item: #1 of 406 id: jcms-100 author: Abdullah, Jasim A.; Hammadi, Amer Ali; Hakem, Russell; Hatef, Zahra; Hussein, Noor title: Study effect of plant extraction for Cuscuta europaea (Dodder) against two species of bacteria Staphylococcus aureus and Escherichia coli date: 2016-12-23 words: 2896 flesch: 58 summary: In Staphylococcus aureus, the best inhibition zone appear in 200 mg/ml (9.5 mm) and the smallest inhibition zone in 50 mg/ml (7.1 mm), in E. coli, the best inhibition zone appears in 200 mg/ml (9.7 mm) and the smallest inhibition zone in 50 mg/ml (8.2 mm),15 therefore, Researchers have been shown the effect of extract plant activity various from one area to another. This study has been investigated to show the antimicrobial activity of plant extract and drug on the bacteria. keywords: aureus; bacteria; coli; extract; plant; staphylococcus cache: jcms-100.pdf plain text: jcms-100.txt item: #2 of 406 id: jcms-1002 author: Naeimi Bafghi, Neda; NaeimiBafghi, Naeimeh; Salajegheh, Shirin title: Comparison of the effect of oral diphenhydramine and midazolam on sedation of children date: 2021-08-26 words: 3084 flesch: 54 summary: Materials and Methods This clinical trial was performed on children aged 1 to 7 years who referred to the emergency department of Bahonar Hos- pital in Kerman, Iran, for diagnostic radiology procedures ISSN 2413-0516 193J Contemp Med Sci | Vol. 7, No. 4, July–August 2021: 192–195 N.N. Bafghi et al. Original Comparison of the Effect of Oral Diphenhydramine and Midazolam on Sedation of Children from May to August 2019. Cengiz M, Baysal Z, Ganidagli S. Oral sedation with midazolam and iphenhydramine compared with midazolam alone in children undergoing magnetic resonance imaging. keywords: children; diphenhydramine; effect; groups; midazolam; oral; sedation; study cache: jcms-1002.pdf plain text: jcms-1002.txt item: #3 of 406 id: jcms-1004 author: Abbas, Zahra; AL-Fayyadh, Sadeq title: Barriers of Professional Autonomy among Arab-Speaking Countries during Covid-19 Pandemic date: 2021-06-26 words: 5073 flesch: 56 summary: Most study participants (96.0%) had indicated that they work on developing their knowledge & experience about nursing professional autonomy. As presented in Table 3, the highest percentages of the perceived barriers of nursing professional autonomy according to the subjects of the current study were the absence of law(s), describing and protecting professional duties (35.6%), fol- lowed by hospital administration style (26.4%), followed by the policy of the health institution (30.4%), followed by domi- nation of physician’s authority (29.9%). keywords: autonomy; barriers; care; clinical; countries; critical; nurses; nursing; study; work; years cache: jcms-1004.pdf plain text: jcms-1004.txt item: #4 of 406 id: jcms-1005 author: Alabdallat, Nessrin G. title: Antioxidant Properties of Orally Administered of Aqueous Extracts of Selected Medicinal Plants and Paracetamol in Human Volunteers: In vivo date: 2021-06-26 words: 2660 flesch: 52 summary: 179J Contemp Med Sci | Vol. 7, No. 3, May-June 2021: 179–182 Original Antioxidant Properties of Orally Administered of Aqueous Extracts of Selected Medicinal Plants and Paracetamol in Human Volunteers: Preparation of Aqueous Extracts 250 grams of each dried plants from the following medicinal plant (Saliva triloba, Origanum syriacum, Zingiber officinale, Rosmarinus officinalis, Verbena triphylla) was poiling with 12 Liter water for 10-15 mints, and then it covered and left soaking for 4-5 hr at 25 °C. keywords: administration; antioxidant; blood; extracts; officinale; plants; rosmarinus; zingiber cache: jcms-1005.pdf plain text: jcms-1005.txt item: #5 of 406 id: jcms-1007 author: Essa, Sarah Flaieh; Ghafel, Hawraa Hussein title: Physical Health problems among Iraqi Women with Ectopic Pregnancy date: 2021-06-26 words: 2285 flesch: 57 summary: In the fallopian tubes, the largest proportion (98.3 percent) of ectopic pregnancies occur.2 Ectopic pregnancies may occur anywhere in the repro- ductive tract, with the fallopian tube being the most common location.3 The risk of an ectopic pregnancy is increased by many factors. Any mechanism that interferes during this phase with the normal function of the fallopian tube raises the risk of ectopic pregnancy. keywords: bleeding; health; pregnancy; problems; study; women cache: jcms-1007.pdf plain text: jcms-1007.txt item: #6 of 406 id: jcms-1008 author: Raheem, Alaa Wahab; Ghafel, Hawraa Hussein title: Evaluation of Sexual Life Problems among Menopausal Woman with post-menopausal Bleeding at Maternity Hospitals in Baghdad City date: 2021-06-26 words: 2950 flesch: 47 summary: Conclusion Most of menopausal women are showing unproblematic sexual life and they have normal and joyful sexual life regardless they suffering from post-menopausal bleeding. Results Most of women are showing unproblematic sexual life and only (23.5%) are showing problematic sexual life presents the mean of scores for evaluation the items of sexual life among women at menopause age; the mean scores indicate unproblematic among most of the items except the items that are related to (suffering from reduced sexual activity; they had regular sexual relations; suffering from a lack of sexual desire; and they cannot give their husband’s marital rights) that are showing problematic. keywords: age; evaluation; life; menopausal; problems; women cache: jcms-1008.pdf plain text: jcms-1008.txt item: #7 of 406 id: jcms-101 author: Abbas, Israa Saeed title: Interleukin-8 251- A/T polymorphism related to peptic ulcer disease in H. pylori infected patient date: 2016-12-23 words: 2425 flesch: 57 summary: The final volume of DNA extraction product was 200 μl, with final concentration 1.25 ng/μl. Identification of H. pylori glM gene To confirm the presence of H. pylori, DNA in biopsies amplifi- cation and melting conditions were optimized for the PCR assay by using specific primer sequences for gene ureC (glmM) 294 (bp) PCR selected were as follows: glmM – forward primer (5´- AAGCTTTTAGGGGTGTTAGGGGTTT -3´), and glmM–reverse primer (5´-AAGCTTACTTTCTAACACT- AACGC -3´). A/T polymorphism related to peptic ulcer disease in H. pylori infected patient allows the amplification of test DNA only when target allele is contained with samples following reaction in the presence or absence of target allele. keywords: disease; gastric; gene; helicobacter; il-8; pcr; polymorphism; pylori cache: jcms-101.pdf plain text: jcms-101.txt item: #8 of 406 id: jcms-1012 author: Ahmady, Soleiman; Seidi, Masoumeh title: The Development of Supervisory Functions as Experienced by Attending Physicians and Medical Trainees: A Qualitative Directed Content Analysis date: 2021-08-26 words: 7278 flesch: 37 summary: In this context, this study aimed to identify the core components of clinical super- vision functions experienced by attending physicians (PAs) and medical trainees. Intentional sampling with maximum variation was used to select the required participants among medical trainees and attending physicians in teaching hospitals at Shahid Beheshti and Hamadan University of Medical Sciences, Iran. keywords: academic; aps; attending; development; education; functions; medical; patient; physicians; students; study; supervision; support; teaching; trainees; university cache: jcms-1012.pdf plain text: jcms-1012.txt item: #9 of 406 id: jcms-1017 author: Abbasi, Masumeh; Gohari, Sepehr; Ahangar, Hassan; Bahrami, Mohsen; Kamalinejad, Mohammad; Reshadmanesh, Tara; Nazari, Seyede Shadi title: Efficacy of Hawthorn fruit extract on blood pressure and quality of sleep in patients with hypertension along with sleep disorders: A randomized double-blind controlled trial date: 2021-08-26 words: 4575 flesch: 57 summary: The consumable part of these plants includes flowers, leaves, and fruits, which are used more often compared to their bushes.7,14 Many of the beneficial effects of C. monogyna fruit are attributed to its fla- vonoid and phenolic components such as hyperoside, chloro- genic acid, and isoquercetin.15 On this basis, in the current randomized clinical trial, we primarily aimed to investigate ISSN 2413-0516 mailto:masumehabbasi45@yahoo.com 197J Contemp Med Sci | Vol. 7, No. 4, July-August 2021: 196–201 M. Abbasi et al. Original Effect of Hawthorn on blood pressure and quality of sleep the clinical effect of C. monogyna fruit extract on controlling the blood pressure of patients suffering from hypertension along with sleep disorders. Body mass index (BMI); however, was significantly higher in C. monogyna group (P = 0.02) (Table 1). keywords: blood; hypertension; monogyna; patients; pressure; quality; sleep; study; treatment cache: jcms-1017.pdf plain text: jcms-1017.txt item: #10 of 406 id: jcms-102 author: KJ, Salma; AA, Wafaa; A, Zainab title: A study of eating habits among female nursing students in the university of Babylon/Iraq date: 2016-12-23 words: 4806 flesch: 61 summary: 47.0% of study samples were sometimes “avoid eating when hungry”, 41.1% of them were “always avoid soft drinks”, 47.0% of study participants were “sometimes cut food into small pieces”, 39.0% of study samples were “sometimes aware of the calorie content of food”, (36.0%) of study samples were “always avoid food with a high carbohydrate content” i.e. (bread, rice, potatoes, etc.), (77.0%) of students answer they “never vomit after eating”, (46.0%) of study subjects were “never guilty after eating”, ( 52.0%) of study samples were “sometimes think about burning up calories when exercising”, (48.0%) of population sample said “sometimes I take longer than others to eat my meals”, (45.0%) of study sample were “never eat diet foods”, (40.0%) of study samples were “sometimes feel that food controls their life”, (50.0%) of study samples were “sometimes l display self-control around food”, (41.0%) of study sample answer they “never feel that others pressure them to eat”. 27 27.0 99 Obese 30–39.9 1 1.0 100 Dieting state present On dieting regimen 28 28.0 28 Non-dieting regimen 72 100.0 100 sugar, 43.0% of study sample was never engage in dieting behavior, and never like stomach to be empty, 48.0% of study samples were sometimes enjoy trying new rich foods, 41.0% of study samples were sometimes skipped breakfast, majority of participants representing 53.0% were sometimes skipped lunch, 51.0% of study samples were sometimes consumed at least 1≤ serving daily of dairies, while more than half of them, 58.0% were sometimes consume one serving of meat and eggs daily, 49.0% of study sample sometimes consume at least one serving 1≤ serving of fruits and vegetables daily, same time 48.0% of girls were sometimes taking meals regularly, and 39.0% of study sample were sometimes taking snacking. keywords: eating; food; habits; nursing; responses; sample; students; study; table; university cache: jcms-102.pdf plain text: jcms-102.txt item: #11 of 406 id: jcms-1022 author: Naeiji, Hamed; Mokaberinejad, Roshanak; Raeissadat, Seyed Ahmad; Nouri, Farshad; Fallah, Yousef; Haj Manouchehri, Reza; Abbassian, Alireza; Riahi, Seyed Mohammad title: Effect of Persian manual therapy (Fateh technique) on patients with mild and moderate carpal tunnel syndrome: a clinical trial date: 2021-08-26 words: 7758 flesch: 58 summary: In the present study, the effect of Fateh manual therapy intervention on the symptoms of carpal tunnel syndrome was investigated and showed that this treatment could be effective in improving Symptom Severity, Functional Status, and reduced pain of the patients who were investigated using VAS and BCTQ and the electrodiagnostic parameters. Hand therapy is one of the non-surgical conservative treatments for carpal tunnel syndrome. keywords: carpal; control; group; hands; intervention; manual; medicine; pain; patients; s e; s s; severity; splint; study; syndrome; therapy; treatment; tunnel; tunnel syndrome cache: jcms-1022.pdf plain text: jcms-1022.txt item: #12 of 406 id: jcms-103 author: Faraj, Raad K. title: Evaluation of health behaviors among secondary school students in Baghdad city date: 2016-12-23 words: 3987 flesch: 61 summary: 148 J Contemp Med Sci | Vol. 2, No. 8, Autumn 2016: 148–152 Research Evaluation of health behaviors among secondary school students in Baghdad city Raad K. Faraj ISSN 2413-0516 Department of Community Health Nursing, College of Nursing, Baghdad University, Iraq. Objectives The present study aims to assess the health behaviors among secondary school students of smoking, diet, and physical activity and to find out the relationship between health behaviors and socio-demographic characteristics of the students. keywords: behaviors; health; motivation; school; smoking; students cache: jcms-103.pdf plain text: jcms-103.txt item: #13 of 406 id: jcms-1033 author: Boroojeny Shahram, Borjian; Hojjat, Seyedeh Maryam title: The effect of Bispectral index monitoring during induction of anesthesia on the amount of propofol consumtion in patients candidates for surgery date: 2021-08-26 words: 3938 flesch: 55 summary: 1 96 1 64 98 6 206 5 397 8 534 4 36 4 40 2 1 2 2 2 2 » Propofol intake in BIS group: (397.8 ± 98.6) Propofol consumption in non-BIS group: (534.4 ± 206.5) Procedure Patients were randomly selected and then divided into case groups (BIS) and control using random blocking method. keywords: anesthesia; bis; group; induction; patients; propofol; time cache: jcms-1033.pdf plain text: jcms-1033.txt item: #14 of 406 id: jcms-1037 author: Hussein, Nawfal R; Musa, Dildar H; Hawezy, Dawan Jamal; Ahmed, Ferhad MR; Khalid, Fatma Kamal; Naqid, Ibrahim A; Assafi, Mahde Saleh title: A study on the prevalence and the risk factors of hepatitis B virus infection in Kurdistan Region, Iraq: A multicenter study: Prevalence and the risk factors of HBV date: 2021-10-26 words: 3079 flesch: 57 summary: Since the distribution of HBV risk factors is important for any public health prevention plan, this study investigated the prevalence of HBV and its associated risk factors in multiple centers in the Kurdistan region, Northern Iraq. Multivariate analysis of the hepatitis B virus- associated risk factors in the recruited population Factors Coef keywords: blood; factors; hbv; hepatitis; infection; iraq; prevalence; risk; study cache: jcms-1037.pdf plain text: jcms-1037.txt item: #15 of 406 id: jcms-1039 author: Alhusseini, Noara Khaled; Elaasser, Basant; Alshaar, Bushra; Alyousof, Shahd; Boukhet, Susan; Omair, Aamir title: Obesity, Quality of Sleep and Anxiety in Saudi Arabia date: 2021-08-26 words: 6227 flesch: 65 summary: BMI categories and Exercise frequencies of the participants and outcome from GAD-7 and PSQI questionnaires (N = 1123) Nationality P-valueSaudi (n = 544) Non-Saudi (n = 579) n % n % BMI (kg/m2) Underweight (<18.5) DeJesus et al. conducted a study with similar results to ours, indicating higher anxiety scores associated with very low and very high BMI levels in comparison to normal weight.27 Another research in Iran also supports that higher anxiety scores are associated with low weight.28 On the other hand, a study conducted among adults in 2016 showed higher anxiety scores for medium to high BMI levels and an inverted U-shaped association for both low and very high BMI levels with anxiety.29 For Saudis, it was found that almost half the ‘Normal weight’ group had the highest proportion of minimal anxiety as compared to about one-third in the obese group. keywords: anxiety; association; bmi; non; obesity; psqi; quality; respondents; saudi; scores; sleep; week cache: jcms-1039.pdf plain text: jcms-1039.txt item: #16 of 406 id: jcms-104 author: Mohammed, Qahtan Q. title: Perceived Stigma and Treatment-Seeking Behavior in Individuals with Substance Use Disorder in Baghdad date: 2016-12-23 words: 3993 flesch: 54 summary: So, the outcome of stigma for individuals with substance use disorder encom- passes poor mental and physical health, delayed treatment seeking and non-adherence to treatment.5 While there is increasing evidence for documenting the damaging effects of mental illness stigma on psychological wellbeing, few studies have been shown on examining the effects of stigma in specific psychiatric disorders such as the stigma towards substance use disorder that has been studied rarely. The individuals with substance use disorder are showing a fair level of treatment-seeking behavior and they perceived moderate level of stigma. keywords: abusers; behavior; disorder; individuals; seeking; stigma; study; substance; treatment; use cache: jcms-104.pdf plain text: jcms-104.txt item: #17 of 406 id: jcms-1040 author: Masser, Jawad Abdul-Hassan; Mousa, Mazin J.; Makki, Hayder Abdul-Amir; Al-Khafaji, Noor S.K.; Al-Dahmoshi, Hussein O.M.; Mahdi, Zena Abdul-Ameer; Kadhum, Samah Ahmed; Hameed, Safa Jihad; Obeed, Suhad H. title: Calcium and Phosphate Homeostasis in Patients with Recurrent Nephrolithiasis date: 2021-12-26 words: 4719 flesch: 56 summary: Findings from a meta-analysis suggest that serum VitD3 level in kidney stone patients was significantly higher than that in control.6 Likewise, there were a non- significant differences of study variables between those with low and those with high serum VitD3 levels. keywords: calcium; kidney; levels; patients; pth; renal; serum; stone; study; urolithiasis; vitamin; vitd3 cache: jcms-1040.pdf plain text: jcms-1040.txt item: #18 of 406 id: jcms-1050 author: Hassanzadeh, Gholamreza; Moshkdanian, Ghazaleh; Gholaminejhad, Morteza; Poorhassan, Mahnaz; Ebrahimi, Babak; Habibi, Reza; Pasbakhsh, Parichehr; Rastegar, Tayebeh; Abdi, Mahdad; Yazdooei, Yasmin; Gity, Masoumeh title: Correlation between Sphenoclivus angle and Gnathic angle with age and gender in Iranian population using CT-Scan date: 2021-08-26 words: 3237 flesch: 53 summary: Keywords Anthropometry, sphenoclivus angle, cranial base angle, gnathic angle, cephalometric measurements ISSN 2413-0516 http://orcid.org/0000-0002-3056-4080 243J Contemp Med Sci | Vol. 7, No. 4, July-August 2021: 242–246 G. Hassanzadeh et al. Original Correlation between sphenoclivus angle and gnathic angle with age and gender in Iranian population using CT-scan Exclusion criteria were in the following: • People with skull bone abnormalities (congenital or acquired). Sphenoclivus angle (cranial base angle): It is an angle between the sphenoid plane and the basion- pituitary point. keywords: age; angle; basion; correlation; gnathic; iranian; medical; population; sciences; sphenoclivus cache: jcms-1050.pdf plain text: jcms-1050.txt item: #19 of 406 id: jcms-1051 author: Kooranifar, Siavash; Alizadeh Attar, Gholamreza; Talebi, Atefeh; Moradians, Vahan; Pourashraf, Maryam; Rostami, Razieh; Bakhtiari, Nima title: The relationship between air pollutants and spirometric indices in schoolchildren of five areas in Tehran date: 2021-10-26 words: 3083 flesch: 65 summary: ± 9.547.4 ± 13.648.0 ± 11.349.5 First time 51.8 ± 30.154.3 ± 28.051.2 ± 24.154.4 ± 28.754.1 ± 21.762.6 keywords: air; function; pollutants; pollution; study; time cache: jcms-1051.pdf plain text: jcms-1051.txt item: #20 of 406 id: jcms-1058 author: Alahmadi, Ahlam Abdulaziz; Banayah, Hessah Mohammed title: Ajwa seeds (Phoenix dactylifera L.) suspension exerted antidiabetic and antihyperlipidemic effects against streptozotocin-induced diabetes in rats by downregulating insulin expression in the pancreatic beta islets date: 2021-08-26 words: 4874 flesch: 55 summary: Hence, the glucose level returned to a more normal range in Ajwa seeds group. Additionally, hypoglycemic effects were reported in many types of Phoe- nixes dactylifera L. seeds and flesh such as Sukkari date seeds,16 Hayani,26 and other types.27 Similar results hypothesized that Ajwa date seeds stimulate insulin secretion from existing β-cells, consequently, the blood glucose levels decreased. keywords: ajwa; ajwa seeds; cells; control; diabetes; diabetic; glucose; group; insulin; rats; seeds; serum cache: jcms-1058.pdf plain text: jcms-1058.txt item: #21 of 406 id: jcms-1059 author: Bawazir, Yasser M.; Jali, Ibtisam title: Knowledge and Misconceptions Regarding SLE Among Medical Students at King Abdulaziz University date: 2021-08-26 words: 3847 flesch: 56 summary: Keywords Systemic lupus erythematous, medical students, medical education, SLE awareness, Saudi Arabia ISSN 2413-0516 https://orcid.org/0000-0002-5060-3884 mailto:ymbawazir@kau.edu.sa 248 J Contemp Med Sci | Vol. 7, No. 4, July–August 2021: 247–251 Knowledge and Misconceptions Regarding SLE among Medical Students at King Abdulaziz University Original Y.M. Bawazir and I. Jali Forms. Frequency of preferred ways of learning about SLE among participants Ways of learning about SLE Number of responses (%) A. See patients in the wards and analyze the pathophysiology, diagnosis, and treatment of the disease. keywords: clinical; knowledge; learning; medical; number; sle; students; university cache: jcms-1059.pdf plain text: jcms-1059.txt item: #22 of 406 id: jcms-1060 author: Murad, Manal Abdulaziz; Abousada, Hoda Jehad; Aldugman, Ghaida Abdullah; Qusti, Nesreen Nabeel; Alsulaimani, Shahad Daifalla; Al Nahari, Sahira Jilan; Alnaimi, Mona Ibrahim; Alsarsh, Aouss Khalid title: Food groups that exacerbate Sinusitis among Saudi Patients date: 2021-08-26 words: 2799 flesch: 50 summary: Comparative analysis of food groups and their frequency in triggering symptoms of rhinosinusitis Food categories Sinusitis aggravated No aggravation Chi-square value P-value Chocolate vs. white flour 41 34 350 331 0.3309 0.565 Chocolate vs. fried foods 41 27 350 341 2.304 0.128 Chocolate vs. pastries 41 24 350 363 4.66 0.03 Chocolate vs. fatty meats 41 23 350 358 5.024 0.02 Chocolate vs. white sugar 41 20 350 345 6.38 0.01 Chocolate vs. mashed potatoes 41 9 350 383 21.96 <0.0001 White flour vs. fried foods 34 27 331 341 0.94 0.33 White flour vs. pastries 34 24 331 363 2.56 0.11 White flour vs. fatty meats 34 23 331 358 2.83 0.09 White flour vs. white sugar 34 20 331 345 3.91 0.04 White flour vs. mashed potatoes 34 9 331 383 17.38 0.00003 Fried foods vs pastries 27 24 341 363 0.39 0.54 Fried foods vs fatty meats 27 23 341 358 0.51 0.47 Fried foods vs white sugar 27 20 341 345 1.04 0.31 Fried foods vs mashed potatoes 27 9 341 383 10.69 0.0011 Pastries vs. fatty meats 24 23 363 358 0.0091 0.92 Pastries vs. white sugar 24 20 363 345 0.18 0.67 Pastries vs. mashed potatoes 24 9 363 383 7.32 0.0068 Fatty meat vs. white sugar 23 20 358 345 0.11 0.74 Fatty meats vs mashed potatoes 23 9 358 383 6.81 0.009 White sugar vs mashed potatoes 20 9 345 383 5.19 0.022 255J Contemp Med Sci | Vol. 7, No. 4, July–August 2021: 252–255 M.A. Murad et al. Abstract Objective This study aimed to identify associations between specific food categories and aggravation of symptoms of chronic rhinosinusitis. keywords: chocolate; food; groups; patients; rhinosinusitis; saudi; study; symptoms cache: jcms-1060.pdf plain text: jcms-1060.txt item: #23 of 406 id: jcms-1065 author: Mohammad, Ameen Mosa; Guelker, Hartmut K; Sheikhow, Sabri K title: Incidence and prognostic significance of myocardial injury after elective percutaneous coronary intervention in Duhok, Iraq date: 2021-10-26 words: 3758 flesch: 56 summary: *Correspondence to: Ameen M Mohammad (E-mail: doctoramb@yahoo.com) (Submitted: 10 July 2021 – Revised version received: 02 August 2021 – Accepted: 25 August 2021 – Published online: 26 October 2021) Abstract Objectives: This study aims to look at the incidence of myocardial injury after elective percutaneous coronary intervention (PCI) and to correlate its effect to midterm clinical outcome. Myocardial infarction due to percutaneous coronary intervention. keywords: cardiac; coronary; ctn; elective; injury; intervention; patients; pci; study; troponin cache: jcms-1065.pdf plain text: jcms-1065.txt item: #24 of 406 id: jcms-1071 author: Toutouni, Hediyeh; Banihashem Rad, Seyed Ahmad; Boroumand, Farzaneh; Hoseini Pouya, Fatemeh title: Designing and validating a questionnaire on oral health care knowledge, attitude, and practice of dental staff date: 2021-10-26 words: 5223 flesch: 60 summary: This study aimed to design a valid questionnaire to evaluate knowledge, attitude, and practice (KAP) of Mashhad Dental school staff about oral health care and to assess the validity and reliability of this instrument. Providing facilities, under- standing the necessity of treatment and its process along with urgency, ability to be more empathetic, and giving clear and simple explanations to patients are critical for treatment process which would certainly affect patients’ satisfaction as a part of chair side manner.2,7 Several factors affect the relationship between staff and patients containing staff ’s awareness of related health issues and health promotion programmes.2 On the other hand, the proper planning for maintaining and improving the staff ’s oral health, their knowledge, attitude, and practice which are also needed for appropriate dental reform in a dental setting, requires a survey at first place, which measures their awareness towards oral health care. keywords: attitude; care; caries; content; cvi; dental; health; instrument; knowledge; practice; questionnaire; questions; staff; validity cache: jcms-1071.pdf plain text: jcms-1071.txt item: #25 of 406 id: jcms-1073 author: Mohammed, Lina Yousif; Jamal, Shaker A; Hussein, Nawfal R; Naqid, Ibrahim A title: Prevalence of Vitamin D deficiency and associated risk factors among General Populations in Duhok province, Kurdistan Region, Iraq: Prevalence of Vitamin D deficiency in Duhok Province, Iraq date: 2021-10-27 words: 3560 flesch: 60 summary: The major source of vitamin D is formed in the skin after exposure of 7-dehydrocholesterol to ultraviolet sun rays (vitamin D3) while minor source of vitamin D comes from food (vitamin D3, cholecalciferol) and from dietary sup- plements (vitamin D2, ergocalciferol) for synthesize a signifi- cant amount of vitamin D requirements.14 Vitamin D (D2 and D3) from the skin and diet are transported and metabolized in the liver to produce 25(OH) vitamin D3 which is used to determine the level of vitamin D in patients, then the kidney converted it by 25-hydroxyvitamin D-1α- hydroxylase enzyme to its to its active form 1,25(OH)2 vitamin D.15 In Iraq including Kurdistan Region, with sunlight throughout the year, vitamin D serum levels are expected to be adequate, yet studies from different Arab countries showed high prevalence levels of vitamin D deficiency and insuffi- ciency.16,17 The prevalence of vitamin D deficiency level is very high and varies from 70% to 90% in different populations, globally.18 There is limited data on the prevalence of Vitamin D defi- ciency among the general population in Kurdistan Region- Iraq. There was significant difference between the status of vitamin D level and their current residency when analysed using the Fisher Exact Test (P = 0.067). keywords: age; deficiency; iraq; levels; mean; population; study; vitamin; zakho cache: jcms-1073.pdf plain text: jcms-1073.txt item: #26 of 406 id: jcms-1074 author: Ganji, Azita; Roustai Geraylow, Kiarash; Shahbazkhani, Bijan; Attarian, Fahimeh title: Common Clinical Symptoms and Concomitant Disease in Celiac Patients – A Large Cohort Study in the North-East of Iran date: 2021-12-26 words: 4880 flesch: 61 summary: In our cohort common type of CD disease was gastroin- testinal, interestingly, 2.65% of total cohort was diagnosed by CD screening, which is lower than previous reports (5–21%).2,4,23 The most common GI symptom was dyspepsia. In our study, 31.01% of patients reported more than one specific clinical symptoms of CD disease. keywords: celiac; cohort; disease; disorders; dyspepsia; liver; patients; pubmed; study; symptoms; type cache: jcms-1074.pdf plain text: jcms-1074.txt item: #27 of 406 id: jcms-1076 author: Khaksar, Mohammad Ali; Hayati, Fatemeh; Bahreini, Amin; Shayesteh zadeh, Behrouz; Shayan pour, Shokouh title: Surgical early complications of the laparoscopic insertion of peritoneal dialysis catheter: A cross-sectional descriptive two-center study in Ahvaz, southwest of Iran date: 2021-12-26 words: 3053 flesch: 41 summary: Therefore more studies to evaluate the association between early complications of the laparoscopic insertion of peritoneal dialysis catheter and factors like comorbidities, BMI, and factors which can affect surgical complications are recommended. Also, we suggest that another study be con- ducted dealing exclusively with the late complications of the laparoscopic insertion of peritoneal dialysis catheter. keywords: catheter; complications; dialysis; insertion; laparoscopic; patients; study; surgery cache: jcms-1076.pdf plain text: jcms-1076.txt item: #28 of 406 id: jcms-1081 author: Khaksar, Mohammad Ali; Zanganeh Yousefabadi, Elham; Taleb Zadeh, Reza; Rashidi, Homeira; Maniati, Mahmood; Bakhtiari, Nima title: Prevalence of comorbidities and its impacts in Hospitalized patients with COVID-19 date: 2021-10-26 words: 5417 flesch: 60 summary: Methods: This was a retrospective, cross-sectional study analyzing data related to the epidemiological characteristics of COVID-19 patients admitted to Razi Hospital in Ahvaz, Iran from November 2020 to February 2021. Throughout the world, researchers have been investigating risk factors that deterio- rate the condition of COVID-19 patients. keywords: comorbidities; covid-19; diabetes; disease; icu; patients; study; yes cache: jcms-1081.pdf plain text: jcms-1081.txt item: #29 of 406 id: jcms-1083 author: Chabuck, Zainab Adil Ghani; Alhelli, Sarah Hashim; Jasim, Saade Abdalkareem title: Effects of anti-Tuberculosis Drugs on the Level of some Nutritional Factors Among Patients with tuberculosis date: 2021-12-26 words: 1990 flesch: 56 summary: *Correspondence to: Zainab Adil Ghani Chabuck (E-mail: zainabibz@gmail.com) Abstract Objectives: The study aimed to assess changes in the level of some nutritional elements including zinc and copper for tuberculosis patients before, during and after anti- tuberculosis therapy. This could occur due to change in the distribution of zinc flowing through out further tissues including the liver; this is due to a reduced production of α-2- macroglobulin in the liver; this protein carry zinc in the blood, to get advantage of high production of this protein, it carries zinc to the liver.6 The result was matched with the study of 6 who found that no significant difference in the mean Zinc (P = 0.415) levels between Tuberculosis patients who have completed Anti- Tuberculosis Treatment 80.48 and Healthy groups 86.42. keywords: copper; patients; therapy; tuberculosis; zinc cache: jcms-1083.pdf plain text: jcms-1083.txt item: #30 of 406 id: jcms-1087 author: Jafar, Nadhir Najim; Hussein, Ahmed Ali title: Pyrimidine Derivatives as Promising Candidates for Potent Antiangiogenic: A silico Study date: 2021-12-26 words: 3193 flesch: 53 summary: Tischer E, Gospodarowicz D, Mitchell R, et al. Connolly DT, Heuvelman DM, Nelson R, et al. keywords: compound; derivatives; energy; interaction; ligand; pyrimidine cache: jcms-1087.pdf plain text: jcms-1087.txt item: #31 of 406 id: jcms-1088 author: Abusaiba, Mohammed A.; Hadi, Najah R.; Fedacko, Jan; Singh, Ram B.; Al-Aubaidy, Hayder A. title: Post COVID-19 Subacute thyroiditis: A case report date: 2021-10-26 words: 1355 flesch: 54 summary: Most importantly, knowing that most of the new cases are asymptomatic.8 Careful examination of the neck looking for localized tenderness around the thyroid gland with laboratory investigation for thyroid function test is advisable for all patients following COVID-19 infection. 2. Seyed Resuli, A. and M. Bezgal, Subacute Thyroiditis in COVID-19 Patients. keywords: covid-19; infection; sat; thyroid; thyroiditis cache: jcms-1088.pdf plain text: jcms-1088.txt item: #32 of 406 id: jcms-1089 author: Mohammad, Ameen Mosa title: The Shifting Environment of Medical Knowledge and the Necessity for Professional Adjustment date: 2022-12-26 words: 943 flesch: 42 summary: The influx of medical information looks equally attention-grapping when global contributions on the corona- virus are reckoned. A short guide for medical professionals in the era of artificial intelligence. keywords: information; knowledge; professionals cache: jcms-1089.pdf plain text: jcms-1089.txt item: #33 of 406 id: jcms-1093 author: Hussein, Nawfal R title: The prevalence of procalcitonin positivity in patients with severe Covid-19 date: 2022-08-26 words: 2025 flesch: 54 summary: Factor associated with clinical outcomes in patients with severe Covid-19 patients Cured Died P OR CI Gender (Male) 23/51 4/4 (100%) 0.99 87 0 Chronic diseases 43/51 (84.3%) 3/4 (75%) 0.64 0.56 0.0514–6.0650 Positive procalcitonin 4/4 (100%) Keywords: Procalcitonin, Covid-19, Iraq ISSN 2413-0516 Introduction Since the discovery of SARS-Cov-2 virus in Wuhan, China in December 2019, Coronavirus disease (COVID-19) spread throughout the planet.1 The vast majority of countries, including Iraq, decided to take extraordinary measures to stop the spread of COVID-19 and reduce the morbidity and mor- tality.2,3 In Iraq, the status of lockdown was declared with the cancellation of gathering and religious rituals, closing schools and education institutes and closing airports and boarders.4 About 80% of Covid-19 patients have mild to moderate symp- toms and may not require specific treatment.1 However, 20% of Covid-19 patients may require hospitalization and ICU admission.1 In the absence of agreed guidelines for the treat- ment of Covid-19 infection, different medications, including antibiotics, have been used to treat such patients.5 Before the Covid-19 pandemic, antimicrobial resistance was global public health issue that claimed more than half a million lives, annually.6,7 keywords: covid-19; disease; iraq; patients; procalcitonin; study; symptoms cache: jcms-1093.pdf plain text: jcms-1093.txt item: #34 of 406 id: jcms-1095 author: Heidari , Reihaneh ; Najafzadeh , Mahsa ; Erfaniyan, Reza ; Razmpa , Ebrahim ; Emami , Hamed ; Heidari, Matineh title: Evaluation of effective factors on pain in patients undergoing sleep apnea surgery date: 2022-02-26 words: 3468 flesch: 49 summary: Depending on the type of surgery, its duration, the patient’s age, the type of opioid prescribed after surgery and other factors, different amounts of postoperative pain have been reported in different studies. Therefore, the aim of this study was to investigate the factors affecting postoperative pain. keywords: apnea; factors; intensity; osa; pain; patients; sleep; study; surgery cache: jcms-1095.pdf plain text: jcms-1095.txt item: #35 of 406 id: jcms-1097 author: Nouri, Masoumeh; Larizadeh, Mohammad Hasan; Mollaei, Hamid Reza; Mianroodi, Aliasghar Arabi; Bahador, Maryam; Shamsi, Sara title: Assessment of Epstein-Barr Virus in Patients with Squamous Cell Carcinoma of the Larynx by Real-Time Polymerase Chain Reaction date: 2021-12-26 words: 4132 flesch: 59 summary: 365J Contemp Med Sci | Vol. 7, No. 6, November-December 2021: 363–367 M. Nouri et al. Original Assessment of EBV in Patients with Squamous Cell Carcinoma of the Larynx by Real-Time PCR The Correlation of Demographic and Clinical Information with EBV Infection in Cancer Patients According to the findings, cancer patients with EBV infection were similar to other cancer patients based on demographic information such as age (P = 0.53), sex (P = 1), cigarette smoking (P = 1), and opium consumption (P = 0.67) (Table 2). The role of many factors, especially tobacco and alcohol consumption, have been confirmed in the develop- ment of laryngeal SCC, but the rate of this malignancy is also increasing in people who do not smoke or drink alcohol.2 Recent studies have investigated the role of viruses in devel- oping this type of cancer.3–5 Epstein–Barr virus (EBV) is a virus that can cause cancer and is transmitted orally and infects more than 95% of people in the first decade of life.1 Although the role of the virus in the pathogenesis of some head and neck cancers, such as naso- pharyngeal cancer, is well known, there are limited studies available on the association of EBV with laryngeal SCC that have shown different results, and the role of EBV in the laryn- geal SCC is still unclear.4,6–9 Although laryngeal cancer mainly affects the glottis in most parts of the world, studies in Iran and Mediterranean countries have reported that the tumor site is mainly in the supraglottis.10–12 On the other hand, it is estimated that the high prevalence of supraglottic cancers than glottis ones in some geographical areas is due to differences in the prevalence of the EBV virus in different locations. keywords: cancer; carcinoma; ebv; infection; laryngeal; patients; scc; study; virus cache: jcms-1097.pdf plain text: jcms-1097.txt item: #36 of 406 id: jcms-1098 author: Safdar, Osama Yousif; Albaz, Ghaidaa Faisal; Mannan, Sara Mohammed; Alshehri, Wejdan Ali; Altumaihi, Razan Mohammed; Bakhashwain, Walaa Jamal; Khayyat, Shahad Tariq; Almehmadi, Wasayf Mohammed title: Prevalence of over-the-counter drug abuse among adults in Jeddah, Saudi Arabia date: 2021-12-25 words: 4382 flesch: 56 summary: In contrast to other studies on the use of OTC drugs in Serbia (57.0 percent), the United Kingdom (38.0 percent), and Northern Ireland (32.2 percent), the prevalence of OTC medication use in our study was higher.15-17 Furthermore, any significant OTC medication rate greater than 50% is more likely to pose a health risk.18 The difference among the rates could be owing to variations in socio-economic factors, such as cultural beliefs, low cost, ease of access, the saving of time, and the severity of illness based on an individual’s knowledge and previous experience.19 The most commonly used types of OTC medications among our respondents were analgesics (90.4 percent), fol- lowed by vitamins and food supplement drugs (52.1 percent). Regarding the duration of OTC drug use, 239 respondents (63.6%) used medication for 1–3 days. keywords: arabia; counter; drug; medication; otc; participants; percent; prevalence; saudi; self; study; use cache: jcms-1098.pdf plain text: jcms-1098.txt item: #37 of 406 id: jcms-1100 author: Mohsin, Haneen Saeed; Ali, Hanaa Addai; Al-Tu'ma, Fadhil Jawad title: Assessment of von Willebrand Factor/ADAMTS13 Ratio and Vitamin K Levels as Predictor Markers for Severity of COVID-19 Patients date: 2021-10-26 words: 4023 flesch: 52 summary: Materials and Methods: In this case-control study, a total of (60) COVID-19 patients (min-max) aged (35–65years) who presented within 7–12 days of displaying COVID-19 symptoms were recruited. The vWF/ADAMTS13 ratio was higher at presentation in COVID-19 patients who died (26.14 vs 12.34; P < .0001). keywords: adamts13; covid-19; group; levels; patients; vitamin; vwf cache: jcms-1100.pdf plain text: jcms-1100.txt item: #38 of 406 id: jcms-1101 author: Alqahtani, Fatimah; Aly, Magda; Bokhari, Fardos; El-Nogoumy, Baher Ali; Alshehri, Wafa title: Isolation and characterization of exopectinase from Bacillus licheniformis FMB9 isolated from agricultural soil date: 2021-10-26 words: 4661 flesch: 51 summary: Effect of different pH on pectinase activity from Bacillus licheniformis pH value Enzyme activity U/ml Relative activity (%) 5 2.69 ± 0.09 119.0 6 2.50 ± 0.12 110.6 7(control) 2.26 ± 0.13 100.0 8 2.20 ± 0.11 97.3 8.5 2.11 ± 0.22 93.3 9 1.33 ± 0.05 58.8 Values are mean ± SD of 3 replicates. Keywords: Pectin; pectinase; Bacillus licheniformis; enzyme activity; 16s rRNA ISSN 2413-0516 1. keywords: activity; bacillus; bacterial; enzyme; fmb9; isolate; journal; licheniformis; medium; pectinase; production; temperature cache: jcms-1101.pdf plain text: jcms-1101.txt item: #39 of 406 id: jcms-1105 author: Mohabati, Fatemeh; Arab, Mohammad; Tajvar, Maryam; Mohaghegh, Bahram; Salarian Zadeh, Mohammad Hossein title: Analyzing the Agenda Setting of the Reforming Policy of the Structure of the Central Staff of Medical Universities in Iran in 2013 Using the Model of Multiple Streams of Kingdon date: 2021-10-26 words: 5281 flesch: 46 summary: • The records of the subject and empirical foundations and partly scientific The first steps for universities structure reform taken in (1995) and continued up to (2013). The current article aimed to explain how this improvement was happened in 2019 in Iran medical universities. keywords: agenda; health; iran; kingdon; medical; ministry; policy; reform; research; stream; structure; system; universities; university cache: jcms-1105.pdf plain text: jcms-1105.txt item: #40 of 406 id: jcms-1106 author: Mohammed, Ibrahim; Ijaz, Sahar; Gholaminejhad, Morteza; Hassanzadeh, Gholamreza title: Clinical Complications Associated with Spinal Cord Injury: A Narrative Review date: 2021-10-26 words: 8326 flesch: 46 summary: This narrative review adds to the knowledge of how spinal cord injury occurs, the various complications resulted by spinal cord injury, through the knowledge of different complications immediate attention will be giving to spinal cord injury patients at the early stage. Keywords: Spinal cord injury, Inflammation, Oxidative stress, Clinical complications ISSN 2413-0516 265J Contemp Med Sci | Vol. 7, No. 5, September–October 2021: 264–271 I. Mohammed et al. keywords: acute; autonomic; blood; chronic; complications; control; cord injury; dysfunction; hassanzadeh; hypotension; inflammation; journal; level; medicine; muscle; patients; pressure; rehabilitation; result; review; sci; sci patients; spinal; spinal cord; system cache: jcms-1106.pdf plain text: jcms-1106.txt item: #41 of 406 id: jcms-1108 author: Sgery, Azri Salih Haji; Hadi, Yousif Maan; Goreal, Amer Abdalla title: Seasonal theory of COVID-19; one-year observation date: 2021-12-26 words: 3040 flesch: 54 summary: Results: A peak in the number of COVID-19 cases and deaths during late autumn and winter months were observed along with some decrease in the number of cases and deaths during spring and summer. Chart 1 shows the global and regional incidence of COVID-19 cases in a 4 week period, from March 1st, 2020 to May 1st, 2021. keywords: cases; countries; covid-19; doubling; sars; seasonality; time; year cache: jcms-1108.pdf plain text: jcms-1108.txt item: #42 of 406 id: jcms-1109 author: Ahmady, Soleiman; Ayazi, Zahra; Kalantarion, Masomeh; Khajeali, Nasrin title: Explaining the Concept of Learning Based on Reflection in Clinical Education: Scoping Review date: 2021-12-26 words: 6963 flesch: 59 summary: Clinical education is undoubtedly the most important and fundamental part of the nursing education program.7,8 It is close to half of the undergraduate education and therefore clinical education is referred to as the heart of nursing education.9 The value of clinical education is accepted by all; And all experts in the field of nursing education believe that the development of scientific and professional nursing educa- tion is impossible without improving clinical education. keywords: clinical; education; learning; medical; nursing; practice; reflection; review; study cache: jcms-1109.pdf plain text: jcms-1109.txt item: #43 of 406 id: jcms-1113 author: AKSOY, UMUT; Şehirli, Ahmet Özer ; SAYINER, SERKAN title: Can Apical Periodontitis Exacerbate Covid-19 Damage? date: 2021-12-26 words: 1127 flesch: 46 summary: Although the studies in this area have increased,3,4 the relationship between apical periodontitis and systemic disease has not yet been completely established. The already increased circulatory proinflammatory cytokines in people with apical periodontitis might aggravate the COVID-19 disease by triggering the cytokine storm and might worsen prognosis. keywords: covid-19; cytokine; disease; east; periodontitis cache: jcms-1113.pdf plain text: jcms-1113.txt item: #44 of 406 id: jcms-1115 author: Mehrpisheh, Shahrokh; Farhadi, Roya; Ghaffari Saravi, Vajihe; Memarian, Azadeh; Nikkhah, Farahnaz title: Efficacy of Amphotericin B on COVID-19: A Case Report Study date: 2022-02-26 words: 2784 flesch: 54 summary: In addition, applying drugs such as Chloroquine and hydroxychloroquine in some COVID-19 patients may be associated with many side effects.19 Our case received treatment with naloxone fol- lowed by meropenem and vancomycin, both of them are antimicrobial agents which improve outcomes and shorten the duration of hospitalization in some cases with respiratory infections including pneumonia.20 Recently, the clinical sig- nificance of therapeutic combination regimens in the man- agement and monitoring of patients who suffer from COVID-19 pneumonia has been considered.20 The use of the different combination regimens has been indicated to improve outcomes of COVID-19 patients; the regimens include meropenem, levofloxacin, vancomycin as the anti- bacterial agents, and hydroxychloroquine, and oseltamivir as the antiviral agents.20 Abstract The role of amphotericin B (AmB) as an antiviral drug against some enveloped viruses has been studied in previous researches. keywords: amb; amphotericin; case; coronavirus; covid-19; doi; patients; report cache: jcms-1115.pdf plain text: jcms-1115.txt item: #45 of 406 id: jcms-1121 author: Mousavi, Mohammad; Tehranchi, Azita; Namdari, Mahshid; Sadeghipour, Maryam; Dalband, Mohsen; Malek Mohammadi, Mahsa; Dalaie, Kazem title: Prevalence of adverse effects of COVID19 vaccines among a sample of Iranian healthcare workers; a comparison between the three available vaccines in Iran date: 2021-12-26 words: 3914 flesch: 57 summary: AstraZeneca vaccine consists of ChAdOx1 (replication- deficient simian adenovirus vector) containing the full-length structural SARS-CoV-2 spike (S) protein. There was also exaggeration and over-reporting of adverse effects of vaccines, as some of these effects are normal physio- logic processes or developmental anomalies.11-13 Thus, this study aimed to evaluate the short-term side effects of COVID-19 vaccines, which are currently used in Shahid Beheshti Dental school. keywords: astrazeneca; dose; effects; injection; pain; second; study; symptoms; vaccination; vaccines cache: jcms-1121.pdf plain text: jcms-1121.txt item: #46 of 406 id: jcms-1125 author: M Saleem, Zana Sidiq; H Abd, Kais ; Ibrahim, Nashwan M.R. ; Hussein, Nawfal R ; Al-Khammas, Hasanain MA title: A study of the Incidence of Cytomegalovirus infection and Preemptive Therapy in Kidney Transplant Recipients date: 2022-02-26 words: 2345 flesch: 56 summary: It was previously shown that different CMV genotypes may influence the severity and the outcome of CMV infection in organ transplant patients.14,15 CMV genotype study has not been performed in our country, therefore more studies are recom- mended investigating CMV genotypes and their association with disease severity and outcomes. Conclusion: Our data suggest that the course of CMV infection is benign with a high success rate of preemptive treatment. keywords: cmv; cytomegalovirus; infection; patients; recipients; study; transplant cache: jcms-1125.pdf plain text: jcms-1125.txt item: #47 of 406 id: jcms-1126 author: Misirli, Melis; Aksoy, Secil; İçen, Murat ; Tumer, Hayriye; Bilginaylar, Kani; Karaoglulari, Suzan; Berberoglu, Atilla; Orhan, Kaan title: Detection of Natural and Simulated Periodontal Defects Using Cone-Beam Computed Tomography and Digital Intraoral Radiography date: 2022-02-26 words: 5348 flesch: 55 summary: *Correspondence to: Melis Misirli (E-mail: melis.misirli@neu.edu.tr) (Submitted: 10 December 2021 – Revised version received: 26 December 2021 – Accepted: 17 January 2022 – Published online: 26 February 2022) Abstract Objectives: In this study, it was aimed to compare the diagnostic value of cone beam computed tomography (CBCT) and digital intraoral periapical imaging methods in the diagnosis of periodontal defects, and the comparison of observers practicing dentistry in the field of periodontology and 3 other observers specialized in various branches was evaluated. In the evaluation of periodontal defects, there was no single observer who had good results, different imaging methods and varying results were obtained in different defects. keywords: bone; cbct; defects; dehiscence; detection; furca; kappa; kvp; observer; sensitivity; study cache: jcms-1126.pdf plain text: jcms-1126.txt item: #48 of 406 id: jcms-1128 author: Al Nasiri, Yusra; Al Abri, Aisha ; Al Rawahi, Afra ; Al Harrasi, Al Anood ; Al Shuaibi, Amal ; Al Owisi, Amina ; Al Rashdi, Arwa ; Al Shabibi, Atheer ; Al Hakmani, Balaqis ; Al Harthi, Shamsa title: Mental Health Wellbeing of School Age Children is Matter: A Study to Evaluate the Effectiveness of a School-Based Mental Health Awareness Program in The Middle Schools in Oman: Mental Health wellbeing of School Age Children date: 2022-02-26 words: 3303 flesch: 55 summary: Some studies attempted to evaluate the effectiveness of mental health programs on reducing mental health symptoms affecting children. 