INTRODUCTION

Auxinic herbicides (e.g., 2,4-D, Dicamba and
Picloram) were the first synthetic herbicides discovered and
have been in use for more than seven decades. These have
been a favorite choice among growers worldwide as they
selectively control broad-leaf weeds in cereal crops. Owing
to this, they are not recommended for use in commercially
important dicot crops such as canola, radish or soybean.
Biotypes of some broad-leaf weeds such as kochia, yellow
Star Thistle, and wild mustard, have evolved resistance to
auxinic herbicides due to selection pressure. Auxinic
herbicide-resistant (R) wild mustard biotypes were found
to be highly resistant to Picloram and Dicamba (104-fold)
(Heap and Morrison, 1992). Genetic analysis of wild mustard
auxinic herbicide resistance suggests that the resistance is
determined by a single dominant gene (Jugulam et al, 2005;
Jasienuik et al, 1995). Further, we recently reported
identification of morphological and molecular markers linked

Transfer of auxinic herbicide resistance from wild mustard (Sinapis arvensis) into
radish (Raphanus sativus) through embryo rescue

J. Mithila and J. Christopher Hall1
Kansas State University, Manhattan KS, USA, 66506

E-mail : mithila@k-state.edu

ABSTRACT

The discovery of auxinic herbicides (e.g., 2,4-D, Dicamba, Picloram) for selective control of broad-leaf weeds in
cereal crops revolutionized modern agriculture. These herbicides are inexpensive and do not generally have prolonged
residual activity in soil. Although cultivated species of Brassicaceae (e.g., radish and other vegetables) are susceptible
to auxinic herbicides, some biotypes of wild mustard (Sinapis arvensis, 2n = 18) were found to be highly resistant to
Picloram and Dicamba.  Inter-generic hybrids between wild mustard and radish (Raphanus sativus, 2n = 18) were
produced by traditional breeding coupled with in vitro embryo rescue/ovule culture. To increase frequency of embryo
regeneration and hybrid plant production, several hundred reciprocal crosses were performed between these species.
Upon altering cultural conditions and media composition, a high frequency of embryo regeneration and hybrid plant
establishment was achieved. A protocol was also optimized for in vitro clonal multiplication of inter-generic hybrids
produced by embryo rescue. To evaluate transfer of auxinic herbicide resistance from wild mustard into hybrid plants,
several screening tests (involving in vitro, molecular-based as well as whole plant-based tests) were performed.
Results indicated that hybrids of R. sativus x S. arevensis were resistant to auxinic herbicides suggesting, that, the
resistance trait was transferred to these hybrids from the wild mustard. This research for the first time demonstrates
the possibility of transfer of auxinic herbicide resistance from wild mustard to radish.

Key words:  Auxinic herbicide,embryo rescue, radish, resistance,  transfer, wild mustard 

to auxinic herbicide resistance in wild mustard (Mithila
et al, 2012).

The family Brassicaceae consists of a number of
economically important species, including oilseed canola, and
vegetable crops such as cabbage, cauliflower, radish and
broccoli. This family also comprises an excellent reservoir
of genes for many economically important traits and is
extremely conducive to gene transfer techniques. Radish is
an important vegetable crop grown across the globe.
Transfer of agronomically desirable traits among Brassica
members, for example, between wild mustard and canola,
has been previously reported (Bing et al, 1995; Inomata,
1988; Momotaz et al, 1998). However, to our knowledge,
there are no reports describing transfer of agronomically
important traits from wild mustard to radish. In this research,
we tested the feasibility of transfer of auxinic herbicide
resistance from wild mustard to radish following both
traditional breeding and embryo rescue methods.

