item: #1 of 600 id: jhs-10 author: Mounika, Y; Sivaram, G Thanuja; Reddy, P Sham Sundar; Ramaiah, M title: Effect of biofertilizers and micronutrients on growth, leaf yield and quality of coriander (Coriandrum sativum L.) cv. Sadhana date: 2017-12-31 words: 3292 flesch: 73 summary: Yield and yield attributes The yield and yield attributing characters, such as fresh leaf yield per plant, leaf yield per plot, leaf yield p er hec t a r e ( Table 3 ) Effect of biofertilizers and micronutrients on growth, leaf yield and quality of coriander (Coriandrum sativum L.) cv. keywords: azospirillum; foliar; inoculation; leaf; seed; spray; yield cache: jhs-10.pdf plain text: jhs-10.txt item: #2 of 600 id: jhs-100 author: Pushpalatha, N; Anjanappa, M; Devappa, V; Pitchaimuthu, M title: Genetic Variability and Heritability for Growth and Yield in Cucumber (Cucumis sativus L.) date: 2016-06-30 words: 2449 flesch: 60 summary: Key words: Genetic variability, heritability, GCV, PCV, cucumber J. Hortl. Hence, the present investigation was formulated with an objective of assessing and quantifying genetic variability, heritability, genetic advance, and genetic advance over per cent of mean for growth and yield traits in selected cucumber genotypes. keywords: days; fruit; mean; number; plant cache: jhs-100.pdf plain text: jhs-100.txt item: #3 of 600 id: jhs-1007 author: B, Varalakshmi; P.E., Rajasekharan title: Characterization, inheritance of male sterility and development of male sterile and maintainer lines in ridge gourd (Luffa acutangula (Roxb.) L.) date: 2022-09-24 words: 4764 flesch: 67 summary: Similarly mean female bud length was more (94.8 cm) in male sterile hybrids than male fertile hybrids (4.6cm) and also the fruit length was more in sterile hybrids (24.8cm) than in fertile hybrids (20.2cm) Male flower production in monoecious line (left) and absence of male flowers in male sterile line (right) J. Hortl. keywords: days; fertile; fertility; flower; gourd; hybrids; length; lines; maintainer; male; plants; pollen; ridge; sterility cache: jhs-1007.pdf plain text: jhs-1007.txt item: #4 of 600 id: jhs-101 author: Roy, Anindita; Kumar, B Prasanna; Swami, D V; Subbramamma, P title: 'Cashew Apple' Juice Blend with Mango, Pineapple and Sapota for Improving Quality of RTS Beverages and Economic Feasibility Thereof date: 2016-06-30 words: 4856 flesch: 70 summary: However, based on organoleptic score, the RTS beverage prepared using mango with cashew apple juice as blend was the best, and as per cost-economics, pineapple with cashew apple juice blend was found to be the best with regard to quality parameters under the study. RTS beverages prepared from different blends of cashew apple juice were evaluated for physico-chemical and organoleptic properties at 0, 30 and 60 days of storage, and significant differences were observed. keywords: apple; cashew; days; juice; mango; pineapple; rts; storage cache: jhs-101.pdf plain text: jhs-101.txt item: #5 of 600 id: jhs-1011 author: Kripa Shankar; S R, Singh title: Morphological and biochemical characterization of Passiflora quadrangularis L. - A source of vegetable from East Siang district, Arunachal Pradesh, India date: 2022-12-06 words: 4440 flesch: 62 summary: Genotypes Code Source Latitude Longitude Altitude 1 Passiflora quadrangularis L. P1 Pasighat, Arunachal Pradesh 280 03' N 950 20' N 156 m 2 Passiflora quadrangularis L. P2 CHF, Pasighat, 280 04' N 950 19' N 183 m Arunachal Pradesh 3 Passiflora quadrangularis L. P3 Baptist Church, Pasighat, 280 05' N 950 18' N 192 m Arunachal Pradesh 4 Passiflora quadrangularis L. P4 Agami House, Pasighat, 280 06' N 950 31' N 168 m Arunachal Pradesh 5 Passiflora quadrangularis L. P5 Police line, Pasighat, 280 05' N 950 32' N 166 m Arunachal Pradesh 6 Passiflora quadrangularis L. Original Research Paper INTRODUCTION Passiflora quadrangularis L. commonly known as Giant granadilla, belongs to Passifloraceae family consists of about 700 species and 16 genera and among them only two gener a, Passiflora and Tetrapathaea are cultivated (Feuillet, 2004) and about 520 species of the genus Passiflora are distributed to Neotropics and Africa (Ulmer and MacDougal, 2004). keywords: arunachal; content; fruit; genotypes; leaf; length; mg/100; passiflora; pradesh; quadrangularis cache: jhs-1011.pdf plain text: jhs-1011.txt item: #6 of 600 id: jhs-1015 author: None title: jhs-1015 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1015.htm plain text: jhs-1015.txt item: #7 of 600 id: jhs-1016 author: KR, Nithinkumar; J. S, Aravinda Kumar; B, Varalakshmi; Mushrif, Sadanand K; R. K, Ramachandra; S. J, Prashanth title: Genetic Divergence Study in Bitter gourd (Momordica charantia L.) date: 2022-04-05 words: 3605 flesch: 58 summary: The maximum inter cluster D2 value was found between cluster II and VI (1620.05) followed by cluster IV and VI (1262.95), cluster II and V (1098.44), cluster II and cluster III 195 Genetic Divergence Study in Bitter gourd (Momordica charantia L.) (851.00), cluster I and cluster VI (749.76) and cluster IV and V (685.87). Among the clusters, cluster VI was generally poor and cluster I as well as cluster III were intermediate in number of fruits per vine and fruit yield (Table 5.). keywords: cluster; divergence; fruit; genotypes; gourd; karnataka; kolar; number; vine; yield cache: jhs-1016.pdf plain text: jhs-1016.txt item: #8 of 600 id: jhs-102 author: Patil, M B; Panchal, V M title: Comparative Studies on 'Nucellar', 'Sathgudi' and 'Local' Sweet Orange (Mosambi) (Citrus sinensis Osbeck.) under Marathwada Conditions date: 2016-06-30 words: 1900 flesch: 67 summary: Therefore, at present, some physical aspects like height and spread of tree, stem girth, number of branches per tree, number of fruits, fruit size, peel to juice ratio, number of seeds per fruit, etc., and chemical aspects like TSS, acidity, pH and ascorbic acid content of fruit juice of ‘Nucellar’ mosambi and Sathgudi have been compared with Local sweet orange. MATERIAL AND METHODS Highest average pH and ascorbic acid content in fruit juice was recorded in cv. keywords: fruit; local; nucellar; orange; sathgudi cache: jhs-102.pdf plain text: jhs-102.txt item: #9 of 600 id: jhs-1022 author: B.L., Manjunath; Nair, Anil Kumar; R H, Laxman; C N, Abhilasha title: Standardisation of soil volume wetting for drip irrigation in mango (Mangifera indica L.,) date: 2022-12-31 words: 4748 flesch: 60 summary: The experiment involved comparison of three levels of soil volume wetting irrigation (30%, 50% and 70%) with normal drip irrigation (80% soil volume wetting) as control in RBD design with six replications. Morshet et al., (1983) also observed that there was a considerable difference in flower abscission between irrigation levels especially at the beginning Manjunath et al Table 2 : Percent wetted soil volume irrigation in influencing the plant growth characters in mango Plant height Canopy volume Girth Primary Secondary Treatment (m) (m3) (cm) branches/plant branches/plant 2019 2020 2019 2020 2019 2020 2019 2020 2019 2020 30% soil wetted 3.20 3.34 35.64 31.98 64.38 70.00 3.00 3.00 3.38 3.38 volume irrigation 50% soil wetted 3.70 3.98 53.06 45.94 64.13 67.75 4.00 4.00 2.95 2.94 volume irrigation 70% soil wetted 3.52 3.70 46.10 37.74 67.75 70.25 2.50 2.50 3.30 3.30 volume irrigation 80% soil wetted 3.44 3.58 38.24 34.22 63.50 67.25 2.75 2.75 3.05 3.04 volume irrigation S.Em± 0.19 0.19 4.10 4.50 3.38 3.90 0.42 0.42 0.27 0.28 C.D (P=0.05) NS NS 12.79 NS NS NS NS NS NS NS Treatment Fruit retention in plant (%) keywords: fruit; irrigation; mango; mean; moisture; plant; soil; use; volume; water; wetting; yield cache: jhs-1022.pdf plain text: jhs-1022.txt item: #10 of 600 id: jhs-1027 author: YELUGURI, SAIDULU; P, Tejaswini ; K K, Upreti ; S, Sriram ; G K, Seetharamu ; V, Devappa ; J B, Mythili title: Biochemical characterization of defense responses in rose genotypes in response to artificial inoculation with black spot pathogen Diplocarpon rosae date: 2022-09-30 words: 6548 flesch: 62 summary: This early increase in activity of PPO in resistant genotypes inhibited the fungal growth and thereby contributed for resistance in resistant genotype. There was consistent increase in the activities of defense related enzymes such as catalase, peroxidase, polyphenol oxidase, superoxide dismutase and phenylalanine ammonia lyase and other defense related secondary metabolites like phenols and flavonoids at different phases of black spot progression and increase was high in resistant genotypes Knock Out and Arka Nishkant. keywords: activity; arka; day; genotypes; inoculation; leaves; pathogen; plant; resistance; rose; spot; total cache: jhs-1027.pdf plain text: jhs-1027.txt item: #11 of 600 id: jhs-1047 author: Ganji Moghadam, Ebrahim; Arghavan, Sara; Fahadan, Ahmad; Zamanipour, Mahboubeh title: Possibility of early detection of graft incompatibility in some commercial plum cultivars by phenolic compounds analysis date: 2022-12-31 words: 4371 flesch: 60 summary: Graft incompatibility generally occurs at the early sta ge of gra ft development when the va scula r connection is forming. Incompatibility does not permanently become Possibility of early detection of graft incompatibility in some commercial plum cultivars by phenolic compounds analysis Arghavan S.1, Ganji Moghadam E.2*, Fahadan A.1, Zamanipour M.3 1Department of Horticulture, Azad University Branch Shirvan, North Khorasan, Iran 2Crop and Horticultural Science Research Department, Khorasan Razavi Agricultural and Natural Resources Research and Education Center, AREEO, Mashhad, Iran 3Department of Agriculture, Technical and Engineering Faculty, Velayat University, Iranshahr, Iran *Corresponding author Email : eganji@hotmail.com ABSTRACT The incidence of incompatibility signs in the grafting point can be delayed, and the analysis of phenols is used as an applicable early sign for the detection of graft incompatibility. keywords: apricot; content; cultivars; graft; graft incompatibility; incompatibility; phenol; plum; rootstock; sci; shams; tala; union; union graft cache: jhs-1047.pdf plain text: jhs-1047.txt item: #12 of 600 id: jhs-105 author: Agele, S; Famuwagun, B; Ogunleye, A title: Effects of Shade on Microclimate, Canopy Characteristics and Light Integrals in Dry Season Field-Grown Cocoa (Theobroma cacao L.) Seedlings date: 2016-06-30 words: 6177 flesch: 53 summary: Air temperatures within the cacao field were highest for open sun cacao, followed by moderate and dense shade, respectively; the values increased from December to April, with peak values seen in April. Shade intensity affected solar radiation transmission through cacao canopy, photosynthetic active radiation (PAR) and canopy light attenuation (extinction coefficient, k). keywords: area; cacao; canopy; cocoa; growth; index; lai; leaf; light; radiation; shade; sun; temperature cache: jhs-105.pdf plain text: jhs-105.txt item: #13 of 600 id: jhs-1052 author: Akshitha HJ; Prasath D; Umesha K; Mohammed Faisal P; Venkataravanappa V title: Molecular characterization of ginger genotypes using RAPD and SSR markers date: 2022-09-27 words: 5049 flesch: 67 summary: Molecular variability of ginger genotypes through pooled RAPD and SSR markers The data obtained on RAPD and SSR primers were pooled to assess the polymorphism. Molecular characterization of ginger genotypes using RAPD and SSR markers Akshitha H.J.1,3*, Prasath D.2, Umesha K.1, Mohammed Faisal P.3 and Venkataravanappa V.4 1College of Horticulture, UHS Campus, Bengaluru, Karnataka, India 2 ICAR-Indian Institute of Spices Research, Kozhikode, Kerala, India 3 ICAR-Indian Institute of Spices Research Regional Station, Appangala, Karnataka, India 4ICAR-IIHR Central Horticultural Experiment Station, Chettalli, Karnataka, India *Corresponding author E-mail: akshi.hosahalli10@gmail.com ABSTRACT Genetic diversity among ginger genotypes collected from different parts of the country was studied using molecular markers (30 RAPD and 55 SSR). keywords: acc; cluster; genotypes; ginger; markers; polymorphism; primers; rapd; sharing; similarity; ssr cache: jhs-1052.pdf plain text: jhs-1052.txt item: #14 of 600 id: jhs-1056 author: M.V, Dhanajaya ; K.K, Upreti; M.R, Dinesh title: National Horticultural Fair 2021-A Success Story date: 2022-09-19 words: 1820 flesch: 44 summary: Eleven Farmers from six different states of the country who have adopted ICAR IIHR technologies and one extension worker from Manipur who was instrumental in popularizing the ICAR IIHR technologies were felicitated during the fair. Six ca mer a s wer e placed in the field to show the demonstration plots of various technologies. keywords: farmers; horticulture; icar; institute; technologies; technology cache: jhs-1056.pdf plain text: jhs-1056.txt item: #15 of 600 id: jhs-106 author: Channabasamma, B B; Rathinakumari, A Carolin; Kumaran, G Senthil; Dayananda, P title: Development and Performance of Power-Operated Garlic Bulb Breaker date: 2016-06-30 words: 3403 flesch: 60 summary: The garlic bulb breaker had 96 per cent clove separation efficiency, 1.22 per cent clumps of clove formation, 1.7 per cent clove damage, 1.08 per cent clove loss and 780kg/h bulb breaking capacity. As maximum separation efficiency was obtained with use of corrugated rubber padding material, the second stage rollers were also provided with corrugated rubber padding material. keywords: bulb; cent; garlic; material; padding; rollers cache: jhs-106.pdf plain text: jhs-106.txt item: #16 of 600 id: jhs-107 author: Deshmukh, H K; Paithankar, D H; Nimbolkar, P K; Dewangan, R K; Awachare, C title: Effect of Plant Growth Regulators and Micronutrients on Reproductive Attributes of Acid Lime (Citrus aurantifolia Swingle) in Hasta bahar Cropping Season date: 2016-06-30 words: 2324 flesch: 71 summary: Effect of plant growth regulators and micronutrients on reproductive attributes of acid lime (Citrus aurantifolia Swingle) in hasta bahar cropping season H.K. Deshmukh*, D.H. Paithankar, P.K. Nimbolkar1, R.K. Dewangan and C. Awachare1 Department of Horticulture, P.G.I. Dr. Panjabrao Deshmukh Krishi Vidyapeeth Akola - 444104, Maharashtra, India *E-mail: hdeshmukh975@gmail.com ABSTRACT Plant growth regulators and micronutrients at various combinations [GA3 50ppm + Cycocel 1000ppm + KNO3 0.2% + Keeping the above in view, the present study was aimed at investigating the effect of different combinations of plant growth regulators and micronutrients on reproductive attributes in acid lime in the Hasta bahar season. keywords: boron; fruit; ga3; kno3; paclobutrazol cache: jhs-107.pdf plain text: jhs-107.txt item: #17 of 600 id: jhs-1072 author: J, Satisha; Pamu, Sampathkumar; Upreti, Kaushal Kishor title: Optimization of GA3 concentration for improved bunch and berry quality in grape cv. Crimson Seedless (Vitis vinifera L): GA3 concentration for improving quality of Crimson Seedless grapes date: 2022-04-05 words: 5612 flesch: 60 summary: Assam lemon Sheikh K.H.A., Singh B., Haokip S.W., Shankar K., Debbarma R. Studies on high density planting and nutrient requirement of banana in 152-163 different states of India Debnath Sanjit Bauri F.K., Swain S., Patel A.N., Patel A.R., Shaikh N.B., Bhalerao V.P., Baruah K., Manju P.R., Suma A., Menon R., Gutam S. and P. Patil Mineral nutrient composition in leaf and root tissues of fifteen polyembryonic 164-176 mango genotypes grown under varying levels of salinity Nimbolkar P.K., Kurian R.M., Varalakshmi L.R., Upreti K.K., Laxman R.H. and D. Kalaivanan Optimization of GA3 concentration for improved bunch and berry quality in 177-184 grape cv. Unlike seeded varieties of grapes, berries of the small stenospermic grape varieties like Thompson Seedless, Flame Seedless, and Crimson Seedless etc. will have lower concentration of GA as they carry Optimization of GA3 concentration for improved bunch and berry quality in grape cv. keywords: application; berries; berry; bunch; cell; concentration; crimson; ga3; grape; length; ppm; quality; rachis; seedless; total; treatments; vitis; weight cache: jhs-1072.pdf plain text: jhs-1072.txt item: #18 of 600 id: jhs-1073 author: Jattan, Minakshi; Kumari, N; Kumar, Raj; Kumar, A; Rani, B; Phogat, D S; Kumar, S; Kumar, P title: Moringa (Moringa oleifera L.): An underutilized and traditionally valued tree holding remarkable potential date: 2021-06-30 words: 11072 flesch: 70 summary: TRADITIONAL VALUE Each part of Moringa oleifera tree has immense potential (Fig 1). In the present scenario when the cultivatable area for fodder production is decreasing day by day due to the cultivation of cash crops; Moringa oleifera can serve as an important source of quality fodder. keywords: 2013; 2014; crop; diversity; et al; fodder; food; india; leaves; livestock; moringa; moringa leaves; moringa oleifera; oil; oleifera; plant; potential; production; protein; sci; seeds; source; species; t r; tree; vol cache: jhs-1073.pdf plain text: jhs-1073.txt item: #19 of 600 id: jhs-1077 author: Agadi, Annapoorna; Kolakar, S; Lakshmana, D; Nadukeri, S; Hanumanthappa, M title: Genetic variability studies in amaranthus (Amaranthus spp.) date: 2021-06-30 words: 5652 flesch: 64 summary: However, the analysis of variance by Genetic variability studies in amaranthus J. Hortl. Genetic variability studies in amaranthus J. Hortl. keywords: advance; amaranthus; gcv; genetic; heritability; leaf; leaf area; length; mean; pcv; plant; stem; variability; weight; yield cache: jhs-1077.pdf plain text: jhs-1077.txt item: #20 of 600 id: jhs-1079 author: Rajagopal, Sivaranjani; Thondiath, John Zachariah title: Elicitors induced changes in essential oil constituents of turmeric (Curcuma longa L.) rhizome date: 2022-09-30 words: 4232 flesch: 56 summary: Essential oil content of elicitor treated turmeric rhizomes (** indicates significant (p<0.01) differences among treatments) Elicitors induced changes in essential oil constituents of turmeric (Curcuma longa L.) rhizome Sivaranjani R.* and Zachariah T.J. Division of Crop Production and Post-Harvest Technology, ICAR – Indian Institute of Spices Research, Kozhikode - 673012, Kerala, India *Corresponding author E-mail : ranjanigop@gmail.com keywords: acid; chitosan; constituents; content; elicitors; genotype; oil; phenylalanine; salicylic; treatments; turmeric cache: jhs-1079.pdf plain text: jhs-1079.txt item: #21 of 600 id: jhs-108 author: Shrivastava, Akanksha; Gowda, I. N. Doreappa title: Development of Intermediate-Moisture Slices of Papaya (Carica papaya L.) by Hurdle Technology date: 2016-06-30 words: 2818 flesch: 60 summary: Similar observations were made by Goukh et al (2010), Othman (2009) and Campostrini & Glenn (2007) in papaya fruit. Physico-chemical changes during growth and development of papaya fruit. keywords: acid; hurdle; moisture; papaya; slices; storage cache: jhs-108.pdf plain text: jhs-108.txt item: #22 of 600 id: jhs-1080 author: Mishra, Smaranika; V., Varsha; H.B. , Lingaiah ; R., Venugopalan ; V., Keshav Rao ; Kattegoudar, Jyothi ; Reddy K., Madhavi title: Combining ability studies to develop superior hybrids in bell pepper (Capsicum annuum var. grossum L.) date: 2022-04-05 words: 5812 flesch: 76 summary: Key words : Bell pepper, half-diallel mating, general combining ability, hybrids, specific combining ability and yield INTRODUCTION The study on general combining ability of parents and specific combining ability of the crosses helps in ident if ica tion of bes t pa r ent s a nd c r oss es respectively. keywords: +1 +1 cache: jhs-1080.pdf plain text: jhs-1080.txt item: #23 of 600 id: jhs-1084 author: Bhandari, M; Bhandari, N; Dhital, M title: Effect of fungicide and essential oils amended wax coating on quality and shelf life 77-90 of sweet orange (Citrus sinensis Osbeck) date: 2021-06-30 words: 7948 flesch: 64 summary: The maximum retention of vitamin C was observed with essential oils treatments due to the antioxidant property of essential oils which prevent ascorbic acid from oxidation (Shao et al., 2013). These results are similar to those reported on the effect of thyme and 86 Table 7: Summary of studies on the effect of essential oils on major post-harvest pathogens of citrus Fruit Target pathogen Essential oils References Orange cv. keywords: carbendazim; citrus; control; effect; emulsion; et al; fruits; fungicide; journal; juice; life; oils; orange; postharvest; quality; sci; shelf; storage; treatments; wax cache: jhs-1084.pdf plain text: jhs-1084.txt item: #24 of 600 id: jhs-1085 author: H.C., Krishna; Sahel, Nasir Ahmad ; S., Bhuvaneswari ; Mushrif, Sadanand K. Mushrif; Reddy, Anjaneya Reddy; Foshanji, Ahmad Shafiq Foshanji title: Effect of modified atmosphere package on physico-chemical properties of pomegranate (Punica granatum L.) fruits date: 2022-09-30 words: 3663 flesch: 62 summary: But, long-term storage of pomegranate fruit has often been limited by weight loss, decay development, husk scald, loss of aril quality and taste (Porat et al., 2016). However, modified atmosphere packaging (MAP) has been found to be successful in reducing water loss, visible shriveling symptoms, husk scald a nd deca y of pomegranate fruit during cold storage, but improper use of MAP will have negative impact (Artés et al., 2000; Selcuk and Erkan, 2015). keywords: atmosphere; bag; days; effect; fruits; life; nano; package; pomegranate; storage cache: jhs-1085.pdf plain text: jhs-1085.txt item: #25 of 600 id: jhs-1089 author: C Yella Swami; G, Senthil Kumaran; R K, Naik; B, Sanjeeva Reddy; C A, Rathinakumari title: Constraints in dry chilli cultivation practices and mechanization of harvesting in Southern India date: 2022-09-30 words: 2807 flesch: 46 summary: Constraints in dry chilli cultivation practices and mechanization of harvesting in Southern India Yella Swami C.1*, Senthil Kumaran G.1, Naik R.K.2, Reddy B.S.3 and Rathinakumari C.A.1 1Division of Post Harvesting Technology and Agricultural Engineering ICAR-Indian Institute of Horticultural Research, Bengaluru, India 2Department of Farm Machinery and Power Engineering, SVCAET&RS, IGKV, Raipur 3ICAR-Central Research Institute for Dryland Agriculture, Hyderabad, India *Corresponding author E-mail : yellaswami@gmail.com ABSTRACT Dry chilli production in India condition faces many challenges apart from adverse weather conditions, labor-intensive production practices and higher overall production costs are limiting profitable dry chilli cultivation. Keywords: Chilli harvester, mechanization and self-propelled machine. 205 Constraints in dry chilli cultivation practices and mechanization J. Hortl. keywords: chilli; cultivation; farmers; harvesting; india; labour; mechanization; planting; practices; production cache: jhs-1089.pdf plain text: jhs-1089.txt item: #26 of 600 id: jhs-109 author: Isaac, Sheeba Rebecca; Mathew, Babu title: Influence of Nutrient Source on Yield, Quality and Economics of Seed Production in Vegetable Cowpea (Vigna unguiculata ssp. sesquipedalis) date: 2016-06-30 words: 2380 flesch: 57 summary: Yield attributes were found non-significant, but had a positive influence on seed yield. Data on fruit yield, yield attributes and seed yield in cow pea fertilized with various combinations of nutrient sources are presented in Table 1. keywords: manure; production; rdn; seed; sources; yield cache: jhs-109.pdf plain text: jhs-109.txt item: #27 of 600 id: jhs-1094 author: Challam, Clarissa; Dutt, S; Sharma, J; Raveendran, M; Sudhakar, D title: Morpho-physiological parameters associated with chlorosis resistance to iron deficiency and their effect on yield and related attributes in potato (Solanum tuberosum L.) date: 2021-06-30 words: 4692 flesch: 60 summary: 2 5 mg/ K g ( D T PA extractable) for Fe sufficient plants whereas Fe deficient plants were filled with calcareous vertisol soil (pH: 8.6) having available Fe 4.53 mg/ Kg (D T PA ex tr a cta ble) ( Ta b le 1). After 9 0 da ys, however, the plants could not acquire sufficient Fe from deficient soil led to inhibition of chlorophyll s ynt hesis . keywords: chlorosis; deficiency; genotypes; idc; iron; number; parameters; plant; potato; root; sci; soil; yield cache: jhs-1094.pdf plain text: jhs-1094.txt item: #28 of 600 id: jhs-11 author: Singh, A K; Singh, C P; Bora, L title: Impact of pruning on growth, yield and quality of mango cv. Dashehari date: 2017-12-31 words: 3379 flesch: 72 summary: t he p a clob u tr a z ol a p pea r ed t o favourably alter the source sink relationship of mango to support fruit growth. Dashehari and ensuring continuous cropping of mango trees besides getting good quality mangoes. keywords: fruit; growth; m0f0t0; mango; pruning; tree; yield cache: jhs-11.pdf plain text: jhs-11.txt item: #29 of 600 id: jhs-110 author: Yogeesha, H S; Ganeshan, S; Shivashankara, K S; Shetty, D L; Kumar, C Anil title: Fruit/Seed Morphology, Seed Drying and Germination Studies in Baccaurea courtallensis (Muell.) Arg., a Threatened Under-Utilized Fruit Species of Western Ghats in India date: 2016-06-30 words: 2005 flesch: 63 summary: This indicates that Baccaurea courtallensis seeds are recalcitrant in nature and, thus cannot withstand drying to low moisture, unlike orthodox seeds. Arg., a threatened under-utilized fruit species of Western Ghats in India H.S. Yogeesha*, S. Ganeshan, K.S. Shivashankara, D.L. Shetty and C. Anil Kumar1 ICAR-Indian Institute of Horticultural Research Hesaraghatta Lake Post, Bengaluru – 560 089, Karnataka, India *E-mail: hsy@iihr.ernet.in ABSTRACT A study was under taken on fruit and seed morphology, seed drying, seed germination and storage behavior in Baccaurea courtallensis, as, this plant is propagated mainly through seeds. keywords: baccaurea; germination; moisture; seed cache: jhs-110.pdf plain text: jhs-110.txt item: #30 of 600 id: jhs-1105 author: G M, Sandeep Kumar; S, Sriram; R H , Laxman; K N , Harshita title: Tomato late blight yield loss assessment and risk aversion with resistant hybrid date: 2022-12-20 words: 3355 flesch: 60 summary: Tomato late blight yield loss assessment and risk aversion with resistant hybrid Fig. 1 : Area under disease progress curve (AUDPC) of tomato late blight in three varieties during 2019 and 2020 in unprotected plots under natural epiphytotics. Among biotic stresses, late blight disease caused by Phytophthora infestans (Mont.) de Bary is a deva sta ting disea se on toma to in India a nd worldwide (Fry et al., 2015). keywords: arka; blight; cent; disease; india; loss; protection; tomato; yield cache: jhs-1105.pdf plain text: jhs-1105.txt item: #31 of 600 id: jhs-1109 author: Malkit Singh; Bala, Madhu; Singh, Simrat title: Optimization of nitrogen application and planting geometry for production of cut chrysanthemums (Chrysanthemum morifolium Ramat.) date: 2022-12-31 words: 5394 flesch: 68 summary: Thus, compared to the conventional practice of N application (300 Kg ha-1) adopted by farmers, the amount of N can be reduced to 1/3rd to grow cut stems of chrysanthemums planted at twice the row spacing for optimum growth and flowering. Effect of N application and spacing on growth and yield of seasonal chrysanthemum (Chrysanthemum coronarium). keywords: chrysanthemum; cut; plants; spacing; stems cache: jhs-1109.pdf plain text: jhs-1109.txt item: #32 of 600 id: jhs-112 author: Navaneethakrishnan, K S; Dhaliwal, H S; Gill, M I S; Brar, J S title: Influence of Nitrogen and Phosphorus Fertilization on Fruiting and Yield Characteristics in Ratoon Crop of Banana (Musa spp. AAA) Cv. Grande Naine date: 2016-06-30 words: 2357 flesch: 70 summary: Grand Naine Treatment Date of Days Date of Days Bunch No. of Hand No. of Finger-length shooting taken to harvest taken weight hands weight fingers (cm) shooting from (kg) per (kg) per shooting bunch hand to harvest T1-150g N(5 split doses)+60g P2O5 Sept.19 98 Jan. 3 106 15.88 7.19 1.66 16.51 18.25 T2-150g N(5 split doses)+90g P2O5 Sept. 25 104 Jan. 6 102 15.37 7.08 1.64 15.77 17.92 T3-200g N(4 split doses)+60g P2O5 Sept. 10 89 Dec. 14 95 17.57 10.08 2.04 19.19 19.24 T4-200g N(4 split doses)+90g P2O5 Sept. 20 98 Dec. 24 95 17.17 9.41 2.01 18.80 18.74 T5-200g N(5 split doses)+60g P2O5 Sept. 7 86 Dec. 9 92 18.11 10.61 2.20 19.75 20.30 T6-200g N(5 split doses)+90g P2O5 Sept. 13 91 Dec. 19 96 17.65 9.98 2.08 19.40 19.40 T7-250g N(4 split doses)+60g P2O5 Sept. 23 102 Jan. 5 129 16.83 9.09 1.96 18.14 19.00 T8-250g N(4 split doses)+90g P2O5 Oct. 4 114 Feb. 22 140 16.51 8.50 1.84 17.92 18.36 T9-250g N(5 split doses)+60g P2O5 Oct. 3 113 Feb. 23 142 16.08 7.51 1.76 16.98 17.85 T10-250g N(5 split doses)+90g P2O5 Oct. 9 112 Mar. 4 145 15.79 7.30 1.64 16.07 17.59 T11-300g N(5 split doses)+60g P2O5 Oct. 9 119 Mar. 2 143 16.42 8.11 1.88 17.74 18.55 T12-300g N (5 split doses) + 60g P2O5; T4- 200g N (4 split doses) keywords: doses; p2o5; split cache: jhs-112.pdf plain text: jhs-112.txt item: #33 of 600 id: jhs-1124 author: Gonzalez, F P H; Saucedo, V C; Guerra, R D; Suarez, E J; Soto, H R M; Lopez, J A; Garcia, C E; Hernández, R G title: Post-harvest quality and quantification of betalains, phenolic compounds and antioxidant activity in fruits of three cultivars of prickly pear (Opuntia ficus-indica L. Mill) date: 2021-06-30 words: 8579 flesch: 66 summary: For the FRAP assay, CP1 (red) and CP4 (orange) show higher antioxidant activity (17.6 and 19.13 µmol ET g-1 dw) than CP3 (white) in peel. On the contrary, CP1 (red) showed higher antioxidant activity in juice and pulp than the other cultivars with values of (8.96 and 5.05 µmol ET g-1dw), respectively. keywords: activity; antioxidant; compounds; content; cp1; cp3; cp4; cultivars; et al; fruit; g-1; indica; juice; opuntia; pear; peel; prickly; pulp; red; total; values cache: jhs-1124.pdf plain text: jhs-1124.txt item: #34 of 600 id: jhs-1125 author: AL-Mansour, Baraa; Kalaivanan, D title: Soil microbial community dynamics as influenced by integrated nutrient management practices in sweet basil (Ocimum basilicum L.) cultivation date: 2021-06-30 words: 7650 flesch: 67 summary: A 19-year long-term experiment conducted to evaluate the effects of fertilization regimes on soil organic carbon (SOC) dynamics indicated that the SOC content in the top 20cm soil layer remained unchanged over time under the unfertilized control plot whereas it significantly increased under both organic, bio and NPK fertilizers and combined manure treatments (Yang et al., 2011). Soil Science, 175: 474-486. Yang, X., Li, P., Zhang, S., Sun, B. and Xinping, C., 2011, Long-term-fertilization effects on soil organic carbon, physical properties, and wheat yield of a loess soil. keywords: application; carbon; cfu; fy m; fym; management; microbial; population; soil; yield cache: jhs-1125.pdf plain text: jhs-1125.txt item: #35 of 600 id: jhs-1128 author: Ravishankar, K V; Vasudeva, R; Hemanth, B; Nischita, P; Sthapit, B R; Parthasarathy, V A; Rao, V R title: Isolation and characterization of microsatellite markers from Garcinia indica and cross species amplification date: 2021-06-30 words: 6215 flesch: 69 summary: 01 28 28 G I_ K V R a6 14 T G T G A G T T G T T T G G C AT G G G T G A G G A G G G T G A G C A A A T C A C A G C T C A (T G )2 2 26 19 7- 29 0 0. 18 5 0. 96 2 0. 94 1 0. 00 52 54 G I_ K V R a6 15 T G T G A G G G G T G A G G T T G A G G C T A C A A A C G C AT C C C C A C T C T C G G (A T )6 27 28 3- 37 9 0. 25 9 0. 95 3 0. 93 3 0. 00 68 29 G I_ K V R a6 51 T G G G T G G C A A A T T T G G G A G G A A A T G C C G C C C A A G G A G A G A G G A A A (A C )8 24 18 5- 27 7 0. 2 0. 97 1 0. 95 0. 00 66 22 G I_ K V R a7 23 T G C A C C A G G A G G G T C A C A G A C T A C A A C G A G G C C T T C C A A C A G G A (A C )1 0 21 41 2- 48 8 0. 14 3 0. 92 6 0. 90 4 0. 01 19 16 G I_ K V R a7 47 T G A C A G A T C G A C A G G C TA G A C T C G A A T C G C C C C C G TC TA T G TA TC A G T C (A T )6 25 43 2- 53 1 0. 19 2 0. 96 2 0. 94 1 0. 00 65 35 G I_ K V R a7 48 T G A A T G C C G A G A G C A A T T G T G C C T C A C A T C A C A A G G C T T G C T C A A A C A (T A )6 33 14 0- 21 4 0. 51 9 0. 97 9 0. 96 0. 00 32 90 G I_ K V R a8 34 G T G C A C A T G T C G C C A TA A A G AT G G A A C C TA C C C C TC C AT A A C AT G C C T T (A T )6 16 10 5- 18 0 0. 13 3 0. 85 3 0. 82 8 0. 03 68 97 G I_ K V R a8 61 G G C C C AT G G C C T C C T C T C AT A C A A T G G G G A A G G A C A A T TA A G T C G G G A (T A )6 15 10 3- 18 5 0. 13 8 0. 00 0 0. 86 0. 82 3 0. 03 36 81 G I_ K V R b1 31 A C C C C TA A C G G T G G G T T C G T C A T C G A G G G T C C T T G A G T T C T C C C C T (A T )6 13 99 -1 90 0. keywords: c c; c g; c ta; c tc; g g; g tg; t c; t g; t t; ta g; tc g; tt g; ° c cache: jhs-1128.pdf plain text: jhs-1128.txt item: #36 of 600 id: jhs-1129 author: Vellaisamy, Ramamoorthy; S, Sindhu; M, Theradimani; S, Samundeeswari; G, Sobanbabu; R, Renuka title: Cropping duration and non-rhizomorphic mycelial phenotype of Pleurotus djamor woody1 co-segregate in the hybrid progenies date: 2022-09-30 words: 4785 flesch: 65 summary: In our previous studies conducted during 2018 and 2020 on breeding between P. djamor woody1 and P. djamor MDU1 or P. florida resulted in several hybrids having both short cropping duration and long cropping duration (Reihana et al., 2018; Samundeeswari, 2020). viz., P. djamor woody1, P. florida, P. djamor MDU1 and hybrids strains viz., H2W12, H2W14 and Pf1W2 (obtained upon crossing between P. djamor woody1 and P. florida) were used in this study. keywords: cropping; days; djamor; duration; florida; growth; hybrid; mushroom; mycelial; p. djamor; pleurotus; spp; strains; woody1 cache: jhs-1129.pdf plain text: jhs-1129.txt item: #37 of 600 id: jhs-113 author: Santhi, V P; Priya, P A title: Evaluation of Carrot (Daucus carota L.) Hybrids at Mid-Elevation and Higher in the Nilgiris date: 2016-06-30 words: 3186 flesch: 52 summary: Variability, heritability and genetic advance as per cent of Mean for different parameters in carrot hybrids for 14 characters during kharif Character Genotypic Phenotypic Heritability Genetic coefficient coefficient (%) advance of variation of variation as per cent (GCV %) (PCV %) of Mean Plant height (cm) 5.90 12.13 23.67 5.91 Number of leaves 10.95 15.43 50.37 16.01 Leaf width (cm) 5.32 12.09 19.34 4.82 Root length (cm) 0.67 7.04 0.92 0.13 Root weight (g) 14.24 20.97 46.14 19.93 Root diameter 8.47 12.11 48.93 12.21 (cm) Inner-core 5.66 16.16 12.29 4.09 diameter (cm) Root-to-top ratio 2.97 16.69 3.17 1.09 Root splitting % 23.00 29.45 60.99 37.01 Root forking % 18.41 24.87 54.78 28.07 Total chlorophyll 38.84 39.18 98.32 79.35 (mg/g) Leaf carotenoids 22.78 22.79 99.91 46.91 (mg/g) Root carotenoids 35.71 35.73 99.94 73.55 (mg/g) Yield/ha (tonnes) 8.13 12.42 42.87 10.97 Table 2. Variability, heritability and genetic advance as per cent of Mean for different parameters in carrot hybrids for 14 characters during summer Character Genotypic Phenotypic Heritability Genetic coefficient coefficient (%) advance of variation of variation as per cent (GCV %) (PCV %) of Mean Plant height (cm) 4.55 4.55 99.96 9.38 Number of leaves 9.68 9.68 99.98 19.94 Leaf width (cm) 7.30 7.30 99.98 15.04 Root length (cm) 12.63 13.79 83.86 23.83 Root weight (g) 12.08 13.37 81.72 22.51 Root diameter 12.89 13.96 85.23 24.52 (cm) Inner-core 11.31 15.92 50.52 16.56 diameter (cm) Root-to-top ratio 7.39 9.45 61.23 11.92 Root splitting keywords: advance; carotenoids; coefficient; genotypic; heritability; root; variation cache: jhs-113.pdf plain text: jhs-113.txt item: #38 of 600 id: jhs-1132 author: None title: jhs-1132 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1132.htm plain text: jhs-1132.txt item: #39 of 600 id: jhs-114 author: Aswath, C; Kumar, Rajiv; Rao, T Manjunatha; Dhananjaya, M V title: Evaluation of Novel Gerbera (Gerbera jamesonii Bolus ex. Hooker F.) Hybrids for Flower Quality Traits under Naturally-Ventilated Polyhouse date: 2016-06-30 words: 1323 flesch: 68 summary: They had novel flower colour (68D as per RHS Colour Chart), Red Purple Group (IIHR 3-34) and 50A Red Group (IIHR 8-45), with double type of flowers. Hooker F.) hybrids for flower quality traits under naturally-ventilated polyhouse C. Aswath*, Rajiv Kumar, T. Manjunatha Rao and M.V. Dhananjaya Division of Ornamental Crops ICAR-Indian Institute of Horticultural Research, Hesaraghatta Lake Post, Bengaluru - 560 089, Karnataka, India *E-mail: aswath@iihr.res.in ABSTRACT The present study was carried out to evaluate performance of two gerbera hybrids IIHR 3-34 and IIHR 8-45 along with their parents and check, for flower quality traits under naturally-ventilated polyhouse in Randomized Block Design, in the years 2014-15 and 2015-16. keywords: flower; gerbera; iihr cache: jhs-114.pdf plain text: jhs-114.txt item: #40 of 600 id: jhs-1154 author: M, Shareefa; R J, Thomas; J S, Sreelekshmi; K, Anitha title: Occurrence of in vitro flowering in coconut (Cocos nucifera L.) date: 2022-10-11 words: 3116 flesch: 65 summary: Flowering is a complex phenomena regulated by both internal and external factors and induction of in vitro flowering is very rare in most of the crops. Such an attempt to induce flowering in vitro has been attempted in many plant systems. keywords: coconut; flowering; inflorescence; l-1; media; plant; sci cache: jhs-1154.pdf plain text: jhs-1154.txt item: #41 of 600 id: jhs-116 author: Kanupriya, C; Kumar, D Manmohan; Nischita, P; Gayathri, M; Ravishankar, K V; Kumar, P Sampath title: Studies on Genetic Divergence in Pomegranate (Punica granatum L.) Using SRAP Markers date: 2015-12-31 words: 3189 flesch: 60 summary: SRAP markers preferentially amplify the ORF regions of DNA, and have been demonstrated to be more powerful at revealing genetic diversity among closely-related cultivars than are SSR, ISSR or RAPD markers as such in other crops like buffalo grass (Budak et al, 2004), okra germplasm (Gulsen et al, 2007), Cucurbit pepo germplasm (Ferriol et al, 2003) and Brassica (Li and Quires, 2001). Pomegranate genotypes have been mainly evaluated in the past based on morphological characters; but, these traits are affected by the environment and cultivation conditions, and do not result in a clear discrimination (Kumar, 1999). keywords: diversity; genotypes; markers; pomegranate; srap cache: jhs-116.pdf plain text: jhs-116.txt item: #42 of 600 id: jhs-1176 author: Hamdy, Rim; Azza El-Hadidy; Gehad Abd El-Mohsen title: Taxonomic revision of the cultivated species of Mimusops (Sapotaceae) in Egypt, with new records date: 2022-12-31 words: 7590 flesch: 69 summary: For Egypt, a relatively few short accounts of Mimusops have been published (Bircher, 1960; Diwan et al., 2004; Hamdy et al., 2007; Youssef et al., 2012; Youssef & Hamdy, 2013; Gamal, 2018). Hamdy et al. (2007) listed the plant distribution of three species in three historic gardens in Egypt (Zohriya, Orman, and Zoo). keywords: acute; africa; apex; calyx; corolla; egypt; fruit; lanceolate; laurifolia; lobes; mimusops; segments; species; stamens cache: jhs-1176.pdf plain text: jhs-1176.txt item: #43 of 600 id: jhs-118 author: Padmakar, B; Sailaja, D; Aswath, C title: Molecular Exploration of Guava (Psidium guajava L.) Genome Using SSR and RAPD Markers: A Step towards Establishing Linkage Map date: 2015-12-31 words: 3570 flesch: 58 summary: SSR markers are widely used for constructing genetic maps (Oliveira et al, 2008; Ogundiwin et al, 2009; Wang et al, 2010; Das et al, 2012; Pauly et al, 2012; Liu et al, 2013; Serba et al, 2013; Zhang et al, 2013). SSR markers have also been utilized for molecular characterization and genetic diversity assessment of guava germplasm resources (Nimisha et al, 2013). keywords: et al; guava; linkage; mapping; maps; markers; psidium; rapd; ssr cache: jhs-118.pdf plain text: jhs-118.txt item: #44 of 600 id: jhs-1182 author: Lamessa Tesgera, Kinde; Nandeshwar, B.C. ; Jalata, Zerihun ; Chala , Teferi Chala title: Physical quality of coffee bean (Coffea arabica L.) as affected by harvesting and drying methods date: 2022-09-19 words: 5601 flesch: 61 summary: Ethiopia produces a large volume of coffee beans Physical quality of coffee bean (Coffea arabica L.) as affected by harvesting and drying methods Chala T.1, Lamessa K.*2 and Jalata Z2 1Bega District Agricultural Office, Coffee and Spices Expert, West Wollega, Ethiopia 2Department of Plant Sciences, Faculty of Agriculture, Shambu Campus, Wollega university, Ethiopia *Corresponding author Email : klamessa@gmail.com ABSTRACT Coffee is a stimulant crop with high socio-economic cultural value including economical significance in Ethiopia. Similarly, Boot (2006) reported that under almost all conditions, the specific weight of ripe cherry is greater than that of an immature cherry, it is heavier, weighing up to 20% more Odor: The analysis of variance revealed there was a highly significant variation (Pd”0.01) for odor due to the main effect of coffee harvesting methods and drying surfaces (Table 1). keywords: bean; coffee; drying; effect; ethiopia; harvesting; harvesting methods; interaction; mesh; methods; quality; selective; strip; surfaces; table; weight; wire cache: jhs-1182.pdf plain text: jhs-1182.txt item: #45 of 600 id: jhs-1186 author: Narukulla, Vijayakumari ; Lahane, Yogesh; A, Rekha title: Ploidy analysis among Citrus mutants using leaf meristematic tissue date: 2022-09-24 words: 3640 flesch: 56 summary: Citrus chromosomes are small with 2-4µm length (Krug 1943). Citrus chromosomes are small in size 2-4µm (Krug 1943) and mitotic index is mostly low. keywords: analysis; chromosome; citrus; cytometry; digestion; flow; india; metaphase; ploidy; protoplast; sample; species; tissue cache: jhs-1186.pdf plain text: jhs-1186.txt item: #46 of 600 id: jhs-1187 author: A, Mukherjee; U, Kumar; D K, Singh; K, Shubha; Atheequlla; P K, Sinha; P, Singh title: Assessing performance of horticultural farmers producer companies: Comparative case study date: 2022-12-31 words: 5489 flesch: 57 summary: Farmer producer companies can play a more important role in sustainable agricultural intensification for smallholders, particularly by addressing the constraints like the size of landholding, access to credit, irrigation, and marketplaces (Reddy et al., 2020). Near about 23 per cent of total registered FPCs are working exclusively in horticulture and Assessing performance of horticultural farmers producer companies: Comparative case study Mukherjee A.1, Kumar U.2, Singh D.K.2, Shubha K.2, Atheequlla G.A.*3 Sinha P.K.4 and Singh P.1 1Divn. keywords: companies; company; effectiveness; farmers; farms; fpc; fpcs; income; increase; index; india; members; producer; sahyadri cache: jhs-1187.pdf plain text: jhs-1187.txt item: #47 of 600 id: jhs-1188 author: P GOWDA, POOJA; M., Rafeekher; S, SARADA title: Performance of parthenocarpic and non-parthenocarpic grafts of cucumber date: 2022-09-29 words: 3403 flesch: 69 summary: Chao and Yen (2013) observed that cucumber gra fted onto Cucumis rootstock showed good rootstock scion combination, better tolerance to soil-borne diseases, better growth, yield and quality. Among the ten graft combinations, the highest vine length (4.37 m) was observed in Heera scion grafted onto bottle gourd rootstock followed by Heera scion grafted onto pumpkin rootstock (4.13 m). keywords: bottle; cucumber; days; fruit; gourd; graft; grafting; heera; kpch-1; melon; rootstock; yield cache: jhs-1188.pdf plain text: jhs-1188.txt item: #48 of 600 id: jhs-119 author: Prakash, D P; Ramachandra, Y L; Hanur, Vageeshbabu S title: Factors Affecting in Vitro Shoot Regeneration in Hypocotyls of Brinjal (Solanum melongena L.) in the Early Steps of Agrobacterium-Mediated Transformation date: 2015-12-31 words: 4274 flesch: 52 summary: Frequency (%) of callus-initiation response (number of explants showing callus-initiation response/ number of explants cultured X 100) and frequency (%) of shoot regeneration response (number of explants showing regeneration response/ number of explants cultured X 100) was calculated. In conclusion, physical (size) and physiological (age and position) of the hypocotyl explant and high cytokinin (BAP) in the pre-culture medium showed a strong impact on shoot regeneration response in hypocotyl explants of brinjal co-cultivated with Agrobacterium. keywords: agrobacterium; brinjal; culture; explants; hypocotyl; medium; pre; regeneration; response; shoot; transformation cache: jhs-119.pdf plain text: jhs-119.txt item: #49 of 600 id: jhs-1198 author: V, DHAYALAN; Sudalaimuthu, Karuppasamy title: Macronutrients and their associated bacterial genera in the soils of Anaimalai block in Tamil Nadu for sustainable vegetable crops cultivation date: 2022-09-29 words: 3815 flesch: 52 summary: Dhayalan and Sudalaimuthu J. Hortl. Sci. Vol. 17(1) : 131-136, 2022 135 genus presences in the soil, soil available nitrogen indicates low status. Achromobacter induce ethylene hor mones for contribution of soil available nitrogen (Bangash et al., 2021) and helps to expose to transient water stress in horticultural crops more specifically tomato and pepper. keywords: achromobacter; arthrobacter; azotobacter; bacterial; citrobacter; crops; e.coli; enterobacter; genera; gnr; nitrogen; phosphorus; soil cache: jhs-1198.pdf plain text: jhs-1198.txt item: #50 of 600 id: jhs-12 author: K S, Shivashankara; K C, Pavithra; G A, Geetha; T K, Roy; Patil, Prakash; Menon, Rema title: Seasonal influence on volatile aroma constituents of two banana cultivars (Grand Naine and Nendran) under Kerala conditions date: 2017-12-31 words: 5101 flesch: 65 summary: The results revealed that with increased temperature volatile aroma compounds decreased in cvs. In case of cv. Nendran, total area of esters and alcohols were maximum at high temperature (34.5ºC) but in cv. keywords: aroma; banana; compounds; esters; fruit; grand; naine; nendran; nendran naine; temperature cache: jhs-12.pdf plain text: jhs-12.txt item: #51 of 600 id: jhs-120 author: Prakash, M K Chandra; Thomas, Reena Rosy; Mondal, Papiya title: In silico Analysis of whole-Genome of Solanum lycopersicum for Alpha-Crystallin Domains Associated with Heat Stress Tolerance date: 2015-12-31 words: 2150 flesch: 54 summary: Heat shock proteins are, therefore, products of heat shock genes and are classified as per their molecular weight, including small heat shock proteins (sHsps). Key words: Solanum lycopersicum, alpha-crystallin domain (ACD), small heat shock proteins (sHsps), in silico, heat stress J. Hortl. keywords: conserved; genome; heat; lycopersicum; proteins; shock cache: jhs-120.pdf plain text: jhs-120.txt item: #52 of 600 id: jhs-1202 author: BHOWMICK, NILESH; Subba, Saidiksha title: Heat unit requirement and performances of litchi under Sub-Himalayan terai region of West Bengal date: 2022-09-29 words: 4034 flesch: 70 summary: Heat unit requirement and performances of litchi under Sub-Himalayan terai region of West Bengal Subba S. and Bhowmick N.* Department. of Pomology and Post-Harvest Technology Uttar Banga Krishi Viswavidyalaya, Pundibari, Cooch Behar, West Bengal-736165, India *Corresponding author E-mail : nilesh@ubkv.ac.in ABSTRACT RESULTS AND DISCUSSION Response of heat unit requirement on flowering of litchi keywords: bedana; bombai; china; content; flowering; fruit; heat; litchi; maximum; requirement; shahi; unit cache: jhs-1202.pdf plain text: jhs-1202.txt item: #53 of 600 id: jhs-1209 author: Dr. B. Anjaneya Reddy; M. V. Praful; Ramachandra, R.K. ; Krishna Reddy, M.; Anjanappa M title: Epidemiology of ChiVMV and loss assessment in capsicum (Capsicum annum var. grossum Sendt) date: 2022-12-31 words: 3782 flesch: 70 summary: Among these, potyviruses viz., potato virus Y (PVY), pepper veinal mottle virus (PVMV), pepper vein banding virus (PVBV), chilli veinal mottle virus (ChiVMV), pepper mottle virus (PMV), tobacco etch virus (TEV) are more prevalent (Caranta et al.,1996). Vector transmission of ChiVMV by using the aphid- Aphis gossypii No. of No. of No. of Per Days required aphids plants plants cent for symptom per plant inoculated infected transmission expression 1 10 4 40 20-21 2 10 6 60 19-20 3 10 6 60 19-20 4 10 8 80 19-20 5 10 10 100 19-20 Control (uninoculated) 10 0 0 0 Loss estimation To know the impact of stage of inoculation on per cent transmission and on plant growth and yield, the plants were inoculated artificially as explained in the material and methods. keywords: capsicum; cent; chilli; chivmv; disease; inoculation; pepper; plant; transmission; virus cache: jhs-1209.pdf plain text: jhs-1209.txt item: #54 of 600 id: jhs-121 author: Dhillon, T S; Kumar, Ajay title: Variability, Heritability, Correlation and Genetic Divergence Studies in Dolichos Bean (Lablab purpureus L.) date: 2015-12-31 words: 4154 flesch: 69 summary: High- to moderate-phenotypic variability for pod yield per plant was Table 1. Highly significant and positive phenotypic correlation (Table 3) was observed between pod yield per plant and six other yield-related components, viz., number of branches per plant, number of pods per cluster, number of pods per plant, weight of 10 green pods, number of clusters per plant and number of flowers per cluster. keywords: bean; cluster; number; plant; pod; pods; yield cache: jhs-121.pdf plain text: jhs-121.txt item: #55 of 600 id: jhs-1212 author: Bhoi, Swamini; Varalakshmi, B; Srinivasa Rao, E; Pitchaimuthu, M; Hima Bindu, K title: Generation mean analysis of important yield traits in Bitter gourd (Momordica charantia) date: 2022-04-05 words: 4651 flesch: 63 summary: i j l Epistasis Days to 1 35.25 ± -4.33 ± 7.12 ± 2.32 ± -0.53 ± -3.38 ± D 1st female 0.24 1.07** 2.44** 2.36* 2.25 4.56** D flower 2 34.47 ± -6.56 ± 2.20 ± -4.36 ± -3.93 ± 16.09 ± C opening 0.25 0.70** 1.81* 1.73** 1.55** 3.18** C Days to 1 24.25 ± -13.43 ± 21.29 ± 0.37 ± 2.36 ± 2.52 ± C 1st male 0.87 3.31** 7.49** 7.43 6.64* 13.74* C flower 2 25.07 ± -17.60 ± 17.89 ± -2.84 ± -6.26 ± 4.70 ± C opening 0.84 2.93** 6.79** 6.78* 5.89** 12.24** C Node 1 3.77 ± 2.77 ± 1.89 ± 0.45 ± 0.27 ± ± 20.30 ± C of fruits 0.44 1.86** 4.22** 4.13** 3.87 7.85** C per 2 38.01 ± 4.25 ± 15.70 ± 1.60 ± 10.76 ± 11.16 ± C plant 0.45 1.19** 3.10** 2.99 2.59** 5.35** C Fruit 1 14.42 ± -3.62 ± 3.71 ± 3.68 ± 3.44 ± 5.26 ± C length 0.27 0.24** 1.22** 1.21** 0.55** 1.53** C (cm) 2 14.14 ± -5.39 ± 6.19 ± 6.73 ± -1.02 keywords: 1st; dominance; epistasis; flower; fruit; iihr; yield cache: jhs-1212.pdf plain text: jhs-1212.txt item: #56 of 600 id: jhs-1214 author: Ranga, Aman Deep; Chaudhary, Ankush; Darvhankar, Mayur S. title: Diversity analysis of phenotypic traits in okra (Abelmoschus esculentus L. Moench) date: 2022-09-24 words: 5929 flesch: 70 summary: Plant height and number of fruits per plant had direct and positive effects towards the yield per hectare The principal component analysis indicated the first 3 principal components contributed 80.517% of total variation among traits describing genotypes. *Corresponding author E-mail: aman_ranga94@yahoo.com ABSTRACT It is necessary to obtain cultivars which provide high yield by exploiting desirable traits from wild genotypes of okra (Abelmoschus esculentus L. Moench). keywords: analysis; correlation; days; flowering; fruit; genotypes; hectare; number; okra; plant; s -0; seed; traits; yield cache: jhs-1214.pdf plain text: jhs-1214.txt item: #57 of 600 id: jhs-122 author: Varalakshmi, B; Pitchaimuthu, M; Rao, E Sreenivas; Manjunath, K S Sanna; Swathi, S H title: Genetic Variability, Correlation and Path Analysis in Ridge Gourd [Luffa acutangula (Roxb.) L.] date: 2015-12-31 words: 2892 flesch: 64 summary: Fruit yield/ha was significantly and positively associated with peduncle length, fruit length, number of fruits/plant (at the phenotypic level), fruit weight and fruit yield/plant. Fruit weight had the highest direct effect (0.847) on fruit yield/ha, followed by fruit yield/plant (0.793), fruit number (0.344), peduncle length (0.237) and number of branches (0.216). keywords: fruit; gourd; length; number; plant; ridge cache: jhs-122.pdf plain text: jhs-122.txt item: #58 of 600 id: jhs-1226 author: Barik, Satyaprakash ; Ponnam, Naresh ; Acharya, Gobinda ; Singh, TH; Kumari, Meenu; dash, manasi title: Genetics of growth and yield attributing traits of brinjal (Solanum melongena L.) through six generation mean analysis date: 2022-09-24 words: 6642 flesch: 62 summary: ±0.27 ±0.19 ±45.75* ±0.16** ±0.24* ±5.99** h 25.91 0.48 -3.02 -834.46 -2.75 -2.04 -19.35 ±1.76** ±0.50 ±0.38** ±92.35* ±0.33** ±0.44** ±9.82** χ2 52.13** 100.83** 155.01** 188.79* 49.63** 39.81** 26.52** *and **significant at p - “0.05” and “0.01”, respectively The dominance x dominance (l) estimate showed superiority over additive × dominance (j), dominance (h) and additive × additive (i) estimates. The estimate of dominance x dominance (l) was higher than dominance (h), additive × dominance (j) and additive × additive (i) estimates. keywords: additive; brinjal; components; dominance; fruit; gene; heterosis; melongena; number; plant; sci; traits; yield cache: jhs-1226.pdf plain text: jhs-1226.txt item: #59 of 600 id: jhs-123 author: Sharma, Neha; ., Babita; Rana, Vishal S title: Effect of Plant Growth Promoting Rhizobacteria and IBA on Rooting of Cuttings in Kiwifruit (Actinidia deliciosa Chev.) date: 2015-12-31 words: 3589 flesch: 60 summary: Dry weight of shoot ranged from 3.4g to 15.3g in hardwood cuttings, and from 2.6g to 10.7g in semi-hardwood cuttings. The best rooting performance in terms of per cent rooted cuttings, number of primary and secondary roots, length of the longest root, total root length, fresh and dry weight of roots and shoots per cutting were recorded in semi-hardwood cuttings prepared in mid-July, whereas, the best results for various shoot and leaf characteristics, viz., shoot length, shoot diameter, shoot biomass, leaf number and leaf area, were noticed with hardwood cuttings prepared in mid-January. keywords: bacillus; cuttings; hardwood; iba; kiwifruit; root; subtilis; treatment cache: jhs-123.pdf plain text: jhs-123.txt item: #60 of 600 id: jhs-1230 author: Bayogan, Emma Ruth ; Secretaria, Leizel; Lequigan, Darlyn ; Abad , Reynaldo title: The use of brick-walled evaporative cooler for storage of tomato date: 2022-09-30 words: 4959 flesch: 66 summary: Cost-benefit analysis of tomato storage in ambient and brick-walled evaporative cooling storage systems for one month computed for use for eight months per year. Tomato fruit metabolizes faster at high temperatures during the postharvest stage leading to shortened shelf life (Liberty et al., 2017). keywords: ambient; bec; brick; conditions; cooler; evaporative; fruit; green; quality; storage; temperature; tomatoes cache: jhs-1230.pdf plain text: jhs-1230.txt item: #61 of 600 id: jhs-1232 author: Mahammed Faizan; BN, Harish Babu; D, Lakshmana; M, Ganapthi; M, Rakshith title: Phenotypic trait association studies in brinjal upon drought stress date: 2022-11-01 words: 2879 flesch: 69 summary: Eggplant is hardy crop and even sustains prolonged stress periods but many studies have been reported there was decrease in fruit yield upon increased moisture deficiency. With respect to present situation of climatic challenges, fruit yield of eggplant is reduced due to drought or moisture stresses. keywords: eggplant; fruit; length; moisture; number; plant; yield cache: jhs-1232.pdf plain text: jhs-1232.txt item: #62 of 600 id: jhs-124 author: Balamohan, T N; Auxilia, J; Sudha, R title: Standardization of Stage-Wise Requirement of Nutrients in Banana Cv. Grande Naine (AAA) date: 2015-12-31 words: 4988 flesch: 66 summary: Yield parameters Influence of various levels of nutrients applied at different growth stages on yield and quality is presented in Table 2. Effect of various levels of fertilizer at different growth stages on growth parameters in banana cv. keywords: banana; growth; map; nutrient; plant; soil; stages cache: jhs-124.pdf plain text: jhs-124.txt item: #63 of 600 id: jhs-1245 author: Sajid, Muhtasim Billah ; Sarker , Kishore Kumar ; Monshi, Fakhrul Islam; Sultana, Sayeda ; Monika, Marjia Akhter; Bhuiyan, Mohammed Shafi Ullah title: Assessing the genetic diversity of squash (Cucurbita pepo L.) genotypes based on agro-morphological traits and genetic analysis: Evaluation of squash genetic diversity date: 2022-09-24 words: 6973 flesch: 60 summary: The data were recorded based on 18 quantitative yield contributing traits i.e. plant height in cm at first harvest (PH), stem diameter in cm at first harvest (SD), number of leaves at first harvest (NL), number of nodes at first harvest (NN), days to flower bud initia tion (DFBI), days to first male flowering (DFMF), days to first female flowering (DFFF), number of male flowers from flowering to last harvest (NMF), number of female flowers from flowering to last harvest (NFF), viable pollen in percentage (VP), days to first harvest (DFH), nodes at first fruit harvest (NFFH), fruit length in cm (FL), fruit diameter in cm (FD), fruit weight in g (FW), number of fruits per plant (NFPP), fruit yield per plant in Kg (FYPP), total yield in t/ha (TY) and 8 qualitative traits i.e. plant vigor, pubescence, stem shape, flower color, fruit size, fruit shape, fruit skin color and luster. The quantitative traits such as fruits yield per plant, fruit weight, length, diameter and total yield per hectare showed the greater phenotypic coefficient of variation (PCV) along with higher heritability which can helps to identify desirable genotypes. keywords: days; et al; flowering; fruit; genetic; genotypes; harvest; number; plant; runner; squash; traits; variability; variation; yield cache: jhs-1245.pdf plain text: jhs-1245.txt item: #64 of 600 id: jhs-1249 author: Adams, Fuleratu Karim; Kumar, Lava; Kwoseh, Charles; Ogunsanya, Patricia; Akromah, Richard; Tetteh, Rashied title: Seed transmission of BCMV-BICM threaten cowpea seed health in the Ashanti and Brong-Ahafo regions of Ghana: BCMV-BICM threaten cowpea seed health in the Ashanti and Brong-Ahafo regions of Ghana. date: 2021-12-31 words: 6597 flesch: 69 summary: Fawole et al. (2006) also analyzed the effect of seed-borne fungi infection of cowpea seed on germination rate and found reduced germination rate because of infection by the fungi. However, in contrast to the above findings, Biemond et al. (2013) found that natural infection of cowpea seeds with some seed-borne pathogens increased germination. keywords: amantin; bcmv; blcm; cowpea; ejura; et al; farm; ghana; lots; market; mosaic; nkoranza; plants; seed; transmission; virus cache: jhs-1249.pdf plain text: jhs-1249.txt item: #65 of 600 id: jhs-125 author: ., Lanuakum; Yepthomi, Graceli I; Maiti, C S title: Effect of Radiation Interception and Canopy Temperature on Growth, Yield and Quality in Banana Cv. Grande Naine (AAA) under Different Planting Densities date: 2015-12-31 words: 3020 flesch: 58 summary: They reported high plant density as having a lower light-transmission-ratio than plants at a wider spacing. Effect of plant density on growth and yield in banana Treatment Pseudostem Pseudostem Length of No. of No. of Fruit Fruit Fruit Yield Yield height at circumference petiole at leaves suckers at weight length breadth (kg/plant) (t/ha) flowering (cm) flowering flowering (g) (cm) (cm) (cm) (cm) keywords: banana; canopy; density; plant; radiation; yield cache: jhs-125.pdf plain text: jhs-125.txt item: #66 of 600 id: jhs-1251 author: Gayathri, M; Pitchaimuthu, M; Ravishankar, Kundapura title: SSR marker development in Abelmoschus esculentus (L.) Moench using transcriptome sequencing and genetic diversity studies date: 2022-04-05 words: 5822 flesch: 62 summary: ISSR ma r ker s in 48 okr a s (Abelmoschus esculentus L.). RNA sequencing is considered as an effective way for obtaining the gene sequences of a non-model crop (Strickler et al. 2012) and for developing the SSR markers (Zhang et al., 2010; Guo et al., 2016& Ravishankar et al. 2015). keywords: abelmoschus; analysis; development; esculentus; et al; genetic; marker; number; okra; sequencing; ssr; total; transcriptome cache: jhs-1251.pdf plain text: jhs-1251.txt item: #67 of 600 id: jhs-126 author: Dutta, S K; Singh, S B; Boopathi, T; Singh, A R; Ramakrishna, Y title: Morpho-Agronomic Diversity in Pole-Type Common Bean (Phaseolus vulgaris L.) Landraces from Lushai Hills of North-East India date: 2015-12-31 words: 3936 flesch: 64 summary: In this state, a large pool of common bean landraces was found in farmers’ fields and forest areas. Grouping of Common bean landraces on the basis of morphological traits: Prior to clustering data, variable rescaling was done for comparability; Hierarchical Cluster Analysis: Distance Calculation method - “Euclidean”, Hierarchical cluster analysis method - “Ward”; Based on Euclidean distance (7.856), 5 clusters were formed J. Hortl. keywords: bean; landraces; leaf; length; number; plant; pod; seed; traits; variation cache: jhs-126.pdf plain text: jhs-126.txt item: #68 of 600 id: jhs-1266 author: POOJA G K; Nagarajappa Adivappar; Shivakumar B. S.; Lakshmana D.; Sharanabasappa title: Characterization and evaluation of morphological and yield traits of tamarind genotypes date: 2022-12-31 words: 3464 flesch: 67 summary: This study was carried out during 2017-18 at Forest Resea r ch Sta tion, Govinkovi, Honna li ta luk, Davangere district which is situated in the Southern Characterization and evaluation of morphological and yield traits of tamarind genotypes Pooja G.K.1, Nagarajappa Adivappar3*, Shivakumar B.S.1, Lakshmana D.2 and Sharanabasappa 3 1Department of Fruit Science, 2Department of Crop Improvement and Biotechnology, College of Horticulture, Mudigere - 577 132, Karnataka, India 3Keladi Shivappa Nayak University of Agricultural and Horticultural Sciences, Shivamogga - 577 204, Karnataka, India *Corresponding author Email : nagarajappaadivappar@gmail.com ABSTRACT The evaluation of morphological and yield traits of tamarind genotypes was carried out during 2017-18 at Forest Research Station, Govinkovi, Honnali taluk, Davangere district. 