4) Poster presentation of the findings of a study done by the nursing students in previous years on mental health status among school age children; 5) A consultation corner by a psychologist to guide and address the parents’ con- cerns on child health mental illness and issues; 6) Material dis- tributions on mental health. keywords: age; awareness; children; health; parents; program; school; students; study cache: jcms-1128.pdf plain text: jcms-1128.txt item: #49 of 406 id: jcms-1133 author: Motwali, Ebtihal A.; Aly, Magda M.; Qari, Huda A.; Alhazmi, Nuha M. title: Effect of nutritional factors and growth conditions on biosurfactant production by Pseudomonas mendocina and Pseudomonas oleovorans isolated from oil contaminated soil in Jeddah city date: 2021-12-26 words: 6488 flesch: 42 summary: In such oil contaminated envi- ronment, biosurfactant production by microorganisms facili- tate emulsification of the hydrocarbons.3 To isolate interesting biosurfactant producing microbes, effective screening analysis should be employed. Statically, biosurfactant production by Ps. mendocina EMB16 also was significantly improved with yeast extract, while with NaNO3 for Ps. oleovorans EMB21. Effects of Different C/N Ratios on Biosurfactant Production A suitable carbon source for each tested Pseudomonas species was added to the production media with different concentra- tions, along with a constant concentration of a selected nitrogen source (Urea). keywords: bacterial; biosurfactant; emb16; emb21; isolates; mendocina; mendocina emb16; oil; oleovorans; production; pseudomonas; surface cache: jcms-1133.pdf plain text: jcms-1133.txt item: #50 of 406 id: jcms-1134 author: Kamel, Suzan Haleem; Al-Tu'ma, Fadhil Jawad; Al-Saegh, Riyadh Mohi title: Angiotensin-Converting Enzyme Receptor Genotype and its Activity Level as Potential Predictors of the Severity COVID-19 among Iraqi Patients date: 2021-12-26 words: 7334 flesch: 54 summary: Conclusion: In the ACE-2 polymorphism, the D/D genotype allele is implicated as a risk factor for severe Covid-19 patients, in Iraqi population. Genotyping for ACE-2 receptor gene polymorphism was performed by the polymerase chain reaction- keywords: ace; activity; allele; angiotensin; control; converting; covid-19; gene; genotype; group; patients; polymorphism; receptor; table cache: jcms-1134.pdf plain text: jcms-1134.txt item: #51 of 406 id: jcms-1153 author: Shafeeq, Ahlam Adnan; Hamandi, Zaid Mohammed Ali; Mohammed, Mohammed Hassan; Al-Shamma, Ghassan title: Synthesis, Characterization, and Antimicrobial Evaluation for New Azo-linked Derivative of Heterocyclic Compounds date: 2022-02-26 words: 4948 flesch: 46 summary: Then, this mixture was filtered, washed well with water, recrystallized from absolute ethanol, dried, and collected as compound A2. Methods of Characterization and Identification Thin Layer Chromatography (TLC) The antimicrobial effect of compound A2 on selected bacteria and fungi Microbes Absorbance = (2–log % G.l.) keywords: antimicrobial; azo; characterization; compound; growth; heterocyclic; inhibition; ornidazole; stretching; synthesis; vibration cache: jcms-1153.pdf plain text: jcms-1153.txt item: #52 of 406 id: jcms-1154 author: Al Alwan, Nada A S title: Cancer Control and Oncology Care in Iraq date: 2022-02-26 words: 3446 flesch: 42 summary: In general, the officially registered educational training programs belonging to the Iraqi MOHESR, MOH and KRG graduate hundreds of oncology specialists annually; thus yielding numerous studies on cancer care. In addition to the educational and training opportunities on cancer control offered through WHO and IARC, IAEA signed a Country Program Framework (CPF) with the Republic of Iraq in 2017 for the years (2018 - 2023). keywords: 2020; breast; cancer; care; control; country; eastern; health; iraq; mediterranean; oncology; research cache: jcms-1154.pdf plain text: jcms-1154.txt item: #53 of 406 id: jcms-1157 author: Mohammadi, Saeed; Mirhadi, Seyed Javad; Javadi Vasigh, Hosein; Asadi, Khatere; Memarian, Azadeh; Nikkhah, Farahnaz title: Demographic evaluation of Post-Concussion Syndrome in referrals to Bandar Abbas Forensic Medical Center, South of Iran from March 2020 to August 2021 date: 2022-04-26 words: 3482 flesch: 61 summary: Therefore, it is significant to develop approaches to prevent PCS symptoms in injured patients, increase awareness of patients as well as physicians on the incidence of PCS, detect PCS at the earliest time, and develop approaches to improve recovery in these patients. Headache and dizziness were significantly the most prevalent symptoms in PCS patients. keywords: accident; brain; concussion; injury; patients; pcs; prevalence; symptoms cache: jcms-1157.pdf plain text: jcms-1157.txt item: #54 of 406 id: jcms-1158 author: Masoumian Hosseini, Toktam; Ahmady, Soleiman; Edelbring, Samuel title: Teaching Clinical Decision-Making Skills to Undergraduate Nursing Students via Web-based Virtual Patients during the COVID-19 Pandemic: A New Approach to The CyberPatientTM Simulator date: 2022-02-26 words: 5707 flesch: 46 summary: Keywords: Nursing students, clinical decision-making, simulation education, virtual simulation, skill ISSN 2413-0516 Introduction One of the most important aspects of nursing education is teaching clinical decision-making skills.1 Because of the com- plexity of the legal and professional issues they face today, nursing students must acquire sufficient skills to make clinical decisions during their education.2 Also, before the intervention, most students were thinking analytically (63/80%) and making clinical decisions, while after the intervention, most students had an analytic-intuitive model of clinical decision-making (63/80%). keywords: case; decision; education; intervention; journal; making; medical; nursing; patient; simulation; skills; students; study; virtual cache: jcms-1158.pdf plain text: jcms-1158.txt item: #55 of 406 id: jcms-1162 author: Abdel-Hamid , Nabil Mohie ; Hassan , Mohamed K ; Ahmed, Amal AM ; Abd Allah, Sara Gamal ; Anber, Nahla H. title: Liver proliferating cell nuclear antigen, BAX/Bcl-2 ratio, collagen, and polysaccharide accumulation as diagnostic tools in experimental hepatocellular carcinoma : BAX/Bcl-2 ratio, polysaccharide, collagen, and PCNA in hepatocellular carcinoma diagnosis date: 2022-02-26 words: 4480 flesch: 42 summary: Also, depressed caspase-3, elevated collagen, polysaccharide accumulation, proliferating cell nuclear antigen in liver tissues, and depressed BAX/Bcl-2 ratio. Liver Tissue Investigations Spectrophotometric assays for malondialdehyde (MDA), nitric oxide (NO), reduced glutathione (GSH) contents, and superoxide dismutase (SOD) activity in liver tissue homogen- ates were executed, using kits purchased from Biodiagnostic, Cairo, Egypt. keywords: accumulation; apoptosis; apoptotic; bax; cancer; carcinoma; collagen; control; dena; group; hcc; hepatocellular; liver; tissue cache: jcms-1162.pdf plain text: jcms-1162.txt item: #56 of 406 id: jcms-1163 author: AL-Ghamdi, Maryam A. title: Association Of Taqi Polymorphism of Vitamin D Receptor (VDR) Gene with Anemia in Saudi Women date: 2022-02-26 words: 2743 flesch: 58 summary: This strongly supports our observation that links anemia and vitamin D anemia. Conclusion: This is the first report of a significant association between vitamin D receptor gene polymorphisms and anemia in saudi population. keywords: anemia; gene; polymorphisms; study; taqi; vdr; vitamin; women cache: jcms-1163.pdf plain text: jcms-1163.txt item: #57 of 406 id: jcms-1164 author: Abed, Ali Musa ; Al-Shuk, Muneim Maki ; Ahmed, Saja Talib ; Al-Tu'ma, Fadhil Jawad title: Role of Mitochondrial DNA in Development of Type 2 Diabetes Mellitus with/without Ischemic Heart Diseases of Iraqi Patients date: 2022-02-26 words: 5472 flesch: 56 summary: This study aimed to investigate the associations between various biomarkers and the specific mutation of mitochondrial DNA in type 2 diabetes mellitus with ischemic heart diseases and compared with T2DM patients without ischemic heart disease. The obtained data revealed that a strong positive correlation between Homeostatic Model Assessment for Insulin Resistance (HOMA-IR) and insulin (r = 0.926) with significant differences (P < 0.05) was obtained in the sera of type 2 diabetic patient with ischemic heart disease as compared with that obtained in type 2 diabetic patients without ischemic heart diseases. keywords: diabetes; disease; dna; heart; heart disease; ihd; insulin; mellitus; mutation; patients; pcr; type cache: jcms-1164.pdf plain text: jcms-1164.txt item: #58 of 406 id: jcms-1166 author: Saleem, Zana Sidiq Mohammed title: Severity of Covid-19 infection among kidney transplant recipients in Duhok city, Kurdistan region, Iraq date: 2022-02-26 words: 3344 flesch: 56 summary: Cravedi P, Suraj SM, Azzi Y et al. COVID-19 and kidney transplantation: results from the TANGO international transplant consortium. Mahalingasivam V, Craik A, Tomlinson LA et al. COVID-19 and kidney transplantation: a systematic review. keywords: covid-19; infection; kidney; patients; recipients; risk; study; transplant; transplantation cache: jcms-1166.pdf plain text: jcms-1166.txt item: #59 of 406 id: jcms-1167 author: Alomrani, Basmah ; Javed, Murid ; Mohammed Ali , Hani S. H. ; Abo-Aba, Salah E. M. ; AlBakheet, Albandary ; Alqudairy, Hanan ; Kaya, Namik title: Genetic Causes, Clinical Manifestations and Diagnosis of Central Nervous System Malformations with Emphasis on Corpus Callosum date: 2022-02-26 words: 16183 flesch: 59 summary: Walsh D M, Shalev S A, Simpson M A, Morgana N V, Gelman-Kohan Z, Chemke J, Trembath R C, Maher E R. Acrocallosal syndrome: Identification of a novel KIF7 mutation and evidence for oligogenic inheritance. Shaheen R, Rahbeeni Z, Alhashem A, Faqeih E, Zhao Q, Xiong Y, Almoisheer A, Al-Qattan S M, Almadani H A, Al-Onazi N, Al-Baqawi B S, Saleh M A, Alkuraya F S. Neu-Laxova syndrome, an inborn error of serine metabolism, is caused by mutations in PHGDH. keywords: 1–17; 2014; abnormalities; acc; agenesis; autosomal; brain; callosum; causes; chromosome; clinical; congenital; contemp; corpus; defect; deletion; development; diagnosis; disease; disorder; dystrophy; et al; features; february; gene; gene gene; gli3; hum; individuals; j med; january; joubert; joubert syndrome; kif7; malformations; manifestations; meckel; med; mutations; neural; patients; primary; protein; rare; recessive; review; sci; syndrome; system; type; variants; vol cache: jcms-1167.pdf plain text: jcms-1167.txt item: #60 of 406 id: jcms-1168 author: Abou-assy, Rawan S. ; Aly, Magda M. ; Amashah, Reda H. ; Jastaniah, Samyah D. ; Al Deen, Hany M. title: Epidemiology of carbapenem resistance Enterobacterales in Saudi Arabia: A systematic review date: 2022-02-26 words: 7243 flesch: 59 summary: M ed in a 15 ,7 08 38 .4 % fo r Im ip en em 46 .1 % fo r M er op en em – K. p ne um on ia e VI TE K- II A l-Z al ab an i et a l. (2 02 0) 47 (C on tin ue d) 23J Contemp Med Sci | Vol. 8, No. 1, January-February 2022: 18–26 R.S. Abou-assy et al. Review Epidemiology of Carbapenem Resistance Enterobacterales in Saudi Arabia: A Systematic Review Ta bl e 4. R ev ie w o f c ar ba pe ne m re si st an ce st ud ie s i n Ce nt ra l, W es te rn , E as te rn , N or th er n an d % – En te ro ba ct er al es (1 4% ), E. c ol i ( 6. keywords: arabia; carbapenem; enterobacterales; genes; hospital; infection; resistance; review; saudi; saudi arabia; studies cache: jcms-1168.pdf plain text: jcms-1168.txt item: #61 of 406 id: jcms-117 author: Murtomaa, Heikki title: BETTER ORAL HEALTH TO ALL date: 2016-12-26 words: 562 flesch: 49 summary: 115 Journal of Contemporary Medical Sciences BETTER ORAL HEALTH TO ALL Despite vast improvement in global oral health, problems persist in many populations and communities particularly among the underprivileged in both and developed and developing countries. This concept bears significant impact on oral health. keywords: diseases; health cache: jcms-117.pdf plain text: jcms-117.txt item: #62 of 406 id: jcms-1178 author: Alkhateeb, Nazdar Ezzaddin; Dauod, Ali Shakir; Shabila, Nazar P; Al-Dabbagh, Ali A title: Faculty and students’ attitude toward e-learning at the start of the COVID-19 pandemic: A cross-sectional study date: 2022-04-26 words: 4862 flesch: 58 summary: The average knowledge and limited usage of e-learning were reflected in their attitudes towards it, as two-thirds of them opposed its potential usefulness, namely, being an interactive, reachable, and flexible platform and appropriate for discussion on com- plex subjects and enhance their skills. Students’ attitude about e-learning use (n = 1706) Attitude Strongly disagree/Disagree Neutral Strongly agree/Agree No. keywords: attitude; covid-19; education; face; faculty; learning; medical; pandemic; staff; students; study; use cache: jcms-1178.pdf plain text: jcms-1178.txt item: #63 of 406 id: jcms-118 author: Khoshnevisan, Mohammad Hossein; Albujeer, Ammar N. H.; Attaran, Nona; Almahafdha, Alya; Taher, Abbas title: WHO's oral health assessment questionnaire for adult: psychometric properties of the Arabic version date: 2016-12-26 words: 2486 flesch: 50 summary: Few items were slightly ISSN 2413-0516 WHO’s oral health assessment questionnaire for adult: psychometric properties of the Arabic version Mohammad Hossein Khoshnevisan,a,b Ammar N. H. Albujeer,c,d Nona Attaran,b Alya Almahafdha,e Abbas Taherf Mohammad Hossein Khoshnevisan et al. 117J Contemp Med Sci | Vol. 2, No. 8, Autumn 2016: 116–118 Research WHO’s oral health assessment questionnaire for adult Results After conducting NGT method, the culturally adapted final Arabic translation of questionnaire was available. In order to interpret the agreement levels, the following categories were selected: “0.0–0.2” for small level, “0.21–0.40” for fair level, “0.41–0.60” for moderate level, “0.61– 0.80” for substantial level and “0.81–1” for almost perfect level.9 118 J Contemp Med Sci | Vol. 2, No. 8, Autumn 2016: 116–118 WHO’s oral health assessment questionnaire for adult Research Mohammad Hossein Khoshnevisan et al. countries. keywords: arabic; health; language; questionnaire; validity; version; world cache: jcms-118.pdf plain text: jcms-118.txt item: #64 of 406 id: jcms-1193 author: Sabah Khalid, Shahad; Mohamed Ali, Zahraa ; Faris Raheem, Mohanad title: Serum Levels of Homocysteine, Troponin-I, and High Sensitive C-Reactive Protein in Iraqi COVID-19 patients date: 2022-06-26 words: 3647 flesch: 56 summary: The current study found a significant increase in measured values of homocysteine in patients’ serum than controls P-value = 0.004 which is < alpha (0.05) with an area under the curve of 0.678, also found a significant increase in measured values of cardiac troponin-I; and hs-CRP in COVID-19 patients than controls, P-values were 0.02 and 0.00 respectively which are < alpha (0.05) with an area under the curve of 0.686 and 0.739 respectively. Many studies reported an association between high levels of hs-CRP and mortality rate in COVID-19 patients. keywords: covid-19; crp; disease; homocysteine; infection; levels; patients; study; troponin; value cache: jcms-1193.pdf plain text: jcms-1193.txt item: #65 of 406 id: jcms-1197 author: Alattas, Sana; Ibrahim, Ibrahim M ; Ali, Ahmed S. ; Barakat, Jehan M ; A Shaker, Assmaa ; Momen, Tasneem N ; S. Mohamed, Abir ; Alfadil, Abdalbabgi ; Alharbi, Amani E title: Safety and efficacy of COVID-19 Vaccines in special populations date: 2022-04-26 words: 10662 flesch: 49 summary: Hwang, J.K., et al., COVID-19 vaccines for patients with cancer: benefits likely outweigh risks. Baden, L.R., et al., Efficacy and safety of the mRNA-1273 SARS-CoV-2 vaccine. keywords: antibody; bnt162b2; cov-2; covid-19; covid-19 vaccine; disease; dose; efficacy; et al; immunogenicity; journal; medicine; mrna; patients; phase; response; review; safety; sars; study; trial; vaccination; vaccine cache: jcms-1197.pdf plain text: jcms-1197.txt item: #66 of 406 id: jcms-1200 author: Kamil, Nawar Bahjet ; Majeed, Sura Saad ; Salman, Mohammed A. title: Histological effect of Artichoke leaf extract on bone healing in rats date: 2022-04-26 words: 2635 flesch: 57 summary: The bone is formed by osteoblasts and when the bone is formed some of them will be embedded in the bone and become osteocytes.1 Bone development happens in two ways, intra membra- nous and endochondral ossification (Ossification is a process of bone formation). This study evaluated the effect of artichoke leaves extract on bone healing. keywords: artichoke; bone; control; experimental; extract; formation; group; healing; week cache: jcms-1200.pdf plain text: jcms-1200.txt item: #67 of 406 id: jcms-1202 author: Mohammad, Ameen M ; Mohammed, Schivan U ; Saeed, Saad Y title: Outcomes of primary percutaneous coronary intervention in ST-Segment elevation myocardial infarction in Kurdistan Region of Iraq date: 2022-04-26 words: 4561 flesch: 67 summary: Keywords: STEMI, primary PCI, Iraq ISSN 2413-0516 Introduction The cardiovascular diseases coming at the top of the list of the disease-related death in Iraq.1 The incidence of STEMI in the area is rapidly over happening particularly in young people.2 According to international medical guidelines the best approach to STEMI patient is the PPCI.3 Discussion This registry showed the feasibility of PPCI with reasonable outcomes in STEMI patients. keywords: cases; coronary; hours; outcomes; patients; ppci; stemi; weeks cache: jcms-1202.pdf plain text: jcms-1202.txt item: #68 of 406 id: jcms-1204 author: Al-Tu’ma, Fadhil Jawad ; Al-Maiyaly, Zahraa Abdul Adheem title: A Novel Study of Protein Kinase C Beta Gene Polymorphism (rs3760106) and Protein Kinase C Activity Levels as a Predictor of Nephropathy Complications in Iraqi Diabetic Patients date: 2022-04-26 words: 5227 flesch: 55 summary: Influence of protein kinase C (PKC) on the prognosis of diabetic nephropathy patients. In diabetic nephropathy group there is a significant correlation between PKC-B level with cre- atinine and eGFR respectively (r = 0.7, P = 0.03, r = –0.6, P = 0.05). keywords: allele; gene; group; nephropathy; patients; protein; study cache: jcms-1204.pdf plain text: jcms-1204.txt item: #69 of 406 id: jcms-1205 author: Al-Tu’ma, Maha M. Kadhim ; Al-Turihi, Mays A. Dakhel ; Ghafat, Sura Zaki title: Comparison of Folliculogenesis and Follicular Maturation in Norvegicus Rats using Foeniculum Vulgare and Clomiphene Citrate date: 2022-04-26 words: 4437 flesch: 51 summary: Results: It was identified that after administration of Fennel citrate drug along with distilled waters, significant differences (P < 0.05) were identified in the rats and all rats formed primary (90% given 800 mg/kg after fennel administration), secondary and matured (80% given 800 mg/kg after fennel administration) follicles. Results: It was identified that after administration of Fennel citrate drug along with distilled waters, significant differences (p<0.05) were identified in the rats and all rats formed primary (90% given / / / https://www.jocms.org/index.php/jcms/index https://www.jocms.org/index.php/jcms/index https://www.jocms.org/index.php/jcms/issue/archive https://www.jocms.org/index.php/jcms/issue/view/68 https://doi.org/10.22317/jcms.v8i2.1205 800mg/kg after fennel administration), secondary and matured (80% given 800mg/kg after fennel administration) follicles. keywords: citrate; clomiphene; fennel; follicles; primary; rats; vulgare cache: jcms-1205.pdf plain text: jcms-1205.txt item: #70 of 406 id: jcms-1206 author: Hadi, Furaq Hussain ; Kadhim, Iman Jabbar ; Deli, Falah Abdulhasan title: Clinical features and upper airway symptoms in association with severity and outcome in patients with COVID-19 date: 2022-04-26 words: 6581 flesch: 58 summary: A significant inverse association was found between SPO2 level and severe disease; patients with mild disease had the higher SPO2 levels with a mean of 97.2 ± 1.1% compared to 92.7% ± 1.2% in moderate disease patients and 74.8% ± 11.3% in severe disease patients, (P. value < 0.001). Distribution of blood urea and serum creatinine levels according to disease severity of among studied group (N = 140) Parameter Severity P. value Chi square test Mild (n = 60) Moderate (n = 40) Severe (n = 40) keywords: association; cases; cov-2; covid-19; disease; mean; mild; n =; patients; sars; severity; significant; symptoms; table cache: jcms-1206.pdf plain text: jcms-1206.txt item: #71 of 406 id: jcms-1209 author: Alrumaikhani, Fahad; Rabbani, Unaib title: Knowledge and Practice of Physicians About Vitamin B12 deficiency among Type 2 Diabetes Mellitus patients in Buraidah, Saudi Arabia date: 2022-08-26 words: 2951 flesch: 57 summary: Vitamin B12 deficiency and the knowledge and practice of physicians regarding screening for vitamin B12 deficiency among type 2 diabetic patients on metformin in selected hospitals in Riyadh, Saudi Arabia. Results: About 135 (72.2%) physicians would test T2DM patients who are on metformin for Vitamin B12, and only 65 (34.8) would test them annually. keywords: b12; deficiency; diabetes; metformin; patients; physicians; study; vitamin cache: jcms-1209.pdf plain text: jcms-1209.txt item: #72 of 406 id: jcms-1218 author: Fartash Tolou, Azadeh; Jadidfard, Mohammad Pooyan ; Ghasemi, Hadi ; Boroumand, Farzaneh ; Namdari, Mahshid ; Khoshnevisan, Mohammad H. title: Influential factors on oral health status of the elderly Iranians: A Path analysis date: 2022-06-26 words: 6270 flesch: 59 summary: This study aimed at assessing the influential factors on oral health status of the elderly Iranian population (65 to 74 years of age) by using Path analysis. This study aimed to assess the effect of influential factors on oral health status of the Ira- nian elderly population with 65 to 74 years old. keywords: dap; dental; dmft; factors; health; insurance; oral; path; ses; status; study cache: jcms-1218.pdf plain text: jcms-1218.txt item: #73 of 406 id: jcms-1220 author: H. Al-Murshedi, Hadbaa ; J. Al-Tu’ma, Fadhil ; A. Hadi, Eman ; Mustafa Mohammed, Borhan ; Al-Kayat, Tarik title: Roles of C-Peptide and Triglyceride as Effective Indices for Insulin Resistance Investigations in Iraqi Women with Polycystic Ovarian Syndrome date: 2022-06-26 words: 5497 flesch: 63 summary: Results: Based on HOMA-IR, the prevalence of insulin resistance in obese PCOS women was 77% while in non-obese PCOS women was 70%. In obese PCOS women, both QUICKI (r = –1.00, P < 0.001) and McAuley (r = –0.81, P < 0.001) were strongly correlated with HOMA-IR, whereas CPI was not. keywords: homa; indices; insulin; non; obese; pcos; peptide; resistance; syndrome; women cache: jcms-1220.pdf plain text: jcms-1220.txt item: #74 of 406 id: jcms-1221 author: Shokri, Taiebe ; Yazdani , Shahram ; Ahmadi, Soleiman ; Afshar , Leila title: Concept analysis of professionalism in teachers and faculty members date: 2022-06-26 words: 5297 flesch: 40 summary: The eight step concept analysis method (Adopted from Walker and Avant, 2005) 1 Selection of concept to analyse 2 Determining the purpose of the analysis 3 Identifying the uses of the concept 4 Determining the defining attributes of the concept 5 Identifying a model case 6 Identifying the borderline, related and contrary cases 7 Identifying the antecedents and consequences 8 Defining the empirical referents ambiguity and semantic integration of this concept to increase the stability in the application of this concept in articles and topics related to teacher professionalism. Walker and Avant state the purpose of concept analysis as follows: The process of distinguishing between the defining features of a concept and its unrelated features. keywords: analysis; concept; concept analysis; education; ethics; faculty; medical; professionalism; students; teacher; teaching cache: jcms-1221.pdf plain text: jcms-1221.txt item: #75 of 406 id: jcms-1222 author: Alzahrani, Kholoud ; Jastaniah, Samyah ; Amasha, Reda ; M. Aly, Magda title: Diversity and Colonization of Endophytic Actinomycetes in some Medicinal Plants: Review date: 2022-06-26 words: 7310 flesch: 49 summary: Pattern recognition is translated into a first line of defense which keeps the most potential invaders under con- trol.24 Endophytic actinomycetes have been equipped with necessary traits that enable them to invade, colonize and translocate in the plant’s interior.25 Plants may subsequently influence the biocontrol expression of endophytic actinomy- cetes against the pathogen.26 Colonizing Organs in Plant Tissues Diversity of endophytic actinomycetes from plant species are documented from various regions around the world. The increased colonization and distribution of endophytic actinomycetes in plants have been reported in many studies. keywords: actinomycetes; colonization; diversity; endophytes; leaf; microbiol; nov; plant; root; stem; vol cache: jcms-1222.pdf plain text: jcms-1222.txt item: #76 of 406 id: jcms-1223 author: R. Salem, Ashraf ; A.R. Al-Wasiti, Estabraq ; A. Hasan, Fahem title: Evaluation of DNA Damage in Traffic Cops Exposed to Polycyclic Aromatic Hydrocarbon Pollution in Baghdad City Streets and its Association to Certain Biomarkers date: 2022-06-26 words: 5180 flesch: 55 summary: As a result, the repeated inhalation of gasoline vapors possesses potential to cause oxidative stress by lowering the body’s antioxidant defenses and cellular functions.47 Poor nutritional status can also contribute to oxidative stress, for example, selenium deficiency, which is associated with increased oxidative stress; higher GPx activity may arise from optimizing Se’s nutritional status. Cohort research done before, during, and after the Beijing Olympics has reported that when air pollution levels increased, indica- tors of total antioxidant status-declined.46 The production of a sizable quantity of ROS by particulate matter in traffic exhausts is one theory for the reported negative health impacts. keywords: air; dna; exposure; levels; police; pollution; polycyclic; stress; study; traffic; years cache: jcms-1223.pdf plain text: jcms-1223.txt item: #77 of 406 id: jcms-1225 author: Kermanian, Fatemeh ; Tavakol, Marzieh ; Beiranvand, Nasim ; Mahakizadeh, Simin title: A descriptive study of Cephalic and prosopic anthropometric indices in one-day-old infants in Imam Ali and Kamali Hospital, Karaj date: 2022-06-26 words: 2876 flesch: 54 summary: There was no significant difference in head shape between two groups. There was no significant difference in head shape between two groups (Table 4). keywords: cephalic; face; female; head; male; type cache: jcms-1225.pdf plain text: jcms-1225.txt item: #78 of 406 id: jcms-1226 author: Maleki, Arash ; Qoreishi, Mohamad ; Shakeri Jousheghan, Saman ; Tajik, Katayoon ; Gholami Manzari, Amirhossein title: Rare case of lateral dislocation of the elbow without distinct radiological signs date: 2022-06-26 words: 1536 flesch: 50 summary: In this study, we described a 65-year-old woman with lateral elbow dislocation referred to Akhtar Hospital. After confirmation of lateral elbow dislocation, the patient was schedule for surgery. keywords: case; dislocation; elbow; joint; reduction cache: jcms-1226.pdf plain text: jcms-1226.txt item: #79 of 406 id: jcms-1231 author: R. Omrain, Alaa ; A.R. Al-Wasiti, Estabraq ; Jassim Hamzah, Mohammed title: Association between Variant Alleles of the X-Ray Cross Complementing Gene (XRCC1) with Benzo[a]Pyrene Levels in Iraqi Workers date: 2022-06-26 words: 4164 flesch: 56 summary: The genotype frequencies studies of XRCC1 gene of car repairers group and controls. Conclusion: As results of prolonged exposure to the higher levels of PAHs that Iraqi car repairs suffer from, they have high levels B[a]P. Especially those who have the TT genotypes, as results of the inefficiency of their DNA repair system. keywords: b[a]p; car; dna; exposure; gene; genotype; group; levels; pahs; pcr; results; xrcc1 cache: jcms-1231.pdf plain text: jcms-1231.txt item: #80 of 406 id: jcms-1232 author: Gadhi, Maha Hassan; S. Saleh, Eman title: Measurement of the serum level of Leucine-rich alpha-2-glycoprotein-1 in hospitalized Iraqi COVID-19 Patients date: 2022-08-26 words: 3818 flesch: 54 summary: The participants were divided into two groups: Group 1: 45 (20 females and 25 males) COVID-19 patients with ages that range between 20 and 60 years old. kit.15 Other blood samples 2 ml put in: • Sodium citrate tube for measurement of D-dimer level in COVID-19 patients. keywords: 103/µl; count; covid-19; leucine; lymphocyte; neutrophil; patients; study cache: jcms-1232.pdf plain text: jcms-1232.txt item: #81 of 406 id: jcms-1233 author: MORKAVUK, Gulin; Sirvanli, Gokce title: The role of Neuropsychological assessment in the Differential Diagnoses of Late-Onset Depression, Dementia, and Mild Cognitive Impairment date: 2023-06-26 words: 6341 flesch: 56 summary: Öktem Verbal Memory Processes test (Ö-VMPT) and WMS (VI) visual pro- duction subtest were used as memory tests. Memory Tests 3.1. keywords: alzheimer; assessment; cognitive; dementia; depression; disease; groups; mci; memory; n(%; normal; patients; study; test; wms cache: jcms-1233.pdf plain text: jcms-1233.txt item: #82 of 406 id: jcms-1235 author: Shamshoon Hagi, Fadi; Yaseen, Yaseen Sedeeq ; Hassan, Liqaa Jabir title: Elongated Mental Spine with Two Lingual Foramina in the Mandible of A Kurdish Woman: A Case Report date: 2022-08-26 words: 1832 flesch: 60 summary: Keywords: CBCT, mental spine, lingual foramen, mandible ISSN 2413-0516 Introduction Many anatomical landmarks can be seen in the anterior lin- gual surface of the mandible, like mental spines, lingual foramen and mandibular symphysis.1 The mental spines (genial tubercules) are small bony emi- nences projected from the lingual surface of mandible.2 Usu- ally four spines are found, two superiors, to which the genioglossus muscles are attached and two inferiors, to which the geniohyoid muscles find their origin.3 Jindal et al.11 reported a case of elongated mental spine in a 78-year-old, completely edentulous male patient with the chief complaint of discomfort while eating. keywords: case; foramina; lingual; mandible; spine cache: jcms-1235.pdf plain text: jcms-1235.txt item: #83 of 406 id: jcms-1236 author: Atrushi, Akrem M. ; Armishty, Farhad; Saleh, Sirwan A. ; Abdulrahman , Mehvan Sh. title: The association between iron deficiency anemia and obesity in children date: 2022-08-26 words: 3366 flesch: 60 summary: According to the World Health Organization (WHO) classification, the prevalence of iron deficiency anemia (IDA) is in the medium level.4 Approximately 18–38% of under 5 years old children have iron deficiency anemia.5 Gajewska40 found that in obese children with sufficient iron intake, the altered ferroportin-hepcidin axis may occur without signs of iron deficiency or iron deficiency anemia. keywords: anemia; children; deficiency; iron; iron deficiency; obese; obesity cache: jcms-1236.pdf plain text: jcms-1236.txt item: #84 of 406 id: jcms-1242 author: Hussein, Nawfal R; Balatay , Amer ; Mohammad , Ameen M ; Dhama, Kuldeep ; Rasheed, Narin A title: Study of factors that impact the production of anti-SARS-CoV-2 antibodies in patients with COVID-19: Factors impacting anti-SARS-CoV-2 antibody production date: 2022-10-26 words: 2936 flesch: 58 summary: Antibody levels were determined using Elecsys Anti-SARS-CoV-2. A significant association was found between antibody levels and the age of the participants (r = 0.175; keywords: antibody; antibody levels; association; cov-2; covid-19; levels; patients; sars; study cache: jcms-1242.pdf plain text: jcms-1242.txt item: #85 of 406 id: jcms-1249 author: Mohammad, Ameen M ; Issa, Haval A ; Saeed, Saad Y title: Clinico-angiographic profiles and in-hospital outcomes of non-ST segment elevation myocardial infarction in Kurdistan Region of Iraq date: 2022-08-26 words: 4473 flesch: 59 summary: Alive 262 92.6 Dead 21 7.4 Total 283 100.0 other studies from Iraq, including Mohammad et al.,17 but was younger compared with western countries’ age presentation of NSTEMI.18-20 The female percentage in our study was 32.5%, which was higher than Kinsara et al. from Saudi Arabia21 and was com- parable to Abdelmoneim et al. Studying the cardiovascular risk factors for the cases, hypertension was the commonest risk factor, followed by smoking in the current study, this comes in agreement with Mohammad et al.,17 but in the Mrsic et al. study from Bosnia, smoking was the commonest risk factor followed by hyperten- sion.24 Generally, the traditional cardiovascular risk factors are clustering with the increasing incidence among Iraqi patients with CAD.25 keywords: cases; grace; heart; higher; infarction; intervention; nstemi; patients; risk; scores; study cache: jcms-1249.pdf plain text: jcms-1249.txt item: #86 of 406 id: jcms-1251 author: Samir Hamed, Ashwan ; Hussein Ghafel, Hawraa title: Evaluation of Elementary School Teachers’ Knowledge about Attention Deficit Hyperactivity Disorder (ADHD) date: 2022-08-26 words: 3074 flesch: 51 summary: Methods: A quantitative research, descriptive correlational design was used in this study, the study conducted on teachers at elementary schools in AL-Diwaniyah City from (20th September 2021 to 30th June, 2022) to evaluate of elementary school teachers knowledge about attention deficit hyperactivity disorder. Conflict of Interest None.  level of rural teachers working in the educational settings. keywords: adhd; attention; deficit; hyperactivity; knowledge; school; study; teachers cache: jcms-1251.pdf plain text: jcms-1251.txt item: #87 of 406 id: jcms-1253 author: Ahmady, Soleiman; Habibi, Amin; Koshgoftar, Zohreh title: Explaining the conceptual considerations of virtual university in medical education: a systematic review date: 2022-10-26 words: 7261 flesch: 48 summary: Abstract Aim: Most of existing literature on the concept of virtual university of medical sciences have been collected in a non-systematic manner. The aim of the present study is to investigate the real complexity and diversity of the concept of virtual university of medical sciences. keywords: articles; components; concept; design; education; framework; health; information; learning; management; medical; models; process; research; sciences; technology; theories; university; virtual cache: jcms-1253.pdf plain text: jcms-1253.txt item: #88 of 406 id: jcms-1254 author: R. Salem, Ashraf ; A.R. Al-Wasiti, Estabraq ; A. Hasan, Fahem title: Effect of pollution represented by Polycyclic Aromatic Hydrocarbons on the levels of p53 and some antioxidant enzymes in Baghdad traffic police date: 2022-08-26 words: 4409 flesch: 55 summary: However, because natural endogenous biomolecules like p53 protein can neutralize PAHs’ carcinogenic effects, their elevation has a beneficial anti-cancer effect by reducing oxidative stress and preventing tumorigenesis. The mechanism of action of p53 protein to avoid the accumulation of genetic errors.15 Six milliliters of blood were collected from each partici- pant, and the blood samples were then centrifuged for 10 min- utes at 3000 rpm to separate the serum before being aspirated, separated into aliquots, and refrigerated at 20oC until they were used for PAH. keywords: air; exposure; hydrocarbons; levels; p53; pahs; police; pollution; polycyclic; protein; traffic cache: jcms-1254.pdf plain text: jcms-1254.txt item: #89 of 406 id: jcms-1255 author: Abdlkhaliq Abass Alkado, Obeda ; Abd Ali Al-Helaly, Luay title: Relationship of Midkine in Myocardial Infarction patients and some biochemical parameters date: 2022-08-26 words: 4935 flesch: 58 summary: Conclusion: The study indicated that the MK increased in patients with myocardial infarction, and it’s increased in males more than female patients, and that may act as a good markers for diagnosis of myocardial infarction disease. The study includes (84) samples: 34 of myocardial infarction patients (19 male and 15 female) and 50 sample of apparently healthy as control group (25 male and 25 female). keywords: alp; ast; crp; disease; group; infarction; mi patients; patients; patients group cache: jcms-1255.pdf plain text: jcms-1255.txt item: #90 of 406 id: jcms-1256 author: R Hussein, Nawfal ; A Naqid, Ibrahim ; A Jamal, Shakir ; Balatay, Amer ; Ibrahim, Nashwan ; H Musa, Dildar ; S M. Saleem, Zana title: A study of relationship between SARS-CoV-2 antibodies levels and host factors among general population in Zakho City, Iraq date: 2022-08-26 words: 2688 flesch: 57 summary: The most common clinical features associated with COVID-19 infection have previously been reported to be fever, dry cough, shortness of breath, loss of appetite and smell.3,11,12 In our study, the most common symp- toms were fever, loss of smell, myalgia, loss of appetite and mild shortness of breath. In conclusion, a significant relationship between sero- positivity rate of COVID-19 infection and age, chronic diseases, presence of symptoms and duration of symptoms were observed in this study. keywords: antibody; iraq; levels; study cache: jcms-1256.pdf plain text: jcms-1256.txt item: #91 of 406 id: jcms-1257 author: H. Salih, Ali ; H. Aubaid, Adnan ; B. Ali , Ghada title: Molecular analysis of Carbapenem resistant genes in Pseudomonas aeruginosa isolated from Baghdad hospitals date: 2022-08-26 words: 3611 flesch: 56 summary: The co-harboring of two carbap- enemase genes in P. aeruginosa isolates has been reported in several studies worldwide.19–21 Unfortunately, carbapenems resistant P. aeruginosa has now emerged and is disseminating worldwide.2-3 Resistance to carbapenems in P. aeruginosa can be mediated by several mechanisms, including MexAB-OprM, AmpC, decreased outer membrane permeability, up-regulation of the efflux pumps, hyper production of a chromosomal AmpC-type cephalosporinases or the production of carbapenemases OprD.4 There is scarce information available on the distribution of MBLs producing P. aeruginosa isolates in Baghdad hospi- tals. keywords: 72–40 °; aeruginosa; carbapenem; genes; isolates; min; pcr; sec; ° c/20; ° c/30 cache: jcms-1257.pdf plain text: jcms-1257.txt item: #92 of 406 id: jcms-1258 author: Rojhanian, Tayebe; Jadidfard, Mohammad Pooyan; Yazdani, Shahram title: Development of dental specialties in Iran: A qualitative study date: 2022-10-26 words: 5231 flesch: 45 summary: The necessity of need assessment, paying attention to the costs of healthcare interventions, defining the range of specialization, and revision of dental specialty programs are among the necessities of development of dental specialties. Dental specialties in countries like Iceland, Poland, Sweden, and United Kingdom have developed in response to public pressure with the aim of protection of public health.2 Advances in dental technology, the need for complex procedures, demographic changes, population aging, improved level of wealth, and changed lifestyle are among the reasons proposed for increased number of dental specialties.1 Financial considerations and economic factors play a funda- mental role in development of specialties in medical field.3 Several studies have assessed the variations, number, reasons for development, and trend of changes of dental specialties, mainly in developed and high-income (HI) countries. keywords: dental; development; education; health; iran; number; programs; specialties; specialty; study; system cache: jcms-1258.pdf plain text: jcms-1258.txt item: #93 of 406 id: jcms-1259 author: Sabry, Ayman ; Ahmed Mohamed, Alaa ; Hassan, Mohamed ; E. M. Abo-Aba, Salah title: A Comparable genetic diversity between chicken ecotypes of different zones using DNA barcoding date: 2022-08-26 words: 4150 flesch: 62 summary: Genetic diversity of indigenous chicken ecotypes in Jordan. Microsatellite-based genetic diversity study in indigenous chicken ecotypes of Karnataka. keywords: barcoding; breeds; chicken; coi; diversity; dna; ecotypes; et al; ism; sites cache: jcms-1259.pdf plain text: jcms-1259.txt item: #94 of 406 id: jcms-1260 author: Emad Bachi, Ghufran ; AL-Fayyadh, Sadeq title: Determination of procedural pain intensity among Critically-Ill patients: Using Behavioral Pain Scale (BPS) date: 2022-08-26 words: 5214 flesch: 52 summary: Shaikh N, Tahseen S, Haq QZ, Al-Ameri G, Ganaw A, Chanda A, Labathkhan MZ, Kazi T. Acute pain management in intensive care patients: facts and figures. And to find out the differences among routine nursing procedures pain severity. keywords: assessment; blood; bps; care; change; icu; level; nursing; nursing procedures; pain; patients; procedures; scale; study cache: jcms-1260.pdf plain text: jcms-1260.txt item: #95 of 406 id: jcms-1261 author: Noor Faleh, Jadeel ; AL-Fayyadh, Sadeq title: Preoperative Incentive Spirometer to Prevent Postoperative Pulmonary Complications following Open Heart Surgeries: A Randomized Single Blinded Multi-Centric Clinical Trial date: 2022-08-26 words: 5361 flesch: 51 summary: Difference in pre-operative PEFR between study and control groups Paired differences Preoperative PEFR (Study group) Preoperative PEFR (Control group) Mean difference Std. Difference in post-operative PEFR between study and control groups Paired differences Effect size Postoperative PEFR (Study group) keywords: complications; control; difference; effect; group; incentive; patients; postoperative; preoperative; pulmonary; spirometer; stay; study; surgery cache: jcms-1261.pdf plain text: jcms-1261.txt item: #96 of 406 id: jcms-1264 author: Abdi, Zana; Hussein, Hishyar MS Garmavy; Rasool, Suzan title: The relation of autonomic biomarkers to the patient's outcome with acute coronary syndrome date: 2023-02-26 words: 6619 flesch: 55 summary: In addition, troponin I, which reflects myocardial cell damage, was highly significantly dif- ferent in ACS patients compared to healthy subjects (0.17 vs. 4.82 ng/ml, respectively) Figure 2. In contrast to the sympa- thetic system, parasympathetic biomarkers such as plasma and RBC cholinesterase activity did not differ substantially between ACS patients and healthy controls (0.83 vs. 0.92 and 1.36 vs. 1.37, respectively). keywords: acs; activity; acute; biomarkers; cardiac; cardiovascular; cholinesterase; chromogranin; heart; journal; patients; plasma; study; syndrome; troponin; value cache: jcms-1264.pdf plain text: jcms-1264.txt item: #97 of 406 id: jcms-1272 author: Abdulsalam Mohammed , Paiman ; Aghali Merza , Muayad title: Charcterization of COVID-19 hospitalized adult patients, vaccinated vs non-vaccinated in Duhok province date: 2022-12-26 words: 5008 flesch: 50 summary: First, to determine prevalence of vaccinated COVID-19 patients among hospitalized patients; second, to determine the epidemiological, clinical, and laboratory characteristics of vaccinated and unvaccinated COVID-19 patients. All PCR confirmed COVID-19 patients from October 1, 2021 until March 31, 2022 were enrolled. keywords: cases; covid-19; days; disease; duhok; health; infection; patients; study; vaccination; vaccine cache: jcms-1272.pdf plain text: jcms-1272.txt item: #98 of 406 id: jcms-1276 author: Mohhamadi Kenari, Hoorieh; Erabi, Sakineh ; Ghobadi, Ali title: The effectiveness of topical Arnebia euchroma Oil in the treatment of Pressure Ulcer: A Case Report: Arnebia euchroma Oil in the treatment of Pressure Ulcer date: 2022-12-26 words: 4128 flesch: 54 summary: Ahmadian et al. also report that chiconin (beta alkanin) is a naphthoquinone pigment obtained from plant roots with antimicrobial effects.42,43 Damiaunakos et al. pre- sented evidence of potent chiconin and alkaline drugs having substantial biologic functions, such as wound remedy and antimicrobial, anti-inflammatory, antioxidant, anti- cancer, and anti-thrombotic effects.44 Akkol et al. docu- mented that therapy by H. choaeh lowered the lesion area and enhanced cell multiplication, migration, vascular for- mation, and re-epithelialization of lesions.45 In a study on the properties of A. euchroma and Malva sylvestris, Pir- balouti et al. found that H. choaeh significantly influenced wound remedy acceleration.46 Karayannopoulou M, Tsioli V, Loukopoulos P, Anagnostou TL, Giannakas N, Savvas I, et al. Evaluation of the effectiveness of an ointment based on Alkannins/Shikonins on second intention wound healing in the dog. keywords: arnebia; case; choaeh; euchroma; healing; journal; medical; medicine; oil; pressure; tissue; ulcers; wound cache: jcms-1276.pdf plain text: jcms-1276.txt item: #99 of 406 id: jcms-128 author: Al-Mozan, Hanaa Daaj Khalaf; Daoud, Yahya Tomaa; Dakhil, Khalid Majeed title: Intestinal parasitic infection effect on some blood components date: 2017-03-26 words: 2897 flesch: 63 summary: As for differential count of white blood cells , the reason of presence significant differences between parasites, S types in per- cent of lymphocytes, neutrophils, monocytes eosinophils except basophils may be due to variation of damage nature that caused by each type of parasites (where worms usually more effect than protozoa on blood criteria) and variation of importance and work each cell of white bloods cells and immunity of patient. Its loss occurs in some pathological conditions including: parasitic infection, malnutrition, blood loss and chronic infection,7 which is expressed anemia.8 Packed cell volume has relation with anemia where the loss of packed cell volume occurs as a result of specific conditions such as anemia.9 White blood cells are considered as one of the basic components of blood and present in peripheral blood,10 to provide defense against germs, parasites and tumors as well as other diseases.11 There are five types of white blood cells vary in size, proportions and functions which are as follow: neutrophils, eosinophils, basophils, lymphocytes and monocytes.9 Materials and Methods Stool Samples Specimens were collected in clean containers to avoid contam- ination with urine, water or any other disinfectants. keywords: blood; cells; effect; histolytica; infection; parasites cache: jcms-128.pdf plain text: jcms-128.txt item: #100 of 406 id: jcms-1280 author: Kazemi, Seyed Morteza ; Keyhani, Sohrab ; Qoreishi, Mohamad ; Shakeri Jousheghan, Saman ; Minaei Noshahr, Reza title: Femoral and Popliteal Artery Pathway in Varus and valgus aligned lower limb; a CT Angiographic study date: 2022-10-26 words: 1575 flesch: 59 summary: Keywords: Femoral artery, popliteal artery, anatomy, varus alignment, valgus alignment, knee ISSN 2413-0516 Introduction Determining the pathway of the femoral and popliteal artery (FA and PA) is an essential step in performing surgical or radi- ological procedures. Olewnik Ł, Łabętowicz P, Podgórski M, Polguj M, Ruzik K, Topol M. Variations in terminal branches of the popliteal artery: cadaveric study. keywords: artery; popliteal; study; valgus; varus cache: jcms-1280.pdf plain text: jcms-1280.txt item: #101 of 406 id: jcms-1281 author: Mohammed, Noor M. title: Docking study, Synthesis, Characterization and Preliminary cytotoxic evaluation of new 1,2,3,4-tetrahydroppyrimidine derivatives date: 2022-10-26 words: 6760 flesch: 67 summary: In Vitro Cytotoxicity Assay 25,26 The in vitro cytotoxicity of compounds V a,s, V b,s, V a,t, and V b,t were evaluated by MTT assay on human breast cancer cells (MCF-7) and human colon adenocarcinoma (HRT-18). Methods: By means of the crystal structure of Histone deacetylases (HDACs-8) with Vorinostat (SAHA) as a co-crystalized ligand was gained from the protein data-bank (PDB code 4QA0) as a result of docking the compounds (V a,s, V b,s, V a,t and V b,t) give good docking scores compared to the standard. keywords: amide; band; c str; cancer; cm–1; compounds; str; v b; vibration; vibration band cache: jcms-1281.pdf plain text: jcms-1281.txt item: #102 of 406 id: jcms-1283 author: Hashim, Zainab Hassan ; Amer, Lubna ; Al-Wasiti, Estabraq A. title: Relation of serum and follicular level of BMP15 with Oocyte quality, embryo grading and pregnancy rate date: 2022-10-26 words: 4627 flesch: 50 summary: 341J Contemp Med Sci | Vol. 8, No. 5, September-October 2022: 337–342 Z.H. Hashim et al. Original Relation of Serum and Follicular Level of BMP15 with Oocyte Quality, Embryo Grading and Pregnancy Rate Relation of Pregnancy Rate to Serum and Follicular Fluid Levels of BMP15 There was no significant difference in mean serum BMP15 between pregnant and non-pregnant women, but the level of follicular fluid BMP15 was higher in pregnant women in com- pression with non-pregnant women in a highly significant manner. The correlations of serum and follicular BMP15 to perifollicular and endometrial blood flow doppler Characteristic Correlation index Perifollicular RI Perifollicular PI Endometrial RI Endometrial PI Serum BMP15 R 0.312 0.309 –0.002 0.202 P 0.207 0.211 0.989 0.217 Follicular fluid BMP15 R –0.068 –0.110 –0.143 0.034 P 0.788 0.782 0.397 0.839 References 1. keywords: bmp15; embryo; fluid; follicular; oocyte; pregnancy; rate; serum; women cache: jcms-1283.pdf plain text: jcms-1283.txt item: #103 of 406 id: jcms-1284 author: Taheri, Sina ; Samadaei, Mahdis ; Pakkhesal, Mina ; Ahmadinia, Amir Reza title: Evaluation of the hemoglobin level in gingival crevice fluid and clinical periodontal parameters in patients with chronic periodontitis date: 2022-10-26 words: 3263 flesch: 49 summary: The methods used to diagnose of periodontal disease should help distinguish between types of periodontal diseases, the degree of destruction of perio- dontal tissue, and the prognosis of periodontal disease.4,5 Today, the main method used in the diagnosis of periodontal diseases, in addition to radiographic findings, is examining clinical parameters such as clinical attachment loss (CAL), periodontal probing pocket depth (PPD), plaque index (PI), gingival index (GI) and BOP.6-8 Gingivitis is checked with bleeding during probing (BOP), which is an important param- eter for comparing and evaluating the results of periodontitis treatment. This study showed that there is a direct relationship between the level of hemoglobin in GCF and periodontal clinical parameters, and in people who had the disease but BOP was negative in them, hemoglobin was detected in GCF, and this indicates that this marker can be used for early diagnosis of periodontal diseases in people who do not have clinical symptoms. keywords: bop; fluid; gcf; gingival; hemoglobin; parameters; periodontal; periodontitis; study cache: jcms-1284.pdf plain text: jcms-1284.txt item: #104 of 406 id: jcms-1285 author: Al-Quraishy, Hiba Aqeel Muslem ; Ali, Hanaa Addai ; Al-Tu’ma, Fadhil Jawad ; Ali, Mousa Mohsin ; Al-Tu’ma, Amir Fadhil title: Association between hormonal Imbalance and Interleulin-10 level with Polycystic Ovarian Syndrome of Iraqi women date: 2022-10-26 words: 3443 flesch: 52 summary: It regulates the differentiation and pro- liferation of immune cells, such as macrophages, T cells, and B cells; reduces monocyte activation; and restricts the release of pro-inflammatory cytokines, such as TNF, IL-1, IL-6, IL-12, and IL-2.9 To keep the ovary functioning properly, the levels of inflammatory markers must be in equilibrium. Th1 cells and macrophages’ expression of pro-inflammatory cytokines is down-regulated by the anti-inflammatory cytokine and suppressor IL-10. keywords: fsh; il-10; level; patients; pcos cache: jcms-1285.pdf plain text: jcms-1285.txt item: #105 of 406 id: jcms-1286 author: Flemban, Arwa F ; Kabrah, Saeed M ; Alfaifi, Suhail S ; Alsubhi, Ahmed S ; Alzahrani, Ayoub S ; Alhazmi, Khalid A ; Alharbi, Samah title: Breast Cancer Knowledge and Screening Practice among Women in Makkah, Saudi Arabia date: 2022-10-26 words: 4606 flesch: 55 summary: We assessed the knowledge of breast cancer risks, the knowledge regarding the BSE and mammogram in Saudi Arabian females using a survey-based study. Among all participants around 54% had poor overall knowledge of breast cancer 65% had poor knowledge regarding breast cancer risk and 93% had poor knowledge regarding clinical examination. keywords: arabia; breast; breast cancer; bse; cancer; cbe; examination; knowledge; practice; risk; saudi cache: jcms-1286.pdf