phyllanthus niruri, withania somnifera, catharanthus roseus and hemidesmus indicus and genus streptomyces was the dominant endophytic actinomycetes with 56.8% while it was recorded by 37.2% in 15 plant samples, obtained from taklamakan desert.66 rare and alternative genera of endophytic actinomycete even though there are many studies support the hypothesis that the genus streptomyces is the most abundant genera in endophytic actinomycetes, there are a wide range of other genera were recorded that are difficult to be isolated or rare.67 the criteria of isolation are important to find novel endophytes.68 furthermore, some studies showed that the diversity of uncultured endophytic actinomycetes is comparable to those of the cultured endophytic actinomycetes.56 gohain et al.13 (2015) isolated 76 endophytic actinomycetes belong to 16 genera which were verrucosispora, isoptericola, kytococcus, streptomyces, micromonospora, saccharopolyspora, kocuria, micrococcus, brevibacterium, amycolatopsis, timonella, leifsonia, microbacterium, mycobacterium and nocardia. another study by gos et al.45 (2017) isolated 10 isolates belong to 8 genera from stems and leaves of vochysia divergens, which were microbispora, actinomadura, microbacterium, 157j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 k. alzahrani et al. diversity and colonization of endophytic actinomycetes in some medicinal plants: review aeromicrobium, micrococcus, streptomyces, sphaerisporangium and williamsia. even though, salam et al.43 (2017) reported 2 major genera of endophytic actinomycetes streptomyces and nocardiopsis in addition to ten rare endophytic actinomycetes, arthrobacter, brevibacterium, kocuria, microbacterium, pseudonocardia, rhodococcus, nocardioides, nocardia, nocardiopsis, and tsukamurella. moreover, 13 different genera of endophytic actinomycetes were detected by shan et al.41 (2018). they included the two rare endophytic actinomycetes, piscicoccus and mobilicoccus. although janatiningrum et al.42 (2018) observed only 1 genera was uncultured endophytic actinomycete in addition to 6 genera, streptomyces, verrucosispora, rhodococcus, kineospora, intrasporangium and actinomadura, that were identified from roots, stems, leaves and fruits from ficus deltoidea. musa et al.39 (2020) obtained 126 endophytic actinomycete isolates belonging to 24 genera from thymus roseus. the genera agromyces, alloactinosynnema, labedella, microbacterium, mycobacterium, williamsia, blastococcus, dietzia, micromonospora, pseudarthrobacter and solirubrobacter belong to rare genera. similarly, out of 23 genera were obtained by wang et al.66 (2021), 6 genera were identified as rare endophytic actinomycetes, labedella, rathayibacter, leucobacter, frigoribacterium, aeromicrobium and kineococcus. qin et al.69 (2009) reported that medicinal plants of tropical rain forests were the richest source of novel endophytic actinomycetes. evidently, endophytic actinomycetes which investigated from medicinal plants and tropical rain forests have a considerable attention of the scientific research community (table 2). additionally, roots are a major organ that had been studied to its novel strains. isolation of endophytes actinomycetes understanding the colonization of endophytic actinomycetes can be gained by studying their characteristics, and explain their interactions and applications into plant tissues. the most commonly used isolation procedures start with surface sterilization of the plant organs. ordinary and specific modified cultures and table 2. novel endophytic actinomycete species isolated from plants plant species isolation region plant organ family novel strain references typha angustifolia l. yunnan province, southwest china root streptomycetaceae streptomyces typhae sp. nov. p1417t peng et al., 202170 peganum harmala l. xinjiang uygur autonomous region of china root pseudonocardiaceae actinokineospora pegani sp. nov. trm 65233t lei et al., 202071 anabasis elatior (c.a.mey.) schischk. xinjiang, north-west china root pseudonocardiaceae amycolatopsis anabasis sp. nov. egi 650086t wang et al., 202072 excoecaria agallocha linn guangxi zhuang autonomous region, pr china stem microbacteriaceae microbacterium excoecariae sp. nov. cbs5p-1t chen et al., 202073 mentha haplocalyx briq. guizhou, pr china stem nakamurellaceae nakamurella flava sp. nov. n5bh11t yan et al., 202074 phragmites australis taklamakan desert in xinjiang uygur autonomous region, china leaf nocardioidaceae aeromicrobium endophyticum sp. nov. 9w16y-2t li et al., 201975 podochilus microphyllus lindl. trat province, thailand. root pseudonocardiaceae actinomycetospora endophytica sp. nov. a-t 8314t sakdapetsiri et al., 201876 triticum aestivum l. langfang, hebei province, china root glycomycetaceae glycomyces rhizosphaerae sp. nov. neau-c8 li et al., 201877 anabasis aphylla l. xinjiang, northwest pr china root glycomycetaceae glycomyces anabasis sp. nov. egi 6500139t zhang et al., 201878 glycine max l. harbin, heilongjiang province, china root streptosporangiaceae nonomuraea glycinis sp. nov. neaubb2c19t li et al., 201779 capparis spinosa urumqi city, xinjiang, north-west china fruit streptomycetaceae streptomyces capparidis sp. nov. egi 6500195t wang et al., 201780 grosourdya appendiculata (blume) rchb.f. nakhorn ratchasima province, thailand. root micromonosporaceae verrucosispora endophytica sp. nov. a-t 7972t ngaemthao et al., 201781 glycine max (l.) merr. harbin, heilongjiang province, china root micromonosporaceae plantactinospora soyae sp. nov. neau-gxj3t guo et al., 201682 (continued) review 158 j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 diversity and colonization of endophytic actinomycetes in some medicinal plants: review review k. alzahrani et al. table 2. novel endophytic actinomycete species isolated from plants plant species isolation region plant organ family novel strain references bruguiera gymnorhiza zhanjiang mangrove forest national nature reserve in guangdong, china stem intrasporangiaceae phycicoccus endophyticus sp. nov. ip6sc6t liu et al., 201683 bruguiera sexangular dongzhaigang national nature reserve in hainan, china stem propionibacteriaceae microlunatus endophyticus sp. nov. s3af-1t tuo et al., 201684 prosopis laegivata san luis potosi, mexico root micrococcaceae kocuria arsenatis sp. nov. cm1e1t román-ponce et al., 201685 anabasis elatior (c.a.mey.) schischk. urumqi, xinjiang province, north-west china root microbacteriaceae frigoribacterium endophyticum sp. nov. egi 6500707t wang et al., 2015b86 veratrum nigrum l. wuchang, heilongjiangprovince, northern china root micromonosporaceae plantactinospora veratri sp. nov. neaufhs4t xing et al., 201587 salsola affinis c. a. mey urumqi, xinjiang province, north-west china root micrococcaceae arthrobacter endophyticus sp. nov. egi 6500322t wang et al., 2015a88 aloe barbadensis pune, maharashtra, india leaf micrococcaceae micrococcus aloeverae sp. nov. ae-6t prakash et al., 201489 artemisia argyi yesanpo located in laishui county, hebei province, china root glycomycetaceae glycomyces artemisiae sp. nov. ixs4t zhang et al., 201490 artemisia annua l. yunnan province, southwest china root streptomycetaceae streptomyces endophyticus sp. nov. yim 65594t li et al., 201391 isolation procedures are critical steps in working with endophytic actinomycetes. surface sterilization of the used part must be carried out. the sterilizing agent should kill any microbe on the plant surface without affecting the host tissue and the endophytic microorganisms. qin et al.69 (2009) described the methods of cleaning and sterilization of plant organs. initially, plant organs samples were air dried, washed to remove the surface soils and adherent epiphytes completely. after that, the samples were subjected to a five-step surface sterilization procedure with 5% sodium hypochlorite for 4–10 min., 2.5% sodium thiosulfate for 10 min., 75% ethanol for 5 minutes, sterile water and finally in 10% sodium bicarbonate for 10 min. after being thoroughly dried under sterile conditions, the surfacesterilized tissues were subjected to continuous drying at 100°c for 15 min. it is very important that sterility is guaranteed for all tools and steps of this procedure. optimination of the procedures for each plant tissue, since sensitivity varies with species, age and surface properties must be considered. the choice of the isolation culture media is crucial as it directly affects the number and type of endophytic actinomycetes that can be isolated from the plant organs. international streptomyces protocol media were also used for isolation as well as some other commonly used media include starch casein agar, starch casein nitrate agar, tryptic soya-yeast extract agar and glycerol aspargine agar.13,33,38,40,45 major identification methods culture characteristics should be determined on international streptomyces protocol (isp) media.80 the colors of aerial and substrate mycelia in addition to color of the soluble pigments are important for actinomycete identification. morphological characteristics are observed by light and scanning electron microscopes and growth at different temperatures (5–60°c) and different ph values are recorded.81 some physiological and biochemical characteristics like utilization of different carbon and nitrogen sources by the actinomycetes are important for identification.82 cell chemistry was determined by detecting diagnostic sugars in whole-cell hydrolysates, amino acids in the cell wall and cell total content of fatty acids and phospholipids. the g+c content of the dna, and 16s rrna gene were performed to confirm the identification of the actinomycetes.78 conclusion and future perspective actinomycetes endophytes are gained importance due to their ability to colonization mechanisms and distribution in all plant organs. many studies had investigated endophytic actinomycetes which associated with different plant species and their organs such as roots, stems, leaves, fruits and flowers. they are considered as useful microorganisms due to their roles as a defense barrier against some pathogenic microorganisms. many medicinal plant hosted many novel taxa, thus, there is a need to specific focusing on isolation of rare endophytic actinomycetes to determine their potent useful and benefit effects on plant growth and production as well as their applications in medical and industrial fields. finally, it is clear that endophytic actinomycetes play a key role in maintaining plant health by contributing to all biotic and a biotic stress tolerance. conflict of interest the authors declare that there is no conflict of interest involved in this study.  159j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 k. alzahrani et al. diversity and colonization of endophytic actinomycetes in some medicinal plants: review references 1. hogg, s. (2013). essential microbiology. (2nd ed.), wiley-blackwell. 2. anandan, r. (2016). an introduction to actinobacteria. in d. dharumadurai and g. manogaran (edt.) basics and biotechnological applications, intechopen, pp. 3 – 37. 3. jiang, y. (2016). isolation and cultivation methods of actinobacteria. in q. li, x. chen and c. jiang (eds), basics and biotechnological applications. (pp. 39 – 57), intechopen. 4. suman, a., yadav, a. and verma, p. (2016). endophytic microbes in crops: diversity and beneficial impact for sustainable agriculture. in: singh d., singh h., prabha r. (eds), microbial inoculants in sustainable agricultural productivity. springer, new delhi. 5. khare, e., mishra, j., & arora, n. k. (2018). multifaceted interactions between endophytes and plant: developments and prospects. frontiers in microbiology, 9, 2732. 6. rangjaroen, c., sungthong, r., rerkasem, b., teaumroong, n., noisangiam, r. and lumyong, s. (2017). untapped endophytic colonization and plant growth-promoting potential of the genus novosphingobium to optimize rice cultivation. microbes environ. vol. 32: 84–87. 7. castanheira, n., dourado, a., pais, i., semedo, j., scotti-campos, p., borges, n. and fareleira, p. (2017). colonization and beneficial effects on annual ryegrass by mixed inoculation with plant growth promoting bacteria. microbiol. res. vol. 198: 47–55. 8. compant, s., clément, c. and sessitsch, a. (2010). plant growth-promoting bacteria in the rhizo-and endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. soil biol. biochem., vol. 42: 669–678. 9. nalini, m. and prakash, h. (2017). diversity and bioprospecting of actinomycete endophytes from the medicinal plants. letters in applied microbiology, vol. 64: 261-270. 10. kobayashi, d. and palumbo, j. (2000). bacterial endophytes and their effects on plants and uses in agriculture. c.w. bacon and j.f. white (eds), marcel dekker, new york. 11. mengistu, a. “endophytes: colonization, behaviour, and their role in defense mechanism”, international journal of microbiology, vol. 2020, article id 6927219, 8 pages. 12. strobel, g. and daisy, b. (2003). bioprospecting for microbial endophytes and their natural products. microbiol. mol. biol. rev. vol. 67: 491–502. 13. gohain, a., gogoi, a., debnath, r., yadav, a., singh, b., gupta, v., sharma, r. and saikia, r. (2015). antimicrobial biosynthetic potential and genetic diversity of endophytic actinomycetes associated with medicinal plants. fems. microbiol. lett. vol. 362(19): 1121-1129. 14. hardoim, p., van overbeek, l., berg, g., pirttilä, a., compant, s., campisano, a., döring, m. and sessitsch, a. (2015) the hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. microbiol. mol. biol. rev. vol. 79(3): 293-320. 15. hardoim, p., van-overbeek, l., and van-elsas, j. (2008). properties of bacterial endophytes and their proposed role in plant growth. trends microbiol. vol. 16: 463–471. 16. abreu-tarazi, m., navarrete, a., andreote, f., almeida, c., tsai, s. and almeida, m. (2010). endophytic bacteria in long-term in vitro cultivated axenic pineapple microplants revealed by pcr dgge. world j. microbiol. biotechnol. vol. 26: pp 555–560. 17. christina, a., christapher, v., and bhore, s. (2013). endophytic bacteria as a source of novel antibiotics: an overview. pharmacogn. rev. vol. 7: 11–16. 18. seipke, r., kaltenpoth, m. and hutchings, m. (2012) streptomyces as symbionts: an emerging and widespread theme. fems microbiol. rev. vol. 36: 862–876. 19. van der meij, a., worsley, s., hutchings, m. and van wezel, g. (2017). chemical ecology of antibiotic production by actinomycetes. fems microbiol. rev., vol. 41: 392–416. 20. kawasaki, a., donn, s., ryan, p. r., mathesius, u., devilla, r., jones, a., & watt, m. (2016). microbiome and exudates of the root and rhizosphere of brachypodium distachyon, a model for wheat. plos one, 11(10), e0164533. 21. patle, p., navnage, n. and ramteke, p. (2018). endophytes in plant system: roles in growth promotion, mechanism and their potentiality in achieving agriculture sustainability. international journal of chemical studies. vol. 6: 270–274. 22. kumar, a. and verma, j. (2018). “does plant-microbe interaction confer stress tolerance in plants: a review?” microbiological research. vol. 207: 41–52. 23. plett, j. and f. martin, m. (2018). know your enemy, embrace your friend: using omics to understand how plants respond differently to pathogenic and mutualistic microorganisms differently to pathogenic and mutualistic microorganisms. the plant journal, vol. 93(4): 729–746. 24. brader, g., compant, s. and vescioetal, k. (2017). ecology and genomic insights into plant-pathogenic and plant-nonpathogenic endophytes. annual review of phytopathology, vol. 55(1): 61–83. 25. liu, h., carvalhais, l. c., crawford, m., singh, e., dennis, p. g., pieterse, c., & schenk, p. m. (2017). inner plant values: diversity, colonization and benefits from endophytic bacteria. frontiers in microbiology, 8, 2552. 26. chow, y., rahman, s. and ting, a. (2017). understanding colonization and proliferation potential of endophytes and pathogen in planta via plating, polymerase chain reaction, and ergosterol assay. j. adv. res. vol. 8: 13–21. 27. ludwig, w., euzéby, j., schumann, p., busse, h., trujillo, m. e., kämpfer, p., et al. (2015). “road map of the phylum actinobacteria,” in bergey’s manual of systematics of archaea and bacteria, eds w. b. whitman, f. rainey, p. kämpfer, m. trujillo, j. chun, p. devos, et al. (hoboken, nj: wiley). 28. stepniewska, z. and kuzniar, a. (2013). endophytic microorganismspromising applications in bioremediation of greenhouse gases. appl. microbiol. biotechnol. vol. 97: 9589–9596. 29. matsumoto, a. and takahashi, y. (2017). endophytic actinomycetes: promising source of novel bioactive compounds. the journal of antibiotics. vol. 70: 514–519. 30. olivares, f., james, e., baldani, j. and döbereiner, j. (1997). infection of mottled stripe disease-susceptible and resistant sugar cane varieties by the endophytic diazotroph herbaspirillum. new phytol., vol. 135: 723–737. 31. vorholt, j. (2012). microbial life in the phyllosphere. nat. rev. microbiol., vol. 10: 828–840. 32. chen, m., zhang, l. and zhang, x. (2011). isolation and inoculation of endophytic actinomycetes in root nodules of elaeagnus angustifolia. modern applied science, vol. 5, 2: 264 267. 33. priya, m. (2012). endophytic actinomycetes from indian medicinal plants as antagonists to some phytopathogenic fungi. vol. 1, 259. 34. goudjal, y., toumatia, o., sabaou, n., barakate, m., mathieu, f. and zitouni, a. (2013) endophytic actinomycetes from spontaneous plants of algerian sahara: indole-3-acetic acid production and tomato plants growth promoting activity. world j. microbiol. biotechnol., vol. 29: 1821–1829. 35. rahayu, s., fitri, l. and ismail, y. (2019). endophytic actinobacteria isolated from ginger (zingiber officinale) and its potential as a pancreatic lipase inhibitor and its toxicity. biodiversitas vol. 20(5): 1312-1317. 36. chaudhry, h., nisar, n., mehmood, s., iqbal, m., nazir, a., & yasir, m. (2020). indian mustard brassica juncea efficiency for the accumulation, tolerance and translocation of zinc from metal contaminated soil. biocatalysis and agricultural biotechnology, 23, 101489. 37. vu, t., nguyen, q., dinh, t., quach, n., khieu, t., hoang, h., chu-ky, s., vu, t., chu, h., lee, j., kang, h., li, w. and phi, q. (2020). endophytic actinomycetes associated with cinnamomum cassia presl in hoa binh province, vietnam: distribution, antimicrobial activity and, genetic features. j. gen. appl. microbiol. vol. 66(1): 24-31. 38. phongsopitanuna, w., sripreechasakc, p., rueangsawang, k., panyawut, r., pittayakhajonwut, p. and tanasupawat, s. (2020). diversity and antimicrobial activity of culturable endophytic actinobacteria associated with acanthaceae plants. science asia, vol. 46: 288-296. 39. musa, z., ma, j., egamberdieva, d., mohamad, o., abaydulla, g., liu, y., li, w. and li, l. (2020). diversity and antimicrobial potential of cultivable endophytic actinobacteria associated with the medicinal plant thymus roseus. frontiers in microbiology. vol. 11, 191. 40. momin, m., passari, a.,singh, b. and tripathi, s. (2019). isolation and morphological identification of endophytic actinomycetes from medicinal plants of mizoram, northeast, india. medicinal plants of india: conservation and sustainable use, 343-351. 41. shan, w., zhou, y., liu, h. and xiaomin, y. (2018). endophytic actinomycetes from tea plants (camellia sinensis): isolation, abundance, antimicrobial, and plant-growth-promoting activities. biomed research international, vol. 2018, article id 1470305, 12 pages. 42. janatiningrum, i., solihin, d., andini, a. and lestari, y. (2018). comparative study on the diversity of endophytic actinobacteria communities from ficus deltoidea using metagenomic and culture-dependent approaches. biodiversitas. vol. 19(4): 1514-1520. 43. salam, p., pandey, v., shrestha, s. and anal, a. (2017). the need for the nexus approach, in water-energy-food nexus: principles and practices. washington, dc: john wiley and sons, inc.,1–10. 44. ranjan, r. and jadeja, v. (2017). isolation, characterization and chromatography-based purification of antibacterial compound isolated from rare endophytic actinomycetes micrococcus yunnanensis. j. pharm anal. vol. 7(5): 343-347. review 160 j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 diversity and colonization of endophytic actinomycetes in some medicinal plants: review review k. alzahrani et al. 45. gos, f., savi, d., shaaban, k., thorson, j., aluizio, r., possiede, y., rohr, j. and glienke, c. (2017). antibacterial activity of endophytic actinomycetes isolated from the medicinal plant vochysia divergens (pantanal, brazil). front. microbiol., vol. 8, 1642. 46. singh, s. and gaur, r. (2016). evaluation of antagonistic and plant growth promoting activities of chitinolytic endophytic actinomycetes associated with medicinal plants against sclerotium rolfsii in chickpea. j. appl. microbiol. vol. 121: 506–518. 47. saini, p., gangwar, m., kalia, a., singh, n. and narang, d. (2016). isolation of endophytic actinomycetes from syzygiumcumini and their antimicrobial activity against human pathogens. j. app. nat. sci. vol. 8: 416–422. 48. kaur, n. (2016). endophytic actinomycetes from azadirachta indica a. juss.: characterization and antimicrobial activity. international journal of advanced research, vol. 4(6): 676-684. 49. passari, a., chandra, p., zothanpuia, mishra, v., leo, v., gupta, v., kumar, b. and singh, b. (2016). detection of biosynthetic gene and phytohormone production by endophytic actinobacteria associated with solanum lycopersicum and their plant-growth-promoting effect. res. microbiol. vol. 167: 692–705. 50. phuakjaiphaeo, c., and kunasakdakul, k. (2015). isolation and screening for inhibitory activity on alternaria brassicicola of endophytic actinomycetes from centella asiatica (l.) urban. j. agri. technol. vol. 11: 903–912. 51. rao, h., rakshith, d. and satish, s. (2015). antimicrobial properties of endophytic actinomycetes isolated from combretum latifolium blume, a medicinal shrub from western ghats of india. frontiers in biology. vol. 10(6): 528–536. 52. gangwar, m., kaur, n., saini, p. and kalia, a. (2015). the diversity, plant growth promoting and antimicrobial activities of endophytic actinomycetes isolated from emblica officinalis gaertn. international journal of advance research. vol. 3: 1062-1071. 53. gangwar, m., dogra, s., gupta, u. and kharwar, r. (2014). diversity and biopotential of endophytic actinomycetes from three medicinal plants in india. african. j. microbiol. res. vol. 8: 184–191. 54. sadrati, n., daoud, h., zerroug, a., dahamna, s. and bouharati, s. (2013). screening of antimicrobial and antioxidant secondary metabolites from endophytic fungi isolated from wheat (triticum durum). journal of plant protection research. vol. 53(2): 128-136. 55. kaewkla, o. and franco, c. (2013) rational approaches to improving the isolation of endophytic actinobacteria from australian native trees. microb. ecol. vol. 65: 384–393. 56. singh, r. and dubey, a. (2018). diversity and applications of endophytic actinobacteria of plants in special and other ecological niches. frontiers in microbiology. vol. 9, 1767. 57. brader, g., compant, s., mitter, b., trognitz, f. and sessitsch, a. (2014). metabolic potential of endophytic bacteria. curr. opin. biotechnol. vol. 27: 30–37. 58. straub, d., rothballer, m., hartmann, a. and ludewig, u. (2013). the genome of the endophytic bacterium h. frisingense gsf30(t) identifies diverse strategies in the herbaspirillum genus to interact with plants. front. microbiol., vol. 4(168). 59. ashkan, m., aly, m., aldhebiani, a. and al-shehri, w. (2020). molecular identification and enzymatic activities of endophytic bacteria of ammannia baccifera grown at hot spring area, laith, saudi arabia. prensa med. argent, s2: 010. 60. sharma, m., dangi, p. and choudhary, m. (2014). actinomycetes: source, identification, and their applications. int. j. curr. microbiol. app. sci., vol. 3(2): 801-832. 61. kandel, s., joubert, p. and doty, s. (2017). “bacterial endophyte colonization and distribution within plants,” microorganisms, vol. 5: 1–26. 62. gaiero, j., mccall, c., thompson, k., day, n., best, a. and dunfield, k. (2013). inside the root microbiome: bacterial root endophytes and plant growth promotion. am. j. bot. vol. 100: 1738–1750. 63. lebeis, s. (2014). the potential for give and take in plant-microbiome relationships. front. plant sci. vol. 5, 287. 64. ashkan, m., aly, m. and aldhebiani, a. (2021). screening and characterization of endophytic bacteria from heliotropium pterocarpum growing at hot spring for their biological impacts. bbiosc. biotech. res. comm. vol. 14, 1. 65. santi, c., bogusz, d. and franche, c. (2013). biological nitrogen fixation in non-legume plants. ann. bot. vol. 111: 743–767. 66. wang, t., li, f., lu, q., wu, g., jiang, z., liu, s., habden, x., razumova, e., osterman, i., sergiev, p., dontsova, o., hu, x., you, x. and sun, c. (2021). studies on diversity, novelty, antimicrobial activity, and new antibiotics of cultivable endophytic actinobacteria isolated from psammophytes collected in taklamakan desert. journal of pharmaceutical analysis. vol. 11 (2): 241-250. 67. chaurasia, a., meena, b., tripathi, a., pandey, k., rai, a. and singh, b. (2018). actinomycetes: an unexplored microorganisms for plant growth promotion and biocontrol in vegetable crops. world j. microbiol. biotechnol., vol. 34, 9: 132. 68. tiwari, k. (2015). the future products: endophytic fungal metabolites. j. biodivers. biopros. dev., vol. 2(145). 69. qin, s., li, j., chen, h., zhao, g., zhu, w., jiang, c. (2009). isolation, diversity, and antimicrobial activity of rare actinobacteria from medicinal plants of tropical rain forests in xishuangbanna, china. appl. environ. microbiol. vol. 75: 6176-6186. 70. peng c, zhuang x, gao c, wang z, zhao j, huang sx, liu c, xiang w. (2021). streptomyces typhae sp. nov., a novel endophytic actinomycete with antifungal activity isolated the root of cattail (typha angustifolia l.). antonie van leeuwenhoek, 114(6):823-833. 71. lei, y., xia, z., luo, x. and zhang, l. (2020). actinokineospora pegani sp. nov., an endophytic actinomycete isolated from the surface-sterilized root of peganum harmala l. int. j. syst. evol. microbiol., vol. 70(7): 4358-4363. 72. wang, h., li, x., gao, r., xie, y., xiao, m., li, q. and li w. (2020). amycolatopsis anabasis sp. nov., a novel endophytic actinobacterium isolated from roots of anabasis elatior. int. j. syst. evol. microbiol. vol. 70(5): 3391-3398. 73. chen, m., li, f., yan, x. and tuo, l. (2020) microbacterium excoecariae sp. nov., a novel endophytic actinobacterium isolated from bark of excoecaria agallocha linn. int. j. syst. evol. microbiol. vol. 70(12): 6235-6239. 74. yan, x., chen, m., yang, c., an, m., li, h., shi, h. and tuo, l. (2020). nakamurella flava sp. nov., a novel endophytic actinobacterium isolated from mentha haplocalyx briq. int. j. syst. evol. microbiol., vol 70(2): 835-840. 75. li, f., liao, s., liu, s., jin, t. and sun, c. (2019). aeromicrobium endophyticum sp. nov., an endophytic actinobacterium isolated from reed (phragmites australis). j. microbiol. vol. 57(9): 725-731. 76. sakdapetsiri, c., ngaemthao, w., suriyachadkun, c., duangmal, k. and kitpreechavanich, v. (2018). actinomycetospora endophytica sp. nov., isolated from wild orchid (podochilus microphyllus lindl.) in thailand. int. j. syst. evol. microbiol. vol. 68(9): 3017-3021. 77. li, w., zhao, j., shi, l., wang, j., wang, h., wang, x. and xiang, w. (2018). glycomyces rhizosphaerae sp. nov., isolated from the root and rhizosphere soil of wheat (triticum aestivum l.). int. j. syst. evol. microbiol. vol. 68(1): 223-227. 78. zhang, y., wang, h., alkhalifah, d., xiao, m., zhou, x., liu, y., hozzein, w. and li, w. (2018). glycomyces anabasis sp. nov., a novel endophytic actinobacterium isolated from roots of anabasis aphylla l. int. j. syst. evol. microbiol. vol. 68(4): 1285-1290. 79. li, z., song, w., zhao, j., zhuang, x., zhao, y., wang, x. and xiang, w. (2017). nonomuraea glycinis sp. nov., a novel actinomycete isolated from the root of black soya bean [glycine max (l.) merr]. int. j. syst. evol. microbiol. vol. 67(12): 5026-5031. 80. wang, h., li, q., xiao, m., zhang, y., zhou, x., narsing, r., duan, y. and li, w. (2017). streptomyces capparidis sp. nov., a novel endophytic actinobacterium isolated from fruits of capparis spinosa l. int. j. syst. evol. microbiol. vol. 67(1): 133-137. 81. ngaemthao, w., pujchakarn, t., chunhametha, s. and suriyachadkun, c. (2017). verrucosispora endophytica sp. nov., isolated from the root of wild orchid (grosourdya appendiculata (blume) rchb. f.). int. j. syst. evol. microbiol., 67(12): 5114-5119. 82. guo, x., guan, x., liu, c., jia, f., li, j., li, j., jin, p., li, w., wang, x. and xiang, w. (2016). plantactinosporasoyae sp. nov., an endophytic actinomycete isolated from soybean root [glycine max (l.) merr]. int. j. syst. evol. microbiol. vol. 66(7): 2578-2584. 83. liu, s., xu, m., tuo, l., li, x., hu, l., chen, l., li, r. and sun, c. (2016). phycicoccus endophyticus sp. nov., an endophytic actinobacterium isolated from bruguiera gymnorhiza. int. j. syst. evol. microbiol. vol. 66(3): 1105-1111. 84. tuo, l., li, j., liu, s., liu, y., hu, l., chen, l., jiang, m. and sun, c. (2016) microlunatus endophyticus sp. nov., an endophytic actinobacterium isolated from bark of bruguiera sexangula. int. j. syst. evol. microbiol. vol. 66(1): 481-486. 85. román-ponce, b., wang, d., vásquez-murrieta, s., chen, w., santos, p., sui, x. and wang, e. (2016). kocuria arsenatis sp. nov., an arsenic-resistant endophytic actinobacterium associated with prosopis laegivata grown on high-arsenic-polluted mine tailing. int. j. syst. evol. microbiol. vol. 66(2): 1027-1033. 86. wang, h., zhang, y., chen, j., guo, j., li, l., hozzein, w., zhang, y., wadaan, m. and li, w. (2015b). frigoribacterium endophyticum sp. nov., an endophytic 161j contemp med sci | vol. 8, no. 3, may-june 2022: 153–161 k. alzahrani et al. diversity and colonization of endophytic actinomycetes in some medicinal plants: review actinobacterium isolated from the root of anabasis elatior (c. a. mey.) schischk. int. j. syst. evol. microbiol. vol. 65(4): 1207-1212. 87. xing, h., liu, c., zhang, y., zhao, j., li, c., liu, h., li, l., wang, x. and xiang, w. (2015). plantactinospora veratri sp. nov., an actinomycete isolated from black false hellebore root (veratrum nigrum l.). int. j. syst. evol. microbiol. vol. 65(6): 1799-1804. 88. wang, h., li, l., zhang, y., hozzein, w., zhou, x., liu, w., duan, y. and li, w. (2015a). arthrobacter endophyticus sp. nov., an endophytic actinobacterium isolated from root of salsola affinis c. a. mey. int. j. syst. evol. microbiol. vol. 65(7): 2154-2160. 89. prakash, o., nimonkar, y., munot, h., sharma, a., vemuluri, v., chavadar, m. and shouche, y. (2014). description of micrococcus aloeverae sp. nov., an endophytic actinobacterium isolated from aloe vera. int. j. syst. evol. microbiol. vol. 64(10): 3427-3433. 90. zhang, x., ren, k., du, j., liu, h. and zhang, l. (2014). glycomyces artemisiae sp. nov., an endophytic actinomycete isolated from the roots of artemisia argyi. int. j. syst. evol. microbiol. vol. 64(10): 3492-3495. 91. li, j., zhao, g., zhu, w., huang, h., xu, l., zhang, s. and li, w. (2013). streptomyces endophyticus sp. nov., an endophytic actinomycete isolated from artemisia annua l. int. j. syst. evol. microbiol. vol. 63(1): 224-229. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i3.1222 review 264 j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 review clinical complications associated with spinal cord injury: a narrative review ibrahim mohammed1, sahar ijaz2, morteza gholaminejhad3, gholamreza hassanzadeh3,4* 1department of histopathology, school of medical laboratory sciences, usmanu danfodiyo university sokoto, nigeria. 2department of anatomy and histology, university of veterinary and animal sciences, lahore, pakistan. 3department of anatomy, school of medicine, tehran university of medical sciences, tehran, iran. 4department of neuroscience and addiction studies, school of advanced technologies in medicine, tehran university of medical sciences, tehran, iran. *correspondence to: gholamreza hassanzadeh, (e-mail: hassanzadeh@tums.ac.ir). (submitted: 12 august 2021 – revised version received: 27 august 2021 – accepted: 09 september 2021 – published online: 26 october 2021) introduction spinal cord injury (sci) is a clinical problem associated with remarkable financial as well as the emotional burden on individual patient, families, and society as well. approximately, there is incidence of sci of about 10–80 cases per million populations in the world.1-3 most of the sci result of tetraplegia (51.57%), followed by paraplegia with (45.9%). sci due to motor vehicle accident account in almost one-half of the injuries worldwide, followed by sci due to falls, sci due to violence (like gunshot), and sci due to sports activities.4 alcoholism is one of the factors contributing to sci with 25% new cases of sci,3 as underlying spine disorder like cervical spondylosis, osteoporosis, atlantoaxial instability, and spinal arthropathies can lead to sci, too.2,5 the extent of sci depend on the severity of the initial injury, as well the financial burden depends also between individual patients, with the estimated cost of 500,000 to 2 million us dollars on individual patient’s lifetime.2 epidemiological studies revealed that the incidence of traumatic sci in the us is between 27 to 83 per million, in europe approximately about 10–30 new cases per million.6 in developed areas such as western europe (16/million), australia (15/million) and north america (39/million). falls on level ground are the most common cause of sci in older countries such as western europe (37%) and japan (42%). violence is one of the common causes of sci in developing regions such as north africa/ middle east (24%), sub-saharan africa (38%) and latin america (22%).7,8 a research conducted in 2008 in tehran based on population, reported that the prevalence of sci was 4.4 per 10,000 populations.9 rahimi movaghar et al. (2013), reported the incidence of sci in developing countries has a rate of 25.5 per million per year, which ranged from 2.1 to 130.7 per million per year.10 also, men are more prone to sci in the world than women, although there are differences in the data based on the countries.7 mechanism of sci categorized into primary and secondary injury, with former resulting from pathologic flexion, compression, rotation, contusion, extension, shearing, fracture-dislocation, ligamentous tears or disruption as well as herniation of intervertebral disk. the primary mechanical injury that happened at the time of injury is followed by a secondary injury phase involving vascular dysfunction, edema, ischemia, excitotoxicity, inflammation, mitochondrial dysfunction, and delayed apoptotic cell death.11-16 a report from gholaminejhad et al. (2017), revealed that the stress oxidative level will increase as one of the complications of sci, finally may result to neurons disruption in animal model.17 there are series of complication occurred as a result of sci starting from primary injury to secondary injury, most often if care is not taken primary injury leads to the secondary injury that increases damage to previously injured spinal cord, it has shown that overexpression of cytokines that are important mediator for inflammation following sci.18,19 sci can initiate biochemical and molecular events like inflammation which one of the key factor in neurodegeneration development.20 in this paper, the various clinical complications due to sci were discussed. this narrative review adds to the knowledge of how spinal cord injury occurs, the various complications resulted by spinal cord injury, through the knowledge of different complications immediate attention will be giving to spinal cord injury patients at the early stage. scopus search, google scholar search, pubmed search are the search engines used to get the information for this review. abstract spinal cord injury (sci) is a neuro-destruction occurred from a complete or incomplete, traumatic or non-traumatic that results in degeneration, structural, biochemical, and physiological changes of tissue. sci is a clinical problem associated with impairments in different aspects of the patient’s life. the pathophysiology of sci involves a primary phase that directly disrupts axons, cell membranes, and blood vessels. this primary phase is followed by a secondary phase involving vascular dysfunction, ischemia, excitotoxicity, oxidative stress, inflammation, and cell death. if this second phase isn’t managed, it will result in many pathological processes that will cause several clinical complications. the aim of rehabilitation and other treatments is to enhance the functional level and to reduce secondary morbidity as well as improve the quality of health of the patient. sci results in different complications in different organs of the individual. early diagnosis, treatment, and prevention of complications in sci patients are very important for limiting these complications. this review was carried out in order review the data about clinical complications associated with sci, including multiple organ dysfunction, systemic inflammation, immune suppression, neurogenic shock, autonomic dysreflexia, orthostatic hypotension, temperature regulation, sweat secretion, respiratory complications and dysphagia, thromboembolism, urinary system, reproductive system, skeletal muscle, bone, liver, spleen and gastrointestinal tract. the purpose of this narrative review is to provide knowledge on the sci complications, sign and symptoms, risk factors prevention and treatment of complications caused by sci. keywords: spinal cord injury, inflammation, oxidative stress, clinical complications issn 2413-0516 265j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 i. mohammed et al. review clinical complications of spinal cord injury multiple organ dysfunctions apart from impairments to sensation and voluntary movement, sci interrupts the autonomic nervous system and leads to dysfunction or failure in multiple organs due to a vital role of the spinal cord in coordinating bodily functions.21 short term as well as long complications due to sci may happen in the nervous system (like neurogenic pain and depression), in lungs (pulmonary edema and respiratory failure), in cardiovascular system (like autonomic dysreflexia and orthostatic hypotension), in spleen (like splenic atrophy and leukopenia), in urinary tract (neurogenic bladder, urinary tract infection as well as kidney damage), in skeletal muscle (muscle spasticity and atrophy), in soft tissue as well as bone (osteoporosis and heterotopic ossification), in skin (pressure sores), there are also sexual dysfunction, hepatic pathology, neurogenic bowel dysfunction, syringomyelia as well as high susceptibility to infection. some sci complications if care is not taken can easily cause the death of the patient, such as liver, kidney as well as lungs damage (figure 1).21-24 multiple organ dysfunctions due to sci are complex regulation by various components. cranial nerves that originate from brainstem (pons and medulla) regulate the functions of multiple organs, the brainstem reflexes were found to be changed in sci patients.25 this shows a complex relationship between multiple organ dysfunction, sci and altered brainstem activity. this suggests that a good care should be given to the brainstem’s role in multiple organ dysfunctions due to sci.25 systemic inflammation the local inflammatory microenvironment around the injured spinal cord is the aggregation of degenerating neurons, damaged myelin sheath, damaged endothelial cells as well as activated glial and infiltrating cells, this microenvironment yields different kind of pro-inflammatory mediators.26,27 apart from this intraspinal inflammation, sci may results in systemic inflammatory response syndrome (sirs), this is a life-threatening situation that can affect other organs, such as liver, kidney, and lung.28 previous research revealed that there is a functional relationship between systemic inflammation and pathogenesis of post injury complications: patients with sirs-positive have more injury severity with more chances of complications compared to sirs-negative patients.29 there are some other different factors like dysregulation of the neuroendocrine system and altered neuroimmune regulation, known as major key factors in determinants of the onset as well as the development of post-sci systemic inflammation. for example, sci induces the hypothalamic-pituitary-adrenal axis, results in increased macrophage migration inhibitory factor processing via pituitary gland.30 macrophage migration inhibitory factor is one of the key factors in systemic inflammation, revealing that sci-elicited neuroendocrine changes lead to the advancement of systemic inflammation. chronic activation of microglia, the neuroimmune cells of the central nervous system, happens in the hippocampus and cerebral cortex following sci; this is showing that neuroimmune dysregulation played an important function in systemic inflammation after sci.31 a research conducted by zandedel et al., (2016) reported that stromal cell-derived factor-1 alpha (sdf-1α) or cxcl12 is the main principal cytokine with numerous functions in the brain at fetal development as well as adult period. the inflammatory response occurred due to sci requires the processing of interleukin-1beta (il-1β) as well as il-18 mediated by caspase-1 in which an intracellular multiprotein complex control it (inflammasome).32 fig. 1 clinical complications of spinal cord injury. after spinal cord injury, several clinical complications occur in the short term or the long term. some of these clinical complications include disorders in the reproductive system, respiratory system, digestive system, urinary system, sweat secretion, skeletal muscles, liver, spleen, bones and systemic inflammation that afflict a person with physical, psychological, social and economic problems. 