273 Characterization and evaluation of tamarind genotypes J. Hortl. keywords: brown; colour; genotypes; pod; tamarind; traits; tree; variation; yellow cache: jhs-1266.pdf plain text: jhs-1266.txt item: #69 of 600 id: jhs-127 author: Angami, T; Jha, A K; Buragohain, Juri; Deka, Bidyut C; Verma, V K; Nath, Amit title: Evaluation of Taro (Colocasia esculenta L.) Cultivars for Growth, Yield and Quality Attributes date: 2015-12-31 words: 4343 flesch: 71 summary: Key words: Colocasia, taro cultivars, growth, yield, quality J. Hortl. 10.22 12.00 0.99 Kadina local 140.66 1330.44 5.00 117.55 10.41 11.00 16.00 1.00 Telia 129.34 657.78 2.67 106.11 9.53 8.00 16.00 0.63 BCC1A 161.44 2349.22 5.33 137.56 13.15 9.67 24.00 1.08 BCC 11 138.56 1567.22 2.89 114.89 10.95 9.56 12.00 0.91 Ascol-1 96.33 549.11 3.55 77.89 7.60 6.56 12.00 0.71 Ascol-2 139.22 1413.56 3.56 113.89 10.05 7.00 16.00 0.96 IG Coll-5 148.22 2012.22 2.89 126.22 11.72 6.55 16.00 1.04 SJ-1 122.89 946.00 4.55 91.67 10.08 8.11 12.00 0.88 TMV-293 123.78 980.33 4.00 102.00 9.70 8.56 16.00 0.78 SEm + 3.62 106.33 0.40 3.72 0.98 0.90 2.40 0.08 CD (P=0.05) 11.71 344.35 1.30 12.04 3.19 2.90 7.79 0.26 Evaluation of taro cultivars for growth and yield J. Hortl. keywords: colocasia; cormel; cultivars; number; panchmukhi; taro; yield cache: jhs-127.pdf plain text: jhs-127.txt item: #70 of 600 id: jhs-1274 author: C Yella Swami; G Senthil Kumaran; R K Naik; B S Reddy; A C Rathina Kumari title: Physio-morphological and Mechanical propertiesof chillies for Mechanical Harvesting date: 2022-09-10 words: 5549 flesch: 57 summary: Detachment force/ pulling force of chilli fruit The weight of 1000 ripened chilli fruits widely ranged from minimum 1.24 kg to maximum 9.21 kg. keywords: arka; chilli; cultivars; demon; force; fruits; green; harvesting; height; maximum; meghana; moisture; plant; properties; red; stem; tejaswini cache: jhs-1274.pdf plain text: jhs-1274.txt item: #71 of 600 id: jhs-128 author: Kasinath, B L; Ganeshamurthy, A N; Nagegowda, N S title: Effect of Magnesium on Plant Growth, Dry Matter and Yield in Tomato (Lycipersicon esculentum L.) date: 2015-12-31 words: 2784 flesch: 67 summary: Mean fruit Fruit of fruits weight yield plant-1 (g fruit-1) (t ha-1) Graded application of magnesium produced significant difference in fruit yield in tomato among treatments. keywords: fruit; ha-1; plant; tomato; yield cache: jhs-128.pdf plain text: jhs-128.txt item: #72 of 600 id: jhs-129 author: Pattanaik, Sanghamitra; Paul, Amitava; Lenka, Pravu Charan title: Performance of Gladiolus Genotypes: Growth, Flowering and Corm Production date: 2015-12-31 words: 4950 flesch: 60 summary: 10(2):194-198, 2015 196 were high (>40%) for number of cormels per plant, corm diameter (cm), individual corm weight (g), corm weight (q/ ha), and, low (< 20%) for days to spike emergence, days to first floret opening, flowering duration (days), spike length (cm), number of florets per spike, etc. Data were recorded for yield and twenty (20) contributing traits thereof, viz., days to sprouting, plant height (cm) at 30 and 60 days after planting (DAP), number of leaves, days to spike initiation, days to floret initiation, flowering duration, spike length (cm), rachis length (cm), number of florets per spike, floret diameter (cm), spike weight (g), number of corms per plant, number of cormels per plant, corm diameter (cm), corm weight (g), number of spikes/corm, number of spikes per m2, spike yield (q/ha), and corm yield (q/ha). keywords: corm; days; gladiolus; number; plant; spike; variability; weight cache: jhs-129.pdf plain text: jhs-129.txt item: #73 of 600 id: jhs-1292 author: Sahinur Ahmed; S, Langthasa title: Effect of dehydration methods on quality parameters of drumstick (Moringa oleifera Lam.) leaf powder date: 2022-09-29 words: 6345 flesch: 70 summary: In the present study, the increase in protein content of dried drumstick leaves compared to fresh leaves as a result of moistur e loss might ha ve influenced dry matter content (Oulai et al., 2016). Iron The iron concentration of dried drumstick leaves was higher as compared to fresh leaves. keywords: blanched; content; drumstick; drying; effect; leaves; methods; mg/100; pre; sample; sci; shade; sun cache: jhs-1292.pdf plain text: jhs-1292.txt item: #74 of 600 id: jhs-1297 author: Udaya Kumar K P; Chaturvedi, Kanupriya ; G S K, Swamy; Sane, Anuradha; Singh, Pritee ; G J, Suresh title: Development and evaluation of ready to serve (RTS) beverage from bael (Aegle marmelose Correa.) date: 2022-09-30 words: 4978 flesch: 70 summary: Udayakumar K.P.1*, Kanupriya Chaturvedi2, Swamy G.S.K.1 Anuradha Sane2, Pritee Singh2 and Suresh G.J.1 1Department of Fruit Science, College of Horticulture, Bengaluru - 560 065, India 2Division of Fruit Crops, ICAR-IIHR, Bengaluru - 560 089, India *Corresponding author E-mail : udaypkumar2897@gmail.com ABSTRACT A research study was carried out to develop a RTS beverage by exploiting the nutritional and organoleptic properties of bael fruit pulp. In Official Methods of Analysis, 17thedn, Titratable acidity of fruit products, 942.15 Association of Official Analytical Chemists, 2006. keywords: acid; bael; beverage; brix; fruit; product; pulp; rts; sugar; total; value cache: jhs-1297.pdf plain text: jhs-1297.txt item: #75 of 600 id: jhs-130 author: Madalageri, Deepa; Bharati, P C; Orsat, V; Raghavan, V; Kage, Udaykumar title: Antioxidant Activity in Pulp and Peel of Three Mango Varieties date: 2015-12-31 words: 7639 flesch: 62 summary: Among the two mango-fruit parts studied, total antioxidant activity in the peel was significantly higher in all the assays evaluated (ABTS, DPPH, FRAP) compared to that in the pulp of the mango fruit. When the means of total antioxidant activity evaluated by ABTS assay were compared, mango peel had 24.782mg TE/g DM (99.128µmol TE/g DM) which was significant higher than in the mango pulp at 1.964mg TE/g DM (7.856µmol TE/g DM)). keywords: abts; activity; antioxidant; antioxidant activity; assay; content; dpph; et al; food; frap; mango; mango peel; peel; pulp; total cache: jhs-130.pdf plain text: jhs-130.txt item: #76 of 600 id: jhs-1309 author: DEEP LATA; C K , Narayana; G, Karunakaran; D V, Sudhakar Rao; Sane, Anuradha title: Maturity determination of red and white pulp dragon fruit date: 2022-09-30 words: 5288 flesch: 67 summary: Red pulp fruits needed comparatively lesser time (29-31 DAF) than white pulp fruits (31-33 DAF) for optimum maturity. For optimum fruit maturity, red pulp fruits needed 29-31 DAF and white pulp needed 31-33 DAF. keywords: colour; daf; days; dragon; dragon fruit; fruit; growth; hylocereus; maturity; pulp; pulp pulp; red; sci; tss; white cache: jhs-1309.pdf plain text: jhs-1309.txt item: #77 of 600 id: jhs-131 author: Bhagawati, M; Saikia, A title: Cultivar Variation for Capsaicinoid Content in some Processed Products of Chilli date: 2015-12-31 words: 3552 flesch: 68 summary: In another experiment, 32 accessions of hot chillies were evaluated for capsaicin content, all of which had a high capsaicin content ranging from 1.20 to 3.74% (Manju and Shreelathakumary, 2002). From Table 4, it can be observed that capsaicin content in the products ranged from 0.15% to 2.59% in dried fruits, 0.15%-2.45% in the powder, 0.13%- 2.35% in the flakes, 0.19%-1.70% in the paste and 0.07%- 1.75% in the salted mash, respectively. keywords: bhut; capsaicin; chilli; content; cultivars; products; pungency; red; shu cache: jhs-131.pdf plain text: jhs-131.txt item: #78 of 600 id: jhs-1312 author: Neeraj; Siddiqui, Saleem ; Dalal, Nidhi; Bindu; Srivastva, Anuradha title: Morphological, physiochemical and colour characteristics of fresh and cured starch in potato varieties date: 2022-09-30 words: 6642 flesch: 75 summary: This investigation was thus performed out with an aim to characterize the morphological and physiochemical characteristics of potato starch extracted by control and combined method (extraction with ambient water ABSTRACT The present study was conducted to study the morphological, physicochemical and colour characteristics of potato starch extracted by control and combined methods from potato varieties viz., Kufri Chipsona-4, Badshah, Pushkar, Bahar and Sindhuri (fresh and cured). keywords: c ur; starch cache: jhs-1312.pdf plain text: jhs-1312.txt item: #79 of 600 id: jhs-132 author: Bhuvaneswari, S; Narayana, C K; Udhayakumar, R; Gowda, R Veere title: Effect of Packaging and Storage Temperature on Shelf-Life of Minimally Processed Onion (Allium cepa L.) date: 2015-12-31 words: 2691 flesch: 67 summary: Due to urbanization and with most of the families having working women, lack of time for cutting onion for cooking is a constraint, and packaged onions fit this need perfectly. Effect of high oxygen modified atmosphere packaging of fresh cut onion quality. keywords: onion; samples; storage cache: jhs-132.pdf plain text: jhs-132.txt item: #80 of 600 id: jhs-133 author: Padmalatha, T; Reddy, G Satyanarayana; Chandrasekhar, R title: Effect of Plant Growth Regulators on Corm Production and Vase Life in Gladiolus date: 2015-12-31 words: 4269 flesch: 67 summary: Sci. Vol. 10(2):220-225, 2015 Effect of plant growth regulators on corm production and vase life in gladiolus T. Padmalatha, G. Satyanarayana Reddy1 and R. Chandrasekhar College of Horticulture, Dr. Y.S.R. Horticultural University Rajendranagar, Hyderabad- 500030, India E-mail: gandhamlatha@yahoo.com ABSTRACT Influence of plant growth regulator sprays on corm production and post-harvest life of two gladiolus cultivars, Darshan and Dhiraj, was investigated for two consecutive years, 2008-09 and 2009-10. Darshan and Dhiraj Treatment Number of corms per plant Corm size (cm) 2008-09 2009-10 2008-09 2009-10 Darshan Dhiraj Mean Darshan Dhiraj Mean Darshan Dhiraj Mean Darshan Dhiraj Mean GA3 (100ppm) 1.67 1.60 1.64 1.67 1.60 1.64 4.43 4.51 4.47 4.26 4.54 4.40 GA3 (150ppm) 1.87 1.67 1.77 1.93 1.67 1.80 5.00 4.86 4.93 4.81 4.85 4.83 TIBA (50ppm) 1.53 1.37 1.45 1.53 1.40 1.47 4.15 4.68 4.42 4.28 4.72 4.50 TIBA (100ppm) 1.47 1.27 1.37 1.43 1.30 1.37 3.84 3.86 3.85 3.91 3.80 3.86 CPPU (2.5ppm) 1.53 1.47 1.50 1.60 1.43 1.52 4.30 4.71 4.51 4.37 4.58 4.48 CPPU (5ppm) 1.60 1.60 1.60 1.63 1.67 1.65 4.59 4.83 4.71 4.55 4.74 4.65 BR (5ppm) 1.63 1.53 1.58 1.53 1.60 1.57 4.39 4.94 4.67 4.52 4.73 4.63 BR (10ppm) 1.93 1.72 1.83 1.80 1.85 1.83 4.98 5.17 5.08 4.73 5.30 5.02 Control (Water) 1.47 1.37 1.42 1.47 1.33 1.40 4.26 4.40 4.33 4.30 4.31 4.31 Mean 1.64 1.50 1.65 1.54 4.44 4.66 4.41 4.62 CD (P=0.05) Cultivars (C) keywords: corm; cormels; darshan; dhiraj; gladiolus; n.s; number; plant cache: jhs-133.pdf plain text: jhs-133.txt item: #81 of 600 id: jhs-134 author: Dhaka, B L; Poonia, M K; Meena, B S; Bairwa, R K title: Yield and Economic Viability of Coriander under Frontline Demonstration in Bundi District of Rajasthan date: 2015-12-31 words: 1885 flesch: 56 summary: With this in view, frontline demonstrations were held at farmers’ fields, in a systematic manner, to showcase the worth of high-yielding varieties, to convince them about the potential of improved production technologies for enhanced productivity in coriander. All the demonstrations were conducted on medium- Yield and economic viability of coriander under frontline demonstration in Bundi District of Rajasthan B.L. Dhaka, M.K. Poonia1, B.S. Meena1 and R.K. Bairwa Krishi Vigyan Kendra Post Box No. 4, Bundi-323 001, India E-mail: maheshkpoonia@gmail.com keywords: demonstration; farmers; frontline; technology; yield cache: jhs-134.pdf plain text: jhs-134.txt item: #82 of 600 id: jhs-1340 author: None title: jhs-1340 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1340.htm plain text: jhs-1340.txt item: #83 of 600 id: jhs-135 author: Prasad, S R Shivu; Reddy, Y T N; Upreti, K K; Srilatha, V title: Chemical Constituents during the Main and Off-Season in Mango (Mangifera indica L.) Cv. Royal Special date: 2015-12-31 words: 2520 flesch: 61 summary: Total carotenoid and lycopene content increased in off season fruits compared to the on-season ones, at a maximum of 4.47mg/100g and 1.01mg/100g, respectively while, minimal content recorded was 2.33mg/100g and 0.45mg/100g during the off- and on- season, respectively. Some aspects of developmental physiology of mango fruit. keywords: acid; content; fruit; mango; season; sugars cache: jhs-135.pdf plain text: jhs-135.txt item: #84 of 600 id: jhs-1352 author: KB, Palanna; P S, Koti; S, Basavaraj; B, Boraiah; T, Narendrappa title: The Morphological and molecular diversity of Ganoderma spp. causal agent of basal stem rot of coconut in Southern dry tracts of Karnataka date: 2022-12-22 words: 7576 flesch: 61 summary: Dendrogram showing relationships of Ganoderma isolates of coconut based on similarity matrix of cultural/morphological characteristics Fig. 2 : Cultural morphological variability Ganoderma isolates. The dendrogram generated from the cultural and morphological characteristics showed clear variations among Ganoderma isolates and formed two main clusters, one cluster consisted of 13 isolates and another cluster consisted of 7 isolates. keywords: coconut; dist; dna; ganoderma; ganoderma isolates; isolates; karnataka; lucidum; molecular; primers; rdna; species cache: jhs-1352.pdf plain text: jhs-1352.txt item: #85 of 600 id: jhs-136 author: Sheela, K R; Pushpakumari, R; Shimi, G J; Geethakumari, V L title: Organic Farming Practices for Double-Sucker Planted Banana date: 2015-12-31 words: 2147 flesch: 59 summary: 4.50 44.42 7.42 24.69 M3 (75% RD) 4.50 45.00 7.71 25.72 F 0.07 0.09 0.89 0.92 CD (P=0.05) NS NS NS NS T1 (2 times) 4.33 44.50 7.14 23.77 T2 (3 times) 4.61 44.61 7.67 25.56 F 1.86 0.01 1.90 1.94 CD (P=0.05) NS NS NS NS M1 T1 4.33 44.67 6.92 23.03 M 1T 2 4.50 43.83 7.25 24.14 M2 T1 4.33 43.83 7.08 23.59 M 2T 2 4.67 45.00 7.75 25.80 M 3T 1 4.33 45.00 7.42 24.70 M 3T 2 4.67 45.00 8.00 26.74 Treatment mean 4.47 44.56 7.40 24.67 F 0.07 0.14 0.07 0.07 CD (P=0.05) Organic farming practices for double-sucker planted banana K.R. Sheela, R. Pushpakumari, G.J. Shimi and V.L. Geethakumari Department of Agronomy, College of Agriculture Vellayani, Thiruvananthapuram-695522, India E-mail: kumarsheela58@gmail.com ABSTRACT An experiment was conducted at College of Agriculture, Vellayani, Kerala, during December 2009 to September 2012 to standardize organic farming practices for double-sucker planted tissue-culture raised banana var. keywords: banana; ns ns; sucker; yield cache: jhs-136.pdf plain text: jhs-136.txt item: #86 of 600 id: jhs-137 author: Lakshmi, R Rajya title: Studies on Genetic Variability, Correlation and Path Analysis of Yield and Yield Components in Onion date: 2015-12-31 words: 3054 flesch: 56 summary: Similarly, Patil et al (1986) and Gurjar and Singhania (2006) reported high genetic gain for bulb yield and low genetic gain for TSS, which is in agreement with our study. Therefore, it is suggested to lay emphasis on these traits while imposing selection for bulb yield in the onion crop. keywords: bulb; diameter; onion; plant; weight; yield cache: jhs-137.pdf plain text: jhs-137.txt item: #87 of 600 id: jhs-1376 author: Usha; M, Ganga; K, Rajamani; S, Manonmani; R, Gnanam title: Impact of pollination strategies on fruit set and fruit growth attributes in jasmine date: 2022-09-24 words: 6342 flesch: 63 summary: Sci. Vol. 17(1) : 73-82, 2022 Impact of pollination strategies on fruit set and fruit growth attributes in Jasmine 78 Table 3: Open and self-pollination of J. auriculatum and J. grandiflorum cultivars Cultivars No. of Initiation No. of No. of Fruit Duration flowers of fruit fruits fruits at set of fruit pollinated set set at maturity (%) retention (DAP) 60 (days) DAP Open pollination J. auriculatum CO.1 Sci. Vol. 17(1) : 73-82, 2022 Usha et al 81 Table 6: Analysis of fruit characteristics for open pollinated and self-pollinated J. auriculatum and J. grandiflorum cultivars Cultivars Fruit Season Shape Colour Fruit Fruit Intensity of fruit of the of the length girth set fruit fruit (cm) (cm) Open Pollination J. auriculatum CO.1 keywords: fruit; pollination; set cache: jhs-1376.pdf plain text: jhs-1376.txt item: #88 of 600 id: jhs-1386 author: SADASHIVA, AVVERAHAALLY; H S, Oberoi; T H , Singh; H C, Prasanna; K, Madhavi Reddy; M, Krishna Reddy; K V, Ravishankar; R S , Nayana title: Breeding tomatoes suitable for processing with triple disease resistance to tomato leaf curl disease, bacterial wilt and early blight date: 2022-12-31 words: 7984 flesch: 59 summary: Tomato breeding p r ogr a mme a t I C AR - I ndia n Flow chart detailing the development of triple disease resistant tomato lines 280 Fig. 2 : Triple disease resistant F1 hybrids developed at ICAR-IIHR Arka Rakshak Arka Samrat IIHR-2833 IIHR-2832 IIHR-2834 IIHR-2835 Sadashiva et al J. Hortl. keywords: arka cache: jhs-1386.pdf plain text: jhs-1386.txt item: #89 of 600 id: jhs-1387 author: V S Karthik Nayaka; R B , Tiwari; C K, Narayana; K, Ranjitha; Azeez, Shamina ; C, Vasugi; R, Venugopalan; S, Bhuvaneswari; O J, Sujayasree title: Comparative effect of different sugars instigating non-enzymatic browning and Maillard reaction products in guava fruit leather date: 2022-09-30 words: 6944 flesch: 66 summary: The aim of the study was to determine the role of different sugars viz., sucrose, fructose, glucose and sorbitol in non-enzymatic browning and antioxidant activity of guava fruit leather. In brief, this paper describes a novel effort in bringing the in-vitro studies related to sugars and total free amino acids, influencing the biochemical and nutritional attributes which are responsible for browning in guava fruit leather. keywords: acid; activity; ascorbic; browning; food; fructose; glucose; guava; leather; non; reaction; sorbitol; sugars; values cache: jhs-1387.pdf plain text: jhs-1387.txt item: #90 of 600 id: jhs-139 author: Bala, Madhu title: Evaluation of Chrysanthemum (Chrysanthemum morifolium Ramat.) Genotypes for Morphological Traits date: 2015-12-31 words: 1878 flesch: 57 summary: Though a large number of chrysanthemum varieties are available in the market, novelty in commercial traits like flower colour, shape, size, growth habit, post-harvest life of the flower, etc., are always valued and preferred by the consumer. Results revealed that the genotypes differed significantly with each other with respect to plant growth and flowering parameters like plant height, number of branches per plant, plant spread, days taken to bud appearance, and, floral traits like number of flowers per plant, diameter of flower, flowering duration, flower colour and flower type. keywords: chrysanthemum; flower; plant; varieties; yellow cache: jhs-139.pdf plain text: jhs-139.txt item: #91 of 600 id: jhs-1397 author: Manisha; K, Padmini; R, Veere Gowda; M V , Dhananjaya title: Genetic diversity study in tropical carrot (Daucus carota L.) date: 2022-06-30 words: 2798 flesch: 71 summary: Per cent contribution of 16 characters towards diversity in carrot 85 Genetic diversity study in tropical carrot Characters group No.of List of AccessionsAccessions 1 Cluster 69 Acc-63, Acc -69, Acc -163B, Acc -52B, Acc -148, Acc -22B, Acc -52C, Acc -87, Acc -56B, Acc -77B, Acc -21A, Acc-72, Acc -76B, Acc -152B, Acc -76C, Acc -60A, Acc -155, Acc -50, Acc -22A, Acc -40, Acc -154A, Acc -140, Acc -77, Acc -777A, Acc -21C, Acc -54, Acc -113A, Acc - 76A, Acc -72, Acc -76, Acc -70, Acc -84, Acc -22D, Acc -01, Acc -135, Acc -102, Acc -135, Acc -88, Acc -21, Acc -21B, Acc -60B, Acc -68, Acc -106A, Acc -153, Acc -02, Acc -77C, Acc -101, Acc -113B, Acc -144C, Acc -56, Acc -146, Acc -41, Acc -152A, Acc -145, Acc -06, Acc -105, Acc -54B, Acc -85, Acc -88, Acc -106B, Acc -144A, Acc -144B, Acc - 54A, Acc -113B, Acc -105, Acc -20, Acc -80, Acc -164, Acc -156 2 Cluster 1 Acc -154B 3 Cluster 6 Acc -52A, Acc -163A, Acc -51, Acc -173, Acc -147, Acc -63 4 Cluster 1 Acc -75 5 Cluster 1 Acc -50 6 Cluster 1 Acc -150 7 Cluster 1 Acc -56A It is desirable to select genotypes from clusters showing high inter-cluster distance cluster VI (Acc -150) and cluster VII (Acc -56A) for further crop improvement programme. keywords: acc; carrot; cluster; diversity; genetic; leaf; mean; root; weight cache: jhs-1397.pdf plain text: jhs-1397.txt item: #92 of 600 id: jhs-14 author: A, Indhushree; Kuruvila, Anil; Thomas, Jesy; C, Latha Bastine title: Fruit and vegetable exports in the post-liberalization era: The Indian experience date: 2017-12-31 words: 5376 flesch: 49 summary: It was followed by gua vas, mangoes and mangosteens which accounted for 6.38 percent of value of fruits exports from India. Quantity (1000 Tons) 92.86 287.48 725.31 836.9 Source: Computed using data from wits.org Note: Per cent share denotes share in total quantity and value of fruit exports J. Hortl. keywords: concentration; export; fruits; grapes; index; india; percent; quantity; share; value; vegetables cache: jhs-14.pdf plain text: jhs-14.txt item: #93 of 600 id: jhs-140 author: Singh, L S; Pariari, A; Shukla, Gopal title: Effect of Panchagavya and GA3 on Germination and Seedling Growth in Cashew (Anacardium occidentale L.) date: 2015-12-31 words: 2835 flesch: 68 summary: L.S. Singh, A. Pariari1 and Gopal Shukla2 Central Plantation Crops Research Institute Research Centre, Kahikuchi, Guwahati - 781 017, India E-mail: singhleichombam@gmail.com ABSTRACT An experiment consisting of three sowing periods (March-May, June-August and September-November) and seven pre-sowing treatments was undertaken to study the effect of these factors on seed germination and initial seedling growth in cashew. Seed germination and growth of cashew seedlings were significantly influenced by pre- sowing treatment (Table 1). keywords: cashew; ga3; germination; growth; panchagavya; root; sowing; treatment cache: jhs-140.pdf plain text: jhs-140.txt item: #94 of 600 id: jhs-1404 author: None title: jhs-1404 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1404.htm plain text: jhs-1404.txt item: #95 of 600 id: jhs-141 author: Kotur, S C; Ramachandran, V title: Root Activity Distribution and Inter-plant Root Competition in 'Robusta' Banana (Musa Sp., 'AAA') under High-Density Planting Determined by Tracer Technique date: 2015-12-31 words: 2493 flesch: 65 summary: The greatest soil depth (45cm) at all the lateral distances studied, gained active roots which led to an hour-glass pattern of root activity distribution, depth-wise. Root activity distribution (%) in ‘Robusta’ banana plant (40 dai) during various stages of plant growth Depth (cm) Distance (cm) 25 50 75 Total 8th leaf stage 15 36.26 13.78 12.92 62.96 30 10.69 11.73 3.46 25.88 45 5.09 3.31 2.76 11.16 Total 52.04 28.82 19.14 100.00 SEm (±) 0.595 C.D. (P=0.05) 1.768 16th leaf stage 15 21.94 19.59 20.14 61.67 30 13.27 7.54 4.20 25.01 45 5.32 5.24 2.76 13.32 Total 40.53 32.37 27.10 100.00 SEm (±) 0.410 C.D. (P=0.05) 1.226 Flower initiation stage 15 30.28 20.37 12.21 62.86 30 12.49 4.31 1.40 18.20 45 11.51 2.07 5.36 18.94 Total 54.28 26.75 18.97 100.00 SEm (±) 0.555 C.D. (P=0.05) 1.650 Shooting stage 15 17.61 13.79 12.58 43.98 30 8.57 3.38 5.56 17.51 45 20.71 8.56 9.24 38.51 Total 46.89 25.73 27.38 100.00 SEm (±) 0.709 C.D. (P=0.05) 2.108 J. Hortl. keywords: activity; depth; plant; root cache: jhs-141.pdf plain text: jhs-141.txt item: #96 of 600 id: jhs-1416 author: Vijayakumar, S; Anil Nair, Sujatha; Nair, Anil Kumar; Laxman, R H; Kalaivanan, D title: Influence of phenophase based irrigation and fertigation schedule on vegetative performance of chrysanthemum (Dendranthema grandiflora Tzelev.) var. Marigold date: 2021-12-31 words: 8320 flesch: 69 summary: Optimum plant nutrition is ver y essential in plant growth and development, if it is not in sufficient amount then it reduces the vigor of the plant and affects yield of flower crops by producing small leaves, light green or off-color foliage, fewer branches and poor flowering (Melvin a nd J a mes , 2 0 0 1) . E x ces s ive a p p lic a t ion of nutrients can cause adverse effects on plant growth, inc r ea s e t he p ot ent ia l f or env ir onment a l conta mina tion thr ough lea ching a nd wa ste of resources. keywords: ea n; fertigation; irrigation; m ea; n f; npk; phase; plant; vegetative cache: jhs-1416.pdf plain text: jhs-1416.txt item: #97 of 600 id: jhs-142 author: Nongmaithem, Nabakishor title: Effect of Post-Harvest Fungal Pathogens on Fruit Quality in Guava Cv. Allahabad Safeda date: 2015-12-31 words: 1985 flesch: 65 summary: Wounds were made in guava fruits with the help of a sterilized cork-borer (6mm) and inoculated with pathogen Pestalotia psidii (T1) and Gloeosporium psidii (T2) containing a spore load of 1x104 conidia/ml (Granger and Horne, 1924). A perusal of the data indicates that physiological loss in weight (PLW) in guava fruit increased with advancement in storage period (Fig. 2). keywords: fruit; gloeosporium; guava; harvest; psidii; storage cache: jhs-142.pdf plain text: jhs-142.txt item: #98 of 600 id: jhs-1421 author: Kanade, Nandkishor; K S, Shivashankara; R M, Kurian; M, Sankaran title: Comparison of leaf volatile aroma constituents and phenolic acid profiles of the seedling originated polyembryonic mango (Mangifera indica L.) genotypes date: 2022-12-31 words: 4570 flesch: 63 summary: Mango leaves are a rich source of phenolic compounds such as xanthone-C-glycosides, gallotannins, benzophenones, flavonol glycosides, 5- alkyl- and 5-alkenylresorcinols and many other miscellaneous phenols (Barreto et al., 2008) such as Comparison of leaf volatile aroma constituents and phenolic acid profiles of the seedling originated polyembryonic mango (Mangifera indica L.) genotypes Kanade N.M.1, Shivashankara K.S.2*, Kurian R.M.1 and Sankaran M.1 1Division of Fruit Crops, 2Division of Basic Sciences, ICAR- Indian Institute of Horticultural Research Hessaraghatta Lake Post, Bengaluru-560089 *Corresponding author Email : Shivashankara.KS@icar.gov.in ABSTRACT In mango, leaf and fruit volatile aroma profiles are variety specific which can be used as fingerprint of a variety. Phenolic acid profile did not show significant diversity among the varieties and therefore cannot be used for identification of varieties. keywords: acid; compounds; genotypes; leaf; mango; phenolic; profiling; sci; varieties cache: jhs-1421.pdf plain text: jhs-1421.txt item: #99 of 600 id: jhs-1425 author: None title: jhs-1425 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1425.htm plain text: jhs-1425.txt item: #100 of 600 id: jhs-1429 author: Skinner, Nicholas; Rea, Mark; Bullough, John title: Effectiveness of the Field Application of UV-C for Cucumber Downy Mildew Control date: 2022-12-31 words: 7721 flesch: 59 summary: UV treatments have been particularly successful for mitigating obligate powdery mildew in a variety of crops (rose, strawberry, cucumber, etc.). Sci. Vol. 17(2) : 424-435, 2022 427 Three levels of UV dose (120 J·m-2, 240 J·m-2, and 480 J·m-2) were selected and each of these doses wer e a p p lied once or t wic e weekly ( i. e. , on Mondays and Thursdays). keywords: condition; control; disease; downy; field; fig; fungicide; l·ha-1; mildew; mulch; severity; treatment; values; year cache: jhs-1429.pdf plain text: jhs-1429.txt item: #101 of 600 id: jhs-1434 author: Subhash Chander; Reju M Kurian; Satisha J; KK Upreti; RH Laxman title: Advancing fruiting season in Annona cv. Arka Sahan through pruning date: 2022-12-06 words: 6493 flesch: 69 summary: Similar results were observed by Sharma et al. (2006) in mango where higher photosynthetic rate was recorded in leaves of pruned trees than trees not pruned. However, total leaf chlorophyll content was recorded similar for both pruned and unpruned mango trees during April and July while during November it was recorded highest in pruned trees (Schaffer and Gaye 1989). keywords: annona; cent; content; fruit; growth; pruning; season; shoot; trees cache: jhs-1434.pdf plain text: jhs-1434.txt item: #102 of 600 id: jhs-144 author: Raghavendra, S; Ramesh, C K; Kumar, V; Khan, M H M; Harish, B S title: Biochemical Changes during Plantlet Regeneration in Two Accessions of Mucuna pruriens date: 2015-06-30 words: 4799 flesch: 57 summary: For Nitrate/ Ammonia assimilating enzymes, extraction for nitrate reductase was carried out as per Altaf Ahmad and Abdin (1999), and enzyme activity was assayed as per Campbell and Smarrelli (1978). Optimum conditions for enzyme activity were maintained, namely, pH, temperature, substrate and cofactor concentrations. keywords: accession; activity; day; enzymes; l-1; medium; mucuna; nitrate cache: jhs-144.pdf plain text: jhs-144.txt item: #103 of 600 id: jhs-145 author: Shikhamany, S D; Jeughale, Sanjay K; Khapre, Kailas N; Venugopalan, R title: Variation in Relation between Yield and Yield Attributes in 'Thompson Seedless' Grape and its Clones date: 2015-06-30 words: 3428 flesch: 66 summary: Regression of cluster weight attributes on cluster weight in different varieties Regression equation Thompson Tas-A- 2A Seedless Ganesh clone a) Intercept -301.78 -213.07 -49.19 b) Slope of x1 68.03 57.82 47.61 (berry weight) This is the reason for a negative correlation of cluster weight with number of clusters/vine and number of clusters cane ratio. keywords: cluster; number; tas; thompson; vine; weight; yield cache: jhs-145.pdf plain text: jhs-145.txt item: #104 of 600 id: jhs-1456 author: None title: jhs-1456 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1456.htm plain text: jhs-1456.txt item: #105 of 600 id: jhs-146 author: Vinay, G M; Chithiraichelvan, R title: Induction of Off-Season Flowering in Custard Apple (Annona squamosa L.) Cv. Balanagar date: 2015-06-30 words: 3501 flesch: 71 summary: Effect of various pruning levels and defoliants on number of flowering shoots and number of flowers Treatment Number of flowering shoots per tree Number of flowers per shoot (days after pruning) (days after pruning) 30 60 90 120 30 60 90 120 T 1 Control (no pruning, no chemicals) 0.00 0.00 0.00 148.33 0.00 0.00 0.00 12.67 T 2 25% pruning (no chemicals) 41.00 61.67 85.00 123.33 5.67 5.00 5.00 5.00 T 3 50% pruning (no chemicals) 32.33 59.67 82.33 120.33 6.67 4.67 5.33 6.33 T 4 25% pruning + Urea 5% 46.00 64.67 83.00 124.33 5.00 5.67 6.33 5.00 T 5 25% pruning + Findings of this investigation helped standardize pruning and defoliation practices on a scientific basis for off-season production of custard apple fruits. keywords: days; flowering; number; pruning; shoots; trees cache: jhs-146.pdf plain text: jhs-146.txt item: #106 of 600 id: jhs-1469 author: ELZA GEORGE, MERIN; S, Sarada; M, Joy title: Screening of yard long bean (Vigna unguiculata subsp. sesquipedalis (L.) Verdcourt) genotypes for resistance to Colletotrichum gloeosporoides date: 2022-12-22 words: 2411 flesch: 55 summary: Recent advances in research on cowpea diseases. MATERIALS AND METHODS Fifty yard-long bean genotypes belonging to bush, semi erect and pole types were screened against anthracnose disease through artificial inoculation under pot cultur keywords: anthracnose; cowpea; disease; kau; long; nbpgr; stem; tcr cache: jhs-1469.pdf plain text: jhs-1469.txt item: #107 of 600 id: jhs-148 author: Batabyal, Kaushik; Sarkar, Dibyendu; Mandal, Biswapati title: Fertilizer-Prescription Equations for Targeted Yield in Radish under Integrated Nutrient Management System date: 2015-06-30 words: 4055 flesch: 61 summary: A ready reckoner for fertilizer dose at varying soil-test values for a yield target of 35 t ha-1 Soil-test value Fertilizer nutrient required (kg ha-1) (kg ha-1) for yield target of 35 t ha-1 Inorganic+ Inorganic FYM (10 t ha-1) N P K N P K N P K 250 5 100 47 7.0 22.5 32 5.7 17.5 275 10 125 43 6.6 20.0 28 4.8 14.2 300 15 150 39 6.1 16.7 24 4.4 11.7 325 20 175 36 5.2 13.3 21 3.9 8.3 350 25 200 32 4.8 10.8 17 3.1 5.8 375 30 225 29 4.4 7.5 15 2.6 2.5 400 35 250 25 3.5 5.0 10 2.2 0.0 Table 6. A ready reckoner for fertilizer dose at varying soil-test values for a yield target of 45tha-1 Soil-test value Fertilizer nutrient required (kg ha-1) (kg ha-1) for yield target of 45 t ha-1 Inorganic+ Inorganic FYM (10 t ha-1) N P K N P K N P K 250 5 100 70 9.2 32.5 55 7.4 26.7 275 10 125 67 8.7 29.2 52 7.0 24.2 300 15 150 63 8.3 26.7 48 6.6 20.8 325 20 175 60 7.4 23.3 45 6.1 18.3 350 25 200 56 7.0 20.8 41 5.2 15.8 375 30 225 52 6.6 17.5 37 4.8 12.5 400 35 250 49 5.7 15.0 34 4.4 9.2 reported that application of FYM at 15 t ha-1 together with chemical fertilizer resulted in a saving of 35, 10.9 and 23.3 kg ha-1 keywords: fertilizer; ha-1; radish; soil; yield cache: jhs-148.pdf plain text: jhs-148.txt item: #108 of 600 id: jhs-1481 author: None title: jhs-1481 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-1481.htm plain text: jhs-1481.txt item: #109 of 600 id: jhs-149 author: Suryapriya, I; Arulmozhiyan, R; Sankari, A; Anand, M title: Evaluation of Cut-Foliage Plants for Eastern Ghats date: 2015-06-30 words: 3840 flesch: 59 summary: In general, foliage plants are grown as understory plants in the canopy of giant trees. As a result, foliage plants are native to this type of environment, are tolerant to low light, sensitive to chilling temperature and are day-neutral to photoperiod. keywords: acute; cordyline; dracaena; foliage; green; philodendron; plant; species cache: jhs-149.pdf plain text: jhs-149.txt item: #110 of 600 id: jhs-150 author: Kavitha, P; Shivashankara, K S; Roy, T K; Pavithra, K C; Rao, V K; Sadashiva, A T; Ravishankar, K V; Sathish, G J title: Metabolite Profiling for Six 'B' Vitamins Using LC-MS in Tomato Genotypes at Different Stages of Fruit Maturity date: 2015-06-30 words: 6062 flesch: 66 summary: These lines can be further used for improving vitamin content by introgression of wild species with lines having a good horticultural background. Key words: Tomato, B vitamins, LC-MS/MS-MRM, fruit ripening, green stage, breaker stage cell formation. keywords: acid; content; fruit; genotypes; kg-1; stage; tomato; vitamins cache: jhs-150.pdf plain text: jhs-150.txt item: #111 of 600 id: jhs-151 author: Shivashankara, K S; Pavithra, K C; Laxman, R H; Sadashiva, A T; Roy, T K; Geetha, G A title: Changes in Fruit Quality and Carotenoid Profile in Tomato (Solanum lycopersicon L.) Genotypes under Elevated Temperature date: 2015-06-30 words: 3845 flesch: 57 summary: Gautier et al (2005) reported decrease in sugar content in cherry tomato when fruit temperatures increased. Changes in fruit quality and carotenoid profile in tomato (Solanum lycopersicon L.) genotypes under elevated temperature K.S. Shivashankara, K.C. Pavithra, R.H. Laxman, A.T. Sadashiva1, T.K. Roy and G.A. Geetha Division of Plant Physiology and Biochemistry ICAR-Indian Institute of Horticultural Research Hesaraghatta Lake Post, Bengaluru - 560 089, India E-mail: shivaiihr@yahoo.com ABSTRACT Tomato (Solanum lycopersicon L.) is a rich source of carotenoids, especially lycopene, and is affected severely by high temperatures under tropical conditions. keywords: carotenoids; content; fruit; genotypes; lycopene; quality; temperature; tomato; total cache: jhs-151.pdf plain text: jhs-151.txt item: #112 of 600 id: jhs-152 author: Kotur, S C title: Direct Nutrient-Feeding to 'Ney Poovan' Banana (Musa Sp. AB) Bunch under Organic or Conventional Farming for Yield, Fruit Quality and Profitability date: 2015-06-30 words: 2820 flesch: 57 summary: Composition of soil, cow dung, urine, panchagavya and their contribution in direct nutrient feeding of ‘Ney Poovan’ banana bunch Property* Soil properties Cow Cow Panchagavya Organic Conventional dung urine farming farming Moisture (%) - - 22.0 95.5 82.5 p H 7.32 7.15 5.8 5.7 5.2 Organic carbon 0.65 0.45 - - - (%) All modes of direct nutrient feeding of the banana bunch tested caused significant increase in fruit yield and bunch weight, in the order of blend: urea + SOP > panchagavya > cow-urine with cow-dung. keywords: banana; bunch; cow; farming; feeding; nutrient cache: jhs-152.pdf plain text: jhs-152.txt item: #113 of 600 id: jhs-1520 author: Chidambara, Bhavya; Elangovan, Dayanandhi ; Avverahally , Sadashiva; Reddy, Krishna; Kundapura, Ravishankar title: Identification of circular RNAs in resistant tomato genotype in response to ToLCBaV infection date: 2022-12-22 words: 5344 flesch: 57 summary: CircRNA were found to be differentially expressed during pathogen interaction in Arabidopsis (Sun et al., 2016; Zhang et al., 2020), pathogen invasion in kiwi fruit (Wang et al., 2017) and interaction with leaf curl virus in tomato (Wang et al., 2018); they also have regulatory roles in response to cotton verticillium wilt and maize Iranian mosaic virus (Xiang et al., 2018; Similar trend was observed when the CircRNAs (62 % from exonic region) were analysed in susceptible tomato (Wang et al. 2018). keywords: circrnas; et al; expression; fig; genes; identification; infection; parent; plant; pox; sod; tolcbav; tomato; wang; zhang cache: jhs-1520.pdf plain text: jhs-1520.txt item: #114 of 600 id: jhs-153 author: Waskar, D P; Khandare, V S; Kalalbandi, B M; Shelke, P S title: Effect of Polyamines on Storability and Quality of Pomegranate Fruit (Punica granatum L.) Cv. Bhagwa date: 2015-06-30 words: 3351 flesch: 68 summary: Control fruits stored at 5oC and 8oC temperature rapidly developed chilling-injury developed symptoms of brown discoloration of skin and weight-loss in pomegranate fruits. However, when stored below 5oC, pomegranate fruits develop chilling- injury (CI), resulting in reduced internal and external fruit quality (Mirdehghan and Rahemi, 2005). keywords: days; fruits; polyamines; pomegranate; storage; temperature; treatment cache: jhs-153.pdf plain text: jhs-153.txt item: #115 of 600 id: jhs-154 author: Khandare, V S; Waskar, D P; Kalalbandi, B M; Pawar, T J title: Nutraceutical Composition of Ber (Zizyphus mauritiana Lamk.) Juice: Effect of Enzyme-Assisted Processing date: 2015-06-30 words: 1475 flesch: 56 summary: In view of the enormous potential of ber as a source of phenolics, the current study was undertaken to examine the effect of enzyme-assisted processing on nutraceutical composition of ber juice. juice: effect of enzyme-assisted processing V.S. Khandare, D.P. Waskar, B.M. Kalalbandi and T.J. Pawar Department of Horticulture Vasantrao Naik Marathwada Krishi Vidyapeeth Parbhani – 431 402, India E-mail: khandarevs@rediffmail.com ABSTRACT An investigation was undertaken to study the effect of pre-press maceration treatment with cell-wall degrading enzyme, pectinase, on antioxidant composition of ber juice, during 2011-2012. keywords: antioxidant; ber; enzyme; juice; total cache: jhs-154.pdf plain text: jhs-154.txt item: #116 of 600 id: jhs-1543 author: Smitha G R; Sujatha A. Nair; D. Kalaivanan title: Standardization of container type, substrate and nutrition for potted plant production of China aster [Callistephus chinensis (L.) Ness.] var. Arka Archana date: 2022-12-31 words: 6948 flesch: 69 summary: Arka Archana released from ICAR- IIHR, Bengaluru is an early bloomer, with spreading plant type, bearing semi double white flowers, the plant form and floriferous nature makes it a suitable candidate for potted plant production. Arka Archana Smitha G.R.1*, Sujatha A. Nair1 and Kalaivanan D.2 1Division of Flowers and Medicinal Crops; 2Division of Natural Resources ICAR-Indian Institute of Horticultural Research, Hesaraghatta, Bengaluru - 580 089 *Corresponding author Email : G.Smitha@icar.gov.in ABSTRACT A study was conducted at the ICAR-Indian Institute of Horticultural Research, Hesaraghatta, Bengaluru for three consecutive seasons during 2019-20, to standardize the container type, substrate combination and nutrition for potted plant production of China aster var. keywords: fym; nutrient; plant; pots; potted; ppm; production; soil cache: jhs-1543.pdf plain text: jhs-1543.txt item: #117 of 600 id: jhs-155 author: Kaur, Prabhjot; Vashist, V K; Kumar, Ajay title: Evaluation of Potato Genotypes for Processing Traits in Late Autumn date: 2015-06-30 words: 4091 flesch: 68 summary: Kufri Chipsona-1and Kufri Chipsona-2 contained the lowest amount of total sugars (362 and 367mg/ 100g fresh weight, respectively). Among the cultivars under study, Kufri Badshah, Kufri Anand, Kufri Bahar, Kufri Chipsona-1, Kufri Chipsona-2, Kufri Ashoka and Kufri Jawahar gave the highest total tuber-yield. keywords: chipsona-1; kufri; kufri chipsona-1; mean; potato; processing cache: jhs-155.pdf plain text: jhs-155.txt item: #118 of 600 id: jhs-156 author: Wachira, P M; Muindi, J N; Okoth, S A title: Survey of Nematode-Destroying Fungi from Selected Vegetable-Growing Areas in Kenya date: 2015-06-30 words: 3862 flesch: 57 summary: From the study, it is evident that agricultural practices affect occurrence and diversity of nematode- destroying fungi, and, Arthrobotrys can be used as a bio-control agent for managing plant-parasitic nematodes. Results from this study can be used in further research for establishing the potential of nematode- destroying fungi in regulation of plant-parasitic nematode population. Fig. keywords: fungi; kenya; mean; nematode; plant; soil; study; vegetable cache: jhs-156.pdf plain text: jhs-156.txt item: #119 of 600 id: jhs-157 author: Gajanana, T M; Murthy, D Sreenivasa; Saxena, A K; Rao, D V Sudhakar; Sudha, M; Dakshinamoorthy, V title: Economic Analysis of Post-Harvest Loss and Marketing Efficiency in Guava (cv. Allahabad safeda) in Karnataka date: 2015-06-30 words: 2318 flesch: 66 summary: Efficiency in marketing guava and impact of post-harvest loss (PHL) Key words: Guava, post-harvest losses, Allahabad safeda, economic analysis, marketing efficiency Doddaballapur, Devanahalli and Bengaluru North, were selected and field-level loss was assessed from harvest at 39 sample-farmers’ fields located in the three taluks. keywords: guava; harvest; level; loss; marketing; post cache: jhs-157.pdf plain text: jhs-157.txt item: #120 of 600 id: jhs-158 author: Santhosha, H M; Indiresh, K M; Gopalakrishnan, C; Singh, T H title: Evaluation of Brinjal Genotypes against Bacterial Wilt Caused by Ralstonia solanacearum date: 2015-06-30 words: 2532 flesch: 60 summary: This is due to the unstable nature of resistance under different environmental conditions, which has necessitated the breeder to explore better sources of resistance in the cultivated brinjal for breeding bacterial wilt resistance. Among the diseases, bacterial wilt caused by Ralstonia solanacearum (Yabucchi et al, 1995) is a major limiting factor. keywords: arka; dai; genotypes; incidence; resistance; solanacearum; wilt cache: jhs-158.pdf plain text: jhs-158.txt item: #121 of 600 id: jhs-159 author: Muttappanavar, Renuka; Sadashiva, A T; Singh, T H; Indiresh, K M title: Evaluation of F1 Hybrids and their Parents for Growth, Yield and Quality in Cherry Tomato (Solanum lycopersicum Var. cerasiforme) date: 2015-06-30 words: 2706 flesch: 73 summary: Thus, hybrid P3 x P5 may be best suited for long-distance transport and for processing. P1 x P5 (3.33) P1 X P7 (3.00) branches No. of secondary P6(12.67) P1 (11.00) P7 (9.67) keywords: hybrids cache: jhs-159.pdf plain text: jhs-159.txt item: #122 of 600 id: jhs-16 author: Hanur, Vageeshbabu S title: Giant strides to reach the memorable ISSUE date: 2018-06-30 words: 683 flesch: 45 summary: Singh et al. report factors that majorly influence the much needed vegetative propagation in walnut. Vidya et al. have undertaken genome- wide analysis of heat responsive microRNAs in banana during the typical acquired thermo tolerance trait expression while Girija et al. attempted to characterize the ever-discombobulating endophytic bacteria, specially associated with Phalaenopsis roots, through the use of typical 16S rRNA gene-based taxonomic profiling. keywords: issue cache: jhs-16.pdf plain text: jhs-16.txt item: #123 of 600 id: jhs-1606 author: Raviteja, M S V; Laxman, R H; Rashmi, K; Kannan, S; Namratha, M R; Madhavi Reddy, K title: Effect of container size and types on the root phenotypic characters of Capsicum date: 2021-12-31 words: 6909 flesch: 70 summary: Identification of appropriate container for high throughput phenotyping of root characteristics The container size plays a major role in plant root and shoots growth. This could be due to the genetic potential of the genotypes exhibiting higher root and shoot biomass (Chowdary et al., 2015). keywords: bucket; capsicum; characteristics; container; genotypes; growth; ihr; leaf; plant; root; root characteristics; shoot; size; soil; volume; water cache: jhs-1606.pdf plain text: jhs-1606.txt item: #124 of 600 id: jhs-165 author: Jayanthi, P D Kamala; Verghese, Abraham; Chittiraichelvan, R; Kumar, Ravindra title: Plant Traits in Fig as Indicators of Resistance to Shoot Borer, Dyscerus? Fletcheri Marshall (Coleoptera: Curculionidae) date: 2015-06-30 words: 4901 flesch: 66 summary: Linear regression models explaining the variability in shoot borer, D. fletcheri, infestation in fig using plant traits Variables considered Model R2 VIF i) Significant variables based on r* y=-0.96-0.02 x1 0.60 2.47 (x1=no. of primary shoots; +0.23 x2-0.03x3 x2=no. of secondary shoots; +0.24 x4+1.28 x5 x3= no. of terminal shoots. Data collected on plant traits, viz., number of primary shoots, secondary shoots, terminal shoots, plant vigour, density of terminal shoots and latex-flow index were analyzed using one way ANOVA to determine differences in the above-mentioned parameters as significant or non- significant, between the two cultivars as per Little and Hills (1978). keywords: borer; density; flow; latex; number; plant; shoots; terminal shoots; traits; vigour cache: jhs-165.pdf plain text: jhs-165.txt item: #125 of 600 id: jhs-166 author: Radhika, V; ., Kanupriya; Rashmi, R; Aswath, C title: A Guide to in silico Identification of miRNAs and their Targets date: 2015-06-30 words: 2053 flesch: 53 summary: Target-align was proposed for plant miRNA target identification, and developed as both web and command line versions. Tools for miRNA structure prediction RNAfold (Zuker and Stiegler, 1981) is a tool which reads RNA sequences, calculates their minimum free energy and structure, and, returns the structure in bracket notation and its free energy. keywords: mirna; plant; prediction; sequences; structure; targets cache: jhs-166.pdf plain text: jhs-166.txt item: #126 of 600 id: jhs-167 author: Rymbai, H; Patel, C R; Ahlawat, T R; Patel, N L title: Studies on Fruit and Yield Traits in Indigenous Coloured Varieties of Mango (Mangifera indica L.) in South Gujarat, India date: 2015-06-30 words: 2947 flesch: 67 summary: Good appearance of mango fruit has the highest phenotypic acceptability in consumers (Uddin et al, 2006). Ripening and shelf-life in mango fruits after harvest Variety Time Post- keywords: cvs; fruit; makaram; mango; medium; totapuri; varieties; yellow cache: jhs-167.pdf plain text: jhs-167.txt item: #127 of 600 id: jhs-170 author: Samant, Deepa; Mandal, S; Singh, H S; Nath, Vishal; Kurian, Reju M title: Effect of in situ Rainwater Harvesting and Mulching on Growth, Yield and Fruit Quality in Mango Var. Arka Neelachal Kesri in Eastern India date: 2015-06-30 words: 1949 flesch: 60 summary: Effect of in situ rain-water harvesting and mulching on fruit yield and quality in mango ‘Arka Neelachal Kesri’ Treatment Fruit yield Fruit quality No. of fruits/tree Average fruit Total weight of Pulp Peel Stone TSS Acidity weight (g) fruits (kg/tree) (%) (%) (%) (°B) (%) 2012 2013 Pooled 2012 2013 Pooled 2012 2013 Pooled In situ rain-water harvesting structures Half-moon 11.33 15.91 13.62 165.72 151.97 158.85 1.87 2.41 2.14 68.32 13.59 18.10 20.01 0.25 Full-moon 13.44 18.73 16.09 156.78 169.27 163.03 2.09 3.10 2.59 68.16 14.80 17.05 19.91 0.26 Cup-and-Plate 23.27 32.55 27.91 164.97 167.98 166.48 3.87 5.46 4.67 67.53 14.11 18.36 19.71 0.27 Trench 18.22 27.18 22.7 167.01 157.70 162.35 2.94 4.28 3.61 69.20 13.92 16.89 18.80 0.28 SE(m)± 1.46 2.03 1.42 4.69 5.95 3.25 0.23 0.36 0.22 0.78 0.48 0.45 0.35 0.2 CD (P=0.5) 4.54 6.31 4.42 NS NS NS 0.71 1.11 0.69 NS NS NS NS NS Mulching Improvement in fruit quality with application of mulch was also observed by Ghosh and Tarai (2007) in ber. Cup-and-plate system of in situ rain-water harvesting and mulching either with paddy-straw or black polythene (100µ thickness) could, therefore, be useful for providing better growth, fruit yield and quality in rainfed mango in the humid tropics of Eastern India. keywords: fruit; mulch; rain; water cache: jhs-170.pdf plain text: jhs-170.txt item: #128 of 600 id: jhs-171 author: Banyal, Sanjeev Kumar; Sharma, Deepa title: Effect of Hormonal Treatment and Mulching on Fruit Drop and Quality in Mango date: 2015-06-30 words: 3211 flesch: 75 summary: Chadha and Singh Effect of hormonal treatment and mulching on fruit drop and quality in mango Sanjeev Kumar Banyal and Deepa Sharma Dr. Y.S. Parmar University of Horticulture and Forestry Krishi Vigyan Kendra, Chamba - 176 310, India E-mail: skbanyal@gmail.com ABSTRACT An experiment was laid out to assess the effect of hormonal treatment and mulching on fruit drop and quality in cvs. keywords: drop; fruit; mango; mulch; polythene cache: jhs-171.pdf plain text: jhs-171.txt item: #129 of 600 id: jhs-172 author: Kotur, S C title: Bio-Fortification with Iron and Manganese for Enhanced Bunch Yield in 'Robusta' Banana through Direct Nutrient-Feeding date: 2015-06-30 words: 1134 flesch: 61 summary: Sci., 5:148-150 Kotur, S.C., Ramesh, P.R. and Venugopalan, R. 2012. evaluating direct feeding of de-navelled banana bunch with nutrients for enhancing fruit quality yield and nutrient contents. Key words: Bunch size, direct nutrient feeding, ‘Robusta’ banana, Musa sp., Bio-fortification, Fe and Mn content of pulp the treatments. keywords: bunch; cow; dung cache: jhs-172.pdf plain text: jhs-172.txt item: #130 of 600 id: jhs-173 author: Sasikumar, K; Baskaran, V; Abirami, K title: Effect of Pinching and Growth Retardants on Growth and Flowering in African Marigold Cv. Pusa Narangi Gainda date: 2015-06-30 words: 1717 flesch: 65 summary: Flower yield is mainly dependent on the number of flower-bearing, branches which can be manipulated by arresting vertical growth of the plant and by encouraging side shoots to develop, with apical-bud pinching. As for flowering and yield, application of CCC at 2000ppm recorded maximum flowering-duration (25.33 days), number of flowers per plant (40), single-flower weight (119.46g), flower yield per plant (408.10g), flower yield per unit area (17.83t/ha) and seed yield per plant (17.80 g), Maximum flower diameter (7.93cm) was recorded with application of CCC 2000ppm, whereas, minimum was recorded with pinching (6.2cm). keywords: flower; growth; pinching; plant; yield cache: jhs-173.pdf plain text: jhs-173.txt item: #131 of 600 id: jhs-174 author: Khandare, V S; Waskar, D P; Kalalbandi, B M; Panpatil, S M title: Antioxidant Composition of Guava (Psidium guajava L.) Beverage Blended with Black-Carrot Juice date: 2015-06-30 words: 2326 flesch: 60 summary: Sensory analysis of guava RTS blended with black- carrot juice Blending guava RTS with black-carrot juice improved organoleptic quality remarkably in guava juice blended with 5 or 10% black-carrot juice (Table 4). Physio-chemical composition of guava RTS blended with black-carrot juice Data presented in Table 3 reveal that TSS of blended guava RTS ranged from 11.10% to 12.03%. keywords: blended; carrot; content; guava; juice; rts cache: jhs-174.pdf plain text: jhs-174.txt item: #132 of 600 id: jhs-175 author: Naik, M Raja title: Influence of Nitrogen and Phosphorus on Flowering in African Marigold (Tagetes erecta L.) Var. Cracker Jack date: 2015-06-30 words: 2835 flesch: 64 summary: Number of days taken to appearance of the first flower-bud decreased progressively with increase in nitrogen level. Increased nitrogen levels stimulating early-flowering may sound contradictory to the general belief that plants normally remain vegetative, thus delaying flowering, due to high nitrogen; But, this does not seem to be true in all the cases. keywords: days; flower; flowering; level; nitrogen; phosphorus cache: jhs-175.pdf plain text: jhs-175.txt item: #133 of 600 id: jhs-176 author: Singh, S R; Banik, B C; Hasan, M A title: Effect of Integrated Nutrient Management on Vegetative Growth and Yield in Mango Cv. Himsagar date: 2015-06-30 words: 2818 flesch: 69 summary: Response of organic manures and bio-fertilizer on growth, fruit yield and quality of mango cv. However, indiscriminate application of inorganic fertilizers leads to changes in physical, chemical and biological properties of the soil, besides reducing its fertility and leading to decline in its organic content (Singh et al, 2001). keywords: increase; mango; tree; yield cache: jhs-176.pdf plain text: jhs-176.txt item: #134 of 600 id: jhs-178 author: Dhatt, A S; Thakur, Prerna title: Production of Doubled Haploids in Onion: A Review date: 2014-12-31 words: 4204 flesch: 59 summary: A high rate of success in onion through gynogenesis was observed by Bohanec et al (1995), Luthar and Bohanec (1999) and Bohanec (2009). Bohanec et al (1995) tested a 2-step culture procedure for generating gynogenic plants using flower pre-culture, followed by ovule or ovary culture method of Campion and Alloni (1990). keywords: allium; bohanec; et al; gynogenic; haploid; induction; jakse; onion cache: jhs-178.pdf plain text: jhs-178.txt item: #135 of 600 id: jhs-179 author: Dinesh, M R; Vasugi, C; Venugopalan, R title: Genetic Variability in some Indian Mango Cultivars and Hybrids date: 2014-12-31 words: 2274 flesch: 68 summary: In our study too, variety Ratna, which is from the Western region of India, grouped with Rumani, a South Indian commercial variety. In the first cluster, varieties Dashehari, Banganapalli, Manjeera, Sindhu, Janardhan Pasand, Ratna, Rumani, Amrapali, Neelgoa and Alphonso grouped together. keywords: arka; cluster; hybrids; parents cache: jhs-179.pdf plain text: jhs-179.txt item: #136 of 600 id: jhs-180 author: Chaithanya, M V Naga; Dinesh, M R; Vasugi, C; Reddy, D C Lakshmana; Sailaja, D; Aswath, C title: Assessment of Genetic Diversity in Guava (Psidium guajava) Germplasm Using Microsatellites date: 2014-12-31 words: 3990 flesch: 60 summary: PIC PI No. R=Reverse primer (3’-5’) (bp) alleles size (bp) HET HET 1 mPgCIR339 F: CCGAAGACGAGGAGATTA 160 5 140-227 0.070 0.658 0.582 0.181 R: TTAAGTGGAAAATCACAGTTG 2 mPgCIR243 F: ACAGCAGGACACAAAGGA 174 7 107-212 0.292 0.798 0.764 0.072 R: GCTCTGAGGTGGTTTTCAT 3 mPgCIR182 F: GAGGAAGAAACCCGAAGTTA 181 8 87-202 0.264 0.8 0.769 0.068 R:GGTAGAAAGATCGGAAAGAC 4 mPgCIR236 F: ACTCATATTCCGTTTGCATC 164 2 154-168 0.056 0.301 0.254 0.507 R:GAATTAACGACGAGTTCCAC 5 mPgCIR316 F: GCTTCATATTACAAACCTTGG 232 4 192-281 0.239 0.464 0.416 0.317 R:GATCTAACTGACTTGCCAAAA 6 mPgCIR326 F: AGAACAAGACACGAGAAGAG 116 6 83-179 0.250 0.787 0.748 0.081 R:AAAATCTACGCACAAACC 7 mPgCIR207 F: CAAGATTTGCCTCAAGAAAC 136 5 71-145 0.306 0.460 0.433 0.319 R:AACTAAATAGCCTGCTGGTG 8 mPgCIR206 F:GGAAGTTTCAAAGTAACAGCAC 181 6 174-295 0.111 0.764 0.721 0.096 R:AGAATGAGTCCATGCTCAAA 9 mPgCIR220 F:AGAGCAGTGGTTGCTATTTT 218 7 145-164 0.083 0.731 0.679 0.121 R:CCCATCTCTTACTTTTCTTGTG 10 mPgCIR277 F:AGCCGATTATGATTACCTG 173 5 144-191 0.250 0.732 0.689 0.113 R:CGATTCACTCCCTCATTACT 11 mPgCIR039 F:GCTCACCTTACTCATTCAGC 155 4 145-200 0.014 0.524 0.406 0.309 R:CTGTTGCTAAGAGCTTTCGT 12 mPgCIR222 F:CCAGAATCAGACATAGTTAGAG 166 3 169-213 0.171 0.393 0.337 0.381 R:CTGAAGACATCAACATGGAA 13 mPgCIR093 F:GCATCATGTGTTTGAACGAT 123 6 102-168 0.194 0.803 0.768 0.070 R:AAGTGTGCGTTCTCCATCT 14 mPgCIR099 F:TCAAAGTCCAAAACTCATGC 220 4 194-267 0.208 0.532 0.475 0.276 R:GGGATGGAGTAAAGATGAAA 15 mPgCIR042 F:CTCACCCAAAATCTACACAAG 107 3 110-140 0.029 0.322 0.296 0.436 R:AAGGGACTGGACGATGTT 16 mPgCIR100 F:CTAGAAGTCGAAGAATGGAA 128 5 122-386 0.239 0.671 0.617 0.154 R:TTTGTTAGTATCGGAGTCGAG 17 mPgCIR185 F:AACGCATCTGGCATTGAT 117 4 97-135 0.141 0.308 0.285 0.476 R:CCTTGGTCTCCCTCTTACTC 18 mPgCIR165 F:TAAGGGATTCATTTCCGAGT 124 3 127-176 0.029 0.523 0.411 0.289 R:CTGGTGTGACGATGACTTTT 19 mPgCIR029 F:CTCGCTTCAATCTCCATCTA 162 2 166-202 0.521 0.414 0.326 0.409 R:AGCGACACAGACTCTTCATT 20 mPgCIR154 F:CTTCAGCTACAGCCTTTCC 138 8 102-285 0.903 0.794 0.759 0.074 R:GGAGAAAGCAGAAATTCCA 21 mPgCIR038 F:AGCCTGTTTTACGCCTTC 111 3 102-131 0.028 0.081 0.079 0.847 R:CGGCTGCTCTATTGTTATTT 22 mPgCIR194 F:GCAGAGAATCGAAGCACTA 172 6 154-208 0.278 0.747 0.695 0.113 R:GCAAGCACAGGTTCTACTTT 23 mPgCIR193 F:GAACGTGGGTTACATACCAT 122 4 102-132 0.028 0.594 0.506 0.252 R:ATCACCGTCCTCCTAAATCT 24 mPgCIR027 F:AGCACTTAGGGACAAATTCA 292 4 262-337 0.167 0.668 0.598 0.178 R:CTCACTCTCCTCCATTCAAG 25 mPgCIR191 F:GACCCTCCCACTTATATTTTG 210 6 216-282 0.485 0.766 0.726 0.071 R:AAGCTGACATAACAGTCGAA 26 mPgCIR091 F:GCGGTGGATTTGAATTTAG 125 3 107-142 0.324 0.552 0.465 0.272 R:CCAAGTAACCCACAACAATA 27 mPgCIR031 F:TCTCACTGATGCAACTTTTC 128 8 104-191 0.159 0.616 0.580 0.156 R:CCCATTTTCATCTCAAAGTC 28 mPgCIR157 F:AACCACCAAACCATACACC 209 4 163-224 0.246 0.692 0.636 0.128 R:CGACCAACCCTACATTCTG Assessment of genetic diversity in guava using microsatellites J. Hortl. Genetic diversity analysis is a prerequisite for identifying potential parents in breeding programs and germplasm conservation. keywords: accessions; analysis; diversity; group; guava; method; pulp; sci; varieties; white cache: jhs-180.pdf plain text: jhs-180.txt item: #137 of 600 id: jhs-181 author: Diengngan, S; Murthy, B N S; Mahadevamma, M title: Effective Decontamination and Regeneration Protocol for in vitro Culture of Strawberry Cv. Chandler date: 2014-12-31 words: 2519 flesch: 58 summary: Decontamination protocol of strawberry nodal explants in vitro culture. Further, maximum shoot proliferation percentage, shoots per explant and minimum number of days to shoot initiation was observed when explants were cultured on MS medium supplemented with 1.5 mg/l BAP over other concentrations of either BAP or in combination with GA. keywords: bap; explants; medium; shoot; strawberry; vitro cache: jhs-181.pdf plain text: jhs-181.txt item: #138 of 600 id: jhs-182 author: Selvi, N A Tamil; Jansirani, P; Pugalendhi, L title: Studies on Heterosis in Pumpkin (Cucurbita moschata Duch. Ex Poir) date: 2014-12-31 words: 6140 flesch: 74 summary: Heterobeltiosis for fruit polar diameter was recorded in the range of –25.59% (Karwar Local x Arka Suryamukhi) to 22.58% (Ambili x Arka Suryamukhi). Highest and lowest values for heterobeltiosis were recorded in the hybrids Karwar Local x Arka Suryamukhi (40.77%) and Ambili x CO 2 (-77.97%), respectively. keywords: arka; avinashi; fruit; heterosis; hybrids; local; local x; suryamukhi cache: jhs-182.pdf plain text: jhs-182.txt item: #139 of 600 id: jhs-183 author: Khangjarakpam, Gayatri; Kumar, Rajiv; Seetharamu, G K; Rao, T Manjunatha; Dhananjaya, M V; Venugopalan, R; Padmini, K title: Genetic Variability for Quantitative Traits in China Aster [Callistephus chinensis (L.) Nees] date: 2014-12-31 words: 2292 flesch: 53 summary: In the present study, high heritability, coupled with high genetic advance as per cent mean was recorded for flower diameter, flower stalk length, number of branches/plant, weight of flower/plant, days to first flower opening, days to 50% flowering, plant height, number of leaves/plant, number of ray florets/head, number of disc florets/head and number of flowers/plant indicating, that, these traits are controlled by additive gene action. High heritability, coupled with high genetic advance as per cent, mean has also been reported for flower diameter and number of ray florets/flower head (Raghava and Negi, 1994), plant height, number of branches/plant, flower stalk length (Aswath and Parthasarathy, 1993) and weight of flowers/plant (Rao, 1982; Negi et al, 1983; Ravikumar and Patil, 2003) in China aster. keywords: china; flower; genetic; heritability; number; plant cache: jhs-183.pdf plain text: jhs-183.txt item: #140 of 600 id: jhs-184 author: Misger, F A; Kumar, Amit; Bandey, S A title: Performance of some Exotic Pear Cultivars under Temperate Conditions of Kashmir date: 2014-12-31 words: 1650 flesch: 60 summary: Performance of exotic pear cultivars in Kashmir J. Hortl. Since the superior quality of pear cultivars are confined to the high hills of Kashmir valley, due to the availability of its high chilling requirements ranging from 500- 1500 hours. keywords: cultivars; fruit; pear; sugar cache: jhs-184.pdf plain text: jhs-184.txt item: #141 of 600 id: jhs-185 author: Arvindkumar, P R; Vasudevan, S N; Patil, M G title: Effect of Foliar Sprays of NAA, Triacontanol and Boron on Growth and Seed Quality in Bitter Gourd (Momordica charantia L.) Cv. Pusa Visesh date: 2014-12-31 words: 3122 flesch: 67 summary: Storage and preservation of quality seed stocks until the next season is as important as producing quality seeds. Pusa Visesh P.R. Arvindkumar, S.N. Vasudevan and M.G. Patil Department of Seed Science and Technology, College of Agriculture University of