plain text: jcms-1286.txt item: #106 of 406 id: jcms-1288 author: Mahmood, Baraa R. ; Allwsh, Thikra A. title: Assessment of the HER2, PDL1 and oxidative stress levels at the menopausal status of newly diagnosed breast cancer patients date: 2022-10-26 words: 4426 flesch: 59 summary: HER2 level at pre and postmenopausal status for control and patient group. In the same as with our result, Di Gioia et al. demonstrate elevated HER2 levels at postmenopausal status.34 The high level of HER2 at postmenopausal status causes an increased level of both follicle-stimulating hormone (FSH) and Luteinizing hormone (LH) which they are boosted cell dif- ferentiation and proliferation, causing an increase in the risk factor of breast cancer.4,35 The high level of HER2 in postmenopausal breast cancer patients also consider as an indicator of the probability of metastatic.36,37 PD-L1 is an immune checkpoint and it is overexpressed on the surface of the cancer cell to evade anti-tumor immune responses by interacting with it a is a receptor (PD-1) at the surface of the T-cell, and then inhibit T-cell function.38,39 keywords: breast; breast cancer; cancer; cancer patients; control; doi; group; her2; level; oxidative; patients; postmenopausal; pre; serum; status; stress cache: jcms-1288.pdf plain text: jcms-1288.txt item: #107 of 406 id: jcms-1289 author: Al-Tamimi, Saad Majeed title: Biofeedback of Heart Rate Variability in the treatment of chronic diseases: A Systematic Review date: 2022-10-26 words: 17392 flesch: 60 summary: Abstract Background: HRVB (heart rate variability biofeedback) is a non-pharmacological method for chronic diseases evaluation. These heart-brain connec- tions caused by vagal afferents and afferents indicate that vagal nerve stimulation has a role in the pathophysiology of chronic disorders and that vagal-activating therapies may be problematic.14 HRVB (heart rate variability biofeedback) is a non-phar- macological method that improves emotional self-regulation and autonomic cardiac modulation by boosting HRV and recovering cardiac vagal function.15 Once breathing is around 6 breaths per minute, the baro- reflex and the breath synchronise, resulting in a unique HRV signal sequence. keywords: biofeedback; e t; e va; io n; n d; n n; t r; t t; ve n cache: jcms-1289.pdf plain text: jcms-1289.txt item: #108 of 406 id: jcms-1290 author: Alfakeh, Sulhi A. ; Alharbi, Alya S. ; Alhebshi, Mohammed K. ; Attar, Abdullah F. title: Executive function deficits associated with anxiety and depression and their impact on medical students’ academic performance in Saudi Arabia date: 2022-10-26 words: 4815 flesch: 55 summary: Medical students’ perceptions of stress due to academic studies and its interrelationships with other domains of life: A qualitative study. In addition, studies have also stated that first-year students are more anx- ious than final-year students and that their level of anxiety decreases over.11,12 However, the prevalence of anxiety symptoms was high even in patients with no cognitive impairment.13 A thorough literature review revealed that no study in the Kingdom of Saudi Arabia (KSA) so far has aimed to assess the associations among EF deficits, anxiety, and depression among medical students. keywords: academic; anxiety; depression; medical; performance; scores; students; study; university cache: jcms-1290.pdf plain text: jcms-1290.txt item: #109 of 406 id: jcms-1294 author: Seyedfatemi, Naima ; Saber, Saman title: Social factors affecting relapse of severe mental illness: A qualitative analysis of healthcare team's perceptions date: 2022-12-26 words: 5578 flesch: 47 summary: Patients with mental illness in China stated that work-related stress and discontinuation of medication are the main reasons for the relapse of their dis- ease.11 In France, patients who had been ill for more than ten years had a higher risk of disease relapse compared to those who had been ill for less than 5 years.12 In Ethiopia, patients who had been suffering from bipolar disorder for more than 5 years faced a higher risk of disease relapse.7 A study in the Republic of Congo showed that low education level, being female, low self-esteem and living in rural areas were among the predictors of mental illness relapse.13 In Iran, for patients with major depressive disorder, factors such as young age at the onset of disease, living in urban areas, history of mental illness in the family, and history of emotional problems play an important role in their frequent hospitalizations.14 A review study stated that in major depressive disorder, factors such as high level of depression, high level of poor sleep quality, and irritability will increase the severity of disease relapse.15 Literature review indicated that different factors including social factors play a major role in the SMI relapse, and patients in different contexts are at risk of SMI relapse. The results of a study in Uganda showed that stigma increases the risk of disease relapse in patients with SMI.23 In order to deal with cultural misconceptions that lead to the relapse of SMI, it is necessary to implement culture-based interventions to correctly confront negative attitudes and stig- matized beliefs and fight against cultural taboos that govern the phenomenon of SMI relapse in Iran. keywords: community; disease; disease relapse; doi; factors; family; participants; patients; relapse; smi; smi relapse; study; treatment cache: jcms-1294.pdf plain text: jcms-1294.txt item: #110 of 406 id: jcms-1298 author: Al-Murshedi, Hadbaa H. ; Fadhil Jawad, Ammar ; Al-Tu’ma, Fadhil J. ; Hadi, Eman A. ; Al-Tu’ma, Maha Mohammed Kadhim title: Molecular studies of CAPN-10 gene (rs2975760) and its association with Insulin Resistance in Polycystic Ovarian Syndrome of Iraqi women date: 2022-12-26 words: 4810 flesch: 57 summary: Results: The prevalence of IR based on HOMA-IR was (80%) in obese PCOS and (48%) in non-obese PCOS women. The genotype distribution was statistically different between obese PCOS women and controls (OR = 5.25, P = 0.048). keywords: capn-10; gene; insulin; obese; pcos; syndrome; women cache: jcms-1298.pdf plain text: jcms-1298.txt item: #111 of 406 id: jcms-1299 author: Dahham, Zainab M. ; Haddad, Namir I. A. title: Circulating levels of Interferon regulatory Factor-5 correlates with disease activity in Systemic Lupus Erythematosus Iraqi patients date: 2022-12-26 words: 5630 flesch: 55 summary: ESR levels were signif- icantly increase in SLE patients during SLE flare and infec- tions as compared to healthy controls.31-33 Many studies indicated that ESR considered an important factor in assessing SLE disease activity, as ESR elevates when disease activity increase. The analysis of receiver operator curves (ROC) for circulating levels of IRF5 protein in SLE-1 and SLE-2 groups showed a good accuracy to distinguish SLE patients from healthy individuals (AUC = 0.758, sensitivity = 65.5%, and specificity = 69%,), and (AUC = 0.788, sensitivity = 77.3%, and specificity = 72.0%,), respectively. keywords: activity; correlation; disease; erythematosus; group; irf5; irf5 protein; levels; lupus; patients; protein; sle cache: jcms-1299.pdf plain text: jcms-1299.txt item: #112 of 406 id: jcms-1300 author: Mohammed , Shaha Abdallha ; Allwsh , Thikra Ali title: Study interplay between Asprosin with Vitamin D in metabolic syndrome date: 2022-12-26 words: 4199 flesch: 44 summary: The study includes (95) samples of metabolic syndrome patients [49 female, 46 males] who were attending the abdominal consultation unit at the Ibn Sina Teaching Hospital in Mosul, Iraq. The findings revealed a significant increase in the concertation of the asprosin hormone in metabolic syndrome patients compared to the control group. keywords: asprosin; blood; cholesterol; control; hdl; insulin; metabolic; mets; patients; syndrome; vitamin cache: jcms-1300.pdf plain text: jcms-1300.txt item: #113 of 406 id: jcms-1301 author: Albakri, Nahlah ; Amasha, Reda ; Aly, Magda M. title: Ruminant gut microbiota: importance, development, and alternative therapeutics for dysbiosis date: 2023-02-26 words: 8383 flesch: 46 summary: Bevans, D. W., Beauchemin, K. A., Schwartzkopf-Genswein, K. S., McKinnon, J. J., & McAllister, T. A. (2005). Bevans, D. W., Beauchemin, K. A., Schwartzkopf-Genswein, K. S., McKinnon, J. J., & McAllister, T. A. (2005). keywords: animal; dairy; development; feed; gut; host; journal; microbial; microbiota; rumen; ruminant; science cache: jcms-1301.pdf plain text: jcms-1301.txt item: #114 of 406 id: jcms-1302 author: Jastaniah, Samyah D. ; Jamal, Taghreed Yasir ; Amashah, Reda H. ; Aly, Magda M. title: New Strategies for Inhibition of Listeria monocytogenes and Klebsiella pneumoniae Biofilm Formation and Persistence date: 2022-12-26 words: 6400 flesch: 47 summary: This study aimed to find new strategies for the prevention of bacterial biofilms and investigate the effect of some plant extracts on the biofilm formation by certain pathogenic bacterial strains in vitro. Thus, application of new natural approaches for inhibiting bacterial biofilm is important to prevent persistent and recurrent biofilm related infections. keywords: bacterial; biofilm; broth; effect; eps; extracts; formation; growth; inhibition; isolates; monocytogenes; plant; plant extracts; pneumoniae cache: jcms-1302.pdf plain text: jcms-1302.txt item: #115 of 406 id: jcms-1303 author: Kabrah, Saeed M title: An evaluation of blood components inventory management during Hajj and Umrah season at Makkah hospitals: Impact of Hajj and Umrah on Blood inventory date: 2022-12-26 words: 4532 flesch: 62 summary: Data demonstrated that utilization of blood units differs according to year, month, and type of blood unit. This demonstrated that the inventory of blood units fluctuates during the year with an overproduction of Cryo (80%), FFP (67%), PLT (83%) and PRBC (57%) units in Hajj Season. keywords: blood; data; donation; hajj; makkah; production; saudi; study; umrah; units; year cache: jcms-1303.pdf plain text: jcms-1303.txt item: #116 of 406 id: jcms-1304 author: Abdulkhaleq, Nuha Mohammed ; Ghareeb, Mowafaq M. title: Development of Gastro-floating drug delivery system by 3D Printing: Impact of formulation and design on the release profile of Baclofen date: 2022-12-26 words: 5267 flesch: 54 summary: This study aims to first formulate sustained-release tablets of baclofen (optimized to release the drug over 12 hr) by HME to be incorporated into the floating device and study the impact of formulation composition on the release profile, the second aim is to develop floating devices by FDM 3D printing using PLA filament (which is safe, biodegradable, and has been widely used in 3D printing16) and study the effect of the design of the floating device on drug release by varying the surface areas of the drug releasing windows. Method: Firstly, four formulas were produced through the hot-melt extrusion and direct compression of the extrudate to produce 30 mg baclofen tablets, then four gastro-floating devices (A, B, C, and D) were designed with two air pockets to enable the floating of the device and have drug-releasing windows with total surface area 4, 10, 20, and 40 mm2 respectively, for drug release. keywords: baclofen; delivery; device; dissolution; drug; gastro; pharmaceutical; printing; profile; release; system; tablets; time; windows cache: jcms-1304.pdf plain text: jcms-1304.txt item: #117 of 406 id: jcms-1305 author: Alkhammash, Alhanouf M. ; Alshehri, Wafa A. ; Alhozali, Amani M. ; Bahieldin, Ahmed title: Link of gut microbiome with risk of type 2 diabetes mellitus date: 2022-12-26 words: 8123 flesch: 50 summary: Huttenhower, C., Gevers, D., Knight, R., Abubucker, S., Badger, J. H., Chinwalla, A. T., Creasy, H. H., Earl, A. M., Fitzgerald, M. G., Fulton, R. S., Giglio, M. G., Hallsworth-pepin, K., Lobos, E. A., Madupu, R., Magrini, V., Martin, J. C., Mitreva, M., Muzny, D. M., Sodergren, E. J., Versalovic, J., Wollam, A. M., Worley, K. C., Wortman, J. R., Young, S. K., Zeng, Q., Aagaard, K. M., Abolude, O. O., Allen-vercoe, E., Alm, E. J., Alvarado, L., Andersen, G. L., Anderson, S., https://www.idf.org/our-network/regions-members/middle-east-and-north-africa/members/46-saudi-arabia.html https://www.idf.org/our-network/regions-members/middle-east-and-north-africa/members/46-saudi-arabia.html 368 J Contemp Med Sci | Vol. 8, No. 6, November-December 2022: 363–369 Link of Gut Microbiome with Risk of Type 2 Diabetes Mellitus Original A.M. Alkhammash et al. Appelbaum, E., Arachchi, H. M., Armitage, G., Arze, C. A., Ayvaz, T., Baker, C. C., Begg, L., Belachew, T., Bhonagiri, V., Bihan, M., Blaser, M. J., Bloom, T., Bonazzi, V., Paul Brooks, J., Buck, G. A., Buhay, C. J., Busam, D. A., Campbell, J. L., Canon, S. R., Cantarel, B. L., Chain, P. S. G., Chen, I. M. A., Chen, L., Chhibba, S., Chu, K., Ciulla, D. M., Clemente, J. C., Clifton, S. W., Conlan, S., Crabtree, J., Cutting, M. A., Davidovics, N. J., Davis, C. C., Desantis, T. Z., Deal, C., Delehaunty, K. D., Dewhirst, F. E., Deych, E., Ding, Y., Dooling, D. J., Dugan, S. P., Michael Dunne, W., Scott Durkin, A., Edgar, R. C., Erlich, R. L., Farmer, C. N., Farrell, R. M., Faust, K., Feldgarden, M., Felix, V. M., Fisher, S., Fodor, A. A., Forney, L. J., Foster, L., DI Francesco, V., Friedman, J., Friedrich, D. C., Fronick, C. C., Fulton, L. L., Gao, H., Garcia, N., Giannoukos, G., Giblin, C., Giovanni, M. Y., Goldberg, J. M., Goll, J., Gonzalez, A., Griggs, A., et al. 2012. Faith, J. J., Guruge, J. L., Charbonneau, M., Subramanian, S., Seedorf, H., Goodman, A. L., Clemente, J. C., Knight, R., Heath, A. C., Leibel, R. L., Rosenbaum, M. & Gordon, J. I. 2013. keywords: diabetes; gut; gut microbiome; human; microbial; microbiome; type cache: jcms-1305.pdf plain text: jcms-1305.txt item: #118 of 406 id: jcms-1306 author: Hamlacı Başkaya, Yasemin; İlçioğlu, Kevser; Ünsal, Alaattin title: Association of Vertigo and Nausea and Vomiting of Pregnancy date: 2023-02-26 words: 6013 flesch: 62 summary: Nausea and vomiting may cause discomfort in pregnant women in the mildest form but may become a serious threat to the lives of fetus and pregnant woman in the most severe form. Considering the association between level of education and vertigo, there were fewer pregnant women with a history of vertigo among pregnant women with a university degree. keywords: association; dizziness; group; history; nausea; pregnancy; study; symptoms; vertigo; vomiting; women cache: jcms-1306.pdf plain text: jcms-1306.txt item: #119 of 406 id: jcms-1308 author: Mouhi Jasiem, Thamer; Al-Hussaini, Rand Muhammed Abdul-Hussain title: The impact of the ERCC2 Lys751Gln polymorphism on the risk of acute myeloid leukemia in an Iraqi patients date: 2023-02-26 words: 2781 flesch: 59 summary: The Impact of the ERCC2 Lys751Gln Polymorphism on the Risk of Acute Myeloid Leukemia in an Iraqi Patients The occurrence of ERCC2 gene polymorphism was revealed by RFLP-PCR technique. Distribution of ERCC2 gene; Lys751Gln in the study population under Dominant inheritance model Genotypes Cases Controls b2 P OR n = 70 n = 30 Value 95% CI Genotype T/T 29(41.5%) 18(60%) 2.91 0.09 0.47 0.20–1.13 Genotype T/G+G/G 41(58.5%) 12(40%) 2.12 0.89–5.07 Table 4. keywords: allele; aml; ercc2; gene; genotype; leukemia; risk cache: jcms-1308.pdf plain text: jcms-1308.txt item: #120 of 406 id: jcms-131 author: Al-Khattabi, Hadi Abd Zaid; Ali, Ali Azeez; Al-jameel, Hameed Hussein; Al-Ameri, Ali Mansoor title: Elastic band ligation of hemorrhoids using flexible gastroscope date: 2017-03-31 words: 2129 flesch: 57 summary: Objective This study aims at investigating the outcome of rubber band ligation of piles in an outpatient setting. Rubber band ligation of piles was made by Pentax iScan gastroscope. keywords: band; hemorrhoids; ligation; patients; rubber; treatment cache: jcms-131.pdf plain text: jcms-131.txt item: #121 of 406 id: jcms-1313 author: Salajegheh, Shirin; Sharifzadeh Kermani , Mahdieh ; Naeimi Bafghi , Naeimeh ; Naeimi Bafghi , Neda ; Salehi , Jafar ; Nakhaei Zadeh , Reza ; Javid , Mohammad Javad title: Investigation of the frequency and risk factors of pulmonary complications following cardiac surgery in the hospital: risk factors of pulmonary complications following cardiac surgery date: 2023-04-26 words: 4814 flesch: 50 summary: Frequency of pulmonary complications in heart surgery patients according to demographic and clinical characteristics Pulmonary complicationTotal P-valueNo Frequency of pulmonary complications in heart surgery patients based on underlying diseases, type of heart surgery and transfusion of blood and blood products Total Pulmonary complication Frequency Percent keywords: complications; factors; frequency; heart; heart surgery; patients; percent; pulmonary; risk; study; surgery cache: jcms-1313.pdf plain text: jcms-1313.txt item: #122 of 406 id: jcms-1314 author: Eslami, Maryam ; Golshanfard, Majid ; Bajouri, Amir ; Aghdami, Nasser ; Mohammadi, Mahsa ; Shafieian, Saeed ; Memarsadeghi, Omeed ; Seifalian, Alexander title: Comparing COL7A1 gene expression in fibroblast cells of dystrophic epidermolysis bullosa patients with clinical responses to autologous fibroblasts transplantation date: 2023-02-26 words: 4266 flesch: 54 summary: Diagnosis of RDEB patients was established based on the clinical symptoms and NGS test by a dermatologist. 1 Successful autologous fibroblasts transplantation as a treatment for RDEB patients. keywords: bullosa; col7a1; dermatology; epidermolysis; expression; fibroblasts; gene; group; journal; patients; rdeb; response; transplantation; treatment cache: jcms-1314.pdf plain text: jcms-1314.txt item: #123 of 406 id: jcms-1315 author: Fareed Yalda, Karam ; Abdalla Goreal, Amer title: Prevalence of Cytomegalovirus infection among pregnant women with cord blood examination date: 2023-02-26 words: 4916 flesch: 55 summary: *Correspondence to: Amer Abdalla Goreal (E-mail: amer.goreal@uod.ac) Abstract Objectives: This study aimed at determining the prevalence of CMV infection among pregnant women at the end of pregnancy and CMV transmission to their newborns. This study was conducted in the city of Duhok/Iraq, in order to know the prevalence of CMV infection among preg- nant women, where it is based on analysis and comparison of umbilical cord blood serum and blood test of the pregnant mother at the end of pregnancy. keywords: avidity; blood; cmv; congenital; cord; cytomegalovirus; igg; igm; infection; prevalence; primary; samples; study; test; women cache: jcms-1315.pdf plain text: jcms-1315.txt item: #124 of 406 id: jcms-1316 author: Ardestani Zadeh, Arash ; Moonesan, Mohammadreza ; Taheri, Fatemeh ; Arab, Davood ; Mokhtari, Tahmineh title: Comparison of rectal suppository and intramuscular morphine for management of patients with renal colic referred to the emergency department: A randomized double-blinded controlled trial date: 2023-02-26 words: 5373 flesch: 60 summary: According to the literature, it has been proved that rectal route morphine results less analgesia and lower pain scores compared to its IV administration.34,37 It has been shown that about two-thirds of rectal morphine can be absorbed via the gastrointestinal tract and then, it paases through portal vein to be metabolized in the liver. keywords: colic; groups; min; morphine; pain; patients; rectal; renal; study; suppository; treatment cache: jcms-1316.pdf plain text: jcms-1316.txt item: #125 of 406 id: jcms-1317 author: Abdul Latif Jouad, Hadeel ; AL- Shammaree , Shatha Abdul Wadood title: Advanced oxidation protein products levels and Paraoxonase 1(Arylesterase) activity in patients with thyrodisim date: 2023-02-26 words: 4634 flesch: 55 summary: Our study was in contract with a study by Azizi et al.30 who found significant lower PON1 activity in both 68 J Contemp Med Sci | Vol. 9, No. 1, January-February 2023: 63–69 AOPP Levels and PON1 (Arylesterase) Activity in Patients with Thyrodisim Original H.A.L. Jouad et al. that indicates the presence of oxidative stress. Demographic and clinical measurements for all participants were recorded which include: Body mass index (BMI), age, weight, height, lipid profile, vitamin D, thyroid hormones (TSH, T3, and T4, FT3, FT4), AOPP levels, and arylesterase activity. keywords: activity; aopp; aryl; control; correlation; esterase; group; hypothyroidism; levels; patients; pon1; protein cache: jcms-1317.pdf plain text: jcms-1317.txt item: #126 of 406 id: jcms-1318 author: Sabaghzadeh, Amir ; Aslani, Hamidreza ; Shakeri Jousheghan, Saman ; Aslani, MohammadAmin ; Tajik, Katayoon title: Reliability and validity of Knee Injury and Osteoarthritis Outcome Score (KOOS) in Iranian Population date: 2023-02-26 words: 5936 flesch: 49 summary: KOOS questionnaire has been recently shown to assess many fields and domains. KOOS questionnaire has been extensively uti- lized in English-speaking countries for the clinical assessment of the severity of the injury and improvement in the perfor- mance for monitoring the treatment outcomes. keywords: factor; injury; knee; koos; osteoarthritis; outcome; patients; questionnaire; reliability; research; score; validity cache: jcms-1318.pdf plain text: jcms-1318.txt item: #127 of 406 id: jcms-1319 author: A. Alkadhi, Karim title: Chronic psychosocial stress reveals Alzheimer’s disease in a novel at-risk rat model date: 2023-02-26 words: 8046 flesch: 60 summary: Several labs, including mine, have demonstrated that chronic stress or corticosterone administration aggravates the disease in both transgenic and non-transgenic animal models. In addi- tion to its late onset, the variation in susceptibility to and time of onset of the disease suggests that, aside from possible genetic factors, environmental determinants, including chronic stress, may play a critical role in the severity of spo- radic AD.3–6 It is commonly believed that the cognitive deficits in AD result from progressive synaptic dysfunction and irreversible neurodegeneration, which are probably initiated by soluble small oligomeric Aβ peptides, in particular the Aβ1-42 form. keywords: alkadhi; alzheimer; amyloid; area; bdnf; beta; brain; calcineurin; chronic; disease; groups; hippocampus; learning; levels; memory; model; protein; psychosocial; rats; stress; subaβ; synaptic; term cache: jcms-1319.pdf plain text: jcms-1319.txt item: #128 of 406 id: jcms-132 author: Al Alak, Mousa; Al Hakeem, Akram F; Al Mousawi, Ali title: Academic performance of fnal year medical students at kerbala medical college date: 2017-03-26 words: 4811 flesch: 53 summary: The selection of suitable assessment or evaluation depends on its validity (a measure of the extent to which the test actually measure what is intended to measure), reliability (a measure of whether the assess- ment or test is consistent and accurate; examines the extent to which factors such as examiners, questions, occasions affect the marks or scores awarded) and practicability was proved.5,14 Academic performance of medical students in western Australia and in Indonesia was found to be significantly 174 J Contemp Med Sci | Vol. 3, No. 9, Winter 2017: 170–177 Academic performance of final year medical students Research Mousa Al Alak et al. Table 6. 170 J Contemp Med Sci | Vol. 3, No. 9, Winter 2017: 170–177 Research Academic performance of final year medical students at kerbala medical college Mousa Al Alak,a Akram F Al Hakeem,b Ali Al Mousawic aDepartment of Gynecology and Obstetrics, College of Medicine, University of Kerbala, Iraq. keywords: college; deviation; examination; kerbala; mean; medical; osce; scores; std; students; year cache: jcms-132.pdf plain text: jcms-132.txt item: #129 of 406 id: jcms-1321 author: Fadhil Obaid , Ali ; Abdulameer Abdulrasol, Zainab ; Mohammed Jasim Shlash , Ahmed ; Rabah Tuman, Methaq ; Dhaher Hussain, Muamel title: Assessment of missing opportunity of vaccination at primary health care center: A retrospective study date: 2023-02-26 words: 2864 flesch: 50 summary: Parental attitude and beliefs towards child vaccination: identifying vaccine hesitant groups in a family health center, Erbil city, Iraq. Concerning the vaccination status the finding showed that the percentage of missed vaccination opportunities reached 61%, and there was a significant positive correlation between vaccination status and (family residence, parental education level, and fathers’ occupation) with a P value of 0.01. keywords: children; education; family; health; immunization; med; status; study; vaccination cache: jcms-1321.pdf plain text: jcms-1321.txt item: #130 of 406 id: jcms-1322 author: Khalil Ibrahim Al-Yassiri, Israa ; Al-Tu’ma, Fadhil Jawad ; Abbood Mukheef, Maher ; Baqir Jawad, Khosay ; Abdul-Kareem Mutar, Baraa title: Association between Nesfatin-1 Levels and C-Peptide in Sera of Obese / Non-Obese Type 2 Diabetic Women date: 2023-02-26 words: 5762 flesch: 56 summary: 58 J Contemp Med Sci | Vol. 9, No. 1, January-February 2023: 56–62 Association between Nesfatin-1 Levels and C-Peptide in Sera of Obese/Non-Obese Type 2 Diabetic Women Original I.K.I. Al-Yassiri et al. Table 1 illustrated that effect of type 2 diabetes non-obese women (N = 25) on some biochemical parameters studied in patients and apparently health control groups (N = 25). Li, Wang, Chen, et al. (2010). keywords: control; levels; nesfatin-1; non; obese; patients; peptide; type cache: jcms-1322.pdf plain text: jcms-1322.txt item: #131 of 406 id: jcms-1324 author: Almufty, Hind; Hayhat, Lara ; Abdal, Wasan G. Abdal; Hussein, Darya S. Hussein; Merza, Muayad A. Merza title: Magnitude of dispensing unprescribed antibiotics in community pharmacies in Duhok province; Kurdistan region of Iraq date: 2023-04-26 words: 3602 flesch: 47 summary: Continuing medical education through training pharmacists on dispensing antibiotics by adhering to the regulations of antibiotic stewardship is crucial. Descriptive statistics were car- ried out for the demographic variables, the most prevalent types of dispensed antibiotics, and to obtain the incidence of dispensing each type of antibiotic individually. keywords: antibiotics; community; dispensing; duhok; iraq; journal; pharmacies; pharmacy; resistance; study; uabs cache: jcms-1324.pdf plain text: jcms-1324.txt item: #132 of 406 id: jcms-1327 author: Hazhar M. Balaky; Akam Jasim Mustafa; Parween Abdulsamad Ismail; Araz Muhammad Yousif title: Physiological effects of Calprotectin and B Cell activating factor in COVID-19 Patients date: 2023-04-26 words: 4505 flesch: 49 summary: Therefore, this case-control study investigates circulating BAFF and Calprotectin levels, function, diagnostic value, and prognostic relevance in COVID-19 infected patients. Materials and Methods The 77 participants in the present study included 52 con- firmed COVID-19 patients between June 2021 to November 2022 aged (23 to 35 years) and 25 healthy volunteers as the control group. Calprotectin levels between the sera of the studied groups. keywords: baff; calprotectin; cell; covid-19; et al; factor; levels; patients; serum; study cache: jcms-1327.pdf plain text: jcms-1327.txt item: #133 of 406 id: jcms-1329 author: Al-Fayyadh, Ziyad Hameed ; Turki, Ahmed Mohammed ; Al-Mathkhury, Harith title: Glyceryl Trinitrate, a Vasodilating Drug Acts as an Antibiofilm Agent in Serratia marcescens date: 2023-06-26 words: 2899 flesch: 57 summary: Regardless of the reservoir, S. marcescens has a rather wide distribution among patients with a variety of clin- ical cases, and hospital staff is thought to be the main source of S. marcescens infection spread by direct contact.18 Patients who have severe clinical problems, long hospital stays, and repeated medical interventions are more likely to contract an infection since these factors require more frequent and intense direct contact with al.4 the development of S. marcescens biofilms is a genetically controlled process. keywords: biofilm; fima; fimc; glyceryl; gtn; isolates; marcescens; serratia; trinitrate cache: jcms-1329.pdf plain text: jcms-1329.txt item: #134 of 406 id: jcms-133 author: Al-Tu’ma, Fadhil Jawad; Dheyauldeen, Maha Hamood; Al-Saegh, Ryiadh Mohi title: Measurement of urinary kidney injury molecule-1 as a predictive biomarker of contrast-induced acute kidney injury date: 2017-03-26 words: 3538 flesch: 60 summary: But urinary KIM-1 level may be useful as a biomarker for tubular damage following intravascular administration of contrast media, 24 h. Keywords kidney injury molecule-1, contrast-induced acute kidney injury, coronary angiography, percutaneous coronary intervention Introduction The administration of radiographic contrast remains an important cause of acute kidney injury in hospital, which con- tributes to mortality during hospitalization.1 One of the most common complications of percutaneous coronary interven- tion (PCI) and other type such as diagnostic procedures of the heart is contrast-induced acute kidney injury (CI-AKI).2 CI-AKI is defined as an increase in serum creatinine of 0.5 mg/dL (44 μmol/L), or a relative 25% increase from the baseline value within 24–48 h following intravascular admin- istration of contrast media.3 There are some studies used urinary KIM-1 level for early diagnosis CIN as Akdeniz et al. found that at 6th and 48th hour of contrast exposure found that KIM-1 levels increased in the patients with CIN (P < 0.01; median levels, 0.27 and 0.70 mg/dl).17 Another report by Malyszko et al. found no data in the literature on such time course changes of KIM-1in contrast nephropathy as in our study.18 Another work carried by Kooiman et al. urinary KIM-1 excretion was unaffected by CE-CT both in patients with and without CI-AKI, suggesting that CI-AKI was not accompanied by tubular injury.19 Urinary KIM-1 is a more recently described type 1 cell membrane glycoprotein that is expressed in humans when the injured renal proximal tubule of the kidney, KIM-1 not detectable in the normal kidney but expresses in proximal tubular cells after ischemic and nephrotoxic injury.20 This may increase levels urinary after 24 h without any change before exposure of contrast media. keywords: cin; contrast; injury; kidney; patients; urinary cache: jcms-133.pdf plain text: jcms-133.txt item: #135 of 406 id: jcms-1330 author: Al-Zebeeby, Aoula; Abbas, Ali title: Statins in combination with Ibrutinib bypasses resistance to Ibrutinib in mantle cell lymphoma : Overcoming chemoresistance to Ibrutinib date: 2023-06-26 words: 2933 flesch: 56 summary: examined the anticancer activity of statins in many cancers, such as non-metastatic rectal cancer, head and neck cancer, advanced liver carcinoma, pediatric tumors, colon cancer and acute myeloid leukemia.31 –33 However, in the present study a group of statins was used to bypass resistance to Ibrutinib in mantle cell lymphoma cell line (Figures 2B and 3). Chemotherapy often creates a stressful environment for cancer cells, which in turn respond to such unfavourable conditions by activation of several pathways that enable the cells to escape therapy.18,19 One example of this is the rewiring of cancer metabolism. keywords: apoptosis; cancer; cell; doi; ibrutinib; lymphoma; mantle; resistance; statins; therapy cache: jcms-1330.pdf plain text: jcms-1330.txt item: #136 of 406 id: jcms-1333 author: Rasho, Fatima Jaafar ; Aghali Merza, Muayad title: The impact of blood group phenotypes on COVID-19 severity and mortality in Duhok province: a prospective cross-sectional study date: 2023-04-26 words: 4037 flesch: 60 summary: A patients had a higher risk of severity, while blood group O patients had a lower risk.28 Another study in India found that blood group O patients had decreased mortality, while blood group B patients had increased mortality.29 Prevalence of ABO blood groups and Rh susceptibility with COVID-19 Blood group Total no. keywords: blood; blood group; covid-19; disease; group; patients; severity; study cache: jcms-1333.pdf plain text: jcms-1333.txt item: #137 of 406 id: jcms-1335 author: Yaseen Mohammed Hasan, Zainab ; Alsamarrae, Khulood W. ; Rushdi, Ahmed title: Molecular Immuno-response Effects for Iraqi Lycium barbarm Carotenes upon Normal Human lymphocytes culture date: 2023-04-26 words: 4031 flesch: 52 summary: 101–105 Original Molecular Immuno-response Effects for Iraqi Lycium barbarm Carotenes upon Abstract Objectives: The study aimed to investigate the effects of Iraqi Lycium barbarm carotene on normal human blood lymphocytes at molecular level. keywords: barbarm; carotene; control; expression; gel; hours; lycium; lymphocytes; rna; total cache: jcms-1335.pdf plain text: jcms-1335.txt item: #138 of 406 id: jcms-1336 author: Ali Hadi, Zainab ; Al-Tu’ma, Fadhil Jawad ; Hameid Odda, Atheer ; Almuhafdah, Hawra title: Serum Antioxidant Status in Sickle Cell Disease Patients: Implications for Oxidative Stress and Disease Severity date: 2023-04-26 words: 3849 flesch: 57 summary: While sickle cell disease patients in this study had significantly higher serum MDA levels than the controls, the erythrocyte CAT level in HbSS in the steady state was significantly lower, and another outcome of the study was that SCD patients had significantly lower mean erythrocyte GSH, GPx levels com- pared with controls group. Materials and Methods Participants with sickle cell disease (SCD) and age-matched healthy controls were included in this study. keywords: antioxidant; cell; disease; levels; patients; scd; sickle; stress; study cache: jcms-1336.pdf plain text: jcms-1336.txt item: #139 of 406 id: jcms-1337 author: Alkhowaiter , H.S. ; Alyahyawy, Othman Yahya ; Aljeddawi, Abdullah Abdulhafeez ; Abo-Aba , Salah El-Deen Mohamed title: Isolation, identification and comparative analysis of 16S rRNA of Multidrug-resistant Bacteria Clinically isolated from Al Qassim Region Hospitals in Saudi Arabia date: 2023-04-26 words: 3106 flesch: 48 summary: The GC content of bacterial sequences varies greatly between single species. Abstract Objective: This study concluded that the antibiotic resistance and gene transfer across bacterial strains in the hospital setting are two possible explanations for the observed sequence changes in the target microorganisms. keywords: 16s; analysis; bacteria; coli; escherichia; gene; isolates; sequence; sites; strains cache: jcms-1337.pdf plain text: jcms-1337.txt item: #140 of 406 id: jcms-1338 author: Tahseen Ibrahim, Hind ; A. Mussa, Ali ; Jabbar Fahad Al-Mathkhury, Harith title: A potential role of extracellular DNA in biofilm and ciprofloxacin resistance date: 2023-04-26 words: 6622 flesch: 52 summary: S. aureus biofilms, once established, are recalcitrant to antimicrobial treatment and the host response, and therefore are the etiological agent of many recurrent infections that have a demonstrated biofilm component.26 Chronic infections are associated with the biofilm mode of growth where S. aureus can attach and persist on host tissues, such as bone and heart valves, to cause osteomyelitis and endocarditis respectively, or on implanted materials, such as prosthetic joints,27 catheters,28 Table 3. Archer, N. K., Mazaitis, M. J., Costerton, J. W., Leid, J. G., Powers, M. E., Shirtliff, M. E. Staphylococcus aureus biofilms: properties, regulation, and roles in human disease. keywords: aureus; biofilm; ciprofloxacin; coli; edna; gene; isolates; transition; transversion; ® c; ® g; ® t cache: jcms-1338.pdf plain text: jcms-1338.txt item: #141 of 406 id: jcms-1339 author: M Mohammad, Ameen ; Mohammed, Malavan ; T Rasul, Mohammed ; Salih Sgery, Azri title: Silent Coronary Artery Disease in Patients with Rheumatoid Arthritis in Kurdistan, Iraq: A cross-sectional study date: 2023-04-26 words: 3690 flesch: 56 summary: Those patients with the established RA have an average of two or more comorbid- ities.2-4 The RA cases are known to have a higher prevalence of cardiovascular morbidity and mortality compared to the gen- eral population.5,6 Cardiovascular diseases, particularly CAD, constitute the leading cause of premature mortality in patients with RA.7,8 The underlying mechanism of CAD tends to be complex and multifactorial, with the additive association of non-traditional risk factors to atherosclerosis.9,10 Rheumatoid factor, anti-cy- clic citrullinated peptide antibody, long duration of RA, and thrombogenic factors are among the non-traditional risk fac- tors contributing to morbidity and mortality of CAD in RA9-12 Given the fact that RA patients are less likely to experi- ence symptoms of CAD and somewhat likely to develop unrecognized events and unforeseen death, the clinical pres- entation of CAD in such patients is different, apparently ear- RA patients may experience cardiovascular events in the presence of minimal atherosclerosis. keywords: artery; arthritis; cad; cardiovascular; coronary; disease; patients; rheumatoid; risk; study cache: jcms-1339.pdf plain text: jcms-1339.txt item: #142 of 406 id: jcms-134 author: Hassan, Heba F.; Khashman, Basim M.; Abdul Qader, Omer A.; Izzat, Alaa W. title: Assessment of Cox2 and CMV in patients with chronic HCV infection date: 2017-03-26 words: 3619 flesch: 55 summary: Conclusion This study concludes that COX-2 and CMV participates in the pathogenesis of chronic HCV infection. The results of this study showed that chronic HCV infection in the male was more predominance among patients, where 22 males (73.4%) and 8 females (26.6 %) out of total cases. keywords: chronic; cmv; cox-2; expression; hcv; hepatitis; human; infection; liver; patients cache: jcms-134.pdf plain text: jcms-134.txt item: #143 of 406 id: jcms-1340 author: Memarian, Azadeh; Ghasempouri, Seyed Khosro ; Kouchek , Mehran ; Sobouti , Behnam ; Aghakhani , Kamran title: Demographic and Clinical Profiles Including Comorbidities in Hospitalized Patients Under 18 Years of Age with COVID-19 date: 2023-06-26 words: 7009 flesch: 57 summary: Hoang A, Chorath K, Moreira A, Evans M, Burmeister-Morton F, Burmeister F, et al. COVID-19 in 7780 pediatric patients: A systematic review. Götzinger F, Santiago-García B, Noguera-Julián A, Lanaspa M, Lancella L, Carducci FIC, et al. COVID-19 in children and adolescents in Europe: a multinational, multicentre cohort study. keywords: age; analysis; characteristics; children; clinical; coronavirus; covid-19; disease; infection; journal; mortality; patients; study; symptoms; year cache: jcms-1340.pdf plain text: jcms-1340.txt item: #144 of 406 id: jcms-1346 author: Hameedi, Isam Ali ; Shadmehr, Azadeh ; Alsaadawi , Tahir title: Effectiveness of radial Extracorporeal Shock Wave Therapy in Reduces muscle spasms in Stroke Patients; A Systematic Review and Meta-Analysis date: 2023-06-26 words: 3369 flesch: 58 summary: spasticity treatments are focused on improving these sec- ondary changes. Considering the various advantages of rESWT, including the ease of use, being safe and non-invasive, and its relatively low cost com- pared to other spasticity treatment methods, including botu- linum toxin injection, it seems that this method can be a suitable alternative to reduce spasticity in Stroke patients. keywords: effectiveness; muscle; patients; reswt; spasticity; stroke; studies; study; therapy; treatment; trial cache: jcms-1346.pdf plain text: jcms-1346.txt item: #145 of 406 id: jcms-1347 author: Balaky, Hazhar M. ; Mustafa, Akam Jasim ; Ismail, Parween Abdulsamad ; Yousif, Araz Muhammad title: Physiological Effects of Calprotectin and B Cell Activating Factor in COVID-19 Patients date: 2023-06-26 words: 4503 flesch: 50 summary: All of these receptors are present in B and T lymphocytes as well as antigen-presenting https://orcid.org/0000-0002-4579-2617 mailto:hazharbalaky86@yahoo.com 153J Contemp Med Sci | Vol. 9, No. 3, May-June 2023: 152–157 Hazhar M. Balaky et al. Original Physiological Effects of Calprotectin and B Cell Activating Factor in COVID-19 Patients cells, proving that BAFF action goes beyond B cell biology.14 Therefore, this case-control study investigates circulating BAFF and Calprotectin levels, function, diagnostic value, and prognostic relevance in COVID-19 infected patients. The value expressed in Mean ± SE Fig. 1 Calprotectin levels between the sera of the studied groups. keywords: baff; calprotectin; cell; covid-19; et al; factor; levels; patients; serum; study cache: jcms-1347.pdf plain text: jcms-1347.txt item: #146 of 406 id: jcms-1348 author: Al-Jumaili, Wed Thamer Salman ; Al-Musawi, Bassam Musa Sadik title: Molecular detection of mononucleotide biomarkers of microsatellite instability in sporadic colorectal carcinoma patients with clinicopathological correlation date: 2023-06-26 words: 4108 flesch: 62 summary: Types, frequencies, and patterns of the detected mononucleotide markers among 5 MSI-H CRC patients Mononucleotide marker P1 P2 P3 P4 P5 Gene frequency BAT25 + + 2/5(40%) BAT26 + + 2/5(40%) NR-21 + + + 3/5(60%) NR-24 + + + + 4/5(80%) MONO-27 + + 2/5(40%) Total 3(60%) 3(60%) 3(60%) 2(40%) 2(40%) 162 J Contemp Med Sci | Vol. 9, No. 3, May-June 2023: 158–162 Detection of MSI Biomarkers in Sporadic Colorectal Cancer Original W. T. S. Al-Jumaili et al. keywords: cancer; crc; instability; microsatellite; msi; patients; study; tumor cache: jcms-1348.pdf plain text: jcms-1348.txt item: #147 of 406 id: jcms-1349 author: Mohammed Hasan , Doaa Alaa ; Sahib , Ahmed Salih ; Al-Rokan, Ahmed Abbas Hasan ; Mohsin, Karrar Kadhim title: Study of the Genetic Polymorphisms of ABCB1 3435G>A in Postmenopausal Women Breast Cancer on Paclitaxel Chemotherapy date: 2023-06-26 words: 3686 flesch: 54 summary: Serum concentrations of Estradiol and Ca 15.3 were measured in breast cancer patients who had been taking Paclitaxel. Two-tailed Fisher’s exact probability (P) tests were used to compare alleles geno- typing percentage frequencies in breast cancer patients and controls, various statistical methods were used to analyze data, chi-square (χ2) test for contingency tables to find the statistical difference between cases and controls about the risk factors. keywords: abcb1; breast; breast cancer; cancer; chemotherapy; paclitaxel; patients; polymorphism; rs1045642; study; women cache: jcms-1349.pdf plain text: jcms-1349.txt item: #148 of 406 id: jcms-1350 author: Abbas, Raaid Fadhl ; Sahib, Ahmed Salih ; Mahmood, Hasanain Shakir ; Mohsin, Karar Kadhim ; Majeed, Ali Amal Aldeen title: Genetic polymorphisms of DPYD in patients with breast cancer on capecitabine therapy date: 2023-06-26 words: 4886 flesch: 55 summary: The study examined the relationship between (G > A) (rs3918290) and (rs55886062, T > G) DPYD gene polymorphisms, their haplotypes, and capecitabine serum concentrations in postmenopausal Iraqi women with breast cancer breast cancer in postmenopausal women during the capecitabine chemotherapy. This study, conducted between July and October 2022 at the oncology center at Imam al-Hussain medical city in Kerbala, Iraq, plasma levels of Capacetabine and 5FU were measured in breast cancer patients who had been taking capecitabine for at least three months. keywords: allele; breast; breast cancer; cancer; capecitabine; dpyd; frequency; genotype; patients; rs3918290; study; women cache: jcms-1350.pdf plain text: jcms-1350.txt item: #149 of 406 id: jcms-1351 author: Al-Azawi , Ahmed ; Hneua, Riyadh Abd-Alrasool ; Hameed, Rana Majeed ; Hassan, Duha Maithem title: The Effect of Adding Pertuzumab to Adjuvant Trastuzumab in Early HER2-Positive Breast Cancer date: 2023-06-26 words: 3553 flesch: 46 summary: Conflict of Interest None.  study larger patient group, longer study period, longer and pertuzumab course.” Eligible patients received adjuvnat Anth- racycline based cytotoxic 3 cycles fallowed by Taxotere + Per- tuzumab + Trastuzumab 3 cycles (110 patients) in compare with arm B patients group (110 patients) who received Taxatere 3 cycles + Trastuzumab 17 cycle in 1-year adjuvant treatment. keywords: adjuvant; breast; cancer; disease; her2; patients; pertuzumab; trastuzumab cache: jcms-1351.pdf plain text: jcms-1351.txt item: #150 of 406 id: jcms-1352 author: Mutar, Baraa Abdul-Kareem ; Allwsh, Thikra Ali ; Yassin, Ammar Gany ; Al-Tu’ma, Fadhil Jawad ; Taghi, Hassanien S. title: Characteristics of Vitamin D3 Receptor Genotypes in T2DM of Iraqi Obese Women date: 2023-06-26 words: 4487 flesch: 58 summary: The target gene (VDR gene) was amplified using allele-specific PCR with a specific primer indicated below which were [purchased from Bioneer, Korea]. Association of vitamin D and vitamin D receptor gene polymorphisms with chronic inflammation, insulin resistance and metabolic syndrome components in type 2 diabetic Egyptian patients. keywords: diabetes; gene; insulin; receptor; type; vdr; vitamin cache: jcms-1352.pdf plain text: jcms-1352.txt item: #151 of 406 id: jcms-1355 author: Alabedi , Haydar H. ; Al Musawi , Mustafa S. ; Mohammed Ali , Nabaa title: Dosimetric effects and impacts caused by a carbon fiber table and its accessories in a linear accelerator date: 2023-06-26 words: 3803 flesch: 55 summary: Our study aimed to investigate the impact of these factors on the attenua- tion of radiation in carbon fiber couches and patient supports, intending to inform more accurate and effective treatment planning strategies for external-beam radiotherapy:3,15 As such, it is recom- mended that the attenuation differences resulting from using carbon fiber couches and supports be accounted for in the MU calculation during treatment planning. keywords: attenuation; beam; carbon; couch; dose; fiber; planning; radiation; treatment cache: jcms-1355.pdf plain text: jcms-1355.txt item: #152 of 406 id: jcms-136 author: Almzaiel, Anwar J; Al-Ameri, Ali Mansoor Jasim; Tariq, Rafad title: Role of Apo E and superoxide dismutase in patients with obstructive lung diseases date: 2017-03-26 words: 2942 flesch: 54 summary: The level of Apo E was non significantly increased in serum of patient, this suggests that protein level of Apo E does not change but may be Apo E gene expression is altered. 189J Contemp Med Sci | Vol. 3, No. 9, Winter 2017: 189–192 Research Role of Apo E and superoxide dismutase in patients with obstructive lung diseases Anwar J Almzaiel,a Ali Mansoor Jasim Al-Ameri,b Rafad Tariqc aDepartment of biochemistry, College of Medicine, University of Alqadisiyah, Iraq. keywords: apo; asthma; control; copd; disease; dismutase; lung; patients; sod; superoxide cache: jcms-136.pdf plain text: jcms-136.txt item: #153 of 406 id: jcms-137 author: AL-Seedi, Abdul-Sattar A. K.; AL-khafaji, Jawad K.; AL-Mosawi, Hadi M. A. title: Comparison and evaluation of diagnostic techniques of mycobacterium tuberculosis in Iraq date: 2017-03-26 words: 3326 flesch: 58 summary: Conclusion The comparison between advance technique (Gene X-pert and real-time PCR) and classical technique (AFB) for the diagnosis of MTB, shows that genetic technique is the best with high sensitivity and specificity. Open the Software shortcut icon of the Gene X-pert in the Windows® desktop by double-click on it. keywords: afb; gene; mycobacterium; pcr; pert; sensitivity; time; tuberculosis cache: jcms-137.pdf plain text: jcms-137.txt item: #154 of 406 id: jcms-14 author: Bashi, Abbas Matrood title: Nanotube synthesis from reaction of 4-chloro phenoxy acetate with zinc layered hydroxide date: 2015-06-26 words: 3004 flesch: 66 summary: So, it is necessary to find some effective methods to induce the conversion of the Zn complex into ZnO particles. Thermal decomposition is a common method to get ZnO particles. keywords: chem; cm–1; complex; doi; fig; oxide; particles; synthesis; zinc; zno cache: jcms-14.pdf plain text: jcms-14.txt item: #155 of 406 id: jcms-141 author: Taher, Abbas title: Editorial – March 2017 date: 2017-04-03 words: 263 flesch: 34 summary: For supporting the researcher & research activity, we have decided to waive the fees of the first paper publish in this Journal or the new Iraqi Journal of Public Health for the Iraqi post graduate students. The Nab’a Al-Hayat foundation’s activity was achieved two successful International conference for medical education and basic scientific researches in Iraq last year, and supporting students, in addition to that we designed mobile applications for vaccination to Iraqi children. keywords: journal cache: jcms-141.pdf plain text: jcms-141.txt item: #156 of 406 id: jcms-142 author: Aziz, Batool Luay; Al-Mayali, Ahmed Hussein; Nada, Shaymaa Zahraw; Mankhi, Fatemah Abdullah title: Impact of adiponectin and oxidized low-density lipoprotein in acute coronary syndrome date: 2017-04-03 words: 3029 flesch: 59 summary: The ACS patients showed a significantly higher (p < 0.001) result in total cholesterol and significantly lower (p < 0.001) level in HDL-C. Conclusion Serum adiponectin negatively correlated with Ox-LDL level in patient group ACS and the healthy control group. Whereas no significant differences in the serum triglyceride, VLDL-C and LDL-C levels in comparison between ACS patient group and healthy control group (p > 0.05). keywords: acs; adiponectin; control; density; group; ldl; mean; patients cache: jcms-142.pdf plain text: jcms-142.txt item: #157 of 406 id: jcms-143 author: Hasan, Abdul Mahdi A. title: Depression and Suicide into Adolescence (12–18) years in Rehabilitation Health Center, in AL-Hilla City date: 2017-04-03 words: 2027 flesch: 64 summary: Results Depression was higher in this study than other studies, higher prevalence of depression in adolescences patients with age between 17 and 18 years (46%). 1. Depression was high in study than other studies, higher prevalence of depression in adolescent patients with age between 17 and 18 years (46%). keywords: depression; health; patients; study; suicide cache: jcms-143.pdf plain text: jcms-143.txt item: #158 of 406 id: jcms-15 author: Kareem, Alaa A. title: Study of antibacterial activity in the local Iraqi propolis date: 2015-06-26 words: 2279 flesch: 52 summary: Keywords antibacterial activity, propolis, inhibition zone, extract Study of antibacterial activity in the local Iraqi propolis Alaa A Kareem, Noor Y Abdzaid, Raghad M Salman, Murtadha K Mohamed, Ali J Dekel & Rawaa S Abdul-Muhsen Introduction Propolis is a natural product derived from plant resins col- lected by honeybees; it is used by bees as glue, general pur- pose sealer and as draught-extruder for beehives. 