266 j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 clinical complications of spinal cord injury review i. mohammed et al. immune suppression complications occur on the immune system as result of sci known as sci-induced immune depression syndrome (sci-ids), due to dysregulation of the sympathetic nervous system as well as immune organ dysfunction.33 sci can result in sympathetic nervous system malfunction instantly through prominent projections of the thoracolumbar spinal cord to sympathetic ganglion or directly through damaging supraspinal control by the hypothalamic-pituitary-adrenal axis. sci-ids, revealed by the loss of splenocytes as well as leukopenia, is a presumed self-defense mechanism that decreases potential autoimmunity to self-antigens released by damaged in the cns.34 report from different sources has shown that sci-ids worsens neurological environments and damages the functional recovery of sci patients. riegger et al., (2009) revealed that a remarkable decrease in the amount of circulating cells associated with innate and adaptive immunity in the acute phase after sci on rat model.35 similar reports were also made in a pilot research that involves 16 patients with sci and 10 healthy individuals as control: decreased monocytes, t lymphocytes, and b-lymphocytes, but granulocytes were not seen in the blood circulation within 24 hours following sci.36 sci-ids has a vital clinical relevance, as sci patients show a higher susceptibility to different infections (like wound infections and pneumonia)37 as well as poor functional recovery.38 autonomic dysreflexia, as well as the expansion of myeloid-derived suppressor cells after sci, has a mutual relationship with sci-ids.39 neurogenic shock at the level of cervical vertebra of sci in human, the common features of neurogenic shock are severe hypotension as well as continuance bradycardia.40 in a study conducted by glenn and bergman (1997) revealed that chronic hypotension was seen 31 tetraplegic subjects examined with chronic sci, most of the subjects need pressure therapy so that the arterial blood pressure will be maintained.41 apart from pronounced hypotension, the majority of the patients with sci experience chronic abnormalities in heart rate. bradycardia was seen in 64–77% of patients with cervical sci at the acute post-injury level and was so chronic and frequent at the first 5 weeks after the injury.42 furthermore, when the injury is at the level of mid-thoracic spinal cord, leaving cardiac sympathetic neurons under brainstem control, the severity of bradycardia problem is very less. furlan et al. (2003) revealed that the hypotension and bradycardia seen at the beginning following the injury persisted in the individuals with more chronic injury of the descending cardiovascular autonomic cascades.43 apart from neurogenic shock, sci as well associated with “spinal shock”.44,45 these are two different complications of sci, neurogenic shock is identified by changes happening in blood pressure control after sci, while spinal shock is identified by a marked decrease or abolition of motor, sensory or reflex activities of the cord under the level of injury.45 clinically, spinal shock period takes about 1 day to 2 weeks in human, with mean period of 4 and 6 weeks after the injury. traditionally the ideas of the medical course of the recovery of spinal shock were associated with the appearance of some groups of reflexes. for instance, most clinicians assumed that spinal shock had ended when the emergence of initial reflexes, like the bulbocavernosus reflex, happened at the beginning after sci, some assumed with the recovery of deep tendon reflexes at two weeks after the injury, while other groups of clinicians categorized the end of spinal shock as the time after 2 months they recovered bladder voiding reflexes.45 autonomic dysreflexia patients with cervical or high thoracic sci experience life-long abnormalities of blood pressure control.46,47 most often, the resting arterial blood vessels pressure in these patients is lower when compared with normal individuals, usually associated with disabling event of orthostatic hypotension. nevertheless, clinical complications of autonomic dysreflexia, associated with high hypertension together with a pounding headache, sometimes accompanied by slow heart rate as well as upper body flushing, in which systolic blood pressure may rise up to 300 mmhg. untreated autonomic dysreflexia may results in serious complication such as retinal detachment, intracranial hemorrhage, seizures and death.48 majority of non-noxious and noxious stimuli like bowel and bladder distension, pressure sores and spasticity may stimulate the sudden high rate in arterial blood pressure of autonomic dysreflexia.47 these cardiovascular complications are associated with autonomic instability, due to the changes happening within the spinal autonomic circuits in stages of sci in acute and chronic stages.46,47 the damaging of the descending vasomotor pathways leads to the loss of excitatory supraspinal input to the sympathetic preganglionic neurons and is assumed to be the main factor responsible for the lack of sympathetic tone as well as continuance arterial hypotension observed following sci.43 orthostatic hypotension low arterial blood pressure is another complication occurred due to sci both acute and chronic. a study reported that there was an inverse linear relationship between the degree of resting blood pressure as well as sci.46,49 the lower resting blood pressure is assumed to be secondary to the decrease in sympathetic nervous activity below the degree of the injured spinal cord. apart from low blood pressure, patients with sci experience other complication of the drop in blood pressure in the upright posture (orthostatic hypotension), most especially in the acute phase of the injury.49 the symptoms of orthostatic hypotension in with sci patients’ are the same as those individuals without sci experiencing orthostatic hypotension, and all are related to cerebral hypoperfusion.50 the common symptoms usually seen are light-headedness, dyspnea, fatigue or weakness, dizziness, blurred vision and restlessness.51 a study by illman et al., (2000) reported that 41.1% of patients with sci that developed orthostatic hypotension were seen asymptomatic regardless of significant falls in blood pressure, it was also documented that orthostatic hypotension is a common complication among patients with sci.52 orthostatic hypotension due to sci seems to be associated with excessive pooling of blood in the viscera as well as dependent extremities, probably caused by low level or absence of efferent sympathetic preganglionic neurons below the injured area.49 this is possibly to be compounded by the loss of lower limbs muscle function that identified to be essential in counteracting venous pooling in the upright level. the remaining excessive venous pooling in the lower limbs and decreased blood ratio within 267j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 i. mohammed et al. review clinical complications of spinal cord injury the intrathoracic veins results in a decreased pressure in the veins that drain through the atria of the heart.53 these will leads to reduce in ventricular end-diastolic filling pressure and stroke volume,54 resulting in the low in heart output as well as arterial pressure. tachycardia may happen due to the decrease cardiac parasympathetic (vagal) activity, reflexly produced by unloading the arterial baroreceptors, but this activity most usually is too small to compensate for the reduced stroke volume as well as blood pressure remains low. temperature regulation in the ability to control temperature by sci patients is among the clinical complications caused by sci, most usually occurred with patients affected by cervical as well as thoracic sci. this is occurred due to decreases sensory input to thermo-regulating centers as well as loss of sympathetic control of temperature and sweet regulation lower than the affected area.55 there are a lot of thermoregulation complications caused by sci. some sci patients were found to have poikilothermia, in the ability to maintain a normal temperature notwithstanding of the ambient temperature. sci above t8 is usually related to actuating temperature, hyperthermia as well as hypothermia.56 sweat secretion the innervations of sweat glands are mostly by the upper region of the body from t1-t5 spinal cord segments, at the lower part innervated by t6-l2 spinal cord segments. hypothalamus and amygdala are the regions where supraspinal control of sweat excretion occurred.55 as results of sci changes in sweat secretion will occur, the absence of sweating (anhidrosis), excessive sweating (hyperhidrosis), and diminished sweating (hypohidrosis) may all occur following sci.55 excessive sweating is a typical complication seen in sci patients.57 in most of the patients, episodic hyperhidrosis is mostly related to other autonomic dysfunctions like autonomic dysreflexia as well as orthostatic hypotension, or with post-traumatic syringomyelia. the typical symptoms seen are minimal or abolished sweating below the injury and profuse sweating above the injured area. this is occurred due to the compensatory high in secretion of sweat above the level of the injured area because of the loss of sympathetic stimulation below the injured area, which leads to decrease in production of sweat.58 there is also the possibility of sweat production exclusively below the level of the injured area. this kind of sweating is known as reflex sweating and is mostly a symptom of massive autonomic response that happened specifically with cervical and high thoracic sci.58 respiratory complications sci at the cervical region has major complications on the pulmonary system, as well respiratory difficulties are among the most complications and can lead to frequent death, both in the acute and chronic level of sci.59 results from the previous research revealed that 67% of acute sci individuals have severe respiratory problems at the first day of the injury; atelectasis 36.4%, pneumonia 31.4% as well as respiratory failure 22.6%.60 it was also revealed that in the acute phase 84% of sci patients with injuries above c4, 6% with injuries from c5-c8 would develop respiratory complications.61 regular monitoring of respiration on sci patients with such injuries is advisable. there is possibility of 56% of sci patients with injuries at the level of t1–t12 to develop severe respiratory problems.62 30–50% reduction of vital capacity is observed in the first week of injury in injured patients at the level of c5–c6. vital capacity, as well as arterial blood gases, should be measured regularly until the patient is normal.63 thromboembolism sci patients have a higher risk of coagulation complications as well as venous stasis due to physical inactivity, altered hemostasis with decreased fibrinolytic activity and high factor viii activity.64 the patients also are at high risk of thromboembolism.65 at the first year of injury, the chances of deep vein thrombosis, as well as pulmonary embolism, are assumed to be 15% and 5% respectively.66 the chances are higher at 2–3 weeks of the injury, at 3 months following the injury it will be at a small peak.67 at the chronic stage, the incidence of thromboembolism is less than 2%.64 urinary system patients with sci have high risk of developing urinary tract complications as well as renal damage, in which both can result in fatal.68 apart from the direct loss of neuronal input following the injury, inflammation has been involved in the pathogenesis of urinary tract malfunction in patients with sci. the inflammation that is possibly occurred due to sci is the production of pro-inflammatory cytokines (il-1β, il-6, and tnf-α), infiltration of immune cells, upregulation of inducible nitric oxide synthase, myeloperoxidase as well as cyclooxygenase-2, then activation of nf-κb.68,69 sci caused complication in bladder, interrupts control of the bladder.70 as a result of sci immediately after the injury, the bladder as well as sphincter is frequently hypotonic. at the chronic stage the bladder dysfunction is categorized as either upper or lower motor neuron syndrome.70 upper motor neuron syndrome known as reflex bladder result in cortical inhibition of sacral reflex arcs because of disturbance of descending spinal tracts, results in detrusor hyperactivity mostly together with detrusor sphincter dyssynergia.71 suppression of the stretch reflex by the pontine storage center is eliminated. a minor quantity of stretch will provide a contraction of the bladder wall; the external urethral sphincter has no voluntary control, leading in recurrent and spontaneous voiding.71 lower motor neuron syndrome occurred due to injury to the sacral region s2–s4, which is part of the autonomic nervous system leading in diminished motor stimulation of the bladder and decreased or lack of contractility of the detrusor and eventually an enlarged bladder.72 reproductive system impaired fertility is among the major complications occurred in men with sci that result in erectile as well as ejaculation malfunctions. semen analysis of sci patients are always poor, there is much evidence from previous research reported that a low sperm viability, motility, leukocytospermia, and high sperm dna fragmentation are common among men with sci.73,74 most of the male sci patients suffer a lot from infertility. nucleotide-binding oligomerization domain-like receptors 268 j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 clinical complications of spinal cord injury review i. mohammed et al. nod-like receptors (nlrs) are the receptors that conjoin with the inflammasome complex. results from different studies revealed that inflammasomes are one of the key factors for secreting cytokines in semen. reactive oxygen species (ros) is one of the agents responsible to initiate inflammasome activation. genital infections as a result of sci can bring about ros generation.75 only a few studies revealed testicular tissue become involved post-sci. impaired spermatogenesis, apoptosis, vast germ cell, inflammatory cytokines elevation, and blood-testis barriers disruption, as well as leukocytes influx, has been shown as abnormal changes in the testis of sci patients, result to the inflammatory event and unstable niche in this tissue.76 a study conducted by nikmehr et al., (2017), examined sperm parameters of sci using rats’ model at acute as well as chronic phases. the result shows a fall in sperm count by half after one day and a third after three days post sci. the severe decrease in sperm count was very significant in the acute phase, sperm motility was also decreased following sci on acute as well as chronic phases compared to the control group.73 sci, a neurogenic impairment, resulted to infertility by disturbing the plasma testosterone balance which is very difficult to be restored by exogenous testosterone administration. sci results in some alteration in oxidative markers, with the reduced free radical scavenging activities of gpx and sod,77 as well as, increased mda concentration and nlrp3 expression after sci.75 skeletal muscle sci makes paralysis and atrophy on the skeletal muscle, especially the muscles controlled by the spinal cord below the level of the injury.78 physiological examinations have shown many alterations in the properties of paralyzed muscles from patients with sci, such as reduced mass area, high susceptibility to fatigue, decreased muscle cross-sectional area as well as the increased proportion of fast glycolytic muscular fibers.79 muscular inflammation can be seen in the acute phase of sci prior to muscular atrophy.80 in long period sci, muscle atrophy is related with the remarkable elevation of inflammatory mediators (such as il-1β, il-6, and tnf-α) as well as activation of nf-κb signaling,81 which is the main agent that regulates the inflammatory state in muscle atrophy.82 bone osteoporosis, which is defined as the loss of bone mineral density (bmd), is formed as a result of sci.83 the distal femur, proximal tibia as well as distal boney sites at sub-lesional area are the major susceptible to bmd loss.84 the low level of bmd is increasing following sci; as well the possibility of patients’ fracture is high,85 there are other various factors that contribute the pathogenesis of osteoporosis as a result of sci. apart from the deficiency in neuronal control, hormonal regulation as well as vascular function,86 the inflammatory microenvironment in bone brings about osteoclast differentiation as well as bone loss.87 liver from the previous report, it was revealed that there are hepatic complications due to sci.88 there are many reports that show liver dysfunction can be related to sci, as the liver plays a significant role in the metabolic dysfunction usually seen in patients with sci. experimental research using animal model revealed that sci activates macrophage activation, neutrophil infiltration, expression of pro-inflammatory cytokines as well as chemokines in the liver.89 this inflammation occurs immediately following the injury,90 and its severity is related to the level of injury.91 a significant amount of accumulated lipid has been seen in rodent liver after sci.92 given the pro inflammatory as well as cytotoxic effects of myelin-laden macrophage related to the accumulation of lipid in the sci,93 macrophage-mediated inflammation considerably leads to hepatic dysfunction following sci. spleen spleen is a very vital lymphoid organ functioned for infiltration of monocytes in the injured spinal cord; spleen is innervated by the autonomic nervous system and regulated by the high thoracic spinal cord. a research using rat model has shown a significant spleen dysfunction due to sci at the t3 level. spleen dysfunction as a result of sci at t3 level was revealed by splenic atrophy with decrease in size, decrease in the amount of splenic leukocyte and increased splenic norepinephrine was seen.94,95 sci mice induced with viral infection revealed impaired immune responses as well as decreased survival, and these results seen in mice were related with deficient cd4+ and cd8+ t cell functions, deficient primary antibody response as well as suppressed activation of macrophages.96 this indicates that dysfunction of the spleen may possibly result in immune suppression in patients with sci. remarkably; post-sci mrna levels of pro-inflammatory cytokines il-17, as well as il-23, were seen upregulated in tissue spleen of rat model by stat3 signaling,97 consequently, crosstalk between spleen and sci could be mediated by neuroinflammation. gastrointestinal tract there are many complications occurred due to sci in the gastrointestinal tract (git), for example, severe constipation, difficulty with evacuation, painful defecation or incontinence, is advisable to restrict and limit the diet and outdoor activities of sci patients.98 despite the fact that function of git is basically regulated by its own intrinsic nervous system as well as autonomic control by the brainstem, sci may cause the destruction of neuronal control of git sensory as well as motor functions, leading to neurogenic bowel dysfunction (nbd). it was estimated that 50% of sci patients are having moderate to severe nbd,99 it appears that abnormal bowel function has a more negative influence on the quality of life of patients with sci.100,101 the clinical presentations of nbd with sci are prolonged bowel transit time; decrease colonic motility as well as anorectal dysfunction.102 even though there is inflammation in colonic lesions of patients with sci,103 the association between systemic inflammation as well as nbd is not well understood. a report from guo et al., (2016) on rat model of nbd after sci shows that upregulation of neuronal nitric oxide synthase leads to colonic dysfunction,104 thus creating inflammation as a possible target for reducing post-sci nbd. conclusion sci leads to different complications in various parts of the body, most often, primary injury gives rise to secondary injury 269j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 i. mohammed et al. review clinical complications of spinal cord injury that increases damage to the previously injured spinal cord. among several processes of secondary injury phase, it seems inflammation is most important because it involves in many pathological problems. therefore, suppression of inflammation maybe is a good target for degenerative diseases. also, knowledge of possible complications by sci is very vital because the complications may be life-threatening and may lead to prolonging rehabilitation for sci patients, also early detection and treatment of the complications will help in managing the patient. even though there is no way to reverse damage to the spinal cord. but there are various researches continually working on new treatments, including transplanting stem cells and medications that may promote nerve cell regeneration or improve the function of nerves that remain after sci. conflicts of interest none.  references 1. grant ra, quon jl, abbed km (2015) management of acute traumatic spinal cord injury. current treatment options in neurology 17 (2):6. 2. sekhon lh, fehlings mg (2001) epidemiology, demographics, and pathophysiology of acute spinal cord injury. spine 26 (24s):s2–s12. 3. thompson c, mutch j, parent s, mac-thiong j-m (2015) the changing demographics of traumatic spinal cord injury: an 11-year study of 831 patients. the journal of spinal cord medicine 38 (2):214–223. 4. jackson ab, dijkers m, devivo mj, poczatek rb (2004) a demographic profile of new traumatic spinal cord injuries: change and stability over 30 years. archives of physical medicine and rehabilitation 85 (11):1740–1748. 5. myers er, wilson se (1997) biomechanics of osteoporosis and vertebral fracture. spine 22 (24):25s–31s. 6. hyun jk, kim h-w (2010) clinical and experimental advances in regeneration of spinal cord injury. journal of tissue engineering 1 (1):650857. 7. chiu w-t, lin h-c, lam c, chu s-f, chiang y-h, tsai s-h (2010) epidemiology of traumatic spinal cord injury: comparisons between developed and developing countries. asia pacific journal of public health 22 (1):9–18. 8. burns as, o’connell c (2012) the challenge of spinal cord injury care in the developing world. the journal of spinal cord medicine 35 (1):3–8. 9. rahimi-movaghar v, saadat s, rasouli mr, ganji s, ghahramani m, zarei m-r, vaccaro ar (2009) prevalence of spinal cord injury in tehran, iran. the journal of spinal cord medicine 32 (4):428–431. 10. rahimi-movaghar v, sayyah mk, akbari h, khorramirouz r, rasouli mr, moradi-lakeh m, shokraneh f, vaccaro ar (2013) epidemiology of traumatic spinal cord injury in developing countries: a systematic review. neuroepidemiology 41 (2):65–85. 11. tator ch, fehlings mg (1991) review of the secondary injury theory of acute spinal cord trauma with emphasis on vascular mechanisms. journal of neurosurgery 75 (1):15–26. 12. ghaffari n, hassanzadeh g, nowrouzi a, gholaminejhad m, mokhtari t, seifali r, mohammed i, akbari m (2018) antioxidative and antiinflammatory effects of cichorium intybus l. seed extract in ischemia/ reperfusion injury model of rat spinal cord. journal of contemporary medical sciences 4 (4). 13. mohammed i, ijaz s, mokhtari t, gholaminejhad m, mahdavipour m, jameie b, akbari m, hassanzadeh g. subventricular zone-derived extracellular vesicles promote functional recovery in rat model of spinal cord injury by inhibition of nlrp3 inflammasome complex formation. metabolic brain disease. 2020 jun 1;35(5). 14. rowland jw, hawryluk gw, kwon b, fehlings mg (2008) current status of acute spinal cord injury pathophysiology and emerging therapies: promise on the horizon. neurosurgical focus 25 (5):e2. 15. hassanzadeh s, jameie sb, soleimani m, farhadi m, kerdari m, danaei n (2018) coenzyme q10 influences on the levels of tnf-α and il-10 and the ratio of bax/bcl2 in a menopausal rat model following lumbar spinal cord injury. journal of molecular neuroscience 65 (2):255–264 16. hassanzadeh s, jameie sb, mehdizadeh m, soleimani m, namjoo z, soleimani m (2018) fndc5 expression in purkinje neurons of adult male rats with acute spinal cord injury following treatment with methylprednisolone. neuropeptides 70:16–25. 17. gholaminejhad m, arabzadeh s, akbari m, mohamadi y, hassanzadeh g (2017) anti-oxidative and neuroprotective effects of flaxseed on experimental unilateral spinal cord injury in rat. journal of contemporary medical sciences 3 (10):213–217. 18. pishva aa, akbari m, farahabadi a, arabkheradmand a, beyer c, dashti n, moradi f, hassanzadeh g (2016) effect of estrogen therapy on tnf-α and inos gene expression in spinal cord injury model. acta medica iranica 54 (5):296–301. 19. mohamadi y, moghahi smhn, mousavi m, borhani-haghighi m, abolhassani f, kashani ir, hassanzadeh g (2019) intrathecal transplantation of wharton’s jelly mesenchymal stem cells suppresses the nlrp1 inflammasome in the rat model of spinal cord injury. journal of chemical neuroanatomy 97:1–8. 20. ijaz s, mohammed i, gholaminejhad m, mokhtari t, akbari m, hassanzadeh g. modulating pro-inflammatory cytokines, tissue damage magnitude, and motor deficit in spinal cord injury with subventricular zone-derived extracellular vesicles. journal of molecular neuroscience. 2020;70(3):458–66. doi: 10.1007/s12031–019–01437–2.. 21. stein dm, menaker j, mcquillan k, handley c, aarabi b, scalea tm (2010) risk factors for organ dysfunction and failure in patients with acute traumatic cervical spinal cord injury. neurocritical care 13 (1):29–39. 22. zimmer mb, nantwi k, goshgarian hg (2007) effect of spinal cord injury on the respiratory system: basic research and current clinical treatment options. taylor & francis, . 23. bilello jf, davis jw, cunningham ma, groom tf, lemaster d, sue lp (2003) cervical spinal cord injury and the need for cardiovascular intervention. archives of surgery 138 (10):1127–1129. 24. macdiarmid s, mcintyre w, anthony a, bailey r, turner j, arnold e (2000) monitoring of renal function in patients with spinal cord injury. bju international 85 (9):1014–1018. 25. kumru h, kofler m (2012) effect of spinal cord injury and of intrathecal baclofen on brainstem reflexes. clinical neurophysiology 123 (1):45–53. 26. altinors n (2009) analysis of serum pro-inflammatory cytokine levels after rat spinal cord ischemia/reperfusion injury and correlation with tissue damage. turkish neurosurgery 19 (4):353–359. 27. mohamadi y, mousavi m, moogahi smhn, abolhassani f, ijaz s, hassanzadeh g (2018) effect of wharton’s jelly derived mesenchymal stem cells on the expression of nlrp3 receptor and neuroinflammation in experimental spinal cord injury. journal of clinical & diagnostic research 12 (10). 28. anthony dc, couch y (2014) the systemic response to cns injury. experimental neurology 258:105–111. 29. kesani ak, urquhart jc, bedard n, leelapattana p, siddiqi f, gurr kr, bailey cs (2014) systemic inflammatory response syndrome in patients with spinal cord injury: does its presence at admission affect patient outcomes? clinical article. journal of neurosurgery: spine 21 (2):296–302. 30. lerch jk, puga da, bloom o, popovich pg. glucocorticoids and macrophage migration inhibitory factor (mif) are neuroendocrine modulators of inflammation and neuropathic pain after spinal cord injury. in: seminars in immunology, 2014. vol 5. elsevier, pp. 409–414. 31. wu j, zhao z, sabirzhanov b, stoica ba, kumar a, luo t, skovira j, faden ai (2014) spinal cord injury causes brain inflammation associated with cognitive and affective changes: role of cell cycle pathways. journal of neuroscience 34 (33):10989–11006. 32. zendedel a, johann s, mehrabi s, joghataei m-t, hassanzadeh g, kipp m, beyer c (2016) activation and regulation of nlrp3 inflammasome by intrathecal application of sdf-1a in a spinal cord injury model. molecular neurobiology 53 (5):3063–3075. 33. kopp ma, druschel c, meisel c, liebscher t, prilipp e, watzlawick r, cinelli p, niedeggen a, schaser k-d, wanner ga (2013) the scientinel studyprospective multicenter study to define the spinal cord injury-induced immune depression syndrome (sci-ids)-study protocol and interim feasibility data. bmc neurology 13 (1):168. 34. schwab jm, zhang y, kopp ma, brommer b, popovich pg (2014) the paradox of chronic neuroinflammation, systemic immune suppression, autoimmunity after traumatic chronic spinal cord injury. experimental neurology 258:121–129. 35. riegger t, conrad s, liu k, schluesener hj, adibzahdeh m, schwab jm (2007) spinal cord injury‐induced immune depression syndrome (sci‐ids). european journal of neuroscience 25 (6):1743–1747. 270 j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 clinical complications of spinal cord injury review i. mohammed et al. 36. riegger t, conrad s, schluesener h, kaps h-p, badke a, baron c, gerstein j, dietz k, abdizahdeh m, schwab j (2009) immune depression syndrome following human spinal cord injury (sci): a pilot study. neuroscience 158 (3):1194–1199. 37. brommer b, engel o, kopp ma, watzlawick r, müller s, prüss h, chen y, devivo mj, finkenstaedt fw, dirnagl u (2016) spinal cord injury-induced immune deficiency syndrome enhances infection susceptibility dependent on lesion level. brain 139 (3):692–707. 38. failli v, kopp ma, gericke c, martus p, klingbeil s, brommer b, laginha i, chen y, devivo mj, dirnagl u (2012) functional neurological recovery after spinal cord injury is impaired in patients with infections. brain 135 (11):3238–3250. 39. wang l, yu w-b, tao l-y, xu q (2016) myeloid-derived suppressor cells mediate immune suppression in spinal cord injury. journal of neuroimmunology 290:96–102. 40. atkinson pp, atkinson jl spinal shock. in: mayo clinic proceedings, 1996. vol 4. elsevier, pp 384–389. 41. glenn m, bergman sb (1997) cardiovascular changes following spinal cord injury. topics in spinal cord injury rehabilitation 2 (4):47–53. 42. lehmann kg, lane jg, piepmeier jm, batsford wp (1987) cardiovascular abnormalities accompanying acute spinal cord injury in humans: incidence, time course and severity. journal of the american college of cardiology 10 (1):46–52. 43. furlan jc, fehlings mg, shannon p, norenberg md, krassioukov av (2003) descending vasomotor pathways in humans: correlation between axonal preservation and cardiovascular dysfunction after spinal cord injury. journal of neurotrauma 20 (12):1351–1363. 44. nacimiento w, noth j (1999) what, if anything, is spinal shock? archives of neurology 56 (8):1033–1035. 45. ditunno j, little j, tessler a, burns a (2004) spinal shock revisited: a fourphase model. spinal cord 42 (7):383–395. 46. mathias c (1992) investigation of autonomic disorders. autonomic faliure, a textbook of clinical disorders of the autonomic nervous system:255–290. 47. teasell rw, arnold jmo, krassioukov a, delaney ga (2000) cardiovascular consequences of loss of supraspinal control of the sympathetic nervous system after spinal cord injury. archives of physical medicine and rehabilitation 81 (4):506–516. 48. eltorai i, kim r, vulpe m, kasravi h, ho w (1992) fatal cerebral hemorrhage due to autonomic dysreflexia in a tetraplegic patient: case report and review. spinal cord 30 (5):355. 49. mathias cj (1995) orthostatic hypotension: causes, mechanisms, and influencing factors. neurology 45 (4 suppl 5):s6–s11. 50. cleophas tj, kauw fh, bijl c, meijers j, stapper g (1986) effects of beta adrenergic receptor agonists and antagonists in diabetics with symptoms of postural hypotension: a double-blind, placebo-controlled study. angiology 37 (11):855–862. 51. sclater a, alagiakrishnan k (2004) orthostatic hypotension. a primary care primer for assessment and treatment. geriatrics (basel, switzerland) 59 (8):22–27. 52. illman a, stiller k, williams m (2000) the prevalence of orthostatic hypotension during physiotherapy treatment in patients with an acute spinal cord injury. spinal cord 38 (12):741. 53. faghri pd, yount jp, pesce wj, seetharama s, votto jj (2001) circulatory hypokinesis and functional electric stimulation during standing in persons with spinal cord injury. archives of physical medicine and rehabilitation 82 (11):1587–1595. 54. ten harkel a, van lieshout j, wieling w (1994) effects of leg muscle pumping and tensing on orthostatic arterial pressure: a study in normal subjects and patients with autonomic failure. clinical science 87 (5):553–558. 55. alexander m, biering-sorensen f, bodner d, brackett n, cardenas d, charlifue s, creasey g, dietz v, ditunno j, donovan w (2009) international standards to document remaining autonomic function after spinal cord injury. spinal cord 47 (1):36–43. 56. phillips wt, kiratli bj, sarkarati m, weraarchakul g, myers j, franklin ba, parkash i, froelicher v (1998) effect of spinal cord injury on the heart and cardiovascular fitness. current problems in cardiology 23 (11):641–716. 57. karlsson a-k (2006) overview: autonomic dysfunction in spinal cord injury: clinical presentation of symptoms and signs. progress in brain research 152:1–8. 58. yaggie ja, niemi tj, buono mj (2002) adaptive sweat gland response after spinal cord injury. archives of physical medicine and rehabilitation 83 (6):802–805. 59. berney s, bragge p, granger c, opdam h, denehy l (2011) the acute respiratory management of cervical spinal cord injury in the first 6 weeks after injury: a systematic review. spinal cord 49 (1):17–29. 60. kirshblum sc, groah sl, mckinley wo, gittler ms, stiens sa (2002) 1. etiology, classification, and acute medical management. archives of physical medicine and rehabilitation 83:s50–s57. 61. jackson ab, groomes te (1994) incidence of respiratory complications following spinal cord injury. archives of physical medicine and rehabilitation 75 (3):270–275. 62. berlly m, shem k (2007) respiratory management during the first five days after spinal cord injury. taylor & francis, . 63. tollefsen e, fondenes o (2012) respiratory complications associated with spinal cord injury. tidsskrift for den norske laegeforening: tidsskrift for praktisk medicin, ny raekke 132 (9):1111–1114. 64. publico/thromboembolism%20in%20sci.pdf uha–gdo (1999) prevention of thromboembolism in spinal cord injury. consortium for spinal cord medicine:1–29. 65. ploumis a, ponnappan r, maltenfort m, patel r, bessey j, albert t, harrop j, fisher c, bono c, vaccaro a (2009) thromboprophylaxis in patients with acute spinal injuries: an evidence-based analysis. jbjs 91 (11):2568–2576. 66. merli g, crabbe s, paluzzi r, fritz d (1993) etiology, incidence, and prevention of deep vein thrombosis in acute spinal cord injury. archives of physical medicine and rehabilitation 74 (11):1199–1205. 