Agricultural Sciences, Raichur – 584 102, India E-mail : arvindkrathod09@gmail.com ABSTRACT An investigation was undertaken to study the effect of foliar sprays of NAA, triacontanol and boron on vine growth, seed quality and storability in bitter gourd cv. keywords: das; gourd; growth; leaf; quality; seed; storage cache: jhs-185.pdf plain text: jhs-185.txt item: #142 of 600 id: jhs-186 author: Bhatt, R M; Rao, N K Srinivasa; Rao, A. D. D. V. S. Nageswara title: Influence of Exogenous Glycinebetaine on Hot Pepper under Water Stress date: 2014-12-31 words: 2665 flesch: 62 summary: The GB treatment was given to seed (6.0%) before sowing and plants through foliar spray (1.0%) at the time of imposing water deficit stress. Since plants being immobile, cannot evade water stress in the same way as other mobile organisms. keywords: deficit; plants; stress; water cache: jhs-186.pdf plain text: jhs-186.txt item: #143 of 600 id: jhs-187 author: Kumar, Ramesh; Ahmed, Nazeer; Sharma, O Chand; Lal, Shiv title: Influence of Auxins on Rooting Efficacy in Carnation (Dianthus caryophyllus L.) Cuttings date: 2014-12-31 words: 2829 flesch: 65 summary: Freshly harvested roots of rooted cuttings were dried in an oven at 60°C for 48 hours to a constant weight, and weight of dried roots per rooted cutting was taken as the dry weight of root. NAA was more effective in rooting carnation cuttings; tip cuttings responded better than Table 3. keywords: carnation; cuttings; naa; rooting; roots; tip cache: jhs-187.pdf plain text: jhs-187.txt item: #144 of 600 id: jhs-188 author: Khan, Arpita Mandal; Shivashankara, K S; Roy, T K title: Determining Composition of Volatiles in Couroupita guianensis Aubl. Through Headspace-Solid Phase Micro-Extraction (HS-SPME) date: 2014-12-31 words: 2678 flesch: 62 summary: Relative abundance of various groups of volatile compounds in Couroupita guianensis flowers Fig 2. Variation in percentage of major chemical compounds in Couroupita guianensis flower fragrance obtained by solvent extraction, micro-simultaneous extraction and head-space solid phase micro-extraction (HS-SPME) techniques Arpita Mandal Khan et al J. Hortl. The objective of the present study was to identify aroma compounds that most likely represent the fragrance of Couroupita guianensis flowers, using the headspace-solid phase micro-extraction (HS-SPME) technique. keywords: compounds; couroupita; extraction; flowers; guianensis; micro; spme cache: jhs-188.pdf plain text: jhs-188.txt item: #145 of 600 id: jhs-19 author: L, Manjunath B; H, Laxman R; K, Upreti K; B, Raghupati H title: Partial root zone drying irrigation in papaya (Carica papaya L.) for enhanced water use efficiency under limited water situations date: 2017-12-31 words: 3829 flesch: 51 summary: Sci. Vol. 12(2) : 143-149, 2017 Partial root zone drying in papaya Treatments Photosynthetic Transpiration Stomatal ABA rate rate conductance (ng/g tissue) (µ mol m-2 s-1) (m mol m-2 s-1) (mol m-2 s-1) Normal irrigation-80% ER: 2 emitters/plant 10.71 2.81 0.21 210.6 Normal irrigation-80% ER: 1 emitter/plant 9.51 3.95 0.18 278.0 Shifting irrigation-80% ER: 1 emitter/plant 11.62 5.52 0.25 266.8 Shifting irrigation-60% ER: 1 emitter/plant 11.05 5.08 0.20 150.6 Shifting irrigation-50% ER: 1 emitter/plant 13.35 6.54 0.27 149.1 Shifting irrigation-40% ER: 1 emitter/plant 9.18 4.00 0.13 151.2 1-Side irrigation-60% Sci. Vol. 12(2) : 143-149, 2017 Manjunath et al Treatments Fruit T.S.S. Fruits / Fruit Fruit Fruit Water Water cavity (%) plant volume yield/ yield use produ- index (cm3) plant (t/ha) efficiency ctivity (kg) (kg/ha.mm) (kg m -3 ) Normal irrigation-80% ER: 0.47 10.8 46 1185 37.88 117.43 91.5 9.15 2 emitters/plant Normal irrigation-80% ER: 0.69 9.9 54 645 40.21 124.66 97.2 9.72 1 emitter/plant Shifting irrigation-80% ER: 0.60 8.2 39 603 29.44 91.27 71.1 7.11 1 emitter/plant Shifting irrigation-60% ER: 0.31 8.9 43 1450 33.43 103.64 134.6 13.46 1 emitter/plant Shifting irrigation-50% ER: 0.31 10.5 51 1053 37.49 116.21 181.2 18.12 1 emitter/plant Shifting irrigation-40% ER: 0.51 9.6 49 995 39.30 121.83 237.4 23.74 1 emitter/plant 1-Side irrigation-60% ER: 0.27 8.3 46 940 40.56 125.73 163.3 16.33 1 emitter/plant 1-Side irrigation-50% ER: 0.64 10.4 50 410 41.50 128.66 200.6 20.06 1 emitter/plant 1-Side irrigation-40% ER: 0.67 13.0 50 715 37.65 116.70 227.4 22.74 1 emitter/plant Shifting irrigation-60% ER: 0.54 8.1 35 623 27.21 84.35 109.6 10.96 2 emitters/plant Shifting irrigation-50% ER: 0.26 8.9 25 1388 19.74 61.19 95.4 9.54 keywords: drying; emitter; irrigation; papaya; plant; prd; root; shifting; soil; water cache: jhs-19.pdf plain text: jhs-19.txt item: #146 of 600 id: jhs-190 author: Kotur, S C; Ramesh, P R; Venugopalan, R title: Evaluating Direct Feeding of De-Navelled Banana Bunch with Nutrients for Enhancing Fruit Quality, Yield and Nutrient Content date: 2014-12-31 words: 3628 flesch: 64 summary: Technique of direct nutrient feeding of banana bunch through the distal end Direct nutrient feeding of de-navelled bunch in banana J. Hortl. Cost of cultivation per banana bunch was Rs. 84.54 in ‘Grand Naine’, Rs. 74.65 in the second and third varieties, Rs. 72.57 in ‘Ney Poovan’ and ‘Nanjangud Rasabale’, Rs. 76.17 in ‘Nendran’ and Rs. 84.54 in ‘Red Banana’ keeping in view crop duration and fertilizer dose. keywords: banana; bunch; feeding; fruit; nutrient cache: jhs-190.pdf plain text: jhs-190.txt item: #147 of 600 id: jhs-192 author: Satisha, G C; Patil, Prakash; Shirol, A M; Ganeshamurthy, A N title: Integrating Fertilizer N Rates with Organics on Soil-Available Nutrients and Yield of Sapota under Semi-Arid Conditions of Karnataka date: 2014-12-31 words: 4807 flesch: 57 summary: Sci. Vol. 9(2):172-178, 2014 176 Overall, soil organic matter content significantly increased in plots supplied with organic manure alone (FYM / Vermicompost) (Table 6). Soil organic matter content was estimated as per Nelson and Sommers (1982). keywords: application; fertilizers; fym; nitrogen; organic; sapota; soil; vermicompost; yield cache: jhs-192.pdf plain text: jhs-192.txt item: #148 of 600 id: jhs-193 author: Kasinath, B L; Ganeshmurthy, A N; Sadashiva, A T title: Interaction Effect of Applied Calcium and Magnesium on Alfisols of Karnataka and its Influence on Uptake and Yield Levels of Tomato (Solanum lycopersium L.) date: 2014-12-31 words: 4077 flesch: 69 summary: Application of Mg and Ca had significant negative influence on plant Mg content. Interaction effects of applied Mg and Ca resulted in enhancing the soil Ca from 430.17ppm in Mg1Ca1 to 694.67ppm in Mg4Ca3 treatments, on the other hand it was observed that interaction effects of applied Mg and Ca resulted in enhancing soil Mg from 92.98ppm in Mg1Ca1 to 213.64ppm in Mg4Ca3 treatments. keywords: fruit; ha-1; levels; plant; soil; tomato; yield cache: jhs-193.pdf plain text: jhs-193.txt item: #149 of 600 id: jhs-194 author: Ganeshamurthy, A N title: Effect of Directly-Applied and Residual Boron on Nutrition in French Bean-Cabbage Cropping Sequence under Alfisol date: 2014-12-31 words: 4257 flesch: 69 summary: Moreover, B sensitive French bean crop should be grown preferably on residual B than on directly applied B in any vegetable cropping system in red soils. Applied B enhanced B levels in French bean tissue from 19.2 to 154.0mg kg-1 in the first crop (Year I) at Site I, and from 36.2 to 174.0mg kg-1 at Site II (Table 3). keywords: bean; cabbage; crop; ha-1; kg-1; site cache: jhs-194.pdf plain text: jhs-194.txt item: #150 of 600 id: jhs-195 author: Kotur, S C title: Influence of Fermented Cocopeat on Seedling Vigour in some Vegetables, Marigold and Pigeon Pea date: 2014-12-31 words: 3071 flesch: 64 summary: The root system in pro-tray grown seedlings showed profuse growth of secondary roots but failed to match the overall root system observed in raised-bed seedlings. In ‘Omphalus’cauliflower, the root of seedlings from raised-bed was shorter than that in pro-tray grown seedlings; but, in respect of rest of the parameters, raised-bed seedlings were superior. keywords: cocopeat; grown; pro; seedlings; soil cache: jhs-195.pdf plain text: jhs-195.txt item: #151 of 600 id: jhs-197 author: Chowdappa, P; Kumar, B J Nirmal; Bhargavi, B Reddi; Hema, K R; Kumar, S P Mohan title: Detection and Quantification of Alternaria solani in Tomato by Real Time PCR date: 2014-12-31 words: 3884 flesch: 53 summary: A. solani produces a wide range of symptoms at all stages of tomato plants, causing early blight, collar rot, stem lesions and fruit rots (Chaerani and Voorrips, 2006). The currently available technique to detect A.solani in tomato seed and infected plant material is based on culturing on agar media and further its morphological characterization (Rotem, 1994), which demands specialized mycological Detection and quantification of Alternaria solani in tomato by real time PCR P. Chowdappa, B.J. Nirmal Kumar, B. Reddi Bhargavi, K.R. Hema and S.P. Mohan Kumar Division of Plant Pathology ICAR-Indian Institute of Horticultural Research Hesaraghatta Lake Post, Bengaluru - 560 089, India E-mail: pallem@iihr.ernet.in ABSTRACT A conventional and real-time PCR assays using SYBR Green for the detection and quantification of A. solani have been developed and validated. keywords: alternaria; detection; dna; material; pcr; plant; seed; solani; time; tomato cache: jhs-197.pdf plain text: jhs-197.txt item: #152 of 600 id: jhs-198 author: Gopalakrishnan, C; Singh, T H; Artal, Rashmi B title: Evaluation of Eggplant Accessions for Resistance to Bacterial Wilt Caused by Ralstonia solanacearum (E.F. Smith) Yabuuchi et Al. date: 2014-12-31 words: 2084 flesch: 62 summary: Crop Evaluation of eggplant accessions for resistance to bacterial wilt caused by Ralstonia solanacearum (E.F. Smith) Yabuuchi et al. C. Gopalakrishnan, T.H. Singh and Rashmi B. Artal ICAR-Indian Institute of Horticultural Research Hessaraghatta Lake Post, Bengaluru - 560 089, India E-mail : gopkran@iihr.ernet.in ABSTRACT Forty-one eggplant accessions were screened in a sick plot for bacterial wilt resistance at Indian Institute of Horticultural Research, Hessaraghatta, Bengaluru. Though resistance to bacterial wilt has been studied in several crops, especially tomato, there is little published work on bacterial wilt resistance in eggplant (Chaudhary and Sharma, 2000; Zakir Hussain et al, 2005; Mondal et al, 2013). keywords: accessions; avt; eggplant; resistance; wilt cache: jhs-198.pdf plain text: jhs-198.txt item: #153 of 600 id: jhs-199 author: Ghosh, S N; Bera, B title: Effect of Pruning on Productivity in Sweet Orange date: 2014-12-31 words: 1960 flesch: 66 summary: Highest fruit production in open-canopy plants (T5) may be due to greater penetration of sunlight and better air circulation, creating a micro-climate conducive to synthesis of carbohydrates and phyto-hormones. Highest fruit yield in T5 may be due to best fruit retention and to production of weighable fruits (Table 2). keywords: canopy; fruit; plants; pruning; removal cache: jhs-199.pdf plain text: jhs-199.txt item: #154 of 600 id: jhs-200 author: Kasinath, B L; Ganeshmurthy, A N; Nagegowda, N S title: Critical Limit of Soil and Plant Magnesium in Tomato-Growing Soils of South Karnataka date: 2014-12-31 words: 2365 flesch: 74 summary: Using scattered plot technique soil Mg limit of 74ppm is arrived as critical soil Mg for tomato crop. Using scattered plot technique a soil Mg limit of 74 ppm is arrived as critical soil Mg for tomato crop. keywords: magnesium; plant; soil; tomato cache: jhs-200.pdf plain text: jhs-200.txt item: #155 of 600 id: jhs-201 author: Baskaran, V; Abirami, K; Roy, S Dam title: Effect of Plant Growth Regulators on Yield and Quality in Gladiolus under Bay Island Conditions date: 2014-12-31 words: 2699 flesch: 64 summary: Effect of plant growth regulators on corm production of gladiolus cv. It is evident from Table 2 that all the characters pertaining to corm production were significantly influenced by plant growth regulator treatments. keywords: corm; ga3; gladiolus; growth; number; plant cache: jhs-201.pdf plain text: jhs-201.txt item: #156 of 600 id: jhs-206 author: Sudha, R; Balamohan, T N; Soorianathasundaram, K; Manivannan, N title: Molecular Diversity Analysis in F3 Intergeneric Population of Papaya (Carica papaya L.) date: 2014-06-30 words: 2444 flesch: 52 summary: This higher genetic diversity of papaya progenies stands to contribute to development of new varieties and, using the data, further hybridization and selection can be planned. Using DNA markers of different nature could help differentiate papaya progenies, and their genetic variation can be evaluated. keywords: bands; cauliflora; issr; markers; papaya; progenies; vasconcellea cache: jhs-206.pdf plain text: jhs-206.txt item: #157 of 600 id: jhs-209 author: Khandagale, K; Padmakar, B; Reddy, D C Lakshmana; Sane, Anuradha; Aswath, C title: Genetic Diversity Analysis and Barcoding in Tuberose (Polianthes tuberosa L.) Cultivars Using RAPD and ISSR Markers date: 2014-06-30 words: 4002 flesch: 61 summary: RESULTS AND DISCUSSION RAPD and ISSR analysis Both RAPD and ISSR markers were used in the study as tools for assessing genetic diversity, to fingerprint and identify different varieties of tuberose. Therefore, during the last decade, RAPD and ISSR markers J. Hortl. keywords: analysis; cultivars; diversity; double; issr; markers; rapd; tuberose; ubc; varieties cache: jhs-209.pdf plain text: jhs-209.txt item: #158 of 600 id: jhs-21 author: Mansour, Baraa AL; D, Kalaivanan; A, Suryanarayana M; K, Nair A title: Effect of integrated nutrient management on dry herbage yield, nutrient uptake and profitability of French Basil (Ocimum basilicum L.) date: 2017-12-31 words: 5630 flesch: 70 summary: Application of recommended FYM (10 t/ha) along with recommended NPK (160:80:80 kg/ha) registered the highest dry herbage yield (8.43 and 3.76 t ha- 1) in the main crop and ratoon, respectively and maximum uptake of nutrient in the main crop as N (155.67 and 113.19 kg/ha), P (43.80 and 32.43 kg/ha) and K (163.33 and 116.16 kg/ha) and in ratoon (56.43 and 26.65 kg ha-1), (16.14 and 14.01 kg ha-1) and (55.65 and 39. Application of recommended NPK (160:80:80 kg /ha) along with recommended FYM (10 t/ha i.e.,T9 registered the highest dry herbage yield (8.43, 3.76 and 12.19 t/ha) whereas the lowest dry herbage yield was observed with recommended FYM (10 t/ha) i.e., T7 (4.80, 2.08 and 6.88 t/ha) of main crop, ratoon and cumulative data respectively. keywords: application; basil; crop; fym; npk; nutrient; rec; uptake; yield cache: jhs-21.pdf plain text: jhs-21.txt item: #159 of 600 id: jhs-210 author: Sharma, Shashi Kumar title: Growth Restoration Studies in Frost-Affected Mango (Mangifera indica L.) Orchards in Sub-Himalayan Region date: 2014-06-30 words: 3842 flesch: 60 summary: Effect of various treatments on growth restorations in frost affected mango orchards at different locations (pooled data for the years 2007 and 2008) Similar pattern was observed for shoot extension growth: BA + urea outscored the other treatments, though statistically it was at par with GA3 + urea (T5) treatment. keywords: frost; fruit; growth; mango; spray; treatments; urea cache: jhs-210.pdf plain text: jhs-210.txt item: #160 of 600 id: jhs-211 author: Somkuwar, R G; Ramteke, S D; Satisha, J; Bhange, Mahadev; Itroutwar, Prerna title: Effect of Canopy Management Practices during forward Pruning on Berry Development and Photosynthesis in Tas-A-Ganesh Grapes date: 2014-06-30 words: 3454 flesch: 60 summary: In addition to primary effects like changed translocation patterns when seasonal practices (such as topping and Effect of canopy management practices during forward pruning on berry development and photosynthesis in Tas-A-Ganesh grapes R.G. Somkuwar, S.D. Ramteke, J. Satisha, Mahadev Bhange and Prerna Itroutwar National Research Centre for Grapes Pune - 412307, India E-mail: rgsomkuwar@yahoo.co.in ABSTRACT Effect of canopy manipulation during forward pruning on berry development and photosynthetic parameters was studied in Tas-A-Ganesh grape grafted onto Dogridge rootstock. Key words: Grape, canopy managements practices, photosynthesis, quality, yield different levels of defoliation) are applied (Hunter and Visser 1988a; Koblet et al, 1993), secondary effects like compensatory growth, take place (Hunter and Visser 1990). keywords: berry; bunch; canopy; leaf; practices; removal; shoot; thinning cache: jhs-211.pdf plain text: jhs-211.txt item: #161 of 600 id: jhs-212 author: Thakur, Nidhika; Rana, Vishal S title: Influence of Pruning Intensity on Yield and Quality of Nectarine Peach date: 2014-06-30 words: 2440 flesch: 67 summary: Nectarine fruits are borne on one-year old wood which turns barren later, and no flower-bud differentiation or subsequent fruit-formation occurs in this part of the branch (Badiyala and Awasthi, 1989). Influence of pruning intensity on yield and quality of nectarine peach Nidhika Thakur and Vishal S. Rana Department of Fruit Science, College of Horticulture Dr. Y.S. Parmar University of Horticulture and Forestry Nauni, Solan - 173 230, India E-mail: drvishal_uhf@rediffmail.com ABSTRACT A study was conducted to improve fruit yield and quality in nectarine through pruning. keywords: fruit; peach; pruning; yield cache: jhs-212.pdf plain text: jhs-212.txt item: #162 of 600 id: jhs-213 author: Reddy, Y T N; Kurian, Reju M title: Effect of Dose and Time of Paclobutrazol Application on the Flowering, Fruit Yield and Quality of Mango Cv. Alphonso date: 2014-06-30 words: 3106 flesch: 71 summary: Regarding fruit yield, maximum mean fruit yield of 22.0kg/plant was recorded with treatment D1T2 (3ml/m canopy PBZ applied 90 days before bud break) and least was with control (13.1kg/plant) which accounts for fruit yield increase of 67.9%. However, there is little information on the long term effects of continuous application of PBZ on flowering, fruit yield and quality of mango especially in varieties like Alphonso Effect of dose and time of paclobutrazol application on the flowering, fruit yield and quality of mango cv. keywords: bud; canopy; days; pbz cache: jhs-213.pdf plain text: jhs-213.txt item: #163 of 600 id: jhs-2131 author: Senthilkumar, K M; Raju, Saravanan; Velumani, Ravi; Gutam, Sridhar title: Transcriptome analysis and identification of leaf, tuberous root and fibrous root tissue-specific high temperature stress-responsive genes in sweet potato date: 2023-06-30 words: 3477 flesch: 53 summary: The gene expression patterns and molecular responses in different tissues of sweet potato under high temperature stress were studied using microarray data sets. Keywords : Fibrous root, high temperature stress, microarray, sweet potato, tuberous root 54 J. Hortic. keywords: et al; fibrous; genes; leaf; potato; root; stress; sweet; temperature; tissues; tuberous cache: jhs-2131.pdf plain text: jhs-2131.txt item: #164 of 600 id: jhs-2133 author: Manjunath, B L; Gutam, Sridhar; Raghupathi, H B title: Standardisation of fertigation in papaya for higher productivity and profitability date: 2023-06-30 words: 4735 flesch: 59 summary: pa pa ya wa s significa ntly influenced by fertilizer doses and fertigation sources (Table 1). Main 0.07 2.31 1.30 NS Sub 0.08 1.93 2.33 0.60 Main x Sub-1 NS 3.69 NS NS Table 1 : Mean plant growth parameters in papaya as influenced by fertilizer doses and fertigation sources Physiological parameters in papaya keywords: application; doses; fertigation; fertilizers; fruit; ha-1; papaya; rdf; soil; sources; water cache: jhs-2133.pdf plain text: jhs-2133.txt item: #165 of 600 id: jhs-2135 author: Vittal, Hatkari; Sharma, Nimisha; Shivran, Mukesh; Sharma, Neha; Dubey, Anil Kumar; Singh, Sanjay Kumar; Sharma, Radha Mohan; Singh, Bikram Pratap; Bollinedi, Haritha; Meena, Mahesh Chand; Pandey, Rakesh; Gutam, Sridhar title: Impact of carbohydrate metabolism pathways on bearing habit of mango (Mangifera indica L.) genotypes date: 2023-06-30 words: 3007 flesch: 61 summary: Simple sequence repeats markers grouped 63.15% studied mango genotypes of regular bearers together. Agarose gel profile of mango genotypes using alcohol dehydrogenase gene-based primer NMAD1 shown in Fig. 1. keywords: bearing; carbohydrate; gene; genotypes; mango; markers; metabolism; phosphate; primers; pusa; synthase cache: jhs-2135.pdf plain text: jhs-2135.txt item: #166 of 600 id: jhs-2138 author: Veluru, Bhargav; Kumar, Rajiv; Bharathi, T U; Dhananjaya, M V; Rao, T M title: Assessment of genetic diversity in China aster [Callistephus chinensis (L.) Nees date: 2023-06-30 words: 2763 flesch: 66 summary: The results suggested that the existing variation in China aster genotypes could be used for the development of trait-specific novel genotypes. Variation in seed production potential of China aster genotypes in the New Alluvial Zone of West Bengal. keywords: aster; china; cluster; flower; flowering; genotypes; life; plant; weight cache: jhs-2138.pdf plain text: jhs-2138.txt item: #167 of 600 id: jhs-2141 author: Athulya, M P; Anitha, P; Pradeepkumar, T; Sangeeta Kutty, M; Sainamole Kurian, P; Sindhumole, P title: Genetic diversity and screening for bacterial wilt in tomato (Lycopersicon esculentum) date: 2023-06-30 words: 3196 flesch: 61 summary: Sci. Vol. 18(1) : 40-45, 2023 out to analyse the diversity in tomato genotypes and screening for bacterial wilt disease. Dendrogram showing clustering of tomato genotypes Fig. 2 : Mahalnobis Euclidean Distance (not to scale) Table 3 : Intra and inter cluster distance in tomato genotypes Cluster No. keywords: cluster; distance; fruit; genotypes; plant; tomato; wilt; yield cache: jhs-2141.pdf plain text: jhs-2141.txt item: #168 of 600 id: jhs-2146 author: Kaur, Manpreet; Sharma, Parveen; Sharma, Akhilesh; Lata, Hem; Kumar, Nimit title: SSR analysis to assess genetic diversity and population structure in parthenocarpy cucumber (Cucumis sativus L.) date: 2023-06-30 words: 3760 flesch: 55 summary: Due to narrow genetic base and use of limited number of SSR markers for genetic diversity analysis, there is a dire need for studying genetic diversity using SSR markers for bridging the gap in the crop improvement by hybridization. The genotypes were maintained at Experimental Farm and Molecular Biology La bor a tor y of Vegeta ble Science a nd Floriculture department, CSK- Himachal Pradesh Krishi Vishvavidyalaya, Palampur, India during the year 2020-21 to take up genetic diversity analysis. keywords: analysis; cucumber; diversity; genotypes; markers; population; ssr; structure cache: jhs-2146.pdf plain text: jhs-2146.txt item: #169 of 600 id: jhs-2148 author: Bharathi, T U; Kumar, Rajiv; Nair, S A; Umamaheswari, R; Sonavane, P; Kalaivanan, D; Rao, V K title: Evaluation of tuberose genotype IIHR 17-23SP-08 (IC0642158) for flower yield, quality and response to biotic stress date: 2023-06-30 words: 4325 flesch: 73 summary: Original Research Paper Evaluation of tuberose genotype IIHR 17-23SP-08 (IC0642158) for flower yield, quality and response to biotic stress Bharathi T.U.1*, Kumar R.1, Nair S.A.1, Umamaheswari R.2, Sonavane P.2 Kalaivanan D.3 and Rao V.K.4 1Division of Flower and Medicinal Crops, 2Division of Crop Protection, 3Division of Natural Resources, 4Division of Basic Sciences ICAR-Indian Institute of Horticultural Research, Hesaraghatta Lake Post, Bengaluru - 560089, Karnataka, India *Corresponding author Email : ushabharathi.t@icar.gov.in ABSTRACT Tuberose (Agave amica, family Asparagaceae) is an important commercial flower crop valued for its spectacular fragrant flowers. Tuberose genotype IIHR 17-23SP-08 was found to be superior with highest plant height (55.53 cm), early flowering (94.93 days), highest number of spikes/plant (8.47), longest spikes (114.61cm) and rachis (32.11 cm) and maximum number of florets/spike (54.87). keywords: bud; days; flower; genotype; iihr; number; prajwal; tuberose; yield cache: jhs-2148.pdf plain text: jhs-2148.txt item: #170 of 600 id: jhs-215 author: Kumar, Ravindra; Ganesh, S; Chithiraichelvan, R; Upreti, K K; Sulladmath, V V title: Effect of Spacing and Pruning on Growth, Yield and Quality of Cv. Deanna Fig (Ficus carica L.) date: 2014-06-30 words: 5205 flesch: 67 summary: Physiology of pruning in fruit trees. minimum [ranging from 2.67-2.72 (-MPa)] under closer spacing of 5x2m during the 3rd year of tree growth (Table 2). keywords: fruit; pruning; pxs; spacing; tree; year cache: jhs-215.pdf plain text: jhs-215.txt item: #171 of 600 id: jhs-2150 author: Gurung, Anamika; Kumar, Rajiv; Aswath, C; Tejaswini, P title: Assessment of genetic variability, character association and path coefficient analysis in Chrysanthemum (Dendranthema x grandiflora Tzvelev) date: 2023-06-30 words: 4233 flesch: 58 summary: Plant Number Number Days Days to Days Flower Flowering Number height of of to first to diameter duration of Trait (cm) branches leaves bud flower optimum (cm) (days) flowers plant-1 plant-1 initiation opening flowering plant-1 Plant height (cm) G 1.000 -0.045 -0.118 0.580** 0.674** 0.599** 0.510** 0.521** -0.008 P 1.000 -0.021 -0.117 0.580** 0.663** 0.588** 0.492** 0.501** -0.008 Number of branches plant-1 A correlation study suggests that the genotype having higher number of flowers per plant would also possess a greater number of branches and number of leaves plant-1. keywords: chrysanthemum; coefficient; correlation; days; flower; flowering; number; plant-1; traits cache: jhs-2150.pdf plain text: jhs-2150.txt item: #172 of 600 id: jhs-2151 author: Lal, shiv; Lal, Gopal; Meena, N K; Meena, R D; Chaudhary, N; Choudhary, M K; Saxena, S N title: Stability analysis of yield, yield attributes and essential oil content in fennel (Foeniculum vulgare Mill.) evaluated under a long-term organic production system date: 2023-06-30 words: 5999 flesch: 65 summary: The two varieties GF-12 and AF-1 had high mean performance, non-significant regression coefficient deviation from unity (bi=1) and non-significant deviation from zero (S2di=0) in terms of numbers of umbels and seed yield per hectare and RF-101 had recorded higher essential oil content. In recent times, improved released fennel varieties AF-1, RF-101, CO-01, Rajendra Saurabha, GF-12, RF-281, RF-125 and GF-02 are cultivated widely under different arid and semi-arid regions for high yields and quality, therefore, these varieties were chosen to investigate their performance and stability for growth and yield under an organic production system. keywords: average; coefficient; fennel; mean; number; plant; regression; seed; stability; variety; yield cache: jhs-2151.pdf plain text: jhs-2151.txt item: #173 of 600 id: jhs-2152 author: Lakshamipathy; Adiga, J D; Kalaivanan, D; Bhagya, H P; Thondaiman, V; Mog, Babli; Manjesh, G N; Veena, G L; Shamsudheen, M; Vanitha, K; Manjunatha, K title: Effect of growth regulators and micronutrients on quality parameters in cashew (Anacardium occidentale L.) date: 2023-06-30 words: 4027 flesch: 69 summary: Hence, it is of utmost importance to address this research gap and it is also essential to understand how the endogenous hormones affect or regulate the stages of plant growth in order to make exogenously applied plant growth hormones to play an important role in maximizing cashew nut yield. The present study represents the first preliminary study on the influence of growth hormones and micronutrients on the nutritional qualities of cashew nuts and apples in the variety Bhaskara. keywords: cashew; content; effect; fruit; growth; micronutrients; ppm; quality; weight; yield cache: jhs-2152.pdf plain text: jhs-2152.txt item: #174 of 600 id: jhs-2153 author: Nair, S A; Smitha, G R; Kalaivanan, D title: Influence of container, potting media and nutrients on production and post-production consumer acceptance of potted marigold (Tagetes patula L.) date: 2023-06-30 words: 5420 flesch: 64 summary: Sci. Vol. 18(1) : 113-121, 2023 Nair et al. nutrient dose in potted plant production of marigold and to gauge the consumer preference. The study on potted plant production of French marigold var. keywords: media; n s; number; nutrients; plant-1; plants; pots; ppm; production cache: jhs-2153.pdf plain text: jhs-2153.txt item: #175 of 600 id: jhs-2156 author: Chang, J; Tang, L title: Manipulating female flower intensity in ‘Yu Her Pau’ Litchi by delayed winter pruning date: 2023-06-30 words: 2557 flesch: 61 summary: Female flower number of ‘Yu Her Pau’ litchi pruned in mid-December [early pruning (EP)] and mid-January [late pruning (LP)]. INTRODUCTION ‘Yu Her Pau’ is an early-maturing litchi (Litchi chinensis) cultivar with outstanding fruit quality, but low crop load is a perpetual issue for its production on Taiwan (Chen et al., 2013; Chang et al., 2022). keywords: flower; fruit; litchi; mid; pau; pruning; trees cache: jhs-2156.pdf plain text: jhs-2156.txt item: #176 of 600 id: jhs-2157 author: Kalaivanan, D; Sankaran, M; Patil, Prakash title: Stionic effects on leaf mineral nutrient contents in Pummelo (Citrus maxima Merr.) grafted on different rootstocks date: 2023-06-30 words: 4491 flesch: 64 summary: that within certain limits, there Original Research Paper J. Hortic. Sci. Vol. 18(1) : 142-149, 2023 https://doi.org/10.24154/jhs.v18i1.2157 Stionic effects on leaf mineral nutrient contents in Pummelo (Citrus maxima Merr.) Keywords : Accessions, grafting, leaf mineral nutrient, pummelo, Rangpur lime, rootstock 143 Stionic effects on leaf mineral nutrient contents in pummelo J. Hortic. keywords: concentration; content; genotypes; kg-1; leaf; lime; nutrient; pummelo; rangpur; selection cache: jhs-2157.pdf plain text: jhs-2157.txt item: #177 of 600 id: jhs-216 author: ., Tarannum; Naik, B Hemla title: Correlation Studies in Carnation (Dianthus caryophyllus L.) date: 2014-06-30 words: 2806 flesch: 48 summary: From the medicinal point of view, carnation flowers are considered to be cardio-tonic, diaphoretic and alexiteric (Shiragur et al, 2004). Flower yield per square meter showed highly significant association with number of branches, nodes per stalk and nodes per plant; stem girth, number of leaves, leaf area, total dry matter and duration of flowering. keywords: correlation; flower; genotypic; number; yield cache: jhs-216.pdf plain text: jhs-216.txt item: #178 of 600 id: jhs-2162 author: Anand, Anusree; Rao, D V S; Narayana, C K; Kurian, M R; Ranjitha, K; Shivashankara, K S title: Effect of hot water treatments on physiological and biochemical changes in mango cv. Banganapalli during storage at ambient temperature date: 2023-06-30 words: 4151 flesch: 69 summary: Sci. Vol. 18(1) : 189-194, 2023 https://doi.org/10.24154/jhs.v18i1.2162 Effect of hot water treatments on physiological and biochemical changes in mango cv. Hot water treatments (HWTs) at specific levels have shown to control the incidence of these important threats. keywords: control; fruits; hot; mango; min; storage; treatments; water cache: jhs-2162.pdf plain text: jhs-2162.txt item: #179 of 600 id: jhs-2163 author: Gurjar, P S; Singh, S R; Verma, A K; Mishra, M title: Post-harvest melatonin application reduced browning in minimally processed lettuce (Lactuca sativa L.) during low temperature storage date: 2023-06-30 words: 3770 flesch: 60 summary: Melatonin treatment slowed down the production of superoxide radicals (O2 –·) and hydrogen peroxide (H2O2) during post-harvest storage which resulted in protection of membrane structure and lower electrolyte leakage (Aghda m et al. , 2015). During post-harvest storage of fr esh pr oduce chlorophyll, dilapidation occurs through the continuous reduction of chlorophyll b inding p r o t eins du e t o eleva t e d keywords: activity; browning; harvest; lettuce; melatonin; post; quality; samples; storage; total; treatment cache: jhs-2163.pdf plain text: jhs-2163.txt item: #180 of 600 id: jhs-2167 author: Suriya, S; Preetha, G; Balakrishnan, N; Sheela, J title: Seasonal incidence, population dynamics and morphometric traits of exotic coconut whiteflies in southern Tamil Nadu date: 2023-06-30 words: 4134 flesch: 64 summary: Population of Aleurodicus rugioperculatus adults in southern districts of Tamil Nadu Location Population of A. rugioperculatus adults/leaflet* Population of A. rugioperculatus nymphs The population of A. rugioperculatus nymphs in four different southern districts of Tamil Nadu is given in Table 2. keywords: coconut; leaflet; nymphs; population; rugioperculatus; whitefly cache: jhs-2167.pdf plain text: jhs-2167.txt item: #181 of 600 id: jhs-2168 author: Mandla, Ishita; Vaidya, M K title: Production function analysis for vegetable cultivation in Kullu valley of Himachal Pradesh: Application of Cobb-Douglas production model date: 2023-06-30 words: 3085 flesch: 62 summary: The marginal value product (MVP) of the resources employed in vegetable production was calculated by multiplying the marginal physical product (MPP) by the unit price of the output(Py), as given below: MVPxi = MPPxi. In order to explain the contribution of individual input in the total output, production function analysis is helpful to evaluate the efficiency of various inputs used by the farmers. keywords: case; function; production; resource; use; vegetable cache: jhs-2168.pdf plain text: jhs-2168.txt item: #182 of 600 id: jhs-2169 author: Umesha, M; Sunisha, C; Usharani, T R; Sowmya, H D; Sriram, S title: Over expression of anti-apoptotic gene in banana cv Rasthali enhances resistance against Fusarium oxysporum f. sp. cubense Race 1 date: 2023-06-30 words: 2990 flesch: 67 summary: Analysis using the real time PCR showed the varying levels of AtBAG4 gene expression under two promoters. The differences in gene expression driven by two promoters revealed that stronger expression of AtBAG4 gene under the ubiquitin promoter suppressed the infection and spreading processes of FOC1 in transgenic banana under standard bioassay systems. keywords: atbag4; banana; expression; fusarium; gene; promoter; transgenic cache: jhs-2169.pdf plain text: jhs-2169.txt item: #183 of 600 id: jhs-217 author: Geeta, Biradar; Chetti, M B; Navalgatti, C M title: Effect of Plant Growth Regulators on Leaf Biochemical Characters and Fruit Yield Components of Bittergourd (Momordica charantia L.) Cvs. MHBI-15 and Chaman Plus date: 2014-06-30 words: 3015 flesch: 62 summary: Though plant growth regulators have a great potential to influence plant growth and morphogenesis, their application and actual assessment needs to be planned well in terms of optimal concentration, stage of application, species- specificity, season, etc. Plant growth regulators (PGRs) have a great potential in increasing productivity in vegetables. keywords: ccc; chlorophyll; growth; plant; regulators; total; yield cache: jhs-217.pdf plain text: jhs-217.txt item: #184 of 600 id: jhs-2171 author: Abhishek, K; Bala, Madhu title: Morphological characterization of standard chrysanthemum (Chrysanthemum morifolium Ramat.) date: 2023-06-30 words: 2083 flesch: 54 summary: The variation in flower colour among chrysanthemum varieties may also be due to the distinct genetic makeup and different proportion of pigments present in a particular genotype. The observations on various growth and flowering parameters such as plant height at bud appearance and at anthesis, number of leaves per plant, days to bud initiation, days to flower opening stage, maturity group (early, medium, late), flower diameter, duration of flowering, flower colour, vase life, flower form and commercial use were recorded. keywords: chrysanthemum; days; flower; varieties cache: jhs-2171.pdf plain text: jhs-2171.txt item: #185 of 600 id: jhs-2175 author: MohanKumar, G N title: Nutraceutical Horticulture : An overview of biochemical and molecular considerations date: 2022-06-30 words: 2040 flesch: 57 summary: P la nt s p r odu c e over 5 0 , 00 0 p hyt oc hemic a ls b elonging t o it s a c tiva t or s, T N F p r omot es degr a da tion of its inhibitory peptide (IkB) resulting in the activation of N F-kB. T he a ctive NF- kB then enter s the nucleus and binds to the response elements (RE) of DNA to promote transcription. keywords: factor; nutraceuticals; tnf; transcription cache: jhs-2175.pdf plain text: jhs-2175.txt item: #186 of 600 id: jhs-2176 author: Sujatha, S; Rao, T M; Kumar, Rajiv; Rupa, T R title: Genotype variations in biomass production and nutrient removal pattern in gladiolus raised from cormels date: 2022-06-30 words: 4249 flesch: 65 summary: Higher corm biomass production with less nutrient uptake in gladiolus genotypes raised from cormels gives scope for largescale planting material multiplication utilizing cormels. 115 J. Hortl. The average dry weights of all components per plant varied significantly among genotypes and were used for computing total biomass production per hectare (Table 1). keywords: arka; biomass; cormels; corms; genotypes; gladiolus; plant; production; removal; soil; total; uptake cache: jhs-2176.pdf plain text: jhs-2176.txt item: #187 of 600 id: jhs-218 author: Srinivasan, R; Rao, K Jeevan; Sailaja, V; Kalaivanan, D title: Influence of Organic Manures and Fertilizers on Nutrient Uptake, Yield and Quality in Cabbage-Baby Corn Cropping Sequence date: 2014-06-30 words: 5124 flesch: 58 summary: Influence of organic manures and fertilizers on nutrient uptake, yield and quality in cabbage-baby corn cropping sequence R. Srinivasan1, K. Jeevan Rao, V. Sailaja and D. Kalaivanan2 Acharya N.G. Ranga Agricultural University, College of Agriculture Rajendranagar, Hyderabad – 500 030, India E-mail: srinivasan.surya@gmail.com ABSTRACT Field experiments were conducted at Acharya N.G. Ranga Agricultural University, Hyderabad, Andhra Pradesh, India, during rabi and kharif seasons of 2010 and 2011 to study direct, cumulative, or residual effect of organic manures (Farmyard Manure, Vermicompost, Poultry Manure, Neem Cake, and combinations thereof) along with the recommended dose of fertilizers (RDF) and absolute Control, on nutrient uptake, yield and quality in cabbage-baby corn cropping sequence system. Organic carbon build-up is appreciable and significant in the case of organic matter applied to soil, and, organic manures leave behind residues sufficient quantity of residues for the next crop in the sequence (Singh et al, 1996; Baruah et al, 1999). keywords: baby; cabbage; cake; corn; fertilizers; ha-1; manure; neem; poultry; uptake; yield cache: jhs-218.pdf plain text: jhs-218.txt item: #188 of 600 id: jhs-22 author: Sharma, Ajay Kumar; Naik, Sharmistha; D, Sawant S; Kadam, Pratiksha; G, Somkuwar R title: Evaluation of commercial dipping oil for production of quality raisins from Thompson Seedless grapes date: 2017-12-31 words: 3320 flesch: 63 summary: Beside it pretreatments of grape bunches or application of solutions during drying also play an important role not only in improving quality of dried grapes, but has significant impact on number of days required for drying. Evaluation of commercial dipping oil for production of quality raisins from Thompson keywords: carbonate; dip; drying; grape; potassium; raisins; storage; super cache: jhs-22.pdf plain text: jhs-22.txt item: #189 of 600 id: jhs-223 author: Swarupa, V; Rekha, A; Ravishankar, K V title: Development of Normalized Cdna Library from Fusarium Wilt Infected Roots of a Tolerant Banana Genotype 'Calcutta-4' Musa acuminata ssp. burmannicoides date: 2014-06-30 words: 3451 flesch: 52 summary: Also, induction of various defense response genes in tolerant genotypes and not in susceptible genotypes has been represented by various transcriptome and proteomic studies (Bai et al, 2013; Li et al, 2013b). Defense genes comprised 9% while, signal transduction genes represented 10%. keywords: banana; calcutta-4; cdna; defense; fusarium; genes; library; normalization; plant; protein; ros; wilt cache: jhs-223.pdf plain text: jhs-223.txt item: #190 of 600 id: jhs-224 author: Kaur, M; Dhatt, A S; Sidhu, A S title: Effect of Seed Disinfectants on in vitro Seed Germination and Seedling Development in Eggplant date: 2014-06-30 words: 2688 flesch: 58 summary: Key words: Seed germination, seedling growth, culture contamination, bleach, mercuric chloride, sodium hypochlorite 1ICAR-Indian Institute of Horticultural Research, Hessaraghatta Lake Post, Bengaluru – 560 089, India hypochlorite (half-strength standard household bleach) for 30 min for improvement in seed germination. Seed germination (%) HgCl2 was highly toxic and inhibited seed germination. keywords: bleach; eggplant; germination; growth; hgcl2; seed cache: jhs-224.pdf plain text: jhs-224.txt item: #191 of 600 id: jhs-225 author: Ramesh, D; Kumar, B Prasanna; Rajasekhar, M; Suneetha, D R Salomi title: Effect of Chemicals and Growth Regulators on Post-Harvest Shelf-Life and Quality in Papaya (Carica papaya L.) Cv. Red Lady date: 2014-06-30 words: 8498 flesch: 77 summary: Physical parameters studied included physiological loss in weight (PLW), per cent fruit ripening, fruit firmness (kg cm-2), shelf-life (days); physico-chemical parameters included total soluble solids -TSS (%), total sugars (%), reducing sugars (%), acidity (%), ascorbic acid (mg/100 g), and TSS: Acid ratio. Moreover, papaya fruits are delicious and commercially important because of their high nutritive and medicinal value. keywords: fruits; papaya cache: jhs-225.pdf plain text: jhs-225.txt item: #192 of 600 id: jhs-227 author: Ranjitha, K; Murthy, B N S; Suresh, E R title: Evaluation of New Grape Hybrids and French Cultivars for Wine Production date: 2014-06-30 words: 2618 flesch: 61 summary: The must from wine grapes is characterized by pH 3-3.5, titratable acidity 0.5-0.7% and TSS of over than 20°Brix (Amerine and Ough, 1982). Hybrid E28/2 possessed higher must pH than required for wine grapes, while, the other varieties had an optimal must pH ranging from 3.3 to 3.5. TSS of all the varieties was satisfactory, with two varieties, viz., E21/31 and E28/2 having a value as high as 24.6oBrix. keywords: acidity; grape; hybrid; india; quality; wine cache: jhs-227.pdf plain text: jhs-227.txt item: #193 of 600 id: jhs-228 author: Sharma, Deepa; Shukla, Y R; Jarial, Kumud title: Evaluation of Onion Varieties under Low Hill Conditions of Himachal Pradesh date: 2014-06-30 words: 2311 flesch: 62 summary: Varieties Palam Lohit, Nasik Red, N- 53 and Agrifound Dark Red recorded significantly higher bulb yield (275.00, 240.67, 239.25 and 232.37 q/ha, respectively) than the other varieties evaluated. Varieties Palam Lohit, Nasik Red and Agrifound Dark Red had medium bulb size and higher yield. keywords: agrifound; bulb; days; onion; red; varieties cache: jhs-228.pdf plain text: jhs-228.txt item: #194 of 600 id: jhs-229 author: Mohan, N; Aghora, T S; Wani, M A title: Studies on Genetic Variability in Dolichos Bean (Lablab purpureus L.) date: 2014-06-30 words: 2386 flesch: 64 summary: GCV was comparatively high in days to 50% flowering, days to pod maturity, pod length, pod weight, number of pods per cluster, number of pods per plant, pod yield per plant and pod width. High heritability estimates were observed for number of pods per plant, pod yield per plant, pod weight, days to 50% flowering, pod length, days to pod maturity, pod width and number of pods per cluster. keywords: days; iihr; number; plant; pod; pods cache: jhs-229.pdf plain text: jhs-229.txt item: #195 of 600 id: jhs-23 author: S, Jat G; D, Munshi A; K, Behera T; C, Bharadwaj title: Inheritance of parthenocarpy in gynoecious cucumber (Cucumis sativus L.) cultivar PPC-2 date: 2017-12-31 words: 2586 flesch: 55 summary: The segregation of F2 population and test crosses for parthenocarpic fruit development suggested that parthenocarpy in gynoecious and parthenocarpic cucumber line PPC-2 is under the control of incomplete dominant gene. All plants of segregating generations (F2, B1 and B2) along with parents and F1 hybrids were tagged and numbered after transplanting for their individual identity for parthenocarpic fruit development. keywords: cucumber; cucumis; development; fruits; parthenocarpic; plants; ppc-2; pusa cache: jhs-23.pdf plain text: jhs-23.txt item: #196 of 600 id: jhs-230 author: Vipitha, V P; Geethakumari, V L title: Evaluation of Different Organic Manure Mixtures in Vegetable Amaranth Cultivation date: 2014-06-30 words: 2489 flesch: 55 summary: Organic manures improve physical, chemical and biological properties of the soil. Initial increase in available N observed in OM3, OM11 and OM13 was perhaps due to mineralization of the nutrients in organic manures. keywords: cake; content; ha-1; manures cache: jhs-230.pdf plain text: jhs-230.txt item: #197 of 600 id: jhs-231 author: Swetha, S; Padmalatha, T; Rao, K Dhanumjaya; Shankar, A Siva title: Effect of Potting Media on Growth and Quality in Aglaonema date: 2014-06-30 words: 3051 flesch: 67 summary: The hormone- like effect of earthworm casts on plant growth. Improved nutrition from vermicompost changes biochemical properties of a plant like chlorophyll, enzymes, and protein synthesis (Tomati et al, 1995) which could be one of the reasons for high visual plant grade. keywords: cocopeat; fym; ratio; sand; vermicompost cache: jhs-231.pdf plain text: jhs-231.txt item: #198 of 600 id: jhs-232 author: Akshitha, H J; Umesha, K; Shankarappa, T H title: Effects of Type of Cutting, IBA and Bioinoculants on Rooting in Madhunashini (Gymnema sylvestre Retz.) date: 2014-06-30 words: 2147 flesch: 68 summary: Among the three types of cuttings, hardwood cuttings registered higher values for fresh (0.790g/cutting) and dry weight (0.650g/cutting) of sprouts, per cent rooting (6.66 %), fresh and dry weight of roots (0.037 and 0.030g/ cutting) and biomass production (0.682g/cutting). Interaction effect of type of cutting, IBA and bioinoculants on fresh and dry weight of sprouts (2.438g and 2.084g, respectively) and biomass production (2.123g/cutting) was found superior in hardwood cuttings treated with IBA 1000ppm. keywords: cuttings; hardwood; rooting; weight cache: jhs-232.pdf plain text: jhs-232.txt item: #199 of 600 id: jhs-233 author: Shivashankara, K S; Pavithra, K C; Laxman, R H; Sadashiva, A T; Christopher, M George title: Genotypic Variability in Tomato for Total Carotenoids and Lycopene Content during Summer and Response to Post Harvest Temperature date: 2014-06-30 words: 3081 flesch: 63 summary: Genotypic variability in tomato for total carotenoids and lycopene content during summer and response to post harvest temperature K.S. Shivashankara, K.C. Pavithra, R.H. Laxman, A.T. Sadashiva1 and M. George Christopher1 Division of Plant Physiology and Biochemistry ICAR - Indian Institute of Horticultural Research Bengaluru – 560 089, India E-mail: shiva@iihr.ernet.in ABSTRACT Lycopene is the major carotenoid responsible for fruit colour in tomato (Lycopersicon esculentum Mill.). High temperature reduced lycopene content in tomato fruits. keywords: arka; carotenoids; content; iihr; lycopene; temperature; tomato; total cache: jhs-233.pdf plain text: jhs-233.txt item: #200 of 600 id: jhs-234 author: Bhat, P S; Srikumar, K K title: Occurrence of Parasitoid, Leiophron Sp. (Hymenoptera: Braconidae), on Adults of Helopeltis antonii Signoret in Cashew date: 2014-06-30 words: 1410 flesch: 52 summary: Key words: Cashew, Helopeltis antonii, Tea Mosquito bug, parasitoid larvae, biological control nymphal parasitoid and the mermithid nematode, Agamermis paracaudata Steiner, has been reported from H. theivora on tea (Durgadas and Sambhunath, 1956) and H. antonii on cashew (Sundararaju, 2002). H. antonii adults died within 2 days after emergence of the parasitoid. keywords: antonii; cashew; helopeltis; leiophron; parasitoid cache: jhs-234.pdf plain text: jhs-234.txt item: #201 of 600 id: jhs-236 author: Mohan, N; Aghora, T S; Wani, M A; Divya, B title: Garden Pea Improvement in India date: 2013-12-31 words: 30243 flesch: 69 summary: The cross combination PMR-32 x Snow pea revealed significant positive heterosis for number of green pods per plant pod yield per plant over better parents. Rastogi et al (1989) found significant non-additive components in case of protein content in pea seed. 2) Inheritance of quantitative characters The highly heritable polygenic characters are plant height, earliness, number of pods per plant, pod length, seeds per pod and 100 seed weight. keywords: ability; additive; analysis; breeding; characters; combining; cross; days; early; effects; et al; flower; garden pea; gene; green; heritability; heterosis; india; kumar; length; mildew; number; pea; pea seed; peas; pisum; pisum sativum; plant; plant height; pod; pod yield; pods; powdery; resistance; rust; sativum; sci; seed; seed yield; selection; sharma; singh; traits; varieties; variety; weight; yield cache: jhs-236.pdf plain text: jhs-236.txt item: #202 of 600 id: jhs-237 author: Davamani, J; Balamohan, T N; Sudha, R title: Evaluation of Papaya (Carica papaya L.) Hybrids for Yield and Papain Recovery date: 2013-12-31 words: 5098 flesch: 69 summary: Higher fruit yield was recorded in hybrids CO-2 × Fruit yield at first harvest showed high genetic advance as percentage of mean and the least genetic advance was seen for days to flowering. keywords: co-2; co-5; fruit; harvest; heritability; hybrids; nanha; papaya; × pusa cache: jhs-237.pdf plain text: jhs-237.txt item: #203 of 600 id: jhs-238 author: Gill, P P S; Kumar, M; Singh, N P; Dhillon, W S title: Studies on Macronutrient Fertilization in Pomegranate under Sub-Tropical Plains date: 2013-12-31 words: 2608 flesch: 68 summary: Studies on macronutrient fertilization in pomegranate under sub-tropical plains P.P.S. Gill, M. Kumar, N.P. Singh and W.S. Dhillon1 Department of Fruit Science Punjab Agricultural University, Ludhiana-141004, India E-mail: parmpalgill@pau.edu ABSTRACT An investigation was carried out to study the influence of different levels of NPK fertilizers on plant growth, fruit yield and quality, and leaf NPK content in pomegranate cv. Maximum increase in plant growth and fruit yield was recorded in plants receiving NPK @ keywords: fruit; leaf; nitrogen; npk; plant; pomegranate; yield cache: jhs-238.pdf plain text: jhs-238.txt item: #204 of 600 id: jhs-24 author: S, Bhuvaneswari; Sangama, Sangama title: Eco friendly packages for freshness retention and shelf life extension of tuberose flower date: 2017-12-31 words: 1452 flesch: 68 summary: An attempt is made to standardise eco friendly packages such as areca nut sheath cup, banana sheath cup and peepal leaf cup which will retain freshness and extend the shelf life of tuberose flowers. Similarly, fragrance index which is the important quality character was higher in tuberose packaged in areca nut sheath cup (71.21), followed by banana sheath cup (66.67) and peepal leaf cup (66.67) both in ambient and low temperature storage (Table 1 and Table 2). keywords: cup; flowers; index; sheath; tuberose cache: jhs-24.pdf plain text: jhs-24.txt item: #205 of 600 id: jhs-243 author: Khapte, Pratapsingh Suresh; Singh, T H; Sadashiva, A T; Reddy, K Madhavi title: Combining Ability for Yield and Yield-Related Traits in Manjarigota Type Brinjal (Solanum melongena L.) date: 2013-12-31 words: 3107 flesch: 70 summary: Among the 21 F1 crosses evaluated, two crosses, L4xT2 and L3xT3, were found to be good specific combiners for most of the yield contributing traits, viz, fruit length, fruit diameter, number of fruits per plant, fruit yield per plant and plant height. Combining ability and gene action studies for fruit yield and yield contributing traits in brinjal. keywords: ability; combining; fruit; gca cache: jhs-243.pdf plain text: jhs-243.txt item: #206 of 600 id: jhs-244 author: Hedau, N K; Saha, S; Gahalain, A; Kumar, Arun; Agrawal, P K; Bhatt, J C title: Variability for Functional and Nutritional Quality Traits in Sweet Pepper (Capsicum annuum L.) date: 2013-12-31 words: 2976 flesch: 57 summary: Changes in phytochemical and antioxidant activity of selected pepper accessions (Capsicum species) as influenced by maturity. Wide variation was observed in functional quality traits like ascorbic acid content (22-129mg 100g-1), and βββββ-Carotene (0.39-1.0mg 100g-1) suggesting a considerable level of genetic diversity. keywords: accessions; acid; ascorbic; capsicum; carotene; content; pepper; vhc cache: jhs-244.pdf plain text: jhs-244.txt item: #207 of 600 id: jhs-245 author: Tamil Selvi, N A; Jansirani, P; Pugalendhi, L title: Evaluation of F1 Hybrids of Pumpkin (Cucurbita moschata Duch. Ex Poir) for Yield and Quality date: 2013-12-31 words: 6384 flesch: 80 summary: Se x ra tio D ay s to N o. o f Fr ui t Fl es h To ta l To ta l C ru de Fr ui t le ng th 1s t f em al e fo r 1 st 1s t ha rv es t fr ui ts w ei gh t th ic kn es s ca rb oh yd ra te ca ro te no id fib er yi el d fl ow er fe m al e pe r vi ne co nt en t co nt en t co nt en t pe r vi ne ap pe ar an ce fl ow er ap pe ar an ce Li ne Pu sa V is hw as -0 .8 5 ** 3. 35 ** -3 .6 0* * -1 .8 9 ** 10 .2 1* * -1 .3 8 ** 0. 24 * * 3. 40 * * A rk a Su ry am uk hi Pu sa V is hw as x -0 .2 7 ** -0 .2 2 -0 .5 7 0. 29 3. 22 -0 .4 2 0. 