item: #1 of 150
          id: jear-10861
      author: Prat, Narcís; Castro-López, Daniel
       title: Chironomidae as indicators of water pollution in Pesquería River (México)
        date: 2023-05-03
       words: 5901
      flesch: 57
     summary: They can even significantly contribute to the terrestrial organic matter budget of riparian areas by exporting flying adults (Soininen et al., 2015). Thus, the taxonomic level at which midges are identified is very important (Edward et al., 2000; Molineri et al., 2020).
    keywords: area; castro; chironomidae; et al; february; lópez; mexico; midges; pesquería; pollution; river; sites; species; taxa; use; water
       cache: jear-10861.pdf
  plain text: jear-10861.txt

        item: #2 of 150
          id: jear-1091
      author: None
       title: jear-1091
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1091.htm
  plain text: jear-1091.txt

        item: #3 of 150
          id: jear-1451
      author: Kolařík, P.; Rotrekl, J.
       title: Regulation of the abundance of clover seed weevils, Apion spp. (Coleoptera: Curculionidae) in a seed stand of red clover (Trifolium pratense L.)
        date: 2013-12-20
       words: 3506
      flesch: 62
     summary: In stands of red clover, seed weevils of the genus Apion represent the most important group of insect pests (Hansen & Boelt, 2008; Kolařík & Rotrekl, 2012a; Rotrekl & Kolařík, 2011; Langer & Rohde, 2008) and can markedly decrease yields of clover seed material (Langer & Rohde, 2008; Lundin et al., 2012). [page 105] Regulation of the abundance of clover seed weevils, Apion spp.
    keywords: clover; insecticides; kolařík; larvae; rotrekl; seed; treatments; weevils
       cache: jear-1451.pdf
  plain text: jear-1451.txt

        item: #4 of 150
          id: jear-1456
      author: Minaei, K.; Alichi, M.
       title: The grass-living thrips (Insecta: Thysanoptera) from Iran with the first record of the genus Arorathrips Bhatti
        date: 2013-09-06
       words: 3311
      flesch: 65
     summary: Nine families are recognized in the order Thysanoptera (Mound et al., 2013), of which five (Aeolothripidae, Stenurothripidae, Melanthripidae Phlaeothripidae, Thripidae) have been recorded in Iran so far (Minaei & Alichi, 2007). Mound et al., 1976 Limothrips Haliday zur Strassen, 2003 Sitothrips Priesner zur Strassen, 2003 Sphaeropothrips Priesner Minaei et al., 2007 Stenchaetothrips Bagnall zur Strassen, 2003 Stenothrip Uzel zur Strassen, 2003 *Not all species breeding on grasses.
    keywords: cia; cia l; iran; mound; nco; species; thrips; thysanoptera
       cache: jear-1456.pdf
  plain text: jear-1456.txt

        item: #5 of 150
          id: jear-1460
      author: None
       title: jear-1460
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1460.htm
  plain text: jear-1460.txt

        item: #6 of 150
          id: jear-1469
      author: Toroitich, F. J.; Knapp, M.; Nderitu, J. H.; Olubayo, F. M.; Obonyo, M.
       title: Susceptibility of geographically isolated populations of the Tomato red spider mite (Tetranychus evansi Baker & Pritchard) to commonly used acaricides on tomato crops in Kenya
        date: 2014-04-14
       words: 4999
      flesch: 60
     summary: Results Acaricides used for spider mites control In Loitoktok, three of four sampled farmers used Dimethoate while the remaining one used Polytrin. Another interesting observation is that T. evansi from Loitoktok appears toler- ant to Karate (lambda-cyhalothrin) yet the farmers from that region had not used it for spider mite control.
    keywords: 100±0*a; acaricides; control; dimethoate; evansi; kenya; mites; mortality; spider; tetranychidae; tetranychus; tomato
       cache: jear-1469.pdf
  plain text: jear-1469.txt

        item: #7 of 150
          id: jear-1553
      author: Marziali, L.; Rossaro, B.
       title: Response of chironomid species (Diptera, Chironomidae) to water temperature: effects on species distribution in specific habitats
        date: 2013-09-06
       words: 19782
      flesch: 63
     summary: Species response under differ- No n- co mm er cia l thermal habitat (Hester & Doyle, 2011). Species response under differ- ent global change scenarios can thus be predicted (Bonada No n- co mm er cia l ent global change scenarios can thus be predicted (Bonada et al.
    keywords: alpine; altitude; chironomid; cia l; data; distribution; et al; figure; habitats; lakes; larvae; nco; optimum; potamal; response; rhithral; river; rossaro; samples; species; temperature; thermal; values; water; water temperature; ° c
       cache: jear-1553.pdf
  plain text: jear-1553.txt

        item: #8 of 150
          id: jear-1600
      author: None
       title: jear-1600
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1600.htm
  plain text: jear-1600.txt

        item: #9 of 150
          id: jear-1620
      author: None
       title: jear-1620
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1620.htm
  plain text: jear-1620.txt

        item: #10 of 150
          id: jear-1622
      author: None
       title: jear-1622
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1622.htm
  plain text: jear-1622.txt

        item: #11 of 150
          id: jear-1633
      author: Oftadeh, M.; Sendi, J.J.; Zibaee, A.; Valizadeh, B.
       title: Effect of four varieties of mulberry on biochemistry and nutritional physiology of mulberry pyralid, Glyphodes pyloalis Walker (Lepidoptera: Pyralidae)
        date: 2014-08-29
       words: 8047
      flesch: 60
     summary: They were reared on fresh mulberry leaves (different host plants) in the laboratory at 24±1°C, 75±5% RH and 16:8 (L:D) 32: 262-268. HEMATI S.A., NASERI B., NOURI GANBALANIC G., RAFIEE DASTJERDI H., GOLIZADEH A., 2011 - Effect of different host plants on nutritional indices of the pod borer, Helicoverpa armigera.
    keywords: activity; df=3; digestive; ecd; efficiency; fed; food; host; ichinose; indices; insect; instar; kenmochi; larvae; mahalii; mulberry; nutritional; plant; protein; pyloalis; shin
       cache: jear-1633.pdf
  plain text: jear-1633.txt

        item: #12 of 150
          id: jear-1658
      author: Ruse, L.P.
       title: Chironomid (Diptera) species recorded from UK lakes as pupal exuviae
        date: 2013-09-06
       words: 4763
      flesch: 56
     summary: Chironomid pupal exuviae were identified using the CD-ROM key of Langton & Visser (2003) and followed its nomenclature unless sub- sequently changed and recorded in Fauna Europaea (version 2.6., 2013; http://www.faunaeur.org). RUSE L.P., 2002 - Chironomid pupal exuviae as indicators of lake sta- tus.
    keywords: chironomid; cia; cia l; lake; langton; nco; pupal; ruse; species
       cache: jear-1658.pdf
  plain text: jear-1658.txt

        item: #13 of 150
          id: jear-1659
      author: Ramzi, S.; Sahragard, A.
       title: A lectin extracted from Citrullus colocynthis L. (Cucurbitaceae) inhibits digestive α-amylase of Ectomyelois ceratoniae Zeller (Lepidoptera: Pyralidae)
        date: 2013-12-20
       words: 5491
      flesch: 60
     summary: The high- est inhibition of E. ceratoniae α-amylase was found at 40°C, which cor- responds with the optimal temperature for enzymatic activity. Time- course experiments revealed the highest amylolytic activity at 20-40 min post-incubation, while the highest inhibition was found after 20- 30 min. Kinetic analysis showed that incubation of α-amylase with CCA significantly decreased Vmax, indicating non-competitive inhibi- tion, but no statistical difference was found in the Km value.
    keywords: activity; amylase; cca; ceratoniae; colocynthis; enzyme; et al; inhibition; inhibitors; insect; lectin; min
       cache: jear-1659.pdf
  plain text: jear-1659.txt

        item: #14 of 150
          id: jear-1734
      author: None
       title: jear-1734
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1734.htm
  plain text: jear-1734.txt

        item: #15 of 150
          id: jear-1738
      author: Viggiani, G.
       title: First record of Gonatocerus litoralis (Haliday) (Hymenoptera: Mymaridae) from Anoplotettix putoni Ribaut (Hemiptera: Cicadellidae)
        date: 2013-12-20
       words: 1801
      flesch: 59
     summary: It was identified initially as belonging to the litoralis group of Gonatocerus (Hymenoptera: Mymaridae) (Viggiani et al., 2008). Materials and methods Pieces of vine bark were randomly collected in some vineyards of the Campania and Basilicata regions of Italy (Taurasi, BN; Rivello, PZ), mostly during winter and spring 2005-2006 (Viggiani et al., 2008).
    keywords: gonatocerus; length; litoralis; triapitsyn
       cache: jear-1738.pdf
  plain text: jear-1738.txt

        item: #16 of 150
          id: jear-1747
      author: Kovendan, K.; Mahesh Kumar, P.; Subramaniam, J.; Murugan, K.; John William, S.
       title: Larvicidal activity of indigenous plant extracts on the rural malarial vector, Anopheles culicifacies Giles. (Diptera: Culicidae)
        date: 2014-12-21
       words: 4938
      flesch: 60
     summary: KOVENDAN K., MURUGAN K., PANNEERSELVAM C., MAHESH KUMAR P., AMERASAN D., SUBRAMANIAM J., VINCENT S., BARNARD D.R., 2012b - Laboratory and field evaluation of medicinal plant extracts against filarial vector, Culex quinquefasciatus Say (Diptera: Culicidae). 2: 165-168. PROMSIRI S., NAKSATHIT A., KRUATRACHUE M., THARAVA U., 2006 - Evaluations of larvicidal activity of medicinal plant extracts to Aedes aegypti (Diptera: Culicidae) and other effects on a non target fish.
    keywords: acetate; aspera; culicifacies; ethyl; extracts; hexane; indicum; larvae; larvicidal; lc50; lc90; ppm; suaveolens
       cache: jear-1747.pdf
  plain text: jear-1747.txt

        item: #17 of 150
          id: jear-1772
      author: Rossaro, B.; Cortesi, P.
       title: The effects of tricyclazole treatment on aquatic macroinvertebrates in the field and in laboratory
        date: 2013-12-20
       words: 5759
      flesch: 56
     summary: A canonical correlation analysis was carried out to have a graphical joint representation of the relation between species, environmental variables and plots with different tricyclazole treatments. The effects of tricyclazole treatments on benthic macroinvertebrates in the field and in laboratory were studied.
    keywords: 2012; concentration; field; plots; rice; sampling; species; table; test; treatment; tricyclazole; water
       cache: jear-1772.pdf
  plain text: jear-1772.txt

        item: #18 of 150
          id: jear-1782
      author: None
       title: jear-1782
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1782.htm
  plain text: jear-1782.txt

        item: #19 of 150
          id: jear-1787
      author: None
       title: jear-1787
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1787.htm
  plain text: jear-1787.txt

        item: #20 of 150
          id: jear-1827
      author: Soltani Ghasemloo, V.; Aleosfoor, M.
       title: Dispersion pattern and fixed precision sequential sampling of Sitobion avenae (Fabricus) (Hemiptera: Aphididae) in wheat fields of Badjgah (Fars province) in Iran
        date: 2013-12-20
       words: 5625
      flesch: 61
     summary: Taylor’s power law analysis appeared to illustrate the distribution of S. avenae well by showing highly significant relationships between the variance and mean of S. avenae population (Figure 2). Regression analysis of Taylor’s power law for S. avenae populations on T. aestivum; A) Shiraz cultivar, B) Bahar cultivar.
    keywords: avenae; distribution; entomol; mean; model; number; population; precision; regression; sample; sampling; taylor; wheat
       cache: jear-1827.pdf
  plain text: jear-1827.txt