6 J Cont Med Sci | Vol. 1, No. 2, Spring 2015:6–8 Research Objective This study includes the investigation of antibacterial activity of the local propolis against four types of bacteria isolated from patients. keywords: activity; antibacterial; bacteria; doi; extract; propolis cache: jcms-15.pdf plain text: jcms-15.txt item: #159 of 406 id: jcms-152 author: Al-Saedy, Ahmed Abed Kadhem; Turki, Kismet M.; Nadaa, Shaymaa Z. title: Effect of serum cystatin C in early diabetic nephropathy in type 2 Iraqi diabetic patients date: 2017-06-26 words: 4356 flesch: 52 summary: Objective This study aimed to find the effect of serum Cystatin C in early diabetic nephropathy. The levels of these markers are increased in person with higher body mass index, inflammation, and diabetes.14 Many studies show the Cystatin C as it believes as a marker of tubular and glomerular dysfunction for early diabetic nephropathy, and the urine level in Cystatin C is high in micro albuminuria in diabetic patients compared with normal albuminuria.15 This study aimed to test the effect of serum Cystatin C in early diabetic nephropathy in type 2 diabetes mellitus of dia- betic Iraqi patients. keywords: albuminuria; cystatin; diabetes; diabetic; gfr; micro; nephropathy; patients; serum; type cache: jcms-152.pdf plain text: jcms-152.txt item: #160 of 406 id: jcms-159 author: Pakravan, Amirhossein; Nafarzadeh, Shima title: Report of a case of surgical ciliated cyst in the left maxillary sinus date: 2017-06-26 words: 1645 flesch: 54 summary: 234 J Contemp Med Sci | Vol. 3, No. 10, Spring 2017: 234–236 Research Report of a case of surgical ciliated cyst in the left maxillary sinus Amirhossein Pakravan,a Shima Nafarzadehb* aOral and Maxillofacial Surgery department, Mazandaran University of Medical Sciences, Sari, Iran. Surgical ciliated cyst happens as a delayed complication in the maxillary sinus, and is more frequent in Asia in comparison with Western countries. keywords: ciliated; cyst; maxillary; oral; sinus; surgical cache: jcms-159.pdf plain text: jcms-159.txt item: #161 of 406 id: jcms-16 author: Al-Tu’ma, Fadhil Jawad title: Alcohol dehydrogenase genotype (ADH2 and ADH3) in alcoholism of Iraqi people date: 2015-06-26 words: 3355 flesch: 56 summary: ADH2 and ADH3 genotypes may have a protective role in the risk for alcoholism in Iraqi alcoholic population. Distribution of ADH3 genotypes for both alcoholics and control group Gene No. ADH3.1 ADH3.2 keywords: adh2; adh3; alcohol; alcoholism; alleles; dehydrogenase; doi; ethanol; liver; non; people; pmid cache: jcms-16.pdf plain text: jcms-16.txt item: #162 of 406 id: jcms-167 author: Allawi, Jaffar title: Allocating Resources in Health Care Services date: 2017-06-26 words: 1414 flesch: 49 summary: 3. High calibre and well-trained statisticians should analyse the data to be informative to give idea of i) number of pop- ulation, ii) male–female ratios, iii) age quartiles, iv) disease prevalence, v) population of urban rural or both and finally vi) what type of medical care services can be provided. If we take the definition of Health by the World Health Organisation in its broader sense in its 1948 constitution as ‘a state of complete physical, mental, and social well-being and not merely the absence of disease or infirmity’, and the Defini- tion of Health Resources Allocation, which states that all materials, personnel both teaching and care providers, medical facilities, funds, and anything else that can be used for providing health care and services, then we would understand the importance of resource allocation.1 Background of Health Services in Iraq Since the opening of the first medical school, The Royal College of Medicine “Al-Albeit University of Iraq” in the 20s of last cen- tury by the British, occupiers of Iraq, and followed many years later by Mosul Medical School as well as the School of Nursing. keywords: care; health; iraq; medical; services cache: jcms-167.pdf plain text: jcms-167.txt item: #163 of 406 id: jcms-168 author: Gholaminejhad, Morteza; Arabzadeh, Somayeh; Akbari, Mohammad; Mohamadi, Yousef; Hassanzadeh, Gholamreza title: Anti-oxidative and neuroprotective effects of flaxseed on experimental unilateral spinal cord injury in rat date: 2017-06-26 words: 3841 flesch: 57 summary: Furthermore, the mean levels of SOD, GPx and CAT in the treatment group was higher than the SCI group (P < 0.001), while, the mean MDA content in the treatment group was significantly less than the SCI group (P < 0.001). SCI group: with SCI without any treatment. 5) SCI + Flaxseed (Treatment) group: with SCI and feed by 10% flaxseed for four weeks. keywords: cat; cord; flaxseed; group; injury; level; oxidative; rats; sci; sci group; spinal; stress; treatment cache: jcms-168.pdf plain text: jcms-168.txt item: #164 of 406 id: jcms-169 author: Al-Malkey, Maysaa Kadhim; Ismeeal, Munira Ch.; Abo Al-Hur, Fahema Jabbar; Mohammed, Sinaa W.; Nayyef, Hanan J. title: Antimicrobial effect of probiotic Lactobacillus spp. on Pseudomonas aeruginosa date: 2017-06-26 words: 4364 flesch: 48 summary: Antimicrobial susceptibility tests included 16 antibiotics; P. aeruginosa isolates showed multi-drug resistance for antibiotics. Results Only 31 out of 48 isolates were identified as P. aeruginosa; 9 (45%) from wound and 22 (79%) from burn swabs. keywords: acidophilus; aeruginosa; agar; bacteriocin; effect; isolates; lactobacillus; method; protease; rhamnosus cache: jcms-169.pdf plain text: jcms-169.txt item: #165 of 406 id: jcms-17 author: Mohammed, Suhad Hadi title: Determination of baseline Widal titre in healthy individuals in Karbala city, South of Iraq date: 2015-06-26 words: 2614 flesch: 69 summary: Keywords Salmonella enterica, Widal test, anti-O,H agglutinins Determination of baseline Widal titre in healthy individuals in Karbala city, South of Iraq Suhad Hadi Mohammed, Mohammed Neama Hmood, Hawraa Jasim Mohammed, Hussien Saleh Nasir, Wejdan Jabar Sultan & Hassan Mohammed Introduction Iraq is considered as one of the many endemic countries with typhoid fever.1 The definitive diagnosis of typhoid fever requires the isolation of Salmonella enterica serotype typhi from the blood, feces, urine or other body fluids. Knowledge of endemic titre and proper interpretation of Widal test are necessary for accurate diagnosis of enteric fever to avoid misuse of antibiotics, thereby preventing the occurrence of drug resistance. keywords: agglutinins; test; titre; widal cache: jcms-17.pdf plain text: jcms-17.txt item: #166 of 406 id: jcms-170 author: Al-Tu’ma, Fadhil Jawad; Mohammed, Zahraa Mohsen; Al-Sarraf, Haidar Hussein title: Role of vitamin D3 level and Apo-B/Apo-A1 ratio in patients with unstable angina in Kerbala province, Iraq date: 2017-06-26 words: 4348 flesch: 60 summary: The risk of cardiovascular events was 1.62 times higher in those with vitamin D3 levels < 15 ng/ml versus the individ- uals with vitamin D3 ≥ 15 ng/mL (95% confidence interval 1.11 to 2.36, P = 0.01) and 1.80 (95% confidence interval 1.05 to 3.08, P = 0.01) for levels < 10 ng/ml.20 Several mechanisms proposed to explain the relation between vitamin D3 deficiency and CVD is that chronic vitamin D3 deficiency causes secondary hyperparathyroidism, acting through pathogenic pathways associated with PTH excess: increased pancreatic cell dysfunction and insulin resistance, predisposing to the metabolic syndrome and diabetes; increasing blood pressure (by activation of the renin angiotensin system), and leading to left ventricular hyper- trophy (with subsequent apoptosis and fibrosis); and stimula- tion of systemic and vascular inflammation, augmenting atherogenesis.20,21 Other studies suggest that parathyroid hormone has a proinflammatory effect, stimulating vascular smooth muscle cells to release cytokines.22 Known risk factors for CVD, including smoking, obesity, advanced age and inactivity (reduced sun exposure), are associated with lower vitamin D3, which make the dissection of the causal role of Fig. They found that a 70-year old individual makes four times less vitamin D3 from the sun than a 20 year old personal.16 In this study, it was noticed that there a significant inverse asso- ciation between vitamin D3 and BMI in the control group, increase of BMI leading to decrease vitamin D3, it’s in line with other research.24 People who are obese, a (BMI ≥ 30), are associated with lower serum vitamin D3 levels compared with non-obese individ- uals; people who are obese may need larger than usual intakes of vitamin D3 to achieve vitamin D3 levels comparable to those of normal weight. keywords: angina; apo; apo a1; apo b; control; disease; ratio; risk; study; vitamin; vitamin d3 cache: jcms-170.pdf plain text: jcms-170.txt item: #167 of 406 id: jcms-171 author: AL-Attraqchi, Azhar AF; Hassan, Jabbar Salman; Dawood, Haider N; Hadab, Marwa A title: Molecular and conventional methods for detection of Candida species isolated from a sample of immunocompromised Iraqi patients with pulmonary symptoms date: 2017-06-26 words: 3757 flesch: 53 summary: The correlations between Candida species infections and gender are shown in Table 2. Out of 100 patients suffering from pulmonary diseases enrolled in this study, they were categorized according to their underlying diseases as follows; 34 patients with tuberculosis, 26 patients with diabetes mellitus, 14 patients with acute lymphoblastic leukemia, 12 patients with lung cancer, 10 patients with lymphoma, 8 patients with acute myelogenic leukemia, 5 patients with asthma, 3 patients with heart failure, 3 patients with renal failure, 2 patients with liver cancer, 2 patients with ovarian cancer, 2 patients with prostate cancer, 1 patient with chronic bronchitis, 1 patient with chronic mye- logenic leukemia and only 1 patient with Rheumatoid arthritis, Fig. In the present study, a relatively high percentage of Candida species infection was found among patients with hematological malignancies, solid tumor, asthma, diabetes mellitus and from patients with tuberculosis. keywords: albicans; candida; culture; gene; germ; patients; pcr; pulmonary; samples; species; tube cache: jcms-171.pdf plain text: jcms-171.txt item: #168 of 406 id: jcms-219 author: Karimi Behnagh, Arman; Rezaei, Negar; Jahannia, Mohadeseh; Noorimotlagh, Zeynab; Kabir, Ali title: New modalities of treatment for hepatocellular carcinoma date: 2017-09-26 words: 14849 flesch: 54 summary: 244 J Contemp Med Sci | Vol. 3, No. 11, Summer 2017: 239–252 Hepatocellular treatment Review Ali Kabir et al. Ruanjianhugan Oral Ruanjianhugan (RJH) tablets which were made up of ten medicinal materials are kind of Chinese herbal medicine used in a 22-year followed up clinical trial study. Retrospective analysis of patients with HCC showed that RFA + CIK + TACE had more 246 J Contemp Med Sci | Vol. 3, No. 11, Summer 2017: 239–252 Hepatocellular treatment Review Ali Kabir et al. Id en ti fic at io n Sc re en in g El ig ib ili ty In cl u d ed Records excluded (n = 1665) Full-text articles excluded (n = 387) Records after duplicates removed (n = 3788) keywords: ablation; analysis; cancer; carcinoma; chemoembolization; chemotherapy; combination; efficacy; et al; group; hcc; hcc patients; hepatic; hepatocellular; hepatocellular treatment; high; liver; med; median; months; oncol; patients; phase; radiation; radiofrequency; radiotherapy; rate; resection; results; review; rfa; sorafenib; studies; study; survival; tace; therapies; therapy; transarterial; treatment; trial; tumour cache: jcms-219.pdf plain text: jcms-219.txt item: #169 of 406 id: jcms-220 author: Khoshnevisan, Mohammad Hossein; Nokhostin, Mohammad Reza; Namvar, Behrooz; Sajjadi, Seyed Hadi; Pakkhesal, Mina title: Methodological heterogeneity in dental fluorosis investigations: a critical review date: 2017-09-26 words: 6829 flesch: 45 summary: 259J Contemp Med Sci | Vol. 3, No. 11, Summer 2017: 253–259 Review Methodological heterogeneity in dental fluorosis investigations appropriate use of fluoride for its caries prevention benefits as well as preventing moderate/severe fluorosis.45 One review study in identifying the risk factors for dental fluorosis has reported that, the reasons for increase in the prev- alence of dental fluorosis as reported by different investigations are due to employing various study designs, using different sample populations, many exposed to multiple sources of fluo- ride, and using different indices to measure fluorosis. Therefore, 39 remaining articles were critically analyzed in order to identify the potential sources of heterogeneity in dental fluorosis studies. keywords: caries; children; dental; enamel; fluoride; fluorosis; health; index; oral; prevalence; review; risk; sources; studies; teeth; tooth; water cache: jcms-220.pdf plain text: jcms-220.txt item: #170 of 406 id: jcms-221 author: Khoshnevisan, Mohammad Hossein; Albujeer, Ammar N. H.; Taher, Abbas A. Y.; Almahafdha, Alya title: Dental education in Iraq: issues, challenges and future date: 2017-09-26 words: 3153 flesch: 46 summary: This recognizes the importance of dental education reevaluation starting from curriculum structure, content, learning and assessment methods as well as administration and governance of dental education. It seems that global standardization of dental education is inevitable for further improvement of oral health in Iraq. keywords: college; dental; education; faculties; health; iraq; units; university cache: jcms-221.pdf plain text: jcms-221.txt item: #171 of 406 id: jcms-222 author: Hafidh, Rand R. title: A comprehensive anticancer molecular study for genistein the promising anticancer drug date: 2017-09-15 words: 4699 flesch: 55 summary: Moreover, diet with genistein; the bioactive molecule (“nutra- ceutical”), has been linked to reduce the rate of cancer metas- tasis in a number of population-based studies.3,5 The ability of genistein to stop metastasis and prompt apoptosis in cancer cells has been proved by several studies. PTGS2 is a key step in the production of prostaglandin E2 (PGE2) in cancer cells, which plays important roles in mod- ulating motility, proliferation and resistance to apoptosis.25 This down-regulation was found in ADME, signal transduction, cardiovascular disease and inflammation families. keywords: anticancer; apoptosis; cancer; cells; families; family; genes; genistein; hela; mechanism; pcr; protein; regulation; smartchip; study; time cache: jcms-222.pdf plain text: jcms-222.txt item: #172 of 406 id: jcms-223 author: Poorhassan, Mahnaz; Mokhtari, Tahmineh; Navid, Shadan; Rezaei, Maryam; Sheikhazadi, Ardeshir; Mojaverrostami, Sina; Hassanzadeh, Gholamreza title: Stature estimation from forearm length: an anthropological study in Iranian medical students date: 2017-09-26 words: 2393 flesch: 65 summary: Conclusion According to the results, forearm length was a moderate predictor for stature estimation of medical students in Iranian population. (2012) find the correlation between forearm length and stature (r = 0.580) and showed that this factor is a poor predictor for stature estimation in comparison with other factors such as upper limb length (r = 0.635), arm length (r = 0.602), hand length (r = 0.695). keywords: estimation; forearm; forensic; length; stature; subjects cache: jcms-223.pdf plain text: jcms-223.txt item: #173 of 406 id: jcms-224 author: Hadi, Najah R.; Al-Amran, Fadhil G.; Naeem, Alaa A.; Abd alsaheb, Ali F.; Alturfy, Mohammed A.; Fakher, Waleed K.; Majeed, Yaser Q.; Alharis, Nada R.; Al-Aubaidy, Hayder A. title: Attenuation of acute systemic inflammatory response after valve surgery date: 2017-09-26 words: 2781 flesch: 53 summary: lium.5,6 There are evidences supporting that CPB can induce the activation of most of the body’s major host defensive pro- cesses, include the activation of various complements, coagula- tion factors, kinins, fibrinolysis, leukocytes, platelets and inflammatory cytokines.7 This study aims to evaluate the possible protective effects of montelukast as a selective cystienyl leukot- riene-1 receptor antagonist in the myocardial ischemic reperfu- sion injury induced by heart valve replacement surgery. Objective This study highlights the protective effects of montelukast on myocardial ischemic reperfusion injury induced by cardiopulmonary bypass during valve replacement surgery. keywords: control; fig; group; montelukast; ratio; replacement; study; surgery; valve cache: jcms-224.pdf plain text: jcms-224.txt item: #174 of 406 id: jcms-225 author: Sajjadian, Maryam; Ragerdi Kashani, Iraj; Pasbakhsh, Parichehr; Hassani, Mahmoud; Omidi, Ameneh; Takzare, Nasrin; Clarner, Tim; Beyer, Cordian; Zendedel, Adib title: Protective effects of cannabidiol on cuprizone-induced demyelination in C57BL/6 mice date: 2017-09-26 words: 5020 flesch: 47 summary: The chosen CBD dosage closely resembled that used in another study to treat CPZ model of MS in mice.22 The 4 groups were as follows: control group that was fed normal diet, cuprizone group which was given only CPZ, vehicle-treated cuprizone group (CPZ+V) and cannabidiol-treated cuprizone group (CPZ+C). Cuprizone treatment with or Fig. keywords: anti; cannabidiol; cbd; control; cpz; cuprizone; demyelination; effects; fig; group; microglia; oxidative; sclerosis; stress cache: jcms-225.pdf plain text: jcms-225.txt item: #175 of 406 id: jcms-226 author: Alsaadawi, Tahir Hussein title: Fatal complication of diffuse idiopathic skeletal hyperostosis (DISH): report of a case date: 2017-09-15 words: 1086 flesch: 54 summary: Diffuse idiopathic skeletal hyperostosis: a review. Diffuse idiopathic skeletal hyperostosis associated with dysphonia and dysphagia: a case report. keywords: dish; dysphagia; fig; hyperostosis; spine cache: jcms-226.pdf plain text: jcms-226.txt item: #176 of 406 id: jcms-23 author: Almzaiel, Anwar Jasib Thaaban title: Oxidative stress and inflammation in ischemic heart disease: role of trace elements, oxidants and antioxidants date: 2015-08-27 words: 4500 flesch: 55 summary: However, H 2 O 2 and cytokines (TNF-α and IL-6) levels demonstrated a significant increase in IHD patients (P < 0.01). IHD patients in this study showed a significant decrease in serum Cu (Table 2), which is consistent with the findings observed by other investigators.14,15 Also lipid profile was significantly different from control lipid profile (Table 1). keywords: cholesterol; control; disease; doi; heart; ihd; inflammation; levels; oxidative; patients; pmid; ros; serum cache: jcms-23.pdf plain text: jcms-23.txt item: #177 of 406 id: jcms-26 author: Al-Daamy, Alaa Abdul-Hussein; Abd-Al Ameer, Haider; Zuher, Hasan title: Antifungal activity of propolis against dermatophytes and Candida albicans isolated from human mouth date: 2015-09-26 words: 4316 flesch: 54 summary: Antifungal activity of propolis extract against dermatophytes Dermatophytes Concentration of propolis extract (mg/ml) Antifungal activity against C. albi- cans: In the current study, we observed that local propolis has antifungal activity against C. albicans (1, 2, 3, 4 and 5). keywords: activity; albicans; concentration; dermatophytes; doi; extract; inhibition; propolis; study cache: jcms-26.pdf plain text: jcms-26.txt item: #178 of 406 id: jcms-266 author: Kermansaravi, Mohammad; Ebrahimian, Mohammad; Delbari, Delaram; Khamoushi, Simin; Kabir, Ali title: Role of bariatric surgery in treatment of non-alcoholic fatty liver disease date: 2017-12-26 words: 9251 flesch: 54 summary: Nassif AT, Nagano TA, Okayama S, Nassif LS, Branco Filho A, Sampaio Neto J. Performance of the bard scoring system in bariatric surgery patients with nonalcoholic fatty liver disease. A recent study on obese adolescents who underwent laparoscopic sleeve gastrectomy (SG) found complete improvement of NASH in all patients and reversed hepatic fibrosis stage 2 in 90%.41 The Role of Obstructive Sleep Apnea (OSA) in NAFLD and Its Improvement Following Bariatric Surgery In a study by cottam et al., patients with fatty liver disease and comorbid conditions underwent a two stage approach; laparo- scopic SG as the first stage and laparoscopic RYGB as the second one. keywords: bariatric; bmi; bypass; et al; fatty; fibrosis; gastric; hepatic; improvement; inflammation; liver; liver disease; loss; metabolic; nafld; nash; nonalcoholic; obes; obesity; patients; prevalence; rygb; steatohepatitis; steatosis; study; surgery; syndrome; treatment; weight; weight loss cache: jcms-266.pdf plain text: jcms-266.txt item: #179 of 406 id: jcms-267 author: Abdel-Hamid, Nabil M.; Salama, Afrah F.; El-Sheekh, Mostafa; Sarhan, Naglaa; Gabr, Asmaa M. title: Oxidative stress predominates apoptosis during experimental hepatocellular carcinoma date: 2017-11-23 words: 4243 flesch: 50 summary: Despite the fact that many strategies for diagnosing liver cancer are possible, many factors, including apoptosis, arise to interfere with cell cycle control. One approach to control liver cancer, is stud- ying the different factors underline the progression of the dis- ease. keywords: activity; apoptosis; cancer; carcinoma; control; dena; group; hcc; hepatocellular; liver; protein; rats; stress; tissue; total cache: jcms-267.pdf plain text: jcms-267.txt item: #180 of 406 id: jcms-268 author: Naif, Hassan M title: Association of gene polymorphism and serum levels of IL-12p40 with the susceptibility to non-Hodgkin's lymphoma in Iraq date: 2017-12-26 words: 4569 flesch: 61 summary: On the contrary, the serum IL-12p40 levels were significantly higher in con- trols than those in osteosarcoma patients with genotype CC and AC/CC were associated with the risk of osteosarcoma.29 Furthermore, 1188A variant was shown to be correlated with reduced levels of IL-12p40 subunit of IL-12, while 1188C variant associated with increase this subunit of the cytokine,30,31 which is similar to the finding of the present study. Hence, SNPs in IL-12p40 gene was examined to assess its effect on the susceptibility to NHLs. keywords: 1188a; allele; association; cancer; gene; il-12p40; levels; nhl; patients; polymorphism; risk; serum; study cache: jcms-268.pdf plain text: jcms-268.txt item: #181 of 406 id: jcms-27 author: Kadhim, Sara K; Al-Janabi, Jawad K; Al-Hamadani, Adnan H title: In vitro, determination of optimal conditions of growth and proteolytic activity of clinical isolates of Trichophyton rubrum date: 2015-09-26 words: 7796 flesch: 67 summary: Proteolytic Activity of T. rubrum Isolates Results of present study showed that T. rubrum isolates have the ability to produce exocellular protease which was indicated by proteolytic activity against casein when added as substrate to the culture filtrates of T. rubrum. The proteolytic activity against casein as substrate showed that T. rubrum isolates have an ability to produce exocellular protease ranged from 10.5–80.1U/ml according to the source of each isolates. keywords: activity; day; growth; incubation; isolates; lsd(0.05; m e; production; protease; t. rubrum; temperature cache: jcms-27.pdf plain text: jcms-27.txt item: #182 of 406 id: jcms-28 author: Shammam, Kammela Hadi; Al-Tu’ma, Fadhil Jawad; El-Yassin, Hedef Dafer title: Myokines in alcoholic myopathy date: 2015-09-26 words: 2473 flesch: 59 summary: by changes in the membrane permea- bility, due to lipid peroxidation which occurred from reaction of acetaldehyde and phospholipids of muscle cells wall.16 IL-15 mRNA levels were up-regulated in human skeletal muscle following strength training, suggesting that IL-15 may accumulate within the muscle as a consequence of regular training or physical activity as happened to alcoholics.17 Oxidative stress produced from alcohol consumption is associated with numerous deleterious consequences for the cell (e.g. lipid peroxidation or even cell apoptosis or necrosis) and leads to different enzyme leakage to outside the cells, causing an increase in the level of these enzymes in the blood. Discussion The high value of IL-15 levels may be due to muscle contraction and violence associated with convulsion and cramps happened to the alcoholic patients, resulted from many alteration in elec- trolyte, calcium and sodium ions, caused Table 1. keywords: alcoholic; cells; doi; il-15; liver; muscle; tnf cache: jcms-28.pdf plain text: jcms-28.txt item: #183 of 406 id: jcms-287 author: Farhan, Ekhlas. M.; Chechan, Rukaibaa A.; Al-Kinani, Lina Q. title: Investigation of role magnetized water used in supplementary feeding for honeybees to modulate the genotoxic side effects induced by cyclophosphamide in mice bone marrow cells date: 2017-12-26 words: 5309 flesch: 56 summary: Sidr honey has strong antioxidant properties, and has wide medic- inal applications and uses.11 Due to the absence of adequate natural food to provide winter food supplies, beekeepers use supplemental feeding of bees, mainly by sugar syrup, often- times, general water in supplementary feeding is used for dis- solve the sugar.12 This present study throws light for the first time about used magnetized water instead of general water as an supplementary feeding. The present study, therefore, recommends further studies that show the relationship between used magnetized water on supplementary feeding and the stimulation of these antiox- idants in the body and its ability to reduce the toxic effects of cancer drugs. keywords: cells; control; effects; feeding; group; honey; mice; treatment; water cache: jcms-287.pdf plain text: jcms-287.txt item: #184 of 406 id: jcms-288 author: Alizamir, Tahereh; Akbari, Mohammad; Mokhtari, Tahmineh; khaksarian, Mojtaba; Hassanzadeh, Gholamreza title: Associated functional motor recovery induced by Intracerebroventricular (ICV) microinjection of Wharton’s jelly mesenchymal stem cells following brain ischemia/reperfusion injury in rat: Decreased dark neurons and Bax gene expression in the cerebral cortex date: 2017-12-26 words: 5105 flesch: 61 summary: They can differentiate into variety of cell types of the body.21 Within the last years, the importance of stem cells application in cell therapy has begun to be determined.22,23 Also, some docu- ments has indicated that stem cells do their therapeutic actions by secretion of some molecules, such as growth factors.24 WJ-MSCs could be effective factors in targeting ischemic stroke.25,26 As a therapeutic agent, stem cells or their derivatives within can transplant into the adult brain for treatment of brain diseases.21 By developing in regenerative medicine field, it seems that application of stem cells in the treatment of ischemic diseases, is a good effective approach.38 Stem cells release growth factors, cytokines and chemokines into their surroundings and cause cell regeneration.39 Different sources of stem cells have been tested for treatment of stroke. keywords: bax; brain; cells; dark; expression; gene; group; icv; injection; ischemia; mcao; mscs; neurons; rat; stem; stroke cache: jcms-288.pdf plain text: jcms-288.txt item: #185 of 406 id: jcms-289 author: Sargeran, katayoun; Mohebbi, Simin Zahra; Chinipardaz, Zahra; Gurani, Yaser title: Senior dental students' training on oral health care for geriatric patients: an interventional study date: 2017-12-26 words: 4630 flesch: 56 summary: Dental student attitudes towards the elderly and training in geriatric dentistry. subject.16 Another study emphasized the necessity of geri- atric dentistry training courses at dental schools to address the needs of the vast elderly population in India.17 Also, findings of a recent investigation in Iran demonstrated that most of the dental students were unwilling to treat the elders and that they did not receive any specific training on geriatric dentistry.14 Therefore, it is important to provide training courses on geriatric oral health care for dental students in Iran. keywords: attitude; care; dental; geriatric; group; health; intervention; knowledge; oral; patients; students cache: jcms-289.pdf plain text: jcms-289.txt item: #186 of 406 id: jcms-29 author: Alshoka, Monem Makki; Al-Hamdany, Kadhim Jawad title: Conditioned risk factors in patients with coronary heart disease date: 2015-09-26 words: 2674 flesch: 61 summary: Relative importance of borderline & elevated level of CAD risk factors. Methods In 85 patients with ischemic heart disease (IHD) we study the presence of risk factors including plasma fibrinogen, serum ferritin, serum iron and serum uric acid. keywords: cad; coronary; disease; doi; factors; ferritin; fibrinogen; patients; risk; serum; study cache: jcms-29.pdf plain text: jcms-29.txt item: #187 of 406 id: jcms-290 author: AL- Shammaree, Shatha Abdul Wadood title: Plasma visfatin levels and insulin sensitivity or resistance relationship in type 2 diabetes date: 2017-12-26 words: 3640 flesch: 58 summary: Visfatin levels were measured using enzyme-linked immune sorbent assay. No significant difference was found in visfatin level between diabetic patients with IR < 2.5 and control group, while, visfatin level in diabetic patients with IR > 2.5 was significantly higher in comparison to that of the group with IR < 2.5 and control group. keywords: 2.5; diabetes; group; insulin; levels; patients; plasma; sensitivity; visfatin cache: jcms-290.pdf plain text: jcms-290.txt item: #188 of 406 id: jcms-30 author: Abdullah, Jasim A; Abdulkalek, Hanen; Haider, Sura; Aamer, Aliaa title: Study of the relationship between calcium ion and thyroid hormones, liver enzymes in some patients of hypocalcaemia and hypercalcaemia date: 2015-09-26 words: 2692 flesch: 59 summary: 27–30 Research Objective This study focuses on the relationship between calcium ion concentration in human body and thyroid hormones with liver enzymes to determine the effect of some physiological and biochemical parameter of liver [glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), Bilirubin] and thyroid stimulating hormone (TSH; T3, T4), on the levels of calcium ion in the blood. This study has been investigated to find the effect of thyroid hormones (T3, T4, TSH) and liver enzymes (GOT, GPT, Bilirubin) on calcium ion concentration. keywords: bilirubin; calcium; concentration; hormones; ion; liver; thyroid; tsh cache: jcms-30.pdf plain text: jcms-30.txt item: #189 of 406 id: jcms-31 author: Rahrotaban, Sedigheh; Aminishaki, Pouyan; Derakhshan, Samira; Mehrabi, Sara title: Leiomyosarcoma of the maxilla: a rare challenging case date: 2015-09-26 words: 2029 flesch: 58 summary: It usually arises from smooth muscle cells of blood vessel wall in this area. Rahrotaban et al. cytoplasm of smooth muscle cells. keywords: case; cells; doi; fig; leiomyosarcoma; lms; maxilla; pmid cache: jcms-31.pdf plain text: jcms-31.txt item: #190 of 406 id: jcms-310 author: Al-Tameemi, Haider Najim; Hassan, Haider Abdul Kadum title: The Anatomical relationship of Optic Nerve Canal to the Posterior Paranasal Sinuses On Computerized Tomography in Iraqi Patients date: 2018-07-14 words: 3332 flesch: 60 summary: Types of optic nerve canals according to Delano’s classification The most frequent type of optic nerve canal according to Delano’s classification (Figs. 1–4) was type I (77.5%), followed by type II (15%), type IV (4%) and least type III (3.5%) with almost approximate right to left prevalence (Table 1). 153–157 Original Anatomical relationship of optic nerve canal to the posterior paranasal sinuses on computerized tomography in Iraqi patients Haider Najim Al-Tameemia and Haider Abdul Kadum Hassanb aDepartment of Radiology, College of Medicine, University of Kufa, Najaf, Iraq. keywords: canal; delano; nerve; optic; sinuses; sphenoid; type cache: jcms-310.pdf plain text: jcms-310.txt item: #191 of 406 id: jcms-323 author: Khazaei, Mozafar; Nematollahi-Mahani, Seyed Noureddin; Mokhtari, Tahmineh; Sheikhbahaei, Fatemeh title: Review on Teucrium polium biological activities and medical characteristics against different pathologic situations date: 2018-03-26 words: 5269 flesch: 54 summary: The metha- nolic extract was more effective than aqueous extract, due to the better solubility of the active chemical components in methanol.34 It has been reported (2012) that terpenoids and antioxidants compounds derived from petroleum ether frac- tion of T. polium accelerate cytotoxic effects against U87.38 Antimicrobial Effects of T. polium Teucrium polium aqueous extract has anti-bacterial proper- ties, but anti-fungal effect has not been confirmed.39 The results demonstrated that T. polium extract significantly has antimicrobial activity in vitro, especially on the strains of gram-positive bacteria.40 Oil extracted from the T. polium with a minimum concentration of 3–5 μl/ml, has the inhibitory effect on Bacillus cereus bacteria, Enterococcus faecalis and Escherichia coli.41 However, 28 days after stopping the drug, kidney damage, emerged including degeneration, degra- dation and vacuolization compared to the control group.53 Effects of T. polium on Hepatic Disorders In recent years, extensive studies have been done to evaluate the effect of T. polium extract on the liver. keywords: cancer; cell; effects; extract; liver; med; plant; polium; rat; sci; t. polium; teucrium; teucrium polium cache: jcms-323.pdf plain text: jcms-323.txt item: #192 of 406 id: jcms-324 author: Gholizadeh, Narges; Najafi, Shamsolmoulouk; Zadeh, Mina Khayam; Afzali, Sajad; Sheykhbahaei, Nafiseh title: Trend in laryngeal cancer, mortality and survival rate in Iran date: 2018-03-26 words: 4345 flesch: 57 summary: Materials and Methods In this retrospective cross-sectional study, for data collection, we used documents related to laryngeal cancer patients from 2009 to 2012 in Cancer Department of the Ministry of Health of the Islamic Republic of Iran. Association of studied factors with survival rate among laryngeal cancer patients (n = 136) Factor P-value* 95% Confidence interval Age P > 0.001* keywords: cancer; delay; factors; oral; patients; rate; study; survival; survival rate; treatment cache: jcms-324.pdf plain text: jcms-324.txt item: #193 of 406 id: jcms-325 author: Khami, M. R.; Bonabi, M.; Mohebbi, S. Z. title: Knowledge and attitude of health-network physicians toward pediatric oral health in Tehran in 2016 date: 2018-03-26 words: 3178 flesch: 56 summary: For this strategy, training physicians in pediatric oral health is of great importance.7 Nevertheless, previous studies have shown the lack of oral health content in medical school programs and residency cur- ricula in many countries.8,9 Moreover, physicians have reported to have insufficient information on oral health care.3,4,8–14 Therefore, the aim of our study is to investigate knowledge and attitude of pediatric oral health care among public health networks’ physicians in non-affluent areas of Tehran, as well as their self-perceived need to gain oral health information. Necessity and tendency to gain oral health information had a considerable difference among respondents (74% vs. 13%) which was similar to Rabiei et al.15 study in the field of necessity that reported majority of physicians were aware of their lack of information on oral health and reported being willing to receive more education. keywords: attitude; care; health; information; knowledge; oral; physicians; tehran cache: jcms-325.pdf plain text: jcms-325.txt item: #194 of 406 id: jcms-326 author: Keshavarz, Elham; Tavakkol, Elham; Momeni Moghaddam, Amin; Jalali, Mohammad; Molaeipoor, Leila; Kabir, Ali title: Investigating the relationship between fetus heart rate in the first trimester screening with fetus sex date: 2018-03-26 words: 4094 flesch: 65 summary: We aimed to assess the relationship between FHR in the first trimester screening with fetus sex. Methods The adjusted regression results showed that fetus sex was not significantly associated with FHR in terms of similar age and mother’s gravid and parity. keywords: age; fetal; fetus; fhr; gender; heart; pregnancy; rate; sex; study; trimester cache: jcms-326.pdf plain text: jcms-326.txt item: #195 of 406 id: jcms-327 author: Mohammed, Ibrahim; Mokhtari, Tahmineh; Ijaz, Sahar; Omotosho D, Akanji; Abubakar Ngaski, Abdullahi; Milanifard, Maryam; Hassanzadeh, Gholamreza title: Anthropometric study of nasal index in Hausa ethnic population of northwestern Nigeria date: 2018-03-26 words: 3814 flesch: 62 summary: Methods The nasal width and height were measured from 200 participants of Hausa ethnic group of northwestern Nigeria, nasal index (NI) was calculated and analyzed statistically. 26 J Contemp Med Sci | Vol. 4, No. 1, Winter 2018: 26–29 Research Anthropometric study of nasal index in Hausa ethnic population of northwestern Nigeria Ibrahim Mohammed,a,b Tahmineh Mokhtari,c,d Sahar Ijaz,a,b Akanji Omotosho D,a,b Abdullahi Abubakar Ngaski,e Maryam Milanifard,a and Gholamreza Hassanzadeha aDepartment of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. keywords: ethnic; groups; hausa; height; index; mesorrhine; nasal; nigeria; nose; sci; study cache: jcms-327.pdf plain text: jcms-327.txt item: #196 of 406 id: jcms-328 author: Abdulkareem, Elham Hazeim; Aftan, Kamal Turki; Alnaqeeb, Ahmed Jassam title: Gold standard approach for removing sialoliths from the submandibular gland date: 2018-03-26 words: 2770 flesch: 58 summary: Keywords chronic sialadenitis/sialadenosis, CT scan, excision of gland, sialoliths of the submandibular salivary gland Introduction Sialadenosis is one of the predominantly occurring conditions of the salivary glands.1–3 Carbonate and phosphate forms of calcium, remains of desquamated epithelia of salivary gland, mucopolysaccharides and glycoprotein like organic compo- nents constitute a sialolith, though bacterial activity is uniden- tified in the existing literature.4–6 Based on the majority of reported cases, it is estimated that out of 1,000 adults, 12 are afflicted with sialolithiasis annually and majority of them con- stitute male population.7 The frequency of rapidly setting (acute) and persistent (chronic) infections of sialolithiasis affecting submandibular salivary gland is higher by 90% while parotid gland affliction is 6%, remaining 2% affects sublingual gland but minor saliva secretion glands seldom develop calculi. Blitzer A. Inflammatory and obstructive disorders of salivary glands. keywords: calculi; duct; gland; report; salivary; sialolithiasis; sialoliths; submandibular; surg cache: jcms-328.pdf plain text: jcms-328.txt item: #197 of 406 id: jcms-331 author: Ahmadi, Yalda; Tonkaboni, Arghavan; Sargaran, Katayoun; Mohammadnia, Abdolreza; Eghbali-Zarch, Reihaneh; Shamshiri, Ahmad Reza title: Evaluation of salivary enzymes and oral lesions among gas station workers compared to nearby shopkeepers in Tehran date: 2018-09-27 words: 3232 flesch: 54 summary: Oral lesions in gas station workers and shopkeepers (n = 52) Oral lesions Present Absent Shopkeepers 2 (7.7%) 24 (92.3%) Gas station workers 0 26 (100%) References 1. Gas station workers were chosen from three gas stations in Tehran city and had a minimum of 1 year of work experience in gas station and work for 5 days a week. keywords: air; gas; health; lead; lesions; pollution; saliva; shopkeepers; station; study; tehran; workers cache: jcms-331.pdf plain text: jcms-331.txt item: #198 of 406 id: jcms-334 author: Albosof, Fazel; Hoseini, Sayed Ahmad; Siahpoush, Amir; Malayeri, Ali Reza; Haghighizadeh, Mohammad Hosein title: Anti-diabetic effects of S. aegyptiaca extract on streptozotocin-nicotinamide induced type 2 diabetes rats date: 2018-03-26 words: 3421 flesch: 53 summary: Administration of S. aegyptiaca extract in 100 and 200 mg/kg also decreases the amount of blood urea to a comparable level with metformin. Effects of S. aegyptiaca Extract on Cholesterol Level Our findings showed that the level of cholesterol increases in diabetic rats in comparison with control animals (Fig. 1). Group I: intact control rats were administered normal saline daily for 4 weeks; group II: diabetic control rats; group III, IV and V: diabetic rats which received S. aegyptiaca leaves hydro-alcoholic extract orally by gastric tube in doses of 100, 200 and 400 mg/kg body weight respectively daily for 4 weeks; group VI: diabetic rats received metformin (100 mg/kg body weight, Sigma-Aldrich, USA) orally for 4 weeks as standard medication. keywords: aegyptiaca; animals; diabetes; effects; extract; levels; metformin; rats cache: jcms-334.pdf plain text: jcms-334.txt item: #199 of 406 id: jcms-335 author: Pakravan, Amir Hosein; Nabizadeh, Mohammad Mehdi; Nafarzadeh, Shima; Jafari, Sina; Shiva, Atena; Bamdadian, Tahmineh title: Evaluation of impact teeth prevalence and related pathologic lesions in patients in Northern part of Iran (2014-2016) date: 2018-03-25 words: 2914 flesch: 59 summary: Extraction of impacted third molars is controversial in dentistry.13 Problems seen associated to the tooth impac- tion varies from simple to complicated life threatening prob- lems. Planinic D, Bodina I, Peric B. Prevalence of odontogenic keratocysts associated with impacted third molars. keywords: impaction; molar; oral; patients; prevalence; sari; study; teeth; tooth cache: jcms-335.pdf plain text: jcms-335.txt item: #200 of 406 id: jcms-336 author: Ali, Mohammed R.; Abdulamir, Ahmed S.; Kadhim, Shurooq R. title: Extraction, Purification and Therapeutic Use of Bacteriophage Endolysin against Multi-Drug Resistant Staphylococcus aureus: in-vivo and in-vitro study date: 2018-03-26 words: 4272 flesch: 58 summary: Intraperitoneal route provides significant protection similar to that of intrave- nous route.21 It was stated that endolysin for S. aureus phages administered by the IP route are distributed, in high titers, more rapidly and delivered for a more sustained period of time to all of the tissues.21 In these experiments, the control group of mice, which were bacterially infected without endolysin phage therapy, showed that all the mice died within just 8 h. Actually using a severe model of sepsis that leads to 100% lethality of mice in less than 24 h is a difficult challenge for every imaginable antibacterial agent. Animal studies have generally supported the utility and safety of endolysin phage therapy against bacterial pathogens, like S. aureus.19,20 In this study, endolysin phage therapy of septicemic laboratory mice, through IP injection with MDR S. aureus, showed that administration of endolysin resolved the infection dramatically. keywords: aureus; bacterial; bacteriophage; endolysin; group; health; mice; min; phage cache: jcms-336.pdf plain text: jcms-336.txt item: #201 of 406 id: jcms-338 author: Adikwu, Elias; Bokolo, Bonsome title: Antioxidants as recipes for efavirenz-induced liver damage: A study in albino rats date: 2018-03-26 words: 6125 flesch: 59 summary: 8.92 ± 0.31a 4.53 ± 0.06a Vitamin E 35.6 ± 4.00a 59.4 ± 3.01a 72.9 ± 6.72a 1.72 ± 3.01a Vitamin C 69.4 ± 6.21a 63.5 ± 4.20a 61.8 ± 5.15a keywords: antioxidants; efavirenz; effects; efv; hepatic; hepatotoxicity; levels; liver; nac; rats; stress; vitamin; vitamins c cache: jcms-338.pdf plain text: jcms-338.txt item: #202 of 406 id: jcms-339 author: Obaid, Rasha Fadhel; Al-Khafaji, Younis A.; Obied, Hamid N.; AL-Jibouri, Salman A.; Mohammed, Salam J.; Al-kilabi, Rana F. title: Correlation between live attenuated measles viral load and growth inhibition percentage in non-small cell lung cancer cell line date: 2018-03-26 words: 4370 flesch: 55 summary: The optical density for cell line cell was measured at 459 nm by ELISA reader. Mean ± SD for three replicates (P < 0.05) Passage number Viral load log 10 (RNA copies/µl) Mean ± SD P1 4.3300 ± 0.24434 P2 4.5967 ± 0.24007 P3 5.2067 ± 0.15044 P4 5.7467 ± 0.09292 P5 6.2600 ± 0.14177 P6 7.6967 ± 0.13868 P7 8.5067 ± 0.07024 P8 8.8600 ± 0.13528 Figure 4A shows measles virus load in lung cell line treated with (10−1) virus was (6.94 log10) at 24 hr, and increased gradually until it reached maximum titer (10.336) at 96 hr. keywords: cancer; cell; effect; growth; inhibition; line; load; lung; measles; measles virus; pcr; percentage; virus cache: jcms-339.pdf plain text: jcms-339.txt item: #203 of 406 id: jcms-340 author: Zolbin, Masoumeh Majidi; Nematin, Sepidah; Daghigh, Faezeh; Namdar, Fariba; Madadian, Mahmoodreza; Abbasi, Mahdi; Noori Mogahi, Seyed Mohammad Hosein; Takzaree, Nasrin title: PMSG and HCG hormones effect on the development and growth of ovarian follicles date: 2018-03-26 words: 3124 flesch: 53 summary: 51J Contemp Med Sci | Vol. 4, No. 1, Winter 2018: 51–54 Research PMSG and HCG hormones effect on the development and growth of ovarian follicles Masoumeh Majidi Zolbin,a Sepideh Nematian,b Faezeh Daghigh,c Fariba Namdar,d Soosan Tak Zaree,e Mahmoodreza Madadian,f Mahdi Abbasi,a Seyed Mohammad Hosein Noori Mogahi,a and Nasrin Takzareea aDepartment of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. The application of PMSG in immature rats increases ovulation and prevents the atresia of periantral and antral follicles.12 Wang examined the effects of LH and FSH on the growth of ovarian follicles in the mice that had previous pituitary gland removal. keywords: development; follicle; group; hcg; hormones; increase; number; ovarian; ovary; ovulation; pmsg cache: jcms-340.pdf plain text: jcms-340.txt item: #204 of 406 id: jcms-370 author: Khalaf, Bashar Sahib; Chabuck, Zainab Adil title: A Comparative Study Between Icteric and Non-Icteric Hepatitis A Among Pediatric Patients Admitted to Babylon Maternity Hospital: Acute Hepatitis A Viral Hepatitis Among Pediatric Patients date: 2018-07-23 words: 3256 flesch: 55 summary: Viral hepatitis A is the most public and common viral hepatitis throughout the childhood period, particularly in the developing countries. Immunoglobulin G (IgG) and immunoglobulin M (IgM) antibodies specific for hepatitis A virus (anti-HAV) were obtained in patients’ sera by enzyme-linked immunosorbent assay. keywords: acute; children; hav; hepatitis; infection; jaundice; non; patients; study cache: jcms-370.pdf plain text: jcms-370.txt item: #205 of 406 id: jcms-398 author: Nafarzadeh, Shima; emamgholipour, mohsen; Bijani, Fatimah; Hosseinkazemi, Hamed; Mostafazadeh, Amrollah; Khakbaz, Oveis; Baladi, Fatemeh; Khafri, Sorayya title: Is salivary evaluation of P53 and MMP-3 a good tool for early detection of oral squamous cell carcinoma? date: 2018-09-26 words: 2710 flesch: 61 summary: Taghavi N, Biramijamal F, Sotoudeh M, Moaven O, Khademi H, Abbaszadegan MR, et al. Association of p53/p21 expression with cigarette smoking and prognosis in esophageal squamous cell carcinoma patients. Saliva is believed to be a reliable tool for diagnosis of OSCC because it is in direct contact with cancerous tissue.7 Is salivary evaluation of P53 and MMP-3 a good tool for early detection of oral squamous cell carcinoma? Shima Nafarzadeh,a Mohsen Emamgholipour,b Fatimah Bijani,c Hamed Hosseinkazemi,a Amrollah Mostafazadeh,d Oveis Khakbaz,a Fatemeh Baladi,d and Soraya Khafrie Objective Oral squamous cell carcinoma (OSCC) is one of the most common malignancies around the world. keywords: cancer; carcinoma; cell; oral; oscc; p53; patients; salivary cache: jcms-398.pdf plain text: jcms-398.txt item: #206 of 406 id: jcms-399 author: Pazouki, Abdolreza; Rezaei, Vahid; Tizmaghz, Adnan; Kabir, Ali title: Preoperative upper endoscopy and bariatric surgeries date: 2018-06-26 words: 2691 flesch: 56 summary: 59–62 62 J Contemp Med Sci | Preoperative upper endoscopy and bariatric surgeries Research Abdolreza Pazouki et al. upper gastrointestinal endoscopy in morbidly obese patients undergoing bariatric surgery. The bariatric surgery is the most effective and long lasting remedy for obese patients which depends on sequential exer- cise after surgery.2 However, research demonstrate that about 80% of patients undergoing surgery do not take the recom- mendation of doctors to do an exercise for more than 150 minutes in a week.1 Because in bariatric surgeries, large part of stomach is involved these parts always become inaccessible to endos- copy. keywords: endoscopy; hernia; patients; pylori; study; surgery; ulcer cache: jcms-399.pdf plain text: jcms-399.txt item: #207 of 406 id: jcms-401 author: Majidi Zolbin, Masoumeh; Mokhtari, Tahmineh; Amidi, Fardin; Parvari, Soraya; MirgaloyBayat, Shahlla; Abbasi, Mehdi title: Isolation and localization of cells expressing Sca-1 in the Adult Mouse Ovary: An evidence for presence of Mesenchymal Stem cells date: 2018-06-26 words: 3171 flesch: 59 summary: Mesenchymal stem cells (MSCs) are the most applicable source of stem cells and the common marker of MSCs is Sca-1 so that the purpose of this study was to clarify the incidence of stem cells in the surface epithelium of ovary. Additionally, the other kinds of stem cells have been iden- tified in the adult ovary, such as very small embryonic-like stem cells9 and a subpopulation of granulosa cells up-regulate some stemness genes related to bone marrow mesenchymal stem cells (MSCs).10 In other way, more recently, stem cell antigen 1 (Sca-1) have been introduced as a selective marker for MSCs in mouse model.11 In this study, we tried to characterize the MSCs in the ovary of mouse model by detecting the cells expressing Sca-1 as a distanced marker of MSCs using different techniques including fluorescence activated cell sorting (FACS) analysis, immunohistochemistry (IHC) and RT-PCR. Materials and Methods Animals This experimental study was performed on 40 adult females C57BL/6 mice 6 weeks of age. keywords: adult; cells; expression; mouse; ovarian; ovary; sca-1; stem cache: jcms-401.pdf plain text: jcms-401.txt item: #208 of 406 id: jcms-402 author: Ajeena, Ihsan M; Al-Haris, Nada; Al-Kefae, Huda N; Goloom, Shehab A; Al-Abudi, Khalid title: The Impact of Transcutaneous Electrical Nerve Stimulation (TENS) on Endometrial Thickness in the Healthy Women, A Step to Improve the Female Fertility date: 2018-06-26 words: 4124 flesch: 58 summary: Uterine blood flow and endometrial thickness (ET) are measured at day 13 of MC before TENS application and at the same day of the next cycle after six sessions of TENS were applied. Results TENS significantly increases endometrial thickness from 5.80 ± 0.24 to 7.60 ± 1.57 mm. keywords: arteries; blood; effect; flow; index; nerve; pregnancy; stimulation; study; tens; thickness cache: jcms-402.pdf plain text: jcms-402.txt item: #209 of 406 id: jcms-403 author: rezaee, Saeed; hemmati, Ali asghar; Malayeri, Alireza; Bakhtiari, Nima title: Simple and fast Development and validation of High Performance Liquid Chromatography Method with UV determination of thiopental in rat plasma date: 2018-06-26 words: 2526 flesch: 56 summary: UV detection is suitable but range of detection change- able, and it seem our methods is most suitable in rat determination of thiopental for pharmacologic study in recent days. The spiking standard solutions (20 μL) were used to spike blank rat plasma samples (200 μL), for both calibration curves and QC samples during method validation study. keywords: chromatography; determination; method; plasma; rat; research; standard; study; thiopental cache: jcms-403.pdf plain text: jcms-403.txt item: #210 of 406 id: jcms-404 author: Mohebbi, Simin Z; Yazdani, Reza; Mofatteh, Mohammad; Bonabi, Maedeh title: Senior dental student’s utilization and self-reported skills of information technology (IT) date: 2018-06-26 words: 4629 flesch: 62 summary: Keywords information technology, senior dental students, internet searching skill, computer using skill, IT utilization Introduction World has witnessed rapid progress and expansion of infor- mation technology (IT) in dentistry in the last few years.1 Nowadays, internet and social networks have found their place among young doctors and this penetration of com- puters and internet has revolutionized the study and practice of dentistry.2 Along with general usage of computer and internet for communication and entertainments, dental edu- cation and research, office management, digital imaging, electronic health records, video conferencing, remote com- munication with patients and other dentists and, continuous distance and patient education are some examples of profes- sional IT usages.1 Several studies of IT usage reveal that about 60–95% of dental students use internet for personal and educational purposes and most of them own personal computers or lap- Because of such barriers, despite great spread of dental webpages, their usage and effec- tiveness in dental training is still unclear and as a result, some of dental students are not enthusiastic to them.2 However, IT has undeniable role in training students and actually can be addressed as one of the main components in new methods which increases the training speed.1 The aim of this study is to evaluate the orientation and uti- lization of IT among senior dental students and to evaluate the association of self-reported skills with usage of IT. keywords: computer; general; internet; skills; students; study; usage; use cache: jcms-404.pdf plain text: jcms-404.txt item: #211 of 406 id: jcms-407 author: Ghafel, Hawraa Hussein title: Neonatal Mortality Rate at AL- Elwaya Maternity Hospital in Baghdad City: Retrospective study date: 2018-06-26 words: 2831 flesch: 55 summary: Figure 1 shows the long-term trend of time sequence (years) factor on the number of neonatal mortality rate factor. 