45 * * -0 .3 3 -0 .1 0 keywords: avinashi; co-2; hybrids; local cache: jhs-245.pdf plain text: jhs-245.txt item: #208 of 600 id: jhs-25 author: R, Sudha; P, Venkatasalam E; K, Divya; Bairawa, Aarti; Mhatre, Priyank H title: Storage behavior of potato cultivars under ambient conditions in the Nilgiris date: 2017-12-31 words: 4385 flesch: 64 summary: Sci. Vol. 12(2) : 186-192, 2017 Storage behaviour of potato varieties at Nilgiris or regions. The results on different storage 188 Sudha et al parameters and cooking quality of potato varieties are described below. keywords: autumn; crop; days; kufri; loss; potato; storage; summer; varieties; weight cache: jhs-25.pdf plain text: jhs-25.txt item: #209 of 600 id: jhs-26 author: Hanur, Vageeshbabu S title: Research diversity in horticulture date: 2017-12-31 words: 672 flesch: 40 summary: Continuing in vegetable crops, while Sudha et al. assess the importance of storage behaviour of five Kufri potato varieties under Nilgiris conditions, Jat et al. analyze the inheritance of the much desired parthenocarpy in a gynoecious cucumber line to be under the regulation of an incompletely dominant gene. In grapes, Sharma et al. evaluate commercial dipping oil and other potassium salts for the production of good quality raisins. keywords: crops cache: jhs-26.pdf plain text: jhs-26.txt item: #210 of 600 id: jhs-28 author: Thangamani, C; Pugalendhi, L; Punithaveni, V title: Screening wild and cultivated cucurbits against root knot nematode to exploit as rootstocks for grafting in cucumber date: 2018-06-30 words: 4341 flesch: 69 summary: Initial screening studies of root stocks for root knot nematode resistance or tolerance could help in root stock selection. The data wer e a na lysed in AGRES sta tistica l pa cka ge (DOSBox-0.74) developed by TNAU, Coimbatore. RESULTS AND DISCUSSION Rootstocks and scions responded differently for challenge inoculation with root knot nematode (Table 1, 2). keywords: cucumber; cucumis; cucurbita; gourd; knot; melo; nematode; peroxidase; resistance; root; rootstocks; scions cache: jhs-28.pdf plain text: jhs-28.txt item: #211 of 600 id: jhs-30 author: Sathappan, C T title: Effect of plant growth regulators and pinching on growth and flower yield of African marigold (Tagetes erecta L.) date: 2018-06-30 words: 4527 flesch: 75 summary: Sci. Vol. 13(1) : 42-47, 2018 Effect of plant growth regulators and pinching on growth and flower yield of African marigold (Tagetes erecta L.) Plant growth regulators have gained wide acceptance for optimizing the yield of plants by modifying growth, development and stress behavior (Shukla and Farooqi, 1990). keywords: ga3; growth; number; plant; yield cache: jhs-30.pdf plain text: jhs-30.txt item: #212 of 600 id: jhs-300 author: Thomas, Reena Rosy; Chandra Prakash, M K; Reddy, M Krishna; Mohandas, Sukhada; Mahmood, Riaz title: Microsatellite Identification in Solanaceae Crops Associated with Nucleoside Diphosphate Kinase (NDK) Specific to Abiotic Stress Tolerance through in silico Analysis date: 2013-12-31 words: 1879 flesch: 40 summary: Protein BLAST result of C. annuum NDK protein sequence against Arabidopsis thaliana protein sequences Description Max Total Query E Max Accession score score cover value indent Nucleoside diphosphate kinase 1 255 255 100% 7e-87 80% NP_567346.1 [Arabidopsis thaliana] Microsatellite identification in Solanaceae crops associated with Nucleoside Diphosphate Kinase (NDK) specific to abiotic stress tolerance through in silico analysis Reena Rosy Thomas, M.K. Chandra Prakash, M. Krishna Reddy1, Sukhada Mohandas2 and Riaz Mahmood3 Section of Economics & Statistics Indian Institute of Horticultural Research, Hessaraghatta Bangalore -560089, India Email : reenart@hotmail.com ABSTRACT Abiotic stress often causes a series of morphological, physiological, biochemical and molecular changes that affect plant growth, development and productivity. keywords: arabidopsis; diphosphate; kinase; ndk; nucleoside; sequence; stress cache: jhs-300.pdf plain text: jhs-300.txt item: #213 of 600 id: jhs-301 author: Anand, M; Sankari, A; Arulmozhiyan, R title: Evaluation of Commercial Cultivars of Cut Gerbera (Gerbera jamesonii Bolus Ex Hooker F.) under Polyhouse in Shevaroy Condition of Eastern Ghats date: 2013-12-31 words: 2967 flesch: 65 summary: Keeping this in view, 36 cultivars of gerbera were collected and evaluated to identify gerbera cultivars suitable for the region. Evaluation of gerbera cultivars for growth attributes under Shevaroy conditions Cultivars Plant Leaf Leaf Number Number Days spread length width of of taken to (cm) (cm) (cm) leaves/ suckers/ flowering plant plant Aida 56.75 15.00 5.33 16.21 5.58 130.67 Amaretto 59.44 19.00 4.90 18.24 5.58 134.67 Arobella 50.16 21.62 4.00 30.40 5.07 116.67 Avemeria 50.67 22.00 4.50 25.33 4.56 123.67 Blondy 49.76 18.00 3.70 39.52 5.27 139.00 Bondana 42.56 21.00 5.90 27.36 6.49 134.67 Dalma 43.07 15.00 6.10 29.39 5.67 113.67 Dolcerita 38.51 19.50 5.00 31.41 4.05 126.67 Essandre 37.49 21.00 5.00 39.52 3.95 127.67 Florida 58.27 16.50 5.14 22.29 5.98 139.00 Golden Gate 67.04 29.62 7.10 35.46 5.67 115.67 Goldy 59.79 14.00 5.26 29.39 3.55 117.67 Junkfru 66.71 25.00 6.70 38.50 7.60 116.67 Kalika 63.84 16.50 3.50 22.29 3.55 121.33 Lily 42.15 14.10 5.77 29.37 3.98 125.33 Marmara 48.14 16.00 5.90 31.41 4.56 123.67 Marshsal 61.81 23.00 5.50 32.43 3.55 126.67 Mini 53.71 23.00 5.70 25.33 4.56 117.67 Oilila 70.59 25.00 6.40 31.41 6.99 134.67 Oranila 61.98 23.50 3.80 31.41 4.56 109.67 Piton 49.65 21.00 5.40 17.23 3.55 145.00 Red Bull 43.57 23.00 5.90 33.44 4.05 129.67 Red Ventura 63.84 17.50 5.00 23.31 5.32 121.33 Ringo 50.67 21.00 5.10 21.28 4.19 127.67 Rosalin 78.02 23.66 6.50 35.46 6.90 120.33 Rosabella 44.08 22.00 4.40 33.44 3.55 133.67 Ruby Red 59.45 23.00 6.40 33.44 6.48 145.00 Sunway 56.75 17.00 4.83 33.44 4.76 120.33 Skylina 42.56 19.00 5.70 34.45 4.96 129.67 Verseck 45.72 20.00 5.89 24.32 5.21 135.67 Vojavir 50.87 15.25 5.37 20.27 5.20 128.67 Thalassa 57.76 20.00 4.50 29.39 4.66 126.67 Tiffany 38.51 25.00 3.60 21.28 3.55 133.67 White Tibet 71.94 22.50 6.20 41.54 6.18 127.67 Woman 39.52 19.00 4.90 39.52 4.56 134.67 Yanara 41.55 23.50 3.20 23.31 4.05 144.00 SEm 2.3 0.37 0.19 1.27 0.42 5.37 CD (P=0.05) 4.7 0.74 0.39 2.53 0.21 10.72 J. Hortl. keywords: cultivars; flower; gerbera; number; nursery; plant cache: jhs-301.pdf plain text: jhs-301.txt item: #214 of 600 id: jhs-302 author: Mahawer, T C; Mahawer, L N; Bairwa, H L title: Performance of Gladiolus Cultivars under Sub-Humid Southern Plains of Rajasthan date: 2013-12-31 words: 4230 flesch: 69 summary: Sci. Vol. 8(2):204-209, 2013 Performance of gladiolus cultivars under sub-humid southern plains of Rajasthan T.C. Mahawer, L.N. Mahawer and H.L. Bairwa AICRP on Floriculture, Department of Horticulture, RCA Campus Maharana Pratap University of Agriculture and Technology Udaipur - 313001, India E- mail: mahawer68@yahoo.co.in ABSTRACT An investigation was carried out during October 2011 - Corms of gladiolus cultivars were collected from IARI, Pusa, New Delhi; IIHR, Bangalore, and AICRP on Floriculture Project Centre, MPUAT, Udaipur. keywords: days; g-12; gladiolus; iihr; number cache: jhs-302.pdf plain text: jhs-302.txt item: #215 of 600 id: jhs-303 author: Anand, M; Sankari, A; Arulmozhiyan, R title: Performance of Orchid Species in Shevaroy Hills of Eastern Ghats date: 2013-12-31 words: 2415 flesch: 58 summary: However, research work on evaluation of orchid species /commercial hybrids and varieties and their suitability for our conditions is very limited. Hence, the present study was aimed at identifying orchid species suitable for growth and flower yield under Shevaroy hills of Eastern Ghats in South India. keywords: aerides; days; dendrobium; orchid; plant; species cache: jhs-303.pdf plain text: jhs-303.txt item: #216 of 600 id: jhs-304 author: Asangi, Honnappa; Vasundhara, M title: Effect of Pinching and Growth Regulators on Growth, Herbage Yield, Essential Oil Content and Oil Yield of Patchouli (Pogostemon patchouli Pellet.) date: 2013-12-31 words: 2040 flesch: 70 summary: Honnappa Asangi and M. Vasundhara1 University of Horticultural Sciences, Bagalkot KRCCH, Arabhavi - 591218, India E-mail: asangipma@gmail.com ABSTRACT An experiment was conducted to study the effect of growth regulators on plant growth, herbage yield, essential oil content and oil yield in patchouli (Pogostemon patchouli Pellet.) Effect of kinetin and Chlormequat chloride on growth, leaf abscission and essential oil yield in Mentha arvensis. keywords: growth; oil; patchouli; yield cache: jhs-304.pdf plain text: jhs-304.txt item: #217 of 600 id: jhs-305 author: Ranjitha, K; Narayana, C K; Roy, T K title: Aroma Profile of Fruit Juice and Wine Prepared from Cavendish Banana (Musa Sp., Group AAA) Cv. Robusta date: 2013-12-31 words: 4184 flesch: 57 summary: It was found that amyl alcohol, (E,E)- dodeca-8,10-dien-1-ol, 11-tridecyne-1-ol were the major hydroxyl compounds in banana juice, while, amyl alcohol, α-methylphenethyl alcohol, (Z,Z)- dodeca -3, 6-dien-1-ol, etc. were prominent in banana wine. Aroma signature compounds of banana juice, viz., isoamyl acetate, butyl isovalerate, isopentyl isovalerate, trans-2-hexenal, butanoates, etc. were present only in a low proportion in banana wine. keywords: acid; aroma; banana; banana juice; banana wine; compounds; esters; ethyl; fruit; juice; wine cache: jhs-305.pdf plain text: jhs-305.txt item: #218 of 600 id: jhs-306 author: Vasugi, C; Dinesh, M R; Chithiraichelvan, R title: Genetic Diversity in 'Appemidi' Pickle Mangoes date: 2013-12-31 words: 2466 flesch: 65 summary: 96.00 Gurumurthy Appe Oblong Medium Medium 37.50 13.77 2.42 2.62 15.51 27.45 Halasage Oblong Strong Medium 34.54 14.79 2.73 2.41 13.85 106.43 Hittalahalli Appe Oblong On the basis of tender- fruit evaluation, accessions Chansi Appe, Dodderi Jeerige, Mani Bhatta Appe, Gorana Appe, Isagoor Appe, Malange, Gurumurthy Appe and Kashimidi possessed good traits for pickling. keywords: appe; fruit; kannada; karnataka; medium; sirsi; uttara cache: jhs-306.pdf plain text: jhs-306.txt item: #219 of 600 id: jhs-307 author: Simi, S; Rajmohan, K title: Evaluation of Traditional Mango (Mangifera indica L.) Varieties of Southern Kerala date: 2013-12-31 words: 3228 flesch: 68 summary: Sci. Vol. 8(2):228-233, 2013 Short communication 1Dept. of Plant Biotechnology, College of Agriculture, Vellayani, Thiruvananathapuiram, Kerala, India Evaluation of traditional mango (Mangifera indica L.) varieties of southern Kerala S. Simi and K. Rajmohan1 Department of Pomology and Floriculture, College of Horticulture Kerala Agricultural University, Vellanikkara - 680 656, India E-mail: simishibu@gmail.com ABSTRACT Investigations were carried out at the Department of Pomology and Floriculture, College of Agriculture, Vellayani, to characterize traditional mango varieties of southern Kerala, based on utility of fruits. Traditional mango varieties flowering round the year and those with desirable characters like high TSS, reducing sugars, Vitamin C and carotenoids that can be recommended for growing in tropical environment, could be identified in this study. keywords: alappuzha; kerala; local; mango; trivandrum; types; varieties cache: jhs-307.pdf plain text: jhs-307.txt item: #220 of 600 id: jhs-308 author: Das, Sukhen Chandra; Dinesh, M R title: Evaluation of Varieties and Hybrids for Physico-Chemical Characters in Papaya (Carica papaya L.) date: 2013-12-31 words: 1492 flesch: 71 summary: 235 Physico-chemical characters of papaya varieties and hybrids Ghanta (1994) recorded a pulp thickness of 3.10cm in the variety ‘Ranchi’. Highest ascorbic acid content was recorded in hybrid H-39 and in Red Gold, and lowest in the variety ‘Waimanalo’. keywords: fruit; h-39; papaya cache: jhs-308.pdf plain text: jhs-308.txt item: #221 of 600 id: jhs-309 author: Reddy, Y T N; Shivu Prasad, S R; Upreti, K K title: Effect of Paclobutrazol on Fruit Quality Attributes in Mango (Mangifera indica L.) Cv. Totapuri date: 2013-12-31 words: 2438 flesch: 60 summary: Although studies have been conducted on effects of paclobutrazol on fruit quality in other fruit crops, these studies are limited with reference to Indian mango varieties. Key words: Fruit quality, mango, Paclobutrazol farm of Indian Institute of Horticultural Research, Hessaraghatta, Bengaluru, on 19 year old, uniform trees of the regular bearing cv. keywords: content; fruit; mango; paclobutrazol; quality; sugars; total cache: jhs-309.pdf plain text: jhs-309.txt item: #222 of 600 id: jhs-310 author: Senthilkumar, M; Ganesh, S; Srinivas, K; Panneerselvam, P title: Enhancing Growth and Yield in Banana Cv. Robusta (AAA) through Fertigation with Microbial Consortium date: 2013-12-31 words: 4174 flesch: 59 summary: Main plant crop yields were higher compared to that in ratoon. Treatments that received 50% RDF + CBF also yielded on par with plants receiving 75% RDF + CBF. keywords: biofertilizers; cbf; consortium; crop; fertigation; ratoon; rdf cache: jhs-310.pdf plain text: jhs-310.txt item: #223 of 600 id: jhs-312 author: Reddy, Y T N; Kurian, Reju M; Ganeshamurthy, A N; Pannerselvam, P; Shivu Prasad, S R title: Influence of Organic Practices on Growth and Fruit Yield in Papaya Cv. Surya date: 2013-12-31 words: 1791 flesch: 52 summary: Therefore, the present investigation assumes importance for adequately marketing of organic papaya. Surya as influenced by various organic treatments Treatment Plant Plant No. of height (m) girth (cm) leaves /plant T1-100% RDF FYM + 3.53 51.0 45.0 Vermicompost T2 -75% RDF FYM + 3.38 53.7 49.9 Vermicompost T3 -50% RDF FYM + 3.54 54.5 43.5 Vermicompost T4 - T1+AZO+Myco 3.15 54.1 43.0 T5 - T1+AZO+PSB 3.20 49.5 39.8 T6 -T2+AZO+Myco 3.13 52.3 32.9 T7 -T2+ AZO+PSB 3.15 52.9 31.5 T8-T3+AZO+Myco 3.22 50.3 30.9 T9-T3+AZO+PSB+Myco 3.47 45.9 26.6 T10-100% RDF 3.42 48.7 26.8 T11-50% RDF applied as 3.51 52.1 49.0 FYM+ AZO+ keywords: dose; fertilizers; fruit; papaya; plant; yield cache: jhs-312.pdf plain text: jhs-312.txt item: #224 of 600 id: jhs-313 author: Kumar, S Ramesh; Arumugam, T title: Gene Action and Combining Ability Analysis in Brinjal (Solanum melongena L.) date: 2013-12-31 words: 5148 flesch: 79 summary: Analysis of Variance for parents and hybrids for 15 characters Source df PH DFF NB/ P FL FPL FC CL Hybrids 39 346.5306* 54.8730* 17.4039* 5.4570* 1.4005* 9.9952* 1.0970* Lines 9 973.0851* 76.5412* 40.2728* 4.9768* 2.1125* 20.0498* 2.5695* Testers 3 66.6626* 17.7451* 12.1612* 9.7032* 0.4415* 16.6776* 0.5407* Line x Testers 27 168.7756* 51.7756* 10.3635* 5.1453* 1.2698* 5.9011* 0.6680* Errors 78 85.0412 3.3519 4.3914* 0.0933 0.0216 0.4478 0.0424 Source df NF/P AFW SBI FBI LLI ACC TPC FY/P Hybrids 39 161.9557* 149.5525* 54.4746* 63.3535* 69.4393* 12.9752* 533.5026* 0.6288* Lines 9 197.8137* 328.0857* 104.8571* 80.0248* 128.8896* 24.3787* 998.8697* 0.9020* Testers 3 234.2205* 72.4168* 41.9781* From an analysis of the combining ability estimates, it was seen that non-additive gene action operated for all the characters in our study, as, variance due to general combining ability (GCA) and specific combining ability (SCA) was highly significant (Table 2). keywords: fruit; plant cache: jhs-313.pdf plain text: jhs-313.txt item: #225 of 600 id: jhs-314 author: Khosa, J S; Dhatt, A S title: Studies on Genetic Variability and Heritability in Bulb Onion (Allium cepa L.) in North-Western Plains of India date: 2013-12-31 words: 2116 flesch: 58 summary: Sci. Vol. 8(2):255-258, 2013 Short communication Studies on genetic variability and heritability in bulb onion (Allium cepa L.) in North-Western plains of India J.S. Khosa and A.S. Dhatt Department of Vegetable Science Punjab Agricultural University, Ludhiana - 141 004, India E-mail: jiffenvir.pau@gmail.com ABSTRACT A study on genetic variability, heritability and genetic advance was carried out in bulb onion for 13 traits using 43 accessions. Key words: Bulb onion, variance, PCV, GCV, heritability, genetic advance was undertaken to estimate genetic variability and heritability in bulb onion to help plan an efficient breeding programme. keywords: bulb; diameter; heritability; onion; plant cache: jhs-314.pdf plain text: jhs-314.txt item: #226 of 600 id: jhs-315 author: Sharma, Rajender; Shukla, Y R title: Performance of Coloured Bell Pepper in Naturally-Ventilated Polyhouse under Mid-Hill Conditions of Himachal Pradesh date: 2013-12-31 words: 1618 flesch: 64 summary: Mean performance of bell pepper genotypes for various horticultural traits Genotype Plant height Fruit weight No. of fruits Fruit length Fruit width Yield Fruitcolour Fruitshape (cm) (g) per plant (mm) (mm) per ha (t) Capsicums (Capsicum annuum L.), commonly called sweet pepper or bell pepper is the Christmas ornamental of vegetable world with a beautifully shaped glossy exterior that comes in an array of vivid colors ranging from green, red, yellow, orange, purple, brown to black. keywords: bell; fruit; pepper; plant; tanvi cache: jhs-315.pdf plain text: jhs-315.txt item: #227 of 600 id: jhs-316 author: Bhatt, R M; ., Rashmi; Rao, A. D. D. V. S. Nageswara; Laxman, R H; Singh, T H title: Seed Germination and Seedling Growth in Solanum Species to Water Stress under in vitro Conditions date: 2013-12-31 words: 1839 flesch: 58 summary: Here, surface soil often dries up rapidly and prevents seed germination and seedling establishment. Sci. Vol. 8(2):262-267, 2013 Short communication Seed germination and seedling growth in Solanum species to water stress under in vitro conditions R.M. Bhatt, Rashmi, A.D.D.V.S. Nageswara Rao, R.H. Laxman and T.H. Singh Division of Plant Physiology and Biochemistry Indian Institute of Horticultural Research Hessaraghatta lake Post, Bangalore - 560 089, India E-mail: rmbt@iihr.ernet.in ABSTRACT A study on seed germination and seedling growth was conducted with five cultivars of Solanum melongena L. (cvs. keywords: 0.0; arka; germination; water cache: jhs-316.pdf plain text: jhs-316.txt item: #228 of 600 id: jhs-317 author: Sharma, B K; Kushwah, S S; Verma, K S; Singh, O P title: Studies on French Bean (Phaseolus vulgaris L.) Varieties under Different N, P, K and S Levels for Growth, Yield and Economics date: 2013-12-31 words: 1733 flesch: 68 summary: With these facts in view, a field experiment was conducted to evaluate performance of French bean varieties under different fertilizer levels. Growth performance and yield of French bean varieties as influenced by different fertilizer levels. keywords: bean; npks; plant; yield cache: jhs-317.pdf plain text: jhs-317.txt item: #229 of 600 id: jhs-318 author: Singh, Parget; Dubey, R K; Singh, Ranjit; Kumar, Ramesh title: Evaluation of Floribunda Rose (Rosa hybrida L.) Cultivars for Landscape Use under Punjab Condition date: 2013-12-31 words: 3056 flesch: 74 summary: Rose cultivars were collected from various sources like Directorate of Floricultural Research, IARI, New Delhi, and from private nurseries and included cvs. Singh (1995) also reported seed- set in rose cultivars under Punjab conditions. keywords: cultivars; flower; group; plant; red cache: jhs-318.pdf plain text: jhs-318.txt item: #230 of 600 id: jhs-319 author: Raveendra, Y C; Shirol, A M; Kulkarni, B S title: Effect of Plant Growth Regulators on Growth and Yield of Daisy (Aster amellus L.) Cv. Dwarf Pink date: 2013-12-31 words: 1266 flesch: 67 summary: Plant growth promoting brassinosteroids. Effect of plant growth regulators on growth and yield of daisy (Aster amellus L.) cv. keywords: acid; days; growth; plant cache: jhs-319.pdf plain text: jhs-319.txt item: #231 of 600 id: jhs-32 author: Naik, Kirtimala B; Nataraj, S K; Shadakshari, Y G; Kumar, D P; Seetharamu, G K; Jayaprasad, K V title: Effect of pre harvest foliar spray of growth regulators on pre and post harvest parameters in ornamental sunflower genotype M-17R date: 2018-06-30 words: 4690 flesch: 72 summary: ABSTRACT An experiment was conducted to study the effect of pre harvest foliar application of growth regulators on the pre and post harvest flower quality in ornamental sunflower during the year 2012-13, at College of Horticulture, GKVK campus, UHS, Bagalkot. An experiment was conducted to study the effect of pre harvest foliar application of growth regulators on the pre and post harvest flower quality in ornamental sunflower. keywords: application; flower; growth; ppm; silicate; sodium cache: jhs-32.pdf plain text: jhs-32.txt item: #232 of 600 id: jhs-320 author: Kayalvizhi, K; Arulmozhiyan, R; Sankari, A; Anand, M title: Influence of Potting Media on Growth of Asparagus densiflorus 'Meyersii' date: 2013-12-31 words: 2730 flesch: 64 summary: Commonly used growth media containing soil, sand and FYM lead to compaction of this crop having fleshy and sensitive fibrous roots. Uniform sized young plants of 15cm height Influence of potting media on growth of Asparagus densiflorus ‘Meyersii’ K. Kayalvizhi, R. Arulmozhiyan, A. Sankari and M. Anand Horticultural Research Station, Yercaud - 636 602, India E-mail: arulmozhiyan@yahoo.co.in ABSTRACT A study was conducted on the influence of growth media on development of Asparagus densiflorus ‘Meyersii’ at Horticultural Research Station, Yercaud during the years 2011-12. keywords: fym; growth; media; sand; soil; vermicompost cache: jhs-320.pdf plain text: jhs-320.txt item: #233 of 600 id: jhs-327 author: Sahijram, Leela; Soneji, Jaya R; Naren, Anitha; Rao, B Madhusudhana title: Hybrid Embryo Rescue: A Non-Conventional Breeding Strategy in Horticultural Crops date: 2013-06-30 words: 12602 flesch: 57 summary: A review of plant embryo culture. Embryo culture is one of the earliest forms of in vitro culture applied to practical problems and is probably the tissue culture technique that has proven of greatest value to breeders (Dunwell, 1986). keywords: breeding; crops; crosses; culture; development; dwarf; embryo; embryo culture; embryo rescue; fruit; germination; hybrid; india; interspecific; leela; leela sahijram; mango; medium; plant; plantlets; sahijram; sci; seedless; species; vitro cache: jhs-327.pdf plain text: jhs-327.txt item: #234 of 600 id: jhs-328 author: Saini, Rajiv; Sidhu, A S; Singh, Daljeet; Kumar, Ajay title: Studies on Genetic Diversity in Growth, Yield and Quality Traits in Tomato (Lycopersicon esculentum Mill.) date: 2013-06-30 words: 2320 flesch: 65 summary: Positive indirect effect was recorded in the case of number of flower- clusters per plant (via fruit number), number of fruit-clusters per plant (via fruit number), number of fruits per cluster (via fruit number) and fruit weight via number of fruits per cluster. A wide range of variability was recorded for number of fruits per plant (10.0-62.8), yield per plant (0.34-1.56kg), fruit weight (22.4-66.4g), number of fruit clusters per plant (4.8-22.2) and number of flower clusters per plant (12.2- 1Indian Institute of Horticulture Research, Hessaraghatta, Bangalore-560089, Karnataka 2Farm Advisory Service Scheme, Amritsar-143001, Punjab J. Hortl. keywords: clusters; fruit; number; plant; sel; yield cache: jhs-328.pdf plain text: jhs-328.txt item: #235 of 600 id: jhs-330 author: Somkuwar, R G; Satisha, J; Ramteke, S D title: Berry Weight, Quality and Cane Biochemistry Changes in Relation to Cane Thickness of Own-Rooted and Grafted 'Tas-A-Ganesh' Grape date: 2013-06-30 words: 3498 flesch: 67 summary: Biochemical parameters such as content of reducing sugars, carbohydrat and phenols were higher in grafted vines of cane thickness >10mm. Berries on grafted vines recorded lower TSS than on own-rooted vines. keywords: berry; cane; content; grape; thickness; vines cache: jhs-330.pdf plain text: jhs-330.txt item: #236 of 600 id: jhs-331 author: Kaur, Mandeep; Gill, M I S; Arora, N K title: Effect of Pre-Harvest Treatment on Yield, Maturity and Quality of Flame Seedless Grape (Vitis vinifera L.) date: 2013-06-30 words: 4420 flesch: 68 summary: Hyun et al (1996) also reported higher bunch weight with Ethephon treatment at veraison in Kyoho grapes. Changes in composition and colour development of ‘Trempranillo’ grapes during ripening induced by Ethephon treatments at véraison. keywords: crop; crop load; effect; ethephon; girdling; grape; load; seedless; treatment cache: jhs-331.pdf plain text: jhs-331.txt item: #237 of 600 id: jhs-332 author: Bhardwaj, R L title: Effect of Growth Media on Seed Germination and Seedling Growth in Papaya (Carica papaya L.) Cv. Red Lady date: 2013-06-30 words: 3815 flesch: 61 summary: Growth medium directly affects seed germination, seedling growth, development and, later, maintenance of the extensively functional rooting system. Sci. Vol. 8(1):41-46, 2013 Effect of growth media on seed germination and seedling growth in papaya (Carica papaya L.) cv. keywords: cocopeat; germination; growth; pond soil; sand; soil cache: jhs-332.pdf plain text: jhs-332.txt item: #238 of 600 id: jhs-333 author: ., Babita; Rana, Vishal S title: Effect of Dormex on Bud-Break, Flowering and Yield in Kiwifruit Cv. Hayward in Mid-Hill Zone of Himachal Pradesh date: 2013-06-30 words: 2314 flesch: 71 summary: Application of 4% Dormex on 10th February, i.e., 40 days prior to anticipated date of natural bud-break, resulted in advancement of bud break and floral-bud emergence by seven days, fruit-set by five days and increase in flowering period by five days. Effect of hydrogen cyanamide on bud break, fruit break, fruit weight and maturation of ‘Hayward’ kiwifruit. keywords: break; bud; days; dormex; kiwifruit; yield cache: jhs-333.pdf plain text: jhs-333.txt item: #239 of 600 id: jhs-334 author: Chao, Hsiu- Fung; Yen, Yung- Fu title: Effects of Cucumis and Cucurbita Rootstocks on Vegetative Traits, Yield and Quality in 'Tainan No. 1' Cucumber date: 2013-06-30 words: 2335 flesch: 59 summary: Cucumber grafted onto Cucumis rootstock showed good rootstock- scion combination, better tolerance to soil-borne diseases, better growth, yield and quality. Results revealed that both kinds of grafted plants had similar graft-survival rate, and, better vegetative growth than non-grafted ones; however, between the two rootstocks, grafted plants did not differ in vegetative growth or yield. keywords: cucumber; cucumis; cucurbita; fruit; grafting; plants; rootstock cache: jhs-334.pdf plain text: jhs-334.txt item: #240 of 600 id: jhs-335 author: Kashinath, B L; Ganesha Murthy, A N; Senthivel, T; Pitchai, G James; Sadashiva, A T title: Effect of Applied Magnesium on Yield and Quality of Tomato in Alfisols of Karnataka date: 2013-06-30 words: 3231 flesch: 60 summary: Acidity and Ascorbic Acid Applied Mg significantly influenced acidity and ascorbic acid content in tomato during the two years of experimentation (Tables 6 & 7) Similar to acidity, highly significant difference in ascorbic acid content in tomato was observed among different treatments (Table 7). keywords: content; harvest; rdf+mgso; tomato; year cache: jhs-335.pdf plain text: jhs-335.txt item: #241 of 600 id: jhs-336 author: Prabhakar, M; Hebbar, S S; Nair, A K title: Influence of Various Sources and Levels of Fertilizer Applied through Fertigation on Hybrid Watermelon Grown in Rabi-Summer date: 2013-06-30 words: 2856 flesch: 50 summary: Higher yield obtained with fertigation treatments may be because of better growth, higher photosynthetic-surface area coupled with better yield attributes such as number of fruits per plant and larger fruit size. In general, fertigation treatments recorded higher values for number of fruits per plant, fruit weight and total soluble solids than conventional soil- application of fertilizers. keywords: application; dose; fertigation; fertilizers; treatments; watermelon; yield cache: jhs-336.pdf plain text: jhs-336.txt item: #242 of 600 id: jhs-337 author: Jawaharlal, M; Visalakshi, M; Cintu, S; Ganga, M title: Standardization for Drying, Bleaching and Dyeing Processes in Dried Flowers date: 2013-06-30 words: 3091 flesch: 59 summary: In the global market, USA, Germany and United Kingdom are the largest consumers of dried flowers. Globally, India has emerged as a leader in export of dried-flower products, trading dried flowers worth Rs 150 crores annually (Patil, 2007). keywords: bleaching; drying; dye; flowers; hcl; leaves; pods; sand cache: jhs-337.pdf plain text: jhs-337.txt item: #243 of 600 id: jhs-34 author: Shilpa, P; Sankar, Mini; Sudhadevi, P K; Geetha, C K; Vijayaraghavan, Reshmi title: Morphophysiological characters of Dendrobium var. Yellow Splash as influenced by bioinoculants and different levels of benzyladenine date: 2018-06-30 words: 4797 flesch: 70 summary: u m inoc u la t ion a nd nit r ogen fertilizer on plant growth promotion and yield response of the blanket flower Gaillardia pulchella. Inocula tion with a ssocia tive nitrogen fixing bacteria: role in cereal grain p r odu c t ion imp r ovement . keywords: amf; azospirillum; benzyladenine; plants; ppm; root cache: jhs-34.pdf plain text: jhs-34.txt item: #244 of 600 id: jhs-340 author: Yogeesha, H S; Kashinath, B L; Bhanuprakash, K; Naik, L B title: Seed Quality Improvement in Okra through Specific Gravity Separation date: 2013-06-30 words: 2326 flesch: 63 summary: Black seed content in heavy seed fraction was significantly low, thereby improving seed quality. Key words: Okra, specific gravity separation, seed quality, black seed J. Hortl. keywords: fraction; germination; gravity; seed; separation cache: jhs-340.pdf plain text: jhs-340.txt item: #245 of 600 id: jhs-341 author: Joshi, Veena; Reddy, S Amarender; Kumar, Vinod; Rao, B Srinivas title: Improvement in Quality of Wine by Blending White and Coloured Grapes date: 2013-06-30 words: 4520 flesch: 69 summary: Another objective of blending wines is to optimize use of certain grape varieties to cut production costs (Escudero-Gilete et al, 2010) Most studies in literature on wine blending are based on sensorial attributes (Datta and Nakai, 1992; Monagas et al, 2006; Monagas et al, 2007). Blending wines is a complex process demanding great rigour. keywords: blanc; blue; chenin; red; ruby; shiraz; wine cache: jhs-341.pdf plain text: jhs-341.txt item: #246 of 600 id: jhs-342 author: Prakash, M K Chandra; Thomas, Reena Rosy; Reddy, M Krishna; Mohandas, Sukhada title: Evidence for Molecular Evolutionary Conservedness of Small Heat-Shock Protein Sequence in Solanaceaeous Crops Using in silico Methods date: 2013-06-30 words: 2218 flesch: 56 summary: The above cladogram from EMBL shows that sHSP sequence is conserved in most of the Solanaceae species. Multiple sequence alignments of sHSP sequence and its conservedness is given below: Visual depiction of alignment in Fig. keywords: annuum; capsicum; heat; mrna; sequence; shock; solanum cache: jhs-342.pdf plain text: jhs-342.txt item: #247 of 600 id: jhs-343 author: Sandhu, Savreet title: Improving Lemon [Citrus limon (L.) Burm.] Quality Using Growth Regulators date: 2013-06-30 words: 2080 flesch: 61 summary: Substantial improvement in fruit quality could be achieved with growth regulator treatment. NAA at 40ppm proved to be the best treatment for managing fruit cracking and improving fruit quality. keywords: cracking; fruit; growth; lemon; naa; quality cache: jhs-343.pdf plain text: jhs-343.txt item: #248 of 600 id: jhs-344 author: Sharma, Lakesh K; Dhaliwal, H S title: Germination and Growth of Rough Lemon (Citrus jambhiri Lush.) Seedlings under Protected Environment date: 2013-06-30 words: 2796 flesch: 58 summary: Rough lemon seeds were extracted from healthy fruits collected from single-tree source and treated with Ridomil MZ 72 WP. Therefore, a study was designed to compare growth of direct-sown and transplanted rough lemon seedlings under controlled conditions. keywords: citrus; conditions; house; seeds; sowing cache: jhs-344.pdf plain text: jhs-344.txt item: #249 of 600 id: jhs-345 author: Gonge, A P; Patel, N L; Ahlawat, T R; Patil, S J title: Effect of Maturity and Storage Temperature on Shelf-Life and Quality of Banana Cv. Grand Naine date: 2013-06-30 words: 2777 flesch: 65 summary: Grand Naine Level of maturity Storage temperature (T) Mean T 1 T 2 T 3 T 4 M 1 35.00 27.67 21.00 9.33 23.25 M 2 28.67 24.33 16.00 8.33 19.33 M 3 26.00 21.00 14.00 6.67 16.92 Mean 29.89 24.33 17.00 8.11 Source M T M x T S. Em± 0.12 0.14 0.24 CD (P=0.05) 0.34 0.40 0.69 CV% 2.06 Table 2. Grand Naine Level of maturity Storage temperature (T) Mean T 1 T 2 T 3 T 4 M 1 10.00 12.00 7.00 4.00 8.25 M 2 8.33 10.33 6.00 3.33 7.00 M 3 8.00 7.00 5.00 3.33 5.83 Mean 8.78 9.78 6.00 3.56 Source M T M x T S. Em± 0.13 0.15 0.25 CD (P=0.05) keywords: banana; life; maturity; storage; temperature cache: jhs-345.pdf plain text: jhs-345.txt item: #250 of 600 id: jhs-347 author: Shukla, Y R; Chhopal, Thuktan; Sharma, Rajender title: Effect of Age of Transplants on Fruit and Seed Yield of Tomato (Solanum lycopersicum L.) date: 2013-06-30 words: 2593 flesch: 66 summary: Maximum seed yield (82.22g/plot) observed in T 7 (33 days old) was significantly superior to that in all other treatments. However, maximum seed yield per plot was produced by middle-aged transplants, while, minimum by younger transplants. keywords: days; seed; transplants; yield cache: jhs-347.pdf plain text: jhs-347.txt item: #251 of 600 id: jhs-348 author: Ganiger, Vasant M; Mathad, J C; Madalageri, M B; Hebasur, N S; Bhuvaneswari, G title: Effect of Organic Cultivation of Capsicum annuum L. on Soil Microbial Properties under Open-Field and Shade-House Conditions date: 2013-06-30 words: 2798 flesch: 58 summary: Results indicated that organic sources of nutrients significantly influenced soil mycorrhizal count as well as dehydrogenase activity compared to inorganic sources. Hence, the present study was undertaken with to assess the response of bell pepper to organic sources of nutrients in relation to biological status of the soil. keywords: bell; count; soil cache: jhs-348.pdf plain text: jhs-348.txt item: #252 of 600 id: jhs-349 author: Saraswathi, T; Praneetha, S title: Effect of Biostimulants on Yield and Quality in Tomato date: 2013-06-30 words: 2081 flesch: 62 summary: Salicylic acid spray may have increased the level of auxin which, in turn, could have increased plant height. Results also revealed comparable performance of panchakavya over salicylic acid and nitrobenzene indicating, that, panchakavya can be utilized as an organic component to increase yield in tomato. keywords: acid; foliar; nitrobenzene; panchakavya; plant; spray cache: jhs-349.pdf plain text: jhs-349.txt item: #253 of 600 id: jhs-35 author: Vidya, S M; Ravishankar, K V; Laxman, R H title: Genome wide analysis of heat responsive microRNAs in banana during acquired thermo tolerance date: 2018-06-30 words: 5101 flesch: 61 summary: Differential expression of miRNAs was seen in response to heat stress in wheat and banana revealed through high-throughput transcriptome sequencing (Xin et al., 2010). , heat stress is a serious threat to yield and affects productivity. keywords: analysis; banana; et al; expression; figure; genes; heat; heat stress; induction; mirnas; plant; protein; stress; target; thermotolerance; ttt cache: jhs-35.pdf plain text: jhs-35.txt item: #254 of 600 id: jhs-351 author: Kumar, Rajiv title: Studies on Genetic Variability in Gerbera (Gerbera jamesonii Bolus Ex. Hooker F.) date: 2013-06-30 words: 1781 flesch: 51 summary: High heritability, coupled with high genetic advance over per cent of mean, was observed for number of leaves/plant, leaf length, leaf width, days to bud-burst, days to first-flower opening, disc diameter, flower-stalk length, number of ray florets per flower head with length and width of ray florets. High genetic advance was observed for number of leaves/plant, leaf length, leaf width, days to bud-burst, days to first-flower opening, disc diameter, flower-stalk length, number of ray florets/flower head, and length and width of ray florets. keywords: flower; heritability; length; number; plant cache: jhs-351.pdf plain text: jhs-351.txt item: #255 of 600 id: jhs-352 author: Amingad, Varun S; Rao, T Manjunatha; Venugopalan, R; Kumar, D P; Dhananjaya, M V; Bhanuprakash, K title: Effect of Temperature and Period of Storage on Breaking Dormancy in Gladiolus (Gladiolus grandiflorus Hort.) Corms date: 2013-06-30 words: 2216 flesch: 66 summary: Days to sprouting Data presented in Table 1 reveal that minimum number of days taken to sprout was recorded in ‘Kum Kum’ (42.7 days), followed by ‘Arka Amar’ (58.8 days) and ‘Darshan’ (74.6 days). Days to spike emergence Interaction between storage temperature and duration of storage showed significant difference for days to spike emergence (Table 1). keywords: corms; days; kum; number cache: jhs-352.pdf plain text: jhs-352.txt item: #256 of 600 id: jhs-353 author: Naidu, L Naram; Purushotham, K title: Evaluation of Turmeric (Curcuma longa L.) Varieties for Rainfed Cultivation date: 2013-06-30 words: 2088 flesch: 66 summary: Correlation studies (Table 2) revealed fresh yield to be positively correlated to number of tillers and number of leaves, while yield of cured rhizomes was significantly influenced by per cent curing, yield of fresh rhizomes and number of leaves. Cultivars PTS-24 and CLL-326 recorded highest mean yield of both fresh and cured rhizomes. keywords: cultivars; yield cache: jhs-353.pdf plain text: jhs-353.txt item: #257 of 600 id: jhs-354 author: Rao, S Narasimha; Kumar, K Ravinder title: Evaluation of Fungicides against Leaf Blotch of Turmeric Caused by Taphrina maculans Butler date: 2013-06-30 words: 2191 flesch: 61 summary: Hence, the present field trial was conducted for managing leaf blotch disease in turmeric using new systemic fungicides. Butler & Bisby] Evaluation of fungicides against leaf blotch of turmeric caused by Taphrina maculans Butler S. Narasimha Rao and K. Ravinder Kumar1 Dr. Y.S.R. Horticultural University Horticultural Research Station, Darsi -523247, India E-mail : varsha.snrao@gmail.com ABSTRACT A field experiment was conducted in the first fortnight of July 2008, 2009 and 2010 at Horticultural Research Station, Jagtial, and in 2010-2011 at Turmeric Research Station, Kammarpally, to evaluate various fungicides against leaf blotch of turmeric. keywords: application; dap; disease; foliar; leaf; spray; turmeric cache: jhs-354.pdf plain text: jhs-354.txt item: #258 of 600 id: jhs-357 author: Kotur, sS C title: Isotope-Aided Research in Fruit and Vegetable Crops date: 2012-12-31 words: 10065 flesch: 55 summary: Generally, a period of high root activity alternated with shoot growth except in guava, in which, both the periods of high root activity and shoot activity coincided. These results are valid for practical management of other fertilizers too, since, nutrient absorption presupposes prevalence of high root activity in the zone of placement at the time of fertilizer application. keywords: activity; banana; crops; fertilizer; fruit; isotope; iyengar; keshava; kotur; mango; murthy; placement; root; sci; soil; use cache: jhs-357.pdf plain text: jhs-357.txt item: #259 of 600 id: jhs-361 author: Kotur, S C title: Effect of Paclobutrazol Application on Nutrient Dynamics, Vigour and Fruit Yield in 'Alphonso' Mango (Mangifera indica L.) date: 2012-12-31 words: 2539 flesch: 63 summary: Nutrient content in different parts of mango tree: Earlier studies have been confined to nutrient composition of the leaf (Reiger, 1990; Werner, 1993). In the case of K, Ca, Mg and S, Paclobutrazol treated trees showed significantly higher values than ‘control’ trees in all plant parts. keywords: content; fruit; mango; paclobutrazol; tree cache: jhs-361.pdf plain text: jhs-361.txt item: #260 of 600 id: jhs-363 author: Jyothi, H K; Patil, M G; Santhosha, H M title: Studies on Stability of Processing-type Genotypes of Tomato (Solanum lycopersicum L.) date: 2012-12-31 words: 2448 flesch: 74 summary: Yield stability differences among tomato genotypes grown in Latin America and the Caribbean. Performance of various tomato genotypes (CV values) Sl. keywords: genotypes; stability; tomato cache: jhs-363.pdf plain text: jhs-363.txt item: #261 of 600 id: jhs-364 author: Singh, Kuldeep; Sidhu, A S; Kumar, Ajay title: Heterosis for Fruit Yield and its Components in Brinjal (Solanum melongena L.) date: 2012-12-31 words: 1870 flesch: 75 summary: Pb Neelam -1.885 -43.749** 35.997** -21.797** 45.632 -16.290** x Pb Barsati -5.866 keywords: aruna; fruit; heterosis; neelam cache: jhs-364.pdf plain text: jhs-364.txt item: #262 of 600 id: jhs-365 author: Bhushan, Bharat; Sidhu, A S; Dhatt, A S; Kumar, Ajay title: Studies on Combining Ability for Yield and Quality Traits in Brinjal (Solanum melongena L.) date: 2012-12-31 words: 7473 flesch: 78 summary: 28 -1 .6 2 * * -1 3. 31 0. 14 -0 .3 7 -0 .5 1 -8 .2 5 * * -7 .3 6 * * IV B R -3 -0 .9 7 -0 .4 6 -2 0 .8 1 * * -1 .3 7 * * 0. 71 ** 0. 91 1. Ingale and Patil (1997) and Varshney et al (1999) also found significant estimates for specific combining ability effects of crosses made for fruit diameter. keywords: ability; combining; fruit cache: jhs-365.pdf plain text: jhs-365.txt item: #263 of 600 id: jhs-367 author: Resmi, J; Sreelathakumary, I title: Studies on Genetic Divergence in Bitter Gourd (Momordica charantia L.) date: 2012-12-31 words: 2095 flesch: 54 summary: Bitter gourd crop improvement programmes need an understanding of the nature and degree of genetic divergence available in the germplasm. Therefore, the present investigation was carried out to examine the nature and magnitude of genetic divergence in 33 bitter gourd genotypes with different geographical origins and distribution. keywords: cluster; fruit; genotypes; gourd cache: jhs-367.pdf plain text: jhs-367.txt item: #264 of 600 id: jhs-368 author: Ganiger, Vasant M; Mathad, J C; Madalageri, M B; Babalad, H B; Bhuvaneswari, G title: Effect of Organics and Inorganics on Yield Parameters in Bell Pepper under Open Condition date: 2012-12-31 words: 3391 flesch: 60 summary: The treatment combination of basal application of N (150kg/ha) equivalent to FYM 50% and poultry manure 50% in the variety California Wonder significantly improved fruit yield and yield attributing factors like weight of 10 fruits, number of fruits per plant and seed weight per fruit. California Wonder produced heavier fruits (621.5 g/10 fruits) and highest fruit yield (423.30 g/plant) over the Local cultivar (254.56 g/10 fruits and 332.20g, respectively). keywords: bell; fruit; pepper; yield cache: jhs-368.pdf plain text: jhs-368.txt item: #265 of 600 id: jhs-369 author: Manohar, S; Choudhary, M R; Yadav, B L; Dadheech, S; Singh, S P title: Analyzing the Efficacy of Organic and Inorganic Sources of Nitrogen and Phosphorus on Growth of Ashwagandha (Withania somnifera Dunal.) date: 2012-12-31 words: 3402 flesch: 58 summary: Positive response by application of inorganic fertilizers on root yield in ashwagandha was also reported by Muthumanickam et al (2002) and Pakkiyanathan et al (2004). This is also supported by existence of significant positive correlation between these soil parameters and root yield. keywords: ha-1; root; yield cache: jhs-369.pdf plain text: jhs-369.txt item: #266 of 600 id: jhs-370 author: Bhardwaj, R L; Mukherjee, S title: Studies on Physico-Chemical, Sensory and Microbiological Quality of Kinnow Juice Blends under Refrigerated Storage date: 2012-12-31 words: 5817 flesch: 66 summary: The juice blend Kinnow juice 87%+Pomegranate juice 10% + Ginger juice 3%, and followed by Kinnow juice 92% + Aonla juice 5% + Ginger juice 3%, processed at 75oC for 15 minutes with 750 ppm potassium meta-bi-sulphite proved to be the most effective treatment for superior physico-chemical and sensory score of the juice blends. Key words: Kinnow juice, juice blends, microbial quality, physico-chemical properties, ready-to-serve J. Hortl. keywords: blends; ginger; juice; kinnow; kinnow juice; potassium; processing; storage; x102; x103 cache: jhs-370.pdf plain text: jhs-370.txt item: #267 of 600 id: jhs-371 author: Jayashree, E; Zachariah, T John; Evangelin, F P P; Bhai, R Susheela title: Qualitative Changes during Storage of Different Ginger-Based Spice Sauces date: 2012-12-31 words: 4146 flesch: 67 summary: Sensory score of the sauces showed that acceptability was high for ginger sauce, followed by ginger-black pepper and ginger-nutmeg sauce. MATERIAL AND METHODS Studies on storage of ginger sauces were conducted during September 2010 at IISR, Peruvannamuzhi Farm, Kozhikode, Kerala. keywords: content; days; ginger; period; sauce; storage; total cache: jhs-371.pdf plain text: jhs-371.txt item: #268 of 600 id: jhs-372 author: Jawaharlal, M; Thamaraiselvi, S P; Ganga, M title: Packaging Technology for Export of Jasmine (Jasminum sambac Ait.) Flowers date: 2012-12-31 words: 9939 flesch: 63 summary: Economics of export packaging technology per kilogram of J. sambac flowers (tested for Long distance market - New Jersey, US) Particulars of packaging per kg of flowers Cost (Rs.) Conclusion From the present investigation, it may be concluded that for the export of J. sambac flowers, a packaging technology of treatment with 4% boric acid + packing in aluminum-foil lined boxes and, further packaging in Thermocol under gel-ice cold condition, was found to be highly suitable. keywords: flowers; packaging cache: jhs-372.pdf plain text: jhs-372.txt item: #269 of 600 id: jhs-373 author: Sudha, R; Balamohan, T N; Soorianathasundaram, K title: Effect of Foliar Spray of Nitrogenous Chemicals on Flowering, Fruit Set and Yield in Mango (Mangifera indica L.) Cv. Alphonso date: 2012-12-31 words: 2556 flesch: 70 summary: Potassium nitrate is a universal rest-breaking agent in deciduous fruit trees (Erez and Lavee, 1974) that may simply hasten flower emergence of a differentiated, but dormant, mango bud. Recent advances in breaking the dormancy of deciduous fruit trees. keywords: chemicals; flowering; fruit; kno; mango cache: jhs-373.pdf plain text: jhs-373.txt item: #270 of 600 id: jhs-374 author: Khan, Hanif; Samadia, D K title: Variability and Association Studies in Tomato Germplasm under High-Temperature Arid Region date: 2012-06-30 words: 3331 flesch: 58 summary: Hence, selection for early flowering and higher fruit weight and number of fruits per plant can indirectly help improve fruit yield per plant. PCV and GCV were high for fruit weight, number of fruits per plant, plant height and fruit yield per plant. keywords: days; fruit; number; plant; tomato; variability; weight; yield cache: jhs-374.pdf plain text: jhs-374.txt item: #271 of 600 id: jhs-375 author: Pitchaimuthu, M; Dutta, O P; Swamy, K R M title: Studies on Inheritance of Geneic Male Sterility (GMS) and Hybrid Seed Production in Okra [Abelmoschus esculentus (L.) Moench.] date: 2012-12-31 words: 2148 flesch: 67 summary: Sci. Vol. 7(2):199-202, 2012 201 In male sterile plants, anthesis was normal but anther dehiscence was partial, showing a small, longitudinal slit without pollen shed. Field designs for maximizing hybrid seed yield using male sterile lines under natural cross – pollination have been standardized , and combining ability of the parents using male sterile lines has been worked out (Pitchaimuthu and Dutta, 2002) keywords: iihr; male; ms-1 cache: jhs-375.pdf plain text: jhs-375.txt item: #272 of 600 id: jhs-376 author: Prakash, D P; Deepali, B S; Ramachandra, Y L; Anand, Lalitha; Hanur, Vageeshbabu S title: Effect of Age and Size of Hypocotyl Explant on in vitro Shoot Regeneration in Eggplant date: 2012-12-31 words: 1631 flesch: 54 summary: Similarly, Frary and Earle (1996) reported reduction in shoot regeneration response with increasing or decreasing size of explants, whereas, 1 cm long hypocotyl explants were optimum for shoot regeneration in tomato (Bhatia et al, 2004). However, no effort has been made to assess and document the effect of age and size of explant on shoot regeneration response in eggplant. keywords: explants; hypocotyl; regeneration; response; shoot cache: jhs-376.pdf plain text: jhs-376.txt item: #273 of 600 id: jhs-377 author: Sankari, A; Anand, M; Arulmozhiyan, R title: Evaluation of Gladiolus Cultivars in Eastern Ghats of Tamil Nadu date: 2012-12-31 words: 2125 flesch: 67 summary: Sci. Vol. 7(2):206-208, 2012 Evaluation of gladiolus cultivars in Eastern Ghats of Tamil Nadu A. Sankari, M. Anand and R. Arulmozhiyan Horticultural Research Station, Yercaud-636 602 Tamil Nadu, India E-mail: sathatnau@yahoo.co.in ABSTRACT Gladiolus grandiflorus L. genotypes were evaluated for growth and floral parameters in Eastern Ghats of Tamil Nadu, under Yercaud conditions. Sci. Vol. 7(2):206-208, 2012 Evaluation of gladiolus cultivars in Eastern Ghats 208 per plant, were recorded and analyzed statistically for assessing suitability of the cultivars for cultivation in Yercaud region of Tamil Nadu. keywords: corm; cultivars; gladiolus; number; pusa cache: jhs-377.pdf plain text: jhs-377.txt item: #274 of 600 id: jhs-378 author: Singh, Neerja title: Effect of Indole Butyric Acid (IBA) Concentration on Sprouting, Rooting and Callusing Potential in Bougainvillea Stem Cuttings date: 2012-12-31 words: 1112 flesch: 64 summary: Louise Wathen cuttings treated with 1000ppm IBA were superior in response with 85.39% sprouting, 75.46% rooting and 80.78% callusing. Hardwood cuttings of Louise Wathen treated with 1000ppm IBA were found to be significantly superior to rest of the treatments with respect to sprouting (85.39%), rooting (75.46%), callusing (80.78%) and establishment (190%). keywords: cuttings; iba; rooting cache: jhs-378.pdf plain text: jhs-378.txt item: #275 of 600 id: jhs-379 author: Bandi, Bhavya; Parmar, B R; Parmar, S B; Parmar, Kruti title: Effect of Auxins on Shoot and Root Growth in an Endangered Medicinal Plant Guggal [Commiphora wightii (Arnott.) Bhand.] date: 2012-12-31 words: 1573 flesch: 68 summary: Effect of PGRs on shoot growth parameters in guggal cuttings PGR concentration (mg l-l) Number of Number of Number of leaves Length of Diameter of days taken shoots per in longest longest shoot longest shoot to sprout cutting shoot (cm) (mm) T 1 ( Data on root and shoot growth were recorded at 120 days after planting. keywords: cuttings; iba; naa; shoot cache: jhs-379.pdf plain text: jhs-379.txt item: #276 of 600 id: jhs-380 author: Ghosh, S N; Roy, S; Bera, B title: Studies on Propagation of Bael (Aegle marmelos L.) under Jhargram Conditions date: 2012-12-31 words: 1833 flesch: 65 summary: Results from two years of investigation showed (Table 2) highest budding success (64%) in rootstock plants that were chip-budded on 25th June, followed by those on 10th June (44%). Data on budding success and seedling growth were recorded two months after the operation. keywords: bael; budding; grafting; success cache: jhs-380.pdf plain text: jhs-380.txt item: #277 of 600 id: jhs-383 author: Mustaffa, M M; Kumar, V title: Banana Production and Productivity Enhancement through Spatial, Water and Nutrient Management date: 2012-06-30 words: 19019 flesch: 63 summary: The total water requirement of banana plants is about 900- 1200mm for an entire life cycle and this can be met through both natural precipitation (rainfall) and supplementary irrigation. Under drip irrigation, banana plants flowered 15 days earlier and recorded higher yields with higher finger, hand and bunch weight as compared to basin-irrigation (Hedge and Srinivas, 1991). keywords: agric; application; banana; banana cv; banana j.; bunch; cavendish; crop; density; effect; et al; fertigation; fertilizers; fruit; growth; hort; indian; irrigation; leaf; mustaffa; nitrogen; nutrient; planting; plants; production; productivity; quality; robusta; sci; soil; water; weight; yield cache: jhs-383.pdf plain text: jhs-383.txt item: #278 of 600 id: jhs-384 author: Mithila, J; Hall, J Christopher title: Transfer of Auxinic Herbicide Resistance from Wild Mustard (Sinapis arvensis) into Radish (Raphanus sativus) through Embryo Rescue date: 2012-06-30 words: 3221 flesch: 52 summary: Further, we recently reported identification of morphological and molecular markers linked Transfer of auxinic herbicide resistance from wild mustard (Sinapis arvensis) into radish (Raphanus sativus) through embryo rescue J. Mithila and J. Christopher Hall1 Kansas State University, Manhattan KS, USA, 66506 E-mail : mithila@k-state.edu ABSTRACT The discovery of auxinic herbicides (e.g., 2,4-D, Dicamba, Picloram) for selective control of broad-leaf weeds in cereal crops revolutionized modern agriculture. To evaluate transfer of auxinic herbicide resistance from wild mustard into hybrid plants, several screening tests (involving in vitro, molecular-based as well as whole plant-based tests) were performed. keywords: arvensis; dicamba; herbicide; hybrids; mustard; plants; radish; resistance cache: jhs-384.pdf plain text: jhs-384.txt item: #279 of 600 id: jhs-385 author: Rajamanickam, C; Rajmohan, K title: Diversity Studies in Ecotypes of Banana (Musa Spp.) Using Molecular Markers and D2 Analysis date: 2012-06-30 words: 3954 flesch: 64 summary: using molecular markers and D2 analysis C. Rajamanickam and K. Rajmohan1 Horticultural College and Research Institute Periyakulam – 625 604, India E-mail : cmanickam@rediffmail.com ABSTRACT The present study was aimed at analyzing the genetic diversity of promising banana ecotypes grown in Kerala. Molecular characterization of banana clones using RAPD markers. keywords: aab; analysis; banana; clones; cluster; dessert; ecotypes; nendran; number cache: jhs-385.pdf plain text: jhs-385.txt item: #280 of 600 id: jhs-386 author: Brar, J S; Dhaliwal, H S; Bal, J S; Dhillon, W S; Singh, Som Pal title: Effect of Spacing on Canopy Microclimate, Vegetative Growth and Yield Attributes in Guava (Psidium guajava L.) date: 2012-06-30 words: 2909 flesch: 62 summary: Relative humidity was calculated from dry and wet bulb temperatures using psychrometric tables on the same day and time as solar radiation and tree canopy temperature were recorded. Radiation/light interception was calculated as difference between incoming radiation received in each of the three parts of tree canopy and was expressed as intercepted radiation at the particular time of observation. keywords: canopy; guava; plant; spacing; tree cache: jhs-386.pdf plain text: jhs-386.txt item: #281 of 600 id: jhs-389 author: Sulladmath, V V; Srinivas, K; Laxman, R H title: Yield and Quality of Passion Fruit in Relation to Training Systems date: 2012-06-30 words: 3149 flesch: 65 summary: Area under cultivation of passion fruit in these regions is rapidly increasing. Passion fruit is a woody, herbaceous, perennial climber that essentially needs to be trained on a support system. keywords: fruit; kniffin; passion; system; tatura; training; trellis; yield cache: jhs-389.pdf plain text: jhs-389.txt item: #282 of 600 id: jhs-390 author: Banerji, B K; Batra, Atul; Dwivedi, A K title: Morphological and Biochemical Characterization of Chrysanthemum date: 2012-06-30 words: 3286 flesch: 70 summary: Pe nn y La ne Sh an ka r D ay al Sn ow B al l S. S A rn ol d Je ff ri es Ve ge ta tiv e ch ar ac te r Pl an t h ei gh t ( cm ) ± SE 71 .5 0 ± 3. 87 60 .4 ± 4. 41 94 .8 ± 4. 63 12 0. 3 ± 5. 10 88 .6 ± 5. 32 81 .0 ± 5. 62 62 .3 ± 2. 98 50 .4 ± 4. 31 60 .0 0 ± 5. 64 62 .6 ± 4. 65 Pl an t S pr ea d N -S (c m ) ± SE 24 .9 1 ± 1. 89 28 .3 2 ± 2. 11 27 .0 1 ± 2. 92 30 .2 3 ± 2. 01 21 .9 0 ± 2. 11 26 .0 ± 2. 99 27 .7 2 ± 3. 10 25 .9 9 ± 2. 89 23 .4 0 ± 3. 11 32 .3 1 ± 2. 91 E- W (c m ) ± S E 26 .0 0 ± 3. 01 32 .9 2 ± 3. 11 31 .9 9 ± 3. 00 29 .6 1 ± 2. 19 24 .2 0 ± 2. 61 28 .3 2 ± 2. 56 32 .9 1 ± 2. 51 31 .9 7 ± 3. 01 27 .7 1 ± 2. 19 28 .3 1 ± 2. 51 St em d ia m et er ( cm ) ± SE 0. 65 ± 0. 61 0. 66 ± 0. 13 0. 69 ± 0. 08 0. 23 Fl or al c ha ra ct er D ay s to b ud in iti at io n ± S E 49 .4 0 ± 2. 38 56 .2 0 ± 2. 77 69 .1 0 ± 3. 23 76 .3 0 ± 4. 21 67 .8 0 ± 3. 56 82 keywords: chrysanthemum; cultivars; flower; green; group; snow; white cache: jhs-390.pdf plain text: jhs-390.txt item: #283 of 600 id: jhs-391 author: Sharma, Shashi Kumar title: Prediction Models for Frost/Low-Temperature Stress in Subtropical Fruit Plantations date: 2012-06-30 words: 3631 flesch: 52 summary: From line 1, it is evident that sunset time temperature (T 530 ) explained around 52 % of the total variation in minimum temperature (T dip ) during a radiation frost event. This variation in the dependent variable (T dip ) could explain upto 61% (regression line 2) when temperature-drop upto two hours after sunset (T 5730 ) was considered along with sunset temperature (T 530 ). keywords: event; frost; line; minimum; prediction; protection; sunset; temperature; time cache: jhs-391.pdf plain text: jhs-391.txt item: #284 of 600 id: jhs-392 author: Varalakshmi, L R; Ganeshamurthy, A N title: Heavy Metal Contamination of Water Bodies, Soils and Vegetables in Peri-Urban Areas: A Case Study in Bangaluru date: 2012-06-30 words: 3606 flesch: 64 summary: RESULTS AND DISCUSSION Heavy metal content In tank waters Mean heavy metal concentration (mg/l) of water from the four water bodies is shown in Table 1. High levels of Pb in these soils can be ascribed to their proximity to the national highway and ring road (where traffic density has increased multifold in the past decade), atmospheric deposition from this traffic, and prolonged use of tank water. keywords: concentration; soils; tank; vegetables; water cache: jhs-392.pdf plain text: jhs-392.txt item: #285 of 600 id: jhs-393 author: Praveen, H M; Nandeesh, M; Chandra Mouli, M R; Rao, G V G; Vijaysegaran, S title: Management of Melon Fly, Bactrocera cucurbitae (Coquillett) Infesting Gherkin:An Areawide Control Programme Adopted in Peninsular India date: 2012-06-30 words: 3647 flesch: 63 summary: Fruit flies lay eggs inside fruits and, upon hatching, the larvae start feeding on pulp, thus making the fruits unfit for human consumption. Fruit flies have a high reproductive potential, with short and overlapping generations. keywords: area; awc; flies; fly; fruit; ftd; gherkin; grid; week cache: jhs-393.pdf plain text: jhs-393.txt item: #286 of 600 id: jhs-394 author: Jayashree, E; Viswanathan, R title: Development of Hand-Operated Mechanical Ginger Peeler date: 2012-06-30 words: 3526 flesch: 65 summary: Diameter of the hollow shaft was determined using the following formula [considering that the shaft for ginger peeling unit is subjected to bending and torsion only, and the axial load acting on the shaft is zero (Khurmi and Gupta, 2006)]. …. 4 Peeling efficiency in square mesh drum ginger peeler for varying a. Drum load & Peeling duration, b. Drum Speed & Peeling duration, c. Drum load & Drum speed Fig. 4a Fig. keywords: drum; ginger; load; material; peeling; speed cache: jhs-394.pdf plain text: jhs-394.txt item: #287 of 600 id: jhs-396 author: Kumar, Amit; Mir, Md. Yasir title: Varietal Assessment, Heritability Estimates and Correlation Studies in Apple Cultivars of South Kashmir date: 2012-06-30 words: 2051 flesch: 63 summary: The following 20 cultivars were selected, viz., Stark’s Earliest, Varietal assessment, heritability estimates and correlation studies in apple cultivars of South Kashmir Amit Kumar and Md. Hort., 18:19-23 Variability in apple cultivars of South Kashmir J. Hortl. keywords: apple; fruit; sugars; tss; yield cache: jhs-396.pdf plain text: jhs-396.txt item: #288 of 600 id: jhs-397 author: Reddy, Y T N; Kurian, Reju M title: Effect of Pruning and Chemicals on Flowering and Fruit Yield in Mango Cv. Alphonso date: 2012-06-30 words: 1552 flesch: 70 summary: Seven treatments were imposed, with pruning of fruited shoots as a common treatment, followed by chemical sprays and a control. However in general, pruning along with chemical sprays reduced percentage of vegetative shoots and increased percentage of flowering shoots compared to control. keywords: fruit; mango; pruning; yield cache: jhs-397.pdf plain text: jhs-397.txt item: #289 of 600 id: jhs-398 author: Reddy, Y T N; Shivu Prasad, S R; Kurian, Reju M; Ganeshamurthy, A N; Pannerselvam, P title: Effect of Organic Practices on Fruit Quality in Papaya Cv. Surya date: 2012-06-30 words: 2016 flesch: 55 summary: Organic practices are important in crops like papaya that are short in duration and bear fruits continuously. Short communication Effect of organic practices on fruit quality in papaya cv. keywords: dose; fertilizers; fym; vermicompost cache: jhs-398.pdf plain text: jhs-398.txt item: #290 of 600 id: jhs-399 author: Varalakshmi, B; Rao, V Kesava; Sudhakar Rao, D V; Tiwari, R B; Prabhakar, M title: High-Yielding Multicut Coriander Variety, Arka Isha date: 2012-06-30 words: 1266 flesch: 68 summary: Development & performance of coriander variety, Arka Isha Arka Isha (Coriandrum sativum var. Salient features of coriander variety Arka Isha ● High yielding, multicut type (3 cuttings can be taken) ● Plants bushy, leaves broad and leaf lobes short ● Late flowering (50 days after sowing) ● First cutting at 40 days after sowing and subsequent cuttings at 15 day intervals ● Yield 3.74t ha-1 by pulling at 40 days after sowing and 11.98t ha-1 by cutting (3 times) ● Leaf moisture 82.4 %, Total Soluble Solids 17.6 % and Vitamin C content 167.05 mg 100g-1 ● Leaf essential oil yield 0.083%, with good aroma ● Keeping quality at Room Temperature (RT) 3 days, and at Low Temperature 3 weeks, without losing aroma when stored in polythene bags (100PE gauge) 93 (MS Received 20 May 2011, Revised 10 December 2011 High-yielding coriander variety Table 5. keywords: arka; coriander; isha; local cache: jhs-399.pdf plain text: jhs-399.txt item: #291 of 600 id: jhs-401 author: Deshmukh, M R title: Effect of Various Irrigation Methods on Growth, Flowering and Yield of Tuberose (Polyanthes tuberosa Linn.) date: 2012-06-30 words: 1902 flesch: 64 summary: These results are in agreement with Beattii et al (1993) who reported very marked differences in response to irrigation methods in Asiatic lilies. Effects of root removal, irrigation methods and ancymidol on flowering of Asiatic lilies. keywords: irrigation; tuberose; yield cache: jhs-401.pdf plain text: jhs-401.txt item: #292 of 600 id: jhs-402 author: Rehman, H U; Sharma, M K; Banday, F A title: Standardization of Leaf Sampling Technique for Macronutrients in Apricot under Temperate Conditions date: 2012-06-30 words: 1683 flesch: 66 summary: Nitrogen content in apricot leaf influenced by position of leaf on the shoot and time of sampling (% dry weight) J. Hortl. Phosphorus content in apricot leaf influenced by position of leaf on the shoot and time of sampling (% dry weight) keywords: apricot; content; leaf; leaves; sampling cache: jhs-402.pdf plain text: jhs-402.txt item: #293 of 600 id: jhs-403 author: Narayan, Kamal; Dubey, P; Sharma, D; Katre, Vijay T; Tiwari, S P; Mishra, Anita title: Effect of Soil and Foliar Application of Nutrients on Growth and Yield in Tomato (Lycopersicon esculentum Mill.) date: 2012-06-30 words: 1898 flesch: 56 summary: Influence of foliar sprays with water soluble fertilizers on yield and quality of carrot (Daucus carota L.) Procs. ABSTRACT An experiment was conducted to study the effect of foliar feeding of water- soluble fertilizers in combination with soil-applied fertilizers on growth, yield and quality attributes in tomato cv. keywords: dose; fertilizers; foliar; fruit; spray cache: jhs-403.pdf plain text: jhs-403.txt item: #294 of 600 id: jhs-404 author: Poonia, M K; Dhaka, B L title: Effect of Phosphorus Solublizing Bacteria (PSB) on Growth and Yield in Tomato date: 2012-06-30 words: 2485 flesch: 59 summary: Phosphorus is one of the most important mineral nutrients for plant growth and development. These bacteria in the presence of labile carbon serve as a sink for P by rapidly immobilizing it even in low P soils (Bünemann et al, 2004). keywords: effect; growth; phosphate; plant; psb; soil; yield cache: jhs-404.pdf plain text: jhs-404.txt item: #295 of 600 id: jhs-405 author: Sridhar, V; Joshi, Sunil; Rani, B Jhansi; Kumar, Rajiv title: First Record of Lantana Mealybug, Phenacoccus parvus Morrison (Hemiptera: Pseudococcidae), as a Pest on China Aster from South India date: 2012-06-30 words: 1224 flesch: 56 summary: During the regular surveys we undertake for pests of ornamental crops at the Indian Institute of Horticultural Research, Bangalore, incidence of lantana mealybug, Phenacoccus parvus Morrison (Hemiptera: Pseudococcidae), was observed on China aster, infesting First record of lantana mealybug, Phenacoccus parvus Morrison (Hemiptera: Pseudococcidae), as a pest on China aster from South India V. Sridhar, Sunil Joshi1, B. Jhansi Rani and Rajiv Kumar2 Division of Entomology and Nematology Indian Institute of Horticultural Research, Bangalore 560 089, India E-mail: vsridhar@icar.org.in ABSTRACT Heavy population of lantana mealybug, Phenacoccus parvus Morrison, was recorded on China aster, Callistephus chinensis (L.) Nees, in pest proportions at Bangalore, South India, both on the collar region and roots. China aster plants infested with Planacoccus parvus (MS Received 7 April 2011, Revised 23 November 2011) J. Hortl. keywords: aster; china; mealybug; parvus; phenacoccus cache: jhs-405.pdf plain text: jhs-405.txt item: #296 of 600 id: jhs-406 author: Krishnamoorthy, A; Ganga Visalakshi, P N title: Record of Thrips on Mango date: 2012-06-30 words: 1065 flesch: 57 summary: Key words: Mango, thrips Following thrips species were collected from Moorapoor Village on mango inflorescences: Date of Type of orchard Species Level of collection collected infestation 26/02/2009 Organic cultivation Frankliniella 1 schultzei 09/03/2009 Organic cultivation -do- No thrips Nil 0 1-5 Low 1 6-10 Medium 2 11-20 Heavy 3 > 21 Very heavy 4 Short communication Record of thrips on mango A. Krishnamoorthy and P.N. Ganga Visalakshi Division of Entomology and Nematology Indian Institute of Horticultural Research Hessaraghatta Lake Post, Bangalore – 560 089, India E- mail: akmurthy@icar.org.in ABSTRACT During a trial in 2009 at Moorapoor Village, Dharmapuri district, Tamil Nadu, for control of mango hoppers and thrips using entomo-pathogens, inflorescences were seen to harbour different species of thrips. keywords: kumar; mango; species; thrips cache: jhs-406.pdf plain text: jhs-406.txt item: #297 of 600 id: jhs-407 author: Jayanthi, P D Kamala; Prakash, G S title: Tip Withering Bug, Anoplocnemis phasiana (Fab.), Halts Grape Shoots: Friend or Foe, Arrival Time Explains date: 2012-06-30 words: 1166 flesch: 67 summary: Phoretic association between the egg parasitoid, Protelenomus sp., and adult A. phasiana bugs, has also been observed. Incidence of tip withering bug, Anoplocnemis phasiana (Fab.), usually coinciding with the period of halting practice, results in die-back of shoot tip and prevents extension of the shoot, thus halting shoot growth. keywords: bug; bugs; grape; phasiana cache: jhs-407.pdf plain text: jhs-407.txt item: #298 of 600 id: jhs-408 author: Pandey, Ashutosh; Mathew, Amita J; Kamle, Madhu; Mishra, Rupesh Kumar; Kumar, Pradeep title: Efficacy of Fungicides for Control of White Mold (Sclerotinia sclerotiorum Lib.) De Bary in Lima Bean date: 2012-06-30 words: 2046 flesch: 57 summary: These results are in accordance with earlier findings showing that spraying the whole plant with effective fungicides provides excellent control of S. sclerotiorum (Hunter et al, 1978). The crop suffers due to infection of Sclerotinia sclerotiorum (Lib.) keywords: control; fungicides; mold; sclerotinia; sclerotiorum cache: jhs-408.pdf plain text: jhs-408.txt item: #299 of 600 id: jhs-409 author: Shivashankara, K S title: Fruit Tree Physiology date: 2012-06-30 words: 789 flesch: 48 summary: Chilling requirement in fruit crops chapter has covered various crops which require chilling temperatures for flowering. However, these books are relatively old ones and no text books are available for researchers, teachers and students working in the area of fruit crops. keywords: chapter; crops; fruit cache: jhs-409.pdf plain text: jhs-409.txt item: #300 of 600 id: jhs-412 author: Mani, M; Krishnamoorthy, A; Shivaraju, C title: Biological Suppression of Major Mealybug Species on Horticultural Crops in India date: 2011-12-31 words: 13748 flesch: 56 summary: Biological suppression of major mealybug species on horticultural crops in India M. Mani, A. Krishnamoorthy and C. Shivaraju Division of Entomology and Nematology Indian Institute of Horticultural Research Bangalore -560 089, India E-mail: mmani1949@yahoo.co.in ABSTRACT Mealybugs, known to be ‘hard to kill pests’, live in protected areas and most stages in their life cycle are covered in a waxy coating. By fifth week of release of the predator, mealybug population was reduced to negligible level. keywords: black; cmyk; cmyk graphic; cmyk profile; color; control; device; graphic; gray; image; intent; krishnamoorthy; mani; mealybug; montrouzieri; point compensation; rgb; rgb graphic; turn cache: jhs-412.pdf plain text: jhs-412.txt item: #301 of 600 id: jhs-413 author: Rekha, A; Dinesh, M R; Venugopalan, R; Murthy, B N S title: Genetic Correlation and Cluster Analysis in Sapota (Manilkara zapota) date: 2011-12-31 words: 3164 flesch: 55 summary: This indicated that excessive increase in fruit weight reduced quality of the fruit and, hence, selection should be preferably made for optimum fruit weight. At ripening, 25% reduction in fruit weight was observed in all the accessions studied. keywords: black; cmyk; fruit; gray; intent; point cache: jhs-413.pdf plain text: jhs-413.txt item: #302 of 600 id: jhs-414 author: Thangamani, C; Pugalendhi, L; Sumathi, T; Kavitha, C title: Evaluation of F1 Hybrids in Bitter Gourd (Momordica charantia L.) for Yield and