        item: #21 of 150
          id: jear-1828
      author: Mirab-balou, M.; Tong, X.L.; Chen, X.X.
       title: Thrips species diversity in urban green spaces of Hangzhou (Zhejiang Province), China
        date: 2014-12-21
       words: 3181
      flesch: 54
     summary: Grasses Thripidae Thripinae Frankliniella intonsa (Trybom) Highly polyphagous; flowers of different plants Thripidae Thripinae Lefroyothrips lefroyi (Bagnall) Camellia sinensis Thripidae Thripinae Megalurothrips distalis (Karny) Ophiopogon japonicus; on flowers of plants family Fabaceae Thripidae Thripinae Microcephalothrips abdominalis (Crawford) Various Asteraceae Thripidae Thripinae Mycterothrips glycines (Okamoto) Glycine max, Alnus japonica Thripidae Thripinae Scirtothrips dorsalis Hood Highly polyphagous Thripidae Thripinae Scolothrips latipennis Priesner** Thuja sp. infested with mites Thripidae Thripinae Scolothrips takahashii Priesner Thuja sp. infested with mites Thripidae Thripinae Taeniothrips eucharii (Whetzel) Ophiopogon japonicus Thripidae Thripinae Thrips flavus Schrank Highly polyphagous Thripidae Thripinae Thrips hawaiiensis (Morgan) Highly polyphagous Thripidae Thripinae Thrips palmi Karny Highly polyphagous Thripidae Thripinae Thrips tabaci Lindeman Highly polyphagous Phlaeothripidae Phlaeothripinae Bagnalliella yuccae (Hind) Yucca flower Phlaeothripidae Phlaeothripinae Gynaikothrips ficorum (Marchal)* Thrips species associated with urban green spaces of Hangzhou (Zhejiang Province).
    keywords: balou; china; hangzhou; mirab; new; research; species; thripidae; thrips; thysanoptera; zhejiang
       cache: jear-1828.pdf
  plain text: jear-1828.txt

        item: #22 of 150
          id: jear-1855
      author: Pellizzari, G.; Frigimelica, G.
       title: First record and establishment of Tuberocephalus (Trichosiphoniella) tianmushanensis Zang, (Hemiptera Aphididae) on ornamental cherry trees in Italy
        date: 2014-04-14
       words: 2278
      flesch: 59
     summary: As above reported, the secondary hosts of Tuberocephalus species, when known, are mostly Artemisia plants. After the first detection of the aphid, investigations were carried out from August to October 2012 on P. subhirtella pendula trees growing in public parks and avenues of the town of Padua and in plant nurseries, located in a large area, eastern of the town; occasional observations occurred wherever P. subhirtella pendula trees were traced.
    keywords: host; pellizzari; remaudière; sorin; species; trees; tuberocephalus
       cache: jear-1855.pdf
  plain text: jear-1855.txt

        item: #23 of 150
          id: jear-1857
      author: Puttler, B.; Bailey, W. C.; Triapitsyn, S.
       title: Notes on distribution, host associations, and bionomics of Erythmelus klopomor Triapitsyn (Hymenoptera, Mymaridae), an egg parasitoid of lace bugs in Missouri, USA, with particular reference to its primary host Corythucha arcuata (Say)(Hemiptera, Tingida)
        date: 2014-04-14
       words: 4097
      flesch: 58
     summary: The known hosts of E. klopomor at the study sites in Missouri are listed in Table 2. Biology of Erythmelus klopomor Based on our laboratory observations, E. klopomor is a solitary idio- biont parasitoid of lace bug eggs. minute pirate bugs, assassin bugs, and predacious mirid bugs), and unaccountable mortality of eggs are cited as factors contributing to reducing damage caused by lace bug species (Connell & Beacher, 1947; Horn et al., 1983).
    keywords: arcuata; bug; eggs; host; klopomor; lace; missouri; oak; parasitoid; species; triapitsyn
       cache: jear-1857.pdf
  plain text: jear-1857.txt

        item: #24 of 150
          id: jear-1868
      author: Ramzi, S.; Zibaee, A.
       title: Digestive proteolytic activity in Apodiphus amygdali Germar (Hemiptera: Pentatomidae): effect of endogenous inhibitors
        date: 2014-08-29
       words: 5739
      flesch: 52
     summary: Specific inhibitors, including phenyl- methylsulfonyl fluoride, Na-p-tosyl-L-lysine chloromethyl ketone, N- tosyl-L-phenylalanine chloromethyl ketone, L-trans-epoxysuccinyl- leucylamido-(4-guanidino)-butane, phenanthroline and ethylendi- amidetetraacetic acid, significantly decreased proteolytic activity, indi- cating the presence of different proteases in the midgut of A. amygdali. Effect of specific inhibitors on proteolytic activity The following compounds were used to find any alteration of the pro- teolytic activity in the midgut of A. spinidens: phenylmethylsulfonyl flu- oride (PMSF) (Sigma-Aldrich, P7626); trypsin inhibitor, Na-p-tosyl-L- lysine chloromethyl ketone (TLCK) (Sigma-Aldrich, T5012); chy- motrypsin inhibitor, N-tosyl-L-phenylalanine chloromethyl ketone Article No n- co mm er cia l u se on ly (TPCK) (Sigma-Aldrich, T7254); cysteine protease inhibitor, L-trans- epoxysuccinyl-leucylamido-(4-guanidino)-butane (E-64) (Sigma- aldrich, E3132); cystatin (Sigma-Aldrich, C8917), metalloprotease inhibitors including phenanthroline (Sigma-Aldrich, 131377) and eth- ylendiamidetetraacetic acid (EDTA) (Merck-Chemicals).
    keywords: activity; amygdali; cathepsin; inhibitors; midgut; proteases
       cache: jear-1868.pdf
  plain text: jear-1868.txt

        item: #25 of 150
          id: jear-1892
      author: None
       title: jear-1892
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1892.htm
  plain text: jear-1892.txt

        item: #26 of 150
          id: jear-1910
      author: None
       title: jear-1910
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1910.htm
  plain text: jear-1910.txt

        item: #27 of 150
          id: jear-1920
      author: Borase, H.P.; Patil, C.D.; Salunkhe, R.B.; Narkhede, C.P.; Suryawanshi, R.K.; Salunke, B.K.; Patil, S.V.
       title: Mosquito larvicidal and silver nanoparticles synthesis potential of plant latex
        date: 2014-08-29
       words: 5663
      flesch: 56
     summary: For these reasons and because of the potent mosquito larvicidal activity showed by plant Plumeria rubra and Pergularia daemia and synthesized AgNPs in our earlier study (Patil et al., 2011a; 2012a), we wanted to investigate the potential of other types of plant latex as eco-friendly mosquito larvicidal agents, and as precursors for environmentally benign silver nanoparticle synthesis. The lowest lethal concentration 50 (LC50) value among the different types of plant latex studied was observed for latex of E. milii (281.28±23.30 and 178.97±37.82 ppm, respectively) against 2nd instar larvae of Ae. aegypti and An. stephensi.
    keywords: activity; aegypti; agnps; et al; hirta; larvae; larvicidal; latex; milii; mosquito; nanoparticles; patil; plant; racemosa; silver; stephensi; synthesis
       cache: jear-1920.pdf
  plain text: jear-1920.txt

        item: #28 of 150
          id: jear-1923
      author: Trematerra, P.
       title: Lobesia arzilae sp. n. and Willibaldiana culatrae sp. n. new species from Portugal (Lepidoptera: Tortricidae: Olethreutinae)
        date: 2014-08-29
       words: 1599
      flesch: 60
     summary: E-mail: trema@unimol.it Key words: Lobesia arzilae sp. n., Willibaldiana culatrae sp. n., Lepidoptera Tortricidae, Olethreutinae, new species, Portugal. Willibaldiana culatrae sp. n., male genitalia.
    keywords: brown; genitalia; male; portugal
       cache: jear-1923.pdf
  plain text: jear-1923.txt

        item: #29 of 150
          id: jear-1936
      author: None
       title: jear-1936
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-1936.htm
  plain text: jear-1936.txt

        item: #30 of 150
          id: jear-1977
      author: Brahma, S.; Aditya, G.; Sharma, D.; Saha, N.; Kundu, M.; Saha, G. K.
       title: Influence of density on intraguild predation of aquatic Hemiptera (Heteroptera): implications in biological control of mosquito
        date: 2014-04-14
       words: 6167
      flesch: 53
     summary: All t-values are significant at P<0.001 level (two-tailed), at df –17. IG predator density Initial shared prey density (numbers) 50 100 200 400 1 t=614.39 t=206.13 t=22.29 Assuming similar manifestations in heteropteran mosquito predator guild, effects of predator and shared prey density on IG prey and shared prey mortality were tested in the present study to deduce feasibility of biological control of wetland mosquitoes using insect predators.
    keywords: bouvieri; density; ig predator; ig prey; igp; mortality; mosquito; predation; predator; prey; prey density; system
       cache: jear-1977.pdf
  plain text: jear-1977.txt

        item: #31 of 150
          id: jear-1986
      author: Amerasan, D.; Murugan, K.; Panneerselvam, C.; Kanagaraju, N.; Kovendan, K.; Mahesh Kumar, P.
       title: Bioefficacy of Morinda tinctoria and Pongamia glabra plant extracts against the malaria vector Anopheles stephensi (Diptera: Culicidae)
        date: 2015-04-23
       words: 8339
      flesch: 58
     summary: This study provides the first report of the larvicidal, adulticidal and ovicidal activities of M. tinctoria and P. glabra plant extracts against the malar- ia vector, A. stephensi, representing an ideal eco-friendly approach for its control. The M. tinctoria and P. glabra leaf extracts were diluted with acetone to make different concentrations.
    keywords: activity; adulticidal; aegypti; anopheles; control; et al; extracts; glabra; larvicidal; leaf; methanol; mortality; mosquito; plant; ppm; stephensi; tinctoria; values
       cache: jear-1986.pdf
  plain text: jear-1986.txt

        item: #32 of 150
          id: jear-2184
      author: None
       title: jear-2184
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-2184.htm
  plain text: jear-2184.txt

        item: #33 of 150
          id: jear-2239
      author: None
       title: jear-2239
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-2239.htm
  plain text: jear-2239.txt

        item: #34 of 150
          id: jear-3224
      author: None
       title: jear-3224
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-3224.htm
  plain text: jear-3224.txt

        item: #35 of 150
          id: jear-355
      author: Pellizzari, Giuseppina; Porcelli, Francesco; Seljak, Gabrijel; Kozár, Ferenc
       title: Some additions to the Scale insect fauna (Hemiptera: Coccoidea) of Crete with a check list of the species known from the island
        date: 2011-09-19
       words: 3346
      flesch: 46
     summary: Present paper Chorizococcus rostellum lobdell Present paper Heliococcus bohemicusŠulc jansen et al., 2010 Heterococcus nudus Green Present paper Peliococcus kimmericus (kiritshenko) kozár et al., 1991 Phenacoccus bicerarius Borchsenius kozár et al., 1991 Phenacoccus madeirensisGreen jansen et al., 2010 Planococcus citri(risso) ayoutantis, 1940 Planococcus ficus (Signoret) argyriou, 1984,  Planococcus vovae(Nasonov) Williams & Moghaddam, 2000; present paper Pseudococcus longispinus(Targioni Tozzetti) present paper Spilococcus halli(Mckenzie & Williams) Coccidae Species Validation source Ceroplastes floridensis comstock Present paper Ceroplastes rusci (linnaeus) ayoutantis, 1940; Podsiadlo, 1983; present paper Ceroplastes sinensis Del Guercio Present paper Coccus hesperidum linnaeus ayoutantis, 1940 Podsiadlo, 1983 Filippia follicularis (Targioni Tozzetti) argyriou, 1984 Lecanopsis formicarum (Newstead) Present paper Lichtensia viburni Signoret argyriou, 1984 Parthenolecanium corni (Bouché) kozár et al.,1991 Poaspis intermedia (Goux) kozár & Nagy, 1998 Protopulvinaria pyriformis (cockerell) jansen et al., 2010; present paper Pulvinariella mesembryanthemi (Vallot) kozàr et al.,1991 Saissetia coffeae (Walker) Podsiadlo, 1983  Saissetia oleae (olivier) ayoutantis, 1940; argyriou & Michelakis, 1975 Sphaerolecanium prunastri (Boyer de Fonscolombe) argyriou & Paloukis, 1976;  Podsiadlo, 1981; kozár et al.,1991;  present paper Fam Asterolecaniidae Species Validation source Pollinia pollini (a. costa) alexandrakis, 1980a 295G. Pellizzari et al.: Scale insect fauna of crete Fam.
    keywords: crete; iraklion; kozár; paper; pellizzari; present; scale; species
       cache: jear-355.pdf
  plain text: jear-355.txt

        item: #36 of 150
          id: jear-356
      author: Pellizzari, Giuseppina
       title: Two new species of scale insects (Hemiptera, Coccoidea) from Sardinia (Italy) with a check list of Sardinian Coccoidea
        date: 2011-09-19
       words: 4419
      flesch: 51
     summary: INTroDUcTIoN one hundred and one species of scale insects (Hemiptera: coccoidea) are currently  known from Sardinia, (Pellizzari & russo, 2006), including alien invasive species,.  The opportunity is taken to also revise the list of Sardinian scale insects based  on previous papers (Pellizzari & Fontana, 1996; Pellizzari, 2003; Pellizzari & russo,  2006) and on ScaleNet (Ben-Dov et al., 2011).
    keywords: coccoidea; fontana; leonardi; pellizzari; pores; russo; sardinia; scale; setae; species
       cache: jear-356.pdf
  plain text: jear-356.txt