1 Long-term trend scatter diagram correlation of time sequence factor on neonatal mortality rate factor. keywords: factor; mortality; neonatal; rate; sequence; study cache: jcms-407.pdf plain text: jcms-407.txt item: #212 of 406 id: jcms-408 author: Albujeer, Ammar N.H.; Almahafdha, Alya title: Does Arbaeen event is taking its place in global mass gathering programs? date: 2018-06-26 words: 523 flesch: 59 summary: The number of visitors increasing each year, long distance of the pilgrim, low sanitation, and the weakness of Iraqi health care system worsen the problem.3,4 The Iraqi ministry of health in collaboration with Iraqi Red Crescent, health care NGOs, and health professions as volunteers provide primary health care and treatments by placing health stations and mobile hospitals on the visitors’ way, but these stations do not cover the whole needs. Global perspectives for prevention of infectious diseases associated with mass gatherings. keywords: care; health; visitors cache: jcms-408.pdf plain text: jcms-408.txt item: #213 of 406 id: jcms-410 author: Yazdani, Reza; Kharazifard, Mohamadjavad; Morafegh, Negin title: Moral skills of Iranian general dentists date: 2018-07-02 words: 3518 flesch: 57 summary: Demographic factors were also assessed and their correlation with moral skills was evaluated using the backward linear regression model. Conclusion The mean percentage of moral skills of Iranian dentists was moderate. keywords: dental; dentists; reasoning; score; sensitivity; skills cache: jcms-410.pdf plain text: jcms-410.txt item: #214 of 406 id: jcms-422 author: Koopaie, Maryam; Fatahzadeh, Mahnaz title: Lichen planus pemphigoides limited to the oral cavity: A case report and literature review date: 2018-07-02 words: 3026 flesch: 52 summary: Solomon LW, Helm TN, Stevens C, Neiders ME, Kumar V. Clinical and immunopathologic findings in oral lichen planus pemphigoides. This patient had been diagnosed with buccal mucosa lesions of LP and later developed LPP lesions on her soft palate. keywords: case; dermatol; lesions; lichen; lpp; palatal; patient; pemphigoides; planus cache: jcms-422.pdf plain text: jcms-422.txt item: #215 of 406 id: jcms-424 author: Syedmoradi, Leila; Hajghassem, Hassan; Tavoosidana, Gholamreza; Rezayat, Seyed Mahdi; Faridi-Majidi, Reza; Omidfar, Kobra title: An electrochemical sensing platform for sensitive detection DNA methylation using Fe3O4/TMC/Au nanocomposite and poly(l-arginine)/reduced graphene oxide modified screen-printed carbon electrode date: 2018-12-26 words: 4702 flesch: 48 summary: Towards DNA methylation detection using biosensors. In FTIR spectra of Fe3O4/TMC Fig. 1 Schematic of the principal mechanism for methylated DNA detection by the genosensor. keywords: cancer; detection; dna; electrochemical; electrode; fe3o4; graphene; methylation; nanocomposite; rgo; streptavidin; surface; target; tmc cache: jcms-424.pdf plain text: jcms-424.txt item: #216 of 406 id: jcms-432 author: Jafari, Hossein; Mokaberinejad, Roshanak; Raeis-Abdollahi, Ehsan title: Echium amoenum from viewpoint of Avicenna: a brief review date: 2018-12-26 words: 3520 flesch: 50 summary: E. amoenum is traditionally used as herbal tea in Iranian traditional medicine (ITM) for conditions such as common cold, bronchitis, stress and fatigue. Conclusion There are many common characteristics about the pharmacological properties of E. amoenum in modern medicine and ITM, but more research is needed to prove the safety and efficacy of the plant. keywords: amoenum; avicenna; drug; e. amoenum; echium; effects; extract; iran; itm; medicine; sci cache: jcms-432.pdf plain text: jcms-432.txt item: #217 of 406 id: jcms-44 author: Al-Tu’ma, Fadhil Jawad; Mahdi, Zena Abdul-Ameer; Abo Almaali, Hassan Mahmood title: Relationship between serine/threonine kinase 39 gene polymorphisms with some cardiac biomarkers in hypertensive patients date: 2016-01-08 words: 3754 flesch: 61 summary: Genotype of the studied variants and cardiovascular risk factors Risk factors Alleles Total Hypertension Control Mean ± S.D. Mean ± S.D. Mean ± S.D. Age (years) 0.35 0.11 0.91 AA 49.28 ± 11.28 50.43 ± 10.69 46.41 ± 12.36 AG 55.00 ± 11.93 57.14 ± 7.97 47.50 ± 24.75 GG 52.00 ± 0.00 0.00 52.00 ± BMI 0.87 0.93 0.1 AA 27.95 ± 5.44 29.60 ± 5.57 23.86 ± 1.55 AG 28.83 ± 4.00 29.79 ± 4.02 25.49 ± 1.53 GG 26.70 ± 0.00 0.00 26.70 ± Systolic BP 0.11 0.07 0.08 AA 135.34 ± 23.06 143.24 ± 21.48 115.74 ± 13.06 AG 152.22 ± 19.22 158.57 ± 16.76 130.00 ± .00 GG 140.00 ± 0.00 0.00 140.00 ± Diastolic BP 0.54 0.71 0.05 AA 83.24 ± 13.33 88.36 ± 11.39 70.56 ± 8.47 AG 87.78 ± 8.33 90.00 ± 5.77 80.00 ± 14.14 GG 90.00 ± 0.00 0.00 90.00 ± FBS 0.84 0.8 0.96 AA 120.98 ± 57.64 130.46 ± 65.75 97.44 ± 10.07 AG 127.78 ± 33.87 136.86 ± 32.87 96.00 ± 9.90 GG 95.00 ± 0.00 0.00 95.00 ± S. Urea 0.19 0.37 0.04 AA 27.99 ± 7.63 28.72 ± 8.14 26.19 ± 5.95 AG 33.00 ± 9.15 31.71 ± 10.14 37.50 ±.71 GG 28.00 ± 0.00 0.00 28.00 ± S. Creatinine 0.03 0.03 0.38 AA .67 ± Characteristics of the study subjects Parameters Hypertension Mean ± SD Control Mean ± SD p value Age (years) 51.07 ± 10.60 46.67 ± 12.62 0.07 BMI (kg/m2) 29.62 ± 5.42 24.06 ± 1.63 0.00 SBP (mmHg) 144.69 ± 21.46 117.50 ± 13.57 0.00 DBP (mmHg) 88.51 ± 10.97 71.83 ± 9.42 0.00 FBS (mg/dl) 131.07 ± 63.25 97.27 ± 9.73 0.00 Serum urea (mg/dl) 29.00 ± 8.32 27.00 ± 6.32 0.23 S. creatinine (mg/dl) 0.71 ± 0.25 0.68 ± 0.24 0.49 S. albumin (g/L) 4.37 ± 0.24 4.33 ± 0.23 0.43 S. cholesterol (mg/dl) 182.88 ± 38.71 178.90 ± 35.85 0.62 S. TG (mg/dl) 181.93 ± 108.46 147.50 ± 74.87 0.11 S. HDL-C (mg/dl) 39.65 ± 23.03 41.07 ± 15.48 0.75 S. LDL-C (mg/dl) 108.79 ± 40.51 108.73 ± 36.06 0.99 S. VLDL-C (mg/dl) 42.75 ± 60.47 32.33 ± 20.44 0.36 Fig. 1 Electrophoresis band for allele G of STK39 gene. keywords: allele; association; control; hypertension; stk39; study cache: jcms-44.pdf plain text: jcms-44.txt item: #218 of 406 id: jcms-449 author: Al-Mawali, Adhra; Idikula, John; Daniel Pinto, Avinash title: Fraud and Misconduct in Clinical Research: A Step to Improve Ethical Practice in Research date: 2018-09-26 words: 6547 flesch: 49 summary: Bias, however is distinct from fraud in that bias is inherent in clinical research and every researcher is obliged to identify potential bias and avoid them or at least reduce them as much as possible. It serves the interest of both those “actively involved in conducting clinical research, and the rights, safety and well-being of participants, which are compliant with the principles stated in the Declaration of Helsinki, and other international ethical guidelines.”1 keywords: bias; clinical; data; ethics; fraud; guidelines; health; med; misconduct; research; researchers; review; studies; study cache: jcms-449.pdf plain text: jcms-449.txt item: #219 of 406 id: jcms-45 author: Al-Wazni, Wafaa Sadeq; Hadi, Bashair Sami title: Antivirulence effects of pomegranate peel extracts on most common urinary tract infection pathogens in pregnant women date: 2016-01-08 words: 4887 flesch: 52 summary: Keywords pomegranate peel extract, antivirulence effect, interaction with antibiotic Antivirulence effects of pomegranate peel extracts on most common urinary tract infection pathogens in pregnant women Wafaa Sadeq Al-Wazni & Bashair Sami Hadi Introduction Urinary tract infection (UTIs) is an injury resulting from the presence and the growth of microorganism in different parts of the urinary tract, so it could be defined as the colonization of and invasion of the structures in the urinary tract by micro-organisms.1 In human, the urinary tract is one of the most common sites of bacterial infection and most case of UTI caused by bacteria which ascend from the perineum, and the reason of the ascent of bacteria raised by conditions like preg- nancy.2,3 UTIs are the most common problem during preg- nancy as result of physiologic changes which are related to pregnancy that make healthy women more susceptible to acquired various injury.4 UTIs are caused by different type of gram positive and negative bacteria like Escherichia coli, Kleb- siella species, Proteus mirabilis, Pseudomonas aeruginosa, Enterococcus, Staphylococcus, and Streptococcus agalactiae.5 The isolate bacteria produce deferent virulence factors which play essential roles in pathogenicity of these bacteria such as hemolysin (is an important virulence factor attached with especial receptors on the erythrocytes wall then making pours in the cell wall so the erythrocytes will lyse), β-lactamase (enzyme that works to destroy the β-lactam ring of antibiotic and causing the loss of effectiveness and contain serine amino acid in their hydroxyl group which represented the active site of this enzyme).6 Pathogen adhesion to the host tissue is regarded as an important initiating step in many types of infection because it helps the bacteria to resist the defense mechanism in the body,7 and biofilm formation (a slimy layer with embedded micro colonies) is most important and wide- spread mode for increase pathogenicity of the microorganism and helps bacteria to resist the surrounding environment con- dition and antibiotic concentration.8 Some pathogens which are responsible for UTI are resistance to different types of antibiotic therefore relatively limited choice of antimicrobial agents can eliminate from the body so has become necessary to work to find a new techniques more effective for the treatment of infection caused by drug-resistant microorganism. 7J Contemp Med Sci | Vol. 1, No. 4, Autumn 2015: 7–12 Research Objective This study includes the investigation of antibacterial and antivirulence activities of three types of pomegranate peel extracts and then determines the interaction between the extracts and antibiotic in vitro. Methods The ability of most common isolated bacteria from urinary tract infection (UTI) to produce different virulence factors were tested and the effect of plant extracts on virulence factors were determined; in addition the correlation between extracts and antibiotics were evaluated by using fractional inhibitory concentrations. keywords: ability; acetone; activity; aureus; bacteria; coli; effect; extracts; peel; pomegranate cache: jcms-45.pdf plain text: jcms-45.txt item: #220 of 406 id: jcms-450 author: Khazaei, Mohammad Rasool; Makalani, Fatemeh; Ghanbari, Elham; Fayzemahdavi, Maryam; Khazaei, Mozafar title: An Overview of Effective Herbal and Antioxidant Compounds on Diabetes date: 2018-09-26 words: 7268 flesch: 48 summary: Herbal medications are considered in diabetes treatment because of less side effects, antioxidant properties and insulin secretion regulatory effects. Ginger reduces blood sugar with antagonistic activity against serotonin-receptors and blocking them, it also probably inhibits the activity of glucosi- dase and amylase enzymes in the intestine and thereby reduces glucose uptake in the body.48 Fenugreek Trigonella foenum-graecum of Fabaceae, is one of the most effective antidiabetic herbs used in traditional medicine.49 Trigonella has shown to decrease blood glucose levels as a dose-dependent state, in both healthy and diabetic animal models.50 Also, in vitro studies demonstrated that 4-hydroxyl lysine, a component of Trigonella leads to increase in insulin secretion of pancreatic island cells in response to glucose, both in human and mice. keywords: acid; activity; antioxidant; beta; blood; cells; compounds; decrease; diabetes; effects; extract; flavonoids; glucose; herbal; herbs; increase; insulin; khazaei; levels; med; medicine; mellitus; oxidative; patients; plants; rats; review; sci; type cache: jcms-450.pdf plain text: jcms-450.txt item: #221 of 406 id: jcms-451 author: Mehrannia, Kobra; Mokhtari, Tahmineh; Noori Mogehi, Seyed Mohammad Hossein; Akbari, Mohammad; Tavakkoly Bazzaz, Javad; Mahakizeh, Simin; Mohammai, Yousef; Ijaz, Sahar; Hassanzadeh, Gholamreza title: Intracerebroventricular injection of Wharton’s jelly mesenchymal stem cells attenuates Brain Damage in Rat Model of Hypoxia: Optimization of vascular endothelial growth factor and downregulation of inflammatory factors date: 2018-09-26 words: 5086 flesch: 58 summary: Cell stem cell. A new blood–brain barrier model using primary rat brain endothelial cells, pericytes and astrocytes. keywords: brain; cells; expression; gene; group; hypoxia; icv; injection; ischemic; model; mscs; neurons; rat; stem; vegf cache: jcms-451.pdf plain text: jcms-451.txt item: #222 of 406 id: jcms-453 author: Siahpoosh, Amir; Majdinasab, Nastaran; Derakhshannezhad, Negin; Khalili, Hamid Reza; Malayeri, Alireza title: Effect of grape seed on quality of life in multiple sclerosis patients date: 2018-09-26 words: 4073 flesch: 60 summary: 148 J Contemp Med Sci | Vol. 4, No. 3, Summer 2018: 148–152 Original Effect of grape seed on quality of life in multiple sclerosis patients Amir Siahpoosh,a Nastaran Majdinasab,b Negin Derakhshannezhad,a Hamid Reza Khalilic and Alireza Malayeric,d aMedicinal Plants Research Center and Department of Pharmacognosy, Faculty of Pharmacy, Ahvaz Jundishapur University of medical Sciences, Ahvaz, Iran. Increased nitric oxide has a direct relation- ship with the incidence of autoimmune inflammatory dis- eases, including multiple sclerosis, rheumatoid arthritis, ISSN 2413-0516 Amir Siahpoosh et al. 149J Contemp Med Sci | Vol. 4, No. 3, Summer 2018: 148–152 Original Effect of grape seed on quality of life in multiple sclerosis patients insulin- dependent diabetes and inflammatory bowel dis- ease.14 keywords: disease; effect; fatigue; grape; health; life; patients; quality; sclerosis; seed; treatment cache: jcms-453.pdf plain text: jcms-453.txt item: #223 of 406 id: jcms-454 author: Alipour, Mohammad Reza; Ahmadiasl, Naser; Karimi, Pouran; Alihemmati, Alireza; Majidi Zolbin, Masoumeh; Daghigh, Faeze title: Effects of genistein treatment on molecular markers related to fibrosis: Addition to histological changes in the lung of ovariectomized diabetic rats date: 2018-09-26 words: 3848 flesch: 53 summary: Simi- larly, ovariectomized diabetic lung is associated with a marked histological abnormalities.4 In the present study, we hypothesized that the administration of genistein could reverse lung fibrosis disturbed by estrogen deprivation. keywords: diabetic; effects; expression; genistein; group; levels; lung; ovx.dia; rats; tgf; treatment cache: jcms-454.pdf plain text: jcms-454.txt item: #224 of 406 id: jcms-456 author: Rahvar, Mostafa; Ahmadi Lakalayeh, Gholamreza; Faridi majidi, Reza; Haririan, Ismaeil; Marouf, Bahereh T.; Ghanbari, Hossein title: Efficacy and safety of micro/nanostructured polymeric coatings for drug eluting stents date: 2018-09-26 words: 3678 flesch: 59 summary: While, very few number of platelets attached on coating surfaces is in non-activated form. However, these peaks was not observed in EHDA–PLA–DEX coating. keywords: adhesion; coatings; dex; drug; ehda; fig; micro; pla; platelet; release; samples; spin; surface cache: jcms-456.pdf plain text: jcms-456.txt item: #225 of 406 id: jcms-46 author: Al-Hisnawi, Maryam Sabah; Jabor, Mohammed Abdulla title: Preparation of nanohybrid compound from the drugs (naproxen and cephalexin) with zinc oxide and studying biological activities against Aeromonas bacteria date: 2016-01-08 words: 2379 flesch: 56 summary: The main advantages of using ZnO nanoparticles are its excellent stability or long shelf life with organic antimicrobial agents.2 In particular, the vigorous antimicrobial properties of nanoscale ZnO particles have been the focus of industrial applications in biocides coating in water treatment, paints, and cosmetic products.7 The scope of ZnO nanoparticles has been a keen area of interest for biologist due to their distinguished anti- microbial and distinct activity which have opened new frontiers to biological sciences.8 keywords: cephalexin; compounds; doi; nanohybrid; nanoparticles; pmid; zno cache: jcms-46.pdf plain text: jcms-46.txt item: #226 of 406 id: jcms-460 author: Khoshnevisan, MH; Ghasemianpour, M; Samadzadeh, H; Baez, RJ title: Oral Health Status and Healthcare System in I.R. Iran date: 2018-09-26 words: 9638 flesch: 58 summary: The target is to halt the progression of oral diseases and maximize the promotion of oral health and quality of life by the year 2025 for the target population. Oral health is more important than healthy teeth; it is an integral part of overall health and well-being and the needs of Iranian citizens must be addressed accordingly. keywords: areas; children; dental; health; healthcare; national; oral; place; score; sex; year cache: jcms-460.pdf plain text: jcms-460.txt item: #227 of 406 id: jcms-47 author: Al-Hassnawi, Abeer T; Al-Ameri, Ali Mansoor; Al-Hassnawi, Huda H title: Association between antistreptolysin-O serum level and chronic plaque psoriasis in Iraqi patients date: 2016-01-08 words: 2363 flesch: 54 summary: Among these, the most commonly used is antistreptolysin.6,7 In our study, chronic plaque psoriasis patients were shown to have significantly higher ASO level compared to the control group (P < 0.05). With the production of myeloperoxidase and elastase by neutrophils, skin lesion of psoriasis might be mediated.3,4 The present study aims to investigate the association between serum antistreptolysin-O (ASO) level in patients with chronic plaque psoriasis by using ELISA technique. keywords: aso; chronic; doi; level; patients; plaque; pmid; psoriasis; serum cache: jcms-47.pdf plain text: jcms-47.txt item: #228 of 406 id: jcms-476 author: Abdulqader, Ali; Ali, Faisal; Ismail, Amin; Esa, Norhaizan title: Gac (Momordica cochinchinensis Spreng.) Fruit and its Potentiality and Superiority in -Health Benefits date: 2018-12-26 words: 6761 flesch: 54 summary: Recently, the food and pharmacological industry have taken a keen interest in Gac fruit and producing Gac fruit products such as Gac powder, Gac oil capsules, Gac juice, and frozen Gac fruit. Abdulqader A. et al. 181J Contemp Med Sci | Vol. 4, No. 4, Autumn 2018: 179–186 Review Gac fruit and its potentiality in health benefits showed that Gac peel and pulp had the highest antioxidant activity at the immature stages of 2.56 and 2.35 µmol/g, respec- tively.5 A separate study reported that DPPH and FRAP assess- ments of 100 g of Gac fruit extract, were equivalent to 45.1 and 5.8 mg, respectively.15 Moreover, Gac peel extract using ethyl acetate showed the ABTS antioxidant capacity yield of 737 µM trolox equivalent (TE) /100 keywords: activity; aril; cancer; carotene; carotenoids; cell; cochinchinensis; extract; gac; gac fruit; gac seed; health; lycopene; momordica; peel; pulp; sci; seed; vitro cache: jcms-476.pdf plain text: jcms-476.txt item: #229 of 406 id: jcms-48 author: Ali, Gasak Falah; Al-Hamadani, Adnan H.; Mohammad, Adnan W title: Detection of cyclohximide resistant gene in selected pathogenic fungi date: 2016-01-08 words: 2964 flesch: 53 summary: Conclusion The tested pathogens had resistance genes to cycloheximide such as (CHY1, CHY2, CDR1, CDR2 and HKG). Later it was found that the resistant to 7-aminocholes- terol (RTA2) gene might also be involved in the development of azole resistance in a mutant C. albicans strain with deletions of CDR1, CDR2 and MDR1.19 Conclusion The tested pathogens had resistance genes to cycloheximide such as CHY1, CHY2, CDR1, CDR2 and HKG. keywords: albicans; cycloheximide; dna; fungi; gene; lane; pathogenic; pcr; pmid; product; resistance cache: jcms-48.pdf plain text: jcms-48.txt item: #230 of 406 id: jcms-485 author: Mostafavi, Maryam; Saeedi Vahdat, Arman; Javadian, Laleh; Ghaznavi, Aisan title: Analysis of condylar volume in relation to craniofacial morphology using cone beam computed tomography date: 2018-12-26 words: 3826 flesch: 61 summary: 202–206 Research Analysis of condylar volume in relation to craniofacial morphology using cone beam computed tomography Maryam Mostafavi,a Arman Saeedi Vahdat,b Laleh Javadian,c and Aisan Ghaznavia* aDepartment of Oral and Maxillofacial Radiology, Dentistry faculty, Urmia University of Medical Sciences, Urmia, Iran. b Department of Oral and Maxillofacial Radiology, Dentistry Faculty, Tabriz University of Medical Sciences, Tabriz, Iran. Considering the high efficacy of CBCT in presenting 3D images without superimposition, magnification, or distortion (with limited exposure dose), researchers started to use this imaging modality for the analysis of TMJ only 2 years after its introduc- tion to jaw and facial imaging.6 Research has been conducted on the relationship between skeletal morphology and condylar volume and morphology using CBCT. keywords: class; classes; condylar; iii; patients; surface; volume cache: jcms-485.pdf plain text: jcms-485.txt item: #231 of 406 id: jcms-486 author: Al-Dhalimi, Muhsin; Al-Sabak, Haider; Hussain, Aula title: Treatment of resistant acral vitiligo with fractional Er:YAG laser date: 2018-12-26 words: 3037 flesch: 60 summary: The Er:YAG laser cause vaporization and coagulation. Fractional CO2 laser was used as ablative therapy in other studies instead of Er:YAG laser in difficult to treat areas.7 Triple therapy was tried (laser, potent topical steroid, NB-UVB) in refractory vitiligo in two studies. keywords: laser; patients; response; treatment; uvb; yag cache: jcms-486.pdf plain text: jcms-486.txt item: #232 of 406 id: jcms-488 author: Al Mudhafar, Adnan W; Hadi, Najah R; Wasfi, Rafid M.A; Mohammed, Zaid M title: The atheroprotective effects of genistein in hypercholestrolemic male rabbit date: 2018-12-26 words: 3616 flesch: 54 summary: 3 Photomicrograph of histomorphometric section in aortic arch of Genistein hyperlipidemic rabbits. These results demonstrate that cholesterol levels lower when increasing LDL receptor activity, this increasing the absorption of LDL from the blood into the liver. keywords: atherosclerosis; cholesterol; crp; days; diet; genistein; group; levels; mcp-1; rabbits; serum cache: jcms-488.pdf plain text: jcms-488.txt item: #233 of 406 id: jcms-489 author: Al-Mawali, Adhra; Morsi, Magdi; Al-Kharusi, Hilal; Al-Shekaili, Waleed; Sabariego, Carla; Lee, Lindsay title: Model disability survey: a pilot study in the North Batinah governorate date: 2018-12-26 words: 2892 flesch: 44 summary: Information on functioning and disability is also relevant for developing evidence-based plans of action and policies, for planning and allocating resources to health and social services, and to monitor and report on the imple- mentation of the convention on the rights of persons with disabilities and the indicators of the sustainable develop- ment goals. In line with the ICF, disa- bility is the outcome of the interaction between a health condition (e.g. arthritis, back problems, hearing loss or depression) and environmental barriers (e.g. limited access to health care, negative attitudes of others, inaccessible transportation and public buildings, or lack of inclusive employment laws).3 Disability is also understood in the ICF as a continuum, ranging from no disability (or full func- tioning) to very high levels of disability. keywords: disability; functioning; health; oman; pilot; survey cache: jcms-489.pdf plain text: jcms-489.txt item: #234 of 406 id: jcms-49 author: Al-Tu’ma, Fadhil Jawad; Abd-Yaser, Zainab Abdul-Hussei; Al-Naffi, Karim Obais title: Role of Apo-lipoprotein A1 as cardiac biomarker for severity of coronary atherosclerosis date: 2016-01-08 words: 3148 flesch: 60 summary: The findings of the cur- rent study indicated significant correlation between the LDL level and extent of coronary atherosclerosis disease. No signif- icant correlation was observed between Apo-A1 and the severity of coronary atherosclerosis disease. keywords: apo; atherosclerosis; cad; coronary; disease; doi; patients; pmid; severity cache: jcms-49.pdf plain text: jcms-49.txt item: #235 of 406 id: jcms-490 author: Al-Omary, Hanan L.; Alawad, Zainab M. title: Cord Blood Sex Hormones Concentration: Relation to Birth Weight and Pregnancy Complications date: 2019-04-26 words: 4949 flesch: 64 summary: For these reasons cord blood is currently the practical way to measure fetal hormones.5 Cord blood (both serum and plasma) is a specially chal- lenging medium to measure because it has unique steroid concentrations due to the mix of placental and fetal steroid production and metabolism.6 Umbilical cord blood is usually obtained after delivery, so the hormone levels in the cord plasma or serum are said to represent the levels in the fetal circulation near the end of pregnancy.7 Umbilical cord blood has about equal quantities of venous and arterial contents, in spite of the fact that the rela- tive amounts are not yet estimated exactly. The negative correlation between cord blood testosterone and gestational age had met results of other studies who emphasizes on testosterone and other androgen keywords: birth; blood; cord; cord blood; estradiol; lead; mean; mean std; pcos; pregnancy; std; testosterone; weight cache: jcms-490.pdf plain text: jcms-490.txt item: #236 of 406 id: jcms-491 author: Al-Rekabi, Sameer H.; Al-Aqooli, Hassan A.; Salim, Muayed S. title: Comparative study of the therapeutic potential of octreotide versus trimetazidine and their combination on acute pancreatitis in male rats date: 2018-12-26 words: 4552 flesch: 52 summary: Effect of Treatment on Study Parameters after l-Arg Induction Effect of Treatment on Proinflammatory Cytokines (TNF-α and IL-1β) after l-Arg Induction This study shows that octreotide treatment significantly decrease the serum levels of proinflammatory cytokines (TNF-α and IL-1β) as compared with the induction group, these findings were also obtained by Yang et al.13 who study the effects of octreotide on hepatic ischemic reperfusion injuries in a rabbit models and shows that the level of both TNF-α and IL-1β are lower significantly in octreotide group than the dis- ease group. Our study shows a significant increase in TAC level in TMZ group as compared with octreotide group proving the strong antioxidant activity of TMZ. keywords: acute; group; induction; induction group; octreotide; pancreatitis; serum; study; tmz; treatment; trimetazidine cache: jcms-491.pdf plain text: jcms-491.txt item: #237 of 406 id: jcms-494 author: Alattabi, Alaa S.; Aljerrah, Israa H. title: Applying ESPGHAN and WGO Guidelines of Celiac Disease on Iraqi Patients date: 2018-12-26 words: 4434 flesch: 54 summary: 1 Percentage of tTG IgA titer of CD patients. Socio-demographic characteristics of celiac patients. keywords: antibodies; biopsy; celiac; diagnosis; disease; iga; patients; study; test; ttg; wgo cache: jcms-494.pdf plain text: jcms-494.txt item: #238 of 406 id: jcms-497 author: Al Nasiri, Yusra; Al Mawali, Adhra Hilal title: Health Related Quality of Life in Children with Sickle Cell Disease: A Concept Analysis date: 2019-02-26 words: 4599 flesch: 56 summary: Although HRQOL concept is frequently used, it has still remained unclear and not well defined and often confused with QOL concept. Since HRQOL concept is a multidimensional concept, a factor analysis test may be needed to explore the dimensionality and the structure of its meaning. keywords: analysis; care; cell; children; concept; disease; health; hrqol; life; quality cache: jcms-497.pdf plain text: jcms-497.txt item: #239 of 406 id: jcms-50 author: Kadhim, Khadega Hamza; Al-Hussaini, Ibtihal Muiz title: Diagnostic and environmental study of Aspergillus terreus isolated from various varieties of apples fruits date: 2016-01-08 words: 4170 flesch: 65 summary: pH The results showed that test three isolates of the A. terreus had variation in growth rates through the use of four pH (Table 5) and there were significant differences (p < 0.05) in the growth of A. terreus on PDA at a temperature of 25 ± 2°C. Apples have nutritional values and it is a compromise natural catalyst for the growth of microorganism, especially fungi, where apples are exposed during the harvest, storage and transport to scratches which facilitates the entry of fungi to the texture of the mature fruit and then putrefac- tion and obtain significant economic losses causing rotting of fruits due to fungus A. terreus during storage and marketing.5 On the other hand, the fungus events to rot in fruit, especially apples stimulates some strains of the fungus to secrete carcinogens myco- toxins. keywords: apples; fungi; growth; isolates; study; temperature; terreus cache: jcms-50.pdf plain text: jcms-50.txt item: #240 of 406 id: jcms-51 author: El-Yassin, Hedef D. title: Integrated assessment in medical education date: 2016-01-08 words: 1893 flesch: 49 summary: Lectures’ objectives and outcomes must be written in a way as to encourage a broad range of assessment strategies which will measure a student’s performance and knowledge of processes on a learning activity or project. Performance assessment 3. keywords: assessment; knowledge; med; performance; strategies; students cache: jcms-51.pdf plain text: jcms-51.txt item: #241 of 406 id: jcms-514 author: Riahi, Shirin; Mokhtari, Ali Mohammad; Vali, Mouhebat; Abdzadeh, Elham; Mohseni, Shokrollah; Salehiniya, Hamid; Hassanipour, Soheil title: The incidence and mortality rate of cervix cancer in Iran from 1990 to 2016: A systematic review and meta-analysis Running title: Cervix cancer in Iran date: 2019-02-26 words: 5017 flesch: 66 summary: Babai M, Mousavi S, Malek M, Danaie N, Jandaghi J, Tousi J, et al. Survey of cancer incidence during a 5-year (1998–2002) period in Semnan province. Cancer incidence and mortality in Ardabil: report of an ongoing population-based cancer registry in Iran, 2004–2006. keywords: age; analysis; cancer; cervix; incidence; iran; meta; mortality; results; review; studies; study cache: jcms-514.pdf plain text: jcms-514.txt item: #242 of 406 id: jcms-517 author: Moghimipour, Eskandar; Ghorbani, Ali; Malayeri, Alireza; Siahpoosh, Amir; Khodadoost, Mahmood; Rajaeipour, Mehdi; Ahmadi Angali, Kambiz; Zaheri Abdehvand, Laleh title: Evaluation of Nigella Sativa and Honey Combination for Treatment of kidney Stone: a Randomized, Placebo Controlled Clinical Trial date: 2019-02-26 words: 3861 flesch: 64 summary: ESW, PNL, and TUL, and laparoscopy are widely used to remove stones; but the use of these invasive methods is not cost effective and causes severe complications, so replacing traditional therapies with medicinal plants or phytotherapy will be valued.4 In the traditional view, kidney stone is due to thick and sticky khilt (humor) which has lost its moisture through excessive heat over the time.6 In traditional, medicine kidney stone is treated in various ways, including body cleansing from akhlat (plural of khilt), diet, regulation of activity, sleep and wakefulness, and the use of different herbal, animal or mineral drugs, including Nigella sativa (NS) and honey. 24 J Contemp Med Sci | Vol. 5, No. 1, January–February 2019: 24–27 Original article Evaluation of Nigella sativa and honey combination for treatment of kidney stone: a randomized, placebo controlled clinical trial Laleh Zaheri Abdehvand,a Eskandar Moghimipour,b Ali Ghorbani,c Alireza Malayeri,d Amir Siahpoosh,e Mahmood Khodadoost,f Mehdi Rajaeipour,g* and Kambiz Ahmadi Angalih aDepartment of Persian Pharmacy, Faculty of Pharmacy, Ahvaz Jundishapur University of medical Sciences, Ahvaz, Iran. keywords: ahvaz; control; group; honey; kidney; serum; stone; study; treatment cache: jcms-517.pdf plain text: jcms-517.txt item: #243 of 406 id: jcms-518 author: Kazemi, Vida; Mojtahedzadeh, Mojtaba; Siadat, Seyed Davar; Hadjiakhondi, Abbas; Ameri, Abdulghani; Ahmadi Badi, Sara; Manayi, Azadeh; Bagheri, Mahdi title: Evaluation the Effect of Royal Jelly on the Growth of Two Members of Gut Microbiota; Bacteroides fragillis and Bacteroides thetaiotaomicron date: 2019-02-26 words: 3600 flesch: 49 summary: Conclusion This study showed that Royal jelly has a potential effect in the preserving gut microbiota and it is suggested that Royal jelly as a complementary and alternative medicine can be used to treatment diseases are associated with gut microbiota–host interactions and immune regulating. It has been known that, gastrointestinal microbiota composition has significant roles in the determi- nation of health and disease states.13 As well as scrutiny gut microbiota pattern in conduct an investigation and preclin- ical studies can be helped in understanding the processes of maintaining gut microbiota by supplementation and prescrip- tion of some natural products such as Royal jelly in preserving gut microbiota, especially in ill patients undergoing intensive care and receiving medication and variety of drugs with a microbiota weakening effect. keywords: bacteroides; cell; effect; growth; gut; jelly; microbiota; royal; study cache: jcms-518.pdf plain text: jcms-518.txt item: #244 of 406 id: jcms-519 author: Mollapour Sisakht, Mahsa; Nilforoushzadeh, Mohammad Ali; Verdi, Javad; Banafshe, Hamid Reza; Safaei Naraghi, Zahra; Mortazavi-Tabatabaei, Seyed Abdolreza title: Fibrin-collagen hydrogel as a scaffold for dermoepidermal skin substitute, preparation and characterization date: 2019-02-26 words: 3955 flesch: 50 summary: These results show improvement in maintaining skin cells in 3D hydrogels as a next generation skin equivalent for the treatment of full-thickness defects. In an ongoing study, we have recently developed a fibrin-collagen hydrogel as a scaffold for skin cell culture. keywords: cells; collagen; culture; fibrin; fig; hydrogel; keratinocyte; layer; scaffold; skin; tissue; wound cache: jcms-519.pdf plain text: jcms-519.txt item: #245 of 406 id: jcms-52 author: Al-Saadiaa, Kawkab Abdulla; Naji, Hassan Fadhil; Al-Saadi, Ali Hmood title: Production and optimisation of hyaluronic acid extracted from Streptococcus pyogenes date: 2016-01-08 words: 1837 flesch: 49 summary: Conclusion There were differences in HA production among local isolates at the same pH. Keywords Streptococcus pyogenes, hyaluronic acid, HA ELISA kit, pH, glucose concentration Production and optimisation of hyaluronic acid extracted from Streptococcus pyogenes Kawkab Abdulla Al-Saadiaaa, Hassan Fadhil Najib, & Ali Hmood Al-Saadib Introduction Hyaluronic acid (HA), also known as hyaluronan, is a linear polysaccharide (up to 10 MDa) consisting of alternating units of (1,4)-glucuronic acid and (1,3)-N-acetyl-D-glucosamine (GlcNAc).1 Additionally to retaining and modulating the flow of water, it also helps as the backbone for proteoglycan gath- ering by binding aggrecan monomers via link protein.2 Fur- thermore, HA carries numerous functions in altering cellular functions during the development of human, specifically during the development of diarthrodial joints. Cell remained at room temperature for 1 hour and then was pelleted and the aqueous phase was used for estimation.9 Quantitative Estimation of HA by HA ELISA Kit The quantitative estimation of HA according to the manufac- ture’s instructions of the HA ELISA kit (Elabscience/China) was carried out. keywords: acid; isolates; production; pyogenes cache: jcms-52.pdf plain text: jcms-52.txt item: #246 of 406 id: jcms-520 author: Ali, Ekhlass N.; Eltyeaf, Emad Mahmoud; Kadhem, Ashwaq A.; Jouda, Jamela title: Effect of Artemisia fruit extract on TNF- α and IL-6 levels in streptozotocin-induced diabetic mice date: 2019-02-26 words: 5586 flesch: 65 summary: Methods After preparation of Artemisia extract, many chemical tests were used to identify the type of element and compounds presented in this plant using many chemical techniques. Artemisia extract have been used to treat diabetic states in Middle East since a long time ago.27 ISSN 2413-0516 52 J Contemp Med Sci | Vol. 5, No. 1, January–February 2019: keywords: artemisia; control; days; diabetes; extract; fruit; groups; il-6; insulin; levels; med; mice; stz; tnf cache: jcms-520.pdf plain text: jcms-520.txt item: #247 of 406 id: jcms-522 author: Alkuraishy, Hayder M.; Al-Gareeb, Ali I.; Al-Naimi, Marwa Salih title: Pomegranate protects renal proximal tubules during gentamicin induced-nephrotoxicity in rats date: 2019-02-26 words: 5017 flesch: 57 summary: ’s31 study that showed the nephro-protective effect of pomegranate in attenuation of gentamicin nephrotoxicity. The effect of the dipeptidyl peptidase-4 inhibitor sitagliptin on gentamicin nephrotoxicity in mice. keywords: control; effect; gentamicin; group; mda; nephrotoxicity; ngal; pomegranate; rats; serum; study cache: jcms-522.pdf plain text: jcms-522.txt item: #248 of 406 id: jcms-53 author: Alshok, Monem Makki title: Disseminated strongyloidiasis in a 70-year-old lady date: 2016-01-08 words: 1866 flesch: 52 summary: 39J Contemp Med Sci | Vol. 1, No. 4, Autumn 2015: 39–41 Research Objectives To describe a case of disseminated strongyloidiasis in an old age lady with non-specific clinical manifestations. Globally between 30 and 100 million people are infected¹,² with disseminated strongyloidiasis, par- ticularly in patients with unsuspected infection who are given glucocorticoids. keywords: diagnosis; doi; hyperinfection; patient; pmid; stercoralis; strongyloides; strongyloidiasis cache: jcms-53.pdf plain text: jcms-53.txt item: #249 of 406 id: jcms-542 author: Omotosho Dhulqarnain, Akanji; Takzaree, Nasrin; Hassanzadeh, Gholamreza; Solhjo, Somayeh; Tooli, Heidar; Yaaghoobi Nejad, Mahsa; Shafaat, Pedram; Rastegar, Tayebeh title: Osteocacin favours the expression of synaptonemal complex protein 3 in azoospermic mouse model date: 2019-02-26 words: 4470 flesch: 55 summary: Significant with azoospermic group. In azoospermic group, there is apoptotic germ cell line which disrupt the progression of spermatogenesis. keywords: bone; busulfan; cells; control; expression; germ; group; male; mice; osteocalcin; sham; spermatogenesis; sycp3 cache: jcms-542.pdf plain text: jcms-542.txt item: #250 of 406 id: jcms-544 author: Alwan, Nada A.S.; Tawfeeq, Furat N.; Mallah, Nawar A.G. title: Demographic and clinical profiles of female patients diagnosed with breast cancer in Iraq date: 2019-02-26 words: 4901 flesch: 58 summary: On the other hand, other studies from developing countries failed to emphasize that the age factor specifically at first child birth was significant.43 Among African-American patients, it was documented that age had a dual effect on parity as a risk factor; increasing the risk in women younger than 45 years and decreasing it among those 45 years and older; thus highlighting some of the factors responsible for the observed variations in the incidence of breast cancer in these societies.44 Conclusion A considerable proportion of breast cancer patients in Iraq is still present with locally advanced disease at the time of diag- nosis. Conclusion A considerable proportion of breast cancer patients in Iraq still present with locally advanced disease at the time of diagnosis. keywords: age; alwan; breast; breast cancer; cancer; clinical; history; iraq; patients; study; years cache: jcms-544.pdf plain text: jcms-544.txt item: #251 of 406 id: jcms-55 author: Hassan, Najat Hamza; Ali, Rabea M title: Effect of life style (exercise and nutrition) on occurrence of breast cancer in women: A retrospective study in Babylon governorate date: 2015-03-26 words: 4686 flesch: 65 summary: Methods A retrospective study (case control study) of a purposive sample of 400 women; 200 women diagnosed with breast cancer visited the Merjan Teaching Hospital Oncology Cancer Center in Babylon Governorate as a study group and 200 women free of breast cancer as a control group. It comprised of socio-demographic data, reproductive data, information related to breast cancer (stage, side, period, family history) and information related to their life style: exercise (5 items) and nutrition (14 items) of 10 years previous breast cancer occurrence, physical measurements for measuring obesity and overweight (BMI) as well as medical records to explain in the stage of breast cancer and other details which may be assisting this study Data were collected from 4 May 2013 to 4 July 2013. keywords: age; breast; cancer; control; group; study; women cache: jcms-55.pdf plain text: jcms-55.txt item: #252 of 406 id: jcms-56 author: Mohammed, Suhad Hadi; Hmood, Mohammed Neama; Abd, Areej Abbas title: Screening of nasal carriage for Staphylococcus aureus and their resistance to oxacillin and cefoxitin among medical students in Karbala University date: 2015-03-26 words: 2939 flesch: 51 summary: The prevalence of S. aureus carriage has been reported in healthy populations in several countries; 43.2% of S. aureus in nasal cavity of adults in Iraq, 17.3% in nasal cavity of Turkish children, 36% in nares of Japanese adults and 32.4% in nasal cavity of adults in the United States.19–22 Pant and Rai’s (2007)23 findings revealed higher S. aureus nasal colonization rate (43.8%) in staffs of teaching hospital in Nepal. The aim of the study was to screen S. aureus carriage and their susceptibility to cefoxitin and oxacillin among medical students. keywords: aureus; carriage; cefoxitin; coagulase; isolates; nasal; oxacillin; pmid; staphylococcus cache: jcms-56.pdf plain text: jcms-56.txt item: #253 of 406 id: jcms-568 author: Afshari, Masood; Malayeri, Ali Reza; Mohammadshahi, Majid title: Effects of Eryngium Caucasicum Extract on Testosterone, Inflammation and Oxidative Status of Nicotinamide-Streptozotocin Induced Type-2 Diabetes in Male Rats date: 2019-04-26 words: 4835 flesch: 51 summary: 77–81 Effects of Eryngium caucasicum extract on Testosterone, inflammation and oxidative status of Nicotinamide-Streptozotocin Original M. Afshari et al. species reported to contain several phenolic compounds, flavonoids and coumarins which their antioxidant activities have been documented.25 Because of high polyphenols and fla- vonoids contents of E. caucasicum extract, their efficient NO scavenging activities have been reported.23 Lipid peroxidation marker, MDA, in our study significantly decreased in dose- dependent manner; the effect on NO production could be one of possible mechanisms. 