67. lamb gc, tomski ma, kaufman j, maiman dj (1993) is chronic spinal cord injury associated with increased risk of venous thromboembolism? the journal of the american paraplegia society 16 (3):153–156. 68. wang w-g, xiu r-j, xu z-w, yin y-x, feng y, cao x-c, wang p-s (2015) protective effects of vitamin c against spinal cord injury-induced renal damage through suppression of nf-κb and proinflammatory cytokines. neurological sciences 36 (4):521–526. 69. shunmugavel a, khan m, hughes fm, purves jt, singh a, singh i (2015) s‐nitrosoglutathione protects the spinal bladder: novel therapeutic approach to post‐spinal cord injury bladder remodeling. neurourology and urodynamics 34 (6):519–526. 70. middleton jw, mann l, leong g (2008) management of spinal cord injury in general practice-part 1. australian family physician 37 (4):229. 71. burns as, rivas da, ditunno jf (2001) the management of neurogenic bladder and sexual dysfunction after spinal cord injury. spine 26 (24s):s129–s136. 72. burns as, ditunno jf (2001) establishing prognosis and maximizing functional outcomes after spinal cord injury: a review of current and future directions in rehabilitation management. spine 26 (24s):s137–s145. 73. nikmehr b, bazrafkan m, hassanzadeh g, shahverdi a, gilani mas, kiani s, mokhtari t, abolhassani f (2017) the correlation of gene expression of inflammasome indicators and impaired fertility in rat model of spinal cord injury: a time course study. urology journal 14 (6):5057–5063. 74. choobineh h, kazemi m, gilani mas, heydari t, shokri s, bazrafkan m, hassanzadeh g (2018) testosterone reduces spinal cord injury-induced effects on male reproduction by preventing cadm1 defect. cell journal (yakhteh) 20 (2):138. 75. bazrafkan m, nikmehr b, shahverdi a, hosseini sr, hassani f, poorhassan m, mokhtari t, abolhassani f, choobineh h, beyer c (2018) lipid peroxidation and its role in the expression of nlrp1a and nlrp3 genes in testicular tissue of male rats: a model of spinal cord injury. iranian biomedical journal 22 (3):151. 76. sánchez-ramos a, vargas-baquero e, martin-de francisco f, godino-durán j, rodriguez-carrión i, ortega-ortega m, mordillo-mateos l, coperchini f, rotondi m, oliviero a (2017) early spermatogenesis changes in traumatic complete spinal cord-injured adult patients. spinal cord 55 (6):sc2016184. 77. choobineh h, gilani mas, pasalar p, jahanzad i, ghorbani r, hassanzadeh g (2016) the effects of testosterone on oxidative stress markers in mice with spinal cord injuries. international journal of fertility & sterility 10 (1):87. 78. qin w, bauman wa, cardozo c (2010) bone and muscle loss after spinal cord injury: organ interactions. annals of the new york academy of sciences 1211 (1):66–84. 79. wu y, zhao j, zhao w, pan j, bauman wa, cardozo cp (2012) nandrolone normalizes determinants of muscle mass and fiber type after spinal cord injury. journal of neurotrauma 29 (8):1663–1675. 80. thakore np, samantaray s, park s, nozaki k, smith ja, cox a, krause j, banik nl (2016) molecular changes in sub-lesional muscle following acute phase of spinal cord injury. neurochemical research 41 (1–2):44–52. 81. yarar-fisher c, bickel cs, kelly na, stec mj, windham st, mclain ab, oster ra, bamman mm (2016) heightened tweak-nf-κb signaling and inflammation-associated fibrosis in paralyzed muscles of men with chronic spinal cord injury. american journal of physiology-endocrinology and metabolism 310 (9):e754–e761. 271j contemp med sci | vol. 7, no. 5, september–october 2021: 264–271 i. mohammed et al. review clinical complications of spinal cord injury 82. jackman rw, cornwell ew, wu cl, kandarian sc (2013) nuclear factor‐κb signalling and transcriptional regulation in skeletal muscle atrophy. experimental physiology 98 (1):19–24. 83. qin w, sun l, cao j, peng y, collier l, wu y, creasey g, li j, qin y, jarvis j (2013) the central nervous system (cns)-independent anti-bone-resorptive activity of muscle contraction and the underlying molecular and cellular signatures. journal of biological chemistry 288 (19):13511–13521. 84. coupaud s, mclean an, purcell m, fraser mh, allan db (2015) decreases in bone mineral density at cortical and trabecular sites in the tibia and femur during the first year of spinal cord injury. bone 74:69–75. 85. bauman wa, cardozo cp (2015) osteoporosis in individuals with spinal cord injury. pm&r 7 (2):188–201. 86. tan co, battaglino ra, morse lr (2013) spinal cord injury and osteoporosis: causes, mechanisms, and rehabilitation strategies. international journal of physical medicine & rehabilitation 1. 87. baum r, gravallese em (2014) impact of inflammation on the osteoblast in rheumatic diseases. current osteoporosis reports 12 (1):9–16. 88. sipski ml, estores im, alexander cj, guo x, chandralapaty s (2004) lack of justification for routine abdominal ultrasonography in patients with chronic spinal cord injury. journal of rehabilitation research and development 41 (1):101. 89. campbell sj, zahid i, losey p, law s, jiang y, bilgen m, van rooijen n, morsali d, davis ae, anthony dc (2008) liver kupffer cells control the magnitude of the inflammatory response in the injured brain and spinal cord. neuropharmacology 55 (5):780–787. 90. hundt h, fleming j, phillips j, lawendy a, gurr k, bailey s, sanders d, bihari r, gray d, parry n (2011) assessment of hepatic inflammation after spinal cord injury using intravital microscopy. injury 42 (7):691–696. 91. fleming jc, bailey cs, hundt h, gurr kr, bailey si, cepinskas g, lawendy a-r, badhwar a (2012) remote inflammatory response in liver is dependent on the segmental level of spinal cord injury. journal of trauma and acute care surgery 72 (5):1194–1201. 92. sauerbeck ad, laws jl, bandaru vv, popovich pg, haughey nj, mctigue dm (2015) spinal cord injury causes chronic liver pathology in rats. journal of neurotrauma 32 (3):159–169. 93. guo l, rolfe aj, wang x, tai w, cheng z, cao k, chen x, xu y, sun d, li j (2016) rescuing macrophage normal function in spinal cord injury with embryonic stem cell conditioned media. molecular brain 9 (1):48. 94. lucin km, sanders vm, jones tb, malarkey wb, popovich pg (2007) impaired antibody synthesis after spinal cord injury is level dependent and is due to sympathetic nervous system dysregulation. experimental neurology 207 (1):75–84. 95. zhang y, guan z, reader b, shawler t, mandrekar-colucci s, huang k, weil z, bratasz a, wells j, powell nd (2013) autonomic dysreflexia causes chronic immune suppression after spinal cord injury. journal of neuroscience 33 (32):12970–12981. 96. zha j, smith a, andreansky s, bracchi-ricard v, bethea jr (2014) chronic thoracic spinal cord injury impairs cd8+ t-cell function by up-regulating programmed cell death-1 expression. journal of neuroinflammation 11 (1):65. 97. zong s, zeng g, fang y, peng j, tao y, li k, zhao j (2014) the role of il-17 promotes spinal cord neuroinflammation via activation of the transcription factor stat3 after spinal cord injury in the rat. mediators of inflammation 2014. 98. han tr, kim jh, kwon bs (1998) chronic gastrointestinal problems and bowel dysfunction in patients with spinal cord injury. spinal cord 36 (7): 485–490. 99. liu c-w, huang c-c, yang y-h, chen s-c, weng m-c, huang m-h (2009) relationship between neurogenic bowel dysfunction and health-related quality of life in persons with spinal cord injury. journal of rehabilitation medicine 41 (1):35–40. 100. correa g, rotter k (2000) clinical evaluation and management of neurogenic bowel after spinal cord injury. spinal cord 38 (5):301. 101. stiens sa, bergman sb, goetz ll (1997) neurogenic bowel dysfunction after spinal cord injury: clinical evaluation and rehabilitative management. archives of physical medicine and rehabilitation 78 (3):s86–s102. 102. fajardo nr, pasiliao r-v, modeste-duncan r, creasey g, bauman wa, korsten ma (2003) decreased colonic motility in persons with chronic spinal cord injury. the american journal of gastroenterology 98 (1): 128–134. 103. han sj, kim cm, lee je, lee th (2009) colonoscopic lesions in patients with spinal cord injury. the journal of spinal cord medicine 32 (4):404–407 104. guo j, zhu y, yang y, wang x, chen b, zhang w, xie b, zhu z, yue y, cheng j (2016) electroacupuncture at zusanli (st36) ameliorates colonic neuronal nitric oxide synthase upregulation in rats with neurogenic bowel dysfunction following spinal cord injury. spinal cord this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v7i5.1106 18 j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 review epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review rawan s. abou-assy1, magda m. aly1,3*, reda h. amashah1, samyah d. jastaniah1, hany m. al deen2 1department of biology, college of science, king abdulaziz university, jeddah, saudi arabia. 2department of microbiology, king faisal medical complex, taif, makkah, saudi arabia. 3department of botany and microbiology, faculty of science, kafrelsheikh university, kafrelsheikh govvernorate, egypt. *correspondence to: (email: mmmohammad@kau.edu.sa) (submitted: 10 december 2021 – revised version received: 26 december 2021 – accepted: 17 january 2022 – published online: 26 february 2022) abstract the widespread of multidrug-resistant bacteria, particularly carbapenem-resistant enterobacterales (cre) bacteria, constitutes a major public health threat worldwide, owing to the limited therapeutic options. this review will describe and uncover the saudi experience in the challenge against carbapenem resistance (cr). the different carbapenem resistance prevalence and carbapenemase genes detected from various bacterial species were mapped for saudi regional distribution, based on saudi published data during a period extended from 2017 to 2021. however, vim, imp, and kpc enzymes were usually reported with the predominance of oxa and ndm among enterobacterales. although sim and gim carbapenemases were uncommonly detected in our country. collaborative efforts and raising awareness of the threat of carbapenem resistance are required to minimize the spread of multidrug-resistant bacteria. keywords: carbapenem, enterobacteriaceae, saudi arabia, lactamase, resistant, carbapenemase issn 2413-0516 introduction carbapenem resistance (cr) bacteria is a significant and mounting health concern globally,1,2 this problem is aggravated by inadequate infection control in developing countries due to poor hygiene, resource and structural constraints, deficient surveillance data, and lack of awareness regarding nosocomial infections.3,4 it occurs mainly among gram-negative pathogens such as klebsiella pneumoniae, pseudomonas aeruginosa and acinetobacter baumannii, and may be intrinsic or mediated by transferable carbapenemase-encoding genes,5,6 the most effective carbapenemases, in terms of carbapenem hydrolysis and globally spread, are kpc, vim, imp, ndm and oxa-48 genotypes.7 carbapenem class antibiotics have been a mainstay of treatment for serious infections caused by enterobacterales, but efficacy has been compromised by the widespread acquisition of resistance genes to these critical drugs.8 effective antimicrobial options for carbapenem-resistant enterobacterales (cre) are often lacking, and treatment typically requires reliance on drugs with a risk of toxicity or other safety concerns.9 carbapenem-resistant klebsiella pneumoniae (crkp) is a prominent cause of nosocomial infections associated with high rates of morbidity and mortality, particularly in immune-compromised individuals.10,11 carbapenem resistance causes a broad spectrum of diseases including pneumonia, urinary tract infections, bloodstream infections, skin, and soft tissue infections.12 this resistance is facilitated by complex factors, including the presence of mobile genetic elements, the misuse of antimicrobial drugs, poor infection control practices, and increased international travel.13 in healthcare settings, cre is transmitted from person to person, often via the hands of healthcare personnel or through contaminated medical equipment.14 additionally, sink drains and toilets are increasingly recognized as an environmental reservoir and cre transmission source.15 risk factors for cre colonization and infection have been identified as longer length of hospital stay, prior hospitalization, admission to icu, renal dysfunction, neurological disorders, tracheostomy, mechanical ventilation, central venous catheter (cvc) use, urinary catheter use, nasogastric tube use, implementation of dialysis, prior use of any antibiotic, and specific use of carbapenems.16–18 the aim of this review was to shed light on all studies tackling carbapenem resistance in enterobacteriaceae, carbapenem resistance a. baumannii (crab) and carbapenem resistance p. aeruginosa (crpa) in the saudi arabia regions, with an indication for each region, description of studies timeline, the prevalence of carbapenem resistance, and cr encoding genes detected based on saudi data published over last 5 years from 2017 to 2021. this study enabled us to gain deep insight into the cr problem in saudi arabia, in addition to mapping the regional distribution of carbapenemase enzymes and cr prevalence for each region, which is strongly encouraged by epidemiologists to improve surveillance strategies to minimize the spread of cr gram negative bacteria such as previously described. methods literature review pubmed, sciencedirect and international journals online databases were searched to december 2021. the search key words used were carbapenem resistance in saudi arabia, enterobacteriaceae, cre, escherichia coli, crec, klebsiella, crkp, pseudomonas aeruginosa, crpa, acinetobacter baumannii, crab, carbapenem, -lactam, -lactamase, resistant, carbapenemase, mbl, metallo-b-lactamase, vim, ndm, oxa, oxacillinase, imp, kpc to extract articles published only in english in an attempt to include up to date relevant data. study selection criteria only research articles reporting the prevalence or molecular genotyping frequency of carbapenem resistance in clinical pathogens isolated from patients and hospital environment or 19j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 r.s. abou-assy et al. review epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review showed the proportion of carbapenem resistant isolates of all gram-negative isolates, or clinical data including patient demographics, underlying conditions, and antibiotic treatment in all saudi arabia regions. only studies elaborating bacteria study population, pathogens identified, phenotypic and genotypic methods used to detect carbapenem resistance were used. patient populations of all hospital types were included while case reports and review articles were excluded from this systematic review as it has become conventional.19,20 data extraction a database was created in which study location, sample collection period, bacterial species isolated, a number of isolates tested for cr, cr isolates, cr prevalence, esbl & carbapenemase genes, methods used to identify resistant isolates, references, and outcomes were included. results the emergence and rapid spread of carbapenem-resistant enterobacterales in saudi arabia encouraged scientific researchers and epidemiologists to investigate cr hospital associated infection prevalence and the genes involved in resistance to carbapenems. as described in figure 1a the number of published articles per year was clearly increased and indicated by the highest number recorded in 2021. this is closely related to the dissemination of cre throughout the country and the increased awareness of the importance of surveillance and control of multidrug-resistant bacteria in order to improve health quality. a high prevalence of carbapenemase producers in saudi arabia was mainly identified as a. baumannii, followed by pseudomonas aeruginosa, and klebsiella pneumonia.21–26 the majority number of published research papers per carbapenemase type was oxa, from all genotyping studies, oxa-48 variant in enterobacteriaceae and oxa-23 variant in a. baumannii, and p. aeruginosa, followed by ndm-1 (all the collected studies except two.27,28 however, low number of published articles (8 studies) has reported the detection of vim genes.22,24,28–33 detection of vim genes was reported in 5 studies while imp was reported by el-badawy, abdelwahab et al. 2019, shah, yasir et al. 2019, jawhar, alrashed et al. 2020, khater, alfaki et al. 2020, alqahtani, tickler et al. 2021)30,31,28,34,24 and kpc genes was reported in 5 studies21,24,27,34,35 as described in figure 1b. furthermore, until now no studies reported the presence of sim and gim genes in the collected bacterial isolates from saudi arabia. saudi arabia is divided into 13 administrative regions, and geographically these regions are distributed in five major areas of the country (central, eastern, northern, southern and western areas). most of the studies about cre were conducted in the central, and western areas and small data came from the eastern, southern, and northern areas. the results according to the literature search and study selection indicate that a total of 24 studies met the inclusion criteria and were included for final review, of these 3 (12.5%) reported extended studies for more than three regions or shared with other countries, 8 (33.3%) reported from the central area, 7 (29%) reported from the western area, 2 (8.3%) reported from the eastern area, 3 (12.5%) reported from the south area, and one (4.2%) reported from north area (figure 1c). there was no data reported from fig. 1 (a) number of published papers reporting cre bacteria in saudi arabia from 2017 to 2021, (b) number of published papers per carbapenemase genes in saudi arabia from 2017 to 2021, and (c) number of published papers per saudi regions from 2017 to 2021. a b c najran, tabuk and north border regions. also, 18 studies (75%) reported genotype including carbapenemase or β-lactamase genes distribution and 16 studies (66.7%) reported clinical cr surveillance data. two studies reported systematic reviews of cr from saudi arabia13,36 and three studies reported cr cases37–39 (excluded from this study). the regional distribution of the different carbapenemases gene prevalence were mapped in saudi arabia from five years up to date (figure 2), and regional distribution cr prevalence in enterobacterales over several saudi regions were mapped (figure 3). extended studies from all saudi arabia there is a wide modern study to determine the prevalence of carbapenem resistance gram-negative genes in gulf cooperation council hospitals including saudi arabia (table 1).24 the results indicate the rates of carbapenem resistance genes varied across the gcc hospitals and even among hospitals in the same country and this result was confirmed by the study of al-abdely et al. (2021)40 which explained the circulating strain causing outbreaks in this specific region. in 20 j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review review r.s. abou-assy et al. fig. 2 percentage of epidemiology of carbapenem resistance enterobacterales in saudi arabia regions.21,23–26 cre, carbapenem resistance enterobacterales; cse, carbapenem sensitive enterobacterales. fig. 3 molecular classification of carbapenem resistance k. pneumoniae genes distribution over saudi arabia regions.21,24,29,32,40 table 1. participating cities, cr prevalence and molecular classification of cr isolates in (alqahtani, tickler et al. 2021)24 study city number of isolates cr isolates cr prevalence (%) carbapenemase genes detected dammam 266 49 18.4% oxa-48 (14.3%), ndm (4.1%) khamis mushait 250 50 20.0% oxa-48 (14.0%), ndm; oxa-48 (6.0%) riyadh 73 49 67.3% oxa-48 (51.0%), ndm (2.0%) ndm; oxa-48 (6.1%) vim; oxa-48 (2.0%), vim (6.1%) 21j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 r.s. abou-assy et al. review epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review table 2. participating hospitals, carbapenem resistance prevalence and molecular classification of 456 isolates of k. pneumoniae in (al-abdely, alhababi et al. 2021)40 study saudi hospital name crkp prevalence carbapenemase genes detected 1. king salman bin abdulaziz hospital, riyadh 96% ndm-1 (11%), oxa48 (89%) 2. king khalid hospital and prince sultan center for health service, al kharj 53% ndm-1 (33%), oxa48 (67%) 3. king fahd specialist hospital, buraydah 90% ndm-1 (22%), oxa48 (44%), ndm-1 +oxa48 (33%) 4. regional laboratory and blood bank, microbiology department, dammam 100% oxa48 (100%) 5. gurayat general hospital 96% ndm-1 (32%), oxa48 (50%), ndm-1 +oxa48 (18%) 6. hael general hospital 83% oxa48 (100%) 7. arar central hospital 100% ndm-1 (33%), oxa48 (67%) 8. asir hospital 93% ndm-1 (25%), oxa48 (71%), ndm-1 +oxa48 (4%) 9. king fahd hospital, al baha 100% oxa48 (83%), ndm-1 +oxa48 (17%) 10. king faisal medical complex, taif 80% ndm-1 (17%), oxa48 (67%), ndm-1 +oxa48 (17%) 11. king abdulaziz specialist hospital, taif 100% ndm-1 (13%), oxa48 (88%) 12. king fahad hospital, madina munawara 84% ndm-1 (16%), oxa48 (70%), ndm-1 +oxa48 (4%) 13. hera general hospital, jeddah 80% ndm-1 (25%), oxa48 (35%), ndm-1 +oxa48 (50%) table 3. review of carbapenem resistance studies which include more than 3 regions in saudi arabia regions number of isolates cr prevalence (%) carbapenemase genes detected organism methods used refs. gulf cooperation council 529 of rectal swabs 26.1% one gene; oxa-48 (59.4%), ndm (13.8%), vim (6.5%) & imp (0.7%) two genes; oxa-48 & ndm (8.7%), oxa-48 & vim (6.5%), ndm & kpc (1.5%) & oxa-48 & kpc (0.7%) – xpertcarba-r assay alqahtani et al. ( 2021)24 five regions include central, north, east, south & west 519 of enterobacterales 84.7% oxa-48 (71.2%), ndm-1 (20.7%) & ndm+oxa-48 (8%). k. pneumoniae (90%), k. oxytoca (0.5%), e. coli (4%), e. cloacae (2.5%) & others e-test xpertcarba-r assay al-abdely et al. (2021)40 five hospitals in the east, west and center regions 635 of p. aeruginosa 28.2% for imipenem 23.0% for meropenem 18.7% for meropenem & imipenem carbapenemase genes; ges (9%), vim (3.4%), ndm (6%) & oxa48 (0.5%) esbl genes; per (1.1%) & veb (1.1%) carbapenemase and esbl genes; vim + per (1.1%), vim + veb (0.5%) p. aeruginosa vitek-ii pcr al hassinah et al. (2020)22 addition to the other two studies, table 2 illustrated the presence of carbapenem resistance genes in enterobacteriaceae and p. aeruginosa isolates in more than 3 regions in saudi arabia (table 3).22,40 epidemiology of central area in the last five years, there are eight published studies related to clinical cr infection from a central area (table 4), six of them detect the carbapenemase genes distribution among specific hospitals,28,34,35,41–43 other three studies give a prevalence rated to cr dissemination,34,35,44 two studies focus on crkp,34,43 and one study detect crg in p. aeruginosa and a. baumannii.28 epidemiology of western area the western area includes the makkah region that had two largest cities (makkah and jeddah) with the highest population outside the central region. millions of muslims from across the globe arrive annually in makkah to perform pilgrimage and umrah. these mass gatherings could be a good environment for spreading multi-drug resistant organisms around the world.13,45 there were seven studies published in the last five years from the western region of saudi arabia, three of them from makkah city,21,33,46 two studies from jeddah city,27,31 one study from taif 30 and one study from al-madinah.47 five of these studies detect the carbapenemase genes dissemination ratios and four studies give a cr surveillances,47 and one study focus on crkp33 while two studies detect the crg genes in p. aeruginosa crpa. other studies focus on crab30,31 while carbapenem resistance klebsiella quasipneumoniae in jeddah was described by hala et al. (2019).27 epidemiology of eastern area there were two genotypic studies published recently from the western region of saudi arabia.32,48 the first one aimed to assess different genotypic and phenotypic methods to detect carbapenemases; however, each has a limitation, talal (2019)32 study evaluated the performance of modified carbapenem inactivation method (mcim) test in enterobacteriaceae in 22 j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review review r.s. abou-assy et al. ta bl e 4. r ev ie w o f c ar ba pe ne m re si st an ce st ud ie s i n ce nt ra l, w es te rn , e as te rn , n or th er n an d so ut he rn a re as o f s au di a ra bi a ar ea (c ity ) nu m be r o f is ol at es cr p re va le nc e (% ) ca rb ap en em as e ge ne s or ga ni sm m et ho ds u se d re fs . 1. r iy ad h & q as si m 16 2, 66 5 23 .2 % – en te ro ba ct er al es (1 4% ), e. c ol i ( 6. 4% ), k. p ne um on ia e (9 .6 % ), a. b au m an ii (1 9. 5% ) & p. a er ug in os a (1 9. 2% ) vi te kii bd p ho en ix m ic ro sc an p lu s m ut ai r e t a l. (2 02 1) 44 2. r iy ad h 1, 86 4 7. 6% es bl (5 3. 3% ), kp c (1 1. 5% ), o xa -4 8 (1 .3 % ) & n d m (0 .6 7% ) – vi te kii xp er tc ar ba r a ss ay a le id an e t a l. (2 02 1) 35 3. r iy ad h – – p. ae ru gi no sa ; o xa -2 3 (5 5% ), o xa 4 0 (5 % ), o xa 1 0 (7 .5 % ), o xa 4 8 (3 .7 5% ), im p (1 .2 5% ), vi m (4 6% ), o xa -1 (2 2% ) & g im (1 5% ) a. b au m an ni i; o xa -2 3 (8 5. 7% ), o xa 4 0 (1 7% ), vi m (1 1. 4% ), im p (1 7% ), g im (2 .8 % ), o xa -1 (2 .8 % ) & o xa -4 8 (2 .8 % ) p. ae ru gi no sa (8 0 is ol at es ) a. b au m an ni i ( 35 is ol at es ) ete st vi te kii pc r ja w ha r e t a l. (2 02 0) 28 4. a l-q uw ay iy ah 54 1 al l s am pl es 78 o f k. p ne um on ia e 6. 7% fo r a ll sa m pl es 46 .2 % fo r k. p ne um on ia e o xa -4 8 (7 7. 8% ), n d m (1 3. 9% ), kp c (5 .6 % ), im p (2 .8 % ), & o xa -4 8 & n d m (1 3. 9% ) k. p ne um on ia e vi te kii d 70 c m h t pc r kh at er e t a l. (2 02 0) 34 5. r iy ad h – – – k. p ne um on ia (4 7% ), e. c ol i ( 31 % ), en te ro ba ct er sp . ( 5. 3% ), ci tro ba ct er sp . (5 .3 % ), kl uy ve ra as co rb at a (5 .3 % ), & pr ot eu s ( 5. 3% ) – a lz om or e t a l. (2 01 9) 50 6. r iy ad h – – ch ro m os om al ; c tx -m -1 5 (9 0% ), n d m -1 (2 0% ), n d m -5 (4 0% ), & o xa -1 81 (4 0% ) pl as m id ; c tx -m -1 5 (1 00 % ), n d m -1 (2 0% ), n d m -5 (3 0% ), c tx -m -1 7 (1 0% ), te m -1 8 (9 0% ), o xa -1 (4 0% ), o xa -1 81 (4 0% ), & c m v42 (8 0% ) e. c ol i m ic ro br ot h di lu tio n m et ho d pc r w g s a bd e l g ha ny e t a l. (2 01 8) 41 7. r iy ad h – – o xa -4 8 (5 8. 1% ) n d m (4 1. 9% ) c tx -m -1 (7 7. 4% ) c tx -m -9 (9 .6 % ) t em -1 (7 4. 2% ) o xa -1 (5 4. 8% ) s h v1 (4 .4 % ) k. p ne um on ia e (2 1 is ol at es ), & e . c ol i ( 10 is ol at es ) ete st im ip en em + e d ta st rip m h t pc r a l-a ga m y e t a l. (2 01 8) 42 8. r iy ad h – – o xa -4 8 (6 7. 6% ), n d m -1 (1 2. 7% ), c tx -m -1 5 (6 6. 2% ), & c tx -m -1 4 (2 1% ) k. p ne um on ia e ete st vi te kii pc r (u z za m an , a lro da yy an et a l. 20 18 )43 9. m ak ka h – – vi m (3 1% ), & g es (8 .6 % ) ps eu do m on as a er ug in os a pc r m ls t (a l-z ah ra ni , i br ah im et a l. 20 21 )33 10 . m ed in a 15 ,7 08 38 .4 % fo r im ip en em 46 .1 % fo r m er op en em – k. p ne um on ia e vi te kii a l-z al ab an i et a l. (2 02 0) 47 (c on tin ue d) 23j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 r.s. abou-assy et al. review epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review ta bl e 4. r ev ie w o f c ar ba pe ne m re si st an ce st ud ie s i n ce nt ra l, w es te rn , e as te rn , n or th er n an d so ut he rn a re as o f s au di a ra bi a ar ea (c ity ) nu m be r o f is ol at es cr p re va le nc e (% ) ca rb ap en em as e ge ne s or ga ni sm m et ho ds u se d re fs . 11 . j ed da h 28 6 of k le bs ie lla sp p – kp c2 kl eb sie lla sp p. vi te kii br ot h m icr od ilu tio n pc r w g s h al a et a l. (2 01 9) 27 12 . t ai f 45 o f a ci ne to ba ct er sp p. 71 % o xa -5 1 (1 00 % ), im p (8 7. 5% ), n d m (6 2. 5% ), o xa -2 3 (5 9. 4% ), vi m (9 .3 % ), & o xa -4 0 (3 .1 % ) a. b au m an ni i vi te kii d is k di ffu si on er ic -p cr e l-b ad aw y et a l. (2 01 9) 30 13 . j ed da h 13 5 of a. b au m an ni i 55 .6 % o xa -5 1 (1 00 % ), o xa -2 3 (9 2% ), im p (8 4% ), n d m -1 (1 .3 % ), o xa -2 4/ 40 (5 .3 % ), vi m (9 2% ), te m (8 4% ), & s h v (1 0. 7% ) a. b au m an ni i vi te kii pc r sh ah e t a l. (2 01 9) 31 14 . m ak ka h 86 4 a ll sa m pl es 12 0 of e nt er oba ct er ia ce ae 21 .7 % o xa -4 8 (1 00 % ), n d m -1 (8 4. 7% ), & k pc (7 3. 1% ) k. p ne um on ia e (8 0. 7% ) e. c lo ac ae (7 .7 % ) e . c ol i ( 7. 7% ) p. m ira bi lis (3 .8 % ) vi te kii d is k pc r k ha n et a l. (2 01 9) 21 15 . m ak ka h 4, 80 3 of g ra m ne ga tiv e ba ci lli 58 .2 3% a. b au m an ni i ( 99 .1 3% ) p. ae ru gi no sa (6 2. 4% ) k. p ne um on ia (3 8% ) e. c ol i ( 5. 59 % ) vi te kii fa id ah e t a l. (2 01 7) 46 16 . m ak ka h – – vi m (3 1% ), & g es (8 .6 % ) ps eu do m on as a er ug in os a m ul tip le x pc r m ls t a l-z ah ra ni e t a l. (2 02 1) 33 17 . a l q at if 75 3 of p at ie nt s 20 8 of c lin ic al su rf ac es 2. 8% o f p at ie nt s 36 % o f c lin ic al su rf ac es o xa -6 6/ o xa -2 3 /a rm a (3 7% ), o xa -6 9/ o xa -2 3/ g es -1 1 (4 .2 % ), o xa -9 4/ n d m -1 (2 .1 % ), o xa -6 6/ o xa -2 3 (9 .5 % ), & o xa -5 1/ o xa -2 3 (1 % ) a. b au m an ni i bd p ho en ix pc r w g s a l-h am ad e t a l. (2 02 0) 48 18 . d am m am – – o xa -4 8 (d om in an t) , n d m (s ec on d cr e ge ne d is se m in atio n) , & v im (l ow p re va le nc e) – m ci m pc r ta la l ( 20 19 )32 19 . a l-j ou f 61 7 of e nt er oba ct er al es 32 % – k. p ne um on ia e (6 3% ), p. m ira bi lis (2 9% ), & e . c ol i ( 8% ) bd p ho en ix b an dy a nd ta nt ry (2 02 1) 25 20 . j iz an 50 10 % fo r i m ip en em 12 % fo r m er op ene m c tx -m (7 0% ), sh v (1 6% ), te m (1 2% ), & n d m -1 (0 % ). e. c ol i ( 50 % ), k. p ne um on ia e (4 0% ), a. b au m an ii (4 % ), p. ae ru gi no sa (4 % ), & e. c lo ac ae (2 % ) cd t vi te kii pc r s ob ia e t a l. (2 02 1) 26 21 . a bh a 27 6 of k . p ne um on ia e 61 .7 % fo r m er op en em 44 .5 % fo r im ip en em – k. p ne um on ia e vi te kii a l b sh ab sh e e t a l. (2 02 0) 49 22 . a bh a 54 o f k . p ne um on ia e 63 % fo r i m ip en em 57 .4 % fo r m er op ene m o xa -4 8 (8 1. 5% ), n d m (7 .4 % ), & v im (1 .8 % ) k. p ne um on ia e vi te kii ete st pc r a l-z ah ra ni a nd a la si ri (2 01 8) 29 d 70 c, ca rb ap en em as e d et ec tio n se t; m h t, m od ifi ed h od ge te st ; u ti , u rin ar y tr ac t i nf ec tio n; m ls t, m ul ti lo cu s se qu en ci ng t yp es ; w g s, w ho le g en om e se qu en ci ng ; m ci m , m od ifi ed c ar ba pe ne m in ac tiv at io n m et ho d. 24 j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review review r.s. abou-assy et al. reference to molecular methods. their obtained results confirm that mcim test is a simple tool for the reliable confirmation of carbapenemase activity with 97.3% sensitivity in enterobacteriaceae, especially in clinical microbiological laboratories with limited resources.32 the second study isolated environmental and clinical crab to assess the potential environmental contamination by this pathogen from frequenthand-touch surfaces of intensive care unit (icu), medical, and surgical units were randomly sampled for a month-long period, and the crab identified were compared to clinical isolates of the same period.48 epidemiology of northern area data regarding the cr patterns of enterobacterales in the northern regions are scarce, there was one surveillance non-genotypic report from al-jouf. bandy and tantry (2021) analyzed the antibiograms of enterobacterales identified from january 2019 to december 2019.25 in total, 617 enterobacterales were identified. k. pneumoniae exhibited 62.5%, 62%, and 58.3% resistance towards ertapenem, imipenem, and meropenem, respectively. in e. coli and k. pneumoniae, seasonal variation in the antimicrobial resistance rate was observed for imipenem and meropenem and the resistance were significantly higher in winter. furthermore, the k. pneumoniae meropenem resistance rate was significantly higher in samples received from intensive care units than from other units.25 epidemiology of southern area in the last five years, there were just three studies from southern regions, saudi arabia. two of them from abha city.29,49 the earlier study aims to identify the prevalence of crkp and the most common types of cabapenemases between late april and september in 2015.29 the results of this study indicate that increasing age and intensive care unit admission were associated with crkp isolation, the major type of carbapenemases in the southern region was oxa-48 with 81.5% and it seems to reach an endemic level, ndm was the second most frequent carbapenemase by 7.4% of isolates, this study refers oxa-48 and ndm carbapenem resistance strains dissemination in saudi arabia to receives large numbers of visitors and migrant workers from oxa-48 and ndm endemic countries such as turkey, india, and pakistan every year.29 the third studies aimed to examine k. pneumoniae infections in the icu of aseer central hospital and to determine their antimicrobial susceptibility and their relationship to patients’ clinical outcomes from patients with various infections.49 conclusion carbapenem-resistant enterobacterials (cre) is a growing threat and serious health concern spreading in saudi arabia and worldwide. this dilemma has been documented in many parts of the country and may challenge local health authorities. however, data is still scarce in certain local areas as well as in the eastern, northern border, tabuk, and najran regions. oxa-48 β-lactamase and ndm-1 β-lactamase are a prevalent gene responsible in cr strains in saudi arabia. the high rates of resistant enterobacterials in saudi arabia call for comprehensive surveillance programs to understand the origins and extent of the cr problem in depth as a major step to controlling the menace, developing a local antibiogram database coupled with nationwide antimicrobial stewardship and an infection prevention program might help in improving the knowledge of cr patterns. multiple complex risk factors associated with cr infection to the hospital environment, patient comorbidities, duration of hospital admission, icu complexity, intercurrent illness and the usage of antimicrobial agents contribute to the spread of cr infection. the findings of risk factors associated with cr infection may help clinicians and hospital epidemiologists estimate the likelihood of cr infection in different situations, and thereby initiate timely, targeted treatment and prevention measures. colistin, tigecycline, and a combination of carbapenem containing regimens are the mainstay of the current treatment options. however, new antimicrobials such as avibactam, plazomicin, or siderophore cephalosporins are promising and the research efforts should be focused on the molecular basis of cr and discovering new therapies.  references 1. codjoe, f. s. and e. s. donkor (2018). “carbapenem resistance: a review.” medical sciences 6(1): 1. 2. aslam, b., m. rasool, s. muzammil, a. b. siddique, z. nawaz, m. shafique, m. a. zahoor, r. binyamin, m. waseem and m. khurshid (2020). “carbapenem resistance: mechanisms and drivers of global menace.” pathog. bact. 3. pittet, d., b. allegranzi, j. storr, s. b. nejad, g. dziekan, a. leotsakos and l. donaldson (2008). “infection control as a major world health organization priority for developing countries.” journal of hospital infection 68(4): 285–292. 4. islam, t. a. b., s. shamsuzzaman, n. nehar and j. fardows (2016). “prevalence and antibiogram of microbial agents causing nosocomial urinary tract infection in surgical ward of dhaka medical college hospital.” journal of enam medical college 6(2): 75–79. 5. meletis, g. (2016). “carbapenem resistance: overview of the problem and future perspectives.” therapeutic advances in infectious disease 3(1):15–21. 6. aruhomukama, d., c. f. najjuka, h. kajumbula, m. okee, g. mboowa, i. sserwadda, r. mayanja, m. l. joloba and d. p. kateete (2019). “bla vimand bla oxa-mediated carbapenem resistance among acinetobacter baumannii and pseudomonas aeruginosa isolates from the mulago hospital intensive care unit in kampala, uganda.” bmc infectious diseases 19(1):1–8. 7. dortet, l., g. cuzon, v. ponties and p. nordmann (2017). “trends in carbapenemase-producing enterobacteriaceae, france, 2012 to 2014.” eurosurveillance 22(6): 30461. 8. de oliveira, d. m., b. m. forde, t. j. kidd, p. n. harris, m. a. schembri, s. a. beatson, d. l. paterson and m. j. walker (2020). “antimicrobial resistance in eskape pathogens.” clinical microbiology reviews 33(3):e00181-00119. 9. pouch, s. m. and m. j. satlin (2017). “carbapenem-resistant enterobacteriaceae in special populations: solid organ transplant recipients, stem cell transplant recipients, and patients with hematologic malignancies.” virulence 8(4): 391–402. 10. di domenico, e. g., i. cavallo, f. sivori, f. marchesi, g. prignano, f. pimpinelli, i. sperduti, l. pelagalli, f. di salvo and i. celesti (2020). “biofilm production by carbapenem-resistant klebsiella pneumoniae significantly increases the risk of death in oncological patients.” frontiers in cellular and infection microbiology 10. 11. sundaramoorthy, n. s., s. thothathri, m. bhaskaran, a. ganeshprasad and s. nagarajan (2021). “phages from ganges river curtail in vitro biofilms and planktonic growth of drug resistant klebsiella pneumoniae in a zebrafish infection model.” amb express 11(1):1–11. 12. di domenico, e. g., i. cavallo, f. sivori, f. marchesi, g. prignano, f. pimpinelli, i. sperduti, l. pelagalli, f. di salvo and i. celesti (2021). “biofilm production 25j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 r.s. abou-assy et al. review epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review by carbapenem.” enterobacteriaceae antimicrobial agents and resistance: relationship with the therapeutic approach. 13. ibrahim, m. e. (2019). “prevalence of acinetobacter baumannii in saudi arabia: risk factors, antimicrobial resistance patterns and mechanisms of carbapenem resistance.” annals of clinical microbiology and antimicrobials 18(1):1–12. 14. weber, d. j., e. e. sickbert-bennett, h. kanamori and w. a. rutala (2019). “new and emerging infectious diseases (ebola, middle eastern respiratory syndrome coronavirus, carbapenem-resistant enterobacteriaceae, candida auris): focus on environmental survival and germicide susceptibility.” american journal of infection control 47:a29–a38. 