        item: #37 of 150
          id: jear-357
      author: None
       title: jear-357
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-357.htm
  plain text: jear-357.txt

        item: #38 of 150
          id: jear-359
      author: Longo, Santi; Suma, Pompeo
       title: First report of Eurytoma plotnikovi Nik. (Hymenoptera, Eurytomidae), a seed parasite of pistachio, in Sicily (Italy)
        date: 2011-09-19
       words: 1074
      flesch: 55
     summary: The wasp  larvae, reared under laboratory conditions, developed into adults that were identified as  Eurytoma plotnikovi, an indigenous pest of inedible nuts of the ornamental pistachio (P. chinensis) in china (Qin et al., 2007; Tian et al., 1994).  335S. longo, P. Suma: First report of Eurytoma plotnikovi in Sicily (Italy) who confused it with that caused by M. pistaciae.
    keywords: eurytoma; pistachio; plotnikovi; wasp
       cache: jear-359.pdf
  plain text: jear-359.txt

        item: #39 of 150
          id: jear-363
      author: None
       title: jear-363
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-363.htm
  plain text: jear-363.txt

        item: #40 of 150
          id: jear-364
      author: Moghaddam, Masumeh; Alikhani, Mamud
       title: Two new species of mealybugs (Hemiptera, Coccoidea, Pseudococcidae) from Iran
        date: 2010-04-23
       words: 2036
      flesch: 59
     summary: Res. Ser. II, 42 (1): 11-17 30 April 2010 M. MOGHADDAM & M. ALIKHANI Two new species of mealybugs (Hemiptera, Coccoidea, Pseudococcidae) from Iran Abstract - Polystomophora arakensis Moghaddam and Phenacoccus salviacus Moghaddam are described and illustrated in detail from Iran.  Riassunto - Two new species of mealybugs (Hemiptera, Coccoidea, Pseudococ- cidae) from Iran.
    keywords: iran; pores; present; setae
       cache: jear-364.pdf
  plain text: jear-364.txt

        item: #41 of 150
          id: jear-365
      author: Trematerra, Pasquale
       title: Lepidoptera Tortricidae from SE European Russia with description of Ceratoxanthis saratovica sp. n.
        date: 2010-04-23
       words: 1903
      flesch: 53
     summary: European Russia with description of Ceratoxanthis saratovica sp. n. Abstract - Faunistic data of some Lepidoptera Tortricidae collected in Southern  Russian territory are reported Ceratoxanthis saratovica sp. n. Material exaMined: 1 male, holotypus, labelled as follows: European p. of Russia  SE, Saratov env., 28.06.1999, Leg.
    keywords: european; material; russia; saratov
       cache: jear-365.pdf
  plain text: jear-365.txt

        item: #42 of 150
          id: jear-366
      author: None
       title: jear-366
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-366.htm
  plain text: jear-366.txt

        item: #43 of 150
          id: jear-367
      author: Viggiani, Gennaro; Nugnes, F.
       title: Description of the larval stages of Dryokosmus kuriphilus Yasumatsu (Hymenoptera: Cynipidae), with notes on their phenology
        date: 2010-04-23
       words: 1856
      flesch: 55
     summary: RESULTS larval instars The present study shows that D. kuriphilus undergoes three instars in the larval  development.  41G.Viggiani, F. Nugnes: Larval stages of Dryokosmus kuriphilus, with notes on their phenology Figs. 1-7. Dryokosmus kuriphilus:
    keywords: fig; instar; kuriphilus; larva
       cache: jear-367.pdf
  plain text: jear-367.txt

        item: #44 of 150
          id: jear-368
      author: Lupi, Daniela; Colombo, Mario; Giudici, Maria Luisa; Villa, Bruno; Cenghialta, Cesare; Passoni, Daniele
       title: On the spatial spread of the Rice Water Weevil, Lissorhoptrus oryzophilus Kuschel (Coleoptera: Erirhinidae), in Italy
        date: 2010-07-26
       words: 3848
      flesch: 62
     summary: Journal of Entomological and Acarological Research, Ser. II, 42 (2), 201082 INTRODUCTION The rice water weevil (RWW), Lissorhoptrus oryzophilus Kuschel, is a polypha- gous phytophagous mainly feeding on gramineous and cyperaceous plants (Tindall &  Stout, 2003; Lupi et al., 2009).  Thereafter it was detected in China, in Korea, and in India  (Lee & Uhm, 1992; Hix et al., 2000; Chen et al., 2004).
    keywords: area; insect; italy; lissorhoptrus; oryzophilus; rice; rww; spread; water; weevil
       cache: jear-368.pdf
  plain text: jear-368.txt

        item: #45 of 150
          id: jear-369
      author: None
       title: jear-369
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-369.htm
  plain text: jear-369.txt

        item: #46 of 150
          id: jear-370
      author: Gama, Zulfaidah Penata; Morlacchi, Pablo; Lozzia, Giuseppe Carlo; Baumgärtner, Johann; Giorgi, Anna
       title: Towards a better understanding of the dynamics of Aphis spiraecola Patch (Homoptera: Aphididae) populations in commercial alpine yarrow fields
        date: 2010-07-26
       words: 5472
      flesch: 50
     summary: Of interest in human medicine is the high content of secondary  metabolites, i.e. organic compounds that are not directly involved in the normal growth,  development, or reproduction of organisms (Fraenkel, 1959; Wink, 2003; Madeo et al.,  2009).  The aqueous and alcoholic extracts have digestive, antiphlogistic, spasmolytic,  stomachic, carminative, and estrogenic properties (Benedek et al., 2007).
    keywords: aphid; compound; model; parameters; sampling; spiraecola; time; yarrow
       cache: jear-370.pdf
  plain text: jear-370.txt

        item: #47 of 150
          id: jear-371
      author: None
       title: jear-371
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-371.htm
  plain text: jear-371.txt

        item: #48 of 150
          id: jear-372
      author: Iaccarino, Fabio M.; Jesu, Riccardo; Giacometti, Rosa
       title: Paraleyrodes minei Iaccarino 1990 (Homoptera: Aleyrodidae), new specie for Italy, on Citrus aurantium L., 1758
        date: 2011-04-30
       words: 2033
      flesch: 50
     summary: Paraleyrodes minei on Citrus aurantium new species for Italy is continuous throughout the year, albeit it has lower trophic activity in adverse time  (Bellows et al., 1998). the  immature stages present compound-style pores in addition to simple ones, legs with a  terminal claw and the lingula extended beyond the posterior margin of the vasiform orifice  and with 2 apical setae pairs (Quaintance et Baker, 1913; Bondar, 1923; evans et al.,  2006; evans, 2008).
    keywords: evans; iaccarino; minei; paraleyrodes; wax
       cache: jear-372.pdf
  plain text: jear-372.txt

        item: #49 of 150
          id: jear-373
      author: Montagna, Matteo; Lozzia, Giuseppe Carlo; Baumgärtner, Johann; Andreis, Carlo; Giorgi, Anna
       title: The Beetle (Coleoptera) and True bug (Heteroptera) species pool of the alpine “Pian di Gembro” wetland (Villa di Tirano, Italy) and its conservation
        date: 2011-04-30
       words: 8514
      flesch: 70
     summary: Because of their capacity to conserve species of conservation interest and to  provide ecosystem services, wetlands are considered as natural capital and often assigned  protected status (Spitzer & Danks, 2006; Fisher et al., 2009). In group A, there are species of conservation interest and species with a wide geographical  distribution such as Lygus pratensis and Galeruca tanaceti, which has also been found  in nearby commercial yarrow fields (Limonta et al., 2003; Sassi, 2007) where Penata  Gama et al. (2010) studied the dynamics of aphid populations.
    keywords: alpine; bog; coleoptera; conservation; della; gembro; heteroptera; interest; linnaeus; montagna; pian; pool; sampling; species; surroundings; table; wetland; zone
       cache: jear-373.pdf
  plain text: jear-373.txt

        item: #50 of 150
          id: jear-374
      author: None
       title: jear-374
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-374.htm
  plain text: jear-374.txt

        item: #51 of 150
          id: jear-375
      author: Reddy, Gadi V.P.; Kikuchi, Rosalie; Remolona, Jenelyn E.
       title: New mite species associated with certain plant species from Guam
        date: 2011-04-30
       words: 2049
      flesch: 48
     summary: Host plants include Acalypha sp., Curculigo sp., Flemingia strobilifera, Glycine javanica, Macroptilium atropurpureum, Psidium guajava, Turnera  sp. and Solanum melongena (De Moraes et al., 2004).   Some species have been investigated as control  agents of pest mites, insects and nematodes (Gerson et al., 2007).
    keywords: guam; mesostigmata; mites; pest; plants; prostigmata; species
       cache: jear-375.pdf
  plain text: jear-375.txt

        item: #52 of 150
          id: jear-376
      author: De Marzo, Luigi
       title: A further evaluation of the sperm length in aleocharines (Coleoptera Staphylinidae)
        date: 2010-11-16
       words: 1235
      flesch: 53
     summary: Evaluations were carried out ei- ther on spermatozoa isolated from the spermatheca (material from females) or on sperm bundles extracted from testis (material from males). Usually, duct contains  only a very poor number of spermatozoa, as Aleochara tristis (Fig. 1.a); otherwise, it  is occluded by a spermatophore, as in Aleochara intricata (Fig. 1.B), and is therefore  filled with a dense mass of sperm.
    keywords: length; species; sperm
       cache: jear-376.pdf
  plain text: jear-376.txt

        item: #53 of 150
          id: jear-377
      author: None
       title: jear-377
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-377.htm
  plain text: jear-377.txt

        item: #54 of 150
          id: jear-378
      author: Barjadze, Shalva; Gratiashvili, Nana; Karaca, İsmail; Yaşar, Bülent
       title: New evidence of parasitoids of pest aphids on roses and grapevine in Turkey (Hem., Aphididae; Hym., Braconidae, Aphidiinae)
        date: 2010-11-16
       words: 961
      flesch: 48
     summary: Journal of entomological and acarological research, Ser. II, 42 (3), 2010144 This species is oligophagous and it attacks aphid species belonging to the genera  Chaetosiphon and Longicaudus (Kavallieratos et al., 2004).  It is distributed mainly in  europe (Starý, 1976; Kavallieratos et al., 2004).
    keywords: aphidius; aphids; isparta; turkey
       cache: jear-378.pdf
  plain text: jear-378.txt

        item: #55 of 150
          id: jear-3787
      author: Aleosfoor, M.; Ehteshami, F.; Fekrat, L.
       title: A six-arm olfactometer for analysing olfactory responses of Goniozus legneri Gordh (Hymenoptera: Bethylidae), the larval ectoparasitoid of carob moth
        date: 2014-12-21
       words: 2798
      flesch: 55
     summary: Currently, several Hymenopterous species have been reported as larval parasitoids of carob moth (Gothilf, 1978; Kishani Farahani et al., 2011, 2012b). The parasitoids significantly more frequently selected the arm con- nected to frass of carob moth larvae compared with the other arms (Figure 3).
    keywords: carob; control; host; larvae; legneri; moth; parasitoids
       cache: jear-3787.pdf
  plain text: jear-3787.txt

        item: #56 of 150
          id: jear-379
      author: Pellizzari, Giuseppina
       title: First record and establishment of Chionaspis wistariae Cooley (Hemiptera, Diaspididae) in Europe
        date: 2010-11-16
       words: 1670
      flesch: 48
     summary: Host plants and distribution C. wistariae develops on Wisteria species (Wisteria brachybotrys, W. floribunda,  W. multijuga, W. nankinensis, W. sinensis) (Liu et al., 1989; Malumphy, 2010, personal  Fig. 1 - leaf of Wisteria sp infested by Chionaspis wistariae Cooley. Journal of entomological and acarological research, Ser. II, 42 (3), 2010148 Chionaspis wistariae Cooley, 1897
    keywords: chionaspis; scale; species; wistariae; wisteria
       cache: jear-379.pdf
  plain text: jear-379.txt

        item: #57 of 150
          id: jear-3791
      author: None
       title: jear-3791
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-3791.htm
  plain text: jear-3791.txt