77–81 Original Effects of Eryngium caucasicum extract on Testosterone, inflammation and oxidative status of Nicotinamide-Streptozotocin induced Type-2 Diabetes in male rats Masood Afshari,a Ali Reza Malayeri,b and Majid Mohammadshahic* aDepartment of Nutrition, Jundishapour University of Medical Sciences, Ahvaz, Iran. bMedical Plant Research Center, Jundishapour University of Medical Sciences. keywords: antioxidant; caucasicum; caucasicum extract; control; diabetes; diabetic; effects; eryngium; extract; group; rats; serum; testosterone cache: jcms-568.pdf plain text: jcms-568.txt item: #254 of 406 id: jcms-569 author: Namjooyan, F.; Ghanavati, R.; Majdinasab, N.; Rezaei zadeh, H title: The efficacy of traditional formulation on quality of life and fatigue in multiple sclerosis patients: a randomized double-blind placebo-control clinical trial date: 2019-04-26 words: 3849 flesch: 61 summary: Objective According to effects that cinnamon, ajwain and Iranian borago shows in involving mechanisms in MS and MS animal model, we decided to survey the effect of traditional formulation on MS patient by clinical trial. Because of good result and revenue of formulation, it seems to be useful for MS patient. keywords: cinnamon; drug; group; life; medicine; month; patients; placebo; quality; score cache: jcms-569.pdf plain text: jcms-569.txt item: #255 of 406 id: jcms-57 author: Amani, Amir; Amani, Milad title: From micelle to microemulsion: an investigation of structural changes using molecular dynamics date: 2015-03-26 words: 4194 flesch: 60 summary: Conclusion It was shown that insertion of oil molecules makes the droplets more spherical, while co-surfactants tend to enlarge them. In ME-0.5 and ME-whole, oil molecules were initially positioned randomly. keywords: doi; droplets; hydrophobic; micelle; microemulsion; molecules; oil; surfactant; system; water cache: jcms-57.pdf plain text: jcms-57.txt item: #256 of 406 id: jcms-570 author: Osanloo, Mahmoud; Sedaghat, Mohammad Mehdi; Sereshti, Hassan; Amani, Amir title: Nano-encapsulated tarragon (Artemisia dracunculus) essential oil as a sustained release nano-larvicide date: 2019-04-26 words: 6177 flesch: 58 summary: On the other hand, the decreasing rate in TEO concentration is slower in F3 compared with bulk TEO in both lab and SSF. It is, therefore, arguable that, by Fig. 5 Comparison of duration of larvicidal activities of selected nanoformulation vs. bulk TEO in the equal concen- tration of essential oil and also nanoformulations without oil both in lab and SSF tests. keywords: bulk; chitosan; concentration; fig; lab; larvicidal; nanoformulation; oil; size; ssf; teo; test cache: jcms-570.pdf plain text: jcms-570.txt item: #257 of 406 id: jcms-571 author: Salih, Khalid M; Jouda, Jamela; Asad, Shatha Salah; Faraj, Yusur Falah; Mohammed, Iyden Kamil; Altaee, Ali Sameer Abudlghani title: Histological impact of nutritional style alteration in mice date: 2019-04-26 words: 3419 flesch: 60 summary: Sahraoui A, Dewachter C, de Medina G, Naeije R, Aouichat Bouguerra S, Dewachter L. Myocardial structural and biological anomalies induced by high fat diet in Psammomys obesus gerbils. A B C 94 J Contemp Med Sci | Vol. 5, No. 2, March–April 2019: 90–95 Histological impact of nutritional style alteration in mice Original K.M Salih et al. Studies in rodents show that in the absence of obesity, the fat replacement of refined carbohydrates can weaken or inhibit ventricular expansion and contractile dysfunction in response to high blood pressure, myocardial infarction or myocardial genetic.32 Moreover, Sahraoui et al.33 showed that a relative short period of high fat diet results in sever alterations of car- diac structure. keywords: cancer; control; diet; fat; fatty; fig; group; liver; mice; weight cache: jcms-571.pdf plain text: jcms-571.txt item: #258 of 406 id: jcms-572 author: Gholizadeh, Narges; Emami Razavi, Hanieh; Jafari Haftkhani, Gholamali; Sheykhbahaei, Nafiseh title: Predictive factors of survival rate in oral squamous cell carcinoma: A retrospective study in Iran date: 2019-04-26 words: 5133 flesch: 59 summary: Despite numerous advances in the treatment of cancers, oral cancer is one of the top 10 causes of death due to delayed detection. Methods In this study, data were collected through medical records of the patients with oral cancer during 2009–2012 in the archives of the Cancer Department of the Ministry of Health of the Islamic Republic of Iran. keywords: age; cancer; carcinoma; cell; delay; patients; rate; study; survival; survival rate; weeks cache: jcms-572.pdf plain text: jcms-572.txt item: #259 of 406 id: jcms-573 author: Behadili, Suhad Faisal; Abd, Mustafa S.; Mohammed, Iyden Kamil; Al-SAYYID, Maha Mohammed title: Breast Cancer Decisive Parameters for Iraqi Women via Data Mining Techniques date: 2019-04-26 words: 5043 flesch: 53 summary: Ravi Kumar G, Ramachandra GA, Nagamani K. An efficient prediction of breast cancer data using data mining techniques. Most of them performed a comparative study of algorithm to take BC data. keywords: algorithms; attributes; breast; cancer; classification; data; diagnosis; iraqi; mining; techniques; women cache: jcms-573.pdf plain text: jcms-573.txt item: #260 of 406 id: jcms-579 author: Madadi, Soheila; Tahmasebi, Fatemeh; Khanehzad, Maryam; Kazemzadeh, Shokofeh; Hassanzadeh, Gholamreza title: Estimation of Stature from Facial indices among Iranian medical students date: 2019-04-26 words: 3653 flesch: 62 summary: 112 J Contemp Med Sci | Vol. 5, No. 2, March–April 2019: 112–116 Original Estimation of stature from facial indices among Iranian medical students Soheila Madadi, Fatemeh Tahmasebi, Maryam Khanehzad, Shokofeh Kazemzadeh, and Gholamreza Hassanzadeh* Department of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Keywords Facial height, facial width, facial index, stature Introduction Craniofacial measurement is an important part of anthro- pology and medicine that determine the morphological features of the face and head.1 Shape of face is affected by many agents, for instance, gender, race and ethnicity, nutritional, climate, socio-economic, and genetic factors.1,2 The determina- tion of facial parameters is useful in plastic surgery, forensics applications, head and face reconstruction, oral and maxillofa- cial surgery, orthodontics, clinical diagnosis and treatment planning.3–5 keywords: face; female; height; index; males; stature; students; study; width cache: jcms-579.pdf plain text: jcms-579.txt item: #261 of 406 id: jcms-580 author: Alkuraishy, Hayder M.; Al-Gareeb, Ali I.; Rasheed, Huda Abdulbaki title: Nephroprotective effect of Curcumin (Curcuma Longa) in acute nephrotoxicity in Sprague-Dawley rats date: 2019-04-26 words: 2280 flesch: 55 summary: Furthermore, curcumin significantly reduced renal tubular injury biomarkers due to significant nephroprotective effect and attenuation of gentamicin induced-nephrotoxicity as supported by Kim et al.,16 study that demonstrated administra- tion of 25 mg/kg/day of curcumin is able to reduce levels of KIM-1 and NGAL sera levels significantly in cadmium induced-nephrotoxicity due to the protective effect of curcumin on the renal tubules. This study also illustrated significant effect of gentamicin in increase KIM-1 levels as correspond with Luo et al., study that showed both KIM-1 and NGAL sera level are sensitive and specific biomarkers during gentamicin induced-nephrotox- icity. keywords: curcumin; effect; gentamicin; group; nephrotoxicity; rats cache: jcms-580.pdf plain text: jcms-580.txt item: #262 of 406 id: jcms-582 author: Yazdani, Reza; Albujeer, Ammar N. H.; Rahnama, Ebrahim; Kharazifard, Mohammad Javad title: Effect of Xylitol on Salivary Streptococcus Mutans: A Systematic Review and Meta-analysis date: 2019-04-26 words: 5133 flesch: 58 summary: Children used sucrose or xylitol chewing gum regularly for 2 months Sample at baseline and after intervention. Mutans streptococci dose response to xylitol chewing gum. keywords: age; articles; caries; effect; group; mutans; review; studies; xylitol; years cache: jcms-582.pdf plain text: jcms-582.txt item: #263 of 406 id: jcms-583 author: Jamshidnezhad, Amir; Koohmareh, Zahra; Pazahr, Ali title: Consideration of Intelligent Applications to Support Diabetic Patients: A Scoping Review for Nutrition Mobile Phone Apps date: 2020-02-26 words: 3596 flesch: 54 summary: “Exploring the far side of mobile health: information security and privacy of mobile health apps on iOS and Android”. This study presents an investi- gation of literature on a wide space of health apps for smart phones in the self-care and education for diabetics’ patients. keywords: applications; apps; criteria; diabetes; diabetic; download; google; health; mobile; patients; play cache: jcms-583.pdf plain text: jcms-583.txt item: #264 of 406 id: jcms-59 author: Bashi, Prof. Dr. Abbas Matrood title: Editorial: Journal of Contemporary Medical Sciences date: 2016-03-26 words: 161 flesch: 36 summary: Journal of Contemporary Medical Sciences In the first years of the journal life the Journal of Contemporary Medical Sciences (JCMS) acquired high successful rate and more researchers to publish with it. This journal addresses four major aspects of writing journal-style scientific papers: (1) fundamental style considerations,  (2)  a suggested strategy for efficiently writing up research results, (3) the nuts and bolts of format and content of each section of a paper (describes how to follow instructions precisely to write a scientific paper), and (4) basic information regarding peer critiques of scientific writing. keywords: journal cache: jcms-59.pdf plain text: jcms-59.txt item: #265 of 406 id: jcms-591 author: Afshar, Mohammad; Otroshi, Omid; Elahian, Elahe; Papi, Shahab; Aalipour, Razieh; Pourebrahimi, Mohammad; Fattah Moghaddam, Ladan; Kameli Morandini, Morteza; Saehiniya, Hamid title: Alcohol consumption and Types of Cancer: A Review date: 2019-10-26 words: 8337 flesch: 61 summary: Materials and Methods This study was conducted in English by February 2019 to include epidemiological evidence from all available rand- omized control trials, case-control and cohort studies reporting alcohol consumption related cancer risks through a search in data bases of the PubMed, Scopus and Web of Science. Methods This study was conducted in English by February 2019 to include studies reporting alcohol consumption related cancer risks through a search in data bases of the PubMed, Scopus and Web of Science. keywords: alcohol; alcohol consumption; alcohol drinking; alcoholic; analysis; bladder; breast; cancer; cancer risk; cohort; control; day; drinking; et al; findings; intake; j cancer; med; meta; prostate; relationship; review; risk; studies; study cache: jcms-591.pdf plain text: jcms-591.txt item: #266 of 406 id: jcms-597 author: Ashrafi-rizi, Hasan; Amraei, Mahdi; Kargar, Hossein; Ghazavi, Zahra; Kazempour, Zahra title: Identification of strategies for collaboration of medical librarians with family physicians in advancing the goals of the family physician program based on experts' viewpoints date: 2019-08-28 words: 5746 flesch: 35 summary: Sahapong S, Manmart L, Ayuvat D, Potisat S. A systematic review of the roles and competencies of medical information professionals(Mips) in evidence-based medicine in Thailand; 2006. Behavior and attitudes of residents and general practitioners in searching for health information: from intention to practice. keywords: family; family physicians; health; information; information resources; librarians; medical; patient; physicians; research; resources; training cache: jcms-597.pdf plain text: jcms-597.txt item: #267 of 406 id: jcms-598 author: Kamali, Alireza; Maktabi, Maryam; Khademi, Zoha; Fereidooni, Taha title: Comparison of the effect of dexmedmotidine and ketamine on controlling pain after cesarean section via intra-peritoneal method: dexmedmotidine and ketamine on controlling pain after cesarean section date: 2019-08-26 words: 2655 flesch: 57 summary: Postoperative pain leads to harmful effects, such as atleticas, thrombosis, ischemic myo- cardium, cardiac arrhythmias, water and electrolyte disorders, urinary retention and ileus.3,4 One of the most commonly used surgical procedures is cesarean section. It may also reduce breastfeeding and mother’s tolerance for breastfeeding.8,9 One of the most important issues in cesarean section is to reduce postoperative pain. keywords: cesarean; dexmedmotidine; group; ketamine; mean; pain; section cache: jcms-598.pdf plain text: jcms-598.txt item: #268 of 406 id: jcms-60 author: Hasan, Abdul Mahdi A. title: Parents understanding on measles: a study in Al-Elwyia paediatric hospital in Baghdad province, Iraq date: 2016-03-26 words: 4150 flesch: 52 summary: yr Count 15 17 32 χ2 = 3.293 P = 0.349 C.C. = 0.179 P = 0.349 NS % within age of child 46.9% 53.1% 100.0% % within mother’s belief 28.3% 36.2% 32.0% % of total 15.0% 17.0% 32.0% 1–4 Count 30 22 52 % within age of child 57.7% 42.3% 100.0% % within mother’s belief 56.6% 46.8% 52.0% % of total 30.0% 22.0% 52.0% 5–9 Count 8 6 14 % within age of child 57.1% 42.9% 100.0% % within mother’s belief 15.1% 12.8% 14.0% % of total 8.0% 6.0% 14.0% 10> Count 2 2 % within age of child 100.0% 100.0% % within mother’s belief 4.3% 2.0% % of total 2.0% 2.0% Gender Male Count 30 28 58 F.E.P.T. P = 0.461 C.C. = 0.030 P = 0.764 NS % within gender 51.7% 48.3% 100.0% % within mother’s belief 56.6% 59.6% 58.0% % of total 30.0% 28.0% 58.0% Female Count 23 19 42 % within gender 54.8% 45.2% 100.0% % within mother’s belief 43.4% 40.4% 42.0% % of total 23.0% 19.0% 42.0% Age of mother <20 yrs Count 2 5 7 χ2 = 9.023 P = 0.061 C.C. = 0.288 P = 0.061 NS Confidence 93.9% meaningful % within age of mother 28.6% 71.4% 100.0% % within mother’s belief 3.8% 10.6% 7.0% % of total 2.0% 5.0% 7.0% 20–29 Count 15 18 33 % within age of mother 45.5% 54.5% 100.0% % within mother’s belief 28.3% 38.3% 33.0% % of total 15.0% 18.0% 33.0% 30–39 Count 14 14 28 % within age of mother 50.0% 50.0% 100.0% % within mother’s believes 26.4% 29.8% 28.0% % of total 14.0% 14.0% 28.0% 40–49 Count 12 9 21 % within age of mother 57.1% 42.9% 100.0% 5J Contemp Med Sci | Vol. 2, No. 5, Winter 2016: 2–8 Research Parents understanding on measlesAbdul Mahdi A. Hasan et al. keywords: age; belief; believes; children; count; measles; mother; parents; pmid; study; total; vitamin cache: jcms-60.pdf plain text: jcms-60.txt item: #269 of 406 id: jcms-601 author: Khodamoradi, Kajal; Amini-Khoei, Hossein; Khosravizadeh, Zahra; Hosseini, Seyed Reza; Dehpour, Ahmad Reza; Hassanzadeh, Gholamreza title: Maternal separation can affect the reproductive system by inflammasome activation in female mice date: 2019-06-26 words: 5214 flesch: 50 summary: The evidence for the involvement of oxidative injury in the Objective The aim of this study is to investigate effect of maternal separation stress on the ovarian function in adult female mice. We concluded that maternal separation stress has harmful effects on ovarian tissue. keywords: control; expression; follicles; function; group; inflammasome; nlrp3; ovarian; percentage; production; role; ros; separation; stress; system cache: jcms-601.pdf plain text: jcms-601.txt item: #270 of 406 id: jcms-602 author: AbdulWahid, Hiba M.; Khalel, Enam A.; Alwan, Nada A.S. title: Mammographic, Ultrasonographic and Pathologic Correlations of Focal Asymmetric Breast Densities among a Sample of Iraqi Women date: 2019-06-26 words: 3740 flesch: 54 summary: The spectrum of breast asymmetries: imaging features, work-up, management. Breast ultrasound was performed for all patients by using GE machine (Voluson E6 with linear trans- ducer of frequency of 7.5–12 MHz) and ultrasound findings were also recorded (any mass or underlying suspicious area or only prominent fibroglandular tissue) and classified according to the ultrasound BI-RADS lexicon. keywords: asymmetric; breast; cancer; cases; fabd; findings; focal; mammographic; ultrasound cache: jcms-602.pdf plain text: jcms-602.txt item: #271 of 406 id: jcms-606 author: Al-Yasseri, Berq J. Hadi; Rahmah, Abbas M.; Al-Saffar, Nizar S. Shawky title: Acromegaly in Iraq: Brief Look on Epidemiology, Comorbidities and Management date: 2019-06-26 words: 3710 flesch: 51 summary: Mazziotti G, Floriani I, Bonadonna S, Torri V, Chanson P, Giustina A. Effects of somatostatin analogs on glucose homeostasis: a metaanalysis of acromegaly studies. Materials and Methods Setting This study was conducted on group of acromegalic patients attending National Diabetes Center (NDC) which represent one of the largest specialized centers in Iraq concerned with management of endocrinological diseases, including acro- megaly. keywords: acromegaly; diagnosis; disease; endocrinol; iraq; patients; pituitary; prevalence; study; treatment; years cache: jcms-606.pdf plain text: jcms-606.txt item: #272 of 406 id: jcms-607 author: Alkuraishy, Hayder M.; Al-Gareeb, Ali I.; Hussien, Nawar Raad title: Diclofenac induced-acute kidney injury is linked with oxidative stress and pro-inflammatory changes in Sprague Dawley rats date: 2019-06-26 words: 5001 flesch: 53 summary: KIM-1 serum is significantly correlated with different grades of renal damage in acute nephro- toxicity and renal injury because; it is highly sensitive and spe- cific for renal tubular toxicity40 as revealed in our study. Correlation of blood urea with biochemical parameters and renal biomarkers in diclofenac-induced AKI group compared with the control group Variables Group І Group ІІ r P r P Serum creatinine (mg/dl) 0.62 0.33 0.99 0.01** GFR (ml/min/1.37) 0.33 0.50 keywords: acute; aki; biomarkers; blood; cystatin; damage; diclofenac; group; injury; kidney; rats; renal; serum; study cache: jcms-607.pdf plain text: jcms-607.txt item: #273 of 406 id: jcms-608 author: Abdulkadim, Hind title: Advantage of day three over day two embryo transfer date: 2019-06-26 words: 3567 flesch: 57 summary: The patients were classified into two groups according to the day of embryo transfer. Conclusion A similar pregnancy rate was obtained by doing embryo transfer on days 2 and 3 after ICSI in spite of slight regression in embryo quality and higher rate of developmental delay in cases of extended culture. keywords: culture; day; embryo; pregnancy; quality; rate; study; transfer cache: jcms-608.pdf plain text: jcms-608.txt item: #274 of 406 id: jcms-609 author: Abedalrahman, Sarab K.; Ali, Besmah M.; Al-Khalidy, Najim Abid Issa; Al-Hashimi, Ali S. title: Risk factors of breast cancer among Iraqi women date: 2019-06-26 words: 3888 flesch: 65 summary: Breast cancer and hormone replacement therapy: collaborative reanalysis of data from 51 epidemiological studies of 52,705 women with breast cancer and 108,411 women without breast cancer. The importance of knowledge of breast cancer risk factors is that it helps in detecting risk group women, and then to use it in the building of breast cancer screening programs and cancer prevention programs. keywords: age; breast; breast cancer; cancer; control; factors; iraqi; risk; risk factors; study; women; years cache: jcms-609.pdf plain text: jcms-609.txt item: #275 of 406 id: jcms-61 author: Ghafel, Hawraa Hussein; Ali, Rabe'a Mohsen; AL-Rahawi, Alaa Hazeem title: Effectiveness of infertile women' commitment to implement in vitro fertilization (long/short) protocols date: 2016-03-26 words: 4044 flesch: 54 summary: 1 Cluster bar charts of final results of program and protocol types at each sample (with and without follow-up) of IVF protocol groups e. The follow-up is very important to implement the commit- ment of IVF protocols through phone and interview with the patient when they come to hospital. keywords: c.c; follow; ivf; protocol; results; significant cache: jcms-61.pdf plain text: jcms-61.txt item: #276 of 406 id: jcms-610 author: Al Mousawi, Ali; Al Ali, Basheer; Al Mousawi, Zainab title: The Prevalence of Dental Caries among students of Dentistry Colleges in Holy Kerbala Governorate/ Iraq in 2017 date: 2019-06-26 words: 5170 flesch: 63 summary: There was statistically a highly significant difference between age, sex, dental visit type and brushing behavior and DMFT.19 For similar studies in other parts of the world, a meta- analysis study in Saudi Arabia estimated DMFT in Saudi Arabia at 3.34 and the prevalence of dental caries was reported to be rising with age (91% for age group 12–19 years; and DMFT of 7.35 while, it was 98% for age group 30–45 years; and DMFT of 14.5).35 While, a study among 320 medical and dental students in Serbia in 2007 reported a mean DMFT value of 12.8 ± 4.7 with only one student with a value of zero.36 A second study in northern Brazil city said to be not served by restorative dental services, among 889 students aged 15–19 years showed that the DMFT index was 4.65 ± 0.12, and the prevalence of dental caries was 87.4%.22 Conclusion This study revealed high dental caries prevalence among dental students in Karbala Governorate with no gender differ- ence. Dental caries prevalence was 100% (none of the examined students were caries free). keywords: caries; college; dental; dentistry; health; holy; iraq; oral; prevalence; students; study; tooth cache: jcms-610.pdf plain text: jcms-610.txt item: #277 of 406 id: jcms-611 author: Ablahad, Aween Auda; Khleel, Ameera Kamal; Almahana, Jasim title: Comparison between Gingival Pyogenic Granuloma and Peripheral Giant Cell Granuloma by Immunohistochemical Detection of CD34 and Alpha Smooth Muscle Actin date: 2019-06-26 words: 3739 flesch: 51 summary: The aim of this research was to study the immunohistochemical expressions of CD34 and α-SMA for gingival pyogenic granuloma in comparison with peripheral giant cell granuloma. They were retrieved from the archives of Rizgary Teaching Hospital, Erbil (Ministry of Health, Kurdistan Region of Iraq) in the period between January, 2013 and Objectives The aim of this research was to study the clinical and the immunohistochemical expressions of CD34 and alpha smooth muscle actin (α-SMA) for gingival pyogenic granuloma in comparison with peripheral giant cell granuloma. keywords: blood; cd34; cell; granuloma; pgcg; pyogenic; sma; vessels cache: jcms-611.pdf plain text: jcms-611.txt item: #278 of 406 id: jcms-612 author: Al-Jumaily, Usama; Al-Safi, Rasha; Al-Mosawi, Sabah; Al-Obaidy, Homam; Fawzi, Mohammed title: Clinico-pathological spectrum of Childhood Central Nervous System Tumors in Iraq: A Single-Institutional Study date: 2019-08-28 words: 3756 flesch: 52 summary: The present study therefore attempts to profile the clinico-patho- logical features of pediatric CNS tumors (according to the WHO classification) at a single tertiary center in Iraq. 3 5.6 Optic nerve 3 5.6 Pineal gland 1 1.9 Total 54 100.0 Table 2 Frequency and percentage of pediatric CNS tumors according to histological type Histology Frequency Percentage Medulloblastoma 20 37.0 Pilocytic astrocytoma 16 29.6 HGG 6 11.1 CNS germinoma 5 9.3 Supratentorial PNET 2 3.7 Ependymoma 2 3.7 Pineoblastoma 1 1.9 Oligodendroglioma 1 1.9 Choroid plexus carcinoma 1 1.9 Total 54 100.0 PNET, primitive neuroectodermal tumors; HGG, high grade gliomas; CNS, central nervous system Original 199J Contemp Med Sci | Vol. 5, No. 4, July-August 2019: keywords: brain; chemotherapy; cns; iraq; patients; pediatric; study; surgery; system; tumors cache: jcms-612.pdf plain text: jcms-612.txt item: #279 of 406 id: jcms-615 author: Alsallal, Muna; Sharif, Mhd Saeed; Hadi, Bydaa; Albadry, Ruwaida title: Decision support detection system for lung nodule abnormalities based on machine learning algorithms date: 2019-06-26 words: 4061 flesch: 52 summary: Keywords machine learning, lung cancer, lung nodule, detection system, classification, image processing, SVM ISSN 2413-0516 166 J Contemp Med Sci | Vol. 5, No. 3, May–June 2019: 165–169 Detection system for lung nodule abnormalities based on machine learning algorithms Original M. Alsallal et al. 165J Contemp Med Sci | Vol. 5, No. 3, May–June 2019: 165–169 Original Decision support detection system for lung nodule abnormalities based on machine learning algorithms Muna Alsallal,a* Mhd Saeed Sharif,b Bydaa Hadi,a and Ruwaida Albadrya aSamawa Technical Institute, ALfurat Alawsat Technical University, Iraq. keywords: algorithms; classification; detection; features; images; kernel; learning; lung; machine; nodules; system; techniques cache: jcms-615.pdf plain text: jcms-615.txt item: #280 of 406 id: jcms-62 author: Salih, Khalid Mahdi; AL-Mosawy, Wafaa Fawzi title: Influence of blood transfusion rate on some clinical manifestations in β-thalassaemia major patients date: 2016-03-26 words: 4184 flesch: 61 summary: Age (years) 12.8 ± 1.7 22.9 ± 1.5 20.2 ± 1.08 <0.0001 BMI (kg/m2) 17.2 ± 0.73 21.8 ± 0.68 21.9 ± 1.07 0.00011 Transfusion rate (times/ year) 13.7 ± 0.54 19.4 ± 0.35 24.4 ± 0.69 <0.0001 Ferritin (ng/ml) 2951 ± 500 3368 ± 663 3204 ± 554 0.869 TSB (mg/dl) 2.03 ± 0.43 1.97 ± 0.36 2.05 ± 0.22 0.990 GPT (U/l) 28.3 ± 3.8 58 ± 16.9 26.4 ± 5.9 0.071 GOT (U/l) 40.2 ± 3.3 59 ± 14.2 29.4 ± 4.4 0.077 ALP (U/l) 170.6 ± 17.1 119.7 ± 12.6 151.3 ± 26.5 0.151 Alb (g/dl) 4.47 ± 0.06 4.44 ± 0.04 4.57 ± 0.07 0.366 TP (g/dl) 7 ± 0.16 7.6 ± 0.11 7.2 ± 0.18 0.046 Table 3. Distribution of gender and blood groups among patients groups and their statistical significance Character G1 (n = 16) G2 (n = 14) G3 (n = 12) Chi-square P value Gender Male 8 (50%) 5 (35.7%) 4 (33.3%) Correlation between serum bilirubin and serum ferritin level in thalassaemia patients. keywords: blood; groups; hcv; iron; liver; normal; patients; thalassaemia; transfusion cache: jcms-62.pdf plain text: jcms-62.txt item: #281 of 406 id: jcms-620 author: Njoku, Charles Obinna; Odusolu, Patience; Cajetan, Emechebe; Ekanem, Emmanuel; Njoku, Amarachukwu title: Umbilical cord length and cord abnormalities in term singleton pregnancy: A Review of pregnancy outcome in a tertiary health institution in Nigeria date: 2019-10-26 words: 5164 flesch: 58 summary: There was positive correlation between fetal weight and umbilical cord length. In our locality, there is scarcity of data on umbilical cord length and cord abnormalities with relation to feto-maternal outcome. keywords: abnormalities; cord; cord length; length; outcome; short; study; umbilical; weight cache: jcms-620.pdf plain text: jcms-620.txt item: #282 of 406 id: jcms-621 author: Al-Shuhayeb, Muna; Ghaznavi, Dara; Parandeh Shirvan, Hoda; Ghasemianpour, M; Khoshnevisan, MH title: Prevalence of dental trauma in 5-6, 12 and 15-year-old children in Iran date: 2019-08-26 words: 4312 flesch: 63 summary: The prevalence of dental trauma in boys is often twice the rate in girls due to their higher outdoor and sport activities.1 Dental trauma may vary in severity from a small enamel crack to complete avulsion of involved teeth. 202 J Contemp Med Sci | Vol. 4, No. 4, July-August 2019: 202–207 Prevalence of dental trauma in 5- to 6-, 12-, and 15-year-old children in Iran Muna Al-Shuhayeb,1 Dara Ghaznavi,2 Hoda Parandeh Shirvan,1 keywords: age; boys; children; dental; girls; iran; prevalence; trauma; year cache: jcms-621.pdf plain text: jcms-621.txt item: #283 of 406 id: jcms-622 author: Ahmadi, Fatemeh; Hajihashemi, Saeed; Rahbari, Ali; Ghanbari, Fatemeh title: Therapeutic Effects of Hydralazine on Renal Ischemia-Reperfusion Injury in Rat. date: 2019-12-26 words: 6512 flesch: 59 summary: Remote ischemic perconditioning attenuates ischemia/ reperfusion‐induced downregulation of AQP2 in rat kidney. (a) Control group with glomerular and normal tubular structure (×40); (b) I-R group with tubular cell necrosis, formation of protein casts inside the tubule lumen, cells scattering into the tubule lumen, vacuolation of tubular cells, increased Bowman’s space and reduced number of red blood cells in glomerulus (×40); (c) sham group with tubular cell necrosis (×40); (d) Hydralazine group with increased Bowman’s space, vacuolation of tubular cells and reduced tubular cell necrosis (×40). keywords: blood; control; control group; group; hydralazine; injury; kidney; r group; rats; renal; reperfusion; sham; sodium; vs. cache: jcms-622.pdf plain text: jcms-622.txt item: #284 of 406 id: jcms-625 author: Rafie, Forouzan; Torabi, Molook; Taheri, Ali; Mellat, Zahra title: Assessment of Quality of Life among Head and Neck Cancer Patients: Quality of Life among Head and Neck Cancer Patients date: 2020-02-26 words: 3884 flesch: 65 summary: The need for effective interventions to improve the health-related QOL of cancer patients is widely recognized.18 The mean age of the patients in this study was 40.00±14.30, which is lower than the age range reported in other works.2, 19 The impact of radiotherapy on quality of life for cancer patients: a longitudinal study. keywords: cancer; head; life; neck; neck cancer; oral; pain; patients; qol; quality; study; treatment cache: jcms-625.pdf plain text: jcms-625.txt item: #285 of 406 id: jcms-63 author: Kadium, Dalal Abdul Hussain; Kaem, Ghsoon Ghanem; Al Saeq, Zaineb Mehdi; Al Safar, Zaineb Assim title: The relationship between male testosterone hormone and some female hormones in women with polycystic ovary syndrome (PCOS) date: 2016-03-26 words: 4444 flesch: 60 summary: Banaszewska B, Spaczynski RZ, Pelesz M, Pawelczyk L. Incidence of elevated LH/FSH ratio in polycystic ovary syndrome women with normo- and hyperinsulinemia. 20 J Contemp Med Sci | Vol. 2, No. 5, Winter 2016: 20–24 Research Objectives This study was designed to determine the levels of hormones insulin, testosterone and some female hormones in some male and female hormones in patients with polycystic ovary syndrome (PCOS) and find the relationship between the male testosterone hormone and female hormones in patients with PCOS and to know the reasons for these changes in view of the prevalence of PCOS and its importance as a major problem affecting the health of women and her fertility. keywords: clin; endocrinol; fsh; hormone; insulin; metab; ovary; patients; pcos; relationship; syndrome; testosterone; women cache: jcms-63.pdf plain text: jcms-63.txt item: #286 of 406 id: jcms-634 author: Seyedmajidi, Maryam; Nafarzadeh, Shima; Rayani, Arezoo; Moslemi, Dariush; Bijani, Ali; Sharbatdaran, Majid title: Immunohistochemical Expression of SIRT1 in Oral Squamous Cell Carcinoma and its Relationship with Clinical-Pathological Factors date: 2019-10-26 words: 3784 flesch: 60 summary: Immunohistochemical expression of SIRT1 in oral squamous cell carcinoma Required information including age, sex, location of tumor, smoking, clinical tumor stage, grade of tumor, neck lymph node metastasis, and distant metastasis were obtained from their pathological reports or during contact with patients. 248–253 Immunohistochemical expression of SIRT1 in oral squamous cell carcinoma M. Seyedmajidi et al. Table 1. keywords: cancer; carcinoma; cells; core; expression; mucosa; oscc; sirt1; squamous; staining; tumor cache: jcms-634.pdf plain text: jcms-634.txt item: #287 of 406 id: jcms-635 author: Al-Shuhayeb, Muna; Meymandi, Mansour; Talebi Ardakani, Mohammad Reza; Amid, Reza; Poursafar, Farzaneh; Rahimi, Hossein Mohammad; Al-Maawi, Sarah; Ghanaati, Shahram; Moscowchi, Anahita title: Application of Platelet Rich Fibrin in the Regeneration of Intra Oral Defects: A Systematic Review date: 2019-08-26 words: 25640 flesch: 72 summary: 170–188 Review Application of platelet rich fibrin in the regeneration of intra oral defects: a systematic review Muna Al-Shuhayeb,1 Mansour Meymandi,1 Mohammad Reza Talebi Ardakani,1 Keywords platelet rich fibrin, bone regeneration, periodontal defects, sinus floor augmentation ISSN 2413-0516 171J Contemp Med Sci | Vol. 5, No. 4, July-August 2019: keywords: al e; co m; e m; e t; fibrin; g ro; ic al; io n; m ea; m m; m o; n o; platelet; prf; r m; r t; s w; th s; tio n cache: jcms-635.pdf plain text: jcms-635.txt item: #288 of 406 id: jcms-636 author: Kaviani, Hanieh; Khayamzadeh, Mina title: The application of salivary gland scintigraphy in quantitative analysis of xerostomia as a frequent salivary gland dysfunction: A review article date: 2019-08-26 words: 6954 flesch: 51 summary: However, salivary gland scintigraphy enables the quantitative assessment of salivary glands’ parenchymal func- tion after radioiodine therapy in differentiated thyroid cancer management. It is specified by its capability in variability of intraindividual observer, also by reproducibility that makes possible the detection of variations in function of parenchyma in a little scope of 5–10%.52 This provides the initial detection of the syndrome of Sjögren’s and impaired parenchyma of sal- ivary glands that are caused due to radioiodine therapy.53 Con- sequently, salivary gland scintigraphy could be applied as an adequate imaging technique for quantitative assessment of parenchymal function of salivary gland. keywords: assessment; cancer; dysfunction; gland; gland scintigraphy; head; med; mouth; neck; oral; patients; radiation; radiotherapy; review; salivary; salivary gland; scintigraphy; sgs; syndrome; xerostomia cache: jcms-636.pdf plain text: jcms-636.txt item: #289 of 406 id: jcms-64 author: Amen, Muhammad Rashid title: Assessment of hypertensive patients' knowledge about lifestyle risk factors and warning signs of stroke date: 2016-03-26 words: 4046 flesch: 49 summary: Of patients, 17.5% only identified physical inactivity as stroke risk factors, fol- lowed by obesity and smoking and tobacco use was 39.5%, excessive alcohol intake came third was 42.1%, and unhealthy diet had greatest percentage among lifestyle stroke risk factor was 43%. Recommendations Our study results recommended that there was a need to bring high risk group awareness about stroke risk factors and warning signs, particularly to the population with hypertension. keywords: factors; hypertensive; knowledge; lifestyle; patients; risk; signs; stroke; study; warning cache: jcms-64.pdf plain text: jcms-64.txt item: #290 of 406 id: jcms-646 author: Wohaib, Ameer Zuhair; Maraie, Nidhal K.; Jassim, Gaith A. title: Application of PLGA-ion exchange resin microcapsules of sulfasalazine ‎for embolization therapy date: 2019-10-26 words: 5189 flesch: 52 summary: DEAE sephadex A­25 is one type of the anion exchange resins, which is a weak base in nature and it is biocompatible so it is suitable for formation of complex with sulfasalazine.24 DRC was pre­ pared previously in our laboratory but it needs further optimi­ zation, therefore in this study DRC 1:8 was prepared and its entrapment efficiency was 72% which is higher than lower drug:resin ratio since the increase in the amount of resin lead to increase in the number of chemical equivalent that available for ionic exchange per unit weight or volume of resin.25 In vitro Dissolution Study for the Prepared Drug–Resin Complex Figure 1 shows the cumulative percent of drug release for the prepared drug:resin ratio (1:8). The initial burst effect may be due to the pres­ ence of some drug particles on the surface of the microspheres, which can be considered as a desired effect to ensure the initial therapeutic action of drug.31 It was also observed that the drug release from F17 (containing resinate:PLGA ratio 1:2) showed significantly lower drug release than F21 (containing resin­ ate:PLGA ratio 2:1) since the drug release rates decreases as the amounts of polymer increases which may create thicker coat around the particles in the microcapsules.32,33 While F19 (containing resinate:PLGA ratio 1:1) showed no significant decrease in drug release in comparison to F21, but F19 showed Fig. keywords: drug; effect; efficiency; embolization; encapsulation; exchange; ion; microcapsules; percent; plga; ratio; release; resin; resinate; sulfasalazine; yield cache: jcms-646.pdf plain text: jcms-646.txt item: #291 of 406 id: jcms-65 author: Nafarzadeh, Shima; Mozaffari, Fatemeh; Khakbaz, Oveis title: A Case Report of Gorlin-goltz Syndrome date: 2016-04-13 words: 1914 flesch: 58 summary: Tarakji B, Baroudi K, Hanouneh S, Azzeghaiby S, Nassani M. Possible recurrence of keratocyst in nevoid basal cell carcinoma syndrome: a review of literature. Treating nevoid basal cell carcinoma syndrome. keywords: basal; case; cell; goltz; gorlin; multiple; syndrome cache: jcms-65.pdf plain text: jcms-65.txt item: #292 of 406 id: jcms-657 author: Shayan, Maryam; Mehrannia, Kobra; Rastegar, Tayebeh; Khanehzad, Maryam; Ghantabpour, Taha; Hassanzadeh, Gholamreza title: Teratogenic effect of the aqueous extract of the Foeniculum vulgare (fennel) on fetal development in mice date: 2019-10-26 words: 3955 flesch: 55 summary: F. vulgare seeds were milled with an electrical mill. F. vulgare is a perennial herb with yellow flowers and feathery leaves that falls within the family of Apiaceae.6 F. vulgare is called “Raziane” in Iranian traditional medicine and has been used in both medicine and food preparation since ancient times. keywords: effect; extract; fennel; fetuses; foeniculum; group; mice; number; study; vulgare cache: jcms-657.pdf plain text: jcms-657.txt item: #293 of 406 id: jcms-658 author: Al-Khafaji, Ahmed Salim Kadhim; Alnefaie, Ghaliah; Al-Shammari, Ahmed Majeed title: Valproic acid enhances the paclitaxel activity in respiratory tract cancer cells date: 2019-08-26 words: 3424 flesch: 54 summary: Duarte ML, de Moraes E, Pontes E, Schluckebier L, de Moraes JL, Hainaut P, et al. Role of p53 in the induction of cyclooxygenase-2 by cisplatin or paclitaxel in non-small cell lung cancer cell lines. MTT analysis of VPA exposure of lung cell lines (A549 and SKLU1) and the second most paclitaxel resistant oral cancer cell line (BHY) demonstrated that these cells are resistant to very high VPA micro-molar concentrations (Fig. 1) with IC50s of 6.63 mM of A549, 20 mM of SKLU1 and 2.1 mM of BHY) (Table 1) at 95% CI. keywords: cancer; cell; dna; epigenetic; lines; lung; p53; paclitaxel; vpa cache: jcms-658.pdf plain text: jcms-658.txt item: #294 of 406 id: jcms-659 author: Mohammed, Dahlia Raouf; Alwan, Nada A.S.; Hussein, Raji title: Immunohistochemical Assessment of Estrogen, Progesterone Receptors and HER2-neu Over Expression by Core Needle Biopsy in a Sample of Iraqi Breast Cancer Patients date: 2019-08-26 words: 2948 flesch: 53 summary: Amplification or over-ex- pression of the ERBB2 gene occurs in approximately 30% of breast cancers and is associated with increased disease recurrence and a worse prognosis.10 Signaling through the ErbB family of receptors promotes cell proliferation and opposes apoptosis, and therefore must be tightly regulated to prevent uncontrolled cell growth.11 Core needle biopsy (CNB), also called Tru-cut biopsy, is widely accepted in routine assessment for the diagnosis of breast cancer. 214 J Contemp Med Sci | Vol. 4, No. 4, July-August 2019: 214–217 Immunohistochemical assessment of estrogen, progesterone receptors and HER2/neu overexpression by core needle biopsy in a sample of Iraqi breast cancer patients Dahlia Raouf Mohammed,1 Nada A.S. Alwan,2 and Raji Hussein1 1Medical City, Ministry of Health, Baghdad, Iraq. keywords: breast; cancer; cases; correlation; expression; her2; neu; patients cache: jcms-659.pdf plain text: jcms-659.txt item: #295 of 406 id: jcms-66 author: Shadmehr, Azadeh; Hejazia, S. Maryam; Olyaei, Gholamreza; Talebian, Saeid title: Effect of Countermovement and Arm Swing on Vertical Stiffness and Jump Performance date: 2016-03-26 words: 2665 flesch: 67 summary: The mechanisms that enable arm motion to enhance vertical jump performance: a simulation study. Only one study has investigated the contribution of stiffness to vertical jump performance.5 keywords: arm; countermovement; force; jump; performance; stiffness; swing; time; vertical cache: jcms-66.pdf plain text: jcms-66.txt item: #296 of 406 id: jcms-661 author: Jalal, Aveen Ageel; AL-Qassab, Zewar A.; AL-Rawi, Rafel A. title: Effects of the Systemic Administration of Omega -3 Polyunsaturated Fatty Acid on Experimental Periodontitis date: 2019-08-26 words: 6254 flesch: 63 summary: The relation of serum MDA (mean ± standard deviation) between different studied treatments groups Groups MDA (ng/ml) 3 h p-Value 24 h p-Value 3 days p-Value 1 Week p-Value 2 Weeks p-Value P/W 32.8 ± 1.303 0.012 32.4 ± 1.516 0.012 31.6 ± 1.14 0.012 31.2 ± 1.303 0.012 30.6 ± 0.894 0.012 P/SRP 27.54 ± 1.143 26.34 ± 1.275 26.94 ± 1.190 26.74 ± 1.26 26.34 ± 1.768 P/W 32.8 ± 1.303 0.012 32.4 ± 1.516 0.012 31.6 ± 1.14 0.012 31.2 ± 1.303 0.012 30.6 ± 0.894 0.012 P/EPA 26.44 ± 1.43 26.54 ± 1.28 26.34 ± 1.275 26.14 ± 1.41 25.74 ± 0.859 P/W 32.8 ± 1.303 0.012 32.4 ± 1.516 0.012 31.6 ± 1.14 0.012 31.2 ± 1.303 0.012 30.6 ± 0.894 0.012 P/SRP + EPA 26.5 ± 1.903 25.94 ± 1.663 26.34 ± 1.275 25.34 ± 1.08 25.14 ± 1.431 P/SRP 27.54 ± 1.143 0.920 26.34 ± 1.275 0.920 26.94 ± 1.190 0.920 26.74 ± 1.26 0.920 26.34 ± 1.768 0.347 P/EPA 26.44 ± 1.43 26.54 ± 1.28 26.34 ± 1.275 26.14 ± 1.41 25.74 ± 0.859 P/SRP 27.54 ± 1.143 0.920 26.34 ± 1.275 0.674 26.94 ± 1.190 0.920 26.74 ± 1.26 0.920 26.34 ± 1.768 0.250 P/SRP + EPA 26.5 ± 1.903 25.94 ± 1.663 26.34 ± 1.275 25.34 ± 1.08 25.14 ± 1.431 P/EPA 26.44 ± 1.43 0.400 26.54 ± 1.28 0.603 26.34 ± 1.275 0.920 26.14 ± 1.41 0.920 25.54 ± 0.841 1.00 P/SRP + EPA 26.50 ± 1.903 25.94 ± 1.663 26.34 ± 1.275 25.34 ± 1.08 25.74 ± 0.859 Serum CRP (mean ± standard deviation) in normal control/water treatment group in relation with all studied groups Groups CRP (ng/ml) 3 h p-Value 24 h p-Value 3 days p-Value 1 Week p-Value 2 Weeks p-Value NC/W 11.81 ± 1.186 0.012 11.61 ± 1.328 0.012 11.41 ± 1.104 0.012 11.61 ± 1.843 0.012 11.81 ± 1.177 0.012 P/W 14.61 ± 0.354 14.81 ± 1.18 14.56 ± 1.876 13.954 ± 1.45 13.093 ± 0.963 keywords: alp; crp; epa; epa treatment; group; periodontal; periodontitis; serum; srp; study; treatment; value cache: jcms-661.pdf plain text: jcms-661.txt item: #297 of 406 id: jcms-668 author: Al-Khayat, Amina; Al-Hadithi, Tariq S title: Satisfaction with focused and risk approach antenatal care services among pregnant women attending primary health care centers in Erbil city date: 2019-12-26 words: 4024 flesch: 63 summary: Methods This cross-sectional study was conducted at two primary health care centers in Erbil city, one provides focused antenatal care services and the other provides risk approach antenatal care services. Further improvement of focused antenatal care services in Erbil is required. keywords: anc; antenatal; care; health; nazdar; phcc; satisfaction; services; women cache: jcms-668.pdf plain text: jcms-668.txt item: #298 of 406 id: jcms-672 author: Njoku, Charles Obinna; Njoku, Amarachukwu Nnaemezie; Efiok, Efiok Eyo title: Uterovaginal Prolapse: The Sociodemographic profile and reproductive health service uptake in A Low Resource Setting, Calabar, Nigeria date: 2020-02-26 words: 2462 flesch: 53 summary: Risk factors for genital prolapse include repeated deliveries, difficult vaginal deliveries, increase intra-abdominal pressure, and estrogen withdrawal as in post-menopausal women.7–9 Three degrees of uterovaginal prolapse are described and the level of the cervix (the lowest and dependent part) is assessed while the patient is straining. Therefore, this study was designed to determine the prevalence, sociodemographic characteristics, utilization of reproductive health services, and health-seeking attitude of patients with uterovaginal prolapse in University of Calabar Teaching Hospital, south-south, Nigeria. Methods and Materials This was a retrospective descriptive study of women who pre- sented with genital prolapse in University of Calabar Teaching Hospital over a 10-year period from May 1, 2009 to June 1, 2019. keywords: genital; health; prolapse; services; women; years cache: jcms-672.pdf plain text: jcms-672.txt item: #299 of 406 id: jcms-673 author: Abdollahpour, Abolfazl; Hosseinzadeh Zoroufchi, Babak; Soltany, Setareh title: Investigating the partial pressure of carbon dioxide (CO2) in the respiratory gases in Laparoscopic Gallbladder Surgery and comparing it with Arterial Partial Pressure of Carbon Dioxide: partial pressure of carbon dioxide (CO2) in the respiratory gases date: 2019-12-26 words: 3028 flesch: 53 summary: Conclusion There was a strong correlation between ETCO 2 results from capnography and PaCO 2 from ABG and to monitor carbon dioxide retention, capnography can be used as an alternative to ABG for laparoscopic gallbladder surgery patients. In this study, systolic blood pressure (SBP) and diastolic blood pressure (DBP) and mean arterial blood pressure (MAP) were reported as 18, 76, and 90, respectively. keywords: arterial; co2; end; laparoscopic; paco2; patients; pressure; surgery cache: jcms-673.pdf plain text: jcms-673.txt item: #300 of 406 id: jcms-680 author: Dehghanian, D; Heydarpoor, P; Namdari, M; Khoshnevisan, MH title: Developing an innovative clinical governance assessment framework for Dental Schools in Iran date: 2019-12-26 words: 3452 flesch: 46 summary: Key words dental clinical governance, dental schools, validation, questionnaire, framework 310 Original Developing an innovative clinical governance assessment framework Dehghanian et al. J Contemp Med Sci | Vol. 5, No. 6, November–December 2019: The “Medical Practitioners and Dentists board” in Kenya developed a national training and QA standards for dental schools and teaching hospitals including: governance and management, academic program, physical infrastructure, human resources, student affairs, program monitoring, and evaluation, as well Developing an innovative clinical governance assessment framework for dental schools in Iran Dehghanian D,a Heydarpoor P,b Namdari M,a Khoshnevisan MHc aCommunity Oral Health Department, School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran. bSchool of Management and Medical Education Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran. cPreventive Dentistry Research Center, Research Institute of Dental Sciences, School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Correspondence to Khoshnevisan MH (mh.khoshnevisan@sbmu.ac.ir ) (Submitted: 07 July 2019 – Revised version received: 18 August 2019 – Accepted: 26 August 2019 – Published online: 26 December 2019) keywords: care; clinical; dental; framework; governance; health; quality; schools; validity cache: jcms-680.pdf plain text: jcms-680.txt item: #301 of 406 id: jcms-681 author: Mirgalobayat, Shahla; Ghahari, Laya; Allahqoli, Leila; Saadat Mostafavi, Seyed Reza; Safari, Katayoun; Rikhtehgar, Masih; RamezanGhorbani, Ali; Madadian, Mohmoodreza title: Evaluation of the link between pelvimetry based on computed tomography and predicting status’ delivery date: 2019-12-26 words: 2984 flesch: 54 summary: Although cesarean delivery rate is increased in last decades.5–8 The result of recent studies showed that rate of cesarean is raised.9–12 In normal female pelvis, a longer diameter of the inlet (the transverse diameter) and a longer diameter of the midpelvis (the anteroposterior diameter) are placed perpendicularly. The cesarean-section is also called cesarean delivery. keywords: cesarean; conjugate; delivery; diameter; pelvimetry; pelvis; section; study; women cache: jcms-681.pdf plain text: jcms-681.txt item: #302 of 406 id: jcms-682 author: Dar-Odeh, Najla; Abu-Hamamd, Osama title: Ferritin level may be a major factor in young females with recurrent aphthous stomatitis date: 2019-10-26 words: 1691 flesch: 57 summary: Although etiology of RAS is not well-determined yet, nutritional and psychosocial factors have been suggested in a certain category of patients.3 A small percentage of RAS patients (5–10%) show low serum levels of iron, folate, zinc, or vitamins B1, B2, B6 and B12 indicating that nutritional deficiency is apparently an etiological factor for RAS.3 It had been suggested that hematologic screening of RAS patients for anemia or deficiency of iron, folate, and B vitamins is appro- priate for patients with major RAS or cases of minor RAS that worsen during adult life.1 keywords: deficiency; ferritin; iron; patients; ras; serum cache: jcms-682.pdf plain text: jcms-682.txt item: #303 of 406 id: jcms-683 author: AlSafi, Rasha Abd Alraouf Neama; Alqanbar, Mohammed F.; Al-Sabbagh, Wafaa Redha Mohammed title: Premalignant changes associated chronic gastritis in Karbala Province: multi institutional study date: 2019-10-26 words: 3732 flesch: 55 summary: The cur- rent study show that there is a significant negative relationship between H. pylori infection and gastric intestinal metaplasia in that 4.8% of patients presented with H. pylori infection were diagnosed to have intestinal metaplastic changes in compar- ison to 13.8% of cases without H. pylori infection show intes- tinal metaplasia on examination. The prevalence of H. pylori infection has been recorded from multiple Middle Eastern countries such as Iraq, Iran, Turkey, Libya, Egypt, Bahrain, Oman, Saudi Arabia, and the United Arab Emirates. keywords: atrophy; cancer; changes; gastric; infection; metaplasia; patients; pylori; study cache: jcms-683.pdf plain text: jcms-683.txt item: #304 of 406 id: jcms-684 author: Ghaznavi, Aisan; Ghaznavi, Dara; Valizadeh, Solmaz; Vasegh, Zahra; Al-Shuhayeb, Muna title: Accuracy of Linear Measurements Made on Cone Beam Computed Tomography Scans at Different Magnifications date: 2019-10-26 words: 3651 flesch: 47 summary: Reliability of pin diameter measurements at all magnifications was below the acceptable range, whereas it was good at 200% magnification for pin length measurements. Interobserver reliability of pin length measurements was good at 200% magnification, while it was below the acceptable range at other magnifications. keywords: accuracy; beam; cbct; cone; linear; magnifications; measurements; pin; study; tomography cache: jcms-684.pdf plain text: jcms-684.txt item: #305 of 406 id: jcms-685 author: Al-khayat, Zakarea Abdullah Yaseen; Agha, Nabaz Fisal Shakir; Alharmni, Kawthar Ibrahim Fatah title: Gender differences in the severity and features of lesions among Cutaneous Leishmaniasis patients date: 2019-12-26 words: 4945 flesch: 53 summary: Gender differences in the severity and features of lesions among cutaneous leishmaniasis patients Zakarea Abdullah Yaseen Al-khayat,a Nabaz Fisal Shakir Agha,b Kawthar Ibrahim Fatah Alharmnic aDepartment of Microbiology, College of Medicine, Hawler Medical University, Erbil, Iraq. 2 Amastigote from cutaneous lesion, Giemsa stain 100 X. 340 Original Gender differences in the severity and features Zakarea Abdullah Yaseen Al-khayat et al. J Contemp Med Sci | Vol. 5, No. 6, November–December 2019: keywords: cells; cutaneous; differences; erbil; gender; immune; leishmaniasis; lesion; number; patients; severity; sex; study; total cache: jcms-685.pdf plain text: jcms-685.txt item: #306 of 406 id: jcms-69 author: Sagt, Kareem R.; Qassim, Wissam J.; Abed, Rajaa Ibrahim title: Assessment of psychosocial aspects of patients with rectal cancer under chemotherapy in Baghdad city date: 2016-06-30 words: 4750 flesch: 66 summary: 38 J Contemp Med Sci | Vol. 2, No. 6, Spring 2016: 36–41 Effect of chemotherapy on rectal cancer patients Research Wissam J. Qassim et al. live in rural house and 90% of patients were married. 40 J Contemp Med Sci | Vol. 2, No. 6, Spring 2016: 36–41 Effect of chemotherapy on rectal cancer patients keywords: cancer; chemotherapy; effect; life; patients; quality; significant; study cache: jcms-69.pdf plain text: jcms-69.txt item: #307 of 406 id: jcms-690 author: Zalzala, Sarah Haider; Al-Lami, Faris H.; Fahad, Khalid Saeed title: Epidemiological profile of type 1 diabetes among primary school children in Baghdad, Iraq date: 2020-02-26 words: 3337 flesch: 67 summary: (Submitted: 23 November 2019 – Revised version received: 02 December 2019 – Accepted: 12 January 2020 – Published online: 26 February 2020) Objectives To estimate the prevalence of type 1 diabetes mellitus in primary school children in Baghdad City, and to evaluate its effect on growth of those children. 