15. julia, l., k. vilankar, h. kang, d. e. brown, a. mathers and l. e. barnes (2017). environmental reservoirs of nosocomial infection: imputation methods for linking clinical and environmental microbiological data to understand infection transmission. amia annual symposium proceedings, american medical informatics association. 16. mills, j. p., n. j. talati, k. alby and j. h. han (2016). “the epidemiology of carbapenem-resistant klebsiella pneumoniae colonization and infection among long-term acute care hospital residents.” infection control & hospital epidemiology 37(1):55–60. 17. zhu, w., z. yuan and h.-y. zhou (2020). “risk factors for carbapenemresistant klebsiella pneumoniae infection relative to two types of control patients: a systematic review and meta-analysis.” antimicrobial resistance & infection control 9(1):1–13. 18. barber, k. e., j. l. wagner, r. c. larry and k. r. stover (2021). “frequency of and risk factors for carbapenem-resistant enterobacteriaceae.” journal of medical microbiology 70(2). 19. morgan, d. j., i. n. okeke, r. laxminarayan, e. n. perencevich and s. weisenberg (2011). “non-prescription antimicrobial use worldwide: a systematic review.” the lancet infectious diseases 11(9):692–701. 20. ssekatawa, k., d. k. byarugaba, e. wampande and f. ejobi (2018). “a systematic review: the current status of carbapenem resistance in east africa.” bmc research notes 11(1):1–9. 21. khan, m. a., a. m. mohamed, a. faiz and j. ahmad (2019). “enterobacterial infection in saudi arabia: first record of klebsiella pneumoniae with triple carbapenemase genes resistance.” the journal of infection in developing countries 13(04):334–341. 22. al hassinah, s., m. alzayer, l. okdah, m. doumith, s. al johani, r. alarfaj, e. alrashidi, n. alhuseinan, b. a. alwan and b. bakhashween (2020). “prevalence of molecular mechanisms of carbapenem resistance in pseudomonas aeruginosa clinical isolates from saudi arabia.” journal of infection and public health 13(2):329. 23. al mutair, a., s. alhumaid, z. al alawi, a. r. z. zaidi, a. j. alzahrani, j. a. al-tawfiq, h. al-shammari, a. a. rabaan, o. khojah and a. al-omari (2021). “five-year resistance trends in pathogens causing healthcare-associated infections at a multi-hospital healthcare system in saudi arabia, 2015– 2019.” journal of global antimicrobial resistance 25:142–150. 24. alqahtani, m., i. tickler, z. al deesi, w. alfouzan, a. al jabri, r. al jindan, s. al johani, s. alkahtani, a. al kharusi and e. mokaddas (2021). “molecular detection of carbapenem resistance genes in rectal swabs from patients in gulf cooperation council hospitals.” journal of hospital infection 112:96–103. 25. bandy, a. and b. tantry (2021). “esbl activity, mdr, and carbapenem resistance among predominant enterobacterales isolated in 2019.” antibiotics 10(6):744. 26. sobia, f., s. n. qurashi and k. y. ghailan (2021). “occurrence of blactxmgp1 and blactx-mgp26 in third generation cephalosporin-resistant and carbapenem-resistant bacterial isolates from southwest region of saudi arabia-a preliminary study.” saudi journal of biological sciences 28(9): 5408–5413. 27. hala, s., c. p. antony, m. alshehri, a. o. althaqafi, a. alsaedi, a. mufti, m. kaaki, b. t. alhaj-hussein, h. m. zowawi and a. al-amri (2019). “first report of klebsiella quasipneumoniae harboring bla kpc-2 in saudi arabia.” antimicrobial resistance & infection control 8(1):1–8. 28. jawhar, w. n. b., m. m. alrashed, a. m. somily and a. m. albarrag (2020). “molecular characterization of carbapenem-resistance genes among pseudomonas aeruginosa and acinetobacter baumannii clinical isolates in riyadh.” pharmacophore 11(6). 29. al-zahrani, i. a. and b. a. alasiri (2018). “the emergence of carbapenemresistant klebsiella pneumoniae isolates producing oxa-48 and ndm in the southern (asir) province, saudi arabia.” saudi medical journal 39(1):23. 30. el-badawy, m. f., s. f. abdelwahab, s. a. alghamdi and m. m. shohayeb (2019). “characterization of phenotypic and genotypic traits of carbapenem-resistant acinetobacter baumannii clinical isolates recovered from a tertiary care hospital in taif, saudi arabia.” infection and drug resistance 12:3113. 31. shah, m. w., m. yasir, m. farman, a. a. jiman-fatani, s. b. almasaudi, m. alawi, d. el-hossary and e. i. azhar (2019). “antimicrobial susceptibility and molecular characterization of clinical strains of acinetobacter baumannii in western saudi arabia.” microbial drug resistance 25(9):1297–1305. 32. talal, l. (2019). “phenotypic and genotypic characterization of carbapenemresistant enterobacteriaceae in bahrain and saudi arabia.” journal of infection and public health 12(2):299. 33. al-zahrani, ibrahim, al-ahmadi and bashaer (2021). “dissemination of vimproducing pseudomonas aeruginosa associated with high-risk clone st654 in a tertiary and quaternary hospital in makkah, saudi arabia.” journal of chemotherapy 33(1):12–20. 34. khater, e. s., a. a. alfaki and s. s. abd elmoaty (2020). “carbapenemresistant klebsiella pneumonia isolated from patients admitted in tertiary care hospital in saudi arabia.” journal of advances in microbiology:76–85. 35. aleidan, f. a., h. alkhelaifi, a. alsenaid, h. alromaizan, f. alsalham, a. almutairi, k. alsulaiman and a. g. abdel gadir (2021). “incidence and risk factors of carbapenem-resistant enterobacteriaceae infection in intensive care units: a matched case–control study.” expert review of anti-infective therapy 19(3):393–398. 36. alotaibi, f. (2019). “carbapenem-resistant enterobacteriaceae: an update narrative review from saudi arabia.” journal of infection and public health 12(4):465–471. 37. alotaibi, f. e., e. e. bukhari, m. m. al-mohizea, t. hafiz, e. b. essa and y. i. altokhais (2017). “emergence of carbapenem-resistant enterobacteriaceae isolated from patients in a university hospital in saudi arabia. epidemiology, clinical profiles and outcomes.” journal of infection and public health 10(5):667–673. 38. abdallah, m., r. alhababi, n. alqudah, b. aldyyat and a. alharthy (2018). “first report of carbapenem-resistant providencia stuartii in saudi arabia.” new microbes and new infections 26:107–109. 39. alghoribi, m. f., k. binkhamis, a. a. alswaji, a. alhijji, a. alsharidi, h. h. balkhy, m. doumith and a. somily (2020). “genomic analysis of the first kpc-producing klebsiella pneumoniae isolated from a patient in riyadh: a new public health concern in saudi arabia.” journal of infection and public health 13(4):647–650. 40. al-abdely, h., r. alhababi, h. m. dada, h. roushdy, m. m. alanazi, a. a. alessa, n. m. gad, a. m. alasmari, e. e. radwan and h. al-dughmani (2021). “molecular characterization of carbapenem-resistant enterobacterales in thirteen tertiary care hospitals in saudi arabia.” annals of saudi medicine 41(2): 63–70. 41. abd el ghany, m., h. sharaf, m. h. al-agamy, a. shibl, g. a. hill-cawthorne and p.-y. hong (2018). “genomic characterization of ndm-1 and 5, and oxa-181 carbapenemases in uropathogenic escherichia coli isolates from riyadh, saudi arabia.” plos one 13(8): e0201613. 42. al-agamy, m. h., a. aljallal, h. h. radwan and a. m. shibl (2018). “characterization of carbapenemases, esbls, and plasmid-mediated quinolone determinants in carbapenem-insensitive escherichia coli and klebsiella pneumoniae in riyadh hospitals.” journal of infection and public health 11(1):64–68. 43. uz zaman, t., m. alrodayyan, m. albladi, m. aldrees, m. i. siddique, s. aljohani and h. h. balkhy (2018). “clonal diversity and genetic profiling of antibiotic resistance among multidrug/carbapenem-resistant klebsiella pneumoniae isolates from a tertiary care hospital in saudi arabia.” bmc infectious diseases 18(1):1–11. 44. mutair, a. a., s. alhumaid, z. a. alawi, a. r. z. zaidi, a. j. alzahrani, j. al-tawfiq, h. al-shammari, a. rabaan, o. khojah and a. al-omari (2021). “five-year resistance trends in pathogens causing healthcare-associated infections at a multi-hospital healthcare system in saudi arabia, 2015-2019.” journal of global antimicrobial resistance. 45. leangapichart, t., p. gautret, k. griffiths, k. belhouchat, z. memish, d. raoult and j.-m. rolain (2016). “acquisition of a high diversity of bacteria during the hajj pilgrimage, including acinetobacter baumannii with bla oxa-72 and escherichia coli with bla ndm-5 carbapenemase genes.” antimicrobial agents and chemotherapy 60(10):5942–5948. 46. faidah, h. s., a. m. momenah, h. m. el-said, a. a. barhameen, s. s. ashgar, a. johargy, a. elsawy, w. almalki and s. al qurashi (2017). “trends in the annual incidence of carbapenem resistant among gram negative bacilli in a large teaching hospital in makah city, saudi arabia.” journal of tuberculosis research 5(04):229. 47. al-zalabani, a., o. a. althobyane, a. h. alshehri, a. o. alrehaili, m. o. namankani and o. h. aljafri (2020). “prevalence of klebsiella pneumoniae antibiotic resistance in medina, saudi arabia, 2014-2018.” cureus 12(8). 26 j contemp med sci | vol. 8, no. 1, january-february 2022: 18–26 epidemiology of carbapenem resistance enterobacterales in saudi arabia: a systematic review review r.s. abou-assy et al. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i1.1168 48. al-hamad, a., t. pal, h. leskafi, h. abbas, h. hejles, f. alsubikhy, d. darwish, a. ghazawi and a. sonnevend (2020). “molecular characterization of clinical and environmental carbapenem resistant acinetobacter baumannii isolates in a hospital of the eastern region of saudi arabia.” journal of infection and public health 13(4):632–636. 49. al bshabshe, a., a. al-hakami, b. alshehri, k. a. al-shahrani, a. a. alshehri, m. b. al shahrani, i. assiry, m. r. joseph, a. alkahtani and m. e. hamid (2020). “rising klebsiella pneumoniae infections and its expanding drug resistance in the intensive care unit of a tertiary healthcare hospital, saudi arabia.” cureus 12(8). 50. alzomor, o. a., t. s. alfawaz, a. abu-shaheen, m. a. alshehri and d. al shahrani (2019). “a matched case-control study to assess the carbapenemresistant enterobacteriaceae infections among hospitalized children at king fahad medical city, riyadh, saudi arabia.” saudi medical journal 40(11):1105. 77j contemp med sci | vol. 9, no. 1, january-february 2023: 77–81 original assessment of missing opportunity of vaccination at primary health care center: a retrospective study ali fadhil obaid1*, zainab abdulameer abdulrasol2, ahmed mohammed jasim shlash3, methaq rabah tuman2, muamel dhaher hussain2 1pediatric nursing, college of nursing, university of babylon, babylon, iraq. 2maternal and newborn health nursing, college of nursing, university of babylon, babylon, iraq. 3adults health nursing, college of nursing, university of al-ameed, karbala, iraq. *correspondence to: fadhil obaid (e-mail: ali19903li@gmail.com) abstract objectives: the study aim is to assess the vaccination status of children under two years old in al-asatetha primary health care center, hilla, babylon province, iraq. method: retrospective study design (retrospective chart review) was used to assess the missed opportunities of vaccination for children under the age of two years by reviewing their immunization status from medical reports at the primary health care center. the purposive sampling was used to collect the data of 1000 children born from 1-1-2020 to 31-12-2020 through the period from 1 december 2021 to 1 february 2022. results: the finding of the current study showed that the age of children in the selected period (2020-2021) was between11–23 months, the number of children (1–8) in the same family, and almost all of these families reside in urban areas. regarding the parents’ educational level the high percentage of both fathers and mothers were attained a primary level of education, and most of the fathers were working, while most of the mothers were not work. concerning the vaccination status the finding showed that the percentage of missed vaccination opportunities reached 61%, and there was a significant positive correlation between vaccination status and (family residence, parental education level, and fathers’ occupation) with a p value of 0.01. on the other hand, the number and the order of children in families had an inversely significant relationship with vaccination status at a p value of 0.01. conclusion: the study concludes that numerous factors affect the vaccination rate such as parents’ education attainment and awareness, family size, address, and economic status of the family. key words: vaccination, vaccines, missed opportunity for vaccination (mov) issn 2413-0516 introduction immunization define as one of the most efficient, safest, and cost-effective public health care interventions to prevent death and disability that can be controlled by vaccination. “immunization will help to achieve the millennium development goals (mdgs) on reducing child mortality, improving maternal health, and preventing diseases” resulting in improved global, national, and regional levels of social, economic, and health outcomes.1,2 immunization leads to a remarkable reduction in cases of vaccine-preventable infectious diseases among children.2,3 moreover, the whole benefits of immunization can be accomplished, if the missed opportunities for vaccination (movs) are eliminated and global vaccination coverage improves.4 the missed opportunity for vaccination define as any time the children or pregnant women of childbearing age who are eligible for vaccination (i.e., unvaccinated, partially vaccinated, or not up-to-date on vaccinations) and makes contact with health services but do not receive all of the vaccine doses for which they are eligible.5,6 the “world health organization (who) established the expanded program on immunization (epi) in 1974” to improve global vaccination coverage and achieve universal access to immunization. in 1977, the program set many goals to make immunization against diphtheria, pertussis, tetanus, poliomyelitis, measles, and tuberculosis available to every child in the world by 1990.7 in 1985, the “expanded program of immunization (epi) was well established in iraq to deliver immunization services to targeted groups and implement national and global strategies to achieve the main objectives of the program by improving the global coverage of vaccination”.8 however, despite the fact that vaccine compliance is a major aspect of preventative healthcare, there is a large gap between immunization mandates and actual compliance.9 various researchers have addressed the factors that cause vaccination delays. although the children eventually get the immunization, this concept considers essential since many delayed cases lead to inadequate vaccination of the children. most of these factors include: single-parent households, child’s health status, larger family size, family socioeconomic status, low parental education level, geographic location, medicaid enrollment, absence of primary health care provider, and lack of insurance coverage.10–13 study objectives the current study aimed to assess the vaccination status of under two year’s children in al-asatetha primary health care center (phc)/hilla-iraq, in addition, to finding out the correlation between the missed opportunity of vaccination and some sociodemographic variables. methods study design retrospective study design (retrospective chart review) was used to assess missed opportunities of under two years’ mailto:ali19903li@gmail.com 78 j contemp med sci | vol. 9, no. 1, january-february 2023: 77–81 assessment of mov at phc center original a.f. obaid et al. table 1. sociodemographic characteristics of children and their parents (no. 1000) items interval freq. percent child age per months 11–15 375 37.5 16–20 407 40.7 21+ 218 21.8 minimum (11 months) maximum (23 months) mean 16.97 std. deviation 3.558 child gender male 518 51.8 female 482 48.2 childern number minimum: 1 child maximum: 8 children child order 1st 256 25.6 2nd 292 29.2 3rd 215 21.5 4th 120 12.0 5th 72 7.2 6th 33 3.3 7th 10 1.0 8th 2 .2 residency rural 199 19.9 urban 801 80.1 father level of edu. illitrate 10 1.0 primary 372 37.2 intermediate 225 22.5 secondary 113 11.3 diploma and above 280 28.0 mother level of edu. illitrate 71 7.1 primary 355 35.5 intermediate 185 18.5 secondary 87 8.7 diploma and above 302 30.2 father occupation not work 246 24.6 work 754 75.4 mother occupation not work 882 88.2 work 118 11.8 children, through reviewing their immunization status from medical records of phc. sample & setting of the study purposive sampling of 1000 children was born from 1-1-2020 to 31-12-2020; collected from the medical reports at al-asatetha primary health care center through the period of 1st december 2021 to 1st of february 2022. instruments the questionnaire was constructed after extensive literature reviews and used for the study, which consisted of two parts: part 1: items related to demographic data of parents and children: this part is concerned with the personal information of parents (occupation and education) and children (age, gender, and order). part 2: items related to the vaccination status of children in this part the data was divided into three categories of vaccination status: the first group was completely vaccinated children, the second group was partially vaccinated children (children who missed one to five vaccines up to their ages), and the third group was children who completely missed their vaccines or were unvaccinated (children missed more than five vaccines up to their ages). all of these data are according to the iraqi schedule of vaccination. statistical analysis the data was analyzed statistically by using “statistical package for social sciences (spss) version 26 through the application of descriptive statistical data analysis including frequencies, percentages, mean of the score (ms) with their standard deviation (sd), inferential statistics, and spearman correlation. results table 1 shows that 40% of children between the age of 16-20 months and the percent of males were equal to females children in the study, regarding children number the minimum number was one child, while the maximum number was eight children in the family. 50% of these families have 2-3 children, and 80% of them reside in urban areas. concerning the parents’ educational attainment, more than 35% of both fathers and mothers have a primary level of education, and regarding the parents’ occupation, the finding shows that 75% of fathers were working while 88% of mothers were not working. table 2 shows that there was a significant positive correlation between vaccination status and (family address, parent education, and father occupation) at p-value < 0.01. in another hand, the children’s number and child order in families had an inverse signification correlation with the vaccination status at p-value < 0.01. discussion the current study shown in (table 1) that the target ages of children in the selected period (2020-2021) were between 1-2 years, and less than half of them were between 16-20 months regarding children number in the family; half of these families have 2-3 children, while some of them have more than six children, and almost all of them reside in the urban area. concerning the parents’ educational attainment, the finding reveals that one-third of parents completed a primary level of education and about the parents’ occupation: most fathers are working while most mothers are not working. these findings were similar to a study conducted by asiegbu and his colleagues in (2020)14 and both of the studies that conducted in baghdad by abbas and his colleague in (2016)15 and fadil and his colleague in (2010).2 mov is a hurdle to rising immunization coverage among children and women of childbearing age worldwide,16 and the 79j contemp med sci | vol. 9, no. 1, january-february 2023: 77–81 a.f. obaid et al. original assessment of mov at phc center fig. 1 missing opportunity of vaccine status of 1000 childern in phc. table 2. correlations coefficient between vaccination status and sociodemographic variables spearman’s rho address child order children numbers father edu. mother edu. father occupation mother occupation vaccination status correlation coefficient .157** -.157** -.165** .116** .123** .114** .013 sig. .000 .000 .000 .000 .000 .000 .691 n 1000 1000 1000 1000 1000 1000 1000 correlation is significant at the 0.01 level (2-tailed).** fig. 2 schedule vaccination status of 1000 childern in phc. results show in (figure 1) that the missing opportunities of the vaccination status of 1000 children in al asatetha phc revealed that there are three categories of vaccination status; one-third of children are fully vaccinated, less than half of them have partially vaccinated children and less than quarter of children completely missing their vaccination, and this finding goes in line with the result of mahmood, (2012), which performed on infant children in diyala province/iraq that found (70%) of children were fully vaccinated, (24%) were partially vaccinated children and (6%) were non-vaccinated children. another study showed that (75.4%) were fully vaccinated, and most of them were vaccinated during immunization campaigns.17 whereas, asiegbu and his colleagues in (2020) found that (71.6%) had missed vaccination appointments for their children with the far immunization center14 and kaboré and his colleagues also found that 76% eligible 80 j contemp med sci | vol. 9, no. 1, january-february 2023: 77–81 assessment of mov at phc center original a.f. obaid et al. children for vaccination missed their opportunity to be vaccinated when visiting the health facilities figure 2.18 regarding the factors that affect mov, (table 2) shows that there is a positive relationship between vaccination status with some sociodemographic variables such as (family address, parents’ education attainment, and fathers’ occupation), which means when the level of parents’ education this leading to increase awareness about the benefits of childhood vaccination. in another hand, the increased children number and child order in the family have a negative relationship with the vaccination status, and this means the family size affects vaccination status. the previously mentioned findings are similar to the results of research conducted in erbil/iraq by hassan & ahmed, (2020), which concluded that children who are not vaccinated on time are likely to be from family of low socio-economic status and having low parental educational level.19 and another research conducted by asiegbu et al., (2020) revealed the mothers’ educational status, and place of residence were significantly associated with increase knowledge of childhood vaccination.14 in addition to dombkowski and his colleagues, which found that parental education, the absence of a two-parent household, and large family size all of these reasons contribute to the delay of child vaccination.12 while some scholars found that the increase in parents’ education and awareness regarding immunization and vaccination and even reminding them by using digital media can significantly affect immunization coverage and reduce the missing opportunity for vaccination.17,18 furthermore, the study by abdul rahman and his colleagues conducted in kurdistan/iraq found the role of religious leaders in improving vaccination coverage about 95% post-intervention period compared with 55% of vaccination coverage pre-intervention period.20 conclusion the overall vaccination rate showed that missed vaccination opportunities reached 61%, and this is due to many reasons such as parents’ education attainment, number of children in the family, and family residential area. therefore, when the parents have a high level of education, then the vaccination rate increase, and if the family have a few children, the missed opportunity of vaccination decrease. recommendations 1. using digital media such as social media and television by health institutions and concerned authorities to increase awareness of families regarding the importance of taking vaccines and their benefits. 2. recommend the health institutions to use sms text messages to remind the families about times of vaccinations, and this technique will help in reaching the children’s immunization coverage. 3. increase vaccination campaigns by phcs to achieve the epi goals of who. ethical considerations the research was conducted with ethical approval from the university of babylon’s nursing college. funding no government, private, or non-profit organization supported this study financially. authors’ contributions each of the authors made significant contributions in this study. conflict of interest there are no conflicts of interest revealed by the authors.  references 1. moh, usaid’s, phcpi. national immunization plan of iraq for 2015 table of contents. 2015;(december 2014). 2. fadil ls, al-lami f. proportion and determinants of incomplete vaccination among children aged less than two years in baghdad city. iraqi postgrad med j. 2010;9(2). 3. raof am. parental attitude and beliefs towards child vaccination: identifying vaccine hesitant groups in a family health center, erbil city, iraq. world fam med j inc middle east j fam med. 2018;99(6002):1–10. 4. jaca a, mathebula l, iweze a, pienaar e, wiysonge cs. a systematic review of strategies for reducing missed opportunities for vaccination. vol. 36, vaccine. 2018. 5. who. essential programme on immunization [internet]. who. 2021 [cited 2022 feb 27]. p. 2021. available from: https://www.who.int/ teams/immunization-vaccines-and-biologicals/essential-programmeon-immunization/implementation/reducing-missed-opportunities-forvaccination-(mov) 6. sridhar s, maleq n, guillermet e, colombini a, gessner bd. a systematic literature review of missed opportunities for immunization in low-and middle-income countries. vaccine. 2014;32(51):6870–9. 7. keja k, chan c, hayden g, henderson rh. expanded programme on immunization. world health stat q. 1988;41(2):59–63. 8. lafta r, hussain a. trend of vaccine preventable diseases in iraq in time of conflict. pan afr med j. 2018;31(1). 9. bundt ts, hu h. national examination of compliance predictors and the immunization status of children: precursor to a developmental model for health systems. mil med. 2004;169(10):795–803. 10. falagas me, zarkadoulia e. factors associated with suboptimal compliance to vaccinations in children in developed countries: a systematic review. curr med res opin. 2008;24(6):1719–41. 11. mahmood ns. rate of vaccination of children at diyala province & the effect of parental education on vaccination status, hospital based study. diyala j med. 2012;3(1):73–81. 12. dombkowski kj, lantz pm, freed gl. risk factors for delay in ageappropriate vaccination. public health rep. 2004;119(2):144–55. 13. al-shemari kd. causes of delay in age appropriate vaccination. iraqi postgrad med j. 2006;5:32–98. 14. asiegbu uv, obu dc, una afi, ezeonu ct, asiegbu ok. evaluating mothers knowledge and attitude as a contributing factor to the low childhood immunization uptake in ebonyi state, nigeria. african j med heal sci. 2020;19(8):127–35. 15. abbas lm, aldeen ld. incomplete vaccination among children below two years in a sample of urban primary health care centers at al-karkh baghdad city. iraqi journalof community med. 2016;29(3). 16. hutchins ss, jansen ha, robertson se, evans p, kim-farley rj. studies of missed opportunities for immunization in developing and industrialized countries. bull world health organ. 1993;71(5):549. 81j contemp med sci | vol. 9, no. 1, january-february 2023: 77–81 a.f. obaid et al. original assessment of mov at phc center 17. fite ro, hailu ld. immunization coverage of 12 to 23 months old children in ethiopia. j public heal epidemiol. 2019;11(1):31–7. 18. kaboré l, meda b, médah i, shendale s, nic lochlainn l, sanderson c, et al. assessment of missed opportunities for vaccination (mov ) in burkina faso using the world health organization’s revised mov strategy: findings and strategic considerations to improve routine childhood immunization coverage. vaccine. 2020;38(48):7603–11. 19. hassan za, ahmed mj. factors associated with immunisation coverage of children aged 12-24 months in erbil/iraq 2017-2018. int j psychosoc rehabil. 2020;24(08). 20. abdul rahman ma, al-dabbagh sa, al-habeeb qs. health education and peer leaders’ role in improving low vaccination coverage in akre district, kurdistan region, iraq. east mediterr heal j. 2013;19(2). this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v9i1.1321 323j contemp med sci | vol. 8, no. 5, september-october 2022: 323–326 original a study of factors that impact the production of anti-sars-cov-2 antibodies in patients with covid-19 nawfal r hussein1, amer balatay2, ameen m mohammad3, kuldeep dhama4, narin a rasheed5* 1department of biomedical sciences, college of medicine, university of zakho, zahko, kurdistan region, iraq. 2department of clinical pharmacy, college of pharmacy, university of duhok, duhok, kurdistan region, iraq. 3department of internal medicine, college of medicine, university of duhok, duhok, kurdistan region, iraq. 4division of pathology, icar-indian veterinary research institute (ivri), izatnagar243122, bareilly, uttar pradesh, india. 5department of medical laboratory technology, college of health and medical technology-shekhan, duhok polytechnic university, duhok, kurdistan region, iraq. *correspondence to: narin a rasheed (e-mail: narin.rasheed@gmail.com) (submitted: 29 april 2022 – revised version received: 12 may 2022 – accepted: 17 may 2022 – published online: 26 october 2022) abstract objectives: the aim of this paper was to investigate the impact of different variables on the production of antibodies in patients who were infected with covid-19. methods: this cross-sectional study was conducted in duhok city, kurdistan region of iraq. the study was conducted between january 2021 and march 2022. demographic data were collected via face-to-face interview. antibody levels were determined using elecsys anti-sars-cov-2. results: the levels of antibody were studied in 138 patients. a significant association was found between antibody levels and the age of the participants (r = 0.175; p = 0.04). besides, a significant correlation was found between antibody levels and the duration of symptoms (r = 0.206; p = 0.015). the antibody levels were not associated with gender; history of chronic diseases; marital status or time interval before testing. conclusion: different variables that may impact the levels of antibody were studied. significant associations were found between antibody levels and both age and duration of symptoms. our results can be used by healthcare providers to focus on patients who are at risk of low antibody production. keywords: sars-cov-2, antibodies, covid-19, duhok, iraq issn 2413-0516 introduction covid-19 caused by sars-cov-2 that was discovered in wuhan, china, in december 2019 and rapidly spread worldwide.1 since the discovery of first cases of covid-19 in kurdistan region of iraq in march, 2020, the region passed through three devastating waves with a case fatality rate of 2%. during the first wave, strict measures were taken to control the infection2 and the case fatality rate was low. then, due to public fatigability and unwillingness,3,4 the measures were relaxed leading a sharp increase in morbidity and mortality of covid-19 cases. such an increase in the cases had a negative impact on the already weak health system.5–8 the number of covid-19 patients exceeded the capacities of acute care beds and home management scheme was launched to manage cases of severe covid. covid-19 has a wide array of symptoms particularly fever and respiratory symptoms such as cough and shortness of breath.9,10 non-respiratory symptoms are not uncommon such as gastrointestinal symptoms including diarrhea and vomiting. herd immunity can be the most important factor to control the pandemic. herd immunity is defined as the reduction in the number of cases due to the development of immunity by natural infection of vaccination.11,12 the spike (s) protein is the antigenic protein of sars-cov-2 that mediate the fusion with human angiotensin-converting enzyme 2 (ace2). the s antigen is consisted of two subunits: 1 (s1) and 2 (s2). the latter is involved in the fusion process between the cell membranes and viruses. antibodies that inhibit this specific binding are known as neutralizing antibody. such antibodies play a pivotal rule in the prevention of reinfection.13–15 it is worth mentioning that studies have shown that antibody response induced by natural infection wane over time and different factors may impact the production and the intensity of antibody production and reinfection is possible.13–15 the aim of this paper was to investigate the impact of different variables on the production of antibodies in patients who were infected with covid-19. materials and methods study design this cross-sectional study was conducted in duhok city, kurdistan region of iraq. the study was conducted between january 2021 to march 2022. blood samples were collected form participants who were at least 18 years old, had a history of confirmed covid-19, had not received vaccination and agreed to participate in the study. then, 5–10 cm3 of venous blood samples were collected using 10-cm3 syringes. the samples were immediately transported to the research center, and sera were separated from the blood and kept frozen at –20°c. demographic data were collected via face-to-face interview. anti-sars-cov-2 antibody antibody levels were determined using elecsys antisars-cov-2 (roche diagnostics international ltd, rotkreuz, switzerland), which is an in-vitro immunoassay to determine antibodies (including igg) to the sars-cov-2 spike (s) protein receptor binding domain (rbd) in human serum and plasma. the assay was performed according to the manufacturer’s instructions. according to the manufacturer, a cutoff index ≥0.8 indicates a positive result. mailto:narin.rasheed@gmail.com 324 j contemp med sci | vol. 8, no. 5, september-october 2022: 323–326 factors impacting anti-sars-cov-2 antibody production original n.r. hussein et al. statistics binary logistic regression was utilized to analyze the association between antibody levels and dichotomous data. pairwise pearson’s correlation was utilized to investigate the relationship between antibody levels and continuous variables. all calculations were performed using minitab 20 software. p value of ≤0.05 was considered significant. ethics the study and all procedures were approved by ethics and scientific committee of the college of medicine, university of zakho. the work was carried out in accordance with the code of ethics of the world medical association (declaration of helsinki) for experiments involving humans. written informed consent was obtained from all participants. results blood samples were collected from participants with a previous history of confirmed covid-19. demographic data were collected via face-to-face interview. in this study, the mean age of the participants was 38.44 ± 1.17, and (68/138) 49.28% of the participants were female. among the participants, (111/138) 80.43% were married and (64/138) 46.38% had a history of chronic diseases (table 1). binary logistic regression was utilized to analyze the association between antibody levels and dichotomous data. although antibody levels were higher in females than that found in males, no statistically significant association was found between sex and antibody levels (or = 0.99; ci = 0.99–1.003; p = 0.7) (table 2). besides, no significant association was found between the history of chronic diseases and antibody levels (or = 1.003; ci = 0.998–1.01; p = 0.1) (table 2). antibody levels were higher in married than unmarried participants, although the association was not statistically significant (or = 1.007; ci = 0.999–1.013; p = 0.058) (table 2). pairwise pearson’s correlation was utilized to investigate the relationship between antibody levels and age. a significant association was found between antibody levels and the age of the participants (r = 0.175; p = 0.04) (figure 1). additionally, pairwise pearson’s correlation was used to study the correlation between antibody levels and duration of the symptoms during the infection. a significant correlation was found between antibody levels and the duration of symptoms (r = 0.206; p = 0.015) (figure 2). the correlation between time interval before testing and antibody levels was investigated. no association was found between antibody levels and time interval before testing (r = 0.038; p = 0.66) (figure 3). discussion kurdistan region of iraq went through three devastating waves that impacted the already weak health system. since the appearance of sars-cov-2 pandemic, healthcare providers are aiming to controlling the spread of the infection.16,17 the development of herd immunity after natural infection or vaccination was the aim. however, reinfection and breakthrough infection appeared to be obstacles for controlling the pandemic by herd immunity.18 understanding factors associated with waning of the immunity is important for healthcare providers to focus on patients who are at risk of low antibody production.19 therefore; we aimed at studying different variables associated with antibody levels in patients who were infected with sars-cov-2. in our study, we found that older age was associated with higher levels of anti-sars-cov-2 antibodies. our results are in agreement with previous studies that found higher level of antibodies in older patients.20–22 this might be explained by that older patients are susceptible to severe infection which might induce more rigorous immune reaction. more studies are needed to investigate the dynamic of antibody response over the time in older patients. additionally, it was previously proposed that biological sex impacts immune responses and covid-19 outcomes.23 in support of this in a table 1. characteristics of participants dichotomous variables no. % gender female 68 49.28 male 70 50.72 chronic disease no 74 53.62 yes 64 46.38 marital status no 27 19.57 yes 111 80.43 continuous variables mean se mean minimum maximum age (year) 38.44 1.17 18 76 time interval before testing (day) 148.82 4.39 38 313 duration of symptoms (day) 12.568 0.743 2 45 se, standard error. table 2. associations between antibody levels and different factors variables no. mean se mean minimum q1 median q3 maximum or ci p value sex female 68 71.95 8.19 0.1 10.22 42.45 131.42 203.6 0.999 0.99-1.003 0.7 male 70 67.58 8.5 0.1 5.22 40.25 121.9 221.9 chronic disease no 74 62.04 7.89 0.1 2.82 22.65 114.08 200.3 1.003 0.998-1.01 0.1 yes 64 78.62 8.76 0.1 10.2 65.55 135.08 221.9 marital status no 27 46.7 12.3 0.1 1.2 10.9 92 221.9 1.007 0.999-1.013 0.058 yes 111 75.32 6.59 0.1 7.4 56.7 134.4 203.6 se, standard error; q, quartile; or, odd ratio; ci, confidence interval. 