1Department of Environmental Biology, University of Guelph, Guelph, Ontario, Canada, N1G 2W1

J. Hortl. Sci.
Vol. 7(1):29-33, 2012



30

Mithila and Christopher Hall

MATERIAL AND METHODS

Raising wild mustard and radish parental plants to
produce hybrids

Auxinic herbicide -R wild mustard and -susceptible
(S) radish plants were raised from seed.   Seeds were sown
in 6" plastic pots containing ‘Promix’, and placed in a growth
chamber with 16-h photoperiod and 22/15oC day/night
temperature.  Light intensity and relative humidity were
maintained at 350µmol.s-1m-2 and 65-75%, respectively.
Each pot contained one plant and the plants were irrigated
when required and fertilized weekly with 20:20:20 (N:P:K).
To confirm resistance to Dicamba, wild mustard plants were
treated with Dicamba (Banvel, BASF, USA) at 200g ae/ ha
at three- to four-leaf stage of development (procedure for
Dicamba application is described later; we used Dicamba
in all experiments in this research, because it is a widely
used auxinic herbicide in agriculture for control of broad-
leaf weeds). All the plants survived Dicamba treatment and
were used for further experimentation.

To produce hybrid plants between auxinic herbicide
– R wild mustard and radish, reciprocal crosses were
performed between these plants following the procedures
described by Jugulam et al (2005) for wild mustard.
Intergeneric hybrids failed to develop in vivo, as, the siliques
(narrow, elongated seed-capsule) did not grow completely,
i.e., it ceased growth before reaching maturity. Therefore,
an in vitro method was sought for completion of embryo
maturation and plantlet formation. To achieve plantlet
regeneration via embryo rescue, we followed two strategies.
In the first approach, siliques from crosses between
Dicamba-R wild mustard and –S radish were harvested
after ∼10-12 days of pollination. These siliques were
disinfested with 70% ethanol for 1–2 min, followed by 20%
commercial bleach (sodium hypochlorite, 5.25%) containing
three to four drops of Tween-20 for 15–20 min, and
subsequently, rinsed four to five times with sterile deionized
water. Embryos/ ovules from the siliques were excised
aseptically with forceps and scalpel for culture on Petri dish
containing 15 ml of one of the following two media: (A) MS
(Murashige and Skoog, 1962) salts with Gamborg vitamins,
sucrose (3%), 500 mg/l casein hydrolysate, or, (B) MS salts
with Gamborg vitamins, sucrose (3%), 0.5 mg/l NAA, 2.5
mg/l Kinetin; pH of the media was adjusted to 5.8, and 8g of
agar was added prior to autoclaving at 121oC for 20 min. In
the second strategy, immature siliques were harvested 3-5
days post-pollination and surface-sterilized (as described
above), followed by aseptic culture of the entire silique on

medium A or B. The siliques were allowed to grow on the
media for ∼ 2 weeks, after which ovules were excised out
from the siliques and cultured in a Petri dish containing fresh
medium (A or B) for ovule maturation and regeneration into
plantlets. All cultures were incubated in a growth room at
24oC under light (16-h photoperiod; 50µmol s-1 m-2) provided
by cool, white fluorescent lamps (Philips Canada,
Scarborough, ON).

After four weeks of embryo/ovule culture,
regenerated hybrid plantlets were transferred individually
to ‘Magenta’ boxes (300 ml plastic vessels, Magenta Corp.,
Chicago IL, USA) containing medium (C): MS salts with
Gamborg vitamins and sucrose (1.5%); pH of medium C
was also adjusted to 5.8, and 8g of agar was added before
autoclaving at 121oC for 20 min. At four weeks upon transfer
to medium C, the hybrid plants produced well-developed
root and shoot system. At this stage, these hybrid plants
were clonally multiplied by sub-culturing nodal segments in
Magenta boxes containing medium C. In vitro hybrid plants
with well-developed roots and shoots were transferred to
soil (‘Promix’) and grown in a growth room under the same
conditions as described, earlier for wild mustard and radish
parental plants.