        item: #58 of 150
          id: jear-380
      author: Limonta, Lidia; Sulo, Juljus; Locatelli, Daria Patrizia
       title: Temperature-dependent development and survivorship of Idaea inquinata (Scopoli) (Lepidoptera Geometridae) eggs at two humidity levels
        date: 2010-11-16
       words: 2750
      flesch: 55
     summary: Key words: eggs hatching, Temperature, relative humidity, rusty wave moth INTroDUCTIoN Idaea inquinata (Scopoli) can be a serious pest in warehouses where dehydrated  plants and cereals are stored; spices and medicinal plants can be heavily damaged and  made unsuitable to essential oil extraction (Candura 1931a, b; Locatelli et al., 2005). a (SE) b (SE) c (SE) 35 400 11.01 (0.165) 38.65 (0.104) 0.0096 (0.0000015) 0.65 (0.87) 1.634 (0.317) 1.043 (0.212) 70 400 8.86 (0.174) 38.10 (0.069) 0.00008888 (0.0000) 0.77 (0.71) 1.644 (1.043) 0.993 (0.142) 159L. Limonta et al.: Development and survivorship of I. inquinata eggs  (e.g. Bell, 1975; Maity et al., 1999).
    keywords: development; eggs; humidity; inquinata; temperature
       cache: jear-380.pdf
  plain text: jear-380.txt

        item: #59 of 150
          id: jear-381
      author: None
       title: jear-381
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-381.htm
  plain text: jear-381.txt

        item: #60 of 150
          id: jear-382
      author: Tóbiás, István; Kozár, Ferenc; Kaydan, Bora. M.; Fetykó, Kinga
       title: Use of molecular tools for the identification of males of some scale insects (Hemiptera: Coccoidea), in pheromone traps used for monitoring and comparison with females
        date: 2010-11-16
       words: 4642
      flesch: 67
     summary: 690 GGAAGGCGATTTCGCGACTCGCGTTACGTGCGACGCACGCGAACGTACCC 739 ||||| ||| | || | | | | ||| | ||| || | 672 GGAAGACGA.TGCGAGCGTGCGATAATTCGCGTTATAAGCGTACTT.... 716 . MaTerIaL aND MeTHoDS Monitoring of mealybugs was conducted by Nagykovácsi type tent trap (10x10 cm),  by using (pheromone ingredients for Pl. citri; (+)-2,2-dimethyl-3-(1-methylethenyl)  cyclobutanemethanol acetate, for Pl. ficus; (S)-lavandulyl senecioate-(S)-lavandulyl  isovalerate), for Ps. comstocki; (2,6-dimethyl-l,5-heptadien-3-ol acetate) with Soveu- rode /Witasek Pflanzenschutz GmbH, austria/ glue and Biochemtech /Biochemtech Ltd.  Kishinev, Moldavia/ pheromone dispensers. 
    keywords: budapest; hungary; males
       cache: jear-382.pdf
  plain text: jear-382.txt

        item: #61 of 150
          id: jear-383
      author: Süss, Luciano; Costanzi, Mariella
       title: Presence of Drosophila suzukii (Matsumura, 1931) (Diptera Drosophilidae) in Liguria (Italy)
        date: 2010-11-16
       words: 829
      flesch: 54
     summary: Res. Ser. II, 42 (3): 185-188 30 December 2010 L. SÜSS - M. CoSTaNzI Presence of Drosophila suzukii (Matsumura, 1931) (Diptera Drosophilidae) in Liguria (Italy) Abstract - The presence of Drosophila suzukii in Liguria (Italy) on strawberries  and raspberries is reported.  after the breeding in the laboratory, from the fruits came some adults of Drosophila suzukii (Matsumura, 1931), (Spotted Wing Drosophila), a species from extreme orients,  but recently signaled both in North america and in europe as noxious on strawberries  (Fragaria spp.), raspberries (Rubus idaeus) and other Rubus spp., blueberries (Vaccinium  spp.)
    keywords: drosophila; eppo; suzukii
       cache: jear-383.pdf
  plain text: jear-383.txt

        item: #62 of 150
          id: jear-384
      author: Chiappini, Elisabetta; Aldini, Rinaldo Nicoli
       title: Morphological and physiological adaptations of wood-boring beetle larvae in timber
        date: 2011-08-20
       words: 5635
      flesch: 48
     summary: As far as protection of antiquarian goods made of wood is concerned, we are dealing mainly with three Coleoptera families, namely Lyctidae, Anobiidae, and Cerambycidae, which include species with wood-boring larvae. The larvae, which penetrate the timbered tissue directly, after having completed embryonic development and hatching, feed exclusively on wood (unless the timber is invaded by fungal mycelia), extracting from this substrate all the main nutrients J. Ent.
    keywords: adaptations; beetles; cellulose; chiappini; coleoptera; feeding; insects; larvae; mandibles; species; starch; substrate; wood
       cache: jear-384.pdf
  plain text: jear-384.txt

        item: #63 of 150
          id: jear-385
      author: Palla, Franco
       title: Characterization of microbial communities in pest colonized books by molecular biology tools
        date: 2011-08-20
       words: 2058
      flesch: 43
     summary: Finally, we are setting up molecular protocols for fungal identification by using oligonucleotide primers specific for ITS regions or tubulin gene (Glass et al., 1995; Palla et al., 2009). F. Palla: Characterization of microbial communities by molecular biology tools 65 We want also point out that bacteria and fungi colonizing indoor environment are able to damage artifacts and release toxins detrimental to human health (Peltola et al., 2001; Nilsson et al., 2004).
    keywords: bacteria; biology; books; dna; fig; palla; pcr
       cache: jear-385.pdf
  plain text: jear-385.txt

        item: #64 of 150
          id: jear-386
      author: Palla, F.; Sineo, L.; Manachini, Barbara
       title: Bacteria, fungi and arthropod pests collected on modern human mummies
        date: 2011-08-20
       words: 2141
      flesch: 42
     summary: Res..indd F. PALLA, L. SINEO, B. MANACHINI Bacteria, fungi and arthropod pests collected on modern human mummies Abstract - A survey of opportunistic biocenosis (macro and micro organisms) as- sociated with a rest of human mummy samples was carried out to characterise the biocenosis and to detect the potential of biodeteriogens. Levinson & Levinson (1994) reported that a complicate biocenosis was recorded in the ancient Egypt tombs and mummies, but some of insects were associated with the food F. Palla et al.: Bacteria, fungi and arthropods pests collected on human mummies Fig.
    keywords: arthropods; bacteria; fig; fungi; mummies
       cache: jear-386.pdf
  plain text: jear-386.txt

        item: #65 of 150
          id: jear-387
      author: None
       title: jear-387
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-387.htm
  plain text: jear-387.txt

        item: #66 of 150
          id: jear-388
      author: Plarre, Rudy; Krüger-Carstensen, Bianca
       title: An attempt to reconstruct the natural and cultural history of the webbing clothes moth Tineola bisselliella Hummel (Lepidoptera: Tineidae)
        date: 2011-08-20
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-388.pdf
  plain text: jear-388.txt

        item: #67 of 150
          id: jear-389
      author: None
       title: jear-389
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-389.htm
  plain text: jear-389.txt

        item: #68 of 150
          id: jear-390
      author: Maistrello, Lara; D’Ilario, Josephine; Bicheron, Gautier; Bouleau, Christophe
       title: Damage by insect pests to the Djingarey Ber Mosque in Timbuktu: detection and control
        date: 2011-08-20
       words: 2619
      flesch: 55
     summary: DISCUSSION AND CONCLUSIONS From the evidence obtained during the inspection, the most serious problem for the Djingarey Ber mosque was represented by termites as structural pests of all wooden elements. Suggestions for a sustainable integrated management strategy aiming at reduction and prevention of attacks from wood pests include: a) wood treatment of all elements of the mosque complex and possibly also its surroundings using borate compounds which provide long-lasting efficacy against wood pests (Gentz & Grace, 2006) and are relatively safe for mammals and the environment (Currie, 1996), b) removal of any non-treated wood/cellulosic material from the mosque and its surroundings to prevent re-infestation; c) in order the reduce wood pests in the mosque as well as inside private houses, it would be extremely useful to activate a basic education program on essential elements of wood protection, such as the prohibition to recycle old/infested wood, the basics of xylophagous insects biology and the use of borates instead of residual insec- ticides.
    keywords: beams; damage; elements; insect; mosque; pests; termites; wood
       cache: jear-390.pdf
  plain text: jear-390.txt

        item: #69 of 150
          id: jear-391
      author: Nilsen, Lisa
       title: Integrated Pest Management as European standard – is it possible?
        date: 2011-08-20
       words: 1383
      flesch: 47
     summary: Res..indd L. NILSEN Integrated Pest Management as European standard – is it possible? Every European country has its own national standard institute that works with na- tional standards, European standards (CEN) and global standards (ISO).
    keywords: conservation; pest; property; standard
       cache: jear-391.pdf
  plain text: jear-391.txt

        item: #70 of 150
          id: jear-392
      author: None
       title: jear-392
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-392.htm
  plain text: jear-392.txt

        item: #71 of 150
          id: jear-393
      author: Baslé, Katia; Guillon, Odile; Fohrer, Fabien; Daniel, Floréal
       title: Monitoring techniques: “StegoGIS: a geographical information system for knowing and preventing infestation risks in cultural heritage”
        date: 2011-08-20
       words: 2670
      flesch: 51
     summary: These two worlds are completely different: food processing industry and cultural heritage field especially concerning the notion of time and the way the insect pests are dealt. Res..indd K. BASLÉ, O. GUILLON, F. DANIEL, F. FOHRER Monitoring techniques: “StegoGIS: a geographical information system for knowing and preventing infestation risks in cultural heritage” Abstract - Since 2004, the Cicrp: “Centre Interrégional de Conservation et Res- tauration du Patrimoine”, located in Marseilles has been involved in an interdis- ciplinary research program dealing with infestation and re-infestation, on lining pastes used in painting conservation, by the Stegobium paniceum through a GIS system : a geographical information system called “StegoGIS”.
    keywords: baslé; data; fig; fohrer; gis; heritage; infestation; information
       cache: jear-393.pdf
  plain text: jear-393.txt

        item: #72 of 150
          id: jear-394
      author: Krüger-Carstensen, Bianca; Plarre, Rudy
       title: Outdoor trapping and genetical characterization of populations of the webbing clothes moth Tineola bisselliella (Lepidoptera: Tineidae) in the broader area of Berlin
        date: 2011-08-20
       words: 2306
      flesch: 56
     summary: The trapping locations in the city also show some larger or smaller differences in the number of trapped moths of T. bisselliella but the occurrence does not base upon the city center distance (Fig. 3) or the human population B. Krüger-Carstensen, R. Plarre: Journal of Entomological and Acarological Research, Ser. II, 43 (2), 2011132 The decreasing occurrence of the webbing clothes moth in the hinterlands com- pared to a higher number of trapped moths in the city leads to the question of their ori- gin (Fig. 3).
    keywords: berlin; bisselliella; clothes; fig; moth; trapping
       cache: jear-394.pdf
  plain text: jear-394.txt

        item: #73 of 150
          id: jear-395
      author: None
       title: jear-395
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-395.htm
  plain text: jear-395.txt

        item: #74 of 150
          id: jear-396
      author: Bentivoglio-Ravasio, Beatrice; Marconi, Emanuele; Trotta, Leonardo; Dreossi, Diego; Sodini, Nicola; Mancini, Lucia; Zanini, Franco; Tonini, Camillo
       title: Synchrotron radiation microtomography of musical instruments: a non-destructive monitoring technique for insect infestations
        date: 2011-08-20
       words: 2674
      flesch: 51
     summary: Radiographics, 19: 639-646. SNIGIREV A., SNIGIREVA I., KOHN V., KUZNETSOV S., SCHELOKOV I., 1995 - On the possibilities of x-ray phase contrast microimaging by coherent high-energy synchrotron radiation. L’Orgue, 21: 7-17. IWAMOTO J., KENMOCHI Y., KOTANI K., NAGASAWA I., 2002 - Extraction of a 3D graph structure of wormholes in a wooden statue of Buddha by X-ray CT image analysis.
    keywords: contrast; instruments; phase; ray; synchrotron; technique
       cache: jear-396.pdf
  plain text: jear-396.txt

        item: #75 of 150
          id: jear-397
      author: Schöller, Matthias; Prozell, Sabine
       title: Biological control of cultural heritage pest Coleoptera and Lepidoptera with the help of parasitoid Hymenoptera
        date: 2011-08-20
       words: 4222
      flesch: 51
     summary: Biological control of the cloth moth Tineola bisselliella Egg parasitoids in the genus Trichogramma are applied for biological control of various pest Lepidoptera in field crops like corn or apple. Biological control of stored product pests is nowadays widely known by farmers and industry and is applied by pest control companies in Central Europe against moths and beetles.
    keywords: cloth; control; distinguendus; enemies; heritage; hololeucus; host; number; parasitoids; pests; schöller; trichogramma
       cache: jear-397.pdf
  plain text: jear-397.txt