325j contemp med sci | vol. 8, no. 5, september-october 2022: 323–326 n.r. hussein et al. original factors impacting anti-sars-cov-2 antibody production fig. 3 scatterplot showing the association between antibody levels and time interval before testing. no significant association was found between antibody levels and the interval before testing (r = 0.038; p = 0.66). fig. 1 scatterplot showing the association between antibody levels and age of the participants. a significant association was found between antibody levels and age of participants (r = 0.175; p = 0.04) fig. 2 scatterplot showing the association between antibody levels and the duration of symptoms. a significant association was found between antibody levels and the duration of symptoms (r = 0.206; p = 0.015). patients than that found in female patients.25 however, in our study, no significant correlation was found between sex and post-infection antibody levels. the disparities in results may be attributed to sampling and methods used in measuring antibody levels. furthermore, previous studies showed associations between history of chronic diseases and the levels of antibody.26,27 in our study, no associations were found between history of chronic diseases and the levels of antibody. besides, in agreement with previous studies,20,28 we found a statistically significant association between the duration of symptoms and antibody levels. this might be explained by that more exposure of immune system to the virus with longer duration of symptoms. more research is needed to explore this. our results are useful because they provide an insight into factors that may impact the production of antibodies in patients with covid-19. our results can be used by healthcare providers to focus on patients who are at risk of low antibody production. finally, our results can be used by researchers to investigate antibody production after vaccination in those who are low antibody producers. declaration of interests the authors declare no conflict of interest.  study recruiting patients with severe covid-19, it was shown that the higher levels of antibody was found in female patients than that found in male patients.24 in the same study, the generation of igg antibody was stronger in females than males in early phase of the disease.24 in contrast, in a study recruiting convalescent patients, antibody levels were higher in male references 1. kumar a, singh r, kaur j, pandey s, sharma v, thakur l, et al. wuhan to world: the covid-19 pandemic. frontiers in cellular and infection microbiology. 2021;11. 2. hussein nr. the role of self-responsible response versus lockdown approach in controlling covid-19 pandemic in kurdistan region of iraq. international journal of infection. 2020;7(4). 3. martinez-garcia m, rabasa a, barber x, polotskaya k, roomp k, oliver n. key factors affecting people’s unwillingness to be confined during the covid-19 pandemic in spain: a large-scale population study. scientific reports. 2021;11(1):18626. 4. wondreys j, mudde c. victims of the pandemic? european far-right parties and covid-19. nationalities papers. 2022;50(1):86–103. 5. robert r, kentish-barnes n, boyer a, laurent a, azoulay e, reignier j. ethical dilemmas due to the covid-19 pandemic. annals of intensive care. 2020;10(1):84. 6. lami f, rashak ha, khaleel ha, mahdi sg, adnan f, khader ys, et al. iraq experience in handling the covid-19 pandemic: implications of public health challenges and lessons learned for future epidemic preparedness planning. journal of public health. 2021;43(supplement_3):iii19–iii28. 7. hussein n. the impact of covid-19 pandemic on the elimination of viral hepatitis in duhok city, kurdistan region of iraq. hepatitis monthly. 2020;20(5):e104643. 8. hussein nr, musa dh, ibrahim n, naqid ia, saleem zsm, jacksi k. impact of covid-19 pandemic on surgical practice in kurdistan, iraq: an online cross-sectional survey. international journal of surgery open. 2020;27:47–51. 9. vetter p, vu dl, l’huillier ag, schibler m, kaiser l, jacquerioz f. clinical features of covid-19. bmj. 2020;369:m1470. 10. hwaiz ra, zaki abdullah sm, jalal balaky st, ali ks, merza my, khailani sa, et al. clinical and hematological characteristics of 300 covid-19 patients in erbil, kurdistan region, iraq. international journal of immunopathology and pharmacology. 2022;36:03946320221085465. 11. john tj, samuel r. herd immunity and herd effect: new insights and definitions. european journal of epidemiology. 2000;16(7):601–6. 326 j contemp med sci | vol. 8, no. 5, september-october 2022: 323–326 factors impacting anti-sars-cov-2 antibody production original n.r. hussein et al. 12. frederiksen lsf, zhang y, foged c, thakur a. the long road toward covid-19 herd immunity: vaccine platform technologies and mass immunization strategies. frontiers in immunology. 2020;11. 13. sariol a, perlman s. lessons for covid-19 immunity from other coronavirus infections. immunity. 2020;53(2):248–63. 14. hussein nr, musa dh, saleem zsm, naqid ia, ibrahim n. possible covid-19 reinfection case in duhok city, kurdistan: a case report. journal of family medicine and primary care. 2021;10(5):2035. 15. hussein nr, rashad bh, almizori la, yousif ss, sadeeq at, abdulkareem yr, et al. the risk of sars-cov-2 reinfection in duhok city, kurdistan region of iraq. mediterranean journal of hematology and infectious diseases. 2021;13(1). 16. zenone m, snyder j, marcon a, caulfield t. analyzing natural herd immunity media discourse in the united kingdom and the united states. plos global public health. 2022;2(1):e0000078. 17. khalife j, vangennep d. covid-19 herd immunity in the absence of a vaccine: an irresponsible approach. epidemiol health. 2021;43:e2021012. 18. hall v, foulkes s, insalata f, kirwan p, saei a, atti a, et al. protection against sars-cov-2 after covid-19 vaccination and previous infection. new england journal of medicine. 2022;386(13):1207–20. 19. papachristodoulou e, kakoullis l, parperis k, panos g. long-term and herd immunity against sars-cov-2: implications from current and past knowledge. pathog dis. 2020;78(3). 20. klein sl, pekosz a, park h-s, ursin rl, shapiro jr, benner se, et al. sex, age, and hospitalization drive antibody responses in a covid-19 convalescent plasma donor population. the journal of clinical investigation. 2020;130(11):6141–50. 21. zhang b, zhou x, zhu c, song y, feng f, qiu y, et al. immune phenotyping based on the neutrophil-to-lymphocyte ratio and igg level predicts this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i5.1242 disease severity and outcome for patients with covid-19. frontiers in molecular biosciences. 2020;7(157). 22. yang hs, costa v, racine-brzostek se, acker kp, yee j, chen z, et al. association of age with sars-cov-2 antibody response. jama network open. 2021;4(3):e214302-e. 23. scully ep, haverfield j, ursin rl, tannenbaum c, klein sl. considering how biological sex impacts immune responses and covid-19 outcomes. nature reviews immunology. 2020;20(7):442–7. 24. zeng f, dai c, cai p, wang j, xu l, li j, et al. a comparison study of sarscov-2 igg antibody between male and female covid-19 patients: a possible reason underlying different outcome between sex. journal of medical virology. 2020;92(10):2050–4. 25. markmann aj, giallourou n, bhowmik dr, hou yj, lerner a, martinez dr, et al. sex disparities and neutralizing-antibody durability to sars-cov-2 infection in convalescent individuals. msphere. 2021;6(4):e00275–21. 26. karuna s, li ss, grant s, walsh sr, frank i, casapia m, et al. neutralizing antibody responses over time in demographically and clinically diverse individuals recovered from sars-cov-2 infection in the united states and peru: a cohort study. plos medicine. 2021;18(12):e1003868. 27. zejda je, brożek gm, kowalska m, barański k, kaleta-pilarska a, nowakowski a, et al. seroprevalence of anti-sars-cov-2 antibodies in a random sample of inhabitants of the katowice region, poland. international journal of environmental research and public health. 2021;18(6):3188. 28. marklund e, leach s, axelsson h, nyström k, norder h, bemark m, et al. serum-igg responses to sars-cov-2 after mild and severe covid-19 infection and analysis of igg non-responders. plos one. 2020;15(10):e0241104. 358 j contemp med sci | vol. 7, no. 6, november-december 2021: 358–362 original prevalence of adverse effects of covid19 vaccines among a sample of iranian healthcare workers; a comparison between the three available vaccines in iran mohammad mousavi1, azita tehranchi2, mahshid namdari3, maryam sadeghipour4*, mohsen dalband5, mahsa malek mohammadi3, kazem dalaie2 1dentofacial deformities research center, research institute of dental sciences, shahid beheshti university of medical sciences, tehran, iran. 2department of orthodontics, school of dentistry, shahid beheshti university of medical sciences, tehran, iran. 3department of community oral health, school of dentistry, shahid beheshti university of medical sciences, tehran, iran. 4department of community oral health, research institute of dental sciences, shahid beheshti university of medical sciences, tehran, iran. 5department of oral and maxillofacial surgery, school of dentistry, shahid beheshti university of medical sciences, tehran, iran. *correspondence to: maryam sadeghipour (e-mail: sadeghipour1393@gmail.com) abstract objectives: describing what to expect after the first and second dose of vaccination will increase the public confidence. this study aimed to describe the short-term side effects after receiving the first, the second, or both doses of sputnik v, oxford-astrazeneca, and sinopharm vaccines in personnel and students of shahid beheshti dentistry school. methods: a cohort project has been conducting at the dental faculty since june 2020. this article is a cross-sectional study as a section of the cohort project. dental faculty began its campaign to vaccinate the personnel on april 2021, with the sputnik v and oxford-astrazeneca and sinopharm. an employed operator phoned each one by one after 48 hours of vaccination. she asked them about any experienced symptoms after receiving each dose. the reported symptoms were coded and categorized. results: the most common symptoms in astrazeneca’s first dose were fever followed by myalgia. after the second dose, the frequency of all symptoms had been reduced significantly. after the first dose of sputnik v, the most common symptoms were myalgia followed by fever. the frequency of fever and pain at the injection site increased significantly after the second dose (p < 0.001). in the sinopharm group, all symptoms occurred whit a low percentage. the most common symptoms were again, myalgia and pain at the injection site. conclusion: post-vaccination adverse effects were mild in all groups and controlled by analgesic. fever, myalgia and pain at the injection site are the most common symptoms reported after vaccination by all three types of vaccines. keywords: adverse effects, covid-19, vaccine issn 2413-0516 introduction during the covid-19 pandemic, people face significant health care challenges, lockdowns, anxiety, and stress, as there is no specific treatment for this pandemic. however, vaccine development is perhaps the best hope to stop this pandemic.1 the most effective vaccines mimic the preventive mechanism resulting from the recovery phase in the standard form of the disease.2 herd immunity is established when sufficient people are immune to stop new cases, which means that enough people are protected to stop person-to-person transmission in the community.3 the percentage of people who need to achieve herd immunity varies with specific diseases, e.g., measles needs about 95% of vaccination among the community. to achieve herd immunity for coivid-19, the exact percentage is not known.4 since the outbreak, multiple vaccine candidates based on rna and dna technologies inactivated viruses, and other approaches have been rapidly developed. doroftei et al. concluded that three vaccines had more than 90% efficacy (pfizer– biontech, ~95%; moderna, ~94%; and sputnik v, ~92%) except for oxford–astrazeneca (~81%).5 iran’s drug regulatory authority has given emergency approval to four vaccines for restricted use against covid-19, including sputnik v, covax in, sinopharm, and astrazeneca. many health workers in the dentistry school of shahid beheshti university have welcomed the program and undergone vaccination with sputnik v, oxford–astrazeneca (chadox1 ncov-19), and sinopharm since march 2021. sputnik v has been used in many countries. the adenoviruses are combined with the sars-cov-2 spike protein to make the vaccine, which prompts the body to make an immune response. interim results (based on data from 14,964 participants in the vaccine group and 4902 in the placebo group) indicate that the vaccine is 91.6% effective, based on its ability to prevent symptomatic infection. there were no cases of moderate or severe covid-19 in the vaccinated group at least 21 days following the first dose. no serious adverse events were detected. most adverse effects were mild, with over half experiencing pain at the injection site.6 oxford–astrazeneca is a viral vector vaccine using a modified chimpanzee adenovirus chadox1.7 the vaccine’s efficacy is 76.0% in preventing symptomatic covid-19 in 22 days following the first dose and 81.3% after the second. the vaccine has a good safety profile, with side effects including injection-site pain, headache, and nausea, generally resolving within a few days. more rarely, anaphylaxis may occur. in rare cases (around 1 in 100,000), the vaccine has been associated with an increased risk of blood clots in combination with low blood platelet level.8 as with any other medicine, vaccines are not free from side effects and adverse reactions, most of which are generally mild, well-tolerated, and self-resolving. these symptoms could indicate the body is developing the desired immunity.9 (submitted: 29 september 2021 – revised version received: 12 october 2021 – accepted: 21 october 2021 – published online: 26 december 2021) 359j contemp med sci | vol. 7, no. 6, november-december 2021: 358–362 m. mousavi et al. original adverse effects of covid19 vaccines among healthcare workers fear of the new vaccines is a driver of vaccine hesitancy.10 the knowledge about what happens post-vaccination in the actual world among the general population is still modest, thus, describing what to expect after the first and second dose of vaccination will help in lowering the apprehension about this type of vaccines, increased and also increases the public confidence and safety, and accelerates the vaccination process against covid-19. this study aimed to describe the short-term side effects after receiving the first, the second, or both doses of sputnik v, oxford-astrazeneca, and sinopharm covid-19 vaccines in a sample of 18 years and older personnel and students of shahid beheshti dentistry school. materials and methods study design and participants a comprehensive cohort project has been conducting at the dental faculty of shahid beheshti university of medical sciences since the reopening of universities in iran in june 2020. all personnel were screened and followed. contraction to the covid-19, signs, and symptoms after contraction, systemic condition, types of activities, and precautional behaviors have been monitored and registered. this article is a cross sectional study as a section of the cohort project. the present study was conducted over the period between april 10 to august 1, 2021. ethical approval was taken from shahid beheshti university of medical sciences’ review committee. procedures according to cdc and who protocols, the dental faculty began its campaign to vaccinate the personnel against the emerging coronavirus on april 2021, with the sputnik v and oxford-astrazeneca and sinopharm. all the students and staff were vaccinated at the same time. types of vaccines with the date of injection of first and second dose were summarized in table 1. 176 doses of oxford–astrazeneca and 600 doses of sputnik v were used in the vaccination. informed consent was obtained from each individual who was rejected to be vaccinated based on who advice. a resident general practitioner was established at the vaccination site to inform and observe any adverse effects. following the vaccination, all recipients were observed for 30 minutes. probable occurrence of side effects and adverse effects following immunization (aefi) like injection site pain, swelling, redness; fever, chills, rigor, sweating, headache, muscle ache, joint pain, cough, running nose, sore throat, diarrhea, nausea, vomiting, abdominal cramps, loss of appetite, skin rashes, itching, palpitation, dizziness, fainting, shortness of breath, chest tightness, was explained to each participant. a phone number was given to them to report any experienced adverse effects, including both systemic (whole-body) and local effects, following 30 days after receiving each dose. an employed operator phoned each one by one after 48 hours of vaccination. she asked them about any experienced symptoms after receiving the first/second dose and asked them if any medicines or painkillers were taking during those days. the reported symptoms were coded and categorized as shown in table 1. statistical analysis ibm-spss statistical package for social sciences version 21 (ibm corp: armonk, ny, usa) was used to obtain descriptive statistics and significant associations between variables. descriptive statistics were reported as frequencies and percentages. cross tabulation with mcnemar’s test was carried out to compare the frequency of individuals with positive side effects after each dose in each vaccine type. a chi-square test was used to compare the frequency of side effects after the first and second doses between different vaccine types. results the total number of vaccinated individuals in each vaccination group and distribution of genders were summarized in table 2. from 472 personnel and students, 236 were vaccinated with sputnik v while 192 received astrazeneca and 44 received sinopharm’s first dose. side effects of each vaccine in every dose were summarized in table 3. the most common symptoms in astrazeneca’s first dose were fever followed by myalgia. 87.2% of individuals who received medicine after the first dose. after the second dose, the frequency of all symptoms had been reduced significantly except tachycardia, cough, and flu-like symptoms. (p < 0.001) indeed, the frequency of those who had such symptoms in the first dose was significantly more than individuals who had the symptoms only after the second dose. however, the percentage of taking medication reduced significantly; still, 51.1% of participants used drugs after the second dose. after the first administration dose, the most common symptoms were myalgia followed by fever for the sputnik v group. 57.3% of individuals received medicine after the first dose. after the second dose, the frequency of fever and pain at the injection site increased significantly. the percentage of individuals who reported fever and pain at the injection site only after the second dose was significantly more than those who reported fever and pain only after the first dose. table 1. similar reported symptoms were coded and categorized code symptoms 1 fever/chilling 2 headache/dizziness 3 myalgia/backache/weakness/fatigue/lethargy 4 gastrointestinal 5 tachycardia/hypoxemia/heart pain/cough 6 pain/swelling at injection site 7 flu-like symptoms (rhinitis etc.) table 2. total number of vaccinated individuals in each vaccination group and distribution of genders vaccine type male (percentage) female (percentage) total number astrazeneca 58.3% 41.7% 192 sputnik v 44.5% 55.5% 236 sinopharm 47.7% 52.3% 44 360 j contemp med sci | vol. 7, no. 6, november-december 2021: 358–362 adverse effects of covid19 vaccines among healthcare workers original m. mousavi et al. (p < 0.001) 57.1 of participants received medicine to relieve pain after the second dose. in the sinopharm group, all symptoms occurred whit a low percentage. the most common symptoms after the first dose were, again, myalgia and pain at the injection site. nobody reported gastrointestinal problems or tachycardia/ hypoxemia/heart pain/cough. among all participants, gastrointestinal symptoms or flu-like symptoms were reported at least. after the first dose injection, the results showed a significant difference in the report of side effects among individuals vaccinated with different vaccines except for tachycardia and flu-like symptoms (p value < 0.05) (figure 1). after the injection of the second dose of astrazeneca and sputnik v, the report of fever, myalgia, and pain at the injection site were significantly different between the two types of vaccines (p = 0.0) (figure 2). discussion there is a variation in people’s acceptance to take the vaccines due to several factors. an important factor may be the shorttime development of new vaccines compared to the previously approved vaccines. another reason for this variation may be the usage of a newly emerging technique for mrna vaccines. there was also exaggeration and over-reporting of adverse effects of vaccines, as some of these effects are normal physiologic processes or developmental anomalies.11-13 thus, this study aimed to evaluate the short-term side effects of covid-19 vaccines, which are currently used in shahid beheshti dental school. in this study, these systemic symptoms, including myalgia, backache, weakness, fatigue, and lethargy, were the most commonly reported symptoms after the injection of the first dose of each vaccine. the second common symptom in astrazeneca and sputnik groups was fever in each dose. however, table 3. side effects of each vaccine in every dose side effects/taking medication astrazeneca sputnik sinopharm first dose (percentage) second dose (percentage) first dose (percentage) second dose (percentage) first dose (percentage) fever/chilling 70.2 25.1* 38.5 46.6* 8.3 headache/dizziness 28.7 7.5* 11.8 13.6 5.6 myalgia/back ache weakness/fatigue/lethargy 63.5 23.5* 46.4 45.2 25.0 gastrointestinal 11.7 2.9* 3.6 5.5 0 tachycardia/hypoxemia/heart pain/cough 3.5 .6 .9 1.8 0 pain/swelling at injection site 14.9 3.4* 2.3 8.6* 19.4 flu-like symptoms (rhinitis etc.) 1.6 1.1 3.6 1.4 2.8 taking medication 87.2 51.1* 57.3 57.1 19.4 fig. 1 comparison of side effects after the injection of first dose between vaccines. 361j contemp med sci | vol. 7, no. 6, november-december 2021: 358–362 m. mousavi et al. original adverse effects of covid19 vaccines among healthcare workers in the sinopharm group, the second common symptom was local pain at the injection site. all these were mild and self limiting. moreover, no treatment was required for any side effects. most similar cross-sectional studies4,10,14,15 also reported fever, tiredness, and pain at the injection site as the most routine symptoms after vaccination. not surprisingly, fever was one of the most frequently reported adverse reactions. similar evidence has been earlier garnered from the phase iii clinical trials of some of these vaccines, where the highest frequency of fever was up to 24% with astrazeneca vaxzervria.4 systemic symptoms are that the immune system could produce cytokines that affect the blood vessels, muscles, and other tissues. it may also produce flu-like symptoms that last for days after vaccination.16 alhazmi et al. reported that most of the participants in their study had tiredness and headache, and they stated that this was mainly due to the younger age of our participants. similarly, in this study, participants were young or below the retirement age.12 vaccines in “in situ” should be kept at a low temperature, including sinopharm vaccine that should store at average refrigeration temperature, and if injected without optimal warming up, this may increase the probability of pain of the injection site symptom. although all covid-19 vaccines cause similar post vaccination side effects, the severity and number of these side effects were significantly associated with vaccine type. in this study, astrazeneca caused more side effects after the first dose than sputnik v and sinopharm.15 similarly, menni et al. reported that those vaccinated with the chadox1 ncov-19 vaccine were more likely to experience systemic side effects than those who had been given other types.17 several viral vaccine development platforms include live attenuated, inactivated, dna-based, rna-based, protein based, and viral vector-based. astrazeneca vaccine consists of chadox1 (replication deficient simian adenovirus vector) containing the full-length structural sars-cov-2 spike (s) protein. the s protein plays a crucial role in penetrating host cells and initiating infection of all sars viruses. the astrazeneca vaccine expresses a codon-optimized coding sequence for the s protein in the human body, which builds immunity against sars-cov-2.18 sputnik v is a recombinant vaccine using human adenovirus vector 26 for the first vaccine and human adenovirus 5 for the second vaccine.2 the sinopharm vaccine has been developed using conventional technology (i.e., inactivated virus). dna vaccines are easy to produce and store with excellent stability and limited toxicity.19,20 the results of abu-hammad et al. study also study confirmed that sinopharm is a “quiet” vaccine since it was significantly associated with symptom-free vaccination.13 the results showed that almost all post-vaccination symptoms in the astrazeneca group, except tachycardia and flu-like symptoms, occurred more frequently after the first dose than the second dose. (p < 0.001). in the sputnik v group, side effects were more noticeable after the second dose. however, the frequency of only fever and pain in the injection site was significant, and most side effects showed no significant association with the number of doses. in a similar study, hatmal et al. assessed the side effects of sinopharm, astrazeneca, pfizer-biontech in jordan, and they also reported that side effects after the first dose were more intense than the second.15 however, according to the centers for disease control and prevention (cdc), side effects might be more noticeable after the second dose.21,22 it seems that in individuals taking the astrazeneca vaccine, the immune system will be activated more vigorously after the first dose. in this study, participants reported taking medication to alleviate pain and reduce symptoms. the percentage of individuals who received medicine was 87.2% for astrazeneca’s first dose to 19.4% for sinopharm’s first dose. in the astrazeneca group, there was a significant association between taking medication and the number of doses. astrazeneca fig. 2 comparison of side effects after the injection of second dose between vaccines. 362 j contemp med sci | vol. 7, no. 6, november-december 2021: 358–362 adverse effects of covid19 vaccines among healthcare workers original m. mousavi et al. company stated that prophylactic use of acetaminophen could reduce some symptoms.2 based on the results, the percentage of taking medications after both doses of sputnik v was similar to the second dose of astrazeneca. although, side effects after the second dose of astrazeneca had been reduced. previous studies suggested non-steroidal anti-inflammatory drugs to control fever or antihistamines for topical side effects of the sputnik v vaccine.2,15 such mild side effects are acceptable during covid-19 vaccination as the body will need some time to adopt vaccination doses and to trigger the immune system. the population should be informed about these minor side effects controlled with some symptomatic treatment like paracetamol. such medicine should also be taken as prophylaxis to avoid developing symptoms and increase the acceptance of the covid-19 vaccine among the mass population. it will help to counter this pandemic disease through ongoing vaccination program successfully.14 the strengths of the study include its large sample size and diversity of vaccines. this study also has some limitations. self-reported data were used, which can introduce information bias. also, the second dose of vaccination with sinopharm has not been completed. since this study was a part of a comprehensive cohort study and all personnel and student were counted, the sex and age of participants could not be matched for the results. it is suggested for future studies to evaluate objectively the antibody response to each vaccine administrated against covid 19 besides subjective reports. conclusion our study confirmed that post-vaccination adverse effects were mild in all groups and controlled by analgesic. in astrazeneca group, systemic reactions were more intense and occurred after the first dose more frequently compared with other groups. in general, fever, myalgia and pain at the injection site are the most common symptoms reported after vaccination by all three types of vaccines. conflicts of interest none.  this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v7i6.1121 references 1. meo s, bukhari i, akram j, meo a, klonoff d. covid-19 vaccines: comparison of biological, pharmacological characteristics and adverse effects of pfizer/biontech and moderna vaccines. eur rev med pharmacol sci. 2021;25(3):1663–9. 2. ghiasi n, arabsorkhi m, hoseyni t, esfandiari k, sadighpour t, jahantigh h. efficacy and side effects of sputnik v, sinopharm and astrazeneca vaccines to stop covid-19; a review and discussion. immunopathologia persa. 2021;7(2):31. 3. metcalf cje, ferrari m, graham al, grenfell bt. understanding herd immunity. trends in immunology. 2015;36(12):753–5. 4. lippi g, mattiuzzi c, henry bm. mild adverse reactions after covid-19 vaccination: updated analysis of italian medicines agency data. available at ssrn 3817988. 2021. 5. doroftei b, ciobica a, ilie o-d, maftei r, ilea c. mini-review discussing the reliability and efficiency of covid-19 vaccines. diagnostics. 2021;11(4):579. 6. baraniuk c. covid-19: what do we know about sputnik v and other russian vaccines? bmj. 2021;372. 7. raadsen m, du toit j, langerak t, van bussel b, van gorp e, goeijenbier m. thrombocytopenia in virus infections. journal of clinical medicine. 2021;10(4):877. 8. ramasamy mn, minassian am, ewer kj, flaxman al, folegatti pm, owens dr, et al. safety and immunogenicity of chadox1 ncov-19 vaccine administered in a prime-boost regimen in young and old adults (cov002): a single-blind, randomised, controlled, phase 2/3 trial. the lancet. 2020;396(10267):1979–93. 9. song bj, katial rk. update on side effects from common vaccines. current allergy and asthma reports. 2004;4(6):447–53. 10. saeed bq, al-shahrabi r, alhaj ss, alkokhardi zm, adrees ao. side effects and perceptions following sinopharm covid-19 vaccination. international journal of infectious diseases. 2021;111:219–26. 11. el-shitany na, harakeh s, badr-eldin sm, bagher am, eid b, almukadi h, et al. minor to moderate side effects of pfizer-biontech covid-19 vaccine among saudi residents: a retrospective cross-sectional study. international journal of general medicine. 2021;14:1389. 12. alhazmi a, alamer e, daws d, hakami m, darraj m, abdelwahab s, et al. evaluation of side effects associated with covid-19 vaccines in saudi arabia. vaccines. 2021;9(6):674. 13. abu-hammad o, alduraidi h, abu-hammad s, alnazzawi a, babkair h, abu-hammad a, et al. side effects reported by jordanian healthcare workers who received covid-19 vaccines. vaccines. 2021;9(6):577. 14. joshi u, singh p. adverse reaction following covisheild a covid 19 vaccine-experience of from a single centre. 15. hatmal mmm, al-hatamleh ma, olaimat an, hatmal m, alhaj-qasem dm, olaimat tm, et al. side effects and perceptions following covid-19 vaccination in jordan: a randomized, cross-sectional study implementing machine learning for predicting severity of side effects. vaccines. 2021;9(6):556. 16. hervé c, laupèze b, del giudice g, didierlaurent am, da silva ft. the how’s and what’s of vaccine reactogenicity. npj vaccines. 2019;4(1):1–11. 17. menni c, klaser k, may a, polidori l, capdevila j, louca p, et al. vaccine after effects and post-vaccine infection in a real world setting: results from the covid symptom study app. 2021. 18. folegatti pm, ewer kj, aley pk, angus b, becker s, belij-rammerstorfer s, et al. safety and immunogenicity of the chadox1 ncov-19 vaccine against sars-cov-2: a preliminary report of a phase 1/2, single-blind, randomised controlled trial. the lancet. 2020;396(10249): 467–78. 19. silveira mm, moreira gmsg, mendonça m. dna vaccines against covid-19: perspectives and challenges. life sciences. 2020:118919. 20. abbood, muhanad hadi; hassan, jabbar sirhan; mehammed, aqeel jassim. case study of covid 19 from august to end of december 2020 in babylon, iraq. iraq medical journal, v. 5, n. 3, sep. 2021 21. control cfd, prevention. possible side effects after getting a covid-19 vaccine. 2021. 22. al-khayat, zakarea abdullah yaseen et al. single center study of vaccination breakthrough infection with sars-cov-2 among erbil population in august 2021. journal of contemporary medical sciences, v. 7, n. 5, oct. 2021. 