Quality date: 2011-12-31 words: 3737 flesch: 46 summary: -59.90** -13.43** -19.96** 140.15** 11.62** -7.11** -14.42** KR x MC-30 57.86 26.81 23.84 67.29 23.66 13.91 102.76 18.89 1.77 90.21 1.44 -3.25** -1.23** 0.66** 1.24** -1.23** 2.22** -2.38** 3.03** 0.22** 0.48 -0.13** 6.41** -6.54** 40.44** 5.45** -13.67** -4.66** 32.07** -18.87** -10.61** -7.03** -33.02** Mean values are shown in bold, sca values in italics and standard heterosis values in normal font* and ** significantly superior at 5% and 1% levels, respectively The parent ‘Preethi’ was found to outperform other parents by its favourable mean performance and gca effect together for the following characters: node of first female- flower appearance, sex ratio, fruit weight, fruit yield, ascorbic acid and iron content. Considering the mean performance, sca and standard heterosis, hybrid ‘Preethi x MC-30’ registered favourable values for the most important characters like earliness, number of fruits, fruit yield and quality. keywords: black; cmyk; gray; intent; point cache: jhs-414.pdf plain text: jhs-414.txt item: #303 of 600 id: jhs-415 author: Angami, Thejangulie; Das, R P title: Standardization of IBA Concentration for Rooting of Cuttings of some Indigenous Fruit Crops of Assam date: 2011-12-31 words: 4711 flesch: 54 summary: Higher endogenous auxin and lower cytokinin concentration may have enabled better rooting in Outenga cuttings. Interaction effect: Data in Tables 1 to 6 reveal that the interaction effect of plant species and IBA treatments was significant longest primary root per cutting, fresh weight of roots per cutting, survival percentage, number of branches per cutting, number of new leaves per cutting, size of the longest shoots per cutting. keywords: black; cmyk; compensation; gray; intent; point cache: jhs-415.pdf plain text: jhs-415.txt item: #304 of 600 id: jhs-416 author: Kumari, Suman; Patel, B S; Mahawer, L N title: Influence of Gibberellic Acid and Planting Date on Growth and Flowering in Gladiolus Cv. Yellow Frilled date: 2011-12-31 words: 3800 flesch: 54 summary: Ind. J. Hort., 37:305-308 Bhattacharjee, S.K. 1984.The effects of growth regulating chemicals on gladiolus, Gartenbauwissenschaft, 49:103-106 Biswas, J., Bose, T.K. and Maiti, R.G. 1983. From the present investigation, it is concluded that gladiolus planting on 25th October along with corm-dip in gibberellic acid @ 50ppm for 30 minutes at the time of planting, is the most effective for improved the growth and flowering under North Gujarat conditions. keywords: black; cmyk; compensation; gladiolus; graphic; gray; intent; point cache: jhs-416.pdf plain text: jhs-416.txt item: #305 of 600 id: jhs-417 author: Hegde, Jayalaxmi Narayan; Chakravarthy, A K; Nagamani, M K; Prabhakar, M S title: Management of Thrips, Scirtothrips dorsalis Hood, on Rose under Open-Field and Protected Conditions date: 2011-12-31 words: 4591 flesch: 55 summary: Efficacy of botanicals, biopesticides and chemicals against rose thrips under polyhouse at Ramohally during 2008 Treatment Particulars *Number of thrips per plant on different days Pre-treatment I Spray II Spray Mean count 3-DAS 5-DAS 3-DAS 5-DAS T1 NSKE-5% 25.18(5.19) 17.28(4.27) 9.38(3.22) 5.46(2.54) 4.32(2.30) 9.11 (3.48)d T2 Neem oil @2% 25.10(5.08) 19.32(4.50) 18.00(4.35) 14.8(3.97) 11.00(3.46) 15.78 (4.27)h T3 Pongamia oil @2% 25.20(5.11) 20.96(4.68) 18.40(4.40) 15.22(4.03) 11.82(3.58) 16.60 (4.26)i T4 Nimbecidine @0.2% 25.14(5.11) 21.00(4.68) 19.50(4.52) 16.48(4.18) 12.74(3.70) 17.43 (4.43)j T5 GB Ag @0.2% 25.63(5.15) 15.90(4.11) 8.96(3.15) 4.92(2.43) 4.04(2.24) 8.46 (3.40)c T6 Spinosad @45SC@0.04% 25.14(5.11) 15.58(4.07) 8.24(3.04) 3.98(2.23) 3.28(2.07) 7.77 (3.29)b T7 Vertimec-1.9EC@0.03% 25.00(5.09) 15.62(4.07) 8.18(3.02) 3.96(2.23) 3.04(2.01) 7.70 (3.29)b T8 Chlorfenapyr-10SC @0.15% 25.40(5.13) 16.14(4.13) 8.46(3.07) 4.98(2.44) 3.72(2.17) 8.33 Efficacy of botanicals, biopesticides and chemicals against rose thrips under polyhouse at, Ramohally during 2009 Treatment Particulars *Number of thrips per plant on different days Pre-treatment I Spray II Spray Mean count 3-DAS 5-DAS 3-DAS 5-DAS T1 NSKE @5% 34.54(5.96) 24.38(5.04) 12.28(3.64) 7.30(2.88) 4.04(2.24) 12.00 (3.95)f T2 Neem oil @2% 34.64(5.96) 28.28(5.41) 18.86(4.45) 16.22(4.14) 13.22(3.77) 19.15 (4.75)j T3 Pongamia oil @2% 34.04(5.91) 29.32(5.50) 18.80(4.45) 15.37(3.04) 13.95(3.86) 19.36 (4.76)j T4 keywords: black; cmyk; compensation; graphic; gray; intent; point; point compensation; thrips cache: jhs-417.pdf plain text: jhs-417.txt item: #306 of 600 id: jhs-418 author: Gantait, Subhendu s; Pal, P title: Comparative Performance of Spray Chrysanthemum Cultivars under Polyhouse and Open-Field Cultivation at Different Dates of Planting date: 2011-12-31 words: 6807 flesch: 49 summary: Effect of planting time and cultivar on flower yield and other flower tracts in cyrysanthemum Treatment Weight (g) of Flower Number of Flower yield Shelf-life of Vase-life of individual diameter (cm) flowers per (g/plant) flower (days) flower (days) flower plant Poly- Open Poly- Open Poly- Open Poly- Open Poly- Open Poly- Open house field house field house field house field house field house field P 1 V 1 1.34 1.53 4.20 4.33 316.82 290.92 363.30 351.63 25.25 23.88 21.50 21.00 P 1 V 2 2.05 1.90 4.85 4.85 551.59 541.59 605.88 586.86 27.13 24.50 21.50 21.00 P 1 V 3 2.30 2.13 4.65 4.45 312.96 235.31 431.71 289.81 26.63 24.50 26.50 21.50 P 1 V 4 2.38 1.90 3.25 3.00 332.14 148.73 424.54 172.55 31.00 26.88 21.00 18.00 P 1 V 5 1.80 1.70 2.83 2.65 72.85 56.74 115.92 79.63 18.38 16.13 19.00 16.50 P 1 V 6 1.85 1.75 4.68 5.48 330.56 319.53 422.49 372.90 28.00 23.75 25.50 23.50 P 1 V 7 3.80 3.65 5.10 4.58 97.65 31.04 290.21 108.23 25.13 17.25 24.50 18.00 P 1 V 8 2.38 2.80 6.00 5.63 410.76 292.91 578.18 488.13 23.25 21.75 21.50 20.50 P 1 V 9 2.18 2.23 5.68 5.35 791.46 521.28 717.30 613.98 29.00 25.63 20.50 18.50 P 1 V 10 2.30 1.95 5.43 5.18 460.96 406.15 597.25 416.31 25.50 23.75 19.50 18.00 P 1 V 11 1.08 0.95 4.25 4.63 798.16 760.87 486.42 340.15 18.75 18.00 20.50 19.50 P 1 V 12 2.10 1.50 5.98 5.75 284.77 209.18 351.68 181.45 26.38 24.63 23.50 21.50 P 1 V 13 1.60 1.43 4.58 4.68 459.17 369.37 408.88 278.16 25.63 24.00 19.50 18.50 P 1 V 14 1.85 1.78 4.83 5.23 399.71 339.53 426.36 333.44 24.00 22.50 24.00 22.50 P 1 V 15 1.03 0.93 4.68 4.33 550.79 386.67 339.35 224.98 20.38 18.63 20.50 18.50 P 2 V 1 1.65 1.48 4.43 4.28 292.28 266.02 380.07 331.75 24.13 22.00 20.50 19.50 P 2 V 2 2.28 1.63 5.10 4.58 520.27 426.37 627.61 429.36 26.25 23.63 22.00 19.50 P 2 V 3 2.60 1.98 4.80 4.48 296.46 212.61 493.44 247.73 27.13 22.88 24.50 20.50 P 2 V 4 2.55 2.10 3.43 3.13 300.05 112.49 405.99 148.88 31.88 25.13 19.50 17.00 P 2 V 5 1.90 1.53 3.33 2.78 62.98 43.77 126.45 58.06 18.13 15.38 19.50 16.00 P 2 V 6 2.00 1.70 4.80 5.33 299.46 278.23 401.51 331.12 26.88 21.50 24.50 22.50 P 2 V 7 4.53 3.58 5.53 4.45 87.16 22.27 358.71 78.63 25.75 16.13 23.00 16.50 P 2 V 8 3.00 2.55 6.35 5.43 361.33 273.75 651.56 398.27 24.50 20.50 22.00 18.50 P 2 V 9 2.73 2.18 6.03 5.13 753.57 424.85 797.94 523.59 27.88 23.75 21.00 18.00 P 2 V 10 2.65 1.88 5.80 5.08 418.89 352.26 625.01 335.01 26.00 24.25 20.50 17.50 P 2 V 11 1.23 1.28 4.43 4.75 758.91 721.32 584.03 558.46 18.13 17.38 22.50 19.00 P 2 V 12 2.28 1.30 6.23 5.48 267.18 165.14 338.66 137.54 27.63 24.63 25.00 20.50 P 2 V 13 2.00 1.48 5.03 4.73 425.40 305.77 484.70 241.09 26.75 22.88 19.00 16.00 P 2 V 14 2.30 2.23 5.58 6.13 379.41 264.67 497.63 344.58 22.38 21.63 25.00 22.00 P 2 V 15 0.90 0.83 4.38 4.03 513.38 354.93 238.19 182.75 19.38 17.38 22.50 17.00 P 3 V 1 1.35 1.28 4.18 4.10 207.89 167.71 216.26 186.97 21.63 19.00 19.50 17.50 P 3 V 2 1.40 1.33 4.20 4.25 381.82 252.83 351.38 196.02 21.63 19.25 19.50 18.00 P 3 V 3 1.80 1.45 4.50 4.28 144.48 106.82 175.51 121.22 22.38 18.75 22.50 19.00 P 3 V 4 2.05 1.20 2.93 2.68 200.51 56.91 220.10 43.90 23.13 16.50 19.00 15.50 P 3 V 5 1.53 1.05 2.83 2.45 36.04 28.21 46.95 25.23 16.00 12.88 16.50 14.50 P 3 V 6 1.73 1.38 4.50 4.93 212.64 191.45 261.14 188.54 21.50 15.75 22.50 21.50 P 3 V 7 4.95 2.73 5.80 4.28 46.49 12.41 224.17 33.41 21.38 13.00 19.50 15.00 P 3 V 8 2.85 2.18 6.08 5.05 232.05 115.24 360.28 170.28 19.63 16.75 18.50 15.50 P 3 V 9 2.85 1.90 6.08 5.63 656.72 347.20 597.97 394.04 22.63 19.13 17.50 15.50 P 3 V 10 2.10 1.68 4.95 4.83 310.22 221.02 347.08 184.33 21.88 18.50 16.50 14.50 P 3 V 11 0.98 0.98 4.25 4.50 514.07 418.36 276.42 261.88 16.50 15.00 19.00 17.50 P 3 V 12 1.83 1.13 5.93 4.80 205.18 104.37 217.53 77.13 20.50 16.88 20.00 18.50 P 3 V 13 1.55 1.13 4.65 4.80 327.56 200.68 278.07 135.22 21.75 20.00 18.00 13.50 P 3 V 14 1.75 2.38 4.50 6.00 247.19 117.99 271.93 182.24 20.88 19.50 23.50 20.50 P 3 V 15 0.75 0.70 3.90 3.65 367.41 289.17 175.40 129.86 15.75 14.63 17.50 15.50 SEm ± 0.091 0.087 0.073 0.071 9.302 9.907 19.831 18.827 0.419 0.426 0.422 0.415 CD (P=0.05) 0.25 0.24 0.20 0.20 25.79 27.46 54.97 52.19 1.16 1.18 NS* NS* *NS = Non-significant Gantait and Pal J. Hortl. In the open-field, Arati recorded maximum flower yield (510.54g) and cultivars, viz., Sarad Mala, Yellow Anemone and Tata Red also produced fairly good quantity of flowers (404.08g, 386.83g and 352.22g per plant, respectively). keywords: black; cmyk; cmyk profile; field; gray; intent; point compensation cache: jhs-418.pdf plain text: jhs-418.txt item: #307 of 600 id: jhs-419 author: Batra, Atul; Banerji, B K title: Influence of Growth Regulators and Explant on Plant Regeneration in Tomato date: 2011-12-31 words: 2460 flesch: 44 summary: Characterization and mapping of a gene controlling shoot regeneration in tomato. Frequency of adventitious shoot regeneration was seen to differ with the type of explants, and, type and concentrations of growth regulators added to the medium. keywords: black; cmyk; compensation; graphic; gray; intent; point cache: jhs-419.pdf plain text: jhs-419.txt item: #308 of 600 id: jhs-420 author: Jyothi, K Uma; Kumari, S Surya; Ramana, C Venkata title: Variability Studies in Chilli (Capsicum annuum L.) with Reference to Yield Attributes date: 2011-12-31 words: 2812 flesch: 53 summary: Five plants were selected randomly from each genotype and observation on height, plant spread, number of fruits per plant, fruit length, fruit girth, number of seed per fruit, ripe chilli yield and dry chilli yield were recorded. Crop improvement largely depends on existence of genetic variability. keywords: black; chilli; cmyk; gray; intent; point cache: jhs-420.pdf plain text: jhs-420.txt item: #309 of 600 id: jhs-421 author: Sawant, S D; Sawant, Indu S; Banerjee, Kaushik; Shetty, Dinesh; Waghmare, Monali; Kalbhor, G; Patil, Shweta; Jadhav, Manjusha title: Bio-Efficacy of Aureofungin-sol in Control of Downy and Powdery Mildews in Grape date: 2011-12-31 words: 4660 flesch: 48 summary: However, to avoid build up of fungicide residues, as well as to prevent development of fungicide- resistant strains of these fungi, there is a need for a large Bio-efficacy of Aureofungin-sol in control of downy and powdery mildews in grape S.D. Sawant, Indu S. Sawant, Kaushik Banerjee, Dinesh Shetty, Monali Waghmare, G. Kalbhor, Shweta Patil and Manjusha Jadhav National Research Centre for Grapes, Pune-412307, India E-mail: ipmsawant@yahoo.co.in ABSTRACT Bio-efficacy of Aureofungin-sol, an antifungal antibiotic, for control of downy mildew and powdery mildew of grape was evaluated during October 2008 - April 2009 fruiting season in vineyards at three locations in Maharashtra. Similarly, four sprays of Aureofungin-sol @ 0.108 g/l at 11 to 20 days’ interval at 65 days after pruning provided complete control of powdery mildew on leaves and bunches. keywords: black; cmyk; control; device; graphic; gray; intent; point compensation; profile cache: jhs-421.pdf plain text: jhs-421.txt item: #310 of 600 id: jhs-423 author: Madhavi, G Bindu; Bhattiprolu, S L title: Evaluation of Fungicides, Soil Amendment Practices and Bioagents against Fusarium solani-Causal Agent of Wilt Disease in Chilli date: 2011-12-31 words: 3726 flesch: 47 summary: The present findings are in conformity with the earlier reports, integration of disease management practices are more effective in controlling Fusariam wilt in gladiolus (Suneel Anand and Harender Raj Gautam, 2006), collar and root rot in strawberry (Bhardwaj and Gautam, 2004) and soil borne diseases in vegetable nurseries (Steven et al, 2003) Although disease resistant varieties are preferred over management of soil borne diseases such as Fusariam wilt there are not many alternatives except to take up drenching with fungicide particularly when the wilt has already appeared in the field. keywords: black; cmyk; compensation; graphic; gray; intent; point; point compensation; profile cache: jhs-423.pdf plain text: jhs-423.txt item: #311 of 600 id: jhs-424 author: Reddy, Y T N; Kurian, Reju M title: Studies on Rejuvenation of Old, Unproductive 'Alphonso' Mango Trees in Orchards date: 2011-12-31 words: 2709 flesch: 58 summary: Thinning of overcrowded branches to facilitate air circulation improves photosynthetic efficiency, fruit yield and quality. Beneficial and favourable effects of pruning in mango have been reported on light interception and chlorophyll content of leaves (Schaffer and Gauye, 1989), growth parameters (Lal et al, 2001) and fruit yield (Lal and Mishra, 2007; Rao and Shanmugavelu, 1976; Burondakar et al, 1997; Shinde et al, 2003), fruit colour (Whitey, 1984) and regularity in bearing (Rao, 1971) keywords: black; cmyk; gray; intent; point; pruning cache: jhs-424.pdf plain text: jhs-424.txt item: #312 of 600 id: jhs-425 author: Singh, Dinesh; Kumar, K; Sharma, Vikas Kumar title: Assessment of Genetic Diversity in Wild Raspberry (Rubus ellipticus Smith) Native to North-Western Himalayan Region date: 2011-12-31 words: 5270 flesch: 33 summary: Geographical distribution of Rubus ellipticus genotypes in some location of North-Western Himalayas Genotype Location Altitude Latitude Longitude Distribution Majhgaon-1 Majhgaon 1482 30o53’115 77o07’081 Abundant Majhgaon-2 Majhgaon-3 Oachhghat-1 Oachhghat Kiar-1 Kyar 1258 30o52’076 77o07’646 Frequent Dhillon-1 Dhillon 1411 30o52’816 77o04’216 Frequent Kumarhatti-1 Kumarhatti 1590 30o53’431 77o03’127 Frequent Shaktighat-1 Analysis of variance for some quantitative traits of horticultural importance for pre-selected genotypes of raspberry (Rubus ellipticus Smith) Character Mean squares Replication Treatment Error Degree of Freedom (d.f.) 2 169 338 Berry weight (g) 0.003 0.048* 0.001 Berry length (mm) 0.062 keywords: black; cmyk; cmyk graphic; cmyk profile; color; device; graphic; gray; image; intent; point compensation; rgb cache: jhs-425.pdf plain text: jhs-425.txt item: #313 of 600 id: jhs-426 author: Madhavi, G Bindu; Bhattiprolu, S L; Reddy, V Bali title: Effect of Various Plant Extracts on Dry Root Rot of Chillies Caused by Sclerotium rolfsii date: 2011-12-31 words: 2397 flesch: 48 summary: Plant extracts are known to possess antimicrobial properties and several research workers have studied antifungal activity of various plant extracts (Seshakiran et al, 2006; Sheoraj Singh et al, 2007; Deepak Kumar et al, 2008). These reports prompted the present investigation on in vitro screening of plant extracts, viz., neem (Azadirachta indica), bottlebrush (Callistemon lanceolatus De), periwinkle (Vinca rosea), ashoka (Polyalthia longifolia), curry leaf (Murraya koenigii), prosopis (Prosopis julifera), onion bulb (Allium cepa) and ginger stem (Zingiber officinalis) to assess their inhibitory effect on pathogen mycelial growth, sclerotial production and sclerotial germination. keywords: black; cmyk; compensation; gray; intent; point cache: jhs-426.pdf plain text: jhs-426.txt item: #314 of 600 id: jhs-427 author: Reddy, K Gurava; Reddy, A Subbarami; Reddy, M Chandra Sekhara title: Adoption of Integrated Pest Management (IPM) in Chilli (Capsicum annuum L.): A Case Study from Guntur District, Andhra Pradesh date: 2011-12-31 words: 3349 flesch: 47 summary: Key words: Integrated Pest Management, Crop Life India, adoption Short communication were recorded in chilli crop in Karnataka in the nursery and in the field, respectively (Reddy and Puttaswamy, 1983). Adoption of Integrated Pest Management (IPM) Important pests and diseases of chilli crop as perceived by respondents Opinion of the respondents differed on important pests and diseases of chilli crop (Table 5). keywords: black; cmyk; compensation; gray; intent; point; point compensation cache: jhs-427.pdf plain text: jhs-427.txt item: #315 of 600 id: jhs-428 author: Varalakshmi, B; Rao, V Kesava; Naik, G title: Antioxidant-Rich Amaranth Varieties, Arka Samraksha and Arka Varna date: 2011-12-31 words: 2562 flesch: 41 summary: Arka Samraksha 161.3 4.36 10.91 499.0 27.3 1.34 Arka Varna 154.1 4.23 10.58 417.0 38.2 1.42 Arka Suguna (c) 115.1 3.08 7.69 419.6 65.8 1.61 Local Check 92.2 2.46 6.15 389.2 82.4 1.42 Mean 133.2 3.55 8.87 428.8 58.2 1.65 C.D. (P=0.01) 47.5 1.27 3.17 39.7 15.6 0.13 CV (%) 8.6 8.05 9.08 15.7 13.6 13.4 Table 4. Performance of amaranth varieties Arka Samraksha and Arka Varna for quantitative / qualitative traits during Kharif 2009 at CHES, Bhubaneswar and Hirehalli CHES, Bhubaneswar CHES, Hirehalli Variety Yield (t/ha) Antioxidant activity Nitrates (mg / Yield Antioxidant activity Nitrates (mg/ 100g Oxalates (100g (mg AEAC units / 100g fr. leaf wt.) Arka Samraksha 13.87 315.2 29.9 7.56 520.6 34.2 1.2 Arka Varna 9.47 214.0 27.9 6.67 596.4 15.0 1.2 Arka Suguna (c) 8.54 99.2 172.6 4.31 399.1 40.3 1.1 Local check 8.75 183.2 88.2 4.11 433.4 64.9 1.2 Mean 11.69 190.9 73.7 5.5 474.4 67.4 1.2 C.D. (P=0.05) 6.08 36.3 31.7 1.41 42.1 15.6 0.052 CV (%) 13.3 15.3 19.2 6.6 15.3 14.2 7.3 and 29.9mg nitrates per 100g of fresh weight of leaves. keywords: arka; black; cmyk; intent cache: jhs-428.pdf plain text: jhs-428.txt item: #316 of 600 id: jhs-429 author: Kushwah, S S; Singh, O P; Gupta, B S title: Evaluation of Potato-Based Crop Sequences for Crop Diversification in Malwa Region of Madhya Pradesh date: 2011-12-31 words: 2377 flesch: 45 summary: Results revealed that crop sequence had remarkable influence on various competition indices. Key words: Limited irrigation, crop diversification, crop sequence, potato in four villages of Malwa (Mandsaur-Neemuch) region, Madhya Pradesh, during 2007-08. keywords: black; cmyk; crop; intent; potato cache: jhs-429.pdf plain text: jhs-429.txt item: #317 of 600 id: jhs-43 author: Shikhamany, S D; Borade, V Swapnil; Jeughale, K Sanjay; Patil, Suryakant Y title: Increasing the Efficacy of GA3 Sprays in Cluster Elongation and Berry Thinning in Tas-A-Ganesh Grape (Vitis vinifera L.) in Tropical Viticulture date: 2018-06-30 words: 6695 flesch: 73 summary: Sci. Vol. 13(1) : 82-90, 2018 Shikhamany et al 86 Effect on Rachis Length Rachis elongation is a desirable effect with respect to reduced cluster compactness. Cluster compactness was derived by multiplying the number of berries/ cm length of rachis with berry diameter. keywords: cluster; compactness; ga3; n s; number; season cache: jhs-43.pdf plain text: jhs-43.txt item: #318 of 600 id: jhs-430 author: Sharma, Akash; Wali, V K; Bakshi, Parshant; Jamwal, Mahital title: Effect of Organic Manures and Biofertilizers on Leaf and Fruit Nutrient Status in Guava (Psidium guajava L.) Cv. Sardar date: 2011-12-31 words: 2776 flesch: 42 summary: Pooled data in Table 2 reveals that after fruit harvest, maximum amount of leaf nitrogen (1.73 %) and fruit nitrogen (1.12 %) was recorded in the treatment comprising full-dose of nitrogen, applied through poultry manure augmented with Azotobacter and Azospirillium. Increase in leaf nitrogen status observed was partially attributed to the stimulating influence of biofertilizers on organic manure which, in turn, increases nutrient-absorption rate and translocation in the tree system. keywords: black; cmyk; compensation; gray; intent; point cache: jhs-430.pdf plain text: jhs-430.txt item: #319 of 600 id: jhs-433 author: Bolan, Nanthi S; Bell, Kerrie; Krishan, Anitha Kunhi; Chung, Jae-Woo title: Irrigating Horticultural Crops with Recycled Water: An Australian Perspective date: 2011-06-30 words: 12685 flesch: 44 summary: Reuse water consumption within the Australian agricultural sector and as percentage of total water consumption (Source: Australian Bureau of Statistics, 2010a) Reclaimed water: its origins and use ‘Treated’ sewage water (commonly known as wastewater, recycled water, or reclaimed water) has been under-utilized in Australia, although increase in its reuse has been seen since mid-nineties (ABS, 2004; Anderson and Davis, 2006). Only 50% of the nitrogen and 60% of the phosphorus are removed during treatment, so, concentration of these major nutrients is still high in treated sewage than in irrigation water from other sources (Kelly et al, 2006). keywords: abs; australia; crops; environmental; et al; guidelines; health; irrigation; low; management; medium; quality; risk; salinity; sci; soil; south; table; total; treatment; use; wastewater; water; water irrigation cache: jhs-433.pdf plain text: jhs-433.txt item: #320 of 600 id: jhs-435 author: Santhosha, H M; Varalakshmi, B; Gowda, N C Narase title: Genetic Diversity in Early Cauliflower (Brassica oleracea Var. botrytis L.) Germplasm date: 2011-06-30 words: 2307 flesch: 74 summary: From these studies, it is concluded that highest inter- cluster distance between Clusters, namely, 8 (IIHR-323- 13, IIHR-214-5, IIHR-277-14 IIHR-263) and IIHR-272, IIHR 263 of Clusters 10 indicated the presence of large diversity among genotypes cluster segregants. Narase Gowda1 Department of Horticulture, University of Agricultural Sciences GKVK Campus, Bangalore-560 065, India E-mail: san3070@gmail.com ABSTRACT An experiment was conducted to study genetic divergence in 51 genotypes of cauliflower. keywords: cauliflower; cluster; curd; genotypes; weight cache: jhs-435.pdf plain text: jhs-435.txt item: #321 of 600 id: jhs-436 author: Banyal, Sanjeev Kumar; Sharma, Shashi Kumar title: Effect of Growth Regulators on Growth and Harvest Maturity in Kiwifruit (Actinidia deliciosa) date: 2011-06-30 words: 2175 flesch: 74 summary: Three plant growth regulators, viz., NAA, 2,4,5-T and Ethrel were sprayed at different concentrations at stage II of fruit growth to study their effect on growth pattern, maturity and quality of fruits. Fruit growth was recorded in terms of fruit-length and fruit diameter at weekly intervals, from 15 days after fruit set until harvest. keywords: ethrel; fruit; growth; ppm cache: jhs-436.pdf plain text: jhs-436.txt item: #322 of 600 id: jhs-437 author: Sandhu, Savreet; Gill, Bikramjit Singh title: Effect of Integrated Nutrient Management Strategies on Growth and Yield of Cape Gooseberry (Physalis peruviana L.) date: 2011-06-30 words: 2295 flesch: 56 summary: Increased plant growth might be due to more efficient absorption of nutrient elements because of the better root system developed by biofertilization. The reason for increased plant height and plant spread may be the build up of colonies of the applied biofertilizer inoculates and their growth promoting effects, including synthesis of plant growth promoting substances. keywords: azotobacter; fym; growth; npk; plant cache: jhs-437.pdf plain text: jhs-437.txt item: #323 of 600 id: jhs-438 author: Basavaraja, P K; Reddy, P N Narasimha; Rajesh, N L; Apoorva, K B title: Development of Fertilizer Prescription Targeted Yield-Equation for Carrot Crop Based on Soil Test Values date: 2011-06-30 words: 2505 flesch: 63 summary: STCR fertilizer prescription ready-reckoner for carrot root yield target of 20t ha-1* STV Only FYM STV Only FYM STV Only FYM KMnO 4 - N inorganics (10t ha-1) Sci. Vol. 6(1):33-36, 2011 36 Table 3. STCR fertilizer prescription ready-reckoner along with STL method of fertilizer application for carrot root yield target of 20tha-1 STCR STL STV STCR STL STCR STL STV KMnO 4 F. N F. N Bray’s F. P 2 O 5 F. P 2 O 5 STV K 2 O F. K 2 O F. K 2 O Req. keywords: ha-1; soil; yield cache: jhs-438.pdf plain text: jhs-438.txt item: #324 of 600 id: jhs-439 author: Radhika, V; Aswath, C; Reddy, D C Lakshman; ., Shweta; Bhardwaj, A title: in Silico Microsatellite Development in Arum Lily (Zantedeschia aethiopica) date: 2011-06-30 words: 2664 flesch: 66 summary: EST projects for several genomes are in progress and are generating a large number of EST sequences for numerous organisms. Alternatively, in silico approach can be followed to detect simple sequence repeats (SSRs) from expressed sequence tags (ESTs) available in public biological databases. keywords: est; ests; nucleotide; repeats; sequence; ssrs; tri cache: jhs-439.pdf plain text: jhs-439.txt item: #325 of 600 id: jhs-440 author: Kirtimala, Naik; Nataraj, S K; Kulkarni, B S; Reddy, B S title: Stability Analysis for Earliness and Corm Characters in Gladiolus (Gladiolus hybridus Hort.) date: 2011-06-30 words: 2869 flesch: 51 summary: Pooled analysis of variance (mean square) for earliness and corm characters in gladiolus S.N Source of Df Days Days for Days Days from Number Number Corm Average variation for corm spike for first first to of corms of cormels diameter corm sprouting initiation floret last floret per plant per plant (cm) weight opening opening (g) 1 Genotype 13 68.52** 180.94** 179.56** 6.13 1.256** 4576.20* 2.14** 1310.8** 2 Environment 2 15.93** 11.17 14.95 19.38** 0.36 8726.34** 1.70** 770.75 3 Genotype x 26 0.46** 4.56 9.23 2.39** 0.154** 1103.96** 0.17** 206.01** Environment 4 Environment 28 1.56** 5.02* 9.6 3.60** 0.169** 1648.41** 0.28** 246.35** +(genotype x environment) 5 Environment 1 31.86** 22.34* 29.96 38.76** 0.73* 17452.7** 3.40** 1541.47* (linear) 6 Genotype x 13 0.59** 3.9 5.34 2.11 0.14 1426.32 0.18 92.50 environment (linear) 7 Pooled 14 0.31** 4.8* 12.18** 2.48** 0.15** 725.76** 0.15** 296.69** deviation 8 Pooled error 78 0.07 3.5 7.52 0.07 0.03 2 0.018 1.55 * and ** indicate significance at 5% and 1%, respectively, Df - Degree of freedom Naik Kirtimala et al J. Hortl. Genotype environmental interactions (GxE) pose a major problem in developing new cultivars and choosing suitable cultivars for any specific location, to identify the most desirable genotypes. keywords: days; environment; floret; genotypes; mean cache: jhs-440.pdf plain text: jhs-440.txt item: #326 of 600 id: jhs-441 author: Lal, S; Kumar, D; Singh, D B; Ahmed, N; Kumar, R; Dar, G A title: Effect of Pre-harvest Application of Calcium Chloride and Gibberellic Acid on Shelf-Life and Post-Harvest Quality of Apricot (Prunus armeniaca L.) Cv. Harcot date: 2011-06-30 words: 4229 flesch: 70 summary: Calcium sprays, time of harvest, and duration in-cold-storage affects fruit quality of ‘d’ Anjou’ pears in a critical year. To increase the supply of apricot fruits, there is an urgent need to study ways in which its marketing period can be extended, while ensuring high-quality. keywords: cacl; calcium; days; effect; fruit; storage cache: jhs-441.pdf plain text: jhs-441.txt item: #327 of 600 id: jhs-442 author: Sundararaju, D title: Diversity of Bee Pollinators and Flora in Cashew date: 2011-06-30 words: 2610 flesch: 67 summary: Diversity of bee pollinators was assessed by collecting bees that maintained constancy on cashew flowers in the cashew belt of coastal Karnataka and in coastal Tamil Nadu, by undertaking surveys during 2004 – 2006. Visitation of bee pollinators at fixed hours and on Diversity of bee pollinators and flora in cashew D. Sundararaju* Directorate of Cashew Research Puttur (D.K.), Karnataka-574 202, India E-mail: dsraju21@gmail.com ABSTRACT Seven species of bee that maintained constancy on cashew flowers were identified from coastal Karnataka [(Pseudapis oxybeloides (Smith), Lasioglossum sp. and Halictus sp., Halictidae; Braunsapis sp., Ceratina smaragdula (F.) and Ceratina sp., Apidae)] and four species from coastal Tamil Nadu keywords: bees; cashew; coastal; flowering; species cache: jhs-442.pdf plain text: jhs-442.txt item: #328 of 600 id: jhs-443 author: Sharma, Shashi Kumar; Banyal, Sanjeev Kumar title: Nursery Output Maximization in Mango under Low-Hill Conditions of Himachal Pradesh date: 2011-06-30 words: 2137 flesch: 60 summary: GTZ-ITFSP (2010) reported that the best spacing for transplanting mango seedlings was 30cm x 30cm. Three separate experiments were laid out to work out optimum spacing, fertilizer level and time of transplant of mango seedlings. keywords: mango; nursery; seedlings cache: jhs-443.pdf plain text: jhs-443.txt item: #329 of 600 id: jhs-444 author: Shukla, Y R; Sharma, Deepa; Tegta, Upasna title: Studies on Training Systems and NAA Application on Bell Pepper Production in Polyhouse date: 2011-06-30 words: 1731 flesch: 69 summary: Those Plants trained to two stems may have increased interception of solar radiation and better air circulation, resulting in improved plant height, number of fruits and fruit yield. Two sprays of NAA @ 15 ppm proved best for plant height, total number of flowers per plant, per cent flower drop, per cent fruit set, days to first picking, number of fruits per plant, fruit weight and total yield per plant. keywords: fruit; naa; number; plant; training cache: jhs-444.pdf plain text: jhs-444.txt item: #330 of 600 id: jhs-445 author: Bharathi, S; Kumari, S Surya; Jyothi, K Uma title: Productivity in Chilli (cv. LCA 334) as Influenced by Organic and Inorganic Nutrient Management in Vertisols date: 2011-06-30 words: 2112 flesch: 65 summary: Data on growth parameters (Table 1) revealed that application of organic manure with recommended dose of inorganic nitrogen showed superior performance in respect of growth and yield. Chilli, being a long duration crop, requires proper manuring and fertilizing in the surface soil is because of its shallow root system, for attaining high yields and quality produce (Bidari, 2000). keywords: azospirillum; manure; yield cache: jhs-445.pdf plain text: jhs-445.txt item: #331 of 600 id: jhs-446 author: Prabhakar, M; Hebbar, S S; Nair, A K title: Effect of Microsprinkler Fertigation on Growth and Yield of Rabi Onion date: 2011-06-30 words: 1820 flesch: 49 summary: Fertigation treatments were superior for marketable bulb yield as compared to soil application of fertilizer. There were significant differences for marketable bulb yield among almost all fertigation treatments, recording higher bulb yield compared to soil application treatment with furrow irrigation treatment. keywords: fertigation; fertilizers; irrigation; yield cache: jhs-446.pdf plain text: jhs-446.txt item: #332 of 600 id: jhs-447 author: Singh, Kushal; Singh, Ranjit; Kumar, Ramesh title: Effect of Pre-Storage GA3 Pulsing on Keeping Quality of Gladiolus Spikes date: 2011-06-30 words: 1405 flesch: 73 summary: Floret size also decreased with increase in storage duration (Table 1) but was maximum (9.25cm) in spikes pulse-treated with 20% sucrose + 400 mg/l Al 2 (SO 4 ) 3 .16H 2 O, + GA 3, and was minimum in Control (6.70cm). Per cent opening of florets was maximum in freshly-harvested Control spikes (60.81) and continued to decrease with increase in storage duration, and was 53.88, 45.03 and 16.55% after 7, 14 and 21 days of storage, respectively (Table 2). keywords: storage cache: jhs-447.pdf plain text: jhs-447.txt item: #333 of 600 id: jhs-448 author: Madhavi, G Bindu; Bhattiprolu, S L; Reddy, V Bali title: Compatibility of Biocontrol Agent Trichoderma viride with Various Pesticides date: 2011-06-30 words: 1421 flesch: 58 summary: Key words: Trichoderma viride, compatibility, pesticides Six seed-treatment chemicals, viz., Carbendazim (0.1%), Mancozeb (0.25%), Captan (0.3%), Tebuconazole (0.15%), Captan+Hexaconazole and Imidacloprid (0.5%); five systemic-fungicides, viz., Hexaconazole (0.2%), Propiconazole (0.15%), Tebuconazole (0.15%), Difenconazole (0.05%), Benomyl (0.1%); three contact fungicides, viz., Pencycuron ( 0.2%), Copper oxy- chloride(0.3%), Propineb (0.2%); one combination product, viz., Carbendazim+Mancozeb (0.2%), and 10 weedicides, viz., Quizalopop ethyl 5% EC , Pyrithiobac sodium 10%EC, Oxyfluoforen 3.5%EC, Cyhalopop butyl 10%EC, Glyphosate+ammonium sulphate, Pendimethalin, 2,4-D Sodium salt 80%WP, Imazithaphir 10%EC, Atrazine 50%WP and Glyphosate 41%SL were evaluated for compatibility with T.viride, in vitro, by poisoned-food technique (Nene and Thapliyal, 1993). Hence, a laboratory study was made to assess compatibility of some commonly-used, commercially available pesticides on growth and sporulation of T. viride. keywords: compatibility; trichoderma; viride cache: jhs-448.pdf plain text: jhs-448.txt item: #334 of 600 id: jhs-449 author: Singh, V K; Gupta, R K title: First Report of Meloidogyne javanica on Ginger and Meloidogyne incognita on Coriander in Jammu and Kashmir (India) date: 2011-06-30 words: 889 flesch: 61 summary: The estimated overall annual yield loss in the world’s major crops to damage by plant parasitic nematodes is reported to be 12.3% (Sasser and Freckman, 1987). Female nematodes were teased out from the galls and transferred to a drop of lactophenol taken on a clean glass slide. keywords: knot; meloidogyne; root cache: jhs-449.pdf plain text: jhs-449.txt item: #335 of 600 id: jhs-45 author: Singh, S R; Ahmed, N; Srivastava, K K; Shagoo, P A title: Studies on factors influencing the vegetative propagation in walnut (Juglans regia L. ) date: 2018-06-30 words: 3179 flesch: 67 summary: April)placed under three environmental conditions(open field,poly trench and polyhouse).Sub-apical portion of resting scion wood resulted in highest sprouting, graft success and plant growth, whereas grafting on 15th March manifested highest graft success. ABSTRACT The experiment was carried out to examine the effect ofdifferent status of physiologically resting scion wood,environment and grafting time for maximum graft success in walnut. keywords: 15th; apical; graft; grafting; march; plant; scion; success; walnut cache: jhs-45.pdf plain text: jhs-45.txt item: #336 of 600 id: jhs-450 author: Prakash, M K Chandra; Thomas, Reena Rosy; Mysore, Sudha; Vadivel, G; Thaker, Rasika title: Market Information System for Horticultural Crops:Web Application Development for Interactive Graphs date: 2011-06-30 words: 4393 flesch: 39 summary: Effort has been made to improve access to market information to all stakeholders involved in marketing of horticultural crops. Web application has been developed for Market information to display the data as Interactive graphs. keywords: crops; data; development; graph; horticultural; information; market; marketing; national; price; products; state cache: jhs-450.pdf plain text: jhs-450.txt item: #337 of 600 id: jhs-453 author: Narain, Prem title: Statistical Genomics and Bioinformatics date: 2010-12-31 words: 9041 flesch: 45 summary: Plant sequence data are generated through (i) whole genome sequencing, (ii) sample sequencing of bacterial artificial chromosomes (BACs), (iii) genome survey sequencing (GSS), and (iv) sequencing of expressed sequence tags (ESTs). The main sequence databases have a number of subsidiaries for storage of particular types of sequence data. keywords: black; cmyk; cmyk graphic; cmyk profile; color; device; graphic; gray; image; intent; point compensation; qtl; rgb; sequence; turn cache: jhs-453.pdf plain text: jhs-453.txt item: #338 of 600 id: jhs-454 author: Dinesh, M R; Vasugi, C title: Guava Improvement in India and Future Needs date: 2010-12-31 words: 13993 flesch: 56 summary: Influence of weather on chemical composition of guava fruits (Psidium guajava L.) var. High content of Vitamin C makes it stand out among guava varieties. keywords: black; cmyk; cmyk graphic; cmyk profile; color; device; device rgb; editor; fruit; graphic; gray; guajava; guava; image; intent; overprint; point compensation; prinect; psidium; rgb; rgb graphic; turn cache: jhs-454.pdf plain text: jhs-454.txt item: #339 of 600 id: jhs-455 author: Rajamanickam, C; Rajmohan, K title: Variability Studies in Palayankodan Ecotypes (AAB Genomic Group) of Banana (Musa Spp.) date: 2010-12-31 words: 4318 flesch: 45 summary: Though ripe fruit weight, number of fingers per hand, leaf width, finger width and finger weight showed moderate estimate of heritability, lower value of genetic advance reflected favourable influence of environment rather than that of the genotype, and simple selection may not be rewarding. Ramanujan and Thirumalachar (1967) suggested that heritability estimate in the broad sense is reliable if accompanied by high genetic advance. keywords: black; cmyk; device; gray; intent; number; weight cache: jhs-455.pdf plain text: jhs-455.txt item: #340 of 600 id: jhs-456 author: Gawankar, M S; Salvi, B R; Chavan, S A; Dalvi, N V title: Comparative Performance of Mango Varieties Grafted on Vellaikolamban and Mixed Rootstock date: 2010-12-31 words: 2704 flesch: 54 summary: yes Delete All Colors: no Convert All to K: no Vellaikolamban rootstock showed beneficial effect on ‘Kesar’ variety, where the yield increased by 10.3% over mixed rootstock. Data reveale that ‘Ratna’ variety on mixed rootstock exhibited 1.32 benefit to cost ratio as against 1.06 in ‘Ratna’ on Vellaikolamban rootstock. keywords: black; cmyk; gray; intent; rootstock; vellaikolamban cache: jhs-456.pdf plain text: jhs-456.txt item: #341 of 600 id: jhs-457 author: Dalvi, N V; Salvi, B R; Chavan, S A; Kandalkar, M P title: High Density Planting in Mango cv. Alphonso date: 2010-12-31 words: 2842 flesch: 55 summary: All the high density treatments recorded higher fruit yield compared to normal spacing. The major objective of the study was to optimize spacing for high density planting to obtain higher yields per unit area during the early period of the plantation. keywords: black; cmyk; gray; intent cache: jhs-457.pdf plain text: jhs-457.txt item: #342 of 600 id: jhs-458 author: Singh, Sanjay Kumar; Singh, S K title: Effect of Pruning Intensity on Leaf Tissue Micronutrient Status in Three Mango (Mangifera indica L.) Cultivars under High Density Planting date: 2010-12-31 words: 4884 flesch: 55 summary: Among the three cultivars, ‘Dashehari’ leaves had highest Zn content (Kumar et al, 1985), while ‘Amrapali’ had the lowest concentration of both Zn and Fe due to continuous production of fruiting terminals in both the years of experiment (Thakur et al, (1981). It was also noted that in the ‘on’ year, Cu and Mn content leaves was lower than in the ‘off’ year (Thakur et al, 1973) because fruiting terminals numbered more in the ‘on’ year than in the ‘off’ year which acted as a sink for mineral nutrients (Thakur et al, 1981). keywords: black; cmyk; f s; gray; intent cache: jhs-458.pdf plain text: jhs-458.txt item: #343 of 600 id: jhs-459 author: Reddy, Y T N; Kurian, Reju M; Ganeshamurthy, A N; Pannerselvam, P title: Effect of Organic Nutrition Practices on Papaya (cv. Surya) Fruit Yield, Quality and Soil Health date: 2010-12-31 words: 3411 flesch: 47 summary: Results indicated that crop growth and fruit yield were higher in inorganic fertilizer treatment (55 t ha1) compared to organic treatments (26.9 to 38 t ha-1). There was no significant variation in average fruit weight and TSS, but shelf life of the fruit was significantly higher in organic treatments (6.2 to 7.9 days) as compared to inorganic fertilizer treatment (5.1days). keywords: black; cmyk; device; gray; intent cache: jhs-459.pdf plain text: jhs-459.txt item: #344 of 600 id: jhs-461 author: Brar, J S; Bal, J S title: Role of Paclobutrazol and Ethephon in Reproductive Growth of 'Allahabad Safeda' Guava (Psidium guajava L.) Plants at Different Spacing date: 2010-12-31 words: 5725 flesch: 58 summary: Fruit Yield : Per plant fruit yield was maximum (34.79 kg/ plant) in plants sprayed with PBZ 1000 ppm, followed by 31.55 kg/plant in PBZ 500 ppm treated plants during the rainy season. In rainy season guava fruit retention recorded in plants treated with Ethephon 500 and 1000 ppm was 47.66 and 44.36%, respectively and lowest fruit retention (39.62%) was observed in PBZ 500 ppm treated plants (Table 3). keywords: black; cmyk; device; fruit; gray; intent cache: jhs-461.pdf plain text: jhs-461.txt item: #345 of 600 id: jhs-462 author: Malam, V R; Singh, S P; Ahlawat, T R; Mathukia, R K; Jat, Giriraj title: Effect of Spacing and Crop Duration on Growth, Flowering and Bulb Production in Tuberose (Polianthes tuberosa L.) Cv. Double date: 2010-12-31 words: 3931 flesch: 58 summary: Spike diameter (cm) First year crop 0.95 0.92 0.87 0.90 0.82 0.06 First ratoon crop 0.83 0.78 0.72 0.75 0.65 0.04 Second ratoon crop 0.67 0.66 0.64 0.65 0.61 NS 5. Diameter of open flower (cm) First year crop 4.6 4.4 4.0 4.3 3.9 0.6 First ratoon crop 3.3 3.0 2.4 2.7 2.2 0.18 Second ratoon crop 2.6 2.8 2.1 2.5 1.5 0.14 6. keywords: black; cmyk; crop; gray; ratoon cache: jhs-462.pdf plain text: jhs-462.txt item: #346 of 600 id: jhs-463 author: Ghosh, S N; Bera, B; Roy, s; Banik, B C title: Effect of Cultivars and Season on Grafting Success in Sapota under Paschim Midnapur Conditions of West Bengal date: 2010-12-31 words: 1867 flesch: 52 summary: Growth of the grafted plants in respect of height and leaf production was better in cultivars with higher grafting success compared to that cultivars those performed poorly in softwood grafting. Higher grafting success during the early part of monsoon (5th June to 1st July) was mainly due to favourable weather conditions (high humidity and atmospheric temperature) which could have resulted in maximum cambial activity in both stock and scion. keywords: cmyk; grafting; gray; sapota; softwood cache: jhs-463.pdf plain text: jhs-463.txt item: #347 of 600 id: jhs-464 author: Panigrahi, Hemant Kumar; Agrawal, Narendra; Agrawal, R; Dubey, Saket; Tiwari, S P title: Effect of Drip Irrigation and Polythene Mulch on the Fruit Yield and Quality Parameters of Mango (Mangifera indica L.) date: 2010-12-31 words: 3747 flesch: 53 summary: But in case of drip irrigation water is made available in the root zone there by reducing the water stress pressure directly near (Bankar et al, 1993). Increasing demand for highly efficient irrigation system calls for the use of drip irrigation, which has also been found suitable under adverse conditions of climate, soil and irrigation water (Singh et al., 1989). keywords: black; cmyk; device; drip; gray; intent; irrigation; water cache: jhs-464.pdf plain text: jhs-464.txt item: #348 of 600 id: jhs-465 author: Devadas, R; Medhi, R P; Das, S P title: Interspecific Hybrid Developed in Epidendrum Orchid from the Cross E. radicans Pav. Ex. Lindl. X E. xanthinum Lindl. date: 2010-12-31 words: 3113 flesch: 51 summary: Need for interspecific hybrids in Epidendrum orchids: Orchid breeding is carried out mainly by commercial firms and is still in its infancy in India. Key words: Epidendrum hybrids, interspecific hybridization, epiphytes, fimbriated lip, clefted anterior lobe introductions do not suffice for improving plant wealth in India (Randhawa and Mukhopadhyaya, 1986). keywords: black; cmyk; device; graphic; gray; intent cache: jhs-465.pdf plain text: jhs-465.txt item: #349 of 600 id: jhs-466 author: Kotur, S C; Keshava Murthy, S V title: Influence of De-Navelling and Stalk-End Nutrient Application on Nutrient Composition of 'Robusta' Banana Fruits date: 2010-12-31 words: 2853 flesch: 48 summary: The crop was raised on a red clay loam having pH of 6.5, electrical conductivity of 0.3 dS/m, organic carbon of 1.2%, cation exchange capacity Influence of de-navelling and stalk-end nutrient application on nutrient composition of ‘Robusta’ banana fruits S.C. Kotur and S.V. Keshava Murthy Division of Soil Science and Agricultural Chemistry Indian Institute of Horticultural Research, Bangalore-560 089, India E-mail: sckotur@gmail.com ABSTRACT The contents of N, P, Mg, S, Fe and Mn in banana fruit increased significantly due to denavelling from 0.32%, 0.086%, 0.12%, 0.024%, 52 ppm and 4.8 ppm, under ‘control’ to 0.37%, 0.085%, 0.13%, 0.027%, 59 ppm and 6.7 ppm, respectively. Substantial response of yield of banana fruits as well as the composition of the fruit may be attributed to the presence of other mineral and bio-chemical ingredients of cow dung. keywords: black; cmyk; device; gray; intent; sulphate cache: jhs-466.pdf plain text: jhs-466.txt item: #350 of 600 id: jhs-467 author: Lanjhiyana, Ravishankar; Sharma, Pravin Kumar; Shukla, N title: Studies on Effect of Chemical Preservatives on Physico-Chemical Changes of Beverages in Lime and Ginger Juice with their Combinations date: 2010-12-31 words: 3789 flesch: 50 summary: Lime and ginger juices were extracted from mature well-ripened lime and fresh ginger procured from local market. Among the various treatment RTS prepared from ginger juice with KMS 0.1% could be stored for extended period of time for sensory characteristics. keywords: black; cmyk; ginger; gray; intent; juice cache: jhs-467.pdf plain text: jhs-467.txt item: #351 of 600 id: jhs-472 author: Hanur, Vageeshbabu S title: Diversified experimentation in horticulture date: 2018-12-31 words: 890 flesch: 44 summary: Covering the post harvest aspects in fruit crops, Muralidhara et al assessed the post harvest changes in bioactive phytonutrients and total antioxidant activity during ripening of mango cv. Amrapali, through the analysis of total antioxidants, total phenols, total flavonoids and total carotenoids while noticing the profound effects of ripening on the post harvest composition of nutraceuticals. In vegetables, Varalakshmi et al have investigated into the determination of the variability, heritability, genetic advance and correlation of fruit yield and yield contributing characters in bottle gourd (Lagenaria siceraria (Mol. Stadl.)), emphasizing the importance of indirect selection. keywords: yield cache: jhs-472.pdf plain text: jhs-472.txt item: #352 of 600 id: jhs-473 author: Varalakshmi, B; Pitchaimuthu, M; Rao, E Sreenivas title: Genetic variability, correlation and path analysis in bottle gourd (Lagenaria siceraria (Mol. Standl.) germplasm date: 2018-12-31 words: 3894 flesch: 66 summary: Fruit number had maximum direct effect (0.812) on fruit yield/ha followed by fruit weight (0.407), fruit length (0.339), fruit width (0.310), fruit yield/vine (0.249), days taken for first female flower appearance (0.224) and vine length (0.173). Fruit number had maximum direct effect (0.812) on fruit yield/ha followed by fruit weight (0.407), fruit length (0.339), fruit width (0.310), fruit yield/vine (0.249), days taken for first female flower appearance (0.224) and vine length (0.173). keywords: bottle; fruit; number; yield cache: jhs-473.pdf plain text: jhs-473.txt item: #353 of 600 id: jhs-476 author: Muralidhara, B M; Veena, G L; Rajan, S; Bhattacherjee, A K; Malav, Pavan Kumar title: Effect of post harvest ripening on bioactive secondary metabolites and antioxidant activity in mango cv. Amrapali date: 2018-12-31 words: 3575 flesch: 62 summary: Carotenoid and carotenoid ester composition in mango fruit as influenced by processing method. Thereafter these amounts decreased in tenth and eleventh day of ripening when the condition of fruits deteriorated except in total carotenoids content which remained constant. keywords: activity; carotenoids; day; fruit; harvest; mango; peel; pulp; ripening; total; values cache: jhs-476.pdf plain text: jhs-476.txt item: #354 of 600 id: jhs-478 author: Ranjitha, K; Oberoi, Harinder Singh; Upreti, K K; Redappa, K title: Screening of probiotic strains for development of ready- to -serve probioticated mango beverage date: 2018-12-31 words: 4273 flesch: 53 summary: Probioticated mango beverage also had about 20 and 13% higher phenolics and flavonoids, respectively, compared to uninoculated RTS mango beverage. However, there is only a limited literature available on development of probioticated fruit beverages (Kumar et al 2015; Panghal et al 2017; Reddy et al 2015). keywords: beverage; helveticus; lactobacillus; mango; mango beverage; mtcc; population; probioticated; rts; strains cache: jhs-478.pdf plain text: jhs-478.txt item: #355 of 600 id: jhs-479 author: Dhanasekaran, D title: Effect of sprigging density and foliar nitrogen on the growth of Bermuda grass (Cynodon dactylon L. Pers. x Cynodon transvaalensis) date: 2018-12-31 words: 3793 flesch: 70 summary: Effect of sprigging density and foliar nitrogen on the growth of Bermuda grass (Cynodon dactylon L. Pers. Hence, an experiment was laid out to study the effect of different sprigging density and foliar nitrogen on the growth and establishment of bermuda grass (Cynodon dactylon L. Pers. keywords: bermuda; dap; grass; length; maximum; nitrogen; shoot; spacing cache: jhs-479.pdf plain text: jhs-479.txt item: #356 of 600 id: jhs-480 author: Shikhamany, S D; Kalbhor, J N; Shelke, T S; Mungare, T S title: Variation in the Interactions among soil K+, Ca++, Mg++ and Na+ ions as influenced by the variety and rootstock in grape date: 2018-12-31 words: 4944 flesch: 72 summary: K Ca Mg Na (mg/kg) (mg/kg) (mg/kg) (mg/kg) Mean 2.57 7.76 0.604 15.79 7.7 110.8 456.0 141.4 70.4 SD 1.08 0.52 0.428 4.21 1.82 54.2 118.8 29.5 17.4 CV(%) 27.8 14.9 70.9 26.7 32.6 48.9 26.1 20.9 24.7 Cook and Lider, 1964; Downton, 1977); and different varieties and rootstocks were involved in these cor r ela tions, K Ca Mg Na_______________________________________________________ keywords: absorption; cations; cent; contents; dog; petiole; rootstock; soil; sonaka cache: jhs-480.pdf plain text: jhs-480.txt item: #357 of 600 id: jhs-483 author: Bhat, M G; Nagaraja, K V; Rupa, T R title: Cashew research in India date: 2010-06-30 words: 10370 flesch: 63 summary: Macronutrient removal by cashew nuts and the cashew apple was N > Influence of different conservation measures on runoff, soil and nutrient loss under cashew nut in lateritic soils of south Konkan region. keywords: anacardium; bhat; cashew; cashew research; crops; effect; et al; growth; india; kernel; management; nut; nuts; occidentale; plant; production; research; sci; soil; varieties; water; yadukumar; yield cache: jhs-483.pdf plain text: jhs-483.txt item: #358 of 600 id: jhs-485 author: Tarai, R K; Ghosh, S N title: Varietal Evaluation for Yield and Yield Parameters of Ber under Semi-Arid Region of West Bengal date: 2010-06-30 words: 2597 flesch: 69 summary: Varietal evaluation for yield and yield parameters of ber under semi-arid region of West Bengal R.K. Tarai and S.N. Ghosh1 Krishi Vigyan Kendra (Nayagarh) Orissa University of Agriculture and Technology, Panipoila, Balugaon E-mail: ranjan_04@rediffmail.com ABSTRACT An experiment was conducted in a private orchard 5 km away from Regional Research Station, Bidhan Krishi Viswavidyalaya, West Bengal, during 2004-2005 to study fruit drop, retention, maturity and fruit yield of ten cultivars of ber. Fruit set, fruit drop and fruiting behaviour in certain ber (Zizyphus mauritiana Lamk.) cultivars. keywords: ber; cultivars; days; fruit; week; yield cache: jhs-485.pdf plain text: jhs-485.txt item: #359 of 600 id: jhs-486 author: Varalakshmi, B; ., Devaraju title: Genetic Variability in Indian Spinach (Basella alba L.) date: 2010-06-30 words: 2543 flesch: 58 summary: Moderate heritability along with high genetic advance was recorded for leaf weight and total plant weight, indicating the presence of additive gene effects. Wide range of variation was observed in most of the characters like branch number (2.30-5.36), leaf number (15.33-40.56), leaf weight (34.16-160.55 g), stem weight (22.50-78.33 g) and total plant weight (68.50- 260.43 g). keywords: basella; leaf; length; number; plant; weight cache: jhs-486.pdf plain text: jhs-486.txt item: #360 of 600 id: jhs-487 author: Ghosh, S N; Pal, P P title: Effect of Basin Versus Drip Irrigation on Quality Production in Mosambi Sweet Orange date: 2010-06-30 words: 3023 flesch: 66 summary: Application of water through drip irrigation along with some mulching materials may be helpful for getting quality fruits. Several workers established the usefulness of drip irrigation in citrus for better plant growth and higher production of quality fruits in addition to other economical benefits of cultivation (Deidda et al, 1994; Kanber et al, 1996; Tayde and Ingle, 1999). keywords: drip; epan; irrigation; plants; polythene cache: jhs-487.pdf plain text: jhs-487.txt item: #361 of 600 id: jhs-488 author: Jana, J C; Guha, S; Chatterjee, R title: Effect of planting geometry and nitrogen levels on crop growth, fruit yield and quality in okra grown during early winter in terai zone of West Bengal date: 2010-06-30 words: 2620 flesch: 62 summary: Normally, higher amount of nitrogen fertilizer has a positive effect on Effect of planting geometry and nitrogen levels on crop growth, fruit yield and quality in okra grown during early winter in terai zone of West Bengal J.C. Jana, S. Guha and R. Chatterjee Department of Vegetable and Spice Crops Uttar Banga Krishi Viswavidyalaya Pundibari, Coochbehar, West Bengal - 736 165, India E-mail: janajc@rediffmail.com ABSTRACT A field-experiment was conducted in early winter of 2006 and 2007 under sub-Himalayan terai agroclimatic region of West Bengal to evaluate comparative effect of planting geometry and nitrogen levels on growth, yield and fruit quality in okra variety Arka Anamika. Key words: Okra, spacing, nitrogen levels, yield and quality fruit size, fruit weight and fruit yield. keywords: fruit; yield cache: jhs-488.pdf plain text: jhs-488.txt item: #362 of 600 id: jhs-489 author: Shylla, Bunty; Sharma, C L title: Evaluation of Mulch Colour for Enhancing Winter-Strawberry Production under Polyhouse in Mid-Hills of Himachal Pradesh date: 2010-06-30 words: 2239 flesch: 65 summary: Use black polythene for higher strawberry fruit yield. In an effort to make the crop remunerative through enhanced winter-production, a polyhouse experiment was set up to investigate influence of mulch colour on off-season fruiting response, fruit size and quality in strawberry ( keywords: fruit; mulch; polyhouse; polythene; soil; strawberry; yield cache: jhs-489.pdf plain text: jhs-489.txt item: #363 of 600 id: jhs-493 author: Chitra, R; Rajamani, K; Jawaharlal, M title: Variability for Qualitative and Quantitative Traits in Glory Lily (Gloriosa superba L.) date: 2010-06-30 words: 2195 flesch: 54 summary: Details of Gloriosa superba genotypes collected in 2007 Sl.No. These easily observable morphological traits are useful tools for preliminary evaluation, because, they offer a fast and reliable approach for assessing extent of diversity in G. superba genotypes. keywords: genotypes; gloriosa; plant; seed; superba; traits cache: jhs-493.pdf plain text: jhs-493.txt item: #364 of 600 id: jhs-494 author: Varu, D K; Barad, A V title: Effect of Stem Length and Stage of Harvest on Vase-Life of Cut Flowers in Tuberose (Polianthes tuberosa L.) Cv. Double date: 2010-06-30 words: 4026 flesch: 71 summary: Effect of harvest maturity and spike length on post harvest life of gladiolus. Effect of harvesting stages and chemical preservatives on post harvest life of golden rod (Solidago canadensis Linn.) keywords: day; life; stage; vase cache: jhs-494.pdf plain text: jhs-494.txt item: #365 of 600 id: jhs-495 author: Singh, S R; Sundouri, A S; Sharma, M K; Srivastava, K K; Dar, H A title: Proliferation and Rooting Efficiency Studies in Sour Cherry (Prunus cerasus) Using in Vitro Techniques date: 2010-06-30 words: 3028 flesch: 61 summary: Hammerschlag et al (1987) observed highest shoot proliferation in peach with 2 mg L-1 BA + 0.01 mg L-1 IBA. For shoot proliferation, IBA and BAP each at four different concentrations viz., 0.00, 0.05, 0.10, 0.15 mgL-1 and 0, 1, 2 and 3 mg/l, were used respectively. keywords: bap; iba; l-1; medium; shoots cache: jhs-495.pdf plain text: jhs-495.txt item: #366 of 600 id: jhs-497 author: Kotur, s c; Keshava Murthy, s v title: Enhancing Fruit Yield in 'Ney Poovan' Banana (Musa paradisiaca L.) by De-Navelling and Feeding N, K and S through Distal Stalk-End of the Bunch date: 2010-06-30 words: 3243 flesch: 69 summary: E ff ec t of d e- n av el li n g an d f ee d in g n u tr ie n ts t h ro u gh t h e st al k -e n d o f ‘N ey P oo va n ‘ b an an a on f re sh w ei gh t of b u n ch , fr u it w ei gh t an d i ts c om p os it io n T re at m en t B un ch F ru it N i n P i n K i n C a in M g in S in F e in f ru it w ei gh t ( g) w ei gh t ( g) keywords: bunch; cow; dung cache: jhs-497.pdf plain text: jhs-497.txt item: #367 of 600 id: jhs-498 author: Sunitha, N; Basavaraja, P K; Dhananjaya, B N title: Response of Beet Root Tubers to Gypsum, P Levels, Boron and Iron Sulphate in Salt-Affected Soils date: 2010-06-30 words: 3491 flesch: 66 summary: However, treatment S 6 consisting of application of P at a higher level plus recommended NK along with FeSO 4 , and, S 7 consisting of application of recommended NPK along with borax and FeSO 4 were found to be on par with treatment S 8 . Among the nutrients, treatment S 8 recorded significantly higher N, P and K uptake irrespective of gypsum application (44.96, 11.66 and 30.22 kg ha-1, respectively), followed by the treatment S 6 . keywords: gypsum; ha-1; uptake cache: jhs-498.pdf plain text: jhs-498.txt item: #368 of 600 id: jhs-500 author: Doijode, S D title: Long-Term Seed Storage Studies in Radish (Raphanus sativus L.) date: 2010-06-30 words: 1639 flesch: 58 summary: Seed storage is widely practiced for preservation of genetic resources especially for medium to long term conservation and it is popular amongst conservationist in view of easy handling, economical and able to maintain genetic stability on conservation. Seed storage in radish in laminated aluminium foil pouches at 5°C was effective as well as cost effective in maintaining high viability (89%) for longer period (25 years) and useful in germplasm conservation avoiding thereby frequent growing of crop and genetic erosion. keywords: seed; storage cache: jhs-500.pdf plain text: jhs-500.txt item: #369 of 600 id: jhs-502 author: Chaudhary, Vipin; Tripathi, R S title: Incidence of Rodent Pests in Cumin (Cuminum cyminum L.) and their Management date: 2010-06-30 words: 2663 flesch: 59 summary: Distribution pattern of live rodent-burrows in cumin fields treated with rodenticide Mean live burrow count at different crop growth stages/ha (Nos.) Rodent damage in cumin at different crop growth stages Plot type Vegetative growth stage/ Flowering/ Fruit set stage Seedling stage Burrow Damage Burrow Damage density/m2 (%) density/m2 (%) keywords: control; crop; cumin; growth; rodent; stage; treatment cache: jhs-502.pdf plain text: jhs-502.txt item: #370 of 600 id: jhs-503 author: Gawankar, M S; Sawale, R D; Pawar, S N; Chavan, S A title: Effect of Ethrel® on Flowering, Sex-Expression and Yield in Cashew date: 2010-06-30 words: 2193 flesch: 65 summary: Gajbhiye et al (2007) and Mohan and Rao (1995) also reported highest nut yield with Ethrel® spray. In respect of flowering behaviour, Ethrel® treatments of 100, 200 and 400 ppm (T 3 , T 4 & T 5 ) showed a positive impact and produced significantly higher number of flowering panicles, i.e., 12, 10 and 11m-2, than in control (T 1 ) or water spray (T 2 ), i.e., 7.3 m-2. keywords: cashew; ethrel; ppm cache: jhs-503.pdf plain text: jhs-503.txt item: #371 of 600 id: jhs-506 author: Deshmukh, N A; Waskar, D P; Sable, P B title: Variability in Markingnut (Semecarpus anacardium L.) Accessions from Marathwada Region of Maharashtra State date: 2010-06-30 words: 2090 flesch: 70 summary: Higher fruit weight is a preferred character in markingnut. Therefore, a study was conducted to assess variation in physico-chemical characteristics of markingnut fruits and to identify superior clones and elite seedlings in Marathwada region of Maharashtra state. keywords: hd-5; markingnut; pericarp; weight cache: jhs-506.pdf plain text: jhs-506.txt item: #372 of 600 id: jhs-507 author: Kotur, S C; Keshava Murthy, S V title: Nutrient Dynamics of Annual Growth-Flush in Mango (Mangifera indica L.) date: 2010-06-30 words: 1770 flesch: 56 summary: Requirement by new growth during this phase is considerable Short communication Nutrient dynamics of annual growth-flush in mango (Mangifera indica L.) S.C. This involves nutrient movement from plant parts not subjected to pruning for long periods (framework) to seasonal growth, which occurs once or more often in a year and remobilization from current season’s growth to framework at the end of the growing season. keywords: concentration; fruit; growth; internodes cache: jhs-507.pdf plain text: jhs-507.txt item: #373 of 600 id: jhs-508 author: Sadarunnisa, Syed; Madhumathi, C; Rao, G Srinivasa; Sreenivasulu, B title: Effect of Fertigation on Growth and Yield of Turmeric Cv. Mydukur date: 2010-06-30 words: 1448 flesch: 59 summary: T1 -100% recommended dose of N & K through drip T2 -75% recommended dose of N & K through drip T3 - 50% recommended dose of N & K through drip T4 - 100% recommended dose of N & K through soil and irrigation by drip T5 -100% recommended dose of N & K through soil and conventional irrigation Recommended dose of fertilizer (RDF) comprised of 180 Kg N, 60 Kg P2 O5 and 120 Kg K2O ha-1. Hence, fertigation with 75% recommended dose of fertilizer is profitable. keywords: dose; drip cache: jhs-508.pdf plain text: jhs-508.txt item: #374 of 600 id: jhs-510 author: Baskaran, V; Jayanthi, R; Janakiram, T; Abirami, K title: Evaluation