        item: #76 of 150
          id: jear-398
      author: None
       title: jear-398
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-398.htm
  plain text: jear-398.txt

        item: #77 of 150
          id: jear-399
      author: Ignatowicz, Stanislaw; Janczukowicz, Krystyna; Olejarski, Pawel
       title: Integrated Pest Management (IPM) of the drug store beetle, Stegobium paniceum (L.), a serious pest of old books
        date: 2011-08-20
       words: 1801
      flesch: 67
     summary: Res..indd S. IGNATOWICZ, K. JANCZUKOWICZ, P. OLEJARSKI Integrated Pest Management (IPM) of the drug store beetle, Stegobium paniceum (L.), a serious pest of old books Abstract - Recently (January 2010), we have found that drugstore beetle, Stegobi- um paniceum (L.), is a serious pest of old books in a religious library in Cra- cow, Poland. Live and dead adults were found around old books and within the library room, especially near windows.
    keywords: beetle; books; larvae; library; pest
       cache: jear-399.pdf
  plain text: jear-399.txt

        item: #78 of 150
          id: jear-400
      author: Querner, Pascal; Morelli, Michaela; Oberthaler, Elke; Strolz, Monica; Schmitz Von Ledebur, Katja; Diehl, Johanna; Zatschek, Isabell; Fermi-Mebarek, Anna; Hölzl, Regina; Engelhardt, Irene; Krammer, Hugo; Fürnkranz, Sophie
       title: Ten years of Integrated Pest Management (IPM) at the Kunsthistorisches Museum in Wien
        date: 2011-08-20
       words: 2558
      flesch: 54
     summary: E-mail: pascal.querner@boku.ac.at MICHAELA MORELLI, Kunsthistorisches Museum mit MVK und ÖTM Museum of Carriages and Department of Court Uniforms, Textile conservation Schloss Schönbrunn, A-1130 Vienna, Austria. REGINA HÖLZL, IRENE ENGELHARDT, Kunsthistorisches Museum mit MVK und ÖTM, Egyptian and Near Eastern Collection, Maria Theresien-Platz, A-1010 Vienna, Austria.
    keywords: collection; ipm; kunsthistorisches; management; monitoring; museum; objects; pest; querner; storage
       cache: jear-400.pdf
  plain text: jear-400.txt

        item: #79 of 150
          id: jear-401
      author: None
       title: jear-401
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-401.htm
  plain text: jear-401.txt

        item: #80 of 150
          id: jear-402
      author: Berzolla, Alessia; Reguzzi, Maria Cristina; Chiappini, Elisabetta
       title: Controlled atmospheres against insect pests in museums: a review and some considerations
        date: 2011-08-20
       words: 3703
      flesch: 47
     summary: Restaurator, 17: 43-60. SELWITZ C., MAEKAWA S., 1998 - Inert gases in the control of museum insect pests. The effects of low oxygen atmospheres on museum pests.
    keywords: atmospheres; conservation; et al; humidity; insects; oxygen; pests; r.h; time; treatment
       cache: jear-402.pdf
  plain text: jear-402.txt

        item: #81 of 150
          id: jear-403
      author: None
       title: jear-403
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-403.htm
  plain text: jear-403.txt

        item: #82 of 150
          id: jear-4036
      author: Weterings, R.; Vetter, K.C.; Umponstira, C.
       title: Factors influencing the predation rates of Anisops breddini (Hemiptera: Notonectidae) feeding on mosquito larvae
        date: 2014-12-21
       words: 4081
      flesch: 59
     summary: Several studies have reported predation rates of backswimmers. In that study, 30 was the maximum number of mosquito larvae in each experimental trial, thus predation rates could possibly have been higher.
    keywords: density; larvae; model; mosquito; predation; predator; prey; rates; species
       cache: jear-4036.pdf
  plain text: jear-4036.txt

        item: #83 of 150
          id: jear-404
      author: Murugan, Kadarkarai; Vasugi, Chellamuthu
       title: Combined effect of Azadirachta indica and the entomopathogenic nematode Steinernema glaseri against subterranean termite, Reticulitermes flavipes
        date: 2011-08-20
       words: 2524
      flesch: 50
     summary: Accordingly, there has been great interest in finding alternative biological approaches to control termites (Grace, 1997). Neem at various concentrations did not affect the survivability of nematodes, whereas neem had considerable impact on the sur- vivability of worker termites and this may be due to the presence of active neem compounds (Azadirachtin, salanin etc.).
    keywords: control; flavipes; glaseri; infectivity; neem; nematodes; nske; termites
       cache: jear-404.pdf
  plain text: jear-404.txt

        item: #84 of 150
          id: jear-405
      author: None
       title: jear-405
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-405.htm
  plain text: jear-405.txt

        item: #85 of 150
          id: jear-4055
      author: Rajabiyan, M.; Shayanmehr, M.; Mohammadi Sharif, M.
       title: The Mediterranean fruit fly (Ceratitis capitata) in Iran: genetic diversity and comparison with other countries
        date: 2015-04-23
       words: 3409
      flesch: 51
     summary: Additionally, according to the assumptions of Malacrida et al., C. capitata populations can be divided into three main categories according to their colonisation pattern: ancestral, ancient and new populations, corresponding to populations from Africa, the Mediterranean basin and America, respectively (Reyes & Ochando, 2004). The results of this study indicate that genetic analyses based on the use mitochondrial genes can provide useful tools for unravelling genetic and phylogenetic relationships in C. capitata populations in northern Iran.
    keywords: capitata; coi; dna; iran; medfly; northern; populations
       cache: jear-4055.pdf
  plain text: jear-4055.txt

        item: #86 of 150
          id: jear-406
      author: Habibpour, Behzad; Cheraghi, Amir; Mossadegh, Mohammad Saeed
       title: Evaluation of cellulose substrates treated with Metarhizium anisopliae (Metschnikoff) Sorokin as a biological control agent against the termite Microcerotermes diversus Silvestri (Isoptera: Termitidae)
        date: 2011-08-20
       words: 2544
      flesch: 54
     summary: Treated sawdust bait was applied by two methods: a) combination of treated sawdust and untreated filter paper, and b) combination of treated sawdust and untreated sawdust. According to this findings fun- gus in combination of sawdust bait revealed efficient alternative in vitro and therefore it can be a candidate for optimizing performance and field trials.
    keywords: bait; paper; sawdust; spore; termites; untreated
       cache: jear-406.pdf
  plain text: jear-406.txt

        item: #87 of 150
          id: jear-407
      author: Maistrello, Lara; Berzolla, Alessia; Macias-Pavon, Irene; Vignali, Francesca; Predieri, Giovanni; Chiappini, Elisabetta
       title: Wood impregnated with metal chelates dissolved in organic media tested for termite resistance
        date: 2011-08-20
       words: 3158
      flesch: 54
     summary: Key words: wood treatment, preservative agents, copper chelates, Kalotermes fla- vicollis, Reticulitermes lucifugus. The present study aimed at evaluating these metal chelates complexes as preservative agents for wood treatment against ter- mites.
    keywords: chelates; consumption; copper; ethylene; glycol; test; wood
       cache: jear-407.pdf
  plain text: jear-407.txt

        item: #88 of 150
          id: jear-408
      author: None
       title: jear-408
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-408.htm
  plain text: jear-408.txt

        item: #89 of 150
          id: jear-4092
      author: Triapitsyn, S.V.; Jones, J.M.L.; Pickett, C.H.; Buffington, M.L.; Rugman-Jones, P.F.; Daane, K.M.
       title: Description of the male of Psyllaephagus euphyllurae (Masi) (Hymenoptera, Encyrtidae), a parasitoid of the olive psylla, Euphyllura olivina (Costa) (Hemiptera, Liviidae), with notes on its reproductive traits and hyperparasitoids
        date: 2014-12-21
       words: 5788
      flesch: 57
     summary: Tel.: +1.(951).827.7817 - Fax: +1.(951).827.3086. E-mail: serguei@ucr.edu Key words: Encyrtidae, Psyllaephagus euphyllurae, host association, Liviidae, olive psylla, Euphyllura olivina, classical biological control, taxonomy, Spain, Apocharips trapezoidea, Pachyneuron sp. Acknowledgments: the first author thanks his father Prof. Vladimir A. Trjapitzin (Moscow, Russia) and Dr. André Panis (Montauroux, France) for providing valuable information on P. euphyllurae, Prof. Gennaro Viggiani (Portici, NA, Italy) for the loan of its type material, Mr. Vladimir V. Berezovskiy (Irvine, CA, USA) for mounting the voucher specimens, Dr. Roger A. Burks (University of California at Riverside, USA – UCR) for con- firmation of the identification of Pachyneuron sp. Psyllaephagus euphyllurae (Masi): Mercet, 1921: 700-702 (as “P. euphyllurae “(Silvestri)”: redescription, distribution, illustration of female); Gahan & Waterston, 1926: 375 (as P. euphyllurae “(Silv.[estri])”: host association, distribution); Ferrière, 1961: 46 (dis- tribution, host), 48 (key); Trjapitzin, 1967: 194 (key, distribution, host); Trjapitzin, 1982: 398 (key, distribution, host); Trjapitzin, 1986: 58 (com- parison with P. hyperboreus Trjapitzin, type information); Trjapitzin, 1989: 262 (key, distribution, host); Evans & Abd-Rabou, 2013: 125 (list, distribution, hosts).
    keywords: c.h; california; euphyllurae; female; figure; host; hymenoptera; olive; olivina; pickett; spain; species; specimens; trjapitzin
       cache: jear-4092.pdf
  plain text: jear-4092.txt

        item: #90 of 150
          id: jear-418
      author: Rossaro, Bruno; Boggero, Angela; Buzzi, Fabio; Agostinelli, Chiara; Nastasi, Francesco
       title: Description of the larva of Protanypus sp. A (Diptera, Chironomidae) from the Italian Alps
        date: 2012-05-06
       words: 2409
      flesch: 64
     summary: The genus is Holarctic in distribution with three species known to occur in Europe, P. caudatus Edwards, 1924, P. forcipatus (Egger, 1864) and P. morio (Zetterstedt, 1838), two species from East Palearctic, P. pseudomorio Makarchenko, 1982, also captured in Alaska (Sæther and Willassen, 1985), and P. tshereshnevi Makarchenko, 1982, three species from North America, P. ramosus Sæther, 1975, P. hamiltoni Sæther, 1975 and P. sætheri Wiederholm, 1975. The first record of Protanypus pseudomorio Makarchenko (Diptera Chironomidae) from the Nearctic, with a Description of the Female and a revised Key to Males of the Genus. - Aquat.
    keywords: chironomidae; figure; genus; protanypus; species; sæther
       cache: jear-418.pdf
  plain text: jear-418.txt

        item: #91 of 150
          id: jear-429
      author: None
       title: jear-429
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-429.htm
  plain text: jear-429.txt

        item: #92 of 150
          id: jear-431
      author: Limonta, Lidia; Morosini, Matteo Carlo; Locatelli, Daria Patrizia
       title: Development of Rhyzopertha dominica (F.) (Coleoptera Bostrichidae) on durum wheat kernels and semolina
        date: 2011-04-30
       words: 2287
      flesch: 64
     summary: Res. Ser. II, 43 (1): 33-38 30 April 2011 L. LIMontA, M.c. MoroSInI, D.P. LocAteLLI Development of Rhyzopertha dominica (F.) (Coleoptera Bostrichidae) on durum wheat kernels and semolina Abstract - the time necessary to larvae of Rhyzopertha dominica to drill kernels  with or without dusts (semolina or debris from adults), and the possibility of  development on semolina were evaluated.  30 (4): 261- 265. Tab. 4 - Number of adults of rhyzopertha dominica (F.) and mean period (S.D.) of adult emerging on semolina of durum wheat kernels (thick 6 mm).
    keywords: debris; development; kernels; larvae; semolina
       cache: jear-431.pdf
  plain text: jear-431.txt