14 Original Epidemiological profile of type 1 diabetes among primary school children Sarah Hayder Zalzala et al. J Contemp Med Sci | Vol. 6, No. 1, January–February 2020: 13–16 and Prevention (CDC) growth charts were used.8The second questionnaire is translated to Arabic language and was sent to parents of the diabetic group only, to gather information about disease variables: Clinical presentation for DM (classic new onset of chronic polydipsia, polyuria, and weight loss); diabetic ketoacidosis; or asymptomatic incidental discovery,9 the duration of DM in year(s), the age at onset of diabetes (early onset diabetes has been variously defined as occurring any- where from age 4 to age 7 years,10 blood glucose monitoring (less than four, four, or more than four times per day) and whether a glucometer in the house was available or not, family history of T1DM, the no. of follow up visit(s) for PHCC, Diabetic cen- ter or private doctor in the last 6 months (routine follow-up should be performed at least four times a year,11 number of ER visits and hospital admission in the last 6 months, and the value of the last HbA1C test for each child were all inquired. keywords: children; diabetes; med; mellitus; phcc; prevalence; school; study; type cache: jcms-690.pdf plain text: jcms-690.txt item: #308 of 406 id: jcms-70 author: Al-Tu’maa, Fadhil Jawad; Abd-Yasera, Zainab Abdul-Hussein; Al-Naffi, Karim Obais title: Association between hs-CRP levels and the severity of coronary atherosclerosis date: 2016-06-30 words: 2908 flesch: 59 summary: Keywords high sensitive C-reactive protein (hs-CRP), coronary arteries disease (CAD), body mass index (BMI) Association between hs-CRP levels and the severity of coronary atherosclerosis Fadhil Jawad Al-Tu’maa, Zainab Abdul-Hussein Abd-Yasera, Karim Obais Al-Naffib Introduction Coronary heart disease is the most prevalent chronic disease and the main leading cause of death in the world, with more than half a million newly diagnosed coronary artery disease (CAD) patients each year.1,2 Cardiac catheterisation and coro- nary angiography are often important for definitive evaluation of coronary artery anatomy, the presence of evaluation of CADs and the presence of interventional therapy.3 The use of biomarkers as a tool for the diagnosis of plaque rupture has generated great interest in clinicians due to their promise to either ‘rule-in’ or ‘rule-out’ acute coronary syn- dromes (ACS).4 There is strong evidence that cardiovascular conditions are linked to inflammation. Serum levels of hs-CRP were measured in patients with CAD before entering into the catheterisation room. keywords: cad; crp; disease; patients; pmid; vessel cache: jcms-70.pdf plain text: jcms-70.txt item: #309 of 406 id: jcms-702 author: Mohammadi Farsani, Gholamreza; Yaghubi-tabar, Reza; Mohammadi Farsani, Taiebeh title: Recombinant Allergens in Immunotherapy of Asthma date: 2020-06-26 words: 6770 flesch: 46 summary: Many patients with extrinsic asthma may respond to immunother- apy such as using of recombinant allergens. The most important strategy is production of recombinant allergens. keywords: allergens; allergy; antigen; asthma; binding; cells; clin; diagnosis; expression; food; ige; immunol; immunotherapy; med; natural; new; plant; production; proteins; recombinant; strategies; system; treatment; vaccines cache: jcms-702.pdf plain text: jcms-702.txt item: #310 of 406 id: jcms-709 author: Mohammadi Farsani, Gholamreza; Naseri, Mohsen; Hosseini, Saeed; Saboor-Yaraghi, Ali Akbar; Kamalinejad, Mohammad; Mohammadi Farsani, Taiebeh; Dorosti Motlagh, Ahmadreza; Movahhed, Mina title: The Evaluation of basic and neurohormonal parameters in hot or cold temperament person proposed in Iranian Traditional Medicine: an observational study: Hot and cold temperaments in Iranian Traditional Medicine date: 2020-08-26 words: 4132 flesch: 51 summary: T3 and TSH levels were respectively, 1.99 and 1.26 in cold temperament individuals and 1.38 and 1.40 in hot temperament individuals (P<0.05). Ten men had hot temperament and 10 had cold temperament. keywords: bmr; body; cold; group; iran; medicine; rate; sciences; study; tehran; temperament; university cache: jcms-709.pdf plain text: jcms-709.txt item: #311 of 406 id: jcms-71 author: Gholami, Neda; Mehrabi, Sara; Zajkani, Elham; Bashirinia, Golnaz title: Knowledge of adults about the symptoms and risk factors of oral cancer in Zanjan city date: 2016-06-30 words: 3075 flesch: 67 summary: Leukoplakia and erythroplakia are among the most important precancerous lesions.4 Major risk factors for oral cancer include tobacco use, alcohol consumption, sunlight exposure, nutritional factors and human papilloma virus.5 Oral cancer clinically manifests as a chronic wound, white plaque or red patch, which does not respond to anti-inflamma- tory treatments.6 Studies have reported variable levels of knowledge of adults about oral cancer risk factors. Powe BD, Finnie R. Knowledge of oral cancer risk factors among African Americans: do nurses have a role? keywords: cancer; factors; knowledge; level; oral; risk; risk factors; symptoms; zanjan cache: jcms-71.pdf plain text: jcms-71.txt item: #312 of 406 id: jcms-712 author: Khosravizadeh, Zahra; Rashidi, Zahra; Talebi, Ali; Khodamoradi, Kajal; Hassanzadeh, Gholamreza title: The role of mitochondria in premature ovarian failure: A review date: 2020-02-26 words: 6805 flesch: 53 summary: Mitochondrial mutations and male infertility. Mitochondrial genetic mutations known to be involved in POF are shown in Table 1. keywords: cell; dna; et al; failure; human; infertility; levels; mitochondrial; mtdna; mutations; oocytes; ovarian; oxidative; patients; pof; polg; premature; reprod; role; ros; stress; women cache: jcms-712.pdf plain text: jcms-712.txt item: #313 of 406 id: jcms-715 author: Hemmati, Ali Asghar; Rashidi, Iran; Dahanzadeh, Sedigheh; Moeini, Mahmoud title: Investigating the healing effect of the hydroalcoholic extract of pomegranate seed (Punica granatum) on the full thickness wound in rabbit date: 2020-04-26 words: 5080 flesch: 60 summary: Rat models of skin wound healing: a review. Moulin V. Growth factors in skin wound healing. keywords: cells; collagen; eucerin; extract; group; healing; hydroxyproline; med; phenytoin; pomegranate; repair; results; seed; skin; tissue; treatment; wound cache: jcms-715.pdf plain text: jcms-715.txt item: #314 of 406 id: jcms-718 author: Golfakhabadi, Fereshteh; Zaheri Abdevand, Zeinab; Tansaz, Mojgan title: Evaluation of flatulence of Uterus (Nafkhat-ol-rahem) as One of the Causes of Infertility in Women from the Viewpoint of Ali ibn Abbas Ahvazi and Modern Medicine date: 2020-06-26 words: 6047 flesch: 53 summary: 17 Peganum harmala Harmal Hot and dry Cleaner, Dissolvent for intestinal bloating and thick material, Increase the flow of urine, milk and menstrual blood, laxative for melancholy and thick phlegm Its enema (Hoghneh) is useful in kidney and uterus coldness 18 Valeriana celtica Nardin Hot and dry Increase the flow of urine and menstrual blood Sitting in its decoction is beneficial in uterus diseases 19 Jasminum officinalis Yasamin Hot and dry Blockage opener, Increase the flow of urine and menstrual blood Cathartic for melancholy, bile and phlegm and it eliminates thick wind. Acupuncture, homeopathy, herbal remedies, massage therapy, etc. are the methods that are now promoted by their proponents.5­7 In traditional medicine, various reasons have been expressed for infertility in women, including disorders in female semen, diseases that occur in the uterus such as types of uterine abnormalities, uterine hemorrhoids, cervical inclina­ tion, and flatulence in uterine and severe swelling in cervix.2,4,8 One of the reasons for infertility that is mentioned in traditional manuscripts is uterus flatulence. keywords: blood; causes; disease; dissolvent; dry; flatulence; flow; hot; infertility; medicine; su’mizaj; treatment; urine; uterine; uterus cache: jcms-718.pdf plain text: jcms-718.txt item: #315 of 406 id: jcms-719 author: Zaheri Abdevand, Zeinab; Siahpoosh, Amir; Malayeri, Alireza; Salami, Anayatollah; Khorsandi, Layasadat title: Determination the Effectiveness of a selected formulations of Iranian Traditional Medicine “Ushaq poultice” (ammoniacum gum ointment) on Wound Healing: an experimental study date: 2020-04-26 words: 5043 flesch: 58 summary: In Iranian traditional medicine manuscripts, special attention is paid to wounds and wound healing, and some headings assigned to this topic.13 Marham-e-ushaq is an ointment that is used in Iranian traditional medicine to heal various types of wounds. In The British Pharmacopoeia, the ammoniacum gum is known as antispasmodic and expectorant and used for chronic bronchitis and persistent coughing.17,18 In traditional medicine books, ammoniacum gum is widely used in the gastrointes- tinal, liver, respiratory, musculoskeletal, and skin disorders as a strong anti-inflammatory, absorbent, and drying agent.13 Recent studies show that this herb has antioxidant19, anti- inflammatory, analgesic20, antimicrobial21, anticonvulsant 22, AChE inhibitor 23, and cytotoxic activity.24 Determination the effectiveness of a selected formulations of Iranian traditional medicine “Ushaq poultice” (ammoniacum gum ointment) on wound healing: An experimental study Zeinab Zaheri Abdevand1, Amir Siahpoosh1, Alireza Malayeri2, Anayatollah Salami3, Layasadat Khorsandi4 1 Department of Pharmacognosy, Faculty of Pharmacy, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. keywords: ago; ammoniacum; base; day; group; growth; gum; healing; ointment; p<0.001; p<0.05; phenytoin; tissue; wound cache: jcms-719.pdf plain text: jcms-719.txt item: #316 of 406 id: jcms-72 author: Al-Tu’ma, Fadhil Jawad; Abd Al-Hassan, Ali Tariq; Abed Al-Da,amy, Eman Musa title: Correlation between malondialdehyde and dyslipidemia in psoriatic patients date: 2016-06-30 words: 2664 flesch: 58 summary: A questionnaire was designed to obtain the information from psoriasis patients and control group. A logistic regression was used for correlation, and the multi-varieties egression was used to investigate the effect of serum lipid level on the severity of psoriasis. keywords: levels; lipid; mda; patients; pmid; psoriasis; psoriatic; serum cache: jcms-72.pdf plain text: jcms-72.txt item: #317 of 406 id: jcms-723 author: Kyei, Gordon; Moshkdanian, Ghazaleh; Pasbakhsh, Parichehr; Abolhasani, Farid; Rastegar, Tayebeh; Hassanzadeh, Gholamreza title: Cephalofacial characteristics of the Akan people in the Assin Districts in Central Region of Ghana: Anthropometric Studies date: 2020-04-26 words: 3535 flesch: 61 summary: Nagamani M. A study of cephalic index and facial index in Visakhapatnam, Andhra Pradesh, India. Objective Cephalic and facial indices are very important in the classification and identification of populations. keywords: akan; cephalic; head; index; study; table; width cache: jcms-723.pdf plain text: jcms-723.txt item: #318 of 406 id: jcms-727 author: Hedayati, Seyed Pouria; Haghparast-Bidgoli, Hassan; A. Kiadaliri, Aliasghar; Mohabati, Fatemeh title: Health-related quality of life and health utility among patients with diabetes: in Zabol, Southeast Iran: Health-related quality of life and health utility among patients with diabetes date: 2020-04-26 words: 6490 flesch: 69 summary: The findings suggest that urgent interventions are required to improve HRQoL/HU of diabetes patients in Zabol. Third, we included both type 1 and type 2 diabetes patients while in the national survey only type 2 diabetes patients were included. keywords: analysis; complications; diabetes; eq-5d-3l; health; hrqol; index; iran; life; patients; quality; score; study; type; value; years cache: jcms-727.pdf plain text: jcms-727.txt item: #319 of 406 id: jcms-729 author: Abed, Dhulfiqar Ali; Jasim, Raad; Al-Hindy, Hayder Abdul-Amir; Obaid, Ammar Waheeb title: Cystatin-C in patients with acute coronary syndrome: Correlation with ventricular dysfunction, and affected coronary vessels date: 2020-02-26 words: 4507 flesch: 60 summary: 5. Wei L, Ye X, Pei X, Wu J, Zhao W. Reference intervals for serum cystatin C and factors influencing cystatin C levels other than renal function in the elderly. PLoS One. 2014;9(1):e86066-e. 6. Cystatin C for risk stratification in patients after an acute coronary syndrome. keywords: acs; coronary; creatinine; cystatin; levels; patients; risk; serum; study cache: jcms-729.pdf plain text: jcms-729.txt item: #320 of 406 id: jcms-73 author: AL-Ma’aroof, Suha F. Mohammed; Ahmed, Mohanad M.; Mansor, Narjis H. title: Studying the effect of ovulation stimulation by using clomiphene citrate on serum level of tumor necrosis factor alpha and interleukin-1ß in sub-fertile women in Holy Kerbala Province date: 2016-06-30 words: 3264 flesch: 58 summary: Keywords ovulation stimulation, clomiphene citrate, tumour necrosis factor alpha, interleukin-1ß, fertility, anovulation Studying the effect of ovulation stimulation by using clomiphene citrate on serum level of tumor necrosis factor alpha and interleukin-1ß in sub-fertile women in Holy Kerbala Province Suha F. Mohammed AL-Ma’aroof, Mohanad M. Ahmed, Narjis H. Mansor ISSN 2413-0516 College of Medicine, Karbala University, Karbala, Iraq. 59J Contemp Med Sci | Vol. 2, No. 6, Spring 2016: 59–62 Research Objectives The overall goal of this study was to figure out the effect of ovulation induction on the levels of TNF-α and IL-1ß, and to investigate the possible interaction between the cytokines and hormones in respect to anovulation. keywords: clomiphene; cytokines; levels; mean; ovulation; pmid; sub; tnf; treatment cache: jcms-73.pdf plain text: jcms-73.txt item: #321 of 406 id: jcms-732 author: Salahshoor, Mohammad Reza; Roshankhah, Shiva; Jalili, Cyrus; Farmandeh, Amir title: Administration of Thymoquinone Offer a Protective Effect through the Apoptogenic and Antioxidant Pathway in Acute Liver Failure induced by Taxol: Thymoquinone and Taxol effects on liver date: 2020-04-26 words: 5544 flesch: 55 summary: Based on the obtained results, it can be indicated that thymoquinone owns positive antioxidant effects on molecular function and histo- logical construction of liver cells. Firozi-Niyaki et al. demonstrated that taxol administration to female mice significantly raised the hepatic enzymes.4 Cure with taxol has also been stated to induce the production of lipid ceramide through lipid mem- branes and de novo pathway as well as the manufacture of reactive oxygen species (ROS) from the mitochondrial matrix.5 Free radicals are active molecules or atoms that, owing to their atomic layer, have a strong desire to combine with other surrounding molecules such as proteins, cell membrane lipids, DNA, lipoproteins, and RNA, can cause tissue damage and diseases such as cancer, hepatic disorders, and cardiovascular if their combining activity is not inhibited.6 One of the most important destructive effects of free radicals is lipid peroxi- dation (LP), which causes cell membrane injury.7 These free radicals can induce the production of LP and cellular damages, particularly in hepatic cells by alkylating the protein groups and other cellular macromolecules and attacking unsaturated fatty acids.8 Oxidative stress plays a vital role in the hepatic tissue impairment induced by toxins and drugs.9 Karaduman et al. found that taxol induced hepatic tissue necrosis and damage, caused fibrosis, and increased sinusoidal space and inflammation in the hepatic tissue of rats.10 Various herbs with antioxidant properties apply to pro- tective effects against chemoprotective drugs. keywords: antioxidant; cells; control; effects; groups; hepatic; liver; ncg; taxol; tcg; thymoquinone; tissue cache: jcms-732.pdf plain text: jcms-732.txt item: #322 of 406 id: jcms-735 author: Mokhtari, Tahmineh; Mahahakizadeh, Simin; Aligholi, Hadi; Ijaz, Sahar; Noori, Leila; Hassanzadeh, Gholamreza title: Triiodothyronine Improves Morphology and Up-regulates seladin-1 of neurospheres extracted from Subventricular Zone in Streptozotocin-induced rat model of Alzheimer's disease date: 2020-02-26 words: 5257 flesch: 62 summary: Katzman R. The prevalence and malignancy of Alzheimer disease: A major killer. Doetsch F, Caille I, Lim DA, García-Verdugo JM, Alvarez-Buylla A. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. keywords: alzheimer; cells; disease; expression; gene; group; injection; model; neurospheres; rat; rats; seladin-1; stem; stz; svz cache: jcms-735.pdf plain text: jcms-735.txt item: #323 of 406 id: jcms-738 author: mercan, ümit; erÅŸen, ogün; Ãœnal, Ali Ekrem title: The Effect of Sarcopenia on Postoperative Complications after Curative Pancreatectomy for Adenocarcinoma: Effect of Sarcopenia on Postoperative Complications date: 2020-04-26 words: 3846 flesch: 51 summary: Key Words Pancreatectomy, Postoperative complication, Sarcopenia 74 Original Effect of sarcopenia on postoperative complications Ümit Mercan et al. J Contemp Med Sci | Vol. 6, No. 2, March–April 2020: 73–77 Computed Tomography Scanning Measurements Preoperative contrast-enhanced CT scans were analyzed to create a sarcopenia profile for each patient. Methods Total psoas index (TPI) was calculated for sarcopenia diagnosis by measures of psoas muscle area on the level of L3 spine from preoperative staging computed tomograhpy (CT) images in pancreatic cancer patients undergoing curative resection. keywords: cancer; complications; muscle; patients; results; sarcopenia; study; surg; tpi cache: jcms-738.pdf plain text: jcms-738.txt item: #324 of 406 id: jcms-74 author: Al-Daamy, Alaa Abdul-Hussein; Bahaa, Ula; Alaaddin, Dhuha; Hassan, Marwa title: Investigation of inhibition efficiency of Punica granatum peel extract against bacteria date: 2016-06-30 words: 3062 flesch: 60 summary: The literature also reveals that P. granatum has antifungal activity against derma- tophytic fungi and Trichophyton mentagrophytes.7 Our study aimed to examine the antibacterial activity of extract of P. granatum peel against five types of pathogenic bacteria, four is gram-negative P. aeruginosa, Pseudomonas oryzihabita, Proteus varaplis and Klebsiella pneumonia and one gram-positive S. aureus using acetone, ethanol, methanol, ethyl acetate and water as solvents. Inhibition zone (mm) of extract P. granatum peel against bacteria by using dilutions series of ethyl acetate Bacteria Ethyl acetate ratio (%) keywords: acetate; bacteria; ethyl; extract; granatum cache: jcms-74.pdf plain text: jcms-74.txt item: #325 of 406 id: jcms-743 author: Hawrami, Falah Abdulla Hussein; Amin, Zanyar M.; Mahmood, Muhammad; Hama, Rebwar A. title: Evaluation esthetic and functional outcomes after rhinoplasty date: 2020-04-26 words: 2635 flesch: 47 summary: There was no significant difference in post-operative ROE scores between the two groups. Mean pre- and post-operative scores and correlation with psychological aspects. keywords: nose; patients; post; rhinoplasty; roe; surgery cache: jcms-743.pdf plain text: jcms-743.txt item: #326 of 406 id: jcms-748 author: Ashrafi-rizi, Hasan; Kazempour, Zahra title: Tumor of Misinformation Consumption and Sharing among People in Coronavirus (Covid-19) Crisis; a Commentary: Tumor of Misinformation Consumption and Sharing date: 2020-04-26 words: 2013 flesch: 45 summary: Since medical librarians equipped with the necessary knowl- edge and awareness about the infrastructures of production and dissemination of health information as well as their famil- iarity with the typology of information can play an essential role in teaching proper health information seeking behav- ior when facing with the crises. It should also be said that educating people to identify valid health information from invalid information will be the most important action of medical librarians in the face of cri- ses. keywords: health; information; media; news; people cache: jcms-748.pdf plain text: jcms-748.txt item: #327 of 406 id: jcms-75 author: Jasim, Wafaa Kadhim; Hassan, Mayada Sahib; Keam, Ghsoon Ghanem title: Study the effect of Nigella Sativa on thyroid function and reproductive hormone of female rat date: 2016-06-30 words: 2118 flesch: 64 summary: The black seed oil is reported to be beneficial due to its composition of many components such as aromatic oils trace ele- ments and vitamins.1 Since Nigella sativa oil possesses high ratio of unsaturated fatty acids such as linoloic acid which in turn play an important positive role in function of reproductive system.2 A high percentage of medicine plants have pharmacolog- ical principles, so they are useful as curatives for many ail- ments. Material and Methods Animal and experimental design: The present study was con- ducted on the female rats (Rattus norvegicus) to evaluate the effect of Nigella sativa oil on some hormonal indices of healthy female rats. keywords: effect; nigella; oil; rats; sativa; thyroid; treatment cache: jcms-75.pdf plain text: jcms-75.txt item: #328 of 406 id: jcms-750 author: Mercan, ümit; ErÅŸen, Ogün; Ãœnal, Ali Ekrem title: The Comparison of Single-Dose and Extended-Dose Antimicrobial Prophylaxis for Preventing Surgical Site Infections After Curative Surgery for Gastric Adenocarcinoma: Single-Dose and Extended-Dose Antimicrobial Prophylaxis in Gastic Cancer Surgery date: 2020-06-26 words: 4268 flesch: 49 summary: Although it has been concluded that single dose AMP is sufficient in colorectal and hepatobiliary surgery, a clear consensus has not been achieved, except for a few randomized studies that advocate the same idea with limited evidence in gastric cancer surgery.6-10 While single-dose AMP prior to gastric cancer surgery was the common concept in the West, it was shown in a survey on surgeons in the Far East that more than 60% of surgeons con- tinued prophylaxis in the postoperative period.11 Based on the limited number of studies and clinical experience, there are no clear data on the duration of antibiotic use, although the sin- gle-dose AMP is considered to be more advantageous than the extended-dose AMP because of the potential complications of extended-dose AMP such as drug side effects and bacterial resistance development. Several prospective randomized studies have shown that single dose AMP is sufficient in gastric cancer surgery. keywords: amp; antimicrobial; cancer; dose; gastric; patients; prophylaxis; ssi; study; surgery; surgical cache: jcms-750.pdf plain text: jcms-750.txt item: #329 of 406 id: jcms-76 author: Al-Eessa, Abbas Saeed; Hasan, Abdulmahdi A. title: Psychosocial and medical patterns of acute stress disorder in burn unit in Baghdad, Iraq date: 2016-06-26 words: 2239 flesch: 68 summary: Conclusion Both the disease process and treatment of burned patients may affect the mental state of patients producing a variety of symptoms. Distribution of acute stress disorder cases in burn patients No. of patients and % Male Female Total Cases 27 53 80 Non cases 14 6 20 Total 41 59 100 Fig. keywords: asd; burn; cases; disorder; patients; stress; total cache: jcms-76.pdf plain text: jcms-76.txt item: #330 of 406 id: jcms-766 author: Khoshnevisan, Mohammad Hossein; Deghatipour, Marzie; EbnAhmady, Arezoo; Keshavarz, Hooman title: Smoking and exposure to environmental tobacco smoke among health occupations students in Iran date: 2020-06-26 words: 4176 flesch: 58 summary: Prevalence of tobacco use and perceptions of student health professionals about cessation training: results from Global Health Professions Students Survey. Among all the disciplines, dental students reported the highest prevalence (52.0%) for current cigarette smoking while public health students reported the lowest (0.0%). keywords: cigarette; dental; ets; exposure; health; prevalence; smoking; students; study; tobacco cache: jcms-766.pdf plain text: jcms-766.txt item: #331 of 406 id: jcms-769 author: Alghazali, Dhia Mahdey; Maamera, Maytham A; Alkazraji, Haider Fadel; Abutiheen, Ali A title: Spectrum of Ground Glass Opacities in Chest CT of COVID-19 Patients in Karbala, Iraq date: 2020-06-26 words: 3833 flesch: 61 summary: Spectrum of ground-glass opacities in chest CT of COVID-19 patients in Karbala Dhia Mahdey Alghazali1*, Maytham A. Maamera 2, Haider Fadel Alkazraji1, Ali Abdulridha Abutiheen3 1 Department of Diagnostic Radiology, Al-Imam Al-Hussein Medical City, Karbala, Iraq. 141 Original Spectrum of ground-glass opacities in chest CT of COVID-19 patients in KarbalaDhia Mahdey Alghazali et al. J Contemp Med Sci | Vol. 6, No. 3, May–June 2020: 140–145 Patients with positive CT scan findings and positive RT-PCR were included in the study. keywords: chest; coronavirus; covid-19; disease; ggo; glass; opacities; patients; type cache: jcms-769.pdf plain text: jcms-769.txt item: #332 of 406 id: jcms-77 author: Nafarzadeh, Shima; Imani, Reza; Mohammadi, Mansooreh; Haghanifar, Sina title: A case report of calcifying epithelial odontogenic (Pindborg) tumour in the mandible date: 2016-06-26 words: 1793 flesch: 57 summary: (Submitted: 10 February 2016 – Revised version received: 24 March 2016 – Accepted: 26 May 2016 – Published online: 26 June 2016) Introduction Calcifying epithelial odontogenic tumour (CEOT), also known as Pindborg tumour, is an uncommon tumour, including <1% of all odontogenic tumours.1–3 The tumour was first described in 1956 by the Late Dr. Jens J Pindborg.1 Calcifying epithelial odontogenic tumour: biological profile based on 181 cases from the literature. keywords: babol; case; oral; pindborg; pmid; tumour cache: jcms-77.pdf plain text: jcms-77.txt item: #333 of 406 id: jcms-774 author: Naik, Varun; Khatri, Chandra Bahadur; BR, Ganesh title: Effect of matrix rhythm therapy in Diabetic foot ulcer healing: A Case Report date: 2020-08-26 words: 2974 flesch: 57 summary: Size of wound decreased with dimension of 6 mm in diameter and 2 mm depth and categorized as Type A grade 1. Conclusion: Matrix rhythm therapy could be considered as adjunct in wound healing of diabetic foot ulcer. Though one of study on effects of vibrations in blood flow in healthy inactive subjects showed that vibration is responsible for increase in blood sup- ply, there are very limited studies related to role of vibrations in wound healing in diabetic subjects.22 In our study, wound healing in DFU is accelerated that can be possibly due to cellular effect of vibrations produced by the application of matrix rhythm therapy. keywords: diabetic; foot; healing; management; matrix; rhythm; therapy; ulcer; wound cache: jcms-774.pdf plain text: jcms-774.txt item: #334 of 406 id: jcms-78 author: Al-Fattli, Hams Hussain Hashim title: The clinical and serological diagnosis of Mycobacterium bovis in blood and milk serums of lactating cows by IDEXX ELISA test in Wasit and Dhi-Qar provinces/Iraq date: 2016-09-27 words: 4234 flesch: 60 summary: BhanuRekha V, Gunaseelan L, Pawar G, Nassiri R, Bharathy S. Molecular detection of Mycobacterium tuberculosis from bovine milk samples. The IDEXX ELISA results were recorded as positives or negatives based on a sample to positive (S/P) ratio and the result of each sample are submitted to the following formula: (15.12%) were positives with milk serum samples by IDEXX ELISA test. keywords: blood; bovine; bovis; btb; cattle; cows; infection; milk; mycobacterium; samples; serum; test; tuberculosis; vet cache: jcms-78.pdf plain text: jcms-78.txt item: #335 of 406 id: jcms-781 author: Arab, Leila; Fanni, Aslan; Nemati, Shiva; Arefian, Ehsan; Ai, Jafar; Mokhtari, Tahmineh; Farahmandfar, Maryam; Aghdami, Nasser; Hassanzadeh, Gholamreza title: Human embryonic derived neural progenitor cells improves neurological scores following brain ischemia/ reperfusion: Modulation of blood and brain tissue MicroRNA-210 date: 2020-06-26 words: 4568 flesch: 57 summary: Embryonic neural stem cells transplanted in middle cerebral artery occlusion model of rats demonstrated potent therapeutic effects, compared to adult neural stem cells. The analysis of neural stem cells’ secretome showed that they secrete different growth factors, Fig. keywords: blood; brain; cells; group; hesc; injection; ischemic; mcao; mirna-210; neural; npcsgfp; rats; stem; stroke; tehran cache: jcms-781.pdf plain text: jcms-781.txt item: #336 of 406 id: jcms-787 author: Yüksel, Cemil; Çulcu, Serdar; Bakırarar, Batuhan; Doğan, Lütfi title: The Effect of Breast Parenchymal Density on Breast Cancer Subtypes and Prognostic Factors: Efficacy of Parenchymal Density on Breast Cancer date: 2020-08-26 words: 4679 flesch: 57 summary: (2014) including three studies showed that breast parenchymal density increased the risk of developing breast cancer regardless of the meno- pausal status.20 Research shows that the risk of developing cancer is 4–6 times higher compared in dense breasts com- pared to fatty breasts.21, 22 Pre- and postmenopausal estrogen receptor positive patients whose breast density showed a higher decrease with tamoxifen have been shown to have bet- ter prognosis.7, 23 Studies on breast density and breast cancer prognosis are yet to reach a consensus on the matter. Advanced age, high body mass index (BMI), number of births, breastfeeding time, and antiestrogens in breast tissue such as Tamoxifen cause a decrease in breast density, while hormone replacement therapy and use of oral contraceptives cause an increase.2 Recently, the American College of Radiology has recommended the assessment of breast density in the BIRADS (Breast Imaging Reporting and Data System) system for the evaluation of lesions in terms of malignancy risk.3 Dense breasts restrict the imaging of lesions detected by mammography and reduce the sensitivity of mammography. keywords: breast; breast cancer; breast density; cancer; correlation; density; mammographic; patients; prognosis; risk; type cache: jcms-787.pdf plain text: jcms-787.txt item: #337 of 406 id: jcms-79 author: Al-Tu’ma, Fadhil Jawad; Al-Zubaidi, Riyadh D.; Al-Khaleeli, Abdul-Mutalib Badr; Abo-Almaalid, Hassan M. title: Polymorphism of tumor suppressor gene (p53) Codon 72 in Iraqi patients with acute myocardial infarction date: 2016-09-27 words: 1851 flesch: 52 summary: Furthermore p53 gene plays an important role in regulating vascular smooth muscle cell growth and may mediate and abnormal occurrence of apop- tosis in atherosclerotic lesions by attenuating or accelerating the apoptotic death process.3 Affected mutations in p53 gene can induce dysfunction of p53 and inhibit apoptosis and loss of gene activity could which play a relevant role in the pathogenesis of atherosclerosis.4 A common p53 tumor suppressor gene polymorphisms occur at codon 72 of exon 4, with two alleles encoding either arginine (CGC) or proline (CCC). keywords: codon; gene; p53; polymorphism; smoker cache: jcms-79.pdf plain text: jcms-79.txt item: #338 of 406 id: jcms-790 author: Hadi, Shaymaa M.; Al-Tu’ma, Fadhil J.; Al-Zubaidi, Riyadh D. title: Association between Hypovitaminosis D3 and Type II Diabetes Mellitus of Iraqi Patients date: 2020-06-26 words: 4684 flesch: 55 summary: After discussing those results, the hidden correlation between VDD and a variety of diseases is still to be discov- ered.45 Vitamin D could be associated with autoimmunity in addition to metabolic diseases.46 Moreover, recent research was set forward, it is concerned with discussing the correlation between vitamin D and adipose tissue. Mitri, J, Dawson-Hughes, B, Hu, F, and Pittas, A. Effects of vitamin D and calcium supplementation on pancreatic β cell function, insulin sensitivity, and glycemia in adults at high risk of diabetes: The Calcium and Vitamin D for Diabetes Mellitus (CaDDM) randomized controlled trial. keywords: diabetes; levels; patients; type; vdd; vitamin; vitamin d cache: jcms-790.pdf plain text: jcms-790.txt item: #339 of 406 id: jcms-791 author: Al-Mawali, Adhra; Al-Harrasi, Ayaman; Jayapal, Sathish Kumar; Al-Kharusi, Hilal; Al-Rashdi, Mariam; Daniel Pinto, Avinash title: Health Research Priority Setting in Oman: Towards better utilization of the available resources date: 2020-06-26 words: 10475 flesch: 56 summary: In Oman, both methods are applicable, as we have reliable mortality and morbidity data for substantial parts of the pop- ulation with IHME estimates of GBD (2016) as well as having” Health Vision 2050” which is considered to be the roadmap for the planning in the future.23,24,25 So, combining both meth- ods for setting health research priority in Oman will give the most reliable list of priorities.26 Evaluation The identification of health research priorities should be seen in the broader context of health research coordination and inform funding and policymaking for health research in a sus- tainable manner.27 The first edition of health research priorities in Oman was published in April 2014. keywords: burden; care; countries; development; disease; exercise; factors; health; health research; list; national; oman; priorities; priority; priority setting; process; research; research priority; setting; system cache: jcms-791.pdf plain text: jcms-791.txt item: #340 of 406 id: jcms-80 author: Al-Sabbagh, Juman Khaleel; A. Razzaq, Mohammad Sabri; Abd-Al-Rudha, Milal M. title: Estrogen-degrading bacteria in women with premature ovarian failure date: 2016-09-27 words: 5271 flesch: 51 summary: The fecal microbiome (number and species) was very directly and strongly associated with systemic estrogens level; these associations were robust to different classifications of microbiome diversity, and they held for estradiol, estrone and EM; and the diversity analysis advises that estrogen levels are not associated with any particular cluster or class of that The etiology of bacterial vaginitis is poorly understood and remains a question for discussion, bacterial vaginitis can arise and remit spontaneously or progress into a chronic or recurrent disease.29 Bacterial vaginitis may sometimes affect women after menopause; the reduction in estrogen levels in perimenopausal and postmenopausal women has been related to an abnormal vaginal flora of 35% and 70%, respectively when compared to the normal flora.30 Vaginal Lactobacilli have a crucial role in maintaining an environment that restricts the growth of pathogenic microorganisms in the vagina.31 It has been proposed that, estrogen and Lactobacillus are required to achieve an optimal vaginal pH of 4.0 to 4.5.32 After puberty, under the effect of estrogen, glycogen is deposited in the vaginal epithelial cells, which is metabolized by vaginal epithelial cells to glucose, Lactobacilli produce lactic acid from glucose, keeping the vagina at an acidic pH.33 keywords: bacteria; control; degradation; degrading; estradiol; estrogen; failure; fsh; hormone; levels; patients; pof; premature; women cache: jcms-80.pdf plain text: jcms-80.txt item: #341 of 406 id: jcms-801 author: Aledhari, Fatin Abd Al Sattar; Sargeran, Katayoun; Gholami, Mahdia; Shamshiri, Ahmad Reza title: Iraqi Dentists' Risk-Based Restorative Treatment Decisions date: 2020-08-26 words: 2879 flesch: 60 summary: Revealed that there was no significant relationship between independent variables and restorative treatment decision regarding low risk patients in dentists >40 years old. Restorative treatment decisions by California dentists. keywords: attitude; caries; dentists; ref; restorative; risk; treatment cache: jcms-801.pdf plain text: jcms-801.txt item: #342 of 406 id: jcms-809 author: Saleh, Mhammad; Saleh, Marwan; Zahid, Mohammed Nabil title: Awareness and response to Coronavirus Disease (Covid-19) epidemic among the Arab population in the Eastern Mediterranean Region and Arab Peninsula date: 2020-08-26 words: 4367 flesch: 53 summary: Until the 9 June, new COVID-19 has been recorded from different countries including America and South Asia. Related to the report of the world health organization in the Eastern Mediterranean region the total report cases were 687,464 and death cases were 15,405 and the daily notification of confirmed COVID-19 in EMR was stably increasing until the day of writing this articles. keywords: age; cases; coronavirus; countries; covid-19; emr; health; infection; participants; population; study cache: jcms-809.pdf plain text: jcms-809.txt item: #343 of 406 id: jcms-81 author: Al-Zubaidi, KA; Shemki, Methak Adul Razzaq.; Yahya, Widad H. title: Survey of congenital malformation concerned to multiple factors in Al- Zahraa Hospital childbed and brats in Al-Najaf AL-Ashraf date: 2016-09-27 words: 3612 flesch: 54 summary: The relationship between the kinds of delivery and congenital malformation at Najaf Obstetric Hospital Types of defects Type of delivery Total χ2 P-value Normal Surgical Malformation of the brain and anencephaly Count 2 6 8 13.2878 .010 Expected count 5.0 3.0 8.0 % within type of defect 25.0% 75.0% 100.0% % within type of delivery 2.7% 13.3% 6.7% % of total 1.7% 5.0% 6.7% Prematurity + dyspnea and warp respiratory Count 23 6 29 Expected count 18.0 11.0 290 % within type of defect 79.3% 20.7% 100.0% % within type of delivery 31.1% 13.3% 24.4% % of total 19.3% 5.0% 24.4% Multiple congenital abnormalities Count 7 10 17 Expected count 10.6 6.4 17.0 % within type of defect 41.2% 58.8% 100.0% % within type of delivery 9.5% 22.2% 14.3% % of total 5.9% 8.4% 14.3% Deformation cardiovascular Count 15 12 27 Expected count 16.8 10.2 27.0 % within type of defect 55.6% 44.4% 100.0% % within type of delivery 20.3% 26.7% 22.7% % of total 12.6% 10.1% 22.7% Bacterial septicemia Count 27 11 38 Expected count 23.6 14.4 38.0 % within type of defect 71.1% 28.9% 100.0% % within type of delivery 36.5% 24.4% 31.9% % of total 22.7% 9.2% 31.9% Total Count 74 45 119 Expected count 74.0 45.0 119.0 % within type of defect 62.2% 37.8% 100.0% % within type of delivery 100.0% 100.0% 100.0% % of total 62.2% 37.8% 100.0% Relation between the types of congenital malformation with blood group at Najaf Obstetric Hospital Types of defects Blood groups χ2 P-value A B O AB Total Malformation of the brain and anencephaly Count Expected count % within defects % within blood group % total 1 1.0 12.5% 6.7% 0.8% 1 1.7 12.5% 4.0% 0.8% 3 2.4 37.5% 8.3% 2.5% 3 2.9 37.5% 7.0% 2.5% 8 8.0 100.0% 6.7% 6.7% 16.120 0.47 Prematurity + dyspnea and warp respiratory Count Expected count % within type of defects % within blood group % of total 4 3.7 13.8% 26.7% 3.4% 4 6.1 13.8% 16.0% 3.4% 9 8.8 31.0% 25.0% 7.6% 12 10.5 41.4% 27.9% 10.1% 29 29.0 100.0% 24.4% 24.4% Multiple congenital abnormalities Count Expected count % within type of defects % within blood group % of total 4 2.1 23.5% 26.7% 3.4% 3 3.6 17.6% 12.0% 2.5% 4 5.1 23.5% 11.1% 3.4% 6 6.1 35.3% 14.0% 5.0% 17 17.0 100.0% 14.3% 14.3% Deformation cardiovascular Count Expected count % within type of defects % within blood group % of total 1 3.4 3.7% 6.7% 0.8% 5 5.7 18.5% 20.0% 4.2% 12 8.2 44.4% 33.3% 10.1% 9 9.8 33.3% 20.9% 7.6% 27 27.0 100.0% 22.7% 22.7% Bacterial septicemia Count Expected count % within type of defects % within blood group % of total 5 4.8 13.2% 33.3% 4.2% 12 8.0 31.6% 48.0% 10.1% 8 11.5 21.1% 22.2% 6.7% 13 13.7 34.2% 30.2% 10.9% 38 38.0 100.0% 31.9% 31.9% Total Count Expected count % within type of defects % within blood group % of total 15 15.0 12.6% 100.0% 12.6% 25 25.0 21.0% 100.0% 21.0% 36 36.0 30.3% 100.0% 30.3% 43 43.0 36.1% 100.0% 36.1% 119 119.0 100.0% 100.0% 100.0% tobacco, and other psychoactive substance, down Syndrome, metabolic and hormonal disorders sickle cell disorders and con- genital hypothyroidism,11 and this results may correspond to the results of previous study that suggested that the high percent of malformation of pregnant women may be due to hormonal imbalance especially steroid hormones (progesterone, estrogen, or androgen) and gonadotrophic hormones as well (FSH, LG) as other causes of congenital malformations involved the mal- nutrition, chemical pollutions, and microbial agent, these sug- gestion which also accordance with the previous studies12,13 and the finding was also identical with the previous studies14–16 that they mentioned the effect of sex hormones on fetus have been documented but this previous studies are based mainly on the exposure of fetus to female sex hormones during the initial period of pregnant from another hand the drug intake during pregnancy include oral contraceptive pills, progesterone ana- logues to confirm pregnancy medications for medical ailments and sex selection drugs to bear male offspring and also when compared with previous studies in Bahrain the congenital mal- formation caused by joint action of genetic liability and envi- ronmental factors17 and there are many environment factors that at one time have been suspected of playing a role in the causation congenital malformation18. keywords: age; blood; congenital; count; group; malformation; study; total; type; years cache: jcms-81.pdf plain text: jcms-81.txt item: #344 of 406 id: jcms-810 author: Aziz, Zainab Waleed; Mahmood, Asmaa Mohammadsheet; Yahiya, Zahraa Osama; Taib Al-Nuaimy, Wahda Mohammed title: Correlation Between Programmed Cell Death Ligand1 (PD-L1) Expression and Clinical Parameters in Colorectal Carcinoma date: 2020-08-26 words: 4090 flesch: 55 summary: Finally, counterstaining and blueing with hematoxylin (Sigma- Aldrich, St Louis, MO, USA), and mounting in a non-aqueous mounting medium.8 Scoring of PD-L1 immunohistochemical expression PD-L1 positivity designated as cells with membranous and/ or cytoplasmic immunohistochemical staining on ≥5% of all TCs or TIICs.12 Trivial changes observed in the staining inten- sity, therefore, was not estimated. PD-L1 immunoexpression on tumor cells (TCs), and tumor-infiltrating immune cells (TIICs) was analyzed sepa- rately. The PD1-PDL1 pathway, therefore, has been involved in cancer progression.5 This observation leads to the production of PD1–PDL1 pathway inhibitors to counteract tumor cells of evading from host immune responses, and to intensify antitumor immu- nity, thus providing a promising approach in oncology toward immunotherapy.6 keywords: cancer; cells; expression; patients; tcs; tiics; tissue; tumor cache: jcms-810.pdf plain text: jcms-810.txt item: #345 of 406 id: jcms-82 author: Hussein, Khalid Ali; Kadhum, Najeh Hashem; Yasser, Yass Kudhir title: The role of bacteria Bacillus subtilis in improving rooting response of Mung bean (Vigna ratiata) cuttings date: 2016-09-27 words: 4230 flesch: 56 summary: Methods The some of the optimal conditions for IAA production have been indicated. The effect of IAA production in Bacillus subtilis filtrate In carbohydrate, protein, IAA contents and activity of IAAO in cutting hypocotyls. keywords: acid; auxin; bacillus; bacteria; bean; cuttings; effect; growth; hypocotyl; iaa; plant; production; rooting; subtilis cache: jcms-82.pdf plain text: jcms-82.txt item: #346 of 406 id: jcms-820 author: Kassim, Zakaria A; Al-Mulaabed, Sharef; Younis, Saif W; Abutiheen, Ali A title: Infection Prevention and Control Measures for COVID-19 among Medical Staff in Nineveh Governorate, Iraq date: 2020-08-26 words: 4510 flesch: 60 summary: 248 (%87) 111 (90%) 0.531 Q6. Compared to other medical staff, physicians were less compliant to washing hands, putting waste in designated places, and wearing protective cloths. keywords: control; covid-19; hands; health; ipc; measures; nineveh; staff; work cache: jcms-820.pdf plain text: jcms-820.txt item: #347 of 406 id: jcms-822 author: Afshar, Parviz; Ghaffaripour, Mohammad; Sajjadi, Hamid title: Suggested role of Vitamin D supplementation in COVID-19 severity date: 2020-08-26 words: 1333 flesch: 55 summary: 191 Letter to editor ISSN 2413-0516 J Contemp Med Sci | Vol. 6, No. 4, July-August 2020: 191–192 Dear Editor in chief The Journal of Contemporary medical sciences Vitamin D, a pre-hormone, regulates and/or affects mul- tiple functions such as immune-, coagulation-, cardiovas- cular-, central nervous system, inflammation, cancer rates, deep-vein-thrombosis, sleep-apnea, and respiratory tract infections (RTIs).1-8 The role of vitamin D in reducing RTI is outstanding as reported by a meta-analysis.2 Our first ref- erence is a must read document with “over 150 references” regarding the RTI reduction in patients with Vitamin D level (VDL) >40-ng/mL versus those <20-ng/mL.1 VDL and Covid severity has been well-shown in a very recent study.9 The two most important causes of COVID-19 severity, needing ventilators and possible death are: 1. If patient recovers in shorter period they are discharged on daily dosage and VDL is checked in 3 months BUT 6 days after last dosage. Suggested role of Vitamin D supplementation in COVID-19 severity Parviz Afshar1, Mohammad Ghaffaripour2, Hamid Sajjadi3 1 Hospital Director, Iranian Hospital Dubai, Dubai, UAE2 ICU Director, Iranian Hospital Dubai, Dubai, UAE 3 Neuro-Ophthalmology Director, Iranian Hospital Dubai, Dubai, keywords: vitamin cache: jcms-822.pdf plain text: jcms-822.txt item: #348 of 406 id: jcms-824 author: Al-Lami, Huda Basim; Al-Tu'ma, Fadhil Jawad; Al-Safi, Wasan Ghazi title: Association between anti-Müllerian Hormone and other biomarkers with ovarian function in polycystic ovarian syndrome of Iraqi women date: 2020-08-26 words: 5973 flesch: 57 summary: Elevated levels of the AMH in PCOS women groups were associated and related to increased number of follicles in women with PCOS agreement with Namik et al,36 which found increase levels of the AMH in PCOS women in their repro- ductive ages. The overweight and obesity was found as a common feature among PCOS women studies which was agreed with others.21 High BMI can influence both clinical and pathophys- iology manifestations of PCOS.41,42 Their report indicate that PCOS women with BMI >25 kg/m² have a marked increase level of insulin, glucose, LH, TT, and increased insulin resis- tance. keywords: age; control; fsh; group; hormone; insulin; ovarian; patients; pcos; syndrome; women cache: jcms-824.pdf plain text: jcms-824.txt item: #349 of 406 id: jcms-826 author: Pazyar, Nader; Fatemi, Nasrin; Mirzai, Nosrat; Jahangir, Mohammad; Rasooli, Farahnaz; Attarzadeh, Shahrzad title: A Report of Clinical Audit for Prevention and Improvement of Bedsore in Southwest Iran date: 2020-12-26 words: 2570 flesch: 50 summary: Optimal time interval for position change for ICU patients using foam mattress against pressure ulcer risk. Incidence, prevention and treatment of pressure ulcers in intensive care patients: a longitudinal study. keywords: audit; bedsore; care; clinical; patients; pressure; prevention; ulcer cache: jcms-826.pdf plain text: jcms-826.txt item: #350 of 406 id: jcms-828 author: Ozverel, Cenk Serhan; Kurtulmus-Yilmaz, Sevcan title: Awareness and perception of dentistry students studying in Cyprus regarding COVID-19: A cross-sectional study date: 2020-10-30 words: 4716 flesch: 55 summary: The vast majority of survey participants are people who come from international countries such as; Turkey (69%, 410), Iran (5%, 30), Jordan (3%, 18), Iraq (4%, 24), Syria (4%, 24), United Arab Emirates (2%, 12), Lebanon (2%, 12), and Germany, France, Canada, Nigeria, Sudan with <1%. The majority of participants were aware that dentists were at high- risk group in terms of COVID-19 (98.5%). keywords: 2020; coronavirus; covid-19; dentistry; knowledge; participants; patients; questions; students; survey; tests cache: jcms-828.pdf plain text: jcms-828.txt item: #351 of 406 id: jcms-829 author: Jaafaraghaei, Fatemeh; Aghajany-Nasab, Monireh; Aghaei, Mahsa; Javadi pashaki, Nazila; Kazemnejhad Leili, Ehsan title: The Biochemical parameters in venous blood sampling by direct venipuncture and peripheral intravenous catheter date: 2020-10-30 words: 3504 flesch: 54 summary: In some patients, such as those with chronic diseases, patients who have had multiple intravenous (IV) injections, IV drug abusers, patients with skin problems at the venous lines, patients taking anticoagulants, the elderly patients with fragile veins, and children, finding a suitable vein may require multi- ple vein punctures.11, 12IV catheters are commonly used in most hospitalized patients for medical purposes such as injections of fluids, medications, and blood.11, 14 These catheters make it unnecessary to use a needle and make it easier for patients with difficult venous blood sampling.13 This protects patients from repeated injuries by venous puncture sampling and nurses from needle puncture, providing comfort and time saving for patients and nurses, especially those in intensive and acute care, and suffer from collapsed veins, speeding up the results of tests and increasing the speed of medical and nursing care, reducing the risk of infections and other complications of blood sam- pling.11 Sampling for diagnostic tests using arterial and venous catheters has been controversial since half a century ago.15 The results of some studies have shown that by inserting and main- taining an IV catheter and accessing the patient’s bloodstream, the blood sample needed for diagnostic tests can be obtained to reduce the complications of direct blood sampling.4, 5, 10 On the other hand, some studies have concluded that laboratory values obtained from IV catheter blood samples are invalid and recommend further studies in this area.5, 7, 13 On the other hand, the results of some studies suggest that the infusion intake through the IV catheter may affect the results of tests performed on IV catheter blood samples.7, 15. According to the results of this study and other stud- ies, peripheral venous catheter blood sampling can be used to measure BUN and creatinine not for sodium and potassium regarding to the types of infusion. keywords: blood; catheter; direct; group; methods; patients; results; saline; sampling; study; venous cache: jcms-829.pdf plain text: jcms-829.txt item: #352 of 406 id: jcms-83 author: Karem, Karem Kdaer; Sabour, Aseel Najah; Kulaifa, Bara Majed title: Comparison between manual procedure and automated for determinant of WBCs and PCV in maternity and labor hospital in Karbala city date: 2016-09-27 words: 1995 flesch: 53 summary: It is considered as an integral part of a person’s complete blood count, along with hemoglobin concentration, white blood cell count and platelet counts.6,7 In Ethiopia, hematocrit is one of the most common parameters from complete blood count used as a routine examination by physicians in any parts of the country where automated method are unavailable, microhe- matocrit procedure is used to evaluate HCT value of patients.8 Materials and Methods A comparative cross sectional study was conducted from 28 December 2015 to 28 January 2016 to assess the analytical perfor- mance between manual procedure and automated methods for aDepartment of Environmental Health, College of Applied Medical sciences, University of Karbala, Karbala, Iraq. Recommendation All health workers in laboratories should take manual method together automated method to reach accurate result. keywords: blood; correlation; manual; method; procedure cache: jcms-83.pdf plain text: jcms-83.txt item: #353 of 406 id: jcms-830 author: Ebrahimi, Babak; Madadi, Soheila; Noori, Leila; Navid, Shadan; Darvishi, Melika; Alizamir, Tahreh title: The stature estimation from students’ forearm and hand length in Hamadan University of Medical Sciences, Iran date: 2020-10-30 words: 2589 flesch: 60 summary: Correlation between stature (cm) with weight (kg), hand length (cm) and forearm length (cm), in total samples, both in males and females are shown in Figs 1, 2, and 3. Correlation between stature (cm) with weight (kg), hand length (cm), forearm length (cm) and foot length (cm). keywords: correlation; forearm; hand; length; stature; study cache: jcms-830.pdf plain text: jcms-830.txt item: #354 of 406 id: jcms-84 author: Al-Daamy, Alaa Abdul Hussein Kareem; Hassan, Ali Abdul; Mahmood, Ali title: Study of antibacterial activity of Lawsonia inermis leaf extract date: 2016-09-27 words: 3099 flesch: 54 summary: Objectives The present study aims to determine antibacterial activity for Lawsonia inermis leaf extract against some pathogenic bacteria. Keywords acetone, Lawsonia inermis, antibacterial activity, MIC numbers 1, 2, 3, 4, and 5. keywords: + +; extract; inermis; lawsonia cache: jcms-84.pdf plain text: jcms-84.txt item: #355 of 406 id: jcms-844 author: Sadighi, Nahid; Fallah Arzpeyma, Sima; Izanlou, Mohsen; Oghabian, Mohamad Ali; Izanlou, Mostafa; Noori, Fateme; Sadeghi Joni, Saeid title: Evaluation of Diagnostic Accuracy of the Approved Tumor Mapping Protocol in Grading of Glial Tumors date: 2020-10-30 words: 3921 flesch: 55 summary: High grade gliomas: The role of dynamic contrast-enhanced susceptibility-weighted perfusion MRI and proton MR spectroscopic imaging in differentiating grade III from grade IV. After obtaining the parameters of two modalities of perfusion MRI and spectroscope, they came to the conclusion that the combination of rCBV, Cho / Cr, Cho / NAA and MI / Cr was associated with specificity of 68%, sensitivity of 95%, PVP of 76% and Nvp of 86.7% for grading of glioma tumors that was in line with our study.9 In a 2003 study by Zidan on 160 patients with an initial diagnosis of glioma, rCBV was obtained from the region with the highest perfusion and MRS parameters with moderate and short TE. keywords: cho; glioma; grade; grade glioma; naa; rcbv; sensitivity; specificity; tumor cache: jcms-844.pdf plain text: jcms-844.txt item: #356 of 406 id: jcms-846 author: Sadeghi, Bita; Estebsari, Fatemeh; Rassouli, Maryam; Ebadi, Abbas title: Factors affecting psychological problems in primary caregivers of People with Multiple Sclerosis: a qualitative study date: 2020-12-26 words: 6651 flesch: 57 summary: MS patients, caregivers who were usually family members and the medi- cal staff including a neurologist, nurse, and psychologist com- prised the participants of this research. Semi-structured interviews were conducted to explore psychological problems involved in providing care to MS patients and the factors affecting them with 8 patients, 10 caregivers and 3 healthcare providers. keywords: caregivers; concerns; data; disease; family; multiple; participants; patient; problems; research; sclerosis; social; study cache: jcms-846.pdf plain text: jcms-846.txt item: #357 of 406 id: jcms-85 author: Kareem, Adel A.; Abood, Asaad Muhsen; Hasan, Abdul Mahdi A. title: Maple Syrup Urine Disease (MSUD) detected in neurologic disorders Iraqi children date: 2016-09-27 words: 3246 flesch: 51 summary: Maple syrup urine disease (branched-chain oxoaciduria). Maple syrup urine disease (MSUD)—clinical profile of 47 Filipino patients. keywords: delay; diagnosis; disease; maple; metabolic; msud; patients; screening; study; syrup; urine cache: jcms-85.pdf plain text: jcms-85.txt item: #358 of 406 id: jcms-851 author: Ghali, Hasanein Habeeb; Al Mamoori, Doaa Alem title: Hemolysis in children with Glucose-6-Phosphate Dehydrogenase deficiency after ingestion of fava beans; facts predicting severity date: 2020-12-26 words: 3604 flesch: 54 summary: The mean duration of exposure was longer in those with mild hemolysis (2.87 days), and the mean onset of