 Assessment of transfer of auxinic herbicide resistance
into hybrids

(i) In vitro assay: Previously, Mithila and Hall (2005)
developed an in vitro assay to assess sensitivity of plants
(explants) to auxinic herbicides. We used this protocol for
initial screening to identify hybrid plants possessing auxinic
herbicide resistance. For this assay, about 50-60 seeds of
wild mustard auxinic herbicide-R and –S radish were
surface-sterilized with 80% alcohol for 2-3 minutes and, then,
treated with 30% bleach containing a drop of Tween-20,
for 12-15 min.  Subsequently, the seeds were rinsed 4-5
times with sterile distilled water.  Sterilized seeds were
cultured aseptically on medium C (described above) in
Magenta boxes.  Cultures were incubated in a growth room
(under the same conditions as described above).  After 6-7
weeks, stem segments of about 1 cm were excised
aseptically using a scalpel from the seedlings of auxinic
herbicide-R wild mustard and –S radish, as well as from
clonally propagated hybrid plants, and cultured on medium
(D) containing MS salts with Gamborg vitamins, sucrose
(3%) and various doses of Dicamba or Picloram (0, 1, 5 or
10M); pH of medium D was adjusted to 5.8, and 8g of agar
was added before autoclaving at 121oC for 20 min. At 3-4
weeks from initial culture, response of stem segments to
Dicamba was recorded.

J. Hortl. Sci.
Vol. 7(1):29-33, 2012



31

(ii) Molecular assay: Recently, we developed a genetic
map describing AFLP (amplified fragment length
polymorphism) markers closely linked to auxinic herbicide
resistance in wild mustard (Mithila et al, 2012). The two
closest flanking regions on either side of R locus were
located at a distance of 1.58 and –6.35 map units. These
DNA markers were sequenced. To further assess transfer
of auxinic herbicide resistance from wild mustard to radish,
primers from the sequence of the closest marker (1.58 map
units) were designed in the present stud (Forward primer:
GGCCGCGAGACATTGGTGA and reverse primer:
TCTCTCGTGACCCTTTACAATTAG) and synthesized.
Genomic DNA was extracted from leaf tissue of hybrid
plants as well as auxinic herbicide-R, -S wild mustard
(auxinic herbicide-S wild mustard DNA was used as a
negative control) and –S radish using DNeasy® Plant Mini
(QIAGEN, Mississauga, ON, Canada) following
manufacturer’s protocol.  Using the above-described
primers, a PCR (polymerase chain reaction)-based assay
was performed for detecting presence or absence of the
PCR product (∼ 220 bp length) that corresponded to the
closest AFLP marker. The following PCR conditions were
used: initial denaturation at 94oC for 3 min, followed
by 30 cycles at 94oC for 30 seconds, 56oC for 30 seconds
and 72oC for 45 seconds, with a final extension at 72oC
for 7 min.

(iii) Whole-plant based assay: Whole-plant screening was
performed to validate transfer of auxinic herbicide resistance
from wild mustard into hybrid plants. In vitro grown hybrid
plants were established in soil. Auxinic herbicide-R wild
mustard and –S radish plants were raised in a growth
chamber as described earlier. Seedlings were treated with
Dicamba (200g ae ha-1) at three-to-four leaf stage of
development using a motorized hood-sprayer.  The sprayer
was equipped with a flat-fan nozzle (8002 E) and calibrated
to deliver 200 l/ha at 276 kPa.  One and two weeks after
treatment, the seedlings were visually rated for injury. Hybrid
plants were classified as R or S by comparing the injury
response with that in wild mustard auxinic herbicide-R and
–S radish seedling response.  Susceptibility of the plants to
Dicamba was assessed based on symptoms of epinasty
(downward curling of leaf and stem tissue) followed by
death, whereas, R plants should show little or no response
to Dicamba.

RESULTS AND DISCUSSION

Inter-generic hybrids of radish and wild mustard failed
to develop in vivo as the siliques were not able to grow
completely, and ceased to develop ahead of maturity. Among

the two strategies followed to produce inter-generic hybrids
in vitro, the second strategy yielded more number of
regenerated embryos than in the first approach (Table 1).
There was no significant difference in the number of hybrids
produced when embryos were cultured on medium A or B
(Table 1). These inter-generic hybrids exhibited several
morphological traits of both parents (e.g., leaf shape, stem,
plant height and flower colour, Fig.1). Clones of the hybrids
were also successfully established in vitro by nodal cuttings.
To our knowledge, this is the first report describing
production of hybrids between wild mustard and radish via
embryo rescue.