        item: #93 of 150
          id: jear-453
      author: Batta, Yacoub A.
       title: The first report on entomopathogenic effect of Fusarium avenaceum (Fries) Saccardo (Hypocreales, Ascomycota) against rice weevil (Sitophilus oryzae L.: Curculionidae, Coleoptera)
        date: 2012-12-16
       words: 5037
      flesch: 55
     summary: The highest mean percentage of adult mortal- ity was obtained by the direct spraying of S. oryzae adults with the fun- gus conidial suspension before introduction of the treated adults into pots containing wheat grain; the lowest mean percentage of adult mor- tality was obtained by spraying the inner surfaces of pots with the fun- gus conidial suspension before introducing the grain and insects. Therefore, the objectives of the present research were: i) to assess the efficacy of F. avenaceum (strain 10A) against S. oryzae adults by applying the fungus conidial suspension in different ways, then comparing the treatment effect by Journal of Entomological and Acarological Research 2012; volume 44:e11 Correspondence:
    keywords: adults; avenaceum; fungus; fusarium; grain; insects; mortality; oryzae; species; suspension; treatment
       cache: jear-453.pdf
  plain text: jear-453.txt

        item: #94 of 150
          id: jear-454
      author: Zahm, Norbert
       title: Contribution to the knowledge of the Lepidoptera Fauna of the lower Sangro valley in the Abruzzo region of Central Italy
        date: 2012-12-16
       words: 16469
      flesch: 67
     summary: 3- VI II N ig ht 16 Pa ra hy po pt a ca es tr um (H Ü BN ER , 1 80 8) x 8- VI I 22 -V II N ig ht 17 Ze uz er a py ri na (L IN N AE U S, 1 76 1) x x 19 -V 3- VI II N ig ht To rt ri ci da e 18 Ph th eo ch ro a in gr id ae H U EM ER , 1 99 0 x 16 -V -2 00 6 N ig ht 4) 8 ) 19 Co ch yl is h yb ri de lla (H Ü BN ER , 1 81 3) x 15 -V II -2 00 0 N ig ht 20 Co ch yl is m ol lic ul an a ZE LL ER , 1 84 7 x 27 -V II I- 19 92 N ig ht 21 Ac le ri s sp ar sa na (D EN IS & S CH IF FE RM Ü LL ER , 1 77 5) x x 16 -V 15 -X N ig ht 15 0 Pe ri ba to de s um br ar ia (H Ü BN ER , 1 80 9) x x 28 -V 15 -X N ig ht 15 1 H yp om ec is p un ct in al is ( SC O PO LI , 1 76 3) x x 18 -V 4- VI II N ig ht 15 2 As co ti s se le na ri a (D EN IS & S CH
    keywords: -v ii; ae u; ig ht; ii -2; ii n; n ae; n ig; n n; n u; u s
       cache: jear-454.pdf
  plain text: jear-454.txt

        item: #95 of 150
          id: jear-4565
      author: None
       title: jear-4565
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-4565.htm
  plain text: jear-4565.txt

        item: #96 of 150
          id: jear-460
      author: Trematerra, Pasquale
       title: Notes on some Lepidoptera Tortricidae from Central Asia
        date: 2012-05-06
       words: 3864
      flesch: 60
     summary: Tribe Cnephasiini Eana samarcandae (Razowski, 1958) MATERIAL EXAMINED: 1 male and 1 female, Kirgizstan, S. Toktogul L., 15 km NE Karakul v., 1300-1400 m, 17.06.2000, S. Churkin leg.; 4 males and 8 females, Kirgizstan, South Chatkal, 5 km E Aflatun v., Karasu r., 1350 m, 19.06.2000, S. Churkin leg. Clepsis moeschleriana (Wocke, 1862) MATERIAL EXAMINED: 1 male, Kirgizstan, S Issyk-Kul L., Ottuk v., 1650, 29.06.2000, S. Churkin leg. DISTRIBUTION.
    keywords: churkin; churkin leg; distribution; female; kirgizstan; leg; material
       cache: jear-460.pdf
  plain text: jear-460.txt

        item: #97 of 150
          id: jear-4603
      author: None
       title: jear-4603
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-4603.htm
  plain text: jear-4603.txt

        item: #98 of 150
          id: jear-461
      author: Baumgärtner, Johann; Gutierrez, Andrew Paul; Pesolillo, Simone; Severini, Maurizio
       title: A model for the overwintering process of European grapevine moth Lobesia botrana (Denis & Schiffermüller) (Lepidoptera, Tortricidae) populations
        date: 2012-05-06
       words: 6953
      flesch: 56
     summary: Newly formed pupae pass first through diapause followed by a post-diapause phase (Gutierrez et al., 2012). The same model is applied here for simulating the three overwintering phases: (7) TnD indicates the ambient hourly temperature, and jTl and jTu are the phase-specific lower and upper temperature thresholds, respec- tively, αj and βj are phase-specific constants, and ξj is a factor chang- ing the developmental rate of the combined egg and larval develop- ment (Gutierrez et al., 2012) into the pre-diapause phase.
    keywords: botrana; data; days; dde; development; diapause; et al; flight; gutierrez; lobesia; model; overwintering; post; pre; rate; temperature
       cache: jear-461.pdf
  plain text: jear-461.txt

        item: #99 of 150
          id: jear-462
      author: Reddy, Gadi V.P.; McConnel, James; E. Badilles, Aleandro
       title: Estimation of the population density of the sweetpotato weevils on the Mariana Islands
        date: 2012-05-06
       words: 3672
      flesch: 62
     summary: Because of the uncertainties regarding the behavior of the beetles, the inspection of the canopy and the ground lasted 10 min. Data analyses To analyze field population densities per quadrat, a nested ANOVA model was applied to test for significant differences between fields within islands and between islands. However, the yield levels have been declining in the recent past due to the presence of sweetpotato weevils Cylas formicarius (Fabricius) (Coleoptera, Brentidae), Euscepes postfasciatus (Fairmaire) and Daealus tuberosus (Zimmer man) (Coleoptera, Curculionidae).
    keywords: formicarius; guam; islands; population; postfasciatus; rota; sampling; sweetpotato; weevil
       cache: jear-462.pdf
  plain text: jear-462.txt

        item: #100 of 150
          id: jear-4623
      author: None
       title: jear-4623
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-4623.htm
  plain text: jear-4623.txt

        item: #101 of 150
          id: jear-463
      author: Mansour, Ramzi; Cavalieri, Vincenzo; Mazzeo, Gaetana; Grissa Lebdi, Kaouthar; Russo, Agatino
       title: A morphological and molecular characterization of vine mealybug populations (Hemiptera, Pseudococcidae) from Tunisia
        date: 2012-05-06
       words: 3156
      flesch: 57
     summary: Specimens P. citri P. ficus P. ficus P. ficus P. ficus P. ficus P. ficus (Italy) (Le Kef) (Mornag) (Sidi Thabet) (Takelsa) (Rafraf) (Testour) P. citri (Italy) 0.000 0.011 0.012 0.010 0.010 0.010 0.010 Neighbour-joining phylo- genetic tree of vine mealybug Planococcus ficus populations from six vine areas in Tunisia.
    keywords: citri; ficus; mealybug; planococcus; populations; tunisia; vine
       cache: jear-463.pdf
  plain text: jear-463.txt

        item: #102 of 150
          id: jear-467
      author: None
       title: jear-467
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-467.htm
  plain text: jear-467.txt

        item: #103 of 150
          id: jear-4684
      author: Saeidi, K.; Mirfakhraei, S.; Mehrkhou, F.
       title: Population dynamics of safflower capsule flies (Diptera: Tephritidae) in Kohgiluyeh safflower farms of Iran
        date: 2015-08-28
       words: 6306
      flesch: 64
     summary: Table 2 shows the number of fruit fly species coming from incubat- ed flower heads during the study period (2009). Whereas, the highest trap catch Table 2 shows the number of fruit fly species coming from incubat- No n- co mm er cia l Table 2 shows the number of fruit fly species coming from incubat- ed flower heads during the study period (2009).
    keywords: cia; cia l; flies; fly; fruit; nco; safflower; species
       cache: jear-4684.pdf
  plain text: jear-4684.txt

        item: #104 of 150
          id: jear-4705
      author: Viggiani, G.
       title: Orgya antiqua (Linnaeus) (Lepidoptera: Lymantriidae): an occasional pest on Pelargonium
        date: 2015-04-23
       words: 818
      flesch: 55
     summary: Pelargonium infested by caterpillars of Orgya antiqua. The recorded infestation of Pelargonium was most likely caused by young caterpillars passively transported by wind.
    keywords: antiqua; caterpillars; figure
       cache: jear-4705.pdf
  plain text: jear-4705.txt

        item: #105 of 150
          id: jear-4817
      author: None
       title: jear-4817
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-4817.htm
  plain text: jear-4817.txt

        item: #106 of 150
          id: jear-4838
      author: Lotfalizadeh, H.
       title: Preliminary checklist of Iranian mymarids (Hymenoptera: Chalcidoidea, Mymaridae)
        date: 2015-12-16
       words: 3960
      flesch: 52
     summary: The genus Gonatocerus Nees (Hymenoptera Chalcidoidea Mymaridae) in corn fields of Navarra, North Spain. Later, Triapitsyn (2013), Haghayeghi-Nosrati et al. (2013), Bayegan et al. (2014) and Haghayeghi-Nosrati et al. (2014) added some new records and increased the number of known species from country.
    keywords: azarbaijan; east; gonatocerus; huber; iran; mymaridae; species; triapitsyn
       cache: jear-4838.pdf
  plain text: jear-4838.txt

        item: #107 of 150
          id: jear-4911
      author: Derdar, M.A.; Belal, H.M.R.
       title: Morphometry of adults and larval stages of Cicadatra persica (Cicadidae: Hemiptera) distributed in Erneh, Syria
        date: 2016-04-28
       words: 2081
      flesch: 68
     summary: Journal of Entomological and Acarological Research 2012; volume 44:e Journal of Entomological and Acarological Research 2016; volume 48:4911 Morphometry of adults and larval stages of Cicadatra persica (Cicadidae: Hemiptera) distributed in Erneh, Syria M.A. Derdar,1 H.M.R. Belal2 1Department of Insects Research, Administration of Plant Protection Research, General Commission for Scientific Agricultural Research, Damascus; 2Department Plant Protection, Faculty of Agriculture, University of Damascus, Damascus, Syria No n- co mm er cia l u se on ly [page 2] The measurements (in mm) of the morphological characters for newly hatched nymphs of Cicadatra persica (n=6).
    keywords: body; cicadatra; figure; persica; research
       cache: jear-4911.pdf
  plain text: jear-4911.txt

        item: #108 of 150
          id: jear-4926
      author: None
       title: jear-4926
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-4926.htm
  plain text: jear-4926.txt

        item: #109 of 150
          id: jear-4938
      author: Prabhavathi, O.; Yuvarajan, R.; Natarajan, D.
       title: Mosquitocidal properties of Ocimum canum Sims (Lamiaceae) leaf extracts against dengue vector Aedes aegypti L. (Diptera: Culicidae)
        date: 2016-12-19
       words: 6763
      flesch: 55
     summary: Recently, the researcher reported that Ocimum plant extract shows better larvicidal activity against larval and adults of mosquito species (Pratheeba et al., 2015; Murugan et al., 2016). (2005) reported the essential oils from select- ed plants as noticeable repellent and ovicidal properties, Hyptissu ave- olens has useful insecticidal (Amusan et al., 2005; Jaenson et al., 2006) and control many stored product pests (Peerzada, 1997; Othira et al., 2009; Conti et al., 2011).
    keywords: activity; aedes; aegypti; analysis; canum; chloroform; compounds; dengue; et al; extracts; larvae; larvicidal; mortality; mosquito; ocimum; plant; repellent; res; research; vector
       cache: jear-4938.pdf
  plain text: jear-4938.txt

        item: #110 of 150
          id: jear-4954
      author: None
       title: jear-4954
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-4954.htm
  plain text: jear-4954.txt

        item: #111 of 150
          id: jear-4955
      author: Sande, S.; Zimba, M.; Chinwada, P.; Masendu, H.T.; Makuwaza, A.
       title: Malaria vector species composition and relative abundance in Mutare and Mutasa districts, Zimbabwe
        date: 2015-12-16
       words: 5376
      flesch: 50
     summary: Morphological identification of anopheline mosquitoes showed pres- ence of two complexes: An. funestus and An. gambiae. Emerged adults were identified morphologically into species complexes (An. gambiae and An. funestus) using taxonom- ic keys of Gillies & Coetzee (1987).
    keywords: arabiensis; funestus; funestus group; gambiae; group; malaria; s.l; sites; species; study; vector; zimbabwe
       cache: jear-4955.pdf
  plain text: jear-4955.txt