of Post Harvest Quality of some Cultivars of Chrysanthemum date: 2010-06-30 words: 1411 flesch: 71 summary: Water loss due to decline in uptake of water coupled with transpiration leads to water deficit, which ultimately reduces turgidity in cut flower. Zagory and Reid (1986) and Weitte et al (1991) reported that stem plugging due to microorganisms reduces the vase life of cut flowers. keywords: arka; flower cache: jhs-510.pdf plain text: jhs-510.txt item: #375 of 600 id: jhs-515 author: Surya, R; Geethumol, T; Anitha, P title: Quality in Coriander leaves as influenced by growing conditions date: 2018-12-31 words: 1626 flesch: 64 summary: Effect of growing conditions on quality parameters in coriander Volatile oil (%) Vitamin C(mg) Varieties Rain shelter Open field Mean Rain shelter Open field Mean CO-1 0.06 0.06 0.06 124.55 209.35 166.95 CO-2 0.06 0.05 0.05 116.60 177.55 147.08 CO-3 0.06 0.06 0.06 148.40 233.20 190.80 CO(Cr-4) 0.05 0.05 0.05 127.20 103.25 115.23 Arka Isha 0.06 0.06 0.06 106.00 225.25 165.63 Mean 0.06 0.05 124.55 189.72 CD(0.05) Growing conditions NS 12.45 Varieties NS 19.69 Interaction NS 27.84 J. Hortl. The interaction effect of growing conditions varieties with respect to herbage yield was not significant. keywords: conditions; field; rain; shelter; varieties cache: jhs-515.pdf plain text: jhs-515.txt item: #376 of 600 id: jhs-516 author: Kumar, Pushpa Chethan; Azeez, Shamina; Roy, T K title: Development of moringa infusion for green tea and its evaluation date: 2018-12-31 words: 2535 flesch: 68 summary: Sci. Vol. 13(2) : 192-196, 2018 Development of moringa infusion for green tea and its evaluation Pushpa Chethan Kumar1*, Shamina Azeez2 and T.K. Roy2 *1Division of Post Harvest Technology and Agricultural Engineering, 2Division of Crop Physiology and Biochemistry, ICAR-Indian Institute of Horticultural Research, Hesaraghatta Lake Post, Bengaluru, Karnataka, India - 560 089 *Email: pushpa0908@gmail.com ABSTRACT Moringa oleifera leaves are known for its high nutritional quality. Kuriyama et al. (2006) studied the association between consumption of green tea and mortality for over 11 years. keywords: acid; content; infusion; moringa; tea; tulsi cache: jhs-516.pdf plain text: jhs-516.txt item: #377 of 600 id: jhs-517 author: Anitha, P; Devi, S Nirmala; Kurian, P Sainamole title: Seed yield and quality as affected by weed management practices in bitter gourd date: 2018-12-31 words: 2018 flesch: 68 summary: Key Words: Bitter gourd, weed, seed quality, seed yield, germination, vigour index INTRODUCTION *Email: anitha.p@kau.in ABSTRACT Effect of weed management practices on seed yield and quality of bitter gourd var. keywords: control; quality; seed; seedling; vigour; weed; yield cache: jhs-517.pdf plain text: jhs-517.txt item: #378 of 600 id: jhs-518 author: Sathappan, C T title: Evaluation of tuberose (Polianthes tuberosa L.) genotypes under coastal ecosystem of Tamil Nadu date: 2018-12-31 words: 4087 flesch: 66 summary: Farmers field at Pachamalayankottai, Dindugul Dt., PT -2 Farmers field at Sempatti, Dindugul Dt., PT -7 Farmers field at Nilakottai, Dindugul Dt., PT -8 keywords: farmers; field; genotypes; heritability; plant; variability cache: jhs-518.pdf plain text: jhs-518.txt item: #379 of 600 id: jhs-519 author: Nasiya-Beegum, A N; Subramanian, Madhu title: Effect of configuration of calyx in cowpea flowers on infestation by spotted pod borer, Maruca vitrata (Fab.) (Lepidoptera: Crambidae) date: 2018-12-31 words: 1620 flesch: 63 summary: Free sepals 211 Cowpea calyx and infestation would provide the first instar borer larvae some extent of concealment as well as enable it to bore into the flower more easily. Free sepals would provide the first instar borer larvae some extent of concealment as well as enable it to bore into the flower more easily. keywords: accessions; calyx; cowpea; sepals cache: jhs-519.pdf plain text: jhs-519.txt item: #380 of 600 id: jhs-520 author: Praveen, N M; Vijayaraghavan, Reshmy; Beena, S; Krishnan, S title: Occurrence of powdery mildew disease of Gerbera in Kerala date: 2018-12-31 words: 1882 flesch: 54 summary: Sci. Vol. 13(2) : 217-220, 2018 Occurrence of powdery mildew disease of Gerbera in Kerala N.M. Praveen*1, Reshmy Vijayaraghavan1, S. Beena1 and S. Krishnan2 1Department of Plant Pathology, College of Horticulture, Kerala Agricultural University, Kerala, India-680 656 2Dept of Agricultural Statistics, College of Horticulture, Kerala Agricultural University, Kerala, India-680 656 Email: pn40785@gmail.com, drreshmydhanesh@gmail.com, reshmy.v@kau.in ABSTRACT A purposive sampling survey on the hilly tracts of Wayanad, Kerala revealed the existence of powdery mildew disease in gerbera crops, grown under both protected and open field condition. keywords: cent; chulliyode; disease; gerbera; mildew; powdery cache: jhs-520.pdf plain text: jhs-520.txt item: #381 of 600 id: jhs-524 author: Dhanasekaran, D title: Influence of growth regulating chemicals on growth and flowering in Jasmine (Jasminum sambac.Ait.) date: 2018-12-31 words: 3531 flesch: 71 summary: Effect of plant growth regulators of corm production in gladiolus. Effect of foliar spray of plant growth regulators on flowering and vase life of Tuberose (Polyanthus tuberose L.). keywords: dap; flowering; ga3; growth; plant; ppm cache: jhs-524.pdf plain text: jhs-524.txt item: #382 of 600 id: jhs-527 author: Lawande, K E; Khar, Anil; Mahajan, V; Srinivas, P S; Sankar, V; Singh, R P title: Onion and Garlic Research in India date: 2009-12-31 words: 20576 flesch: 64 summary: Significant positive correlation between clove and bulb mean-weight, negative correlation between clove mean-weight and clove-number has also been reported (Baghalian et al., 2005). Diversity assessment on the basis of morphological (Panthee et al, 2006; Baghalian et al, 2005), physical-chemical, productive and molecular characteristics (Mota et al, 2004), allicin content (Baghalian et al., 2006), pungency (Natale et al, 2005), productive and qualitative characteristics (Resende et al, 2003) and chemotaxonomic classification (Storsberg et al, 2003) have been studied. keywords: 1998; 2006; 2007; allium; application; bulb; cepa; control; crop; day; development; disease; effect; et al; garlic; genetic; hortl; hybrids; india; irrigation; lawande; lines; management; new; onion; onion thrips; onion varieties; plant; production; red; research; sativum; sci; seed; short; singh; storage; studies; thrips; varieties; vol; weed; white; yield cache: jhs-527.pdf plain text: jhs-527.txt item: #383 of 600 id: jhs-528 author: Prasad, H M Kallesh; Mythili, J B; ., Tejaswini; Anand, Lalitha; Rashmi, H J; Suneetha, C title: Optimization of Regeneration Protocol and Agrobacterium Mediated Transformation in Carnation (Dianthus caryophyllus L.) date: 2009-12-31 words: 4490 flesch: 52 summary: Most of the reports on carnation regeneration have utilized combination of BAP and NAA (Nugent et al, 1991; Firoozabady et al, 1995; Van Altvorst et al, 1996). It was observed that carnation leaf explants were resistant to infection by Agrobacterium as evidenced by the lack of Agrobacterium overgrowth even after 3-4 days of co-cultivation. keywords: agrobacterium; carnation; explants; leaf; medium; regeneration; shoots; transformation cache: jhs-528.pdf plain text: jhs-528.txt item: #384 of 600 id: jhs-529 author: Sharma, Puja; Sharma, Y D; Gupta, Y C title: Effect of paclobutrazol and benzyl adenine on oriental lily hybrids date: 2009-12-31 words: 3312 flesch: 69 summary: Flower buds were initiated earlier in ‘Star Gazer White’ (84.48 days) as compared to ‘Star Gazer Pink’ (85.90 days). It is evident from the data (Table 2a) that mean height of plants of ‘Star Gazer White’ was more (84.46 cm) as compared to ‘Star Gazer Pink’ (81.38 cm). keywords: gazer white; growth; plant; star gazer; white cache: jhs-529.pdf plain text: jhs-529.txt item: #385 of 600 id: jhs-53 author: Laishram, M; Ghosh, S N title: Nutrient management in jackfruit (Artocarpus heterophyllus Lam.) under rainfed condition date: 2018-06-30 words: 3381 flesch: 65 summary: Combined application of organic manures and inorganic fertilizers in fruit trees is now emerging as integrated nutrient supply (INS) appr oa ch for susta inable higher production of quality fruits. r ee) a nd t his t r ea t ment a ls o resulted in highest fruit yield. keywords: fruit; jackfruit; manures; npk; soil; tree; year; yield cache: jhs-53.pdf plain text: jhs-53.txt item: #386 of 600 id: jhs-530 author: Kumar, Dhiraj; Singh, B P; Singh, Viveka Nand title: Effect of Integrated Nutrient Management on Growth, Flowering Behaviour and Yield of African Marigold (Tagetes erecta L.) Cv. African Giant Double Orange date: 2009-12-31 words: 2812 flesch: 52 summary: Among all treatments, application of Azotobacter + PSB + FYM +50% N and P + full K (T 11 ) recorded maximum flower yield per hectare (196.66 and 212.72 q/ha) and shelf life (7.12 and 7.69 days), followed by Azotobacter + PSB + FYM + full NPK and further it was significantly superior over all the treatments during both the years. The effect of combined application of Azotobacter + PSB culture in association with nitrogen and phosphorus with or without FYM was observed to be better than the application of culture inoculation alone/combination. keywords: azotobacter; fym; marigold; psb; yield cache: jhs-530.pdf plain text: jhs-530.txt item: #387 of 600 id: jhs-531 author: Wani, S A; Siddique, M A A; Khan, F U; Qadri, Z A; Khan, F A; Dar, Q A H; Ali, S title: Effect of Pulsing Treatments for Enhancing Shelf-Life of Cut Asiatic Lilium cv. Elite date: 2009-12-31 words: 3702 flesch: 64 summary: Water loss Data presented in Table 2 revealed that various pulsing treatments had significant influence on water loss behaviour of cut Asiatic lilium throughout the period compared with control which could also be evidenced from the cumulative data on water loss. Our results are in close conformity with those of Gowda and Murthy (1992) who reported that water uptake and thus water loss was significantly higher in sucrose + keywords: cut; ppm; pulsing; sucrose; water cache: jhs-531.pdf plain text: jhs-531.txt item: #388 of 600 id: jhs-532 author: Kavitha, C; Vadivel, E; Sivasamy, R; Rajamani, K title: Analyzing Variability in Coleus forskohlii Briq. Using RAPD Markers date: 2009-12-31 words: 2993 flesch: 56 summary: The results indicated that RAPD could be used for genetic diversity analysis in C. forskohlii using higher number of primers as it is reliable, easy, rapid and cost-effective. Hence, it is suggested that further genetic diversity analysis in C. forskohlii with more number of primers for RAPD or the advanced marker system producing a large number of informative polymorphic markers per primer pair that are highly reliable and reproducible (Mueller and Wolfenbarger, 1999 ; Mullis et al, 1986) has to be attempted. keywords: forskohlii; genotypes; growth; leaves; pubescence; roots; sub cache: jhs-532.pdf plain text: jhs-532.txt item: #389 of 600 id: jhs-533 author: Murthy, D Sreenivasa; Prabhakar, B S; Hebbar, S S; Srinivas, V; Prabhakar, M title: Economic Feasibility of Vegetable Production under Polyhouse:A Case Study of Capsicum and Tomato date: 2009-12-31 words: 3428 flesch: 55 summary: Annul and seasonal production costs were used directly and it is only a question of apportion the cost of establishment. The pay back period for polyhouse production of capsicum was found to be less than two years or four production seasons. keywords: capsicum; cost; cultivation; polyhouse; price; production; tomato; years cache: jhs-533.pdf plain text: jhs-533.txt item: #390 of 600 id: jhs-534 author: Venugopalan, R; Pitchaimuthu, M title: Statistical Models for Stability Analysis in Watermelon date: 2009-12-31 words: 3833 flesch: 60 summary: MATERIAL AND METHODS Fourteen promising F 1 hybrids of watermelon namely, IIHR-188 X IIHR-118, IIHR 114 X IIHR 118 , IIHR 119 X IIHR-20-1, Arka Manik X IIHR 46, IIHR 43 X IIHR 46, Arka Manik X IIHR-188, Arka Jyothi, NS-295, Kushboo, Madhubala, Apoorva, CWH-7 and Riya evaluated in the experimental plots of Division of Vegetable Crops, Indian Institute of Horticultural Research, Bangalore during 2002- 04, were utilized to develop stability models with a view to identify best variety(s) for commercial exploitation based on Yield (t ha-1), fruit length (cm), fruit girth (cm), days to first male flower opening & female flower opening, Rind thickness(cm) and TSS (%). Statistical models for stability analysis in watermelon R.Venugopalan and M. Pitchaimuthu1 Section of Economics and Statistics Indian Institute of Horticultural Research Hessearghatta Lake PO, Bangalore-560 089, India E-mail: venur@iihr.ernet.in ABSTRACT Fourteen promising F 1 hybrids of watermelon namely IIHR-188 X IIHR-118, IIHR 114 X IIHR 118 , IIHR 119 X IIHR- 20-1, Arka Manik X IIHR 46, IIHR 43 X IIHR 46, Arka Manik X IIHR-188, Arka Jyothi, NS-295, Kushboo, Madhubala, Apoorva, CWH-7 and Riya were evaluated in experimental plots of Division of Vegetable Crops, Indian Institute of Horticultural Research, Bangalore during 2002-04. keywords: ih r; r -1 cache: jhs-534.pdf plain text: jhs-534.txt item: #391 of 600 id: jhs-535 author: Ghosh, S N; Bera, B; Roy, S; Kundu, A title: Effect of Plant Growth Regulators in Yield and Fruit Quality in Pomegranate cv. Ruby date: 2009-12-31 words: 1778 flesch: 68 summary: Fruit yield was calculated on the basis of actual weight of mature fruits harvested from each plant up to onset of rainy season i.e., 10th June. Fruit yield was highest in both the years of investigation with foliar application of NAA (25 ppm) increase in yield was more than double compared to the control plants. keywords: fruit; growth; pomegranate; ppm; yield cache: jhs-535.pdf plain text: jhs-535.txt item: #392 of 600 id: jhs-536 author: Gill, P P S; Bal, J S title: Effect of Growth Regulator and Nutrients Spray on Control of Fruit Drop, Fruit Size and Quality of Ber under Sub-Montane Zone of Punjab date: 2009-12-31 words: 2071 flesch: 66 summary: Sci. Vol. 4 (2): 161-163, 2009 Effect of growth regulator and nutrients spray on control of fruit drop, fruit size and quality of ber under sub-montane zone of Punjab P.P.S. Gill and J.S. Bal Department of Horticulture Punjab Agricultural University Ludhiana - 141 004, Punjab, India E-mail: timgill740@rediffmail.com ABSTRACT The effect of foliar spray of plant growth regulators and nutrients on fruit drop, fruit size and quality was studied in ber cv Sanuar-2 at Krishi Vigyan Kendra, Hoshiarpur, Punjab Agricultural University, Ludhiana, during 2005-2006. The data on fruit drop, fruit colour, fruit size and weight are presented in Table 1. keywords: ber; control; drop; fruit; kno; znso cache: jhs-536.pdf plain text: jhs-536.txt item: #393 of 600 id: jhs-537 author: Ghosh, S N; Bera, B; Roy, S; Kundu, A; Roy, S K Dutta title: Effect of Nutrients and Plant Growth Regulators on Fruit Retention, Yield and Physico-Chemical Characteristics in Aonla Cv. NA-10 date: 2009-12-31 words: 1967 flesch: 65 summary: In West Bengal, the demand for aonla fruits has been progressively increased due to its popularity for preparation of chip bits and morabba. Effect of micro-nutrients and plant growth regulators on yield and physico-chemical characteristics of aonla fruits in NA-10. keywords: aonla; fruit; naa; plant; ppm; yield cache: jhs-537.pdf plain text: jhs-537.txt item: #394 of 600 id: jhs-538 author: Ravishankar, K V; Aghora, T S; Mohan, N; Naveen, A H; Krishnareddy, M title: Identification of RAPD Marker Linked to Mungbean Yellow Mosaic Virus Resistance in French Bean (Phaseolus vulgaris L.) date: 2009-12-31 words: 2141 flesch: 58 summary: Bulk segregant analysis (BSA): BSA was employed to identify RAPD marker linked to MYMV resistance. RAPD marker OPP 07 730 linked to MYMV resistance using bulk segregant analysis J. Hortl. keywords: bean; dna; marker; mymv; rapd; resistance cache: jhs-538.pdf plain text: jhs-538.txt item: #395 of 600 id: jhs-539 author: Yadav, Murlee; Chaudhary, Rashmi; Singh, D B title: Heterosis in Bitter Gourd (Momordica charantia L.) date: 2009-12-31 words: 3379 flesch: 85 summary: -17.44 4.52 -0.37 6.29 1.31 1.87 -2.90 L 5 x T 3 -13.95 -15.91 8.94 -4.52 8.08 -5.28 4.59 -8.34 L 5 x T 4 -8.14 -31.30* 9.81 -6.04 10.05 -5.83 2.91 -11.94 L 6 x T 1 45.61* Estimates of heterobeltiosis and mean heterosis (%) for various traits in bitter gourd Cross Vitamin C Powdery mildew content infestation BP M P BP M P L 1 x T 1 1.16 -1.13 -12.12 27.01* L 1 x T 2 6.56* -0.72 -23.23* 4.11 L 1 x T 3 32.97* 9.75* -12.12* 15.23* L 1 x T 4 0.34 0.19 -6.06 14.81* L 2 x T 1 14.86* -18.85* -20.00* 8.47 L 2 x T 2 22.3* -18.65* -10.00 13.39 L 2 x T 3 8.11 -3.03 -5.00 15.15* L 2 x T 4 16.22* -15.27* -2.50 9.09 L 3 x T 1 2.98 -2.72 -7.91 44.63* L 3 x T 2 5.35* -5.19* -4.32 43.01* L 3 x T 3 26.92* 8.71* -2.88 41.36* L 3 x T 4 0.00 -2.99* -1.44 35.64* L 4 x T 1 2.49 -3.52* -7.32 41.61* L 4 x T 2 5.39* -5.58 -5.28 37.06* L 4 x T 3 28.02* 10.17* -3.66 35.43* L 4 x T 4 0.00 -3.41* -3.25 27.96* L 5 x T 1 3.69 0.90 -7.03 43.37* L 5 x T 2 0.00 -1.89 -5.04 38.29* L 5 x T 3 52.20* 18.38* -5.08 35.00* L 5 x T 4 8.53* 2.94* -3.91 28.50* L 6 x T 1 0.38 -1.12 -10.95* 39.43* L 6 x T 2 1.52 -4.64* -8.03 36.96* L 6 x T 3 38.46* 13.26* -6.20 35.98* L 6 x T 4 1.16 0.19 -3.65 32.00* S. Em. (±) 0.21 0.19 0.19 0.16 * keywords: gourd; heterosis cache: jhs-539.pdf plain text: jhs-539.txt item: #396 of 600 id: jhs-54 author: Girija, D; Rajeevan, P K; Balakrishnan, Swathi; Panchami, P S; Mohan, Mahesh title: 16S rRNA gene taxonomic profiling of endophytic bacteria associated with phylaenopsis roots date: 2018-06-30 words: 1952 flesch: 61 summary: Illumina-based analysis of endophytic bacterial diversity of tree peony (Paeonia Sect. Generally, endophytes play an important role in promoting plant growth and yield, suppress pathogens, aid in removing heavy metal contaminants, solubilize phosphate or contribute to nitrogen assimilation for plants (Hallmann et al., 2006). keywords: bacteria; plant; roots cache: jhs-54.pdf plain text: jhs-54.txt item: #397 of 600 id: jhs-540 author: Baskaran, V; Jayanthi, R; Janakiram, T; Abirami, K title: Studies on Genetic Variability, Heritability and Genetic Advance in Chrysanthemum date: 2009-12-31 words: 1727 flesch: 49 summary: For effective selection, it is necessary to separate genetic variability from total variability, which enables breeders to adopt suitable breeding programmes. The assessment of genetic variability is necessary to evaluate the performance of the individual cultivars. keywords: flower; genetic; number; plant cache: jhs-540.pdf plain text: jhs-540.txt item: #398 of 600 id: jhs-541 author: Kumar, P Hemanth; Kulkarni, B S title: Genetic Variability in Gladiolus for Growth and Flowering Characters (Gladiolus hybridus Hort.) date: 2009-12-31 words: 2269 flesch: 67 summary: No. Parent Days for bud Days for first floret Days for first to Duration of initiation opening last floret opening flowering 1 A. Beauty 62.81 70.67 14.38 15.11 2 Sylvia 66.14 72.97 12.12 10.66 3 Melody 63.25 72.80 13.68 15.77 4 S. Sunshine 66.86 75.12 14.57 12.40 5 Vedanapoli 77.71 85.18 14.57 15.86 6 Magic 80.93 88.72 13.34 17.92 7 Priscilla 71.88 80.40 13.69 17.28 Hybrid 1 A. Beauty x Sylvia 68.93 77.34 13.23 14.69 2 A. Beauty x Melody 61.76 69.71 10.57 12.69 3 A. Beauty x S. Sunshine 68.10 76.90 15.30 15.69 4 A. Beauty x Vedanapoli 70.16 77.57 15.22 15.33 5 A. Beauty x Magic 82.11 89.11 13.42 14.06 6 A. Beauty x Priscilla 61.24 71.68 13.07 16.28 7 Sylvia x Melody 60.58 69.04 11.51 12.95 8 Sylvia x S. Sunshine 68.07 76.46 15.24 9.33 9 Sylvia x Vedanapoli 63.94 71.87 13.72 16.69 10 Sylvia x Magic 65.74 71.43 10.15 15.68 11 Sylvia x Priscilla 69.19 79.29 11.16 14.24 12 Melody x S. Sunshine 68.73 76.40 14.16 16.33 13 Melody x Vedanpoli 62.18 70.43 15.16 13.75 14 Melody x Magic 69.93 78.47 11.89 15.88 15 Melody x Priscilla 67.34 75.24 12.40 15.89 16 S. Sunshine x Vedanpoli 74.69 82.37 15.25 16.75 17 S. Sunshine x Magic 78.62 89.93 13.78 16.56 18 S. Sunshinex Priscilla 66.23 73.86 13.34 11.57 19 Vedanpoli x Magic 82.21 90.52 15.40 19.35 20 Vedanpoli x Priscilla 73.90 84.62 13.18 13.91 21 Magic x Priscilla 77.22 84.62 14.40 18.92 S. Em± 2.27 2.73 1.06 1.09 followed by Vedanapoli x Magic (4.72 cm) and American Beauty x Priscilla (4.55 cm), and, minimum (3.03 cm) was recorded in Sylvia x Summer Sunshine. Data (Table 3) on number of days for flower bud initiation revealed that cv. keywords: days; melody; sunshine cache: jhs-541.pdf plain text: jhs-541.txt item: #399 of 600 id: jhs-542 author: Devadas, R; Upadhyaya, R C; Khatiwara, P title: Characterization and Evaluation of a Rare Orchid Renanthera imschootiana Rolfe from Manipur & Nagaland date: 2009-12-31 words: 1424 flesch: 60 summary: The general descriptions for the morphological characters of the collection based on mean data (quantitative) and expressivity of qualitative characters like color pattern observed for two years is shown in Table 1 and the flowering pattern of this collection of species from the date of spike initiation at Pakyong, Sikkim (Altitude 1,300 MSL) is shown in Table 2. 182 Salient features/description of collection (IC 566525) In-vitro germination of orchid species and hybrids: Biotechnological intervention in Orchids and bulbous flowering crops. keywords: color; flower; orchids; species cache: jhs-542.pdf plain text: jhs-542.txt item: #400 of 600 id: jhs-543 author: Nataraj, S K; Gangadharappa, P M; Reddy, B S; Naik, K B; Prashanth, S J; Prakash, D P title: Evaluation of Annual Statice (Limonium sinuatum L.) Cultivars date: 2009-12-31 words: 1647 flesch: 71 summary: (1998) in annual statice Turbo White. Turbo White, which was on par with the cultivar Turbo Carmine (22.54). keywords: plant; turbo; white cache: jhs-543.pdf plain text: jhs-543.txt item: #401 of 600 id: jhs-544 author: Davara, P R; Patel, N C title: Assessment of Post Harvest Losses in Banana Grown in Gujarat date: 2009-12-31 words: 2380 flesch: 63 summary: No. Method of ripening Ripening losses observed/reported (%) Sci. Vol. 4 (2): 187-190, 2009 Assessment of post harvest losses in banana grown in Gujarat P.R. Davara and N.C. keywords: banana; harvest; level; losses; post; ripening cache: jhs-544.pdf plain text: jhs-544.txt item: #402 of 600 id: jhs-545 author: Sharma, Debi; Moorthy, P N Krishna; Krishnamoorthy, A title: Comparative Study of Pesticide Residue Pattern in Vegetables Grown Using IPM and Non-IPM Practices date: 2009-12-31 words: 2327 flesch: 61 summary: Apart from recording pesticide spray pattern in IPM and non-IPM (which follow a different schedule of plant protection treatments, mostly with insecticides) of these crops in farmers’ fields situated around Bangalore, pesticide residues in these crops too were analyzed and compared. Pesticide residues, if present, were mostly in trace amounts (< 0.01 ppm) in vegetables grown as per IPM practices, except the residues of methomyl and monocrotophos in cabbage, where slightly higher levels of pesticides were observed. keywords: ipm; non; pesticide; practices; residues; samples cache: jhs-545.pdf plain text: jhs-545.txt item: #403 of 600 id: jhs-547 author: Raja, M Edward title: Importance of Micronutrients in the Changing Horticultural Scenario in India date: 2009-06-30 words: 19870 flesch: 59 summary: Hence, plants can manage with lower soil B in acid soils, than in high pH soils (calcareous soils). The increase in organic-matter status itself increases availability of soil micronutrients owing to the chelating ability of humic and fulvic acids in the compost. keywords: application; boron; chlorosis; content; correction; crops; deficiency; disease; edward; effect; foliar; fruit; growth; horticultural; india; iron; leaf; leaves; low; mango; medium; micronutrients; nutrition; organic; plant; quality; raja; role; root; sci; soil; spray; use; yield; zinc cache: jhs-547.pdf plain text: jhs-547.txt item: #404 of 600 id: jhs-549 author: Singh, Dinesh; Kumar, K; Sharma, Vikas Kumar; Singh, Mohar title: Expression of Genetic Variability and Character Association in Raspberry (Rubus ellipticus Smith) Growing Wild in North-Western Himalayas date: 2009-06-30 words: 2098 flesch: 60 summary: Berry length and berry breadth had significant and positive effect on berry weight. Variation ranged from 0.25 g - 0.93 g for berry weight. keywords: berry; raspberry; weight cache: jhs-549.pdf plain text: jhs-549.txt item: #405 of 600 id: jhs-55 author: kumar, Ramesh title: Standardization of plant species and growing medium for vertical garden system: A new urban horticulture concept date: 2018-06-30 words: 4529 flesch: 64 summary: Composition of plant growing media may vary depending on several reasons. Hence a study was carried out in the Department of Horticulture, Annamalai University, during the year 2013, with the objectives to study the influence of Coir pith, Stockosorb and Geohumus as components of growing media along with FYM, Vermicompost and Leaf mould compost on growth and performance of ornamental plants for establishment of vertical garden and to study the performance of ornamental plants Viz., Philodendron erubescens Cv. keywords: plants; vertical cache: jhs-55.pdf plain text: jhs-55.txt item: #406 of 600 id: jhs-552 author: Panicker, Bindu; Thomas, Pious; Janakiram, T title: Acclimatization and Field Evaluation of Micropropagated Plants of Chrysanthemum Cv.'Arka Swarna' date: 2009-06-30 words: 2258 flesch: 55 summary: Overall, tissue culture derived plants were comparable to or superior to conventionally propagated plants, depending on whether these were planted directly (TC-D) or after going though a nursery (TC-N). The cultures showed reduction in rooting with cytokinins in the medium bringing Acclimatization and field evaluation of micropropagated plants of chrysanthemum cv. keywords: acclimatization; chrysanthemum; field; flower; nursery; plants cache: jhs-552.pdf plain text: jhs-552.txt item: #407 of 600 id: jhs-553 author: Singh, Viveka Nand; Banerji, B K; Dwivedi, A K; Verma, A K title: Effect of Gamma Irradiation on African Marigold (Tagetes erecta L.) Cv. Pusa Narangi Gainda date: 2009-06-30 words: 3001 flesch: 69 summary: Reduction in survival percentage, plant height, number of branches, leaf number, leaf size, plant-spread, stem diameter, increased foliage and floral abnormalities were observed upon irradiation and with increase in dose of gamma rays. RESULTS AND DISCUSSION Reduction in % plant survival, plant height, branch number, plant-spread, leaf number and size and stem diameter was observed at 100 Grays exposure of gamma rays. keywords: flower; gamma; grays; head; irradiation; number; plant cache: jhs-553.pdf plain text: jhs-553.txt item: #408 of 600 id: jhs-554 author: Saini, H K; Gill, M I S title: Induction of Mutation in Rough Lemon (Citrus jambhiri Lush.) Using Gamma Rays date: 2009-06-30 words: 1870 flesch: 63 summary: Most of the ill- effects of gamma radiation treatment started immediately after treatment and were manifest in terms of decreased sprouting capacity with increasing the dose. Seedling height in different gamma ray treatments ranged from 5.8-9.0 cm in the control, 5.3-8.8 cm in 4 kr, 2.0-9.4 cm in 6kr and 0.4-7.0 cm in 8 kr treatment. keywords: control; gamma; seedling; treatment cache: jhs-554.pdf plain text: jhs-554.txt item: #409 of 600 id: jhs-555 author: Sharma, D title: Distribution of Staminate and Hermaphrodite Flowers and Fruit-Set in the Canopy of Cashew Genotypes date: 2009-06-30 words: 4637 flesch: 72 summary: Cashew flowers are borne on an inflorescence that is an indeterminate panicle. However, there was consistently greater number of staminate flowers than hermaphrodite flowers during both early and late flowering . keywords: cashew; flowering; flowers; genotypes; hermaphrodite; number; sides; staminate cache: jhs-555.pdf plain text: jhs-555.txt item: #410 of 600 id: jhs-556 author: Mohan, N; Aghora, T S; ., Devaraju title: Evaluation of Dolichos (Lablab purpureus L.) Germplasm for Pod Yield and Pod Related Traits date: 2009-06-30 words: 2259 flesch: 83 summary: Pod-yield per plant ranged from 69 to 576.9 g and maximum pod-yield was recorded in IIHR 150 and IIHR 159 with 576.9 and 576.2 g/plant, respectively (Fig.1 and 2). 10- No.of Yield Pod colour No. 50% pod- length width pod pods per flowering maturity (cm) (cm) weight (g) per plant plant (g) 1. keywords: green; iihr; pod; tamil cache: jhs-556.pdf plain text: jhs-556.txt item: #411 of 600 id: jhs-557 author: Gantait, Subhendu S; Pal, P title: Studies on Yield and Yield Components of Spray Chrysanthemum (Chrysanthemum morifolium Ramat.) cv. Amal under Various Sources of Nitrogen date: 2009-06-30 words: 3196 flesch: 67 summary: Results revealed that maximum stem length (62 cm) of cut flower and flower yield, number of flower heads (6387) and weight (4071.48 g/sqm) were mostly achiveved by application of total recommended dose of nitrogen through a combination of 25% N as neem cake + 25% N as mustard cake + 25% N as CAN + 25% as urea, and the treatment increased flower yield by 57.96% over treatment with nitrogen solely through urea. A perusal of results presented in Tables 1, 2, 3 and 4 and Fig. 1 and 2 on plant height, canopy spread plant-1, days to optimum bloom, stem-length of flower, flower size, individual flower weight and flower yield (number and weight of flowers heads sqm-1), shelf-life and vase-life of flowers and anthocyanin content of petal revealed significant differences between sole application of inorganic and organic fertilizer and their combinations. keywords: basal; cake; flower cache: jhs-557.pdf plain text: jhs-557.txt item: #412 of 600 id: jhs-558 author: Datta, S; Dey, A N; Maitra, S title: Effect of FYM and GA3 on Growth and Yield of Sweet Flag (Acorus calamus L.) under Terai Zone of West Bengal date: 2009-06-30 words: 2793 flesch: 73 summary: Similarly, these parameters increased with application of GA 3 but showed non-significant relationship, except in rhizome yield. From the above discussion, it may be concluded that increase in application of FYM from 0 to 50 t ha-1 along with GA 3 has increased rhizome yield of Sweet flag and an application of 50 t ha-1 keywords: fym; ha-1 cache: jhs-558.pdf plain text: jhs-558.txt item: #413 of 600 id: jhs-559 author: Velmurugan, M; Rajamani, K; Paramaguru, P; Gnanam, R; Bapu, J R Kannan title: Studies on Correlation and Path Analysis in Mutants of Coleus (Coleus forskohlii Briq.) for Yield and forskolin Content in V2M1 Generation date: 2009-06-30 words: 3276 flesch: 60 summary: Information on strength and direction of correlation of these component characters on tuber yield and inter se association among them would be useful in designing breeding programmes for yield improvement. Being a complex trait, tuber yield is largely influenced by many component characters. keywords: correlation; ems; number; plant-1; tuber; yield cache: jhs-559.pdf plain text: jhs-559.txt item: #414 of 600 id: jhs-56 author: Naik, Kirtimala B; Nataraj, S K; Kumar, D P; Shadakshari, Y G; Seetharamu, G K; Veugopalan, R; Jayaprasad, K V title: Evaluation of ornamental sunflower for value addition date: 2018-06-30 words: 1632 flesch: 69 summary: Dried flowers do not have to be used in arrangements immediately. Mean scores of sensory evaluation of dried sunflower flower genotype M-17R Embedding Treatments Colour retention Appearance Texture Shape Borax powder (T1) 2.88 3.06 2.94 2.81 Sand (T2) 3.00 2.69 2.94 2.75 Silica gel (T3) 4.44 4.44 4.31 4.38 Alum powder (T4) 3.44 3.13 3.25 3.19 Corn meal (T5) 3.31 2.81 3.31 3.31 Shade (T6) 4.63 3.81 3.63 3.22 Sem 0.27 0.32 0.20 0.22 CD @ 1% 0.80 0.94 0.58 0.65 F-test * keywords: drying; flowers; gel; silica; sunflower cache: jhs-56.pdf plain text: jhs-56.txt item: #415 of 600 id: jhs-561 author: Gupta, Y C title: Combining Ability in African Marigold (Tagetes erecta L.) date: 2009-06-30 words: 3014 flesch: 76 summary: The present study was carried out at Experimental Farm of Division of Floriculture and Landscaping, IARI, New Delhi involving 3 male sterile lines, viz., ms 7 ms 8 and ms 12 and a set of 11 genetically diverse pollinators numbered Sel. 7, Sel. 8, Sel. 14, Sel. 19, Sel. 21, Sel. 22, Sel. 27, Sel. 28, Sel. 29, Sel. 31 and Sel. 56 as testers. It may be mentioned here that during summer crop, Sel. 7 did not flower but its three hybrids flowered. keywords: flower; sel cache: jhs-561.pdf plain text: jhs-561.txt item: #416 of 600 id: jhs-562 author: Ramachandrudu, K; Thangam, M title: Performance of Tuberose (Polianthes tuberosa L.) Cultivars in Goa date: 2009-06-30 words: 1252 flesch: 66 summary: Performance of tuberose cultivars under agro-climatic conditions of Goa Cultivar Plant Days to Days to Spike Rachis Florets/ Floret Floret No. of No. of Bulb Bulb height emergence flower length length spike weight diameter spikes/ bulbs/ weight diameter (cm) of spike opening (cm) (cm) (g) (cm) plant plant (g) (cm) Mexican Single 60.85 101.00 119.00 103.79 34.15 42.65 1.18 3.34 5.73 16.86 11.98 2.20 Shringar 52.09 104.50 122.00 76.95 26.36 44.77 1.06 3.22 3.02 15.54 7.96 1.90 Suvasini 58.27 109.00 131.00 91.54 50.52 57.46 2.65 4.12 2.43 17.05 11.60 1.88 Prajwal 65.13 110.50 131.00 97.78 33.75 51.39 1.98 3.59 2.67 16.69 10.52 1.95 Vaibhav 54.92 104.00 126.00 91.25 56.03 55.65 2.26 3.58 3.02 16.53 8.88 1.79 CD (P=0.05) 5.67 1.62 1.32 5.95 6.94 5.55 0.30 0.20 0.54 NS 1.55 0.17 Performance of tuberose in Goa J. Hortl. Cultivar Mexican Single (5.73) recorded the highest spike yield/plant, which was significantly superior to other cultivars. keywords: cultivars; plant; tuberose cache: jhs-562.pdf plain text: jhs-562.txt item: #417 of 600 id: jhs-563 author: Baskaran, V; Misra, R L; Abirami, K title: Effect of Plant Growth Regulators on Corm Production in Gladiolus date: 2009-06-30 words: 2092 flesch: 66 summary: In spite of its importance, very little information is available on effect of growth regulators on gladiolus corm production. Significance at 1% probability level Growth regulators in gladiolus corm production J. Hortl. keywords: corm; gladiolus; growth; ppm cache: jhs-563.pdf plain text: jhs-563.txt item: #418 of 600 id: jhs-564 author: Delvadia, D V; Ahlawat, T R; Meena, B J title: Effect of Different GA3 Concentration and Frequency on Growth, Flowering and Yield in Gaillardia (Gaillardia pulchella Foug.) Cv. Lorenziana date: 2009-06-30 words: 2457 flesch: 70 summary: In recent years, idea of regulating plant growth, flower yield and quality by application of plant growth regulators has assumed significant importance. It can thus be inferred that a single spray of GA 3 at 250 ppm was found best for optimum growth and production of Gaillardia flowers under South Saurashtra conditions of Gujarat. keywords: growth; plant; ppm; spray cache: jhs-564.pdf plain text: jhs-564.txt item: #419 of 600 id: jhs-565 author: Srivastava, Renu; Lal, Abhilasha A title: Incidence of Post-Harvest Fungal Pathogens in Guava and Banana in Allahabad date: 2009-06-30 words: 1975 flesch: 56 summary: Fungal pathogens were isolated from infected guava and banana fruits and Short communication Incidence of post-harvest fungal pathogens in guava and banana in Allahabad Renu Srivastava and Abhilasha A. Lal Department of Plant Protection Allahabad Agricultural Institute – Deemed University Allahabad-211007, India E-mail: Renu1srivastava@rediffmail.co.in ABSTRACT A survey was conducted to study incidence of pathogens associated with post-harvest losses in fruits in produce from fruit markets of Allahabad. Mean incidence of post harvest fungal pathogens associated with guava fruits in Allahabad was 18.4%. keywords: colletotrichum; penicillium; trichothecium cache: jhs-565.pdf plain text: jhs-565.txt item: #420 of 600 id: jhs-567 author: Prasad, K S Krishna title: Management of Potato Nematodes:An overview date: 2008-12-31 words: 9566 flesch: 59 summary: Breeding potato for combined resistance to late blight and potato cyst nematodes in Nilgiris. Determination of species and pathotypes of potato cyst nematodes in Nilgiri hills. keywords: cpri; crop; cyst; fig; himachal; himachal pradesh; india; krishna; krishna prasad; kufri; management; nematode; pcn; potato; pradesh; pradesh cpri; prasad; rkn; root; spp; uttar cache: jhs-567.pdf plain text: jhs-567.txt item: #421 of 600 id: jhs-568 author: Vijayalatha, K R; Chezhiyan, N title: Multivariate Based Marker Analysis in Turmeric (Curcuma longa L.) date: 2008-12-31 words: 3018 flesch: 53 summary: Cluster mean values of eight characters for turmeric accessions Cluster / character 1 2 3 4 5 % contribution Number of accessions 143 2 2 2 74 Plant height (cm) 37.36 34.07 32.61 32.46 34.06 0.08 Number of leaves 15.03 12.04 11.38 11.75 12.84 0.22 Number of tillers 3.68 1.67 1.75 1.71 1.74 0.60 Days to maturity 248.71 233.25 242.75 251.50 235.38 0.63 Weight of primary rhizomes (cm) 100.89 92.50 127.08 87.09 106.51 8.57 Weight of secondary rhizomes (cm) 67.44 71.67 75.00 61.25 71.38 7.77 Girth of secondary rhizomes (cm) 5.11 4.42 4.46 4.21 4.19 10.46 Yield (kg/plot) 3.77 2.96 2.78 2.70 3.65 65.65 Fig 1. Dendrogram of thirty accessions using UPGMA based on squared Euclidean distances Molecular markers in turmeric J. Hortl. Molecular profiling of Curcuma accessions had some similarity with morphological characterization, though, there were incongruities of the accessions of unidentical morphology falling in the same group, or vice versa (Syamkumar and Sasikumar, 2007). keywords: accessions; analysis; cluster; markers; rapd cache: jhs-568.pdf plain text: jhs-568.txt item: #422 of 600 id: jhs-569 author: Tomar, Rukam S; Kulkarni, G U; Kakade, D K title: Genetic Analysis in Muskmelon (Cucumis melo L.) date: 2008-12-31 words: 4009 flesch: 59 summary: Therefore, fruit yield may be improved by selecting genotypes with higher fruit weight, fruit length, and fruit girth, number of fruits per plant, flesh thickness and moisture percentage, with less total soluble solids. Path analysis based on genotypic association revealed that number of fruits per plant and moisture percentage was the main yield- attributing characters in fruit yield of muskmelon. keywords: fruit; muskmelon; number; percentage; plant; total; yield cache: jhs-569.pdf plain text: jhs-569.txt item: #423 of 600 id: jhs-57 author: Kavitha, P S; Sudha, A; Srividya, S title: Assessment of chilli varieties in Salem district for higher productivity date: 2018-06-30 words: 1630 flesch: 71 summary: 119 Assessment of chilli varieties in Salem district for higher productivity P.S. Kavitha1, A. Sudha2 and S. Srividya3 1Horticultural College and Research Institute for Women, Trichy, Tamil Nadu, India 2Forestry College and Research Institute, Mettupalayam Tamil Nadu, India, 3Regional Research Station, Paiyur, Tamil Nadu, India. Sci. Vol. 13(1) : 119-121, 2018 120 Assessment of chilli varieties J. Hortl. keywords: chilli; lalima; lca; varieties; yield cache: jhs-57.pdf plain text: jhs-57.txt item: #424 of 600 id: jhs-570 author: Reddy, Y T N; Kurian, Reju M title: Cumulative and Residual Effects of Paclobutrazol on Growth, Yield and Fruit Quality of 'Alphonso' Mango date: 2008-12-31 words: 2571 flesch: 64 summary: Days for 50% fruit ripening No 1997 1998 1999 2000 2001 2002 1997 1998 1999 2000 2001 2002 1 PBZ 500 ppm 2.0 2.5 2.4 2.0 2.9 2.4 9.0 9.8 9.1 9.0 10.1 9.9 2 PBZ 1000 ppm 8.0 10.0 2.6 2.5 3.1 3.0 9.1 9.3 9.6 9.2 9.5 9.4 3 PBZ 2000 ppm 8.0 10.0 2.0 2.8 3.0 2.8 9.0 8.8 9.8 9.0 9.9 9.0 4 PBZ 5g a.i. 7.5 10.0 2.1 3.9 1.9 2.0 8.5 8.8 9.0 8.7 10.5 9.2 5 PBZ 10g a.i. 6.5 17.5 2.0 4.2 2.5 2.6 8.7 9.5 10.0 9.1 9.8 9.5 6 Control 4.0 5.0 3.2 2.8 4.0 3.8 6.5 6.0 8.5 8.9 8.1 8.4 S. Em.+ 4.05 5.03 2.1 3.10 1.5 1.9 0.41 0.59 1.8 0.48 1.7 1.4 LSD P=0.05 NS NS NS NS NS NS 1.21 1.75* NS NS NS NS * Such information is very important for sustained production of perennial fruit trees; hence this Cumulative and residual effects of paclobutrazol on growth, yield and fruit quality of ‘Alphonso’ mango Y. T. N. Reddy and Reju M. Kurian Division of Fruit Crops Indian Institute of Horticultural Research, Bangalore – 560 089, India E-mail : nreddy@iihr.ernet.in ABSTRACT A field experiment was conducted during 1996 to 2002 at Indian Institute of Horticultural Research, Bangalore, to study the cumulative and residual effects of paclobutrazol (PBZ) application on shoot vigour, flowering and fruit yield of seventeen years old ‘Alphonso’ mango trees. keywords: mango; ns ns; pbz cache: jhs-570.pdf plain text: jhs-570.txt item: #425 of 600 id: jhs-571 author: Ravishankar, H; Shivananda, T N; Purohit, A G title: Effect of Planting Density on Growth Parameters and Fruit Yield in Guava (Psidium guajava L.) cv. Allahabad Safeda Cultivated under Mild Humid Conditions of Coorg date: 2008-12-31 words: 2859 flesch: 64 summary: Effect of planting densities on plant height (m) Effect of planting densities on plant spread (m) in East – West direction Spacing 1992 1993 1994 1995 1996 1997 6mx3m 2.72 3.01 3.57 4.02 5.28 6.50 6mx4m 2.68 3.06 3.44 3.37 4.96 6.70 6mx6m 3.08 3.05 3.65 4.05 5.40 6.80 8mx4m 2.54 2.94 3.40 3.96 5.44 7.07 8mx3m 3.02 3.77 4.32 4.82 6.15 7.44 SEm — — 0.15 0.25 0.23 0.22 CD (P= 0.05) NS NS 0.49 0.81 0.75 0.71 Table 4. keywords: ns ns; planting; plants; table cache: jhs-571.pdf plain text: jhs-571.txt item: #426 of 600 id: jhs-572 author: Indira, M; Nair, C S title: Standardization of NPK Requirement in Banana Cv. "Njalipoovan" (Musa AB Group) in Onattukara Soil of South Kerala date: 2008-12-31 words: 3417 flesch: 66 summary: Application of N, P 2 O 5 and K 2 O at 200:200:400 g plant-1 proved to be ideal for maintaining higher yield and benefit: cost ratio. Increased availability and uptake of nutrients at higher levels of N might have led to the better expression of growth and yield attributes which ultimately resulted in higher yield. keywords: banana; plant-1 cache: jhs-572.pdf plain text: jhs-572.txt item: #427 of 600 id: jhs-573 author: Anjaneyulu, K; Raghupathi, H B; Chandraprakash, M K title: Compositional Nutrient Diagnosis Norms (CND) for Guava (Psidium guajava L.) date: 2008-12-31 words: 2432 flesch: 65 summary: Compositional nutrient diagnosis norms (CND) for guava (Psidium guajava L.) K. Anjaneyulu, H. B. Raghupathi and M. K. Chandraprakash Division of Soil Science and Agricultural Chemistry Indian Institute of Horticultural Research, Bangalore-560 089, India E-mail: anjaney@iihr.ernet.in ABSTRACT Multivariate nutrient diagnostic norms were developed for guava using compositional nutrient diagnosis (CND) through leaf nutrient concentration vs. yield data bank. Compositional nutrient diagnosis norms for guava CND variate CND norm SD V N 2.480 0.120 V P 0.236 0.140 V K 2.131 0.191 V Ca 1.906 0.319 V Mg 0.987 0.117 keywords: cnd; norms; nutrient cache: jhs-573.pdf plain text: jhs-573.txt item: #428 of 600 id: jhs-575 author: Savita, B; Anjaneyulu, K title: Development of Leaf Nutrient Norms and Identification of Yield-Limiting Nutrients Using DRIS in Sapota cv. Kalipatti date: 2008-12-31 words: 3228 flesch: 67 summary: Kalipatti in Raichur, Dharwad and Belgaum districts of Northern Karnataka for developing leaf nutrient norms through Diagnosis and Recommendation Integrated System (DRIS) for nutrient management. Optimum leaf N ranged from 1.51 to 2.09%, P from 0.06 to 0.15% and K from 0.83 to 1.44%. keywords: dris; leaf; nutrient cache: jhs-575.pdf plain text: jhs-575.txt item: #429 of 600 id: jhs-577 author: Padmapriya, S; Balasubramanian, R; Sathiyamurthy, V A title: Weed Management Studies in Cassava (Manihot esculenta L.) Intercropping Systems under Irrigated Conditions date: 2008-12-31 words: 2746 flesch: 61 summary: Therefore, the present investigation was undertaken to assess the production potential of intercropping system of cassava with various methods of weed control under rainfed condition. Key words: Cassava, intercropping, weed control, yield, economics characters such as available N – 218.3 kg/ha, available P 2 O 5 – 12.74 kg/ha, available K 2 O – 271.82 kg /ha and organic carbon – 0.49% were also recorded. keywords: cassava; cowpea; hand; intercropping; weed; yield cache: jhs-577.pdf plain text: jhs-577.txt item: #430 of 600 id: jhs-578 author: Kumar, Satish; Gowda, Basave; Shekhar, S Patil title: Influence of Storage Containers and Seed Pelleting on Seed Quality in Brinjal (Solanum melongena L.) during Storage date: 2008-12-31 words: 2448 flesch: 58 summary: Key words: Brinjal, seed pelleting, seed quality, seed storage. provides an opportunity to package, effective quantities of materials such that they can influence the micro environment of each seed (Krishnasamy, 2003). Thus seed pelleting Influence of storage containers and seed pelleting on seed quality in brinjal (Solanum melongena L.) during storage Satish Kumar, Basave Gowda and S. Patil Shekhar Seed Science and Technology Research Laboratory Regional Agricultural Research Station, Raichur – 584 102, India E- mail: bgowdseeds@rediffmail.com ABSTRACT The experiment was conducted using brinjal hybrid seeds cv. keywords: brinjal; pelleting; quality; seed; storage cache: jhs-578.pdf plain text: jhs-578.txt item: #431 of 600 id: jhs-579 author: Suresh, E R title: Development of Shelf-Stable Brined Vegetables by Lactic Acid Fermentation date: 2008-12-31 words: 2859 flesch: 55 summary: Selection of lactic acid bacteria for use in vegetable fermentations. A few attempts have been made to develop lactic fermented vegetables in this country (Anand and Das Lakshmi, 1971; Kohli and Kulkarni, 1973; Sethi and Anand, 1984; Ramdas and Kulkarni, 1987; Sethi, 1990; Suresh et al, 1996; Desai and Seth, 1997). keywords: acid; fermentation; sci; vegetables cache: jhs-579.pdf plain text: jhs-579.txt item: #432 of 600 id: jhs-580 author: Vasugi, C; Sekar, K; Dinesh, M R; Suresh, E R title: Evaluation of Unique Mango Accessions for whole-Fruit Pickle date: 2008-12-31 words: 2708 flesch: 65 summary: Sensory quality of tender mango pickle The sensory quality scores of tender mango pickles made from different accessions indicated that the accession, Malange recorded the highest score for colour (4.17), which is on par with Isagoor Appe, Danti mamidi, Mani Bhatta Appe, etc. Physical and quality parameters of mango accessions evaluated for whole fruit pickle Sl.no Accession Fruit Raw mango Latex Fruit Firmness Titrable shape flavour flow weight of fruit Acidity pH Dry Vit. (g) kg/cm2 (%) matter(%) keywords: accessions; appe; bhatta; fruit; mango; pickle; quality cache: jhs-580.pdf plain text: jhs-580.txt item: #433 of 600 id: jhs-581 author: Choudhary, Madan Lal; Dikshit, S N; Shukla, Neeraj; Saxena, R R title: Evaluation of Guava (Psidium guajava L.) Varieties and Standardization of Recipe for Nectar Preparation date: 2008-12-31 words: 1825 flesch: 61 summary: Chemical composition of guava fruits used for nectar Characters TSS TotalSugar Reducing sugar Non-reducing sugar Ascorbic acid (oBrix) (%) The chemical composition of guava varieties is presented in Table1. keywords: guava; months; nectar; storage; sugar cache: jhs-581.pdf plain text: jhs-581.txt item: #434 of 600 id: jhs-582 author: Ghosh, S N title: Effect of Season on Success of Air Layering in Water Apple in Red Laterite Zone of West Bengal date: 2008-12-31 words: 1212 flesch: 64 summary: It was interesting to note that the percentage of rooted layers in water apple was maximum during the rainy season. Meteorological data (Table 2) indicate that a maximum temperature of 40.3oC and a minimum of 25.2oC, with relative humidity of 95% at 7.00 am and 51% at 2.00 pm are congenial for getting higher percentage of rooted layers of water apple in the red laterite zone of West Bengal. keywords: apple; layering; layers cache: jhs-582.pdf plain text: jhs-582.txt item: #435 of 600 id: jhs-583 author: Delvadia, D V; Ahlawat, T R; Chovatia, R S; Barad, A V title: Performance of Banana Cultivars in Gujarat date: 2008-12-31 words: 1327 flesch: 65 summary: Based on trials conducted over a period of three years, it could be inferred that Gandevi Selection was superior to the other varieties in terms growth characters, fruit yield and associated traits. Kurian et al (1985) reported a strong positive correlation of fruit yield with number of hands, number of fingers, number of leaves per plant, stem girth and total duration of the crop. keywords: banana; varieties cache: jhs-583.pdf plain text: jhs-583.txt item: #436 of 600 id: jhs-584 author: Janakiram, T; Debner, Thomas title: Variability in Hip Characters in Rosa Species date: 2008-12-31 words: 1209 flesch: 67 summary: Similarly, in Chile, variability for hip size, pulp thickness and ascorbic acid was observed among rose hips collected and evaluated from 60 different locations. Apart from having ornamental value, rose hips have attained great importance for their various economic uses. keywords: hip; hips; red; species cache: jhs-584.pdf plain text: jhs-584.txt item: #437 of 600 id: jhs-585 author: Ranganath, H R; Krishna Kumar, N K; Kumar, Vikas title: Thrips Species Composition on Grapes in Karnataka and Maharashtra date: 2008-12-31 words: 2317 flesch: 60 summary: 2 Incidence of grape thrips at different locations in Bijapur (February 2005) No. of thrips collected out of 2 tapings Location Variety Area(Acre) New foliage Inflor Millet size Sorghum size Pea size > Pea size Kadlivada TS 10 6.3 —— —— —— 2 0 Kadlivada SS 4 12.2 —— —— —— 6 1 Bableshwar TS 2 8.6 —— —— —— 16 3 Bableshwar TS 2 14.8 —— —— 8.9 4 0 Bijapur- TS 2 6.5 —— —— —— 7 4 Aurangabad road A. Tanda TS 2 18.4 —— —— —— 4.3 Zalki TS 3 17.5 —— —— —— 1 Tajpur TS 2 11.2 —— —— —— 18 Galagali Road TS 4 23.6 —— —— —— 47 Aliabad TS 2 7.8 —— —— —— 28 TS 3 3.1 —— —— —— 22.5 TS- Thomson Seedless, SS- Sharad Seedless Species of thrips identified: New foliage: Scirtothrips dorsalis, Thrips palmi Inflorescence: Scirtothrips dorsalis, T. palmi Millet size berry- S. dorslis Sorghum size berry- S. dorslis Pea size berry- S. dorsalis Thrips species on grapes J. Hortl. No. of thrips collected out of 2 tapings Location Variety Area(Acre) New foliage Inflor Millet size Sorghum size Pea size > Pea size Bableshwar TS 2 8.7 —— —— —— —— 2.6 Bableshwar TS 1 2.7 —— —— —— —— 0 Aliabad TS 1 7.6 —— —— —— —— 0 Trikota TS 2 12.5 —— —— —— —— 2 Thidugundi TS 2 3.7 —— —— —— —— 2.5 A. Tanda TS 1 8.3 —— —— —— —— 5.2 Kadlivada TS 10 2.5 —— —— —— —— 2.6 Kadlivada SS 4 6.8 —— —— —— —— 1.5 TS- Thomson Seedless, SS- Sharad Seedless Species of thrips identified: New foliage: Scirtothrips dorsalis, Thrips palmi Inflorescence: Scirtothrips dorsalis, T. palmi Millet size berry- S. dorslis Sorghum size berry- S. dorslis Pea size berry- S. dorsalis Table: 4. Incidence of grape thrips at different locations in Bijapur (December 2005) keywords: inflorescence; pea; seedless; size; thrips cache: jhs-585.pdf plain text: jhs-585.txt item: #438 of 600 id: jhs-586 author: Mani, M; Krishnamoorthy, A title: Evaluation of Australian Ladybird Beetle Cryptolaemus montrouzieri Mulsant against Green Shield Scale Chloropulvinaria psidii (Maskell) on some Medicinal Plants date: 2008-12-31 words: 1914 flesch: 68 summary: The present study was conducted to evaluate the impact of C. montrouzieri in suppression of C. psidii on Evaluation of Australian ladybird beetle Cryptolaemus montrouzieri Mulsant against green shield scale Chloropulvinaria psidii (Maskell) on some medicinal plants M. Mani* and A. Krishnamoorthy Division of Entomology and Nematology Indian Institute of Horticultural Research, Bangalore -560 089, India E-mail: mmani1949@yahoo.co.in ABSTRACT Severe infestation of green shield scale Chloropulvinaria psidii (Green) was observed during 2003-04 on the medicinal plants namely Withania somnifera, Madhuca longifolia, Mimusops elengi and Wrightia tinctoria. Evaluation of the exotic predator Cryptolaemus montrouzieri Muls. (Coccinellidae, Coleoptera) in the suppression of green shield scale Chloropulvinaria psidii (Maskell) (Coccidae, Homoptera) on guava. keywords: montrouzieri; population; psidii; scale cache: jhs-586.pdf plain text: jhs-586.txt item: #439 of 600 id: jhs-589 author: Ganeshamurthy, A N; Varalakshmi, L R; Sumangala, H P title: Environmental Risks Associated with Heavy Metal Contamination in Soil, Water and Plants in Urban and Periurban Agriculture date: 2008-06-30 words: 20146 flesch: 61 summary: A green cure for heavy metal contaminated soils. In situ decontamination of heavy metal polluted soils using crops of metal-accumulating plants. keywords: agriculture; concentration; contamination; content; crops; effluents; environmental; et al; food; health; human; india; levels; metals; periurban; plants; pollution; sci; sewage; soil; soil sci; table; upa; urban; vegetables; vol; waste; water cache: jhs-589.pdf plain text: jhs-589.txt item: #440 of 600 id: jhs-59 author: Sridhar, V; Senthil Kumaran, G title: Light trap, an effective component of integrated management of Tuta absoluta(Lepidoptera : Gelechiidae) on Tomato date: 2018-06-30 words: 1131 flesch: 65 summary: icar.org.in ABSTRACT The effectiveness of mass trapping the moths of Tuta absoluta was evaluated using light traps in tomato polyhouse at ICAR-Indian Institute of Horticultural Research, Bengaluru during March - June, 2018. Thus light traps can be an effective tool for IPM of this pest on tomato, under polyhouse conditions. keywords: light; tomato; traps; tuta cache: jhs-59.pdf plain text: jhs-59.txt item: #441 of 600 id: jhs-590 author: Rekha, A; Hiremath, S C title: Chromosome Studies and Karyotype Analysis of some Triploid Banana (Musa Species) Cultivars of AAA Genomic Group date: 2008-06-30 words: 3047 flesch: 69 summary: Chromosome studies of Bihar bananas. The range of chromosome length was 1.47 to 2.49 mm. keywords: arm; banana; centromere; chromosomes; length; median cache: jhs-590.pdf plain text: jhs-590.txt item: #442 of 600 id: jhs-591 author: Yadav, Murlee; Singh, D B; Chaudhary, Rashmi; Singh, Devi title: Genetic Variability in Bitter Gourd (Momordica charantia L.) date: 2008-06-30 words: 2583 flesch: 73 summary: Significantly minimum number of days for first appearance of male flower and maximum fruit length, fruit width, yield per vine, yield per plot, yield/ha were recorded in MC-84. Maximum fruit length was recorded in MC-84 (20.50 cm) followed by JMC-4 (19.33 cm), S-17 (19.00 cm) and minimum in TZA 1 and DVBT-G-5 (7.33 cm) and TZA (8.33 cm). keywords: days; fruit; number; vine cache: jhs-591.pdf plain text: jhs-591.txt item: #443 of 600 id: jhs-592 author: Anjaneyulu, K title: Diagnostic Soil Nutrient Standards and Identification of Yield Limiting Nutrients in Onion (Allium cepa) Using DRIS date: 2008-06-30 words: 2693 flesch: 68 summary: Beaufils and Sumner (1976) developed DRIS norms for P, K, Ca, and Mg to be applied to sugarcane culture on South African Diagnostic soil nutrient standards and identification of yield limiting nutrients in onion (Allium cepa) using DRIS K. Anjaneyulu Division of Soil Science & Agricultural Chemistry Indian Institute of Horticultural Research Hessaraghatta lake post, Bangalore-560 089, India E-mail: anjaney@iihr.ernet.in ABSTRACT Soil samples collected from a survey of fifty onion growing fields in Karnataka were analyzed for various macro and micronutrients for establishing a data bank to develop soil nutrient norms. As no established standards are available, it was planned to develop soil nutrient standards for onion using diagnosis and recommendation integrated system (DRIS), which provides a means of simultaneously identifying imbalances, deficiencies and excesses in crop nutrients and ranking them in the order of importance (Beaufils, 1973). keywords: dris; nutrient; onion; soil cache: jhs-592.pdf plain text: jhs-592.txt item: #444 of 600 id: jhs-595 author: Jawandha, S K; Randhawa, J S; Gill, P P S; Singh, Jagjit title: Effect of Post-Harvest Treatment on Storage Quality in 'Umran' Ber Fruit date: 2008-06-30 words: 3090 flesch: 76 summary: Studies revealed that GA 3 (60 ppm) treated ber fruits maintained very good quality at 20 days of cold storage. The present study was, therefore, undertaken to study the effect of post-harvest treatments with various chemical compounds on the quality of ber fruit during cold storage. keywords: ber; days; fruits; storage cache: jhs-595.pdf plain text: jhs-595.txt item: #445 of 600 id: jhs-596 author: Bisen, A; Pandey, S K title: Effect of Post Harvest Treatment on Biochemical Composition and Organoleptic Quality in Kagzi Lime Fruit during Storage date: 2008-06-30 words: 2664 flesch: 70 summary: TSS was recorded in coconut oil coated fruits followed by those coated in liquid paraffin (9.8). Minimum (29.10mg/100ml juice) Vitamin C content was recorded under mustard oil coated fruits. keywords: coating; coconut; fruits; oil; storage; treatments cache: jhs-596.pdf plain text: jhs-596.txt item: #446 of 600 id: jhs-597 author: Kavitha, P S; Balamohan, T N; Poornima, K; Bergh, I Van den; Waele, D De title: Screening of Banana Hybrids for Resistance to Pratylenchus coffeae date: 2008-06-30 words: 3348 flesch: 71 summary: The lowest root population of 142 nematodes per 5 g of root was recorded in hybrid H-04-23, which was lower than the reference cultivar Pisang Lilin (145) and the highest was in H-04-10 (387). Two banana hybrids, H-04-05 and H-04-06 were found to be resistant and ten hybrids, H-04-01, H-04-03, H-04-04, H-04-07, H-04-09, H-04-11, H-04-16, H-04-19, H-04-21 and H-04-24 were found to be tolerant to the lesion nematode, Pratylenchus coffeae and the remaining were rated as susceptible. keywords: banana; h-04; hybrids; nematode; population; resistance; root cache: jhs-597.pdf plain text: jhs-597.txt item: #447 of 600 id: jhs-598 author: Chitra, R; Vadivel, E; Rajamani, K title: Estimation of Anti-hepatic Viral Compounds in Phyllanthus amarus in vitro Cultures date: 2008-06-30 words: 2139 flesch: 58 summary: Plant cell cultures can be established from an array of plant species, including most that produce secondary products of commercial value (Berlin, 1984). Plant cell cultures – a future source of natural products. keywords: amarus; callus; compounds; cultures; phyllanthus; shoot; vitro cache: jhs-598.pdf plain text: jhs-598.txt item: #448 of 600 id: jhs-599 author: Pitchaimuthu, M; Dutta, O P; Prasad, V S R K Krishna; Swamy, K R M title: Development of Novel Character in Okra [Abelmoschus esculentus (L.) Moench] date: 2008-06-30 words: 811 flesch: 60 summary: [Abelmoschus esculentus (L.) Moench] M. Pitchaimuthu, O. P. Dutta, V. S. R. K. Krishna Prasad 1 and K. R. M. Swamy Division of Vegetable Crops Indian Institute of Horticultural Research Hessaraghatta Lake Post, Banaglore-560 089, India E-mail: muthu@iihr.ernet.in ABSTRACT Transgressive segregation in the population of IIHR-31-1-2 x Arka Anamika BC 3 F 1 -F 6 generations led to the development of, various novel characters such as, ridgeless fruits (round fruit) and enhanced nodal productivity bearing short internodal length in okra selection-1, which was found to be promising for cultivation with high yield and good fruit quality. These are adapted to a wide range of agro-climatic conditions and cropping patterns, possess better fruit yield and quality combined with Yellow Vein Mosaic Virus resistance (Dutta, 1990). keywords: fruit; green; okra cache: jhs-599.pdf plain text: jhs-599.txt item: #449 of 600 id: jhs-600 author: Yadav, Murlee; Kushwah, M S; Singh, D B; Roshan, R K; Pebam, Nongallei title: Effect of γ-Irradiation on Germination, Growth, Sensitivity and Survivability of Papaya cv. Kesar King date: 2008-06-30 words: 3027 flesch: 60 summary: Interaction effect of γ-irradiation of 10 Krad and 15th September seed sowing (R 2 D 1 ) recorded the highest percentage of germination (73.20%) and survival (70%), whereas the lowest germination (55%) and survival (52%) were observed with no irradiation in 15th October sowing. Mutation by γ-irradiation is used for improvement of fruit crops, particularly in papaya. keywords: irradiation cache: jhs-600.pdf plain text: jhs-600.txt item: #450 of 600 id: jhs-603 author: Varalakshmi, L R; Ganeshamurthy, A N title: A Market Survey of Vegetables in Bangalore for Heavy Metal Contamination in Relation to Human Health date: 2008-06-30 words: 2514 flesch: 63 summary: Heavy metal content of vegetables ranged from 0.24 to 2.54 mg Cd kg-1, 2.16 to 10.40 mg Pb kg-1 , 3.08 to 16.2 mg Cr kg-1and 1.66 to 11.52 mg Ni kg-1. Heavy metals content of leaf vegetables from Bangalore market Leaf vegetables keywords: content; health; kg-1; metals; vegetables cache: jhs-603.pdf plain text: jhs-603.txt item: #451 of 600 id: jhs-604 author: Reddy, P Venkata Rami; Vasugi, C title: Resistance to Fruit Fly, Bactrocera dorsalis (Hendel) and Tea Mosquito Bug, Helopeltis antonii (Sign.) in Certain Wild Psidium Species date: 2008-06-30 words: 1775 flesch: 59 summary: As endogenous metabolites were reported to play a significant role in fruit fly resistance (Kaur et al, 1994), the per cent fruit fly and tea mosquito bug infestation were correlated with TSS, total sugars, vitamin C and acidity. Varietal differences of guava in their reaction to fruit fly and tea mosquito bug are reported (Arora et al, 2000; Reddy and Vasugi, 2004) but information is lacking on the reaction of wild