Sensitivity to auxinic herbicides results in excessive
root growth in plant cultures in vitro (Mithila and Hall, 2005).
In this study, after 3-4 weeks of initial culture of stem
segments, excessive root formation was observed in
Dicmaba-S radish in response to 1, 5 or 10µM Dicamba or
Picloram in the medium. Conversely, wild mustard R
segments did not show root formation even at 10µM
Dicamba or Picloram (Fig. 2). More importantly, stem
segments for all hybrids produced via embryo rescue
responded similarly to R wild mustard when treated with
Dicamba or Picloram (Fig. 2). These results suggest that

D

A B

Fig 1. Hybrids produced by crossing auxinic herbicide-S R.-sativus
and -R S. arvensis: A and B represent R. sativus and S. arvensis
plants, respectively. C and D are the inter-generic hybrids produced
by crossing R. sativus and S. arvensis and following embryo rescue
technique  (note the hybrid exhibiting characteristics intermediate
between R. sativus and S. arvensis)

Intergeneric transfer of herbicide resistance to radish using embryo rescue

J. Hortl. Sci.
Vol. 7(1):29-33, 2012

C



32

all the hybrids derived via embryo rescue from crosses (both
direct and reciprocal) between radish (S) x wild mustard
(R) were found not sensitive to Dicamba or Picloram.
Therefore, it appears that the R trait was transferred to the
hybrids from R biotypes of the wild mustard. In addition,
PCR results of molecular-based assay also demonstrated
presence of a 220 bp fragment (representing the AFLP
marker closely-linked to auxinic herbicide resistance in wild
mustard; Mithila et al, 2012) in all the hybrids, and in
Dicamba-R wild mustard; whereas, DNA of auxinic
herbicide-S wild mustard and radish did not show this
fragment (Fig. 3). These results suggest that the DNA
fragment containing auxinic herbicide-resistance from wild
mustard was probably transferred to R hybrids. Results from
whole-plant screening further confirmed Dicamba resistance
in the hybrids (Fig. 4) since these displayed little or no
epinasty, a response that was similar to that in R wild mustard
plants; however, radish plants ceased to grow 2 weeks after
treatment with Dicamba (Fig. 4).

Fig 2.  Response to Dicamba (10µµµµµM) or Picloram (10µµµµµM) of stem
segments of auxinic herbicide-R S. arvensis, -S radish (R.-sativus)
and their hybrids (R. sativus X S. arvensis)

Fig 3. PCR product (∼∼∼∼∼ 220 bp) amplified by primers corresponding
to a closet AFLP marker linked to Dicamba resistance in wild
mustard (Mithila et al, 2012): Lane 1: 100 bp ladder; 2: reaction
without a template; 3, 5: wild mustard auxinic herbicide-R; 4, 6:
wild mustard-S biotype; 7: radish; 8, 9: inter-generic auxinic
herbicide-R hybrids

Fig 4. A-C: Plants treated with Dicamba (200g ae/ha) 7 days after
treatment. A and C illustrate dicamba- S radish and -R wild
mustard, respectively; B represents the hybrid plant between radish
(S) x wild mustard (R)

Successful gene transfer from interspecific crosses
using conventional plant breeding techniques involves several
barriers, including (but not limited) to pollen-stigma
incompatibility or sterility, embryo and endosperm imbalance,
homologous chromosome pairing between the species, etc.
In this research, we have demonstrated production of
hydrids between two diploid species of Brassicaceae, viz.,
S. arvensis and R. sativus. Although both these species
are diploid with 2n:18, genomes of these two species are
different (Mizusima,1980).  Success of interspecific
hybridization among members of Brassicaceae depends on
genome compatibility as well as ploidy of the species

Table 1. Hybrids produced by crossing auxinic herbicide-S R. sativus and -R S. arvensis: Frequency of embryo regeneration and hybrid
plant establishment upon direct and reciprocal crossing followed by in vitro culture and embryo rescue

Cross combination No. of buds No. of siliques No. of embryos No. of embryos No. of hybrids
pollinated cultured excised germinated obtained

Strategy I
1. R. sativus x S. arvensis 100-150 - ∼ 70 (A or B) 2 2
2. S. arvensis x R. sativus 100-150 - ∼ 65 (A or B) 1 1
Strategy II
1. R. sativus x S. arvensis 150-200 ~ 125 ∼ 50 (A or B) 5 5
2. S. arvensis x R. sativus 150-200 ~ 110 ∼ 25 (A or B) 1 1
A: MS salts + Gamborg vitamins (4.4. g/l) + 30 g sucrose/l + 500 mg/l casein hydrolysate (pH of the medium 5.8; agar 8 g/l)
B: MS salts + Gamborg vitmains (4.4 g/l) + 30g sucrose/l + 0.5mg/l NAA + 2.5mg/l
kinetin (pH of the medium 5.8; agar 8 g/l)