        item: #112 of 150
          id: jear-496
      author: Lozzia, Giuseppe Carlo
       title: Editorial
        date: 2012-05-06
       words: 309
      flesch: 38
     summary: I would also like to thank the former Editorial Board and Director, and all the colleagues who will work with me on this interesting and stimulating new project. jear2012 [Journal of Entomological and Acarological Research 2012; 44]
    keywords: journal
       cache: jear-496.pdf
  plain text: jear-496.txt

        item: #113 of 150
          id: jear-5016
      author: Kenawy, M.A.; Al Ashry, H.A.; Shobrak, M.
       title: Distribution and periodicity of sandflies (Diptera: Phlebotominae) along different altitudes in Asir Region, Southwest of Saudi Arabia
        date: 2015-08-28
       words: 7509
      flesch: 62
     summary: on ly on ly References ABDELWAHAB A.I., ABDOON M.A.A., 2005 - Distribution and population dynamics of Phlebotomus sandflies (Diptera: Psychodidae) in an endemic area of Cutaneous leishmaniasis in Asir Region, Southwestern of Saudi Arabia. 39: 832-836. AL-ZAHRANI M.A., LANE R.P., CHING C.I., ASIRY M.A., PETERS W., 1997 - Biology of Phlebotomus sandflies (Diptera: Psychodidae) in two contrasting leishmaniasis foci in south-west Saudi Arabia.
    keywords: arabia; asir; cia; cia l; nco; sandflies; saudi; species
       cache: jear-5016.pdf
  plain text: jear-5016.txt

        item: #114 of 150
          id: jear-502
      author: None
       title: jear-502
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-502.htm
  plain text: jear-502.txt

        item: #115 of 150
          id: jear-503
      author: Epis, S.; Montagna, M.; Comandatore, F.; Damiani, C.; Diabaté, A.; Daffonchio, D.; Chouaia, B.; Favia, G.
       title: Molecular typing of bacteria of the genus Asaia in malaria vector Anopheles arabiensis Patton, 1905
        date: 2012-08-31
       words: 3239
      flesch: 56
     summary: DNA extraction and amplification from selected colonies DNA was extracted from Asaia strains and mosquitoes using com- mercial kit Wizard Genomic DNA Purification (PROMEGA Corp., Fitchburg, WI, USA) and eluted in 100 μL of elution buffer. Similar to a recently described work (Chouaia et al., 2010), here we present the first description of the sym- biont Asaia in A. arabiensis mosquitoes and its genetic diversity.
    keywords: 16s; anopheles; arabiensis; asaia; et al; mosquito; pcr; strains
       cache: jear-503.pdf
  plain text: jear-503.txt

        item: #116 of 150
          id: jear-506
      author: Lukwa, N.; Makuwaza, A.; Mutambu, S.L.; Munosiyei, P.
       title: The residual effect of lambda-cyhalothrin, deltamethrin and dichlorodiphenyltrichloroethane in Zhombe, Kwekwe district, Zimbabwe
        date: 2012-08-31
       words: 3167
      flesch: 61
     summary: During the first month on sprayed walls, deltamethrin was not as effective as either lambda-cyhalothrin of DDT but this trend was totally different on sprayed roofs over the same peri- od. Bioassays conducted on sprayed walls (1 month), showed that effica- cy of lambda-cyhalothrin was the same with DDT but different with deltamethrin and this trend continued in the 2nd month.
    keywords: cyhalothrin; ddt; deltamethrin; lambda; month; mosquitoes; range; spraying
       cache: jear-506.pdf
  plain text: jear-506.txt

        item: #117 of 150
          id: jear-508
      author: Lukwa, N.; Sande, S.; Munosiyei, P.; Zimba, M.
       title: Insecticide susceptibility tests conducted in Kamhororo, Masakadza and Chilonga villages in Zimbabwe during the 2011 malaria period
        date: 2012-12-16
       words: 6526
      flesch: 60
     summary: Knock down Chilonga Kamhororo Masakadza (min) (%) (%) (%) 0 Knockdown Chilonga Kamhororo Masakadza (min) (%) (%) (%) 0
    keywords: chilonga; kamhororo; knockdown; masakadza; mean; min; min observation; mosquitoes; observation; range; resistance; time
       cache: jear-508.pdf
  plain text: jear-508.txt

        item: #118 of 150
          id: jear-5085
      author: None
       title: jear-5085
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-5085.htm
  plain text: jear-5085.txt

        item: #119 of 150
          id: jear-5090
      author: Minaei, K.
       title: The first record of Dendrothrips aspersus (Thysanoptera: Thripidae) from Iran
        date: 2015-12-16
       words: 2418
      flesch: 60
     summary: Mound (1999, 2011a) demonstrated that among Dendrothripinae, none of Dendrothrips species is associated with grasses. An identification key for those gen- era and species including four species in Dendrothrips are also avail- able (Alavi et al., 2014).
    keywords: dendrothrips; iran; minaei; new; species; thripidae; thrips; thysanoptera
       cache: jear-5090.pdf
  plain text: jear-5090.txt

        item: #120 of 150
          id: jear-5120
      author: None
       title: jear-5120
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-5120.htm
  plain text: jear-5120.txt

        item: #121 of 150
          id: jear-5135
      author: Namaki Khamneh, R.; Khaghaninia, S.; Gilasian, E.
       title: New records of the subfamily Oscinellinae (Diptera; Chloropidae) from Iran
        date: 2015-08-28
       words: 3774
      flesch: 62
     summary: Nartshuk and Andersson (2013) provided a book about species of this No n- co mm er cia l Nartshuk and Andersson (2013) provided a book about species of this family. New records of the subfamily Oscinellinae (Diptera; Chloropidae) from Iran R. Namaki Khamneh,1 S. Khaghaninia,1 E. Gilasian2 1Department of Plant Protection, University of Tabriz, Tabriz; 2Insect Taxonomy Research Department, Iranian Research Institute of Plant Protection, Tehran, Iran No n- co mm er cia l erately large family of Acalyptratae (Nartshuk, 2012a).
    keywords: black; chloropidae; cia; nartshuk; nco; species
       cache: jear-5135.pdf
  plain text: jear-5135.txt

        item: #122 of 150
          id: jear-5151
      author: Rossaro, B.; Zaupa, S.; Boggero, A.
       title: Pseudosmittia fabioi Boggero, Zaupa & Rossaro, 2014 (Diptera: Chironomidae: Orthocladiinae) a new junior synonym of Prosmittia verae Krasheninnikov & Makarchenko, 2008
        date: 2015-08-28
       words: 2922
      flesch: 59
     summary: Comparisons of measurements on Pr. verae and Ps. fabioi are given in Table 1 (head, body, wings) and Table 2 (legs). that Ps. fabioi, with a moderate costal extension, R4+5 ending dis- tal to M3+4 and absence of acrostichals, can be included beyond any doubt in the genus Prosmittia; the shape of hypopygium emphasized the strict similarity with the one of Pr. verae.
    keywords: cia; cia l; nco; prosmittia
       cache: jear-5151.pdf
  plain text: jear-5151.txt

        item: #123 of 150
          id: jear-5180
      author: None
       title: jear-5180
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-5180.htm
  plain text: jear-5180.txt

        item: #124 of 150
          id: jear-5181
      author: Amini, S.; Hosseini, R.
       title: A multiplex polymerase chain reaction based method for rapid identification of two species of the genus Scolytus Geoffroy (Col: Curculionidae: Scolytinae) in Iran
        date: 2016-04-28
       words: 4386
      flesch: 55
     summary: In this study CO1 in mtDNA region is selected for design of primers, because studies have shown that this region is useful for identification of Coleoptera species (Paul et al., 2009; Dirk et al., 2007; Fang, 2009) as result showed high potential of this region of genome in discrimination of Scolytus species. It is possible to identify a large number of Scolytus species even in immature developmental stages, which might be a rapid and rel- atively low cost.
    keywords: bark; beetles; dna; identification; min; pcr; primers; reaction; scolytus; species
       cache: jear-5181.pdf
  plain text: jear-5181.txt

        item: #125 of 150
          id: jear-5256
      author: Harbi, A.; Abbes, K.; Dridi-Almohandes, Bouthaina; Chermiti, B.
       title: Efficacy of insect-proof nets used in Tunisian tomato greenhouses against Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and potential impact on plant growth and fruit quality
        date: 2015-12-16
       words: 5765
      flesch: 59
     summary: This study was carried out aiming to: i) evaluate the efficacy of these two insect-proof net setups to control T. absoluta in greenhouses when combined with male monitoring; ii) assess possible impacts of both netting setups on plant growth and quality parameters of tomato fruits. Weekly monitoring of T. absoluta in two tomato greenhouses with different netting setups using pheromone traps and sampling of leaves and fruits showed no differences in the levels of infestation by the pest with a maximum average values of 6.66 eggs/leaf, 4.16 larvae/leaf and 4.16 mines/leaf.
    keywords: absoluta; figure; fruits; greenhouse; insect; parameters; pest; plant; proof; stage; tomato; tuta
       cache: jear-5256.pdf
  plain text: jear-5256.txt

        item: #126 of 150
          id: jear-5285
      author: None
       title: jear-5285
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-5285.htm
  plain text: jear-5285.txt

        item: #127 of 150
          id: jear-529
      author: Razowski, J.; Trematerra, P.
       title: Tortricidae (Lepidoptera) from Ethiopia, 2
        date: 2012-08-31
       words: 2556
      flesch: 65
     summary: In the present collection there are further four species described or recorded from Nigeria (Lobesia hecista Razowski, L. talyana Razowski, L. lecta Razowski, and Endothenia gutturalis Meyrick, 1934) and found in Ethiopia. ©Copyright J. Razowski and P. Trematerra, 2012 Licensee PAGEPress, Italy Journal of Entomological and Acarological Research 2012; 44:e8 doi:10.4081/jear.2012.e8
    keywords: ethiopia; legg; razowski; sciarretta; zone
       cache: jear-529.pdf
  plain text: jear-529.txt

        item: #128 of 150
          id: jear-534
      author: Minaei, K.
       title: First report of an endemic Australian thrips, Thrips australis (Thysanoptera: Thripidae) on Eucalyptus in Shiraz, Iran
        date: 2012-08-31
       words: 2250
      flesch: 63
     summary: Although variation in color and structure was observed within the Iranian specimens (Tables 1 and 2), they were distinguishable from other Thrips species by almost a complete row of forewing (Figure 1A), six (instead of five) marginal setae on clavus (Figure 1A), and a bullet shaped antennal segment VI (Figure 1B). Thirty-four species are recorded from Africa (Mound, 2010) and subsequently an illustrated key is provided to distinguish the 33 species of genus Thrips recorded from China (Zhang et al., 2011).
    keywords: genus; iran; mound; setae; shiraz; species; thrips; thysanoptera
       cache: jear-534.pdf
  plain text: jear-534.txt

        item: #129 of 150
          id: jear-5361
      author: None
       title: jear-5361
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-5361.htm
  plain text: jear-5361.txt

        item: #130 of 150
          id: jear-5403
      author: Saeidi, K.; Saeidi, E.
       title: Bio-control efficiency of Bacillus thuringiensis (Berliner) against the citrus leaf miner, Phyllocnistis citrella Stainton (Lep., Gracillariidae) under laboratory conditions
        date: 2016-12-19
       words: 3883
      flesch: 51
     summary: Page 119. JAFARZADEH M., 2000 - Biology and comparison application methods Imidacloprid against of citrus leaf miner Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae). The first record of citrus leaf miner from southern and northern Iran, with a dramatic increase and widespread dispersal, was noted in 1961 and 1994, respectively (Amiri Besheli, 2006a).
    keywords: citrella; citrus; days; different; leaf; miner; mortality; phyllocnistis; thuringiensis
       cache: jear-5403.pdf
  plain text: jear-5403.txt

        item: #131 of 150
          id: jear-5492
      author: Goh, Y.K.; Teo, T.M.; Marzuki, N.F.; Tan, S.S.; Subramanian, R.; Hasim, I.; Goh, Y.K.; Goh, K.J.
       title: First record of entomopathogenic Beauveria bassiana (Ascomycota: Hypocreales) on pleasing fungus beetle Episcapha quadrimacula (Coleoptera: Erotylidae) in Malaysia
        date: 2016-12-19
       words: 1205
      flesch: 54
     summary: Beauveria bassiana and Episcapha quadrimacula: A) E. quadrimacula beetle infested with B. bassiana on oil palm trunk infected with Ganoderma boninense; B) E. quadrimacula with B. bassiana conidia and mycelia (ventral view of the beetle); C) Morphology of B. bassiana colony on MEA (front); D) Reverse view of B. bassiana colony morphology on MEA; E and F) Control and treated E. quadrimacula (E: dorsal view, and F: ventral view). In conclusion, E. quadrimacula beetles are susceptible to the infes- tation by B. bassiana, demonstrating mortality and with external mycelia after exposed to conidia from B. bassiana.
    keywords: bassiana; beetles; quadrimacula
       cache: jear-5492.pdf
  plain text: jear-5492.txt