149j contemp med sci | vol. 5, no. 3, may–june 2019: 149–153 original risk factors of breast cancer among iraqi women sarab k.abedalrahman,a*besmah m.ali,bnajim abid issa al-khalidy,aand ali s. al-hashimia awomen health center, al-alwiyaa maternity teaching hospital, baghdad, iraq. bdepartment of public health, ghazi al-hariri hospital for specialized surgery, medical city, baghdad, iraq. *correspondence to sarab k.abedalrahman(email: sarab.abedalrahman@yahoo.com). (submitted: 25 december 2018 – revised version received: 20 january 2019 – accepted: 25 april 2019 – published online: 26 june 2019) introduction cancer is anticipated to rise by 70% in the coming 25 years in the developing countries. breast cancer is known to represent the main part that increase.1breast cancer has ranked the first malignancy among the iraqi population in general and the leading cause of death among women following cardiovascular diseases.2,3 iraqi breast cancer rates were generally constant between 2000 and2009, but newer statistics from the iraqi cancer registry detect increasing rates since 2009 with females over50s causing the main contribution to the increase.4 breast cancer arises from a multifactorial process. recently, attention was focused on genetic predisposition, and on its association with the modern life style,including diet, alcohol consumption.5oral contraceptive pills was proved to increase risk of breast cancer, which decrease after stopping it.6these risks are associated with more recent formulations of oral contraceptives.7 in iraq with a huge variation in life style modes, cultural, geographical, diets and habits, there are considerably limited information’s sources of on cancer risk factors. actually, the factors for differences in breast cancer incidence in women are not fully understood, which are likely to be explained by reproductive and lifestyle factors such as literacy, diet, age at menarche and menopause, age at first delivery, abortion, family history of breast cancer.8–10 the importance of knowledge of breast cancer risk factors is that it helps in detecting risk group women, and then to use it in the building of breast cancer screening programs and cancer prevention programs. as the risk factors is unique for each community, the study of breast cancer risk factors for iraqi women will be an important step in planning screening and prevention programs. this study attempts to find out some of the various risk factors of breast cancer among iraqi women. patients and methods a retrospective case control study done on patients attended the women health center, in al-alwiyaa maternity teaching hospital, during the period from january 1, 2018to october 30,2018. the study sample consists of 147 females proved to have breast cancer by histopathological examination, and 161 patients proved not to have breast cancer by radiological, histopathological, and cytological investigations and considered as a control group. data collected through standardized questionnaire to gain information about the personal, demographic characteristics, risk factors for breast cancer (e.g. reproductive, hormonal and genetic). the diagnosis of cases and controls done by consultant medical staff, using a triple assessment technique (i.e. physical breast examination, ultrasonography, with or without mammography and fine needle aspiration cytology) according to the patient state. the risk factors are asfollows:early age at menarche,late age at menopause, early age at firstpregnancy, and family history, was categorized according to the centers for disease control and prevention.11 the statistical package for social sciences, version 18 was used for data entry and analysis. pearson chi-square (χ2) test was used to compare proportions of different factors among different groups of study sample. odds ratio (or), and binary univariate logistic regression using enter method were used to find the associations of risk factors. p-value of ≤0.05 was regarded as statistically significant. results the age distribution show that most of cancer cases were 40–50 years (45, 30.6%), and 50–60 years (45,30.6%), versus <30 years (78, 48.4%) among control group, at the same period, this relation was statistically significant as shown in table 1. the mean age among cases 50.6±11.3, was significantly higher than controls 34.7±12.3. the breast cancer starts at the age of 28 years. most of the breast cancer cases and controls were from middle socioeconomic state as follows; 104(70.7%) and 119 (73.9%) respectively. estimating the risk using odds ratio objective this study aimed to identify the risk factors of breast cancer among iraqi women. methods a retrospective case control study, done on 147 breast cancer cases compared with 161 non-malignant cases selected randomly from women health center in al-alwiyaa maternity teaching hospital. results increased risk for breast cancer significantly associated with increased age especially ≥60 years, widow or divorced women[odds ratio (or) 3.7, confidence interval (ci1.5–8.5)], menopause [or 6.43, ci(3.58–11.9)],age at menarche <12 years[or 1.99, ci(1.04–3.8)], and use of contraceptive pills for≥1 year [or 1.99, ci(1.01–3.95)]. conclusion positive risk factor for breast cancer was old age≥60 years, widow or divorced women, menopause, age at menarche <12 years, and use of contraceptive pills for≥1 year. family history, seconddegree relative,not associated with breast cancer. there are some discrepancies between our findings and other studies in the literature need further studies. keywords breast cancer, risk factors, iraqi women issn 2413-0516 150 j contemp med sci | vol. 5, no. 3, may–june 2019: 149–153 risk factors of breast cancer among iraqi women original s.k.abedalrahman et al. demonstrate that socioeconomic state, occupation, and education, were non-significantly associated with breast cancer. however, regarding marital status, when comparing the widow/divorced women to married show [or 3.7(1.1.5–8.5)], this relation was statistically significant, as shown in table 2. the odds ratio of the menopause was 6.43, age at menarche 1.99, hormonal contraception use for ≥1 year 1.99, and menstrual irregularity 1.56 was significantly associated with breast cancer, while age at menopause ≥55 year was non-significantly associated with breast cancer as shown in table 3. the odds ratio for family history of breast cancer was non-significantly associated with breast cancer: family history of breast cancer 0.804, firstdegree relative 1.036, firstand seconddegree relative 1.036, only seconddegree relative 0.56, one relative 0.82, two or more relatives 0.73, as shown in table 6. discussion breast cancer was reported among females in 20s, which is the same to what reported in previous literatures in iraq,4,12,13and neighbor countries14but lower than in cameron 35 years.15this may be due to same environmental exposure. about 52.4% of cases aged <50 years this figure goes with what reported previously in iraq,4,12,13 and differ from what is known globally that, 75% of new cases occurs in women aged older than 50 years,16,17 this difference indicate presence of an environmental factors. the early onset of cancer is accompanied by or increment with increasing age, indicating that factors other than age may affect the breast cancer development.15 most of cases and controls were from middle socioeconomic state 104(70.7%), 119 (73.9%), respectively,this is similar to previous iraqi studies,18 as most of the iraqi women were from middle income families and those with high socioeconomic state usually seek the private health care services, that we cannot catch them. women are at higher risk of breast cancer with high socioeconomic status of 2.5-foldthan those from lower socioeconomic level, which is similar to nkondjock etal., and this may be due to the fact that they tend to carry fewer pregnancies or have children at an older age.19 employed womenhad higher risk of breast cancer of 1.7 than housewives, which agree with ghiasvand et al.14 this may be related to exposure to other risk factors, e.g. carcinogens and stress, as well as they were more educated and had higher socioeconomic status, which by itself risk factors for breast cancer. most of the patients were of low educational level, this agree with previous iraqi studies.13,18,20high educational level had higher odds ratiothan low educational level,this goes with ghiasvand et al.14those patients were more health education to seek medical counseling. menopause had 6.43-fold risk for having breast cancer than menstruating women, goes with what was found in india 1.6-fold,21 which was higher than what was found in iran 0.95fold,22 and cameron 0.37-fold.15this may be due to effect of aging as the menopausal women are already old, or to the high postmenopausal blood estrogen levelswhich is established as risk factors.23sahan et al.24 in iraq documented an increased serum estradiol and prolactin among the preand post-menopausal breast cancer women, and recommends emphasizing the necessity of co-operation between the ministry of health and the ministry of commerce and protecting them from dangerous behavior by providing them with sufficient support and guidance to stay away from the hormonic products and focusing on the extension programs in the protection of the community through educating them with the guidance. late menopause increases the risk of breast cancer. risk increases by almost 3% for each year older at menopause, so that a women who has the menopause at 55 years rather than 45 years, has approximately 30% higher risk.25this study revealed that menopause at the age of 55 yearsincreases the risk of breast cancer by twofoldthan those their age of menopause <55 years. this is consistent with studies in morocco(1.36-fold),26(1.7-fold)27and lower than found by al ramahi28 menopause above 50 years had 9.5-fold risk than under 45 years. this discrepancy may be explained by that most women (especially old age) have difficulties in recalling past events such as age at menarche; therefore, recall bias was unavoidable.13 age at menarche of <12 years had twofold risk than at age ≥12 years, this agree with altaha (3.05).18 this result differs from iranian studies,22,29 which revealed 1.5-fold of risk in women with age at menarche of<13 years was fourfold. use of hormonal contraceptivepills for 1 year or more, increase the risk bytwofold than non-hormonal contraceptive drugs user, this was supported by the following studies:in china (1992), norway and sweden (2002) and malaysia (2005).30–32 however, anafrican study show negative association.33 menstrual irregularity was associated with increased risk of breast cancer by 1.6-fold than women with regular menstruation, this finding is consistent with terry34 that irregular menstruation associated with 1.12-fold risk for breast cancer, and other previous studies.35,36 while opposed by most of the studies which found inverse effect on breast cancer risk.37–41this increase may be due to use table 1 age distribution of study groups cases no (%) controls no (%) total no (%) or (95%ci) p <30 years 6 (4.10) 78 (48.40) 84 (27.30) 1 30–40 years 26 (17.70) 27 (16.80) 53 (17.20) 12.519 <0.05 40–50 years 45 (30.60) 40 (24.80) 85 (27.60) 14.625 <0.05 50–60years 45 (30.60) 15 (9.30) 60 (19.50) 39.000 <0.05 >60 years 25 (17.60) 1(0.60) 26 (8.4) 325.000 <0.05 mean 50.6±11.3 34.7±12.3 χ2= 98.7, p<0.05. 151j contemp med sci | vol. 5, no. 3, may–june 2019: 149–153 original risk factors of breast cancer among iraqi womens.k.abedalrahman et al. table 2. the socio demographic variables among breast cancer cases and women without breast cancer cases no (%) controls no (%) total no (%) or (95% ci) p socioeconomic low 37 (25.2) 30(18.60) 67 (21.80) 1 >0.05 middle 104 (70.7) 119(73.90) 223 (72.40) 1.4 (0.8–2.5) >0.05 high 6 (4.1) 12(7.50) 18 (5.80) 2.5 (0.8–7.5) >0.05 marital status married 108 (73.5) 127(78.90) 235 (76.30) 1.00 unmarried 14 (9.50) 26(16.10) 40 (13.00) 0.63 (0.3–1.5) >0.05 widow/divorced 25 (18.8) 8(5.9) 33 (12.3) 3.7 (1.1.5–8.5) <0.05 occupation housewife 114 (77.60) 137(85.10) 251 (81.50) 1.00 employed 33 (22.4) 24(14.9) 57 (18.5) 1.7 (0.9–2.9) >0.05 education illiterate 44 (29.9) 37 (23) 81 (26.30) 1.00 >0.05 primary 49 (33.3) 61(37.9) 110 (35.70) 1.5 (0.8–2.6) >0.05 intermediate 24 (16.3) 30 (18.60) 54 (17.50) 1.5 (0.7–2.9) >0.05 secondary 12 (8.20) 8 (5.00) 20 (6.50) 0.8 (0.3–2.1) >0.05 university 18 (12.2) 25 (15.50) 43 (14.00) 1.7 (0.0.8–3.5) >0.05 total 147 (100) 161 (100) 308 (100) table 3 the hormonal risk factors among breast cancer cases and women without breast cancer hormonal risk factor cases (%) controls (%) total (%) or (95% ci) p menopause yes 61 (41.5) 16 (9.90%) 77 (25.00%) 6.43 (3.58–11.9) <0.05 no 86 (58.50) 145 (90.10%) 231 (75.00%) age at menarche <12 28 (19.00) 17 (10.60) 45 (14.60) 1.99 (1.04–3.8) <0.05 ≥12 119 (81.00) 144 (89.40) 263 (85.40) age of menopause <55 years 42 (68.90) 13 (81.30) 55 (71.40) 1.96 (0.5–7.96) >0.05 ≥55 years 19 (31.10) 3 (18.80) 22 (28.60) contraceptive <1 year 122 (83) 146 (90.7) 268 (87) 1.99 (1.01–3.95) <0.05 ≥1 year 25 (17.00) 15 (9.30) 40 (13.00) regularity irregular 22 (26.20) 27 (18.50) 49 (21.30) 1.56 (0.8–2.96) >0.05 regular 62 (73.80) 119 (81.50) 181 (78.70) table 6. the genetic risk factors among breast cancer cases and women without breast cancer genetic risk factors cases (%) controls (%) total (%) or (95%ci) p family history of breast cancer yes 35 (23.80) 45(28.00) 80(26.00) 0.8(0.48–1.34) >0.05no 112 (76.20) 116 (72.00) 228 (74.00) 1 relative degree no relative 112 (76.20) 116 (72.00) 228 (74.00) 1 first degree relative 17 (11.60) 17 (10.60) 34 (11.00) 1.04 (0.5–2.1) >0.05 second degree relative 12 (8.20) 22 (13.70) 34 (11.00) 0.56 (0.26–1.2) >0.05 first and second degree 6 (4.10) 6 (3.70) 12 (3.90) 1.036 (0.3–3.3) >0.05 no. of relatives 0 112 (76.20) 116 (72.00) 228 (74.00) 1 1 28 (19.00) 35 (21.70) 63 (20.50) 0.83 (0.47–1.5) >0.05 ≥2 7 (4.80) 10 (6.30) 16 (5.20) 0.73 (0.3–1.97) >0.05 152 j contemp med sci | vol. 5, no. 3, may–june 2019: 149–153 risk factors of breast cancer among iraqi women original s.k.abedalrahman et al. of hormonal therapy for regulation as it was found by titus-ernstoff et al.41 that the apparent inverse association with irregular menstrual cycles was stronger among women who did not use hormonal replacement therapy. positive family history was not significantly associated with increase breast cancerrisk (0.8), while many studies reported the strong association between family history and breast cancer,42in moroccan two to threefold increased risk,26and in southern iran9.07.22,14 family history of the firstdegree relative show increased risk by 1.036-fold than women without family history of breast cancer, thisagree with a study in iraq 2.1-fold increase,28and in cameron 1.3.15 patient with one or more relatives with breast cancer was non-significantly associated with increased risk of breast cancer, this oppositionwhat found by brewer et al.43in large data base study, a cohort of over 113,000 women from the general uk population, found that one relative with breast cancer history increase the risk by 1.7 times and two or more increase the risk by 2.5 times. and the effect of family history was more prominent in women aged <45 years (2.47-fold), while among those aged >45 years the risk was 1.63-fold.the majority of multiple-case families that segregate both breast and ovarian cancer in a dominant fashion are due to mutations in the brca1 gene on chromosome 17q.44 this difference may be explained by the presence of other factors that affect both the cases and control groups, in which its effect appear even on the age distribution also, or may be due to having a relative with breast cancer is promoting for seeking health services, which affect our results. from the results of this study, a need for further investigating the environmental factors that may have direct or indirect effect, on breast cancer, particularly among younger women. conclusion and recommendation positive risk factor for breast cancer was ≥60 years of age, widow or divorced women, menopause, age at menarche <12 years, and use of contraceptive pills for≥1 year,family history, seconddegree relative, not associated with breast cancer. there are some discrepancies between our findings and other studies in the literature which necessity need further studies. conflicts of interest none.  references 1. center m, rebecca s, ahmedin j. global cancer facts &figures.2nded.; american cancer society,atlanta,2011,1–52. 2. iraqi cancer board. results of the iraqi cancer registry 2012. iraqi cancer registry center, ministry of health,baghdad, 2015. 3. alwan nas. breast cancer among iraqi women: preliminary findings from a regional comparative breast cancer research project. jgloboncol.2016;2:255–258. 4. al-hashimi mm, wangxj. breast cancer in iraq, incidence trends from 2000-2009. asian pacjcancer prev.2014;15:281–286. 5. mcpherson k, steel cm, dixonj. m.. abc of breast diseases. breast cancer-epidemiology, risk factors, and genetics. bmj 2000;321:624–628. 6. bhupathiraju sn, grodstein f, stampfer mj, willett wc, hu fb, manson je. exogenous hormone use: oral contraceptives, postmenopausal hormone therapy, and health outcomes in the nurses’health study. am j public health. 2016;106:1631–1637. 7. mørch ls, skovlund cw, hannaford pc, iversen l, fielding s, lidegaard ø. contemporary hormonal contraception and the risk of breast cancer. n engl j med. 2017;377:2228–2239. 8. meshram ii, hiwarkar pa, kulkarni pn. reproductive risk factors for breast cancer: a case control study. online j health allied sci. 2009;8:1–4. 9. pakseresht s, ingle gk, bahadur ak, ramteke vk, singh mm, garg s, et al. risk factors with breast cancer among women in delhi. indian j cancer. 2009;46:132–138. 10. lodha sr, nandeshwara s, pal kd. risk of breast cancer in obese women: a case control study. natl j community med. 2010;1:166–167. 11. joseph da, king jb, miller jw, richardson lc; centers for disease control and prevention (cdc). prevalence of colorectal cancer screening among adults--behavioral risk factor surveillance system, united states, 2010. mmwr suppl. 2012;61:51–56. 12. alwan na. breast cancer: demographic characteristics and clinico-pathological presentation of patients in iraq. east mediterr health j. 2010;16:1159–1164. 13. lafta rk, saeed eq, isa sa. risk factors of breast cancer among women (a sample from baghdad). iraqi j commun med. 2013;26:1–6. 14. ghiasvand r, maram es, tahmasebi s, tabatabaee sh.risk factors for breast cancer among young women in southern iran. int. j. cancer. 2011;129:1443–1449. 15. essiben f, foumane p, meka enu, soh ps, sama,jd osogo e, et al. risk factors for breast cancer: a case-control study of 315 women followed in the gynecology and oncology departments of two university teaching hospitals in yaounde, cameroon. open j obstet gynecol. 2016;6:676–688. 16. robbins sl, cotran rs, kumar v.pocket companion: pathologic basis of disease. 2nded.; wb saunders co, philadelphia, usa, 2001. 17. international agency for research on cancer.iarc hand-books of cancer prevention. weight control and physical activity. vol 6, iarc press, france,2002. 18. altaha ma, al-ani. reproductive factors and risk of breast cancer. al-anbar med j. 2013;11:17–26. 19. nkondjock a, ghadirian p. [risk factors and risk reduction of breast cancer]. med sci (paris).2005;21:175–180 (in french). 20. alwan nas. family history among iraqi patients diagnosed with breast cancer. int j sci res. 2017;6:869–873. 21. butt z, shahbaz u,naseem t,ashfaq u,khan ua, khan mr, et al.reproductive risk factors for female breast cancer: a case – control study. ann king edw med univ. 2009;15:206–210. 22. mahouri k, dehghani zahedani m, zare s. breast cancer risk factors in south of islamic republic of iran: a case-control study.east mediterr health j. 2007;13:1265–1273. 23. graham ac, heather jb, rulla mt. breast cancer. in: david s, joseph ff (eds.) cancer epidemiology and prevention, 3rded.; oxford university press inc., new york, 2006, pp. 995–1012. 24. sahan es, majid ay, hassan as. evaluation of estradiol and prolactin serum levels “in premenopausal; and postmenopausal” women with ((breast cancer)) in baghdad city. iraqi natl j nurs spec. 2017;30:111–117. 25. breast cancer and hormone replacement therapy: collaborative reanalysis of data from 51 epidemiological studies of 52,705 women with breast cancer and 108,411 women without breast cancer. collaborative group on hormonal factors in breast cancer. lancet 1997; 350:1047–1059. 26. laamiri fz, bouayad a, hasswane n, ahid s, mrabet m, amina b.risk factors for breast cancer of different age groups: moroccan data? open j obstet gynecol. 2015;5:79–87. 27. khalis m, charbotel b, chajès v, rinaldi s, moskal a, biessy c, et al. menstrual and reproductive factors and risk of breast cancer: a case-control study in the fez region, morocco. plos one 2018;13:e0191333. 28. al-ramahi s.j.j, al-saffar ajaa. breast cancer risk factors among iraqi women from baghdad/iraq 2012. published thesis, the arab board in community medicine,2013, 37. 29. bahir bh, al-naqeeb aa., niazy sm. risk factors for breast cancer in a sample of women. iraqi j. commun. med.2012;25:4–8. 30. wang qs, ross rk, yu mc, ning jp, henderson be, kimm ht. a case-control study of breast cancer in tianjin, china. cancer epidemiol biomarkers prev. 1992;1:435–439. 153j contemp med sci | vol. 5, no. 3, may–june 2019: 149–153 original risk factors of breast cancer among iraqi womens.k.abedalrahman et al. 31. kumle m, weiderpass e, braaten t, persson i, adami ho, lund e. use of oral contraceptives and breast cancer risk: the norwegianswedish women’s lifestyle and health cohort study. cancer epidemiol biomarkers prev. 2002; 11:1375–1381. 32. norsa’adah b, rusli bn, imran ak, naing i, winn t. risk factors of breast cancer in women in kelantan, malaysia. singapore med j. 2005;46:698–705. 33. balekouzou a, yin p, pamatika cm, bekolo ce, nambei sw, djeintote m, et al.reproductive risk factors associated with breast cancer in women in bangui: a case-control study. bmc womens health. 2017;17:14 34. terry kl, willett wc, rich-edwards jw, hunter dj, michels kb. menstrual cycle characteristics and incidence of premenopausal breast cancer. cancer epidemiol biomarkers prev.2005;14:1509–1513. 35. grabrick dm, vierkant ra, anderson ke, cerhan jr, anderson ve, seller ta. association of correlates of endogenous hormonal exposure with breast cancer risk in 426 families (united states). cancer causes control. 2002;13:333–341. 36. gao yt, shu xo, dai q, potter jd, brinton la, wen w, et al. association of menstrual and reproductive factors with breast cancer risk: results from the shanghai breast cancer study. int j cancer. 2000;87:295–300. 37. clavel-chapelon f. cumulative number of menstrual cycles and breast cancer risk: results from the e3n cohort study of french women. cancer causes control. 2002;13:831–838. 38. den tonkelaar i, de waard f. regularity and length of menstrual cycles in women aged 41-46 in relation to breast cancer risk: results from the domproject. breast cancer res treat. 1996;38:253–258. 39. wu ah, ziegler rg, pike mc, nomura am, west dw, kolonel ln, et al. menstrual and reproductive factors and risk of breast cancer in asianamericans. br j cancer. 1996;73:680–686. 40. parazzini f, la vecchia c, negri e, franceschi s, tozzi l. lifelong menstrual patterns and risk of breast cancer. oncology. 1993;1993:222–250. 41. titus-ernstoff l, longnecker mp, newcomb pa, dain b, greenberg er, mittendorf r, et al. menstrual factors in relation to breast cancer risk. cancer epidemiol biomarkers prev. 1998;7:783–789. 42. collaborative group on hormonal factors in breast cancer. familial breast cancer: collaborative reanalysis of data from 52 epidemiological studies of 58209 women with breast cancer and 101986 women without the disease. lancet. 2001;358:1389–1399. 43. brewer hr, jones me, schoemaker mj, ashworth a, swerdlow aj. family history and risk of breast cancer: an analysis accounting for family structure. breast cancer res treat.2017;165:193–200. 44. ford d, easton df, peto j. estimates of the gene frequency of brca1 and its contribution to breast and ovarian cancer incidence.am j hum genet. 1995;57:1457–1462. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. dx.doi.org/10.22317/jcms.06201906 102 j contemp med sci | vol. 8, no. 2, march-april 2022: 96–100 original demographic evaluation of post-concussion syndrome in referrals to bandar abbas forensic medical center, south of iran from march 2020 to august 2021 saeed mohammadi1, seyed javad mirhadi2, hosein javadi vasigh1, khatere asadi1, azadeh memarian3,* , farahnaz nikkhah4,5 1legal medicine center of hormozgan, bandar abbas, iran. 2legal medicine research center, iranian legal medicine organization, bandar abbas, iran. 3department of neonatology, faculty of medicine, mazandaran university of medical sciences, sari, iran. 4operating room nursing, rasool akram medical complex clinical research, iran university of medical sciences, tehran, iran. development center (rcrdc), iran university of medical sciences, tehran, iran. *correspondence to: azadeh memarian (e-mail: a.memarian@mazums.ac.ir) (submitted: 17 december 2021 – revised version received: 04 january 2022 – accepted: 25 january 2022 – published online: 26 april 2022) abstract objectives: the aim of the present study is the demographic assessment of pcs in referrals to forensic medical centers in bandar abbas. methods: this cross-sectional and descriptive study was performed on 72 patients with mild brain trauma who were referred to bandar abbas forensic medical center. pcs was confirmed according to the diagnostic and statistical manual of mental disorders (dsm-iv) criteria. information on age, sex, mechanism of trauma, the time interval between the first visit to the forensic medical center, level of consciousness, number of hospitals stays days, number of days in icu, and symptoms at initial referral were recorded in the designed form. results: the mean age of patients was 30.81 ± 13.39 years. there was a significant difference in sex and mechanisms of trauma (p < 0.001). the average time interval of the first referral to forensic medical center was 9.44 ± 18.37 days. 87.5% were hospitalized and only 9.7% were hospitalized at icu. the consciousness level of all patients was in the range of 12 to 15 (mild range). among symptoms, headache (87.5%) and dizziness (81.9%) were the most significant prevalent symptoms. 70.8% of patients had no symptoms one month after the accident but 12.5% still had symptoms and only 9.7% still had symptoms of concussion after 3 months. conclusion: according to the results, pcs mostly happened in the male gender and the main mechanism of trauma was an accident. headache and dizziness were the main symptoms. only a small percentage of patients have symptoms after one month and three months, post-injury. keywords: post-concussion syndrome (pcs), mild traumatic brain injury (mtbi), symptoms issn 2413-0516 introduction traumatic brain injury is a significant public health concern globally and they may begin a series of metabolic reactions which lead to post-concussion syndrome (pcs).1 pcs after a traumatic brain injury and mild traumatic brain injury (mtbi) are very prevalent.2 pcs is a prototypal psychosomatic disorder and both psychosocial and physical factors playing a significant role in its etiology.3 numerous factors raise the pcs development risk after brain injury. a previous mental disorder like anxiety or depression, acute post-traumatic stress, and pain were predictive of pcs.4,5 age above 40, female gender, prior head injuries, and substance abuse are reported as other risk factors for pcs.6 pcs can be diagnosed using the international classification of diseases (icd-10) and diagnostic and statistical manual of mental disorders dsm-iv.7,8 the prognosis of pcs is commonly good. most of the patients recover by 3 months.9 however, in 10–20% of the cases, pcs may continue for weeks or months as a result of metabolic and structural brain injuries. among these patients, 25–33% experience persistent post-concussion syndrome and the symptoms become chronic and last for more than 6 months.10,11 pcs symptoms comprise three clinical areas: somatic symptoms such as headache, insomnia, fatigue, tinnitus, dizziness, sensitivity to noise or light; cognitive symptoms including reduced memory, concentration, and attention; and affective symptoms such as depression, anxiety, and irritability.1 in the assessment of pcs, the clinician had better evaluate consciousness loss, the post-traumatic amnesia duration, and the glasgow coma scale after trauma. they should assess the information about the accident and hospital stays and the outcomes of treatment should be recorded.3 it was shown that the differences in the incidence of pcs could be as a result of cultural diversities.12 moreover, in a study, it has been shown that the effect of culture and language should be considered in pcs assessments.13 subsequently, prevalence rates and demographic features of pcs in populations may vary between countries. this study aimed to investigate the prevalence of post-concussion syndrome in patients referred to bandar abbas forensic medicine center. materials and methods this is a cross-sectional and descriptive study. in one year, patients with mild brain trauma, no structural change in ct scan, mild level of consciousness (glasgow coma scale (gcs) = 13–15), and mild memory impairment before and after the traumatic event (less than 1 hour) who referred to bandar abbas forensic medical center, south of iran, from march 2020 to august 2021, for whom the diagnosis of concussion was made were selected. 5 https://orcid.org/0000-0002-6872-1870 103j contemp med sci | vol. 8, no. 2, march-april 2022: 96–100 s. mohammadi et al. original demographic evaluation of pcs in referrals to bandar abbas forensic medical center information on age, sex, mechanism of trauma (accident, quarrel), the time interval between the first visit to the forensic medical center, level of consciousness, number of hospitals stays days, number of days in icu, and symptoms at initial referral (headache, dizziness, anger, sleep disturbance, fatigue, forgetfulness, memory impairment, and concentration disorder) were recorded in the designed form. if there are at least three of the above symptoms, re examination was considered for patients. at one month after the accident, the symptoms were re-examined and if they did not improve, neurological counseling was performed to confirm the symptoms. if symptoms do not improve, re-examination was done for 3 months after the accident, and symptoms were re-examined at 3 months post-accident and confirmed by a neurologist. post-concussion syndrome was confirmed according to the diagnostic and statistical manual of mental disorders (dsm-iv) criteria if there were at least three of these symptoms for at least 3 months. statistical analysis spss version 20 was used to analyze the data. data are presented as frequency and percentage and mean and standard deviation. univariate chi-square test was used to show the difference of variables between the research samples. values were significant at p < 0.05. result seventy-two patients met the criteria and selected for the study. the mean age of patients was 30.81 ± 13.39 years. the univariate chi-square test showed that there was a significant difference between the research sample in terms of sex and mechanisms of trauma (table 1). the average time interval between the accident and the first referral to forensic medical center was 9.44 ± 18.37 days. as shown in table 2, the level of consciousness of all individuals was in the range of 12 to 15 (mild range). also, most of the patients, 53 (73.6%), had a level of consciousness of 15. the univariate chi-square test showed that there was a significant difference in terms of the level of consciousness. among the patients, 63 patients (87.5%) were hospitalized and 9 patients (12.5%) were not hospitalized. most of the patients, 65 (90.3%), were not hospitalized in the icu and only 7 patients (9.7%) had a history of being admitted to the icu. the univariate chi-square test showed that there was a significant difference in terms of the prevalence of hospitalization and the prevalence of hospitalization in the intensive care unit (table 3). the average days of hospitalization and hospitalization in the icu are shown in table 4. at referral, 87.5% had a headache and 81.9% had dizziness. most of the patients (61.1%) did not have the “anger” symptom. however, this symptom was present in 38.9% of patients. 44 patients (61.1%) had “sleep disorder”. 51.4% had a sign of “fatigue” and 48.6% did not have. 35 patients (48.6%) had “forgetfulness” and 37 patients (51.4%) did not have “forgetfulness”. most patients (91.7%) did not have “ paramnesia” and 64.88% did not have “concentration disorder” and only 8 patients (11.1%) had. univariate chi-square test showed that there was a significant difference in terms of headache, dizziness, paramnesia, and concentration disorder symptoms. on the other hand, the univariate chi-square test showed that there was no significant difference in terms of “anger” sign, sleep disorder, fatigue, and “forgetfulness” symptoms (table 5). most of the patients (70.8%) had no symptoms one month after the accident but 12.5% still had symptoms of concussion one month after the accident. the univariate chi-square test showed that there was a significant difference in terms of the prevalence of symptoms at the referral one month after the table 1. the frequency of gender prevalence and mechanism of trauma between the accident and the first referral of patients with the diagnosis of pcs variable frequency percent %cf p-value gender male 51 70.8 70 p < 0.001 female 21 29.2 100 total 72 100 mechanism of trauma accident 57 79.2 79.2 p < 0.001 quarrel 15 20.8 100 total 72 100 table 2. level of consciousness in patients with the diagnosis of pcs level of consciousness frequency percent %cf p-value 12 2 2.5 2.8 < 0.001 13 8 11.1 14.1 14 8 11.1 25.4 15 53 73.6 100 missing data 1 1.4 total 72 100 table 3. prevalence of hospitalization and hospitalization in icu in patients with the diagnosis of pcs frequency percentage %cf p-value prevalence of hospitalization yes 63 87.5 87.5 < 0.001 no 9 12.5 100 total 72 100 prevalence of hospitalization in the icu yes 7 9.7 9.7 < 0.001 no 65 90.3 100 total 72 100 table 4. mean of hospitalization days and hospitalization days in icu in patients with the diagnosis of pcs variable no. mean sd min. max. days of hospitalization 71 2.02 1.58 1 8 days of hospitalization in the icu 71 1.80 1.30 1 4 104 j contemp med sci | vol. 8, no. 2, march-april 2022: 96–100 demographic evaluation of pcs in referrals to bandar abbas forensic medical center original s. mohammadi et al. accident. 36.1% had no symptoms three months after the accident. 9.7% still had symptoms of concussion at the referral three months after the accident. data from 54.2% of patients were also not reported. the univariate chi-square test showed that there was a significant difference between the study samples in terms of the prevalence of symptoms at the referral three months after the accident (table 6). table 5. prevalence of symptoms at initial referral in patients diagnosed with pcs variable frequency percentage %cf p-value headache yes 63 87.5 87.5 < 0.001 no 9 12.5 100 total 72 100 dizziness yes 59 81.9 81.9 < 0.001 no 13 18.1 100 total 72 100 anger yes 28 38.9 38.9 > 0.05 no 44 61.1 100 total 72 100 sleep disorder yes 44 61.1 61.1 > 0.05 no 28 38.9 100 total 72 100 fatigue yes 37 51.4 51.4 > 0.05 no 35 48.6 100 total 72 100 forgetfulness yes 35 48.6 48.6 > 0.05 no 37 51.4 100 total 72 100 paramnesia yes 6 8.3 8.3 < 0.001 no 66 91.7 100 total 72 100 concentration disorder yes 8 11.1 11.1 < 0.001 no 64 88.9 100 total 72 100 other symptoms yes 3 4.2 4.2 < 0.001 no 69 95.8 100 total 72 100 table 6. prevalence of symptoms in one month and three months after the accident in patients with the diagnosis of pcs variable frequency percentage %cf p-value prevalence of symptoms in a month after the accident yes 9 12.5 15 < 0.001 no 51 70.8 100 missing data 12 16.7 total 72 100 prevalence of symptoms in referral three months after the accident yes 7 9.7 21.2 < 0.001 no 26 36.1 100 missing data 39 54.2 total 72 100 discussion in the present study, the demographic evaluation of pcs was performed in patients who were referred to the forensic medical center of bandar abbas as a result of mild brain injury. according to the result of this study, the mean age of the patients with pcs was 30.81 ± 13.39 years. most of the patients were male and the main mechanism of trauma was an accident. the level of consciousness of all patients was in the mild range (12 to 15) and most of them had the level of consciousness of 15. most of the patients were hospitalized but only 9.7% being admitted to the icu. headache and dizziness were significantly the most prevalent symptoms in pcs patients. there was no significant difference in terms of anger, sleep disorder, fatigue, and forgetfulness symptoms. the prevalence of concentration disorder and paramnesia was very low in patients. most of the patients had no symptoms one month and 3 months after injury but only 12.5% at one month and 9.7% at 3 months after still had symptoms of concussion. dean et al. compared pcs prevalence in individuals with mild tbi and without head injury and reported a higher prevalence of headaches and significantly higher cognitive problems were those with mtbi in comparison to the control group.14 similar to the result of the present study the prevalence of headaches was high. balakrishnan et al. evaluated the pcs after mtbi and in contrast to this study, they reported the female gender as the dominant gender for pcs. similar to the result of the current study the prevalence of pcs was low after 2 weeks, 3, and 6 months and they were 9.6%, 8.1%, and 8.1%. again like this study, the main reason for injury was traffic accidents.15 varner et al. study in adults with acute mild traumatic brain injury, 20.3% had persistent concussion symptoms. headache, use of drugs or alcohol at the time of injury, the injury happening by bike or motor vehicle crash, history of depression or anxiety, and numbness were defined to be independently related to persistent concussion symptoms in a month.16 consistent with the present study headache was the main symptom. beauchamp et al. compared pcs symptoms in sports related mtbi with non-sports-related mtbi and reported that patients with sports-related mtbi might be at lower risk for symptoms like dizziness and fatigue in 90 days after injury. they suggested that patients with non-sports-related mtbi may show more pcs symptoms and that the physical activity level could affect the rehabilitation of the patient.17 105j contemp med sci | vol. 8, no. 2, march-april 2022: 96–100 s. mohammadi et al. original demographic evaluation of pcs in referrals to bandar abbas forensic medical center acknowledgments all the researchers who have helped us in this research project. the authors also thank the rasool akram medical complex clinical research development center (rcrdc) for its technical and editorial assists. conflict of interest the author reports no conflicts of interest in this work. ethical consideration the study is approved by the ethics committee of forensic medicine organization of the country of iran (code: 2062(24.12.98 ). written informed consent was obtained from patients. consent for publication written informed consent was obtained from the patients for publication of this paper. informed consent written informed consent was obtained from the patients for participation in the study. a copy of the written consent is available for review by the editor-in-chief of this journal. data availability statement the data that support the findings of this study are available from corresponding author on reasonable request. funding the authors declare that this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.  in a study by van der vlegel 22.0% of the 1282 patients in the general injury population met the pcs criteria. patients with head injuries showed a high frequency of pcs (29.4%). patients with pcs had lesser hrql, lesser coming back to work levels, and greater health care utilization, in comparison to non-pcs patients.18 patients with mild traumatic brain injuries frequently complain about a group of physical, cognitive, as well as emotional, or behavioral symptoms. the most frequent symptoms for pcs are headache, dizziness, reduced concentration, memory complications, fatigue, visual disorders, irritability, noise sensitivity, judgment issues, anxiety, and depression. even though these symptoms normally resolve during one month, in some cases pcs may remain for months or years or even permanently. physiological as well as psychological factors have been recommended as reasons for persistent pcs. researchers believe that a range of injury-associated, preand post-morbid neuropathological, and psychological elements play role in the progression and prolongation of these symptoms.19 therefore, it is significant to develop approaches to prevent pcs symptoms in injured patients, increase awareness of patients as well as physicians on the incidence of pcs, detect pcs at the earliest time, and develop approaches to improve recovery in these patients. declarations author contributions study concept and design: sm, sjm, am drafting of the manuscript: sm, am literature searching: all authors statistical analysis and interpretation of the data: hjv, ka, am critical revision of the manuscript for important intellectual content and taking responsibility for the integrity and the accuracy of the data: all authors study supervision: am reviewed and modified the manuscript: fn, am all authors read and approved the final manuscript. references 1. hadanny a, efrati s. treatment of persistent post-concussion syndrome due to mild traumatic brain injury: current status and future directions. expert rev neurother. 2016;16(8):875-87. 2. evans rw. the postconcussion syndrome and the sequelae of mild head injury. neurol clin. 1992;10(4):815-47. 3. foy k, murphy kc. post-concussion syndrome. br j hosp med (lond). 2009;70(8):440-3. 4. meares s, shores ea, taylor aj, batchelor j, bryant ra, baguley ij, et al. the prospective course of postconcussion syndrome: the role of mild traumatic brain injury. neuropsychology. 2011;25(4):454-65. 5. ponsford j, cameron p, fitzgerald m, grant m, mikocka-walus a, schonberger m. predictors of postconcussive symptoms 3 months after mild traumatic brain injury. neuropsychology. 2012;26(3):304-13. 6. edna th, cappelen j. late post-concussional symptoms in traumatic head injury. an analysis of frequency and risk factors. acta neurochir (wien). 1987;86(1-2):12-7. 