Psidium species. keywords: fly; fruit; species; tea cache: jhs-604.pdf plain text: jhs-604.txt item: #452 of 600 id: jhs-605 author: Banerji, R; Sahoo, S K; Jha, S; Banerjee, H title: Persistence and Dissipation of Triazophos in Bitter Gourd date: 2008-06-30 words: 1128 flesch: 68 summary: The present study was, therefore, undertaken to determine dissipation of triazophos residue in bitter gourd fruit, for evaluation of safety in applying it. Thereafter, triazophos residue declined to 0.10 and 0.02 ppm showing a reduction of 87.34% and 93.55%, respectively. keywords: days; gourd; residue; triazophos cache: jhs-605.pdf plain text: jhs-605.txt item: #453 of 600 id: jhs-611 author: Murti, G S R; Upreti, K K title: Plant Growth Regulators in Water Stress Tolerance date: 2007-12-31 words: 14967 flesch: 63 summary: Regulation of levels of proline as an osmolyte in plant water stress. Plant responses to water stress are believed to be complex as these operate at various levels of plant organization. keywords: 1997; aba; acid; cell; cytokinins; et al; ethylene; expression; genes; growth; physiol; plant; polyamines; regulators; response; root; sci; stomatal; stress; tolerance; upreti; water stress cache: jhs-611.pdf plain text: jhs-611.txt item: #454 of 600 id: jhs-612 author: Prakash, D P; Deepali, B S; Asokan, R; Ramachandra, Y L; Anand, Lalitha; Hanur, Vageeshbabu S title: Effects of Growth Regulators and Explant-Type on Agrobacterium-Mediated Transformation in Brinjal (Solanum melongena L.) cv. Manjarigota date: 2007-12-31 words: 2969 flesch: 47 summary: Hypocotyl explants were found to be better than cotyledonary leaf explants in regenerating shoots after Agrobacterium co-cultivation. Hypocotyl explants and cotyledonary leaf explants were cultured without Agrobacterium co-cultivation on MS medium containing hormones as specified for these explants, as control. keywords: agrobacterium; brinjal; explants; leaf; regeneration; response; transformation cache: jhs-612.pdf plain text: jhs-612.txt item: #455 of 600 id: jhs-613 author: Patil, Prakash; Vastrad, Neeta; Dinesh, M R; Bantwal, A R title: A Revised Protocol for in Vitro Propagation of Carica papaya Using Lateral Buds from Field-Grown Trees date: 2007-12-31 words: 3088 flesch: 60 summary: Culture incubation Cultures were incubated at 16h photoperiod, at 25+1oC under white cool fluorescent light having an intensity of 30limol/m2/sec. RESULTS AND DISCUSSION Effect of 6-benzyl amino purine on shoot proliferation In the present investigation (Table 1), explants were cultured on MS basal medium supplemented with NAA at 0.1 mg/l and different concentrations of BAP (0.1, 0.2 and 0.5 mg/l). In the present study (Table 2), explants were cultured on MS basal medium supplemented with BAP at 0.3 mg/l, NAA at 0.1 mg/l and varying concentrations of GA 3 (0.5, 1.0 and 1.5 mg/l) for elongation of the shootlets. keywords: bap; medium; papaya; vitro cache: jhs-613.pdf plain text: jhs-613.txt item: #456 of 600 id: jhs-614 author: Aghora, T S; Mohan, N; Somkuwar, R G; Ganeshan, Girija title: Breeding French Bean (Phaseolus vulgaris L.) for Resistance to Rust (Uromyces phaseoli Reben Wint.) date: 2007-12-31 words: 2320 flesch: 68 summary: The cross, Arka Bold x Arka Komal indicated dominance of resistance to rust over susceptibility in F 1 progeny. Further, Pedigree method of breeding was followed and segregants with resistance to rust were selected from F 2 generation onwards and were advanced up to F 7 generation, wherein, a promising line (Arka Bold x Arka Komal)-99-17-2-1-4-12-3 possessing resistance to rust with high yield and good pod quality was selected and named as Table 1. keywords: arka; komal; resistance; rust cache: jhs-614.pdf plain text: jhs-614.txt item: #457 of 600 id: jhs-615 author: Selvi, B Senthamizh; Ponnuswami, V; Kumar, N title: Radiosensitivity of Amla (Emblica officinalis Gaertn.) Varieties Treated with Gamma Rays date: 2007-12-31 words: 2598 flesch: 61 summary: The present investigation purports to assess sensitivity of amla to different gamma ray treatments in terms of survival percentage and degree of crop growth inhibition. Sensitivity studies A preliminary study was conducted to fix the optimal dose of gamma ray irradiation on survival of grafts J. Hort. keywords: amla; doses; gamma; rays; survival cache: jhs-615.pdf plain text: jhs-615.txt item: #458 of 600 id: jhs-616 author: Bhat, Z A; Khan, F U title: Effect of Spacing and Corm Size on Growth, Flowering and Corm Production in Gladiolus cv. White Prosperity under Kashmir Conditions date: 2007-12-31 words: 1735 flesch: 72 summary: Bhat and F. U. Khan Division of Floriculture, Medicinal and Aromatic Plants S.K. University of Agricultural Sciences & Technology of Kashmir Shalimar, Srinagar – 191 121, India E-mail:zahoorflori2003@gmail.com Abstract A study was carried out during 2005 - 2006 at the Division of Floriculture, Medicinal and Aromatic Plants, SKUAST-K, Shalimar, to determine the effect of corm size (4.1-4.5, 4.6-5.0 and 5.1-5.5 cm) and spacing (10 x 20, 15 x 20 and 20 x 20 cm) on growth, flowering and corm production in gladiolus cv. The effect of corm size on the production of flower, corm and cormel in gladiolus. keywords: corm; size; spacing cache: jhs-616.pdf plain text: jhs-616.txt item: #459 of 600 id: jhs-617 author: Anjaneyulu, K title: DRIS Norms for Identifying Yield-Limiting Nutrients in Sapota (Manilkara achras (Mill). Fosberg) Cv. Cricketball date: 2007-12-31 words: 2649 flesch: 63 summary: Leaf nutrient guides for fruit crops. It can be concluded that yield-limiting nutrients in sapota gardens can be corrected by following efficient fertilizer application based on leaf nutrient norms developed. keywords: dris; mean; nutrient cache: jhs-617.pdf plain text: jhs-617.txt item: #460 of 600 id: jhs-618 author: Kotur, S C; Shilpashree, Y P; Sheshshayee, M S; Ramesh, P R title: Nitrogen Use Efficiency in Tomato (Lycopersicon esculentum L.) and French Bean (Phaseolus vulgaris L.) as Influenced by Coating of Urea with Neem Oil and Graded Levels of Nitrogen date: 2007-12-31 words: 2183 flesch: 63 summary: Arka Komal Treatment Pod yield Dry matter N content N Uptake Ndff Fertilizer N uptake Fertilizer (g/pot) (g/pot) (%) (g/pot) (%) (mg/pot) utilization(%) Control vs. N application Control 57.40 26.20 1.170 0.340 - - - N application 72.30 38.10 1.390 0.570 - - - SEm (±) 1.39 0.36 0.011 0.009 - - - CD (P=0.05) 3.02 0.79 0.024 0.019 - - - Prilled urea(PU) vs. neem oil coated urea (NOCU) PU 69.30 35.30 1.310 0.490 23.90 110.50 39.20 NOCU 75.30 41.00 1.470 0.640 25.70 176.60 60.20 SEm (±) 0.74 0.19 0.006 0.005 0.12 2.10 0.66 CD (P=0.05) 2.28 0.60 0.018 0.014 0.37 6.46 2.02 Levels of nitrogen (percentage of recommended dose) 60% N dose 63.20 40.00 1.270 0.520 20.50 111.10 50.90 80% N dose 71.00 37.00 1.390 0.550 24.40 148.60 51.10 100% N dose 82.60 37.40 1.520 0.620 24.70 170.90 47.00 SEm (±) 0.91 0.24 0.007 0.006 0.15 2.57 0.80 CD (P=0.05) 2.80 0.73 0.022 0.018 0.45 NS 2.48 Kotur et al J. Hort. Sci. Vol. 2 (2): 119-122, 2007 121 Table 3. (%) (g/pot) (%) uptake (mg/pot) utilization (%) Control vs. N application Control 295.00 40.20 0.410 0.160 - - - N application 441.60 69.50 0.600 0.420 - - - SEm (±) 10.74 1.76 0.008 0.012 - - - CD (P=0.05) 23.41 3.84 0.017 0.025 - - - Prilled urea(PU) vs. neem oil coated urea (NOCU) PU 399.90 62.70 0.540 0.340 22.10 66.50 10.00 NOCU 483.30 76.30 0.660 0.510 24.60 116.90 17.10 SEm (±) 5.74 0.94 0.004 0.006 0.23 10.46 0.21 CD (P=0.05) 17.69 2.90 0.013 0.019 0.71 4.49 0.63 Levels of nitrogen (percentage of recommended dose) 60% N dose 384.20 63.90 0.510 0.290 19.90 56.30 11.50 80% N dose 429.20 68.90 0.580 0.410 22.10 77.90 11.90 100% N dose 511.50 75.70 0.700 0.530 28.00 140.90 17.20 SEm (±) 7.03 1.15 0.005 0.008 0.28 1.78 0.25 CD (P=0.05) 21.67 3.55 0.016 0.023 0.87 5.50 0.77 Table 2. Effect of N application, coating of urea with neem oil and graded doses of N on pod yield, dry matter production and parameters of N use in French bean var. keywords: neem; nocu; oil; pot; urea cache: jhs-618.pdf plain text: jhs-618.txt item: #461 of 600 id: jhs-619 author: Padmapriya, S; Chezhiyan, N; Sathiyamurthy, V A title: Effect of Shade and Integrated Nutrient Management on Biochemical Constituents of Turmeric (Curcuma longa L.) date: 2007-12-31 words: 4341 flesch: 74 summary: Effect of and integrated nutrient management on rhizome yield per plot (kg), curcumin (per cent) and oleoresin (%) content in turmeric Treatment Rhizome yield per plot (kg) Curcumin (%) Essential oil (%) M 1 (Open) M 2 (Shade) Mean M 1 (Open) M 2 (Shade) Mean M 1 (Open) M 2 (Shade) Mean S 1 14.31 15.85 15.08 4.23 5.07 4.65 4.41 5.12 4.77 S 2 14.72 16.44 15.58 4.40 5.16 4.78 4.60 5.28 4.94 S 3 14.24 15.30 14.77 4.18 5.00 4.59 4.30 5.04 4.67 S 4 13.70 15.19 14.44 4.16 4.98 4.57 4.13 5.00 4.57 S 5 14.44 15.92 15.18 3.95 4.86 4.41 3.86 4.90 4.38 S 6 14.57 17.14 15.86 4.46 5.20 4.83 4.65 5.34 5.00 S 7 16.03 17.70 16.86 4.42 5.18 4.80 4.62 5.30 4.96 S 8 16.60 19.20 17.90 4.77 5.40 5.09 4.88 5.50 5.19 S 9 13.53 15.06 14.30 4.18 4.98 4.58 4.19 5.02 4.61 S 10 12.48 13.27 12.87 4.00 4.88 4.44 3.91 4.91 4.41 S 11 11.80 13.20 12.50 4.02 4.88 4.45 3.98 4.93 4.46 S 12 13.07 14.01 13.54 3.92 4.85 4.39 3.84 4.87 4.36 S 13 14.58 17.09 15.84 4.22 5.04 4.63 4.36 5.08 4.72 S 14 15.56 17.47 16.51 4.80 5.42 5.11 4.90 5.53 5.22 S 15 16.55 19.09 17.82 4.80 5.50 5.15 4.91 5.57 5.24 S 16 12.95 13.97 13.46 4.81 5.51 5.16 4.95 5.62 5.29 S 17 12.02 13.14 12.58 4.38 5.14 4.76 4.56 5.25 4.91 S 18 13.18 14.63 13.90 4.82 5.57 5.20 5.00 5.68 5.34 S 19 12.62 13.81 13.22 4.50 5.24 4.87 4.69 5.38 5.04 S 20 11.27 12.28 11.78 3.84 4.75 4.30 3.72 4.80 4.26 Mean 13.91 15.49 14.70 4.34 5.13 4.74 4.42 5.21 4.81 Rhizome yield per plot Curcumin Essential oil M S M at S S at M M S M at S S at M M S M at S S at M S Ed 0.182 0.520 0.740 0.736 0.007 0.007 0.012 0.010 0.007 0.013 0.019 0.018 CD (P=0.01) 11.61 1.411 4.749 1.995 0.427 0.019 0.264 0.027 0.422 0.034 NS 0.049 CD (P=0.05) 2.319 1.053 1.978 1.489 0.085 0.014 0.065 0.020 0.084 0.026 0.063 0.036 NS : Non-significant Padmapriya et al J. Hort. 135 DAP 180 DAP 225 DAP M 1 (Open) M 2 (Shade) Mean M 1 (Open) M 2 (Shade) Mean M 1 (Open) M 2 (Shade) Mean S 1 1.357 1.462 1.410 1.682 1.816 1.749 1.563 1.622 1.593 S 2 1.385 1.489 1.437 1.722 1.850 1.786 1.594 1.648 1.621 S 3 1.328 1.445 1.386 1.673 1.795 1.734 1.551 1.598 1.575 S 4 1.314 1.427 1.371 1.659 1.764 1.712 1.536 1.578 1.557 S 5 1.374 1.475 1.425 1.700 1.823 1.762 1.578 1.632 1.605 S 6 1.460 1.521 1.491 1.761 1.893 1.827 1.614 1.678 1.646 S 7 1.485 1.552 1.519 1.795 1.922 1.859 1.631 1.710 1.671 S 8 1.514 1.589 1.552 1.825 1.953 1.889 1.663 1.764 1.714 S 9 1.290 1.412 1.351 1.642 1.752 1.697 1.522 1.564 1.543 S 10 1.187 1.332 1.260 1.552 1.645 1.599 1.411 1.512 1.462 S 11 1.350 1.278 1.314 1.485 1.575 1.530 1.362 1.496 1.429 S 12 1.258 1.384 1.321 1.617 1.715 1.666 1.491 1.536 1.514 S 13 1.421 1.510 1.466 1.745 1.875 1.810 1.608 1.660 1.634 S 14 1.474 1.538 1.506 1.782 1.911 1.847 1.622 1.692 1.657 S 15 1.508 1.575 1.542 1.811 1.941 1.876 1.648 1.742 1.695 S 16 1.238 1.380 1.309 1.608 1.689 1.649 1.477 1.525 1.501 S 17 1.159 1.310 1.235 1.523 1.621 1.572 1.375 1.508 1.442 S 18 1.274 1.399 1.337 1.622 1.726 1.674 1.509 1.555 1.532 S 19 1.224 1.354 1.289 1.582 1.680 1.631 1.453 1.518 1.486 S 20 1.110 1.265 1.188 1.445 1.542 1.494 1.325 1.468 1.397 Mean 1.336 1.435 1.385 1.662 1.774 1.718 1.527 1.600 1.563 135 DAP 180 DAP 225 DAP M S M at S S at M M S M at S S at M M S M at S S at M S Ed 0.007 0.021 0.029 0.029 0.005 0.011 0.016 0.016 0.005 0.015 0.022 0.021 CD (P=0.01) 0.421 0.056 0.170 0.079 NS 0.031 0.130 0.043 0.345 0.041 0.142 0.058 CD (P=0.01) 0.084 0.042 keywords: fym; kg ha-1; m m; npk; phosphobacteria; shade; t ha-1 cache: jhs-619.pdf plain text: jhs-619.txt item: #462 of 600 id: jhs-620 author: Patil, M B; Shitole, D S; Shinde, S B; Purandare, N D title: Response of Garlic to Organic and Inorganic Fertilizers date: 2007-12-31 words: 2376 flesch: 66 summary: Highest bulb yield per plot was recorded in the treatment T 7 (5.10 kg) followed by the treatment T 6 (4.97 kg) and treatment T 1 (4.95 kg), which were significantly superior over to rest of the treatments under study. The next best treatment for attaining early maturity was treatment T 7 (25% RDF + 75 % N – through FYM) (126.67 days), which was statistically at par with the treatments T 1, and T 5 . keywords: bulb; garlic; treatment; yield cache: jhs-620.pdf plain text: jhs-620.txt item: #463 of 600 id: jhs-621 author: Chander, M Subhas; Palaniappan, R title: Oxidative Stress and Changes in Antioxidant and Biochemical Constituents in Papaya (Carica papaya L.) under Salt Stress date: 2007-12-31 words: 3047 flesch: 62 summary: MATERIAL AND METHODS Six papaya cultivars, viz., Pusa Dwarf, Surya, Solo, CO5, Tainan and Red Lady were subjected to salt stress continuously for six months with saline water irrigation having EC value of 0.6, 2.0 and 4.0 dsm-1 during the year 2004-05. Among these, Red Lady was more sensitive while Tainan resisted salt stress. keywords: control; dsm-1; lady; red; salt; stress; sugars; tainan cache: jhs-621.pdf plain text: jhs-621.txt item: #464 of 600 id: jhs-622 author: Mir, M M; Jhon, A Q; Khan, F U; ., Nelofar title: Studies on Physical and Chemical Characteristics of Pomegranate Cultivars in Kashmir Valley date: 2007-12-31 words: 2354 flesch: 69 summary: Fruit weight, diameter and volume was significantly higher in cv. Bedana, Kandhari, Dholka and G-137. Variation in fruit weight and diameter was in accordance with findings of Bist et al (1994). keywords: bedana; cultivars; fruit; kandhari; pomegranate cache: jhs-622.pdf plain text: jhs-622.txt item: #465 of 600 id: jhs-623 author: ., Nelofar; Khan, F U; Jhon, A Q; Mir, M M title: Effect of Dry and Wet Storage on Post Harvest Life and Flower Quality in Cut Tulip cv. Cassini date: 2007-12-31 words: 2783 flesch: 74 summary: During first year significantly maximum days (7.0) to flower opening were taken by zero day storage in water which was at par with 0 and 2 days of dry storage (6.44 and 6.11, respectively). Sonia decreased with increased in length of dry storage. keywords: cut; days; dry; storage; water cache: jhs-623.pdf plain text: jhs-623.txt item: #466 of 600 id: jhs-624 author: Varu, D K; Barad, A V title: Effect of Date of Harvest and Floral Preservatives on Vase Life of Cut Flowers in Tuberose (Polyanthes tuberosa L.) cv. Double date: 2007-12-31 words: 3166 flesch: 69 summary: Observations like uptake of water, water loss, loss-uptake ratio, fresh weight of spike, percentage of opened, partial opened, neck bent and abscised florets as well as floret longevity, floret circumference and vase life of the spikes were recorded. Low temperature and high humidity during October might have reduced transpiration thus lowering water loss from the spikes. keywords: life; water cache: jhs-624.pdf plain text: jhs-624.txt item: #467 of 600 id: jhs-625 author: Ghosh, S N; Tarai, Ranjan K title: Performance of Mosambi Sweet Orange on Different Rootstocks Grown in Laterite Soil in West Bengal date: 2007-12-31 words: 1614 flesch: 65 summary: Growth of sweet orange tree was maximum on Jambhiri (Jatti Khatti) followed by Karna Khatta while on Rangpur lime rootstock, growth was minimum. Fruit weight was maximum on Rangpur lime rootstock (164 g) followed by on jambhiri (146g). keywords: fruit; mosambi; orange; rootstock cache: jhs-625.pdf plain text: jhs-625.txt item: #468 of 600 id: jhs-626 author: Khan, F U; Malik, F A; Khan, F A; ., Nelofar title: Effect of Pre-Harvest Application of GA3 and PP333 as Bulb Dip and Foliar Spray on Quality and Vase Life of Cut Tulip cv. Cassini date: 2007-12-31 words: 1863 flesch: 67 summary: Key words: Cut tulip, quality, vase life, gibberellic acid, paclobutrazol paclobutrazol on post harvest behavior and vase life of cut tulip cv. Days taken to flower, flower diameter, scape length and vase life calculated from the day of full flower to the day when petals expressed first sign of wilting, were also recorded and the method of Gomez and Gomez (1984) was applied for analysis of variance. keywords: ppm; vase; water cache: jhs-626.pdf plain text: jhs-626.txt item: #469 of 600 id: jhs-627 author: Hasan, M A; Chowdhury, R Ray; Sarkar, S; Mathew, S title: Effect of Bunch-Trimming on Yield and Quality in Banana date: 2007-12-31 words: 2054 flesch: 62 summary: The time of hand removal did not show any significant difference on yield while hand weight, finger weight, finger length, finger diameter and volume of finger increased with the increase in number of hands removed. It was evident that hand removal had significant effect on bunch weight, yield, hand weight, finger weight, finger length, diameter, pulp weight, peel weight, pulp thickness, peel thickness, total sugar, reducing and non- reducing sugar, acidity and TSS/acid ratio. keywords: finger; hand; removal; weight cache: jhs-627.pdf plain text: jhs-627.txt item: #470 of 600 id: jhs-628 author: Singh, Devi; Bahadur, Vijay title: Effect of Various Nursery Media on Onion Seedlings Development date: 2007-12-31 words: 1508 flesch: 62 summary: Annual Report, Vegetable Research, All India Coordinated Vegetable Improvement Project, p 38 Nursery media in onion seedling growth (MS Received 13 November 2006, Revised 23 August 2007) J. Hort. Sci. Vol. 2 (2): 162-163, 2007 Influence of various nursery media on raising onion seedlings Treatment % Seedling Stem Root Shoot Root fresh Total Shoot Root Total germination height (cm) diameter length fresh weight seedlings dry dry seedlings at 10 DAS (cm) (cm) weight (g) (g) fresh weight (g) weight (g) weight (g) dry weight (g) T 1 70.00 7.09 0.15 7.03 2.86 1.85 4.71 0.49 0.71 1.65 T 2 84.67 8.18 0.18 7.83 3.00 1.89 4.89 1.12 0.83 1.95 T 3 84.33 7.91 0.18 7.61 3.00 1.88 4.88 1.06 0.72 1.78 T 4 87.67 8.50 0.20 8.13 3.27 2.16 5.44 1.30 0.93 2.23 T 5 86.00 8.26 0.19 8.03 3.11 2.05 5.16 1.20 0.84 2.04 T 6 100.00 11.42 0.33 10.86 6.96 3.22 10.18 3.95 1.53 5.48 T 7 100.00 11.22 0.31 10.70 6.55 3.05 9.60 3.57 1.50 5.07 T 8 100.00 10.32 0.26 10.39 4.74 2.77 7.51 2.39 1.44 3.83 T 9 99.33 9.35 0.23 10.02 4.44 2.61 7.05 1.97 1.24 3.21 T 10 96.00 8.62 0.21 9.81 3.72 2.28 5.99 1.51 1.04 2.55 T 11 99.00 9.14 0.22 9.87 3.89 2.38 6.27 1.52 1.22 2.73 T 12 99.00 9.16 0.23 9.88 4.27 2.44 6.71 1.90 1.22 3.12 T 13 92.67 8.55 0.21 9.36 3.61 2.22 5.82 1.45 0.99 2.44 T 14 100.00 9.56 0.24 10.25 4.44 2.66 7.10 2.16 1.35 3.52 F-Test S S S S S S S S S S SEd + 1.95 0.22 0.02 0.15 0.09 0.06 0.09 0.06 0.03 0.07 CD (P=0.05) 4.01 0.45 0.03 0.32 0.18 0.12 0.19 0.12 0.07 0.15 Note: Parameters were recorded at 45 days after sowing except germination percentage Table 2. keywords: fym; sand; soil cache: jhs-628.pdf plain text: jhs-628.txt item: #471 of 600 id: jhs-630 author: Parthasarathy, V A; Karun, Anitha; Rajesh, M K title: Biotechnology of Coconut date: 2007-06-30 words: 9182 flesch: 58 summary: Success obtained in coconut embryo culture and its use in germplasm collection was one of the major achievements in this direction. Sucrose might be important in early stages of coconut embryo cultures to maintain high chlorophyll concentration and a high number of chloroplasts. keywords: coconut; cocos; culture; diversity; embryos; et al; genetic; j. l.; markers; medium; nucifera; somatic; tissue cache: jhs-630.pdf plain text: jhs-630.txt item: #472 of 600 id: jhs-631 author: Saiprasad, G V S; Raghuveer, P title: Influence of Ethylene Inhibitors and Ethrel on Production of Protocorm Like Bodies in Orchid-Dendrobium 'Sonia' date: 2007-06-30 words: 3551 flesch: 59 summary: Ethylene production was observed in all ethrel treatments only, but could not be detected in ethylene inhibitor treatments. Inhibition of ethylene production by CoCl 2 resulting in increased shoot regeneration was reported, for instance in Brassica oleracea (Sethi et al, 1990); in Brassica campestris (Palmer, 1992); in pearl millet (Pius et al, 1993) and in silk tree (Sankhla et al, 1995). keywords: ethrel; ethylene; inhibitors; methane; plb; production; treatments cache: jhs-631.pdf plain text: jhs-631.txt item: #473 of 600 id: jhs-632 author: Prakash, D P; Deepali, B S; Asokan, R; Ramachandra, Y L; Anand, Lalitha; Hanur, Vageeshbabu S title: Effect of Antibiotics and Gelling Agents in Transformation of Brinjal (Solanum melongena L.) cv. Manjarigota date: 2007-06-30 words: 4498 flesch: 50 summary: There were marked differences in regeneration response in hypocotyl explants cultured on medium solidified with various gelling agents indicating the influence of gelling agent on the activity of kanamycin in culture medium, which indirectly affects selection and recovery of transformants. Regeneration response of hypocotyl explants after Agrobacterium cocultivation cultured on SRMH containing defferent levels of cefotaxime (mg/l):1, 0; 2, 100; 3, 250; 4, 500; 5,750 and 6, 1000 mg/l. keywords: callus; cefotaxime; explants; gelling; hypocotyl; kanamycin; regeneration; response; transformation cache: jhs-632.pdf plain text: jhs-632.txt item: #474 of 600 id: jhs-633 author: Rao, V S; Sankar, G R Maruthi title: Effects of Clay Mineral Application on Soil Moisture Status, Physiological Traits and Yield of Rainfed Tomato under Semi-Arid Alfisols date: 2007-06-30 words: 5022 flesch: 63 summary: Effects of clay mineral application on soil moisture status, physiological traits and yield of rainfed tomato under semi-arid alfisols V. S. Rao and G. R. Maruthi Sankar Central Research Institute for Dryland Agriculture Santoshnagar, Hyderabad–500059, India E-mail : vsrao@crida.ernet.in ABSTRACT The effects of application of farm yard manure (FYM) and clay mineral (CM) on soil and plant characteristics like soil moisture at field capacity, permanent wilting point, leaf area, leaf nitrogen, relative water content, yield of tomato were examined based on field experiments conducted in a semi-arid alfisol at Hyderabad during 1998 –99 and 1999-2000. Key words : Soil moisture, plant traits, correlation, regression, prediction INTRODUCTION keywords: fym; moisture; ns ns; soil cache: jhs-633.pdf plain text: jhs-633.txt item: #475 of 600 id: jhs-634 author: Basavaraja, P K; Sridhara, S; Sushma, A R; Hareesh, G R title: Effect of Integrated Nutrient Management on Onion Yield and Soil Properties under Chromic haplusterts of Karnataka date: 2007-06-30 words: 2867 flesch: 65 summary: Effect of integrated nutrient management on onion yield and soil properties under Chromic Haplusterts of Karnataka P. K. Basavaraja, S. Sridhara1, A. R. Sushma and G. R. Hareesh Department of Soil Science and Agricultural Chemistry GKVK, University of Agricultural Sciences, Bangalore-560 065, India E-mail: pkbraj@yahoo.com ABSTRACT A field experiment was conducted during the Kharif season of 2002 and 2003 under Chromic Haplusterts (medium black soils) at Zonal Agricultural Research Station, Hiriyur to study the effect of Coir Pith Based Compost (CPBC) along with organic manures and inorganic fertilizers on yield of Onion. Onion bulbs were cut horizontally and the number of layers was counted. keywords: application; cpbc; onion; rdf cache: jhs-634.pdf plain text: jhs-634.txt item: #476 of 600 id: jhs-635 author: Pal, Harshata; Banik, Ashis Kumar; ., Nuchhungi title: Effect of Blending, Additives and Storage Conditions on the Quality of Watermelon Nectar date: 2007-06-30 words: 3030 flesch: 58 summary: Key words: Watermelon nectar; total soluble solid, reducing sugar, lycopene, titratable acidity, blending, additives, storage INTRODUCTION Watermelon (Citrullus lanatus) is an important cucurbitaceous crop, which is widely grown in our country and is highly relished due to its cool and thirst quenching property. The experiment was conducted at the department of Post Harvest Technology of Horticultural Crops, Faculty Fig 1 Steps followed for processing of watermelon nectar of Horticulture, B.C.K.V., Mohanpur, Nadia, West Bengal. keywords: storage; temperature; watermelon cache: jhs-635.pdf plain text: jhs-635.txt item: #477 of 600 id: jhs-636 author: Kavitha, C; Vadivel, E; Rajamani, K; Thangamani, C title: Analysis of Variability for Qualitative and Quantitative Traits in Coleus forskohlii Briq. date: 2007-06-30 words: 1651 flesch: 49 summary: The availability of a limited number of morphological traits, their poor or unknown genetic control, environmental influence on the phenotypic expression, and difficulties in stage-specific identification are major impediments in using these as genetic traits for genetic diversity analysis. For qualitative traits, a large number of genotypes out of 37 clustered together at 74 % similarity in four different groups. keywords: data; forskohlii; genotypes; plant; traits cache: jhs-636.pdf plain text: jhs-636.txt item: #478 of 600 id: jhs-637 author: Padmini, K; Gowda, R Veere; Naik, L B title: Studies on Parental Synchronization in Flowering for Hybrid Seed Production in Onion (Allium cepa L.) date: 2007-06-30 words: 1871 flesch: 64 summary: Delay in planting of C lines by a week after planting A lines resulted in synchronised flowering of parental lines at peak flowering stage. Synchronisation of flowering of parental lines is absolutely essential in onion hybrid seed production for effecting natural crossing in CMS lines (A line ) by pollinators from pollinator lines (C line) ( Peters,1990). keywords: flowering; lines; planting cache: jhs-637.pdf plain text: jhs-637.txt item: #479 of 600 id: jhs-638 author: Bhuvaneswari, S; Tiwari, R B title: Pilot Scale Processing of Red Flesh Guava RTS Beverage date: 2007-06-30 words: 1699 flesch: 67 summary: Fruit juice based RTS beverages have the distinct advantage of higher nutritional value over synthetic aerated waters. RTS beverage was prepared by mixing fruit pulp with syrup to an optimum level of acidity and sugar, as standardized on a laboratory scale. keywords: beverage; guava; peeling; rts; storage cache: jhs-638.pdf plain text: jhs-638.txt item: #480 of 600 id: jhs-639 author: Krishnamoorthy, A; Visalakshi, P N Ganga title: Influence of some Pesticides on Entomopathogenic Fungus Lecanicillium (=Verticillium) lecanii (Zimm.) ZARE & GAMS date: 2007-06-30 words: 3321 flesch: 58 summary: Conidial germination, mycelial growth and conidial production in L. lecanii was determined by calibrating i) per cent germination of conidial spores ii) rate of growth of mycelium and iii) yield of conidial spores after the vegetative phase. A rating with 81-100% inhibition denotes that the interaction resulted in very highly toxic effect on mycelial growth of L. lecanii, where there is no chance of revival of the fungus. keywords: carbendazim; conidia; germination; growth; lecanii; pesticides cache: jhs-639.pdf plain text: jhs-639.txt item: #481 of 600 id: jhs-640 author: Chowdappa, P title: Molecular Characterization of Phytophthora nicotianae Associated with Diseases of Horticultural Crops by RFLP of PCR Internal Transcribed Spacer Region of Ribosomal DNA and AFLP Fingerprints date: 2007-06-30 words: 3377 flesch: 68 summary: Sporangial measurement in P. nicotianae isolates Isolate No Length*(µm) Morphology of P. nicotianae isolates, Top left, sporangia, Top right, chlamydospores, Bottom left, oogonia, Bottom right, oospores Table 2. keywords: isolates; nicotianae; parasitica; phytophthora cache: jhs-640.pdf plain text: jhs-640.txt item: #482 of 600 id: jhs-641 author: Sundharaiya, K; Venkatesan, K title: Studies on Combining Ability in Bitter Gourd (Momordica charantia L.) date: 2007-06-30 words: 2522 flesch: 67 summary: This was followed by line L 3 . The line L 1 expressed the best gca for fruit length, fruit size index, cavity size index, individual fruit weight and yield per vine. keywords: days; fruit; index; size cache: jhs-641.pdf plain text: jhs-641.txt item: #483 of 600 id: jhs-642 author: Singh, H S; Kumar, N K Krishna; Krishnakumari, B title: Effect of Pheromone Lure-Distance and Direction in Trapping Brinjal Fruit and Shoot Borer (Leucinodes orbonalis Guen.) Male Moths date: 2007-06-30 words: 2361 flesch: 65 summary: Effect of wind direction on orientation of male BSFB moths and trap catch Number of days the wind Mean wind positive Mean wind negative % trapped as blew in a specific direction population population wind negative Direction of wind Wind blow days (location of trap) Negative Positive S N (South) 26 9 0.08 0.23 74.19 N S (North) 9 26 0.11 0.20 64.52 E W (East) 16 10 0.10 0.19 65.52 W E (West) 10 16 0.06 0.12 66.67 Mean 67.72 Pheromone distance and direction in trapping brinjal fruit borer 69J. Hort. Results indicated that the number of male BSFB moths in distantly located traps (350 m from the brinjal field) was at par with the numbers observed in traps placed in the main brinjal field. keywords: brinjal; bsfb; direction; fruit; male; moths; pheromone cache: jhs-642.pdf plain text: jhs-642.txt item: #484 of 600 id: jhs-643 author: Asokan, R; ., Puttaswamy title: Comparative Toxicity of Two Isolates of Bacillus thuringiensis Berliner from Plutella xylostella L. and Papilio demoleus L. to some Important Lepidopteran Pests of Horticultural Crops date: 2007-06-30 words: 879 flesch: 50 summary: Among these, C. binotalis was highly susceptible (28.4 and 26.0 ng/cm2, for KPx-1 and IPd-1, respectively), while, H. armigera was the least susceptible (9.5 and 10.0 µg/ml, for KPx-1 and IPd-1, respectively). Stock culture of H. armigera was maintained on semisynthetic diet (Nagarkatti and Prakash, 1974), while, that of C. binotalis and D. obliqua maintained on cabbage. keywords: isolates; lepidoptera; toxicity cache: jhs-643.pdf plain text: jhs-643.txt item: #485 of 600 id: jhs-645 author: Kumar, N title: Problems and Prospects of Banana Breeding in India date: 2006-12-31 words: 11000 flesch: 62 summary: Male fertility in banana hybrids could be assessed by pollen output per anther; pollen viability and pollen size, which vary from cross to cross, and also from ploidy to ploidy. Damodaran (2004) employed this method for the first time in banana hybrids in India to confirm ploidy status of some hybrids. keywords: aab; aabb; banana; breeding; bunch; diploid; fusarium; hybrids; india; lilin; musa; nematodes; parents; pisang; ploidy; resistance; table; triploid cache: jhs-645.pdf plain text: jhs-645.txt item: #486 of 600 id: jhs-646 author: Shivashankar, S; Nachane, R P; Kalpana, S title: Composition and Properties of Fibre Extracted from Pseudostem of Banana (Musa Sp.) date: 2006-12-31 words: 2809 flesch: 61 summary: Fibre content of the outermost three layers of pseudostem sheath did not differ significantly, but, the yield of extractable fibre was significantly different among varieties (Table 1). Key words: Banana cultivars, pseudostem fibre, mechanical properties Cellulose in the sheath and fibre was converted into acetylated cellodextrins by acetolysis with acetic/nitric reagent (4:1) followed by acid hydrolysis into glucose and was estimated following Sadasivam and Manickam (1996). keywords: banana; commercial; content; cultivars; fibre; properties; pseudostem cache: jhs-646.pdf plain text: jhs-646.txt item: #487 of 600 id: jhs-647 author: Satisha, J; Prakash, G S; Bhatt, R M; Sampathkumar, P title: Effect of Soil Moisture Stress on Physiological Response in Grape (Vitis vinifera L.) Varieties date: 2006-12-31 words: 3019 flesch: 61 summary: Finally, it is concluded that a slight reduction in photosynthetic rate, lower transpiration rate and better water relation in terms of water potential and osmotic adjustment under mild water stress in the varieties Flame Seedless and Thompson Seedless suggests their uniqueness and differential sensitivity to soil moisture stress. Effect of water stress and salinity on photosynthesis of pistachio. keywords: day; moisture; seedless; stress; water cache: jhs-647.pdf plain text: jhs-647.txt item: #488 of 600 id: jhs-649 author: Tomar, Rukam S; Bhalala, M K title: Combining Ability Studies in Muskmelon (Cucumis melo L.) date: 2006-12-31 words: 4155 flesch: 71 summary: However, parent AMM-02-26 was a good combiner for fruit yield peer plant but was average or poor combiner for the remaining traits in pooled analysis. The potence ratio of both the components of genetic variance was below one (unity) for all the characters except fruit girth and moisture content in E 1 which suggests that specific combining ability effects were more pronounced for inheritance of most traits. keywords: amm-00; hara; madhu; madhuras; pmm-96 cache: jhs-649.pdf plain text: jhs-649.txt item: #489 of 600 id: jhs-650 author: Hanur, Vageeshbabu S; Prakash, D P; Deepali, B S; Asokan, R; Ramachandra, Y L; Mahmood, Riaz; Anand, Lalitha title: Synergistic Use of Hypocotyl Explants and High Bap Preconditioning for Enhanced Transformation Frequency in Brinjal (Solanum melongena L.) date: 2006-12-31 words: 2542 flesch: 49 summary: Tissue cultures and plant regeneration from different J. Hort. Re-evaluation of conditions for plant regeneration and Agrobacterium- mediated transformation from tomato. keywords: agrobacterium; bap; brinjal; explants; regeneration; transformation cache: jhs-650.pdf plain text: jhs-650.txt item: #490 of 600 id: jhs-651 author: Reddy, S G Eswara; Kumar, N K Krishna title: Integrated Management of the Yellow Mite, Polyphagotarsonemus latus (Banks), on Sweet Pepper Grown under Polyhouse date: 2006-12-31 words: 2926 flesch: 56 summary: Our results are in agreement with the findings of Honnamma Rani (2001) who Table 1: Modules evaluated against P. latus on sweet pepper under polyhouse (September 2002-March 2003 and June-December 2003) Module Spray sequence M 1 Abamectin 0.00095% - Ethion 0.05% - Abamectin 0.00095% M 2 Abamectin 0.00095% - Profenophos 0.05% - Abamectin 0.00095% M 3 Dicofol 0.037% - Pongamia oil 1% - Neem seed kernel extract 4% M 4 Dicofol 0.037% -Amblyseius tetranychivorus - Verticilium lecanii 0.30% M 5 Dicofol 0.037% - A. tetranychivorus – Pongamia oil 1% M 6 Control (No spray) Table 2: Modules evaluated against P. latus on sweet pepper in polyhouse (March -September 2004) Module Spray sequence M 1 Abamectin 0.00095% - Dicofol 0.037% M 2 Dicofol 0.037% - Fenazaquin 0.01% M 3 Fenazaquin 0.01% - Pongamia oil 1% M 4 Oxymetrin 0.0009%- keywords: 0.71)a; abamectin; dicofol; latus; module; spray cache: jhs-651.pdf plain text: jhs-651.txt item: #491 of 600 id: jhs-652 author: Devi, H Usha Nandhini; Chezhiyan, N title: Impact of Gamma Rays on Turmeric Crop (Curcuma longa L.) date: 2006-12-31 words: 3888 flesch: 69 summary: This may be the reason for the yield that resulted at higher doses of gamma rays, irrespective of the fact that the plants could recover from the shock of gamma ray treatments later in their growth period. Yield per plant vMo generation Among the different treatments of G 1 (CL144), treatment T 3 (2.0 kR) produced the highest yield per plant (373.75 g) and the lowest yield (137.50 g) was recorded in T 7 (4.0 kR), whereas, the control (T 0 ) registered 301.50 g. In G 2 (CL146), treatment T 3 (2.0 kR) registered increased yield (266.25 g) and T 7 (4.0 kR) obtained decreased yield (63.75 g), while, the yield per plant observed in the control (T 0 ) was 97.88 g. keywords: curing; days; gamma; yield cache: jhs-652.pdf plain text: jhs-652.txt item: #492 of 600 id: jhs-653 author: Khan, F U; Jhon, A Q; Khan, F A; Mir, M M title: Effect of NPK and Zn on Growth, Flowering and Bulb Production in Tulip under Polyhouse Conditions in Kashmir date: 2006-12-31 words: 5153 flesch: 65 summary: Increased plant growth with nitrogen application Table 2. A marked increase in both the number of bulbs and bulblet weight per plant may be attributed to better availability of phosphorus, which is required in particularly for bulb growth. keywords: bulb; growth; nitrogen cache: jhs-653.pdf plain text: jhs-653.txt item: #493 of 600 id: jhs-654 author: Khan, F A; Rather, A H; Qazi, N A; Bhat, M Y; Darzi, M S; Beigh, M A; Ahmad, Imtiyaz title: Effect of Modified Atmosphere Packaging on Maintenance of Quality in Apple date: 2006-12-31 words: 1793 flesch: 62 summary: ‘Golden Delicious’ showed higher incidence of bitter pit as compared to ‘Red Delicious’ apples. The least incidence of bitter pit in ‘Golden Delicious’ was recorded with T 4 (30 x 2 mm perforation) and T 3 (20 x 2 mm) treatment in ‘Red Delicious’ apples. keywords: apples; delicious; perforation; pit cache: jhs-654.pdf plain text: jhs-654.txt item: #494 of 600 id: jhs-655 author: Kumar, Pankaj; Gangwar, M P; Dimri, D C title: Evaluation of Spur and Colour Mutant Cultivars of Apple (Malus domestica Borkh.) for their Suitablity under Mid Hill Conditions of Uttaranchal date: 2006-12-31 words: 1458 flesch: 64 summary: In addition, Farooqui et al (1986) recorded fruit diameter in the Delicious group of apple cultivars ranging from 6.52 cm to 8.24 cm. Observations on fruit weight and volume also showed significant variation ranging from 118.1 g (Tydeman’s Early Worcester) to 170.4 g (Red Spur) and 136.89 ml (Tydeman’s Early Worcester) to 193.13 ml (Red Spur). Sci. Vol. 1 (2): 138-140, 2006 Evaluation of apple cultivars 139 page 140 Kanwar, S.M. 1991. keywords: apple; delicious; fruit; red; spur cache: jhs-655.pdf plain text: jhs-655.txt item: #495 of 600 id: jhs-656 author: Sharma, H R; Sharma, Deepa title: Genetic Divergence for Yield and Yield-Contributing Traits in Cucumber (Cucumis sativus L.) date: 2006-12-31 words: 1585 flesch: 64 summary: Key words: Cluster analysis, cucumber, genetic divergence, Cucumis sativus L. Cucumber (Cucumis sativus L.) is an important vegetable crop that has its origins in the Indian sub- continent. Cluster analysis grouped the genotypes of cucumber into seven clusters. keywords: cluster; fruit; green; local cache: jhs-656.pdf plain text: jhs-656.txt item: #496 of 600 id: jhs-657 author: Tomar, Rukam S; Bhalala, M K title: Heterosis Studies in Muskmelon (Cucumis melo L.) date: 2006-12-31 words: 2661 flesch: 78 summary: Observations showed that F 1 hybrids of muskmelon yield higher than the standard cultivars. Thus, total fruit yield could be a result of combinational heterosis. keywords: fruit; heterosis; plant cache: jhs-657.pdf plain text: jhs-657.txt item: #497 of 600 id: jhs-658 author: Mani, M; Krishnamoorthy, A title: Colonization of Introduced Parasitoid, Encarsia guadeloupae Viggiani, on the Exotic Spiralling Whitefly, Aleurodicus dispersus Russell, Infesting Ornamentals date: 2006-12-31 words: 2043 flesch: 56 summary: A steady decline in the population of spiralling whitefly was observed on these ornamentals. Short communication page 149 total of 156 adults of E. guadeloupae on R. indica in August 2002, 179 adults on H. rosasinensis during May 2003, 124 adults on P. pulcherrima in July 1998, and 247 adults on A. hispida infested with spiralling whitefly in June 2003, were released. keywords: aleurodicus; dispersus; encarsia; guadeloupae; parasitism; whitefly cache: jhs-658.pdf plain text: jhs-658.txt item: #498 of 600 id: jhs-66 author: Talang, H D; Dutta, P; Mukhim, C; Patil, S title: Effect of Integrated Nutrient Management on Mango (Mangifera indica L.) cv. Himsagar date: 2017-06-30 words: 4302 flesch: 73 summary: Sci. Vol. 12(1) : 23-32, 2017 26 Fig.1: Effect of integrated nutrient management on no. of fruits/tree Fig.2: Effect of integrated nutrient management on fruit weight (g) Fig.3: Effect of integrated nutrient management on fruit yield (kg/tree) For yield parameters, average number of fruits per tree, average yield per tree (kg) and average weight of fruit (g) were recorded. keywords: ½ t cache: jhs-66.pdf plain text: jhs-66.txt item: #499 of 600 id: jhs-663 author: Peter, K V; Babu, K Nirmal; ., D Minoo title: Spices biotechnology date: 2006-06-30 words: 9324 flesch: 59 summary: Tree spices Micropropagation protocols have been reported in many tree spices like cinnamon, nutmeg, cassia, clove, camphor, curry leaf, pomegranate, camboge and tamarind (ZhangandStoltz, 1981; Mascarenhas, etal 1987;Mathew andHariharan, 1990;Hazarikaera/, 1995; Mini efaf, 1997; Mallika, et al, 1997; Bhuyan et al, 1997; Huang et al, 1998; Nirmal Babu et al, 2000; Mehta et al, 2000). In vitro induction of microrhizomes in ginger, turmeric and Kaempferia is reported by many workers (Bhat et al, 1994; Nirmal Babu, 1997; Raghu Rajan, 1997; Sunitibala et al, 2001; Nirmal Babu et al, 2003). keywords: babu; biotechnology; black; capsicum; cell; cultures; et al; ginger; micropropagation; nirmal; pepper; piper; plants; production; rapd; regeneration; sci; spices; turmeric; vanilla; vitro cache: jhs-663.pdf plain text: jhs-663.txt item: #500 of 600 id: jhs-665 author: Bhanuprakash, K; Yogeesha, H S; Naik, L B; Arun, M N title: Studies on Physiological and Biochemical Changes in Relation to Seed Viability in Aged Onion Seeds date: 2006-06-30 words: 2344 flesch: 60 summary: Based on these findings, it is concluded that seed ageing in onion is the J. Hort. Vol. 1 (1): 15-18, 2006 Studies on physiological and biochemical changes in relation to seed viability in aged onion seeds K. Bhanuprakash, H. S. Yogeesha, L. B. Naik and M. N. Arun Section of Seed Science & Technology Indian Institute of Horticultural Research Hessaraghatta Lake Post, Bangalore-560 089, India E-mail: kbp_iihr@yahoo.co.in ABSTRACT Rapid loss in viability of onion seeds during seed storage is a major problem. keywords: ageing; duration; germination; increase; onion; seeds; viability; vigour cache: jhs-665.pdf plain text: jhs-665.txt item: #501 of 600 id: jhs-667 author: Satisha, J; Prakash, G S; Murti, G S R; Upreti, K K title: Response of Grape Rootstocks to Soil Moisture Stress date: 2006-06-30 words: 2922 flesch: 68 summary: The higher levels of abscisic acid content in Dogridge and Salt Creek under soil moisture stress suggested their better drought tolerance capacity through a reduction of stomatal conductance and increased water use efficiency. This investigation aims to study the levels of endogenous ABA and cytokinin levels in the leaves of commonly employed rootstocks, their root and shoot growth patterns under varying levels of soil moisture stress with the ultimate objective of identifying the drought tolerant rootstocks in terms of increased water use efficiency by production of more ABA and increased root growth. keywords: aba; creek; dogridge; moisture; rootstocks; shoot; stress; water cache: jhs-667.pdf plain text: jhs-667.txt item: #502 of 600 id: jhs-668 author: Kaur, R; Thakur, Neetu; Sharma, D R title: Low Cost Strategy for Micropropagation of Lilium Asiatic Hybrid Cv. Toscana date: 2006-06-30 words: 2522 flesch: 60 summary: Culture medium containing all the cost effective components was found to be the best for in vitro establishment of cultures yielding 6.00 bulblets per explant and medium supplemented with tapioca granules as cost effective component was found to be the best for in vitro multiplication of bulblets giving 3.70 bulblets per in vitro formed bulblet five weeks from third subculture. Earlier attempts by Sharma et al (1992) in 'Colt'- a rootstock of cherry, Ganapathi et al (1992) in banana and Okuno et al (1996) in Brassica campestris, tried to bring down the cost of in vitro muliplication on MS medium containing tap water and table sugar as cost effective components of culture medium. keywords: agar; bulblets; cost; lilium; medium; table; water cache: jhs-668.pdf plain text: jhs-668.txt item: #503 of 600 id: jhs-669 author: Anjaneyulu, K title: Development of Diagnostic Leaf Nutrient Norms and Identification of Yield Limiting Nutrients Using DRIS in Rose Grown under Protected Conditions date: 2006-06-30 words: 3237 flesch: 63 summary: Vol. 1 (1): 28-32, 2006 Development of diagnostic leaf nutrient norms and identification of yield limiting nutrients using DRIS in rose grown under protected conditions K. Anjaneyulu Division of Soil Science & Agricultural Chemistry Indian Institute of Horticultural Research Hessaraghatta Lake Post, Bangalore-560 089, India E-mail: anjaney@iihr.emet.in ABSTRACT Leaf samples collected from protected cultivation units of rose around Bangalore (Karnataka) and Hosur (Tamil Nadu), when flower buds were at pea size, were processed and analyzed for various nutrients and thus, the data bank was established. DRIS ratio norms Forty-five nutrient expressions chosen as diagnostic norms from high yielding population are presented in J. Hort. keywords: dris; nutrient cache: jhs-669.pdf plain text: jhs-669.txt item: #504 of 600 id: jhs-67 author: Naik, Kirtimala B; Nataraj, S K; Kumar, D P; Shadakshari, Y G; Seetharamu, G B; Venugopalan, R; Jayaprasad, K V title: Standardisation of agro-techniques for flower quality parameters in ornamental sunflower (Helianthus annus L.) date: 2017-06-30 words: 3498 flesch: 75 summary: Sci. Vol. 12(1) : 33-41, 2017 Agro techniques for flower quality in ornamental sunflower Ta bl e 1. S3 (60 cm x 20 37 Agro techniques for flower quality in ornamental sunflower J. Hortl. keywords: flower; mulch; npk; npk kg cache: jhs-67.pdf plain text: jhs-67.txt item: #505 of 600 id: jhs-670 author: Sharma, Debi; Krishnamoorthy, A; Moorthy, P N Krishna; Ganesan, Girija; Ahuja, A K; Awasthi, M D title: Development of IPM Package with Safe Pesticide Residue: 1. Cabbage date: 2006-06-30 words: 3745 flesch: 65 summary: Validation of non-chemical control Several botanical insecticides and biocontrol agents were evaluated singly or in combination for control of cabbage pests in the third trial. Thus, it was observed that considering residual persistence among the chemicals used for control of cabbage pests, dimethoate can be recommended for control of aphids and mancozeb can be used for the control oi Altemaria leaf blight and bacterial rot as these are safe to be applied at harvest stage of cabbage. keywords: cabbage; control; days; dbm; ipm; mancozeb; parasitoid; pesticide; pests; residues; spray cache: jhs-670.pdf plain text: jhs-670.txt item: #506 of 600 id: jhs-671 author: Kumar, N K Krishna; Kumari, B Krishna; Singh, H S; Ranganath, H R; Shivakumara, B; Kalleshwaraswamy, C M title: Pheromone Trapping Protocols for Brinjal Shoot and Fruit Borer, Leucinodes orbonalis Guenee (Lepidoptera: Pyralidae): Evaluation of Trap Design, Quantity and Dispenser date: 2006-06-30 words: 2846 flesch: 67 summary: Key words; Brinjal shoot and fruit borer, Leucinodes orbonalis, pheromone traps and lures I N T R O Catches of Leucinodes orhonalis in water trap with different types of pheromone dispensers (loaded with 4 mg of IICT synthesized pheromone) at IIHR, Bangalore, and CHES, Bhubaneswar IIHR, Bangalore CHES, Bhubaneshwar Treatment Total moths keywords: lures; pest; pheromone; rubber; septa; trap; water cache: jhs-671.pdf plain text: jhs-671.txt item: #507 of 600 id: jhs-672 author: Kumar, A Manoj; Ganesan, Girija title: Management of Bacterial Wilt of Tomato Caused by Ralstonia solanacearum (Smith) Yabuuchi et al Using Biological Control Agents date: 2006-06-30 words: 2231 flesch: 59 summary: Vol. 1 (1): 44-47, 2006 Management of bacterial wilt of tomato caused by Ralstonia solanacearum (Smith) Yabuuchi et al using biological control agents A. Manoj Kumar and Girija Ganesan' Department of Crop Physiology University of Agricultural Sciences G K. V. K., Bangalore-560 065, Kamataka, India. At the time of transplanting, roots were dipped in broth containing biological control agents viz., T. harzianum, T. viride, B. subtilis and P. fluorescens for 30 min. and transplanted to the sick plots, in randomized block design (RBD). keywords: control; dip; root; soil; solanacearum; tomato; wilt cache: jhs-672.pdf plain text: jhs-672.txt item: #508 of 600 id: jhs-673 author: Meman, M A; Barad, A V; Raval, L J title: Effect of Drying Conditions and Embedding Materials on Post-Harvest Quantitative Parameters in China Aster (Callistephus chinensis) Flowers date: 2006-06-30 words: 2000 flesch: 72 summary: From first to fourth day, moisture content was higher in room dried flowers as compared to sun dried flowers. The per cent moisture loss was higher in silicagel dried flowers due to its strong hygroscopic nature, as compared to borax treatment. keywords: day; drying; moisture cache: jhs-673.pdf plain text: jhs-673.txt item: #509 of 600 id: jhs-674 author: Sharma, H R; Sharma, Deepa; Thakur, A K title: Analysis of Genetic Divergence in Tomato (Lycopersicon esculentum Mill.) date: 2006-06-30 words: 1445 flesch: 67 summary: Maximum divergence within a cluster was exhibited by the cluster VIH (1.531), closely followed by cluster III (1.528) and cluster V (1.460), whereas, cluster VIII and cluster II were the most divergent from each other followed by cluster VII and cluster VIII. Maximum number of genotypes figured in cluster IX followed by cluster III, cluster V and cluster VII (8 genotypes in each), cluster X (7 genotypes), cluster I and cluster VI (6 genotypes), cluster II (3 genotypes) and cluster IV and cluster VIII (2 genotypes each). keywords: cluster; genotypes; plant cache: jhs-674.pdf plain text: jhs-674.txt item: #510 of 600 id: jhs-675 author: Padmini, K; Naik, L B title: Studies on the Extent of Genetic Contamination in Seed Production of Ridge Gourd (Luffa acutangula Roxb.) date: 2006-06-30 words: 1839 flesch: 65 summary: Extent of genetic contamination at various isolation distances in ridge gourd Isolation distance (m) 200 400 600 800 CD (0.05) Genetic contamination (%) in the progeny of round fruited ridge gourd 2004 28.62 (31.49)* 20.14 (26.43)* 17.44 (24.06)* _ NS 2005 88.11 (69.80)* 83.51 (66.01)* 79.04 (63.23)* 74.23 (59.47)* NS : Angular transformed values; - No fruit set was observed The present study revealed that as the isolation distance increased from 200 m to 800 m, per cent contamination in the progeny of round fruited ridge gourd decreased. Hence, any reduction in isolation distance from the prescribed 800 m would drastically affect the genetic purity of ridge gourd / Hort. keywords: contamination; isolation; seed cache: jhs-675.pdf plain text: jhs-675.txt item: #511 of 600 id: jhs-677 author: Doijode, S D title: Long Term Seed Storage Studies in Muskmelon (Cucumis melo L.) date: 2006-06-30 words: 1328 flesch: 60 summary: They are high value seeds demanding suitable protection during seed storage, to produce high quality plants. Seed storage under improper condition affects the seed quality and causes great loss to farming community (Harrington, 1972). keywords: seed; storage cache: jhs-677.pdf plain text: jhs-677.txt item: #512 of 600 id: jhs-678 author: Mahajan, P K; Thakur, M title: Influence of Morphological Characters on the Yield of Apricot (Prunus armeniaca L.) - A Statistical Approach date: 2006-06-30 words: 1942 flesch: 69 summary: To bring out the basic factors associated with the above referred morphological characters of apricot, the data of two populations-High Yielder (Population I) and Low Yielder (Population II)-were subjected to factor analysis. Factor analysis in onion (Allium cepa L.). keywords: factor; number; yielder cache: jhs-678.pdf plain text: jhs-678.txt item: #513 of 600 id: jhs-679 author: Venugopalan, R; Rawal, R D; Saxen, A K title: A Statistical Model for Ascertaining the Influence and Reliability of Weather Parameters on Incidence of Blossom Blight in Mango (Mangifera indica L.) date: 2006-06-30 words: 2253 flesch: 48 summary: Results showed that preceding week's weather variables viz., maximum and minimum temperature, evaporation, rainfall, morning and evening relative humidity and wind speed were found to collectively predict blossom blight incidence to the extent of 94.3 per cent. All the data were subjected to statistical analysis in order to assess the influence of abiotic factors on blossom blight incidence and subsequently for the development of disease prediction models as detailed below. keywords: blight; blossom; incidence; model; weather cache: jhs-679.pdf plain text: jhs-679.txt item: #514 of 600 id: jhs-68 author: Singh, S R; Ahamed, N; Kumar, Dinesh; Srivatsava, K K; Yousuf, Sabeena; Mir, Abid title: Genetic divergence assessment in Kale (Brassica oleracea L var. acephala (DC.) Alef.) by using the multivariate analysis date: 2017-06-30 words: 2739 flesch: 53 summary: Key words: Kale, genetic diversity, principal component analysis, single linkage cluster analysis. Principal component analysis (PCA), one of multivariate analysis methods, depicts the tr a its which wer e decisive in genotype differentiation(Kovacic,1994). keywords: analysis; cluster; component; genotypes; kale; leaf; new; traits; yield cache: jhs-68.pdf plain text: jhs-68.txt item: #515 of 600 id: jhs-680 author: Shamasundaran, K S; Yenugopalan, R title: Statistical Modelling for Pre-Harvest Forecast:An Illustration with Rose date: 2006-06-30 words: 1569 flesch: 60 summary: correlation among yield (total) and individual pickings yield were computed are presented in Tables 1 and 2. In the present study, an attempt has been made to develop multiple regression models for obtaining a pre- harvest estimate of yield of rose based on information pertaining to several pickings. keywords: model; picking; regression; yield cache: jhs-680.pdf plain text: jhs-680.txt item: #516 of 600 id: jhs-681 author: Gajanana, T M; Sudha, M; Dakshinamoorthy, V title: Marketing and Post-Harvest Loss Assessment in Sapota date: 2006-06-30 words: 2983 flesch: 64 summary: Private retail outlets and HOPCOMS retail outlets in Bangalore city were selected for assessing retail level losses in sapota. It may be observed from Table 4 that field level loss accounted for maximum loss in the HOPCOMS channel (41%), while, in the WSM channel, retail level losses accounted for 44% of the total PHL. keywords: fruits; hopcoms; level; loss; marketing; phl cache: jhs-681.pdf plain text: jhs-681.txt item: #517 of 600 id: jhs-69 author: Gill, PP S; Kaur, Sharanjit; Singh, NavPrem title: Effect of N and K Fertilizers on Growth, Yield and Quality of Pear (Pyrus pyrifolia) date: 2017-06-30 words: 2714 flesch: 68 summary: Nitrogen is one of the most important elements for high productivity and growth of fruit plants (Titus and Kang, 1982) and also promotes fruit and seed development (Marschner, 1995). However, fully grown-up plants of this cultivar show variability in fruit yield with small sized fruits which fetch poor market price. keywords: effect; fruit; pear; plant; quality; treatment; yield cache: jhs-69.pdf plain text: jhs-69.txt item: #518 of 600 id: jhs-693 author: Srivastava, K K; Kumar, Dinesh; Singh, S R; Sharma, O C title: Effect of cultivars on tree growth, yield and quality attributes of apple on espalier architecture under high density planting system date: 2019-06-21 words: 3139 flesch: 68 summary: (2006) a nd yield efficiency indicates the real potential of tree yield irrespective of the tree size. Key words: apple, tree architecture, espalier, high density planting, Coe-Red –Fuji, yield efficiency, chroma INTRODUCTION Apple (Malus domestica Borkh) is an important fruit, occupies more than, 70% area and 60% production of total temperate fruits in India. keywords: apple; architecture; efficiency; fruit; tcsa; tree; weight; year; year year; yield cache: jhs-693.pdf plain text: jhs-693.txt item: #519 of 600 id: jhs-694 author: Srivastava, K K; Kumar, Dinesh; Barman, P title: Sweet cherry cultivars influenced the growth and productivity under HDP date: 2019-06-20 words: 3046 flesch: 67 summary: Key words: Sweet cherry, Prunus avium, high density planting, TCSA, quality attributes, yield efficiency INTRODUCTION Sweet cherry (Prunus avium L.) an important stone fruit growing world-wide in temperate zone. Similarly Manolova and Kolev (2013) observed that high density of Sweet cherry he observed that HDP exhibited greater precocity, high annual yield per unit area along with faster financial returns. keywords: bigarreau; cherry; efficiency; fruit; growth; napoleon; noir; tree; yield cache: jhs-694.pdf plain text: jhs-694.txt item: #520 of 600 id: jhs-70 author: Ravishankar, K V; Rekha, A; Menon, Rema; Anoopa, C K; Sudeepa, K; Poornima, R title: Genetic diversity studies among AAB group Indian banana cultivars using ISSR markers date: 2017-06-30 words: 2540 flesch: 64 summary: However, there are no studies exclusively focused on diversity analysis of AAB group cultivars and analysis of the genetic basis among these sub- groups using ISSR markers. Clustering of AAB group cultivars was based on their sub gr oup cla ssification. keywords: aab; banana; cultivars; diversity; group; issr; journal; markers; musa; new; pome cache: jhs-70.pdf plain text: jhs-70.txt item: #521 of 600 id: jhs-706 author: AN, Nasiya Beegum; Subramanian, Madhu title: Effect of trichomes in cowpea on infestation by spotted pod borer, Maruca vitrata (Fab.) (Lepidoptera: Crambidae) date: 2019-06-30 words: 2214 flesch: 76 summary: N u mb er of t r ic homes o n p ods t ic R es ou r c keywords: density; mm2; pod; rms; trichomes cache: jhs-706.pdf plain text: jhs-706.txt item: #522 of 600 id: jhs-707 author: Muralidhara, B M; Gowda, IN Doreyappa title: Soft wood grafting - A novel and rapid multiplication technique in Coorg mandarin (Citrus reticulate Blanco) date: 2019-06-30 words: 3215 flesch: 67 summary: Therefore, present study was formulated to observe performance of soft wood grafting in Coorg mandarin on different aged rootstocks of Rangpur lime and which is beneficial for commer cia l citr us gr owers and nurser ymen to strengthen Coorg mandarin cultivation in Karnataka, Kerala and Tamil Nadu. Sci. Vol. 14(1) : 7-12, 2019 Original Research Paper Soft wood grafting - A novel and rapid multiplication technique in Coorg mandarin (Citrus reticulate Blanco) B.M. Muralidhara1 and I.N. Doreyappa Gowda2 1Scientist (Fruit Science), 2Principal Scientist & Head ICAR-Indian Institute of Horticultural Research Central Horticultural Experimental Station- Chettalli - 571248 1E-mail: muralidhara.bm@gmail.com ABSTRACT Coorg mandarin is commercially multiplied by shield or T budding. keywords: coorg; grafting; mandarin; months; plant; rootstocks; weight; wood cache: jhs-707.pdf plain text: jhs-707.txt item: #523 of 600 id: jhs-708 author: ., Dalamu; Sharma, J; Kumar, S; Luthra, S K; Sharma, A K; Sharma, V; Dua, V K title: Mineral content of red skinned potatoes of Eastern India date: 2019-06-30 words: 1922 flesch: 63 summary: Zinc content in potato germplasm has been reported to be in range of 0.22 (Tuberosum gp; Rivero et al, 2003) -0.76 (Andigena gp) mg/100g FW of tuber (Andre et al, 2007). Considering an average 20 % dry matter, the zinc content (11-38 ppm dry weight basis) in these studies corroborates to that of results of our study while zinc content of United States genotypes and previous reports of Indian genotypes was on lower side ie 12 to 18 ppm (Brown et al, 2011) and 10 to 18 ppm (Trehan and Sharma, 1996), respectively on dry weight basis. keywords: content; iron; potato; rms; zinc cache: jhs-708.pdf plain text: jhs-708.txt item: #524 of 600 id: jhs-709 author: Kumar, Dinesh; Srivastava, K K; Singh, S R title: Correlation of trunk cross sectional area with fruit yield, quality and leaf nutrient status in plum under North West Himalayan region of India date: 2019-06-30 words: 4555 flesch: 75 summary: Keywords: TCSA, plum fruit yield, quality, leaf nutrient INTRODUCTION Plum (Prunus domestica L.) is one of the important stone fruits of temperate region of India, mainly grown in the states of Jammu and Kashmir, Himachal Pradesh and Uttarakhand. Sci. Vol. 14(1) : 26-32, 2019 Original Research Paper Correlation of trunk cross sectional area with fruit yield, quality and leaf nutrient status in plum under North West Himalayan region of India Dinesh Kumar, K.K. Srivastava and S.R. Singh ICAR- Central Institute for Temperate Horticulture, Srinagar, Jammu and Kashmir, India Principal Scientist, ICAR- Central Institute for Subtropical Horticulture, Lucknow. keywords: area; correlation; fruit; leaf; plum; pulp; sugar; tcsa; tree; weight; yield cache: jhs-709.pdf plain text: jhs-709.txt item: #525 of 600 id: jhs-71 author: Singh, S R; Phurailatpam, A K; Singh, Siddhartha title: Effect of GA3 and fungicide at colour-break stage for extension of bearing period and shelf-life in Khasi mandarin (Citrus reticulata Blanco.) date: 2017-06-30 words: 2741 flesch: 58 summary: Keeping the view and considering the need of fruit retention during the bearing period and to increase the profit among the mandarin growers, the present research was initiated to explore the potential of growth regulators for extension of bearing period and better shelf life of Khasi mandarin under the Pasighat condition of Arunachal Pradesh, India. Response of Nagpur mandarin fruit to pre-harvest spray of gibberellic acid and carbendazim. keywords: bearing; citrus; fruit; fungicide; ga3; journal; mandarin; period; tree cache: jhs-71.pdf plain text: jhs-71.txt item: #526 of 600 id: jhs-710 author: Shivashankara, K S; Geetha, G A; Roy, T K title: Metabolite profiling in Mango (Mangifera indica L.) pollen grains in relation to viability date: 2019-06-30 words: 5189 flesch: 67 summary: Therefore, it is essential to understand whether these variations of pollen viability are due to differences in biochemical composition of pollen grains in the above three cultivars. pollen grains in relation to viability *K.S. Shivashankara, G.A. Geetha