        item: #132 of 150
          id: jear-5506
      author: None
       title: jear-5506
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-5506.htm
  plain text: jear-5506.txt

        item: #133 of 150
          id: jear-554
      author: Damos, Petros T.
       title: Fecundity and trapping of Varroa destructor (Mesostigmata: Varroidae) in Greek drone brood of Apis melifera (Hymenoptera: Apididae)
        date: 2012-12-16
       words: 6364
      flesch: 58
     summary: Multiple parasitization levels per drone brood cells caused by V. destructor mites of A. melifera during the (A) first and (B) second treatments. V. destructor multiple parasitization levels in drone brood cells of A. melifera and during the (A) and (B) second treatments (i.e., first and second mite generations).
    keywords: bee; brood; cells; destructor; drone; levels; melifera; mite; number; parasitization; second; varroa
       cache: jear-554.pdf
  plain text: jear-554.txt

        item: #134 of 150
          id: jear-557
      author: Akyazi, Rana
       title: First report of Aculops lycopersici (Tryon, 1917) (Acari: Eriophyidae) on Pepino in Turkey
        date: 2012-12-16
       words: 1722
      flesch: 57
     summary: Short paper Aculops lycopersici (Tryon, 1917) (Acari: Eriophyidae) is known as tomato russet mite or tomato rust mite. Tomato russet mite was also found on S. nigrum in the tomato fields in Tokat province (Yanar et al., 2008).
    keywords: acarina; aculops; eriophyidae; lycopersici; mite; solanum; tomato; turkey
       cache: jear-557.pdf
  plain text: jear-557.txt

        item: #135 of 150
          id: jear-572
      author: Murugan, Kadarkarai; Madhiyazhagan, Pari; Nareshkumar, Arjunan; Nataraj, Thiyagarajan; Dinesh, D.; Hwang, Jiang Shiou; Nicoletti, Marcello
       title: Mosquitocidal and water purification properties of Ocimum sanctum and Phyllanthus emblica
        date: 2012-12-16
       words: 7036
      flesch: 58
     summary: Results emphasized that plant extracts have high toxicity against the egg and larvae of the malarial vector Anopheles stephensi and also have water sedimentation properties. Water quality parameters such as color, turbidity and pH were analyzed in the water samples (pre-treatment and post-treatment of plant extracts) taken from the breeding sites of mosquitoes.
    keywords: activity; anopheles; concentration; control; eggs; emblica; ethanol; extracts; larvae; mortality; mosquito; ocimum; oviposition; phyllanthus; plant; ppm; sanctum; stephensi; treatment; water
       cache: jear-572.pdf
  plain text: jear-572.txt

        item: #136 of 150
          id: jear-585
      author: Nareshkumar, Arjunan; Murugan, Kadarkarai; Baruah, Indra; Madhiyazhagan, Pari; Nataraj, Thiyagarajan
       title: Larvicidal potentiality, longevity and fecundity inhibitory activities of Bacillus sphaericus (Bs G3-IV) on vector mosquitoes, Aedes aegypti and Culex quinquefasciatus
        date: 2012-12-16
       words: 5897
      flesch: 58
     summary: In the present study, a bacterial pesticide, Bacillus sphaericus (Bs G3-IV), was used to control the dengue and filarial vectors, Aedes aegypti and Culex quinquefasciatus. Bacillus sphaericus (Bs G3-IV) was very effective against Aedes aegypti and Culex quinquefasciatus, showing significant larval mortality.
    keywords: aedes; aegypti; bacillus; bacillus sphaericus; control; culex; larvae; mosquito; ppm; quinquefasciatus; sphaericus; treatment
       cache: jear-585.pdf
  plain text: jear-585.txt

        item: #137 of 150
          id: jear-591
      author: Lukwa, N.; Makuwaza, A.; Chiwade, T.; Mutambu, S.L.; Zimba, M.; Munosiyei, P.
       title: Wash resistance and repellent properties of Africa University mosquito blankets against mosquitoes
        date: 2013-04-23
       words: 2743
      flesch: 64
     summary: ITMs have been used for some time although the use of treated blankets is relatively uncommon. One hundred percent mortality was realized up to 20 washes before it decreased at 25 washes when treated blankets were used.
    keywords: blankets; control; malaria; mosquito; repellence; washes
       cache: jear-591.pdf
  plain text: jear-591.txt

        item: #138 of 150
          id: jear-602
      author: None
       title: jear-602
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-602.htm
  plain text: jear-602.txt

        item: #139 of 150
          id: jear-615
      author: Dardar, Marah Ahmad; Belal, Hamzeh Mouhammad Ramadan; Basheer, Abedlnabi Mouhammad
       title: Observations on some biological aspects of Cicadatra persica (Cicadidae: Hemiptera) in apple fruit orchards in Erneh, Syria
        date: 2012-12-16
       words: 2130
      flesch: 63
     summary: Egg laying period The peak of adult emergence was in the 4th week of June (23th-29th) (Figure 3).
    keywords: apple; cicadas; egg; emergence; june; period; persica; research
       cache: jear-615.pdf
  plain text: jear-615.txt

        item: #140 of 150
          id: jear-626
      author: Chaib, N.; Fouzari, A.; Bouhala, Z.; Samraoui, B.; Rossaro, B.
       title: Chironomid (Diptera, Chironomidae) species assemblages in northeastern Algerian hydrosystems
        date: 2013-04-23
       words: 5895
      flesch: 59
     summary: Despite their importance, little is known of habitat preferences of chi- ronomids, especially in the southern Mediterranean, including Algeria (Lounaci et al., 2000a; Lounaci et al., 2000b; Arab et al., 2004; Belaidi et al., 2004; Chaib et al., 2011a; Chaib et al., 2011b). Loss of wetland biodiversity can only be mitigated through critical knowledge of threats (Battisti et al., 2008; Gibbs, 2000).
    keywords: algeria; analysis; chironomidae; east; gravel; kebir; samraoui; sand; seybouse; sites; sp.1; species; substrate
       cache: jear-626.pdf
  plain text: jear-626.txt

        item: #141 of 150
          id: jear-637
      author: None
       title: jear-637
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-637.htm
  plain text: jear-637.txt

        item: #142 of 150
          id: jear-639
      author: Emami, F.; Alichi, M.; Minaei, K.
       title: Interaction between the entomopathogenic fungus, Beauveria bassiana (Ascomycota: Hypocreales) and the parasitoid wasp, Aphidius colemani Viereck (Hymenoptera: Braconidae)
        date: 2013-04-23
       words: 3744
      flesch: 54
     summary: No. aphids exposed to No. aphids treated with fungus No. mummies produced by % Emergence of F1 Treatments Ac After exposure to Ac Ac Generation of Ac Only Ac 40 - 32.0±0.77a 94.1±3.9a Ac+Bb (24 h) 40 35.1±1.1 9.5±0.99d 19.4±4.6e Ac+Bb (48 h) 40 34.9±1.2 18.4±1.75c 46.1±5.9d Ac+Bb (72 h) 40 33.5±1.1 25.1±1.66b 61.2±0.5c Ac+Bb (96 h) 40 33.2±1.3 26.2±1.15b 75.8±5.3b Ac, Aphidius colemani; Bb, Beauveria bassiana. Least squares means (±SE), number of Aphidius colemani mummies produced, percent adult emergence of F1 generation, and percentage of females in the F1 generation from Myzus persicae sprayed with Beauveria bassiana and then parasitized 0, 24, 48, and 72 h later.
    keywords: aphidius; aphids; bassiana; colemani; control; emergence; fungus; parasitoid
       cache: jear-639.pdf
  plain text: jear-639.txt

        item: #143 of 150
          id: jear-660
      author: Trematerra, P.
       title: Isotrias penedana sp. n. a new species of Lepidoptera (Tortricidae: Chlidanotinae: Polyorthini) from Portugal
        date: 2013-04-23
       words: 1357
      flesch: 60
     summary: Chlidanotinae: Polyorthini) from Portugal P. Trematerra Department of Agricultural, Environmental and Food Sciences, University of Molise, Campobasso, Italy Abstract A new species of Tortricidae (Lepidoptera: Chlidanotinae: Polyorthini), Isotrias penedana sp. n., is described. E-mail: trema@unimol.it Key words: Isotrias penedana sp. n., Lepidoptera Tortricidae, Chlidanotinae, Polyorthini, new species, Portugal.
    keywords: isotrias; penedana; serra
       cache: jear-660.pdf
  plain text: jear-660.txt

        item: #144 of 150
          id: jear-674
      author: None
       title: jear-674
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-674.htm
  plain text: jear-674.txt

        item: #145 of 150
          id: jear-676
      author: Farahani, S.; Talebi, A.A.; Rakhshani, E.
       title: A contribution to the knowledge of Euphorinae (Hymenoptera: Braconidae), with six new records from Iran
        date: 2013-09-06
       words: 8772
      flesch: 58
     summary: Lateral habitus of adult Perilitus species, females: (A) P. aethiops; (B) P. bicolor; (C) Frontal view of head in Perilitus species, females: (A) P. aethiops, (B) P. bicolor, (C)
    keywords: antennae; braconidae; brown; cia; cia l; figure; hymenoptera; iran; length; nco; perilitus; province; species
       cache: jear-676.pdf
  plain text: jear-676.txt

        item: #146 of 150
          id: jear-678
      author: Sorkhabi-Abdolmaleki, S.; Zibaee, A.; Hoda, H.; Hosseini, R.; Fazeli-Dinan, M.
       title: Proteolytic compartmentalization and activity in the midgut of Andrallus spinidens Fabricius (Hemiptera: Pentatomidae)
        date: 2013-04-23
       words: 7061
      flesch: 53
     summary: Protease compartmentalization in the four sections of midgut To determine proteolytic compartmentalization, four-sectioned midguts of A. spinidens were separated and protease activities were measured as described above. Proteolytic profile in different nymphal instars General and specific proteolytic activities were measured in the five nymphal instars of A. spinidens to find their differences depending on developmental stage.
    keywords: activity; digestion; figure; inhibitors; like; midgut; proteases; serine; spinidens; trypsin
       cache: jear-678.pdf
  plain text: jear-678.txt

        item: #147 of 150
          id: jear-689
      author: None
       title: jear-689
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-689.htm
  plain text: jear-689.txt

        item: #148 of 150
          id: jear-715
      author: Saeidi, K.; Hassanpour, B.
       title: Efficiency of Mentha piperita L. and Mentha pulegium L. essential oils on nutritional indices of Plodia interpunctella Hübner (Lepidoptera: Pyralidae)
        date: 2014-04-14
       words: 3488
      flesch: 60
     summary: The first factor in this design included three treatments, consisting of the essential oils of M. piperita, M. pulegium and a control, and the second factor consist- ed of six concentrations of plant essential oils: 0.1, 0.5, 0.75, 1, 1.5 and 2 mL/disk, and a control treatment. -Toxicity of plant essential oils and their components against Lycoriella ingenua (Diptera: Sciaridae).
    keywords: food; indices; insects; interpunctella; mentha; oils; piperita; plant; pulegium
       cache: jear-715.pdf
  plain text: jear-715.txt

        item: #149 of 150
          id: jear-724
      author: Kalimuthu, K.; Panneerselvam, C.; Murugan, K.; Hwang, J.- S.
       title: Green synthesis of silver nanoparticles using Cadaba indica lam leaf extract and its larvicidal and pupicidal activity against Anopheles stephensi and Culex quinquefasciatus
        date: 2013-09-06
       words: 7804
      flesch: 58
     summary: In the present study, we report on the synthesis of silver nanoparti- cles, reducing the silver ions present in the solution of silver nitrate by C. indica lam leaf extract, and its efficacy against A. stephensi and C. quinquefasciatus. Larvicidal activity of synthesized silver nanoparticles using C. indica lam leaf extract against larvae and pupa of A. stephensi and C. quinquefasciatus.
    keywords: cia; cia l; extract; indica; lam; leaf; nanoparticles; nco; plant; quinquefasciatus; silver; synthesis
       cache: jear-724.pdf
  plain text: jear-724.txt

        item: #150 of 150
          id: jear-977
      author: None
       title: jear-977
        date: None
       words: 16
      flesch: 90
     summary: 429 Too Many Requests You have sent too many requests in a given amount of time.
    keywords: requests
       cache: jear-977.htm
  plain text: jear-977.txt