symptoms was also longer in severe hemolysis (2.20 days) with a signifi- cant P value of 0.005. According to the WHO classification of G6PD deficiency, the severity of G6PD enzyme deficiency corresponds to the chronicity of hemolysis.16Excessive heme metabolism resulting from severe intravascular hemolysis leads to significant increases in biliru- bin, which overwhelms the hepatic conjugation process result- ing in unconjugated hyperbilirubinemia state.17 Biochemically, our results showed that the more increase in TSB, and retic- ulocyte count could predict the severity of hemolysis. keywords: children; deficiency; fava; g6pd; hemolysis; history; patients; phosphate; study cache: jcms-851.pdf plain text: jcms-851.txt item: #359 of 406 id: jcms-852 author: Khayamzadeh, Mina; Kaviani, Hanieh title: A Review on Therapeutic Management for Oral Chronic Graft-versus-Host Disease date: 2020-10-30 words: 7501 flesch: 50 summary: The results of a recent comprehensive multivariate logisti- cal regression analysis showed that oral cGVHD had significant relationships with mouth pain in patients as well as with a num- ber of inflammation laboratory markers such as higher levels of total complement and lower levels of albumin.36 The oral cGVHD can have many health consequences such as reduced oral epithelial integrity and limited repair abil- ity, increased oral infections, oral pain, negative impacts on eating, nutrition, speech, quality-of-life, and increased caries ris.19 Oral cGVHD is not related to poor long-term survival, but it has negative impacts on functional capacity, oral health, symptoms, and quality-of-life of patients. It tried to provide practical and relevant considerations and recommendations for all clinicians who deal with oral cGVHD patients in order to achieve improved care and outcomes. keywords: blood; cgvhd; chronic; diagnosis; disease; gland; graft; host; host disease; management; mucosal; oral; patients; review; risk; salivary; therapy; treatment cache: jcms-852.pdf plain text: jcms-852.txt item: #360 of 406 id: jcms-856 author: Kamali, Alireza; Sarkhosh, Sepideh; Kazemizadeh, Hosein title: Comparison the Sedation Effect and Satisfaction of Two Combinations, Dexmedetomidine and Fentanyl with Midazolam and Fentanyl, in Patients Undergoing Bronchoscopy date: 2020-12-26 words: 3420 flesch: 55 summary: According to the results, there was a signif- icant difference between the two groups in terms of patients satisfaction score in recovery and there was a significant differ- ence in patients satisfaction score in dexmedetomidine group (P-value = 0.04), but Ramsay score showed no significant dif- ference between the two groups in recovery and was almost the same (P-value = 0.6). According to the results of this study, there was no significant difference between the two groups in mean blood pressure (P-value = 0.6) and mean heart rate (P-value = 0.4) at the time of bronchoscopy, but at 5 and 10 min after bronchoscopy, there was a significant difference, mean blood pressure and heart rate were significantly lower in dexmedetomidine group. keywords: bronchoscopy; dexmedetomidine; difference; fentanyl; groups; midazolam; patients; study cache: jcms-856.pdf plain text: jcms-856.txt item: #361 of 406 id: jcms-857 author: Farhadi, Mahtab; Khorshidifar, Abdolreza; Ghalambor, Abdolazim; Bakhshaeekia, Alireza title: Comparative evaluation about the efficacy of the use of variable concentrations of Epinephrine in Tumescent solution for control of bleeding in patients with abdominal liposuction date: 2020-12-26 words: 2806 flesch: 55 summary: Although several publications have cited its use in liposuction, its effectiveness in reducing pre-operative blood loss during liposuction has not yet been studied.10 On the other hand, epinephrine is the most widely used blood vessel constrictor and blood coagulation accelera- tor, particularly on the skin or mucous membranes to con- trol bleeding at the site of the operation.6, 7 It can reduce the absorption of local anesthetics into the bloodstream, result- ing in decreased systemic toxic side effects, longer therapeutic duration of action, and decreased blood loss.11 The effect of epinephrine, with its non-selective adrenergic properties on the skin and subcutaneous tissues, in a local anesthetic solu- tion is exerted by the constriction of local vasculatures and a decrease in local blood flow.8, 9 Epinephrine, however, has serious side effects and there are some drawbacks owing to possible dose-related heart effects.7 In addition, the change in its concentration tends to have vari- ous effects on the severity of bleeding in the surgical cut.12 The optimum dosage of epinephrine for the prevention of bleeding has still not been specifically established and is controversial in dermatological surgery.9-12 This research was conducted to assess the influence of dose-dependent epinephrine supple- mentation in local anesthesia on intraoperative bleeding regu- lation, and also to assess its effects on hemodynamic properties during dermatological surgery. Effect of local epinephrine on cutaneous blood flow in the human neck. keywords: blood; case; control; epinephrine; group; liposuction; study; surgery cache: jcms-857.pdf plain text: jcms-857.txt item: #362 of 406 id: jcms-859 author: Al-Jobawi, Zainab J; Ali, Besmah M.; Al-Niyazee, Asan A; Ibraheem, Mustafa H title: HPV co-testing as cervical screening test, Experience of Alweiya early detection cervical clinic: one-year Analysis date: 2020-10-30 words: 3679 flesch: 59 summary: Ogilvie GS, van Niekerk D, Krajden M, Smith LW, Cook D, Gondara L, et al. Effect of screening with primary cervical HPV testing vs cytology testing on high-grade cervical intraepithelial neoplasia at 48 months: The HPV FOCAL randomized clinical trial. Screening through cytology has undoubtedly led to a major decline in cervical cancer burden in several resource-rich countries, however, the method might have reached its limits, with reports from several countries with longstanding high-quality cytology-based programmers indicating that trends have either stabilized or began to rise.6 Meta-analyses and pooled analyses of randomized trials have shown that screening with HPV tests protects better against future cervical precancerous lesions and invasive cancers than screening by cytology7-9 and, therefore, virological screening programmes are becoming increasingly recommended.10, 11 Routine cervical screening of women 30 years and older using Papanicolaou (Pap) cytology and HPV together (co-testing) was first approved by the US Food and Drug Administration in 2003.12 Currently, there are two different major guidelines for hr-HPV testing. keywords: cancer; cervical; cytology; hpv; prevalence; results; screening; test; testing; women cache: jcms-859.pdf plain text: jcms-859.txt item: #363 of 406 id: jcms-86 author: Hamdi, Yahia Dahash; Alzubaidi, KA; Al-Kafagy, Siraj M title: Histological study of granulocytic series in the bone marrow of adult goat (Caprus Hircus) date: 2016-09-27 words: 1603 flesch: 59 summary: Communication between bone cells and hematopoietic stem cells. Objectives The aim of this research is to identify and evaluate the cellular granulocytic series of bone marrow in goat that aids to diagnose bone marrow from a variety of clinical disorders in the field of medicine. keywords: bone; cells; fig; giemsa; marrow; ×100 cache: jcms-86.pdf plain text: jcms-86.txt item: #364 of 406 id: jcms-860 author: Shukur, Zaid Yousif Hameed title: The effect of thin lenticule versus thick lenticule (a cut-off value of 55 micrometer) on the outcome of SMILE in low myopia date: 2020-10-30 words: 4470 flesch: 64 summary: In 2008, SMILE was introduced for the first time to be a novel refrac- tive surgical approach.8 A paradigm shift has been marked by refractive lenticule extraction in the refractive surgery field from the well-known and practiced flap-based corneal abla- tive techniques to flapless extraction method of femtosecond laser-produced intrastromal lenticules.9 The extraction of an intrastromal lenticule has been described by Sekundo et al following lifting a flap in 2008, and the procedure has been developed to the SMILE, a procedure in which a small 2–5-mm side cut incision is made through which the refractive lenticule is extracted.8, 10, 11 As of the time this paper is being prepared, femtosec- ond LASIK and SMILE are considered to be the most widely accepted procedures by both refractive surgeons and myopic patients for the correction of refractive errors.12 Refractive lenticule extraction: Transition and comparison of 3 surgical techniques. keywords: acuity; extraction; lenticule; patients; smile; study; thickness; ≤55 cache: jcms-860.pdf plain text: jcms-860.txt item: #365 of 406 id: jcms-861 author: Al-araji, Amna E.; Omran, Tuqa Z.; Ahmed, Mohanad M.; Metib, Nazar J. title: Evaluation of T-Bet immunostaining in the counting of intraepithelial lymphocytes in celiac disease date: 2020-10-30 words: 4747 flesch: 62 summary: Abstract Objective: In this study, we aimed to evaluate CD3, T-bet, and GATA3 staining of intraepithelial lymphocytes (IELs) in comparison to the routine H&E stains in celiac disease. Methods: A total of 50 patients, in whom celiac disease was diagnosed based on a combination of clinicopathological features, were enrolled in the study. keywords: bet; cases; cd3; celiac; count; disease; distribution; iels; marsh; staining cache: jcms-861.pdf plain text: jcms-861.txt item: #366 of 406 id: jcms-862 author: Shukur, Haider Y. title: Long term continuous Trastuzumab use for HER2-positive advanced breast cancer date: 2020-10-30 words: 6221 flesch: 55 summary: Time trends of overall survival among metastatic breast cancer patients in the real-life ESME cohort. patients had serious adverse car- diac events (marked reduction in LVEF % <45% and devel- oped cardiac toxicity) that were not corrected with supportive treatment and/or postponed treatment, therefore, treatment is permanently suspended. keywords: breast; cancer; disease; her2; long; months; patients; progression; response; study; term; therapy; trastuzumab; treatment cache: jcms-862.pdf plain text: jcms-862.txt item: #367 of 406 id: jcms-863 author: Albujeer, Ammar N.H. title: COVID-19 impact on dental education in Iraq; Challenges and future implications date: 2020-10-30 words: 558 flesch: 54 summary: Machado, RA, Bonan, PRF, Perez, DEDC and Martelli JÚnior, H. COVID-19 pandemic and the impact on dental education: discussing current and future perspectives. COVID-19 impact on dental education in Iraq; challenges and future implications Ammar N.H. Albujeer1,2,3, 1 Nab’a Al-Hayat Foundation for Medical Sciences and Health Care, Najaf, Iraq. keywords: dental; iraq cache: jcms-863.pdf plain text: jcms-863.txt item: #368 of 406 id: jcms-864 author: Didari, Tina; Hassani, Shokoufeh; Baeeri, Maryam; Kazemi, Vida; Abdollahi, Mohammad; Mojtahedzadeh, Mojtaba title: Evaluation the cardiopulmonary markers in cecal ligation and puncture induced sepsis in Wistar rats date: 2020-10-30 words: 5477 flesch: 58 summary: Animal Groups All male Wistar rats were randomly divided into the following three groups: Sham or control group (which underwent the same oper- ation without the CLP procedure) and CLP group with G-18 (which was operated with two punctures of G-18) Moreover, no significant differences were found between the heart and lung tissues of CLP groups (Table 1). keywords: autophagy; clp; clp group; gene; group; heart; hours; inflammation; levels; lung; p<0.001; procedure; rats; samples; sepsis; sham; tissue cache: jcms-864.pdf plain text: jcms-864.txt item: #369 of 406 id: jcms-875 author: Ahmady, Soleiman; Seidi, Masoumeh title: The Core components of three functions of clinical supervision in undergraduate medical education during a clinical course date: 2021-04-26 words: 6300 flesch: 36 summary: 72 Supportive/Restorative/Resourcing This function provides support to supervisee’s emotional responses,42 adequately refreshed and recreative,52 to allevi- ate the stress,54,55 well-being,50,53 self-care,50 acknowledges the emotional effects on the individual work, and in particular work with people in distress,19 real-time supervision, positive achievements, coping for adverse incidents.56 Space for trainees to vent their feelings in a listening environment.46 Student sup- port is complemented by the form of peers and peer groups, and the existence of personal tutors or educational advisers,52 facil- itates the discharging of emotions and recharging of energies.20 Discussion This study aimed to identify the characteristics and the com- ponents of clinical supervision functions of medical trainees during a clinical course. Main components of clinical supervision functions of supervised medical trainees. keywords: clinical; components; documents; education; functions; medical; medicine; mentoring; review; school; social; standards; students; supervision; trainees; training; university; work cache: jcms-875.pdf plain text: jcms-875.txt item: #370 of 406 id: jcms-883 author: Caygur, Ayse title: Air Polishing and CHX Effects in Addition to Subgingival Ultrasonic Instrumentation on Clinical Periodontal Parameters: A Randomised Clinical Trial date: 2020-12-26 words: 3037 flesch: 53 summary: effects.14 In one study, glycine powder air-polishing (GPAP) reduced the total viable bacterial counts in periodontal pockets with prob- ing depth (PDs) ranging from 3 to 5 mm and to a significantly greater extent than SRP using curettes.15 However, no studies Air polishing and CHX effects in addition to subgingival ultrasonic instrumentation on clinical periodontal parameters: A randomised clinical trial Ayse Caygur Department of Periodontolgy, Faculty of Dentistry, Near East University, Nicosia, Cyprus. On the other hand, a similar study by Tumer et al,8 there was a significant decrease in all parameters but there were not statistically significant difference between the groups. 284 Original Air polishing andCHX effects in addition to subgingival ultrasonic instrumentation on clinical periodontal parameters Ayse Caygur J Contemp Med Sci | Vol. 6, No. 6, November–December 2020: keywords: chx; gpap; group; instrumentation; periodontal; study cache: jcms-883.pdf plain text: jcms-883.txt item: #371 of 406 id: jcms-886 author: Sajid, Muhammad Raihan; Quraiba, Lama; Khames, Rahaf Iyad; Alhusseini, Noara Khaled; Alsheikh, Haifa; Basha, Nabel; Mansoor, Saad; Omair, Aamir title: Frequency of Dietary Supplements usage in the Saudi Arabian Public and Gym Users date: 2020-12-26 words: 4495 flesch: 53 summary: A cross-sectional study used nationally representative data from the National Health and Nutrition Examination Survey in the United States indicated that over half of Americans used at least one type of dietary supple- ments during the previous month of the study.14 In addition, the prevalence of dietary supplement use among Pakistanis was 48.2%,15 and 35.6% among college students in the United Arab Emirates,16 which confirm the findings of the high prevalence of dietary supplements use in general. Though only 15% of the participants used dietary supplements due to a medical rec- ommendation/prescription from a doctor, it is recommended to increase awareness measures from official health entities by educating the general population and physically active adults about dietary supplement use and adverse effects to ensure safe practices. keywords: arabia; bmi; dietary; effects; gym; participants; respondents; saudi; study; supplements; use cache: jcms-886.pdf plain text: jcms-886.txt item: #372 of 406 id: jcms-887 author: Bahoush, Gholamreza; Pahlevani, Rozhin title: Evaluation of the effectiveness and safety of N-Chromosome Royal Jelly on the number of peripheral white blood cells in patients with acute lymphoblastic leukemia date: 2020-12-26 words: 3284 flesch: 57 summary: In addition, Shirzad and colleagues in a study published in 2013 have concluded that use of RJ in syngeneic mice suf- fering from fibrosarcoma can significantly reduce tumor size (p<0.05).20 Our purpose in this study was to evaluate N-chromosome RJ effects on blood cell counts, especially lymphocyte and neu- trophil absolute count and to see its potentials in patients diag- nosed with ALL in complete remission and maintenance phase. Evaluation of the effectiveness and safety of N-chromosome Royal Jelly on the number of peripheral white blood cells in patients with acute lymphoblastic leukemia Gholamreza Bahoush, Rozhin Pahlevani Department of Pediatric Hematology and Oncology, Ali-Asghar children`s Hospital, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran. keywords: bid; chromosome; patients; tid cache: jcms-887.pdf plain text: jcms-887.txt item: #373 of 406 id: jcms-891 author: Abbas, Yammamah Jawad; Al-Tu'ma, Fadhil Jawad; Al-Hemerri, Alaa Fraq title: Association between Matrix Metalloproteinas-2 Gene Variants and Pathogenesis of Breast Cancer in Sera of Iraqi Women date: 2020-12-26 words: 5174 flesch: 56 summary: In this context, we explored the relationship between susceptibility to breast cancer and the existence of variants of MMP2 (promoter): rs243865 (1306 C/T), as possible biomarkers of breast cancer risk. Materials and Methods Forty-one (41) women with breast cancer with age ranged between 16 and 82 years, and another 45 apparently normal women as a control group with age ranged between 16 and 55 years were included in a case–control study during Nov. 2019 to Sep. 2020. The analysis of results showed that the (rs243865) of MMP-2 gene (C→T) genotype frequencies of wild genotype (CC), heterozygous genotype (CT), and homozygous genotype (TT) were 31.7%, 51.2 %, and 17.1%, respectively in breast cancer patients and 62.2%, 31.1%, and 6.7% in the control group. keywords: allele; breast; breast cancer; cancer; control; gene; genotype; matrix; metalloproteinase-2; patients; risk; value; women cache: jcms-891.pdf plain text: jcms-891.txt item: #374 of 406 id: jcms-896 author: Jasemi, Eghbal; Momtaz, Saeideh; Ghaffarzadegan, Reza; Abdolghaffari, Amir Hossein; Abdollahi, Mohammad title: A narrative review of herbal preparations against RNA viruses date: 2021-02-26 words: 19929 flesch: 60 summary: Keywords viruses, coronaviruses, herbal extracts, phytochemicals, essential oils https://en.wikipedia.org/wiki/Lamiaceae 7 Review A narrative review of herbal preparations against RNA virusesSaeideh Momtaz et al. J Contemp Med Sci | Vol. 7, No. 1, January-February 2021: 6 – 22 study reported that some natural products such as lycorine, homoharringtonine, silvestrol, ouabain, tylophorine, and 7‐ methoxycryptopleurine may possess potential antiviral activ- ities at nanomolecular equivalent concentrations.13 Natural isolates or extracts such as scutellarein, silvestrol, tryptan- thrin, saikosaponin B2, lectins such as griffithsin, lycorine and polyphenolics including quercetin, myricetin, caffeic acid, psoralidin and isobavachalcone were also shown to be active against human coronaviruses.14 Given the significance of nat- ural products, particularly herbal preparations and phyto- chemicals, on viral infections, we tried to collect a list of plant species/bioactive components or antiviral herbal medicine formulations that are capable of combating viral infections in RNA viruses with emphasize on coronaviruses. We avoided studies on DNA viruses and focused on RNA viruses, specifically the coronavirus family. keywords: activity; antiviral; ce ae; cell; coronavirus; da l; dna; e h; e m; e xt; ea e; et al; h iv; herbal; hiv; host; ia l; influenza; inhibitors; io n; itr o; l e; l h; l o; la m; m g/; m ia; m l; med; n m; o il; protein; replication; review; rna; ru s; sars; vi ru; virus; viruses cache: jcms-896.pdf plain text: jcms-896.txt item: #375 of 406 id: jcms-897 author: Hajian, Sara; Yazdani, Shahram; Jadidfard, MohammadPooyan; Khoshnevisan, Mohammad Hossein title: Factors influencing the migration intention of health professionals in low and middle income countries: Critical review with a theoretical model date: 2020-12-26 words: 5017 flesch: 51 summary: Robinson M, Clark P. Forging solutions to health worker migration. Security and skills: the two key issues in health worker migration. keywords: countries; dental; factors; graduates; health; income; medical; migration; model; professional; push; social; study; workers cache: jcms-897.pdf plain text: jcms-897.txt item: #376 of 406 id: jcms-898 author: Farzane, Ali; Akbarzadeh, Maryam; Ferdousi, Reza; Rashidi, Mohammadreza; Safdari, Reza title: Potential biomarker detection for liver cancer stem cell by machine learning approach date: 2020-12-26 words: 7841 flesch: 56 summary: The use of high-throughput techniques has resulted in an exponential growth in the amount of infor- mation available in biomedical databases, which then can be exploited to integrate gene expression data for applications such as biomarker discovery, disease classification, or pheno- type comparisons, among others.9 However, these types of data are characterized by high dimensionality as the number of genes is far bigger than the number of samples. It is responsi- ble for the breakdown of the optimal statistical model fitting.10 To address the problem, researchers have applied various machine learning methods to reduce both cardinality and redundancy of gene expression data during the classification process, and most of these methods were developed to facil- itate the analysis of microarray data to identify the best dis- criminative genes or biomarkers.11 Extreme gradient boosting (XGBoost) is a machine learn- ing algorithm that assigns an importance score to each feature in the training phase, and these scores can then be used as the basis for identification of importance features. keywords: analysis; batch; biomarker; cancer; cell; cscs; data; effect; expression; feature; fig; gene; importance; liver; model; xgboost cache: jcms-898.pdf plain text: jcms-898.txt item: #377 of 406 id: jcms-903 author: Soltani, Maryam; Hassanipour, Soheil; Veisani, Yousef; Darbandi, Mitra; Rezaiean, Shahab title: The Global survival rate of patients with beta thalassemia major: a systematic review and meta-analysis date: 2021-04-26 words: 3744 flesch: 62 summary: Selected keywords for international databases included: “beta-Thalassemia”, survival rate”, “sur- vival analysis” and “Kaplan–Meier estimate” The initial search was conducted by two researchers (ShR and SH). Methods A comprehensive literature search of five international databases including Medline/PubMed, Scopus, Embase, Web of knowledge, and ProQuest was conducted to identify studies reporting survival rate of beta-thalassemia major until March 2020. keywords: analysis; beta; iran; major; patients; rate; studies; study; survival; survival rate; thalassemia; year; year survival cache: jcms-903.pdf plain text: jcms-903.txt item: #378 of 406 id: jcms-910 author: Qalqili, Tamara; Rayyan, Yaser; Tayyem, Reema title: Nutrition and Lifestyle Factors Associated with Inflammatory Bowel Disease date: 2021-04-26 words: 6290 flesch: 50 summary: Ghosha C, Shukla, A. Malnutrition in inflammatory bowel disease patients in northern India: frequency and factors influencing its development. Inflammatory bowel disease (IBD) is a chronic inflammatory condition of unknown etiology that is thought to result from a complex interaction of genetic predisposition (leading to immunological abnormalities), dysbiosis of the gut microbi- ota, and environmental influences. keywords: bmi; bowel; bowel disease; diet; disease; factors; ibd; lifestyle; patients; review; risk; smoking; studies; study cache: jcms-910.pdf plain text: jcms-910.txt item: #379 of 406 id: jcms-912 author: Ali, Alaa Abbas; Abd, Kais Hassan; Saleem, Zana Sidiq title: Expression of VWF and Interferon γ in renal allograft biopsies and correlation with inflammatory cells. Single center experience. date: 2021-02-26 words: 4335 flesch: 53 summary: Jones periodic acid-methenamine silver stains were performed on Expression of VWF and Interferon γ in renal allograft biopsies and correlation with inflammatory cells. Methods Forty-nine (49) indicated renal allograft biopsies were analyzed histologically by the Banff 2017 classification, inflammatory cell infiltration was analyzed by immunohistochemistry study for CD4, CD8, CD16, and CD68 markers, and a fresh tissue used for molecular study. keywords: acute; cells; expression; normal; rejection; renal; tcmr; transplant; vwf cache: jcms-912.pdf plain text: jcms-912.txt item: #380 of 406 id: jcms-919 author: Jabbarzadehkhoei, Foujan; Bakhshandeh, Soheila; Namdari, Mahshid; Pakkhesal, Mina; Khoshnevisan, Mohammad Hossein title: Periodontal and chronic kidney diseases: A modifiable association date: 2021-02-26 words: 4023 flesch: 52 summary: Periodontal disease: a covert source of inflammation in chronic kidney disease patients. Likewise, such correlations have been assumed between periodontal diseases and a number of other systemic conditions such as cardiovascular diseases, diabetes mellitus, osteoporosis, respiratory diseases, rheumatoid arthritis, low birth weight, and immature birth.4,12-19 In general, periodon- titis is a multifactorial disease, and therefore, several factors are affecting the susceptibility and development of periodon- tal diseases.20,21 The prevalence of periodontal disease has been reported 57% in CKD patients.22 keywords: chronic; ckd; correlation; disease; health; index; kidney; oral; patients; periodontal; study cache: jcms-919.pdf plain text: jcms-919.txt item: #381 of 406 id: jcms-920 author: Alshehri, Wafa A.; Moussa, Tarek A. A. title: Extended-spectrum β-lactamase Enterobacteriaceae from patients in Jeddah, Saudi Arabia: Antibiotic susceptibility and molecular approaches date: 2021-02-26 words: 4049 flesch: 61 summary: Changes in the frequencies of β-lactamase genes among Enterobacteriaceae isolates in US hospitals, 2012 to 2014: activity of ceftazidime-avibactam tested against β-lactamase- producing isolates. The presence of these genes in pairs in the same strain was detected, where the highest pair of genes in the same organism was blaTEM + blaCTX-M (134) (E. coli (74), K. pneumoniae (51) and E. cloaca (9)), followed by blaSHV + blaCTX-M (64) (K. pneu- moniae (63) and E. cloaca (1)), blaSHV + blaTEM (52) (K. pneu- moniae (51) and E. cloaca (1)) and the least pairs were blaTEM + blaOXA (3) (E. cloaca (2) and P. mirabilis (1)) and blaCTX-M + blaOXA (2) in E. cloaca only. keywords: bla; coli; ctx; enterobacteriaceae; oxa; shv cache: jcms-920.pdf plain text: jcms-920.txt item: #382 of 406 id: jcms-926 author: Almaawi, Ahmed Kh. Mohammed title: Detecting chronic kidney disease in diabetic adults by estimating glomerular filtration rate and Serum Creatinine date: 2021-02-26 words: 5192 flesch: 60 summary: Female No=221 209 94.6% 18 8.1% 6 2.7% 0 0% 1 0.5% 196 88.7% 209 94.6% 12 5.4% 26.1±2.6 (18.3-30) 61-70 Male No=130 127 97.7% 16 12.3% 65 50% 4 3.1% 4 3.1% 41 31.5% 115 88.5% 15 11.5% 25.2±2.5 (16.7-30) Female No.=97 91 93.8% 3 3.1% 7 7.2% 3 3.1% 0 0% 84 86.6% 96 99% 1 1% 26.3±2.8 (19.5-30) 18-70 Male No=405 374 92.3% 104 25.7% 93 23% 13 3.2% 33 8.1% 162 40% 357 88.1% 48 11.9% 25.2±2.6 (16.7-29.98) Female No=395 350 88.6% 28 7.1% 13 3.3% 4 1% 3 0.8% 347 87.8% 370 93.7% 25 6.3% 26±2.6 (18.3-30) Total N=800 724 90.5% 132 16.5% 106 13.3% 17 2.1% 36 4.5% 509 63.6% 727 90.9% 73 9.1% 25.6±2.6 (16.7-30) n.: number of subjects with specific characteristic; %: Percentage= (n. /No); Cockcroft Gault equation; eGFR: estimated Glomerular Filtration Rate; n.: number of subjects with characteristic; %: Percent= (n. /N). keywords: chronic; ckd; disease; egfr; epi; equation; female; kidney; prevalence; study cache: jcms-926.pdf plain text: jcms-926.txt item: #383 of 406 id: jcms-928 author: Jahandideh, Ali Akbar; Rohani, Hadi; Rajabi, Hamid; Shariatzadeh, Mohammad; Razmjou, Sahar title: LEP and LEPR Polymorphisms Influences Anthropometric Outcome in Response to 8 Weeks of Combined Training in Obese boys date: 2021-04-26 words: 6360 flesch: 58 summary: rs1137101 leptin receptor gene on body mass (P = 0.04, F = 3.625) and WHR (P  =  0.037, F  =  3.75). In addition, participants with G homozygous experienced a greater reduction in leptin levels in response to training which is same as previous studies.10 In a study conducted on 242 European participants, Walsh et al. showed that individuals with GG homozygous may gain additional health benefits from expending more energy in training due to their genetic predisposition compared to carriers of the A allele.10 In rs1137101 leptin receptor gene, the lowest leptin level was observed in GA heterozygous at baseline. keywords: body; gene; lepr; leptin; mass; obesity; receptor; rs1137101; rs2167270; study; training; whr cache: jcms-928.pdf plain text: jcms-928.txt item: #384 of 406 id: jcms-932 author: Amiri, Ali; Khosravi, Setareh; Torabi, Shiva; Golshekan, Hadi; Qi, Fan title: Evaluating the effect of the temporal intra-oral skeletal anchorage device (TISADs) for facilitating the anchorage reinforcement: A meta-analysis and systematic review date: 2021-02-26 words: 3600 flesch: 55 summary: Then, we computed the mean difference of TISADs and conventional anchorage groups with a confidence interval (CI) of 95%, restricted maximum likelihood, and random effect model of the mesial movement of molars and their tipping. 2017;151(3):440-55.https://doi.org/10.1016/j. ajodo.2016.08.029. 8. Diar-Bakirly S, Feres MF, Saltaji H, Flores-Mir C, El-Bialy T. Effectiveness of the transpalatal arch in controlling orthodontic anchorage in maxillary premolar extraction cases: A systematic review and meta-analysis. keywords: analysis; anchorage; group; meta; orthodont; review; studies; study; tisads; treatment cache: jcms-932.pdf plain text: jcms-932.txt item: #385 of 406 id: jcms-937 author: Almarzouki, Nawaf; Faisal, Konooz; Nassief, Arwa; Najem, Noura; Eid, Rayana; Albakri, Renad; Alhibshi, Dana; Alwethinani, Shehana; Ashi, Heba title: Digital Eye Strain During COVID-19 Lockdown in Jeddah, Saudi Arabia date: 2021-02-26 words: 4024 flesch: 66 summary: The second part included the participant’s habits like using the computer; the third part included the frequency and intensity of eye symptoms, and the final part included habits to reduce symptoms of CVS. This was the fact due to which numerous children and their parents were compelled to use electronic devices more frequently to connect them- selves with the outside world.1 Unfortunately, this frequent use of electronic devices lead them towards computer vision syndrome (CVS). keywords: computer; cvs; eye; n=1048; screen; severity; study; symptoms; use; vision cache: jcms-937.pdf plain text: jcms-937.txt item: #386 of 406 id: jcms-940 author: Forouhandeh, Haleh; Zarchini, Mahtab; Safarzadeh, Elham; Molavi, Omoleila; Asgharian, Parina; Tarhriz, Vahideh title: Evaluation of the Cytotoxic Activity of Anthriscus nemorosa on Breast Cancer Cells date: 2021-08-26 words: 6444 flesch: 58 summary: 1 Viability of MCF-7 cancer cells after exposure to increasing concentrations of n-Hex, DCM, and MeOH extracts of A. nemorosa after 24 and 48 hours of incubation. 7 Flow cytometric test of n-Hex extract and some of its fractions on MCF-7 cells and comparison of apoptotic and necrotic cells in MCF-7 cell line. that n-Hex extract had significantly (P < 0.001) more cytotox- icity on MCF-7 cancer cells in 24 and 48 hours treatment com- pared to DCM, MeOH extracts and DMSO control. keywords: activity; anthriscus; breast; cancer; cells; cytotoxic; extract; fractions; hex; hours; nemorosa cache: jcms-940.pdf plain text: jcms-940.txt item: #387 of 406 id: jcms-943 author: Khavid, Atefeh; Sametzadeh, Mojgan; Godiny, Mostafa; Moarrefpour, Mohammad Mehdi title: Comparison of the Hounsfield Unit Values Obtained From Cone-Beam Computed Tomography (CBCT) and Multidetector Computed Tomography (MDCT) Images for Different Bone Densities date: 2021-04-26 words: 3002 flesch: 56 summary: Fuster-Torres MÁ, Peñarrocha-Diago M, Peñarrocha-Oltra D, Peñarrocha- Diago M. Relationships between bone density values from cone beam computed tomography, maximum insertion torque, and resonance frequency analysis at implant placement: a pilot study. For this purpose, a comparison was made between the HU values obtained for a series of specimens with different bone densities from CBCT and MDCT images. keywords: bone; cbct; density; images; mdct; specimens; tomography; values cache: jcms-943.pdf plain text: jcms-943.txt item: #388 of 406 id: jcms-944 author: Ashi, Heba title: Oral health of children in association with gender and mothers' education: a comparative cross-sectional study date: 2021-02-26 words: 3809 flesch: 66 summary: % <0.001* Once or a few times a week 11 4% 11 15% 25 12% Once a day 65 26% 9 12% 75 36% Twice a day 97 39% 41 55% 89 43% More than twice a day 60 24% 10 13% 14 7% Other 17 7% 2 3% 3 1% 2. 53 Original ISSN 2413-0516 J Contemp Med Sci | Vol. 7, No. 1, January-February 2021: 53 – 60 Introduction The World Health Organization (WHO) states that oral health is considered a part of the general well-being and is an essen- tial element for good quality of life.1 Good oral health helps us speak, smile, taste, chew, swallow, and express ourselves confidently.2,3 Besides, it affects appearance, by allowing peo- ple to perform their daily activities without psychological or social limitations (Shah and ElHaddad, 2015)not many peo- ple are aware of the relationship of smoking with potential oral diseases. keywords: children; dental; education; gender; health; hygiene; mothers; oral cache: jcms-944.pdf plain text: jcms-944.txt item: #389 of 406 id: jcms-945 author: Talei, Sahand; Mokhtari, Tahmineh; Asadi, Ilia; Arab, Leila; Hassanzadeh, Negar; Hosseinjani, Emadoddin; Hassanzadeh, Gholamreza title: Flaxseed oil (Linum Usitatissimum) attenuates restraint stress-induced depressive-like behavior: Upregulation of neurotrophic factors in CA1 region of hippocampus date: 2021-02-26 words: 4475 flesch: 55 summary: Methods In this study, 32 male mice were divided into 4 groups: Control group; FS oil group; Model group: The immobility stress (using falcon for 20 day, 6 h a day) Results Effects of FS oil on depressive-like behavior TST was used for evolutions of FS oil effects on depressive like behavior. keywords: bdnf; behavior; brain; ca1; depressive; effects; gdnf; group; immobility; mice; model; oil; region; stress cache: jcms-945.pdf plain text: jcms-945.txt item: #390 of 406 id: jcms-947 author: Al Jabri, Abdullah Rashid; Al Mawali, Adhra title: Risk Factors Associated with Diabetic Foot Disease in Diabetes Patients: First National Study in Oman date: 2021-04-26 words: 4727 flesch: 64 summary: - Increased public awareness of DFD risk factors and its substantial impact on the incidence and outcomes of the disease. All retrieved case files were studied thoroughly to find out all the relevant data related to DFD patients includ- ing their presence of foot ulcers, date of diagnosis, onset of disease, age, gender, HbAc1 (levels of glycosylated hemoglo- bin), body mass index (BMI), LDL, HDL, triglyceride, and total blood cholesterol before getting DFD. keywords: age; analysis; dfd; diabetes; factors; foot; oman; patients; risk; study cache: jcms-947.pdf plain text: jcms-947.txt item: #391 of 406 id: jcms-951 author: Al-Khayat, Zakarea Abdullah Yaseen; Faqi, Sharmeen Qadr; Hasan, Dlshad Abdullah; Falo, Dalia Yaqoub title: Single Center Study of Vaccination Breakthrough infection with SARS-CoV-2 Among Erbil Population in August 2021 date: 2021-10-02 words: 3421 flesch: 56 summary: COVID-19 vaccines are efficient and pivotal weapons to boost the control of this pandemic2. However, early studies propose that COVID-19 vaccines shelter against severe illness; however, postvaccination SARS-CoV-2 infections (i.e., breakthrough infections) can occur because COVID-19 vaccines do not offer 100% protec- tion12. keywords: cov-2; covid-19; incidence; infection; pcr; persons; sars; study; vaccinated; vaccination; vaccine cache: jcms-951.pdf plain text: jcms-951.txt item: #392 of 406 id: jcms-955 author: Al-Khayat, Zakarea Abdullah Yaseen; Agha, Nabaz Fisal Shakir; Majeed, Pshtiwan Dhahir; Alharmni, Kawthar Ibrahim Fatah; Agha, Derin Nabaz Fisal title: Prevalence of HIV among newly diagnosed tuberculosis patients in Erbil Governorate, Iraq date: 2021-04-26 words: 6266 flesch: 53 summary: Prevalence rates of HIV TB patients vary internationally.16 Conclusions The prevalence of HIV infection in TB patients in current study was 10.3%. keywords: age; cases; erbil; health; hiv; hiv infection; infection; med; patients; prevalence; pulmonary; studies; study; tb patients; test; tuberculosis; tuberculosis patients cache: jcms-955.pdf plain text: jcms-955.txt item: #393 of 406 id: jcms-956 author: Osman, Nadia N.; Al-Mutairi, Dalal Mhammed title: Effect of Oral Contraceptive Pills on Oxidative Stress in Saudi women date: 2021-04-26 words: 4678 flesch: 54 summary: Variables Group N Mean p-value Sig Vitamin E NOC 25 0.000 H. Sig OCP 30 24.379.87 Vitamin B6 NOC 25 627.65123.38 0.000 H. Sig OCP 30 274.1870.24 Vitamin B12 NOC 25 267.4867.05 0.32 N. Sig OCs 30 248.46 NOC non-oral contraceptives, OCP oral contraceptives pills. Chen, J-T, Kotani, K. Different effects of oral contraceptive and dydrogesterone treatment on oxidative stress levels in premenopausal women. keywords: antioxidant; contraceptive; crp; effect; levels; ocp; oxidative; stress; study; users; vitamin; women cache: jcms-956.pdf plain text: jcms-956.txt item: #394 of 406 id: jcms-960 author: Wennas, Osamah N.; Mohammed, Mohammed H.; Al Abood, Raid M.; Abed, Dhulfiqar A title: Design, Synthesis, and Biological Evaluation of Camptothecin Loaded Biotinylated Cellulose Nanowhiskers as Anticancer Agents date: 2021-06-26 words: 5071 flesch: 60 summary: Sample Particle size PDI Zeta potential Biotin % CPT % CNWs 68.1±4.19 0.383±0.124 -34.33±1.59 - - Compound 10 81.23±0.3.53 0.462±0.052 -65.2±2.40 - - Compound 12 87.26±3.496 0.369±0.035 -45.16±1.20 The in vitro drug release was studied at different GSH concentrations, and the cytotoxic effects of the nano con- jugate on MCF7, HpeG2, and CHO cell lines were studied and compared with CPT prodrug without the nanocarrier. keywords: biotin; camptothecin; cellulose; cnws; compound; cpt; mmol; nmr; release; synthesis cache: jcms-960.pdf plain text: jcms-960.txt item: #395 of 406 id: jcms-961 author: Abdulla, Nour Ali; Ghafel, Hawraa Hussein title: Correlation between Placenta Accreta and History of Cesarean Section among Iraqi Pregnant Women: Retrospective study date: 2021-04-26 words: 2456 flesch: 57 summary: miscarriage.5 6 Methodology A retrospective study among pregnant women diagnosed with placenta accreta who undergo a cesarean section (C/S) at maternity wards in Baghdad City’s Teaching Hospitals. Abstract Objective To identify demographic characteristics of pregnant women with placenta accreta and to find out the correlation between placenta accreta and history of cesarean section (C/S). keywords: accreta; cesarean; history; placenta; pregnant; women cache: jcms-961.pdf plain text: jcms-961.txt item: #396 of 406 id: jcms-962 author: Alfakeh, Sulhi A.; Alghamdi, Khaled Mesfer; Hilal, Rawan Mostafa; Abdelmoaty, Marwa Mohamed title: Rates of depression, anxiety, and stress in King Abdulaziz University freshmen, Jeddah, Saudi Arabia: a cross-sectional study date: 2021-04-26 words: 5159 flesch: 59 summary: The first-year experience: Mental health of university students in Okinawa, Germany, and Thailand. al conducted a systemic review on depres- sion prevalence in university students, including 24 studies from 12 different countries—2 of them were within the mid- dle-east: Egypt and Lebanon. keywords: anxiety; depression; health; prevalence; saudi; stress; students; study; symptoms; university cache: jcms-962.pdf plain text: jcms-962.txt item: #397 of 406 id: jcms-963 author: Jasim, Alaa Fahem; Al-Tu'ma, Fadhil Jawad; Faisal, Dhafir Abdul-Mahdi title: Association between Microalbuminuria and MYH9 Gene Polymorphisms in Hypertensive Iraqi Patients with Metabolic Syndrome date: 2021-04-26 words: 4771 flesch: 56 summary: The significant result (P ≤ 0.01) were appeared between TT for MYH9 genotype patients and obese control with biochemical parameters (Blood glucose, HbA1c, TC, TG, VLDL-C, and LDL-C). The correlation between TT SNP for MYH9 genotype patients and non-obese control with biochemical parameters is significant result (P ≤ 0.01 and P ≤ 0.05) (Blood glucose, HbA1c, insulin, TC, TG, VLDL-C, LDL-C, urea, and microalbuminuria). keywords: blood; control; metabolic; myh9; obese; parameters; patients; syndrome cache: jcms-963.pdf plain text: jcms-963.txt item: #398 of 406 id: jcms-97 author: Shuaila, Mohammed Abdulwahid; Abdulamir, Hassanain M Saeed; Alshok, Monem Makki title: Prognostic value of cystatin C in acute coronary syndrome date: 2016-12-23 words: 3984 flesch: 57 summary: 0.5–1.0 ml of serum is stored at 2–8 Celsius for a few days for the measurement of Cystatin C level. Also, we found that higher patient with higher level of Cystatin C levels have associated with increased incidence in hospital electrical complications (P value 0.035), and this agrees with Osama Tayah et al. who have confirmed that higher level of Cystatin C is associated with a higher chance of electrical complications (P value 0.029). keywords: coronary; cystatin; disease; heart; level; mortality; patients; risk; study; value cache: jcms-97.pdf plain text: jcms-97.txt item: #399 of 406 id: jcms-970 author: Rashad, Brisik H; Abdi, Basheer A; Naqid, Ibrahim A; Hussein, Nawfal R; Ibrahim, Zubaida A; Rashad, Jodi A; Saleem, Shangist M; Saleh, Avan S; Mustafa, Alaa A title: Risk factors associated with poor glycemic control in patients with type two Diabetes mellitus in Zakho city: Risk factors associated with Type 2 Diabetes mellitus date: 2021-06-26 words: 2811 flesch: 63 summary: Discussion To prevent organ damage and other complication of diabetes, glycemic control remains the main therapeutic objective.15 It was previously shown that diabetic patients who control their HBA1C below 7% will have less microvascular diabetic com- plications.14 Age, sex, waist circumference, smoking history, family history, body mass index and hypertension were shown to play role in the control of HBA1C.6,9,10,16,17 Studying risk fac- tors associated with poor glycemic control is crucial for the control of diabetes in any society. A better understanding of the tra- ditional drivers “risk factors” of the diabetes is required in order to combat the disease.3 There are considerable number of risk factors associated with poor glycemic control including age; sex; family history; smoking history; hypertension; chronic diseases such as Ischemic heart disease, bronchial asthma and thyroid diseases; raised body mass index and raised waist circumfer- ence.6-10 Few studies have been conducted in neighboring coun- tries to Iraq to assess the risk factors associated with poor glycemic control.11-13 The aim of this study was to investigate the prevalence of poor glycemic control in Zakho city in Kurdistan Region of Iraq and to explore the modifiable risk factors that may help controlling the disease. keywords: control; diabetes; factors; hba1c; patients; risk; study; type cache: jcms-970.pdf plain text: jcms-970.txt item: #400 of 406 id: jcms-972 author: Al-Brefkani, Azad Mohammed Taher; Naqid, Ibrahim A; Yahya, Nizar Bakir; Hussein, Nawfal title: Seroprevalence and risk factors associated with Helicobacter pylori infection among children aged less than 18 years old in Duhok Province, Iraq: Prevalence and risk factors for H. pylori infection date: 2021-06-26 words: 4715 flesch: 58 summary: Another study also found that 28% of recruited samples were seropositive for H. pylori infection in Duhok Province, Iraq, which is slightly lower than the prevalence reported in our study.17 The prevalence of H. pylori infection ranges from more than 70% in devel- oping countries, such as India and Bangladesh, to around 20% in developed countries, such as Australia and the Netherlands.18 However, the prevalence of infection in our study was much lower than that reported in several studies in Iran, where H. pylori infection rates were found to be at 47% to 64%19 and at 72.8%.20 Nguyen et al. conducted another study in Langson province, Vietnam, and found an overall seropositivity rate of 41.4% to 46.8% in children.21 In a previous study conducted in Iraq, the prevalence of H. pylori infection varied according to age group, ranging from 27% in children to 58% in teenagers.5 keywords: children; factors; h. pylori; helicobacter; infection; iraq; prevalence; pylori; pylori infection; risk; study cache: jcms-972.pdf plain text: jcms-972.txt item: #401 of 406 id: jcms-976 author: S.Hariri, Armin; Shayesteh, Sevda; Asgharian, Parina; Chamanara, Mohsen; Sadrzadeh-Afshar, Maryam-Sadat title: Eremostachys Binalodensis, A Potential Therapeutic Choice for Gingival Inflammatory Wounds date: 2021-06-26 words: 3998 flesch: 49 summary: Cells were cultured in Abstract Objectives In this study we aimed to evaluate the effect of E. binalodensis on gingival inflammatory wounds. Conclusions Regarding anti-inflammatory and proliferative effects of E. binalodensis on hGFs, availability and safety of it, it is suggested for enhancing the wound healing process in gingival inflammatory wounds. keywords: binalodensis; gingival; group; healing; hgfs; il-1β; il-6; inflammatory; lps; scratch; tnf; wound cache: jcms-976.pdf plain text: jcms-976.txt item: #402 of 406 id: jcms-98 author: Al-Khayat, Hasanain Salah; Al-Ameri, Ali Mansoor; Abode, Moaid Abdulbari title: Inflammatory status as a contributor for anemia in patients with chronic kidney disease in Karbala, Iraq date: 2016-12-23 words: 2355 flesch: 56 summary: An increased level of the proinflammatory cytokine, interferon gamma, was detected in renal failure and some sort of competition for common receptors between Erythropoietin and interferon gamma was suggested.2,12 Similarly, it was found that inflammatory factors contribute to anemia in renal patients in all the stages of renal failure and cytokines like interleukin 1 and 6 were associated with anemia in those patients.13 Another proposed role of the inflammatory cytokines, such as interleukins (IL-1 and IL-6), and tumor necrosis factor (TNF-alpha), is that they are believed to cause the destruction of RBC precursors and decrease the number of erythropoietin receptors on progenitor cells.14 Data analysis of this study also express significantly reduced level of serum albumin especially in HD group. Can a nutrition intervention improve albumin levels among hemodialysis patients? keywords: anemia; ckd; count; kidney; patients cache: jcms-98.pdf plain text: jcms-98.txt item: #403 of 406 id: jcms-982 author: Mohammadifard, Mahyar; Khorashadizadeh, Nasrin; Zarouni, Maryam title: Detection rate of fetal CNS anomalies by first and second trimester ultrasound screening date: 2021-06-26 words: 2578 flesch: 54 summary: Keywords CNS anomaly, ultrasound, first trimester, second trimester ISSN 2413-0516 165J Contemp Med Sci | Vol. 7, No. 3, May-June 2021: 164–166 M. Mohammadifard et al. Original Detection rate of fetal CNS anomalies by first and second trimester ultrasound screening trimester at week 18-20 by a 5-8 mhz ultrasound transducer. Conclusion Second trimester ultrasound is the method of choice in diagnosing central nervous system abnormalities. keywords: abnormalities; age; anomalies; cns; study; system; trimester; ultrasound cache: jcms-982.pdf plain text: jcms-982.txt item: #404 of 406 id: jcms-986 author: Akbari, Hassan; Heydarolad, Khadije title: The supply of cellular energy by changing in diet and life-style a possible treatment for uterine myoma and cyst: A case report date: 2021-08-26 words: 2400 flesch: 51 summary: Inanmdar W, Sultana A, Mubeen U, Rahman K. Clinical efficacy of Trigonella foenum graecum (Fenugreek) and dry cupping therapy on intensity of pain in patients with primary dysmenorrhea. According to the Traditional Persian medicine, cupping therapy has a favorable effect on uterus and ovaries func- tions improvement and is recommended for their related diseases.14 The possible therapeutic effects of cupping therapy have been studied previously. keywords: cupping; cyst; energy; honey; medicine; myoma; patient; therapy cache: jcms-986.pdf plain text: jcms-986.txt item: #405 of 406 id: jcms-987 author: Alsilmi, Rahmah title: Effect of Early Initiation of Combination Therapy of Anti-Inflammatory and Anti-Fibrotic Drugs on Post COVID-19 Interstitial Lung Disease: A Case Report date: 2021-06-26 words: 2708 flesch: 46 summary: Some predictors of the outcome of lung fibrosis post-acute COVID-19 were reported to include older age, length of hospital stay, ICU admission, maximum CT score of the parenchymal changes at the initial illness, and elevated inflammatory markers.9,10,11 Moreover, the factors that might correlate with persistence of the lung parenchymal changes on subsequent chest images and thus might predict subsequent pulmonary fibrosis were noted to include the severity of the initial illness, elderly age, and comorbidities.7 This observation signifies the importance of close follow-up on the patients with these potential risk fac- tors for early identification, monitoring, and adequately treating this substantial outcome. Effects of pirfenidone on transforming growth factor-beta gene expression at the transcriptional level in bleomycin hamster model of lung fibrosis. keywords: acute; covid-19; fibrosis; lung; patients; post; pulmonary cache: jcms-987.pdf plain text: jcms-987.txt item: #406 of 406 id: jcms-998 author: Alharbi, Samah; Eid, Refaat A. title: Exogenous acylated ghrelin promotes but un-acylated ghrelin prevents hepatic steatosis by modulating peripheral insulin resistance and hepatic oxidative and endoplasmic reticulum stress date: 2021-06-26 words: 9075 flesch: 57 summary: Porteiro, B., Díaz-Ruíz, A., Martínez, G., Senra, A., Vidal, A., Serrano, M., Gualillo, O., López, M., Malagón, M. M. & Diéguez, C. J. E. 2013. Wang, D., Wei, Y. & Pagliassotti, M. J. 2006. keywords: control; data; fatty; fig; ghrelin; glucose; hepatic; insulin; journal; levels; liver; protein; rats; stress; uag cache: jcms-998.pdf plain text: jcms-998.txt