and T.K. Roy Division of Plant Physiology and Biochemistry, ICAR-Indian Institute of Horticultural Research, Hessaraghatta Lake Post, Bengaluru - 560 089, Karnataka, India *Email : shivaiihr@yahoo.com ABSTRACT Mango productivity is affected mainly by irregular flowering, proportion of bisexual flowers, poor pollination and fertilization and fruit drop. keywords: acids; alphonso; amino; amrapali; anthesis; cultivars; fruit; grains; mango; pollen; pollen grains; sci; set; viability cache: jhs-710.pdf plain text: jhs-710.txt item: #527 of 600 id: jhs-711 author: ., Kanupriya; Kumar, Pushpa Chethan; Sane, Anuradha title: An assessment of fruiting and polyembryony in Langsat (Lansium domesticum Corr.) from Nilgiris, India date: 2019-06-30 words: 2098 flesch: 63 summary: Sensory evaluation revealed that fruit color was pale brown, pulp color was whitish jelly type similar to litchi pulp, the taste was sweet with bit sour similar to taste of litchi fruit (Table 3). In the present investigation we report the morphological and biochemical parameters of the plants and fruits obtained from State Horticultural Farm, Buliar (latitude 11.34; longitude 76.79) in Tamil Nadu, at elevation of 360 m MSL and receiving average annual rainfall of 125.14 cm. keywords: copy; fig; fruit; langsat; polyembryony; rms; seed; tree; weight cache: jhs-711.pdf plain text: jhs-711.txt item: #528 of 600 id: jhs-712 author: Nataraj, S K; Naik, Kirtimala B; Kumar, HS Yallesh; Ramesha, Y S title: Performance of Anthurium (Anthurium anderanum Lindl) cultivars under hill zone of Karnataka date: 2019-06-30 words: 2591 flesch: 69 summary: Femina et al (2006) also reported variation in spadix angle in Anthurium cultivars studied. Flower, quality and yield parameters as influenced by Anthurium cultivars (pooled data 3yrs) Days to Peduncle Spathe Spathe Spadix Spadix Spadix Flowering Number Vase Treatment intiate bud length length width angle to length width duration of flowers/ life to flowering (cm) (cm) (cm) spathe (cm) (mm) (days) plant/year (days) keywords: anthurium; cost; cultivar; days; maximum; plant; recorded; tropical cache: jhs-712.pdf plain text: jhs-712.txt item: #529 of 600 id: jhs-713 author: Singh, T H; Reddy, DC Lakshmana; Reddy, C Anand; Sadashiva, A T; Pandyaraj, P; Manoj, Y B title: Evaluation of Solanum species and eggplant cultivated varieties for bacterial wilt resistance date: 2019-06-30 words: 5233 flesch: 71 summary: Sci. Vol. 14(1) : 13-19, 2019 Evaluation of eggplant for bacterial wilt resistance 18 (CARI-1) were found to have high resistance with no incidence of bacterial wilt. Here, we evaluated wild solanum species and cultivated varieties for bacterial wilt resistance through artificial inoculation, and these can be used as root-stock in grafting. keywords: bacterial; solanum; ui t; wilt cache: jhs-713.pdf plain text: jhs-713.txt item: #530 of 600 id: jhs-714 author: Gajanana, T M; Murthy, D Sreenivasa; Sudha, M; Saxena, A K; Rao, DV Sudhakar; Dakshinamoorthy, V title: Post harvest loss and marketing of fruits - economic analysis of pink flesh guava in local and distant markets in India date: 2019-06-30 words: 2848 flesch: 66 summary: The wholesaler received a margin of 22.91 percent in trading of guava fruits. After 4 days of storage, guava fruits lose weight to the extent of 6 per cent and the spoilage starts after 5 days. keywords: cent; flesh; fruits; guava; level; loss; storage cache: jhs-714.pdf plain text: jhs-714.txt item: #531 of 600 id: jhs-719 author: Hannur, Vageeshbabu S title: Interdependence in Horticultural Research date: 2019-06-30 words: 714 flesch: 37 summary: Dalamu et al have addressed the nutritional improvement and heritability aspects of red skinned potatoes of Eastern India through genetic diversity in terms of iron and zinc levels. Srivastava et al have studied significant correlations between growth, yield and quality of apple in relation to trunk cross sectional area under espalier architecture. keywords: crops; farming cache: jhs-719.pdf plain text: jhs-719.txt item: #532 of 600 id: jhs-72 author: Rohila, Harsha; Gehlot, Rakesh; Siddiqui, S; Rekha, Rekha title: Changes in chemical constituents and overall acceptability of bael-guava nectar and crush during storage date: 2017-06-30 words: 2285 flesch: 65 summary: Thus, blending of guava pulp with bael pulp will supplement its blended beverages with vitamins, minerals, besides improving its overall acceptability. Blending of bael pulp with guava pulp resulted in significant increase in ascorbic acid content in bael-guava nectar and crush. keywords: bael; blends; crush; guava; nectar; pulp; storage cache: jhs-72.pdf plain text: jhs-72.txt item: #533 of 600 id: jhs-74 author: Gantait, Subhendu S; Dutta, Koushik; Majumder, Jayoti title: In vitro regeneration and conservation of an endangered medicinal plant sarpagandha (Rauvolfia serpentina L.) date: 2017-06-30 words: 3117 flesch: 63 summary: The half strength MS medium fortified with 5.0 mgl-1 2,4-D and 2.0 mgl-1 Different growth regulators as supplement of MS medium were optimized for rapid in vitro multiplication and conservation of Rauvolfia serpentina callus using leaf explant as an initial plant material. keywords: callus; medium; mgl; mgl-1; plant; rauvolfia; regeneration; serpentina cache: jhs-74.pdf plain text: jhs-74.txt item: #534 of 600 id: jhs-75 author: Singh, Ranjit; Singh, Parminder; Kaur, Jaswinder title: Manipulation of shade and plant density for enhanced production of cut-foliage in Ruscus hypophyllum L. date: 2017-06-30 words: 1769 flesch: 67 summary: Different shade levels significantly affected the plant height and plant spread (Table 1). However, different shade levels exhibited non significant effect on plant height. keywords: cut; levels; plant; shade; spacing cache: jhs-75.pdf plain text: jhs-75.txt item: #535 of 600 id: jhs-750 author: Ganeshamurthy, Arkalgud Nanjundaiah; Adak, Tarun; Kumar, Kailash ; Singh, Vinod Kumar title: Response of Dashehari mango to different Zn levels on yield and pulp nutrient contents grown on sandy loam soils of Lucknow date: 2022-09-29 words: 4247 flesch: 71 summary: Effect of foliar application of Zn on fruit yield and quality of mango 0.385%, much lower than critical level of 0.50% (Table 4). Fruit yield and fruit quality increased significantly with application of 1.0% ZnSO4 over control. keywords: foliar; fruit; kg-1; mango; nutrient; quality; response; soil; yield cache: jhs-750.pdf plain text: jhs-750.txt item: #536 of 600 id: jhs-759 author: Sriram, S title: In This Issue date: 2019-12-31 words: 519 flesch: 44 summary: Merin et al. report on the best suitable timing for crossing in yard long bean. Meena et al. screened coriander varieties for their resistance to aphids and identified least susceptible varieties. keywords: report cache: jhs-759.pdf plain text: jhs-759.txt item: #537 of 600 id: jhs-76 author: Kamala Jayanthi, P D; Kempraj, Vivek; Murthy, B N S title: Incidence of cetonid beetles, Protaetia alboguttata (Vigors) on karonda, Carissa carandas date: 2017-06-30 words: 1258 flesch: 64 summary: The beetles were found attracted to ripe fruits compared to unripe karonda fruits. Adult beetles of P. guttata moving on karonda plants (a); Aggregation and feeding of beetles on ripe karonda fruits (b); Typical gouging and feeding posture of beetle (c); Damged karonda fruits (d); Adult male and fe male beetles in dorsal (e) and ventral (f) views 84 J. Hortl. keywords: beetles; journal; karonda; new; november; sph cache: jhs-76.pdf plain text: jhs-76.txt item: #538 of 600 id: jhs-763 author: Ganesan , Sangeetha; M, Panda; K, Kishore title: Occurrence of algal stem blotch in ber (Ziziphus mauritiana) under coastal Odisha conditions in India date: 2022-10-11 words: 3676 flesch: 66 summary: Periodical visit and subsequent investigations revealed the occurrence of a new kind of stem blotch disease in ber caused by alga. The stem blotches lead to death of young twigs measured between 3 to 8 mm thickness on primary and secondary branches wherein thickness of branches was more than 10 mm, algal blotches caused cracking of bark. keywords: algal; bark; ber; blotch; blotches; disease; india; odisha; plant; species; stem; trentepohlia cache: jhs-763.pdf plain text: jhs-763.txt item: #539 of 600 id: jhs-77 author: Ali, Shahid; Kumar, B B; Swamy, C M Kalleshwara; Kadian, M S; Ramakrishna, B V; Singh, Brajesh title: Low cost potato warehouse facility for Karnataka: A success story date: 2017-06-30 words: 1371 flesch: 58 summary: The objective of this study was to demonstrate the use of low cost warehouse in Karnataka by CIP store fresh harvested table potatoes for short time and seed potatoes for long time storage in the hill zone of Karnataka. By using this low-cost ware house facility, Karnataka farmers will be able to retain good quality farm seed potato thereby saving approximately40 percent of potato seed cost every year. keywords: cost; new; november; potato; seed; sph cache: jhs-77.pdf plain text: jhs-77.txt item: #540 of 600 id: jhs-773 author: Oberoi, Harinder Singh; M R, Dinesh title: Trends and Innovations in Value Chain Management of Tropical Fruits date: 2019-12-31 words: 6234 flesch: 49 summary: Transportation of fruits, such as mango, banana and guava in vans/wagons operating through evaporative cooling/ cooling mechanism using phase change material will help in improving the shelf life of such fruits. Harvesters for fruits, like citrus fruits, sapota, etc. help in reducing the damage/injury to such fruits, eventually leading to extended storage life for such fruits. keywords: chain; cooling; farmers; fruits; help; india; life; losses; management; pre; produce; quality; shelf; storage; supply; supply chain; value; vegetables cache: jhs-773.pdf plain text: jhs-773.txt item: #541 of 600 id: jhs-775 author: Raghu, B R title: Diversity and Distribution of Curry Leaf in India date: 2020-06-30 words: 4708 flesch: 60 summary: The essential oils extracted from curry leaf plant have several industrial applications in the manufacturing of soaps, perfumes, cosmetics, food processing and many others. The different parts of curry leaf plant have many applications in Ayurveda and other traditional medicine system (Karthikar and Basu, 1935). keywords: curry; curry leaf; curry leaves; genetic; india; koenigii; leaf; leaves; murraya; oil; parts; plant; region; sci; western cache: jhs-775.pdf plain text: jhs-775.txt item: #542 of 600 id: jhs-776 author: Ganeshamurthy, A N; Kalaivanan, D; Rupa, T R; Raghupathi, H B title: Groundwater Decline and Prolonged Drought Could Reduce Vigour, Enhance Vulnerability to Diseases and Pests and Kill Perennial Horticultural Crops: Needs Urgent Policy Intervention date: 2020-06-30 words: 6023 flesch: 56 summary: Our habits of water use will not change until the cost of water rises sufficiently to force an alteration. Yet the legal rules governing water use usually ignore the link between law and science. keywords: areas; crops; decline; diseases; drought; fruit; government; groundwater; irrigation; lakes; pumping; rivers; surface; trees; use; water; wells cache: jhs-776.pdf plain text: jhs-776.txt item: #543 of 600 id: jhs-778 author: S R, Singh ; N, Ahamed ; K K, Srivastava; D, Kumar; S, Yousuf title: Assessment of Genetic Divergence in Long Day Onion (Allium cepa L.) through Principal Component and Single Linkage Cluster Analysis date: 2020-06-30 words: 5724 flesch: 68 summary: Genotype CITH-O-29 scored highest TSS (16 %) whereas minimum TSS (0.36%) was recorded with genotype CITH-O-5. Based on single linkage cluster analysis genotypes were grouped into five clusters by quantifying their share and cluster means for all the traits (Table 4 a,b). keywords: analysis; bulb; cith; cluster; day; genotype; grade; onion; plant; traits; yield cache: jhs-778.pdf plain text: jhs-778.txt item: #544 of 600 id: jhs-779 author: Pandurangaiah, Shilpa ; A T, Sadashiva; K S, Shivashankar; D V, SudhakarRao ; K V, Ravishankar title: Carotenoid Content in Cherry Tomatoes Correlated to the Color Space Values L*, a*, b*: A Non-destructive Method of Estimation date: 2020-06-30 words: 3396 flesch: 64 summary: The complexity of tomato color is due to the presence of a diverse ca r otenoid pigment system with a ppea r a nce conditioned by pigment types and concentrations, and subject to both genetic and environmental regulation (Radzevicius et al., 2014). RESULTS Colorimetric measurements: Significant differences were observed among the cherry tomato lines for color values L*, a*, b*, C* and hue angle. keywords: carotenoids; color; content; iihr; lycopene; tomato; value cache: jhs-779.pdf plain text: jhs-779.txt item: #545 of 600 id: jhs-78 author: Shilpa, P; Ravishankar, K V; Shivashankara, K S; Sadashiva, A T; Kumar, N Sunil title: Molecular Mechanisms Involved in Biosynthesis and Regulation of Carotenoids in Plants date: 2016-12-31 words: 8521 flesch: 57 summary: A putative tomato NAC transcription fa ctor named SlNAC4 ac ts a s a positive regulator of fruit carotenoid synthesis in tomato. Plant carotenoids have been successfully engineered with either plant or bacterial genes, or, combinations of genes from the two sources. keywords: accumulation; biosynthesis; carotene; carotenoid; carotenoid biosynthesis; content; et al; ethylene; fruit; gene; light; lycopene; pathway; phytoene; plant; regulation; ripening; sci; tomato cache: jhs-78.pdf plain text: jhs-78.txt item: #546 of 600 id: jhs-780 author: B L, Manjunath; A K, Nair; R H, Laxman title: Standardization of Spacing and Soil Volume Wetting for Drip Irrigationin Papaya (Carica papaya L.) date: 2020-06-30 words: 4905 flesch: 59 summary: Sci. Vol. 15(1) : 35-44, 2020 Standardization of spacing and soil volume wetting for drip irrigation in papaya Among the irrigation levels, the gross returns were relatively higher (Rs. 4,91,180/ha) with irrigation at 30% ER a nd 30 per cent soil volume wetting, which may be attributed to the better soil moisture availability under the treatment in turn improving the productivity. When spacing is varied, it further warrants for understanding the requirement of wetted volume for standardizing the drip irrigation practice in a given agro-climatic condition. keywords: irrigation; papaya; plant; root; soil; spacing; volume; wetting cache: jhs-780.pdf plain text: jhs-780.txt item: #547 of 600 id: jhs-782 author: M, Thangam; K, Ramachandrudu ; J, Ashok Kumar ; S A, Safeena ; S, Priya Devi title: Variability and Genetic Divergence in Vegetable Cowpea Germplasm of Goa date: 2020-06-30 words: 5015 flesch: 70 summary: Khanpara S.V., Jivani L.L., Vachanni J.H. and Kachchadia H. (2016) Genetic variability, heritability and genetic advance studies in vegetable cowpea Hence, the present investigation was carried out systematically to evaluate the local accessions to estimate the extent of genetic variability, heritability, genetic advance and genetic divergence in the locally collected germplasm of vegetable cowpea. keywords: cowpea; plant; pod cache: jhs-782.pdf plain text: jhs-782.txt item: #548 of 600 id: jhs-784 author: C, Susmita ; T S, Aghora; N, Mohan ; R M, Bhatt title: Breeding for Improvement of High Temperature Tolerance in Garden Pea (Pisum sativum L.) for off Season Cultivation date: 2020-06-30 words: 3469 flesch: 61 summary: Key words: Breeding, Early summer, Garden pea, High temperature, Stress tolerance Original Research Paper Globa lly, vegetable legumes are conventionally identified as indispensable sources of nutrition and health to humankind besides radically influencing agricultural sustainability. The r ea listic a ppr oa ch to sur mount this ba r r ier unequivoca lly includes initia tion of br eeding programmes to develop resilient varieties tolerant to high temperature (up to 350C) that could suit off season cultivation. keywords: arka; breeding; checks; iihr; lines; plant; pod; temperature; yield cache: jhs-784.pdf plain text: jhs-784.txt item: #549 of 600 id: jhs-785 author: S B, Jadhav; S V, Vichare ; S M, Katwate title: Evaluation of Hybrids and Cultivars of Single type Tuberose (Polianthes tuberosa) date: 2020-06-30 words: 2822 flesch: 67 summary: Performance of different tuberose genotype on bulb and bulb-lets characters Treatment No. of bulb per clump No. of bulb-lets per clump Length of bulbs (cm) Diameter of bulb (cm) Weight of individual bulb (g) Weight of bulb-lets (g) Diameter of bulb-lets (cm) Total bulbs per plot Local Single 8.33 17.11 6.54 2.64 23.51 7.11 1.47 249.90 Arka Shringar 10.28 23.44 6.08 3.39 39.13 7.67 1.58 308.30 Phule Rajani 9.78 25.89 6.21 2.95 35.06 7.77 1.76 293.30 Hyderabad Single 9.10 22.33 5.97 2.98 31.46 7.63 1.62 273.10 Arka Nirantara 8.55 13.45 7.08 3.72 59.91 9.16 1.68 256.40 Arka Prajwal 9.30 12.50 7.55 3.56 56.90 9.43 1.75 279.00 Variegated 7.01 21.21 6.18 3.47 40.24 5.40 1.41 210.20 Variegated X Phule Rajani L9P7 8.60 15.89 5.87 3.15 38.73 7.83 1.63 258.10 Variegated X Phule Rajani L1P4 10.78 18.67 8.09 3.76 52.21 9.28 1.85 323.50 Variegated X Phule Rajani L9P2 11.00 25.33 5.87 3.26 43.23 8.39 1.58 329.90 Local Single X Arka Shringar GK-T-C-1 9.87 17.10 6.04 3.26 34.29 9.86 1.54 296.00 Local Single X Arka Shringar GK-T-C-2 10.52 16.33 5.46 2.98 43.47 8.43 1.56 315.50 Local Single X Arka Shringar GK-T-C-7 8.48 24.09 5.65 2.91 28.30 7.05 1.48 254.50 Phule Rajani X Arka Suvasini 8.22 28.66 6.02 3.04 35.07 7.67 1.40 247.93 Local Single X Arka Shringar GK-T-C-4 9.26 23.78 5.73 3.13 43.31 8.41 1.64 277.80 SE(m) ± 0.49 1.63 0.22 0.12 1.89 0.36 0.06 14.45 C.D. at 5% 1.41 4.75 0.66 0.35 5.50 1.05 0.19 42.07 Evaluation of hybrids and cultivars of single type tuberose (Polianthes tuberosa) J. Hortl. The variation in weight of individual and cut spike among different genotype is due to genetic factors, length and thickness of floret and spike respectively. keywords: arka; bulb; single; spike cache: jhs-785.pdf plain text: jhs-785.txt item: #550 of 600 id: jhs-786 author: I, Rashmi; H R, Meena; J, Somasundaram; T K, Radha title: Soil and Plant Analysis - A Strategic Tool to Diagnose Micronutrient Imbalance in Lime and Sapota Orchard in Tablelands of Chambal Ravine Region of India date: 2020-06-30 words: 4638 flesch: 68 summary: Sci. Vol. 15(1) : 72-80, 2020 Cu (100 mg kg-1) in plants, lime plants samples showed excessive total Cu content. Available micronutrients from soil samples were extracted using diethylenetriaminepenta acetic acid (DTPA) and it was in the order of manganese (Mn)> iron (Fe)> zinc (Zn)> copper (Cu) in both lime and sapota plantations. keywords: concentration; kg-1; leaf; lime; micronutrient; orchard; plant; samples; sapota; soil cache: jhs-786.pdf plain text: jhs-786.txt item: #551 of 600 id: jhs-787 author: K Chandran, Neethu; S, Sriram ; Prakash, Tejaswini title: Identification of NBS-LRR Resistance Gene Analogues (RGA) from Rose (IIHRR13-4) Resistant to Powdery Mildew (Podosphaera pannosa (Wallr.:Fr.) de Bary) date: 2020-06-30 words: 6433 flesch: 67 summary: Identification of resistant genes (R genes) from plant species will help in breeding programs. These RGAs will be useful for mapping and characterization of R genes in IIHRR13-4 and breeding for improved powdery mildew resistance in roses. keywords: debener; disease; domain; family; genes; hybrid; iihrr13; lrr; mildew; nbs; plant; powdery; protein; resistance; rgas; rosa; rose; sci; study; tir cache: jhs-787.pdf plain text: jhs-787.txt item: #552 of 600 id: jhs-788 author: C, Aswath; Kumar, Rajiv title: Evaluation of Novel Gerbera (Gerbera jamesonii Bolus ex. Hooker F.) Hybrids for Flower Quality Traits under Polyhouse Condition date: 2020-06-30 words: 1605 flesch: 69 summary: In view of importance of the crop and to bring down the high cost of imported gerbera, two indigenously gerbera hybrids i.e. IIHR15-7 and IIHR16-8 were developed and evaluated with their parents and commercial check for flower quality traits under polyhouse condition. Sci. Vol. 15(1) : 93-96, 2020 commercial check Susan for flower quality traits. keywords: check; flower; gerbera; hybrids cache: jhs-788.pdf plain text: jhs-788.txt item: #553 of 600 id: jhs-789 author: S, Priya Devi; A Porob , Shejal; M, Thangam title: Studies on Fruit Development in Pink and White types of Wax Apple (Syzygium samarangense Merr. & Perry) in Goa, India date: 2020-06-30 words: 4448 flesch: 70 summary: Therefore, this study was undertaken in order to study the growth and development of wax apple fruits right from anthesis to harvest. Key words: Fruit development, Goa, Wax apple, White and Pink types INTRODUCTION Wax apples (Syzygium samarangense Merr. & Perry) (syn. keywords: apple; daa; development; fruit; harvest; increase; study; wax; white cache: jhs-789.pdf plain text: jhs-789.txt item: #554 of 600 id: jhs-791 author: A N, Ganeshamurthy; S, Rajendiran; D, Kalaivanan; T R, Rupa title: Zinc Status in the Soils of Karnataka and Response of Horticultural Crops to Zinc Application : A Meta-analysis date: 2019-12-31 words: 5072 flesch: 63 summary: Zn malnutrition problems in India and global level, soil Zn status of Karnataka, various factors that responsible for Zn deficiency in the soils of Karnataka and the response of various horticultural crops to Zn application in the region is discussed. Typical results from ICRISAT on soil Zn status for two districts in Karnataka are included here as an example (Fig.7). keywords: application; crops; deficiency; effect; foliar; indian; journal; karnataka; soil; status; yield; zinc; znso4 cache: jhs-791.pdf plain text: jhs-791.txt item: #555 of 600 id: jhs-793 author: S A, Safeena ; M, Thangam; N P, Singh title: Evaluation of Different Cultivars of Tuberose (Polianthes tuberosa L.) under Humid agro Climatic conditions of Goa date: 2019-12-31 words: 2973 flesch: 57 summary: Adaptation and acclimatization of different tuberose cultivars under humid agro climatic conditions of Goa are to be confirmed for their better performance. Keeping these facts in view, the pr esent study wa s conducted to eva lua te the performance of different tuberose cultivars under coastal humid climatic conditions of Goa and to find out the suitable tuberose cultivar under agroclimatic conditions of Goa. MATERIALS AND METHODS keywords: conditions; cultivars; double; single; spike; tuberose cache: jhs-793.pdf plain text: jhs-793.txt item: #556 of 600 id: jhs-794 author: J, Satisha; R G, Somkuwar title: Effect of Leaf Removal on Composition of Wine Grape Varieties Grown in Semiarid Tropical Climate of India date: 2019-12-31 words: 6444 flesch: 68 summary: The total phenolic compound was significantly highest in west leaf removal vines (94.01 mg/L) compared to east leaf removal vines (72.09 mg/L). Similarly highest juice pH was recorded with east control vines (3.58) and least with west leaf removal vines (3.43). keywords: acid; berry; canopy; composition; control; east; fruit; grape; leaf; leaf removal; potassium; removal; sauvignon; vines; west; wine cache: jhs-794.pdf plain text: jhs-794.txt item: #557 of 600 id: jhs-795 author: N K, Meena ; G, Lal; S S, Meena; K, Kant; R D, Meena title: Screening of Coriander Genotypes for their Relative Susceptibility against Aphids under Field Conditions date: 2019-12-31 words: 3314 flesch: 63 summary: The build-up of aphid infestation started from second half of December and reached to its maximum in the first to third week of February in both years and then gradually declined. RESULTS AND DISCUSSION Twelve varieties/entries of coriander were screened out for their r ela tive susceptibility to a phids (Hyadaphis coriandri Das and Myzus persicae Sulzer) and the data on mean aphid’s mixed population per plant were taken for two consecutive years and presented in Table 1 and 2, revealed that, none of the varieties/entries was free from aphid infestation. keywords: acr-1; aphids; coriander; infestation; plant; rcr-446; varieties cache: jhs-795.pdf plain text: jhs-795.txt item: #558 of 600 id: jhs-796 author: Vincent, Linta; K, Soorianathasundaram; K S, Shivashankara title: Correlation of Leaf Parameters with Incidence of Papaya Ring Spot Virus in Cultivated Papaya and its Wild Relatives date: 2019-12-31 words: 2398 flesch: 55 summary: The PRSV incidence was significantly low in both V. cauliflora and V. cundinamarcensis, which registered thicker leaves, higher epicuticular wax content and denser trichomes. Observations Characters such as leaf thickness, leaf pubescence, epicuticular wax content and trichome density were recorded after three months of transplanting in the field, since symptoms a ppea r ed in susceptible genotypes after three months of transplanting. keywords: aphid; content; density; disease; epicuticular; leaf; papaya; trichome; wax cache: jhs-796.pdf plain text: jhs-796.txt item: #559 of 600 id: jhs-797 author: Sankar, Mini ; P K, Sudhadevi ; C K, Geetha; Kurian, Roshmi; P, Shilpa title: Performance Evaluation of Ferns for Cut Green and Landscape Purpose date: 2019-12-31 words: 1832 flesch: 48 summary: Sci. Vol. 14(2) : 137-141, 2019 Table 1: Evaluation of different species of ferns for vegetative characters Plant Plant Plant No. of Longevity Leaf Vase Species/Varieties height spread spread leaves Longevity production life (cm) NS (cm) EW (cm) per plant plant interval (days) Based on the performance, suitable species for various landscape uses were identified. keywords: asplenium; ferns; nephrolepis; nephrolepis biserrata; nephrolepis exaltata; species cache: jhs-797.pdf plain text: jhs-797.txt item: #560 of 600 id: jhs-798 author: A N, Ganeshamurthy; P, Govindakrishnan; H B, Raghupathi ; M B, Mahendra Kumar title: Compositional Nutrient Diagnosis (CND) Norms and Indices for Potato (Solanum tuberosum L.) date: 2019-12-31 words: 3459 flesch: 70 summary: VIIth step: the standardized variables (VN - V*N)/ SD*N to (VB - V*B) / SD*B are CND nutrient indices for low yielding population. Nutrient status in plants is currently diagnosed using nutrient concentration or dual ratios in selected tissues (Walworth and Sumner, 1987). keywords: cnd; diagnosis; norms; nutrient; potato; yield cache: jhs-798.pdf plain text: jhs-798.txt item: #561 of 600 id: jhs-799 author: S R, Maneesha; S, Priya Devi title: Effect of Calcium Nitrate and Potassium Nitrate Priming on Seed Germination and Seedling Vigour of Papaya (Carica papaya L.) date: 2019-12-31 words: 3296 flesch: 72 summary: Effect of calcium ions on papaya seed germination was studied earlier by Bautista-Calles et al. (2008) and reported that, seeds treated for 4 days in 105 M calcium chloride solution increased seed germination up to 262 % and seedlings generated from treated seeds accumulated more biomass than the control seedlings. The results of the experiment proved the significant effect of calcium ions over potassium ions on papaya seed germination and seedling vigour. keywords: calcium; effect; germination; leaf; nitrate; papaya; potassium; ppm; seed; seedling; weight cache: jhs-799.pdf plain text: jhs-799.txt item: #562 of 600 id: jhs-80 author: Chakraborty, B N; Allay, S; Chakraborty, A P; Chakraborty, U title: PGPR in Managing Root Rot Disease and Enhancing Growth in Mandarin (Citrus reticulata Blanco.) Seedlings date: 2016-12-31 words: 5970 flesch: 60 summary: Bacillus subtilis SQR 9 can control Fusarium wilt in cucumber by colonizing plant roots. Inte nsive inter ac tions ta ke pla c e in the rhizos pher e a mong soil, mic roorga nis ms and microfauna which may affect plant growth and yield positively or negatively (Antoun and Prevost, 2006). keywords: activity; application; bacillus; chakraborty; control; disease; growth; isolates; mandarin; oxysporum; pgpr; plant; poae; root; rot; sci cache: jhs-80.pdf plain text: jhs-80.txt item: #563 of 600 id: jhs-800 author: P, Amrutha ; Vijayaraghavan, Reshmy title: Characterization of Rhizoctonia solani causing Fruit rot of Strawberry (Fragaria x ananassa Duch.) in Wayanad and in vitro Evaluation of Fungicides, Organic preparations and Bioagents for its Management date: 2019-12-31 words: 2476 flesch: 64 summary: Sci. Vol. 14(2) : 155-160, 2019 Short Communication Characterization of Rhizoctonia solani causing Fruit rot of Strawberry (Fragaria x ananassa Duch.) The pathogen was identified as Rhizoctonia solani based on cultural and morphological characters. keywords: cent; pathogen; rhizoctonia; solani; strawberry; vitro cache: jhs-800.pdf plain text: jhs-800.txt item: #564 of 600 id: jhs-801 author: M R, Dinesh; M, Sankaran; K V, Ravishankar; Gowda, Sunil title: Varate Giduga (Acc. No. 21067; IC No. 418238) : A unique mango (Mangifera indica L.) variety date: 2019-12-31 words: 317 flesch: 67 summary: Besides, several other tr aits have drawn special attention to this mango variety as it has large sized fruits (Fig-1), late variety with very good taste, fruit can be cut into two halves by retaining the stone in one half, regular bearer and fruit fly resistant genotype because of its thick peel and high phenolic content in pulp (317.50 mg/100 g). Fig. 1: Fruits and cut fruits of Varate Giduga genotype. The fruit of this tree matures by mid-April and fruit has a distinctive yellow skin color on fruit exposed to the sun. keywords: fruit cache: jhs-801.pdf plain text: jhs-801.txt item: #565 of 600 id: jhs-802 author: R, Chitra title: Comparative studies on growth and Yield of Conventional and Tissue culture plants of Turmeric (Curcuma longa) var. CO2 date: 2019-12-31 words: 2575 flesch: 66 summary: CO 2 Characters Conventional rhizome Tissue culture Difference derived plants plants Off type (%) 1.8z 3.7z 1.9** Plant height (cm) 65.61±.19a 76.88±.27b Among the var iation observed in both the populations (in vitro and conventional plant), tillers of approximately 3.7% of in vitro raised plants and approximately 1.8% of conventional rhizome plants had leaves with one half of the lamina green and the other half albino and variegation on the edge of lamina (Table 1). keywords: conventional; culture; growth; number; plants; rhizome; tissue; turmeric; yield cache: jhs-802.pdf plain text: jhs-802.txt item: #566 of 600 id: jhs-803 author: B R, Jayanthi Mala; P D, Kamala Jayanthi ; Subramoniam, Anjana ; A, Rekha title: Management of Eulophid Seed Borer, Anselmella kerrichi (Narayanan et al.) (Hymenoptera : Chalcidoidea : Eulophidae) on Jamun date: 2019-12-31 words: 1245 flesch: 60 summary: 1: a. Pricks on immature Jamun fruits, b. adult Jamun seed borer, c & d. galleries 168 Jayanthi Mala et al Treatment Fruit infestation (%) C: A total of 12 treatments (as listed in Table 1) were evaluated against jamun seed borer. keywords: borer; jamun; seed cache: jhs-803.pdf plain text: jhs-803.txt item: #567 of 600 id: jhs-804 author: E G, Merin; S, Sarada; V A, Celine title: Pod set and Pollen Viability Studies in Yard Long Bean (Vigna unguiculata sub sp. sesquipedalis) date: 2019-12-31 words: 1977 flesch: 66 summary: The aim of the study was to observe the percentage fruit set at two time intervals in the yard long bean hybrid VS 50 x VS 26 and the influence of pollen viability of the parents at different times on fruit set, in order to identify the best time interval for pollination in yard long bean hybrids. The present study showed that the best time interval for crossing in yard long bean is 6.30- 7.30 a.m. Table 3: Percentage of Pollen viability Time Pollen viability (%) VS 50 VS 26 6.30 a.m. 86.50 90.90 7.30 a.m. 89.50 93.00 8.30 a.m. 88.50 88.50 J. Hortl. keywords: long; pod; pollen; set; viability; yard cache: jhs-804.pdf plain text: jhs-804.txt item: #568 of 600 id: jhs-81 author: Lekshmi, R S; Soni, K B; Alex, Swapna; Nair, Deepa S; Sreekantan, Lekha; Reghunath, B R title: A Rapid Protocol for Somatic Embryogenesis Mediated Regeneration in Banana (Musa Spp.) Cv. Nendran date: 2016-12-31 words: 4864 flesch: 67 summary: The IMF produced pale- white to yellow, globular embryogenic callus on MS medium supplemented with BA (0.05 – 0.50mgL-1) and picloram (0.50 – 2.00mgL -1) with explant response of to 30 per cent. Embryogenesis was induced (33.3 to 60 per cent) on semisolid (0.30 per cent Gelrite©) MS medium supplemented with BA 2mgL-1 + IAA 0.5mgL-1. keywords: banana; callus; embryogenesis; embryos; medium; mgl-1; musa; pale; somatic; treatments; white cache: jhs-81.pdf plain text: jhs-81.txt item: #569 of 600 id: jhs-82 author: Garg, Naveen; Jindal, S K; Dhaliwal, M S; Cheema, D S title: G × E Interaction and Heterosis in Elite Tomato Hybrids for Growth, Earliness and Fruit Parameters in Diverse Agro-Climatic Zones of Punjab date: 2016-12-31 words: 2673 flesch: 65 summary: E interaction was significant for early yield, fruit weight and total fruit yield, whereas, it was non-significant for fruit number, locule number, pericarp thickness and vine length. Characteristics of the experimental soil (0-15 cm soil profile) at the two locations are presented in Table 2. Observations were recorded for seven characters, viz., early yield (t ha-1), fruit number per vine, fruit weight (g), locule number, pericarp thickness (mm), vine length (cm) and total fruit yield (t ha-1). keywords: fruit; heterosis; hybrids; number; table; yield cache: jhs-82.pdf plain text: jhs-82.txt item: #570 of 600 id: jhs-83 author: Shikhamany, S D; Borade, Swapnil V; Jeughale, Sanjay K; Patil, Suryakant Y title: Effect of Cane Regulation and GA3 Spray on Berry Thinning in 'Thompson Seedless' Grape (Vitis vinifera L.) date: 2016-12-31 words: 4933 flesch: 69 summary: Location x Treatment effect on cluster compactness index ____________________________________________________________________________________ Location Treatment —————————————————————————————————— T1 T2 T3 T4 T5 —————————————————————————————————————————— L1 27.8a 34.2efg 29.5abcd As smaller clusters have fewer berries, cluster compactness derived at by number of berries per unit length (cm) of rachis, and, berry-diameter were considered as a measure of berry-thinning. keywords: berry; cluster; compactness; effect; location; number; season; table; treatment cache: jhs-83.pdf plain text: jhs-83.txt item: #571 of 600 id: jhs-838 author: LR, Varalakshmi; P, Tejaswini; S, Rajendran; K K, Upreti title: Assessment of soil and water quality status of rose growing areas of Rajasthan and Uttar Pradesh, India date: 2022-09-19 words: 3857 flesch: 72 summary: Soil samples were analyzed for pH using glass electrode and EC using conductivity meter in 1:2.5 soil: wa ter suspension (Richa r ds, 1954). This is evident from the pH values of soil samples from the rose fields in both Rajastan and U.P. keywords: areas; l-1; meq; quality; rajasthan; rose; samples; soil; water cache: jhs-838.pdf plain text: jhs-838.txt item: #572 of 600 id: jhs-839 author: Bharathi, T U; Srinivas, Meenakshi; Umamaheswari, R; Sonavane, Priti title: Performance evaluation of double type tuberose IIHR-4 (IC -0633777) for flower yield. quality and biotic stress resistance/tolerance date: 2021-12-31 words: 4056 flesch: 68 summary: The field view of tuberose line IIHR-4 and flower spikes 237 Table 1. Sci. Vol. 16(2) : 234-240, 2021 Genotype No. of No. of No. of No. of No. of Vase Nature Tinge Type spikes spikes spikes bulbs bulblets life of on of per per per per per (days) spike flower flower clump m2 ha/year clump clump bud opening IIHR-4 4.43 33.94 398781.25 4.25 44.63 6.50 keywords: arka; breeding; florets; flower; iihr-4; length; line; mean; number; spike; tuberose; yield cache: jhs-839.pdf plain text: jhs-839.txt item: #573 of 600 id: jhs-84 author: Dutta, Koushik; Gantait, Subhendu S title: Standardization of an in Vitro Regeneration Protocol in Gerbera (Gerbera jamesonii Bolus Ex. Hooker F.) date: 2016-12-31 words: 2446 flesch: 61 summary: In this study, individual or combination effects of different growth regulators in MS media have be e n inve stigate d f or induc ing indirec t organogenesis. Three concentrations of BAP (1.0, 2.0 or 3.0mgL-1) and Kinetin (1.0, 2.0 or 3.0mgL-1), alone or in combination with NAA (0.5mgL-1) in MS medium, were used for shoot regeneration from callus (Table 2). keywords: bap; callus; gerbera; medium; naa; shoot cache: jhs-84.pdf plain text: jhs-84.txt item: #574 of 600 id: jhs-840 author: Wani, Atif Khurshid; Singh, Rattandeep ; Mir, Tahir ul Gani; Akhtar, Nahid title: Limonene extraction from the zest of Citrus sinensis, Citrus limon, Vitis vinifera and evaluation of its antimicrobial activity date: 2022-09-19 words: 3344 flesch: 63 summary: The summary of microbiostatic/microbiocidal effect of crude essential oils rich in limonene with different dilutions is given in Table 3. Corresponding author Email : atifkhurshid61200216@gmail.com ABSTRACT Citrus rinds contain essential oils. keywords: activity; citrus; limonene; oils cache: jhs-840.pdf plain text: jhs-840.txt item: #575 of 600 id: jhs-844 author: Debnath, Sanjit; Bauri, F K; Swain, S; Patel, A N; Patel, A R; Shaik, N B; Bhalerao, V P; Baruah, K; Manju, P R; Suma, A; Menon, R; Gutam, Sridhar; Patil, Prakash title: Studies on High Density Planting and Nutrient Requirement of Banana in Different States of India date: 2021-12-31 words: 6774 flesch: 67 summary: Original Research Paper Studies on high density planting and nutrient requirement of banana in different states of India Debnath Sanjit1, Bauri F.K.1, Swain S.2, Patel A.N. 3, Patel A.R. 3, Shaikh N.B. 4, Bhalerao V.P. 4, Baruah K. 5, Manju P.R. 6, Suma A.6, Menon R.6, Gutam S.7 and Patil P.7* ICAR-All India Coordinated Research Project on Fruits; 1BidhanChandra Krishi Viswavidyalaya, Mohanpur, West Bengal 2Orissa University of Agriculture and Technology, Bhubaneswar, Odisha; 3Navsari Agriculture University, Gandevi, Gujarat 4Mahatma Phule Krishi Vidyapeeth, Jalagon, Maharashtra; 5Assam Agricultural University, Jorhat, Assam 6Kerala Agriculture University, Kannara, Kerala; 7Indian Institute of Horticultural Research, Hessarghatta, Bengaluru *Corresponding author Email : pcfruits.iihr@icar.gov.in ABSTRACT An experiment was conducted under the ICAR-All India Coordinated Research Project on Fruits to study the high density planting (HDP) and nutrient requirement of banana at six research centres across the country, including Bhubaneswar (Orissa), Gandevi (Gujarat), Jalgaon (Maharashtra), Jorhat (Assam), Kannara (Kerala) and Mohanpur (West Bengal) to enable higher productivity of banana and profit to farmers. Sci. Vol. 16(2) : 152-163, 2021 Studies on high density planting and nutrient requirement 156 Table 5. keywords: bhubaneswar; centres; density; gandevi; jorhat; kannara; mohanpur; nutrition; plant/; planting; rdf; soil cache: jhs-844.pdf plain text: jhs-844.txt item: #576 of 600 id: jhs-846 author: R N, Amulya; Adivappar, Nagarajappa; B S, Shivakumar; K M, Satish title: Studies on genetic variability and relationship of bael (Aegle marmelos (L) Correa) using morphological and molecular markers date: 2022-09-27 words: 4320 flesch: 61 summary: The main objective of the study was to characterise bael trees using morphological molecular markers, to evaluate the genetic diversity and relationship. The present study revealed that molecular markers can be successfully utilized for determining genetic diversity and relationship of bael trees for further varietal improvement. keywords: bael; cluster; fruit; gag; markers; rapd; similarity; trees cache: jhs-846.pdf plain text: jhs-846.txt item: #577 of 600 id: jhs-857 author: Kiran, Mehwish; Jilani, Muhammad Saleem; Kashif Waseem; Fazal Haq; Khan, Muhammad Sohail; Nadeem, Muhammad Amjad; Khalid Rahman; Ghazanfar Ullah; Kashif Hussain title: Growth and yield enhancement of carrot through integration of NPK and organic manures date: 2022-12-06 words: 3748 flesch: 59 summary: Organic fertilizers are cheaper than inorganic sources, thus farmers can easily afford the cost of organic fertilizers (Hafez et al., 2020) Original Research Paper Growth and yield enhancement of carrot through integration of NPK and organic manures Kiran M.1, Jilani M.S.1, Waseem K.1, Haq F.2, Khan M.S.1, Nadim M.A.3* Rahman K.1 and Hussain K.1 1Department of Horticulture, 2Institute of Chemical Sciences, 3Department of Agronomy, Gomal University, Dera Ismail Khan, Pakistan *Corresponding author Email : mehwishkiran@gu.edu.pk ABSTRACT A pot experiment was conducted at Horticulture Experimental Area, Gomal University, Dera Ismail Khan, Pakistan to investigate the combined effects of NPK and organic manures on growth and yield of carrot, for two consecutive years. keywords: carrot; fertilizers; manures; npk; organic; plant; root; year; yield cache: jhs-857.pdf plain text: jhs-857.txt item: #578 of 600 id: jhs-87 author: Reddy, G Chandramohan; Hebbar, S S; Nair, A K; Raghupathy, H B; Gowda, A.P Mallikarjuna; Umesha, K title: Growth and Yield Performance of Hybrid Hot Pepper, Chilli (Capsicum annuum L.) as Influenced by Fertigation and Polyethylene Mulching date: 2016-12-31 words: 2062 flesch: 55 summary: Urea, Polyfeed (19- 19-19) and potassium nitrate (13-0-45) were used as the water-soluble fertilizers for treatments T 1 to T4; urea , di-ammonium phosphate (DAP) a nd muriate of potash (MOP) as normal fertilizers for fertigation treatments T 5 and T 6; DAP was used as the source of P2O5 in T5 & T6. Among fertigation treatments, application of 100% recommended fertilizer does through water-soluble fertilizers along with mulching (T 1 ) recorded the least number of days to 50% flowering (27.77 days), followed by application of 100% recommended dose through normal fertilizers along with mulching (T5). keywords: chilli; fertigation; fertilizers; plant; treatments; water; yield cache: jhs-87.pdf plain text: jhs-87.txt item: #579 of 600 id: jhs-872 author: None title: jhs-872 date: None words: 81 flesch: 45 summary: File: /var/www/jhs/lib/pkp/classes/core/PKPPageRouter.inc.php line 246 Function: PKPRouter->_authorizeInitializeAndCallRequest(Array(2), Object(Request), Array(2), False) File: /var/www/jhs/index.php line 68 Function: PKPApplication->execute() keywords: www cache: jhs-872.htm plain text: jhs-872.txt item: #580 of 600 id: jhs-88 author: Seiar, Y Ahmad title: Effect of Growth Regulators on Rooting of Cuttings in Pomegranate (Punica granatum L.) Cv. 'Bhagwa' date: 2016-12-31 words: 2844 flesch: 77 summary: Rooting percentage Percentage of rooted cuttings as influenced by various growth regulator combination is presented in Table 2. Bhatt and Tomar (2010) obtained maximum number of sprouted cuttings (68.50%) with the growth regulator IBA at 500ppm. keywords: cuttings; growth; iba; naa; number; pomegranate cache: jhs-88.pdf plain text: jhs-88.txt item: #581 of 600 id: jhs-882 author: RATHINAKUMARI, CAROLIN; G, Senthil Kumaran title: Onion detopping machine - an emerging horticultural enterprising date: 2022-09-30 words: 2503 flesch: 70 summary: In Tamil Nadu multiplier onion is Onion detopping machine - an emerging horticultural enterprising Rathinakumari A.C.* and Senthil Kumaran G. ICAR-Indian Institute of Horticultural Research, Bengaluru – 560 089, Karnataka. Onion detopping machine The prototype onion de-topper consists of i) keywords: detopping; india; machine; onion; rollers; tops cache: jhs-882.pdf plain text: jhs-882.txt item: #582 of 600 id: jhs-89 author: Bhandari, Narendra Singh; Srivastava, Ranjan; Goshwami, Versha title: Evaluation of Lilium Hybrids (Lilium x hybrida) for Growth, Flowering and Bulb Attributes in the Hilly Regions of Uttarakhand date: 2016-12-31 words: 1867 flesch: 55 summary: Evaluation of lilium hybrids (Lilium x hybrida) for growth, flowering and bulb attributes in the hilly regions of Uttarakhand Narendra Singh Bhandari*, Ranjan Srivastava and Versha Goshwami Department of Horticulture, G.B. Pant University of Agriculture & Technology Pantnagar 263145, Uttarakhand, India *Email: narendra.bhandari@icar.gov.in The present study was initiated to elucidate performance of 18 exotic lilium hybrids (Lilium x hybrida) to assess their suitability for commercial cultivation in the hilly regions of Uttarakhand. Key words: Lilium hybrids, evaluation, vegetative and flowering attributes, bulblets INTRODUCTION keywords: days; flower; flowering; lilium; maximum cache: jhs-89.pdf plain text: jhs-89.txt item: #583 of 600 id: jhs-893 author: Sheikh, K H A; Singh, Barun; Haokip, Songthat William; Kripa, Shankar; Debbarma, Raju; Athokpam, Gaitri Devi; Nengparmoi, T H title: Response of Yield and Fruit Quality to Foliar Application of Micronutrients in Lemon [Citrus limon (L.) Burm.] cv. Assam Lemon date: 2022-03-31 words: 5542 flesch: 63 summary: Harnessing the potential of 131-143 plants beyond aesthetics Shalini Jhanji and U.K.Dhatt Research Articles Response of fruit yield and quality to foliar application of micro-nutrients in 144-151 lemon Original Research Paper Response of fruit yield and quality to foliar application of micro-nutrients in lemon keywords: application; assam; boron; citrus; content; effect; foliar; fruit; lemon; micronutrients; plant; quality; sci; sugar; weight; yield; zinc cache: jhs-893.pdf plain text: jhs-893.txt item: #584 of 600 id: jhs-897 author: C, Chandrashekara; K K, Mishra; J, Stanley; A R N S, Subbanna; K S, Hooda; R S, Pal; J C, Bhatt ; A, Pattanayak title: Management of diseases and insect-pests of French bean in Northwestern Indian Himalayan region using integrated approaches date: 2022-12-06 words: 7330 flesch: 62 summary: * Per cent reduction is with respect to control calculated using Henderson Tilton formula $ Analyzed using SPSS after square root transformation In a column means followed by a common letter are not significantly different at p=0.05 by LSD Evaluation of different IPM modules against French bean diseases and insect pests Based on the findings of different sets of experiments, six efficacious treatments against bean disease and insects were selected. Six different IPM modules involving different orga nic/inorga nic substra te/ chemicals/bioagents in different combinations along with pure chemicals and untreated check were tested against french bean diseases and insect pests. keywords: bean; cent; control; diseases; field; foliar; french; incidence; insect; management; plant; root; rot; rust; soil; treatment cache: jhs-897.pdf plain text: jhs-897.txt item: #585 of 600 id: jhs-9 author: Dhatt, Ajmer Singh; Garg, Naveen; Singh, Rajinder; Aujla, I S title: Effect of plastic low tunnel and mulch type on soil temperature, growth, earliness and yield of brinjal under net-house and open field in plains of North-Western India date: 2017-12-31 words: 3889 flesch: 64 summary: Under net house, black and clear plastic mulch were better than other treatments and recorded maximum plant height (50.8 cm and 43.7 cm), number of leaves/plant (64.8 and 64.3), early yield (7.1 and 6.6 t ha-1), number of fruits/plant (16.1 and 14.4) and total yield (57.4 and 55.7 t ha-1), respectively. Sci. Vol. 12(2) : 106-112, 2017 Original Research Paper 106 107 Mulch type and net house / open field on brinjal parameters J. Hortl. keywords: brinjal; field; house; mulch; net; plant; plastic; soil cache: jhs-9.pdf plain text: jhs-9.txt item: #586 of 600 id: jhs-90 author: Talang, H D; Dutta, P; Mukhim, C; Patil, S title: Effect of Calcium, Boron and Sorbitol on Fruit-Set, Yield and Quality in Mango Cv. Himsagar date: 2016-12-31 words: 1978 flesch: 71 summary: Effect of spraying some macro and micro nutrients on fruit set, yield and fruit quality of Washington Naval tree s. J. Appl. Key words: Mango, calcium nitrate, boric acid, sorbitol, fruit quality INTRODUCTION Mango (Mangifera indica L.) is the ‘national fruit’ of India. keywords: acid; boron; calcium; fruit; mango; sorbitol; yield cache: jhs-90.pdf plain text: jhs-90.txt item: #587 of 600 id: jhs-909 author: Vishwakarma, Pradeep Kumar; Masu, M. M. ; Singh, Sumit title: Effect of various pre-harvest treatments on shelf life and morphological characteristics of fruits of mango (Mangifera indica L.) var. ‘Amrapali’ date: 2022-09-29 words: 7496 flesch: 78 summary: Extension of fruit shelf life is a prime importance for availability of fresh fruit in market for longer duration and distance transportation. Gibberellic acid in proper concentration and at appropriate time have been found to better results in fruits quality, yield, size, decrease fruit drop, incr easing sugar content, improve the physico- chemical characteristics and extend the post-harvest life of fr uits thr ough modifica tion of va r ious physiological and bio-chemical processes of plant (Pandey and Sinha, 2013). keywords: effect; fruit; ga3; harvest; life; mango; shelf; storage; treatments cache: jhs-909.pdf plain text: jhs-909.txt item: #588 of 600 id: jhs-91 author: Padmakar, B; Dinesh, M R; Ravishankar, K V title: Marker-Trait Association for Fruit Characters in Mango (Mangifera indica L.) Cultivars date: 2016-12-31 words: 4620 flesch: 62 summary: Tree Genet. & Genomes, 9:331-349 Harjes, C.E., Rocheford, T.R., Bai, L. et al. 2008. J. Human Genet., 32:314- 331 Brachi, B., Faure, N., Horton, M. et al. 2010. keywords: acidity; association; cultivars; et al; fruit; mango; mapping; marker; number; population; structure; study; trait cache: jhs-91.pdf plain text: jhs-91.txt item: #589 of 600 id: jhs-92 author: Sakthivel, K; Baskaran, V; Abirami, K; Manigundan, K; Gautam, R K title: Cross-Infectivity of Ralstonia solanacearum from Marigold Grown in Andaman Islands date: 2016-12-31 words: 1808 flesch: 54 summary: Also, our re sults a re in concurrence with findings of Ramesh et al (2014) who reported 93% of Ralstonia solanacearum isolates collected from various hosts all over India to be pathogenic to eggplant and tomato. Cross-infectivity of Ralstonia solanacearum from marigold grown in Andaman Islands K. Sakthivel, V. Baskaran, K. Abirami, K. Manigundan and R.K. Gautam ICAR-Central Island Agricultural Research Institute, Port Blair - 744 101 Andaman & Nicobar Islands, India E-mail: vbaski01@gmail.com ABSTRACT Bacterial wilt disease, caused by Ralstonia solanacearum, is one of the major concerns for marigold cultivation in Andaman Islands. keywords: brinjal; marigold; plants; ralstonia; solanacearum; tomato; vegetables; wilt cache: jhs-92.pdf plain text: jhs-92.txt item: #590 of 600 id: jhs-93 author: Bhuvaneswari, S; Singh, T H; Sadhashiva, A T title: Effect of Different Packages on Quality and Extension of Shelf-Life in Tomato (Lycopersicon esculentum L. Mill.) date: 2016-12-31 words: 2041 flesch: 66 summary: Plastic crate Polyethylene bag CD (5%) PLW (%) 6.02 5.48 1.33 1.01 Spoilage (%) 8.70 7.65 10.92 0.92 Storage life (days) 11 11 11 NS Weight of tomato fruit decreased from the initial ‘turning stage’ to red-ripe stage at 11 days under ambient conditions. Similar observations were made by Shahnawaz et al (2012) where weight- loss in tomato fruits in the Control decreased from green-unripe to red-ripe stage at 11 days at ambient temperature. keywords: boxes; cfb; life; packaging; plastic; storage; tomato cache: jhs-93.pdf plain text: jhs-93.txt item: #591 of 600 id: jhs-95 author: Dinesh, M R; Ravishankar, K V; Sangma, Donald title: Mango Breeding in India - Past and Future date: 2016-06-30 words: 7709 flesch: 61 summary: 11(1):1-12, 2016 Diversity in mango fruit for shape, size and peel colour 10 marker assisted breeding (MAB), we can plan to reduce this period. As for skin colour, it was found that when red coloured varieties were crossed with green coloured varieties, gradation of colour in the progenies indicated that fruit colour was controlled by a number of loci (Sharma, 1987; Iyer & Subramanyam, 1987). keywords: bearing; breeding; colour; diversity; fruits; hybrid; indica; mangifera; mango; markers; pulp; research; selection; varieties; variety cache: jhs-95.pdf plain text: jhs-95.txt item: #592 of 600 id: jhs-96 author: Padmakar, B; Kanupriya, C; Latha, P Madhavi; Vasugi, C; Dinesh, M R; Sailaja, D; Aswath, C title: Enrichment of Genetic Linkage Maps and Mapping QTLs Specific to Seed Strength-Hardness/Softness-In Guava (Psidium guajava L.) date: 2016-06-30 words: 4484 flesch: 61 summary: Enrichment of genetic linkage maps and mapping QTLs specific to seed strength - hardness / softness - in guava (Psidium guajava L.) B. Padmakar1, C. Kanupriya, P. Madhavi Latha, C. Vasugi, M.R. Dinesh, D. Sailaja2 and C. Aswath* ICAR-Indian Institute of Horticultural Research Hesaraghatta Lake Post, Bengaluru - 560089, Karnataka, India *E-mail: aswath@iihr.res.in ABSTRACT The present research focuses mainly on molecular mining and morphological evaluation of guava genome within a full-sib population and, thereby, mapping of quantitative trait loci related to fruit quality traits, viz., seed strength (hardness/softness) and average fruit weight. Genetic linkage map of ‘Kamsari’: keywords: et al; fruit; genome; guava; linkage; mapping; markers; qtl; rapd cache: jhs-96.pdf plain text: jhs-96.txt item: #593 of 600 id: jhs-968 author: Nayani, Surya Prakash Rao; K Das, Divya; M B , Shivanna title: Vegetative vigour, yield and field tolerance to leaf rust in four F1 hybrids of coffee (Coffea arabica L.) in India date: 2022-09-19 words: 5277 flesch: 62 summary: Among the various diseases that affect arabica, coffee leaf rust (CLR) caused by an obligate parasitic fungus, Hemileia vastatrix Berk et Br is the most prominent one that cause severe crop losses to an extent of 70% in susceptible cultivars, if proper control measures are not adopted (Anon., 2014). The host resistance to coffee leaf rust is reported to be governed by nine resistance genes, designated as S H 1 to S H 9, distributed across the coffee gene pool. keywords: arabica; coffee; gene; hybrids; leaf; resistance; rust; s h; s.5086; tolerance; yield cache: jhs-968.pdf plain text: jhs-968.txt item: #594 of 600 id: jhs-97 author: Prakash, D P; Ramachandra, Y L; Hanur, Vageeshbabu S title: Effect of Agrobacterium Infection Time, Co-Cultivation and Cell Density on in vitro Response in Hypocotyl of Eggplant (Solanum melongena L.) date: 2016-06-30 words: 3940 flesch: 50 summary: Previous studies on brinjal indicate a necessity for identifying factors affecting in vitro response to increase in vitro regeneration frequency in Agrobacterium co-cultivated explants and, in turn, transformation efficiency to reduce resources for production of transgenic plants in elite cultivars. A delay and drastic reduction was seen in in vitro regeneration response, common in Agrobacterium co-cultivated explants. keywords: agrobacterium; cultivation; culture; eggplant; explants; regeneration; response; time cache: jhs-97.pdf plain text: jhs-97.txt item: #595 of 600 id: jhs-98 author: Shikhamany, S D; Borade, Swapnil V; Jeughale, Sanjay K; Patil, Suryakant Y title: Assessing Efficiency of White Seedless Grape Vineyards for Table Grape Production date: 2016-06-30 words: 4450 flesch: 67 summary: Bunch Compactness Index was derived by the following formula: Number of berries in a Bunch Compactness Index = bunch/total length of rachis of the bunch (cm) X mean berry diameter (mm) Bunches with >35 Compactness Index were graded as compact; between 31-35 a well-filled; 25-30 a loose, and <25 as straggly. Timely berry-thinning (before 6mm stage), coupled with girdling and growth-regulator treatments, are ways for increasing berry diameter. keywords: berries; berry; bunch; cane; ratio; seedless; uniformity; yield cache: jhs-98.pdf plain text: jhs-98.txt item: #596 of 600 id: jhs-986 author: Shalini Jhanji; Dhatt, Ujjalpreet Kaur title: Phytoremediation of Indoor Air Pollutants: Harnessing the potential of Plants beyond Aesthetics date: 2022-03-31 words: 8178 flesch: 59 summary: their hazardous effects on human health, potential of indoor plants in their remediation and their practical utility. Besides providing oxygen to breathe, multifaceted roles of indoor plants have been well documented. keywords: air; air pollutants; buildings; effects; environ; health; human; indoor; leaf; phytoremediation; plants; pollutants; pollution; potential; quality; sci; studies; study cache: jhs-986.pdf plain text: jhs-986.txt item: #597 of 600 id: jhs-990 author: Sharon Jacob; A, Sobhana title: Qualitative and organoleptic evaluation of immature cashew kernels under storage date: 2022-09-19 words: 2744 flesch: 65 summary: Original Research Paper Qualitative and organoleptic evaluation of immature cashew kernels under storage Sharon Jacob1 and Sobhana A.2 1Department of Post Harvest Technology, College of Agriculture, Vellanikkara, Kerala Agricultural University, Thrissur - 680656, Kerala, India 2Professor and Head, Fruit Crops Research Station, Thrissur, India *Corresponding author Email : jacobsharon1930@gmail.com ABSTRACT Cashew cultivars, based on flowering behaviour, are categorized into three types, viz., early season, mid-season and late season. In this context, present study was conducted in immature cashew kernel to find out suitable storage treatments to enhance the shelf life. keywords: brine; cashew; kernels; nuts; storage; sugar; syrup cache: jhs-990.pdf plain text: jhs-990.txt item: #598 of 600 id: jhs-991 author: Tetteh, Rashied; Aboagye, Lawrence Misa ; Osafo, Eric Ansah ; Darko, Robert; Dassah, Augustine; Obirih-Opareh, Jennifer title: Effect of tree age on fruit characteristics, seed emergence and seedling growth in Rambutan (Nephelium lappaceum L.) date: 2022-10-11 words: 2624 flesch: 69 summary: Rambutan seedlings plant height at monthly intervals after seed emergence obtained from fruits harvested from different tree ages is shown in Fig. Short Communication Effect of tree age on fruit characteristics, seed emergence and seedling growth in Rambutan (Nephelium lappaceum L.) keywords: age; emergence; fruits; leaves; plant; seed; trees; weight; years cache: jhs-991.pdf plain text: jhs-991.txt item: #599 of 600 id: jhs-992 author: Hiremata, Virupakshi; Narayanaswamy M; Shet R M title: Assessment of growth and yield parameters in Arecanut (Areca catechu L.) through correlation and path analysis under hilly zone of Karnataka date: 2022-12-06 words: 6709 flesch: 74 summary: The association of fruit yield per palm was positive significant with the kernel breadth (0.39), fresh weight of husk (0.65), number of bunches per palm (0.68), husk thickness (0.69), dry weight of husk (0.40), fresh nut yield per palm (0.68), recovery percentage (0.36), bunch weight per palm (0.68), fresh kernel weight per palm (0.97), fresh weight of husk per palm (0.89), dry weight of husk per palm (0.90) and number of inflorescence (0.66) (Archana, 2017) and Rajesh (2007) for per cent nut set, the number of female flowers per inflorescence. Phenotypic cor r elations of 34 cha r acter s both growth and yield quantitative characters namely, kernel breadth (mm), fr esh weight of husk (g), number of bunches per palm, husk thickness (mm), dry weight of husk (g), fresh nut yield per palm (g), recovery percentage (%), bunch weight per palm (g), fresh kernel weight per palm (g), fresh weight of husk per palm (g), dry weight of husk per palm, (g) number of inflor escence, plant height (m), crown length (m), girth (m), inter nodal length (m), number of fronds , number of leaflets , length of oldest leaf (m), breadth of oldest leaf (m), length of leaf sheath (m), brea dth of leaf sheath (m), number of female flowers per inflorescence, number of nuts per palm, fruit length(mm), fruit breadth (mm), fresh fruit weight (mm), kernel length (mm) , fruit volume (cc), dry weight of kernel (mm), Total chlorophyll content (μg /g) and number of nuts per inflorescence fruit yield per palm (g) presented in Table 1 and 2. keywords: -0 .1; fruit; palm; weight; yield cache: jhs-992.pdf plain text: jhs-992.txt item: #600 of 600 id: jhs-996 author: G, Rajiv; m, Jawaharlal; J J, Allen; S, Ganesh title: Diversity assessment of Nerium accessions for growth and flower yield date: 2022-11-09 words: 2726 flesch: 60 summary: Number of flowers per inflorescence 4 Table 1 : Evaluation of nerium accessions for flowering parameters Accession Days Single Flower Flower Number Number Yield / No. taken flower flower diameter bud of inflore- of flowers g / initation weight (cm) length scences per inflore- Plant (days) (g) (cm) per plant scences Acc. 1 100.82 0.27 4.79 3.08 16.73 9.58 197.33 Acc. 2 96.17 0.24 4.86 3.08 18.12 8.89 183.75 Acc. 3 97.53 0.27 4.80 3.29 24.04 10.09 262.52 Acc. 4 109.89 0.30 4.89 3.20 11.17 9.51 151.57 Acc. 5 97.28 0.24 4.03 2.88 14.67 10.67 171.02 Acc. 6 94.37 0.27 4.97 3.38 10.83 8.83 140.63 Acc. 7 114.08 0.24 4.62 3.12 14.67 9.00 172.17 Acc. 8 107.83 0.21 4.86 3.26 11.83 8.50 120.89 Acc. 9 113.98 0.25 4.91 3.20 12.17 8.83 135.47 Acc. 10 104.73 0.27 4.46 3.12 14.67 9.35 136.05 Acc. 11 113.58 0.23 4.39 3.14 13.50 9.89 172.61 Acc. 12 90.47 0.29 4.80 3.40 24.17 10.67 265.37 Acc. 13 98.10 0.23 4.84 3.26 10.00 7.51 115.65 Acc. 14 93.87 0.27 4.74 3.34 23.00 10.00 258.33 Acc. Short Communication Diversity assessment of Nerium accessions for growth and flower yield Rajiv G .1*, Jawaharlal M .2, Allen J.J.3 and Ganesh S.3 1Assistant professor, SRM College of Agricultural Sciences, Chengalpattu, Tamil Nadu, India 2Dean, SRM College of Agricultural Sciences, Chengalpattu, Tamil Nadu, India 3Kerala Agricultural University, Thrissur, Kerala, India *Corresponding author Email : florirajiv91@gmail.com ABSTRACT Thirty nerium accessions were evaluated for growth and flower yield. keywords: acc; accessions; flower; nerium; number; plant cache: jhs-996.pdf plain text: jhs-996.txt