7. diagnostic a. statistical manual of mental disorders. washington. dc: american psychiatric association. 1994;4. 8. organization wh. the icd-10 classification of mental and behavioural disorders: clinical descriptions and diagnostic guidelines: world health organization; 1992. 9. binder lm. a review of mild head trauma. part ii: clinical implications. j clin exp neuropsychol. 1997;19(3):432-57. 10. king ns, kirwilliam s. permanent post-concussion symptoms after mild head injury. brain inj. 2011;25(5):462-70. 11. sterr a, herron ka, hayward c, montaldi d. are mild head injuries as mild as we think? neurobehavioral concomitants of chronic post-concussion syndrome. bmc neurol. 2006;6:7. 12. wang y, chan rc, deng y. examination of postconcussion-like symptoms in healthy university students: relationships to subjective and objective neuropsychological function performance. arch clin neuropsychol. 2006;21(4):339-47. 13. zakzanis kk, yeung e. base rates of post-concussive symptoms in a nonconcussed multicultural sample. arch clin neuropsychol. 2011;26(5):461-5. 14. dean pj, o’neill d, sterr a. post-concussion syndrome: prevalence after mild traumatic brain injury in comparison with a sample without head injury. brain inj. 2012;26(1):14-26. 15. balakrishnan b, rus rm, chan kh, martin ag, awang ms. prevalence of postconcussion syndrome after mild traumatic brain injury in young adults from a single neurosurgical center in east coast of malaysia. asian j neurosurg. 2019;14(1):201-5. 16. varner c, thompson c, de wit k, borgundvaag b, houston r, mcleod s. predictors of persistent concussion symptoms in adults with acute mild 106 j contemp med sci | vol. 8, no. 2, march-april 2022: 96–100 demographic evaluation of pcs in referrals to bandar abbas forensic medical center original s. mohammadi et al. traumatic brain injury presenting to the emergency department. cjem. 2021;23(3):365-73. 17. beauchamp f, boucher v, neveu x, ouellet v, archambault p, berthelot s, et al. post-concussion symptoms in sports-related mild traumatic brain injury compared to non-sports-related mild traumatic brain injury. cjem. 2021;23(2):223-31. 18. van der vlegel m, polinder s, toet h, panneman mjm, haagsma ja. prevalence of post-concussion-like symptoms in the general injury population and the association with health-related quality of life, health care use, and return to work. j clin med. 2021;10(4). 19. ryan lm, warden dl. post concussion syndrome. int rev psychiatry. 2003;15(4):310-6. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v8i2.1157 175j contemp med sci | vol. 9, no. 3, may-june 2023: 175–178 original glyceryl trinitrate, a vasodilating drug acts as an antibiofilm agent in serratia marcescens ziyad hameed al-fayyadh1, ahmed mohammed turki1, harith jabbar fahad al-mathkhury2* 1department of biology, college of science, university of anbar, al-anbar, iraq. 2department of biology, college of science, university of baghdad, baghdad, iraq. *correspondence to: harith jabbar fahad al-mathkhury (e-mail: harith.fahad@sc.uobaghdad.edu.iq) (submitted: 17 march 2023 – revised version received: 05 april 2023 – accepted: 27 april 2023 – published online: 26 june 2023) abstract objectives: serratia marcescens is a gram-negative pathogen of many species. the ability of s. marcescens to form biofilms and its potent innate resistance to antimicrobials and cleaning solutions are both essential for its pathogenicity and survival. the present study was conducted to investigate the effect of glyceryl trinitrate (gtn) on the biofilm of s. marcescens, as an alternative for antibiotic therapy. methods: different specimens, including ear swabs, burns, mid-stream urine, wound swabs, and sputum, were collected from patients who were brought to al-ramadi hospital, iraq. all samples were cultured, and the colonies that were obtained were detected using the vitek® 2 compact. the ability of biofilms to develop was examined using the microtiter plate technique. the bactericidal effectiveness of gtn was estimated by the broth microdilution technique. the presence of fima and fimc in s. marcescens isolates was detected using the polymerase chain reaction (pcr) method. quantitative real-time polymerase chain reaction (qrt-pcr) was used to assess the effect of gtn on fima and fimc gene expression. results: the results demonstrated that gtn has no effect on s. marcescens growth; while its biofilm was significantly (p < 0.05) influenced. moreover, all s. marcescens isolates had fima and fimc, and the presence of gtn reduced the expression of these genes. conclusion: the findings of this study reveal that gtn can act as a promising antibiofilm agent in reference to s. marcescens. keywords: fima, fimc, glyceryl trinitrate, serratia marcescens issn 2413-0516 introduction serratia marcescens is a gram-negative, opportunistic, and motile nosocomial pathogen of the enterobacteriaceae family. it produces the characteristic red pigment known as prodigiosin.1 fimbria or pili, the synthesis of which is reportedly associated with the development of biofilm in s. marcescens, are used by bacteria to adhere to tissues in order to cause infections. the fimabcd operon encodes type i pili. the primary fimbrial subunits of s. marcescens are known to be fima and fimc.2 the biofilms produced by s. marcescens are distinct from those produced by other species of traditional biofilm-forming bacteria, such as p. aeruginosa and e. coli, which are composed of undifferentiated cells arranged in microcolonies.3 according to labbate et al.4 the development of s. marcescens biofilms is a genetically controlled process. this results in cell and structure differentiation, as evidenced by the development of extended threadlike cells, bacterial cell assemblages alongside the threadlike cells, and interconnected cell aggregates as the biofilm matures. these bacteria exhibit both intrinsic and multidrug resistance to many drugs. treatment success for s. marcescens as a nosocomial causative agent depends heavily on the timing of medication depending on the results of antibiotic susceptibility tests.5 according to a local investigation by zahraa and saad,6 34 (68%) of the s. marcescens isolates produced extended-range beta-lactamases. glyceryl trinitrate (gtn) or nitroglycerin (1, 2, 3 propanetriol trinitrate) is an organic nitrate that acts as a vasodilator.7 glycerol trinitrate possesses anti-microbial characteristics in addition to its anti-hypertensive effect. it has the potential to suppress candida albicans and p. aeruginosa planktonic growth.8,9 glycerol trinitrate significantly inhibited biofilm, staphyloxanthin, and oxidative stress tolerance in s. aureus.10 the present study was aimed at investigating the role of gtn in the biofilm of s. marcescens, as a replacement for antibiotic therapy. materials and methods isolation and identification of bacterial isolates from february to june 2021, 316 different specimens, including ear swabs, burns, mid-stream urine, wound swabs, and sputum, were collected from patients who were brought to al-ramadi hospital, iraq. an informed consent according to the declaration of helsinki was obtained from all participants. a sterile cotton swab was used to collect the swabs, and they were then taken to the laboratory in a sterile tube containing normal saline solution. all samples were cultured on blood agar and aerobically incubated at 37°c for 24 hours. the colonies that formed were grown on macconkey agar and incubated under the same conditions. using the sophisticated colorimetric approach of vitek 2 compact (biomérieux, france), the dark red colonies (lactose fermenters) were chosen for the identification of s. marcescens. a gram-negative (gn) card was used to identify s. marcescens. determination of glyceryl trinitrate’s minimal inhibitory concentration to determine the minimal inhibitory concentration (mic) of gtn, a broth microdilution test was used,11 with progressive twofold concentrations (0.01 to 0.175 mg/ ml) of gtn. biofilm assay biofilm formation was quantified according to the method described by.12 all the isolates were grown in brain heart infusion broth for 18 hours at 37°c. each isolate was diluted in https://orcid.org/0000-0002-5414-9834 mailto:harith.fahad@sc.uobaghdad.edu.iq 176 j contemp med sci | vol. 9, no. 3, may-june 2023: 175–178 glyceryl trinitrate, a vasodilating drug acts as an antibiofilm agent in serratia marcescens original h. j. f. al-mathkhury et al. tryptic soy broth (tsb), which contains 1% glucose, and pipetted thoroughly. a bacterial isolate suspension was adjusted to the 0.5 mcfarland standard. an aliquot of 200 µl of an isolate culture was added to three wells of 96-well polystyrene microplates with a u-shaped bottom. the plate was then covered and incubated for 24 hours at 37°c. following incubation, the microplates were twice cleaned to get rid of loose bacteria, tapped on paper towels (filter paper) to get rid of any remaining water, and then air-dried. each well was fixed for 20 minutes at room temperature with 200 μl of absolute methanol. an aliquot of 200 μl of 0.1% crystal violet was applied for 15 minutes. after the staining reaction was completed, excess dye was removed by repeatedly washing (2–3 washes) with distilled water. the plates were then dried by leaving them at room temperature for around 30 minutes to ensure they were completely dry. following that, 200 μl of 95% ethanol was placed into each well and left there for 10 minutes. ethanol was used to dissolve the crystal violet dye that was attached to the adherent cells. the experiment was performed in triplicate, with the absorbance of bacteria-free tsb-containing wells representing the negative control. quantification was carried out using a microplate reader at od600. the classification of bacterial adherence presented in table 1 was utilized for data simplification and computation based on od600 values obtained for individual isolates of s. marcescens. the cut-off value (odc) was determined as follows: odc = od600 of the negative control + 3 (standard deviation) (1) all experiments followed the same procedure to assess the effect of gtn on biofilm, with one exception. tryptic soy broth contained gtn at a concentration of 0.175 mg/ml. detection of fima and fimc genes using the polymerase chain reaction the genomic dna of the bacterial isolates was extracted using the abiopuretm total dna (usa) kit. pcr reaction tubes containing the mixture were placed in the thermocycler, and dna was amplified using the primers grouped in table 2 using the reactants indicated in table 3. the pcr conditions were optimized by using gradient pcr (table 4). thereafter, amplicons were resolved on a 1.5% agarose gel. measurement of gene expression using quantitative real-time polymerase chain reaction in addition to examining the effect of gtn on target gene expression, a biofilm investigation for five isolates (whose biofilm was strongly influenced by the gtn) was carried out in microtiter plates. a similar technique was used with gtn, including mueller hinton broth at 0.175 mg/ml. rna was extracted from the selected isolates with and without gtn treatment using trizoltm reagent following the manufacturer’s instructions. the primers listed in table 2 were used in the real-time polymerase chain reaction (qrt-pcr). table 5 summarizes the reaction combinations. also, the final procedure is displayed in table 4. relative quantitation was used to determine gene expression levels. the fold changes were assessed between the treated groups and each gene’s calibrators.13 these values were normalized to rplu as shown below: folding =2-δδct (1) table 1. calculation of biofilm intensity mean od 600 biofilm intensity od ≤ odc* non-biofilm producer odc < od ≤ 2odc weak 2odc < od ≤ 4odc moderate od > 4odc strong *cut off value source: khayyat et al. (2021) table 2. primers used in this study primer name sequence (5´–3´) product size (bp) fima f actacaccctgcgtttcgac 259 r gcgttagagtttgcctgacc fimc f aagatcgcaccgtacaaacc 259 r tttgcaccgcatagttcaag rplu f gcttggaaaagctggacatc 192 r tacggtggtgtttacgacga source: srinivasan et al. (2017) table 3. components of conventional polymerase chain reaction component volume (µl) master mix 10 µl forward primer (10 μm) 1 µl reverse primer (10 μm) 1 µl nuclease free water 6 µl template dna 2 µl final volume 20 µl table 4. polymerase chain reaction amplification program step temperature (°c) minute:second cycles initial denaturation 95 10:00 1 denaturation 95 00:45 40 annealing 57 00:45 extension 72 00:50 source: srinivasan et al. (2017) table 5. components of the quantitative real-time polymerase chain reaction (qrt-pcr) master mix components volume (μl) qpcr master mix 5 rt mix 0.25 mgcl 2 0.25 forward primer 0.5 reverse primer 0.5 nuclease free water 1.5 rna 2 total volume 10 177j contemp med sci | vol. 9, no. 3, may-june 2023: 175–178 h. j. f. al-mathkhury et al. original glyceryl trinitrate, a vasodilating drug acts as an antibiofilm agent in serratia marcescens δδct =δct treated (t) δct untreated (c) (2) δct = ct of target gene – ct of housekeeping gene (3) a fold change of less than twofold was considered insignificant.14 a melting curve was obtained with temperatures ranging from 72 to 95°c at 0.3°c/s. statistical analysis each experiment was replicated three times (n = 3). data were analyzed using graphpad prism 9 software using a two-tailed student’s t-test and a one-way anova. a p-value of < 0.05 was considered significant. results occurrence of bacterial isolates in specimens out of 360 specimens, 305 showed positive bacterial growth on blood agar and macconkey agar. using the vitek 2 compact system, 50 (16.3%) isolates were identified as s. marcescens. the highest isolation percentage was from wound infections (42%, n = 21), followed by burns (34%, n = 17). values of 10% (n = 5) and 14% (n = 7) were observed for midstream urine and sputum specimens, respectively. nevertheless, the bacterium was not isolated from ear swabs. biofilm formation by serratia marcescens all s. marcescens isolates produced biofilm. however, a one-way anova showed no differences between the biofilms that were produced (p > 0.05). in addition, 15 and 35 isolates, respectively, formed weak and moderate biofilms. none of the isolates could develop a strong biofilm. on the other hand, gtn significantly (p < 0.05) reduced the biofilm intensity of s. marcescens isolates, as shown in figure 1. fima and fimc detection in bacterial isolates the pcr amplification revealed the presence of fima and fimc genes in all the s. marcescens isolates, as presented in figure 2. effect of glyceryl trinitrate on fima and fimc gene expression figure 3 showed that gtn reduced the expression of the fima and fimc genes in three isolates, while the gene expression in the other two isolates was unaffected. discussion serratia marcescens is a significant human opportunistic pathogen that has been linked to a variety of nosocomial infections, including bacteremia, respiratory tract infections, eye infections, and most significantly, urinary tract infections. it produces biofilm and releases a range of virulence factors through a signal-mediated qs mechanism.15 in mosul, iraq, ali16 reported that 150 different specimens were isolated, including 3 from blood (15%), 2 from throat swabs (20%), 3 from urine (6%), and 4 from wounds (8%). in basra, iraq, mahdi17 stated that out of 160 blood samples from neonatal patients in the neonatal intensive care unit, 5 isolates were identified as s. marcescens. regardless of the reservoir, s. marcescens has a rather wide distribution among patients with a variety of clinical cases, and hospital staff is thought to be the main source of s. marcescens infection spread by direct contact.18 patients who have severe clinical problems, long hospital stays, and repeated medical interventions are more likely to contract an infection since these factors require more frequent and intense direct contact with staff hands.19 the presence of type 1 fimbriae (figure 2) and the downregulation of the fima and fimc genes are evidence that all s. marcescens formed biofilm, as can be observed from the current results. in spite of that, gtn had no impact on s. marcescens’ development. a search for an alternative therapy option besides antibiotics is essential given the significant antibiotic resistance of s. marcescens. the findings of this study revealed that gtn can serve this function because it has no effect on cell viability. instead, it damaged the pathogen’s biofilm, which is an essential component of its pathogenicity. fig. 3 effect of glyceryl trinitrate on the fima and fimc expression. fig. 1 effect of glyceryl trinitrate on serratia marcescens biofilms. asterisks: significant difference over the control; horizontal lines: mean ± standard deviation. fig. 2 fima, fimc, and rplu amplicons of selected serratia marcescens isolates run on ethidium bromide-containing agarose gel (1.5%) at 5 v/cm. 178 j contemp med sci | vol. 9, no. 3, may-june 2023: 175–178 glyceryl trinitrate, a vasodilating drug acts as an antibiofilm agent in serratia marcescens original h. j. f. al-mathkhury et al. conflicts of interest the authors have no potential conflicts of interest to disclose.  references 1. nelson g, greene m. enterobacteriaceae. in: john e. bennett, raphael dolin, martin j. blaser, editors. mandell, douglas, and bennett’s principles and practice of infectious diseases. 9th ed: elsevier; 2020. 2. shanks rm, stella na, brothers km, polaski dm. exploitation of a “hockey-puck” phenotype to identify pilus and biofilm regulators in serratia marcescens through genetic analysis. can j microbiol. 2016;62(1):83–93. 3. reisner a, haagensen ja, schembri ma, zechner el, molin s. development and maturation of escherichia coli k-12 biofilms. mol microbiol. 2003;48(4):933–46. 4. labbate m, queck sy, koh ks, rice sa, givskov m, kjelleberg s. quorum sensing-controlled biofilm development in serratia liquefaciens mg1. j bacteriol. 2004;186(3):692–8. 5. şimşek m. determination of the antibiotic resistance rates of serratia marcescens isolates obtained from various clinical specimens. niger j clin pract. 2019;22(1):125–30. 6. zahraa as, saad lh. molecular detection of extended-spectrum β-lactamasesproducer serratia marcescens causing neonatal sepsis in iraq. international journal of research in pharmaceutical sciences. 2020;11(4):5803–8. 7. kim kh, kerndt cc, adnan g, schaller dj. nitroglycerin: statpearls publishing; 2022. 8. palmeira-de-oliveira a, ramos ar, gaspar c, palmeira-de-oliveira r, gouveia p, martinez-de-oliveira j. in vitro anti-candida activity of lidocaine and nitroglycerin: alone and combined. infect dis obstet gynecol. 2012;2012:727248. 9. rosenblatt j, reitzel ra, raad i. caprylic acid and glyceryl trinitrate combination for eradication of biofilm. antimicrob agents chemother. 2015;59(3):1786–8. 10. abbas ha, elsherbini am, shaldam ma. glyceryl trinitrate blocks staphyloxanthin and biofilm formation in staphylococcus aureus. afr health sci. 2019;19(1):1376–84. 11. andrews jm. bsac standardized disc susceptibility testing method. j antimicrob chemother. 2001;48:43–57. 12. khayyat an, hegazy wah, shaldam ma, mosbah r, almalki aj, ibrahim ts, et al. xylitol inhibits growth and blocks virulence in serratia marcescens. microorganisms. 2021;9(5). 13. livak kj, schmittgen td. analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. methods. 2001;25(4):402–8. 14. rasigade jp, moulay a, lhoste y, tristan a, bes m, vandenesch f, et al. impact of sub-inhibitory antibiotics on fibronectin-mediated host cell adhesion and invasion by staphylococcus aureus. bmc microbiol. 2011;11:263. 15. srinivasan r, mohankumar r, kannappan a, karthick raja v, archunan g, karutha pandian s, et al. exploring the anti-quorum sensing and antibiofilm efficacy of phytol against serratia marcescens associated acute pyelonephritis infection in wistar rats. front cell infect microbiol. 2017;7:498. 16. ali t. antibiomicrobial susceptibility testing of serratia species isolated from hospitalized patients in two hospitals in al-mosul, iraq. jordan m j. 2007;41:121–8. 17. mahdi s. isolation and molecular identification of a serratia spp. from suspected neonatal sepsis in intensive care unit (icu) of basra province, iraq int j inn res sci eng technol. 2016;5:4619–24. 18. mahlen sd. serratia infections: from military experiments to current practice. clin microbiol rev. 2011;24(4):755–91. 19. passaro dj, waring l, armstrong r, bolding f, bouvier b, rosenberg j, et al. postoperative serratia marcescens wound infections traced to an out-ofhospital source. j infect dis. 1997;175(4):992–5. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v9i3.1329 93j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 original investigation of the frequency and risk factors of pulmonary complications following cardiac surgery in the hospital mahdieh sharifzadeh kermani1, naeimeh naeimi bafghi2, neda naeimi bafghi2, shirin salajegheh1*, jafar salehi3, reza nakhaei zadeh4, mohammad javad javid1 1clinical research development unit, shafa hospital, kerman university of medical sciences, kerman, iran. 2clinical research development unit, shahid bahonar hospital, kerman university of medical sciences, kerman, iran. 3department of anesthesiology, school of medicine, kerman university of medical sciences, kerman, iran. 4department of cardiac surgery, school of medicine, kerman university of medical sciences, kerman, iran. *correspondence to: shirin salagegheh (e-mail: drshirinsalajegheh@aol.com) (submitted: 10 january 2023 – revised version received: 21 february 2023 – accepted: 15 march 2023 – published online: 26 april 2023) abstract objectives: the purpose of this study was to determine the frequency of pulmonary complications after heart surgery and to assess the pre-operative, intra-operative and post-operative risk factors. methods: this was a descriptive and analytical study that was conducted on 244 patients who underwent various cardiac surgeries from december 2021 to may 2022 in shefa kerman hospital. this descriptive/analytical study on patients undergoing heart surgery at shafa hospital, kerman, iran, from december 2021 to may 2022. pulmonary complications included atelectasis pneumonia, pleural effusion, long-term mechanical ventilation, and respiratory failure. the pre-operative, intra-operative and post-operative risk factors were investigated in the present study. spss software was used to analyze the data. logistic regression analysis was employed to determine the relationship between risk factors and the incidence of lung complications. results: in the present study, 55 patients (22.5%) had pulmonary complications, followed by prolonged mechanical ventilation (13.1%), pneumonia (11.5%), respiratory failure (4.1%), pleural effusion (11.1%) and atelectasis (6.1%). pulmonary complications after heart surgery were associated with days of icu stay, post-operative stroke, post-operative acute kidney injury, emergency surgery, ffp injection, high drainage rate, and mitral valve replacement surgery (all p < 0.001). 4% of patients died after surgery, which was statistically related to pulmonary complications (p < 0.0001). the results of multivariable logistic regression test showed that ffp injection, type of heart surgery, hypertension, icu stay days are capable of predicting pulmonary complications after heart surgery. conclusion: mortality was found to be higher in patients with pulmonary complications. based on the results of the regression analysis, ffp injection, type of surgery, history of hypertension and length of icu stay were independent risk factors of pulmonary complications. key words: pulmonary complications, cardiovascular surgery, risk factors, fresh frozen palsma issn 2413-0516 introduction cardiac surgery is a high-risk intervention that requires specialized teams to manage patients in the preand post-operative care. pulmonary complications include pneumonia with mechanical ventilation for more than 24 hours, respiratory failure, pleural effusion, atelectasis, pneumothorax, bronchospasm and aspiration pneumonitis, acute respiratory distress syndrome, and pulmonary embolism, which increases the length of hospital stay and treatment costs.1 heart surgery is usually performed by cardiopulmonary bypass. in this technique, the pumping action of the heart and the gas exchange of the lungs are temporarily replaced by a special mechanical device called an oxygenator pump, which is connected to the vascular system. cardiopulmonary bypass exposes the blood to artificial substances that lead to the production and secretion of toxins and the activation of the vascular reaction. in addition, the activation of neutrophils and their migration to the pulmonary circulation causes deep endothelial, epithelial, and interstitial lung damage, which is associated with increased capillary permeability, decreased lung capacity, and gas exchange disorders.2,3 abnormalities in gas exchange and changes in lung mechanical function cause pulmonary complications after heart surgery. in recent studies, changes in muscle and chest wall function due to median sternotomy, systemic inflammatory response syndrome with cardiopulmonary bypass, phrenic nerve injury due to cold saline injection in the pericardial cavity during cardiac arrest, and dilatation associated alveolar edema, and an increase in left ventricular pressure in the pulmonary vessels has been stated as the main causes of this complication.4,5 the reported frequency of pulmonary complications after cardiac surgery varies from 6 to 70% depending on the criteria used to define pulmonary complications.6 the incidence of pulmonary complications in major surgeries varies from 1 to 23%.7 identifying the risk factors of susceptible patients is helpful in preventing and eliminating complications. previous studies reported a combination of preoperative and postoperative risk factors. despite many advances in intraoperative care, postoperative pulmonary complications remain the main cause of disability and death after cardiac surgery in adults.8,9 very few studies have focused on intraand post-operative risk factors responsible for pulmonary complications in patients undergoing cardiac surgery using cardiopulmonary bypass.10,11 ventilation with a flow volume of 4–6 cc/kg during surgery was associated with a decrease in pulmonary complications.12 it has been reported that age over 60 years, prolongation of surgery time, preoperative pulmonary blood pressure and intraoperative phrenic nerve damage were risk factors for pulmonary complications.6 determining the factors affecting the rate of pulmonary complications can be beneficial in order to reduce these risk factors and timely treatment of more common pulmonary complications in patients after heart surgery. if risk factors are found, comprehensive and complete treatment of these factors mailto:drshirinsalajegheh@aol.com 94 j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 investigation of the frequency and risk factors of pulmonary complications following cardiac surgery original m.s. kermani et al. can be effective in improving the clinical course of patients who underwent heart surgery. in iran, there is a lack of studies on pulmonary complications after heart surgery.13,14 considering the large number of heart surgeries in iran and the high global prevalence of postoperative pulmonary complications, it is necessary to determine the prevalence of this complication and its related factors in iran. the current study aimed to investigate the frequency and risk factors of pulmonary complications following cardiac surgery in shafa hospital between 2021 and 2022. materials and methods this is a descriptive/analytical cross-sectional study approved by the ethics committee of kerman university of medical sciences (ir.kmu.ah.rec.1401.104). the research population included all patients who underwent heart surgery (coronary artery grafting, heart valve replacement, atrial septum repair, and ventricular septal defect repair) at shafa hospital, kerman, iran, from december 2021 to may 2022. the research population included all patients who underwent heart surgery (coronary artery grafting, heart valve replacement, atrial septum repair, and ventricular septal defect repair) at shafa kerman hospital from december 2021 to may 2022. patients who had surgery for congenital heart disease and incomplete medical records were excluded from the study. the data was extracted from the patient files through a researcher-made form including demographic information and medical information. collected data includes the variables of age, sex, smoking, opioid use, body mass index, ejection fraction, type of surgery, duration of surgery, type of pulmonary complication, use of cardiopulmonary pump during surgery. surgery, duration of cardiopulmonary pump, duration of mechanical ventilation, acute kidney injury after surgery, hemoglobin level before surgery, co-morbidity (diabetes, hypertension), duration of hospitalization in intensive care unit (icu), transfusion of blood or blood products, type of surgical urgency, postoperative drainage and mortality. pulmonary complications investigated included: pleural effusion, which was investigated and recorded by lung ultrasound and x-ray), pneumonia (fever, purulent sputum, test findings, lung x-ray and confirmed by infectious consultation), atelectasis (confirmed by lung x-ray and ultrasound), prolonged mechanical ventilation (more than 24 hours) and acute respiratory distress syndrome (ards). statistical analysis descriptive data were presented using mean, standard deviation, frequency and percentage in the form of tables and graphs. the kolmogorov smirnov test was used to check the normality of the data. t-test was used to compare the mean of two groups for normal data. mann whitney u test for non-normally distributed data and chi square test was used to analyze qualitative data. logistic regression analysis (backward: lr) was used to investigate the simultaneous effect of demographic and medical variables with postoperative pulmonary complications. the first group was considered as the reference group. spss software version 24 was used for data analysis. a significance level of less than 0.05 was considered. results 244 patients with a mean age of 59 ± 12 (15–82 years) participated in this study, consisting of 167 (68%) men and 77 (32%) women. the average height and weight of the patients were 168 ± 9 and 68 ± 13, respectively. the average bmi in these people was 24 ± 4 (range 14–37). 50% of patients used opium and 10% smoked. of these patients, 36% had diabetes, 68% had hypertension, and 5% had chronic kidney disease. the mean preoperative hemoglobin in the patients was 14 ± 2. the average ejection fraction in patients was 44 ± 10. the average ejection fraction in patients before surgery was determined to be 44 ± 10. 6% of patients underwent emergency surgery and 88% underwent elective surgery. the average time of surgery was 4 ± 0.8 hours (range 2–8 hours). 49% of patients used cardiopulmonary pump with an average duration of 37 ± 32 minutes. according to the type of surgery, 87% of patients underwent open heart surgery, followed by mitral valve replacement (8%), aortic valve replacement (6%), septal defect surgery (3%), and other surgeries (3%). after surgery, 55 patients (22.5%) had pulmonary complications, followed by prolonged mechanical ventilation (13.1%), pneumonia (11.5%), respiratory failure (4.1%), pleural effusion (11.1%) and atelectasis (6.1%). the duration of the intensive care unit (icu) satay after the operation was 5 ± 3 days. the average duration of mechanical ventilation in patients was also determined to be 22 ± 31 (range 4.5–264 hours) hours. during or after ffp operation, 17% of plt and 51% of p.c were injected for 20% of patients. the amount of drainage after surgery was found to be less than one liter for 85% of patients and more than one liter for 15%. 2.5% of patients had a stroke after surgery and 17.6% had acute kidney failure. finally, 4% of patients died after surgery. no significant difference was found in terms of the gender in two groups with pulmonary complications after cardiac surgery and without pulmonary complications after cardiac surgery. no significant difference was observed between on-pump and off-pump patients in two groups with pulmonary complications after heart surgery and without pulmonary complications after heart surgery. a significant difference was found in terms of the type of urgency in two groups after heart surgery. patients who underwent emergency surgery had more pulmonary complications after heart surgery. a statistically significant difference was also revealed in terms of drainage in two groups after heart surgery. patients who had more than one liter of drainage on the first day had more pulmonary complications after heart surgery. a significant difference was observed in terms of post op cva in two groups after heart surgery. all patients who had a stroke had pulmonary complications after heart surgery. a statistically significant difference was found in terms of death in patients in two groups after heart surgery, where patients who died showed more pulmonary complications after heart surgery. a significant difference was also seen in terms of acute kidney injury in patients of two groups after heart surgery. the frequency of pulmonary complications was higher in patients with acute kidney injury. 95j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 m.s. kermani et al. original investigation of the frequency and risk factors of pulmonary complications following cardiac surgery table 1. descriptive statistics n minimum maximum mean std. deviation age in years 243 15 82 58.75 11.699 weight in kg 244 2.00 120.00 68.3975 13.26509 height in cm 244 147.00 198.00 168.1844 8.55885 bmi 205 14.03 36.63 24.0432 3.92621 ejection fraction in percent 238 20.00 65.00 44.0126 10.19700 surgery duration in minutes 244 140.00 465.00 251.6189 47.83311 pump_time in minutes 244 .00 199.00 32.1352 36.59693 days of icu admission 244 1.00 24.00 4.9508 3.22631 mechanical ventilation hours 244 4.50 264.00 22.0266 30.58241 pre op hb 244 9.1 22.7 14.201 2.1269 valid n (listwise) 199 no significant difference was observed in patients of two groups in terms of drug use, smoking, blood pressure, diabetes and chronic kidney disease. a significant difference was observed in terms of mitral valve replacement in the two groups of patients after heart surgery. the frequency of pulmonary complications was higher in patients who had mitral valve replacement. a significant difference was observed in terms of other surgeries in patients of two groups. the frequency of pulmonary complications was higher in patients who had other surgeries. in terms of ffp injection, a significant difference was observed in two groups. the frequency of pulmonary complications was higher in patients who received ffp injection. there was no statistically significant difference in the mean age of patients in the two groups (p = 0.374) no statistically significant difference was found in the average duration of surgery in the two groups of patients (p = 0.735) there was a statistically significant difference in the average days of the icu stay in the two groups of patients (p < 0.0001). the average days of icu stay was found to be higher in the group of patients with pulmonary complications after heart surgery (p < 0.0001). there was no statistically significant difference between the two groups of patients in the mean preoperative hemoglobin (p = 0.603). the average time of being on the pump in the group of patients with pulmonary complications was higher than the patients without pulmonary complications, but this difference was not found to be statistically significant (p = 0.101). the results of multivariable logistic regression test demonstrated that ffp injection, type of heart surgery, blood pressure, and number of days of the icu stay can be capable of predicting pulmonary complications after heart surgery. people who had aortic valve replacement surgery are 91.7 times more likely to have pulmonary complications after heart surgery. people who had mitral valve replacement surgery are 73 times more likely to have pulmonary complications after heart surgery. patients who had septal defect surgery are 128 times more likely to have pulmonary complications after heart surgery. patients with open heart surgery have 36.8 times more pulmonary complications after heart surgery. every day icu stay was capable of increasing the chance of pulmonary complications by 1.72 times. people who had high blood pressure are 4.6 times more likely to have pulmonary complications after heart surgery. patients who received ffp injections were 4.6 times more likely to have pulmonary complications after heart surgery. discussion the present study was conducted with the aim of investigating the frequency and risk factors of pulmonary complications following heart surgery in shafa hospital from december 2021 to may 2022. 