Mithila and Christopher Hall

J. Hortl. Sci.
Vol. 7(1):29-33, 2012



33

(Mizusima, 1950). Based on cytogenetic analyses by
Mizusima (1980), it appears that at least one chromosome
of S. arvensis can form a bivalent with R. sativus during
meiosis.  Since all the hybrids produced via embry rescue in
this research were found R to auxinic herbicides, the
Dicamba-R gene residing on S. arvensis chromosome may
have formed a bivalent with R. sativus, thereby transferring
Dicamba resistance into radish.

In conclusion, in we have shown for the first time,
possibility of production of Dicamba-R hybrids between R.
sativus and S. arvensis. Further experiments are required
to test the possibility of introgressing auxinic herbicide
resistance from hybrids into radish by repeated backcross-
breeding to develop radish varieties with desirable agronomic
traits, along with auxinic herbicide resistance. This will allow
selective removal of most broad-leaf weeds. Further,
development of auxinic herbicide resistant radish following
transfer of resistance trait from related species by
introgreesion breeding is a non-transgenic approach thus,
allowing acceptance across the globe, including Europe.

ACKNOWLEDGEMENT

Financial support to JCH from Natural Science and
Engineering Research Council of Canada, and BASF, NC,
USA through NSERC-CRD grant, is gratefully
acknowledged.

REFERENCES

Bing, D.J., Downey, R.K. and Rakow, F.W, 1995, An
evaluation of the potential intergeneric gene transfer
between Brassica napus and Sinapis arvensis.
Plant Breed., 114:481-484

Heap. I.M. and Morrison. I.N. 1992, Resistance to auxin-
type herbicides in wild mustard (Sinapis arvensis L.)

populations in western Canada.  Annual Meeting of
Weed Science Society of America. Abstract # 32,
p. 164

Inomata, N.,1988. Intergeneric hybridization between
Brassica napus and Sinapis arvensis and their
crossability. Eucarpia Cruciferae Newslett., 13:
22-23

Jasieniuk, M., Morrison, I.N. and Brule-Babel, A.L.1995.
Inheritance of Dicamba resistance in wild mustard
(Brassica kaber). Weed Sci., 43:192-195

Jugulam, M., McLean, M.D. and Hall, J.C.2005. Inheritance
of Picloram and 2,4-D resistance in wild mustard
(Brassica kaber). Weed Sci., 53:417-423

Mithila, J. and Hall, J.C.2005. Comparison of ABP1 over-
expressing Arabidopsis and under-expressing
tobacco with an auxinic herbicide-resistant wild
mustard (Brassica kaber) biotype.  Pl. Sci., 169:
21-28

Mithila, J. McLean, M.D., Chen, S. and Hall, J.C. 2012.
Development of near-isogenic lines and identification
of markers linked to auxinic herbicide resistance in
wild mustard (Sinapis arvensis). Pest Mgt. Sci.,
68:548-556

Mizushima, U. 1950 Karyogenetic studies of species and
genus hybrids in the tribe Brassiceae of Cruciferae.
Tohoku J. Agril. Res., I:1-14

Mizushima, U. 1980 Genome analysis in Brassica and allied
genera. In: Tsunoda, T., Hinata, K. and Gomez-
Campo, G. (eds), Brassica Crops and Wild Allies,
Biology and Breeding, pp. 89-106, Japan Scientific
Societies Press, Tokyo

Momotaz, A., Kato, M. and Kakihara, F.1998. Production
of intergeneric hybrids between Brassica and Sinapis
species by means of embryo rescue techniques.
Euphytica, 103:123-130

(MS Received 07 June 2012, Revised 28 June, 2012)

Intergeneric transfer of herbicide resistance to radish using embryo rescue

J. Hortl. Sci.
Vol. 7(1):29-33, 2012