244 patients who underwent heart surgery during a period of 6 months were included in the study. in our study, there was no relationship between pulmonary complications and demographic characteristics, including average age, sex, and body mass index. the results of our study showed an incidence of 22.5% for pulmonary complications after heart surgery. pulmonary complications after heart surgery were related to type of surgery (mitral valve replacement surgery, other heart surgeries), history of hypertension, prolonged stay in icu, urgency of heart surgery, post-operative acute kidney injury, post-operative stroke, ffp injection and high drainage rate. mortality was significantly higher in patients with pulmonary complications. regarding the regression analysis of plasma injection, type of surgery, history of hypertension and length of stay in icu were independent risk factors for developing pulmonary complications. one of the positive points of our study was the comprehensive review of pre-operative, intra-operative and post operative risk factors in order to determine the frequency and risk factors influencing the development of pulmonary complications. regarding the retrospective nature of the study, it was not possible to investigate the thickness of the diaphragm and possible paralysis in pulmonary complications. the most common pulmonary complications in patients were long-term mechanical ventilation (more than 24 hours, 13.1%) and pneumonia (11.5%). considering that infection is an important factor of morbidity and mortality around 96 j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 investigation of the frequency and risk factors of pulmonary complications following cardiac surgery original m.s. kermani et al. table 2. frequency of pulmonary complications in heart surgery patients according to demographic and clinical characteristics pulmonary complicationtotal p-valueno yes percentfrequency 0.65512839frequency68.4167male sex 76.6%23.4%percent 6116frequency31.677female 79.2%20.8%percent 0.5059926frequency51.2125offpump 79.2%20.8%percent 9029frequency48.8119on 75.6%24.4%percent p < 0.0001611frequency5.714emergencyurgent type of surgery 35.3%64.7%percent 18344frequency88.5216elective 80.6%19.4%percent 0.04716542frequency84.8207below 1litdrainage 79.7%20.3%percent 2413frequency15.237over 1lit 64.9%35.1%percent p < 0.000118949frequency97.5238nopost op cva 79.4%20.6%percent 06frequency2.56yes 0.0%100.0%percent p < 0.000118648frequency95.9234nodeath 79.5%20.5%percent 37frequency4.110yes 30.0%70.0%percent 0.00116437frequency82.4201noacute kidney injury 81.6%18.4%percent 2518frequency17.643yes 58.1%41.9%percent table 3. frequency of pulmonary complications in heart surgery patients based on underlying diseases, type of heart surgery and transfusion of blood and blood products total pulmonary complication frequency percent no yes underlying diseases opioid addiction no 123 50.4 frequency 101 22 percent 82.1% 17.9% yes 121 49.6 frequency 88 33 percent 72.7% 27.3% smoking no 219 89.8 frequency 170 49 percent 77.6% 22.4% yes 24 9.8 frequency 19 5 percent 79.2% 20.8% unknown .4 .4 frequency (continued) 97j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 m.s. kermani et al. original investigation of the frequency and risk factors of pulmonary complications following cardiac surgery table 3. frequency of pulmonary complications in heart surgery patients based on underlying diseases, type of heart surgery and transfusion of blood and blood products—continued total pulmonary complication frequency percent no yes diabetes mellitus no 157 64.3 percent 125 32 frequency 79.6% 20.4% yes 87 35.7 percent 64 23 frequency 73.6% 26.4% hypertension no 79 32.4 percent 65 14 frequency 82.3% 17.7% yes 165 67.6 percent 124 41 frequency 75.2% 24.8% chronic kidney disease no 230 94.3 percent 180 50 frequency 78.3% 21.7% yes 12 4.9 percent 7 5 frequency 58.3% 41.7% unknown 2 .8 percent type of cardiac surgery aortic valve replacement no 230 94.3 frequency 180 50 percent 78.3% 21.7% yes 14 5.7 frequency 9 5 percent 64.3% 35.7% mitral valve replacement no 225 92.2 frequency 178 47 percent 79.1% 20.9% yes 19 7.8 frequency 11 8 percent 57.9% 42.1% septal defect no 236 96.7 frequency 182 54 percent 77.1% 22.9% yes 8 3.3 frequency 7 1 percent 87.5% 12.5% cardiac arterial bypass graft no 32 13.1 frequency 25 7 percent 78.1% 21.9% yes 212 86.9 frequency 164 48 percent 77.4% 22.6% other no 237 97.1 frequency 186 51 percent 78.5% 21.5% yes 7 2.8 frequency 3 4 percent 42.9% 57.1% transfusion of blood and blood products ffp no 196 80.3 frequency 163 33 percent 83.2% 16.8% yes 48 19.7 frequency 26 22 percent 54.2% 45.8% plt no 202 82.8 frequency 159 43 percent 78.7% 21.3% yes 42 17.2 frequency 30 12 percent 71.4% 28.6% p.c no 120 49.2 frequency 93 27 percent 77.5% 22.5% yes 124 50.8 frequency 96 28 percent 77.4% 22.6% 98 j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 investigation of the frequency and risk factors of pulmonary complications following cardiac surgery original m.s. kermani et al. table 4 frequency of pulmonary complications in patients variables frequency percent pulmonary complication no 189 77.5 yes 55 22.5 pneumonia no 216 88.5 yes 28 11.5 respiratory failure no 234 95.9 yes 10 4.1 pleural effusion no 217 88.9 yes 27 11.1 atelectasis no 229 93.9 yes 15 6.1 prolonged mechanical ventilation no 212 86.9 yes 32 13.1 table 5. comparison of the mean of quantitative variables in two groups of patients with pulmonary complications and without pulmonary complications after heart surgery variables pulmonary complication n mean std. deviation std. error mean p-value age in years no 189 58.39 11.945 .869 .374 yes 54 60.00 10.807 1.471 surgery duration in minutes no 189 251.0582 45.20570 3.28823 .735 yes 55 253.5455 56.36088 7.59970 days of icu admission no 189 4.1111 1.67056 .12152 p < 0.0001 yes 55 7.8364 5.11629 .68988 pre op hb no 189 14.239 2.1108 .1535 .603 yes 55 14.069 2.1958 .2961 pump_time in minutes no 189 29.5185 32.98204 2.39909 0.101 yes 55 41.1273 46.18965 6.22821 surgery, it is necessary to examine and identify patients at risk for faster control and treatment. the occurrence of pulmonary complications in studies has been between 3 and 50% and its occurrence is the result of pre-operative, intra-operative and post-operative risk factors. older age, genetics, diabetes, obesity, smoking, chronic lung disease, and emergency surgery have been identified as preoperative risk factors in studies. in our study, emergency surgery and hypertension were risk factors, while other comorbidities were not associated with increased risk, probably owing to the smaller sample size. in our study, one of the risk factors affecting the increase of pulmonary complications during surgery was the type of surgery, i.e., non-coronary and heart valve surgeries. in sadeghi’s study, patients with heart valve surgery had higher complications and mortality because a large number of these patients suffer from obstructive and restrictive lung disease, which may be due to cardiomegaly, pleural effusion, table 6. the results of multivariate logistic regression b s.e. exp(b) 95% c.i. for exp(b) p-value lower upper gender (1) –.815 .793 .443 .094 .304 .304 age in years –.031 .028 .969 .917 .270 .270 bmi .050 .069 1.052 .918 .466 .466 aortic valve replacement (1) 4.519 1.504 91.725 4.813 .003 .003 mitral valve replacement (1) 4.295 1.755 73.337 2.351 .014 .014 septal defect (1) 4.857 2.061 128.574 2.265 .018 .018 coronary arterial bypass (1) 3.606 1.660 36.803 1.423 .030 .030 surgery duration in minutes –.002 .008 .998 .982 .752 .752 pump (1) –2.136 1.334 .118 .009 .109 .109 pump_time in minutes .021 .020 1.021 .982 .298 .298 opioid addiction (1) .923 .518 2.516 .911 .075 .075 smoking (1) –.010 .951 .990 .153 .991 .991 diabetes mellitus (1) .429 .610 1.536 .465 .482 .482 hypertension (1) 1.540 .690 4.665 1.206 .026 .026 (continued) 99j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 m.s. kermani et al. original investigation of the frequency and risk factors of pulmonary complications following cardiac surgery table 6. the results of multivariate logistic regression—continued b s.e. exp(b) 95% c.i. for exp(b) p-value lower upper chronic kidney disease (1) –2.842 2.312 .058 .001 .219 .219 days of icu admission .545 .126 1.724 1.346 .000 .000 ffp (1) 1.539 .591 4.658 1.463 .009 .009 plt (1) –1.676 .797 .187 .039 .036 .036 p.c (1) –.529 .665 .589 .160 .427 .427 acute kidney injury (1) .041 .781 1.042 .225 .958 .958 urgent type of surgery (1) –.690 .946 .502 .079 .466 .466 drainage (1) .290 .762 1.336 .300 .704 .704 constant –14.449 3.152 .000 .000 .000 peribronchial and pericapillary fibrosis during the period of pulmonary congestion.14 in our study, fresh frozen plasma injection was an independent risk factor for pulmonary complications. it was stated by gupta et al. that intraoperative blood transfusion was significantly higher in patients with pulmonary complications after surgery.15 while the results of the study by mathis and his colleagues showed a significant relationship between the transfusions of various blood products and pulmonary complications after heart surgery.12 following the infusion of blood products, especially plasma and platelets, there is a possibility of complications such as transfusion-related acute lung injury (trali), transfusion-related circulatory overload (taco) and increased risk of infection transmission.16,17 serani et al. also showed that plasma transfusion in sick patients was associated with an increased risk of infections.18 bochicchio’s study showed an increased risk of ventilator associated pneumonia in trauma patients with transfusion of blood products.19 according to the results of our study, plasma injection was introduced as a risk factor for causing postoperative pulmonary complications. transfusion of plasma and blood products is recommended to be based on the indication, if necessary. according to desborough’s review study, the prophylactic administration of fresh frozen plasma for patients undergoing cardiovascular surgery is not approved in the absence of coagulopathy, and more research is needed for other outcomes including 30-day mortality due to the bias in the studies and their low quality.20 in the present study, acute kidney failure and longer length of icu stay were associated with increased pulmonary complications, which was consistent with other studies.21 the mortality rate in patients with pulmonary complications was significantly higher, which was similar to other studies.6,22 pulmonary complications after heart surgery can be prevented by teaching the prevention and management of these risk factors to the health department staff and determining specific protocols. further longitudinal and multicenter studies are needed to investigate the risk factors of pulmonary complications after heart surgery. conflict of interest none.  references 1. tristan george tanner, mai o. colvin. pulmonary complications of cardiac surgery. lung (2020) 198:889–896. 2. wynne r, botti m. postoperative pulmonary dysfunction in adults after cardiac surgery with cardiopulmonary bypass: clinical significance and implications for practice. am j crit care. 2004;13(5):384–93. 3. mali s, haghaninejad h. pulmonary complications following cardiac surgery. archives of medical sciences atherosclerotic diseases. 2019;4:e280. 4. sabaté s, mazo v, canet j. predicting postoperative pulmonary complications: implications for outcomes and costs. current opinion in anesthesiology. 2014;27(2):201–9. 5. gravlee gp. cardiopulmonary bypass: principles and practice: lippincott williams & wilkins; 2008. 6. naveed a, azam h, murtaza hg, ahmad ra, baig mar. incidence and risk factors of pulmonary complications after cardiopulmonary bypass. pakistan journal of medical sciences. 2017;33(4):993. 7. miskovic a, lumb a. postoperative pulmonary complications. bja: british journal of anaesthesia. 2017;118(3):317–34. 8. canet j, gallart l, gomar c, paluzie g, valles j, castillo j, et al. prediction of postoperative pulmonary complications in a population-based surgical cohort. the journal of the american society of anesthesiologists. 2010;113(6):1338–50. 9. younossian ab, adler d, bridevaux p-o, kherad o. postoperative pulmonary complications: how to anticipate and prevent the risk? revue medicale suisse. 10. canver cc, chanda j. intraoperative and postoperative risk factors for respiratory failure after coronary bypass. the annals of thoracic surgery. 2003;75(3):853–7. 11. ji q, mei y, wang x, feng j, cai j, ding w. risk factors for pulmonary complications following cardiac surgery with cardiopulmonary bypass. international journal of medical sciences. 2013;10(11):1578. 12. mathis mr, duggal nm, likosky ds, haft jw, douville nj, vaughn mt, et al. intraoperative mechanical ventilation and postoperative pulmonary complications after cardiac surgery. anesthesiology. 2019;131(5):1046–62. 13. mali s, haghaninejad h. pulmonary complications following cardiac surgery. archives of medical science-atherosclerotic diseases. 2019;4(1):280–5. 14. sadeghi ha, tabrizi ra, ghadrdoost b, azarfarin r. evaluation of pulmonary complications in patients with valvular heart surgery: clinical and laboratory significances. res cardiovasc med. 2017;6(2):e39944. 15. gupta s, fernandes rj, rao js, dhanpal r. perioperative risk factors for pulmonary complications after non-cardiac surgery. journal of anaesthesiology, clinical pharmacology. 2020;36(1):88. 16. saadah nh, van der bom jg, wiersum‐osselton jc, richardson c, middelburg ra, politis c, et al. comparing transfusion reaction risks for various plasma products–an analysis of 7 years of istare haemovigilance data. british journal of haematology. 2018;180(5):727–34. 17. khan h, belsher j, yilmaz m, afessa b, winters jl, moore sb, et al. fresh-frozen plasma and platelet transfusions are associated with 100 j contemp med sci | vol. 9, no. 2, march-april 2023: 93–100 investigation of the frequency and risk factors of pulmonary complications following cardiac surgery original m.s. kermani et al. development of acute lung injury in critically ill medical patients. chest. 2007;131(5):1308–14. 18. sarani b, dunkman wj, dean l, sonnad s, rohrbach ji, gracias vh. transfusion of fresh frozen plasma in critically ill surgical patients is associated with an increased risk of infection. critical care medicine. 2008;36(4):1114–8. 19. bochicchio gv, napolitano l, joshi m, bochicchio k, shih d, meyer w, et al. blood product transfusion and ventilator-associated pneumonia in trauma patients. surgical infections. 2008;9(4):415–22. 20. desborough mjr, sandu r, brunskill sj, doree c, trivella m, montedori a, abraha i, stanworth sj. fresh frozen plasma for cardiovascular surgery. cochrane database of systematic reviews 2015, issue 7. art. no.: cd007614. doi: 10.1002/14651858.cd007614.pub2. 21. gontse leballo, hlamatsi jacob moutlana, michel kasongo muteba, palesa motshabi chakane. factors associated with acute kidney injury and mortality during cardiac surgery gontse leballo, hlamatsi jacob moutlana, michel kasongo muteba, palesa motshabi chakane cardiovascular journal of africa 2021;32(6):313–318. 22. cavayas ya, eljaiek r, rodrigue é, lamarche y, girard m, wang ht, et al. preoperative diaphragm function is associated with postoperative pulmonary complications after cardiac surgery. critical care medicine. 2019;47(12):e966–e74. this work is licensed under a creative commons attribution-noncommercial 3.0 unported license which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly. https://doi.org/10.22317/jcms.v9i2.1313 224 j contemp med sci | vol. 8, no. 4, july-august 2022: 224–228 original measurement serum level of leucine-rich alpha-2-glycoprotein-1 in iraqi hospitalized covid-19 patients maha h. gadhi*, eman s. saleh department of clinical laboratory science, college of pharmacy, university of baghdad, baghdad, iraq. *correspondence to: maha h. gadhi (e-mail:maha.hasan1200m@copharm.uobaghdad.edu.iq) (submitted: 12 april 2021 – revised version received: 19 may 2022 – accepted: 25 june 2022 – published online: 26 august 2022) abstract objective: the study aimed to assess leucine-rich alpha-2-glycoprotein-1 biomarker serum level in hospitalized covid-19 patients. methods: the case control study from multi-center in baghdad included 45 adult patients (19 females and 26 males) with covid-19, diagnosed with a positive real-time reverse transcription polymerase chain reaction and excluded negative rt-pcr for covid-19 and comorbidity conditions. second group, 43 control (20 females and 23 males). results: this study found decrease leucine-rich alpha-2-glycoprotein-1 biomarker serum level in these patients and a significant difference in d. dimer, neutrophil count, lymphocyte count, and neutrophil lymphocyte ratio between the patients and controls at a p value equal to 0.000. conclusion: the concentration of leucine-rich alpha-2-glycoprotein-1 in the patients after taking tocilizumab was greatly decreased in many studies. most of the patients in the study were treated with tocilizumab which agent that directly blocks the effect of il-6 by blocking the il-6 receptors and greatly decreased the expression of lrg1 to impair production of the angiopathogenic constituent. keywords: covid-19, interleukin-6, leucine-rich alpha-2-glycoprotein-1 issn 2413-0516 introduction coronavirus disease 2019 (covid-19) pandemic issued through the world health organization (who)1 at 11/3/2020 after announcement that popular of health emergency at 30/1/2020.2 the coronavirus detected according to genomic sequence of virus.3 the viral detection through the real-time or reverse transcription polymerase chain reaction (rt-pcr) testing.4 coronavirus is an enveloped rna virus from beta coronavirus genus,5 nidovirale order, and coronaviridae family.6 covid-19 infection extended from minor and severe infection and very common to cause to insult of different body tissues like heart, kidneys, gastrointestinal tract, and brain,7 covid-19 characterized by abnormal laboratory testing such as leukopenia, lymphopenia, elevated levels of c-reactive protein (crp), lactate dehydrogenase (ldh), d-dimer, serum ferritin, aminotransferase, and the abnormal finding further seen in computed tomography (ct) and chest x-ray.8 covid-19 enter the host cells through angiotensin converting enzyme2 (ace-2) protein7 that present on type ii pulmonary epithelial cells by a spike protein of the virus. the process of virus attachment is succeeded by host trans membrane serine protease 2 (tmprss2) that prim s2 subunit of spike protein to facilitate entry into host cell and caused an early phase through viral-related tissue injury directly and continued after the second phase after the infected host cells cause the activation of immune reaction by releasing the cytokines like interleukin-1 (il-1), interleukin-6 (il-6), interferon (ifn)-γ, tumor necrosis factor-α (tnf α), and other pro inflammatory mediators. over activation of immune response caused liberations greater amounts of cytokines mainly tnf-α and il-6 to the circulations as a cytokine storm and producing locally and extensively of the inflammatory reactions.9 this inflammation caused accumulation of fluid lead to acute respiratory distress syndrome (ards) that a major contributed factor for mortality within patients of covid-19.10 the pro-inflammatory mediator like il-6 and tnf-α can induce level of leucine-rich alpha-2-glycoprotein-1 (lrg1) that is about 50 kda plasma glycoprotein contain 312 amino acid residues and weighing 23% carbohydrate of it. its expressed within macrophages, neutrophils, the endothelial cells, and liver cells.9 lrg1 transcription was activated by il-6 by a phosphorylation and linking stat3 to a consensus sequence in promoter site of the lrg1. the inflammatory cytokines disrupted the vasculatures by many factorial, such as disruption the vascular effects that mediated by cytokine inducing lrg1,11 causing pulmonary edema and increase the vascular permeability.12 the circulating lrg1 levels have been presented to be raised in severe covid-19 patients13 where vascular damage is a primary caused. blocking of il-6 signal at pulmonary endothelium, by anti-il6 receptor antibody, tocilizumab is an immunomodulating agent and highly specific monoclonal antibody directly block effect of the il-6 by blocking the il-6 receptors and greatly decreased the expression of lrg1. lrg1 has been defined an acute phase protein released into the circulation and as biomarker the possible pathological role, prognostic biomarker through determination of severity of infection, and as the subsequent therapeutic targets in covid-19.11 the study aimed to assess the serum level of leucine-rich alpha-2-glycoprotein-1 biomarker in iraqi hospitalized covid-19 patients. measurement of correlation between the serum levels of leucine-rich alpha-2-glycoprotein-1 biomarker, d.dimer. lymphocyte count, and neutrophil count. materials and methods study design this study was approved by the university of baghdad/college of pharmacy and the iraqi ministry of health/rusafa health department. the study was involved a case control from the multi-center, the samples were collected from al-kindy teaching hospital, al-ataa hospital, and sheikh dhari al-fayadh hospital, in baghdad-iraq from september/2021 to january/2022. hospitalized patients with covid-19 tested. 225j contemp med sci | vol. 8, no. 4, july-august 2022: 224–228 m.h. gadhi et al. original measurement serum level of leucine-rich alpha-2-glycoprotein-1 in iraqi hospitalized covid-19 patients the inclusion criteria were involved adult patients from age (20 to 60) years (median age 47) with covid-19 who were diagnosed clinically, patients who showed the positively result to covid-19 infection through the real-time reverse transcription polymerase chain reaction (rt-pcr) of respiratory samples from nasal/oropharyngeal swabs,14 had a fever and pulmonary symptoms (cough, shortness of breath, chest tightness, and pain), and patients with radiological findings of consolidation either on chest x-ray or computed tomography (ct). exclusion criteria include the negatively result of rt-pcr to covid-19 infection, and comorbidities conditions (liver, renal, cardiovascular diseases, hypertension, diabetes, and autoimmune disease). the participants were divided into two groups: group 1: 45 (20 females and 25 males) covid-19 patients with ages that range between 20 and 60 years old. group 2: 43 (20 females and 23 males) control subjects with ages that range between 20 and 60 years old. laboratory analysis the three milliliters of blood samples that have been drawn from patients with covid-19 and healthy control were (1 ml in a gel tube) and left to coagulate for 15 minutes, then the samples were centrifuged at 5,000 rounds per minute (rpm) for 5 minutes to obtain the serum was collected by using the micropipette in a plain tube and stored about –20°c to measure the human leucine-rich alpha-2-glycoprotein-1 (µg/ml) sandwich enzyme-linked immunosorbent assay (elisa) kit.15 other blood samples 2 ml put in: • sodium citrate tube for measurement of d-dimer level in covid-19 patients. the sample of blood in was mixed gently for one minute to mix the sample with an anticoagulant reagent, then centrifuged at 4000 rpm for 6–10 minutes, collected plasma, and was used immediately for measurement level d-dimer by using fluorescence immunoassay.16 • edta test tube to prevent coagulation of blood sample. sysmex/xn-350 analyzer was used for evaluating the white blood cell differential count.17 statistical analysis the data were performed by using ibm spss software (version 26.0; ibm) and microsoft excel 2010. continuous variables were presented as median (interquartile range, iqr) because the variables not normally distributed. the number and percentage for the categorical variables of patients and healthy individuals were compared by using a chi square. the mann-whitney u test used for comparing the continuous variables between both groups. the two-tailed spearman correlation coefficient (non-parametric) for showing the correlation between the leucine-rich alpha-2-glycoprotein-1 biomarker serum level with d.dimer, lymphocyte count, neutrophil count, and neutrophil lymphocyte ratio (nlr). the analysis of receiver operating characteristic (roc) curve for assessing a test’s diagnostic performance or accuracy in distinguishing diseased from normal instances. the tests were two-tailed, and the statistically significant differences were considered at p-values of <0.05. results the study consisted from 45 hospitalized covid-19 patients, there were 20 females and 25 males and apparent healthy subjects 43 were 20 females and 23 males. the result of present study expressed as no significant difference (p value = 0.467) between the gender of patients and the control. this relationship between categorical data, percentages, and numbers are calculated by a chi-square test. the descriptive data were presented as median (interquartile range) due to these variables not normally distributed and p-values were calculated using the mann-whitney u test, a non-parametrical test and the significant differences were considered statistically at p-values of <0.05. the categorical data was represented as numbers and percentages and the relationship between both groups was compared and calculated p-values by the chi square and the statistically significant differences were considered at p-values of <0.05. the result of present study expressed as no significant difference between the age and gender of patients and the control at p value equal to 0.514, 0.467 respectively and significant difference between the leucine-rich alpha-2-glycoprotien-1, d. dimer, neutrophil count, lymphocyte count, and neutrophil lymphocyte ratio between the patients and control at p value equal to 0.000 for these variables (table 1). table 1. general characteristics of the variables between covid-19 patients and control variables patients controls p value age (20−60) year median (iqr) 47 (14) 49 (9) 0.514 gender male (female) number “percent” 25 “28.4%” (20 “22.7%”) 23” 26.1%” (20 “22.7%”) 0.846 lrg1 µg/ml median (iqr) 7.477 (7.963) 12.196 (37.449) 0.000 d. dimer µg/ml median (iqr) 1.06 (1.735) 0.1 (0.048) 0.000 neu × 103/µl median (iqr) 9.8 (4.250) 6.65 (0.99) 0.000 lym × 103/µl median (iqr) 1.2 (0.43) 1.88 (0.42) 0.000 nlr median (iqr) 7.6613 (4.59) 3.075 (1) 0.000 *p < 0.05 statistically significant differences. lrg1: leucine-rich alpha-2-glycoprotien-1 µg/ml, neu × 103/µl: neutrophil × 103/µl, and lym × 103/µl: lymphocyte × 103/µl, nlr: neutrophil lymphocyte ratio. 226 j contemp med sci | vol. 8, no. 4, july-august 2022: 224–228 measurement serum level of leucine-rich alpha-2-glycoprotein-1 in iraqi hospitalized covid-19 patients original m.h. gadhi et al. table 2. correlation between leucine rich alpha2 glycoprotien1 and d.dimer with d.dimer neutrophil count, lymphocyte count parameter lrg1 d.dimer lrg1 µg/ml p value r. p value r. – – 0.007 –0.284** d.dimer µg/ml p value r. p value r. 0.007 –0.284** – – neu × 103/µl p value r. p value r. 0.008 -0.28** 0.000 0.759** lym × 103/µl p value r. p value r. 0.002 0.331** 0.000 –0.54** nlr p value r. p value r. 0.000 –0.412** 0.000 0.733** **correlation is significant at the 0.01 level (2-tailed). p < 0.05 statistically significance. r.: correlation coefficient, lrg1: leucine-rich alpha-2-glycoprotien-1 (µg/ml), neu × 103/µl: neutrophil × 103/µl, and lym × 103/µl: lymphocyte × 103/µl, nlr: neutrophil lymphocyte ratio. table 3. receiver operating characteristic curve for study of covid-19 patients for d.dimer, lymphocyte count, neutrophil count and neutrophil lymphocyte ratio variable(s) accuracy area (auc) significance asymptomatic asymptomatic 95% confidence interval lower bound upper bound d.d (µg/ml) excellent 0.929 0.000 0.864 0.995 neu × 103/µl excellent 0.981 0.000 0.961 1.000 nlr excellent 0.992 0.000 0.981 1.000 lym × 103/µl very good 0.839 0.000 0.754 0.924 fig. 1 receiver operating characteristic curve for d. dimer µg/ml studied groups. in the table 2 lrg1 µg/ml and d.dimer µg/ml expressed a significant correlation with neu × 103/µl, lym × 103/µl, nlr and the significant correlation between lrg1 µg/ml and d.dimer µg/ml sperman correlation revealed a strong correlation between d.dimer µg/ml and neu × 103/µl and nlr and correlation coefficient (r.) values (0.759, 0.733) respectively. the table 3 is showing use of receiver operating characteristic (roc) for measurement the accuracy and area under the curve of the variables (d.dimer, neutrophil count, lymphocyte count and nlr). the accuracy of d-dimer for both groups. area under the curve (auc) of d.d was 0.929, the cutoff value of d-dimer in the s (0.2155 µg/ml), sensitivity 86.7% while the specificity is 97.7% as represented in figure 1. area under the curve (auc) of lymphocyte count was 0.839, the cutoff value of lymphocyte count (0.78 × 103/µl), sensitivity 2.2% while the specificity is 100% as represented in figure 2a while area under the curve (auc) of neutrophil count was 0.981, the cutoff value of neutrophil count (10 × 7.553/µl), sensitivity 88.9% while the specificity is 90.7% and area under the curve (auc) of neutrophil lymphocyte ratio was 0.992, the cutoff value of neutrophil lymphocyte ratio (4.3282), sensitivity 95.6% while the specificity is 97.7% as represented in figure 2b. discussion the study showed the male patients are more susceptible to covid-19 disease than women, and no significant differences in age between both genders, the study agreed with other 227j contemp med sci | vol. 8, no. 4, july-august 2022: 224–228 m.h. gadhi et al. original measurement serum level of leucine-rich alpha-2-glycoprotein-1 in iraqi hospitalized covid-19 patients studies that the males (72%) highly affected than females (28%) and no significance difference in both gender of patients, (p = 0.750) in severe covid-19 infection.18 this study also a significant differences in lymphocytes count and neutrophils count and nlr in covid-19 patients and agreed within the previous studied such as khartabil et al. complete blood count is widely used routine laboratories analysis, the detection of neutrophil count, nlr were extremely increase in covid-19 patients with comparison with healthy subjects and decrease level of lymphocyte count in those patients.17 the data of complete blood count that represented in the neutrophil count and lymphocyte count, and related to nlr. an increase the level of neutrophil count related to the systemic inflammation intensity while decrease the level of lymphocyte count related to sequestration of lymphocytes at site of inflammation and their apoptosis. the combination of these two biomarkers will be better indicator for detection the severe infection in covid-19.19 huang et al. that described same determinations, the patients of icu accomplished by increase leukocyte count, neutrophil count, with decrease lymphocyte count compared without icu.20 when decrease lymphocyte counts below 0.8 × 109/l can related to the severe covid-19 infection and increase neutrophil count higher than 3.5 × 109/l considered as bad medical outcomes.21 the covid-19 prognosis predicted when increase neutrophil-to-lymphocyte ratio (nlr), reported by yang et al. study.22 the meta-analysis for six studies showed the elevation of nlr might propose the poor prognostic within covid-19 patients.21 roc analysis curving appeared nlr is greatest of the accuracy over markers of complete blood count for measuring the severity of covid-19 within cut off value 4.3282 with acceptance to previous studies ciccullo, a. et al. that show the significant increase nlr with patients of severe covid-19 in the cohort study for 452 hospitalized patients.23 in this study appear the significant differences in d.dimer of severe form covid-19 patients and agreed within the previous study ye et al. showed increase d-dimer level in severe forms of covid-19 infection, an increased d-dimer values due to increase the activity of coagulation19 and contributed mechanism due to inflammatory mediator activation and contributed with rupturing of plaque by inflammatory response directly, induce of pro-coagulatory factors, and hemodynamically changing causing ischemia and thrombosis also the angiotensin converting enzyme 2 (ace-2) that sars-cov-2 receptor express with vascular endothelium, least ways for the possible direct viral invasion into myocardium.24 level of leucine-rich alpha-2-glycoprotien-1 biomarker in covid-19 patients in this study in compared with other studied as demichev et al. that reported of a cohort study that increased levels of the inflammatory and acute phase protein within the time such as lrp1 and related to possibility the death due to covid-19 infection.25 among the patients that collected the data of them were presenting in severe infection of covid-19 and presented in the hospitals that collect the data from it in long periods more that 25 days and greater. those patients had been taken tocilizumab as the humanized monoclonal antibody that its a interleukin-6 receptors blocker. in covid-19, first uses within 21 patients from chinese have serious states and notable enhancements. at the initial appearance of il-6 blocker strategies for applying the treatment another patients of covid-19 that include italian patients with different results that leading to the clinical trial of phase ii multicenter.26 in scientific reports of dritsoula et al., showing the block signal of il-6 receptors within tocilizumab to vascular endothelium of the lung causing reduce level of lrg1 led to impair production the angiopathogenic constituent. the meta-analysis and other studies reported tocilizumab for treatment the severly and critical illness of covid-19 have benefit results.11 the limitation in this study, timing of the sample that collected form the fig. 2 receiver operating characteristic curve for studied groups. (a) lymphocyte count (b) neutrophil count and neutrophil lymphocyte ratio. 228 j contemp med sci | vol. 8, no. 4, july-august 2022: 224–228 measurement serum level of leucine-rich alpha-2-glycoprotein-1 in iraqi hospitalized covid-19 patients original m.h. gadhi et al. patients, the sample should collect within the time of them admission to the hospital for measuring differences in the serum of biomarkers after treatment. conclusion the direct participation pathogenesis of immune system in covid-19 infection due to the pro-inflammatory cytokine causing induce systemic inflammation and pulmonary insult. the previous studies were showing the inflammatory mediators, as il-6 cause induce damage of epithelium. the lrg1 biomarker is the one of significant biomarkers producing angiopathogenesis causing disruption in the usual vascular physiology. abbreviation covid-19: coronavirus disease 2019, who: world health organization, rt-pcr: real-time reverse transcription polymerase chain reaction, crp: c-reactive protein, ldh: lactate dehydrogenase, ct: computed tomography, ace-2: angiotensin-converting enzyme2, tmprss2: trans membrane serine protease 2, il-1: interleukin-1, il-6: interleukin-6, ifn-γ: interferon-γ, tnf-α: tumor necrosis factor-α, ards: acute respiratory distress syndrome, lrg1: leucine-rich alpha-2-glycoprotein-1, nlr: neutrophil lymphocyte ratio, roc: receiver operating characteristic, neu × 103/µl: neutrophil × 103/µl, lym × 103/µl: lymphocyte × 103/µl, auc: area under the curve, icu: intensive care unit. acknowledgments special thanks to all physicians and laboratory staff in al-kindy teaching hospital, al-shifaa center al-ataa hospital, and sheikh dhari al-fayadh hospital who helped me in completing collecting data . conflict of interest no conflicts of interest. references 1. allawi, j. s. et al. the first 40-days experience and clinical outcomes in the management of coronavirus covid-19 crisis. single center preliminary study. j. fac. med. baghdad 61, (2019). 2. parasher, a. covid-19: current understanding of its pathophysiology, clinical presentation and treatment. postgraduate medical journal vol. 97 312–320 (2021). 3. al-imam, a., motyka, m. a. & al-doori, h. j. surface web merits for sarscov-2 pandemic in iraq. j. fac. med. baghdad 62, 117–127 (2020). 4. corman, v. m. et al. detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr. eurosurveillance 25, 2000045 (2020). 5. nassi, k. f. clinical evaluation of selected pharmacological treatments used for coronavirus (covid-19) pandemic. j. fac. med. 62, (2020). 6. ouassou, h. et al. the pathogenesis of coronavirus disease 2019 (covid-19): evaluation and prevention. journal of immunology research vol. 2020 (2020). 7. mirz, a. j. & taha, a. y. catheter directed thrombolysis for covid-19 thrombotic complications in kurdistan-iraq: two case reports. j. fac. med. 63, (2021). 8. alqubbanchi, f. b. & al-hamadani, f. y. a pharmacoeconomics study for anticoagulants used for hospitalized covid-19 patients in al-najaf al-ashraf city–iraq (conference paper). iraqi j. pharm. sci. (p-issn 1683-3597, e-issn 2521-3512) 30, 48–59 (2021). 9. yang, y. et al. leucine-rich α2-glycoprotein-1 upregulation in plasma and kidney of patients with lupus nephritis. bmc nephrol. 21, 1–11 (2020). 10. lester, m., sahin, a. & pasyar, a. the use of dexamethasone in the treatment of covid-19. ann. med. surg. 56, 218 (2020). 11. dritsoula, a. et al. angiopathic activity of lrg1 is induced by the il-6/stat3 pathway. sci. rep. 12, 1–14 (2022). 12. rajnik, m., cascella, m., cuomo, a., dulebohn, s. c. & di napoli, r. features, evaluation, and treatment of coronavirus (covid-19). (2021). 13. messner, c. b. et al. ultra-high-throughput clinical proteomics reveals classifiers of covid-19 infection. cell syst. 11, 11–24 (2020). 14. wei, p.-f. diagnosis and treatment protocol for novel coronavirus pneumonia (trial version 7). chin. med. j. (engl). 133, 1087–1095 (2020). 15. shinzaki, s. et al. leucine-rich alpha-2 glycoprotein is a serum biomarker of mucosal healing in ulcerative colitis. j. crohn’s colitis 11, 84–91 (2017). 16. farooqi, h. et al. elevated d-dimer levels are strongly associated with high mortality rate in covid-19 patients. an observational study: elevated d-dimers in covid-19 patients. pakistan biomed. j. 83–89 (2022). 17. khartabil, t. a., de frankrijker, m. m., de rijke, y. b. & russcher, h. the sysmex xn‐l (xn‐350) hematology analyzer offers a compact solution for laboratories in niche diagnostics. int. j. lab. hematol. 43, 29–39 (2021). 18. hachim, i. y. et al. male gender is a risk factor for sever form of covid-19 illness and worse outcome in the middle east. (2020). 19. ye, w. et al. dynamic changes of d-dimer and neutrophil-lymphocyte count ratio as prognostic biomarkers in covid-19. respir. res. 21, 1–7 (2020). 20. huang, c. et al. clinical features of patients infected with 2019 novel coronavirus in wuhan, china. lancet 395, 497–506 (2020). 21. pourbagheri-sigaroodi, a., bashash, d., fateh, f. & abolghasemi, h. laboratory findings in covid-19 diagnosis and prognosis. clin. chim. acta 510, 475–482 (2020). 22. yang, a.-p., liu, j., tao, w. & li, h. the diagnostic and predictive role of nlr, d-nlr and plr in covid-19 patients. int. immunopharmacol. 84, 106504 (2020). 23. ciccullo, a. et al. neutrophil-to-lymphocyte ratio and clinical outcome in covid-19: a report from the italian front line. int. j. antimicrob. agents 56, 106017 (2020). 24. zhou, f. et al. clinical course and risk factors for mortality of adult inpatients with covid-19 in wuhan, china: a retrospective cohort study. lancet 395, 1054–1062 (2020). 25. demichev, v. et al. a proteomic survival predictor for cov